UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular cloning, characterization and expression of the endoglucanase C gene of Cellulomonas fimi and… Moser, Bernhard 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A1 M67_5.pdf [ 9.79MB ]
Metadata
JSON: 831-1.0098157.json
JSON-LD: 831-1.0098157-ld.json
RDF/XML (Pretty): 831-1.0098157-rdf.xml
RDF/JSON: 831-1.0098157-rdf.json
Turtle: 831-1.0098157-turtle.txt
N-Triples: 831-1.0098157-rdf-ntriples.txt
Original Record: 831-1.0098157-source.json
Full Text
831-1.0098157-fulltext.txt
Citation
831-1.0098157.ris

Full Text

MOLECULAR CLONING, CHARACTERIZATION AND EXPRESSION OF THE ENDOGLUCANASE C GENE OF CELT.ULOMONAS FTMI AND PROPERTIES OF THE NATIVE AND RECOMBINANT GENE PRODUCTS by BERNHARD MOSER Diploma, F e d e r a l I n s t i t u t e of Technology, Z u r i c h , Switzerland, 1981 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES (Department of Microbiology) We accept t h i s t h e s i s as conforming t o the r e q u i r e d standard THE UNIVERSITY OF BRITISH COLUMBIA October 1988 © Bernhard Moser, 1988 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada D „ e ocr. m , ngg DE-6 (2/88) i i ABSTRACT In addition to substrate-associated c e l l u l a s e s , Cellulomonas fimi s e c r e t e s endoglucanases ( endo-1, 4 - f i - D - g l u c a n glucanohydrolases, EC 3.2.1.4. ) which are recovered from the c e l l u l o s e - f r e e c u l t u r e supernatant of c e l l s grown on microcrystalline c e l l u l o s e . Two such enzymes, C3.1 and C3.2 with M rs of 130'000 and 120'000, r e s p e c t i v e l y , were p u r i f i e d to homogeneity. The two endoglucanases were shown to share the same N - t e r m i n a l amino a c i d sequence and to h y d r o l y z e carboxymethylcellulose ( CMC ) with s i m i l a r e f f i c i e n c i e s ( 236u/mg protein for C3.1 and 367u/mg protein for C3.2 ). The recombinant lambda vector L47.1-169 was i d e n t i f i e d from a C.fimi DNA-lambda l i b r a r y on the basis of h y b r i d i z a t i o n with C3.1/2-specific oligonucleotide probes. The subclone pTZ18R-8 only moderately expressed CMCase a c t i v i t y . The 5'-terminus of cenC ( the gene coding for C3.1/2 ) was l o c a l i z e d i n the i n s e r t by Southern t r a n s f e r experiments and nucleotide sequence analysis. Results from t o t a l C.fimi RNA-DNA hybrid p r o t e c t i o n analyses defined the boundaries of cenC i n pTZ18R-8 and l e d to the tentative i d e n t i f i c a t i o n of -10 and -35 promoter sequences. To improve the expression of cenC, i t s e n t i r e coding sequence, except for the s t a r t codon GTG, was fused i n frame to the ATG codon of a synthetic ribosomal binding s i t e ( PTIS ) and placed under the t r a n s c r i p t i o n a l control of the lac p/o system. Induction of the r e s u l t i n g clone ( JM101[pTZP-cenC] ) led to impaired growth i n l i q u i d cultures because overproduction of CenC i n h i b i t e d c e l l division'" and eventually l e d to c e l l death. A n a l y s i s of c e l l f r a c t i o n s by SDS-PAGE revealed a dominant ( >10% of t o t a l c e l l e x t r a c t p r o t e i n s ), c l o n e - s p e c i f i c p r o t e i n with a M r of approximately 140'000 which was found e x c l u s i v e l y i n the i i i c y t o p l a s m i c f r a c t i o n . Conversely, 60% of the t o t a l CMC-hydrolyzing a c t i v i t y was l o c a l i z e d i n the p e r i p l a s m i c f r a c t i o n i n d i c a t i n g that t h e e x p o r t o f CenC i s r e q u i r e d f o r maximal e x p r e s s i o n of endoglucanase a c t i v i t y . I s o l a t i o n o f the c e l l u l o l y t i c a c t i v i t i e s from an osmotic shockate l e d t o the p u r i f i c a t i o n t o homogeneity of two recombinant c e l l u l a s e s , CenCl and CenC2, w i t h M r o f 130'000 and 120'000, r e s p e c t i v e l y . B o t h enzymes h y d r o l y z e d CMC w i t h s i m i l a r e f f i c i e n c i e s ( 278u/mg p r o t e i n f o r CenCl and 390u/mg p r o t e i n f o r CenC2 ). In a d d i t i o n , amino a c i d sequence a n a l y s e s showed the two enzymes t o have the same N - t e r m i n i as the n a t i v e enzymes and proved furthermore t h a t the CenC l e a d e r p e p t i d e was f u n c t i o n a l i n Escherichia c o l i . i v TABLE OF CONTENTS ABSTRACT TABLE OF CONTENTS LIST OF TABLES LIST OF FIGURES LIST OF ABBREVIATIONS ACKNOWLEDGEMENTS I. INTRODUCTION 1. Background 2. The c e l l u l o l y t i c system secreted by Cellulomonas fimi 2.1. Biochemical characterization of the c e l l u l o l y t i c components of C.fimi 2.2. Characterization of cloned C.fimi cellulase genes and the i r recombinant products 2.2.1. Molecular cloning of C.fimi cellulase genes 2.2.2. Subcloning and expression of cex 2.2.3. Subcloning and expression of cenA 2.2.4. Comparative biochemical analyses of Cex and CenA, and of the i r genes 2.2.5. Subcloning and expression of cenB 2.2.6. Ident i f i c a t i o n of an E.coli clone expressing fi-glucosidase a c t i v i t y 3. Objectives for the research of t h i s thesis II. MATERIALS AND METHODS 1. Bacterial strains, plasmids and phage vectors 2. Biochemicals 3. Preparation of rabbit serum s p e c i f i c for C3.2 4. Protein biochemistry PAGE i i i v v i i v i i i x i x i i 1 1 4 4 12 12 13 14 15 18 18 19 21 21 21 22 22 V PAGE 4.1. Preparation of Affigel-10-RccC3 .2 a f f i n i t y column 22 4.2. Determination of protein concentrations 22 4.3. Polyacrylamide gel electrophoresis ( SDS-PAGE ) 24 4.4. Western blot analysis 24 4.5. Amino acid sequence analysis and amino acid composition determination 24 4.6. Fractionation of bacterial c e l l s 25 5. Enzyme assays 25 5.1. DNS-CMCase assay 25 5.2. pNPCase assay 26 5.3. f3--lactamase assay 26 5.4. Glucose-6-P-DHase assay 27 5.5. Congo red plate assay 27 6. Electron microscopy 28 7. DNA and RNA methodology 28 7.1. Isolation of C.fimi DNA 28 7.2. Isolation of plasmid and bacteriophage DNA 29 7.3. Preparation of template DNA for sequencing 2 9 7.4. Construction of plasmid deletions for sequencing 30 7.5. DNA sequencing 35 7.6. Construction of the C.fimi DNA-lambda l i b r a r y 35 7.7. Synthesis and p u r i f i c a t i o n of oligonucleotides 36 7.8. Labeling of DNA with 3 2 P 36 7.9. Screening methods for recombinant bacteriophage and plasmid vectors 37 7.10. DNA and RNA dot-blot analysis 38 7.11. Southern transfer analysis 38 7.12. cDNA synthesis by primer extension 39 7.13. Isolation of C.fimi RNA 39 7.14. RNA-DNA hybrid protection analysis 40 v i PAGE I I I . RESULTS AND DISCUSSION 41 1. I s o l a t i o n and c h a r a c t e r i z a t i o n of endoglucanases from C.fimi c u l t u r e supernatant 41 1.1. P u r i f i c a t i o n of C3.1 and C3.2 41 1.2. C h a r a c t e r i z a t i o n of C3.1 and C3.2 45 2. Molecular c l o n i n g of cenC 51 2.1. P r e l i m i n a r y experiments 51 2.2. C l o n i n g s t r a t e g y 55 2.3. Subcloning and i n i t i a l c h a r a c t e r i z a t i o n of cenC 57 2.4. Sequence a n a l y s i s of the 5'-end of cenC 66 3. Analyses of in vivo cenC t r a n s c r i p t s of C.fimi 74 3.1. Mapping of the 5'-ends of cenC t r a n s c r i p t s 74 3.2. Mapping of the 3 1-ends of cenC t r a n s c r i p t s 78 4. Overproduction of CenC i n E.coli 84 4.1. C o n s t r u c t i o n of pTZP-cenC 84 4.2. C h a r a c t e r i z a t i o n of the expression of cenC i n JM101[pTZP-cenC] 93 5. I n i t i a l c h a r a c t e r i z a t i o n of p u r i f i e d , recombinant CenC 103 5.1. P u r i f i c a t i o n of recombinant CenCl and CenC2 103 5.2. Amino a c i d sequence a n a l y s i s of CenCl and CenC2 106 6. F i n a l remarks 108 IV. REFERENCES 114 V. APPENDIX Flow-chart p r o t o c o l f o r the molecular c l o n i n g of cenC and the c o n s t r u c t i o n of the cenC high-expression vector, pTZP-cenC 124 v i i LIST OF TABLES TABLE PAGE I. Comparison of values for the kinetic parameters of C.fimi cellulases 6 II. Cloned cellulase genes of C.fimi and t h e i r products 8 III. Flow-chart of the p u r i f i c a t i o n of C3.1 and C3.2 44 IV. Amino-terminal amino acid sequence data of C3.1, C3.2 and the C3.2-internal t r y p t i c peptide T-115 49 V. P a r t i a l amino acid composition analysis of C3.2 50 VI. Cross-screen of recombinant L47.1 clones 59 VII. Endoglucanase a c t i v i t i e s of various cenC clones 96 VIII. Effect of IPTG on growth and v i a b i l i t y of JM101 [pTZP-cenC] 97 IX. Localization of CenC a c t i v i t y in JM101[pTZP-cenC] 102 X. Flow-chart of the p u r i f i c a t i o n of CenCl and CenC2 105 v i i i L I S T OF FIGURES Figure PAGE 1. Proposed bifunctional structure of CenA and Cex 16 2. ELISA of rabbit B3 anti C3.2 serum 23 3. P u r i f i c a t i o n of template DNA by alkaline sucrose gradient centrifugation 31 4. Generation of deletions following a modification of the Dale procedure 33 5. P u r i f i c a t i o n scheme for C3.1 and C3.2 42 6. SDS-PAGE analysis of C3.1 and C3.2 46 7. Western blot analysis of p u r i f i e d C3.1 and C3.2 48 8. P a r t i a l nucleotide sequence of pUC13-l/43 53 9. Oligonucleotide screening probes for the lambda L47.1-C.fimi DNA l i b r a r y 56 10. Autoradiogram of a pl a q u e - f i l t e r l i f t hybridization experiment 58 11. Diagram of the recombinant clone lambda L47.1-169 60 12. DNA dot-blot hybridization experiment 62 13. Nucleotide sequence analysis of the plasmids M13mpl9-B4 and M13mpl9-B5 63 14. Diagram of the Genescribe vector system pTZ18/19-R/U 65 i x Figure PAGE 15. Restriction enzyme map of the recombinant DNA in pTZ18R-8 67 16. Southern transfer analyses of pTZ18R-8 DNA 69 17. Sequencing strategy for the insert i n pTZ18R-8/5-5 70 18. Effect of using 7d-dGTP during sequencing C.fimi DNA 72 19. Nucleotide sequence of the 5'-region of cenC 73 20. Dot-blot analysis of t o t a l C.fimi RNA 75 21. Preparation of the probe for the 5'-cenC transcript mapping 7 6 22. SI nuclease protection analysis of 5'-ends of cenC transcripts 77 23. Fine-mapping of 5'-ends of cenC transcripts 7 9 24. 5'-region of cenC showing the proposed transcription start sites 80 25. Scheme used for the preparation of the probe for the 3'-cenC transcript mapping 82 26. Mapping of 3'-ends of C.fimi transcripts 85 27. Nucleotide sequence at the 3'-end of cenC 86 28. Construction of pTZP-cenC 89 29. Construction of PTIS-cenC fusion by primer extension 91 30. Congo red plate assay 94 X F i g u r e PAGE 31. Growth and a c t i v i t y p r o f i l e s of JM101[pTZP-cenC] 98 32. E l e c t r o n micrographs of JM101[pTZP-cenC] c e l l s 101 33. SDS-PAGE a n a l y s i s of p r o t e i n samples from d i f f e r e n t compartments of JM101[pTZP-cenC] 104 34. SDS-PAGE a n a l y s i s of CenCl and CenC2 107 x i LIST OF ABBREVIATIONS a.a. amino acid(s) Amp a m p i c i l l i n bp base p a i r ( s ) cbg C.fimi gene encoding Cbg Cbg C.fimi fi-glucosidase cenA (B, C) C.fimi gene encoding CenA(B,C) CenA(B, C) C.fimi endoglucanase A(B,C) cex C.fimi gene encoding Cex Cex C.fimi exoglucanase CMC carboxymethylcellulose Con A concanavalin A DNS d i n i t r o s a l i c y l i c a c i d dNTP deoxynucleotide t r i p h o s p h a t e IPTG i s o p r o p y l - p - D - t h i o g a l a c t o s i d e kb k i l o base p a i r ( s ) kDa k i l o dalton(s) l a c l a c t o s e operon l a c p/o l a c promoter-operator LB L u r i a broth X bacteriophage lambda PAGE polyacrylamide g e l e l e c t r o p h o r e s i s p f u plaque forming u n i t (s) PL l e f t w a r d promoter of lambda pNPC p - n i t r o p h e n o l c e l l o b i o s i d e PTIS p o r t a b l e t r a n s l a t i o n i n i t i a t i o n s i t e RBS ribosomal b i n d i n g s i t e SDS sodium dodecyl s u l f a t e x i i ACKNOWLED GEMENT S I wish t o thank Drs. D.G. K i l b u r n , R.C. M i l l e r , J r . and R.A.J. Warren f o r t h e i r guidance and support during d i s c u s s i o n s , bench-work and completion of t h i s t h e s i s . I am indebted t o Dr. K. Humphrey f o r h i s advice and h e l p f u l suggestions during advisory committee meetings and proof reading of t h i s t h e s i s . I g r a t e f u l l y acknowledge Dr. N.R. G i l k e s f o r the c o n s t r u c t i v e c r i t i c i s m and readiness t o help whenever I knocked at h i s door. I wish t o thank Ms. K i e l l a n d , Dr. R. Olefson and Dr. D. McKay f o r performing amino, a c i d sequence analyses and amino a c i d composition determination, Drs. R. Bradley and D.G. Scraba f o r the e l e c t r o n microscopy work, and Dr. T. Atkinson f o r s y n t h e s i z i n g the o l i g o n u c l e o t i d e s . I am g r a t e f u l t o E. Kwan f o r lending me her s k i l l f u l hand i n p u r i f y i n g the n a t i v e endoglucanases. I e s p e c i a l l y wish to thank the l a d i e s and gentlemen as w e l l as my f e l l o w graduate students ( don't give up, p r e t t y soon y o u ' l l belong t o the former c l a s s !) of the c e l l u l a s e group f o r t h e i r support and a l l the good times we shared. To F. R o l l i I wish t o express my g r a t i t u d e f o r her understanding and s a c r i f i c e s during the predawn p e r i o d of t h i s work. This work was supported by grants from the Natural Sciences and Engineering Research Council of Canada. I dedicate t h i s t h e s i s t o Fr a n z i s k a and t o my parents, Hanni and Hans Moser. 1 I. INTRODUCTION I.1. Background As a main photosynthetic product the (3-glucan, cellulose, i s the most abundant, renewable polycarbon on earth. Not l a s t l y due to i t s chemical and physical properties, c e l l u l o s e i s only slowly degraded by a wide v a r i e t y of microorganisms. Among the most extensively studied organisms producing c e l l u l o l y t i c enzymes are the fungal species Trichoderma and Sporotrichum, actinomycetes of the species Streptomyces, and the b a c t e r i a l species Cellulomonas, Erwinia, Clostridium and Bacillus. It i s not the purpose of t h i s introduction to elaborate on the properties of t h e i r c e l l u l o l y t i c systems and to carry out a detailed comperative analysis. Instead, I w i l l r e f e r the reader to numerous exc e l l e n t review a c t i c l e s ( Beguin et al., 1987, Coughlan, 1985, B i s a r i a and Ghose, 1981, Mandels, 1983, and Eriksson and Wood, 1985). A general model for the degradation of cellulose by c e l l u l o l y t i c enzymes emerged mainly from studies of the fungi Trichoderma sp. and Sporotrichum pul verulentum. In a f i r s t step, the (5-1,4-gl y c o s i d i c bonds in amorphous regions of ce l l u l o s e are hydrolyzed by endoglucanases ( endo-1, 4-(5-D-glucan glucanohydrolase, EC 3.2.1.4 ) . There seems to be some controversy as to whether substrate bound endoglucanases are capable of d i s r u p t i n g the c r y s t a l l i n e structure of cellulose to form microamorphous regions p r i o r to t h e i r enzymatic action ( Klyosov et al., 1986, Ryu et al., 1984 ) or whether additional factors such as hydrogen bondase ( Enari and Niku-Paavola, 1987 ) or other protein components l i k e CI ( Montenecourt, 1983 ) are the sole requirements for the "amorphogenesis" of c e l l u l o s e . The newly created ends of cellulose macromolecules are subsequently attacked at t h e i r nonreducing ends by c e l l o b i o h y d r o l a s e s ( 1, 4-|3-D-glucan cellobiohydrolase, EC 2 3 . 2 . 1 . 9 1 , a l s o r e f e r e d t o a s e x o g l u c a n a s e s ) t o p r o d u c e c e l l o b i o s e . F i n a l l y , s m a l l s o l u b l e c e l l o d e x t r i n s i n c l u d i n g c e l l o b i o s e a r e d e g r a d e d t o g l u c o s e by c e l l o b i a s e s o r g e n e r a l l y (3-g l u c o s i d a s e s ( EC 3.2.1.21 ) . A c o n s e n s u s i s e m e r g i n g w i t h r e s p e c t t o t h e c e l l u l a r l o c a t i o n o f c e l l o b i a s e s : f u n g i s e c r e t e t h e enzyme t o h y d r o l y z e c e l l o b i o s e e x t r a c e l l u l a r l y w h e r e a s b a c t e r i a c o n v e r t t h e s u b s t r a t e t o g l u c o s e b y c e l l a s s o c i a t e d c e l l o b i a s e s . The b i o s y n t h e s i s o f c e l l u l a s e s i n v i r t u a l l y a l l m i c r o o r g a n i s m s e x a m i n e d t o d a t e i s s u b j e c t t o r e g u l a t i o n b y t h e c a r b o n s o u r c e . C e l l u l o s e i n t h e g r o w t h medium h a s a n i n d u c i n g e f f e c t w h e r e a s g l u c o s e o r r e a d i l y m e t a b o l i z e d s u g a r s r e p r e s s t h e e x p r e s s i o n o f c e l l u l a s e s ( C o u g h l a n , 1985 ) . H o w e v e r , t h e s t r u c t u r e o f t h e a c t u a l i n d u c e r w h i c h i s g e n e r a l l y e f f e c t i v e i n a v a r i a t y o f c e l l u l o l y t i c s y s t e m s i s s t i l l e l u s i v e t o d a t e . I t i s w i d e l y a c c e p t e d t h a t i n t h e p r e s e n c e o f c e l l u l o s e , l o w l e v e l s o f c o n s t i t u t i v e l y e x p r e s s e d e ndo- a n d e x o g l u c a n a s e s p r o d u c e s o l u b l e o l i g o s a c c h a r i d e s w h i c h a c t a s i n d u c e r s o r a r e s u b s e q u e n t l y c o n v e r t e d t o i n d u c e r m o l e c u l e s p e r h a p s b y ( 3 - g l u c o s i d a s e s o r g l y c o s y l t r a n s f e r a s e s . I n t h e f u n g a l s p e c i e s Trichoderma reesei ( S t e r n b e r g a n d M a n d e l s , 197 9 ) a n d Trichoderma v i r i d e ( E r i k s s o n a n d Hamp, 1978 ) s u c h an i n d u c e r m o l e c u l e h a s b e e n i d e n t i f i e d as s o p h o r o s e ( 2 - 0 - f i - g l u c o p y r a n o s y l - D - g l u c o s e ) , w h i c h e x h i b i t e d a d u a l r o l e i n t h e r e g u l a t i o n o f c e l l u l o s e e x p r e s s i o n ( S t e r n b e r g a n d M a n d e l s , 1980 ) . A t l o w c o n c e n t r a t i o n s ( 0 .5(IM ) t h e p r o d u c t i o n o f ( 5 - g l u c o s i d a s e s i s r e p r e s s e d , t h e r e b y d e c r e a s i n g t h e r a t e o f s o p h o r o s e h y d r o l y s i s . T h i s l e a d s t o t h e a c c u m u l a t i o n o f t h e i n d u c e r ( a p p r o x . 3 0 0 - f o l d i n c r e a s e i n c o n c e n t r a t i o n ) t o a c o n c e n t r a t i o n h i g h e n o u g h f o r t h e i n d u c t i o n o f e n d o - a n d e x o g l u c a n a s e e x p r e s s i o n . C e l l o b i o s e ( a n d l a c t o s e ) i s n o t c o n s i d e r e d t o be t h e n a t u r a l i n d u c e r s i n c e i t s i n d u c i n g a c t i v i t y 3 i s only observed at u n p h y s i o l o g i c a l l y high c o n c e n t r a t i o n s at which exoglucanases are i n h i b i t e d ( Coughlan, 1985 ). I t i s a common c h a r a c t e r i s t i c o f most c e l l u l o l y t i c systems to express m u l t i p l e forms of i n d i v i d u a l c e l l u l a s e a c t i v i t i e s . We are only b e g i n n i n g t o understand the reason f o r the complex nature of such c e l l u l o s e degrading apparatus. C e r t a i n l y , the s t e r e o c h e m i c a l and p h y s i c a l p r o p e r t i e s o f c e l l u l o s e r e q u i r e an a r r a y o f c e l l u l a s e s with d i f f e r e n t a c t i v i t i e s and f i n e - s p e c i f i c i t i e s . I t i s not s u r p r i s i n g then t h a t a v a r i e t y of genes c o n t r i b u t e t o the d i v e r s i t y of c e l l u l o l y t i c a c t i v i t i e s . However, e l e c t r o p h o r e t i c and amino a c i d sequencing a n a l y s i s as w e l l as i m m u n o - c r o s s r e a c t i v i t y d e t e r m i n a t i o n s produced a p i c t u r e f a r more complex than expected ( Coughlan, 1985 ). I t i s c e r t a i n t h a t g l y c o s y l a t i o n of e u k a r y o t i c c e l l u l a s e s c o n t r i b u t e s t o the v a r i e t y o f chromat©graphically d i s t i n c t c e l l u l o l y t i c components ( T e e r i , 1987 ) . Yet, the p h y s i o l o g i c a l f u n c t i o n of t h i s p o s t - t r a n s l a t i o n a l m o d i f i c a t i o n i s s t i l l s p e c u l a t e d upon. I t has been suggested t h a t g l y c o s y l a t i o n i s r e q u i r e d f o r s e c r e t i o n of f u n g a l c e l l u l a s e s ( S h e i r - N e i s s and Montenecourt, 1984 ). In a d d i t i o n , i t may c o n f e r thermal and pH s t a b i l i t y as w e l l as l i m i t e d p r o t e c t i o n a g a i n s t the a c t i o n of s e c r e t e d p r o t e a s e s . I t has been observed i n Trichoderma reesei t h a t t h e c o n c e n t r a t i o n and d i v e r s i t y o f c e l l u l a s e components change with i n c r e a s i n g age of the c u l t u r e ( Gong and Tsao, 197 9 ). The r e l e a s e of s m a l l e r , a c t i v e fragments from p u r i f i e d c e l l u l a s e s by p r o t e a s e p r e p a r a t i o n s from the same organism emphasizes the r o l e of p r o t e o l y s i s i n generating the m u l t i p l i c i t y of c e l l u l o l y t i c a c t i v i t i e s i n a g i v e n system ( L a n g s f o r d et al., 1987, Arfman et al., 1987 ) . P r o t e a s e s may p l a y an important r o l e in vivo by a l l o w i n g r e u t i l i z a t i o n of e x t r a c e l l u l a r enzymes by an organism growing under n i t r o g e n l i m i t a t i o n . 4 1.2. The c e l l u l o l y t i c system secreted by Cellulomonas fimi. 1.2.1. Biochemical characterization of the c e l l u l o l y t i c components of C.fimi The c e l l u l a s e system of C.fimi appears to be complex ( Langsford et a l . , 1984 ). Supernatants of cultures of t h i s Gram-p o s i t i v e , coryneform, mesophilic bacterium grown on a low concentration of A v i c e l ( m i c r o c r y s t a l l i n e c e l l u l o s e ; 0.1% ) c o n t a i n up to 10 d i s t i n g u i s h a b l e c e l l u l a s e a c t i v i t i e s as determined by t h e i r a b i l i t y to hydrolyze the soluble substrate carboxymethylcellulose ( CMC ). As i n fungal systems ( Coughlan, 1985 ), and a few c e l l u l o l y t i c b a c t e r i a l species such as Clostridium ( Ng and Zeikus, 1981, Creuzet and Frixon, 1983 ), Pseudomonas ( Yamane et al., 1970 ), and Thermomonospora ( Calza et al., 1985 ), some of the c e l l u l o l y t i c components secreted by C.fimi are glycosylated ( Langsford et al., 1984 ). I n i t i a l studies focused on the biochemical characterization of c e l l u l a s e s which were t i g h t l y bound to the i n s o l u b l e substrate A v i c e l . The two main components were recovered from A v i c e l by e l u t i o n with 6M guanidine hydrochloride and further p u r i f i e d to homogeneity by Concanavalin A-sepharose and MonoQ anion-exchange column chromatography. One enzyme was an exoglucanase ( gCex; the p r e f i x g indicates that the protein i s glycosylated ) with a Mr of 55'000. Its i s o e l e c t r i c point ( p i ) was shown to be 5.8, and the enzyme was glycosylated exclusively with mannose ( 8% by weight; Langsford, 1988 ). The s p e c i f i c a c t i v i t y of p u r i f i e d gCex on the substrate p-nitrophenolcellobioside ( pNPC ) was 9.3 units per mg of protein ( l u n i t = lu,mole p-nitrophenol released per minute ) , and on CMC i t was 85 units per mg of protein ( l u n i t = l|lmole reducing sugar produced per minute ). The values for the kinetic 5 parameters, Km and Vmax, using the substrates CMC and pNPC for the exoglucanase ( as well as for other native and recombinant C.fimi cellulases, see below ) are l i s t e d in Table I. The second enzyme was an endoglucanase ( gCenA ) with the Mr of 57'000, a p i of 8.2 and containing approx. 10% mannose by weight ( Langsford, 1988 ). As i s the case for true endoglucanases, the a c t i v i t y of gCenA on a r y l - c e l l o b i o s i d e substrates was marginal whereas CMC was e f f i c i e n t l y hydrolyzed, as the s p e c i f i c a c t i v i t y of 370 units per mg of protein indicates. Not a l l of the c e l l u l o l y t i c components secreted by C.fimi are associated with the insoluble substrate A v i c e l . Quite an array of c e l l u l a s e a c t i v i t i e s arises during the growth of the c e l l s on low concentration of A v i c e l , which remain free i n the c u l t u r e supernatant. The range of molecular weights of these enzymes suggests that not a l l of them are the r e s u l t of d i f f e r e n t i a l g l y c o s y l a t i o n or p r o t e o l y t i c cleavage of a r e s t r i c t e d repertoire of enzymes but instead are encoded by separate genes other than cex or cenA. One would expect that an e f f i c i e n t c e l l u l o l y t i c system contains, i n a d d i t i o n to substrate-bound c e l l u l a s e s , soluble enzymes with high substrate s p e c i f i c i t i e s for soluble intermediates generated during c e l l u l o s e h y d r o l y s i s . Such endoglucanases are c u r r e n t l y being i n v e s t i g a t e d ( see t h i s thesis ). C.fimi also synthesizes |3-glucosidases. At least two are found in whole c e l l extracts as determined by non-denaturing PAGE followed by assaying aryl-glucosidase ( pNPGase ) and cellobiase a c t i v i t y ( Wakarchuck et al . , 1984 ) . The expression of the pNPGase a c t i v i t y was not a f f e c t e d s i g n i f i c a n t l y by the carbon source used for growth of the c e l l s . On the other hand, the faster migrating c e l l o b i a s e was markedly growth substrate dependent, being maximally expressed i n the presence of cellobiose or A v i c e l . These two d i s t i n c t fj-glucosidases have not been i s o l a t e d and 6 TABLE I. Comparison of valu e s f o r the k i n e t i c parameters of C.fimi c e l l u l a s e s . The v a l u e s f o r the k i n e t i c parameters are based on h y d r o l y s i s o f CMC, pNPG and pNPC by g l y c o s y l a t e d , n a t i v e or n o n - g l y c o s y l a t e d , recombinant c e l l u l a s e s . Values f o r Kms are l i s t e d as mg/ml f o r CMC and mM f o r pNPG and pNPC; Vmaxs are e x p r e s s e d as umoles products r e l e a s e d per minute, per mg p r o t e i n . s u b s t r a t e enzyme 3 Km Vmax r e f erence* 5 CMC gCex 3.18+/-0.21 42.9+/-1.5 1 ngCex 3.04+/-0.23 35.8+/-1.9 1 gCenA 0.19+/-0.1 62.5+/-1.1 1 ngCenA 0.17+/-0.1 56.6+/-1.0 1 ngCenB 0.51+/-0.05 26.1+/-1.1 2 pNPC gCex 0.64+/-0.03 9.3+/-0.2 1 ngCex 0.70+/-0.02 11.4+/-0.1 1 pNPG ngCbg - 0.13 - 1063 3 a The p r e f i x g i n d i c a t e s the gly c o s y l a t e d form of the enzyme obtained from C.fimi c u l t u r e s ; ng stands f o r the non-glycosylated, recombinant form of the enzyme. b The numbers r e f e r to the references c i t e d : 1, Langdford et a l . , 1987; 2, Owolabi, 1988; 3, Paradis, personal communication. 7 p u r i f i e d yet. Cellobiose phosphorylases ( EC 2.4.1.20 ) of organisms which do not secrete |3-glucosidases are thought to play an important role i n the metabolism of c e l l o b i o s e . Preliminary studies of a cellobiose phosphorylase a c t i v i t y i n Cellulomonas sp. DSM 20108 indicate that t h i s enzyme i s located i n the cytosol ( Schimz and Decker, 1985 ). Maximal a c t i v i t y was recovered when the c e l l s were grown with c e l l o b i o s e as sole carbon source. However, no biochemical data are available to date for t h i s enzyme. C.fimi has not been assayed for t h i s a c t i v i t y . In fact, v i r t u a l l y nothing i s known about the metabolism of cellobiose i n C.fimi. In addition to the expression of c e l l u l a s e s , C.fimi secretes proteases. The major p r o t e o l y t i c a c t i v i t y i s i n h i b i t e d by phenylmethylsulfonyl f l u o r i d e ( PMSF ) , suggesting i t to be a serine protease ( Langsford et a l . , 1984, Langsford, 1988 ). Quantitative measurements of protease production i n supernatants of cultures grown with di f f e r e n t carbon sources show that protease synthesis i s regulated independently of c e l l u l o s e synthesis by c a t a b o l i t e r e p r e s s i o n during growth on glucose. The C.fimi protease preparations cleave p u r i f i e d gCenA and gCex into smaller fragments without a f f e c t i n g the t o t a l c e l l u l o l y t i c a c t i v i t y ( Langsford et al., 1987, Langsford, 1988 ), suggesting strongly that some of the small molecular weight c e l l u l o l y t i c a c t i v i t i e s observed i n older C.fimi cultures are derived by p r o t e o l y s i s of bigger cellulases. 8 TABLE I I . Cloned c e l l u l a s e genes of C.fimi and t h e i r products. L e t t e r s i n s u p e r s c r i p t : a, s p e c i f i c a c t i v i t i e s i n u n i t s per sample volume or mg p r o t e i n s ; b, e s t i m a t e d v a l u e s f o r the m o l e c u l a r weights of p u r i f i e d enzymes based on SDS-PAGE. L e t t e r s i n s u p e r s c r i p t behind numbers f o r the s p e c i f i c a c t i v i t i e s i n d i c a t e what the p a r t i c u l a r v a l u e s are r e f e r r e d t o : ve, ml of c e l l e x t r a c t ; vs, ml of c u l t u r e s u p e r n a t a n t ; v l , ml o f c e l l l y s a t e ; p, mg of c e l l e x t r a c t p r o t e i n s ; ps, mg o f c u l t u r e s u p e r n a t a n t p r o t e i n s . One u n i t e q u a l s one jimole o f products ( reducing sugar, p - n i t r o p h e n o l ) r e l e a s e d per minute. Arrows ( <-> ) i n d i c a t e the c o n s t r u c t s from which the r e s p e c t i v e recombinant enzymes were p u r i f i e d . Numbers i n b r a c k e t s r e f e r t o r e f e r e n c e s c i t e d : (1), W h i t t l e e t al., 1982; (2), G i l k e s et al., 1984a; (3), O ' N e i l l et al., 1986b; (4), C u r r y et al., 1988; (5), O ' N e i l l , 1986 ; (6), Langsford, 1988 ; (7), Wong et al., 1986a ; (8), Wong, 1986 ; (9), S k i p p e r et al., 1985; (10), Johnson et al., 1986; (11), Guo et al., 1988; (12), Owolabi et al., 1988a; (13), Owolabi, 1988; (14), Moser, t h i s t h e s i s ; (15), P a r a d i s , p e r s o n a l communication; (16), G i l k e s et al., 1988. TABLE II. Cloned c e l l u l a s e genes of C.fimi and t h e i r products gene p u r i f i e d recomb.prot. p u r i f i e d n a t i v e prot. construct (vector) host ,,a b promoter substrate spec• a c t * M £ spec. act%. M x spec, act^. cex pDWl (pBR322) p E C l (pBR322) E.coli C600 tet ? CMC 0.027v e (1) tet ? CMC pNPC 0.147P (2) 0.036P (2) gCe^; (6) 55'000 9.3 (pNPC) 85.0 (CMC) PUC12-1.1-PTIS pCP3cex pMV3.cex (pc!857) lac pNPC S. MEL1 cerevisiae 0.146P (3) <->na££x (5,16) 47'300 11.4 (pNPC) 37.0 (CMC) X P L pNPC 0.042P (3) <->59'000 pNPC 3.0PS (4) cenA pEC2 (pBR322) E.coli C600 tet CMC pNPC 0.217P (7) 0.778P (2) <0.00lP (2) gCe.n,A (6) 57'000 370 (CMC) pcEC2 (pUC) E.coli lac ? JM101 (F') CMC 0.015P (7) TABLE II. continued gene p u r i f i e d recomb.prot. p u r i f i e d n a t i v e prot, clone host (vector) promoter substrate spec. a c t ^ a M £ b spec, act^. Mx spec, act^. pK2 . 4 (pOP) S. ADC1 cerevisiae CMC 1.60 v s (9) pREC2.2 (pJAJ103) R. rxcA capsulatus CMC 8.75P (10) pUC18-1.6cenA E.coli lac JM101 (F 1) CMC 1.10 v e (ll)<-> naf^ ejoA (8,16) 48'700 4.13 (CMC) cenB pEC3 (pBR322) E.coli tet ? CMC 0.007P (12) C600 0.027P (2) n.d. n.d. pJB301 (pUC) E.coli RR1 lac CMC 0.147P (12)<->ao££nfi (13) llO'OOO 13.57 (CMC) pJB303 (pUC) lac CMC 0.157P (12) cenC L47.1-169 E.coli (Lambda L47.1) NM538 X P L ? CMC <0.01 v l C3.3, (14) 130'000 236 (CMC) TABLE I I . continued gene p u r i f i e d recomb.prot. p u r i f i e d n a t i v e p r o t . construct hQSt promoter substrate spec. act¥ a M £ b spec, act^. M.£ spec, act^. (vector) pTZ18R-8 E.coli lac ? CMC 0.008P (14) C3.2 (14) J M 1 0 1 (F') 120'000 367 (CMC) pTZP-cenC " lac CMC 0.350P (14)<->CenCl (14) 130'000 278 (CMC) < - > c e n c a (14) 120'000 390 (CMC) cbg pEC62 E.coli tet ? pNPG 5. 8P (15) (pBR322) C600 pUC13-62A31 E.coli lac ? pNPG 120P (15) <-> Cbg (15) n.d. n.d. JM83 180'000 12'950P 12 1.2.2. Characterization of cloned C.fimi c e l l u l a s e genes and t h e i r recombinant products 1.2.2.1. Molecular cloning of C.fimi cellulase genes Whittle et al. were the f i r s t group to report the molecular cloning of a c e l l u l a s e gene ( Whittle et al., 1982 ) . Total genomic C.fimi DNA was cloned into pBR322, and the r e s u l t i n g C.fimi DNA l i b r a r y was subsequently screened with antibodies against proteins i n C.fimi culture supenatants. The recombinant clone pDWl expressed CMCase a c t i v i t y as determined by the DNS-CMCase assay (Table II ) . A subsequent screening by the immunoscreening procedure of a new C.fimi DNA l i b r a r y of DNA digested to completion with BamHI and cloned into pBR322 yielded 61 immunopositives, of which 38 e x h i b i t e d c e l l u l a s e a c t i v i t y ( Gilkes et al., 1984b ). Based on a n t i g e n i c i t y and c e l l u l a s e a c t i v i t y , further c h a r a c t e r i z a t i o n of some of these p o s i t i v e s r evealed clones determining three d i s t i n c t c e l l u l a s e s . The plasmids i n these clones were refered to as pECl, pEC2 and pEC3 ( Table II ). pECl c a r r i e d a subfragment of the i n s e r t i n pDWl. Viscometric and c o l o r i m e t r i c analyses of CMC hydrolysis showed tha t the enzymes encoded by pEC2 and pEC3 behaved as endoglucanases, whereas the c e l l u l a s e encoded by pECl showed exoglucanase a c t i v i t y ( Gilkes et al., 1984a, Gilkes et al., 1984b ). Sequencing of the genes i n pECl and pEC2 demonstrated that pECl encoded the recombinant counterpart ( ngCex; p r e f i x ng stands f o r the non-glycosylated form of Cex ) of the native exoglucanase, gCex ( O'Neill et al., 1986a ), and that the gene encoding the recombinant analogue ( ngCenA ) of the native endoglucanase, gCenA, was contained p a r t i a l l y on pEC2 ( Gilkes et al., 1984a, Wong et al., 1986a ). 13 1.2.2.2. Subcloning and expression of cex The gene cex was l o c a l i z e d on a 2.58kb DNA fragment i n pECl w i t h a c o d i n g r e g i o n of 1452bp ( 484 codons ). The c o d i n g r e g i o n f o r the N - t e r m i n a l amino a c i d sequence of the mature Cex i s preceded by a sequence encoding a leader p e p t i d e of 41 amino acids ( O ' N e i l l et al., 1986a ). The amino a c i d composition p r e d i c t s a M r of 47'100 ( G i l k e s , et al., 1988 ) which agrees w e l l w i t h the e s t i m a t e d molecular mass of the p u r i f i e d exoglucanase on SDS-PAGE ( 47.3kDa ). Maximal e x p r e s s i o n of cex i n E.coli was achieved by r e p l a c i n g t h e n a t u r a l C.fimi t r a n s c r i p t i o n a l and t r a n s l a t i o n a l c o n t r o l s i g n a l s w i t h the l e f t w a r d promoter of phage lambda and a s y n t h e t i c r i b o s o m a l b i n d i n g s i t e ( PTIS ) . The r e s u l t i n g c o n s t r u c t , pCP3cex ( Table II ), l e d t o the o v e r p r o d u c t i o n of ngCex exceeding 20% of t o t a l c e l l u l a r p r o t e i n s ( O ' N e i l l et al., 1986b ), r e s u l t i n g i n the formation of i n s o l u b l e , c y t o s o l i c ngCex aggregates. Optimal e x p r e s s i o n of cex w i t h concomitant e x p o r t i n t o the p e r i p l a s m o f E.coli was a c h i e v e d w i t h t h e c o n s t r u c t pUC12-1.1(PTIS). The processed, recombinant exoglucanase was found i n the p e r i p l a s m i c f r a c t i o n of the host c e l l s , but was not e x c r e t e d i n t o the c u l t u r e medium. A f t e r random mutagenesis of E.coli C600 09098 wit h n i t r o s o g u a n i d i n e , " l e a k y " mutants were i s o l a t e d which prompted the r e l e a s e of up to 42% of t o t a l c e l l u l o l y t i c a c i t i v i t y i n t o the c u l t u r e supernatant a f t e r t r a n s f o r m a t i o n with e i t h e r pECl ( G i l k e s et a l . , 1984c ) or pEC2 ( see below ). The use of "leaky" mutants as h o s t s f o r the p r o d u c t i o n o f c e l l u l a s e s g r e a t l y f a c i l i t a t e s t h e i r i s o l a t i o n and p u r i f i c a t i o n . An e x p r e s s i o n v e c t o r was c o n s t r u c t e d f o r the s e c r e t i o n of exoglucanase by Saccharomyces cerevisiae ( Curry et a l . , 1988 ). The n u c l e o t i d e sequence c o d i n g f o r t h e s i g n a l p e p t i d e of a-14 missing the coding sequence for the Cex leader peptide, and i t s expression was placed under the con t r o l of the MEL1 promoter ( Table II ). Yeast transformed with t h i s plasmid ( pMV3.cex ) produced active extracellular, glycosylated exoglucanase. 1.2.2.3. Subcloning and expression of cenA The i n i t i a l clone, pEC2, coding for the endoglucanase CenA, did not contain the entir e cenA gene. It encoded a Tet-CenA fusion polypeptide i n which the N-terminal sequence of the t e t r a c y c l i n e resistance determinant was fused in-frame to the coding seuence of cenA ( Wong et al., 1986a ) . An a d d i t i o n a l C.fimi DNA cloning experiment r e s u l t e d i n a clone (pcEC2 ) which contained a contiguous stretch of DNA encoding the missing N-terminal sequence and the rest of the mature endoglucanase ( Table II ). The coding sequence of cenA was determined by nucleotide sequence analysis. As i n the case of cex, the G plus C content was r e l a t i v e l y high ( 72.5% ), manifesting i t s e l f i n the biased codon usage. Over 98% of the codons contained e i t h e r a G or C i n the t h i r d p o s i t i o n ( Wong, 1986 ) . The complete sequence of cenA was 1347bp long, encoding 449 amino acids. The sequence coding for the mature ngCenA was preceded by a sequence of 31 codons encoding a leader peptide. This leader sequence was shown to function i n E.coli since part of the endoglucanase a c t i v i t y was recovered from the periplasm ( approx. 50% of t o t a l CMCase a c t i v i t y ). The estimated molecular weight for the p u r i f i e d ngCenA of 48*700 was not i n agreement with the size given by the predicted amino acid sequence ( 43.8kDa; Gilkes et el., 1988 ). Subcloning of cenA into plasmid pUC18 to give pUC12-l.6cenA increased the length of the CenA leader peptide by 9 amino acids, inclu d i n g the f i r s t 6 amino acids of the E.coli P-galactosidase gene, and led to an 800-fold increase in the le v e l of expression 15 o f cenA i n E . c o l i ( Guo et al., 1988 ). O v e r e x p r e s s i o n of ngCenA by t h i s c o n s t r u c t a l s o r e s u l t e d i n a temperature dependent leakage of p e r i p l a s m i c p r o t e i n s , i n c l u d i n g CenA, i n t o the c u l t u r e medium. In a d d i t i o n , the endoglucanase gene was f u s e d t o the l e a d e r sequence of the yeast p r e p r o t o x i n KI gene ( p l a s m i d pK2.4 ) and i n t r o d u c e d i n t o Saccharomyces cerevisiae ( S k i p p e r et al., 1985 ) . The f u s i o n p r o t e i n was e x c r e t e d i n t o the c u l t u r e medium and was shown to be g l y c o s y l a t e d . In Rhodobacter capsulatus, cenA was e x p r e s s e d by the p l a s m i d pREC2.2 ( Table II ) as a f u s i o n p r o t e i n ( Johnson et a l . , 198 6 ). The 5'-terminal p o r t i o n of the B870b gene was l i n k e d to the coding sequence of cenA, and e x p r e s s i o n of the h y b r i d gene was c o n t r o l l e d by the R.capsulatus rxcA promoter. CMCase a c t i v i t y was found predominantly i n the c y t o s o l . 1.2.2.4. Comparative biochemical analyses of cex and cenA, and of t h e i r genes L i k e t h e i r n a t i v e , g l y c o s y l a t e d c o u n t e r p a r t s , both ngCenA and ngCex b i n d t o A v i c e l . Based on t h e i r p r e d i c t e d amino a c i d sequences, each enzyme f e a t u r e s t h r e e d i s t i n c t regions ( F i g . 1 ). A s h o r t sequence of approx. 20 amino a c i d s c o n t a i n i n g e x c l u s i v e l y p r o l i n e and threonine r e s i d u e s ( Pro-Thr box ) i s conserved almost p e r f e c t l y i n the two enzymes. T h i s sequence was p o s t u l a t e d to f u n c t i o n as a h i n g e r e g i o n , d i v i d i n g t h e enzymes i n t o two f u n c t i o n a l l y d i f f e r e n t domains: a) An i r r e g u l a r r e g i o n , r i c h i n hydroxyamino a c i d s , of low charge d e n s i t y , and which was p r e d i c t e d t o have l i t t l e secondary s t r u c t u r e , was 50% c o n s e r v e d i n both enzymes ( Warren et a l . , 1986 ); b i o c h e m i c a l a n a l y s i s confirmed t h i s r e g i o n to be the c e l l u l o s e b i n d i n g domain ( Langsford et al., 16 FIGURE 1. Proposed b i f u n c t i o n a l s t r u c t u r e of CenA and Cex. Numbers i n d i c a t e t h e l e n g t h s o f the c e l l u l a s e s i n amino a c i d s ; PT denotes Pro-Thr box and AS stands f o r p u t a t i v e a c t i v e s i t e s . Endoglucanase CenA H 2 N Binding Domain % • / / / / / / / / , AS COCH 41 8 Exoglucanase Cex H2N AS COCH 443 17 1987, Gilkes et a l . , 1988 ). and b) An ordered region of higher charge density which was predicted to have secondary structure but which d i d not appear to be conserved i n the c e l l u l a s e s . The p u t a t i v e a c t i v e s i t e sequences, Glu-Xaa7-Asn-Xaa6~Thr, were i d e n t i f i e d by comparison with lysozyme and l o c a l i z e d within t h i s p a r t i c u l a r region of CenA and Cex. The order of these two f u n c t i o n a l l y d i s t i n c t domains i s reversed i n the two enzymes ( Warren et al., 1986 ). The order and structure of these features i n the exo- and endoglucanase suggest that t h e i r genes have arisen by sequence shuffling and duplication. Since E . c o l i does not glycosylate proteins, the cloning of the genes cex and cenA i n E . c o l i allowed analysis of the function of the g l y c o s y l groups of C.fimi c e l l u l a s e s . It was shown that g l y c o s y l a t i o n d i d not a f f e c t the s t a b i l i t y of e i t h e r enzyme to extremes of pH and temperature. In addition, no differences were observed in the values for the k i n e t i c parameters of the two forms of Cex and CenA ( Table I ), ( Arfman et a l . , 1987, Langsford et a l . , 1987 ) . However, the glycosylated enzymes, when bound to i n s o l u b l e c e l l u l o s e , were protected from attack by the C.fimi serine protease, while the non-glycosylated, recombinant enzymes yielded active, truncated products with greatly reduced a f f i n i t y for A v i c e l ( Langsford et a l . , 1987 ) . As a r e s u l t , the binding domains of the recombinant cellulases remained bound to cellulose, whereas the c a t a l y t i c domains s t i l l expressing i n t a c t enzymatic a c t i v i t y were released into the medium ( Langsford et a l . 1987, ). Amino aci d sequence analysis of the truncated proteins indicated that the dominant protease cleavage s i t e s i n both c e l l u l a s e s were located at the C-terminal end of the hinge regions ( Pro-Thr box; see Figure 1 ), ( Gilkes et a l . , 1988 ). Presumably, glycosylation of threonine residues i n the Pro-Thr box prevents the c e l l u l o s e a s s o c i a t e d enzymes from being cleaved while they are s t i l l 18 a c t i v e l y involved i n hydrolysis of insoluble c e l l u l o s e . The effect of glycosylation on the s t a b i l i t y of the binding of the cellulases to microcrystalline cellulose i s currently being investigated. 1.2.2.5. Subcloning and expression of cenB Plasmid pEC3 contains a 5.6kb C.fimi DNA insert coding for the endoglucanase CenB. Not s u r p r i s i n g , the expression of CMCase a c t i v i t y was only moderate. Subcloning into pUC19 and replacement of the C.fimi t r a n s c r i p t i o n a l and t r a n s l a t i o n a l regulatory signals with those of the E.coli lac operon ( pJB301; see Table II ) led to a 20-fold increase i n s p e c i f i c a c t i v i t y ( Owolabi et al. , 1988a ). Deletion mutants missing up to 35% of the cenB DNA at i t s 3'-end s t i l l expressed f u l l CMCase a c t i v i t y , i n d i c a t i n g that the active s i t e resided i n the N-terminal portion of CenB. Like Cex and CenA, endoglucanase B exhibited high a f f i n i t y for c r y s t a l l i n e c e l l u l o s e and could be p u r i f i e d to homogeneity i n one step by a Avi c e l a f f i n i t y column ( HOkDa, based on SDS-PAGE ) . In addition, i t was shown that the C.fimi serine protease cleaved the enzyme into two polypeptides of 65kDa and 43kDa, one of which s t i l l retained the capacity to bind to c e l l u l o s e ( 65kDa ), ( Owolabi, 1988 ) . The sequence of cenB has not been determined yet, and biochemical data on the native C.fimi enzyme are s t i l l elusive. 1.2.2.6. Ident i f i c a t i o n of an E.coli clone expressing |3-glucosidase a c t i v i t y The E.coli clone harbouring pEC62 was one of a few clones which were i d e n t i f i e d on the basis of t h e i r r e a c t i v i t y with an immune serum s p e c i f i c for C.fimi culture supernatant antigens ( Gilkes et al., 1984b ) but which d i d not hydrolyze CMC. I n i t i a l c h a r a c t e r i z a t i o n of pEC62 showed that the a c t i v i t y was a J3-19 glucosidase, hydrolyzing a r y l - c e l l o b i o s i d e s , aryl-glucosides as well as cellobiose. A protein with the molecular weight of approx. 180'000, e x h i b i t i n g pNPGase a c t i v i t y ( p-nitrophenolglucoside ), was i s o l a t e d from the highest expressing clone, pUC13-62A31 ( see Table II; Paradis, personal communication ). Preliminary data on the k i n e t i c parameters of t h i s (i-glucosidase are l i s t e d i n Table I. It hydrolyzes not only c e l l o b i o s e but i s even more e f f e c t i v e on c e l l o t r i o s e , c e l l o t e t r o s e and cellopentose as substrates, indicating that t h i s (3-glucosidase i s not a true and exclusive cellobiase. Whether t h i s recombinant enzyme corresponds with one of the two (3-glucosidases i d e n t i f i e d i n C.fimi c e l l extracts has to be seen. 1.3. Objectives for the research of t h i s thesis The long-term goal of our group i s to understand the complex c e l l u l o l y t i c system secreted by C.fimi. The general approach to reach t h i s end i s to dissect the c e l l u l a s e system, biochemically characterize i t s components and define t h e i r enzymatic properties. Since information regarding the genetics of C.fimi i s rudimentary at best, we have chosen to apply molecular cloning techniques for the c h a r a c t e r i z a t i o n of the genes i n v o l v e d i n c e l l u l o s e h y d r o l y s i s . Expression of these genes i n E.coli or any other s u i t a b l e host i s p r o v i d i n g us with a source of recombinant cel l u l a s e s devoid of any contaminating c e l l u l o l y t i c a c t i v i t i e s . By applying genetic engineering methodology to these genes, we hope to be able to improve the e f f i c i e n c y of c e l l u l o s e degradation by the components ind i v i d u a l l y or in combination. To date, we have cloned three C.fimi genes coding for c e l l u l a s e s with high a f f i n i t i e s for c r y s t a l l i n e c e l l u l o s e . These 20 c e l l u l a s e s with high a f f i n i t i e s for c r y s t a l l i n e c e l l u l o s e . These ce l l u l a s e s produce soluble c e l l u l o s e intermediates which need to be further degraded by enzymes with high s p e c i f i c a c t i v i t i e s for the soluble substrates. In order to f i l l t h i s gap i n our understanding of the C.fimi c e l l u l a s e system, I concentrated on c e l l u l a s e s which accumulated i n the s u b s t r a t e - f r e e c u l t u r e supernatant of c e l l s grown on m i c r o c r y s t a l l i n e c e l l u l o s e , using the general approach outlined above. This t h e s i s d e s c r i b e s the p u r i f i c a t i o n of two C.fimi endoglucanases with low a f f i n i t y for insoluble c e l l u l o s e . A gene was i s o l a t e d from a lambda C.fimi DNA l i b r a r y and was shown to encode the recombinant counterparts of the two p u r i f i e d , native enzymes. By t r a n s c r i p t mapping experiments and DNA sequence analysis t h i s gene was further defined. F i n a l l y , the construction of a high expression vector system resulted i n the overproduction of the endoglucanases and a l l o w e d t h e i r p r e l i m i n a r y characterization. A summary flow-chart of the strategies for the cloning of the C.fimi endoglucanase gene, cenC, into E.coli and f o r the construction of the cenC high-expression vector, pTZP-cenC, i s appended ( see Appendix ). 21 I I . MATERIALS AND METHODS 11.1. Bacterials strains, plasmids and phage vectors Cellulomonas flmi ATCC 484 was used throughout the work described i n t h i s t h e s i s . The E.coli s t r a i n JM101 has been d e s c r i b e d p r e v i o u s l y ( Yanish-Perron et al., 1985 ). The properties of the plasmids pUC12 and pUC13, as well as M13mpl9 are described by Messing ( 1983 ). For the maintenance and properties of the plasmids pTZ18/19-R/U, the reader i s r e f e r e d to the Genescribe-Z™ laboratory manual ( UBS Genescribe-Z™ protocol ). Properties of and protocols for the maintenance of bacteriophage lambda L47.1 have been described by Brammar ( 1982 ). 11.2. Biochemicals The complementary strands of the portable translation i n i t i a t i o n s i t e ( P T I S ) were synthesized at the regional DNA synthesis laboratory at the University of Calgary. Nucleotides and primers f o r sequencing were obtained from Pharmacia and New England Biolabs, respectively. Radioactive nucleotides were from Amersham. Res t r i c t i o n endonucleases and DNA modifying enzymes were purchased from several sources ( Bethesda Research Lab., Pharmacia, New England Biolabs, and Boehringer Mannheim ). Lambda L47.1 DNA and the in v i t r o packaging k i t were purchased from Amersham. Chemicals for electrophoresis were supplied by Bio-Rad Labs. A l l HPLC grade s o l v e n t s f o r FPLC were obtained from F i s h e r S c i e n t i f i c . N i t r o c e l l u l o s e membranes BA85 were from Schleicher & Schuell Inc., Biodyne membranes P/N BNRG3050 were obtained from P a l l U l t r a f i n e F i l t r a t i o n Corp., and HATF c e l l u l o s e discs were purchased from M i l l i p o r e Corp. 22 11.3. P r e p a r a t i o n o f r a b b i t serum s p e c i f i c f o r C3.2 100|J.g o f p u r i f i e d C3.2 e n d o g l u c a n a s e were m i x e d w i t h i n c o m p l e t e a n d c o m p l e t e F r e u n d ' s a d j u v a n t a t a 1:1 r a t i o a n d i n j e c t e d s u b c u t a n e o u s l y i n t o a New Z e a l a n d w h i t e r a b b i t . A f t e r two a d i t i o n a l b o o s t s ( 50jlg o f C3.2 e a c h ) , t h e r a b b i t was b l e d f r o m an e a r , a n d t h e serum was t e s t e d a g a i n s t p u r i f i e d c e l l u l a s e s C3.1 an d C3.2, C.fimi c u l t u r e s u p e r n a t a n t p r o t e i n s , a n d E.coli c e l l e x t r a c t p r o t e i n s i n an e n z y m e l i n k e d i m m u n o a d s o r b e n t a s s a y ( E L I S A ; s e e F i g . 2 ) a s d e s c r i b e d e l s e w h e r e ( V o l l e r e t al. , 1976 ) . S u b s e q u e n t l y , l a r g e a m o u n t s o f b l o o d w e r e c o l l e c t e d b y c a r d i a c p u n c t u r e , a n d t h e i s o l a t e d immuneserum, s u p p l e m e n t e d w i t h 0.02% N a + - a z i d e , was s t o r e d a t -70°C. 11.4. P r o t e i n b i o c h e m i s t r y I I . 4 . 1 . P r e p a r a t i o n o f A f f i g e l - 1 0 - R a C 3 . 2 a f f i n i t y column The a f f i n i t y c o l u m n m a t e r i a l was p r e p a r e d a c c o r d i n g t o t h e p r o t o c o l o f t h e s u p p l i e r o f t h e g e l m a t r i x ( B i o - R a d L a b s . ) . A f t e r c o u p l i n g o f t o t a l r a b b i t s erum p r o t e i n s t o A f f i g e l - 1 0 , t h e column m a t e r i a l was washed w i t h s e v e r a l c h a n g e s o f 50mM T r i s - H C l . pH 7.2 p l u s 1M N a C l a n d 50mM g l y c i n e - H C l , pH 2.5, a n d f i n a l l y s t o r e d i n PBS ( 0.2g K H 2 P 0 4 , 2.17g N a 2 H P 0 4 ( 7 H 2 0 ) , 8g N a C l a n d 0.2g KC1 p e r l i t e r ) p l u s 0.02% N a + - a z i d e a t -70°C. I I . 4. 2. D e t e r m i n a t i o n o f p r o t e i n c o n c e n t r a t i o n s The p r o t o c o l f o r a s s a y i n g p r o t e i n s w i t h t h e B i o - R a d dye r e a g e n t i s b a s e d on t h e c o l o r i m e t r i c d e t e r m i n a t i o n o f s o l u b l e p r o t e i n s as d e s c r i b e d b y B r a d f o r d ( 1976 ) . B o v i n e s e r u m a l b u m i n was u s e d as s t a n d a r d . 23 FIGURE 2. ELISA of rabbit B3 anti C3.2 serum. Test antigens were coupled in t r i p l i c a t e to microtitre plates using the followina amounts of protein per well: 20ng of C3.1, 50ng of C3.2, 2 u.g of C.fimi culture supernatant proteins and 10 Jig of E.coli c e l l extract proteins. The op t i c a l absorbances at 405nm r e f l e c t the mean values of the a c t i v i t y of alkaline phosphatase conjugated to goat IgG antibodies against rabbit IgG bound to the test antigens. 24 I I . 4 . 3 . P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s ( SDS-PAGE ) E l e c t r o p h o r e t i c s e p a r a t i o n o f p r o t e i n s was a c c o m p l i s h e d b y a m o d i f i c a t i o n o f t h e m e t h o d o f L a e m m l i ( 1 9 7 0 ) . 7 . 5 % p o l y a c r y l a m i d e g e l s w i t h 0.1% SDS w e r e u s e d f o r t h e a n a l y s i s o f t h e C3.1/2 a n d C e n C l / 2 e n z y m e s . The h i g h m o l e c u l a r w e i g h t p r o t e i n s t a n d a r d s w e r e s u p p l i e d b y S i g m a . The g e l s w e r e s t a i n e d w i t h Coommassie b l u e a n d d r i e d on c e l l o p h a n e p a p e r . I I . 4. 4. W e s t e r n b l o t a n a l y s i s The p r o c e d u r e f o r t h e t r a n s f e r o f p r o t e i n s f r o m p o l y a c r y l a m i d e g e l s t o n i t r o c e l l u l o s e membranes was d e s c r i b e d p r e v i o u s l y ( Towbin e t al., 1979 ) . G l y c o p r o t e i n s w e r e v i s u a l i z e d b y i n c u b a t i n g t h e b l o c k e d ( 1% BSA i n TBS: 20mM T r i s - H C l , pH 7.5, 500mM N a C l ) a n d p r e w a s h e d ( TBS w i t h a n d w i t h o u t 0.2% Tween ) membranes w i t h C o n c a n a v a l i n A - h o r s e r a d i s h p e r o x i d a s e c o n j u g a t e ( 4[ig/ml i n TBS p l u s 0.2% BSA ) f o r 1 t o 3h a t room t e m p e r a t u r e . B e f o r e t h e a d d i t i o n o f t h e HRP c o l o r d e v e l o p m e n t r e a g e n t , t h e membranes were w a s h e d s e v e r a l t i m e s a s o u t l i n e d a b o v e . C o l o r d e v e l o p m e n t was i n i t i a t e d a n d s t o p p e d as d i r e c t e d b y t h e s u p p l i e r o f t h e HRP c o l o r d e v e l o p m e n t r e a g e n t ( B i o - R a d L a b s . ) . I I . 4 . 5 . Amino a c i d s e q u e n c e a n a l y s i s a n d amino a c i d c o m p o s i t i o n d e t e r m i n a t i o n P r o t e i n s a m p l e s f o r amino a c i d s e q u e n c e a n a l y s i s were d e s a l t e d b y B i o g e l P-6DG c h r o m a t o g r a p h y a n d l y o p h y l i z e d p r i o r t o t h e i r s h i p m e n t t o t h e s e q u e n c i n g l a b o r a t o r i e s . N - t e r m i n a l a m i n o a c i d s e q u e n c e s w ere d e t e r m i n e d e i t h e r b y Dr.D.McKay, P r o t e i n S e q u e n c e F a c i l i t y , U n i v e r s i t y o f C a l g a r y , o r b y S . L . K i e l l a n d , 25 M i c r o - s e q u e n c i n g F a c i l i t y , U n i v e r s i t y o f V i c t o r i a , on an A p p l i e d B i o s y s t e m s 470A g a s - p h a s e s e q u e n a t o r . The a m i n o a c i d c o m p o s i t i o n o f C3.2 was d e t e r m i n e d b y Dr.D.McKay w i t h a Beckman 6300 amino a c i d a n a l y z e r . I I . 4 . 6 . F r a c t i o n a t i o n o f b a c t e r i a l c e l l s The c e l l u l a r l o c a t i o n s o f f 3 - l a c t a m a s e , g l u c o s e - 6 - P - D H a s e a n d e n d o g l u c a n a s e w ere d e t e r m i n e d a s f o l l o w s . C e l l s h a r b o r i n g t h e p l a s m i d p TZP-cenC were grown a t 30°C i n L u r i a b r o t h ( LB; M i l l e r , 1972 ) s u p p l e m e n t e d w i t h 100|Ig o f a m p i c i l l i n / m l t o an OD ( 600nm ) o f 1.0. I n d u c t i o n o f e x p r e s s i o n was i n i t i a t e d b y a d d i t i o n o f i s o p r o p y l - f i - D - t h i o g a l a c t o s i d e ( IPTG ) t o lmM, a n d i n c u b a t i o n o f t h e c u l t u r e a t 30°C was c o n t i n u e d f o r a n o t h e r l ^ - ^ h . The c u l t u r e was d i v i d e d i n t o t w o p a r t s , a n d t h e c e l l s w e r e h a r v e s t e d by c e n t r i f u g a t i o n . The c e l l s o f one p a r t w e r e s u b s e q u e n t l y p a s s e d s e v e r a l t i m e s t h r o u g h a F r e n c h P r e s s u r e c e l l , a n d t h e c e l l d e b r i s w ere s e p a r a t e d f r o m t h e s o l u b l e l y s a t e ( t o t a l c e l l e x t r a c t ) by c e n t r i f u g a t i o n . The s e c o n d c e l l a l i q u o t was s u b j e c t e d t o o s m o t i c s h o c k t r e a t m e n t as d e s c r i b e d e l s e w h e r e ( N o s s a l a n d H e p p e l , 1 9 6 6 ) . The p e r i p l a s m i c f r a c t i o n was s e p a r a t e d f r o m t h e s p h e r o p l a s t s b y c e n t r i f u g a t i o n . F i n a l l y , t h e c y t o p l a s m i c f r a c t i o n was p r e p a r e d b y p a s s i n g t h e s p h e r o p l a s t s t h r o u g h t h e F r e n c h P r e s s and r e c o v e r i n g t h e s o l u b l e components by c e n t r i f u g a t i o n . I I . 5 . Enzyme a s s a y s I I . 5 . 1 . DNS-CMCase a s s a y T o t a l c e l l e x t r a c t , c y t o s o l i c a n d p e r i p l a s m i c f r a c t i o n s as w e l l a s c u l t u r e s u p e r n a t a n t s a m p l e s were e x a m i n e d f o r c e l l u l o l y t i c 26 a c t i v i t y b y a s s a y i n g CMC h y d r o l y s i s u s i n g d i n i t r o s a l i c y l i c a c i d ( DNS; M i l l e r e t al., 1960 ) . The a s s a y c o n d i t i o n s w e r e a s f o l l o w s : 5 0 0 | l l o f C M C - s o l u t i o n ( 4% l o w v i s c o s i t y CMC i n p h o s p h a t e b u f f e r : 50mM p o t a s s i u m p h o s p h a t e , pH 7.0, 0.02% N a + - a z i d e ) were i n c u b a t e d a t 37°C w i t h s a m p l e s o f enzyme p r e p a r a t i o n s i n a t o t a l r e a c t i o n v o l u m e o f 800(11. A t i n t e r v a l s , 100(11 a l i q u o t s w e r e r e m o v e d a n d t h e r e a c t i o n s s t o p p e d b y a d d i t i o n o f 800(11 o f DNS-s o l u t i o n ( 500(11 DNS r e a g e n t , 275(11 o f p h o s p h a t e b u f f e r , p l u s 25 (11 o f g l u c o s e a t lmg/ml ) . A f t e r t h e f i n a l a l i q u o t was t a k e n , t h e s a m p l e s were s t e a m e d f o r 15 m i n , a n d t h e o p t i c a l a b s o r b a n c e a t 550nm was m e a s u r e d . F o r t h e q u a n t i t a t i v e d e t e r m i n a t i o n o f CMCase a c t i v i t y ( |lmoles r e d u c i n g s u g a r s p r o d u c e d p e r m i n ) a g l u c o s e s t a n d a r d a s s a y ( w i t h g l u c o s e b e i n g t i t r a t e d f r o m 0 t o 100(lg ) was r u n p a r a l l e l t o t h e e x p e r i m e n t . I I . 5. 2. pNPCase a s s a y H y d r o l y s i s o f p - n i t r o p h e n o l c e l l o b i o s i d e ( pNPC ) was f o l l o w e d s p e c t r o p h o t o m e t r i c a l l y b y m e a s u r i n g t h e r e l e a s e o f p - n i t r o p h e n o l . 500(11 o f an enzyme p r e p a r a t i o n was i n c u b a t e d a t 37°C w i t h 500(11 o f p N P C - s o l u t i o n ( 5mM pNPC i n lOOmM p o t a s s i u m p h o s p h a t e , pH 7.0, 0.02% N a + - a z i d e ) . A l i q u o t s were removed a nd a d d e d t o 500U.1 o f 1M N a 2 C 0 3 ^ a n d t h e o p t i c a l a b s o r b a n c e was m e a s u r e d a t 410nm. The m i c r o m o l a r e x t i n c t i o n c o e f f i c e n t f o r pNP a t 410nm i n Na2C03 a t 25°C i s 18.8 p e r cm ( S t o p p o c k e t al., 1982 ) . I I . 5. 3. |3-lactamase a s s a y The ( 3 - l a c t a m a s e a c t i v i t y i n c e l l u l a r f r a c t i o n s was a s s a y e d by m o n i t o r i n g t h e i n c r e a s e i n a b s o r b a n c e a t 486nm as a r e s u l t o f h y d r o l y s i s o f n i t r o c e f i n ( O ' C a l l a g h a n e t al., 1972 ) . B r i e f l y , 50(11 o f n i t r o c e f i n s o l u t i o n ( 5. 2mg n i t r o c e f i n i n 500(11 DMSO and 27 9.5ml o f 50mM p o t a s s i u m p h o s p h a t e , pH 7.0 ) was i n c u b a t e d w i t h 5 0 [ i l o f enzyme s a m p l e a n d 9 0 0 | l l o f 50mM p o t a s s i u m p h o s p h a t e b u f f e r . I m m e d i a t e l y a f t e r m i x i n g t h e s a m p l e s , t h e i n c r e a s e i n o p t i c a l a b s o r b a n c e was f o l l o w e d i n t h e s p e c t r o p h o t o m e t e r . A lOmM s o l u t i o n o f n i t r o c e f o i c a c i d h a s an OD ( 486nm ) o f 1.55 i n a 1cm c u v e t t e . 11.5.4. G l u c o s e - 6 - P - D H a s e a s s a y G l u c o s e - 6 - P - D H a s e a c t i v i t y was a s s a y e d b y m e a s u r i n g t h e i n c r e a s e i n o p t i c a l a b s o r b a n c e a t 340nm r e s u l t i n g f r o m t h e r e d u c t i o n o f NADP. The f o l l o w i n g s o l u t i o n s were m i x e d a n d e q u i l i b r a t e d a t 30°C p r i o r t o t h e a d d i t i o n o f enzyme: 900U.1 o f 55mM T r i s - H C l , pH 7.8, 3.3mM MgCl2 p l u s 33U.1 o f 6mM NADP a n d 33U.1 o f 0. 1M g l u c o s e - P . The r e a c t i o n was s t a r t e d by t h e a d d i t i o n o f 33U.1 o f enzyme s a m p l e , and t h e o p t i c a l a b s o r b a n c e was r e c o r d e d a f t e r 3 0 s e c i n t e r v a l s . G l u c o s e - 6 - P - D H a s e a c t i v i t y was e x p r e s s e d i n r e l a t i v e u n i t s : change i n a b s o r b a n c e ( 340nm ) p e r m i n . 11.5.5. Congo r e d p l a t e a s s a y B a c t e r i a l c o l o n i e s o r r e c o m b i n a n t l a m b d a p h a g e p a r t i c l e s were grown a t 37°C on a g a r p l a t e s c o n t a i n i n g t h e a p p r o p r i a t e g r o w t h medium a nd a n t i b i o t i c s , a n d 15g o f l o w v i s c o s i t y CMC p e r l i t e r o f a g a r medium. A f t e r r e m o v i n g t h e c o l o n i e s a n d t h e t o p a g a r c o n t a i n i n g t h e l a m b d a p l a q u e s , t h e p l a t e s w e r e i n c u b a t e d w i t h C ongo r e d s o l u t i o n ( 2mg/ml ) , ( T e a t h e r a n d Wood, 1982 ) . F i n a l l y , t h e p l a t e s w e r e d e s t a i n e d w i t h 1M N a C l t i l l z o n e s o f c l e a r i n g were v i s i b l e . 28 11.6. E l e c t r o n m i c r o s c o p y A c u l t u r e o f JM101 c e l l s h a r b o r i n g t h e p l a s m i d p T Z P - c e n C was grown a t 3 0 ° C i n LB p l u s 100(ig o f a m p i c i l l i n / m l t o an o p t i c a l a b s o r b a n c e a t 600nm o f 1.0. IPTG ( ImM f i n a l c o n c e n t r a t i o n ) was added t o one h a l f o f t h e c u l t u r e and i n c u b a t i o n c o n t i n u e d f o r 90 m i n . T h e n , t h e c e l l s were h a r v e s t e d f r o m b o t h h a l v e s by c e n t r i f u g a t i o n and washed t w i c e w i t h 0.2M p o t a s s i u m p h o s p h a t e , pH 7.2. The c e l l s were f i x e d a t room t e m p e r a t u r e f o r 60 min i n p h o s p h a t e b u f f e r c o n t a i n i n g 2% g l u t a r a l d e h y d e . F i n a l l y , t h e c e l l s were washed t h r e e t i m e s w i t h 6.84% s u c r o s e i n p h o s p h a t e b u f f e r . E m b e d d i n g o f t h e c e l l s , p r e p a r a t i o n o f t h e c r o s s - s e c t i o n s and m i c r o s c o p i c a n a l y s i s was p e r f o r m e d by D r . D . G . S c r a b a a t t h e U n i v e r s i t y o f A l b e r t a , Edmonton. 11.7. DNA and RNA M e t h o d o l o g y I I . 7 . 1 . I s o l a t i o n o f C.fimi DNA Genomic DNA f r o m C.fimi was i s o l a t e d e s s e n t i a l l y as d e s c r i b e d by M a n i a t i s et al. ( 1982 ) . A c u l t u r e was grown a t 30°C i n LB low s a l t c u l t u r e medium t o a d e n s i t y o f 0.5 t o 1.0x10^ c e l l s / m l . The chromosomal DNA was r e c o v e r e d a f t e r l y s i n g t h e l y s o z y m e p r e t r e a t e d c e l l s w i t h 0.5% SDS ( 65 ° C , 30 m i n ) . RNA was s u b s e q u e n t l y d i g e s t e d w i t h RNase T I ( 400 u n i t s / m l ) . A f t e r t h e p r o n a s e i n c u b a t i o n s t e p , p r o t e i n s w e r e r e m o v e d b y s e v e r a l p h e n o l e x t r a c t i o n s ( t i l l i n t e r f a c e was c l e a r ) , f o l l o w e d b y e t h e r e x t a c t i o n s t i l l t h e l y s a t e became c l e a r . R e s i d u a l e t h e r i n t h e DNA p r e p a r a t i o n was e v a p o r a t e d by b l o w i n g N 2 gas o v e r t h e DNA sample w h i l e g e n t l y s h a k i n g on a V i b r a x s h a k i n g p l a t f o r m . D u r i n g t h e w h o l e p r o c e d u r e s p e c i a l c a r e was t a k e n t o a v o i d u n n e c e s s a r y s h e r i n g o f t h e c h r o m o s o m a l DNA. P u r i t y o f t h e p r e p a r a t i o n was e s t i m a t e d by measuring t h e o p t i c a l a b s o r b a n c e a t 260nm and 280nm. 29 The DNA was stored at -20°C t i l l further use. 11.7.2. Isolation of plasmid and bacteriophage DNA Small samples of plasmid DNA were i s o l a t e d by a modification of the a l k a l i n e l y s i s procedure ( Birnboim and Doly, 1979 ) . For further p u r i f i c a t i o n of small scale plasmid DNA preparations, a NACS Prepac™ ( BRL ) chromatography step was included i n the procedure. Plasmid DNA on a large scale was i s o l a t e d according to the method described by Maniatis et al. ( 1982 ). Routinely, the f i n a l p u r i f i c a t i o n step involved the concentration and p u r i f i c a t i o n of the DNA by CsCl density gradient centrifugation i n the presence of ethidium bromide ( EtBr ). The i s o l a t i o n of si n g l e stranded M13 and pTZ DNA has been d e s c r i b e d elsewhere ( Messing, 1983; UBS Genescribe-Z™ protocol ). Recombinant lambda L47.1 DNA was i s o l a t e d as follows. Top agar containing phage p a r t i c l e s from s i n g l e plaques together with E.coli NM538 indicator c e l l s was spread on LB agar plates to give confluent l y s i s . Top agar containing phage p a r t i c l e s was harvested and processed e s s e n t i a l l y as described by Maniatis et al. ( 1982 ). The phage p a r t i c l e s were p u r i f i e d on a saturated CsCl density gradient and then dialyzed against 50mM Tris-HCl, pH 8.0, 20mM NaCl, lOmM MgCl2- The DNA was f i n a l l y recovered by the SDS-b o i l i n g method ( Maniatis et a l . , 1982 ) and p u r i f i e d by organic extractions. 11.7.3. Preparation of template DNA for sequencing The procedure described i n the UBS Genescribe-Z™ manual was 30 / f o l l o w e d f o r the i s o l a t i o n of s i n g l e stranded pTZ DNA. S u p e r i n f e c t i o n of E.coli JM101 c e l l s harboring recombinant plasmids with helper phage M13K07 led to the accumulation i n the culture medium of single stranded pTZ DNA enveloped i n M13 v i r i o n p r o t e i n s . To obtain template DNA of high p u r i t y , an a l k a l i n e sucrose gradient centrifugation step was added as the f i n a l step i n the DNA p u r i f i c a t i o n procedure. After PEG p r e c i p i t a t i o n of the phage-like ( but not i n f e c t i o u s ) p a r t i c l e s and resuspension in 0.5ml of lOmM T r i s - H C l , pH 7.2, ImM EDTA, the samples were ove r l a i d onto a sucrose step gradient ( four steps ranging from 5 to 20% sucrose ) containing lOmM Tris-HCl, pH 7.2, 0. 8M NaCl and 0. 2M NaOH. The polyallomer tubes containing the gradients were ce n t r i f u g e d f o r 15h at 25K rpm i n a Beckman SW 50.1 ro t o r . Fractions of ~0.5ml were c o l l e c t e d from the bottoms of the tubes, and the o p t i c a l absorbance at 280nm and 260nm was determined ( Fig.3 ). The DNA was reproducibly recovered i n the lower t h i r d of the gradients. Samples p u r i f i e d as described above and stored f o r s e v e r a l months as dry p e l l e t s at -20°C were just as s a t i s f a c t o r y for sequencing as fresh preparations. The a l k a l i n e sucrose gradient c e n t r i f u g a t i o n step eliminated the problem of high background in sequencing C.fimi DNA. II.7.4. Construction of plasmid deletions for sequencing A series of deletions i n plasmid pTZ18R-8/5-5 was generated by following the Dale protocol ( Dale et al., 1985 ). The procedure i s outlined i n Fig.4. A second set of deletions was created using Bal31 exonuclease ( New England Biolabs ) a f t e r l i n e r i z i n g the plasmid DNA with BamHI. The optimal amount of exonuclease and the digestion times required for the generation of the desired deletion fragments were determined empirically by analyzing the extent of the deletions on 31 FIGURE 3. P u r i f i c a t i o n o f t e m p l a t e DNA b y a l k a l i n e s u c r o s e g r a d i e n t c e n t r i f u g a t i o n . A p p r o x . 0.5ml f r a c t i o n s o f a n a l k a l i n e s u c r o s e g r a d i e n t were c o l l e c t e d d r o p w i s e a f t e r p u n c t u r i n g a h o l e i n t h e b o t t o m o f t h e t u b e . A.) O p t i c a l a b s o r b a n c e a t 260nm and 280nm o f i n d i v i d u a l f r a c t i o n s were m e a s u r e d , a n d t h e r e s u l t i n g R-v a l u e s ( OD [ 260nm ] o v e r OD [ 280nm ]) were p l o t t e d ( o-o ) a g a i n s t t h e l o c a t i o n o f t h e f r a c t i o n s i n t h e g r a d i e n t ( i n m i s ) . The c o n c e n t r a t i o n s o f DNA ( fig DNA/ml ) i n t h e f r a c t i o n s b a s e d on o p t i c a l a b s o r b a n c e a t 2 60nm a r e g r a p h i c a l l y i l l u s t r a t e d as d o t t e d b a r s . B.) A l i q u o t s o f e a c h s a m p l e e q u i v a l e n t t o 0.2|lg o f s i n g l e s t r a n d e d DNA were e l e c t r o p h o r e s e d on an a g a r o s e g e l a n d s t a i n e d w i t h E t B r ; m, l a m b d a - H i n d i I I DNA s i z e s t a n d a r d s . 32 33 FIGURE 4. Generation of deletions following a modification of the Dale procedure. Single stranded pTZ18R-8/5-5 DNA was hybridized with a 2-fold molar excess of primer R23 at 50°C for up to 3h. The primer R23 ( 5'-CGACTCACTATAGGGAATTCCCC-3' ) was e s p e c i a l l y designed to reconstitute the EcoRI s i t e ( ER1 ) of the multiple cloning s i t e i n pTZ18R and to hybridize to 14 nucleotides of the la c z gene proximal to the EcoRI s i t e . Then, the DNA was completely digested with EcoRI. The extent of plasmid l i n e r i z a t i o n was checked on an agarose gel, and the DNA was redigested with EcoRI i f necessary. This step proved to be c r i t i c a l in avoiding the generation of large numbers of transformants harboring undeleted plasmids. DTT and BSA were added to the reaction mixtures to the f i n a l concentrations of lOmM and 200llg/ml, respectively. Exonuclease digestion was i n i t i a t e d by addition of T4 DNA polymerase ( 1 to 5 units per fig DNA; New England Biolabs ). I found that C.fimi DNA was digested more e f f i c i e n t l y when the reaction mixture was incubated at higher temperature ( 45°C ) . A l i q u o t s containing appropriately deleted fragments were pooled. Terminal deoxynucleotidyl transferase ( TdT ) and dGTP were used to synthesize guanosine homopolymer t a i l s at the 3'-termini of the DNA fragments ( 8 units TdT per ml reaction mixture, 5U.M dGTP f i n a l concentration, for 20 min at 45°C, followed by heat inactivation ). Fresh primer R23 was subsequently added i n a 2 to 4-fold molar excess and annealed at 45°C for 2 to 4h. The r e c i r c u l a r i z e d deletion fragments were f i n a l l y ligated for 12 to 15h at 14°C with 5 to 10 units of T4 DNA ligase and ATP ( 8mM f i n a l concentration ), and E.coli JM101 transformants were screened for appropriate deletion mutants by analysis of plasmid DNA on agarose gels. Considerable improvement i n the number of transformants was achieved by r e p e t i t i v e cycles of heating the l i g a t i o n mixtures followed by l i g a t i o n at 14°C p r i o r to transformation. 34 ER1 C C C 3' pr imer anneal ing 3'-exonuc lease delet ions EcoR1 T4 DNA Pol, At ER1 i-5' tai l ing reaction 3'-GQGGGG i TdT, dGTP ligation. t ransformat ion ER1 -5' primer band-aid anneal ing 35 agarose gels. Deletion fragments of the appropriate s i z e were i s o l a t e d from agarose gels and subcloned into pTZ18R. Subclones c o n t a i n i n g d e l e t i o n mutants were screened by analyzing the isolat e d plasmid DNA on agarose gels. 11.7.5. DNA sequencing The nucleotide sequences of DNA cloned into pTZ and M13 vectors were determined by the dideoxy chain termination method ( Sanger et al., 1977 ). The following modifications helped to diminish "compressions" inherent to DNA with high G plus C content. The molar r a t i o s of dideoxy- to deoxynucleotides i n the nucleotide mixes were adjusted for sequencing G plus C r i c h DNA ( Mizusawa et al., 1986 ); dGTP was replaced with 7-deaza-dGTP; f i n a l l y , the sequencing reactions were incubated at elevated temperatures ( 37 - 45°C ) to d e s t a b i l i z e secondary structures i n the template DNA. The protocol for the electrophoretic analysis of the sequencing reaction products i s described by Maniatis et al. ( 1982 ). 11.7.6. Construction of the C.fimi DNA-lambda l i b r a r y C.fimi DNA was p a r t i a l l y digested with Sau3A. Fragments ranging i n size from 8 to 20kb were i s o l a t e d from an agarose gel, and the ends of the fragments were dephosphorylated using c a l f i n t e s t i n a l a l k a l i n e phosphatase. The arms of the lambda vector L47.1 were prepared by l i g a t i n g the cohesive ends followed by t o t a l digestion with BamHI and i s o l a t i o n of the arms ( free of the s t u f f e r fragment ) from an agarose g e l . L i g a t i o n of the C.fimi DNA fragments with the lambda DNA arms resulted i n the formation of recombinant DNA concatamers which were subsequently packaged in vitro as described elsewhere ( Hohn, 1979 ). The phage p a r t i c l e s were plated on the non-permissive host E.coli NM359 (P2) to select 36 f o r r e c o m b i n a n t phage v e c t o r s ( f i r s t r o u n d o f a m p l i f i c a t i o n ) . The t o t a l y i e l d o f v i a b l e p h a ge p a r t i c l e s a m o u n t e d t o a p p r o x . 2 x l 0 5 p f u ( 7 x l 0 4 p f u / [ l g o f l i g a t e d and p a c k a g e d DNA ) . The number o f p l a q u e s on E.coli NM538 ( p e r m i s s i v e h o s t ) c o m p a r e d t o t h e y i e l d on t h e P 2 - l y s o g e n ( E.coli NM359 ) i n d i c a t e d t h a t more t h a n 95% o f t h e phage p a r t i c l e s h a d an i n s e r t . The r e c o m b i n a n t L47.1 phage p a r t i c l e s f r o m t h e f i r s t a nd s u b s e q u e n t a m p l i f i c a t i o n s were s t o r e d a t 4°C. 11.1.1. S y n t h e s i s and p u r i f i c a t i o n o f o l i g o n u c l e o t i d e s O l i g o n u c l e o t i d e s were s y n t h e s i z e d b y D r . T . A t k i n s o n o f t h e D e p a r t m e n t o f B i o c h e m i s t r y , U n i v e r s i t y o f B r i t i s h C o l u m b i a , u s i n g an A p p l i e d B i o s y s t e m s a u t o m a t e d DNA s y n t h e s i z e r , model 380A. They were p u r i f i e d by p r e p a r a t i v e p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s a n d C i s c a r t r i d g e ( S e p - P a c k ; M i l l i p o r e C o r p . ) c h r o m a t o g r a p h y ( A t k i n s o n and Smith, 1984 ) . I I . 7 . 8 . L a b e l i n g o f DNA w i t h 3 2 P P h o s p h o r y l a t i o n o f s y n t h e t i c o l i g o n u c l e o t i d e s w i t h y - 3 2 P - A T P and T4 p o l y n u c l e o t i d e k i n a s e ( PNK ) a r e d e s c r i b e d by Z o l l e r and Smit h ( 1983 ) . F o r t h e l a b e l i n g o f 5'-ends, d o u b l e s t r a n d e d DNA f r a g m e n t s were t r e a t e d w i t h c a l f i n t e s t i n a l a l k a l i n e p h o s p h a t a s e p r i o r t o p h o s p h o r y l a t i o n w i t h y - 3 2 P - A T P and PNK. To l a b e l 3'-ends o f DNA f r a g m e n t s , t h e Klenow f r a g m e n t o f E.coli DNA p o l y m e r a s e I was u s e d i n a f i l l - i n r e a c t i o n w i t h a - 3 2 P - d N T P s . When r e q u i r e d , t h e l a b e l e d f r a g m e n t s were f u r t h e r p u r i f i e d b y n o n - d e n a t u r i n g PAGE and subsequent e l c t r o e l u t i o n ( M a n i a t i s e t al., 1982 ) . 37 II.7.9. Screening methods f o r recombinant bacteriophage and plasmid v e c t o r s The s c r e e n i n g f o r CMCase a c t i v i t y t o i d e n t i f y p o s i t i v e lambda p a r t i c l e s by t h e Congo r e d p l a t e a s s a y was a c c o m p l i s h e d by f o l l o w i n g the method o u t l i n e d above and as d e s c r i b e d elsewhere ( K o t o u j a n s k y et al., 1985 ) e x c e p t f o r t h e f o l l o w i n g m o d i f i c a t i o n . P l a t e s c o n t a i n i n g the phage plaques were r e p l i c a t e d t o M i l l i p o r e c e l l u l o s e d i s c s ( 0.45|lm ). The d i s c s c o n t a i n i n g phage p a r t i c l e s and E.coli NM538 c e l l s were p l a c e d on f r e s h LB p l a t e s t i l l plaques became v i s i b l e ( master p l a t e s ). The o r i g i n a l p l a t e s were then used i n the Congo red p l a t e assay a f t e r s c r a p i n g o f f t h e t o p agar. F i n a l l y , p o s i t i v e c l o n e s were i d e n t i f i e d by matching the haloes with the plaques on the master p l a t e s . The method f o r the s c r e e n i n g of the C.fimi DNA-lambda l i b r a r y and r e c o m b i n a n t M13 phage p a r t i c l e s w i t h 3 2 P - l a b e l e d o l i g o n u c l e o t i d e probes i s o u t l i n e d by Woods ( 1984 ) and M a n i a t i s et al. ( 1982 ). B r i e f l y , the phage plaques were grown t o approx. 0.5 t o 1.0mm i n diameter. The phage p a r t i c l e s were l i f t e d from the p l a t e s w i t h Biodyne membrane c i r c l e s ( p l a q u e - f i l t e r l i f t ) and l y s e d w i t h an a l k a l i n e b u f f e r ( Woods, 1984 ). Subsequently, the DNA was bound t o the membranes by b a k i n g . A f t e r washing the membrane c i r c l e s w i t h a S D S - s o l u t i o n at 68°C f o r up t o 15h ( Woods, 1984 ) and p r e h y b r i d i z a t i o n at 37°C f o r 2h, the membranes were i n c u b a t e d w i t h 3 2 p _ i a ] - ) e ] _ e c j o l i g o n u c l e o t i d e p r o b e s i n h y b r i d i z a t i o n b u f f e r ( Woods, 1984 ) at 42°C f o r 12 t o 15h. Subsequently, the membranes were washed i n 6xSSC, 0.05% N a + -pyrophosphate f o r 5 min i n t e r v a l s at i n c r e a s i n g temperatures u n t i l l p o s i t i v e s i g n a l s on autoradiograms c l e a r l y s t o o d out over background. Normally, washing the membranes at the temperature of Tm - 5°C l e d t o the d i s s o c i a t i o n o f n o n - s p e c i f i c a l l y h y b r i d i z e d o l i g o n u c l e o t i d e p r o b e s . The Tm was e s t i m a t e d a c o r d i n g t o the equation: 38 Tm = 16.61og[ Na+ ] + 0.41( G + C i n % ) + 81.5 - 500/n where n i s the number of nucleotides i n the h y b r i d i z a t i o n probe ( Wahl et al., 1987 ). Hybridization positive plaques were f i n a l l y picked, p u r i f i e d and rescreened. The c l o n a l recombinant lambda p a r t i c l e s were stored in suspension at 4°C. E.coli clones harboring recombinant plasmids were screened by the c o l o n y - f i l t e r l i f t h y b r i d i z a t i o n technique, e s s e n t i a l l y as described above. Generally, p r i o r to the c o l o n y - f i l t e r l i f t , single colonies of transformed E.coli JM101 c e l l s were transferred in a g r i d pattern to fresh plates to simplify the i d e n t i f i c a t i o n of p o s i t i v e s . P o s i t i v e clones were stored e i t h e r as s i n g l e colonies on agar plates or as 20% glycerol stocks at -20°C. 11.7.10. DNA and RNA dot-blot analysis 0.5 to 2pmoles of plasmid DNA were denatured according to Maniatis et al. ( 1982 ), spotted onto Biodyne membranes and fixed to membranes by baking ( 80°C, 2h ) . Between 5 and 10|lg of t o t a l C.fimi RNA per dot i n lOmM Tris-HCl, pH 7.6, ImM EDTA were applied to Biodyne membranes. After baking, the DNA and RNA b l o t s were further processed as described in section II.7.9. II. 7.11. Southern transfer analysis The protocol for Southern t r a n s f e r analysis was described i n d e t a i l by Maniatis et al. ( 1982 ). Hybridization of the DNA on the membranes with 3 2 p _ i a ] 3 e i e c i Q N A probes and the subsequent washing steps were performed as outlined in section II.7.9. 39 11.7.12. cDNA s y n t h e s i s b y p r i m e r e x t e n s i o n 2 0 p m o l e s a m p l e s o f s i n g l e s t r a n d e d p T Z 1 8 R - S / B DNA w e r e r e s u s p e n d e d i n 200u,l o f H i n d i b u f f e r ( BRL ) . An e q u i m o l a r amount o f p r i m e r - 8 / 5 ( 5 1-GTTTCTCGCAGGTCATCA-3' ) was a d d e d , t h e n t h e s a m p l e s were h e a t e d t o 90°C f o r 5min a nd i n c u b a t e d a t 50°C f o r 2 t o 4h. P r i m e r e x t e n s i o n was i n i t i a t e d b y a d d i t i o n o f 15 u n i t s o f t h e K l e n o w f r a g m e n t o f E.coli DNA p o l y m e r a s e I p l u s dNTPs ( 0.25mM f i n a l c o n c e n t r a t i o n ) a n d DTT ( 5mM f i n a l c o n c e n t r a t i o n ) . A f t e r 2 0 m i n i n c u b a t i o n a t 50°C, a f u r t h e r 15 u n i t s o f K l e n o w enzyme w e r e a d d e d a n d t h e i n c u b a t i o n c o n t i n u e d f o r a n o t h e r 2 0 m i n . The r e a c t i o n m i x t u r e s w e r e d e - p r o t e i n i z e d b y e x t r a c t i o n w i t h p h e n o l / c h l o r o f o r m a n d c h l o r o f o r m . The DNA was r e c o v e r e d by e t h a n o l p r e c i p i t a i o n a n d r e s u s p e n d e d i n 200U.1 o f mung b e a n n u c l e a s e b u f f e r ( New E n g l a n d B i o l a b s ) . To g e n e r a t e f l u s h - e n d , d o u b l e s t r a n d e d DNA f r a g m e n t s , 50 u n i t s o f mung b e a n n u c l e a s e ( New E n g l a n d B i o l a b s ) were a d d e d , a n d t h e r e a c t i o n m i x t u r e was i n c u b a t e d a t 37°C f o r 20 m i n . The r e a c t i o n was s t o p p e d by a d d i t i o n o f 8|Xl o f 10% SDS. S u b s e q u e n t l y , t h e DNA was p u r i f i e d b y o r g a n i c e x t r a c t i o n s , p r e c i p i t a t e d a n d d i g e s t e d t o c o m p l e t i o n w i t h H i n d l l l a s v e r i f i e d b y a g a r o s e g e l e l e c t r o p h o r e s i s . F i n a l l y , t h e 2 2 0 b p b l u n t -e n d / H i n d l l l f r a g m e n t c o d i n g f o r t h e N - t e r m i n u s o f C e n C l / 2 was i s o l a t e d f r o m a g a r o s e g e l s a n d p u r i f i e d b y o r g a n i c e x t r a c t i o n s p r i o r t o l i g a t i o n i n t o pTZ18R-PTIS. 11.7.13. I s o l a t i o n o f C.fimi RNA T o t a l RNA was e x t r a c t e d f r o m C.fimi e x a c t l y a s d e s c r i b e d b y G r e e n b e r g et al. ( 1987a ) . C e l l s o f C.fimi c u l t u r e s ( up t o 100ml ) g r o w n i n b a s a l medium ( S t e w a r t a n d L e a t h e r w o o d , 1976 ) w e r e h a r v e s t e d i n t h e l a t e l o g p h a s e . S p e c i a l c a r e was t a k e n t o p e r f o r m t h e l y s i s o f t h e c e l l s a n d t h e e x t r a c t i o n o f RNA a s 40 q u i c k l y a s p o s s i b l e t o a v o i d e x c e s s i v e d e g r a d a t i o n o f RNA by C.fimi n u c l e a s e s . A l l g l a s s w a r e u s e d f o r RNA work was e i t h e r b a k e d a t 300°C f o r 3h o r was b o u g h t a s d i s p o s a b l e l a b w a r e . D i s t i l l e d w a t e r u s e d f o r t h e p r e p a r a t i o n o f b u f f e r s was t r e a t e d w i t h 0.2% d i e t h y l p y r o c a r b o n a t e as d e s c r i b e d e l s e w h e r e ( M a n i a t i s e t al., 1982 ) . I I . 7 . 1 4 . RNA-DNA h y b r i d p r o t e c t i o n a n a l y s i s The 3'- a n d 5 ' - e n d s o f C.fimi t r a n s c r i p t s w e r e m a p p e d e s s e n t i a l l y a s d e s c r i b e d e l s e w h e r e ( G r e e n b e r g e t al,. 1 9 8 7 a ) . B r i e f l y , 20(ig o f t o t a l C.fimi RNA o r t h e same amount o f c o n t r o l RNA ( y e a s t t R N A ) w e r e p r e c i p i t a t e d w i t h 3 2 p _ i a b e i e C i d o u b l e s t r a n d e d DNA p r o b e s a n d r e d i s s o l v e d i n 3Ofi.1 o f h y b r i d i z a t i o n b u f f e r ( 40mM s o d i u m p h o s p h a t e , pH 6.5, 0.4M N a C l , 0.5mM EDTA, 80% f o r m a m i d e ) . The s a m p l e s were h e a t e d a t 90°C f o r l O m i n , t h e n i n c u b a t e d i n a 60°C w a t e r b a t h f o r 3h. S u b s e q u e n t l y , t h e s a m p l e s were d i l u t e d q u i c k l y w i t h 300(11 o f i c e - c o l d S I n u c l e a s e b u f f e r ( 30mM N a + - a c e t a t e , pH 4.5, 28mM N a C l , 4.5mM Z n + + - s u l f a t e ) c o n t a i n i n g 300 t o 700 u n i t s o f S I n u c l e a s e ( BRL ) . A f t e r 30min i n c u b a t i o n a t 37°C, t h e r e a c t i o n s were s t o p p e d b y t h e a d d i t i o n o f 7 5 | l l o f s t o p b u f f e r ( 2 . 5mM N a + - a c e t a t e , pH 4.5, 50mM EDTA ) . A f t e r a d d i n g 20|lg o f c a r r i e r RNA ( y e a s t tRNA ) , t h e p r o t e c t e d f r a g m e n t s w e r e p r e c i p i t a t e d b y a d d i t i o n o f 400^.1 i s o p r o p a n o l . F i n a l l y , a l i q u o t s o f t h e -labeled s a m p l e s were a n a l y z e d by PAGE u s i n g d e n a t u r i n g g e l s w i t h u r e a ( M a n i a t i s e t al., 1982 ) . 41 III. RESULTS AND DISCUSSION I I I . l . I s o l a t i o n and c h a r a c t e r i z a t i o n of endoglucanases from C.fimi culture supernatant III.1.1.Purification of C3.1 and C3.2 Beguin and Eisen reported the s e c r e t i o n of two classes of c e l l u l a s e s by the Cellulomonas sp. Ilbc ( Beguin and Eisen, 1977) . One class comprised enzymes which were t i g h t l y bound to insoluble c e l l u l o s e . These enzymes were shown to be endoglucanases with respect to t h e i r CMCase a c t i v i t i e s , and glycoproteins by t h e i r r e a c t i v i t y with p e r i o d i c a c i d - S c h i f f ' s s t a i n . The second c l a s s was t y p i f i e d by a t h i r d , non-glycosylated c e l l u l a s e , e n d o c e l l u l a s e I, found free i n the c u l t u r e supernatant of Cellulomonas Ilbc ( Beguin and Eisen, 1978 ). The p u r i f i c a t i o n of endoglucanase I was f a c i l i t a t e d by i t s a b i l i t y to bind to the dextran Sephadex G-25. This i n i t i a l p u r i f i c a t i o n step not only had the advantage of being a convenient way of concentrating the enzyme preparation but was also very s p e c i f i c for t h i s c e l l u l a s e . For the p u r i f i c a t i o n of the soluble endoglucanases, C3.1 and C3.2, secreted by C.fimi, we adopted and modified t h i s Sephadex G-25 a f f i n i t y chromatography step. The p u r i f i c a t i o n procedure i s summarized i n Fig.5. Advantage was taken of the fact that C3.1 and C3.2 demonstrated s u f f i c i e n t binding a f f i n i t y for Sephadex G-25 in the presence of 0.2M ammonium sulfate to allow t h e i r p u r i f i c a t i o n . It i s inte r e s t i n g to note that only ~ 2% of the t o t a l c e l l u l o l y t i c a c t i v i t y present free i n the C.fimi c u l t u r e supernatant was recovered by t h i s i n i t i a l p u r i f i c a t i o n step ( Table III ) . The wash f r a c t i o n i n Table III includes the CMCase a c t i v i t i e s remaining i n the c u l t u r e supernatant a f t e r the batchwise incubation with Sephadex G-25 and the "wash" of the column p r i o r 42 FIGURE 5. P u r i f i c a t i o n scheme for C3.1 and C3.2. 10 ml of LB containing 0.2% glucose was inoculated with a single colony of C.fimi and incubated at 30°C for 24h. In the next step, two 100 ml volumes of the same medium were inoculated with lml of fre s h l y grown c e l l s and incubated as above. F i n a l l y , six 2 l i t r e volumes of Leatherwood's medium ( Stewart et al., 1976 ) supplemented with 0.2% A v i c e l , were inoculated with 20ml of the second culture and incubated for 5 days at 30°C i n a rotary a i r shaker. The c l a r i f i e d culture medium was tre a t e d with PMSF ( 0. 5mM f i n a l concentration ) and NaN3 added to 0.02%. Aft e r addition of ammonium sulfate to a f i n a l concentration of 0.2M, the culture supernatant was incubated batchwise with 600 ml of preswollen Sephadex G-25 ( preswollen i n s t a r t i n g b u f f e r : 40mM potassium phosphate, pH 7.5, 0. 2M ammonium s u l f a t e ) . Subsequently, the dextran was packed in t o a column, washed with s t a r t i n g buffer and the bound material e l u t e d with a concave, decreasing s a l t gradient ( 40mM potassium phosphate, pH 7.5, 0.2M ammonium s u l f a t e to 0.02% NaN3 ). Fractions with enzyme a c t i v i t y ( DNS-CMCase assay ) were pooled ( pool I and pool II ). Each pool was frac t i o n a t e d using the MonoQ-FPLC system. The samples were loaded i n 20mM sodium p i p e r a z i n e , pH 5.8, 0. 2M NaCl ( piperazine buffer ) , and the column was washed with the same buffer. The bound CMCase a c t i v i t i e s ( C3.1 and C3.2 ) were eluted and recovered by applying a l i n e a r , increasing NaCl-gradient ( 0.02 to 1M NaCl i n 20mM sodium piperazine, pH 5.8 ) . The enzyme preparations were stored i n the piperazine buffer containing 0.02% NaN3 at 4°C. Alternatively, the samples were desalted on a Bio-Gel P-6DG column p r i o r to l y o p h i l i z a t i o n and storage at -20°C. 43 activi ty I poo l I poo l II activi fractions 44 TABLE I I I . F l o w - c h a r t o f t h e p u r i f i c a t i o n o f C3.1 and C3.2. A c t i v i t y was d e t e r m i n e d b y t h e DNS-CMCase a s s a y . T o t a l a c t i v i t y i n t h e s t a r t i n g m a t e r i a l i n c l u d e s a l l s o l u b l e C M C - h y d r o l y z i n g components s e c r e t e d by C.fimi when grown u n d e r t h e c o n d i t i o n s g i v e n i n F i g . 5. U n i t s ( u ) a r e i n (itnoles g l u c o s e e q u i v a l e n t s ( C M C - r e d u c i n g ends ) p r o d u c e d p e r m i n u t e . t o t a l p r o t e i n (mg) a c t i v i t y (u / m l ) t o t a l a c t i v i t y (u) s p e c i f i c a c t i v i t y (u/mg prot.) r e c o v e r y o f a c t i v i t y (%) b e f o r e Seph. G-25 147 0.164 1899 12.9 1 00 w a s h 1 46 0.121 1500 10.3 83 pool 1 0.34 0.056 8.4 24.3 0.4 pool II 0.82 0.111 27.1 33.0 1.4 MonoQ C3.1 0.03 0.116 7.1 236 0.35 MonoQ C 3 . 2 0.06 0.076 22.0 367 1 .2 45 t o e l u t i o n of the c e l l u l a s e s . The d i s c r e p a n c y i n the r e c o v e r y of the a c t i v i t y ( 83% i n the wash f r a c t i o n and approx. 2% i n p o o l I and p o o l II w i t h 15% of t o t a l a c t i v i t y not accounted f o r ) i s due t o t h e a d d i t i o n o f ammonium s u l f a t e t o t h e C.fimi c u l t u r e supernatant p r i o r to the Sephadex G-25 step ( ammonium s u l f a t e was shown t o decrease the s e n s i t i v i t y of the DNS-CMCase assay ). The two major f r a c t i o n s , p o o l I and p o o l II, showed s i m i l a r behaviour on the MonoQ anion-exchange column and were e l u t e d i n two separate p e a k - f r a c t i o n s ( C3.1 and C3.2 ) between 430mM and 440mM NaCl. The y i e l d of C3.1 and C3.2 from a 12 1 C.fimi c u l t u r e was t y p i c a l l y i n the range o f 100 - 500 (lg p r o t e i n , depending p r i m a r i l y on the volume r a t i o of Sephadex to c u l t u r e supernatant and i n c u b a t i o n time of Sephadex with the c u l t u r e supernatant. The m o l e c u l a r weights of C3.1 and C3.2 were es t i m a t e d to be 130'000 and 120'000, r e s p e c t i v e l y , based on t h e i r r e l a t i v e m o b i l i t i e s on SDS-PAGE ( Fig.6 ). III.1.2. C h a r a c t e r i z a t i o n of C3.1 and C3.2 The substrate-bound c e l l u l a s e s from C.fimi, CenA and Cex, are g l y c o s y l a t e d ( G i l k e s et al., 1984a, L a n g s f o r d et al., 1987 ). The g l y c a n m o d i f i c a t i o n s c o n t a i n e x c l u s i v e l y mannose r e s i d u e s , p r o b a b l y l i n k e d t o t h r e o n i n e s i d e - c h a i n s ( G i l k e s , p e r s o n a l communication ) . The g l y c o s y l groups may be i n v o l v e d i n the b i n d i n g t o c e l l u l o s e ( Chanzy et al., 1984 ) . A l t h o u g h the recombinant, n o n - g l y c o s y l a t e d CenA and Cex enzymes produced by E.coli do b i n d t o A v i c e l , g l y c o s y l a t i o n might a f f e c t the s t r e n g t h of the b i n d i n g . T h i s e f f e c t of g l y c o s y l a t i o n i s suggested by the o b s e r v a t i o n t h a t recombinant CenA and Cex, but not t h e i r n a t i v e c o u n t e r p a r t s , can be e l u t e d from A v i c e l w i t h water ( G i l k e s , p e r s o n a l communication ). On the other hand, s t a b i l i t y of the enzymes towards extremes of temperature and pH was not a f f e c t e d by 46 FIGURE 6. SDS-PAGE analysis of C3.1 and C3.2. Samples of MonoQ-FPLC p u r i f i e d C3 .1 and C3.2 enzyme preparations were loaded in lanes a and b, respectively. Lane c, aliquot of Amicon concentrated starting material for the p u r i f i c a t i o n of the native enzymes ( C.fimi culture supernatant ) ; lane m, SDS-PAGE molecular weight standards. The gel was stained with Coommassie blue. 47 glycosylation ( Arfman et al., 1986 ) . For a de t a i l e d discussion of the ro l e of g l y c o s y l a t i o n of c e l l u l a s e s see Langsford, M.L. ( 1988 ) . The result of a Western blot experiment ( Fig.7 ) i s interesting i n s o f a r as none of the soluble proteins present i n the C.fimi c u l t u r e supernatant reacted with Concanavalin A - Horseradish peroxidase ( ConA-HRP ) conjugate nor did p u r i f i e d C3.1 or C3.2, indicating that these enzymes may not be glycosylated. These data, together with the observation that C3.1 and C3.2 were recovered from the substrate-free culture supernatant of C.fimi grown on Avicel, suggest i n d i r e c t l y that glycosyl chains may be involved in binding of cellulases to c r y s t a l l i n e cellulose. The amino-terminal amino acid sequences of the native enzymes were determined i n order to design oligonucleotides for use as screening probes i n the cloning of the C.fimi gene(s) encoding C3.1 and C3.2. For the same purpose an internal t r y p t i c peptide of C3.2 ( T-115 ) was sequenced. Table IV l i s t s the amino ac i d sequencing data. Surprisingly, C3.1 and C3.2 shared the same N-terminal sequence. A sample of p u r i f i e d C3.2 was analyzed for i t s amino a c i d composition ( Table V ) . This procedure p a r t i a l l y destroyed amino acids T and S and therefore t h e i r values are inaccurate. W and C residues are not included i n the amino acid composition ta b l e since t h e i r determination requires s p e c i f i c sample preparations ( methanesulfonic acid hydrolysis for W and performic acid oxidation for C ) . The preliminary characterization of C3.1 and C3.2 suggested that the two enzymes were clos e l y related to each other. Both proteins were i s o l a t e d by the same p u r i f i c a t i o n scheme. Moreover, t h e i r separation on the MonoQ column could only be achieved by elu t i n g with a shallow s a l t gradient to ensure s u f f i c i e n t r e s olution of two i n d i v i d u a l peak f r a c t i o n s . Neither C3.1 nor C3.2 reacted 48 FIGURE 7. Western blot analysis of p u r i f i e d C3.1 and C3.2. The r e a c t i v i t y of C3 .1 and C3.2 with Concanavalin A-Horseradish peroxidase ( ConA-HRP ) was assessed as follows. After SDS-PAGE separation of C.fimi c u l t u r e supernatant material, the proteins were transfered onto n i t r o c e l l u l o s e membrane. The membrane was incubated with ConA-HRP conjugate. Binding of ConA-HRP was detected by addition of HRP color development reagent. Protein samples analyzed were: lane a, 35|lg t o t a l soluble proteins in C.fimi culture supernatant; lanes b and c, 2|lg p u r i f i e d C3.1 and C3.2, respectively; and lane d, 0.5|lg p u r i f i e d native exoglucanase, gCex. Negative control: SDS-PAGE molecular weight standards. 49 TABLE IV. Amino-terminal amino a c i d sequence data of C3.1, C3.2 and the C 3 . 2 - i n t e r n a l t r y p t i c peptide, T-115. The sequences were determined by automated Edman degradation. Amino a c i d sequences up to p o s i t i o n number 10 were confirmed by r e -sequencing f r e s h p r o t e i n p r e p a rations of both enzymes. No. of cycle PTHAA No. of cycle PTHAA C3.1 C3.2 T - 1 1 5 C3.1 C3.2 T-1 1 5 1 A A L 1 1 D D Q 2 S S L/E 1 2 G/D - T 3 P P E 1 3 P P L 4 I I P 1 4 E - L 5 G/K G Y 1 5 E/G - E 6 E E D 1 6 W - A 7 G G P 1 7 V - A 8 T T Q 1 8 A/D -9 F F L 1 9 Y -1 0 D D A 2 0 G -50 TABLE V. P a r t i a l amino a c i d composition a n a l y s i s of C3.2. The molar contents of i n d i v i d u a l amino acids were based on the estimated molecular weight of 120'000 f o r C3 .2 . a m i n o a c i d c o m p o s i t i o n (mol/mol prot.) a m i n o ac id c o m p o s i t i o n (mol/mol prot.) D + N 9 9 . 5 9 M 6 . 7 2 T 8 5 . 9 8 I 1 7 . 6 6 S 8 7 . 3 2 L 9 8 . 6 0 E + Q 1 3 6 . 5 4 Y 4 7 . 8 9 P 9 4 . 2 7 F 3 2 . 6 1 G 1 4 5 . 5 6 H 1 9 . 5 5 A 1 4 5 . 5 0 K 2 1 . 5 7 V 9 6 . 8 1 R 3 2 . 6 1 51 detectably with the ConA-HRP conjugate. Also, t h e i r respective k i n e t i c parameters for the hydrolysis of the a r y l - c e l l o b i o s i d e substrate, pNPC, were very s i m i l a r : the Kms i n mM were 0.13 for both enzymes, and the Vmax values i n [imoles per min per mg protein were 0.39 and 0.50 for C3.1 and C3.2, respectively. Furthermore, a rabbit serum s p e c i f i c for p u r i f i e d C3.2 exhibited approximately the same r e a c t i v i t y ( t i t r e ) in ELISA for both p u r i f i e d antigens, C3.1 and C3.2. And l a s t l y , the two c e l l u l a s e s share the same amino-terminal amino acid sequence. Because of t h e i r congruent properties, I was led to postulate at t h i s stage of the project that C3.1 and C3.2 were encoded by the same C.fimi gene. In accordance with the accepted nomenclature the gene was designated cenC and i t s recombinant product CenC. III.2. Molecular cloning of cenC III.2.1. Preliminary experiments In the following paragraph I describe the appetizer to the cenC cloning dinner. Despite i t s elaborate preparation, i t was not a meal i n i t s e l f . However, i t s a f t e r t a s t e contributed considerably to the success of the main course. A p a r t i a l Sau3A digest of C.fimi DNA was shotgun-cloned into pUC13. For the screening of the plasmid l i b r a r y , a r e s t r i c t e d pool of oligonucleotides ( JO.2 ) corresponding to the codons for amino acids number 7 to 11 of the N-terminal sequence of the C3 enzymes was used i n a c o l o n y - f i l t e r l i f t h y b r i d i z a t i o n experiment. The r a t i o n a l e f o r using a biased o l i g o n u c l e o t i d e pool was the p r e v i o u s l y demonstrated r e s t r i c t e d codon usage i n C.fimi ( O'Neill et al., 1986a ). Thus far, only 35 out of 61 amino acid codons were found i n approx. 6kb of sequenced C.fimi DNA. In addition, i n over 98% of the codons the t h i r d p o s i t i o n contained 52 either a guanosine ( G ) or cytosine ( C ). Hence, a biased probe pool was considered appropriate for screening ( F i g . 8 ) . JO. 2 comprised only four different 15-mers, with a l l codons ending with a G or C. The screening yielded several h y b r i d i z a t i o n - p o s i t i v e clones; however, none expressed d e f i n i t i v e CMCase a c i v i t y in the Congo Red plate assay. Based on previous results ( Wong et al., 1986a, Owolabi, 1988 ), we knew that E.coli recognizes the t r a n s c r i p t i o n a l regulatory sequences of C.fimi only poorly, and therefore, we were not surprised by the very low a c t i v i t y of the JO.2-positive recombinant clones. In order to t e s t for the successful cloning of cenC the nucleotide sequence corresponding to the N-terminal amino ac i d sequence of C3.1/2 was determined. Consequently, the inserts of several individual clones hybridizing most strongly to JO. 2 were completely digested with H a e l l l and shotgun-cloned i n t o Ml3mpl0. Subclones to be sequenced were i d e n t i f i e d by screening with 32p_^ a] : ) ei e cj J O . 2 . F i g . 8 shows the sequence of the best matching clone. Note that only one nucleotide did not agree with the probe and only two i n t o t a l could not be aligned with the amino acid sequence of C3.2. Unfortunately, none of the clones screened with JO. 2 contained the sequence corresponding to amino acids number 1 to 4. It was conceivable that c e r t a i n amino acids ( I 4 , Eg and D u ) had been mistakenly i d e n t i f i e d . But resequencing of new preparations of C3.1 and C3.2 confirmed the o r i g i n a l amino acid sequencing data. This led me to conclude that none of the i s o l a t e d recombinant clones contained cenC or even part of i t , possibly as a r e s u l t of using a biased n u c l e o t i d e probe pool for screening. Consequently, f o r the subsquent cloning experiment ( see below ) a f u l l y redundant pool of oligonucleotides were used for screening purposes. 53 FIGURE 8. P a r t i a l n u c l e o t i d e s e q u e n c e o f p U C 1 3 - l / 4 3 . The n u c l e o t i d e s e q u e n c e o f t h e p l a s m i d i s i n a l i g n m e n t w i t h t h e s e q u e n c e s c o r r e s p o n d i n g t o t h e N - t e r m i n u s o f C3.2 and t h e p o o l o f s y n t h e t i c o l i g o n u c l e o t i d e s , JO. 2 ( b o l d l e t t e r s ) . V e r t i c a l b a r s i n d i c a t e d i s c r e p a n c i e s among t h e s e q u e n c e s . N-terminal A.A. sequence A i s 2 P 3 «4 G 5 E 6 G 7 T 8 Fg D10 D11 " P13 of C3.2 GCN T TCN/AGC CCN T ATC A GGN A GAG I GGN ACN T TTC T GAC T GAC I CCN I I J 0 . 2 C GGG C ACG TTC GAC GAC pUC13-1/43 5' GGG I GCC GGC ACG TTC GAC I GTC I I TCG TGG e t c . 55 III.2.2. Cloning strategy The replacement vector lambda L47.1 was chosen for the cloning of genomic C.fimi DNA for several reasons: the cloning capacity ( 4.7 to 19.6kb for cloning into the BamHI s i t e s ) i s superior to most common plasmid vectors; i t i s an expression vector with the expression of recombinant in s e r t s being under the control of the strong lambda leftward promoter P L; and l a s t l y , lambda L47.1 provides a convenient p o s i t i v e s e l e c t i o n system ( Spi-phenotype ) by p l a t i n g the in vitro packaged phage p a r t i c l e s on the non-permissive host E.coli NM 539 ( P2 lysogen ). NM 539 allows only the propagation of recombinant L47.1 p a r t i c l e s ( gam-, r e d - ), ( Loenen and Brammar, 1980, Brammar, 1982 ). Genomic DNA of C.fimi was p a r t i a l l y digested with Sau3A and liga t e d to the BamHI arms of L47.1 to form concatamers, which were subsequently packaged in vitro ( Hohn,' 1979, Amersham, b u l l e t i n N.334 ) . To select for and amplify recombinant phage p a r t i c l e s , the lambda p a r t i c l e s were plated on the P2 lysogen NM 539 ( f i r s t round of a m p l i f i c a t i o n ) . I adopted the a c t i v i t y screening protocol described for the cloning of an Erwinia chrysanthemi c e l l u l a s e gene for the i d e n t i f i c a t i o n of CMCase p o s i t i v e phage p a r t i c l e s i n the plaque-Congo red plate assay ( Kotoujansky et al., 1985 ) . Ly s i s of the host c e l l s during phage propagation leads to l i b e r a t i o n of cytoplasmic proteins and increases the s e n s i t i v i t y for the detection of CMCase postive clones. Approx. 2 x l 0 4 phage p a r t i c l e s plated on NM 538 ( permissive host ) were screened for expression of cellulase a c t i v i t y in t h i s way. However, most of the phage p a r t i c l e s were screened with o l i g o n u c l e o t i d e s i n a p l a q u e - f i l t e r l i f t h y b r i d i z a t i o n assay. Fig.9 l i s t s the pools of oligonucleotide probes prepared for t h i s purpose. Note that the pools J0.3A,B,C and D constitute the f u l l y redundant r e p e r t o i r e of oligonucleotides corresponding to the amino a c i d sequence depicted i n the top panel of F i g . 9. The 56 FIGURE 9. O l i g o n u c l e o t i d e s r e e n i n g probes f o r the lambda L47 . 1 -C. fimi DNA l i b r a r y . The l e t t e r s w i t h numbers i n s u b s c r i p t represent amino a c i d s and t h e i r p o s i t i o n s i n the N-t e r m i n a l amino a c i d sequences o f t h e C.fimi enzymes ( C3.1/2 ) and the i n t e r n a l t r y p t i c p e p t i d e T-115. The p o o l s J0.3A, B, C, and D c o n s t i t u t e the f u l l y redundant r e p e r t o i r e of o l i g o n u c l e o t i d e s c o r r e s p o n d i n g t o the amino a c i d sequence Eg to Du o f the C3-enzymes. The probe p o o l , BM.C, was b i a s e d with respect t o C.fimi codon usage. C3.1/2 E 6 G 7 T 8 F 9 D 1 0 D11 A GAG GGN ACN T TTC T GAC T GAC J 0 . 3 A A GAG GGN ACN TTC GAC GA J 0 . 3 B A GAG GGN ACN TTT GAC GA J 0 . 3 C A GAG GGN ACN TTG GAT GA J 0 . 3 D A GAG GGN ACN TTT GAT GA T - 1 1 5 E 3 P4 Y 5 P 7 Q 8 A GAG CCN T TAC T GAC CCN A CAG BM.C A GAG T CCG C TAC GAC T CCG C CAG 57 oligonucleotide probe pool BM.C was used for the cross-screening of JO.3 p o s i t i v e clones. Two plates with approx. 1.5x10^ plaques t o t a l l y were screened with each of the four JO.3 probe pools, and the p o s i t i v e phage p a r t i c l e s were p u r i f i e d by p l a t i n g and i s o l a t i o n of s i n g l e plaques. Fig.10 shows an example of an autoradiogram of a p l a q u e - f i l t e r l i f t h y b r i d i z a t i o n experiment using 3 2 p _ j _ a D e i e c j J O . 3 A . S i g n i f i c a n t l y , the screening with J0.3A yielded f a r more p o s i t i v e plaques ( 10 to 20-fold ) than any of the other three probe pools, suggesting that J0.3A contained the correctly matching oligonucleotide. A s e l e c t i o n of JO.3A-positive or CMCase-positive clones was subsequently rescreened using d i f f e r e n t types of probes. These r e s u l t s are l i s t e d i n Table VI. Only two clones ( 169 and 180 ) reacted with more than one type of probe, suggesting that the genes cex, cenA and cenC are not c l o s e l y l i n k e d on the C.fimi chromosome. Surprisingly, none of the JO.3A-positive clones showed s i g n i f i c a n t a c t i v i t y by the Congo red plate assay; nor did any of the CMCase active clones react with J0.3A. However, i n l i g h t of the findings with respect to the CenC-overproducing construct, t h i s phenomenon can be explained ( see chapter III.4. ). Fig.11 i s a diagram of the recombinant clone L47.1-169 ( p o s i t i v e for J0.3A and BM.C but negative for CMCase a c t i v i t y ) which I selected for further studies. The approx. length of the C.fimi DNA inse r t was 10.5kb; and contained two internal BamHI s i t e s . The unique HindiII and EcoRI s i t e s were parts of the sequences i n the l e f t and right arms of the cloning vector. III.2.3. Subcloning and i n i t i a l characterization of cenC I n i t i a l attempts to subclone the e n t i r e H i n d l l l fragment of L47.1-169 i n t o pUC13 were unsuccessful, probably because of 58 FIGURE 10. Autoradiogram of a p l a q u e - f i l t e r l i f t h y bridization experiment. Approx. 15,000 in vitro packaged and amplified phage p a r t i c l e s were plat e d with permissive host c e l l s , NM538 on two seperate p l a t e s ( 150mm i n diameter ) . Plaque material was absorbed onto Biodyne membrane. Subsequently, the membrane was probed with 32p-iabeled J0.3A. A selection of po s i t i v e clones ( three of which are indicated by arrows ) were i s o l a t e d and p u r i f i e d for further characterization. 59 TABLE VI. Cross-screen of recombinant L47.1 c l o n e s . A s e l e c t i o n of p o s i t i v e clones was h y b r i d i z e d with o l i g o n u c l e o -t i d e probes s p e c i f i c f o r e i t h e r cex , cenA or cenC . Upper panel: J0.3A- p o s i t i v e clones; lower panel: CMCase-positive clones, a: a c t i v i t y was determined q u a l i t a t i v e l y on CMC-Congo red i n d i c a t o r p l a t e s , b: o l i g o n u c l e o t i d e probes used t o screen recombinant phage plaques; J0.3A and BM.C were l a b e l e d by phosphorylation, the probes s p e c i f i c f o r cex and cenA were r a d i o a c t i v e l y l a b e l e d by n i c k - t r a n s l a t i o n of 5'-sequences of the r e s p e c t i v e genes. X L47.1 c lones ac t iv i ty 3 J 0 . 3 Ab BM.C C e n A Cex 14 - + - - -114 - + - - -I 24 - + - - -I 34 - + - - -I 45 - + - - -I 57 - + - - -I 69 - + + - -I 80 - + + - -IV 9 - + - - -II 16 II 26 II 36 II 47 II 71 1191 + + + + + + -+ + + -60 FIGURE 11. Diagram of the recombinant clone lambda L47.1-169. The stippled box represents the insert of C.fimi DNA, the lines represent lambda DNA. Restriction enzymes are: Bl, BamHI; Rl, EcoRI; H3, H i n d l l l and S3A, Sau3A. P Lstands for the leftward promoter of lambda; numbers are in kb. The r e s t r i c t i o n fragments which hybridized with either JO.3A or BM.C are indicated. Lambda L47.1-I69 21.3 4.0 5.2 * + # - 8 . 2 - H H3 B1 B l H3 cos 1 cos •ft-R1 t t R1 BM.C J0.3B S3A/B1 S3A/B1 61 interference of the lambda P L promoter with plasmid r e p l i c a t i o n . In order to c o r r e l a t e cenC sequences with subfragments of the L47.1-169 i n s e r t , the 5'-end and o r i e n t a t i o n of cenC were determined i n a dot-blot hybridization experiment ( Fig.12 ). For t h i s , the BamHI-Hindlll fragment lacking the lambda P L promoter and BamHI-BamHI fragment of L47.1-169 were subcloned into pUC13 ( to give pUC13-B and pUC13-B/H ) and screened eith e r with J0.3A or BM.C. Since the si z e of cenC required to encode C3.1/2 was estimated to be approx. 3.4kb, the r e s u l t s from the dot-blot experiments indicated that the BamHI-Hindlll fragment containing the lambda P L promoter ( Fig.11 ) was lacking any part of cenC. In order to prove by nucleotide sequence analysis that the the clone L47.1-169 contained cenC or at l e a s t part of i t , a t o t a l Sau3A-HaeIII digest of pUC13-B ( which hybridized with J0.3A ) was shotgun-cloned into M13mpl9. P o s i t i v e clones were i d e n t i f i e d by p l a q u e - f i l t e r l i f t h y b r i d i z a t i o n using ^^F-labeled J0.3A as screening probe. P a r t i a l sequences of two subclones are l i s t e d in Fig.13. Both sequences overlapped and agreed f u l l y with the amino acid sequence. Note the unusual C.fimi codon, GGA, for glycine at amino a c i d p o s i t i o n number 7. This unexpected f i n d i n g o f f e r s an explanation for the lack of success of the f i r s t attempt to clone cenC: the biased pool of oligonucleotides i n JO.2 did not include GGA for glycine ( Fig.8 ). The 7.7kb BamHI-Hindlll fragment hybridizing with J0.3A and BM.C ( Fig.11 ) was subsequently cloned into pTZ18R to give plasmid pTZ18R-8. I found the Genescribe vector system most suitable for generating s p e c i f i c constructs since i t enabled the i s o l a t i o n of the plasmid as single stranded DNA ( Fig.14 ). DNA fusion s i t e s or s p e c i f i c sequences i n constructs can be examined e a s i l y , without the need for further subcloning, by DNA sequence analysis using commercially available or s p e c i f i c a l l y prepared sequencing primers 62 FIGURE 12. DNA dot-blot hybridization experiment. pUC13-B DNA ( I69-B ) and pUC13-B/H DNA ( I69-B/H ), containing the BamHI/BamHI fragment and the BamHI/Hindlll fragment of the recombinant lambda clone L47.1-169, r e s p e c t i v e l y , were spotted onto Biodyne membrane and hybridyzed either with 32p_ labeled J0.3A ( panel A ) or 3 2 p _ i a ] 3 e i e c i BM.C ( panel B ) . Positive control was L47.1-169 DNA; negative controls: L47.1-IV9 ( unrelated recombinant clone ), L47.1 and pUC13 DNA. Controls L47.1-IV9 L47.1-I69 I Cont ro l I69-B I69-B/H B Cont ro l I 6 9 - B I69-B /H 63 FIGURE 13. N u c l e o t i d e s equence a n a l y s i s o f p l a s m i d s M13mpl9-B4 and M13mpl9-B5. The sequence i s a l i g n e d w i t h the N - t e r m i n a l amino a c i d sequence o f t h e C3 enzymes. The b o l d l e t t e r n u c l e o t i d e t r i p l e t emphazises unusual C.fimi codon f o r g l y c i n e ( compare w i t h o l i g o n u c l e o t i d e p r o b e JO. 2 i n F i g . 8 ). N-terminal A 1 S 2 P 3 l 4 G 5 E 6 G 7 T 8 F 9 D 1 0 - P , 3 A.A. sequence of C3.1/2 IJ1 rp T T T GCC T C N / A G C CCN ATC GGN GAG GGN ACN T T C GAC GAC CCN A B4/B5 5'G ATC GGG GAG GGA ACG TTC GAC GAC GGG CCC e t c . 65 FIGURE 14. D i a g r a m o f t h e G e n e s c r i b e v e c t o r s y s t e m pTZ18/19-R/U. Ap-R, a m p i c i l l i n r e s i s t a n c e m a r k e r gene; o r i ( f 1 / pBR322 ), o r i g i n s o f r e p l i c a t i o n o f p l a s m i d s pBR322 and phage f l ; l a c z, R - g a l a c t o s i d a s e gene; l a c p/o, p r o m o t e r a n d o p e r a t o r o f t h e l a c o p e r o n ; T7 p r o m o t e r , phage T7 p r o m o t e r in vitro t r a n s c r i p t i o n ; MCS, m u l t i p l e c l o n i n g s i t e . Sequencing-Ap-R 66 ( USB, Genescribe-Z i M protocol ). The diagram of the i n s e r t i n clone pTZ18R-8 ( Fig.15 ) documents various r e s t r i c t i o n enzyme site s determined by the method of Smith and B i r n s t i e l ( 1976 ). By Southern t r a n s f e r analysis, the 5'-end of cenC, encoding the N-terminus of the mature endoglucanase, was found to be l o c a l i z e d on a 900bp Sstl-BamHI fragment ( Figs.15 and 16 ). S i m i l a r l y , the r e s t r i c t i o n fragment h y b r i d i z i n g with BM.C was i d e n t i f i e d as a Sstl-Smal fragment ( Figs.15 and 16 ). III.2.4. Sequence analysis of the 5'-end of cenC The clone JM101[pTZ18R-8] expressed very low CMCase a c t i v i t y by the DNS-CMCase assay ( ~0.008u/mg of t o t a l c e l l e x t r a c t proteins ) . In order to construct a more e f f i c i e n t expression system ( see chapter III.4. ) i t was necessary to sequence the 5'-end of cenC and the DNA upstream of th i s region. Deletions of the insert i n pTZ18R-8/5 ( Fig.17 ) were generated using two d i f f e r e n t s t r ategies: s t a r t i n g at the SstI s i t e of the fragment, the exonuclease a c t i v i t y of T4DNA polymerase was used to create d e l e t i o n fragments by digesting l i n e a r , s i n g l e stranded plasmid DNA e x c l u s i v e l y i n the 3' to 5' d i r e c t i o n ( see Dale's protocol i n section II ); deletions s t a r t i n g at the BamHI end of the i n s e r t were generated using Bal31 exonuclease. Arrows i n Fig.17 denote the o r i e n t a t i o n s and the lengths of the DNA sequences determined in each deletion construct. The p u r i t y of the template DNA was c r u c i a l to the successful analysis of C.fimi DNA by the chain termination method ( Sanger et al., 1977 ). D e f i n i t i v e data were reproducibly obtained only when the single stranded template DNA was further p u r i f i e d on an al k a l i n e sucrose gradient ( see section II ). The r e l a t i v e high G plus C content" of C.fimi DNA ( 72% ) necessitated a d d i t i o n a l 67 FIGURE 15. R e s t r i c t i o n enzyme map of recombinant DNA in pTZ18R-8. L o c a l i z a t i o n of r e s t r i c t i o n enzyme s i t e s was established according to the method of Smith and B i r n s t i e l ( 1976 ). Restriction enzymes: B, BamHI, H, H i n d l l l , K, Kpnl, M, Mlul, P, PstI, Sm, Smal, S, S s t l . No sites were found for B e l l i , B g l l l , C l a l , EcoRI, PvuII, SphI, and Xbal. S o l i d bars indicate the r e s t r i c t i o n fragments hybridizing with either JO.3A or BM.C. Stippled bars represent the lengths of inserts of two subclones of pTZ18R-8 chosen for further studies. P T Z 1 8 R - 8 0 1 2 3 4 5 6 7 I I I I I I I L B | | | I S \ \ / B M S S m S S " ^ M S S K S M , K H J U J0.3A BM.C pTZ18R-8 /5 -5 pTZ18R-8/5 69 FIGURE 16. Southern transfer analyses of pTZ18R-8 DNA. Total digests of pTZ18R-8 DNA were resolved on a 1% agarose gel, transfered to Biodyne membranes and probed with 32p_]_abe;Led J0.3A ( panel A ) or with 3 2 P - l a b e l e d BM.C ( panel B ) . Numbers i n lanes refer to r e s t r i c t i o n enzymes used: 1, Kpnl, 2, PstI, 3, Mlul, 4, Mlul and BamHI, 5, Smal, 6, Smal and BamHI, 7, SstI, 8,SstI and BamHI. Lane c, control DNA ( pUC12 digested with BamHI ) , lane m, DNA standards ( lambda DNA digested with H i n d l l l and EcoRI ). C I 2 3 4 5 6 7 8 m m -B .2027 '1904 •1584 • 137S 947 831 m C 1 2 3 4 5 7 8 - 3 5 3 0 3530 -2027 1904 1584 1375 947 -831 -t - 564 564 - — 70 FIGURE 17. Sequencing s t r a t e g y f o r t h e i n s e r t i n pTZ18R-8/5-5. The pTZ18R-8/5-5 d e l e t i o n s D l , D2, and D3, were c o n s t r u c t e d as d e s c r i b e d by Dale et al. ( 1985 ); see a l s o M a t e r i a l s and Methods, D e l e t i o n s i n the o p p o s i t e d i r e c t i o n were c r e a t e d by d i g e s t i o n o f the p l a s m i d w i t h B a l 31 exonuclease ( a f t e r l i n e a r i z a t i o n w i t h BamHI ) and subsequent s u b c l o n i n g i n t o pTZ19R. The syn-t h e t i c o l i g o n u c l e o t i d e , JO.T, was used as sequencing p r i m e r t o c o n f i r m the B28 sequencing d a t a . The arrows i n d i c a t e the o r i g i n , d i r e c t i o n and number of n u c l e o t i d e s determined i n each sequencing experiment. The c r o s s - h a t c h e d bar r e p r e s e n t s t h e i n s e r t i n pTZ18R-8/5-5. 30 0 600 900 kb p T Z 1 8 R - 8 / 5 - 5 SstI B a m H I D1 D2 D3 — B 2 8 JO.T 71 precautions ( O' N e i l l et al., 1986a, Wong, 1986 ). Secondary s t r u c t u r e s i n template DNA or sequencing r e a c t i o n products manifested themselves as "compressions". Fig.18 shows an example of compressions t y p i c a l l y seen i n sequencing C.fimi DNA. Substitution of dGTP with the analogue 7-deaza-dGTP ( 7d-dGTP ) in the nucleotide mixes proved to be very e f f e c t i v e i n d e s t a b i l i z i n g most secondary structures i n the sequencing reaction products. A second class of compressions was due to the formation of secondary structures i n the template DNA, causing the DNA polymerase to s t a l l and f a l l o f f . Preparation of deletions s t a r t i n g close to extended G plus C stretches and/or incubating the sequencing reactions at higher temperature helped to a l l e v i a t e t h i s problem. Fig.19 documents the sequence of the insert of plasmid pTZ18R-8/5. The sequence in bold l e t t e r s indicates the hybridization s i t e for one of the oligonucleotides i n J0.3A. The sequencing data were in complete agreement with the amino acid sequencing r e s u l t s . The s t r e t c h of 32 amino acids upstream of the put a t i v e leader peptidase cleavage s i t e , A - A, shows t y p i c a l features of a leader peptide of a secreted p r o t e i n ( Wickner and Lodish, 1985 ) : p o s i t i v e l y charged amino acids at the N-terminus are followed by a sequence of hydrophobic amino acids; close to the putative leader petidase cleavage s i t e , amino acids with small side-chains are predominant. The predicted s t a r t codon i s GUG; no other in-frame s t a r t codons could be i d e n t i f i e d w i t h i n 200 nucleotides proximal to the GTG. The size of the leader peptide ( 32a.a. ) i s s i m i l a r to other leader sequences of C.fimi proteins: Cex, 41a.a.; CenA, 31a.a. and CenB, 32a.a. ( Owolabi et al., 1988a, O'Neill et al., 1986a, Wong et al., 1986a ). 72 FIGURE 18. E f f e c t of u s i n g 7d-dGTP d u r i n g sequencing C.fimi DNA. The recombinant DNA i n p l a s m i d pTZ18R-8/5-5 was sequenced by the c h a i n - t e r m i n a t i o n method. To t e s t the e f f e c t of 7-deaza-dGTP ( 7d-dGTP ) on d e s t a b i l i z i n g s e c o n d a r y s t r u c t u r e s i n t h e s e q u e n c i n g p r o d u c t s , e i t h e r normal n u c l e o t i d e mixes ( -7d-dGTP ) or n u c l e o t i d e mixes c o n t a i n i n g 7d-dGTP i n s t e a d o f dGTP ( +7d-dGTP ) were used i n the sequencing r e a c t i o n s . + 7d-dGTP - 7d-dGTP G A T C G A T C 73 FIGURE 19. Nucleotide sequence of the 5'-region of cenC. The r e a d i n g frame was i d e n t i f i e d by alignment w i t h the N-t e r m i n a l amino a c i d sequence o f C3.1/2. L e t t e r code i n s u p e r s c r i p t r e p r e s e n t s the amino a c i d sequence. S t a r t codon and sequence corresponding t o o l i g o n u c l e o t i d e s c r e e n i n g probe ( J0.3A ) are i n d i c a t e d i n b o l d l e t t e r s . The l e t t e r N i n the nu c l e o t i d e sequence denotes undetermined n u c l e o t i d e r e s i d u e s . 5' -> 3' CGCGGCGCGGCCC GTCACGGTGTCGCGGTTCGACGTGCACGGACGCCGGCGCGCGGNTCGTCGACGGCACCGCG GTCTCGACGTCGACGTCACGGTCGTGTGCTCGTCGGGCACGTACGNGGGCGCTCGCGCGCG ACGTCGGGCGGCCTGGCGTCGCGTCACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNCCCCCCGCACGCTCGAGCAGCTCGCCGCCGAGCCGGAGACGCGCCGTTCCCGTGCTG CCGTGTCCGACGCCGCGGGGGCGACCTTCCCGTGCGCGACCTGGCGAGCGAGTGCGGATTG TACGGCAGCGTGGCGTCGACGGGGCGGGCAGGTCGCGGCCGATCGCCCGGACGGACGCTCG TCGCCTGGTCGAGGACGGGGCGGGCGCGTGCGGCCGGTCCTCGTCTTCGCGCCGGACGCTG ACCGGTCGGCACGGCGCGCGCCTCCGCCCGCACCCTGTCTGGAGCCGTCCGCGACCGAAAC GATTCGGTCCGGTGCGCACGCTTCCGCGGGCGCCGCGGCCGTGCCTACCCTGCCGCCGCAG CACCGGCGTTCTCCACCGCAGGGTGGGAGCGCTCCTACGACAGGGGAGACAGA M V S R R S S Q A R G A L T A GTG'GTT'TCT'CGC'AGG'TCA'TCA'CAG'GCG'CGC'GGC'GCG'CTC'ACG'GCC' V V A T L A L A L A G S G T A GTC'GTC'GCG'ACG'CTC'GCC'CTC'GCG'CTC'GCC'GGG'AGC'GGC'ACC'GCG'C L A A S P I G E G T F D D G P TC'GCC 1GCG 1TCG 1CCG 1ATC 1GGG 1 GAG'GGA'ACG'TTC'GAC'GAC1GGG1CCC E G W V A Y G T D G P L D T S GAG1GGG'TGG'GTC'GCG'TAC'GGC'ACC1GAC'GGC'CCC'CTC'GAC'ACG'AGC' T G A L W L A V P A G S ACG'GGC'GCG'CTG'TGG'CTC'GCC'GTG'CCG'GCC'GGA'TCC BamHI 74 III. 3. /Analyses of in vivo cenC transcripts of C.fimi III.3.1. Mapping of the 5'-ends of cenC transcripts The expression of cex, cenA and cenB i n C.fimi i s regulated by the nature of the carbon source i n the c u l t u r e medium ( Greenberg et al., 1987a,b ). An i n i t i a l experiment was conducted to determine the optimal conditions for t r a n s c r i p t i o n of cenC in C.fimi with respect to the carbon source. Aliquots of t o t a l RNA i s o l a t e d from C.fimi cultures grown i n minimal medium containing e i t h e r glucose ( 0.2% ), g l y c e r o l ( 0.2% ) or CMC ( 1% ) were b l o t t e d onto Biodyne membranes and hybridized with the 5'-cenC s p e c i f i c , 3 2 p _ i a D e i e c i oligonucleotide JO.T. No cenC t r a n s c r i p t s could be detected with RNA i s o l a t e d from c e l l s grown on glycerol or glucose ( F i g . 20 ) . Only t o t a l RNA from c e l l s grown on CMC contained cenC t r a n s c r i p t s at a l e v e l which allowed t h e i r detection by the dot-blot experiment. If C.fimi does express cenC c o n s t i t u t i v e l y then t r a n s c r i p t s i s o l a t e d from glucose or glycerol grown c e l l s were too few for detection by t h i s a n a l y s i s . A l l subsequent work was conducted with t o t a l RNA i s o l a t e d from C.fimi cultures grown with CMC. Fig.21 outlines the preparation of the hyb r i d i z a t i o n probe for the 5" -mapping of cenC t r a n s c r i p t s . The denatured, 3 2 p _ i a ] 3 e i e c j probe was annealed i n the presence of formamide either with t o t a l RNA from C.fimi or with unrelated RNA. Subsequently, the samples were digested with SI nuclease, and the protected fragments were resolved by denaturing polyacrylamide gel electrophoresis. Several fragments approx. 260 nucleotides long were protected by C.fimi RNA ( F i g . 22 ) . The heterogeneity of the fragments may have r e s u l t e d from overdigestion of the RNA-DNA hybrids with SI nuclease rather than representing s p e c i f i c s t a r t s i t e s of cenC t r a n s c r i p t i o n . For fine-mapping of these fragments an appropriate dideoxy-sequencing ladder was prepared by making a sequencing 75 FIGURE 20. Dot-blot a n a l y s i s of t o t a l C.fimi RNA. T o t a l RNA was i s o l a t e d from C.fimi c u l t u r e s grown e i t h e r on 1% CMC ( CMC]_ and C M C 2 , two i n d i v i d u a l RNA p r e p a r a t i o n s ), 0.2% g l y c e r o l ( G l y i ) or 0.2% glucose ( Glu^ ) and b l o t t e d onto Biodyne membrane. The 3 2 p _ l a ] - ) e l e ^ o l i g o n u c l e o t i d e JO.T was used as h y b r i d i z a t i o n probe. In the c o n t r o l lane, e q u i v a l e n t RNA samples were hydrolyzed i n 0.2N NaOH p r i o r t o b l o t t i n g . CMC-, G I V 1 Glu 1 CMC 2 test control 76 FIGURE 21. Preparation of the probe for the 5'-cenC transcript mapping. Plasmid pTZ18R-8/5 was digested with BamHI, dephosphory lated with c a l f i n t e s t i n a l Dhosphatase and labeled with T4 polynucleotide kinase plus y-(32)P-ATP. Subsequently, the DNA was digested with EcoRI, and the fragments were separated by non-denaturing PAGE. F i n a l l y , the 900bp probe was electroeluted and concentrated prior to use. The black box represents part of the multiple cloning s i t e in pTZ18R; the stippled box indicates C.fimi DNA. The following r e s t r i c t i o n enzyme sit e s are repre-sented: B, BamHI, H3, H i n d l l l , Sm, Smal, Ss, SstI, and Rl, EcoRI Rl Ss BamHI CIPase 3 2 T4PNKase, y - P-ATP EcoRI • P A G E R l SS I I B I 5'-' *************************************************************************************** ***************************************************************************************** 32 5 ' - P 0 900bp 77 FIGURE 22. SI nuclease p r o t e c t i o n a n a l y s i s of 5'-ends of cenC t r a n s c r i p t s . P r o t e c t e d , 3 2 p _ i a ] 3 e i e c j DN7\ fragments were separated by d e n a t u r i n g PAGE. Lane 1, i n t a c t probe ( no SI n u c l e a s e treatment ) ; lane 2, probe h y b r i d i z e d w i t h y e a s t tRNA and d i g e s t e d w i t h SI nuclease ( c o n t r o l ); lane 3, SI nuc l e a s e p r o t e c t e d fragments a f t e r h y b r i d i z a t i o n w i t h t o t a l C.fimi RNA. Standards ( M ) are 3 2 p _ i a j - ) e i e c i fragments from s i n g l e stranded M13 DNA d i g e s t e d with H a e l l l . M 2 5 2 2 _ 1 6 1 8 -8 4 9 - _ 5 2 5 -3 4 1 3 3 8 3 0 9 1 6 9 1 5 8 78 ladder from the probe i n plasmid pTZ19R-B/S. Digestion of the reaction products with BamHI p r i o r to t h e i r loading on the gel ensured that the sequencing fragments shared the same star t s i t e as the 32p_i ab e;L e ci h y b r i d i z a t i o n probe. In t h i s way the main protected fragments could be mapped to the nucleotides indicated by arrows i n Fig.23. Note that the arrows indicate the putative s t a r t s i t e s of the three dominant fragments of a t o t a l of four to five protected fragments. The diagram i n Fig.24 shows the putative start s i t e s of i n v i v o cenC t r a n s c r i p t s ( bold l e t t e r s ) and part of the proximal non-transcribed nucleotide sequence of cenC. The sequence proximal to the putative cenC mRNA star t s i t e s was compared for homology with some known b a c t e r i a l promoters ( Rosenberg and Court, 1979, Hawley and McClure, 1983 ). Two E . c o l i promoters ( lexA and r r n E l PI ) showed some degree of homology with the -10 and -35 hexamers of the proposed cenC promoter ( Miki et a l . , 1981 and G i l b e r t et a l . , 1979 ) . There was no homology with Gram-positive t r a n s c r i p t i o n a l regulatory sequences. However, i t should be noted that these sequences have to be examined further and tested for t h e i r f u n c t i o n a l i t y e i t h e r by studies with p u r i f i e d C.fimi RNA polymerase or by i n v i v o analysis. A prerequisite for the l a t t e r approach i s a transformation procedure for C.fimi which would allow the re-introduction of our postulated C.fimi promoters i n order to test them for t h e i r a b i l i t y to i n i t i a t e transcription. III.3.2. Mapping of the 31-ends of cenC transcripts The 3'-ends of i n v i v o cenC transcipts were also determined by SI nuclease protection analysis. Fig.25 shows the strategy for the p r e p a r a t i o n of the h y b r i d i z a t i o n probe. The choice of the r e s t r i c t i o n enzyme fragment to use as probe was based on the 79 FIGURE 23. Fine-mapping of 5'-ends of cenC t r a n s c r i p t s . 5 ' - l a b e l e d DNA probe was t r e a t e d w i t h SI n u c l e a s e a f t e r h y b r i d i z a t i o n w i t h t o t a l C.fimi RNA ( lane 1 ) or w i t h yeast tRNA ( l a n e 2 ) . A s e q u e n c i n g l a d d e r was p r e p a r e d by s e q u e n c i n g pTZ19R-B/E w i t h r e v e r s e p r i m e r f o l l o w e d by complete d i g e s t i o n o f the sequencing r e a c t i o n p r o d u c t s w i t h BamHI ( t o ensure t h a t the fragments share the same 5'-ends as the h y b r i d i z a t i o n probe ). Arrows i n d i c a t e the n u c l e o t i d e s corresponding t o the 5'-ends of C.fimi t r a n s c r i p t s . 80 FIGURE 24. 5'-region of cenC showing the proposed t r a n s c r i p t i o n s t a r t s i t e s . The non-transcribed coding strand of cenC proximal to the 5'-ends of in vivo t r a n s c r i p t s i s compared with known b a c t e r i a l promoters. The lexA and rr n E l PI -10 and -35 hexamers are given f o r comparison with corresponding cenC sequences. Putative cenC mRNA st a r t s i t e s are shown i n bold l e t t e r s . -35 -10 A C C G A A A C G A T T C G G T C C G G T G C G C A C G C T T C C G C G G G C G C C G C G G C C G T G C C T A C C C T G C C G C C G C A G C A C C G G C 18bp l e x A TTCCAA 17bp TAT ACT r r n E l P l TTGCGG 16bp TATAAT 82 FIGURE 25. Scheme used for the preparation of the probe for the 3'-cenC t r a n s c r i p t mapping. The Smal/Hindlll fragment from pTZ18R-8/5 was f i r s t subcloned into pTZ18R ( to give pTZ18R-8/5-4 ) and digested with Mlul. The 3'-ends were labeled by a f i l l - i n reaction using Klenow enzyme plus dGTP and CC-32P-dCTP. After digestion with H i n d l l l , the 650bp Ml u l / H i n d l l l fragment was isolated as described i n the legend to Fig.21. The black boxes represent parts of the multiple cloning s i t e of pTZ18R; the stippled boxes indicate C.fimi DNA. The following r e s t r i c t i o n enzyme sit e s are indicated: B, BamHI, H3, H i n d l l l , M, Mlul, Sm, Smal, Ss, SstI, and RI, EcoRI. 83 Rl Ss M fa Smal Hindl l l pTZ18R Mlul 32 •Klenow, a - P-dCTP, dGTP Hindl l l PAGE H3 3?_ -5 ' 550bp 84 estimated size of cenC and i t s l o c a l i z a t i o n i n the plasmid pTZ18R-8/5. The autoradiogram of the SI nuclease protection experiment revealed two major protected fragments and a smear of fragments of smaller size ( Fig.26 ). Again the RNA-DNA hybrids might have been overdigested with the nuclease. The two major bands mapped to two guanosine nucleotides depicted i n bold l e t t e r s on the d i s t a l end of the pTZ18R-8/5 i n s e r t ( Fig.27 ). The 3'-ends of the t r a n s c r i p t s were located very close to the o r i g i n a l cloning s i t e of the C.fimi insert adjacent to the l e f t arm of L47.1, indicating that the e n t i r e gene for CenC was contained on the plasmid pTZ18R-8/5. The lengths of the t r a n s c r i p t s were approximately 3.4kb. Palindromic sequences which are postulated to function as t r a n s c r i p t i o n a l terminators are underlined by arrows i n Fig.27. The putative t r a n s l a t i o n a l stop codon ( TGA ) can be v e r i f i e d once the entire sequence of cenC i s known. III. 4. Overproduction of CenC in E . c o l i III.4.1. Construction of pTZP-cenC None of the subclones of cenC expressed s i g n i f i c a n t CMCase a c t i v i t y as measured i n the DNS-CMCase assay. The clone JM1 0 1 [pTZ 1 8R-8 ] when i n d u c e d " w i t h i s o p r o p y l - ( 3 - D -thiogalactopyranoside ( IPTG ) was most active with a s p e c i f i c a c t i v i t y of 0.008 u/mg p r o t e i n ( units i n jlmoles glucose equivalents per minute ) for t o t a l soluble c e l l extract proteins. Based on the s p e c i f i c a c t i v i t i e s of the p u r i f i e d C3 enzymes, a one l i t r e culture of JM[pTZ18R-8] grown to an O D g g o o f 1-° would produce less than 5 |lg of CenC. Therefore, i t was necessary to c o n s t r u c t a b e t t e r expression system to f a c i l i t a t e the p u r i f i c a t i o n of large quantities of CenC. The e f f i c i e n c y of expression of recombinant genes depends on 85 FIGURE 26. Mapping of 3'-ends of C.fimi t r a n s c r i p t s . The 3'-end labeled DNA probe was hybridized to ei t h e r t o t a l C.fimi RNA ( lane 1 ) or yeast tRNA ( lane 2 ) and digested with S I nuclease p r i o r to electrophoresis on polyacrylamide g e l . DNA standards ( M ) as in Fig.22. M 341 338= * » 3 0 9 " -1 6 9 - — 1 5 8 - » 1 2 1 1 7 -1 0 6 - — 9 8 - -6 9 -86 FIGURE 27. Nucleotide sequence at the 3'-end of cenC. The putative t r a n s l a t i o n a l stop codon ( TGA ) of cenC i s shown in bold l e t t e r s . The two s o l i d , v e r t i c a l arrows in d i c a t e the nucleotides corresponding to the 3'-ends of the in vivo cenC t r a n s c r i p t s . The l o c a t i o n s of palindromic sequences are underlined by arrows. The cloning s i t e ( Sau3A/BamHI ) of C.fimi DNA into the l e f t arm of lambda L47.1 i s indicated i n bold l e t t e r s and underlined. 5 ' —>3 • GGGCGAGGCCGGCGCGGACGGCGGTGGCGCGTAC7AACGACTCCCAGGT 3'-end of canC transcripts GGCCGACGAGTTCTACTGGGCGGCCGCGAGCTCTACCTGACGACSGfiCGAGGGCGCGTGCCGTGTTCCGCGCGGCCGCCGACGGGTACCCACGCCTG CGTCGTGTGGCAGGTGCGGTGGGGCGGCGGGAGCTGGCGGCCCfiaiCCGCCTACCrrrCAGCAGrrGCGCAGrr Lambda L-47.1 DNA Sau3A / BamH I 88 several factors. Besides the copy number of the gene, the strength of the promoter on the expression vector i s an important consideration. In addition, the degree of recognition by the host of heterologous t r a n s l a t i o n a l regulatory sequences and t h e i r spacing r e l a t i v e to the t r a n s l a t i o n a l i n i t i a t i o n codon contributes to the e f f i c i e n c y of expression. Other factors such as codon usage by the host, messenger RNA s t a b i l i t y and t o x i c i t y of the recombinant product may also play an important role. I found the lac promoter-operator system ( l a c p/o ) suitable for the construction of an e f f i c i e n t cenC expression system. Besides providing a r e l a t i v e l y strong promoter, the expression of any gene under i t s control i s regulated i n an appropriate host ( e.g. the E.coli s t r a i n JM101 which expresses high l e v e l of the la c repressor protein c o n s t i t u t i v e l y ) . In case the recombinant p r o t e i n i s t o x i c f o r the host, the c e l l s are grown up under repressed conditions. Addition to the culture medium of IPTG w i l l induce expression and the recombinant protein w i l l be synthesized. The synthetic portable t r a n s l a t i o n i n i t i a t i o n s i t e ( PTIS ) was s p e c i a l l y designed for optimal function i n E.coli ( deBoer et al., 1983 ) . When fused to the gene to be expressed, the i n i t i a t i o n of t r a n s l a t i o n occurs with high e f f i c i e n c y , thus providing optimal conditions for the expression of cenC. Fig.28 outlines the strategy for the construction of pTZP-cenC. The PTIS fragment, which also provided the ATG start codon, had to be fused i n frame to the second codon, GTT, of the leader sequence of cenC. The double stranded DNA fragment corresponding to the 5'-end of cenC was synthesized by primer extension using primer-8/5, which hybridized to codons 2 to 7 of the leader sequence. This fragment was fused by blunt-end l i g a t i o n to the ATG of the PTIS in pTZ18R-PTIS ( Fig.29 ). JM101 transformants were screened i n a c o l o n y - f i l t e r l i f t hybidization assay using 32p_]_ ab e]_ e cj J Q . 3A , and 89 FIGURE 28. Construction of pTZP-cenC. The black boxes represent the multiple cloning s i t e ( or part of i t ) of pTZ18R, the l i g h t l y - s t i p p l e d boxes indicate the PTIS sequence, and C.fimi DNA containing cenC or part of i t i s represented by d a r k - s t i p p l e d boxes. The f o l l o w i n g r e s t r i c t i o n enzyme s i t e s are i n d i c a t e d : B, BamHI, H3, H i n d l l l , Rl, EcoRI, and Ss, SstI. B/bl with b l standing for blunt-end, denotes the fusion point of cenC with PTIS. A: PTIS was l i g a t e d into the BamHI and EcoRI s i t e s of pTZ18R. The construct ( pTZ18R-PTIS ) was confirmed by sequence analysis. B: The 900bp EcoRI/BamHI fragment, encoding the cenC-leader peptide and part of the mature CenC sequence, was subcloned from pTZ18R-8/5 into pTZ18R to give pTZ18R-S/B. C: In frame fusion of the cenC coding sequence to the ATG of PTIS i n pTZ18R-PTIS r e s u l t i n g i n pTZl8R-PTIS-5 1 ( see Fig.29 ). D: The 3.5kb BamHI/Hindlll fragment of pTZ18R-8/5 coding for the C-terminus and most part of CenC ( complementing the cenC sequence i n pTZ18R-PTIS-5' ) was i s o l a t e d and cloned into pTZ18R-PTIS-5 1 to complete the construction of pTZP-cenC. Competent JM101 c e l l were transformed and the r e s u l t i n g recombinant clones were screened for CMCase a c t i v i t y i n the Congo red plate assay. P o s i t i v e clones ( JM101[pTZP-cenC] ) were further analyzed ( see below ). pTZP-cenC 91 FIGURE 29. Construction of PTIS-cenC fu s i o n by primer extension. Primer-8/5 was annealed to single stranded pTZ18R-S/B DNA. The sequence of the synthetic primer corresponded to the second codon and extended over the consecutive fiv e codons of the leader sequence of cenC. Subsequently, double stranded DNA was synthesized by primer extension using Klenow enzyme and deoxynucleotides. In the next step, the single stranded gaps were eliminated by Mung Bean nuclease treatment. The DNA was d i g e s t e d with H i n d l l l , and the r e s u l t i n g b l u n t -e n d / H i n d l l l fragment, encoding the N-terminus of the unprocessed CenC, was i s o l a t e d and cloned into pTZ18R-PTIS. For t h i s step ( p r i o r to c l o n i n g ) , pTZ18R-PTIS was l i n e a r i z e d with BamHI and treated with Mung Bean nuclease to provide a PTIS sequence with flush ends right a f t e r the ATG. The vector was further digested with H i n d l l l , i s o l a t e d and used for the construction of pTZ18R-PTIS-5' as described above. Recombinant JM101 clones were subsequently screened by c o l o n y - l i f t f i l t e r hybridization with 32p_i ak e;L e ci J O . 3 A . The correct fusion construct was confirmed by sequence analysis. 92 D T Z 1 8 R - P T I S BamHI 5'->3' TATATGGGAATTCGGAGGAAAAAATTATG ATATACCCTTAAGCCTCCTTTTTTAATACCTAG lacz' PTIS - Mung Bean nuclease - Hindlll pTZI8R-S/B ss plasmid DNA primer-8/5 primer-8/5 GTTTCTCGCAGGTCATCA CCTCTGTCTCACCAAAGAGCGTCCAGTAGTGTCCGC etc. 3'->5' • start codon cenC leader - Klenow, dNTP's - Mung Bean nuclease Hindlll ->3' f PTIS TATAGGGAATTCGGAGGAAAAAATTATG G T T T C T C G C etc . P T Z 1 8 R - P T I S - 5 ' lacz' RBS start codon cenC leader 93 t h e f u s i o n c o n s t r u c t ( p T Z 1 8 R - P T I S - 5 ' ) was c o n f i r m e d b y s e q u e n c e a n a l y s i s . F i n a l l y , t h e m i s s i n g 3 ' - r e g i o n o f cenC was c l o n e d i n t o p T Z 1 8 R - P T I S - 5 1 t o c o m p l e t e t h e c o n s t r u c t o f pTZP-cenC. I n i t i a l a t t e m p t s t o s y n t h e s i z e t h e f u l l l e n g t h o f cenC ( e x c e p t s t a r t c o d o n GTG ) b y p r i m e r e x t e n s i o n f a i l e d . The p r i m e r - 8 / 5 was s u b s e q u e n t l y t e s t e d f o r i t s s p e c i f i c i t y i n p r i m i n g s e q u e n c i n g r e a c t i o n s i n pTZ18R-8/5. The s e q u e n c i n g r e s u l t s i n d i c a t e d m u l t i p l e p r i m i n g w h i c h e x p l a i n e d t h e d i f f i c u l t i e s i n g e t t i n g f u l l - l e n g t h , d o u b l e - s t r a n d e d cenC DNA. The p r o b l e m o f m u l t i p l e p r i m i n g was s o l v e d b y s u b c l o n i n g t h e 5'- e n d o f cenC ( a p p r o x . 250bp ) i n t o pTZ18R p r i o r t o p r i m e r e x t e n s i o n . I I I . 4 . 2 . C h a r a c t e r i z a t i o n o f t h e e x p r e s s i o n o f cenC i n JM101[pTZP-cenC] The c l o n e J M 1 0 1 [ p T Z P - c e n C ] d i d n o t grow on LB p l a t e s c o n t a i n i n g 10 0|lg o f a m p i c i l l i n / m l a n d s u p p l e m e n t e d w i t h IPTG ( ImM ) when i n c u b a t e d a t 37°C. O n l y a t 30°C o r b e l o w was g r o w t h p o s s i b l e b u t s t i l l a t a r e d u c e d r a t e c o m p a r e d t o t h e c o n t r o l c l o n e J M 1 0 1 [ p T Z 1 8 R ] . A p p a r e n t l y , t h e i n c r e a s e d e x p r e s s i o n o f cenC h a d a d e l e t e r i o u s e f f e c t on c e l l g r o w t h . I n l i q u i d c u l t u r e t h i s c l o n e c o u l d o n l y be n o r m a l l y p r o p a g a t e d by o m i t t i n g IPTG ( r e p r e s s i o n o f e x p r e s s i o n o f cenC ) a n d d e c r e a s i n g t h e c u l t u r e t e m p e r a t u r e t o 30°C. S e v e r a l s u b c l o n e s , i n c l u d i n g JM101[pTZP-cenC] were c o m p a r e d w i t h e a c h o t h e r f o r t h e i r a c t i v i t y i n t h e C o n g o r e d p l a t e a s s a y ( F i g . 3 0 ) . A l t h o u g h t h e s i z e o f t h e c o l o n i e s o f J M 1 0 1 [ p T Z P - c e n C ] w e r e m a r k e d l y s m a l l e r t h a n t h e o t h e r s , t h e i n c r e a s e i n a c t i v i t y was s t r i k i n g . Q u a n t i t a t i o n o f t h e s p e c i f i c a c t i v i t y o f t o t a l c e l l -e x t r a c t p r o t e i n s b y t h e DNS-CMCase a s s a y r e v e a l e d a n a p p r o x . 4 0 - f o l d i n c r e a s e i n e x p r e s s i o n i n a n i n d u c e d J M 1 0 1 [ p T Z P - c e n C ] 94 FIGURE 30. Congo red plate assay. Four different JM101 clones were analyzed for t h e i r r e l a t i v e CMCase a c t i v i t i e s . The clones contained the following plasmid constructs ( from top to bottom ): pTZ18R ( no insert ), pTZ18R-8, pTZ18R-8/5 and pTZP-cenC. The colonies were grown overnight at 30°C on LB plates supplemented with ampicillin and IPTG. 95 c u l t u r e v e r s u s a n i n d u c e d c u l t u r e o f J M 1 0 1 [ p T Z 1 8 R - 8 ] ( T a b l e V I I ) . , T a b l e V I I I i l l u s t r a t e s t h e t o x i c e f f e c t o f i n d u c e d e x p r e s s i o n o f cenC on J M 1 0 1 [ p T Z P - c e n C ] c e l l s i n c u l t u r e . 5 h o u r s a f t e r a d d i t i o n o f I P T G t h e number o f c e l l s h a d o n l y d o u b l e d w h i l e t h e v i a b i l i t y o f t h e c e l l s h a d d r o p p e d b e l o w 5%. C e l l s i n s t a t i o n a r y p h a s e a f t e r 24 h o u r s i n c u b a t i o n d i d n o t e x p r e s s CMCase a c t i v i t y i n t h e C o n g o r e d p l a t e a s s a y , a n d w e r e s e n s i t i v e t o a m p i c i l l i n , s u g g e s t i n g t h a t t h e y h a d l o s t p l a s m i d p T Z P - c e n C . The c e l l s w e r e s e n s i t i v e t o phage T4, p r o v i n g them t o be E.coli. The t i m e c o u r s e o f e x p r e s s i o n o f c e n C u n d e r i n d u c e d a n d n o n -i n d u c e d c o n d i t i o n s i s shown i n F i g . 3 1 . O v e r p r o d u c t i o n o f CenC c l e a r l y i n h i b i t e d t h e g r o w t h o f t h e c e l l s . The i n d u c e d c u l t u r e r e a c h e d i t s h i g h e s t c e l l d e n s i t y a f t e r 2 1/2 h o u r s w h e r e a s t h e c o n t r o l c u l t u r e was s t i l l i n t h e e x p o n e n t i a l p h a s e . The maximum s p e c i f i c CMCase a c t i v i t y was r e a c h e d a f t e r 1 1/2 h o u r s a n d o n l y s l i g h t l y d e c r e a s e d t h e r e a f t e r , i n d i c a t i n g t h a t t h i s c u l t u r e c e a s e d t o p r o d u c e CenC a f t e r 1 1/2 h o u r s a n d t h a t t h e r e c o m b i n a n t c e l l u l a s e r e m a i n e d f a i r l y s t a b l e . I n a d d i t i o n , u n d e r t h e p h a s e c o n t r a s t m i c r o s c o p e we n o t e d a d i s t i n c t d i f f e r e n c e i n s i z e a n d s h a p e o f i n d u c e d v e r s u s u n i n d u c e d c e l l s . We t h o u g h t t o d e t e c t d e n s e l y p a c k e d , g r a n u l a r m a t e r i a l i n t h e c y t o p l a s m o f t h e s e c e l l s when i n d u c e d w i t h I P T G . A s i m i l a r p h e n o m e n o n was o b s e r v e d w i t h a c l o n e o v e r e x p r e s s i n g t h e e x o g l u c a n a s e g e n e , cex, i n E.coli ( O ' N e i l l e t al., 1986b ) . A s i m p l e p r o t o c o l f o r t h e p u r i f i c a t i o n o f t h e s e C e x g r a n u l e s t o g e t h e r w i t h e f f i c i e n t e x p r e s s i o n o f cex p r o m i s e d t o p r o v i d e an o p t i m a l s y s t e m f o r t h e o v e r p r o d u c t i o n a n d i s o l a t i o n o f t h e r e c o m b i n a n t e x o g l u c a n a s e . H o w e v e r , o n l y d r a s t i c m e a s u r e s c o u l d p a r t i a l l y r e - d i s s o l v e t h e C e x a g g r e g a t e s a n d t h e r e c o v e r e d a c t i v i t y was m a r g i n a l . E l e c t r o n m i c r o s c o p i c a n a l y s i s o f 96 TABLE V I I . E n d o g l u c a n a s e a c t i v i t i e s o f v a r i o u s cenC c l o n e s . The c e l l s w e r e g r o w n i n LB p l u s 100|!g o f a m p i c i l l i n / m l a t 30°C t o an ODggo o f 1 - 0 . IPTG was a d d e d t o a f i n a l c o n c e n t r a t i o n o f ImM where i n d i c a t e d , a n d i n c u b a t i o n c o n t i n u e d f o r a n o t h e r 1I/2I1. The s o l u b l e c e l l e x t r a c t p r o t e i n s were i s o l a t e d b y p a s s i n g t h e c e l l s t h r o u g h a F r e n c h p r e s s , a n d r e m o v i n g i n s o l u b l e m a t e r i a l b y c e n t r i f u g a t i o n . The c e l l e x t r a c t s w e r e a s s a y e d f o r CMCase a c t i v i t i e s b y t h e DNS-CMCase a s s a y . 1 u n i t c o r r e s p o n d s t o 1 (Imole g l u c o s e e q u i v a l e n t s p r o d u c e d p e r m i n u t e . c l o n e IPTG ( ImM ) s p e c i f i c a c t i v i t y ( u/mg p r o t e i n ) JM101[pTZ18R-8] + 0.008 JM101[pTZP-cenC] 0.030 JM101[pTZP-cenC] + 0 .350 97 TABLE V I I I . Effect of IPTG on growth and v i a b i l i t y of JMlOi[pTZP-cenC]. 50 ml volumes of culture medium containing 100 U. g ampicillin/ml were inoculated with JM101 [pTZP-cenC] from a g l y c e r o l stock. The growth of the cultures were monitored by measuring the o p t i c a l density at 600nm. Numbers of c e l l s ( #cells ) were counted i n a Petroff-Hauser cytometer. To evaluate the CMCase a c t i v i t y of c e l l s i n the cultures, a number of single colonies were screened by the Congo red plate assay. The v i a b i l i t y of the c e l l s i n the culture was determined by comparing the number of c e l l s ( #cells ) with t h e i r a b i l i t y to form colonies on LB, a m p i c i l l i n plates. JM101[pTZP- cenC ] induced with IPTG (1mM) culture-time in hrs. OD(600nm) #cells / ml culture r % total Amp -colonies with haloes % viable cells on LB, Amp 0 0.04 3.5 x 1 0 7 67 100 2 0.24 4.0 x 10 7 63 5 5 0.24 8.0 x 1 0 7 60 < 5 24 6.70 1.3X10 1 0 <0 .1 <0 .1 JM101 [pTZP- cenC ] uninduced (control) 0 0.04 3.2 x 10 7 73 100 2 0.45 2.1 x 1 08 80 nd 5 5.70 4 . 2 x 1 0 9 82 nd 24 6.90 10 1.6 x 10 85 > 9 0 98 FIGURE 3 1 . G r o w t h a nd a c t i v i t y p r o f i l e s o f JM1 0 1 [ p T Z P - c e n C ] . A t 0 h o u r s , IPTG was e i t h e r o m i t t e d o r a d d e d ( ImM f i n a l c o n c e n t r a t i o n ) t o a c u l t u r e o f JM101[pTZP-cenC] a t an ODggo o f 0.8. The c e l l s w e r e i n c u b a t e d a t 30°C i n a r o t a r y w a t e r b a t h . D u r i n g a c u l t u r e p e r i o d o f 5 h o u r s , s a m p l e s were t a k e n t o m e a s u r e t h e ODggo ( o-o, p l u s IPTG; x - x , no IPTG ) a n d t o d e t e r m i n e t h e s p e c i f i c a c t i v i t i e s i n t h e t o t a l c e l l e x t r a c t s ( s t i p p l e d b a r s , p l u s IPTG; c r o s s - h a t c h e d b a r s , no IPTG ) . CMCase a c t i v i t y was d e t e r m i n e d i n t h e DNS-CMCase a s s a y . U n i t s ( u ) a r e i n (imoles g l u c o s e e q u i v a l e n t s p r o d u c e d p e r m i n u t e . 99 100 J M 1 0 1 [ p T Z P - c e n C ] a l s o s u g g e s t e d t h e i n t r a c e l l u l a r a c c u m u l a t i o n o f CenC ( F i g . 3 2 ) . The r e c o m b i n a n t m a t e r i a l seemed t o a g g r e g a t e a r o u n d t h e c h r o m a t i n ( s e e a r r o w s ) c a u s i n g t h e chromosome t o be c o m p r e s s e d . The c e l l g r o w t h s t u d i e s t o g e t h e r w i t h t h e d a t a f r o m t h e e l e c t r o n m i c r o s c o p i c a n a l y s i s s u g g e s t t h a t i n t r a c e l l u l a r CenC b i n d s t o a n d a g g r e g a t e s a t t h e chromosome, l e a d i n g t o i n t e r r u p t i o n o f c e l l d i v i s i o n a n d , u l t i m a t e l y , t o c e l l d e a t h . T h i s w o u l d e x p l a i n why i n i t i a l c l o n i n g e x p e r i m e n t s o f cenC b a s e d on e x p r e s s i o n o f a c t i v i t y f a i l e d t o p r o d u c e h i g h l y a c t i v e c l o n e s . E.coli i s n o t r e g a r d e d a s an o p t i m a l s y s t e m f o r h i g h - l e v e l e x p r e s s i o n o f s e c r e t e d p r o t e i n s . The o n l y n a t u r a l p r o t e i n s e c r e t e d i n t o t h e medium by E.coli i s h e m o l y s i n ( H o l l a n d e t al., 1986 ) . I was i n t e r e s t e d i n s e e i n g how e f f i c i e n t l y J M 1 0 1 [ p T Z P - c e n C ] p r o c e s s e d a n d t r a n s p o r t e d t h e r e c o m b i n a n t c e l l u l a s e i n t o t h e p e r i p l a s m . T a b l e I X s u m m a r i z e s t h e CMCase a c t i v i t y p r o f i l e o f CenC i n d i f f e r e n t c e l l u l a r c o m p a r t m e n t s . T h e a c t i v i t e s a n d d i s t r i b u t i o n s o f p e r i p l a s m i c a n d c y t o p l a s m i c m a r k e r enzymes ( 0-l a c t a m a s e a n d g l u c o s e - 6 - P - D H , r e s p e c t i v e l y ) were u s e d t o d e t e c t c r o s s - c o n t a m i n a t i o n o f t h e two f r a c t i o n s . The f u l l y i n d u c e d c e l l s seemed t o be more f r a g i l e s i n c e t h e p r e p a r a t i o n o f t h e s e c e l l s f o r t h e o s m o t i c s h o c k t r e a t m e n t r e s u l t e d i n a 50% l o s s o f (3-lactamase a c t i v i t y . However, an e q u i v a l e n t l o s s o f CMCase a c t i v i t y was n o t o b s e r v e d . The h i g h m o l e c u l a r w e i g h t o f CenC t o g e t h e r w i t h i t s p o t e n t i a l t o f o r m a g g r e g a t e s , t h e r e b y g e t t i n g t r a p p e d i n t h e p e r i p l a s m i c s p a c e , c o u l d e x p l a i n t h e d i s c r e p a n c y . U n l i k e t h e s e c r e t i o n o f e x o g l u c a n a s e i n t o t h e c u l t u r e medium b y a " l e a k y " m u t a n t ( G i l k e s e t al., 1984c ) , h a r d l y any CMCase a c t i v i t y c o u l d b e r e c o v e r e d f r o m J M 1 0 1 [ p T Z P - c e n C ] c u l t u r e m e d i u m . The i n t r a c e l l u l a r d i s t r i b u t i o n ( c y t o p l a s m v e r s u s p e r i p l a s m ) o f c e l l u l a s e a c t i v i t y i n d i c a t e d t h e l i m i t e d c a p a c i t y o f J M 1 0 1 [ p T Z P -c e n C ] t o t r a n s p o r t CenC a c r o s s t h e p l a s m a membrane ( s e e c o n t r o l c u l t u r e i n T a b l e I X ) . R e g a r d l e s s o f t h e i n d u c t i o n s t a t e o f t h e s e 101 FIGURE 32. E l e c t r o n micrographs of JM101[pTZP-cenC] c e l l s . C u l t u r e s of JM101[pTZP-cenC] were e i t h e r induced w i t h IPTG ( panel B ) or grown under repressed c o n d i t i o n s ( panel A ). A f t e r embedding the c e l l s i n Epon 812 epoxy r e s i n , the c r o s s -s e c t i o n s were prepared by ultramicrotomy. The m a g n i f i c a t i o n was 20,000-fold. A no induction B induction 102 TABLE I X . L o c a l i z a t i o n o f C e n C - a c t i v i t y i n JM101[pTZP-cenC]. C e l l s were grown i n t h e p r e s e n c e o r a b s e n c e o f IPTG. A c t i v i t y o f CenC was d e t e r m i n e d i n t h e DNS-CMCase a s s a y , a: numbers i n u/ml c e l l c u l t u r e ; l u n i t r e p r e s e n t s l n m o l e p r o d u c t s f o r m e d ( CMC-r e d u c i n g e n d s , n i t r o c e f o i c a c i d , NADH2 ) p e r m i n u t e , b: r e c o v e r y o f a c t i v i t y ( % ) w i t h r e s p e c t t o t o t a l c e l l e x t r a c t . cell culture enzyme assayed total cell extract periplasmic fraction cytoplasmic fraction JM101[pTZP-cenC] plus IPTG ( 1 mM ) CenC a 1 2 3 b ( 1 0 0 ) 7 2 ( 5 9 ) 5 1 ( 4 1 ) P -lactamase 1 3 2 ( 1 0 0 ) 5 4 ( 4 1 ) 1 0 ( 8 ) glucose-6 -P-DH 4 . 1 9 ( 1 0 0 ) 0 . 4 0 ( 9 ) 2 . 7 1 ( 6 5 ) JM101[pTZP-cenC] no IPTG CenC 7 . 7 ( 1 0 0 ) 4 . 5 ( 5 8 ) 2 . 5 ( 3 2 ) P -lactamase 2 0 1 ( 1 0 0 ) 1 4 2 ( 7 1 ) 1 5 ( 8 ) glucose-6 -P-DH 4 . 8 4 ( 1 0 0 ) 0 . 5 4 ( 1 1 ) 3 . 1 9 ( 6 6 ) 103 c e l l s , approx. 60% of the t o t a l a c t i v i t y was accumulated in the periplasmic compartment. The i n t r a c e l l u l a r d i s t r i b u t i o n of the recombinant cellu l a s e was examined further by SDS-PAGE ( Fig.33 ) . The appearence of a dominant ( >10% of t o t a l c e l l u l a r p r o t e i n ) , slow migrating protein band i n the cytoplasm correlated with the overexpression of cenC. Its apparent molecular weight, however, was ~10kDa larger than f o r C3.1. Since leader peptide processing of soluble secretory proteins i s coupled with t h e i r translocation across the plasma membrane, t h i s f i n d i n g suggests the c y t o p l a s m i c accumulation of unprocessed CenC. Protein bands with s i m i l a r molecular weights as C3.1 or C3.2 were not detected i n the periplasmic fracti o n ( lane 2c ). The electrophoresis data c l e a r l y disagree with the i n t r a c e l l u l a r d i s t r i b u t i o n pattern of CMCase a c t i v i t y ; a f i n d i n g which could be explained by postulating that unprocessed CenC has a considerably lower s p e c i f i c a c t i v i t y than the exported cell u l a s e . III.5. I n i t i a l characterization of purif i e d , recombinant CenC III.5.1. P u r i f i c a t i o n of recombinant CenCl and CenC2 Pri o r to the detailed characterization of recombinant CenC, i t was necessary to devise a simple p u r i f i c a t i o n scheme. Table X describes the protocol chosen for the p u r i f i c a t i o n and l i s t s the flow-chart data. Since the larger portion of the t o t a l CMCase a c t i v i t y resided in the periplasmic fraction, the osmotic shockate of a JM101[pTZP-cenC] culture was used as s t a r t i n g material. The f i r s t p u r i f i c a t i o n step employed immunoadsorption chromatography on an affigel-10-rabbitaC3.2 column. Preliminary data indicated 104 F I G U R E 33. SDS-PAGE a n a l y s i s o f p r o t e i n s a m p l e s f r o m d i f f e r e n t c o m p a r t m e n t s o f JM101[ p T Z P - c e n C ] . C e l l s were grown e i t h e r i n t h e a b s e n c e ( l a n e s l a , b , c ) o r p r e s e n c e ( l a n e s 2a,b,c ) o f ImM IPTG. Whole c e l l e x t r a c t p r o t e i n s ( l a n e s l a , 2a ) , c y t o p l a s m i c p r o t e i n s ( l a n e s l b , 2b ) o r p e r i p l a s m i c p r o t e i n s ( l a n e s l c , 2c ) were e l e c t r o p h o r e s e d . A l l l a n e s were l o a d e d w i t h a m o unts o f p r o t e i n s s t a n d a r d i z e d t o t h e c u l t u r e v o l u m e , e x c e p t o f l a n e 2c ( 5 - f o l d e x c e s s i n o r d e r t o d e t e c t h i g h m o l e c u l a r w e i g h t p r o t e i n s ) . L a n e s 3 a n d 4 : a l i q u o t e s o f p u r i f i e d C3.1 and C3.2. 105 TABLE X. F l o w - c h a r t o f t h e p u r i f i c a t i o n o f C e n C l a n d CenC2. The s t a r t i n g m a t e r i a l f o r t h e p u r i f i c a t i o n was t h e o s m o t i c s h o c k a t e ( 1 l i t r e ) o f a 5 l i t r e c u l t u r e o f JM101[pTZP-cenC] grown a t 30 °C t o OD(600nm) o f 1.0 a n d s u b s e q u e n t l y i n d u c e d w i t h ImM IPTG f o r 1 1/2 h o u r s , a: u n i t s i n U. m o l e s g l u c o s e e q u i v a l e n t s p r o d u c e d p e r m i n u t e . T o t a l a c t i v i t y : a c t i v i t y i n u n i t s r e c o v e r e d a f t e r e a c h p u r i f i c a t i o n s t e p . purification steps total protein (mg) activity a (u/ml) spec, activity (u/mg prot.) total activity recovery of activity (%) osm. shockate (cone.) 74.2 1.79 1.3 95.0 100 affigel-10aC3.2 (1M NaSCN) 0.66 5.15 51.5 34.0 36 MonoQ ngCenCI 0.050 3.53 278.0 13.9 15 MonoQ ngCenC2 0.025 2.85 390.0 10.1 11 106 t h a t CenC was s e n s i t i v e t o low pH ( g l y c i n e - b u f f e r , pH=2.5, ) and h i g h s a l t c o n c e n t r a t i o n s ( NaSCN > 1.5M ). To a v o i d i n a c t i v a t i o n o f CenC, 1. OM NaSCN was chosen as t h e e l u a n t , a l t h o u g h the r e c o v e r y of a c t i v i t y was r a t h e r low ( 36% ). By analogy w i t h the p u r i f i c a t i o n o f C3.1 and C3.2, the CenC a c t i v i t y was f u r t h e r p u r i f i e d by MonoQ chromatography. We were s u r p r i s e d t o f i n d a s i m i l a r e l u t i o n p r o f i l e as f o r the n a t i v e enzymes: two c l o s e l y spaced e l u t i o n peaks w i t h CMCase a c t i v i t y . The v a l u e s f o r the s p e c i f i c a c t i v i t i y o f the two p r e p a r a t i o n s , d e s i g n a t e d as CenCl and CenC2, were comparable w i t h the r e s p e c t i v e numbers f o r C3.1 and C3.2 ( see Tables I I I and X ). The p u r i t y of the CenCl and CenC2 p r e p a r a t i o n s was examined by SDS-PAGE ( Fig.34 ). A f t e r the a f f i n i t y chromatography step, two h i g h m o l e c u l a r weight p r o t e i n bands were d e t e c t e d , which co-m i g r a t e d w i t h C3.1 and C3.2. These two bands ( CenCl and CenC2 ) presumably r e p r e s e n t e d the processed isozymes of the c y t o p l a s m i c , recombinant CenC. Lanes d and e were o v e r l o a d e d w i t h samples of the MonoQ p u r i f i e d CenCl and CenC2 p r e p a r a t i o n s t o v e r i f y t h e i r p u r i t y . III.5.2. Amino a c i d sequence a n a l y s i s of CenCl and CenC2 The p u r i t y of the two recombinant c e l l u l a s e p r e p a r a t i o n s allowed t h e i r N-terminal amino a c i d sequences to be analyzed. 10 PTH-amino a c i d c y c l e s were performed f o r each sample ( data not shown ). The r e s u l t s proved t h a t CenCl and CenC2 had the same amino-terminus. Furthermore, the sequence corresponded t o the amino-termini of C3.1 and C3.2. From these data i t can be concluded t h a t E.coli not only exported the two recombinant isozymes but a l s o recognized the same leader-peptidase cleavage s i t e as C.fimi. The q u e s t i o n remains as to how one gene can encode two p r o t e i n s 107 FIGURE 34. SDS-PAGE a n a l y s i s o f C e n C l a n d CenC2. F r a c t i o n s were a n a l y z e d a t v a r i o u s s t a g e s d u r i n g t h e p u r i f i c a t i o n o f t h e r e c o m b i n a n t c e l l u l a s e s . L a n e a: t o t a l c e l l e x t r a c t p r o t e i n s f r o m i n d u c e d J M 1 0 1 [ p T Z P - c e n C ] c e l l s ; l a n e b: p e r i p l a s m i c f r a c t i o n ( o s m o t i c s h o c k a t e ) ; l a n e c: e l u a t e f r o m the a f figel-10-rabbitocC3.2 column; lanes d and e: CenCl and CenC2 p r e p a r a t i o n s a f t e r MonoQ-FPLC c h r o m a t o g r a p h y ; l a n e s f a n d g: p u r i f i e d C3.1 a n d C3.2, r e s p e c t i v e l y . The g e l was s t a i n e d w i t h Coommassie b l u e . a b c d e f g 108 with d i f f e r e n t e l e c t r o p h o r e t i c m o b i l i t i e s . D i f f e r e n t i a l glycosylation can be ruled out since E.coli does not glycosylate exported p r o t e i n s . In addition, the s i m i l a r m o b i l i t i e s of the corresponding native and recombinant c e l l u l a s e s gave further evidence for the absence of glycosylation of the native enzymes by C.fimi. It would appear unlikel y that p r o t e o l y t i c cleavage i n the two species was responsible for the generation of these isozymes since prolonged incubation d i d not bring about a s h i f t from the higher to the lower molecular weight forms. The same argument rules out auto-proteolytic cleavage. However, i t has been reported that c e l l u l a s e genes from Schizophyllum commune give r i s e to multiple t r a n s c r i p t s of d i f f e r e n t sizes ( W i l l i c k and Seligy, 1985 ) . A s i m i l a r phenomenon i n our system would explain the unchanging protein r a t i o ( high to low molecular weight ) seen in the various c e l l u l a s e preparations. I f indeed cenC encoded two d i f f e r e n t s i z e classes of t r a n s c r i p t s , then the 3'-ends of the shorter transcripts would not have been detected i n my SI nuclease s t u d i e s because the h y b r i d i z a t i o n probe was too short. Unfortunately, the resolution of RNA species by Northern transfer a n a l y s i s i s generally i n s u f f i c i e n t for the separation of RNA fragments i n the size range of 3.5kb which d i f f e r i n g by only 250b. The e l e c t r o p h o r e t i c a n a l y s i s of in vitro t r a n s c r i p t i o n and t r a n s l a t i o n products encoded by pTZP-cenC could be used to examine t h i s question. In t h i s way the involvement of the host organism's post-translational processing system could be ruled out. III.6. F i n a l remarks The endoglucanases, C3.1 and C3.2, are not the main components of the c e l l u l o l y t i c system secreted by C.fimi. Furthermore, unlike CenA and Cex, the two cellulases are not substrate-associated when C.fimi i s grown on A v i c e l , suggesting that the natural substrates 109 for C3.1 and C3.2 are most l i k e l y soluble cellodextrans which are released from i n s o l u b l e c e l l u l o s e by the action of c e l l u l o s e -associated cellulases. C3.1 and C3.2 are c l o s e l y related to each other. Both enzymes were p u r i f i e d by the same p u r i f i c a t i o n scheme ( Fig.5 ). Their Mrs on SDS-PAGE were sim i l a r ( 130'000 for C3.1 and 120'000 for C3.2, see Fig.6 ). Amino acid sequence analyses showed that the enzymes share the same N-terminal sequence ( Table IV ). Furthermore, the values for the k i n e t i c parameters Km and Vmax, determined by a preliminary k i n e t i c analysis on pNPC as substrate, provided more evidence for t h e i r relatedness ( the Km was 0.13mM for both enzymes, and the Vmax values, i n (imoles per min per mg protein, were 0.39 and 0.50 for C3.1 and C3.2, respectively ). A C.fimi DNA-lambda l i b r a r y was constructed for the cloning of the gene(s) encoding the C3 enzymes. Recombinant phage p a r t i c l e s were, screened e i t h e r for expression of CMCase a c t i v i t y by the Congo red pla t e assay or for h y b r i d i z a t i o n with a s e l e c t i o n of s y n t h e t i c o l i g o n u c l e o t i d e probes by a p l a q u e - f i I t e r l i f t h ybridization assay. It was surprising that the a c t i v i t y screening assay did not detect any of the cenC-positive clones determined by cross-screeening with the C 3 - s p e c i f i c o l i g o n u c l e o t i d e probes ( Table VI ). It i s possible that the N-termini of the C3 enzymes are c r u c i a l for the expression of CMCase a c t i v i t y . In t h i s case, most truncated fusion proteins would be i n a c t i v e . In contrast, several CMCase active clones contained cenA sequences. Following the same l i n e of reasoning, t h i s finding can be explained by the data of the analysis from deletion mutants which indicated that the active s i t e of CenA resided i n the C-terminal portion of the c e l l u l a s e . In addition, computer analysis of the sequence upstream of the cenC s t a r t codon revealed several palindromic sequences which might i n t e r f e r e with the expression of t r a n s c r i p t i o n a l fusions by acting as t r a n s r i p t i o n a l terminators. Also, we know that the t r a n s c r i p t i o n a l regulatory sequences of C.fimi are .110 only poorly recognized by E.coli ( Wong et al., 1986a, Owolabi, 1988 ) . Consequently, recombinant lambda clones which were producing low numbers of fusion t r a n s c r i p t s would not be detected by the Congo red pl a t e assay. F i n a l l y , i n the l i g h t of the findings from the CenC overproducing clone ( JM101[pTZP-cenC], see below ), i t i s feasible that the production of CenC by recombinant lambda clones i n t e r f e r e d with the propagation of phage p a r t i c l e s and the formation of lambda plaques and, consequently, the corresponding clones could not be i d e n t i f i e d by the a c t i v i t y screening assay. The lambda c l o n e , L47.1-169, h y b r i d i z e d w i t h both o l i g o n u c l e o t i d e probe pools s p e c i f i c f or the N-terminal and i n t e r n a l sequences of C3 ( J0.3A and BM.C ) and was chosen for further characterization ( Table VI and Fig.11 ). The subclones, JM101[pTZ18R-8] and JM101[pTZ18R-8/5] ( Fig.15 ), containing a 7.7kb and a 4.3kb C.fimi DNA insert, respectively, only marginally expressed CMCase a c t i v i t y as determined by the DNS-CMCase assay ( Table VII; data not shown for JM101[pTZ18R-8/5] ). The location and boundaries of cenC in pTZ18R-8 were defined by analyses of in vivo C.fimi t r a n s c r i p t s . RNA-DNA hybrid protection analysis using SI nuclease led t o the i d e n t i f i c a t i o n of the 5'-and 3'-ends of cenC t r a n s c r i p t s and the l o c a t i o n of the corresponding s i t e s i n the insert of pTZ18R-8 ( Figs.24 and 27 ). The s i z e s of the t r a n s c r i p t s were i n the range of 3.4kb. In addition, by comparison with known b a c t e r i a l promoters, putative t r a n s c r i p t i o n a l regulatory sequences ( -10 and -35 hexamers ) were i d e n t i f i e d ( Fig.24 ). It i s int r i g u i n g that the postulated C.fimi promoter sequences for cex, cenA and cenB ( Greenberg et al., 1987a, Greenberg et al., 1987b ) and cenC do not reveal consensus sequences or s t r i k i n g s i m i l a r i t i e s . It should be emphasized, however, that no d e f i n i t e conclusions can be drawn from these data u n t i l the v a l i d i t y of these promoters has been confirmed by fu n c t i o n a l analyses ( ei t h e r by binding studies with p u r i f i e d I l l C.fimi RNA polymerase p r e p a r a t i o n s or by C.fimi t r a n s f o r m a t i o n experiments u s i n g an E.coli s h u t t l e v e c t o r ). The replacement of the C.fimi t r a n s c r i p t i o n a l and t r a n s l a t i o n a l r e g u l a t o r y sequences with an E.coli promoter and ribosomal b i n d i n g s i t e c o n s i d e r a b l y improved the e x p r e s s i o n of cenC. The e n t i r e c o d i n g sequence of cenC except f o r the GTG s t a r t codon was fused i n frame to the ATG of a s y n t h e t i c t r a n s l a t i o n i n i t i a t i o n sequence ( PTIS ). The t r a n s c r i p t i o n was p l a c e d under the c o n t r o l o f the l a c p/o system. The r e s u l t i n g c o n s t r u c t , JM101[pTZP-cenC], l e d t o the o v e r p r o d u c t i o n and c y t o p l a s m i c accumulation of CenC ( >10% of t o t a l c y t o p l a s m i c p r o t e i n s ) . Only a s m a l l f r a c t i o n o f the recombinant enzyme was e x p o r t e d i n t o the p e r i p l a s m of E.coli. F r a c t i o n a t i o n o f the c e l l s and a n a l y s i s of the f r a c t i o n s by SDS-PAGE r e v e a l e d a dominant band with a M r of approx. 140'000 i n the c y t o p l a s m i c f r a c t i o n but a co r r e s p o n d i n g p r o t e i n was not d e t e c t e d i n the p e r i p l a s m i c f r a c t i o n ( Fig.33 ) . Co n v e r s e l y , 60% o f the t o t a l CMCase a c t i v i t y was l o c a l i z e d i n the p e r i p l a s m ( Table IX ). Consequently, the s p e c i f i c a c t i v i t y o f the c y t o p l a s m i c CenC was e s t i m a t e d t o be s e v e r a l o r d e r s o f magnitude lower than the s p e c i f i c a c t i v i t y o f t h e p e r i p l a s m i c enzyme(s). S i n c e the estimated molecular weight of the cytoplasmic CenC was l a r g e r than the m o l e c u l a r weight of C3.1, I concl u d e d t h a t the recombinant p r o t e i n i n the cytoplasm represented the unprocessed form of CenC. The d i f f e r e n c e i n the M rs of the c y t o p l a s m i c enzyme and CenCl ( approx. 10'000 ) would account f o r more than the l e a d e r p e p t i d e of the CenC enzymes ( the M r of the 32 amino a c i d s l e a d e r p e p t i d e i s 3116 ) . However, I s h o u l d emphasize t h a t t h e M r o f the c y t o p l a s m i c CenC i s o n l y a rough e s t i m a t e ( see F i g . 32 ) . P r o t e o l y t i c p r o c e s s i n g o f the l e a d e r p e p t i d e and/or t r a n s p o r t a c r o s s the c y t o p l a s m i c membrane seem t o be a p r e r e q u i s i t e f o r e x p r e s s i o n of a c t i v i t y o f some p e r i p l a s m i c enzymes i n E.coli. Howver, i t i s g e n e r a l l y accepted t h a t E.coli i s not a good host f o r t h e e f f i c i e n t e x p o r t o f recombinant p r o t e i n s . C e r t a i n 112 c o n s t r u c t s e x p r e s s i n g cex and cenA a l s o l e d t o the i n t r a c e l l u l a r accumulation of recombinant p r o t e i n s ( O ' N e i l l et a l . , 1986b, Guo. Z.M., p e r s o n a l communication ). I t was i n t e r s t i n g t o note that the o v e r p r o d u c t i o n o f CenC i n JM101 [pTZP-cenC] i n t e r f e r e d w i t h c e l l d i v i s i o n and l e d u l t i m a t e l y t o c e l l death ( Tab l e V I I I ) . The growth r a t e of the c e l l s was slowed down even when the c e l l s were grown under r e p r e s s e d c o n d i t i o n s ( no IPTG added t o the c u l t u r e s ). Apparen t l y , even low l e v e l e x p r e s s i o n of cenC caused an i n h i b i t o r y e f f e c t on c e l l growth. The f r a c t i o n a t i o n o f CMCase a c t i v i t i e s from the p e r i p l a s m i c compartment of JM101[pTZP-cenC] l e d to the p u r i f i c a t i o n o f two recombinant c e l l u l a s e s , CenCl and CenC2. T h e i r molecular weights, as e s t i m a t e d by SDS-PAGE, c o r r e l a t e d with the v a l u e s f o r C3.1 and C3.2 ( Fig.34 ). In a d d i t i o n , the s p e c i f i c a c t i v i t i e s o f the n a t i v e and recombinant enzymes w i t h CMC as s u b s t r a t e were comparable ( Tables I I I and X ). N-terminal sequence a n a l y s i s of the CenC enzymes not onl y proved t h a t CenCl and CenC2 share the same N - t e r m i n i as the C3 enzymes but a l s o showed t h a t the E.coli l e a d e r p e p t i d a s e r e c o g n i z e d the same l e a d e r p e p t i d a s e cleavage s i t e as the c o r r e s p o n d i n g C.fimi enzyme. At t h i s stage i t i s not c l e a r what the mechanisms were which were r e s p o n s i b l e f o r the one gene-two p o l y p e p t i d e s phenomenon. The p r e l i m i n a r y b i o c h e m i c a l data f o r CenCl and CenC2 r u l e out p o s t - t r a n s l a t i o n a l m o d i f i c a t i o n s such as d i f f e r e n t i a l g l y c o s y l a t i o n and/or p r o t e o l y t i c p r o c e s s i n g as an e x p l a n a t i o n f o r the for m a t i o n of these isozymes. A n a l y s i s of i n v i t r o cenC t r a n s c r i p t s and t h e i r p r o d u c t s w i l l h e l p t o c l a r i f y t h i s question. The c o n s t r u c t i o n of the clone JM101[pTZP-cenC] provided a system f o r the a n a l y s i s o f the recombinant c e l l u l a s e s d e v o i d of other c o n t a m i n a t i n g c e l l u l o l y t i c a c t i v i t i e s . T h i s c l o n e w i l l a l l o w the p u r i f i c a t i o n of s u f f i c i e n t q u a n t i t i e s of CenCl and CenC2 f o r t h e i r f u r t h e r c h a r a c t e r i z a t i o n , such as the determination of the k i n e t i c parameters and the substrate s p e c i f i c i t i e s . A d e t a i l e d c h a r a c t e r i z a t i o n of the recombinant c e l l u l a s e s 113 ( C.fimi p r o t e a s e s t u d i e s ( G i l k e s et al., 1988, L a n g s f o r d e t al., 1987, Arfman et al., 1987 ), a n a l y s i s o f s y n e r g i s t i c p r o p e r t i e s w i t h o t h e r c l o n e d c e l l u l a s e s , c r y s t a l l o g r a p y , e t c . ) r e q u i r e s a b e t t e r source f o r the i s o l a t i o n of l a r g e q u a n t i t i e s of CenCl/2. As d e s c r i b e d above, the p r o d u c t i o n of p r o c e s s e d CenCl/2 by JM101[pTZP-cenC] appears to be l i m i t e d due t o the t o x i c i t y of the i n t r a c e l l u l a r recombinant p r o d u c t s . For the o v e r e x p r e s s i o n of t h e mature enzymes I suggest t h a t the c o d i n g sequence o f cenC ( l a c k i n g the l e a d e r sequence ) be fused t o PTIS u s i n g a s t r a t e g y a n a l o g o u s t o t h e c o n s t r u c t i o n o f pTZP-cenC. S i n c e t h e o v e r p r o d u c t i o n of CenC d i d not l e a d to the f o r m a t i o n of i n s o l u b l e a ggregates i n the cytoplasm of t h e s e c l o n e s , such a c o n s t r u c t might p r o v i d e a s u i t a b l e system f o r t h e i s o l a t i o n o f l a r g e q u a n t i t i e s of CenC c e l l u l a s e s . 114 IV. REFERENCES Amersham International p i c . A, i n v i t r o packaging p r o t o c o l . B u l l e t i n N.334. Arfman, N., Gilkes, N.R., Guo, Z., Kilburn, D.G., Langsford, M., M i l l e r , R.C.Jr., Owolabi, J., and Warren, R.A.J. 1987. C h a r a c t e r i z a t i o n of Cellulomonas f i m i c e l l u l a s e s . Sixth Canadian Bioenergy R&D Seminar. Richmond, B.C. Atkinson, T., and Smith, M. 1984. In oligonucleotide synthesis: a p r a c t i c a l approach. Gait, N.J. ed. IRL press, Washington, Washington D.C. Beguin, P., Gilkes, N.R., Kilburn, D.G., M i l l e r , R.C.Jr., O'Neill, G.P., and Warren, R.A.J. 1987. Cloning of c e l l u l a s e genes. CRC C r i t . Rev. Biotech. 6:12 9-162 Beguin, P., and Eisen, H. 1978. P u r i f i c a t i o n and p a r t i a l c h a r a c t e r i z a t i o n of three e x t r a c e l l u l a r c e l l u l a s e s from Cellulomonas sp. Eur. J. Biochem. 87:525-531 Beguin, P., and Eisen, H. 1977. Free and cellulose-bound c e l l u l a s e s i n a Cellulomonas species. J. Gen. M i c r o b i o l . 101:191-196 Birnboim, H.C., and Doly, J. 1979. A rapid a l k a l i n e extraction procedure for screening recombinant plasmid DNA. Nucl. Acids Res. 7:1513-1523 Bisa r i a , V.S., and Ghose, T.K. 1981. Biodegradation of c e l l u l o s i c material: substrates, microorganisms, enzymes and products. Enzyme Microb. Technol. 3:90-104 deBoer, H.A., Comstock, L.J., Wong, E., and Vasser, M. 1983. Portable Shine-Dalgarno regions - A system for a systematic study of defined a l t e r a t i o n s of nucleotide sequences within E s c h e r i c h i a c o l i ribosome binding s i t e s . DNA. 2:231-235 115 B r a d f o r d , M.M. 1 9 7 6 . A r a p i d a n d s e n s i t i v e m e t h o d f o r t h e q u a n t i t a t i o n o f m i c r o g r a m q u a n t i t i e s o f p r o t e i n u t i l i z i n g t h e p r i n c i p l e o f p r o t e i n - d y e b i n d i n g . A n a l . B i o c h e m . 72:248-252 Brammar, W.J. 1982. V e c t o r s b a s e d on b a c t e r i o p h a g e l a m b d a . Gen. E n g i n e e r i n g . 3:53-81 C a l z a , R.E., I r w i n , D.C., and W i l s o n , D.B. 1985. P u r i f i c a t i o n and c h a r a c t e r i z a t i o n o f t w o (3-1, 4 - e n d o g l u c a n a s e s f r o m Thermomonospora fusca. B i o c h e m i s t r y . 24:7797-7804 C h a n z y , H., H e n r i s s a t , B., a n d V u o n g , R. 1984. C o l l o i d a l g o l d l a b e l l i n g o f 1, 4-|3-D-glucan c e l l o b i o h y d r o l a s e a d s o r b e d on c e l l u l o s e s u b s t r a t e s . FEBS L e t t e r s . 172:193-197 C o u g h l a n , M.P. 1 985. The p r o p e r t i e s o f f u n g a l a n d b a c t e r i a l -c e l l u l a s e s w i t h comment on t h e i r p r o d u c t i o n a n d a p p l i c a t i o n . B i o t e c h n o l . G e n e t . Eng. Rev. 3:39-109 C r e u z e t , N . , a n d F r i x o n , C. 1 9 8 3 . P u r i f i c a t i o n a n d c h a r a c t e r i z a t i o n o f an e n d o g l u c a n a s e f r o m a n e w l y i s o l a t e d t h e r m o p h i l i c a n a e r o b i c b a c t e r i u m . B i o c h i m i e . 65:149-156 C u r r y , C , G i l k e s , N.R., O ' N e i l l , G.P., M i l l e r , R . C . J r . , a n d S k i p p e r , N. 1988. E x p r e s s i o n a n d s e c r e t i o n o f a Cellulomonas fimi e x o g l u c a n a s e i n Saccharomyces cerevisiae. A p p l . E n v i r o n . M i c r o b i o l . 54:476-484 D a l e , R.M.K., M c C l u r e , B.A., a n d H o u c h i n s , J . P . 1 9 8 5 . A r a p i d s i n g l e - s t r a n d e d c l o n i n g s t r a t e g y f o r p r o d u c i n g a s e q u e n t i a l s e r i e s o f o v e r l a p p i n g c l o n e s f o r u s e i n DNA s e q u e n c i n g : A p p l i c a t i o n t o s e q u e n c i n g t h e c o r n m i t o c h o n d r i a l 18S rDNA. P l a s m i d s . 13:31-40 E n a r i , T.M., a n d N i k u - P a a v o l a , M.L. 1987. E n z y m a t i c h y d r o l y s i s o f c e l l u l o s e : I s t h e c u r r e n t t h e o r y o f t h e m e c h a n i s m s o f h y d r o l y s i s v a l i d ? CRC C r i t . Rev. B i o t e c h n o l . 3:39-109 E r i k s s o n , K.E., a n d Wood, T.M. 1985. B i o d e g r a d a t i o n o f c e l l u l o s e . B i o s y t n . B i o d e g . Wood Comp., H i g u c h i , T., E d . , A c a d e m i c P r e s s , L o n d o n . 469-503 116 Eriksson, K.E., and Hamp, S.G. 1978. Regulation of endo-1,4-R-D-glucanase production in Sporotrichum pulverulent urn. Eur. J. Biochem. 99:183-190 Gilbert, S.F., deBoer, H.A., and Nomura, M. 1979. Ide n t i f i c a t i o n of i n i t i a t i o n s i t e s for the in vitro t r a n s c r i p t i o n of rRNA operons rrnE and rrnA in E.coli. C e l l . 17:211-224 Gilkes, N.R., Warren, R.A.J., M i l l e r , R.C.Jr., and Kilburn, D.G. 1988. Precise excision of the cellulos e binding domains from two Cellulomonas fimi cellulases by a homologous protease and the effect on ca t a l y s i s . J. B i o l . Chem. 263: pp. Gilkes, N.R., Langsford, M.L., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. 1984a. Mode of action and substrate s p e c i f i c i t i e s of cloned b a c t e r i a l genes. J. B i o l . Chem. 259:10455-10459 Gilkes, N.R., Kilburn, D.G., Langsford, M.L., M i l l e r , R.C.Jr., Wakarchuck, W.W., Warren, R.A.J., Whittle, D.J., and Wong, W.K.R. 1984b. Isolation and characterization of Escherichia coli clones expressing c e l l u l a s e genes from Cellulomonas fimi. J. Gen. Microbiol. 130:1377-1384 Gilkes, N.R., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.C. 1984c. A mutant of Escherichia coli that leaks c e l l u l a s e a c t i v i t y encoded by cloned c e l l u l a s e genes from Cellulomonas fimi. Bio/Technology. 2:259-263 Gong, C.S., and Tsao, G.T. 1979. C e l l u l a s e and biosynthesis regulation. Ann. Reports on Fermentation Processes. 3:111-139 Greenberg, N.M. 1988. C e l l u l a s e gene t r a n s c r i p t i o n i n Cellulomonas fimi and an Agrobacterium. Ph.D. Thesis, University of B.C., Vancouver, Canada Greenberg, N.M., Warren, R.A.J., Kilburn, D.G., and M i l l e r , R.C.Jr. 1987a. Regulation, i n i t i a t i o n , and termination of the cenA and cex t r a n s c r i p t s of Cellulomonas fimi. J. Bacteriol. 169:646-653 117 G r e e n b e r g , N.M., W a r r e n , R . A . J . , K i l b u r n , D.G., a n d M i l l e r , R . C . J r . 1987b. R e g u l a t i o n a n d i n i t i a t i o n o f cenB t r a n s c r i p t s o f Cellulomonas fimi. J . B a c t e r i o l . 169: 4674-4677 G r i f f i n , H., D i n t z i s , F.R., K r u l l , L., a n d B a k e r , F . L. 1984. A m i c r o f i b r i l g e n e r a t i n g f a c t o r f r o m t h e enzyme c o m p l e x o f Trichoderma reesei. B i o t e c h n o l . B i o e n g . 26:296-300 Guo, Z., A r f m a n , N. , Ong, E., G i l k e s , N.R., K i l b u r n , D.G., W a r r e n , R . A . J . , a n d M i l l e r , R . C . J r . 1 9 8 8 . L e a k a g e o f Cellulomonas fimi c e l l u l a s e s f r o m Escherichia coli. FEMS M i c r o b i o l . L e t t e r s . 49:279-283 H a w l e y , D.K., and M c C l u r e , W.R. 1983. C o m p i l a t i o n a n d a n a l y s i s o f Escherichia coli p r o m o t e r DNA s e q u e n c e s . N u c l . A c i d s . R e s . 11:2237-2255 Hohn, B. 1 9 7 9 . In vitro p a c k a g i n g o f X a n d c o s m i d DNA. Met h . E n z y m o l . 68: 299-309 H o l l a n d , I.B., Mackman, N., a n d N i c a u d , J.-M. 1986. S e c r e t i o n o f p r o t e i n s f r o m b a c t e r i a . B i o / T e c h n o l o g y . 4:427-431 J o h n s o n , J.A., Wong, W.K.R., and B e a t t y , J.T. 1986. E x p r e s s i o n o f c e l l u l a s e genes i n Rhodobacter capsulatus by u s e o f p l a s m i d e x p r e s s i o n v e c t o r s . J . B a c t e r i o l . 167:604-610 K l y o s o v , A . , M i t k e v i c h , O.V., a n d S i n i t s y n , A.P. 1986. R o l e o f t h e a c t i v i t y a n d a d s o r p t i o n o f c e l l u l a s e s i n t h e e f f i c i e n c y o f t h e e n z y m a t i c h y d r o l y s i s o f a m o r p h o u s a n d c r y s t a l l i n e c e l l u l o s e . B i o c h e m . 25:540-542 K o t o u j a n s k y , A., D i o l e z , A., B o c c a r a , M., B e r t h e a u , Y., A n d r o , T. , a n d C o l e n o , A. 1 9 8 5 . M o l e c u l a r c l o n i n g o f Erwinia chrysanthemi p e c t i n a s e a n d c e l l u l a s e s t r u c t u r a l g e n e s . EMBO J . 4:781-785 L a e m m l i , U.K. 1970. C l e a v a g e o f s t r u c t u r a l p r o t e i n s d u r i n g t h e a s s e m b l y o f t h e h e a d o f t h e b a c t e r i o p h a g e T4. N a t u r e 227:680-685 118 Langsford, M.L. 1988. The p u r i f i c a t i o n and characterization of two ce l l u l o s e - b i n d i n g , glycosylated c e l l u l a s e s from the bacterium Cellulomonas fimi. Ph.D. Thesis. U n i v e r s i t y of B.C., Vancouver, Canada Langsford, M.L., Gilkes, N.R., Singh, B., Moser, B., M i l l e r , R.C.Jr., Warren, R.A.J., and K i l b u r n , D.G. 1987. Glycosylation of b a c t e r i a l c e l l u l a s e s prevents p r o t e o l y t i c cleavage between functional domains. FEBS Le t t e r s . 225:163-167 Langsford, M.L., Gilkes, N.R., Wakarchuck, W.W., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. 1984. The c e l l u l a s e system of Cellulomonas fimi. J. Gen. Microbiol. 130:1367-1376 Loenen, W.A.M., and Brammar, W.J. 1980. A bacteriophage lambda vector for cloning large DNA fragments made with several r e s t r i c t i o n enzymes. Gene. 10:249-259 Mandels, M. 1983. Applications of c e l l u l a s e s . Biochem. Soc. Trans. 13:414-416 Maniatis, T., F r i t s c h , E.F., and Sambrook, J. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York Messing, J. 1983. New M13 vectors for cloning. Methods Enzymol. 101:20-78 Mi k i , T., Ebina, Y., K i s h i , F . , and Nakazawa, A. 1981. Organization of the lexA gene of Escherichia coli and nucleotide sequence of the regulatory region. Nucl. Acids Res. 9:529-543 M i l l e r , G.L., Blum, R. , Glennon, W.E., and Burton, A.L. 1960. Measurement of carboxymethylcellulase a c t i v i t y . Anal. Biochem. 2:127-132 M i l l e r , J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York 119 Mizusawa, S., Nishimura, S., and Seela, F. 1986. Improvement of the dideoxy chain termination method of DNA sequencing by use of deoxy-7-deazaguanosine triphosphate i n place of dGTP. Nucl. Acids Res. 14:1319-1324 Montenecourt, B.S. 1983. Trichoderma reesei c e l l u l a s e s . Trends Biotechnol. 1:156-160 Ng, T.K., and Zeikus, J.G. 1981. P u r i f i c a t i o n and c h a r a c t e r i z a t i o n of an endoglucanase ( 1,4-fJ-D-glucan glucanohydrolase ) from Clostridium thermocellum. Biochem. J. 199:341-350 Nossal, N.G., and Heppel, L.A. 1966. The release of enzymes by osmotic shock from Escherichia coli i n exponential phase. J. B i o l . Chem. 241:3055-3062 O'Callaghan, C.H., Morris, A., Kirby, S.M., and Shingler, A.H. 1972. Novel method for detection of P-lactamase by using a chromogenic cephalosporin substrate. Antimicrob. Ag. Chemother. 1:283-288 O ' N e i l l , G.P. 1986. Structure of the gene encoding the exoglucanase of Cellulomonas fimi and i t s expression and secretion i n Escherichia coli. Ph.D. Thesis. University of B.C., Vancouver, Canada O'Ne i l l , N.P., Goh, S.H., Warren, R.A.J., Kilburn, D.G., and M i l l e r , R.C. J r . 1986a. Structure of the gene encoding the exoglucanase of Cellulomonas fimi. Gene. 44: 325-330 O'Neill, G.P., Kilburn, D.G., Warren, R.A.J., and M i l l e r , R.C.Jr. 1986b. Overproduction from a c e l l u l a s e gene with a high guanosine-plus-cytosine content i n Escherichia coli. Appl. Environ. Microbiol. 52:737-743 Owolabi, J.B. 1988. C h a r a c t e r i z a t i o n and expression of Cellulomonas fimi endoglucanase B gene and properties of the gene product from Escherichia coli. Ph.D.Thesis. University of B.C., Vancouver, Canada 120 Owolabi, J.B., Beguin, P., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. 1988a. Expression i n Escherichia coli of the Cellulomonas fimi s t r c t u r a l gene for endoglucanase B. Appl. Environ. Microbiol. 54:518-523 Pugsley, A.P., and Schwartz, M. 1985. Export and secretion of proteins by bacteria. FEMS Microbiol. Rev. 32:3-38 Rosenberg, M., and Court, D. 1979. Regulatory sequences involved in the promotion and termination of RNA t r a n s c r i p t i o n . Ann. Rev. Genet. 13:319-353 Ryu, D.D.Y., Kim, C , Mandels, M. 1 9 8 4 . Competitive adsorption of c e l l u l a s e components and i t s s i g n i f i c a n c e i n a sy n e r g i s t i c mechanism. Biotechnol. Bioeng. 26:488-496 Sanger, F., Nicklen,S., and Coulson, A.R. 1977. DNA sequencing with chain terminating i n h i b i t o r s . Proc. Nat l . Acad. S c i . USA. 74:5463-5467 Schimz, K.L., and Decker, G. 1985. Cellobiose phosphorylase ( EC 2.4.1.20 ) of Cellulomonas sp. : i n v e s t i g a t i o n s on i t s l o c a l i z a t i o n . Can. J. Microbiol. 31:751-754 Sheir-Neiss, G., and Montenecourt, B.S. 1984. Characterization of the secreted c e l l u l a s e s of Trichoderma reesei wild type and mutants during c o n t r o l l e d fermentations. Appl. M i c r o b i o l . Biotechnol. 20:46-53 Skipper, N., Sutherland, M., Davis, R.W., Kilburn, D., M i l l e r , R.C.Jr., Warren, R.A.J., and Wong, R. 1985. Secretion of a bac t e r i a l cellulase by yeast. Science. 230:958-960 Smith, H.O., and B i r n s t i e l , M.L. 1976. A simple method for DNA r e s t r i c t i o n s i t e mapping. Nucl. Acids Res. 3:2387-2398 Stewart, B.J., and Leatherwood, J.M. 1976. Derepressed synthesis of cellulase by Cellulomonas. J. B a c t e r i d . 128:609-615 .12.1 Sternberg, D. and Mandels, G.R. 1980. Regulation of the c e l l u l o l y t i c system i n Trichoderma reesei by sophorose: Induction of c e l l u l a s e and repression of P-glucosidase. J. Bact e r i o l . 144:1197-1199 Sternberg, D. and Mandels, G.R. 1979. Induction of c e l l u l o l y t i c enzymes in Trichoderma reesei by sophorose. J. B a c t e r i o l . 139: 761-769 Stoppock, W., Rapp, P., and Wagner, F. 1982. Formation, l o c a l i z a t i o n and regulation of endo-1,4-P-glucanases from Cellulomonas uda. Appl. Environ. Microbiol. 44:43-53 Teather, R.M., and Wood, P.J. 1982. Use of Congo-red-p o l y s a c c h a r i d e i n t e r a c t i o n s i n enumeration and characterization of c e l l u l o l y t i c bacteria from bovine rumen. Appl. Environ. Microbiol. 43:777-780 T e e r i , T.T. 1987. In:"The c e l l u l o l y t i c enzyme system of Trichoderma reesei". Technical Research Center of Finland, Publications 38 Towbin, H., Staehlin, T., and Gordon, J. 1979. Electrophoretic t r a n s f e r of p r o t e i n s from p o l y a c r y l a m i d e g e l s to n i t r o c e l l u l o s e sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA. 76:4350-4354 V o l l e r , A., Bidwell, D., and B a r l e t t , A. 1976. Microplate immunoassays for the immunodiagnosis of v i r u s i n f e c t i o n s . Rose, N., and Freedman, H., eds. Manual of c l i n i c a l immunology, 1st ed. American Society for Microbiology. Washington, Washington D.C. Wahl, G.H., Berger, S.L., and Kimmel, A.R. 1987. Molecular h y b r i d i z a t i o n of immobilized n u c l e i c acids: t h e o r e t i c a l concepts and p r a t i c a l considerations. In "Guide to molecular cloning techiques". p.399-407. Methods Enzymol. 152 Wakarchuck, W.W., Kilburn, D.G., M i l l e r , R.C.Jr., and Warren, R.A.J. 1984. The preliminary c h a r a c t e r i z a t i o n of the P~ glucosidases of Cellulomonas fimi. J. Gen. M i c r o b i o l . 130:1385-1389 122 Warren, R.A.J., Beck, C.F., Gilk e s , N.R., Ki l b u r n , D.G., Langsford, M.L., M i l l e r , R.C.Jr., O'Neill, G.P., Scheufens, M., and Wong, W.K.R. 1986. Sequence conservation and region s h u f f l i n g i n an endoglucanase and exoglucanase from Cellulomonas fimi. PROTEINS: Structure, Function and Genetics. 1:335-341 Whittle, D.J., Kilburn, D.G., Warren, R.A.J., and M i l l e r , R.C.Jr. 1982. Molecular cloning of a Cellulomonas fimi gene in Escherichia coli. Gene. 17:139-145 Wickner, W.T., and Lodish, H.F. 1985. Multip l e mechanisms of pr o t e i n i n s e r t i o n i n t o and across membranes. Science. 230:400-407 Will i c k , G.E., and Seligy, V.L. 1985. M u l t i p l i c i t y i n cellulases of Schizophyllum commune: D e r i v a t i o n p a r t l y from heterogeneity i n t r a n s c r i p t i o n and gl y c o s y l a t i o n . Eur. J. Biochem. 151:89-96 Wong, W.K.R. 1986. The cloning and c h a r a c t e r i z a t i o n of an endoglucanase gene of Cellulomonas fimi. Ph.D. Thesis. University of B.C., Vancouver, Canada Wong, R.W.K., Gerhard, B., Guo, Z.M., Kilburn, D.G., Warren, R.A.J., and M i l l e r , R.C.Jr. 1986a. Ch a r a c t e r i z a t i o n and structure of an endoglucanase gene cenA of Cellulomonas fimi. Gene. 44:315-324 Woods, D. 1984. Oligonucleotide screening of cDNA l i b r a r i e s . Focus, Bethesda Research Lab. 6:1-3 United States Biochemical Corporation ( UBS ) . Genescribe-Z™: d e s c r i p t i o n and experimental protocols. P.O. Box 22400, Cleveland, Ohio 44122 Z o l l e r , M., and Smith, M. 1983. O l i g o n u c l e o t i d e - d i r e c t e d mutagenesis of DNA fragments cloned into M13 vectors. Meth. Enzymol. 100:468-500 123 Yamane, K., S u z u k i , H . , a n d N i s i z a w a , K. 1970. P u r i f i c a t i o n a n d p r o p e r t i e s o f e x t r a c e l l u l a r a n d c e l l - b o u n d c e l l u l a s e c o m p o n e n t s o f Pseudomonas fluoresence v a r . cellulosa. J . B i o c h e m . 67:19-35 Yanish-Perron, C , V i e i r a , J . , and Messing, J . 1985. Improved M13 phage c l o n i n g v e c t o r s and host s t r a i n s : n u c l e o t i d e sequences of M13mp and pUC v e c t o r s . Gene. 33:103-119 124 V. APPENDIX Flow-chart p r o t o c o l f o r the molecular cl o n i n g of cenC and the con s t r u c t i o n of the cenC high-expression vector, pTZP-cenC p u r i f i c a t i o n of the C.fimi endo-glucanases, C3.1 and C3.2 determination of the amino a c i d sequences of the N-termini of C3.1 and C 3 . 2 and the C 3 . 2 - i n t e r n a l , t r y p t i c peptide, T-115 synthesis of oligonucleotide probes corresponding to the N-termini of the C3 enzymes ( J0.3A,B,C, and D ) and to T-115 ( BM.C ) construction of a C.fimi DNA-lambda l i b r a r y by cloning genomic C.fimi DNA into the lambda vector L47.1 ? screening of recombinant lambda phage p a r t i c l e s by p l a q u e - f i l t e r l i f t h y b r i d i z a t i o n using the radio-labeled JO.3 oligonucleotide probes 125 • p u r i f i c a t i o n of J0.3A p o s i t i v e recombinant phage p a r t i c l e s and rescreening with the radiolabeled oligonucleotide probes, J0.3A and BM.C se l e c t i o n of the recombinant phage p a r t i c l e , L47.1-169, f o r further studies l o c a l i z a t i o n of cenC i n the i n s e r t of L47.1-169 by DNA dot-blot analysis using the radiolabeled probes, JO.3A and BM.C subcloning of the cenC -containing, 7.7 kb H i n d l l l / BamHI fragment into the plasmid vector pTZ18R r e s u l t i n g i n the subclone pTZ18R-8 l o c a l i z a t i o n of the 5 *-end of cenC i n the i n s e r t of pTZ18R-8 by Southern t r a n s f e r experiments nucleotide sequence determination of the 900 bp SstI/ BamHI fragment containing the 5'-end of cenC determination of the boundaries of cenC i n pTZ18R-8 and i d e n t i f i c a t i o n of the t r a n s c r i p t i o n a l regulatory sequences by RNA-DNA hybrid protection analysis 126 • subcloning of the 900 bp Sstl/BamHI fragment containing the 5'-end of cenC into pTZ18R resu l t i n g i n pTZ18R-S/B synthesis of the 5'-end of cenC s t a r t i n g with second codon of the cenC leader sequence by primer ex-tension using the synthetic o l i g o -nucleotide primer-8/5 i n s e r t i o n of the synthetic trans-l a t i o n i n i t i a t i o n sequence ( PTIS ) into the EcoRI and BamHI s i t e s of pTZ18R r e s u l t i n g i n pTZ18R-PTIS fusion of the synthesized 5'-end fragment of cenC with the ATG s t a r t codon of the PTIS i n pTZ18R-PTIS r e s u l t i n g i n the subclone pTZ18R-5' construction of pTZP-cenC by cloning the 3.4 kb BamHI/Hindlll fragment of pTZ18R-8 containing the missing 3'-sequence of cenC into pTZ18R-5' o v e r - e x p r e s s i o n o f cenC by t h e E.coli c l o n e JM101[pTZP-cenC] 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098157/manifest

Comment

Related Items