UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization and expression of Cellulomonas fimi endoglucanase B gene and properties of the gene… Owolabi, Joshua Babatunde 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A1 O96_3.pdf [ 7.3MB ]
Metadata
JSON: 831-1.0098159.json
JSON-LD: 831-1.0098159-ld.json
RDF/XML (Pretty): 831-1.0098159-rdf.xml
RDF/JSON: 831-1.0098159-rdf.json
Turtle: 831-1.0098159-turtle.txt
N-Triples: 831-1.0098159-rdf-ntriples.txt
Original Record: 831-1.0098159-source.json
Full Text
831-1.0098159-fulltext.txt
Citation
831-1.0098159.ris

Full Text

CHARACTERIZATION AND EXPRESSION OF CELLULOMONAS FIMI ENDOGLUCANASE B GENE AND PROPERTIES" OF THE GENE PRODUCT FROM ESCHERICHIA COLI By JOSHUA BABATUNDE OWOLABI B.Sc, University of Ife, 1979 M.Sc, University of Ife, 1982 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA January 1988 © Joshua Babatunde Owolabi, 1988 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Microbio logy The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date January 27, 1988 DE-6n/8-n ABSTRACT In C e l l u l o m o n a s f i m i the cenB gene encodes a s e c r e t e d endoglucanase (EngB) i n v o l v e d i n the d e g r a d a t i o n of c e l l u l o s e . The cenB gene c a r r i e d on a 5.6 kb C f i m i DNA fragment encodes a p o l y p e p t i d e of M r 110,000 i n E s c h e r i c h i a  c o l i . The l e v e l of e x p r e s s i o n of the gene was s i g n i f i c a n t l y i n c r e a s e d by r e p l a c i n g i t s normal t r a n s c r i p t i o n a l and t r a n s l a t i o n a l r e g u l a t o r y s i g n a l s w i t h t h o s e of the E_j_ c o l i  l a c operon. The i n t a c t EngB p o l y p e p t i d e i s not r e q u i r e d f o r enzymatic a c t i v i t y : a c t i v e p o l y p e p t i d e s of M f 95,000 and 82,000 a l s o appear i n c o l i and a d e l e t i o n mutant of cenB encodes an a c t i v e p o l y p e p t i d e of M r 72,000. The i n t a c t and t r u n c a t e d EngB both b i n d t o m i c r o c r y s t a l l i n e c e l l u l o s e . A s i m p l e , r a p i d a f f i n i t y chromatography p r o c e d u r e on A v i c e l was d e v e l o p e d f o r the p u r i f i c a t i o n of i n t a c t EngB and of the 72,000 d e l e t i o n d e r i v a t i v e . Alignment of the a m i n o - t e r m i n a l amino a c i d sequence of the p u r i f i e d i n t a c t EngB from E^ c o l i w i t h the p a r t i a l n u c l e o t i d e sequence of the c l o n e d C_;_ f i m i DNA showed t h a t the mature EngB i s p r e c e ded by a sequence enc o d i n g a p u t a t i v e s i g n a l p o l y p e p t i d e of 32 amino a c i d s , a t r a n s l a t i o n a l i n i t i a t i o n codon and a sequence r e s e m b l i n g an E. c o l i ribosome b i n d i n g s i t e 4 n u c l e o t i d e s b e f o r e the i n i t i a t i o n codon. The s i g n a l p e p t i d e f u n c t i o n s and i s c o r r e c t l y p r o c e s s e d i n E_j_ c o l i , even when i t s f i r s t 15 amino a c i d s a r e r e p l a c e d by the f i r s t 7 amino a c i d s of j3-galactosidase. The truncation of EngB does not af f e c t i t s export to the periplasm of E . . c o l i . In the intact EngB, 25% of the residues are hydroxyamino acids. It displays features common to endo-/3-1 ,4-glucanases, since i t has a high a c t i v i t y on carboxymethylcellulose. The kinetic parameters for carboxymethylcellulose hydrolysis of both intact and truncated EngB are not s i g n i f i c a n t l y d i f f e r e n t . C. f imi protease cleaves intact EngB, in a s p e c i f i c manner, to generate two polypeptides of Mr 65,000 and 43,000; the former has the capacity to bind A v i c e l . A polyclonal antibody raised against the p u r i f i e d intact EngB recognizes a C_^  fimi e x t r a c e l l u l a r protein of M 110,000 as well as 5 polypeptides of lower molecular weight. iv TABLE OF CONTENTS L i s t of Tables v i i L i s t of Figures v i i i Acknowledgements x L i s t of Abbreviations xi INTRODUCTION 1 I Background 1 II Enzymatic hydrolysis of c e l l u l o s e 3 A) Structure of Cellulose 3 B) Cellulase-producing organisms 5 C) C e l l u l o l y t i c enzyme systems 6 D) Measurement of c e l l u l a s e a c t i v i t i e s 8 E) Adsorption/desorption and synergism of c e l l u l a s e s 10 F) Mechanism of c e l l u l o s e hydrolysis 12 III The application of molecular biology to the study of Cellulomonas f imi c e l l u l a s e s 14 IV Objectives of this thesis 24 MATERIALS AND METHODS 25 I Bacterial s t r a i n s , plasmids and phages 25 II Cultivation conditions 25 III B i o l o g i c a l screening for endoglucanase a c t i v i t y 27 IV Preparation and l o c a l i z a t i o n of proteins 27 A) Elution of Avicel-bound C. f imi proteins with water 27 B) E x t r a c e l l u l a r C. fimi protease 28 C) Localization of recombinant EngB 28 V P u r i f i c a t i o n of intact and truncated recombinant EngB 28 VI Enzyme assays and protein determination 30 A) Reducing sugar assays 30 B) Aryl glycosidase assays 31 C) 0-lactamase assay 32 D) 0-galactosidase assay 32 E) Protease assay 33 V F) Protein determination 33 VII DNA methodology 33 A) Plasmid DNA i s o l a t i o n and analysis 33 B) Oligonucleotide synthesis and p u r i f i c a t i o n .. 34 C) DNA sequencing 34 VIII M i n i c e l l s 35 IX Electrophoretic analysis of proteins 36 X Immunological detection of EngB .... 37 XI Determination of NH 2 _terminal amino acid sequence and amino aci d composition of intact EngB 37 XII Enzymes and reagents 38 RESULTS 39 I Genetic characterization and increased expression of the cenB gene 39 A) Determination of the d i r e c t i o n of tr a n s c r i p t i o n of the cenB gene 39 B) Delineation of the 5' end of the cenB gene .. 42 C) L o c a l i z a t i o n of the 3' end of the cenB gene . 47 D) Structure of the 5' terminal region of the cenB gene 52 II Export of EngB in E. c o l i 55 III P u r i f i c a t i o n of intact and truncated EngB from E. c o l i 57 IV Biochemical characterization of EngB 68 A) NH 2 _terminal amino acid sequence and t o t a l amino acid composition of intact EngB 68 B) I d e n t i f i c a t i o n of the C. fimi protein corresponding to EngB 68 C) Action of C. fimi protease on recombinant EngB 68 D) Substrate s p e c i f i c i t y of recombinant EngB ... 75 E) C a t a l y t i c properties of intact and truncated EngB 75 DISCUSSION .. 81 LITERATURE CITED 89 APPENDIX 106 I Expression of cenB on a thermoinducible runaway r e p l i c a t i o n plasmid 106 v i A) Targeted 5' deletions of the cenB gene 106 B) Construction of pCP3cenB expression vectors 107 C) EngB synthesis in E. coli/pCP3cenBA5 108 v i i LIST OF TABLES TABLE Page I Summary of cloned c e l l u l a s e genes 15 II B a c t e r i a l s t r a i n s , plasmids and phages 26 III CMcellulase a c t i v i t i e s of various cenB clones 43 IV L o c a l i z a t i o n of EngB, 0-lactamase and /3-galactosidase in E. c o l i RRI cultures 58 V P u r i f i c a t i o n of intact EngB from E. c o l i RRl/pJB301 64 VI P u r i f i c a t i o n of truncated EngB from E. c o l i RRl/pJB303 67 VII Amino acid composition of the intact EngB polypeptide 69 VIII A c t i v i t y of intact EngB towards various substrates 77 IX Comparison of the kinetic parameters for CMcellulose hydrolysis of intact and truncated EngB, of EngA and of Exg 80 v i i i LIST OF FIGURES Figure Page 1. Structure of c e l l u l o s e 4 2. Schematic representation of the action of c e l l u l a s e s on a c e l l u l o s e f i b r i l 13 3. Overall structures of Exg and EngA of C. f i m i , and of the fusion protein Exg-EngA from E. c o l i 21 4. Detection E. c o l i C600/pEC3-encoded endoglucanase on LB-CMcellulose agar plate with Congo red 40 5. Construction of various pEC3 derivatives 41 6. Autoradiogram of polypeptides encoded by pBR322, pEC3 and pEC303 44 7. Scheme for targeting deletions from the 5'end of the cenB gene 45 8. Extents of deletions into the 5'end of the cenB gene and effects on CMcellulase a c t i v i t y ....... 48 9.. Nucleotide sequence of the RBS, translat ional i n i t i a t i o n s i t e and amino-terminus of the fusion junction of the lacZ'-cenB expression-secretion plasmid, pJB30l 49 10. Screening of various cenB subclones on a CMcellulose-Congo red indicator plate 50 11. Diagrams of pJB3 and i t s deletion derivatives 51 12. SDS-PAGE and zymograms of t o t a l c e l l u l a r proteins from E. c o l i RR1 containing pJB30l or i t s deletion d e r i v a t i v e s 53 13. Nucleotide sequence of the 5' terminus of the cenB gene and the deduced NH 2 _terminal sequence of EngB 54 14. Comparison of the cenB, cex and cenA 5' flanking regions 56 15. A f f i n i t y chromatography of i n t a c t recombinant EngB on Avicel 60 ix 16. Chromatography of intact recombinant EngB on a Mono Q anion-exchange column 62 17. SDS-PAGE analysis of the p u r i f i c a t i o n of intact EngB 63 18. Chromatography of truncated recombinant EngB on a Mono Q anion-exchange column 65 19. SDS-PAGE analysis of the p u r i f i c a t i o n of truncated recombinant EngB 66 20. Enzyme-linked immunoadsorbent assay of the t i t r e of the antiserum to p u r i f i e d intact recombinant EngB 70 21. Immunological detection of recombinant EngB and of related polypeptides from C. fimi 72 22. SDS-PAGE analysis of the effect of the C. fimi protease on intact recombinant EngB 74 23. Western blot analysis of intact and truncated recombinant EngB and of the proteoly t i c products of recombinant EngB 76 24. Lineweaver-Burke plot of the kin e t i c s of hydrolysis of CMcellulose by intact recombinant EngB 78 25. Lineweaver-Burke plot of the kinetics of hydrolysis of CMcellulose by truncated recombinant EngB 79 26. Comparison of the Exg, EngA and EngB signal peptides 84 X ACKNOWLEDGEMENTS I would l i k e to thank Drs. R.A.J. Warren, R.C. M i l l e r J r . , and D.G. Kilburn for th e i r guidance and support during t h i s work. Also, I wish to thank Dr. P.M. Townsley for he l p f u l discussions. I would l i k e to thank Ms. Sandy Keilland and Dr. Robert Olafson for the amino-terminal protein sequence, and Dr. D.J. Mckay for the amino acid composition analysis, also Dr. Tom Atkinson for the oligonucleotide synthesis and Dr. Neil R. Gilkes for information on the p u r i f i c a t i o n of C. fimi endoglucanase weakly bound to A v i c e l . Also , I wish to thank Dr. P. Beguin for collaboration on the construction of pCP3cenB expression vectors. I would l i k e to thank a l l members of the Cellulase Group for th e i r support when I needed i t . This work was supported by strategic grant 67-0941 from the Natural Sciences and Engineering Research Council of Canada to D.G.K., R.C.M., and R.A.J.W. I wish to thank the Canadian Government for the award of a Canadian Commonwealth Scholarship that enabled me to further my graduate studies. This thesis is dedicated to my wife, Aina, and my children, Olayinka and Akinsanya, for t h e i r understanding and support. x i LIST OF ABBREVIATIONS aa Amino acid(s) Amp Am p i c i l l i n cenA Gene encoding C. fimi endoglucanase A cenB Gene encoding C. fimi endoglucanase B cex Gene encoding C. fimi exoglucanase CM Carboxymethyl dCTP Deoxycytosine triphosphate DNSA D i n i t r o s a l i c y l i c acid DP Degree of polymerization DS Degree of substitution EngA protein encoded by cenA EngB protein encoded by cenB Exg protein encoded by cex FPLC Pharmacia Fast Protein Liquid Chromatography system IPTG I sopropyl-/3-D-thiogalactoside Kan Kanamycin kb 1000 base pairs kDa 1000 daltons LacZ E. c o l i j3-galactosidase gene LacZ' The f i r s t 78 amino acids of |3-galactosidase including the operator and promoter region of the gene. LB Luria broth min Minute(s). Mr Apparent molecular weight MUC 4-methylumbelli f eryl-j3-D-cellobioside ONPG o-nitrophenyl-j3-D-galactoside PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline p-HBAH p-hydroxybenzoic acid hydrazide PMSF Phenylmethylsulfonyl fluoride pNPC p-nitrophenyl-(3-D-cellobioside pNPG p-ni trophenyl-j3-D-glucoside pNPX p-n i trophenyl-j3-D-xyloside SDS Sodium dodecyl sulfate Tet t e t r a c y c l i n e X-gal 5-bromo-4-chloro-3-indolyl-/3-D-galactoside X-phosphate 5-bromo-4-chloro-3-indolyl-phosphate / plasmid c a r r i e r state 1 INTRODUCTION I Background Cellulose i s the world's most abundant renewable carbon source. It i s found as the main s t r u c t u r a l element and constituent of the walls of higher plants. Some algae, fungi and certain bacteria (for example, Acetobacter  xylinum) also produce some c e l l u l o s e . In recent years, due to energy shortage, food c r i s i s and p o l l u t i o n , the potential for the use of c e l l u l o s i c biomass for the production of microbial protein, l i q u i d fuels and i n d u s t r i a l chemicals has become recognized. Cellulose can be hydrolysed by strong acids or by a set of enzymes c a l l e d c e l l u l a s e s . Hydrolysis of c e l l u l o s i c s with acids poses a i r pollution problems through the emissions of stack gases containing corrosive chlorides and sulfur oxides. It requires extreme conditions of temperature and pH, and does not y i e l d glucose as a sole end-product. Enzymatic hydrolysis, on the other hand, i s a very selective process,^ being s p e c i f i c for the substrate, c e l l u l o s e . The f i n a l product, glucose, i s stable under the r e l a t i v e l y mild conditions required for enzymatic hydrolysis. The enzymes are reusable, non-polluting and energy-sparing, but very large quantities are required because of their low s p e c i f i c a c t i v i t i e s and t h e i r poor 2 conversion of c e l l u l o s e to glucose. C e l l u l o s i c materials can be pretreated to enhance their enzymatic conversion to glucose (Brownell and Saddler, 1987; Fan et al . , 1 982; Horton et al., 1980; M i l l e t et al .,1976). High y i e l d i n g c e l l u l a s e producing st r a i n s (Choi et al.,1978; Hagget et al ., 1978; Moloney et al ., 1983; Montenecourt, 1983) as well as mutants that are resistant to catabolite repression (Bailey and Oksanen, 1984; Stewart and Leatherwood, 1976) and end-product i n h i b i t i o n have been isolated (Choudhury et al.,1980). Strategies have also been devised for optimizing fermentation conditions which enhance c e l l u l a s e a c t i v i t y (Chahal, 1985; Watson et al ., 1984). Gene cloning technology affords another approach to increasing c e l l u l a s e production ( J o l i f f et al., 1986b; O'Neill et al ., 1986c; Teeri, 1987). From a more basic point of view, gene cloning f a c i l i t a t e s separation and i d e n t i f i c a t i o n of various components of the often complex c e l l u l a s e systems. A given enzyme free of other c e l l u l o l y t i c components allows determination of substrate s p e c i f i c i t y and c a t a l y t i c properties. Besides, the nucleotide sequences of cloned c e l l u l a s e genes can be determined; the deduced amino acid sequences provide information on the structure of the enzymes. This f a c i l i t a t e s analysis of structure-function relationships. An understanding of c e l l u l a s e s t r u c t u r a l genes and of the structures, substrate s p e c i f i c i t i e s and c a t a l y t i c properties of the enzymes they encode is a necessary prerequisite to a 3 f u l l e r understanding of the r e l a t i v e importance , and mechanism of action of each enzyme in the hydrolysis of c e l l u l o s e , and to the reconstitution of optimized c e l l u l a s e systems. II Enzymatic hydrolysis of c e l l u l o s e A) Structure of c e l l u l o s e Cellulose i s a linear homopolymer, composed of glucose residues held together by 0-1,4 linkages (Fan et al ., 1980a). The glucose units adopt the chair configuration with every other residue rotated 180° around the main axis to give an unstrained linear configuration (Fig. 1a). Thus, the basic functional unit of c e l l u l o s e i s c e l l o b i o s e . Cellulose is organised into several l e v e l s of higher order structure. The smallest structural units are the elementary f i b r i l s , in which a number of polymer chains oriented in p a r a l l e l are held together by both i n t r a - and inter-chain hydrogen bonds. Within the f i b r i l s there are c r y s t a l l i n e , completely ordered regions which alternate with less ordered, amorphous regions (Fig. 1b). Bundles of f i b r i l s form f i b e r s . In the native state, c e l l u l o s e fibers are .associated with other polysaccharides, such as hemicelluloses, and with l i g n i n (Fig. 1c). 4 Figure 1. Structure of c e l l u l o s e , (a) Stereochemical representation of a c e l l u l o s e molecule. Arrows A and B represent 0-1,4-linkages lying in d i f f e r e n t planes within the c e l l u l o s e f i b r i l . Cleavage at these linkages w i l l generate two d i f f e r e n t end-group configurations (Wood, 1985). (b) Organization of c e l l u l o s e molecules in elementary f i b r i l s . Regions of the f i b r i l in which the polymers are highly ordered or are in r e l a t i v e disarray have been termed the c r y s t a l l i n e and amorphous regions, respectively, (c) Cross-section of a wood f i b e r . Cellulose elementary f i b r i l s are embedded in a matrix of hemicellulose and l i g n i n , reducing their a c c e s s i b i l i t y to enzymatic digestion (adapted from Beguin et al., 1987; Fan et al., 1980a). a) CRYSTALLINE AMORPHOUS CRYSTALLINE REGION REGION REGION F IBRIL 0 / Cellulose z . , .. elementary fibril ^Hemice l l u l ose = Lignin 5 B) Cellulase-producing organisms Although a variety of microorganisms can hydrolyse amorphous c e l l u l o s e , only a few are capable of degrading c r y s t a l l i n e c e l l u l o s e e f f i c i e n t l y . Notable in this regard are fungal species such as Trichoderma, Fusarium, Myrothec ium, Penici11ium, and Sporotrichum; actinomycetes such as Streptomyces and Thermonospora; and b a c t e r i a l species such as A c e t i v i b r i o , Bacteroides, Cellulomonas, Clostridium, and Sporocytophaqa (Coughlan, 1985). In most organisms, the synthesis of c e l l u l a s e s i s subject to induction by c e l l u l o s e and repression by glucose. Neither the nature of the actual inducer nor the mechanism of induction are f u l l y understood. Sophorose (2-0-/3-glucopyranosyl-D-glucose) i s an excellent inducer of ce l l u l a s e synthesis in some species, including Trichoderma (Sternberg and Mandels, 1979), Sporotr ichum (Eriksson and Hamp, 1978) and Cellulomonas (Stewart and Leatherwood, 1976). There i s some disagreement over the involvement of cAMP in the regulation of c e l l u l a s e biosynthesis. There i s no corre l a t i o n between induction of c e l l u l a s e s and i n t r a c e l l u l a r cAMP levels in Pseudomonas fluorescens var. ce l l u l o s a (Suzuki, 1975) and Trichoderma reesei (Montenecourt, 1983), but cAMP may be involved in regulating c e l l u l a s e biosynthesis in Thermonospora (Coughlan, 1985). 6 C) C e l l u l o l y t i c enzyme systems C e l l u l o l y t i c organisms produce complex mixtures of enzymes and other components to effect hydrolysis of native c e l l u l o s e . The enzymes are mostly hydrolytic, but may be phosphorolytic or oxidative. The major types of hydrolytic enzymes include endoglucanases (endo- 1 , 4-j3-glucanase, EC 3 . 2 . 1 . 4 ) which cause internal cleavage of ce l l u l o s e chains, exoglucanases (exo-1 , 4 - j3~glucanase, EC 3 . 2 . 1 . 9 1 ) which remove cellobiose units from the non-reducing ends of the major chain or shorter chains produced by the action of endoglucanases, and cellobiases ( j3-glucosidase, EC 3 . 2 . 1 . 2 1 ) which convert cellobiose to glucose. While fungi usually secrete j3-glucosidases bacteria take up cellobiose and hydrolyse i t i n t r a c e l l u l a r l y . Cellobiose phosphorylase (EC 2 . 4 . 1 . 2 0 ) catalyses the rever s i b l e phosphorylation of cellobiose (Alexander, 1 9 6 8 ) . The oxidative enzymes cellobiose oxidase and cellobiose dehydrogenase oxidise cellobiose and higher cellodextrins to the corresponding lactones in the presence of molecular oxygen or other electron acceptors such as l i g n i n or quinone, respectively (Eriksson, 1 9 7 8 ) . As some of the organisms producing these non-hydrolytic enzymes do not synthesize 0-glucosidases, they provide alternative means of metabolizing c e l l u l o s e biodegradation products and of diminishing the in h i b i t o r y effect of cellobiose on c e l l u l a s e 7 a c t i v i t y . Although, Reese et al . (1950) proposed the existence of a non-enzymatic factor, termed C 1 f that renders c r y s t a l l i n e c e l l u l o s e amenable to hydrolysis by other components of the c e l l u l a s e system, the components of most fungi have been i s o l a t e d and shown to be exoglucanases ( H a l l i w e l l and G r i f f i n , 1973; Pettersson, 1975). However, the existence of an e s s e n t i a l non-enzymatic component has been recently demonstrated in two separate studies. G r i f f i n et al. (1984) isolated from T. reesei c e l l u l a s e , a factor that generates m i c r o f i b r i l s or shorter f i b e r s from f i l t e r paper without hydrolysis. In addition to the e x t r a c e l l u l a r enzymes, Ljungdal et al . (1983) also isolated a low molecular weight water-insoluble "yellow a f f i n i t y substance" from culture f i l t r a t e s of Clostridium thermocellum. This substance binds to the c e l l u l o s e f i b e r s in the growth medium and promotes the binding of the endoglucanases to the substrates. Each of the major hydrolytic components of the ce l l u l a s e complex synthesized by an individual organism may exist in a number of forms. This m u l t i p l i c i t y of components could be genetically determined, or be caused by p a r t i a l proteolysis (Gong and Tsao, 1979; Langsford et al., 1984; Nakayama et al., 1976) or by d i f f e r e n t i a l glycosylation of a common polypeptide chain (Moloney et al., 1985). Wood (1985) has suggested that, for stereochemical reasons, at least two types of endoglucanase and exoglucanase should be 8 required for hydrolysis of c r y s t a l l i n e c e l l u l o s e . T h e o r e t i c a l l y , he argues, there w i l l be two types of non-reducing end groups in the ce l l u l o s e c r y s t a l l i t e , requiring two d i f f e r e n t stereospecific enzymes for hydrolysis. Proteolysis has been reported to a f f e c t the release of c e l l u l a s e from the c e l l walls of some c e l l u l o l y t i c fungi (Kubicek, 1981). Increased s p e c i f i c a c t i v i t y or^ acti v a t i o n of the endoglucanase from Sporotrichum pulverulentum (Eriksson and Pettersson, 1982) and PeniciIlium janthinellum (Deshpande et al., 1984b) a f t e r treatment with protease(s) from the respective fungus has also been reported. D) Measurement of c e l l u l a s e a c t i v i t i e s A number of methods are available for the detection and measurement of the a c t i v i t i e s of a l l or parts of the c e l l u l a s e system (Mullings, 1985). A common q u a l i t a t i v e assay r e l i e s on the incorporation of CMcellulose (a soluble c e l l u l o s e derivative) into growth media and i t s int e r a c t i o n with Congo red. Hydrolysis of the CMcellulose by hydrolytic organisms provides zones of clearing (Teather and Wood, 1982). A development of this assay i s the Congo red-stained agar r e p l i c a used to detect c e l l u l a s e a c t i v i t y in polyacrylamide gels -(Beguin, 1983). Determination of reducing sugar by the d i n i t r o s a l i c y l i c a c i d (DNSA) ( M i l l e r , 1959) and the Nelson-Somogyi (Nelson, 1952) procedures are the most popular types of quantitative 9 assay available. Both methods are subject to s i g n i f i c a n t interference from other reducing substances. Moreover, the response of either reagent varies considerably from sugar to sugar. Although i n s i g n i f i c a n t when the hydrolysis of p u r i f i e d c e l l u l o s i c substrate i s under investigation, these drawbacks can be very serious when impure l i g n o c e l l u l o s i c materials are used (Rivers et al ., 1984). Breuil and Saddler (1985) have also commented on the inadequacies of the reducing sugar assay procedures. A l t e r n a t i v e l y , the increase in f l u i d i t y accompanying hydrolysis of soluble derivatives of c e l l u l o s e may be assayed v i s c o m e t r i c a l l y (Almin efa/., 1975). Plots of increase in r e l a t i v e f l u i d i t y versus reducing equivalents, indicating the "randomness" of attack on the substrate, have been used to compare i n d i v i d u a l endoglucanases (Gilkes et al . , 1984c). Although the slopes obtained in such curves may help to characterize exoglucanases,it has become more usual to determine exoglucanase a c t i v i t y by measuring the release of p-nitrophenol from p-nitrophenyl-j3-cellobioside (pNPC) (Deshpande et al., 1984a) or release of methylumbelliferone from methylumbelliferyl cellobioside (MUC) (van Tilbeurgh et al . , 1982). j3-glucos idase a c t i v i t y is determined by measuring the release of p-nitrophenol from p-nitrophenyl - 0-glucoside or by the release of glucose from cellobiose (Mullings, 1985). 1 0 E) Adsorption/desorption and synergism of c e l l u l a s e s The adsorption of c e l l u l a s e on the surface of c e l l u l o s i c material i s the f i r s t step in h y d r o l y s i s . Factors a f f e c t i n g the adsorption of c e l l u l a s e s to c e l l u l o s e include: the nature of the substrate; i t s p u r i t y ; pretreatment and the extent to which i t i s c r y s t a l l i n e or amorphous; enzyme/substrate r a t i o ; the a f f i n i t y of the multicomponent enzyme used for the substrate; the fact that the topography of the substrate changes as digestion proceeds; inactivation of bound or free enzyme; non-productive binding or immobilization of enzyme; and accumulation of products, especially c e l l o b i o s e , that i n h i b i t enzyme a c t i v i t y (Castanon and Wilke, 1980; Coughlan, 1985; Moloney and Coughlan, 1983). On l i g n o c e l l u l o s i c s such as newspaper, the enzymes once bound remain immobilized (Castanon and Wilke, 1980). However, when r e l a t i v e l y pure c e l l u l o s i c materials are used, c e l l u l a s e s are rapidly adsorbed, followed by a slow release of the enzymes to the l i q u i d phase as the hydrolysis proceeds (Moloney and Coughlan, 1983). In the l a t t e r , the adsorption behavior obeys Michaelis-Menten k i n e t i c s (Moloney and Coughlan, 1983) in that the extent of adsorption increases as c e l l u l o s e concentration or enzyme concentration increases. Maximum adsorption or desorption of c e l l u l a s e s occurs under the conditions of pH and temperature optimal 11 for hydrolysis (Moloney and Coughlan, 1983). However, at 0-5°C the extent of adsorption in the i n i t i a l phase is slow but such adsorption continues u n t i l ultimately much more enzyme i s bound than at higher temperature (Moloney and Coughlan, 1983; Ryu et al ., 1984). C e l l u l o l y t i c enzymes adsorb with d i f f e r e n t degrees of tenacity to c e l l u l o s i c subtrates. This d i f f e r e n t i a l a f f i n i t y has been exploited for the purposes of enzyme fractionation and p u r i f i c a t i o n (Beguin and Eisen, 1978; Boyer et al ., 1987; Gilkes et al., 1984c; H a l l i w e l l and G r i f f i n , 1978; Nummi et al., 1981; Owolabi et al., 1988; Reese, 1982; Schwarz et al . , 1986; van Tilbeurgh et, al . , 1984) . Although the i n d i v i d u a l components of c e l l u l a s e systems by themselves have l i t t l e action on c r y s t a l l i n e c e l l u l o s e , synergism between endo- and exo-glucanases has been shown for the enzymes from a number of fungal species (Eriksson, 1975; Moloney et al . , 1985; Ryu et al . , 1 984; Wood, 1975). This synergistic i n t e r a c t i o n i s most marked when highly c r y s t a l l i n e substrates are used, i s low with amorphous cel l u l o s e and i s absent with soluble derivatives (Wood and McCrae, 1979). Synergy has been reported to be maximal when the components are in the same r a t i o as they occur in the crude f i l t r a t e s (Wood, 1975; Ryu et al., 1984). Cross-synergism between the exoglucanases produced by one organism and the endoglucanase fractions of another has also been demonstrated (Wood, 1975; Moloney et al ., 1985). 12 Not a l l endoglucanases from a given f i l t r a t e are capable of e f f e c t i v e synergistic i n t e r a c t i o n with exoglucanases from the same f i l t r a t e (Eriksson, 1975; Wood, 1975). This i s best understood in terms of the recent observation that endoglucanases f a l l into two classes; those that adsorb "strongly" and those that adsorb "weakly" to insoluble c e l l u l o s e (Ryu et al ., 1984). The former predominate in c e l l u l a s e systems that are highly active against c r y s t a l l i n e c e l l u l o s e , whereas the "weakly" binding forms predominate in f i l t r a t e s that are r e l a t i v e l y inactive against such subtrates. Both forms of enzyme are equally active against soluble substrates (Ryu et al., 1984). A similar study by Klyosov et al. (1986) suggests that the tightness of binding of the endoglucanases to the substrates, plays a c r u c i a l role in the degradation of c r y s t a l l i n e c e l l u l o s e . F) Mechanism of c e l l u l o s e hydrolysis The mechanism of c e l l u l a s e action as i t relates to s o l u b i l i z a t i o n of c r y s t a l l i n e c e l l u l o s e i s s t i l l c ontroversial (Fan et al., 1980b; G r i f f i n et al ., 1984; Mandels, 1982; Reese et al ., 1950; Ryu et al ., 1984; Wood, 1985). A model accomodating the observations of various investigators has been proposed by Coughlan (1985) and i s shown in F i g . 2. In the f i r s t step, amorphogenesis, the c r y s t a l l i n e substrate i s rendered more accessible to the hydrolytic enzymes by non-enzymatic factors. Further Figure 2. Schematic representation of the action of c e l l u l a s e s on a c e l l u l o s e f i b r i l . Individual glucose residues of the c e l l u l o s e chains are represented by hexagons. The non-reducing end of a c e l l u l o s e polymer denoted by a f i l l e d hexagon (adapted from Beguin et al 1987). Crystalline region endoglucana.se Amorphous region O adsorption of cellulases exoglucanase J endogtucanase / M O O O O 1 4 hydrolysis is then brought about by the combined actions of endoglucanases and exoglucanases, displaying synergism and perhaps competitive adsorption. L a s t l y , /3-glucosidases act on the cellobiose to produce glucose. This model, although based on fungal studies, i s thought to hold true for b a c t e r i a l c e l l u l a s e systems. I l l The application of molecular biology to the study of Cellulomonas fimi c e l l u l a s e s The f i r s t molecular cloning of a c e l l u l a s e gene was reported in 1982 (Whittle et al., 1982). Since then several research groups have reported the molecular cloning of about 60 c e l l u l a s e genes from 20 d i f f e r e n t organisms (Table I ) . The research focus has been on the characterization and the heterologous expression of the cloned c e l l u l a s e genes. Notable among the achievements in the f i e l d i s the determination of nucleotide sequences of 14 of the c e l l u l a s e genes (Beguin et al., 1985; Fukumori et al ., 1986a,b; Grepinet and Beguin, 1986; J o l i f f et al . , 1986a; Kohchi and Toh-e, 1985; O'Neill et al ., 1986a; P e n t t i l a et al ., 1986, Robson and Chambliss, 1987; Shoemaker et al . , 1983, 1984; Teeri et al., 1987; Wakarchuk et al ., 1 988; Wong et al . , 1986), and the overexpression in Escherichia c o l i of a c e l l u l a s e gene which led to the f i r s t c r y s t a l l i z a t i o n of a c e l l u l a s e ( J o l i f f et al., 1986b). Currently, the structural organization of recombinant c e l l u l a s e s i s being studied in d e t a i l and speculations about the active s i t e s and substrate T a b l e I. Summary of c l o n e d c e l l u l a s e genes Organ i sm Genes c l o n e d no . t ype S c r e e n i ng method R e f e r e n c e A g r o b a c t e r i u m ATCC21400 1 0 - g 1 u c o s i d a s e DNA probe Wakarchuk e t a / . , 1986 Bac i11 us s u b t i 1 i s 1 e n d o g l u c a n a s e i n d i c a t o r p i a t e s K o i d e et al . , 1986 B . sub t i 1 i s DLG 1 e n d o g l u c a n a s e i mmunolog i c a l Robson and C h a m b l i s s , 1986 B a c i l l u s s p . s t r a i n N-4 2 e n d o g l u c a n a s e s i nd i c a t o r p i a t e s S a s h i h a r a et a l . , 1984 B a c i l l u s s p . s t r a i n 1139 1 e n d o g l u c a n a s e i n d i c a t o r p i a t e s Fukumori et a l . , 1986a B a c t e r o i d e s s u c c i n o g e n e s 1 e n d o g l u c a n a s e i nd i c a t o r p i a t e s Co l 1 i e r e t al. , 1984 C e l l u l o m o n a s f i m i 2 e n d o g l u c a n a s e s i mmunolog i c a 1 W h i t t l e e t a l . , 1982 1 e n d o g l u c a n a s e DNA probe B. M o s e r , p e r s o n a l c o m m u n i c a t i o n 1 e x o g l u c a n a s e enzyme a s s a y s G i l k e s et a l . , 1984a,b 1 0 - g l u c o s i dase enzyme a s s a y s N. B a t e s , p e r s o n a l c o m m u n i c a t i o n C e l 1 u l o m o n a s uda 1 0 - g l u c o s i d a s e i n d i c a t o r p i a t e s Nakamura et a l . , 1986 C e l l u l o m o n a s m i x t u s 1 0 - g 1 u c o s i dase i nd i c a t o r p l a t e s Wayne and P e m b e r t o n , 1986 1 endog1ucanase i nd i c a t o r p l a t e s Wayne and P e m b e r t o n , 1986 C l o s t r i d i u m a c e t o b u t y 1 i c u m 1 0 - g l u c o s i dase enzyme a s s a y s Zappe e t a l . , 1986 1 e n d o g l u c a n a s e i nd i c a t o r p i a t e s Zappe et a l . , 1986 C l o s t r i d i u m t h e r m o c e l l u m 7 e n d o g l u c a n a s e s i nd i c a t o r p i a t e s C o r n e t et a l . , 1983b 3 e x o g 1 u c a n a s e s enzyme a s s a y s Mi 1 l e t et a l . , 1985 2 p - g l u c o s i d a s e s i n d i c a t o r p i a t e s Schwarz e t a l . , 1985 1 3 e n d o g l u c a n a s e s i nd i c a t o r p 1 a t e s Romaniec et a l . , 1987 E s c h e r i c h i a a d e c a r b o x y l a t a 1 p - g l u c o s i dase growth on c e 1 1 o b i ose A r m e n t r o u t and Brown, 1981 E r w i n i a c a r a t o v o r a 1 p - g l u c o s i dase comp1ementat i on B a r r a s e t a l . , 1984 T a b l e I c o n t i n u e d Organ i sm Genes c l o n e d no. type S c r e e n i n g method R e f e r e n c e E r w i n i a c h r y s a n t h e m i 1 endoglucanase i n d i c a t o r p l a t e s van G i j s e g e m et al . , 1985 1 endog1ucanase i n d i c a t o r p l a t e s B a r r a s et al., 1984 1 endog1ucanase i n d i c a t o r p l a t e s K o t o u j a n s k y et al . , 1985 Thermonospora f u s c a YX 2 endog1ucanases enzyme a s s a y s C o l l m e r and W i l s o n , 1983 Pseudomonas sp. 1 endoglucanase i n d i c a t o r p l a t e s Wol f f et al . , 1986 Pseudomonas f l u o r e s c e n s 1 endoglucanase i n d i c a t o r p l a t e s Wol f f et al. , 1986 sub sp. ce1 1u 1osa Ruminococcus f l a v e f a c i e n s 1 endoglucanase i n d i c a t o r p l a t e s B a r r a s and Thomson, 1987 A s p e r g i 1 l u s n i q e r 1 0 - g l u c o s i dase i n d i c a t o r p l a t e s P e n t t i l a et al., 1984 Candida p e l l i c u l o s a 1 0-g 1ucos i dase i n d i c a t o r p l a t e s Kohchi and Toh-e, 1985 Kluyveromyces f r a g i l i s 1 p-g1ucos i d a s e enzyme a s s a y s Raynal and G u e r i n e a u , 1984 Tricho d e r m a r e e s e i 1 exoglucanase d i f f e r e n t i a l Shoemaker et al., 1983 h y b r i d i z a t i o n of cDNA probes; 1 endoglucanase h y b r i d s e l e c t i o n of mRNA P e n t t i l a et al., 1986 1 exog1ucanase d i f f e r e n t i a l T e e r i er al., 1983 h y b r i d i z a t i o n of cDNA probes; 1 exoglucanase h y b r i d s e l e c t i o n of mRNA T e e r i et al., 1987 17 binding domains are already emerging (Enari and Niku-Paavola, 1987; Knowles et al., 1987; Langsford et al., 1987; Teeri et al., 1987; van Tilbeurgh et al., 1986; Warren et al . , 1986, 1988; Yaguchi et al., 1983). This discussion w i l l be li m i t e d to the application of molecular biology to the study of Cellulomonas fimi c e l l u l a s e s . An excellent review a r t i c l e by Beguin et al. (1987) provides a detailed account of the cloning and characterization of recombinant c e l l u l a s e s . The genus Cellulomonas comprises a group of coryneform Gram-variable, mesophilic, fac u l t a t i v e anaerobic rods, many of which are capable of degrading c e l l u l o s e (Keddie, 1974). Although not as extensively studied as Trichoderma spp., there i s a considerable body of information on their basic physiology and biochemistry. Cellulomonas spp. have the p o t e n t i a l for single c e l l protein production from waste c e l l u l o s i c s (Hitchner and Leatherwood, 1980; Enriques, 1981), and also for d i r e c t s a c c h a r i f i c a t i o n of c e l l u l o s i c s (Hagget et al . , 1979). Several types of mutant of Cellulomonas strains have been isolated: those resistant to end-product i n h i b i t i o n (Choudhury et al ., 1980) or c a t a b o l i t e repression (Stewart and Leatherwood, 1976); and those that produce increased levels of c e l l u l a s e s (Choi et al . , 1978) . The most intensively studied Cellulomonas sp. at both the biochemical and genetic levels i s Cellulomonas fimi (Beguin and Eisen, 1978; Beguin et al.,. 1977; Gilkes et al . , 18 1984a,b,c; Greenberg et al., 1987a,b; Guo et al., 1988; Langsford et al., 1984, 1987; O'Neill et al., 1986a,b,c; Owolabi al., 1988; Wakarchuk a/., 1984; Warren e? al ., 1986, 1988; Whittle a/., 1982; Wong et al., 1986). This organism produces a complex mixture of enzymes active against CMcellulose during growth on microcrystalline c e l l u l o s e (Avicel) (Beguin et al . , 1977; Beguin and Eisen, 1978; Langsford et al., 1984), at least some of which are glycosylated (Beguin and Eisen, 1978; Langsford et al., 1984). Several of the enzymes bind strongly to the substrate; others bind weakly and are removed by water or dil u t e buffer (Beguin et al ., 1977, Beguin and Eisen, 1978; Langsford et al., 1984; Owolabi et al. , 1988). Two of the t i g h t l y bound enzymes, both glycoproteins, have been characterized in d e t a i l . They are eluted from Avicel with 6 M guanidium hydrochloride. One of them is an exoglucanase (Exg); the other, an endoglucanase (EngA) (Gilkes et al., 1984c; Langsford et al . , 1984). Both enzymes hydrolyse CMcellulose, a l b e i t with d i f f e r e n t k i n e t i c s , but only the Exg hydrolyses pNPC and MUC. The structural genes, cenA for EngA and cex for Exg, were cloned in E. c o l i on the vector pBR322 (Gilkes et al ., 1984a; Whittle et al ., • 1982). The genes have been sequenced; their coding regions were i d e n t i f i e d by comparison of the nucleotide sequences with the NH 2-terminal amino acid (aa) sequences of the enzymes p u r i f i e d from C. fimi (O'Neill et al., 1986a; Wong et al., 1986). The cenA 19 gene (1347 bp) encodes a polypeptide of 449 aa, including a 31 aa leader peptide (Wong et al . , 1986). The cex gene(l452 bp) encodes a polypeptide of 484 aa, including a 41 aa long leader peptide (O'Neill et al ., 1986a). Both leader peptides function in the processing and export of each enzyme into the periplasm of E. c o l i (O'Neill et al., 1986b; Wong et al., 1986). Although the natural cex and cenA promoters (Greenberg et al., 1987a) were present on the cloned fragments, operon fusion experiments in E. c o l i showed that tr a n s c r i p t i o n of these genes in E. c o l i absolutely required E. c o l i promoter sequences (O'Neill et al ., 1 986c; Wong et al., 1986). Using the above information, both the cenA and cex genes have been engineered for overproduction in E. c o l i (Guo et al., 1988; O'Neill et al., 1986c). To obtain the overproduction of Exg, the cex coding sequence was fused to a synthetic ribosome-binding s i t e and an i n i t i a t i n g ATG , and placed under the control of the leftward promoter of bacteriophage lambda contained on the run-away r e p l i c a t i o n plasmid vector pCP3 (O'Neill et al., 1986c). With the exception of an inserted asparagine adjacent to the i n i t i a t i n g ATG, the highly expressed Exg (20 % of t o t a l c e l l u l a r protein) was id e n t i c a l to the native exoglucanase. However, the pCP3~cex-directed overproduction of Exg led to i t s accumulation in the cytoplasm as aggregates devoid of a c t i v i t y . The aggregates sedimented readily and could be s o l u b i l i z e d in either 6 M Urea and 5 M guanidium 20 hydrochloride. Following s o l u b i l i z a t i o n and d i a l y s i s , p a r t i a l recovery of Exg a c t i v i t y was obtained (O'Neill et al ., 1986c). To obtain overexpression of the cenA gene, i t s coding sequence was fused to the t r a n s l a t i o n a l and t r a n s c r i p t i o n a l signals of the E. c o l i lac operon in pUCl8 (Guo et al., 1988). In t h i s construct, the length of the EngA leader peptide was increased by 9 aa, none of which was basic. Nonetheless, the hybrid leader peptide was recognized and processed by E. c o l i . Moreover, the 800-fold overexpression caused the c e l l s to release EngA in the culture medium by non-specific leakage from the periplasm in a temperature-dependent manner (Guo et al., 1988). It has been suggested that the accumulation of a protein to a high l e v e l in the periplasm d e s t a b i l i z e s the outer membrane of E. c o l i resulting in the leakage of periplasmic proteins to the medium (Gatz and H i l l e n , 1986). Comparison of the predicted aa sequences of Exg (443 aa) and EngA (418 aa) show that each enzyme has three d i s t i n c t regions: a short sequence of about 20 aa composed only of proline and threonine (the Pro-Thr box), which i s conserved almost p e r f e c t l y in the two enzymes; a region r i c h in hydroxyamino acids but of low charge density, which i s 50% conserved; and a region, comprising about 70% of the polypeptide, which i s poorly conserved but contains a potential active s i t e , Glu - Xaa 7 - Asn - Xaa 6 - Thr. The order of the regions i s reversed in the two enzymes (Fig. 3; Langsford et al., 1987; Warren et al., 1986). The Pro-Thr J 21 Figure 3. Overall structures of Exg (a) and EngA (b) of C. fim i , and of the fusion protein Exg-EngA (c) from E. c o l i . PT denotes the Pro-Thr box; AS denotes the putative active s i t e ; arrows indicate C. fimi protease cleavage s i t e s of recombinant enzymes. Numbers refer to amino acids, begining at the mature NH 2 -termini. The fusion protein lacks the Pro-Thr box and a l l of the irregular low charge hydroxyl r i c h region of EngA, and most of a similar region of Exg (adapted from Langsford et al ., 1987; Warren et al., 1986 and 1988). H2N 'AS j ORDERED I I CHARGED J L IRREGULAR LOW CHARGE HYIDROXYLRICH COOH 316 335 443 H2N IRREGULAR LOW CHARGE HYDROXYLRICH PT 112 134 1 r ORDERED Uc CHARGED j i L COOH 418 H2N AS ORDERED CHARGED PT 316 335 367 ORDERED CHARGED 'AS! COOH 641 NO 23 box may be a s i t e for O-linked glycosylation. The sequence Asn-Xaa-Ser/Thr which occurs 6-8 times in both enzymes (4 such s i t e s in the conserved irregular regions) i s a potential glycosylation s i t e for N-linked sugars (Warren et al ., 1986). Mannose appears to be the sole glycosyl component of the two enzymes from C. f imi (Arfman et al . , 1987; M. Langsford, personal communication). Glycosylated EngA and Exg from C. fimi have been compared with their non-glycosylated counterparts produced in E. c o l i (Langsford et al ., 1987). Glycosylation of the enzymes does not s i g n i f i c a n t l y affect t h e i r k i n e t i c and substrate binding properties or their s t a b i l i t i e s toward heat and pH. However, the glycosylated enzymes are protected from attack by C. fimi protease when bound to Av i c e l , whereas the non-glycosylated enzymes y i e l d active, truncated products, 30 kDa from EngA (48 kDa) and 39 kDa from Exg (46.5 kDa), with greatly reduced a f f i n i t y for c e l l u l o s e . Immunological characterization of the proteolysis products from both recombinant enzymes with the antiserum to synthetic Exg Pro-Thr box showed the presence of 15 kDa and 39 kDa immunoreactive fragments from EngA and Exg, respectively (Langsford et al., 1987). These data are consistent with a bifunctional organization of the enzymes: the C. fimi protease s p e c i f i c a l l y cleaves both enzymes at si t e s close to the carboxyl-terminus of the Pro-Thr box, generating two fragments, one containing the c a t a l y t i c region, and the other the ce l l u l o s e binding region (Fig. 3). 24 In another study, the sequences of the cex and cenA genes encoding the c a t a l y t i c domains of Exg and EngA were joined together (Warren et al, 1988). The gene fusion encodes a polypeptide with both exoglucanase and endoglucanase a c t i v i t i e s but unable to bind to A v i c e l , presumably because i t lacks an intact substrate binding region (Fig. 3). These properties further support the bifu n c t i o n a l organization of the enzymes. IV Objectives of t h i s thesis The primary goal of the Cellulase Research Group at the University of B r i t i s h Columbia i s the characterization of a l l the components of the C. fimi c e l l u l a s e system. The successful reconstruction by molecular genetics of the entire c e l l u l a s e system depends on an understanding of a l l the s t r u c t u r a l genes involved. To t h i s end, another endoglucanase gene was also cloned from C. fimi into pBR322 (Gilkes et al. , 1984a). The r e s u l t i n g plasmid, pEC3, was reported to contain a 5.6 kb BamHI fragment of C. fimi DNA (Gilkes et al.,1984a) expressing endoglucanase a c t i v i t y in E. c o l i , a l b e i t at a very low l e v e l (Gilkes et al., 1984c). A s i g n i f i c a n t f r a c t i o n of th i s a c t i v i t y was found in the periplasm of the heterologous host (Gilkes et al ., 1984a). This thesis describes the s t r u c t u r a l gene (cenB) for C. fimi endoglucanase B (EngB) c a r r i e d by pEC3, i t s increased expression in E. c o l i , and the p u r i f i c a t i o n and characterization of recombinant EngB from E. c o l i . 25 MATERIALS AND METHODS I Bacterial s t r a i n s , plasmids and phages C. fimi ATCC 484 was the source of the endoglucanase B gene. The E^ _ c o l i strains C600, JM101, RR1 and BD1854 were described previously (Appleyard, 1954; Jensen et al., 1984; Peacock et al ., 1981; Yanisch-Perron et al., 1985). The plasmids pBR322, pel857, pCP3, pEC3, pUCl8, pUCl9 and pDR540 were described previously (Bolivar et al. , 1977; Gilkes et al., 1984a; Norrander et al., 1983; Remaut et al , 1983; Russell and Bennett, 1982; Yanisch-Perron et al . , 1985). The phage vectors Ml3mp11 and M13mpl8 were described previously (Messing, 1 983; Yanisch-Perron et al . , 1985). The c h a r a c t e r i s t i c s of these b a c t e r i a l s t r a i n s , plasmids and phages are given in Table I I . II C u l t i v a t i o n conditions C. f imi was grown at 30°C in basal s a l t medium (Hitchner and Leatherwood, 1980) supplemented with 3% Avicel or 0.1% gl y c e r o l . Except for E. c o l i JM101, which was maintained on M9 minimal medium plates ( M i l l e r , 1972), a l l other E. c o l i strains were grown in Luria broth (LB) (M i l l e r , 1972). A m p i c i l l i n (100 ixg/ml) was used when growing bacteria containing plasmids. S o l i d media contained 11 g agar per l i t e r . When screening recombinant clones for endoglucanase a c t i v i t y 0.1% CMcellulose (Low v i s c o s i t y , DP Table II B a c t e r i a l s t r a i n s , plasmids and phages B a c t e r i a l s t r a i n Relevant genotype Reference E. c o l l C600 t h l - 1 thr-1 leuBG lacY1 tonA21 supE44 Appleyard , 1954 E. co l 1 BD1854 m1nA minB th i rpSL tonA lac Jensen et al., 1984 E. c o l 1 RR1 hsds20(r^-mg) ara-14 proA2 galK2 rpsL20 supE44 Peacock et al., 1981 E. c o l l JM101 supE th1 A( lac -p roAB) [F ' t raD36 proAB laclPZAM15] Yan1sch-Perron et al. , 1985 C. f l m l ATCC484 c e l l u l o s e u t i l i z a t i o n Plasmids Relevant features Reference pBP.322 Amp", Te t R Bol War et al . , 1977 pEC3 AmpR G1 1kes et al . , 1984a pUC18 AmpR l a c Z ' Yanisch-Per ron et al. , 1985 pUC19 AmpR 1 acZ ' ' Norrander et al., 1983 pDR540 AmpR q a l K + Russe l l and Bennett , 1982 pCP3 Amp", ts runaway r e p l i c a t i o n , V O J ^ P L Remaut et al., 1983 pcI857 KanR, VcI857^s Remaut et ,al . , 1983 Phage Relevant features Reference M13mp1 1 l a c Z ' Messing, 1983 M13mp18 1acZ' Yanisch-Per ron et al. , 1985 27 400) was incorporated into LB-agar plates. III B i o l o g i c a l screening for endoglucanase a c t i v i t y The interaction of the dye Congo red with intact /3-glucans provided a basis for a rapid and sensitive assay system for screening recombinant clones with endoglucanase a c t i v i t y . E. c o l i clones carrying recombinant plasmids expressing endoglucanase were picked onto both a master LB-agar plate and a LB-agar-CMcellulose plate. The use of CMcellulose for the q u a l i t a t i v e assay of endoglucanases has been described previously (Teather and Wood, 1982). After incubation of the plates at 30 to 37°C for 8-12 hours, the colonies were removed and the plates were flooded with Congo red dye solution (2 mg/ml) then rocked gently on a platform for 15 min. The Congo red solution was poured o f f , and the plates were flooded with 1 M NaCI and rocked as above. The zones of hydrolysis were pale yellow against a red background. IV Preparation and l o c a l i z a t i o n of proteins A) Elution of Avicel-bound C. fimi proteins with water 5 l i t e r s of a 6 day stationary phase culture of C. fimi (grown in 3% Avicel-basal s a l t s medium) were allowed to set t l e at 23°C for 1 hour. After removing the supernatant by aspiration, the ce l l u l o s e s l u r r y was centrifuged at 4000 g for 15 min at 4°C. The remaining supernatant and c e l l s 28 were discarded. The c e l l u l o s e p e l l e t was resuspended in d i s t i l l e d water to a t o t a l volume of 1.5 l i t r e s and centrifuged as above. The f i n a l p e l l e t was discarded. The water eluates were combined, adjusted to 0.02% sodium azide, c l a r i f i e d by further centrifugation and concentrated 250-fold by pressure f i l t r a t i o n through an Amicon PM10 membrane. B) E x t r a c e l l u l a r C. fimi protease A 100ml 2 day exponential phase culture of C. fimi (grown in 0.1% glycerol-basal sa l t s medium) was centrifuged at 7000 g for 20 min at 4°C. The supernatant was f i l t e r e d through a 0.22jum f i l t e r unit ( M i l l i p o r e ) , adjusted to 0.02% sodium azide and kept at 4°C. C) Loc a l i z a t i o n of recombinant EngB Proteins from t o t a l c e l l extracts were prepared by breaking the c e l l s with a French press (Whittle et al., 1982). Periplasmic proteins were isolated by osmotic shock (Nossal and Heppel, 1966). Cytoplasmic proteins were prepared by rupturing the osmotically shocked c e l l s with a French press. V P u r i f i c a t i o n of intact or truncated recombinant EngB E. c o l i RR1 containing pJB30l or pJB303 was grown in 10 l i t r e s Luria broth in a s t i r r e d fermenter at 30°C. Exponentially growing c e l l s were harvested with a centrifuge 29 (Sharpies) and washed with 2 l i t r e s of ice-cold 0.01 M Tris-HCl (pH 7 . 1 ) - 0.03 M NaCl. The periplasmic f r a c t i o n of the c e l l s was prepared as described (Nossal and Heppel, 1966) and kept in buffer A (50 mM potassium phosphate, pH 6.9, 0.02% sodium azide) containing phenylmethylsulfonyl fluoride (20 ng/ml) at 4°C u n t i l needed. Avic e l was s t i r r e d gently in d i s t i l l e d water (20ml/g), and centrifuged at 4000 g for 5 min to remove " f i n e s " . This step was repeated 4 times, and the Avicel was f i n a l l y resuspended in the same volume of water. After autoclaving for 30 min (121°C, 15 l b / i n 2 ) i t was l e f t to cool to room temperature (23°C). The aqueous phase was replaced and discarded twice as above, and f i n a l l y replaced with buffer A. After overnight e q u i l i b r a t i o n at 4°C, the l i q u i d was removed. The wet s e t t l e d A v i c e l was resuspended in ice-cold buffer A (4ml/g) and kept on i c e . A 350 ml volume of periplasmic f l u i d (from 10 l i t r e s of culture) was mixed with 150 ml of the autoclaved Avicel (containing approximately 25 g of dry A v i c e l ) , and kept on ice for 1 hour. A l l subsequent steps were carr i e d out at room temperature. The unadsorbed material was separated from Avicel by f i l t r a t i o n through sintered glass (GF/C). The Avicel-enzyme complex was washed once with buffer A by f i l t r a t i o n as above, resuspended in half i t s volume of fresh buffer and packed into a column (2.5 cm x 13 cm). Proteins bound to Avicel were eluted with a concave descending gradient of buffer A (55 ml) and water (800 ml), at a flow 30 rate of 30 ml/hour. Fractions containing endoglucanase a c t i v i t y were pooled and concentrated by pressure f i l t r a t i o n through an Amicon PM10 membrane before loading or loaded d i r e c t l y onto a Pharmacia Mono Q anion exchange column that was equilibrated in buffer B (20 mM Tris-HCl, pH 7.5). The protein was eluted with a 30-40 ml gradient of zero to 0.15 or 0.20 M NaCI in buffer B. Those fractions with the highest s p e c i f i c a c t i v i t y were pooled and desalted by gel f i l t r a t i o n using Bio-Gel P-6DG. VI Enzyme assays and protein determination A) Reducing sugar assays CMcellulase a c t i v i t y was determined by colo r i m e t r i c estimation of sugars using the DNSA (Miller et al ., 1960) or p-hydroxybenzoic acid hydrazide (p-HBAH) (Lever, 1973) method. The assay conditions for the DNSA method were as follows: 0.25 ml of appropriately d i l u t e d enzyme solution was mixed with 0.5 ml of 4% CMcellulose (Low v i s c o s i t y , DP 400) in buffer A. After 1 hour incubation at 37°C, the reaction was stopped with 0.8 ml of d i n i t r o s a l i c y l i c a c i d reagent ( M i l l e r , 1959); 0.05 ml of 0.1% glucose was added, and the tubes were steamed for 15 min. The absorbance was read at 550 nm against appropriate blanks containing equivalent amounts of enzyme added afte r mixing substrate with DNSA reagent. One unit of enzyme released 1 nmole glucose equivalents per min by reference to a glucose 31 standard curve. The assay conditions for the p-HBAH method were as follows: 0.1 ml of appropriately d i l u t e d enzyme solution was mixed with 0.4 ml of 0.5% CMcellulose (Low v i s c o s i t y , DP 400) in buffer C (50 mM sodium c i t r a t e , pH 6.8). After incubation at 30°C for 30 min, the reaction was stopped with 1.0 ml p-HBAH reagent (Lever, 1973); and the tubes were steamed for 12 min. The absorbance was read at 420nm against blanks containing equivalent amounts of enzyme added after mixing substrate with p-HBAH reagent. One unit of enzyme a c t i v i t y released 1 nmole glucose equivalents per min by reference to a glucose standard curve. Other polysaccharides (0.8 to 2.0 mg/ml, f i n a l concentration) were incubated with appropriately diluted enzyme in buffer C ( t o t a l volume was 0.5 ml) at 30°C for 30 min. The reducing sugar was determined with the p-HBAH reagent as described above. B) Aryl glycosidase assays Aryl glycosidase a c t i v i t i e s (p-nitrophenyl cellobiosidase, p-nitrophenyl xylosidase, p-nitrophenyl glucosidase) were determined by incubation of 0.5 ml of 5 mM substrate with 0.5 ml of appropriately d i l u t e d enzyme in buffer A at 37°C for 1 hour. The reaction was stopped with 0.5 ml of 1 M Na 2C0 3. The absorbance was read at 410 nm against blanks containing equivalent amounts of enzyme added after mixing substrate with 1 M Na 2C0 3. One unit of a r y l glycosidase was that amount of enzyme which li b e r a t e d 1 nmol 32 of p-nitrophenol per min at 37°C. C) /3-lactamase assay /3-lactamase a c t i v i t y was assayed spectrophotometrically following the release of ni t r o c e f o i c acid from n i t r o c e f i n (O'Callaghan et al., 1972). A 1.0 mM stock solution of ni t r o c e f i n was prepared by dissol v i n g 5.2 mg of n i t r o c e f i n in 0.5 ml of DMSO and then d i l u t i n g t h i s solution into 9.5 ml of buffer A. The assay contained 0.05 ml of 1.0 mM n i t r o c e f i n , 0.9 ml of buffer A, and 0.05 ml of appropriately di l u t e d c e l l extract. This solution was immediately mixed in a cuvette and the rate of change of absorption at 486 nm was recorded. The results were plotted as change in O.D. at 486 nm versus time; only values in the linear range of the plot were used for cal c u l a t i o n s . A 0.01 M soluti o n of nit r o c e f o i c acid has an O.D. at 486 nm = 1.55 (O'Callaghan et al ., 1972). One unit of enzyme a c t i v i t y released 1 nmole of n i t r o c e f o i c acid per min at 23°C. D) /3-galactosidase assay /3-galactosidase a c t i v i t y was measured according to M i l l e r ( 1 972) , by the hydrolysis of o-ni trophenyl-/3-galactoside (0NPG). The assay conditions were as follows: 0.2 ml of ONPG (4 mg/ml) was added to 1.0 ml of pre-incubated enzyme and Z-buffer ( M i l l e r , 1972). After 10 min incubation at 28°C, the reaction was stopped with 0.5 ml of 1 M Na 2C0 3 solution. The absorbance was read at 420 nm 33 against a Z-buffer blank. One nmole/ml of o-nitrophenol (ONP) has an O.D. at 420nm = 0.0045. j3-galactosidase a c t i v i t y was calcul a t e d as described ( M i l l e r , 1972). One unit of 0-galactosidase a c t i v i t y is the amount of enzyme which produces 1 nmole o-nitrophenol per min at 28°C. E) Protease assay Protease a c t i v i t y was determined by the hide powder blue assay (Rinderkneckt et al., 1968). 1.5 ml enzyme in buffer D (50 mM Tris-HCl pH 7.8) was mixed with 10 mg hide powder azure. After 1 hour incubation at 37°C, the reaction tubes were cooled on ice and centrifuged. The absorbancies at 595 nm of the supernatant solutions were taken against buffer blanks. Protease a c t i v i t y was standardized with collagenase (Sigma); one unit of a c t i v i t y releases 1 Mmol L-leucine in 5 hours at pH 7.8 and 37°C. F) Protein determination Protein was determined by the dye binding assay (Bradford, 1976) using bovine plasma albumin as standard. VII DNA methodology A) Plasmid DNA i s o l a t i o n and analysis Plasmid DNA for r e s t r i c t i o n analysis was isolated by the alkaline l y s i s procedure (Birnboim and Doly, 1979). Plasmid DNA to be sequenced was p u r i f i e d by banding in 34 CsCl-ethidium bromide density gradients (Maniatis et al . , 1982). The M13RF and v i r a l DNAs were i s o l a t e d from infected cultures as described (Messing, 1983). DNA r e s t r i c t i o n fragments were resolved by agarose gel electrophoresis (Maniatis et al ., 1982). B) Oligonucleotide synthesis and p u r i f i c a t i o n The deoxyoligoribonucleotide 5'-CTTTATGCTTCCGGCTCGTA-3' (20-mer) to be used as primer for sequencing junctional regions of fusion plasmids was synthesized by Dr. T. Atkinson at the University of B r i t i s h Columbia, using an Applied Biosystems automated DNA synthesizer model 380A as described (Atkinson and Smith, 1984). The oligonucleotide was p u r i f i e d by polyacrylamide gel electrophoresis (PAGE) on a 20% acrylamide-7M urea sequencing gel, located by UV shadowing on a thin-layer-chromatography (TLX) plate, and extracted from the gel by the crush and soak method (Atkinson and Smith, 1984). C) DNA sequencing Fusion regions of deletions at the 5' end of the C. fimi chromosomal DNA subcloned in pUCl9, generated with Exonuclease III and S, nuclease (Guo and Wu, 1983; Roberts and Lauer, 1979), were sequenced by the double stranded sequencing technique of Hattori and Sakaki (1986), using the above oligonucleotide as primer. The 400 bp BamHI - PstI fragment and some r e s t r i c t i o n fragments of the deleted DNA 35 were subcloned into M13mp11 and/or M13mpl8, then sequenced by the enzymatic procedure of Sanger et al . (1977). The presence and number of the PTIS (portable translation i n i t i a t i o n s i t e ) sequences inserted in the pCP3 expression vector were confirmed by DNA sequencing using the base-specific chemical degradation method (Maxam and Gi l b e r t , 1980). VIII M i n i c e l l s M i n i c e l l s were prepared from E. c o l i BD1854 transformed with appropriate plasmids using the method of Jensen et al. (1984), with modifications. The c e l l s were harvested by centrifugation and resuspended in 20 ml of M9 minimal medium (M i l l e r , 1972). The minicells were separated from real c e l l s by sedimentation in a 30 ml 5-20% sucrose gradient for 15 min at 5000rpm in a Beckman SW-27 rotor at 4°C. After tapping the m i n i c e l l s and p e l l e t i n g them, the sucrose gradient step was repeated. The mini c e l l s were again tapped, p e l l e t e d , washed once in 5 ml M9 medium, and resuspended in the same medium to an A 4 S 0 of about 2. Samples (0.5 ml) were prepared containing 0.4 ml of the above suspension of mi n i c e l l s , glucose (0.1%), 5 mM each of the protein amino acids except methionine, thiamine (2 yg/ml), b i o t i n (2 uq/ml), h i s t i d i n e (100 yg/ml), and preincubated for 20 min at 37°C. 5 /iCi of [ 3 5S] methionine were added to each sample and incubated further for 1 h at the same temperature. 36 IX Electrophoretic analysis of proteins Proteins were analysed by PAGE in sodium dodecyl sulfate (SDS) containing gels as previously described (Laemmli, 1970). The stacking gels were 3% acrylamide and the separating gels were 7.5% acrylamide (1.5 mm t h i c k ) . The r a t i o of acrylamide to bis-acrylamide was 30:0.8. Electrophoresis was performed at a constant voltage of 70 for stacking and 120-140 for separation. Gels were cooled with running tap water. Endoglucanase a c t i v i t y in the gels was detected with modifications of the Congo red-stained agar r e p l i c a method (Beguin, 1983). After polyacrylamide gel electrophoresis, SDS was removed by washing the gel four to six times for 30 min in buffer A. The f i r s t two washes contained 25% isopropanol. The washed and p a r t i a l l y dried gel was l a i d on top of a thin sheet (0.75 mm thickness) of 2% agarose containing 0.1% CMcellulose (High v i s c o s i t y grade, DP 3000) in buffer A. After overnight incubation at 30°C, zones of CMcellulose hydrolysis were revealed by s t a i n i n g the agarose r e p l i c a with Congo red. Protein was v i s u a l i z e d by staining with 0.03% Coomassie b r i l l i a n t blue dissolved in 10% acetic acid and 25% 2-propanol. Excess stain was removed by soaking the gel in 10% acetic acid u n t i l background s t a i n i n g was minimal. Destained gels were dried at room temperature in cellophane 37 sandwiches (Juang et al., 1984). Radioactive gels containing [ 3 5S] methionine-labelled proteins were dried onto Whatman 3MM paper under vacuum and the l a b e l l e d proteins were located by autoradiography. X Immunological detection of EngB 0.1 mg of Avic e l a f f i n i t y p u r i f i e d intact EngB (110 kDa) was mixed with Freund's complete and incomplete adjuvant (1:1), and injected subcutaneously at 3 week in t e r v a l s into a New Zealand white rabbit. Serum was c o l l e c t e d a week after the t h i r d i n j e c t i o n . The antiserum was tested against the intact EngB, using an enzyme-1inked-immunoadsorbent assay (ELISA) as described (Voller et al., 1976). Polypeptides on polyacrylamide gels were detected by immunoblotting as previously described (Towbin et al., 1979), using the alkaline phosphatase/5-bromo-4-chloro~3-indolyl-phosphate (X-phosphate) detection system (Blake et al ., 1984) . XI Determination of NH 2 _terminal amino acid sequence and amino ac i d composition of intact EngB The NH 2 -terminal amino acid sequence of intact recombinant EngB was' determined by automated Edman degradation using an Applied Biosystems model 470A gas sequenator u t i l i z i n g the resident sequencing program. The aa residues were analyzed by reversed phase HPLC 38 chromatography. These analyses were provided by the University of V i c t o r i a protein sequencing f a c i l i t y . The aa composition of intact recombinant EngB was determined at the University of Calgary protein sequencing f a c i l i t y . XII Enzymes and reagents Growth media components were from Difco. A l l r e s t r i c t i o n endonucleases were purchased from Bethesda Research Laboratories, Burlington, Canada or Pharmacia, Dorval, Canada. Calf i n t e s t i n a l phosphatase was from Boehringer Mannheim, Dorval, Canada. IPTG, X-Gal, CMcellulose (low v i s c o s i t y , DP 400, DS 0.7; high v i s c o s i t y , DP 3000, DS 0.7), PMSF, ONPG, collagenase, and hide blue powder were from Sigma, St. Louis, Missouri, U.S.A. Acrylamide, bis-acrylamide, Bio-Gel P-D6G and Coomassie b r i l l i a n t blue were from Bio-Rad, Mississauga, Ontario, Canada. Avicel (Type PH-101) was from PMC International, Cork,Ireland. N i t r o c e f i n was a g i f t from Glaxo Group Res. Ltd., Greenford, U.K. SDS was from BDH Biochemicals, Toronto, Canada. Radioactive deoxyribonucleotide-5-triphosphates and [ 3 5S] methionine were from NEN Research Products, Boston, U.S.A. and Amersham Canada Ltd, Oakville, Canada, respectively. A l l solvents used for FPLC were of HPLC grade and were obtained from Fisher S c i e n t i f i c , Vancouver, Canada. 39 RESULTS I Genetic characterization and increased expression of the cenB gene A) Determination of the d i r e c t i o n of tr a n s c r i p t i o n of the cenB gene The o r i g i n a l l i b r a r y of fimi genes was constructed by l i g a t i n g a BamHI digest of genomic DNA into the BamHI s i t e of pBR322 (Gilkes et al., 1984a). E. c o l i C600 c e l l s were transformed with the l i g a t i o n mix. Expression of endoglucanase a c t i v i t y in recombinant clones was determined using an immunological plate screening method (Whittle et al. , 1982), CMcellulose-Congo red indicator plate or by assaying CMcellulase a c t i v i t y in c e l l extracts with the DNSA method (Gilkes et al. , 1984a). The plasmid pEC3 encodes an endoglucanase (Fig. 4; Gilkes et al., 1984c) on an insert of about 5.6 kb (Fig. 5; Gilkes et al., 1984a). The cloned C. fimi gene (cenB) i s d i f f e r e n t and d i s t i n c t from cenA and cex, based on the r e s t r i c t i o n endonuclease maps of their DNA fragments and the degree of randomness of attack of CMcellulose by the crude c e l l extracts (Gilkes et al. ,1984a,c). In order to i d e n t i f y the t r a n s c r i p t i o n a l regulatory sig n a l for the expression of the cenB gene, derivatives of 41 Figure 5. Construction of various pEC3 derivatives. The cenB gene was contained on a 5.6kb BamHI fragment (boxed a r e a i l inserted into the BamHI s i t e of pBR322 to y i e l d pEC3 (Gilkes et al ., 1984a; Whittle et al., 1982). To construct pEC30l, pEC3 was digested to completion with BamHI and religated; plasmids with inserts in opposite orientation to Ptet were confirmed by EcoRI and Kpnl double digests which generated 4.7kb and 5.3kb EcoRI-Kpnl fragments. pEC3 was r e s t r i c t e d with EcoRI and Hindi 11, the ends were " f i l l e d i n " in the presence of the Klenow fragment of DNA polymerase I and liga t e d to obtain pEC302. pEC303 was obtained by substituting the promoter and the f i r s t 289 bp of the tet r a c y c l i n e coding region with the tac promoter fragment from the plasmid pDR540 (Russell and Bennett, 1982). pEC3 was r e s t r i c t e d with BamHI and EcoRI and the 5.6kb BamHI and 4.0kb EcoRI-BamHI fragments were isol a t e d . The tac promoter was g e l - p u r i f i e d as an EcoRI-BamHI fragment from pDR540. Ligation of the tac promoter fragment, the 5.6kb BamHI fragment and the 4.0kb EcoRI-BamHI fragment yielded pEC303. Ptet, t e t r a c y c l i n e promoter; Ptacf tac promoter. R e s t r i c t i o n s i t e s : B, BamHI; E, EcoRI; H3, Hindi 11; K, Kp_nl; P, PstI . 42 pEC3 were constructed ( F i g . 5). F i r s t , the 5.6 kb BamHI DNA fragment was inverted with respect to the tet promoter in pBR322 (Sutcliffe,1979, Stuber and Bujard, 1981), to give the plasmid pEC'301. Secondly, the tet promoter was inactivated by digestion of pEC3 with EcoRI and HindiII, " f i l l i n " of the staggered ends with the Klenow fragment of DNA polymerase I, and c i r c l e reclosure. The resulting plasmid was designated pEC302. The plasmid pEC303 (Fig. 5) was constructed by replacing the tet promoter of pEC3 with the tac promoter from pDR540 (Russell and Bennett, 1982). Endoglucanase expression from either pEC30l or pEC302 was d r a s t i c a l l y reduced (Table I I I ) . The s p e c i f i c endoglucanase a c t i v i t y was increased about 7-fold in pEC303 (Table I I I ) . These results indicate that the tra n s c r i p t i o n of the cenB gene in pEC3 i s dependent upon the tet promoter. The increased expression of the gene in pEC303 further supports thi s view, and r e f l e c t s the "strength" of the tac promoter (de Boer and Shepard, 1983). The electrophoretic pattern of proteins synthesized in min i c e l l s of E. c o l i BD1854 containing pBR322, pEC3 or pEC303 i s shown in F i g . 6. In addition to the j3-lactamase proteins of pBR322 (laneB) a polypeptide of Mr 110,000 was synthesized in pEC3 and pEC303 (lanes C and D). B) Delineation of the 5' end of the cenB gene The strategy for targeting deletions from the 5' end of the 5.6 kb BamHI fragment i s shown in F i g . 7. The 5.6 kb 43 Table I I I . CMcellulase a c t i v i t i e s of various cenB clones Host Plasmid 3 CMcellulase 0 Strain U/mg pEC3 7.61 C600 PEC301 0.28 PEC302 0.16 pEC303 51.10 pJB3 38.90 RR1 PJB301 146.70 pJB302 167.00 PJB303 156.70 a) For d e t a i l s of plasmid structure see Figures 5 and 11 . pEC3 and pJB3 are the parental clones containing the entire cenB gene. pEC30l, 302 and 303 are derivatives of pEC3 produced to investigate control of t r a n s c r i p t i o n . PJB301 i s a gene fusion of lacZ and cenB. pJB302 and 303 are deletion derivatives of pJB30l. b) CMcellulase a c t i v i t y was determined by assay of reducing sugars with DNSA. 44 Figure 6. Autoradiogram of polypeptides encoded by pBR322, pEC3 and pEC303. E. c o l i BD1854 was transformed with plasmids pBR322, pEC3 and pEC303. The proteins encoded by the plasmids were l a b e l l e d in mini c e l l s (Jensen et a l . , 1 9 8 4 ) . The l a b e l l e d proteins were analyzed by SDS-PAGE. Lane A, BD1854; LaneB, BD1854/pBR322; Lane C, BD1854/pEC3; Lane D, BD1854/pEC303. The molecular weight standards were as shown. The positions of the bla and cenB gene products are indicated by arrows. The exposure was too short to v i s u a l i z e the tet gene product. 45 Figure 7. Scheme for targeting deletions from the 5' end of the cenB gene. pJB3 contained the 5.6kb BamHI fragment (boxed area) carrying the cenB gene subcloned into the BamHI s i t e of pUCl9 such that the transcription was regulated from the lac promoter. The plasmid was opened at the Xbal s i t e , end-labelled with [a- 3 2P] dCTP in the presence of the Klenow fragment of DNA polymerase I, and digested with SphI. Varying amounts of DNA were removed by Exo III and S, nuclease as described (Guo and Wu, 1983; Roberts and Lauer, 1979). Only relevant r e s t r i c t i o n s i t e s are shown. Res t r i c t i o n s i t e s : B, BamHI; H3, Hindi11; S, SphI; X, Xbal. lc-32P]dCTP,Klenow SphI B Exolll B Nuclease B 8 ^Klenow JLigase 47 BamHI fragment of pEC3 was subcloned into pUC19 such that the 5' end was adjacent to the lac promoter/operator region to give plasmid pJB3. Plasmid pJB3 was l i n e a r i z e d at the Xbal s i t e , end-labelled with [a- 3 2P] dCTP and digested to completion with SphI. Then the deletions near the 5'end of the insert were made using Exonuclease III and nuclease S T as described (Guo and Wu, 1983; Roberts and Lauer, 1979). Several clones were examined for endoglucanase a c t i v i t y and insert size (Fig. 8). Deletion of about 100 to 250 bp from the 5' end of the 5.6 kb insert did not affe c t the le v e l of expression of the cenB gene. However, deletions of more than 385 bp prevented expression of the gene. A deletion mapped at about 325 bp from the 5' end of the insert gave a s i g n i f i c a n t l y increased l e v e l of endoglucanase a c t i v i t y . The plasmid was designated pJB30l; i t c a r r i e s an in-frame fusion between codon 16 for the EngB signal peptide (18 codons before the cleavage s i t e ) and codon 7 for the a-fragment of )3-galactosidase (Fig. 9). C) Localization of the 3' end of the cenB gene The plasmid, pJB30l, was cleaved p a r t i a l l y with Smal or PstI and rel i g a t e d . This resulted in the deletion of various lengths of DNA on the 3' side of the cenB gene. Transformants were screened for endoglucanase a c t i v i t y (Fig. 10) and plasmids from active clones were characterized by r e s t r i c t i o n mapping (Fig. 11). The c e l l s from selected clones were assayed quant i t a t i v e l y for endoglucanase 48 Figure 8. Extents of deletions into the 5' end of the cenB gene and effects on CMcellulase a c t i v i t y . E. c o l i RRI AmpR clones containing various deletion plasmids were screened for CMcellulase a c t i v i t y with Congo red. The plasmids were isolated and the sizes of deletions were- determined by r e s t r i c t i o n enzyme analysis and agarose gel electrophoresis. Only the C. fimi DNA fragments are shown, (a) parental fragment; (b-f) deleted fragments with sizes are shown. Transcription depended on the lac promoter/operator provided by pUCl9. CMcellulase phenotypes: inactive; "+", active; "+++", s i g n i f i c a n t l y a c t i v e . R e s t r i c t i o n s i t e s : B, BamHI; P, PstI. a B P i 5 5.6 kb, P _L_ J I CMcellulase g Phenotype -r + + + + + 3 Figure 9. Nucleo t ide sequence of the RBS, t r a n s l a t i o n a l i n i t i a t i o n s i t e and amino-terminus of the fus ion j u n c t i o n of the 1acZ'-cenB express ion - sec re t ion plasmid, pJB301. The f i r s t cenB codon i n the fus ion plasmid r e t a i n s i t s o r i g i n a l p o s i t i o n number (see F i g . 13). The nuc leo t ides and amino acids de r ived from 1acZ' are unde r l i ned . -18 -15 M T M I T P S L A V A V G V ACACAGGAACAGCT ATG ACC ATG ATT ACG CCA AGC CTC GCC GTC GCC GTC GGG GTG -10 -5 -1 +1 L V A P L A T G A A A A P CTC GTC GCC CCG CTC GCG ACC GGC GCG GCC GCC GCG CCC . . . 50 F i g u r e 10. S c r e e n i n g of v a r i o u s cenB s u b c l o n e s on a C M c e l l u l o s e - C o n g o r e d i n d i c a t o r p l a t e . E. c o l i RRI c e l l s c o n t a i n i n g a p p r o p r i a t e p l a s m i d s were screen e d f o r C M c e l l u l a s e a c t i v i t y as d e s c r i b e d ( M a t e r i a l s and Methods). A, pJB3; B, p J B 3 0 l ; C, pJB302; D, pJB303. 51 F i g u r e 1 1 . D i a g r a m s o f p J B 3 a n d i t s d e l e t i o n d e r i v a t i v e s . The c i r c u l a r p l a s m i d s a r e shown i n a l i n e a r f a s h i o n f o r c l a r i t y . The o p e n b a r r e p r e s e n t s P U C 1 9 D N A ; t h e s o l i d b a r r e p r e s e n t s C . f i m i D N A ; t h e s i n g l e l i n e r e p r e s e n t s t h e r e g i o n s d e l e t e d i n e a c h d e r i v a t i v e . T h e a r r o w a t t h e t o p i n d i c a t e s t h e f u n c t i o n a l o r i e n t a t i o n f o r t h e l a c p r o m o t e r . The l e n g t h o f C . f i m i DNA f r a g m e n t i n e a c h p l a s m i d i s i n d i c a t e d . The d e l e t i o n i n p J B 3 0 3 e x t e n d s t o t h e S m a l s i t e (Sm) o f p U C l 9 . R e s t r i c t i o n s i t e s : B , B a m H I ; P , P s t I ; P v , P v u I I ; S , Sp_hl , Sm, S m a l ; X , X b a l . 8 8-3 kb J _ l P l a s m i d p J B 3 Insert(kb) 5 6 Sm P B Pv pJB301 5-3 Sm P P B P V p J B 3 0 2 4.1 Sm P P B Pv P J B 3 0 3 Pv Sm Sm Pv 21 52 a c t i v i t y (Table I I I ) . The shortest, uninterrupted fragment of the 5.3 kb insert which expressed endoglucanase a c t i v i t y equal to that of pJB30l was 2.1 kb long, i t was found in pJB303 (Fig. 11, Table I I I ) . C e l l extracts of E. c o l i RRI containing pJB301, pJB302 and pJB303 were subjected to SDS-PAGE analysis. The separated polypeptides were screened for endoglucanase a c t i v i t y (Materials and Methods). This a c t i v i t y was e a s i l y detected in SDS gels prepared from samples heated in loading buffer for 2 min at 65°C prior to loading. Control experiments showed no noticeable difference in migration of the polypeptides from gently heated or boiled samples (data not shown). Three active polypeptides of Mr 110,000, 95,000 and 82,000 were observed for pJB30l and pJB302; pJB303 encoded an active polypeptide of Mf 72,000 (Fig. 12) D) Structure of the 5' terminal region of the cenB gene The 400 bp BamHI-PstI fragment of pJB3 (Fig. 11) and the deleted inserts generated with Exonuclease III and S, nuclease were subcloned into M13mpll and Ml3mpl8, and the single stranded DNA sequenced using the dideoxy chain termination method (Sanger et al . ,1977). The nucleotide sequence and the deduced amino acid sequence of the C. fimi DNA fragment containing the 5'region of the cenB gene are shown in F i g . 13. The sequence corresponding to the amino terminus of the mature enzyme was located using the amino acid sequence of the protein 53 Figure 12. SDS-PAGE and zymograms of t o t a l c e l l u l a r proteins from E. c o l i RRI containing p J B 3 0 l or i t s deletion derivatives. Lanes A,B,C, are t o t a l c e l l u l a r proteins stained with Coomassie b r i l l i a n t blue. Lane A, R R l / p J B 3 0 l ; Lane B, RRI/pJB302; Lane C, RRl/pJB303. Lanes 1,2, and 3 are zymograms of A,B,C, resp e c t i v e l y . The arrows indicate active endoglucanase components. The molecular weight markers were rabbit muscle myosin, 205,000; E. c o l i 0-galactosidase, 116,000; rabbit muscle phosphorylase b, 97,4000; bovine serum albumin, 66,000; ovalbumin, 45,000; carbonic anhydrase, 29,000. Figure 13. Nucleo t ide sequence of the 5' terminus of cenB gene and the deduced NHi - t e r m i n a l sequence of EngB. The p u t a t i v e RBS i s under l ined . The arrow ind ica tes the E_. c o l i s igna l peptide process ing s i t e . The under l ined amino ac ids were determined by automated Edman degradation of the p u r i f i e d in tac t EngB from E_. col 1 RRI/pJB301. GGATCCCGCGCCCGGCGCGA 1 20 GCCCGCAACCCACGCGCCCACGGATCGGGCCTCACGAGCCCGACGTTGGCGGCCGGGCCGGGGGGCGACCTCGAGACCGA 40 60 80 100 GGAGCCCCCGCGTGAGGCGACGTTGGCCGCGCACGCCGCTGGTGAGCGGGCTGAATCGTTTAGGGCGTTGACCTGCGGAC 120 140 160 180 GGACCCGTCTGGACGATGCGCCAGGCGTCGTGCGGGTGCGACTGCGGACAGCACGGGTCGCCGACCACCACTCCCGTGCC 120 220 240 260 -33 -30 -20 M L R Q V P R T L V A G G S A L CGGAAGAGGACCCC ATG CTC CGC CAA GTC CCA CGC ACG CTC GTC GCG GGT GGC TCC GCC CTC 280 300 320 -10 -1W+1 A V A V G V I V A P I A T G A A A A P T GCC GTC GCC GTC GGG GTG CTC GTC GCC CCG CTC GCG ACC GGC GCG GCC GCC GCG CCC ACC 340 360 380 10 20 Y N Y A E A L Q K S M F F Y Q A Q G G TAC AAC TAC GCC GAG GCC CTG CAG AAG TCG ATG TTC TTC TAC CAG GCG CAC GGC TCC . . . 400 ' 420 cn 55 p u r i f i e d from E. c o l i (see Results,section I I I ) . This sequence i s preceded by one encoding a putative signal peptide of 33 amino acids, with a hydrophilic amino-terminus of 7 amino acids, including two arginines, followed by a hydrophobic sequence of 26 amino acids. The tr a n s l a t i o n a l start codon at nucleotide 275 i s preceded by a stretch of nucleotides (GGAAGAGGA) cl o s e l y resembling other ribosome binding s i t e s (RBSs) (Lofdahl et al., 1983; Gold et al. , 1981; McLaughlin et al.,1981; Vasantha et al. , 1984). The DNA sequence upstream of the i n i t i a t i o n codon contains sequences similar to those of cenA and cex promoter sequences (Fig. 14, Greenberg et al. , 1987a). Recently, a cluster of four s i t e s located 24 to 75 bases 5' to the start codon of the cenB gene was i d e n t i f i e d by S T nuclease protection studies (Greenberg et al . , 1987b). II Export of EngB in E. c o l i A s i g n i f i c a n t f r a c t i o n of the endoglucanase encoded by pEC3 was translocated into the E. c o l i periplasmic space (Gilkes et al . , 1984a). This indicates that the EngB signal peptide functions in E. c o l i . The i s o l a t i o n of the plasmid PJB301 provided an opportunity to study the eff e c t of deleting part of the EngB signal peptide, or forming a hybrid signal peptide, on the export of EngB in this organism. It was also of interest to examine the effect of truncation of EngB on i t s export. Figure 14. Comparison of the cenB, cex and cenA 5' f l a n k i n g reg ions . Conserved nuc leo t ides between cenB ( t h i s t h e s i s ) , cex (Greenberg e t a / . , 1987a; O ' N e i l l e t a / . , 1986a), and cenA (Greenberg e t a / . , 1987a; Wong e t a)., 1986) 5' f l a n k i n g regions are denoted'by * Mapped mRNA s t a r t s i t e s (Greenberg e t a / . , 1987a,b) are unde r l i ned . 5 '->3' cenB : GCTG AATCGTTTAGGGCGTTGACCTGCGGACGGACCCGTC TGG ACGATGCG. . . ** * ***** ** * * ** ******** *** * * * * *** cex : GCCGAAAT GATTCAGCACCT CCC GCGGACGGGCCCCACGTCACAGGGTGCACC. . . ******* *** * ** * * ** * **** **** **** * cenA: TAGGAAATCC TCATCCGCT CGC GCCGTGGGGCATT CGTC GGGTTTCCTCGTCG. 57 Cultures of E. c o l i RRI containing pJB3, pJB30l, pJB302 and pJB303 were harvested in the exponential phase of growth. The periplasmic and cytoplasmic fractions were prepared (Materials and Methods) and assayed for endoglucanase a c t i v i t y . For comparison, 0-galactosidase, a cytoplasmic enzyme, and j3-lactamase, a periplasmic enzyme, were also measured. About 35% of the endoglucanase a c t i v i t y determined by pJB3 appeared in the periplasm (Table IV). In the fusion plasmid pJB30l and derivatives pJB302 and pJB303, the signal peptide was as described (Fig. 9), and in pJB303, the carboxy terminal region of the mature protein was deleted (Figs. 11 and 12). Nonetheless, endoglucanase a c t i v i t y appeared largely in the periplasms of c e l l s carrying these plasmids (Table IV). I l l P u r i f i c a t i o n of intact and truncated EngB from E. c o l i Attempts to i s o l a t e EngB from E. c o l i employing an immunoadsorbent scheme described e a r l i e r (O'Neill et al . , 1986c) were not successful. Therefore a novel a f f i n i t y chromatography scheme was developed based on the adsorption of the enzyme on Avicel (see Materials and Methods). Osmotic shock f l u i d s of RRI/pJB30l or RRl/pJB303 were adsorbed onto autoclaved Avicel on ice for 1 hour. The Avicel-enzyme complex was washed with buffer A (Materials and Methods), and packed into a short column (2.5cm x 13cm). The adsorbed materials were eluted from the Avicel with a descending, concave gradient of buffer A and water at room 58 Table IV. Location of EngB, ^-lactamase, and (3-galactosidase in E. c o l i RR1 cultures Enzyme a c t i v i t y 3 (and s p e c i f i c activity* 3) Plasmid Fraction EngBc ^-lactamase 0-galactosidase pJB3 PJB301 pJB302 pJB303 periplasmic 1 .9 770 0.85 (148.3) (53600) (67.7) cytoplasmic 3.5 1 08 355 (53.5) (1120) (3669) Whole c e l l s 5.4 980 427 (38.9) (7210) (4611) periplasmic 11.6 260 7.9 (644) (14330) (441 ) cytoplasmic 5.6 12.1 1 23 (52.3) (92) (1156) Whole c e l l s 18.1 320 142 (146.7) (3400) (1150) periplasmic 13.6 323 11.7 (689) (16400) (594) cytoplasmic 7.9 1 6 1 32.2 (100) (200) (1679) Whole c e l l s 22.1 371 1 42 (167) (3960) (1515) per iplasmic 14.1 420 9. 1 (726) (21600) (467) cytoplasmic 6.9 20 208 (68.3) (200) (2037) Whole c e l l s 22.6 453 265 (156.7) (3700) (1595) a) Enzyme a c t i v i t y : nmol products released/min/ml culture b) Numbers in parentheses represent the s p e c i f i c a c t i v i t y : nmol products released/min/mg protein c) EngB was determined by assay of reducing sugars with DNSA. 59 temperature. When necessary, pools of endoglucanase-containing fractions were further p u r i f i e d using a Mono Q anion exchange column (Materials and Methods). A representative elution p r o f i l e of intact EngB from the A v i c e l a f f i n i t y column i s shown in F i g . 15. Elution p r o f i l e s of both intact and truncated EngB from the Mono Q anion exchange column are shown in Figs. 16 and 18, respectively. Intact EngB was p u r i f i e d approximately 50-fold (Fig. 17), with more than 50% recovery of enzymatic a c t i v i t y from the Avicel a f f i n i t y column (Table V). Truncated EngB was p u r i f i e d approximately 40-fold (Fig. 19), with about 30% recovery of a c t i v i t y from the Avicel column (Table VI). There was no difference in the s p e c i f i c a c t i v i t i e s of the Mono Q fractions number 22 and 25 of the truncated EngB (Table VI). The s p e c i f i c a c t i v i t y of the truncated EngB was v i r t u a l l y i d e n t i c a l with that of the intact enzyme- (Tables V and VI). The Mono Q step was unnecessary. It reduced the y i e l d of both intact and truncated EngB 6-fold, and i t did not improve their s p e c i f i c a c t i v i t i e s . The M rs of the p u r i f i e d intact and truncated EngB are 110,000 and 72,000, respectively (Figs. 17 and 19), which agree well with the sizes, determined by the m i n i c e l l and zymogram techniques (Figs. 6 and 12). 60 Figure 15. A f f i n i t y chromatography of intact recombinant EngB on A v i c e l . Shockate obtained from E. c o l i RRl/pJB30l was mixed with autoclaved Avicel at 0°C for 1 hour. After washing the Avicel-protein complex i t was applied to a column (2.5cm x 13cm). Adsorbed proteins were eluted with a descending, concave gradient of buffer A and water at a flow rate of 30ml/hour at 23°C (see Materials and Methods). Fractions of 5 ml were c o l l e c t e d . CMcellulase a c t i v i t y was determined using 5yl of each f r a c t i o n in the DNSA method (Materials and Methods). Only the relevant part of the conductivity gradient is shown. 19 62 Figure 16. Chromatography of intact recombinant EngB on a Mono Q anion-exchange column. The fractions containing CMcellulase a c t i v i t y from the Avicel a f f i n i t y column were pooled and brought to 20 mM Tris-HCl pH 7.5 (buffer B). The sample (40-50 ml) was pumped onto a Mono" Q column equilibrated with buffer B at a flow rate of 1ml/min. The gradient was increased slowly to 15% (0.15 M NaCI in buffer B, 2ml/1% change); then to 25% (0.25 M NaCI in buffer B, lml/1% change). Fraction size was 1.0ml. The CMcellulase a c t i v i t y p a r a l l e l e d the major protein peak. 10 20 30 40 Volume 63 Figure 17. SDS-PAGE analysis of the p u r i f i c a t i o n of intact EngB. Samples of various fractions obtained during the p u r i f i c a t i o n of intact EngB were analysed on a 7.5% SDS-polyacrylamide g e l . Lane A, molecular weight standards ( X 1 0 ~ 3 ) ; Lane B, crude c e l l extract; Lane C, periplasmic f l u i d ; Lane D, pooled active fractions from the Avicel column; Lane E, pooled active fractions from the Mono Q column. The arrow indicates the position of intact EngB. A B C D E 45 64 Table V. Puri f i c a t i o n RR1/pJB301 of intact EngB from E. c o l i Fraction Total protein (mg) Total a c t i v i t y 3 (Units) S p e c i f i c act i v i t y (Units/mg) Yi e l d (%) Periplasmic 38. 50 10425 270.7 100 Avicel 0.42 6043 14388.0 58 Mono Q 0.07 950 13571.0 9 a) CMcellulase a c t i v i t y was determined by assay of reducing sugars with DNSA. 65 Figure 18. Chromatography of truncated recombinant EngB on a Mono Q anion-exchange column. CMcellulase a c t i v i t y pool (100 ml) obtained from Avicel a f f i n i t y column chromatography of E. c o l i RRl/pJB303 (data not shown) was concentrated 15-fold by pressure f i l t r a t i o n through an Amicon.PM 10 membrane. The Amicon retentate (6.5 ml) was brought to 20 mM Tris-HCl, pH 7.5 (buffer B), pumped onto a Mono Q column equilibrated with buffer B at a flow rate of 1ml/min. The gradient was increased slowly to 20% (0.2M NaCl in buffer B, 2 ml/1% change). Peak fraction size was 1.0 ml. Volume 66 F i g u r e 19. SDS-PAGE a n a l y s i s of the p u r i f i c a t i o n of t r u n c a t e d recombinant EngB. Samples of v a r i o u s f r a c t i o n s o b t a i n e d d u r i n g t h e p u r i f i c a t i o n of t r u n c a t e d EngB were a n a l y s e d on a 7.5% S D S - p o l y a c r y l a m i d e g e l . Lane A, m o l e c u l a r weight s t a n d a r d s ( x 1 0 ~ 3 ) ; Lane B, cr u d e c e l l e x t r a c t ; Lane C, p e r i p l a s m i c f l u i d ; Lane D, p o o l e d a c t i v e f r a c t i o n s from the A v i c e l column; Lane E, f r a c t i o n number 22 from the Mono Q column; Lane F, f r a c t i o n number 25 from t h e Mono Q column. 67 Table VI. Pu r i f i c a t i o n of RR1/pJB303 truncated EngB from E. c o l i Fraction Total protein (mg) Total act i v i t y a (Units) S p e c i f i c act i v i t y (Units/mg) Y i e l d (%) Periplasmic 128.00 40625 317.4 1 00.0 Avicel 0.94 1 21 88 12925.0 30.0 Mono Q Fraction no. Fraction no. 22 25 0.22 0.12 2375 1417 11875.0 11808.0 5.8 3.5 a) CMcellulase a c t i v i t y was determined by assay of reducing sugars with DNSA. 68 IV Biochemical characterization of EngB A) NH 2 -terminal amino acid sequence and to t a l amino acid composition of the intact EngB It was of interest to determine how EngB was processed by E. c o l i , since both the intact and truncated EngB were exported to the periplasmic space. The f i r s t 20 amino acids of the mature intact recombinant EngB are shown underlined in F i g . 13. This reveals the presence of a single NH 2 _terminus, the mature product being cleaved at the second Ala-Ala s i t e . The amino acid composition of the p u r i f i e d intact EngB i s shown in Table VII. B) I d e n t i f i c a t i o n of the C. fimi protein corresponding to EngB P u r i f i e d intact recombinant EngB was used to raise antibodies in a rabbit. The antiserum reacted with intact and truncated recombinant EngB (Figs. 20 and 21), and also with a high molecular weight (Mr 110,000) and 4 or 5 lower molecular weight C. f imi proteins. The antibody also reacted with p u r i f i e d native EngA. C) Action of C. fimi protease on recombinant EngB C. fimi secretes a serine protease when grown on basal medium plus either CMcellulose, A v i c e l , or glycero l 69 Table VII. Amino acid composition of intact EngB polypeptide Amino acid Residues 3/ molecule Aspartic acid/asparagine 92 Threonine 134 Serine 86 Glutamic acid/glutamine 69 Proline 78 Glycine 109 Alanine 130 Cysteine 8 Valine 85 Methionine 2 Isoleucine 14 Leucine 67 Tyrosine 51 Phenylalanine 30 His t i d i n e 14 Lysine 46 Tryptophan 25 Arginine 25 Total residues 1065 Molecular weight 110,l00 b a) Average values from three determinations b) Molecular weight based on the weights of each aa X no. of residues. 70 Figure 20. Enzyme-linked immunoadsorbent assay of the t i t r e of the antiserum to p u r i f i e d intact recombinant EngB. 100M1 al i q u o t s , (O.ljug) of p u r i f i e d intact EngB were transferred onto a multiwell plate. After incubation of the plate for 2 hours at 37°C the wells were washed four times with PBS. Subsequently, the wells were f i l l e d to the brim with 2% bovine serum albumin in PBS and the plate was incubated for 1 hour at 37°C to block the remaining protein binding sites on the plate surface. Following t h i s , the wells were washed three times with PBS, f i l l e d with 100 nl preimmune (o) or immune (•) antiserum diluted with 0.2% bovine serum albumin in PBS. After incubation of the plate for 16 hours at 4°C, and extensive washing, 100JU1 of the second antibody, a l k a l i n e phosphatase-conjugated goat anti-rabbit IgG, were added at 2000-fold d i l u t i o n . Subsequently, the plate was incubated for 2 hours at 37°C. The wells were washed, the substrate, p-nitrophenyl phosphate, was added, and the plate was incubated for 1 hour at 37°C. The adsorbance at 405 nm was determined in a Titertek Multiskan. 71 72 F i g u r e 21. Immunological d e t e c t i o n of recombinant EngB and of r e l a t e d p o l y p e p t i d e s from C. f i m i . The probe was a n t i s e r u m t o i n t a c t recombinant EngB. Lane A, i n t a c t recombinant EngB; Lane B, C. f i m i w a t e r - s o l u b i l i z e d A v i c e l bound p r o t e i n s , 40jug; Lane C, t r u n c a t e d EngB; Lane D, n a t i v e EngA. The g e l was e l e c t r o b l o t t e d onto n i t r o c e l l u l o s e . The b l o t was i n c u b a t e d w i t h r a b b i t a n t i s e r u m a t a 1:1000 d i l u t i o n i n 1% b o v i n e serum albumin i n phosphate b u f f e r e d s a l i n e ( 1 % BSA i n PBS) f o r 16 hours a t 4°C. Bound a n t i b o d y was d e t e c t e d w i t h goat a n t i - r a b b i t IgG c o u p l e d w i t h a l k a l i n e phosphatase. The a n t i b o d y c o n j u g a t e was used a t 1:2000 i n 1% BSA i n PBS. The second a n t i b o d y i n c u b a t i o n was f o r 3 hours at 23°C. The p o s i t i o n of bound a n t i b o d y was d e t e c t e d by the h y d r o l y s i s of X-phosphate by a l k a l i n e phosphatase. The m o l e c u l a r w e i g h t s ( X 1 0 ~ 3 ) are as shown on the r i g h t . A B C D 110 95 62 49 37 73 (Langsford et al., 1984). It was of interest to examine the s u s c e p t i b i l i t y of the recombinant EngB to crude C. f imi protease. 60 nq of intact EngB powder were dissolved in 2 ml crude extract of C. f imi protease (400 u n i t s ) . Phenylmethylsulf onyl f l u o r i d e (lOO/xg/ml, f i n a l concentration) was added to 0.5 ml aliquots removed at regular time i n t e r v a l s . Half of each aliquot was examined for the a b i l i t y of the products to bind A v i c e l . The other half and the supernatant fract i o n s of centrifuged A v i c e l - p r o t e o l y t i c product complex were analysed by SDS-PAGE (Fig. 22). Intact EngB was stable in the absence of protease (lane B). During the f i r s t hour of incubation with protease, a band corresponding to intact EngB (110 kDa) was present along with two other bands (65 kDa and 43 kDa) (lane C). After 24 hours, only the lower molecular weight bands were seen (lane E). It seemed that longer incubation resulted in further cleavage of the 65 kDa fragment (lanes G,I). The intact EngB and a s i g n i f i c a n t f r a c t i o n of the 65 kDa fragment were adsorbed by A v i c e l (D,F,H,J). However, the 43 kDa fragment lacked a f f i n i t y for the substrate, as shown by i t s r e l a t i v e abundance in the supernatants after Avicel adsorption (lanes D,F,H,J). The C. fimi protease has been shown to expose the Pro-Thr box in recombinant Exg and EngA, the pr o t e o l y t i c products being reactive with antiserum to a synthetic Exg Pro-Thr box whereas the intact proteins are unreactive. (Langsford et al., 1987). The antiserum to the synthetic 74 Figure 22. SDS-PAGE analysis of the ef f e c t of the C. fimi protease on intact recombinant EngB. EngB (6nMg) was resuspended in 2.0 ml crude C. fimi protease preparation (400 Units) and incubated at 37°C. At given intervals 0.5 ml aliquots (approximately 15jug EngB) were removed and the protease digestion was stopped with PMSF (100/ug). Half of each aliquot bound to Avicel and was centrifuged to give supernatant fr a c t i o n s . Samples of EngB before and after protease digestion, and after Avicel adsorption were run on a 7.5% SDS-polyacrylamide gel. Staining was with Coomassie blue. Lane A, molecular weight standards ( x l 0 ~ 3 ) ; intact EngB Lane B, no protease; Lane C, + protease for 1 hour, no A v i c e l ; Lane D, + protease for 1hour, + Avicel; Lane E, + protease for 24 hours, no Av i c e l ; Lane F, + protease for 24 hours, + Av i c e l ; Lane G, + protease for 48 hours, no A v i c e l ; Lane H, + protease for 48hours, + A v i c e l ; Lane I, + protease for 72 hours, no A v i c e l ; Lane J, + protease for 72 hours, + A v i c e l . 75 Exg Pro-Thr box was used to probe the intact EngB and i t s proteolytic products ( F i g . 23). The 39 kDa proteolytic product of Exg bound antibody (lane E), whereas a 32 kDa truncated Exg, lacking the Pro-Thr box (Lane F), and the intact Exg (46.8 kDa) (lane D) did not react. Neither intact (110 kDa) (lane A) nor truncated (72 kDa) (lane C) EngB, nor the p r o t e o l y t i c products (65 kDa and 43 kDa) from intact EngB (lane B) reacted with the antiserum. A non-specific band (65 kDa) was seen in a l l lanes. D) Substrate s p e c i f i c i t y of recombinant EngB Pu r i f i e d intact EngB was tested for i t s a b i l i t y to hydrolyse various polysaccharides and aryl-j3-glycosides (Table VIII). The r e s u l t s confirmed that EngB i s an endoglucanase. It had low but s i g n i f i c a n t a c t i v i t y on lichenan. The a c t i v i t i e s on Avi c e l and xylan were 1.4% and 0.5%, respectively, of the a c t i v i t y on CMcellulose. It did not hydrolyse the other glucans nor any of the aryl-0-glycosides. E) Catalytic properties of intact and truncated EngB K and V m values were determined for the hydrolysis m max •* J-of CMcellulose by p u r i f i e d intact and by truncated EngB (Figs 24 and 25; Table IX). Figure 23. Western blot analysis of intact and truncated recombinant EngB and proteolytic products of recombinant EngB. The probe was antiserum to synthetic Exg Pro-Thr box. Lane A, intact EngB; Lane B, proteolysis products of intact EngB; Lane C, truncated EngB; Lane D, native Exg; Lane E, 39,000 proteolysis product of recombinant Exg; Lane F, 32,000 truncated product of recombinant Exg. Positions of molecular weight standards (X10~3) are as indicated. A non-specific band (65,000) i s seen in a l l lanes. A B C D 116 53 45 > 1 41 77 Table VIII. A c t i v i t y of intact EngB towards various substrates Substrate Enzyme s p e c i f i c a c t i v i t y 3 CMcellulose Lichenan Avicel Xylan Na-polygalacturonate Laminar in Mannan pNPG pNPC pNPX 17407.8 759.4 230.3 83.3 18.6 3.6 <0.01 <0.01 <0.01 « <0.01 a) Polymer hydrolysis i s expressed as nmol reducing sugar liberated (as glucose equivalents for a l l polymeric substrates except xylan) /min /mg of protein. Xylanase a c t i v i t y i s nmol xylose equivalents/min. Reducing sugars were determined.with p-HBAH. Figure 24. Lineweaver-Burke plot of the kinetics of hydrolysis of CMcellulose by intact recombinant EngB. I n i t i a l v e l o c i t i e s were determined at 30°C and pH 6.8. - 1 , - 2 0 2 4 6 1/IS] (ml/mg) Figure 25. Lineweaver-Burke plot of the kinetics of hydrolysis of CMcellulose by truncated recombinant EngB. I n i t i a l v e l o c i t i e s were determined at 30°C and pH 6.8. 100 1/[S] (ml/mg) 80 Table IX. Comparison of the ki n e t i c parameters for CMcellulose hydrolysis of inta c t and truncated EngB, of EngA and of Exg Enzyme Km(mg/ml) V m a x(units 0/mg) EngAa 0. 1 7±0. ,10 56. ,60±1, .00 Exg a 3. 04±0. .23 35, ,80±1, .90 EngB(110kDa) D 0. 51 ±0. 05 26, .06±1, .06 EngB(72kDa) b 0. 25±0. .03 27, ,77±0. .96 a) Values for EngA and Exg are from Langsford et al . , 1987. b) Values were derived from weighted l i n e a r regression analysis of the double reciprocal p l o t s , Figs. 24 and 25. c) Units: Mmol glucose equivalents released/min. 81 DISCUSSION The cenB gene encodes a polypeptide of Mf 110,000 in E. c o l i . A polypeptide of similar size from C. f i m i , which binds weakly to the substrate in cultures grown with Avicel, has been p u r i f i e d but not sequenced (N.R. Gilkes, personal communication). An intragenic cenB DNA fragment hybridized very strongly to a species of C. fimi RNA approximately 3,200 bases long isolated from CMcellulose-grdwn c e l l s (Greenberg et al. , 1987b). Furthermore, a polyclonal antibody against the EngB p u r i f i e d from E. c o l i recognizes a C. fimi e x t r a c e l l u l a r protein of 110,000 as well as 4 or 5 polypeptides of lower molecular weight (Fig. 21). One of these immunologically related polypeptides i s EngA. Several of the CMcellulase a c t i v i t i e s in C. f imi culture supernatants were shown e a r l i e r to be immunologically related (Langsford etal., 1984). The sequence upstream of the t r a n s l a t i o n a l start s i t e of cenB does not contain an E. c o l i - l i k e promoter sequence (Rosenberg and Court, 1979), but i t does contain sequences similar to those of two other C. fimi promoters (Greenberg et al .,1987a). Transcription of cenB in C. f imi is directed from two tandem promoters; the d i s t a l cenBpl regulated promoter and the proximal cenBp2 constitutive promoter (Greenberg et al ., 1987b). These regulatory elements are weak or non functional in E. c o l i , l i k e those of the cenA 82 and cex genes of C. f imi (0' N e i l l et al . , 1986c; Wong et al . , 1986). When the cenB coding sequence i s fused in-frame to the E. c o l i lac RBS and the sequence coding the f i r s t 7aa of 0-galactosidase, and placed under the control of the lac promoter on the plasmid vector pUC19, the le v e l of EngB obtained in E. c o l i i s about 0.2% of the t o t a l c e l l u l a r protein in t h i s organism. This agrees with an an e a r l i e r observation on the expression of the cex gene in E. c o l i (O'Neill et al .1986c). A hybrid lacZ'-cex gene causes the production of Exg constituting about 0.2% of the t o t a l c e l l u l a r protein (O'Neill et al., 1986c). When the cenB coding sequence is fused to a synthetic RBS and an i n i t i a t i n g ATG, and placed under the control of the leftward promoter of bacteriophage lambda contained on the runaway re p l i c a t i o n plasmid vector pCP3, the l e v e l of EngB expression i s very low (See Appendix). This contrasts the report of the cex gene expression in a similar construct (O'Neill et al ., 1986c). The l e v e l of Exg expression obtained in E. c o l i from a pCP3-cex plasmid i s more than 20% of t o t a l c e l l u l a r protein. The reasons for t h i s difference in the expression of the cenB and cex genes from the same high-level expression vector are not c l e a r . Like many other genes coding for a secreted product, the cenB gene codes for a signal sequence at the amino-terminal end of the protein. Such sequences are believed necessary for e f f i c i e n t export of a protein in most 83 Gram-negative organisms and are usually composed of a short s t r e t c h of charged amino acids (2 to 11 residues) at the amino terminus followed by a longer stretch (14 to 20) residues of strongly hydrophobic amino acids (Inouye and Halegoua, 1980; Silhavy et al . , 1983). Signal sequences from Gram-positive organisms have the same structure, but are often s l i g h t l y longer than those of other systems (Lampen et al .1984; Lofdahl et al., 1983; Murphy et al . , 1984; Robson and Chambliss, 1987). Despite i t s unusual length the EngB signal peptide allows export of EngB in E. c o l i . Furthermore, replacement of i t s basic amino-terminal section with the amino-terminal amino acids of 0-galactosidase does not block processing and export of EngB. Deletion of the basic amino acids in the signal peptide of E. c o l i l ipoprotein, or the i r replacement with neutral amino acids, has l i t t l e e f f e c t on lipoprotein export (Inuoye et al., 1982; Vlasuk et al., 1983). However, th e i r replacement with negatively charged amino acids reduced lipoprotein export d r a s t i c a l l y . The significance of the hydrophobic region of the EngB signa l peptide remains to be determined. The EngA, EngB, and Exg signal peptides exhibit extensive homology in th e i r hydrophobic carboxy terminal sequences (Fig. 26; O'Neill et al ., 1986a,b; Wong et al., 1 986). The conservation of these sequences, esp e c i a l l y in EngA, EngB, suggests an es s e n t i a l role for the structure in protein export and processing. Some mutations in the hydrophobic regions of Figure 26. Comparison of the Exg, EngA and EngB deduced from the nuc leo t ide sequences ( O ' N e i l l et boxed. * denotes a gap l e f t in the sequence. s ignal pept ides . The amino a c i d sequences of Exg, EngA and EngB were a / . , 1986a; Wong et al., 1986; t h i s t h e s i s ) . Conserved res idues are Exg: M P R T T P A P G H P A R G A R T A Eng A : Eng B: M L R M S L R T R R j R A A T L T R R T A A A L 0 V P R T L V G G S V V G A L A A T V A A V TJA V A V G * * * * * * * * G L T A L T T T V I V A P L A T A 0 A A 0 A co 85 the leader peptides of E. c o l i lamB and maltose binding proteins prevent export of these proteins (Bedouelle et al . , 1980; Emr et al., 1980). The adsorption of intact and truncated recombinant EngB on Avicel allowed the development of an a f f i n i t y chromatography for their p u r i f i c a t i o n . The procedure i s r e l a t i v e l y simple, fast, inexpensive and e f f i c i e n t . Autoclaving the Avicel resulted in better adsorption of the recombinant c e l l u l a s e s . The procedure yields EngB of a s u f f i c i e n t purity for amino acid sequence determination, amino acid composition analysis and the r a i s i n g of polyclonal antibody. Moreover, i t i s applicable to the p u r i f i c a t i o n of Exg and EngA from E. c o l i , and i t also f a c i l i t a t e s substrate binding studies (Langsford et a l . , 1987). It i s noteworthy that 25% of the residues in EngB are hydroxyamino acids (Table VII). Both EngA and Exg contain 20% of hydroxyamino acids, which tend to occur in c l u s t e r s (Warren et al., 1986). Other glucanases are also r i c h in hydroxyamino acids: 20% in an a-amylase from Bac i l l u s  s u b t i l i s (Yang et al . , 1983); 22% in a /3-glucanase from the same organism (Murphy et al., 1984); 27 and 28%, respectively, in CBHI and endoglucanase from T. reesei (Enari and Niku-Paavola, 1987; Shoemaker et al . , 1983, P e n t t i l a et al., 1986); 21 and 17% in two endoglucanases from C. thermocellum (Beguin et al., 1985; Grepinet and Beguin, 1986); 30% in an a-amylase from Aspergillus niger 86 (Boel et al., 1984). A l l of these enzymes contain clusters of hydroxyamino acids, and i t has been suggested that they function as binding domains for insoluble c e l l u l o s e (Langsford etal., 1987; Warren et al ., 1988; van Tilbeurgh et al ., 1986). Preliminary experiments suggested that EngB is an endoglucanase (Gilkes et al . , 1984c). cenB clones expressing enzymatic a c t i v i t y form halos on Congo red-stained CMcellulose plates, a feature commonly shared by endoglucanases (Bartley et al . , 1984; Teather and Wood, 1982). P u r i f i e d EngB hydrolyses CMcellulose more than other polysaccharides. Lichenan i s a mixed glucan containing 0-1,4 and 0-1,3 linkages. Presumably, only the 0-1,4 linkages are l a b i l e since the p u r i f i e d EngB does not attack laminarin, a predominantly 0-1,3-linked glucan. The low a c t i v i t y on Avicel suggests that i t hydrolyses the amorphous but not the c r y s t a l l i n e regions of this substrate. The enzyme does not hydrolyse c e l l o b i o s e , pNPG or PNPC and i s therefore not a c e l l o b i a s e or exoglucanase. The s p e c i f i c a c t i v i t y of p u r i f i e d EngB on CMcellulose is in the same range as that of EngA and Exg (Table IX; Langsford et al., 1987). Proteins of Mr 110,000, 95,000 and 82,000 are enzymatically a c t i v e . It i s l i k e l y that a l l three polypeptides are encoded by the cenB gene, whose product is p a r t i a l l y hydrolysed in the E. c o l i c e l l s . Furthermore, a truncated EngB of Mr 72,000 also 87 possesses enzymatic a c t i v i t y similar to those of the o r i g i n a l protein. Taken together, these results provide evidence that the intact EngB i s not required for enzymatic a c t i v i t y and that the multiple a c t i v i t i e s encoded by the complete gene may result from proteolytic processing of the intact product from the carboxyl terminal region. An active truncated product of the alkaline c e l l u l a s e gene from an a l k a l o p h i l i c B a c i l l u s sp. has been reported (Fukumori et al., 1987). M u l t i p l i c i t y of products of other c e l l u l a s e genes cloned in E. c o l i has also been reported: the celA and celB genes from Clostridium thermocellum (Cornet et al., 1983a, Beguin et al ., 1983); the endoglucanase gene from Bacteroides succ inogenes (Taylor et al., 1987), the endoglucanase gene from B a c i l l u s s u b t i l i s (Robson and Chambliss, 1986); and the cex and cenA genes from C. fimi (Z. Guo and N. Arfman, personal communication). C. fimi protease cleaves intact EngB s p e c i f i c a l l y to generate a truncated polypeptide with both enzymatic a c t i v i t y and substrate binding capacity. It i s not presumptuous to expect a similar e f f e c t in vivo. Proteolysis has been proposed to account for the m u l t i p l i c i t y of C. fimi c e l l u l a s e s (Langsford et al., 1984). Although the polypeptides of Mr 95,000, 62,000 and 37,000 reactive with the antiserum to EngB may be proteol y t i c products of the intact native EngB, i t i s equally possible that they are as yet uncharacterized components of the C. f imi c e l l u l a s e system. What ever their nature, the 88 antiserum to EngB could be useful for the p u r i f i c a t i o n of these proteins by immunoadsorption chromtography. EngB hydrolyses CMcellulose and binds to Av i c e l , l i k e EngA and Exg (Gilkes et al . , 1984a; Langsford et al., 1987). However, while the intact EngA and Exg are necessary for these two functions (Langsford et al , 1987; Warren et al . , 1988), the carboxyl terminal one-third of EngB i s required for neither. The role of t h i s apparently dispensable region of EngB in c e l l u l o s e hydrolysis remains to be determined. It is not c e r t a i n that the 110,000 C. fimi protein weakly bound to A v i c e l , p u r i f i e d e a r l i e r (N.R. Gilkes, personal communication) or immunologically characterized in this thesis, has the same enzymological properties as those described for the E. coli-made enzyme. However, EngA and Exg, unglycosylated in E. c o l i , both retain the s p e c i f i c i t i e s of the native enzymes from C. fimi (Langsford et al., 1987). 89 LITERATURE CITED Alexander, J.K. (1968) P u r i f i c a t i o n and s p e c i f i c i t y of cellobiose phosphorylase from Clostridium thermocellum. J. B i o l . Chem. 243:2899-2904. Almin, K.E., Eriksson, K.E., and Pettersson, L.G. (1975) Ext r a c e l l u l a r enzyme system u t i l i z e d by the fungus Sporotr ichum pulverulentum (Chryosporium 1ignorum) for the breakdown of c e l l u l o s e . 2. A c t i v i t i e s of the five endo-/3-1 ,4-glucanases towards carboxymethylcellulose. Eur. J . Biochem. 51: 207-211. Appleyard, R.K. (1954) Segregation of new lysogenic types during growth of a doubly lysogenic s t r a i n derived from Escherichia c o l i K-12. Genetics 39:440-452. Arfman, N., Gilkes, N.R., Guo, Z., Kilburn, D.G., Langsford, M., M i l l e r , R.C., J r . , Owolabi, J . , and Warren, R.A.J. (1987) Characterization of Cellulomonas fimi c e l l u l a s e s . In Proceedings of the Sixth Canadian Bioenergy R & D Seminar, in press. Armentrout, R.W., and Brown, R.D. (1981) Molecular cloning of genes for cellobiose u t i l i z a t i o n and their expression in Escherichia c o l i . Appl. Environ. Microbiol. 41: 1355-1362. Atkinson, T. , and Smith, M. (1984) In Oligonucleotide Synthesis: a p r a c t i c a l approach. Gait, N.J. ed. IRL press, Washington. Bailey, M.J., and Oksanen, J . (1984) C e l l u l a s e production by mutant strains of Trichoderma reesei on non-cellulosic media. In Proceedings of the Third European Congress of Biotechnology, volume 2:157-162 Verlag Chemie Weinheim. Barras, F., Boyer, M.H., Chambost, J.P., and Chippaux, M. (1984) Construction of a genomic l i b r a r y of Erwinia  chrysanthemi and molecular cloning of c e l l u l a s e genes. Mol. Gen. Genet. 197:513-514. 90 Barros, M.E.C., and Thomson, J.A. (1987) Cloning and expression in Escherichia c o l i of a c e l l u l a s e gene from Ruminococcus flavefaciens. J . B a c t e r i o l . 169: 1760-1762. Bartley, T.D., Murphy-Holland, K., and Eveleigh, D.E. (1984) A method for the detection and d i f f e r e n t i a t i o n of c e l l u l a s e components in polyacrylamide gels. Anal Biochem. 140:157-161. Bedouelle, H., Bassford, P.J., Fowler, A.V., Zabin, I., Beckwith, J., and Hofnung, M. (1980) Mutations which a l t e r the function of the signal sequence of the maltose binding protein of Escherichia c o l i . Nature 285:78-81. Beguin, P. (1983) Detection of c e l l u l a s e a c t i v i t y in polyacrylamide gels using Congo red-stained agar r e p l i c a s . Anal. Biochem. 131:333-336. Beguin, P., Cornet, P., and Aubert, J.-P. (1985) Sequence of a c e l l u l a s e gene of the thermophilic bacterium Clostridium thermocellum. J. B a c t e r i o l . 162:102-105. Beguin, P., Cornet, P., and M i l l e t , J. (1983) I d e n t i f i c a t i o n of the endoglucanase of the celB gene of Clostridium thermocellum. Biochimie 65:495-500. Beguin, P., and Eisen, H. (1978) P u r i f i c a t i o n and p a r t i a l c haracterization of three e x t r a c e l l u l a r c e l l u l a s e s from Cellulomonas sp. Eur. J. Biochem. 87:525-531. Beguin, P., Eisen, H. , and Roupas, A. (1977) Free and c e l l u l o s e bound c e l l u l a s e s from Cellulomonas sp. J.' Gen. M i c r o b i o l . 101:191-196. Beguin, P., Gilkes, N.R., Kilburn, D.G., M i l l e r , R.C. J r . , O ' N e i l l , G.P., and Warren, R.A.J. (1987) Cloning of c e l l u l a s e genes. CRC C r i t i c a l Rev. Biotechnol. 6:129-162 . Birnboim, H.L., and Doly, J. (1979) A rapid a l k a l i n e extraction procedure for screening of recombinant plasmid DNA. Nucl. Acids Res. 7:1513-1523. Blake, M.S., Johnston, K.H., Russel-Jones, G.J., and Gotschlich, E.C. (1984) A rapid and sensitive method for detection of al k a l i n e phosphatase conjugated anti-antibody on Western blots. Anal. Biochem. 136:175-179. 91 Boel, E., Hjort, I., Svensson, B., Norris, F., Norris, K.E., and F i i l , N.P. (1984) Glucoamylases G1 and G2 from Asperqillus niger are synthesized from two d i f f e r e n t but closely related mRNAs. EMBO J . 3:1097-1102. Bolivar, F., Rodreiquez, R.L., Bethlach, M.C, Heyneker, H.L. Boyer, H.W., Crosa, J.H., and Falkow, S. (1977) Construction and chara c t e r i z a t i o n of new cloning vehicles, I I . A multipurpose cloning system. Gene 2:95-113. Boyer, R.F., Allen, T.L., and Dykema, P.A. (1987) Fractionation of Aspergillus niger c e l l u l a s e s by combined ion exchange a f f i n i t y chromatography. Biotechnol. Bioeng. 29:176-179. Bradford, M.M. (1976) A rapid and se n s i t i v e method for the quantitation of microgram quantities of protein u t i l i z i n g the p r i n c i p l e of protein-dye binding. Anal. Biochem. 72:248-254. B r e u i l , C , and Saddler, J.N. (1985) Comparison of the 3 , 5 - d i n i t r o s a l i c y l i c acid and Nelson-Somogyi methods of assaying for reducing sugars and determining c e l l u l a s e a c t i v i t y . Enzyme Microb. Technol. 7:327-332. Brownell, H.H., and Saddler, J.N. (1987) Steam pretreatment of l i g n o c e l l u l o s i c material . for enzymatic hydrolysis. Biotechnol. Bioeng. 29:228-235. Castanon, M., and Wilke, C.R. (1980) Adsorption and recovery of ce l l u l a s e s during hydrolysis of newspaper. Biotechnol. Bioeng. 22:1037-1053. Chahal, D.S. (1985) Solid-state fermentation with Trichoderma reesei for c e l l u l a s e production. Appl. Environ. Microbiol. 49:205-210. Choi, W.Y., Haggett, K.D., and Dunn, N.W. (1978) Isolation of a cotton wool degrading s t r a i n of Cellulomonas: mutants with altered a b i l i t y to degrade cotton wool. Aust. J. B i o l . S c i . 31:553-564. Choudhury, N., Gary, P.P., and Dunn, N.W. (1980) Saccharification of sugar cane bagasse by an enzyme preparation from Cellulomonas: resistance to product i n h i b i t i o n . Biotechnol. Lett . 2:427-428. C o l l i e r , B., Thomas, D.Y., Teather, R.M., E r f l e , J.D., and Crosby, W.L. , (1984) Cloning and expression in Escherichia c o l i of c e l l u l a s e genes from Bacteroides  succinogenes. DNA 3:184-188. 92 Collmer, A., and Wilson, D.B. (1983) Cloning and expression of a Thermonospora YX endocellulase gene in E. c o l i . Bio/Technology 1:589-594. Cornet, P., M i l l e t , J ., Beguin, P., and Aubert, J.-P. (1983a) Characterization of two eel (cellulose degradation) genes of Clostr idium thermocellum coding for endoglucanases. Bio/Technology 1:589-594. Cornet, P., Tronik, D., M i l l e t , J., and Aubert, J.-P. (1983b) Cloning and expression in Escherichia c o l i of C l o s t r idium thermocellum genes coding for amino aci d synthesis and c e l l u l o s e hydrolysis. FEMS Mic r o b i o l . Lett. 16:137-141. Coughlan, M.P. (1985) The properties of fungal and b a c t e r i a l c e l l u l a s e s with comments on their production and applica t i o n . Biotech. Genetic Engineering Rev. 3:39-109. de Boer, H. A., and Shepard, H. M. (1983) Strategies for optimizing foreign gene expression in Escherichia  c o l i . Horizons Biochem. Biophys. 7:205-248. Deshpande, M.V., Eriksson, K.E., and Pettersson, B. (1984a) An assay for selective determination of exo-j3-1 ,4-glucanases in a mixture of c e l l u l o l y t i c enzymes. Anal. Biochem. 138:481-487. Deshpande, V., Rao, M., Keskar, S., and Mishra, C. (1984b) Occurence of a procellulase in the culture f i l t r a t e s of PeniciIlium janthinellum. Enzyme Microb. Technol. 6:371-374. Emr, S.D., Hedgpeth, J., Clement, J.-M., Silhavy, T.J. and Hofnung, M. (1980) Sequence analysis of mutations that prevent export of X receptor, an Escher ichia  c o l i outer membrane protein. Nature 285:82-85. Enari, T.-M., and Niku-Paavola, M.-L. (1987) Enzymatic hydrolysis of c e l l u l o s e : i s the current theory of mechanisms of hydrolysis valid? CRC C r i t i c a l Rev. Biotechnol. 5:67-87. Enriques, A. (1981) Growth of c e l l u l o l y t i c bacteria on sugarcane bagasse. Biotechnol. Bioeng. 23:1423-1429 93 Eriksson, K.E. (1975) Enzyme mechanisms involved in the degradation of wood components, p. 263-280. In M. Bailey, T.M. Enari and M. Linko (eds.), Symposium on Enzymatic Hydrolysis of Cel l u l o s e . SITRA, Helsink i . Eriksson, K.E. (1978) Enzyme mechanisms involved in ce l l u l o s e hydrolysis by the rot fungus Sporotrichum  pulverulentum. Biotechnol. Bioeng. 20:317-332. Eriksson, K.E., and Hamp, S.G. (1978) Regulation of endo -/3-D-glucanase production in Sporotr ichum pulverulentum. Eur. J . Biochem. 90:183-190. Eriksson, K.E., and Pettersson, B. (1982) P u r i f i c a t i o n and p a r t i a l characterization of two a c i d i c proteases from the white-rot fungus Sporotrichum pulverlentum. Eur. J . Biochem. 124:635-642. Fan, L.T., Lee, Y.-H., and Beardmore, D.H. (1980a) Major chemical and physical features of c e l l u l o s i c materials as substrates for enzymatic hydrolysis. Adv. Biochem. Engineering 14:101-118. Fan, L.T., Lee, Y.-H., and Beardmore, D.H. (1980b) Mechanism of enzymatic hydrolysis of c e l l u l o s e : Effects of the major s t r u c t u r a l features of cel l u l o s e on enzymatic hydr o l y s i s . Biotechnol. Bioeng. 22:177-199. Fan, L.T., Lee, Y.-H., and Gharpuray, M.M. (1982) The nature of 1ignocellulosics and the i r pretreatments for enzymatic hydrolysis. Adv. Biochem. Engineering 23:157-183. Fukumori, F., Kudo, T., and Horikoshi, K. (1987) Truncation analysis of an a l k a l i n e c e l l u l a s e from an a l k a l o p h i l i c B a c i l l u s species. FEMS Microbiol. Lett. 40:311-314. Fukumori, F., Kudo, T., Narahashi, Y., and Horikoshi, K. (1986a) Molecular cloning and nucleotide sequence of the a l k a l i n e c e l l u l a s e gene from the a l k a l o p h i l i c B a c i l l u s sp. stra i n 1139. J . Gen. Microbiol. 132:2329-2335. Fukumori, F., Sashihara, N., Kudo, T., and Horikoshi, K. (1986b) Nucleotide sequences of two c e l l u l a s e genes from a l k a l o p h i l i c B a c i l l u s sp. s t r a i n N-4 and their strong homology. J. B a c t e r i o l . 186:494-504. 94 Gatz, C , and H i l l e n , W. (1986) Acinetobacter calcoaceticus encoded mutarotase: nucleotide sequence analysis of the gene and characterization of i t s secretion in Escherichia c o l i . Nucl. Acids Res. 14:4309-4323. Gilkes, N.R., Kilburn, D.G., Langsford, M.L., M i l l e r , R.C.Jr., Wakarchuk, W.W., Warren, R.A.J., Whittle, D.J., and Wong, W.K.R. (1984a) Isolation and characterization of Escherichia c o l i clones expressing c e l l u l a s e genes from Cellulomonas f i m i . J . Gen. Microbiol. 130: 1377-1384. Gilkes, N.R., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. (1984b) A mutant of Escherichia c o l i that leaks c e l l u l a s e a c t i v i t y encoded by cloned c e l l u l a s e genes from Cellulomonas fimi. Bio/Technology 2: 259-263. Gilkes, N.R., Langsford, M.L., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. (1984c) Mode of action and substrate s p e c i f i c i t i e s of c e l l u l a s e s from cloned b a c t e r i a l genes. J. B i o l . Chem. 259: 10455-10459. Gold, L., Pribnow, D., Schneider, T., Shinedling, S., Swebelius-Singer, B., and Stormo, G. (1981) Translational i n i t i a t i o n in prokaryotes. Ann. Rev. Microbiol. 35:365-403. Gong, C.S., and Tsao, G.T. (1979) Cellulase and biosynthesis regulation. Ann. Reports on Fermentation Processes 3:111-139. Greenberg, N.M., Warren, R.A.J., Kilburn, D.G., and M i l l e r , R.C.Jr. (1987a) Regulation, i n i t i a t i o n and termination of the cenA and cex transcripts of Cellulomonas f i m i . J . Bac t e r i o l . 169:646-653. Greenberg, N.M., Warren, R.A.J., Kilburn, D.G., and M i l l e r , R.C.Jr., (1987b) Regulation and i n i t i a t i o n of cenB tra n s c r i p t s of Cellulomonas f i m i . J. B a c t e r i o l . 169:4674-4677. Grepinet, O., and Beguin, P. (1986) Sequence of the c e l l u l a s e gene of Clostridium thermocellum coding for endoglucanase B. Nucl. Acids Res. 14:1791-1799. G r i f f i n , H., Din t z i s , F.R., K r u l l , L., and Baker, F.L. (1984) A m i c r o f i b r i l generating factor from the enzyme complex of Trichoderma reesei. Biotechnol. Bioeng. 26:296-300. 95 Guo, Z., Arfman, N., Ong, E., Gilkes, N.R., Kilburn, D.G., Warren, R.A.J., and M i l l e r , R.C.Jr. (1988) Leakage of Cellulomonas fimi c e l l u l a s e s from Escherichia  c o l i . FEMS Microbiol. Lett., in press. Guo, L.-H., and Wu R. (1983) Exonuclease III : Use for DNA sequence analysis and in s p e c i f i c deletions of nucleotides. Methods Enzymol. 100:60-96. Hagget, K.D., Choi, W.Y., and Dunn, N.W. (1978) Mutants of Cellulomonas which produce increased lev e l s of /3-glucosidase. Eur. J. Appl. Microbiol. Biotechnol. 6:189-191. Hagget, K.D., Gray, P.P., and Dunn, N.W. (1979) C r y s t a l l i n e c e l l u l o s e degradation by a s t r a i n of Cellulomonas and i t s mutants d e r i v a t i v e s . Eur. J. Appl. Microbiol. Biotechnol. 8: 183-190. H a l l i w e l l , G., and G r i f f i n , M. (1973) The nature and mode of action of the c e l l u l o l y t i c component C, of Trichoderma koningii on native c e l l u l o s e . Biochem. J. 135:587-594. H a l l i w e l l . G., and G r i f f i n , M. (1978) A f f i n i t y chromatography of the c e l l u l a s e system of Trichoderma ko n i n g i i . Biochem. J . 169:713-715. Hat t o r i , M., and Sakaki, Y. (1986) Dideoxy sequencing method using denatured plasmid templates. Anal. Biochem. 152:232-238. Hitchner, E.V., and Leatherwood, J.M. (1980) Use of a c e l l u l a s e derepressed mutant of Cellulomonas in the production of a s i n g l e - c e l l protein product from c e l l u l o s e . Appl. Environ. Microbiol. 39:382-386. Horton, G.L., Rivers, D.G., and Emert, G.H. (1980) Preparation of c e l l u l o s i c s for enzymatic conversion. Ind. Eng. Chem. Prod. Res. Dev. 19:422-429. Inouye, M., and Halegoua, S. (1980) Secretion and membrane l o c a l i z a t i o n of proteins in Escherichia c o l i . CRC C r i t i c a l Rev. Biochem. 7:339-371. Inouye, S., Soberon, X., Franceschini, T., Nakamura, K., Itakura, K., and Inouye, M. (1982) Role of posit i v e charge on the amino-terminal region of the signal peptide in protein secretion across the membrane. Proc. Natl. Acad. S c i . USA 79:3438-3441. 96 Jensen, K.F., Larsen, J.N., Schack, L., and Sivertsen, A. (1984) Studies on the structure and expression of Escherichia c o l i pyrC, pyrD, and pyrF using the cloned genes. Eur. J. Biochem. 140:343-352. J o l i f f , G., Beguin, P., and Aubert, J.-P. (1986a) Nucleotide sequence of the c e l l u l a s e gene encoding endoglucanase D of Clostridium thermocellum. Nucl. Acids Res. 14:8605-8613. J o l i f f , G., Beguin, P., Juy, M., M i l l e t , J ., Ryter, A., Poljak, R., and Aubert, J.-P. (1986b) I s o l a t i o n , c r y s t a l l i z a t i o n and properties of a new c e l l u l a s e of Clostridium thermocellum overproduced in Escherichia  c o l i . Bio/Technology 4:896-900. Juang, R.-H., Chang, Y.-D., Sung, H.-Y., and Su, J.-C. (1984) Oven-drying method for polyacrylamide gel slab packed in cellophane sandwich. Anal. Biochem. 141:348-350. Keddie, R.M. (1984) Genus I I I . Cellulomonas, p. 629-631. In R.E. Buchanon and N.E. Gibbons Teds), Bergey's manual of determinative bacteriology, 8th ed. The Williams and Wilkins Co., Baltimore. Klyosov, A., Mitkevich, O.V., and Sinitsyn, A.P. (1986) Role of the a c t i v i t y and adsorption of c e l l u l a s e s in the e f f i c i e n c y of the enzymatic hydrolysis of amorphous and c r y s t a l l i n e c e l l u l o s e . Biochem. 25:540-542. Knowles, J., Lehtovaara, P., and Teeri, T. (1987) Cel l u l a s e families and their genes. TIBTECH 5:255-261. Kohchi, C , and Toh-e, A. (1985) Nucleotide sequence of Candida p e l l i c u l o s a 0-glucosidase gene. Nucl. Acids Res. 13:6273-6282. Koide, Y., Kakamura, A., Uozumi, T., and Beppu, T. (1986) Molecular cloning of a c e l l u l a s e gene from B a c i l l u s  s u b t i l i s and i t s expression in Escher i c h i a c o l i . Agric. B i o l . Chem. 50:233-237. Kotoujansky, A., Diolez, A., Boccara, M., Bertheau, Y., Andro, T., and Coleno, A. (1985) Molecular cloning of Erwinia chrysanthemi pectinase and c e l l u l a s e structural genes. EMBO J . 4:781-785. Kubicek, C P . (1981) Release of carboxymethylcellulase and 0-glucosidase from walls of Trichoderma reesei . Eur. J. Appl. Microbiol. Biotechnol. 13: 226-231. 97 Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. Lampen, J.O., Wang, W., Mezes, P.S.F., and Yang, Y.-J. (1984) 0-lactamases of B a c i l l i : Nature and processing, p. 129-140. In J. Hoch and A.T. Genesan (eds.), Genetics and Biotechnology of B a c i l l i . Academic Press, New York. Langsford, M.L., Gilkes, N.R. Wakarchuk, W.W., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. (1984) The c e l l u l a s e system of Cellulomonas f i m i . J. Gen. Microbiol. 130:13671376. Langsford, M.L., Gilkes, N.R., Singh, B., Moser, B., M i l l e r , R.C.Jr., Warren, R.A.J., and Kilburn, D.G. (1987) Glycosylation of b a c t e r i a l c e l l u l a s e s prevents pro t e o l y t i c cleavage between functional domains. FEBS Lett. 225:163-167. Lever, M. (1973) Colorimetric and fluorometric carbohydrate determination with p-hydroxybenzoic acid hyrazide. Biochem. Med. 7:274-281. Ljungdahl, L., Pettersson, B., Eriksson, K.E., and Wiegel, J. (1983) A yellow a f f i n i t y substance involved in the c e l l u l o l y t i c system of Clostridium thermocellum. Current M i c r o b i o l . 9:195-200. Lofdahl, S., Guss, B., Uhlen, M., Philipson, L., and Lindberg, M. (1983) Gene for staphylococcal protein A. Proc. Natl. Acad. S c i . USA 80:697-701. Mandels, M. (1982) C e l l u l a s e s , p. 35-78. In G.T. Tsao (ed.), Annual reports of fermentation processes, v o l . 5. Academic Press Inc., New York. Maniatis, T., F r i t s c h , E.F., and Sambrook, J. (1982) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Maxam, A.M., and G i l b e r t , W. (1980) Sequencing end-labelled DNA with base-specific chemical cleavages. Method Enzymol. 65:499-560. McLaughlin, J.R., Murray, C.L., and Rabinowitz, J.C. (1981) Unique features in the ribosome binding s i t e sequence of the Gram-positive Staphylococcus aureus (3-lactamase gene. J . B i o l . Chem. 256:11283-11291. Messing, J. (1983) New M13 vectors for cloning. Method Enzymol. 10!C:20-78. 98 M i l l e r , G.L. (1959) Use of d i n i t o s a l i c y l i c acid reagent for determination of reducing sugar. Anal. Chem. 31:426-428. M i l l e r , G.L., Blum, R., Glennon, W.E., and Burton, A.L. (1960) Measurement of carboxymethylcellulase a c t i v i t y . Anal. Biochem. 2:127-132. M i l l e r , J.H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. M i l l e t , J . , Petre, D., Beguin, P., Raynaud, 0., and Aubert, J.-P. (1985) Cloning of ten d i s t i n c t DNA fragments of Clostridium thermocellum coding for c e l l u l a s e s . FEMS Microbiol. Lett. 29:145-149. M i l l e t t , M.A., Baker, A.J., and Satter, L.D. (1976) Physical and chemical pretreatments for enhancing c e l l u l o s e s a c c h a r i f i c a t i o n . Biotechnol. Bioeng. Symp. 6:125-153. Moloney, A.P., and Coughlan, M.P. (1983) Sorption of Talaromyces emersoni i c e l l u l a s e on c e l l u l o s i c substrates. Biotechnol. Bioeng. 25:271-280. Moloney, A.P., Hackett, T.J., Considine, P.J., and Coughlan, M.P. (1983) Isolation of mutants of Talaromyces  emersoni i CBS 814.70 with enhanced c e l l u l a s e a c t i v i t y . Enzy. Microb. . Technol. 5:260-264. Moloney, A.P., McCrae, S.I., Wood, T.M., and Coughlan, M.P. (1985) Isolation and characterization of the 1 ,4-/3-D-glucan glucanohydrolases of Talaromyces  emersonii. Biochem. J. 225:365-374. Montenecourt, B.S. (1983) Trichoderma reesei c e l l u l a s e s . Trends Biotechnol. 1:156-161. Mullings, R. (1985) Measurement of s a c c h a r i f i c a t i o n by c e l l u l a s e s . Enzy. Microb. Technol. 7:586-591. Murphy, N., McConnell, D.J., and Cantwell, B.A. (1984) The DNA sequence of the gene and genetic c o n t r o l s i t e s for the excreted B. s u b t i l i s enzyme /3-glucanase. Nucl. Acids Res. 12:5355-5367. Nakamura, K., Misawa, N., and Kitamura, K. (1986) C e l l u l a s e genes of Cellulomonas uda CB4. I. Cloning and expression of 0-glucosidase genes in Escherichia c o l i . J. Biotechnol. 3:239-246. 99 Nakayama, M. , Tomita, Y. , Suzuki, H., and Nisizawa, K. (1976) P a r t i a l proteolysis of some c e l l u l a s e components from Tr ichoderma v i r i d e and the substrate s p e c i f i c i t y of modified products. J. Biochem. 79:955-966. Nelson, N. (1952) A photometric adaptation of the Somogyi method for the determination of glucose. J. B i o l . Chem. 153:376-380. Norrander, J . , Kempe, T., and Messing, J. (1983) Construction of improved M13 vectors using oligodeoxyribonucleotide-directed mutagenesis. Gene 26:101-106. Nossal, N.G., and Heppel, L.A. (1966) The release of enzymes by osmotic shock from Escherichia c o l i in exponential phase. J . B i o l . Chem. 241: 3055-3062. Nummi, M, Niku-Paavola, M.-L., Enari, T.-M., and Raunio, V. (1981) I s o l a t i o n of c e l l u l a s e s by means of b i o s p e c i f i c sorption on amorphous c e l l u l o s e . Anal. Biochem. 116:137-141. O'Callaghan, C.H., Morris, A., Kirby, S.M., and Shingler, A.H. (1972) Novel method for detection of 0 -lactamase by using a chromogenic cephalosporin substrate. Antimicrob. Ag. Chemother. 1:283-288. O'Neill, G., Goh, S.H., Warren, R.A.J. Kilburn, D.G., and M i l l e r , R.C.Jr. (1986a) Structure of the gene encoding the exoglucanase of Cellulomonas f imi. Gene 44:325-330. O'Neill, G., Warren, R.A.J., Kilburn, D.G., and M i l l e r , R.C.Jr. ( 1986b) Secretion of a Cellulomonas fimi exoglucanase by Escherichia c o l i . Gene 44:331-336. O'Neill, G., Warren, R.A.J., Kilburn, D.G., M i l l e r , R.C.Jr. (1986c) Overproduction of a c e l l u l a s e gene with a high guanosine plus cytosine content in Escherichia  c o l i . Appl. Environ. Microbiol. 52:737-743. Owolabi, J.B., Beguin, P., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. (1988) Expression in Escherichia  c o l i of the s t r u c t u r a l gene for endoglucanase B of Cellulomonas f i m i . Appl. Environ. Microbiol., in press. Peacock, S.L., Mclver, CM., and Monohan, J.J. (1981) Transformation of E. c o l i using homopolymer-linked plasmid chimeras. Biochim. Biophys. Acta 655:243-250. 100 P e n t t i l a , M. , Lehtovaara, P., Nevalainen, H., Bhikhabhai, R., and Knowles, J. (1986) Homology between c e l l u l a s e genes of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene. Gene 45:253-263. P e n t t i l a , M.E., Nevalainen, K.M.H., Raynal, A., and Knowles, J.K.C. (1984) Cloning of Aspergillus niger genes in yeast. Expression of the gene coding Aspergillus j3-glucosidase. Mol. Gen. Genet. 194:494-499. Pettersson, L.G. (1975) The mechanism of enzymatic hydrolysis of c e l l u l o s e by Trichoderma v i r i d e , p. 255-280. In M.' Bailey, T.M. Enari, and M. Linko, (eds.), Symposium on Enzymatic Hydrolysis of Cellulose. SITRA, He l s i n k i . Raynal, A., and Guerineau, M. (1984) Cloning and expression of the st r u c t u r a l gene for 0-glucosidase of Kluyveromyces f r a g i l i s in Escherichia c o l i and Saccharomyces cerevisiae . Mol. Gen. Genet. 195:108-115. Reese, E.T. (1982) Elution of c e l l u l a s e from c e l l u l o s e . Process Biochem. 17:2-6. Reese, E.T., Siu, R.G.H., and Levinson, H.S. (1950) B i o l o g i c a l degradation of soluble c e l l u l o s e derivatives. J. B a c t e r i o l . 59:485-487. Remaut, E., Tsao, H., and F i e r s , W. (1983) Improved plasmid vectors with a thermoinducible expression and temperature regulated runaway r e p l i c a t i o n . Gene 22:103-113. Rinderknecht, H., Geokas, M.C, Silverman, P., and Haverback, B.J. (1968) A new u l t r a s e n s i t i v e method for the determination of p r o t e o l y t i c a c t i v i t y . C l i n . Chim. Acta 21:197-203. Rivers, D.B., Gracheck, S.J., Woodford, L . C , and Emert, G.H. " (1984) Limitations of the DNS assay for reducing sugars from saccharified l i g n o c e l l u l o s i c s . Biotechnol. Bioeng. 26:800-802. Roberts, T.M., and Lauer, CD. (1979) Maximizing gene expression on a plasmid using recombination in  v i t r o . Method Enzymol. 68:473-482. Robson, L.M., and Chambliss, G.H. (1986) Cloning of the Bac i l l u s s u b t i l i s DLG 0-1,4-glucanase gene in Escherichia c o l i and B. s u b t i l i s . J . B a c t e r i o l . 165:612-619. 101 Robson, L.M., and Chambliss, G.H. (1987) Endo-j3 -1 ,4-glucanase gene of B a c i l l u s s u b t i l i s DLG. J. B a c t e r i o l . 169:2017-2025. Romaniec, M.P.M., Clarke, N.G., and Hazlewood, G.P. (1987) Molecular cloning of Clostridium thermocellum DNA and the expression of further novel endo-/3-1 , 4-glucanase genes in Escherichia c o l i . J . Gen. M i c r o b i o l . 133:1297-1307. Rosenberg, M. , and Court, D. (1979) Regulatory sequences involved in the promotion and termination of RNA t r a n s c r i p t i o n . Ann. Rev. Genet. 13:319-353. Russell, D.R., and Bennett, G.N. (1982) Construction and analysis of ir\ vivo a c t i v i t y of E. c o l i promoter hybrids and promoter mutants that a l t e r the -35 to -10 spacing. Gene 20:231-243. Ryu, D.D.Y., Kim, C , andMandels, M. (1984) Competitive adsorption of c e l l u l a s e components and i t s s i g n i f i c a n c e in a synergistic mechanism. Biotechnol. Bioeng. 26:488-496. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with chain terminating i n h i b i t o r s . Pro. Natl. Acad. S c i . USA 74:5463-5467. Sashihara, N., Kudo, T., and Horikoshi, K. (1984) Cloning and expression of c e l l u l a s e genes of a l k a l o p h i l i c B a c i l l u s sp. st r a i n N-4 in Escherichia c o l i . J. B a c t e r i o l . 158: 503-506. Schwarz, W. , Bronnenmeier, K., and Staudenbauer, W.L. (1985) Molecular cloning of Clostridium thermocellum genes involved in 0-glucan degradation in bacteriophage lambda. Biotechnol. Lett. 7:859-864. Schwarz, W.H., Grabnitz, F., and Staudenbauer, W.L. (1986) Properties of a Clostr idium thermocellum endoglucanase produced in Escherichia c o l i . Appl. Environ. Microbiol. 51:1293-1299. Shoemaker, S.P., Gelfand, D.H., Innis, M.A. Kwok, S.Y., Ladner, M.B., and Schweickart, V. (1984) Recombinant fungal cellobiohyrolases. European patent application EP 137,280. European Patent O f f i c e . 1 02 Shoemaker, S.P., Schweilkart, V., Ladner, M. , Gelfand, D., Kwok, S., Myambo, K., and Innis, M. (1983) Molecular cloning of the exocellobiohydrolase derived from Trichoderma reesei s t r a i n L27. Bio/Technology 1:691-696. Silhavy, T.J., Benson, S.A., and Emr, S.D. (1983) Mechanism of protein l o c a l i z a t i o n . M i c r o b i o l . Rev. 47: 313-344. Sternberg, D., and Mandels, G.R. (1979) Induction of c e l l u l o l y t i c enzymes in Trichoderma reesei by sophorose. J. B a c t e r i o l . 139:761-769. Stewart, B.J., and Leatherwood, J.M. (1976) Derepressed synthesis of c e l l u l a s e by Cellulomonas. J. B a c t e r i o l . 128:609-615. Stuber, D., and Bujard, H. (1981) Organization of t r a n s c r i p t i o n a l signals in plasmids pBR322 and pACYC184. Proc. Natl. Acad. S c i . USA 78:167-171 . S u t c l i f f , J.G. (1979) Complete nucleotide sequence of the Escherichia c o l i plasmid pBR322. Cold Spring Harbor Symp. Quant. B i o l . 43:77-90. Suzuki, H. (1975) Cellulase formation in Pseudomonas  fluorescens var. c e l l u l o s a , p. 115-169. In M. Bailey, T.M. Enari, and M. Linko (eds.), Symposium on Enzymatic Hydrolysis of C e l l u l o s e . SITRA, Hel s i n k i . Taylor, K.A., Crosby, B., McGavin, M., Forsberg, C.W., Thomas, D.Y. (1987) C h a r a c t e r i s t i c s of the endoglucanase encoded by a eel gene from Bacteroides  succ inogenes expressed in Escher i c h i a c o l i . Appl. Environ. Microbiol. 53:41-46. Teather, R.M., and Wood, P.J. (1982) Use of Congo-red-poly saccharide interactions in enumeration and characterization of c e l l u l o l y t i c bacteria from bovine rumen. Appl. Environ. Microbiol. 43:777-780. Tee r i , T. (1987) The c e l l u l o l y t i c enzyme system of Trichoderma reesei. Molecular cloning, characterization and expression of the cellobiohydrolase genes. Technical Research Centre of Finland. Publications 38. Espoo, Finland. 103 Tee r i , T.T., Lehtovaara, P., Kauppinen, S., Salovuori, I., and Knowles, J. (1987) Homologous domains in Tr ichoderma reesei c e l l u l o l y t i c enzymes: gene sequence and expression of cellobiohydrolase I I . Gene 51:43-52. Teeri , T., Salovuori, I., and Knowles, J. (1983) The molecular cloning of the major c e l l u l a s e gene from Tr ichoderma reesei. Bio/Technology 1:696-699. Towbin, H., Staehlin, T., and Gordon, J . (1979) Electrophoretic transfer of proteins from polyacrylamide gels to n i t r o c e l l u l o s e sheets: procedure and some applications. Proc. Natl. - Acad. S c i . USA 76:4350-4354. van Gijsegem, F., Toussaint, A., and Schoonejans, E. (1985) In vivo cloning of the pectate lyase and c e l l u l a s e genes of Erwinia chrysanthemi. EMBO J. 4:787-792. van Tilbeurgh, H., Bhikhabhai, R., Petterson, L.G., and Claeyssens, M. (1984) Separation of endo- and exo-type c e l l u l a s e s using a new a f f i n i t y method. FEBS L e t t . 169:215-218. van Tilbeurgh, H., Claeyssens, M., and de Bruyne, C.K. (1982) The use of 4-methylumbelliferyl and other chromophoric glycosides in the study of c e l l u l o l y t i c enzymes. FEBS Lett. 149: 152-156. van Tilbeurgh, H., Tomme, P., Claeyssens, M., Bhikhabhai, R., and Petterson, G. (1986) Limited proteolysis of the cellobiohydrolase I from Trichoderma reesei. Separation of functional domains. FEBS Lett. 204:223-227. Vasantha, N. , Thompson, L.D., Rhodes, C , Banner, C , Nagle, J . , and F i l p u l a , D. (1984) Genes for alkaline protease and neutral protease from Bacillus  amyloliquefaciens contain a large open reading frame between the regions coding for the signal sequence and mature protein. J. B a c t e r i d . 159:811-819. Vlasuk, G.P., Inouye, S., Ito, H., Itakura, K., and Inouye, M. (1983) Ef f e c t s of the complete removal of basic amino acid residues from the signal peptide on secretion of lipoprotein in Escherichia c o l i . J . B i o l . Chem. 258:7141-7148. 104 V o l l e r , A., Bidwell, D., and B a r l e t t , A. (1976) Microplate immunoassays for the immunodiagnosis of virus infections, p. 506-512. In N. Rose, and H. Freedman (eds.), Manual of C l i n i c a l Immunology, 1st ed. American Society for Microbiology, Washington, D.C. Wakarchuk, W.W., Greenberg, N.M., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. (1988) Structure and tran s c r i p t i o n analysis of the gene encoding a cell o b i a s e from Agrobacterium ATCC21400. J . B a c t e r i o l . 170:301-307. Wakarchuk, W.W., Kilburn, D.G., M i l l e r , R.C. J r . , and Warren, R.A.J. (1984) The preliminary characterization of j3-glucosidases of Cellulomonas  f i m i . J . Gen. Microbiol. 130:1385-1389. Wakarchuk, W.W., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. (1986) The molecular cloning and expression of a cellobiase gene from an Agrobacter ium in Escherichia c o l i . Mol. Gen. Genet. 205:146-152. Warren, R.A.J., Beck, C.F., Gilkes, N.R., Kilburn, D.G., Langdford, M.L., M i l l e r , R.C.Jr., O'Neill, G.P., Scheufens, H., and Wong, W.K.R. (1986) Sequence conservation and region s h u f f l i n g in an endoglucanase and an exoglucanase from Cellulomonas  f i m i . Proteins: Structure, Function and Genetics 1:335-341. Warren, R.A.J., Gerhard, B., Gilkes, N.R., Owolabi, J.B., Kilburn, D.G., and M i l l e r , R.C.Jr. (1988) A bifu n c t i o n a l exoglucanase-endoglucanase fusion protein. Gene, in press. Watson, T.G., Nelligan, I., and Lessing, L. (1984) Cellulase production by Tr ichoderma reesei (RUT-C30) in fed-batch culture. Biotechnol. Lett. 6:667-672. Whittle, D.J., Kilburn, D.G., Warren, R.A.J., and M i l l e r , R.C.Jr., (1982) Molecular cloning of a Cellulomonas f imi c e l l u l a s e gene in Escherichia c o l i . Gene 17:139-145. Wolff, B.R., Mudry, T.A., Glick , B.R., and Pasternak, J . J . (1986) Isolation of endoglucanase genes from Pseudomonas fluorescens subsp. c e l l u l o s a and a Pseudomonas sp. Appl. Environ. Microbiol. 51:1367-1369. 105 Wong, W.K.R., Gerhard, B., Gou, Z.M., Kilburn, D.G., Warren, R.A.J., and M i l l e r , R.C.Jr. (1986) Characterization and structure of an endoglucanase gene cenA of Cellulomonas f i m i . Gene 44:315-324. Wood, T.M. (1975) Properties and mode of action of ce l l u l a s e s . Biotechnol. Bioeng. Symp. 5:111-137. Wood, T.M. (1985) Properties of c e l l u l o l y t i c enzyme systems. Biochem. Soc. Trans. 13:407-410. Wood, T.M., and McCrae, S.I. (1979) Synergism between enzymes involved in the s o l u b i l i z a t i o n of native c e l l u l o s e , p. 181-209. In R.D. Brown, and L. Jurasek, (eds.), Advances in Chemical Series v o l . 181. American Chemical Society, Washington, D.C. Wynne, E.C., and Pemberton, J.M. (1986) Cloning of a gene clus t e r from C e l l v i b r i o mixtus which codes for ce l l u l a s e , c hitinase, amylase, and pectinase. Appl. Environ. Microbiol. 52:1362-1367. Yaguchi, M., Roy, C , R o l l i n s , C.F., Paice, M.G., and Jurasek, L. (1983) A fungal c e l l u l a s e shows sequence homology with the active s i t e of hen egg-white lysozyme. Biochem. Biophys. Res. Comm. 116:408-411. Yang, M., G a l i z z i , A., and Henner, D. (1983) Nucleotide sequence of the amylase gene from B a c i l l u s subti1 i s . Nucl. Acids Res. 11:237-249. Yanisch-Perron, C , V i e i r a , J ., and Messing, J. (1985) Improved M13 phage cloning vectors and host s t r a i n s : nucleotide sequences of M13mp and pUC vectors. Gene 33:103-119. Zappe, H., Jones, D.T., and Woods, D.R. (1986) Cloning and expression of Clostr idium acetobutylicum endoglucanase, cellobiase and amino acid biosynthesis genes in Escherichia c o l i . J. Gen. Microbiol. 132:1367-1372. 106 APPENDIX I Expression of cenB on a thermoinducible runaway rep l i c a t i o n plasmid A) Targeted 5' deletions of the cenB gene In order to further engineer the cenB gene for overexpression in E. c o l i , another set of targeted deletions of the gene was generated. The plasmid pJB3 was l i n e a r i z e d with Hindi11 and digested b i - d i r e c t i o n a l l y with Exonuclease III, followed by removal of single-stranded overhanging regions with S, nuclease (Materials and Methods). The res u l t i n g products were cleaved with EcoRI, and ligated into Smal and EcoRI cleaved pUCl9. E. c o l i C600 c e l l s transformed with the l i g a t i o n mix were selected for Amp and screened for CMcellulase. Plasmids isolated from clones were analysed by r e s t r i c t i o n enzyme digestion and agarose gel electrophoresis. The fusion junctions of the lacZ'-cenBA plasmids were also sequenced. Representative 5' deletions of cenB obtained are as shown (Fig. A l ) . 1 07 B) Construction of pCP3cenB expression vectors The plasmid pCP3 is a derivative of the runaway r e p l i c a t i o n vector pKN402 which contains the lambda pL promoter adjacent to a multiple cloning s i t e (see Materials and Methods). In order to provide the necessary t r a n s l a t i o n a l i n i t i a t i o n signals for the overexpression of cenBAs, a derivative of pCP3 was constructed as shown (Fig. A2). pCP3 deleted for the EcoRI-BamHI region in the multiple cloning s i t e was lig a t e d to an EcoRI - BamHI portable t r a n s l a t i o n i n i t i a t i o n sequence (PTIS, purchased from Pharmacia, Canada). A single copy of the PTIS was observed on the res u l t i n g plasmid pCP3::PTIS, by r e s t r i c t i o n enzyme analysis and sequencing by the base-specific chemical degradation method (data not shown). cenBA5 was subcloned into pCP3::PTIS as shown (Fig. A2). The 2.1kb fragment generated from BamHI-Smal digestion of pJB3A5 was g e l - p u r i f i e d and ligate d into the BamHI and HincII sites of pUCl8. E. c o l i c e l l s transformed with the l i g a t i o n mix were selected for Amp and screened for CMcellulase a c t i v i t y . The resulting plasmid, pUC18cenBA5, was digested with BamHI and HindiII; the desired fragment was p u r i f i e d and ligat e d into BamHI and Hindi11 s i t e s of the pCP3::PTIS expression vector. 108 In the plasmid, designated pCP3cenBA5, the lambda leftward promoter i n i t i a t e s t r a n s c r i p t i o n across the cenBA5, which i s fused in-frame to the i n i t i a t i n g codon of the PTIS. C) EngB synthesis in E. coli/pCP3cenBA5 E. c o l i C600/pcI857 c e l l s carrying pCP3cenBA5 were grown in Luria broth supplemented with a m p i c i l l i n (l00Mg/ml) and kanamycin (50/xg/ml) at 30°C to an O.D. at 600 nm of 0.3. Subsequently, the culture was divided, and p a r a l l e l samples were grown further at 30°C (noninduced) and at 41°C (induced) for 2 hours. The plasmid pcl857 codes for kanamycin resistance and for the thermolabile cl857 gene product (Materials and Methods). Although the c e l l extract of the C600/pcI857/pCP3cenBA5 induced culture had endoglucanase a c t i v i t y on CMcellulose Congo red indicator plate, the l e v e l of expression could not be accurately measured in the reducing sugar assay with the DNSA reagent because the absorbance was not s i g n i f i c a n t l y d i f f e r e n t from that of the reagent blank. Moreover, no d i s t i n c t polypeptide corresponding to the pCP3cenBA5 encoded endoglucanase could be detected by SDS-PAGE analysis. 109 Figure A1. Sizes of deletions CMcellulase expression of the cenB C600 AmpR clones containing various and effects on gene. E. c o l i deletion plasmids were screened for CMcellulase a c t i v i t y with Congo red. The plasmids were isola t e d and the sizes of deletions were determined by r e s t r i c t i o n enzyme analysis and agarose gel electrophoresis. Only the C. fimi DNA fragments are shown. a)parental fragment; b) A160; c) A75; d) A5; e) A78; f)A7. Transcription depended on the lac promoter/operator provided by pUCl9. CMcellulase phenotypes : " - " , inactive; " +/- " , weakly active; " + " , active. R e s t r i c t i o n s i t e s : B, BamHI; P, PstI. 0 a) b) B P 5.6 kb ~~' CMcelluiase B Phenotype 0 d) e) -I-/-1 10 Figure A2. Scheme for the construction of pCP3cenB expression vector. See the text for d e t a i l s . The DNA sequence of the cenBA5 coding region immediately 3' to the lambda leftward promoter in pCP3 i s shown. The functional orientations of the gene coding for /3-lactamase (Amp R ) , EngB, and the lac and P L promoters are indicated by arrows. P T I S ; coding sequence of the EngB. Re s t r i c t i o n s i t e s : B, BamHI; E, EcoRI; He, H i n d I; H3, Hindi11; Sm, Smal. The deduced amino acid sequence for translated codons i s indicated in one-letter code. S m ...AATTATGGATCCCCCCGCC -

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0098159/manifest

Comment

Related Items