Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of the promoter in a human B19 parvovirus Blundell, Matthew Charles 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-UBC_1989_A1 B58.pdf [ 13.6MB ]
JSON: 831-1.0098149.json
JSON-LD: 831-1.0098149-ld.json
RDF/XML (Pretty): 831-1.0098149-rdf.xml
RDF/JSON: 831-1.0098149-rdf.json
Turtle: 831-1.0098149-turtle.txt
N-Triples: 831-1.0098149-rdf-ntriples.txt
Original Record: 831-1.0098149-source.json
Full Text

Full Text

CHARACTERIZATION OF THE PROMOTER IN A HUMAN B19 PARVOVIRUS  By MATTHEW CHARLES BLUNDELL B.Sc.(hons.), University of British Columbia, 1983 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF GRADUATE STUDIES DEPARTMENT OF BIOCHEMISTRY We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA FEBRUARY, 1989 © Matthew Charles Blundell ©1989  In  presenting  degree freely  at  this  the  thesis  in  partial  fulfilment  University  of  British  Columbia, I agree  available for  copying  of  department publication  this or of  reference  thesis by  this  for  his  and study. scholarly  or  thesis  for  her  purposes  of  c\v^  The University of British C o l u m b i a Vancouver, Canada  Date  DE-6  (2/88)  ^Ao  r c V.  ,  may  representatives.  financial  l y ^ 9  the  requirements that the  I further agree that  gain  permission.  Department  of  s.'V^i/  It  shall not  be  advanced  Library shall make  by  understood be  an  permission for  granted  is  for  allowed  the that  without  it  extensive  head  of  my  copying  or  my  written  ii ABSTRACT The nucleotide sequence of the B19-Wi isolate of an autonomous human parvovirus was determined and compared with the sequence of the closely related isolate, B19-Au. The B19-Wi genome was similar to the B19-Au genome, as shown from DNA sequence analyses. It had been previously suggested from the sequence of the B19-Au genome, that the termini may be imperfect inverted terminal repeats. The additional sequence present on the right-hand terminus of B19-Wi supported that supposition. The hairpin termini of the B19 genome were of the same type as those found in adeno-associated parvoviruses, and suggested B19 may be more closely related to A A V viruses than to the autonomous parvoviruses. In vitro transcription with HeLa nuclear extracts using B19-Wi DNA identified a single active RNA polymerase II promoter between map unit 5 and 6. A single promoter was unique; all other parvoviruses characterized to date have two or more active promoters. A series of ordered deletions, prepared in the region upstream of the initiation site of the promoter, indicated that multiple cis-activating motifs were required to maximize in vitro transcription. A transcription factor in HeLa cells specifically bound to and protected a G C rich sequence or GC-box upstream of the promoter, as shown by gel-shift competition assays, and DNAse I and DMS footprinting assays. The protected GC-box had the consensus sequence of a high affinity binding site for the trans-activating factor SP1. The GC-box also formed the distal element of a tandem SPl-like motif, 21 bp upstream of the active T A T A box. Synthetic oligonucleotides containing the GC-box specifically bound a HeLa factor and also depressed in vitro transcription from the B19 promoter when added as a competitor. Although not conclusive, binding of the HeLa factor may be inhibited by methylation of a cytosine residue within the GC-box. In vitro transcriptional activity decreased when the GC-box upstream of the B19 promoter was modified by site specific mutagenesis.  iii Preliminary identification of other cis-activating motifs, which include two sequences recognized by factors that are functional both in transcription and replication, suggested that the B19 promoter is a complex regulatory region.  iv Table of Content  Page I.  Abstract  ii  II.  Table of Contents  iv  III.  List of Tables  vii  IV.  List of Figures  viii  V.  Acknowledgements  x  VI.  List of Abbreviations  xi  VII.  INTRODUCTION A. The Discovery of a Human Parvovirus, B19 B. Review of Parvoviruses Including B19 1. General Description of Parvoviruses 2. Classification of Parvoviruses 3. Pathogenicity of Parvoviruses 4. General Life Cycle of Parvoviruses 5. Propagation of B19 6. Genome Organization of Parvoviruses, Including B19 C. RNA Polymerase II Transcription 1. In Vitro Determination of Eukaryotic Promoters 2. Factors Involved in Minimal Transcription D. Regulation of Transcription Initiation 1. Transacting Factors 2. DNA Binding Domains of Transacting Factors 3. Interactions with TFIID 4. Interactions with the Basic Subunit of Pol II 5. Other Mechanisms by Which Factors may Alter Transcription 6. Multifunctional Transacting Factors E. Modulation of Transcription by Covalent Alteration of Transacting Factors 1. Phosphorylation 2. Methylation F. Regulation of Pol II Termination G. Alternative Splicing and/or Polyadenylation Regulates mRNA Production H. Transcription of Parvovirus Promoters 1. Transcription and Translation 2. Regulation I. Transcriptional Studies of B19 1. DNA Sequence Analyses of B19-Wi 2. In vitro transcription  3. Multiple cis-activating sequences 4. A HeLa Factor Binds to a GC-box  1 2 2 3 4 5 6 7 7 7 8 10 10 11 13 14 17 18 18 18 19 20 20 23 23 24 26 26 27  27 28  V  VIII.  MATERIALS AND METHODS A. Materials B. Strains and Media ' 1. Bacteria 2. HeLa cells 3. Plasmids C. Basic Molecular Cloning Techniques 1. Isolation of DNA Fragments for Subcloning 2. Subcloning Fragments in pUC Vectors 3. Subcloning Fragments in Ml3 Vectors 4. Plasmid and Ml3 Transformations D. Plasmid DNA Isolation 1. Large Scale Plasmid DNA Preparation 2. Small Scale Plasmid DNA Preparation 3. Ml3 DNA Preparation E. Preparation of Deletion Clones F. DNA Sequence Analyses of B19 Clones 1. Single Stranded DNA Sequencing 2. Double Stranded DNA Sequencing 3. Chemical DNA Sequencing 4. Overcoming DNA Sequencing Artifacts G. Preparation of HeLa Extracts 1. Large Scale Growth of HeLa Cells 2. HeLa Nuclear Extract Preparation 3. Sephacryl S300 Fractionation of HeLa Nuclear Extracts H. Transcription Analyses 1. Plasmid Preparation 2. Run-off Assays 3. Mapping the Initiation Site I. Gel Retention Studies 1. Dephosphorylation of DNA Fragments 2. Radioactive Labeling of DNA Fragments 3. Isolation of End-labelled DNA 4. Gel Shift Assays 5. Competition Assays J. DNA Footprinting 1. DNAse I Protection 2. DMS Methylation Interference 3. DMS Methylation Protection K. Studies with a Synthetic Oligonucleotide 1. Cloning a Synthetic GC-box Into pUC 2. Methylated and Nonmethylated GC-box L. Site-Specific Mutagenesis of the B19 Promoter 1. Uracil Containing Ml3 Templates 2. Preparation of the Oligonucleotide  IX.  RESULTS A. DNA Sequence Differences in B19 Viruses B. In vitro Transcription of B19 DNA in HeLa Extracts 1. Determining the Start Site of Transcription 2. Upstream Deletions of the B19 Promoter 3. Comparison of Different Deletion Clones C Putative Cis-activating Motifs Identified by Sequence Analyses D. HeLa Factor(s) Bind to the B19 Promoter Region  29 30 31 31 32 32 32 32 33 33 33 33 35 35 36 37 37 38 39 39 40 40 40 42 42 42 43 44 44 44 45 46 46 47 47 48 49 50 51 51 51 52 52 53 54 65 65 65 68 76 82  vi E. HeLa Factor Binds a GC-box in the B19 Promoter 1. DNAse I Protection 2. DMS Interference 3. DMS Protection F. Transcription Interference with a Synthetic GC-box 1. Characterization of a Synthetic GC-box 2. Binding of a HeLa Factor to the Synthetic GC-box 3. Transcription Competition by a GC-box Fragment G. Binding of HeLa Factor(s) Affected by Competitors H. In vitro Transcription and a Mutagenized B19 GC-box 1. Factor Binding Affected by a Mutagenized GC-box 2. B19 Transcription is Reduced by GC-box Mutagenesis X.  XI.  86 86 92 94 94 95 95 100 103 105 105 108  DISCUSSION A. Genome of B19-Wi B A Single Active Promoter in B19-Wi C. Multiple Sequence Motifs are Required for Maximal Transcription D. A GC-box acts as a Cis-activating Element E. Does the GC-box Interact with SP1 F. Methylation in Transcription Control G. Relationship of B19 and other Promoters H. Future Prospects  113 114 119 121 126  LITERATURE CITED  128  110 111 112  L i s t of Tables  I.  Comparison of Nucleotide Sequence (nt 1-5095) of the Complementary (Coding) Strand of B19-Wi with B19-Au  II.  Relative Transcriptional Strength of Equimolar mixes of p3141 and p3141 Deletion Templates  III.  Cis-Activating Consensus Sequences in the B19 Promoter  List of Figures  1.  DNA Sequencing Strategy for B19-Wi  Page 55  2.  Comparison of B19-Wi and B19-Au DNA sequence  56  3.  Terminal Hairpins of B19-Wi Clone pYT102  62  4.  Transcription of Cloned B19-Wi in HeLa Nuclear Extracts  66  5.  In vitro Transcription of p3141 and Deletion Clones  67  6.  In vitro Transcription of Equimolar Mixtures of p3141, p3141<107 and p3141<170  69  7.  In vitro Transcription of Equimolar Mixtures of p3141 and p3141 Deletion Clones  74  8.  Putative DNA Binding Sites for Trans-activating Factors in the B19 Promoter Region  77  9.  Gel-shift Mobility Assays with HeLa Nuclear Extract and Sephacryl S300 Column Fractionated HeLa Nuclear Extract  83  10.  Construction of D272  85  11.  Gel-shift Mobility Assay of D272 with HeLa Nuclear Extract and Sepharcryl S300 Fractions  87  12.  Preparative Gel-Shift Mobility Assays for DNAse I and DMS Footprinting of B19 DNA (D272) in HeLa Nuclear Extracts  89  13.  DNAse I Footprint of D272 with HeLa Nuclear Extract  91  14.  DMS Footprint of D272 with HeLa Nuclear Extract  93  15.  Characterization of Synthetic GC-boxes  96  16.  Sequence of GC-S  97  17.  Gel-shift Mobility Assays of Synthetic GC-S with HeLa Nuclear Extract  99  18.  In vitro Transcription Assays of p3141 in the Presence of Competitor GC-box Containing Fragments  19.  Competition for Binding of D272 in Gel-shift Assays  104  20.  Site Specific Mutagenesis of B19's GC-box  106  101  Gel Retention Assays of Wildtype (D272) and Mutant (D272-TT) GC-box Containing Fragments in HeLa Nuclear Extracts In vitro Transcription of pD272-H and pD272-HTT in HeLa Nuclear Extracts  X  Acknowledgement  I thank Dr. Caroline Astell, my research supervisor, for giving me the opportunity to work in her lab. The research topic was interesting and challenging. The independence to pursue the diverging pathways that occurred as this project developed with continuing support and ideas from Caroline was most appreciated. Thanks to my colleagues in the lab, Caroline Beard, Dr. Roland Russnak, and Dr. Rosemary Shade, for the ideas and assistance you offered me. For help on the computer thanks to Dr. Rob McMaster. A very special thanks to Linda for reading and editing my thesis. For help in the photography thanks to Dr. Dale Laird, Doug Yeung, and to Dr. Bob Molday for the use of his darkroom. Thankyou to the members of my graduate committee, Dr. Gordon Tener and Dr. George Spiegelman for your suggestions and for reading my thesis. To members of the Biochemistry department at U.B.C., thanks for your support and friendship. The MacMillan family and MRC are thanked for studentship support, which allowed me to pursue graduate studies at U.B.C.  XI  List of Abbreviations A  wavelength  AAV  adeno-associated virus  ATP  riboadenosine 5'-triphosphate  bp  base pair (s)  BSA  bovine serum albumin  °C  Centigrade  CAT  chloramphenicol acetyl transferase  CGRP  calcitonin gene related peptide  CIP  calf intestinal phosphatase  cm  centimetres  cpm  counts per minute  CTD  carboxy-terminal domain(s)  dATP  deoxyriboadenosine 5' - triphosphate  dCTP  deoxy ribocy tidine 5' - triphosphate  dGTP  deoxyriboguanosine 5'-triphosphate  ddATP  dideoxyriboadenosine 5'-triphosphate  ddCTP  dideoxyribocy tidine 5' - triphosphate  ddGTP  dideoxyriboguanosine 5'-triphosphate  ddNTP  dideoxyribonucleotide triphosphate mix  ddTTP  dideoxyribothymidine 5'-phosphate  DEP  diethylpyrocarbonate  dhfr  dihydrofolate reductase  DMS  dimethyl sulphate  DMSO  dimethyl sulfoxide  DNA  deoxyribonucleic acid  dNTP  deoxyribonucleotide triphosphate mix  ds  double-stranded  DTT  dithiothreitol  dTTP  deoxyribothymidine 5'-triphosphate  E. coli  Escherichia coli  EDTA  ethylene diaminetetraacetate  EtBr  ethidium bromide  EtOH  ethanol  g  gram (s)  G  Gravity  HBsAG  hepatitis B surface antigen  hr  hour (s)  IPTG  isopropylthiogalactoside  K  thousand  kb  kilobase pair (s)  kDa  kilodalton (s)  1  litre (s)  LB  Luria-Bertani  LH  left-hand  LHH  left-hand hairpin  M  moles/litre  mA  milliamperes  mg  milligram (s)  min  minute (s)  ml  millilitre (s)  MLTF  major late transcription factor  mM  millimolar  mu  map unit  MVM  Minute Virus of Mice  NaOAC  sodium acetate  ng  nanogram (s)  NS  nonstructural proteins  nt  nucleotide (s)  ORF  open reading frame (s)  PCV  packed cell volume (s)  PEG  polyethylene glycol, carbowax  pM  picomole (s)  PMSF  phenyl methyl sulfonyl flouride  Pol II  RNA polymerase II  RE  restriction enzyme (s)  RF  replicative form  RH  right-hand  RHH  right-hand hairpin  RIA  radioimmunoassay  RPHA  reverse passive haemagglutination  RNA  ribonucleic acid  rpm  revolutions per minute  RT  room temperature (approximately 23 °C)  SDS  sodium dodecyl sulfate  sec  second (s)  SN  supernatant  ss  single-stranded  TB  Terrific Broth  TEMED  N,N,N',N'-tetramethylethylene diamine aminomethane  Tris  tris(hydroxymethyl)aminomethane  u  unit (s)  UAS  upstream activating sequence  Hg  microgram (s)  y\  microlitre (s)  UV  ultraviolet  V  volts  vDNA  viral DNA  VP  viral protein (s)  W  watts  Xgal  5-bromo 4-chloro 3-indolylgalactoside  1 INTRODUCTION  Transcriptional regulation of eukaryotic R N A from yeast to mammals, has many common features. within the D N A  Polymerase II in organisms ranging These include cis-acting elements  sequence such as TATA-boxes, CAT-boxes, U A S or upstream activating  sequences and enhancer elements, all of which are bound by transcription factors (proteins) which either increase or decrease transcription (reviewed in McKnight  and Tjian, 1986;  Struhl, 1987).  Eukaryotic viruses have been very useful in studying specific aspects of  transcription.  Indeed, adenovirus has been used so extensively as a model system for  eukaryotic transcription, that it is often referred to as "the eukaryotes".  bacteriophage-lambda  of  The small, well defined genome of viruses required host factors for gene  expression: hence many of the viral regulatory signals mimic those of the host cell.  For  example, the promoter-specific transcription factor, Spl, was first detected in HeLa cells on the basis of its ability to activate the SV40 early promoter (Dynan and Tjian, 1983a; Dynan and Tjian, 1983b).  Spl  binds upstream of many viral and cellular genes, and through  specific protein-DNA interactions, it contributes directly to promoter strength in vitro (Dynan et al., 1986; Gidoni et al.; 1985; Jones et al., 1985; Jones and Tjian, 1985) and in vivo (Benoist and Chambon, 1981; Everett et al., 1983; McKnight and Kingsbury, 1982; McKnight et al., 1984).  Another example of related host cell and viral transcription factors includes the  mammalian enhancer factor A P - 1 , yeast transcription factor G C N 4 and the product of the V - j u n gene of avian sarcomaviruses (Bos et al., 1988). The recent discovery of a pathogenic parvovirus, B19, provided another useful system to study regulatory signals of a human virus within human cells (Pattison, 1988). A. T h e Discovery of a H u m a n Parvovirus,  B19  During the mid 70's, Vandervelde et al. (1974) were testing human sera for hepatitis B  surface  antigen  (HBsAg)  using  reverse  passive  haemagglutination  (RPHA),  radioimmunoassay (RIA), and gel electrophoresis. Three sera were positive by electrophoresis but negative by R P H A and RIA (Vandervelde et al., 1974; Pattison, 1988). Two of the three electrophoretic positive sera contained Hepatitis-B-like particles when viewed by electron  2 microscopy, but  the third serum  characteristic of a parvovirus.  showed  viral particles  with  a diameter  of  23  nm,  The viral particles of the third serum were immunologically  distinct from other known parvoviruses (Cossart et al., 1983; Pattison, 1988).  The B19 virus  derived its name from inclusion of that third serum in a quality control panel, for HBsAg testing, as number 19 in panel B.  The anomalous results were due to the fact that H B s A G  positive human sera used in electrophoresis tests also contained antibodies to B19 antigens, while hyperimmune animal sera used in R P H A and RIA  tests was monovalent for HBsAg  (Pattison, 1988). At that time no human diseases were related to parvoviral infection. B. Review of Parvoviruses Including B19. 1. General Description of Parvoviruses Intact virions of the parvovirus family are small, nonenveloped and 20-25 nm in diameter (for general references see Ward and Tattersall, 1978; Berns, 1984; Pattison; 1988). Under an electron microscope, icosahedral particles composed of multiple capsomers are visible and easily distinguishable from most other virus groups by their small size. comprises  DNA  19-37% of the total mass of infectious particles. The viral particles have no  apparent lipids, carbohydrates, cellular or virally encoded enzymes or histone-type proteins. Each virion contains a linear single stranded (SS) approximately 5 kilobases (kb) in length.  nonpermuted D N A  molecule  A long single-stranded coding region comprising  90% of the genome is bracketed by shorter terminal palindromic regions capable of forming hairpin duplexes (Bourguignon et al., 1976).  The packaged strand may be predominantly of  one polarity, the minus strand (complement of the coding sense), or a mixture of strands of both polarities packaged in separate virions (Siegl and Gautschi, 1973). There are some  standard  conventions  when discussing  the parvovirus  genome  (Armentrout and Linser, 1978). The genome is drawn with the coding sense going from left to right (mRNA 5' to 3' direction). DNA  Therefore, for viruses packaging mainly a single-sense  strand, the 3' end of the virion is the left-hand end (LH) and the 5' end is the  right-hand end (RH).  Parvovirus genomes are divided into 100 map units (m.u.).  Map unit  3  one corresponds to nucleotide 1 of the plus or coding strand and m.u. 100 corresponds to the last nucleotide of this strand. 2. Classification of Parvoviruses Originally, parvoviruses were divided into three genera; autonomous parvovirses and dependoviruses  which  infect  vertebrates;  and densoviruses  which  infect  insects.  Dependoviruses, alternatively known as adeno-associated virues (or AAV), require a helper virus (either herpesvirus or adenovirus) for DNA replication. Dependoviruses have direct terminal repeats which contain palindromes, and package both plus and minus DNA strands equivalently.  Autonomous parvoviruses, capable of independent replication, have unique  ends which contain palindromes and they preferentially package the minus strand (Tattersall and Cotmore, 1988). Little is known of Densoviruses. The Densovirus genomes which have been characterized package equal amounts of plus and minus strands (Kelly et al., 1977; Tijssen et al., 1985).  The genome of the densovirus, DNV-1, appears to contain direct  terminal repeats (Tijssen et al., 1985). The distinction between autonomous parvoviruses and dependoviruses which has been based on independent or helper-dependent replication, the type of genome packaged, and the structures of the genomic termini (Siegl et al., 1985) is no longer as clear cut. The autonomous parvovirus, LuIII, packages equal amounts of plus and minus strands (Bates et al., 1984). The adeno-associated virus, AAV5, replicates independently in mutagen-treated host cells (Yalkinoglu et al., 1985) and AAV2 replicates in chemically synchronized cell populations (Yakobson et al., 1987).  B19, classified as an autonomous parvovirus, also  packages equal numbers of complementary strands into separate virions (Summers et al., 1983).  The B19 ends form terminal hairpins (Cotmore and Tattersall, 1984) and DNA  sequence analyses from molecularly cloned B19 termini indicate extensive homologies between the termini (Shade et al., 1986). The overlapping similarities between dependoviruses and autonomous parvoviruses has resulted in classification of vertebrate parvoviruses according to the properties of their DNA genome; Type A viruses would package plus and minus strands and have direct  4  terminal repeats (B19 or AAV2); and type B viruses would package predominately one strand (the minus strand) and have unrelated palindromic ends. Viruses within each group may be autonomous or helper-dependent (Astell, 1988). 3. Pathogenicity of Parvoviruses The original isolation of many autonomous parvoviruses, mostly from tumors, suggested that these viruses may play a causal role in neoplastic transformation (Kilham and Olivier, 1959; Toolan, 1961). The mitotically active state of the tumor presumably supplied the necessary environment for viral growth and replication. Latent infections by these viruses may actually interfere with and suppress the subsequent formation of tumors in their hosts (Toolan, 1967; Toolan and Ledinko, 1968; Bergs, 1969; Toolan et al., 1982). Parvoviruses generally cause fetal and neonatal abnormalities by destroying specific cell populations which are rapidly proliferating during the normal course of development (Margolis and Kilham, 1975; Kilham and Margolis, 1975; Berns, 1984; Lipton and Johnson, 1972; Porter and Cho, 1980). Post-birth or adult infections of animal species, which may be fatal, involve extensive destruction of gut epithelium and reticuloendothelial cells (Berns, 1984; Porter and Cho, 1980). Although first discovered in 1975, it was 1981 when B19 was implicated as the causative agent of a transient aplastic crisis (or temporary cessation of red blood cell production) in people with hereditary sickle cell anemia (Pattison et al., 1981; Serjeant et al., 1981). Since then, B19 has been associated with aplastic crisis in other hemolytic diseases such as hereditary spherocytosis (Kelleher et al., 1983; Mortimer et al., 1983c), pyruvate kinase deficiency (Duncan et al., 1983) and thalassaemia (Rao et al., 1983). The common factor to all these hereditary aneamias is a defective red blood cell, compensated for by hyperactive bone marrow production of red blood cells. B19 also causes a common childhood rash called Fifth's disease (Anderson et al., 1983) and transient postinfection arthropathy or polyarthralgia syndrome in adults (White et al., 1985; Reid et al., 1985).  5  The virus can cross the placentas of women infected during pregnancy (Brown et al., 1984), causing an immune response in the foetus (Knott et al., 1984). It has been associated with some cases of hydrops fetalis (Knott et al., 1984; Brown et al., 1984; Bond et al., 1986; Anand et al., 1987). In Japan, one documented case of hydrops fetalis appears to be a direct cause of intrauterine B19 infection (Matsunaga et al., 1988). Recently it was shown that in immunosuppressed individuals, persistent B19 infection causes chronic bone marrow failure (Kurtzman et al., 1987) Like other parvoviruses, B19 appears to have a propensity for mitotically active cells. What is uncertain is whether the many effects are all caused by the same strain of B19 or by different strains of B19. 4. General Life Cycle of Parvoviruses Infected cells are lysed in the productive life cycle of a parvovirus. Virions bind to specific cell-surface receptors, and for the autonomous Minute Virus of Mice (MVM), N-acetyl neuraminic acid residues appear to play an essential role in binding (Tattersall and Cotmore, 1988). MVM binds efficiently to a number of species but some differentiated cell types lack receptors and are completely resistant to viral infection (Spaholz and Tattersall, 1983). Internalization probably takes place through coated pits (Linser et al., 1977). The genome is transported to the nucleus but whether it arrives as an intact or uncoated virion is unclear (Tattersall and Cotmore, 1988). Viral entry and accumulation in the nucleus proceeds independent of cell cycle (Siegl and Gautschi, 1973; Rhode, 1973), but viral replication and gene expression is dependent upon cellular factors expressed transiently during the the S-phase of the cell cycle (Tennant et al., 1969; Tattersall, 1972; Siegl and Gautschi, 1973; Rhode, 1973; Hampton, 1970). The differentiated state of the host cell is also critical for viral replication. (Mohanty and Bachmann, 1974; Miller et al., 1977; Tattersall, 1978). Large internal deletions of MVM have shown all critical cis-acting sites necessary for replication are located near the termini (Faust and Ward, 1979). Within 2 hours of entering S-phase of the mitotic cycle all viral proteins can be detected, which is well before amplification of duplex viral DNA is observed (Tattersall and Cotmore, 1988).  6  There are three phases of viral DNA replication: synthesis of double-stranded (ds) replicative-form (RF) DNA from the infecting parental viral DNA (vDNA); the synthesis of concatamer RF molecules, and the excision and packaging of vDNA progeny (Astell et al., 1985; Astell, 1988; Pattison, 1988). Southern hybridization analysis of erythroid cells from B19 infected bone marrow culture has detected similar RF DNAs and replication is probably similar to other parvoviruses (Ozawa et al., 1986). Restriction mapping and DNA sequencing show the right-hand termini of MVM and H - l (a rat virus) replicative form (RF) DNA exists in two alternative sequence orientations, termed "flip" and "flop", occurring with equal frequency.  The 5' end of MVM viral DNA also exists in both orientations (Astell et al.,  1983a; Rhode and Klaassen, 1982; Astell et al., 1985). This type of sequence inversion is also found for both terminal repeats of packaged AAV DNA but not the LH of either RF or virion DNA from MVM.  A modified "rolling hairpin" mode for replication has been  proposed, taking into account the above features (Astell et al., 1985; Pattison, 1988). A protein is covalently linked both to the 5'-terminus of H - l and MVM RF DNA, and to a fraction of total SS viral DNA. Immunologically unrelated to the viral proteins, this covalently linked protein was proposed to be of cellular origin (Chow et al., 1986; Revie et al., 1979). However, more recent studies indicate it is likely a proteolytic product of NS1, the major nonstructural protein of the parvovirus (Cotmore and Tattersall, 1986c). Linear double stranded adenovirus DNA also has a protein covalently bound at the 5' termini. Since adenovirus replication origins are at or near the termini (Coombs et al., 1979; Rekosh et al., 1977; Stillman and Bellett, 1979) it has been suggested that site-specific nicking by a terminal protein is required for processing and maturation of the MVM termini and/or for initiating replication from the RF molecules of parvoviruses (Astell et al., 1985; Astell et al., 1983) It is unknown whether B19 has a similar protein bound to its terminus during replication. 5. Propagation of B19 B19 is considered an autonomous Parvovirus though no cell-culture system is available for the propagation of this virus: a requisite for demonstrating that a helper virus is not required by B19 (Pattison, 1988).  All attempts for propagation of the B19 virus in  7 long-term cultures have failed (Pattison, 1988). The virus has been successfully propagated in short-term suspension cultures of bone marrow obtained from people with sickle cell anemia (Ozawa et al., 1986.) Erythroid cells normally comprise 30% of total bone marrow cells, but increase to 50-70% in people afflicted with sickle cell anemia.  Viral propagation was  enhanced by the addition of erythropoietin which induces red blood cell production (Ozawa et al., 1986). Like other parvoviruses studied to date, B19 replicates only in actively dividing cells.  Acute sera from B19 infected individuals inhibits erythroid colony formation when  added to clonal assays of normal bone marrow (Mortimer et al., 1983a).  Presumably,  erythroid progenitor cells are infected and lysed by B19 present in the acute sera. In in vitro infected bone marrow cell cultures, anti-leukocyte antibodies are used to separate erythroid and leukocyte fractions. Immunoblotting analysis revealed B19 proteins only in the erythroid fraction (Ozawa and Young, 1987).  Whether the specificity of B19 for erythroid cells is  dependent on viral replication or viral entry remains to be determined (Pattison, 1988) 6. Genome Organization of Parvoviruses. Including B19 The protein coding regions of all parvoviruses are confined to one DNA strand, the plus strand by definition. For parvoviruses which encapsidate strands of one sense, this coding strand is the complement of that virion DNA molecule. frames (ORF) span the entire genome.  Two large open reading  The left-hand ORF encodes nonstructural proteins  (NS) and the right-hand ORF encodes capsid polypeptides (VP) (for review, Berns, 1984) . The organization of the B19 genome is generally similar to other parvoviruses. (Shade et al., 1986; Cotmore et al., 1986; Ozawa et al., 1988). C. RNA Polymerase II Transcription To understand RNA transcription from parvovirus promoters, one should first consider the known features of eukaryotic promoters. 1. In vitro Determination of Eukarvotic Promoters Cellular extracts are routinely used to characterize active eukaryotic promoters.  In  vitro reactions containing mammalian extracts (Weil et al., 1979; Manley et al., 1980; Manley et al, 1983; Dignam et al., 1983) accurately initiate transcription by RNA polymerase II from  8 either mammalian or viral promoters. The simplest in vitro reaction depends solely on the recognition of the "TATA" sequence (or TATA-box) in a DNA template.  In mammalian  cells, the site of transcription initiation for RNA Polymerase II (Pol II) is confined to a region about 30 bp downstream of a TATA-box (Breathnach and Chambon, 1981). Pol II transcripts synthesized in vitro are efficiently capped and methylated at the 5' ends (Weil et al., 1979; Manley et al., 1980). Pol II does not terminate transcription in vitro, so distinct RNA products are generated by "run-off assays. Restriction enzymes (RE) are used to cut the DNA downstream or 3' to a putative start site. Pol II runs off at the end of the DNA fragment yielding a population of RNA molecules of discrete size. Pol II is inhibited by low levels of a-amanitin and detection of a particular length of an a-amanitin sensitive RNA product positions the promoter site relative to the terminus of the DNA fragment. There are some limitations to such procedures.  Start sites of RNA can only be  mapped to within twenty nucleotides whereas the start site may be accurately determined to within one nucleotide by primer extension (Ghosh et al., 1980). A synthetic complementary oligodeoxyribonucleotide is annealed to RNA isolated from in vitro reactions, extended with dNTP's and reverse transcriptase, and sized on a denaturing urea-acrylamide gel by comparison to DNA which has been sequenced using the same primer in a typical dideoxy nucleotide termination reaction (Sanger et al., 1977). With in vitro transcription assays, the activity of different promoters can vary markedly with changes in total DNA concentration  and extract concentration (Fire et al.,  1981). Also, the in vitro activity of promoters may not accurately reflect in vivo activity. Extracts of uninfected cells initiate at either early, intermediate or late promoters sites of adenovirus with roughly the same efficiency. Adenovirus infected extracts selectively initiate at early or late promoters dependent on the time of extract preparation during the course of the lytic infection (Fire et al., 1981) 2. Factors Involved in Minimal Transcription Chromatographic fractionation and biochemical analysis of mammalian cell extracts have revealed four separate activities required to reconstitute accurate initiation by purified  9 Pol II from a promoter containing a TATA element (Matsui et al., 1980; Samuels et al., 1982). A series of steps to initiate transcription were proposed based on in vitro transcription from an assembly of these cellular fractions; template commitment; activated complex (rapid-start complex formation) formed in the absence of nucleotides; and rapid transcription inititation (within 1 min) upon addition of nucleotides (Samuels et al., 1982; Hawley and Roeder, 1985). A factor TFIID (also known as TATA-box factor, DB, or BTF1) specifically recognizes and binds to the TATA element to form a stable preinitiation complex or committed template complex (Sawadogo and Roeder, 1985b; Shi et al., 1986; Davison et al., 1983; Concino et al., 1984).  A protein TFIIA (AB or STF), when added to TFIID, facilitates  formation of a stable preinitiation complex on the promoter in the absence of Pol II (Egly et al., 1984; Samuels and Sharp, 1986; Fire et al., 1984,). Two other transcription factors, TFIIE (BTF2 or CB II) and TFIIB (BTF3 or CB I), are then required in addition to Pol II for accurate initation of transcription (Moncollin et al., 1986; Reinberg and Roeder, 1987a; Reinberg et al., 1987b; Zheng et al., 1987).  TFIIB binds stably to Pol II as demonstrated by  the observation that both sediment as a complex in glycerol gradients.  TFIIB forms a  Complex with Pol II that is transcriptionally active in the presence of other transcription factors (Zheng et al., 1987). There is no evidence purified TFIIB interacts with DNA or is required for formation of a stable preinitiation complex (Zheng et al., 1987; Davison et al., 1983). The interaction of TFIIB in Pol II initiation is not yet understood.  It has been  suggested that some interactions between a stable preinitiation complex (TFIIA, TFIID, and the major late promoter of adenovirus 2) and the TFIIB-RNA polymerase B complex could be mediated through TFIIE (Zheng et al., 1987). Sawadogo and Roeder (1985b) suggested TFIID binding bends the DNA near the TATA box causing downstream regions of DNA to wind around the transcription factor, thereby specifying the site of initiation approximately 30 bp downstream.  From DNAase I  footprinting, TFIID interacts with a large region of the promoter. The main area of protection lies over the TATA box, however four turns of the downstream helix including  10  the initiation start site are superficially in contact with TFIID (Sawadogo and Roeder, 1985b; Shi et al., 1986).  In yeast, transcription initiation is 60-120 bp downstream of the  TATA-box. A yeast protein functionally similar to the mammalian TATA element-binding transcription factor, TFIID, substitutes for TFIID in mammalian Pol II in vitro transcription reactions, forms a stable preinitation complex on the adenovirus major late promoter (MLP), and binds specifically to the TATA boxes of mammalian and yeast promoters (Buratowski et al., 1988). The yeast factor protects only a region centered over the TATA element but promotes initation at a distance from the TATA element typical of a mammalian system. The evidence suggests that the initiation site is not determined solely by TFIID (Buratowski et al., 1988) but by some other process(es). Some recent in vitro experiments by Workman and Roeder (1987) have shown TFIID, when prebound to the adenovirus major late promoter before nuclesome reassembly, enhances subsequent transcription from that promoter. The results suggest that TFIID binding could make the adenovirus promoter accessible to Pol II. The exact role of TFIID binding remains unclear, but TFIID could have multiple functions. The mechanism(s) of Pol II transcriptional regulation remain elusive, but a number of alternatives are possible. Regulation may be at the level of initiation, alternative splicing, polyadenylation site choice, methylation and possibly termination. D. Regulation of Transcription Initiation 1. Transacting Factors The  most commonly characterized  form of transcriptional regulation is the  stimulation of transcription by regulatory proteins (transacting factors) that bind to specific DNA sequences (cis-activating sequences) upstream of promoters.  Many promoters have  been characterized with multiple cis-activating sequences including SV40 (Zenke et al., 1986), simian and human cytomegalovirus (Jeang et al., 1987), human metallothionein gene (Lee et al., 1987), Rous sarcoma virus (Sealey and Chalkley, 1987), and human histone H2B gene (Sive et al., 1986). Control of initiation is multi-modal. It may be a combinatorial process whereby the presence of different cis-activating elements allows the interaction of a number of factors to  11  elevate or depress transcription, for example CTF and Spl in SV40 (Jones et al., 1985) or AP-4 and AP-1 in SV40 (Mermod et al., 1988). Specific DNA binding proteins may have their actions mediated through other non-DNA binding proteins to elevate transcription (COUP and S300-II; Tsai et al., 1987), or depress transcription (AP-2 and SV40 T Antigen; Mitchell et al., 1987). Controlling the level of any of these factors could have a variable effect on transcription from different promoters. The OTF2 factor (Scheidereit et al., 1987), present only in B-cells, interacts with an octamer sequence upstream of immunoglobulin promoters to allow tissue specific expression of these genes (Staudt et al., 1986; Wirth et al., 1987; Weinberger et al., 1986; Sen and Baltimore, 1987; Landolfi et al., 1986; Singh et al., 1986; Sen and Baltimore, 1986). Steroids, whose actions are mediated through steroid receptors interacting with specific sequences within promoters (hormone responsive elements), control the expression of entire classes of genes (Evans, 1988). Temporal expression of H2B or histone transcription is controlled by the production of specific factors such as OTF1 (Fletcher et al., 1987) only during S phase (Sive et al., 1986). The cellular promoter-specific factor E2F (Kovesdi et al., 1986a; Kovesdi et al., 1986) is activated in a postranslational manner upon cellular infection with adenovirus, by the product of the 13S-E1A gene (Reichel et al., 1988).  Whether the E1A product  covalently modifies E2F or interacts allosterically with it to activate it is unclear. Some other indirect mechanism involving the El A product and E2F could also be involved. 2. DNA Binding Domains of Transacting Factors Characterized transactivating factors have separate DNA binding domains and transactivation domains (Keegan et al., 1986; Brent and Ptashne, 1985; Struhl, 1988). The DNA binding domains are sequence specific.  Two distinct structural motifs have been postulated for  specific DNA-binding proteins, the "helix-turn-helix" of prokaryotic repressors and activators (reviewed by Pabo and Sauer, 1984), and the "zinc-finger" of eukaryotic transcription factors (Miller et al., 1985; reviewed by Harrison, 1986; Hartshorne et al., 1986; Rosenberg et al., 1986).  12  One of the better characterized transacting factors of eukaryotes is TFIIIA, a Xenopus RNA polymerase III transcription factor. It has nine tandemly repeated sequences of a 30 amino acid unit (Miller, 1985, Brown et al, 1985). Each structural repeat, called a finger, has the general form of Cys-X _ -Cys-X -Phe-X -Leu-X -His-X -His (Miller et 2  4  3  5  2  3  al., 1985; Berg, 1986). The 2 cysteine and 2 histidine residues are believed to coordinate a Zinc(II) ion to give a metalloprotein structure interacting with DNA. One TFIIIA protomer is bound per 50 bp of DNA and each finger recognizes about 5.5 bp, or one-half a double-helical turn. The evidence for a structural repeat of 5.5 bp is supported by a 5.5 bp periodicity of guanine residues in the TFIIIA binding site (Rhodes, 1985). Methylation protection and nuclease digestion data (McCall et al., 1986) indicate the protein lies on one side of the double helix, with its 'fingers inserted every half-turn into the major grove. The 1  fingers of the protein are hypothesized to fold as a twisted /5-sheet and the amino acids between would span the minor grove (Miller et al., 1985). A fusion protein expressed in E. coli,  with 89 amino acids from TFIIIA containing 3 zinc fingers is sufficient for  sequence-specific binding to DNA by DNAse I studies.  Zinc is also required for specific  DNA binding as shown by electrophoretic gel retention assays (Nagai et al., 1988). Several other DNA-binding proteins have finger sequences (Rhodes and Klug, 1986; Hartshorne et al., 1986; Rosenberg et al., 1986). The cysteine-zinc finger of the Gal4 protein, replaced with a similar region from the yeast Mal63 protein, retains Gal4 specific DNA binding activity although the activity was reduced (Johnston et al., 1988). These result are consistent with the idea that a cysteine-zinc finger forms a general DNA binding domain. Preliminary evidence suggests that a single zinc-finger has an independent structure sufficient for DNA binding (Suzanna et al., 1988) Molecular dynamic studies  of TFIIIA, which calculated  minimal enthalpy  configurations of TFIIIA, suggest that two of the zinc fingers may fold to form stable ahelical regions, while the intervening domain appears to have an extended structure.  This  would be an alternate mechanism for a protein to form a helix-turn-helix DNA binding region to facilitate site specific interactions with DNA (Michaels et al., 1988).  13  3. Interactions with TFIID The gene-specific transcription factor MLTF (also called USF), purified from HeLa cells, causes a 10-20 fold increase in transcription from the adenovirus major late promoter (Ad MLP).  Enhanced transcription was demonstrated in an in vitro system reconstituted with  TFIIB, TFIID, TFIIE, and Pol II, in the presence or absence of MLTF.  DNA footprint  analyses show that MLTF was interacting with a palindromic DNA sequence, located 50 to 60 residues upstream of the inititation site (Sawadogo and Roeder, 1985b). Dissociation rate measurements  indicate a cooperative  interaction  between  MLTF  and TFIID when  simultaneously bound to the promoter (Sawadogo and Roeder, 1985b). Limiting transcription to one round of inititaion, there is a 5 fold increase in the number of template DNA molecules that form a committed complex (preinitiation complex) in the presence of MLTF (Merino et al., 1988). To achieve the 10 to 20 fold increase in transcription observed by the addition of MLTF, mechanism(s) other than the formation of additional commmitted complexes must somehow enhance transcription. In vivo  experiments support the establishment of stable transcription complexes in  the presence of transactivating factors.  Delayed competition experiments were done with  COS cells infected with SV40 and a second temperature sensitive replicating plasmid containing cis-activating sequences homologous to those in SV40. After enhancer-dependent transcription was established at the SV40 early promoter, temperature shifts to allow the replication of the competing plasmid have no effect on enhancer-dependent transcription. The experiments did not show whether enhancer factors are an integral part of transcription complexes (Wang and Calame, 1986).  Possibly, with the formation of a transcription  complex, a transactivating factor (such as MLTF) could dissociate and participate in the formation of another stable committed complex. TATA elements responsive to the Ad El A gene product all share the same consensus sequence (TATAA) (Green et al, 1983; Wu et al., 1987; Simon et al., 1988). DNA mutagenesis analysis and fusions of this TATA-box sequence to a chloramphenicol acetyl transferase (CAT) gene both show that the specific TATAA sequence is responsive to the  El A product (Wu et al., 1987).  14 Either El A affects distinct proteins which interact with  different TATA sequences or a single TATA factor is somehow affected by El A and recognizes various sequences differently (Simon et al., 1988) The recent purification of the TATA binding factor supports the existence of a single factor (Buratowski et al., 1988). Given the interaction of MLTF with TFIID it seems likely the TATA factor may also be multifunctional or under allosteric control by different factors. 4. Interactions with the Basic Subunit of Pol II One suggested control in transcription initiation is through direct interaction of Pol II with transactivating factors. The evidence for control of transcription initiation is based on both structural and functional studies of Pol II. There is an exceptional conservation of RNA polymerases in all organisms (Allison et al., 1985).  Comparison of the nucleotide  sequences of hamster, mouse, and Drosophila RP021 DNAs (the largest subunit of RNA Pol II), reveal an amino-terminal sequence that is homologous to the corresponding enzyme of E. coli  (Allison et al., 1985; Bartolomei, et al., 1988; Corden et al., 1985; Allison et al., 1988).  The carboxy-terminal domains (CTD) in RP021 are unique to eukaryotes, and consist of tandemly repeated heptapeptide sequences with 27 and 52 repeats in yeast and hamster respectively (Corden et al., 1986; Allison et al., 1985). There is no CTD equivalent found in the subunits of RNA polymerase I or III (Buhler et al., 1987; Allison et al., 1985), suggesting it serves a special function in transcription of Pol II genes. The repeating elements of the CTD are not needed for accurate transcription in a minimal system which has no cis-activating elements upstream of the promoter (Sigler, 1988). Sequential deletions of the C-terminus have established that a minimum number of 9-11 heptapeptide repeats are essential for RP021 function in yeast cells (Nonet et al., 1987). Replacement of the yeast heptapeptide repeats by the longer hamster repetitive domain resulted in viable yeast cells (Allison et al., 1985). The consensus repeat of the CTD is Tyr-Ser-Pro-Thr-Ser-Pro-Ser, in which the tyrosine and proline residues are virtually invariant.  A monoclonal antibody,  believed to recognize this domain, blocks accurately initiated in vitro transcription (Dahmus and Kedinger, 1983) A synthetic peptide analog containing five heptapeptide repeats inhibits  15  Pol II.transcription from the Ad M L P and mouse dihydrofolate reductase promoter in vitro, but has no effect on randomly initiated transcription of calf thymus DNA by Pol II or accurately initiated transcription by Pol III.  The kinetics of inhibition indicate the  C-terminal peptide analogue antagonizes formation of an initiation-competent transcription complex (Allison et al., 1988). From these results, Ingles et al. (1987) and Allison et al. (1988) suggested the C-terminal domain of Pol II has a role in transcription initiation by binding a special class of Pol II transcription factors. The tandemly repeated structure of the CTD could provide a series of sites for interaction with DNA-binding proteins present in RNA polymerase II initiation complexes at variable or multiple positions relative to Pol II. While DNA binding domains for transactivating factors are usually sequence specific, the transcriptional activation domains of these appear to have both functional and structural similarities. Fusion proteins containing the DNA binding domain of one factor fused to the activation domain of another factor are capable of activating transcription from the binding domain of the former (Brent and Ptashne, 1985; Struhl, 1988). Short segments rich in acidic amino acid residues are present in transcriptional activation domains and are required for positive activation (Hope and Struhl, 1986; Ma and Ptashne, 1987). Derivatives of the yeast GCN4 transcription factor, containing acidic regions of 35 to 40 amino acids fused to a DNA-binding domain, are transcriptionally functional in vivo. Deletion analysis and proteolytic mapping suggest the activation region is a repeated structure composed of small units acting additively. A short peptide, designed to form an amphiphathic a-helix with negative charges on one surface, was sufficient to substitute for the activation portion of GAL4 in transcriptional assays (Giniger et al., 1985). The acidic character of transcription factors such as GCN4 and GAL4 may be important for interaction with transcriptional machinery (Hope et al., 1988). Acidic amino acids could be involved in forming a network of hydrogen bonds between the transcription factor and hydroxyl groups on the side chains of amino acids on RP021 C-terminal repeats. Possibly the relative strengths of promoters in different tissues or in cells in different physiological states is influenced by the degree to which different trans-acting factors have  16  competing, overlapping, or separate recognition sites on the RP021 C-terminal domain (Allison et al., 1988). If the C-terminus of Pol II interacts with acidic activating regions on transactivating factors, interaction by that factor with the CTD, should be limited to the distance within which the CTD tail of Pol II extends.  Sequential deletions of the CTD domain have  demonstrated that a minimum length of 9 to 11 heptapeptide repeats, on the carboxy terminus of RP021, is required for spore viability in tetrad analyses (Allison et al., 1988). Smaller derivatives of the Gal4 protein, which maintain the acidic activating site, enhance transcription better when placed progressively closer to the TATA box sequence. The enhanced transcription observed with smaller derivatives of Gal4 when moved progressively closer to the TATA box could reflect the limit of physical extension, and correspondingly the putative interaction, of both the CTD tail of Pol II and the transcription factor (Ruden et al., 1988). A synthetic DNA octamer sequence (5'-ATCGAAAT-3') was inserted at different positions from -40 to -70 nucleotides upstream of a /J-globin TATA box. The synthetic octamer sequence could direct lymphocyte-specific RNA synthesis when transfected into a myeloma cell line, with no strong dependence on positioning of the octamer to the TATA box (Wirth et al., 1987). The upstream activating sequences (UAS) of yeast can be inverted and moved relative to the TATA box without affecting activity (Guarente and Hoar, 1984; Struhl, 1984). Activating regions of other transacting factors have been fused to segments of the LexA or Gal4 proteins responsible for DNA site specific binding. The fusion proteins are functional and not dependent on the alignment of their respective binding sites to the TATA sequence.  The potential flexibility of the repeating unit which makes up the CTD  (Allison et al., 1988) might allow a certain degree of independence with respect to the TATA box and a transactivating factor which may bind upstream to the TATA box. Direct interaction of the CTD domain of Pol II with any known transactivating factors has yet to be shown.  A  I-labeled derivative of the heptapeptide repeats from the CTD, using  17  photoaffinity crosslinking techniques, binds to a specific protein (72 kDA) in HeLa cell extracts (Moyle and Ingles, 1988). The identity of this protein remains to be determined. Factors binding to DNA interact with each other and the location of protein binding sites relative to each other can be critical. Insertion of 5 or 15 basepairs between cis-activating sequences in the SV40 early promoter has a profound effect on in vivo transcription whereas two insertions of 10 or 21 basepairs do not (Takahashi et al., 1986). Other studies have shown proteins bound to the same side of the DNA helix interact with each other more readily than proteins bound on opposite sides of the DNA helix, in vitro and in vivo (Dunn  al.,  et al., 1984; Hochschild and Ptashne, 1986; Kramer et al., 1987; Takahashi et  1986; Hahn et al., 1986).  Electron microscopy reveals  that protein-protein  interaction,with concomitant formation of DNA loops, is favored when binding sites for these proteins are aligned on the same side of the DNA helix (Kramer et al., 1987; Griffith et al., 1986). Direct interactions of DNA-bound proteins with other DNA-bound proteins close to the initiation site, or even with elements of the Pol II transcription complex, would result in looping out of intervening sequences and bring the activating portions of the factors into contact with the Pol II complex (Ptashne, 1986).  This could also explain why some  cis-activating sequences act to enhance transcription when located up to several kilobases upstream or downstream of a promoter. 5. Other Mechanisms bv Which Factors may Alter Transcription Adenovirus El A proteins stimulate Ad MLP transcription by altering the kinetic pathway of the transactivating factor, MLTF, binding to an upstream activating sequence (UAS).  Kinetic analyses show the stimulation of MLTF binding by El A is due to the  accelerated rate of formation of the MLTF-UAS complex (Albin and Flint, 1988). The Xenopus sperm H2B gene which is not expressed at the embryo stage has two CCAAT motifs. Embryonic extracts contain a novel factor that binds with high affinity to sequences overlapping the CCAAT element proximal to the promoter, preventing DNA interaction with CCAAT-binding factors.  This suggests the CCAAT displacement protein  may repress embryo specific transcription of the sperm H2B gene (Barberis et al., 1987).  18  Two purified binding factors, AP-4 and AP-1, bind to adjacent sequences to activate SV40 late transcription in vitro. Half the maximal amount of both AP-1 and AP-4 together result in a higher level of induction than the maximal amount of either factor alone suggesting a synergistic effect of both factors (Mermod et al., 1988). AP-1 and SP1 both bind SV40, however the AP-1 site is further upstream from the early promoter than the Spl site. A mutant GC-box which does not bind Spl also results in failure of AP-1 to stimulate transcription, suggesting that interaction of AP-1 with Spl may be required to transmit its effect over a distance (Lee et al., 1987). A different activator element may be used by a variety of different genes in conjunction with other elements to confer transcriptional specificity (Dynan and Tjian, 1983a; McKnight and Tjian, 1986; Gidoni et al., 1984; Gidoni et al., 1985). 6. Multifunctional Transacting Factors CTF is a transcription factor which selectively recognizes eukaryotic promoters containing the sequence CCAAT.  CTF has been purified to homogeneity and is  biochemically indistinguishable from NF-I (Jones et al., 1987).  NF-I binds with high  affinity to a specific sequence element within the adenovirus origin of replication and binding is absolutely required for efficient initiation of replication (Guggenheimer et al., 1984; Rawlins et al., 1984; Leegwater et al., 1985).  Very recently another transcription  factor, octamer binding factor (OTF-1), has been shown to be identical to the DNA replication factor NF-III (O'Neill et al., 1988). The mechanism(s) used by these factors to function in both transcription and DNA replication is unknown. £. Modulation of Transcription by Covalent Alteration of Transacting Factors 1. Phosphorylation Binding of transactivating factors can be controlled by phosphorylation. The binding of a transcription factor from pea is reversibly regulated by phosphorylation (Cashmore and Katta, 1988). Another transacting factor, ADR1, activates transcription from the alcohol dehydrogenase II gene (ADH2).  Phosphorylation diminishes ADR1-mediated  transcriptional activation of ADH2 (Cherry et al., 1988).  It is not clear whether  19  phosphorylation of ADR1 directly affects its binding to the Pol II complex. If ADR1 was interacting directly with the CTD domain of Pol II; one might expect the additional negative charges of a phosphorylated ADR1 to enhance transcription, not to diminish transcription. Many other transcription factors are polyphosphorylated proteins and phosphorylation or dephophorylation events may affect their activities (Imbra and Karin, 1986; Imbra and Karin, 1987). 2. Methvlation Methylation may be component of a multilevel control of transcription (for review see Yisraeli and Azyl, 1984).  Inhibition of genomic methylation by 5-azacytidine can  reactivate genes on the transcriptionally inactive X chromosome (Mohanadas et al.; 1981; Jones et al., 1982) and induce tissue-specific gene expression (Ivarie and Morris, 1982; Lan, 1984).  In vitro  hypermethylated sequences, when transformed into recipient cells, are not  expressed (Stein et al., 1982; Busslinger et al., 1983).  Other results suggest that cytosine  methylation may be involved in structural ordering of chromatin (Keshet et al., 1986; Buschhausen et al., 1987).  Methylated M13 phage constructs assume DNase I-insensitive  conformations when transfected into eukaryotic cells (Keshet et al., 1986).  Methylated  thymidine kinase DNA, reconstituted with histones prior to microinjection into Xenopus, is biologically inactive.  Conversely, non-methylated thymidine kinase DNA was actively  expressed by non-methylated constructs (Buschhausen et al., 1987).  It is unclear whether  methylation affects either the accessibility of the above promoter regions to activating factors by disturbing nucleosome positioning, or by direct steric hindrance to the binding of an activating factor to a specific DNA site. Two examples of methylated cis-activating sequences which alter transcription have been reported.  Transcription from the Pg^ promoter of the bovine papilloma virus is  responsive to the upstream site specific binding of the E2 transactivating factor.  The E2  binding core contains a single CpG site whose methylation reduces E2 response by the Pgg promoter in transient transfections and enzymatic CAT assays (Turek et al., 1988). It is both  20  unclear whether E2 factor binding is affected and if methylation of this site actually does occur in vivo. The enhancer binding nuclear factor, NF-^B increases expression of endogenous kappa (K) genes in pre-B cells but not plasma cells. At the plasma cell stage transcription activation of K genes is coupled to hypomethylation of the K locus and enhancer independence.  It is unclear whether hypomethylation is unfavorable for the binding of  NF-j^B or whether the interaction by other proteins frees the gene from enhancer dependence (Delley and Perry, 1988). F. Regulation of Pol II Termination Transcriptional interference is the name given to inhibition of the downstream a-globin gene by transcription of an upstream a-globin gene (Proudfoot, 1986). The existence of a mechanism such as transcription interference suggests transcriptional termination could be used to regulate gene expression by preventing interference between adjacent genes. The selective use of termination signals, if proven, may provide a novel way of regulating activity of eukaryotic genes (Proudfoot, 1986).  At this point there is little  information as to what constitutes a functional termination site in mammalian genes. G. Alternative Splicing and/or polvadenvlation regulates mRNA Production The removal of intervening sequences from primary transcripts by RNA splicing is an essential step in the maturation of most eukaryotic mRNA precursors (for reviews see Padgett et al., 1985; Nevins, 1983; Leff et al., 1986; Sharp, 1987). Mature RNAs may be polyadenylated. In some cases polyadenylation appears to affect the sites used for splicing and in other cases splicing affects the sites used for polyadenylation.  Although  polyadenylation is generally thought to precede splicing (Nevins and Darnell, 1978), in the case of adenovirus, splicing choice may determine the polyadenylation site in processing of the major late trancripts (Adami and Nevins, 1988). In B-cell development, two forms of IgM heavy-chain (n) mRNA result from the same transcription unit as a result of varying sites of polyadenylation.  A switch from n  m  to n mRNA during B-cell differentiation s  appears to be a selective switch in the choice of polyadenylation site (Galli et al., 1988).  21  Presumably, the availability of certain factor(s) changes during cellular differentiation to favor one polyadenylation site over the other. Splicing requires the juxtaposition of two segments of RNA for joining.  Part of  the specificity for this reaction is encoded in the consensus sequences found at the 5' and 3' splice junction sites.  The splicing preference of two closely situated 5' splice sites is  dependent upon splice site sequence and could control the level of each alternative spliced message (Eperon et al., 1986).  Competition among splicing factors and polyadenylation  factors can also determine the type of mRNA production. overlapping mRNAs produced by the adenovirus E3 gene.  One example of this is the Four nt upstream of a  polyadenylation signal used by one mRNA, an overlapping mRNA has a 3' splice site. As might be predicted, if the polyadenylation signal is destroyed, the overlapping mRNA is exclusively produced.  In addition, if insertion mutants are made which increase the distance  between the 3' splice site and the polyadenylation signal, the overlapping mRNA is produced exclusively (Brady and Wold, 1988).  Presumably, the close apposition of splice sites and  polyadenylation sites in the wild type gene results in direct competition for these sites by polyadenylation factors and splicing factors. Increasing the distance between the 3' splice site and the polyadenylation signal removes the direct competition, and favors the production of the overlapping mRNA. While unproven, one could speculate that increasing or decreasing levels of polyadenylation factors or splicing factors during the cell cycle could alter the level of overlapping mRNAs from the same gene. Small nuclear ribonucleoprotein particles (snRNP) composed of protein and small nuclear RNAs (snRNA) are crucial factors for recognition of 5' and 3' splice sites. Altering levels of such factors could alter the RNA processing to change the output of a transcription unit. Two U4 snRNA genes in domestic chickens (Hoffman et al., 1986) code for U4B RNA and a sequence variant U4X RNA. Using specific hybridization probes, it has been shown that both are expressed in all chicken tissues, although the relative accumulation of either varies from tissue to tissue. In embryonic tissues, the U4X:U4B RNA ratio is higher than corresponding adult tissues. It has been suggested that U4X may function primarily as the  22  embryonic U4 snRNA and the ratio of U4X:U4B RNA could play a role in tissue specific development (Korf et al., 1988). It remains unclear what role, if any, that U4 RNA has in tissue development. Alternative splicing can be under either temporal or tissue specific control. One example of temporal control is the exclusive splice in the mRNA of a P-transposable element. The splice occurs only in the germ line of Drosophila and restricts that element to the germ line of Drosophila. A transformer locus of Drosophila is turned on in females and off in males by controlling the 3' splice site used in removal of the first intron (for review and references see Bingham et al., 1988). Calcitonin and calcitonin gene related peptide (CGRP) both originate from the same gene. Calcitonin mRNA is produced in the thyroid and CGRP mRNA in neurons. Studies suggest the splicing factor(s) required to produce CGRP mRNA is primarily restricted to neurons.  The absence of these splicing factor(s) in other tissues  results in calcitonin mRNA production, in what might be considered as the default RNA processing choice (Rosenfeld et al., 1988). In adult muscle, specific trans factors might be required for generation of the alternatively spliced adult form of troponin (Andreadis and Nadal-Ginard, 1988).  The protein of the suppressor gene of the white apricot locus in  Drosophila [su(w )] is turned on and off by controlling splicing of its primary transcript. a  A  fully spliced RNA is sufficient for su(w ) function. The su(w ) protein autoregulates its a +  a  production by repressing removal of the first intron resulting in a nonfunctional RNA (Bingham et al., 1988) Transfection experiments of plasmacytoma cells with various immunoglobulin gene constructs suggest a connection between promoter type and mRNA processing. Expression of cytoplasmic  immunoglobulin 1 mRNA  requires  immunoglobulin promoter drives transcription.  a  non-specific  intron  when an  The need for introns is obviated when  cytomegalovirus or heat-shock promoters are used (Neuberger and Williams, 1988). The exact nature of this control is unclear.  23  H. Transcription of Parvovirus Promoters I. Transcription and Translation Autonomous parvoviruses such as MVM and HI have two functional promoters, one each at map unit (mu) 4 and at mu 39 (Pintel et al., 1983; Lebovitz and Roeder, 1986). The dependovirus AAV2 has three functional promoters, one each at mu 4, 19, and 40 (Carter et al., 1984).  In MVM, three major spliced and polyadenylated RNAs (R1-R3) have been  identified; all 3 are transcribed from the virion (-) strand of DNA. Two transcripts, Rl and R2, originate from the promoter at mu 4. The most abundant viral RNA molecule, R3, is a product of the promoter at mu 38. All transcripts terminate at the right-hand (RH) end of the genome (Pintel et al., 1983). In vitro  translation of mRNA from MVM infected cells results in 4 major viral  encoded proteins. Non-structural protein 1 (NS-1, 85 kDa) and NS-2 (25 kDa) are products of Rl and R2 respectively.  Capsid protein 1 (VP1) and VP2 are both products of an  alternatively spliced R3 message.  There is a 1:5 ratio of VP1 to VP2 from the in vitro  translation of mRNA, similar to that found both in assembled empty capsids and from proteins purified from viral particles (Cotmore et al., 1983). Recently the splicing of a small intron common to all MVM RNAs was elucidated. Three splice patterns, occurring at mu 45, generate a total of three R l , three R2, and three R3 transcripts.  The Rl transcripts all encode NS1, as the alternate splicing is outside the  coding region. However the multiple R2 transcripts could encode three distinct NS2 proteins, each differing by a few amino acids at the carboxyterminal end. Two of the R3 transcripts encode VP2 while one encodes VP1 (Morgan and Ward, 1986). Whether there is any specific control over these splicing patterns has not been determined. In B19 all transcripts initiate from a left-hand (LH) promoter both in vitro and in vivo (Blundell  et al., 1987; Doerig et al., 1987; Ozawa et al., 1987). At least 9 overlapping  poly (A) transcripts have been identified in infected cells. +  Three of the 9 transcripts  terminate in the middle of the genome (Ozawa et al., 1987). An immunoblot of translated RNA from infected cells show that one transcript, which covers the entire LH side of the  24 genome, encodes a single nonstructural protein (Ozawa and Young, 1987; Ozawa et al., 1988). This nonstructural protein (NS1, 77 kDa) and two other minor nonstructural proteins are present only in the nuclei of erthrocytes from in vitro infected bone marrow (Ozawa and Young, 1987). The two minor nonstructural proteins probably represent degradation products of NS1 (Ozawa et al., 1988). The other two transcripts, which terminated in the middle of the genome, have most of the intervening sequence of NS1 removed and they apparently do not code for any proteins. Also, the two transcripts terminating in the middle of the genome are very abundant, by SI nuclease analyses, relative to the other transcripts. Their functional significance, if any, is unknown (Ozawa and Young, 1987). All six transcripts encoded by the RH side of the B19 genome have 5' leader sequences of about 60 bp with the remainder of the intervening sequence of NS1 removed (Ozawa et al., 1987). The two largest transcripts contain the complete coding sequence of VP1 (84 kDa) and either one or both of these RNAs is translated (Ozawa et al., 1987; Ozawa et al., 1988). Two slightly smaller transcripts contain the coding sequence of VP2 (56 kDa) and either one or both of these RNAs is translated (Ozawa et al., 1987; Ozawa et al., 1988). On an immunoblot of protein translated in vitro from RNA isolated  from infected bone  marrow, VP2 (56 kDa) was the major capsid species and VP1 (83 kDa) only a minor species (Ozawa et al., 1988). The sizes of VP1 and VP2 are the same as immunoprecipitated proteins localized mainly in the cytoplasm of both sera from B19 infected patients (Cotmore et al., 1986) and erythrocytes from in vitro B19 infected bone marrow (Ozawa and Young, 1987). The two smallest transcripts, encoded by the RH side of the B19 genome, contain a limited coding sequence of 87 amino acids from the very RH of the genome.  Whether the two  smallest transcripts are translated and what their functional significance may be, is unknown. 2. Regulation At least some of the proteins of parvovirus are multifunctional.  Frameshift  mutations of the nonstructural NS-1 prevent excision and replication of viral sequences of an infectious plasmid clone of MVM following transfection. NS1 may play an essential role in viral DNA replication by cutting or nicking DNA at specific sites  (Merchlinsky, 1984).  25  Highly conserved DNA sequences in the parvovirus NS1 proteins of B19, MVM, and AAV-2 have a strong similarity to the T antigens of polyomaviruses, SV40, and the putative El proteins of papillomaviruses These regions have been implicated in ATPase and nucleotide binding activities in papovavirus and SV40 proteins (Astell et al., 1987). In SV40 T antigen, this ATPase is associated with a helicase activity required for the initiation of SV40 replication (Dean et al., 1987). Early in infection the NS-1 protein of B19 accumulates in the nucleus of infected cells in two major forms; one co-migrates with its in vitro translation product and the second, a phosphoprotein, migrates more slowly with an apparent higher molecular weight (Cotmore and Tattersall, 1986c).  The functional significance of the  phosphorylated protein, if any, remains unknown. Frameshift mutations of capsid genes may inhibit SS DNA and virion synthesis but allow high levels of duplex DNA replication (Merchlinsky, 1984). Presumably, a functional capsid protein has some role in maturation of the SS virion from duplex B19 RF DNA. Quantitative RNA hybridization and nuclease protection assays, to study infected RNA from highly synchronized cells, show mRNAs generated from the MVM LH promoter at mu 4 (P4) appear prior to mRNAs generated from the viral P39 promoter. Preliminary experiments with temperature sensitive mutants of the MVM NS1 protein indicate temporal expression of the p39 promoter is mediated by the NS1 gene product (Clemens et al., 1988). The NS1 protein of HI parvovirus also up-regulates transcription from the viral promoter at P38, but down regulates activity of its own P4 and other heterologous promoters (Rhode, 1985; Rhode 1985b).  A cis-activating element upstream of the HI P38 promoter is  responsive to transactivation by NS1 (Rhode and Richards, 1987), although whether NS1 binds to this element is unknown. Cotransfecting a construct containing a putative B19 middle promoter-CAT gene fusion and a B19 fragment which expresses NS1 failed to show any activity from a middle promoter. These results agree with SI nuclease analysis of RNA isolated from B19 infected bone marrow cells (Ozawa et al., 1987). The NS1 protein of B19 may have other functions but its role in transcriptional regulation is likely to be quite different to that of the NS1 proteins of such parvoviruses as AAV2 and MVM.  26  Transcription of the MVM P4 promoter is dependent on an Spl-type factor in HeLa extracts (Gavin et al., 1988).  Promoters  at P39 in MVM and H - l also have  CCAAT-sequences 87 nt upstream of the TATA-box.  Whether these have any role in  transcription is unknown. In vivo,  a 142 nt transcript has been identified which originates from the P4  promoter of MVM and terminates immediately downstream of a short nucleotide sequence capable of forming alternative secondary structures (Ben-Asher and Aloni, 1984).  Either  readthrough or premature termination occurs depending on the secondary structure, in a manner analogous to attenuation in prokaryotes (Yanofsky, 1981).  The abundance of full  length mRNAs from the P4 transcription unit may be regulated by interaction of a viral gene product with this sequence during RNA synthesis (Ben-Asher, and Aloni, 1984). With a single active promoter, abundance of B19 transcripts cannot be regulated by differential promoter strength or trans-activation of other promoters by nonstructural proteins. Alternative splicing, selective choice of alternative polyadenylation, or pausing in the middle of transcription could control the abundance of RNAs produced (Ozawa et al., 1987). It has been suggested that the three B19 transcripts which terminate in the middle of the genome may use an unusual polyadenylation signal (Ozawa et al., 1987). Whether there is any relation between the site of termination, and the use of an unusual polyadenylation signal, is unknown. I. Transcriptional Studies of B19 1. DNA Sequence Analyses of B19-Wi At the time I started studies of B19-Wi, the DNA of one strain, B19 Augusta or B19-Au, had been partially sequenced in our lab. No other B19 strain had been sequenced. In addition, the transcriptional strategy of B19 was unknown. B19-Au was obtained from the serum of an individual suffering acute aplastic crisis. The B19 Williams strain (or B19-Wi) was obtained from the serum of an asymptomatic blood donor, who tested serologically positive for B19 (Cotmore and Tattersall, 1984). It was of interest to characterize B19-Wi to determine the variation between B19-Wi and B19-Au DNA sequences which had been  27  isolated over a 10 year time span, and to see if this variation could be correlated to the symptoms of infection. There is a precedence for different strains of other parvoviruses of the same serotype to have different pathogenic potentials.  MVM has two strains closely  related in sequence (Astell et al., 1983; Astell et al., 1986). The immunosuppressive strain, MVM(i), infects lymphocytes and the prototype strain, MVM(p), infects fibroblasts. The primary defect in restrictive infection seems to be a result of decreased initiation of viral transcription (Tattersall and Cotmore, 1988). Transfection experiments using recombinants of the two genomes suggest a mutable genetic element in the virus may determine the type of differentiated cell the virus could lytically infect (Astell et al., 1983; Astell et al., 1986; Tattersall and Cotmore, 1988) The DNA of B19-Wi is cloned as two separate BamHI fragments in the vector pAT153 (Cotmore and Tattersall, 1984). An asymmetric series of overlapping deletion clones for either end of B19 were created by using Exonuclease III and SI nucleases (Henikoff, 1984). This technique proved very useful relative to other methods such as "shotgun cloning" because it was a methodical approach for obtaining a series of clones spanning the entire length of the genome. Sequence data comparisons between B19-Au and B19-Wi allowed the alignment of unconnected sequences in one or the other strain. 2. In vitro Transcription Previous analyses of the B19-Au genome had identified up to four putative promoters. Five TATA sequences are clustered at the extreme LH of the viral genome with additional TATA boxes at nt 1225 (mu 22), 2247 (mu 41), 2308 (mu 43), and 2986 (mu 57) and 3 with appropriately spaced upstream CAAT sequences at nt 1196, 2283, and 2950 (Shade et al., 1986).  In vitro  runoff assays with B19 fragments in HeLa cell extracts were  undertaken to show which, if any, of these promoters were active. 3. Multiple Cis-activating Sequences Preliminary results of in vitro run-off transcription assays indicated the presence of a relatively strong promoter at the left end of the B19 genome. Sequence analyses identified the presence of an enhancer-like element within the strong promoter.  Such elements are  28  composed of a number of cis-activating sequences. There is a possibility that some of these sequences could be involved in both transcription and replication. 4. A HeLa Factor Binds to a GC-box In this study it was found that a GC-box at nt 319 of the B19 genome stimulated in vitro  transcription with HeLa nuclear extracts. DNA sequence analyses indicated that this  GC-box was a high affinity site for SP1, a transactivating factor known to enhance transcription of the SV40 early promoter as well as many other eukaryotic genes. Gel-shift assays revealed that factors in HeLa extracts specifically bound to a fragment containing the GC-box. In the presence of HeLa extracts the GC-box was protected in DNA footprinting analysis using DNAse I. The G residues, located within the GC-box and protected in DMS footprinting studies, are the same as those protected in other characterized SP1-binding sites. The same G-residues, when methylated, inhibited factor binding in DMS interference experiments.  Site-specific mutagenesis of nucleotides within this site depressed in vitro  transcription. The GC-box was further characterized by making a synthetic double stranded oligonucleotide containing the same GC-box.  The synthetic GC-box was also bound by  factors in HeLa nuclear extracts, as shown in gel-retention assays.  The synthetic GC-box  reduced transcription when added to in vitro reactions transcribing the LH B19 promoter. A second synthetic GC-box, differing only by the addition of a single methyl group to a cytosine residue within the GC-box, was used as a control in all experiments in which the synthetic GC-box was used. Methylation of the GC-box appeared to modulate both factor binding and transcription.  29  MATERIALS AND METHODS A. Materials All chemicals were analytical or reagent grade. TEMED were purchased from Bio-Rad Laboratories.  Acrylamide, bis-acrylamide and Aldrich Chemical Co. supplied  Acetonitrile (HPLC grade). [a P] dNTP (3000 Ci/mmol), [a P] UTP (400 Ci/mmol) and [-y P] ATP (3000 32  32  32  Ci/mmol) were either from Amersham Corp. or New England Nuclear. Ribo NTPs, deoxy NTPs and dideoxy NTPs were obtained from Pharmacia P-L Biochemicals. Poly [dPdC] was supplied by Boehringer Mannheim and yeast tRNA by Bethesda Research Laboratories. All oligonucleotide primers were synthesized on an Applied Biosystems DNA synthesizer. Restriction enzymes were purchased from Bethesda Research Laboratories, New England Biolabs, Boehringer Mannheim and Pharmacia P-L Biochemicals, and used as specified by the manufacturer. E. coli DNA Polymerase I (Klenow fragment), Exonuclease III and T4 DNA Ligase were supplied by Promega Biotec, Bethesda Research Laboratories or New England Biolabs. SI nuclease came from Bethesda Research Laboratories or Pharmacia P-L Biochemicals.  DNase I was purchased from Worthington or Millipore, and Calf  Intestinal Alkaline Phosphatase (CIP) was from Boehringer Mannheim or Promega Biotec. T Polynucleotide Kinase and RNasin were supplied by Promega Biotec.  4  Proteinase K was  bought from Boehringer Mannheim. Joklik modified Minimal Essential Medium for suspension cultures [with L Glutamine, without NaHCO^], and a-amanitin were supplied by Sigma Chemical Co. L Glutamine, NaHC03, Penicillin-G, and Streptomycin-S0 (all specially tested for cell culture 4  growth) were purchased from Sigma Chemical Co. Fetal bovine serum was obtained from Gibco Company. Agarose (Ultrapure) and Low Melting Point Agarose (Ultrapure), and bovine serum albumin (BSA) were from Bethesda Research Laboratories. The Sep-Pak Cjg cartridges were from Millipore; Nacs Prepacs were supplied by Bethesda Research Laboratories; Gene Clean kits from Bio 101; Biorad Protein assay Reagent from Bio-Rad Protein Laboratories; and a  30  HeLa whole cell transcription kit, prepared according to the Manley method (Manley et al., 1983), was purchased from Bethesda Research Laboratories. B. Strains and Media 1. Bacteria Escherichia coli (E. coli)  K-12 strain JC8111 (recB21 recC22 sbcB15 recF143) was  used to propagate plasmids pYT102 and pYTlOl. The rec minus feature of the JC8111 strain allowed propagation of large palindromes contained in double stranded DNA plasmids (Boissy and Astell, 1985). E. coli strain DH5 [F' endAl hsdR17(r ~ M ~) supE44 thf 1 r-1 recAl k  gyrA96 relAl]  K  (Hanahan, 1983) was used to to propagate subclones of these plasmids. All  plasmids containing the complete left-hand hairpin (LHH) or right-hand hairpin (RHH) were checked for deletions by excising the hairpins and comparing the length of the fragment to the original plasmid preparations of pYT102 and pYTlOl (supplied by P. Tattersall, Yale University). Transformed bacteria were routinely grown in Luria-broth (LB) [5 g yeast extract, 10 g tryptone, 10 g NaCl, 1 g glucose (pH 7.7)] with Ampicillin (100 fig/ml) to selectively maintain the plasmids. Later E. coli containing pUC or pUC-B19 recombinants was grown in Terrific Broth (TB) [12 g tryptone, 24 g yeast extract, 5 g glycerol made up to 800 ml with dH o, autoclaved and added to 100 ml autoclaved 0.17 M KH PO :0.72 M 2  2  4  K2HPO4] supplemented with Ampicillin (100 /xg/ml). TB medium supports cell growth to higher densities and resulted in increased yield of plasmid DNA for a given volume of cell culture. E. coli  JM101 (supE thi lac pro F'traD36 proAB lacflz M15; Messing, 1983) was  used for /?-galactosidase color selection during subcloning of B19 fragments into pUC or Ml3 vectors.  JM101 was maintained on M9 minimal medium plates [1.5% agar(w/v), 5 g/1  Na HP0 , 3 g/1 K H P 0 , 1 g/1 NH C1, 0.5 g/1 NaCl, 1 mM MgS0 , 0.1 mM CaCl , 1 mM 2  4  2  4  4  thiamine-HCl, and 0.2% glucose; Davis et al.,1980].  4  2  M13 transformed JM101 cells were  plated on YT agar plates [1.5% agar(w/v), 8 g/1 Tryptone, 5 g/1 yeast extract, and 5 g/1 NaCl, (pH 7.2-7.4)] with Top Agar [YT + 0.75% agar(w/v); Messing, 1983].  31 -  E. coli  mtl-1, supE44)  RB404 (dam-3, dcm-6, metBl, galK2, galT22, his-4, thi-1, tonA31, tsx-78, were maintained on LB agar and used for synthesis of nonmethylated BstNl  restriction sites on plasmids. E. coli supE44),  RZ1032 (HfrKL 16 PO/45,lysA61, dull, ungl, thil, relAl,  Zbd-279:TnlO,  for preparation of uracil containing M13 templates (Kunkel et al., 1987), was  maintained on LB plates with tetracycline (25 /ig/ml). 2. HeLa Cells Minimal essential medium (Joklik's modified) for suspension culture was made up as recommended by Sigma [2 g NaHCO^/l, 4.5 mg Penicillin-G/1, 100 mg Streptomycin-SO^/l] and the pH adjusted to 7.0, prior to filter sterilization. Fetal calf serum (heat inactivated at 55 °C for 30 minutes) was added [5% (v/v)] and the complete medium (MEM) was stored at 4 °C. MEM was warmed to 37 °C prior to use. Hela S3 cells were a gift from Nathaniel Heintz at Rockefeller University, New York. These cells were supplied in 1 ml aliquots which had been frozen in DMSO and stored at -70 °C. HeLa cells were thawed at 37 °C and immediately centrifuged for one minute to pellet cells.  The supernatant (SN) was discarded and the cells gently resuspended by  vortexing in 1 ml MEM.  HeLa cells were transferred to a 25 ml tissue culture plate  containing 12 ml of MEM and grown to confluence in a CC» incubator (37 °C, H 0 2  saturated, 5% C0 ) in 2-3 days. 2  2  The petri plate was scraped once with a sterile rubber  policeman to dislodge the loosely attached cells from the plate.  HeLa cells were equally  divided between two petri plates with a 10 ml pipette and MEM added to a final volume of 12 ml/plate.  The cell count from confluent plates was approximately 1.0 x lO^cells/plate.  These cells were used to initiate a large scale suspension culture (see section Gl). 3. Plasmids Plasmids pYTlOl and pYT102 containing the B19-Wi genome were gifts from Susan Cotmore and Peter Tattersall, Yale University, Connecticut. described elsewhere (Cotmore and Tattersall, 1984)  The cloning of the B19-Wi genome is  32  C. Basic Molecular Cloning Techniques. Most basic molecular cloning techniques were conducted as described in Maniatis et al. (1982). These routine methods included agarose and acrylamide gel preparation, restriction enzyme site mapping, isolation of DNA fragments from low melting point agarose and acrylamide gels, phenolrCHClj [50:50 (v/v)] extractions, and quantitation of DNA using EtBr/agarose plates. DNA or RNA was precipitated with addition of 1/10th volume 3 M NaOAc (pH 5.2) and 2 volumes EtOH (95%) and immediate centrifugation at 10K rpm in an Eppendorf microcentrifuge for 15-30 minutes (min) at room temperature (RT). 1. Isolation of DNA fragments for subcloning DNA was digested with the appropriate enzyme, phenol/CHCl^ extracted, and EtOH precipitated. For ligation of DNA with cohesive ends, DNA was resuspended in TE [10 mM Tris, 1 mM EDTA (pH 8)]. Fragments to be cloned in the Sma I site of pUC or Ml3 were made blunt-ended using DNA Polymerase I, Klenow Fragment (Maniatis et. al, 1982). Following restriction enzyme digestion, the DNA was repaired with 2 units (u) Klenow fragment in a 50 /il reaction mixture [50 mM Tris-Cl (pH 7.4), 10 mM MgS0 , 0.01 mM 4  DTT, 50 /ig/ml BSA], containing 80 /iM dNTPs]. Following incubation at RT for 15 min, the DNA Polymerase I Klenow fragment was heat inactivated at 70 °C for 10 min.  DNA  fragments in the 30-300 bp size range were separated and purified from 4% acrylamide gels or fragments longer than 300 bp were separated and purified from 0.7% agarose gels (Maniatis et al., 1982). DNA fragments from agarose gels were purified using GeneClean (according to manufacturers specifications). 2. Subcloning Fragments in pUC Vectors Ligations typically contained 0.1-0.2 /ig of linearized plasmid DNA and 2-5x molar excess of insert fragment in 20 /il reaction volumes with 1-2 u T4 DNA ligase, and incubation at 16 °C for a minimum of 12 hr. Ligation buffer contained 50 mM Tris-HCl (pH 7.5), 10 mM MgCl , 10 mM DTT, 1 mM spermidine, 0.1 mg/ml BSA, and 1 mM ATP. 2  33  3. Subcloning Fragments in Ml3 Vectors Ml3 cloning ligation mix routinely contained 0.42 picomoles (pM)/ml Ml3 vector DNA (usually 40 ng per 20 /d reaction), 5x molar excess of insert fragment, ligation buffer and 1-2 u T4 DNA ligase. Reactions were incubated at 16 °C for 16-20 hr (Messing, 1983). 4. Plasmid and Ml3 Transformations Plasmid or Ml3 DNA was introduced into bacteria cells that were made competent by incubation in CaC^ (Messing, 1983). For plasmid DNA transformation, 0.2 ml of CaC^ competent cells were used per reaction. After adding DNA from ligation reactions (3-5 /d), cells were incubated on ice for 30 min, heat shocked at 42 °C for 1.5 min, followed by the addition of 0.8 ml LB or YT medium to each tube. Cell recovery was at 37 °C for 1 hr with gentle shaking. Aliquots (100 /d) of the transformation mix were plated on selection plates and colonies were visible after 12-16 hr at 37 °C. When using JM101 cells in ^-galactosidase color selection to detect inserts into the pUC plasmid, 50 pft. Xgal (2% in dimethyl formamide) and 10 /il IPTG (100 mM) were spread on selection plates 1 hr before transformation mixes were plated. For transformations with M13 DNA, 0.2 ml of CaCl^ competent JM101 cells and 35 nl of DNA ligation mixtures were incubated on ice for 30 min. Following a heat shock at 42 °C for 2 min, cells were added to 3 ml YT top agar that contained 0.2 ml of exponentially growing JM101 cells, 50 (il Xgal (2%), and 10 (il IPTG (100 mM). Cells and top agar mixtures were plated on YT agar plates and plaques were visible after incubation at 37 °C for 10-14 hr. D. Plasmid DNA Isolation. 1. Large Scale Plasmid DNA Preparation Plasmid DNA was isolated by the alkaline lysis procedure (Maniatis et al., 1982) from E. coli cell cultures grown overnight in either TB (200 ml) or LB (500 ml) with antibiotic selection (100 /xg/ml ampicillin). DNA and RNA in the cleared lysates were precipitated by addition of the supernatant (SN) to 0.6 volumes of isopropanol, and pelleted by immediate centrifugation at 5K rpm for 30 min at RT in a GSA rotor. The pellet was  34  washed with 70% ethanol (EtOH) and dried under vacuum for 15 minutes.  Pellets were  resuspended in 10 ml of TE (10 mM Tris-HCl, 1' mM EDTA, pH 8), transferred to 40 ml Teflon tubes, and incubated with pancreatic RNase (20 /ig/ml) and RNAse TI (20 units/ml), for 15 min at 37 °C. Protein was extracted with vigorous vortexing (about 1 min) in an equivalent volume of phenol/CHCl^, centrifugation at 10K rpm for 15 min at RT in a Beckman JA17 rotor and removal of the aqueous layer to a clean 40 ml Teflon tube. DNA was precipitated with 1/10 volume 3 M NaOAC (pH 5.2) and 2 volumes of 95% EtOH, and pelleted by centrifugation for 15 min at 10,000 rpm in a Beckman centrifuge and JA17 rotor. The pellet was washed with 70% EtOH, dried for 5 min under vacuum, and resuspended in 20 ml TE with 1 g/ml CsCl (w/v) and 1 mg/ml ethidium bromide. After incubation for 30 min on ice the tube was centrifuged for 15 min at RT and 10K rpm in a Beckman centrifuge and JA17 rotor to remove any precipitate.  Plasmid was purified from the SN by density  gradient centrifugation in a Beckman ultracentrifuge using a Ti70.1 rotor for 16 hr at 15 °C and 60K rpm. Two bands were usually seen under ultraviolet light (366 nm). The lower of the two bands (covalent closed circular plasmid DNA) was removed with an 18 gauge needle and syringe. EtBr was removed by extracting 4 times with an equivalent volume of water saturated n-butanol. The CsCl was removed by dialysis of the plasmid solution in 1 inch dialysis tubing with two six hour washes in 50 volumes of TE (10 mM Tris-Cl, 1 mM EDTA, pH 8) at 4 °C. DNA was precipitated by the addition of 1/10 volume 3 M NaOAc (pH 5.2) and 2 volumes of 95% EtOH and immediately pelleted at 10K rpm in an Eppendorf microcentrifuge for 15 min at RT. Each plasmid preparation was washed in 70% EtOH, dried under vacuum for 10 min and resuspended in a final volume of 1 ml TE (pH 8.0). DNA concentration and purity were measured using a Shimadzu UV160 spectrophotometer. ^280^260  r a t  '  o s  w e r e  usually 1.81-1.85, indicating a high purity of DNA.  Typical pUC  preparations in E. coli DH5 or JM101 yielded 0.8-1.5 mg DNA/1 when using LB medium and 5-7 mg DNA/1 when using TB medium. Small aliquots (1 /ig) were electrophoresed on 0.7% agarose gels (0.5 Mg/ l EtBr) for m  1 hr at 100 V. DNA standards of known concentration were also run on the same gel. When  35 the gel was observed on a UV transilluminator (300 nm), the plasmid preparations contain no apparent RNA contamination.  The DNA concentrations of these plasmid preparations,  compared to the known DNA standards on the same gel, agreed with spectrophotometer measurements. 2. Small Scale Plasmid DNA Preparation A modified alkaline lysis method (Maniatis et al., 1982) was followed for isolation of plasmid DNA from 1.5 ml of E. coli. Modifications included omission of the lysozyme from Solution 1 and final resuspension of precipitated DNA in 50 /xl TE containing 20 /xg/ml pancreatic RNase and 20 u/ml RNase TI. 3. Ml3 DNA Preparation M13 replicative form (RF) DNA was prepared by either the iw vivo or the in vitro methods (Messing, 1983). In vivo M13 RF DNA (Messing, 1983; Yanisch-Perron et al.,1985) was prepared from a 500 ml culture of JM101 cells infected with the Ml 3 clone of interest. JM101 cells were grown overnight at 37 °C in M9 medium to stationary phase. These JM101 cells were diluted 100 fold in 2x YT medium and incubated for 1 hr at 37 °C with vigorous shaking. A single Ml3 plaque for the clone of interest was picked from a fresh plate and used to inoculate 5 ml of the JM101 cells grown in 2x YT medium, and incubated at 37 °C for 4 hr with vigorous shaking. The cells were pelleted by centrifugation and 5 ml of phage SN and 5 ml of stationary phase JM101 cells were added to 500 ml of 2x YT medium in a 2 1 Erlenmeyer flask and incubated at 37 °C for 4-5 hr with vigorous agitation.  Cells were  harvested by centrifugation at 2000 rpm in a Sorvall centrifuge and GSA rotor for 10 min at 4 °C. The cells were resuspended in 50 ml ice cold STE [0.1 M NaCl, 10 mM Tris, 1 mM EDTA (pH 7.8)] and pelleted a second time as above. Ml3 RF DNA was isolated by the alkaline lysis procedure described for plasmid DNA isolation (Maniatis et al., 1982), and purified by EtBr-CsCl equilibrium density gradient centrifugation.  Typical RF Ml 3  preparations in E. coli JM101 yielded 0.16-0.20 mg DNA/1 when YT medium was used.. In vitro  Ml3 RF DNA was prepared by annealing 2-4 ng Ml3 clone DNA with 10  36  pM of M13 universal primer in a 20 pi reaction mixture containing 10 mM Tris-HCl (pH 8.0) and 5 mM MgCl at 55 °C for 10 min. The primer was elongated for 20 min at RT 2  with 2 u of DNA polymerase (Klenow fragment) and 0.25 mM dNTPs. The reaction was stopped by heat inactivation of Klenow fragment at 70 °C for 10 min. Single-stranded (SS) M13 template DNA was isolated after infecting 1.2 ml JM101 cells (early log phase) with phage from a selected Ml3 plaque, and growing for 4 hr at 37 °C with vigorous shaking. Cells were pelleted in an Eppendorf microcentrifuge for 1 min. The phage SN (800 /xl) was added to 200 pi PEG solution (15% PEG 4000, 2.5 M NaCl) and incubated for 15 min at RT. Precipitated phage were pelleted by centrifugation at 10K rpm for 5 min in an Eppendorf microcentrifuge at RT. The SN was discarded and the pellet microcentrifuged for 5 sec to remove traces of the PEG solution. After resuspension of phage with 100 pi TE [10 mM Tris-HCl, 1 mM EDTA (pH 7.5)], phage DNA was isolated by extracting twice with phenol/CHCl followed by EtOH precipitation. DNA was resuspended 3  in 40 pi TE and stored at -20 °C. E. Preparation of Deletion Clones Sets of deletion clones were prepared with Exonuclease III (Exo III) and SI nuclease for both orientations of the insert present in the Ml3 RF subclone mpl212 and pUC subclone pi467, and one orientation for the pUC subclone p3141 (Fig. 1 A,B) as described by Henikoff (Henikoff, 1984). For each clone, 10 pg DNA was treated with 800 u ExoIII in 100 pi buffer [66 mM Tris-HCl (pH 8.0), 0.66 mM MgCl , 1 mM 0-mercaptoethanol] at 37 °C. 2  Aliquots (5.0 /il) were taken at 30 sec intervals for 10 min, added to 15.0 pi ExoIII stop mix [0.2 M NaCl, 5 mM EDTA (pH 8.0)] per time point, and incubated at 70 °C for 10 min. DNA was precipitated with 3 volumes EtOH (95%) per aliquot, resuspended in 50 /xl SI nuclease buffer [0.25 M NaCl, 30 mM potassium acetate (pH 4.8), 1 mM ZnS0 , 5% glycerol] 4  and treated with 1 u SI nuclease per aliquot for 30 min at RT. The reaction was terminated with 6 pi SI stop solution [0.5 M Tris-HCl, 0.125 M EDTA, (pH 8.0)], followed by phenol/CHCl^ extraction and EtOH precipitation. The termini were repaired by treatment with 0.1 u DNA Polymerase I (Klenow fragment) per aliquot in 10 pi Klenow repair buffer  37  [20 mM Tris (pH 8.0), 7 mM MgCl ] at 37 °C for 2 min, followed by the addition of 1 /xl 2  dNTP mix (0.125 mM) and incubation at 37 °C for an additional 2 min. The deletion clones were religated in 40 /d ligation buffer [66 mM Tris-HCl (pH 8.0), 6.6 mM MgCl , 10 mM 2  DTT, 100 /ig/ml BSA, 1 mM spermidine-HCl] per time point aliquot and 1 u T4 DNA ligase and incubated at RT for 4 hr. Ligation mix aliquots (10 /il) were transformed into E. coli DH5 cells. The extent of deletion was determined by agarose gel electrophoresis of a sample of DNA for each ExoIII/Sl time point aliquot and comparison with both nondeleted DNA, and DNA size standards. Selected deletion clones were characterized by either dideoxy chain termination sequencing (Sanger et al., 1977; Hong, 1981) or chemical sequencing (Maxam and Gilbert, 1980). F. DNA Sequence Analyses of B19 Clones All deletion clones of pi467 were subcloned into Ml3 for sequencing by dideoxy chain termination. When possible, deletion clones of p3141 were also subcloned into M13 and sequenced. It was not possible to subclone into Ml3 fragments which contained the first 600 bp of sequence from the left hand end of B19. These clones were characterized by double stranded sequencing using dideoxy chain termination or by the chemical sequencing of Maxam and Gilbert (1980). 1. Single Stranded DNA Sequencing Single stranded DNA templates (M13-B19 subclones) were sequenced by the dideoxy chain terminator method (Messing, 1983; Sanger et al.,1977; Sanger et al.,1980). Template DNA (5 /il or 1-2 /ig) was annealed with 2 pM Ml3 universal sequencing primer (or insert sequence specific primer) in 10 /il annealing buffer [10 mM Tris-HCl (pH 8.0), 10 mM MgCl , 1 mM DTT] at 55 °C for 5 min. After 10-20 min at RT, 1 /il of [a P] dATP (10 2  32  /iCi) and 1 /il 12.5 /iM dATP were added to the annealed mixture. Four tubes were labelled C,T,A, or G, and 2 /il of DNA/primer mix plus 2 /il of each respective dNTP/ddNTP mix were added. The following nucleotide mixes were used:  38  C mix: 0.011 mM dCTP, 0.25 mM ddCTP, 0.11 mM dGTP, 0.11 mM dTTP T mix: 0.0055mM dTTP, 0.50 mM ddTTP, 0.11 mM dCTP, 0.11 mM dGTP A mix: 0.05 mM ddATP, 0.075 mM dCTP, 0.075 mM dTTP, 0.075 mM dGTP G mix: 0.055 mM dGTP, 0.30 mM ddGTP, 0.11 mM dCTP, 0.11 mM dTTP Tubes were preincubated in a 37 °C H 0 bath for 5 min. DNA Polymerase I (Klenow 2  fragment) was diluted to 0.25 u/pl in lx Kpn buffer [6 mM NaCl, 6 mM MgCl , 6 mM Tris 2  (pH 7.5), 6 mM 8ME]. At time 0 min, 2 pi of Klenow fragment (0.5 u) was added to each C, T, A, and G tube. Following incubation at 37 °C for 15 min, 2 pi of the Klenow fragment (0.5 u) plus 2 pi dNTP (0.5 mM) chase mix were added per tube. Following a second 15 min, 37 °C incubation, 5 pi formamide dye stop mix (95% deionized formamide, 10 mM EDTA, 0.1% Xylene Cyanol, 0.1% Bromophenol Blue) were added. Samples were heated to 90-100 °C for 2-3 min in a H 0 bath to denature DNA and were immediately quick chilled 2  on ice. Electrophoresis conditions were 8% acrylamide (acrylamide:bis-acrylamide, 29:1), 7 M urea gels, 45 W (constant power), 45 mA maximum current in TBE buffer (50 mM Tris, 50 mM borate, 1 mM EDTA (pH 8.3). Samples (2 pi) were loaded at time 0 hr, 1.2, and 2.4 hr, and electophoresis was stopped at 3.6 hr. Gels were dried on Whatman 3MM paper using a vacuum gel dryer. Exposure of XRP-1 film was at RT for 12-16 hr. 2. Double Stranded DNA Sequencing Double stranded DNA was sequenced by the dideoxy chain termination method modified by Hong (Hong, 1981). Plasmid DNA (5 pg of pUC-B19 subclones) purified from CsCl gradients, was digested with Pvu I, a restriction site unique to the pUC vector. The DNA was extracted with phenol/CHCl^, precipitated with EtOH and resuspended in H 0 2  (200 ng DNA/pl).  Ml 3 universal forward primer or reverse primer (10 pM) was added to  template DNA (5 pi or 1 pg) in 10 pi, heated to 100 °C for 3 minutes in a boiling H 0 bath, 2  quick chilled to -70 °C in a C0 /EtOH bath, and thawed. One pi of lOx annealing buffer 2  was added. After incubation for 20 min at RT, 1 pi [a P] dATP and 12.5 pM dATP were 32  added. Subsequent steps were as outlined for single stranded sequencing.  39 3. Chemical DNA Sequencing Chemical sequencing by the method of Maxam and Gilbert (1980) follows the protocol outlined by Maniatis et al. (1982), with the following modifications. After addition of stop solutions and EtOH (95%), base specific modification reactions were incubated at -70 °C in a C0 -EtOH bath for 5 min and subsequently at 0 °C on wet ice for 1.5 min to 2  decrease viscosity. The tube was vortexed vigorously and DNA pelleted at 10 K rpm in an Eppendorf microcentrifuge for 5 min at RT. DNA was resuspended in 250 /il 0.3 M NaOAc (pH 5.2) and 750 /il EtOH (95%) by vigorous vortexing (10-15 sec) and immediately pelleted again in an Eppendorf microcentrifuge for 5 min at RT. Any remaining salt was removed by two more washes with EtOH (95%) at RT and immediate 2 min centrifugations, prior to vacuum drying and treatment with piperidine (Maniatis et al., 1982). 4. Overcoming DNA Sequencing Artifacts DNA bands  visible across all 4 lanes of single or double stranded dideoxy  sequencing gels were a common problem, particularly for clones containing any of the LH or RH hairpins of B19. Sequencing at 50 °C was successful at removing many of these stop sites, presumably by destabilizing hairpins or secondary structures and allowing the polymerase to read through. Single stranded sequencing used 5 pM primer and 1-2 /ig of Ml3 in 10 /il of Hinc buffer [60 mM NaCl, 7 mM Tris (pH 7.5), 7 mM BME, 7 mM MgCl ]. 2  The DNA was denatured at 90-100 °C for 5 min, than immediately frozen in a -70 °C C0 /EtOH bath for 1 min. The DNA was thawed and annealed for 45 min at 50 °C. All 2  subsequent steps were as previously outlined for SS sequencing except the reactions were all done at 50 °C. In some cases chemical sequencing (Maxam and Gilbert, 1980) was the only way to avoid such "stops" observed in enzymatic sequencing. Hairpin formation or strong secondary DNA structures caused compressions or anomalous movements of bands on sequencing gels. The hairpins were resolved initially by electrophoresis of gels at 60 mA, with the gel temperature hot enough to melt secondary DNA structures.  The use of 7M urea-40% formamide acrylamide gels was the most  successful method to ensure complete denaturation of secondary DNA structures.  40  G. Preparation of HeLa Extracts 1. Large Scale Growth of HeLa Cells HeLa cells from 16 confluent cell culture plates were added to a 500 ml roller bottle and made up to a total volume of 240 ml with complete MEM. The roller bottle was purged with 5% C0 /95% air, capped, sealed with Parafilm, and incubated at 37 °C and 60-75 rpm. Cell 2  aggregation on the flask bottom resulted in abnormally low cell counts. The color change of the media from orange to yellow-orange was the best indication that the culture could be split to a larger volume. Within 1-2 days cells were divided equally to a second roller bottle and MEM media added to a final volume of 240 ml per flask. Within 48 to 54 hours, cells from both bottles were collected into a single 1 liter Bellco spinner flask (previously washed in non-phosphate detergent, rinsed well with distilled H 0 and heat sterilized), and an 2  equivalent volume of MEM (480 ml) was added. The cell count was approximately 2 x 10^ cells/ml. The spinner flask was purged with 5% C0 /95% C 0 (repeated whenever the flask 2  2  was opened), sealed with Parafilm and incubated at 37 °C with the spinner bar rotating at 50-60 rpm.  Within 36-40 hours, when the cell count was approximately 6x10^ cells/ml,  MEM was added to a final volume of 1 litre.  Within 24-27 hours, the HeLa cells were  divided equally into two 1 litre spinner flasks and MEM added to make up a volume of 1 1/flask. Within 24 hours, 250 ml more of MEM was added to each spinner flasks for a final volume of 1.25 1/flask. Cells were harvested at 4-6 x 10^ cells/ml. The cell generation time was approximately 24-25 hours. 2. HeLa Nuclear Extract Preparation All buffers were pretreated with diethylpyrocarbonate (0.1%) for 12 hours at 37 °C and autoclaved to inactivate RNase activity.  All glassware was incubated at 200 °C for a  minimum or 4 hours. Freshly made DTT or PMSF [100 mM in isopropanol] were added to buffers just prior to use. All buffers and tubes were prechilled on ice, and the entire preparation was carried out at 4 °C or on ice.  41 HeLa cells (2.5 litres) were harvested at 4-6 x 10^ cells/ml using the procedure of Dignam et al. (1983). The cells were pelleted by centrifugation at 2K rpm in a Sorvall GSA rotor for 10 min. [Note: 6 x 10 cells is approximately 2 ml (the packed cell volume or PCV) when pelleted by centrifugation (Manley et al., 1983)].  HeLa cells were washed and  resuspended in 5 PCV phosphate buffered saline [1 litre: 8 g NaCl, 0.2 g KC1, 0.2 g K H P 0 , 1.15 g Na HP0 , (pH 7.3-7.4, adjusted with Tris-HCl if necessary)]. 2  4  2  4  After  transferring to two 30 ml Corex tubes, the cells were pelleted for TO min at 2K rpm in a Beckman JA17 rotor. The SN was discarded, and the cells were resuspended in 5 PCV of buffer A [10 mM Hepes (pH 7.9), 1.5 mM MgCl , 10 mM KC1, 0.5 mM DTT], and 2  incubated for 10 min. After a 2K rpm centrifugation for 10 min the SN was immediately and carefully decanted. The plasma membranes swell due to the hypotonicity of buffer A and cells pellet rather poorly. HeLa cells were resuspended in 2 PCV of buffer A, transferred into a 15 ml Kontes all glass Dounce homogenizer and broken open with 8-10 strokes of a B pestle. Phase contrast microscopy was used to check for complete cell lysis. The lysed cells were poured into two 15 ml Corex tubes and the crude nuclei pelleted by centrifugation at 2K rpm for 10 min in a Sorvall GSA rotor. The SN was discarded and the pellet centrifuged for 20 min at 13,500 rpm (25,000 G  A v e  ) in a Beckman JA17 rotor.  Residual SN was  discarded and the crude nuclei were resuspended with buffer C [20 mM Hepes (pH 7.9), 1.5 mM MgCl , 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT, 20% glycerol (w/v)], using 2 ml 2  per 10^ cells, by gentle vortexing (Heintz and Roeder, 1984).  The crude nuclei were  transferred into a 7.5 ml Kontes all glass Dounce homogenizer and lysed with 8-10 strokes of a B pestle. This mixture was transferred into a 10 ml Erlenmeyer flask (with a magnetic stir bar) and stirred gently for 30 min. While stirring, the conductivity (millimho) of a 50 p\ aliqout (diluted to 1 ml in H 0) was measured and plotted on a standard KC1 curve ([KC1] vs 2  millimho).  The KC1 solutions, used to derive a standard KC1 curve, were made up in  distilled H 0. The KC1 concentration of the lysed nuclei was adjusted with the addition of 2  2M KC1, so the conductivity of the lysed nuclei equaled the conductivity of the 0.33 M KC1 solution.  The lysed nuclei (a gelatinous mix) were poured into a 15 ml Corex tube and  42  centrifuged for 30 min at 13500 in a Beckman JA17 rotor.  The SN was dialyzed in 50  volumes buffer D [20 mM Hepes (pH 7.0), 20% glycerol (w/v), 0.1 M KC1, 0.2 mM EDTA, 0. 5 mM PMSF, 0.5 mM DTT] for 4-5 hr at 4 °C. The nuclear extract was transferred to a 15 ml Corex tube with a Pasteur pipette and centrifuged for 25 min at 13,500 rpm in a Beckman JA17 rotor. Aliquots of the SN (100-300 pi) were quick frozen in a C0 /EtOH 2  bath, and stored in liquid N . 2  Protein concentration of HeLa nuclear extracts was  determined using a Bio-Rad Protein Assay kit with BSA as the standard.  Nuclear extract  preparations generally contained 8-14 pg protein/pl with a total yield of 15-20 mg Q  protein/10 cells. 3. Sephacrvl S300 Fractionation of HeLa Nuclear Extract Fractionation of the nuclear extract used the procedure of Briggs et al. (1986) except nuclear extract from 5 litres of HeLa extract was prepared as outlined above. The nuclear extract was precipitated with 53% saturated ammonium sulfate and centrifuged at 35,000 xG for 15 min at 4 °C. The pellet was resuspended in TM buffer [50 mM Tris (pH 7.9), 12.5 mM MgCl , 1 mM EDTA, 1 mM DTT, and 20% glycerol] to a final protein concentration of 2  about 30 mg/ml.  This extract was applied to a Sephacryl S300 column (2.5 by 40 cm)  equilibrated with TM buffer containing 0.1M KC1. Protein elution was monitored using a Bio-Rad Protein Assay with BSA as the standard. The column was previously calibrated with Blue Dextran and Vitamin B12 to determine the void volume (V =75 ml) and total volume Q  (V=160 ml) of the column. t  Flow rate was set to 1 ml/2 min and 2 ml fractions were  collected. Every other fraction from V to V was tested for factor binding in gel-assays as Q  t  outlined below. H. Transcription Analyses 1. Plasmid Preparation Template DNA (20 pg) was digested with 40 units of the appropriate restriction enzyme for one hour in a final volume of 200 pi. Protein was removed by two extractions with an equivalent volume of phenol/CHCl^.  DNA was precipitated with EtOH, washed  43  once with EtOH (70%), vacuum dried (3 min) and resuspended in TE [10 mM Tris-HCl, 1 mM EDTA (pH 8)]. The concentration of DNA was measured by A-jgQ and aliquots were run on 0.7% agarose gels against DNA standards of known concentration. 2. Run-off Assays Transcription assays contained 10-15 /il of nuclear extract in a final volume of 25 /il. Final concentrations for various components (including those contributed by the extract) were: 12 mM Hepes (pH 7.9 at 22 °C), 12% (v/v) glycerol, 0.3 mM DTT, 0.12 mM EDTA, 60 mM KC1, 8 mM MgCl , 5 mM creatine phosphate, 330 fiM each for the three unlabelled 2  triphosphates (GTP, CTP, ATP), 6.25 /iM UTP, 10 /iCi [a P] UTP (400 Ci/mM), and 32  template DNA. The conditions varied for the amount and type of template as indicated. The nuclear extract (stored at -70 °C) was thawed on ice and added to a cocktail (containing creatine phosphate, MgCl , CTP, ATP, GTP, UTP, and [a P] UTP) to start the reaction. 2  32  Standard incubation was for 60 min at 30 °C (Dignam et al., 1983; Manley et al., 1983). Transcription reactions were terminated by incubation with 100 pi Stop Buffer [125 mM Tris-HCl (pH 8), 0.625% SDS (w/v), 200 mM NaCl, 16 mM EDTA, 25 /ig/ml tRNA, and 125 /ig/ml Proteinase K] for 15 min at 30 °C. The mixture was extracted once with an equivalent volume of phenol/CHCl^. RNA was precipitated with 2.5 volumes EtOH (95%) and immediately pelleted at 10K rpm in an Eppendorf microcentrifuge at RT for 15 min. EtOH was carefully removed with a drawn-out glass pipette to minimize possible loss of RNA. Samples were resuspended in 3-5 /il formamide dye mix (95% deionized formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue), and incubated at 90 °C for 1 min. RNA was fractionated on 4% acrylamide-7 M urea gels at 30 W (constant power) for 1^2 "  3  hours.  Gels were dried on Whatman 3MM paper using a vacuum gel dryer.  Exposure of XRP-1 film was at -70 °C with a Cronex intensifying screen for 12-34 hours. Alternatively, RNA samples were fractionated in 1% agarose - formaldehyde gels with 1 x MOPS buffer [5 x MOPS: 0.2 M morpholinopropanesulfonic acid (MOPS, pH 7.0), 50 mM sodium acetate, 1 mM EDTA (pH 8.0); • Maniatis et al., 1982].  Following  44  electrophoresis at 60-100 V for 2-3 hours, gels were dried on Whatman 3MM paper at 80 °C using a vacuum gel dryer. Gels were exposed on XRP-1 film at -70 °C with a Cronex intensifying screen for 12-24 hours. 3. Mapping the Initiation Site Based on the activity of a promoter at the L H end of B19-Wi, the oligonucleotide (5'ATAAATACCTGTTAGTT-3')  was designed since it is complementary  to the B19  nucleotides 414 to 398 (Shade et al., 1986). The synthetic oligonucleotide was purified using a 20% polyacrylamide-7M urea sequencing gel (40 x 20 x 0.05 cm) in TBE buffer. Following elution from the gel by a crush-soak method described by Maxam and Gilbert (1980) using 0. 5 M ammonium acetate, the oligonucleotide was isolated by Cjg Sep-Pak chromatography. The synthetic oligodeoxyribonucleotide was subsequently used by Caroline Beard to map the 5' end of the B19-Wi promoter (Blundell et al., 1987) using the primer extension method (Ghosh, 1980). 1. Gel Retention Studies 1. Dephosphorvlation of DNA fragments The ligation of B19 DNA fragments into the multiple cloning site (MCS) of pUC served three uses; dephosphorylation is very efficient with 5' overhangs, fragments are easy to cut out and isolate with the EcoRI and Hindlll site on either site and restriction sites are available within the EcoRI and Hindlll sites that enable one to obtain fragments uniquely labelled at one end or the other. Plasmids (200 pg) were cut with the appropriate restriction enzyme (either Hindlll or EcoRI/HindlH) in 400 pi to excise the fragment of interest.  The mixture was incubated 2x  with an aliquot of CIP (9 u each time) for 30 min at 37 °C. After the addition of 47 pi lOx STE [100 mM Tris (pH 8), 1.0 M NaCl, 10 mM EDTA] and 22.5 pi of 10% SDS ( / ) the w  v  mixture was incubated for 15 min at 68 ° C to inactivate the phosphatase (Maniatis et al., 1982). Protein was extracted 2x with an equivalent volume of phenol/CHC^ and the DNA was EtOH precipitated and resuspended in 50 pi of T E [10 mM Tris, 1 mM EDTA (pH 8)]. Fragments were fractionated on a 4% acrylamide gel (20 x 20 x 0.3 cm) at 150 V for 1.5-2 hr  45  in TBE. The gel was soaked in an ethidium bromide solution (0.5 /ig/ml) for 15 min and DNA was visible under UV light (302 nm). The desired band(s) was excised and the gel fragment added to a 1 inch dialysis bag filled with TBE. Excess TBE was poured off to leave the minimum volume of TBE with no air pockets. DNA was electroeluted for 15-30 min at 75 mA (constant amperage). The voltage was reversed for 10-15 seconds. Buffer was removed from the dialysis tube and filtered through a glass wool plug at the bottom of a cut off Pasteur pipette, to remove any acrylamide fragments. The dialysis bag was washed with 300 /il of TBE and this was also filtered through the glass wool. DNA was precipitated with EtOH and pelleted for 30 min in an Eppendorf microcentrifuge at RT. EtOH was removed with a drawn out pipette. The pellet was washed with 1 ml of EtOH (95%), vortexed briefly, centrifuged for 2 min, and the EtOH carefully removed with a drawn out pipette. DNA was resuspended in 1 ml TE (pH 7.5) and the concentration measured by absorbance (A) at 260 nm. DNA was EtOH precipitated and washed with EtOH as outlined above, and resuspended in TE (100 ng DNA//d). The concentration of DNA was checked on an agarose gel against DNA standards of known concentration.  The recovery of DNA was 50-90% for fragments  ranging from 30 bp to 90 bp. 2. Radioactive Labeling of DNA Fragments DNA (550 ng), in 10 /il kinase buffer [50 mM Tris (pH 7.6), 10 mM MgCl , 5 mM 2  DTT, 1 mM spermidine, 0.2 mM EDTA, 30 /iCi [7 P] ATP (3000 Ci/mM)] was incubated 32  with T polynucleotide kinase (5u) for 30 min at 37 °C (Maniatis et al., 1982). 4  For chemical DNA sequencing, DNAse I and DMS footprinting, and some gel retention experiments, DNA labelled at only one end was required. After labelling, a small aliquot (0.5 /il) of the mix was saved and added to 2 /il of 0.5 M EDTA (pH 8). This aliquot served as a marker for undigested DNA when electrophoresed in a gel slot beside that of the remaining DNA which was digested with another enzyme as subsequently described. The remainder of the mix was made up to 40 /il in the appropriate buffer containing restriction enzyme (20-40u), and incubated for 60 min at the required temperature for the enzyme.  46  Incubation at 68 °C denatured the protein and prevented smearing when separating fragments on the gel. 3. Isolation of End-labelled DNA The DNA was purified on a 12% acrylamide gel (20 x 20 x 0.1 cm) by electrophoresis at 150 V (constant voltage) for 3-10 hr in TBE. Gels were exposed on XRP1 film for 5-10 min.  Gel slices containing labelled DNA were excised, the DNA was  electroeluted in 1 inch dialysis tubes, precipitated with EtOH and washed as outlined previously. DNA fragments differing by 10-12 bp ranging from 55-110 bp were effectively separated after 1500 Volfhours. DNA was resuspended in 40 /xl H 0 and 2 /xl was counted 2  by Cerenkov counting. A 1 /xl aliquot was run on a gel and compared to DNA standards to determine the concentration. Specific activity for fragments labelled at one end was 750010000 cpm/ng DNA and recovery of 2.5-4.5 x 10^ cpm was common (45-82% recovery based on 550 ng and 10,000 cpm/ng DNA). 4. Gel Shift Assays Gel electrophoresis, used to detect sequence-specific DNA-binding proteins in crude cell lysates (Strauss and Varshavsky, 1984), is based on the reduced mobility of protein-DNA complexes during gel electrophoresis (for review, see Hendrickson, 1985). method outlined by Strauss and Varshavsky (1984) was used.  A modified  HeLa nuclear extracts  (approximately 7 /xg protein) were incubated with 3.2 /xg poly (dl-dC) in 18 /xl of binding buffer [5% glycerol, 10 mM Tris (pH 7.5), 50 mM NaCl, 0.5 mM DTT, 1 mM EDTA, 6.25 mM MgCl , 0.5 mM PMSF, 2% polyvinyl alcohol] for 10-15 min at RT. Two /xl of the 2  3 2  P-  labelled DNA fragment [7500-10000 cpm] in binding buffer were added and incubated for 10-15 min at RT. Three /xl of a dye marker were added [binding buffer, 0.1% xylene cyanol, 0.1% bromophenol blue].  The mixture was loaded onto a low-ionic-strength 4%  polyacrylamide gel (acrylamiderbis-acrylamide weight ratio of 29:1) containing 6.7 mM Tris (pH 7.5), 3.3 mM Na-acetate, and 1 mM EDTA.  The gel (20 x 20 x 0.2 cm) was  pre-electrophoresed for 1 hr at 150 V at RT with the buffer stirred in the lower compartment and recirculated between the compartments. Electrophoresis was carried out for  47 1.5-2 hours at 150 V with buffer recirculation and stirring.  Gels were transferred to  Whatman 3MM paper and dried on a vacuum gel drier for 1 hr at 80 °C. Gels were exposed to XRP-1 film with a Cronex intensifying screen at -70 °C for 12-14 hr. Mobility shift assays done at 4 ° C gave the same results.  The gel shift assay was optimized by varying the  type and amount of non-specific competitor [E. coli DNA vs poly d(IC)], the amount of HeLa extract, and the order in which the components of the mixture were added together and incubated. 5. Competition Assays If potential protein-DNA complexes are observed in gel-shift assays, it is also necessary to demonstrate  specificity of binding.  Adding increasing concentration of  unlabelled homologous DNA (using 1-100 fold molar excess of unlabelled probe) prior to adding the labelled probe, should reduce formation of specific complexes by more than 90%. Competition assays with unrelated DNA fragments similar in size to the labelled probe should compete less and only nonspecifically (Hennighausen and Lubon, 1987). Specificity of protein binding to a [ P] labelled DNA fragment was tested by competition experiments with different fragments of DNA, either upstream of the B19 promoter or from pUC. Competitor DNA (200 ng) was added to the assay containing the nuclear extract with poly d(IC) and incubated for 10-15 min at RT prior to the addition of end-labelled fragment.  J. DNA Footprinting DNA footprinting was done using either protection or interference  techniques.  Protection experiments employ nuclease or chemical probes to analyze DNA sequences that are protected by the bound protein from attack by the probes (Galas and Schmitz, 1978; Ptashne et al., 1980; Simpson, 1982). Using interference or premodification techniques, DNA is first chemically modified, incubated with the binding protein, and modified sites that interfere with binding are determined.  Interference technique provides the most detailed  information on regions of the DNA that make close contact with a binding protein (Hendrickson, 1985).  Some idea of the structure of the protein-DNA complex can be  48  obtained from protection experiments.  The accessibility of modifying reagents to residues  within a binding site will change when specific factors are bound to that site. 1. DNAse I Protection In DNase I protection experiments, DNA fragments labelled exclusively on one end are treated with the binding protein, briefly treated with DNAasel, denatured, and separated on a sequencing gel. A control with fragments treated in the absence of protein is run,on the same gel and an autoradiograph is made of the gel., Where a protein binds to the DNA, an absence of radioactive bands occurs compared to the control.  The exact place where the  protein is bound is located by comparison with the chemical sequence of the same fragment of end-labelled DNA which is run on the same sequencing gel. This approach is only successful when the binding protein is pure enough and in excess quantity to ensure all fragments of DNA are bound to protein. These same techniques can be employed with crude extracts using gel-shift electrophoresis.  DNA is incubated with binding protein and treated  with DNAse I. The protein-DNA complexes are separated from free DNA by electrophoresis on a preparative polyacrylamide gel. Autoradiography is used to locate free-DNA and protein-DNA complex bands. The bands are eluted and electrophoresed in DNA sequencing gels with DNA sequence standards (Hendrickson, 1985). DNAsel footprinting was successful with crude HeLa extracts using a technique outlined by Hendrickson (1985). HeLa nuclear extract (90 fig) was incubated with 32 fig poly d(PC) in binding buffer (180 fii) for 15 min at RT. The [ P] labelled fragment (200,000 32  cpm) in binding buffer (20 fil) was added and incubated for 15 min at RT. DNAse I (1 fig) in binding buffer (20 fil) was added, gently mixed, and incubated at RT for 1 min. Dye marker was added (30 fil) and the mixture was immediately loaded onto a 4% acrylamide gel (20 x 20 x 0.3 cm). The gel was pre-electrophoresed for 1 hour at 80 V in the cold room (4 °C) with recirculated buffer as outlined previously. The conditions outlined ensured that the DNAse I activity was essentially negligible when the DNAse I treated fragment (at RT) was loaded on the gel (at 4 °C). The gel was electrophoresed for 4 hr at 4 °C and 80 V, and exposed to XRP-1 film under a Cronex intensifying screen for 12 hr at 4 °C. Two  49  radioactive gel bands were located and excised. The gel slices were put in 1 inch dialysis tubes with TBE and yeast tRNA (10 pg) to maximize DNA recovery.  The DNA was  electroeluted (as described in Section I above) and the dialysis bag washed once with 300 pi TBE and both fractions filtered through a wool plug. After phenol extraction, the DNA was precipitated with EtOH, washed with EtOH, vacuum dried and resuspended in 1 ml buffer A [7.5 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.2 M NaCl]. DNA fragments were purified on NACS PREPAC columns to remove trace amounts of acrylamide which cause severe band smearing on sequencing gels.  NACS PREPAC  columns were hydrated with 3 ml buffer D [10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 2 M NaCl]. Columns were washed with 3 ml buffer A. Samples were loaded with a 1 ml syringe and columns were washed with 3 ml buffer A. DNA was eluted with 450 pi of buffer D, precipitated with 2 volumes of EtOH (95%) and pelleted for 30 min at 10K rpm in an Eppendorf microcentrifuge. DNA recovery was 80-90% of of the initial Cerenkov counts. DNA was resuspended in a formamide-dye mix [50% formamide, 0.1% Xylene Cyanol, 0.1% Bromophenol Blue] and denatured by heating at 90 °C for 60 seconds. The DNA was fractionated on a 12% acrylamide-7M urea sequencing gel with the same number of counts being loaded for the free and bound bands. Two marker lanes included T and A chemical sequencing reactions for the same fragment.  The gel was electrophoresed for 70  min at 45 W (constant power), vacuum dried onto Whatman 3MM paper and exposed to XRP-1 film for two weeks at -70 °C under a Cronex intensifying screen. 2. DMS Methylation Interference Dimethylsulphate (DMS) methylates the N7 of guanine in the DNA major groove and at a slower rate, the N3 of adenine in the minor groove (Maxam and Gilbert, 1980). Since the G residue is modified at a much greater rate than the A residue, under controlled conditions only the G residue is modified. Samples subsequently treated with piperidine (or NaOH) are cleaved at these modified sites.  Using interference techniques, a radioactively  labelled DNA fragment is treated with DMS such that each molecule is modified once on average at a single G residue. Over the population of molecules, every target site will be  modified in a number of molecules.  50 The modified DNA is incubated with the binding  protein and separated on a preparative polyacrylamide gel. The free and protein bound DNA bands are isolated from the gel and cleaved at the methylated G residues with piperidine. Modified samples from the free-DNA band will exhibit increased cleavage at sites where modification of DNA interferes with protein binding. Samples from protein-DNA complexes will exhibit cleavages at all positions except those important for protein-binding. Contacts are interpreted either as sites of chemical interaction between the protein and DNA or sites of steric interference between the modified DNA and protein (Hendrickson, 1985).  DNA  contacts contributed by each protein in a multi-protein complex can be determined by recovering DNA from the proper positions in the gel (Hendrickson, 1985) The [ P] labelled D272 was treated with dimethyl sulphate (DMS) to methylate the 32  G residues, according to the method of Maxam and Gilbert (1980). The only methodological modification was the replacement of non-specific calf thymus DNA (2 fig) with 2 pg poly d(PC) in the cacodylate buffer. Following DMS treatment, EtOH precipitation, pelleting, and washing, D272 was resuspended in H2O. The same gel-shift protocol for DNAse I footprinting was repeated, except DMS modified D272 (200,000 cpm) was incubated with HeLa cell nuclear extract. The mixture was fractionated and the radioactive DNA bands located by autoradiography (Fig. 10B) and excised. DNA was electroeluted and purified by glass wool filtration, phenol extracted, EtOH precipitation, followed by resuspension in buffer A, Nacs Prepac column elution, and EtOH precipitation. The DNA was washed 3 times with EtOH (95%), vacuum dried, resuspended in 50 pi of 1 M piperidine and incubated for 30 min at 90 °C to cause strand cleavage (Maxam and Gilbert, 1980). After lyophilizing 3x to remove piperidine, the DNA was resuspended in formamide dye mix, fractionated on a 12% sequencing gel and exposed to XRP-1 film. 3. DMS Methylation Protection The same gel-shift protocol for DNAse I footprinting was repeated except 1 pi of DMS was added to D272 (200,000 CPM), and incubated for 3 min prior to loading the gel.  51  After gel electrophoresis and electroelution, DNA was purified on NACS PREPAC columns. The DNA was treated with piperidine, lyophilized, resuspended in formamide, fractionated on a 12% sequencing gel and exposed to XRP-1 film. K. Studies with a Synthetic Oligonucleotide  1. Cloning a Synthetic GC-Box Into pUC Footprinting results suggested that Spl or an Spl-like protein binds to the distal Spl-like motif (or GC-box) of D272. Based on comparison with the consensus Spl sequences (Briggs et al., 1986; Kadonaga et al., 1986), a synthetic oligonucleotide spanning the GC-box from residues 292 to 301 of B19-Wi was designed. Two complementary oligonucleotides, [(5'-TGGGCGGAGC-3') and [(5'-GCTCCGCCCA-3')], were purified and resuspended in TE. Both oligonucleotides (6.7 tig each) were annealed in 40 pi total volume at 55 °C for 10 min and allowed to cool to RT. Diluted mixtures of the annealed oligo mix (335 ng, 67 ng, 13.3 ng) were ligated into the Sma I site of pUC 19 (100 ng) in a final volume of 20 pi and picked by 0-galactosidase color selection of transformed JM101. After CsCl density gradient purification of a large scale preparation, the insert was characterized by DNA sequence analyses using the dideoxy chain termination method (Sanger et al., 1977). 2. Methylated and Nonmethvlated GC-Box Chemical sequencing of the synthetic GC-box showed a missing band at the internal C position of the GC-motif. Cloning of the synthetic GC-box into the Smal site of pUC created a BstNl site [5'-CCAGG-3'] (Fig.l4C).  Plasmids grown in dcm strains such as +  JM10I contain a 5-mefhyl-cytosine residue at the position of the internal cytosine residues in the BstNl site.  Methylated-cytosine residues are not cleaved in chemical DNA sequencing  reactions, hence there is a blank in the sequencing lane. The same plasmid was prepared from an E. coli RB404 (dcm-) strain, which can not methylate cytosine residues in BstNl sites. The GC-box contained within DNA fragments propagated in both E. Coli strains was isolated and chemically sequenced. Methylated and nonmethylated synthetic GC-boxes were compared in gel retention assays and their effect as competitors in transcription assays was measured.  52  L. Site-Specific Mutagenesis of the B19 Promoter Previous studies had shown that site specific mutations within SP1 motifs depress in vitro  transcriptional activity (Gidoni et al., 1985; Jones et al., 1986). Based on site-specific  mutation results of Jones et al. (1986), the two G residues at nt 293-294 (Shade et al., 1986) were each changed to A residues, and the effect on in vitro transcription was tested. 1. Uracil Containing Ml3 Templates A B19-Wi deletion fragment containing the GC-box and downstream initiation site was cloned into the phage, M13mpll (Fig. 20A). The following was a modification for the preparation of uracil containing M13 single stranded templates (Kunkel et al., 1987). Ten ml of 2x YT media was inoculated with 100 /xl of a fresh overnight preparation of JM101 (grown in M9 media), and incubated for 60 min at 37 °C with vigorous shaking. A fresh phage plug from an overnight plate of Ml3 transformed JM101 was added to 1.2 ml of the JM101 inoculated YT media, and incubated for 4 hr at 37 °C with vigorous shaking. After three hours of the phage infected JM101 incubation, an additional two hundred ml of YT media (25 /xg/ml tetracycline) were inoculated with 2 ml of an overnight preparation of RZ1032 and incubated for 1 hr at 37 °C. After four hours incubation, the JM101 cells were separated from the phage containing 2x YT media by microcentrifugation at 10,000 rpm for 2 min at RT in an Eppendorf. Twenty /xl of the phage supernatant were used to infect the 200 ml of E. coli RZ1032 inoculated YT media, and the mixture was incubated for 4 hr at 37 °C with vigorous shaking. The cells were pelleted by a 10 min centrifugation at 5K rpm in a Sorvall GSA rotor at RT. The phage were precipitated from the supernatant (160 ml) by a  15 min incubation  at RT with 0.25  volumes  (40 ml)  of a PEG solution  (15% PEG 4000, 2.5 M NaCl). Phage were pelleted by centrifugation at 5K rpm for 15 min at RT, and the SN was discarded.  Residual SN was removed after a another 30 second  centrifugation at 2000 rpm. The phage pellet was resuspended in 400 /xl TE (pH 8.0). Protein was extracted 2x with phenol/CHCl^ and once with CHCI3. The DNA was EtOH precipitated, washed with EtOH (70%), vacuum dried and resuspended in 200 /xl TE (pH 8.0). The uracil containing Ml 3 templates  were roughly quantitated  by comparison to  53  minipreparations of wild type SS Ml3 templates, both templates electrophoresed on agarose gels. 2. Preparation of the Oligonucleotide A  synthetic  22-mer  oligonucleotide  (5'-GCTCCGCAAATTTTAACCGTTA-3')  complementary to the plus strand (nt 301-280) (Shade, 1986) was designed based on previously outlined site-specific mutagenesis protocol (Zoller, 1987). Two C residues in the complementary strand were replaced by the two underlined A residues in the oligonucleotide (equivalent to replacing two G residues with two T residues in the plus strand). Two hundred pM of the oligonucleotide, in 20 /il kinase buffer [80 mM Tris-HCl (pH 8.3), 10 mM MgCl , 10 mM DTT), were incubated with T polynucleotide 2  4  kinase (5 u) at in the presence of 1 mM ATP at 37 °C for 60 min. The reaction was stopped by incubating for 10 min at 68 °C. The kinased oligonucleotide (20 pM) was added to annealing buffer [20 mM Tris-HCl (pH 7.5), 10 mM MgCl , 1 mM DTT, 50 mM NaCl,] with uracil-containing M13 2  template (2 fig) in a total volume of 20 /il. The mixture was incubated at 65 °C for 5 min and at RT for 5 min. The annealed oligonucleotide template (10 /il) was incubated with 10 /il of extension buffer [20 mM Tris (pH 7.5), 10 mM MgCl , 10 mM DTT, 400 /im dNTP's, 1 mM ATP, 3 u 2  T ligase, 2 u DNA Polymerase (Klenow) for 12 hr at 15 °C. Five /il of this reaction mix 4  was used to transform JM101 competent cells and Ml3 templates were prepared using previously outlined procedures. Ml3 templates were characterized by Sanger sequencing and 50% of the clones sequenced had the desired mutation. The B19-M13 RF DNA of mutated templates were prepared by in vitro methods (previously outlined in section D3). Mutated B19 inserts were isolated from Ml3 RF DNA ts by restriction digestion, and gel electrophroesis.  The mutated B19 inserts were cloned,  transferred into pUC (Fig. 21 A) and large scale B19-pUC preparations were purified on EtBr-CsCl density gradients.  Mutated and wild type GC-box containing templates were  compared both in gel retention assays and in in vitro transcription assays.  54  RESULTS A. DNA Sequence Differences in B19 Viruses The major portion of the B19-Wi genome, cloned as two separate fragments in pYTT02 and pYTlOl (Cotmore and Tattersall, 1984), was subcloned into the plasmid vectors pUC12 and pUC13 and the bacteriophage M13mpl9.  A series of nested deletions were  constructed from these subclones and the complete DNA sequence of B19 was determined. The entire sequence of B19 was determined for one or both strands (Fig. IA, B, and C). The sequence is displayed along with that of the B19-Au sequence in Figure 2. Differences in the DNA sequence between B19-Wi and the related B19-Au virus (Shade, 1986) were checked by resequencing or sequencing on the opposite strand. The RH terminus of the B19-Wi clone extends 153 nucleotides further in the 3' direction of the coding strand (from nt 5109 to nt 5261 inclusive) when compared to B19-Au (Fig. 3A). The sequences of these two strains were very similar and nucleotide differences were summarized (Table 1).  Comparing the two viruses there are 48 nucleotide changes.  Seven of these changes were contiguous (nt 94 to 100) and they form an inverted complement to the same basepairs in the B19-Au strain (Table 1).  In the remaining 41 nucleotide  changes, thirty-one transitions predominate over 10 transversions.  Thirty seven nucleotide  changes were located within the large open reading frames (ORF). Of these 37 changes, 25 were silent mutations as there were no changes in the predicted amino acid sequence. Four nucleotide changes result in conservative amino acid substitutions. Eight amino acid changes result in seven nonconservative amino acid substitutions [two nucleotide changes occurred in the same amino acid codon starting at nt 1009 [residues CCG code for proline in B19-Wi compared to residues GCT coding for alanine in B19-Au)]. The parvoviral genome has extensive hairpins in both the LH and RH termini respectively (Fig. 3A and 3B).  In addition, the RH hairpin (RHH) contains internal  palindromes which may form an alternate stem and arm structure (Fig. 3C) as seen in other parvovirus termini (Fife et al., 1977; Lusby et al., 1980; Astell, et al., 1983; Astell, 1988). Seven nucleotides in B19-Wi (nt 94-100) fall within the loopout of unmatched basepairs on  Figure 1. DNA Sequencing Strategy for B19-W1 55 Restriction endonuclease maps of (A) pYT102 and (B) pYT101 and their respective subclones . The heavy line is insert (B19-Wi) DNA and the light line is vector DNA. Bracketed names below plasmid names identify vector DNA. Arrows within the subclones indicate the direction of Exolll deletions and DNA sequencing. The DNA RF preparation of mp1212 was deleted (nt 5107 to 5262) from the right hand hairpin of pYT101. A DNA fragment containing the nucleotides 5107 to 5262 was isolated from pYT101 and chemically sequenced. (C)Combined restriction map of B19-WL Light lines with arrows above and below show strands sequenced and direction of sequencing.  A  56  Figure 2. Comparison of B19-Wi and B19-Au DNA sequence. The nucleotide sequence for the plus strand of B19-Wi is the upper line and B19-Au is the lower line. The B19-Wi DNA, I sequenced (Blundell, 1987), was from the clones pYTlOl and pYT102 (Cotmore and Tattersall, 1984) and for the B19-Au DNA from the clones pYT103 and pYT104 (Cotmore et al., 1986) which were sequenced by Shade et al. (1986). The B19-Wi DNA has two BamHI linkers, one on each termini. The B19-Au DNA has two EcoRI linkers, one on each termini. The numbering starts at 1 (5' to 3') for the first nucleotide of the BamHI and EcoRI linker on the plus strand of B19-Wi and B19-Au, respectively. The B19-Au sequence stops at 5112, the last nucleotide of the EcoRI linker. The B19-Wi sequence stops at nt 5261.  57  10 20 30 40 50 60 70 80 90 100 G C CAGGAAA G AT CCGCCAAATCAGATGCCGCCGGTCGCCGCCGGTAGGCGGGACTTCCGGTACAAGATGGCGGACAATTACGTCATTTCCTGTGACGTCA G AT CCGCCAAATCAGATGCCGCCGGTCGCCGCCGGTAGGCGGGACTTCCGGTACAAGATGGCGGACAATTACGTCATTTCCTGTGACGTCA A T TTTCCTG 10 20 30 40 50 60 70 80 90 100 110  120  130  140  150  160  170  180  190  200  TGACGTCACAGGAAATGACGTAATTGTCCGCCATCTTGTACCGGAAGTCCCGCCTACCGGCGGCGACCGGCGGCATCTGATTTGGTGTCTTCTTTTAAAT TGACGTCACAGGAAATGACGTAATTGTCCGCCATCTTGTACCGGAAGTCCCGCCTACCGGCGGCGACCGGCGGCATCTGATTTGGTGTCTTCTTTTAAAT 110  120  130  140  150  160  170  210  220  230  240  250  260  270  310  320  410  420  510  520  180  190  200  280 290 300 C TTTAGCGGGCTTTTTTCCCGCCTTATGCAAATGGGCAGCCATTTTAAGTGTTTTACTATAATTTTATTGGT AGTTTTGTAACGGTTAAAATGGGCGGAG TTTAGCGGGCTTTTTTCCCGCCTTATGCAAATGGGCAGCCATTTTAAGTGTTTTACTATAATTTTATTGGT AGTTTTGTAACGGTTAAAATGGGCGGAG T 210 220 230 240 250 260 270 280 290 300 330 340 350 360 370 380 390 400 G C CGTAGGCGGGGACTACAGTATATATAGCA GG ACTGCCGCAGCTCTTTCTTTCTGGGCTGCTTTTTCCTGGACTTTCTTGCTGTTTTTTGTGAGCTAAC CGTAGGCGGGGACTACAGTATATATAGCA GG ACTGCCGCAGCTCTTTCTTTCTGGGCTGCTTTTTCCTGGACTTTCTTGCTGTTTTTTGTGAGCTAAC C T 310 320 330 340 350 360 370 380 390 400 430 440 450 460 470 480 490 500 A G TAACAGGTATTTATACTACTTGTTAACAT CTAACATGGAGCTATTTAGAGGGGTGCTTCAAGTTTCTTCTAATGTTCT GACTGTGCTAACGATAACTG TAACAGGTATTTATACTACTTGTTAACAT CTAACATGGAGCTATTTAGAGGGGTGCTTCAAGTTTCTTCTAATGTTCT GACTGTGCTAACGATAACTG C A 410 420 430 440 450 460 470 480 490 500 530  540  550  560  570  580  590  600  GTGGTGCTCTTTACTGGATTTAGACACTTCTGACTGGGAACCACTAACTCATACTAACAGACTAATGGCAATATACTTAAGCAGTGTGGCTTCTAAGCTT GTGGTGCTCTTTACTGGATTTAGACACTTCTGACTGGGAACCACTAACTCATACTAACAGACTAATGGCAATATACTTAAGCAGTGTGGCTTCTAAGCTT 510  520  530  540  550  560  570  580  590  610  620  630  640  650  660  670  680  690  710  720  730  740  750  760  770  780  790  600  700 T GACTTTACCGGGGGGCCACTAGCAGGGTGCTTGTACTTTTTTCAAGTAGAATGTAACAAATTTGAAGAAGGCTATCATATTCATGTGGTTA TGGGGGGC GACTTTACCGGGGGGCCACTAGCAGGGTGCTTGTACTTTTTTCAAGTAGAATGTAACAAATTTGAAGAAGGCTATCATATTCATGTGGTTA TGGGGGGC C 610 620 630 640 650 660 670 680 690 700 CAGGGTTAAACCCCAGAAACCT CAGGGTTAAACCCCAGAAACCT 710  720  810  820  C T  800  ACAGTGTGTGTAGAGGGGTTATTTAATAATGTACTTTATCACCTTGTAACTGAAAATGTGAAGCTAAAATTTTTGCC ACAGTGTGTGTAGAGGGGTTATTTAATAATGTACTTTATCACCTTGTAACTGAAAATGTGAAGCTAAAATTTTTGCC 730  740  750  760  770  780  790  800  830  840  850  860  870  880  890  900  AGGAATGACTACAAAAGGCAAATACTTTAGAGATGGAGAGCAGTTTATAGAAAACTATTTAATGAAAAAAATACCTT TAAATGTTGTATGGTGTGTTACT AGGAATGACTACAAAAGGCAAATACTTTAGAGATGGAGAGCAGTTTATAGAAAACTATTTAATGAAAAAAATACCTTTAAATGTTGTATGGTGTGTTACT 810  820  830  840  850  860  870  880  890  910  920  930  940  950  960  970  980  990  900  1000 G AT A A ATG AT C TA AATATTGATGGATATATAGATACCTGTATTTCTGCTACTTTTAGAAGGGGAGCTTGCCATGCCAAGAAACCCCGCATTACCACAGCCATAAATGAT CTA A 910 920 930 940 950 960 970 980 990 1000  58 10 to C G  1020  1110  1120  1030  1040  1050  1060  1070  1080  1090  1100  GTAGTGAT C GGGGAGTCTAGCGGCACAGGGGCAGAGGTTGTGCCATTTAATGGGAAGGGAACTAAGGCTAGCATAAAGTTTCAAACTATGGTAAACTG GTAGTGAT C GGGGAGTCTAGCGGCACAGGGGCAGAGGTTGTGCCATTTAATGGGAAGGGAACTAAGGCTAGCATAAAGTTTCAAACTATGGTAAACTG GT 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1130  1140  1150  1160  1170  1180  1190  1200  GTTGTGTGAAAACAGAGTGTTTACAGAGGATAAGTGGAAACTAGTTGACTTTAACCAGTACACTTTACTAAGCAGTAGTCACAGTGGAAGTTTTCAAATT GTTGTGTGAAAACAGAGTGTTTACAGAGGATAAGTGGAAACTAGTTGACTTTAACCAGTACACTTTACTAAGCAGTAGTCACAGTGGAAGTTTTCAAATT 1110  1120  1130  1140  1150  1160  1170  1180  1190  1200  1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 G A CA AGTGCACTAAAACTAGCAATTTATAAAGCAACTAATTTAGTGCCTACTAGCACATTTTTATTGCATACAGACTTTGAGCAG TTATGTGTATTAAAG CA AGTGCACTAAAACTAGCAATTTATAAAGCAACTAATTTAGTGCCTACTAGCACATTTTTATTGCATACAGACTTTGAGCAG TTATGTGTATTAAAG A G 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310  1320  1330  1340  1350  1360  1370  1380  1390  1400 C ACAATAAAATTGTTAAATTGTTACTTTGTCAAAACTATGACCCCCTATTGGTGGGGCAGCATGTGTTAAAGTGGATTGATAAAAAATGTGG AAGAAAAA ACAATAAAATTGTTAAATTGTTACTTTGTCAAAACTATGACCCCCTATTGGTGGGGCAGCATGTGTTAAAGTGGATTGATAAAAAATGTGG AAGAAAAA T 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410  1420  1430  1440  1450  1460  1470  1480  1490  1500  TACACTGTGGTTTTATGGGCCGCCAAGTACAGGAAAAACAAACTTGGCAATGGCCATTGCTAAAAGTGTTCCAGTATATGGCATGGTTAACTGGAATAAT TACACTGTGGTTTTATGGGCCGCCAAGTACAGGAAAAACAAACTTGGCAATGGCCATTGCTAAAAGTGTTCCAGTATATGGCATGGTTAACTGGAATAAT 1410  1420  1510  1520  1610  1620  1430  1440  1450  1460  1470  1480  1490  1500  1530 1540 1550 1560 1570 1580 1590 1600 G G GAAAACTTTCCATTTAATGATGTAGCAGG AAAAGCTTGGTGGTCTGGGATGAAGGTATTATTAAGTCTACAATTGT GAAGCTGCAAAAGCCATTTTAG GAAAACTTTCCATTTAATGATGTAGCAGG AAAAGCTTGGTGGTCTGGGATGAAGGTATTATTAAGTCTACAATTGT GAAGCTGCAAAAGCCATTTTAG A A 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1630  1640  1650  1660  1670  1680  1690  1700  GCGGGCAACCCACCAGGGTAGATCAAAAAATGCGTGGAAGTGTAGCTGTGCCTGGAGTACCTGTGGTTATAACCAGCAATGGTGACATTACTTTTGTTGT GCGGGCAACCCACCAGGGTAGATCAAAAAATGCGTGGAAGTGTAGCTGTGCCTGGAGTACCTGTGGTTATAACCAGCAATGGTGACATTACTTTTGTTGT 1610  1620  1630  1640  1710  1720  1730  1740  1810  1820  1830  1840  1650  1660  1670  1680  1690  1700  1750 1760 1770 1780 1790 1800 A AAGCGGGAACACTACAACAACTGTACATGCTAAAGCCTTAAAAGAGCG ATGGTAAAGTTAAACTTTACTGTAAGATGCAGCCCTGACATGGGGTTACTA AAGCGGGAACACTACAACAACTGTACATGCTAAAGCCTTAAAAGAGCG ATGGTAAAGTTAAACTTTACTGTAAGATGCAGCCCTGACATGGGGTTACTA C 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1850  1860  1870  1880  1890  1900  ACAGAGGCTGATGTACAACAGTGGCTTACATGGTGTAATGCACAAAGCTGGGACCACTATGAAAACTGGGCAATAAACTACACTTTTGATTTCCCTGGAA ACAGAGGCTGATGTACAACAGTGGCTTACATGGTGTAATGCACAAAGCTGGGACCACTATGAAAACTGGGCAATAAACTACACTTTTGATTTCCCTGGAA 1810  1820  1830  1840  1850  1860  1870  1880  1890  1900  1910  1920  1930  1940  1950  1960  1970  1980  1990  2000  TTAATGCAGATGCCCTCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAAGAACTCAGTGA TTAATGCAGATGCCCTCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAAGAACTCAGTGA 1910  1920  1930  1940  1950  1960  1970  1980  1990  2000  2010  2020  2030  2040  2050  2060  2070  2080  2090  2100  AAGCAGCTTTTTTAACCTCATCACCCCAGGCGCCTGGAACACTGAAACCCCGCGCTCTAGTACGCCCATCCCCGGGACCAGTTCAGGAGAATCATTTGTC AAGCAGCTTTTTTAACCTCATCACCCCAGGCGCCTGGAACACTGAAACCCCGCGCTCTAGTACGCCCATCCCCGGGACCAGTTCAGGAGAATCATTTGTC 2010  2020  2030  2040  2050  2060  2070  2080  2090  2100  2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 T GGAAGC CAGTTTCCTCCGAAGTTGTAGCTGCATCGTGGGAAGAAGCCTTCTACACACCTTTGGCAGACCAGTTTCGTGAACTGTTAGTTGGGGTTGA1T GGAAGC CAGTTTCCTCCGAAGTTGTAGCTGCATCGTGGGAAGAAGCCTTCTACACACCTTTGGCAGACCAGTTTCGTGAACTGTTAGTTGGGGTTGATT C 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200  59 2210  2220  2230  2240  2250  2260  2270  ATGTGTGGGACGGTGTAAGGGGTTTACCTGTGTGTTGTGTGCAACATATTAACAATAGTGGGGGAGG ATGTGTGGGACGGTGTAAGGGGTTTACCTGTGTGTTGTGTGCAACATATTAACAATAGTGGGGGAGG 2210  2220  2230  2240  2250  2310  2320  2330  2340  2350  GGCTTGGTATAATGGATGGAAATTTCGAGAATTTACCCCAGATTTGGTGCG GGCTTGGTATAATGGATGGAAATTTCGAGAATTTACCCCAGATTTGGTGCG 2310  2320  2330  2340  2350  2410  2420  2430  2440  2450  G A  AAAAAATGTGCTTACCTGTCTGGATTGCAAAGCTTTGTAGATTATGAGTAAA AAAAAATGTGCTTACCTGTCTGGATTGCAAAGCTTTGTAGATTATGAGTAAA 2410  2420  2510  2520  2610  2620  A  TTGGGACTTTGTCCCCATTGCATTAATGTAGG TTGGGACTTTGTCCCCATTGCATTAATGTAGG  2260  G 2270  2280  2290  2300  2360  2370  2380  2390  2400  TGTAGCTGCCATGTGGGAGCTTCTAATCCCTTTTCTGTGCTAACCTGC TGTAGCTGCCATGTGGGAGCTTCTAATCCCTTTTCTGTGCTAACCTGC 2360  2370  2380  2390  2400  2460  2470  2480  2490  2500  AAAGTGGCAAATGGTGGGAAAGTGATGATAAATTTGCTAAAGCTGTG AAAGTGGCAAATGGTGGGAAAGTGATGATAAATTTGCTAAAGCTGTG  2530 2540 2550 2560 2570 2580 2590 G TATCAGCAATTTGTGGAATTTTATGA AAGGTTACTGGAACAGACTTAGAGCTTATTCAAATATTAAAAGATCATTATAATATTTCTTTAGAT TATCAGCAATTTGTGGAATTTTATGA AAGGTTACTGGAACAGACTTAGAGCTTATTCAAATATTAAAAGATCATTATAATATTTCTTTAGAT A 2510 2520 2530 2540 2S50 2560 2570 2580 2590  2600 C ATCCCC ATCCCC A 2600  2610  2620  2710  2720  G  2630  2640  2450  2300  2500  A  2440  2290  2490  TAGAAAACCCATCCTCTCTGTTT TAGAAAACCCATCCTCTCTGTTT  2430  G  C  2280  2650  2460  2660  2470  2670  2480  2680 .  2690  2700  ACTTAGTTGCTCGTATTAAAAATAACCTTAAAAACTCTCCAGACTTATATAGTCATCATTTTCAAAGTCATGGACA ACTTAGTTGCTCGTATTAAAAATAACCTTAAAAACTCTCCAGACTTATATAGTCATCATTTTCAAAGTCATGGACA 2630  2640  2650  2660  2670  2680  2690  2700  2730  2740  2750  2760  2770  2780  2790  2800  GTTATCTGACCACCCCCATGCCTTATCATCCAGTAGCAGTCATGCAGAACCTAGAGGAGAAAATGCAGTATTATCTAGTGAAGACTTACACAAGCCTGGG GTTATCTGACCACCCCCATGCCTTATCATCCAGTAGCAGTCATGCAGAACCTAGAGGAGAAAATGCAGTATTATCTAGTGAAGACTTACACAAGCCTGGG 2710  2720  2730  2740  2750  2760  2770  2780  2790  2600  2810  2820  2830  2840  2850  2860  2870  2880  2890  2900  CAAGTTAGCGTACAACTACCCGGTACTAACTATGTTGGGCCTGGCAATGAGCTACAAGCTGGGCCCCCGCAAAGTGCTGTTGACAGTGCTGCAAGGATTC CAAGTTAGCGTACAACTACCCGGTACTAACTATGTTGGGCCTGGCAATGAGCTACAAGCTGGGCCCCCGCAAAGTGCTGTTGACAGTGCTGCAAGGATTC 2810  2820  2830  2840  2850  2860  2870  2880  2890  2900  2910  2920  2930  2940  2950  2960  2970  2980  2990  3000  ATGACTTTAGGTATAGCCAACTGGCTAAGTTGGGAATAAATCCATATACTCATTGGACTGTAGCAGATGAAGAGCTTTTAAAAAATATAAAAAATGAAAC ATGACTTTAGGTATAGCCAACTGGCTAAGTTGGGAATAAATCCATATACTCATTGGACTGTAGCAGATGAAGAGCTTTTAAAAAATATAAAAAATGAAAC 2910  2920  2930  2940  2950  2960  2970  2980  2990  3000  3010  3020  3030  3040.  3050  3060  3070  3080  3090  3100  TGGGTTTCAAGCACAAGTAGTAAAAGACTACTTTACTTTAAAAGGTGCAGCTGCCCCTGTGGCCCATTTTCAAGGAAGTTTGCCGGAAGTTCCCGCTTAC TGGGTTTCAAGCACAAGTAGTAAAAGACTACTTTACTTTAAAAGGTGCAGCTGCCCCTGTGGCCCATTTTCAAGGAAGTTTGCCGGAAGTTCCCGCTTAC 3010  3020  3030  3040  3050  3060  3070  3080  3090  3100  3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 T C AACGCCTCAGAAAAATACCCAAGCATGACTTCAGTTAATTCTGCAGAAGCCAGCACTGGTGCAGGAGGGGG GGCAGTAAT CTGTCAAAAGCATGTGGA AACGCCTCAGAAAAATACCCAAGCATGACTTCAGTTAATTCTGCAGAAGCCAGCACTGGTGCAGGAGGGGG GGCAGTAAT CTGTCAAAAGCATGTGGA G T 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210  3220  C GTGAGGGGGCCACTTTTAGTGC GTGAGGGGGCCACTTTTAGTGC T 3210 3220  3230  3240  3250  3260  3270  3280  3290  3300  AACTCTGTAACTTGTACATTTTCCAGACAGTTTTTAATTCCATATGACCCAGAGCACCATTATAAGGTGTTTTCTCC AACTCTGTAACTTGTACATTTTCCAGACAGTTTTTAATTCCATATGACCCAGAGCACCATTATAAGGTGTTTTCTCC 3230  3240  3250  3260  3270  3280  3290  3300  3310  3320  3330  3340  3350  3360  3370  3380  3390  3400  3310  3320  3330  3340  3350  3360  3370  3380  3390  3400  A T CGCAGC AGTAGCTGCCACAATGCCAGTGGAAAGGAGGCAAAGGTTTGCACCAT AGTCCCATAATGGGATACTCAACCCCATGGAGATATTTAGATTTT CGCAGC AGTAGCTGCCACAATGCCAGTGGAAAGGAGGCAAAGGTTTGCACCAT AGTCCCATAATGGGATACTCAACCCCATGGAGATATTTAGATTTT G C  60 34 10 3420 3430 3440 3450 3460 3470 3480 3490 3500 AATGCTTTAAATTTATTTTTTTCACCTTTAGAGTTTCAGCACTTAATTGAAAATTATGGAAGTATAGCTCCTGATGCTTTAACTGTAACCATATCAGAAA AATGCTTTAAATTTATTTTTTTCACCTTTAGAGTTTCAGCACTTAATTGAAAATTATGGAAGTATAGCTCCTGATGCTTTAACTGTAACCATATCAGAAA 3410  3420  3430  3440  3450  3460  3470  3480  3490  3500  3510  3520  3530  3540  3550  3560  3570  3580  3590  3600  TTGCTGTTAAGGATGTTACAGACAAAACTGGAGGGGGGGTACAGGTTACTGACAGCACTACAGGGCGCCTATGCATGTTAGTAGACCATGAATACAAGTA TTGCTGTTAAGGATGTTACAGACAAAACTGGAGGGGGGGTACAGGTTACTGACAGCACTACAGGGCGCCTATGCATGTTAGTAGACCATGAATACAAGTA 3510  3520  3530  3540  3550  3560  3570  3580  3610  3620  3630  3640  3650  3660  3670  3680  3590  3600  3690 3700 G C CCCATATGTGTTAGGGCAAGGTCAGGATACTTTAGCCCCAGAACTTCCTATTTGGGTATACTTTCCCCCTCAATATGCTTACTTAACAGT GGAGATGT CCCATATGTGTTAGGGCAAGGTCAGGATACTTTAGCCCCAGAACTTCCTATTTGGGTATACTTTCCCCCTCAATATGCTTACTTAACAGT GGAGATGT A T 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710  3720 3730 3740 3750 3760 3770 3780 3790 3800 C C AACACACAAGGAAT TCTGGAGACAGCAAAAAATTAGCAAGTGAAGAATCAGCATTTTATGTTTTGGAACACAGTTC TTTCAGCTTTTAGGTACAGGAG AACACACAAGGAAT TCTGGAGACAGCAAAAAATTAGCAAGTGAAGAATCAGCATTTTATGTTTTGGAACACAGTTC TTTCAGCTTTTAGGTACAGGAG T T 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 A GTACAGCA GTACAGCA T 3810  3820  3830  3840  3850  3860  3870  3880  3890  3900  CTATGTCTTATAAGTTTCCTCCAGTGCCCCCAGAAAATTTAGAGGGCTGCAGTCAACACTTTTATGAAATGTACAATCCCTTATACGGATC CTATGTCTTATAAGTTTCCTCCAGTGCCCCCAGAAAATTTAGAGGGCTGCAGTCAACACTTTTATGAAATGTACAATCCCTTATACGGATC 3820  3830  3840  3850  3860  3870  3880  3910  3920  3930  3940  3950  3960  3970  3980  4010.  4020  4030  4040  4050  4060  4070  4080  3890  3900  3990 4000 T CCGCTTAGGGGTTCCTGACACATTAGGAGGTGACCCAAAATTTAGATCTTTAACACATGAAGACCATGCAATTCAGCCCCAAAACTT ATGCCAGGGCCA CCGCTTAGGGGTTCCTGACACATTAGGAGGTGACCCAAAATTTAGATCTTTAACACATGAAGACCATGCAATTCAGCCCCAAAACTT ATGCCAGGGCCA C 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4090  4100  CTAGTAAACTCAGTGTCTACAAAGGAGGGAGACAGCTCTAATACTGGAGCTGGAAAAGCCTTAACAGGCCTTAGCACAGGTACCTCTCAAAACACTAGAA CTAGTAAACTCAGTGTCTACAAAGGAGGGAGACAGCTCTAATACTGGAGCTGGAAAAGCCTTAACAGGCCTTAGCACAGGTACCTCTCAAAACACTAGAA 4010  4020  4030  4040  4050  4060  4110  4120  4130  4140 '  4150  4160  4210  4220  4230  4240  4250  4260  4070  4080  4090  4100  4170 4180 4190 4200 T A TATCCTTACGCCCTGGGCCAGTGTCTCAGCCATACCACCACTGGGACACAGATAAATATGT ACAGGAATAAATGCCATTTCTCATGGTCA ACCACTTA TATCCTTACGCCCTGGGCCAGTGTCTCAGCCATACCACCACTGGGACACAGATAAATATGT ACAGGAATAAATGCCATTTCTCATGGTCA ACCACTTA C G 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4270  4280  4290  4300 T TGGTAACGCTGAAGACAAAGAGTATCAGCAAGGAGTGGGTAGATTTCCAAATGAAAAAGAACAGCTAAAACAGTTACAGGGTTTAAACATGCACACCT A TGGTAACGCTGAAGACAAAGAGTATCAGCAAGGAGTGGGTAGATTTCCAAATGAAAAAGAACAGCTAAAACAGTTACAGGGTTTAAACATGCACACCTA C  4210  4220  4230  4240  4250  4260  4270  4280  4290  4300  4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 C TT CCCAATAAAGGAACCCAGCAATATACAGATCAAATTGAGCGCCCCCTAATGGTGGGTTCTGTATGGAACAGAAGAGCCCTTCACTATGAAAGCCAGC TT CCCAATAAAGGAACCCAGCAATATACAGATCAAATTGAGCGCCCCCTAATGGTGGGTTCTGTATGGAACAGAAGAGCCCTTCACTATGAAAGCCAGC T 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 45CO TGTGGAGTAAAATTCCAAATTTAGATGACAGTTTTAAAACTCAGTTTGCAGCCTTAGGAGGATGGGGTTTGCATCAGCCACCTCCTCAAATATT1TTAAA TGTGGAGTAAAATTCCAAATTTAGATGACAGTTTTAAAACTCAGTTTGCAGCCTTAGGAGGATGGGGTTTGCATCAGCCACCTCCTCAAATATTTTTAAA 4410  4420  4430  4440  4450  4460  4510  4520  4530  4540  4550  4560  4470  4480  4490  4500  4570. 4580 4590 4600 C AATATTACCACAAAGTGGGCCAATTGGAGGTATTAAATCAATGGGAATTACTACCTTAGTTCAGTA GCCGTGGGAATTATGACAGTAACTATGACATTT AATATTACCACAAAGTGGGCCAATTGGAGGTATTAAATCAATGGGAATTACTACCTTAGTTCAGTA GCCGTGGGAATTATGACAGTAACTATGACATTT T 4510 4520 4530 4540 4550 4560 4570 4580 4590 46O0  61 4610  4620  4630  4640  4650  4660  4670  4680  4690  4700  AAATTGGGGCCCCGTAAAGCTACGGGACGGTGGAATCCTCAACCTGGAGTATATCCCCCGCACGCAGCAGGTCATTTACCATATGTACTATATGACCCCA AAATTGGGGCCCCGTAAAGCTACGGGACGGTGGAATCCTCAACCTGGAGTATATCCCCCGCACGCAGCAGGTCATTTACCATATGTACTATATGACCCCA 4610  4620  4630  4640  4650  4660  4670  4680  4690  4700  4710  4720  4730  4740  4750'  4760  4770  4780  4790  4800  CAGCTACAGATGCAAAACAACACCACAGACATGGATATGAAAAGCCTGAAGAATTGTGGACAGCCAAAAGCCGTGTGCACCCATTGTAAACACTCCCCAC CAGCTACAGATGCAAAACAACACCACAGACATGGATATGAAAAGCCTGAAGAATTGTGGACAGCCAAAAGCCGTGTGCACCCATTGTAAACACTCCCCAC 4710  4720  4730  4740  4750  4760  4770  4780  4790  4800  4810  4820 4830 4840 4850 4860 4870 4880 4890 4900 A C CGTGCCCTCAGCCA GATGCGTAACTAAACGCCCACCAGTACCACCCAGACTGTACCTGCCCCCTCCTGTACCTATAAGACAGCCTAACACAAAAGA AT CGTGCCCTCAGCCA GATGCGTAACTAAACGCCCACCAGTACCACCCAGACTGTACCTGCCCCCTCCTGTACCTATAAGACAGCCTAACACAAAAGA AT G T 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910  4920  4930  4940  4950  4960  4970  4980  4990  5000  AGACAATGTAGAATTTAAGTACTTAACCAGATATGAACAACATGTTATTAGAATGTTAAGATTGTGTAATATGTATCAAAATTTAGAAAAATAAACATTT AGACAATGTAGAATTTAAGTACTTAACCAGATATGAACAACATGTTATTAGAATGTTAAGATTGTGTAATATGTATCAAAATTTAGAAAAATAAACATTT 4910  4920  4930  4940  4950  4960  4970  4980  4990  5000  5010  5020  5030  5040  5050  5060  5070  5080  5090  5100  GTTGTGGTTAAAAAATTATGT-TGTTGCGCTTTAAAAATTTAAAAGAAGACACCAAATCAGATGCCGCCGGTCGGCCGGTAGGCGGGACTTCCGGTACAAG GTTGTGGTTAAAAAATTATGTTGTTGCGCTTTAAAAATTTAAAAGAAGACACCAAATCAGATGCCGCCGGTCGGCCGGTAGGCGGGACTTCCGGTACAAG 5010  5020  5030  5040  5050  5060  5070  5080  5090  5100  5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 CAATTACGTCATTTCCTGTGACGTCATTTCCTGTGACGTCACTTCCGGTGAGCGGAACTTCCGGAAGTGACGTCACAGGAAATGACGTCACA ATGGCGGA ATGGCGGA ATTC 5110 5210 5220 5230 5240 5250 5260 GGAAATGACGTAATTGTCCGCCATCTTGTACCGGAAGTCCCGCCTACCGGCCGACCGGCGG  62 Figure 3. Terminal Hairpins of B19-Wi Clone pYT102. (A) Right-hand hairpin (RHH) and (B) left-hand hairpin (LHH). The DNA sequence corresponds to the complementary (plus) strand (5' to 3'). The numbering of sequence corresponds to the B19-Au genome (Shade, 1986). The asterix(*) indicates the mismatched nucleotide. The caret ( ) indicates the end of the sequence for the righthand hairpin of B19-Au in the pYT103 clone. The first 6 nt of the LHH of B19-Wi is a BamHI linker ligated to the end of the LHH of the B19-Wi fragment during the protocol of cloning this B19 fragment into a double stranded plasmid vector, and so nt 1 to 6 are not included here (Cotmore and Tattersall, 1984). Note: The first six nt of the B19-Au genome (nt 1 to 6) is an EcoRI linker added in a similar fashion to the end of the LHH of B19-Au (Cotmore et al., 1986) (C)Alternate Stem and Arms Structure of the RHH of B19-WL A  A. RH B19-Wi TCA 5261  5252  5242  5232  5222  5212  5202  5192  5182  5172  T A  3'-GGCGGCCAGC--CGGCCATCCGCCCTGAAGGCCATGTTCTACCGCCTGTTAATGCAGTAAAGGACACTGCAGTAAAGGACACTGCAGTGAAGGCC  G  5'-CACCAAATCAGATGCCGCCGGTCG--GCCGGTAGGCGGGACTTCCGGTACAAGATGGCGGACAATTACGTCATTTCCTGTGACGTCATTTCCTGTGACGTCACTTCCGG 5053  5063  5073  5083  5093  5103  *  5113  5123  5133  5143  RH end B 1 9 - A u ( 5 1 0 7 )  184  174  164  154  144  134  124  114  104  AA  3'-GTGGTTTAGTCTACGGCGGCCAGCGGCGGCCATCCGCCCTGAAGGCCATGTTCTACCGCCTGTTAATGCAGTAAAGGACACTGCAGT  A  5'-CGCCAAATCAGATGCCGCCGGTCGCCGCCGGTAGGCGGGACTTCCGGTACAAGATGGCGGACAATTACGTCATTTCCTGTGACGTCA  G  7*10  20  30  40  50  60  70  80  90  CAG  C. Stem & Arm Structure of RHH AGG A  A A  C TA GC AT CG GC TA CG AT  5261  5252  5242  5232  5222  5212  TCA  5202 CG  T  3'-GGCGGCCAGC--CGGCCATCCGCCCTGAAGGCCATGTTCTACCGCCTGTTAATGCAGTAAAGGAAAGGCC  5063  5073  5083  5093  5103  *  5113  5123 GC  RH end B 1 9 - A u ( 5 1 0 7 )  GC  CG GC TA CG AT T  G T  T  C C  C  GAG  AT  T  G T  TA  A  A G  5'-CACCAAATCAGATGCCGCCGGTCG--GCCGGTAGGCGGGACTTCCGGTACAAGATGGCGGACAATTACGTCATTTCCTTTCCGG 5053  G T  C  GAG  A  B. LH B19-Wi  5153  Table 1. Comparison of Nucleotide Sequence Changes (nt 1-5095) between the Complementary (Coding) Strand of B19-Wi and B19-Au (Shade et al., 1986) Nucleotide 94 95 96 97 98 99 100 272 330 333 430 480 692 723 997 1009 1011 1203  B19-Wi  Amino acid changes  -  C A G  T T  G A A A C G A G G  C C T G T C T C A  T C  C T  Ile-Thr  G C G  A G T  Ala-Thr  G  A G T A A C C G A A A A G G T T G C A T T T T C  1285 1392 1530 1578 1749 2107 2268 2352 2453 2527 2594 2624 3172 3182 3223 3307 3355 3691 3700 3715 3778 3809 3988  A C G G A T C G G G C A T C C A T G C C C A T  4162 4192 4300 4303 4567 4815  T A  4898  B19-Au  T C C A C  T  C G C T T G T  Pro-Ala Pro-Ala  Ile-Val  Ser-Pro  -  Glu-Lys  His-Asn Asn-Asp  Pro-Ser  Thr-Ser  Arg-Gly  -  Note. The first eleven nucleotide changes are not within open reading frames (ORFs) while the remainder are.  64  the LH termini of B19 (Fig. 3B). The seven nucleotides are the inverted complement of seven similarly positioned nucleotides in B19-Au (Table 1). One might interpret the data as evidence for two sequence orientations at the LH end of the B19 genome, as are present at both ends of the AAV2 genome and the RH ends of the MVM and HI genomes (Fife et al., 1977; Lusby et al., 1980; Astell et al., 1983a; Rhode and Klaassen, 1982; Astell et al., 1985). However, these sequences can also be explained as a result of deletion events which occur during propagation of large palindromes in E. coli. The intact hairpin ends, estimated from purified viral DNA, are approximately 330 nt long (Shade et al., 1986). When cloned in plasmids in E. coli, they are deleted symmetrically about the loop end of the palindromes (Boissy and Astell, 1985). Sequencing independent isolates of MVM plasmids, which have deleted the RH end, have shown the reconstructed loop ends contain sequences that are inverted complements of each other. A plausible explanation for the deletion events in E. coli  suggests they occur by slipped mispairing during replication. Depending which strand is  the leading or lagging strand, the loop end will be of one sequence or the inverted complement (Astell, 1988 in press). Comparison of LH and RH termini of B19-Wi revealed extensive overlapping homologies (Fig. 3A and 3B). There were an extra 49 nucleotides in the central portion of the RH terminus (nt 5135 nt 5183) not present in the LH terminus (Fig. 3A and 3B). The "missing" 49 nucleotides of the LH terminus border the loopout of unmatched basepairs (nt 94-100) in the LH hairpin (Fig. 3B). There were two C residues and two G residues missing in the RH terminus relative to the LH terminus of B19-Wi.  In the hairpin formation,  missing C and G residues occurred at the same sites on the opposing strands of the RH hairpin (indicated by —) and conversely for the additional C and G residues on the LH hairpin (Fig. 3A and 3B). This means there are no unmatched nucleotides in either hairpin due to loss or addition of C and G residues. The two C residues (between nt 5073 and 5074) were also reported missing in the RH terminal relative to the LH terminal of B19-Au (Shade et al., 1986). The other two missing G residues in the RH termini of B19-Wi (between nt 5252 and 5253) are within the additional sequence present in the RH terminus of B19-Wi  relative to B19-Au (Fig. 3A).  65 Except for the missing 49 basepairs, the RHH and LHH of  B19-Wi are probably imperfect inverted terminal repeats. It should be mentioned that these cloned hairpins are incomplete due to deletion of the loop end during propagation of clones in E. coli.  Estimates from restriction digests of annealed plus and minus strands of viral  DNA suggest the intact inverted repeats are approximately 330 bp long (Astell, C. unpublished results).  The longest terminal inverted repeat that has been sequenced is the  RHH of B19-Wi (218 bp) (Fig. 3A). B. In vitro Transcription of B19 DNA in HeLa Extracts. 1. Determining The Start Site of Transcription The major BamHI fragment of B19-Wi contained in pYT102 (Fig. 4A) included all four of the putative transcription start sites at m.u. 5, 24, 49, and 58 (Shade et al., 1986). Runoff transcription assays using commercial HeLa whole cell extracts (Manley et al., 1980) or HeLa nuclear cell extracts, and pYT102 DNA digested with restriction enzymes which cut sequentially closer to the left end of the viral genome resulted in a series of RNA transcripts of decreasing size (Fig. 4B, lanes 1-4). The sizes of these fragments were consistent with a transcription start site between nt 260 and 360 (mu 5-7). 2. Upstream Deletion of the B19 Promoter Using pYT102 DNA digested with XmnI (Fig. 4A), a transcript of approximately 1200 nt was observed (Fig. 5A, lane 1). The size of the transcript was consistent with the presence of a Pol II promoter site between mu 5-7, previously observed (Fig. 4B). Different RNA polymerases (I, II, and III) are each uniquely tolerant to different levels of a-amanitin (Manley, 1980).  When low levels of a-amanitin were present (1 /xg/ml) the 1200 nt long  transcript disappears, indicating that Pol II mediates its synthesis (Fig. 5A, lane 2). If the cloning vector pAT153 was used (Fig. 5A, lane 3) the 1200 nt band was also absent. A radioactive band at about 1900 nt was present in lanes 1-3 (Fig. 5A). In Fig. 5, lane 3 contains only the pAT vector while lanes 1 and 2 contain both the pAT vector plus B19 insert. Therefore the radioactive band at 1900 nt probably originates from the pAT vector.  66 Figure 4. Transcription of cloned B19-WJ in HeLa nuclear extracts. (A) Restriction endonuclease map of pYT102 and p3141. The heavy line is insert (Bl9-Wi) DNA and the light line is pAT153 or pUC 13. (B) Transcription of pYT102 in HeLa nuclear extracts. Incubation procedures were as described in Materials & Methods. The total volume of each assay was 25 u| and the concentration of DNA template was 16ug/ml. RNA products were electrophoresed on a 2.2 M formaldehyde-1.0% agarose gel for 1500 volt-hours in 1x MOPs buffer. The gel was dried and autoradiographed for 12 hours. Lane M, a size marker, is labelled bacteriophage lambda DNA cut with EcoRI and Hindlll. Lanes 1-4 are transcription of the pYT102 clone of B19-W1 cut with: lane 1, PstI; 2, Smal; 3, Xmnl; and 4, Spel.  A  Figure 5. In vitro transcription of p3141 and deletion clones In vitro transcription assays of B19-Wi DNA cloned into pAT153 (A) and pUC13 (B). Incubation procedures were as described in Fig.2. RNA products were fractionated by electrophoresis on a 7 M urea-4% acrylamide gel. Gels were autoradiographed for 12 hours. Lane M is P-labeled SV40 DNA cut with Hinfl. (A) Lanes 1 and 2 are pYT102 DNA and lane 3 is pAT153. The reaction analyzed in lane 2 also contained a-amanitin (1 /ig/ml). (B) Lanes 1 and 2 are p3141 DNA and lane 3 is pUC DNA. Lane 2 also contained a-amanitin (1 /ig/ml). Lanes 4-7 are deletion clones of p3141. Lane 4 DNA p3141<207 (missing nt 1-207 inclusive); lane 5 is p3141<257 (missing nt 1-257 inclusive); lane 6 is p3141<321 (missing nt 1-321 inclusive); lane 7 is p3141<523 (missing nt 1-523). DNA templates in assays (lanes) 1-3 (A) and 1-7 (B) were digested with Xmnl. 32  A  B M 1 2 3  M 1 2 3 4 5 6 7  68  Although RNA Pol II is known also to initiate at DNA ends and internal nicks (Manley, 1983), the band at 1900 did not disappear in the presence of a-amanitin and hence is not a RNA Pol II transcript (Fig. 5A, lane 2). The sensitivity of the band to RNase treatment was never tested, and it is possible the band at 1900 was either the product of another RNA polymerase other than Pol II or it could also be an end labelled pAT vector (Manley et al., 1983). The 1200 nt transcript was present when p3141 DNA (Fig. 3A) was used as the template (Fig. 5B, lane 1) and absent in the presence of a-amanitin (Fig. 5B, lane 2) or with pUC as a template (Fig. 5B, lane 3). The 1200-nt transcript disappeared when DNA deleted between nt 258 and nt 321 was used as a template (Fig. 5B, lane 6). Examination of the nucleotide sequence in this region revealed two "TATA-like" sequences previously identified at nt 257 and nt 319 (Shade et al., 1986). The clone p3141<257 is missing the first T residue in the "TATA" sequence at nt 257 and the clone p3141<321 is missing the first T and A residues in the "TATA" sequence at nt 319. No transcripts were detected with the p3141<523 clone (Fig. 5B, lane 7). Transcriptional signal strength decreased with increasing deletions from the full length p3141 clone to p3141<207 and p3141<257 clones (Fig. 5B, lanes 1, 4, and 5). The results suggest a single active promoter in B19 located at nt 319. 3. Comparison of Different Deletion Clones Transcriptional assays with deletion clones suggested that at least 2 upstream sequence(s) were  enhancing transcription.  transcriptional levels.  Removal of these sequences depressed  To define more accurately the sequences which were enhancing  transcription, a number of deletion clones were compared for transcriptional strength. Signal strength varied by as much as 20%-50% from one assay to the next, using the same template (Fig 6B, lanes 1 and 5, or 2 and 6). Comparing transcriptional activity of different templates was difficult (Fig. 6B, lanes 1 and 2, or 5 and 6) and the results questionable. It was suggested that I mix two different deletion templates together in equimolar amounts, in the same assay. If the total transcription level in a given assay varied, the effect should be the same on both templates, allowing a better comparison of promoter strength  69  Figure 6. In vitro transcription of equimolar mixtures of p3141, p3141<107 and p3141<170. (A) Restriction digests of DNA templates are electrophoresed on a 0.7% agarose gel in M&G buffer [50 mM Tris-Borate, 1 mM EDTA (pH8.3)]. Lane 1 and 5 are p3141\XmnI, lane 2 and 6 are p3141PsfI, lane 3 and 7 are p3141<107-XmnI, and lane 4 and 8 are p3141<107PstI. Lanes 1-4 have 100 ng DNA template and lanes 5-8 have 50 ng DNA template. Lanes 1-4 were templates diluted 2 fold and lanes 5-8 were templates diluted 4 fold. Lanes 1 to 8 were an additional visual observation to ensure that the concentration of undiluted templates, subsequently used in transcription experiments, were the same. The concentration of all undiluted templates by A 6o 200 ng/pl. (B) Transcription assays of p3141 and p3141<107. Transcription of DNA templates were as described in Materials and Methods. Twenty /d aliquots (200 ng//d DNA) of the templates in Fig. 5a, one digested with XmnI and the other with PstI, were mixed and 2 pi (400 ng) were used for each assay. RNA products were electrophoresed on a 2.2 M formaldehyde-1% agarose gel. Wet gels were exposed overnight at 4 °C with a Cronex intensifying screen to locate radioactive bands which were excised and measured by Cerenkov counts. A single DNA template in a transcription reaction was 16 pg/ml and each template in mixed reactions was 8 pg/ml. Lane M is bacteriophage Lambda DNA digested with EcoRI and Hindlll and labeled with [a P]dATP. Lane 1 and 5 are both p3141 "XmnI. Lane 2 and 6 are both p3141<107XmnI. Lane 3 is p3141\XmnI and p3141<107PstI. Lane 4 is p3141 PstI and p3141<107XmnI. 2  w a s  32  ,  70 Figure 6C. In vitro transcription of equimolar mixtures of p3141 and p3141<170. Transcription assay procedures were as described [Fig.5(b)]. Lane 1 is p3141XmnI. Lane 2 is p3141<170\XmnI. Lane 3 is p3141XmnI and p3141<170PstI. Lane 4 is p3141PsfI and p3141<170-XmnI.  1  2  3  4  71  between two different templates.  Two different templates were each cut with a different  enzyme downstream of the initiation site, prior to mixing the two templates together for a single transcription assay.  Hence, the length of the transcript would identify the template  that transcribed it. The two different templates were then each digested with the converse enzymes from the first assay, prior to mixing together for a second transcription assay. Templates, prior to mixing and transcription, had the same concentration when compared by spectrophotometer measurements at A gQ. 2  DNA templates were checked by  agarose gel electrophoresis, to both ensure complete restriction digestion and that approximately equivalent amounts of template were used in each assay (Fig. 6A, lanes 1-8). DNA concentration for optimal transcription of the B19 template, from control experiments not shown here, were about 16-20 pg/ml. The difference in template concentration between a fully intact B19 template, and a B19 template with nt 1-321 removed, was about 5% in the final transcription assay.  The 5% difference is based on the following calculation. Two  hundred ng each of two different templates was used per transcription reaction in a volume of 25 pi (total DNA concentration =16 pg/ml). Two hundred nanograms of p3141 with 5827 basepairs (pUC 13 with 2686 bp and B19 insert with 3141 bp) would be about 52 femtomoles.  Two hundred nanograms of p3141<321 (equivalent to p3141 except for a  deletion of 321 bp) with 5506 basepairs would be about 54.8 femtomoles of DNA. The difference between 52 and 54.8 femtomoles is 5%. B19 DNA digested with PstI has an in vitro RNA transcript size of 2790 nt. B19 DNA digested with XmnI has an in vitro RNA transcript size of 1150 nt. The size of the two transcripts is based on both a single RNA start site (Fig. 4B) at nt 351 (Fig. 4; Blundell et al., 1987), and the location of the first downstream PstI or XmnI site (Fig. 4A). The PstI cut p3141 had a transcript of about 2900 nt and p3141<107 cut with XmnI had a transcript of about 1300 nt (Fig. 6B, lane 3), when compared to DNA size markers (Fig. 6B, lane M). Since RNA migrates more slowly than DNA on formaldehyde-agarose gels 4  (Maniatis et al., 1982), the size of the two different RNA transcripts from PstI and XmnI  72 digested B19 should be, and was, larger than the calculated size when compared to DNA markers. The PstI digested p3141 template signal was stronger than the XmnI digested p3141 <107 template (Fig. 6B,lane 3), as expected, since the p3141 encoded transcript was longer. The PstI digested p3141<107 template signal was stronger than the XmnI digested p3141 template signal in the converse assay (Fig. 6B, lane 4). The ratio of transcriptional signal strength of the longer to the shorter transcript in either assay was the same, 1.6:1 (Table 2). The experiment was repeated a second time with similar results. The same ratio suggests that the levels of transcription from both the p3141 and p3141<107 templates are the same. The PstI transcript was 2.4x longer than the XmnI transcript. One would expect the ratio of transcriptional signal strength between the PstI and XmnI transcript to be 2.4:1. The actual 1.6:1 ratio of transcriptional signal strength between the PstI and XmnI transcripts was unexpected. The proportion of uracils per unit length is the same throughout the transcript. The difference between the expected ratio of 2.4:1 and the actual ratio of 1.6:1 may be a result of early termination of transcription by Pol II, before it runs off the template. The longer the transcript, the more likely Pol II might terminate early, the lower the expected transcriptional strength of a longer transcript relative to a shorter transcript. The increasing chance of early termination by Pol II on a longer transcript is unproven, but early termination has been suggested elsewhere (Manley, 1980). The XmnI digested p3141 template had a stronger transcriptional signal than XmnI digested p3141<170, when assays containing single templates of either were compared (Fig. 6C, lanes 1 and 2). In an assay containing an equimolar mixture of the two templates, XmnI digested p3141, though encoding the shorter transcript, had a much stronger signal than the PstI digested p3141<170 (Fig. 6C, lane 3). The stronger signal from the shorter transcript encoded by the p3141 template, suggests that the loss of a sequence(s) between nt 107 and 170 in the p3141<170 template has depressed transcription. For the PstI digested p3141<170 and XmnI digested p3141, the signal ratio of longer to shorter transcript was 0.42:1 (Table 2).  73  The 0.42:1 ratio is a decrease from the 1.6:1 ratio established between the p3141 and p3141<107 templates. For PstI digested p3141 and XmnI digested p3141<170, the signal ratio of the longer to shorter transcript was 6.7:1 (Fig. 6C, lane 4, and Table 2). The strong signal ratio of PstI digested p3141 compared to Xmn I digested P3141<170, also suggests that some sequence between nt 107 and 170 had an enhancing effect on transcription. A series of mixed deletion templates, compared by gel electrophoresis prior to transcription, had the same concentration of DNA (Fig. 7A, lane 1-12). The XmnI digested p3141 template had a stronger signal than each of the longer transcripts of the PstI digested templates p3141<170 (shown previously), p3141<207, and p3141<257 (Fig. 7B, lanes 1, 3, and 5, Table 2). The PstI cut p3141 template had a greatly enhanced signal compared to each of the shorter transcripts of the XmnI digested templates p3141<170, p3141<207, and p3141<257 (Fig. 7B, lanes 2, 4, and 6, Table 2). The results clearly show a region between nt 108 and nt 170 (inclusive) was required for enhanced transcription. The transcription signal of XmnI digested p3141<170 was equivalent to the longer Pst I digested p3141<207 transcript (Fig. 7B, lane 7, Table 2). In the converse assay, the transcription signal of XmnI digested p3141<207 was equivalent to the signal from the longer transcript of PstI digested p3141<170. The two assays were repeated 3 times, with the same result.  The results suggest that in vitro there are probably no cis-activating sequences  between nt 170 to 207 that are involved in transcription. The transcript signal of XmnI digested p3141<170 was stronger than the longer transcript of PstI digested p3141<257 (Fig. 7B, lane 9). The ratio of the transcript signal of PstI digested p3141<170 to XmnI digested p3141<257 was 3:1 (Table 2, Fig. 7B, lane 10). The results suggested a sequence(s) between nt 170 and 257 was enhancing transcription. The XmnI digested template of p3141<207 had a stronger signal than the longer transcript of PstI digested p3141<257 (Fig. 7B, lane 11). The ratio of the transcript signal of PstI digested p3141<207 to XmnI digested p3141<257 was 2.6:1 (Table 2, Fig. 7B, lane 12). A sequence between nt 208 and 257 must also be contributing to the elevated transcription  74  Figure 7. In vitro transcription of equimolar mixtures of p3141 and p3141 deletion clones. (A) Aliquots (20 pi) of different DNA templates (80 ng/pl), one template digested with XmnI and the other with PstI, were mixed together. Two pi of each mixture were electrophoresed on a 0.7% agarose gel. Lane 1: p3141XmnI and p3141<170PstI Lane 2: p3141PstI and P3141<170XmnI Lane 3: p3141 XmnI and p3141 <207 PstI Lane 4: p3141 PstI and p3141<207XmnI Lane 5: p3141XmnI and p3141<257 PstI Lane 6: p3141 PstI and p3141<257 XmnI Lane 7: p3141<170XmnI and p3141<207PstI Lane 8: p3141<170PstI and p3141<207\XmnI Lane 9: p3141<170XmnI and p3141<257TstI Lane 10: p3141<170PstI and p3141<257 XmnI Lane 11: p3141 <207 XmnI and p3141<257PstI Lane 12: p3141<207PstI and p3141<257 XmnI (B) Transcription assays of mixes [Fig.7(a)], lanes 1-12 were as described in Materials and Methods. RNA was electrophoresed on a 2.2 M formaldehyde-0.7% agarose gel, and radioactive bands located by autoradiography and activity measured by Cerenkov counts.  I i 1 t S I M  I IOII I I  Table 2. Relative Transcriptional Strength of Equimolar mixes of p3141 and p3141 Deletion Templates Template 1 P s t I Template 2 XmnI  CPM 1 CPM 2  D3141 P314K100  1.6*  D314K100 p3141  1.6*  D3141 p3141<170  6.7**  D314K170 p3141  0.42  D3141 p3141<207  11.4  D314K207 p3141  0.59  P3141 p3141<257  8.6  D314K257 p3141  0.27  D314K170 p3141<207  1.09  D314K207 p3141<170  0.81  P314K170 P314K257  3.09  TJ314K257 p3141<170  0.51  D314K207 P314K257  2.69  D314K257 p3141<207  0.37  Template 2 P s t I Template 1 XmnI  CPM 2 CPM 1  *Average of 2 assays **Average of 3 assays Results are tabulated from gels shown in Fig. 6, Fig. 6C, Fig. 7, and repetitive assays of these gels. Equimolar mixtures containing two different DNA templates, one digested with PstI and the other with XmnI, were transcribed in HeLa extracts and their respective RNA transcipts isolated after fractionation on agarose and autoradiography. Cerenkov counts in counts per min (CPM) were taken of one cnr~ gel slices containing radioactive RNA transcripts. Two gel slices, each gel slice 1cm , one gel slice directly above and one directly below the RNA containing gel slice were excised, counted, averaged and subtracted as background, from the CPM of the RNA containing gel slice. The ratio of CPM1:CPM2 is calculated using the CPM (minus the background) from the two transcripts of each assay, each transcript encoded by a different template. Gels were reexposed after the radioactive bands were excised, to ensure the complete bands were excised.  76 level. The contribution to transcription by a sequence(s) between nt 208 and 257 agrees with results described previously (Fig 5B, lanes 4 and 5); While the mixing experiments did not detect subtle changes in transcription between different deletion templates, the results of mixing experiments supported the results observed when assaying and comparing transcription between individual templates such as in Figure 5B.  All the results suggested that a number of sequences were involved in enhancing  transcription from the B19 promoter. C . Putative C i s - a c t i v a t i n g M o t i f s Identified by Sequence Analyses  A number of transactivating factors have been purified and their cis-activating consensus sequences characterized.  The first 500 nt on the LH of the B19 genome were  searched for these known sequences using a Seqnce4 software program available from Delaney Software (Fig. 8A). Deletion of the B19 promoter sequence from nt 101 to 170 resulted in decreased transcription and the deletion removed three potential cis-activating sequences (Fig. 8B); an EIIA-EF site (Sivaraman et al., 1986; Sivaraman and Thimmappaya, 1987; Jalinot et al., 1988), a CREB site (Montminy and Bilezikjian, 1987; Hardy and Shenk, 1988) and a SP1 site (Briggs et al., 1986).  The inverted complements of these three putative cis-activating  sequences are also present in the first 100 bp of B19 (the consequence of the hairpin sequence in this region) but the removal of nt 1 to 100 had no apparent effect on in vitro transcription (Fig. 6B, Table 1). No known cis-activating sequences were identified between nucleotides 170 and 207, in agreement with in vitro transcription results. Deletion of nt 208 to 257 caused a further decrease in transcription levels and removed a putative SP1 site (Briggs et al., 1986) and an OTF/NF-III site (Fletcher et al., 1987; Scheidereit et al., 1987; Pruijn et al., 1986) (Fig. 8B). Deletion of nt 257 to 321, in addition to removing part of the functional TATA site, also eliminated a CAT/NF1 site (Raymondjean et al., 1988; Jones et al., 1987; Dorn et al., 1987; Cereghini et al., 1987) and two tandem SP1 sites (Briggs et al., 1986) (Fig. 8B). NF-1 and NF-III are also known to interact with and stimulate initiation of DNA replication of  77 Figure 8. Putative DNA binding sites for trans-activating factors in the B19 promoter region. (A) Putative DNA binding sites (boxed areas) are identified and located by the number on the solid line. The numbering of these boxed areas is shown two ways. The numbers above the solid line are based on a standard promoter with a transcriptional start site of +1. Nucleotides upstream are negatively numbered. Numbers in brackets below the line correlate with B19-Au (Shade, 1986) with +1 nucleotide at the LH end of B19. Ratio of numbers below each boxed area indicates similarity of B19 to consensus sequence of Sp1( wmtj, EIILA-EF ( « ^ ) , O T F ( • ) , C A T (• ), or C R E B (O) trans-activating factors. The TATA box (CD) is also shown. (B) Deletion clones of p3141 used in transcription assays for Fig. 4, 5, 6 & 7. Solid lines are B19.-W1 sequences and hatched areas ( i i i i n i )indicate extent of deletions. All deletion clones are named according to the amount of B19 sequence deleted (inclusive) from the left-hand side of B19-Au (Shade.1986) with the exception of p A which retains nt 1 to 44 of B19. p A 1 7 0 probably occurred by hairpin deletion during replication. Numbers at the end of each crosshatched box indicate the extent of upstream deletion based on a transcriptional start site of +1. Deletions in B labelled as pA 100, etc. are equivalent to p3141^ 100, text and remaining figures. 1 7 0  -265 -350  -313 (38)  (1)  10 10  -250 -235  -283  -204  -136  J<>4)-b-J<>—L-  (72) (86)  _7_ 7  (116) (101)  8  8  8  8  7 7  -126  (215)  (147)  10 10  (225)  _8  -85  4  . "7  -59  -32  30\ irn n\ (266) (292) (319) (303)  +  1 1  (351)  10 9 10 10  8  10  B p3141  +1 +1  PA  -180  170  +1 -143  P A 207 llllllllllllllllllllllllllllll  +1 -9.3  p A 257  iiiimiiiiimiiiimiii PA  nm  -29  321  IIIIIIIII  i  +1  nimmiiiiHiiiiin  i  mm  minium  78  adenovirus (Pruijn et al., 1986; Guggenheimer et al., 1984; Rawlins et al., 1984; Leegwater et al., 1985). A second computer search was performed by comparing the B19 sequence (nt 1 to 500) to a compiled set of cis-activating sequences (in Nucl. Acids Res.; Wingender, 1988). The comparisons (Table 3) were confined to factors within HeLa and other human extracts, as B19 is a human virus. It is of interest to note there are no known restriction enzyme recognition sites for 6 bp sequences in the first 500 bp on the LH of B19. On average, a 6 bp restriction enzyme sequence should occur once every 4^ bp (or 4000 bp). In contrast, in the first 500 bp there are 19 sequences which have 6 or more contiguous nucleotides homologous to previously identified cis-activating elements (Table 3). It seems likely that a number of these putative B19 cis-activating elements are functional. Some of the sequences of B19 in Table 3 are probably recognized by the same factors identified in Fig. 8A and some are probably unique. The interval of nt 170 to 207 has no cis-activating sequences, according to Table 3, and  in vitro  transcription was not measurably affected when nt 170 to  207 were removed (Fig. 7B, lanes 7 and 8). The additional 49 nt in the central portion of the RH terminus (nt 5135 to 5183), not present in the LH terminus (Fig. 3A and 3B), was also searched for cis-activating sequences. The extra sequence found in the RHH of B19 could presumably occur in viral DNA in the LHH of B19. No additional cis-activating sequences were identified within the 49 nt. Compiling a list of cis-activating sequences was done mainly for future references in studying other regulatory sequences of B19, but one particularly interesting observation can be made.  There are eight AAV-like consensus sequences for binding of transactivating  factors (Table 3). The eight putative cis-activating elements include binding sites for the previously identified NF1 and NFIH factors which can be bifunctional, involved both in transcription and replication (Jones et al., 1987; O'Neill, 1988).  79  Table 3. Cis-activating consensus sequences in the B19 Promoter (see * at end). Numbers quoted under sequence motifs correlate with B19-Au (Shade,86). Numbering of sequence motifs in positive direction (left to right) is 5' to 3' on the plus strand. Numbering in negative direction (left to right) is 5' to 3' on the negative strand. GENE (SPECIES) c - f OS  (human) B19 h i s t o n e h.4 (human) B19 EIIaEl (adenovirus2)  SEQUENCE MOTIF  FACTOR BOUND  GTGACGT ******* GTGACGT 109 103 GAAATGNNGAAATG ****** * *** GAAATGACGTAATT 112 125  CELL LINE  REFERENCE  HeLa  Fisch,87  ?  HeLa  Pauli,87  EIIaE-Ca  HeLa  Boeuf,87 Jalinot,87  B19  GTGGGATTTCCTT * ******* ACGTCATTTCCTG 121 109  hbvl (hepatitis B virus) B19  GGGTTATGTCATTGGATGTT ? *** ****** *** CAATTACGTCATTTCCTGTG 126 107  HepG2  EIIaEl (AAV-5, AAV-2)  TGGAGATGACGTAGTTT EIIA-EF *** ******** ** AGGAAATGACGTAATTG 110 126  HeLa  Sivaraman,86 Sivaraman,87 Yee,8 7 Jalinot,87 Bouef,87  CATAATGGCGCT ** ****** CAAGATGGCGGA 138 127  EIIAE-Cb  HeLa  Jalinot,87  GACTTC ****** GACTTC 149 144  histone specific factor  human  B19  EIIaEl (adenovirus2) B19 Histone (H2B) B19  Shaul,87  Zhong,83 Hazel,86  80 GENE (SPECIES)  SEQUENCE MOTIF  FACTOR BOUND  CELL LINE  REFERENCE  lpv (lymphtropic papovavirus) B19  IgPE-2 human CCACCAAACCGAAAGTCCAGG **** ****** * ATCTTGTACCGGAAGTCCCGC 133 153  u5snrna2 (Xenopu laevis) B19  GGTGCGCGCCGGT *** ******* GGTCGCCGCCGGT 167 155  HeLa  Kazmaier,87  hsp70 (human)  GACCGTCGGAGTAG ***** * * * * GACCGGCGGCATCT 165 178  HeLa  Morgan,87  HeLa  Wu,87  NF-III (OTF)  HeLa  Prui;jn,86  CCATTTTCGCGGGAA ******* * CCATTTTAAGTGTTT 239 253  E2F  HeLa  Kovesdi,87  GTTGTAGTAAA ** * * * * * * * ATTATAGTAAA 262 252  ?  HeLa  Barret,87  CCATTTTCGCGGGAA ******* * * * CCATTTTAACCGTTA 294 280  E2F  HeLa  Kovesdi,87  B19 hsp70 (human) B19 adenovirus B19 E1A (adenovirusS) B19 E1A (adenovirus2) B19 E1A (adenovirus5) B19  GAAGGGAAA * ****** GGCGGGAAA 222 214 TATGATAATGAG **** **** * TATGGAAATGGG 224 235  ?  Schlokat,86  81  GENE (SPECIES)  SEQUENCE MOTIF  momulv2 a n d Adenovirus  TGAATATGGGCCA  B19  immunoglobulin (kappa l i g h t chain) B19 mmtv4 B19  * ** ******  FACTOR BOUND NF-1 (CTF)  TTAAAATGGGCGG 286 298  GGGGACTTTCC  ********  NF-kB  CELL LINE  REFERENCE  NIH3T3 Speck,87 HeLa Rawlins,84 Guggenheimer,84 Leegwater,85 Jones,87 human B cells  Sen,8 6  CTGGACTTTCT 369 379 AGTGTTCT  * ******  AATGTTCT 472 479  NIH3T3 GR (glucocorticoid receptor)  Payvar,83  *Table was derived from comparison of B19 sequences with "Table 1: Transcription regulating sites which are bound by proteins." in Nuc. Acids Res 16:1880-1889 (Wingender, 1988) Basepairs 1-500 of B19 were compared. Cis-activating sequences with 6 or more sequential matching basepairs to B19 are included.  82  D. HeLa Factor(s) Bind to the B19 Promoter Region  Site specific DNA-binding proteins have been shown to interact with cis-activating DNA sequences to enhance transcriptional strength of various promoters.  The gel-shift  mobility assay is one means to test for specific protein binding to a DNA sequence. Labelled DNA fragments are combined with cellular extracts and the mixtures are fractionated by gel electrophoresis.  DNA fragments with bound protein have decreased mobility compared to  unbound or free DNA fragment, and along with the appropriate controls, these assays can show whether the protein is bound to a specific DNA sequence. Gel-shift mobility assays using a P-labelled B19 DNA fragment (nt 101-343) 32  incubated with HeLa nuclear extracts identified at least two retained bands, bl and b2 (Fig. 9, lane H), when compared to a control with no added extract (Fig. 9, lane C). Previously, SP1 had been partially purified by gel-exclusion chromatography of a HeLa nuclear extract on a Sephacryl S300 column (Dynan and Tjian, 1983).  Given the  multiple putative SP1 sites, a series of gel-shift assays using the same B19 fragment (nt 101 to nt 343) with Sephacryl S300 HeLa fractions seemed an appropriate first step in characterizing the bound protein. The void volume (V , fractions 36 to 40) of the Sepacryl S300 column, containing G  proteins and cellular material equal to or larger than 10^ daltons), contained no observable factors capable of binding the B19 fragment in gel-shift assays (Fig. 9). In fractions 44 to 64, retained bands in the same position as bl and b2 gradually appear and then disappear (Fig. 9).  The retained bands bl and b2 were most prominent at fraction 56 (Fig. 9). A  third faint band appeared above b2 in fractions 54 and 56.  The included volume of the  column (fractions 75-85), containing proteins equal to or less than 10^ daltons, had no binding activity in the gel shift assay (Fig. 9). The band observed across the top of the gel was probably nonspecific protein -DNA aggregates that were retained in the gel slot (Fig. 9). In this type of binding assay, the use of excess protein could cause considerable non-specific binding of RNA Pol II and other DNA binding proteins to DNA fragments (Shanblatt and Revzin, 1984).  83  Figure 9. Gel-shift Mobility Assays with HeLa nuclear extract and Sephacryl S300 column fractionated HeLa nuclear extract. A P-labelled B19-Wi fragment (nt 101-343) was used in binding reactions. Lane C is control, with no extract added. Lane H has Hela nuclear extract (7 /xg protein). Lanes 36-86 are the even numbered fractions (0.4 /xg protein/lane) from a HeLa nuclear extract passed through a Sephacryl S300 column. Sephacryl S300 column fractionation and gel shift assays were as outlined in Materials and Methods. J  84  The previously reported ratio of the eluted volume ( V ^ ) to the void volume (VQ), on a Sephacryl S300 column, was 1.4:1 for SP1 (Briggs et al., 1986). Given that the average V Q of the S300 column in Fig. 9 was at fraction 37.5, and that 2 ml fractions were collected, then fraction 52.5 had a V ^ / V Q of 1.4:1, similar to the ratio observed for SP1 (Briggs et al., 1986). The observed pattern of increasing and decreasing prominence of retained bands in fractions 52 to 58 (Fig. 9), which included the fraction with a V  E  /VQ  of 1.4:1, suggested  that SP1 could be one factor that was binding to the B19 fragment (nt 101 to 343). The DNA fragment used in gel retention assays (nt 108-343) contained a number of putative cis-activating sequences, other than the potential SP1 sites. To simplify the analyses and thereby eliminate confusing results, it was necessary to obtain fragments containing individual binding sites. The sequence of one of the five SPl-like sites identified (nt 292301, Fig. 8A) closely matched high affinity SP1 binding sites previously reported and outlined below. The  putative Spl site  High a f f i n i t y binding 1986) a r e : HSV-IE3  o f B19 (nt292 t o 3 0 1 ) i s : 5'-TGGGCGGAGC-3' s i t e s f o r S p l (Kadonaga e t a l . , 5'-TGGGCGGGGC-3'  SV40  ( I I I and V )  5'-TGGGCGGAGT-3'  DHFR  ( I I and I V )  5'-GGGGCGGAGC-3'  Differences in nucleotide residues between the high affinity SP1 sites and B19 are underlined.  Each of the high affinity sites differs at just one bp when compared to the  putative B19 Spl site.  Also, for each of the Spl sites that differs at the one bp when  compared to B19, the nucleotide residue at that same position in the other two SP1 sites matches that residue within the B19 sequence. A BamHI to SauIIIA fragment (nt 1-1006) was cloned into pUC19 and sequences upstream of this high affinity SPl-like site were removed by Exo III and SI nuclease digestion (Fig. 10A). A fragment containing this site, designated D272 (nt 272-343) was characterized by DNA sequencing (Fig. 10B), isolated from the resulting plasmid (pD272, Fig. 10A), and used in gel shift assays.  85  Figure 10. Construction of D272. (A) Construction of deletion clone p__ 271 and characterization of D272. (B19-Wi, nt 272-343). (B) Complete nucleotide sequence of D272 was obtained by the dideoxy chain termination method of Sanger. The GC-boxes (SP1-like motifs) are identified by heavy overlines. D272, labeled by phosphorylating the starred nucleotide (* ), was used in subsequent footprinting and gel-retention assays. SaulllA(1  SaulllA(1621) SaulllA(2570) SaulllA(2591)  BamHI/SaulllA(1)  Pstl(3141)  BamHI/SaulllA BamHI/SaulllA(1) PstI Hindlll  I  nt 272 (B19-Au  SaulllAl[1006) EcoRI  -BamHI/Pstl -Exolll/S1 -T4 Ligase  Hindlll(595)  Hindlll  SaulllA(1006) EcoRI  Hindlll nt272 Hindlllv^j  Alul(342) |  _____  D272  B  nt272  Hindlll(595)  I  CIP T4 kinase/ Alul  nt272 HindllKI  32P^ATP  nt343  nt343  5'-AAGCTTGCATGCCTCAGTTTTGTAACGGTTAAAATGGGCGGAGCGTAGGCGGGGACTACAGTATATATAGCAGGGCACTGCCGCAG 3 -CGAACGTACGGAGTCAAAACATTGCCAATTTTACCCGCCTCGCATCCGCCCCTGATGTCATATATATGGTCCCGTGACGGCG -  TC  86  Three prominent retained bands, Bl, B2, and B3, were visible when D272 was incubated with HeLa nuclear extract in the presence of a non-specific competitor DNA, poly [d(rC)] (Fig. 11 A, lane 3). Three faint retained bands were present, one in the same position as B l , when D272 was incubated with HeLa nuclear extract using E. coli DNA as a nonspecific competitor, (Fig. 11 A, lane 2). Two distinct bands were present at positions Bl and B3, and one very faint band at B2, when D272 was incubated with fraction 56 from the Sephacryl S300 column and poly [d(PC)] (Fig. 11 A, lane 5). The banding pattern of D272 incubated with fraction 56 and E. coli DNA (Fig. 11 A, lane 5) was similar D272 incubated with HeLa crude extract E. coli DNA. A distinct change in banding patterns was observed depending on whether E. coli or poly [d(PC)] DNA was used as a nonspecific competitor. Studies of the lac gene show that the type of competitor DNA can alter the stability of specific protein-DNA complexes (Fried and Crothers, 1984; Hendrickson, 1985). The multiple cloning site (MCS) from pUC19 was used in a series of binding reaction analogous to D272.  Multiple retained bands were obtained in the presence of  nuclear extract (Fig. 11B, lanes 2 and 3) or Fraction 56 (Fig. 11B, lanes 4 and 5) but none of the retained bands had the enhanced intensity observed with D272 in the presence of poly [d(PC)] (Fig. 11 A, lane 3).  DNA ends can sequester specific proteins (Sawadogo and  Roeder, 1984; Shanblatt and Revzin, 1984) and consequently the appearance of faint bands for any labelled DNA fragments would be expected. The appearance of very strong bands when D272 was incubated with HeLa extract in the presence of poly [d(PC)] suggested specific protein-DNA binding (Fig. 11 A, lane 3). Only competition assays using unlabelled D272 as a competitor can confirm specific protein-DNA binding of D272 in HeLa extracts. The competition assays were done and have been included in Figure 19 below. £. HeLa Factor Binds a GC-box in the B19 Promoter Region 1. DNAse I Protection Attempts to map the protein binding site of D272 by DNA footprint analyses were unsuccessful with fractionated HeLa extracts from the Sephacryl S300 column. According to Briggs et al. (1986) this protocol should have given a pure enough preparation of SP1 to  87  Figure 11. Gel-shift Mobility Assay of D272 with HeLa nuclear extract and Sephacryl S300 fractions. (A) and (B)Lane 1 has no extract, lane 2 and 3 have HeLa nuclear extract (7 pg) and lane 4 and 5 have Fraction 56 (0.4 pg) (Fig. 9) from the Sephacryl S300 column. Lanes 1,2, and 4 have E. coli DNA (3.2 pg) and lanes 3 and 5 have poly d(PC) DNA (3.2 pg) as nonspecific competitor. Binding reactions were as outlined in Materials and Methods. (A) Lanes 1-5 have the P-labeled D272 fragment. (B) Lanes 1-5 have the P-labeled multiple cloning site (MCS: EcoRI-Hindlll, 55bp) from PUC19. 32  32  B 1  2 3 4 5  iv.  B1  1 2 3 4 5  i  B2 B3  HeLa extract  +  Fraction 56  - -  +  +  - -  +  +  +  +  E. coli  poly [d(PQ]  +  +  - -  -  +  + -  +  - +  +  88  footprint an SP1 site. Typically, labelled D272 was incubated with Sephacryl S300 fractions, treated briefly with DNAse I, purified, separated pn an acrylamide-urea sequencing gel, and compared to D272 under similar conditions without added extract.  A variety of extract  volumes and DNAse I levels were tested. The stability of factors in the fraction from the Sephacryl column may have been a problem. Purification of other transactivating factors like CTF and AP-1 are done in the presence of Nonidet P-40 (Jones et al., 1987; Lee et al., 1987) which stabilizes proteins in low concentration (Hendrickson, 1985).  At the time I  fractionated HeLa extracts on the Sephacryl S300 column, I was unaware of the usefulness of Nonidet P-40. Alternatively, the fragment used for the S300 Sephacryl binding (nt 100 to 343) included a number of putative sites for binding other factors. The D272 fragment (nt 273 to 343) may not have had the sites for binding that were present in the remainder of the larger fragment. Instead, D272 DNA was "footprinted" using an empirically derived footprinting method suggested by Hendrickson (1985).  Nuclear extract was mixed with labelled D272  DNA and treated with DNAse I prior to fractionation on a non-denaturing acrylamide gel. Free and retained bands were electroeluted and compared on a denaturing acrylamide gel. Regions within a single DNA strand, protected from DNAse I cleavage, appeared as a gap or footprint, in an otherwise uninterrupted ladder of cleavage products. Both a free band and a retained band were visible after autoradiography of the DNAse I treated gel-shift assay of D272 (Fig. 12A). The retained band had a faster mobility and hence a lower apparent molecular weight than the 3 retained bands previously identified with D272 (Fig. 11 A, lane 3). The explanation of the apparent discrepancy between the three retained bands (Bl, B2, and B3) identified previously and the single retained band seen here (Fig. 12A) is not obvious. A series of control experiments were originally conducted to determine the concentration of DNase I necessary to obtain a useful footprint of D272. At the levels of DNAse I needed for a footprint, the retained fragment was always a single band migrating slightly slower than the free fragment. It was this retained band that gave the footprint shown in Fig. 13B. The presence of multiple retained bands of D272 could possibly  89  Figure 12. Preparative Gel-Shift Mobility Assays for DNAse I and DMS Footprinting of B19 DNA (D272) in HeLa Nuclear Extracts. 200,000 cpm of [ P] labeled D272 (10,000 cpm/ng) was incubated with 90 /xg of HeLa nuclear extract prior to fractionation on a 4% nondenaturing gel as outlined in Materials and Methods. (A) DNAse I protection. D272 was incubated with HeLa nuclear extract prior to treatment with DNAse I and subsequent fractionation. Free band (F) and bound band (B) are indicated. (B) DMS methylation interference. D272 was methylated with DMS prior to incubation with HeLa nuclear extract and subsequent fractionation. Free band (F) and bound bands Bl, B2, and B3 are indicated. (C) DMS methylation protection. D272 was incubated with HeLa nuclear extract, then methylated with DMS prior to fractionation. Free band (F) and bound band (B) are indicated. 32  90  be due to other proteins within the HeLa extract binding to an already formed protein-DNA complex. The levels of DNAsel necessary to footprint D272 may interfere with and prevent other proteins binding to an protein-DNA complex. commercially  available  DNAse I  preparations  Alternatively, it is known that  contain  the proteolytic  contaminant  chymotrypsin, which will slowly inactivate DNAse I in aqueous buffer solutions. However, while the activity of DNAse I is retained during the short time course of the DNAse I digestion (Ward and Dabrowiak, 1988), proteins which may contribute to formation of Bl, B2, and B3 may undergo sufficient proteolysis that the retained band is converted to a single, more rapidly migrating fragment. Analyses of the DNA fragment showed that a segment covering 8 nt is protected from DNAse I when the retained band was compared to the free band (Fig. 13B, lane B and F respectively).  C-T and A - G specific reaction products obtained in DNA chemical  sequence analyses of D272 (Maxam and Gilbert, 1980), electrophoresed on the same denaturing gel as the DNAse I treated D272 DNA (Fig. 13B), identified the nucleotides residing in the protected region. Certain factors must be accounted for when aligning DNA chemical sequence products with DNAse I treated fragments. Base-specific reactions (Maxam and Gilbert, 1980) remove the base and sugar moieties leaving a 3' end terminated by a phosphate group. Given a fragment N nucleotides long, a base specific reaction will remove 1 nucleotide so its mobility on the gel will be that of a fragment that is N minus 1 nucleotides long.  Therefore a base specific reaction will migrate on a gel to a position one  less than the actual nucleotide which it identifies. DNAse I cleaves the phosphodiester bond so that the 3' end is terminated by a hydroxyl group. Two fragments, one produced by chemical removal of a particular base and one by DNAse I cleavage to the 5' side of the same base, will migrate in the gel such that the DNAse I produced fragment will have a slightly faster mobility than the chemically cleaved fragment (Galas and Schmitz, 1978). The full chemical sequence of D272 (Fig. 13A) was also included to differentiate the C versus T residues and the A versus G residues in the chemical sequence used to orient the  91  Figure 13. DNAse I footprint of D272 with HeLa nuclear extract (A)Chemical sequence of D272, P-labeled on the 5' coding strand, and electrophoresed on a 7 M urea-40% formamide-12% acrylamide gel. The nucleotide sequence shown, numbered according to the B19-Au sequence (Shade et al.,1986), extends over the protected area visible in Fig.llB and protected nt are indicated by solid circles. The boundaries of the SPl-like motif within B19 are also shown. (B)Dnase I footprint of D272. The DNAse I footprint is a large scale gel shift assay with D272 treated briefly with DNAse I prior to loading the gel. Two bands, visible after autoradiography, are excised, purified, and electrophoresed on a 7 M urea-40% formamide-12% acrylamide gel. The F lane is the free running band and the B lane is the bound band (see Fig. 12A). The C T and A"G lanes are the chemical sequence of D272 and serve as markers to identify the protected sequence in the B lane.  A C C  G T A G  C  B  C G T A  F B  DNAse I footprint (Fig. 13B). The eight protected nucleotides are located within the putative high affinity SP1 site (Fig. 13). 2. DMS Interference The end-labelled D272 DNA was modified with dimethyl sulphate (DMS), which methylates the N7 position of guanine in DNA, using the chemical DNA sequencing method (Maxam and Gilbert, 1980). The modified D272 fragment was incubated with HeLa nuclear extract and fractionated on a preparative acrylamide gel. Three retained bands and one free band were visible after autoradiography of the gel (Fig. 12B). The banding pattern was similar to that seen previously with D272 (Fig. 11 A, lane 3). An additional heterogenous smear with a slightly greater mobility than B3 was also observed on the gel (Fig. 12 B) and possibly represents labelled DNA fragments which became unbound from the protein during fractionation on the preparative gel. Purified fragments were cleaved to completion with piperidine and separated on a urea-acrylamide gel. In this type of assay the free DNA band exhibits increased cleavage at sites where modification of the DNA interferes with protein binding. The retained bands (protein-DNA complexes) will exhibit cleavages at all positions except those important for protein-binding. The retained bands Bl and B2 (see Fig. 12B) both had a significantly decreased intensity over 6 G residues (Fig. 14, lanes 2 and 3) when compared to the same G residues of the free band (Fig. 14, lane 1). The same G residues of the retained band B3 (see Fig. 12B) had an intermediate intensity, less then G residues in the free running band (Fig. 14, lane 4 and lane 1) but greater than that observed with Bl and B2 (Fig 14, lanes 2 and 3). Bl and B2 (Fig. 14, lanes 2 and 3) would appear to have the same factor binding to the same region of DNA. The slower mobility of Bl relative to B2 could be due to the binding to B2 of a proteolytic fragment of the factor which binds Bl. The same factor which binds Bl and B2 may also bind to B3, but the actual identity of the factor which binds B3 is unclear from my results. I cannot say why Bl, B2, and B3 have different mobilities on gel-shift assays. Other than the evidence for factor binding between nt 292 and 301, no other protected areas were detected. However, binding of the factor to itself or  Figure 14. DMS footprinting of D272 with HeLa nuclear extract Lanes 1-4. DMS interference footprint of D272. Guanine residues of P-labeled D272 were methylated with DMS (Maxam and Gilbert, 1980). G-modified D272 (200,000 cpm/20 ng) was incubated with HeLa nuclear extract, in a scaled up gel-shift mobility assay. Four bands, located by autoradiography were excised, purified and electrophoresed on a 7 M urea-40% formamide-12% acrylamide gel. Lane 1 is the free running band, and lanes 2, 3, and 4, are the bound bands Bl, B2, and B3 respectively (see Fig. 12B). Lanes 5 and 6 are the DMS protection footprint of D272. P-labeled D272 (200,000 cpm/20 ng) was incubated with HeLa nuclear extract in a scaled up gel-shift mobility assay. The mixture was briefly treated with 3 11 DMS prior to loading the gel. After elecrophoresis, two bands were visible by autoradiography. These bands were electroeluted, purified, treated with piperdine (Maxam and Gilbert, 1980) and electrophoresed on a 7 M urea-40% formamide-12% acrylamide gel. Lane 5 is the free running band and lane 6 is the bound band (see Fig. 12C). The complete sequence of the identified SPl-like motif and protected G residues (solid circles) are diagrammed to the left and numbered according to B19-Au (Shade et al., 1986) 3  12  3 4  5  6  other, factors by protein-protein interactions is one plausible explanation.  94 Different  secondary DNA conformations of a SS D272 fragment might also alter mobility. 3. DMS Protection The corollary to DMS interference experiments is the protection of a region from chemical modification by the presence of a bound protein.  Proteins were first bound to  end-labelled D272 by incubation with HeLa nuclear extract The mixture was briefly treated with DMS prior to fractionation on a preparative acrylamide gel. A free running band and one major retained band were visible after autoradiography (Fig. 12C).  Again, the major  retained species in this scaled up incubation migrated more rapidly (Fig. 12c) than the retained bands Bl, B2, and B3, seen earlier (Fig 11 A, lane 3). I cannot explain the enhanced mobility of the retained fragment, but it is likely that the DMS could methylate both DNA and protein.  Methylation of proteins may prevent additional protein-protein interactions  which contribute to the formation of multiple retained species. The D272 fragments were extracted from the bound and free bands, treated with piperidine to cleave at modified G residues, and fractionated on a denaturing gel. The intensity of 6 G residues was decreased in the bound band relative to the free band (Fig. 14, lanes 6 and 5 respectively). Five of the 6 G residues had a very low signal intensity compared to the remaining G residue (B19-Au, nt 298). One can observe that with a bound factor only one G residue (nt 298) was at least partially accessible to DMS modification. The next three G residues below the G residue at nt 292, in the bound band, appear to have a slightly lower intensity than the same G residues in the free band (Fig. 14, lanes 5 and 6).  The lower  intensity of the G residues may represent some small degree of protection from methylation by a bound factor.  The protection from methylation, if any, for the G residues below nt  292, is unclear from my results. F. Transcription Interference with a Synthetic GC-box A GC-binding factor (possibly SP1) was binding within the SPl-like motif (nt 292301, B19-Au) as shown in DNAse I and DMS footprints. I wanted to know whether this 10  95  bp motif alone was responsible for the binding shown in gel-shift assays and whether it was involved in transcription. 1. Characterization of a Synthetic GC-box Complementary oligonucleotides with the sequence of B19 from nt 292-301 (Shade et al., 1986) were annealed and cloned into pUC19 (Fig. 15A).  Three different clones were  obtained. Two clones, pGC-S and pGC-O, each contained a single GC-box but in opposite orientations relative to each other (Fig. 15B). The remaining clone, pGC-T, had two tandem GC-boxes in the same orientation (Fig. 15B). The clones pGC-T and pGC-O were used in later experiments (see Figures 18 and 19) GC-S was the EcoRI-Hindlll fragment containing the GC-box, isolated from pGC-S (Fig. 15B), and used in subsequent assays.  GC-S was chemically sequenced to ensure the  DNA sequence matched the results obtained previously by the dideoxy chain termination method. A gap was present across all 4 sequencing lanes where a cytosine (complementary to the guanine at nt 293 of B19-Au) was expected (Fig. 16A, lane C). Cloning the GC-box into the Smal site of pUC created a BstNl site (Fig. 16C). The BstNl recognition site contains a 5-methylcytosine at the position of the internal cytosine residues on both strands (Fig. 16C) when grown in methylation competent strains (dcm+) such a E. coli JM101.  The  5-methylcytosine is resistant to cleavage during chemical sequencing (Maxam and Gilbert, 1980) and therefore a methylated C residue resulted in a blank across all 4 sequencing lanes. However, the cytosine residue was clearly visible in the chemical sequence of GC-S isolated from a dcm- mutant strain of E. coli (Fig. 16B, lane C). 2. Binding of a HeLa Factor to the Synthetic GC-Box To test the effect of methylation on factor binding to the GC-box, the MCS site of pUC19 was used as a control in gel-shift assays of the methylated synthetic GC-S (mGC-S). The only difference between the MCS and mGC-S fragments was the additional synthetic GC-box in mGC-S (Fig. 15, A and B). If the GC-box did bind a specific factor, there should be at least one extra retained band for mGC-S, when comparing mGC-S to MCS in gel retention assays. Two retained bands, bl and b2, were observed with mGC-S in the  96 Figure 15. Characterization of synthetic GC-boxes. (A)Cloning of synthetic GC-motifs into the multiple cloning site (MCS) of pUCl9. Purification and annealing of complementary oligonucleotides, and ligation of duplex DNA into pUC were as outlined in methods. (B) Characterization of resulting clones: a single GC-box (GC-S ); a single GC-box in the opposite orientation (GC-SO); and a tandem GC-box (GC-T). Plasmids from which the fragments are isolated are indicated in brackets above the name of each fragment. The arrows above the GC-boxes indicate the orientation. All clones were sequenced by the dideoxy chain terminator method of Sanger. Clones are identified in brackets above each fragment.  (pGC-S)  ^  GC-S  nt292 nt301 | GC box |  5 * -AAGCTTGCATGCX^TGCAGGTCGACTCTAGAGG^ 3 -TT(XJAA<X3TACXJGACGTCCAGCTGAGATCTCX3TAGGGGACCCGCCTCGCXX %  Hindlll  PstI  BamHI  Kpnl  EcoRI  (pGC-SO)  GC-SO GGATCXXCGCTCCXaCCCAGGGTACC  | Hindlll  GCTAGGGGQ3AGGCGGGTC^CATGG \ 7 BamHI  (pGC-T)  •  GC-T  ^  | Hindlll  \ X Kpnl  •  | EcoRI  J  p  GGATCCCCGCTCCGCCCAGCTCCGCCCAGGGTACC CCTAGGGGCGAGGCGGGTCX3AGGCGGGTCCCATGG \ ^ \ > BamHI Kpnl  EcoRI  97  Figure 16. Sequence of GC-S. Sequencing was by the method of Maxam and Gilbert (1980). A 7 M urea-12% acrylamide gel was used for electrophoresis in (A) and (B). The GC-S fragments were isolated from pUC with EcoRI-Hindlll restriction enzyme digests. Phosphatasing, endlabeling with 32P - dATP and kinase, and PstI restriction digestion yields fragments uniquely labeled at the 5' EcoRI site. (A) Sequence of the methylated GC-S (mGC-S). The plasmid containing the synthetic GC-motif was grown in the dcm+ strain of E. coli. JM101. (B) Sequence of the non-methylated GC-S. The plasmid containing GC-S was grown in the dcm- strain - E coli. RB404. (C) Location of the BstNl site created by cloning a synthetic GC-motif into the Sma site of pUC19. The arrow indicates the orientation of the GC-motif. The star ( * ) locates the methylated C present in the sequence of mGC-S (Fig. 14A). The triangle locates the methylated C on the opposite strand of mGC-S.  B C  T A G  C CTAG G  —  I  •  ccTCG-  c GC-S Hindlll PstI  J  S_  I  5-GGATCCCCTGGGCGGAGCGGGTACC-3' 3" -CCTAGGGGACCCGCCTCGCCCATGG-5' I * I BstNl  | EcoRI  98  presence of HeLa extract (Fig. 17A, lane 2).  The addition of cold competitors mGC-S or  MCS removed only the bl band (Fig. 17A, lanes 3 and 4). There were no retained mGC-S bands in the absence of extract (Fig. 17A, lane 1). The pattern of retained bands for MCS was similar to mGC-S (Fig. 17A, lanes 4-8), with some differences. In binding assays of mGC-S the bl band was lighter than the b2 (Fig. 17A, lane 2), but in assays of MCS the bl band was darker than b2 (Fig. 17A, lane 6). The bl band disappears when either mGC-S or MCS are added as cold competitors to either labelled mGC-S (Fig. 17A, lanes 3 and 4) or labelled MCS (Fig. 17A, lanes 7 and 8). An extra band appears just above the free running band of MCS in the presence of extract and the mGC-S cold competitor (Fig. 17A, lane 7). What the extra band represents, if not just an artifact, is unknown. There appeared to be a very faint band, b3, visible in assays of mGC-S (Fig. 17A, lanes 2-4) but not in assays of MCS (Fig. 17A, lanes 6-8).  There seemed to be no significant differences in banding  patterns between mGC-S and MCS and hence the methylated GC-box probably does not bind to specific factors. Methylated (mGC-S) and non methylated (GC-S) GC-box fragments were compared in gel retention assays. Three retained bands were obtained for both GC-S and mGC-S in the presence of HeLa extract (Fig. 17B, lanes 2 and 6). In the assay of GC-S, the intensity of b3 was strong whereas in the assay of mGC-S the intensity of b3 was weak (Fig. 17B, lanes 2 and 6). The strong intensity of b3 in the GC-S assay suggests that b3 may represent the specific binding of a factor to the GC-box. The methylated C residue in the GC- box of mGC-S could decrease the ability of the factor to bind in the mGC-S assay. Doublets for bl and b2 were observed in the GC-S assay (Fig. 17B, lane 2).  Whether these doublets were  artifactual, or otherwise, was unclear. In the assay of labelled GC-S, addition of GC-S as a competitor DNA decreased the intensity of all 3 retained bands (Fig. 17B, lane 3), particularly b3, but only the intensity of bl was significantly reduced when mGC-S was used as a competitor (Fig. 17B, lane 4). Unlabelled GC-S and mGC-S are both effective competitors for bl, but only unlabeled GC-S  99  Figure 17. Gel-shift mobility assays of synthetic GC-S with HeLa nuclear extract One ng of P-labeled DNA (1 ng) was added for every assay. Competition assays were done as outlined in Materials and Methods. (A) Lanes 1-4 have the P-labeled mGC-S and lanes 5-8 have P-labeled MCS of pUC19. Lanes 1 and 5 have no extract and lanes 2-4 and 6-8 have extract. Lanes 3 and 7 have 200 ng of unlabeled mGC-S and lanes 4 and 8 have 200 ng of unlabeled MCS of pUC 19. (B) Lanes 1 -4 have P-labeled GC-S and lanes 5-8 have P-labeled mGC-S. Lanes 1 and 5 have no extract and lanes 2-4 and 6-8 have extract. Lanes 3 and 7 have 200 ng of unlabeled GC-S and lanes 4 and 8 have 200 ng of unlabeled mGC-S. 32  32  32  32  1  2  3  4  5  6  7  8  ? b3  «•»  b1  B 1  2  3  4  5  6  7  8  b3 b2  b1  lit  M  ii  i M J i  100  is an effective competitor for b3. Methylation of the GC-box in mGC-S probably decrease the ability of mGC-S to act as an effective competitor for b3. In the assay of labelled mGC-S, addition of either GC-S or mGC-S as a competitor DNA decreased the intensity of all 3 retained bands, but particularly b2. (Fig. 17B. lanes 7 and 8). Since the bl band could be eliminated by competition with MCS, GCS and mGC-S, bl could be a result of specific binding of a protein in the HeLa cell extract, to the MCS sequence of pUC. The b3 band was very strong in the assay of labeled GC-S, weak in the assay for mGC-S, and not present in the assay for MCS. Only unlabeled GC-S was an effective competitor for b3, in the GC-S assay.  Therefore b3 was probably a result of  specific binding of a factor in HeLa cell extracts, to the synthetic GC-box in GC-S. The nonmethylated GC-box appeared to bind the factor with a much higher affinity than the methylated GC-box. 3. Transcription Competition bv a GC-box Fragment The GC-box containing fragment, GC-S, specifically bound a factor in HeLa nuclear extracts. The factor (SP1 or a similar GC-box binding protein) probably binds both to the the GC box in GC-S and the identical sequence in B19 (nt 292-301). If that factor were involved in elevating transcription by binding to the GC-box of the B19 promoter, then the addition of GC-S might compete with the B19 GC-box for that factor, thereby depressing transcription from the B19 promoter. The effect on transcription from the B19 promoter in the presence of either a nonmethylated GC-box (GC-S) or a methylated GC-box (mGC-S) was compared. The transcription signal from an assay of p3141 was measured in the presence of 4 fold molar ratio of cold competitor to promoter. The transcription signal was 1.2 fold stronger with added mGC-S relative to GC-S DNA (Fig. 18A, lanes 1 and 2). In the presence of 8 fold molar excess of cold competitor, the transcription signal was 1.5 fold stronger with added mGC-S relative to GC-S DNA (Fig. 18A, lanes 3 and 4). There was a slightly stronger transcription signal in the presence of mGC-S, relative to GC-S. The slightly stronger transcription signal suggests that the methylated GC-box of GC-S may be competing less  101  Fig. 18. In vitro transcription assays of p3141 in the presence of competitor GC-box containing fragments. Nonlabeled competitor DNA (2 n I) in TE (pH8) was added to HeLa nuclear extract (15n I), gently mixed and incubated on ice for 15 min, prior to starting the reaction. p3141 (400 ng) digested with XmnI was added in a cocktail to start the reaction. All other procedures were as described in Methods. RNA was electrophoresed on 2.2 M formaldehyde-1% agarose gels. (A)Lane 1 has 20 ng mGC-S and lane 2 has 20 ng GC-S. Lane 3 has 40 ng mGC-S and lane 4 has 40 ng GC-S. (B)Lane 1 has 20 ng mGC-TBT and lane 2 has 20 ng GC-TBT. Lane 3 has 40 ng mGC-TBT and lane 4 has 40 ng GC-TBT. (C) Construction and characterization of the tandem GC-box, GC-TBT. An equimolar mixture of two BamHI-EcoRI fragments, one isolated from pGC-S and the other from pGC-SO, were ligated into the EcoRI site of pUC19. The plasmid, pGC-TBT contains a tandem GC-box separated by 10 bp and an intervening BamHI site. Stars indicate the sites of methylation when grown in a dcm+ strain of E. coli. and arrows indicate the orientation of the GC-box.  A ,  2  3  4  * w&  mm mm?.  i  2  3  •  GC 5'-GMTTCGAGCTCX3GTACCCTGGGCGGAGCGGGGATC 3'-CTTAAGCTCGAGCCATGGGACXXGCCTCG(XCCT EcoRI  Kpnl  4  BamHI  r  GC  Kpnl  EcoRI  102  effectively for a factor which normally binds to the GC-box of the B19 promoter. Transcription was reduced at 8 fold excess with mGC-S or GC-S compared to 4 fold excess of mGC-S or GC-S, respectively (Fig. 18A, lanes 1,3 or 2,4). The effect of a tandem GC-box as an unlabelled competitor in transcription was tested.  Two fragments containing single GC boxes in the opposite orientation were ligated  together in a single plasmid, pGC-TBT (Fig. 16C).  The DNA fragment isolated from  pGC-TBT by EcoRI restriction enzyme digestion contained two GC-boxes in the same orientation and separated by 10 bp (Fig. 18C). GC-TBT was methylated at both GC-boxes (mGC-TBT) when grown in a dcm+ E. coli strain and not methylated (GC-TBT) when grown in a dcm- E. coli strain (Fig. 16C). The transcription signal from an assay of p3141 was measured in the presence of 4 fold molar ratio of cold competitor to promoter.  The  transcription signal was 2.1 fold stronger with added mGC-TBT relative to GC-TBT DNA (Fig. 18B, lanes 1 and 2).  In the presence of 8 fold molar excess of cold competitor, the  transcription signal was 1.7 fold stronger with added mGC-TBT relative to GC-TBT DNA (Fig. 18B, lanes 3 and 4). At 4 fold and 8 fold molar excess of cold competitor to promoter (p3141), the transcription signal was stronger in the presence of mGC-TBT compared to GC-TBT (Fig. 18B, lanes 1,2 or 3,4).  The stronger transcription signal in the presence of  mGC-TBT, relative to GC-TBT, suggests that the methylated GC-box of mGC-TBT can not compete as effectively as the nonmethylated GC-box for a factor which binds the GC-box of the B19 promoter. Transcription was reduced at 8 fold excess with mGC-TBT or GC-TBT compared to 4 fold excess of mGC-TBT or GC-TBT, respectively (Fig. 18B, lanes 1,3 or 2,4). DNA ends sequester RNA Pol II and other specific proteins (Sawadogo and Roeder, 1984; Shanblatt and Revzin, 1984).  Therefore if the number of free DNA ends in a  transcription assay were to increase, one might expect the total transcription of the assay to decrease. Therefore the reduced transcription observed (Fig. 18A, lanes 1 and 3), when using an 8 fold molar excess of competitor relative to a 4 fold molar excess of the same competitor could be explained.  The important point is the difference in transcription between the  103  methylated and non-methylated GC-box and the finding that methylation interferes with or eliminates binding of a specific HeLa cell factor. G. Binding of HeLa Factors(s) Affected by Competitors To show specificity of protein binding to the B19 promoter fragment D272 in gel-shift assays, different unlabelled or cold competitor DNA fragments were added to test if binding could be abolished. In all cases, the competitor DNA fragment was in 200 molar excess of the end labelled D272. End-labelled D272 in the presence of HeLa nuclear extracts had 3 retained bands, Bl, B2, and B3 (Fig. 19, lane 2), not present in the absence of extract (Fig. 19, lane 1). The addition of excess cold D272 strongly reduced the intensity of all 3 retained bands (Fig. 19, lane 3). Cold B55 (B19-Au, nt 1-55) diminished the intensity of Bl, B2, and B3 (Fig. 19, lane 4). Cold B139 (B19-Au, nt 1-139) diminished the intensity of Bl and B2 and strongly reduced B3 (Fig. 19, lane 5). Cold B84 (B19-Au, nt 56-139) strongly reduced B3 but had no effect on B2 or B3 (Fig. 19. lane 6). Cold nonmethylated GC-T (Fig. 15B) diminished the intensity of B l , B2, and B3 (Fig. 19, lane 7).  Cold mGC-TBT  diminished only slightly the intensity of Bl, B2, and B3 (Fig. 19, lane 8). Cold GC-TBT strongly reduced binding of Bl, B2, and B3 (Fig. 19, lane 9). The addition of a nonspecific competitor, the multiple cloning site from pUC19, had no visible effect on Bl, B2, or B3 (Fig. 19, lane 10). An additional band migrating ahead of the free band on the gel was observed in assays with no extract (Fig. 19, lane 1) and assays with GC-TBT as the cold competitor (Fig. 19, lane 9) This additional band could be single stranded D272. Ethanol precipitation and subsequent drying of short double stranded DNA fragments (up to 100 bp) is known to induce a transition into single-stranded DNAs which migrate aberrantly during gel electrophoresis. These SS DNAs bind strongly to nonspecific DNA binding proteins present in nuclear extracts, and may result in misleading interpretations of mobility shift assays (Svaren et al., 1987). This is not a problem in the interpretation of my results since the additional band was only present in some gel-shift assays of D272 whereas the retained bands Bl, B2, and B3 were always observed (except in some large scale preparations of D272 used  104  Figure 19. Competition for binding of D272 in gel-shift assays. (a)Binding reactions were as outlined in Materials and Methods except cold competitor is added before incubation of assays with HeLa extract. All lanes have P-labeled D272 (10,000 cpm, 1 ng DNA). Lane 1 is control with no HeLa extract. Lanes 2-10 have added HeLa extract (7 /xg). Unlabelled competitor DNA fragments (200 ng) were added to lane 3, D272; lane 4, p55 (B19, nt 1-55); lane 5, pl39 (B19, nt 1-139); lane 6, p84 (B19, nt 56-139); lane 7, GC-T; lane 8, mGC-TBT; lane 9, GC-TBT; and lane 10, MCS (pUC19).  for footprinting analyses). The SS bands may not be observed in gel shift assays when in the presence of extract, for the SS DNA could bind variable amounts of different proteins and be distributed throughout the gel. H. In vitro Transcription and a Mutagenized B19 GC-box To directly assess the effect of the GC-box in the B19 promoter, the sequence was altered by site directed mutagenesis.  A fragment containing the promoter and GC-box of  B19 (nt 272-407) was transferred into the bacteriophage vector M13mpll (Fig. 20A). Two G residues at nt 293 and 294 of the plus strand (Shade et al., 1986) were changed to two T residues using the method of Kunkel et al. (1987). The sequence shows the complementary (minus) strand of the wild type (M13<271-H) versus the mutant (M13<271-HTT), where two C nucleotides have replaced two A nucleotides (Fig. 20B). Mutations at similar positions in three Spl binding sites of the HIV-I retrovirus promoter, where 2 T residues replaced 2 G residues, have been shown to eliminate the binding of Spl and to cause a tenfold reduction in transcriptional efficiency in vitro (Jones et al., 1986). I. Factor Binding Affected bv a Mutagenized GC-box DNA fragments (B19-Au, nt 272 to 407) containing the mutagenized or wild type GC-box, from in vitro RF preparations of M13<271-HTT or M13<271-H, were cloned into pUCll (Fig. 21 A).  End-labelled fragments D272 or D272-TT (containing the mutagenized  GC-box) were isolated from the resulting plasmids, pD272-H and pD272-HTT respectively (Fig. 21 A).  Comparing increasing amounts of D272-TT and D272 in gel-shift assays, the  typical pattern of retained bands, bl, b2, and b3, seen with D272 (Fig. 21B, lanes 7-10), was not obtained with D272-TT_ (Fig. 21B, lanes 2-5). At very high levels of D272-TT at least 2 retained bands with a much greater mobility than b3 were observed (Fig. 2IB, lanes 4 and 5). No retained bands were visible in the absence of extract with either D272-TT or D272 (Fig. 2IB, lanes 1 and 5).  A lower intensity band which migrates ahead of the free band is  present in some lanes and could represent single stranded DNA as mentioned previously (Svaren et al., 1987). Mutation of the GC-box eliminates binding of a HeLa factor.  Figure 20. Site specific mutagenesis of B19's GC-box. (A) Construction of M13 clones used for mutagenesis. An oligonucleotide (5'-GCTCC«C^ATTTTAACCGTTA-3') complementary to the plus strand (B19, nt 301 to 280) was used as outlined in Methods. The underlined A residues were substituted for the C residues in the wild type. (B) Sequence of wild type (WT) and mutant (M) M13 clones. Sequencing was by the chain termination method (Sanger, 1977) using the forward primer of M13. Electrophoresis was on a 7 M urea-8% acrylamide gel. Hpal SaulllA(1Q06) (404) nt 272 (B19-Au Smal Hindlll EcoRI  A  Hpal/Smal T4 ligase nt 272 (B19-Au  nt 407(Smal/Hpal) .EcoRI  Hindlll  nt 272 (B19-Au  nt 407(Smal/Hpal) .EcoRI  nt 272 (B19-Au  Hindlll  nt 407(Smal/Hpal) .EcoRI  Hindlll  Site specific mutagenesis  Mutant  Wildtype  B  W. T.  M  107  Fig. 21. Gel retention assays of wild type (D272) and mutant (D272-TT) GC-box containing fragments in HeLa nuclear extracts. (A) Construction of pD272-H and pD272-HTT. EcoRI-Hindlll fragments (containing B19, nt 272-407) were isolated from in vitro RF M13 __271-H or M13 __271-HTT (Fig. 18) and cloned into the EcoRI-Hindlll site of pUC11 to give plasmids pD272-H and pD272-HTT respectively. D272 and D272-TT were isolated from pD272-H and pD272-HTT respectively, by Hindlll-Alu digestion, end-labeled and used in subsequent gel retention assays. The arrow indicates the direction of transcription from the B19 promoter. (B) Gel retention assays. Lanes 1-5 have D272-TT and lanes 6-10 have D272. Lanes 1 and 6 have no HeLa extract. Lanes 1, 2, 6, and 7 have 10,000 CPM (10,000 CPM/ng DNA). Lanes 3 and 8 have 20,000 CPM. Lanes 4 and 9 have 50,000 CPM. Lanes 5 and 10 have 100,000 CPM.  (Smal/Hpal) nt 407  PD272-H  or  pD272-HTT  108  2. B19 Transcription is Reduced bv GC-box Mutagenesis The DNA templates  were prepared by digesting pD272-H (wildtype) and  PD272-HTT (mutant) at a unique site, either Seal or Sspl (Fig. 21 A). Runoff transcripts from a Seal digested template should be 994 nt long and from an Sspl digested template, 670 nt long (Fig. 21 A)  Aliquots of the  templates were checked for  equivalent DNA concentrations by A gQ measurments and by comparisons on agarose gel 2  (Fig. 22A, lanes 1-4).  The Seal digested pD272-H had a very strong transcription signal  compared to a similar concentration (16 /-g/ml) of Seal digested pD272-HTT (Fig. 22B, lanes 1 and 2). The Sspl digested pD272-H had a very strong transcription signal compared to Sspl digested pD272-HTT (Fig. 22B, lanes 3 and 4).  The two transcripts, resulting from  equimolar mixtures of the pD272-H template digested with Seal and Sspl, were both stronger than their respective transcripts obtained from an equivalent mixture of pD272-HTT (Fig. 22B, lanes 5 and 6). The stronger transcript signals of the wild type promoter suggests that the GC-box is binding a factor which enhances transcription. Using equimolar mixtures of a wildtype and a mutant template, the transcript signal from the Seal digested pD272-H was enhanced compared with the shorter, almost nondetectable signal from Sspl digested pD272-HTT (Fig. 22B, lane 7).  The transcript signal of the Sspl digested pD272-H was  stronger than the longer transcript from the Seal digested pD272-HTT (Fig. 22B, lane 8). A third minor band was visible, migrating slightly more slowly than the transcript at 670 nt, with both wildtype and mutant templates digested with Sspl (Fig. 22B, lanes 3 and 4) or mixtures of templates digested with Seal and Sspl (Fig. 22B, lanes 5-8).  The third minor  band was not visible with wild type or mutant templates digested with Seal alone (Fig. 22B, lanes 1 and 2).  The third minor band could represent an end-labelled DNA fragment or  end-to-end nonspecific transcription of a short DNA fragment by a RNA polymerase (Manley et al, 1983). Either wildtype or mutant pD272 when cut with Sspl-Hindlll yields a DNA fragment of 749 bp (Fig. 21 A), which would migrate in the approximate postion observed for the third minor band (Fig. 22B).  Aside from this minor band, mutation of the  GC-box dramatically reduced in vitro transcription from the B19 promoter.  109  Figure 22. In vitro transcription of pD272-H and pD272-HTT in HeLa nuclear extracts. (A) Restriction digests of wild type and mutant clones (200 ng DNA/pl) were diluted 4 fold (50 ng/pl), 8 fold (25 ng/pl) and 16 fold (12.5 ng/pl). Two /xl (25 ng DNA)of the 16-fold diluted digests were loaded in lanes 1-4 and electrophoresed for 30 min at 100 V on a 0.7% agarose gel. This was repeated with the 8 fold dilution, then the 4 fold dilution with the same restriction digests loaded in each lane. Lanes 1 and 2 are respectively pD272-H and pD272-HTT, each digested with Seal. Lanes 3 and 4 are respectively pD272-H and pD272-HTT, each digested with Sspl [see Fig. 21 A]. (B) Transcription assays were as described in Materials and Methods. RNA was electrophoresed on a 7 M urea-4% acrylamide gel. Lanes 1-4 are single DNA templates in transcription mixes (16 pg DNA/ml). Twenty pi aliquots of wild type and/or mutant templates [Fig. 22A], one template cut with Seal and the other with Sspl, were mixed and used in equimolar transcription assays (16 pg DNA/ml) in lanes 5-8. Lanes 1 and 2 are respectively pD272-H and pD272-HTT, each digested with Seal. Lanes 3 and 4 are respectively pD272-H and pD272-HTT, each digested with Sspl [see Fig. 21 A]. Lane 5 is an equimolar mix of wild type template, pD272-H, digested with Sspl or Seal. Lane 6 is an equimolar mix of mutant templates. pD272-HTT, digested with Sspl or Seal. Lane 7 is Seal digested pD272-H and Sspl digested pD272-HTT. Lane 8 is Seal digested pD272-HTT and Sspl digested pD272-H.  670-  110  DISCUSSION A. Genome of B19-WI While the cloned hairpins of B19-Wi genome in my study are incomplete, their sequence indicates they have inverted terminal repeats as does the adeno-associated virus genome.  The hairpins of viral B19 termini are approximately 330 nt long (Cotmore and  Tattersall, 1984; Shade et al., 1986) or 165 basepairs in the fully intact SS virion.  Large  portions of hairpin regions (approximately 72-80 bp) were lost in the cloned B19 fragments. Several mechanisms have been reported which could cause these deletions.  Firstly, the  failure of DNA polymerase (Klenow fragment) to replicate through the hairpin and secondly, the subsequent deletions of the loop-end of the hairpin during propagation of the clones in E. coli (Merchlinsky et al., 1983; Boissy and Astell, 1985). The loopout of seven unmatched basepairs in the B19 LHH is at the site where deletions would be expected to  occur (Boissy and Astell, 1985).  If one compares the  unpaired 7 nt loop-end sequence of the LHH of B19-Wi with the unpaired 7 nt loop-end sequence of the LHH of B19-Au (Shade et al., 1986), it is apparent that the loops are related in that one is the inverted complement of the other.  A proposed mechanism for these  loop-end deletion events in E. coli suggests that it occurs as a result of slipped mispairing of the lagging strand during DNA replication. The slipped mispairing is facilitated by short direct and inverted repeat sequences. Mispairing can occur on either strand and hence the loop-out corresponds to the sequence of either strand. Analyses of deletion clones of the MVM genome support the slipped mispairing mechanism (Astell, 1988). It is unlikely that the inverted complements represent the flip-flop orientations which occur during replication of the ends of parvovirus genomes (Astell et al., 1983). If the inverted complements did represent the flip-flop orientations, one would expect the size of the deletion at the loopout in the flip orientation to be different from that of the flop orientation. The possibility that B19 ends are imperfect inverted terminal repeats was suggested for the B19-Au genome (Shade, 1986). The additional sequence present on the RH terminus of B19-Wi demonstrates that the RH and LH of B19 do indeed form imperfect terminal  Ill  repeats (Fig. 3A). It is likely that the 49 nucleotides absent in the LH hairpin of B19-Wi represent a deletion event which did not occur in the RH hairpin. One should bear in mind that large portions of these central hairpins were deleted during replication in a bacterial host, and the true nature of B19's termini and their relatedness can not be answered yet. While some of the nucleotide changes within the remainder of the B19-Wi sequence may be explained by spontaneous deaminations and depurination or depyrimidation events occurring during prolonged storage of the B19-Wi isolate prior to cloning of its DNA (Cotmore and Tattersall, 1984), it seems more likely that these nucleotide changes have occurred in the B19-Au genome during continuous rounds of replication in a human host. Sequence studies with feline parvovirus and canine parvovirus (Parrish and Carmichael, 1985) as well as MVM(i) passaged for a relatively short time in two laboratories (Sahli et al., 1985; Astell et al., 1986) have shown that nucleotide changes can accumulate rapidly. Of interest is that the sequence within the coding region for nonstructural proteins of B19-Au, which is highly conserved among other parvoviruses (Shade et al., 1986), was unchanged in the B19Wi genome.  The nonstructural proteins from isolates of B19 and other parvoviruses will  probably have very similar functions in replication and transcription of their respective genomes. B. A Single Active Promoter in B19 In vitro transcription of cloned B19 DNA identified a single active promoter in the LH end of B19. The absence of any transcript in the presence of low levels of a-amanitin identified RNA Pol II as responsible for this transcript. No other transcripts were identified when the LH promoter is completely removed athough all other putative promoters of B19 were present on this B19 clone (Shade et al., 1986). Using in vitro CAT assays, with each of the putative promoters fused to CAT genes, Doerig et al. (1987) demonstrated that only one promoter, around mu 6 was active. SI nuclease analysis of RNA from B19 infected bone marrow tissues also indicates there is only one active promoter, at the LH terminus of the B19 genome (Ozawa et al., 1987). Also, when the B19 genome was cloned into an SV40  112  origin vector and transfected into COS cells, only one promoter at mu 6 was active (Beard, C , and Astell, C. manuscript in preparation). In having a single functional promoter site at the LH end of the viral genome, B19 is unique among all parvoviruses characterized to date (Pintel et al., 1983; Lebovitz and Roeder, 1986; Carter et al., 1984). The previously identified "TATATATA" sequence at nt 319 is probably the functional TATA box. This seems likely since the promoter was still active after removal of upstream sequences, up to and including the first T residue in a putative TATA-box at nt 257.  The promoter was inactivated only when all upstream sequences including the first T  and A residues in the TATA box at nt 319 were removed. Primer extension of the 5'-end of the in vitro RNA transcript identifies a start site at nt 350, 31-32 nt downstream of the TATA-sequence at position 319 (Blundell et al., 1987). RNase protection analysis of RNA isolated from B19 infected bone marrow cells localizes leader sequences of all B19 transcripts to between nucleotides 340 to 410 (Ozawa et al., 1987) as well as all RNA transcripts generated in COS cells transfected with an SV40-B19 hybrid vector (Beard, C , and Astell, O, manuscript in preparation).  It is probable that both the initiation site and functional  TATA-sequence are the same in vitro as in vivo (Carter et al., 1984; Serfling et al., 1985; Weil et al., 1979). C. MULTIPLE SEQUENCE MOTIFS ARE REQUIRED FOR MAXIMAL TRANSCRIPTION In vitro transcription of progressively deleted B19 plasmid clones was initially undertaken to identify the functional TATA box at the LH end of B19. Results from transcription of deleted clones suggest that multiple discrete elements contributed to a fully functional promoter. Stepwise removal of these sequences resulted in stepwise reductions in transcription. Comparing transcription from different deletion clones, or mixing experiments with different pairs of deletion clones, allowed the identification of at least three regions that modulate transcription; between nt 100 to 170, nt 208 to 257, and nt 257 to 321. A number of putative cis-activating sequences were identified by comparison to consensus sequences known to interact with purified transacting factors which enhance transcription. The existence of a consensus site for a trans-activating factor does not mean it will necessarily  113 react with that factor or that it will have any effect on transcription. Short and degenerate consensus sequences occur in DNA segments without transcriptional enhancer properties (Zenke et al., 1986).  However, for the B19 promoter,  transcription decreased when  sequences containing these elements were removed, indicating that some are probably functional cis-activating elements. Residues from nt 9-93 are the inverted complement of residues from nt 101-185. Hence in this region there are two copies (in opposite orientation) of the putative SP1 (Briggs et al., 1986), CREB (Montminy and Bilezikjian, 1987; Hardy and Shenk, 1988), and EIIA-EF binding site (Sivaraman et al., 1986; Sivaraman and Thimmappaya, 1987; Jalinot et al., 1988) (Fig. 8A). Deletion of 1 to 100 nt had no effect on in vitro transcription, although three putative cis-activating sequences were removed. Deletion of additional nt between 100 to 170, which contains the inverted complements of these sequences, did affect in vitro transcription.  If Pol II is directly interacting with trans-activating factors independent of  their orientation, presumably the greater the number of cis-activating elements, the greater the enhancement of transcription (Allison et al., 1988; Sigler, 1988; Ingles et al., 1987). Removal of the three furthest upstream cis-activating elements was expected to decrease transcription, however I observed no effect on transcription from the B19 promoter in these studies. Either sequence orientation and/or position is important, or the inability to detect a difference further upstream is an inherent limitation of in vitro transcription techniques. In vivo transfection with intact and upstream deletions would be of interest to test whether the furthest upstream sequences could enhance transcription. These experiments are in progress. D. A GC-box Acts as a Cis-activating Element A factor present in HeLa nuclear extracts protected a GC-box (GC-rich sequence), upstream of the B19 promoter, both in DNAse I (Fig. 13) and DMS protection studies (Fig. 14). A synthetic oligonucleotide containing the same GC rich sequence (B19, nt 292 to 301) specifically bound to a factor in HeLa extracts (Fig. 17B). The synthetic oligonucleotide competed for binding in gel retention assays with a labelled fragment from B19 which contained the same GC-rich sequence (Fig. 19, lane 9). In vitro transcription was reduced by  114  addition of the synthetic oligonucleotide.  The same synthetic oligonucleotide with an  additional methylated C residue within the GC rich sequence also reduced in vitro transcription, but not to the same extent as the nonmethylated oligonucleotide. It seems likely that the GC rich sequence in the synthetic oligonucleotide was competing for the factor which binds to the same sequence in the B19 promoter. Mutagenesis of two of the residues within this GC-rich sequence, upstream of the B19 promoter, abolished binding of the factor and reduced in vitro transcription (Fig 21 and Fig. 22). The evidence strongly supports the contention that the GC rich sequence is a cis-activating element for in vitro transcription from the B19 promoter. Enhancement of transcription is mediated by a HeLa factor which binds to the GC rich sequence and presumably interacts with some component of the RNA Pol II complex. E. Does the GC-box interact with SP1? SP1 has been purified to homogeneity from HeLa cells (Briggs et al., 1986). Two polypeptides (105 and 95 kDa) are responsible for recognizing and interacting specifically with GC-box promoter elements characteristic of Spl. The DNA consensus sequence for Spl binding is shown below (Briggs et al., 1986):  5'-G/A C/T GGCG G/A G/T G/T C/A-3'  Purified Spl requires Zn(II) for sequence-specific binding to DNA (Kadonaga et al., 1987). A cDNA encoding the C-terminal 168 residues of Spl has been expressed as a fusion protein in E. coli and is capable of binding to Spl sites. Three contiguous Zn(II) finger motifs are identified in this cDNA (Kadonaga et al., 1987). Spl recognition sites which are about 10 bp in length have a strong 5 bp periodicity, suggesting Spl binds to DNA with fingers similar to those in TFIIIA (Rhodes and Klug, 1986). Spl binds to some but not all sequences that contain the GGGCGG hexanucleotide. Activation of transcription by Spl appears to be independent of the orientation of the Spl binding site to the initiation site. Promoters responsive to Spl generally contain multiple Spl  115  binding sites located within 40 to 150 bp upstream of the RNA start site. (Kadonaga et al., 1986).  B19 has 4 putative SP1 sites within 150 bp of the RNA start site (Fig. 8), two of  which are tandemly arranged (bp 292 to 312) and located the same distance upstream from the RNA initiation site as sites in SV40 and the Herpes Simplex Virus thymidine-kinase (HSV-tk) promoter (Gidoni et al., 1985; Jones et al., 1985). The results of Gidoni et al. (1986) suggest that weak sites in SV40 may be equivalent to or more important for promoter strength than high affinity Spl sites at distal positions. SV40 has six tandem GC-boxes within three 21-bp repeats which bind Spl. The three Spl binding sites proximal to the early promoter, GC-I, GC-II, and GC-III, enhance transcription from the early promoter. (Gidoni et al., 1985).  The GC-1 box of SV40 is most proximal to the early promoter  Although GC-I is a relatively weak Spl binding site, it is important  for specifying transcription in the early promoter of SV40 (Gidoni et al., 1986).  A similar  arrangement of a weak Spl binding site proximal to the initiation site for transcription was observed in the HSV-tk promoter (Jones et al., 1985). The proximal GC-box of the HSV-tk promoter, which only binds Spl weakly, has a large effect on transcription both in vivo and in vitro (Jones et al., 1985; McKnight and Kingsbury 1982; McKnight et al., 1984). As of yet, there is no evidence for cooperative binding by Spl. In B19, the more distal site (bp 292 to 301) of the tandem Spl sites was a putative high affinity site for Spl.  Site-specific mutagenesis of the high affinity Spl site of B19  removed detectable factor binding in gel-shift assays, yet transcription was only reduced, not eliminated.  The Spl site proximal to the TATA-box may be contributing to transcription  even though binding was weak and not detected by DNAse I or DMS footprinting. Alternatively, the distal Spl site when mutated may still have a low binding affinity for Spl, which could enhance transcription.  Hybrid templates  containing a thymidine kinase  TATA-box and upstream SV40 GC-boxes are transcriptionally active but in the absence of the GC-boxes there is no detectable RNA synthesis (Gidoni et al., 1985). The involvement of the proximal Spl site of B19 in transcription might be resolved by measuring transcription  116 after mutating the proximal GC-box and/or footprint analysis of this tandem Spl site with purified Spl factor. Four of the five putative SPl-like sites are present on the B19 fragment (nt 100 to 324) used in gel-shift assays with HeLa nuclear extract fractionated on a Sephacryl S300 column. Since all four Spl-like sites have slightly different sequences, one would expect a range of binding affinities for Spl. Of those column fractions that contained DNA binding activity, the pattern of retained bands increased in both number and intensity, being maximal in fractions containing proteins in the size range of SP1 (Fig. 9) (Briggs et al., 1986). Since control assays with specific and nonspecific competitor were not done it is premature to draw conclusions about specific binding with different column fractions. In two case, binding of SP1 protected 18 to 20 bp of DNA in DNAse I footprint analyses (Kadonaga et al., 1986; Jones and Tjian, 1985). Only 8 bp were protected in the GC-box of B19 which by sequence corresponds to a high affinity binding site for Spl (Kadonaga et al., 1986). The HIV-I retrovirus promoter, ARV-2, has 3 tandem Spl sites upstream of the RNA start site. Protection of guanines on both strands of ARV-2 has been observed (Jones et al., 1986), in contrast to SV40 where only the guanines of the G-rich strand are protected (Jones and Tjian, 1985; Kadonaga et al., 1986).  DMS interference  footprint studies have shown that all methylated G residues on the G-rich strand, contained within the putative Spl binding site of B19, interfere with HeLa Spl factor binding. Interference to binding by G methylation of similar residues within other characterized Spl sites has been observed (Gidoni et al., 1985; Jones et al., 1985). DMS and DNAse I footprint analyses of B19 were done with crude HeLa extracts and other SP1 footprints were done with partially purified extracts (Kadonaga et al., 1986). It is conceivable that other factors within crude extracts may affect the way SP1 interacts with DNA, altering the accessibility of DNAse I and explaining the difference in DNase I footprints observed with B19. Footprint studies of the opposite strand would demonstrate whether the G residues on the opposite strand were involved in factor binding.  117 Three bands with altered mobility were observed in gel-shift assays using the B19 fragment containing the high affinity Spl site.  The B3 band was selectively removed by  another fragment from B19, which from sequence analysis contained no Spl binding sites. All 3 bands were removed in competition with a fragment containing a synthetic GC-box. The competition results may be explained by the presence of other HeLa factors which weakly bind the Spl site.  Four other trans-acting factors, Apl through Ap4, weakly  recognize sequences present in the SV40 21-bp repeats (Mermod et al., 1988; Lee et al., 1987; Mitchell et al., 1987). The high mobility B3 band may be a result of any of Apl through Ap4 weakly binding (or some other as yet unidentified factor). The B19 fragment (nt 56 to 139) which specifically abolished the B3 band (Fig. 19, lane 6) may contain a high affinity site for a factor binding with low affinity to the B19 Spl site.  Therefore the use of a  competitor fragment with an Spl site could conceivably eliminate all 3 bands.  Another  competitor fragment with a high affinity banding site for the factor binding with low affinity to the B3 band, could selectively remove the B3 band.  From DNA sequence  analyses, there were no obvious binding sites for Apl through Ap4 in the B19 fragment (nt 56 to 139) which selectively competed for the B3 band. Another cellular transcription factor, LSF, identified in HeLa cells, stimulates SV40 late transcription and binds specifically to SV40 21 base pair repeat elements which contain the GC-boxes. LSF forms a protein-DNA complex which migrates more rapidly through nondenaturing polyacrylamide gels than do Spl-DNA complexes. LSF is distinguishable from Spl in both its transcriptional and DNA-binding properties (Kim et al., 1987). LSF may actually be AP4, which has been shown to bind with low affinity to Spl binding sites, but which actually stimulates transcription by binding selectively to the A-domain sequences of SV40 (Mermod et al., 1988). From DMS interference analysis of the B19 GC-box, two of the three bands observed in gel retention assays bound the same factor at the same site within the GC-box. It seems possible that one band may be bound to an intact Spl factor and the other may be bound to a proteolytic fragment of the same factor.  A cDNA has been isolated which  118  encodes 696 amino acid residues from the C-terminal human Spl. A C-terminal fragment of 168 residues from the cDNA was fused to a j9-galactosidase gene in E. coli. The chimeric protein, expressed in E. coli, is capable of sequence specific binding to Spl sites (Kadonaga et al., 1987).  The DNA binding of an Spl fragment is compatible with the previous  observation that a 40 kDa proteolytic fragment of Spl from human placenta binds to DNA (Briggs et al., 1986). The possibility of a proteolytic fragment in HeLa nuclear extracts may also explain why Bl and B2 have the same footprint but have different mobilities in gel shift assays. Finally, protein-protein interactions may account for the multiple retained bands. The possibility for protein-protein interactions was suggested from the DNAsel and DMS protection assay. In either assay, only one retained band with a higher mobility than Bl, B2, or B3 was observed after footprinting. DMS or DNasel could conceivably interfere with protein-protein interactions and thereby reduce the number of bands observed in gel-shift assays. One might speculate that if B2 were a result of a proteolytic fragment of Spl binding to the GC-box, that proteolytic fragment could have a lower affinity for the GC-box, and be more easily removed in the presence of DMS or DNasel. Site specific mutagenesis of the B19 high affinity Spl binding site reduced factor binding and in vitro transcription.  Mutation of nucleotide residues at similar positions in  other Spl binding sites also affects in vitro transcription (Jones et al., 1986). Finally, factor binding to the GC-box (nt 292 to 301) was abolished by another fragment containing a predicted Spl site (nt 38 to 47). Absolute proof of Spl binding would require purified Spl, however all the experimental results reported here support the contention that the GC-box in B19 (nt 292 to 301) binds Spl and in vitro enhances transcription. Some other interesting observations can be made if indeed Spl does bind to the GC-box. Gidoni et al. (1985) have studied relationship between adjacent GC-boxes in SV40. They found that Spl bound to the GC-box V of SV40 appeared to prevent efficient binding of factor to the adjacent GC-box IV. Mutations of GC-box V both prevented binding of Spl to GC-box V and increased the protection of GC-box IV from DNasel digestion when  119  Spl was present. Presumably Spl interacts with the wildtype GC-box V making GC-box IV inaccessible to Spl binding. While all other decanucleotide GC-boxes in SV40 are separated by a single basepair, GC-box IV and V, as determined from decanucleotide consensus sequence, overlap by one nucleotide. Thus GC-box V, a high affinity site for Spl, prevents efficient binding to GC-box IV due to steric constraints (Gidoni et al., 1985). Two synthetic, identical tandem B19 GC-boxes (or putative high affinity Spl sites), each 10 residues long and separated by 10 residues, competed more effectively in gel retention assays (Fig. 19, lane 9) than the same tandem GC-boxes with no intervening residues (Fig. 19, lane 7).  Either a cooperative effect is allowed by separation of GC-boxes, or alternatively the  steric hindrance of directly joined GC-boxes prevents them from competing effectively for factor binding to the single B19 GC-box.  Steric hindrance may account for the typical  arrangement of pairs of GC-boxes separated by a single residue in SV40. If two Spl binding sites were directly opposed as with the GC-T fragment (Fig. 15B) or overlapping (as with GC-box IV and V in SV40), steric hindrance between two Spl factors trying to bind to the two Spl sites might occur and prevent efficient factor binding.  The synthetic tandem  GC-boxes could therefore not compete as effectively in gel-shift assays as synthetic tandem GC-boxes separated by 10 nt. While there is no evidence of cooperative binding of Spl to adjacent GC-box sequences (Gidoni et al., 1985), tandem Spl sites probably have some functional role, as suggested from their prevalence in promoters such as SV40, HSV-tk, B19 and other genes. F. Methylation in Transcription Control When the synthetic Spl site was made, a BstNl site bordering one side of the Spl site was also created. In dam+ strains of E. coli, BstNl sites are methylated. BstNl sites are methylated on the C residue at position 5 of the pyrimidine base. Two C residues separated by a basepair, one on either strand within the BstNl site, are methylated. In the synthetic GC-box of B19 that meant that one C residue within the GC-box was methylated and one C residue immediately outside of the GC-box was methylated (when grown in a dam+ strain of E. coli).  Methylation of the synthetic GC-box inhibited binding of a factor in HeLa  120 extracts.  The synthetic nonmethylated GC-box was an effective competitor for factor  binding to the GC-box of B19 whereas the synthetic methylated GC-box was not. In in vitro transcription assays, the presence of the synthetic nonmethylated GC-box appeared to inhibit transcription from the B19 promoter, more than the methylated GC-box.  It is unclear  whether methylation of the GC-box directly inhibits factor binding by steric hindrance, and if so, which of the two methylated C residue (one on each strand) may be participating in the steric hindrance. Alternatively, the methylation of two C residues on opposite strands and separated by an intervening basepair, could conceivably distort the DNA helix and prevent factor binding. X-ray crystallography would be useful in determining if the helix itself were distorted by methylation. Within eukaryotic cells, sites of methylation occur on cytosine residues when followed by a guanine residue (CpG) (Gruenbaum et al., 1981).  Interest in whether  methylation can directly affect the binding of a factor (and therfore transcription) has been directed at Spl sites which contain CpG residues. Synthetic olignucleotides have been used to investigate the effect of cytosine methylation on Spl binding.  Annealed oligomers  containing fully methylated, hemimethylated either strand or nonmethylated SP1 sites have been constructed (Harrington et al., 1988). The star (*) indicates the sites of methyl cytosine on the synthetic GC-box oligomers: * 5'-GGGGCGGGGC-3' 3'-CCCCG^CCCG-5'  The methyl group of 5-methylcytosine extends into the major groove (Harrington et al., 1988). Unmethylated, hemimethylated or fully methylated GC-box oligomers were shown to bind Spl, or inhibit the formation of other Spl-DNA complexes when used as competitors. The results account only for 2 sites of a number of possible methylation sites within the given Spl consensus sequence outlined earlier (Briggs et al., 1986).  Other potential  methylation sites could be created if the Spl site were flanked by the appropriate C or G residues.  There is evidence that the mouse metallothionein I (Lieberman et al., 1983) and  human metallothionein-IB genes (Heguy et al., 1986), both of which have SP1 binding sites,  121 may be sensitive to methylation control. The results of GC-box methylation in B19 suggest that the binding of Spl (and therefore transcription) could be controlled by methylation in some cases.  The methylation of a C residue within a synthetic G C box of B19 was a  fortuitous result allowed by the creation of a BstNl site flanking and merging with the synthetic GC-box. In eukaryotes this C residue is not likely to be methylated because the C residue, on the minus strand of B19 (nt 293), is followed by an A residue (CpA), not a G residue (CpG). Therefore methylation of the GC-box as a means of controlling transcription from the B19 promoter would not occur in vivo. However the results suggest that other GC-boxes, with the CpG sequence necessary for methylation, could be under transcriptional control by methylation.  G. Relationship of B19 and other Promoters From preliminary transfection studies (Beard and Astell, unnpublished results) and in vivo SI nuclease studies of RNA from B19 infected bone marrow cells (Ozawa et al., 1987), it appears that there is only one promoter (Pg) in B19 at the left end of the genome.  The in  vivo results agree with in vitro studies (Blundell et al., 1987; Doerig et al., 1987).  Hence, it  seems highly unlikely that the NS1 protein of B19 is involved in trans-activation of a middle promoter responsible for mRNAs encoding viral structural proteins.  Other parvoviruses  studied to date have a middle promoter transactivated by NS1 (Rhode III, 1985; Rhode III, 1985b; Rhode III and Richards, 1987; Clemens et al., 1988).  Possibly to compensate for a  lack of transactivation by NS1, B19 has a single strong promoter on the lefthand end of the genome. Generation of discrete mRNAs encoding all the viral polypeptides required for B19 replication  likely  polyadenylation.  involves  complex  R N A processing  steps  including  splicing and  In addition, mRNA stability may regulate the level of different mRNAs.  B19 parvovirus has an extremely restricted cell specificity and this may be a reflection of specific splicing factor(s) in permissive cells. B19, like other parvoviruses, requires mitotically active cells for its replication (Ozawa et al., 1987). It is therefore of interest to compare the B19 promoter to promoters of other mitotically active genes which have presumably evolved to take advantage of the  specialized state of a cell during mitosis.  122 The level of dihydrofolate reductase (DHFR)  mRNA varies during the cell cycle, being maximal at the onset of DNA synthesis (Farnham and Schimke, 1985; Dynan et al., 1986).  All mammalian DHFR genes examined so far  including human DHFR genes, contain potential Spl binding sites. Genes involved in purine metabolism which are maximally expressed at the onset of DNA synthesis also have sequences homologous to the Spl consensus sequence (Chen et al., 1984). There are other genes, not preferentially expressed during the S-phase, that have sequences homologous to the Spl consensus sequence (Dynan et al., 1986). Therefore the presence of 5 putative Spl sites on B19 may or may not reflect the requirements of B19 to take advantage of the mitotic state of the cell. What might be of interest to know is how the level of Spl varies during the cell cycle. It has been suggested that Spl regulation of promoters is more general and adjacent sequences control temporal or spatial regulation of specific genes, either separately, through direct interaction with Spl or indirectly through other factors which may interact with both (Dynan et al., 1986). The B19 promoter is very active in extracts from nonsynchronized HeLa extracts and it seems unlikely that the promoter is under temporal or spatial regulation. In cultured mammalian cells, most histone gene expression is elevated during the S phase of the cell cycle (Hentschel and Birnstiel, 1981; Maxson et al., 1983; Heintz and Roeder,  1984) and control of gene expression occurs at both transcriptional and  post-transcriptional levels (Heintz et al., 1983; Rickles et al., 1982; Sittman et al., 1983) From sequence comparison, a hexamer sequence (GACTTC) is present in many human histone genes (Zhong et al., 1983). Mutations of this hexamer cause a decrease in histone H2B transcription to 50% of the level of wildtype (Sive et al., 1986). B19 has a similar hexamer sequence (nt 149 to 144) but the functional significance of this is yet to be determined. Another H2B specific sequence, conserved between sea urchin, chicken, and human histone H2B genes contains the octamer ATTTGCAT (Sive et al., 1986). An octamer binding transcription factor, OTF-1, has been purified from HeLa cells.  OTF-1 stimulates H2B  transcription in a reconstituted in vitro system and this effect is dependent upon an intact  123 octamer element (ATTTGCAT). OTF-1 activity was only detected in nuclear extracts from S-phase synchronized cells.  Mutations of the ocatamer element have no effect on  transcription in cells arrested at the Gl/S phase boundary, but completely eliminate induction of H2B transcription as cells entered S phase (Fletcher et al., 1987).  The core octamer  sequence is included as part of a larger element from the H2B histone for comparison to B19 below: OTF-1 sequence i n H2B B19 (minus s t r a n d , 238 t o 225)  5'-CTTATTTGCATAA-3' 5'-CCCATTTGCATAA-3'  Ten out of the 12 residues are aligned in the B19 promoter with the OTF-1 sequence in the H2B promoter.  Distinct elements containing the octamer motif have been implicated in  ubiquitous and tissue-specific promoter function (Banerji et al., 1983; Mattaj et al., 1985; Krol et al., 1985; Sen and Baltimore, 1986; Bohmann et al., 1987; Parslow et al., 1987; Bergman et al., 1984; Falkner and Zachan, 1984; Parslow et al., 1984; Mason et al., 1985). B19 could have acquired this octamer sequence to take advantage of a specific factor available during the S-phase of the cell cycle or it may just utilize a ubiquitous factor. Thymidine kinase (TK) expression  parallels the onset of DNA synthesis.  Transcriptional and posttranscriptional controls involved in regulation of TK expression cause a 20 fold increase in TK mRNA observed at the beginning of S phase in eukaryotic cells. Sequences in the region flanking the 5' end of the TK gene are important for transcription. Gel-mobility shift assays have been used to detect nuclear protein binding to the TK promoter through the G to S phase transition. Q  While multiple specific nucleoprotein  complexes have been observed, the abundance of TK promoter-nuclear protein complexes changes temporally at the Gj/S boundary.  The pattern of bound complexes shifts to  complexes of smaller apparent size and the change correlates with increase in TK mRNA transcription.  Methylation interference studies at G|/S boundary show the binding sites  involved are a pair of inverted CCAAT-boxes upstream of the RNA initiation site (Knight et al., 1988). A number of factors binding to different CCAAT sequences have been identified (Raymondjean et al., 1988; Jones et al., 1987; Graves et al., 1986). NF-Y* interacts with the thymidine kinase promoter (Dorn et al., 1987). The cell cycle regulation of the NF-Y* is  124 unknown. Whether this is the same factor that was observed to have increased binding at the inverted CCAAT-boxes of the thymidine kinase promoter is unclear. B19 has an inverted CCAAT-box upstream of the RNA initiation site (5' to 3', nt 270 to 266). What role, if any, that the B19 inverted CCAAT-box sequence has in transcription remains to be determined. What is most interesting is the presence of at least 4 different consensus sequences in B19 which match cis-activating sequences of mitotically active genes; the Spl sequence of the DHFR gene and other genes involved in purine synthesis; the hexamer and octamer sequences of histone genes, and the inverted CCAAT-box sequences of the thymidine kinase genes. The Spl factor probably interacts with B19, but whether any of the other cis-activating sequences of B19 are functional remains to be determined. It does seem though that the B19 promoter has evolved to take advantage of a number of cellular factors which may be of particular importance in the mitotic cell. B19 has two putative sequences highly similar to the binding sites for NFIII and NF-1 in adenovirus (Table 1).  NF-1 (or CTF) is a factor which is both involved in  transcription from CCAAT-boxes and replication (Jones et al., 1987). NF-1 binds with high affinity to a specific sequence element within the adenovirus origin of replication and the binding of NF1 is absolutely required for efficient initiation of adenovirus replication (Guggenheimer et al., 1984; Rawlins et al., 1984; deVries et al., 1985; Leegwater et al., 1985). The initial steps in adenovirus replication involve covalent attachment of a viral precursor  terminal  protein  (pTP)  to  the  first  deoxynucleotide  residue  (a  cytidine-5'-monophosphate) of the new DNA strand. Formation in vitro of the pTP-dCMP initiation complex is dependent on the adenovirus DNA polymerase, the viral origin sequences, and several nuclear proteins that interact specifically with the origin, including NF-1 (Rosenfeld et al., 1987). The initiation reaction is strongly stimulated by the addition of a partially purified HeLa nuclear fraction (BR-FT) which is depleted of NF-1 activity. Addition of NF-1 causes a 10-fold increase in pTP-dCMP levels. There is no appreciable stimulation by NF-1 in the absence of the BR-FT fraction (Rosenfeld et al., 1987).  125  The BR-FT fraction contains other proteins that bind to the adenovirus origin of DNA replication (Rosenfeld et al., 1987) and recent studies indicate one of these stimulatory proteins (ORP-C) binds specifically to the octamer element (ATGCAAAT) required for optimal transcription from a variety of cellular promoters (Falkner and Zachan, 1984; Parslow et al., 1984; Ephrussi et al., 1985; Mason et al., 1985; Sive et al., 1986; Singh et al., 1986; Pruijn et al., 1986).  The factor ORP-C (also called NFIII) recognizes a sequence in the  adenovirus origin and stimulates DNA replication four to sixfold by increasing initiation efficiency (Pruijn et al., 1986; Wides et al., 1987). Very recently it has been shown that OTF-1 is functionally identical to NFIII (O'Neill et al., 1988). The sequences in B19 similar to NFIII and NFI binding sites could be serving dual functions in transcription and/or possibly replication. It is of interest to note that the factor CTF (or NFI) is involved in attachment of a viral protein to the first deoxynucleotide residue of the new strand of adenoviral DNA. A protein linked to the 5' terminus of both H - l and MVM DNA has been reported (Chow et al., 1986; Revie et al., 1979; Cotmore and Tattersall, 1988), and it appears to be related to NS-1 (Cotmore and Tattersall, 1988). So far it is unknown whether B19 has a terminal protein, however it seems likely since other parvoviruses have terminal proteins. It has been suggested that although B19 is an autonomous parvovirus, it may have evolved from an adeno-associated virus (Ozawa et al., 1987). As yet, there is insufficient information to come to a conclusion about the actual evolution of B19. However two B19 DNA sequences, NF-1 and NFII, are similar to regulatory DNA sequences in adenovirus. The sequences are important for the replication of adenovirus, a virus intimately associated with the replication of AAV. Six other DNA sequences identified in B19 (Table 1) are similar to cis-activating sequences in adenovirus. The terminal hairpin repeats of B19 are typical of adeno-associated virus. In addition, the putative protein sequences of B19 are related to those of AAV (Shade et al., 1986). There is no doubt that adenovirus and B19 viruses are related. However, the question of which virus evolved from which, or whether both viruses evolved from another virus, is not answerable at this time.  126  H. Future Prospects Studies of the human parvovirus B19 promoter indicate a number of areas that could be considered for future investigation. There are at least three other cis-activating elements of B19 which are enhancing transcription, other than the Spl site characterized here. The location of the putative cis-activating elements on the B19 genome, and the factors with which they may interact, have been described. It remains to be proven what cis-activating sequences are actually involved in transcription. Some of these elements may be involved in replication.  There is of course the interesting possibility that other as yet unidentified  factors could be enhancing transcription from the B19 promoter. Although in vitro transcription studies do provide evidence for the importance of cis-activating elements, eventually all these elements will have to be studied in an in vivo system.  In vivo, a vector containing the B19 genome has been shown to be inhibited in its  replication (from the SV40 origin) if the NS1 protein of B19 is expressed.  The inhibition  was demonstrated by co-transfecting a hybrid vector (SV40-B19) with one containing a mutated NS-1 gene. It is not yet possible to say the B19 NS-1 product effects replication inhibition by interacting with sequences 5' to the P6 promoter (Beard and Astell, unpublished results). Methylation of specific cis-activating sequences may be a means of modulating transcription.  There are other CpG sequences within Spl binding sites that could be  methylated in a eukaryotic cell.  In order to study the interaction of Spl with its DNA  binding site, the availability of methylated and nonmethylated synthetic GC-boxes, which are most probably interacting with Spl, would be useful. It seems unlikely that regulating the activity of a single promoter is a means of limiting the cellular replication of B19. Controlling mRNA splice patterns may determine the final tissue type of a cell (Korf et al., 1988; Bingham et al., 1988; Rosenfeld et al., 1988; Andereadis and Nadal-Ginard, 1988). B19 has a preference for progenitor red blood cells (Mortimer et al., 1983a) and shows a highly complex splicing pattern from SI nuclease analysis when infected into red blood cells from bone marrow (Ozawa et al., 1987). Promoter  127 stype may affect the RNA processing of immunoglobulin genes (Neuberger and Williams, 1988). There is the possibility that permissiveness of the progenitor red blood cell could be controlled by alternative splicing. Another interesting observation is that TK gene regulation is modulated post-transcriptionally by efficient processing of its mRNA which occurs preferentially during the S phase (Gudas et al., 1988). The promoter of B19 could carry some of the elements necessary to interact with an alternative splicing apparatus thereby controlling its own splicing and replication. It is of interest to note that the juxtaposition of an Spl binding site (nt 215) and an octamer binding site (nt 225) is analogous to that observed with a number of small nuclear RNA genes which control splicing (Ares et al., 1987; Das et al., 1988). The functional significance of this sequence arrangement in B19 remains to be determined. On a more practical note, the B19 promoter appears to be a highly active one in HeLa cells in vitro, and COS cells in vivo (Beard and Astell, unpublished results). It is also a very effective promoter in immature red blood cells. As such it may be a useful general promoter for a variety of genes introduced into different cell types for the purpose of gene therapy.  128 LITERATURE CITED Adami, G., and Nevins, J. 1988. Splice site selection dominates over polyA site choice in RNA production from complex adenovirus transcription units. EMBO J. 7:2107-2116. Albin R., Flint, S. 1988. Adenovirus infection alters transcription factor MLTF-UAS DNA interactions. J. Cell. Bioc. 12D:90. Allison, L., Moyle, M., Shales, M., and Ingles, J. 1985. Extensive homology among the largest subunits of eukaryotic and prokaryotic RNA polymerases. Cell 42:599-612. Allison, L., Wong, J., Fitzpatrick, D., Moyle, M., and Ingles, J. 1988. The C-terminal domain of the largest subunit of RNA polymerase II of Saccharomyces cerevisiae, Drosophila melanogaster, and mammals: a conserved structure with an essential function. Mol. Cell. Biol. 8:321-329. Anand, A., Gray, E., Brown, T., Clewley, J., and Cohen, B. 1987. Human parvovirus infection in pregnancy and hydrops fetalis. New Engl. J. Med. 316:183-186. Anderson, M., Jones, S., Fisher-Hoch, S., Lewis, E., Hall, S., Bartlett, C , Cohen, B., Mortimer, P., and Pereira, M. 1983. Human parvovirus, the cause of erythema infectiosum (Fifth Disease). Lancet 7:1378. Andreadis, A., and Nadal-Ginard, B. 1988. Cis and trans elements are involved in splicing of the troponin T mutually exclusinve exons. J. Cell. Bioc. 12D:45. Ares, M., Chung, J., Giglio, L., and Weiner, A. 1987. Distinct factors with Spl and NF-A specificities bind to adjacent functional elements of the human U2 snRNA gene enhancer. Genes & Development 1:808-817. Armentrout, R. and Linser, P. 1978. in Replication of Mammalian Parvoviruses:523-526. (D. Ward and P. Tattersall, Eds.) Cold Spring Harbor Press, Cold Spring Harbor, New York. Astell, C , Thomson, M., Chow, M., and Ward, D. 1983. Structure and replication of MVM DNA. Cold Spring Harbor Symp. Quant. Biol. 47:751-762. Astell, C , Thomson, M., Merchlinsky, M., and Ward, D. 1983a. The complete DNA sequence of minute virus of mice, an autonomous parvovirus. Nuc. Acids Res. 11:999-1018. Astell, C , Chow, M., And Ward, D. 1985. Sequence analysis of the termini of virion and replicative forms of minute virus of mice DNA suggests a modified rolling hairpin model for autonomous parvovirus DNA replication. J. Virol. 54:171-177 Astell, C , Gardiner, E., and Tattersall, P. 1986. The DNA sequence of the lymphotropic variant of minute virus of mice, MVM(i), and its comparison to that of the fibrotropic prototype strain. J. Virol. 57:57:656-669. Astell, C , Mol, C , and Anderson, W. 1987. Structural and functional homology of parvovirus and papovavirus polypeptides. J. Gen. Virol. 68:885-893. Astell, C. 1988. Terminal hairpins on parvoviruses genomes and their role in DNA replication, in Handbook of Parvoviruses: Part 1, P. Tjssens, Ed., CRC Press Inc., Florida.  129 Banerji, J., Olson, L., and Wchaffner, W. 1983. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 33:729740. Barberis, A., Superti-Furga, G., and Busslinger, M. 1987. Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter. Cell 50:347-359. Bartolomei, M., Halden, F., Cullen, C , and Corden, J. 1988. Genetic analyses of the repetitive carboxy-terminal domain of the largest subunit of mouse RNA polymerase III. Mol. Cell. Biol. 8:330-339. Bates, R., Snyder, C , Baneriee, P., and Sankar, M. 1984. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands. J. Virol. 49:319-324. Ben-Asher, E., and Aloni, Y. 1984. Transcription of Minute Virus of Mice, an autonomous parvovirus, may be regulated by attenuation. J. Virol. 52:266-276. Benoist, C , and Chambon, P. 1981. In vivo sequence requirements of the SV40 early promoter region. Nature 290:304-310. Berg, J. 1986. Potential metal-binding domains in nucleic acid binding proteins. Science 232:485-487. Bergman, Y., Rice, D., Grosschedl, R., and Baltimore, D. 1984. Two regulatory elements for immunoglobulin kappa light chain gene expression. Proc. Natl. Acad. Sci. USA 81:7041-7045. Bergs, V. 1969. Rat virus-mediated suppression of leukemia induction by Moloney virus in rats. Cancer Res. 29:1669. Berns, K. I. 1984. (Ed.) in The Parvoviruses, Plenum Publ., New York Bingham, P., Chou, T., Mims, I., and Zachar, Z. 1988. On/off regulation of gene expression at the level of splicing. Trends in Genetics 4:134-138. Blundell, M., Beard, C. and Astell, C. 1987. In vitro identification of a B19 parvovirus promoter. Virology 157:534-538. Bohmann, D., Keller, W., Dale, T., Scholer, H., Tebb, G., and Mattaj, I. 1987. A transcription factor which binds to the enhancers of SV40, immunoglobulin heavy chain and U2 snRNA genes. Nature 323:268-272. Boissy, R. and Astell, C. 1985. An Escherichia coli recBCsbcBrecF host permits the deletion resistant propagation of plasmid clones containing the 5'-terminal palindrome of minute virus of mice. Gene 35:179-185. Bond, P., Caul, E., Usher, J., Cohen, B., Clewley, J., and Field, A. 1986. Intrauterine infection with human parvovirus. Lancet i:448-449. Bos, T., Bohmann, D., Tsuchie, H., Tjian, R., and Vogt, P. 1988. V-jun encodes a nuclear protein with enhancer binding properties of AP-1. Cell 52:705-712. Bourguignon, G., Tattersall, P., and Ward, D. 1976. DNA of minute virus of mice: self-priming, non-permuted, single-stranded genome with a 5' terminal hairpin duplex. J. Virol. 20:290-306.  Brady, H., and Wold, W. 1988. Competition among splicing factors and polyadenylation factors determines which adenovirus region E3 overlapping mRNAs are made. J. Cell. Bioc. 12D:46.  130  Bram, R., Lue, N., and Romberg, R. 1986. A Gal family of upstream activating sequences in yeast: roles in both induction and repression of transcription. EMBO J. 5:603-608. Breathnach, R., and Chambon, P. 1981. Organization and expression of eukaryotic split genes coding for proteins. A. Rev. Biochem. 50:349-383. Brent, R., and Ptashne, M. 1985. A eukaryotic transcriptional activator bearing the DNA specificity of a prokaryotic repressor. Cell 43:729-736. Briggs, M., Kadonaga, J., Bell, S., and Tjian, R. 1986. Purification and biochemical characterization of the promoter-specific transcription factor, Spl. Science 234:47-52. Brown, D. 1984. The role of stable complexes that repress and activate eucaryotic genes. Cell 37:359-365. Brown, R., Sander, C , and Argos, P. 1985. The primary structure of transcription factor TFIIIA has 12 consecutive repeats. FEFS Lett: 196:271-274. Brown, T., Anand, A., Ritchie, L., Clewley, J., and Reid, T. 1984. Intrauterine parvovirus infection associated with hydrops fetalis. Lancet 11.1033-1034 Buhler, J., Riva, M., Mann, C , Thuriaux, P., Memet, S., Micouir, J., Treich, S., Mariotte, S., and Sentenac, A. 1987. Eukaryotic RNA polymerase subunits, and genes. p25-36. In W. Reznikoff, R. Burgess, J. Dahlberg, C. Gross, M. Record and mM Wickers (ed.), RNA Polymerase and the Regulation of Transcription. Elsevier Science Publishing Co., New York. Buratowski, S., Hahn, S., Sharp, P., and Guarente, L. 1988. Function of a yeast TATA element-binding protein in a mammalian transcription system. Nature 334:37-42. Buschhausen, G., Wittig, B., Graessmann, M., and Graessmann, A. 1987. Chromatin structure is required to block transcription of the methylated herpes simplex virus thymidine kinase gene. Proc. Natl. Acad. Sci. USA 84:1177-1181. Busslinger, M., Hurst, J., and Flavell, R. 1983. DNA methylation and the regulation of globin gene expression. Cell 34:197-206. Carter, B., Laughlin, A., and Marcus-Sekura, C. 1984. In "The Parvoviruses" (K. Berns, Ed.) pp. 153-207. Cashmore, A., and Katta, N. 1988. Regulation of a trans_acting factor by phosphorylation. J. Cell. Bioc. 12D:97. Cereghini, S., Raymondjean, M., Carranca, A., Herbomel, P., and Yaniv, M. 1987. Factors involved in control of tissue-specific expression of albumin gene. Cell 50:627-638. Chen, M., Shimada, t., Moulton, A., Cline, A., Humphries, R., Maizel, J., and Nienhuis, A. 1984. The functional human dihydrofolate reductase gene. J. Biol. Chem. 259:3933-3943. Cherry, J., Johnson, T., Dollard, K.,and Denis, C. 1988. Phosphorylation modulates the activity of the transcriptional activator ADR1. J. Cell. Bioc. 12D:97.  Chow M., Bodnar, J., Polvino-Bodnar, M., and Ward, D. 1986. Identification and characterization of a protein covalently bound to DNA of Minute Virus of Mice. J. Virol. 57:1094-1104.  131  Clemens, K., Tullis, G., and Pintel, D. 1988. The two transcription units of the autonomous parvovirus, Minute Virus of Mice (MVM), are transcribed in a temporal order which may be mediated by the large viral nonstructural protein. Journal of Cellular Biochemistry 12D:177. Concino, M., Lee, R., Merryweather, J., and Weinmann, R. 1984. The adenovirus major late promoter TATA box and initiation site are both necessary for transcription in vitro. Nucl. Acids Res. 12:7423-7433. Coombs, D., Robinson, A., Bodnar, , J., Jones, C , and Pearson, G. 1979. Detection of covalent DNA-protein compeexes: the adenovirus DNA-terminal protein complex HeLa DNA-protein complexes. Cold Spring Harbor Symp. Quant. Biol. 43:741-753. Corden, J., Cadena, D., Ahearn, J., and Dahmus, M. 1985. A unique structure at the carboxyl terminus of the largest subunit of eukaryotic RNA polymerase II. Proc. Natl. Acad. Sci. USA 82:7934-7938. Cossart, Y., Field, A., Cant, B., and Widdows, D. 1983. Parvovirus-like particles in human sera. Lancet 7:72-73. Cotmore, S., Sturzenbecker, L., and Tattersall, P. 1983. The autonomous parvovirus MVM encodes two nonstructural proteins in addition to its capsid polypeptides. Virology 129:333343. Cotmore, S., and Tattersall, P. 1984. Characterization and molecular cloning of a human parvovirus genome. Science 226:1161-1165. Cotmore, S., Mckie, V., Anderson, L, Astell, C , and Tattersall, P. 1986. Identification of the major structural and non-structural proteins encoded by the human parvovirus 19 and mapping of their genes by procaryotic expression of isolated genomic fragments. J. Virol. 60:548-557. Cotmore, S., and Tattersall, P. 1986c. The NS-1 polypeptide of the autonomous parvovirus MVM is a nuclear phosphoprotein. Virus. Res. 4:243. Cotmore, S., and Tattersall, P. 1988. The NS-1 polypeptide of Minute Virus of Mice is covalently attached to the 5~ termini of duplex replicative form DNA and progeny single strands. J. Virol. 62:851-860. Dahmus, M., and Kedinger, C. 1983. Transcription of adenovirus-2 major late promoter inhibited by monoclonal antibody directed aginst RNA polymerase Ho and IIA. J. Biol. Chem. 258:2303-2307. Das, G., Henning, D., Wright, D. and Reddy, R. 1988. Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III. EMBO J 7:503-512. Davison, B., Egly, J., Mulvihill, E., and Chambon, P. 1983. Formation of stable preinitiation complexes between eukaryotic class B transcription factors and promoter sequences. Nature 301:680-686.  132 Dean, F., Bullock, P., Murakami, Y., Wobbe, C , Weissbach, L., and Hurwitz, J. 1987. Simian virus 40 (SV40) DNA replication: SV40 large T antigen unwinds DNA containing the SV40 origin of replication. Proc. Natl. Acad. Sci. USA 84:16-20. Delley, D., and Perry, R. 1988. The transition to enhancer independent transcription of Ig Kappa genes is developmentally controlled and correlates with methylation status. J. Cell. Bioc. 12D: 166 Dignam, J., Lebovitz, R. and Roeder, R. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489. Doerig, C , Beard, P., and Hirt, B. 1987. A transcriptional promoter of the human parvovirus B19 active in vitro and in vivo. Virol. 157:539-542. Dorn, A., Bollekens, J., Staub, A., Benoist, C , and Mathis, D. 1987. A multiplicity of CCAAT box-binding proteins. Cell 50:863-872. Duncan, J., Potter, C , Cappelini, M., Durtz, JI, Anderson, M., and Weatherall, D. 1983. Aplastic crisis due to parvovirus infection in pyruvate kinase deficiency. Lancet T£:14-16. Dunn, T., Hahn, S., Ogden, S., and Schleif, R. 1984. An operator at -280 basepairs that is required for repression of ara BAD operon promoter: Addition of DNA helical turns between the operator and promoter cyclically hinders repression. Proc. Natl. Acad. Sci. USA 81:50175020. Dynan, W., and Tjian, R. 1983a. Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II. Cell 32:669-680. Dynan, W., and Tjian, R. 1983b. The promoter-specific transcription factor Spl binds to upstream sequences in the SV40 early promoter. Cell 35:79-87. Dynan, W., Sazer, S., Tjian, R., and Schimke, R. 1986. Transcription factor Spl recognizes a DNA sequence in the mouse dihydrofolate reductase promoter. Nature 319:246-248. Egly, J., Miyamoto, Moncollin, N., and Chambon, P. 1984. Is actin a transcription initiation factor for RNA polymerase B? EMBO J. 3:2362-2371. Eperon, L., Estibeiro,, J., and Eperon, I. 1986. The role of nucleotide sequences in splice site selection in eukaryotic pre-messanger RNA. Nature 324:280-282. Ephrussi, A., Church, G., Tonegawa, S., and Gilbert, W. 1985. B lineage-specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science 227:134-140. Evans, R. 1988. The steroid and thyroid hormone receptor superfamily. Science 240:889-895. Everett, R., Baty, D., and Chambon, P. 1983. The repeated GC-rich motifs upstream from the TATA box are important elements of the SV40 early promoter. Nucl. Acids Res. 11:24472464. Falkner, F., and Zachan, G. 1984. Correct transcription of an immunoglobulin kappa gene requires an upstream fragment containing conserved sequence elements. Nature 310:71-74. Farnham, P., and Schimke, R. 1985. Transcriptional regulation of mouse dihydrofolate reductase in the cell cycle. J. Biol. Chem. 260:7675-7680.  133 Faust, E., and Ward, D. 1979. Incomplete genomes of the parvovirus minute virus of mice: selective conservation of genome termini. J. Virol. 32:276-292. Fife, K., Berns, K., and Murray, K. 1977. Structure and nucleotide sequence of the terminal regions of adeno-associated virus DNA. Virology 78:475. Fire, A., Baker, C , Manley, J., Ziff, E., and Sharp, P. 1981. In vitro transcription of Adenovirus. J. Virol. 40:703-719. Fire, A., Samuels, M., and Sharp, P. 1984. Interactions between RNA polymerase II, factors, and template leading to accurate transcription. J. Biol. Chem. 279:2509-2516. Fletcher, C , Heintz, N., and Roeder, R. 1987. Pufification and characterization of OTF-1, a transcription factor regulating cell cycle expression of a human histone H2b gene. Cell 51: 773-781. Fried, M., and Crothers, D. 1984. Kinetics and mechanism in the reaction of gene regulatory proteins with DNA. J. Mol. Biol. 172:263-282. Galas, D. and Schmitz, A. 1978. DNAase footprinting: a simple method for the detection of protein-DNA binding specificity. Nucleic Acids Res. 5:3157-3170. Galli, G., Guise, J., Tucker, P., and Nevins, J. 1988. Poly(A) site choice rather than splice site choice governs the regulated production of IgM heavy-chain RNAs. Proc. Natl. Acad. Sci. USA 85:2439-2443. Gavin, B., Gyanendra, K., Ahn, J., and Ward, D. 1988. Transcription of the minute virus of mice P4 promoter is dependent on an Sp-1 type factor in human and murine nuclear extracts. J. Cell. Bioc. 12D: 188. Ghosh, P., Reddy, V., Piatak, M., Lebowitz, P. and Weissman, S. 1980. Determination of RNA sequences by primer directed synthesis and sequencing of their cDNA transcripts. "Methods in Enzymology" (L. Grossman and K. Moldave, Eds.) Vol. 65_:580-595. Academic Press, New York. Gidoni, D., Dynan, W., and Tjian, R. 1984. Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature 312:409-413. Gidoni, D., Kadonaga, T., Barrera-Saldana, H., Takahashi, K., Chambon, P., and Tjian, R. 1985. Bidirectional SV40 transcription mediated by tandem Spl binding interactions. Science 230:511-517. Giniger, E., Varnum, S., and Ptashne, M. 1985. Specific DNA binding of GAL4, a positive regulatory protein of yeast. Cell 40:767-774. Graves, B., Johnson, P., McKnight, S. 1986. Homologous recognition of a promoter domain common to the MSV LTR and HSV tk gene. Cell 44:565-570. Green, M., Treisman, R., and Maniatis, T. 1983. Transcriptional activation of cloned human £-globin genes by viral immediate early gene products. Cell 35:137-148. Griffith, J., Hochschild, A., and Ptashne, M. 1986. DNA loops induced by a cooperative binding of lambda repressor. Nature 322:750-752. Gruenbaum, Y., Stein, R., Cedar, H., and Razin, A. 1981. Methylation of CpG sequences in eukaryotic DNA. FEBS Letters 124:67-71.  134 Guarente, L., and Hoar, E. 1984. Upstream activation sites of the CYC1 gene of Saccharomyces cerevisiae are active when inverted but not when placed downstream of the TATA box. Proc. Natl. Acad. Sci. 8J.:7860-7864. Gudas, J., Knight, G., and Pardee, A. 1988. Nuclear posttranscriptional processing of thymidine kinase mRNA at the onset of DNA synthesis. Proc. Natl. Acad. Sci. USA 85:47054709. Gudas, J., Knight, G., and Pardee, A. 1988. Cell cycle regulation of thymidine kinase mRNA involves nuclear processing events. J. Cell. Bioc. 12D:20. Guggenheimer, R., Stillman, B., Nagata, K., Tamanol, F., and Hurwitz, J. 1984. DNA sequences required for the in vitro replication of adenovirus DNA. Proc. Natl. Acad. Sci. USA 81:3069-3073. Hahn, S., Hendrickson, W., and Schleif, R. 1986. Transcription of Escherischia coli ara in vitro. The cyclic AMP receptor protein requirement for P g i n d u c t i o n that depends on the presence and orientation of the ara0 site. J. Mol. Biol. 188:355-367. 2  Hampton, E. 1970. H - l growth in synchronized rat embryo cells. Can. J. Microbiol. 16:266. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580. Hardy, S., and Shenk, T. 1988. Adenoviral control regions activated by E1A and the cAMP response element bind to the same factor. Proc. Natl. Acad. Sci. USA 85:4171-4175. Harrington, M., Jones, P., Imagawa, M., and Karin, M. 1988. Cytosine methylation does not affect binding of transcription factor Spl. Proc. Natl. Acad. Sci. USA 85:2066-2070. Harrison, S. 1986. Fingers and DNA half-turns. Nature 322:597-598. Hartshorne, T., Blumberg, H., and Young, E. 1986. Sequence homology of the yeast regulatory protein ADR1 with Xenopus transcription factor IIIA. Nature 320:283-287. Hawley, D., and Roeder, R. 1985. Separation and partial characterization of three functional steps in transcription initiation by human RNA polymerase II. J. Biol. Chem. 260:8163-8172. Heguy, A., West, A., Richards, R., and Karin, M. 1986. Structure and tissue-specific expression of the human metallothionein Ig gene. Mol. Cell. Biol. 6:2144-2157. Heintz, N., Sive, H., and Roeder, R. 1983. Regulation of human histone gene expression: kinetics of accumulation changes in the rate of synthesis and in the half-lives of individual histone mRNAs during the HeLa cell cycle. Mol Cell. Biol. 3:539-550. Heintz, N., and Roeder, R. 1984. Transcription of human histone genes in extracts from synchronized HeLa cells. Proc. Natl. Acad. Sci. USA 81_:2713-2717. Hendrickson, W. 1985. Protein-DNA interactions studied by the gel electrophoresis-DNA binding assay. BioTechniques: 198-207, Henikoff, S. 1984. Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28:351-359.  135 Hennighausen, L. and Lubon, H. 1987. Interaction of protein with DNA in vitro. Methods in Enzymology 152:721-735. Academic Press, New York. Hentschel, C , and Birnstiel, M. 1981. The organization and expression of histone gene families. Cell 25:301-313. Hochschild, A., and Ptashne, M. 1986. Cooperative binding of lambda repressores to sites separated by integral turns of the DNA helix. Cell 44:681-687. Hoffman, M., Korf, G., McNamara, K., and Stumph, W. 1986. Structural and functional analysis of chicken U4 small nuclear RNA genes. Mol. Cell. Biol. 6:3910-3919. Hong, G. 1981. A method for sequencing single-stranded cloned DNA in both directions. Bioscience Reports 1:243-252. Hope, I., and Struhl, K. 1986. Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46:885-894. Hope, I., Mahadevan, S., and Strugl, K. 1988. Structural and functional characterization of the short acidic transcriptional activation region of yeast GCN4 protein. Nature 333:635-640. Imbra, R., and Karin, M. 1986. Phorbol ester induces the transcriptional activity of the SV40 enhancer. Nature 323:555-558. Imbra, R., and Karin, M. 1987. Metallothionein gene expression is regulated by serum factors and activators of protein kinase C. Mol. Cell. Biol. 7:1358-1363. Ingles, C. J., Moyle, M., Allison, L., Wong, K., Archambault, J., and Friesen, J. 1987. Molecular genetics of eukaryotic RNA polymerases. UCLA Symp. Mol. Cell. Biol. 52:383393. Ivarie, R., and Morris, J. 1982. Induction of prolactin-deficient variants of GH, rat pituitary tumor cells by ethyl methanesulfonate: Reversion by 5-azacytidine, a DNA methylation inhibitor. Proc. Natl. Acad. Sci. USA 79:2967-2970. Jackson , S., and Tjian, R. 1988. O-Glycosylation of eukaryotic transcription factors: implications for mechanisms of transcriptional regulation. Cell 55:125-133. Jalinot, P., Wintzerith, M., Gaire, M., Hauss, C , Egly, J., and Kedinger, C. 1988. Purification and functional characterization of a cellular transcription factor that binds to an enhancer element within the adenovirus early EIIA promoter. Proc. Natl. Acad. Sci. USA 85:2484-2488. Jeang, K., Rawlins, D., Rosenfeld, P., Shero, J., Kelly, T., and Hayward, G. 1987. Multiple tandemly repeated binding sites for cellular nuclear factor I that surround the major immediate-early promoters of simian and human cytomegalovirus. J. Virol. 61:1559-1570. Johnston, M., Dover, J., Kim, J., and Michels, C. 1988. Role of the Cysteine-zinc finger in DNA binding. J. Cell. Bioc. 12D:207. Jones, P., Taylor, J., Mohandas, T., and Shapiro, L. 1982. Cell cycle-specific reactivation of an inactive X-chromosome locus by 5-azadeoxycytidine. Proc. Natl. Acad. Sci. USA 79:12151219. Jones, K., Yamamoto, K., and Tjian, R. 1985. Two distinct transcription factors bind to the HSV thymidine kinase promoter in vitro. Cell 42:559-572.  136  Jones, K., and Tjian, R. 1985. SP1 binds to promoter regions and activates herpes simplex virus "immediate-early gene transcription in vitro. Nature 317:179-182. Jones, K., Kadonaga, J., Luciw, P., and Tjian, R. 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science 232:755-759. Jones, K., Kadonaga, J., Rosenfeld, P., Kelly, T., and Tjian, R. 1987. A cellular DNAbinding protein that activates eukaryotic transcription and DNA replication. Cell 48:79-89. Kadonaga, J., Jones, K., and Tjian, R. 1986. Promoter-specific activation of RNA polymerase II transcription by Spl. TIBS l_l_:20-23. Kadonaga, J., Carner, K., Masiarz, F., and Tjian, R. 1987. Isolation of cDNA encoding transcription factor Spl and functional analysis of the DNA binding domain. Cell 51:10791090. Keegan, L., Gill, G., and Ptashne, M. 1986. Separation of DNA binding from the transcription-activating function of a eukaryotic regulatory protein. Science 231:699-704. Kelleher, J., Naomi, M., Luban, L., Mortimer, P., and Kamimura, T. 1983. Human serum "parvovirus": A specific cause of aplastic crusis in children with hereditary spherocytosis. J. Pediatr. 102:720-722. Kelly, D., Barwide, A., and Walder, I. 1977. DNA contained by two densonucleosis viruses. J. Virol. 21:396-409. Keshet, I., Lieman-Hurwitz, J., and Cedar, H. 1986. DNA methylation affects the formation of active chromatin. Cell 44:535-543. Kilham, L. and Olivier, L. 1959. A latent virus of rats isolated in tissue culture. Virology 2:428-437. Kilham, L., and Margolis, G. 1975. Problems of human concern arising from animal models of intrauterine and neonatal infections due to viruses: a review. I. Introduction and virologic studies. Prog. Med. Virol. 20:113. Kim, C , Heath, C , Bertuch, A., and Hansen, U. 1987. Specific stimulation of simian virus 40 late transcription in vitro by a cellular factor binding the simian virus 40 21-base-pair repeat promoter element. Proc. Natl. Acad. Sci. USA 84:6025-6029. Knight, G., Gudas, J., and Pardee, A. 1988. A CCAAT binding protein mediates the transcriptional response of the human thymidine kinase promoter during the cell cycle. J. Cell. Bioc. 12D: 114. Knott, P., Welply, G., Anderson, M. 1984. Serologically proved intrauterine infection with parvovirus. Br. Med. J. 289:1660. Korf, G., Botros, I., and Stumph, W. 1988. Tissue-specific differential expression of chicken U4 small nuclear RNA genes. J. Cell. Bioc. 12D:51. Kovesdi, I., Reichel, R., and Nevins, J. 1986a. E1A transcription induction: Enhanced binding of a factor to upstream promoter sequences. Science 231:719-722. Kovesdi, I., Reichel, R., and Nevins, J. 1986. Identification of a cellular transcription factor involved in EIA trans-activation. Cell 45:219-228.  137  Kramer, H., Neimoller, M., Amouyal, M., Revet, B., von Wicken-Beergmann, B., and Muller-Hill, B. 1987. Lac repressor forms loops with linear DNA carrying two suitably spaced lac operators. EMBO J. 6:1481-1491. Krol, A., Lund, E., and Dahlberg, J. 1985. The two embryonic U l RNA genes of Xenopus laevis have both common and gnen-specific transcription signals. EMBO J. 4:1529-1535. Kunkel, T., Roberts, J., and Zakour, R. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154:367-382. Kurtzman, G., Ozawa, K., Cohen, B., Hanson, G., Oseas, R., and Young, N. 1987. Chronic bone marrow failure due to B19 parvovirus infection. N. Engl. J. Med. 317:287-294. Landolfi, N., Capra, J., and Tucker, P. 1986. Interaction of cell-type-specific nuclear proteins with immunoglobulin V promoter region sequences. Nature 323:548-551. H  Lebovitz, R., and Roeder, R. 1986. Parvovirus H - l expression: Mapping of the abundant cytoplasmic transcripts and identification of promoter sites and overlapping transcription units. J. Virol. 58:271-280. Lee, W., Haslinger, A., Karin, M., and Tjian, R. 1987. Activation of transcription by two factors that bind promoter and enhancer sequences of the human metallothionein gene and SV40. Nature 325:368-372. Leegwater, P., vanDriel, W., and van der Vliet, P. 1985. Recogniton site of nuclear factor I, a sequence-specific DNA-binding protein from HeLa cells that stimulates adenovirus DNA replication. EMBO J. 4:1515-1521. Leff, S., Rosenfeld, M., and Evans, R. 1986. Complex transcription units: Diversity in gene expression by alternative RNA processing. Annu. Rev. Biochem. 55:1091-1117. Lieberman, M., Beach, L., Palmiter, R. 1983. Ultraviolet radiation induced metallothionein-I gene activation is associated with extensive DNA demethylation. Cell 35:207-214. Linser, P., Bruning, H., and Armentrout, R. 1977. Specific binding sites for a parvovirus, minute virus of mice, on cultured mouse cells. J. Virol 24:211-221. Lipton, HI, and Johnson, R. 1972. The pathogenesis of rat virus infections in the newborn hamster. Lab. Invest. 27:508-513. Lusby, E., Fife, K., and Berns, K. 1980. Nucleotide sequence of the inverted terminal repetition in adeno-associated virus DNA. J. Virol. 34:402. Ma, J., and Ptashne, M. 1987. Deletion analysis of GAL4 defines two transcription activating seqments. Cell 48:847-853. Maniatis, T., Fritsch, E., and Sambrook, J. 1982. "Molecular Cloning:A Laboratory Manual". Cold Spring Harbour Laboratory, Cold Spring Harbour, NY. Manley, J., Fire, A., Cano, A., Sharp. P. and Gefter, M. 1980. DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract. Proc. Natl. Acad. Sci. USA 77:3855-3859. Manley, J., Fire, A., Samuels, M., and Sharp, P. 1983. "In vitro transcription:Whole-cell extract". Methods Enzymol. 101:569-583. Academic Press, New York.  Margolis, G., and Kilham, L. 1975. Problems of human concern arising from animal models of intrauterine and neonatal infections due to viruses: a review. II. Pathologic studies. Prog. Med. Virol. 20:144.  138  Mason, J., Williams, G., and Neuberger, M. 1985. Transcription cell type specificity is conferred by an immunoglobulin V J J gene promoter that includes a functional consensus sequence. Cell 41:479-487. Matsui, T., Segall, J., Weil, P., and Roeder, R. 1980. Multiple factors required for accurate initiation of transcription by purified RNA polymerase II. J. Biol. Chem. 255:11992-11996. Matsunaga, Y., Matsukura, T., Yamazaki, S., Sugase, M., and Izumi, R. 1988. Hydrops fetalis caused by intrauterine human parvovirus infection. Japan J. Med. Sci. Biol. 40:165-169. Mattaj, I., Lienhard, S., Jiricny, J., and DeRobertis, E. 1985. An enhancer like sequence within the Xenopus U2 gene promoter facilitates the formation of stable transcription complexes. Nature 316:163-167. Maxam, A. and Gilbert, W. 1980. Sequencing end-labelled DNA with base specific chemical cleavages. Methods Enzymol. 65:499-560. Academic Press, New York. Maxson, R., Cohn, R., and Kedes, L. 1983. Expression and organization of histone genes. Annu. Rev. Genet. 17:239-277. McCall, M., Brown, T., Hunter, W., and Kennard, O. 1986. The crystal structure of d(GGATGGGAG) forms an essential part of the binding site for transcription factor IIIA. Nature 322:661-664. McKnight, S. and Kingsbury, R. 1982. Transcriptional control signals of a eukaryotic protein-coding gene. Science 217:316-324. McKnight, S., Kingsbury, R., Spence, A., and Smith, M. 1984. The distal transcription signals of the herpesvirus tk gene share a common hexanucleotide control sequence. Cell 37:253-262. McKnight, S., and Tjian, R. 1986. Transcriptional selectivity of viral genes in mammalian cells. Cell 46:795-805. Merchlinsky, M., Tattersall, P., Leary, J., Cotmore, S., Gardiner, E., and Ward, D. 1983. Construction of an infectious molecular clone of the autonomous parvovirus minute virus of mice. J. Virol. 47:227-232. Merchlinsky, M. 1984. Studies on MVM DNA replication using an infectious molecular clone; Ph.D thesis, Yale University, New Haven, Conn. Merino, A., Buckbinder, L., Carcamo, J., and Reinberg, D. 1988. Formation of a preinitiation complex at the adenovirus major late promoter. Role of MLTF. J. Cell. Bioc. 12D:121. Mermod, N., Williams, T., and Tjian, R. 1988. Enhancer binding factors AP-4 and AP-1 act in concert to activate SV40 late transcription in v/7ro:Nature 332:557-561. Messing, J. 1983. New Ml3 vectors for cloning. Methods Enzymol. 101:20-79.  Michaels, G., Brooks, B., and Feldmann, R. 1988. Molecular modeling of zinc binding domains from Xenopus transcription factor IIIA. J. Cell. Bioc. 12D: 122.  139  Miller, J., McLachlan, A., and Klug, A. 1985. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J. 4:1609-1614 Miller, R., Ward, D., and Ruddle, R. 1977. Embryonal carcinoma cells (and their somatic cell hybrids) are resistant to infection by the murine parvovirus MVM, which does infect other teratocarcinoma-derived cell lines. J. Cell. Physiol. 91_:393. Mitchell, P., Wang, C , and Tjian, R. 1987. Positive and negative regulation of transcription in vitro: Enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 50:847-861. Mohanty, S., and Bachmann, P. 1974. Susceptibility of fertilized mouse eggs to minute virus of mice. Infect. Immun. 9:762. Moncollin, V., Miyamoto, G., Zheng, X., and Egly, J.. 1986. Purification of a factor specific for the upstream element of the adenovirus-2 major late promoter. EMBO J. 5:2577-2584. Montminy, M. and Bilezikjian, L. 1987. Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Nature 328:175-178. Morgan, W. and Ward, D. 1986. Three splicing patterns are used to excise the small intron common to all minute virus of mice RNAs. J. Virol. 60:1170-1174. Mortimer, P., Humphries, R., Moore, J., Purcell, R., and Young, N. 1983a. A human parvovirus-like virus inhibits haematopoietic colony formation in vitro. Nature 302:426-429. Mortimer, P. 1983c. Hypothesis: the aplastic crisis of hereditary spherocytosis is due to a single transmissible agent. J. Clin. Pathol. 36:445-448. Moyle, M., and Ingles, C. 1988. A function for the C-terminal domain of the largest subunit of RNA polymerase II. J. Cell. Bioc. 12D:216. Nagai, K., Nakaseko, Y., Nasmyth, K., and Rhodes, D. 1988. Zinc-finger motifs expressed in E. coli and folded in vitro direct specific binding to DNA. Nature 332:284-286. Neuberger, M., and Williams, G. 1988., The intron requirement for immunoglobulin gene expression is dependent upon the promoter. Nuc. Acids Res. 16:6713-6724 Nevins, J. 1983. The pathway of eukaryotic mRNA formation. Annu. Rev. Biochem. 52:441466. Nonet, M., Sweetser, D., and Young, R. 1987. Functional redundancy and structural polymorphism in the large subunit of RNA polymerase II. Cell 50:909-915. O'Neill, E., Fletcher, C , Burrow, C , Heintz, N., Roeder, R., and Kelly, T. 1988. Transcription factor OTF-1 is functionally identical to the DNA replication factor NF-III. Science 241:1133-1164. Ozawa, K., Kurtzmann, G., and Young, N. 1986. Replication of the B19 parvovirus in human bone marrow cell cultures. Science 233:883-886. Ozawa, K., Ayub, J., Yu-Shu, H., Kurtzman, G., Shimada, T. and Young, N. 1987. Novel transcription map for the B19 (human) pathogenic parvovirus. J. Virol. 61:2395-2406.  140 Ozawa, K., and Young, N. 1987. Characterization of capsid and noncapsid proteins of B19 parvovirus propagated in human erythroid bone marrow cell cultures. J. Virol. 61:2627-2630. Ozawa, K., Ayub, J., and Young, N. 1988. Functional mapping of the genome of the B19 (human) parvovirus by in vitro translation after negative hybrid selection. J. Virol. 62:25082511. Pabo, C , and Sauer, R. 1984. Protein-DNA recognition. Ann. Rev. Biochem. 53:293-321. Padgett, R., Grabowski, P., Konarska, M., Seiler, S., and Sharp, P. 1985. Splicing of messanger RNA precursors. Annu. Rev. Biochem. 55:1119-1150 Parrish, C , and Carmichael, L. 1985. Abstract, EMBO Workshop on Parvoviruses, Grangeneuve/Posieux, Wintzerland, SV1/1:39. Parslow, T., Blair, D., Murphy, W., and Granner, K. 1984.Structure of the 5' ends of immunoglobulin genes: a novel conserved sequence. Proc. Natl. Acad. Sci. USA 81:2650-2654. Parslow, T., Jones, S., Bond, B., and Yamamoto, K. 1987. The immunoglobulin octanucleotide: independent activity and selective interaction with enhancers. Science 235:1498-1501. Pattison, J., Jones, S., Hodgson, J., Davis, L., White, J., Stroud, C , and Murtaza, L. 1981. Parvovirus infections and hypoplastic crisis in sickle-cell anaemia. Lancet £664-665. Pattison, J. 1988, (Ed.) in Parvoviruses and Human Disease, CRC Press Inc., Boca Raton, Florida. Pintel, D., Dadachanji, D., Astell, C , and Ward, D. 1983. The genome of minute virus of mice, an autonomous parvovirus, encodes two overlapping transcription units. Nuc. Acids Res. 11:1019-1038. Porter, D., and Cho, H. 1980. Aleutian Disease of mink: a model for persistent infection, p 233. In Fraenkel-Conrat, H. and Wagner, R., (eds.), Comprehensive Virology 16. Plenum Press. New York. Proudfoot, V. 1986. Transcriptional interference and termination between duplicated a-globin gene constructs suggests a novel mechanism for gene regulation. Nature 322:562-565. Pruijn, G., van Driel, W., and van der Vliet, P. 1986. Nuclear factorlll, a novel sequencespecific DNA-binding protein from HeLa cells stimulating adenovirus DNA replication. Nature 322:656-659. Ptashne, M., Jeffery, A., Johnson, A., Maurer, R., Meyer, B., Pabo, C , Roberts, T., and Sauer, R. 1980. How the lambda repressor and cro work. Cell 19:1-11. Ptashne, M. 1986. Gene regulation by proteins acting nearby and at a distance. Nature 322:697-701. Rao, K., Patel, A., Anderson, M., Hodgson, J., Jones, S., and Pattison, J. 1983. Infection with parvovirus-like virus and aplastic crisis in chronic hemolytic anemia. Annals of Internal Medicine 98:930-932. Rawlins, D., Rosenfeld, P., Wides, R., Challberg, M., and Kelly, T. 1984. Structure and function of the adenovirus origin of replication. Cell 37:309-319.  141 Raymondjean, M., Cereghini, S., and Yaniv, M. 1988. Several distinct "CCAAT" box binding proteins coesist in eukaryotic cells. Proc. Natl. Acad. Sci. USA 85:757-761. Reichel, R., Kovesdi, I., and Nevins, J. 1988. Activation of a preexisting cellular factor as a basis for adenovirus ElA-mediated transcription control. Proc. Natl. Acad. Sci. USA. 85:387390. Reid, D., Brown, T., Reid, T., Rennie, J., and Eastmond, C. 1985. Human parvovirusassociated arthritis: A clinical and laboratory description. Lancet 7:422-425. Reinberg, D., and Roeder, R. 1987a. Factors involved in specific transcription by mammalian RNA polymerase II: purification and functional analysis of initiation factors TFIIB and TFIIE. J. Bioll. Chem. 262:3310-3321. Reinberg, D., Horikoshi, M., and Roeder, R. 1987b. Factors involved in specific transcription of initiation factors TFIIA and TFIID and identification of a new factor operating at sequences downstream of the initiation site. J. Biol. Chem. 262:3322-3330. Rekosh, D., Russell, W., Bellett, A., and Robinson, A. 1977. Identification of a protein linked to the ends of adenovirus DNA. Cell 11:283-295. Revie, D., Yseng, B., Grafstom, R., and Goulian, 1979. Covalent association of protein with replicative form DNA of parvovirus HI. Proc. Natl. Acad. Sci. USA 76:5539-5543. Rhodes, D. 1985. Structural analysis of a triple complex between the histone octamer, a Xenopus gene for 5S RNA and transcription factor IIIA. EMBO J. 4:3473-3482. Rhodes, D., and Klug, A. 1986. An underlying repeat in some transcriptional control sequences corresponding to half a double helical turn of DNA. Cell 46:123-132. Rhode, S. 1973. Replication process of the parvovirus H - l . I. Kinetics in a parasynchronous cell system. J. Virol. 11:856-861. Rhode, S., Ill and Klaassen, B. 1982. DNA sequence of the 5' terminus containing the replication origin of parvovirus replicative form DNA. J. Virol. 41:990-999. Rhode III, S. 1985. ira«s-activation of parvovirus P^g promoter by the 76K noncapsid protein. J. Virol. 55:886-889. Rhode, S., III. 1985b. Regulation of parvovirus transcription by non-capsid protein. EMBO Parvovirus Workshop, Grangeneuve, Switzerland. Rhode III, S., and Richard, S. 1987. Characterization of the irans-activation-responsive element of the parvovirus H - l P38 promoter. J. Virol. 61:2807-2815. Rickles, R., Marash, R., Sierra, F., Clark, S., Wells, J., Stein, J., and Stein, G. 1982. Analysis of histone gene expression during the cell cycle in HeLa cells by using cloned human histone genes. Proc. Natl. Acad. Sci. USA 79:749-753. Rosenberg, U., Schroder, C , Preiss, A., Kienlin, A., Cote, S., Riede, I., and Jackie, H. 1986. Structural homology of the product of the Drosophila Kruppel gene with Xenopus transcription factor IIIA. 1986. Nature 319:336-339. Rosenfeld, P., O'Neill, E., Wides, R., and Kelly, T. 1987. Sequence-specific interactions between cellular DNA binding proteins and the adenovirus origin of DNA replication. Mol. Cell. Biol. Mol. Cell. Biol. 7:875-886.  142 Rosenfeld, M., Guise, J., Emeson, R., Russo, A., Bryan, E., Leff, S. 1988. Regulation of alternative RNA processing in calcitonin/CGRP gene expression. J. Cell. Bioc. 12D:10 Ruden, D., Ma, J., and Ptashne, M. 1988. No strict alignment is required between a transcriptional activator binding site and the "TATA box" of a yeast gene. Proc. Natl. Acad Sci. USA 85:4262-4266. Sahli, R., McMaster, G, and Hirt, B. 1985. DNA sequence comparison between two tissue-specific variants of the autonomous parvovirus, minute virus of mice. Nuc. Acids Res. 13:3617-3632. Samuels, M., Fire, A., and Sharp, P. 1982. Separation and characterization of factors mediating accurate transcription by RNA polymerase II. J. Biol. Chem. 257:14419-14427. Samuels, M., and Sharp. P. 1986. Purification and characterization of a specific RNA polymerase II transcription factor. J. Biol. Chem. 261:2003-2013. Sanger, S., Nicklen, S., and Coulson, A. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. Sanger, R., Coulson, A., Barell, B., Smith, A., and Roe, B. 1980. Cloning in single stranded phage vectors as an aid to rapid DNA sequencing. J. Mol. Biol. 143:161-178. Sawadogo, M., and Roeder, R. 1984. Energy requirements for specific transcription initiation by the human RNA polymerase II system. J. Biol. Chem. 259:5321-5326. Sawadogo, M. and Roeder, R. 1985b.Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43:165-175. Scheidereit, C , Heguy, A., and Roeder, R. 1987. Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in vitro. Cell 51:783-793. Sealey, L., and Chalkley, R. 1987. At least two nuclear proteins bind specifically to the Rous Sarcoma virus long terminal repeat enhancer. Mol. Cell. Biol. 7:787-798. Sen, R., and Baltimore, D. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705-716. Sen, R., and Baltimore, D. 1987. In vitro transcription of immunoglobulin genes in a B-cell extract: Effects of enhancer and promoter sequences. Mol. Cell. Biol. 7:1989-1994. Serf ling, E., Jasin, M., and Schaffner, W. 1985. Enhancers and eukaryotic gene transcription. Trends in Genetics, August:224-330. Serjeant, G., Mason, K., Topley, J., Serjeant, B., Pattison, J., Jones, S., and Mohamed, R. 1981. Outbreak of aplastic crises in sickle cell anaemia associated with parvovirus-like agent. Lancet 2:595-597. Shade, R., Blundell, M., Cotmore, S., Tattersall, B. and Astell, C. 1986. Nucleotide sequence and genome organization of human parvovirus B19 isolated from the serum of a child during aplastic crisis. J. Virol. 58:921-936. Shanblatt, S., and Revzin, A. 1984. Kinetics of RNA polymerase-promoter complex formation: effects of nonspecific DNA-protein interactions. Nucl. Acids. Res. 12:4287-5306.  143 Sharp, P. 1987. Splicing of messenger RNA precursors. Science 235:766-771. Shi, Z., Lee, R., and Weinmann, R. 1986. Protein factor(s) binding independently to two different regions of the adenovirus-2 major late promoter. Nucl. Acids Res. 14:3729-3744. Siegl, G. and Gautschi, M. 1973. The multiplication of parvovirus LuIII in a synchronized culture system. I. Optimum conditions for virus replication. Arch. Gesamte Virusforsch. 40:105. Siegl, G., Bates, R., Berns, K., Carter, B., Kelly, D., Kurstak, E., and Tattersall, P. 1985. Characteristics and taxonomy of Parvoviridae. Intervirology 23:61. Sigler, P. 1988. Transcription activation: Acid blobs and negative noodles. Nature 333:210212. Simon, M., Fisch, T., Benecke, B., Nevins, J., and Heintz, N. 1988. Definition of multiple, functionally distinct TATA elements, one of which is a target in the hsp70 promoter for El A regulation. Cell 52:723-729. Simpson, R. 1982. Evidence for close contacts between RNA polymerase and promoter DNA, pp. 164-179. In R. Rodriquez and M. Chamberlin (ed.), Promoters:structure and function. Prager, NY. Singh, H., Sen, R., Baltimore, D., and Sharp, P. 1986. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobuling genes. Nature 319:154-158. Sittman, D., Graves, R., and Marzluff, W. 1983. Histone mRNA concentrations are regulated at the level of transcription and mRNA degradation. Proc. Natl. Acad. Sci. USA 80:18491853. Sivaraman, L., Subramanian, S., and Thimmappaya, B. 1986. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells. Proc. Natl. Acad. Sci. USA 83:5914-5918. Sivaraman, L., and Thimmappaya, B. 1987. Two promoter-specific host factors interact with adjacent sequences in an EIA-inducible adenovirus promoter. Proc. Natl. Acad. Sci. USA 84:6112-6116. Sive, H., and Roeder, R. 1986b. Interaction of a common factor with conserved promoter and enhancer sequences in histone H2B, immunoglobulin, and U2 small nuclear RNA (snRNA) genes. Proc. Natl. Acad. Sci. USA 83:6382-6386. Sive, H., Heintz, N., and Roeder, R. 1986. Multiple sequence elements are required for maximal in vitro transcription of a human histone H2B gene. Mol. Cell. Biol. 6:3329-3340. Spalholz, B., and Tattersall, P. 1983. Specific binding for a Parvovirus, minute virus of mice, on cultured mouse cells. J. Virol. 46:937Staudt, L., Singh, H., Sen, R., Wirth, T., Sharp, P., and Baltimore, D. 1986. A lymphoidspecific protein binding to the octamer motif of immunoglobulin genes. Nature 323:640-643. Stein, R., Gruenbaum, Y., Pollack, Y., Razin, A., and Cedar, H. 1982. Clonal inheritance of the pattern of DNA methylation in mouse cells. Proc. Natl. Acad. Sci. USA 79:61-65.  144 Stillman, B., and Bellett, A. 1979. An adenovirus protein associated with the end of replicating DNA molecules. Virology 93:69-79. Strauss, F. and Varshavsky, A. 1984. A protein binds to a satellite DNA repeat at three specific sites that would be brought into mutual proximity by DNA folding in the nucleosome. Cell 37:889-901. Struhl, K. 1987. Promoters, activator proteins, and the mechanism of transcription initiation in yeast. Cell 49:295-299. Struhl, 1988. The JUN oncoprotein, a vertebrate transcription factor, activates transcription in yeast. Nature 332:649-650 Summers, J., Jones, S., and Anderson, M. 1983. Characterization of the genome of the agent of erythrocyte aplasia permits its classification as a human parvovirus. J. Gen. Virol. 64:25272532. Suzanna, G., Horvath, S., Eisen, A., Taylor, W., Hood, L. 1988. Zinc-dependent structure and DNA binding of a single finger domain of ADR1. J. Cell. Bioc. 12D: 144. Svaren, J., Inagami, S., Lovegren, E. and Chalkley, R. 1987. DNA denatures upon drying after ethanol precipitation. Nucleic Acids Res. 15:8739-8754. Takahashi, K., Vigneron, M., Matthes, H., Wildeman, A., Zenke, M., and Chambon, P. 1986. Requirements of stereospecific alignments for initiation from the simian virus early promoter. Nature 319:121-126. Tattersall, P. 1972. Replication of the parvovirus MVM. Dependence of virus multiplication and plaque formation on cell growth. J. Virol. 10:586-590. Tattersall, P. 1978. Susceptibility to minute virus of mice as a function of host cell differentiation. In D. Ward and P. Tattersall (eds.), Replication of Mammalian Parvoviruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Tattersall, P., and Cotmore, S. 1988. The nature of parvoviruses, in Parvoviruses and Human Diseases, J. Pattison, Ed., CRC Press, Inc., Florida. Tennant, R., Layman, K., and Hand, R. 1969. Effect of cell physiological state on infection by rat virus. J. Virol. 4:872-878. Tijssen, P., Belloncik,S., and Arella, M. 1985. Structure and sequencing of densonucleosis virus DNA. Abstract, EMBO Workshop on Parvoviruses. Grangeneuve, Switzerland, 71. Toolan, H. 1961. Studies on a viral agent associated with human tumors. Proc. Am. Assoc. Cancer Res. 3:273. Toolan, H. 1967. Lack of oncogenic effect of the H-viruses. Nature 214:1036-1037. Toolan, H. and Ledinko, N. 1968. Inhibition by H - l virus of the incidence of tumors produced by adenovirus 12 in hamsters. Virology 35:475-478. Toolan, H. Rhosde, S., III,and Gierthy, J. 1982. Inhibition of 7,12-dimethylbenz(a)anthracene-induced tumors in Syrian hamsters by prior infection with H-l parvovirus. Cancer Res. 42:2552-2555.  145 Tsai, S., Sagami, I., Wang, H., Tsai, M., and O'Malley, B. 1987. Interactions between a DNAbinding transcription factor (Coup) and a non-DNA binding factor (S300-II). Cell 50:701709. Turek, L., Haugen, T., Cripe, T.,k and Ginder, G. 1988. DNA methylation at specific C G sites inhibits early BPV-1 transcription and trans-activation by the E2 function. J. Cell. Bioc. 12D:321. m e  Vandervelde, E., Goffin, C , Megson, G., Mahmood, N., Porter, A., and Cossart, Y. 1974. User's guide to some new tests for hepatitis-B antigen. Lancet 2:1066 Wang, X., and Calame, K. 1986. SV40 enhancer-binding factors are required at the extablishment but not the maintenance step of enhancer-dependent transcriptional activation. Cell 47:241-247. Ward, B. and Dabrowiak, J. 1988. Stability of DNasel in footprinting experiments. Nucl. Acids Res. 16:8724. Ward, D., and Tattersall, P. 1978. (Eds.) in Replication of Mammalian Parvoviruses, Cold Spring Harbor Press, Cold Spring Harbor, New York. Weil, A., Luse, D., Segall, J., and Roeder, R. 1979. Selective and accurate initiation of transcription at the AD2 Major late promotor in a soluble system dependent on purified RNA polymerase II and DNA. Celll8:469-484. Weinberger, J., Baltimote, D., and Sharp, P. 1986. Distinct factors bind to apparently homolgous sequences in the immunoglobulin heavy-chain enhancer. Nature 322:846-848. White, D., Mortimer, P., Blake, D., Woolf, A., Cohen, B., and Bacon, P. 1985. Human parvovirus arthropathy. Lancet vA 19-421. Wides, R., Challberg, M., Rawlins, D., and Kelly, T. 1987. Adenovirus origin of replication: sequence requirements for replication in vitro. Mol. Cell. Biol. 7:875-886. Wingender, E. 1988. Compilation of transcription regulating proteins. Nuc. Acids Res. 16:1879-1902. Wirth, R., Staudt, L., and Baltimore, D. 1987. An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity. Nature 329:174-178. Workman, J., and Roeder, R. 1987. Binding of transcription factor TFIID to the major late promoter during in vitro nucleosome assembly potentiates subsequent initiation by RNA polymerase II. Cell 51:613-622. Wu, L., Rosser, D., Schmidt, M., and Berk, A. 1987. A TATA box implicated in E1A transcriptional activation of a simple adenovirus 2 promoter. Nature 326:512-515. Yakobson, B., Koch, T., and Winocour, E. 1987. Replication of adeno-associated virus in synchronized cells without the addition of a helper virus. J. Virol. 61:972-981. Yalkinoglu, A., Schlehofer, J., and zar Hausen, H. 1985. Transient inhibition of cellular DNA replication in a SV40 transformed Chinese Hamster Ovary cell line by aphidicolin, hydroxyurea, or methotrexate, respectively, induces helper-virus-independent AAV-5 DNA replication. Abstract, EMBO Workshop on Parvoviruses. Grangeneuve, Switzerland, 48.  Yanisch-Perron, Viera, J., and Messing, J. 1985. Improved Ml3 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.  146  Yanofsky, C. 1981. Attenuation in the control expression of bacterial operons. Nature 289:751-758. Yisraeli, J., and Azyl, M. 1984. in DNA Methylation, eds. Razin, A., Cedar, H., and Riggs, A. New York:353-378. Zenke, M., Grundstrom, T., Matthes, H., Wintzerith, M., Schatz, C , Wildeman, A., and Chambon, P. 1986. Multiple sequence motifs are involved in SV40 enhancer function. EMBO J. 5:387-397. Zheng, X., Moncollin, V., Egly, J., and Chambon, P. 1987. A general transcription factor forms a stable complex with RNA polymerase B (II). Cell 50:361-368. Zhong, R., Roeder, R., and Heintz, N. 1983. The primary structure and expression of four cloned human histone genes. Nucleic Acids Res. 11:7409-7425. Zoller, M., and Smith, M. 1987. Oligonucleotide-directed mutagenesis: A simple method using two oligonucleotide primers and a single-stranded DNA template. Methods in Enzymology 154:329-350.  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items