Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular genetic studies of the surface layer of caulobacter crescentus : nucleotide sequencing and… Gilchrist, Angus Robert 1991

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1991_A6_7 G54.pdf [ 4.07MB ]
Metadata
JSON: 831-1.0098433.json
JSON-LD: 831-1.0098433-ld.json
RDF/XML (Pretty): 831-1.0098433-rdf.xml
RDF/JSON: 831-1.0098433-rdf.json
Turtle: 831-1.0098433-turtle.txt
N-Triples: 831-1.0098433-rdf-ntriples.txt
Original Record: 831-1.0098433-source.json
Full Text
831-1.0098433-fulltext.txt
Citation
831-1.0098433.ris

Full Text

Molecular Genetic Studies of the Surface Layer of Caulobacter crescentus: Nucleotide Sequencing and Analysis of the Regular Surface Array Gene, and the Effect of Surface Layer and Other Variables on the Development of Electroporation for the Caulobacters By ANGUS ROBERT GILCHRIST B.Sc, University of British Columbia, 1988 A THESIS SUBMITTED LN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in T H E F A C U L T Y OF GRADUATE STUDIES (Department of Microbiology) We accept this thesis as conforming to the required standard  T H E UNIVERSITY OF BRITISH CO L UMB I A August 1991 © Angus R. Gilchrist, 1991  In  presenting this  degree at the  thesis  in  University of  partial  fulfilment  of  of  department  this thesis for or  by  his  or  requirements  British Columbia, I agree that the  freely available for reference and study. I further copying  the  representatives.  an advanced  Library shall make it  agree that permission for extensive  scholarly purposes may be her  for  It  is  granted  by the  understood  that  head of copying  my or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada  DE-6 (2/88)  ABSTRACT  The  regular  crescentus S-layer  surface  gene  (rsaA)  of  Caulobacter  codes for the 130K surface layer (S-layer) protein.  protein  sheaths the  forms  a  paracrystalline  bacterium and is  bacteria.  These  presented  array  in  studies  investigate In  the  to  two  first,  those of  aspects  the  of  effect  of  completely many the  other  S-layer on  electroporation  of Caulobacters is reported with the development  of  that technique  for the transformation of Caulobacters.  part  parts.  comparable  which  S-layer  interesting  two  array  This  Many  aspects to this procedure are also reported.  details  the  comprehensive  sequencing  review  of  the  rsaA  gene  of the properties of the  The  and  other second  includes  a  130K S-layer protein  as predicted from nucleotide sequence. A has  been  significant the  voltage  lack  impediment of  to  genetic analysis  a plasmid transformation  electroporation-mediated  (electrotransformation)  is  pKT230.  Optimum  8  efficient  Caulobacters  procedure.  plasmid  unusually  Caulobacters yielding up to 3 x 10  of  High  transformation with  freshwater  transformants per jig of plasmid  conditions  for  electrotransformation  of  Caulobacters required a single pulse of high field strength and short duration.  Changes  Caulobacters  so  in  that  growth they  media  would  to  help  survive  adapt  marine  preparation  for  electroporation, along with a modification of the preparation regime, resulted  in  the  electrotransformation  ii  of  MCS6.  Several  genetic  techniques  were successfully  the  introduction  direct  mutagenesis,  and  of  the  Caulobacters.  applied using electroporation, including ligation  electrotransfer  Presence  electrotransformation. electrotransformed  mixtures  of  of  the  bacteria,  suicide  plasmids  from E.  coli to  S-layer  Caulobacters  with  into  lacking  approximately  ten  greatly S-layer  times  influenced protein  greater  were  efficiency  than comparable strains with an S-layer. The nucleotide regular  surface  sequence of the  array  gene  CB15A was determined.  (rsaA)  The rsaA  130K S-layer protein encoding from Caulobacter  crescentus  gene encoded a protein of  amino acids, with a predicted molecular weight of 98,132. cleavage  of  retrievable  mature  130K  protein  peptides yielded  two  and  amino  peptides:  the  acid  1026  Protease  sequencing  first  aligned  of  with a  region approximately two thirds of the way into the predicted amino acid  sequence;  the  second  peptide  carboxy terminus of the protein. carboxy  portion of  with the exception the  protein was  protein. small  130K  corresponded  to  aspartate,  occurred during the  export  residues amino  resulting in an especially Secondary  structure  regular structure. produced  no  process and,  of the removal of the initial methionine  not processed  charged  predicted  Thus, no cleavage processing of the  by cleavage to produce the  The predicted 130K amino acid profile was neutral  the  predominating. acids  were  the  in relatively  mature  unusual, with exception  did not predict any long  A homology matches  of  low proportion,  acidic protein with a predicted pi of  analysis  close  With  residue,  3.46.  stretches of  scan of the Swiss Protein Bank to  iii  the  predicted  130K  17  sequence.  However,  130K  protein  exported proteins  shared  measurable  homology  of other bacteria, including the  particular interest was a specific region of the was  homologous  residues  to  the  repeat  regions  of  with  some  hemolysins.  Of  130K protein which  glycine  and  found in several proteases and hemolysins.  aspartate  These  repeats  are implicated in the binding of calcium for proper structure and biological perform  activity a  of these proteins.  similar  function,  since  proper  surface attachment requires calcium. homology  with  ten  other  protein of Campylobacter rsaA  followed  crescentus known  the  genes.  codon  fetus  strong  in  S-layer  130K may  assembly  proteins  with  the  scoring highest.  codon  crescentus  usage  and  130K protein also shared some  bias  surface  exhibited  sequence  frequencies.  by  array  Codon usage for by  other  The reported D N A sequence increases  Caulobacter  accepted  S-layer  Those present  30%  the total  and  Manipulations of  C.  changes  rsaA  gene  plasmid constructs, including subcloning of gene fragments and other routine  genetic  Escherichia  coli  procedures  indicated  hosts, when sequencing  that  presented  plasmids.  The  of  independent  mutant, C B 1 5 A C a l 0 ,  the  iv  were  toxic  to  within high copy number  S-layer  and the  history of this mutant are discussed.  many  gene  from  a calcium  background experimental  T A B L E OF CONTENTS Page  Abstract  ii  List of Figures  ix  List of Tables  xi  Abbreviations  xii  Acknowledgements  xiii  Dedication  xiv  Introduction  1  Part 1  Electrotransformation of Caulobacters  Materials and Methods  8  Bacterial strains, media and plasmids.  8  Preparation of cells for electrotransformation.  10  Electroporation  1 1  procedures.  E D T A experiments. Other genetic techniques  12 involving electroporation.  v  12  Transposon mutagenesis via electroporation.  12  Electroporation using ligation reaction mixtures. Plasmid  1 3  electrotransfer.  13  Results and Discussion Effects  14  of modifying  conditions  electrotransformation  on electrotransformation  efficiency.  14  Plasmid concentration and transformation  efficiency.  1 6  of marine Caulobacters.  1 9  Electrotransformation  Combining other genetic techniques  with electroporation.  21  Transposon mutagenesis via electroporation.  21  Electrotransformation  23  Plasmid  using ligation mixtures.  electrotransfer.  23  Effect of S-layers on electrotransformation.  24  Additional  27  Part 2:  discussion.  Nucleotide Sequence Analysis of the Regular Surface Array  Gene of Caulobacter  crescentus  Predicted Surface Layer Protein  CB15A  and Examination of  Sequence.  Materials and Methods  29  Bacterial strains and growth media.  29  Gene cloning and related methods.  29  vi  the  Nucleotide sequence analysis of the S-layer  (rsaA)  Sequencing sample  genes from CB15A and CB15ACalO.  techniques  30  and  preparation.  30  Oligodeoxyribonucleotide  primers.  31  Computer analysis of the nucleotide and predicted protein  sequences.  31  Amino acid and peptide analysis of the 130K protein  32  Calculation of free energies for mRNA  secondary  structure.  33  Results and Discussion  33  Sequencing strategy of the regular surface array genes from CB15A and CB15ACal0. Resequencing  33  of the previously published partial  sequence of the  rsaA  gene from CB15A.  35  Size of the regular surface array gene and predicted  130K sequence.  Codon usage of the Predicted  35  rsaA  rsaA  gene.  38  transcription terminator.  40  Problems with subcloning of the S-layer gene from CB15A and CB15ACal0 and with sequencing  template  generation.  Primary structure analysis amino acid sequence.  40  of the predicted 44  General analysis.  44 vii  Peptide  analysis.  44  Specific amino acid abundance  and implications.  Predicted protein secondary  structure analysis.  45 48  Protein homology scans.  50  Possible calcium binding region of the 130K protein.  55  Sequencing of the regular surface array gene from the calcium independent mutant C B 1 5 A C a l 0 .  58  References  62  Appendix  73  Parameters  involved in electroporation.  viii  73  LIST OF FIGURES  Figure  1.  Effect of various field strengths on the  electrotransformation of C. crescentus CB2A.  2  Effect of pulse duration and S-layer on the electrotransformation of  C. crescentus strains.  3 Effect of DNA concentration on electrotransformation  4  efficiency  Generation times of marine Caulobacter  strains in PYE broth with different concentrations of sea salts.  5  Generation times of other marine bacteria  in PYE broth with different concentrations of sea salts.  6  Sequencing strategy for the rsaA genes  form C. crescentus CB15A and CB15ACalO.  ix  7  Complete nucleotide sequence of the  rsaA gene.  8.  A model of surface array attachment  CB15A and CB15CalO.  LIST OF TABLES  Table  Page  I.  39  II.  Amino acid analysis of the 130K protein.  Codon usage in the rsaA gene and ten  other Caulobacter  III.  crescentus genes.  41  Comparison of various features from  S-layers of ten bacterial species including secondary  IV.  46  Homology between the 130K and  several  V.  structure predictions.  S-layer proteins.  51  130K protein homology search of the  Swiss Prot 15 sequence bank using F A S T A  54  VI.  57  Putative Calcium binding regions.  xi  ABBREVIATIONS  a.a.  amino acid  cm  centimeter  DNA  deoxyribonucleic  EDTA  ethylendiaminetetra-acetic  EtBr  ethidium  g  gravity  kb  kilobase  kV  kilovolts  LPS  lipopoly saccharide  MCS  marine caulobacter  m s  millisecond  nm  nanometer  Q  ohms  PAGE  polyacrylamide  PYE  peptone yeast  RNA  ribonucleic acid  S. A . O.  specific-membrane  S-layer  surface  SDS  sodium dodecyl  TE  tris E D T A  acid  bromide  strain  gel  electrophoresis  extract  associated  layer sulfate  microliter VC  vent  acid  caulobacter  xii  oligosaccharide  Acknowledgements Thankyou to my committee,  and especially  Tony Warren, for  allowing me to defend on such short notice when everyone was short of time.  Thankyou to John Smit for accepting me into his lab many  years ago. Many people, including Steve Robins and Rob McMaster, were helpful how  with suggesting  to use  different protocols to me or demonstrating  some of the more difficult procedures or troublesome  computer systems.  Special thanks are due to Wade Bingle, Richard  Siehnel and Don Trimbur who were very helpful in providing good advice, supplies on the sly, and much time for discussions Many writing  thanks to my parents for feeding  period  Thankyou  to  and especially  Cheri  for  critical  me during the  reading  of  this  final work.  Marsanne Gee putting up with me during  the  course of most of this work: I am sorry you missed the end. Of  all  the  deserves  the  most  people thanks.  I  relied  upon,  Thankyou  Stephen  George  Walker  for photographing my  gels  after midnight, for helping me with science problems, and most of all for reassuring me that I wasn't the only one going a little insane.  xiii  This thesis is dedicated to Honor Joan Gilchrist in loving memory  xiv  INTRODUCTION  Caulobacters biphasic  life  are  cycle  gram-negative  consisting  sedentary stalked stage.  of  Caulobacters  although  significant are  swarmer  Less attention  investigation,  environmentally  a motile  having  an  unusual  stage  and a  As a result, they have elicited interest as a  simple developmental model. directions  of  bacteria  and  on other are  an  group.  and are  often  cited  as  In introductory microbiology courses  they are frequently given as examples types to inhabit clear lake waters limited in oxygen content.  Caulobacters  important  chemoorganotrophic  classic examples of oligotrophs.  has focussed  of one of the main bacterial  which are low  in organics and  While many Caulobacters are well suited  to this environment, they have also been isolated from almost every aquatic from  environment  moist  soils  Poindexter 1981). Poindexter  went  (except antarctic waters)  (Anast and Smit  1988;  and can  MacRae  be  isolated  and Smit  1991;  The most well-known Caulobacter researcher Jean so  far  as  to  title  a review  "The Caulobacters:  Ubiquitous Unusual Bacteria" (Poindexter 1981). Caulobacters exhibit fascinating and physiological and life cycle adaptations.  The process of cellular division results in one stalked  cell giving rise to one stalked and one swarmer cell.  The daughter  swarmer cell can then move about the medium under the power of a polar flagellum. formation.  This  polar site is  also  the  site  of  future  stalk  Stalks appear to be extensions of the cell envelope and do  1  not contain cytoplasmic materials.  At the base of the flagellum or  the end of the stalk in the sedentary stage, is an adhesive, probably polysaccharide, holdfast material which serves to anchor the cell to surfaces.  It has been postulated that the presence of holdfast in the  swarmer stage is often necessary  for attachment of Caulobacter cells  to surfaces. The probability of a collision with the force required to overcome electrostatic repulsion with a surface is more likely than in the stalked stage.  The cell would then eject the flagellum and initiate  stalk development for the next round of division (Poindexter 1981). Caulobacters,  particularly strains  of  Caulobacter  have been the subject of genetic analysis  crescentus,  for many years primarily  because they exhibit a cell cycle in which many morphological and physiological (Newton  characteristics  1984;  transformation studies.  Shapiro  are temporally  1985).  method has  However,  been  and spatially the  an impediment  lack  of  controlled a plasmid  to these and other  The introduction of extraneous D N A has only been possible  via conjugation and phage transduction (Ely and Croft 1982, Ely and Johnson  1977).  Conjugation has been the only method available to  introduce plasmids into Caulobacter but is relatively inefficient awkward.  Conjugation  conjugation-proficient often  with  several  necessarily  strains  and  antibiotics  and  requires involves viruses  the  development  selection directed  and of  procedures,  against  donor  cells. The  successful  (electroporation)  to  application  eucaryotic  bacterial species Campylobacter  cells jejuni  2  of and  electrotransformation more  (Miller  recently  1988)  to  the  prompted the  investigation procedure  of its potential to transformation of Caulobacter.  offered  application materials  greater  among  than  efficiency  different  strains,  conjugations.  electroporation  in  We  plasmid  and  also  improving  accomplished by more lengthy  in  transfer,  required  less  investigated  the  genetic  The  broader  time  and  utility  techniques  of  commonly  procedures.  Most published work on the  electrotransformation  of bacteria  reports the use of equipment capable of maximum field strengths of 6.25 <10  kV/cm 6  and  has  demonstrated  transformation  efficiencies  transformants per u.g of plasmid (Luchansky et al. 1988;  et al. 1989; Miller et al. 1988; Schurter et al. 1989; et al. 1989; Wirth et al. 1989).  Scott  Liebl  and Rood  We used a Bio-Rad Gene Pulser and  Pulse Controller and cuvettes with 0.2-cm interelectrodal gaps. arrangement produced  high  coli (>10 For  allowed  salt  field  strengths  electrotransformation  of  12.5  efficiencies  kV/cm with  This  and  Escherichia  reasons  of  efficiency  preparations  must  [Bio-Rad Laboratories  as  well  as  safety,  be relatively 1989]).  high  salt free  voltage  (<5  We anticipated  mmols  problems  with the preparation of marine Caulobacters (Anast and Smit since many marine bacteria lyse in low-salt environments. decided  to  relatively  attempt  low  salt  adaptation media  so  of as  preparation for electrotransformation. cations  has  transformants per u.g of plasmid [Dower et al. 1988]).  10  electroporation total  for  of  to  stabilize  bacterial  the to  marine aid  Also,  membranes  survival  ability  and  (Beveridge and Murray 1976; Smit and Agabian 1982) 3  It  Caulobacters  their the  1988)  of  surface  was to  during divalent layers  in much lower  concentrations  than univalent  cations  deionized water with 10 m M M g C l  prompted the  and 5 m M C a C l  2  replacement  of  during the early  2  stages of preparation of the marine bacteria for electroporation. later washes 10% glycerol seemed sufficient of the concentrated The  to maintain the integrity  cells.  exact mechanism  of  electrotransformation  is  but the plasmid D N A must breach the membranes cell  in  order  to  get  into  the  cytoplasm.  surrounding the cell (Smit et al. common among  1981a).  a wide  Sleytr and Messner 1988a).  not  of the  Many  Caulobacters possess a paracrystalline protein surface  relatively  In  known, recipient  freshwater  array  (S-layer)  Comparable S-layers  spectrum of bacteria (Smit  are 1986,  We speculated that the S-layer could be  a barrier to the electrotransformation  of Caulobacter and initiated an  evaluation. S-layers been  consisting  described  archaebacterial These  spectrum,  regular  monomers  are  linked to one Murray  from  of regularly arranged protein subunits species  across  (Sleytr  and Messner  eubacterial 1988a;  two-dimensional  paracrystalline  arrays  self-assembling;  the  are  another and to the  1984).  the  Although the  have  monomers  underlying cell  and  Smit  1986).  of  protein  noncovalently  wall (Koval and  structural characterization  of  the  S-  layers of a number of organisms is well advanced, the regulation of their synthesis, transport, and variability is poorly understood.  As  well, the functions of most known surface arrays have not been fully ascertained. wide  variety  The superficial presence of S-layers on bacteria from a of  environments  would 4  suggest that  they  have  many  possible functions.  In order to produce the large amount of protein  required to sheath the cell, typically 7-12% (Baumeister  et al. 1988), one can assume that much of a bacterium's  energies is devoted to this endeavor. surface  layers  are  often  lost  in  proposals that they play specific environments. separation  This, coupled with the fact that laboratory  and essential  culture,  has  led  to  roles in their natural  Their functions may include protecting cells by steric  from  preventing foreign  of the total cell protein  external  lytic  DNAs  influences,  enzymes,  from  working as  bacteriophages,  contacting  molecular  parasitic  sieves,  bacteria  underlying membranes  (Sleytr  or and  Messner 1988b; Smit 1986). The major and possibly sole component of the C. layer is probably  the apparent Mr-105,000 protein (130K protein). the  approximately  most  abundant protein  possible  of  the  cell,  5% of total cell protein synthesized  1979; Smit and Agabian 1984). the  crescentus S-  exception  of  This  accounting  is for  (Agabian et al.  It forms a hexagonal array and, with  exopolysaccharide  (Ravenscroft  et al. in  press), associated with the membranes, and lipopolysaccharide, is the outermost layer of the cell (Smit et al. 1981a). Subunit assembly ways,  of the surface  array occurs in two  either as random addition of subunits within the  distinct  preexisting  array or as de novo assembly at the specific sites of stalk elongation and along the cell division plane (Smit and Agabian latter  cases  of  spatially  restricted  array  formation  1982).  are temporally  regulated, occurring at specific stages of the life cycle. protein is synthesized at a constant rate (Agabian et al.  5  These  As the 130K 1979; Fisher  et al. 1988) from a single copy gene it is difficult to see how these two processes are coordinated.  The entire transport journey across  the inner and outer membranes, culminating with final  addition to  the surface layer supramolecule, is likely to prove a complex process with many factors and mechanisms involved. It is of interest to us to learn in molecular detail how the Slayer is excreted, assembled and attached to the cell surface; toward that  end, primary  (rsaA) Agabian (Fisher  gene was 1984) et al.  sequence information is cloned from  and the 1988).  site  C.  of  crescentus  Unlike  other  signal leader peptide.  The S-layer  CB15A  (Smit  and  transcription initiation determined  That site was  confirmed by alignment with  protein sequencing of the first twenty-one protein.  essential.  sequenced  amino acids of the mature  S-layers,  there  was  no  cleaved  The sequence published in the Fisher et al.  1988 paper, including the first 940 nucleotides of the gene, contained ten errors. and  the  These errors have since been corrected by James Fisher staff  of  Applied  BioSystems  and  the  corrections  incorporated in the entire sequence of the gene presented here.  are The  S-layers of ten other bacteria have been sequenced and, for the first time, are here compared to each other, and 130K. share many interesting  similarities.  These  S-layers  A likely region related to the  role of calcium in surface attachment and self assembly  was noted,  but with respect to a mechanism of excretion, we learned that this protein has no clear analogy to other characterized exported bacterial proteins.  The  sequencing  of  the  S-layer  gene  from  independent mutant, C B 1 5 A C a l 0 , was also undertaken. 6  a calcium  It was hoped  that even if no mutation was found, the sequence would provide a confirmation of that done from the wild-type parent, CB15A.  7  1:  Part  Transformation  Caulobacters Layers  on  by  of  Electroporation  Freshwater and  Electrotransformation  the  and  Effect  Marine  of  Surface  Efficiency.  M A T E R I A L S AND METHODS  Bacterial  strains,  media  and  plasmids.  Freshwater C. crescentus CB2NY66R and CB15A ( A T C C 19089) were  used  as  parental  strains,  paracrystalline  S-layer  (Poindexter  CB15A  variant  of  is  a  synchronously-growing crescentus  cell  CB15,  both  1964, in  cultures  that work  having  Smit  a  and Agabian  techniques well  wild-type  for  in this  1984).  preparing  strain.  C.  C B 2 A is a spontaneous mutant that has lost its ability to  make 130K, the dominant or only protein of the S-layer.  CB15AKSAC  is  by  an  S-layer  insertion  minus  derivative  of  CB15A,  produced  of a kanamycin resistance cassette (Barany  1985)  in  vitro  into  the  130K gene on a plasmid with a C o l E l replicon and subsequent forced exchange  of  the  wild-type  gene for the  interrupted version.  forced exchange was done via electroporation is  not  maintained  resistance. protein  in  caulobacter,  and  of this plasmid, which  selection  for  kanamycin  CB15ACalO is a mutant of CB15A that produces  capable  of producing an S-layer  does not efficiently  structure,  attach to the cell surface.  The  but  the  130K protein  No evidence of the S-  layer can be seen on cells by negative stain electron microscopy, yet, when  examining  plate colonies of this mutant,  8  large  sheets of  the  assembled  structure can be found adjacent to the cells.  Marine Caulobacter strains M C S 3 , M C S 6 , MCS17, MCS18 and MCS24  have  Caulobacter  been strains  Poindexter,  and  described  (Anast  and  VC5  VC13  were  were  and  isolated  from  deep  Smit  1988).  obtained sea  ocean  Vent  from  Jean  vent  water  samples. Freshwater Caulobacter strains were grown in a 0.2% 0.1%  yeast  extract  medium  (PYE)  supplemented  peptone  with  0.02%  M g S 0 . 7 H 0 and 0.01% C a C l . 2 H 0 at 3 0 ° C with vigorous shaking 4  2  (Mitchell  2  and  Pseudomonas  Smit  1990).  atlantica  2  Marine  and  Vent  Caulobacters  and  were grown at 2 5 ° C with shaking in SSPYE  (PYE supplemented with sea salts [Sigma Chemical Co, St. Louis, MO] at noted  concentrations).  Generation concentrations  times  were  of  the  derived  marine  using  bacteria  in  different  salt  a Klett-Summerson Colorimeter  under the growth conditions described above. E. coli strains D H 5 a et al.  (Hanahan 1983), K802 (Wood 1966)  S17-1  (Simon  1983)  were used  grown  in L broth (Sambrook  et al.  and  as plasmid hosts and were  1989)  at 3 7 ° C with  vigorous  shaking. Plasmids have  been  described  streptomycin kanamycin  RSF1010  and its  (Bagdasarian  resistance.  resistance  resistance and has  derivatives et al.  pKT230  genes.  pKT215  1981).  carries  pKT215  and  RSF1010  pKT230 confers  streptomycin  confers  and  chloramphenicol  a streptomycin resistance gene that is expressed  in Caulobacter and not E. coli (Bingle and Smit 1990). 9  pSUP2021 is a  Tn5-carrying  plasmid  that  is  maintained  in  E.  coli,  but  not  Caulobacter, and is used as a suicide mutagenesis vector (Simon al. 1983).  et  C . crescentus carrying Tn5 can be selected for on media  containing streptomycin (50 |ig/ml [O'Neill et al. 1984]). Purified pKT230 was used for most of the experiments electrotransformation lysate  method  (Sambrook  confirmed pSUP2021  and  was  and banded by C s C l  et al.  preparations  efficiency  1989).  were  by  visual  was  density  gradient  The D N A concentration  determined  by  estimation  prepared  prepared by  by  absorbance  using  a  agarose  mini-alkaline  at gel  the  testing cleared  centrifugation  of the plasmid 260  nm  and  electrophoresis.  plasmid preparation  method (Sambrook et al. 1989).  Preparation The  of  cells  for  electrotransformation.  bacterial electroporation  from Dower et al. (1988).  preparation method  was  adapted  Bacteria were grown to mid-logarithmic  growth phase (optical density at 600 nm of 0.4 to 0.7).  Caulobacter  cells were harvested by centrifugation at 10,500 x g for 20 min at 4 ° C.  E. coli cells were harvested by centrifugation at 6500 x g for 12  min at 4 ° C .  A l l subsequent  steps were done on ice or at 4 ° C .  Typically, cell pellets from 500 ml of culture were suspended in 500 ml of cold, deionized water, centrifuged, resuspended in 250 ml cold water and centrifuged again. 25  The cell pellet was then resuspended in  ml of cold water and centrifuged  at  15000 x g or 7500 x g  (Caulobacter or E. coli, respectively), suspended in 25 ml of cold 10% glycerol, centrifuged and finally resuspended to a thick slurry. 10  This  resulted  in suspensions of  approximately concentrated  2.5  x  10  suspension  1 x  10  cells/ml  11  cells/ml  1 0  for  for  E.  Caulobacter and  coli  strains.  The  was incubated on ice for 30-60 min, divided  into 50 ul portions, frozen in a dry ice/ethanol bath and stored at -70° C. M C S 6 cells were grown in 0.6% preparation of freshwater  S S P Y E medium.  cells for electrotransformation  Caulobacters,  except  that  was the  the steps  Subsequent same as for involving  centrifugation and suspension in water were instead done with a cold solution of 10 m M M g C l  Electroporation  2  and 5 m M C a C l . 2  procedures.  The apparatus used was a Bio-Rad Gene Pulser with the output channelled through a Bio-Rad Pulse Controller.  Potter-type  cuvettes  (Bio-Rad, Richmond California) with 0.2 cm interelectrodal gaps were employed.  This apparatus could achieve field strengths of up to  12.5  kV/cm. In typical experiments, were  thawed  at  room  pKT230 D N A (100  concentrated  temperature  ng/u.1).  1000  Q,  suspensions  mixed  with  1.25  (50 u.1  (il) of  Forty u.1 of cells were removed to the  electroporation cuvette and shocked. k V and 25 U.F.  and  cell  The Gene Pulser was set at 2.5  The Pulse Controller setting was varied from 100 to  depending  on the nature of the experiment.  Immediately  following the shock, the cuvette contents were mixed with 960 u.1 of outgrowth medium ( P Y E for freshwater Caulobacters or 1.5% for  MCS6)  and  incubated  for 11  15-30  min  at  room  SSPYE  temperature.  Cultures  were  freshwater noted  then  shaken  vigorously  for  2  hr  at  Caulobacters, or 4 hr at 2 5 ° C for MCS6.  that  after  the  completion  of  these  30°  times  could  recovered transformants.  be  halved  described  experiments  streptomycin  (50  a  major  delivery  reduction  in  Freshwater Caulobacter cultures were then  diluted appropriately in water either  without  for  It should be  further work determined that all of the above post shock incubation  C  and plated on P Y E agar,  Lig/ml),  kanamycin  (50  containing  jig/ml)  or  both.  MCS6 cultures were diluted in 1.5% SSPYE and plated on 2% SSPYE plates  containing  u.g/ml).  streptomycin  (50  |ig/ml)  and  kanamycin  (70  To determine cell survival, dilutions were plated on P Y E or  2.0% SSPYE, as appropriate.  EDTA  experiments. In  some  experiments  the  effect  was evaluated.  of  electrotransformation  efficiency  EDTA  electrotransformation  preparations, in concentrations  of  EDTA  on  was added to 125  to  1000  fiM, just prior to electroporation.  Other  genetic  Transposon  techniques  mutagenesis  involving via  electroporation.  electroporation.  The procedure above was employed with certain changes. of  1 u.1  a 30 (ll mini-alkaline plasmid preparation of pSUP2021, prepared  from 1.5 ml of E. coli strain S17-1, replaced pKT230.  C.  crescentus  C B 2 A cells were used and, after shocking at a Pulse Controller setting of 200 Q , the preparation was plated on P Y E agar containing either  12  streptomycin  and/or kanamycin.  Electroporation  using  Electroporation previously ligation  of  described  reaction  ligation ligation  reaction  mixtures.  mixes  was  carried out  with  minor  changes.  technique  et al.  mixes (Sambrook  using  the  Standard  1989), containing from 10  to 500 ng of plasmid vector and insert D N A from a variety of sources, were diluted ten fold and used as the plasmid source. of  the  strains,  diluted using  mixes  were  electroporated  standard conditions  (200  with  or 400  From 1 to 5 u.1  CB2A Q  or E.  Pulse  coli  Controller  settings).  Plasmid We  electrotransfer. investigated  electroporating  the possibility of transforming cells simply by  them in the presence of 'donor' cells.  E. coli cells  K802, carrying RSF1010, and DH5oc, carrying pKT215, were used as donors and C B 2 A cells as recipients. cell preparation protocols,  The above methods, including  were again used except that E. coli and  C B 2 A cells were mixed together, at E. coli-to-CB2A 1:1  to  1:5  (total  volume  40  ul),  and  Controller settings of 200, 400, or 600 Q . added.  The recovered  were  plated  untransformed streptomycin (30  on  ul/ml),  with  Pulse  No extraneous plasmid was u.1 of P Y E and  For plating they were not diluted further.  P Y E with  CB2A. (50  shocked,  cells were diluted in 960  shaken at 3 0 ° C for 1.5 h. They  then  cell ratios of from  Where  selection  RSF1010  ampicillin  (50  against  transfer ul/ml),  E. was  coli  involved,  and trimethoprim  ul/ml) were used for selection of transformed C B 2 A .  both ampicillin and trimethoprim resistant.  13  and  Where pKT215  CB2A  is  transfer  was  involved,  streptomycin  (50  u.l/ml)  was  the  only  selection  needed.  RESULTS AND DISCUSSION.  Effects  of  modifying  electrotransformation  electrotransformation The 1988)  parameters  conditions  efficiency. involved  in  electroporation  (Dower  include the field strength (expressed in kilovolts  capacitance  (set  time constant  at 25  on  which is  a measure  and is modified by the Pulse Controller (ohms).  al.  [kV/cm]), the  u,F for most of these experiments),  (milliseconds),  et  and the  of pulse duration A simple and short  discussion of these parameters is contained in the appendix. Initial by  attempts  maximum  electroporation available.  field  to  electrotransform  strengths  cuvettes  of  with  6.25  Caulobacter were  kV/cm  0.4-cm  interelectrodal  account  of  bacterial  electrotransformation  1988), did not call for a high concentration  yield  only  wide  gaps  were  Also, the cell preparation protocol, adapted from the first  published  (about  because  limited  (Miller  of cells in preparation  10 /ml) or as many water and 10% glycerol washes. 9  with  pKT230  CB2A  was  (results not  approximately  shown).  with 0.2-cm interelectrodal  10  The use  gaps,  transformants  4  of  allowing  et al.  per jig of  electroporation field  The  cuvettes  strengths of up to  12.5 kV/cm, and the preparation protocol described above, effected a dramatic  improvement  of  electroporation  efficiency;  transformation  levels of >10 /u.g of plasmid were routinely obtained (Fig 1). 8  14  2.0  0.0  H  r—  1  i  1  i  7  8  9  10  11  12  Field Strength  FIG.  1.  The  electrotransformation  effect  of  efficiency  varying  1  13  (kV/cm)  field  of C. crescentus  strengths CB2A.  kV/cm  in parallel to the electroporation cuvette:  200, 400, or 600 Ci resulting in time constants of approximately 8.1, or 12.1  the  A mixture of  cells and plasmid was pulsed at field strengths of 7 to 12.5 with one of three resistors  on  ms, respectively.  4.2,  Standard error, derived by the Student  t test, is displayed in this and the following figures.  Each data point  was derived from at least 3 and as many as 12 experiments.  15  The  effects  controller set crescentus efficiency 4.2 ms.  of  a  at 200,  range  400  of  or 600  field Q  C B 2 A was investigated  strengths  with  the  for the electroporation  (Fig 1).  pulse of C .  Maximum transformation  was achieved using pulses of 12.5 kV/cm and durations of Pulses of 8.1 ms were nearly as efficient.  the most efficient  Cell survival under  electrotransformation conditions was 40 to 50%.  The effect of variation of time constants on the electroporation of five strains of C.  crescentus was examined (Fig 2).  Field strength  and capacitance  were set at the apparatus maximum of  for all pulses.  Again, maximum efficiency  both  survival  rate  produced  the  number of  (from  higher  transformants  8-30%  cell  Longer time constants recovered  survival).  survival  Shorter  (>50%)  kV/cm  was achieved with pulse  durations of 4.2 to 8.1 ms (200 and 400 Q.). reduced  12.5  but  lower  and the  time  cell  constants  transformation  efficiency. The  application  of  higher  levels  of  current (via  the  use  of  higher capacitance settings on a Bio-Rad Capacitance Extender™) was only briefly evaluated. with  field  strengths  Capacitance settings of from 125 of  which  6.25  survival  rates,  efficiency  (Data not shown).  Plasmid  concentration  kV/cm,  reduced  and  significantly  overall  to 960U.F,  reduced  cell  electrotransformation  transformation  efficiency.  The relationship between the amount of plasmid used and the resulting electrotransformation The  number  of  efficiency  transformants  was  recovered  also examined  was  amount of plasmid added, from 10 ng to 700 ng.  16  proportional  (Fig 3). to  the  Above 700 ng (ie.  0  200  Pulse  FIG.  2.  The  400  Controller  effect  electrotransformation  of  of C.  pulse  600  Setting  lacking S-layers (CB2A [•] layer is assembled  (Ohms)  duration  and  crescentus strains.  tested include two with S-layers (CB2NY66R  800  [•]  C.  S-layer  on  the  crescentus strains  and CB15A [•]),  two  and C B 1 5 A K S A C [O]) and one in which S-  but not attached to the cell (CB15ACalO  [A]).  Cells and plasmid were pulsed at a field strength of 12.5 kV/cm with a pulse controller setting  of 100, 200, 400,  settings resulted  constants  in time  12.1, and 16.0 msec, respectively.  17  of  600, or 800 Q.  approximately 2.3,  4.2,  These 8.1,  2 . 0  co  o  CD  «2  1.01  c cn  8  CO  c  o. o -M 1  1oo  o  DNA  1000  (ng)  FIG. 3. The effect of DNA concentration and electrotransformation efficiency.  The indicated quantities of pKT230 plasmid DNA were  added to electroporation preparations of C. shocking.  18  crescentus  CB2A prior to  lu,g)  recovered  transformants/u.g  plasmid  decreased.  This  phenomenon was found in other bacteria (Conchas and Carniel Dower  et al.  1988,  contaminating reach  a  critical  level  of  the  be  which flow  either  across  Above this level,  hindered.  electroporation (data not  above  current  are affected.  actually  It may be possible that  substances in the D N A preparation or the D N A itself  characteristics cuvette  Luchansky et al. 1988).  1990,  did  Preincubation of not  improve  the  the  cells  suspension  or  the  in  the  electrotransformation cells  with  plasmid  electrotransformation  may before  efficiency  shown).  Electrotransformation  of  marine  Caulobacters.  Marine Caulobacter MCS6 has been the recent focus of genetic studies, including construction of a Tn5 mutagenesis library to isolate holdfast CB2A  mutants  as has  (Mitchell  application  of  electotransform  and  been done  Smit  electroporation MCS6  with Caulobacter  1990). to  We  this  were  work  2  the  efficiencies  so  attempted  When M C S 6  the to was  2  solution, excessive cell  To help overcome this difficulty, MCS6 was grown in  lowest level Using  and  in  SSPYE) and prepared for  electroporation with water or the M g C l / C a C l lysis occurred.  interested  using the above methods.  grown in standard saltwater medium (3.5%  crescentus  of  MCS6 of 1.5  sea  salt consistent with good  cells x 10  3  grown  in  0.6%  SSPYE,  growth  (Fig  4).  transformation  transformants per (ig of pKT230 with the  Pulse Controller set on 600 or 800 Q (12 and 16 ms time constants)  19  FIG.  4.  Generation  concentrations of derived using  from a  sea  growth  times of five  marine  salts in P Y E broth. of  cultures  Klett-Summerson  Caulobacter in Generation  times were  at 2 5 ° C and turbidity  Colorimeter.  MCS24  is  different  readings, a  marine  Caulobacter with the unusual ability to grow with little or no added sea salts  (1).  20  *  could  be  obtained.  Total  recovered  significantly: i.e., as much as 50%.  transformants  could  vary  Lower Pulse Controller settings  (i.e., shorter time constants) produced no transformants. The growth of other marine Caulobacter strains in varying sea salt concentrations should prove  was  useful  these strains.  also investigated  for the  future  (Fig. 4).  testing  of  This information  electroporation  with  As well, the growth of two vent Caulobacter strains  and Pseudomonas  atlantica  was  examined in the same conditions  (Fig. 5).  MCS24 grows well in a wide range of salt concentrations  including  very low  limited  sea  salt  media  amenable  to  including  the vent  more  salt concentrations, (Fig.  electroporation  sensitive  to  4).  while  These  than  the  MCS3  strains  others.  sea  salt  conditions  might  well in be  The other  Caulobacters and Pseudomonas low  grew  but  application of electroporation may still be feasible.  more  strains,  atlantica, the  were  successful  It is interesting  that all the marine Caulobacters (MCS') grew well in half strength sea salts media (1.5 to 2.0%)  and most actually grew faster than they did  in full strength marine concentrations (3.5 to 4.0%).  Combining Transposon  other  genetic  mutagenesis  techniques via  with  electroporation.  electroporation.  The standard procedure was used except that 1 u.1 of a 30 pi mini-alkaline plasmid preparation of pSUP2021, prepared from ml of E. coli S17-1, replaced pKT230.  pSUP2021 is a Tn5-carrying  plasmid that is maintained in E. coli but not in Caulobacter. electrotransformed  Caulobacter 21  to  1.5  survive  streptomycin  For the selection,  FIG.  5.  Generation  concentrations derived  from  of  sea  growth  times  of  four  marine  salts in P Y E broth. of cultures  using a Klett-Summerson  Generation  in  different  times were  at 2 5 ° C and turbidity  Colorimeter.  22  bacteria  readings,  the  transposon  maintained. 200  Q,  'hop'  approximately  Ligation  ligation) of  the  chromosome  where  500  Tn5  transposition  reactions  using  ligation  will  be  events  were  could  be  and E. coli.  mixtures.  directly  electrotransformed  minimized diminishing time constants (due to the  (Sambrook  et al.  into  Dilution of standard ligation mixes (after  salts) and improved transformation efficiency.  mixes  it  obtained.  Electrotransformation  Caulobacter  to  C B 2 A cells were shocked at a Pulse Controller setting of  and  consistently  must  presence  Ligation reaction  1989), containing 10 to 500 ng of plasmid  vector and insert D N A from a variety of sources, were diluted 10fold , and 1 to 5 u.1 was electroporated into C B 2 A or D H 5 a (200 or 400 Q Pulse Controller settings). according to the efficiency and  insert  The efficiency of the process varied  of the ligation reaction (involving vector  sizes, D N A purity and other factors),  were readily recoverable; this  is now  the  yet  transformants  standard practice in our  laboratory.  Plasmid  electrotransfer.  E. coli and Caulobacter cells were mixed together and shocked, as described in "Materials and Methods".  E.  coli  K802 carrying  RSF1010 and E. coli DH5a carrying pKT215 were used as donors and C B 2 A was the recipient strain. and were  recipient combined) recovered  Maximum recovered  on  efficiency  was  selection was  transformants  When a total of 40 u.1 of cells (donor shocked, media  achieved varied  23  approximately (see  materials  with pulses by  as  much  of as  150  recipients  and  methods).  4.1  ms.  65%  Total between  experiments  but were always  Effect  S-layers  of  on  readily isolated.  electrotransformation.  C B 2 A and CB2NY66R differed significantly with respect to their electrotransformability of  CB2A  was  (Fig 2).  Maximum  transformation  efficiency  obtained with pulse durations of one-third the length  needed for maximal levels of transformation in CB2NY66R, and the maximum  efficiency  of  transformation  with  higher than that possible with CB2NY66R. also electrotransformed strain.  Mutant  efficiently  (if  at  was  to  times  than its parental  which produced S-layer  all)  10  Similarly, C B 1 5 A K S A C was  10 times more efficiently  CB15ACal0,  attach  CB2A  the  electrotransformed at twice the efficiency  cell  that did not  surface,  of CB15A.  could  be  As the surface  array was not expected to bound to the cells we had anticipated this strain to be transformed as efficiently strains. CalO  as the surface array  The exact nature of the interaction of S-layer protein and  cells is  not  established.  This  strain sheds S-layer in large  amounts, visible to the naked eye in culture. phenomena, remain  deficient  there  attached  are to  the  a few cell  To explain the above  possibilities. and thus  Residual  inhibit  S-layer  may  electrotransformation.  S-layer is not usually seen on the CalO cells in electron micrographs but the possibility remains that the attached,  and is  separated  electron  microscopy.  circumstantial evidence the  cells  in  the  A  from  S-layer protein is very  the  more  cells  likely  during  preparation for  possibility  to support this) is that S-layer  preparation  24  of  CalO  and  weakly  then  (as  there  is  contaminates inhibits  the  electrotransformation  of  these  bacteria.  S-layer  blobs,  visible  in  liquid culture, may co-isolate with the cells during the washing steps of preparation for electroporation. the  procedure  electrical Indeed,  in  a  number  changes in the the  cells  of  sample  appear  This material may causing  chemical  and/or  for and/or during electroporation.  and  preparation phase compared to  ways  then inhibit  behave  differently  their parental  strain.  during The  the  mutant  cells appear to be slower to pellet and the pellet is not uniform; that is the top of the pellet (material last to pellet) appears to be slightly gel-like  and viscous.  degree  of  This part of the cell pellet may have a high  contaminating  S-layer.  The contaminating  S-layer  may  actually even bind the added D N A , thereby inhibiting the D N A from entering the cells during electroporation. electron  micrographs of purified hexagonally  layer from the show  In support of this concept,  what  Baumeister  bacterium Deinococcus  appears  to  be  packed intermediate  radiodurans  attached  DNA  strands  S-  consistently (Peters  and  1987).  It is not surprising that a physical technique  of breaching the  cell wall barriers for plasmid introduction might be impeded by an additional cell wall structure. C.  However, current image analysis of the  crescentus S-layer structure suggests a widely  network  of  proteins)  arranged at 23.5-nm  widely layers  spaced  six-membered  network  rings  (each  intervals  is relatively  ring  spaced,  having  hexagonal  six  S-layer  (Smit et al. 1981a).  Such a  unusual compared with the  of other bacteria (Sleytr and Messner  1988a), yet  apparently  even a loose network can strongly affect electrotransformation.  25  S-  The  S-layers of other bacteria may well prove to have a similar retarding effect per  on  electrotransformation.  U-g of  plasmid  strains, sufficient  were  still  obtained  >10  with  preparations  S-layer  and  EDTA  disrupts  of the S-array proficient  the  organized  were administered, E D T A  U.M.  rates,  of  diminishing recovery  competes  for  membrane  stability,  divalent  concentration. pulse  is  Immediately  before  the  to  shocks  concentrations  A l l resulted in lower cell survival  cations  leading  The  electrotransformation  was added to make to final  over the range 125 to 1,000  structure  strains CB15A and CB2NY66R  were tested in the presence of E D T A .  electrical  expressing  improve the stability of Caulobacter S-  (Steven Smith and John Smit unpublished), the efficiencies  transformants  7  for many applications.  Since divalent cations layer  Nevertheless,  transformants. that  cell  disturbance delivered,  are death  of and  the the  EDTA  probably  essential  to  when  high  in  membranes following  maintain enough  when  the  membrane  restabilization period may offer a good opportunity for the E D T A  to  get  to  at  these  normally  restabilization failure.  integral  divalent  cations,  leading  Even at 125 u M , cell survival was reduced at  higher Pulse Controller settings (i.e., >400 Q: [data not shown]). ultimate  improvement  optimal conditions  (125  of  electrotransformation  u,M E D T A ,  200  efficiency  The under  Q Pulse controller setting)  was variable; with from 0 to 50% more transformants recovered than without E D T A .  26  Additional  discussion.  Compared seems  well  to  published  suited  transformants  for  data  for  electroporation.  part,  tumefaciens  (Farinha and Kropinski this  is  due  electrotransformation of 12.5 kV/cm.  to  advantages  high for  the  1990,  apparatus.  for C B 2 A  of  over  10  8  was  and  1988), and Pseudomonas  Mersereau et al.  1990).  Maximum efficiency  achieved  at the  of  apparatus limit  This suggests that Caulobacters could be transformed  at still higher efficiency Very  Levels  Caulobacter  Exceptions are E. coli (Dower et al.  with similar levels, Agrobacterium  In  bacteria,  per u.g of plasmid are higher than for other reported  bacterial systems.  aeruginosa  other  if greater field strengths were possible.  electroporation work with  efficiencies  Caulobacters.  may  occasionally  When large  have  amounts  of  plasmid (i.e., 1 u.g or more) are used, as many as 10% of survivors contain  the  selecting  (via  antibiotic markers) for the cells containing plasmid, is feasible.  In  some cases, native  plasmid.  it  sources,  may  Thus,  be  perhaps  screening,  desirable specifying  to  rather  install  cryptic plasmids  an activity  but for which selection is not possible.  than  that can  In such cases,  be  from  assayed  high-efficiency  electroporation is a way to accomplish the task. High efficiency genetic  techniques  was with  key to the  success in improving several  electroporation.  Caulobacters using ligation reaction mixtures first  transform  Caulobacters  by  E.  coli  and  conjugation.  then  Electrotransformation  of  eliminated the need to  introduce  the  plasmid  into  Electrotransformation combined  with  suicide  mutagenesis  technique  resulted  in  a  simpler  method  than  conjugation to introduce the plasmid and did not require the use of recipient Caulobacters with additional mutations to select against coli  donor cells (e.g., rifampin resistance).  were  not  donor  compromised by  cells.  Hence,  the  presence  results  were  E.  Also, plasmid recipients of  contaminating  obtained  faster  E.  than  coli with  conjugation, often within 24 h for freshwater strains.  Also, no special  plasmid  mutagenesis  constructions  gene replacement (e.g.,  strategy;  p U C plasmids)  required.  were  needed simple  sufficed,  to  use  suicide  colicin El-replicon  since  type  vectors  mobilization capability is  In gene replacement experiments  or  not  performed in the Smit  lab, (including the the construction of C B 1 5 A K S A C discussed earlier), 3  to  23%  of  replacement  the  events;  (plasmid insertion) The  initial the  drug-marker resistant  remainder appear  to  clones  be  are  single  gene  crossover  events.  electrotransfer  of plasmid from  E. coli  to  Caulobacters  circumvents a plasmid purification step, conjugation procedures, and the necessity that the E. coli host be constructed to act as a donor strain. for E.  Electrotransfer of plasmids has hitherto only been reported coli  strains  (S ummers  and  Withers  suggested that electrotransfer might be possible other species; it is.  28  1990)  where  it  was  between E. coli and  Part  2:  Nucleotide  Sequence  Analysis  Surface Array Gene of Caulobacter Examination  of  the  of  the  CB15A and  crescentus  Predicted  Surface  Regular  Layer  Protein  Sequence.  MATERIALS AND METHODS  Bacterial strains C.  and growth media.  crescentus  supplemented crescentus  CB15A  (ATCC  19089)  was  P Y E medium at 3 0 ° C with shaking (as CB15ACal0,  is  an mutant  of CB15A  grown above).  that sheds  in C.  130K  protein (also see above: materials and methods part 1). E.  used  for all techniques  requiring E. coli, except for when non-methylated  D N A was required  for  coli D H 5 a F '  (Hanahan  1983)  was  subcloning, as in cases involving Bell  In this case, RB404 (Brent and Ptashne and  dam-6  minimal  mutations  media  were  was used  used. as  and Clal  restriction  1980), containing the  L broth, T Y P , 2 x Y T  required to  grow  sites. dam-3  and M9  E.  coli at 3 7 ° C  fragment  purifications,  (Sambrook et al. 1989).  Gene cloning and related The ligations using  preparation  of  methods. plasmid  DNA,  and other necessary genetic manipulations  standard  methods  (Sambrook  et al.  1989).  were carried out Plasmids  were  prepared by either the boiling method of Holmes and Quigley (1981)  29  or the alkaline technique of Birnboim and Doly (1979). quantities technique al.  of  plasmid  were  either  or a cleared lysate method was  1989).  a  scaled-up  employed  alkaline  (Sambrook  et  Plasmids isolated on a large scale were further purified  using two CsCl-EtBr density or  desired,  When larger  gradient cycles (Sambrook et al.  the  Bio-Rad  Prep-a-Gene kit  Double  stranded  plasmid  previously  mentioned  minipreparations  for  (Bio-Rad Richmond  sequencing  preparations  (Kraft  et al.  or  1988).  was  California).  obtained  from  1989)  PEG  from  the  precipitated  Where required, plasmids  were introduced into E. coli by electrotransformation (as above [Part 1]).  Nucleotide  sequence  analysis  of  the  S-layer  ( r s a A )  genes  from CB15A and CB15ACalO. Sequencing DNA  method  generate  M13mpl9 1987)  (Sanger  single-stranded  was  performed by the  et al.  1977).  template  D N A phage  dideoxy  chain  Two methods were used  D N A : the system  M13mpl8  (Vieira  and  and Messing  and the p T Z plasmid vector system (United States Biochemical  single-stranded cases,  supernatants  Helper phage M13K07 was used to produce  D N A from cells  single-stranded by  additions  ammonium acetate to 430 in 4.5  sample preparation.  single-stranded  Corp., Cleveland, Ohio).  both  and  sequence analysis  termination to  techniques  carrying pTZ-rsaA  DNA of  mM.  phage  polyethylene  were  constructs.  precipitated  glycol  to  Precipitated phage were  3.3%  In from and  suspended  M sodium perchlorate and the liberated D N A was bound to  30  glass  filters,  followed  Single-stranded  by  template  extensive  D N A was  washing  recovered  with  70%  from the  ethanol.  filters  in a  solution of 1 m M Tris and 100 (iM E D T A and the D N A concentration was estimated gel  by visual examination of bands obtained from agarose  electrophoresis. Sequencing  reactions  using single stranded or double  stranded  D N A were performed using the Sequenase kit (U.S. Biochemical Corp., Cleveland, Ohio) with [a-35S] dATP, following the protocol supplied with  the  kit.  (including Pharmacia  Alternatively,  7-deaza (Baie  T7  G T P ) and dideoxy-NTPs d'Urfe,  Quebec)  according to supplied protocols. 5-6%  D N A polymerase,  and  were  deoxy-NTPs  purchased  sequencing  from  reactions  run  Reaction products were separated on  polyacrylamide-urea gels.  Oligodeoxy ribonucleotide  primers.  Oligodeoxyribonucleotide  primers  (18-22mers)  were  prepared  by a service within the Biochemistry department of the University of British Columbia. model  380B  They were assembled  DNA  diisopropylamino Oligonucleotides  Synthesizer  on an Applied  using  phosphoramidites  were purified  by  b  cyanoethyl-N-,  (Sinha  CI8  Biosystems  SEP-PAK  et  al.  N-  1984).  minicolumns  as  described in Atkinson and Smith (1984).  Computer  analysis  of  the  nucleotide  and  predicted  protein  sequences. The Delaney sequence handling program (Delaney uses  codon  preferences  to  predict 31  the  proper reading  1983), which frame,  was  used to confirm proper reading frame from nucleotide sequence data. Many of the P C / G E N E (Intelligenetics,  Mountain View, C A ) programs  were used for sequence analysis (see below), including the  FSTPSCAN  program to search for homology with the Swiss Prot release 17 using the method of Myers and Miller (1988). (Pearson and Lipman 1988)  As well, the F A S T A program  was used to scan the Swiss Prot release  15.  Amino acid and peptide analysis of 130K protein. 130K  protein  composed  of  produced  by  filtration  in the presence  described  shed  was  C:  (Smit  hydrolyzed  purified  surface  proteins  crescentus  and  John  Smit  sodium dodecyl  Agabian  from  and an insoluble  CB15 (Smit et al.  of  in 6 M HC1 at  by  1984).  red pigment  1981b),  sulfate  using  gel  as previously  The purified  1 1 0 ° C for 24  aggregates  h and the  protein  was  amino acid  composition evaluated with a Durrum D500 amino acid analyzer by Ken Walsh and his staff at the University of Washington. Silvia sequencing 130K V8  Yuen  of  Applied  experiments.  preparation as above protease  digested  in 0.1  protein was  BioSystems  Peptides  were  by digestion  performed  generated  from  peptide the  same  at room temperature with  M ammonium carbonate buffer, p H 8.0.  The  applied to a Aquapore RP300A reverse  phase  column and peaks were eluted with a 0-100% gradient of Buffer A (0.1% trifluoroacetic acid [TFA]) in Buffer B (0.085% T F A in 70% acetonitrile).  For those  peaks  retrievable  in  sufficient  quantity,  amino acid sequencing was done by sequential Edman degradations. 32  Calculation of free energies for mRNA secondary structure. Calculation of free energies for mRNA secondary structure was determined according to the method of Tinoco et al. (1973).  RESULTS AND DISCUSSION  Sequencing  strategy  of  the  regular  surface  array  genes  form CB15A and CB15ACalO. Various fragments of the regular surface array genes from both CB15A (Fig.  and CB15ACalO were subcloned into p T Z and M13 vectors  6).  The Hindlll to BamHl 4.2 kb fragment (denoted A19 from  CB15A and E1F2 from CB15ACalO) was cloned into both M13mpl8 and  19 as well  as pTZ18U,  19U, 18R and 19R.  subclones  were put in the p T Z vectors (Fig. 6).  universal  and reverse  were  used  numerous  to  primer annealing regions  sequence  the  sequence-derived  so that sequencing  ends  of  the  oligonucleotide  Further smaller In these cases the  in the p T Z vectors  inserts.  In  primers were  addition, generated  of much of the gene proceeded in a "walking"  manner, such that sequence derived from one primer overlapped the hybridization  region  for  the  next  (Sambrook  et al.  1989).  Both  strands of the 130K gene were fully sequenced, in this manner, 3' to the A v a l  site indicated in Figure 6, with all sequences overlapping.  Sequencing of the E1F2 fragment carrying the S-layer gene from the mutant CB15ACalO proceeded in an identical manner except for the additional  investigation  between  33  the  unique  Clal  site  and  the  M  M  rH  O  M • O  >  H  H  H M Q E O V) . 3 <d Cd (X, X CQ  riJ  •5  X  IT  5'  .3 ?t  i  i  x  i  x  .  .  r , , t?t?  ^ 2  tt  . t  J  I  T  1  x  2  3  t  2  FIG. 6.  D N A region containing  segments used for D N A sequencing. coding  region.  The  sequencing  in the  positions  the  CB15A and CB15ACalO rsaA  gene and the D N A  at  which  oligonucleotide  maps  only  5' to 3' direction of  the  indicated with broken lines. lines.  terminal  rsaA  probes  Those .pointing down were used the  gene while  pointing up were used for the 3' to 5' direction. construct  r  The solid bar indicates the  hybridized are marked with arrows. for  x  T  Restriction maps of the C. crescentus  chromosomal  , ! ? _ _  It 4  J  I  Tx  _  Tr 4  3  Tx  kb  . 4  sites  The inserts  of  the  those  In the plasmid vector  D N A are  are indicated by unbroken  Those inserts, including the full Hindlll  to BamHl  fragment,  were cloned into one or more of pTZ18U, 18R, 19U, or 19R for single strand template  production.  As well, the entire Hindlll  fragment  cloned  M13mpl8  template the Hindlll  was  production. to BamHl  into  The A v a l fragment.  34  and  19  to  for "single  BamHl strand  site indicated was one of seven on  indicated Aval site (Fig. 6).  Resequencing of the rsaA A  of  the  previously  published  partial  gene from CB15A.  previous  study  (Fisher  untranslated regions of the rsaA  et al.  1988)  focussed  figure  predictive  6.  During  analysis  Caulobacter were  the  course third  5'  of  the  position  present codon  site indicated study,  bias  using  expressed  where  the  in the reported sequence, predicted amino  resulting in  acid sequence  was  a in  resequenced  by James Fisher and the staff  corrections  to  the  nucleotide  several  inaccurate.  Accordingly, a major portion of the region 5' to the Aval  Ten  the  crescentus (see below), it was noted that several errors  likely present  regions  of  the  on  gene from CB15A, but also included  sequence and the predicted translation up to the Aval in  sequence  site was  of Applied BioSystems.  sequence resulted  in  a reading  frame that was contiguous with the remainder of the gene and, using the  Delaney  reading frame predictive program,  codon bias present throughout the gene (see  exhibited  a strong  below).  Size of the regular surface array gene and predicted 130K sequence. The entire gene sequence with flanking D N A is shown in Figure 7.  The open reading frame extended for 3081 nucleotides, coding for  a protein of 1026 amino acids. contained  59  or  13  stop  The second and third forward frames codons,  respectively.  The  mature  polypeptide, with its N-terminal methionine cleaved, is predicted to  35  GCTAH£TCGACGTATGACGTTTGCTC1A1AGCCATCGCTGCTCCCATGCGCGCCACTCGGTCGCAGGGGGTGTGGGATTTTTTTTG££A£ACAATCCTC  -35  -10  *"*-130K  S.D.  1 1  M A Y T T A O T , V T A Y T N A N T , G K A P D A A T T L T L D A Y A T ATGGCCTATACGACGGCCCAGTTGGTGACTGCGTACACCAACGCCAACCTCGGCAAGGCGCCTGACGCCGCCACCACGCTGACGCTCGACGCGTACGCGA  35 100  Q T Q T G G L S D A A A L T N T L K L V N S T T A V A I Q T Y Q F CTCAAACCCAGACGGGCGGCCTCTCGGACGCCGCTGCGCTGACCAACACCCTGAAGCTGGTCAACAGCACGACGGCTGTTGCCATCCAGACCTACCAGT?  68 200  F T G V A P S A A G L D F L V D S T T N T N D L N D A Y Y S K F A CTTCACCGGCGTTGCCCCGTCGGCCGCTGGTCTGGACTTCCTGGTCGACTCGACCACCAACACCAACGACCTGAACGACGCGTACTACTCGAAG7TCGC7  101 300  Q E N R F I N F S I N L A T G A G A G A T A F A A A Y T G V S Y A C CAGGAAAACCGCTTCATCAACTTCTCGATCAACCTGGCCACGGGCGCCGGCGCCGGCGCGACGGCTTTCGCCGCCGCCTACACGGGCGTTTCG7ACGCCC  135 400  T V A T A Y D K I I G N A V A T A A G V D V A A A V A F L S R Q A AGACGGTCGCCACCGCCTATGACAAGATCATCGGCAACGCCGTCGCGACCGCCGCTGGCGTCGACGTCGCGGCCGCCGTGGCTTTCCTGAGCCGCCAGGC  168 500  N I D Y L T A F V R A N T P F T A A A D I D L A V K A A L I G ' 7 1 CAACATCGACTACCTGACCGCCTTCGTGCGCGCCAACACGCCGTTCACGGCCGCTGCCGACATCGATCTGGCCGTCAAGGCCGCCCTGATCGGCACCATC  201 600  L N A A . T V S G I G G Y A T A T A A M I N D L S D G A L S T D N A A CTGAACGCCGCCACGGTGTCGGGCATCGGTGGTTACGCGACCGCCACGGCCGCGATGATCAACGACCTGTCGGACGGCGCCCTGTCGACCGACAACGCGG  235 700  G V N L F T A Y P S S G V S G S T L S L T T G T D T L T G T A N N CTGGCGTGAACCTGTTCACCGCCTATCCGTCGTCGGGCGTGTCGGGTTCGACCCTCTCGCTGACCACCGGCACCGACACCCTGACGGGCACCGCCAACAA  268 800  D T F V A G E V A G A A T L T V G D T L S G G A G T D V L N W V Q CGACACGTTCGTTGCGGGTGAAGTCGCCGGCGCTGCGACCCTGACCGTTGGCGACACCCTGAGCGGCGGTGCTGGCACCGACGTCCTGAACTGGGTGCAA  301 900  A A A V T A L P T G V T I S G I E T M N V T S G A A I T L N T S 5 G GCTGCTGCGGTTACGGCTCTGCCGACCGGCGTGACGATCTCGGGCATCGAAACGATGAACGTGACGTCGGGCGCTGCGATCACCCTGAACACGTCTTCGG  335 1000  V T G L T A L N T N T S G A A Q T V T A G A G Q N L T A T T A A C GCGTGACGGGTCTGACCGCCCTGAACACCAACACCAGCGGCGCGGCTCAAACCGTCACCGCCGGCGCTGGCCAGAACCTGACCGCCACGACCGCCGCTCA  368 1100  A A N N V A V D G G A N V T V A S T G V T S G T T T V G A N S A A AGCCGCGAACAACGTCGCCGTCGACGGGCGCGCCAACGTCACCGTCGCCTCGACGGGCGTGACCTCGGGCACGACCACGGTCGGCGCCAACTCGGCCGCT  401 1200  S G T V S V S V A N S S T T T T G A I A V T G G . T A V T V A Q 7 A G TCGGGCACCGTGTCGGTGAGCGTCGCGAACTCGAGCACGACCACCACGGGCGCTATCGCCGTGACCGGTGGTACGGCCGTGACCGTGGCTCAA.-.CGGCCG  4 35 1300  N A V N T T L T Q A D V T V T G N S S T T A V T V T Q T A A A T A GCAACGCCGTGAACACCACGTTGACGCAAGCCGACGTGACCGTGACCGGTAACTCCAGCACCACGGCCGTGACGGTCACCCAAACCGCCGCCGCCACCC-C  468 14 00  G A T V A G R V N G A V T I T D S A A A S A T T A G K I A T V 7 L CGGCGCTACGGTCGCCGGTCGCGTCAACGGCGCTGTGACGATCACCGACTCTGCCGCCGCCTCGGCCACGACCGCCGGCAAGATCGCCACGGTCACCCTG  501 1500  G S F G A A T I D S S A L T T V N L S G T G T S L G I G R G A L T A GGCAGCTTCGGCGCCGCCACGATCGACTCGAGCGCTCTGACGACCGTCAACCTGTCGGGCACGGGCACCTCGCTCGGCATCGGCCGCGGCGCTC7GACCG  535 1600  T P T A N T L T L N V N G L T T T G A I T D S E A A A D D G F T T CCACGCCGACCGCCAACACCCTGACCCTGAACGTCAATGGTCTGACGACGACCGGCGCGATCACGGACTCGGAAGCGGCTGCTGACGATGGTT7CACCAC  568 17 00  I N I A G S T A S S T I A S L V A A D A T T L N I S G D A R V 7 I CATCAACATCGCTGGTTCGACCGCCTCTTCGACGATCGCCAGCCTGGTGGCCGCCGACGCGACGACCCTGAACATCTCGGGCGACGCTCGCGTCACGA7C  601 1800  T S H T A A A L T G I T V T N S V G A T L G A E L A T G L V F 7 G G ACCTCGCACACCGCTGCCGCCCTGACGGGCATCACGGTGACCAACAGCGTTGGTGCGACCCTCGGCGCCGAACTGGCGACCGGTCTGGTCTTCACGGGCG  635 1900  A G A D S I L L G A T T K A I V M G A G D D T V T V S S A T L G A GCGCTGGCCGTGACTCGATCCTGCTGGGCGCCACGACCAAGGCGATCGTCATGGGCGCCGGCGACGACACCGTCACCGTCAGCTCGGCGACCC7GGGCGC  668 2000  G G S V N G G D G T D V L V A N V N G S S F S A D P A F G G F E T TGGTGGTTCGGTCAACGGCGGCGACGGCACCGACGTTCTGGTGGCCAACGTCAACGGTTCGTCGTTCAGCGCTGACCCGGCCTTCGGCGGCTTCGAAACC  (Fig. 7- continued next page)  36  701 2100  L R V A G A A A Q G S H N A N G F T A L Q L G A T A G A T T F T N V CTCCGCGTCGCTGGCGCGGCGGCTCAAGGCTeGCACAACGCCAACGGCTTCACGGCTCTGCAACTGGGCGCGACGGCGGGTGCGACGACCTTCACCAACG  735  A V N V G L T V L A A P T G T T T V T L A N A T G T S D V F N L 7  2200  TTGCGGTGAATGTCGGCCTGACCGTTCTGGCGGCTCCGACCGGTACGACGACCGTGACCCTGGCCAACGCCACGGGCACCTCGGACGTGTTCAACCTGAC  768 2300  L S S S A A L A A G T V A L A G V E T V N I A A T D T N T T A H V CCTGTCGTCCTCGGCCGCTCTGGCCGCTGGTACGGTTGCGCTGGCTGGCGTCGAGACGGTGAACATCGCCGCCACCGACACCAACACGACCGCTCACGTC  801 2400  D T L T L Q A T S A K S I V V T G N A G L N L T N T G N T A V T S F GACACGCTGACGCTGCAAGCCACCTCGGCCAAGTCGATCGTGGTGACGGGCAACGCCGGTCTGAACCTGACCAACACCGGCAACACGGCTGTCACC.-.GCT  835 2500  D A S A V T G T G S A V T F V S A N T T V G E V V X X E G . G . A G . A TCGACGCCAGCGCCGTCACCGGCACGGCTCCGGCTGTGACCTTCGTGTCGGCCAACACCACGGTGGGTGAAGTCGTCACGATCCGCGGCGGCGCTGGCGC *  *  *  *  868  E . £ L X £ £ A . X A ] i E X X X G . £ A £ A G X L Y X X G . £ I G X £ I £  2 600  CGACTCGCTGACCGGTTCGGCCACCGCCAATGACACCATCATCGGTGGCGCTGGCGCTGACACCCTGGTCTACACCGGCGGTACGGACACCTTCACGGGT  901 2700  G  . X S A J 2 I F D I N A I G T S T A F V T I T D A A V G D K L D L V G GGCACGGGCGCGGATATCTTCGATATCAACGCTATCGGCACCTCGACCGCTTTCGTGACGATCACCGACGCCGCTGTCGGCGACAAGCTCGACCTCGTCG  935 2800  I S T N G A I A D G A F G A A V T L G A A A T L . A Q Y L D A A A A GCATCTCGACGAACGGCGCTATCGCTGACGGCGCCTTCGGCGCTGCGGTCACCCTGGGCGCTGCTGCGACCCTGGCTCAGTACCTGGACGCTGCTGCTGC  968 2900  G D G S G T S V A K W F Q F G G D T Y V V V D S S A G A T F V S G CGGCGACGGCAGCGGCACCTCGGTTGCCAAGTGGTTCCAGTTCGGCGGCGACACCTATGTCGTCGTTGACAGCTCGGCTGGCGCGACCTTCGTCAGCGGC  1001 3000  A .. D A V I K L T G L V T L T T S A F A T E V T, T T, A pnd GCTGACGCGGTGATCAAGCTGACCGGTCTGGTCACGCTGACCACCTCGGCCTTCGCCACCGAAGTCCTGACGCTCGCCTAAGCGAACGTCTGATCCTCGC  3100  CTAGGCGAGGATCGCTAGACTAAGAGACCCCGTCTTCCGAAAGGGAGGCGGGGTCTTTCTTATGGGCGCTACGCGCTGGCCGGCCTTGCCTAGTTCCGG7  >  •  F i g . 7. gene  The complete nucleotide sequence of the C. crescentus  and  the  predicted  amino acid code. well are  as  the  arrowed  the  single  letter  Shine-Dalgarno sequence  of 130K protein and of peptides  lines.  in  Partial amino acid sequences determined  transcription  underlined  product  rsaA  The -35 and -10 sites of the promoter region as  V 8 protease are  putative  translational  start of transcription and the  indicated.  degradation with  <  indicated  by  terminator  obtained after  contiguous palindrome  This region  cleavage  underlining. is  indicated  The region encoding the glycine-aspartate  with a broken line.  by Edman The with  repeats is  includes .five  aspartic  acids (indicated by asterisks) that may be involved in the binding of calcium ions (see text). 37  be 1025 amino acids with a calculated mass of 98,001 daltons.  This  mass  from  is  relatively  polyacrylamide  close  gel  to  the  electrophoresis  (Smit and Agabian 1984).  apparent  mass  which is  as  about  derived  105,000  daltons  The predicted amino acid profile was also  a close match to that chemically derived from purified 130K protein (Table I), again supporting the validity of these reported sequences.  Codon usage of the  rsaA  gene.  Codon usage of the structural gene was strongly biased toward use of G and C .  The overall G+C content was 68%, whereas that of  codon position 3 is 86%. time,  and was  (glutamine)  only  A was found at position 3 only 1.8% of the  used  in this  position  and G A A (glutamate).  for  two  codons: C A A  Even in cases where there is a  choice of G or C in the third position for a given codon, generally one of the two will be used in preference to the other (Schoenlein et al. 1990).  This strong codon bias aided computer analysis of the D N A  sequence  (Delaney  frame was  1983)  which confirmed that the proper reading  maintained throughout  the reported gene sequence, and  also indicated that the region immediately codon  was  non-coding.  matched closely  downstream  The codon usage frequency  used  (glutamine)  of  this  stop gene  with that of other caulobacter genes (Table II) with  the exceptions that the codons G C T (alanine), were  of the  more  frequently,  were in low  glutamine  and glutamate  sampling:  the  rsaA  and  and C A A (glutamine)  G A G (glutamate)  abundance.  and C A G  The variant codon usage for  may be the result of a statistically  gene  coded  38  for  only  20  glutamines  small and  9  TABLE I . A m i n o a c i d  c o m p o s i t i o n o f t h e 130K p r o t e i n  Amino a c i d c o m p o s i t i o n  (mol%)  from:  /Amino a c i d ' Amino  DNA sequence  acid  analysis  Ala  19.7  19.4  Arg  0.7  1.0  Asn  5.8  Asp  5.1  10. 9  Cys  0.0  ND  Gin  1. 9  Glu  0.8  Gly  12 . 0  His  0.2  0.4  He  3.8  3.8  Leu  7.4  7.9  Lys  1.0  0.9  Met  0.3  0.4  Phe  3.0  3.0  Pro  0.7  1.0  Ser  7.3  6.7  Thr  18.5  17 . 6  Trp  0.1  ND  Tyr  1. 4  1.6  Val  9.1  9.0  a  T o t a l Asn p l u s Asp; t o t a l from DNA sequence  b  ND, Not determined.  c  T o t a l G i n p l u s G l u ; t o t a l from DNA sequence  b  3. 9  C  12 .7  i s 10.9.  F o r t h e c a l c u l a t i o n s t h i s v a l u e was s e t t o 0.  39  a  i s 2.7.  C  glutamates.  Some  unexpected;  the  variation from  the  combined  pattern  was  not  size of the rsaA coding sequence reported here is  30% of the combined size of the previously published C.  crescentus  CB15 coding regions noted in Table II.  Predicted  transcription  rsaA  terminator.  The 3' end of the gene was followed by a palindrome coding for a predicted stem loop of 38 bases, with a perfect stem of 17 bp in length, a loop of 4 bases, and a calculated free energy of -27 kcal. The  last  five  nucleotides  nucleotides  include  a  in  the  relatively  stem rich  (70%), typical of factor-independent (Watson  et  especially  al.  long  1987). (as  and the  to  five  3'  deoxyribosylthymine  region  transcription termination  signals  Although this  compared  adjoining  10  base  region  factor-independent  was  not  termination  regions in other species), it is clearly atypical when compared to the high  G+C  crescentus  content  of  surrounding  D N A in general.  sequence  The m R N A  predicted termination site (about  3.2  and  Caulobacter  size indicated by  Kb) compares  well  with  this that  determined by Northern analysis (3.3 Kb) (Fisher et al. 1988).  Problems  with  subcloning  of the  and CB15ACalO and with Subcloning  fragments  S-layer gene from CB15A  sequencing  the  regular  template surface  generation.  array  gene  often  presented problems related to tolerance of the gene by E. coli even though the promoter of the gene is not recognized by E. coli (Fisher et  al.  1988).  When  the  intact 40  130K  gene  was  transcribed,  <  TABLE I I .  Codon  usage  rsaA Rel.%  Ala  rsaA..and  Other  3  ten other Caulobacter  Rel.freq.  rsaA  b  103  300  0.61  CTC  10  58  0 .19 .  39  114  0.23  CTG  64  183  0 .70 .  GCT  61  29  0.14  CTT  0  19  0 .05 .  0.01  CTA  0  3  0..01  TTG  2  15  0 .05 .  TTA  0  0  0..00  0 57 3  8 111  0.87  23  0.13  172  0.81  Leu  11  129  0 .93 ,  AAA  0  11  0..07  Met  ATG  4  63  1 . .00  Phe  TTC  78  0 .. 88  15  0..12  Lys GAC  Cys  49  GAT  4  49  0.19  CGC  8  97  0 .57  CGG  0  44  0.24  CGT  0  20  0.11  CGA  0  11  0.0 6  AGG  0  3  0.02  AGA  0  1  0.01  TGC  0  14  0.93  TGT  0  1  0.07  CAG  10  109  0.83  CAA  10  15  0.17  AAG  TTT Pro  Ser Gin  Gly '  0  58  0 .36 .  7  78  0 .53 .  CCT  1  16  0 .11 .  CCA  0  1  0 .01 .  TCC  ..... T C T  GAG  1  84  0 . 62  AGC  GAA  9  44  0.38  AGT  His  lie  a  3 0 18 0  45  0 .14  117  0 .50 .  10  0 .04 .  6 78 6  38  0.08  ACG  30  0.12  ACT  2  7  0 .02 .  ACA  0  6  0 .01 .  Trp  TGG  2  Tyr  TAC  13  0.03  CAC  3  30  0.80  CAT  0  ATC  40  8 141  83  0 . 63  271  0 0  185  76  0 .. 02  95  GGA  112  0 . 02 ' 0 .28 .  GGG  29  ACC  2 52  GGC GGT  Thr  0  CCG  TCG  0 .77  31  CCC  TCA Glu  3  GCG  AAT  Arg  Other  GCC  AAC  Asp  genes.  b  GCA Asn  in  0 .34 .  24  1.. 00  43  0 . 63  28  0 .37 .  0.20 TAT  0.96  ATT  0  8  0.04  ATA  0  0  0.00  Val  11 4  0 .. 55  GTC  46  156  GTG  35  94  0 .35 .  GTT  13  21  0 .09 .  GTA  0  5  0 .01 .  Total number of times a codon appears in 3419 codons from ten Caulobacter gcncsiflaD, flaE, flaY, trpF,  trpB, trpA,fla],flaK, sodA, and flaF (Schoenlein and Ely, 1990).  Relative synonymous codon usage frequency determined from data in previous two columns. The numbers in bold type indicate the frequency of occurrence of the preferred codon of a synonymous codon group.  41  apparently from the lac promoters in p T Z vectors, inclusion bodies could be readily seen by phase contrast microscopy (data not shown). Bacteria  containing  these  construct  plasmids  formed colonies  grew more slowly than those with just plasmid vectors. bacteria  were  used  for both  single  that  When these  stranded and double  stranded  sequencing template production, D N A yields were very low and were found to be unusable as for sequencing.  When these inserts  were  cloned in reverse orientation to the lac promoter or out of frame with respect to the lac (3-galactosidase problem was not alleviated. Clal  When the 5' region of the gene to the  site was removed, similar difficulties were encountered.  constructs, internal  including the  Bell  fragment  manner above. the  fragment in pUC-type plasmids, the  full  be  generated  from  nature  due  shadow when  genes  missing  to  Ml 3  care  incubation times sequencing plasmid  was  (Fig. 6),  (even  in  specific clones  deletions,  bands from great  to Pstl  with  and recA of  the  usually  different gels. to  the  unexpected  from M l 3 constructs carrying  hsdR  would  taken  behaved in  regions  sequencing was  fragment and the 2346 bp  also  Sequencing templates  length  frequently  Clal  hosts)  insert.  be  insert  pick  single  heterogeneous sizes  plaques  as  template.  in  resulting  and  in  even when  When double stranded  turned to as an alternative, D N A from large used  would  Template  This problem persisted  were kept to a minimum.  preparations was  Other  scale  Strangely, resulting  sequencing gel films had bands across all four lanes for any given set of reactions, corresponding to every possible nucleotide position, as if  42  all four termination mixes had been added to each reaction. stranded sequencing  was  repeated  using further purified D N A from  CsCl-EtBr gradients and purified by the but  the  problem  remained.  Double  Bio-Rad Prep-a Gene system,  Finally  the  mini  P E G precipitation  method of Kraft et al. (1988) was used, but without success. It may be that within the 2346 bp BeII  fragment  there  is a  fortuitous site of transcription initiation which E. coli recognized and consequently  a gene product was  made that E. coli found toxic in  high amounts.  When present in high copy number this problem was  exacerbated.  During  template  incubation  times  necessary  for  sequencing  production, genetic deletions would occur in some of  constructs.  The  resulting  mutants  would  grow  faster  than  the the  original clones, later accounting for a heterogeneous mix of prepared template, gels. of  which when  used, lead to  shadow  bands  and unreadable  These problems may have also been responsible for the failure  the  double  stranded sequencing  techniques.  However,  chemical  contamination of the mixes and/or nicking of the plasmids may have been additional factors. For  sequencing  purposes  this  was  overcome  by  subcloning  smaller fragments (Fig. 6), in reverse orientation to the lac promoter. Subclones  of  the  S-layer  gene  from  identical manner to those of CB15A.  43  CB15ACalO  behaved  in  an  Primary  structure  analysis  of  the  predicted  amino  acid  sequence. General  analysis.  The  rsaA  gene  polypeptide of 1026 al.  was  3081  nucleotides  amino acids.  long,  coding  for  a  As previously reported (Fisher et  1988), there was no indication of a cleaved signal leader peptide;  only the N-terminal methionine is absent in the mature protein. predicted  amino  acid  composition  derived  from  DNA  The  sequence  matched closely with the amino acid profile derived from purified Slayer protein (Table I), with the exception glutamate  and  underestimated  glutamine, by  1.2%.  amino acid analysis due  to  which It is,  technique  degradation  during  of the combined score for  direct  however,  amino not  hydrolysis  analysis  uncommon  to under-represent acid  acid  for  these amino  (K.  Walsh,  the  acids,  personal  communication).  Peptide  analysis.  Amino revealed two nucleotide acids  acid  sequencing  peptides  from  the  130K  protein  sequences that aligned to the translation of the  sequence.  which  of  One peptide  aligned with  647 to 661 (Fig. 7).  yielded a sequence of  the region  corresponding  15  rsaA amino  to amino  acids  The other peptide yielded a sequence that was  six amino acids long, the first five of which aligned to the end of the predicted 130K protein sequence.  The sixth residue, a glycine, is one  of the most common contaminants to occur in amino acid sequencing and  can  sequenator  be  scored  as  the  next  amino  acid  in  cases  has in fact reached the 3' end of a peptide.  44  where  the  The amino  acid 5' to the start of this peptide (glutamate) for  V8  protease  cleavage  and  there  was  was a predicted site no  other  comparable  alignment within the protein or within a translation of the other two reading frames.  Thus, it is likely that the five amino acid sequence  represented the entirety The presence stop  codon  was  in  of the protease-cleaved  peptide.  of this peptide confirmed that the the predicted fact  the  one  used  for  termination  of  130K.  Moreover, the derivation of this peptide from a mature 130K protein indicated that no post-translational processing from the 3' end of the protein  was  likely.  Cleavage  of  peptides  from  the  3'  end  is  apparently part of the mechanism of excretion used in some other bacterial exported proteins (Wandersman 1989); this is not the case for 130K.  Since it was demonstrated in previous studies that beyond  the removal of the initial methionine residue there is no processing of  the  5' terminal (Fisher et al.  1988),  it  appears  for the  130K  protein that post-translational cleavage of peptides is not part of the mechanism of protein export. comparable  to  the  The 130K protein is  hemolysins  and  in this  metalloproteinases  cleaved after secretion if at all (Ludwig et al.  1988;  sense  which  are  Wandersman  1989). Specific  amino  acid  abundance  and  implications.  The predicted 130K protein sequence was very low in sulfurcontaining amino acids (and had no cysteine residues is the case with other S-layer proteins. sequence amino  contained  acids  an unusually  (threonine,  45  The predicted 130K protein  high proportion of  asparagine,  [Table III]) as  serine,  glycine,  small neutral alanine,  and  TABLE III. Characteristics of S-layers proteins including secondary structure deduced from DNA sequence of cloned genes. Cleaved Organism of  Conformation  S-layer protein  of S-array  origin  lattice •  Caulobacter crescentus Campylobacter fetus*  hexagonal  Rickettsia  tetragonal  hexagonal  prowazckifi  Aeromonas salmonicida^ Bacillus sphaericus Deinococcus radiodurans^ Acetogenium kivui Rickettsia rickettsii^ Halobacterium halobium Bacillus brevis OWP Bacillus brevis MWP°  tetragonal tetragonal  1  hexagonal hexagonal  k  tetragonal m  n  hexagonal hexagonal hexagonal  Percent of  N-terminal  Predicted  Number  Number of  signal  isoelectric  Of  Residues  sequence*  point  cysteines  •  3  3  1026 933  no  1612 • 502 1176 1036 762  no  1299 852 1004 1053  ro  21 a.a. 3 0 a.a. yes  2 6 a.a. ?  c  Percent of residues in  and • c' d serine  Specified conformation Helical  Extended, Turn  Coil  13 . 8 7.8  3,.46 . 4..55  0 1  25.8 21.3  25 .0 39 .3  58 . 7' 46 .3  4..85 4 .79 4 . 69 4..54 4. ,75  3 0 0 7  17 . 4 15.2 18 . 5 19.6 14.5 17 . 7 19.7 16.4 11.6  16 ,.2 36 ,.2 56 ,, 8 12 ,.8 29 ,.2 17 ,. 6 27 .. 6 42 .. 1 56,,2  62,.7  6. 5 7.3  45 ,, 5 32 ,. 9 67 ,.7  8. ,5 2, ,6 8. ,3  58 ,. 8 62 ,, 9 46 ,,2 42 ,. 4 27 ,, 8  5,. 8 11,,0 5,9 7 .,5  5,.30 3..21 4. ,49 4 .28  3 4 a.a. 2 4 a.a. 2 3 a.a.  0  threonine  0 2 0 0 0  a  Number of predicted amino acid residues from DNA sequence.  b  If N-terminal signal sequence length is known it is indicated by the number of amino acids.  c  Values from the mature protein where cleavage site is known (ie. after signal cleavage but not accounting for possible C-terminal cleavage of  the Rickettsial S-layers)': otherwise full precursors as predicted from DNA sequence. d  The percentage of serine and threonine out of the total number of amino acid residues within the S-layer protein.  c  By the method of Gamier (16).  1  Blaser and Gotschlich 1990.  ' Bowditch et al. 1989. 1  Gilmour et al. 1989.  & Carl et al. 1990.  h  Chu et al 1991.  J Peters et al. 1987.  k  Peters et al. 1989.  m  Lechnerand Sumper 1987.  n  Tsuboi et al. 1986..  46  °Tsuboi et al. 1988.  2.3  13.7  9.5 7.5 11.1 6. 6 . 5.2 13.5 15.8 9.4 8.3  valine).  Necessarily,  abundance.  This  higher  results  mass  in  the  amino mature  predicted molecular mass of 98,001 daltons  acids protein for its  in  lower  having 1025  length, and an average amino acid mass of only 95.6 The C-terminal of the Deinococcus  were  a  low  amino acid  daltons.  radiodurans  S-layer (HPI)  protein has a high proportion of aromatic amino acids.  Although not  as pronounced in the  130K protein, the first and last thirds of the  130K protein contained most of the aromatic residues.  One striking  feature of the 130K protein was that fully 25.8% of the residues were threonine  or serine.  This was mainly due to a high abundance  threonine,  accounting  sequenced  S-layers  hydroxylated 21.3%  in the  hexagonal  for  also contain  amino  acids  surface  arrays  18.5%  of  the  higher  (Table  130K  residues.  ranging  from  11.6%  array protein of Campylobacter  of Halobacterium  halobium  are also close to the top of this range.  two  proteins  are  Deinococcus Moreover, these  possibly  being the outermost for  a functional  selected  analogous  lipopolysaccharide.  If S-layers  environment,  may  hydroxylated  ruled out.  Peters  S-layers,  et  al.  possibly  layers of the cells, may be heavily hydroxylated  role  they  1987;  at  Glycosylation of the 130K protein has not yet been detected, been rigorously  Sumper  The  1987).  not  and  to  and  it has  (Lechner  quite  of  serines  although  threonines  glycosylated,  up  fetus.  and  radiodurans S-layer  Other  than normal proportions  III),  of  groups  to  glycosidic  block the  compensate by  the  for  presenting  of  the  exposure of LPS to  the  this them  residues  loss  of  presented  themselves.  A  hydroxylated outer surface may play an important role in presenting 47  a relatively hydrophilic surface to the world. All  charged  amino  acids  except  for  aspartate  were  in  low  abundance, resulting in a net negative charge of -40 at p H 5.6 and a pi of 3.46.  This value is unusually low for a protein; however other  S-layer proteins also have acidic pis,  mainly ranging from about 3 to  5.5 (Table III) and the predicted pi for the cell surface glycoprotein of Halobacterium  halobium,  glycosylation, is only 3.21  after cleavage of the signal and without (Table III).  Although aspartate was not  more prevalent than in an average protein (5.2%  of 130K residues),  because of the low amount of other charged amino acids, it accounted for 63% of all charges and 85% of the negative charges in the 130K. The  net  negative  charge  important role in attachment subunit interactions.  of  the  in  key  There is  positions  probably plays  an  of the S-layer to the cell or subunitevidence  mediated specifically by calcium cations. residues  130K  within  that both interactions  are  It is possible that aspartate the  folded  protein  enable  attachment via calcium bridging, either to another 130K molecule or to  an  oligosaccharide  attachment.  of  The regions  the  cell  envelope  of homology  implicated in  with other calcium-requiring  proteins (discussed below) add significant support to this  Predicted  protein  Protein  secondary  secondary  several analysis programs. sheets methods  were  readily  structure  structure  STayer  hypothesis.  analysis.  predictions  were  made  using  No long stretches of a-helix or (3-pleated  obvious.  The  secondary  structure prediction  of Gamier, Osguthorpe, and Robson (Gamier et al. 48  1978),  and  GGBSM  (Gascuel  and  Golmard  1988)  gave  somewhat  contradictory predictions, although both claim a success rate of 56 to 59%.  Respectively,  they predicted 25% helical, 59% extended,  2%  turn, 14% coil (Table III), and 29% helical, 26% extended and 45% coil.  Based  method  on  secondary  for all the  S-layers  structure  predictions  with known amino  predicted from nucleic acid sequence, the predictions  are the  entirely  estimates  of  unknown  sequence)  average  secondary would  indicate  have lower levels of cx-helical  III).  of  that  structure  the  Gamier  acid sequence, as  130K secondary structural  (Table  structures  by  Circular  other  dichroism  S-layers  S-layers  in  (most  general  of  may  (<2-19%) and P-structure  (20-44%) and a higher level of aperiodic (random coil) structure than indicated by the above Gamier predictions (Baumeister Bingle  et al.  1986; Dooley et al. 1988;  Koval  1988;  et al.  1982;  Phipps et  al.  1983). The 130K protein is fully secreted to the exterior of the cell and the  S-layer  indeed  can  assembles on the self-assemble  1981a).  Thus  integral  secondary  structures  surface  with  no  of  the  outer  membrane and  membrane  present  (Smit  spanning  regions,  one  membrane  which predictive methods  are able to  et al. of  the  identify,  were not expected to be present. The  130K protein  sequence  structures including helical wheels.  was  evaluated  for  These regions of a-helix  predominance of hydrophobic residues hydrophilic residues  also  specific with a  on one side of the helix and  on the other are known to have a role in the  export of some proteins, including the hemolysins 49  (Koronakis et al.  1989), to which 130K shares some homology.  The region from amino  acids 130 to 145 fulfilled some of the criteria established for such a helical  wheel,  but  based  on  current  published  information  judged inadequate to suggest that function with confidence.  was  Helical  wheels often interact in pairs and there was no nearby sequence to the  above  indicated  region  that  looked  likely  to  form  such  a  structure. Indeed, how cleaved  130K is exported remains unknown.  signal leader peptide  recent  studies  involving  (Fisher et al.  fusions  1988).  between  rsaA  It has no  Moreover, our and a  cellulase  reporter gene indicated that the initial amino acids did not function as  a  signal  unpublished).  leader  equivalent  (Wade  Bingle  and  John  Smit  The data reported here indicate that 3' cleavage does  not occur during export.  It is likely that other proteins  (perhaps  'chaperones') are involved with facilitating particular stages of export as has been described for the hemolysins (Blight and Holland and  Erwinia  chrysanthemi  Wandersman  Protein  (Delepelaire  and  scans.  Using the P C / G E N E  130K  B  1989).  homology  search the  metalloprotease  1990)  sequence analysis program F S T P S C A N  Swiss Prot release  17 for homologous  to  sequences to the  protein, many small areas (17-34 amino acids) of identity were  identified exported  within or  intermediate  several  proteins.  structural proteins S-layer  protein  of 50  Most  including Deinococcus  of the  these  proteins  were  hexagonally-packed radiodurans.  This  TABLE IV. Homology between 130K and several surface layer proteins.  Organism and protein  %identical  a  %similar  Campylobacter fetus surface array protein  24.0  16.6  Rickettsia prowazekii surface protein antigen  21.4  19.5  Aeromonas salmonicida surface virulence A-protein  20.0  17.5  Bacillus sphaericus 125 kDa S-layer protein  18.3  19.7  Deinococcus radiodurans HPI-layer surface protein precusor  18.0  16.4  Acetogenium divui S-layer protein precursor  17.8  15.6  Rickettsia rickettsii 120 kD surface-exposed protein  17.5  14.6  Halobacterium halobium cell surface glycoprotein precursor  16.0  17.5  Bacillus brevis outer wall protein precursor  15.0  16.1  Bacillus brevis middle wall protein precursor  14.3  13.1  b  Alignments performed by the PC/GENE program P A L I G N using the structure-genetic matrix and an open gap cost of 7 and a unit gap cost of 2. a  %identical indicates the percentage of identical amino acid pairs in aligned sequences. %similar indicates the percentage of conservatively similar amino acid pairs in the aligned  sequences. Amino acids said to be similar are: A,S,T; D,E; N,Oj R,K; I,L,M,V; F,Y,W.  51  program was  useful  in identifying proteins for further testing  the P C / G E N E program P A L I G N . establish  that  with  Using P A L I G N it was possible to  130K protein had a reasonable  degree  of  homology  with other S-layer proteins (Table IV), although it showed that 130K was not closely related to most of them. surface  protein  130K  protein, with 24% identity and 16.6% conservative substitution.  One  possibly  showed  limiting  the  the  greatest  degree  of  similarity to  fetus  the  factor  array  The Campylobacter  homology  between  130K  protein and other S-layer proteins is that at the present there is only one  other  hexagonal  Campylobacter 1988a),  fetus  for  which  arrangement VC119  is  of  array  in  a  gram-negative  23D surface array protein (Sleytr and Messner protein  sequence  S-layer  protein  the  tetragonal  (oblique  is  available.  from  [Dubreuil et al.  to compare the sequence of this  available,  with  that  of  the  hexagonal  The  lattice  Campylobacter  interesting  strain 23D.  bacterium,  array  fetus  1990]); it should be  S-layer, if it becomes S-layer  protein  from  It may be possible that even though they arrange into  different lattice conformations, they are closely related in sequence. Using the F A S T A program, the 120kD surface exposed protein of Rickettsia  rickettsii  was found to match better to 130K than all  other S-layer proteins on the Swissprot including this  the  release,  accessible useful  for  Campylobacter however  it  was  through the F A S T A representing  fetus the  15.  protein are not to be found on most  program.  homology  52  Most S-layer proteins  in  recent  version  The F A S T A a  different  that  was  program was  way  from  the  P A L I G N program.  Whereas P A L I G N will give homology scores for  entire regions of homology the F A S T A program will select the most favorable regions of homology within the proteins and give identity and  similarity scores for these specific  regions.  Thus the  FASTA  program was able to indicate specific regions of interest within the 130K  protein that  were  homologous  to  specific  regions  of  other  proteins. One  such region, the N-terminal of 120kD protein of  rickettsii, V)  of  scored 20% identity with a 457 amino acid stretch (Table  the  exported  Rickettsia  130K protein near the  and  structural proteins  C-terminal.  were  also  Matches  found.  to  One  other was  fragment of the apomucin gene from pigs (Timpte et al. 1988).  a  This  protein is made up of repeats of 81 residues and is rich in threonine, serine, glycine, and alanine, as is the 130K protein, accounting for the high degree of homology noted in Table V . the  C-terminal  portion  precursor B of Erwinia 1989).  There was  including  strong  repeats.  The same  of  the  extracellular  chrysanthemi  32%  identity  homology area of  over the  Another match was with  (Delepelaire  over a 129 a  region  130K  metalloproteinase and Wandersman  amino acid overlap,  with  protein  glycine-aspartate that  matched  the  glycine-aspartate repeats in proteinase B matched a similar region in the  extracellular  metalloproteinase  of  30.5% homology over 131 amino acids.  Serratia  marcescens,  with  This region of 130K protein  also shared homology with similar regions from hemolysins (Devinish and  Rosendal 1991; Ludwig et al. 1987).  These glycine-rich repeat  regions have been implicated in the binding of calcium.  53  TABLE V. 130K homology search of the Swiss Prot 15 sequence bank using F A S T A .  3  Region in Region in Organism and protein  %identical  b  protein  130K  0  d  Rickettsia rickettsii 120 kD surface-exposed protein  20  1-459  541-998  Sws scrofa apomucin  20  1-434  240-672  31  327-457  844-969  Erwinia chrysanthemi protease B precursor  32  302-428  817-942  Bordetella pertussis adenylate  15  316-1067  154-907  Escherichia coli hemolysin A (plasmid)  16  76-428  106-459  Actinobacillus pleuropneumononiae hemolysin  30  713-815  830-936  Serratia marcescens 50kD metallo-protease  a  precursor  cyclase-haemolysin  Alignments performed by the FASTA program after searching the Swiss Prot release 15 using a k-  tuple value of 2. b  %identical indicates the percentage of identical amino acid pairs in aligned sequences.  c  The stretch of amino acids in the protein homologous to an area of the 130K protein.  d  The stretch of amino acids in the 130K protein homologous to an area in the protein.  54  Possible calcium binding region of the 130K protein. Calcium is known to be a factor in the maintenance of the crescentus  S-layer (Smit et al. 1981b).  essential  role in attachment  may be  involved  with  of the  been proposed, by John Smit, whereby cation mediating  surface  Calcium has a specific and  S-layer to the cell  subunit-subunit  attachment  interactions.  surface and  A model  has  calcium acts as a divalent  by ionic  S-layer and a specific membrane-associated [Fig. 8]).  C.  bridging between  the  oligosaccharide (S. A . O.  Such a model predicts that specific  regions of the 130K  protein must be adapted to interact with calcium ions to accomplish the  bridge  interaction.  glycine-aspartate regions  may  interactions; molecule  The  repeat regions  also that is  be  current in fact  involved  in  hypothesis  proposes  serve that function.  surface  calcium may facilitate  array  that These  subunit-subunit  binding of  one  S-layer  to another.  In the cases of the hemolysins hemolytica,  from E. coli and  Pasteurella  calcium is required for biological activity and is related  to the presence of glycine-rich repeat regions (Devinish and Rosendal 1991; Ludwig et al. 1987).  The glycine-rich repeats are usually nine  amino acids in length (Table VI).  They contain conserved  aspartates  usually separated by 8 amino acids and include a high proportion of glycine residues, which can participate in p-turns.  These sharp turns  may allow the aspartates to be positioned in a group orientation so as to allow the binding of calcium ions. successive  nonapeptide  repeat 55  units  It has been proposed that three can  form  finger-like  loop  130K  Fig. 8.  monomer  calcium ion  SAO  molecule  A model to describe the roles of 130K protein, calcium and  specific membrane-associated oligosaccharide (S. A . O.) by John Smit. Part A  schematically  diagrams a possible  arrangement in wildtype  CB15A while part B diagrams possible arrangements for the calcium independent molecule,  mutant CB15ACalO.  possibly  aspartates,  Negative  charges  on the  S-layer  bind to a calcium which also binds  another S-layer molecule or the S. A . 0.  In the CB15ACalO case, the  S. A . O. molecule is either not present in the outer membrane or it is greatly reduced.  Surface array then forms in the media as a single  layer or a double layer.  Recent 3-D reconstruction data (Smit and  Baumeister unpublished) would indicate that the shed surface array is  more likely a double layer with calcium bridging together  arrays instead of one array and S. A . O. molecules.  56  two  T A B L E VI. Comparison of consensus sequences for putative Calcium binding regions  Organism and protein  Consensus sequences for glycine rich repeats  Escherichia coli h e m o l y s i n  X  L  X  G  Bordetella pertussis adenylate cyclase-haemolysin  t/x  L  X  G  Erwinia  g/x  X  G  G d/x  3  n/d  D  G d/x  D  chrysanthemi protease B  X  L  X  G  G  X  G  X  D  Serratia marcescens 50kD metallo-protease  X  L  X  G  G  A  G  X  D  A  D  Caulobacter crescentus 130K  a  T  1/x t / x  G  G  A  G  T h e consensus sequences for putative calcium binding, glycine-rich repeats are shown using the single  letter amino acid code, w i t h X denoting no preference for one particular amino acid. A n uppercase letter indicates that the residue occurs more than 50% of the time i n that position for a given repeat i n that protein. Lowercase letters indicate the residue is preferred over others i n that position but occurs less than 50% of the time there.  57  structures,  thereby  generating  (Ludwig  et  1987).  al.  metalloproteases Wandersman  stabilized  an  octahedral  These by  calcium  regions  calcium  are  ions  binding  also  site  found  (Delepelaire  in and  1989).  There may be a similar role for the corresponding region in 130K (Fig. 7).  This region contains four or possibly five  aspartate repeats,  compared to nine and eleven to  in Actinobacillus  pleuropneumoniae  and E.  sixteen reported  coli  (Devinish and Rosendal 1991; Ludwig et al. 1987). of Erwinia  chrysanthemi,  repeats  the  and  contains et al.  only  three  1986).  (Delepelaire  Sequencing calcium  zinc  contains  metalloprotease  (Delepelaire  Both proteins  of  of  Sequencing  only  six  are  also  stabilized  reported  marcescens  and Wandersman 1989,  the  regular  surface  mutant  by  Nakahama  calcium  ions  CB15CalO  from the  Clal  the  site to the end of the  result  This  from  array gene of the calcium  and  CB15A.  gene  CB15ACalO.  of the regular surface  mutant  array  between the rsaA  of  The protease B  Serratia  gene indicated no difference that  hemolysins  and Wandersman 1989).  independent  independent  however,  glycine-  is  gene of  puzzling  as  CB15CalO  previous  work,  indicated that a defect was present in the region of the protein 3' to the unique Clal site (ie. the last 82% of the gene). CB15ACalO  (phenotype  calcium independent  explained  above)  mutant by John Smit.  of CB15A cells on calcium deficient M j o H i G G  58  was  isolated  Successive so  as a  subculturing  \[^ medium resulted  in about 1 in 10 efficiency  cells  6  forming  on P Y E medium.  described above.  colonies,  relative  These mutants  to  the  plating  shed their S-layers  as  One of these mutants, CalO, was randomly selected  for further experiments. In  experiments  performed  by  Patti  Edwards, an  attempt  to  localize a potential mutation in the rsaA  gene of CalO, the regions to  either side of the Clal  were  CB15A  and the  site  (Fig.  CB15ACalO  matched hybrid genes.  6)  S-layer  switched  between  genes, in effect  making mix-  When the hybrids were put into C B 2 A , a non  S-layer-producing strain, then the hybrid with the back (3') the  gene  from  bacterium  CalO  made  a  patchy  in  electronmicroscopy.  The  S-layer  that  appeared  fashion  other  when  hybrid  to  82% of  cover  examined  produced  S-layer  which  The results  experiment  were not entirely clear and it was  determined that  experiment  should be repeated in a more stringent manner.  same patchy  examined.  labelling  However,  was  indicated  in most  in later experiments,  were put into C B 1 5 A K S A C ,  these hybrid  gene.  It  was  also  the  Again bacteria  constructs  between the clones carrying each  hybrids: both produced apparently normal S-layers. hypothesized  the  of this  an S-layer gene knockout mutant, and  there was no noticeable difference  data it was  of  the by  appeared to fully cover the cell, as wildtype.  the  the  that the  proposed  rsaA that  To explain these  from CalO because  the  was  a mutant  mutation  was  compensated for in the CB15A background but not in the C B 2 A , the interacting  molecules  in  the  CB2A  were  Sequencing of the gene, as described above, was  59  slightly  different.  then attempted in  order to find the mutation in the mutant gene. The layers  CalO  from  differently  S-layer protein, as was the case with all other S-  calcium  run  any  electrophoresis  than  Also, all subcloned fragments of the rsaA  gene  with respect  130K  from wildtype.  (Fig.  6)  from  wildtype  A19  CalO  independent to  did  polyacrylamide gel  appeared to be identical to  fragments  electrophoresis.  mutants,  in  size  as  estimated  not  the corresponding from  agarose  gel  These data suggested that if a mutation in the S-  layer gene of CalO were present, it was likely a point mutation or a small deletion which resulted in a minor change to the amino acid sequence. Since examined  the  investigated found  the  "mix-match"  experiments  lipopolysaccharide of  Steven  Walker  these Caulobacters.  In  has every  case where the S-layer is shed, including CalO, he has  that  the  bacteria  lack  a  specific  membrane-associated  oligosaccharide (S. A . O.) that is present on wild type cells.  This  molecule is therefore a potential candidate for the attachment site of the S-layer molecule (Fig. 8). that of Aeromonas  This arrangement would be similar to  salminocida  where  the  outer  membrane O-  polysaccharide (part of a unique-length smooth LPS) probably binds the S-layer protein to the cell (Griffiths and Lynch mix-match therefore  experiments be  a  double  to  be  mutant  explained,  the  with  mutation  one  1990).  CalO  formation or transfer of S.A.O. to its proper position.  For the  mutant  must  preventing  the  One must also  propose that the S.A.O. of CB2A is slightly different from that of CB15 because  the  S.A.O.  of  CB2A  will  60  not compensate  for the  second  mutation: that is  a mutation in the last 82% of the  S-layer  gene.  Unfortunately, no second mutation was identified by sequencing, and this would appear to be in conflict with the mix-match experiments.  61  REFERENCES  Agabian,  N . , Evinger, M . , and Parker, G .  asymmetry  during development.  1979.  Segregation  proteins in Caulobacter. J. Cell Biol. 81: Anast, N . , and Smit, J. 1988. caulobacters  and  experimentation. Atkinson.T.,  and  Generation of  123-136.  of  their  potential  Appl. Environ. Microbiol. 54: M.  Oligodeoxyribonucleotides  1984. by  the  IRL Press, Oxford,  for  genetic  809-817.  Solid-phase  Synthesis  phosphite-triester  Oligonucleotide Synthesis: A practical approach. Gait.  type-specific  Isolation and characterization of marine  assessment  Smith,  of  method  of in  Edited by M . J.  pp 35-81.  Bagdasarian, M , Lurz, R., Ruckert, B., Franklin, F. C. H . , Bagdasarian, M . M . , Frey, J . , and Timmis, K . N . 1981. cloning  vectors.  RSFlOlO-derived cloning in Barany, F . 1985.  II.  Broad  vectors,  host  Specific-purpose plasmid  range,  high  and a host-vector  Pseudomonas.  copy  number,  system for gene  Gene 16: 237-247.  Single-stranded hexameric linkers: a system for in-  phase insertion mutagenesis and protein engineering.  Gene 3 7 :  111-123. Baumeister, W . , Karrenberg, F . , Racher, R., Engel, A . , Ten Heggeler, B., and Saxton, W. O. 1982.  The major cell envelope protein of  Micrococcus radiodurans characterization. Eur. J. Biochem. 125: Baumeister,  (Rl).  535-544.  W . , Wildhaber, I., and Engelhardt, H . 1988.  62  Structural and  Bacterial  c  surface  proteins.  Some  structural, functional  and evolutionary  aspects. Biophys. Chem. 29: 39-49. Beveridge,  T . J . , and Murray, R. G . E . 1976.  surperficial layers of Spirillum  Dependence  putridiconchylium  of the  on C a  2 +  and  S r . Can. J. Microbiol. 22:1233-1244. 2 +  Bio-Rad  Laboratories.  1989.  Bacterial  Electro-transformation  Pulse Controller Instruction Manual. Version Bingle, W . H . , Doran, J. L . , and Page, W. J. 1986. the surface layer protein from Azotobacter Microbiol. 32:  Characterization of vinelandii.  High-level expression  crescentus  transcription/translation paracrystalline  2-89.  Can. J.  112-120.  Bingle, W. H . , and Smit, J. 1990. Caulobacter  and  vectors for  incorporating  initiation  surface-layer-protein  regions  gene.  Plasmid  the  of  the  24:  143-  149. Birnboim, H . C . and Doly, J. 1979.  A rapid extraction procedure for  screening recombinant plasmid D N A . Nucl. Acid Res. 7:  1513-  1524. Blaser, M . J . , and Gotschlich, E . C. 1990. Campylobacter Chem. 265:  fetus: cloning and gene structure.  B , P-glycoprotein  Structure and function of  and other  family of membrane translocators.  members  of the gene encoding  63  of  a novel  M o l . Microbiol. 4:873-880.  Bowditch, R. D., Baumann, P., and Yousten, A . A . 1989. sequencing  J. of Biol.  14529-14535.  Blight, M . A . , and Holland, I. B . 1990. haemolysin  Surface array protein of  a 125-kilodalton  Cloning and surface-layer  protein from Bacillus  spaericus  2362 and of a related cryptic  gene. J. Bacteriol. 171: 4178-4188. Brent, R., and Ptashne, M . 1980.  The lexA gene product represses its  own promoter. Proc. Natl. Acad. Sci. U S A 77: 1932-1936. Carl, M . , Dobson, M . E . , Ching, W. M . , and Dasch, G . A . Characterization  of  the  gene  paracrystalline-surface-layer  encoding  protein  of  the  1990.  protective  Rickettsia  prowazekii:  presence of a truncated identical homolog in Rickettsia  typhi.  Proc. Natl. Acad. Sci. U S A 87: 8237-8241. Conchas, R.F., and Carniel, E . 1990.  A highly efficient  system for transformation of Yersinia.  electroporation  Gene 87: 133-137.  Chu, S., Cavaignac, S., Feutrier, J., Phipps, B. M . , Kostrzynska, M . , Kay, W. W., and Trust, T. J. 1991.  Structure of the tetragonal surface  virulence array protein and gene of Aeromonas  salmonicida.  In press, J. Biol. Chem. Delaney, A . D., 1983.  A D N A sequence handling program. Nucl. Acid.  Res. 10: 61-67. Delepelaire,  P., and Wandersman, C . 1989.  Erwinia  secretion  by  chrysanthemi. J. Biol. Chem. 264: 9083-9089.  Devinish, J., and Rosendal, S. 1991. for  Protease  biological  produced  activity  Calcium binds to and is required  of  the  by Actinobacillus  104-kilodalton  hemolysin  pleuropneumoniae  serotype  1.  Can. J. Microbiol. 37: 317-321. Dooley, J. S. G . , McCubbin, W. D., Kay, C. M . , and Trust, T. J. 1988. Isolation protein  and  biochemical  from a pathogenic 64  characterization Aeromonas  of  the  hydrophila  S-layer strain. J.  Bacteriol. 1 7 0 : 2631-2638. Dower, W. J . , Miller, J. F., and Ragsdale, C. W. 1988. transformation  of  E.  coli  by  high  High efficiency  voltage  electroporation.  Nucleic Acids Res. 1 6 : 6127-6145. Dubreuil, J. D . , Kostrzynska, M . , Austin, J. W., and Trust, T. J. 1990. Antigenic  Differences  among  Campylobacter  fetus  S-Layer  Proteins. J. Bacteriol. 1 7 2 : 5035-5043. Ely, B., and Croft, R. H . 1982.  Transposon mutagenesis in  Caulobacter  crescentus. J. Bacteriol. 1 4 9 : 620-625. Ely,  B.,  and Johnson,  Caulobacter Farinha,  R.  C.  1977.  Generalized  transduction  in  crescentus. Genetics 8 7 : 391- 399.  M . A.,  and  electroporation  Kropinski,  A.  M.  of Pseudomonas  1990.  High  aeruginosa  eeiciency  using frozen cell  suspensions. F E M S Microbiol. Lett. 7 0 221-226. Fisher, J.A., Smit, J., and Agabian, N . 1988. the major surface  Transcriptional analysis of  array gene of Caulobacter  crescentus.  J.  Bacteriol. 1 7 0 : 4706-4713. Gamier, J . , Osguthorpe, D. J . , and Robson, B. 1978.  Analysis of the  accuracy and implications of simple methods for predicting the secondary structure of globular proteins.  J. M o l . Biol. 1 2 0 : 97-  120. Gascuel, O., and Golmard, J. L . 1988. the  secondary  accuracy.  structure  A simple method of predicting  of globular proteins:  implications  CABIOS 4: 357-365.  Gilmore Jr., R. D., Joste, N . , and McDonald, G . A . 1989. expression  and  and  sequence  analysis  65  of  the  gene  Cloning,  encoding  the  120kD  surface-exposed  Microbiol. 3: Griffiths,  S.  protein of Rickettsia  salmonicida  W. H .  1990.  Characterization of  variants with altered cell surfaces and  their use in studying surface protein assembly. 154:  Mol.  1579-1586.  G . , and Lynch,  Aeromonas  rickettsii.  Arch. Microbiol.  308-312.  Hanahan, D. 1983.  Studies on transformation of Escherichia  plasmids. J. Mol. Biol. 166: Hanahan, D. 1985.  coli with  557-580.  Techniques for transformation of E. coli, p. 109-  114. In D. M . Glover (ed.),  D N A Cloning Techniques: A Practical  Approach. Volume 1, IRL Press, Oxford. Holmes, D.S. and Quigley, M . 1981. A rapid boiling method for the preparation  of  bacterial plasmids.  Anal.  Biochem.  114:  193-  197. Jacobs, M . , Wnendt, S., and Stahl, U . 1990. transformation  of  Escherichia  mixtures. Nucl. Acids Res. 18:  coli  High-efficiency  with D N A from ligation  1653.  Koronakis, V . , Koronakis, E . , and Hughes, C . 1989. analysis  of  Escherichia membranes.  the  C-terminal  coli  hemolysin  electro-  signal protein  Isolation and  directing across  export  both  of  bacterial  E M B O J. 8:595-605.  Koval, S. F . , and Murray, R. G . E . 1984.  Isolation of surface array  proteins from bacteria. Can. J. Biochem. Cell. Biol. 62:  1181-  1189. Koval, S. F . 1988.  Paracrystalline protein surface arrays on bacteria.  Can. J. Microbiol. 34:  407-414. 66  Kraft, R., Tardiff, J . , Krauter, K . S., and Leinwand, L . A . 1988. mini-prep  plasmid  DNA  templates with Sequenase. Lechner,  J . , and  Sumper,  for  sequencing  double  Using  stranded  BioTechniques 6: 544-546.  M . 1987.  procaryotic glycoprotein.  The primary structure  Cloning and sequencing  surface glycoprotein gene of Halobacteria.  of  a  of the cell  J. Biol. Chem.  262:  9724-9729. Liebl, W., Bayerl, A . , Schein, B., Stillner, U . , and Schleifer, K . H . 1989. High  efficiency  glutamicum  electroporation  of  intact  Cory neb  acterium  cells. F E M S Microbiol. Lett. 65: 299-303.  Luchansky, J. B . , Muriana, P. M . , and Klaenhammer, T. R.  1988.  Application of electroporation for transfer of plasmid D N A to Lactobacillus, Bacillus,  Lactococcus,  Staphylococcus,  Leuconostoc,  Listeria,  Enterococcus and  Pediococcus,  Propionibacterium.  Molec. Microbiol. 2: 637-646. Ludwig, A . , Jarchau, T., Benz, R., and Goebel, W . 1988. domain of Escherichia for its  coli haemolysin  Ca2+ -dependent  Genet. 214:  responsible M o l . Gen.  553-561. Characterization of  from wastewater treatment  Microbiol. 57: Mersereau,  is  binding to erythrocytes.  MacRae, J. D . , and Smit, J. 1991. isolated  (HlyA)  The repeat  electroporation.  Appl.  Environ.  751-758.  M . , Pazour,  transformation  systems.  caulobacters  of  G.  J.,  and  Das,  Agrobacterium  Gene 90:  A.  1990.  Efficient  tumefaciens  b y  149-151.  Miller, J. F . , Dower, W. J . , and Tompkins, L . S. 1988.  High-voltage  electroporation Campylobacter U S A 85: Mitchell,  of  bacteria:  Genetic  transformation  of  jejuni with plasmid D N A . Proc. Natl. Acad. Sci.  856-860.  D . , and Smit, J. 1990.  Identification  of  genes  production of the adhesion organelle of Caulobacter CB2. J. Bacteriol. 172:  affecting crescentus  5425-5431.  Myers, E . W., Miller, W. 1988.  Optimal alignments  in linear space.  CABIOS 4: 11-17. Nakahama, K . , Yoshimure, K . , Marumoto, R., Kikuchi, M . , Lee, I. S., Hase, T., and Matsubara, H . 1986.  Cloning and sequencing of a  Serratia protease gene. Nucleic. Acids Res. 14: Newton,  A . 1984.  cell  cycle,  5843-5855.  Temporal and spatial control of the Caulobacter p. 51-75.  In P. Nurse  and E . Streiblova  (ed.s),  Microbial Cell Cycle. CRC Press, Boca Raton, F L . O'Neill, E . A . , Kiely, G . M . , and Bender, R . A . 1984. encodes  streptomycin  Bacteriol. 159:  resistance  in  Transposon Tn5  nonenteric  bacteria.  J.  388-389.  Pearson, W. P., and Lipman, D. J. 1988. sequence comparison.  Improved tools for biological  Proc. Natl. Acad.  Sci. U S A 85:  2444-  2448. Peters J . , Peters, M . , Lottspeich, F . , Schafer, W . , and Baumeister, W. 1987.  Nucleotide  Deinococcus sequence,  and  Bacteriol. 169:  sequence analysis  radiodurans  of the gene encoding  the  surface protein, derived amino acid  complementary  protein  chemical  studies.  J.  5216-5223.  Peters, J., Peters, M . , Lottspeich, F., and Baumeister, W. 1989.  68  S-layer  protein gene of Acetogenium Escherichia  kivui: cloning and expression  coli and determination of the nucleotide  J. Bacteriol. 171:  sequence.  6307-6315.  Phipps, B . M . , Trust T. J . , Ishiguro, E . E . , and Kay, W. W . Purification A-protein  in  and characterization of the cell from Aeromonas  salmonicida.  surface  1983.  virulence  Biochemistry  22:  2934-2939. Poindexter, J.S. 1964.  Biological properties and classification  of the  Caulobacter group. Bacteriol. Rev. 28: 231-295. Poindexter, J.S. 1981.  The caulobacters: ubiquitous unusual bacteria.  Microbiol. Rev. 45: 123-179. Sambrook, J., Fritsch, E . , and Maniatis, T. 1989. 2nd ed.  Molecular cloning,  Cold Spring Harbor Laboratory, Cold Spring Harbor,  N.Y. Sanger, F . , Nicklen, S., and Coulson, A . R . 1977. chain-terminating inhibitors.  D N A sequencing with  Proc. Natl. Acad.  Sci. U S A 74:  5463-5467. Schoenlein, P . V . , Gallman, L . S., Winkler, M . E . , and Ely, B. Nucleotide  sequence of the Caulobacter  flbT genes and an analysis G+C-rich genomes.  thuringiensis  and B.  T.,  and  Rood,  J.  I. 69  1989.  Efficient transformation  cereus strains  endotoxin gene. M o l . Gen. Genet. 218: P.  with  Gene 93:17-25.  Transformation of acrystalliferous  Scott,  flaF and  of codon usage in organisms  Schurter, W., Geiser, M . , and Mathe, D. 1989. of Bacillus  crescentus  1990.  via  electroporation:  with a cloned delta-  177-181. Electroporation-mediated  transformation  of  lysostaphin-treated  Clostridium  perfringens.  Gene 82: 327-333. Shapiro.  L . 1985.  Generation  of polarity during Caulobacter cell  differentiation. Ann. Rev. Cell Biol. 1: 173-207. Simon, R., Priefer, U . , and Puhler, A . 1983.  A broad host range  mobilization system for in vivo genetic engineering:  transposon  mutagenesis in Gram negative bacteria. Bio/technology  1: 784-  790. Sinha, N . D . , Biernat, J . , McManus, J . , and Koster, H . 1984. support oligonucleotide N,  synthesis.  N-dialkylamino  deoxynucleosides simplifying  XVIII: Use of b cyanoethyl-  N-morpholino  for  deprotection  the  Polymer  phosphoramidite  synthesis  of  and disolation  of  DNA the  of  fragments  final  product.  Nucl. Acids Res. 12: 4539-4557. Sleytr, U . B . , and Messner, P. 1988a. bacteria, p. 160-186. M.  Crystalline surface  layers  on  In U . B. Sleytr, P. Messner, D . Pum, and  Sara (ed.), Crystalline bacterial cell surface layers. Springer-  Verlag K G , Berlin. Sleytr, U . B . , and Messner, P. 1988b.  Crystalline surface  layers in  procaryotes. J. Bacteriol. 170: 2891-2897. Smit, J . , Grano, D. A . , Glaeser, R. M . , and Agabian, N . 1981a. surface  array in Caulobacter  crescentus:  Periodic  Fine structure  and  chemical analysis. J. Bacteriol. 146: 1135-1150. Smit, J . , Hermodson M . , and Agabian, N . crescentus  pilin:  Purification,  70  1981b.  chemical  Caulobacter  characterization  and  the NH2-terminal amino acid sequence of a structural protein regulated during development. Smit,  J.,  and  Agabian,  morphogenesis:  N.  J. Biol. Chem. 256:  1982.  Biogenesis of  Cell  surface  a periodic  3092-3097.  pattering  surface  and  array during  Caulobacter development. J. Cell Biol. 95: 41-49. Smit, J . , and Agabian, N . 1984. Caulobacter  crescentus  characterization  of  the  assays. J. Bacteriol. 160: Smit, J. 1986.  Cloning of the major protein of the periodic surface  cloned  by  expression  1137-1145.  as  model  systems.  Wiley & Sons, Inc., New York.  Edited by M . Inouye.  of  bacterial  plasmid  John  pp. 343-376.  D . K . , and Withers, H . L . 1990.  transfer  protein  and  Protein surface layers of bacteria. In Bacterial outer  membranes  Summers,  peptide  layer: Detection  Electrotransfer: direct  D N A by  electroporation.  Nucl.  Acids Res. 18: 2192. Timpte, C . S., Eckhardt, A . E . , Abernethy, J. L . , and Hill, R. L . 1988. Porcine  submaxillary  gland  apomucin  repeated identical sequences of 81 residues.  contains  tandemly  J. Biol. Chem. 263:  1081-1088. Tinoco, I., Borer, P. N . , Dengler, B. D., Levine, M . D., Uhlenbeck, O. C , Crothers, D. M . , and Gralla, J. 1973.  Improved estimation  of  secondary structure in ribonucleic acids.  Nature New Biol. 246:  40-41. Tsuboi A . , Uchihi, R., Tabata, R., Takahashi, Y . , Hashiba, H . , Sasaki, T., Yamagata,  H.,  Tsukagoshi,  N.,  and  Udaka,  Characterization of the genes coding for two 71  S.  major cell  1986. wall  proteins  from  protein-producing  Bacillus  brevis  47:  nucleotide sequence of the outer wall protein gene. 168:  complete  J. Bacteriol.  365-373.  Tsuboi A . , Uchihi, R., Adachi, T., Sasaki, T., Hayakawa, S., Yamagata, H . , Tsukagoshi, N . , and Udaka, S. genes for  the  hexagonally  protein-producing  1988.  Characterization of  arranged  Bacillus  surface  brevis  47:  layer proteins  complete  sequence of the middle wall protein gene.  the in  nucleotide  J. Bacteriol.  170:  935-945. Vieira,  J . , and  Messing,  J.  1987.  Production  plasmid D N A . Methods Enzymol. 153: Wandersman,  C.  1989.  Secretion,  bacterial extracellular proteases.  of  single-stranded  and  activation  1-11.  processing  M o l . Microbiol. 3:  of  1825-1831.  Watson, J. D., Hopkins, N . H . , Roberts, J. W., Steitz, J. A . , and Weiner, A . M.  1987.  Molecular biology  of  the  gene. Fourth E d .  The  Benjamin/Cummings publishing company Inc., Menlo Park, C A . Wirth, R., Friesenegger, various  species  different  genera  A . , and Fiedler, S. 1989. of  gram-negative  by electroporation.  bacteria  Transformation of belonging  Molec. Gen. Genet.  to  11 216:  175-177. Wood, W . B . 1966. coli:  Host specificity of D N A produced by  Bacterial  Mutations  affecting  the  Modification of D N A . J. Mol. Biol. 16: 118-133.  72  Escherichia  Restriction  and  APPENDIX  Parameters Field voltage distance.  involved  in  electroporation.  strength, expressed  differential across  in kV/cm,  is  a measurement  of the  the sample divided by the interelectrodal  The time constant (expressed in milliseconds [msec]) is the  time it takes the peak voltage  of an electroporation pulse,  decline to Vo/e, and is a way to express the pulse length.  V o , to  The pulse  length can be modified in the apparatus by resistors in parallel to the electroporation cuvette, using the Pulse Controller.  Modification of  capacitance settings (expressed in pF), allows adjustment of the total quantity of current delivered to the electroporation cuvette.  73  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098433/manifest

Comment

Related Items