UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A Drosophila tRNA gene family Newton, Craig Hunter 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1989_A1 N48.pdf [ 9.81MB ]
Metadata
JSON: 831-1.0098177.json
JSON-LD: 831-1.0098177-ld.json
RDF/XML (Pretty): 831-1.0098177-rdf.xml
RDF/JSON: 831-1.0098177-rdf.json
Turtle: 831-1.0098177-turtle.txt
N-Triples: 831-1.0098177-rdf-ntriples.txt
Original Record: 831-1.0098177-source.json
Full Text
831-1.0098177-fulltext.txt
Citation
831-1.0098177.ris

Full Text

A DROSOPHILA  tRNA GENE FAMILY By  Craig Hunter Newton B.Sc., McGill University,  1980  M.Sc., University of British Columbia,  1984  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in THE FACULTY OF GRADUATE STUDIES Department  of  Biochemistry  We accept this thesis as conforming to the required  standard  THE UNIVERSITY OF BRITISH COLUMBIA ©  C. H. Newton 1989  In presenting this thesis  in partial fulfilment of the  requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive v  copying of this thesis for scholarly purposes may be granted by the head of my department  or  by his or  her  representatives.  It  is  understood  that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada  DE-6 (2/88)  ii  Abstract  This thesis describes a t R N A ^ r g gene family in the fruit fly D.  The  melanogaster.  study was initiated in order to better understand the gene organization of a subset of this family. Of a total of 10 tRNA^rg gene copies that comprise this genes This  are arranged tandemly on repeated sequences 200 organization  duplication.  suggests  To investigate  these  the  four  genes  bp and 600  have  bp in length.  undergone  significance of such events,  these  family, four  recent  tRNA^rg  gene genes  were compared to other members of this gene family in regards their structure, function, and organization between  vitro sibling  different D.  in  strains and  melanogaster  species. The  results show that the four repeated genes differ in sequence at a single  nucleotide (CI3)  relative to six additional gene copies. Five of these additional genes  are identical in sequence and one differs at two nucleotides (A16,  A37). The gene  family is organized at four different chromosomal sites. Six of the  10 gene copies  occur  at  polytene region  12E1-2 on the  X  chromosome.  These  include the four  repeated genes (R12.1-R12.4) and two additional gene copies (R12.5-R12.6). A single gene occurs at another X-linked locus located at  19F (R19.1). The three remaining  gene copies occur on chromosome 3R as a gene doublet at 85C (R85.1-R85.2) and as a single gene at 83AB (R83.1). All 10 genes in this family are active as templates for in vitro homologous and  extracts. The predicted 5' initiation sites are all very similar  Drosophila  occur at conserved nucleotides 4-5  genes.  Six of the ten gene copies  repeated  gene  copies  less efficient templates concentrations  where  transcription in.  however,  bp upstream from the mature 5' ends of the  are  have novel  in Drosophila other  transcribed efficiently in  gene  copies  vitro  transcription properties;  extracts (2-5 transcribe  .  they  The four are much  fold) and are inhibited at KC1 optimally. These  properties do  not result from the single nucleotide difference in coding sequence or an inability to  iii form  stable  pre-initiation complexes.  upstream  5'  flanking  sequence.  observed  in_heterologous  Instead  These  transcription  novel systems  they  appear  to  transcription containing  result  from the  properties human  are not  cell  extracts.  Instead they are transcribed efficiently relative to other members of the gene family and no longer exhibit sensitivity to KC1. Comparison of the repeated tRNA^rg gene locus between several strains  indicates  laboratory  that this  D.  melanogaster  is the predominant form in the majority  of wild and  stocks. However, a fraction of populations (5/45) contain a variant locus  that consists of only three gene copies. These have apparently lost, or not gained, one of the repeats found in the majority of populations. Similar comparisons between D. sibling species  melanogaster  show that only the  D.  (D.  simualns,  melanogaster  D.  teissieri,  D.  lines have  putative  ancestral  isolated from respectively, this gene  D.  acquired three new gene  single gene.  at the nucleotide level  (pDt27R, p27ry2) and  )  D.  (D.  simulans  ), D .  by duplication of a and single gene simulans  loci  (p27simC),  suggests a model to account for the evolution of  cluster.  One additional sequence associated tRNA^rg  copies  Analysis of the four, three,  melanogaster  yakuba  lines contain the repeated genes. Thus in the  time since the divergence from its closest related sibling species melanogaster  and D.  erecta,  with this gene family consists of a half  gene composed of the 3' 37 bp. This half gene contains a 3' CCA sequence  and is flanked on one side by a region that is > 90% homologous to the LTR of the Drosophila  related  retrotransposon retrotransposon  or  mdg  1. It is not clear if this half gene is itself part of a  has originated  by recombination  transcription with mdg 1. The 3' ends t R N A g Ar  or  aberrant  reverse  have been proposed to function as  primers for at least two classes of retrotransposon, mdg 1 and 412  (Yuki et al., 1986).  iv T A B L E OF CONTENTS Page  Abstract  ii  Table of Contents  iv  List of Tables  x  List of Figures  xi  Acknowledgements  xiii  Dedication  xiv  Abbreviations  xv  INTRODUCTION  1.  Background  2.  Redundant  3.  Organization  4.  1 gene  families encode  of  tRNA  gene  tRNA  2  families  3.1  Genomic organization in D. melanogaster  3  3.2  tRNA gene organization in other eucaryotes  6  3.3  Exceptional organization of tRNA gene families  7  3.4  Other classes of genes associated with tRNA genes  8  Structure 4.1 4.2  of  tRNA  gene  families  Homogeneity of tRNA gene families  9  tRNA pseudogenes  11  4.3  Sequences flanking members of tRNA gene families  12  4.4  The evolution of tRNA gene families  13  5. Function of tRNA gene families 5.1 5.2  Structure/function relationships in tRNA In vitro  14 gene  expression  activity of gene copies within a tRNA gene family  16 18  V  Page 5.3  Significance of variable tRNA gene activity within a family  6. Thesis study-  M A T E R I A L S and  a  tRNA  A r  8  gene family in D. melanogaster  19 21  METHODS  MaterialsEnzymes  25  Nucleotides  25  Oligonucleotides  <•  25  Autoradiography and photography  26  Media components  26  Electrophoresis reagents  26  Organic reagents Microbial strains  26  Drosophila  27  strains and sibling species  Plasmid DNAs  27  Transfer RNAs  27  Methods 1. Preparation of plasmid DNA  28  2. Preparation of single stranded DNA from pEMBL plasmids  29  3. Preparation of Drosophila  29  genomic DNA  4. General nucleic acid techniques -Precipitation of nucleic acids with ethanol  30  - Elution of DNA fragments from agarose gels  30  - De-phosphorylation with Calf Intestinal Phosphatase  31  vi  Page - Filling in 5' single stranded ends with DNA Polymerase I (Klenow enzyme)  31  - Ligations with T4 DNA Ligase  31  - Digestion with Exonuclease III  31  5. Radioactive labelling of Nucleic acids with 32p - Nick translation of DNA fragments with DNA Polymerase 1  32  - Labeling of single strand  32  RNA with T 7 RNA Polymerase  - 3' end labeling of tRNA with T RNA Ligase  32  4  - 5' end labeling of synthetic oligonucleotides  with T 4  Polynucleotide Kinase 6.  Filter  >  33  hybridizations  - [32p] DNA/DNA  33  - [32p] RNA/DNA  33  7. Cloning of size fractionated DNA into pEMBL mini-libraries  34  8. DNA sequencing with pEMBL vectors  35  9. In vitro  36  transcription of tRNA genes  10. Analysis of in vitro  11.  transcription  products  - RNase T l Fingerprinting  37  - 5' end analysis by primer extension with Reverse Transcriptase  37  Plasmid constructions - pArg  38  -pA27  38  -pR12.4  39  -pR12.2  39  -pR12.5  39  -pR85.1  39  vii Page  -pR85.2  40  -pR83.L  40  -pR19.1  40  -pR5*/3'  40  -pR12.4  41  T13  RESULTS AND DISCUSSION  Part  I  t R N A ^ r g gene family in D.  melanogaster  1. Genomic Organization of tRNA gene family 1.1 In situ 1.2  hybridization analysis  42  Genomic Southern analysis  45  2. Molecular analysis of tRNA^rg gene family 2.1  Identification and isolation of recombinant  clones  -pDt67R, pDt66R, Dt72R  48  -pDtl7R, pDt85C  50  -pR12.6  51  P  2.2  2.3  Organization and structure of the t R N A 8 gene family Ar  - 12E1-2. region  52  - 19F region  55  - 85C region  55  - 83AB region  55  Comparison of tRNA flanking sequences  3.Summarv of tRNA^rg g  e n e  family in D. melanogaster  60 64  viii Part  II  -  Evolution of  pDt27R  gene  Page  cluster  1. Analysis of the pDt27R locus in D. melanogaster and sibling species  66  2. Genomic Southern analysis of pDt27R homologous loci 2.1 Survey of  D.  melanogaster  strains  68  2.2 Survey of  D.  melanogaster  sibling species  73  3. Molecular analysis of variant pDt27R loci in  D.  melanogaster  and  D.  simulans  3.1 Nucleotide sequence of p27ry2 amd p27simC  74  3.2 Junctions of repeated sequences in pDt27R, p27ry2 and p27simC  80  3.3  80  Divergence of repeated sequences in pDt27R from p27simC  4. A model for evolution of p27rv2 and pDt27R t R N A S gene clusters.  86  Ar  5. Relation of  D.  simulans  and  D.  to other  melanogaster  Drosophila  sibling  species  Part Un  92  III  -  Functional  studies  of  the  tRNA  A r  8  gene family  transcription of t R N A £ gene family  vitro  94  Ar  1.1 Gene products  95  1.2 RNase T l fingerprinting of in vitro  transcripts  1.3 Intitiation and termination of in vitro 1.4  98  transcripts  101  Transcription efficiency of different gene copies  105  1.5 Novel properties of pDt27R genes -Coding and flanking sequence  dependence  112  -Template pre-incubation assays -Extract dependence; 1.5 2. In vivo  Summary of  in  vitro  Drosophila  113 versus HeLa cell extracts  transcription of t R N A 8  expression- Identity of gene products  Ar  gene family  116 121 123  ix Page  Part  IV  A tRNA 8 Ar  pseudogene  or  retrotransposon?  127  CONCLUSIONS and PERSPECTIVES  135  REFERENCES  138  APPENDIX  154  X  LIST OF T A B L E S  Page  Table 1.  Summary of plasmids containing t R N A S  Table 2.  D. melanogaster  Ar  genes  strains and sibling species used to study  homologous pDt27R loci Table 3.  69  Pairwise comparison of repeated  sequences  in pDt27R with  single copy sequences in p27simC Table 4.  Summary of in vitro t R N A " g gene family A  49  79  transcription efficiency of 109  xi LIST OF FIGURES  Page Figure 1.  Summary of structure of plasmid pDt27R  23  Figure 2.  In situ  44  Figure 3. Figure 4.  hybridization of t R N A 8 genes in D. melanogaster Ar  Genomic Southern analysis of t R N A S genes in D. Ar  melanogaster..  Summary of t R N A g gene family  54  Ar  Figure 5.  Cloverleaf structure of the  Figure 6.  Comparison of the t R N A 8  Figure 7.  predicted t R N A " g  Ar  A  gene products  gene flanking sequences  strains and Drosophila  sibling species  Figure 8. Restriction maps of Bam HI sites in pDt27R, p27ry2, and p27simC  72 76  Ar  78  lO.Junction sequences of duplicated regions in pDt27R and p27simC  Figure  62  Sequence comparison of t R N A § gene clusters in pDt27R, p27ry2, and p27simC  Figure  58  Summary of genomic Southern analysis of different D. melanogaster  Figure 9.  47  11.Sequence divergence D. melanogaster  '. between  83  repeated regions in  and D. simulans  85  Figure 12.Model for the evolution of the pDt27R locus Figure 13. In vitro Drosophila  89  transcription products of the t R N A S gene family in Ar  cell extracts  97  Figure 14. RNase T l fingerprints of in vitro  transcription products  Figure 15. Primer extension  Ar  analysis of t R N A S  transcripts  synthesized in vitro  103  Figure 16. Transcription efficiency of t R N A § Ar  Figure 17. KC1 optima for in vitro  100  templates  transcription  Figure 18. Stable complex formation of pDt27R genes  108 111 115  xii Page Figure 19. Comparison of Drosophila in vitro  and human cell (HeLa) extracts  on  transcription of pDt27R gene  118  Figure 20. Comparison of t R N A S genes in HeLa cell extracts Ar  as function of KC1  120  Figure 21. Hybridization of purified t R N A  4  A r  g to t R N A  A r e  Plasmid DNAs  Figure 22. Structure of t R N A g gene in pDt72R  129  Ar  Figure 23. Comparison of pDt72R to sequence of mdg  125  1 LTR  132  xiii  ACKNOWLEDGMENTS  I wish to thank  Gordon Tener, Shizu Hayashi, Ian Gillam, Jeffrey Leung , Don Sinclair, Nir  Seto, Roland Russnak,  Marlys Kochinsky, Rob Kay, Ron Mackay, Ferydoun  Speigelman, Tony Griffiths, Hugh Brock,  oversaw  indebted  this  hybridization  to  research. analysis  this work together.  the I  and  financial  thank  Georj  Dave Holm, Caroline Astcll, Ross McGillivray, ar  Joan McPherson for generously giving their particularly  Sajjadi,  time and help to me with this venture. I a:  support  Shizu  providing the  and  provided Ian  ,  by  Gordon  respectively,  purified tRNAs .which  for  Tener doing  who the  together helped  patient! in  si\  glue a  I wish to also thank Patrick Dennis and members of his laborator  Lawrence Shimmin, Willa Downing, Peter Durovic, Phalgun Joshi,  Bruce May, Janet Ye  and Deidre De Jong Wong for putting up with me during the gestation period of this thesi Special thanks must go to Lawrence Shimmin for his infinite patience with those of us wr must be shown the same thing several times in the motor scooter.  use of a microcomputer or fixing  XIV  DEDICATION  This thesis is dedicated to the memory of John Ramsey Hunter Wells  X V  ABBREVIATIONS A  adenosine  A260  absorbance  at 260  ATP  adenosine  -5'  bp  basepairs  BSA  bovine  BPB  bromophenol  C  cytidine  Cp  cytidine  cpm  counts  DNA  deoxyribonucleic  dNTP  2' deoxyribonucleoside triphosphate (where N = any of the four  nm (or other  triphosphate  serum  albumin blue  -2'(3')  phosphate  per minute  (Cerenkov  radiation)  acid  nucleosides, A, G, C, DTT  wavelengths)  or T)  1,4-dithiothreitol  DMSO  dimethyl  sulfoxide  DNase I  Bovine  EDTA  ethylenediaminetetraacetic  EtBr  ethidium  G  guanosine  g  gravity  HEPES  N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic  ICR  internal  kbp  kilobasepairs  LTR  long  MYR  million  NTP  ribonucleoside triphosphate  pancreatic  deoxyribonuclease acid  bromide  control  terminal  acid  region  repeat  years  nucleosides A,C,G,U)  (where N=  any of the four  xvi  PBS  primer  PEG  polyethylene  pfu  plaque  Pol III  RNA polymerase  RNA  ribonucleic  RNase  pancreatic  rRNA  ribosomal RNA  S  Svedberg  SDS  sodium  SSPE  20X= 3M NaCl, 0.2 M NaH P0 - H 0 , 0.02M EDTA, pH 7.4  T  thymidine  TAE  10X= 0.4 M Tris-acetate, 0.02 M EDTA, pH 8.0  TE  10 mM Tris-HCl (pH 7.5), 0.1 mM EDTA,  TBE  10X= 0.9 M Tris-borate, 0.9 M boric acid. 0.01M EDTA, pH 8.3  Tris-Cl  tris(hydroxymethyl)aminomethane  tRNA  transfer RNA  TJ  uridine  UV  ultraviolet  XD  xylene  YT  0.8%  YT  a r a D  binding  site  glycol (MW 6-8000)  forming  units III  acid ribonuclease  A  units dodecylsulphate 2  YT  4  2  neutralized  with  cyanol bactotryptone, 0.5% yeast extract, 0.5%  media containing 0.1  mg/ml ampicillin  NaCl  HC1  1 INTRODUCTION  1. B a c k g r o u n d The presence of gene families encoding related proteins and structural RNAs rRNA)  demonstrates  how gene  evolution of eucaryotic follow  from gene  duplication  has played an important  role  genomes (Li, 1983). Two evolutionary outcomes  duplication  events.  On one hand,  (i.e in the  appear to  many protein coding gene  families are thought to have arisen by duplication events where the once identical duplicated  gene  copies  to present  day genes  subsequently evolved independently, eventually giving that vary in structure  rise  and have specialized functions based  around a common theme (i.e the hemoglobin gene family). In contrast, rRNA,  tRNA)  other gene families such as those encoding structural RNAs (i.e  show  much  less  difference  in structure  between  between  large  numbers of different gene copies, and because so, are thought to have evolved in concert  and have  Dover, 1982). of  not accumulated  significant sequence  divergence  (reviewed by  A rationale for these homogeneous gene families is to allow synthesis  greater quantities of more or less functionally equivalent gene products. One obvious difference between gene families that evolve independently and  those that evolve in concert is how the gene families are organized in the genome. For  example  rRNA  genes  are organized into one or a few clusters containing  hundreds of tandemly repeated units of gene coding and spacer sequence (Long and Dawid,  1980). It has been suggested that unequal exchange and or gene conversion  events  between  these  clusters  would  be  sufficient  homogeneity between different gene copies (Petes,  to  maintain  the observed  1980, Coen and Dover,  1983 ).  Independently evolving gene copies on the other hand, are generally not organized in  such tandem arrays  similar  and, with  mechanisms of genetic  some exceptions,  are presumably not subject to  turnover and consequent co-evolution.  2 Transfer [t]RNA is another cellular component that is encoded by redundant gene families. Their evolution and potential  function is more complex  these gene families are not organized in tandem arrays more  like  the independently  raises  the question  function  solely  products,  or  to  evolving  that presently  gene  families.  This  gene  copies  encoding  individual  redundant  increase  the synthetic  potential  different gene copies  because  but instead are organized  protein  whether  rather, whether  however  of their  organization tRNAs  corresponding  gene  have unique functional roles  are not apparent.  As a basis for better understanding the evolution and function of tRNA genes, this study describes This  organism  a tRNA gene family in the fruit fly Drosophila  is ideally suited to the study of tRNA  different gene copies can be localized by in situ chromosomes. redundancy structure,  In addition its small genome  simplify  the analysis.  organization,  2.  Redundant  gene  organization  size  and relatively  The following  pages  will  tRNA  low tRNA  review  genes  sequences  briefly the  Drosophila.  families  hybridization studies  gene  drawing heavily  encode  tRNA.  The first evidence that tRNAs are encoded by redundant gene families kinetic  because  hybridization to polytene salivary  and function of eucaryotic  from the extensive studies in  gene  melanogaster.  between  total  tRNA  (4S  RNA) and  came from homologous  in genomic DNA. A wide range of eucaryotes studied (i.e yeast through  human) all showed that the number of total tRNA genes per haploid genome was much greater than the complexity  of the 4S R N A (Long and Dawid,  1980). For  example in Drosophila,  a total of 600-750 tRNA genes encode the 60-100 different  tRNA species detectable  in this organism (Ritossa  et al., 1966, Weber and Berger,  1976, White et al., 1973). This suggested each individual tRNA was encoded by gene families on average composed of 10-12  copies.  A rough generalization is that the  3 average size of each tRNA gene family, or degree of redundancy, is usually larger in complex eucaryotes  such as Drosophila  and humans than in simple eucaryotes  like  yeast (Long and Dawid, 1980). For example, while the total number of tRNA species is approximately the same between Drosophila , yeast, and humans (60-100, White et al., 1973,  Lin and Agris, 1980) the total number of human tRNA genes is approximately  double that in Drosophila Conversely, inDrosophila  3. The  (ca.  1200-  1300  copies,  in yeast the total number of tRNA  Hatlen  genes  and Attardi,  1971).  is approximately half that  (ca. 350, Guthrie and Abelson, 1982).  organization  of  tRNA  gene  families  3.1- Genomic organization of tRNA genes in Drosophila The organization of studies in Drosophila hybridization  tRNA gene families was first suggested from cytological (Steffanson and Wimber, 1971, Elder et al., 1980). In situ  of radiolabeled total  polytene salivary chromosomes  4S R N A (containing  resulted  in labeling  all species  of tRNA) to  of all the major  arms at approximately 60-75 different chromosomal sites.  chromosome  Each site can usually be  assigned to a single band on the polytene map of the salivary chromosomes and are named as such (i.e 12E1-2). The only obvious difference between the four major chromosome arms of the Drosophila  genome was that the X chromosome contained  significantly  fewer  the autosomal  chromosomes  2 and 3 each  tRNA  chromosome contains contains no tRNA loci  loci  than  contain approximately  chromosomes.  30-40 tRNA  loci  For example, while the X  less than a dozen. In addition the small fourth chromosome and the Y chromosome in males cannot be assayed this way  because it is not polytenized. Therefore tRNA genes are not located at one or a few chromosomal  sites,  such as the case of other  redundant gene  genes), but instead are dispersed randomly in the genome.  families (ie. rRNA  4 The use of purified tRNA preparations  allowed individual members of a single  tRNA gene family to be localized (Hayashi et al., 1980, 1982, more than 25 different Drosophila  Kubli, 1982).  To date  tRNA gene families have been studied by in situ  hybridization. Some generalizations of these results are as follows. Gene copies homologous to a single tRNA species different chromosomal  are generally found at 2-4  sites. These can occur on the same or different  chromosome  and show no obvious pattern between different types of tRNA and the locations of their  corresponding  intensities  loci.  suggesting  different sites.  These that  dispersed  different  loci  numbers  often  show  quite  of homologous  different genes  signal  occur  at  In addition, a particular chromosomal site identified with one tRNA  may also be identified with one or more different tRNAs. This is not due to crosshybridization but results from apparent clustering of different kinds of tRNA  genes.  Usually no more than one chromosomal site is shared; any other sites will be unique between  different tRNAs.  These cytological  studies  with purified tRNAs  predicted  that members of a tRNA gene family occur at several chromosomal sites in clusters of the same and different type of tRNA gene. No apparent order to this organization has been deduced except for the paucity or lack of sites on certain chromosomes, and the fact that with only one exception (serine tRNAs, Hayashi et al., 1980), genes for different tRNAs accepting the same amino acid (isoacceptors) do not share the same chromosomal  sites.  These cytological studies have been confirmed and extended at the molecular level by cloning and D N A sequencing of genomic particular  the organization  of some  fragments  Drosophila  containing tRNA  tRNA  gene clusters  genes. In has been  analysed in detail. A classic example is a tRNA gene cluster derived from polytene region 42A (Yen and Davidson 1980). This sites after in situ contain  a large  region is one of the most intensely labeled  hybridization with total 4S RNA and therefore  number of tRNA  genes.  The molecular  analysis  was predicted to showed that of  5 almost  100 k b p analysed, a 4 6 k b p central  four  t R N A 2  individual showed  orientation.  with  genes,  copies  to  numbers 90BC 56EF  that  of  (Delotto  t R N A 2  organized  and Schedl,  gene  type,  genes  varied  A  8  r  additional  genes  from  have  as  been  1 9 8 4 , A d d i s o n et a l . , 1 9 8 2 ) ,  were  as  a few  interspersed gene  sites.  were  (Robinson  gene  and  the t R N A  genes  e  isolated  genes,  n  transcriptional  chromosomal  tRNA^  tRNA  s  gene. T h e  e  little  of  been isolated  Other  ,  or  copies  genes  u  genes h a v e  a l . , 1980).  spacing  other  I  A  4 6 k b p segment  f e w instances  from  two t R N A ^  t R N A 5  tRNA  this  Additional  isolated five  single  within  a  eight  For  identified  and Davidson,  from  a gene  cluster  clusters  with  smaller  from  polytene  regions  1 2 E 1 - 2 ( C r i b b s et a l . , 1987), a n d  ( H o s b a c h et a l . , 1980).  hybridization (Kubli, occur  tRNA  detects  several  genes  sites  1982) and similarly,  to  appear  which  molecular  to  only  studies  occur a  in  single  have  clusters tRNA  shown  however.  species  that  some  is  that  clustering the  species  d u e to that  have  been  located  by  at  tRNA  most  pattern  only to  organization o f cloned  half  of  homogeneity  o t h e r Drosophila  Spradling in  gene  o n the sizes  purified  unlike  together  apparent  of  limits  fact  Therefore reviewed  studies  and Rubin,  the genome  the  but  has yet emerged  regions  gene  members  this  the  in  families  of either  genome  by  a  alone  organization  of  gene  tRNA  hybridization.  gene or  genes  analysed, and  (i.e r R N A  tRNA  localized  resolvable  situ  situ  It i s l i k e l y  extent  are usually  chromatographically  are dispersed in  that  and localized  redundant 1981),  underestimate  In  tRNA  a l o n e i n r e g i o n s o f c l o n e d D N A ( S h a r p et a l . , 1 9 8 1 , G l e w et a l . , 1 9 8 6 ) .  however  No  to  R N A .  region,  additional  similarly  subclusters  were  et  and a  10 k b p a n d i n  contained  8 4 F (Dudler  contained  genes,  s  in  poly-A  cluster  N o t a l l Drosophila  by  as  polytene  v  different  also  region  L  regard  between  this  at t h e 5 0 A B  polytene  in  hybridized  in  Similarly,  scattered  as m u c h  that  encoded  t R N A 2  pattern  T h e distances  D N A fragment  1981).  five  were  obvious  sequences  example,  at  S  basepairs  families  in  r  gene no  hundred  A  portion  o r 5 S genes,  family  are not  gene  clusters.  into except  f o r the  fact  6 that some tRNA gene clusters apparently encode tRNAs that accept amino acids with the same polar side chains (see DeLotto and Schedl, 1984). In addition the clustering does  not follow patterns  isoaccepting anticodons.  tRNAs Only  that  of evolutionary accept  the  relatedness  same  amino  in one case do isoaccepting  tRNA  that acid  exists  between  but recognize  those  different  genes localize to the same  polytene region (Cribbs et al., 1987). This example may be unique because the two isoacceptors  differ only by three  nucleotides.  The only other digression from a  totally random organization is that the X chromosome contains only a few tRNA gene loci and the small fourth chromosome contains none.  The latter may simply reflect  its small size relative to the other chromosome arms.  3.2 tRNA Gene Organization in other  eucaryotes.  The organization of tRNA genes in yeast has received extensive  study (reviewed by  Guthrie and Abelson, 1982). Without the advantage of cytological studies possible in Drosophila genes.  , it is  more difficult to determine the detailed organization of yeast tRNA  However genetic  mapping of tRNA suppressor loci and molecular studies of  cloned D N A show that tRNA gene  families in yeast are also dispersed randomly  throughout the genome. One difference however is that no tRNA gene clusters have been isolated from yeast. To date,  yeast tRNA  genes have been isolated  almost  exclusively as single gene copies within cloned DNA fragments and do not show the close association with genes of the same or different type as is seen in  Drosophila  (eg. Baker et al., 1982, Bull et al., 1987). One exception to this rule is a pair of tRNA3 and  A f  g  and t R N A P genes in Saccharomyces  tRNAi^  As  e t  cerevisiae  and a pair of t R N A  S e r  genes in Schizosacchromyces pombe . In both organisms these genes  are separated by only a few nucleotides and are transcribed as dimeric precursors to the apparent advantage of the trailing tRNA species (Hottinger-Werlen et al., 1985).  7 In mammals where both cytological and genetic evidence are not yet available, the organization of tRNA genes has been determined solely from molecular studies (reviewed by Sharp et al., 1985). The approximately 60-90 different species of human tRNA (Lin and Agris, 1980) are encoded by 12-1300 genes (Hatlen and Attardi, 1971) and thus correspond to 10-20 gene copies per tRNA species. Several studies suggest these genes also tRNAj are  M e t  each  are dispersed randomly in the genome.  (Santos and Zasloff, 1981) and t R N A found  on at least  12-13  different  V a l  For example  the human  (Arnold et al., 1986) gene families  sized restriction  fragments.  To date  mammalian tRNA genes have not been assigned to different chromosomes  either by  somatic cell hybrid analysis (Naylor et al., 1983) or by copy metaphase  chromosomes.  in situ  hybridization to single  Thus while their genomic organization has not been  shown directly, these cloning studies suggest  that like in yeasts and  Drosophila  ,  tRNA genes in humans are also probably randomly distributed. Analysis of  cloned DNAs show that mammalian tRNA genes also occur in clusters.  For example a 13.8 kbp segment of human DNA contains two pairs of genes encoding tRNA Y L  s  and t R N A  p h e  (Doran et al., 1987). This and other examples (Chang et al.,  1986, Ma et al., 1984, Pirtle et al., 1986, Looney and Harding, 1983, Makowski et al., 1983) demonstrate  that mammalian tRNA genes families are organized in a manner  similar to that seen  3.3 Exceptional  inDrosophila  .  organization of tRNA gene families  In some cases tRNA  genes are not organized singly or in heterogeneous  dispersed in the genome. The classic example is a 3.18 kbp segment of  Xenopus  clusters laevis  DNA that contains 8 tRNA genes organized irregularly within it, much like the gene clusters  observed  in other  feature of this segment  eucaryotes  (Muller  and Clarkson, 1980).  is that it is tandemly repeated approximately  The unusual 150 times per  haploid genome at only one or a few chromosomal locations. Other tRNA genes may  8 be similarly  arranged in X. laevis  and likely  account  for the exceptionally high  redundancy of tRNA genes in this organism (ca. 8000, Long and Dawid, 1980). Another example is the silk gland specific t R N A  A l a  genes of Bombyx mori.  This tRNA is selectively expressed during silk synthesis during the larval stages of development  (Garel,  1982).  Its  corresponding  genes  have  distinct  functional  properties (see below. Young et al., 1986) and are arranged as a tandem cluster of approximately 30 gene copies (Underwood et al., 1988). These and other examples (Sharp et al., 1985) may represent specialized cases where tRNA gene copy number has been amplified to meet increased demand of tRNA products at certain stages of development and in extreme cases of  3.4  tissue specific protein synthesis.  Other classes of genes associated with tRNA genes In certain cases tRNA genes are found associated with genes encoding different  structural RNAs and proteins. For instance, members of the the Drosophila gene family  tRNA  G l u  are located adjacent to the 3' end of the 5S RNA gene cluster located at  polytene region 56EF (Indick and Tartof, 1982). At least three additional tRNA species (tRNA2  L v s  , tRNA3  M e t  , t R N A 3 y ) have also been localized to this site (Hayashi et al., G1  1980). Another stable RNA, U6 snRNA, is encoded by 1-3 gene copies  at a t R N A P A s  locus found at polytene region 96A (Saluz et al., 1988). All three classes of these RNAs are transcribed by RNA polymerase III (see below). Another retrotransposons  example  of  a  close  association  with  tRNA  genes  is  the Ty3  of S. cerevisiae (Hansen et al., 1988). At least two of these mobile  retroviral-like elements are found within 20 bp of the 5' ends of either a tRNA^ys or t R N A Leu gene. In addition, the associated sigma elements that correspond to isolated LTRs of Ty3 are also found near tRNA genes. One interpretation of this data is that the tRNA genes are involved as targets for the site specific transposition of these elements.  9 Some tRNA genes also occur near or within protein coding genes transcribed by RNA polymerase II. For example, at the Drosophila pdlyA  containing  sequences  (Yen and Davidson, 1980). located  within  were  interspersed  In addition,  the putative  5'  42A gene cluster it was noted that between  tRNA  coding  two pairs of Drosophila  control  regions  tRNA  T v r  sequences genes are  of two developmentally regulated  genes transcribed by RNA polymerase II (Suter and Kubli, 1988). Another member of this gene family is located within an intron of the decapentaplegic Drosophila  gene, no-ocelli,  al.,  In addition there is increasing evidence for a functional relationships  1988).  contains within it a total of 5 t R N A l y  gene. The  G  genes (Meng et  between Pol II and Pol III promoters (Chang and Clayton, 1989, Carbon et al., 1987, Murphy et al., 1987) that may eventually shed light on how the RNA polymerases of eucaryotes  have  evolved and possibly  genes today (Chung  4  .  Structure  also  their  functional interaction  in certain  et al., 1987, Mattaj et al., 1988).  of tRNA  gene families  4.1 Homegeneity The in situ  hybridization studies (Kubli, 1982) suggested that individual members of  tRNA genes families were  sufficiently similar in sequence to cross-hybridize under  the conditions employed. This  relative  homogeneity of gene  family  structure has  largely been confirmed by D N A sequencing studies of a large number of cloned eucaryotic  tRNA  genes.  For example,  eight different members of a  Drosophila  t R N A ^ y r gene family are derived from three different chromosomal sites (85A, 28C, 22F) and each predict mature tRNAs that are identical to the known sequence of this tRNA (Suter and Kubli, gene  family  1988). These 8 t R N A y  and therefore  T  are  one example  r  genes likely constitute the whole where  all members,  less  post-  transcriptional modifications (reviewed by Bjork et al., 1988), give rise to identical gene products.  The homogeneity observed in these 8 tRNATyr coding regions  does  10 not  include the total  occur  transcription unit however.  a few nucleotides upstream  For example,  the sequences  and downstream from the mature  that  coding region  are included in the primary transcripts of tRNA genes (Sharp et al., 1985) but differ significantly  between  different gene  copies.  In addition, each  gene  copy  contains  the intron in identical positions within the tRNA coding region but both minor and major differences  in sequence  and structure  are observed between  the introns of  different gene copies (Choffat et al., 1988). For example, five introns are 20-21 bp in length and differ in sequence only at 1-2 positions. A sixth intron is also 21 bp long but differs completely in sequence from those  above.  The two remaining introns  present in this gene family are 48 and 113 bp long and each are composed of unique sequence relative to other introns in this gene family. There are numerous other examples of tRNA gene families where at least some of the mature coding regions are identical but in practically every case these analyses do not include every member of the particular gene family (Yen and Davidson, 1980, Robinson and Davidson, 1981, Addision et al., 1982, Lofquist and Sharp, 1986, Meng et al., 1988). As more genes are sequenced it is becoming apparent that not all members of tRNA gene family are identical (Leung et al., 1984, Cribbs et al., 1987, Defranco et al., 1982, Hosbach et al., 1980, Sharp et al., 1981, Bull et al., 1987,  Doran et al., 1986,  Arnold et al., 1986, Pirtle et al., 1986, Ma et al., 1984, Gouillard and Clarkson, 1986). In these examples tRNA-like genes  were isolated that differ by 1-6 nucleotides from  known  other  tRNA  sequences  and/or  identical  anticodon sequences,  authentic  genes  tRNA  and therefore  gene  at least  copies.  They  theoretically  retain  however,  are equivalent to  in their protein de-coding functions. In the yeast tRNA^he  gene  family, two of 8 otherwise identical gene copies contained the same 1 bp change and suggests  these differences may not be accumulating on a random basis (Bull et al.,  1987).  Also these variant genes  sometimes have different functional properties as  templates in vitro (Addison et al., 1982, Leung et al., 1984).  11 Whether these isocoding variant genes or 'allogenes' (Leung et al., 1984) have any  functional significance  remains  to  be shown.  By definition  their  in vivo  products have not been isolated and at least in two cases there is some evidence to suggest that they are not expressed at all (Larson et al., 1984, Pirtle et al., 1986). However, their frequency in gene families is probably an underestimate because in only a few cases (Suter and Kubli, 1988, Bull et al., 1987, Cribbs et al., 1987, Leung et al., in preparation) have all gene copies of a particular gene family been analysed.  4.2 tRNA pseudo genes One last category of sequences can be included in a tRNA gene family, if only on die basis  of their  origin.  These  include tRNA  genes  that  have  incurred obvious  structural defects in the coding region that are likely to result in an inactive gene copy.  Examples include human t R N A j  (Pirtle cause  M e  t  (Zasloff et al., 1982) and t R N A y  et al., 1986) which contain single nucleotide changes the lack of template activity observed in vitro  which  are likely to  (see Sharp et al., 1985 and  below). More extensive derangements occur in a Drosophila where an 8 bp coding segment  genes  GI  tRNA^  is different from an authentic  l s  pseudogene  gene copy located  nearby (Cooley et al., 1984). Similarly, a rat tRNA gene cluster contained t R N A and  tRNA y G1  genes that also were lacking portions of their coding regions and  likewise were inactive in vitro  (Makowski et al., 1983, Shibuya et al., 1982). In some  cases tRNA pseudogenes have been described that consist (Sharp et al., 1981, Reilly et al., 1982) or 1985) tRNA to  and an absence  of either 3' fragments  of 5' fragments of intact genes (Pratt et al.,  of the remaining gene portion. In the case of the mouse  pseudogene (Reilly et al., 1982) the presence of a 3' C C A sequence adjacent  P n e  the 3'  transcription sequence  G l u  end of the gene of tRNA  fragment  sequences  was interpreted  and reintegration  is added post-transcriptionally to eucaryotic  into  as  reflecting  the genome.  tRNAs  the  reverse  The  CCA  and is therefore not  12 expected at this position in the DNA. The presence of these pseudogenes  emphasizes  how estimates of tRNA gene number or their location in the genome (i.e by in situ hybridization) may often not solely reflect at  the  molecular  level  is  the  only  authentic  tRNA  unambiguous  genes and that analysis  method  of  determining the  organization and composition of tRNA gene families.  4.3 Sequences flanking members of tRNA gene families. A potentially significant feature of tRNA gene families is that the high conservation between  different  gene  copies  includes  only  the mature  tRNA  coding  region.  Regions immediately adjacent to the coding region, which as noted above are also included  in the gene transcription  show little or no where  most  tRNA y T  r  unit, and flanking sequences  homology between different gene copies. For instance, in examples  if not all gene copies  have been analysed such as for  (Suter and Kubli, 1988) and yeast t R N A  sequences  show  little homology  presence of a tract of d T following  n  to  (n= 4  the 3' end of the tRNA  p h e  one another. or more)  A universal exception  residues  coding region.  in the non-coding  This  signal in all classes of genes transcribed  Geiduschek  and Tocchini-Valentini, 1988).  One example is the yeast t R N A 3 ^  1983). Four copies of this family  sequence  and Johnson,  1987) and is also conserved  classes of yeast tRNA genes. specific  activity  strand as a  of gene family members e u  gene family (Raymond  contain a conserved  sequence adjacent to the 5' end of the genes. This sequence has important for their in vitro and in vivo  functions  is the  by Pol III (see review by  In a few cases homologies in the 5' flanking sequences have also been detected.  Drosophila  (Bull et al., 1987), the flanking  termination  and Johnson,  beyond frequently  15 nucleotide  been shown to be  (Raymond et al., 1985, Raymond  at equivalent positions in certain  other  Similarly, in the silkworm Bombyx mori , the silk gland  tRNA genes also share short stretches (25-35 bp) of highly conserved 5' and  13 3' flanking sequences in the 10 gene copies that have been analysed (Young et al., 1986). These conserved sequences are also important for function but are part of  the  spacer sequence of a tandem gene cluster (Underwood et al., 1988) and therefore are distinct from conserved sequences found in other dispersed gene copies. Other examples of short conserved sequences preceding tRNA coding regions include mouse t R N A P  genes (Looney and Harding, 1983), t R N A ^  A s  and  Harding,  1986),  human t R N A y G1  genes (Baker et al., 1982). analogy with the yeast  l s  genes (Morry  genes (Pirtle et al., 1986) and certain  yeast  Their significance and origin is not clear at present. By  tRNA3^  e u  genes, they may represent  functional regulatory  elements that are conserved, or alternatively, may reflect short sequences that mark the recent  evolution of these particular genes (see below). In either case what is  clear is that with the exception of the 3' poly dT tracts, the majority of tRNA genes either  within  outside  the  or between genes  that  different tRNA have  obvious  gene  families do not share  similarities.  This  sequences  may be functionally  significant because these flanking sequences close to the genes are thought to play a regulatory role in the expression of tRNA genes (see below).  4.4  The evolution of tRNA gene families  In some examples of cloned tRNA genes  more extensive homologies are found in  both the 5' and 3' flanking sequences of certain gene copies. For instance a cluster of five Drosophila  tRNA  G l u  genes derived from chromosomal region 62A (Hosbach  et al., 1980) exhibit a pattern of 5' and 3' flanking sequence homologies that suggests these genes arose by duplication of a gene doublet followed by an unequal crossing over event that converted one of these doublets into a gene triplet. In another case, two Drosophila  tRNA ty genes G  are contained on direct  repeats  of 1.1-2.0 kbp  (Hershey and Davidson, 1980). In these and other examples (Sharp et al., 1981, Ma et al., 1986) the flanking sequence similarities are thought to reflect the fact that these  14 DNA segments have  recently duplicated and have not yet lost their homology by the  random accumulation of flanking sequence nucleotide substitutions. In all cases the gene  coding  sequences  have  remained  identical  while  although highly homologous, are distinguishable by  the  flanking  varying degrees  sequences,  of nucleotide  sequence divergence. These examples support the idea that tRNA gene families have evolved by successive  gene duplications followed by flanking  sequence divergence  and coding region conservation. However it is not yet clear how members of tRNA genes become dispersed in the genome. To date all cases of tRNA gene duplication have  involved  gene  copies  located  at the same  chromosomal  frequent observation that gene copies within a family sequence homology implies that the majority of  locus.  The more  share little if any flanking  gene families are ancient.  Other possible mechanisms for the emergence of multiple gene copies include reverse  transposition  events  similar  to  those  proposed  pseudogenes of protein coding genes and retrotransposons 1986).  With the exception of the mouse t R N A  P n e  for the  generation  of  (Li, 1983, Weiner et al.,  pseudogene (Reilly et al., 1982)  there is no evidence yet that tRNA gene copies have arisen by this route. What is clear about the evolution of tRNA gene families is that tRNA coding regions  remain identical or at least closely related between different gene copies  over long evolutionary periods. This high similarity between redundant gene copies has led to the proposal that tRNA gene families are maintained by genetic processes of homogenization such as gene conversion (Dover, 1982, Munz et al., 1982, Cribbs et al.,  1987). While gene conversion-like events between non-allelic tRNA gene copies  have been shown to occur in yeast (Munz et al., 1982), it is not clear how significant this is in the evolution and maintenance of tRNA gene copies within a gene family. These  small  primary exists  R N A molecules  structure  have  extremely  high  and it is not inconceivable that  for every nucleotide in their mature structure  information content strict  in their  functional conservation  (Rich and RajBhandary, 1976).  15 This  is  reflected  from  diverse  term  the  species  exhibited between that each  by  extreme  (reviewed  conservation  exhibited  by Cedergen et  many or all members  al.,  may  be  of a redundant gene  of  gene  inappropriate  for  equivalent  tRNAs  1981). That such conservation  gene copy is also subject to strict selection.  'redundant'  between  is  family could also imply  In turn this suggests that the  describing  members  of  a  tRNA  gene  family.  5. The An  function  important  active In  question  copies  concerning  within tRNA  a  tRNA  gene  gene  families  is  family whether  and thus capable of at least potentially contributing to the total 4S  other  redundant  gene  active as gene templates. and 28S  rRNAs  families  there  is  evidence  that  For instance in the Drosophila  as many as  65%  of the gene  coding region and do not give rise to transcripts  copies in  not  18S  contain insertions  vivo  (Jamrich  5S  one  inactivem vitro  heterogeneity  may  products  example  difficult to  of different gene  attempts have  (Sharp  et  al.,  be common in redundant  genes it is technically the  in the  and Miller,  cloned 1981, vitro  to  interpret  gene Rajput  been made  .  these results  templates et  1984).  genes derived from the  gene  assess whether  copies to  are  often  assess the  1984).  This  suggests  families. In the  all genes are  al.,  and the 1982)  unambiguously.  development  of cell  vitro  activity  are  also  of  indistinguishable. In at  least  assays  allows the comparison of t R N A  Certain aspects of in  case  vivo  Alternatively, free  that  in  in vivo  active  contribution  copies at specific chromosomal loci (Dunn et al., 1979b, Larsen et al., 1984) difficult  28S  D N A cluster contain a single point mutation in the coding region and  transcriptionally  because  R N A pool.  gene families encoding  Drosophila  tRNA  gene  is  are  ribosomal R N A redundant gene families, 19 of 23  functional  all  member  copies  Also in 5S  are  each  gene  the  of  gene  but it is  availability of  (Dingermann et family members  manifested  in  vivo  al., in  which  16 suggests  that  these  results  al.,  1985, S c h a a c k and S o i l ,  5.1  Structure  tRNA  genes  Polymerase RNA,  All  reviewed  of  and B  the  and  and  contain  by  dual  Pol  factors,  52-62,  et  al.,  of III  I,  III  include RNAs;  VAII  both  ancillary  (Raymond  et  1987).  (Class  genes  V A  comparable  genes  genes  have  by  protein  genes those  )  RNAs,  encoding  by  5S  RNA  ribosomal  Epstein Barr E B E R  and  unique  transcription  Sollner-Webb  transcribed  7 S K , 7 S L , U6, 4.5S R N A s ,  common  functions by  factors  that  III  apparently  in  in  (reviewed  and  1988,  features  factors  Geiduschek  et the  multiple  et  al.,  and  al.,  and  I,  EBER  in  regard  required and  for  Tocchini-  mature  factors  appear  formation rounds  of  of  the  Burke two  occur  to  et  stable  1976) and  between Their  1988).  dimensional  in  recognition of  1985).  blocks  the  These  of  sequence  between  positions  (Hofstetter  pre-initiation  transcription.  Soil,  universally  1985).  three and  been  conserved  transcription  and  region  be  al.,  final  approximately  coding  have  highly  separated  interchangeably Sharp  regions  recognition 1983,  transcription  Tocchini-Valentini,  RajBhandary,  that  the  1983,  and  coding  recognize  ICRs)  gene  determining  facilitate  function  tRNA  Geiduschek  both  TFIIIB,  of  in  mature  Rich  (Lassar  These  (Lassar  1985, their  Control R e g i o n s ,  results  during  al.,  within  TFIIIC  1981).  species  relationship  et  respectively,  and  sequences  dissociate  genes  (Sharp  tRNA  Internal  eucaryotes  ICR  et a l . ,  tRNA  adenovirus  III  approximately  and cytoplasmic  (reviewed  transcription  transcription  different  (i.e  Pol  have  template  Sharp  nuclear  structure-function  that  protein  8-19  class  sequences  genes  sequences  (A  Other  RNAs  extensively  tRNA  gene  Huibregtse  in  be  1988). The  structure  1985,  set  small  transcription  least  a diverse  III).  these  promoter  Valentini,  of  of  at  relationships  of  (Pol  small viral  their  All  one  III  RNAs).  gene  are  a variety  certain II  -Function  may  et  al.,  conserved tRNA interaction  complexes  Experimentally,  1981, in  all  genes  of  with  the  that  do  not  formation  of  17 stable complexes is observed by the inhibition of transcription of a gene that is added to a transcription reaction that has been briefly preincubated with a different gene template. If the transcription factors  are in limiting quantities then formation  of a stable complex on one template sequesters them and blocks formation of complexes  on the second  Alternatively,  template  formation of stable  (Schaack complexes  et  al., 1983,  Sharp et  al., 1983).  can be observed directly  protection from deoxyribonucleases (Newman et al., 1983). Disruption  similar  by  DNA  of the ICR  sequences either by deletion or nucleotide substitution results in an inactive gene template both in vitro and in vivo (Folk and Hofstetter, 1983, Schaack and Soli, 1985, Huibreigste et al., 1987). In addition to the ICR , sequences outside the gene coding region also influence in vitro  transcription of tRNA genes. For example in Drosophila  several  different tRNA  genes  have  been  the transcription of  shown to depend on the 5' upstream  sequences (Schaack et al., 1984, Dingermann et al., 1982,, Lofquist and Sharp, 1986, Sajjadi et al., 1987). Deletion or mutagenesis of these 5' flanking sequences either results  in improvement of in vitro  Dingermann  et  al., 1982)  or more  transcription rates frequently they  (Defranco et al., 1982,  lower  or abolish  in  vitro  transcription (i.e. Schaack et al., 1984). The basis of these effects does not appear to result from the ability of the template to form stable complexes, although exceptions to this may exist progressive  5'  (Cooley et al., 1984, Morry  deletions  of Drosophila  and Harding,  tRNA2  A r  S  gene  1986). For example, affect  transcription  efficiency more dramatically than the ability of the gene to form stable complexes, although the latter is disrupted as sequences closer to the ICR regions are removed (Schaack  et al., 1984). Similar results were observed with other Drosophila tRNA  genes (Lofquist and Sharp, 1986), yeast tRNA genes (Raymond and Johnson, 1987) and human or mouse tRNA genes (Arnold and Gross,  1987, Rooney and Harding,  1988). A generalization that emerges is that the ICR region is  important for stable  18  complex regions  formation constitute  and hence  transcription  a third promoter  which a gene may be transcribed. modulation  competence,  element  that  while  modulates  Also associated  the 5'  the efficiency with  with this 5' flanking  are differences in the sensitivity of in vitro  flanking  sequence  transcription to the salt  concentration of the reaction (Lofquist and Sharp, 1986, Young et al., 1986). This has been interpreted as reflecting the ability of Pol III to interact with these 5' flanking sequences.  However it is also possible that additional protein transcription  may be involved (Young et al., 1986, Marschalek and Dingermann, 1988). the mechanism of these modulatory sequences, than  those  required  for  stable  complex  they  apparently  formation  because  factors  Whatever  are less conserved the  dependance is not observed or is less dramatic in experiments using  5'  sequence  gene templates  and cell extracts from different species (Schaack and Soli, 1985, Sprague et al., 1984).  5.2 In vitro activity of gene copies within a tRNA gene family. In studies where more than one copy of a tRNA gene family have been compared in vitro  the results  suggest  transcriptional activity. (Dingermann  that different gene  copies can have wide ranges of  For example in the Drosophila  et al., 1982),  template activity (pYH48)  of four identical gene  tRNA2 S Ar  copies  while the remaining three genes,  each had much lower activities (12-15% and, <1%, members of the t R N A 5  A s n  and t R N A 2  Defranco et al., 1984)  also exhibit large  L v s  assayed,  gene family  one had high  pi IF, p35D, and pl7D  respectively). Similarly,  different  gene families (Lofquist and Sharp, 1986, differences  in in vitro  transcriptional  activity. In both these examples the gene coding regions, hence ICR sequences, are identical within different copies of the respective in  activity  sequences.  were Similar  shown results  to be between  conferred  gene families, and the differences  by the respective  identical or closely  been observed in yeast (Bull et al., 1987), Xenopus  related  upstream gene  flanking  copies  have  (Gouillard and Clarkson, 1986),  19 and humans (Doran et al., 1987). These differences in activity within a tRNA gene family are also suggested from in vivo both S. cerevisiae  studies of  tRNA^y  r  nonsense suppressors in  (Rothstein et al., 1977) and the nematode Caenorhabditis  elegans  (Kondo et al., 1988).  5.3 Significance of variable tRNA gene activity within a gene family. Why different copies of a gene family encoding identical gene products should exhibit such wide differences in transcriptional activity is not known. It may simply be  the fortuitous  sequences  result  of the apparent  low conservation  in these  that appear to modulate transcription rates. However the  modulation observed between cell extracts from different species  5'  flanking  differences in  suggests that some  function of the 5' flanking sequence has evolved in a species specific manner. One of the most obvious differences encountered in studies of tRNA is the large differences  in cellular abundance that occur between tRNAs that are esterified to  the same or different amino acids. In unicellular organisms such as E. coli  or yeast  there  and the  is a strong  abundance  correlation  between  of the corresponding tRNA  the most (reviewed  frequently used codons by Ikemura,  1985,  deBoer and  Kastelein, 1986). The degree of this bias in codon choice is greater for genes that are highly expressed compared to those that are expressed at low levels. Also different organisms for instance,  have different favoured codons and give rise to genome 'dialects', that distinguish genes that are highly expressed  are highly expressed  in E. coli.  Therefore  in yeast from those that  in unicellular organisms,  where one  cytoplasm must meet the needs of all protein synthesis, a relationship has evolved between the abundance of tRNAs and the codon choice patterns of different protein messages. This presumably has been selected for by the metabolic cost of inefficient protein synthesis caused tRNA levels.  by codon choices  that are not matched  to the available  20 Similar biases in codon usage are found in genes of multicellular eucaryotes. However different genes show biases for different codons to" be any one genome results  in cells  'dialect'.  In multicellular organisms  with vastly different requirements  thought, in contrast  and there does not appear differentiation often  for protein synthesis  to unicellular organisms, that the tRNA  and it is  levels are tailored to  meet the needs of different cell types. The best known example is in the silk gland of the silkworm B. mori where several tRNAs whose codons show high bias in silk protein mRNAs  are co-ordinately induced at the developmental stage when silk is  synthesized (Garel, 1982). The genes for at least one of these silk gland specific tRNAs  ( t R N A ^ ) , differ from the constitutive t R N A A  anticodon  stem  a  and have  distinct  5'  flanking  transcription properties (Young et al., 1986).  by only 1 nucleotide in the  A l a  sequence  dependant  in  vitro  Although this is an extreme example  due to the nature of silk synthesis in the silk gland, it may serve as a prototype for differential  tRNA  transcription  in  all  tissues  of  differentiated  multicellular  organisms. The observation of differential in vitro transcriptional gene family may therefore However,  be related to this tailoring of tRNA  while several studies show the induction of  specific manner  activity  within  a tRNA  abundance levels.  novel tRNAs  in a tissue  (i.e Lin et al., 1980, Hedgcoth et al., 1984, Lin and Agris, 1980) there  is no evidence of similar tissue or developmentaly regulated expression of different gene copies  within a tRNA gene family.  understanding the function of tRNA  Such studies however are important in  gene families, and in particular whether they  function as as whole or whether individual components of the family have specific functions. Resolving these questions will of  these  organism's  gene  families  genome.  and the  in turn help us understand the evolution  significance  of  their  maintenance  within  an  21  6.  Thesis background-pDt27R and the t R N A g gene family in  Drosophila  Ar  This  study began  tRNA  A r  g  with the  fortuitous  isolation of a group of D.  melanogaster  genes on the basis of their linkage to different tRNA genes for which a  purified tRNA probe existed (Newton 1984,  M.Sc. Dissertation, University of British  Columbia). The plasmid pDt27R was originally isolated using a t R N A 4 / 7 ^  er  probe and  was shown to be derived from the single major X chromosome tRNA cluster located at polytene region 12E1-2 (Dunn et al., 1979a). The insert of this plasmid was shown to contain two identical t R N A 4 ^ four t R N A " g of  tRNA they  A r  repeating  g  Bam HI restriction  sites that were  subsequently  identified as  genes on the basis of their 5' T C G anticodon sequence and the fact that  exhibited  isoacceptor,  and an additional cluster of  genes (Newton, this thesis). These genes were originally detected as a  A  series  genes (Cribbs et al., 1987)  cr  84%  identity  to  the  only  other  known Drosophila  arginine  t R N A 2 g (Silverman et al., 1979, Sprinzel et al., 1987). Each of the four Ar  tRNA coding regions were identical and contained a Bam HI restriction site located within  it.  The  organization  of  these  genes  and  the  product  they  encode  are  summarized in Figure IA and IC. The interesting feature of these t R N A g genes was the fact that each gene coding Ar  region  was  contained  within  four tandemly  repeated  sequences  almost identical in spacer sequence. Two of these repeats were 200 and R2) and the remaining two repeats were 600  (R1-R4)  that  were  bp in length (Rl  bp in length (R3 and R4). The two  size classes differed mainly in the amount of 5' flanking sequence that was associated with  each  significantly homologous  tRNA  coding  higher regions  region.  numbers in  of  the  diagrammatically in Figure IB.  In  addition  flanking other  one  sequence  repeats.  of  the  repeats  (Rl)  polymorphisms relative  These  homologies  are  showed to  the  shown  One interpretation of this organization is that these  genes arose by recent gene duplication. The different sizes and degree  of homology  22 Figure 1.  SummarY  ttf  LtL£  recombinant  restriction map of the 6.5 kbp Drosophila  plasmid  pDt27R. (A)  shows  the  Hind III fragment in pDt27R (Newton,  1984). The position of 6 tRNA genes are indicated by open boxes (serine tRNA genes) and  closed  boxes  (tRNA g Ar  genes). For clarity the boxes are not drawn to scale.  Expanded beneath the restriction map is a summary of the nucleotide sequence of the region encoding the  four repeated  tRNA g A r  gene is contained within pairs of repeats 200  genes (R12.1-R12.4). bp and 600  tRNA  A r  g  bp in length (open bars).  The repeats are composed of identical gene coding sequences by different lengths of almost identical flanking sequence  Each  (filled boxes)  flanked  (open bars). The direction  of tRNA transcription for each gene is indicated by arrows. (B) The regions of the 200 bp and 600  bp repeats are  flanking sequences.  aligned vertically  The cross-hatched  above in A) indicates the decreased to the other repeats (R12.  2-4).  according  open boxes  to  the  overlap of their  flanking the R12.1  gene ( and  level of identity observed in this repeat relative  (C) shows the cloverleaf structure  of the  tRNA  A r  g  predicted from the sequence of the four identical genes in pDt27R. The 5'phosphate (p) and 3' hydroxyl (OH) ends of the predicted tRNA are indicated. The 5 T C G anticodon sequence is boxed.  The first nucleotide of the Bam HI restriction site present in all  four genes is indicated at position 36 . The unique cytosine residue at position 13 in the D loop is also shown.  pDt27R B  B B B  P  B P P P E  _l S 5/  R  R  L  L1LI  R R  •  R12.4  '1 •  RI2.3  R12.2  600 bp repeats  I  200 bp repeats  I  -454  R12.1  I  -30  :  +80  R12.4  R12.3  R12.2 RI2.I  PG A C C G T  A A  GOH C  T G G C A  T GC  ,  3  C CG A  AjA  GGC  T  G  T  C  C  T6  GCAGG T G  C G  A  T G  G C G C A T C A T G m ^ f G i 36  A B  T  C T  I  24 between The  these repeats suggests  biological  basis  or  that these duplications occurred  rationale  duplications (Hosbach et al., 1980) The tRNA  A r  g  for  these  and  other  tRNA  gene  is not clear.  species in order to provide a context Ar  genes  into which the apparent duplication  in pDt27R might be better understood. Using homologous  probes derived from pDt27R, additional genomic t R N A S A r  characterized  constitute the whole gene family as judged by genomic  Southern analysis and in situ To  determine  transcriptionally  gene copies were isolated  by DNA sequencing. These and one other clone provided by J.  Leung (Ph.D Thesis, 1988)  results).  proposed  aim of this thesis was to characterize the entire gene family encoding this  of the t R N A g  and  in multiple steps.  active  hybridization experiments  whether they  were  all  the  members  compared  of  (S.  Hayashi,  this  gene  using Drosophila  in vitro  unpublished family  are tissue  culture cell extracts. Lastly the four duplicated genes in pDt27R were compared to the homologous loci from the related Drosophila  sibling species in order to facilitate  a more detailed reconstruction of the recent evolution of this unusual gene cluster. In  addition to the question of tRNA gene duplication, it was hoped that a complete  description of this tRNA  gene  function and evolution of tRNA  family might lead to  a better appreciation of the  gene families in general.  25 M A T E R I A L S AND METHODS  MATERIALS Enzymes from  - Restriction  commercial  endonucleases  suppliers  recommendations;  Bethesda  England  (NEB),  Biolabs  and DNA modifying enzymes  and  used  Research  according  Laboratories  Promega  (Pr),  to  (BRL),  Boehringer  the  were obtained manufacturers'  Pharmacia  Mannheim  (Ph), New  (BM).  Creatine  Phosphokinase was obtained from Sigma. RNase Inhibitor was obtained from BM or Promega.  Drosophila  Schneider cell SlOO extracts were obtained from L. Duncan  (University of British Columbia) and HeLa cell nuclear extracts were obtained from M. Blundell (University of British Columbia).  Nucleotides-  Deoxyribonucleoside  triphosphates,  ribonucleoside  deoxyribonucleoside  triphosphates  labeled nucleotides  were obtained  triphosphates,  triphosphates, were  obtained  from Amersham  dideoxyribonucleoside  and from  P.  (1 )-phosphorothioate L  Biochemicals.  3 2p_  and New England Nuclear (Du  Pont).  Oligonucleotides- Synthetic oligonucleotides were synthesized by T. Atkinson on an Applied Biosystems 380B DNA synthesizer. The following oligonucleotides were used:  FP1-  5" d(TCACG ACGTTGT A A AAC)-3'  RP1- 5' d(TC ACACAGG A A ACAGCT)-3' Argl- 5'd(TTATCCATTAGGCCACACGG)-3' Arg2- 5'd(GACCGTGACAGGACTCG)-3'  26 Crude oligonucleotides were purified by measuring the  Polaroid  and quantified by  A26O (Maniatis et al., 1982).  Autoradiography intensifying  gel electrophoresis  and photography  screens  667  film  were  used  equipment- Kodak XRP-1 film and Dupont Cronex for autoradiography  was used for fluorescence  of radiolabeled  photography  of EtBr  nucleic stained  acids. nucleic  acids.  Media  components-  Agar,  yeast  extract,  and Bacto-tryptone  were  from  Difco.  Ampicillin was from Sigma.  Electrophoresis DNA  grade  and chromatography  supplies- Ultra-pure agarose was from BRL.  agarose was from Bio-Rad.  ethylenediamine  (TEMED)  were  from  Acrylamide and N,N,N',N'  -Tetramethyl-  Kodak. Methylene bis-acrylamide  MBB. Urea was from Sigma. Cellulose acetate membrane strips  was from  were obtained from  Schleicher and Schuell. DEAE-cellulose plates were from Machery-Nagel and AcA-54 resin was from Pharmacia.  Organic reagents- Formamide (analytical  grade,  BDH) was de-ionized with Bio-Rad  AG501-X8-D mixed bed resin and stored in aliquots at -20°C. Phenol (Malinckrodt) was redistilled and stored in aliquots at - 2 0 ° C .  Microbial coli E.  strains- Recombinant DNA molecules were propagated in the following E.  hosts: coli  JM101 -  (lac-pro). s u p E . thi. s t r A . s b c B 15. end A . h s p R 4 . F'  proAB. l a c H . lacZ M15  (Yanisch-Perron et al., 1985).  traD36.  27 E. coli  DH1 - F- r e c A l . e n d A l . gvrA96. t h i l . hsdR17(r' .m k  (Hanahan,  +  k  '). supE44. r c l A l . I"  1983).  Bacterial cultures were grown at 37°C in 1-2X Y T media (Miller, 1972) containing 0.1  mg/ml  ampicillin  transformations  (YT  a m  p)  with plasmid DNAs  and  agar  (1.5%)  were performed  as  required.  as described  Bacterial  (Maniatis  et al.,  sibling  species,  1982).  Drosophila and  strains- Drosophila  their  sources  temperature  on  communication)  are listed  melanogaster in Table  Soybean-Yeast  extract-  2.  strains, Drosophila  The flies  Glucose  were  media  maintained  ( G . M . Tener  room  personal  in pint urine bottles or 30 ml glass vials.  Plasmid DNAs- The plasmids pDt27R, pDt67R, pDt66R and pDt72R contain genomic Hind III fragments R.C.  at  Drosophila  in pBR322 (Dunn et al., 1979) and were obtained from  Miller Jr. (University of British Columbia). The plasmid vector pEMBL8- and  helper phage IR1 (Dente et al., 1983) were obtained from M . Zoller in the laboratory of M . Smith (University of British Columbia). The plasmid pYH48 was obtained from D. Soil (Yale University).  Transfer  RNAs- Total Drosophila  tRNA contained in the 4S fraction was obtained  from V . Dartnell (University of British Columbia). was obtained from  Purified Drosophila  I.C. Gillam (University of British Columbia).  tRNA4 S Ar  28 METHODS 1. Preparation of plasmids DNAs Plasmids DNAs were prepared from 250-500 ml E. coli YT  a m  p.  further  cultures grown in 2X  Nucleic acids were isolated by the alkaline lysis (Maniatis et al, 1982) and purified by banding in CsCl-EtBr  gradients.  For CsCl  gradients,  ethanol  pellets from alkaline lysis crude lysates (per 250 ml culture) were redissolved in 7.6 ml T E . To this solution was added 0.2 ml 0.5 M EDTA (pH 8.0), 8.4 g of powdered CsCl, and 0.6 ml EtBr (10 mg/ml). An optional step was to remove the resulting precipitate by centrifugation in a SS34 rotor for 5' at 10K rpm. The solution was loaded into two 5.1 ml Quick-Seal polyallomer tubes (Beckman)  and  centrifuged in a VTi65 rotor at  65K rpm for 4-5 hours or at 50K rpm overnight at 2 0 ° C . The plasmid DNA bands were removed with an 18-21 gauge syringe, diluted twice with water, extracted three times with n-butanol (saturated with CsCl and water), and then precipitated twice with 2.5 volumes of ethanol (95%). The final ethanol precipitation was performed in 2.5 M ammonium acetate (pH 7.0).  After washing the pellet with ethanol, the DNA was  redissolved in T E and quantified by spectrophotometry  at 260 nm as described by  Maniatis et al. (1982). Small scale plasmid (pEMBL) preparations were prepared by alkaline lysis from 2 ml Y T  a m  p  cultures  grown to saturation.  To remove contaminating RNA the pellet  was redissolved in 0.1 ml T E and treated for 1 hour with 5 u.1 RNase A (5 mg/ml, boiled for 10 minutes). This was mixed with 0.06 ml 20% polyethylene glycol 8000/2.5 M ammonium  acetate  centrifugation supernatant  (pH 7.0)  and chilled  on  for 10 minutes in a microfuge  ice  (12,000  for  15  -30  minutes.  After  x g, room temperature) the  was removed with a fine tipped Pasteur pipette. The pellet was washed  with 80% ethanol, chilled at - 7 0 ° C for 5 minutes, spun in the microfuge for 1 minute, dried in vacuo , and re-dissolved in 0.05 ml T E .  This plasmid DNA was suitable for  29 double stranded DNA sequencing by the dideoxy terminator 1977  method (Sanger  et al.,  and below).  2. Preparation of single stranded DNA from pEMBL plasmids A single E. coli  colony  harbouring a pEMBL plasmid was picked from a plate spread  the previous night and used to inoculate a 2 ml culture of 2X Y T shaken  vigorously at  hours). The culture phage (5-6  supernatant  3 7 ° C until the A goo nm  was then infected with (10^-  10*0  pfu.)  p . The culture was  approximately 0.1  w a s  0.01  a m  to 0.2  ml of helper bacteriophage  and grown until the AgQO  (1-2 IR1  reached 0.5 to 0.6  hours). The culture was cleared by centrifuging 1 minute in a microfuge and 1.0 ml  phage  supernatant  mixing with 0.3  was transferred ml 2.5  to  a new tube.  The phage  were  collected by  M ammonium acetate/20% PEG and chilling on ice 15-30'.  After centrifugation in a microfuge at 4 ° C for 10' the supernatants with a flame drawn Pasteur pipette. The last droplets of supernatant  were withdrawn were collected  by a brief spin and removed. The phage pellet was redissolved in 0.2  ml T E and  extracted once with an equal volume of T E equilibrated phenol and then twice more with an equal volume of phenol: chloroform (1:1). The aqueous phase was mixed with 0.5  volumes of ammonium acetate and precipitated with 2.5  volumes of ethanol.  After washing with ethanol the pellet was redissolved in 50 p.1 of TE.  3. Preparation of Drosophila Genomic  D N A was  prepared  genomic DNA from  adult  flies  that  had  been  frozen  at  -70° C .  Approximately 0.1-0.2 g (100-200 flies) were ground to a paste with a flame rounded glass rod in the bottom of a 1.8 ml microfuge tube containing 0.3 ml 100 mM Tris-HCl (pH 9.4), 200 mM NaCl, 10 mM ETDA, and 0.5% SDS (on ice). The paste was diluted with 0.5 ml of the same buffer and placed at 70° C  for 20 minutes. This was mixed with 0.15  30 ml 8 M potassium acetate, chilled on ice for 30 minutes, and spun in a microfuge for 10 minutes at 4 ° C . The supernatant chloroform (1:1) and  was extracted twice  with 0.8 ml  of phenol:  precipitated at room temperature with two volumes of ethanol.  The pellet was redissolved in 0.4 ml T E , treated with RNase A , re-extracted once with phenol:  chloroform, and precipitated  with 2.5  volumes of ethanol.  redissolved in 0.1-0.2 ml T E and quantified by electrophoresis  The pellet was  in 0.5% agarose gels.  The yield varied from 50-100 ug and could be stored at 4 ° C for more than a year without significant degradation.  This  DNA  was suitable for restriction  endonuclease  analysis and cloning from size fractionated DNAs (see below).  4. General nucleic Restriction  techniques  endonuclease  polyacrylamide were  acid  digestions,  electrophoresis,  performed  essentially  modifications and choices  D N A fragment  Southern as  blotting,  described  by  and other  Maniatis  et  agarose and  standard al.  techniques  (1982).  Minor  of standard techniques are described briefly below.  - Precipitation of nucleic acids with ethanol: aqueous solutions  subcloning,  DNA or RNA was precipitated from  by adding one half volume of 7.5 M ammonium acetate (final 2.5  M), 2.5 to 3 volumes of ethanol, and chilling at - 7 0 ° C for 30 minutes or - 2 0 ° C overnight. The precipitates  were collected  by centrifugation  in a microfuge for 10  minutes at room temperature or in a Sorvall SS34 rotor at 12,000 x g at 4 ° C for 20 minutes. DNA pellets were then washed with 80% ethanol and dried in - Elution of DNA fragments from agarose gels: gel (DNA grade, given  only  BioRad)  or slices thereof,  minimal exposure  302-360 nm). DNA  fragments  vacuo  after staining with EtBr the were protected  to U V radiation  (preferably  were eluted from  .  agarose  from visible light and at longer  gel slices  wavelengths,  by electroelution  into  dialysis tubing using IX T A E buffer. After the eluate was removed, the tubing was washed  with a small volume of T E , the two combined, and then concentrated by  31 several  extractions  with  n-butanol.  This  with phenol: chloroform and precipitated  concentrated with ethanol  eluant  was extracted  once  as above.  -Dephosphorylation with calf intestinal phosphatase (CIP): The 5' ends of DNA fragments adding  were dephosphorylated  with CIP (BM, 25,000 units /ml) by  10 units of enzyme directly to the restriction  minutes ends).  (5 pmoles)  at 3 7 ° C  (for 5' overhanging ends) or 5 0 ° C  Dephosphorylated  recovered  DNAs  by precipitation -Filling  were  extracted  once  buffer and incubating for 30 (for 3' overhanging with  or blunt  phenol :chloro form and  with ethanol.  in 3' ends  with the Klenow fragment  Approximately 1-2 pmoles of 3' ends were incubated at 3 7 ° C  of D N A polymerase  I:  for 10 minutes in 10-20  ul reactions of 50 mM Tris-HCl (pH 7.5), 10 mM M g C l , 10 mM DTT, 100 ug/ml BSA, 0.1 2  mM dNTPs, and 1-2 units of Klenow enzyme. The reactions were stopped with EDTA (10 mM final) and heated at 7 5 ° C for 10 minutes. If necessary, excess dNTPs were removed by precipitation with ethanol - Ligations with T 4 D N A  and ammonium acetate.  ligase: DNAs (0.1-0.2 ug) were mixed in 10-20 ul 50 mM  Tris-Cl (pH 8.0), 10 mM MgCl2, 0.1 mg/ml BSA, 10 mM DTT, 1 mM ATP, 0.5-1 unit T 4 D N A ligase and incubated at 1 5 ° C overnight. - Treatment of DNA with exonuclease III: DNA to be digested was suspended at 100150 pmoles/ml in 50 mM Tris-Cl (pH 8.0), 10 mM MgCl2, 10 mM DTT, 0.1 mg/ml BSA containing  2-5000  units/ml  exonuclease  III  (BM). After  incubation  at  3 7 ° C for  appropriate time (30 seconds to 5 minutes) the DNA solution was added to an equal volume of 2X SI buffer (10X= 2M NaCl, 0.5 M NaOAC [pH 4.5], 10 mM ZnSC>4, 5% glycerol)  containing 250 units/ml SI nuclease.  for 30 minutes the reactions were terminated precipitated  with ethanol  After digestion  at room temperature  by phenol: chloroform extraction and  and ammonium acetate. For religation the digested  were treated with Klenow enzyme as described above. 5. Labelling of Nucleic acid probes  DNAs  -Nick translation of DNA fragments with DNA polymerase I (Rigby et al., 1977): DNA fragments were purified from agarose gels and nick translated in 50 pi 50 mM Tris-Cl (pH 7.5), 5 mM MgCl2, 0.1 mg/ml BSA, 5 mM DTT, 0.2 mM CaCl2, 20 p M each unlabeled dNTP, 1. 8 p M [<x P] dNTP (500 Ci/mmole, NEN), 32  1 ng/ml DNase I (freshly  diluted in 10 mM Tris-Cl pH7.5, 5 mM MgCl2, 1 mg/ml BSA), lOpg/ml DNA, 10 units DNA polymerase  I, and incubated at 1 5 ° C for 2.5 hours. The reactions were stopped  with EDTA and SDS to 10 mM and 1 %, respectively, heated to 6 8 ° C for 10 minutes and mixed with 25 pg carrier tRNA. two  precipitations  with  ethanol  Unincorporated as  described  nucleotides above.  were then  Prior  to  removed by  addition  to the  hybridization solution the labelled DNA was denatured by boiling for 10 minutes and quickly chilled on ice. -Labeling single strand RNA with T7 RNA Polymerase  (Melton et al., 1984): pArg  plasmid DNA (1 pg) was linearized with Hind III and purified by phenol extraction and precipitation  with ethanol.  The DNA was redissolved  in diethyl  pyrocarbonate  treated water (Maniatis et al., 1982) and transcribed in 20 pi 50 mM Tris-Cl (pH 7.5), 6 mM MgCl2, 2 mM spermidine, 5 mM DTT, 0.5 mM each unlabeled rNTP, 25 u,M [ a P ] 32  rNTP (200 Ci/mmole, Amersham),  1000 units/ml RNAsin (Promega), and 70 units T  7  RNA Polymerase (BM). After incubation for 1 hour at 3 7 ° C the DNA was digested with 100 units RNase-free  DNase (BRL) for 10 minutes at 3 7 ° C  chloroform  extraction.  precipitated  with  -3'  tRNA  (25  pg)  was added  and together  were  ethanol.  end labeling of tRNA with T4 RNA ligase  [ P]pCp 32  Carrier  and purified by phenol:  (England  and Uhlenbeck,  1978) :  was synthesized in 10 p.1 containing 1.2 nM Cp (2'+3') 50 mM Tris-Cl (pH (  8.0), 10 mM MgCl2, 10 mM DTT, 100 pCi [Y P] ATP (3000 Ci/mmole, NEN) and 5 units of 32  T4 polynucleotide kinase. The reaction  was incubated at 3 7 ° C for 1 hour and stopped  by heating to 100°C for 1 minute. For 3' end labeling tRNA, 5 u.1 [ P ] C p 32  p  was added to  50 pmoles tRNA (1.5 pg) in 20 u.1 containing 50 mM Hepes (pH 7.5), 15 mM M g C l , 5 2  mM DTT, 0.1 mg/ml BSA, 10% DMSO, 20 uM ATP, and 5-10 units T Biochemicals).  After incubation overnight  RNA ligase (P.L.  4  at 4 ° C the reaction was stopped with 25  mM EDTA, 1% SDS and heated at 6 5 ° C for 10 minutes. The labelled tRNA was mixed with 10 mg £. coli  tRNA and purified by chromatography over AcA54 resin (10 cm X  0.5 cm) in 200 mM NaCl, 10 mM Tris, 2 mM EDTA, 0.1% SDS and precipitated with ethanol. -5'  end labelling  of  synthetic  oligonucleotides  (Maniatis et al., 1982): 100 uCi [ Y P ] 32  with  T4  polynucleotide  kinase  A T P (3000 Ci/mmole, NEN) and 10 pmoles  oligonucleotide in a 10 ul volume containing 50 mM Tris-Cl (pH 8.0), 10 mM MgCl2, 10 mM DTT, and 10 units T4 polynucleotide kinase were incubated 1 hour at  3 7 ° C , the  reaction was stopped by heating at 100° C for 1 minute. The labelled oligonucleotide was  either  used directly  or purified by two precipitations  with ethanol  in the  presence of 10 ug carrier E . coli tRNA.  6. Filter  hybridizations  - f P ] DNA/DNA hybridizations were performed at 6 5 ° C in 5X SSPE, 5X Denhardt's 32  solution,  0.5%  Nitrocellulose Amersham)  SDS, and 0.1-0.2 (Schleicher  mg/ml sonicated,  and Schuell  containing bound DNAs  32  BA54)  or  nylon  salmon filters  were prehybridized 1-12 hours  hybridization solution was added containing denatured  denatured  1-5 x l O  6  sperm DNA. (Hybond-N,  and then fresh  cpm/ml (Cerenkov counts) of  P-labeled probe. Hybridization was continued for 12-24 hours and the  filters were washed in 2-0.2 X SSPE containing 0.5% SDS at 6 5 ° C . - [ P] 32  RNA/DNA  hybridizations were performed at 3 7 - 4 2 ° C in 50% de-ionized  formamide, 5X SSPE, 5X Denhardt's solution, 0.5% SDS and 50-100 ug/ml E. coli tRNA. High stringency  hybridizations were at 4 2 ° C.  Hybridization times  and washes  were  as above. The excess moisture was removed from the filters with Kimwipes and they  were  wrapped in Saran  screen was necessary  wrap  and exposed  to autoradiography.  If an intensifying  the films were exposed at -70° C .  7. Cloning of size fractionated DNAs into pEMBL mini-libraries genomic  Drosophila  endonucleases, ethanol  DNA  purified  as above.  (25-50  pg) was digested to completion with restriction  by phenol:  chloroform  The D N A fragments  were  extraction,  and precipitated  with  redissolved in IX T A E buffer and  fractionated by electrophoresis in 0.7-1.0 % agarose gels containing IX T A E buffer. After visualizing the DNA by staining in 1 pg/ml EtBr, the gel was protected from visible light. The appropriate size range of DNA was cut out in a gel band and purified  as described above. The D N A fragments  vectors  with  increasing  molar  ratios  of  insert  were then ligated into to  vector.  Ligation  pEMBL mixtures  containing the optimal molar ratio of DNAs (eg. maximum # of amp colonies) r  used to transform E.  coli  DH1 (Hanahan, 1984) and resulting ampicillin  were  resistant  colonies were selected on Y T ^ p plates. Colonies (500-5000, 200-500/plate) grown to diameter of less than 1 mm were chilled at 4 ° C several hours and then transferred to 98 cm nitrocellulose (S&S) or Hybond-N (Amersham) filter circles  (Grunstein and  Hogness, 1975). Pin pricks were used to orient the filters to these master plates. The filters were transferred to fresh Y T  a m  p  plates and grown until 1-2 mm in diameter.  The master plates were regrown until the colonies were visible and stored at 4 ° C wrapped  in Cellophane. The filters  were  then  denatured  and neutralized by  treatment for 5' with 0.5 N NaOH/1.5 M NaCl and 1.0 M Tris-Cl/1.5 M NaCl (pH 7.5), respectively. filters)  The filters were air dried and baked 2 hour at 8 0 ° C  or exposed  to UV on a transilluminator (260  (nitrocellulose  nm) for 3 minutes (nylon  filters). The filters were then scrubbed in 2X SSPE until no cell debris remained, air dried, and then screened by filter hybridization (above).  8. DNA sequencing with single strand or double strand All  templates  DNA sequencing was done by the dideoxy terminator  (1977) using synthetic  method of Sanger et al.,  oligonucleotides (FP1 and FP2) using  either single stranded  or double stranded pEMBL recombinant DNAs. Single stranded pEMBL8- DNAs were prepared as described above. For sequencing double stranded templates (2-3 pg)  plasmid DNA  was denatured with 0.2 N NaOH for 5' at room temperature. The DNA was  neutralized by addition of one-half volume of 7.5 M ammonium acetate (pH 7.0) and precipitated  with 3 volumes of ethanol. The DNA pellets  ethanol, dried in vacuo ,  were washed  with 80%  and redissolved in 5 p.1 of water. This solution was mixed  with 2 ul 10X HIN.LS buffer (100 mM NaCl, 500 mM Tris-Cl (pH 7.5), 100 mM MgCl2), 1 u.1 17-mer (FP1 or RP1, 5 pg/ml), hybridized at 3 7 ° C for 15' and then chilled on ice. To this was added 1 pi of 15 p M dATP, 1 pi 0.1 M DTT, 1 -1.5 ul of [ a P ] 32  dATP (3000  Ci/mmole, NEN). , and 4.5 pi of a solution containing 1 mg/ml BSA, 100 mM potassium phosphate (pH 7.5) and 500 units /ml Klenow enzyme. This mix was divide into four 3.5 pi aliquots to which were added 1.5 pi of each  dideoxy/deoxyribonucleotide mix  (Sanger et al., 1977). The four reactions were placed at 3 7 ° C then chased  for 5-10 minutes and  with l p l of 2 mM each dNTP for an additional 5-10 minutes. After  addition of 5 pi 98% formamide dye mix (XC and BPB at 0.1%) the reactions were heated  at  80°C  polyacrylamide:  for 3 minutes. bis (29:1)  gels  Aliquots (0.5-1.0 and fractionated  pi) were  loaded  by electrophoresis  onto  5-8%  as described  (Maxam and Gilbert, 1980). Often the 8% gels were wedged from top to bottom (0.2-0.6 mm) using different numbers of spacers. Single stranded pEMBL DNA templates were treated similarly except that the concentration of DNA was reduced (0.5 pg) and the template  DNA:  primer mixture  temperature instead of treating double stranded  templates.  was heated  to 6 5 ° C and slowly cooled to room  with NaOH. Subsequent steps were the same as for  DNA generated  sequences  were usually obtained  with exonuclease  from sets of overlapping deletions  III and SI nuclease.  previously (Newton, M . S c , 1984, Henikoff, 1984).  These  strategies  were described  All sequences were compiled using  the DBUTIL programs of Staden (1981).  9. ln vitro  transcription of tRNA genes  Transcription reactions were performed as described by St.Louis and Speigelman (1985).  Standard transcription reactions were performed in 25 1 containing 9 - 12.5  pi of Drosophila  Schneider cell  S100 extract  approximately 6 mg/ml total protein), MgCl2,  5 mM creatine  phosphate,  triphosphates, and 25 u M (cc32p).labeled  in  template DNA concentration  nuclear  extract  (both  10% glycerol, 20 mM Tris-Cl (pH 7.9), 5 mM  3 mM DTT, 100 mM K C L , 2.5 ug/ml a-amanitin  phosphokinase,  The  or Hela cell  0.6  mM each  ,  6 units/ml creatine  unlabeled ribonucleoside  ribonucleotide triphosphate  was varied from 0.1- 5.0 ug/ml  (3-5 Ci/mmole).  (5-250  ng/reaction)  the presence of sufficient pEMBL DNA to maintain a constant 20 ug/ml. The  reactions were incubated at 2 4 ° C for 90 minutes  and terminated by addition of 25 ul  of Stop solution (0.3M NaCl, 0.5% SDS, 1 mg/ml proteinase K, 50 ug/ml E. coli After 15 minutes at 3 7 ° C  tRNA).  the reactions were extracted with phenol: chloroform and  precipitated with ethanol. The nucleic acids were redissolved in 5 pi of Urea buffer (7 M Urea, 5 mM EDTA, 0.1% BPB/XC), heated at 6 5 ° C for 5*. and fractionated by electrophoresis  in 8-10% polyacrylamide-urea gels (Maxam  autoradiography, excised  from  the  bands  corresponding  to  the  the gel and quantified by counting  and Gilbert, 1977). After  transcription  Cerenkov  products  radiation.  were  In some  experiments the KC1 concentration of the reaction was varied from 45 mM K C L to 125 mM KC1. In these cases the lower S100 extract was used (9.0 ul). Also in some cases Hela cell extracts were substituted for Drosophila  extracts but the conditions were  37 otherwise  identical.  The template  preincubation  respective figure legends but otherwise  10. Analysis of in vitro  assays  described  in the  used the conditions described above.  transcription products  -RNase T l Fingerprinting: [a 2p] GTP- labeled transcripts 3  excised from gels and  are  synthesized  were  in vitro  eluted overnight at 3 7 ° C in a small volume of 0.3 M NaCl, 10  mM Tris-Cl (pH 7.5), 1 mM EDTA, 0.1% SDS. After extraction with phenol: chloroform and  precipitation  with  ethanol,  the labelled  R N A (5000-20,000  cpm Cerenkov  radiation) was digested with 10 units RNase T j (BM) in 5 pi T E for 30' at 3 7 ° C . The products were dessicated in vacuo  and redissolved in 2 pi 98% de-ionized formamide.  The mix of oligoribonucleotides and a 1 pi of dye markers (0.33% each X C , orange G, acid fuchsin) were spotted to the origin of a cellulose acetate strip (3 cm X 35 cm) that had been soaked in 5% HOAc, 7M Urea, 5 mM EDTA (pH 3.5), blotted dry, and covered  with Saran  wrap.  The oligoribonucleotides  first dimension by high voltage separated  electrophoresis  were then  fractionated  in the  (Shandon)  at 3000 V until the X C  8-10 cm. The products were then transferred  by capillary blotting with  water to a DEAE cellulose plate (20 cm X 20 cm) that had previously been developed at 6 5 ° C in 1 mM EDTA. The origin was washed with water, dried and then developed in the second dimension with 20 mM K O H homomix (Krupp and Gross, 1983) at 65° C until the front had reached the top. exposed -5'  to  autoradiography.  end analysis  transcripts  The D E A E cellulose plate was then dried and  by primer  synthesized  extension  in reactions  with  containing  Reverse  Transcriptase:  all unlabeled  In  ribonucleotides  vitro  (625  pM) were purified and redissolved in 8 pi. To this was added 1 pi (3 pmoles) of Argl 20-mer labelled at its 5' end with [y P] ATP. The RNA and primer were heated at 80°C 32  for 1 minute, brought to 0.3 M with 1 pi 3 M NaCl, placed at 65°C for 10 minutes, and slowly cooled to room temperature. The reaction was then brought up to 50 pi in 100  38 mM KC1, 10 mM MgCl2, 100 mM Tris-Cl (pH 8.3 at 42°C), 10 mM DTT, 4% DMSO, 0.5 mM each  dNTP,  transcriptase.  500  units/ml  RNasin  (Promega)  and 50  units/ml  A M V reverse  After incubation for 1 hour at 4 2 - 5 5 ° C, the reaction was stopped with  EDTA (10 mM), treated with RNase A (50 pg/ml) for 15' at 3 7 ° C , and then extracted with phenohchloroform and precipitated analysed The  on 10-12%  sizes  ladders  products  gels  were  The extension  and visualized by determined  from  Ar  were  autoradiography.  dideoxy  sequencing  plasmid DNAs  template.  constructions  These constructions, with the exception of pArg and pD27, Figure 4 and are named according the the t R N A g A r  - pArg  products  with the same end-labelled primer and denatured  containing a t R N A g  ll.Plasmid  urea-polyacrylamide  of the extension  generated  with ethanol.  are summarized in  gene they contain.  : This subclone of pDt27R (Figure 1) was originally constructed by J. Leung in  M13mp9 (1988). It consists of a 81 bp Hae III/ Dde I restriction fragment made blunt ended  with Klenow enzyme.  This  fragment  contains  the coding  region  of R12.2  ( t R N A g ) from the Hae III site at position 11 to a Dde I site 3 bp outside the 3' end of A r  the gene. For this work the insert was removed from M13mp9 by digestion with Hind III/Eco RI and the resulting fragment was ligated into the corresponding sites of the T7/SP6 transcription vector SPT18 (BM). -pA27:  A 3.2 kbp Hind III/Pst I fragment of pDt27R contained in the corresponding  sites of M13mp9 Aliquots  was linearized at the Hind III site and treated with Exonuclease III.  were taken  at 15, 30 and 45 seconds  and treated with SI Nuclease as  described above. The deleted DNAs were then digested with Pst I and the released blunt end/Pst I end inserts were recloned into the Sma I/Pst I sites of pEMBL 8-. The extent  of deletion  was determined  by dideoxy  sequencing  with the RP universal  primer. A subclone was selected that removed 669 bp from the original Hind III site  39 of  pDt27R.  This  fragment  is  lacking  both  tRNA^er  g es but retains all the en  duplicated t R N A g regions of pDt27R. Ar  - pR12.4 enzyme  :  This Ava II fragments of pDt27R were first made blunt with Klenow  and then inserted into the Sma I site  selected that contains a 597  of pEMBL8-.  A recombinant was  Ava II fragment. This fragment contains the R12.4  gene  contained in the 600 bp repeat R4. It consists of 154 bp of 5' flanking sequence and 370 bp of 3' flanking sequence. The 3' flank is composed of 80 bp of unique flank joined to the 5' flank of the downstream R3 repeat. -pR12.2  : This plasmid contains a 205 bp Dra I fragment of pDt27R inserted directly  into the Sma I site of pEMBL8-. of the 200  This fragment contains a gene (R12.2) found in one  bp repeats (R2) of pDt27R.  The 5' flank is composed of the 30 bp of  endgenous flank linked to the upstream 76 bp of 3' flank in the adjacent The 3' flank of pR12.2  R l repeat.  ends 22 bp downstream from the gene just after the poly dT  termination signal where it then joins the Sma I site of pEMBL. - pR12.5  : This plasmid contains a derivative of the 850 bp Hha I fragment of pDtl7R.  This fragment contained the R12.5 bp downstream. The  fragment  t R N A g gene and a t R N A ^ e r g A r  was first made blunt  enzyme and then redigested with Eco Rl to generate ligated into the Eco Rl/Sma  by treatment  a 702  e n e  located 276  with  Klenow  bp fragment that was  I sites of pEMBL8+. The resulting recombinant was  linearized by digestion with the Sal I and Pst I sites in the poly linker site of pEMBL (downstream from the tRNA genes). The linearized DNA was treated with Exonuclease III to remove  180  remaining  bp insert  522  bp that contained the t R N A ^ e r was  gene coding sequence.  recircularized and contains  only  the  R12.5  The coding  sequence. -  pR85.1  : This plasmid contains the 1.05  kbp Pst  1 fragment of pDt85C ligated  directly into the Pst 1 site of pEMBL8+. This clone contains approximately 430 bp of 5'  40 flanking  sequence,  the  R85.1  tRNA g  coding region and 539  Ar  bp of 3" flanking  sequence. - pR85.2 : This plasmid contains the 1.7 kbp Eco Rl fragment of pDt85C ligated into the Eco Rl site of pEMBL 8+. The R85.2 gene in this fragment contains 413 bp of 5' flanking sequence and approximately  11.3  kbp of 3' flanking  sequence.  - pR83.1 : This plasmid contains the 1.35 kbp Hind II of pDt66R inserted into the Sma I site  of  pEMBL8-.  The R83.1  Preceding  141  the  bp of  5'  5'  flanking  sequence  sequence  and  additional 400  bp Hind II/ Hind III region of pBR322 that was subcloned along with  - pR19.1:  sequence.  flanked by  700  melanogaster  3'  is  approximately  the D.  bp of  gene  is an  sequences.  This plasmid contains the 1.0 kbp Hind III/Pst I fragment of pDt67R ligated  directly into the corresponding sites of pEMBL8+. The R19.1  t R N A S gene is flanked Ar  by approximately 580 bp of 5' sequence and 450 bp of 3' sequence. - pR573': Bam  This plasmid is a fusion of the pR12.4 and pR85.2 genes at their common  HI site located within the tRNA coding region.  pR12.4 was digested with Bam HI,  treated with CIP, and then purified by phenol extraction  and ethanol precipitation.  This releases a fragment containing the 5' flanking sequence and the 5' half of the tRNA  A r  S  coding sequence. The 3' half of the gene and adjacent  flanking sequence  remain attached to the vector. pR85.2 was then digested with EcoRI and treated with CIP.  This DNA was then redigested with Bam HI to release a Bam HI fragment that  contains the 5' flank and 5' half of the gene coding region. The pR12.4 and pR85.2 DNAs were then mixed and ligated via their Bam HI sites for transformation into E. coli  . The only combination of ligatable fragments and vectors that will give rise to  ampicillin resistant  colonies are the 5'  flank and gene half from pR85.2 inserting  into the 3' gene half and flanking sequence of pR12.4 coding original  region  contains  the  T13  nucleotide  pR12.4 plasmid. This construction  that  The 5' half of this fusion  distinguishes  pR85.2  from  the  was confirmed by sequencing both ends  41 of the fused insert to show that the 3' flank was derived from pR12.4 and that the 5' flank was derived from pR85.2 (data not shown). - pR12.4  T 1 3  : The C13 nucleotide of pR12.4 was changed to a T13 residue using the 20-  mer oligonucleotide Argl Briefly,  Argl  Approximately  was 0.5  (see  Materials)  phosphorylated  as described by Zoller and Smith (1984).  with  ATP  and  T4  polynucleotide  pg single stranded pR12.4 DNA and 50  kinase.  pmoles phosphorylated  Argl were mixed in 10 pi 100 mM Tris-Cl pH 7.5, 20 mM NaCl, 20 mM MgCl2, heated to 65°C,  and slowly cooled to room temperature.  The mixture was brought to 20 pi  containing 10 mM DTT, 0.1 mg/ml BSA, 0.5 mM ATP, 0.5 mM each dNTP, 3 units T DNA Ligase, and 2.5  D H L Resulting ampicillin resistant colonies were  transferred to Hybond N fdters and screened with 5' SSC, 5 x Denhardt's solution, 0.1% washing at 3 7 ° C in 6x SSPE, 0.1%  of these stronger  more  T4  units Klenow enzyme. After incubation overnight at 1 5 ° C this  DNA was used to transform E. coli  hybridized Argl  4  SDS SDS  32  P-labelled Argl  for differential colony hybridization. After approximately 2% of the recombinant clones  intensely than background colonies.  hybridizing  colonies  Arg2 showed it contained the correct  at 4 2 ° C in 6X  with the  tRNA  A r  S  DNA sequencing of one specific  17-mer primer  C13-T13 transition (data not shown).  42  R E S U L T S a n d DISCUSSION  Part  1: The structure  of the  tRNA  A r  8  gene family in  Drosophila  The first part of this study describes the structural analysis of the t R N A " g  gene  A  family in Oregon R strains of Drosophila found originally in pDt27R  were  melanogaster.  likely  to constitute  The four t R N A g  genes  Ar  only part  of a larger  gene  family. Additional copies of this gene family were identified by hybridization with a homologous pDt27R.  probe  (pArg)  prepared  from  the  tRNA  A r  8  gene  coding regions of  The chromosomal sites to which this probe was homologous were identified  by in situ hybridization. sequences  were  The  restriction  fragments  containing  these  homologous  then identified in plasmids that had previously been cloned with  different tRNA probes  (Dunn et al., 1979a) or where necessary, were cloned directly  using pArg as a homologous probe.  1- Genomic 1. Un situ  organization  of  tRNA  A r  g gene  family  hybridization with pArg  The overall chromosomal organization of this family was determined by in situ hybridization of pArg to squashes of polytene salivary chromosomes (courtesy of Dr. S. Hayashi). The results in Figure 2 show that in addition to the 12E1-2 site from which pDt27R was originally derived, three different chromosomal sites this probe.  A second X chromosome locus is located at polytene region 19F near the  chromocentre 85C  and two autosomal sites occur on chromosome  and 83AB. Differences in signal intensity between  minimum of four pDt27R gene copies located at contains approximately 2-3 1  gene  hybridize  copy  (S.  3R at polytene regions  these sites relative  12E1-2 suggest  to the  that the 85C site  gene copies and that the 19F and 83AB sites contain only  Hayashi, personal  communication).  This  shows  that  the  four  43 Figure  2  Chromosomal  organization  Squashes  melanogaster.  of  larvae (gt^w / y sc In (1) g t  melanogaster  3  buffer at 3 5 ° C (Hayashi et al., 1980) transcripts  salivary  of the t R N A g  autoradiography  Ar  and  are  (courtesy Dr. S. Hayashi).  tKNA  chromosomes  x 1 1  with [  of.  )  1 2 5  A  r  from  8 genes third  in—Q—.  instar  D .  were hybridized in 70 % formamide  I ] CTP labelled T7 RNA polymerase  probe pArg. Sites of hybridization were visualized by  assigned  to  the  polytene  regions  indicated  by  arrows  44  45 tRNA  A r  S genes found in pDt27R are indeed part of a larger family of identical or  closely related gene copies.  1.2 To  Genomic Southern analysis identify the genomic  Southern analysis of  DNA  Oregon-R  pArg probe. The results hybridize  the probe  fragment  that  equivalent  is  sized  insert  fragments  that carry  these gene  copies,  genomic DNA was performed using the  Drosophila  show that a total of 5 different sized Hind III fragments  (Figure  6.5  restriction  3). The strongest  kbp in length of pDt27R  hybridization signal arises  and therefore  containing  four  likely tRNA  A f  corresponds g  over a to the  gene copies . The  remaining fragments are 9.5 kbp, 8.1 kbp, 5.5 kbp, and 3.0 kbp in size. The signal intensity of the 5.5 kbp fragment  is approximately  one half that of pDt27R and  therefore is predicted to contain at least two gene copies. The remaining 9.5 kbp, 8.1 kbp,  and 3.0  kbp fragments  are weaker  still  and therefore  probably contain only  single gene copies. These data show at least 5 different genomic Hind III fragments hybridize with the tRNAArg  sequences  probe. One likely corresponds to the previously cloned  insert of pDt27R while the remaining four fragments contain additional members of this  gene  Drosophila  primary  family. The only  other  known  tRNA g Ar  related  sequences  in the  genome are the genes encoding tRNA.2 & . Although closely related in Ar  sequence  (84%),  these  under the stringent conditions of  two arginine in situ  isoacceptors  do not cross-hybridize  hybridization (Hayashi et al., 1980) and  suggests that the bands seen in Figure 3 are specific to genes that are identical or closely related to those found in pDt27R. One additional Hind III fragment is not visible in Figure 3. This fragment also contains  tRNA  A r  g  sequences but was missed from this analysis because of its small  size (359 bp). This fragment was isolated by J. Leung (1988,) and is described below.  46 Figure 3. Genomic melanogaster.  was  digested  through  1.0  Southern  analysis  Approximately 5 pg of D. with  restriction  % agarose gels.  the bound D N A fragments exposed to autoradiography.  of  tRNA  A r  8  coding  melanogaster  endonucleases  and  After denaturation  were hybridized to  in  D.  (Oregon R) genomic DNA  fractionated  and transfer  sentiences  by  to  P-labelled pArg  electrophoresis  nylon  membranes,  transcripts  and  Digestions were performed with Hind III (lane a),  Eco  RI (lane b), Pst I (lane c) and Bam HI (lane d). The size standards on the right  were  1 DNA digested with Hind III and EcoR I. The sizes of the Hind III fragments that hybridize pArg are indicated on the left with arrows.  48  2. M o l e c u l a r 2.1  QL t R N A A r g  analysis  Identification  gene family  and isolation of recombinant  clones  containing  tRNA  A r  g  gene  family Recombinant  plasmids  containing  each  of  the  Hind  III  fragments  visible on  genomic Southerns were either identified from previously cloned Drosophila III fragments The  (Dunn et al., 1979a) or were cloned directly using t R N A g A r  chromosomal  hybridization fragments  location  (S.  of each  Hayashi,  recombinant  unpublished results)  insert  Hind probes.  was identified by in situ  and the  corresponding  were confirmed by Southern blotting (data not shown).  genomic  A summary of  these plasmids is given in Table 1. The regions of the inserts that contained the tRNA  A r  g  coding region were determined by DNA sequencing and are shown in  Appendix I.  -pDt66R. pDt67R.  and pDt72R:  Two of the Drosophila  Hind III fragments  identified  in Figure 3 were isolated previously on the basis of hybridization to a t R N A 5 ^ y s preparation  (Dunn  et al., 1979a).  shown by in situ (DeFranco  et  These  Hind  III  fragments  were  subsequently  hybridization to not be derived from known t R N A 5 ^ y s  al., 1982)  but instead  were  derived  from  two of the t R N A  chromosomal loci identified in Figure 2 (S. Hayashi, unpublished results).  j } oc  A r  g  pDt66R  contains the 8.1 kbp Hind III fragment seen in Figure 3 and is derived from the pArg site  at polytene  region  83AB.  pDt67R  contains  the 3.0  kbp genomic  Hind III  fragment and is derived from the second X chromosome site located at 19F. A third Hind III fragment contained in pDt72R was also isolated with this lysine tRNA  preparation.  It  is 6.5  kbp in length  and therefore  should co-migrate  on  49  Table 1. Summary of plasmids containing t R N A ^ gene family  Plasmid  pDt27R*  Hind III fragment  6.5 kbp  Chromo- . Polytene some site  X  12E1-2  tRNA 9 genes  Polymorphic sites 13 16 37  Ar  R12.1 R12.2 R12.3 R12.4  C C c c  T T T  T  0 e Q  0  pR12.6  0.38 kbp  X  12E1-2  R12.6  T  T  G  pDtl7R*  9.5 kbp  X  12E1-2  R12.5  T,  T  G  pDt67R  3.0 kbp  X  19F  R19.1  T  T  G  pDt85C  5.5 kbp  3R  85C  R85.1 R85.2  T T  T T  G G  pDt66R  8.1 kbp  3R  83AB  R83.1  T  A  A  pDt72R**  6.5 kbp  ?  ?  R\?.l  -  -  G  These plasmids also contain genes encoding tRNA^Ser j described in detail by Leung (PhD Thesis 1988) and by Crfbbs et al (1987). This plasmid could not be localized to a specific genomic fragment or chromosomal site due to cross-hybridization with repeated sequences in D. meJanogaster genomes. an(  a r e  50 genomic  Southerns  hybridizes with  with the similar sized insert  Drosophila  repetitive  sequences  localized to a single polytene region in situ (S.  in pDt27R.  This  fragment  cross  (see Part IV) and could not be  Hayashi, unpublished  observations)  or to a single band on genomic Southerns (data not shown). The reason these plasmids were isolated with a t R N A 5 ^ y  probe was subsequently  s  explained by the fact that this tRNA preparation also contained a contaminant tRNA whose partial sequence  closely matched  that of the t R N A S A r  sequence predicted  from pDt27R (Cribbs 1982a, Cribbs et al., 1982). An unusual feature of this tRNA, and in  part,  why it went  undetected  in the t R N A 5 ^ y s  preparation,  was that it is  uniformly lacking 5 nucleotides from the 3' end and thus no longer was able to be aminoacylated  with [ C ] -  arginine in vitro .  14  -pDt85C and pDt!7R ; Two Hind III fragments detectable in Figure 3 are 9.5 kbp and 5.5 kbp in length. These were cloned directly using Hind  III  restriction  D N A fragments  genomic Hind III fragments.  enriched  plasmid libraries of genomic  for the respective  size  range  The libraries were screened with pArg and  positive clones, pDt85C, and pDtl7R, were isolated. They contained inserts predicted length, 5.5 kbp and 9.5 on genomic  Southerns  of  resulting of the  kbp, and hybridized to the same length fragments  (not shown). In situ  hybridization showed that the 5.5 kbp  insert in pDt85C is derived from the 85C pArg locus while the 9.5 kbp insert of pDtl7R is derived from the same loci as pDt27R, polytene region 12E1-2 (S. Hayashi unpublished). It was subsequently recognized that like pDt27R, the 9.5 kbp insert of pDtl7R had previously been cloned with serine tRNA probes (Dunn et al., 1979a). The fragment described here is given the same name (pDtl7R) but it should be noted that this  is an independent  isolate  and may contain  distinguish it from previous isolates  strain  specific  (Dunn et al., 1979a, Cribbs  differences  that  1982a). The serine  51 tRNA genes in this plasmid have been described elsewhere (Cribbs et al., 1987, Leung 1988)  pR 12.6-  One final Hind III fragment was obtained from a 1 clone derived from the  12E1-2 region using pDt27R as a probe (Leung, 1988 fragment is located approximately  Ph.D thesis). A 359 bp Hind III  10 kbp upstream from the genes in pDt27R  Figure 4). This fragment hybridized with the t R N A S Ar  and  (See  specific oligonucleotide Arg2  was subsequently shown by DNA sequencing to contain a t R N A S gene. Due to Ar  its small size this fragment was not identified in Figure 3 and was kindly provided by J. Leung. The  plasmids described above probably  per  haploid  family  genome  because  chromosomal sites that are detected and  they  represent  are  by in situ  derived  the entire t R N A " g A  from  each  of  hybridization with pArg  the  (Figure  gene four 2),  they correspond to all of the genomic Hind III fragments that were detected by  genomic Southern analysis (Figure 3).  Additional members of this gene family may  occur only if they are undetectable by these two hybridization type experiments. For example, inverted  such gene  as  in heterochromatic orientations  that  regions preclude  of salivary  chromosomes  hybridization  with  or  due to  nucleic  acid  probes.(Yen and Davidson, 1980). It was not shown whether additional small genomic fragments  were detectable  number of t R N A g Ar  by Southern analysis but this is not consistent  hybridizing fragments  detected  with the  after digestion with different  restriction enzymes (lanes b, c, and d Figure 3). Therefore it is concluded that the plasmids described here constitute family in Oregon R strains of D.  most, if not all members of this t R N A 8 A r  melanogaster.  gene  2.2  Organization and structure of the t R N A S - gene family Ar  Figure 4  shows  a summary  contained in these plasmids. originally  in pDt27R,  fragments. mature  structural  analysis  C C A sequences  7  Hind  are  below).  that  are  either  inserts  were identified in these Hind  identical or are closely  None of the normally  III  regions found  Ar  6 different coding regions  (see  of the  In addition to the four t R N A 8 coding  All the gene copies  coding regions  terminal  of the  genes contain  added  related  III  in their  introns nor the  post-transcriptionally  to  3'  mature  eucaryotic tRNAs. With the exception of the pDt27R and pDtl7R inserts derived from 12E1-2,  these plasmids contain  no other  tRNA  genes that could be detected by  hybridization with radiolabeled total 4S RNA (data not shown). The t R N A g  genes  A r  are  named by a prefix  segment  denoting their  number of their  polytene  amino  acid class (i.e  site (1-100)  and finally  R) by  followed by the a decimal  of  the  number of genes located at that site (i.e R12.1-R12.6, R85.1-R85.2 etc).  -The  12E1-2 polytene region (R12.1-R12.6)- In addition to the four genes in pDt27R  (R12.1-R12.4),  two other  Hind  III  fragments  were derived from the  Chromosomal walking of the 12E1-2 region showed that a t R N A g Ar  located  approximately  10  genes contained in pDt27R  kbp upstream (Leung,  from  the  cluster  of  12E1-2  gene (R12.6) is  serine  and  arginine  1988). This gene is identical in mature coding  sequence  to the pDt27R genes except for a single C-T substitution at position  Another  tRNA S Ar  gene, R12.5,  site.  13.  is located within the 9.5 kbp insert of pDtl7R. This  gene is identical to the R12.6 gene and contains the same C-T substitution at position 13. The pDtl7R insert has not been localized relative to the pDt27R within the 12DE12 region  but must occur at least 15-20  communication).  Like  pDt27R,  the  kbp up or downstream (J.  Leung, personal  t R N A g gene in pDtl7R is interspersed with Af  serine genes tRNA genes that are also carried on this Hind III fragment (filled bars in Figure 4).  53  Figure 4. J J K t R N A  A r  III  contain  fragments  that  6  gene family i n P, tRNA S Ar  mdanoeaster.  sequences  are  The Drosophila  indicated  by  bold  Hind lines.  Restriction endonuclease sites for Hind III (H), Eco RI (E), Pst I (P), and Bam HI (B) are indicated above the line. The location of t R N A g A f  coding sequences  are indicated  by open boxes (not to scale). The direction of transcription is indicated by the arrows (5'-3' direction) Where present,  additional serine tRNA genes are indicated by small  cross bars. The filled bars beneath the restriction used for in vitro subclones  transcription  derived thereof,  studies.  map correspond to the subclones  The names  and the chromosomal  of each  starting  site from which they  plasmid, the are derived  (courtesy of Dr. S. Hayashi) are indicated on the right of each restriction map. The 10 kbp that separate the 6.5 kbp Hind III fragment in pDt27R from the 0.36 kbp Hind III fragment (pR12.6) are indicated by a thin slashed line (J. Leung, 1988).  54 L±k^l  B E  E +J  •4-61-  E  E  1 I  pDtl7R  I  a) pR12.5  a)  HBH  BH  B  P  BBW  BPPP —LLL1  a)  b)  (12DE,X)  pDfc27R  E  (12DE,X)  a) pR12.6 b) pR12.4 c) pR12.2  L  c)  pDt67R a)  pR19.1  pDt66R  lo-  (19F,X)  (83AB,3R)  a) pR83.1  a)  P B PEBB  P  pDt85C  E H  i  (85C,3R)  «0 pR8S.l b) pR85.2  a)  b)  HPP  I  I I  H  J  pDt72R  (multiple)  55 Combined with the work of  Cribbs et al., (1987) and Leung, (1988), these results  show that the single major tRNA gene cluster at 12E1-2 is composed of at least 14 genes. There are a total of 6 t R N A S  genes and probably 8 additional genes coding  Ar  for  two  other  serine  of  the  isoacceptors 25  or  (tRNA^er,  more  tRNAy^er)  purified tRNAs  that  an(  j  g  have  e n e  var  been  hybridization localize to the 12E1-2 region (Hayashi et al., 1980,  iants  tested  1982,  -The 19F polytene region (R19.1)- The second t R N A S locus on the Ar  represented  by the  plasmid contains R12.6  genes.  single 3.0  kbp Hind  a single t R N A g A r  III  fragment  contained  thereof. No by  in situ  Kubli, 1982).  X chromosome is in pDt67R.  This  gene (R19.1) that is identical to the R12.5 and  As judged by hybridization with 4S tRNA, pDt67R contains  no other  tRNA genes and no other tRNAs have been definitively localized to the 19F site by in  situ  hybridization. A possible exception  using  t R N A y probes (Suter and Kubli, 1988).  -The  T  85C  however is the detection  r  polytene region (R85.1-R85.2)- A single 5.5  kbp Hind III fragment in the  plasmid pDt85C is derived from the 85C site on chromosome 3R. hybridization  analysis  gene copies.  They are  showed that this  fragment  identical in their  chromosome genes R19.1, R12.5 genes by  of weak signals  two  identical  coding sequence  to  the  tRNA three  A r  g X  , and R12.6, and likewise differ from the four pDt27R kbp and occur  in the same  transcriptional orientation. No other tRNA genes are present in this 5.5  kbp Hind III  fragment  1 nucleotide. They  mature  contains  DNA sequencing and  are  separated  by  1.05  and no other tRNA genes have been localized to this polytene region to  date.  -The  83AB  polytene  region (R83.1)- The plasmid derived from the 83AB  region (pDt66R) contains a single gene (R83.1) near one end of the 6.7  polytene  kbp Hind III  fragment. This gene differs from all the above genes by two substitutions at position 16 (T-A) and position 37 (G-A). The latter change accounts  for the absence of the  Bam HI restriction site that is present in all other gene copies. No other tRNA genes are present on this plasmid  and to date no other tRNAs are predicted to occur at the  83AB site. The mature coding regions of all ten gene copies are summarized in Figure 5. Of a total of 10 gene copies in this family, Five could give rise to identical products, four could give rise to products that differ by 1 nucleotide (C13, pDt27R), and a single gene could give rise to a product that differs at 2 nucleotides (A16, A37, pDt66R). Whether  all  these  genes  are  expressed  in  vivo  remains  to  be shown. The  significance of the polymorphisms in these potential gene products is not clear. The C13 polymorphism in the four pDt27R genes (R12.1-R12.4) occurs within the A box of the RNA polymerase III ICR but still conforms to the ICR consensus sequence (Sharp et al., 1985)  and therefore  is not expected  change does, however, alter the possible  to affect  gene  template  activity.  This  basepairing in the D-loop (positions 13:22)  and changes the length of the predicted basepaired stem from 4 bp to 3 bp. In turn this may alter the overall three dimensional structure of the tRNA product. The changes in the 2 nucleotide variant R83.1 gene (A16, A37) are more complex. The  G37 to A37 transition changes the nature of the base at a site that frequently is  modified post-transcriptionally. In turn,  modification at position 37 is suspected to  play a role in translation efficiency (reviewed by Bjork et al., 1987) raises  the possibility that the tRNA  product  from the R83.1  gene  and therefore is functionally  distinct from other gene copies that have the guanylate residue at this position. The second variant nucleotide (T16-A16) also has potential consequences gene template Pol  activity  and tRNA function. The A16 transversion  III ICR A box and replaces  a conserved  both in terms of occurs  pyrimidine residue  within the  with an purine  residue that is not found in any arginine tRNA and only rarely in all other known  57 Figure 5.  T h e tRNA  products  gene products of all 10 t R N A 8 A r  of the r R N A g A r  gene  The predicted  family.  genes are summarized in the cloverleaf structure  shown. The backbone sequence of the cloverleaf corresponds to the mature coding sequence of the five identical gene copies (R12.5, R12.6, R19.1,  R85.1,  single nucleotide change that distinguishes the four pDt27R genes indicated  by an arrow  outside the cloverleaf at position 13.  R85.2). The  (R12.1-R12.4) is  The two nucleotide  changes that distinguish the single gene in pDt66R (R83.1) are also indicated outside the backbone at positions 16 and 37. The anticodon sequence is boxed.  PG  C 13  A A T  CCGG  AGGC  T  T  G  T A  T  C T  A C C G T G  G OH C T G G C A CT G T C C T GCAGG T T  T  C G G A  A  GA C C T A  A G  6 C  A  37  59 tRNAs(Sprinzel et al., 1987). It is not known what effect this change may have of gene template  activity in vivo  but a generalization is that mutations away from the  ICR consensus sequence (Sharp et al., 1985) leads to reductions in the stability of pre-initiation complexes and the overall rate of template transcription (Koski et al., 1980, Folk  and Hofstetter,  1983). However, it is shown below (Part III) that this  template is still active in vitro . other  tRNAs  dihydrouridine.  that  is  also  However this  activity in vivo  The A16  replaces a uridine residue present in most  frequently  modified  modification does  post-transcriptionally  not appear  to  to  be essential for  in at least one tRNA (Lo and Roy, 1982) and it is therefore not clear  what consequence, if any, might be associated with this variant R83.1 arginine tRNA gene. . In addition to potential functional differences in the genes or their products, these  structural  heterogeneities  isocoding gene family account  raise  the possibility that  the products  of this  for more than one of the five species that can be  resolved by chromatography of Drosophila  arginine tRNAs (see Figure 21 and White  et al., 1973). The single high abundance arginine tRNA  species  ( t R N A 2 2 ) has Ar  previously been shown to be distinct from this gene family (Silverman et al., 1979) and leaves the four remaining  less abundant species  gene family. Whether each of the three t R N A S A r  as potential products of this  species predicted from the gene  coding sequences account for one of more of these minor species must await their purification  and sequence  concerning  possible  potential tRNA4 below  A r  functional S,  suggest  characterization.  differences consequences.  in  This  should  post-transcriptional  To date  only  also  answer  modification  one of  these  questions and their  minor  species,  has been purified (I.C. Gillam, unpublished results) and results presented that this tRNA  corresponds  encoded by this gene family (see Figure 21).  to at least  one of the gene  products  60 2. 3  Comparison of gene flanking sequences  The  sequences  family  are  immediately adjacent  shown  in  Figure  to  6.  the  The  10  gene  flanking  coding regions sequences  are  of this numbered  gene -1  corresponding to the first nucleotide adjacent to the 5' end of the mature tRNA and + 1 corresponding to the first nucleotide adjacent to the 3' nucleotide to which the 3' CCA  sequence  sequences  is eventually added post-transcriptionally. The four pDt27R  flanking  are summarized by a single sequence (R12.4) due to the high similarity  between all four gene copies (see Figure 11). With the exception of the pDt27R genes, the most obvious feature of these flanking  sequences  is the  fact  that  they  share  only  limited  mature tRNA coding region. In the 3' flanking sequence  identity  outside  the  the only sequence strictly  conserved in all gene copies are the poly dT tracts found 12-20  bp downstream from  the 3' end of the gene. These are present in virtually all eucaryotic tRNA genes and act  as  termination  Tocchini-Valentini,  signals  for  RNA polymerase  III  1988). These 3' flanking sequences  (reviewed are  by  Geidushek and  quite A T rich (60-86%)  and in some cases give rise two or more potential poly dT termination sites. In the 5' flanking regions the sequence of highest similarity observed between all  10 gene copies occur immediately adjacent to the 5' ends of the mature coding  region. At position -6 to -1  each gene copy shares the sequence motif  5'  ^-/IAA^^/QJ  from position -6 to -1. The central dAA dinucleotide of this motif is conserved exactly in all gene copies except R83.1  where it is shifted upstream by 1 bp. This degenerate  motif is present in the primary transcripts of these genes in vitro  (see Part III) and  thus may  be considered part  sequences  in the 3' flanking sequence between the 3' end of the mature tRNA and  the  dT tracts are  poly  equivalent  also  similarities between  of the gene coding region. In contrast however, the  included  in the primary transcript  different gene  copies.  but do not show  61  Figure 6 .  Comparison  the  of  tRNA  A r  g  gene  flanking  sequences are shown for all copies o f the tRNA & Ar  abbreviated  within the  nucleotides  that  tRNA.  (centre) and include the  distinguish  numbered from -1 mature  box  different  gene  copies  gene family. The mature coding re£ terminal (boxed).  to - 5 0 beginning with the first nucleotide  The  3'  flanking sequences  are  sequences. The 5 ' and 3'  numbered  +1  nucleotides The  5'  upstream to  plus the pol;  flanking  sequer  from the 5 ' enc  + 5 0 beginning with  nucleotide of the of the gene coding region. The poly dT tracts in the 3' flanking sequ indicated with a heavy regions  in  the  5'  flanking  underlined. The vertical transcription  underline. Small regions  arrows  initiation (see  sites. The vertical  sequences  Figure  and R12.2  boxed  and  adjacent to the mature  additional  upstream  homoloj  in the 5 ' flanking sequence indicate the predicted major 1 5 ) . The filled circles  bar in the R12.4  truncation in the R12.1  are  of 5 ' homology  show the  position of minor  5 ' flanking sequence indicates the position of the di  genes. All four flanking sequences of the repeated gen  R12.1-R12.4 are shown in Figure 11.  -50 pR85.2  1  -I . t.  GCTTGCflCRCGTflTCRRRTOTTTTCGRGTTTRRGCOTGCTTCGRfl|lflflS£]  •GGTCG  +50  RRflCCflRflGTRTTRTJIIIIICTTTTTflTTTTTTTTTTGTGflGRRRCTTR  t.  pR19.1  CTCGTTCCCRCGTTTGCCTTRTTCRCRTCTTflfiTCCGCTTGflfiRflCRfiOCl  GRCC. . T . T .  . G . .GGTCG  RTflRflTTTflTRIIIIIIRTTTGTTTTCGGflflTCflflflTTRGTCRTflTRTTT  pRI2.5  CTGCTCRGCTfiGTTGCTTTTCTTGGCRRCTTfifiGCCRCOTTTfiRfilCRfiCTl  GRCC. , T . T .  , G . .GGTCG  TflCRRRTCCCUIIIGTTRTCTTCCRRRCTTTTTGGCTTTCflTTTTTGRR  pR83.1  GTflCCCRTTTTGRGCTTTRTRGGGCRGGGRCflflflCGGGflCGTTTLmaESG G R C C . • T Jfl].  0  RTTTRRCGGCTGRRTGCRTTTTTTGCRCCGRCTGGCTTGTTTRRRCTTCT  pR85.l  TTTGTRRRGCCCGTCTTTRTGTTRGTCRTRTTTTTTCRGflGTTGCfcflflCJJ  GRCC. • T . T .  , G . .GGTCG  TCGTRRRRTTRRCTTTTTTCTTTTGTRTCCRGflflTTTTTTTTRTTTflTTT  t t  .GGTCG  pR12.4  RCCGTTTTGTRTCRTTGRTcjrTGGGflRTTTGGGRCGCCGGTTGCClTRRCTl  GRCC.(C]T.  . G . .GGTCG  RRGCTCRGGCTRTRTTTTTTTflflflTTRTRTTTTGTTCGTCCTRGRRTRTR  pRt 2 . 6  CTCTCGCCTCTCCCTCTTTRTRTTTGTTCTTRCOGCCTGGTRRTqCRfiCTI  GRCC. • T . T .  ,fi,  RCCGCTCTRTCTTTTTTTTRRTRTTCRTRTTTTCCTTGRGCTRTGRRTRT  ,GGTCG  13.16 .37  N3  63  Additional blocks of identical  sequence 5-7 bp in length are found further  upstream from several of the gene copies but these genes  and show  no common  features.  However,  occur only a  between pairs of  degenerate  sequence  motif  (5'TNNCT, where N is any nucleotide) that was shown to be functionally important in the 5' modulation of aDrosophila Speigelman positions  1988)  is found  valine tRNA gene (Sajjadi et. al. 1987, Sajjadi and in several  of these  gene  flanking  sequences  between  -29 to -40. In addition to the valine genes, this region of the 5' flanking  sequence has been shown to contain sequences necessary transcription Valentini,  of several  other  eucaryotic  tRNA  genes  for the efficient in  vitro  (Geidushek and Tocchini-  1988). It remains to be shown whether the TNNCT  sequence motif plays  equivalent roles in the modulation of this tRNA gene family. The  only upstream flanking sequences that show extended similarity are between  the first 20 nucleotides of the R19.1 and similarity  declines  to  the degree  R12.5 gene 5' flanks. Beyond this point, the  of unrelatedness  evident  between  other  gene  flanking sequences The 3' flanking sequences these two genes only share a general predominance of dA or dT residues in this region (72%-86%). These mostly unrelated flanking similarity  seen  in the tRNA  sequences  coding regions. This  contrast  sharply with the high  suggests  that  if the different  members of this gene family once arose from one another as units of coding and flanking sequence, as is suggested by the pDt27R genes (see Part II), then they arose so long ago that few remnants of similarity remain in the flanking  regions. One  such remnant may be the short region upstream from the R12.5 and R19.1 genes. conclusion, conserved flanking  with the exception gene  family  sequences.  of the 3' poly dT tracts,  specific  control  sequences  can  In  obvious candidates for be  identified 0  in  these  64 3. Summary The  ul  gene  family  organization  structure and organization of these genes  and  structure.  appear typical for D r o s o p h i l a  tRNAs.  They are a family composed of 10 identical and closely related gene copies that occur either  alone  (ie.  chromosomal  R19.1,  R83.1)  locations.  concentration  of genes  One  or  in clusters  exceptional  encoded on the  genes account for the majority  (12E1-2,  feature  X  of  this  chromosome.  85C)  at  four different  family  Combined,  is  the  these  high  X-linked  (7/10) of the total gene family (R12.1-R12.6, R19.1).  This is striking because relative to the other major chromosomes, the X chromosome contains very few tRNA gene loci. To date, the only other X-linked tRNA genes that have been identified with certainty  are those encoding the family of serine tRNA  genes that are interspersed with the t R N A S Ar  genes at the 12E1-2 site (Cribbs et al.,  1987). It would appear that the 12E1-2 locus may be a single major site for tRNA genes on the entire X chromosome. As will be shown below, three of the four t R N A S Ar  probably  arose recently  the gene family was  by gene  duplication. Prior to  this predicted amplification  composed of five identical gene copies and two 1 and 2 bp  variant copies (R12.1, R83.1 therefore  genes in pDt27R (R12.2-R12.4)  respectively).  The bias in X chromosome linkage was  less in these putative ancestors (4/7)  most other known D r o s o p h i l a  but is still substantial compared to  tRNAs. The fact that the majority of gene copies in  this gene family are located on the X chromosome raises the question of how gene copy  number  differences  between  the  sexes  might  affect  tRNA S Ar  levels  and  whether this has any biological significance (Birchler et al., 1982). In terms of the proposed recent duplication of the pDt27R genes, it can now be seen that these genes are structurally distinct from all other members of this gene family. Although they only differ by a single nucleotide, this change has potential structural consequences in the tRNA product. By comparison, the constitutive  tRNA  A l a  tissue specific and  species of B. mori, also differ by only a single nucleotide and  65 yet their genes have distinct transcriptional properties that are probably related to their tissue specific expression (Young et al., 1986). The  heterogeneity  of potential gene  products  in this gene  family  further  illustrates the point that tRNA populations may be much more complex than can be discerned by hybridization  analysis alone. At present  functional  associated  significance is  with  potential  it is not clear minor variant  whether any  tRNAs.  presence in this and several other tRNA gene families (Leung et al., 1984) either  reflects  unknown  functional  properties  or  alternatively,  consequence of the evolution of these gene families. For example, families do co-evolve by sequence rectification (Dover, 1982, et al., 1987)  therefore are  the  if tRNA  gene  Munz et al., 1982,  Cribbs  then these mechanisms are restricted to certain members of the gene  family. In this example 5 of the evolve. The four 1 bp processes  Their  and have  10 gene copies are identical and potentially co-  and single 2 bp variants are apparently not be subject to these  acquired and maintained the  sequence  variations observed. In  the case of the 1 bp variant genes in pDt27R, it will be shown below that they have also probably recently duplicated the variant sequence from one to four gene copies per haploid genome.  66  Part II-  Evolution  1. Analysis  of  of the  the  pDt27R  pDf27R  locus  gene  cluster  in D_,  melanogaster  stains  anrl  sibling  species. The  tandemly repeated  organization of the four pDt27R genes is in marked contrast  to the other members of this gene family and most other  and eucaryotic  Drosophila  tRNA genes. One interpretation of the organization of the pDt27R genes is that the high  flanking  sequence  homology  reflects  their  recent  evolution  by  gene  duplication (Hosbach et al., 1980). Alternatively these genes could be maintained in this  organization by frequent unequal exchanges or gene  the  tandem  repeats of ribosomal R N A genes.  experiments  rates calculated MYR,  Preliminary genomic  analogous to Southern blot  indicated that this tandem structure was not an artifact of cloning in E.  but also existed in Oregon R  coli  conversions  from  D.  genomic DNA. Using mutation  melanogaster  DNA sequences  otheiDrosophila  (0.5-1.7% substitutions per  Zweibel et al., 1982, Stephens and Nei, 1985, Caccone et al., 1988),  number of polymorphisms that occur  in the repeated  the four 200 bp and 600 bp pDt27R repeats (Table 3),  flanking  sequences  and the between  it is possible to estimate that  these predicted gene duplications occurred within the last 5-10 M Y R . In this time period the most recent divergence between species  D.  (ie.  yakuba,  D.  references recent  simulans D.  D.  melanogaster  is thought to have taken place. Other erecta,  D.  teissieri,  )  and its closest sibling sibling species  Drosophila  diverged much earlier (approximately 30 MYR,  above). To test the hypothesis that these pDt27R genes have resulted from  gene  duplications,  and to obtain  more  involved, the homologous loci from a variety of  detail D.  concerning  melanogaster  species were compared by genomic Southern blot experiments  the mechanisms strains and sibling  in order to assess how  common this tandem organization is within different D. melanogaster  populations,  and  whether it also exists in sibling species that diverged from D.  melanogaster  within the last 5-30 MYR.  2. GenflmJC  Southern  analysis  homologous  of p D t 2 7 R  Lfl£i  The probe used for these analyses was a deletion variant of pDt27R (pA27) that was lacking  the  two  tRNA^er  located approximately 1.3  g  e n e s  located upstream and truncated at the Pst I site  kbp downstream from the R12.1  This probe is largely specific for the repeated sequences  in pDt27R.  Genomic DNAs  restriction  endonuclease  Bam HI. This  tRNA 600  A r  to  tRNA  sequences  be  and adjacent  screened  enzyme will  cut  gene (Figure 1).  A r e  were once  single copy  digested  with  within each  the  pDt27R  8 coding region (Figure 5) and generate a doublet of 200 bp fragments and a  bp fragment that are diagnostic of the repeated  additional  fragments  1.3  kbp and 2.0  organization in pDt27R. Two  kbp in length result  from Bam HI sites  contained in the outermost t R N A S genes (R12.4, R12.1) and sites located in unique Ar  flanking within  sequence the  melanogaster  outside the  tRNA  coding  duplicated gene  regions  should  be  and the related sibling species  markers. The flanking Bam HI site of the 2.0  cluster.  The Bam  HI sites  highly  conserved  both  located  within  D .  and thus provide useful phylogenetic kbp fragment is also expected  to be  highly conserved because in pDt27R it actually consists of two sites separated by 1 bp (Newton, 1984). The limitation of using these Bam HI sites for assessing the structure of homologous loci in other strains and species is that the number of 200 bp and 600 bp  repeats can be determined unambiguously only  by the presence  or absence  of  the Bam HI fragments. Differences in the actual number of these repeats can only be  detected  fragments. internal  by  the  change  in signal  However the presence  standards  intensities  of the  1.3  of  the  kbp and 2.0  corresponding  restriction  kbp fragments provide  which allow ready comparison of differences in fragment signal  intensity and thus give a rough idea of Bam HI fragment copy number.  68  2.1. Survey of The  D.  D.  strains  melanogaster  strains that were tested are listed in Table 2. These strains are  melanogaster  composed of a world-wide collection of wildtype flies obtained from the Umea stock centre  in  Sweden.  In  addition  several  Oregon R, Samarkand, Canton-S, etc.) strains early (D.  common  wild-type  and a diverse set of mutant  were included. The latter were chosen 1920s to 30s  laboratory  because they  D.  with Bam HI, fractionated  (i.e  melanogaster  were isolated  and had been maintained in their original genetic  Holm, personal communication).  stocks  in the  backgrounds  Genomic DNAs from these flies were digested  by electrophoresis  in agarose gels,  and then blotted to  filters for probing with pD27. The results of this analysis are included in Table 2 and are summarized in Figure 7.  Lanes  wildtype  (a-c) contain D.  genomic  from Oregon R,  Urbana S,  and Samarkand  strains. Each of these strains hybridized the same four  melanogaster  genomic fragments  DNAs  predicted from pDt27R (2.0  kbp, 1.3  kbp). Of the approximately 50 different strains of  D.  kbp, 0.6  kbp, and the  0.2  tested in Table 2,  melanogaster  only five differed from this pattern. The remainder were identical to the four gene cluster seen in pDt27R and therefore  are predicted to carry identical duplicated gene  clusters. The five variant Lausanne-S,  Table 2)  absence of the 600 R12.4  or R12.3  repeats (see  D.  melanogaster  were all  strains  identical  (rosy , 2  and each  yellow2,  differed  from  W420, and  pDt27R  by  the  bp Bam HI fragment. This is equivalent to the loss of either the  gene and results in a gene triplet contained on three identical 200 bp  Figure 8).  Examples of two of these variant pDt27R loci are shown in  lanes  (d-e). The faint band with mobility slightly larger  from  one  of  W760,  the  tRNA  A r  S  genes  located  at  the  85C  than 0.6 region  kbp is and  derived  results  from  Table 2. Drosophila melanogaster-strains and sibling species Strains Oregon-pJ Oregon-R Island 2  tRNA 9 genes  Source Tener (UBC) Grigliatti (UBC) Holm (UBC)  Ted  B  Canton-S(USA) Samarkand-S Swedish-C Urbana-S HikoneAS HikoneAW scute^ forked white (w/w) prune Algeria (W10, Algeria) Alma Ata (W20, USSR) Ashtarok (W60, USSR) Berlin (W90, Germany) Boa Esperanca (W120, Brazil) Champtiers ( W H O , France) Curituba(W180, Brazil) Fairfield (W200, Australia) Falsterbo (W310, Sweden) Formosa (W330, Taiwan) Frunze (W340, USSR) Groningen (W400, Netherlands) Haceteppe(W440, Turkey) Hampton Hill(W450 Britian) Hikone(W460, Japan) Hodejice (W480, Czechoslovakia) Israel (W500, Israel) Karsnas (W520, Sweden) Krasnodar (W560, USSR) Kreta-75 (W570, Crete) Naantali (W640 .Finland) Oslo (W690, Norway) Poringland (W720, Britian) Slankman (W820, Jugoslavia) Valencia (W1000, Spain) Wien (w 1030.Austria)  Pasadena*  3  Holm (UBC)  C  ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +  Umea  M  M  " ** ** ** %% M M M M  t  **  " **  • «  ** **  ** M  d  9  Ar  +  +  +  ++++ ++++ ++++ ++++ ++++ ++++ +++ + ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ + +++ ++++ ++++ ++++ ++++  V  Tab I e 2. (continued)  tRNA 9 genes"  Strains  Source  Lausanne-S Gruta (W420, Argentina) San Miguel (W760, Argentina)  Pasadena Umea " Holm(UBC)  rosy yellow 2  Ar  +++ +++ ++ + +  c  +  "  2  +  +++  D. simulans -Lima -C  Holm (UBC)  - yellow, white  . -  South Africa Kushla-F ' Morrow Bey Guatemala  D. mauritiana  D. teisssieri D. erecta D. yakuba  .  .  •". • Pasadena • •' •; "• "• .  Bowling Green  "  + .+  . +•  + ." + .+• +  e  +  +  "• "  + +. •  a The number of t R N A ^ genes (+'s) at the homologous pDt27R loci were determined by digestion of genomic DNAs with Bam HI and genomic Southern hybridization with pA27 (Rgure 7). Strains are given four +'s on the basis of hybridization with the 2.0 kbp. 13 kbp, 0.6 kbp, and 02 kbp Bam HI fragments. Three +"s are given when only the 2D kbp, 13 kbp, and 02 kbp bands were visible A single + indicates that only the 2D kbp and 12 kbp (or derivatives thereof) fragments were present . b These strains were obtained from the Pasadena Stock Centre, Pasadena, Calrfbrrtia. USA c The DsneJanogaster mutant strains were choosen on the basis of their initial isolation in the early to late 1920s or 30s and their subsequent propagation in the same genetic background (D. Holm, UBC, personal communication), d A global collection of wild Dsnelanogaster collections was obtained from the. Umea Strock Centre, Umea, Sweden In brackets are the stock centre accession country e DjneJanogaster^cim^  nuT mh be ers and the speocfiesoriwgeir ne . obtained from the Bowling Stock Centre, Bowling Green, Ohio. USA  71 Figure 7 Genomic melanoeaster DNAs  Southern populations  analysis and  of  the  closely  related  locus-  sibling  in  different D  species.  Genomic  were digested with the restriction endonuclease Bam HI and fractionated by  electrophoresis  through  1.2%  agarose  gels.  The  nitrocellulose filters and hybridized with a 32p the  pDt27R  repeated  size markers  tRNA g A r  fragments  labelled probe  were  transferred  to  (pD27R) containing  gene region of pDt27R and exposed to autoradiography. The  (right) are pBR322 DNA digested with Hinf I and 1 DNA digested with  Hind III. The arrows (left) indicate the positions of the genomic Bam HI fragments that  are  genomic  predicted DNAs  are  to  hybridize the  tRNA & Ar  region of pDt27R. The sources  indicated above the lanes. Lanes (a-e)  contain samples of D .  genomic DNAs, lanes (f-g) contain samples of D.  melanogaster  simulans  DNA, and lanes (i-j) contain the more distantly related sibling species, teissieri  , and  D.  yakuba  of  , respectively. With the exception of lane (a),  D.  genomic erecta  ,  D.  approximately  equal quantities of DNA ( 5 pg) were loaded into each lane. In lane (a) approximately half as much total DNA was loaded onto the gel.  • W  i O  %  0  "^Ifc  »  Oregon-R  V  Urbana-S  °  Samarkand  a  t  t  »  Rosy 2 Lausanne-S  "» S . A f r i c a f  £  ^  f£  9 9  *  9  €  '  r^i  H i  II  -  i 11 i i i i #jj  D.erecta D. t e i s s i e r i  d  f  •  Bay  =r Guatemala  ^  €  riorro  *"  D.yakuba  73  hybridization  with the small percentage of t R N A g coding sequence Ar  contained in  pA27. This contain  survey shows that D a  tRNAArg  .melanogaster  strains collected from around the globe  locus that is highly similiar if not identical to that found in  pDt27R. This is not surprising considering that this particular species of  Drosophila  is highly cosmopolitan and single populations can easily spread around the world. The fact that five strains contain only three genes can be interpreted two ways. On one hand these strains could be deletion variants that have lost a 600 unequal  exchange,  that have not yet Whether  or  alternatively,  acquired this 600  could  represent  bp repeat present  different fly populations can  by vertical inheritance is not clear. five  they  acquire  the  bp repeat by  intermediate  populations  in the majority  repeats  of strains.  independently or solely  One observation, however, was that one of the  three gene variants (W420), contained a Hind III site polymorphism that was  not shared by other three gene variant populations (data not shown). Instead of a 6.5 kbp pDt27R-like fragment, this strain gave rise to a @15  kbp Hind III fragment on  genomic Southerns (data not shown). This suggests either that these strains share  closely  recently. necessary  2.2  related  X  chromosomes  or  that  the  polymorphism occurred  More detailed analysis of polymorphisms associated to distinguish between  Survey of D.  melanogaster  Similar experiments  do not more  with this loci will be  these possibilities.  sibling species  with genomic DNAs from the Drosophila  sibling species are  shown in Figure 7 lanes (f- -k). This includes samples of three different D. simulans isolates (lanes f-h), and one isolate each of the more distantly related sibling species, D. erecta , D. teissieri , and D. yakuba  (lanes i-k, respectively). Figure 7 and Table 2  show that all the sibling species are missing both the 600  bp and 200  bp fragments  present in D. melanogaster . The flanking 1.3 kbp and 2.0 kbp bands arc still present  74 and suggest that only a single Bam HI site, and  tRNA S  coding region, occur in  A r  these homologous DNAs. Slight differences in mobility of the equivalent pDt27R these become  fragments  are seen in the D.  more pronounced in the more  simulans  distantly  1.3  kbp and 2.0 kbp  strains (lanes e-g) and  related  siblings (lanes,  h-k)  until in the oldest sibling, D. yakuba  (approximately 30 MYR), the 1.3 kbp fragment  is  by at  absent  altogether  and is replaced  bands. These changes substitution, tRNA  A r  S  are to be expected  insertions,  and  deletions  smaller,  weakly hybridizing  as random sequence  drift by nucleotide  accrue  in  two  the  sequences  flanking  the  coding sequence. Studies by Leung (1988) confirm that the coding regions  of these genes in D. erecta and D. yakuba D.  least  melanogaster  have remained almost identical to those in  and each still contain the internal Bam HI site predicted from  Figure 7.  3. Molecular  analysis  of  variant  pDt27R  loci  in  D. melanoeaster  and  fl.  simulans. 3.1 Nucleotide sequence of p27ry2 and p27simC The 5.5 -5.9 kbp Hind III fragments analogous to pDt27R were isolated from of the five variant D. simulans  melanogaster  strains  (rosy^  species (strain C) listed in Table 2.  ) and a representative  one D.  These fragments were cloned into  pEMBL and the resultant plasmids are designated p27ry2 and p27simC, respectively. A partial restriction map of their Hind III inserts are shown in Figure 8. The left hand portions of these two Hind III  fragments  were sequenced and in Figure 9  they are aligned with those from pDt27R. As predicted, the p27ry2 clone contains 3 tRNA  A r  §  coding regions contained on three identically sized 200  the  p27simC  clone  flanking sequence. identical  to  All  contains  a  single  tRNA S Ar  gene  bp repeats while  surrounded  by  unique  tRNA coding regions in both the p27ry2 and p27simC are  those in pDt27R.  The  non-coding regions,  especially  in the  more  Figure shows  8. Partial the  6.5  restriction kbp Hind  man III  of  fragment  pDt27R. derived  p27ry2  from pDt27R.  homologous fragment (p27ry2) derived from the rosy 2 (C) shows the homologous fragment (p27simC) (see Table 2).  The t R N A S A r  a n d p27simC.  strain of D.  (B)  shows  melanogaster  derived from D. simulans  (A) the .  strain C  coding regions are indicated by open boxes and the  serine tRNA genes are indicated by filled boxes (not to scale).  77  Figure  9.  Sequence  comparison  p27rv2 and p27simC.  of  tRNA  A r  g gene  clusters  in  The sequence of pDt27R beginning at position 600  pDt27R. relative  to the leftmost Hind III site (see Figure 1) is shown in full on the upper line (5' to 3' from  left to  right).  The sequences  of p27ry2 and p27simC  dashes to indicate identity to the pDt27R sequence. and p27simC sequence  are  indicated by asterisks  are  shown below as  Nucleotides absent from p27ry2 (*)  . Additional  nucleotides in  p27ry2 and p27simC are shown below each line and occur on the 3' side of the nucleotide immediately above. The location of the t R N A S A r  coding sequences are  boxed in heavy lines. The transcriptional orientation of the genes are 5' to 3' from left to right.  In the repeated  flanking sequences  outside the gene coding regions,  the 8 bp repeats that flank the 600 bp repeat containing R12.4 are boxed. At the 3' 8 bp repeat, the downstream adjacent 5 bp are also boxed. The location of these 8 bp repeats in the flanking sequences  of the other genes are also indicated by boxes.  The three adenylate residues that occur at the junctions of the 200  bp repeats are  boxed. The single tRNA & coding sequence in p27simC is arbitrarily divided at the Ar  Bam HI site in order to maximize identity between the pDt27R and p27simC flanking sequences.  78 p0t27R  CCCTTTGTTTGGCflflTTfiCTTTCTGTCTflflTGflflTTTCTTflflTTCflflTTflTflHTCCGCflTTTTGflTCflTflTTTCCTRTTCflflGGftflCCflCflTCTCTRflTTTTTTTflCCTTGCCTflTTTGT  p27ry2  •  p27sl.C  .  T—fl-fl  R  c  fl  720  CG  CT  CTCGCflTTOTGhGCCCnnhcflCRflCflflCBCCBCCCflCCHGflCflCGCflCRRflflTTflTTTflCnTTTGCTGCTGRCGflGTTCGTTGflfllCTTTGflTSflCCTTTTTGGTCTGCTCCTCGGCnn 6 1 0 ***********************************ft*********************************************************** * * * * * * C R ta***************************************************************************************************  TTTTflTTTCTCTflTRTRCTRflRTTTTTCGGCTGTCTTTCCTTTRCTTTCGTTTTGCTCTTCCGTCTGTGGGCGTRTRTCGCGTCCflCflflflflflGCCTCRRRRTGTCTTTGGTCCTTTTGCfl 9 6 0 • ••••••••••A************************************************************************************************************  ****** •••••***** •**•**•****« ************** •**•*•*•*•******••*•**•«*«**********************«****«•*««******* ******* ****** CCflTTGftCGTTGTTGTTTCCGCflGGTCCGflGCCCGCflGGflflTCTTTGRTflflflGflTCTTTRTRTTRTCflflTGTCTRflGTflTflGRTRRRRTGRRTRflflTRflTTflTGRRflTRRGRRTGTflRRT I 0 8 0 • a********************************************************************************************************************** •  A**********************************************************************************************************************  1200  BtraTTTTCflflTCRflTCGTTTTRRGCmGGTTCBTTTGCflBTBTTRTflBBCTRTM^ *•****•«*•**••**••***•***«*•******•***************** •*•*•********•**•*•**•*«*****•***•***•«««••**  • ••*«*««*•* a**************** a * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *  ***********************  ***••**•*••••*•** * • • * * « « • « * * * * • * * * * * * * * * * * * *  ICCRRTGGRTRRGGCGTCGGflCTTCGGRTCCGRflGRTTGCRGGTTCGRGTCCTGTCRCGGTCGl^RGCTCftGGCTRTRTTTTTTTRRflTTRTRTTTTGTTCGTCCTflGRRTflTRTTRRTflTG 1320 • •a********************************************************************************************************************* vs**********************************************************************************************************************  M10  GGBGRTTCCcfrRGCCCRfltEEfliDrcBCflCCBBCBCCflCCCBC a********************** —A •••****••**** •**•«**«** »***  •—C Q  — G  C C  T  GWnnRTTTCTCTflTflTBCTRRRnnTCGTCTTTCTnCCTTTRCTTTCGTTTTGCTCTTTCDTCTGTGGGCGTRTRTCGCGTCCflDRflRflGCCTCRflRRTGTCTITGGTCCTTTT 1 5 6 0  T  C  fl 1660  GCflCCflTTGBCGTTGTTGTTTCCGCBGGTCflGflGCCCGCflGGARTCTTTGflTRflTGRTCn -T  •-  BflTBcnnrmcaRTCwucomTMUSCTBGGTTCflm -G-c  G  T  fl  T fl  1920  IGOCCCTflTGGflTRRGCCOTCGGfiCTTCCGflTCCGflBGflTTGCflGGTTCGRGTrc ********* •**•*****•******•••••«*****•*••• ••***••••*•*•••••*•**•****•«•**•*•*****  2010  TRTGGGBGATTCCdrflOCCCTBtCCBmGTGTRflCCTGflGfjfffi^  •••a************************************************** •****••*•**•****•******•***•*****•*«••*•««***•*•**•***« **•***«««•* 2160  hTGCRGGTTCORGTCCTGTCflCCGTCtfefiOCTCflGGCTflTflTTTTTTTTRRfiTTflT^ a*****—***************************************************************************************************************  GBGfiB^GGGRBTTTGGGflCGCGGGnBCGTRRCnrSBreGTGTGGCC^^  2280  «****•*•«*•*•*** ************************ A*********************** •*•*•«•*••  „  QJ_  2100  TTBBmTTTTTGflHCTTfimTTCGnCGTCCABTAATATATTflfiTflTK^ fl-T-CCfl C  T  C--T  CCCflATTGflRflGflTTTATTGGBCTTTTflCBTGGGTCfiTrcflTGGflCGflflTCflflCBTGTGtXT  2520  fiCBBflTCTCTTTflBCGTCBGCftflBflRRTBBBRflGRTflTrTTTTCTBflBGTTTGTflTTGTCGTflCfllTTGGTTTBTBRTTTTBflTBTTTRGCGTRTCRflTTBRRTCflRTGTGTCTflTGTGT  2610  R—T  T  *C  RR  T  T  —  R  CCGflTRCTTTCGTGTRTTTTGTTRIGrTTCTGTGTBTCTGCTGGTGTCGTTGCTGCflflTTGTTGCTflGCTrGflflTflGCTflTflTRTTTTTTflTTCTCTTTTGTCflGCflflGCflGflCTGflGGfl fl C  T  C  2760  79  Table 3.  Pairwise comparisons of duplicated t R N A 8 gene flanking sequences. A r  A. Comparison of 30 bp of 5' flanking sequence (positions -30 to -1) and 99 bp of 3' flanking sequence (positions +1 to +99) common to the 200 bp repeated regions of pDt27R, p27ry2 and p27simC . a  3' Flanks (+1 to +99)  5* Flask; (-30to-l)  Rl  R'l  R2  R'2  R3  R'3  R4  SI Rl R'l R2 R'2 R3 R'3  4  5 1  12 12 14  12 13 14 0  12 13 14 2 2  12 13 14 2 2 0  13 13 15 2 3 3 3  SI Rl R2 R3  5  -  2 3  -  1 3 1  -  1 4 1  -  -  a. Sequences compared are shown in Figure 11. Numbers correspond to nucleotide substitutions or deletion/insertion events between pairs of sequences. R1-R4 correspond to the four 200 bp repeated regions of pDt27R. Rl-R*3 correspond to the three 200 bp repeats of p27ry2. SI corresponds to the single homologous 200 bp region of p27simC (see Figure 8). The 5' flanks of p27ry2 are not included because they give identical results with pDt27R.  B. Comparison of 454 bp (positions -454 to -1) of 5* flanking sequences in pDt27R, p27ryl and p27simC . b  SI R3 R'3  R3  R'3  R4  30  29 3  32 13  b. S e q u e n c e s c o m p a r e d a r e s h o w n i n F i g u r e 9. R e p e a t d e s i g n a t i o n s a n d are the s a m e as above.  n numbers  80 distantly  related  substitutions  D.  sequence,  simulans  and deletion/insertion events  contain  small numbers  that distinguish the  of  nucleotide  different  sequences.  The alignment and positioning of homologous positions in p27ry2 and p27simC with  pDt27R  is  based  on  minimizing  these  differences  between  all  possible  comparisons (see Table 3 for pairwise comparisons). In doing so the polymorphisms which distinguish the pDt27R repeats recur in p27ry2 and show that the three genes in this  D.  strain correspond to the closely spaced triplet of genes  melanogaster  R12.1, R12.2, and R12.3  of pDt27R.  pDt27R  contains  and  p27ry2  For example, the leftmost repeat (Rl) approximately  5x  more  polymorphisms when compared to the equivalent sequence  flanking  in the 2-3  in both sequence  repeats  (R2-  R4) further upstream (Table 3). Therefore the only difference between these 3 and 4 gene  polymorphic  R12.4 (or R12.3)  D.  melanogaster  loci is that the 600  bp repeat containing the  gene is not present in p27ry2.  The sequence of p27simC  contains only a single t R N A S  gene downstream from  Ar  the pair of serine tRNA genes found in both species (Cribbs et al., 1987). Curiously, the 5' and 3' flanking sequences of this single  D.  tRNAArg  simulans  highest homology not to any single gene within the  D.  gene show repeats, but  melanogaster  instead to the 5' flank of one set of genes (R12.2, R12.3, R12.4) and the 3' flank of another  gene  (R12.1). Therefore in the alignment shown in Figure 9 a break has  arbitrarily been introduced mid-way in the  D.  order  homologies observed. This  to maximize the  flanking  homology will be discussed  3.2 The  sequence  simulans  tRNA  A r  S coding region in difference in  more fully below.  Junctions of repeated sequences in pDt27R. p27ry2 and p27simC sequences  melanogaster  that  mark  the  boundaries  of  the  duplicated  are compared to the single copy sequence of  10A. The 200 bp repeats in  D.  melanogaster  D.  regions  simulans  in  in  D .  Figure  correspond to positions -30 in the 5'  81 flank and +100 200  of the 3' flank of the single p27simC gene.  bp repeats containing genes R12.1  occur  that are  not present  and R12.2  in the single copy  three adenylate  residues (boxed)  p27simC sequence.  These additional  residues may have arisen during the duplication event. and  +100  At the -30 junctions of the  The sequences  junctions do not show any obvious symmetries  inverted repeats.  at these -30  such as small direct  or  Thus the only obvious feature of the junctions between the three  200 bp repeats in p27ry2 or pDt27R are the adenylate residues which occur precisely  at the duplication termini.  The 600 bp repeat in pDt27R is quite different however (Figure 10 B). In this case the duplicated region is bounded by an 8 bp direct repeat 5'TAGCCCAA. The precise junction  of this  determine  600  exactly  bp repeat with the because  the  adjacent  resulting  200  novel  bp repeat  joint  is  apparently  difficult to contains  a  duplication of the 5' bp internal segment of the 8 bp repeat (5' CCCAA). Alternatively this apparent 5' bp duplication could also arise by inclusion of 4 nt that are directly repeated  immediately adjacent to the 3' 8 bp repeat, followed by the insertion of an  additional  single adenylate  residue.  The resulting sequences  are  cases and makes the exact position of the junction ambiguous. that these 8 bp direct repeats and  therefore  may  have  involving homologous  3.3  mark the boundaries of the 600  played a role  recombination  in their  same in both  It is clear however bp repeat in pDt27R  duplication by  some  mechanism  or slippage during DNA replication.  Divergence of repeated sequence in pDt27R from p27simC  When two DNA sequences  arise by duplication it is expected that initially they are  identical and then subsequently accumulation  of  nucleotide  begin to diverge from one another  substitutions  and  small  number of these changes should be approximately and  the  deletions  or  by the random insertions.  The  proportional to the mutation rate  the length of time that the duplicated regions have existed.  In addition, i f the  82 Figure  10.  Duplication  R12.4)  R12.3  the  in the  600  bp repeats  show the junctions of the 200  and R12.2  corresponding  to  repeated  regions  in  show the 5' flanking sequence  gene (p27simC) and the two D.  simulans  contained  sequences  of  (A) The top two sequences  melanogaster. single D.  junctions  around  -30.  bp repeats of the D.  positions  -30/+99  (375'  The  middle two  adenylate residues at these junctions are boxed. The bottom two sequences  (3' R12.1) and D..simulans  (3'  genes  melanogaster R12.2-3).  position of the 3' ends of the 200 bp repeats around position +99  from the  genes (5' R12.3 and  melanogaster position  D .  from D.  The three show the melanogaster  p27simC). The numbering of the flanking sequences  relative to the mature tRNA coding regions are as in Figure 6 and correspond to the sequence  from D.  flanking sequence the  pDt27R  (p27simC). (B). The top two  of p27simC around position -449  R12.4  containing R12.4  simulans  gene with the  (position +73).  sequence  at the  and the 3'  sequences compare the 5' equivalent sequence in  end of the  600  bp repeat  The 8 bp direct repeats that flank this 600 bp repeat  are boxed. Five nucleotides that occur at the junction of the R12.4  and R12.3  600 bp  repeats are also boxed. The lower two sequences show this junction at the equivalent positions in the R12.1 and R12.2  200 bp repeats, and in the single p27simC gene.  _ J L 3misizd,z l"ZIB.£  BB1919J.J.J.B3JLqB3333gBip33.Ll I I I I 111111 111 111 11 H«1019111U313g33339yIp3311 I II1111 1111 I 11 111  Z"ZIB.C  «01919111U333g«3339«333311  £'Zia.£/.S  B33U303U^«55JS3339UT J3311  I-I 111 r  II H I M B3BB3B3B I I 111111 B3BB3B3B  KZIB.S 3"!ci2d,g  gb3339Bl|D1911 ^ 1111 )BB33B9B1P19.L3  66+  I  rzia  .c  z'zi-a.s/.c C'ZIU.S/.C  t'czia.e  39BBJL99391-9U9133BB19 I I I I 11 I I I I I 11111 111 I 39BBJL9939J.--9B9133BB19 I IIII IIII I lilBB9991J^Bj)B9133BB19 I III III1II I II II IIII I lllBB9991JjBBBpB9133BB19 I IIIIIIII I 111BB99911 31B911B31B I IIIIIIIII II I II I I I 111BB99911 B1B911B311  oc-  84 Figure  11  simulans sequences  Sequence at  the  P  divergence  Dt27R  tRN A  A  between r  8  Incus.  D.  melanogaster  and D .  The unique t R N A  of p27simC are compared with the repeated  A r  g  flanking sequences  flanking in pDt27R.  All 5 sequences are shared from positions -30 in the 5' flank to + 99 in the 3' flank. The  p27simC sequence  sequences  are  pDt27R  repeats  is shown in full at the top and identities with the pDt27R  indicated below by dashes. caused  by  Differences  nucleotide  deletion/insertions are shown by asterisks.  between  substitutions  The identical tRNA  are shown as open boxes where SI signifies the D. simulans four  repeated  D.  melanogaster  p27simC  are Ar  S  and the  indicated coding  and  sequences  gene and R1-R4 the  genes in pDt27R. The direction of transcription is  indicated by the arrow and the poly dT tract of the p27simC gene is underlined.  -30  5'  *3  TTGGGflflTTTGGGflCGCCGGTTGCGCflflCT I S 1  GG  A--T—C  •99  flGCTCflGGTTflTTflCGfiCTTJTTJfiflCTTfiTTTTTCGTTCGCCCTRTfifiTflTflTTflflTflTGGGflGRTTCCCTflGCCCCRCTCflTTTGTGTflflCCTGfiG  R 1  TR-T-fl-*TTT  0  — T - -R  C—fl***TT  R 2 R R 3  fl  C—CR***TT  R 1  fl—  C—R****T  fi—  --R-- — T — — T - — G  fl--c  00  86 divergence  accumulates  randomly  then  the  amount  of  divergence  should  be  the  same in both or all the duplicated regions. As was noted previously in pDt27R (Newton, 1984)  and confirmed here again with  p27ry2, the amount of divergence is not equal between the three or four duplicated regions in these DNAs. This is shown in Figure 11 where the 30 bp of  duplicated 5'  flank and 99 bp of duplicated 3' flank are shared between all four pDt27R repeats and the single copy sequence from p27simC. The equivalent regions from p27ry2 are not shown because they  are virtually identical to the R l , R2,  and R3 sequences  from  pDt27R. When these repeated D. melanogaster sequence a curious pattern emerges. repeats  contain  sequence, The  fewer  nucleotide  eg. less divergence,  exact opposite  pattern  dissimilar to D. simulans variable  divergence  The 5' flanks of the D. changes  from  for the R l  while the 3'  but  show  equivalent  sequence  for the  fact that the  melanoagster  different in D.  corresponding  rates  repeat: the  flank is most  D.  of  p27simC  R2-R4 simulans  flank is  most  flank specific  sequence  melanogaster  nucleotide  5'  similar. This  gene, as is indicated  seem therefore that these duplicated regions in D. randomly  the  melanogaster  than do the equivalent 3' flanks of the same repeats. is observed  accounts  closely with no single D.  sequences are compared to the D. simulans  aligns  most  in Figure 9. It would are not all evolving  substitution  relative  to  the  simulans.. This is at least partly explained below in a  model that attempts to trace the evolutionary history of these duplicated loci in D . melanogaster.  4. A  model  for  the  evolution  of  P  27rv2  and  P  Dt27R  tRNA  A r  g  g£D£  clusters A model that describes the evolution of the pDt27R gene cluster and its derivatives (i.e p27ry2) is presented in Figure 12. For simplification the model assumes that the  duplicated loci described in pDt27R and p27ry2  represent  duplication products that  have not been rearranged by secondary events. This assumption is supported b y the fact that the Southern analysis (Figure 7) showed that these loci were very similar if not identical in all the strains tested. This however does not exclude the possibility that earlier events The  may have rearranged  the duplication products.  model proposes that a single t R N A 8 Ar  gene  homologous locus in the common ancestors of  was  present  at  ancestral  single gene  copy became  repeats only in the D. melanogaster gene  intermediate  populations flanking  until  of  accumulation  was  flanking  simulans  duplicated on a pair of identical 200 lineage (Figure  12B).  bp  This hypothetical two melanogaster  quite recently.  MYR) the  of  the  nucleotide not  sequences  duplicated  and D.  is then proposed to have been maintained in D.  sequences  accumulation  pDt27R  and its sibling  D. melanogaster  species (Figure 12A). Soon after the divergence of D. melanogaster the  the  flanking  sequences  this  time  identical  repeats  substitutions  caused  entirely  between  During  the  random gene  (approximately  became by  however;  coding regions  outside the  gene  distinguishable  random  more  5-10  sequence  changes (hatched)  coding regions  by  drift.  occurred  the This  in the  than  did in the  (open).  The tRNA  coding regions, like most other tRNA genes, remained identical during this time. The majority of the sequence  differences between  the repeated  regions  in pDt27R and  p27ry2 are proposed to have occurred in this two gene intermediate. The second step in this model (Figure 12C) was the generation of a third repeat  (R3). The high similarity  (98%  identical) between this third repeat R3 and  one of the pre-existing doublet repeats (R2) and  probably  within  the  last  1-2  200 bp  suggests that R3 arose directly from R2  million  years.  This  putative  three  gene  intermediate would be identical to the locus described in p27ry2 (Figure 8). The last  and most recent step in the model is the generation of the fourth gene  contained in the 600  bp repeat R4 (Figure 12D). This duplication was different from  88 Figure  12  proposed  Model  for  ancestral  the  evolution  pDt27R  closest sibling species, D.  D.  of  the  pT)t27R  melanogaster  simulans.  locus  tRNA  A r  g-  Incus.  (A)  prior to its divergence  The  from its  . The single t R N A " g coding region is shown as a Al  filled box. The adjacent flanking sequences are shown by open boxes to position -30 and +99  and by a thick dark line to position -449 to -454.  intermediate simulans the  boxes  residues  correspond  recently (0.5-1.5  (D)  shown  melanogaster containing  the  divergence  of D.  melanogaster  event  from D .  The endpoints of the duplication event are at position -30 in +96-98  in the  beyond.  in the 3' flank. The junction  slash  connecting  flanking sequences  (C) The three gene  consists  of three  the  repeats.  The cross-hatched  that  diverge  more  intermediate  quickly  than  found in a minority  strains (i.e p27ry2, see Table 2 ) is proposed to have arisen quite  M Y R ) . It differs from the two gene intermediate  bp repeat  The final  after  to the internal  melanogaster  200  soon  and at position  flanking regions  of D.  third  arose  (@ 5-10 M Y R ) .  5' flank  adenylate  the  that  (B) A proposed two gene  (R3) with  an identical junction  in the evolution  of  the  containing  gene  cluster  by the addition of a 3 adenylate present  residues.  in most  D .  strains tested (Table 2) was the duplication of a 600 bp region (R4)  the R12.4  gene.  This  region  is flanked  by 8 bp repeats  (arrows) and  contains an apparent 5 bp duplication of the target sequence at the junction.  89  -  (A)  3 0  •••  1) Divergence of D.mel ond D. S i m ( a p p r o x i m a t e l y S HYR)  2 ) D u p l i c a t i o n of 2 0 0 bp f l a n k i n g unit ( - 3 0 5 ' and * 1 0 0 3 ) w i t h A A A i n s e r t e d at j u n c t i o n 3 ) D i f f e r e n t i a l a c c u m u l a t i o n of f l a n k i n g sequence p o l y m o r p h i s m  (B) -30  -100  5'  A A A  Second 200 bp duplication of the R2 repeat i.e by slippage repair or unequal exchange  (C)  -4S4  -tfc_  -30  |—1  * \  5'  A A A  5-  A  A  A  '  ^  ^  ^  R1 Duplication of 6 0 0 bp region flanking the R 3 repeat by recombination between 9 bp repeats  30  -60  (D)  5'  AAA  90 the previous events both in the size of the region duplicated (600 bp versus 200 bp) and the novel joints generated (Figure  10).  In this case the amount of duplicated  sequence was larger and at their termini contains direct 8 bp repeats. The amount of divergence between the resulting two 600 bp regions is very low (<1%,  Table 3) and  suggests that this four gene locus arose within the last million years. Why and how this four gene arrangement became fixed in the majority of tested  D.  melanogaster  is unknown. This model proposes that within the time span since the divergence of  and  strains  D.  melanogaster  D.  simulans  (3-10 MYR, Zweibel et al., 1982, Cohn et al., 1984, Stephens and  Nei, 1985, Caccone et al., 1988) a single member of this t R N A g gene family in D . A r  has been duplicated from one to four copies per haploid genome. In  melanogaster  order  to  account  for the irregular  pattern  of sequence  polymorphisms observed  between the duplicated regions in p27ry2 and pDt27R, the model proposes that the duplications occurred in successive stages using specific repeats as the templates for each  subsequent  precedence  duplication. The successive  in the structure  cultures selected  for drug resistance  1984). Also, to account simulans  of highly  nature  amplified  of  DNAs  these  duplications has  in vertebrate  tissue  cell  (reviewed by Schimke, 1984, Stark and Wahl,  for different levels of divergence from the single copy D .  sequence (Figure 9), the model proposes first, that a two gene intermediate  accumulated the majority of flanking  sequence polymorphisms present,  and second,  that this accumulation was not random but showed a higher rate in the intergenic flanking  sequences  than  in the extragenic  rate at which D N A sequences  flanking  sequences.  evolve has been predicted  This  difference in  from both hybridization  studies of total genomic sequences (Zweibel et al., 1982, Caccone et al., 1988) and from molecular  studies  of specific  Together these features  genomic  regions  of the model account  (Martin  and Meyerowitz,  1986).  for the flanking sequence differences  91  that are observed in the three and four gene repeats found in D.  melanogaster  today. One  aspect of this model that is not clear is the mechanism by which these  duplications occurred. Two different kinds of event occurred as judged by the size of the duplicated region and novel joints created. direct  repeats  mark  therefore  suggest  extensive  precedence  al.,  the boundaries  their  of the duplicated  involvement  in examples  In the case of the 600 bp repeat R4  in  the  region  duplication  of procaryotic  gene  (Figure  mechanism.  10) and This  has  amplification (Whoriskey et  1987) and is proposed to result either from homologous recombination between  the direct repeats or by slippage-mispairing  during DNA synthesis (Moore, 1983).  The mechanism of the 200 bp duplications are less clear. In contrast to the 600 bp repeats,  no obvious sequence  duplicated  regions.  The only  symmetries clue  occur  of the  at the junctions  mechanism  of the 200 bp  is that  three additional  adenylate residues have been added at the junctions. In other examples of eucaryotic genome  rearrangements  nucleotides  that  are sometimes  involve  non-homologous  sequences  added at junctions to create direct  repeats (Roth et al.,  1985). This is not the case here and suggests that these sequences added  by ligation  rearrangements metallothionein and  events  similar  (Alt and Baltimore, gene  to  what  is  observed  may have been  during immunoglobulin  1982). The tandem duplication of a  similarly occurred  without  flanking  sequence  Drosophila  direct  repeats  also added nucleotides at the junction (Otto et al., 1986). Though the particular  boundary  and junction  sequences  differ,  both  this  and the  duplication described here have similarities that may reflect for  additional  tRNA  A r  g  gene  a common mechanism  the initial generation of a tandem duplication. In this evolutionary history  it is proposed that the three identical 200 bp repeats,  with identical junctions, arose by two different events years.  separated  by several  There are three possible ways to explain this seemingly unlikely  million  occurrence.  92 All require the generation of an initial doublet of 200 bp repeats. Once established, a third repeat (or more) could have arisen (a) by an identical event as the first, (b) by unequal DNA but  exchanges  between  mispaired chromatids,  or (c)  by slippage-repair during  synthesis. At present it is not possible to distinguish between these possibilities the  exact  conservation  of  both  5'  and  3'  flanking  sequence polymorphisms  between R3 and R2 would favour a slippage repair type mechanism.  5.  Relation  sibling The  of  D.  D.  to other  melanogaster  Drosophila  species  Southern analysis of  tiessieri  )  sibling species (Figure 7, lanes i-k )  Drosophila  that the more distantly related ,  and D.  simulans  D.  sibling species (D.  melanogaster  erecta  ,  suggested D.  yakuba  all contain a single t R N A S gene at the homologous pDt27R locus. In Ar  the case of D. erecta  and D.  , molecular analysis of this single gene copy  yakuba  showed that the mature tRNA coding region does not contain the C13 polymorphism that distinguishes the pDt27R genes from all the other gene family copies in the  (Leung, 1988 Ph.D Thesis). This would suggest that sometime after the  melanogaster  divergence sibling  of the  species  D.  D.  and  melanogaster  (approximately  incurred a T13-C13 when  30  D.  lines from the remaining  simulans  M Y R ago),  this  ancestral  single  and  melanogaster  D.  lines. The rationale, or apparent of this tRNA  gene  simulans  selected  copy  diverged from one another, this variant  copy  selective  is not yet  advantage,  known.  by cadmium resistance  after  melanogaster  for the successive duplication  In the case of the  metallothionein gene, the gene duplication can be explained were  gene  substitution relative to other members of this gene family. Later  gene copy became amplified from one to four copies per genome in D.  flies  D.  growth  Drosophila  by the fact that the  for several  generations in  media containing cadmium (Otto et al., 1986). However, the advantage of three more copies of a variant tRNAArg gene is not clear. A obvious possibility is that more gene  93  product could be synthesized but the selective  advantage  of this is unknown. Note  that for two of the four duplicated gene copies, only 30 bp of 5' flanking sequence were included in the 200  bp repeats. This raises the possibility that not all of these  amplified genes are active because modulatory sequences of the 200 confer  assaying evident  requirement of 5' flanking  for the efficient expression of many tRNA genes. In the case  bp repeats, the 30 bp of 5' flanking sequence may not be sufficient to  optimal  addresses  of the now apparent  template  whether their  activity.  The following  section  all four of these genes are  activity  in vitro,  and also  that might help explain the  members of this gene family.  whether  of  potential any  this  thesis,  templates  differences  duplication of these genes  in  therefore, vivo  by  in activity  are  relative  to  other  94  Part  III- Functional  studies  of  the  tRNA S  gene  A r  family  An important question regarding the net function of a tRNA gene family is whether  all  gene  copies  are  active  as  templates  products. In redundant gene families encoding  capable  synthesizing RNA  ribosomal RNAs (i.e  Drosophila  18S, 28S) only a portion of the total gene copies may  of  5S,  be active (Jamrich and Miller,  1984,  Sharp et al., 1984). Therefore it was of interest to determine whether all these  tRNA  A r  pool  S genes copies are at least potentially capable of contributing to the 4S RNA  in  vivo  ,  and  in  particular,  whether  any  duplicated 1 bp variant genes found in pDt27R.  differences  are  observed  in  the  As was discussed in the Introduction,  it is technically difficult to distinguish the products of different gene copies in vivo when they  are identical or differ by only 1-2  was to see  whether  individual gene copies  Drosophila  cell free extracts.  1. In vitro  transcription  of  tRNA  A r  g  The cell extracts used for transcription  been shown to transcribe a variety of (Leung et al., 1984, plasmid constructions  S  in  An alternative  vitro  approach  using homologous  gene family in  were derived from embryonic  vitro  Drosophila  St. Louis and Speigelman, 1984,  Extracts from these cells have  tRNA genes with high efficiency Lofquist and Sharp, 1986). The  used to compare the activity of each gene family member are  described in the Methods and are A r  are active  Schneider 2 cells (Rajput et al., 1982).  Drosophila  tRNA  nucleotides.  indicated in Figure 4.  They consist  of single  genes flanked by at least 100 bp of 5' and 3' flanking sequences contained  in closed circular plasmid vectors (pEMBL 8-/+). In each case the plasmid is named after the gene it contains (i.e pR12.5, pR12.6 etc). The cluster of four pDt27R genes were not all subcloned individually.  One  template  (pR12.4) contains a single gene  copy derived from a 600 bp repeat  (R4, Figure 1).  A second template (pR12.2) is  95  derived from a  200 bp repeat (R2, Figure 1).  These two templates are  of the two pairs of 600 bp and 200 bp repeats containing identical  representative  tRNA g A r  genes.  The transcription properties of the two untested genes (R12.1 and R12.3) are assumed to be equivalent because of their almost identical DNA flanking sequences.  1.1 Gene products of the t R N A g - gene family Ar  Figure  13  containing  shows  the  equimolar  in  products  vitro  amounts  of  different  identical  tRNAArg  indicate that each member of the gene family albeit in some cases, with greatly  of  transcription  gene templates.  reactions  The results  gives rise to a set of discrete products,  differing efficiencies (see  below).  The smallest  transcription product (M) is identical in size between all gene copies and therefore probably  corresponds  to  the  between each gene template. (pR12.5,  pR85.2,  mature  tRNA  A r  g  transcript  that is identical in size  Each gene also gives rise to one, and in some cases two  pR85.1),  higher molecular  weight  transcription  products  (P)  that  are much more abundant as judged by labelling intensity, and vary in size between the different gene copies. By analogy with other tRNA genes transcribed these should correspond  to  the precursor  heterogenous  5'  and 3'  lengths  of  (pre-) transcription  flanking  sequences  transcription initiation and termination, respectively. the  transcription  products  of  a control  products  depending on  in vitro  and contain the  Also included in Figure  t R N A 2 S gene  contained  Ar  ,  site  of  13  are  in the plasmid  pYH48 (Silverman et al., 1979). This gene is the most efficiently transcribed member of this related tRNA gene family using Drosophila al.,  1984)  and also transcribes  efficiently in Schneider cell extracts (Lofquist and  Sharp, 1986). In addition to these mature and fainter probably  bands  with  correspond  intermediate to  lesser  Kc cell extracts (Dingermann et  electrophoretic  amounts  pre-tRNA g transcription Ar  mobility  of partially  are  processed  also  products,  visible.  These  intermediates.  These  also differ in size depending on the gene template in question. The major difference  96  Figure  13  In  transcription  vitro  tRNA  A r  g gene  tRNA  gene family were transcribed in 25 pi reactions containing 100  12.5 pi Drosophila were  by electrophoresis  visualized by autoradiography. are  family.  containing single copies  of the  mM KC1,  Schneider cell extract, and [a^2p] GTP. The labeled transcripts  fractionated  transcripts  DNAs  the  amounts  8  nM) of plasmid  of  Equimolar A r  (1.3  products  The  indicated by arrows  in denaturing 10% predicted primary on the  polyacrylamide gels and (P)  and mature (M) gene  right. The template  DNAs  for each  transcription were pYH48 (lane a), pR12.6 (lane b), pR12.5 (lane c), pR12.2 (lane d), pR12.4 (lane e), p R 1 2 . 4  T13  (lane f). pR5'/3' (lane g), pR85.2 (lane h), pR85.1 (lane i),  pR83.1 (lane j), and pR19.1 (lane k).  /  I 9t  I  I  I  K  3  •  II I  &>  pVH48  9  pR12.6  n  pR12.5  a  PR12.2  •  PRI2.4  *  PR12.4  •  pR5V3"  9  PR85.2  -  PR85.1  I  pR83.1 *  PR19.1  T13  98 between  members  transcription  of  products  this  gene  of the  family  evident  duplicated pR12.2  from  Figure  and pR12.4  13  genes  is are  that  the  much  less  abundant than other gene copies and the control pYH48 gene. This is examined in more detail in following  sections.  1.2 RNase T l Fingerprinting To  confirm  that  the  P  and  M bands  correspond  to  the  precursor  and  mature  transcription products of the same gene, they were eluted from gels and subjected to RNase T l fingerprint analysis (Figure 14). Tl  In the case of the pR12.5 transcripts, the  fingerprint of the major P band is identical to that of the M band except for the  presence  of  one  additional labeled oligoribonucleotide  presumably corresponds  (Panel  A,  spot  X).  This  to the 5' leader T l oligoribonucleotide (5'AACUGp) predicted  from the DNA sequence (Figure 6).  None of the 3' trailer sequence  oligonucleotides  will be labelled in this experiment (labeled with [a 32pj GTP) and therefore are not visible in the Panel A. The fingerprints are consistent absence their  of  ribonucleotides  predicted  precursor-product  Panel C in Figure 14 variant  pR12.4  products from  gene.  a transcription  transcription  by  transcript  processing  the  low  abundance  of these  cell extracts, this particular experiment reaction  efficiency  thus  supports  shows the T l fingerprint of the P band derived from the 1 bp  was  that contained much  higher  a heterologous  (human  HeLa  cell  cells,  transcription  used the P band extract in which see  below).  This  product also gives rise to a similar fingerprint but includes additional  oligoribonucleotides that are expected from the different 3' 6),  and  relationship.  Note that due to  in Drosophila  transcription  removed  with them differing by the  and in particular,  a large oligoribonucleotide (Y)  trailer  sequence  (Figure  whose shifted charge mobility  and size suggests it corresponds to the single ribonucleotide that should be different  Figure 14  Tl  RNase  Fingerprints  [cc32p] GTP labeled transcripts were with  (horizontal)  and  second dimension (vertical),  vitro  transcription  at pH 3.5  products  on cellulose acetate in the first  homochromatography on D E A E the plates were exposed  shows the fingerprint of the plate (B)  in  eluted from gel slices and digested to completion  RNase T l . After electrophoresis  dimension  of  99  cellulose plates  in the  for autoradiography. Plate  (A)  pR12.5 major precursor transcript (P in Figure 13) and  shows the fingerprint of  the corresponding pR12.5 mature transcript (M).  Plate (C) shows the fingerprint of the pR12.4  gene P transcript (synthesized in HeLa  cell extracts, see Figure 19). The (b) indicated in each panel shows the position of the bromophenol blue dye marker.  X indicates the position of an oligoribonucleotide in  the pR12.5  M transcript that is absent in the pR12.5  indicates  R12.4  a  oligoribonucleotide whose  size  cellulose acetate is consistent the single T13-C13 product.  P transcript.  and difference  In panel C, Y in mobility  on  substitution predicted in this gene  101  in this transcription product (5' rCCLLAAUGp to 5' rCC£AAUGp). As predicted from the DNA  sequence, the 5' leader oligoribonucleotides of the pR12.4 and pR12.5 genes are  identical (Figure 6) and consequently give rise to identical spots in Panel A and C. This  further supports  the  above  conclusion that the  spot  missing in Panel B  corresponds to this 5' leader oligoribonucleotide. These results  strongly support the  conclusion that the P and M products mature  tRNAArg  transcription  in Figure  products.  13  In  in the  RNase T l  fingerprints of  correspond to precursor and  addition,  difference predicted from the DNA sequences of the evident  X  their  the  single  nucleotide  pR12.4 and pR12.5 genes is  products  and could conveniently  provide an assay for the expression of these genes.  1.3 To  Initiation and termination of in vitro determine the length of the 5'  and  hence  analysed  the inferred Pol III by  primer  extension  products of an in vitro synthetic the  5'  predicted  mature  leader sequences of these precursor transcripts, initiation sites,  with  reverse  transcription  oligonucleotide (Argl, tRNA  A r  see 8.  deoxyribonucleotides, this primer  transcripts.  (lanes  c-j).  Control  to  reactions  were  After extension  (Figure  hybridized  with  transcripts  vitro  Methods) complementary  to  reverse  15).  The  with a  were total  20-mer  positions 3-22 transcriptase  of and  gave rise to 22 nucleotide extension products that A r  that correspond  transcriptase  reaction  should correspond to the mature f R N A § nucleotides)  the in  precursor  and to longer extension products (23-29 transcripts  of transcription  that  reactions  initiate  further upstream  containing only  pEMBL  vector DNA also gave rise to a 22 nt extension product and suggests that significant amounts of (lane  a).  (tRNA2  endogenous mature t R N A S are present in theDrosophila No  A r  cell extract  Ar  8)  additional bands  arise  are extended with Argl  when  transcripts  synthesized  from  (lane b) and prior treatment with  results in loss of all extension products (data not shown).  pYH48  RNase A  102 Figure in  15.  extension  analysis  of; t R N A  A  r  g  transcripts synthesized  Total nucleic acids from 50 p i transcription reactions  vitro.  Schneider cell extract, 625 u M 'cold'  Drosophila and  Primer  containing 25  pi  deoxyribonucleoside triphosphates,  0.2 pg template DNA (lanes a-i) were purified and hybridized to 5' 32  P-labelled  20 mer (Argl). After extension with A M V Reverse Transcriptase and treatment  with  RNase A, the extension products were fractionated by electrophoresis through a 12% urea- polyacrylamide gel alongside a sequencing ladder using the same end labeled primer and a cloned gene template (pR12.4, (a-j)  were  from  transcription  reactions  not shown). Extension products in lanes  containing the  following  template  DNAs:  pEMBL alone (lane a), pYH48 (lane b), pR12.5 (lane c), pR85.2 (lane d), pR19.1 (lane e), pR85.1 (lane f). pR83.1 (lane g), pR12.2 (lane h), pR12.4 (lane i), and pR5'/3' (lane j). The sizes of the extension products are indicated on the left. shown a diagram indicating the extension products mature (bold  and precursor vertical  arrow).  tRNAArg transcripts  hybridized  (vertical to  On the right is  arrows)  derived from  the 20-mer  primer Argl  103  a  b  e  d  e  f  g  h  i  j  104 In lanes (c-j) of Figure 15 all but one member of this gene family (pR83.1) gave rise to the same predominant 26 nucleotide extension product. This  corresponds to a  5' initiation site at position -4 relative to the mature 5' end of the tRNA. The only other gene copy not included in Figure 15 (pR12.6) gave identical results (data not shown).  Other less abundant extension products that are a few- nucleotides longer or  shorter are also visible and differ in size between different gene copies. The longest extension product is 29 nucleotides long (pR12.5, initiation  site  at  position -7.  These  major  lane c) and corresponds to a minor  and minor transcript  start  sites  are  summarized above the flanking sequence shown in Figure 6. The length of these 5' leader regions shows that major transcription initiation site  occurs  at  the  first of two conserved  adenylate  residues  sequence of every gene family member except one (R83.1 pR83.1 and,  5'  flanking  Figure 6).  In the  gene the position of this pair of adenylate residues are shifted upstream 1 bp  correspondingly, so  (Figure  see  in the  15,  lane g). This  is  the  position of  suggests  a major  transcription  initiation  site  that these adenylate residues may serve some  functional purpose in the location of the transcription initiation site in members of this  gene  family.  The pR83.1  gene  also  gives  rise  to  significant amounts  of  transcripts that appear to initiate at position -1 and slightly less so at position -2. The only other major transcripts which initiate at sites different from the conserved pair of adenylate residues are from the pR12.4 gene (Figure 15, lane i). In this  case  transcription  initiation  appears  to  adenylate (position -4) and at a guanylate residue  occur  equally  at  the  conserved  located 2 nt upstream (position -  6). The pR12.2 gene, which is identical in sequence in this region, shows much less initiation at this upstream site. The reason for this difference is unknown. The gene coding  regions  are  nucleotide in the 30  identical  and  the  5'  flanking  sequence  differ  only  bp that are common between these two templates.  significant difference between these  genes  is that the 5'  flanking  by  1  The only  sequence  is not  105 truncated  at position -30  in pR12.4,  and thus raises  the possibility  that upstream  sequences can also influence the site of transcription initiation. In almost every case the major and minor initiation sites sequences, especially those upstream of the major -4  in these flanking  site (and therefore less likely  to be the products of degradation or incomplete extension) occur at purine residues located in the non-coding strand of the 5' flank. This is consistent with properties of RNA  polymerase  (Geiduschek  III  transcription  initiation  and Tocchini-Valentino,  Though not tested  from  a  wide  variety  of  examples  1988).  directly (i.e  by SI  mapping) the sites  of transcription  termination in all gene copies likely occur at the first poly dT tracts that follow the coding regions. This is because the sizes of the precursor products (P) Figure 13 the  3'  visible in  are consistent with the predominant transcript start site and the length of tailor  sequences  predicted  from the  3'  flanking  sequences  (Figure  Transcripts from the pR12.5 gene also include a discrete product approximately  6). 10-  15 nt longer than the major P product. A second poly dT tract occurs in the pR12.5 3' flank  at this position and suggests  that this is a minor readthrough transcription  product that terminates at the second poly dT tract. Why just this gene copy gives rise  to readthrough transcripts is unknown but may result from the fact that this  gene  has  the  shortest  poly  dT tract  (n=  transcription readthrough. Both the pR85.1  5)  and results  and pR85.2  in a small  amount of  genes also give rise to minor  P products that are a few nucleotides longer than the more abundant P transcripts. The origin of these bands is not clear.  1.4  Transcription efficiency of different gene copies  The most obvious difference between members of this gene family is in the signal intensity  of  the  transcription  products  (Figure  13).  Because  they  are  all  approximately the same specific activity (i.e number of G or U (T) residues) and were  106 synthesized intensity  from  should  synthesized.  equimolar amounts correspond  to  of gene  differences  template,  in the  the difference  total  amount  in signal  of  transcripts  The most extreme differences are in the products of the duplicated  pDt27R genes (pR12.2, pR12.4 lanes d-f)  which are hardly visible relative to the  other gene copies derived from the same (lane b,c) or different chromosomal sites (lane  h-k). These other  gene  family  members  give  rise  to transcription  that are comparable or exceed the abundance of a t R N A 2 ^ 8  products  gene contained in the  r  plasmid pYH48. To quantify these differences in signal intensity, the transcription efficiency (pmoles of transcript per hour) of each gene was determined as a function of the concentration  of template  D N A (Figure  determined for each gene (Figure experiments  16)  at the optimal  17). The [KC1] was varied  showed that the pDt27R genes  KC1 concentration because preliminary  were particularly sensitive to this salt  and were markedly inhibited at the standard KC1 concentration (100 mM, Figure 17). All  the  remaining  genes  in  this  family  are  relatively  unaffected  by KC1  concentration and show near or optimal transcription rates in the 80-100 mM range. The amount of transcription products synthesized by each determined the from  specific  concentration of  transcripts.  activity  The number of transcripts  increases  higher concentrations  (ie. number of G or U residues  DNA (Figure  16). The total  linearly at low template (0.5-1.0  nM). Double  concentration  reciprocal  of these data were then used to estimate the apparent V gene template  was then  (St. Louis and Speigelman, 1985).  calculated  per transcript and  labeled ribonucleotide in the transcription reaction)  a function of input template transcripts  was  by quantifying the Cerenkov radiation emitted by gel slices containing  abundant precursor their  template  and plotted as  amount of accumulated and then  plateaus  at  Lineweaver-Burke type plots m  a  x  (pmoles/hour)  These results  for each  arc summarized in  107 Figure  16  template  Transcription  efficiency  of  tRNA  pYH48 and each of the t R N A S  experiment using the same batch of Drosophila  32p]  8  gene templates  gene templates  A r  template was  A r  were transcribed  transcribed in 6 parallel 25 pi reactions containing 9 pi of  extract, [a  GTP, optimal KC1 concentration (see Figure 17 and Table 4), and input template that varied from 0.1-2.0 pg/ml. The total  each  maintained  reaction  transcription  13)  in one  Schneider cell extract (#402). Each  DNA concentrations  The  Reference  was  products  radioactivity  at  a constant 20  were then  incorporated  fractionated  into  specific  by  pg/ml  with  DNA concentration in pEMBL  electrophoresis  primary  transcripts  as (P  D N A . The  in Figure  bands  13.  in Figure  was quantified by Cerenkov radiation from excised gel slices. Using the number  of GTP residues in each primary transcript and the specific activity of [oc-^p] GTP in the  transcription  reaction,  the  pmoles  of  transcript  synthesized  calculated and are plotted as a function of the concentration The  tRNA g A f  box on the left.  gene templates  and reference template  per  hour  were  of input template DNA.  (pYH48)  are indicated in the  108  0.30  •  PVH48  •  PR85.2  •  PR12.4  0  PR12.5  •  PR12.6 PR85.1  1  2  T e m p l a t e DNfl  (nM)  A  PR83.1  A  PR19.1  Table 4. Comparison of in vitro transcription efficiency between members of the gene family.  Gene template  Relative trartscription efficiency a  pYH48 pR12.4 PR12.5 pP.12.6 pR19.1 PR83.1 pR85.1 PR85.2 PR5V3*  1.00 0.37 1.77 1.00 0.98 0.87 0.77 1.80 1.12  c  d  Optimal K Q (mM^  85 65 95 85 Q5 85 85 75  -  a) . Data from Figure 16 were replotted (1/S versus 1 /V) and the y-intercepts (1 / V) were used to estimate apparent maximum transcription rates (pmoles transcript/hour). The trartscription efficiency of each tRNA^Sgeneis expressed as a ratio of the apparent maxhrrum transcriptionrateof a reference template (pYH48) determined in the same experiment The correlation coefficents (R values) for all but one of the templates was 0.99-1 JOQ. pR83.1 gave an R value of 0.98 which was probably due to anomoloush/ low activity at low template concentrations (see Figure 16). b). The optimal K Q concentration for each template was determined from Figure 17. The data for pYH48 are not included in this figure but gave a broad profile with a maximun around the 85 mM range (data not shown). c). Identical results were obtained with the pR12J2 gene (data not shown) d). The transcription efficiency of pR573* relative to pYH48 was determined tn separate experiments in transcription reactions containing the 100 mM K d  110 Figure tRNA  17. A r  §  Effect  of  K C I on  in  vitro  gene was transcribed in sets of 8  transcription  efficiency.  reactions (as in Figure 16) where the  final added KCI was varied from 0-70 mM. The KCI contribution from the Schneider endogenous  cell  extract  was estimated  KCI in the transcription  at  approximately  reactions  Each  are  45  Drosophila  mM. The added and  summed on the abscissa. The  primary products (P) of each transcription were quantified as before and the results are  expressed  efficiency  on  the  ordinate  observed over  gene templates  as  the range  a  percentage  of  the  of KCI concentrations  are indicated in each panel.  maximal tested.  transcription  The individual  Ill  112  Table 4 and are expressed as a ratio of the rate for the control t R N A 2 ^ 8 r  gene  (pYH48) transcribed in the same experiment. As suggested initially in Figure 13,  6 of the 10 copies in this gene family are  moderately to highly active in these Drosophila  cell extracts relative to the pYH48  gene. The four identical pDt27R genes are all several fold less active based on the low efficiencies of the pR12.2 and pR12.4 templates.  In the more active group, two genes  appear to be most efficient (pR12.5 and pR85.2) while the remainder (pR12.6, pR19.1, pR85.1, pR83.1)  vary in activity at slightly more or less than the  efficiency of the  control gene in pYH48.  1.5  Novel properties  The  pR12.2  of the pDt27R genes.  and pR12.4  templates derived from pDt27R show the most dramatic  differences in transcription efficiency of all the members' in this gene family. They are at least 2-5 fold less active than any other gene copy and have a much lower KC1 optima.  The basis  of  this  difference  in transcription properties  were  therefore  examined in more detail. - Gene  coding  structure  and  flanking  sequence  dependence:  that distinguish the pDt27R genes  The only differences in DNA  (R12.1-R12.4) from other gene copies  are first, the 1 bp change at position 13 (C13 versus T13) and second, the adjacent 5' and 3'  flanking  sequences. To examine the effect  of the  single coding  sequence  polymorphism, the C13 of pR12.4 was converted by site specific mutagenesis to the T13 present in all other gene copies (pR12.4 ^3) T  an(  j  transcribed in standard 100 mM  KC1 reactions (Figure 13, lane f)- The results are not significantly different from the original pR12.4  template and suggest that this coding sequence polymorphism does  not play a role in the distinctive transcription properties of these genes. To test the dependence of the 5' flanking sequences, a template was constructed consisting of the 5' and 3' halves of pR85.2 and pR12.4 genes, respectively, fused at  113  their common Bam HI sites, (see Methods for details of this construction). The result is an intact gene with the T13 coding region nucleotide and 5' flanking sequence of pR85.2 and the 3' coding region and flanking sequence of pR12.4. Transcription of this  fusion hybrid  that  is  no  (pR5'/3') in standard  longer  salt  sensitive  reactions  (Figure  13)  results  and  in high template  suggests  that  the  5'  activity flanking  sequence confers these distinctive properties on the pR12.4 gene. Both pR12.2 and pR12.4 have equivalent activity both in regard to template activity and salt optima (Figure amount  of  duplication  unique  5'  13,  flanking  17).  These two templates differ however in the  sequence  of these genes discussed  preceding  in Part  II  each  coding  included 454  regions.  bp of  5'  The  flanking  sequence in the case of the pR12.4 template and only 30 bp of 5' flanking sequence in  the  case of the  flanking  sequence  pR12.2 template.  Therefore if they  dependant transcription properties,  flank switching experiments,  both have  equivalent  as is suggested  by the  5'  above  then these properties are likely to be conferred by the  short 30 bp flank region common to both. - Template flanking  pre-incubation  sequences  confer  assays: the  The experiments  distinctive  salt  efficiency properties of the pDt27R genes. the  ability of the  transcription that  do  1987,  to  form stable  factors TFIIIC and TFIIIB  form.  Drosophila  gene  Such  5'  flanking  (Cooley et al., 1984)  Morry and Harding, 1986,  above  sensitivity  suggest  and  low  genes they  containing  pR12.5  pre-incubated 20  were or  pre-initiation complexes or alternatively,  sequence  dependence  Rooney and Harding,  as  5'  transcriptional  the has  with the  stability of been  seen  Pol  III  complexes with  other  and eucaryotic tRNA genes (Raymond and Johnson,  transcribed  pYH48  the  One possible mechanism is by reducing  1988,  Sajjadi and Speigelman,  1989). To measure the extent and stability of pre-initiation complexes pDt27R  that  in pre-incubation assays (Sharp  reference  templates.  minutes with increasing concentrations  formed on the al.,  1983)  Transcription reactions  were  of  et  pR12.4 DNA and then  114 Figure  18  Formation  Template of  stable  pre-incubation pre-initiation  assays  for  complexes  stable  was  complex  tested  increasing concentrations of competitor template DNA (0- 400 2 4 ° C in 50 pi transcription reactions  by  formation.  pre-incubating  ng) for 20 minutes at  containing 25 pi Schneider cell extract, [a 32pj_  UTP, 100 mM KC1, and pEMBL DNA to maintain a constant total DNA concentration of 20 pg/ml.  The reactions were then challenged by addition of 200  ng of reference  template and then together were incubated for an additional 60 minutes. The mixture of  transcription  products  from  the  two  templates  were  then  separated  by  electrophoresis and visualized by autoradiography. In the autoradiogram at the top, panel  A  shows  concentrations  the  reference  pYH48  transcripts  of competitor pR12.4 DNA.  in the  presence  of increasing  In panel B the reference  template is  pR12.5 with the same concentrations of competitor pR12.4. In panel C the reference pR12.5 template is tested against pYH48 competitor D N A and panel D shows the converse, where pYH48 reference DNA is tested against pR12.5 competitor DNA. In all sets of six reactions, the concentration of competitor DNA was 0, 50, 100, 200, 300, and 400 ng of plasmid DNA. The inhibition of the reference DNA transcripts as a function of  increasing concentrations  radiation.  of  competitor  D N A was  The results are plotted below (inset,  quantified  by  Cerenkov  A , B , C, and D, as above) as a  percentage of the reference DNA transcripts in the presence of no  competitor DNA.  115  Competitor template D N A (nM)  116 challenged  by addition of  a fixed saturating  concentration  of reference  template  (either pYH48 or pR12.5). The results in Figure 18 show that pre-incubation with the pDt27R derived pR12.4  template results in the inhibition of  transcription of both  pYH48 or pR12.5 templates. This suggests that the pR12.4 template is fully capable of sequestering  limiting  transcription factors  with the ability of either pR12.5 genes  into stable  complexes.  When compared  or pYH48 to form stable complexes, the pDt27R  appear to be even stronger  competitors  gene templates. This is also seen with  than these  Drosophila  more highly transcribed  tRNA4  V a l  genes (Sajjadi and  Speigelman, 1989). These assays were performed at the KC1 concentration (100 mM) where gene transcription of pR12.4 is mostly inhibited the ability to form stable complexes the salt  salt  not result  transcription  factors.  - Extract  dependence:  any  is independent of transcriptional activity and  concentration in the transcription reaction.  sensitivity does  effect  (Figure 16) and shows that  from an inability  In turn this suggests to form stable  that the  complexes  with  Another question was whether the source of cell extract had  on the transcriptional properties of the pDt27R genes.  Several studies  show 5' flanking sequence modulation is most evident in homologous transcription reactions  containing genes  and cell extracts from the same species (Dingermann et  al., 1982, Schaack and Soil,  1985). In one set of experiments, transcriptions reactions  were performed at the inhibitory KC1 concentration containing mixed with extract  increasing fractions  replacement  (lane  of the  total  protein)  of human HeLa  extract (Figure 19). The results show that  Drosophila  alone  (pg/pg  (100 mM) in parallel reactions  i)  the transcription  Drosophila  products  are  cell  in  not detectable.  extract with HeLa cell extract  extract  Drosophila  However,  (lanes  a-h) in  reactions containing identical amounts of template DNA leads to at least a 100 fold stimulation of pR12.4  transcription. To show that the stimulation is specific to the  pR12.4 gene and does not result from a higher Pol III activity in these HeLa extracts.  117 Figure  19  in vitro  Comparison  transcription  of of  and Human  Drosophila  pR12.4  The  (HeLa)  autoradiogram  extracts—211  ££jj  shows  the  transcription  products synthesized in 25 pi reactions containing 100 mM KCI, O.lpg pR12.4 DNA, a 32  p-GTP,  extract.  The  and varying proportions of transcripts  autoradiography  as  were  described  Drosophila  fractionated before.  Lane  by a  Schneider cell and HeLa cell electrophoresis shows  the  and  visualized by  products  of  containing only HeLa cell extract. Lanes b-h contain increasing ratios of extract mixed with HeLa cell extract (pg per pg total protein); 0.04 c), 0.20 (lane d), 0.30  (lane e), 0.40  contains  reactions with  transcription  (lane 0. 0.60 Drosophila  (lane g), and 0.80  reactions Drosophila  (lane b), 0.10 (lane (lane h).  Lane (i)  extract alone. The results were  quantified by counting Cerenkov radiation of the band indicated with an arrow and are plotted as a percentage of the transcripts present in HeLa extract alone (lane a).  100  0.0  —r~ 02  —r  0.4  —r~  0.6  0.8  Ratio of Dme/Hsa extracts (micrograms protein)  119 Figure 20 in  Comparison  transcrintion  autoradiogram  of  KCI  reactions  sensitivity using  shows the transcription  of  crude  pR12.4 HeLa  products of 25  and ££il  templates  pR12.5 extract.  pi reactions  (A)  The  containing 9 pi  HeLa cell extract, 0.1 pg template DNA, [a 32p] GTP, and total KCI from approximately 45-115 mM (as  in Figure 17).  Lanes (a-h)  show transcription products of pR12.4  template DNA at 45, 55, 65, 75, 85, 95, 105, and 115 mM KCI respectively. Lane (i) shows the transcription products of pEMBL vector DNA alone. pR12.5 template DNA at the same KCI concentrations transcription  products  (arrows)  radiation and are plotted in (B) diamonds correspon  correspond to  to  from  each  template  Lanes  as before. were  (j-q) are those of The two major  quantified by Cerenkov  as a function of KCI concentration.  reactions reactions  containing pR12.5 containing  DNA and the pR12.4  The filled open  boxes  DNA.  120  A PR12.4  pR.2.5  i  a b e d  40  e  60  f  g  h  1  i  i  j  80  k  l  m  n  100  A p p r o x i m a t e KC1 c o n c e n t r a t i o n  o  120 (mM)  p q  121 the  transcription  pR12.4 and the  rates  at  varying  KCI  concentrations  were  normally more efficient pR12.5 template  compared  (Figure  20).  between  The results  show that in HeLa cell extract alone the two templates are now almost equivalent in activity  and no longer exhibit the dramatic  extracts. However the total accumulation of pR12.4 transcripts is still  Drosophila  slightly  differences in KCI sensitivity seen in  less  than  concentration.  This  pR12.5 agrees  and with  also  plateaus  studies  of  earlier  the  tRNA2  and yeast extracts (Schaack and Soil, 1985)  Drosophila  transcription sequence  systems  exhibit  similar  but  less  with A r  S  increasing  gene  KCI  of pYH48 in  which show that heterologous  drastic  differences  in  flanking  dependence. The reasons for this observed extract dependence are not known but have been  attributed to the presence transcription  that  transcription  are  factors  Valentino-Tocchinni,  not  of additional factors conserved  necessary 1988).  for  In this  between stable case the  necessary  species complex  to  for specific tRNA the  same  formation  pDt27R  genes  may  extent  as  (Geiduschek  gene the and  be repressed in  Schneider cell extracts by specific factors that either are not present or  Drosophila  have significantly diverged in HeLa cell extracts.  1.5  Summary of  in  vitro  transcription data.  These results show that all members of this gene family are active can potentially contribute each  template  located 4-5  accurately  in  vivo  initiates  to the total 4S RNA pool. In transcription  at  in  vitro  Drosophila  a conserved  adenylate  and  extracts residue  nucleotides upstream from the 5' end of the mature tRNA and terminates  transcription at the first tract of dT residues in the 3' flank. In one case (pR12.5) small amounts of readthrough transcript are then correctly  were also detected.  The primary transcripts  processed to yield identically sized mature transcription products.  122 Although all gene copies are active in vitro , template  transcriptional  efficiency.  The majority  equivalent to or greater than the t R N A 2 & Ar  recently other  duplicated pDt27R genes,  gene  family  concentrations properties  members  appear  templates  have  efficiencies  reference gene in pYH48 (Table 4). The  however, are at least  and in addition,  are  2-5  fold  markedly  less  active than  inhibited  by KCI  to be conferred  by the respective  5'  gene  flanking  sequence.  (pR12.2) and 600 bp (pR12.4) gene copies behave similarly in  and do not appear to be influenced by the 3' flanking sequence,  modulatory  region  sequence. 200  of  at which the other gene copies transcribe near optimally. Both these  Because the 200 bp vitro  they exhibit wide differences in  is predicted  within  the first  30  bp of 5'  flanking  This demonstrates that the 30 bp of 5' flanking sequence included in the  bp duplication events  regulatory  to occur  this 5'  sequences  were  associated  sufficient  to  maintain  the  original  potential  with these genes.  In regards KCI sensitivity and transcription efficiency, these results are similar to at least two other studies. One of three Drosophila  tRNA  A s n  genes  also showed  marked differences in KCI optima that was not related to the ability of the gene to form  stable  complexes  or to transcriptional efficiency (Lofquist and Sharp,  Also in a comparison of constitutive and silk gland specific t R N A ' A  observed  that  the tissue  specific  gene  showed  wide  variations  a  1986).  genes it was  in transcription  efficiency depending on the extract preparation and that the KCI optima of this gene was much lower than for the constitutive t R N A * A  this vitro  latter  example,  differences  in salt  reflected the fact that in vivo  a  gene (Young et al., 1986). Thus in  sensitivity  and transcription  efficiency  in  these genes were expressed in a tissue specific  manner. The exact correlation between these properties is not yet known. However, it is tempting to speculate that the pDt27R genes might also be regulated in a tissue or developmental manner, especially in light of their recent duplication. But until  123 the products of these genes can be identified (see below) and followed in vivo , speculation  should be deferred.  2. In YJVQ expression:  Identify  of  the  gene  nrodiicts  The last question in this section addresses the in vivo products encoded by this gene family. and abundance  of Drosophila  relatively  simple pattern.  A single major  be resolved  major  species  by high resolution  corresponds  to  the  identity of the tRNA  Previous work by White et al. (1973) on the  numbers  could  such  arginine isoacceptor  RPC-5 tRNA2  accepting and 3-4  chromatography A r  S  encoded  tRNAs  showed a  minor  isoacceptors  (Figure  21  in pYH48.  A). The  The minor  isoacceptors presumably include the tRNA(s) predicted by the gene family described here  and any  other  arginine  accepting  species  that  might  also  be  present.  According to the genetic code and rules for anticodon: codon 'wobbling', the major arginine isoacceptor  tRNA2 S Ar  (5'ICG) should recognize the arginine codons 5' CGC,  CGU, and C G A . The 5' T(U)CG anticodon  sequence of the t R N A g Ar  here predicts that they all should recognize the 5'CGA  family described  and C G G codons. Thus all four  of the 5'CGN family of arginine codons may be translated  by these two families of  tRNA. The remaining two arginine 5' A G A and A G G codons may also be translated by a  single  anticodon  sequence.  Therefore  in addition  to the three  gene  products  predicted from the t R N A g (5'CGU) family, at least one of the minor species should Ar  correspond account  to the 5'AGA or A G G class of arginine isoacceptors and together could  for all five  correspondence their  individual  of the species  between  RPC-5  purification  peaks  detected  in vivo  and arginine  and ribonucleotide  .  To show  accepting  sequence  one  (I.C. Gillam,  of the peaks  unpublished results).  that  elutes  after  This  the major  species,  tRNAs  will  the  require  determination.  At the time of this study only one of the minor/)rosophila purified  precisely  arginine tRNA had been  tRNA4 g,  tRNA2  A r  A r  S  corresponds to  species  on RPC-5  124 Figure  21 Hybridization  to  plasmid  The upper panel shows a RPC-5 profile of total [ ^ C ]  labeled  tRNAs  from  permission).  adult  D.  of  purified  tRNAj  A r  S  DNAs. arginine  accepting  flies (taken from White et al., 1973  melanogaster  One of the minor peaks (#4)  was obtained from I.C. Gillam.  shown a filter containing dot blots of increasing bound, denatured plasmid DNAs. The filter was  concentrations (5  hybridized in a 50%  Below is  ng -25  pg)  of  formamide, 5X  SSPE solution at 4 2 ° C with purified t R N A 4 g that was 3' end labeled with [ P ] Ar  with  32  pCp.  The blots were then washed in 0.2X SSPE at 6 5 ° C and exposed to autoradiography. The plasmid (tRNA  DNAs 2  Ar  used  were (a)  pDt0.3  (tRNA  4  V a l  g ) , (c) pR12.2, (d) pR83.1, and (e) pEMBL.  Rajput et  al.,  1982), (b)  pYH48  12  ADULT (Arg)  i  NaCI(M)  1  0-70-  / min/ fractic  c  /  OO  0-65-  0-60—' V  CM i  O  0-55-  x  4  3 4  u  [\ 1  ^ 80  7 i V-/ 1 100  Fraction  v.  120  No.  a b  I  c  d e  i  0-50-  A5  • •• ••• • ••• •  1  140  126 chromatography  columns. To investigate  whether  this tRNA  is homologous to the  gene family described here, tRNA^ "*? was end labelled with 32p 1  filter  bound  pR83.1). tRNA4 hybrids (tRNA  plasmid DNAs  The results A r  S  A r  tRNA S A r  j hybridized to  coding sequences  (Figure 21B) show that hybrids form between  (pR12.2 and pR12.2  and  under stringent hybridization and washing conditions (see Methods). No  are formed to vector 2  containing  an(  DNAs  or to plasmid D N A containing both related  g , pYH48) and unrelated tRNA genes ( t R N A  This suggests  4  V a l  , pDt0.3 Rajput et al., 1982).  that t R N A 4 S is very similar to the gene products in pR12.2 but does Ar  not exclude the possibility that it is a related species  with a different anticodon.  Interestingly, of all the arginine species assayed through Drosophila it was noted that t R N A 4 S Ar  was one species  whose  abundance  development, changed slightly  between developmental stages in 4S RNA isolated from whole organisms (White et al., 1973). It will be interesting to see if t R N A 4 ^ 8 r  contains the C13 unique to the the  pDt27R genes (i.e Panel C in Figure 14) and whether this change in abundance is specific to a particular tissue (i.e. t R N A  A l a  in B. mori  as is the case for certain tRNAs in other organisms  Young et al 1986).  127 Part  IV- A  tRNA  A r  g  pseudogene  One additional plasmid  or  retrotransposon ?  (pDt72R) described in Figure 4  also contains sequences  that hybridize the t R N A g probe. Like pDt66R (R83.1) this plasmid does not contain Ar  a Bam HI site and was therefore predicted to contain another variant gene coding sequence. In addition this plasmid did not give rise to in  extracts (data not shown) and suggested it was an inactive 'pseudogene'.  Drosophila Lastly,  transcripts using  vitro  attempts to localize this 6.5  region by in situ  hybridization  kbp Hind III  indicated that  fragment to a specific polytene  the  fragment  contained, or  cross-  hybridized with, repetitive sequence located at several different sites in the genome (S.  Hayashi,  experiments  unpublished where  results).  15-20  different  fragment (data not shown). with t R N A g Ar  This  was  sized  also  observed  restriction  in  Southern blotting  fragments  hybridized  the  To further characterize pDt72R, the region of homology  was sequenced and is shown in Figure 22 (see also Appendix I)  The results confirm that t R N A g homologous sequence is present in pDt72R but Ar  does not constitute a complete tRNA gene. A single 37 bp sequence is identical to the 3'  half (positions  37-73) of the  intact  tRNA  A r  g  genes  found  elsewhere  in the  genome. In addition, at the 3' end the DNA sequence of the non-coding strand reads 5' C C A which is equivalent to the 3' sequences eucaryotic sequence which tRNA  and archaebacterial is located  together A r  tRNAs. No characteristic  downstream  suggests  that  from the  this  3'  sequence  thought  Pol III poly dT termination  end of this half-gene did not  originate  (Appendix I)  from an  authentic  g gene.  The association of tRNA-like sequences in the  added post-transcriptionally to all  structure to  act  homologous  to  of eucaryotic as  retrotransposons  replication  small  regions  primers within  for the  with repetitive sequences has precedence and retroviruses;  cellular tRNAs  are  these  elements  are  repetitive  retotransposon  or  retroviral  and  genome  128 Figure 22  Structure  of  tRNA g A r  sequence  in  pDt72R.  The sequence of pDt72R that is homologous to the predicted t R N A g A r  relative to the intact genes from other t R N A r g A  is enclosed  plasmids. The 3' CCA sequence is in  outline print and the adjacent 5' and 3' flanking sequences of pDt72R are in lower case with their 5' and 3' orientations indicated. The first dT residue in the 5' flanking sequence  replaces the G36 nucleotide of the intact genes and accounts for the loss of  the Bam HI restriction site.  129  3"  Atgtagttaaa G C AIT C G C G G C T A G  T G G C A G Go V J - « J T  A  C  tcgtacggacc  5'  130 (Dahlberg, 1980, Yuki et al., 1986, Varmus, 1988). Recently it was reported that the predicted primer binding sites (PBS) of the retrotransposons  Drosophila  mdg  1  and 412  nucleotides of a tRNA identical to the t R N A S Ar  1986). These two families of retrotransposons but  are homologous to the 3' 15  species described here (Yuki et al.,  are divergent in nucleotide  sequence  are evolutionarily related based on their identical PBS sites and homology in the  predicted tRNA  A r  reverse S  transcriptase  protein  sequence.  To test  the possibility that the  sequences in pDt72R are related to a Drosophila  retrotransposon,  the  sequences around the half gene in pDt72R were compared to the available sequences of 472  (Will et al., 1981) and mdg  detected  between pDt72R  1  (Kulgushkin et al., 1981).  and the 412  L T R sequences. In contrast,  sequence immediately adjacent to the 3' end of the t R N A S Ar  the last 6 nucleotides of the mdg pDt72R sequence  resumes  No homology was  1 5' LTR (Figure 23).  the pDt72R  half gene is identical to  After a deletion of 31 bp the  homology with the upstream mdg  1  LTR sequence and  continues up to the Eco RI site which is the end of the region of pDt72R for which sequences mdg  1  were determined. The overall difference in nucleotide sequence  and this portion of pDt72R  between  is only about 7.5% and shows that these two DNAs  are closely related to one another. The next question concerns the identity of the DNA contained in pDt72R. It has obvious similarity to the LTR of mdg pDt72R is a retrotransposon cross-hybridization  1 but this does not necessarily  mean that  itself. The repetitive nature of pDt72R could arise by  with authentic  mdg 1  elements. In fact, the genomic Southern  hybridization experiments in Part I (Figure 3) suggest that 37 bp t R N A S half gene Ar  sequences  are probably not significantly more numerous than the number of half  genes predicted from digestion of the 10 intact t R N A 8 A r  (Figure 3, lane d). This suggests  that the 37 bp t R N A § Ar  gene copies with BamHI half gene in pDt72R is  present at only one or a few copies per haploid genome. Combined with the rather  131 Figure 23 mdg  Comparison  of  pDt72R  to the D.  1. (A) The sequence of the 5' mdg  melanosaster  rEtrotranspofiQn  1 long terminal repeat (LTR I) is shown (5'-  3'from left to right) with position 1 corresponding to the first nucleotide of the 4 bp direct repeat that occurs at the junction of genomic and mdg 1  sequence  (Kulguskin  et al., 1981). The sequence of pDt72R begins at the Eco Rl site located at position 180 in the mdg 1 LTR and is aligned below themdg 1 sequence.  Identities between the  two sequences are shown by dashes and deletions are shown by asterisks. The primer binding site (PBS) of mdg fragment  1 is boxed and compared to the sequence of the t R N A g A r  found in pDt72R. The arrows  indicate the inverted repeats that occur  at  both ends of each LTR. The thin underlined sequences show the 11 bp direct repeats that  flanked the  putative ' T A T A ' retrotransposon  deleted  sequence  in pDt72R.  box of the LTR. (B) is  indicated  in  the  The  The relative diagram  (not  thick  underline indicates  the  position of the PBS within a to  scale).  The  open  boxes  correspond to LTR I and LTR II and the connecting thin line indicate the internal gene coding regions. The position of the PBS is shown by the small arrow and would correspond to a tRNA primer in the 5' to 3* orientation adjacent to the 3' end of LTR I.  132  , , ^ 60 I RTCGfrGTRGT RTRTRCGftftT RTRRTRRCftfl TRRTRRTRRT RRCRRTARTR RTRRTRRTRT 120 TftflTRRTRRT TRTRRTRTGR RTCRTRRTftfl TRftCTCBfrCT RRTRRGTRflfl CTTRGGRCCR 180 CCCTfiflTTCC TTRGGGTCRC CCTRGTRGRT CTTTRGRTRC RCCCTflflTRC TflflflTRTGQG]  EcoRI 240 iRRTTQRGGflT GTRCGCCTTT RGGGGTCGGR CTCGRCTCCC RTTGGTTRTC GRGTRRTGRR C  G  *  C  *  300 CTTCHTRCRT RCflTRTTGCfl GflOTTTGCTR GTGTCRGCflC TTGGCTGTCfl CflflGRGRTCT -G—C380 CCCTGTRGftC CRCflCTRRGfl TCRGTTRTRfl TRCRGGftflTfl GflTCRGGflflT GTRCRCTCGC -G—  RT-  -flT-  420 TTflflTRfWRfl CCRRRTRRRG RTftflfl*RTGRC C*ftoCTGCG TTTTGflGflC* TTTRTTRRCT -G-*T-  -CT-C - f l 480  RCRTCRGRftG TRTTTRGRflT TCRRflTTRRCT RCfJTGGCGR CCGTGRCRRfl GGftfrCGTTflT  ** —^rcGRRC  mdg  1  pDt72R  133 high degree of sequence divergence in the LTR-like portion of pDt72R, this suggests that  pDt72R  either  melanogaster elements.  is not a retrotransposon  or is one that  is inactive  in D .  and is not present in the high copy number seen for authentic mdg 1  A more  clear  understanding of pDt72R  sequence on the 5' side of the tRNA region.  will  require comparison of the  Homology to mdg  1 on both sides of this  PBS-like sequence would support the idea that pDt72R corresponds to an intact, but low copy number or defective However, the part  unusual structure of the PBS is one argument against pDt72R being  of an authentic  retrotransposons  retrotransposon.  retrotransposon.  or retroviruses,  In 412 , mdg  the PBS consists  1,  and most other  eucaryotic  of the terminal 11-18 nucleotides  of a corresponding tRNA (Dahlberg , 1980, and references  in Kikuchi et al., 1986).  The PBS-like sequence in pDt72R however, although identical in position relative to the LTR of mdg 1  , is 40 nt long (including the 3'CCA) and includes the entire 3' half  of the gene. The only other tRNA half gene of this kind was a mouse pseudogene which also contained the 3' C C A (Reilly et al., 1982). Drosophila  PBS sequences  include one for the mdg  3  tRNA  p h e  Other unusual  retrotransposon  which  predicts a leucine tRNA that is lacking the terminal 5 nucleotides (Saigo, 1986). The predicted primer of the copia  family of retrotransposons  is more bizarre; it consists  of the 5' half of a t R N A ^ e t that has been specifically cleaved at position 39 (Kikuchi et al., 1986) such that the 3' end of this tRNA nucleotide region adjacent different  retrotransposons  to the copia  fragment is homologous to a 15  5' LTR. Thus while the structure PBSs in  can be quite variable they  all tend to be much shorter  than the sequence in pDt72R. With incomplete data on the homology of pDt72R to mdg  1 it is difficult to account  for the origin of the half gene in pDt72R. If no further homology exists between these two sequences then the origin of pDt72R could be explained by between an intact t R N A g gene and an mdg Ar  recombination  1 element, which, followed by further  134  DNA scrambling (i.e truncation of the tRNA gene) possibly could yield a half tRNA gene fused to an mdg  1 5' LTR sequence.  exists between pDt72R and mdg  Alternatively, if more extensive homology  1 then the unusual structure of the PBS site can be  interpreted in at least two ways. The fact that the 5' end of the tRNA half gene (position  37)  containing  corresponds  tRNAs  raises  exactly  the  as  become  cleaved  a primer during mdg  transcription of mdg  1  of  two  processing  a tRNA  A r  6  sites  for  intron  molecule, which do not  at this position and then subsequently was transposition.  During  the  putative  reverse  1 RNA intermediates, this now smaller tRNA primer may have  mis-incorporated  would account  one  possibility that  contain introns, was aberrantly utilized  to  into  the  DNA genome  of  this  particular  element.  This  for the predicted low copy number and position of the t R N A  truncation. Alternatively, the half gene may represent  an ancestral  form of an  Ar  S  mdg  1 element. This also might account for the extended size of the PBS site and the sequence divergence in the LTR region. Until additional mdg possible to however  1 sequence is available for comparison to pDt72R it is not  distinguish between  that  not  all  sequences  these possibilities. This which hybridize to  represent intact genes. It also demonstrates  example  tRNA  does  probes  demonstrate will  the involvement of tRNAs in at least one  of several diverse non-protein synthetic functions (i.e Schon et al., 1986, Ciechanover,  1987).  actually  Ferber and  135  CONCLUSION  The  goal  at  and  the  PERSPECTIVES  outset  of this  study  organization of a set of t R N A 6 A r  was  to  try  to  understand the duplicated  genes found in the plasmid pDt27R. This was  attempted first by analyzing additional members of this gene family and comparing their properties in vitro , and second, by comparing the duplicated loci from closely related  species. While an explanation for these duplication events is still not clear,  several intriguing facts are now available. By comparison with closely related sibling species it is proposed that the genes have been duplicated in successive  stages over a period of several million  years.  Most recently it is proposed that the genes duplicated from 2 to four gene copies by at  least  two different mechanisms that account  for the  size difference and novel  junctions of the duplication units. In addition it appears that the rates of flanking sequence divergence were not equivalent in the duplicated sequences. This that duplication of these genes did not occur  suggests  by chance, but rather, were subject to  unknown selective pressures that resulted in multiple events occurring at the same locus.  The difference in flanking  possibility  that  mechanisms  sequence  exist  to  divergence selectively  is  curious  differentiate  and raises the  the  flanking  sequences, and in the case of tRNA genes, potential regulatory sequences, of newly duplicated gene copies. By comparison with other members of this genes family, it can now be seen that these duplicated genes  are part of a larger gene family and that they are unique  from other members of this family both in the structure of their tRNA products and the in vitro  transcription  consistent with the idea that  properties  of  the  gene  templates.  These  results  are  a specific function may be associated with these genes  and that this might be the basis for their duplication.  136 These family  differences  suggest  functional  that  sense.  not  This  genes  in  general  is  rather  to  provide  the  variants this  of  a  the  mechanisms  of  required  function  contain  To gene  in  utilizing  individual  gene  is  not  and  be  to  used  the 1  3'  to 17-18 for  end 2  the of  1982)  (i.e In  the  of  gene  this  extension  specific In  identical  turn  still  by  in  based  are  their  on  the  strains  viable  function  deficiencies  attempted  cloned  tRNA  of  (D.  of  the  would  duplicated  and  the  the  might  in  A  specific of  g  r  the  t R N A  conserved  experiments  genes  A  of  r  or  the  be  to  this  nuclear  have  been  alternatively,  family  genes,  regions  germ-line  expression  primary  the  tRNA  tRNA^yr  gene  g  by that  Drosophila  beginning  be  either  assay  t R N A  sequences  expression of  copies,  to  the  intronless  the  gene  transcripts  3'  from  long  but  co-evolve  special  such  endogenous  introns  unique  be  of  primary  case  nucleotides  any  tRNA  Drosophila  region  Whether  may  from  in  nucleotides  primer  This  them  1988).  In  that  or  a  known.  Rubin,  the  remain  in  of  development.  that  gene  product,  tRNA,  w i l l b e n e c e s s a r y to m e a s u r e the  copies  use  of in  note  12E1-2  suggests  absent.  in vivo.  gene  markers.  With  be  This  the  gene  independently  However,  over  when  sequences  oligonucleotide thus  evolve  tRNA  to  the  redundant  necessarily  order  of  organization  stages  not  may  lethal  Kubli,  do  instead  copies.  are  amount  or  but  gene  the  the  types  genes  members  family  of  in  unique  and  amount in  other  multicopy  1982)  distinguish  between  signal.  tRNA  to  might  specific  occur  that  populations  endogenous  the  flexibility  deficiencies  (Spradling  gene  that  cell  and  (Dover,  individually  Suter  approach  not  this  the  different  a n s w e r t h e s e q u e s t i o n s it  in vitro  family,  more  communication).  are  transformation  by  raise  for  individual  wild  copies  altered  of  to  genes  drive'  chromosomal  genes  maintained  needed  of  possibility  with  sequences,  personal  pDt27R  cell  duplicated  members  solely  'molecular  coding  Sinclair,  not  the  the  possibility  mature  that  all  raises  tRNA,  raises  between  poly on one  a  of gene  related  transcripts  as  14  nucleotides  dT  termination  either gene  primary  side, type  an and  transcripts.  However these regions tend to be AT rich and are shorter in other gene copies pR12.5- 10 nucleotides) and therefore would not be applicable to all members of gene  family.  138  REFERENCES: Addison, W.R., Astell, C.R., Delaney, A.D., Gillam, I.C., Hayashi, S., Miller Jr., R.M., Rajput, B., Smith, M . , Taylor, D.M., and Tener, G.M. (1982) The structures of genes hybridizing with t R N A 4 * from Drosophila melanogaster  J. Biol.Chem. 257 , 670-  Va  673. Alt,  F.W. and Baltimore,  D. (1982) Joining of immunoglobulin heavy  segments: implications from a chromosome  with evidence  chain gene  of three D-JJJ  fusions.  Proc. Natl. Acad. Sci. USA 79, 4118-4122. Arnold,  G . J. and Gross,  H.J., (1987) Unrelated  promote human tRNA gene transcription. Gene  leader  sequences can efficiently  51. 237-246.  Arnold, G.J., Schmatzler, C , Thoman, U . , van Tof, H., and Gross H.J. (1986) The human tRNA^al  gene  family:  organization,  transcription of three single copy genes  nucleotide Gene  sequences  and homologous  44 . 165-174.  Baker, R.E., Eigel, A . , Vogel, D., and Feldman, H.,(1982) Nucleotide sequences of yeast genes for t R N A 2 ^ , t R N A 2 S , and t R N A i er  Ar  of different tRNA genes EMBO Birchler,  V a l  :  homology blocks occur in vicinity  J. 1 , 291-295.  J.A., Owenby, R.K., and Jacobson, K , B . (1982)  Dosage  compensation of  serine-4 transfer RNA in Drosophila melanogaster. Genetics 102. 525-537. Bjork, G.R., Ericson,  J.U., Gustafsson,  C.E.D.,  Hagervall, T . G . , Jonsson,  Wikstrom P.M. (1987) Tranfer RNA Modification.  Ann. Rev. Biochem. 5_6_ , 263-287.  Bull, P., Thorikay, M . , Moenne, A . , Wilkens. M . , Sanchez, Venegas,  A.  transcriptional promoters.  (1987) activities  DNA  Burke, D.B and  The reveal  Yeast  tRNA  memeber  P n e  Y . H . , and  gene  differences  H . , Valenzuela, P., and  family:  structures and  not expected  by intragenic  6_, 353-362.  Soil, D. (1985) Functional analysis of fractionated  extract cell tRNA gene transcription components. J. Biol.Chem.  Drosophila Kc Cell 260 , 816-823.  139  Caccone, A., Amato, G.D., and Powell, J.R. (1988) Rates and patterns of scnDNA and mtDNA divergence  within the Drosophila melanogaster subgroup.  Genetics 118.  671-683. Carbon, P., Murgo, S., Ebel, J-P., Krol, A., Tebb, G., and Mattaj, I. W. (1987) A common octamer motif binding protein is involved in the transcription RNA polymerase III and U2 snRNA by RNA polymerase II. Cell  of U6 snRNA by  5 1 , 71-79  Cedergren, R.J., Sankoff, D., LaRue, B., and Grosjean, H. (1981) The evolving tRNA molecule. Crit. Rev. Biochem. 1_L 35-104. Chang, Y - N , Pirtle, I.L., and Pirtle, R.M. (1986) Nucleotide sequence and transcription of a human tRNA gene cluster with four genes.  Gene  48_ , 165-174.  Chang, D.D. and Clayton, D.A. (1989) Mouse RNase MRP RNA is encoded by a nuclear gene and contains  a decamer sequence complementary  mitochondrial RNA substrate. Cell  to a conserved  region of  5JL 131-139.  Choffat, Y., Suter, B., Behra, R., and Kubli, E. (1988) Pseudouridine modification in the tRNA^y  anticodon is dependant on the presence, but independant of the size and  sequence, of the intron in eucaryotic  t R N A ^ y genes. Mol. Cell. Biol, ft, 3332-3337.  Chung, J., Sussman, D.J., Zeller, R., and Leder, P. (1987) superimposed RNA polymerase II and III promoters.  The c-myc gene encodes  Cell 5_1_, 1001-1008.  Coen, E.S. and Dover, G.A. (1983) Unequal exchanges and the co-evolution of X and Y rDNA arrays in Drosophila melanogaster. Cell Cooley, L., Schaack, J., Burke, J.D.,  33. 849-855.  Thomas, B., and Soli, D. (1984) Transcription factor  binding is limited by the 5' flanking regions of Drosoph ila tRNAHis pseudogene. Mol. Cell. Biol.  tRNA  H i s  gene and a  4 , 2714-2722.  Cribbs, D. L. (1982a) Ph.D dissertation. University of British Columbia. Cribbs,  D . L . , Gillam,  I.C., Tener,  G . M . (1982b) The structure of t R N A  Drosophila melanogaster. Nucleic Acids Res. 1_Q_, 6393-6399.  5  L  y  s  from  140 Cribbs, D.L., Leung, J., Newton, C.H., Hayashi, S., Miller Jr., R . C , and Tener, G.M., (1987).  Extensive  microheterogeneity  ' melanogaster. J. Mol. Biol. Dahlberg,  J.E. (1980)  of serine  tRNA  genes  from  Drosophila  197. 397-404.  tRNAs as primers  for reverse transcriptases.  In Transfer  RNA:Biological Aspects (eds. Soli, D., Abelson, J.N., and Schimmel, P.R.) Cold Spring Harbour Laboratory,  Cold Spring Harbour, NY pp. 507-516.  de Boer H.A. and Kastelein, R.A.  (1986) Biased codon usage:  in the optimization of translation.  an exploration of its role  In Maximizing Gene Expression (Ed. Reznikoff,  W and Gold, L.) Butterworths. Stoneham, MA pp. 225-277. Defranco, D, Sharp, contained  S.,  and Soil, D. (1984)  Identification of regulatory sequences  in the 5' flanking sequence of Drosophila  tRNA2^y  s  genes. J. Biol.  Chem. 259. , 12424-12429. Defranco, D., Burke, K.B., Hayashi, S., Tener, G.M., Miller Jr., R . C , and Soli, D. (1982) Genes for tRNA5^ys f  r o m  Drosophila melanogaster.  Nucleic Acids Res. 1_0_, 5799-  5808. Dente, L., Cesareni, G., and Cortese, R. (1983) pEMBL: a new family of single stranded plasmids. Nucleic Acids Res. 1_L, 1645-1656. DeLotto, R. and Schedl, P. (1984) A Drosophila melanogaster cluster at the cytogenetic locus 90BC.  transfer R N A gene  J. Mol. Biol. 179. 587-605.  Dingermann, T., Sharp, S., Appel, B., Defranco, D., Mount, S., Helerman, R., Pongs, O., and Soil, D. (1981)  Transcription of a cloned  tRNA and 5S RNA genes in a  Drosophila cell free extract. Nucleic Acids Res. 9_ . 3907-3918. Dingermann, T., Burke, D.B., Sharp, S., Schaack, J., and Soli, D. (1982) The 5' flanking sequences of Drosophila t R N A S A r  genes control their in vitro transcription in a  Drosophila cell extract. J. Biol. Chem. 257.  14738-14744.  141 Doran, J.L., Wei, X., and Roy, K.L. (1987) Analysis of a human gene cluster coding for tRNA  p h e  and t R N A y . Gene 5_£ , 231-243. L  s  Dover, G. (1982). Molecular Drive: a cohesive mode of species evolution. Nature  299.  111-117. Dudler, R., Egg, A . H . , Kubli, E., Artavanis-Tskonas, S., Gehring, W.J., Steward, R., and Schedl P. (1980) Transfer RNA genes of Drosophila melanogaster.  Nucleic Acids  Res. & , 2921-2936. Dunn, R., Delaney, A.D., Gillam, I.C., Hayashi, S., Tener, G.M., Grigliatti, T., Misra, V., Spurr,  M . G . , Taylor,  D . M . , and Miller  characterization of recombinant  Jr.,  DNA plasmids  R . C . (1979a)  carrying  Isolation  and  Drosophila tRNA genes.  Gene 1 , 197-215. Dunn, R., Hayashi, S., Gillam, I.C., Delaney, A.D., Tener, G.M., Grigliatti, T.A., Kaufman, T.C., and Suzuki, D.T. (1979b) Genes in Drosophila melanogaster. J. Mol. Biol.  coding for valine transfer ribonucleic acid-3b 128. 277-287.  Elder, R., Szabo, P., and Uhlenbeck, O. (1980). 4S gene organization melanogaster .  in Drosophila  In Transfer RNA:Biological Aspects (eds. Soli, D., Abelson, J.N.,  Schimmel, P.R.) Cold Spring Harbour Laboratory,  Cold  Spring Harbour,  N Y pp.  317-323. England, T.E., and Uhlenbeck, O.C. (1978) 3" terminal labelling of RNA with T4 RNA ligase.  Nature  275. 560-561.  Ferber, S. and Ciechanover, by the ubiquitin pathway.  A. (1987) Role of arginine -tRNA in protein Nature 326. 808-811.  Folk, W.R. and Hofstetter, H. (1983) A detailed mutational tRNA!  M e t  degradation  analysis of the eucaryotic  gene promoter. Cell 3_3_, 585-593.  Frendewey, D., Dingermann, T., Cooley, L., and Soli, D. (1985) Processing of precursor tRNAs in Drosophila: processing  of the 3' end involves an endonucleolytic clevage  and occurs after 5' end maturation. J. Biol. Chem.  260 , 449-454.  142  Garel, J.P. (1982) The silkworm, a model for the molecular and cellular biologists. Trends Biochem. Sci. 3_, 105-108. Geiduschek  E.P. and Tocchini-Valentini,  polymerase III.  Ann. Rev. Biochem.  G.P. (1988)  Transcription  by R N A  5J_ , 873-914.  Glew, L., Lo, R., Reece, T., Nichols, M . , Soil, D., and Bell, J. (1986) The nucleotide sequence,  localization and transcriptional  properties  of a t R N A  L e u  (CUG) gene  from Drosophila melanogaster . Gene 44, 307-314. Gouilloud, E. and Clarkson, S.G., (1986)  A dispersed tyrosine tRNA gene from Xenopus  laevis with high transcriptional activity in Vitro  J. Biol.Chem.  261. 486-494.  Grunstein, M . and Hogness, D. (1975) Colony hybridization: a method for isolation of cloned DNAs that contain a specific gene. Guthrie, C. and  Proc. Natl. Acad. Sci.  USA 7JL 3961-3965.  Abelson, J. (1982) Organization and expression of tRNA genes in  Saccharomyces cerevisiae  in The molecular biology of yeast S accharomyces:  metabolism and gene expression (Ed. Strathern J.N, Jones E.W., and Broach, J.R. ) Cold Spring Harbour Laboratory, Cold Spring Harbour. N Y pp. 487-528. Hanahan, D. (1983). Studies on transformation of Escherichia coli  J. Mol. Biol.  166.  557-580. Hansen, L.J., Chalker, D.L., and Sandmeyer, S.B. (1988) Ty3, a yeast retrotransposon associated with tRNA genes, has homology to animal retroviruses. Mol. Cel. Biol.  8_,  5245-5256. Hatlen, L. and Attardi, G . (1971) Proportion of the HeLa cell genome complementary to transfer RNA and 5S RNA. J. Mol. Biol. i £ , 535-553. Hattori,  M . and Sakaki, Y. (1986)  plasmid templates. Anal. Biochem.  Dideoxy sequencing 152. 232-238.  method  using  denatured  143 Hayashi, S., Gillam, I.C., Delaney, A.D., Dunn, R., Tener, G . M . , Grigliatti, T . A . , and Suzuki, D.T. (1980) Hybridization of tRNAs of Drosophila melanogaster to polytene chromosomes. Chromosoma 7_6_, 65-84. Hayashi, S., Gillam, L C , Grigliatti, T.A., and Tener, G.M. (1982) Localization of tRNA genes of Drosophila melanogaster by in situ  hybridization. Chromosoma  8_6_, 279-  292. Hedgcoth, C , Hayenga, K., Harrison, M . , and Ortwerth, B.J. (1984) Lysine tRNAs from rat  liver:  lysine tRNA  sequences are highly conserved.  Nucleic Acids Res. 12.  2535-2541. Hershey, P.D. and Davidson, N. (1980) Two Drosophila melanogaster tRNA^iy genes are contained in a direct duplication at chromosomal  locus 56F. Nucleic Acids Res.  i , 4899-4910. Hofstetter,  H . , Kressman,  A . , and Birnsteil,  M . L . (1981)  A split  promoter for a  eucaryotic tRNA gene. Cell 24, 573-585. Hosbach,  H . A . , Silberklang,  melanogaster  M . , and McCarthy,  glutamate tRNA gene cluster. Cell  Hottinger-Werben,  Huibregtse,  Acids Res. i i ,  J.M., Evans,  transcription  Evolution  of a D ^  2JL , 169-178.  A . , Schaack, J., Mao, J.I. Nichols, M . , and Soli, D. (1985) Dimeric  tRNA gene arrangement in S_. pombe gene. Nucleic  B.J. (1980)  allows  increased expression of downstream  8739-8747.  C.F., and Engelke, D.R. (1987) Comparison of tRNA gene  complexes formed  in vitro  and in nuclei.  Mol. Cell. Biol.  7_i 3212-  3220. Ikemura,  T. (1985) Codon usage and tRNA content in unicellular and multicellular  organisms.  Mol. Biol. Evol. 2 , 13-34.  Indik, Z.K. and Tartof, I. (1982) Glutamate tRNA genes are adjacent to 5S RNA genes in Drosophila and reveal a conserved Acids Res. 10 , 4159-4172.  upstream sequence (the A C T - T A  box). Nucleic  144  Inouye, S., Saigo, K., Yamada, K., and Kuchino, Y. (1986) Identification and nucleotide sequence  determination of a potential primer tRNA for reverse transcription of a  Drosophila  retrotransposon, 297. Nucleic Acids. Res. 14 , 3031-3043.  Jamrich, M . and Miller, O.L. (1984) The rare transcripts of interrupted rRNA genes in Drosophila melanogaster  are processed or degraded during synthesis.  EMBO  J. 3_,  1541-1545. Kikuchi,  Y., Ando,  Y., and Shiba, T. (1986) Unusal priming mechanism of RNA  directed DNA synthesis in copia 312.  retrovirus-like particles of Drosophila. Nature  824-826.  Kondo, K., Hodgkin, J., and Waterston, tRNA^rp  R.H. (1988) Differential expression of five  (TJAG) amber suppressors in Caenorhabditis elegans. Mol. Cell. Biol. 8_,  3627-3635. Koski, R.A., Clarkson, S.G., Kurjan, J., Hall, B.D., and Smith, M .  (1980) Mutations of the  yeast SUP4 tRNA^yr locus: transcription of the mutant gene in vitro Cell 2 2 . 415425. Kubli, E. (1982) The genetics of transfer RNA in Drosophila. Adv. Genet. 21 , 123-172. Kurjan, J., Hall, B.D., Gillam, S., and Smith, M . (1980) Mutations at the yeast SUP4 tRNA^yr  locus: DNA sequence  changes  in mutants  lacking suppressor  activity.  Cell 20., 701-709. Kulgushkin, element  V . V . , Ilyin.Y.V.,  and Georgiev, G.P. (1981)  MDG 1 of Drosophila melanogaster:  Mobile  dispersed  genetic  nucleotide sequence of long terminal  repeats. Nucleic Acids Res. 9_ , 3451-3464. Kunkel, G.R., Maser, R.L, Calvet, J.P. and Pederson, T. (1986) U6 small nuclear RNA is transcribed by RNA polymerase III. Proc. Nat'l. Acad. Sci. USA  8_3_ , 8575-8579  145 Krupp, G. and Gross, H. (1983) Sequence analysis of in vitro 32p_i  auC  i j RNA. In The C(  modified nucleosides of transfer RNA II. (eds. Agris, P.F. and Kopper, R.A.) Alan R. Liss Inc., New York. NY pp. 11-58. Larsen,  T . M . , Miller Jr., R . C , Speigelman,  G.B., Hayashi, S., Tener,  G . M . , Sinclair,  D.A.R., and Grigliatti, T.A., (1982) RNA:DNA hybridization analysis of tRNA3bVal in Drosophila melanogaster . Mol. Gen. Genet.  185. 390-396.  Lassar, A. B., Martin, P.L., and Roeder, R.G. (1983) Transcription of class III genes: formation of preinitiation complexes .  Science  222 , 740-748.  Leung, J. (1988) Ph.D dissertation. University of British Columbia. Leung, J., Addison, W.R., Delaney, A.D., MacKay, R.M., Miller Jr., R.M., Speigelman, G.B., Grigliatti, T.A., and Tener, G.M. (1984) Drosophila melanogaster  tRNA3  D  V a l  genes and their allogenes. Gene 3_4 , 207-217. L i , W-H. (1983) Evolution of duplicate genes and pseudogenes. In Evolution of genes and proteins,  (eds. Nei, M . and Koehn, R.K.) Sinauer Associates Inc., Sunderland,  M A . pp. 15-37. Lin, F.-K.,  Furr, T.D., Chang, S.H., Horwitz, J., Agris, P.F., and Ortwerth, B.J. (1980) The  nucleotide  sequence of two bovine lens phenylalanine tRNAs. J. Biol. Chem.  255.  6020-6023. Lin,  V . K . and Agris, P.F. (1980) Alterations  erythroid differentiation  in tRNA isoaccepting species during  of the Fiend leukemia cell. Nucleic  Acids Res. 8_, 3467-  3489. Lo,  R.Y.C,  Bell,  J.B., and Roy, K . L . (1982)  Saccharomyces cerevisiae. Lofquist,  A. and Sharp,  melanogaster  tRNA5  Chem. 26J. , 14600-14606.  tRNAs in  Nucleic Acids Res. 1Q_, 889-902.  S, (1986) A s n  Dihydrouridine-deficient  The 5'  genes differentially  flanking  sequences  of  Drosophila  arrest RNA polymerase III. J. Biol.  146 Long, E. and Dawid, I. (1980) Repeated genes in eucaryotes. Ann. rev. Biochem.  49.  727-764. Looney, J.E. and Harding, J.D. (1983) Structure and evolution of a mouse tRNA gene cluster encoding  tRNA P, As  t R N A y , and t R N A G1  encoding t R N A P . Nucleic Acids Res. 11, As  G l u  and an unlinked, solitary gene  8761-8776.  Ma, D.P., Lund, E., Dahlberg, J.E., and Roe, B.A., (1984) Nucleotide sequences of two regions of the human genome containing t R N A  A s n  genes. Gene 2JL , 257-262.  Makowski, D.R., Haas, R.A., Dolan, K.P., and Grunberger, D. (1983) Molecular cloning, sequence  analysis  Acids Res. H ,  and  in vitro  expression of a rat  tRNA  gene cluster. Nucleic  8609-8620.  Maniatis, T., Fritsch, E.F., and Sambrook, J., (1982) Molecular cloning. A laboratory manual.  Cold Spring Harbour Laboratory,  Cold Spring Harbour,  Martin, C.H., and Meyerowitz, E . M . (1986) Characterization adjacent rapidly and slowly evolving genomic  NY.  of the boundries between  regions in Drosophila . Proc. Natl.  Acad. Sci. USA £3_, 8654-8658. Marschalek,  R. and Dingermann, T. (1988) Identification  of a protein factor binding  to the 5' flanking region of a tRNA gene and being involved in modulation of tRNA gene transcription  in vivo in Saccharomyces cerevisiae. Nucleic Acids Res.  16_, 6737-6752. Maxam, A . M . and Gilbert, W. (1980). Sequencing end-labeled DNA with chemical  cleavages.  In  Methods  in Enzymology.  65.  (eds.  base-specific  Grossman,  L. and  Moldave K.) Academic Press, New York, NY pp. 499-580. Mattaj, I.W., Dathan, N.A., Parry, H.D., Carbon, P., and Krol, A. (1988) Changing the RNA polymerase specificity of U snRNA gene promoters. Cell 5_5_, 435-442. Melton, D.A., Kreig, P.A., Rebagliati, A.J., Maniatis, T., Zinn, K., and Green, M.R. (1984) Efficient  in vitro  synthesis of  biologically  active RNA and  RNA hybridization  147  probes from plasmids containing bacteriophage  SP6 promoter. Nucleic. Acids Res.  12, 7035-7056. Meng, Y.B., Stevens, R.D., Chia, S., McGill, S., and Ashburner, M . (1988) Five glycyl tRNA genes within the noc  gene complex of Drosophila melanogaster.  Nucleic  Acids Res. 16_, 7189. Miller,  J.  H . (1972)  Experiments  in molecular  genetics.  Cold  Spring  Harbour  Laboratory, Cold Spring Harbour, NY. Moore,  G.P. (1983)  Slipped-mispairing  and the evolution  of introns. Trends.  Biochem. Sci. 4, 411-414. Morry, M.J. and Harding, J.D. (1986) Modulation of transcriptional activity and stable complex formation by 5' flanking regions of mouse t R N A ^  ls  genes.  Mol. Cell. Biol.  6_, 105-115. Muller, F. and Clarkson, S.G. (1980) Nucleotide sequence of genes coding for t R N A and t R N A y T  r  p h e  from a repeating unit of X . laevis DNA. Cell 12, 345-353.  Munz, P., Amstutz,  J., Kohli,  J., and Leopold, U . (1982) Recombination between  dispersed serine tRNA genes in Schizosaccharomyces pombe . Nature  300 , 225-  231. Murphy, S., Di Liegro, C , and Melli, M . (1987) The in vitro transcription of the 7SK RNA  gene  by R N A polymerase I I I  upstream promoter. Cell  is dependant only  on the presence  of an  5_1_, 81-87.  Naylor, S.L., Sakaguchi, A.Y., Shows, T.B., Grzeschik, K.-H., Holmes, M . , and Zasloff, M. (1983)  Two non-allelic  tRNAj  M e t  genes are located in the p23-ql2  region of  human chromosome 6. Proc. Natl. Acad. Sci. USA 8J1 , 5027-5031. Newman, A.J., Ogden, R . C , and Abelson, J. (1983) tRNA gene transcription in yeast: effects of base substitutions in the intragenic promoter. Cell 35., 117-125.  148 Otto, E., Young, J.E., and Maroni, G. (1986) Structure and expression  of a tandem  duplication of the Drosophila metallothionein gene. Proc. Natl. Acad, Sci. USA 83. 6025-6029. Petes,  T . D . (1980)  Unequal meiotic  ribosomal DNA genes. Cell Pirtle,  I.L., Shortridge,  recombination  within tandem  arrays  of yeast  L9_, 765-774.  R.D., and Pirtle,  R . M . (1986)  transcription of a human glycl t R N A c c c ^ l y  Nucleotide  sequence and  gene and nearby pseudogene. Gene  11 , 155-167. Rajput, B., Duncan, L . , Demille, D., Miller Jr., R . C , and Speigelman, G.B. (1982) Transcription  of  cloned  transfer  R N A genes  from  P_,_ m e l a n o g a s t e r  in a  homologous cell free extract. Nucleic Acids Res. 1Q_ , 6541-6550. Raymond, G.J. and Johnson, J.D. (1983) The role of non-coding DNA sequences in transcription and processing of a yeast tRNA. Nucleic Acids Res. 11, 5969-5988. Raymond,  G.J., and Johnson,  tRNA3^  J.D., (1987)  The 5'  flanking sequences from  stable pre-initiation  Raymond, K . C , Raymond, G.J., and Johnson, J.D. (1985) In vivo  modulation of yeast  complexes.  genes enhances the rate of transcription  of yeast  e u  Nucleic Acids Res. L i , 9881-9894.  tRNA gene expression by 5' flanking sequence. EMBO  J.  4_» 2649-2656.  Reilly, J.G, Ogden, R., and Rossi, J.J. (1982) Isolation of a mouse pseudo tRNA gene encoding C C A - possible example of reverse flow of genetic information. Nature 300. 287-289. Rich,  A.  and RajBhandary, U.L. (1976) Transfer RNA: Molecular structure, sequence  and properties. Ann. Rev. Biochem. 45_ , 806-861. Rigby,  P.W., Dieckmann,  deoxyribonucleic  J . M . , Rhodes,  acid to high specific  C,  activity  DNA polymerase I. J. Mol. Biol. I l l , 237-251.  and Berg, in vitro  P.  (1976).  Labelling  by nick translation with  149 Ritossa,  F . M . , Atwood, K . C . , Lindsley, D . L . , and Speigelman,  redundancy  of DNA complementary  S. (1966). On the  to amino acid transfer RNA and its absence  from the nucleolus organizer region of Drosophila melanogaster  Genetics 54. 663-  ' 676. Robinson, R.R. and Davidson, N. (1981) Analysis of a Drosophila tRNA gene cluster: two t R N A L  e u  genes contain intervening sequences. Cell  21 , 251-259.  Rooney, R.J. and Harding, J.D. (1988) Transcriptional activity and factor binding are stimulated  by separate and distinct  sequences in the 5' flanking sequences of a  mouse t R N A P gene. Nucleic Acids Res. 16., 2509-2521. As  Roth,  D.B., Porter, T . N . , and Wilson, J.H. (1985) Mechanisms  recombination in mammalian cells. Rothstein,  R.J., Esposito,  Mol. Cell. Biol.  R.E., and Esposito,  of nonhomologous  5_, 2599-2607.  M.S. (1977)  The effect  of ochre  suppression on meiosis and ascospore formation in Saccharomvces Genetics 8_5_, 35-54. Rubin, G . M . and Spradling, A . C . (1982) Genetic transformation transposable element vectors. Science  of Drosophila with  218 , 348-353.  Saigo, K. (1986) A potential primer for reverse transcription of mgd 3 copia -like element,  is a leucine tRNA  , a Drosophila  lacking its 3' terminal 5 bases. Nucleic  Acids Res. 14 , 4370. Sajjadi, F.G., Miller Jr., R . C , and Speigelman, G.B. (1987) Identification of sequences in the 5' flanking region of a D r o s o p h i l a melanogaster  t R N A 4 ^ ' gene that a  modulate its transcription in vitro. Molec. Gen. Genet. 206. 279-284. Sajjadi, F . G . and Speigelman, G.B. (1989) The modulatory transcription  of a Drosophila  tRNA4^al  gene  complex stability. Nucleic Acids Res. 17. 755-766.  without  element  TNNCT  affecting  affects  transcription  150 Saluz, H., Dudler.R., Schmidt, T., and Kubli, E. (1988) Localization and estimated copy number of Drosophila melanogaster U l , U4, U5, and U6 sn RNA genes. Nucleic Acids Res. 16_, 1203. Sanger,  F., Nicklen,  S., and Coulson, A.R. (1977)  D N A sequencing  with  chain  terminating inhibitors. Proc. Natl. Acad. Sci. USA J4 , 5463-5467. Santos,  T . and Zasloff, M . (1981)  A comparative analysis  segments bearing nonallelic dispersed t R N A j  M e t  of human  chromosomal  genes. Cell 23. , 699-709.  Schaack, J. and Soil, D., (1985) Transcription of a t R N A S gene in yeast extract; 5' Ar  flanking  sequence  Nucleic Acids Res.  dependence  for  transcription  in  a  heterologous  system.  11 ,2803- 2813.  Schaack, J., Sharp, S., Dingermann, T., Burke, D. J., Cooley, L., and Soil, D. (1984) The extent of a eucaryotic tRNA gene;  5' and 3' flanking sequence dependence for  transcription and stable complex formation.  J. Biol. Chem.  259 , 1461-1467.  Schaack, J., Sharp, S., Dingermann, T., and Soil, D. (1983) Transcription of eucaryotic tRNA genes II. Formation of stable complexes. J. Biol. Chem. Schimke, R.T. (1984) Gene amplification in cultured animal cells.  258 , 2447-2453. Cell  3_7_, 705-713.  Schon, A . . , Krupp, G . , Lowe, S., B-., Kannangara, C.G., and Soli, D. (1986) The RNA required  in the first  step of chlorophyll biosynthesis  is a chloroplast  glutamate  tRNA. Nature 322, 281-284. Sharp, S., DeFranco, D., Silberklang, M . , Hosbach, H.A., Schmidt, T., Kubli, E., Gergen, J.P., Wensink, P.C., and Soli, D. (1981) The initiator tRNA genes of Drosophila melanogaster: evidence for a tRNA pseudogene. Nucleic Acids Res. 9_ , 5867-5882. Sharp,  S., Schaack,  J.,  Cooley,  L . , Burke,  transcription of eucaryotic tRNA genes Press, Florida 19_, 107-144.  D.J., Soli,  Crit. Rev. Biochem.  D. (1985)  Structure and  (ed. Fasman, G.D.) CRC  151 Sharp,  S., DeFranco,  control  regions  D., Dingermann, T., Farrell,  for transcription  P., and Soli,  D. (1981)  of eucaryotic tRNA genes. Proc.  Internal  Natl. Acad. Sci.  USA 2ft, 6657-6661. Sharp, S., Dingermann, T., Schaack, J . , and Soli, D. (1983) Transcription of eucaryotic tRNA genes in vitro  1: analysis of control regions using a competetion  assay. J.  Biol. Chem. 25ft , 2440-2446. Sharp, S., Garcia, A . , Cooley, L., and Soli, D. (1984) Transcriptionally inactive  active and  gene repeats within the D. melanogaster 5S RNA gene cluster. Nucleic  Acids. Res. 12, 7617-7632. Shibuya, K., Noguchi, S., Nishimura, T., and Sekiyu, S. (1982) Characterization of a rat tRNA gene cluster containing the genes for t R N A P , t R N A y , and t R N A As  pseudogenes.  G1  G l u  , and  Nucleic Acids Res. 1Q_ , 4441-4448.  Silverman, S.O., Schmidt, O., Soil, D. Hoveman, B. (1979). The nucleotide sequence of a cloned arginine tRNA gene and its in vitro  transcription in Xenopus  germinal  vesicle extracts. J. Biol. Chem. 254. 10290-10294. Sollner-Webb, B. (1988) Surprises in polymerase III transcription. Cell. 5_2, 153-154. Southern,  E . M . (1975).  Detection  of specific  separated by gel electrophoresis. J . Mol. Biol.  sequences  among  D N A fragments  9_ft, 503-517.  Spradling, A . C . and Rubin, G . M . (1981) Drosophila  genome organization:  conserved  and dynamic aspects. Ann. Rev. Genet. _L5_, 219-264. Sprinzel,  M . , Hartman, T., Meissner, F., Moll,  J . , and Vorderwulbecke, T. (1987).  Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 1!, r53-rl88. St. Louis, D.C. and Speigelman, G.B. (1985) tRNA^  e r  genes from Drosophila melanogaster.  Steady-state kinetic analysis of cloned Eur. J. Biochem.  148. 305-313.  Stark, G.R. and Wahl, G.M. (1984) Gene amplification. Ann. Rev. Biochem.  5_3_, 447-491.  152 Steffenson, D . M . , and Wimber, D.E. (1971) Localization of tRNA genes in salivary chromosomes of Drosophila by RNA:DNA hybridization. Genetics Stephens,  J.C., and Nei, M . (1985)  Phylogenetic  analysis  6_9_, 163-178.  of polymorphic  sequences at the A D H locus in Drosophila melanogaster  DNA  and its sibling species.  J.Mol. Evol. 22, 289-300. Suter, B. and Kubli, E. (1988) t R N A y T  r  genes of Drosophila melanogaster:  of single-copy genes studied by SI mapping. Mol. Cell. Biol.  Expression  8_ , 3322-3331.  Underwood, D . C , Knickerbocker, H . , Gardner, G . , Condliffe, D.P., and Sprague, K.U. (1988) Silkgland  specific  tRNAs  are tightly  clustered  in the silkworm genome.  Mol. Cell. Biol. 8_, 5504-5512. Varmus, H. (1988) Retroviruses.  Science  240. , 1427-1434.  Weber, L. and Berger, E. (1976) Base sequence complexity of the stable RNA species of Drosophila melanogaster . Biochemistry Weiner,  1_5_, 5511-5519.  A . M . , Deininger, P.L., and Efstradiadis,  genes,  pseudogenes,  and transposable  elements  genetic information. Ann. Rev. Biochem..  A . (1986) generated  Nonviral  retroposons:  by the reverse flow of  5_5_, 631-661.  White, B.N., Tener, G.M., Holden, J., and Suzuki, D.T. (1973)  Analysis of tRNAs during  development of Drosophila . Dev. Biol. 3JL , 185-195. Whoriskey, S.K., Ngheim, V.-H., Genetic  rearrangements  Leong, P.-M., Mason, J.-M., and Miller, J.H. (1987)  and gene  sequences at the junctures of amplified Will,  amplification  in E s c h e r i c h i a c o l i : D N A  gene fusions. Genes and Dev.  1, 227-237.  B. M . , Bayev, A . A . , and Finnegan, D. J. (1981) Nucleotide sequence  terminal similarity  repeats of 412 transposable to  proviral  long  elements  terminal  repeats  of the  of Drosophila melanogaster: A and its  mechanism of transposition. J. Mol. Biol. 153. 897-915.  implications  for the  153 Yanisch-Perron,  C , Vieira, J. and Messing, J. (1985) Improved  M13 phage cloning  vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 21, 103-119. Yen, P.H. and Davidson, N. (1980) The gross anatomy of a tRNA gene cluster at region 42A of a D. melanogaster chromosome. Young  , L.S., Takahashi, N.,  distinctive tRNA Yuki,  A , a  transcription  Cell  and Sprague,  properties  on  22. , 137-148. K. (1986) Upstream genes  encoding  sequences confer  silkgland  specific  Nucleotide  sequence  . Proc. Natl. Acad. Sci. USA 8J. , 374-378.  S., Inouye,  characterization  S., Ishimura,  of a Drosophila  S., and Saigo,  K. (1986)  retrotransposon, 412.  Eur. J. Biochem.  158 , 403-  410. Zasloff,  M . Santos,  precursor  T., Romeo,  processing  of  P., and Rosenberg,  normal  and mutant  M . (1982)  human  Transcription and  tRNAjMet  genes in a  homologous cell-free system. J. Biol. Chem. 257. 7857-7863. Zoller,  M.J. and Smith, M . (1983) Oligonucleotide mutagenesis  cloned into M13 vectors. In  Methods in Enzymology.  Moldave, K.) Academic Press, New York, NY.  of DNA fragments  100. (eds. Grossman, L. and  pp. 468-500.  Zweibel, L.J., Cohn, V . H . , Wright, D.R., and Moore, G.P. (1982) Evolution of single-copy DNA and the ADH gene in seven Drosophilids. J. Mol. Evol.  62-71.  154  APPENDIX  The nucleotide sequence The sequences coding regions pDt72R  A r  were determined on both strands determined  The gene coding regions  from multiple determinations.  only on one  strand  The R12.5  gene in pDtl7R begins  downstream begins at position 572. The R85.1 1299.  The R83.1  gene begins at position 153.  begins at position 350.  but with unambiguous gel  gene in pDt67R begins at  at position 223;  the  serine gene  gene in pDt66R begins at position 142.  gene in pDt85C begins at position 245;  The R12.6  The  are underlined and in all cases show the non-  coding strand (= tRNA sequence) from 5* to 3'. The R19.1 position 586.  genes are shown.  were determined as described in the Methods. In most cases the gene  half gene was  readings.  of the plasmids containing the t R N A g  the R85.2 gene begins at position  The half gene sequence  in pDt72R  O CM  1U  < < <  O  •C CM  CJ  < <  CJ  o < <  < < cj <  l-  CJ  't  CJ  O 1o o  CJ CJ  CJ  o O  co  CJ  O u •<r C J CJ  «5  o o  CJ  —  < < o  < CJ o  hh-  CJ  <  <  <  CJ  <  CJ  < <  < < 1-  < <  CJ  ow CJ (-  1a o o to o o  O  (-  1t<t  o  o o o t-  o  <  t1-  tCJ  o »<  tCJ o  CJ  t-  (CJ  t1t< o 1o < <  o  (J O  (-  CO 1 CO C J o CJ  o o o t1-  <  CJ CJ  o 1((-  <  CJ  lO O i n ho 1o o o O  CJ CJ  1CJ  CJ CJ  (-  < <  1-  <  «J  o  h-  CJ  CJ  1-  <  CJ  CJ  o  < < 1o o 0)  CJ  <  t< CJ CJ  <  a H  (-  1-  CJ  tO (co i t~ 1— 1-  CJ  o tco <  CO  CJ  < < CJ < o CJ  CJ  < CJ  o  <  «t  o  lCJ 1(-  < < < 1CJ  < CJ < o CJ  CJ  1-  CJ  CJ  11CJ  O 1c» o 0) C J  CJ CJ  CJ  o  < o  CJ  (-  CJ  o < 1 <  < CJ  CJ  < < < o < < < o CJ  tl<  o  < <  11o  a CJ  CJ  o  1<t  o  o o 1-  CJ  CJ  f-  o  < < < < 1-  1-  o  <  CJ  0)  <  o  (0oK  CM <  CJ CJ  1-  CM t -  CJ  11lo o  CJ  CJ  O  < < < <  a  CJ  CJ  <  < < t-  «t  a  >~  CJ  < < t-  < <  h~  <  CJ  CJ  < < o o (-  CO 1 t~ CO (-  CJ  1o t-  o o o  o  <  1-  o  <o  CJ  •<r < CO <  l-  ••" <  < < <  <  o  <  o o 1H  CJ  o o o  CJ CJ  <  1-  t-  < <  UJ  o  »CJ  <  CJ  <  o  to d  113 to o 1o o O 1TT (-  a  J—  < < < CJ  CJ  CJ  o  o  <  o o o 1-  CJ CJ  CJ CJ  o  <  a  o CO <  o o  CJ  O CJ CM C J in i 1-  1-  <D O o 1-  H  <  < < <  «£> <  CJ  CJ  CJ  O  o o  tC3  o  h-  <  o  \-  CO (N  CJ  <  <  11«t  CJ  CJ  <  CJ  \~  t1O 1-  < < to < o  1<t t-  o < <  in  H  O  o  \\-  <  T  1o  1t-  CM  1-  1-  CJ  o ca  O  I<-  <  H  <  CJ  1-  o  <  <  <  CJ  < CJ  CJ CJ  CJ  o  t-  <  o <o  d  t-  1-  <  (o 1-  CJ  O  CJ  t1-  1  < o  CJ  o  <  CJ CJ  <  o o  111-  (-  CJ  <  o o o  CJ  y-  CJ  <  t11t-  C3  1o  <S  UJ  1-  o  CJ  o 1-  O CJ CO t-  <  CJ  <  yt1-  <  1-  o  CJ  o  f< <  CJ  CJ  tO h(O < ~- o  CJ  CJ  t< o < o < o  <  <  o o <  <  a o  <  CJ  i n t1-  CJ  tt-  <  ho  o  UJ  CM <t  00 ( -  o I-  1o  CJ  — f-  o <  CJ  <  CJ < <. CJ CJ  CJ  < < <  < < 1-  < o  O <t  <  o o t-  1-  O 1<o t -  CJ  CJ  <  <  t(-  o  <  (-  <  <  <  < •-  <  <  CJ  CJ  1t-  CJ  <  CJ  CJ  <  <  <  CO  <  o o o (t-  O O O 1t- C J  CJ  o (-  •<»  <  1o  < o o t(t-  <  in  1-  CJ CJ  <  o 1o 1-  00  < < o  o  <  < < <  o  O  CD  1-  ^t< t-  CJ  o  h- o <  CJ  1t-  CJ  th-  (o a  CM  <  f-  o t  O  t~ t- C O Ct-J < CJ < < CJ < CJ < < o CJ o  o  < o  o < < < CJ o <  o <  o o 1-  o o  (-  t-  <  K  o  t-  CM  CJ  o o  CJ  o  H-  CJ  1-  < tto o  o o o  <  o  c> y~  CJ  CJ  CJ  CJ  o •< a  O t<o a •a- o  to  o < tCV  CJ  COC J <  1-  a o  a o <  o  CJ  (t-  CJ  1-  O kt-  <J  o o CJ o  CJ  <  CJ  CM  <  t~ t-  < <  O  <  <  UJ  CJ  o  *~  (<  o<  CJ  CJ  o  (0  CJ  1-  9 5<  t(1—  o  t1-  1(-  <  CJ  CJ  t— t— < o  < 1u  <  tt— CJ t—  o  < t~ o  <  CJ  <N hh-  t-  o t1-  CJ  CJ  t-  o o  a)  t-  <  CM  o o < o  H  CJ  tt— o  CJ CJ  O  (-  <D  CO CJ  O  CJ  CJ  O  CO CJ  u  <  o < O O o — < o < o  lf-  O  < < CJ  co < co C J  CJ  o  < f-  o < CO <J 0)  < CJ  < CJ  CJ  t-  < < < CJ  < < o CJ  1-  o CJ  o  CJ  <  1O  CJ  1-  f~ CJ  01 t -  <  1-  < CJ 1t(-  pDt17R 20 40 60 80 100 120 ATTCCCGATTTTACGCAGTGCGTGCGTGTTTAACGCATGATATTACGTGGCTCTTCTATTAGCGACGCACTATTAACTGTTAAACTATTGACCATATAGCTGCCATTTGATTGGGGTGTC 140 1G0 180 200 220 240 TT ATGTGCGGTAATGACTTCTTTTCCTTTTGTATCCTTTTATGCTCGAGTCCCTGCTCAGCTAGTTGCTTTTCTTGGCAACTTAAGCCACGTTTAAACAACTGACCGTGTGGCCTAATGG 260 280 300 320 340 360 ATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAATCCTGTCACGGTCGTACAAATCCCTTTTTGTTATCTTCCAAACTTTTTGGCTTTCATTTTTGAACAGTTTACAGCTAAA 380 400 420 440 460 480 TGCGGTGTGTGTATATATTTGGGTTTTCTAATTGCTTAGACATTTCTAGTATGTTAATCCTTTTATTATCCTTCAATGGATATTTCAATATTGGCAATAATTATTGTAGCATCATTTGAT 500 520 „ 540 560 580 600 AGTTACAAATTATGTAAATTTTAGCGACAGTGGAAAAGTAAAAGTGCTCGGACTTTCCAAGTACGTAATTTAACACCAGCTATAACAAGAAGCAGTCGTGGCCGAGTGGTTAAGGCGTCT 620 640 660 680 700 720 GACTCGAAATCAGATTCCCTTTGGGAGCGTAGGTTCGAATCTACCGGCTGCGAATCGAATCCAATTTTTTACACTTTGCATGAGCTACCATATTTTTATGTGCGCCTCAATTAAACTTGA 730 TGACAAACCAAAGTCC  pDt66R 20 40 60 80 100 120 AAGCTTATGCCGGCAAGGGTGGTTTTTACTGCCACATCCTGGGAGGTGGAGGTGTCAGGATGCGAAAGTGTGGTGAAAGTATGTCCTGGGAGTACCCATTTTGAGCTTTATAGGGCAGGG 140 160 180 200 220 240 ACAAACGGGACGTTTCAACCGGACCGTGTGGCCTAAAGGATAAGGCGTCGGACTTCGAATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCGATTTAACGGCTGAATGCATTTTTTGC 260 280 300 320 340 360 ACCGACTGGCTTGTTTAAACTTCTCTAGTTACTACCCTCGTATGGTTTGCGTACTCAGAAACTCATCTTGTTTGTTTTGAAACACAATAAAAACCAGTTTCTTTCGACTCTGTGGCAACG 380 400 420 440 460 480 CAAAATGCAAAATCAATTAGGTATGGAAAAAAAGACAACTGAGCAACCGAAAACCGATTGGATCGACCACTGGTAATGAATATCCAGCAGATATCTCGTCTTCTCCAATGCTTCTAAATA 500 520 540 560 ' 580 600 TCAAATGTCCACTATAAGTTATTTTTTGAGCCAGTAAAACTTGTGAATTAGCTCTAATACGTGCCATTCA-TTCCGTAAGCTGAGTTTTTTGGTTGAAGCTGAGCAATACAGTGGCTTGAA 620 640 660 680 700 720 TGTTAGTTAAACGTATCACTTTAGATATATGCTTGTCAATATATGTATCTTAATTTCTCCTAATGAACATGTTTTTTTAAAACATCTTGGGGCGTGGATAAAAGACCGTTTCATTAAGTT 740 760 780 800 820 TTTTTTCTGGCTGATTTAGCTTAGAAAACTTAAAACTTAAAAACAACATTTCTCATTCGAGATTAGCAAATGTAATTTATCAGAAACTTGTCTAATTATCCAGCCTTATATGATGAA 850 860 870 880 890 900 910 920 TGGCGTCCATTCAGTTCAAAAAGAGCAAGCCTATAAGTCGAGTCGAAATAAATATGTGTGTAAGTCCCCGAAAGACTTTGAACCTAGT  840 TGA  20 40 60 80 100 120 AATGCAATGCGGTGATTGATGGCTAGGTGGTGGTATTCAATGGCQTAAAGAATTTTAATATTAGGAAATCAAGGAATTTCCCTTAATAAAGATTTTTATATTTACTGTTTTTAACGTAGA r  140 160 180 200 220 240 GTTCTAGATTTATAATCTCAAATGGGGTATTCGGATAAAAAACGATTTAGCAACTGTTAACGGTGAACTAAATTATTTGTAAAGCCCGTCTTTATGTTAGTCATATTTTTCAGAGTTGCC 260 280 300 320 340 360 AACTGACCGTGTGGCCTAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCGTCGTAAAATTAACTTTTTTCTTTTGTATCCAGAATTTTTTTTA 380 400 420 440 460 480 TTTATTTTATGAAAATGAGATTTGAGGGCATTTGGTTGCATTTATCACACTTTGTAAGTCTGTATCTCACCTTCTTGAAGCGCCTTCGCTGCGATGAAGAGTGCGTCGATGCAGTTTCGA 500 520 540 560 580 600 GC AGATTGCTGTTGTTATCCCCCCCATCCCTTTTGCCCAGTGCCTGGAGAAGATCGTCAACGTTGCGTATATAGGGGCGATCTCGATCCCCGCCGCGTTCCCTTTCCTTTTCGCCACCCC G20 640 660 680 700 720 CTCCACCGCCGCCCATGCAGCTGGTTATGCTCCGATTGCCCACACTATTCTACGCGATCGGGATCTGGTCTTTTGCTTGCCCAGCCAGTAAACCTGATTTGCCAAATTTATTTCGGCGGC 740 760 780 800 820 840 TGCCGCAGCCTTTCTTCTGCCCAATTGTTGTTGCTCCTGCACCTGTTGATGCTGCTGCTGCTGTTGTTGCTGCTGCTGCTGTTGTTCACTGGCCAGATATTCGCCGGCTATATGAACCTT 860 880 900 920 940 960 GGGTGCACTAACCAACTGCAGGCCAGTGGCGCCGAATTGCTGAGGQAATTCGTGCAACTCGAGGGGGAAACGGGGATCCATGGTCTGACCCGGTTGACGCGGGTACATATAGCCATCGCG 980 1000 1020 1040 1060 1080 TAGAAACATCTTGCTGGTGGTATAGACCCTATCCGCGATTTGGTACATCCACTCGAGCCGGGACCCTCGCCGCCGCCAATAATTCCATTTCGGACATAGGCTGTCGGGCGATAGCGAACG 1100 1120 1140 1160 1180 1200 AGTGGGTTATATACATTCGATTTGGGGGGTTTCGTTTTGAAACTGCGACGTCGCGTGCTGGGCTTCATATTTTTGTTGTATTTAATTTTCGTTTTTGTTCGTTTGTATTTGCACCCCGCG 1220 1240 1260 1280 1300 1320 ATAACAGAATGTTTGCTCTACAGAAAATCCACCCTTGTGCTGTAGGTTGCTTGCACACGTATCAAATGTTTTCGAGTTTAAGCGTGCTTGGAATAAGCGACCGTGTGGCCTAATGGATAA 1340 1360 1380 1400 1420 1440 GGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCGAAACCAAAGTATTATTTTTTTCTTTTTATTTTTTTTTTGTGAGAAACTTATGTTTTGTTCTTTAAAAAA 1460 1480 1500 1520 1540 1560 TTCAATTTGTTGCAAACTAAAACCATAAAATAAATCAACAAAAACAACAAAAATTTTAAGGTTCACTTGGCTAATTTTACATAAAATCTACACTGTCTTTAGACTGACGATAGAATGTTT 1580 1600 1620 1640 1660 1680 TATGATTACATGTAAAATTAGATCACGCAAAATTATATTTTTTCCTTTGGAAATATATAAAAAAAAAAAAA-AATAAAACCAGATTAGTGTTTCAAGGGTGTTGAGTTAATTTAGAGACTT 1700 1720 1740 1760 1780 1800 TTTGTTCTTTTTCAAATGTAATTTTCGACCGCGTAAAAGTATGCTACAGATATGGTTGAATTATTTTTCATGGCGTTCTTGTTTAACAGCGCACAAAAGCAGGCAACATTTGTGTTTTTA 1820 1840 1860 1880 1900 1920 AAAACGCCTGAGAGAGGCCAATAAAAAAGAGATAAACCCTATAAACTATATTGAAAATAACCGATTTTTTAAGGGTTTTACGCGACCAACACGTTCGGCACACTGCACGTTCGATTTTCC 1940 1960 1980 2000 2020 2040 ACTGCAATTGTTTGATTTTATTGCAACAACTTTTTCTGCTTTTCTGTTGTTTGCTGGAAGGCACGCACTGCCAATCCAATTAGCCGGGGTTCACCTTTCGAGCCGTCGTCTTTGCGCAAG 2050 2060 GTAAATTGTTTTTCGAACCCAAAGTGG  PRI2.6 20 40 GO 80 100 120 AAGCTTCGTTTCGCGTTGAAACTGAATTTTTTGCAATTCAACCCTTCCCACTTATTATAGTTTTCGTTCTGTTCTCACTAGCAAATGTTCTCACTCCAGTTTCTCTCGCCTCTCCCTCTT 140 160 180 200 220 240 TATATTTGTTGTTACGGCCTGGTAATCCAACTGACCGTGTGGCCTAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCGACCGCTCTATACTTT 255 270 285 300 315 330 345 TTTTTTAATATTCATATTTTTCCTTGAGCTATGAATATTACAGCTTTTATTAATTGGCCAAGTCAATTGCTGCAAAAAATATTTATTAGTTCTTTAAGGAACTAGAAGCT  pDt72R 20 40 60 80 GTCCC TCGCAGTCQTTCGGGCAGCTTTTCTTAAAAGCAGGCAGGCTTTTCGQATGGGGAGTTGGAGTTTTGTTAATTGTTAACGATT  100  120  T TATTTGTTTT TCTGAGGGAT T TTTTTCTTAAG  140 160 180 200 220 240 ATATTCGACACAGTGGTCTAGCTCAGCTTGTAGTTTTTTAGCTTTCGACCATTGGGGCGGTGGAGTGTTCGTATATAATAGCCACTTTATGTGCGCTATTCTCTTTTTTGCTTTATTTCG 260 280 300 320 340 360 AACTCCGCCCCTGTTTTTACCAATCGCACTAACACTCTACTCACTCAGATCGCTGTTTCTCCATAATTGCCGCCGACTTGGTGGATAAGCATCGAATGCCAGGCATGCTGATCCGAAGAT 380 400 420 440 460 480 TGCAGGTTCGAGTCCTGTCACGGTCGCCATGTAGTTAAATAGGAGTCAAAACGCAATCGGTCATATTTATCTTTATTTGGTTTTTATTCAGCATGTGTACATTCTTGATCTATTCCTGAT TCAT A  500 520 540 560 580 600 ACTGAACTTGGTGTGGTCTACAGGCAGATCGCTCGTGACAGCCAAGTGCTGACACTAGCAAATTCTGCAATATGTATGTATGAAGTTCATACTCGATAACCAATGGGAGTCGAGT  610 620 GCGACCCCTAAAGCGCACATGCTGAATT  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098177/manifest

Comment

Related Items