Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular genetic studies of the surface layer of caulobacter crescentus : nucleotide sequencing and… Gilchrist, Angus Robert 1991

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1991_A6_7 G54.pdf [ 4.07MB ]
Metadata
JSON: 831-1.0098433.json
JSON-LD: 831-1.0098433-ld.json
RDF/XML (Pretty): 831-1.0098433-rdf.xml
RDF/JSON: 831-1.0098433-rdf.json
Turtle: 831-1.0098433-turtle.txt
N-Triples: 831-1.0098433-rdf-ntriples.txt
Original Record: 831-1.0098433-source.json
Full Text
831-1.0098433-fulltext.txt
Citation
831-1.0098433.ris

Full Text

Molecular Genetic Studies of the Surface Layer of Caulobacter crescentus: Nucleotide Sequencing and Analysis of the Regular Surface Array Gene, and the Effect of Surface Layer and Other Variables on the Development of Electroporation for the Caulobacters By ANGUS ROBERT GILCHRIST B.Sc, University of British Columbia, 1988 A THESIS SUBMITTED LN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA August 1991 © Angus R. Gilchrist, 1991 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada DE-6 (2/88) A B S T R A C T The regular surface array gene (rsaA) of Caulobacter crescentus codes for the 130K surface layer (S-layer) protein. This S-layer protein forms a paracrystalline array which completely sheaths the bacterium and is comparable to those of many other bacteria. These studies investigate two aspects of the S-layer presented in two parts. In the first, the effect of S-layer on electroporation of Caulobacters is reported with the development of that technique for the transformation of Caulobacters. Many other interesting aspects to this procedure are also reported. The second part details the sequencing of the rsaA gene and includes a comprehensive review of the properties of the 130K S-layer protein as predicted from nucleotide sequence. A significant impediment to genetic analysis of Caulobacters has been the lack of a plasmid transformation procedure. High voltage electroporation-mediated plasmid transformation (electrotransformation) is unusually efficient with freshwater Caulobacters yielding up to 3 x 108 transformants per jig of plasmid pKT230. Optimum conditions for electrotransformation of Caulobacters required a single pulse of high field strength and short duration. Changes in growth media to help adapt marine Caulobacters so that they would survive preparation for electroporation, along with a modification of the preparation regime, resulted in the electrotransformation of MCS6. Several genetic ii techniques were successfully applied using electroporation, including the direct introduction of ligation mixtures into bacteria, suicide mutagenesis, and the electrotransfer of plasmids from E. coli to Caulobacters. Presence of the S-layer greatly influenced electrotransformation. Caulobacters lacking S-layer protein were electrotransformed with approximately ten times greater efficiency than comparable strains with an S-layer. The nucleotide sequence of the 130K S-layer protein encoding regular surface array gene (rsaA) from Caulobacter crescentus CB15A was determined. The rsaA gene encoded a protein of 1026 amino acids, with a predicted molecular weight of 98,132. Protease cleavage of mature 130K protein and amino acid sequencing of retrievable peptides yielded two peptides: the first aligned with a region approximately two thirds of the way into the predicted amino acid sequence; the second peptide corresponded to the predicted carboxy terminus of the protein. Thus, no cleavage processing of the carboxy portion of 130K occurred during the export process and, with the exception of the removal of the initial methionine residue, the protein was not processed by cleavage to produce the mature protein. The predicted 130K amino acid profile was unusual, with small neutral residues predominating. With the exception of aspartate, charged amino acids were in relatively low proportion, resulting in an especially acidic protein with a predicted pi of 3.46. Secondary structure analysis did not predict any long stretches of regular structure. A homology scan of the Swiss Protein Bank 17 produced no close matches to the predicted 130K sequence. iii However, 130K protein shared measurable homology with some exported proteins of other bacteria, including the hemolysins. Of particular interest was a specific region of the 130K protein which was homologous to the repeat regions of glycine and aspartate residues found in several proteases and hemolysins. These repeats are implicated in the binding of calcium for proper structure and biological activity of these proteins. Those present in 130K may perform a similar function, since proper S-layer assembly and surface attachment requires calcium. 130K protein also shared some homology with ten other S-layer proteins with the surface array protein of Campylobacter fetus scoring highest. Codon usage for rsaA followed the strong codon bias exhibited by other C . crescentus genes. The reported D N A sequence increases the total known Caulobacter crescentus sequence by 30% and changes accepted codon usage frequencies. Manipulations of rsaA gene plasmid constructs, including subcloning of gene fragments and other routine genetic procedures indicated that many were toxic to Escherichia coli hosts, when presented within high copy number plasmids. The sequencing of the S-layer gene from a calcium independent mutant, CB15ACal0 , and the background experimental history of this mutant are discussed. iv T A B L E O F C O N T E N T S Page Abstract ii List of Figures ix List of Tables xi Abbreviations xii Acknowledgements xiii Dedication xiv Introduction 1 Part 1 Electrotransformation of Caulobacters Materials and Methods 8 Bacterial strains, media and plasmids. 8 Preparation of cells for electrotransformation. 10 Electroporation procedures. 1 1 E D T A experiments. 1 2 Other genetic techniques involving electroporation. 12 v Transposon mutagenesis via electroporation. 12 Electroporation using ligation reaction mixtures. 1 3 Plasmid electrotransfer. 1 3 Results and Discussion 1 4 Effects of modifying electrotransformation conditions on electrotransformation efficiency. 14 Plasmid concentration and transformation efficiency. 1 6 Electrotransformation of marine Caulobacters. 1 9 Combining other genetic techniques with electroporation. 2 1 Transposon mutagenesis via electroporation. 21 Electrotransformation using ligation mixtures. 2 3 Plasmid electrotransfer. 2 3 Effect of S-layers on electrotransformation. 2 4 Additional discussion. 2 7 Part 2: Nucleotide Sequence Analysis of the Regular Surface Array Gene of Caulobacter crescentus CB15A and Examination of the Predicted Surface Layer Protein Sequence. Materials and Methods 2 9 Bacterial strains and growth media. 2 9 Gene cloning and related methods. 2 9 vi Nucleotide sequence analysis of the S-layer (rsaA) genes from CB15A and CB15ACalO. 3 0 Sequencing techniques and sample preparation. 3 0 Oligodeoxyribonucleotide primers. 3 1 Computer analysis of the nucleotide and predicted protein sequences. 3 1 Amino acid and peptide analysis of the 130K protein 3 2 Calculation of free energies for mRNA secondary structure. 3 3 Results and Discussion 3 3 Sequencing strategy of the regular surface array genes from CB15A and CB15ACal0. 3 3 Resequencing of the previously published partial sequence of the rsaA gene from CB15A. 3 5 Size of the regular surface array gene and predicted 130K sequence. 3 5 Codon usage of the rsaA gene. 3 8 Predicted rsaA transcription terminator. 4 0 Problems with subcloning of the S-layer gene from CB15A and CB15ACal0 and with sequencing template generation. 4 0 Primary structure analysis of the predicted amino acid sequence. 4 4 General analysis. 4 4 vii Peptide analysis. 4 4 Specific amino acid abundance and implications. 4 5 Predicted protein secondary structure analysis. 4 8 Protein homology scans. 5 0 Possible calcium binding region of the 130K protein. 5 5 Sequencing of the regular surface array gene from the calcium independent mutant CB15ACal0. 5 8 References 6 2 Appendix 7 3 Parameters involved in electroporation. 7 3 viii LIST OF FIGURES Figure 1. Effect of various field strengths on the electrotransformation of C. crescentus CB2A. 2 Effect of pulse duration and S-layer on the electrotransformation of C. crescentus strains. 3 Effect of DNA concentration on electrotransformation efficiency 4 Generation times of marine Caulobacter strains in PYE broth with different concentrations of sea salts. 5 Generation times of other marine bacteria in PYE broth with different concentrations of sea salts. 6 Sequencing strategy for the rsaA genes form C. crescentus CB15A and CB15ACalO. ix 7 Complete nucleotide sequence of the rsaA gene. 8. A model of surface array attachment CB15A and CB15CalO. LIST OF TABLES Table Page I. Amino acid analysis of the 130K protein. 3 9 II. Codon usage in the rsaA gene and ten other Caulobacter crescentus genes. 4 1 III. Comparison of various features from S-layers of ten bacterial species including secondary structure predictions. 46 IV. Homology between the 130K and several S-layer proteins. 5 1 V. 130K protein homology search of the Swiss Prot 15 sequence bank using F A S T A 5 4 VI. Putative Calcium binding regions. 5 7 xi ABBREVIATIONS a.a. amino acid cm centimeter DNA deoxyribonucleic acid EDTA ethylendiaminetetra-acetic acid EtBr ethidium bromide g gravity kb kilobase k V kilovolts LPS lipopoly saccharide MCS marine caulobacter strain m s millisecond n m nanometer Q ohms PAGE polyacrylamide gel electrophoresis PYE peptone yeast extract RNA ribonucleic acid S. A. O. specific-membrane associated oligosaccharide S-layer surface layer SDS sodium dodecyl sulfate TE tris E D T A microliter VC vent caulobacter xii Acknowledgements Thankyou to my committee, and especially Tony Warren, for allowing me to defend on such short notice when everyone was short of time. Thankyou to John Smit for accepting me into his lab many years ago. Many people, including Steve Robins and Rob McMaster, were helpful with suggesting different protocols to me or demonstrating how to use some of the more difficult procedures or troublesome computer systems. Special thanks are due to Wade Bingle, Richard Siehnel and Don Trimbur who were very helpful in providing good advice, supplies on the sly, and much time for discussions Many thanks to my parents for feeding me during the final writing period and especially for critical reading of this work. Thankyou to Cheri Marsanne Gee putting up with me during the course of most of this work: I am sorry you missed the end. Of all the people I relied upon, Stephen George Walker deserves the most thanks. Thankyou for photographing my gels after midnight, for helping me with science problems, and most of all for reassuring me that I wasn't the only one going a little insane. xiii This thesis is dedicated to Honor Joan Gilchrist in loving memory xiv I N T R O D U C T I O N Caulobacters are gram-negative bacteria having an unusual biphasic life cycle consisting of a motile swarmer stage and a sedentary stalked stage. As a result, they have elicited interest as a simple developmental model. Less attention has focussed on other directions of investigation, although Caulobacters are an environmentally significant and important group. Caulobacters are chemoorganotrophic and are often cited as classic examples of oligotrophs. In introductory microbiology courses they are frequently given as examples of one of the main bacterial types to inhabit clear lake waters which are low in organics and limited in oxygen content. While many Caulobacters are well suited to this environment, they have also been isolated from almost every aquatic environment (except antarctic waters) and can be isolated from moist soils (Anast and Smit 1988; MacRae and Smit 1991; Poindexter 1981). The most well-known Caulobacter researcher Jean Poindexter went so far as to title a review "The Caulobacters: Ubiquitous Unusual Bacteria" (Poindexter 1981). Caulobacters exhibit fascinating and physiological and life cycle adaptations. The process of cellular division results in one stalked cell giving rise to one stalked and one swarmer cell. The daughter swarmer cell can then move about the medium under the power of a polar flagellum. This polar site is also the site of future stalk formation. Stalks appear to be extensions of the cell envelope and do 1 not contain cytoplasmic materials. At the base of the flagellum or the end of the stalk in the sedentary stage, is an adhesive, probably polysaccharide, holdfast material which serves to anchor the cell to surfaces. It has been postulated that the presence of holdfast in the swarmer stage is often necessary for attachment of Caulobacter cells to surfaces. The probability of a collision with the force required to overcome electrostatic repulsion with a surface is more likely than in the stalked stage. The cell would then eject the flagellum and initiate stalk development for the next round of division (Poindexter 1981). Caulobacters, particularly strains of Caulobacter crescentus, have been the subject of genetic analysis for many years primarily because they exhibit a cell cycle in which many morphological and physiological characteristics are temporally and spatially controlled (Newton 1984; Shapiro 1985). However, the lack of a plasmid transformation method has been an impediment to these and other studies. The introduction of extraneous D N A has only been possible via conjugation and phage transduction (Ely and Croft 1982, Ely and Johnson 1977). Conjugation has been the only method available to introduce plasmids into Caulobacter but is relatively inefficient and awkward. Conjugation necessarily requires the development of conjugation-proficient strains and involves selection procedures, often with several antibiotics and viruses directed against donor cells. The successful application of electrotransformation (electroporation) to eucaryotic cells and more recently to the bacterial species Campylobacter jejuni (Miller 1988) prompted the 2 investigation of its potential to transformation of Caulobacter. The procedure offered greater efficiency in plasmid transfer, broader application among different strains, and required less time and materials than conjugations. We also investigated the utility of electroporation in improving genetic techniques commonly accomplished by more lengthy procedures. Most published work on the electrotransformation of bacteria reports the use of equipment capable of maximum field strengths of 6.25 kV/cm and has demonstrated transformation efficiencies of <10 6 transformants per u.g of plasmid (Luchansky et al. 1988; Liebl et al. 1989; Miller et al. 1988; Schurter et al. 1989; Scott and Rood et al. 1989; Wirth et al. 1989). We used a Bio-Rad Gene Pulser and Pulse Controller and cuvettes with 0.2-cm interelectrodal gaps. This arrangement allowed for field strengths of 12.5 kV/cm and has produced high electrotransformation efficiencies with Escherichia coli (>101 0 transformants per u.g of plasmid [Dower et al. 1988]). For reasons of efficiency as well as safety, high voltage electroporation preparations must be relatively salt free (<5 mmols total salt [Bio-Rad Laboratories 1989]). We anticipated problems with the preparation of marine Caulobacters (Anast and Smit 1988) since many marine bacteria lyse in low-salt environments. It was decided to attempt adaptation of the marine Caulobacters to relatively low salt media so as to aid their survival during preparation for electrotransformation. Also, the ability of divalent cations to stabilize bacterial membranes and surface layers (Beveridge and Murray 1976; Smit and Agabian 1982) in much lower 3 concentrations than univalent cations prompted the replacement of deionized water with 10 mM M g C l 2 and 5 mM C a C l 2 during the early stages of preparation of the marine bacteria for electroporation. In later washes 10% glycerol seemed sufficient to maintain the integrity of the concentrated cells. The exact mechanism of electrotransformation is not known, but the plasmid D N A must breach the membranes of the recipient cell in order to get into the cytoplasm. Many freshwater Caulobacters possess a paracrystalline protein surface array (S-layer) surrounding the cell (Smit et al. 1981a). Comparable S-layers are relatively common among a wide spectrum of bacteria (Smit 1986, Sleytr and Messner 1988a). We speculated that the S-layer could be a barrier to the electrotransformation of Caulobacter and initiated an evaluation. S-layers consisting of regularly arranged protein subunits have been described from species across the eubacterial and archaebacterial spectrum, (Sleytr and Messner 1988a; Smit 1986). These regular two-dimensional paracrystalline arrays of protein monomers are self-assembling; the monomers are noncovalently linked to one another and to the underlying cell wall (Koval and Murray 1984). Although the structural characterization of the S-layers of a number of organisms is well advanced, the regulation of their synthesis, transport, and variability is poorly understood. As well, the functions of most known surface arrays have not been fully ascertained. The superficial presence of S-layers on bacteria from a wide variety of environments would suggest that they have many 4 possible functions. In order to produce the large amount of protein required to sheath the cell, typically 7-12% of the total cell protein (Baumeister et al. 1988), one can assume that much of a bacterium's energies is devoted to this endeavor. This, coupled with the fact that surface layers are often lost in laboratory culture, has led to proposals that they play specific and essential roles in their natural environments. Their functions may include protecting cells by steric separation from external influences, working as molecular sieves, preventing lytic enzymes, bacteriophages, parasitic bacteria or foreign DNAs from contacting underlying membranes (Sleytr and Messner 1988b; Smit 1986). The major and possibly sole component of the C. crescentus S-layer is the apparent Mr-105,000 protein (130K protein). This is probably the most abundant protein of the cell, accounting for approximately 5% of total cell protein synthesized (Agabian et al. 1979; Smit and Agabian 1984). It forms a hexagonal array and, with the possible exception of exopolysaccharide (Ravenscroft et al. in press), associated with the membranes, and lipopolysaccharide, is the outermost layer of the cell (Smit et al. 1981a). Subunit assembly of the surface array occurs in two distinct ways, either as random addition of subunits within the preexisting array or as de novo assembly at the specific sites of stalk elongation and along the cell division plane (Smit and Agabian 1982). These latter cases of spatially restricted array formation are temporally regulated, occurring at specific stages of the life cycle. As the 130K protein is synthesized at a constant rate (Agabian et al. 1979; Fisher 5 et al. 1988) from a single copy gene it is difficult to see how these two processes are coordinated. The entire transport journey across the inner and outer membranes, culminating with final addition to the surface layer supramolecule, is likely to prove a complex process with many factors and mechanisms involved. It is of interest to us to learn in molecular detail how the S-layer is excreted, assembled and attached to the cell surface; toward that end, primary sequence information is essential. The S-layer (rsaA) gene was cloned from C. crescentus CB15A (Smit and Agabian 1984) and the site of transcription initiation determined (Fisher et al. 1988). That site was confirmed by alignment with protein sequencing of the first twenty-one amino acids of the mature protein. Unlike other sequenced S-layers, there was no cleaved signal leader peptide. The sequence published in the Fisher et al. 1988 paper, including the first 940 nucleotides of the gene, contained ten errors. These errors have since been corrected by James Fisher and the staff of Applied BioSystems and the corrections are incorporated in the entire sequence of the gene presented here. The S-layers of ten other bacteria have been sequenced and, for the first time, are here compared to each other, and 130K. These S-layers share many interesting similarities. A likely region related to the role of calcium in surface attachment and self assembly was noted, but with respect to a mechanism of excretion, we learned that this protein has no clear analogy to other characterized exported bacterial proteins. The sequencing of the S-layer gene from a calcium independent mutant, CB15ACal0, was also undertaken. It was hoped 6 that even if no mutation was found, the sequence would provide a confirmation of that done from the wild-type parent, CB15A. 7 Part 1 : Transformation of Freshwater and Marine Caulobacters by Electroporation and the Effect of Surface Layers on Electrotransformation Efficiency. MATERIALS AND METHODS Bacterial strains, media and plasmids. Freshwater C. crescentus CB2NY66R and CB15A (ATCC 19089) were used as parental strains, both having a wild-type paracrystalline S-layer (Poindexter 1964, Smit and Agabian 1984). CB15A is a variant of CB15, in that techniques for preparing synchronously-growing cell cultures work well in this strain. C. crescentus CB2A is a spontaneous mutant that has lost its ability to make 130K, the dominant or only protein of the S-layer. CB15AKSAC is an S-layer minus derivative of CB15A, produced by in vitro insertion of a kanamycin resistance cassette (Barany 1985) into the 130K gene on a plasmid with a ColEl replicon and subsequent forced exchange of the wild-type gene for the interrupted version. The forced exchange was done via electroporation of this plasmid, which is not maintained in caulobacter, and selection for kanamycin resistance. CB15ACalO is a mutant of CB15A that produces 130K protein capable of producing an S-layer structure, but the protein does not efficiently attach to the cell surface. No evidence of the S-layer can be seen on cells by negative stain electron microscopy, yet, when examining plate colonies of this mutant, large sheets of the 8 assembled structure can be found adjacent to the cells. Marine Caulobacter strains MCS3, MCS6, MCS17, MCS18 and MCS24 have been described (Anast and Smit 1988). Vent Caulobacter strains V C 5 and VC13 were obtained from Jean Poindexter, and were isolated from deep sea ocean vent water samples. Freshwater Caulobacter strains were grown in a 0.2% peptone 0.1% yeast extract medium (PYE) supplemented with 0.02% M g S 0 4 . 7 H 2 0 and 0.01% C a C l 2 . 2 H 2 0 at 30° C with vigorous shaking (Mitchell and Smit 1990). Marine and Vent Caulobacters and Pseudomonas atlantica were grown at 25° C with shaking in SSPYE (PYE supplemented with sea salts [Sigma Chemical Co, St. Louis, MO] at noted concentrations). Generation times of the marine bacteria in different salt concentrations were derived using a Klett-Summerson Colorimeter under the growth conditions described above. E. coli strains DH5a (Hanahan 1983), K802 (Wood 1966) and S17-1 (Simon et al. 1983) were used as plasmid hosts and were grown in L broth (Sambrook et al. 1989) at 37° C with vigorous shaking. Plasmids RSF1010 and its derivatives pKT215 and pKT230 have been described (Bagdasarian et al. 1981). RSF1010 confers streptomycin resistance. pKT230 carries streptomycin and kanamycin resistance genes. pKT215 confers chloramphenicol resistance and has a streptomycin resistance gene that is expressed in Caulobacter and not E. coli (Bingle and Smit 1990). pSUP2021 is a 9 Tn5-carrying plasmid that is maintained in E. coli, but not Caulobacter, and is used as a suicide mutagenesis vector (Simon et al. 1983). C. crescentus carrying Tn5 can be selected for on media containing streptomycin (50 |ig/ml [O'Neill et al. 1984]). Purified pKT230 was used for most of the experiments testing electrotransformation efficiency and was prepared by the cleared lysate method and banded by CsCl density gradient centrifugation (Sambrook et al. 1989). The D N A concentration of the plasmid preparations were determined by absorbance at 260 nm and confirmed by visual estimation using agarose gel electrophoresis. pSUP2021 was prepared by a mini-alkaline plasmid preparation method (Sambrook et al. 1989). Preparation of cells for electrotransformation. The bacterial electroporation preparation method was adapted from Dower et al. (1988). Bacteria were grown to mid-logarithmic growth phase (optical density at 600 nm of 0.4 to 0.7). Caulobacter cells were harvested by centrifugation at 10,500 x g for 20 min at 4° C. E. coli cells were harvested by centrifugation at 6500 x g for 12 min at 4° C. A l l subsequent steps were done on ice or at 4° C. Typically, cell pellets from 500 ml of culture were suspended in 500 ml of cold, deionized water, centrifuged, resuspended in 250 ml cold water and centrifuged again. The cell pellet was then resuspended in 25 ml of cold water and centrifuged at 15000 x g or 7500 x g (Caulobacter or E. coli, respectively), suspended in 25 ml of cold 10% glycerol, centrifuged and finally resuspended to a thick slurry. This 10 resulted in suspensions of 1 x 10 1 1 cells/ml for Caulobacter and approximately 2.5 x 1 0 1 0 cells/ml for E. coli strains. The concentrated suspension was incubated on ice for 30-60 min, divided into 50 ul portions, frozen in a dry ice/ethanol bath and stored at -70° C. MCS6 cells were grown in 0.6% SSPYE medium. Subsequent preparation of cells for electrotransformation was the same as for freshwater Caulobacters, except that the steps involving centrifugation and suspension in water were instead done with a cold solution of 10 mM M g C l 2 and 5 mM CaCl 2 . Electroporat ion procedures. The apparatus used was a Bio-Rad Gene Pulser with the output channelled through a Bio-Rad Pulse Controller. Potter-type cuvettes (Bio-Rad, Richmond California) with 0.2 cm interelectrodal gaps were employed. This apparatus could achieve field strengths of up to 12.5 k V / c m . In typical experiments, concentrated cell suspensions (50 (il) were thawed at room temperature and mixed with 1.25 u.1 of pKT230 D N A (100 ng/u.1). Forty u.1 of cells were removed to the electroporation cuvette and shocked. The Gene Pulser was set at 2.5 kV and 25 U.F. The Pulse Controller setting was varied from 100 to 1000 Q, depending on the nature of the experiment. Immediately following the shock, the cuvette contents were mixed with 960 u.1 of outgrowth medium (PYE for freshwater Caulobacters or 1.5% SSPYE for MCS6) and incubated for 15-30 min at room temperature. 11 Cultures were then shaken vigorously for 2 hr at 3 0 ° C for freshwater Caulobacters, or 4 hr at 25° C for MCS6. It should be noted that after the completion of these described experiments further work determined that all of the above post shock delivery incubation times could be halved without a major reduction in recovered transformants. Freshwater Caulobacter cultures were then diluted appropriately in water and plated on P Y E agar, containing either streptomycin (50 Lig/ml), kanamycin (50 jig/ml) or both. MCS6 cultures were diluted in 1.5% SSPYE and plated on 2% SSPYE plates containing streptomycin (50 |ig/ml) and kanamycin (70 u.g/ml). To determine cell survival, dilutions were plated on P Y E or 2.0% SSPYE, as appropriate. E D T A experiments. In some experiments the effect of E D T A on electrotransformation efficiency was evaluated. E D T A was added to electrotransformation preparations, in concentrations of 125 to 1000 fiM, just prior to electroporation. Other genetic techniques involving electroporation. Transposon mutagenesis via electroporation. The procedure above was employed with certain changes. 1 u.1 of a 30 (ll mini-alkaline plasmid preparation of pSUP2021, prepared from 1.5 ml of E. coli strain S17-1, replaced pKT230. C. crescentus CB2A cells were used and, after shocking at a Pulse Controller setting of 200 Q , the preparation was plated on P Y E agar containing either 12 streptomycin and/or kanamycin. Electroporation using ligation reaction mixtures. Electroporation of ligation mixes was carried out using the previously described technique with minor changes. Standard ligation reaction mixes (Sambrook et al. 1989), containing from 10 to 500 ng of plasmid vector and insert DNA from a variety of sources, were diluted ten fold and used as the plasmid source. From 1 to 5 u.1 of the diluted mixes were electroporated with C B 2 A or E. coli strains, using standard conditions (200 or 400 Q Pulse Controller settings). Plasmid electrotransfer. We investigated the possibility of transforming cells simply by electroporating them in the presence of 'donor' cells. E. coli cells K802, carrying RSF1010, and DH5oc, carrying pKT215, were used as donors and CB2A cells as recipients. The above methods, including cell preparation protocols, were again used except that E. coli and CB2A cells were mixed together, at E. coli-to-CB2A cell ratios of from 1:1 to 1:5 (total volume 40 ul), and then shocked, with Pulse Controller settings of 200, 400, or 600 Q. No extraneous plasmid was added. The recovered cells were diluted in 960 u.1 of P Y E and shaken at 30° C for 1.5 h. For plating they were not diluted further. They were plated on P Y E with selection against E. coli and untransformed C B 2 A . Where RSF1010 transfer was involved, streptomycin (50 ul/ml), ampicillin (50 ul/ml), and trimethoprim (30 ul/ml) were used for selection of transformed CB2A. CB2A is both ampicillin and trimethoprim resistant. Where pKT215 transfer 13 was involved, streptomycin (50 u.l/ml) was the only selection needed. RESULTS AND DISCUSSION. Effects of modifying electrotransformation conditions on electrotransformation efficiency. The parameters involved in electroporation (Dower et al. 1988) include the field strength (expressed in kilovolts [kV/cm]), the capacitance (set at 25 u,F for most of these experiments), and the time constant (milliseconds), which is a measure of pulse duration and is modified by the Pulse Controller (ohms). A simple and short discussion of these parameters is contained in the appendix. Initial attempts to electrotransform Caulobacter were limited by maximum field strengths of 6.25 kV/cm because only wide electroporation cuvettes with 0.4-cm interelectrodal gaps were available. Also, the cell preparation protocol, adapted from the first published account of bacterial electrotransformation (Miller et al. 1988), did not call for a high concentration of cells in preparation (about 109/ml) or as many water and 10% glycerol washes. The yield with C B 2 A was approximately 104 transformants per jig of pKT230 (results not shown). The use of electroporation cuvettes with 0.2-cm interelectrodal gaps, allowing field strengths of up to 12.5 kV/cm, and the preparation protocol described above, effected a dramatic improvement of electroporation efficiency; transformation levels of >108/u.g of plasmid were routinely obtained (Fig 1). 14 2.0 0.0 H r— 1 i 1 i 1 7 8 9 10 11 12 13 Field Strength (kV/cm) F I G . 1. The effect of varying field strengths on the electrotransformation efficiency of C. crescentus CB2A. A mixture of cells and plasmid was pulsed at field strengths of 7 to 12.5 kV/cm with one of three resistors in parallel to the electroporation cuvette: 200, 400, or 600 Ci resulting in time constants of approximately 4.2, 8.1, or 12.1 ms, respectively. Standard error, derived by the Student t test, is displayed in this and the following figures. Each data point was derived from at least 3 and as many as 12 experiments. 15 The effects of a range of field strengths with the pulse controller set at 200, 400 or 600 Q for the electroporation of C . crescentus CB2A was investigated (Fig 1). Maximum transformation efficiency was achieved using pulses of 12.5 kV/cm and durations of 4.2 ms. Pulses of 8.1 ms were nearly as efficient. Cell survival under the most efficient electrotransformation conditions was 40 to 50%. The effect of variation of time constants on the electroporation of five strains of C. crescentus was examined (Fig 2). Field strength and capacitance were set at the apparatus maximum of 12.5 kV/cm for all pulses. Again, maximum efficiency was achieved with pulse durations of 4.2 to 8.1 ms (200 and 400 Q.). Longer time constants reduced both the number of transformants recovered and the cell survival rate (from 8-30% survival). Shorter time constants produced higher cell survival (>50%) but lower transformation efficiency. The application of higher levels of current (via the use of higher capacitance settings on a Bio-Rad Capacitance Extender™) was only briefly evaluated. Capacitance settings of from 125 to 960U.F, with field strengths of 6.25 kV/cm, significantly reduced cell survival rates, which reduced overall electrotransformation efficiency (Data not shown). P l a s m i d concentra t ion a n d t r a n s f o r m a t i o n eff ic iency. The relationship between the amount of plasmid used and the resulting electrotransformation efficiency was also examined (Fig 3). The number of transformants recovered was proportional to the amount of plasmid added, from 10 ng to 700 ng. Above 700 ng (ie. 16 0 2 0 0 4 0 0 6 0 0 8 0 0 P u l s e C o n t r o l l e r Set t ing (Ohms) F I G . 2. The effect of pulse duration and S-layer on the electrotransformation of C. crescentus strains. C. crescentus strains tested include two with S-layers (CB2NY66R [•] and CB15A [•]), two lacking S-layers (CB2A [•] and CB15AKSAC [O]) and one in which S-layer is assembled but not attached to the cell (CB15ACalO [A]). Cells and plasmid were pulsed at a field strength of 12.5 kV/cm with a pulse controller setting of 100, 200, 400, 600, or 800 Q. These settings resulted in time constants of approximately 2.3, 4.2, 8.1, 12.1, and 16.0 msec, respectively. 17 2 . 0 co o CD «2 1 .01 c cn 8 CO c o . o - M 1 o 1 o o DNA (ng) 1 0 0 0 FIG. 3. The effect of DNA concentration and electrotransformation efficiency. The indicated quantities of pKT230 plasmid DNA were added to electroporation preparations of C. crescentus CB2A prior to shocking. 18 lu,g) recovered transformants/u.g plasmid decreased. This phenomenon was found in other bacteria (Conchas and Carniel 1990, Dower et al. 1988, Luchansky et al. 1988). It may be possible that contaminating substances in the D N A preparation or the D N A itself reach a critical level above which either the cells or the characteristics of the current flow across the suspension in the cuvette are affected. Above this level, electrotransformation may actually be hindered. Preincubation of cells with plasmid before electroporation did not improve electrotransformation efficiency (data not shown). Electrotransformation of marine Caulobacters. Marine Caulobacter MCS6 has been the recent focus of genetic studies, including construction of a Tn5 mutagenesis library to isolate holdfast mutants as has been done with Caulobacter crescentus C B 2 A (Mitchell and Smit 1990). We were interested in the application of electroporation to this work and so attempted to electotransform MCS6 using the above methods. When MCS6 was grown in standard saltwater medium (3.5% SSPYE) and prepared for electroporation with water or the M g C l 2 / C a C l 2 solution, excessive cell lysis occurred. To help overcome this difficulty, MCS6 was grown in the lowest level of sea salt consistent with good growth (Fig 4). Using MCS6 cells grown in 0.6% S S P Y E , transformation efficiencies of 1.5 x 103 transformants per (ig of pKT230 with the Pulse Controller set on 600 or 800 Q (12 and 16 ms time constants) 19 FIG. 4. Generation times of five marine Caulobacter in different concentrations of sea salts in P Y E broth. Generation times were derived from growth of cultures at 25° C and turbidity readings, using a Klett-Summerson Colorimeter. MCS24 is a marine Caulobacter with the unusual ability to grow with little or no added sea salts (1). 20 * could be obtained. Total recovered transformants could vary significantly: i.e., as much as 50%. Lower Pulse Controller settings (i.e., shorter time constants) produced no transformants. The growth of other marine Caulobacter strains in varying sea salt concentrations was also investigated (Fig. 4). This information should prove useful for the future testing of electroporation with these strains. As well, the growth of two vent Caulobacter strains and Pseudomonas atlantica was examined in the same conditions (Fig. 5). MCS24 grows well in a wide range of salt concentrations including very low salt concentrations, while MCS3 grew well in limited sea salt media (Fig. 4). These strains might be more amenable to electroporation than the others. The other strains, including the vent Caulobacters and Pseudomonas atlantica, were more sensitive to low sea salt conditions but the successful application of electroporation may still be feasible. It is interesting that all the marine Caulobacters (MCS') grew well in half strength sea salts media (1.5 to 2.0%) and most actually grew faster than they did in full strength marine concentrations (3.5 to 4.0%). Combining other genetic techniques with electroporation. Transposon mutagenesis via electroporation. The standard procedure was used except that 1 u.1 of a 30 pi mini-alkaline plasmid preparation of pSUP2021, prepared from 1.5 ml of E. coli S17-1, replaced pKT230. pSUP2021 is a Tn5-carrying plasmid that is maintained in E. coli but not in Caulobacter. For the electrotransformed Caulobacter to survive streptomycin selection, 21 FIG. 5. Generation times of four marine bacteria in different concentrations of sea salts in P Y E broth. Generation times were derived from growth of cultures at 25° C and turbidity readings, using a Klett-Summerson Colorimeter. 22 the transposon must 'hop' to the chromosome where it will be maintained. CB2A cells were shocked at a Pulse Controller setting of 200 Q, and approximately 500 Tn5 transposition events were consistently obtained. Electrotransformation using ligation mixtures. Ligation reactions could be directly electrotransformed into Caulobacter and E. coli. Dilution of standard ligation mixes (after ligation) minimized diminishing time constants (due to the presence of salts) and improved transformation efficiency. Ligation reaction mixes (Sambrook et al. 1989), containing 10 to 500 ng of plasmid vector and insert D N A from a variety of sources, were diluted 10-fold , and 1 to 5 u.1 was electroporated into CB2A or DH5a (200 or 400 Q Pulse Controller settings). The efficiency of the process varied according to the efficiency of the ligation reaction (involving vector and insert sizes, D N A purity and other factors), yet transformants were readily recoverable; this is now the standard practice in our laboratory. Plasmid electrotransfer. E. coli and Caulobacter cells were mixed together and shocked, as described in "Materials and Methods". E. coli K802 carrying RSF1010 and E. coli DH5a carrying pKT215 were used as donors and CB2A was the recipient strain. When a total of 40 u.1 of cells (donor and recipient combined) was shocked, approximately 150 recipients were recovered on selection media (see materials and methods). Maximum efficiency was achieved with pulses of 4.1 ms. Total recovered transformants varied by as much as 65% between 23 experiments but were always readily isolated. Effect of S-layers on electrotransformation. CB2A and CB2NY66R differed significantly with respect to their electrotransformability (Fig 2). Maximum transformation efficiency of CB2A was obtained with pulse durations of one-third the length needed for maximal levels of transformation in CB2NY66R, and the maximum efficiency of transformation with CB2A was 10 times higher than that possible with CB2NY66R. Similarly, CB15AKSAC was also electrotransformed 10 times more efficiently than its parental strain. Mutant CB15ACal0, which produced S-layer that did not efficiently attach (if at all) to the cell surface, could be electrotransformed at twice the efficiency of CB15A. As the surface array was not expected to bound to the cells we had anticipated this strain to be transformed as efficiently as the surface array deficient strains. The exact nature of the interaction of S-layer protein and CalO cells is not established. This strain sheds S-layer in large amounts, visible to the naked eye in culture. To explain the above phenomena, there are a few possibilities. Residual S-layer may remain attached to the cell and thus inhibit electrotransformation. S-layer is not usually seen on the CalO cells in electron micrographs but the possibility remains that the S-layer protein is very weakly attached, and is separated from the cells during preparation for electron microscopy. A more likely possibility (as there is circumstantial evidence to support this) is that S-layer contaminates the cells in the preparation of CalO and then inhibits the 24 electrotransformation of these bacteria. S-layer blobs, visible in liquid culture, may co-isolate with the cells during the washing steps of preparation for electroporation. This material may then inhibit the procedure in a number of ways causing chemical and/or electrical changes in the sample for and/or during electroporation. Indeed, the cells appear and behave differently during the preparation phase compared to their parental strain. The mutant cells appear to be slower to pellet and the pellet is not uniform; that is the top of the pellet (material last to pellet) appears to be slightly gel-like and viscous. This part of the cell pellet may have a high degree of contaminating S-layer. The contaminating S-layer may actually even bind the added DNA, thereby inhibiting the D N A from entering the cells during electroporation. In support of this concept, electron micrographs of purified hexagonally packed intermediate S-layer from the bacterium Deinococcus radiodurans consistently show what appears to be attached D N A strands (Peters and Baumeister 1987). It is not surprising that a physical technique of breaching the cell wall barriers for plasmid introduction might be impeded by an additional cell wall structure. However, current image analysis of the C. crescentus S-layer structure suggests a widely spaced, hexagonal network of six-membered rings (each ring having six S-layer proteins) arranged at 23.5-nm intervals (Smit et al. 1981a). Such a widely spaced network is relatively unusual compared with the S-layers of other bacteria (Sleytr and Messner 1988a), yet apparently even a loose network can strongly affect electrotransformation. The 25 S-layers of other bacteria may well prove to have a similar retarding effect on electrotransformation. Nevertheless, >107 transformants per U-g of plasmid were still obtained with S-layer expressing strains, sufficient for many applications. Since divalent cations improve the stability of Caulobacter S-layer preparations and E D T A disrupts the organized structure (Steven Smith and John Smit unpublished), the electrotransformation efficiencies of the S-array proficient strains CB15A and CB2NY66R were tested in the presence of E D T A . Immediately before shocks were administered, E D T A was added to make to final concentrations over the range 125 to 1,000 U.M. Al l resulted in lower cell survival rates, diminishing recovery of the transformants. E D T A probably competes for divalent cations that are essential to maintain membrane stability, leading to cell death when in high enough concentration. The disturbance of the membranes when the electrical pulse is delivered, and the following membrane restabilization period may offer a good opportunity for the E D T A to get at these normally integral divalent cations, leading to restabilization failure. Even at 125 uM, cell survival was reduced at higher Pulse Controller settings (i.e., >400 Q: [data not shown]). The ultimate improvement of electrotransformation efficiency under optimal conditions (125 u,M E D T A , 200 Q Pulse controller setting) was variable; with from 0 to 50% more transformants recovered than without E D T A . 26 Addi t iona l discussion. Compared to published data for other bacteria, Caulobacter seems well suited for electroporation. Levels of over 10 8 transformants per u.g of plasmid are higher than for other reported bacterial systems. Exceptions are E. coli (Dower et al. 1988), and with similar levels, Agrobacterium tumefaciens and Pseudomonas aeruginosa (Farinha and Kropinski 1990, Mersereau et al. 1990). In part, this is due to the apparatus. Maximum efficiency of electrotransformation for CB2A was achieved at the apparatus limit of 12.5 kV/cm. This suggests that Caulobacters could be transformed at still higher efficiency if greater field strengths were possible. Very high electroporation efficiencies may occasionally have advantages for work with Caulobacters. When large amounts of plasmid (i.e., 1 u.g or more) are used, as many as 10% of survivors contain the plasmid. Thus, screening, rather than selecting (via antibiotic markers) for the cells containing plasmid, is feasible. In some cases, it may be desirable to install cryptic plasmids from native sources, perhaps specifying an activity that can be assayed but for which selection is not possible. In such cases, high-efficiency electroporation is a way to accomplish the task. High efficiency was key to the success in improving several genetic techniques with electroporation. Electrotransformation of Caulobacters using ligation reaction mixtures eliminated the need to first transform E. coli and then introduce the plasmid into Caulobacters by conjugation. Electrotransformation combined with suicide mutagenesis technique resulted in a simpler method than conjugation to introduce the plasmid and did not require the use of recipient Caulobacters with additional mutations to select against E. coli donor cells (e.g., rifampin resistance). Also, plasmid recipients were not compromised by the presence of contaminating E. coli donor cells. Hence, results were obtained faster than with conjugation, often within 24 h for freshwater strains. Also, no special plasmid constructions were needed to use suicide mutagenesis or gene replacement strategy; simple colicin El-replicon type vectors (e.g., pUC plasmids) sufficed, since mobilization capability is not required. In gene replacement experiments performed in the Smit lab, (including the the construction of CB15AKSAC discussed earlier), 3 to 23% of the initial drug-marker resistant clones are gene replacement events; the remainder appear to be single crossover (plasmid insertion) events. The electrotransfer of plasmid from E. coli to Caulobacters circumvents a plasmid purification step, conjugation procedures, and the necessity that the E. coli host be constructed to act as a donor strain. Electrotransfer of plasmids has hitherto only been reported for E. coli strains (S ummers and Withers 1990) where it was suggested that electrotransfer might be possible between E. coli and other species; it is. 28 Part 2: Nucleotide Sequence Analysis of the Regular Surface Array Gene of Caulobacter crescentus CB15A and Examination of the Predicted Surface Layer Protein Sequence. MATERIALS AND METHODS Bacterial strains and growth media. C. crescentus CB15A ( A T C C 19089) was grown in supplemented P Y E medium at 30° C with shaking (as above). C . crescentus CB15ACal0 , is an mutant of CB15A that sheds 130K protein (also see above: materials and methods part 1). E. coli DH5aF' (Hanahan 1983) was used for all techniques requiring E. coli, except for when non-methylated D N A was required for subcloning, as in cases involving Bell and Clal restriction sites. In this case, RB404 (Brent and Ptashne 1980), containing the dam-3 and dam-6 mutations was used. L broth, T Y P , 2xYT and M9 minimal media were used as required to grow E. coli at 37° C (Sambrook et al. 1989). Gene cloning and related methods. The preparation of plasmid D N A , fragment purifications, ligations and other necessary genetic manipulations were carried out using standard methods (Sambrook et al. 1989). Plasmids were prepared by either the boiling method of Holmes and Quigley (1981) 29 or the alkaline technique of Birnboim and Doly (1979). When larger quantities of plasmid were desired, either a scaled-up alkaline technique or a cleared lysate method was employed (Sambrook et al. 1989). Plasmids isolated on a large scale were further purified using two CsCl-EtBr density gradient cycles (Sambrook et al. 1989) or the Bio-Rad Prep-a-Gene kit (Bio-Rad Richmond California). Double stranded plasmid for sequencing was obtained from the previously mentioned preparations or from P E G precipitated minipreparations (Kraft et al. 1988). Where required, plasmids were introduced into E. coli by electrotransformation (as above [Part 1]). Nucleotide sequence analysis of the S-layer ( r s a A ) genes from CB15A and CB15ACalO. Sequencing techniques and sample preparation. D N A sequence analysis was performed by the dideoxy chain termination method (Sanger et al. 1977). Two methods were used to generate single-stranded template D N A : the M13mpl8 and M13mpl9 single-stranded D N A phage system (Vieira and Messing 1987) and the pTZ plasmid vector system (United States Biochemical Corp., Cleveland, Ohio). Helper phage M13K07 was used to produce single-stranded D N A from cells carrying pTZ-rsaA constructs. In both cases, single-stranded D N A phage were precipitated from supernatants by additions of polyethylene glycol to 3.3% and ammonium acetate to 430 mM. Precipitated phage were suspended in 4.5 M sodium perchlorate and the liberated D N A was bound to 30 glass filters, followed by extensive washing with 70% ethanol. Single-stranded template D N A was recovered from the filters in a solution of 1 mM Tris and 100 (iM E D T A and the D N A concentration was estimated by visual examination of bands obtained from agarose gel electrophoresis. Sequencing reactions using single stranded or double stranded D N A were performed using the Sequenase kit (U.S. Biochemical Corp., Cleveland, Ohio) with [a-35S] dATP, following the protocol supplied with the kit. Alternatively, T7 D N A polymerase, deoxy-NTPs (including 7-deaza GTP) and dideoxy-NTPs were purchased from Pharmacia (Baie d'Urfe, Quebec) and sequencing reactions run according to supplied protocols. Reaction products were separated on 5-6% polyacrylamide-urea gels. Oligodeoxy ribonucleotide primers. Oligodeoxyribonucleotide primers (18-22mers) were prepared by a service within the Biochemistry department of the University of British Columbia. They were assembled on an Applied Biosystems model 380B D N A Synthesizer using b cyanoethyl-N-, N -di isopropylamino phosphoramidites (Sinha et al. 1984). Oligonucleotides were purified by CI8 S E P - P A K minicolumns as described in Atkinson and Smith (1984). Computer analysis of the nucleotide and predicted protein sequences. The Delaney sequence handling program (Delaney 1983), which uses codon preferences to predict the proper reading frame, was 31 used to confirm proper reading frame from nucleotide sequence data. Many of the P C / G E N E (Intelligenetics, Mountain View, CA) programs were used for sequence analysis (see below), including the FSTPSCAN program to search for homology with the Swiss Prot release 17 using the method of Myers and Miller (1988). As well, the F A S T A program (Pearson and Lipman 1988) was used to scan the Swiss Prot release 15. Amino acid and peptide analysis of 130K protein. 130K protein was purified by John Smit from aggregates composed of shed surface proteins and an insoluble red pigment produced by C: crescentus CB15 (Smit et al. 1981b), using gel filtration in the presence of sodium dodecyl sulfate as previously described (Smit and Agabian 1984). The purified protein was hydrolyzed in 6M HC1 at 110° C for 24 h and the amino acid composition evaluated with a Durrum D500 amino acid analyzer by Ken Walsh and his staff at the University of Washington. Silvia Yuen of Applied BioSystems performed peptide sequencing experiments. Peptides were generated from the same 130K preparation as above by digestion at room temperature with V8 protease in 0.1 M ammonium carbonate buffer, pH 8.0. The digested protein was applied to a Aquapore RP300A reverse phase column and peaks were eluted with a 0-100% gradient of Buffer A (0.1% trifluoroacetic acid [TFA]) in Buffer B (0.085% T F A in 70% acetonitrile). For those peaks retrievable in sufficient quantity, amino acid sequencing was done by sequential Edman degradations. 32 Calculation of free energies for mRNA secondary structure. Calculation of free energies for mRNA secondary structure was determined according to the method of Tinoco et al. (1973). RESULTS AND DISCUSSION Sequencing strategy of the regular surface array genes form CB15A and CB15ACalO. Various fragments of the regular surface array genes from both CB15A and CB15ACalO were subcloned into pTZ and M13 vectors (Fig. 6). The Hindlll to BamHl 4.2 kb fragment (denoted A19 from CB15A and E1F2 from CB15ACalO) was cloned into both M13mpl8 and 19 as well as pTZ18U, 19U, 18R and 19R. Further smaller subclones were put in the pTZ vectors (Fig. 6). In these cases the universal and reverse primer annealing regions in the pTZ vectors were used to sequence the ends of the inserts. In addition, numerous sequence-derived oligonucleotide primers were generated so that sequencing of much of the gene proceeded in a "walking" manner, such that sequence derived from one primer overlapped the hybridization region for the next (Sambrook et al. 1989). Both strands of the 130K gene were fully sequenced, in this manner, 3' to the Aval site indicated in Figure 6, with all sequences overlapping. Sequencing of the E1F2 fragment carrying the S-layer gene from the mutant CB15ACalO proceeded in an identical manner except for the additional investigation between the unique Clal site and the 33 5' M M rH O > I T M • O X •5 .3 H H M H riJ Q E O V) .3 <d Cd (X, X CQ . 4 kb ? t i i i x x . . r , , t ? t ? _ ^ Tr 2 3 4 tt J Tx T 1 x , ! ? _ _ I t 4 . t I Tx I 2 3 J t x r 2 T FIG. 6. Restriction maps of the C. crescentus CB15A and CB15ACalO chromosomal D N A region containing the rsaA gene and the DNA segments used for DNA sequencing. The solid bar indicates the rsaA coding region. The positions at which oligonucleotide probes hybridized are marked with arrows. Those .pointing down were used for sequencing in the 5' to 3' direction of the gene while those pointing up were used for the 3' to 5' direction. In the plasmid construct maps only the terminal sites of the vector D N A are indicated with broken lines. The inserts are indicated by unbroken lines. Those inserts, including the full Hindlll to BamHl fragment, were cloned into one or more of pTZ18U, 18R, 19U, or 19R for single strand template production. As well, the entire Hindlll to BamHl fragment was cloned into M13mpl8 and 19 for "single strand template production. The A v a l site indicated was one of seven on the Hindlll to BamHl fragment. 34 indicated Aval site (Fig. 6). Resequencing of the previously published partial sequence of the rsaA gene from CB15A. A previous study (Fisher et al. 1988) focussed on the 5' untranslated regions of the rsaA gene from CB15A, but also included sequence and the predicted translation up to the Aval site indicated in figure 6. During the course of the present study, using a predictive analysis of the third position codon bias expressed in Caulobacter crescentus (see below), it was noted that several errors were likely present in the reported sequence, resulting in several regions where the predicted amino acid sequence was inaccurate. Accordingly, a major portion of the region 5' to the Aval site was resequenced by James Fisher and the staff of Applied BioSystems. Ten corrections to the nucleotide sequence resulted in a reading frame that was contiguous with the remainder of the gene and, using the Delaney reading frame predictive program, exhibited a strong codon bias present throughout the gene (see below). Size of the regular surface array gene and predicted 130K sequence. The entire gene sequence with flanking D N A is shown in Figure 7. The open reading frame extended for 3081 nucleotides, coding for a protein of 1026 amino acids. The second and third forward frames contained 59 or 13 stop codons, respectively. The mature polypeptide, with its N-terminal methionine cleaved, is predicted to 35 GCTAH£TCGACGTATGACGTTTGCTC1A1AGCCATCGCTGCTCCCATGCGCGCCACTCGGTCGCAGGGGGTGTGGGATTTTTTTTG££A£ACAATCCTC - 3 5 - 1 0 *"*-130K S . D . 1 M A Y T T A O T , V T A Y T N A N T , G K A P D A A T T L T L D A Y A T 1 ATGGCCTATACGACGGCCCAGTTGGTGACTGCGTACACCAACGCCAACCTCGGCAAGGCGCCTGACGCCGCCACCACGCTGACGCTCGACGCGTACGCGA 35 Q T Q T G G L S D A A A L T N T L K L V N S T T A V A I Q T Y Q F 100 C T C A A A C C C A G A C G G G C G G C C T C T C G G A C G C C G C T G C G C T G A C C A A C A C C C T G A A G C T G G T C A A C A G C A C G A C G G C T G T T G C C A T C C A G A C C T A C C A G T ? 68 F T G V A P S A A G L D F L V D S T T N T N D L N D A Y Y S K F A 200 C T T C A C C G G C G T T G C C C C G T C G G C C G C T G G T C T G G A C T T C C T G G T C G A C T C G A C C A C C A A C A C C A A C G A C C T G A A C G A C G C G T A C T A C T C G A A G 7 T C G C 7 101 Q E N R F I N F S I N L A T G A G A G A T A F A A A Y T G V S Y A C 300 C A G G A A A A C C G C T T C A T C A A C T T C T C G A T C A A C C T G G C C A C G G G C G C C G G C G C C G G C G C G A C G G C T T T C G C C G C C G C C T A C A C G G G C G T T T C G 7 A C G C C C 135 T V A T A Y D K I I G N A V A T A A G V D V A A A V A F L S R Q A 400 AGACGGTCGCCACCGCCTATGACAAGATCATCGGCAACGCCGTCGCGACCGCCGCTGGCGTCGACGTCGCGGCCGCCGTGGCTTTCCTGAGCCGCCAGGC 168 N I D Y L T A F V R A N T P F T A A A D I D L A V K A A L I G ' 7 1 500 C A A C A T C G A C T A C C T G A C C G C C T T C G T G C G C G C C A A C A C G C C G T T C A C G G C C G C T G C C G A C A T C G A T C T G G C C G T C A A G G C C G C C C T G A T C G G C A C C A T C 201 L N A A . T V S G I G G Y A T A T A A M I N D L S D G A L S T D N A A 600 CTGAACGCCGCCACGGTGTCGGGCATCGGTGGTTACGCGACCGCCACGGCCGCGATGATCAACGACCTGTCGGACGGCGCCCTGTCGACCGACAACGCGG 235 G V N L F T A Y P S S G V S G S T L S L T T G T D T L T G T A N N 700 C T G G C G T G A A C C T G T T C A C C G C C T A T C C G T C G T C G G G C G T G T C G G G T T C G A C C C T C T C G C T G A C C A C C G G C A C C G A C A C C C T G A C G G G C A C C G C C A A C A A 268 D T F V A G E V A G A A T L T V G D T L S G G A G T D V L N W V Q 800 CGACACGTTCGTTGCGGGTGAAGTCGCCGGCGCTGCGACCCTGACCGTTGGCGACACCCTGAGCGGCGGTGCTGGCACCGACGTCCTGAACTGGGTGCAA 301 A A A V T A L P T G V T I S G I E T M N V T S G A A I T L N T S 5 G 900 GCTGCTGCGGTTACGGCTCTGCCGACCGGCGTGACGATCTCGGGCATCGAAACGATGAACGTGACGTCGGGCGCTGCGATCACCCTGAACACGTCTTCGG 335 V T G L T A L N T N T S G A A Q T V T A G A G Q N L T A T T A A C 1000 GCGTGACGGGTCTGACCGCCCTGAACACCAACACCAGCGGCGCGGCTCAAACCGTCACCGCCGGCGCTGGCCAGAACCTGACCGCCACGACCGCCGCTCA 368 A A N N V A V D G G A N V T V A S T G V T S G T T T V G A N S A A 1100 AGCCGCGAACAACGTCGCCGTCGACGGGCGCGCCAACGTCACCGTCGCCTCGACGGGCGTGACCTCGGGCACGACCACGGTCGGCGCCAACTCGGCCGCT 401 S G T V S V S V A N S S T T T T G A I A V T G G . T A V T V A Q 7 A G 1200 TCGGGCACCGTGTCGGTGAGCGTCGCGAACTCGAGCACGACCACCACGGGCGCTATCGCCGTGACCGGTGGTACGGCCGTGACCGTGGCTCAA.- .CGGCCG 4 35 N A V N T T L T Q A D V T V T G N S S T T A V T V T Q T A A A T A 1300 GCAACGCCGTGAACACCACGTTGACGCAAGCCGACGTGACCGTGACCGGTAACTCCAGCACCACGGCCGTGACGGTCACCCAAACCGCCGCCGCCACCC-C 468 G A T V A G R V N G A V T I T D S A A A S A T T A G K I A T V 7 L 14 00 CGGCGCTACGGTCGCCGGTCGCGTCAACGGCGCTGTGACGATCACCGACTCTGCCGCCGCCTCGGCCACGACCGCCGGCAAGATCGCCACGGTCACCCTG 501 G S F G A A T I D S S A L T T V N L S G T G T S L G I G R G A L T A 1500 GGCAGCTTCGGCGCCGCCACGATCGACTCGAGCGCTCTGACGACCGTCAACCTGTCGGGCACGGGCACCTCGCTCGGCATCGGCCGCGGCGCTC7GACCG 535 T P T A N T L T L N V N G L T T T G A I T D S E A A A D D G F T T 1600 CCACGCCGACCGCCAACACCCTGACCCTGAACGTCAATGGTCTGACGACGACCGGCGCGATCACGGACTCGGAAGCGGCTGCTGACGATGGTT7CACCAC 568 I N I A G S T A S S T I A S L V A A D A T T L N I S G D A R V 7 I 17 00 C A T C A A C A T C G C T G G T T C G A C C G C C T C T T C G A C G A T C G C C A G C C T G G T G G C C G C C G A C G C G A C G A C C C T G A A C A T C T C G G G C G A C G C T C G C G T C A C G A 7 C 601 T S H T A A A L T G I T V T N S V G A T L G A E L A T G L V F 7 G G 1800 ACCTCGCACACCGCTGCCGCCCTGACGGGCATCACGGTGACCAACAGCGTTGGTGCGACCCTCGGCGCCGAACTGGCGACCGGTCTGGTCTTCACGGGCG 635 A G A D S I L L G A T T K A I V M G A G D D T V T V S S A T L G A 1900 GCGCTGGCCGTGACTCGATCCTGCTGGGCGCCACGACCAAGGCGATCGTCATGGGCGCCGGCGACGACACCGTCACCGTCAGCTCGGCGACCC7GGGCGC 668 G G S V N G G D G T D V L V A N V N G S S F S A D P A F G G F E T 2000 TGGTGGTTCGGTCAACGGCGGCGACGGCACCGACGTTCT G G T G G CCAACG T CAACG G T T CG T CG T T CAG CG CT G ACCCG G CCT T CG G CG GCTTCGAAACC (Fig. 7- continued next page) 36 7 0 1 L R V A G A A A Q G S H N A N G F T A L Q L G A T A G A T T F T N V 2 1 0 0 C T C C G C G T C G C T G G C G C G G C G G C T C A A G G C T e G C A C A A C G C C A A C G G C T T C A C G G C T C T G C A A C T G G G C G C G A C G G C G G G T G C G A C G A C C T T C A C C A A C G 7 3 5 A V N V G L T V L A A P T G T T T V T L A N A T G T S D V F N L 7 2 2 0 0 T T G C G G T G A A T G T C G G C C T G A C C G T T C T G G C G G C T C C G A C C G G T A C G A C G A C C G T G A C C C T G G C C A A C G C C A C G G G C A C C T C G G A C G T G T T C A A C C T G A C 7 6 8 L S S S A A L A A G T V A L A G V E T V N I A A T D T N T T A H V 2 3 0 0 C C T G T C G T C C T C G G C C G C T C T G G C C G C T G G T A C G G T T G C G C T G G C T G G C G T C G A G A C G G T G A A C A T C G C C G C C A C C G A C A C C A A C A C G A C C G C T C A C G T C 8 0 1 D T L T L Q A T S A K S I V V T G N A G L N L T N T G N T A V T S F 2 4 0 0 G A C A C G C T G A C G C T G C A A G C C A C C T C G G C C A A G T C G A T C G T G G T G A C G G G C A A C G C C G G T C T G A A C C T G A C C A A C A C C G G C A A C A C G G C T G T C A C C.-.GCT 8 3 5 D A S A V T G T G S A V T F V S A N T T V G E V V X X E G . G . A G . A 2 5 0 0 T C G A C G C C A G C G C C G T C A C C G G C A C G G C T C C G G C T G T G A C C T T C G T G T C G G C C A A C A C C A C G G T G G G T G A A G T C G T C A C G A T C C G C G G C G G C G C T G G C G C * * * * 8 6 8 E . £ L X £ £ A . X A ] i E X X X G . £ A £ A G X L Y X X G . £ I G X £ I £ 2 6 0 0 C G A C T C G C T G A C C G G T T C G G C C A C C G C C A A T G A C A C C A T C A T C G G T G G C G C T G G C G C T G A C A C C C T G G T C T A C A C C G G C G G T A C G G A C A C C T T C A C G G G T 9 0 1 G . X S A J 2 I F D I N A I G T S T A F V T I T D A A - V G D K L D L V G 2 7 0 0 G G C A C G G G C G C G G A T A T C T T C G A T A T C A A C G C T A T C G G C A C C T C G A C C G C T T T C G T G A C G A T C A C C G A C G C C G C T G T C G G C G A C A A G C T C G A C C T C G T C G 9 3 5 I S T N G A I A D G A F G A A V T L G A A A T L . A Q Y L D A A A A 2 8 0 0 G C A T C T C G A C G A A C G G C G C T A T C G C T G A C G G C G C C T T C G G C G C T G C G G T C A C C C T G G G C G C T G C T G C G A C C C T G G C T C A G T A C C T G G A C G C T G C T G C T G C 9 6 8 G D G S G T S V A K W F Q F G G D T Y V V V D S S A G A T F V S G 2 9 0 0 C G G C G A C G G C A G C G G C A C C T C G G T T G C C A A G T G G T T C C A G T T C G G C G G C G A C A C C T A T G T C G T C G T T G A C A G C T C G G C T G G C G C G A C C T T C G T C A G C G G C 1 0 0 1 A .. D A V I K L T G L V T L T T S A F A T E V T, T T, A pnd 3 0 0 0 G C T G A C G C G G T G A T C A A G C T G A C C G G T C T G G T C A C G C T G A C C A C C T C G G C C T T C G C C A C C G A A G T C C T G A C G C T C G C C T A A G C G A A C G T C T G A T C C T C G C 3 1 0 0 C T A G G C G A G G A T C G C T A G A C T A A G A G A C C C C G T C T T C C G A A A G G G A G G C G G G G T C T T T C T T A T G G G C G C T A C G C G C T G G C C G G C C T T G C C T A G T T C C G G 7 • > < Fig . 7. The complete nucleotide sequence of the C. crescentus rsaA gene and the predicted translational product in the single letter amino acid code. The -35 and -10 sites of the promoter region as wel l as the start of transcription and the Shine-Dalgarno sequence are indicated. Partial amino acid sequences determined by Edman degradation of 130K protein and of peptides obtained after cleavage with V 8 protease are indicated by contiguous underlining. The putative transcription terminator palindrome is indicated with arrowed lines. The region encoding the glycine-aspartate repeats is underlined with a broken line. This region includes .five aspartic acids (indicated by asterisks) that may be involved in the binding of calcium ions (see text). 37 be 1025 amino acids with a calculated mass of 98,001 daltons. This mass is relatively close to the apparent mass as derived from polyacrylamide gel electrophoresis which is about 105,000 daltons (Smit and Agabian 1984). The predicted amino acid profile was also a close match to that chemically derived from purified 130K protein (Table I), again supporting the validity of these reported sequences. Codon usage of the rsaA gene. Codon usage of the structural gene was strongly biased toward use of G and C. The overall G+C content was 68%, whereas that of codon position 3 is 86%. A was found at position 3 only 1.8% of the time, and was only used in this position for two codons: C A A (glutamine) and G A A (glutamate). Even in cases where there is a choice of G or C in the third position for a given codon, generally one of the two will be used in preference to the other (Schoenlein et al. 1990). This strong codon bias aided computer analysis of the D N A sequence (Delaney 1983) which confirmed that the proper reading frame was maintained throughout the reported gene sequence, and also indicated that the region immediately downstream of the stop codon was non-coding. The codon usage frequency of this gene matched closely with that of other caulobacter genes (Table II) with the exceptions that the codons G C T (alanine), and C A A (glutamine) were used more frequently, and G A G (glutamate) and C A G (glutamine) were in low abundance. The variant codon usage for glutamine and glutamate may be the result of a statistically small sampling: the rsaA gene coded for only 20 glutamines and 9 38 TABLE I . Amino a c i d c o m p o s i t i o n of t h e 130K p r o t e i n /Amino acid' Amino a c i d composition (mol%) from: DNA sequence Amino a c i d a n a l y s i s A l a 19.7 19.4 Arg 0.7 1.0 Asn 5.8 Asp 5.1 10. 9 a Cys 0.0 NDb Gin 1. 9 Glu 0.8 3. 9 C Gly 12 . 0 12 .7 His 0.2 0 . 4 H e 3.8 3 . 8 Leu 7 . 4 7.9 Lys 1.0 0.9 Met 0.3 0 . 4 Phe 3.0 3.0 Pro 0.7 1.0 Ser 7.3 6.7 Thr 18.5 17 . 6 Trp 0.1 NDC Tyr 1. 4 1.6 V a l 9.1 9.0 a T o t a l Asn plus Asp; t o t a l from DNA sequence i s 10.9. b ND, Not determined. For the c a l c u l a t i o n s t h i s value was set to 0. c T o t a l Gin plus Glu; t o t a l from DNA sequence i s 2.7. 39 glutamates. Some variation from the combined pattern was not unexpected; the size of the rsaA coding sequence reported here is 30% of the combined size of the previously published C. crescentus CB15 coding regions noted in Table II. Predicted rsaA transcription terminator. The 3' end of the gene was followed by a palindrome coding for a predicted stem loop of 38 bases, with a perfect stem of 17 bp in length, a loop of 4 bases, and a calculated free energy of -27 kcal. The last five nucleotides in the stem and the adjoining five 3' nucleotides include a relatively rich deoxyribosylthymine region (70%), typical of factor-independent transcription termination signals (Watson et al. 1987). Although this 10 base region was not especially long (as compared to factor-independent termination regions in other species), it is clearly atypical when compared to the high G+C content of surrounding sequence and Caulobacter crescentus D N A in general. The mRNA size indicated by this predicted termination site (about 3.2 Kb) compares well with that determined by Northern analysis (3.3 Kb) (Fisher et al. 1988). Problems with subcloning of the S-layer gene from CB15A and CB15ACalO and with sequencing template generation. Subcloning fragments the regular surface array gene often presented problems related to tolerance of the gene by E. coli even though the promoter of the gene is not recognized by E. coli (Fisher et al. 1988). When the intact 130K gene was transcribed, 40 < TABLE I I . Codon u s a g e i n rsaA. .and t e n o t h e r C a u l o b a c t e r g e n e s . rsaA O t h e r 3 R e l . f r e q . b r s a A O t h e r 3 R e l . % b A l a GCC 103 300 0.61 Leu CTC 10 58 0 . 19 GCG 39 114 0.23 CTG 64 183 0 . 70 GCT 61 29 0.14 CTT 0 19 0 . 05 GCA 0 8 0.01 CTA 0 3 0. .01 TTG 2 15 0 . 05 Asn AAC 57 111 0.87 TTA 0 0 0. .00 AAT 3 23 0.13 Lys AAG 11 129 0 , .93 Asp GAC 49 172 0.81 AAA 0 11 0. .07 GAT 4 49 0.19 Met ATG 4 63 1 . 00 A r g CGC 8 97 0 .57 CGG 0 44 0.24 Phe TTC 31 78 0 . 88 CGT 0 20 0.11 TTT 0 15 0. .12 CGA 0 11 0.0 6 AGG 0 3 0.02 P r o CCC 0 58 0 . 36 AGA 0 1 0.01 CCG 7 78 0 . 53 CCT 1 16 0 . 11 Cys TGC 0 14 0.93 CCA 0 1 0 . 01 TGT 0 1 0.07 S e r TCC 2 45 0 .14 G i n CAG 10 109 0.83 TCG 52 117 0 . 50 CAA 10 15 0.17 ..... TCT 3 10 0 . 04 TCA 0 6 0 . 02 G l u GAG 1 84 0 . 62 AGC 18 78 ' 0 . .28 GAA 9 44 0.38 AGT 0 6 0 . 02 G l y GGC 95 271 0 .77 T h r ACC 112 185 0 . 63 ' GGG 0 38 0.08 ACG 76 83 0 . 34 GGT 29 30 0.12 ACT 2 7 0 . 02 GGA 0 13 0.03 ACA 0 6 0 . 01 H i s CAC 3 30 0.80 T r p TGG 2 24 1. . 00 CAT 0 8 0.20 T y r TAC 11 43 0 . 63 l i e ATC 40 141 0.96 TAT 4 28 0 . 37 ATT 0 8 0.04 ATA 0 0 0.00 V a l GTC 46 156 0 . 55 GTG 35 94 0 . 35 GTT 13 21 0 . 09 GTA 0 5 0 . 01 a Total number of times a codon appears in 3419 codons from ten Caulobacter gcncsiflaD, flaE, flaY, trpF, trpB, trpA,fla],flaK, sodA, and flaF (Schoenlein and Ely, 1990). Relative synonymous codon usage frequency determined from data in previous two columns. The numbers in bold type indicate the frequency of occurrence of the preferred codon of a synonymous codon group. 41 apparently from the lac promoters in pTZ vectors, inclusion bodies could be readily seen by phase contrast microscopy (data not shown). Bacteria containing these construct plasmids formed colonies that grew more slowly than those with just plasmid vectors. When these bacteria were used for both single stranded and double stranded sequencing template production, D N A yields were very low and were found to be unusable as for sequencing. When these inserts were cloned in reverse orientation to the lac promoter or out of frame with respect to the lac (3-galactosidase fragment in pUC-type plasmids, the problem was not alleviated. When the 5' region of the gene to the Clal site was removed, similar difficulties were encountered. Other constructs, including the Clal to Pstl fragment and the 2346 bp internal Bell fragment (Fig. 6), also behaved in the unexpected manner above. Sequencing templates from M l 3 constructs carrying the full length genes (even in hsdR and recA hosts) would frequently be missing specific regions of the insert. Template generated from M l 3 clones would usually be heterogeneous in nature due to deletions, with different insert sizes resulting in shadow bands from sequencing gels. This problem persisted even when great care was taken to pick single plaques and when incubation times were kept to a minimum. When double stranded sequencing was turned to as an alternative, D N A from large scale plasmid preparations was used as template. Strangely, resulting sequencing gel films had bands across all four lanes for any given set of reactions, corresponding to every possible nucleotide position, as if 42 all four termination mixes had been added to each reaction. Double stranded sequencing was repeated using further purified D N A from CsCl-EtBr gradients and purified by the Bio-Rad Prep-a Gene system, but the problem remained. Finally the mini P E G precipitation method of Kraft et al. (1988) was used, but without success. It may be that within the 2346 bp BeII fragment there is a fortuitous site of transcription initiation which E. coli recognized and consequently a gene product was made that E. coli found toxic in high amounts. When present in high copy number this problem was exacerbated. During incubation times necessary for sequencing template production, genetic deletions would occur in some of the constructs. The resulting mutants would grow faster than the original clones, later accounting for a heterogeneous mix of prepared template, which when used, lead to shadow bands and unreadable gels. These problems may have also been responsible for the failure of the double stranded sequencing techniques. However, chemical contamination of the mixes and/or nicking of the plasmids may have been additional factors. For sequencing purposes this was overcome by subcloning smaller fragments (Fig. 6), in reverse orientation to the lac promoter. Subclones of the S-layer gene from CB15ACalO behaved in an identical manner to those of CB15A. 4 3 Primary structure analysis of the predicted amino acid sequence. General analysis. The rsaA gene was 3081 nucleotides long, coding for a polypeptide of 1026 amino acids. As previously reported (Fisher et al. 1988), there was no indication of a cleaved signal leader peptide; only the N-terminal methionine is absent in the mature protein. The predicted amino acid composition derived from D N A sequence matched closely with the amino acid profile derived from purified S-layer protein (Table I), with the exception of the combined score for glutamate and glutamine, which direct amino acid analysis underestimated by 1.2%. It is, however, not uncommon for the amino acid analysis technique to under-represent these amino acids, due to degradation during acid hydrolysis (K. Walsh, personal communication). Peptide analysis. Amino acid sequencing of peptides from the 130K protein revealed two sequences that aligned to the translation of the rsaA nucleotide sequence. One peptide yielded a sequence of 15 amino acids which aligned with the region corresponding to amino acids 647 to 661 (Fig. 7). The other peptide yielded a sequence that was six amino acids long, the first five of which aligned to the end of the predicted 130K protein sequence. The sixth residue, a glycine, is one of the most common contaminants to occur in amino acid sequencing and can be scored as the next amino acid in cases where the sequenator has in fact reached the 3' end of a peptide. The amino 44 acid 5' to the start of this peptide (glutamate) was a predicted site for V8 protease cleavage and there was no other comparable alignment within the protein or within a translation of the other two reading frames. Thus, it is likely that the five amino acid sequence represented the entirety of the protease-cleaved peptide. The presence of this peptide confirmed that the the predicted stop codon was in fact the one used for termination of 130K. Moreover, the derivation of this peptide from a mature 130K protein indicated that no post-translational processing from the 3' end of the protein was likely. Cleavage of peptides from the 3' end is apparently part of the mechanism of excretion used in some other bacterial exported proteins (Wandersman 1989); this is not the case for 130K. Since it was demonstrated in previous studies that beyond the removal of the initial methionine residue there is no processing of the 5' terminal (Fisher et al. 1988), it appears for the 130K protein that post-translational cleavage of peptides is not part of the mechanism of protein export. The 130K protein is in this sense comparable to the hemolysins and metalloproteinases which are cleaved after secretion if at all (Ludwig et al. 1988; Wandersman 1989). Specific amino acid abundance and implications. The predicted 130K protein sequence was very low in sulfur-containing amino acids (and had no cysteine residues [Table III]) as is the case with other S-layer proteins. The predicted 130K protein sequence contained an unusually high proportion of small neutral amino acids (threonine, asparagine, serine, glycine, alanine, and 45 TABLE III. Characteristics of S-layers proteins including secondary structure deduced from DNA sequence of cloned genes. Cleaved Percent of Organism of Conformation • N-terminal Predicted Number threonine Percent of residues in S-layer protein of S-array Number of signal isoelectric Of and Specified conformation origin lattice • Residues3 sequence*3 pointc cysteines0 • c d serine ' Helical Extended, Turn Coil Caulobacter crescentus hexagonal 1026 no 3, .46 0 25. 8 25 .0 58 . 7' 2 .3 13 . 8 Campylobacter fetus* hexagonal 933 ro . 4. .55 1 21. 3 39 .3 46 .3 6 . 5 7 . 8 Rickettsia prowazckifi tetragonal 1612 no 4. .85 3 17 . 4 16 , .2 62, .7 7 .3 13.7 Aeromonas salmonicida^ tetragonal • 502 21 a.a. 4 . 79 0 15. 2 36 , .2 45 , , 5 8 , .5 9.5 Bacillus sphaericus1 tetragonal 1176 3 0 a.a. 4 . 69 0 18 . 5 56 , , 8 32 , . 9 2 ,  6 7.5 Deinococcus radiodurans^ hexagonal 1036 yes 4. .54 7 19. 6 12 , .8 67 , .7 8 , .3 11.1 Acetogenium kivui k hexagonal 762 2 6 a.a. 4 , .75 0 14. 5 29 , .2 58 , . 8 6 . 6 . 5.2 Rickettsia rickettsii^ tetragonal 1299 ? 5, .30 2 17 . 7 17 , . 6 62 , , 9 5, . 8 13.5 Halobacterium halobiumm hexagonal 852 3 4 a.a. 3. .21 0 19. 7 27 . . 6 46 , 2 11, ,0 15.8 Bacillus brevis OWP n hexagonal 1004 2 4 a.a. 4 , .49 0 16. 4 42 . . 1 42 , . 4 5 , 9 9.4 Bacillus brevis MWP° hexagonal 1053 2 3 a.a. 4 . 28 0 11. 6 56, ,2 27 , , 8 7 . ,5 8.3 a Number of predicted amino acid residues from DNA sequence. b If N-terminal signal sequence length is known it is indicated by the number of amino acids. c Values from the mature protein where cleavage site is known (ie. after signal cleavage but not accounting for possible C-terminal cleavage of the Rickettsial S-layers)': otherwise full precursors as predicted from DNA sequence. d The percentage of serine and threonine out of the total number of amino acid residues within the S-layer protein. c By the method of Gamier (16). 1 Blaser and Gotschlich 1990. & Carl et al. 1990. h Chu et al 1991. ' Bowditch et al. 1989. J Peters et al. 1987. k Peters et al. 1989. 1 Gilmour et al. 1989. mLechnerand Sumper 1987. nTsuboi et al. 1986.. °Tsuboi et al. 1988. 46 valine). Necessarily, higher mass amino acids were in lower abundance. This results in the mature protein having a low predicted molecular mass of 98,001 daltons for its 1025 amino acid length, and an average amino acid mass of only 95.6 daltons. The C-terminal of the Deinococcus radiodurans S-layer (HPI) protein has a high proportion of aromatic amino acids. Although not as pronounced in the 130K protein, the first and last thirds of the 130K protein contained most of the aromatic residues. One striking feature of the 130K protein was that fully 25.8% of the residues were threonine or serine. This was mainly due to a high abundance of threonine, accounting for 18.5% of the 130K residues. Other sequenced S-layers also contain higher than normal proportions of hydroxylated amino acids (Table III), ranging from 11.6% up to 21.3% in the surface array protein of Campylobacter fetus. The hexagonal arrays of Halobacterium halobium and Deinococcus radiodurans are also close to the top of this range. Moreover, these two S-layer proteins are glycosylated, quite possibly at selected serines and threonines (Lechner and Sumper 1987; Peters et al. 1987). Glycosylation of the 130K protein has not yet been detected, although it has not been rigorously ruled out. S-layers, possibly being the outermost layers of the cells, may be heavily hydroxylated for a functional role analogous to the glycosidic residues of the lipopolysaccharide. If S-layers block the exposure of LPS to the environment, they may compensate for this loss of presented hydroxylated groups by presenting them themselves. A hydroxylated outer surface may play an important role in presenting 47 a relatively hydrophilic surface to the world. A l l charged amino acids except for aspartate were in low abundance, resulting in a net negative charge of -40 at pH 5.6 and a pi of 3.46. This value is unusually low for a protein; however other S-layer proteins also have acidic pis, mainly ranging from about 3 to 5.5 (Table III) and the predicted pi for the cell surface glycoprotein of Halobacterium halobium, after cleavage of the signal and without glycosylation, is only 3.21 (Table III). Although aspartate was not more prevalent than in an average protein (5.2% of 130K residues), because of the low amount of other charged amino acids, it accounted for 63% of all charges and 85% of the negative charges in the 130K. The net negative charge of the 130K probably plays an important role in attachment of the S-layer to the cell or subunit-subunit interactions. There is evidence that both interactions are mediated specifically by calcium cations. It is possible that aspartate residues in key positions within the folded protein enable attachment via calcium bridging, either to another 130K molecule or to an oligosaccharide of the cell envelope implicated in STayer attachment. The regions of homology with other calcium-requiring proteins (discussed below) add significant support to this hypothesis. Predicted protein secondary structure analysis. Protein secondary structure predictions were made using several analysis programs. No long stretches of a-helix or (3-pleated sheets were readily obvious. The secondary structure prediction methods of Gamier, Osguthorpe, and Robson (Gamier et al. 1978), 48 and G G B S M (Gascuel and Golmard 1988) gave somewhat contradictory predictions, although both claim a success rate of 56 to 59%. Respectively, they predicted 25% helical, 59% extended, 2% turn, 14% coil (Table III), and 29% helical, 26% extended and 45% coil. Based on secondary structure predictions by the Gamier method for all the S-layers with known amino acid sequence, as predicted from nucleic acid sequence, the 130K secondary structural predictions are entirely average (Table III). Circular dichroism estimates of the secondary structures of other S-layers (most of unknown sequence) would indicate that S-layers in general may have lower levels of cx-helical structure (<2-19%) and P-structure (20-44%) and a higher level of aperiodic (random coil) structure than indicated by the above Gamier predictions (Baumeister et al. 1982; Bingle et al. 1986; Dooley et al. 1988; Koval 1988; Phipps et al. 1983). The 130K protein is fully secreted to the exterior of the cell and the S-layer assembles on the surface of the outer membrane and indeed can self-assemble with no membrane present (Smit et al. 1981a). Thus integral membrane spanning regions, one of the secondary structures which predictive methods are able to identify, were not expected to be present. The 130K protein sequence was also evaluated for specific structures including helical wheels. These regions of a-helix with a predominance of hydrophobic residues on one side of the helix and hydrophilic residues on the other are known to have a role in the export of some proteins, including the hemolysins (Koronakis et al. 49 1989), to which 130K shares some homology. The region from amino acids 130 to 145 fulfilled some of the criteria established for such a helical wheel, but based on current published information was judged inadequate to suggest that function with confidence. Helical wheels often interact in pairs and there was no nearby sequence to the above indicated region that looked likely to form such a structure. Indeed, how 130K is exported remains unknown. It has no cleaved signal leader peptide (Fisher et al. 1988). Moreover, our recent studies involving fusions between rsaA and a cellulase reporter gene indicated that the initial amino acids did not function as a signal leader equivalent (Wade Bingle and John Smit unpublished). The data reported here indicate that 3' cleavage does not occur during export. It is likely that other proteins (perhaps 'chaperones') are involved with facilitating particular stages of export as has been described for the hemolysins (Blight and Holland 1990) and Erwinia chrysanthemi metalloprotease B (Delepelaire and Wandersman 1989). Protein homology scans. Using the P C / G E N E sequence analysis program F S T P S C A N to search the Swiss Prot release 17 for homologous sequences to the 130K protein, many small areas (17-34 amino acids) of identity were identified within several proteins. Most of these proteins were exported or structural proteins including the hexagonally-packed intermediate S-layer protein of Deinococcus radiodurans. This 50 TABLE IV. Homology between 130K and several surface layer proteins. Organism and protein % i d e n t i c a l a % s i m i l a r b Campylobacter fetus surface array protein 24.0 16.6 Rickettsia prowazekii surface protein antigen 21.4 19.5 Aeromonas salmonicida surface virulence A-protein 20.0 17.5 Bacillus sphaericus 125 kDa S-layer protein 18.3 19.7 Deinococcus radiodurans HPI-layer surface protein precusor 18.0 16.4 Acetogenium divui S-layer protein precursor 17.8 15.6 Rickettsia rickettsii 120 kD surface-exposed protein 17.5 14.6 Halobacterium halobium cell surface glycoprotein precursor 16.0 17.5 Bacillus brevis outer wall protein precursor 15.0 16.1 Bacillus brevis middle wall protein precursor 14.3 13.1 Alignments performed by the PC/GENE program PALIGN using the structure-genetic matrix and an open gap cost of 7 and a unit gap cost of 2. a %identical indicates the percentage of identical amino acid pairs in aligned sequences. %similar indicates the percentage of conservatively similar amino acid pairs in the aligned sequences. Amino acids said to be similar are: A,S,T; D,E; N,Oj R,K; I,L,M,V; F,Y,W. 51 program was useful in identifying proteins for further testing with the P C / G E N E program PALIGN. Using PALIGN it was possible to establish that 130K protein had a reasonable degree of homology with other S-layer proteins (Table IV), although it showed that 130K was not closely related to most of them. The Campylobacter fetus surface array protein showed the greatest similarity to the 130K protein, with 24% identity and 16.6% conservative substitution. One factor possibly limiting the degree of homology between 130K protein and other S-layer proteins is that at the present there is only one other hexagonal array in a gram-negative bacterium, Campylobacter fetus 23D surface array protein (Sleytr and Messner 1988a), for which protein sequence is available. The lattice arrangement of the S-layer protein from Campylobacter fetus VC119 is tetragonal (oblique [Dubreuil et al. 1990]); it should be interesting to compare the sequence of this S-layer, if it becomes available, with that of the hexagonal array S-layer protein from strain 23D. It may be possible that even though they arrange into different lattice conformations, they are closely related in sequence. Using the F A S T A program, the 120kD surface exposed protein of Rickettsia rickettsii was found to match better to 130K than all other S-layer proteins on the Swissprot 15. Most S-layer proteins including the Campylobacter fetus protein are not to be found on this release, however it was the most recent version that was accessible through the F A S T A program. The F A S T A program was useful for representing homology in a different way from the 52 P A L I G N program. Whereas PALIGN will give homology scores for entire regions of homology the F A S T A program will select the most favorable regions of homology within the proteins and give identity and similarity scores for these specific regions. Thus the F A S T A program was able to indicate specific regions of interest within the 130K protein that were homologous to specific regions of other proteins. One such region, the N-terminal of 120kD protein of Rickettsia rickettsii, scored 20% identity with a 457 amino acid stretch (Table V) of the 130K protein near the C-terminal. Matches to other exported and structural proteins were also found. One was a fragment of the apomucin gene from pigs (Timpte et al. 1988). This protein is made up of repeats of 81 residues and is rich in threonine, serine, glycine, and alanine, as is the 130K protein, accounting for the high degree of homology noted in Table V . Another match was with the C-terminal portion of the extracellular metalloproteinase precursor B of Erwinia chrysanthemi (Delepelaire and Wandersman 1989). There was 32% identity over a 129 amino acid overlap, including strong homology over a region with glycine-aspartate repeats. The same area of the 130K protein that matched the glycine-aspartate repeats in proteinase B matched a similar region in the extracellular metalloproteinase of Serratia marcescens, with 30.5% homology over 131 amino acids. This region of 130K protein also shared homology with similar regions from hemolysins (Devinish and Rosendal 1991; Ludwig et al. 1987). These glycine-rich repeat regions have been implicated in the binding of calcium. 53 TABLE V. 130K homology search of the Swiss Prot 15 sequence bank using FASTA. 3 Region in Region in Organism and protein %identicalb protein0 130Kd Rickettsia rickettsii 120 kD surface-exposed protein 20 1-459 541-998 Sws scrofa apomucin 20 1-434 240-672 Serratia marcescens 50kD metallo-protease precursor 31 327-457 844-969 Erwinia chrysanthemi protease B precursor 32 302-428 817-942 Bordetella pertussis adenylate cyclase-haemolysin 15 316-1067 154-907 Escherichia coli hemolysin A (plasmid) 16 76-428 106-459 Actinobacillus pleuropneumononiae hemolysin 30 713-815 830-936 a Alignments performed by the FASTA program after searching the Swiss Prot release 15 using a k-tuple value of 2. b %identical indicates the percentage of identical amino acid pairs in aligned sequences. c The stretch of amino acids in the protein homologous to an area of the 130K protein. d The stretch of amino acids in the 130K protein homologous to an area in the protein. 54 Possible calcium binding region of the 130K protein. Calcium is known to be a factor in the maintenance of the C. crescentus S-layer (Smit et al. 1981b). Calcium has a specific and essential role in attachment of the S-layer to the cell surface and may be involved with subunit-subunit interactions. A model has been proposed, by John Smit, whereby calcium acts as a divalent cation mediating surface attachment by ionic bridging between the S-layer and a specific membrane-associated oligosaccharide (S. A. O. [Fig. 8]). Such a model predicts that specific regions of the 130K protein must be adapted to interact with calcium ions to accomplish the bridge interaction. The current hypothesis proposes that glycine-aspartate repeat regions in fact serve that function. These regions may also be involved in surface array subunit-subunit interactions; that is calcium may facilitate binding of one S-layer molecule to another. In the cases of the hemolysins from E. coli and Pasteurella hemolytica, calcium is required for biological activity and is related to the presence of glycine-rich repeat regions (Devinish and Rosendal 1991; Ludwig et al. 1987). The glycine-rich repeats are usually nine amino acids in length (Table VI). They contain conserved aspartates usually separated by 8 amino acids and include a high proportion of glycine residues, which can participate in p-turns. These sharp turns may allow the aspartates to be positioned in a group orientation so as to allow the binding of calcium ions. It has been proposed that three successive nonapeptide repeat units can form finger-like loop 55 calcium ion 130K monomer S A O molecule Fig. 8. A model to describe the roles of 130K protein, calcium and specific membrane-associated oligosaccharide (S. A. O.) by John Smit. Part A schematically diagrams a possible arrangement in wildtype CB15A while part B diagrams possible arrangements for the calcium independent mutant CB15ACalO. Negative charges on the S-layer molecule, possibly aspartates, bind to a calcium which also binds another S-layer molecule or the S. A. 0. In the CB15ACalO case, the S. A. O. molecule is either not present in the outer membrane or it is greatly reduced. Surface array then forms in the media as a single layer or a double layer. Recent 3-D reconstruction data (Smit and Baumeister unpublished) would indicate that the shed surface array is more likely a double layer with calcium bridging together two arrays instead of one array and S. A. O. molecules. 56 T A B L E VI. Comparison of consensus sequences for putative Calc ium binding regions Organism and protein Consensus sequences for glycine rich repeats 3 Escherichia coli hemolysin X L X G g/x X G n /d D Bordetella pertussis adenylate cyclase-haemolysin t /x L X G G d / x G d / x D Erwinia chrysanthemi protease B X L X G G X G X D Serratia marcescens 50kD metallo-protease X L X G G A G X D Caulobacter crescentus 130K T 1/x t /x G G A G A D a T h e consensus sequences for putative calcium binding, glycine-rich repeats are shown using the single letter amino acid code, wi th X denoting no preference for one particular amino acid. A n uppercase letter indicates that the residue occurs more than 50% of the time in that posit ion for a given repeat in that protein. Lowercase letters indicate the residue is preferred over others i n that position but occurs less than 50% of the time there. 57 structures, thereby generating an octahedral calcium binding site (Ludwig et al. 1987). These regions are also found in metalloproteases stabilized by calcium ions (Delepelaire and Wandersman 1989). There may be a similar role for the corresponding region in 130K (Fig. 7). This region contains four or possibly five glycine-aspartate repeats, compared to nine and eleven to sixteen reported in Actinobacillus pleuropneumoniae and E. coli hemolysins (Devinish and Rosendal 1991; Ludwig et al. 1987). The protease B of Erwinia chrysanthemi, however, contains only six reported repeats and the zinc metalloprotease of Serratia marcescens contains only three (Delepelaire and Wandersman 1989, Nakahama et al. 1986). Both proteins are also stabilized by calcium ions (Delepelaire and Wandersman 1989). Sequencing of the regular surface array gene from the calcium independent mutant CB15ACalO. Sequencing of the regular surface array gene of the calcium independent mutant CB15CalO from the Clal site to the end of the gene indicated no difference between the rsaA gene of CB15CalO and that of CB15A. This result is puzzling as previous work, indicated that a defect was present in the region of the protein 3' to the unique Clal site (ie. the last 82% of the gene). CB15ACalO (phenotype explained above) was isolated as a calcium independent mutant by John Smit. Successive subculturing of CB15A cells on calcium deficient MjoHiGG so\[^ medium resulted 58 in about 1 in 106 cells forming colonies, relative to the plating efficiency on P Y E medium. These mutants shed their S-layers as described above. One of these mutants, CalO, was randomly selected for further experiments. In experiments performed by Patti Edwards, an attempt to localize a potential mutation in the rsaA gene of CalO, the regions to either side of the Clal site (Fig. 6) were switched between the CB15A and the CB15ACalO S-layer genes, in effect making mix-matched hybrid genes. When the hybrids were put into CB2A, a non S-layer-producing strain, then the hybrid with the back (3') 82% of the gene from CalO made S-layer that appeared to cover the bacterium in a patchy fashion when examined by electronmicroscopy. The other hybrid produced S-layer which appeared to fully cover the cell, as wildtype. The results of this experiment were not entirely clear and it was determined that the experiment should be repeated in a more stringent manner. Again the same patchy labelling was indicated in most of the bacteria examined. However, in later experiments, these hybrid constructs were put into C B 1 5 A K S A C , an S-layer gene knockout mutant, and there was no noticeable difference between the clones carrying each hybrids: both produced apparently normal S-layers. To explain these data it was hypothesized that the rsaA from CalO was a mutant gene. It was also proposed that because the mutation was compensated for in the CB15A background but not in the CB2A, the interacting molecules in the C B 2 A were slightly different. Sequencing of the gene, as described above, was then attempted in 59 order to find the mutation in the mutant gene. The CalO S-layer protein, as was the case with all other S-layers from calcium independent mutants, did not run any differently with respect to polyacrylamide gel electrophoresis than 130K from wildtype. Also, all subcloned fragments of the rsaA gene (Fig. 6) from CalO appeared to be identical to the corresponding wildtype A19 fragments in size as estimated from agarose gel electrophoresis. These data suggested that if a mutation in the S-layer gene of CalO were present, it was likely a point mutation or a small deletion which resulted in a minor change to the amino acid sequence. Since the "mix-match" experiments Steven Walker has examined the lipopolysaccharide of these Caulobacters. In every investigated case where the S-layer is shed, including CalO, he has found that the bacteria lack a specific membrane-associated oligosaccharide (S. A. O.) that is present on wild type cells. This molecule is therefore a potential candidate for the attachment site of the S-layer molecule (Fig. 8). This arrangement would be similar to that of Aeromonas salminocida where the outer membrane O-polysaccharide (part of a unique-length smooth LPS) probably binds the S-layer protein to the cell (Griffiths and Lynch 1990). For the mix-match experiments to be explained, the CalO mutant must therefore be a double mutant with one mutation preventing the formation or transfer of S.A.O. to its proper position. One must also propose that the S.A.O. of CB2A is slightly different from that of CB15 because the S.A.O. of CB2A will not compensate for the second 60 mutation: that is a mutation in the last 82% of the S-layer gene. Unfortunately, no second mutation was identified by sequencing, and this would appear to be in conflict with the mix-match experiments. 61 REFERENCES Agabian, N . , Evinger, M . , and Parker, G. 1979. Generation of asymmetry during development. Segregation of type-specific proteins in Caulobacter. J. Cell Biol. 81: 123-136. Anast, N. , and Smit, J. 1988. Isolation and characterization of marine caulobacters and assessment of their potential for genetic experimentation. Appl. Environ. Microbiol. 54: 809-817. Atkinson.T., and Smith, M . 1984. Solid-phase Synthesis of Oligodeoxyribonucleotides by the phosphite-triester method in Oligonucleotide Synthesis: A practical approach. Edited by M . J. Gait. IRL Press, Oxford, pp 35-81. Bagdasarian, M , Lurz, R., Ruckert, B., Franklin, F. C. H . , Bagdasarian, M . M . , Frey, J. , and Timmis, K. N. 1981. Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSFlOlO-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16: 237-247. Barany, F. 1985. Single-stranded hexameric linkers: a system for in-phase insertion mutagenesis and protein engineering. Gene 3 7 : 111-123. Baumeister, W., Karrenberg, F., Racher, R., Engel, A. , Ten Heggeler, B., and Saxton, W. O. 1982. The major cell envelope protein of Micrococcus radiodurans (Rl) . Structural and chemical characterization. Eur. J. Biochem. 125: 535-544. Baumeister, W., Wildhaber, I., and Engelhardt, H . 1988. Bacterial 62 surface proteins. Some structural, functional and evolutionary aspects. Biophys. Chem. 29: 39-49. Beveridge, T. J. , and Murray, R. G. E . 1976. Dependence of the surperficial layers of Spirillum putridiconchylium on C a 2 + and S r 2 + . Can. J. Microbiol. 22:1233-1244. Bio-Rad Laboratories. 1989. Bacterial Electro-transformation and Pulse Controller Instruction Manual. Version 2-89. Bingle, W. H. , Doran, J. L . , and Page, W. J. 1986. Characterization of the surface layer protein from Azotobacter vinelandii. Can. J. Microbiol. 32: 112-120. Bingle, W. H . , and Smit, J. 1990. High-level expression vectors for Caulobacter crescentus i n c o r p o r a t i n g the transcription/translation init iat ion regions of the paracrystalline surface-layer-protein gene. Plasmid 24: 143-149. Birnboim, H .C . and Doly, J. 1979. A rapid extraction procedure for screening recombinant plasmid DNA. Nucl. Acid Res. 7: 1513-1524. Blaser, M . J. , and Gotschlich, E . C. 1990. Surface array protein of Campylobacter fetus: cloning and gene structure. J. of Biol. Chem. 265: 14529-14535. Blight, M . A. , and Holland, I. B. 1990. Structure and function of haemolysin B, P-glycoprotein and other members of a novel family of membrane translocators. Mol. Microbiol. 4:873-880. Bowditch, R. D., Baumann, P., and Yousten, A. A. 1989. Cloning and sequencing of the gene encoding a 125-kilodalton surface-layer 63 protein from Bacillus spaericus 2362 and of a related cryptic gene. J. Bacteriol. 171: 4178-4188. Brent, R., and Ptashne, M . 1980. The lexA gene product represses its own promoter. Proc. Natl. Acad. Sci. USA 77: 1932-1936. Carl, M . , Dobson, M . E . , Ching, W. M . , and Dasch, G . A. 1990. Characterization of the gene encoding the protective paracrystalline-surface-layer protein of Rickettsia prowazekii: presence of a truncated identical homolog in Rickettsia typhi. Proc. Natl. Acad. Sci. USA 87: 8237-8241. Conchas, R.F., and Carniel, E . 1990. A highly efficient electroporation system for transformation of Yersinia. Gene 87: 133-137. Chu, S., Cavaignac, S., Feutrier, J., Phipps, B. M . , Kostrzynska, M . , Kay, W. W., and Trust, T. J. 1991. Structure of the tetragonal surface virulence array protein and gene of Aeromonas salmonicida. In press, J. Biol. Chem. Delaney, A. D., 1983. A DNA sequence handling program. Nucl. Acid. Res. 10: 61-67. Delepelaire, P., and Wandersman, C. 1989. Protease secretion by Erwinia chrysanthemi. J. Biol. Chem. 264: 9083-9089. Devinish, J., and Rosendal, S. 1991. Calcium binds to and is required for biological activity of the 104-kilodalton hemolysin produced by Actinobacillus pleuropneumoniae serotype 1. Can. J. Microbiol. 37: 317-321. Dooley, J. S. G., McCubbin, W. D., Kay, C. M . , and Trust, T. J. 1988. Isolation and biochemical characterization of the S-layer protein from a pathogenic Aeromonas hydrophila strain. J. 64 Bacteriol. 1 7 0 : 2631-2638. Dower, W. J. , Miller, J. F., and Ragsdale, C. W. 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16: 6127-6145. Dubreuil, J. D., Kostrzynska, M . , Austin, J. W., and Trust, T. J. 1990. Antigenic Differences among Campylobacter fetus S-Layer Proteins. J. Bacteriol. 1 7 2 : 5035-5043. Ely, B., and Croft, R. H. 1982. Transposon mutagenesis in Caulobacter crescentus. J. Bacteriol. 1 4 9 : 620-625. Ely, B. , and Johnson, R. C. 1977. Generalized transduction in Caulobacter crescentus. Genetics 8 7 : 391- 399. Farinha, M . A . , and Kropinski, A . M . 1990. High eeiciency electroporation of Pseudomonas aeruginosa using frozen cell suspensions. FEMS Microbiol. Lett. 7 0 221-226. Fisher, J.A., Smit, J., and Agabian, N. 1988. Transcriptional analysis of the major surface array gene of Caulobacter crescentus. J. Bacteriol. 1 7 0 : 4706-4713. Gamier, J. , Osguthorpe, D. J. , and Robson, B. 1978. Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J. Mol. Biol. 1 2 0 : 97-120. Gascuel, O., and Golmard, J. L . 1988. A simple method of predicting the secondary structure of globular proteins: implications and accuracy. CABIOS 4: 357-365. Gilmore Jr., R. D., Joste, N. , and McDonald, G. A. 1989. Cloning, expression and sequence analysis of the gene encoding the 65 120kD surface-exposed protein of Rickettsia rickettsii. Mol. Microbiol. 3: 1579-1586. Griffiths, S. G . , and Lynch, W. H . 1990. Characterization of Aeromonas salmonicida variants with altered cell surfaces and their use in studying surface protein assembly. Arch. Microbiol. 154: 308-312. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166: 557-580. Hanahan, D. 1985. Techniques for transformation of E. coli, p. 109-114. In D. M . Glover (ed.), DNA Cloning Techniques: A Practical Approach. Volume 1, IRL Press, Oxford. Holmes, D.S. and Quigley, M . 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114: 193-197. Jacobs, M . , Wnendt, S., and Stahl, U . 1990. High-efficiency electro-transformation of Escherichia coli with D N A from ligation mixtures. Nucl. Acids Res. 18: 1653. Koronakis, V . , Koronakis, E . , and Hughes, C. 1989. Isolation and analysis of the C-terminal signal directing export of Escherichia coli hemolysin protein across both bacterial membranes. E M B O J. 8:595-605. Koval, S. F., and Murray, R. G. E . 1984. Isolation of surface array proteins from bacteria. Can. J. Biochem. Cell. Biol. 62: 1181-1189. Koval, S. F. 1988. Paracrystalline protein surface arrays on bacteria. Can. J. Microbiol. 34: 407-414. 66 Kraft, R., Tardiff, J. , Krauter, K. S., and Leinwand, L . A. 1988. Using mini-prep plasmid D N A for sequencing double stranded templates with Sequenase. BioTechniques 6: 544-546. Lechner, J . , and Sumper, M . 1987. The primary structure of a procaryotic glycoprotein. Cloning and sequencing of the cell surface glycoprotein gene of Halobacteria. J. Biol. Chem. 262: 9724-9729. Liebl, W., Bayerl, A. , Schein, B., Stillner, U . , and Schleifer, K. H. 1989. High efficiency electroporation of intact Cory neb acterium glutamicum cells. FEMS Microbiol. Lett. 65: 299-303. Luchansky, J. B. , Muriana, P. M . , and Klaenhammer, T. R. 1988. Application of electroporation for transfer of plasmid D N A to Lactobacillus, Lactococcus, Leuconostoc, Listeria, Pediococcus, Bacillus, Staphylococcus, Enterococcus and Propionibacterium. Molec. Microbiol. 2: 637-646. Ludwig, A . , Jarchau, T., Benz, R., and Goebel, W. 1988. The repeat domain of Escherichia coli haemolysin (HlyA) is responsible for its Ca2+ -dependent binding to erythrocytes. Mol . Gen. Genet. 214: 553-561. MacRae, J. D., and Smit, J. 1991. Characterization of caulobacters isolated from wastewater treatment systems. Appl. Environ. Microbiol. 57: 751-758. Mersereau, M . , Pazour, G . J . , and Das, A . 1990. Efficient transformation of Agrobacterium tumefaciens b y electroporation. Gene 90: 149-151. Miller, J. F. , Dower, W. J., and Tompkins, L . S. 1988. High-voltage electroporation of bacteria: Genetic transformation of Campylobacter jejuni with plasmid DNA. Proc. Natl. Acad. Sci. USA 85: 856-860. Mitchell, D. , and Smit, J. 1990. Identification of genes affecting production of the adhesion organelle of Caulobacter crescentus CB2. J. Bacteriol. 172: 5425-5431. Myers, E . W., Miller, W. 1988. Optimal alignments in linear space. CABIOS 4: 11-17. Nakahama, K. , Yoshimure, K. , Marumoto, R., Kikuchi, M . , Lee, I. S., Hase, T., and Matsubara, H. 1986. Cloning and sequencing of a Serratia protease gene. Nucleic. Acids Res. 14: 5843-5855. Newton, A. 1984. Temporal and spatial control of the Caulobacter cell cycle, p. 51-75. In P. Nurse and E . Streiblova (ed.s), Microbial Cell Cycle. CRC Press, Boca Raton, F L . O'Neill, E . A . , Kiely, G . M . , and Bender, R.A. 1984. Transposon Tn5 encodes streptomycin resistance in nonenteric bacteria. J. Bacteriol. 159: 388-389. Pearson, W. P., and Lipman, D. J. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. U S A 85: 2444-2448. Peters J . , Peters, M . , Lottspeich, F. , Schafer, W., and Baumeister, W. 1987. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies. J. Bacteriol. 169: 5216-5223. Peters, J., Peters, M . , Lottspeich, F., and Baumeister, W. 1989. S-layer 68 protein gene of Acetogenium kivui: cloning and expression in Escherichia coli and determination of the nucleotide sequence. J. Bacteriol. 171: 6307-6315. Phipps, B. M . , Trust T. J. , Ishiguro, E . E . , and Kay, W. W. 1983. Purification and characterization of the cell surface virulence A-protein from Aeromonas salmonicida. Biochemistry 22: 2934-2939. Poindexter, J.S. 1964. Biological properties and classification of the Caulobacter group. Bacteriol. Rev. 28: 231-295. Poindexter, J.S. 1981. The caulobacters: ubiquitous unusual bacteria. Microbiol. Rev. 45: 123-179. Sambrook, J. , Fritsch, E . , and Maniatis, T. 1989. Molecular cloning, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N . Y . Sanger, F. , Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. Schoenlein, P.V., Gallman, L . S., Winkler, M . E . , and Ely, B. 1990. Nucleotide sequence of the Caulobacter crescentus flaF and flbT genes and an analysis of codon usage in organisms with G+C-rich genomes. Gene 93:17-25. Schurter, W., Geiser, M . , and Mathe, D. 1989. Efficient transformation of Bacillus thuringiensis and B. cereus via electroporation: Transformation of acrystalliferous strains with a cloned delta-endotoxin gene. Mol. Gen. Genet. 218: 177-181. Scott, P. T . , and Rood, J. I. 1989. Electroporation-mediated 69 transformation of lysostaphin-treated Clostridium perfringens. Gene 82: 327-333. Shapiro. L . 1985. Generation of polarity during Caulobacter cell differentiation. Ann. Rev. Cell Biol. 1: 173-207. Simon, R., Priefer, U . , and Puhler, A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/technology 1: 784-790. Sinha, N . D., Biernat, J. , McManus, J. , and Koster, H . 1984. Polymer support oligonucleotide synthesis. XVIII: Use of b cyanoethyl-N , N-dialkylamino N-morpholino phosphoramidite of deoxynucleosides for the synthesis of D N A fragments simplifying deprotection and disolation of the final product. Nucl. Acids Res. 12: 4539-4557. Sleytr, U.B. , and Messner, P. 1988a. Crystalline surface layers on bacteria, p. 160-186. In U . B. Sleytr, P. Messner, D. Pum, and M . Sara (ed.), Crystalline bacterial cell surface layers. Springer-Verlag K G , Berlin. Sleytr, U.B. , and Messner, P. 1988b. Crystalline surface layers in procaryotes. J. Bacteriol. 170: 2891-2897. Smit, J. , Grano, D. A. , Glaeser, R. M . , and Agabian, N. 1981a. Periodic surface array in Caulobacter crescentus: Fine structure and chemical analysis. J. Bacteriol. 146: 1135-1150. Smit, J . , Hermodson M . , and Agabian, N . 1981b. Caulobacter crescentus pilin: Purification, chemical characterization and 70 the NH2-terminal amino acid sequence of a structural protein regulated during development. J. Biol. Chem. 256: 3092-3097. Smit, J . , and Agabian, N . 1982. Cell surface pattering and morphogenesis: Biogenesis of a periodic surface array during Caulobacter development. J. Cell Biol. 95: 41-49. Smit, J. , and Agabian, N. 1984. Cloning of the major protein of the Caulobacter crescentus periodic surface layer: Detection and characterization of the cloned peptide by protein expression assays. J. Bacteriol. 160: 1137-1145. Smit, J. 1986. Protein surface layers of bacteria. In Bacterial outer membranes as model systems. Edited by M . Inouye. John Wiley & Sons, Inc., New York. pp. 343-376. Summers, D. K. , and Withers, H . L . 1990. Electrotransfer: direct transfer of bacterial plasmid D N A by electroporation. Nucl. Acids Res. 18: 2192. Timpte, C. S., Eckhardt, A. E . , Abernethy, J. L . , and Hill, R. L . 1988. Porcine submaxillary gland apomucin contains tandemly repeated identical sequences of 81 residues. J. Biol. Chem. 263: 1081-1088. Tinoco, I., Borer, P. N., Dengler, B. D., Levine, M . D., Uhlenbeck, O. C , Crothers, D. M . , and Gralla, J. 1973. Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246: 40-41. Tsuboi A. , Uchihi, R., Tabata, R., Takahashi, Y . , Hashiba, H . , Sasaki, T., Yamagata, H . , Tsukagoshi, N . , and Udaka, S. 1986. Characterization of the genes coding for two major cell wall 71 proteins from protein-producing Bacillus brevis 47: complete nucleotide sequence of the outer wall protein gene. J. Bacteriol. 168: 365-373. Tsuboi A. , Uchihi, R., Adachi, T., Sasaki, T., Hayakawa, S., Yamagata, H. , Tsukagoshi, N . , and Udaka, S. 1988. Characterization of the genes for the hexagonally arranged surface layer proteins in protein-producing Bacillus brevis 47: complete nucleotide sequence of the middle wall protein gene. J. Bacteriol. 170: 935-945. Vieira, J . , and Messing, J. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153: 1-11. Wandersman, C. 1989. Secretion, processing and activation of bacterial extracellular proteases. Mol. Microbiol. 3: 1825-1831. Watson, J. D., Hopkins, N. H. , Roberts, J. W., Steitz, J. A. , and Weiner, A. M . 1987. Molecular biology of the gene. Fourth Ed. The Benjamin/Cummings publishing company Inc., Menlo Park, C A . Wirth, R., Friesenegger, A. , and Fiedler, S. 1989. Transformation of various species of gram-negative bacteria belonging to 11 different genera by electroporation. Molec. Gen. Genet. 216: 175-177. Wood, W. B. 1966. Host specificity of DNA produced by Escherichia coli: Bacterial Mutations affecting the Restriction and Modification of DNA. J. Mol. Biol. 16: 118-133. 72 A P P E N D I X Parameters involved in electroporation. Field strength, expressed in kV/cm, is a measurement of the voltage differential across the sample divided by the interelectrodal distance. The time constant (expressed in milliseconds [msec]) is the time it takes the peak voltage of an electroporation pulse, Vo, to decline to Vo/e, and is a way to express the pulse length. The pulse length can be modified in the apparatus by resistors in parallel to the electroporation cuvette, using the Pulse Controller. Modification of capacitance settings (expressed in pF), allows adjustment of the total quantity of current delivered to the electroporation cuvette. 73 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098433/manifest

Comment

Related Items