UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Essential genes in the rif region of the Escherichia coli chromosome Downing, Willa Lee 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1989_A1 D69.pdf [ 10.54MB ]
Metadata
JSON: 831-1.0098278.json
JSON-LD: 831-1.0098278-ld.json
RDF/XML (Pretty): 831-1.0098278-rdf.xml
RDF/JSON: 831-1.0098278-rdf.json
Turtle: 831-1.0098278-turtle.txt
N-Triples: 831-1.0098278-rdf-ntriples.txt
Original Record: 831-1.0098278-source.json
Full Text
831-1.0098278-fulltext.txt
Citation
831-1.0098278.ris

Full Text

ESSENTIAL GENES IN T H E RTF REGION OF T H E ESCHERICHIA COLI C H R O M O S O M E . b x • S ' Wi l l a Lee Downing Hon . B.Sc., University of Western Ontario, 1976. Diploma (Painting), Emi ly Carr College of Ar t and Design, 1982. A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S FOR T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y in T H E F A C U L T Y O F G R A D U A T E STUDIES D E P A R T M E N T O F B I O C H E M I S T R Y We accept this thesis as conforming to the required standard T H E UNIVERSITY O F BRITISH C O L U M B I A October 1989 © Wil la Lee Downing, 1989 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of £ t Q CHaM'S ~f&_ y The University of British Columbia Vancouver, Canada DE-6 (2/88) ABSTRACT Regulation of the contiguous secE-nusG and rplKATL-rpoBC operons, found i n the rif region at 90 minutes on the Escherichia coli chromosome, was examined. SecE protein is important in protein export. N u s G protein is involved i n transcription antitermination. The rplKATL-rpoBC gene cluster encodes, respectively, the four 50S subunit ribosomal proteins L l l , L I , L10 and LI2 , and the p and B' subunits of R N A polymerase. The nucleotide sequences of the secE and nusG genes were determined and their transcripts were analyzed by primer extension and SI nuclease mapping. The two genes are cotranscribed, with transcripts initiated at the PEG promoter and terminated at the Rho-independent terminator overlapping the P U 1 promoter. The majority of transcripts are processed i n the 5' untranslated leader region by RNase l l l and possibly by a second unidentified nuclease. Transcripts from the rplKATL-rpoBC gene cluster were quantitated by filter hybridization and their ends mapped by SI nuclease protection. The most abundant transcript was the 2600 nucleotide tetracistronic L11-L1-L10-L12 m R N A initiated at the P L U promoter and terminated at the attenuator in the L12-B intergenic space. Less abundant 1300 nucleotide L l l - L l and L I 0-L12 bicistronic transcripts were also observed. Two 5' ends for the L10-L12 bicistronic m R N A were located, one at the P L 1 0 promoter and the other 150 nucleotides downstream of P L 1 0 , i n a region where no promoter activity has been detected. About 80% of the transcripts were terminated at the attenuator; transcripts reading through the attenuator were partially processed by RNaseDI. N o other major 5' ends were observed i n the L12-B intergenic region. Dur ing restriction of R N A polymerase activity, transcriptional disruption of rp lKATL and rpoBC results mainly from modulation i n the frequency of initiation at P L 1 i and P L 1 0 promoters, and termination and antitermination at the attenuator. i i i The rplTL transcript leader region is thought to mediate regulation of L10 and L I 2 synthesis by folding into a translationally closed or open secondary structure (T. Christensen, M . Johnsen, N . P . F i i l and J.D. Friesen (1984) E M B O J. 3, 1609-1612). Point mutants in the leader m R N A were created by site-directed mutagenesis and analyzed in an in vitro translation assay. Preliminary results suggest that alternative secondary or higher order R N A interactions may be involved. i v TABLE OF CONTENTS List of Tables v i List of Figures . . . • • v i i Abbreviations v i i i Acknowledgements • • • x I. GENERAL INTRODUCTION 1 1.1 Regulation of Ribosome Synthesis in Escherichia coli . '. 1 1.1.1 Background and perspective 1 1.1.2 Regulation of r R N A synthesis . 4 1.1.3 Regulation of r-protein synthesis 7 1. Translational feedback regulation 7 2. Transcriptional regulation 9 1.2 Purpose of This Work - General Overview : • • • • H II. MATERIALS A N D M E T H O D S 13 2.1 Bacterial strains and plasmid constructions 13 2.2 Media and culture conditions . 13 2.3 General techniques of molecular biology 13 2.3.1 Preparation of plasmid D N A 13 2.3.2 Restriction endonuclease digestion of D N A 15 2.3.3 Ge l electrophoresis 15 2.3.4 D N A restriction fragment preparation . . . . 15 2.3.5 Ligations 1 5 2.3.6 Transformations : 16 2.3.7 Blunt-ending recessed 3' ends 16 2.3.8 3' End-labelling of D N A fragments 16 2.3.9 5' End-labelling of D N A fragments 16 2.3.10 5' End-labelling of oligonucleotides 17 2.3.11 Labelling D N A fragments by nick-translation 17 2.4 Preparation of single-stranded D N A . 17 2.4.1 From M13 phage recombinants 17 2.4.2 From p E M B L recombinants 17 2.5 D N A sequencing 18 2.6 Preparation of total cellular R N A 19 2.6.1 General method 19 2.6.2 Preparation of R N A of temperature-sensitive mutants 19 2.7 R N A analysis . . . . 20 2.7.1 Sucrose gradient fractionation 20 2.7.2 Filter hybridization 20 2.7.3 R N A electrophoresis and Northern hybridization analysis . 21 2.7.4 SI nuclease mapping . , 22 V 2.7.5 Primer extension • 22 2.7.6 m R N A stability 23 2.8 Oligonucleotide-directed mutagenesis • • • 24 2.8.1 Construction of cloning vector pEMBL8 + (BII) . 24 2.8.2 Oligonucleotides for mutagenesis 25 2.8.3 Construction of mutant plasmid derivatives 25 2.9 In vitro assay of mutant plasmids 27 III. S T U D I E S O F T H E secE-nusG G E N E C L U S T E R . 29 3.1 Introduction , 29 3.2 Results and Discussion 31 3.2.1 Sequence analysis of secE-nusG 31 3.2.2 Transcript mapping 35 I V . S T U D I E S O F T H E r p l K A T L - r p o B C G E N E C L U S T E R 41 4.1 Introduction • 41 4.2 Results and Discussion > 49 4.2.1 Transcriptional pattern of the rplKATL-rpoBC gene cluster 49 1. Filter hybridization . • • 49 2. Size fractionation of R N A transcripts 49 3. SI nuclease mapping . 53 (a) the N u s G - L l l intergenic region 54 (b) the L1-L10 intergenic region 57 (c) the L10-L12 intergenic region . 63 (d) the L12-P intergenic region 65 4.2.2 Differential regulation of rp lKATL and rpoBC 71 1. Filter hybridization 72 2. S i nuclease mapping 75 3. Transcript stability 84 4.2.3 Translational point mutants in the rplTL leader region 90 V . S U M M A R Y 106 R E F E R E N C E S 109 LIST OF TABLES Table 1 Bacterial strains and plasmids. . 14 Table 2 Single and double base mutants of the L10 leader, region. 28 Table 3 Hybridizat ion of pulse-labelled C600 R N A to specific D N A probes 48 Table 4 Filter hybridization of pulse-labelled R N A s isolated from strains XH56, NF536 and NF537 . 73-74 Table 5 In vitro translation assay of mutant plasmids : translational levels of rplKATL. . . 101 Vll LIST OF FIGURES Fig. 1 The Escherichia coli ribosome 2 Fig. 2 Location of r R N A and r-protein genes on the E. coli genetic map. . 3 Fig. 3 Genetic organization of the secE-nusG gene cluster 30 Fig. 4 Nucleotide sequence of secE-nusG genes. 32-33 Fig. 5 Transcript mapping by primer extension and SI nuclease protection 36 Fig. 6 Genetic organization of rplKATL-rpoBC. . 42-43 Fig. 7 Positions of r-proteins L l l , L I , L10 and L12 on the E. coli large ribosomal subunit ; 44 Fig. 8 Sedimentation analysis of total R N A . . . . , 50 Fig. 9 Northern hybridization analysis of L l l - L l and L10-L12 m R N A 52 Fig. 10 Nuclease SI mapping of transcript ends derived from the N u s G - L l l intergenic region. . . 55-56 Fig. 11 Nuclease SI mapping of transcript ends derived from the L1-L10 intergenic region . 58-59 Fig. 12 Nuclease SI mapping of transcript ends derived from the L12-P intergenic space. 66-67 Fig. 13 Differential transcriptional regulation of rp lKATL and rpoBC; nuclease mapping of transcript ends derived from the L12-P intergenic region 77 Fig. 14 Transcript end sites i n the L12-p intergenic region 78 Fig. 15 Nuclease SI analysis of stability of rplKATL-rpoBC transcripts i n the mutant XH56. . 85-86 Fig. 16 Decay of rplKATL-rpoBC transcripts in the mutant XH56, 88-89 Fig. 17 Construction of plasmid derivatives carrying single and double point mutations i n the L10-L12 m R N A leader 93 Fig. 18 Partial sequences of single base and double base point mutations i n the L10-L12 m R N A leader region. 94-95 Fig. 19 Positions of point mutations in the L10-L12 m R N A leader region; possible secondary structures as proposed by Christensen et al. (1984). . . . . . . . . 97-99 Fig. 20 S D S - P A G E of In vitro translation assay of mutant plasmids. 100 v i i i ABBREVIATIONS A adenosine A^jo absorbance at 460 n m (or other wavelength) A T P adenosine triphosphate bp base pair(s) C cytosine cpm counts per minute d C T P deoxycytidine triphosphate ddTTP dideoxythymidine triphosphate D N A deoxyribonucleic acid d N T P deoxynucleoside triphosphate d p m disintegrations per minute DTT dithiothreitol dTTP deoxythymidine triphosphate E D T A ethylene diamine tetraacetic acid G guanosine G T P guanosine triphosphate h hour(s) K A N kanamycin resistance cassette kb kilobases L I , L2 ... proteins from the large ribosomal subunit m.o.i. multiplicity of infection m A milliamperes Met methionine m i n minute(s) m R N A messenger R N A N X-encoded antitermination factor N A D nicotinamide adenine dinucleotide P A G E polyacrylamide gel electrophoresis ppGpp guanosine 5',3'-bis(diphosphate) rif rifampicin r-protein ribosomal protein R N A ribonucleic acid RNase ribonuclease rpm revolutions per minute r R N A ribosomal R N A S Svedberg unit of sedimentation coefficient s.a. specific activity S i , S2 ... proteins from the small ribosomal subunit SDS sodium dodecyl sulphate T - •. • thymidine TE 10 m M Tris-Cl (pH7.5), 1 m M E D T A Tris tris-(hydroxymethyl)amino methane t R N A transfer R N A ts temperature sensitive U uridine V volts W watts wt w i l d type X-gal 5Tbromo-4-chldro-3-indolyl-fJ-D-galactoside X A C K N O W L E D G E M E N T S I wish to thank Deidre de Jong Wong for her technical assistance and Pat Dennis for providing me the opportunity to work i n his laboratory. Thanks go to a l l my fellow students i n the lab for discussions on everything; their friendship was appreciated. Special thanks go to Lawrence Shimmin for sharing, wi th great patience and generosity, his tremendous technical expertise. Also , his love for science is an inspiration in itself. It was a joy to work wi th Craig Newton; his joie de vivre was contagious. I also wish to thank Joan McPherson for her friendship. M y gratitude goes to P. Bonnard and R . H . van Rijn for reminding me what is important. Thanks also go to A n n Nelson and Trish Shwart for their friendship and for keeping the Muse alive. Most of al l , I wish to thank Rod, whose unconditional support has made all this possible. I. GENERAL INTRODUCTION 1 1.1 R E G U L A T I O N O F RIBOSOME SYNTHESIS I N E S C H E R I C H I A C O L I 1.1.1 B A C K G R O U N D A N D PERSPECTIVE The Escherichia coli ribosome is a complex subcellular organelle comprised of three ribosomal R N A molecules ( rRNA) and 52 different ribosomal proteins (r-proteins). A 70S particle, the ribosome is composed of a small 30S subunit which includes 21 ribosomal proteins and 16S r R N A , and a large 50S subunit which has 31 r-proteins and 23S and 5S r R N A s (fig. 1). Except for r-protein L I 2, which exists in four copies, each r-protein and each r R N A is found in one copy per ribosome. Ribosomal protein genes, each found in a single copy per genome, are organized into at least 20 operons scattered throughout the K coli chromosome. Some of these bperons also contain genes essential for (i) D N A replication, such as dnaG ( D N A primase), (ii) transcription, such as rpoA, rpoBC and rpoD encoding R N A polymerase subunits a, P, p' and O70 respectively, (iii) translation, such as tufA (EF-TuA) and fusA (EF-G) and (iv) protein export, such as secY (secY) (fig. 2). There are seven operons for r R N A i n E. coli. Each operon encodes a precursor transcript which upon processing generates 16S, 23S and 5S r R N A , as wel l as several t R N A species. During exponential growth, the synthesis of ribosomal components is under growth rate-dependent control such that the cellular ribosome concentration increases wi th increasing growth rate and corresponds to the amount necessary to sustain a given level of translation. 1. Introduction 2 ( a ) ( b ) ( c ) .FIGURE 1. The Escherichia coli ribosome. Three different arrangements of the E. coli ribosome from analysis of electron micrographs are shown. The hatched shape represents the 30S small subunit; the unmarked form represents the 50S large subunit. (a) The " U C L A " model (b) The "Nutley" model (c) The "Berlin" model. (Illustration taken from Liljas, 1982.) 1. Introduction 3 .FIGURE 2. Location of r R N A and r-protein genes on the Escherichia coli genetic map. Genes for r-proteins are represented by the protein product. The directions of transcription of the operons, when known, are indicated by arrows. The origin of replication (oriC) is situated at 84 minutes. (Figure taken from Nomura et al. , 1984) 1. Introduction 4 A s well , the synthesis of most or a l l r-proteins are coordinated/ and stoichiometrically regulated to match the levels they represent in complete ribosomes, wi th little excess r-protein and r R N A production. Thus the control of ribosome synthesis in R coli presents two major challenges : to coordinate the synthesis of the various ribosomal components and to balance the synthesis of these components wi th the growth requirements of the cell (Reviews : Jinks-Robertson and Nomura, 1987; Nomura et al., 1984; Lindahl and Zengel, 1986). 1.1.2 R E G U L A T I O N O F r R N A SYNTHESIS Theories of transcriptional regulation of r R N A operons have been formulated in light of two classical regulatory phenomena : growth rate-dependent control and stringent control. Dur ing exponential growth, ribosome synthesis is correlated to growth rate; this relationship has been described above. Under this growth condition, the synthesis of the individual r R N A and r-protein components is coordinately controlled and there is no significant turnover of these components or build-up of pools of free components. However, during periods of amino acid starvation, the stringent response is evoked. The stringent response involves a complex set of physiological changes in exponentially growing E. coli when aminoacylated t R N A becomes the l imiting factor in protein synthesis. This starvation response can result from amino acid deprivation or inactivation of an aminoacyl-tRNA synthetase. The cellular changes are diverse and include a dramatic decrease i n the synthesis of all ribosomal components and a concomitant accumulation of guanosine tetraphosphate (ppGpp) as wel l as other unusual nucleotides. There is growing evidence that ppGpp is the major regulatory signal during the stringent response and that its targets are at both the post-translational level and at the level of 1. Introduction 5 transcription initiation. There appear to be two pathways of ppGpp synthesis. During amino acid starvation, formation of ppGpp is a relA-dependent reaction which occurs on idl ing ribosomes. Stringent relA* strains exhibit the stringent response whereas relaxed relA' strains continue to synthesize stable R N A s ( rRNAs and tRNAs) and r-proteins under aminoacyl-t R N A starvation conditions. In addition, there is an ill-defined relA-independent pathway for ppGpp synthesis which occurs during exponential growth. The spoT gene product, responsible for the degradation of ppGpp, is thought to be part of this relA-independent pathway. The stringent response is probably integrated with other global responses (e.g. heat shock response) (review : Cashel and Rudd, 1987). The ribosome feedback regulation model has been proposed by Nomura to explain the regulation of stable R N A synthesis under conditions of balanced growth. This model suggests that stable R N A synthesis is feedback regulated by non-translating or free ribosomes; however, there is no direct evidence that free ribosomes can interact with promoters to interfere with transcription. The concentration of free ribosomes is thought to be determined by the nutritional environment and thus can efficiently adjust the level of stable R N A (and hence ribosome) synthesis to environmental conditions. It is not known whether idle ribosomes act directly by blocking transcription or indirectly through the action of an effector (perhaps ppGpp), whose concentration reflects the level of free ribosomes (reviews : Jinks-Robertson and Nomura, 1987; Nomura et al., 1984; Lindahl and Zengel, 1986). During the stringent response, ppGpp has been suggested to be the effector i n regulating stable R N A expression. The mechanism of its action is still unclear. R N A polymerase is a target for ppGpp (Glass et al., 1987) and its promoter selectivity for r-protein and stable R N A promoters is modulated by direct interaction wi th ppGpp (Ishihama 1. Introduction 6 et al., 1987). Therefore, it appears that ppGpp interacts wi th R N A polymerase and alters the equilibrium between two (or more) forms of the enzyme, one which has a specificity for r-protein and stable R N A promoters and one which does not, as first proposed by Travers (1976), Travers et al . (1980). Also , Travers and co-workers have suggested that stringently regulated stable R N A promoters (and probably r-protein promoters; see below) are distinguished from non-stringent promoters by a GC-r ich "stringent discriminator" sequence between the -10 Pribnow box and the initiating nucleotide (Travers 1980, 1984). However, questions concerning the significance of the discriininator sequence in stringent control have been raised by Yamagishi et al. (1987). Alternatively, Bremer and colleagues have argued that the conventional distinction between growth rate control and stringent control is unfounded. The relationship between the rate of stable R N A synthesis relative to the rate of total R N A synthesis (r 8/r t) and the concentration of ppGpp can be described by a single function which applies to exponential growth or amino acid deprivation conditions and which is independent of the re lA allele (Ryals et al., 1982). This implies that ppGpp is the major, if not only, effector in regulation of stable R N A gene activity and that growth rate control and stringent control should be considered as one phenomenon differing only i n extent (Cashel and Rudd, 1987). Nucleotide ppGpp appears not to be determined directly by the growth medium but by the rate at which the cell can generate the substrates for protein synthesis. Since ribosomes starved of aminoacyl-tRNAs are the sites of ppGpp synthesis, one possibility is that the level of free ribosomes determines the level of ppGpp which then establishes the promoter preference of R N A polymerase by adjusting the equilibrium between the two forms of R N A polymerase (reviews : Jinks-Robertson and Nomura, 1987; Nomura et al., 1984; Lindahl and Zengel, 1986). 1. Introduction 7 1.1.3 R E G U L A T I O N O F r -PROTEIN SYNTHESIS 1. Translational feedback regulation Regulation of r-protein synthesis can be exercised at both the transcriptional and translational levels. A t the translational level, much is now known about the molecular mechanisms involved i n control of r-protein production, at least for the major r-protein gene clusters located at 73 and 90 minutes on the E. coli chromosome (fig. 2). To explain the phenomenon of coordinated and balanced synthesis of the various r-proteins, the translational feedback model was proposed. According to this model, the synthesis of r-proteins is coupled wi th the assembly of ribosomes. Briefly, each r-protein operon encodes a bifunctional regulatory protein; this ribosomal protein can either be incorporated into assembling ribosomes or, in the absence of an adequate supply of r R N A , can bind to a site on its own m R N A and prevent further translation (reviews : Jinks-Robertson and Nomura, 1987; Nomura et al., 1984; Lindahl and Zengel, 1986). However, recent studies on the t rmD operon have shown that r-protein synthesis from this operon is not translationally feedback regulated; Wikstrom et al. (1988) have proposed that r-protein operons which do not encode proteins that b ind directly to r R N A are not under autogenous control. The control mechanisms for regulation of expression of these r-proteihs have yet to be determined; some possibilities are protein degradation and metabolic regulation at the transcriptional level (Wikstrom et al., 1988). Autogenous translational control was first described for the regulation of gene 32 expression in bacteriophage T4 (Lemaire et al., 1978). Subsequently, translational feedback regulation has been discovered to control the expression of a variety of E. : coli genes 1. Introduction 8 including secA (Schmidt and Oliver, 1989), thrS (threonyl-tRNA synthetase) (Springer et al., 1985) and ksgA (a methyltransferase) (van Gemen et al., 1989). Many r-proteins have now been identified as "translational repressors" which selectively inhibit the synthesis of some or al l of the r-proteins whose genes are in the same operon as the repressor r-protein. For example, r-proteins S7, L I , L10, S8 and S4 are the translational repressors of the str, L l l ( rp lKA), L10 (rplTL), spc and alpha operons, respectively (reviews : Jinks-Robertson and Nomura, 1987; Nomura et al., 1984; Lindahl and Zengel, 1986). The regulatory protein presumably interacts with its m R N A and the corresponding r R N A by recognizing similar regulatory sites predicted by sequence homologies (Nomura et al., 1980; Olins and Nomura , 1981; Johnsen et al., 1982; Deckman and Draper, 1985). Recent detailed studies on regulatory protein binding sites support this proposition ( L l l : Thomas and Nomura, 1987, Said et al., 1988; S8 : Gregory et al.,1988 Cerretti et al., 1988; S20 : Parsons et al., 1988). The regulatory sites are usually situated i n the leader region of the m R N A . However, in the str (Dean et al.,1981) and s jx (Olins and Nomura, 1981) operons, the binding sites are located i n an intergenic region. In most cases, the binding site on the messenger begins close to the initiation codon, but i n the L10 operon it is found more than 100 nucleotides upstream (Johnsen et al., 1982). Translational coregulation of genes i n the same operon by r-protein binding at a single site is l ikely achieved by translational coupling, a phenomenon first demonstrated in the tryptophan operon by Oppenheim and Yanofsky (1980). When two genes are translationally coupled, efficient translation of a downstream gene requires prior translation of the preceding gene. Experimental evidence for this has been demonstrated for the L l l 1. Introduction 9 operon (Baughman and Nomura, 1983; Sor et al , 1987), the stjc operon (Mattheakis and Nomura, 1988), the S10 operon (Lindahl et al., 1989) and the alpha operon (Thomas et al., 1987), Thus for certain r-protein operons, translational feedback regulation and translational coupling insure that r-protein synthesis is coordinated to each other and adjusted to r R N A synthesis. 2. Transcriptional regulation A s in the case of r R N A operons, transcriptional regulation of r-protein genes has been argued to be involved i n growth rate (Little et al , 1981; Little and Bremer, 1984; Dennis, 1977a) and stringent control of r-protein synthesis (Dennis and Nomura, 1974; Maher and Dennis, 1977). Again , free ribosomes and/or ppGpp have been postulated as negative effectors of r-protein synthesis. The translation feedback loop may be superimposed on transcriptional control to determine the final rate of r-protein synthesis (reviews : Jinks-Robertson and Nomura, 1987; Nomura et al., 1984; Lindahl and Zengel, 1986). There appears to be more than one strategy to achieve growth rate-dependence and stringent regulation of r-protein synthesis. Unique among R coli r-protein operons, the synthesis of r-proteins in the S10 operon is controlled by feedback regulation by L4 both at the transcriptional (Freedman et al., 1987; Lindahl et al., 1983; Lindahl and Zengel, 1979) and translational levels (Freedman et al., 1987; Yates and Nomura, 1980). The binding of excess L4 not only stimulates transcription termination (attenuation) within the S10 m R N A leader, but also inhibits translation of the polycistronic m R N A . L4-mediated transcriptional and translational regulation share some sequence requirements but the two processes recognize different features of the S10 leader. Stringent control is accomplished at the level of transcription initiation only. However, growth medium-dependent control involves 1. Introduction 10 regulation of both transcription initiation and transcription read-through at the attenuator (Freedman et al.,1985). In contrast, studies involving r-protein promoter fusions to galK or lacZ indicate that the characteristic increase i n r-protein synthesis with increasing growth rate is determined not by transcriptional processes but by post-transcriptional ones (Miura et al.,1981). A s further support for this, Cole and Nomura (1986b) have argued that translational regulation is solely responsible for growth rate-dependent and stringent control of the synthesis of r-proteins L l l and L I . A base substitution mutation i n the repressor binding site of the L l l operon abolishes not only autogenous translational control but also both growth rate regulation and stringent control. Alternatively, as suggested by results of pulse-labelled R N A experiments, stringent regulation of r-protein synthesis was thought to function at the transcriptional level (Maher and Dennis, 1977). However, it is now known that translational feedback repression can cause selective inactivation of r-protein m R N A (Fallon et al., 1979; Singer and Nomura, 1985; Cole and Nomura, 1986a). Consequently, it is possible that the apparent change i n r-protein m R N A synthesis rates in these experiments was due to a decrease in m R N A half-life caused by feedback repression. Hence, stringent control of r-protein synthesis may be an indirect effect mediated by the translational feedback process. A s in the case of r R N A genes, the effects of ppGpp on r-protein gene activity have been examined. The competitive template assays of Kajitani and Ishihama (1984) have revealed ppGpp sensitivity of promoters upstream of the rpsA and rplT genes. Promoters of r-protein operons also contain the G C rich "stringent discriminator" sequence (see above), although its importance i n stringent regulation is now in doubt (Yamagishi et al.,1987). 1. Introduction 11 Attempts to examine ppGpp-dependent regulation of r-protein genes have produced unclear results because of other effects (e.g. polarity and R N A polymerase sink effects) which are superimposed on m R N A gene activities (Little and Bremer, 1984). In summary, the role of transcription i n the regulation of r-protein synthesis is still not clear. Unlike the translational feedback system which is now wel l characterized, the molecular mechanisms that control transcription of most r R N A and r-protein operons have not been elucidated. It may be too simplistic to assume that one or two sets of regulatory pathways can account for the regulation of a l l r R N A and r-protein operons under al l physiological conditions. 1.2 P U R P O S E O F THIS W O R K - G E N E R A L O V E R V I E W Genes encoding 31 of the 52 r-proteins are found at two major loci at 73 and 90 minutes on the E. coli chromosome (fig. 2). The rif region at 90 minutes contains the following organization of genes essential for transcription, translation and protein export : tufB, secE-nusG, and rplKATL-rpoBC. The tufB operon encodes four t R N A s and the transl-ation elongation factor EF-TuB; the D N A sequence of this operon has been determined and its transcripts have been partially analyzed (An and Friesen, 1980a; V a n Delft et al., 1987). The secE and nusG genes are co-cistronic and both are essential for cell viability. The SecE protein is an integral membrane protein and is a component of the protein export apparatus (Schatz et al., 1989). The N u s G protein is believed to be involved in transcription antitermination 0. Greenblatt, S. Sullivan and M . Gottesman, personal communication); its activity appears to be l inked to those of other Nus proteins such as N u s A , NusB and NusE. Because of the essential nature of secE and nusG i n cell viability and because of their 1. Introduction 12 grouping wi th other genes involved in translation and transcription, the first part of this thesis (chapter 3) is concerned wi th sequence and transcript analyses of this gene cluster .as an initial effort to understand the regulation of expression of the secE-nusG operon. Downstream, the rplKATL-rpoBC gene cluster encodes, respectively, the four 50S subunit ribosomal proteins L l l , L I , L10 and L12 , and the p and p' subunits of R N A polymerase; the nucleotide sequence of this gene cluster has been determined previously (Post et al., 1979) and much work has been done on the regulation of this cluster (review: Jinks-Robertson and Nomura, 1987). However, several regulatory features in rp lKAIL- rpoBC still require clarification, for a better understanding of the regulated synthesis of these ribosomal and R N A polymerase components. The second and greater part of this thesis (chapter 4) addresses regulatory mechanisms of the rplKATL-rpoBC gene cluster. Expanded introductions to the secE-nusG and rplKATL-rpoBC operons are found in chapters three and four respectively. II. MATERIALS A N D M E T H O D S 13 2.1 B A C T E R I A L STRAINS A N D P L A S M I D C O N S T R U C T I O N S The bacterial strains and plasmid constructions used in this work are described in table 1. 2.2 M E D I A A N D C U L T U R E C O N D I T I O N S Bacteria were grown exponentially either in YT media (5 g/1 Bacto-yeast extract, 8 g/1 Bacto-tryptone,. 5 g/1 N a C l , pH7.5) or i n M 9 minimal salts media (Miller, 1972) supplemented wi th glucose (0.2%), required amino acids (50 ug /ml) , thiamine (0.5 ug /ml ) and N A D (1 ug /ml ) when required, in a rotary shaker bath or air shaker. Growth was at 37°C unless otherwise stipulated for temperature sensitive strains. Bacterial growth was monitored by measuring absorbance at 460 nm. When required, antibiotic concentrations used were : ampicil l in (100 ug /ml) , tetracycline (15 ug /ml ) and kanamycin (50 ug/ml). 2.3 G E N E R A L T E C H N I Q U E S O F M O L E C U L A R B I O L O G Y General recombinant D N A techniques were carried out according to Maniatis et al. (1982) unless otherwise specified. 2.3.1 P R E P A R A T I O N O F P L A S M I D D N A Small scale preparation of plasmid D N A was done by the alkaline lysis method (p.368, Maniatis et al., 1982). Large scale preparation was carried out according to the lysozyme-SDS lysis method (pp. 92-94, Maniatis et al., 1982). 2. Materials and Methods 14 Table 1 Bacterial strains and Plasmids Strain Description C600 thr leu trp thi recA XH56 F his thi metB strA lac rpoC(ts) N2076 F thi a r g H l nad84 l acYl gal6 n a l A l V xyl7 ara!3 mtl2 str9 tonA2 rnc + (from D . Apir ion) N2077 F thi a r g H l nad84 l acYl gate n a l A l V xy]7 ara!3 mt!2 str9 tonA2 rnc!05 (from D . Apirion) NF536 leu valS(ts) r e L V NF537 leu valSfts) re lA N3431 H f r P O l r d l t h i l lacZ43 rne3071(ts) (from D. Apir ion) N3433 H f r P O l re l l th i l lacZ43 rne + (from D. Apirion) PD828 C600 / p B R U PD858 C600 / p B R U : : K A N Plasmid Description p B R U Smal-EcoRI 2.1 kb fragment, containing the 3' end of the tufB gene, the entire secE and nusG genes and the 5' end of the rp lK ( L l l ) gene, cloned into the EcoRI and the blunt-ended C l a l sites of pBR322 (fig. 3) pSS105 same as p B R U except the Smal-EcoRI fragment, was inserted, using an EcoRI linker at the Smal end, into the EcoRI site of pBR322 (from S. Sullivan and M . Gottesman) p B R U : : K A N pSS105 with a kanamycin cassette (from pUC4KISS; Pharmacia Inc.) inserted into the N r u l site at nucleotide 347 within the secE gene (also known as pSS107, from S. Sullivan and M - Gottesman) (fig. 3) 2. Materials and Methods 15 2.3.2 RESTRICTION E N D O N U C L E A S E DIGESTION O F D N A Restriction enzymes used were purchased from Pharmacia Inc., Bethesda Research Laboratories (BRL) or N e w England Biolabs. Digests were carried out according to the instructions of the suppliers. 2.3.3 G E L ELECTROPHORESIS Agarose slab gels (0.7% or 1.2%) were run in T A E buffer (40 m M Tris-acetate, p H 8.0, 20 m M sodium acetate, 1 m M E D T A ) at 200 m A . The gels were run i n the presence of 0.25 u g / m l ethidium bromide or were stained in ethidium bromide after electrophoresis. Genetic technology grade agarose (Schwarz/Mann Biotech) was used for preparative agarose gels. Analytical (1 m m thick) or preparative (3 m m thick) 5% polyacrylamide gels were run in TBE buffer (89 m M Tris-borate, 89 m M boric acid, 2 m M E D T A ) at 260 V . 2.3.4 D N A RESTRICTION F R A G M E N T P R E P A R A T I O N Bands of restricted D N A , stained wi th ethidium bromide, were excised from agarose or polyacrylamide gels, placed in dialysis tubing and electroeluted in 0.5X TBE at 160 V for 1 h. The eluate was collected and purified by phenol/chloroform extraction and ethanol precipitation. 2.3.5 L I G A T I O N S For sticky-end ligations, 40 fmoles of plasmid vector D N A and 1-3 fold molar excess of insert D N A were used. Incubation was at room temperature for 2 h or at 14-16°C, overnight. For blunt-end ligations, the molar ratio of vector to insert D N A was 1:4. Incubation was at room temperature, overnight. 2. Materials and Methods 16 Total ligation volume was 20 u l . Half of the ligation mix was used per transformation. 2.3.6 T R A N S F O R M A T I O N S R coli host cells were made competent for D N A transformation by the C a C l 2 method (p. 250, Maniatis et al., 1982). Competent cells were gently mixed with 20-40 fmoles of D N A , left on ice for 40-60 min, heat shocked at 42°C for 2 m i n and plated directly on selective media. For tetracycline resistance, 1.0 m l Y T medium was added to the cells after heat shock; the cells were incubated for 1 h at 37°C, centrifuged, resuspended in 0.1-0.2 m l Y T media and plated. 2.3.7 B L U N T - E N D I N G RECESSED 3 ' E N D S When required, D N A restriction fragments with recessed 3' ends were blunt-ended by using the Klenow fragment of E. coli polymerase I to f i l l in the recessed end. Each d N T P (0.25 m M ) was used i n a total volume of 20 u l (p. 113, Maniatis et al., 1982). 2.3.8 3' E N D - L A B E L L I N G O F D N A F R A G M E N T S D N A restriction fragments containing recessed 3' ends were end-labelled using Klenow enzyme and the appropriate [a - K P]dNTP (s.a. 3000 C i / m m o l , 10 m C i / m l ) (p. 115, Maniatis et al., 1982). The labelled fragment was purified by two successive ethanol precipitations. Radioactivity was measured by Cerenkov counting. 2.3.9 5' E N D - L A B E L L I N G O F D N A F R A G M E N T S The 5' ends of D N A restriction fragments were labelled wi th T4 polynucleotide kinase (PNK) and [y- 3 2P]ATP (s.a. 3000 C i / m m o l , 10 m C i / m l ) after dephosphorylation with calf intestinal alkaline phosphatase (p. 122, Maniatis et al., 1982). 2. Materials and Methods 17 2.3.10 5' E N D - L A B E L L I N G O F O L I G O N U C L E O T I D E S Oligodeoxyribonucleotides (250 ng) were 5' end-labelled at 37°C for 40 min wi th 10 units of P N K and 100 u C i of [ y - ^ A T P i n 20 u l of ligase buffer (0.1 M Tris-Cl pH8.0, 5 m M DTT, 10 m M MgCL) . The reaction was terminated by addition of 1 u l of 0.5 M E D T A (pH8.0), and incubation at 65°C for 5 min. Carrier t R N A (8 ug) was added and the reaction volume taken up to 100 p i with TE (10 m M Tris-Cl pH7.5, 1 m M E D T A ) . The labelled oligonucleotide was purified by two successive ethanol precipitations in the presence of 2.5 M ammonium acetate and redissolved i n 20-50 u l TE. 2.3.11 L A B E L L I N G D N A F R A G M E N T S B Y N I C K - T R A N S L A T I O N H i g h specific activity double-stranded D N A hybridization probes were prepared by the nick-translation method (Rigby et al., 1977; pp.109-112, Maniatis et al., 1982). Two different [a- 3 2P]dNTP's were used as radiolabels. The labelled probes were purified by two successive ethanol precipitations i n the presence of 2.5 M ammonium acetate. 2.4 P R E P A R A T I O N O F S I N G L E - S T R A N D E D D N A 2.4.1 F R O M M13 P H A G E R E C O M B I N A N T S Single-stranded M l 3 phage D N A was prepared according to Sanger et al. (1980) and Messing (1983). 2.4.2 F R O M p E M B L R E C O M B I N A N T S Single-stranded p E M B L D N A was prepared as described by Dente et al. (1983). Single colony p E M B L recombinants were grown overnight at 37°C in M 9 minimal salts media wi th ampicillin. Two m l aliquots of YT + ampicil l in were inoculated with 20 u l of 2. Materials and Methods 18 fresh overnight cultures and grown at 37°C to A^o ~ 0.2 (approximately 5 X 107 cells). The cells were superinfectedi wi th the f l helper phage variant R408 (Russell et al., 1986) at a m.o.i. of 10:1 and then incubated at 37°C for 5-7 h. Phage particles and single-stranded D N A s were isolated as for M13 phage recombinants. 2.5 D N A S E Q U E N C I N G Except for the sequencing ladders used to determine transcript ends in SI nuclease mapping experiments, a l l D N A sequence determination was done by the dideoxynucleotide chain termination method (Sanger et al. 1977, 1980; Messing, 1983). Single-stranded D N A templates were prepared as described above. Double-stranded templates were denatured with alkali and precipitated with ethanol prior to sequencing (Hattori and Sakaki, 1986). Often the templates were first screened by using only the d T T P / d d T T P reactions to avoid sequencing redundant clones. Universal forward or reverse primers were used i n most cases. Site-specific mutants in the L10 m R N A leader region were confirmed by sequencing, using oligonucleotide primer oPD28 (5' - C A A G C T G A A T A G C G A C G - 3'); this oligonucleotide hybridizes to a position upstream of the mutated sites in the transcript leader (nucleotide position 1477 - 1493, Post et al., 1979). In the primer extension experiments, the oligonucleotide primer used for the sequencing ladder was the same as that used i n the primer extension reaction, oWD32 or oWD33 (see section 2.7.5). Sequencing ladders used for situating transcript ends i n SI nuclease protection experiments were prepared by the base modification procedure of Maxam and Gilbert (1980). A l l sequencing reactions were analyzed on 8% and/or 6% polyacrylamide-urea gels (20 cm X 38.5 cm X .35 mm). Electrophoresis was done in 0.5X TBE at a maximum voltage of 1750 V and initial power of 35 W . The gels were dried onto Whatman 3mm filter paper and exposed to Kodak X-Omat R P film. 2. Materials and Methods 19 2.6 P R E P A R A T I O N O F T O T A L C E L L U L A R R N A 2.6.1 G E N E R A L M E T H O D Bacteria were grown at 37°C i n 5-10 m l supplemented M 9 minimal salts media, and the selective antibiotic when required, to early log phase, A 4 6 0 = 0,3-0.4. Cells were poured over 5 m l of 40 m M N a N 3 at -70°C, centrifuged at 6000 rpm for 5 min and resuspended in 1 m l medium C (40 m M N H 4 C I , 40 m M Na 2 HP04 , 20 m M K H 2 P 0 4 , 50 m M NaCl) and 10 m M N a N 3 . This was added to 1 m l of SDS lysis mix (100 m M N a C l , 10 m M E D T A , 0.5% SDS) at 100°C and boiled for 15-30 sec. The lysate was immediately extracted with 2 m l phenol 3 times, followed once by 2 m l C H C 1 3 and ethanol precipitated 3 times in the presence of 0.25 M N a C l . The R N A pellet was finally resuspended in 2-5 m l TE. 2.6.2 P R E P A R A T I O N O F R N A O F T E M P E R A T U R E - S E N S I T I V E M U T A N T S The bacterial strains of concern are : (i) XH56, (ii)NF536 (reLV) and NF537 (relA) and (iii) N3433 (RNaseE +) and N3431 (RNaseE) (table 1). Strain XH56 has a temperature-sensitive mutation i n rpoC which is lethal to the cell at 42°C but semi-restrictive at 39°C. Strain NF536 (reLV) has a temperature-sensitive va ly l - tRNA synthetase which elicits the stringent response at the semi-restrictive temperature of 35.5-37°C; NF537 is the isogenic re lA strain and exhibits the relaxed response (Dennis and Nomura, 1974; Maher and Dennis, 1977). Strains N3433 and N3431 are rneVrne isogenic strains; compared to N3433 grown at 30°C and 44°C, growth of N3431 is normal at 30°C but restricted at 44°C due to the temperature-sensitive mutation in rne. Mutant bacterial cultures were grown exponentially in supplemented M 9 minimal salts media at 30°C When the cells reached A ^ ~ 0.3-0.4, portions of the cultures were shifted to the appropriate semi-restrictive temperature. For strain XH56, the semi-restrictive temperature was 39°C for 15 m i n in al l cases. For strains NF536 and NF537, the semi-2. Materials and Methods 20 restrictive condition was 35.5°C for 15 min for the filter hybridization studies and, i n order to maximize the stringent-relaxed responses, 37°C for 15 min for the SI nuclease protection studies. For strains N3433 and N3431, the restrictive condition was incubation at 44°C for 15 or 30 min. Total cellular R N A was prepared from 5-10 m l culture aliquots at both 30°C and the semi-restrictive temperatures. 2.7 R N A A N A L Y S I S 2.7.1 S U C R O S E G R A D I E N T F R A C T I O N A T I O N A 5 m l culture at an A ^ of 0.35 was labelled with [ 3H]uracil (25 u C i / m l ; 0.09 ug of non-radioactive carrier uraci l /ml) for 3 min. The cell lysate was prepared as described above (section 2.6.1) and layered directly onto a 12 m l 6% to 30% (w/v) sucrose gradient with N E T S buffer (0.1 M N a C l , 0.01 M E D T A , 0.01 M T r i s - H C l (pH7.6). 0.2% SDS) and centrifuged for 4.5 h at 40,000 rpm in an SW41 rotor at 20°C. Fractions (0.3 ml) were collected and 20 u l was removed from each, precipitated wi th trichloroacetic acid, collected on a nitrocellulose filter and counted. A second portion (200 ul) was hybridized to D N A -containing filters ( D N A i n excess) as described below (section 2.7.2). 2.7.2 FILTER H Y B R I D I Z A T I O N D N A - R N A hybridizations were carried out as described (Dennis and Nomura, 1974; Dennis, 1977a, 1984). Cultures were labelled wi th [5,6- 3H]uracil (s.a. 42 C i / m m o l ; 10 u C i / m l ) for 1 min and R N A was prepared according to the protocol in section 2.6.1. Increasing amounts of total cellular R N A (12.5-50 ug) were hybridized to an excess of de-natured M13, plasmid or X; phage D N A immobilized on nitrocellulose filters at 67°C for 16 h. Filters were washed in 2X SSC (SSC is 0.15 M N a C l , 0.015 M trisodium citrate, pH7.0), treated with RNaseA, and radioactivity was measured by scintillation counting. 2. Materials and Methods 21 Two separate hybridization series were carried out to measure either L l l - L l m R N A , B m R N A and Xspc m R N A or L10-L12 m R N A and p' m R N A . The A,sp_c D N A was used as i an external hybridization control; this D N A encodes 15 ribosomal proteins and the a subunit of R N A polymerase within a 9000 base region of the transducing phage (Jaskunas et al., 1975; Dennis, 1977a). The other D N A probes were as follows (Dennis, 1984). The L l l - L l D N A probe was a 617-base long EcoRI-Bglll minus strand fragment cloned into M13mp9. The L10-L12 D N A probe was a 653-base long Pstl-EcoRI minus strand fragment cloned into M13mp8. The P D N A probe was the 2.8 kb EcoRI fragment from the central region of the p subunit gene. The P' D N A probe was the 2.6 kb EcoRI fragment from the central region of the P' subunit gene. 2.7.3 R N A ELECTROPHORESIS A N D N O R T H E R N H Y B R I D I Z A T I O N A N A L Y S I S Northern hybridization analysis was carried out according to Maniatis et al. (1982) wi th minor modification. Total R N A (10 ug) from exponentially growing cells was fractionated on a 1% agarose/formaldehyde gel. The gel was rinsed 3 times with distilled water. Without prior alkaline hydrolysis, the R N A species were transferred to Gene Screen (New England Nuclear) hybridization membranes by capillary transfer using 2X SSC. After baking under vacuum at 80°C for 2 h, the blots were prehybridized at 42°C for 9 h in a solution of 50% formamide, 5X SSC, 50 m M sodium phosphate (pH7.0), and 2X Denhardt's solution (Maniatis et al., 1982). Probes for hybridization were prepared by nick-translation of restriction fragments. The D N A probes used were the 617-nucleotide long EcoRI-Bglll fragment spanning the L l l - L l region and the 290-nucleotide long Hindl l l -EcoRI fragment spanning the L10-L12 region. The probes were denatured in 200 u l of the hybridization buffer and approximately 107 d p m of probe in a final volume of about 5 m l was used for hybridization. Hybridization was at 42°C for 18 h. The membranes were washed twice with 2X SSC, 0.1% SDS for 5 m i n at room temperature, twice wi th the same solution for 15 2. Materials and Methods 22 m i n at 65°C and twice wi th 0.1X SSC, 0.1% SDS for 15 min at room temperature. The washed membranes were air-dried and exposed to X-ray film. 2.7.4 SI N U C L E A S E M A P P I N G The 3' and 5' ends of i n vivo m R N A transcripts were analyzed by SI nuclease mapping as described by Berk and Sharp (1978) and as modified by Favaloro et al. (1980). Total in vivo R N A was prepared as described above; 5 ug of R N A was hybridized to approximately 10* to 105 d p m of denatured 5' or 3' end-labelled fragment ( D N A i n excess) at a temperature of 48-52°C for 3 h i n 80% formamide hybridization buffer. Digestion with nuclease SI (200-400 units /ml) was carried out at either 20 or 37°C for 30 min. Fragments of D N A protected from SI nuclease digestion by complementary m R N A sequences were analyzed for length on 8% polyacrylamide D N A sequencing gels. Molecular length standards were M s p l fragments of pBR322, 3' end-labelled wi th Klenow enzyme and [cc-^PJdCTP. In many experiments the G and A + G reaction products of Maxam-Gilbert sequencing of the 5' or 3' end-labelled probe were used as length standards (Maxam and Gilbert, 1980). These standards were assumed to run two nucleotides faster than the S l -protected fragments because they lack the terminal A or G nucleoside but retain the terminal phosphate group at the site of cleavage. 2.7.5 P R I M E R E X T E N S I O N Transcript 5' ends from the secE-nusG operon were analyzed by the primer extension method according to Newman (1987). Total R N A (10 ug) and 5' end-labelled oligonucleotide primer (1 ng) were heated at 65°C for 5 m i n in 10 u l of 160 m M KC1, 40 m M Tris-Cl (pH8.5), 1 m M E D T A . The mixture was cooled gradually to 42°C and incubated at 42°C for 1 h. Five units each of A M V reverse transcriptase and RNase inhibitor were then added to each reaction wi th 10 u l of l O m M M g C l j , 10 m M fi-mercaptoethanol and 1 m M of each 2. Materials and Methods 23 d N T P . Incubation was continued at 42°C for 1 h. The reaction was stopped by the addition of 2 u l of 0.5 M E D T A (pH8.0) and 78 p i of TE. The products were precipitated wi th ethanol i n the presence of 0.3 M sodium acetate. The pellet was dissolved in 5 u l of formamide sequencing dye mix and the radioactivity measured by Cerenkov counting. The reaction products were analyzed on 8%. polyacrylamide-urea sequencing gels alongside a sequencing ladder generated by using an appropriate single-stranded template and the same primer (but unlabelled) as that used i n the primer extension procedure. Two oligonucleot-ides were used as primers : oWD32 5 ' - G C A A T C A G A A T T A C T A C G G C - 3' oWD33 5 ' - C G G A A A A C G C C T G A A C G A C G - 3' Primer oWD32 is complementary to a sequence in the secE gene (position 378 - 397); oWD33 is complementary to a sequence in the proximal region of the nusG gene (position 654 -673). The sequence numbering system is according to that used i n chapter three. Templates used for the corresponding sequencing ladders were (i) the SmaK-684)-Hpal(419) 1.1 kb fragment cloned i n the correct orientation into the Smal site of M13mpl9 with oWD32 as primer and (ii) the Pstl(399)-Pstl(967) 568 bp fragment cloned in the correct orientation into the PstI site of M13mpl8 wi th oWD33 as primer. 2.7.6 m R N A STABILITY Study of m R N A stability at the permissive and semi-restrictive temperatures was according to von Gabain et al . (1983) with some modification. Strain XH56 was grown at 30°C i n 40 m l of supplemented M 9 minimal salts media to A ^ = 0.3 - 0.4. A 7 m l aliquot was taken for R N A preparation just before addition of rifampicin. Rifampicin was added to the remaining culture to a final concentration of 200 u g / m l . This was designated as time = 0 min. Successive 7 m l aliquots were taken for R N A preparations at 2, 4, 6 and 8 min. For studies of m R N A stability at the semi-restrictive temperature, the XH56 culture, when 2. Materials and Methods 24 it had reached a cell density of A«o = 0.4, was shifted from 30°C to 39°C for 25 m i n before rifampicin was added. Aliquots were taken at the same time points. Total R N A was prepared as described above. Levels of L l l - L l , L10-L12 and 6 transcripts were analyzed, in duplicate, by SI nuclease protection using 5 ug of total R N A . The following D N A restriction fragments, labelled at the 3' end, were used as probes : (i) the 617 bp EcoRI-Bgin fragment detects L l l - L l message, (ii) the 290 bp Hindl l l -EcoRI fragment detects L10-L12 message, (iii) the 584 bp Sall-EcoRI fragment detects B message and (iv) the 496 bp EcoRI-Sall fragment detects read-through transcripts as wel l as transcript 3' ends in the L12-B intergenic region (fig. 15). For internal consistency, probes for L10-L12 and B transcripts were used together in the S i nuclease protection study. Resultant autoradiogram bands were scanned by a video densitometer (BioRad model 620) and the data computer analyzed (BioRad 1-D analyst, version 2.01). Integrated areas of the appropriate peaks were used to calculate relative band intensities. 2.8 O L I G O N U C L E O T I D E - D I R E C T E D M U T A G E N E S I S 2.8.1 C O N S T R U C T I O N O F C L O N I N G V E C T O R pEMBL8 +(BII) The multiple cloning site (MCS) of p E M B L 8 + (Dente et al., 1983) was replaced by a modified M C S containing a Bg in restriction site derived from an altered p G E M 4 Z vector kindly provided by Jan St. Amand. The Bg in recognition sequence was generated by the insertion of an X b a l 6mer linker into the Xba l site of p G E M 4 Z (Promega). The insertion is in frame and allows the usual colour selection with X-gal. The M C S of pEMBL8 +(BII) has the following restriction sites surrounding the Bg in site : EcoRI BamHI-Xbal-Bgin-Xbal-Sall- - - H i n d l H 2. Materials and Methods 25 2.8.2 O L I G O N U C L E O T I D E S F O R M U T A G E N E S I S The oligodeoxyribonucleotides were synthesized on an Appl ied . Biosystem 380A D N A synthesizer and were deprotected and purified as described by Atkinson and Smith (1984). The crude D N A pellet was dissolved in 90 u l TE. A m m o n i u m acetate (0.5 M ) and magnesium acetate (10 m M ) were added to a 15 p i aliquot in a final volume of 500 u l . The oligonucleotide solution was passed through a Q g S E P - P A K cartridge (Waters Scientific) which had been activated by washing with 10 m l of H P L C grade acetonitrile followed by 10 m l of distilled water. Contaminants were washed off the column with 4.5 m l of distilled water. The oligonucleotide was eluted off the column with 4.5 m l of 60% C H 3 O H / 4 0 % distilled H 2 0 , the eluant being collected i n three 1.5 m l fractions. The oligonucleotide concentration of each fraction was spectrophotometrically determined, wi th one A ^ unit corresponding to 20 u g / m l . The oligonucleotide was frozen i n dry ice, evaporated to dryness in a Savant Speed-Vac and dissolved i n 50 p i of TE. The oligonucleotides used for mutagenesis are listed below; the single base mutation is underlined. Name Sequence Nucleotide positions OPD23 5' - CCAGGCCTTCGTCGAAG - 3' 1529 - 1545 OPD24 5' - ATATTCTGACTTGTTTC - 3' 1615 - 1631 OPD25 5' - GCTTGTTTTTGCTCACC - 3 ; 1623 - 1639 OPD26 5' - TGCGTAGATGGTGACAG . -3' 1578 - 1594 2.8.3 C O N S T R U C T I O N O F M U T A N T P L A S M I D DERIVATIVES The mutagenesis method was according to Ner et al. (1988) and is a combination of the primer extension protocol of Zoller and Smith (1982) and the strand selection method of Kunkel (1985), and Kunke l et al. (1987). The 1.1 kb BglH-Smal fragment from plasmids pNF1344, pNF1661 to pNF1664 were cloned into the BgUI-Smal site of pEMBL8 +(BII). This 2. Materials and Methods 26 Bgll l -Smal fragment contains the 3' end of the L I gene, the untranslated L10 leader region and the 5' end of the L10 gene. Competent dufung' E. coli RZ1032 was transformed wi th the pEMBL8 +(BII) recombinant plasmids. RZ1032 lacks the enzyme dUTPase (dut) and the resulting elevated concentration of d U T P effectively competes with TTP for incorporation into D N A . RZ1032 also lacks the enzyme uracil N-glycosylase (ung") which normally removes uracil from D N A . Thus i n RZ1032, uracil is incorporated into D N A and is not removed (Kunkel, 1985; Kunkel et al., 1987). Single-stranded, uracil-containing D N A was prepared as described above (section 2.4.2). In vitro mutagenesis was carried out as described by Ner et al. (1988). Oligonucleotides oPD23 to oPD26 were used to generate compensatory point mutations in the L10 leader regions of pNF1661 to pNF1664, respectively. Each oligonucleotide was also used to mutagenize the w i l d type plasmid pNF1344. Strong selection for the newly syn-thesized strand was accomplished by transforming the heteroduplex into the dut + ung + host JM101. Transformants were screened for mutations initially by colony or D N A filter hybridization (Maniatis et al., 1982) and finally by dideoxy sequencing using oPD28 as the sequencing primer (see section 2.5). The mutagenized 1.1 kb BglTJ-Smal fragment was excised from the pEMBL8 + (BH) derivatives and inserted into the BglTJ-Smal site of pNF1344, replacing the w i l d type sequence (fig. 17). The BglTJ-Smal pNF1344 vector D N A was gel-purified away from its wild-type 1.1 kb Bgll l -Smal fragment i n order to increase the probability of obtaining mutant recombinants. Again, mutants were identified by the procedure described above. Mutant plasmids were designated as pNF1661'(23), pNF1344(23) etc. and are listed in table 2. Bacterial transformants carrying plasmids pNF1661'(23) and pNF1662'(24) were not viable. Partial sequences of the relevant D N A regions are shown in figure 18; the positions of these point mutations in the secondary structure of the L10 leader (Christensen et al., 1984) are illustrated in figure 19. 2. Materials and Methods 27 2.9 I N V I T R O A S S A Y O F M U T A N T P L A S M I D S A prokaryotic, DNA-directed, in vitro translation system (Amersham) was used to assess the translational efficiency of the mutant plasmids. Procedure was as specified by the kit, wi th some modifications. Each assay consisted of : 1.2 - 1.5 ug plasmid D N A template 10 units RNase inhibitor (Pharmacia Inc) 1.5 p i 10 m M DTT 1.0 p i [ ^ l - M e t (s.a.1200 C i / m m o l , 11.8 m C i / m l ) 3.8 p i supplement solution (kit) 1.5 p i amino acid (minus Met) solution (kit) 2.5 p i S-30 extract (kit) in a total volume of 15 p i . The assay was incubated at 37°C for 1 h and then chased with 2.5 u l of methionine chase solution (kit) at 37°C for 10 min. [^Sl-methionine incorporation was measured according to the supplied protocol. Each plasmid was assayed in duplicate. Translation products were electrophoresed in duplicate on SDS-polyacrylamide gels. M i n i SDS slab gels containing 15% polyacrylamide with a 4.5% stacking gel were prepared using the discontinuous buffer system of Laemmli (1970). A 1.5 p i aliquot of each assay was loaded per well . Molecular size standards were high range protein molecular weight standards from BRL. Electrophoresis was carried out at 100 V (maximum) and 15-30 m A with the bromophenol blue dye running 0.9-1X the gel length. The gel was stained and destained, dried and exposed to Kodak X-Omat RP film. Autoradiogram band intensities were analyzed by densitometry (section 2.7.6). 2. Materials and Methods TABLE 2 S I N G L E A N D D O U B L E B A S E M U T A N T S O F T H E L10 L E A D E R R E G I O N Plasmid Mutagenizing oligonucleotide Mutation Position (Post et al.,1979) pNF1661' pNF1344(23) pNF1662' pNF1344(24) pNF1663' pNF1344(25) oPD23 pNF1661'(23) oPD23 oPD24 pNF1662'(24) oPD24 oPD25 pNF1663'(25) oPD25 G -> A C -> T not viable C -> T G -> A not viable G -> A C -> T G -> A C -> T 1516 .1537 1599 1623 1594 1631 1594 1631 pNF1664' pNF1344(26) pNF1664'(26) oPD26 oPD26 G -> A C -> T G -> A C -> T 1640 1586 1640 1586 III. STUDIES OF T H E secE-nusG GENE CLUSTER 29 3.1 I N T R O D U C T I O N The secE and nusG genes, whose products are essential for cell viability, are situated i n the region between two wel l characterized operons, tufB and rplKATL, around 90 minutes on the E. coli chromosome (fig. 3). The SecE protein has been shown to be an integral membrane protein and is an essential component of the protein translocation apparatus (Schatz et al., 1989). The other members of this protein export complex include proteins SecA, SecB, SecD and SecY (Review : Oliver, 1987). R-proteins S15 and L34, initially isolated as suppressors of mutations in secA, are also implicated in protein translocation. This possible involvement of r-proteins in protein secretion suggests an interaction between the protein export and translational machineries. Previous studies on the timing of protein secretion with respect to protein synthesis also provide evidence for the coupling of translation wi th translocation (Review : Oliver, 1987). The Nus proteins, which include N u s A , NusB, NusE and N u s G , are factors that regulate transcription termination i n E. coli. N u s A , B and E were first identified as host genes necessary for N-mediated antitermination of X transcription (Friedman and Gottesman, 1983). N u s A and NusB proteins are also involved in the termination/antitermination process in several bacterial operons (Farnham et al., 1982; Kingston and Chamberlin, 1981; Ward and Gottesman, 1981; Kurok i et al., 1982; Sharrock et al., 1985). NusE, identified as r-protein SI 0, functions as a X transcription antitermination factor; however, its effects on the expression of E. coli genes are not yet known. N u s G is thought to be involved in regulating transcription antitermination since it is required, along with N u s A , NusB and 3. secE-nusG 30 SCALE (bp) - 5 0 0 1 i i i i 500 _ i i i i i 1000 _I 1 I 1— 1500 GENOtllC nap tufB ( E F T u ) T £ X i n u secC n u s G r p l K ( L l l ) I r HR H PLflSfl I OS I 1 , , pSS105 (S pBRU (S -+-C) | KAN 1 NSERT pBRU::KAN S1 PROBES .FIGURE 3. Genetic organization of the secE-nusG gene cluster. The positions of the tufB (EF-Tu), secE, nusG, rp lK ( L l l ) genes are denoted by the filled rectangles. Selected restriction sites are indicated and their positions on the nucleotide scale are : Smal (S, -684); N e i l (N , -117, 1013); N r u l (NR, 347); H p a l (H, 419); Asp718 (A, 753); EcoRI (E, 1438). The Smal site at position -684 corresponds to the Smal site at position 491 i n the sequence numbering system of A n and Friesen (1980a). Nucleotide 1158 and the EcoRI site at nucleotide 1438 correspond respectively to positions 1 and 280 in the sequencing numbering system of Post et al. (1979). The transcription start sites PEG and P L n (this work, section 4.2.2(2)) are at positions 60 and 1235. The terminators (T) for tufB and secE-nusG genes are located at positions 66-67 and 1238-1247, respectively. The RNaseEI processing sites (RNaseUD are situated at nucleotides 96 and 129. A prominent 5' transcript end which is located at nucleotide 216 is indicated by "X" . Cloned derivatives of this chromosomal region are as follows. The Smal-EcoRI 2.1 kb fragment was cloned , using an EcoRI linker at the Smal end, into the EcoRI site of pBR322 to produce pSS105. Plasmid p B R U is identical to pSS105 except that the Smal-EcoRI fragment was inserted into the EcoRI site and the blunt-ended C M site of pBR322. Plasmid p B R U : : K A N was derived from pSS105 by insertion of a kanamycin ( K A N ) cassette into the N r u l site at nucleotide 347. The probes used for SI nuclease protection experiments were the 5' end-labelled 1.1 kb Smal-Hpal fragment and the 3' end-labelled 1.1 kb Ne i l fragment (bottom). 3. secE-nusG 31 NusE, for X N-mediated antitermination in an i n vitro transcription system (J. Greenblatt, personal communication). In addition, some mutations in nusG are able to suppress the E. coli n u s A l and nusE71 mutations, and restore N activity (S. Sullivan and M . Gottesman, personal communication). Because of the essential nature of both the SecE and N u s G proteins in cell viability, and because of their physical linkage to rplKATL-rpoBC and their functional involvement wi th the translation and transcription apparati, the initial steps in understanding the regu-lation of their expression have been taken to sequence the secE-nusG gene cluster and to analyze the transcripts derived from this region. 3.2 RESULTS A N D DISCUSSION 3.2.1 S E Q U E N C E A N A L Y S I S O F secE-nusG A physical map of the 1318 nucleotide long region between the end of the tufB gene and the beginning of the rp lK gene is depicted i n figure 3. The complete nucleotide sequence of this region was determined using the Smal-EcoRI 2.1 kb fragments obtained from both genomic D N A and from the transducing phage X.rifd18 (Kirshbaum and Konrad, 1973). The two sequences were identical and are presented in figure 4. The region contains two long open reading frames that have been designated secE and nusG. The nucleotide numbering system used i n this chapter is different from that of A n and Friesen (1980a) and Post et al. (1979); the terminal portion of the tufB sequence by A n and Friesen extends to position 79 of this numbering system and nucleotide 1 of the rp lKATL sequence by Post et al. corresponds to position 1158. 3. secE-nusG 32 .FIGURE 4. Nucleotide sequence of secE-nusG genes. The predicted amino acid sequences of secE and nusG are given below the D N A sequence. The secE gene is located between nucleotides 240-620; the nusG gene is located between nucleotides 625-1167. The Peg and P L 1 1 transcription initiation sites are depicted by arrows (->) at position 59 and 1235 respectively. The -10 and -35 sequences associated with these 5' transcript end sites are indicated. Other 5' transcript ends that originate from processing or weak promoters are indicated by " X " for major and "x" for minor m R N A species. The sites of RNaselTI processing are noted. Sites of transcription termination of tufB m R N A and the secE-rnusG m R N A are shown by filled circles at positions 66-67 and 1239-1241. Sequences exhibiting inverted repeat symmetry associated wi th termination are overlined and those associated with the stem structure recognized by RNasein are underlined. Oligonucleotides oWD32 and oWD33 used as primers for primer extension experiments are complementary to the indicated sequences. The kanamycin resistance cassette was inserted in the N r u l site at position 347 (pBRU::KAN). The H p a l site (419) and the N e i l site (1013) indicate respectively the ends of restriction fragments, 1.1 kb Smal-Hpal and 1.1 kb Ne i l , which were used as probes for SI nuclease mapping. The terminal portion of the nucleotide sequence of A n and Friesen (1980a) extends to position 79. The two sequences are identical i n the overlapping region wi th one exception; beginning at position 41, my nucleotide sequence has a run of four consecutive A ' s compared to a run of three consecutive A ' s i n the sequence of A n and Friesen (1980a). 3. secE-nusG - 3 5 - 1 0 20 1 10 ^ I 60 ^ 80 IO0 I20 TCTGflGCTflHTTGeCGHTflHCflTTTGBCOCRBTCCGCnCTflflHflGGGCflTCSTTTGflTGCCCTTTTTGCBCGCTTTCGTnCCnGnnCCTGCCTCflTCnGTGHTTTTCTTTGTCHTRRTCfl L S TER | - > - X < R H a « l l l ) t u f B ( E F T u ) M O 160 180 200 220 210 TTGCTGRGflCRGGCTCTGTTGRGGGCGJRTRRTCCGflRRRGCTRRTflCGCGTTTCGflTTTGGTTTGCCTCGCGRTCGCGGGGTGRRRRTGTTTGTRGRRflHCTTCTGRCRGGTTGGTTTfl X ( R H o s e l l l ) " " i i x x X I Km I H S E R T - D B R U : : KB*h1 260 280 300 320 3 1 0 | 360 TGflGTGCGflRTflCCGflflGCTCRflGGflflGCGGGCGCGGCCTGGflflGCGRTGflRGTGGGTCGTTGTGGTGGCflTTGCTCCTGGTGGCGflTTGTCGGCflflCTflTCTTTflTCGCGflCflTTRTGC n S R H T E R O G S G R G L E R n r U U U U U f l L L L U f l I U G H V L V R D I 11 s e c E ; 1 2 ? a a ; t i l l 13S93 0U032 Hpo l 380 I 100 120 I 110 160 180 TGCCGCTGCGTGCGCTGGCCGTflGTflRTTCTGflTTGCTGCflGCGGGTGGTGTCGCGCTGTTflflCGRCflflflflGGTRflflGCTflCCGTTGCTTTTGCCCGTGflRGCGCGTflCCGflflGTCCGTfl L P L R A L A U U I L I f l f l f l G G U B L L T T K G K f l T U B F f l R E A R T E U R 500 520 510 560 S80 600 AGGTCRTTTGGCCGflCTCGCCRGGRRRCflTTGCACRCCflCGCTGRTTGTGGCTGCGGTTRCCGCAGTRflTGTCRCTGRTCCTGTGGGGRCTGGRTGGTflTTCTGGTTCGCCTGGTRTCCT K U I U P T R Q E T L H T T L I U B R U T R U n S L I L U G L O G I L U R L U S OU033 620 610 660 I 680 700 . 720 TTflTCflCTGGCCTGflGGTTCTGflGflTGTCTGflflGCTCCTflRflflflGCGCTGGTflCGTCGTTCRGGCGTTTTCCGGTTTTGflflGGCCGCGTflGCflflCGTCGCTGCGTGflGCflTflTCflflflTTfl F I T G L R F T E R t l S E A P K K R U V U U Q A F S G F E G R U R T S L R E H I K L n u s G ; I S I a a ; Ml 20508 710 760 780 800 820 810 CflCflflCflTGGflflGRTTTGTTTGGTGflflGTCflTGGTflCCflflCCGflftGflflGTGGTTGflflflTCCGTGGCGGTCRGCGTCGCflflflflGCGfiflCGTflflflTTCTTCCCTGGCTflCGTCCTCGTTCflG H H n E O L F G E U H U P T E E U U E I R G G Q R R K S E R K F F P G Y U L U Q 860 880 900 920 910 960 RTGGTGRTGRRCGRCGCGRGCTGGCRCCTGGTGCGCRGCGTRCCGCGTGTGRTGGGCTTCflTCGGCGGTRCTTCCGRTCGTCCTGCGCCRRTCRGCGRTRflAGRflGTCGflTGCGRTTRTG n U f l N O R S U H L U R S U P R U n G F I G G T S O R P R P I S O K E U O R I I I H e l l 980 1000 I 1020 1010 1060 1080 flflCCGCCTGCflGCflGGTTGGTGflTflflGCCGCGTCCGflflflflCGCTGTTTGflflCCGGGTGflflflTGGTCCGTGTTflflTGRTGGTCCGTTCGCTGflCTTCflRCGGTGTTGTTGflflGflflGTGGflT N R L Q Q U G D K P R P I C T L F E P G E n U R U H O G P F R O F H G U U E E U O 1100 1120 1110 1160 1180 1200 TflCGflGflflflTCTCGTCTGflflflGTGTCTGTTTCTflTCTTCGGTCGTGCGflCCCCGGTflGflGCTGGflCTTCflGCGflGGTTGflflflflflGCCTflflCCCRGCGflTCflflflflflflGCGGCGflTTTflflTC V E K S R L K U S U S I F G R A T F U E L D F S Q U E K A T E R - 3 S - 1 0 1210 T ^ 1220 ~ T " ^ 1260 1280 1300 1320 GTTGCflCflflGGCGTGflGflTTGGflflTflCflflTTTCGCGCCTTTTGTTTTTflTGGGCCTTGCCCGTflflflflCGRTTTTTTflTflTCflCGGGGflGCCTCTCflGflGGCGTTflTTflCCCflflCTTGflGG !-»-.•• 1310 1360 1380 flflTTTflTHflTGGCTflflGflflflGTflCRRGCCTflTGTCAflGCTGCflGGTTGCflGCTGGTflTGG t l f l r K U Q H Y U K l Q U A A G I I L l l RIBOSOMflL PROTEIN GEHE FIGURE 4 3. secE-nusG 34 The distance between the end of the tufB gene and the beginning of the secE open reading frame is 229 nucleotides (fig. 4). Overlapping sequences characteristic of a Rho-independent transcription terminator and an R N A polymerase promoter recognition sequence occur immediately after the tufB gene (between nucleotide positions 20-70) . If functional, the terminator wou ld reduce or prevent extension of the abundant tufB transcripts into the secE-nusG region. Transcripts initiated at the promoter wou ld contain a 5' untranslated leader of approximately 180 nucleotides in length. The secE gene (position 240-620) encodes a 127 amino acid long polypeptide that is rich in hydrophobic residues. Based on a number of different alkaline phosphatase (phoA) fusions to secE, Schatz et al. (1989) have shown that the secE gene product is an integral membrane protein containing three membrane-spanning domains. These domains, representing residues 19-36, 45-63 and 93-111, are 18 or 19 amino acids in length and are devoid of charged residues. The amino terminus of the protein is believed to be localized to the inside surface and the carboxy terminus to the outside surface of the cell membrane. The position of the initiating methionine codon at nucleotide 240 is supported by the isolation of a secE-phoA gene fusion with a junction immediately after the G A A glutamic acid codon at nucleotide 282. The initiation codon is preceded by a ribosome binding sequence at position 230-233. It has been shown that the secE gene is essential for cell viability and that its gene product is an important component of the bacterial protein translocation system (Schatz et al., 1989). Only a single nucleotide separates secE from the open reading frame designated nusG. The nusG gene begins with an A T G methionine codon at position 625 and encodes a polypeptide of 181 amino acids i n length. This protein contains a high proportion of acidic (14%) and basic (15%) residues and therefore is probably not an integral membrane 3. secE-nusG 35 protein. Two fusions of alkaline phosphatase to nusG, at codons three and six, confirm the position of the initiation codon (Schatz et al., 1989). This conclusion has recently been substantiated by an N-terminal amino acid sequence of the purified N u s G protein Q. Greenblatt, personal communication). The nusG gene has been shown to be essential for cell viability (Downing et al., 1989) and likely encodes a transcription termination factor (J. Greenblatt, S. Sullivan and M . Gottesman, personal communication). The nusG-rplK intergenic space is 158 nucleotides long. This region contains the major promoter for transcription of the rplKATL-rpoBC gene cluster which initiates at or near nucleotide 1235 (equivalent to nucleotide 77, Post et al., 1979; this work, section 4.2.2(2), fig. 10). This promoter region overlaps the terminator site for transcripts exiting the nusG gene. 3.2.2 T R A N S C R I P T M A P P I N G Plasmids pSS105 and p B R U contain the 2.1 kb Smal-EcoRI fragment and are capable of complementing lethal mutations i n the chromosomal secE (Schatz et al., 1989) and nusG genes (Downing et al., 1989). Neither plasmid contains the upstream tufB promoter, suggesting that secE and nusG are transcribed independently of tufB. In vivo transcripts derived from the secE-nusG region on the bacterial chromosome and the plasmid p B R U were characterized by primer extension and SI nuclease protection analysis. For this purpose, two synthetic oligonucleotides, one complementary to a region in secE (oWD32) and the other complementary to a region in nusG (oWD33), were prepared. The 5' transcript end sites in the tufB-secE intergenic space were analyzed using oWD32 to prime reverse transcription using total R N A isolated from a number of different bacterial strains. A total of seven different 5' end sites were evident using R N A from strain 3. secE-nusG 36 .FIGURE 5. Transcript mapping by primer extension and SI nuclease protection. Panel A : Primer extension using oWD32 as primer. Reaction products from primer extension experiments were analyzed on a 8% polyacrylamide-urea sequencing gel alongside a sequencing ladder (G,A,T,C). The major 5' transcript ends are located on the D N A se-quence at positions 60, 96, 129 and 216. The minor 5' m R N A ends are indicated by ' X I ' , ' X 2 ' , and ' X 3 ' , and correspond to nucleotide positions 149, 161 and 178, respectively. Ten micrograms of total cellular R N A , prepared from the following strains, were used for each reaction : lane 1, PD828 (C600/pBRU); lanes 2 and 4, PD858 (C600/pBRU: :KAN); lanes 3 and 5, C600; lane 6, N2076 (rnc+); lane 7, N2077 (rnc); lane 8, N3433 (rne+); lane 9, N3431 (rne). Lanes 1-3 are short exposures (30 h) and lanes 4-9 are long exposures (2 weeks). Panel B : Nuclease SI mapping of 5' transcript ends derived from the tufB-secE intergenic region. The 5' end-labelled 1.1 kb Smal-Hpal restriction fragment was used as probe; five micrograms of R N A were used in each reaction. Lane designations are : lane 1, molecular length markers are 3' end-labelled M s p l fragments of pBR322 (their lengths are 623, 528, 405, 310, 243, 239, 218, 202, 191, 181, 161 nucleotides); lane 2, C600 R N A ; lane 3, N2076 R N A (rnc*); lane 4, N2077 R N A (rnc); lane 5, r R N A (control); lane 6, 5' end-labelled 1.1 kb Smal-H p a l probe. The predominant 5' transcript ends are correlated wi th their respective primer extension counterparts. The probe (P) and the nucleotide positions of transcript termini are indicated. Panel C : Nuclease SI mapping of 3' transcript ends derived from the tufB-secE intergenic region. The 3' end-labelled 1.1 kb Ne i l D N A fragment was used as probe (lane 2). The lane designations are similar to those in panel B. The 3' transcript ends are situated on the D N A sequence at positions 11, 18, 44, 53 and 67. 3. secE-nusG 37 C600 (fig. 5A, lanes 3 and 5); these sites are located at or near nucleotide positions 60, 96, 129, 149, 161, 178 and 216. Only the sites at positions 60 and 161 are preceded by easily recognizable and appropriately spaced -10 and -35 promoter consensus sequences. The intensities of the seven 5' end sites were uniformly enhanced when R N A from strain C600 containing the p B R U plasmid (PD828) was used as template (fig. 5A, lane 1). This observation indicates that the transcripts derived from the secE-nusG region of the chromosome and the recombinant plasmid are identical and implies that transcription is not dependent on the upstream tufB promoter. The oligonucleotide oWD33, complementary to a region in nusG was also used to locate 5' transcript ends. The 5' end sites of the products generated wi th this primer correspond to those generated wi th oWD32 (data not shown). Plasmid p B R U : : K A N contains a kanamycin cassette inserted into the N r u l site at nucleotide position 347 within the secE gene. When R N A from a strain carrying this plasmid (PD858) was used in the primer extension assay with oWD32 as primer, only the low level transcripts derived from the chromosomal secE-nusG region were detected (fig. 5A, lanes 2 and 4). In addition, S i nuclease analysis clearly demonstrated that few, if any, transcripts exit from the kanamycin cassette (data not shown). Together, these results indicate that the secE and nusG genes are cotranscribed and that the kanamycin cassette in plasmid p B R U : : K A N induces transcriptional polarity on the downstream nusG gene. The two 5' end sites at nucleotide positions 96 and 129 are located at opposite positions within a region of inverted repeat symmetry. The R N A s from an RNase l l l mutant strain (N2077) and its isogenic w i l d type parent (N2076) were examined by primer extension to determine if these sites were generated by RNase l l l cleavage (fig. 5A, lanes 6 and 7). In the mutant strain, the 5' end sites at positions 96 and 129 were greatly reduced and the 3. secE-nusG 38 intensity of the 5' end site at position 60 was correspondingly increased. This result suggests that a precursor R N A with a 5' end site at position 60 is either partially or s lowly cleaved by RNase l l l at position 96 and/or 129 and that the site at position 60 probably represents the major transcription initiation site for the secE-nusG m R N A . A s discussed below (section 4.2.2(2)), RNase l l l has a range of effects on the expression of many E. coli and bacteriophage genes. The function of RNase l l l processing in the secE-nusG leader sequence remains to be detennined. The 5' transcript end at nucleotide 216 is of unknown origin. The sequence surrounding this anomalous but abundant end site exhibits some resemblance to the consensus recognition sequence for endonuclease RNaseE. In E. coli , RNaseE is an essential function required for the excision of precursor 5s r R N A from the nascent r R N A transcript and for the cleavage of R N A I , a transcript involved i n replication of colEI plasmid D N A (Apirion and Lassar, 1978; Ghora and Api r ion , 1979; Tomcsanyi and Api r ion , 1985). To determine if RNaseE is responsible for generating the 5' end site at position 216, total R N A was isolated from a temperature-sensitive RNaseE mutant strain that had been incubated for 15 or 30 m i n at the restrictive temperature of 44°C. Primer extension with oWD32 indicates that none of the extraneous 5' end sites including the one at position 216 are produced by RNaseE cleavage (fig. 5A, lanes 8 and 9). The major 5' end site at nucleotide 216, while not generated by RNaseE processing, may be the result of an unidentified nuclease activity. The sequence i n the vicinity of this 5' end site is similar to the sequence in the region of the major 5' transcript end in the L10-L12 leader (at nucleotide 1500; section 4.2.2(2), sequence numbering according to Post et al., 1979). It is possible that these sequences aire processed by the same nuclease and hence may indicate a similar mode of regulation of these two operons. 3. secE-nusG 39 secE-nusG leader 5'...CGGGGTGAAAATGTTTGTAGAA...•3' III I I I I I I I I I I L 1 0 - L 1 2 leader 5'...CGGATAGAAAAGATTTGTTCGT... 3 ' I I I I I I I I I I I secE-nusG leader 5'...TTTGTAGAAAACTTCTGACAGG.. . 3 ' (The 5' end sites are underlined. Two alignments of the secE-nusG leader sequence are shown; i n this region, nucleotide identities with the L10-L12 leader sequence are indicated.) The significance of this similarity i n sequence and transcript processing requires further investigation. A s implied by their relative autoradiogram intensities, transcripts wi th 5' termini at positions 129 (RNaselH) and 216 are the predominant m R N A species (fig. 5A and B). If the m R N A 5' end at position 216 is the result of nuclease activity, then it appears that the majority of transcripts initiated at position 60 are processed in the 5' untranslated leader region; this post-transcriptional event may provide an additional level of regulation in the expression of these genes. R N A processing may be involved i n the decay of transcripts or in the "unmasking" of the ribosome binding site for translation (King et al., 1986; Gegenheimer and Api r ion , 1981). The 5' transcript ends detected by primer extension were confirmed by SI nuclease protection experiments (fig. 5B). Total cellular R N A s isolated from E. coli C600 and rncVrnc strains N2076 and N2077 were used to protect the 5' end-labelled Smal-Hpal 1.1 kb fragment spanning the tufB-secE intergenic region (fig. 3). The ends of fragments 3. secE-nusG 40 protected from SI nuclease digestion, correspond to the transcript ends observed i n the primer extension experiments (fig. 5 A and 5B). Nuclease SI protection experiments, using the 3' end-labelled N c i l - N c i l 1.1 kb probe (fig. 3), indicate that transcripts exiting the tufB gene are efficiently terminated. The largest transcripts terminate at or near nucleotide position 66-67. This end site is probably a Rho-independent transcription terminator since it is within a tract of T residues that is preceded by inverted repeat symmetry. A number of other shorter but more abundant transcripts with 3' end sites near nucleotide positions 11, 18, 44 and 53 were also defected (fig. 5C). A l l of these sites are beyond the tufB termination codon. It is unclear whether these 3' end sites are generated by termination events or by nuclease cleavage i n the 3' untranslated portion of tufB m R N A . The 3' end of the secE-nusG transcript has been previously mapped to nucleotides 1238 to 1247 within a Trtract sequence that is preceded by inverted repeat symmetry (fig. 4) (Downing and Dennis, 1987; this work, section 4.2.2(2)). There is little if any transcription read-through into the downstream r p l K gene. The major promoter for the rplKATL-rpoBC gene cluster initiates transcription at or near nucleotide 1235. The overlap of this transcription start site wi th the secE-nusG termination site may permit some regulatory interaction between these two secE-nusG and rp lKATL gene clusters (Downing and Dennis, 1987; this work, section 4.2.2(2)). IV. STUDIES OF T H E rplKATL-rpoBC GENE CLUSTER 41 4.1 I N T R O D U C T I O N The rplKATL-rpoBC gene cluster lies immediately downstream of the secE-nusG operon and encodes, respectively, the four 50S subunit ribosomal proteins L l l , L I , L10 and L12, and the two large (3 and p" subunits of R N A polymerase (fig. 6). The locations of these four r-proteins on the ribosome are known (fig. 7). Four copies of elongated r-protein L I 2 are found in the stalk of the large subunit. A t the base of the stalk, they bind to a single copy of L10 protein (Strycharz et al., 1978; Petterson and Liljas, 1979) which, perhaps facilitated by the L l l protein, binds to the 23S r R N A (Dijk et al., 1979; Petterson, 1979). This complex forms part of the GTPase centre on the large subunit and is required for the binding of extrinsic translation factors (e.g. EF-Tu and EF-G) to the ribosome and the concomitant hydrolysis of G T P (reviews : Liljas, 1982). Protein L I is found in the shoulder on the opposite side of the large subunit; it is involved in the interaction wi th peptidyl-t R N A at the P (peptidyl) site and indirectly with the GTPase centre (Subramanian and Dabbs, 1980; Lake and Strycharz, 1981; Sander, 1983). Proteins p and P' are components in the DNA-dependent R N A polymerase which is responsible for transcription of the bacterial genome. Found i n two forms, the polymerase holoenzyme (c^PP'o) initiates transcription at unique promoter sequences and the core enzyme (o^PP') is responsible for R N A chain elongation. Transcription termination or pausing is mediated by ancillary factors such as Rho or Nus proteins. The P subunit is thought to be involved i n binding the nucleoside triphosphate substrates and the P' subunit appears to b ind the D N A template (Zil l ig et al., 1976). Regulation of the rplKATL-rpoBC gene cluster is complex. Transcription is initiated 4. rp lKATL- rpoBC 42 .FIGURE 6. Genetic organization of rplKATL-rpoBC. The positions of the nusG, rp lK ( L l l ) , r p lA (LI), rpJI (L10), rpJL (L12), rpoB (B) and rpoC (B ' ) genes are indicated by the filled rectangles. The nucleotide numbering system is that of Post et al. (1979). The transcription start sites for the defined P L n and P L 1 0 promoters are, by SI mapping, at nucleotides 77 and 1346, respectively. Other sites are: the terminator for nusG transcripts (TEG) at about nucleotide 81; the translational control L I binding site on the m R N A (LI B) between nucleotides 130 and 200; the translational control L10 binding site on the m R N A (L10 B) between nucleotides 1510 and 1590; the transcription attenuator (ATT P ) at about nucleotide 2717, and the RNase l l l processing site (RNaselll) at about nucleotide 2780. Relevant restriction sites and their nucleotide positions are as follows : A v a i l (AH: -118); A v a l (A l : 228); EcoRI (R: 280, 2444, 3524, 6392, 7593, 10068); B g l l l (B: 897); H i n f l (Hf: 1206, 1416, 1805, 2549, 3068); PstI (P: 1791); H i n d l l l (H: 2154); HjnPI (HP: , 1293); Fnu4HI (F: 1404); HaeJfKHa: 1513); Dra l (D: 1728); N a r l (Nr: 2730); AccI (Ac: 2941). The restriction fragments util ized as probes in the hybridization assays to quantify L l l - L l , L10-L12, B and B ' m R N A sequences are illustrated above the genetic map; the 617 and 653 base probes are minus strand M13 clones, and the 2868 and 2475 base probes are pBR322 clones. The transcripts deduced from SI protection experiments are illustrated below. The filled circles indicate 5' ends corresponding to the sites of the defined P L 1 1 and P L 1 0 promoters; the open circle represents a 5' end not associated wi th a previously recognized promoter. The open boxes correspond to 3' end sites. The scissored interruption represe-nts the site of RNase l l l processing of read-through transcripts. 4. rplKATL-rpoBC 43 * 5 FIGURE 6 4. rplKATL-rpoBC 44 .FIGURE 7. Positions of r-proteins L l l , L I , L10 and L I 2 on the E. coli large ribosomal  subunit. The positions of r-proteins on the ribosome have been determined by immune electron microscopy, neutron scattering and cross-linking studies. Four copies of L12 form the stalk of the large subunit. A t the base of the stalk, they bind to L10 which, perhaps facilitated by L l l , binds to the 23S r R N A ; this complex forms part of the GTPase centre. The binding site for elongation factor EF-G is shown. Protein L I is found on the shoulder of the large subunit near the peptidyl (P) site. (Adapted from Liljas (1982), and Noller and Nomura (1987)) 4. rplKATL-rpoBC 45 at two major promoters, P L 1 1 and P u o (Post et al., 1979; Taylor and Burgess, 1979; Yamamoto and Nomura, 1978; L i n n and Scaife, 1978) and 80% of the transcripts are terminated at the transcription attenuator in the L12-B intergenic space (Dennis, 1977a, 1984; Barry et al., 1979, 1980). However, no detailed analyses of in vivo transcripts from this genetic locus have been done. Several regulatory features in this gene cluster are of interest and require further investigation. The stoichiometry of production of the four ribosomal proteins is coordinate but unequal; r-protein L I 2 is present in four copies per ribosome, whereas L l l , L I and L10 r-proteins are present in one copy per ribosome (Subramanian, 1975; Hardy, 1975). Bruckner and Matzura (1981) have concluded that the major transcript of this region is tetracistronic and encodes al l four ribosomal proteins. Other investigators have suggested that the L10-L12 intergenic space contains an additional promoter required to enhance expression of the L12 gene (Newman et al., 1979; M a et al., 1981). The L12-B intergenic space contains a number of sequences which are important in regulating expression of the downstream B and B ' R N A polymerase genes (Barry et al., 1979, 1980; A n and Friesen, 1980b). Dur ing balanced growth, transcription of the B B ' genes is under the control of the L l l and L10 promoters and the transcription attenuator in the L12-B intergenic region which terminates about 80% of the transcripts reading through the upstream ribosomal protein genes (Dennis, 1977a, 1984). This results i n reduced B and B ' gene expression and accounts for the five to one ratio of ribosomes to core R N A polymerase found in growing bacteria (Shephard et al., 1980). Downstream from the attenuator in the intergenic space is an RNase l l l processing site; processing p_er se at this site has little or no effect on B B ' gene expression (Barry et al., 1980; Dennis, 1984). However, the sequences surrounding this site, as defined by deletion analysis, appear to be essential for efficient 4. rplKATL-rpoBC 46 translation of the downstream P and p' transcripts. There may be a weak P promoter in the L12-P intergenic region but its contribution to PP' expression would be extremely minor (Barry et al., 1979; Yamamoto and Nomura, 1978; L i n n and Scaife, 1978; Newman et al., 1979). Although the pp' genes are co-transcribed wi th the upstream ribosomal protein genes, regulation of PP' synthesis is distinct. A t the translational level, synthesis of P and p' subunits is feedback regulated by R N A polymerase holoenzyme (o^ PP'g) or the assembly intermediate o^P (Bedwell and Nomura, 1986; Meek and Hayward, 1986; Dennis et al., 1985; Fukuda et al., 1978; Yang and Zubay, 1981). Two physiological conditions elicit differentially controlled expression of these ribosomal protein and R N A polymerase genes. First, restrictions that l imit R N A polyme-rase activity, mediated either by addition of the antibiotic rifampicin (Hayward and Fyfe, 1978; Morgan and Hayward , 1987) or by use of strains temperature sensitive in R N A polymerase activity (Dennis, 1977b; Little and Dennis, 1980), selectively stimulate transcription of Pp' R N A polymerase genes relative to transcription of r-protein genes. Second, during amino acid deprivation, ribosomal proteins L l l , L I , L10 and L12 are strin-gently regulated in r e L V strains whereas R N A polymerase subunits are not (Blumenthal et al., 1976; Maher and Dennis, 1977; Reeh et al., 1976). It has been proposed that this differential transcriptional activity is a result of dynamic modulation of transcription initiation at the P L 1 1 and P L 1 0 promoters and termination at the attenuator (Dennis, 1977b; Little and Dennis, 1980). Finally, as an additional level of control, the translation of L l l - L l m R N A and L10-L12 m R N A is regulated by their respective repressor proteins, L I and L10 (or a complex 4. r p l K A T L - r p o B C 47 of L10-L12). The L I binding site i n the leader region of the L l l - L l transcript has been studied in great detail by using mutagenesis techniques; it is adjacent to, and overlapping with the L l l cistron translation initiation site (Baughman and Nomura, 1983; Thomas and Nomura, 1987; Said et al.,1988). Unl ike other r-protein binding sites, the L10 binding site in the leader region of the L10-L12 transcript is located about 140 nucleotides upstream from the L10 translation initiation site (Fill et al., 1980; Johnsen et al., 1982). Point mutants and deletion mutants, located in or near the L10 binding site are translationally defective (Fiil et al., 1980; Friesen et al., 1983; Christensen et al., 1984). To account for the long range effect of these mutations on L10 and L12 synthesis, a model for translation regulation involving alternative secondary structures of the L10-L12 m R N A leader has been proposed by Christensen et al . (1984). Subsequently, a portion of this model was substantiated by Cl imie and Friesen (1987). However, the greater part of the proposed secondary structures still requires validation. In conclusion, these questions regarding the regulation of expression of rplKATL- rpoBC still remain : (i) the 4:1 stoichiometry of synthesis of r-protein L12 relative to other r-proteins, (ii) the differential transcription of rpoBC relative to rplKATL and (iii) R N A secondary structure of the rplTL transcript leader region and translational regulation of r-protein L10, L I 2 synthesis. A s an attempt to address these questions, transcripts derived from this gene cluster have been analyzed and characterization of the secondary structure of the L10-L12 m R N A leader region has been initiated. 4. rplKATL-rpoBC 48 T A B L E 3 H Y B R I D I Z A T I O N O F P U L S E - L A B E L L E D C600 R N A T O SPECIFIC D N A PROBES Probe D N A a relative Hybr id iz . b % hybridiz per 0 transcriptional percentage*1 (%) nucleotideXlO 4 activity termination L l l -L l (617n) L10-L12(653n) p(2860n) spc(9000n) 0.096 0.128 0.100 1.94 1.56 1.96 0.350 2.16 0.72 0.91 0.16 1.00 82 .TABLE 3. Hybridizat ion of pulse-labelled C600 R N A to specific D N A probes. (a) The various probes complementary to m R N A transcripts from ribosomal protein and R N A polymerase genes are described i n figure 6 and in Materials and Methods (section 2.7.2). The length of each sequence complementary to m R N A is indicated in parentheses (n, nucleotides). (b) The percentage of the input radioactivity i n specific R N A - D N A hybrids is the average of 8 hybridizations (see Dennis, 1984). Input radioactivity was varied over a 4-fold range from 1.44 X 10 s cpm (50 p i input R N A ; about 12.5 pg) to 5.76 X 10s cpm (200 p i input R N A ; about 50 pg). (c) The percentage hybridization per nucleotide of complementary sequence in each of the D N A probes was calculated as the quotient of the percentage hybridization and the probe length . This value is an estimate of the transcriptional activity of each of these D N A sequences. The transcriptional activity of the sgc gene was used as an external control and arbitrarily set at 1.00. (d) The percentage of transcription termination at the attenuator i n the L12-P intergenic space was determined as 1 minus the quotient of the transcriptional activities of the p and L10-L12 genes. 4. rp lKATL- rpoBC 49 4.2 RESULTS A N D DISCUSSION 4.2.1 T R A N S C R I P T I O N A L P A T T E R N O F T H E rplKATL-rpoBC G E N E C L U S T E R 1. FILTER H Y B R I D I Z A T I O N Total cellular R N A , labelled wi th [ 3H]uracil, was hybridized to a molar excess of the respective D N A probe immobilized on nitrocellulose filters. The fraction of input radioactivity hybridizing per nucleotide of probe D N A was determined (table 3). The results are as follows : (i) the L10-L12 genes were transcribed about 25% more frequently than the upstream L l l - L l genes (relative transcriptional activity of 0.91 versus 0.72) and (ii) the R N A polymerase genes, as represented by the B gene probe, were transcribed at about one-fifth the frequency of the upstream ribosomal protein genes. These results are consistent with previous suggestions of P L 1 0 promoter activity in the L1-L10 intergenic space and a transcription attenuator in the L12-B intergenic region (Hui et al., 1982; Yamamoto and Nomura, 1978; L i n n and Scaife, 1978; Taylor and Burgess, 1979; Barry et al., 1980). The attenuator terminates approximately 80% of the transcripts reading through the L12 gene and accounts, in part, for the reduced stoichiometry of R N A polymerase relative to ribosomes in growing bacteria (Dennis, 1977a, 1984; Shephard et al., 1980). 2. SIZE F R A C T I O N A T I O N O F R N A TRANSCRIPTS The size distribution of R N A transcripts from the rplKATL-rpoBC gene cluster was analyzed by sucrose density-gradient centrifugation and Northern hybridization. Nascent R N A transcripts from an exponential culture were labelled wi th [ 3H]uracil for 3 min and size-fractionated by sucrose density-gradient centrifugation. Fractions from the gradient 4. rplKATL-rpoBC 50 RADIOACTIVITY (CPM/O.lul) 0 5 10 15 20 25 30 35 TOP FRACTION .FIGURE 8. Sedimentation analysis of total R N A . A 5 m l bacterial culture was labelled for 3 min with [ 3H]uracil, rapidly harvested and lysed, and was immediately sedimented through a 6 to 30% sucrose density-gradient. Fractions of 0.3 m l were collected. Upper panel: distribution of total radioactivity incorporated into R N A (cpm per 0.1 ul). Lower panels: distribution of m R N A sequences complementary to the four different D N A hybridization probes described in figure 6. Midd l e panel: L l l - L l m R N A (0) and L10-L12 m R N A (•). Lower panel: B m R N A (0) and B' m R N A (•). The positions of mature 16S and 23S r R N A are indicated. There has been no correction of the hybridization data for the sizes of the different D N A probes. 4. rplKATL-rpoBC 51 were hybridized to specific D N A probes i n order to estimate the relative amounts and molecular lengths of the L l l - L l , L10-L12, p and p' m R N A sequences (fig. 8). The L l l - L l m R N A sequences were found i n transcripts of about 2600 and 1300 nucleotides i n length at a molar ratio of about 3 : 1 . The L10-L12 m R N A sequences were also found i n transcripts of about the same sizes but in a molar ratio of about 3 : 2. The major 2600 nucleotide transcript probably corresponds to the tetracistronic m R N A initiated at the P U 1 promoter and terminated at the attenuator site in the L12-P intergenic space; this transcript hybridizes to both the L l l - L l and the L10-L12 probe D N A s . The shorter molecules of around 1300 nucleotides probably correspond to the separate bicistronic transcripts of the L l l - L l and the L10-L12 genes. The two shorter transcripts could arise by processing of the long tetracistronic transcripts. However, the molar excess of the downstream L10-L12 sequences suggests that at least some of these transcripts arise from promoter activity i n the L1-L10 intergenic space. The size distributions of the p and P' m R N A transcripts were similar but heterogeneous with about two-thirds of the sequences in molecules greater than 3000 nucleotides long. The heterogeneous distribution probably results from the fact that the synthesis time of the intact 9000 nucleotide PP' m R N A molecule (about 3 min) is greater than the average half-life of m R N A (about 1.5 min). This means that many nascent molecules are simultaneously being elongated at their 3' ends, degraded at their 5' ends and translated by ribosomes i n the region between the 3' and 5' ends. Few, if any, full-length 9000 nucleotide long molecules wou ld be expected. The size distribution of rp lKATL m R N A sequences observed in the sucrose density-gradient profile was confirmed by Northern hybridization analysis (fig. 9). Total in vivo 4. rplKATL-rpoBC 52 A B C 2 6 0 0 = 1 3 0 0 I" W - 2 5 2 7 • - 1 7 3 7 • - 8 4 9 « - 7 2 9 | ~ 6 2 3 . F I G U R E 9. Northern hybridization analysis of L l l - L l and L10-L12 m R N A . Total R N A (10 ug) was fractionated on an agarose/formaldehyde gel, transferred to nitrocellulose and probed wi th pPJ-labelled, nick-translated restriction fragments. Lane A : the probe was the 617 nucleotide EcoRI-BgUI fragment spanning the L l l - L l genes. Lane B: the probe was the 290 nucleotide Hindl l l -EcoRI fragment spanning the L10-L12 genes. Lane C: the molecular length markers were 5' end-labelled H a e i n fragments of M 1 3 m p l l and are indicated i n nucleotides. 4. r p lKATL- rpoBC 53 R N A was fractionated on a denaniring agarose gel and probed with radioactive D N A fragments. The L l l - L l probe was the 617 bp EcoRI-Bgffl fragment (nucleotides 230 - 897; fig. 6) and the L10-L12 probe was the 290 bp Hindin-EcoRI fragment (nucleotides 2154 -2444). Both probes hybridized to the 2600 nucleotide tetradstronic R N A transcript. Each of the probes hybridized also to smaller transcripts of about 1300 nucleotides, which represent the bicistronic L l l - L l and L10-L12 m R N A species, respectively. A s observed in the sucrose density-gradient profile, the relative abundance of the bicistronic L10-L12 m R N A sequence appears to be greater than the L l l - L l m R N A sequences. 3. SI N U C L E A S E M A P P I N G The 5' and 3' ends of R N A transcripts arise from transcription initiation or termination, from R N A processing, or from R N A degradation. The transcript ends derived from the rplKATL-rpoBC gene cluster were located on the D N A sequence by SI nuclease mapping. Appropriate sequencing ladders were used for resolution of transcript ends at the nucleotide level. The nucleotide numbering system in this chapter is according to Post et al. (1979). The results obtained are summarized in figure 6. These SI nuclease transcript mapping experiments were carried out using R N A isolated from bacteria growing at rates of 2.00 (glucose plus casamino acids), 1.10 (glucose) and 0.83 (glycerol) doublings per hour. The results presented here used total in vivo R N A from the glucose-grown culture; the results with the other R N A s were qualitatively similar and no obvious differences were ap-parent. 4. r p lKATL- rpoBC 54 (a) T H E N u s G - L l l I N T E R G E N I C R E G I O N The N u s G - L l l intergenic space contains the characteristic inverted repeat symmetry and T-rich sequence associated with Rho-independent terminators as wel l as the -10 and -35 recognition sequences of R N A polymerase (fig. 10). A 346 bp A v a i l - A v a l fragment was used to locate the site of termination of nusG gene transcripts, to locate the site of initiation of P L U transcripts and to determine the degree of transcription read-through from the nusG gene into the L l l ribosomal protein gene. Hybridization of the probe, 3' end-labelled at the A v a i l site in the nusG gene, to total R N A resulted in a protected fragment of about 200 nucleotides (fig. 10, lane E). This positions the 3' end of the nusG gene transcripts at about nucleotides 82 to 87 on the D N A sequence that is preceded by inverted repeat symmetry. Use of the same D N A probe, 5' end-labelled at the A v a l site in the L l l gene resulted in a protected fragment 150 to 160 nucleotides long (fig. 10, lane D). This fragment was sized by electrophoresis alongside the Maxam-Gilbert G and A+G sequencing ladder. The length of the predominant fragment, about 157 nucleotides long (lane F), corresponds to the C residue at position 77; this site is preceded by the -10 and -35 R N A polymerase recognition signals of the P U 1 promoter and is within one nucleotide of the point identified by m vitro transcription studies (Taylor and Burgess, 1979; Post et al., 1979). The negligible amount of protection of the full-length D N A probe in these experiments may be due to either reannealing of the double-stranded probe or to protection by a small amount of read-through transcript. Such read-through transcripts, if they exist, wou ld contribute little to ribosomal protein gene transcription. The transcription start point for the L l l - L l b i - and tetracistronic transcripts at nucleotide 77 is located within the second half of an inverted repeat symmetry that also 4. r p lKATL- rpoBC 55 . F I G U R E 10. Nuclease SI mapping of transcript ends derived from the N u s G - L l l intergenic  region. The nucleotide sequence scale and the N u s G - L l l intergenic region are illustrated (top). The open rectangle below represents the 346 bp A v a i l - A v a l probe used to map transcript ends of transcripts in the intergenic space: the lengths of the 5'-protected fragments are illustrated above and the 3'-protected fragments below the open rectangle. Restriction site designation and positions are given in figure 6 (n, nucleotides). Autoradiograms of nuclease S i protection products are shown (middle); T: top of gel, B: bottom of gel. The designations are: lane A , molecular length standards (3' end-labelled M s p l fragments of pBR322 with lengths of 623, 528, 405, 310, 243, 239, 218, 202, 191, 181, 161, 148, 123, 111, 91, 77 and 68 nucleotides); lane B, 5' end-labelled 346 nucleotide A v a i l -A v a l probe; lane C , 5' end-labelled probe protected by r R N A ; lane D , 5' end-labelled probe protected by total R N A ; lane E, 3' end-labelled probe protected by total R N A ; lane F, 5' end-labelled probe protected by total R N A alongside the Maxam-Gilbert G and A + G reaction products. For lane F, the probe was 5' end-labelled only at the A v a i l site. The D N A sequence in the region surrounding the 3' and 5' transcript ends is illustrated (bottom). The positions of the 3' and 5' ends are indicated as wel l as putative secondary structures i n the R N A transcript. 4. r p l K A T L - r p o B C 100 _ l (NuaG) I A l l 3 • » I I 100 _| 200 _| fun (I57n> (200nl -*J 1 I fl:STHNOHROS B: 5' HI- N i l , PROBE G: 5' HI fill, rRNH 0: 5' HI- HI I E: 3' HI- HII I F: 5' HI- HII I * fl*6 fl-6—HHH6-G-66HHHH-C R " - T 6 fl 6 - C T — fl T - R C - 6 H - T G - C bo - 6 • T B - C fl-T G - C G - C r - 1 T . G T . G l r m I B - T 6 - c T ( 5 E H D ) T _ " C - G T-fl G - C T - R R R T C G T T G C R C R R G - C T T T T G T T - f l C G fl T T . . . 3 " I 4 0 B 0 ( 3 1 END) F I G U R E 10 4. rp lKATL- rpoBC 57 constitutes a portion of the termination signal for transcripts of the upstream nusG gene. Although there is little or no cotranscription of the nusG and the L l l - L l ribosomal protein genes, there may be some regulatory interaction between the overlapping terminator and promoter signals. (b) T H E L1-L10 I N T E R G E N I C R E G I O N The L1-L10 intergenic space contains the -10 and -35 signals associated wi th the L10 promoter but lacks any recognizable Rho-independent signals (Piatt, 1986; Yager and von Hippe l , 1987) for terminating L l l operon bicistronic transcripts (fig. 11). The 1257 bp BglTJ-HindlTJ fragment was used to identify uninterrupted transcripts spanning the L1-L10 intergenic space as wel l as 3' and 5' transcript ends generated within this region. Both 5' and 3' end-labelled probes exhibited a 1257 nucleotide, full-length fragment as the major protection product (fig. 11: panel I, lanes A and B); these products were derived presumably from protection by the 2600 nucleotide tetracistronic m R N A observed i n the sucrose gradient (fig. 8) and Northern analyses (fig. 9). The less abundant bicistronic L l l - L l and L10-L12 m R N A s provided partial protection of the respective end-labelled Bgin-HindUI probes. The probe, 3' end-labelled at the B g l l l site i n the L I gene, resulted in fragments of about 420 to 460 nucleotides and a series of multiple fragments ranging i n size from about 650 to 750 nucleotides (fig. 11: panel I, lane A ) . The set of shorter fragments corresponds to protection by a L l l - L l transcript with a 3' end just beyond the L I gene (nucleotides 1320 to 1360). The set of longer fragments result from protection by L l l - L l transcripts wi th 3' termini i n the region between nucleotides 1540 to 1650 in the D N A sequence. 4. r p l K A T L - r p o B C 58 . F I G U R E 11. Nuclease SI mapping of transcript ends derived from the L1-L10 intergenic  region. The nucleotide sequence scale and the L1-L10 intergenic region are illustrated (top). The open rectangles below represent various restriction fragments used to map transcript ends. These are: (i) a 1257 bp B g l l l - H i n d i n fragment labelled at either the 5' or 3' end; (ii) a 198 bp HinfI-Fnu4HI fragment 3' end-labelled at the H i n f l site; (iii) a 435 bp HinPI-Dral fragment labelled at either the 3' end (HinPI site) or the 5' end (Dral site) and (iv) a 121 HinPI-Hinf l fragment 5' end labelled at the H i n f l site. The lengths of the 5' and 3' protected fragments are illustrated above and below each rectangle, respectively (n, nucleotides). The "F" at the ends of the B g l l l - H i n d i n fragments designates full protection by the tetracistronic read-through transcripts. Restriction site designations and positions are given in figure 6. Autoradiograms of nuclease SI protection products are shown (middle); T: top of gel, B: bottom of gel. The D N A probes protected with total R N A are: Panel I, lane A , the 3' end-labelled B g l l l - H i n d i n fragment; lane B, the 5' end-labelled BgLU-HindHT fragment; Panel II, lane C, the 3' end-labelled HihfI-Fnu4HI fragment; Panel III, lane D , the 3' end-labelled HinPI-Dral fragment; Panel I V , lane E, the 5' end-labelled HinPI-Dral fragment and Panel V , lane F, the 5' end-labelled HinPI-Hinf l fragment. The probes in lanes C to F are labelled only in the minus strand, and the Si-protected products are electrophoresed alongside the Maxam-Gilbert A and A+G reaction products. The D N A sequence i n the region surrounding the 3' and 5' transcript end sites are illustrated (bottom). The positions of the 3' and 5' ends are marked and a potential secondary structure i n the m R N A is indicated. won l I Mil l I /too 1 t t tt HI H P F n HI | » - l 1 M l i i i l | • I I ,MM. 1 4 2 0 4 6 0 n l It I 6 S 0 ? 5 0 n l - t n , ' l u i 4 - 1 « J 11 i t , i n ( • • • n i i i h i i j * . i , v i m i , ' i i n i -»J -«J -»J I 2 9 7 n ( U 4 7 n l I 7 i n l r* Panel 1 , " . i/i — « H: 5 B - H II 5 I N Panel II s i H B C fl B fl G G G G 6 6 C: 5 ' H»- F n G T 1,11 I. 111,11 IIII III! II Panel III T i l i B I | j II 1 HI- II I I I H i l l I 6 fl'G ( - S B B - f l - G G - G B HI, I, G - - H - - G — A G G G B - G G B G G — G G B Panel IV Panel V G - G - - - B flflfl-BHG-HB G fl*G i. Bi.BB (.i.i.i.i. i. n .T • C. 6 T i B T C ' T - H ' T - « - 1340 fl-T T - G - C ' 6 • T G • T _ _ C ." | P L , o | G - C G - c I ( 5 - END) 5 - . . . T A R T G C C T T T R C G T f - t t C I t f I • 1 I 1 t i t l 1 ...3' H ( 3 ' END) 13 ' END) 1480 1900 5 ' . . . T C R C R R 6 C T G R R T R G C G R C 6 6 R T R G R R R R G R T T T G T . . . 3 ' I ( 5 ' END) M M " « 5 ' . . . T C G T T G G R G C C T G G C C T R T C C R G G C C T C C 6 T C G R R . . . 3 ' ( 3 ' END) 1 5 ' . . . R f l C T T R R T C C C C T G C G T R G H C G G T G R C R G R f l C G C T . . . 3 ' ( 3 ' END) 1 5 ' . . . R T R T T C T G G C T T G T T T C T G C T C R C C G T R R T T R R G f l . . . 3 ' ( 3 ' END) 1 F I G U R E 11 4. r p l K A T L - r p o B C 60 The same D N A probe, when 5' end-labelled at the H i n d i n site in the L10 gene, yielded fragments of about 810 and 660 nucleotides long (fig. 11: panel I, lane B). The 810 base fragment places the m R N A 5' end near the P u o promoter around nucleotide 1350. The major 660 base fragment protected by L10-L12 m R N A corresponds to a 5' transcript end near position 1500, a region in which no promoter activity has been detected. More precise mapping of the positions of these 5' and 3' transcript ends was carried out using shorter restriction fragments and electrophoresing the protected fragments next to the Maxam-Gilbert G and A+G sequencing ladder. The less prominent 3' transcript ends in the region between nucleotides 1320 and 1360 were visualized using the 198 nucleotide HinfI-Fnu4HI fragment 3' end-labelled only at the H i n f l site at nucleotide 1209 (fig. 11: panel n , lane C). The protected fragments of 121 nucleotides and 146 to 149 nucleotides correspond to 3' transcript ends at or near nucleotides 1320 and 1356 to 1360, respectively. Neither site exhibits identifiable termination-like sequences. The 3' transcript ends in the region between nucleotides 1540 and 1650 were located by using a 435 nucleotide HinPI-Dral fragment 3' end-labelled only at the HinPI site at nucleotide 1294 (fig; 11: panel i n , lane D). Major protected fragments of 244 to 246, 297 to 300 and 347 to 350 nucleotides were apparent and correspond to 3' transcript ends at positions 1537 to 1539, 1591 to 1594 and 1641 to 1644, respectively. Again , none of these regions exhibits identifiable tenrtination-like sequences. The 5' transcript ends i n the region between the L I and L10 genes were precisely located using a 435 nucleotide HinPI-Dral fragment 5' end-labelled only at the Dra l site at nucleotide 1728 i n the L10 coding sequence (fig. 11: panel IV, lane E). The major protected fragment of 223 to 228 nucleotides corresponds to a 5' transcript end at nucleotides 1500 to 4. r p lKATL- rpoBC 61 1503. N o promoter activity has been detected in this region, and the sequences i n the region show no similarity to promoter consensus signals. A second, less prominent protected fragment of about 380 nucleotides long was apparent in lane E. The 5' end of this second transcript was located by using a HinPI-H i n f l fragment 5' end-labelled only at the H i n f l site at nucleotide 1419 (fig. 11: panel V , lane F). The protected products represent a graduated series. The largest protected fragment is 73 nucleotides long and corresponds to nucleotide position 1346; the series extends wi th decreasing intensity down the sequencing ladder. Similar results were obtained using different concentrations of SI nuclease and digestion temperatures, and different D N A probes. The position of the longest 5' transcript end at nucleotide 1346 is preceded by the -10 and -35 R N A polymerase recognition signal of the P L 1 0 promoter. The L1-L10 intergenic space contains five distinct 3' end sites for L l l - L l bicistronic transcripts and two distinct 5' end sites for L10-L12 bicistronic transcripts. There are no obvious termination signals associated with any of the five 3' end sites or anywhere else in the intergenic region. Similarly, no corresponding 5' end sites (the other product of an endonuclease cleavage) have been observed near or downstream from any of the major 3' end sites, although such 5' transcript ends could be less stable and escape detection by SI analysis. The two L10-L12 m R N A 5' transcript end sites are both located upstream from the three major L l l - L l m R N A 3' transcript end sites. Consequently, none of these ends are likely the reciprocal products generated by an endonuclease cleavage of the tetracistronic transcript. The most prevalent 3' end site at nucleotide 1594 occurs immediately downstream of the binding site for the L10 translational control protein. This means that these L l l - L l 4. rp lKATL- rpoBC 62 bicistronic transcripts can potentially bind L I protein near its 5' end and L10 protein near its 3' end. It is possible that binding of excess L10 protein to nascent L l l - L l transcripts elicits R N A polymerase pausing and transcription termination beyond this site. Such a mechanism could regulate, to some extent, the synthesis of L10-L12 m R N A sequences. Insertion of transposon Tn5 into plasmids carrying this region of the bacterial chromosome have defined the limits of the P u o promoter region between nucleotides 1282 and 1360; insertions at 1360 and beyond are polar on the expression of the L10, L I 2 and P genes in vivo (Hui et al., 1982). In vitro, R N A polymerase binding and transcription studies are in agreement wi th this result and position the major start site at 1347 to 1348 (Post et al., 1979; Taylor and Burgess, 1979). By SI nuclease mapping, the 5' end of putative PL 1o-initiated in vivo transcripts is heterogeneous; the most prominent end corresponds to position 1346 wi th other ends appearing at one-nucleotide increments extending beyond position 1360. The heterogeneity may be due to processing at the 5' end of the P L 1 0-initiated transcript or to artefacts caused by SI nucleolytic activity at the end of the R N A - D N A hybrid. However, this result appears to be independent of the SI concentration and the digestion temperature. Decay of transcripts in a net 5' to 3' direction in E. coli has been proposed by Cannistraro and Kennell (1985) and Portier et al. (1987). However, since no 5' to 3' exonuclease activity has been isolated, this decay may be due to 3' to 5' exonucleolytic processing following an initial endonucleolytic cleavage. The second and more abundant 5' end site for bicistronic L I 0-L12 transcripts is situated at nucleotide 1500. This end appears to be generated by R N A processing and not by transcription initiation since there are no recognizable -35 and -10 promoter consensus sequences i n this region, and insertion of Tn5 140 nucleotides i n front of this site is polar on downstream genes (Hui et al., 1982). Transcripts beginning at this site retain the intact 4. r p l K A T L - r p o B C 63 binding site for the L10 translational regulatory protein. The sequence at this 5' transcript terminus bears some similarity to the sequence at a prominent 5' transcript end in the leader region of the secE-nusG m R N A (see section 3.2.2). Whether or not this similarity signifies a common regulatory mechanism remains to be determined. Finally, the generation of a l l transcript ends, both 5' and 3', within the L1-L10 intergenic space is not altered i n the mutant strain defective in RNasein activity; if any of the transcript ends are generated by processing, RNasein most likely is not involved (data not shown). (c) T H E L10-L12 I N T E R G E N I C R E G I O N The ribosome contains four copies of L I 2 protein and only single copies of al l the other ribosomal proteins. To account for this stoichiometry, it has been suggested that the L10-L12 intergenic space contains a promoter which specifically enhances transcription and expression of the L12 gene (Newman et al., 1979; M a et al., 1981; Railing and L inn , 1984). A 290 nucleotide Hindm-EcoRI fragment, 5' end-labelled at the EcoRI site within the L12 gene, was used to detect transcripts initiated in the L10-L12 intergenic space (data not shown). Only the full-length 290 base fragment resulting from protection by either the bicistronic L10-L12 m R N A or the tetracistronic m R N A was observed; no transcription initiation was detected in the L10-L12 intergenic space. This suggests that the L I 2 message is translated more efficiently than the co-cistronic L10 message upstream, i n order to account for the 4 : 1 molar ratio of L12 to L10 and to al l other r-proteins. Noncoordinate expression, achieved solely at the translational level, has also been observed i n the t rmD operon; this operon is transcribed as one polycistronic 4. rp lKATL- rpoBC 64 m R N A that encodes r-protein SI 6, an unknown 21K protein, a tRNA-methytransferase and r-protein L19, in that order (Wikstrom and Bjork, 1988). Under steady state conditions, the amount of r-proteins S16 and L19 is about 12 times higher than the amount of the 21K protein and about 40 times higher than the amount of the T rmD protein. It has been suggested that codon usage i n E. coli is modulated for gene expression, i.e. highly expressed genes contain few or no rare codons (review: de Boer and Kastelein, 1986) . This relationship was demonstrated for the t rmD operon (Wikstrom and Bjork, 1988). However, i n the rplTL operon, the increased translation of L I 2 relative to L10 is not likely due to biased codon usage since the codons used i n both genes are those recognized efficiently by the most abundant t R N A species (Post et al., 1979). There is some evidence that secondary or tertiary structure which may shield or expose the ribosome binding site (RBS) and the A U G initiation codon can be an important factor in controlling translation efficiency of m R N A (Kastelein et al., 1983; Queen and Rosenberg, 1981; Munson et al., 1984; Looman et al., 1986; Berkhout and van Fuin, 1985). The codon following the A U G initiation codon may also be involved in translational regulation, presumably by its effect on the RBS structure (Sherer et al., 1980; Looman et al., 1987) . However, i n the L10-L12 intergenic region, there are no obvious secondary structures which might enhance translation. Others have suggested that sequences 5' to the RBS can affect translation without involving secondary structures (Boyen et al., 1982; Stanssens et al., 1985). Interestingly, the D N A sequences upstream from the initiation codon of the L19 gene and the L I 2 gene are both AT-rich; this has been suggested to be an important feature of the translation initiation region of some heavily translated m R N A s (McCarthy et al., 1985). Whether or not this is the mechanism of translational enhancement of L I 2 expression remains to be determined. 4. rp lKATL- rpoBC 65 (d) T H E L12-B I N T E R G E N I C R E G I O N The L12-B intergenic region contains a transcription attenuation site that terminates about 80% of the transcripts entering the intergenic region (Dennis 1977a, 1984; Barry et al., 1979, 1980). Transcripts that read through the attenuator contain a potential downstream RNase l l l processing site (King et al., 1986; Gegenheimer and Apir ion , 1981). Processing p_er se has no detectable effect on expression of the B and B' R N A polymerase genes; however, a sequence in the vicinity of the processing site appears to be essential for efficient translation of the downstream m R N A sequences (Dennis, 1984). The 1080 nucleotide EcoRI fragment, either 5' or 3' end-labelled, was used to further characterize the activity of these two intergenic regulatory sites (fig. 12). Using a 3' end-labelled 1080 bp EcoRI fragment, three major fragments of 240 to 270 nucleotides were protected by total R N A (fig. 12, lanes A to C). The two minor bands of 325 and 1080 bases correspond to protection by RNase l l l processed m R N A and by unprocessed m R N A , respectively. Using total R N A from a RNaselll" mutant (N2077) (fig. 12, lane B), the 325 base protected fragment disappeared and the amount of the full-length 1080 base fragment was correspondingly increased. When the EcoRI probe was labelled at the 5' end, protection products of 750 and again 1080 bases were observed (fig. 12, lane D). The 750 base product resulted from protection by the reciprocal portion of the RNase l l l processed transcript; i n the RNaselll" mutant, this fragment also disappeared and the intensity of the full-length fragment accordingly increased (data not shown). These 3' m R N A ends were mapped more precisely by using a 395 base Hinfl-AccI fragment 3' end-labelled only at the H i n f l site at nucleotide 2552 (fig. 12, lane E). Using 4. rp lKATL- rpoBC 66 . F I G U R E 12. Nuclease S i mapping of transcript ends derived from the L12-B intergenic  space. The nucleotide sequence scale the the L12-B intergenic region are shown (top). The open rectangles below represent various restriction fragments used to map transcript ends. o These are: (i) a 1080 bp EcoRI fragment labelled at either the 3' or the 5' end; (ii) a 395 bp "Hinfl-AccI fragment 3' end-labelled at the H i n f l site and (iii) a 336 bp Nar l -Hin f l fragment 5' end-labelled at the H i n f l site. The lengths of the 5' and 3' protected fragments are illustrated above and below each rectangle, respectively (n, nucleotides). The "F" at the ends of the EcoRI fragment designates some full-length protection by read-through transcripts. Restriction site designation and positions are given i n figure 6. Autoradiograms of nuclease SI protection products are shown (middle); T: top of gel, B: bottom of gel. D N A probes protected wi th total R N A are: lanes A to C, the 3' end-labelled EcoRI fragment; lane D , the 5' end-labelled EcoRI fragment; lane E, the 3' end-labelled Hinfl-AccI fragment; lane F, the 5' end-labelled Nar l -Hinf l fragment. The R N A s used for protection in lanes B and C were from isogenic rnc" and rnc* strains, respectively. The probes in lanes E and F are labelled only in the minus strand, and the SI reactions are electrophoresed alongside the Maxam-Gilbert A and A + G reaction products. The D N A sequence i n the regions surrounding the 3' and 5' ends-are shown and some potential secondary structures in the m R N A s are illustrated, i.e. the attenuator (upper) and the RNase l l l processing site (lower). 4. r p l K A T L - r p o B C 2400 2600 2800 3000 3500 (240-270nl - » U J • ! (325n) (t38,148,l64n) (223n) r*- I284n) r * 5' 90 O 2 S I I S I S i H: 3' B-fl B: 3' H-B (rnc") C: 3 R-B (rnc*) D: 5' B-R E: 3 HI Hi G B+6 fl-BGG-RRRRGG—GG-GR -RRRRBG—R—HG--B--BG GRB-BRRGR-RG-G—GBR (3' END) 13' END) 5 , . . . T R R 6 C C R R C C C T T C C G G T T G C - 6 R T 6 - C T T T T 6 C G C T 6 T . 3 ' (3 END) 2780 (5 ENO) 5 \ 3" C C T T T C R f l T G C T T 6 T T ' C T R T C R C 6 C T T R R ' I I I I I I I I I I • I I I I I I I I I I I I I I I I I 6 R R R G T T R C 6 6 R C R fl. G R T R 6 T 6 C 6 R R T T . G C '6 ' 2890 2870 F I G U R E 12 4. rp lKATL- rpoBC 68 this probe, the three major fragments were resolved as heterogeneous 3' transcript ends ranging in length from 164 to 173 nucleotides, 148 to 152 nucleotides and 138 to 142 nucleo-tides. The longest set of fragments corresponds to the previously defined termination site, recognized as a transcription attenuator, at nucleotides 2716 to 2719 (Post et al., 1979; Barry et al., 1980; Rail ing and Linn , 1987). The sequence at this site consists of four consecutive T residues and is preceded by a region of GC-r ich inverted repeat symmetry characteristic of Rho-independent terminators (Reviews : Piatt; 1986; Yager and von Hippel , 1987). The two shorter sets of fragments, 148 to 152 bases long and 138 to 142 bases long, correspond respectively to 3' transcript ends within and preceding the inverted repeat sequence (fig. 12) at nucleotides 2700 to 2704 and at nucleotides 2690 to 2694: these fragments may be artifacts due to S i nibbling at the ends of R N A - D N A hybrids. The potential for base interactions at the 3' end of transcripts terminated near nucleotide 2717 could generate unusual structures in the R N A - D N A hybrids (i.e. cruciforms), which might be sensitive to SI attack. Alternatively, these fragments might represent alternative termination sites that have not been resolved and identified. These multiple 3' ends have been observed in a l l E. coli strains examined and are independent of SI nuclease concentration and digestion temperature. This pattern of multiple ends was not observed by Barry et al. (1980), possibly because their method was less sensitive than that employed here. However, since completion of the transcript analysis presented here, Railing and L i n n (1987) have reported a similar pattern of 3' transcript ends, with one exception, i n the L12-p intergenic region; they d i d not observe the m R N A species whose 3' terminus was situated at nucleotides 2690 to 2694. Although the attenuator resembles a simple factor-independent terminator, the function of this structure appears to be more complex than that of a constitutive terminator. The attenuator is postulated to be a dynamic structure where the frequency of termination 4. r p l K A T L - r p o B C 69 can be modulated. For example, when R N A polymerase transcription capacity is inhibited in a temperature-sensitive E. coli mutant (XH56), increased transcription of the downstream p and p' R N A polymerase genes is thought to result from a lower frequency of transcript tennination at this site (Dennis, 1977b; Kirschbaum, 1978) (see below). Other examples of attenuation in r-protein operons are seen in the S15, S21 and S10 operons (Regier and Portier, 1986; Burton et al., 1983; Freedman et al., 1987; Lindahl et al., 1983). Except for the S10 operon, transcription attenuation is used in these instances to down-regulate the transcription of non-ribosomal genes such as the polynucleotide phosphorylase gene (pnp) i n the SI 5 operon, and the D N A primase (dnaG) and R N A polymerase o subunit (rpoD) genes i n the S21 operon. A s described previously (section 1.1.3(2)), the S10 operon is unique among r-protein operons. The protein product of the third gene in this operon, protein L4, not only acts as the translational repressor but also causes transcription termination in the leader region of the operon (Freedman et al., 1987; Lindahl,et al., 1983). N o model explaining attenuation at this site has been proposed. Transcription-attenuation is also used to regulate amino acid biosynthetic operons i n E. coli. In this case, the mechanism of attenuation has been elucidated : transcription termination is translationally regulated and occurs in the leader regions of these operons. Similar mechanisms of transcription attenuation regulate pyrimidine biosynthetic operons, the ampC operon and the tryptophanase operon among others (Review : Landick and Yanofsky, 1987). However, the mechanism of modulation of transcription attenuation in the L12-P intergenic region is not known. Transcription termination in E. coli can be factor-independent or it can involve a number of different factors which interact wi th the R N A 4. rp lKATL- rpoBC 70 polymerase core enzyme. These transcription termination factors include Rho protein, the Nus proteins (such as N u s A , NusB, NusE and NusG) and the sfrB gene product (Review : Yager and von Hippe l , 1987). Based on R N A filter hybridization results of various nus,  rho and sfrB mutants, Rail ing and L i n n (1987) have suggested that Rho and N u s A may regulate the frequency of transcription termination at the attenuator, even though the attenuator resembles a factor-independent terminator. In agreement wi th this hypothesis, Chamberlin et al. (1987) have identified two factors, Tau and N u s A , which act at Rho-independent sites i n vitro to reflect the accuracy and efficiency of termination in vivo. The specificity of these factors suggests that there may be several classes of Rho-independent terminators. Railing and L inn (1987) have proposed that Rho normally increases the frequency of termination at the attenuator i n the L12-(3 intergenic region and that N u s A and the sfrB gene product decrease this frequency. However, it is conceivable that these termination factors act at a site distal to the attenuator since no obvious differences in the pattern of S i protected fragments were seen between these mutants and the wild-type. The 3' end of the transcript created by RNase l l l processing protected about 223 nucleotides of the 395 base Hinfl-AccI probe and corresponds to endonuclease cutting between positions 2775 and 2778. A much less prominent protected fragment about ten nucleotides longer and corresponding to cutting at nucleotides 2785 to 2788 was barely apparent (data not shown). The 5' end of the reciprocal RNase l l l processed transcript was localized using the 336 base Nar l -Hin f l fragment 5' end-labelled only at the H i n f l site at nucleotide 307 (fig. 12, lane F). The major protected fragment was 283 to 285 bases and corresponds to a 5' end site at nucleotides 2786 to 2788. Both of the RNaselll-dependent 3' and 5' transcript ends are located within the first half of an inverted repeat symmetry that is capable of forming 4. rp lKATL- rpoBC 71 a duplex structure in the m R N A . Processing results in generation of a 3' end and a 5' end that are separated by about ten nucleotides. This implies either that RNasein cuts at two positions (separated by about one helical turn) or that one of the products of a single en-donuclease cut is rapidly trimmed by about ten nucleotides. There does not appear to be any significant promoter activity in the L12-P intergenic region. The role of RNase in processing of PP' m R N A transcripts remains unclear. The results reported here indicate that, at a given time, only about half of the transcripts spanning the 1080 bp EcoRI fragment are processed in an rnc + (RNaseffi+) genetic background. This may mean that processing of the m R N A is either slow or incomplete. In an rnc" background, there was no detectable processing and no obvious effect on (3 and P' gene expression. Possible functions of RNasein processing are discussed below (section 4.2.2(2)). 4.2.2 D I F F E R E N T I A L R E G U L A T I O N O F rplKATL A N D rpoBC Although the PP' genes are co-transcribed with the upstream ribosomal protein genes, regulation of PP' synthesis is distinct at both the translation level and the transcriptional level. It has been proposed that differences in transcriptional activities, during restriction of R N A polymerase activity or during the stringent response, can be attributed to modulation of transcription initiation at promoters P U 1 and P u o and termination at the attenuator (Dennis, 1977b; Little and Dennis, 1980). To clarify the mechanism of transcriptional regulation of rpoBC, transcripts produced under these restrictions were examined by SI nuclease mapping. 4. rp lKATL- rpoBC 72 Two sets of E. coli mutants were used. Strain XH56 has a temperature-sensitive mutation in rpoC which is initiation defective and thus lethal to the cell at 42°C but only semi-restrictive at 39°C. Strain NF536 (relA +) has a temperature-sensitive va ly l - tRNA synthetase which elicits the stringent response at the semiTrestrictive temperature of 35.5 to 37°C; NF537 is the isogenic relA strain and exhibits the relaxed response (Dennis and Nomura, 1974; Maher and Dennis, 1977). In vivo transcripts produced by these strains at the permissive and semi-restrictive temperatures were analyzed by (i) filter hybridization to various D N A probes to measure relative transcriptional levels of the rplKATL-rpoBC sequences and (ii) SI nuclease mapping to locate 5' and 3' transcript ends. Observed differences i n transcript levels of rp lKATL and rpoBC may be due to relative changes in transcript synthesis or degradation. In order to answer this question, the relative decay rates of rplKATL-rpoBC transcripts from the strain XH56 were determined at the permissive and semi-restrictive temperatures. 1. FILTER H Y B R I D I Z A T I O N Total cellular R N A from exponential or semi-restricted cultures was analyzed by filter hybridization to D N A probes as described above (section 3.2.1). The percent of input radioactivity hybridizing per nucleotide of probe D N A was calculated (table 4). A large change i n transcript levels was observed with strain XH56. A temperature shift from 30 to 39°C resulted in almost a 5 fold increase in the transcription of B m R N A and only a 1.6 fold increase in the transcription of L10-L12 m R N A . The ratio of distal to proximal m R N A increased dramatically from 0.18 to 0.54. These results agree with previously published measurements (Dennis, 1977b). 4. rp lKATL- rpoBC 73 . T A B L E 4. Filter hybridization of pulse-labelled R N A s isolated from strains XH56, NF536  and NF537. (a) The various probes complementary to m R N A transcripts from ribosomal protein and R N A polymerase genes are described i n figure 6 and in Methods and Materials (section 2.7.2). The length of each sequence complementary to m R N A is indicated in parentheses (n, nucleotides). (b) The percentage of the input radioactivity i n specific R N A - D N A hybrids is the average of 8 hybridizations (see Dennis, 1984). Input radioactivity was varied over a 4-fold range from 50 p i (about 12.5 pg) to 200 u l input R N A (about 50 pg). XH56, 30°C : from 1.32 X 105 to 5.28 X 10 s cpm 39°C : from 4.65 X 104 to 1.86 X 10 s cpm NF536, 30°C : from 1.49 X 105 to 5.96 X 10 s cpm 35.5°C : from 5.50 X 10* to 2.20 X 10 s cpm NF537, 30°C : from 1.34 X 105 to 5.36 X 10 s cpm 35.5°C : from 2.27 X 10s to 9.08 X 10 s cpm (c) The percentage hybridization per nucleotide of complementary sequence in each of the D N A probes was calculated as the quotient of the percentage hybridization and the probe length . This value is an estimate of the transcriptional activity of each of these D N A sequences. The transcriptional activity of the sr?c gene at 30°C was used as an external control and arbitrarily set at 1.00. (d) The ratio of P m R N A to L10-L12 m R N A was calculated as the quotient of the relative transcriptional activities of the p and the L10-L12 genes. 4. r p l K A T L - r p o B C T A B L E 4 FILTER H Y B R I D I Z A T I O N O F P U L S E - L A B E L L E D R N A S I S O L A T E D F R O M STRAINS XH56, NF536 A N D NF537 Probe D N A " hybridization b (%) % hybridiz per 0 nucleotideXlO 4 relative transcriptional activity ratio " B m R N A L10-L12 m R N A 30°C 39CC 30°C 39°C 30°C 39°C 30°C 39°C XH56 (rpoC 8) L l l -L l (617n) 0.112 0.170 1.81 2.76 0.73 1.10 L10-L12(653n) 0.160 0.253 2.45 3.87 0.99 1.56 B(2868n) 0.130 0.597 0.455 2.08 0.18 0.84 0.18 0.54 spc(9000n) 2.23 2.50 2.48 2.78 1.00 1.10 a(700n) 0.127 0.169 1.81 2.41 0.73 0.97 3 0 ^ 35.5°C 3 0 ^ 35.5°C 30°C 35.5°C 30°C 35.5°C NF536 (reLV) L l l - L l 0.079 0.040 1.28 0.64 0.59 0.29 L10-L12 0.128 0.091 1.95 1.39 0.89 0.64 B 0.089 0.103 0.31 0.36 0.14 0.17 0.16 0.27 spc 1.96 1.28 2.18 1.42 1.00 0.65 a 0.109 0.081 1.55 1.16 0.71 0.53 NF537 (relA) L l l - L l 0.097 0.124 1.57 2.01 0.72 0.92 L10-L12 0.135 0.178 2.07 2.72 0.95 1.25 B 0.074 0.060 0.26 0.21 0.12 0.096 0.13 0.08 spc 1.96 2.48 2.18 2.76 1.00 1.27 a 0.105 0.128 1.50 1.83 0.69 0.84 4. rp lKATL- rpoBC 75 In strain NF536 (relA*), L l l - L l , L10-L12 and control m R N A transcription decreased whereas 8 m R N A transcription increased slightly when the temperature was shifted from 30 to 35.5°C. The ratio of PP' m R N A sequences to L10-L12 m R N A sequences thus increased from 0.16 to 0.27. This was i n contrast to hybridization results obtained using R N A from strain NF537 (relA); L l l - L l , L10-L12 m R N A transcription increased, P m R N A transcription decreased and the distal to proximal m R N A ratio decreased from 0.13 to 0.08. Previous filter hybridization results indicate that the parental strain (NF314) at 30°C and 36°C displays transcription patterns identical to those of NF536 and NF537 at 30°C (Maher and Dennis, 1977). This similarity indicates that the differences in transcription patterns between these two mutant strains are not due to the temperature shift but to genetic differences in the re lA gene. Changes in the ratio of P m R N A to L10-L12 m R N A during these restrictions could result from modulation of transcription termination at the attenuator, activation of dormant or cryptic promoters in the L12-P intergenic region, changes i n the rate of transcript degradation, or a combination of these possibilities. 2. SI N U C L E A S E M A P P I N G To distinguish between the possible mechanisms of regulating transcription levels, 5' and 3' transcript ends generated during these restrictions were localized by SI nuclease mapping. The D N A probes which were used were derived from the N u s G - L l l , the L l -L10 and the L10-L12 intergenic regions and have been described above. The patterns of transcript ends were identical to those for cultures in balanced growth; no new ends were detected in these P L n and P L 1 0 promoter regions although the quantity of ends fluctuated 4. rp lKATL- rpoBC 76 as expected from the filter hybridization results during the temperature shifts. There were no transcript ends detected i n the L10-L12 intergenic region under any of the conditions examined. Autoradiograms of the SI experiments using probes from the L12-B intergenic region are shown in figure 13. Using the 3' end-labelled 1080 bp EcoRI probe and XH56 R N A , changes in relative intensities of major bands were apparent (fig. 13, lane A) . A s previously described (section 4.2.3(3d)), the fully protected 1080 nucleotide long fragment indicates read-through and unprocessed message. The other major 240-270 nucleotide long protected fragments represent transcripts terminated near the attenuator. The 325 base long band arises from RNase l l l processing. The second minor protection product, 420 nucleotides long, situates the transcript 3' end near nucleotide 2860 which is i n the second half of the stem-loop structure recognized by RNasel l l . This end could be an S i artifact, the result of non-specific transcription termination or the result of an alternative RNase l l l endonuclease cleavage event. In the previous analysis using E. coli C600 R N A , this band was virtually undetectable (section 4.2.3(3d); fig. 12). For strain XH56 after the temperature shift to 39°C, fewer transcripts exiting L12 were terminated at the attenuator as indicated by the decrease in the relative amount of the 240-270 nucleotide long protected fragments and the increase in the relative amount of the 1080 nucleotide long protection product (fig. 13, lane A ) . The 5' transcript ends derived from the intergenic space were located by using the 5' end-labelled 1080 bp EcoRI fragment as probe. The major protected fragments were 1080 and 750 nucleotides long and correspond to protection by unprocessed and RNase l l l processed transcripts respectively (fig. 13, lane B). These results indicate that the increase in the ratio of B m R N A to ribosomal protein m R N A following the temperature restriction 4. r p l K A T L - r p o B C 77 I750n> I6?0nl (- p |-<5t5»l ( 2 « 270nl -1U -I J IV>nl l U S n l (225-22ln> (211-21M I2l3-215nl I IM-I72nl i a" 2 — 751 = >2< 515 525-24Q-27of U J L . .R. .MM 1 1 ' J , M M . ....R.RRC C..M..C.' I! t i l l R.G.S...6 R.flbG.b RS..R...6 • M I.HHfld -215-215 — 225-221 -211 -213 • 166 I n I- . I -» B m H m i B t n pom I I R S 5 I S I 1 * - « - j 325 — . F I G U R E 13. Differential transcriptional regulation of rp lKATL and rpoBC; nuclease mapping  of transcript ends derived from the L12-B intergenic region. The nucleotide sequence scale and the L12-B intergenic region are illustrated (top). The open rectangles below represent various restriction fragments used to map transcript ends. These are a 1080 bp EcoRI fragment labelled at either the 3' or the 5' end and a 336 bp Nar l -Hin f l 5' end-labelled at the H i n f l site. The lengths of the 5' and 3' protected fragments are shown above and below each rectangle, respectively (n, nucleotides). The "F" at the ends of the restriction fragments designates some full-length protection by read-through transcripts. Restriction site designation and positions are given in figure 6. Autoradiograms of nuclease SI protection products are shown (bottom). D N A probes protected wi th total R N A are: lanes A , E and F, the 3' end-labelled EcoRI fragment; lanes B, G and H , the 5' end-labelled EcoRI fragment; lane C , the 5' end-labelled Nar l -Hin f l frag-ment. The probe i n lane C is labelled only in the minus strand and the SI-protected products are electrophoresed alongside the Maxam-Gilbert A and A + G reaction products. Lane D: M s p l fragments of pBR322 used as size standards (fragment lengths are 623, 528, 405, 310, 243 and 239 nucleotides). 4. r p l K A T L - r p o B C 78 (3 ' (NO) I 1 I 1 J 2 7 0 0 - T — R « ' «. I c - c 6 fl | n - i " a - r ' G - C G — c i - n T - A G - C C - G ~ G - C C - S 2 I - f l •"P' 1 I 6 ~ C h T C - « (JENO) n - T _ r J G - C I 5 ' . . . G T T f l f l f l T f l R G C C R A C C C T T C C G G T T G C - 6 fl 7 G - C T T I T G C G C T G T I I fl 2 O * 0 2 7 2 0 n G 2 7 6 0 2 7 4 0 Q . I C l l t l t l i r i l C l C l t l l l t t t I T G f l C C G T . 1 Y 6 " C r T c <3'tN0) (5-END) „ T 6 " M M G . 2 7 0 0 , ft ° C 1 ' .T. 1 - G - V T I I I I I I 1 I I I • I I I I I I I I I I I I I I I I I G R R R G T T R C G G R C R R G R T R G T G C G R R T T 2 S M t • . . - P - T G ' G J T 6 2SS0 N G G C 'I I , T R ( | C G C fl 1 2040 I T T T C C G G T C R R C R R R R I R 6 T G T T . I % (S- ENO) A C x a w G T R G f l C f l G G T R a C T C G C C T G r c n a R * M I O T C S A C T T G T C f l G C 6 R G C T G R G G R R C C C T R T G G T T . . . 3 -<s- ENO) 1000 I - 7 : 1 . F I G U R E 14. Transcript end sites in the L12-B intergenic region. The positions of 3' and 5' transcript end sites and some of the potential secondary structures i n the R N A transcripts are shown. The secondary structure between nucleotide positions 2668 and 2715 is the transcription attenuator. The inverted repeat between nucleotides 2769 and 2878 is believed to be the substrate for RNase in processing; the major cleavage site generates a 3' end at position 2777 and a 5' end at position 2785 (section 4.2.1 (3d)). The weak 5' transcript end situated at nucleotide 2858 is not shown; it may be the reciprocal portion of the 3' transcript end situated at approximately position 2860 produced as a result of endonucleolytic cleavage. The arrow at nucleotide 2807 indicates the single base change that resulted i n an up mutation as reported by A n and Friesen (1980b). The distal end of rp lL and the proximal end of rpoB are denoted by the open boxes. 4. rp lKATL- rpoBC 79 probably resulted from downward modulation of termination of ribosomal protein transcripts at the attenuator and not from activation of cryptic promoters in the L12-P intergenic space. There are however at least two minor new or more intensified 5' protected fragments, 620 and 585 nucleotides long, that are protected by the 39°C R N A . These 5' transcript ends were more precisely located by using a 5' end-labelled 336 base long N a r l -H i n f l probe and the protection products were electrophoresed alongside the Maxam-Gilbert G and A+G sequencing ladder (fig. 13, lane C). The major products 336 and 283-285 nucleotides long are derived respectively from protection by readthrough transcripts and RNase l l l processed transcripts. The remaining protection products are much less abundant. The 211-213 nucleotide long minor fragment seen at both 30°C and 39°C situates the 5' transcript end at approximately nucleotide 2858 and may be derived by endonucleolytic cleavage from the transcript that gave rise to the 420 nucleotide long protected fragment using the 3' end-labelled EcoRI probe (see above). The other 3 minor products appear to be unique to XH56 R N A at 39°C. The protected fragments 225-228, 166-172 and 124-125 nucleotides long position 5' transcript ends at nucleotides 2841-2844, 2896-2902 and 2944-2945 respectively (fig. 14). These 3 minor transcripts have no obvious corresponding 3' end sites and therefore may be transcription initiation products at weak cryptic promoters rather than products of an endonucleolytic cleavage event. The new but minor 5' transcript ends at positions 2841, 2896 and 2944 were analyzed for potential -35 and -10 (Pribnow box) R N A polymerase recognition sequences. 4. rp lKATL- rpoBC 80 -35 spacincr -10 s p a c i n a 5' end p o s i t i o n TTGACA (16-19n) TATAAT (5-7n) GCGACA (15n) GTAAAT (8n) 2841 GTGATA (22n) TTCCAT (9n) 2896 TTGCAC (18n) ACAGAT (6n) 2944 The homology of these putative cryptic promoter sequences with the consensus sequences is either absent or very poor; even where homology exists, some of the spacings between the -35 and -10 regions, the -10 region and 5' transcript end vary substantially from the optimal. The putative promoter wi th the Pribnow sequence centred at nucleotide 2830 has been previously reported. A n and Friesen (1980b) have described an up mutation i n the -35 recognition region of this Pribnow sequence. In their mutant plasmid the w i l d type hexamer G C G A C A centred at nucleotide 2808, is changed to G T G A C A which now differs from the consensus sequence T T G A C A by only one nucleotide. This substitution results in an activation of this cryptic promoter during balanced growth. Although increased activity of cryptic promoters in the L12-0 intergenic region may occur, it would make a minor contribution to the increased levels of 80' transcripts during periods of stress that require greater synthesis of R N A polymerase subunits relative to ribosomal proteins. In XH56 39°C R N A , along with the decrease in transcript termination at the attenuator, there was a decrease i n RNaselH-processed m R N A relative to read-through message, as suggested by the decrease in intensity of the relevant protection products relative to the 1080 nucleotide fragment (fig. 13, lanes A , B, C). The decreased amount of processed transcripts could be due to a reduction in RNase l l l processing or to an 4. rp lKATL- rpoBC 81 acceleration in the decay of processed transcripts. A study of decay rates of XH56 transcripts from the L12-B intergenic region showed that read-through and RNase l l l processed m R N A s have similar degradation profiles at both permissive and semi-restrictive temperatures (section 4.2.2(3); fig. 16). These results suggest that the relative decrease in the amount of RNase l l l processed transcripts was likely due to a decrease in RNaselTi processing. This reduction i n RNase l l l activity may simply be the result of a l imiting cellular concentration of RNase l l l or it may indicate a regulatory function of the enzyme. The role of RNase l l l processing in the function of PP' m R N A is not known. RNase l l l processing appears to have various effects on gene expression i n E. coli . RNase l l l is involved in the maturation of r R N A s from 30S precursor R N A transcripts and in the regulation of several E. coli and bacteriophage genes (Takiff et al., 1989, and references therein). RNase l l l has been shown to decrease X int gene expression by processing at the 3' end of the int transcript (Gottesman et al.,1982). A s well , RNasel l l has been shown to process m R N A at the 5' end of genes to either increase or decrease gene expression. Processing may enhance expression by removing base pairing which blocks the ribosome binding site as in T7 m R N A s (Dunn and Studier, 1975) or reduce expression by initiating the decay of transcripts downstream as in the polynucleotide phosphorylase (pnp) m R N A (Portier et al., 1987). Portier and co-workers (1987) have suggested that RNase l l l processing of PP' m R N A may have the same function as in the pnp message. In contrast, Morgan and Hayward (1987) have argued that pp' m R N A stability is not significantly affected by RNase l l l processing. Deletion of nucleotides 2729 to 2890, which removes the putative RNase l l l processing stem, results in m R N A that is inefficient as a template for translation (Dennis, 1984). This suggests that sequences near or in the processing site, not processing per se, is important 4. r p l K A T L - r p o B C 82 for efficient translation of BB' m R N A ; these sequences may be important for opening up the rpoB ribosome binding site which could otherwise be sequestered in an alternative secondary structure incompatible wi th translation initiation (Meek and Hayward, 1986). Similarly, Al tuv ia et al. (1987) have proposed that for the X dn gene, RNasein stimulates cm translation by binding to a site i n the m R N A leader region; this binding may expose the cHI ribosome binding site and hence stimulate translation. This stimulation does not involve R N A processing. The precise roles of R N A secondary structure and RNaselH-mediated processing i n determining translation efficiency of PP' m R N A remain to be determined. Nuclease S i protection experiments using total R N A from strains NF536 and NF537 produced results different from that seen for E. coli XH56. The 3' end-labelled 1080 bp EcoRI probe showed that, for NF536 (relA*) at the semi-restrictive temperature (37°C), there are fewer transcripts entering the L12-P intergenic region as a result of the stringent response (fig. 13, lane E). However, of these transcripts, there was no detectable change in the attenuated transcript level (based on densitometric measurements) as was anticipated from the filter hybridization results and previous transcript analysis of XH56 R N A . It is possible that the nuclease S i protection technique is not sensitive enough to detect small changes at. low, transcript levels. In contrast, for strain NF537 (relA) at 37°C, there are more transcripts entering the intergenic space compared to NF536 at 37°C, but a much smaller fraction of these extend through the attenuator and into the p gene (fig. 13, lane F). Us ing the 5' end-labelled 1080 bp EcoRI probe, NF537 (relA) R N A revealed little change in relative intensities of read-through and RNasein processed m R N A s after the temperature shift (fig. 13, lane H) . However, in NF536 (relA +) (lane G), there appears to be an increase in the level of RNase l l l processed message relative to the amount of read-through message; this increase may partially explain the slight enhancement in the p to L10-4. r p lKATL- rpoBC 83 L12 m R N A ratio! Based on densitometry data, the ratio of read-through to processed m R N A was calculated to be 1 : 0.47 at 30°C and 1 : 0.9 at 37°C. There was no change in the relative level of the corresponding upstream fragment generated by RNase l l l processing (325 nucleotide long fragment i n fig. 13, lane E; densitometry data not shown). Again , the low transcript levels may diminish the sensitivity of SI nuclease protection analysis. It is possible that the elevated level of RNase l l l processed transcripts was due to an increased stability of this downstream fragment. The greater stability of B m R N A , i f real, may be the result of increased translation of the B message which may be required during the stringent response; translating ribosomes have been shown to protect some m R N A s against decay (Schneider et al., 1978). Unl ike XH56 at 39°C, no new or more intensified 5' transcript ends were detected i n the L12-B intergenic region for NF536 and NF537 (fig. 13, lanes G and H) . During the stringent response, the levels of L l l - L l and L10-L12 transcripts were reduced as compared to the level of B transcripts (filter hybridization and SI results of strain NF536, 35.5°C or 37°C). Stringent control of r-protein synthesis was previously thought to act at the level of transcription (Maher and Dennis, 1977). However, translational repression is now known to cause an accelerated decay of some r-protein m R N A s (Singer and Nomura, 1985; Fallon et al., 1979), including L l l - L l m R N A (Cole and Nomura , 1986a). Also, Cole and Nomura (1986b) have demonstrated that translational regulation of r-proteins L l l and L I can account for the stringent response of r p l K A . Therefore, it is possible that the reduced levels of L l l - L l and L10-L12 transcripts were due to a decrease in m R N A half-lives caused by feedback inhibition during the stringent response. The initial results presented i n this work are not sufficient to verify or to disprove this conclusion; further investigation on the decay rates of transcripts from the rplKATL-rpoBC gene cluster under stringent conditions is required. 4. r p lKATL- rpoBC 84 3. T R A N S C R I P T STABILITY The steady state level of a m R N A reflects both its rate of synthesis and its rate of decay. Therefore, it is possible that the relative levels of r p l K A J L and rpoBC transcripts, under the various restrictions examined above, were due to changes in m R N A degradation rates. A s mentioned previously, it has been shown that for L l l - L l m R N A (Cole and Nomura, 1986a), S13-S11-S4 (alpha operon) m R N A (Singer and Nomura, 1985) and spc m R N A (Fallon et al., 1979), translational repression increases the decay rate of r-protein m R N A . However, the translational repression of the synthesis of r-protein S20 is not accompanied by an accelerated decay of its m R N A (Mackie, 1987). In order to determine degradation rates of rp lKATL and rpoBC m R N A s , total cellular R N A from cultures of E. coli XH56 grown at 30°C and 39°C were analyzed by SI nuclease protection according to von Gabain et al. (1983) with some modification. Transcription initiation was first blocked by the addition of rifampicin; total cellular R N A was then prepared from aliquots of cells taken at various time points. Levels of L l l - L l , L10-L12 and B transcripts were probed respectively with 3' end-labelled 617 bp EcoRI-Bglll , 290 bp Hindl l l -EcoRI and 584 bp Sall-EcoRI restriction fragments (fig. 15). In addition, the 3' end-labelled 496 bp EcoRI-Sall fragment was used to analyze amounts of attenuated and RNase l l l processed transcripts as wel l as uninterrupted transcripts in the L12-0 intergenic region. Fragments protected from S i nuclease activity were fractionated on a 8% polyacrylamide-urea gel; autoradiogram band intensities were quantified by densitometry as an estimate of transcript levels. For internal consistency, probes for L10-L12 and P transcripts were incubated in the same SI nuclease reaction. In general, the results show that the decay rates of the transcripts examined are 4. r p l K A T L - r p o B C 85 . F I G U R E 15. Nuclease S i analysis of stability of rplKATL-rpoBC transcripts i n the mutant  XH56. Top : The nucleotide scale (Post et al., 1979) is shown i n kilobases. The positions of genes are indicated. Relevant restriction sites and their nucleotide positions are : EcoRI (E: 280, 2444, 3524); BgUI (B: 897); H i n d l H (H: 2154); Sai l (S: 2940). The 3' end-labelled restriction fragments used as probes were (i) the 617 bp EcoRI-Bgin fragment to detect L l l -L l message, (ii) the 290 bp HindUI-EcoRI fragment to detect L10-L12 message, (iii) the 584 bp Sall-EcoRI fragment to detect B message and (iv) the 496 bp EcoRI-Sall fragment to detect transcript 3' ends i n the L12-B intergenic, region as wel l as transcripts which read-through the region. Total cellular R N A was isolated 0, 2, 4, 6 and 8 min. after rifampicin treatment of E. coli XH56 at 30°C and 39°C. Five micrograms of R N A were used i n each SI nuclease protection assay. Autoradiograms of protection products are shown (middle and bottom). Probes for L10-L12 and p transcripts were used i n the same nuclease SI protection assay. Transcripts derived from RNase l l l processing (RNaselll) and termination at the attenuator (ATT) in the L12-P intergenic region are indicated. Also see figure 16. 4. r p l K A T L - r p o B C 86 Nuc leo l i * scale Genetc map Probes L10-L12 -L 1 2 - 0 - • * F I G U R E 15 4. rp lKATL- rpoBC 87 greater at 39°C than they are at 30°C (fig. 15 and 16). This may be a result of increased translational feedback inhibition, a result of the increase in temperature, or the consequence of an unknown event. Regardless of the cause, the increased decay rates cannot explain the elevated levels of L l l - L l , L10-L12 and P transcripts under semi-restrictive conditions. This strongly suggests that the 1.5 to 1.6 fold increase in transcription of L l l - L l and L10-L12 at 39°C (table 4) was a consequence of increased transcription initiation at the P U 1 and P u o promoters, and not a result of changes in m R N A stability. A t the semi-restrictive temperature of 39°C, the level of p transcript increased five fold. If this increase was mainly due to a change in transcript stability, then the rate of degradation of p m R N A should decrease substantially at the semi-restrictive temperature. Again , the observed increase in rate of decay of P m R N A argues against this interpretation (fig. 15 and 16); transcript stabilities cannot account for the observed 5 fold increase in p m R N A as compared to the 1.5 to 1.6 fold increase in the upstream m R N A s . Consequently, increase in the level of P transcripts during these periods of stress is likely due to both increased transcription initiation at the P L 1 1 and P u o promoters and relaxation of transcrip-tion termination at the attenuator i n the L12-P intergenic region. Modulat ion of attenuator activity has also been observed during rifampicin-mediated restriction of R N A polymerase activity (Morgan and Hayward, 1987). In vivo, rifampicin partially uncouples rpoBC from rplKATL transcription by decreasing termination of m R N A at the attenuator. Alteration in m R N A stability and relaxation of post-transcriptional autogenous regulation were considered unlikely to be involved. A s noted previously, the decrease i n RNase l l l processed transcripts relative to read-through message i n XH56 R N A at the semi-restrictive temperature (fig. 13, lanes A , B, C ; also section 4.2.2(2)) could be due to diminished RNasein activity in the L12-p intergenic 4. r p lKATL- rpoBC 88 . F I G U R E 16. Decay of rplKATL-rpoBC transcripts in the mutant XH56. Autoradiogram bands of nuclease SI protected products (fig. 15) were scanned by a densitometer and relative band intensities were analyzed by computer. Logarithms of the band intensities (in arbitrary units) were plotted against time (in minutes). Degradation profiles of transcripts i n the following intergenic regions were analyzed : (a) L l l - L l , (b) L10-L12, (c) P and (d) L12-p. In al l cases, the open circles and dashed lines represent readthrough message at 30°C; the filled circles and solid lines represent readthrough message at 39°C. In panel (d), the open triangles and dashed line represent RNase l l l processed transcripts at 30°C; the filled triangles and solid line represent RNase l l l processed transcripts at 39°C. Transcript stability studies were done in duplicate. The results shown here are from one experiment but are representative of the repeated findings. 2.00 3 1.50 1.00 0.50 0.00 4. rp lKATL- rpoBC 89 (a) L11- L1 Time (min.) 2.00 1.50 1.00--0.50 0.00 2 . 0 0 * 3 1.50 1.00--0.50 0.00 2.00 a 1.50-• 1.00 0.50 0.00 (d) L12- p Time (mtn.) F I G U R E 16 4. rp lKATL- rpoBC 90 region or to intensified transcript degradation. The 3' end-labelled 496 bp EcoRI-Sall fragment was used to analyze decay rates of RNasein processed transcripts (fig. 15). t h e results show that processed and read-through m R N A s have similar decay rates at 30°C and similar but accelerated decay rates at 39°C (fig. 16). This suggests that the relative decrease i n processed transcripts at the semi-restrictive temperature was due to a reduction in RNaseffl processing. 4.2.3 T R A N S L A T I O N A L POINT M U T A N T S I N T H E rplTL L E A D E R R E G I O N The translational feedback model has been proposed to explain the coordinated synthesis of r-proteins. Certain regulatory r-proteins are capable of binding to specific sequences on their own m R N A as wel l as related sequences on r R N A . A deficiency in r R N A results in protein binding to the m R N A and prevention of further translation. Repressor binding sites are usually located i n the vicinity of the ribosome binding site and regulatory protein binding can directly block translation. Unique among r-protein operons, the L10-L12 repressor protein binding site (nucleotides 1523 -1579) is situated more than 100 nucleotides upstream of the L10 initiation codon (Johnsen et al., 1982). Point mutants and deletion mutants which are translationally defective have been isolated (Fill et al., 1980; Friesen et al., 1983; Christensen et al., 1984); these mutations are localized some 80-200 bases upstream of the translation initiation site of rplT. Based on this evidence and on the identification of the repressor binding site, Chris-tensen et al. (1984) have proposed a model for translation inhibition and R N A secondary structure of the L10-L12 m R N A leader sequence. The model involves two alternative configurations of this leader region (fig. 19). Normally, the portion of the leader between nucleotides 1505 and 1721 (the L10 start codon) exists in form I, i n which the ribosome 4. rplKATL-rpoBC 91 binding site is not base-paired and the transcript is thus open for translation. When there is an excess of L10-L12 , the repressor protein binds to its recognition structure, indicated in figure 19 as enclosed by the dotted box, and shifts the equilibrium to favour form n . In form JJ, the ribosome binding site is sequestered, and translation efficiency is reduced. In this way, binding of L10-L12 in the central region of the rplTL leader can exert its inhibitory effect, over a distance, on L10-L12 translation. Alternative m R N A structures have also been proposed as a way to regulate expression of drug resistance genes (Duvall et al., 1983; Mayford and Weisblum, 1985; Narayanan and Dubnau, 1987) and the X clE gene (Kornitzef et al., 1989). While the assumption of secondary structure in the L10 leader sequence can explain many experimental observations, there was no evidence to confirm its existence. In order to test a segment of the secondary structures proposed by Christensen et al., Cl imie and Friesen (1987) have constructed a set of deletion, single base change, and double base change mutations i n the leader region of a rplT-lacZ fusion plasmid. The mutations are located in the stem loop A region (fig. 19) within the L10-L12 binding site. A s well , the secondary structure in this region was examined by chemical modification. Results from these biological and chemical analyses define a region of secondary structure which is necessary for feedback regulation and which is i n agreement wi th the predicted stem loop A structure. The results also indicate that the overall secondary structure, and not the primary sequence per se, is required for regulation. In order to determine further the validity of other aspects of the proposed secondary structures in translational regulation of L10-L12 expression, regulatory mutants which were previously isolated (Fiil et al., 1980) were re-examined by site-specific mutagenesis. Designated as plasmids pNF1661 to pNF1666, these six original regulatory mutants were 4. rp lKATL- rpoBC 92 derived from the parent plasmid pNF1337A. Plasmid pNF1337A is a pBR322 recombinant carrying the PstI(487)-EcoRI(2444) 1957 bp fragment which includes the 3' end of the L l l gene, the entire L I and L10 genes and the 5' portion of the L12 gene (fig. 17). Wi th this plasmid, expression of the plasmid-borne rplT gene i n the absence of an intact plasmid-borne rp lL gene is detrimental to cell growth. However, the derivatives of pNF1337A which were isolated could overcome this detrimental effect. These regulatory mutants are transcriptionally normal but translationally defective. They were al l determined to be point mutations in the central region of the rplTL leader, but outside of the L10-L12 binding site. According to the model of Christensen et al. (1984), each of these point mutations destabilizes form I and enhances form II; the result is concealment of the ribosome binding site and inhibition of L10-L12 translation. Four of these mutants, pNF1661 to pNF1664, were chosen for further study. The positions of these point mutations are indicated in figure 19, (a) to (d). One of these mutations (pNF1661) is situated in stem B while the remaining three a l l lie within stem C. The Bgll l -Smal 1087 bp fragment containing the L10 leader sequence was subcloned from each of the mutants pNF1661 to pNF1664 into the Bgll l -Smal site of pNF1344, replacing the analogous wild-type sequence. Plasmid pNF1344 contains the 3' end of the nusG gene, the entire rplKATL region and the 5' end of the rpoB gene (fig. 17). Subcloning the mutant L10 leader region into pNF1344 permits the use of r-proteins L l l and L I as internal standards in the translational assay of these mutants (see below). The mutant recombinants i n pNF1344 are designated as plasmids pNF1661' to pNF1664'. To examine the putative R N A structures, a second point mutation thought to reestablish base-pairing in form I was introduced by site-directed mutagenesis into each of the plasmids pNF1661' to pNF1664' by using oligonucleotides oPD23 to oPD26, respectively. Theoretically, if the proposed structures, stem B and stem C , are the only structures involved in translation regulation, the double base changes should behave as pseudorevertants and 4. rp lKATL- rpoBC 93 L l l • LI L1 0 L12 ' PNF1661 to pNF!661 (parent:pNF1337/i) eutagenes i 3 In PEr1BL8 + (BI I > In pEt18L8 + (B I I) PNF13-H LI 1 LI LI 0 L12 J scale (kb) . F I G U R E 17. Construction of plasmid derivatives carrying point mutations i n the L10-L12  m R N A leader. Top : single point mutants pNF1661 to pNFl664 were derived from the parent plasmid pNF1337A which is a pBR322 recombinant carrying the Pst(487)-EcoRI(2444) 2.0 kb fragment (Fiil et al., 1980). The asterisk indicates the general location of the point mutations. For one set of mutant derivatives, the 1.1 kb Bgin(897)-Smal(1984) fragment from pNF1661 to pNF1664 were cloned directly into the Bg in and Smal sites of pNF1344 to give pNF1661' to pNF1664'. In addition, this 1.1 kb fragment from the mutant plasmids or the w i l d type plasmid, pNF1344, were cloned into pEMBL8 + (BII) for site-specific mutagenesis; only the mutant plasmids are illustrated. The mutagenized Bgll l -Smal 1.1 kb fragments were then cloned into the Bgin and Smal sites of pNF1344 to yield pNF1344(25), pNF1663'(25) etc. Bottom : plasmid pNF1344 contains a 6.0 kb fragment from X r i f 18 D N A inserted into the PstI site of pBR322 (Hui et al., 1982); The relevant r-protein coding region of pNF1344 is illustrated. Pertinent restriction sites and their nucleotide positions are : PstI (P: 487); B g l l l (B: 897); Smal (S: 1984); EcoRI (E: 2444) (Post etlal., 1979). The nucleotide scale (in kb) is shown at the bottom. 4. rp lKATL- rpoBC 94 . F I G U R E 18. Partial sequences of single base and double base point mutations in the L10- L12 m R N A leader region. Plasmid pNF1344 is the w i l d type analog. * Plasmids pNF1661'(23) and pNF1662'(24) were not viable; their sequences shown here were derived from the pEMBL8 + (BH) recom-binants carrying the corresponding 1.1 kb BglH-Smal fragment used for mutagenesis. Arrows indicate the positions of the base mutations. For the nucleotide positions of these mutations, refer to table 2 and figure 19. 4. r p l K A T L - r p o B C 95 F I G U R E 18 4. rp lKATL- rpoBC 96 restore L10-L12 translation. A s a control, each oligonucleotide was also used to mutate the w i l d type plasmid pNF1344. The resultant mutants are designated as pNF1661'(23), pNF1344(23) etc. (table 2 and fig. 18). Plasmids pNF1661'(23) and pNF1662'(24) were not viable. Repeated attempts to clone these double mutant Bgll l -Smal 1.1 kb fragments into the Bgin and Smal sites of pNF1344 failed. The integrity of the insert and vector D N A was tested in control experiments and the endonuclease restricted ends were found to be intact (i.e. able to be ligated and produce recombinants). A prokaryotic, DNA-directed, i n vitro translation system (Amersham) was used to assay the translation levels of plasmid-borne genes rplKATL. Translation products were electrophoresed on a 15% SDS-polyacrylamide minigel using the discontinuous buffer system of Laemmli (1970) (fig. 20). Autoradiograms of the gels were analyzed by densitometry. Each plasmid was assayed in vitro twice, and each assay was analyzed by SDS-polyacry-lamide gel electrophoresis and densitometry in duplicate. The results are summarized in table 5. After correcting for the number of methionine residues per protein, each densitometry measurement was first normalized to the arbitrary internal standard, r-protein L l l and second, normalized to each respective value calculated for the w i l d type plasmid pNF1344. RNase inhibitor was added to the in vitro translation system to insure that changes i n protein levels were due to changes i n translation and not due to changes in transcript stability. Previous analysis of the i n vivo expression of L10 from the original mutant plasmids pNF1661 to pNF1666 showed that translation is reduced by at least 20 fold relative to the expression of L10 from the w i l d type plasmid (Fiil et al., 1980). Also , these mutant plasmids demonstrated normal transcriptional activity but their L10-L12 m R N A was somewhat less 4. rp lKATL- rpoBC 97 . F I G U R E 19. Positions of point mutations in the L10-L12 m R N A leader region; possible  secondary structures as proposed by Christensen et al. (1984). The point mutations carried by each of the mutant plasmids, depicted as the R N A transcripts, are indicated. The ribosome binding site is enclosed by a solid line. The dotted line in form II encloses the sequence that is protected m vitro by L10-L12 binding. Refer also to table 2 and figure 18. * Bacterial transformants carrying plasmids pNF1661'(23) (in panel a) and pNF1662'(24) (in panel b) were not viable. 4. r p l K A T L - r p o B C a • G —• A • C - » U G —• A P N F 1 6 6 1 ' p N F 1 3 4 4 [ 2 3 | • G • A - j _ p N F 1 6 6 1 ' [ 2 3 r • C - » U J A , C - A % G A t o ' U A U A U A A U c o o c-wao J - A U - U ' oc - « G C - 0 C G - u A U A U -G A U C G -A L H C G C U A G C a c C Q - W 4 0 C G U A L 1 0 - L12 £ O - U - A - Q - A U A A U U A A G A C G C Q - 4 H 3 - A U H J C C A Q A G A U 0 C 1 5 4 0 - U U - G U ' C G • ) C G 4 R - U A A Xfc '**' 1 7 0 0 G C G C - 1 5 2 0 A U C G X G . 1 7 2 0 - A A U G - 3 , C - A . G A ' C G ' U A U A U A A U / , U " A , C O " , U - U . 1 0 6 0 - G I * C G ' C G U A - C G U " C G U A if A C G  U U G C " A . 1 6 3 0 G C - 1 5 8 0 *A if 1 6 4 0 A ^ . A ' C * C G . 1 6 0 0 G C U G - A I K ) C C A G A G [ C C - U A - A G G U C U C 1 7 0 0 ' A - Q - C G ' 1 5 4 0 - " * G C - 1 6 2 0 C - U A * U A U A U G • C G - U - G - A - C G - G - C - U - U - G C U A A U G - 3 C G U C C G A Q * 1 7 2 0 G C S « 2 0 S G C \ U V B B F o r m I Form. II C • c-• G -• C -• G -p N F 1 6 6 2 p N F 1 3 4 4 I24 I ] _ p N F 1 6 6 2 ' l 2 4 l * u - 1 6 2 0 , C - A , G A - C G -U A U A U A G C »»»» A U C G G C - 1 S 6 0 ' " - A I T " ' G C -Gc-y C G T J A U A O -0 C - " A U C Q - c A U - C O C U A G C G C C G - 1 6 4 0 " C O " C G U A "•c 0 L 1 0 - L12 J C G - U - A - G - A U A A U U A A G A C G C G - U - G - A U ^ J C C A G A G ' * * 0 , * , : C - U A - A G G U C U C , . * U - G - U - U - 5 A U G C , C G , 1 5 4 0 - U U T ) U ' C G C G - 4 J A A > ( C troo G C G C - 1 5 2 0 A U c a £ G . 1 T 2 0 - A A U G - 3 „ U - G . G A '> A G > 1 6 6 0 G - A U - U C C A G A G I C C H J A - A G G U C U C 1 7 0 0 G C G C -C G A U C G - U - G - A - C G -U C G U C C G A Q § c O « 0 S G C \ J J A U , 1 G r ' A 1 ' U G - C - U - U - G C U A A U G - 3 ' B B F o r m I Form II F I G U R E 19 4. rp lKATL- rpoBC 99 • G -• C -• G -• C -p N F 1 6 6 3 ' P N F 1 3 4 4 I 2 5 I } - p N F 1 6 6 3 ' | 2 5 l U A U A 0 C AU^-»-A 0 C C K : A U C Q Q C - 1 5 8 0 U A* G C - ' 6 2 0 A l * U J C O G C - U C G - i A U • G C ^ A U ^ * C O . A U - C G C U A G C G C C G - 1 0 4 0 1 6 4 0 - G ^ 0 "C G ' C G U A <l U A L 1 0 - L12 jC Q - U - A - O - A U A A U U A A G A C G C Q - U - Q - A J U C C A O A G ' * " 0 * 5"-'*:*^ G U C U C 'u-u' X U - G - U - U -A U G C , C G . 1 5 4 0 - u U ^ G U ' C G C Q G C G C - 1 5 2 0 A U C G JC Gs 1 — 1 1700 1 7 2 0 - A A U G . - 3 U A > G C U . . I A I T 0 * * A i G - U . G C C _ C / C G ' C G U A - C G U X G U A C G • \ A C Q U G C 1640 A * ^ ; G C - 1 5 S O A ' C X G» « 0 0 G C ' A - G - C G ' G . . - A U - ^ . y . 1 5 4 0 - U * C A U C G - U - G - A - C G - G - C - U - U - G C U A A U G -, U - G . G A G - A L R l C C A G A G |C C-U A - A G G U C U C 1 7 0 0 C G U C C G A Q G C \ U B B F o r m I Form II • G - » A p N F 1 6 6 4 • C . - H J p N F 1 3 4 4 ! 2 6 ] • G - » A • C - is y p n f i 6 6 4 ' i 2 6 i - C - A , G A • C G ' U A U A U A G C O C )1 a c c < A u C G G C - 1 6 2 0 u J C O G C - " C G - u A U A U-G A U C G -A U - C G C U A G C 0 C . •C G" C G U A " - C 0 U A L 1 0 - L12 G C - 1 5 8 0 • € C>t«40 U A * ny* £ G - U - A - G - A U A A U U A A G A C G C G - U - G - A I H J C C A G A G " i C - U A - A G G U C U C 7 •G , C A A f c n , _ 0 u G C , C G 1 5 4 0 - u *G U* C G C G <o G C G C - 1 ! A U C G A G . V C - C - " , C " A , " G A " C G ' U A U A U A G C „ A U - U G C , G C C G / U U * A - * ^ C | G C - 1 5 8 0 ' A U * «40 A X : C - c G • W O O G C U U C - " - A ! . . U H ; . C [ G ! G , R > U . . . „ ' C - U A C A u u n j A G C - W 2 0 U A A U U G ' C G ' C G U A U ' C G  U ' C G U A ? \ X. U G C * A - G - C G* C G - U - G , . G * ^ A G>16fl0 G - A U4j C C A G A G C C - U A - A G G U C U C ^ A' - V c * C ' I C G - U - G - A - C G - G - C - U - U - G C U A A U G • C G U C C G A Q 1 7 2 0 C G ' G G C v , U * u , 1 G c - u ' B i B F o r m I Form II F I G U R E 19 4. r p l K A T L - r p o B C 100 -i r *- co ^ m m (o to 5 CM CM CM CM CM CM t j - t - "d- cm O co * 3 Tt ID CO tD tJ- (D (D <J (D C O < O C 0 « O C 0 t D c 0 C O ( O C 0 C D L L L L U - L L L L L L L L L L L L L L L L z z z z z z z z z z z a a a o . a a a a o . a a 2 3 4 5 6 7 8 9 10 11 25.7 18.4 14.3 L1 L10 L11 L12 . F I G U R E 20. SDS-PAGE of in vitro translation products of mutant plasmids. A prokaryotic i n vitro translation system (Amersham) was used to assess the translational efficiency of the mutant plasmids. Translation products were electrophoresed on 15% SDS-polyacrylamide minigels using the discontinuous buffer system of Laemmli (1970). The protein molecular weight standards (in kilodaltons) are shown on the left. The positions of r-proteins L I , L10, L l l and L12 are indicated on the right. Refer also to table 4. r p lKATL- rpoBC 101 T A B L E 5 I N VITRO T R A N S L A T I O N A S S A Y O F M U T A N T P L A S M I D S :  T R A N S L A T I O N A L L E V E L S O F rplKATL Plasmid L l l L I L10 L12 L12:L10' pNF1344 (wt) 1.0 1.0 1.0 1.0 1.0 pNF1661' 1.0 1.3 0.7 0.8 1.1 pNF1344(23) 1.0 1.0 0.3 0.5 1.7 pNF1662' 1.0 1.1 0.7 0.7 1.0 pNF1344(24) 1.0 1.1 1.0 1.1 1.1 pNF1663' 1.0 1.0 0.6 0.6 1.0 pNF1344(25) 1.0 1.1 0.5 0.6 1.2 pNF1663'(25) 1.0 1.1 0.8 0.8 1.0 pNF1664' 1.0 1.0 0.7 0.7 1.0 pNF1344(26) 1.0 1.0 1.3 1.1 0.9 pNF1664'(26) 1.0 1.0 1.2 1.1 0.9 . T A B L E 5. In vitro translation assay of mutant plasmids : translational levels of rplKATL. In vitro translation products, derived from plasmids carrying point mutations i n the L I 2 leader sequence, were fractionated on SDS-polyacrylamide minigels (fig. 20). Resultant autoradiograms were scanned by a densitometer (BioRad) and the band intensities quantitated (see Materials and Methods, section 2.9). Each densitometry measurement was (i) calculated as intensity (arbitrary units) per methionine residue, (ii) normalized to the value of the arbitrary internal standard, r-protein L l l , and (iii) normalized to each respective value calculated for the w i l d type plasmid pNF1344. * The ratio of L12:L10 was experimentally determined to be 4:1 for pNF1344; this value is set at 1.0 for the standard pNF1344. 4. rp lKATL- rpoBC 102 stable than those i n a non-plasmid control strain. The in vitro results of this work only partially reflect the previously reported in vivo results. Mutant plasmids pNF1661' to pNF1664' display levels of expression of r-proteins L10 and L12 that range from 60 to 80% of normal (i.e. relative to pNF1344; table 5). In vivo , the greater reduction in L10 r-prbtein synthesis may partially be due to the increased degradation of L10-L12 transcripts; the absence of loading ribosomes is associated wi th an increased m R N A decay rate (Schneider et al., 1978). RNase inhibitor added to the in vitro system prevents ribonuclease-mediated degradation of m R N A s and may indirectly cause the higher translation level of rplTL. Another difference is found in the plasmid construction; the original point mutants pNF1661 to pNF1664 contain only the P L 1 0 promoter whereas the mutants of this study contain both P L 1 1 and P u o promoters. Also, the original mutants lack the attenuator stem-loop structure i n the L12-B intergenic region, thus possibly destabilizing the L10-L12 transcripts i n vivo. In addition, the two proposed R N A structures, forms I and H , may be further stabilized in vivo by cellular components which are absent or inactivated in vitro. Finally, the plasmid D N A concentration (100 pg /ml ) used in the in vitro assay likely exceeded the saturating level for one particular plasmid; that is, i n vivo, a l l other cellular m R N A s would be competing with rp lKATL transcripts for ribosomes and translational factors. This lack of competition in vitro may have had an effect on the translational efficiency of the plasmid-borne rp lKATL sequences. Some or al l of these dissimilarities may explain the discrepancy between the i n vitro and m vivo results. Plasmid pNF1661' has a point mutation (G -> A) at position 1516 in the stem B structure. Synthesis of r-proteins L10 and L I 2 are 70-80% of normal. A n attempt to introduce a second mutation (C -> U) at position 1537 to restore the putative stem B structure/and hence possibly to restore L10-L12 translation to normal levels, failed to yield viable recombinants. However, the singular C -> U mutation at nucleotide 1537 4. rp lKATL- rpoBC 103 (pNF1344(23)) caused a reduction i n L10 synthesis to 30% of normal and L12 synthesis to 50% of normal. Also, the molar ratio of L12 to L10, usually 4:1, increased 1.7 fold. Nucleo-tide position 1537 is located within the sequence protected by L10-L12 binding (fig. 19a) (Johnsen et al., 1982) and appears to be involved i n the regulation of L10 and L12 synthesis. While the C -> U mutation apparently favours the closed form and inhibits translation, it also appears to disrupt the normal 4:1 stoichiometric synthesis of r-protein L12, perhaps via some complex tertiary interactions which have not been considered. The lethality of the double mutant also implies that other secondary or higher order R N A interactions may be involved in translational regulation of L10-L12 expression. The remaining point mutants al l lie within the putative stem C structure of form I (fig. 19b, c, d). Plasmids pNF1662' (C -> U mutation at nucleotide 1599) and pNF1344(24) (G -> A mutation at nucleotide 1623) display respectively, 70% and normal translation levels of r-proteins L10 and L I 2. Again , the double mutant was not viable. A s predicted by the model, the C -> U mutation at position 1599 destabilizes the open form (form I) and favours the closed form (form II) (fig. 19b). However, the G -> A mutation alone (position 1623), which was expected to destabilize the stem C structure of form I and thus inhibit translation, does not appear to have an effect on the translation of rplTL. A s before, this evidence as well as the lethal nature of the double mutant indicate that alternate secondary or tertiary R N A interactions may be involved. M i d w a y in the proposed stem C structure are the G -> A mutation (nucleotide 1594) of pNF1663' and across the stem structure, the C -> U mutation (nucleotide 1631) of pNFl344(25). Both single point mutations resulted i n a decrease i n r-protein L10 and L I 2 expression to approximately 50-60% of normal. In the double mutant pNF1663'(25), the synthesis of both L10 and L12 r-proteins were restored to 80% of normal levels. This 4. rplKATL-rpoBC 104 partial recovery of translational efficiency provides some evidence for the existence of the stem structure, at least in the general vicinity of nucleotides 1594 and 1631. It appears that the overall secondary structure, and not the nucleotide sequence, is more important in regulation. However, the incomplete translational recovery of the double mutant may indicate some significance in the sequence or involvement of these nucleotides in other secondary interactions. Alternatively, the decreased translation levels of the pseudorevertant may be a result of the destabilization of form I due to the G C (wild type) -> A T change. The last set of mutants are situated at the base of stem C (fig. 19d). The G -> A mutation (position 1640) of pNF1664' caused a decrease in L10 and L12 r-protein synthesis to approximately 70% of w i l d type levels. However, the G -> U mutation at position 1586 in plasmid pNFl344(26) resulted i n normal or slightly above normal expression of r-proteins L10 and L I 2. In this case, the mutant nucleotide U can still conceivably base pair with the opposite G residue i n the putative stem structures in both forms I and II; thus, normal L10 and L12 production may be the net result. In the double mutant pNF1664'(26), synthesis levels of r-proteins L10 and L12 are similar to that seen for pNF1344(26). It is difficult to determine if the increase i n L10 and L I 2 synthesis in the double mutant as compared to that i n pNF1664' was a result of the second mutation reestablishing stem C in the open form since the second mutation alone (pNF1344(26)) can achieve the same level of L10-L12 expression. • These first attempts at characterizing the unusual rp lKATL m R N A leader region have provided inconclusive evidence for portions of the secondary structures proposed by Christensen et al. (1984); the translation assay was subject to shortcomings of an in vitro system. These initial results suggest that additional secondary or higher order R N A interactions may be involved in the translational regulation of rplKATL. Certain R N A s are 4. r p l K A T L - r p o B C 105 thought to fold into unusual structures. For example, pseudoknot structures, i n which the loop of a hairpin is base paired to sequences upstream or downstream of the hairpin, have been proposed for several R N A s including the alpha operon m R N A (C.K. Tang and D.E. Draper, 1989), 16S r R N A (Noller, 1984) and T4 gene 32 m R N A (McPheeters et al., 1988). Procedures for the prediction of possible higher order structures are not yet available. The current methods used to estimate the stability of an R N A structure relate only to the secondary structure and only consider base pairs located i n stem structures; demonstration of the strong influence of loop sequences on hairpin stability in some cases (Tuerk et al., 1988) reveals the limitations of these methods. V . S U M M A R Y 106 In conclusion, the nucleotide sequences of the secE and nusG genes have been determined. This completes the nucleotide sequence of the entire rif region at 90 minutes on the R coli chromosome. The two genes are cotranscribed, with transcription initiation occurring at the PEG promoter and termination occurring at the Rho-independent terminator in the vicinity of the P L 1 1 promoter. The majority of transcripts are processed i n the 5' untranslated leader region by RNase l l l and possibly also by a second unidentified nuclease. These sites may be regulatory features involved in the expression of secE and nusG. The SecE and N u s G proteins are involved i n seemingly unrelated cellular processes. However, the juxtaposition and co-transcription of a protein export factor and a transcription factor raise questions concerning a possible functional connection between these two processes. The regulation of this cistron may prove to be mtriguing, in light of the present knowledge of regulation of other nus and sec genes. For instance, SecA protein expression is controlled by autogenous translational repression (Schmidt and Oliver, 1989). O n the other hand, the expression of transcription termination factors Rho and N u s A is known to be regulated by autogenous attenuation of transcription (Matsumoto et al., 1986; Plumbridge et al.,1985). It would be instructive to resolve the regulation of secE and nusG gene expression. The effect of SecE or N u s G protein on transcription and translation of the chromosome-encoded secE-nusG operon can be examined in vivo by using an inducible expression vector. Also , sequences in the secE-nusG m R N A leader region which may be involved in regulation can be identified by the use of point mutants and deletion mutants of this region; effects of the mutations on gene expression can be assessed by using a reporter gene, such as lacZ. 5. Summary 107 Transcripts from the rplKATL-rpoBC gene cluster were quantified and their ends mapped. The most abundant transcript was the 2600 nucleotide tetracistronic L11-L1-L10-L12 m R N A initiated at the P m promoter and terminated at the transcription attenuator in the L12-B intergenic space. Less abundant 1300 nucleotide L l l - L l and L10-L12 bicistronic transcripts were also observed. The 3' ends of the L l l - L l transcripts were heterogeneous; most of the ends were localized to three sites within a 110 bp region in the L1-L10 intergenic space. This intergenic space also encodes the P u o promoter and the m R N A binding site for the L10 translational control protein. Two 5' ends were observed for L10-L12 bicistronic m R N A , one at the P L 1 0 promoter and the other 150 nucleotides further downstream in a region i n which no promoter activity has been detected; this second 5' end may be generated by processing of the transcripts initiated at the P L 1 0 promoter. N o transcript initiation in the L10-L12 intergenic space was detected. About 80% of the transcripts reading through the L12 gene were terminated in the vicinity of the transcription attenuator that is responsible for the reduction in the expression of the downstream R N A polymerase genes. Transcripts reading through the attenuator were partially processed by RNasellL N o other major 5' ends were observed in the L I 2-0 intergenic space. During restriction of R N A polymerase activity or during the stringent response, the normal balance between transcription of ribosomal protein genes and R N A polymerase genes is partially uncoupled. In the first situation, this transcriptional disruption results almost exclusively from modulation in the frequency of (i) initiation at P U 1 and P L 1 0 promoters and (ii) termination and antitermination at the attenuator. However, in the second situation, the results are not conclusive; during the stringent response, changes i n the extremely reduced levels of rp lKATL transcripts are difficult to assess by the SI nuclease protection method employed here. Further investigation is required to resolve this problem. 5. Summary 108 Finally, preliminary attempts at characterizing the unusual rplKATL transcript leader region have given only inconclusive evidence for the secondary structures of this region as proposed by Christensen et al. (1984). The results, derived from in vitro translation assays of point mutants, suggest that alternative secondary or higher order R N A interactions may be involved in the translational regulation of rplKATL. Structure mapping experiments of the L10 leader by chemical and enzymatic methods, i n the presence and absence of L10 repressor protein, may help to define regions of secondary structure. In vivo studies of this region by using a rplT-lacZ fusion plasmid should provide additional useful information. The fusion plasmid may also circumvent the problem of lethality of some of these double base mutants. Experimental verification of the proposed secondary structures awaits further investigation. 109 R E F E R E N C E S Al tuvia , S., H . Locker-Giladi, S. Koby, O. Ben-Nun and A . B . Oppenheim. 1987. RNase l l l stimulates the translation of the cjn gene of bacteriophage X. Proc. Nat l . Acad. Sci. U S A 84, 6511-6515. A n , G . and J.D. Friesen. 1980a. The nucleotide sequence of tufB and four nearby t R N A structural genes of Escherichia coli. Gene 12, 33-39. A n , G . and J.D. Friesen. 1980b. Characterization of promoter-cloning plasmids : Analysis of operon structure i n the rif region of Escherichia coli and isolation of an enhanced internal promoter mutant. J. Bacteriol. 144, 904-916. Api r ion , D . and A . B . Lassar. 1978. A conditional lethal mutant of Escherichia coli which affects the processing of ribosomal R N A . J. Biol . Chem. 253, 1738-1742. Atkinson, T. and M . Smith. 1984. Solid phase synthesis of oligodeoxyribonucleotides by the phosphite-triester method, pp. 35-81. In M.J . Gait (ed.), Oligonucleotide Synthesis. A Practical Approach. IRL Press, Oxford /Washington. Barry, G . , C . Squires and C .L . Squires. 1980. Attenuation and processing of R N A from the rplTL-rpoBC transcription unit of Escherichia coli. Proc. Nat l . Acad. Sci. U S A 77, 3331-3335. Barry, G . , C .L . Squires and C. Squires. 1979. Control features within the rplKATL-rpoBC transcription unit of Escherichia coli. Proc. Natl . Acad. Sci. U S A 76, 4922-4926. Baughman, G . and M . Nomura. 1983. Localization of the target site for translational regulation of the L l l operon and direct evidence for translational coupling in Escherichia  coli. Ce l l 34, 979-988. Bedwell, D . M . and M . Nomura. 1986. Feedback regulation of R N A polymerase subunit synthesis after the conditional overproduction of R N A polymerase i n Escherichia coli. M o l . Gen. Genet. 204, 17-23. Berk, A . J . and P .A . Sharp. 1978. Spliced early m R N A s of simian virus 40. Proc. Nat l . Acad. Sci. U S A 75, 1274-1278. Berkhout, B. and J. van Duin . 1985. Mechanism of translational coupling between coat protein and replicase genes of R N A bacteriophage MS2. Nuc l . Acids Res. 13, 6955-6967. Blumenthal, R . M . , P .G. Lemaux, F.C. Neidhardt and P.P. Dennis. 1976. The effects of the relA gene on the synthesis of aminoacyl-tRNA synthetases and other transcription and translation proteins in Escherichia coli B. M o l . Gen. Genet. 149, 291-296. Boyen, A . , J. Piette, R. Cun in and N . Glansdorff. 1982. Enhancement of translation efficiency i n Escherichia coli by mutations in a proximal domain of m R N A . J. M o l . Biol . 162, 715-720. Bruckner, R. and H . Matzura. 1981. Jn vivo synthesis of a polycistronic messenger R N A for the ribosomal proteins L l l , L I , L10 and L 7 / L 1 2 in Escherichia coli. M o l . Gen. Genet. 183, 277-282. 110 Burton, Z.F. , C . A . Gross, K . K . Watanabe and R.R. Burgess. 1983. The operon that encodes the sigma subunit of R N A polymerase also encodes ribosomal protein S21 and D N A primase in E. coli K12. Ce l l 32, 335-349. Cannistraro, V.J . and D . Kennell. 1985. Evidence that the 5' end of lac m R N A starts to decay as soon as it is synthesized. I- Bacteriol. 161, 820-822. Cashel, M . and K . E . Rudd. 1987. The stringent response, pp. 1410-1438. In F.C. Neidhardt (ed. i n chief), Escherichia coli and Salmonella tvphimurium; Cellular and Molecular Biology, V o l . 2. American Society for Microbiology, Washington D.C. Cerretti, D P . , D. Dean, G.R. Davis, D . M . Bedwell and M . Nomura. 1983. The spc ribosomal protein operon of Escherichia c o l i : Sequence and cotranscription of the ribosomal protein genes and a protein export gene. Nuc l . Acids Res. 11, 2599-2616. Cerretti, D.P., L . C . Mattheakis, K.R. Kearney, L . V u and M . Nomura. 1988. Translational regulation of the sp_c operon i n Escherichia coli; identification and structural analysis of the target site for S8 repressor protein. J. M o l . Biol . 204, 309-329. Chamberlin, M.J. , K . M . Arndt , J.F. Briat, R.L. Reynolds and M . C . Schmidt. 1987. Prokaryptic factors involved i n termination at rho-independent tennination sites, pp. 347-356. Jn W.S. Reznikoff, R.R. Burgess, J.E. Dahlberg, C . A . Gross, M.T . Record, Jr., M . P . Wickens (editors), R N A Polymerase and the Regulation of Transcription. Proceedings of the Sixteenth Steenbock Symposium. Elsevier Science Publishing Co., Inc., N . Y . , N . Y . Christensen, T., M . Johnsen, N . P . F i l l and J.D. Friesen. 1984. R N A secondary structure and translation inhibition : Analysis of mutants in the rpJI leader. E M B O J. 3, 1609-1612. Cl imie, S.C. and J.D. Friesen^ 1987. Feedback regulation of the rplTL-rpoBC ribosomal protein operon of Escherichia coli requires a region of m R N A secondary structure. J. M o l . Biol . 198, 371-381. Cole, J.R. and M . Nomura. 1986a. Changes in the half-life of ribosomal protein messenger R N A caused by translation repression. J. M o l . Biol . 188, 383-392. Cole, J.R. and M . Nomura. 1986b. Translation regulation is responsible for growth-rate-dependent and stringent control of the synthesis of ribosomal proteins L l l and L I in Escherichia coli. Proc. Nat l . Acad. Sci. U S A 83, 4129-4133. de Boer, H . A . and R .A . Kastelein. 1986. Biased codon usage : an exploration of its role in optimization of translation, pp. 225-285. Jn W . Reznikoff and L . Go ld (editors), Maximiz ing gene expression. Butterworth Publishers, Stoneham, Mass. Dean, D. , J.L. Yates and M . Nomura. 1981. Identification of ribosomal protein S7 as a repressor of translation wi thin the str operon of E. coli., Ce l l 24, 413-419. Deckman, I.C. and D.E. Draper. 1985. Specific interaction between ribosomal protein S4 and the alpha operon messenger R N A . Biochemistry 24, 7860-7865. Dennis, P.P. 1977a. Transcription patterns of adjacent segments on the chromosome of E. coli containing genes coding for four 50S ribosomal proteins and the P and p' subunits of 111 R N A polymerase. T. M o l . Biol . 115, 603-625. Dennis, P.P. 1977b. Regulation of synthesis and activity of a mutant R N A polymerase in Escherichia coli. Proc. Nat l . Acad. Sci. U S A 74, 5416-5420. Dennis, P.P. 1984. Site specific deletions of regulatory sequences in a ribosomal protein-R N A polymerase operon in Escherichia coli. J. Biol . Chem. 259, 3202-3209. Dennis, P.P., V . Nene and R.E. Glass. 1985. Autogenous post-transcriptional regulation of R N A polymerase B and B' subunit synthesis in Escherichia coli. J. Bacterid. 161, 803-806. Dennis, P.P. and M . Nomura. 1974. Stringent control of ribosomal protein gene expression in Escherichia coli. Proc. Nat l . Acad. Sci. U S A 7 L 3819-3823. Dente, L . , G . Cesareni and R. Cortese. 1983. p E M B L : a new family of single stranded plasmids. Nuc l . Acids Res. 11, 1645-1655. Dijk, J., R . A . Garret and R. Muller . 1979. Studies on the binding of the ribosomal protein complex L7/L12-L10 and protein L l l to the 5' one third of 23s R N A : a functional centre of the 50S subunit. Nuc l . Acids Res. 6, 2717-2729. Downing, W . L . and P.P. Dennis. 1987. Transcription products from the rplKATL-rpoBC gene cluster. J. M o l . Biol . 194, 609-620. Downing, W . L . , S. Sullivan, M . Gottesman and P.P. Dennis. 1989. Sequence and transcription pattern of the essential Escherichia coli secE-nusG operon. (Manuscript submitted). Dunn, J.J. and F.W. Studier. 1975. Effect of RNase l l l cleavage on translation of bacteriophage T7 messenger R N A s . J. M o l . Biol . 99, 487-499. Duval l , E.J., D . M . Will iams, P.S. Lovett, C. Rudolph, N . Vasantha and M . Guyer. 1983. Chloramphenicol-inducible gene expression in Bacillus subtilis. Gene 24, 171-177. Fallon, A . M . C.S. Jinks, G .D. Strycharz and M . Nomura. 1979. Regulation of ribosomal protein synthesis i n Escherichia coli by selective m R N A inactivation. Proc. Natl . Acad. Sci. U S A 76, 3411-3415. Farnham, P.J., J. Greenblatt and T. Piatt. 1982. Effects of N u s A protein on transcription termination i n the tryptophan operon of Escherichia coli. Ce l l 29, 945-951. Favaloro, J., R. Treisman and R. Kamen. 1980. Transcription maps of polyoma virus-specific R N A : Analysis by two-dimensional nuclease SI gel mapping. Methods Enzymol. 65, 718-749. F i i l , N .P . , J.D. Friesen, W . L . Downing and P.P. Dennis. 1980. Post-transcriptional regulatory mutants in a ribosomal protein-RNA polymerase operon of E. coli. Ce l l 19, 837-844. Freedman, L.P. , J .M. Zengel, R . H . Archer and L . Lindahl . 1987. Autogenous control of the S10 ribosomal protein operon of Escherichia coli : genetic dissection of transcriptional and posttranscriptional regulation. Proc. Natl . Acad. Sci. U S A 84, 6516-6520. 112 Freedman, L.P. , J .M. Zengel and L . Lindahl . 1985. Genetic dissection of stringent control and nutritional shift-up response of the Escherichia coli S10 ribosomal protein operon. J. M o l . Bio l . 185, 701-712. Friedman, D.I. and M . Gottesman. 1983. Lytic mode of lambda development, pp. 21-51. In R.W. Hendrix, J.W. Roberts, F.W. Stahl and R . A . Weisberg (editors), Lambda II. C o l d Spring Harbor Laboratory, C o l d Spring Harbor, N . Y . Friesen, J.D., M . Tropak and G . A n . 1983. Mutations i n the rpJJ, leader of Escherichia coli that abolish feedback regulation. Ce l l 32, 361-369. Fukuda, R., M . Taketo and A . Ishihama. 1978. Autogenous regulation of R N A polymerase P subunit synthesis i n vitro. J. Biol . Chem. 253, 4501-4504. Gegenheimer, P. and D . Api r ion . 1981. Processing of procaryotic ribonucleic acid. Microbiol . Rev. 45, 502-541. Ghora, B.K. and D . Api r ion . 1979. Identification of a novel R N A molecule in a new R N A processing mutant of Escherichia coli which contains 5S r R N A sequences. J. Biol . Chem. 254, 1951-1956. Glass, R.E., S.T. Jones and A . Ishihama. 1987. R N A polymerase IS a target for ppGpp. pp. 393-395. In W.S. Reznikoff, R.R. Burgess, J.E. Dahlberg, C . A . Gross, M.T . Record, Jr., M . P . Wickens (editors), R N A Polymerase and the Regulation of Transcription. Proceedings of the Sixteenth Steenbock Symposium. Elsevier Science Publishing Co. , Inc., N . Y . , N . Y . Gottesman, M . , A . Oppenheim and D . Court. 1982. Retroregulation : Control of gene expression from sites distal to the gene. Cel l 29, 727-728. Gregory, R.J., P.B.F. Cahi l l , D .L . Thurlow and R A . Zimmermann. 1988. Interaction of Escherichia coli ribosomal protein S8 wi th its binding sites in ribosomal R N A and messenger R N A . J. M o l . Biol . 204, 295-308. Hardy, S. 1975. The stoichiometry of the ribosomal proteins in Escherichia coli. M o l . Gen. Genet. 140, 253-274. Hattori, M . and Y. Sakaki. 1986. Dideoxy sequencing method using denatured plasmid templates. Ana l . Biochem. 152, 232-238. Hayward, R.S. and S.K. Fyfe. 1978. Non-coordinate expression of the neighbouring genes rp lL and rpoBC of Escherichia coli. M o l . Gen. Genet. 160, 77-80. H u i , I., K . Maltman, R. Little, S. Hastrup, M . Johnsen, N . F i i l and P. Dennis. 1982. Insertions .of transposon Tn5 into ribosomal protein R N A polymerase operons. J. Bacteriol. 152, 1022-1032. Ishihama, A . , N . Fujita and T. Nomura. 1987. Promoter selectivity of Escherichia coli R N A polymerase, pp. 397-401. In W.S. Reznikoff, R.R. Burgess, J.E. Dahlberg, C . A . Gross, M.T . Record, Jr., M . P . Wickens (Editors), R N A Polymerase and the Regulation of Transcription. Proceedings of the Sixteenth Steenbock Symposium. Elsevier Science Publishing Co., Inc., N . Y . , N . Y . 113 Jaskunas, S.R., R.R. Burgess and M . Nomura. 1975. Identification of a gene for the alpha-subunit of R N A polymerase at the str-spc region of the Escherichia coli chromosome. Proc. Nat l . Acad. Sci. U S A 72, 5036-5040. Jinks-Robertson, S. and M . Nomura. 1987. Ribosomes and t R N A . pp. 1358-1385. In F.C. Neidhardt (ed. in chief), Escherichia coli and Salmonella tvphimurium ; Cellular and Molecular Biology, V o l . 2. American Society for Microbiology, Washington D.C. Johnsen, M . , T. Christensen, P.P. Dennis and N . P . F i i l . 1982. Autogenous control : Ribosomal protein L10-L12 complex binds to the leader sequence of its m R N A . E M B O J. 1, 999-1004. Kajitani, M . and A . Ishihama. 1984. Promoter selectivity of Escherichia coli R N A polymerase. Differential stringent control of the multiple promoters from ribosomal R N A and protein operons. J. Biol . Chem. 259, 1951-1957. Kastelein, R .A. , B. Berkhout, G.P. Overbeek and J. van Duin . 1983. Effect of the sequences upstream from the ribosome binding site on the yield of protein from the cloned gene for phage MS2 coat protein. Gene 23, 245-254. King , T.C., R. Sirdeskmukh and D . Schlessinger. 1986. Nucleolytic processing of ribonucleic acid transcripts i n prokaryotes. Microbiol . Rev. 50, 428-451. Kingston, R.E. and M.J . Chamberlin. 1981. Pausing and attenuation of in vitro transcription in the rrnB operon of E. coli. Ce l l 27, 523-531. Kirschbaum, J.B. and E.B. Konrad. 1973. Isolation of a specialized lambda transducing bacteriophage carrying the beta subunit gene for Escherichia coli ribonucleic acid polymerase. J. Bacteriol. 116, 517-526. Kornitzer, D . , D. Teff, S. Al tuvia , A . B . Oppenheim. 1989. Genetic analysis of bacteriophage lambda cin gene : m R N A structural requirements for translation initiation. J. Bacteriol. 171, 2563-2572. Kunkel , T .A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Nat l . Acad. Sci. U S A 82, 488-492. Kunkel , T .A. , J.D. Roberts and R .A . Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154, 367-382. Kuroki , K . , S. Ishii, Y . Kano, T. Miyashita, K , N i s h i and F. Imamoto. 1982. Involvement of the nusA and nusB gene products i n transcription of Escherichia coli tryptophan operon m vitro. M o l . Gen. Genet. 185, 369-371. Laemmli, U . K . 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lake, J.A. and W . A . Strycharz. 1981. Ribosomal proteins L I , L17 and L27 from Escherichia  coli localized at single sites on the large subunit by immune electron microscopy. J. M o l . Bio l . 153, 979-992. Landick, R. and C . Yanofsky. 1987. Transcription attenuation, pp. 1276-1301. In F .C. 114 Neidhardt (ed. in chief), Escherichia coli and Salmonella typhimurium ; Cellular and Molecular Biology, V o l . 2. American Society for Microbiology, Washington D.C. Lemaire, G . , L . Go ld and M . Yarus. 1978. Autogenous translational repression of bacteriophage T4 Gene 32 expression m vitro. J. M o l . Biol . 126, 73-90. Liljas, A . 1982. Structural studies of ribosomes. Prog. Biophys. M o l . Biol . 40, 161-228. Lindahl , L . , R . H . Archer, J .R McCormick, L.P. Freedman and J .M. Zengel. 1989. Translational coupling of the two proximal genes in the S10 ribosomal protein operon of Escherichia coli. J. Bacteriol. 171; 2639-2645. Lindahl , L . , R. Archer and J .M. Zengel. 1983. Transcription of the S10 ribosomal protein operon is regulated by an attenuator in the leader. Ce l l 33, 241-248. Lindahl , L . and J .M. Zengel. 1979. Operon-specific regulation of the S10 ribosomal protein synthesis i n Escherichia coli. Proc. Nat l . Acad. Sci. U S A 16, 6542-6546. Lindahl , L . and J .M. Zengel. 1986. Ribosomal genes in Escherichia coli. A n n . Rev. Genet. 20, 297-326. L inn , T. and J. Scaife. 1978. Identification of a single promoter i n E. coli for rplL rp lL and rpoBC. Nature 276, 33-37. Little, R. and H . Bremer. 1984. Transcription of ribosomal component genes and lac in a r e l A V r e l A pair of Escherichia coli strains. J. Bacteriol. 159, 863-869. Little, R. and P.P. Dennis. 1980. Regulation of R N A polymerase synthesis : Conditional lethal amber mutations i n the p subunit. J. Biol . Chem. 255, 3536-3541. Little, R., N . P . F i i l and P.P. Dennis. 1981. Transcriptional and post-transcriptional control of ribosomal protein and ribonucleic acid polymerase genes. J. Bacteriol. 147, 25-35. Looman, A . C . , J. Bodlaender, L.J. Comstock, D. Eaton, P. Jhurani, H . A . de Boer and P . H . van Knippenberg. 1987. Influence of the codon following the A U G initiation codon on the expression of a modified lacZ gene i n Escherichia coli. E M B O J. 6, 2489-2492. Looman, A . C . , J. Bodlaender, M . de Gruyter, A . Vogelaar and P . H . van Knippenberg. 1986. Secondary structure as primary detenninant of the efficiency of ribosomal binding sites in Escherichia coli. Nuc l . Acids Res. 14, 5481-5497. M a , J.C., A.J . Newman and R.S. Hayward. 1981. Internal promoters of the rpoBC operon of Escherichia coli. M o l . Gen. Genet. 184, 548-550. Mackie, G. 1987. Postranscriptional regulation of ribosomal protein S20 and stability of the S20 m R N A species. J. Bacteriol. 169, 2697-2701. Maher, D .L . and P.P. Dennis. 1977. In vivo transcription of E. coli genes coding for r R N A , ribosomal proteins and subunits of R N A polymerase : Influence of the stringent control system. M o l . Gen. Genet. 155, 203-211. Maniatis, T., E. Fritsch and J. Sambrook, editors. 1982. Molecular Cloning : A Laboratory 115 Manual . C o l d Spring Harbor Laboratory Press, C o l d Spring Harbor, N . Y . Matsumoto, Y . , K . Shigesada, M . Hirano and M . Imai. 1986. Autogenous regulation of the gene for transcription termination factor Rho in Escherichia coli : Localization and function of its attenuator. J. Bacteriol. 166, 945-958. Mattheakis, L . C . and M . Nomura. 1988. Feedback regulation of the spc operon in Escherichia coli : translational coupling and m R N A processing. J. Bacteriol. 170, 4484-4492. Maxam, A . M . and W . Gilbert. 1980. Sequencing end-labeled D N A with base-specific chemical cleavages. Methods Enz. 65, 499-560. Mayford, M . and B. Weisblum. 1985. Messenger R N A from Staphylococcus aureus that specifies macrolide-lincosamide-streptogramin resistance : demonstration of its conformations and of the leader peptide it encodes. J. M o l . Biol . 185, 769-780. McCarthy, J.E.G., H . U . Schairer and W . Sebald. 1985. Translational initiation frequency of atp genes from Escherichia coli : Identification of an intercistronic sequence that enhances translation. E M B O J. 4, 519-526. McPheeters, D.S., G.D. Stormo and L . Gold . 1988. Autogenous regulatory site on the bacteriophage T4 gene 32 messenger R N A . J. M o l . Biol . 20L 517-535. Meek, D.W. and R.S. Hayward. 1986. Direct evidence for autogenous regulation of the Escherichia coli genes rpoBC m vivo. M o l . Gen. Genet. 202, 500-508. Messing, J. 1983. N e w M13 vectors for cloning. Methods Enz. 101, 20-79. Mil ler , J. 1972. Experiments i n Molecular Genetics. C o l d Spring Harbor Laboratory Press, C o l d Spring Harbor, N . Y . Miura , A . , J .H. Krueger, S. Itoh, H . A . de Boer and M . Nomura. 1981. Growth-rate-dependent regulation of ribosome synthesis i n E. coli : expression of the lacZ and galK genes fused to ribosomal promoters. Ce l l 25, 773-782. Morgan, B .A . and R.S. Hayward. 1987. Direct evidence for rifampicin-promoted readthrough of the partial terminator t^ in the rpoBC operon of Escherichia coli. M o l . Gen. Genet. 210, 358-363. Munson, L . M . , G .D. Stormo, R.L. Niece and W.S. Reznikoff. 1984. LacZ translation initiation mutations. J. M o l . Biol . 177, 663-683. Narayanan, C.S. and D . Dubnau. 1987. A n m vitro study of the translational attenuation model of ermC regulation. J. Biol . Chem. 262, 1756-1765. Ner, S.S., D.B. Goodin and M . Smith. 1988. A simple and efficient procedure for generating random point mutations and for codon replacements using mixed oligodeoxynucleotides. D N A 7, 127-134. Newman, A . 1987. Specific accessory sequences i n Saccharomyces cerevisiae introns control assembly of pre-mRNAs into spliceosomes. E M B O J. 6, 3833-3839. 116 Newman, A . , T. L i n n and R. Hayward. 1979. Evidence for co-transcription of the R N A polymerase genes rpoBC wi th a ribosomal protein gene of Escherichia coli. M o l . Gen. Genet. 169, 195-204. Noller, H.F. 1984. Stmcture of ribosomal R N A . A n n . Rev. Biochem. 53, 119-162. Noller , H.F . and M . Nomura. 1987. Ribosomes. pp. 104-125. In F.C. Neidhardt (ed. in chief), Escherichia coli and Salmonella typhimurium; Cellular and Molecular Biology, vol . 1. American Society for Microbiology, Washington, D .C . Nomura, M . , R. Gourse and G . Baughman. 1984. Regulation of the synthesis of ribosomes and ribosomal components. A n n . Rev. Biochem. 53, 75-117. Nomura, M . , J.L. Yates, D . Dean and L .E . Post. 1980. Feedback regulation of ribosomal protein gene expression in Escherichia coli : Structural homology of ribosomal R N A and ribosomal protein m R N A . Proc. Natl . Acad. Sci. U S A 77, 7084-7088. Olins, P. and M . Nomura. 1981. Translational regulation by ribosomal protein S8 in Escherichia coli : Structural homology between r R N A binding site and feedback target on m R N A . Nuc l . Acids Res. 9, 1757-1764. Oliver, D.B. 1987. Periplasm and protein secretion, pp. 56-69. In F.C. Neidhardt (ed. in chief), Escherichia coli and Salmonella typhimurium; Cellular and Molecular Biology, vol . 1. American Society for Microbiology, Washington D . C . Oppenheim, D . and C. Yanofsky. 1980. Translational coupling during expression of the tryptophan operon in Escherichia coli . Genetics 95, 785-795. Parsons, G.D. , B.C. Donly and G . A . Mackie. 1988. Mutations i n the leader sequence and initiation codon of the gene for ribosomal protein S20 (rpsT) affect both translational efficiency and autoregulation. J. Bacteriol. 170, 2485-2492. Pettersson, I. 1979. Studies on the R N A and protein binding sites of the E. coli ribosomal protein L10. Nuc l . Acids Res. 6, 2637-2646. Pettersson, I. and A . Liljas. 1979. The stoichiometry and reconstitution of a stable protein complex from Escherichia coli ribosomes. FEBS Lett. 98, 139-144. Piatt, T. 1986. Transcription termination and the regulation of gene expression. A n n . Rev. Bioch. 55, 339-371. Plumbridge, J.A., J. Dondon, Y . Nakamura and M . Grunberg-Manago. 1985. Effect of N u s A protein on expression of the nusA, infB operon in E. coli. Nuc l . Acids Res. 13, 3371-3388. Portier, C , L . Dondon, M . Grunberg-Manago and P. Regnier. 1987. The first step i n the functional inactivation of the Escherichia coli polynucleotide phosphorylase messenger is a ribonuclease HI processing at the 5' end. E M B O J. 6, 2165-2170. Post, L .E . , G .D. Strycharz, M . Nomura, H . Lewis and P.P. Dennis. 1979. Nucleotide sequence of the ribosomal protein gene cluster adjacent to the gene for R N A polymerase subunit 6 i n Escherichia coli. Proc. Nat l . Acad. Sci. U S A 76, 1697-1701. 117 Queen, C . and M . Rosenberg. 1981. Differential translation efficiency explains discoordinate expression of the galactose operon. Ce l l 25, 241-249. Railing, G . and T. Linn . 1984. Relative activities of the transcriptional regulatory sites in the rplKATLrpoBC gene cluster of Escherichia coli. J. Bacteriol. 158, 279-285. Railing, G . and T. Linn. 1987. Evidence that Rho and N u s A are involved in termination in the rplL-rpoB intercistronic region. J. Bacteriol. 169, 2277-2280. Reeh, S., S. Pedersen and J.D. Friesen. 1976. Biosynthetic regulation of individual proteins in r e L V and re lA strains of Escherichia coli during amino acid starvation. M o l . Gen. Genet. 149, 279-289. Regnier, P. and C. Portier. 1986. Initiation, attenuation and RNase l l l processing of transcripts from the E. coli operon encoding ribosomal protein SI 5 and polynucleotide phosphorylase. J. M o l . Biol . 187, 23-32. Rigby, P.W.J., M . Diekmann, C. Rhodes and P Berg. 1977. Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with D N A polymerase I. J. M o l . Biol . 113, 237-251. Russell, M . , S. K i d d and M . R . Kelley. 1986. A n improved filamentous helper phage for generating single-stranded plasmid D N A . Gene 45, 333-338. Ryals, J., R. Little and H. Bremer. 1982. Control of r R N A and t R N A syntheses in Escherichia coli by guanosine tetraphosphate. J. Bacteriol. 151, 1261-1268. Said, B. , J.R. Cole and M . Nomura. 1988. Mutational analysis of the L I binding site of 23S r R N A i n Escherichia coli. Nuc l . Acids Res. 16, 10529-10545. Sander, G . 1983. Ribosomal protein L I from Escherichia coli. Its role i n the binding of t R N A to the ribosome and i n elongation factor G-dependent G T P hydrolysis. J. Biol . Chem. 258, 10098-10102. Sanger, F., A . R . Coulson, B .G. Barrell, A . J .H . Smith and B.A. Roe. 1980. Cloning in single-stranded bacteriophage as an aid to rapid D N A sequencing. J. M o l . Biol . 143, 161-178. Sanger, F., S. Nicklen and A . R . Coulson. 1977. D N A sequencing with chain terminating inhibitors. Proc. Nat l . Acad. Sci. U S A 74, 5463-5467. Schatz, P.J., P .D. Riggs, A . Jacq, M.J . Fath and J. Beckwith. 1989. The secE gene encodes an integral membrane protein required for protein export i n E. coli. Genes and Dev. 3, 1035-1044. Scherer, G.F.E., M . D . Walkinshaw, S. Arnott and D.J. Morre. 1980. The ribosome binding sites recognized by E. coli ribosomes have regions wi th signal character in both the leader and protein coding segments. Nuc l . Acids Res. 8, 3895-3907. Schmidt, M . G . and D.B. Oliver. 1989. Sec A protein autogenously represses its own translation during normal protein secretion in Escherichia coli. J. Bacteriol. 171, 643-649. Schneider, E. , M . Blundell .and D . Kennell. 1978. Translation and m R N A decay. M o l . Gen. 118 Genet. 160, 121-129. Sharrock, T.A. , R.L. Gourse and M . Nomura. 1985. Defective antitermination of r R N A and t R N A synthesis in the nusB5 mutant of Escherichia coli. Proc. Nat l . Acad. Sci. U S A 82, 5275-5279. Shephard, N . , G . Churchward and H . Bremer. 1980. Synthesis and activity of ribonucleic acid polymerase in Escherichia coli. J. Bacteriol. 141, 1098-1108. Singer, P. and M . Nomura. 1985. Stability of ribosomal protein m R N A and translational feedback regulation i n Escherichia coli. M o l . Gen. Genet. 199, 543-546. Sor, F., M . Bolotin-Fukuhara and M . Nomura. 1987. Mutational alterations of translational coupling in the L l l ribosomal protein operon of Escherichia coli. J. Bacteriol. 169, 3495-3507. Springer, M . , J.A. Plumbridge, J.S. Butler, M . Graffe, J. Dondon, J.F. Mayaux, G . Fayat, P. Lestienne, S. Blanquet and M . Grunberg-Manago. 1985. Autogenous control of Escherichia coli threonyl-tRNA synthetase expression in vivo. J. M o l . Biol . 185, 93-104. Stanssens, P., E. Remaut and W . Fiers. 1985. Alterations upstream from the Shine-Dalgarno region and their effect on bacterial gene expression. Gene 36, 211-223. Strycharz, W . A . , M . Nomura and J.A. Lake. 1978. Ribosomal proteins L 7 / L 1 2 localized at a single region of the large subunit by immune electron microscopy. J. M o l . Biol . 126, 123-140. Subramanian, A . R . 1975: Copies of proteins L7 and L12 and heterogeneity of the large subunit of Escherichia coli ribosome. J. M o l . Biol . 95, 1-8. Subramanian, A .R . and E.R. Dabbs. 1980. Functional studies on ribosomes lacking protein L I from mutant Escherichia coli. Eur. J. Biochem. 112, 425-430. Takiff, H.E. , S .M. Chen and D.L . Court. 1989. Genetic analysis of the rnc operon of Escherichia coli. J. Bacteriol. 171, 2581-2590. Tang, C .K . and D.E. Draper. 1989. Unusual m R N A pseudoknot structure is recognized by a protein translational repressor. Ce l l 57, 531-536. Taylor, W . and R. Burgess. 1979. Escherichia coli R N A polymerase binding and initiation of transcription on fragments of A r i f l B D N A containing promoters for X genes and for rrnB,  tufB, r p l K A , rplTL and rpoBC genes. Gene 6, 331-365. Thomas, M.S. , D . M . Bedwell and M . Nomura. 1987. Regulation of alpha operon gene expression i n Escherichia coli. A novel form of translational coupling. J. M o l . Biol . 196, 333-345. Thomas, M.S. and M . Nomura. 1987. Translational regulation of the L l l ribosomal protein operon of Escherichia c o l i : Mutations that define the target site for repression by L I . Nuc l . Acids Res. 15, 3085-3096. Tomcsanyi, T. and D . Api r ion . 1985. Processing enzyme ribonuclease E specifically cleaves 119 R N A I , an inhibitor of primer formation in plasmid D N A synthesis. J. M o l . Biol . 185, 713-720. Travers, A . 1976. Modulat ion of R N A polymerase specificity by ppGpp. M o l . Gen. Genet. 147, 225-232. Travers, A . A . 1980. Promoter sequence for stringent control of bacterial ribonucleic acid synthesis. J. Bacteriol. 141, 973-976. Travers, A . A . 1984. Conserved features of coordinately regulated E. coli promoters. N u c l . Acids Res. 12, 2605-2618. Travers, A . A . , R. Buckland and P .G. Debenham. 1980. Functional heterogeneity of Escherichia coli ribonucleic acid polymerase holoenzyme. Biochemistry 19, 1656-1662. Tuerk, C ; P. Gauss, C. Thermes, D.R. Groebe, M . Gayle, N . Gu i ld , G . Stormo, Y . D'Arbenton-Carafa, O.C. Uhlenbeck, I. Tinoco Jr., E . N . Brody and L . Gold . 1988. C U U C G G hairpins : extraordinarily stable R N A secondary structures associated with various biochemical processes. Proc. Nat l . Acad. Sci. U S A 85, 1364-1368. V a n Delft, J .H .M. , D.S. Schmidt and L . Bosch. 1987. The tRNA-tufB operon transcription termination and processing upstream from tufB. J. M o l . Biol . 197, 647-657. van Gemen, B., J. Twisk and P . H . van Knippenberg. 1989. Autogenous regulation of the Escherichia coli ksgA gene at the level of translation. J. Bacteriol. 171, 4002-4008. von Gabain, A . , J.G. Belasco, J.L. Schottel, A . C . Y . Chang and S.N. Cohen. 1983. Decay of m R N A i n Escherichia coli : Investigation of the fate of specific segments of transcripts. Proc. Nat l . Acad. Sci. U S A 80, 653-657. Ward , D.F. and M . E . Gottesman. 1981. The nus mutation affects transcriptional termination in Escherichia coli. Nature (London) 292, 212-215. Wikstrom, P . M . and G.R. Bjork. 1988. Noncoordinate translation-level regulation of ribosomal and nonribosomal protein genes in the Escherichia coli t rmD operon. J. Bacteriol. 170, 3025-3031. Wikstrom, P . M . , A.S. Bystrom and G.R. Bjork. 1988. Non-autogenous control of ribosomal protein synthesis from the t rmD operon in Escherichia coli. J. M o l . Biol . 203, 141-152. Yager, T.D. and P . H . von Hippel . 1987. Transcript elongation and termination in Escherichia coli. pp. 1241-1275. In F .C. Neidhardt (ed. i n chief), Escherichia coli and Salmonella typhimurium; Cellular and Molecular Biology, V o l . 2. American Society for Microbiology, Washington D .C . Yamagishi, M . , J.R. Cole, M . Nomura, F.W. Studier and J.J. Dunn. 1987. Stringent control in Escherichia coli applies also to transcription by T7 R N A polymerase. J. Biol . Chem. 262, 3940-3943. Yamamoto, M . and M . Nomura. 1978. Cotranscription of the genes i o r R N A polymerase subunits (3 and P' wi th genes for ribosomal proteins i n Escherichia coli. Proc. Natl . Acad. Sci. U S A 75, 3891-3895. 120 Yang, H . L . and G . Zubay. 1981. Negative regulation of B and B' synthesis by R N A polymerase. M o l . Gen. Genet. 183, 514-517. ' Yates, J.L. and M . Nomura. 1980. E. coli ribosomal protein L4 is a feedback regulatory protein. Ce l l 21, 517-522. Z i l l i g , W. , P. Palm and A . Hei l . 1976. Function and reassembly of subunits of D N A -dependent R N A polymerase, pp. 101-125. In R. Losick and M . Chamberlin (editors), R N A Polymerase. C o l d Spring Harbor Laboratory, C o l d Spring Harbor, N . Y . Zoller, M.J . and M . Smith. 1982. Oligonucleotide-directed mutagenesis using M13-derived vectors : A n efficient and general procedure for the production of point mutations in any fragment of D N A . Nuc l . Acids Res. 10, 6487-6500. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098278/manifest

Comment

Related Items