Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

In vivo in vitro synthesis of ribosomal RNA in bacillus subtilis 1988

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
UBC_1988_A1 W42.pdf [ 6.61MB ]
UBC_1988_A1 W42.pdf
Metadata
JSON: 1.0098343.json
JSON-LD: 1.0098343+ld.json
RDF/XML (Pretty): 1.0098343.xml
RDF/JSON: 1.0098343+rdf.json
Turtle: 1.0098343+rdf-turtle.txt
N-Triples: 1.0098343+rdf-ntriples.txt
Citation
1.0098343.ris

Full Text

IN VIVO AND IN VITRO SYNTHESIS OF RIBOSOMAL RNA IN BACILLUS SUBTILIS by VERA ANN B. WEBB B.A. C a l i f o r n i a State University, Long Beach, 1976 B.Sc. The University of Liverpool,. 1979 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES Department of Microbiology We accept t h i s thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA August 1988 © Vera Ann B. Webb, 1988 In p r e s e n t i n g this thesis in partial fu l f i lment of the r e q u i r e m e n t s f o r an a d v a n c e d d e g r e e at the Univers i ty of Brit ish C o l u m b i a , I agree that the Library shall m a k e it freely available f o r re ference a n d s t u d y . 1 further agree that p e r m i s s i o n f o r ex tens ive c o p y i n g of this thesis f o r scholar ly p u r p o s e s may b e g r a n t e d b y the h e a d of m y d e p a r t m e n t o r b y his o r her representat ives . It is u n d e r s t o o d that c o p y i n g o r p u b l i c a t i o n of this thesis f o r f inancial ga in shall n o t b e a l l o w e d w i t h o u t m y w r i t t e n p e r m i s s i o n . D e p a r t m e n t T h e U n i v e r s i t y of Brit ish C o l u m b i a V a n c o u v e r , C a n a d a D a t e \i Qci^hev n n DE-6 (2/88) ABSTRACT The work p r e s e n t e d e x p l o r e d t h e i n v i v o and i n v i t r o s y n t h e s i s o f r i b o s o m a l RNA i n t h e Gram p o s i t i v e , s p o r e - f o r m i n g b a c t e r i u m B a c i l l u s s u b t i l i s . The i n v e s t i g a t i o n began w i t h a s t u d y o f rRNA s y n t h e s i s i n B. s u b t i l i s d u r i n g s t e a d y s t a t e g r o w t h and under n u t r i t i o n a l s h i f t - u p c o n d i t i o n s . The p e r c e n t of t r a n s c r i p t i o n w h i c h i s r i b o s o m a l RNA was measured by h y b r i d i z a t i o n o f p u l s e l a b e l e d RNA t o a s p e c i f i c DNA p r o b e c a r r y i n g t h e 3' end o f t h e 23S RNA gene. The f r a c t i o n a l r a t e o f r i b o s o m a l RNA s y n t h e s i s i n c r e a s e d w i t h c e l l u l a r growth r a t e , and showed a r a p i d i n c r e a s e a f t e r a n u t r i t i o n a l s h i f t up. RNA s y n t h e s i s d u r i n g i n f e c t i o n w i t h an amber mutant of b a c t e r i o p h a g e SP01 was a l s o examined. I n f e c t e d c e l l s c o n t i n u e d t o s y n t h e s i z e rRNA a t t h e p r e i n f e c t i o n r a t e , b u t c o u l d n o t r e s p o n d t o media e n r i c h m e n t by i n c r e a s i n g t h e p e r c e n t rRNA- s y n t h e s i s . The l a t t e r s t u d y s u g g e s t e d t h e e x i s t e n c e o f a s p e c i f i c RNA p o l y m e r a s e t h a t t r a n s c r i b e d r i b o s o m a l RNA genes. The c o n c l u s i o n s from t h e i n v i v o s t u d y l e d t o an a n a l y s i s o f rRNA t r a n s c r i p t i o n i n v i t r o . The i s o l a t i o n o f t h e p u t a t i v e r i b o s o m a l RNA s p e c i f i c RNA p o l y m e r a s e was a t t e m p t e d by a f f i n i t y chromatography on c e l l u l o s e complexed w i t h p l a s m i d DNA c o n t a i n i n g t h e promoter r e g i o n o f t h e B. s u b t i l i s r r n B rRNA o p e r o n , and by s e d i m e n t a t i o n t h r o u g h a g l y c e r o l g r a d i e n t . No d i f f e r e n c e i n a c t i v i t y p r o f i l e was o b s e r v e d when t r a n - s c r i p t i o n a c t i v i t y a t t h e rRNA tandem p r o m o t e r s was compared t o a c t i v i t y a t a n o n - r i b o s o m a l p r o m o t e r . Since i n vivo analysis of the control of rRNA synthesis i n Escherichia c o l i suggested that regulation occurs at the l e v e l of transcription i n i t i a t i o n , i n v i t r o transcription i n i t i a t i o n at the B. s u b t i l i s rRNA promoters was investigated using the single round transcription assay. I n i t i a l rates of transcription were different at each of the two tandem promoters of the B. s u b t i l i s rrnB operon: the upstream promoter, PI, i n i t i a t e d slowly, while the downstream promoter, P2, i n i t i a t e d faster. In addition, transcription i n i t i a t i o n at the two promoters appeared to be linked. The formation of a heparin resistant complex at the PI promoter affected the s t a b i l i t y of the heparin resistant complex formed at the P2 promoter. The ki n e t i c s of transcription i n i t i a t i o n at the tandem rRNA promoters were examined using the tau plot analysis. RNA polymerase had a high a f f i n i t y for both rRNA promoters, but the rate of i n i t i a t i o n at these promoters was r e l a t i v e l y slow when compared to non-ribosomal promoters. F i n a l l y , transcription i n i t i a t i o n on two a r t i f i c i a l tandem promoter constructs was compared with i n i t i a t i o n on the native tandem promoter construct. In general, PI was shown to have a positive effect on transcription from downstream promoters, but had s p e c i f i c effects on different promoters. i i i TABLE OF CONTENTS A b s t r a c t i i T a b l e o f c o n t e n t s i v L i s t o f T a b l e s v i L i s t o f F i g u r e s v i i L i s t o f A b b r e v i a t i o n s • x Acknowledgements x i I . INTRODUCTION 1 I I . MATERIALS AND METHODS A. B a c t e r i a l s t r a i n s , Phage, and P l a s m i d s 16 B. Media and Growth C o n d i t i o n s 18 C. B a c t e r i o p h a g e SP82 B u r s t A s s a y 19 D. T r a n s p o r t A s s a y s 19 E. P r e p a r a t i o n o f P u l s e - L a b e l e d RNA 20 F. C o n s t r u c t i o n o f pVG-1... 21 G. H y b r i d i z a t i o n A s s a y s 21 H. C a l c u l a t i o n o f P e r c e n t i n v i v o rRNA S y n t h e s i z e d 24 I . pHD1.8 D N A - C e l l u l o s e Column 26 J . P u r i f i c a t i o n o f B. s u b t i l i s Holoenzyme.. 26 K. T r a n s c r i p t i o n A s s a y s 28 I I I . IN VIVO RESULTS 30 A. I n t e r a c t i o n o f C u l t u r e C o n d i t i o n s and SP82 I n f e c t i o n 31 B. rRNA S y n t h e s i s i n an U n i n f e c t e d C u l t u r e 42 i v C. rRNA Synthesis i n an Infected Culture....... 50 D. Summary of In Vivo Results 55 IV. IN VITRO RESULTS A. Templates Used f o r In V i t r o T r a n s c r i p t i o n Studies 56 B. I s o l a t i o n of rRNA S p e c i f i c RNA Polymerase 61 C. E f f e c t of Assay Parameters on Tra n s c r i p t i o n from the rRNA Promoters 69 D. Tr a n s c r i p t i o n from PI Af f e c t s T r a n s c r i p t i o n from P2 78 E. K i n e t i c Analysis of Tr a n s c r i p t i o n I n i t i a t i o n at Tandem rRNA Promoters 90 F. Formation of Heparin-Resistant Complexes on Mutant rRNA Constructs 100 G. Summary of In V i t r o Results 120 V. DISCUSSION A. Ribosomal RNA Synthesis during Steady State and N u t r i t i o n a l S h i f t Up i n B. s u b t i l i s . . 123 B. Using SP01 to Probe RNA Polymerase P a r t i t i o n i n g 125 C. RNA Synthesis i n Phage Infected B. s u b t i l i s 127 D. I s o l a t i o n of rRNA S p e c i f i c RNA Polymerase 130 E. Single Round Tr a n s c r i p t i o n Assay 132 F. Heparin Resistant Complex Formation at PI Aff e c t s Heparin Resistant Complex Formation at P2 136 G. K i n e t i c Analysis of Tra n s c r i p t i o n I n i t i a t i o n at the rRNA Promoters.. 145 H. Tran s c r i p t i o n I n i t i a t i o n from Promoters on Mutant Tandem Promoter Constructs 147 I. Summary 150 REFERENCES v 153 LIST OF TABLES Table I. Growth Rates for B. s u b t i l i s i n Various Media 36 Table I I . Exponential Rate Constants for Total RNA per C e l l , Percent Active RNA Polymerase, and SP82 Burst Size 41 Table I I I . Summary of Shi f t Up Experiments 53 Table IV. Relative RNA Polymerase A c t i v i t y at PI and P2 Promoters of pPldP2 107 Table V. DNA Sequences at the rrnB PI and P2 Promoters 137 v i LIST OF FIGURES Figure 1. Construction of Plasmid pVG-1 22 Figure 2. Effect of SP01am34 Infection on Nutrient Transport 33 Figure 3. Burst Size of SP82 as a Function of Host C e l l Growth Rate 38 Figure 4. Hybridization of Pulsed Labeled RNA to Cloned Ribosomal DNA 43 Figure 5. Rate of Ribosomal RNA Synthesis as a Function of Growth Rate 46 Figure 6. The Kinetics of Ribosomal RNA Synthesis Following a N u t r i t i o n a l Shift Up 48 Figure 7. The Effect of SP01am34 Infection on the Synthesis of Ribosomal RNA ." 51 Figure 8. Structure of Plasmids Containing the Promoter Regions of rrnB Operon 57 Figure 9. Structure of Plasmids Containing the Promoter Region of Two §29 Promoters 59 Figure 10. Elution P r o f i l e of RNA Polymerase A c t i v i t y from pHD1.8 DNA-Cellulose Column 63 Figure 11. Specific RNA Polymerase A c t i v i t y i n Glycerol Gradient Fractions 67 Figure 12. The Effect of RNA Polymerase Concentration on Transcription i n i t i a t i o n from A2, PI, and P2 70 v i i Figure 13. The Effect of I n i t i a t i o n Time on Transcription I n i t i a t i o n from A2, G2, PI, and P2 73 Figure 14. The Effect of the Nucleotide Composition of the I n i t i a t i o n Mix on Transcription I n i t i a t i o n from the Separated Ribosomal Promoters 75 Figure 15. The Effect of I n i t i a t i o n Nucleotides on Transcription I n i t i a t i o n from P2 79 Figure 16. The Effect of PI Deletion from the rRNA Promoter Template on Transcription I n i t i a t i o n from P2 83 Figure 17. The Effect of P2 Deletion from the rRNA Promoter Template on Transcription I n i t i a t i o n from PI 86 Figure 18. The Effect of RNA Polymerase Concentration on Transcription I n i t i a t i o n at the P2 Promoter of the Tandem Promoter Template 88 Figure 19. Kinetic Analysis of I n i t i a t i o n Complex Formation at the A2 Promoter 91 Figure 20. Semilogarithmetic Plot of the Data from an I n i t i a t i o n Time Course with the Tandem rRNA Promoter Template 95 Figure 21. Tau Plot of I n i t i a t i o n Complex Formation at the PI and P2 Promoters 98 Figure 22. Structure of the Wild Type Promoter Region and an Insertion Mutant of the rrnB Operon 101 Figure 23. The Effect of Increasing the Distance between the PI and P2 Promoters ..104 Figure 24. Structure of the Tandem Promoter Region of Plasmid pPlA2 109 v i i i Figure 25. The Effect of I n i t i a t i o n Nucleotides on Transcription I n i t i a t i o n from the Tandem Promoters of pPlA2 I l l Figure 26. Time Course of Transcription I n i t i a t i o n at the A2 Promoter When the PI rRNA Promoter Is Upstream 115 Figure 27. Effect on Transcription I n i t i a t i o n at the PI Promoter When the <|)29 A2 Promoter Is Downstream 120 i x LIST OF ABBREVIATIONS 2-ME 2-mercaptoethanol cpm Counts per minute EDTA Ethylenediaminetetra-acetic a c i d h Hour kb Kilobase min Minute moi M u l t i p l i c i t y of i n f e c t i o n PFU Plaque forming units PMSF Phenylmethylsulfonyl f l u o r i d e SDS Sodium dodecyl su l f a t e SSC 0.15 M NaCl, 0.015 M sodium c i t r a t e , pH 7 TBE 1 M T r i s base, 1 M Boric Acid, 0.2 M EDTA TCA T r i c h l o r o a c e t i c a c i d u growth rate uL m i c r o l i t r e ug microgram uM micro molar x ACKNOWLEDGEMENTS Over the past 8 years I have worked with many people i n the Department of Microbiology; we have celebrated the good times and they have helped me through the rough times, thank you everyone. In partic u l a r I would l i k e to thank B i l l Ramey and the people on the Second Floor. I would l i k e to give special thanks to the people who have shared the lab with me: George Spiegelman, for being my friend and for teaching me how to do science without losing sight of The Big Questions; Kathy Dobinson, for keeping me going when I wanted to give up; Harry Deneer, Loverne Duncan, Stephen Wellington, Fereydoun Sajjadi, and a l l the others for being themselves. F i n a l l y , I would l i k e to thank my husband, Tim Webb, and my mother, June Budarf, for unwavering love, support, and encouragement. x i I. INTRODUCTION The a b i l i t y of b a c t e r i a l c e l l s to grow and divide depends on many factors: the transport of nutrients from the surrounding medium, the conversion of those nutrients to accessible energy, and the use of that energy i n the synthesis of macromolecules, such as RNA, DNA, polysac- charides, and protein. Under a l l growth conditions for Escherichia c o l i cultures, protein comprises at least half the c e l l mass (Bremer and Dennis, 1987). The engine of protein synthesis, the b a c t e r i a l ribosome, i s a complex organelle composed of 52 proteins (r-proteins) and three RNAs (rRNA). Schleif (1967) noted that under the most favorable laboratory conditions ribosomes can make up as much as 40% of the t o t a l dried c e l l u l a r mass of the bacterium E. c o l i . Over the l a s t ten years the coordination of the synthesis of the ribosomal components i n E. c o l i has been examined by a number of different groups (Maaloe, 1979; Nomura, et a l . , 1984; Lindahl and Zengel, 1986; Bremer and Dennis, 1987; Travers, 1987). I t has been found that when rRNA molecules are unavailable for binding by r-proteins, certain r - proteins function as i n h i b i t o r s of protein synthesis from their own messenger RNAs (Nomura, et a l . , 1984; Lindahl and Zingel, 1986). In other words, a primary rate l i m i t i n g step i n the synthesis of the ribosome, and hence protein synthesis and c e l l growth i n general, i s the synthesis of rRNA. The work presented i n t h i s Ph. D. Thesis explored the i n vivo and i n v i t r o synthesis of rRNA i n the Gram posi t i v e , spore-forming bacterium 1 B a c i l l u s s u b t i l i s . In t h i s introductory section I w i l l f i r s t summarize the current understanding of global control of rRNA synthesis i n bacteria, p a r t i c u l a r l y E. c o l i . Second, I w i l l b r i e f l y describe the structure of the operons which encode rRNA genes. I w i l l then consider recent experiments which characterize the control of rRNA synthesis i n both E. c o l i and B. s u b t i l i s . Since rRNA i s the ultimate product from the r r n operons, that i s , no t r a n s l a t i o n a l amplification occurs, tran- sc r i p t i o n i n i t i a t i o n i s thought to be a primary s i t e of fine control; thus, I w i l l discuss the current understanding of the stages of transcription i n i t i a t i o n and the potential sites at which the i n i t i a t i o n process can be controlled. I w i l l conclude with a brief summary of the work presented i n the body of the thesis. A. Relationship between ribosome content and growth rate The rate at which a b a c t e r i a l c e l l grows dictates the rate of ribosome accumulation (Maaloe, 1979; Gausing, 1980). The number of ribosomes per c e l l for E. c o l i cultures growing over a range of different growth rates has been calculated and found to increase as the growth rate increases (Bremer and Dennis, 1987); that i s , the number of ribosomes rather than the a c t i v i t y of individual ribosomes responds to changes i n demand for increased protein synthesis. As I noted above, according to the current models for the control of ribosome synthesis, the synthesis of rRNA i s probably the rate l i m i t i n g step i n the production of new ribosomes. The i n i t i a t i o n rate at rrn genes has been calculated and found to increase from 4 i n i t i a t i o n s per minute per gene i n cultures with a doubling time of 100 min to 61 i n i t i a t i o n s per minute per gene i n cultures with a 24 min doubling time (Bremer and Dennis, 1987). What i s 2 the mechanism which controls the rate of i n i t i a t i o n at the r r n operons? Two basic models have been proposed: the feedback regulation model (Nomura, et a l . , 1984) and the d i r e c t regulation model (Bremer and Dennis, 1987). Feedback r e g u l a t i o n — T h e feedback regulation model proposes that rRNA synthesis i s regulated by free, non-translating ribosomes which prevent the synthesis of ribosomes i n excess of the amount needed for protein synthesis. The model makes a number of predictions which have been tested experimentally. The f i r s t p r e d i c t i o n i s that rRNA synthesis rates w i l l not be s i g n i f i c a n t l y affected by changes i n gene dosage. Experimental evidence has shown that an increase i n copy number of complete rRNA operons resulted i n a decrease i n rRNA t r a n s c r i p t i o n from the i n d i v i d u a l rRNA operons while the o v e r a l l rate of rRNA t r a n s c r i p t i o n was maintained at a constant l e v e l (Dennis, 1971; Jinks-Robertson, et a l . , 1983). The second p r e d i c t i o n i s that p r e f e n t i a l i n h i b i t i o n of ribosome assembly w i l l lead to a d e f i c i e n c y of free ribosomes which should cause a stimulation of rRNA synthesis. Using condi t i o n a l mutants i n ribosome assembly Takebe, et a l . (1985) showed that rRNA synthesis increased under non-permissive conditions. While a body of i n d i r e c t support for the feedback regulation model e x i s t s , a key p r e d i c t i o n , namely, i n v i t r o i n h i b i t i o n of rRNA synthesis by free ribosomes, has not been shown. Direct r e g u l a t i o n — T h e basic premise of the d i r e c t regulation model i s that the synthesis of rRNA i s c o n t r o l l e d d i r e c t l y by RNA polymerase. The model postulates that the c e l l u l a r pool of a c t i v e l y t r a n s c r i b i n g RNA polymerase i s divided i n two forms: form I which transcribes stable RNA 3 genes (rRNA and tRNA) and form II which transcribes a l l other genes. The the nucleotide guanosine tetraphosphate (ppGpp) i s the suggested agent for the conversion between the two forms of RNA polymerase (Travers, et a l . , 1980; Ryals, et a l . , 1982). The strong inverse correlation of the i n t r a c e l l u l a r concentration of ppGpp to the f r a c t i o n a l rate of stable RNA synthesis ( r s / r t ) during steady state growth and n u t r i t i o n a l shift-up conditions supports the more general role for t h i s nucleotide i n control of rRNA synthesis (Ryals, et a l . , 1982; L i t t l e , et a l . , 1983). Using well defined amber mutations, the beta subunit of RNA polymerase has been unambiguously shown to be a target for ppGpp (Glass, et a l . , 1986). A synthesis of the models—Recent experimental evidence has suggested that the feedback regulation and the direct regulation models are not mutually exclusive. Cole and co-workers (1987) constructed a s t r a i n i n which they could examine the effects of translation i n i t i a t i o n factor IF2 l i m i t a t i o n by placing the chromosomal copy of the gene encod- ing IF2 under lac promoter/operator control. Low concentrations of the lac inducer isopropyl thiogalactoside (IPTG) resulted i n a s i g n i f i c a n t decrease i n growth rate, an increase i n RNA content, and a large accumulation of non-translating ribosomes which were unable to cause feedback regulation of rRNA synthesis. The induction of IF2 synthesis led to a transient repression of rRNA synthesis before a new steady-state rate was attained. The authors suggest that a c t i v e l y translating, rather than non-translating, ribosomes lead to feedback regulation of rRNA. A possible interpretation of their results i s that with the induction of IF2 synthesis, the non-translating ribosomes were able to i n i t i a t e protein synthesis, which led to an increase i n uncharged tRNA and the 4 subsequent p r o d u c t i o n o f ppGpp, and t h a t t h i s l a t t e r e f f e c t , i n t u r n , c a u s e d t h e t r a n s i e n t r e p r e s s i o n o f rRNA s y n t h e s i s . B. S t r u c t u r e of r i b o s o m a l RNA operons I n E. c o l i f o u r o f t h e seven r r n operons a r e c l u s t e r e d n ear t h e o r i g i n o f r e p l i c a t i o n , w h i l e t h e o t h e r t h r e e a r e l o c a t e d w i t h i n t h e f i r s t h a l f o f t h e chromosome t o be r e p l i c a t e d (Nomura, e t a l . , 1984). I n B. s u b t i l i s , c l u s t e r i n g about t h e o r i g i n i s even more pron o u n c e d : seven o f t h e t e n r r n operons a r e w i t h i n 166 kb o f t h e o r i g i n o f r e p l i c a t i o n (about 20% o f t h e c o d i n g c a p a c i t y of t h a t r e g i o n ) , w h i l e t h e o t h e r t h r e e o perons a r e a l s o l o c a t e d w i t h i n t h e f i r s t h a l f o f t h e chromosome t o be r e p l i c a t e d (Widom, e t a l . , 1988). W h i l e t h e most d e t a i l e d a n a l y s i s of t h e rRNA ope r o n s t r u c t u r e has been made i n E. c o l i , no s i g n i f i c a n t d i f - f e r e n c e s have been n o t e d i n t h e o v e r a l l o p e r o n s t r u c t u r e i n B. s u b t i l i s ( L a F a u c i , e t a l . , 1986). B r i e f l y , t h e r e i s a tandem promoter r e g i o n ( s e e b e l o w ) , f o l l o w e d by a 171-173 base p a i r l e a d e r between t h e P2 promoter and t h e s t a r t o f t h e mature 16S c o d i n g r e g i o n . Between t h e 16S and t h e 23S genes i s a 350-450 base p a i r s p a c e r r e g i o n w h i c h o f t e n c o n t a i n s 1 o r 2 tRNA genes. The 23S gene i s f o l l o w e d by t h e 5S gene. D i s t a l t o t h e 5S gene a n o t h e r 1 o r 2 tRNA genes can be encoded. C. C h a r a c t e r i z a t i o n o f t r a n s c r i p t i o n f r o m rRNA p r o m o t e r s Many f a c e t s of t r a n s c r i p t i o n of rRNA operons have been e x t e n s i v e l y i n v e s t i g a t e d . For example, L i e t a l . (1984) l o c a l i z e d t h e a n t i t e r m i - n a t i o n system i n v l o v e d i n E. c o l i rRNA s y n t h e s i s . However, t h e r e g u l a - t i o n o f a n t i t e r m i n a t i o n i s superimposed on t h e mechanism o f growth r a t e 5 regulation; and as Gourse et a l . (1986) have shown, the sequences which confer growth rate regulation are i n the promoter region (see below). Thus, the experiments described i n t h i s section w i l l focus on only two areas of research: experiments characterizing d i f f e r e n t i a l transcription from the tandem rRNA promoters, and experiments delineating non-promoter control sequences i n the promoter region of the rRNA operon. The tandem promoter arrangement has been defined as two (or more) promoters oriented i n the same dir e c t i o n which transcribe the same gene or operon (McClure, 1985). Tandem promoters are found i n the control regions of many bacte r i a l operons that encode the components of the protein synthesizing system. The structure of these tandem promoters i s such that each has near-consensus sequences at the -35 and -10 regions and the two start sites are separated by 70-120 bases (Lindahl and Zengel, 1986). The spacing between these tandem promoters t h e o r e t i c a l l y allows the binding of an RNA polymerase molecule at each promoter s i t e , and thus makes them different from other tandem promoters such as those at the gal operon i n E. c o l i (Musso, et a l . , 1977; Aiba et a l . , 1981) or the veg promoters i n B. s u b t i l i s (Le Grice and Sonenshein, 1982) which overlap and permit only one polymerase molecule i n the promoter region. In E. c o l i greater than one t h i r d (6 out of 17) r-protein operons and a l l seven rRNA operons have a tandem promoter structure (reviewed i n Lindahl and Zengel, 1986). In B. s u b t i l i s less i s known about the structure of the promoter regions of r-protein operons, but nine of the ten rRNA operons have a tandem promoter arrangement (K. Bott and R. Rudner personal communication). 6 In E. c o l i the expression of the two rRNA promoters d i f f e r s . Recombinant DNA techniques have been used to demonstrate that i n vivo each of the two rRNA promoters i s functionally d i s t i n c t . Sarmientos and Cashel (1983) created a plasmid which contained the tandem promoter region of the rrnA operon fused to the terminator region of the rrnB operon to show that transcription from the upstream promoter (PI) increased exponentially with growth rate and predominated at high growth rates, and that transcription originating at the downstream promoter (P2) changed only s l i g h t l y at different growth rates. They also demonstrated that upon carbon starvation, a c t i v i t y from PI was not detectable but a c t i v i t y from P2 persisted. Sarmientos, et a l . , (1983) showed i n another set of experiments using the same construct that i n vivo transcription a c t i v i t y from the PI promoter was subject to stringent control, while a c t i v i t y from the P2 promoter was i n h i b i t e d by amino acid starvation i n both wild type and relaxed strains. In a s t r a i n containing a plasmid i n which the P2 region had been deleted, transcription from the PI promoter showed stringent regulation. More recently, Gourse, et a l . (1986) used lysogens containing various rrnB Pl-lacZ gene fusions to show that growth rate regulation i n E. c o l i takes place at the PI promoter i t s e l f . Thus, i n E. c o l i , the PI promoter i s growth rate regulated, stringently controlled, and predominant at high growth rates, while the P2 promoter i s c o n s t i t u t i v e l y expressed. The upstream promoter need not be the growth rate regulated one of the p a i r . Deneer and Spiegelman (1987), constructed plasmids which contained the B. s u b t i l i s rrnB tandem promoters or the separated rrnB promoters fused to the structural gene for tetracycline acetyltrans- ferase. Using these constructs expressed i n E. c o l i , they showed that 7 the downstream promoter (P2) was the growth rate regulated and transcrip- t i o n a l l y more active of the B. s u b t i l i s rRNA tandem promoters, while the PI promoter was c o n s t i t u t i v e l y expressed. The canonical promoter elements at -10 and -35 of the stable RNA operons are not the only sites on the DNA that have an effect on the l e v e l of expression i n E. c o l i . The upstream region between -98 and -40 of the tyrT promoter has been shown to be important for the high l e v e l of i n vivo promoter a c t i v i t y . By following the production of a plasmid encoded tyrT-galK fusion transcript, Lamond and Travers (1985) showed that deletion of sequences i n t h i s region reduced the promoter strength to about 10% of the wild type l e v e l . A region upstream of the PI promoter of the E. c o l i rrnB promoter has also been shown to affect i n vivo transcription. Using a rrnB Pl-lacZ fusion deletion series, Gourse, et a l . (1986) demonstrated that the removal of sequences from -88 to -51 reduced transcription to about 5% of wild type. D. In v i t r o analysis of transcription i n i t i a t i o n In v i t r o analysis of transcription i n i t i a t i o n has been used to delineate possible mechanisms for the i n vivo control of gene expression (McClure, 1985). A minimal model for RNA chain i n i t i a t i o n has existed for many" years (Walter, et a l . , 1967). Three major stages i n tran- s c r i p t i o n i n i t i a t i o n have been defined and can be summarized as: 1) binding; 2),isomerization; and 3) promoter clearance (McClure, 1985). Results obtained with different promoters and with various techniques have been interpreted as demonstrating that any of these three stages 8 could be uniquely rate l i m i t i n g . In the discussion that follows, R = RNA polymerase, D = DNA, and P = promoter. Binding—The binding stage can be Subdivided into at least two phases: 1) the binding of RNA polymerase to the DNA and 2) the location of a s p e c i f i c s i t e along the DNA by the polymerase to form a closed complex. R + D«->RD«->RPC The binding constant, K B, i s the k i n e t i c parameter used to describe t h i s stage of transcription i n i t i a t i o n (McClure, 1985). The rate at which enzyme binds to DNA i s strongly dependent on the concentration of the reactants which i s probably not a factor i n vivo (Nomura, et a l . , 1986) and can be controlled i n i n v i t r o reactions so that neither i s l i m i t i n g . However, the second phase of the binding reaction could t h e o r e t i c a l l y be rate l i m i t i n g depending on the mechanism for the location of s p e c i f i c s i t e s . Each base pair on the DNA molecule i s a potential non-specific binding s i t e , and non-specific sites outnumber spec i f i c sites by many orders of magnitude. There i s a limited number of s p e c i f i c binding sites on the DNA. If the mechanism for locating these sites was a three- dimensional d i f f u s i o n process, the rate at which the interaction of polymerase with a s p e c i f i c s i t e would be slow, and hence rate l i m i t i n g (Chamberlin, 1974). However, i f the locating mechanism involved linear d i f f u s i o n along the contour of the DNA molecule, the search for a s p e c i f i c s i t e would be f a c i l i t a t e d due to a reduction i n dimensionality 9 and/or a diminution i n the volume to be searched (Singer and Wu, 1987). Wu, et a l . (1983) have developed a rapid-mixing/photocross-linking tech- nique and used i t to d i r e c t l y follow the changing d i s t r i b u t i o n of RNA polymerase along the DNA template as a function of time. Using t h i s technique a set of k i n e t i c traces which represent the transient occupation by polymerase of both s p e c i f i c and non-specific DNA-binding sites was produced and showed that linear d i f f u s i o n along the DNA molecule must be playing a dominant role i n promoter search (Singer and Wu, 1987). McClure (1985) noted that there was no evidence that d i f f u s i o n to a promoter was slower than the subsequent steps i n transcription i n i t i a t i o n . More recently, Singer and Wu, (1987) reported the rate at which polymerase located a promoter as 50-fold faster than the reported rate of open complex formation at the lacUV5 promoter (S. Straney and Crothers, 1987). Isomerization—Simply stated, the isomerization stage i s charac- terized by the t r a n s i t i o n of the closed promoter complex to the open promoter complex: RP C->RP 0 Extensive investigation of this t r a n s i t i o n , however, has shown i t to be multi-stepped and probably unique for each promoter (McClure, 1985). The rate constant, k f, i s the k i n e t i c parameter used to describe t h i s stage of transcription i n i t i a t i o n . After RNA polymerase locates a promoter, the i n i t i a l complex formed i s c a l l e d the closed complex (Chamberlin, 1974). Since the closed complex i s transient at 37° C, evidence for the existence of such a complex has been indirect and derived primarily from 10 analyses of the kinetics of chain i n i t i a t i o n (Chamber1in, et a l . , 1982; Hawley, et a l . , 1982). Recently, however, i t has been shown that polymerase s p e c i f i c a l l y bound at a promoter at 0° C protects a reduced area from DNase I digestion when compared to footprints made at 37° C at the same promoter (Kovacic, 1987). Kovacic (1987) also noted that while the T7-A3 and the lacUV5 promoters had footprints of comparable size at 0° C, the protection patterns were unique for each promoter. I t i s known that formation of the open complex ultimately results i n : 1) a topo- l o g i c a l unwinding of the DNA of 540° (Gamper and Hearst, 1982); 2) an increased exposure to chemical reagents >10 base pairs of DNA lo c a l i z e d near the s t a r t s i t e (Siebenlist, 1979; Kirkegaard, et a l . , 1983); and 3) an a l t e r a t i o n i n the hyperchromicity of DNA bases (Hsieh and Wang, 1978; Riesbig, et a l . , 1979). McClure (1985) notes that the nature and magni- tude of the structural changes i n DNA or polymerase that precede these alterations i n the template are unknown. The formation of the open complex has been extensively studied with the lacUV5 promoter. Chemical, enzymatic, and electrophoretic methods have been used to i d e n t i f y two stable binary complexes at t h i s promoter (S. Straney and Crothers, 1987; Spassky, et a l . , 1985). On the basis of k i n e t i c studies, the form that predominated at lower temperatures has been proposed as an intermediate, the conversion of which i s the rate l i m i t i n g step, i n the isomerization of closed to open complex formation (Buc and McClure, 1985). The proposed intermediate has been designated as "closed", since no single-stranded region was detectable i n the DNA (Spassky, et a l . , 1985). Thus, the positioning of the enzyme at the promoter, rather than the unwinding of the template appears to be the rate l i m i t i n g step i n isomerization at the lacUV5 promoter. 11 Promoter Clearance—The promoter clearance stage of transcription i n i t i a t i o n proceeds from the open complex through the formation of the f i r s t phosphodiester bond, to the dissociation of the sigma subunit from the ternary complex. sigma Subsequent to the tight binding of the polymerase to the promoter i n the formation of the open complex, the enzyme must choose the precise tran- s c r i p t i o n i n i t i a t i o n point on the template, i n i t i a t e the synthesis of an RNA chain, and escape from the stable open promoter complex to elongate the RNA. The overall process requires a balancing of two c o n f l i c t i n g requirements: promoter binding should be tight i n order to establish proper recognition, but not so tight that the polymerase i s prevented from escaping the promoter to elongate the RNA. The manner i n which these two c o n f l i c t i n g requirements i s resolved at p a r t i c u l a r promoters has been examined by characterizing the production of abortive transcripts, and by following the release of the sigma subunit of RNA polymerase. DNase I footprints and methylation protection experiments have shown that RNA polymerase can remain t i g h t l y complexed at the lacUV5 promoter and r e i t e r a t i v e l y synthesize short RNA chains up to 10 bases long (Carpousis and Gr a l l a , 1985; D. Straney and Crothers, 1987). Exonuclease I I I digestion through the upstream domains 12 of the lacUV5 promoter has demonstrated a sl i g h t loss of upstream open complex contacts during abortive transcription, but a large loss of these contacts upon escape from abortive cycling into productive transcription (D. Straney and Crothers, 1987). In addition to the interaction between the polymerase and the up- stream region of the promoter, the interaction between polymerase and the nascent transcript/template hybrid has been shown to be important i n the rate at which the enzyme leaves the promoter. When inosine triphosphate was substituted for GTP i n transcription i n i t i a t i o n reactions at the lacUV5 promoter, the rate of the abortive transcript formation increased and the rate of productive transcript formation decreased (D. Straney and Crothers, 1987). The authors suggest that the weaker hydrogen bonding between the rl.dC base-pairs i n the transcript/template hybrid favors the tight binding stage i n the i n i t i a t i o n reaction. Further support for the role of the downstream sequences has come from studies which monitor the point at which the sigma subunit i s released from ternary complexes. Using a 5'-azide photoreactive dinucleotide i n transcription i n i t i a t i o n reactions, Bernhard and Mearse (1986) reported that the sigma subunit was labeled by RNA chains 9-13 bases long at the lambda P R promoter and by chains 3 bases long at the T7 A l promoter. The authors suggest that early sigma release may occur when an alternating pattern of hydrogen bond donors and acceptors i s observed i n the RNA/DNA hybrid as i s the case at the T7 A l promoter, but not at the lambda P R promoter. Thus, the promoter clearance stage i n transcription i n i t i a t i o n appears to be rate l i m i t i n g for the lambda P R and the lacUV5 promoters, but not l i m i t i n g for the T7 A l promoter. 13 Transcription i n i t i a t i o n i n B. s u b t i l i s — T r a n s c r i p t i o n i n i t i a t i o n has been studied almost exclusively at a few E. c o l i promoters. Recently, however, i n i t i a t i o n has been investigated at two (J)29 promoters used by the predominant B. s u b t i l i s sigma 4 3 RNA polymerase (Dobinson and Spiegelman, 1985 & 1987). The k i n e t i c parameters, K A * (Kg) and k 2 ( k f ) , were determined for the |)29 A2 promoter and found to be char a c t e r i s t i c of weak E. c o l i promoters, i n that these parameters were similar to those reported for three lac mutants (Dobinson and Spiegelman, 1985; Stefano and G r a l l a , 1982). The effect of the delta subunit of B. s u b t i l i s polymerase on transcription i n i t i a t i o n at the weak §29 A2 promoter and the strong (j)29 G2 promoter was compared (Dobinson and Spiegelman, 1987). It had been proposed that delta played a role i n enhancing the s p e c i f i c i t y of polymerase binding by i n h i b i t i n g the formation of stable complexes at nonspecific sites on the Ba c i l l u s chromosomal DNA (Achberger, et a l . , 1982; Doi, 1982). Dobinson and Spiegelman (1987) found that delta inhibited the formation of heparin resistant complexes at the A2 promoter but not at the G2 promoter. To account for these differences the authors suggested that the release of delta from the A2- polymerase complex might be the rate l i m i t i n g step i n the i n i t i a t i o n reaction at that promoter. E. Summary of the work presented i n t h i s thesis This investigation began with a study of rRNA synthesis i n B. s u b t i l i s during steady state growth and under n u t r i t i o n a l shift-up conditions. I demonstrated that i n B. s u b t i l i s the f r a c t i o n a l rate of rRNA synthesis increased as a function of growth rate, and was similar to that reported for E. c o l i . I also examined the relationship between rRNA 14 synthesis and RNA polymerase a v a i l a b i l i t y using an amber mutatant of the SP01 phage. Evidence was found which suggested the existence of a ribosomal s p e c i f i c RNA polymerase. The conclusions from the i n vivo study led to an analysis of rRNA t r a n s c r i p t i o n i n v i t r o . The i s o l a t i o n of the putative ribosomal RNA s p e c i f i c RNA polymerase was attempted, but no d i f f e r e n c e i n a c t i v i t y p r o f i l e was observed when t r a n s c r i p t i o n a c t i v i t y at the rRNA tandem promoters was compared to a c t i v i t y at a non-ribosomal promoter. In vivo analysis of the control of rRNA synthesis i n E. c o l i suggested that regulation occurs at the l e v e l of t r a n s c r i p t i o n i n i t i a t i o n , therefore, i n v i t r o t r a n s c r i p t i o n i n i t i a t i o n at the B. s u b t i l i s rRNA promoters was investigated using the single round t r a n s c r i p t i o n assay. I showed that the formation of a heparin r e s i s t a n t complex at the PI promoter affected the s t a b i l i t y of the heparin r e s i s t a n t complex formed at the P2 promoter. The k i n e t i c s of t r a n s c r i p t i o n i n i t i a t i o n at the rRNA promoters were examined and I demonstrated that RNA polymerase had a high a f f i n i t y f o r both rRNA promoters, but the rate of i n i t i a t i o n at these promoters was r e l a t i v e l y slow when compared to non-ribosomal promoters. F i n a l l y , t r a n s c r i p t i o n i n i t i a t i o n on two a r t i f i c i a l tandem promoter constructs was compared with i n i t i a t i o n on the native tandem promoter construct. In general, PI was shown to have a p o s i t i v e e f f e c t on t r a n s c r i p t i o n from downstream promoters, but had s p e c i f i c e f f e c t s on d i f f e r e n t promoters. 15 I I . MATERIALS AND METHODS A. Bacteri a l strains, Phage, and Plasmids 1. Bacterial s t r a i n s — B a c i l l u s s u b t i l i s 168M (obtained from H. R. Whiteley, University of Washington, Seattle, WA.) was the host for bac- teriophage SP82 infections and the source of p u r i f i e d RNA polymerase. B. s u b t i l i s L15 ( s u + 3 , thr) (Georgolopolous, 1969) was obtained from W. D. Ramey, University of B r i t i s h Columbia and served as the host for bacteriophages SP01 amber 34 and (j)29. Escherichia c o l i SF8 (Olson, et a l . , 1977) was the host for plasmids pVG-1, p328-5, and pHD1.8. E. c o l i HB101 was used as the host for plasmids pKK427B, pTLXT210, pTLXT3B, pPldP2 and pPlA2. The E. c o l i s t r a i n containing pl2E2 (Moran and Bott, 1979), a pBR313 recombinant plasmid containing portions of B. s u b t i l i s ribosomal RNA genes, was provided by K. Bott (University of North Carolina, Chapel H i l l ) . 2. Phage—Bacteriophage SP82 p a r t i c l e s were p u r i f i e d by concen- t r a t i n g 4 L of phage lysate by overnight p r e c i p i t a t i o n with polyethylene glycol 6000 (to 10%, w/v) and NaCl (to 1.9%, w/v) at 4°C. The p r e c i - p i t a t e was harvested by centrifugation, resuspended i n 20 mL of 20 mM Tris-HCl (pH 7.4), 1 mM MgCl 2 r and 0.1 M NaCl, and dialyzed against 4 L of the same buffer for 48 h at 4° C. The dialyzed suspension was centrifuged at 27,000 x g for 10 min and the supernant l i q u i d was stored at 4°C. T i t r e of the supernant l i q u i d was approximately 2 X 1 0 1 1 (PFU)/mL. 16 Bacteriophage SP01 amber 34 ( F u j i t a , et a l . , 1971 and Fox, 1976) pa r t i c l e s were p u r i f i e d as described above with the following change: after d i a l y s i s of the resuspended polyethylene glycol 6000 precipitate, 0.8 g CsCl was added per mL of phage suspension and the suspension centrifuged at 32,000 rpm at 20°C for 24 h i n a Beckman 50 T i rotor. The phage band was removed and dialyzed against 2 x 4 L 20 mM Tris (pH 7.4), 1 mM MgCl 2, and 0.1 M NaCl for 16 h at 4° C. The p u r i f i e d phage p a r t i c l e s were stored at 4° C. T i t r e of the dialysate was 1.5 x 1 0 1 2 PFU/mL on the suppressor host and 2.4 x 10^ PFU/mL on the wild type host. Bacteriophage (J>29 p a r t i c l e s were p u r i f i e d as described for the SPOl-like phages with the following changes: phage p a r t i c l e s were concentrated form infected culture lysates i n 11% w/v polyethylene glycol 6000 and 2.3% w/v NaCl, and 0.73 g CsCl was used per mL phage suspension i n the gradient centrifugation step. For bacteriophage (j>29 DNA, p u r i f i e d phage p a r t i c l e s were treated with 1% SDS, 20 mM EDTA and heated at 65°C for 10 min. The ruptured p a r t i c l e s were then treated with 50 ug/mL Proteinase K (Sigma) for 2 h at room temperature. The DNA was p u r i f i e d by phenol extraction and ethanol precipitated i n the presence of 3% sodium acetate. The DNA was dissolved i n O.lx SSC (SSC i s 0.15 M NaCl, 0.015 M sodium c i t r a t e , pH7) and stored over chloroform. 3. Plasmids—Plasmid DNA was p u r i f i e d using the Clewell and Helinski (1972) cleared lysate method with the modifications described by Dobinson and Spiegelman (1985). Plasmid DNA was p u r i f i e d from the cleared lysate by centrifugation i n CsCl-ethidium bromide. The isolated plasmid was treated with butanol to remove the ethidium bromide, ethanol precipitated and redissolved i n d i s t i l l e d water or O.lx SSC. 17 B. Media and Growth Conditions The media used i n the B. s u b t i l i s growth rate experiments were of two basic types. Defined medium plus L-trytophan (DMT) i s similar to that described by Hiatt and Whiteley (1978) except L-trytophan (Sigma) (to 5 ug/mL) and 0.5% (w/v) casamino acids (Difco) were used. Various carbon sources (glucose to 0.1%, sodium acetate to 0.25%, and succinic acid to 0.25%) and nutrients (casamino acids to 2%, beef extract (Oxoid) to 0.5%, adenosine (Sigma) to 0.6 mg/mL, uridine (Sigma) to 0.6 mg/mL, thymidine (Sigma) to 0.6 mg/mL, and a vitamin mixture described by Rodin (1972)) were added to DMT. Three types of complex media were used: trypticase soy (Difco), 2.5 g/L, with glucose to 0.1%; L broth as described by Silverman and Simon (1973); and M medium (Yehle and Doi, 1967) modified as follows (per l i t r e ) : 2.5 g yeast extract (Difco), 5 g tryptone (Difco), 10 g NaCl, and 1 g glucose. After s t e r i l i z a t i o n a l l media were adjusted to f i n a l concentrations of 5 mM MgS04 and 0.02 mM MnCl 2. A l l B. s u b t i l i s cultures were grown at 37° C unless otherwise stated. B. s u b t i l i s L15 when grown as a host for |)29 and B. s u b t i l i s 168M when grown as a source for RNA polymerase were grown i n unmodified M medium (Yehle and Doi, 1967). Doubling time was determined by change i n op t i c a l density at 640nm, and growth rate (u) was calculated by dividing the natural logarithm of 2 by the doubling time (g) i n hours: u=(ln2/g) E. c o l i strains bearing plasmids were grown at 30°C i n M9 medium (Champe and Benzer, 1962) modified as follows i n f i n a l concentrations: 18 0.25% glucose, 0.2% casamino acids, 0.1 mM FeC l 3 , 0.1 mM CaCl 2, 200 ug uridine/mL, 10 ug thymidine/mL, and 20 ug thiamine/mL. C. Bacteriophage SP82 Burst Assays Cultures were grown on a rotary platform shaker set at 250 rpm. I n i t i a l medium volume per fla s k was 100 mL per 500 mL f l a s k . The phage infections were performed as described by P a l e f s k i , et a l . , (1972) with the following a l t e r a t i o n s . Cultures were inoculated with 1.5 mL from a o standing overnight culture grown i n DMT, grown to a density of 3.9 x 10 cell/mL and then infected at a m u l t i p l i c i t y of 1.6 phage/cell. Burst size was determined as the r a t i o of phage produced/mL to i n f e c t i v e centers/mL. The phage y i e l d was measured by pl a t i n g for PFU immediately after the o p t i c a l density drop i n the infected culture indicated c e l l l y s i s . Infective centers were determined by removing 1 mL of culture 1 min after i n f e c t i o n , centrifuging for 4 min i n an Eppendorf centrifuge, removing the supernant l i q u i d , resuspending the p e l l e t i n 1 mL of M medium, and plating at 1 0 - 5 for plaques. D. Transport Assays P a r a l l e l cultures of B. s u b t i l i s were grown i n DMT with casamino acids (to 0.2% or 0.01%) and acetate or succinic acid (to 0.2%) as carbon source to a density of 5 x 10 7 cells/mL. One of the cultures was infected with SP01am34 at a m u l t i p l i c i t y of in f e c t i o n of 25 and growth of both cultures continued for a further 10 min. Uptake assays were performed as described by Beaman, et a l . (1983) with the following changes: radioactive nutrient (1-2.5 uCi/mL of culture) was added to 19 each culture and 0.2 mL samples were taken 20 sec after the addition of labeled nutrient and then every 45-60 sec for upto 3 min. Samples were f i l t e r e d through n i t r o c e l l u l o s e membrane f i l t e r s ( M i l l i p o r e ) , the mem- brane washed 3 times with cold medium, dried and counted i n a Beckman S c i n t i l l a t i o n Counter. Immediately p r i o r to radioactive nutrient addition, duplicate culture samples were taken for protein determination (Sandermann and Strominger, 1972). In a l l cases, except for the glucose assays, the labeled nutrient was added d i r e c t l y to the culture medium and no attempt was made to calculate the f i n a l nutrient concentration. When thi s procedure was t r i e d for the glucose assays, e r r a t i c results were obtained. The undiluted concentration of the glucose label was 0.019 uM while the reported KJJ, for glucose i n a wild type stra i n of B. s u b t i l i s i s 0.01 mM (Price and Gallant, 1983), therefore, the labeled glucose was added i n a 0.23 mM glucose solution to give a 3 uM f i n a l glucose concen- t r a t i o n . E. Preparation of pulse labeled RNA B. s u b t i l i s was grown i n M medium or i n defined medium plus various •7 carbon sources (see above) to a density of 5 x 10 cells/mL. In shift-up experiments, the culture was enriched with 1/10 volume of lOx M medium or a mixture of 19% glucose, lOx vitamins (Rodin, 1972). Unshifted cultures were labeled with 10 uCi [5,6- 3H]Uridine per mL culture while the shifted cultures were labeled with 200 uCi/mL. SP01am34 phage were added to a m u l t i p l i c i t y of infection of about 25. Labeling was stopped by the addition of sodium azide to 0.05 M and rapid cooling to 0° C. RNA was isolated from 1 mL aliquots according to the freeze-thaw method of Sogin, et a l . (1977) except 100 ug/mL yeast tRNA was included i n the buffers as 20 c a r r i e r . A f t e r SDS-EDTA t r e a t m e n t t h e samples were p h e n o l e x t r a c t e d t w i c e , e t h a n o l p r e c i p i t a t e d , e t h a n o l washed, r e s u s p e n d e d i n 0.2 mL s t e r i l e d i s t i l l e d water and s t o r e d a t -20° C. F. C o n s t r u c t i o n of pVG-1 The h y b r i d i z a t i o n p r o b e used i n t h e i n v i v o s t u d i e s , pVG-1, c o n t a i n e d sequences from t h e genes e n c o d i n g t h e 23S and 5S rRNAs o f B. s u b t i l i s i s o l a t e d f r o m p l 2 E 2 (Moran and B o t t , 1979). P l a s m i d pVG-1 was c o n s t r u c t e d by c l e a v i n g p l 2 E 2 w i t h H i n d i I I and BamHI, and i s o l a t i n g t h e 2.8 kb fragment by e l e c t r o e l u t i o n a f t e r a c r y l a m i d e g e l e l e c t r o - p h o r e s i s . The i s o l a t e d fragment was l i g a t e d t o a p p r o p r i a t e l y c l e a v e d pBR322 DNA and a f t e r t r a n s f o r m a t i o n c o l o n i e s r e s i s t a n t t o a m p i c i l l i n and s e n s i t i v e t o t e t r a c y c l i n e were s c o r e d . P l a s m i d pVG-1 was v e r i f i e d as h a v i n g t h e c o r r e c t DNA fragment by h y b r i d i z a t i o n t o t h e p a r e n t p l a s m i d , h y b r i d i z a t i o n t o i n v i v o l a b e l e d rRNA, and by r e s t r i c t i o n enzyme a n a l y s i s ( d a t a n o t shown). F i g u r e 1 shows a r e s t r i c t i o n enzyme map of t h e p a r e n t p l a s m i d ( t a k e n from Moran and B o t t , 1979) and t h e DNA fragment s u b c l o n e d i n t o pVG-1. R e s t r i c t i o n e n d o n u c l e a s e s and DNA l i g a s e were o b t a i n e d from New E n g l a n d B i o l a b s and used a c c o r d i n g t o t h e s u p p l i e r ' s i n s t r u c t i o n s . G. H y b r i d i z a t i o n a s s a y s I t was o b s e r v e d t h a t a f t e r h e a t d e n a t u r a t i o n p l a s m i d DNA would "snap-back" as m o n i t o r e d by r a p i d d e c r e a s e i n 0 D 2 6 Q . I t was f o u n d t h a t p l a s m i d DNA w h i c h had been k n i c k e d w i t h S I n u c l e a s e ( L i l l e y , 1980), u s i n g 1 u n i t o f enzyme p e r 10 ug DNA, remained d e n a t u r e d . D e n a t u r e d DNA was i m m o b i l i z e d on n i t r o c e l l u l o s e membrane f i l t e r s ( S c h l e i c h e r and S c h u e l l ) 21 Figure 1. Construction of plasmid pVG-1. A DNA fragment 2.8 kb long from plasmid pl2E2 delineated by BamHl (B) and HindiII (H) r e s t r i c t i o n endonuclease sites was isolated and cloned into pBR322 treated with BamHI and HindiII. The map of plasmid pl2E2 i s from Moran and Bott (1979). Approximate positions of the 23S RNA (23S), 5S RNA (5S), and tRNA (4S) coding regions are shown. Open bars represent cloned B. s u b t i l i s DNA, and s o l i d l i n e represents vector DNA. 22 p12E2 B 2 . 8 kb 2 3 S H 1 4S» H H B pBR31 3 pVG-1 i i B H p B R 3 2 2 as described by G i l l e s p i e and Spiegelman (1965). Hybridization experi- ments were performed at constant RNA concentration with increasing DNA concentration i n 6x SSC, 0.1% SDS at 67°C for 16 h. After hybridization f i l t e r s were washed i n 6x SSC at 67°C, treated with 10 ug/mL RNase A (Sigma) at 37°C for 30 min, and washed i n 6x SSC at 67°C two more times. H. Calculation of the percent i n vivo rRNA synthesized Conversion of the r a d i o a c t i v i t y bound to pVG-1 DNA f i l t e r s to the rate of rRNA synthesis included the following: (1) the hybridization e f f i c i e n c y (determined to be 0.88 using p u r i f i e d 3H-rRNA); (2) the size of the hybridization probe (53% of the rRNA transcription unit, Moran and Bott, 1979); and (3) the fact that the uridine content of B. s u b t i l i s rRNA (20.7%, Doi and I g a r i s h i , 1964) d i f f e r s from the t o t a l thymidine content of B. s u b t i l i s DNA (28.5%, MacHattie and Thomas, 1968) and from the hydroxymethyl uridine content of SP01 DNA (28%, Szybalski, 1968). In addition, three assumptions were made: (1) labeled uridine entered mRNA and rRNA precursor pools equally; (2) uridine was not involved i n cytidine metabolism; and (3) the uridine content of non-rRNA was equal to the thymidine content of the t o t a l DNA. The synthesis of rRNA (the percent rRNA) was monitored by the r a t i o of nucleotides incorporated into rRNA (C r) to the t o t a l nucleotides incorporated (C T) i n the one min pulse labeling i n t e r v a l or, 24 % rRNA = [(C r*)/(C T*)] x 100% The values of C r and C T were calculated from the t o t a l radio- a c t i v i t y input i n a hybridization and the resulting r a d i o a c t i v i t y bound to pVG-1 DNA, correcting for the hybridization e f f i c i e n c y and probe size i n the case of C r and the t o t a l uridine content of the RNA i n the case of both Cr* and CT* . If C r cpm of pulse labeled 3H-RNA, out of t o t a l input of C T cpm, bound to pVG-1 f i l t e r s , then * c = c *~r ^ r 0.53 x 0.88 x 0.207 and 0.28 Note the sp e c i f i c a c t i v i t y of the uridine label was not included as i t cancels out of the percent rRNA calculation. I. pHD1.8 DNA-Cellulose Column A pHD1.8 DNA-cellulose column for i s o l a t i o n of an rRNA sp e c i f i c RNA polymerase was prepared using a modification of the Litman (1968) procedure. B r i e f l y , 830 mg of washed cellulose (undesiccated) was mixed with 2.75 mL of p u r i f i e d pHD1.8 DNA 564 ug/mL, dried 16 h i n a vacuum 25 desiccator and lyopholized a further 16 h i n a freeze d r i e r . Four hundred ninety milligrams were recovered, suspended i n 30 mL absolute ethanol, and i r r a d i a t e d with long wave u l t r a v i o l e t l i g h t for 20 min. The material was washed with 250 mL 0.1 M NaCl and dri e d for three days i n a vacuum desiccator. Four hundred seventy milligrams were recovered. The pHD1.8 DNA-cellulose was suspended i n 10 mL of buffer containing 10% g l y c e r o l , 0.01 M Tris-HCl pH 7.9, 1 mM EDTA, 0.01 M MgCl 2, 50 ug/mL PMSF, 0.2 M 2-ME, 0.05 M NaCl, poured i n t o a 5cc syringe, and washed with 75 mL of the same buffer. J . P u r i f i c a t i o n of B. s u b t i l i s holoenzyme 1. RNA polymerase for single round t r a n s c r i p t i o n assays was p u r i f i e d from f r e s h l y grown B. s u b t i l i s 168M as described previously (Dobinson and Spiegelman, 1985) with the following modifications. The 0.6 M NaCl DNA c e l l u l o s e f r a c t i o n s containing RNA polymerase a c t i v i t y were pooled and subjected to chromatography on heparin-sepharose (Dobinson and Spiegelman, 1985). The 0.6 M NaCl f r a c t i o n s containing enzyme a c t i v i t y were pooled, concentrated and sedimented through the 15- 30% g l y c e r o l gradient described by Dobinson and Spiegelman (1985). The peak enzyme f r a c t i o n s from the g l y c e r o l gradient were pooled and concentrated by chromatography on a second 0.5 mL heparin-sepharose column. The protein concentration was determined (Sandermann and Strominger, 1972) using bovine serum albumin (Fraction V, Sigma Chemical Co.) as the standard. Total enzyme a c t i v i t y was assayed by as described by Spiegelman and Whiteley (1974), with several modifications. 029 DNA was incubated i n the presence of 0.04 M Tris-HCl pH 7.9, 0.02 M MgCl 2, 0.05 M NaCl, with 0.08 mM GTP, CTP, and ATP, and 8 uM UTP and 25 uCi 26 [JH]-UTP for 2 min, 10 uL of enzyme was added and incubation continued for a further 10 min. The reaction mixtures were precipitated with TCA in the presence of 100 ug/mL yeast RNA (Type II-S from Torula yeast, Sigma Chemical Co.). The amount of active enzyme i n the p u r i f i e d preparation was found to be 50% as measured by spec i f i c i n i t i a t i o n s on the (j)29 G2 promoter as described by Brion and Spiegelman ( i n preparation). 2. RNA polymerase for rRNA s p e c i f i c i t y studies was p u r i f i e d from B. s u b t i l i s 168 (Iowa Grain Processing Corp.) as described above. One and a half m i l l i l i t r e s of the pooled 0.6 M NaCl fractions from the f i r s t heparin-sehparose chromatography were dilut e d with a buffer containing 10% gl y c e r o l , 0.01 M Tris-HCl pH 7.9, 1 mM EDTA, 0.01 M MgCl 2, 50 ug/mL PMSF, 0.2 M 2-ME to 0.05 M NaCl (monitored on a Bach-Simpson Ltd. type CDM-2f conductivity meter). The sample was loaded on a 1.5 cc pHD1.8 DNA- cellu l o s e column and eluted with a 10 mL 0.05-0.8 M NaCl gradient of the same buffer. Four drop fractions were collected and assayed for RNA polymerase a c t i v i t y as described previously (Dobinson and Spiegelman, 1985). Fractions containing peak a c t i v i t y were used i n a standard transcription assay with pHD1.8 (rrnB tandem promoter) or p328-5 (cj)29 A2 promoter) as template to assess enzyme s p e c i f i c i t y . The sodium chloride concentration of the fractions was determined by establishing a standard curve of conductivity vs NaCl concentration, and measuring the conductivity of a 1/20 d i l u t i o n of each f r a c t i o n . 27 K. T r a n s c r i p t i o n A s s a y s 1. S t a n d a r d A s s a y — T r a n s c r i p t i o n s were done i n 100 uL o f b u f f e r c o n t a i n i n g 40 mM T r i s - H C l pH 7.9, 20 mM M g C l 2 - For a s s a y s o f chromato- g r a p h y f r a c t i o n s o f NaCl g r a d i e n t e l u t i o n s , a l l r e a c t i o n s were made up t o 60 mM N a C l . ATP, GTP, CTP, and UTP were a l l 400 uM e x c e p t when t h e t r a n s c r i p t s were l a b e l e d , i n w h i c h c a s e t h e l a b e l e d n u c l e o t i d e was a t 10 uM. R e a c t i o n s where pHD1.8 s e r v e d as t e m p l a t e c o n t a i n e d 5 u C i o f [ a l p h a - J , i P ] A T P (New E n g l a n d N u c l e a r ) , w h i l e r e a c t i o n s i n w h i c h p328-5 was t h e t e m p l a t e c o n t a i n e d 4.5 u C i [ a l p h a - 3 2 P ] U T P (Amersham). R e a c t i o n s were s t a r t e d by t h e a d d i t i o n o f t h e n u c l e o t i d e m ix t o a s o l u t i o n o f DNA and RNA p o l y m e r a s e which had been i n c u b a t e d f o r 5 min a t 37° C. T r a n s c r i p - t i o n was c a r r i e d out f o r 10 min and st o p p e d by w i t h 25 mM EDTA and c h i l l e d on i c e . 2. S i n g l e Round T r a n s c r i p t i o n A s s a y — The s i n g l e r ound t r a n - s c r i p t i o n a s s a y was p e r f o r m e d as d e s c r i b e d p r e v i o u s l y ( D o b i n s o n and Sp i e g e l m a n , 1987). B r i e f l y , l i n e a r i z e d t e m p l a t e DNA and RNA p o l y m e r a s e were i n c u b a t e d t o g e t h e r i n t h e p r e s e n c e o f two o r t h r e e n u c l e o s i d e t r i p h o s p h a t e s (400 uM f i n a l c o n c e n t r a t i o n ) . A t t i m e s i n d i c a t e d , 38 u l o f t h e r e a c t i o n were removed and added t o a 2 uL m i x t u r e c o n t a i n i n g h e p a r i n (5 ug/mL f i n a l c o n c e n t r a t i o n ) and r e m a i n i n g n u c l e o s i d e t r i p h o s p h a t e s , one of w h i c h was t h e l a b e l e d n u c l e o t i d e and p r e s e n t a t 10 uM. A f t e r 10 min t o a l l o w e l o n g a t i o n , r e a c t i o n s were s t o p p e d by t h e a d d i t i o n o f 10 uL o f 10 M u r e a , 0.1 M T r i z m a Base, 0.1 M b o r i c a c i d , and 2 mM EDTA. H a l f o f each r e a c t i o n was e l e c t r o p h o r e s e d t h r o u g h an 8% p o l y a c r y l a m i d e g e l c o n t a i n i n g 7 M u r e a a t 35 v o l t s / c m . R e g i o n s o f t h e g e l c o n t a i n i n g s p e c i f i c t r a n s c r i p t s were l o c a l i z e d by a u t o r a d i o g r a p h y , e x c i s e d , and t h e 28 amount of incorporated label determined by measuring the Cerenkov radiation i n each s l i c e . The number of transcripts was calculated by di v i d i n g the Cerenkov radiation i n such gel pieces (counts per min) by the s p e c i f i c a c t i v i t y of a single transcript (the sp e c i f i c a c t i v i t y of the labeled nucleotide i n the reaction corrected by the number of times the nucleotide occurs per t r a n s c r i p t ) . The ribonucleoside triphosphates used were isolated as nucleoside triphosphates (97-99% pure, Sigma Chemical Co), i t was found that the pyrmidine nucleotides formed by the enzymatic phosphorylation of 5'-CMP or uridine contained levels of ATP which permitted the formation of f u l l length transcripts i n the absence of added ATP. 29 I I I . IN VIVO RESULTS One of t h e p u r p o s e s o f t h e e x p e r i m e n t s r e p o r t e d i n t h i s s e c t i o n was t o examine s h i f t - u p i n d u c e d s y n t h e s i s o f rRNA i n c e l l s w h i c h had been d e p l e t e d o f t h e i r p o o l s o f RNA p o l y m e r a s e . The use o f r e s t r i c t i v e c o n d i - t i o n s f o r c o n d i t i o n a l mutants o r RNA p o l y m e r a s e i n h i b i t o r s has been shown t o change t h e s t a t e s o f r i b o s o m e and RNA p o l y m e r a s e and t h e r e b y a l t e r t h e t r a n s c r i p t i o n a l a c t i v i t y o f t h e c e l l ( Y u r a and I s h i h a m a , 1979; L i n d a h l and Z e n g e l , 1982). I t was, t h e r e f o r e , c o n s i d e r e d i m p o r t a n t t h a t t h e c e l l s be d e p l e t e d o f t h e i r p o o l o f e x c e s s p o l y m e r a s e w i t h o u t c h a n g i n g t h e t r a n s c r i p t i o n a l a c t i v i t y i n t h e c e l l . The B a c i l l u s phage SP01 was used t o c a r r y o u t d e p l e t i o n o f t h e c e l l u l a r p o o l of RNA p o l y m e r a s e . Phage SP01 and SP82 (a c l o s e l y r e l a t e d phage) a r e l a r g e , h y d r o x y m e t h y l u r a c i l (HMU) c o n t a i n i n g DNA phages o f B a c i l l u s . I n f e c t i o n w i t h t h e s e phages l e a d s t o s p e c i f i c and t e m p o r a l m o d i f i c a t i o n s o f t h e c e l l u l a r RNA p o l y m e r a s e ( D o i and Wang, 1986). The f i r s t m o d i f i c a t i o n , o c c u r r i n g e a r l y i n t h e l y t i c c y c l e , i n v o l v e s t h e r e p l a c e m e n t o f t h e major h o s t sigma s u b u n i t , s i g m a 4 3 , w i t h a phage encoded s u b u n i t , gp28, ( F u j i t a , e t a l . , 1971; Fox, 1976; D u f f y and G e i d u s c h e k , 1975). The second r e p l a c e m e n t o c c u r s l a t e r i n t h e i n f e c t i o n c y c l e and i n v o l v e s phage gene p r o d u c t s gp33 and gp34 ( F u j i t a , e t a l . , 1971; Fox, 1976; T j i a n and P e r o , 1976). I n v i v o r e p l a c e m e n t o f s i g m a 4 3 by gp28 i s accompanied by a 95% d e c r e a s e i n h o s t mRNA s y n t h e s i s i n d i c a t i n g t h a t most b a c t e r i a l p r o m o t e r s a r e no l o n g e r u t i l i z e d (Gage and G e i d u s c h e k , 1971; G e i d u s c h e k and I t o , 1982). Phage w i t h amber m u t a t i o n s i n t h e gene f o r gp34 do not s y n t h e s i z e l a t e p r o t e i n s o r DNA but do 30 undergo t h e f i r s t p o l y m e r a s e m o d i f i c a t i o n and t h e s h u t - o f f o f h o s t mRNA s y n t h e s i s ( F u j i t a , e t a l . , 1971; Fox, 1976). Thus, by i n f e c t i n g B. s u b t i l i s w i t h SP01am34, d e p l e t i o n o f much o f t h e c e l l u l a r RNA p o l y m e r a s e p o o l c o u l d t a k e p l a c e w i t h o u t i n h i b i t i n g t r a n s c r i p t i o n . The r e s u l t s p r e s e n t e d i n t h i s s e c t i o n a r e d i v i d e d i n t o t h r e e p a r t s : 1) p r e l i m i n a r y s t u d i e s i n w h i c h t h e i n t e r a c t i o n o f B. s u b t i l i s c u l t u r e c o n d i t i o n s and b a c t e r i o p h a g e SP01 i n f e c t i o n were i n v e s t i g a t e d ; 2) c o n t r o l s t u d i e s w h i c h e s t a b l i s h e d t h e l e v e l s o f rRNA s y n t h e s i s i n B. s u b t i l i s d u r i n g s t e a d y - s t a t e growth and i n s h i f t - u p c o n d i t i o n s ; and 3) e x p e r i m e n t a l s t u d i e s where t h e rRNA s y n t h e s i s i n SP01am34 i n f e c t e d c u l t u r e s was examined. The o v e r a l l theme o f t h e s e e x p e r i m e n t s was t h e i n t e r a c t i o n between rRNA s y n t h e s i s and RNA p o l y m e r a s e a v a i l a b i l i t y . A. I n t e r a c t i o n of B. s u b t i l i s c u l t u r e c o n d i t i o n s and SP82 phage i n f e c t i o n 1. E f f e c t o f SP01 phage i n f e c t i o n on t h e r a t e o f n u t r i e n t t r a n s p o r t . I f i n f e c t i o n w i t h SP01 was g o i n g t o be used t o d e p l e t e t h e h o s t p o o l o f RNA p o l y m e r a s e p r i o r t o a n u t r i t i o n a l s h i f t - u p , t h e n t h e e f f e c t o f phage i n f e c t i o n on t h e h o s t ' s a b i l i t y t o t r a n s p o r t t h e n u t r i e n t s needed t o be known. The f o l l o w i n g s e t of e x p e r i m e n t s was not i n t e n d e d t o r e p r e s e n t an i n d e p t h a n a l y s i s o f n u t r i e n t t r a n s p o r t i n B. s u b t i l i s ( s e e Beaman, e t a l . 1983), b u t r a t h e r a b r i e f s t u d y i n v e s t i g a t i n g a p a r t i c u l a r s e t o f e x p e r i m e n t a l c o n d i t i o n s . P a r a l l e l c u l t u r e s o f B. s u b t i l i s were grown i n DMT w i t h a c e t a t e o r s u c c i n i c a c i d as c a r b o n s o u r c e and casamino a c i d s t o a d e n s i t y o f 5 x 1 0 7 31 cells/mL. One of the cultures was infected with SP01am34 and growth of both cultures continued for a further 10 min. Radioactive nutrient (1- 2.5 uCi/mL of culture) was added to each culture and 0.2 mL samples were taken 20 sec after the addition of labeled nutrient and then every 45-60 sec for up to 3 min. Samples were f i l t e r e d on to n i t r o c e l l u l o s e membrane f i l t e r s , the membrane washed 3 times with cold medium, dried and counted. Immediately prior to radioactive nutrient addition, duplicate samples were taken from each culture for protein determination (Sanderman and Strominger, 1972). SP01am34 infection did not affect the rates of transport of the nutrients tested equally (Figure 2), suggesting that control of nutrient transport i n B. s u b t i l i s i s complex. The rate of methionine transport i n the phage infected cultures was unaffected, and the rates of glucose and leucine transport were s t i l l 90% and 75%, respectively, of the control. The rates of nucleoside and base transport were more dramatically affected by phage in f e c t i o n . The rates of adenine, adenosine, and cytidine transport i n the infected cultures were reduced to approximately 40% of the control, while the rate of uridine transport was reduced to 60% of the control. It i s not clear from these single concentration experiments whether the or the v m a x or both were affected by phage in f e c t i o n . Beaman et a l . (1983) reported the apparent 1^ for adenosine uptake by B. s u b t i l i s as 12 uM. In the shift-up experiments reported below the f i n a l adenosine concentration was about 2 mM; i f the apparent KJJ, for adenosine uptake was increased by 60%, the substrate binding sites would s t i l l be saturated at th i s concentration. Although the reduction i n the rates of nucleoside and base transport were of interest, i t was more s i g n i f i c a n t for the subsequent shift-up studies that phage 32 F i g u r e 2. E f f e c t o f SP01am34 i n f e c t i o n on n u t r i e n t t r a n s p o r t . The h i s t o g r a m shows t r a n s p o r t r a t e s f o r seven n u t r i e n t s i n an SP01am34 i n f e c t e d c u l t u r e r e l a t i v e t o t h e r a t e s i n u n i n f e c t e d c u l t u r e s . P a r a l l e l c u l t u r e s o f B. s u b t i l i s were grown i n DMT + 0.25% a c e t a t e o r 0.25% s u c c i n a t e and 0.2% casamino a c i d s t o a d e n s i t y o f 5 x 1 0 7 c e l l mL~^. One o f t h e c u l t u r e s was i n f e c t e d w i t h an moi=25 and growth of b o t h c u l t u r e s c o n t i n u e d f o r a f u r t h e r 10 min. R a d i o a c t i v e n u t r i e n t (1-2.5 uCi/mL) was added t o each c u l t u r e . Samples (0.2 mL) were t a k e n 20 sec a f t e r t h e a d d i t i o n o f l a b e l e d n u t r i e n t and t h e n e v e r y 45-60 sec f o r up t o 3 min. Samples were f i l t e r e d on t o n i t r o c e l l u l o s e membranes, t h e mem- bra n e s washed 3 t i m e s w i t h c o l d medium, d r i e d and c o u n t e d . I m m e d i a t e l y p r i o r t o r a d i o a c t i v e n u t r i e n t a d d i t i o n , d u p l i c a t e samples were t a k e n from each c u l t u r e f o r p r o t e i n a s s a y . The r a t e o f t r a n s p o r t p e r mg p r o t e i n (cpm/min/mg p r o t e i n ) was d e t e r m i n e d f o r b o t h c u l t u r e s . D a t a a r e p r e s e n t e d as t h e r a t e o f t r a n s p o r t i n i n f e c t e d c u l t u r e s d i v i d e d by t h e r a t e o f t r a n s p o r t i n u n i n f e c t e d c u l t u r e s x 100 t o g i v e t h e % U n i n f e c t e d . 33 V c y t i d i n e a d e n o s i n e a d e n i n e u r i d i n e k I e u c i n e g l u c o s e m e t h i o n i n e T — i 1 — r J L ' ' ' ' I L 20 40 60 80 100 % U n i n f e c t e d 34 i n f e c t i o n d i d not markedly reduce the rates of glucose or amino a c i d transport• 2. SP82 burst size i s dependent on growth rate. In preliminary experiments to determine whether c e l l s grown i n poor media could support successful SP82 i n f e c t i o n , i t was noticed that the burst s i z e of wild type phage var i e d dramatically with the growth rate of the host. To further i n v e s t i g a t e t h i s observation the SP82 burst s i z e was measured over a range of b a c t e r i a l growth ra t e s . It was found that there was a l i n e a r r e l a t i o n s h i p between the natural logarithm of the burst s i z e and the c e l l growth rate. The media used for growth of the b a c t e r i a l cultures and the growth rates obtained with each medium are l i s t e d i n Table I. For some media a range of growth rates i s reported. This range r e f l e c t s day to day v a r i a t i o n s during repeat experiments. One hundred m i l l i l i t r e cultures were inoculated with 1.5 mL from a standing overnight culture grown i n DMT. Cultures were grown to a density of 3.9 x 10 8 cell/mL, and then in f e c t e d at a m u l t i p l i c i t y of 1.6 phage/cell. Burst s i z e was determined as the r a t i o of phage produced/mL to i n f e c t i v e centers/mL. Since p l a t i n g for phage burst and i n f e c t i v e centers were performed within 50 min of each other, equal p l a t i n g e f f i c i e n c i e s for the two determinations were assumed. In r e l a t i n g burst size and growth rate, the p o s s i b i l i t y was con- sidered that at high growth rates the phage l y t i c time might be shortened and that the large y i e l d s were caused by multiple rounds of i n f e c t i o n . To i n v e s t i g a t e t h i s p o s s i b i l i t y , a one-step growth experiment u t i l i z i n g a 35 TABLE I Growth rates for B. s u b t i l i s i n various media Medium Growth Rate 1. M 1.46-2.97 2. L Broth 2.81 3. Trypticase soy 1.47 4. DMT +0.1% glucose 1.34-1.43 5. DMT + 0.25% succinic acid 0.76-1.09 6. DMT + 2% casamino acids 0.59-0.76 7. DMT +0.5% beef extract 1.39 8. DMT +0.5% beef extract +0.1% glucose 1.97 9. DMT + 0.1% glucose + vitamins 3 + adenosine 1 3 + u r i d i n e b 1.79-1.98 10. DMT + 0.1% glucose + vitamins 3 + adenosine 1 3 + uridine 1 3 + thymidine 1 3 2.30 3 As described by Rodin (1972) b 0.6 mg/mL. 36 c u l t u r e of b a c t e r i a grown i n M medium was performed (data not shown). The c u l t u r e had a doubling time of 19 min and burst s i z e of 1200, and exhibited a single increase of 10 2 PFU/mL over a span of 5 min, with a midpoint of 38 min, the l y t i c time previously reported (Lawrie, et a l . , 1976). Furthermore, the time for i n f e c t e d cultures to reach minimum o p t i c a l density (OD 6 4 0=0.05) was about the same (45-50 min) for a l l growth ra t e s . Thus, i t i s u n l i k e l y that multiple rounds of phage i n f e c t i o n had taken place. When the burst size was p l o t t e d against the growth rate the r e l a t i o n s h i p was markedly nonlinear (Figure 3a) having a l i n e a r c o r r e l a t i o n c o e f f i c i e n t of 0.79 (by the method of le a s t squares). When the natural logarithm of the burst s i z e was plo t t e d against the growth rate (Figure 3b) a more l i n e a r r e l a t i o n s h i p , with a c o r r e l a t i o n c o e f f i c i e n t of 0.88, was observed. It i s obvious that the burst s i z e i s growth rate dependent. The r e s u l t s obtained with a s i n g l e medium (for example, medium 1) exhibit the same trend as seen o v e r a l l , suggesting that the v a r i a t i o n i n burst size was indeed growth rate dependent rather than medium dependent. Schaechter, et a l . (1958) reported that for Salmonella c e l l u l a r contents of DNA, RNA, and protein at a given temperature depended only on growth rate and not on medium composition. It i s s i g n i f i c a n t that a logarithmic function better describes the r e l a t i o n s h i p between the burst s i z e and growth rate. Leduc, et a l . (1982) measured the accumulation of t o t a l RNA and RNA polymerase i n B. s u b t i l i s over a range of growth rates similar to those shown i n Figure 3, and found that both t o t a l RNA per c e l l and the percent a c t i v e RNA polymerase increased exponentially with growth rate as has been reported 37 Figure 3. Burst size of SP82 as a function of host c e l l growth rate (u). A. The phage burst size i s plotted against the c e l l growth rate. The line has a regression coefficient of 0.79. B. The natural logarithm of the phage burst i s plotted against the c e l l growth rate. The line has a regression coefficient of 0.883. The symbols shown refer to media l i s t e d numerically in Table I: medium 1; O , medium 2; £\, medium 3; A i medium 4; Q , medium 5; medium 6; \f, medium 7; ̂ , medium 8; *k, medium 9; X , medium 10. The lines were calculated by the method of least squares. 38 39 40 TABLE II Exponential rate constants for t o t a l RNA per c e l l , percent a c t i v e RNA polymerase, and SP82 burst si z e Parameter Exponential Rate Constant 3 T o t a l RNA per C e l l 0 Percent Active RNA polymerase' 0.723 + 0.108 0.943 + 0.166 SP82 Burst Size 1.030 + 0.250 3The slope of the l i n e when the natural logarithm of the parameter i s pl o t t e d against growth rate. Also given i s the 95% confidence l i m i t s for the slopes of the l i n e s (calculated by the method of Larsen and Marx, 1981). bTaken from Leduc et a l . (1982). 41 for the enteric bacteria (Maaloe and Kjeldgaard, 1966; Gausing, 1977; Quann, et a l . , 1980; Bremer and Dennis, 1987). The exponential rate constant for burst size against growth rate (the slope of the l i n e i n Figure 3b) and the exponential rate constants for t o t a l RNA per c e l l and percent active RNA polymerase against growth rate are shown i n Table II (the l a t t e r two values were obtained from Leduc, et a l . , 1982). The difference i n the constants for SP82 burst size and percent active RNA polymerase i s not s t a t i s t i c a l l y s i g n i f i c a n t , but the exponential rate constant for t o t a l RNA per c e l l i s s i g n i f i c a n t l y d i f f e r e n t from the constant of the other two parameters. This result suggested that phage burst size might be dependent on active RNA polymerase and indicated that the HMU phage might be a suitable probe for RNA polymerase a v a i l a b i l i t y . B. rRNA synthesis i n an uninfected culture 1. Analysis of rRNA synthesis i n Bac i l l u s during steady state growth. Plasmid pVG-1 was used as a DNA probe for DNA-RNA hybridization to determine the percent rRNA synthesis. Cells were pulse labeled for 1 min with [ 3H]-uridine and a constant amount of the p u r i f i e d RNA was hybridized to increasing levels of pVG-1. The ef f i c i e n c y of the reaction was measured by hybridization of increasing concentrations of p u r i f i e d rRNA to 2 ug of rDNA and was c h a r a c t e r i s t i c a l l y high (88%). Binding to either blank f i l t e r s or to f i l t e r s carrying pBR322 DNA was negligible. Results from a hybridization experiment are shown i n Figure 4. RNA was labeled i n c e l l s grown i n a DMT + succinate medium (u=1.16h-1) and hybridized for 14 h to increasing amounts of pVG-1 DNA (achieved by including more DNA f i l t e r s i n the reaction vessel). Figure 4 shows a 42 Figure 4. Hybridization of pulse labeled RNA to cloned ribosomal DNA. C e l l s were grown i n DMT + 0.25% succinate at a growth rate u=1.16 h - l . When culture density reached 5.7 x 10 7 c e l l s mL - 1. Twenty m i l l i l i t r e s of c e l l s were labeled with 200 uCi [ 3H]-uridine for 1 min. The s p e c i f i c a c t i v i t y of the p u r i f i e d RNA was 18,300 cpm u g _ 1 RNA. The hybridization reaction was for 14 h. Each v i a l contained 3.1 ug (57,000 cpm) of RNA. The percent rRNA synthesis (46.8% i n t h i s experiment) was calculated from the cpm of RNA bound at the plateau as described i n Materials and Methods. 43 i F c 1 1 1 r D N A input lug) 44 saturation curve with increasing input DNA which reaches a maximum at 18 ug with no a d d i t i o n a l increase up to 37 ug. This saturation l e v e l was used to c a l c u l a t e the percent rRNA l e v e l s . At l e a s t two factors might lead to an error i n the estimation of t h i s number. F i r s t , the d i s t r i b u - t i o n of labeled u r a c i l i n t o other pyrimidine nucleoside triphosphates was not taken i n t o account. Second, although the curve appears to be satu- r a t i n g , i t could be lower than true equilibrium. However, both these errors w i l l be systematic, and w i l l not a f f e c t comparisons between growth conditions. Although no estimation of the magnitude of these errors has been made, i t i s u n l i k e l y to be greater than + 10% of the f i n a l value. To determine the range for the percent rRNA synthesis i n B a c i l l u s growing at d i f f e r e n t rates and to define conditions suitable f or the shift-up experiments, cultures were grown i n media y i e l d i n g d i f f e r e n t growth r a t e s . At a density of 1 x 10 8 cells/mL, the c e l l s were pulse labeled with [ 3H]-uridine for 1 min and the percent rRNA synthesis was determined. A steady increase i n the percent of pulse labeled RNA which i s ribosomal was seen over the growth rate range 0.68 h " 1 to 1.88 h " 1 (Figure 5). The rRNA synthesis varied between 43% and 63% at the extremes with an increase of 12.5%/u assuming the observed r e l a t i o n s h i p was, as indicated, l i n e a r . The two sigma confidence of the r e l a t i o n s h i p shown i n Figure 5 was 0.91; shown are h y b r i d i z a t i o n r e s u l t s obtained using the same RNA sample (growth rates 1.88 and 1.16), which can be used to assess the accuracy of the data presented. 45 F i g u r e 5. R a t e o f r i b o s o m a l RNA s y n t h e s i s as a f u n c t i o n o f growth r a t e . C u m u l a t i v e r e s u l t s o f n i n e h y b r i d i z a t i o n e x p e r i m e n t s u s i n g p u l s e l a b e l e d RNA from seven d i f f e r e n t s t e a d y s t a t e c u l t u r e s . The per c e n t rRNA s y n t h e s i s c a l c u l a t e d from t h e s a t u r a t i o n l e v e l o f r a d i o a c t i v i t y bound t o pVG-1 i s shown as a f u n c t i o n o f growth r a t e , u. 46 7 0 47 Figure 6. The kinetics of ribosomal RNA synthesis following a n u t r i t i o n a l shift-up. C e l l s were grown i n DMT + 0.25% acetate + 0.2% casamino acids at a growth rate u=0.68 h - 1 . When culture 7 —] density reached 6.2 x 10 c e l l s mL the culture was shifted to ( f i n a l concentration) 0.1% glucose, 0.5% casamino acids, 6 mg/mL adenosine, and vitamins. At the times indicated 10 mL of culture were removed and labeled with 200 uCi [H3]-uridine for 1 min. The per cent rRNA synthesis was calculated from input r a d i o a c t i v i t y bound to pVG-1 at DNA saturation. 48 49 2. Kinetics of rRNA synthesis following a n u t r i t i o n a l shift-up. The change i n kin e t i c s of rRNA synthesis during a n u t r i t i o n a l shift-up i s shown i n Figure 6. Cell s were grown i n DMT-acetate medium to a density of 5 x 10 7 cells/mL. A prewarmed concentrated solution of glucose + casamino acids was added to a f i n a l concentration of 0.1% glucose and 0.5% casamino acids, 0.6 mg/mL adenosine and l x vitamins (Rodin, 1972) with a volume increase of 10%. After addition of the nutrients 2mL samples were removed and pulse labeled for 1 min. RNA was extracted and hybridized to determine the percent rRNA synthesis. The percent rRNA synthesis appeared to remain constant for 1 min and then increased rapidly up to 18-20 min after the s h i f t when i t became stable again. The data showed that labeling times between 5 and 10 min after n u t r i t i o n a l s h i f t should allow monitoring of the s h i f t i n rRNA synthesis. C. rRNA synthesis i n a phage infected culture To examine the effect of SP01 RNA polymerase modification on rRNA synthesis, a culture of B. s u b t i l i s was grown i n DMT + acetate medium. When the density reached 6 x 10 cells/mL, the culture was s p l i t into control and experimental aliquots. The experimental culture was then infected with SP01am34 carrying an amber mutation i n one of the two proteins involved i n the second polymerase modification (see Introduction to t h i s section). After 10 min of in f e c t i o n , one-half of both the phage infected and uninfected cultures was subjected to n u t r i t i o n a l shift-up by the addition of concentrated medium. After 8 min of further incubation to allow expression of increased rRNA synthesis, samples of a l l 4 c u l - tures were pulse labeled and the isolated RNA analyzed by hybridization. Examples of the hybridization data are shown i n Figure 7 and Table I I I . 50 F i g u r e 7. The e f f e c t o f SP01am34 i n f e c t i o n on t h e s y n t h e s i s o f r i b o s o m a l RNA i n r e s p o n s e t o a n u t r i t i o n a l s h i f t - u p . C e l l s were grown i n DMT + 0 . 5 % a c e t a t e + 0.2% casamino a c i d s a t a growth r a t e u=0.68 h - 1 . When c u l t u r e d e n s i t y r e a c h e d 6 x 1 0 7 c e l l s m L - 1 an a l i q u o t was i n f e c t e d a t an moi=25 ( p a n e l B ) . Ten m i n u t e s a f t e r i n f e c t i o n b o t h i n f e c t e d and u n i n f e c t e d c u l t u r e s were s h i f t e d t o M medium ( f i n a l c o n c e n t r a t i o n ) . These c u l t u r e s were l a b e l e d 8 min a f t e r t h e s h i f t - u p (18 min p o s t i n f e c t i o n ) , and t h e p e r c e n t rRNA s y n t h e s i s was measured as d e s c r i b e d i n F i g u r e 4 and M a t e r i a l s and Methods. H y b r i d i z a t i o n r e a c t i o n s were f o r 21 h. Symbols a r e : u n s h i f t e d u n i n f e c t e d (open t r i a n g l e s ) ; s h i f t e d u n i n f e c t e d ( c l o s e d t r i a n g l e s ) ; u n s h i f t e d i n f e c t e d (open c i r c l e s ) ; s h i f t e d i n f e c t e d ( c l o s e d c i r c l e s ) . 51 T 1 1 1 1 1 1 r D N A i n p u t lug| 52 TABLE I I I Summary of S h i f t Up E x p e r i m e n t s P e r c e n t rRNA s y n t h e s i s 3 l a b e l i n g C o n d i t i o n s N u t r i t i o n a l C o n d i t i o n s U n s h i f t e d S h i f t e d l a b e l 5 min a f t e r s h i f t u n i n f e c t e d i n f e c t e d 41.4 + 15 38.5 + 2.9 50.2 + 1.4 39.2 + 1.4 l a b e l 8 min a f t e r s h i f t u n i n f e c t e d i n f e c t e d 47.4 + 1.1 30.9 + 1.1 59.3 + 1.6 31.0 + 1.6 l a b e l 8 min a f t e r s h i f t u n i n f e c t e d i n f e c t e d 31.4 + 2.0 36.1 + 1.8 46.1 + 2.2 38.4 + 1.4 3 C a l c u l a t e d from t h e i n p u t r a d i o a c t i v i t y ( 3 H - u r i d i n e RNA) from c u l t u r e s ( e i t h e r i n f e c t e d , o r u n i n f e c t e d and w i t h and w i t h o u t n u t r i t i o n a l s h i f t - up) b i n d i n g t o rDNA. 53 In panel A of Figure 7, hybridization data from the uninfected control c e l l s are i l l u s t r a t e d . Addition of the nutrients stimulated the percent rRNA synthesis from 47% to 58% within 8 min after the addition of nutrients. The extent of th i s change i s similar to that seen i n Figure 6 where 8 min after the sif t - u p the percent rRNA synthesis increased from 40 to 52%. Panel B, Figure 7, shows the hybridization data using RNA isolated from the infected c e l l s . The pulse labeling of the infected c e l l s i n Figure 7 took place a t o t a l of 18 min after phage i n f e c t i o n allowing ample time for modification of the host polymerase (Fox, 1976). The data i n Figure 7 show that the percent rRNA synthesis was only marginally changed by SP01am34 i n f e c t i o n . In Figure 7 the unshifted rRNA synthesis rate was somewhat lower after in f e c t i o n than before, however i n other t r i a l s (Table I I I ) , addition of the phage had no effect on rRNA synthesis. The most s t r i k i n g point i l l u s t r a t e d i n Figure 7 (panel B) i s that addition of the phage completely blocked the increase i n rRNA synthesis stimulated by addition of r i c h media. As shown i n Table I I I , s l i g h t variations i n timing of s h i f t or pulse labeling had no effect on the result that phage infe c t i o n blocked the shift-up response. In a l l cases phage infected c e l l s carried on rRNA synthesis at roughly prein- fection rates but could not undergo shift-up i n rRNA production. These data suggested that there might be an RNA polymerase sp e c i f i c for rRNA synthesis and that that form of polymerase was "immune" from gp28 modification. These data also indicated that the hypothesis that phage burst size might be dependent on active RNA polymerase cannot be correct, since the fra c t i o n of polymerase synthesizing rRNA (and hence "immune" from gp28 modification) would increase with growth rate. 54 D. Summary of i n vivo results The results presented i n t h i s section showed the following: 1. SP01 in f e c t i o n did not appreciably affect the rate of transport of amino acids and glucose into the infected c e l l ; however, the rates of nucleosides and base transport were reduced to 40-60% of the control. 2. SP82 could productively infect B a c i l l u s cultures growing i n poor medium. Burst size increased logarithmically with growth rate. 3. The percent of t o t a l RNA that i s rRNA synthesized at any one instant during steady state growth increased 12.5%/u. 4. In shift-up experiments the percent rRNA synthesized appeared to remain constant 1 min after the addition of nutrients, and then increased r a p i d i l y for 18-20 min. 5. Ribosomal RNA continued to be synthesized during SP01am34 infec t i o n at preinfection l e v e l s . The percent rRNA synthesized, however, did not increase when phage infected cultures were provided r i c h medium effecting a n u t r i t i o n a l shift-up. 55 IV. IN VITRO RESULTS A. Templates used for i n v i t r o transcription studies Figure 8 shows the organization of the rRNA rrnB operon of B. s u b t i l i s and the structure of subsequent plasmid constructions. The plasmid pHD1.8 (Deneer and Spiegelman, 1987) served as the primary- template i n t h i s study. For i n v i t r o transcriptions pHD1.8 was line a r i z e d at the unique BstEII s i t e , and the runoff transcripts which originated at PI (384 bases) and P2 (294 bases) were quantified as described i n Materials and Methods. Also shown i n Figure 8 are three subcloned constructions of the promoter region. Plasmid pKK427B contains both promoters of the rrnB operon, but has only 200 bases 5' of the PI promoter and 37 bases 3' of the P2 promoter (Deneer and Spiegelman, 1987). In v i t r o transcriptions using pKK427B lin e a r i z e d with BamHI produced a 200 base PI transcript and a 110 base P2 tra n s c r i p t . The tandem promoters were separated as summarized i n Figure 8 (H. Deneer, Ph.D. Thesis, University of B r i t i s h Columbia, 1986). For i n v i t r o tran- s c r i p t i o n both plasmids were lin e a r i z e d with BamHI. The separated PI construct, pTLXT-205, produced a 65 base runoff transcript, while the separated P2 construct, pTLXT-220, produced a 110 base transcript. Figure 9 shows the structure of the two plasmids containing non- rRNA promoters which served as controls i n these studies. The plasmid p328-5 i s a pBR322 derivative which contains the A2 promoter from Ba c i l l u s phage (Ji29 (Dobinson and Spiegelman, 1985). In v i t r o t ranscription using p328-5 which had been treated with EcoRl produced a 236 base runoff transcript. The plasmid p679 i s a pEMBL8 derivative 56 F i g u r e 8. S t r u c t u r e o f p l a s m i d s c o n t a i n i n g t h e p r omoter r e g i o n s of t h e r r n B o p e r o n . A. The p l a s m i d pHD1.8 was c o n s t r u c t e d by i n s e r t i n g t h e 1900 bp E c o R l fragment o f pGS227 wh i c h c o n t a i n s t h e B. s u b t i l i s r r n B tandem promoter ( S t e w a r t and B o t t 1983) i n t o t h e E c o R l s i t e o f pKM-1 (Deneer and S p i e g e l m a n , 1987). B. P l a s m i d pKK427 c o n t a i n s a 512 bp D d e l fragment f r o m t h e 1900 bp i n s e r t o f pHD1.8 wh i c h was i s o l a t e d and t h e n d i g e s t e d w i t h Sau96I and c l o n e d i n t o t h e Smal s i t e o f pKM-1 (Deneer, Ph. D. t h e s i s ) . Heavy l i n e s r e p r e s e n t c l o n e d , n o n - c o d i n g r e g i o n s 5' t o t h e s t r u c t u r a l gene. Open box r e p r e s e n t s t h e c o d i n g r e g i o n o f t h e 16S gene. T h i n l i n e s r e p r e s e n t v e c t o r DNA. To s e p a r a t e t h e p r o m o t e r s , a 427 bp fragment from pKK427 was d i g e s t e d w i t h Sau3A and H i n d i and a 205 bp fragment whose 3' t e r m i n u s ended i n t h e -35 r e g i o n o f t h e P2 promoter was i n s e r t e d i n t o t h e BamHI s i t e o f pTLXT-11 (Deneer, Ph. D. t h e s i s ) . The r e s u l t i n g p l a s m i d , pTLXT- 205, c o n t a i n s o n l y t h e P I p r omoter i n t a c t . To y i e l d a p l a s m i d w i t h o n l y P2, pKK427 was c u t w i t h E c o R l , t r e a t e d w i t h B a l 3 1 exo- n u c l e a s e . One o f t h e d e l e t i o n s (pTLXT-220) was sequenced and t h e 5' end was f o u n d t o l i e between t h e -10 and -35 r e g i o n s of P I ( i n d i c a t e d by x ) , i n a c t i v a t i n g t h e promoter (Deneer, Ph. D. t h e s i s ) . R e s t r i c t i o n s i t e s a r e d e s i g n a t e d as f o l l o w s : E c o R l ( E ) , BamHI ( B ) , B s t E I I ( B s ) , Sau3A ( S 3 ) , Sau96I ( S 9 6 ) , D d e l ( D ) , and H i n d i ( H c ) . R e s t r i c t i o n s i t e s i n p a r e n t h e s i s have been d e s t r o y e d by c l o n i n g but a r e shown f o r r e f e r e n c e . The l e n g t h s o f t h e r u n o f f t r a n s c r i p t s p r o d u c e d i n i n v i t r o t r a n s c r i p t i o n r e a c t i o n s a r e i n d i c a t e d . 57 A. pHD18 0-2 k b S96 Bs E P1 92 •J 16S 295 b a s e s 385 b a s e s B. Promoter region subc lones E |D) S 3 L p K K 4 2 7 P1 Hc P 2 IS96I S3 P 1 (Hcl B I D-Ch A^- P T L X T 2 0 5 6 5 b a s e s 70 b a s e s I 1 p T L X T 2 2 0 Hc -D LVO p 2 IS961B 110 b a s e s 58 F i g u r e 9. S t r u c t u r e o f p l a s m i d s c o n t a i n i n g t h e p r o m o t e r r e g i o n o f two <j)29 p r o m o t e r s . A. P l a s m i d p328-5 c o n t a i n s a 2.4 kb fragment f r o m <J)29 DNA, d e l i n e a t e d by H i n d i 11 r e s t r i c t i o n e n d o n u c l e a s e s i t e s , was i s o l a t e d and c l o n e d i n t o pBR322 ( D o b i n s o n and S p i e g e l m a n , 1985). B. P l a s m i d p679 c o n t a i n s a H i n d i I I t o H i n f l r e s t r i c t i o n e n d o n u c l e a s e fragment f r o m t h e r i g h t t e r m i n u s o f p29 genome, c l o n e d i n t o t h e Smal s i t e o f pEMBL-8 (Dente e t a l . , 1985). The (J)29 fragment c o n t a i n s t h e G2 promoter (Garvey e t a l . , 1985; D o b i n s o n and S p i e g e l m a n , 1987). R e s t r i c t i o n s i t e s a r e d e s i g n a t e d as f o l l o w s : H i n d i I I ( H ) , E c o R l ( E ) , BamHI ( B ) , and Smal ( S ) . The l e n g t h s o f t h e r u n o f f t r a n s c r i p t s p r o d u c e d i n i n v i t r o t r a n s c r i p t i o n r e a c t i o n s a r e i n d i c a t e d . Open boxes r e p r e s e n t s c l o n e d <}>29 DNA, t h i n l i n e s r e p r e s e n t v e c t o r DNA. 59 A, p328-5 A2 promoter 236 b a s e s 1 • 16 kb 0-8 kb 1 I 1 k B H E H E art o B. p679 G2 promoter 110 bases —• 180 bases S S H w h i c h c o n t a i n s t h e G2 promoter o f phage <J>29 (D o b i n s o n and S p i e g e l m a n , 1987). A 110 base r u n o f f t r a n s c r i p t was p r o d u c e d when H i n d i I I t r e a t e d p679 was used as t e m p l a t e i n i n v i t r o t r a n s c r i p t i o n r e a c t i o n s . B. I s o l a t i o n o f rRNA s p e c i f i c RNA p o l y m e r a s e A l t h o u g h SP01 i n f e c t e d c u l t u r e s c o u l d n o t c a r r y o u t t h e n u t r i t i o n a l s h i f t - u p r e s p o n s e of an i n c r e a s e d r a t e o f rRNA s y n t h e s i s , t h e o b s e r v a t i o n t h a t rRNA c o n t i n u e d t o be s y n t h e s i z e d a t p r e i n f e c t i o n l e v e l s ( s e e above) s u g g e s t e d t h a t t h e r e might be an rRNA s p e c i f i c RNA p o l y m e r a s e t h a t was "immune" from phage m o d i f i c a t i o n by gp28 ( F u j i t a , e t a l . , 1971; Fox, 1976; D u f f y and G e i d u s c h e k , 1975). Two approaches were t a k e n t o w a r d t h e i s o l a t i o n o f such an rRNA s p e c i f i c RNA p o l y m e r a s e . The b a s i c a s s u m p t i o n i n t h e f i r s t a p p r o a c h was t h a t an rRNA s p e c i f i c enzyme might have i n c r e a s e d a f f i n i t y f o r DNA c o n t a i n i n g t h e promoter r e g i o n o f an rRNA opero n , and hence, might be i s o l a t e d by chromatography on a s p e c i f i c DNA- c e l l u l o s e and subsequent e l u t i o n w i t h a s a l t g r a d i e n t . The a s s u m p t i o n i n t h e second a p p r o a c h was based on t h e o b s e r v a t i o n s o f T r a v e r s , e t a l . (1980) t h a t on zone s e d i m e n t a t i o n E. c o l i RNA p o l y m e r a s e e x h i b i t e d f u n c t i o n a l h e t e r o g e n e i t y w i t h r e s p e c t t o t e m p l a t e p r e f e r e n c e , r e g u l a t i o n by ppGpp, and a f f i n i t y f o r fMet-tRNA. The f o l l o w i n g a r e t h e r e s u l t s o f p r e l i m i n a r y e x p e r i m e n t s s u g g e s t e d by t h e above a p p r o a c h e s . I n b o t h c a s e s no s i g n i f i c a n t d i f f e r e n c e s were o b s e r v e d between RNA p o l y m e r a s e a c t i v i t y on t h e A2 promoter and a c t i v i t y on t h e rRNA tandem p r o m o t e r s . 1. A f f i n i t y c h r o m a t o g r a p h y — F o r t h e a f f i n i t y s t u d i e s RNA p o l y m e r a s e was p u r i f i e d f rom B. s u b t i l i s 168 as d e s c r i b e d i n t h e M a t e r i a l s and Methods e x c e p t t h a t s e d i m e n t a t i o n t h r o u g h t h e g l y c e r o l 61 gradient was omitted. One and one-half m i l l i l i t r e s of the pooled 0.6 M NaCl fractions from the f i r s t heparin-sepharose chromatography were loaded on a 1.5cc pHD1.8 DNA-cellulose column and eluted with a 0.05-0.8 M or a 0.05-0.6 M NaCl gradient. Four drop fractions were collected and assayed for RNA polymerase a c t i v i t y as described previously (Dobinson and Spiegelman, 1985). Fractions containing peak a c t i v i t y were used i n a standard transcription assay with pHD1.8 (rrnB tandem promoter, Figure 10a) or p328-5 (<J)29 A2 promoter, Figure 10b) as template to assess enzyme s p e c i f i c i t y . Figure 10 shows the elution p r o f i l e of t o t a l RNA polymerase a c t i v i t y , the enzyme a c t i v i t y on the sp e c i f i c templates and the NaCl concentration for two different enzyme samples chromatographed on pHD1.8 DNA-cellulose. In both experiments the t o t a l a c t i v i t y peak occurred at a higher salt concentration than the sp e c i f i c a c t i v i t y peak. Total polymerase a c t i v i t y eluted as a broad peak with an estimated maximum eluting at 0.22 M NaCl, while maximum polymerase a c t i v i t y assayed on the spe c i f i c templates eluted at 0.18 M NaCl for both the tandem rRNA promoters (Figure 10a) and the A2 promoter (Figure 10b). The assay for t o t a l a c t i v i t y measures the RNA synthesized by both core (alpha2, beta, beta 1) and holoenzyme (core + sigma 4 3), whereas the assay for spec i f i c transcripts measures the RNA synthesized by only holoenzyme. The dif f e r e n t elution patterns of t o t a l a c t i v i t y and spe c i f i c a c t i v i t y may r e f l e c t the different a f f i n i t i e s of core and holoenzyme for site s on the DNA cel l u l o s e . 2. Sedimentation—For the sedimentation studies RNA polymerase from B. s u b t i l i s 168 (Iowa Grain Processing) which had been p u r i f i e d through the DNA cell u l o s e a f f i n i t y chromatography step (Dobinson and Spiegelman, 1985) was used. The fractions which showed the peak polym- 62 F i g u r e 10. E l u t i o n p r o f i l e o f RNA p o l y m e r a s e a c t i v i t y f rom pHD1.8 D N A - c e l l u l o s e column. One and a h a l f m i l l i l i t r e s o f h e p a r i n - s e p h a r o s e p u r i f i e d RNA p o l y m e r a s e were l o a d e d o n t o 1.5cc pHD1.8 D N A - c e l l u l o s e column. A. Column was e l u t e d w i t h a 0.05-0.8 M NaCl g r a d i e n t . B. Column was e l u t e d w i t h a 0.05-0.6_M NaCl g r a d i e n t . T o t a l RNA p o l y m e r a s e a c t i v i t y ( c l o s e d s q u a r e s ) and NaCl c o n c e n t r a t i o n ( c l o s e d t r i a n g l e s ) a r e shown i n t h e upper p a r t o f each p a n e l . Enzyme a c t i v i t y a t s p e c i f i c p r o m o t e r s was d e t e r m i n e d u s i n g t h e s t a n d a r d t r a n s c r i p t i o n a s s a y d e s c r i b e d i n Methods and i s shown i n t h e lower p a r t o f each p a n e l : P I (open c i r c l e s ) , P2 ( c l o s e d c i r c l e s ) , and A2 (open t r i a n g l e s ) . 63 i 1 1 1 1 1 1 1 r 1 5 9 11 17 21 25 2 9 3 3 37 41 4 5 F r a c t i o n n u m b e r 64 RNA Polymerase act iv i ty x10 3 c p m NaCl c o n c e n t r a t i o n e r a s e a c t i v i t y were c o n c e n t r a t e d , l o a d e d on a 15-30% g l y c e r o l g r a d i e n t and s e d i m e n t e d as d e s c r i b e d i n Methods. The f r a c t i o n s w h i c h showed t h e peak p o l y m e r a s e a c t i v i t y were a s s a y e d f o r p r o t e i n c o n c e n t r a t i o n and used i n s i n g l e r ound t r a n s c r i p t i o n a s s a y s a t 20 nM RNA p o l y m e r a s e w i t h e i t h e r t h e rRNA tandem promoter c o n s t r u c t o r t h e |)29 A2 promoter c o n s t r u c t as t e m p l a t e ( F i g u r e 1 1 ) . The tandem rRNA p r o m o t e r s were f o u n d t o be h i g h l y s e n s i t i v e t o t h e n u c l e o t i d e c o m p o s i t i o n o f t h e i n i t i a t i o n mix ( s e e b e l o w ) . The r e s u l t s p r e s e n t e d i n F i g u r e 11 f o r t h e rRNA p r o m o t e r s a r e f r o m s e p a r a t e a s s a y s i n w h i c h t h e pHD1.8 t e m p l a t e was i n c u b a t e d w i t h GTP, ATP, and UTP (GAU, P I d a t a ) o r ATP, GTP, and CTP (AGC, P2 d a t a ) and enzyme b e f o r e h e p a r i n and t h e f o u r t h n u c l e o t i d e were added. The RNA p o l y m e r a s e was more a c t i v e a t P I when GAU was i n t h e i n i t i a t i o n mix t h a n when AGC was p r e s e n t , and c o n v e r s e l y , t h e enzyme was more a c t i v e a t P2 when AGC was i n t h e i n i t i a t i o n mix t h a n when t h e mix c o n t a i n e d GAU ( s e e b e l o w ) . D e s p i t e t h e v a r i a t i o n i n the. a b s o l u t e l e v e l o f RNA p o l y m e r a s e a c t i v i t y a t each p r o m o t e r , t h e peak o f a c t i v i t y o c c u r r e d i n f r a c t i o n 12 f o r a l l p r o m o t e r s s u g g e s t i n g t h a t an rRNA s p e c i f i c p o l y m e r a s e was n o t i s o l a t e d by t h i s method. These p r e l i m i n a r y e x p e r i m e n t s f a i l e d t o i s o l a t e an RNA p o l y m e r a s e w h i c h would p r e f e r e n t i a l l y t r a n s c r i b e rRNA genes. R o u t i n e l y p u r i f i e d enzyme f r a c t i o n s p r o d u c e d t r a n s c r i p t s a t a r e p r o d u c i b l e l e v e l f rom rRNA and non-rRNA p r o m o t e r s i n t h e s i n g l e r o u n d t r a n s c r i p t i o n a s s a y . These d a t a s u g g e s t e d t h a t r e g u l a t i o n o f rRNA s y n t h e s i s might t a k e p l a c e a t RNA p o l y m e r a s e - p r o m o t e r i n t e r a c t i o n s . The f o c u s of t h e i n v i t r o s t u d y o f rRNA s y n t h e s i s , t h e r e f o r e , widened t o i n c l u d e t h e n a t u r e o f t h e i n t e r - a c t i o n between p o l y m e r a s e and t h e rRNA p r o m o t e r s . 66 F i g u r e 11. S p e c i f i c RNA p o l y m e r a s e a c t i v i t y i n g l y c e r o l g r a d i e n t f r a c t i o n s . T o t a l RNA p o l y m e r a s e a c t i v i t y o c c u r r e d i n g r a d i e n t f r a c t i o n s 11-15 and r e a c h e d maximum i n f r a c t i o n 14. Enzyme a c t i v i t y a t s p e c i f i c p r o m o t e r s was d e t e r m i n e d u s i n g t h e s i n g l e r o und t r a n s c r i p t i o n a s s a y d e s c r i b e d i n Methods. The i n c u b a t i o n r e a c t i o n f o r t r a n s c r i p t i o n from t h e P I promoter (open c i r c l e s ) c o n t a i n e d 400 uM GTP, CTP and 10 uM ATP; UTP was added t o 400 uM w i t h h e p a r i n . The i n c u b a t i o n r e a c t i o n f o r t r a n s c r i p t i o n from t h e P2 promoter ( c l o s e d c i r c l e s ) c o n t a i n e d 400 uM GTP, UTP, and 10 uM ATP; CTP was added t o 400 uM w i t h h e p a r i n . The i n c u b a t i o n r e a c t i o n f o r t r a n s c r i p t i o n from t h e A2 promoter ( c l o s e d t r i a n g l e s ) c o n t a i n e d 400 uM ATP and GTP; CTP (400 uM) and UTP (10 uM) were added t o w i t h h e p a r i n . H e p a r i n mix was added 1 min a f t e r t h e enzyme and e l o n g a t i o n was p e r m i t t e d f o r 10 min. T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. The f i n a l enzyme c o n c e n t r a t i o n f r o m a l l f r a c t i o n s was 20 nM. 67  C. E f f e c t o f a s s a y p a r a m e t e r s on i n v i t r o t r a n s c r i p t i o n o f t h e tandem rRNA p r o m o t e r s To b e g i n t h e i n v e s t i g a t i o n of t r a n s c r i p t i o n i n i t i a t i o n a t t h e i n d i v i d u a l rRNA p r o m o t e r s , t h e e f f e c t o f d i f f e r e n t k i n e t i c p a r a m e t e r s on RNA p o l y m e r a s e a c t i v i t y on t h e tandem promoter c o n s t r u c t was s t u d i e d . RNA p o l y m e r a s e a c t i v i t y a t t h e rRNA p r o m o t e r s i n t h e tandem c o n s t r u c t e x h i b i t e d some un e x p e c t e d c h a r a c t e r i s t i c s when compared t o a c t i v i t y a t t h e p r e v i o u s l y d e s c r i b e d b a c t e r i o p h a g e (|>29 p r o m o t e r s ( D o b i n s o n and S p i e g e l m a n , 1985 & 1987). I n t h e f o l l o w i n g e x p e r i m e n t s RNA p o l y m e r a s e a c t i v i t y was measured by f o l l o w i n g t h e s y n t h e s i s o f t r a n s c r i p t s p r o d u c e d when m i x t u r e s of p o l y m e r a s e and promoter were c h a l l e n g e d w i t h h e p a r i n . The e x p e r i m e n t s t h u s measure t h e f o r m a t i o n of complexes w h i c h can i n i t i a t e i n t h e p r e s e n c e o f h e p a r i n and a r e t h u s c a l l e d h e p a r i n r e s i s t a n t complexes. F i g u r e 12 compares t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t t h e (j)29 A2 promoter and a t t h e tandem rRNA p r o m o t e r s as a f u n c t i o n of enzyme c o n c e n t r a t i o n . I n t h i s e x p e r i m e n t t h e r e a c t i o n m i x t u r e w i t h t h e A2 t e m p l a t e ( a t 2 nM) i n c l u d e d ATP and GTP (AG), w h i l e t h e r e a c t i o n m i x t u r e w i t h t h e tandem rRNA promoter t e m p l a t e ( a t 2.6 nM) i n c l u d e d GTP, UTP, and CTP (GUC). As t h e enzyme c o n c e n t r a t i o n i n c r e a s e d , t h e l e v e l o f h e p a r i n r e s i s t a n t complexes r e a c h e d a p l a t e a u i n d i c a t i n g t h a t e i t h e r t h e DNA was s a t u r a t e d w i t h enzyme o r a s t e a d y s t a t e had been r e a c h e d . The rRNA p r o m o t e r s r e q u i r e d a h i g h e r enzyme c o n c e n t r a t i o n t o r e a c h t h e i r p l a t e a u l e v e l (30-50 nM) t h a n d i d t h e phage promoter (lOnM). T h i s r e s u l t was r a t h e r s u r p r i s i n g i n l i g h t o f t h e s t r e n g t h of t h e rRNA p r o m o t e r s i n v i v o . F i g u r e 12 a l s o shows t h a t even a t t h e h i g h e s t enzyme c o n c e n - 69 F i g u r e %2. The e f f e c t o f RNA p o l y m e r a s e c o n c e n t r a t i o n on t r a n s c r i p t i o n i n i t i a t i o n f r o m A2 ( c l o s e d c i r c l e s ) , P I (open s q u a r e s ) , and P2 ( c l o s e d s q u a r e s ) p r o m o t e r s . RNA p o l y m e r a s e a t t h e c o n c e n t r a t i o n s i n d i c a t e d was i n c u b a t e d w i t h l i n e a r i z e d t e m p l a t e s o f e i t h e r t h e A2 promoter (2 nM) i n t h e p r e s e n c e o f 400 uM ATP and GTP, o r t h e rRNA tandem promoter (2.6 nM) i n t h e p r e s e n c e o f 400 uM GTP, UTP, and CTP f o r 10 m i n u t e s , a t w h i c h t i m e h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and t h e r e m a i n i n g n u c l e o - t i d e s were added and t h e e l o n g a t i o n r e a c t i o n a l l o w e d t o p r o c e e d f o r a f u r t h e r 10 m i n u t e s . T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. 70  t r a t i o n s t h e amount o f h e p a r i n used was s u f f i c i e n t t o s t o p m u l t i p l e rounds o f t r a n s c r i p t i o n i n i t i a t i o n . No more t h a n 0.3 t r a n s c r i p t s p e r promoter were p r o d u c e d a t e i t h e r t h e A2 t e m p l a t e o r t h e tandem rRNA promoter t e m p l a t e a t t h e h i g h e r enzyme i n p u t s . D o b i n s o n and S p i e g e l m a n (1987) r e p o r t e d a comparable l e v e l o f p o l y m e r a s e a c t i v i t y a t t h e A2 p r o m o t e r . A second u n e x p e c t e d c h a r a c t e r i s t i c o f the r r n B tandem p r o m o t e r s i s i l l u s t r a t e d by t h e d a t a i n F i g u r e 13. The r a t e o f h e p a r i n r e s i s t a n t com- p l e x f o r m a t i o n a t t h e (J)29 A2 and G2 p r o m o t e r s and t h e tandem rRNA p r o m o t e r s was measured i n t h e p r e s e n c e of AG, f o r t h e f o r m e r , o r GUC, f o r t h e l a t t e r . Complexes formed v e r y r a p i d l y on b o t h phage p r o m o t e r s and r e a c h e d maximum l e v e l s i n a p p r o x i m a t e l y one m i n u t e . S i m i l a r k i n e t i c s were r e p o r t e d by Dobinson and S p i e g e l m a n (1985, 1987; see b e l o w ) . I n c o n t r a s t , t h e rRNA tandem p r o m o t e r s were r e l a t i v e l y i n e f f i c i e n t s u b s t r a t e s f o r complex f o r m a t i o n as i t t o o k 4 min t o r e a c h t h e maximum l e v e l o f complexes. I n a l l c a s e s t h e l e v e l o f complexes remained c o n s t a n t f o r up t o 15 min. F u r t h e r m o r e t h e slow r a t e o f complex f o r m a t i o n was o b s e r v e d w i t h d i f f e r e n t enzyme b a t c h e s and appeared t o be a c h a r a c t e r i s t i c o f t h e holoenzyme. A t h i r d u n e x p e c t e d c h a r a c t e r i s t i c o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e rRNA p r o m o t e r s was t h e a p p a r e n t s e n s i t i v i t y o f t h e r e a c t i o n t o t h e p r e s e n c e of s p e c i f i c n u c l e o t i d e s i n t h e i n i t i a t i o n m i x t u r e . H e p a r i n r e s i s t a n t complexes formed a t b o t h P I and P2 of t h e tandem promoter c o n s t r u c t when t h e i n i t i a t i o n mix i n c l u d e d GUC (see a b o v e ) . When t h e s e p a r a t e d p r o m o t e r c o n s t r u c t s s e r v e d as t e m p l a t e s a d i f f e r e n t r e s u l t was seen. F i g u r e 14a shows an a u t o r a d i o g r a m of an enzyme c o n c e n t r a t i o n 72 F i g u r e 13. The e f f e c t o f i n i t i a t i o n t i m e on t r a n s c r i p t i o n i n i t i a t i o n from A2 ( c l o s e d c i r c l e s ) , G2 (open c i r c l e s ) , P I (open s q u a r e s ) , o r P2 ( c l o s e d s q u a r e s ) p r o m o t e r s . RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h l i n e a r i z e d t e m p l a t e s o f e i t h e r t h e A2 p r o m oter (2 nM), G2 promoter (2.3 nM), o r t h e rRNA tandem promoter (2.6 nM) f o r t h e t i m e s i n d i c a t e d . The A2 and G2 t e m p l a t e s i n c u b a t i o n mixes c o n t a i n e d 400 uM ATP and GTP, and t h e rRNA tandem promoter t e m p l a t e i n c u b a t i o n mix c o n t a i n e d 400 uM GTP, UTP and CTP. A f t e r t h e i n i t i a t i o n p e r i o d 38 uL a l i q u o t s were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and t h e r e m a i n i n g n u c l e o t i d e s . T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. 73 Transcript/promoter N> H • • • • 0> 3 oo ••IB 3 ro P ro • a O CO o o O J L 0 L F i g u r e 14. The e f f e c t o f t h e n u c l e o t i d e c o m p o s i t i o n o f t h e i n i t i a t i o n mix on t r a n s c r i p t i o n i n i t i a t i o n from t h e s e p a r a t e d r i b o s o m a l p r o m o t e r s . P l a s m i d pTLXT-205 c o n t a i n i n g o n l y t h e P I promoter ( l a n e s 1-10) o r p l a s m i d pTLXT-220 c o n t a i n i n g o n l y t h e P2 promoter ( l a n e s 11-20) were i n c u b a t e d i n a s o l u t i o n c o n t a i n i n g 400 uM GTP, UTP, CTP ( p a n e l A) o r 400 uM ATP, GTP, CTP ( p a n e l B) w i t h RNA p o l y m e r a s e a t t h e f o l l o w i n g c o n c e n t r a t i o n s f o r 10 min: 4 nM, l a n e s 1 and 11; 6 nM, l a n e s 2 and 12; 8 nM, l a n e s 3 and 13; 10 nM, l a n e s 4 and 14; 20 nM, l a n e s 5 and 15; 30 nM, l a n e s 6 and 16; 50 nM, l a n e s 7 and 17; 60 nM, l a n e s 8 and 18; 70 nM, l a n e s 9 and 19; o r 80 nM, l a n e s 10 and 20. H e p a r i n and t h e r e m a i n i n g n u c l e o t i d e ( { a l p h a - 3 2 P ] l a b e l e d ) were added t o 5 ug/mL and 10 uM, r e s p e c - t i v e l y , and i n c u b a t e d f o r a f u r t h e r 10 min. T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and t h e a c r y l a m i d e g e l s u b j e c t e d t o a u t o r a d i o g r a p h y . 75 A. GUC initiation pTLXT-205 pTLXT-220 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 -P2 xc pr xc 76 B. A G C ini t iat ion pTLXT-205 pTLXT-220 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 e x p e r i m e n t i n w h i c h t h e p l a s m i d s c o n t a i n i n g t h e s e p a r a t e d P I p r o m o t e r , pTLXT205, ( l a n e s 1-10), o r t h e s e p a r a t e d P2 p r o m o t e r , pTLXT220, ( l a n e s 11-20), s e r v e d as t e m p l a t e s and t h e i n i t i a t i o n mix c o n t a i n e d GUC. RNA p o l y m e r a s e formed h e p a r i n - r e s i s t a n t complexes o n l y a t t h e P I p r o m o t e r , but n o t a t t h e P2 p r o m o t e r . On t h e o t h e r hand, when an enzyme c o n c e n t r a t i o n e x p e r i m e n t was p e r f o r m e d u s i n g t h e same t e m p l a t e s but i n c u b a t e d w i t h AGC, t h e p o l y m e r a s e formed h e p a r i n - r e s i s t a n t complexes a t t h e P2 promoter ( F i g u r e 14b, l a n e s 1 1 - 2 0 ) , but n o t a t t h e P I promoter ( F i g u r e 14b, l a n e s 1-10). D. T r a n s c r i p t i o n from P I a f f e c t s t r a n s c r i p t i o n from P2 Changes i n t h e i n i t i a t i o n mix were f o u n d t o i n f l u e n c e t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t a p a r t i c u l a r promoter and t h e s t a b i l i t y o f t h e enzyme i n h e p a r i n - r e s i s t a n t c o m p l e x e s . B o t h f o r m a t i o n and s t a b i l i t y e f f e c t s a r e i l l u s t r a t e d i n F i g u r e 15. F i g u r e 15a shows an a u t o r a d i o g r a p h o f a p o l y a c r y l a m i d e g e l o f t r a n s c r i p t s p r o d u c e d i n an i n i t i a t i o n t i m e c o u r s e e x p e r i m e n t e m p l o y i n g 20 nM RNA p o l y m e r a s e . I n t h e r e a c t i o n s shown i n l a n e s 1-8 t h e i n i t i a t i o n r e a c t i o n c o n t a i n e d n u c l e o - t i d e s AGC. T r a n s c r i p t s were p r o d u c e d f r o m P2 o n l y . I n t h e r e a c t i o n s shown i n l a n e s 9-16 t h e i n i t i a t i o n r e a c t i o n c o n t a i n e d GUC and t r a n s c r i p t s were i n i t i a t e d a t b o t h P I and P2. The e f f e c t on t h e s t a b i l i t y o f t h e h e p a r i n - r e s i s t a n t complexes formed a t P2 can be more r e a d i l y seen i n F i g u r e 15b, where t h e l e v e l o f t r a n s c r i p t s from P2 has been p l o t t e d as a f u n c t i o n o f i n c u b a t i o n t i m e . When h e p a r i n - r e s i s t a n t complexes c o u l d be formed a t P I (GUC i n i t i a t i o n ) , h e p a r i n r e s i s t a n t complexes a t P2 were s t a b l e t o i n c u b a t i o n t i m e , s i n c e 78 F i g u r e 15. The e f f e c t o f i n i t i a t i o n n u c l e o t i d e s on t r a n s c r i p t i o n i n i t i a t i o n f rom P2. A. A u t o r a d i o g r a m o f p o l y a c r y l a m i d e g e l o f t r a n s c r i p t i o n p r o d u c t s . RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h t h e rRNA tandem promoter t e m p l a t e (2.6 nM) i n t h e p r e s e n c e o f 400 uM ATP, GTP and CTP ( l a n e s 1-8) o r 400 uM GTP, UTP, and CTP ( l a n e s 9-16). I n i t i a t i o n r e a c t i o n s were f o r 0.5 min ( l a n e s 1 and 9 ) , 1 min ( l a n e s 2 and 1 0 ) , 2 min ( l a n e s 3 and 1 1 ) , 4 min ( l a n e s 4 and 1 2 ) , 6 min ( l a n e s 5 and 1 3 ) , 8 min ( l a n e s 6 and 1 4 ) , 10 min ( l a n e s 7 and 1 5 ) , and 15 min ( l a n e s 8 and 1 6 ) . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL a l i q u o t s were removed and added t o 2 uL h e p a r i n (5 ug/mL f i n a l c o n c e n t r a t i o n ) and t h e r e m a i n i n g n u c l e o t i d e ( [ a l p h a - 3 2 P ] l a b e l e d ) and a l l o w e d t o e l o n g a t e f o r 10 min. The P I t r a n s c r i p t was n o t d e t e c t a b l e i n t h e AGC i n i t i a t i o n c o n d i t i o n s . . B. T r a n s c r i p t i o n p r o d u c t s were q u a n t i f i e d as d e s c r i b e d i n Methods: p o l y m e r a s e a c t i v i t y a t t h e P2 promoter w i t h AGC ( c l o s e d c i r c l e s ) o r GUC ( c l o s e d s q u a r e s ) i n i t i a t i o n c o n d i t i o n s . 79 AGC GUC 1 2 3 4 5 6 7 8 9 10 11 1 2 1 3 14 15 16 80 81 a f t e r 4 min t h e number o f t r a n s c r i p t s p e r promoter remained c o n s t a n t a t about 0.2. When h e p a r i n r e s i s t a n t complexes c o u l d n o t be formed a t P I (AGC i n i t i a t i o n ) , t h e f o r m a t i o n o f h e p a r i n - r e s i s t a n t P2 complexes was r e d u c e d by 20% a t 0.5 min i n i t i a t i o n and c o n t i n u e d t o decay t h r o u g h o u t t h e d u r a t i o n o f t h e e x p e r i m e n t . T h i s d e c ay i n d i c a t e d t h a t a l t h o u g h h e p a r i n - r e s i s t a n t complexes c o u l d be formed i n i t i a l l y a t P2, t h e com- p l e x e s d i d n o t r e m a i n r e s i s t a n t t o h e p a r i n a t t a c k w i t h i n c r e a s e d i n i t i a t i o n t i m e . I t s h o u l d be n o t e d t h a t t h e decay o f complexes a t P2 o c c u r r e d i n t h e absence o f h e p a r i n and i n t h e p r e s e n c e o f t h e n u c l e o t i d e s AGC. The e x p e r i m e n t s u s i n g t h e tandem promoter t e m p l a t e c o n f i r m e d t h e i n i t i a l o b s e r v a t i o n made on t h e s e p a r a t e d promoter t e m p l a t e s : when t h e i n i t i a t i o n mix c o n t a i n e d t h e n u c l e o t i d e s ATP, GTP, and CTP, RNA polym- e r a s e formed h e p a r i n r e s i s t a n t complexes a t t h e P2 promoter o n l y . I n i t i a t i o n t i m e c o u r s e e x p e r i m e n t s u s i n g t h e s e p a r a t e d P2 c o n s t r u c t as t e m p l a t e were p e r f o r m e d t o i n v e s t i g a t e whether t h e s t a b i l i t y o f t h e h e p a r i n - r e s i s t a n t complexes was s i m i l a r t o t h a t o b s e r v e d a t P2 on t h e tandem promoter c o n s t r u c t . F i g u r e 16 compares t h e AGC i n i t i a t i o n d a t a f r o m F i g u r e 15b t o RNA p o l y m e r a s e a c t i v i t y a t P2 from an i n i t i a t i o n t i m e c o u r s e e x p e r i m e n t where t h e s e p a r a t e d P2 promoter c o n s t r u c t was t h e t e m p l a t e , t h e i n i t i a t i o n mix c o n t a i n e d AGC and t h e enzyme c o n c e n t r a t i o n was 20 nM. No s i g n i f i c a n t d i f f e r e n c e i n t h e l e v e l o f h e p a r i n - r e s i s t a n t complex f o r m a t i o n between t h e two P2 t e m p l a t e s was seen. I n a d d i t i o n , no s i g n i f i c a n t d i f f e r e n c e i n t h e s t a b i l i t y o f t h e h e p a r i n - r e s i s t a n t complexes was n o t e d , i . e . d e c ay o f h e p a r i n - r e s i s t a n t complexes o c c u r r e d on b o t h t e m p l a t e s . 82 Figure 16. The e f f e c t of PI d e l e t i o n from the rRNA promoter template on t r a n s c r i p t i o n i n i t i a t i o n from P2. RNA polymerase (20 nM) was incubated with the tandem rRNA template (2.6 nM pHD1.8 DNA) (closed c i r c l e s ) or the separated P2 template (2.5 nM pTLXT- 220 DNA) (open c i r c l e s ) i n a solution containing 400 uM ATP, GTP and CTP for the times in d i c a t e d . After the i n i t i a t i o n period 38 uL a l i q u o t s were removed and added to 2 uL heparin (5 ug/mL, f i n a l concentration) and [alpha- 3 2P]-UTP (10 uM f i n a l concentration) and allowed to elongate for 10 min. Tran s c r i p t i o n products were separated by electrophoresis and qu a n t i f i e d as described i n Methods. 83 joiowojd/iduosueji 84 U n l i k e t h e a c t i v i t y seen a t t h e P2 p r o m o t e r , RNA p o l y m e r a s e a c t i v i t y a t t h e P I promoter d i d n o t change w i t h t h e absence o f a f u n c t i o n a l P2. F i g u r e 17 compares t h e r e s u l t s o f an i n i t i a t i o n t i m e c o u r s e e x p e r i m e n t i n wh i c h t h e s e p a r a t e d P I c o n s t r u c t was used as t h e t e m p l a t e , t h e i n i t i a t i o n mix c o n t a i n e d GUC, and RNA p o l y m e r a s e was a t 20 nM, w i t h t h e P I d a t a o f t h e tandem promoter c o n s t r u c t i n F i g u r e 15. For b o t h t e m p l a t e s t h e l e v e l o f a c t i v i t y r o s e o v e r 4 min and remained c o n s t a n t , and no s i g n i f i c a n t d i f f e r e n c e was n o t e d i n t h e l e v e l o f h e p a r i n - r e s i s t a n t complex f o r m a t i o n n o r i n t h e s t a b i l i t y o f t h e com- p l e x e s . These r e s u l t s i n d i c a t e d t h a t t h e f o r m a t i o n of h e p a r i n - r e s i s t a n t complexes a t t h e P I promoter was i n d e p e n d e n t o f a c t i v i t y a t t h e P2 pr o m o t e r . F i g u r e 18 shows t h e e f f e c t o f RNA p o l y m e r a s e c o n c e n t r a t i o n on t h e r a t e o f h e p a r i n - r e s i s t a n t complex f o r m a t i o n a t P2 of t h e tandem promoter c o n s t r u c t when t h e i n i t i a t i o n mix c o n t a i n e d AGC by comparing t h e t i m e c o u r s e o f complex f o r m a t i o n f o r t h r e e enzyme i n p u t s . The decay o f com- p l e x e s a t P2 c o u l d n o t be a l l e v i a t e d by an i n c r e a s e i n enzyme c o n c e n t r a - t i o n , a l t h o u g h RNA p o l y m e r a s e c o n c e n t r a t i o n d i d i n c r e a s e t h e maximum l e v e l o f t r a n s c r i p t i o n a c t i v i t y and t h e l e n g t h o f t h e i n c u b a t i o n t i m e a t whi c h maximum a c t i v i t y o c c u r r e d . As t h e RNA p o l y m e r a s e c o n c e n t r a t i o n i n c r e a s e d f r o m 4 nM t o 60 nM, t h e t i m e t o r e a c h maximum a c t i v i t y i n - c r e a s e d f r o m 1 min t o 4 min. S t e f a n o and G r a l l a (1979) and D o b i n s o n and Spiege l m a n (1987) have r e p o r t e d t h a t p o l y m e r a s e i r r e v e r s i b l y d e n a t u r e s under i n i t i a t i o n c o n d i t i o n s when i t cannot form s t a b l e complexes w i t h DNA. Such d e n a t u r a t i o n p r o b a b l y a c c o u n t s f o r t h e l o s s o f t r a n s c r i p t i o n a c t i v i t y . The o b s e r v e d r a t e o f decay from maximum t o 50% maximum was about t h e same f o r t h e t h r e e enzyme c o n c e n t r a t i o n s : 6.2 min a t 4 nM, 7.7 85 F i g u r e 17. The e f f e c t o f P2 d e l e t i o n f r o m t h e rRNA promoter t e m p l a t e on t r a n s c r i p t i o n i n i t i a t i o n f rom P I . RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h t h e tandem rRNA t e m p l a t e (2.6 nM pHD1.8 DNA) ( c l o s e d c i r c l e s ) o r t h e s e p a r a t e d P I t e m p l a t e (1.5 nM pTLXT- 205 DNA) (open c i r c l e s ) i n a s o l u t i o n c o n t a i n i n g 400 uM GTP, UTP and CTP f o r t h e t i m e s i n d i c a t e d . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL a l i q u o t s were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and [ a l p h a - 3 2 P ] - A T P (10 uM f i n a l c o n c e n t r a t i o n ) and a l l o w e d t o e l o n g a t e f o r 10 min. T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. 86  F i g u r e 18. The e f f e c t o f RNA p o l y m e r a s e c o n c e n t r a t i o n on t r a n s c r i p t i o n i n i t i a t i o n a t t h e P2 promoter o f t h e tandem promoter rRNA t e m p l a t e . The tandem promoter t e m p l a t e was i n c u b a t e d w i t h RNA p o l y m e r a s e a t 4 nM (open s q u a r e s ) , 20 nM ( c l o s e d c i r c l e s ) , and 60 nM (open t r i a n g l e s ) , i n t h e p r e s e n c e of 400 uM ATP, GTP and CTP and a l l o w e d t o f o r m complexes f o r t h e t i m e s i n d i c a t e d . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and [ a l p h a - 3 2 P ] - U T P (10 uM f i n a l c o n c e n t r a t i o n ) . T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. 88  min a t 20 nM, and 7.8 min a t 60 nM, g i v i n g an a v e r a g e decay c o n s t a n t , k=0.1 m i n - 1 . The e f f e c t o f enzyme c o n c e n t r a t i o n on t h e s e p a r a t e d P2 t e m p l a t e when t h e i n i t i a t i o n mix c o n t a i n e d AGC was t h e same as t h a t shown i n F i g u r e 18 ( d a t a n o t shown). E. K i n e t i c a n a l y s i s o f tandem rRNA p r o m o t e r s The i n i t i a t i o n r a t e a s s a y i l l u s t r a t e d i n F i g u r e 13 showed t h a t RNA p o l y m e r a s e a t t h e rRNA p r o m o t e r s r e q u i r e d more t i m e t o r e a c h maximum a c t i v i t y t h a n d i d t h e enzyme a t t h e two |)29 p r o m o t e r s . To compare t h e k i n e t i c c h a r a c t e r i s t i c s o f t h e p o l y m e r a s e a t t h e tandem rRNA p r o m o t e r s t o t h o s e o f t h e enzyme a t t h e A2 p r o m o t e r , i n i t i a t i o n r a t e e x p e r i m e n t s were p e r f o r m e d o v e r a range o f enzyme c o n c e n t r a t i o n s f o r a n a l y s i s u s i n g t h e c o m p o s i t e r a t e a s s a y ( S t e f a n o and G r a l l a , 1982; D o b i n s o n and Sp i e g e l m a n , 1985) a m o d i f i c a t i o n o f t h e t a u p l o t a n a l y s i s ( M c C l u r e , 1 9 80). The com- p o s i t e r a t e a s s a y makes two a s s u m p t i o n s : f i r s t , t h a t p o l y m e r a s e a t a promoter p r o c e e d s t h r o u g h an u n s t a b l e i n t e r m e d i a t e and t h a t i t s c o n v e r s i o n t o a s t a b l e complex i s t h e r a t e l i m i t i n g s t e p i n t r a n s c r i p t i o n i n i t i a t i o n ; and second, under c o n d i t i o n s o f enzyme e x c e s s , t h e r e a c t i o n w i l l become p s e u d o - f i r s t o r d e r i n promoter s i t e s . The o b s e r v e d r a t e w i l l be i n f l u e n c e d by t h e s t a b i l i t y and c o n v e r s i o n of t h e u n s t a b l e i n t e r - m e d i a t e t o t h e open complex. V a r i a t i o n o f t h e p o l y m e r a s e c o n c e n t r a t i o n w i l l i n f l u e n c e t h e r a t e by c h a n g i n g t h e f r a c t i o n a l s a t u r a t i o n o f t h e pro m o t e r s i t e s w i t h t h e i n t e r m e d i a t e s ( S t e f a n o and G r a l l a , 1982). The t a u p l o t i s f o r m a l l y a n a l o g o u s t o t h e L i n e w e a v e r - B u r k d o u b l e r e c i p r o c a l p l o t ( M c C l u r e , 1980). T r a n s f o r m a t i o n o f i n i t i a t i o n r a t e d a t a i n t o a t a u p l o t p e r m i t s t h e c a l c u l a t i o n o f t h e o v e r a l l f o r w a r d r a t e 90 F i g u r e 19. K i n e t i c a n a l y s i s o f i n i t a t i o n complex f o r m a t i o n a t t h e A2 p r o m o t e r . A. S e m i l o g a r i t h m e t i c p l o t o f t h e d a t a f r o m an i n i t i a t i o n t i m e c o u r s e . The A2 pr o m o t e r t e m p l a t e (2 nM) was i n c u b a t e d w i t h RNA p o l y m e r a s e a t 6 nM ( c l o s e d c i r c l e s ) o r 16 nM (open c i r c l e s ) i n t h e p r e s e n c e o f 400 uM ATP and GTP f o r t h e t i m e s i n d i c a t e d . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) , CTP (400 uM, f i n a l c o n c e n t r a t i o n ) and [ a l p h a - 3 2 P ] - U T P (10 uM f i n a l c o n c e n t r a t i o n ) . T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. The o r d i n a t e r e p r e s e n t s t h e f r a c t i o n o f a v a i l a b l e promoter s i t e s r e m a i n i n g a f t e r t h e p e r i o d of i n i t i a t i o n , c a l c u l a t e d f r o m t h e l e v e l o f t r a n s c r i p t i o n ( C t ) o b t a i n e d a f t e r i n i t i a t i o n t i m e = t , and t h e maximum l e v e l o f t r a n s c r i p t i o n (G*,) o b t a i n e d a f t e r 10 min o f i n i t i a t i o n . B. Tau p l o t .of i n i t i a t i o n complex f o r m a t i o n ( h e p a r i n r e s i s t a n t complexes) a t '1:he A2 p r o m o t e r . Each p o i n t r e p r e s e n t s t h e t a u v a l u e ( l / k ^ g ) , c a l c u l a t e d f r o m t h e i n i t i a l r a t e o f h e p a r i n r e s i s t a n t complex f o r m a t i o n f o r t h e c o r r e s p o n d i n g enzyme c o n c e n t r a t i o n . The l i n e was c a l c u l a t e d by l i n e a r r e g r e s s i o n . The o b s e r v e d r a t e c o n s t a n t f o r c o n v e r s i o n o f t h e i n t e r m e d i a t e t o a h e p a r i n r e s i s t a n t complex ( k 2 ) i s 0.152 s - 1 , and t h e a p p a r e n t d i s s o c i a t i o n c o n s t a n t f o r t h e i n t e r m e d i a t e (K.*) i s 50 nM. 91 30 45 60 T ime (sec) 92 93 constant for the formation of i n i t i a t i o n complexes ( K Q n ) , the equilibrium dissociation constant for the assumed unstable intermediate ( K A * ) , and the rate constant for the conversion of the unstable intermediate to the i n i t i a t e d complex ( k 2 ) . B r i e f l y , the log of the f r a c t i o n of available promoter site s remaining after the i n i t i a t i o n period was plotted against the time of the i n i t i a t i o n period i n seconds. An example of these plots i s shown i n Figure 19a for experiments performed at 6 nM and 16 nM RNA polymerase using the A2 promoter as template. The pseudo f i r s t order rate constant (K^g) for each enzyme concentration was calculated from the slope of the resulting l i n e . Tau values ( l / K ^ g ) were plotted against the reciprocal of the enzyme concentration to produce the tau plot (Figure 19b). The o v e r a l l forward rate constant ( K o n ) , 3.0 x 10 6 M~ 1 s - 1 , was derived from the slope of the l i n e ; the equilibrium dissociation constant for the assumed unstable intermediate (K A*) was 50 nM, and calculated from the x-intercept; and the rate constant for the conversion of the unstable intermediate to the i n i t i a t e d complex (k 2) was 0.152s - 1, and calculated from the y-intercept. Dobinson reported similar values at the A2 promoter for RNA polymerase preparations which had low delta content (Ph. D. Thesis, University of B r i t i s h Columbia, 1986). I n i t i a t i o n rate experiments were performed using the tandem promoter construct as template and an i n i t i a t i o n mix containing GUC. Figure 20 shows examples of the semilogarithmic plot of the f r a c t i o n of remaining promoter sites available after the i n i t i a t i o n period at 16 nM and 24 nM RNA polymerase. Unlike the A2 results the slope of the l i n e , the pseudo f i r s t order rate constant ( K 0 k s ) ' decreased with increased enzyme concentration for both PI (Figure 20a) and P2 (Figure 20b). When the tau values ( l / K ^ g ) were plotted against the reciprocal of the enzyme 94 F i g u r e 20. S e m i l o g a r i t h m e t i c p l o t o f t h e d a t a f r o m an i n i t i a t i o n t i m e c o u r s e w i t h t h e tandem rRNA promoter t e m p l a t e . The tandem promoter t e m p l a t e (2.6 nM pHD1.8 DNA) was i n c u b a t e d w i t h RNA p o l y m e r a s e a t 16 nM ( c l o s e d c i r c l e s ) o r 24 nM (open c i r c l e s ) i n t h e p r e s e n c e o f 400 uM GTP, UTP, and CTP f o r t h e t i m e s i n d i c a t e d . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and [ a l p h a - 3 2 P ] - A T P ( f i n a l c o n c e n t r a t i o n 10 uM). T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. The o r d i n a t e i s t h e same as i n F i g u r e 19a. Data from t h e P I promoter a r e shown i n p a n e l A and d a t a from t h e P2 promoter a r e shown i n p a n e l B. 95 96 97 Figure 21. Tau p l o t of i n i t i a t i o n complex formation (heparin r e s i s t a n t complexes) at the PI (closed c i r c l e s ) and P2 (open c i r c l e s ) promoters. Each point represents the tau value ( l / k ^ g ) , c a l c u l a t e d from the i n i t i a l rate of heparin r e s i s t a n t complex formation for the corresponding enzyme concentration. The l i n e s were calculated by l i n e a r regression. 98 9 99 c o n c e n t r a t i o n , f l a t o r s l i g h t l y n e g a t i v e s l o p e s were o b t a i n e d from t h e d a t a from b o t h rRNA p r o m o t e r s ( F i g u r e 2 1 ) , i n d i c a t i n g t h a t t h e K Q n and K A* f o r t h e rRNA p r o m o t e r s c o u l d n o t be c a l c u l a t e d by t h i s method. However, t h e r a t e c o n s t a n t f o r t h e c o n v e r s i o n o f t h e u n s t a b l e i n t e r - m e d i a t e t o t h e i n i t i a t e d complex, k 2 , c o u l d be c a l c u l a t e d from t h e y- i n t e r c e p t : f o r P I k 2=0.005 s - 1 , w h i l e f o r P2 k 2=0.019 s _ 1 . The k 2 v a l u e s f o r t h e rRNA p r o m o t e r s a r e 30 and 7.5 t i m e s s l o w e r , r e s p e c t i v e l y , t h a n t h o s e o b t a i n e d f o r t h e A2 promoter and might a c c o u n t f o r t h e s l o w i n i t i a t i o n r a t e s o b s e r v e r e d i n F i g u r e 13. F. F o r m a t i o n o f h e p a r i n r e s i s t a n t complexes on mutant c o n s t r u c t s The d a t a p r e s e n t e d i n F i g u r e s 14, 15, and 16 s u g g e s t e d t h a t i n o r d e r f o r RNA p o l y m e r a s e t o form s t a b l e , h e p a r i n r e s i s t a n t complexes a t P2, h e p a r i n r e s i s t a n t complexes must a l s o be formed a t P I . To f u r t h e r i n v e s t i g a t e t h e r e l a t i o n s h i p between t h e complexes formed a t P I and P2 i n t h e n a t i v e c o n f i g u r a t i o n , i n i t i a t i o n r a t e e x p e r i m e n t s were p e r f o r m e d u s i n g two mutant tandem promoter c o n s t r u c t s . The p l a s m i d p P l d P 2 was used t o i n v e s t i g a t e t h e e f f e c t o f i n c r e a s i n g t h e d i s t a n c e between PI and P2 on t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t com- p l e x e s a t b o t h p r o m o t e r s . F i g u r e 22 d e s c r i b e s t h e p r o c e d u r e used i n t h e c o n s t r u c t i o n o f p P l d P 2 . B r i e f l y , a DNA fragment c o n t a i n i n g t h e i s o l a t e d P2 p r omoter was c l o n e d i n t o t h e BamHI s i t e o f a p l a s m i d c o n t a i n i n g t h e i s o l a t e d P I p r o m o t e r , m a i n t a i n i n g t h e o r i e n t a t i o n b u t i n c r e a s i n g t h e d i s t a n c e between PI and P2 from 90 bases t o 185 bases (C. B r i o n , p e r s o n a l c o m m u n i c a t i o n ) . 100 F i g u r e 22. S t r u c t u r e o f t h e w i l d t y p e promoter r e g i o n and an i n s e r t i o n mutant o f t h e r r n B o p e r o n . A. The promoter r e g i o n o f p l a s m i d pKK427B w h i c h c o n t a i n s t h e n a t i v e promoter r e g i o n of t h e r r n B o p e r o n and i s redrawn f r o m F i g u r e 8. B. The promoter r e g i o n o f p l a s m i d p P l d P 2 w h i c h c o n t a i n s a 95 base i n s e r t i n t h e promoter r e g i o n o f t h e r r n B o p e r o n . P l a s m i d p P l d P 2 was c o n s t r u c t e d by i n s e r t i n g t h e 220 ba s e p a i r fragment w h i c h c o n t a i n s o n l y t h e P2 promoter from pKK220 ( s i m i l a r t o pTLXT220 shown i n F i g u r e 8) i n t o t h e BamHI s i t e o f pKK282B, wh i c h c o n t a i n s o n l y t h e P I promoter ( p e r s o n a l communication C. B r i o n ) . The s i n g l e h a t c h e d box r e p r e s e n t s t h e -35 r e g i o n o f t h e P I p r o m o t e r ; t h e open box r e p r e s e n t s t h e -10 r e g i o n o f t h e P I p r o m o t e r ; t h e f i l l e d box r e p r e s e n t s t h e -35 r e g i o n o f t h e P2 p r o m o t e r ; and t h e d o u b l e h a t c h e d box r e p r e s e n t s t h e -10 r e g i o n o f t h e P2 p r o m o t e r . R e s t r i c t i o n s i t e s a r e d e s i g n a t e d as f o l l o w s : BamHI ( B ) , Sau96I ( S 9 6 ) , D d e l ( D ) , and H i n d i ( H c ) . R e s t r i c t i o n s i t e s i n p a r e n t h e s i s have been d e s t r o y e d by c l o n i n g b u t a r e shown f o r r e f e r e n c e . The l e n g t h s o f t h e r u n o f f t r a n s c r i p t s p r o d u c e d i n i n v i t r o t r a n s c r i p t i o n r e a c t i o n s a r e i n d i c a t e d . 101 pK K427B- native construct PI 200 b a s e s P2 110 b a s e ^ Hc (S96) H H 190 b a s e s l pP1dP2- increased distance construct PI 295 b a s e s P2 110 b a s e s (He) B Hc (S96 185 b a s e s F i g u r e 23 shows t h e a v e r a g e d r e s u l t s o f a number o f i n i t i a t i o n t i m e c o u r s e e x p e r i m e n t s i n w h i c h RNA p o l y m e r a s e a t 20 nM was i n c u b a t e d w i t h e i t h e r t h e n a t i v e tandem promoter t e m p l a t e o r t h e i n c r e a s e d d i s t a n c e tandem promoter t e m p l a t e i n an i n i t i a t i o n mix c o n t a i n i n g GUC. S i n c e t h e r a t e o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e P I promoter was f o u n d t o be t h e same on t h e s e p a r a t e d and tandem promoter t e m p l a t e s ( F i g u r e 1 7 ) , t h e i n i t i a l p r e d i c t i o n was t h a t i n c r e a s i n g t h e d i s t a n c e between rRNA p r o m o t e r s would a f f e c t p o l y m e r a s e a c t i v i t y a t P2, but n o t a t P I . However, t h e number o f h e p a r i n r e s i s t a n t complexes formed a t b o t h p r o m o t e r s d e c l i n e d when t h e d i s t a n c e between them was i n c r e a s e d . A t P I o f t h e mutant c o n s t r u c t t h e p l a t e a u l e v e l o f p o l y m e r a s e a c t i v i t y was r e d u c e d by a l m o s t 3 t i m e s when compared t o t h e a c t i v i t y a t P I o f t h e n a t i v e c o n s t r u c t ( F i g u r e 2 3 a ) , w h i l e t h e p l a t e a u l e v e l o f a c t i v i t y a t P2 was about 1.6 t i m e s l o w e r on t h e mutant t e m p l a t e t h a n on t h e n a t i v e t e m p l a t e ( F i g u r e 2 3 b ) . A d d i t i o n a l i n i t i a t i o n r a t e e x p e r i m e n t s p e r f o r m e d a t 4 nM and 60 nM RNA p o l y m e r a s e w i t h p P l d P 2 o r pHD1.8 as t e m p l a t e s i n d i c a t e d t h a t t h e r e l a t i v e l e v e l s o f p o l y m e r a s e a c t i v i t y a t t h e p r o m o t e r s i n t h e mutant c o n s t r u c t were n o t c o n s t a n t when compared t o a c t i v i t y a t t h e p r o m o t e r s on t h e n a t i v e c o n s t r u c t . I n T a b l e IV t h e r e l a t i v e a c t i v i t y o f t h e p o l y m e r a s e a t P I and P2 o f t h e mutant c o n s t r u c t i s e x p r e s s e d as a p e r c e n t o f t h e p l a t e a u l e v e l o f a c t i v i t y a t t h e r e s p e c t i v e p r o m o t e r s i n t h e n a t i v e c o n s t r u c t . As t h e enzyme c o n c e n t r a t i o n i n c r e a s e d t h e p o l y m e r a s e a c t i v i t y a t t h e p r o m o t e r s on t h e mutant c o n s t r u c t approached t h e l e v e l o b s e r v e d a t t h e p r o m o t e r s on t h e n a t i v e c o n s t r u c t . 103 F i g u r e 23. The e f f e c t o f i n c r e a s i n g t h e d i s t a n c e between t h e P I and P2 p r o m o t e r s on t r a n s c r i p t i o n i n i t i a t i o n . A. The e f f e c t o f i n i t i a t i o n t i m e on t r a n s c r i p t i o n i n i t i a t i o n from t h e P I pr o m o t e r of pHD1.8 ( c l o s e d c i r c l e s ) and t h e P I promoter o f p P l d P 2 (open c i r c l e s ) . B. The e f f e c t o f i n i t i a t i o n t i m e on t r a n s c r i p t i o n i n i t i a t i o n f rom t h e P2 promoter o f pHD1.8 ( c l o s e d c i r c l e s ) and t h e P2 promoter o f p P l d P 2 (open c i r c l e s ) . The d a t a from t h e pHD1.8 pr o m o t e r s ( c l o s e d c i r c l e s ) a r e t h e a v e r a g e o f t h r e e i n i t i a t i o n t i m e c o u r s e e x p e r i m e n t s i n w h i c h t h e tandem promoter t e m p l a t e (2.6 nM) was i n c u b a t e d w i t h RNA p o l y m e r a s e (20 nM) i n t h e p r e s e n c e o f 400 uM GTP, UTP, and CTP f o r t h e t i m e s i n d i c a t e d . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and [ a l p h a - 3 2 P ] - A T P ( f i n a l c o n c e n t r a t i o n 10 uM). T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. The d a t a from p P l d P 2 (open c i r c l e s ) a r e from t h e a v e r a g e o f two i n i t i a t i o n t i m e c o u r s e e x p e r i m e n t s i n w h i c h t h e i n c r e a s e d d i s t a n c e t e m p l a t e (1.5 nM) was i n c u b a t e d w i t h RNA p o l y m e r a s e (20 nM) under t h e same c o n d i t i o n s as d e s c r i b e d f o r pHD1.8. 104  901 TABLE IV R e l a t i v e RNA p o l y m e r a s e a c t i v i t y a t P I and P2 p r o m o t e r s o f p P l d P 2 nM % A c t i v i t y on N a t i v e T e m p l a t e 3 RNA p o l y m e r a s e P I P2 4 10 21 20 35 60 60 80 92 a F o r e x p e r i m e n t s p e r f o r m e d a t each RNA p o l y m e r a s e c o n c e n t r a t i o n t h e p l a t e a u l e v e l o f p o l y m e r a s e a c t i v i t y a t P I and P2 of t h e mutant c o n s t r u c t was d i v i d e d by t h e p l a t e a u l e v e l o f a c t i v i t y a t P I and P2 of t h e n a t i v e c o n s t r u c t and m u l t i p l i e d by 100. 107 The r e s u l t s p r e s e n t e d i n F i g u r e 23 and T a b l e IV s u g g e s t e d t h a t t h e i n t e r a c t i o n between t h e rRNA p r o m o t e r s was more complex t h a n i n i t i a l l y assumed. The c l o n i n g scheme used t o make p P l d P 2 i n v o l v e d t h e l i g a t i o n o f two DNA f r a g m e n t s w h i c h c o n t a i n e d t h e sequences f o r t h e -35 r e g i o n o f P2 and t h e -10 r e g i o n o f P I such t h a t a p r o m o t e r - l i k e r e g i o n between P I and P2 was c r e a t e d ( s e e F i g u r e 2 2 ) . The r e s u l t s from t h e s e i n i t i a l r a t e e x p e r i m e n t s c o u l d n o t d e t e r m i n e whether t h e r e d u c e d p o l y m e r a s e a c t i v i t y o b s e r v e d a t t h e p r o m o t e r s on p P l d P 2 was due s o l e l y t o t h e i n c r e a s e d d i s t a n c e between t h e tandem p r o m o t e r s o r whether t h e i n c r e a s e i n rRNA promoter r e g i o n sequences a l s o a f f e c t e d t h e r e s u l t s . The p l a s m i d p P l A 2 ( F i g u r e 24) was used as a t e m p l a t e t o i n v e s t i g a t e whether t h e p r e s e n c e o f t h e rRNA P I promoter upstream of t h e (j)29 A2 promoter would a f f e c t p o l y m e r a s e a c t i v i t y a t t h e downstream p r o m o t e r . P l a s m i d p P l A 2 was c o n s t r u c t e d by c l o n i n g a 165 base p a i r fragment c o n t a i n i n g t h e A2 promoter i n t o t h e BamHI s i t e o f a p l a s m i d w h i c h c o n t a i n e d t h e s e p a r a t e d P I promoter (C. B r i o n , p e r s o n a l c o m m u n i c a t i o n ) . The d i s t a n c e between t h e a r t i f i c i a l tandem p r o m o t e r s i s 126 bases (C. B r i o n , p e r s o n a l c o m m u n i c a t i o n ) , r a t h e r t h a n t h e 90 bases seen i n t h e n a t i v e rRNA c o n s t r u c t . F i g u r e 25a i s an a u t o r a d i o g r a m o f a i n i t i a t i o n r a t e e x p e r i m e n t i n w h i c h RNA p o l y m e r a s e a t 20 nM was i n c u b a t e d w i t h p P l A 2 , l i n e a r i z e d downstream o f t h e A2 p r o m o t e r , i n a mix c o n t a i n i n g e i t h e r GUC ( l a n e s 1-8) o r AG ( l a n e s 9-16). The r e s u l t s showed t h a t t h e i n i t i a t i o n c o n d i t i o n s r e q u i r e d f o r t h e f o r m a t i o n of h e p a r i n r e s i s t a n t complexes a t t h e p r o m o t e r s on t h e a r t i f i c i a l tandem p r o m o t e r t e m p l a t e , were t h e same as t h o s e t h a t p r o d u c e d h e p a r i n r e s i s t a n t complexes on t h e r e s p e c t i v e n a t i v e 108 F i g u r e 24. S t r u c t u r e o f t h e tandem promoter r e g i o n of p P l A 2 . The tandem promoter r e g i o n o f t h e p l a s m i d p P l A 2 c o n t a i n s t h e P I promoter of t h e r r n B o p e r o n and t h e A2 promoter o f <|)29. P l a s m i d p P l A 2 was c o n s t r u c t e d by i n s e r t i n g t h e 165 base p a i r fragment c o n t a i n i n g t h e A2 promoter i n t o t h e S a i l s i t e o f pKK282B, w h i c h c o n t a i n s o n l y t h e P I rRNA promoter ( p e r s o n a l c o m m u n i c a t i o n , C. B r i o n ) . R e s t r i c t i o n s i t e s a r e d e s i g n a t e d as f o l l o w s : BamHI ( B ) , D d e l ( D ) , and H i n d i I I ( H d ) . The l e n g t h s of t h e r u n o f f t r a n s c r i p t s p r o d u c e d i n i n v i t r o t r a n s c r i p t i o n r e a c t i o n s a r e i n d i c a t e d . The d i s t a n c e between t h e two p r o m o t e r s i s 126 base p a i r s . 109 pP1 A 2 P1 245 bases 65 bases !> A2 111 bases •CHJ B Hd « M 126bases I F i g u r e 25. The e f f e c t of i n i t i a t i o n n u c l e o t i d e s on t r a n s c r i p t i o n i n i t i a t i o n f rom t h e tandem p r o m o t e r s o f p P l A 2 . A. A u t o r a d i o g r a m o f p o l y a c r y l a m i d e g e l o f t r a n s c r i p t i o n p r o d u c t s . RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h t h e p P l A 2 tandem promoter t e m p l a t e (2.1 nM) i n t h e p r e s e n c e o f 400 uM GTP, UTP and CTP ( l a n e s 1-8) o r 400 uM ATP and GTP ( l a n e s 9-16). I n i t i a t i o n p e r i o d s were f o r 0.5 min ( l a n e s 1 and 9 ) , 1 min ( l a n e s 2 and 1 0 ) , 2 min ( l a n e s 3 and 1 1 ) , 4 min ( l a n e s 4 and 1 2 ) , 6 min ( l a n e s 5 and 1 3 ) , 8 min ( l a n e s 6 and 1 4 ) , 10 min ( l a n e s 7 and 1 5 ) , and 15 min ( l a n e s 8 and 1 6 ) . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL a l i q u o t s were removed and added t o 2 uL h e p a r i n (5 ug/mL f i n a l c o n c e n t r a t i o n ) and t h e r e m a i n i n g n u c l e o t i d e ( s ) : [ a l p h a - 3 2 P ] - A T P (10 uM f i n a l c o n c e n t r a t i o n ) l a n e s 1-8; o r CTP and [ a l p h a - 3 2 P ] - U T P (400 uM and 10 uM f i n a l c o n c e n t r a t i o n , r e s p e c t i v e l y ) l a n e s 9-16; and a l l o w e d t o e l o n g a t e f o r 10 min. B. T r a n s c r i p t i o n p r o d u c t s were q u a n t i f i e d as d e s c r i b e d i n Methods: RNA p o l y m e r a s e a c t i v i t y a t t h e P I promoter w i t h GUC i n i t i a t i o n c o n d i t i o n s ( c l o s e d c i r c l e s ) and t h e A2 p r o m oter w i t h AG i n i t i a t i o n c o n d i t i o n s (open c i r c l e s ) . I l l GUC AG 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 P1 # • M v s I - A 2 112 113 t e m p l a t e s ( D o b i n s o n and S p i e g e l m a n , 1987; F i g u r e s 13, 14, and 15 a b o v e ) . When t h e number o f t r a n s c r i p t s / p r o m o t e r was c a l c u l a t e d ( F i g u r e 2 5 b ) , t h e l e v e l o f p o l y m e r a s e a c t i v i t y a t t h e P I promoter was about 2.5 t i m e s l o w e r t h a n t h a t o b s e r v e d a t P I on t h e n a t i v e t e m p l a t e ( s e e F i g u r e 1 3 ) , w h i l e t h e l e v e l o f a c t i v i t y a t t h e A2 t e m p l a t e was o v e r 2 t i m e s h i g h e r t h a n t h e a c t i v i t y a t A2 on t h e n a t i v e t e m p l a t e ( s e e F i g u r e 1 3 ) . A l t h o u g h t h e p r e s e n c e o f P I upstream o f A2 d i d not a l t e r t h e r e q u i r e m e n t s f o r RNA p o l y m e r a s e t o f o r m h e p a r i n r e s i s t a n t complexes a t A2, t h e p r e s e n c e o f P I upstrea m o f A2 d i d appear t o i n c r e a s e p o l y m e r a s e a c t i v i t y a t A2. To f u r t h e r i n v e s t i g a t e t h e e f f e c t o f t h e p r e s e n c e o f t h e P I promoter u p s t r e a m o f t h e A2 promoter on p o l y m e r a s e a c t i v i t y a t A2, a s e r i e s o f i n i t i a t i o n r a t e e x p e r i m e n t s were p e r f o r m e d u s i n g as t e m p l a t e s v a r i o u s r e s t r i c t i o n e n d o n u c l e a s e d i g e s t s o f p P l A 2 w h i c h d i f f e r e n t i a l l y i s o l a t e d t h e p r o m o t e r s . F i g u r e 26 d i s p l a y s t h e r e s u l t s o f one such e x p e r i m e n t , where p o l y m e r a s e was i n c u b a t e d w i t h p P l A 2 d i g e s t e d w i t h e i t h e r H i n d l l l , w h i c h c l e a v e s t h e p l a s m i d downstream o f t h e A2 promoter l e a v i n g P I and A2 a t t a c h e d , o r b o t h H i n d i I I and BamHI, wh i c h removes t h e P I promoter f r o m t h e r e g i o n u p s t r e a m of t h e A2 promoter (each a t 2.1 nM), as t e m p l a t e . I n c o n t r o l r e a c t i o n s p o l y m e r a s e was i n c u b a t e d w i t h E c o R l d i g e s t e d p328-5 ( a t 2.0 nM), w h i c h c o n t a i n s t h e n a t i v e A2 p r o m o t e r . A l l r e a c t i o n s i n c l u d e d AG i n t h e i n i t i a t i o n mix. F i g u r e 26 shows t h a t RNA p o l y m e r a s e a c t i v i t y was l o w e s t a t t h e A2 promoter on t h e c o n t r o l t e m p l a t e , a p l a t e a u l e v e l o f about 0.26 t r a n - s c r i p t s p e r promoter b e i n g a t t a i n e d . P o l y m e r a s e a c t i v i t y a t t h e A2 promoter when t h e P I promoter was p h y s i c a l l y l i n k e d ( H i n d i I I d i g e s t e d t e m p l a t e ) , was 1.8 t i m e s g r e a t e r t h a n t h e c o n t r o l . However, a c t i v i t y a t 114 F i g u r e 26. Time c o u r s e o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e A2 promoter when t h e P I rRNA promoter i s upstream. RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h t h e p P l A 2 t e m p l a t e d i g e s t e d H i n d i I I ( P I upstream o f A2, see F i g u r e 24; c l o s e d c i r c l e s ) , t h e p P l A 2 t e m p l a t e d i g e s t e d w i t h BamHI and H i n d i I I ( P I n o t upstream o f A2, see F i g u r e 24; open c i r c l e s ) o r t h e p328-5 t e m p l a t e d i g e s t e d w i t h E c o R l (A2 promoter i n n a t i v e e n v i r o n m e n t , see F i g u r e 9, c l o s e d t r i a n g l e s ) , i n t h e p r e s e n c e o f 400 uM ATP and GTP f o r t h e t i m e i n d i c a t e d . A f t e r t h e i n i t i a t i o n p e r i o d 38 uL a l i q u o t s were removed and added t o 2 uL h e p a r i n (5 ug/mL, f i n a l c o n c e n t r a t i o n ) and t h e r e m a i n i n g n u c l e o t i d e s , CTP and [ a l p h a - 3 2 P ] - U T P (400 uM and 10 uM f i n a l c o n c e n t r a t i o n , r e s p e c t i v e l y ) . T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. The c o n c e n t r a t i o n o f t h e t e m p l a t e s was 2.1 nM f o r p P l A 2 and 2 nM f o r p328-5. 115 9TI T r a n s c r i p t / P r o m o t e r p p o p o - * ro co ^ cn • O • • o • t h e A2 promoter when t h e PI promoter was no l o n g e r u p s t r e a m ( t h e d o u b l e d i g e s t e d t e m p l a t e ) a l s o i n c r e a s e d by 1.5 t i m e s . The r e m o v a l of some i n h i b i t o r y sequences when t h e DNA fragment c o n t a i n i n g t h e A2 promoter was s u b c l o n e d t o p r o d u c e p P l A 2 might a c c o u n t f o r t h e i n c r e a s e d p o l y m e r a s e a c t i v i t y a t A2 on t h e d o u b l e d i g e s t e d t e m p l a t e . N e v e r t h e l e s s , when t h e PI promoter was p h y s i c a l l y l i n k e d t o t h e A2 promoter ( H i n d i I I d i g e s t e d t e m p l a t e ) p o l y m e r a s e a c t i v i t y a t t h e A2 promoter i n c r e a s e d 30%, and u n l i k e t h e s i t u a t i o n a t t h e P2 p r o m o t e r , a h e p a r i n r e s i s t a n t complex a t t h e PI promoter was n o t r e q u i r e d f o r an e f f e c t a t t h e A2 pr o m o t e r . F i g u r e 27 p r e s e n t s t h e r e s u l t s o f an e x p e r i m e n t u s i n g p P l A 2 d e s i g n e d t o i n v e s t i g a t e t h e e f f e c t o f t h e p r e s e n c e o f t h e A2 promoter downstream on p o l y m e r a s e a c t i v i t y a t t h e PI p r o m o t e r . The f i g u r e shows t h e r e s u l t s o f an i n i t i a t i o n r a t e e x p e r i m e n t i n w h i c h RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h p P l A 2 d i g e s t e d w i t h e i t h e r BamHI, w h i c h c l e a v e d t h e p l a s m i d DNA between t h e PI promoter and t h e A2 pr o m o t e r , o r H i n d i I I , w h i c h c l e a v e d t h e p l a s m i d downstream of t h e A2 promoter (each a t 2.1 nM), as t e m p l a t e . The s e p a r a t e d PI promoter c o n s t r u c t , pTLXT-205 ( a t 1.5 nM), d i g e s t e d w i t h BamHI was t h e c o n t r o l t e m p l a t e and a l l r e a c t i o n s c o n t a i n e d GUC i n t h e i n i t i a t i o n mix. The r e s u l t s f r o m F i g u r e 27 i n d i c a t e d an a p p a r e n t d e c r e a s e ( t o 85% of t h e pTLXT-205 c o n t r o l ) i n RNA p o l y m e r a s e a c t i v i t y a t t h e PI promoter when t h e A2 promoter was n o t p h y s i c a l l y downstream (BamHI d i g e s t e d p P l A 2 t e m p l a t e ) . T h i s a p p a r e n t d e c r e a s e i n a c t i v i t y c o u l d be due d i f f e r e n c e s i n enzyme t o promoter r a t i o s . T h e o r e t i c a l l y t h e r e were 13 p o l y m e r a s e m o l e c u l e s f o r e v e r y PI promoter when t h e s e p a r a t e d promoter c o n s t r u c t s e r v e d as t e m p l a t e and 5 p o l y m e r a s e m o l e c u l e s f o r e v e r y PI promoter when 117 F i g u r e 27. E f f e c t on t r a n s c r i p t i o n i n i t i a t i o n a t t h e P I promoter when t h e $29 A2 promoter i s downstream. RNA p o l y m e r a s e (20 nM) was i n c u b a t e d w i t h t h e p P l A 2 t e m p l a t e d d i g e s t e d w i t h H i n d i I I (A2 downstream o f P I , see F i g u r e 24; open c i r c l e s ) , t h e p P l A 2 t e m p l a t e d i g e s t e d w i t h BamHI (A2 n o t downstream o f P I , see F i g u r e 24; c l o s e d c i r c l e s ) , o r pTLXT205 t e m p l a t e d i g e s t e d w i t h BamHI ( P I promoter i n n a t i v e e n v i r o n m e n t , see F i g u r e 8; c l o s e d t r i a n g l e s ) , i n t h e p r e s e n c e o f 400 uM GTP, UTP, and CTP f o r t h e t i m e s i n d i c a t e d . A f t e r t h e i n c u b a t i o n p e r i o d 38 uL a l i q u o t s were removed and added t o 2 uL h e p a r i n (5 ug/mL, c o n c e n t r a t i o n ) and [ a l p h a - 3 2 P ] - A T P (10 uM, f i n a l c o n c e n t r a t i o n ) . T r a n s c r i p t i o n p r o d u c t s were s e p a r a t e d by e l e c t r o p h o r e s i s and q u a n t i f i e d as d e s c r i b e d i n Methods. The c o n c e n t r a t i o n o f t h e t e m p l a t e s was 2.1 nM f o r p P l A 2 and 1.5 nM f o r pTLXT205. 118 6TT BamHI d i g e s t e d p P l A 2 was t h e t e m p l a t e , assuming t h a t RNA p o l y m e r a s e i n t e r a c t e d w i t h t h e A2 p r o m o t e r . The a s s u m p t i o n t h a t p o l y m e r a s e i n t e r a c t i o n was w i t h t h e A2 promoter r a t h e r t h a n n o n - s p e c i f i c DNA i s s u p p o r t e d by t h e f a c t t h a t t h e a c t u a l DNA c o n c e n t r a t i o n s were about t h e same f o r a l l r e a c t i o n s (0.28 - 0.3 ug/mL). F u r t h e r , when t h e A2 promoter was p h y s i c a l l y l i n k e d t o t h e PI promoter ( t h e H i n d i I I d i g e s t e d p P l A 2 t e m p l a t e ) , RNA p o l y m e r a s e a c t i v i t y a t t h e PI promoter was r e d u c e d by 30% when compared t o a c t i v i t y on t h e u n l i n k e d p P l A 2 t e m p l a t e (BamHI d i g e s t e d ) . Taken t o g e t h e r t h e d a t a f r o m F i g u r e s 25, 26 and 27 s u g g e s t e d t h a t when t h e PI and A2 p r o m o t e r s were n o t p h y s i c a l l y l i n k e d RNA p o l y m e r a s e a c t i v i t y a t one promoter was i n d e p e n d e n t o f a c t i v i t y a t t h e o t h e r p r o m o t e r ; however, when t h e p r o m o t e r s were l i n k e d , PI app e a r e d t o s t i m u l a t e p o l y m e r a s e a c t i v i t y a t A2. G. Summary o f i n v i t r o r e s u l t s The r e s u l t s p r e s e n t e d i n t h i s s e c t i o n showed t h e f o l l o w i n g : 1. Two approaches were t a k e n t o i s o l a t e an rRNA s p e c i f i c RNA p o l y m e r a s e : a f f i n i t y chromatography and z o n a l c e n t r i f u g a t i o n . I n b o t h c a s e s when p u r i f i e d enzyme f r a c t i o n s were t e s t e d on rRNA and non-rRNA p r o m o t e r s , no d i f f e r e n c e i n s p e c i f i c i t y was o b s e r v e d . 2. I n s i n g l e r ound t r a n s c r i p t i o n a s s a y s where t h e e f f e c t o f polym- e r a s e c o n c e n t r a t i o n was i n v e s t i g a t e d , a g r e a t e r enzyme c o n c e n t r a t i o n was r e q u i r e d f o r maximum a c t i v i t y a t t h e rRNA p r o m o t e r s t h a n a t t h e (|)29 A2 p r o m o t e r . I n i n i t i a t i o n r a t e e x p e r i m e n t s where t h e e f f e c t o f t h e i n i t i a - t i o n p e r i o d was s t u d i e d , RNA p o l y m e r a s e r e q u i r e d a l o n g e r p e r i o d t o r e a c h 120 maximum a c t i v i t y a t t h e rRNA p r o m o t e r s t h a n a t t h e (j)29 A2 and G2 p r o m o t e r s . 3. When RNA p o l y m e r a s e c o u l d f o r m h e p a r i n r e s i s t a n t complexes a t th e P I p r o m o t e r , t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t t h e P2 promoter was s t a b l e . However, when RNA p o l y m e r a s e c o u l d n o t form h e p a r i n r e s i s t a n t complexes a t t h e P I p r o m o t e r , e i t h e r b ecause o f u n f a v o r a b l e i n i t i a t i o n c o n d i t i o n s o r due t o d e l e t i o n , t h e h e p a r i n r e s i s t a n t complexes formed a t t h e P2 promoter were n o t s t a b l e . 4. I n i t i a t i o n r a t e e x p e r i m e n t s were p e r f o r m e d u s i n g t h e tandem rRNA as t e m p l a t e f o r k i n e t i c a n a l y s i s i n a m o d i f i e d t a u p l o t . The i n i t i a t i o n r a t e a t b o t h rRNA p r o m o t e r s d i d n o t i n c r e a s e w i t h i n c r e a s e d enzyme c o n c e n t r a t i o n as i t d i d f o r t h e (J>29 A2 p r o m o t e r , t h u s t h e o v e r a l l f o r w a r d r a t e c o n s t a n t and t h e e q u i l i b r i u m ' d i s s o c i a t i o n c o n s t a n t c o u l d n o t be d e t e r m i n e d u s i n g t h e m o d i f i e d t a u p l o t a n a l y s i s . However, t h e r a t e c o n s t a n t f o r t h e c o n v e r s i o n o f t h e u n s t a b l e i n t e r m e d i a t e t o t h e i n i t i a t e d complex c o u l d be c a l c u l a t e d , and was fo u n d t o be r e l a t i v e l y s l o w . 5. Two a r t i f i c i a l tandem promoter c o n s t r u c t s were used t o i n v e s t i - g a t e p a r a m e t e r s i m p o r t a n t f o r i n t e r a c t i o n s between t h e tandem p r o m o t e r s on t h e n a t i v e c o n s t r u c t . When t h e A2 promoter was n o t l i n k e d t o P I on pP l A 2 t e m p l a t e , p o l y m e r a s e a c t i v i t y a t t h e P I promoter was about t h e same as a c t i v i t y a t t h e P I promoter on t h e s e p a r a t e d c o n s t r u c t c o n t r o l tem- p l a t e . F u r t h e r , when t h e P I promoter was upstream o f t h e A2 p r o m o t e r , p o l y m e r a s e a c t i v i t y was s t i m u l a t e d a t t h e A2 p r o m o t e r . However, a c t i v i t y a t b o t h t h e P I and P2 p r o m o t e r s on p P l d P 2 d e c r e a s e d . These r e s u l t s 121 s u g g e s t e d t h a t t h e i n t e r a c t i o n s between tandem p r o m o t e r s were complex t h a t more s u i t a b l e c o n s t r u c t s s h o u l d be used i n f u r t h e r i n v e s t i g a t i o n s 122 V. DISCUSSION A. R i b o s o m a l RNA s y n t h e s i s d u r i n g s t e a d y s t a t e growth and n u t r i t i o n a l s h i f t - u p i n B. s u b t i l i s The p e r c e n t rRNA s y n t h e s i s under v a r i o u s c u l t u r e c o n d i t i o n s was measured by h y b r i d i z a t i o n o f p u l s e l a b e l e d RNA t o p l a s m i d DNA c o n t a i n i n g t h e 3' end o f t h e 23S RNA gene and t h e 5S RNA gene o f B. s u b t i l i s . The h y b r i d i z a t i o n e f f i c i e n c i e s were u n i f o r m l y h i g h and t h e r e p r o d u c i b i l i t y o f t h e r e a c t i o n was such t h a t changes i n t h e p e r c e n t rRNA s y n t h e s i s as low as 5% c o u l d be i d e n t i f i e d . DNA s a t u r a t i o n c u r v e s r e a c h e d p l a t e a u l e v e l s w i t h l e s s t h a n 16 ug DNA p e r r e a c t i o n , t h a t v a l u e r e p r e s e n t s a 7 - f o l d e x c e s s o v e r t h e RNA added t o t h e h y b r i d i z a t i o n r e a c t i o n . Over t h e growth range u=0.68 t o u=1.98 rRNA s y n t h e s i s showed an i n c r e a s e o f 43% t o 63% of t h e t o t a l RNA s y n t h e s i z e d w i t h an i n c r e a s e o f 12%/u ( F i g u r e 5 ) . These v a l u e s a g r e e c l o s e l y w i t h t h o s e r e p o r t e d by G a u s i n g (1977, 1980) f o r E. c o l i w i t h i n t h e same growth r a t e r a n g e . D a t a r e p o r t e d by Shepherd e t a l . ( 1 9 8 0 ) , a l s o f o r E. c o l i , c o l l e c t e d by h y b r i d i z a t i o n o f p u l s e l a b e l e d RNA t o s p e c i f i c p r o b e s , e x h i b i t a s i m i l a r t r e n d but a r e somewhat h i g h e r ; i t i s not c l e a r why t h e r e s u l t s a r e d i f f e r e n t . When a c u l t u r e o f B. s u b t i l i s g r o w i n g on an a c e t a t e based medium was s u b j e c t e d t o a s h i f t - u p i n growth c o n d i t i o n s by t h e a d d i t i o n o f g l u c o s e , casamino a c i d s , and a d e n o s i n e , t h e r a t e o f rRNA s y n t h e s i s i n c r e a s e d r a p i d l y and w i t h i n 10 min was 10% o f t h e f i n a l a d j u s t e d r a t e ( F i g u r e 6 ) . The f i n a l l e v e l o f i n c r e a s e i n p e r c e n t rRNA t r a n s c r i p t i o n i s s i m i l a r t o t h a t measured i n E. c o l i by G a u s i n g (1977) and Z e n g e l and 123 L i n d a h l ( 1 9 8 6 ) , however, b o t h E. c o l i s t u d i e s d e s c r i b e d d i f f e r e n t k i n e t i c s f o r t h e r a t e o f i n c r e a s e i n rRNA s y n t h e s i s . F o r example, Z e n g e l and L i n d a h l (1986) r e p o r t e d t h a t t h e r e l a t i v e r a t e o f rRNA s y n t h e s i s i n c r e a s e d t o about 1.5 t i m e s t h e i n i t i a l r a t e w i t h i n 30-60 sec a f t e r t h e s h i f t - u p , t h e n dropped t o about 1.2 t i m e s between 2-4 min a f t e r t h e s h i f t , and r e a c h e d a f i n a l l e v e l o f about 1.35 t i m e s a t 10 min a f t e r t h e s h i f t . T here a r e two t e c h n i c a l f a c t o r s why such f l u c t u a t i o n s and e a r l y p l a t e a u l e v e l might n o t have been o b s e r v e d i n t h e d a t a p r e s e n t e d i n F i g u r e 6. F i r s t , t h e t i m e between p o i n t s and t h e d u r a t i o n o f t h e p u l s e l a b e l i n t h e e x p e r i m e n t i l l u s t r a t e d i n F i g u r e 6 were r e l a t i v e l y l o n g i n c o m p a r i s o n t o t h e 24 sec p u l s e w i t h sarnies t a k e n e v e r y 20-30 sec i n t h e E. c o l i s t u d i e s . B o t h of t h e s e f a c t o r s would r e d u c e t h e s e n s i t i v i t y o f my a s s a y . An e s t i m a t e of 15 min as t h e t i m e a t w h i c h t h e f i n a l r a t e o f s y n t h e s i s was r e a c h e d was made by d e t e r m i n i n g t h e i n t e r s e c t i o n o f t h e i n i t i a l r a t e l i n e and t h e p l a t e a u l i n e . Second, t h e DNA p r o b e used i n t h i s s t u d y was m i s s i n g about 2 kb f r o m t h e 5' end o f t h e r i b o s o m a l operon ( F i g u r e 1) w h i l e t h e p r o b e s used i n t h e E. c o l i s t u d i e s i n c l u d e d t h e 5' end o f t h e o p e r o n . Two k i l o b a s e s o f rRNA can be s y n t h e s i z e d i n l e s s t h a n 30 sec i n E. c o l i a t 37° C (Bremer and D e n n i s , 1987), t h u s t h e e s t i m a t e d t i m e a t w h i c h t h e f i n a l r a t e of s y n t h e s i s was r e a c h e d i n t h e e x p e r i m e n t shown i n F i g u r e 6 can be c a l c u l a t e d as about 14.5 min a f t e r t h e s h i f t - u p . A s i d e from t h e above t e c h n i c a l r e a s o n s , i t i s p o s s i b l e t h a t t h e s l o w e r r e s p o n s e t i m e i n t h e B. s u b t i l i s system i s due t o i n t r i n s i c d i f f e r e n c e s between t h e Gram n e g a t i v e , e n t e r i c , f a c u l t a t i v e anaerobe E. c o l i , and t h e Gram p o s i t i v e , s p o r e f o r m i n g , a e r o b e B. s u b t i l i s . From 124 a t e l e o l o g i c a l p o i n t o f v i e w , E. c o l i must r e s p o n d q u i c k l y t o changes i n t h e e n v i r o n m e n t , whereas, B. s u b t i l i s a l w a y s has t h e o p t i o n o f spo r e f o r m a t i o n . B. U s i n g SP01 t o probe RNA p o l y m e r a s e p a r t i t i o n i n g The a v a i l a b i l i t y o f RNA p o l y m e r a s e f o r d i s t r u b u t i o n between rRNA and non-rRNA p r o m o t e r s was t h e p r i m a r y f o c u s o f t h e i n v i v o s t u d y o f rRNA s y n t h e s i s i n B. s u b t i l i s . The p e r c e n t o f a c t i v e RNA p o l y m e r a s e has been shown t o i n c r e a s e from about 10% i n slow g r o w i n g c e l l s t o about 40% i n f a s t g r o w i n g c e l l s f o r b o t h B. s u b t i l i s ( Leduc, e t a l . , 1982) and E. c o l i ( S hepherd, e t a l . , 1980). When a c u l t u r e undergoes a n u t r i t i o n a l s h i f t - up an immediate i n c r e a s e i n t h e p e r c e n t rRNA s y n t h e s i s i s o b s e r v e d ( F i g u r e 6; G a u s i n g , 1980; Z e n g e l and L i n d a h l , 1986), s u g g e s t i n g t h a t r e d i s t r i b u t i o n o f e x i s t i n g p o l y m e r a s e , r a t h e r t h a n de novo s y n t h e s i s , i s t h e p r i m a r y mechanism f o r t h e i n c r e a s e (Maaloe and K j e l d g a a r d , 1966; Dennis and Bremer, 1974; N i e r l i c h , 1978; G a u s i n g , 1980). I n f e c t i o n w i t h t h e l a r g e HMU c o n t a i n i n g DNA phages of B a c i l l u s l e a d s t o s p e c i f i c and t e m p o r a l m o d i f i c a t i o n s o f t h e c e l l u l a r RNA p o l y m e r a s e ( r e v i e w e d i n D o i and Wang, 1986). The b a c t e r i o p h a g e SP01 was used t o probe RNA p o l y m e r a s e a v a i l a b i l i t y f o r t r a n s c r i p t i o n o f rRNA operons d u r i n g a n u t r i t i o n a l s h i f t - u p . I n p r e l i m i n a r y e x p e r i m e n t s i t was shown t h a t phage i n f e c t i o n had a v a r i e d e f f e c t on t h e r a t e o f h o s t n u t r i e n t t r a n s p o r t ( F i g u r e 2 ) . The r a t e o f m e t h i o n i n e t r a n s p o r t was u n a f f e c t e d by phage i n f e c t i o n and t h e r a t e s o f g l u c o s e and l e u c i n e t r a n s p o r t were o n l y m i l d l y a f f e c t e d , 90% and 75% o f u n i n f e c t e d r a t e s r e s p e c t i v e l y . S i n c e c a r b o n and n i t r o g e n s o u r c e s 125 a r e t h e p r i m a r y e f f e c t o r s i n a n u t r i t i o n a l s h i f t - u p , i t was c o n c l u d e d t h a t phage i n f e c t i o n would n o t p r e c l u d e t h e s h i f t - u p r e s p o n s e a t t h e l e v e l o f t r a n s p o r t o f t h e s e n u t r i e n t s . The r e s u l t s o f t h e t r a n s p o r t a s s a y , however, i n d i c a t e d t h a t t h e r a t e s o f n u c l e o s i d e and base t r a n s p o r t were a f f e c t e d by SP01 i n f e c t i o n . The r a t e s o f c y t i d i n e , a d e n o s i n e , and a d e n i n e t r a n s p o r t were r e d u c e d t o 40% o f t h e u n i n f e c t e d r a t e s and t h e r a t e o f u r i d i n e t r a n s p o r t was r e d u c e d t o 60%. Beaman, e t a l . (1983) r e p o r t e d t h a t g l u c o s e and amino a c i d u p t a k e was r e d u c e d i n s p o r u l a t i n g B. s u b t i l i s c u l t u r e s , and t h a t u p t a k e o f RNA p r e c u r s o r s was r e d u c e d by t h e s t r i n g e n t r e s p o n s e t o amino a c i d s t a r v a t i o n . Phage i n f e c t i o n does n o t i n d u c e e i t h e r s p o r u l a t i o n o r t h e s t r i n g e n t r e s p o n s e ; however, i t i s p o s s i b l e t h a t SP01 i n f e c t i o n c o u l d i n d u c e a s p e c i f i c s e t o f p h y s i o l o g i c a l r e s p o n s e s w h i c h m i g h t i n c l u d e r e d u c e d r a t e s o f n u c l e i c a c i d p r e c u r s o r u p t a k e . For example, o v e r a l l c o nsumption o f n u c l e i c a c i d p r e c u r s o r s c o u l d d e c r e a s e upon phage i n f e c t i o n , and t h r o u g h a f e e d b a c k mechanism s u b s e q u e n t l y r e d u c e p r e c u r s o r u p t a k e . The r e s u l t s shown i n F i g u r e 7 and T a b l e I I I s u g g e s t t h a t t h e r e d u c e d r a t e o f u r i d i n e t r a n s p o r t i n t h e phage i n f e c t e d c u l t u r e s had no e f f e c t , s i n c e t h e measured rRNA s y n t h e s i s c o n t i n u e d a t an u n d i m i n i s h e d r a t e a f t e r phage i n f e c t i o n . I n e x p e r i m e n t s which i n v e s t i g a t e d t h e e f f e c t o f growth r a t e on b u r s t s i z e i t was shown t h a t t h e b u r s t s i z e o f SP82 (an HMU c o n t a i n i n g , DNA phage c l o s e l y r e l a t e d t o SP01) i n c r e a s e d l o g a r i t h m e t i c a l l y w i t h h o s t g r o w t h r a t e ( F i g u r e 3 ) . P r e v i o u s work ( H i a t t and W h i t e l e y , 1978; Downard and W h i t e l e y , 1981) s u g g e s t e d t h a t SP82 development was r e g u l a t e d t h r o u g h t h e p r o d u c t i o n o f mRNA. As a r e s u l t o f t r a n s c r i p t i o n a l r e g u l a t i o n , one 126 might p r e d i c t t h a t phage p r o d u c t i o n would be l i m i t e d by e i t h e r t r a n s l a t i o n o r t r a n s c r i p t i o n c a p a c i t y . L a w r i e , e t a l . (1978) e s t i m a t e d t h e p r o t e i n coded by SP82 genome as 3 x 1 0 6 d a l t o n s , w h i c h f o r a b u r s t s i z e o f 1200 c o r r e s p o n d s t o a p p r o x i m a t e l y 6 x 1 0 ~ 1 5 g phage p r o t e i n p e r c e l l . A t h i g h growth r a t e s t h i s v a l u e i s l e s s t h a n 1/10 t h e amount o f p r o t e i n i n a B a c i l l u s c e l l ( E . Leduc and G. S p i e g e l m a n , u n p u b l i s h e d o b s e r v a t i o n s r e p o r t e d i n Webb, e t a l . , 1 9 8 2 ) . S i n c e t h e s y n t h e s i s of h o s t mRNA c e a s e s a f t e r i n f e c t i o n w i t h HMU phages ( H e m p h i l l and W h i t e l e y , 1975), t h e r e i s ample t r a n s l a t i o n c a p a c i t y f o r phage p r o t e i n s . T a b l e I I compares t h e e x p o n e n t i a l r a t e c o n s t a n t s f o r phage b u r s t s i z e , t o t a l RNA p e r c e l l , and p e r c e n t a c t i v e RNA p o l y m e r a s e . The d i f f e r - ence i n t h e c o n s t a n t s f o r SP82 b u r s t s i z e and p e r c e n t a c t i v e RNA p o l y m e r a s e i s n o t s t a t i s t i c a l l y s i g n i f i c a n t , i n o t h e r words, t h e SP82 b u r s t s i z e i n c r e a s e d a t t h e same r a t e w i t h growth r a t e as t h e p e r c e n t a c t i v e p o l y m e r a s e . The e x p o n e n t i a l r a t e c o n s t a n t f o r t o t a l RNA p e r c e l l , however, d i f f e r e d s t a t i s t i c a l l y f rom t h e c o n s t a n t s o f t h e o t h e r two p a r a m e t e r s . These d a t a s u g g e s t e d t h a t phage b u r s t s i z e i s dependent on a c t i v e RNA p o l y m e r a s e . C. RNA s y n t h e s i s i n phage i n f e c t e d B. s u b t i l i s The a p p a r e n t dependence o f HMU phage b u r s t s i z e on t h e p o o l o f a c t i v e RNA p o l y m e r a s e p r o v i d e d t h e o r i g i n a l r a t i o n a l e f o r t h e e x p e r i m e n t s r e p o r t e d i n F i g u r e 7 and T a b l e I I I : i f RNA p o l y m e r a s e was l i m i t i n g i n t h e c e l l s a t t h e t i m e o f phage i n f e c t i o n , t h e n m o d i f i c a t i o n of a c o n s i d - e r a b l e p o r t i o n o f t h e p o l y m e r a s e c o u l d p r e v e n t d i s t r i b u t i o n of more p o l y m e r a s e t o t h e rRNA p r o m o t e r s . S i n c e i t i s u n l i k e l y t h a t SP01- 127 m o d i f i e d p o l y m e r a s e c o u l d be used t o t r a n s c r i b e rRNA ( s e e b e l o w ) , t h e phage i n d u c e d m o d i f i c a t i o n s h o u l d d e p l e t e t h e p o l y m e r a s e p o o l and p r e v e n t t h e s h i f t - u p r e s p o n s e . The d a t a p r e s e n t e d i n F i g u r e 7 and T a b l e I I I showed t h a t t h e p e r c e n t rRNA s y n t h e s i s d i d n o t i n c r e a s e a f t e r a n u t r i - t i o n a l s h i f t - u p i n phage i n f e c t e d c e l l s . The c o n t r o l e x p e r i m e n t w i t h t h e u n i n f e c t e d c e l l s showed t h a t t h e c o n d i t i o n s o f g r o w t h , l a b e l i n g and s h i f t - u p i n d u c t i o n were s u f f i c i e n t t o i n d u c e and d e t e c t i n c r e a s e d rRNA s y n t h e s i s . Phage i n f e c t i o n a p p e a r e d t o b l o c k o r a l t e r a c h e m i c a l r e a c t i o n o r a h o s t gene p r o d u c t w h i c h was r e q u i r e d t o s t i m u l a t e i n c r e a s e d rRNA s y n t h e s i s . I f phage b u r s t s i z e i s dependent on a v a i l a b l e a c t i v e p o l y m e r a s e , why i s n ' t phage messenger RNA t h e o n l y t r a n s c r i p t i o n p r o d u c t ? Gage and G e i d u s c h e k (1971b) r e p o r t e d t h a t h o s t mRNA s y n t h e s i s d r o p s by 95% i n t h e f i r s t m i n u t e o f i n f e c t i o n . Why does t h e s y n t h e s i s o f r i b o s o m a l RNA c o n t i n u e ? I n v i t r o e x p e r i m e n t s s t r o n g l y suggest t h a t i f t o t a l r e p l a c e m e n t o f t h e h o s t s i g m a 4 3 s u b u n i t o f RNA p o l y m e r a s e w i t h t h e phage- coded gp28 s u b u n i t o c c u r r e d , rRNA t r a n s c r i p t i o n would s t o p . The m o d i f i e d p o l y m e r a s e i s h i g h l y s e l e c t i v e f o r HMU DNA ( D u f f y and G e i d u s c h e k , 1975; Lee, e t a l . , 1980). F u r t h e r m o r e , even i f t h e B. s u b t i l i s chromosomal DNA c o n t a i n e d HMU, t h e n u c l e o t i d e sequences ar o u n d t h e s t a r t o f t h e 16S gene show no h o m o l o g i e s t o p r o m o t e r s f o r gp28 c o n t a i n i n g p o l y m e r a s e ( T a l k i n g t o n and P e r o , 1979; S t e w a r t and B o t t , 1983). Chelm, e t a l . (1981) showed t h a t gp28 i s more e f f e c t i v e a t b i n d i n g t o c o r e t h a n i s s i g m a 4 3 . G i v e n t h a t t h e c e l l s were i n f e c t e d a t an moi=25, w h i c h s h o u l d t h e o r e t i c a l l y g i v e an abundance o f gp28, one would e x p e c t t h a t i n t h e phage i n f e c t e d c e l l most o f t h e p o l y m e r a s e would be complexed w i t h gp28 and n o t s i g m a 4 3 . However, rRNA s y n t h e s i s d i d c o n t i n u e i n i n f e c t e d c e l l s , 128 w h i c h i m p l i e s t h a t t h e r e i s some p o l y m e r a s e w h i c h i s i n a c c e s s i b l e t o gp28 m o d i f i c a t i o n . T h i s p o s s i b i l i t y has a l s o been s u g g e s t e d by H e m p h i l l and W h i t e l e y ( 1 9 7 5 ) . The d a t a p r e s e n t e d i n F i g u r e 7 and T a b l e I I I s u g g e s t t h a t t h e RNA p o l y m e r a s e w h i c h t r a n s c r i b e s rRNA genes i s r e s i s t a n t t o gp28 m o d i f i c a t i o n , and t h a t rRNA s p e c i f i c p o l y m e r a s e i s f u n c t i o n a l l y , a t l e a s t , a s t a b l e e n t i t y . Two models f o r t h e p a r t i t i o n i n g o f RNA p o l y m e r a s e have been s u g g e s t e d by a number o f groups w o r k i n g on E. c o l i . The f i r s t model p o s t u l a t e s t h e e x i s t e n c e o f a p r o t e i n f a c t o r w h i c h a s s o c i a t e s w i t h e i t h e r RNA p o l y m e r a s e c o r e o r holoenzyme such t h a t s t a b l e RNA operons a r e s p e c i f i c a l l y t r a n s c r i b e d (Muto, 1978, 1981; O o s t r a , e t a l . , 1980, W i l l i a m s , e t a l . , 1983). I f t h i s model were t r a n s l a t e d i n t o t h e B. s u b t i l i s system, p o l y m e r a s e complexed w i t h such a f a c t o r might be l e s s e f f e c t i v e a t b i n d i n g gp28 and t h u s a l l o w rRNA t r a n s c r i p t i o n t o c o n t i n u e . The second model p o s t u l a t e s t h a t RNA p o l y m e r a s e holoenzyme e x i s t s i n two forms m o d u l a t e d by t h e n u c l e o t i d e ppGpp: f o r m I s p e c i f i c a l l y t r a n s c r i b e s s t a b l e RNA operons and f o r m I I t r a n s c r i b e s a l l o t h e r o p e r o n s ( T r a v e r s , 1976; R y a l s , e t a l . , 1982). A g a i n , i f t h i s model were t r a n s l a t e d i n t o t h e B. s u b t i l i s system, t h e form I enzyme would be l e s s e f f e c t i v e a t b i n d i n g gp28 and rRNA t r a n s c r i p t i o n would c o n t i n u e . A l t h o u g h t h e d a t a p r e s e n t e d i n F i g u r e 7 and T a b l e I I I d i d n o t s u p p o r t o r c o n t r a d i c t e i t h e r model, t h e models s u g g e s t e d two d i f f e r e n t a p p roaches f o r f u r t h e r c h a r a c t e r i z a t i o n o f t h e p u t a t i v e rRNA s p e c i f i c RNA p o l y m e r a s e . 129 D. I s o l a t i o n o f rRNA s p e c i f i c RNA p o l y m e r a s e To i s o l a t e an rRNA s p e c i f i c RNA p o l y m e r a s e f r o m p r e p a r a t i o n s o f enzyme, one o f two p u r i f i c a t i o n s t e p s was used i n c o n j u n c t i o n w i t h t h e s t a n d a r d p u r i f i c a t i o n p r o c e d u r e o f D o b i n s o n and S p i e g e l m a n ( 1 9 8 5 ) : a f f i n i t y c hromatography t h r o u g h a pHD1.8 D N A - c e l l u l o s e column ( F i g u r e 10) , o r s e d i m e n t a t i o n t h r o u g h a 15-30% g l y c e r o l g r a d i e n t ( F i g u r e 1 1 ) . The a c t i v i t y p r o f i l e o f t h e p o l y m e r a s e p r e p a r a t i o n w h i c h had been chromatographed t h r o u g h a pHD1.8 D N A - c e l l u l o s e column showed t h a t t h e peak o f s p e c i f i c t r a n s c r i p t i o n was t h e same f o r b o t h t h e rRNA and non- rRNA p r o m o t e r s , b u t d i f f e r e d from t h e peak o f t o t a l a c t i v i t y ( F i g u r e 1 0 ) . S i m i l a r l y , t h e a c t i v i t y p r o f i l e o f t h e p o l y m e r a s e p r e p a r a t i o n s e d imented t h r o u g h a g l y c e r o l g r a d i e n t showed t h a t t h e peak of s p e c i f i c t r a n - s c r i p t i o n was t h e same f o r b o t h t h e rRNA and non-rRNA p r o m o t e r s ( F i g u r e 11) . The a s s a y f o r t o t a l a c t i v i t y measured t h e RNA s y n t h e s i z e d by b o t h c o r e (alpha2# b e t a , b e t a ' ) and holoenzyme ( c o r e + s i g m a 4 3 ) , whereas t h e a s s a y f o r s p e c i f i c t r a n s c r i p t s measured t h e RNA s y n t h e s i z e d by o n l y holoenzyme. The d i f f e r e n t e l u t i o n p a t t e r n s o f t o t a l a c t i v i t y and s p e c i f i c a c t i v i t y may r e f l e c t t h e d i f f e r e n t a f f i n i t i e s o f c o r e and h o l o - enzyme f o r s i t e s on t h e DNA c e l l u l o s e . V a r i a t i o n s o f b o t h t h e s e methods have been used by o t h e r s t o i s o l a t e s p e c i f i c p r o t e i n s . For example, P i r r o t t a and P t a s h n e (1969) used s p e c i f i c DNA f r a g m e n t s complexed t o c e l l u l o s e t o i s o l a t e t h e r e p r e s s o r from b a c t e r i o p h a g e 434, and T r a v e r s , e t a l . (1980) c l a i m e d f u n c t i o n a l h e t e r o g e n e i t y o f E. c o l i RNA p o l y m e r a s e sedimented t h r o u g h a g l y c e r o l g r a d i e n t . Why wasn't an rRNA s p e c i f i c RNA p o l y m e r a s e i s o l a t e d i n t h e 130 e x p e r i m e n t s i l l u s t r a t e d i n F i g u r e s 10 and 11? There a r e two p o s s i b l e answers t o t h i s q u e s t i o n . On a s u p e r f i c i a l l e v e l t h e t e c h n i q u e s might n o t have been s u f f i - c i e n t l y s e n s i t i v e t o i s o l a t e an rRNA s p e c i f i c p o l y m e r a s e . I n t h e a f f i n i t y chromatography e x p e r i m e n t , t h e whole p l a s m i d DNA, w h i c h c o n t a i n e d s e v e r a l E. c o l i p r o m o t e r s i n a d d i t i o n t o t h e B. s u b t i l i s r r n B p r o m o t e r s , was complexed t o t h e c e l l u l o s e r a t h e r t h a n a s p e c i f i c promoter f r a g m e n t . Thus, t h e r i b o s o m a l promoter r e g i o n sequence was d i l u t e d w i t h b o t h o t h e r p r o m o t e r s and n o n - s p e c i f i c sequence. F u r t h e r , i f a DNA fragment c o n t a i n i n g t h e tandem promoter had been used, t h e r a t i o o f non- s p e c i f i c p o l y m e r a s e b i n d i n g s i t e s t o s p e c i f i c b i n d i n g s i t e s would s t i l l have been h i g h , t h e r e f o r e , u n l e s s t h e d i f f e r e n t i a l b i n d i n g t o rRNA p r o m o t e r s was v e r y s t r o n g , i t i s n o t c l e a r whether s a l t g r a d i e n t e l u t i o n w ould have s e g r e g a t e d t h e p u t a t i v e r i b o s o m a l s p e c i f i c p o l y m e r a s e . I n t h e s e d i m e n t a t i o n e x p e r i m e n t t h e f r a c t i o n s c o l l e c t e d from t h e g l y c e r o l g r a d i e n t were 8 t o 4 t i m e s l a r g e r t h a n t h e f r a c t i o n s c o l l e c t e d i n t h e s t u d y by T r a v e r s , e t a l . ( 1 9 8 0 ) , t h u s any p o s s i b l e p o l y m e r a s e h e t e r o - g e n e i t y might have been m i s s e d w i t h t h e l a r g e r f r a c t i o n s i z e . On a more b a s i c l e v e l , i f one of t h e c u r r e n t models of rRNA s y n t h e s i s i n E. c o l i ( C o l e , e t a l . , 1987; C a s h e l and Rudd, 1987; Bremer and D e n n i s , 1987; L i n d a h l and Z e n g e l , 1986) h o l d s f o r B. s u b t i l i s , t h e wrong q u e s t i o n might have been a s k e d . My s e a r c h f o r an rRNA s p e c i f i c RNA p o l y m e r a s e grew o u t o f s h i f t - u p e x p e r i m e n t s and hence t h e e x p e c t e d r e s p o n s e was a s t i m u l a t i o n o f , o r p o s i t i v e e f f e c t on, t r a n s c r i p t i o n from t h e rRNA p r o m o t e r s . Other s t u d i e s o f s p e c i f i c c o n t r o l o f rRNA s y n t h e s i s c e n t e r e d on t h e s t r i n g e n t r e s p o n s e and t h e e f f e c t o f t h e n u c l e o t i d e ppGpp 131 ( G l a s e r , e t a l . , 1983; S a r m i e n t o s , e t a l . , 1983; K i n g s t o n and C h a m b e r l i n , 1981; T r a v e r s , e t a l . , 1980). The f o c u s o f t h e s e s t u d i e s was t h e r e p r e s s i o n o f , o r n e g a t i v e e f f e c t on, t r a n s c r i p t i o n from t h e rRNA p r o m o t e r s . However, R y a l s , e t a l . (1982) widened t h e r o l e o f ppGpp by e x t e n d i n g t h e p r o p o s a l o f T r a v e r s (1976) t h a t s t a b l e RNA gene a c t i v i t y i n E. c o l i was r e g u l a t e d v i a a ppGpp p a r t i t i o n i n g o f t h e c e l l u l a r complement o f RNA p o l y m e r a s e i n t o two f o r m s , one w i t h a h i g h and t h e o t h e r w i t h a low a f f i n i t y f o r s t a b l e RNA p r o m o t e r s . S u b s e q u e n t l y , L i t t l e , e t a l . (1983) d e m o n s t r a t e d t h a t t h e r a t e o f s t a b l e RNA s y n t h e s i s as a f r a c t i o n o f t h e i n s t a n e o u s r a t e o f t o t a l RNA s y n t h e s i s ( r s / r t ) had an i n v e r s e r e l a t i o n s h i p t o ppGpp c o n c e n t r a t i o n . T h e o r e t i c a l l y t h e n , when no ppGpp i s p r e s e n t , r s / r t s h o u l d e q u a l 1 and a l l RNA p o l y m e r a s e m o l e c u l e s s h o u l d be i n form I , w i t h a h i g h a f f i n i t y f o r rRNA p r o m o t e r s . The p o l y m e r a s e p u r i f i c a t i o n p r o c e d u r e may have removed n u c l e o t i d e s and t h e r e f o r e , u n l e s s ppGpp i s v e r y t i g h t l y bound t o p o l y m e r a s e , t h e p u r i f i e d RNA p o l y m e r a s e would t h e o r e t i c a l l y be i n f o r m I . I n o t h e r words, t h e p u r i f i e d polym- e r a s e was a l r e a d y i n t h e rRNA s p e c i f i c form, and f u r t h e r s t i m u l a t i o n o f t r a n s c r i p t i o n from t h e rRNA p r o m o t e r s would not have been o b s e r v e d . The r e s u l t s o f t h e k i n e t i c a n a l y s i s o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e rRNA p r o m o t e r s p r e s e n t e d i n F i g u r e 21 s u g g e s t e d t h a t p u r i f i e d p o l y m e r a s e d i d have a h i g h a f f i n i t y f o r rRNA p r o m o t e r s ( s e e b e l o w ) . E. S i n g l e round t r a n s c r i p t i o n a s s a y S i n c e t h e c u r r e n t models f o r t h e r e g u l a t i o n o f r ibosome s y n t h e s i s i n E. c o l i p o s t u l a t e t h e i n i t i a t i o n o f rRNA s y n t h e s i s as a p r i m a r y s i t e o f c o n t r o l ( J i n k s - R o b e r t s o n and Nomura, 1987; Bremer and D e n n i s , 1987), t h e l o g i c a l s t e p i n t h e i n v e s t i g a t i o n of rRNA s y n t h e s i s i n B. s u b t i l i s 132 was a s t u d y o f t r a n s c r i p t i o n i n i t i a t i o n f r o m t h e r r n B p r o m o t e r s . To f o c u s on a s i n g l e i n i t i a t i o n e vent r a t h e r t h a n m u l t i p l e rounds o f t r a n - s c r i p t i o n i n i n v i t r o a s s a y s , t h e c o m p e t i v e i n h i b i t o r h e p a r i n , an a n a l o g u e o f s i n g l e s t r a n d e d DNA, i s i n c l u d e d i n t h e p r o d u c t i v e a s s a y de- s c r i b e d f o r E. c o l i systems ( S t e f a n o and G r a l l a , 1980) and i n t h e s i n g l e r o u n d t r a n s c r i p t i o n a s s a y f o r B. s u b t i l i s systems ( D o b i n s o n and S p i e g e l m a n , 1985). On a l l t e m p l a t e s t h e l e v e l o f RNA p o l y m e r a s e a c t i v i t y was l e s s t h a n 1 t r a n s c r i p t p e r promoter ( F i g u r e s 12 and 1 3 ) . S i m i l a r l e v e l s o f polym- e r a s e a c t i v i t y a t t h e G2 and A2 p r o m o t e r s have been r e p o r t e d ( Dobinson and S p i e g e l m a n , 1987). Comparison of t r a n s c r i p t i o n l e v e l s from d i f f e r e n t p r o m o t e r s s t u d i e d i n d i f f e r e n t l a b o r a t o r i e s has been d i f f i c u l t f o r a number o f r e a s o n s . I n some c a s e s t r a n s c r i p t i o n a s s a y s do n o t i n c l u d e h e p a r i n , hence r e p o r t e d t r a n s c r i p t i o n l e v e l s measure m u l t i p l e rounds o f t r a n s c r i p t i o n i n i t i a t i o n ( f o r example, G l a s e r , e t a l . , 1 9 8 3 ) . Other r e p o r t s of a s s a y s w h i c h i n c l u d e h e p a r i n do n o t e x p r e s s t r a n s c r i p t i o n a c t i v i t y as t r a n s c r i p t s formed p e r promoter p r e s e n t , but r a t h e r as a b o r t i v e p r o d u c t s formed ( M c C l u r e , 1980) o r i n r e l a t i v e terms such as c o u n t s p e r m i n u t e ( S t e f a n o and G r a l l a , 1982) o r as r a t i o s ( P e t h o , e t a l . , 1 9 8 6 ) . S e v e r a l e x p l a n a t i o n s f o r a t t a i n i n g l e s s t h a n one t r a n s c r i p t p e r promoter i n i n v i t r o a s s a y s have been p r o p o s e d . For example, i n t e r f e r e n c e by i n a c t i v e , o r e x c e s s p o l y m e r a s e , has been s u g g e s t e d ( P r o s e n and Cech, 1985). The s i g n i f i c a n c e o f t h i s e f f e c t has been q u e s t i o n e d (D. S t r a n e y and C r o t h e r s , 1987) and t h e r e has been no i n d i c a t i o n o f such i n h i b i t i o n i n t h e work w i t h phage p r o m o t e r s (K. 133 D o b i n s o n , p e r s o n a l communication) o r w i t h t h e p r e s e n t d a t a . A second r e a s o n f o r low l e v e l s of t r a n s c r i p t i o n c o u l d be t h a t even i n t h e p r e s e n c e o f n u c l e o t i d e s , B. s u b t i l i s RNA p o l y m e r a s e does n o t r e a c h a h e p a r i n r e s i s t a n t s t a t e v e r y r a p i d l y . The l e v e l s o f t r a n s c r i p t i o n o b s e r v e d would r e f l e c t t h e c o m p e t i t i o n between h e p a r i n i n a c t i v a t i o n and e l o n g a t i o n . I f i n a c t i v a t i o n i s s t i l l a r a p i d e v e n t , one would n o t e x p e c t t o r e a c h h i g h l e v e l s o f t r a n s c r i p t i o n even when a l l p r o m o t e r s were complexed w i t h p o l y - merase. A number o f components of t h e i n v i t r o a s s a y might a l s o l e a d t o t h e low l e v e l o f p o l y m e r a s e a c t i v i t y . For example, a l i n e a r t e m p l a t e r a t h e r t h a n a s u p e r c o i l e d t e m p l a t e might c o n t r i b u t e t o low l e v e l s of t r a n s c r i p - t i o n . I n E. c o l i systems i t has been w e l l e s t a b l i s h e d t h a t i n v i t r o t r a n s c r i p t i o n from rRNA p r o m o t e r s i s s e n s i t i v e t o t h e t o p o l o g i c a l s t a t e of t h e t e m p l a t e ( P e t h o , e t a l . , 1986; G l a s e r , e t a l . , ' 1983). On t e m p l a t e s c o n t a i n i n g E. c o l i rRNA p r o m o t e r s i n t r a n s c r i p t i o n r e a c t i o n s w i t h o u t h e p a r i n , G l a s e r , e t a l . (1983) r e p o r t e d t h a t t r a n s c r i p t i o n was s t i m u l a t e d 1 0 0 0 - f o l d when t h e t e m p l a t e was s u p e r c o i l e d r a t h e r t h a n l i n e a r . S i n c e i t i s i m p o s s i b l e t o o b t a i n g r e a t e r t h a n 1 t r a n s c r i p t p e r promoter i n t h e s i n g l e r o u n d t r a n s c r i p t i o n a s s a y used i n my s t u d i e s , t h e l e v e l of 0.2 t r a n s c r i p t p e r promoter c o u l d n o t be i n c r e a s e d a t h o u s a n d - f o l d . S u p e r c o i l i n g c o u l d s t i m u l a t e , however, t h e k i n e t i c s of t h e r e a c t i o n , t h a t i s , one o r more o f t h e s t e p s i n t r a n s c r i p t i o n i n i t i a t i o n c o u l d be a f f e c t e d by t h e t o p o l o g i c a l s t a t e o f t h e t e m p l a t e . R e c e n t l y , B o r o w i e c and G r a l l a (1987) p r o p o s e d t h a t s u p e r c o i l i n g may p l a y a r o l e i n t h e c l o s e d t o open complex t r a n s i t i o n . They s u g g e s t e d t h a t t h e e nergy o f s u p e r c o i l i n g c o u l d be s t o r e d t r a n s i e n t l y i n a s t r e s s e d RNA p o l y m e r a s e - promoter complex b e f o r e b e i n g used t o m e l t DNA sequences near t h e s t a r t - 134 p o i n t o f t r a n s c r i p t i o n . I t i s p o s s i b l e t h a t a s i m i l a r mechanism would o p e r a t e a t t h e B. s u b t i l i s rRNA p r o m o t e r s , and c o u l d be m a n i f e s t e d i n t h e s i n g l e r ound t r a n s c r i p t i o n a s s a y as an i n c r e a s e i n t r a n s c r i p t s p e r p r o m o t e r , o r i n an i n c r e a s e i n t h e r a t e o f some s t e p i n t h e i n i t i a t i o n pathway. T r a n s c r i p t i o n i n i t i a t i o n a t t h e rRNA p r o m o t e r s e x h i b i t e d a number o f u n e x p e c t e d c h a r a c t e r i s t i c s . The enzyme c o n c e n t r a t i o n c u r v e ( F i g u r e 12) and t h e i n i t i a t i o n r a t e a s s a y ( F i g u r e 13) compared i n v i t r o t r a n s c r i p t i o n p r o p e r t i e s o f t h e tandem rRNA p r o m o t e r s t o two w e l l c h a r a c - t e r i z e d |)29 p r o m o t e r s , A2 and G2. F i g u r e 12 showed t h a t t h e rRNA p r o m o t e r s r e q u i r e d more enzyme t o r e a c h maximum h e p a r i n r e s i s t a n t complex f o r m a t i o n t h a n d i d t h e phage p r o m o t e r . A t t h e A2 p r o m o t e r , maximum a c t i v i t y was r e a c h e d a t an i n p u t r a t i o o f enzyme t o DNA e q u a l 5 p o l y m e r a s e m o l e c u l e s p e r p r o m o t e r , w h i l e t h e rRNA p r o m o t e r s r e q u i r e d a r a t i o o f n e a r l y 10 p o l y m e r a s e m o l e c u l e s p e r p r o m o t e r . T r a v e r s , e t a l . (1983) s u g g e s t e d t h a t more t h a n one m o l e c u l e of RNA p o l y m e r a s e i s r e q u i r e d f o r t r a n s c r i p t i o n a t p r o m o t e r s f o r genes t h a t encode s t a b l e RNA. Lamond and T r a v e r s (1985) f u r t h e r s u g g e s t e d t h a t RNA p o l y m e r a s e i n t e r a c t i o n s a l o n e c o u l d n o t a c c o u n t f o r t h e low l e v e l o f i n v i t r o t r a n - s c r i p t i o n f r o m a tRNA p r o m o t e r , and p o s t u l a t e d t h a t a d d i t i o n a l f a c t o r s m i g ht be p r e s e n t i n v i v o t h a t s t i m u l a t e e x p r e s s i o n f r o m s t a b l e RNA genes. As w i t h o t h e r B a c i l l u s p r o m o t e r s , t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t t h e rRNA p r o m o t e r s was found t o be s e n s i t i v e t o t h e n u c l e o t i d e c o m p o s i t i o n o f t h e i n i t i a t i o n b u f f e r ( D o b i n s o n and S p i e g e l m a n , 1987). The r e s u l t s p r e s e n t e d i n F i g u r e 13 d e m o n s t r a t e d t h a t on t h e tandem promoter c o n s t r u c t , RNA p o l y m e r a s e c o u l d f o r m h e p a r i n 135 r e s i s t a n t complexes i n t h e p r e s e n c e o f GTP, UTP, and CTP a t b o t h P I and P2. However, when t h e r i b o s o m a l p r o m o t e r s were on s e p a r a t e t e m p l a t e s , as i n t h e e x p e r i m e n t shown i n F i g u r e 14, p o l y m e r a s e formed h e p a r i n r e s i s t a n t complexes i n t h e p r e s e n c e o f GUC o n l y a t P I ( F i g u r e 14a) and i n t h e p r e s e n c e o f AGC o n l y a t P2 ( F i g u r e 1 4 b ) . T a b l e V shows t h e DNA sequence of t h e promoter r e g i o n of t h e r r n B o p e r o n and t h e i n v i v o t r a n s c r i p t i n i t i a t i o n s i t e s f o r b o t h p r o m o t e r s ( S t e w a r t and B o t t , 1 9 8 3 ) . The r e s u l t s o f e x p e r i m e n t s u s i n g t h e s e p a r a t e d t e m p l a t e s seem t o a g r e e w i t h t h e i n v i v o t r a n s c r i p t i o n i n i t i a t i o n d a t a , w h i l e t h e d a t a from t h e tandem promoter t e m p l a t e appear t o c o n t r a d i c t them. I n t h e absence of S I maps, t h e 5' end o f t h e t r a n s c r i p t s p r o d u c e d from t h e tandem promoter t e m p l a t e c o u l d n o t be i d e n t i f i e d . I t i s u n c l e a r whether t h e p o l y m e r a s e b e g i n s t r a n s c r i p t i o n a t P2 w i t h t h e m i d d l e A r e s i d u e ( s e e T a b l e V) under a l l i n i t i a t i o n c o n d i t i o n s o r whether t h e enzyme a d j u s t s t h e i n i t i a t i n g n u c l e o t i d e as c o n d i t i o n s change. The d i f f e r e n t i m p l i c a t i o n s o f t h e s e two p o s s i b i l i t i e s a r e d i s c u s s e d below. F. H e p a r i n r e s i s t a n t complex f o r m a t i o n a t P I a f f e c t s h e p a r i n r e s i s t a n t complex f o r m a t i o n a t P2 The r e s u l t s p r e s e n t e d i n F i g u r e 15 showed t h a t t h e f o r m a t i o n of s t a b l e , h e p a r i n r e s i s t a n t polymerase-DNA complexes a t P2 o f t h e tandem rRNA p r o m o t e r s was dependent on t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t P I . These d a t a a l s o i n d i c a t e d t h a t i f RNA p o l y m e r a s e d i d not f o r m h e p a r i n r e s i s t a n t complexes a t P I , t h e n t h e h e p a r i n r e s i s t a n t complexes formed a t P2 d e c a y e d . S i n c e my b a s i c a s s u m p t i o n i s t h a t h e p a r i n r e s i s t a n c e r e f l e c t s an i n i t i a t e d complex, I h y p o t h e s i z e d t h a t some s t e p i n t r a n s c r i p t i o n i n i t i a t i o n a t t h e P2 promoter o f t h e tandem rRNA 136 TABLE V DNA sequences a t t h e r r n B P I and P2 p r o m o t e r s 3 TAAAAAACTATTGCAATAAATAAATACAGGTGTTATATTATTAAACGTCGC P2 + AAAAAAGTTGTTGACAAAAAAGAAGCTGAATGTTATATTAGTAAAGCTGCT Gram p o s i t i v e s AAAAA TTGACA...A..A...A.T.TG.TATAATAATAT E. c o l i A T.TTGACAT. .T T.TG.TATAAT -35 -10 3DNA sequences [from S t e w a r t and B o t t ( 1 983)] a r e compared w i t h t h e consensus promoter sequences (Hawley and M c C l u r e , 1983; and Graves and R a b i n o w i t z , 1986) f o r p r o m o t e r s r e c o g n i z e d by E. c o l i sigma 7 1" 1 and B. s u b t i l i s s i g m a 4 3 RNA p o l y m e r a s e s . The -10 and -35 r e g i o n s and t h e i n v i v o i n i t i a t i o n s i t e s f o r t h e r r n B p r o m o t e r s a r e u n d e r l i n e d and marked w i t h p l u s e s , r e s p e c t i v e l y ( S t e w a r t and B o t t , 1983). 137 p r o m o t e r s was a l t e r e d by t h e f r o m a t i o n o f h e p a r i n r e s i s t a n t complexes a t t h e P I p r o m o t e r . G i v e n t h e c u r r e n t u n d e r s t a n d i n g o f t r a n s c r i p t i o n i n i t i a t i o n , s i g n i f i c a n t changes i n t h e r e a c t i o n c o u l d o c c u r a t e i t h e r o f two r a t e l i m i t i n g s t e p s : t h e i s o m e r i z a t i o n s t e p ( t h e t r a n s i t i o n f r o m c l o s e d t o open complex) o r t h e p r o moter c l e a r a n c e s t e p ( t h e t r a n s i t i o n f r o m i n i t i a t e d t o e l o n g a t i o n complex) ( M c C l u r e , 1985). As I a l l u d e d t o above, i f t h e s t a r t s i t e of t h e P2 t r a n s c r i p t on t h e tandem promoter t e m p l a t e d i f f e r e d under AGC and GUC i n i t i a t i o n c o n d i t i o n s , t h e h e p a r i n r e s i s t a n t complexes a t P I c o u l d m e d i a t e t h e change i n s t a b i l i t y of t h e h e p a r i n r e s i s t a n t complexes a t P2 a t d i f f e r e n t p o i n t s i n t h e t r a n s c r i p t i o n i n i t i a t i o n p r o c e s s . To f a c i l i t a t e t h e a n a l y s i s , I w i l l f i r s t r e v i e w t h e d a t a i n p o i n t f o r m . I w i l l t h e n p r e s e n t two t h e o r i e s and d i s c u s s t h e i m p l i c a t i o n s of each t h e o r y f o r t h e s t e p . c o n t r o l l e d i n P2 t r a n s c r i p t i o n i n i t i a t i o n by h e p a r i n r e s i s t a n t complexes a t P I . Summary o f t h e d a t a : 1. H e p a r i n r e s i s t a n t P2 t r a n s c r i p t s a r e formed w i t h AGC i n i t i a t i o n c o n d i t i o n s on b o t h t h e s e p a r a t e d and tandem promoter t e m p l a t e s ( F i g u r e s 14b, 15, 1 6 ) . 2. P2 complexes decay w i t h AGC i n i t i a t i o n c o n d i t i o n s on b o t h t h e s e p a r a t e d and tandem promoter t e m p l a t e s ( F i g u r e s 15, 1 6 ) . 3. H e p a r i n r e s i s t a n t P2 t r a n s c r i p t s a r e n o t formed w i t h GUC i n i t i a t i o n c o n d i t i o n s on t h e s e p a r a t e d promoter t e m p l a t e ( F i g u r e 1 4 a ) . 138 4. S t a b l e , h e p a r i n r e s i s t a n t P2 t r a n s c r i p t s a r e formed w i t h GUC i n i t i a t i o n c o n d i t i o n s on t h e tandem promoter t e m p l a t e ( F i g u r e 1 5 ) . 5. H e p a r i n r e s i s t a n t P I t r a n s c r i p t s a r e n o t formed w i t h AGC i n i t i a t i o n c o n d i t i o n s on e i t h e r t h e s e p a r a t e d o r tandem promoter t e m p l a t e s ( F i g u r e 14b, 1 5 a ) . I t s h o u l d be emphasized h e r e t h a t t h e f o l l o w i n g t h e o r i e s a r e based on t r a n s c r i p t i o n i n i t i a t i o n s t u d i e s p e r f o r m e d on a few p r o m o t e r s w i t h E. c o l i RNA p o l y m e r a s e and models d e v e l o p e d from t h o s e s t u d i e s . To d a t e s i m i l a r s t u d i e s f o r B. s u b t i l i s t r a n s c r i p t i o n i n i t i a t i o n have n o t been c a r r i e d o u t and i t i s n o t known how w e l l t h e s e E. c o l i models w i l l t r a n s l a t e i n t o t h e B a c i l l u s system. T h e o r y 1 — U n d e r a l l i n i t i a t i o n c o n d i t i o n s t h e P2 t r a n s c r i p t a l w a y s s t a r t s w i t h one o f t h e A r e s i d u e s ( s e e T a b l e V ) . A b a s i c a s s u m p t i o n i s t h a t changes i n t h e s t a b i l i t y o f t h e p o l y m e r a s e - p r o m o t e r complex t o h e p a r i n r e f l e c t changes i n t h e i s o m e r i z a t i o n s t e p . S u pport f o r t h i s a s s u m p t i o n i s found i n t h e lacUV5 promoter system where t h e c l o s e d complex i s h e p a r i n s e n s i t i v e , w h i l e t h e open complex i s h e p a r i n r e s i s t a n t ( M i l l e r and B u r g e s s , 1978). A P2 t r a n s c r i p t was n o t o b s e r v e d w i t h GUC i n i t i a t i o n c o n d i t i o n s on t h e s e p a r a t e d promoter t e m p l a t e , t h a t i s , t h e b i n a r y complex had n o t formed an open complex; however, on t h e tandem p r o m o t e r t e m p l a t e , a s t a b l e h e p a r i n r e s i s t a n t complex was formed a t P2. T h e r e f o r e , t h e h e p a r i n r e s i s t a n t complex a t P I must make t h e enzyme a t P2 on t h e tandem promoter t e m p l a t e h e p a r i n r e s i s t a n t i n t h e absence o f 139 n u c l e o t i d e s . Theory 1 i m p l i e s t h a t t h e P I m e d i a t e d change a t P2 o c c u r s p r i m a r i l y a t t h e i s o m e r i z a t i o n s t e p . Under T h e o r y 1, t h e d e c a y o f h e p a r i n r e s i s t a n t P2 complexes o b s e r v e d w i t h AGC i n i t i a t i o n c o n d i t i o n s i s i n t e r p r e t e d as i n s t a b i l i t y o f t h e complexes w h i l e w a i t i n g f o r t h e f o u r t h n u c l e o t i d e , and s u g g e s t s t h a t P2 may be a n a l o g o u s t o an E. c o l i f a s t s t a r t promoter ( s e e b e l o w ) . The f o r m a t i o n of s t a b l e , h e p a r i n r e s i s t a n t complexes o b s e r v e d w i t h GUC i n i t i a t i o n c o n d i t i o n s a t P2 on t h e tandem promoter t e m p l a t e o c c u r s b e c a u s e t h e P2 b i n a r y complex (now h e p a r i n r e s i s t a n t due t o t h e p r e s e n c e o f a h e p a r i n r e s i s t a n t complex a t P I ) can p r o c e e d t h r o u g h t h e f o r m a t i o n o f t h e f i r s t p h o s p h o d i e s t e r bond and e l o n g a t i o n w i t h o u t w a i t i n g f o r n u c l e o t i d e s , t h a t i s , t h e f o r m a t i o n of t e r n a r y complexes t a k e s p l a c e a f t e r a l l f o u r n u c l e o t i d e s a r e p r e s e n t . The p r i m a r y argument f o r Theory 1 i s one o f c o n s i s t e n c y , t h a t i s , t h e i n v i v o and i n v i t r o s t a r t s i t e s would be t h e same. An a d d i t i o n a l a t t r a c t i o n o f Theory 1 i s t h a t i t p o s t u l a t e s t h a t t h e P2 promoter i s a f a s t s t a r t p r o m o t e r , l i k e o t h e r s t r o n g i n v i v o promoter such as t h e T7 A p r o m o t e r s ( M c C l u r e , 1980). A p o t e n t i a l argument a g a i n s t Theory 1 i s t h a t i n t h e GUC i n i t i a t i o n r e a c t i o n s , t h e c o n c e n t r a t i o n o f t h e " i n i t i a t i n g " n u c l e o t i d e (A) was low. A t t h e lambda P R promoter t h e d i s s o c i a t i o n c o n s t a n t f o r t h e i n i t i a t i n g n u c l e o t i d e has been r e p o r t e d as a p p r o x i m a t e l y 50 t i m e s h i g h e r t h a n t h e M i c h a e l i s c o n s t a n t of t h e second n u c l e o t i d e i n t h e f o r m a t i o n o f a b o r t i v e t r a n s c r i p t s ( M c C l u r e , e t a l . , 1978). M c C l u r e , e t a l . (1978) r a t i o n a l i z e d t h e d i s p a r i t y between t h e b i n d i n g a f f i n i t i e s o f t h e i n i t i a t i n g t r i - 140 p h o s p h a t e s and t h e subsequent t r i p h o s p h a t e s by n o t i n g t h a t RNA p o l y m e r a s e does n o t r e q u i r e a p r i m e r and t h a t t h e s t a c k i n g s t a b i l i z a t i o n must be s u p p l i e d by t h e enzyme a l o n e . They s u g g e s t e d t h a t once t h e w e a k l y bound i n i t i a t i n g n u c l e o t i d e i s p o s i t i o n e d p r o p e r l y , t h e second t r i p h o s p h a t e can b i n d t o t h e complex and t r a p t h e f i r s t . I n t h e GUC i n i t i a t i o n r e a c t i o n i n my e x p e r i m e n t s , t h e ATP c o n c e n t r a t i o n (10 uM) was n e c e s s a r i l y low b ecause i t was t h e l a b e l e d n u c l e o t i d e , w h i l e t h e c o n c e n t r a t i o n o f t h e o t h e r n u c l e o t i d e s was 400 uM, t h a t i s , t h e p u t a t i v e i n i t i a t i n g t r i p h o s p h a t e was p r e s e n t a t o n e - f o r t i e t h t h e c o n c e n t r a t i o n of t h e subsequent t r i p h o s p h a t e s . Thus, c o n d i t i o n s f o r an A i n i t i a t i o n a t t h e P2 promoter were n o t v e r y f a v o r a b l e . T heory 2 — T h e P2 t r a n s c r i p t can s t a r t a t d i f f e r e n t s i t e s w i t h i n t h e i n i t i a t i o n r e g i o n of t h e p r o m o t e r . On t h e tandem promoter t e m p l a t e w i t h AGC i n i t i a t i o n c o n d i t i o n s t h e P2 t r a n s c r i p t p r o b a b l y s t a r t e d w i t h t h e A r e s i d u e ; h e p a r i n r e s i s t a n t complexes were no t o b s e r v e d a t P I w i t h t h e s e c o n d i t i o n s . S i n c e a P2 t r a n s c r i p t was n o t o b s e r v e d w i t h GUC i n i t i a t i o n c o n d i t i o n s on t h e s e p a r a t e d promoter t e m p l a t e , t h e h e p a r i n r e s i s t a n t complex a t P I on t h e tandem promoter t e m p l a t e must have f a c i l i t a t e d t h e i n i t i a t i o n o f t h e P2 t r a n s c r i p t a t a n o t h e r r e s i d u e , p r o b a b l y t h e G (see T a b l e V ) , under GUC i n i t i a t i o n c o n d i t i o n s . S i n c e t h e p o s t u l a t e d change i n s t a r t s i t e o f t h e h e p a r i n r e s i s t a n t complexes a t P2 l e a d s t o i n c r e a s e d s t a b i l i t y o f t h e complexes, T h e o r y 2 i m p l i e s t h a t t h e P I m e d i a t e d change o c c u r s a f t e r t h e f o r m a t i o n of t h e open complex and p o s s i b l y i n t h e p r o - moter c l e a r a n c e s t e p a t P2. I n i t i a t i o n s t a r t s i t e h e t e r o g e n e i t y i s n o t an u n p r e c e d e n t e d phe- nomenon. C a r p o u s i s , e t a l . (1932) r e p o r t e d t h a t i n i n v i t r o t r a n - 141 s c r i p t i o n i n i t i a t i o n r e a c t i o n s , t r a n s c r i p t s from t h e lacUV5 promoter c o u l d s t a r t a t one of f o u r p u r i n e s w i t h i n a s i x n u c l e o t i d e i n i t i a t i o n r e g i o n . They a l s o f o u n d t h a t t h e r e l a t i v e d i s t r i b u t i o n o f t r a n s c r i p t s i n i t i a t e d f rom a s i n g l e s i t e was dependent on t h e c o n c e n t r a t i o n s o f t h e i n i t i a t i n g n u c l e o t i d e s . F u r t h e r , t h e y c o n c l u d e d t h a t t h e c h o i c e o f t r a n s c r i p t s t a r t s i t e s was dependent on e v e n t s t h a t o c c u r r e d a f t e r t h e f o r m a t i o n o f t h e open complex and i n v o l v e d t h e i n i t i a t i n g n u c l e o t i d e . The P2 promoter of t h e B. s u b t i l i s r r n B o p e r o n might be amenable t o changes i n s t a r t s i t e s , s i n c e t h e i n v i v o i n i t i a t i o n s i t e f o r t h e P2 t r a n s c r i p t i s l o c a t e d c l o s e r t o t h e -10 r e g i o n o f t h e promoter t h a n most b a c t e r i a l t r a n s c r i p t i o n s t a r t s i t e s ( T a b l e V; Graves and R a b i n o w i t z , 1986). o The promoter c l e a r a n c e s t e p has been b e s t c h a r a c t e r i z e d f o r t h e E. c o l i slow s t a r t promoter lacUV5 ( C a r p o u s i s and G r a l l a , 1985; D. S t r a n e y and C r o t h e r s , 1987). S t r a n e y and C r o t h e r s (1987) p r o p o s e d a model f o r promoter c l e a r a n c e i n w h i c h open complex (polymerase-DNA) c o n t a c t s compete w i t h i n i t i a t e d complex (polymerase-DNA-RNA) i n t e r a c t i o n s t o p r o d u c e a " s t r e s s e d i n t e r m e d i a t e " d u r i n g t h e f o r m a t i o n o f a s h o r t RNA-DNA d u p l e x . They f u r t h e r p r o p o s e d t h a t t h e s t r a i n e n ergy i n t h e t e r n a r y complex i s r e l i e v e d by e i t h e r e j e c t i o n o f t h e s h o r t RNA, w h i c h r e s u l t s i n a b o r t e d i n i t i a t i o n , o r by e l i m i n a t i o n o f t h e sigma s u b u n i t and b r e a k i n g o f open complex c o n t a c t s , w h i c h r e s u l t s i n p r o d u c t i v e t r a n s c r i p t i o n . U s i n g Theory 2 and t h e S t r a n e y and C r o t h e r s model, t h e decay of h e p a r i n r e s i s t a n t complexes a t P2 o b s e r v e d w i t h AGC i n i t i a t i o n c o n d i t i o n s i s i n t e r p r e t e d as weakened c o n t a c t s i n t h e -10 r e g i o n ; t h a t i s , under n o r m a l t r a n s c r i p t i o n c o n d i t i o n s (no h e p a r i n ) t h e t h e r e s o l u t i o n of t h e 142 s t r e s s e d i n t e r m e d i a t e complex would f a v o r t h e promoter c l e a r a n c e s t e p . However, under t h e s i n g l e r ound t r a n s c r i p t i o n c o n d i t i o n s t h e p o l y m e r a s e d i d n o t make s t r o n g open complex c o n t a c t s , t h e r e f o r e , t h e enzyme came o f f t h e DNA. The P I m e d i a t e d change i n s t a b i l i t y o f t h e h e p a r i n r e s i s t a n t complexes a t t h e P2 promoter on t h e tandem promoter t e m p l a t e w i t h GUC i n i t i a t i o n c o n d i t i o n s i s t h u s i n t e r p r e t e d as t h e r e s o l u t i o n o f t h e s t r e s s e d i n t e r m e d i a t e such t h a t t h e e x p u l s i o n o f t h e a b o r t i v e p r o d u c t and t h e r e v e r s i o n t o t h e open complex were f a v o r e d , t h a t i s , t h e open complex c o n t a c t s a t P2 were s t r e n g t h e n e d by t h e h e p a r i n r e s i s t a n t complexes a t P I and t h e enzyme s t a y e d on t h e DNA. A d i f f i c u l t y w i t h t h i s i n t e r p r e t a t i o n o f t h e r e s u l t s i s found i n t h e p u t a t i v e sequences o f t h e r e s p e c t i v e n a s c e n t RNAs. S t r a n e y and C r o t h e r s (1987) p o s t u l a t e t h a t p r o m o t e r s t h a t f a v o r t h e promoter c l e a r a n c e s t e p may m i n i m i z e t h e r e s t r a i n t c aused by t h e competing e n e r g i e s by i n c l u d i n g mechanisms t h a t s t r e n g t h e n t h e RNA-DNA d u p l e x . A c c o r d i n g t o t h i s h y p o t h e s i s , one would e x p e c t t h a t t h e RNA-DNA d u p l e x formed d u r i n g AGC i n i t i a t i o n w ould have a h i g h e r G + C c o n t e n t and t h e r e f o r e be more s t a b l e , however, t h e enzyme c o u l d p o t e n t i a l l y s y n t h e s i z e o n l y a 4-base n a s c e n t RNA w h i c h would have a G + C c o n t e n t o f 50% ( s ee T a b l e V ) . I n c o n t r a s t , w i t h GUC i n i t i a t i o n c o n d i t i o n s t h e enzyme c o u l d s y n t h e s i z e an 8-base n a s c e n t RNA w h i c h would have a G + C c o n t e n t o f 62.5%. A t p r e s e n t t h e d a t a a r e i n s u f f i c i e n t t o make a c h o i c e between Th e o r y 1 and 2. As I n o t e d above t h e s e t h e o r i e s a r e a d a p t e d from models bas e d on t r a n s c r i p t i o n i n i t i a t i o n s t u d i e s o f a l i m i t e d number o f E. c o l i p r o m o t e r s , i t i s l i k e l y t h a t t r a n s c r i p t i o n i n i t i a t i o n a t B. s u b t i l i s 143 p r o m o t e r s , and even a t o t h e r E. c o l i p r o m o t e r s , may n o t f i t i n t o t h e s e models. A m e c h a n i s m — A mechanism f o r how h e p a r i n r e s i s t a n t complexes a t P I m i g ht e f f e c t t h e change i n p o l y m e r a s e - p r o m o t e r i n t e r a c t i o n a t P2 has n o t been e s t a b l i s h e d . However, i t i s u n l i k e l y t h a t t h e b i n d i n g of p o l y m e r a s e t o P I i s s u f f i c i e n t t o m e d i t a t e t h e change. The r e s u l t s shown i n F i g u r e 16 s u g g e s t e d t h a t when P I was p h y s i c a l l y p r e s e n t and a v a i l a b l e f o r enzyme b i n d i n g ( t h e tandem promoter c o n s t r u c t , AGC i n i t i a t i o n ) , t h e h e p a r i n - r e s i s t a n t complexes formed a t P2 d e c a y e d a t t h e same r a t e as complexes formed on t h e s e p a r a t e d P2 c o n s t r u c t ( P I p h y s i c a l l y a b s e n t ) . I n a d d i t i o n , g e l r e t a r d a t i o n e x p e r i m e n t s d e m o n s t r a t e d t h a t t h e b i n d i n g of RNA p o l y m e r a s e t o P I d i d n o t a f f e c t t h e b i n d i n g s t e p i n P2 i n i t i a t i o n (Wakarchuk and S p i e g e l m a n , u n p u b l i s h e d o b s e r v a t i o n s ) . A p o s s i b l e mechanism f o r t h e e f f e c t o f P I on P2 c a n be s u g g e s t e d i f one assumes t h a t a l t e r a t i o n s i n t h e DNA s t r u c t u r e o c c u r when a h e p a r i n - r e s i s t a n t complex i s formed a t P I . DNase I f o o t p r i n t s on t h e veg p romoter and t h e G2 promoter showed t h a t RNA p o l y m e r a s e p r o t e c t e d r e s i d u e s -45 t o +30 (Le G r i c e and S o n n e s h e i n , 1982; B r i o n and S p i e g e l m a n , i n p r e p a r a t i o n ) . I f t h e enzyme p r o t e c t s s i m i l a r r e g i o n s a t b o t h P I and P2, two RNA p o l y m e r a s e m o l e c u l e s would come w i t h i n 14 base p a i r s o f one a n o t h e r . DNA u n w i n d i n g i n d u c e d by E. c o l i RNA p o l y m e r a s e has been measured i n b i n a r y , i n i t i a t i o n , and t e r n a r y complexes, a l l o f w h i c h had an u n w i n d i n g a n g l e of 17 + 1 base p a i r s (Gamper and H e a r s t , 1 9 8 2 ) . E l l i s o n , e t a l . (1987) have d e m o n s t r a t e d t h a t a s u p e r c o i l i n g - d e p e n d e n t t r a n s i t i o n o c c u r i n g i n one sequence ca n a c t a t a d i s t a n c e t o a f f e c t t h e b e h a v i o r o f o t h e r t r a n s i t i o n s o c c u r r i n g e l s e w h e r e w i t h i n a g i v e n 144 t o p o l o g i c a l domain. They a l s o n o t e t h a t any change i n t h e e n e r g e t i c r e q u i r e m e n t s o f a s i n g l e sequence, such as p r o t e i n b i n d i n g , i s l i k e l y t o a f f e c t t h e p a t t e r n o f e v e n t s i n a l l o t h e r sequences c o m p e t i n g w i t h i n a g i v e n t o p o l o g i c a l domain. Thus, a t t h e rRNA tandem p r o m o t e r s t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t P I c o u l d c a use a l t e r a t i o n s i n t h e t e m p l a t e s t r u c t u r e w h i c h c o u l d a f f e c t t h e c o n t a c t s between RNA p o l y m e r a s e and t h e P2 p r o m o t e r . G. K i n e t i c a n a l y s i s o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e rRNA p r o m o t e r s The c o m p o s i t e a s s a y used i n S e c t i o n E o f I n V i t r o R e s u l t s was d e v e l o p e d t o i n v e s t i g a t e t h e r a t e and mechanism of open complex f o r m a t i o n l e a d i n g t o p r o d u c t i v e t r a n s c r i p t f o r m a t i o n f o r a s e r i e s of mutant E. c o l i l a c p r o m o t e r s ( S t e f a n o and G r a l l a , 1982). T h i s a s s a y has a l s o been used, w i t h some m o d i f i c a t i o n s , t o d e t e r m i n e t h e r a t e of h e p a r i n r e s i s t a n t complex f o r m a t i o n f o r t h e B. s u b t i l i s (J)29 A2 promoter ( F i g u r e 19a; Dobinson and S p i e g e l m a n , 1985). • Three k i n e t i c p a r a m e t e r s f o r p o l y m e r a s e - p r o m o t e r i n t e r a c t i o n s can be d e r i v e d f r o m t a u p l o t s : (1) t h e o v e r a l l f o r w a r d r a t e c o n s t a n t f o r t h e f o r m a t i o n o f i n i t i a t i o n complexes, K o n , from t h e s l o p e of t h e l i n e ; (2) t h e e q u i l i b r i u m d i s s o c i a t i o n c o n s t a n t , K A*, from t h e x - i n t e r c e p t ; and (3) t h e r a t e c o n s t a n t f o r t h e c o n v e r s i o n of t h e u n s t a b l e i n t e r m e d i a t e t o t h e i n i t i a t e d complex, k 2 , f r o m t h e y - i n t e r c e p t . The t a u p l o t s of p o l y m e r a s e - p r o m o t e r i n t e r a c t i o n s f o r t h e l a c p r o m o t e r s and t h e A2 promoter r e s u l t e d i n l i n e s w i t h a p o s i t i v e s l o p e ( S t e f a n o and G r a l l a , 1982; F i g u r e 19a; D o b i n s o n and S p i e g e l m a n , 1985), t h u s , p e r m i t i n g t h e c a l c u l a t i o n o f a l l t h r e e p a r a m e t e r s . The t a u p l o t f o r t h e tandem rRNA 145 p r o m o t e r s , however, r e s u l t e d i n l i n e s w i t h f l a t o r. s l i g h t l y n e g a t i v e s l o p e s ( F i g u r e 2 1 ) , hence, K o n and K A* c o u l d n o t be d e t e r m i n e d u s i n g t h i s method. What a r e t h e i m p l i c a t i o n s o f a s h a l l o w s l o p e on a t a u p l o t f o r p o l y m e r a s e - p r o m o t e r i n t e r a c t i o n s ? K A* has a l s o been r e f e r r e d t o as Kg, t h e e q u i l i b r i u m b i n d i n g c o n s t a n t o f p o l y m e r a s e t o p r o m o t e r ( M c C l u r e , 1985). U s i n g t h i s l a t t e r d e s i g n a t i o n , t h e r e s u l t s p r e s e n t e d i n F i g u r e 21 s u g g e s t t h a t a p o l y m e r a s e m o l e c u l e i s a l w a y s bound a t t h e rRNA p r o m o t e r s . A s h a l l o w p o s i t i v e o r a f l a t s l o p e i n a t a u p l o t i s n o t u n p r e c e d e n t e d . A t a u p l o t a n a l y s i s o f phage T7 A l , A2, and A3 p r o m o t e r s ( d e r i v e d from t h e a b o r t i v e t r a n s c r i p t a s s a y s ) r e s u l t e d i n l i n e s w i t h s h a l l o w o r f l a t s l o p e s f o r t h o s e t h r e e s t r o n g p r o m o t e r s ( M c C l u r e , 1980; D a y t o n , e t a l . , 1 984). M c C l u r e (1980) p r e d i c t e d t h a t f r e q u e n t l y i n i t i a t i n g p r o m o t e r s as a c l a s s w ould have low y - i n t e r c e p t s and low s l o p e s . The y - i n t e r c e p t s f o r b o t h t h e rRNA p r o m o t e r s were h i g h e r t h a n any d e t e r m i n e d f o r t h e T7 p r o m o t e r s , t h e lacUV5 promoter o r t h e (J)29 A2 p r o m t e r . The major weakness i n u s i n g e i t h e r t h e a b o r t i v e i n i t i a t i o n o r t h e c o m p o s i t e a s s a y s t o o b t a i n k i n e t i c p a r a m e t e r s i s t h a t b o t h a r e i n d i r e c t and might n o t r e f l e c t a l l t h e i n t e r m e d i a t e s t e p s i n t h e f o r m a t i o n of an i n i t i a t e d complex. I n a d d i t i o n , t h e y r e q u i r e a number o f a s s u m p t i o n s t o be made i n o r d e r t o d e r i v e k i n e t i c v a l u e s ( S t e f a n o and G r a l l a , 1982). The a b o r t i v e i n i t i a t i o n a s s a y , however, i s i d e a l l y s u i t e d t o i n v e s t i g a t e t h e dynamics of t h e promoter c l e a r a n c e s t e p ( s e e a b o v e ) . A g e l r e t a r - d a t i o n method, w h i c h measures i n i t i a t i o n p r o d u c t s d i r e c t l y , has been used t o d e t e r m i n e t h e k i n e t i c s o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e lacUV5 p r o m o t e r ( S t r a n e y and C r o t h e r s , 1 9 8 7 ) . The g e l r e t a r d a t i o n method, as 146 d e s c r i b e d , r e q u i r e s a DNA fragment c o n t a i n i n g a s i n g l e p r o m o t e r , and as d e m o n s t r a t e d above ( F i g u r e s 15-18) s t a b l e t r a n s c r i p t i o n i n i t i a t i o n f rom t h e P2 promoter i s dependent on t h e p r e s e n c e o f a s t a b l y i n i t i a t e d complex a t P I , i n o t h e r words, two p r o m o t e r s on a DNA fr a g m e n t . I t i s p o s s i b l e t h a t t h e g e l r e t a r d a t i o n method w i l l be u s e f u l i n e s t a b l i s h i n g t h e k i n e t i c p a r a m e t e r s f o r t h e B. s u b t i l i s rRNA tandem p r o m o t e r s , i f a c l e a r c h a r a c t e r i z a t i o n o f a l l p o t e n t i a l bands on a g e l can be made. H. T r a n s c r i p t i o n i n i t i a t i o n f rom p r o m o t e r s on a r t i f i c i a l tandem promoter t e m p l a t e s The d a t a p r e s e n t e d i n F i g u r e s 14, 15, and 16 i n d i c a t e d t h a t i n o r d e r f o r RNA p o l y m e r a s e t o f o r m s t a b l e , h e p a r i n r e s i s t a n t complexes a t t h e r r n B P2 p r o m o t e r , h e p a r i n r e s i s t a n t complexes must a l s o be formed a t t h e r r n B P I p r o m o t e r . The i n v e s t i g a t i o n s o f t r a n s c r i p t i o n i n i t i a t i o n a t pr o m o t e r s on a r t i f i c i a l tandem promoter c o n s t r u c t s were d e s i g n e d t o l i m i t p o s s i b l e mechanisms f o r t h e P I m e d i t a t e d e f f e c t on t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t t h e P2 p r o m o t e r . T r a n s c r i p t i o n i n i t i a t i o n on p P l d P 2 — I n b o t h B. s u b t i l i s and E. c o l i t h e tandem p r o m o t e r s o f t h e r i b o s o m a l operons a r e s e p a r a t e d by about t h e same d i s t a n c e , 90 t o 110 base p a i r s (K. B o t t , p e r s o n a l c o m m u n i c a t i o n ; L i n d a h l and Z e n g e l , 1986). I s t h i s d i s t a n c e between t h e p r o m o t e r s c r i t i c a l ? E x p e r i m e n t s u s i n g p l a s m i d p P l d P 2 s e t o u t t o examine t h e e f f e c t on t r a n s c r i p t i o n i n i t i a t i o n o f i n c r e a s i n g t h e d i s t a n c e between t h e r r n B p r o m o t e r s f r o m 90 t o 185 b a s e s . S i n c e t h e r a t e and f i n a l l e v e l o f t r a n - 147 s c r i p t i o n i n i t i a t i o n a t t h e P I promoter was u n a f f e c t e d by t h e p r e s e n c e o r absence o f t h e P2 promoter ( F i g u r e 1 7 ) , t h e i n i t i a l p r e d i c t i o n was t h a t t r a n s c r i p t i o n i n i t i a t i o n f rom P2 might be d e p r e s s e d by i n c r e a s i n g t h e d i s t a n c e between t h e tandem p r o m o t e r s , and t h a t t h e p a t t e r n o f t r a n s c r i p - t i o n f r o m P I would be u n a f f e c t e d . The r e s u l t s p r e s e n t e d i n F i g u r e 23 and T a b l e IV, however, i n d i c a t e d t h a t t r a n s c r i p t i o n i n i t i a t i o n a t b o t h rRNA p r o m o t e r s was r e d u c e d on t h e p P l d P 2 t e m p l a t e . When t h e p o l y m e r a s e c o n - c e n t r a t i o n was i n c r e a s e d , t h e l e v e l s o f t r a n s c r i p t i o n a t b o t h p r o m o t e r s on p P l d P 2 approached t h o s e o b s e r v e d on t h e w i l d t y p e t e m p l a t e ( T a b l e I V ) . However, i t i s u n l i k e l y t h a t a c o n c e n t r a t i o n e f f e c t c o u l d p r o v i d e a s i m p l e e x p l a n a t i o n f o r t h e s e o b s e r v a t i o n s , s i n c e t h e p o l y m e r a s e t o promoter r a t i o was h i g h e r i n r e a c t i o n s i n wh i c h p P l d P 2 DNA was t h e t e m p l a t e , t h a n i n r e a c t i o n s i n w h i c h pHD1.8 DNA was t e m p l a t e . The i n t e r p r e t a t i o n o f t h e s e d a t a i s f u r t h e r c o m p l i c a t e d by t h e e x i s t e n c e o f p r o m o t e r - l i k e sequences between P I and P2 c r e a t e d i n t h e c l o n i n g p r o c e s s o f t h e p P l d P 2 t e m p l a t e ( F i g u r e 2 2 ) . As n o t e d above, E l l i s o n , e t a l . (1987) have p o s t u l a t e d t h a t s u p e r c o i l i n g dependent t r a n s i t i o n s o c c u r r i n g i n one sequence can a c t a t a d i s t a n c e t o a f f e c t t h e b e h a v i o r o f o t h e r t r a n s i t i o n s o c c u r r i n g e l s e w h e r e w i t h i n a t o p o l o g i c a l domain. They a l s o s u ggest t h a t any change i n t h e e n e r g e t i c r e q u i r e m e n t s o f a s i n g l e sequence t h r o u g h m u t a t i o n , base m o d i f i c a t i o n o r p r o t e i n b i n d i n g i s l i k e l y t o a f f e c t t h e p a t t e r n o f e v e n t s i n a l l o t h e r sequences c o m p e t i n g w i t h i n t h e domain. I t i s p o s s i b l e t h a t t h e p r o m o t e r - l i k e sequence between t h e two rRNA p r o m o t e r s competed w i t h t h e two t r u e p r o m o t e r s and t h e r e f o r e changed t h e e n e r g e t i c r e q u i r e m e n t s f o r b o t h P I and P2 on t h e p P l d P 2 t e m p l a t e . 148 T r a n s c r i p t i o n i n i t i a t i o n on p P ! A 2 — T h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t P I on t h e tandem promoter t e m p l a t e p e r m i t t e d t h e f o r m a t i o n o f s t a b l e , h e p a r i n r e s i s t a n t complexes a t t h e P2 promoter ( F i g u r e s 14, 15, and 1 6 ) . Was t h i s P I m e d i t a t e d e f f e c t l i m i t e d t o t h e P2 promoter o r would P I a f f e c t t r a n s c r i p t i o n i n i t i a t i o n a t o t h e r p r o m o t e r s ? The aim o f t h e e x p e r i m e n t s u s i n g t h e p l a s m i d p P l A 2 as a t e m p l a t e was t o i n v e s t i g a t e t h e e f f e c t o f t h e r r n B P I promoter on t r a n s c r i p t i o n i n i t i a t i o n a t t h e §29 A2 p r o m o t e r . T h e o r y 2 ( s e e above) p o s t u l a t e d t h a t t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t P I e n a b l e d t h e t r a n s c r i p t formed a t P2 t o i n i t i a t e w i t h a GTP r e s i d u e , an event w h i c h d i d n o t o c c u r on t h e s e p a r a t e d P2 promoter t e m p l a t e ( F i g u r e 1 4 a ) . W h i l e t h e r e s u l t s p r e s e n t e d i n F i g u r e 25 d e m o n s t r a t e d t h a t t h e p r e s e n c e o f t h e P I promoter upstream o f t h e A2 promoter d i d n o t a l t e r t h e i n i t i a t i o n n u c l e o t i d e r e q u i r e m e n t s f o r t h e f o r m a t i o n o f h e p a r i n r e s i s t a n t complexes a t t h e A2 p r o m o t e r , t h e y d i d suggest t h a t t h e p r e s e n c e o f P I s t i m u l a t e d t r a n s c r i p t i o n a c t i v i t y a t t h e downstream p r o m o t e r . R e s u l t s from subsequent e x p e r i m e n t s ( F i g u r e s 26 and 27) s u g g e s t e d t h a t when t h e P I promoter was p h y s i c a l l y l i n k e d t o t h e A2 promoter and i n i t i a t i o n c o n d i t i o n s p e r m i t t e d , t r a n s c r i p t i o n i n i t i a t i o n was s t i m u l a t e d f rom t h e A2 p r o m o t e r . U n l i k e t h e s i t u a t i o n a t t h e P2 p r o m o t e r , a h e p a r i n r e s i s t a n t complex a t t h e P I promoter was n o t r e q u i r e d f o r an e f f e c t a t t h e A2 p r o m o t e r . Under t h e s e c o n d i t i o n s t h e P I promoter might be a c t i n g l i k e t h e a c t i v a t o r r e g i o n s r e p o r t e d upstream o f many n a t u r a l p r o m o t e r s i n b o t h E. c o l i and B. s u b t i l i s ( G o u r s e , e t a l . , 1986; Lamond and T r a v e r s , 1983; Banner, e t a l . , 1983; Horn and W e l l s , 1981). The k i n e t i c p r o p e r t i e s o f t h e P I p r o m o t e r , h i g h a f f i n i t y f o r t h e p o l y m e r a s e and slow 149 i n i t i a t i o n r a t e ( F i g u r e 2 1 ) , would s u p p o r t t h e r o l e o f p o l y m e r a s e " f e e d e r " t o a downstream p r o m o t e r . I . Summary I began t h i s i n v e s t i g a t i o n w i t h a s t u d y of rRNA s y n t h e s i s i n B. s u b t i l i s d u r i n g s t e a d y s t a t e growth and under n u t r i t i o n a l s h i f t - u p c o n d i t i o n s . I d e m o n s t r a t e d t h a t i n B. s u b t i l i s t h e f r a c t i o n a l r a t e o f rRNA s y n t h e s i s i n c r e a s e d as a f u n c t i o n o f growth r a t e , and was s i m i l a r t o t h a t r e p o r t e d f o r E. c o l i . The k i n e t i c s o f rRNA s y n t h e s i s a f t e r a n u t r i t i o n a l s h i f t - u p i n B. s u b t i l i s , however, d i d n o t co n f o r m t o t h o s e e s t a b l i s h e d f o r E. c o l i . I a l s o examined t h e r e l a t i o n s h i p between rRNA s y n t h e s i s and RNA p o l y m e r a s e a v a i l a b i l i t y u s i n g an amber m u t a t a n t o f t h e SP01 phage and f o u n d e v i d e n c e w h i c h s u g g e s t e d t h e e x i s t e n c e o f a r i b o s o m a l RNA s p e c i f i c RNA p o l y m e r a s e . The c o n c l u s i o n s from t h e i n v i v o s t u d y l e d t o an a n a l y s i s o f rRNA t r a n s c r i p t i o n i n v i t r o . When I u n d e r t o o k t h e i s o l a t i o n o f t h e p u t a t i v e r i b o s o m a l RNA s p e c i f i c RNA p o l y m e r a s e , I o b s e r v e d no d i f f e r e n c e i n a c t i v i t y p r o f i l e when t r a n s c r i p t i o n a c t i v i t y a t t h e rRNA tandem p r o m o t e r s was compared t o a c t i v i t y a t a n o n - r i b o s o m a l p r o m o t e r . I n v i v o a n a l y s i s o f t h e c o n t r o l o f rRNA s y n t h e s i s i n E. c o l i s u g g e s t e d t h a t r e g u l a t i o n o c c u r r e d on t h e l e v e l o f t r a n s c r i p t i o n i n i t i a t i o n , t h e r e f o r e , I t u r n e d my i n v i t r o i n v e s t i g a t i o n t o t r a n s c r i p t i o n i n i t i a t i o n a t t h e B. s u b t i l i s rRNA p r o m o t e r s u s i n g t h e s i n g l e round t r a n s c r i p t i o n a s s a y . I showed t h a t t h e f o r m a t i o n o f a h e p a r i n r e s i s t a n t complex a t t h e P I promoter a f f e c t e d t h e s t a b i l i t y o f t h e h e p a r i n r e s i s t a n t complex formed a t t h e P2 p r o m o t e r . I examined t h e k i n e t i c s o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e rRNA p r o m o t e r s 150 and d e m o n s t r a t e d t h a t RNA p o l y m e r a s e had a h i g h a f f i n i t y f o r b o t h rRNA p r o m o t e r s , b u t t h e r a t e o f i n i t i a t i o n a t t h e s e p r o m o t e r s was r e l a t i v e l y s l o w when compared t o n o n - r i b o s o m a l p r o m o t e r s . F i n a l l y , I compared t r a n s c r i p t i o n i n i t i a t i o n on two a r t i f i c i a l tandem promoter c o n s t r u c t s w i t h i n i t i a t i o n on t h e n a t i v e tandem promoter c o n s t r u c t , and f o u n d t h a t w h i l e t h e p r e s e n c e o f t h e P I promoter had s p e c i f i c e f f e c t s when i t was upstrea m from t h e d i f f e r e n t p r o m o t e r s , i n g e n e r a l , P I had a p o s i t i v e e f f e c t on t r a n s c r i p t i o n from downstream p r o m o t e r s . The work d e s c r i b e d i n t h i s t h e s i s c o n t r i b u t e s t o t h e u n d e r s t a n d i n g o f t h e s y n t h e s i s o f rRNA i n t h e f o l l o w i n g a r e a s . My i n v i v o i n v e s t i g a t i o n showed t h a t i n terms o f g l o b a l c e l l u l a r r e g u l a t i o n t h e s y n t h e s i s o f rRNA i n B. s u b t i l i s i s s i m i l a r t o t h a t o b s e r v e d i n E. c o l i . S i n c e I was u n a b l e t o i s o l a t e a rRNA s p e c i f i c RNA p o l y m e r a s e , I cannot o f f e r a p r e c i s e mechanism f o r growth r a t e r e g u l a t i o n , a t t h e rRNA p r o m o t e r s . However, my i n v e s t i g a t i o n o f t r a n s c r i p t i o n i n i t i a t i o n d i d s u g g e s t some mechanisms f o r r e g u l a t i o n a t t h e l e v e l o f i n i t i a t i o n . W h i l e t r a n s c r i p t i o n i n i t i a t i o n has been s t u d i e d i n v i t r o a t many E. c o l i p r o m o t e r s i n c l u d i n g some tRNA p r o m o t e r s , no tandem rRNA p r o m o t e r s have been examined i n t h i s way. My i n v e s t i g a t i o n o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e tandem p r o m o t e r s o f B. s u b t i l i s i n d i c a t e d t h a t t h e r a t e and f i n a l l e v e l o f f o r m a t i o n of h e p a r i n r e s i s t a n t complexes was h i g h e r a t P2 t h a n a t P I , and s u p p o r t e d t h e i n v i v o o b s e r v a t i o n t h a t t h e P2 promoter of t h e B. s u b t i l i s r r n B operon when e x p r e s s e d i n E. c o l i was t h e t r a n s c r i p - t i o n a l l y more a c t i v e more a c t i v e o f t h e tandem rRNA p r o m o t e r s (Deneer and S p i e g e l m a n , 1987). The r e s u l t s from i n i t i a l r a t e a s s a y s a t n a t i v e and a r t i f i c i a l tandem c o n s t r u c t s s u g g e s t e d t h a t t h e B. s u b t i l i s P I promoter might a c t l i k e t h e s t i m u l a t o r y e lements f o u n d upstream o f t h e s t a b l e RNA 151 p r o m o t e r s i n E. c o l i ( G o u r s e , e t a l . , 1986; Lamond and T r a v e r s , 1983; Banner, e t a l . , 1983; Horn and W e l l s , 1981). I p r o p o s e d t h a t t h e h e p a r i n r e s i s t a n t complexes formed a t t h e P I promoter changed t h e polymerase-DNA c o n t a c t s a t t h e P2 promoter and t h e r e b y a l t e r e d e i t h e r t h e i s o m e r i z a t i o n o r t h e p r o m o t e r c l e a r a n c e s t e p i n t r a n s c r i p t i o n i n i t i a t i o n a t t h e P2 p r o m o t e r , by m o d i f y i n g s u p e r c o i l i n g - d e p e n d e n t t r a n s i t i o n s w i t h i n a g i v e n t o p o l o g i c a l domain. F i n a l l y , t h e t a u p l o t k i n e t i c a n a l y s i s o f t h e tandem rRNA p r o m o t e r s showed t h a t t h e k i n e t i c s o f t r a n s c r i p t i o n i n i t i a t i o n f r o m t h e s e p r o m o t e r s were c h a r a c t e r i s t i c o f o t h e r p r o m o t e r s w h i c h a r e v e r y a c t i v e i n v i v o , namely t h e phage T7 A p r o m o t e r s ( M c C l u r e , 1980). 152 REFERENCES A c h b e r g e r , E . C , H i l t o n , M.D. and W h i t e l e y , H.R. ( 1 9 8 2 ) . The e f f e c t o f t h e d e l t a s u b u n i t on t h e i n t e r a c t i o n o f B a c i l l u s s u b t i l i s RNA p o l y m e r a s e w i t h bases i n a SP82 e a r l y gene p r o m o t e r . Nuc. A c i d s Res. 10:2893-2910. A i b a , H., Adhya, S. and deCrombrugghe, B. ( 1 9 8 1 ) . E v i d e n c e f o r two f u n c t i o n a l g a l p r o m o t e r s i n i n t a c t E s c h e r i c h i a c o l i c e l l s . J . B i o l . Chem. 256:11905-11910. Banner, C.D.B., Moran C P . , J r . a n d L o s i c k , R. ( 1 9 8 3 ) . D e l e t i o n a n a l y s i s o f a complex promoter f o r a d e v e l o p m e n t a l l y r e g u l a t e d gene from B a c i l l u s s u b t i l i s . J . M o l . B i o l . 168:351-365. Beaman, T . C , H i t c h i n s , A.D., Ochi,K., V a s a n t h a , N., Endo, T. and F r e e s e , E. ( 1 9 8 3 ) . S p e c i f i c i t y and c o n t r o l o f up t a k e o f p u r i n e and o t h e r compounds i n B a c i l l u s s u b t i l i s . J . B a c t e r i o l . 156:1107-1117. B e r n h a r d , S.L. and Mearse, C F . ( 1 9 8 6 ) . The sigma s u b u n i t o f RNA p o l y m e r a s e c o n t a c t s t h e l e a d i n g ends of t r a n s c r i p t s 9-13 bases l o n g on t h e lambda P R promoter but n o t on T7 A l . Biochem. 25:5914-5919. B o r o w i e c , J.A. and G r a l l a , J.D. ( 1 9 8 7 ) . A l l t h r e e e lements o f t h e l a c p s promoter m e d i a t e i t s t r a n s c r i p t i o n a l r e s p o n s e t o DNA s u p e r c o i l i n g . J . M o l . B i o l . 195:89-97. Bremer, H. and D e n n i s , P.P. ( 1 9 8 7 ) . M o d u l a t i o n o f c h e m i c a l c o m p o s i t i o n and o t h e r p a r a m e t e r s o f t h e c e l l by growth r a t e , i n E s c h e r i c h i a c o l i and S a l m o n e l l a t y p h i m u r i u m : C e l l u l a r and M o l e c u l a r B i o l o g y , volume 2. ( e d s . Ingraham, J . L . , Low, K.B., Magasanik, B., S c h a e c h t e r , M., Umbarger, H.E.) pp.1527-1542. A m e r i c a n S o c i e t y f o r M i c r o b i o l o g y , W a s h i n g t o n , D.C Buc, H. and M c C l u r e , W.R. ( 1 9 8 5 ) . K i n e t i c s o f open complex f o r m a t i o n between E s c h e r i c h i a c o l i RNA p o l y m e r a s e and t h e lacUV5 p r o m o t e r . E v i d e n c e f o r a s e q u e n t i a l mechanism i n v o l v i n g t h r e e s t e p s . Biochem. 24:2712-2723. C a r p o u s i s , A . J . and G r a l l a , J.D. ( 1 9 8 5 ) . I n t e r a c t i o n o f RNA p o l y m e r a s e w i t h lacUV5 promoter DNA d u r i n g mRNA i n i t i a t i o n and e l o n g a t i o n : F o o t p r i n t i n g , m e t h y l a t i o n , and r i f a m p i c i n - s e n s i t i v i t y changes accompanying t r a n s c r i p t i o n i n i t i a t i o n . J . M o l . B i o l . 183:165-177. 153 C a r p o u s i s , A . J . , S t e f a n o , J.E. and G r a l l a , J.D. ( 1 9 8 2 ) . 5' n u c l e o t i d e h e t e r o g e n e i t y and a l t e r e d i n i t i a t i o n o f t r a n s c r i p t i o n a t mutant l a c p r o m o t e r s . J . M o l . B i o l . 157:619-633. C a s h e l , M. and Rudd, K.E. ( 1 9 8 7 ) . The s t r i n g e n t r e s p o n s e , i n E s c h e r i c h i a c o l i and S a l m o n e l l a t y p h i m u r i u m : C e l l u l a r and M o l e c u l a r B i o l o g y , volume 2. ( e d s . Ingraham, J . L . , Low, K.B., Magasanik, B., S c h a e c h t e r , M., Umbarger, H.E.) pp.1410-1438. A m e r i c a n S o c i e t y f o r M i c r o b i o l o g y , W ashington, D.C. C h a m b e r l i n , M.J., Rosenberg, S. and Kadesch, T. ( 1 9 8 2 ) . S t u d i e s o f t h e i n t e r a c t i o n o f E. c o l i RNA p o l y m e r a s e holoenzyme w i t h b a c t e r i o p h a g e T7 promoter A l ; a n a l y s i s o f k i n e t i c s and e q u i l i b r i a o f t e m p l a t e s e l e c t i o n and open complex f o r m a t i o n , i n P r o m o t e r s , s t r u c t u r e and f u n c t i o n ( e d s . R o d r i g u e z , R.L. and C h a m b e r l i n , M.J.) pp.34-53. P r a e g e r P u b l i s h e r s , New Y o r k . C h a m b e r l i n , M.J. ( 1 9 7 4 ) . The s e l e c t i v i t y o f t r a n s c r i p t i o n . Ann. Rev. Biochem. 43:721-775. Champe, S.P. and B e n z e r , S. ( 1 9 6 2 ) . R e v e r s a l o f mutant phenotypes by 5- f l u o r o - u r a c i l : An a p p r o a c h t o n u c l e o t i d e sequences i n messenger- RNA. P r o c . N a t l . A c a d . S c i . U.S.A. 48:532-546. Chelm, B.K., B e a r d , C. and G e i d u s c h e k , E.P. ( 1 9 8 1 ) . Changes i n t h e a s s o c i a t i o n between B a c i l l u s s u b t i l i s RNA p o l y m e r a s e c o r e and two s p e c i f i c i t y - d e t e r m i n i n g s u b u n i t s d u r i n g t r a n s c r i p t i o n . Biochem. 20:6563-6569 C l e w e l l , D.B. and H e l i n s k i , D.R. ( 1 9 7 2 ) . E f f e c t o f growth c o n d i t i o n s on t h e f o r m a t i o n o f t h e r e l a x a t i o n complex o f s u p e r c o i l e d c o l E l d e o x y r i b o n u c l e i c a c i d and p r o t e i n i n E s c h e r i c h i a c o l i . J . B a c t e r i o l . 110:1135-1146. C o l e , J.R., O l s s o n , C.L., Hershey, J.W.B., Grunberg-Manago, M., and Nomura, M. ( 1 9 8 7 ) . Feedback r e g u l a t i o n o f rRNA s y n t h e s i s i n E s c h e r i c h i a c o l i : Requirement f o r i n i t i a t i o n f a c t o r I F 2 . J . M o l . B i o l . 198:383-392. Dayton, C . J . , P r o s e n , D.E., P a r k e r , K.L.-, Cech, C.L. ( 1 9 8 4 ) . K i n e t i c measurements of E s c h e r i c h i a c o l i RNA p o l y m e r a s e a s s o c i a t i o n w i t h b a c t e r i o p h a g e T7 e a r l y p r o m o t e r s . J . B i o l . Chem. 259:1616-1621. Deneer, H.G. and Spiegelman, G.B. ( 1 9 8 7 ) . B a c i l l u s s u b t i l i s rRNA p r o m o t e r s a r e growth r a t e r e g u l a t e d i n E s c h e r i c h i a c o l i . J . B a c t e r i o l . 169:995-1002. 154 D e n n i s , P.P. ( 1 9 7 1 ) . R e g u l a t i o n o f s t a b l e RNA s y n t h e s i s i n E s c h e r i c h i a c o l i . N a t u r e (London) New B i o l . 232:43-47. D e n n i s , P.P. and Bremer, H. (1 9 7 4 ) . R e g u l a t i o n o f r i b o n u c l e i c a c i d s y n t h e s i s i n E s c h e r i c h i a c o l i B / r : An a n a l y s i s o f a s h i f t - u p . J . M o l . B i o l . 89:233-239. D o b i n s o n , K.F. and S p i e g e l m a n , G.B. (1985). N u c l e o t i d e sequence and t r a n s c r i p t i o n o f a b a c t e r i o p h a g e (J)29 e a r l y p r o m o t e r . J . B i o l . Chem. 260:5950-5955. D o b i n s o n , K.F. and Sp i e g e l m a n , G.B. (1987). E f f e c t o f t h e d e l t a s u b u n i t o f B a c i l l u s s u b t i l i s RNA p o l y m e r a s e on i n i t i a t i o n o f RNA s y n t h e s i s a t two b a c t e r i o p h a g e (j)29 p r o m o t e r s . Biochem. 26:8206-8213. D o i , R.H. and I g a r i s h i , R.T. (1964). R i b o n u c l e i c a c i d s o f B a c i l l u s s u b t i l i s s p o r e s and s p o r u l a t i n g c e l l s . J . B a c t e r i o l . 87:323-328. D o i , R.H. ( 1 9 8 2 ) . RNA p o l y m e r a s e o f B a c i l l u s s u b t i l i s . i n The M o l e c u l a r B i o l o g y o f t h e B a c i l l i volume I . B a c i l l u s s u b t i l i s ( e d . Dubnau, D. A.) pp. 72-110. Academic P r e s s , N.Y. D o i , R.H. and Wang, L. ( 1 9 8 6 ) . M u l t i p l e p r o c a r y o t i c r i b o n u c l e i c a c i d p o l y m e r a s e sigma f a c t o r s . M i c r o . B i o l . Rev. 50:227-243. Downard, J.S. and W h i t e l e y , H.R. ( 1 9 8 1 ) . E a r l y RNAs i n SP82- and SP01- i n f e c t e d B a c i l l u s s u b t i l i s may be p r o c e s s e d . J . V i r o l . 37:1075- 1078. D u f f y , J . J . and G e i d u s c h e k , E.P. ( 1 9 7 5 ) . RNA p o l y m e r a s e from SP01 i n f e c t e d and u n i n f e c t e d B. s u b t i l i s . J . B i o l . Chem. 250:4530-4541. E l l i s o n , M.J., F e n t o n , M.J., Ho, P.S. and R i c h , A. ( 1 9 8 7 ) . Long-range i n t e r a c t i o n s o f m u l t i p l e DNA s t r u c t u r a l t r a n s i t i o n s w i t h i n a common t o p o l o g i c a l domain. EMBO J . 5:1513-1522. Fox, T.D. ( 1 9 7 6 ) . I d e n t i f i c a t i o n o f phage SP01 p r o t e i n s coded by r e g u l a t o r y genes 33 and 34. N a t u r e 262:748-753. F u j i t a , D.J., O h l s s o n - W h i l h e l m , B.M. and G e i d u s c h e k , E.P. ( 1 9 7 1 ) . T r a n s c r i p t i o n d u r i n g b a c t e r i o p h a g e SP01 development: M u t a t i o n s a f f e c t i n g t h e program of v i r a l t r a n s c r i p t i o n . J . M o l . B i o l . 57:301-317. 155 Gage, L.P. and G e i d u s c h e k , E.P ( 1 9 7 1 ) . RNA s y n t h e s i s d u r i n g b a c t e r i o p h a g e SP01 development: S i x c l a s s e s o f SP01 RNA. J . M o l . B i o l . 57:279-300 Gage, L.P. and G e i d u s c h e k , E.P. (1971b). RNA s y n t h e s i s d u r i n g b a c t e r i o p h a g e SP01 development I I : Some m o d u l a t i o n s and p r e r e q u i s i t e s o f t h e t r a n s c r i p t i o n program. V i r o l . 44:200-210. Gamper, H.B. and H e a r s t , J.E. ( 1 9 8 2 ) . A t o p o l o g i c a l model f o r t r a n s c r i p t i o n based on u n w i n d i n g a n g l e a n a l y s i s o f E. c o l i RNA p o l y m e r a s e b i n a r y , i n i t i a t i o n and t e r n a r y complexes. C e l l 29:81- 90. G a u s i n g , K. ( 1 9 7 7 ) . R e g u l a t i o n of r i b o s o m e p r o d u c t i o n i n E s c h e r i c h i a c o l i : S y n t h e s i s and s t a b i l i t y o f r i b o s o m a l RNA and o f r i b o s o m a l p r o t e i n messenger RNA a t d i f f e r e n t growth r a t e s . J . M o l . B i o l . 115:335-354. G a u s i n g , K. ( 1 9 8 0 ) . R e g u l a t i o n of r i b o s o m e b i o s y n t h e s i s i n E. c o l i . i n Ribosomes: S t r u c t u r e , f u n c t i o n , and g e n e t i c s , ( e d . C h a m b l i s , e t a l • ) . pp.693-718. U n i v e r s i t y Park P r e s s , B a l t i m o r e , Md. G e i d u s c h e k , E.P. and I t o , J . ( 1 9 8 2 ) . R e g u l a t o r y mechanisms i n t h e development of l y t i c b a c t e r i o p h a g e s of B a c i l l u s s u b t i l i s . I n : Dubnau, D.A. (ed.) The m o l e c u l a r b i o l o g y o f t h e B a c i l l i , v o l 1. Academic P r e s s , New Y o r k , pp 203-245. G e o r g o l o p o l o u s , C P . ( 1 9 6 9 ) . S u p p r e s s o r system i n B a c i l l u s s u b t i l i s 168. J . B a c t e r i o l . 97:1397-1402. G i l l e s p i e , D. and S p i e g e l m a n , S. ( 1 9 6 5 ) . A q u a n t i t a t i v e a s s a y f o r DNA- RNA h y b r i d s w i t h DNA i m m o b i l i z e d on a membrane. J . M o l . B i o l . 12:829-842. G l a s e r , G., S a r m i e n t o s , P. and C a s h e l , M. ( 1 9 8 3 ) . F u n c t i o n a l i n t e r r e l a t i o n s h i p between two tandem E. c o l i r i b o s o m a l RNA p r o m o t e r s . N a t u r e . 302:74-76. G l a s s , R.E., J o n e s , S.T. and I s h i h a m a , A. ( 1 9 8 6 ) . G e n e t i c s t u d i e s on t h e b e t a s u b u n i t o f E s c h e r i c h i a c o l i RNA p o l y m e r a s e : V I I . RNA p o l y m e r a s e i s a t a r g e t f o r ppGpp. M o l . Gen. Genet. 203:265-268. Gourse, R.L., de Boer, H.A. and Nomura, M. ( 1 9 8 6 ) . DNA d e t e r m i n a n t s o f rRNA s y n t h e s i s i n E. c o l i : Growth r a t e dependent r e g u l a t i o n , 156 f e e d b a c k i n h i b i t i o n , u pstream a c t i v a t i o n , a n t i t e r m i n a t i o n . C e l l 44:197-205. G r a v e s , M. C. and R a b i n o w i t z , J.C. ( 1 9 8 6 ) . I n v i v o and i n v i t r o t r a n s c r i p t i o n o f t h e C l o s t r i d i u m p a s t e u r i a n u m f e r r e d o x i n gene. J . B i o l . Chem. 261:11409-11415. Hawley, D.K., Malan, T., M u l l i g a n , M.E. and M c C l u r e , W.R. ( 1 9 8 2 ) . i n P r o m o t e r s , s t r u c t u r e and f u n c t i o n ( e d s . R o d r i g u e z , R.L. and C h a m b e r l i n , M.J.) pp.54-68. P r a e g e r P u b l i s h e r s , New Y o r k . Hawley, D.K. and M c C l u r e , W.R. ( 1 9 8 3 ) . C o m p i l a t i o n and a n a l y s i s o f E s c h e r i c h i a c o l i p r o moter DNA sequences. Nuc. A c i d . Res. 11:2237- 2255. H e m p h i l l , H.E. and W h i t e l e y , H.R. ( 1 9 7 5 ) . B a c t e r i o p h a g e s o f B a c i l l u s s u b t i l i s . B a c t e r i o l . Rev. 39:257-315. H i a t t , W.R. and W h i t e l e y , H.R. ( 1 9 7 8 ) . T r a n s l a t i o n o f RNAs s y n t h e s i z e d i n v i v o and i n v i t r o f r o m b a c t e r i o p h a g e SP82 DNA. J . V i r o l . 25:616-629. Horn, G.T. and W e l l s , R.D. ( 1 9 8 1 ) . The l e f t w a r d p r omoter o f b a c t e r i o p h a g e lambda: s t r u c t u r e , b i o l o g i c a l a c t i v i t y , and i n f l u e n c e by a d j a c e n t r e g i o n s . J . B i o l . Chem. 256:2003-2009. H s i e h , T.-S. and Wang, J.C. ( 1 9 7 8 ) . Nuc. A c i d . Res. 5:3337-3347. J i n k s - R o b e r t s o n , S., Gourse, R.L. and Normura, M. ( 1 9 8 3 ) . E x p r e s s i o n o f rRNA and tRNA i n E s c h e r i c h i a c o l i : E v i d e n c e f o r f e e d b a c k r e g u l a t i o n by p r o d u c t s o f rRNA o p e r o n s . C e l l 33:865-876. J i n k s - R o b e r t s o n , S. and Normura, M. ( 1 9 8 7 ) . Ribosomes and tRNA. i n E s c h e r i c h i a c o l i and S a l m o n e l l a t y p h i m u r i u m : C e l l u l a r and M o l e c u l a r B i o l o g y , volume 2. ( e d s . Ingraham, J . L . , Low, K.B., Magasanik, B., S c h a e c h t e r , M., Umbarger, H.E.) pp.1358-1385. A m e r i c a n S o c i e t y f o r M i c r o b i o l o g y , Washington, D.C. K i n g s t o n , R.E. and C h a m b e r l i n , M.J. ( 1 9 8 1 ) . P a u s i n g and a t t e n u a t i o n o f i n v i t r o t r a n s c r i p t i o n i n t h e r r n B operon o f E. c o l i . C e l l 27:523- 531. K i r k e g a a r d , K., Buc, H. Spa s s k y , A. and Wang, J.C. ( 1 9 8 3 ) . P r o c . N a t l . A c a d . S c i . U.S.A. 80:2544-2548. 157 K o v a c i c , R.T. ( 1 9 8 7 ) . The 0° c l o s e d complexes between E s c h e r i c h i a c o l i RNA p o l y m e r a s e and two p r o m o t e r s , T7-A3 and l a c U V 5 . J . B i o l . Chem. 262:13654-13661. L a F a u c i , G., Widom, R.L., E i s n e r , R.L., J a r v i s , E.D. and Rudner,R. ( 1 9 8 6 ) . Mapping of rRNA genes w i t h i n t e g r a b l e p l a s m i d s i n B a c i l l u s s u b t i l i s . J . B a c t e r i d . 165:204-214. Lamond, A . I . and T r a v e r s , A.A. ( 1 9 8 3 ) . Requirement f o r an upstre a m element f o r o p t i m a l t r a n s c r i p t i o n o f a b a c t e r i a l tRNA gene. N a t u r e 305:248-250. Lamond, A . I . and T r a v e r s , A.A. ( 1 9 8 5 ) . G e n e t i c a l l y s e p a r a b l e f u n c t i o n a l e l e m e n t s m e d i a t e t h e o p t i m a l e x p r e s s i o n and s t r i n g e n t r e g u l a t i o n o f a b a c t e r i a l tRNA gene. C e l l 40:319-326. L a r s e n , R . J . and Marx, M.L. ( 1 9 8 1 ) . An i n t r o d u c t i o n t o m a t h e m a t i c a l s t a t i s t i c s and i t s a p p l i c a t i o n s . P r e n t i c e - H a l l , I n c . , Engelwood C l i f f s , N.J. L a w r i e , J . M . , Downard, J.S. and W h i t e l e y , H.R. ( 1 9 7 8 ) . B a c i l l u s s u b t i l i s b a c t e r i o p h a g e s SP82, SP01, and <|>e: a c o m p a r i s o n of DNAs and p e p t i d e s s y n t h e s i z e d d u r i n g i n f e c t i o n . J . V i r o l . 37:725-737. L e G r i c e , S . F , J . and S o n e n s h e i n , A.L. ( 1 9 8 2 ) . S e p a r a t i o n and a n a l y s i s o f t h e RNA p o l y m e r a s e b i n d i n g s i t e s o f a complex B a c i l l u s s u b t i l i s p r o m o t e r . M o l . Gen. Genet. 204:229-236. Leduc, E., H o e k s t r a , M. and S p i e g e l m a n , G.B. ( 1 9 8 2 ) . R e l a t i o n s h i p between s y n t h e s i s o f rib o s o m e s and RNA p o l y m e r a s e i n B a c i l l u s s u b t i l i s . Can. J . M i c r o b i o l . 28:1280-1288. Lee, G., H a n n e t t , N.M., Korman, A. and P e r o , J . ( 1 9 8 0 ) . T r a n s c r i p t i o n o f c l o n e d DNA from B a c i l l u s s u b t i l i s phage SP01: Requirement f o r h y d r o x y m e t h y l u r a c i l - c o n t a i n i n g DNA by p h a g e - m o d i f i e d RNA p o l y m e r a s e . J . M o l . B i o l . 139:407-422. L i , S . C , S q u i r e s , C.L. and S q u i r e s , C. ( 1 9 8 4 ) . A n t i t e r m i n a t i o n o f E. c o l i rRNA t r a n s c r i p t i o n i s c a u s e d by a c o n t r o l r e g i o n segment c o n t a i n i n g Lambda n u t - l i k e sequences. C e l l 38:851-860. L i l l e y , D.M. ( 1 9 8 0 ) . The i n v e r t e d r e p e a t as a r e c o g n i z a b l e f e a t u r e i n s u p e r c o i l e d DNA m o l e c u l e s . P r o c . N a t l . Acad. S c i . U.S.A. 77:6468- 6472. 158 Lindahl, L. and Zengel, J.M. (1982). Expression of ribosomal genes i n bacteria. Advances i n Genetics, volume 21. pp.53-121. Academic Press, New York. Lindahl, L. and Zengel, J.M. (1986). Ribosomal Genes i n Escherichia c o l i . Ann. Rev. Genet. 20:297-326. Litman, R.M. (1968). A deoxyribonucleic acid polymerase from Micrococcal luteus (Micrococcus lysodeikticus) isolated on deoxyribonucleic acid-cellulose. J . B i o l . Chem. 243:6222-6233. L i t t l e , R., Ryals, J . and Bremer, H. (1983). rpoB mutation i n Escherichia c o l i a l t e r s control of ribosome synthesis by guanosine tetraphosphate. J . Bacte r i o l . 154:787-792. Maaloe, 0. and Kjeldgaard, N.O. (1966). Control of macromolecular synthesis: A study od DNA, RNA, and protein synthesis i n bacteria. W.A Benjamin Inc., New York. Maaloe, 0. (1979). Regulation of the protein synthesizing machinery— ribosomes, tRNA, factors, and so on. i n Bi o l o g i c a l regulation and development, volume I. (ed. Goldberger, R.). pp.487-542. Plenum Publishing Corp., New York. MacHattie, L.A. and Thomas, C.A. (1968). Nucleic acids: v i r a l DNA molecules, i n CRC handbook of biochemistry, selected for molecular biology, (ed. Sober, H.A.) The Chemical Rubber Company, Cleveland. McClure, W.R., Cech, C.L. and Johnston, D.E. (1978). A steady state assy for the RNA polymerase i n i t i a t i o n reaction. J . B i o l . Chem. 253:8941-8948. McClure, W.R. (1980). Rate-limiting steps i n RNA chain i n i t i a t i o n . Proc. Natl. Acad. S c i . U.S.A. 77:5634-5638. McClure, W.R., (1985). Mechanism and control of transcription i n i t i a t i o n i n prokarotes. Ann. Rev. Biocem. 5_4:171-204. M i l l e r , J.S. and Burgess, R.R. (1978). S e l e c t i v i t y of RNA chain i n i t i a - t i o n i n v i t r o . 3. Variables affecting i n i t i a t i o n of transcription. Biochem. 17:2064-2069. Moran, C P . and Bott, K.F. (1979). Restriction enzyme analysis of Bac i l l u s s u b t i l i s ribosomal nucleic acid. J Bacteriol 140:99-105. 159 Musso, R.E., DiLauro, R.r Adhya, S. and deCrombrugghe, C. (1977). Dual con t r o l for t r a n s c r i p t i o n of the galactose operon by c y c l i c AMP and i t s receptor p r o t e i n at two interspersed promoters. C e l l 12:847- 854. Muto, A. (1978). Control of ribosomal RNA synthesis i n Escherichia c o l i IV. Frequency of t r a n s c r i p t i o n of ribosomal RNA genes as a function of growth rate. Mol. Gen. Genet. 164:39-44. Muto, A. (1981). Control of ribosomal RNA synthesis i n Escherichia c o l i V. Stimulation of rrnC. Gene t r a n s c r i p t i o n i n v i t r o by a protein f a c t o r . Mol. Gen. Genet. 181:69-73. N i e r l i c h , D.P. (1978). Regulation of b a c t e r i a l growth, RNA and protein synthesis. Ann. Rev. M i c r o b i o l . 32:393-432. Nomura, M., Gourse, R. and Baughman, G. (1984). Regulation of the synthesis of ribosomes and ribosomal components. Ann. Rev. Biochem. 53:75-117. Nomura, M., Bedwell, D.M., Yamagishi, M., Cole, J.R. and Kolb, J.M. (1986). i n RNA polymerase and the regulation of t r a n s c r i p t i o n (eds. Reznikoff, W., et a l . ) E l s e v i e r Science Publishing Co., New York. Olson, M.V., Montgomery, D.L., Hopper, A.K., Page, G.S., Horodyski, F. and H a l l , B.D. (1977). Molecular c h a r a c t e r i z a t i o n of the tyrosine tRNA genes of yeast. Nature (London) 267:639-641. Oostra, B.A., Ab, G. and Gruber, M. (1980). S p e c i f i c stimulation of ribosomal RNA synthesis i n E. c o l i by a protein f a c t o r . Mol. Gen. Genet. 177:291-295. P a l e f s k i , S.,. Hemphill, H.E., Kolenbrander, P.E. and Whiteley, H.R. (1972). Dominance r e l a t i o n s h i p s i n mixedly inf e c t e d B a c i l l u s s u b t i l i s . J . V i r o l . 9:594-601. Petho, A., B e l t e r , J . , Boros, I. and Venetianer, P. (1986). The r o l e of upstream sequences i n determining the strength of an rRNA promoter i n E. c o l i . Biochim. Biophys. Acta. 866:37-43. P i r r o t a , V. and Ptashne, M. (1969). I s o l a t i o n of the 434 phage repressor. Nature (London) 222:541-544. 160 Prosen, D.E. and Cech, C.L. (1985). Bacteriophage T7-E promoter: I d e n t i f i c a t i o n and measurement of k i n e t i c s of as s o c i a t i o n with Escherichia c o l i RNA polymerase. Biochem. 24:2219-2227. Price, V.L., and Gallant, J.A. (1983). B a c i l l u s s u b t i l i s r e lG mutant: defect i n glucose uptake. J . B a c t e r i o l . 153:270-273. Quann, CD., Pandak, H. and Vermenlen, CW. (1980). Isopycnography on in t a c t c e l l s — I I I : Concentration of ribosomes i n Escherichia c o l i versus growth rate. Biochem. Biophys. Res. Commun. 97:520- 523. Riesbig, R.R., Woody, A.-Y. M. and Woody, R.W. (1979). Stereoscopic analysis of the i n t e r a c t i o n of Escherichia c o l i DNA-dependent RNA polymerase with T7 DNA and synthetic polynucleotides. J . B i o l . Chem. 254:11208-11217. Rodin, A.G. (1972). Methods i n aquatic microbiology translated by Colwell, R.R. and Zambruski, M.S. University Press, Baltimore, Maryland. Ryals, J . , L i t t l e , R. and Bremer, H. (1982). Control of rRNA and tRNA synthesis i n Escherichia c o l i by guanosine tetraphosphate. J . B a c t e r i o l . 151:1261-1268. Sandermann, H. J r . and Strominger, J.L. (1972). P u r i f i c a t i o n and properties of C55-isoprenoid alcohol phosphokinase from Staphylococcus aureus. J . B i o l . Chem. 247:5123-5131. Sarmientos, P. and Cashel, M. (1983). Carbon starvation and growth r a t e - dependent regulation of the Escherichia c o l i ribosomal RNA promoters: D i f f e r e n t i a l c o n t r o l of dual promoters. Proc. N a t l . Acad. S c i . U.S.A. 80:7010-7013. Sarmientos, P., Sylvester, J.E., Contente, S. and Cashel, M. (1983). D i f f e r e n t i a l stringent control of the tandem E. c o l i ribosomal RNA promoters from the rrnA operon expressed i n v i t r o i n multicopy plasmids. C e l l 32:1337-1346. Schaechter, E., Maaloe, 0. and Kjeldgaard, N.O. (1958). Dependence on medium and temperature of c e l l s i z e and chemical composition during balanced growth of Salmonella typhimurium. J . Gen. M i c r o b i o l . 19:592-606. 161 Schleif, R. (1967). Control of the production of ribosomal protein. J . Mol. B i o l . 27:41-55. Shepherd, N.S., Churchward, G., and Bremer, H. (1980). Synthesis and a c t i v i t y of ribonucleic acid polymerase i n Escherichia c o l i . J . Bac t e r i o l . 141:1098-1108. Siebenlist, U. (1979). RNA polymerase unwinds an 11-base pair segment of phage T7 promoter. Nature 279:651-652. Silverman, M. and Simon, M. (1973). Genetic analysis of bacteriophage Mu-induced f l a g e l l a mutants i n Escherichia c o l i . J . Bac t e r i o l . 116:114-122 Singer, P. and Wu, C.-W. (1987). Promoter search by Escherichia c o l i RNA polymerase on c i r c u l a r DNA template. J . B i o l . Chem. 262:14178- 14189. Sogin, M.L. Pace, B. and Pace, N.R. (1977). P a r t i a l p u r i f i c a t i o n and properties of a ribosomal RNA maturation endonuclease from Bacillus s u b t i l i s . J B i o l Chem 252:1350-1357. Spassky, A., Kirkegaard, K. and Buc, H. (1985). Changes i n the DNA structure of the lacUV5 promoter during formation of an open complex with Escherichia c o l i RNA polymerase. Biochem. 24:2723- 2731. Spiegelman, G.B. and Whiteley, H.R. (1974). P u r i f i c a t i o n of ribonucleic acid polymerase from SP82-infected Ba c i l l u s s u b t i l i s . J . B i o l . Chem. 249:1476-1482. Stefano, J.E. and Gralla, J.D (1979). LacUV5 transcription i n v i t r o . Rate l i m i t a t i o n subsequent to formation of an RNA polymerase-DNA complex. Biochem. 18:1063-1067. Stefano, J.E. and Gralla, J.D. (1980). Kinetic investigation of the mechanism of RNA polymerasebinding to mutant lac promoters. J . B i o l . Chem. 255:10423-10430. Stefano, J.E. and Gra l l a , J.D. (1982). Mutation-induced changes i n RNA polymerase-lac p s promoter interactions. J. B i o l . Chem. 257:13924- 13929. 162 S t e w a r t , G. and B o t t , K. ( 1 9 8 3 ) . DNA sequence o f t h e tandem r i b o s o m a l RNA p r omoter f o r B. s u b t i l i s o p e r o n r r n B . Nuc. A c i d s Res. 11:6289- 6300. S t r a n e y , D.C. and C r o t h e r s , D.M. ( 1 9 8 7 ) . A s t r e s s e d i n t e r m e d i a t e i n t h e f o r m a t i o n of s t a b l y i n i t a t e d RNA c h a i n s a t t h e E s c h e r i c h i a c o l i l acUV5 p r o m o t e r . J . M o l . B i o l . 193:267-278. S t r a n e y , S.B. and C r o t h e r s , D.M. ( 1 9 8 7 ) . K i n e t i c s o f t h e s t a g e s o f t r a n s c r i p t i o n i n i t i a t i o n a t t h e E s c h e r i c h i a c o l i lacUV5 p r o m o t e r . Biochem. 26:5063-5070. S z y b a l s k i , W. ( 1 9 6 8 ) . Use o f c e s i u m s u l f a t e f o r e q u i l i b r i u m d e n s i t y g r a d i e n t c e n t r i f u g a t i o n . I n : Grossman L. and M oldave, K. ( e d s . ) Methods i n enzymology, v o l X I I B . N u c l e i c A c i d s . Academic P r e s s , New Y o r k , pp 330-360. Takebe, Y., M i u r a , A., B e d w e l l , D.M., Tam. M. and Nomura,M. ( 1 9 8 5 ) . I n c r e a s e d e x p r e s s i o n o f r i b o s o m a l genes d u r i n g i n h i b i t i o n o f r i b o s o m e assembly i n E s c h e r i c h i a c o l i . J . M o l . B i o l . 184:23-30. T a l k i n g t o n , C. and P e r o , J . ( 1 9 7 9 ) . D i s t i n c t i v e n u c l e o t i d e sequence of p r o m o t e r s r e c o g n i z e d by RNA p o l y m e r a s e c o n t a i n i n g a phage-encoded " s i g m a - l i k e " p r o t e i n . P r o c . N a t l . Acad. S c i . U.S.A. 76:5465-5469. T j i a n , R. and P e r o , J . ( 1 9 7 6 ) . B a c t e r i o p h a g e SP01 r e g u l a t o r y p r o t e i n s d i r e c t i n g l a t e gene t r a n s c r i p t i o n i n v i t r o . N a t u r e 262:753-757. T r a v e r s , A.A. ( 1 9 7 6 ) . RNA p o l y m e r a s e s p e c i f i c i t y and t h e c o n t r o l o f g r o w t h . N a t u r e 263:641-646. T r a v e r s , A.A., B u c k l a n d , R. and Debenham, P.G. ( 1 9 8 0 ) . F u n c t i o n a l h e t e r o g e n e i t y of E s c h e r i c h i a c o l i r i b o n u c l e i c a c i d p o l y m e r a s e holoenzyme. Biochem. 19:1656-1662. T r a v e r s , A.A., Lamond, A . I . , Mace, H.A.F. and Berman, M.L. ( 1 9 8 3 ) . RNA p o l y m e r a s e i n t e r a c t i o n s w i t h t h e upstream r e g i o n o f t h e E. c o l i t y r T p r o m o t e r . C e l l 35:265-273. T r a v e r s , A.A. ( 1 9 8 7 ) . S t r u c t u r e and f u n c t i o n of E. c o l i p romoter DNA. CRC C r i t i c a l Rev. i n Biochem. 22:181-219. 163 W a l t e r , G., Z i l l i g , W., Palm, P. and F u c h s , E. ( 1 9 6 7 ) . I n i t i a t i o n o f DNA-dependent RNA s y n t h e s i s and t h e e f f e c t o f h e p a r i n on RNA p o l y m e r a s e . E u r . J . Biochem. 3:194-201. Webb, V., Leduc, E. and S p i e g e l m a n , G.B. ( 1 9 8 2 ) . B u r s t s i z e o f b a c t e r i o p h a g e SP82 as a f u n c t i o n o f growth r a t e o f i t s h o s t B a c i l l u s s u b t i l i s . Can. J . M i c r o b i o l . 28:1277-1280. Widom, R. L., J a r v i s , E.D., L a F a u c i , G. and Rudner, R. ( 1 9 8 8 ) . I n s t a b i l i t y o f rRNA operons i n B a c i l l u s s u b t i l i s . J . B a c t e r i o l . 170:605-610. W i l l i a m s , D.E., J a c k s o n , J.M. I l l , and Chaney, S.G. ( 1 9 8 3 ) . C h a r a c t e r i z a t i o n o f RNA s y n t h e s i s i n an E s c h e r i c h i a c o l i mutant w i t h a t e m p e r a t u r e - s e n s i t i v e l e s i o n i n s t a b l e RNA s y n t h e s i s . J . B a c t e r i o l . 153:616-626. Wu, C.-W., H i l l e l , Z. and P a r k , C S . ( 1 9 8 3 ) . A r a p i d m i x i n g - phot c r o s s l i n k i n g t e c h n i q u e t o s t u d y t h e dynamics o f n u c l e i c a c i d - p r o t e i n i n t e r a c t i o n s . A n a l Biochem. 128:481-489. Y e h l e , C O . and D o i , R.H. ( 1 9 6 7 ) . D i f f e r e n t i a l e x p r e s s i o n of ' b a c t e r i o p h a g e genomes i n v e g e t a t i v e and s p o r u l a t i n g c e l l s o f B a c i l l u s s u b t i l i s . J . V i r o l . 1:935-947. Y u r a , T. and I s h i h a m a , A. ( 1 9 7 9 ) . G e n e t i c s o f b a c t e r i a l RNA p o l y m e r a s e s . Ann. Rev. Genet. 13:59-97. Z e n g e l , J.M. and L i n d a h l , L . ( 1 9 8 6 ) . T r a n s c r i p t i o n of r i b o s o m a l genes d u r i n g a n u t r i t i o n a l s h i f t - u p o f E s c h e r i c h i a c o l i . J . B a c t e r i o l . 167:1095-1097. 164

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
China 22 3
France 4 0
United States 3 1
Japan 3 0
City Views Downloads
Beijing 22 0
Unknown 4 1
Tokyo 3 0
Mountain View 2 1
Ashburn 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}

Share

Share to:

Comment

Related Items