Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Structure, function, and role in antibiotic resistance of outer membrane protein H1 in Pseudomonas aeruginosa Bell, Angus 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1989_A1 B43.pdf [ 10.37MB ]
Metadata
JSON: 831-1.0098139.json
JSON-LD: 831-1.0098139-ld.json
RDF/XML (Pretty): 831-1.0098139-rdf.xml
RDF/JSON: 831-1.0098139-rdf.json
Turtle: 831-1.0098139-turtle.txt
N-Triples: 831-1.0098139-rdf-ntriples.txt
Original Record: 831-1.0098139-source.json
Full Text
831-1.0098139-fulltext.txt
Citation
831-1.0098139.ris

Full Text

STRUCTURE, FUNCTION, AND ROLE IN ANTIBIOTIC RESISTANCE OF OUTER MEMBRANE PROTEIN Hi IN PSEUDOMONAS AERUGINOSA By ANGUS BELL B.Sc. (Hons.), The U n i v e r s i t y of Edinburgh, 1982 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of M i c r o b i o l o g y ) We accept t h i s t h e s i s as conforming to the r e q u i r e d standard THE UNIVERSITY OF BRITISH October 1989 © Angus B e l l , 1989 COLUMBIA In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of MlCfrOfelOL.06>/ The University of British Columbia Vancouver, Canada Date S Oazo^^a. l i S l DE-6 (2/88) i i ABSTRACT A d i v a l e n t c a t i o n - r e g u l a t e d outer membrane p r o t e i n of Pseudomonas aeruginosa, HI, was p u r i f i e d by s e l e c t i v e s o l u b i l i z a t i o n s of outer membranes i n detergent and e t h y l e n e d i a m i n e t r a a c e t a t e (EDTA) followed by e i t h e r two c y c l e s of anion-exchange chromatography or sodium d o d e c y l s u l p h a t e - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . P r o t e i n p u r i f i e d by the former method was contaminated with an equi-molar or higher c o n c e n t r a t i o n of 1 i p o p o l y s a c c h a r i d e , (LPS) that was e n r i c h e d i n 0 s i d e c h a i n - c o n t a i n i n g molecules, suggesting an a s s o c i a t i o n between p r o t e i n Hi and smooth LPS. E l e c t r o p h o r e s i s gave higher y i e l d s of p u r i f i e d p r o t e i n H i , and t h i s product was used f o r N-terminal amino a c i d sequencing, amino a c i d a n a l y s i s , and p o l y c l o n a l antiserum p r o d u c t i o n . 0 1 i g o d e o x y r i b o n u c l e o t i d e s complementary to the upstream end of the s t r u c t u r a l gene f o r p r o t e i n H i , oprH, were designed using the N-terminal sequence of the p r o t e i n . Probing of Southern b l o t s of chromosomal DNA d i g e s t s with the o l i g o n u c l e o t i d e s r e v e a l e d that oprH was probably a s i n g l e - c o p y gene, and allowed i t to be cloned i i i i n E s c h e r i c h i a c o 1 i . N u c l e o t i d e sequence a n a l y s i s confirmed the c l o n i n g of the c o r r e c t gene, and the d e r i v e d amino a c i d sequence i n d i c a t e d a s l i g h t l y b a s i c p r o t e i n ( i n agreement with i t s proposed f u n c t i o n of i n t e r a c t i n g with a n i o n i c s i t e s on LPS) of 178 r e s i d u e s , with two hydrophobic segments. P r o t e i n HI was produced, p r o t e o l y t i c a l l y processed and probably exported to the outer membrane in E_. c o l i c e l l s c a r r y i n g the complete oprH gene on plasmids. The oprH gene could be expressed weakly from a promoter on the cloned DNA provided that a p a r t i c u l a r downstream sequence was not d e l e t e d . T h i s suggested that the downstream region was i n v o l v e d i n r e g u l a t i o n of e x p r e s s i o n of the cloned oprH gene. P r o t e i n HI was produced at l e v e l s much higher than background when e x t r a copies of the oprH gene were present i n an e x p r e s s i o n ve c t o r i n P. aeruginosa. This o v e r p r o d u c t i o n of p r o t e i n HI caused decreased s u s c e p t i b i l i t y of c e l l s to k i l l i n g by EDTA, but not by polymyxin B or gentamicin. T h i s p a r t l y confirmed the hypothesis (T.I. Nicas and R.E.W. Hancock, J . B a c t e r i o l . 143; 872-878, 1980) that p r o t e i n HI causes r e s i s t a n c e to these agents by i n h i b i t i n g t h e i r s e l f -i v promoted uptake across the outer membrane. However, an a d d i t i o n a l a l t e r a t i o n ( p o s s i b l y an i n c r e a s e i n c a t i o n i c s u b s t i t u e n t s on LPS) was ap p a r e n t l y r e q u i r e d f o r the f u l l y r e s i s t a n t phenotype. This idea was supported by the observed suppression by LPS mutations of the polymyxin B r e s i s t a n c e of p r o t e i n Hl-overproducing c e l l s , and by the p r o p e r t i e s of a P_. aeruginosa s t r a i n a p p a r e n t l y l a c k i n g p r o t e i n H i . S e v e r a l s p e c i e s of b a c t e r i a r e l a t e d to P. aeruginosa produced envelope p r o t e i n s that were i n d u c i b l e by growth 2+ in Mg - d e f i c i e n t medium, and one (a p r o t e i n of apparent molecular weight 20,000 from P. c h l o r a p h i s ) c r o s s - r e a c t e d immunologically with p r o t e i n H i . P. c h l o r a p h i s , l i k e P_. aeruginosa, was polymyxin B r e s i s t a n t when i t was grown 2+ in Mg - d e f i c i e n t medium. V TABLE OF CONTENTS Page ABSTRACT i i TABLE OF CONTENTS V LIST OF TABLES r ix LIST OF FIGURES X LIST OF ABBREVIATIONS x i i ACKNOWLEDGEMENTS x i i i DEDICATION x i v INTRODUCTION 1 1. Pseudomonas aeruginosa 1 2. The outer membrane of P. aeruginosa and other Gram-negative b a c t e r i a 3 a. General p r o p e r t i e s 3 b. P h o s p h o l i p i d 4 c. L i p o p o l y s a c c h a r i d e and d i v a l e n t c a t i o n s . . . 4 d. P r o t e i n s 9 e. Functions of the outer membrane 12 3. A n t i b i o t i c s u s c e p t i b i l i t y and r e s i s t a n c e i n P. aeruginosa 14 a. A n t i b i o t i c a c t i o n and r e s i s t a n c e 14 b. E f f e c t s of c h e l a t o r s and p o l y c a t i o n s on c e l l s 16 c. A n t i b i o t i c uptake pathways 18 4. Aims of t h i s study 23 MATERIALS AND METHODS 25 1. B a c t e r i a l s t r a i n s , plasmids, and growth c o n d i t i o n s 25 2. SDS-PAGE 30 3. P r o t e i n p u r i f i c a t i o n methods 30 v i Page 4. Determination of N-terminal amino a c i d sequence and amino a c i d composition of p r o t e i n HI . . . . 32 5. Antiserum p r o d u c t i o n and p u r i f i c a t i o n , immunoblotting, and c r o s s - l i n k i n g 32 6. O l i g o n u c l e o t i d e design and s y n t h e s i s 34 7. DNA techniques 35 8. DNA sequencing 36 9. DNA and p r o t e i n sequence analyses 36 10. Whole c e l l p r o t e i n and LPS p r e p a r a t i o n and c e l l f r a c t i o n a t i o n . . 37 11. T r i p a r e n t a l c o n j u g a t i o n . . . . . . 37 12. A n t i b i o t i c s u s c e p t i b i l i t y t e s t i n g . . . . . . . . 38 13. Measurement of c e l l s u r f a c e h y d r o p h o b i c i t y . . . 40 14. Growth of P_. aeruginosa i n chamber implants in mice 40 15. C e l l envelope i s o l a t i o n 40 16. Other methods 41 RESULTS CHAPTER 1. PURIFICATION AND PROPERTIES OF PROTEIN HI AND CLONING AND NUCLEOTIDE SEQUENCE OF ITS STRUCTURAL GENE 42 1. P u r i f i c a t i o n of p r o t e i n HI: o p t i m i z a t i o n of outer membrane s o l u b i l i z a t i o n s 42 2. P u r i f i c a t i o n of p r o t e i n HI from s o l u b i l i z e d membranes by anion-exchange chromatography . . . 45 3. P u r i f i c a t i o n of p r o t e i n HI from s o l u b i l i z e d membranes by SDS-PAGE 46 4. P r o p e r t i e s of p u r i f i e d p r o t e i n Hi 47 5. A n a l y s i s of P._ aeruginosa chromosomal DNA by h y b r i d i z a t i o n with o l i g o n u c l e o t i d e s complementary to oprH 49 v i i Page 6. Molecular c l o n i n g of oprH 52 7. N u c l e o t i d e sequence a n a l y s i s of oprH 57 8. A n a l y s i s of the d e r i v e d amino a c i d sequence of p r o t e i n HI 59 9. Summary 62 CHAPTER 2. EXPRESSION OF CLONED oprH IN E. c o l i AND P. aeruginosa . 64 1. Ex p r e s s i o n of oprH i n E. c o l i ; e f f e c t s of growth medium, s u b c l o n i n g , and promoter type 64 2. Expres s i o n of oprH i n E_. c o l i ; export and p r o c e s s i n g of p r o t e i n Hi 71 3. Overproduction of p r o t e i n HI from cloned oprH in P. aeruginosa 72 4. E f f e c t of oprH expr e s s i o n on a n t i b i o t i c s u s c e p t i b i l i t y 74 5. Summary 77 CHAPTER 3. INTERACTION WITH LPS AND FUNCTION OF PROTEIN HI . . . . 80 1. Surface p r o p e r t i e s of p r o t e i n Hl-overproducing c e l l s 80 2. C r o s s - l i n k i n g s t u d i e s 82 3. E f f e c t of LPS mutations i n combination with p r o t e i n Hi overproduction on a n t i b i o t i c s u s c e p t i b i l i t y 82 4. Approaches to mutagenesis of oprH 86 5. P r o p e r t i e s of P. aeruginosa ATCC33354 87 6. Pr o d u c t i o n of p r o t e i n HI by P. aeruginosa grown in mice 89 7. Summary ' 89 v i i i Page CHAPTER 4. Mg 2 +-REGULATED CELL ENVELOPE PROTEINS OF SPECIES RELATED TO P. aeruginosa 92 2+ 1. Envelope p r o t e i n s i n d u c i b l e by growth i n Mg d e f i c i e n t medium and r e a c t i v i t y with antiserum to p r o t e i n Hi 92 2. Polymyxin B s u s c e p t i b i l i t y of P_. c h l o r a p h i s . . . 95 3. Summary 95 DISCUSSION ^ . 97 1. General p r o p e r t i e s of p r o t e i n HI 97 2. I n t e r a c t i o n of p r o t e i n HI with LPS 98 3. S t r u c t u r e and f u n c t i o n of p r o t e i n Hi 101 4. Gen e t i c s and r e g u l a t i o n of p r o t e i n HI s y n t h e s i s 103 5. Role of p r o t e i n HI i n a n t i b i o t i c r e s i s t a n c e . . . 107 6. A model mechanism of a n t i b i o t i c r e s i s t a n c e f o r p r o t e i n Hl-overproducing c e l l s 112 7. New p e r s p e c t i v e s on self-promoted uptake . . . . 119 LITERATURE CITED 121 i x LIST OF TABLES Table T i t l e Page I B a c t e r i a l s t r a i n s 26-27 II Plasmids 28-29 III Amino a c i d composition of p r o t e i n HI 50-51 IV L e v e l of ex p r e s s i o n of cloned oprH DNA in E_. c o l i and P. aeruginosa 65-66 V Surface h y d r o p h o b i c i t y of p r o t e i n H l -overproducing c e l l s measured by adhesion to xylene 81 VI E f f e c t of LPS mutations i n combination with p r o t e i n HI over p r o d u c t i o n on s u s c e p t i b i l i t y to polymyxin B 84 VII S u s c e p t i b i l i t y to polymyxin B and c a r b e n i c i 1 1 i n of P_. aeruginosa PA01 (serotype 5) and ATCC33354 (serotype 6) grown i n M g 2 + - s u f f i c i e n t and Mg 2+-def i c i e n t medium 88 2+ VIII Mg - r e g u l a t e d c e l l envelope p r o t e i n s 93 IX S u s c e p t i b i l i t y to polymyxin B and c a r b e n i c i 1 1 i n of Pseudomonas sp e c i e s grown i n M g ^ - s u f f i c i e n t and M g 2 + - d e f i c i e n t medium 96 X LIST OF FIGURES F i g u r e T i t l e Page 1. T e n t a t i v e s t r u c t u r e of the core o l i g o s a c c h a r i d e of LPS i n P_. aeruginosa PA01 and d e r i v a t i v e s . . . 7 2. Coomassie B l u e - s t a i n e d SDS-polyacrylamide g e l electrophoretogram i l l u s t r a t i n g p u r i f i c a t i o n of p r o t e i n HI 43 3. SDS-polyacrylamide-urea g e l e l e c t r o p h o r e t o g r a m of p u r i f i e d p r o t e i n HI samples, s i l v e r - s t a i n e d f o r LPS 48 4. N-terminal amino a c i d sequence of the f i r s t 22 r e s i d e n t s of p r o t e i n HI, and sequences of o l i g o n u c l e o t i d e s complementary to oprH 53 5. Agarose g e l e l e c t r o p h o r e t i c and Southern b l o t a n a l y s i s of r e s t r i c t i o n fragments of pGBl and pGB2 55 6. R e s t r i c t i o n map of a 2.8kb EcoRI fragment of PA01 chromosomal DNA c o n t a i n i n g the oprH gene, and sequencing s t r a t e g y 56 7. N u c l e o t i d e sequence of the oprH r e g i o n and d e r i v e d amino a c i d sequence of p r o t e i n HI . . . . 58 8. Hydropathy p l o t f o r p r o t e i n HI 61 9. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m and Western immunoblot of c e l l l y s a t e s of E. c o l i c a r r y i n g plasmids with oprH DNA, showing p r o d u c t i o n of p r o t e i n HI 68 10. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m and Western immunoblot of f r a c t i o n e d E. c o 1 i c e l l s producing p r o t e i n Hi 69 11. Diagram of plasmid pGB25 73 12. SDS-polyacrylamide e l e c t r o p h o r e t o g r a m of P. aeruginosa c e l l l y s a t e s showing o v e r p r o d u c t i o n of p r o t e i n Hi from oprH on a plasmid 75 x i F i g u r e T i t l e Page 13. K i l l i n g of P_. aeruginosa, overproducing p r o t e i n HI from the oprH gene on a plasmid, by EDTA (+ T r i s ) 76 14. K i l l i n g of P. aeruginosa, overproducing p r o t e i n HI from the oprH gene on a plasmid, by polymyxin B 78 15. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m and Western immunoblot showing e x p r e s s i o n of p r o t e i n HI by P. aeruginosa grown i n chamber implants in mice 90 16. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m and Western immunoblot of c e l l envelopes of P_. aeruginosa and P. c h l o r a p h i s 94 17. Schematic diagrams of L P S - d i v a l e n t c a t i o n b i n d i n g s i t e s i n the OM of P. aeruginosa 114 x i i ABBREVIATIONS AgQQ absorbance at 600nm BM2 Basal Medium no. 2 DEAE d i e t h y l a m i n o e t h y l EDTA e t h y l e n e d i a m i n e t e t r a a c e t a t e kb k i l o b a s e p a i r s KDO 2-deoxy-D-manno-octulosonic a c i d (ketodeoxyoctonic acid) LB L u r i a - B e r t a n i broth LPS 1 i p o p o l y s a c c h a r i d e MIC minimum i n h i b i t o r y c o n c e n t r a t i o n MW molecular weight OM outer membrane PP2 Proteose Peptone no. 2 broth SDS-PAGE sodium d o d e c y l s u l p h a t e - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s T r i s - H C l tris(hydroxymethyl)aminomethane h y d r o c h l o r i d e x i i i ACKNOWLEDGEMENTS I warmly thank Bob Hancock f o r advice and encouragement, and my c o l l e a g u e s i n Bob's lab f o r h e l p f u l d i s c u s s i o n s and f o r p r o v i d i n g a working environment that was . . . w e l l , s t i m u l a t i n g to say the l e a s t . Barb Angus and Richard S i e h n e l were e s p e c i a l l y h e l p f u l . I thank a l s o the other members of the Department of M i c r o b i o l o g y who were of a s s i s t a n c e . The help and support I r e c e i v e d from Sandie Shewchuk i s g r e a t l y a p p r e c i a t e d . For f i n a n c i a l support at d i f f e r e n t times d u r i n g t h i s p r o j e c t I acknowledge the Science and E n g i n e e r i n g Research C o u n c i l (United Kingdom), Dr. R.E.W. Hancock, and the Canadian C y s t i c F i b r o s i s Foundation. x i v DEDICATION To Irene and Ian B e l l , my parents, f o r t h e i r i n v a l u a b l e c o n t r i b u t i o n s to my e d u c a t i o n . 1 INTRODUCTION 1. Pseudornonas aeruginosa Pseudomonas aeruginosa i s a m o t i l e , rod-shaped, asporogenous, Gram-negative bacterium. L i k e other members of i t s genus, i t can grow in simple mineral media at the expense of a wide v a r i e t y of sources of carbon and energy. I t i s u b i q u i t o u s i n the environment, e s p e c i a l l y i n s o i l , water, sediments, and a s s o c i a t e d with animals and o c c a s i o n a l l y p l a n t s ( P a l l e r o n i , 1981). P. aeruginosa i s b a s i c a l l y a saprophyte, but i n s p i t e of t h i s i t has become an i n c r e a s i n g l y important pathogen of humans. I t appears unable to i n i t i a t e i n f e c t i o n i n a h e a l t h y , u n i n j u r e d host, presumably because i t la c k s the necessary i n v a s i v e elements or i s s u s c e p t i b l e to defences on the s k i n and mucosa. However, i f host b a r r i e r s are breached by i n j u r y (e.g. burns, major surgery, eye i n j u r y ) or i f the immune system i s compromised by d i s e a s e or treatment (e.g. n e o p l a s i a , d i a b e t e s m e l l i t u s , immunosuppressive drug t h e r a p y ) , P. aeruginosa can cause d i s e a s e at v a r i o u s body s i t e s . Consequently, P_. aeruginosa i s almost e x c l u s i v e l y an o p p o r t u n i s t i c , nosocomial pathogen. I n f e c t i o n s by P. aeruginosa i n the u r i n a r y t r a c t , b lood, wounds, and the r e s p i r a t o r y t r a c t ( e s p e c i a l l y the congested lungs of c y s t i c 2 f i b r o s i s p a t i e n t s ) are now common and are a s s o c i a t e d with a high m o r t a l i t y r a t e (Young, 1984). Once e s t a b l i s h e d , P_. aeruginosa produces t o x i n s , p r o t e a s e s , l i p a s e s and p o l y s a c c h a r i d e slime l a y e r s that c o n t r i b u t e to i t s v i r u l e n c e (Doering et_ al_. , 1987). The i n t r i n s i c r e s i s t a n c e of P. aeruginosa to many a n t i m i c r o b i a l agents i s i n d i r e c t l y r e s p o n s i b l e f o r both the frequency and s e v e r i t y of i n f e c t i o n s by>this organism. I t s a b i l i t y to s u r v i v e and even grow i n the presence of some h o s p i t a l d i s i n f e c t a n t s (e.g. c e t r i m i d e ) c o n t r i b u t e s to i t s o f t e n r a p i d spread between p a t i e n t s . A l s o , P. aeruginosa i s r e s i s t a n t to many of the a n t i b i o t i c s used i n therapy of i n f e c t i o u s d i s e a s e s . Among the few e f f e c t i v e agents are aminoglycosides, some beta-lactams, quinolones ( G i l b e r t , 1985) and (f o r t o p i c a l use o n l y ) , polymyxins. P_. aeruginosa was r a r e l y i s o l a t e d as a pathogen before the i n t r o d u c t i o n of widespread a n t i b i o t i c therapy about 45 years ago (Weinstein, 1985). By c o n t r a s t , i t was estimated in 1984 to be the second most common h o s p i t a l pathogen i n the U.S.A. (Botzenhart and Rueden, 1987). Production of a n t i b i o t i c -i n a c t i v a t i n g enzymes such as aminoglycoside a c e t y l t r a n s f e r a s e s , and low p e r m e a b i l i t y of the outer membrane to a n t i b i o t i c s , are b e l i e v e d to be the two major p h y s i o l o g i c a l c h a r a c t e r i s t i c s c o n f e r r i n g high a n t i b i o t i c r e s i s t a n c e on most P. aeruginosa i s o l a t e s (Sabath, 1984; see 3 below). As t h i s t h e s i s i s about the l a t t e r , knowledge of the s t r u c t u r e and f u n c t i o n of the outer membrane w i l l be overviewed f i r s t , to pr o v i d e a background f o r d i s c u s s i o n of mechanisms of a n t i b i o t i c uptake and a c t i o n to f o l l o w . 2. The outer membrane of P. aeruginosa and other Gram- neg a t i v e b a c t e r i a a) General p r o p e r t i e s . The outer membrane (OM) of Gram-negative b a c t e r i a i s a 7.5nm-thick membrane that covers the e n t i r e s u r f a c e of the c e l l , l y i n g o u t s i d e the cy t o p l a s m i c (inner) membrane, p e r i p l a s m i c space and p e p t i d o g l y c a n l a y e r (Inouye, 1979). I t i s best d e s c r i b e d i n c e r t a i n E n t e r o b a c t e r i a c e a e such as E s c h e r i c h i a c o l i and Salmonella  typhimurium, but i t s p r o p e r t i e s are s i m i l a r i n P. aeruginosa and most other Gram-negative b a c t e r i a examined to date. Most of the present knowledge of outer membranes i s covered i n two recent reviews, by Nikaido and Vaara (1985) and (for P. aeruginosa i n p a r t i c u l a r ) by Nikaido and Hancock (1986), which are mentioned here to avoid r e p e t i t i v e c i t a t i o n s . The OM, l i k e other membranes, i s a l i p i d b i l a y e r c o n t a i n i n g p r o t e i n s . I t has s e v e r a l unique f e a t u r e s , however, one of which i s the presence of 1 i p o p o l y s a c c h a r i d e (LPS) i n i t s outer monolayer. C e r t a i n OM p r o t e i n s and l i p o p r o t e i n s are c o v a l e n t l y or n o n - c o v a l e n t l y attached to the p e p t i d o g l y c a n l a y e r , and there may be s i t e s of f u s i o n between 4 c y t o p l a s m i c and outer membranes. The OM can be c o n s i d e r e d the outermost l a y e r of the c e l l , although there may be polymeric networks o u t s i d e i t . b) P h o s p h o l i p i d . The p h o s p h o l i p i d composition of the OM i s s i m i l a r to that of the c y t o p l a s m i c membrane except that the OM c o n t a i n s more phosphatidylethanolamine. Phosphatidylethanolamine i s the major s p e c i e s of p h o s p h o l i p i d i n the P. aeruginosa OM, and the most abundant f a t t y a c i d components are hexadecanoic, hexadecenoic and octadecenoic a c i d s . The a v a i l a b l e data suggest that i n the E n t e r o b a c t e r i a c e a e , the p h o s p h o l i p i d s are c o n f i n e d to the inner monolayer of the OM, l e a v i n g the outer monolayer to have LPS as i t s major, i f not s o l e , l i p i d i c component. Since the p r o p e r t i e s of LPS i n some s p e c i e s confer on the c e l l r e s i s t a n c e to hydrophobic compounds, detergents and phospholipases (see below), and such r e s i s t a n c e i s a l s o c h a r a c t e r i s t i c of P. aeruginosa, t h i s s p e c i e s too probably l a c k s p h o s p h o l i p i d i n i t s outer monolayer. Patches of p h o s p h o l i p i d i n the outer monlayer have been repor t e d , however ( G i l l e l a n d et_ al^. , 1973). P o s s i b l y , the c o n d i t i o n s of growth determine whether or not p h o s p h o l i p i d i s present i n the outer monolayer. c) L i p o p o l y s a c c h a r i d e and d i v a l e n t c a t i o n s . LPS are amphipathic molecules, with hydrophobic l i p i d p o r t i o n s anchored i n the outer monolayer of the OM and h y d r o p h i l i c 5 p o l y s a c c h a r i d e p o r t i o n s p r o t r u d i n g i n t o the surrounding medium. LPS c o n s i s t s of three domains: l i p i d A, core o l i g o s a c c h a r i d e , and 0 s i d e chain p o l y s a c c h a r i d e (O-antigen). S t r u c t u r a l analyses of LPS molecules have been l i m i t e d by the h e t e r o g e n e i t y of LPS and incomplete knowledge of the chemistry of some of i t s unusual components (Wilkinson, 1983). However, improved techniques of carbohydrate chemistry, the i s o l a t i o n of mutants with a l t e r e d LPS and the 31 a p p l i c a t i o n of p h y s i c o - c h e m i c a l techniques such as P-n u c l e a r magnetic resonance spectroscopy have improved our understanding of LPS s t r u c t u r e , although knowledge of P. aeruginosa LPS has lagged behind that of the E n t e r o b a c t e r i a c e a e . The l i p i d A of P_. aeruginosa probably c o n s i s t s of a 4-phosphoglucosaminyl-glucosamine-l-phosphate d i s a c c h a r i d e with a beta 1-^6 l i n k a g e , to which about seven f a t t y - a c y l chains are attached by e s t e r and amide l i n k a g e s . The f a t t y a c i d s present are mainly dodecanoic, hydroxydecanoic and hydroxydodecanoic a c i d s , and are attached e i t h e r d i r e c t l y to the backbone or to hydroxyl groups of neighbouring f a t t y - a c y l c h a i n s (Wilkinson, 1983; K r o p i n s k i e_t a_l. , 1985). The f a t t y -a c y l chains extend i n t o the i n t e r i o r of the OM. The core o l i g o s a c c h a r i d e i s s o - c a l l e d because, u n l i k e the 0 p o l y s a c c h a r i d e , i t i s present i n a l l LPS molecules. It i s a ttached to a l i p i d A glucosamine r e s i d u e , by e s t e r l i n k a g e , to the f i r s t r e s i d u e of 3-deoxy-D-manno-octulosonic a c i d (KDO) i n the core. The exact arrangement of residues and s u b s t i t u e n t s v a r i e s between s t r a i n s , but most s t r a i n s probably have a core s i m i l a r to that of P. aeruginosa PA01, which i s shown i n F i g u r e 1. Current data suggest that there are between 10 and 16, and p o s s i b i l i t y even more, phosphate groups per core o l i g o s a c c h a r i d e i n P. aerugjnosa, compared with 4-7 i n E n t e r o b a c t e r i a c e a e . P_. aeruginosa mutants d e f i c i e n t i n p a r t s of the core o l i g o s a c c h a r i d e as w e l l as 0 a n t i g e n have been p a r t l y c h a r a c t e r i z e d (Figure 1). By analogy with the well-understood s e r i e s of mutants of S_. typhimurium, these are c a l l e d "rough" or "deep-rough" depending on how much core i s absent. The composition of the 0 s i d e c h a i n p o l y s a c c h a r i d e v a r i e s g r e a t l y between s t r a i n s , and t h i s h e t e r o g e n e i t y i s the b a s i s f o r the I n t e r n a t i o n a l A n t i g e n i c Typing Scheme s e r o t y p i n g of P. aeruginosa i s o l a t e s (see K n i r e l e_t a l . , 1988). A wide v a r i e t y of n e u t r a l , amino-, and a c i d i c sugars, some unique, are found i n P. aeruginosa ( K n i r e l e_t a l . , 1988). These are arranged i n unbranched t r i - or t e t r a -s a c c h a r i d e repeat u n i t s , and most of the amino sugars are N-a c e t y l a t e d . The number of repeat u n i t s attached to a core v a r i e s between molecules i n a s i n g l e c e l l . C e r t a i n numbers of u n i t s are more common than o t h e r s , and only 0.2-20% of molecules have s i d e chains at a l l (Hancock, et a l . , 1983; 7 CORE 0.9 Ala, 2 EtNPCv 8 P0 4 LIPID A KDO-KDO-Hep-Hep-\ / \ /. (KDO) (Hep) AK 1282 -GalN-I A l a 0 2 AK 1012 -Glc.Rha-AK < 1401 AK1414, H222 -O-ANTIGEN Figure J^ . Tentative structure of the core oligosaccharide of LPS i n P_. aeruginosa PA01 and d e r i v a t i v e s . The st r u c t u r e shown i s an "average" one; f r a c t i o n s (e.g. A l a g 2) indic a t e approximate frequency of s u b s t i t u t i o n i n a population of molecules, and the presence of residues i n parentheses i s v a r i a b l e . The substituents above the h o r i z o n t a l l i n e are attached to the core residues i n uncertain loc a t i o n s . The phosphate content shown may be an underestimate. LPS-altered rough mutants AK1282 (deep-rough), AK1012 and AK1401 (semi-rough) are believed to be d e f i c i e n t i n structure to the right of the bold v e r t i c a l l i n e s beside each s t r a i n name. AK1414 core i s probably intermediate i n structure between AK1012 and AK1401. Preliminary evidence suggested that H222 may be s i m i l a r to AK1414. Ala, Li-alanine; EtN, ethanolamine; PO4, phosphate; KDO, 3-deoxy-D-manno-octulbsonic acid ; Hep, heptose (probably L-glycero-D-manno-heptose); GalN, D-galactosamine; Glc, p_-glucose. Information i s from Kropinski et a l . , 1979 and 1985; Berry and Kropinski, 1986; and t h i s study. 8 K r o p i n s k i et a l . , 1985; R i v e r a et_ al_. , 1988). Mutants p o s s e s s i n g f u l l core o l i g o s a c c h a r i d e s but l a c k i n g O-antigen are u s u a l l y c a l l e d "semi-rough." The i n v e s t i g a t i o n of LPS s t r u c t u r e i n P. aeruginosa was 1 f u r t h e r complicated by the d i s c o v e r y of a d i s t i n c t sub-p o p u l a t i o n of LPS molecules. These molecules, c a l l e d "A-bands" by R i v e r a et^ a^. (1988) and p o s s i b l y r e l a t e d to n e u t r a l s u g a r - r i c h LPS f r a c t i o n s r e p o r t e d b e f o r e , can be separated from the m a j o r i t y of LPS molecules ("B-bands") by g e l e x c l u s i o n chromatography. The A-bands comprise 10-15% by weight of t o t a l LPS. They are c h e m i c a l l y d i s t i n c t from B-bands, c o n t a i n i n g s h o r t e r p o l y s a c c h a r i d e s i d e c h a i n s , fewer amino-sugars, and sulphate i n s t e a d of phosphate. The two types are a l s o a n t i g e n i c a l l y d i s t i n c t , and A-bands are a p p a r e n t l y more h i g h l y conserved among P_. aeruginosa s t r a i n s (Rivera and McGroarty, 1989). LPS i s s t r o n g l y a s s o c i a t e d with d i v a l e n t c a t i o n s such as 2+ 2+ Mg and Ca i n the OM. These act as c o u n t e r - i o n s to the n e g a t i v e l y - c h a r g e d phosphate and c a r b o x y l groups i n LPS. As shown by the profoundly d i s r u p t i v e e f f e c t s of the d i v a l e n t c a t i o n - c h e l a t o r e t h y l e n e d i a m i n e t e t r a a c e t a t e (EDTA; see below), these c a t i o n s are e s s e n t i a l to the s t a b i l i t y of i n t e r a c t i o n between adjacent LPS molecules and the i n t e g r i t y of the OM. The LPS, c r o s s b r i d g e d by d i v a l e n t c a t i o n s , forms a charged, h y d r o p h i l i c l a y e r d i f f e r e n t from the s u r f a c e of a pure p h o s p h o l i p i d membrane. This allows the OM to exclude hydrophobic compounds and to r e s i s t the b a c t e r i o c i d a l e f f e c t s of serum. Deep-rough mutants, and some s t r a i n s of N e i s s e r i a and Haemophilus that have rough-type LPS, are more s u s c e p t i b l e to these agents. T h e r e f o r e , LPS together with d i v a l e n t c a t i o n s i s a major component of the outer membrane p e r m e a b i l i t y b a r r i e r , which i s d i s c u s s e d i n more d e t a i l below. LPS b i o s y n t h e s i s occurs at the c y t o p l a s m i c membrane. B r i e f l y , l i p i d A i s c o n s t r u c t e d by the a d d i t i o n of f a t t y a c i d s to UDP-sugars, core sugars are added i n stepwise f a s h i o n , and O-antigen repeat u n i t s are added with the a i d of a g l y c o s y l c a r r i e r l i p i d ( G a b r i e l , 1987). LPS may be t r a n s f e r r e d to the OM at zones where the cy t o p l a s m i c membrane attaches to the OM. d) P r o t e i n s . P r o t e i n s make up n e a r l y , h a l f of the mass of the OM. The OM co n t a i n s a l a r g e number of p r o t e i n s p e c i e s , but a few (the major OM p r o t e i n s ) are dominant. In P_. aeruginosa, up to nine major OM p r o t e i n s are produced, depending on growth c o n d i t i o n s . S e v e r a l of these p r o t e i n s form p o r i n s ( w a t e r - f i l l e d channels of 0.6-2.3nm diameter) i n model membrane systems (e.g. liposomes) and probably i n whole c e l l s . P r o t e i n F forms n o n - s p e c i f i c channels (Hancock e_t a l . , 1979), the phosphate s t a r v a t i o n - i n d u c i b l e p r o t e i n P forms small a n i o n - s p e c i f i c channels (Hancock et a l . , 1982a), 10 the g l u c o s e - i n d u c i b l e p r o t e i n DI forms glucose uptake channels (Hancock and Carey, 1980; T r i a s ejb a_l_. , 1988), and p r o t e i n D2 forms channels that are s e l e c t i v e f o r the beta-lactam imipenem ( T r i a s e_t a l . , 1989). P r o t e i n s C and E have a l s o been reported to be p o r i n s (Yoshihara and Nakae, 1989). P r o t e i n F and l i p o p r o t e i n s H2 and I are a s s o c i a t e d with p e p t i d o g l y c a n and presumably p l a y s t r u c t u r a l r o l e s (Woodruff and Hancock, 1989; Hancock et_ al_. , 1981a). P r o t e i n Hi i s i n d u c i b l e by growth i n d i v a l e n t c a t i o n - d e f i c i e n t c o n d i t i o n s (Nicas and Hancock, 1980) and i s d i s c u s s e d i n d e t a i l below. The f u n c t i o n of p r o t e i n G i s unknown. Most of the major OM p r o t e i n s seem to be well-conserved between s t r a i n s (Mutharia et a l . , 1982). In a d d i t i o n to these major p r o t e i n s , the OM of P_. aeruginosa c o n t a i n s i r o n s t a r v a t i o n - i n d u c i b l e p r o t e i n s , presumably i n v o l v e d i n uptake of i r o n c h e l a t e s , and e s t e r a s e and phospholipase enzymes. Proteases and a p r o t e i n i n v o l v e d i n v i t a m i n B.^ uptake have been d e s c r i b e d i n other s p e c i e s . The major OM p r o t e i n s d e s c r i b e d are a l l b e l i e v e d to be i n t e g r a l to the OM of P_. aeruginosa. P r o t e i n s DI, D2 and F, and p o s s i b l y o t h e r s , are surface-exposed (Lambert and Booth, 1982; Mutharia and Hancock, 1983). P r o t e i n s DI, F and P a p p a r e n t l y form t r i m e r i c aggregates. S e v e r a l p r o t e i n s (Dl, D2, F, G and HI) are f a i r l y r e s i s t a n t to complete d e n a t u r a t i o n by b o i l i n g i n sodium dodecyl sulphate (SDS), and so are " h e a t - m o d i f i a b l e " on SDS-polyacrylamide g e l s . The 11 i n a t i v e secondary s t r u c t u r e s , determined by c i r c u l a r d i c h r o i s m , were mainly beta-sheet f o r d e t e r g e n t - s o l u b i 1 i z e d p r o t e i n s F and P and mainly a l p h a - h e l i x f o r l i p o p r o t e i n I (Mizuno and Kageyama, 1979a and b; Worobec et^ al_. , 1988). OM p r o t e i n s are s y n t h e s i z e d on cyt o p l a s m i c membrane-bound polyribosomes and exported to the 0Mf p o s s i b l y at s i t e s of adhesion between the cyt o p l a s m i c membrane and 0Mf accompanied by cleavage of leader ( s i g n a l ) p eptides from N-t e r m i n i of the p r o t e i n s (Randall et_ al_. , 1987). OM p r o t e i n s presumably i n t e r a c t with LPS and ph o s p h o l i p i d s to maintain the i n t e g r i t y of the membrane. C e r t a i n LPS mutations a f f e c t the p r o t e i n composition of the j OM, and sometimes r e c e p t o r s f o r bacteriophage a d s o r p t i o n or co n j u g a t i o n are a combination of LPS and p r o t e i n . However, i t i s d i f f i c u l t to measure protein-LPS i n t e r a c t i o n s d i r e c t l y . P r o t e c t i o n by LPS from d e n a t u r a t i o n and p r o t e o l y s i s has been demonstrated f o r the OmpA p r o t e i n of E. c o l i (Schweizer et^ a l . , 1978). Beher et_ a_l. (1980) measured b i n d i n g of OmpA to LPS-coated e r y t h r o c y t e s , and r e c e n t l y B o r n e l e i t ejb a l . (1989) used an a f f i n i t y e l e c t r o p h o r e s i s system to measure protein-LPS i n t e r a c t i o n s i n A c i n e t o b a c t e r c a l c o a c e t i c u s . The rele v a n c e of these methods to protein-LPS i n t e r a c t i o n s i n i n t a c t c e l l s remains to be e s t a b l i s h e d . However, i n P_. aeruginosa a s s o c i a t i o n of p r o t e i n F with LPS has been demonstrated by chemical c r o s s l i n k i n g and by crosse d 12 Immunoelectrophoresis techniques (Lam et a_l., 1983). Techniques of molecular c l o n i n g and heterologous gene ex p r e s s i o n have advanced knowledge of the s t r u c t u r e and f u n c t i o n of OM p r o t e i n s of v a r i o u s b a c t e r i a . P_. aeruginosa p r o t e i n s F and P were cloned and expressed i n E. c o l i , and the p r o t e i n s i s o l a t e d from E. c o l i formed channels i n l i p i d b i l a y e r s (Woodruff et a l . , 1986; S i e h n e l e_t a_l., 1988a). Sequences of p r o t e i n s F (Duchene et_ a_l. , 1988) and I ( C o r n e l l s e_t a^. , 1989) have been analy s e d . The cloned gene fo r p r o t e i n F was mutated by i n s e r t i o n of a s e l e c t a b l e DNA fragment, introduced i n t o P. aeruginosa to r e p l a c e the w i l d -type gene, and the r e s u l t i n g mutant used to c l a r i f y the r o l e of the p r o t e i n i n a n t i b i o t i c uptake and i n maintenance of c e l l shape (Woodruff and Hancock, 1988, 1989). e) Functions of the outer membrane. P h o s p h o l i p i d b i l a y e r s are u s u a l l y permeable to hydrophobic a n t i b i o t i c s (e.g. m a c r o l i d e s , r i f a m y c i n s , actinomycin D), hydrophobic dyes (e.g. methylene blue) and detergents (e.g. b i l e s a l t s , T r i t o n X-100) and s u s c e p t i b l e to degradation by p h o s p h o l i p a s e s . The presence of w i l d - t y p e LPS i n the outer monolayer allows the OM of P_. aeruginosa to r e s i s t these agents. T h i s r e s i s t a n c e i s l o s t i n deep-rough mutants (e.g. AK1282, F i g u r e 1), as a r e s u l t e i t h e r of appearance of p h o s p h o l i p i d i n the outer monolayer or of weakening of i n t e r a c t i o n s between adjacent LPS molecules. H y d r o p h i l i c 13 compounds (e.g. most beta-lactams, t e t r a c y c l i n e , chloramphenicol) presumably cross the OM through the v a r i o u s p o r i n channels. However, h y d r o p h i l i c p e r m e a b i l i t y i s g e n e r a l l y l i m i t e d to compounds small enough to pe n e t r a t e the channels and c o n t a i n i n g the c o r r e c t charge, shape or s p e c i f i c chemical groups r e q u i r e d to pass through channels that are s e l e c t i v e . In t h i s way, the OM ac t s as a s e l e c t i v e p e r m e a b i l i t y b a r r i e r , a l l o w i n g i n f l u x of n u t r i e n t s (sometimes v i a s p e c i f i c t r a n s p o r t pathways) and e f f l u x of waste products, while e x c l u d i n g many harmful compounds to which Gram-negative b a c t e r i a are exposed. P_. aeruginosa, moreover, has i n d u c i b l e mechanisms f o r the uptake of hydrophobic substances such as the hydrocarbon hexadecane (on which i t w i l l grow, s l o w l y , as s o l e carbon and energy source; Miguez et a 1. , 1986), so p e r m e a b i l i t y i s not l i m i t e d to small h y d r o p h i l i c s u b s t r a t e s . However, the p e r m e a b i l i t y b a r r i e r can be d i s r u p t e d by c e r t a i n agents, as w i l l be d i s c u s s e d i n d e t a i l below. Besides p r o v i d i n g a s u b s t a n t i a l b a r r i e r to a n t i b i o t i c p e n e t r a t i o n , the OM p l a y s other r o l e s important i n human i n f e c t i o n . The l i p i d A p o r t i o n of LPS i s r e s p o n s i b l e f o r the v a r i o u s t o x i c e f f e c t s of P_. aeruginosa endotoxin. The he t e r o g e n e i t y of LPS 0 s i d e c h a i n s , the major a n t i g e n i c s t r u c t u r e s , renders an antibody response to the s u r f a c e of one s t r a i n n o n - p r o t e c t i v e a g a i n s t o t h e r s . The LP S - d i v a l e n t 14 c a t i o n s u r f a c e s t r u c t u r e a l s o makes P_. aeruginosa h i g h l y r e s i s t a n t to k i l l i n g by serum and complement (Hancock, 1985). i'" 3. A n t i b i o t i c s u s c e p t i b i l i t y and r e s i s t a n c e i n P. aeruginosa a) A n t i b i o t i c a c t i o n and r e s i s t a n c e . P_. aeruginosa i s s u s c e p t i b l e or r e s i s t a n t to a n t i b a c t e r i a l a n t i b i o t i c s f o r many of the same reasons as are other b a c t e r i a . An e f f e c t i v e a n t i b i o t i c must be abl e to reach i t s t a r g e t i n the c e l l i n s u f f i c i e n t c o n c e n t r a t i o n s to cause an i n h i b i t o r y or k i l l i n g e f f e c t ; t h i s may r e q u i r e p e n e t r a t i o n of the outer membrane and sometimes the cyto p l a s m i c membrane, by membrane d i s r u p t i o n , entry' v i a n o n - s p e c i f i c t r a n s p o r t systems such as some p o r i n s , or e n t r y v i a t r a n s p o r t systems; spec i f i c f o r molecules s t r u c t u r a l l y s i m i l a r to the a n t i b i o t i c . The a n t i b i o t i c must then be a c t i v e enough, given the i c o n c e n t r a t i o n a v a i l a b l e at the t a r g e t s i t e , to i n h i b i t or d i s r u p t i t s t a r g e t s u f f i c i e n t l y to cause a b a c t e r i o s t a t i c or b a c t e r i o c i d a l e f f e c t . For example, beta-lactam a n t i b i o t i c s a f f e c t t a r g e t molecules concerned with p e p t i d o g l y c a n b i o s y n t h e s i s l o c a t e d at the cy t o p l a s m i c membrane, causing m o r p h o l o g i c a l a b e r r a t i o n s due to c e l l w a l l weakening, growth i n h i b i t i o n , and c e l l l y s i s . To achieve t h i s s u c c e s s f u l l y , the beta-lactam molecules must cr o s s the OM i n s u f f i c i e n t q u a n t i t i e s . In a human host, a n t i b i o t i c s need to be e f f e c t ive a g a i n s t b a c t e r i a that have p r o p e r t i e s that are 15 d i f f e r e n t from those of b a c t e r i a grown i n v i t r o (e.g. K e l l y et a l . , 1989), and the drug must have the necessary pharmacokinetic p r o p e r t i e s to reach the s i t e of i n f e c t i o n i n c o n c e n t r a t i o n s s u f f i c i e n t to i n h i b i t or k i l l the t a r g e t b a c t e r i a , but not e x c e s s i v e enough to cause t o x i c i t y to the host i t s e l f . R e s i s t a n c e to a n t i b i o t i c s may be g e n e t i c or adaptive; the former may be passed on to progeny of the r e s i s t a n t c e l l i n the absence of a n t i b i o t i c , and so i s the r e s u l t of some a l t e r a t i o n i n DNA, but the l a t t e r i s merely a temporary change i n c e l l p h y s i o l o g y that d i s a p p e a r s soon a f t e r removal of the a n t i b i o t i c . Genetic r e s i s t a n c e may be i n t r i n s i c (e.g. a p r o p e r t y of most s t r a i n s of a sp e c i e s ) or acq u i r e d ( i . e . the r e s u l t of mutation, DNA rearrangement or new DNA a c q u i s i t i o n ) . Some of the common mechanisms of r e s i s t a n c e can be i l l u s t r a t e d by t a k i n g beta-lactam a n t i b i o t i c s as an example. R e s i s t a n t c e l l s may i n a c t i v a t e the beta-lactam u s i n g a p e r i p l a s m i c enzyme, may s y n t h e s i z e an a l t e r e d t a r g e t ( p e n i c i l l i n - b i n d i n g p r o t e i n ) that binds l e s s of the drug, may have reduced OM p e r m e a b i l i t y to the drug, or may use a combination of these (Sabath, 1984). In P_. aeruginosa, reduced OM p e r m e a b i l i t y i s b e l i e v e d to be a s i g n i f i c a n t cause of i n t r i n s i c , a c q u i r e d , and adaptive r e s i s t a n c e to a n t i b i o t i c s (Hancock, 1984), but, because of d i f f i c u l t i e s i n st u d y i n g p e r m e a b i l i t y , the p r e c i s e mechanisms have r a r e l y 16 been e x p l a i n e d . The pathways of a n t i b i o t i c uptake w i l l be co n s i d e r e d below, but f i r s t , the e f f e c t s of c e r t a i n a n t i b a c t e r i a l agents important i n t h i s study w i l l be reviewed. b) E f f e c t s of c h e l a t o r s and p o l y c a t i o n s on c e l l s . As mentioned above, EDTA and other c h e l a t o r s of d i v a l e n t c a t i o n s (e.g. n i t r i l o t r i a c e t a t e ) have profound e f f e c t s on OM s t r u c t u r e (Nikaido and Vaara, 1985). EDTA ( i n the presence of T r i s b u f f e r ) causes r e l e a s e of LPS and p e r i p l a s m i c p r o t e i n s , m o r p h o l o g i c a l a l t e r a t i o n s i n the c e l l s u r f a c e as seen by f r e e z e - f r a c t u r e e l e c t r o n microscopy, enhanced s u s c e p t i b i l i t y to lysozyme, detergents and hydrophobic compounds, enhanced OM p e r m e a b i l i t y to the beta-lactam n i t r o c e f i n , and (at high c o n c e n t r a t i o n ) c e l l l y s i s . The c h e l a t i o n by EDTA of d i v a l e n t c a t i o n s a s s o c i a t e d with a n i o n i c LPS i s b e l i e v e d to d i s r u p t LPS-LPS i n t e r a c t i o n s , perhaps by i n c r e a s i n g e l e c t r o s t a t i c r e p u l s i o n between adjacent molecules. P o s s i b l y , p h o s p h o l i p i d r e p l a c e s the r e l e a s e d LPS in the outer monolayer, enhancing hydrophobic uptake (Nikaido and Vaara, 1985). Since i t enhances uptake of v a r i o u s compounds across the OM of P_. aeruginosa (Nikaido and Hancock, 1986), EDTA has been c a l l e d a permeabi1izer (a compound that i n c r e a s e s OM p e r m e a b i l i t y ) . Polymyxin B, a p o l y c a t i o n i c decapeptide with a f a t t y -a c y l t a i l , a c t s p r i m a r i l y on c y t o p l a s m i c membrane l i p i d s , 17 c a u s i n g l e a k i n e s s of the membrane (Hancock and Nicas, 1984). Polymyxin B i s too l a r g e to pass through most p o r i n s , but crosses the OM with c o n s i d e r a b l e d i s r u p t i o n (causing m o r p h o l o g i c a l a b e r r a t i o n s such as b l e b b i n g , and s e n s i t i z a t i o n of c e l l s to lysozyme, detergents, and hydrophobic agents), which may be a s u b s t a n t i a l component of i t s l e t h a l a c t i o n on c e l l s (Nikaido and Vaara, 1985). Polymyxin B binds LPS with high a f f i n i t y ( k^ of approximately 0.4uM; Moore et a l . , 1986) and enhances h y d r o p h i l i c as w e l l as hydrophobic uptake, so i s a l s o a permeabi 1 i z e r of the P_. aeruginosa OM. Deacylated polymyxin B i s a l s o a potent p e r m e a b i l i z e r , but i s much l e s s t o x i c to b a c t e r i a (Nikaido and Vaara, 1985). This i m p l i e s that the p o l y c a t i o n i c p e p t i d e , with i t s seven-amino a c i d r i n g s t r u c t u r e , i s s u f f i c i e n t f o r p e r m e a b i 1 i z a t i o n , but the f a t t y - a c y l t a i l i s r e q u i r e d f o r i n s e r t i o n i n t o p h o s p h o l i p i d membranes l e a d i n g to l e t h a l breakdown of cy t o p l a s m i c membrane i n t e g r i t y . In a d d i t i o n to i n t a c t and d e a c y l a t e d polymyxin B, a v a r i e t y of p o l y c a t i o n i c compounds p e r m e a b i l i z e the OM of P_. aeruginosa (Hancock and Wong, 1984). The group i n c l u d e s a n t i b i o t i c s of the a m i n o g l y c o s i d e / a m i n o c y c l i t o l group, such as gentamicin, streptomycin, and tobramycin. Although these drugs have long been known to a f f e c t p r o t e i n s y n t h e s i s , they have a v a r i e t y of other e f f e c t s on c e l l s i n c l u d i n g OM damage (Hancock 1981a and b; D a l h o f f , 1987). A t h i r d c l a s s of 18 compounds, monovalent o r g a n i c c a t i o n s (such as T r i s and c e t r i m i d e ) can p e r m e a b i l i z e the P. aeruginosa OM at high c o n c e n t r a t i o n s (Hancock and Wong, 1984). The permeabi1izer 2+ 2+ compounds are g e n e r a l l y antagonized by added Mg and Ca Taken to g e t h e r , the data suggest that permeabi1izers are l i k e l y to e x e r t t h e i r a c t i o n p r i m a r i l y by d i s r u p t i o n of LPS-d i v a l e n t c a t i o n b i n d i n g s i t e s at the OM s u r f a c e (Hancock, 1984), e i t h e r by c h e l a t i o n (e.g. EDTA) or c o m p e t i t i v e displacement of d i v a l e n t c a t i o n s (e.g. p o l y c a t i o n s ) . The l a t t e r has been shown by s t u d i e s of i n t e r a c t i o n of d a n s y l -polymyxin, a f l u o r e s c e n t l y - l a b e l e d polymyxin B d e r i v a t i v e , with LPS (Moore et a l . , 1986). However, the d i f f e r e n t e f f e c t s of d i f f e r e n t permeabi1izers (e.g. i n competition with dansy1-polymyxin f o r b i n d i n g s i t e s on LPS) suggest that not a l l L P S - d i v a l e n t c a t i o n b i n d i n g s i t e s have the same s u s c e p t i b i l i t y to a given agent. c) A n t i b i o t i c uptake pathways. The p o r i n pathway of uptake i s a v a i l a b l e to some small h y d r o p h i l i c a n t i b i o t i c s , as d e s c r i b e d above. In E. c o l i , aminoglycosides have been assumed to pass through p o r i n s (Nakae and Nakae, 1982; but see N i k a i d o and Vaara, 1985 f o r a c r i t i q u e of t h i s work), but the mechanism of uptake may be d i f f e r e n t i n P_. aeruginosa at l e a s t (see below). P o r i n - d e f i c i e n t mutants of E n t e r o b a c t e r i a c e a e and P_. aeruginosa are more r e s i s t a n t to some beta-lactam a n t i b i o t i c s , t e t r a c y c l i n e , chloramphenicol 19 and n o r f l o x a c i n (Hancock and B e l l , 1988). One of the reasons f o r the high i n t r i n s i c a n t i b i o t i c r e s i s t a n c e of P_. aeruginosa compared with E. c o l i may be that at any given time, most molecules of p r o t e i n F (the major p o r i n of P. aeruginosa) adopt a conformation that g i v e s c l o s e d or very narrow channels (Nikaido and Hancock, 1986) . A second pathway of uptake, p a r t i t i o n of moderately hydrophobic a n t i b i o t i c s i n t o the OM i n t e r i o r , i s v i r t u a l l y n o n - e x i s t e n t i n w i l d - t y p e P. aeruginosa, as d e s c r i b e d above. This can be shown by experiments with a hydrophobic probe, 1-N-phenylnaphthylamine, that f l u o r e s c e s upon p e n e t r a t i o n of membranes (Loh e_t al^. , 1984). I t s uptake can be enhanced by deep-rough mutations and by a d d i t i o n of permeabi1izers, as mentioned above. A t h i r d a n t i b i o t i c uptake pathway, self-promoted uptake, was r e c e n t l y p o s t u l a t e d to occur f o r polymyxin B, aminoglycosides and EDTA + T r i s i n P. aeruginosa and p o s s i b l y other s p e c i e s . Chemically-induced mutants of P_. aeruginosa c r o s s - r e s i s t a n t to EDTA + T r i s , polymyxin B and aminoglycosides were i s o l a t e d ( s t r a i n s H181 and H185; Nicas and Hancock, 1980) and found to overproduce c o n s t i t u t i v e l y an OM p r o t e i n , H i , by up to 2 4 - f o l d . Wild-type c e l l s grown i n 2+ 2+ media d e f i c i e n t i n c e r t a i n d i v a l e n t c a t i o n s (Mg , Ca , 2+ 2+ Mn , Sr ) had s i m i l a r r e s i s t a n c e p r o p e r t i e s and were induced f o r p r o t e i n Hi e x p r e s s i o n (Nicas and Hancock, 1980, 20 1983b). C e l l s with mutational o v e r p r o d u c t i o n of p r o t e i n Hi d i s p l a y e d a l t e r e d k i n e t i c s of streptomycin uptake (Hancock et 2 + a l . , 1981b) and had reduced Mg l e v e l s i n t h e i r c e l l envelopes (Nicas and Hancock, 1980). There was no change, however, i n s u s c e p t i b i l i t y to other a n t i b i o t i c s such as toeta-lactams and t e t r a c y c l i n e s , or i n the outer memhrane p e r m e a b i l i t y to the beta-lactam n i t r o c e f i n (Nicas and Hancock, 1983a). I t was concluded that p r o t e i n Hi probably i n h i b i t s a common uptake pathway that i s e s s e n t i a l to the b a c t e r i o c i d a l a c t i o n of p o l y c a t i o n s and EDTA + T r i s . Since these compounds are known to d i s r u p t L P S - d i v a l e n t c a t i o n i n t e r a c t i o n s and p e r m e a b i l i z e the OM (see above), they could presumably enhance t h e i r own uptake. P r o t e i n Hi i s hypothesized to i n h i b i t self-promoted uptake by r e p l a c i n g d i v a l e n t c a t i o n s at n e g a t i v e l y charged s i t e s on LPS. The p r o t e i n , being s t a b l y anchored i n the membrane, could not be d i s p l a c e d by the permeabi1izers, and thus c o u l d prevent membrane d i s r u p t i o n and consequent uptake of the d i s r u p t i n g p o l y c a t i o n . These c o n c l u s i o n s were d i s p u t e d by G i l l e l a n d and Conrad (1982), who reported other changes i n OM p r o t e i n s and l i p i d s •i i n H181 and H185, and demonstrated decreased l e v e l s of p r o t e i n HI i n these s t r a i n s when grown i n s u b - i n h i b i t o r y c o n c e n t r a t i o n s of polymyxin B. They proposed that the mechanism of r e s i s t a n c e i n the mutants i s s i m i l a r to that 21 found i n P. aeruginosa that was made a d a p t i v e l y - r e s i s t a n t by growing i n polymyxin B, i n v o l v i n g changes i n p h o s p h o l i p i d content caused by reduced d i v a l e n t c a t i o n c o n c e n t r a t i o n s i n the c e l l envelope ( G i l l e l a n d e_t al_. , 1984). However, Moore et a l . (1984) drew a d i s t i n c t i o n between mutational a l t e r a t i o n i n the i n i t i a l s u s c e p t i b i l i t y of a s t r a i n to polymyxin B (mimicked by growth i n d i v a l e n t c a t i o n - d e f i c i e n t medium), and adaptive a l t e r a t i o n s o c c u r r i n g i n c u l t u r e s growing i n the presence of the drug. T h e i r more thorough study f a i l e d to demonstrate changes i n the mutants H181 and H185, other than t h e i r o v e r p r o d u c t i o n of p r o t e i n H i , that could account f o r the r e s i s t a n t phenotype. Moreover, Nicas and Hancock (1983b) had shown that p r o t e i n HI l e v e l s corresponded w e l l with ( i n i t i a l ) s u s c e p t i b i l i t y to polymyxin B and E D T A when c e l l s were s h i f t e d from low to high 2+ c o n c e n t r a t i o n s of Mg Recently, Said e_t al_. (1987) f a i l e d to f i n d a r e l a t i o n s h i p between s u s c e p t i b i l i t y to polymyxin B and E D T A and l e v e l s of p r o t e i n HI.in twelve c l i n i c a l i s o l a t e s of P. a e r u g i n o s a . However, t h e i r data only c o n f i r m that f a c t o r s other than p r o t e i n Hi are i n v o l v e d i n s u s c e p t i b i l i t y or r e s i s t a n c e to those agents, and underscore the need f o r study of the e f f e c t s of p r o t e i n HI o v e r p r o d u c t i o n independent of other v a r i a b l e s . A somewhat s i m i l a r type of mutation has been d e s c r i b e d 22 i n S almonella typhimurium (Makela ejt a_l., 1978). The pmrA mutants were r e s i s t a n t to k i l l i n g and p e r m e a b i l i z a t i o n by polymyxin B and EDTA + T r i s , a p p a r e n t l y owing to ov e r p r o d u c t i o n of 4-aminoarabinose and ethanolamine, which reduced the net negative charges on LPS (Vaara et al_. , 1981). Peterson et_ a K (1987) found that polymyxin B - r e s i s t a n t mutants of E. c o l i (Meyers et a_l. , 1974) a l s o had LPS with a lower net negative charge, owing to i n c r e a s e d e s t e r i f i c a t i o n of phosphate groups i n the l i p i d A and core r e g i o n s . In n e i t h e r s et of mutants, however, was o v e r p r o d u c t i o n of an OM p r o t e i n i n v o l v e d . Chapman and Georgopapadokou (1988) have r e c e n t l y suggested that the quinolone a n t i b i o t i c f l e r o x a c i n , which may act as a c h e l a t o r of d i v a l e n t c a t i o n s , c r o s s e s the OM of E. c o l i i n p a r t by the self-promoted uptake pathway. The pathway i s a l s o i m p l i c a t e d i n the uptake of the p o l y c a t i o n i c a n t i b i o t i c s t r e p t o t h r i c i n i n E_. c o l i (Seltmann and Walter, 1987) and of p o l y c a t i o n i c p e p t i d e s from macrophages (Sawyer et a l . , 1988). These o b s e r v a t i o n s and the s i m i l a r p r o p e r t i e s of OM of d i f f e r e n t Gram-negative s p e c i e s (see above) suggest that the self-promoted pathway may operate i n s p e c i e s other than P. aeruginosa. The p r e c i s e molecular nature of the uptake process f o l l o w i n g d i s r u p t i o n of LPS-cation i n t e r a c t i o n s remains obscure, and i t s e l u c i d a t i o n probably depends on a b e t t e r 23 understanding of abnormal s t r u c t u r e s i n LPS-c o n t a i n i n g membranes. There i s e l e c t r o n m i c r o s c o p i c evidence f o r the accumulation of t r a n s i e n t holes i n g e n t a m i c i n - t r e a t e d outer membranes (Martin and Beveridge, 1986). A n a l y s i s of the e f f e c t s of p o l y c a t i o n s on LPS using a c a t i o n i c s p i n probe has le d to the pro p o s a l that displacement of c a t i o n s causes LPS aggregates to become r i g i d and allows a n t i b i o t i c s to rearrange LPS packing, causing " c r a c k s " i n the s t r u c t u r e (Peterson e_t al_., 1985). 4. Aims of t h i s study As d i s c u s s e d above, P_. aeruginosa i s an important nosocomial pathogen. I t i s h i g h l y r e s i s t a n t to many commonly-used a n t i b i o t i c s , p a r t l y because of i t s low outer membrane p e r m e a b i l i t y . The p o s s i b i l i t y of a novel pathway of a n t i b i o t i c uptake, used by some of the most e f f e c t i v e a n t i -Pseudomonas agents, i s t h e r e f o r e of great i n t e r e s t . A deeper understanding of t h i s self-promoted uptake pathway might lead to new i n s i g h t s i n t o e f f e c t i v e chemotherapy f o r P_. aeruginosa i n f e c t i o n s . One element that may be i n v o l v e d i n b l o c k i n g self-promoted uptake, OM p r o t e i n H i , was i n v e s t i g a t e d i n t h i s study. There i s a l s o s u b s t a n t i a l g e n e r a l i n t e r e s t i n OM p r o t e i n s as models of membrane p r o t e i n s t r u c t u r e and f u n c t i o n , and research i n t o OM p r o t e i n s i s addressing some 24 fundamental b i o l o g i c a l problems. On the l i m i t e d i n f o r m a t i o n a v a i l a b l e , p r o t e i n Hi of P. aeruginosa may have an unique f u n c t i o n , so i n v e s t i g a t i o n of i t i s l i k e l y to i l l u m i n a t e the f i e l d even f u r t h e r . The approach I have taken to i n v e s t i g a t e the s t r u c t u r e , f u n c t i o n , and r o l e i n a n t i b i o t i c r e s i s t a n c e of p r o t e i n HI has been c h i e f l y molecular g e n e t i c . The p r o t e i n was p u r i f i e d and s u b j e c t e d to N-terminal amino a c i d sequencing, to allow c o n s t r u c t i o n of complementary o l i g o n u c l e o t i d e s as probes to i d e n t i f y the cloned s t r u c t u r a l gene f o r p r o t e i n HI i n E_. c o l i . C l o n i n g of the gene pe r m i t t e d sequence a n a l y s i s (Chapter 1), and s t u d i e s of e x p r e s s i o n of the i s o l a t e d gene and the e f f e c t of t h i s on a n t i b i o t i c s u s c e p t i b i l i t y (Chapter 2 ) . Some s t u d i e s of the f u n c t i o n of p r o t e i n Hi and i t s i n t e r a c t i o n with LPS are presented (Chapter 3). F i n a l l y , the occurrence of s i m i l a r p r o t e i n s i n s p e c i e s r e l a t e d to P_. aeruginosa was examined (Chapter 4 ) . The r e s u l t s of these i n v e s t i g a t i o n s w i l l be presented f o l l o w i n g a summary of the m a t e r i a l s and methods used. .1 25 MATERIALS AND METHODS 1. B a c t e r i a l s t r a i n s , plasmids, and growth c o n d i t i o n s The b a c t e r i a l s t r a i n s used i n t h i s study are d e s c r i b e d i n Table I. The LPS a l t e r a t i o n s i n rough P^ _ aeruginosa mutants are i l l u s t r a t e d i n F i g u r e 1. A l l s t r a i n s were kept as s t o c k s at -70°C in 8% d i m e t h y l s u l p h o x i d e . For short-term maintenance, a l l Pseudomonas s t r a i n s , X. m a l t o p h i 1 i a and A. c a l c o a c e t i c u s were maintained on 1% proteose peptone no. 2 (PP2) 2% Bacto agar (Difco L a b o r a t o r i e s , D e t r o i t , Michigan, U.S.A.) except H181, which was maintained on PP2 agar with 8ug/ml polymyxin B s u l p h a t e . E ^ c o l i JM101 was maintained on M9-glucose agar (Maniatis et^ al_. , 1982) supplemented with 5ug/ml thiamine h y d r o c h l o r i d e , and DH5o4F' was maintained on LB agar (Maniatis et; al_. , 1982). Growth temperatures were 37 °C except f o r rough P^ aeruginosa mutants j P_^_ c h l o r a p h i s , P. s y r i n g a e , P. s t u t z e r i , P. c e p a c i a s t r a i n s and X. m a l t o p h i l i a (30°C). Plasmids (Table II) were maintained i n b a c t e r i a with the f o l l o w i n g a n t i b i o t i c c o n c e n t r a t i o n s added to growth media: f o r c o l i , 25ug/ml ( i n LB) or 15ug/ml ( i n M9-glucose) a m p i c i l l i n sodium, 12.5ug/ml t e t r a c y c l i n e h y d r o c h l o r i d e , 25ug/ml kanamycin s u l p h a t e , 25ug/ml streptomycin sulphate; f o r P. aeruginosa, 150ug/ml t e t r a c y c l i n e h y d r o c h l o r i d e , 26 Table I. B a c t e r i a l s t r a i n s Species S t r a i n Relevant Phenotype Source or reference P. aeruginosa PA01 H181 H222 AK1282 AK1012 AK1414 OT684 AK1401 c o l i prototroph, O-serotype 5 "r Px , p r o t e i n H1-overproducing mutant of PA01 s Px , pr o t e i n H1-overproducing pseudorevertant of H181 rough mutant of PA01 (see Figure 1) PA01 leu l y s res ( r e s t r i c t i o n d e f i c i e n t ) rough mutant of 0T684 (see Figure 1) ATCC33354 O-serotype 6 M2 v i r u l e n t s t r a i n JM101 Alac-pro supE t h i F'traD36 proAB laciqzAM15 DH5°CF' F'4>80dlacZ Ml5 endAl recAl  hsdRl7 ( r ^ - , m^-) supE44 thi-1 gyrA relA1 A,( lacZYA-argF)U169 P. chloraphis ATCC9446 P. fluorescens ATCC949 " ATCC13525 type s t r a i n P. putida ATCC4359 A.M. Kropinski Nicas and Hancock, 1980 Nicas, T.I. and R.E.W. Hancock, unpublished A.M. Kropinski P.V. L i u S t i e r i t z and Holder, 1975 c J.T. Beatty Bethesda Research Laboratories ^  American Type Culture C o l l e c t i o n * Species S t r a i n Relevant Phenotype Source or reference P. s t u t z e r i P. syringae P. cepacia it Xanthomonas  ma l t o p h i l i a ATTCC17588 ATCC19310 ATTCC25416 ATCC25609 ATCC13637 type s t r a i n Acinetobacter 8197 calcoaceticus C l i n i c a l i s o l a t e ; var. haemolyticus/alcaligenes American Type Culture C o l l e c t i o n A.W. Chow A.M. Kropinski, Dept. of Microbiology and Immunology, Queen's University, Kingston, Ontario b P.V. L i u , Un i v e r s i t y of L o u i s v i l l e , L o u i s v i l l e , Kentucky, U.S.A. c J.T. Beatty, Dept. of Microbiology, U n i v e r s i t y of B r i t i s h Columbia, Vancouver, B.C. d Bethesda Research Laboratories, Burlington, Ontario e American Type Culture C o l l e c t i o n , R o c k v i l l e , Maryland, U.S.A. f A.W. Chow, D i v i s i o n of Infectious Diseases, Vancouver General Hospital, Vancouver, B.C. TC S Px , polymyxin B-resistant. Px , polymyxin B-susceptible. 28 Table I I . Plasmids Plasmid Relevant properties Source or reference pUC8 ColE1 A P r plac + lacZot V i e i r a and Messing, 1982 pUC9 ColE1 A P r plac l a c Z < 11 pUC18 ColE1 A P r plac + lacZoc. Yanisch-Perron et a l . , 1985 pTZ18R ColE1 A P r plac + lacZoc f 1 - o r i + U.S. Biochemical Corp. a pTZ18U ColE1 A P r plac lacZoC f 1 - o r i • I I pLAFRI IncP1 T C r Xcos + -mob t r a Friedman ejb a l . , 1982 pRK404 IncP1 T C r plac + + -lacZ**. mob t r a D i t t a et_ al_., 1985 pRK767 IncP1 Tc r plac + + -l a c Z « x mob t r a b G.S. D i t t a pRK2013 pRK2045 pNM185 pGB1 pGB2 pGB3 pGB4 pGB5 pGB6 pGBl 1 pGB12 ColE1 t r a ( R K 2 ) + K m r pSC101 t r a ( R K 2 ) + T c r IncQ/P4 Kmr Smr p j n( TOL) mob + t r a 1.3kb PstI fragment ( p a r t i a l oprH) i n pUC18 F i g u r s k i and H e l i n s k i , 1979 Mermod et a l . , 1986 d This study As pGBl, fragment i n opposite o r i e n t a t i o n As pGB1, i n pUC9 As pGB2, i n pUC9 As pGB1, i n pUC8 As pGB2, i n pUC8 0.5kb Smal-PstI fragment ( p a r t i a l oprH) i n pTZl8R As pGBll, fragment i n opposite o r i e n t a t i o n Plasmid Relevant properties Source or reference pGB22 2.8kb EcoRI fragment (oprH) i n pUCl8 pGB23 2.8kb EcoRI fragment (oprH) i n pRK767 pGB24 As pGB23, fragment i n opposite o r i e n t a t i o n pGB25 As pGB23, i n pNM185 (see Figure 11) pGB32 1.8kb BamHI-Sall fragment (oprH) i n pUC18 pGB52 0.8kb Smal-Kpnl fragment (oprH) i n pTZ18R pGB54 As pGB52, i n pTZ18U pGB62 1.9kb EcoRI-Kpnl fragment (oprH) i n pTZ18U pGB122 c As pGB22, fragment from H181 PGB123 2.8kb EcoRI fragment (oprH) from H181 i n pRK404 PGB124 As pGBl23, fragment i n opposite o r i e n t a t i o n pGB142 1.4kb BamHI-Kpnl fragment (oprH) from H181 i n pTZ18R pGB162 As pGB62, fragment from H181 PGB172 2.3kb EcoRI-Sall fragment (oprH) from H181 i n pTZ18U a United States Biochemical Corp., Cleveland, Ohio, U.S.A. b G.S. D i t t a , Dept. of Biology, University of C a l i f o r n i a at San Diego, La J o l l a , C a l i f o r n i a , U.S.A. c Odd-numbered plasmids (e.g. pGBl) had oprH i n the same o r i e n t a t i o n as the vector promoter; even-numbered plasmids had oprH and the vector promoter i n opposite ori e n t a t i o n s . Plasmids numbered below 100 contained fragments from the chromosome of P_^  aeruginosa PA01; those numbered above 100 contained fragments from the chromosome of P. aeruginosa H181. d For a r e s t r i c t i o n map of the oprH region, see Figure 6. 30 300ug/ml ( i n LB with low s a l t , i . e . l g / 1 NaCl) or 500ug/ml (i n BM2-succinate or M9-glucose) kanamycin s u l p h a t e . E x p r e s s i o n of s t r e p t o m y c i n - r e s i s t a n c e or i n s e r t e d genes i n pNMl85 was co-induced by a d d i t i o n of sodium benzoate to 5mM (fo r E ^ c o l i ) or 2mM (for a e r u g i n o s a ) . A n t i b i o t i c s were obtained from Sigma Chemical Co., S t . L o u i s , M i s s o u r i , U.S.A.). 2. SDS-PAGE A n a l y s i s of p r o t e i n p r o f i l e s was done by SDS-PAGE on 14% p o l y a c r y l a m i d e g e l s , c o n t a i n i n g 85mM NaCl to permit s e p a r a t i o n of p r o t e i n s Hi and H2, as d e s c r i b e d p r e v i o u s l y (Hancock and Carey, 1979). In some experiments, samples were p r e t r e a t e d i n 2% t r i c h l o r o a c e t i c a c i d and n e u t r a l i z e d with T r i s b efore s o l u b i l i z a t i o n i n SDS and e l e c t r o p h o r e s i s . Gels f o r a n a l y s i s of LPS contained 15% p o l y a c r y l a m i d e and 6M urea and were p e r i o d a t e - t r e a t e d and s i l v e r s t a i n e d f o r LPS by the method of T s a i and Frasch (1982). 3. P r o t e i n p u r i f i c a t i o n methods For i s o l a t i o n of outer membranes (OM), PAOl and H181 were grown i n 1.51 c u l t u r e s i n BM2-succinate medium (Eagon and Phibbs, 1971; and c o n t a i n i n g lOuM FeS0 4) at 37°C, with 2+ vigo r o u s a e r a t i o n . C u l t u r e s of AK1012 were grown i n Mg 2+ d e f i c i e n t (20uM Mg ) BM2-succinate at 30°C. C e l l s were 31 harvested at an AgQQ of 0.7-1.0. They were t r e a t e d with DNase I, broken i n a French pressure c e l l (American Instrument Co., S i l v e r S p r i n g , Maryland, U.S.A.), and f r a c t i o n a t e d by sucrose g r a d i e n t sedimentation as d e s c r i b e d p r e v i o u s l y (Hancock and Carey, 1979). OM were s o l u b i l i z e d i n detergents as de s c r i b e d by Hancock e_t al_. (1982b) . P r o t e i n assays were done by the method of Sanderman,and Strominger 'i (1972). ! D e t e r g e n t - s o l u b i 1 i z e d OM were f r a c t i o n a t e d on i o n -exchange columns c o n t a i n i n g DEAE-sephacel or carboxymethyl-sepharose r e s i n s (Pharmacia, Baie d'Urte, Que.). The b a s i c running b u f f e r s c o n s i s t e d of 2% T r i t o n X-100, 20mM T r i s HC1 b u f f e r (pH 8.0), lOmM EDTA f o r DEAE-sephacel and 2% T r i t o n X-100, 20mM sodium phosphate b u f f e r (pH 6.0), lOmM EDTA f o r carboxymethyl-sepharose. P r o t e i n s were e l u t e d with a continuous g r a d i e n t of 0 to 0.3M NaCl i n running b u f f e r , with a f i n a l wash with 0.5M or IM NaCl. P r o t e i n samples were conce n t r a t e d by d i a l y s i s a g a i n s t dry p o l y e t h y l e n e g l y c o l 20,000. D e t e r g e n t - s o l u b i 1 i z e d outer membranes were a l s o f r a c t i o n a t e d on 1.5 mm-thick SDS-polyacrylamide g e l s and p r o t e i n bands e x c i s e d and e l e c t r o e l u t e d e s s e n t i a l l y as d e s c r i b e d by Parr e_t a^. (1986) , except that g l y c i n e and methanol were omitted from the e l e c t r o e l u t i o n b u f f e r . 32 4. Determination of N-terminal amino a c i d sequence and amino  a c i d compos i t ion of p r o t e i n Hi P r o t e i n HI p u r i f i e d by SDS-PAGE was d i a l y s e d e x t e n s i v e l y a g a i n s t 0.1% SDS i n d e i o n i z e d water, and s u b j e c t e d to N-t e r m i n a l amino a c i d sequencing by S. K i e l l a n d (Dept. of B i o c h e m i s t r y and M i c r o b i o l o g y , U n i v e r s i t y of V i c t o r i a , B.C.). A s p i n n i n g cup sequenator (model 890-C; Beckman Instruments, Inc., Palo A l t o , C a l i f o r n i a , U.S.A.) was used. Pure p r o t e i n HI f o r amino a c i d a n a l y s i s was d i a l y z e d e x t e n s i v e l y a g a i n s t d e i o n i z e d water and l y o p h i l i z e d . Amino a c i d a n a l y s i s was a l s o performed by S. K i e l l a n d , by h y d r o l y s i s i n 6M HC1 at 110°C f o r 24, 48 and 72 hours, f o l l o w e d by a p p l i c a t i o n to a Beckman 119-CL automated amino a c i d a n a l y z e r . 5. Ant iserum product ion and p u r i f i c a t i o n , immunoblotting,  and c r o s s - l i n k i n g P r o t e i n HI was p u r i f i e d by s o l u b i l i z a t i o n of AK1012 OM i n 2% SDS-20mM T r i s HC1 pH 8.0 and p r e p a r a t i v e SDS-PAGE as d e s c r i b e d above and i n Chapter 1 below. The heat-unmodified p r o t e i n HI band was e x c i s e d , to g i v e some non-denatured molecules. A t o t a l of 380ug of p r o t e i n HI was administered to a female New Zealand white r a b b i t i n a s e r i e s of subcutaneous i n j e c t i o n s over a p e r i o d of 11 weeks. The f i r s t i n j e c t i o n i n c l u d e d 50% Freund's complete adjuvant and the second 50% Freund's incomplete adjuvant. When the t i t r e 33 a g a i n s t SDS-solubi 1 i z e d outer membranes (Hancock e_t a l . , 1984) reached 10^, as determined by enzyme-linked immunosorbent assay, the r a b b i t was exsanguinated by c a r d i a c puncture and the serum was e x t r a c t e d and s t o r e d at -70°C. Contaminating a n t i b o d i e s d i r e c t e d a g a i n s t outer membrane p r o t e i n s F and H2 were removed by p a s s i n g the serum over a p r o t e i n F-Sepharose a f f i n i t y column (Poole and Hancock, 1986) that was k i n d l y provided by K. Poole. The serum f r a c t i o n that remained unbound to the column was then absorbed to whole PA01 c e l l s as d e s c r i b e d by Poole and Hancock (1986). The r e s u l t i n g adsorbed, a f f i n i t y - p u r i f i e d serum reacted with both 18,000 and 21,000-MW p r o t e i n HI bands on Western immunoblots when used at 1/25 d i l u t i o n , but i t d i d not rec o g n i z e any other components of P^ aeruginosa c e l l l y s a t e s . ; T r a n s f e r of p r o t e i n s from SDS g e l s to n i t r o c e l l u l o s e sheets (Western b l o t t i n g ) was done as d e s c r i b e d by Towbin e_t a l . (1979), using a c u r r e n t of 10mA f o r 18 hours. B l o t s were developed as d e s c r i b e d p r e v i o u s l y (Hancock et; a^., 1984) usi n g p u r i f i e d antiserum to p r o t e i n Hi at 1/25 d i l u t i o n as the f i r s t antibody, and a l k a l i n e phosphatase-conjugated goat a n t i - r a b b i t immunoglobulin (Helix B i o t e c h . L t d . , Richmond, B.C.) as the second. Colony immunoblotting was done by the method of Helfman et^ a_^. (1983), u s i n g the same a n t i b o i d e s and s t a i n s as f o r Western b l o t s . M o l e c u l a r c r o s s - l i n k i n g r e a c t i o n s were done on OM as d e s c r i b e d by Reithmeier and 34 Bragg (1977) using d i t h i o b i s ( s u c c i n i m i d y l propionate) ( P i e r c e Chemical Co., Rockford, I l l i n o i s , U.S.A.) or g l u t a r a l d e h y d e . Products were analysed by one-dimensional SDS-PAGE and Western b l o t t i n g . 6. O l i g o n u c l e o t i d e des ign and synthes i s O l i g o d e o x y r i b o n u c l e o t i d e s were s y n t h e s i z e d on a 380A/B DNA s y n t h e s i z e r (Applied Biosystems, F o s t e r C i t y , C a l i f o r n i a , U.S.A.) by T. Atk i n s o n , Dept. of B i o c h e m i s t r y , U n i v e r s i t y of B r i t i s h Columbia, Vancouver, B.C. Crude o l i g o n u c l e o t i d e s were p u r i f i e d as d e s c r i b e d by Atk i n s o n and Smith (1984). The N-terminal amino a c i d sequence of p r o t e i n HI (see Fi g u r e 4) was used i n the design of complementary o l i g o d e o x y r i b o n u c l e o t i d e s that were used as probes to i d e n t i f y the s t r u c t u r a l gene f o r p r o t e i n H i , oprH. The codon usage e s t a b l i s h e d f o r two P^ aeruginosa genes (Gray et a l . , 1984; P r i t c h a r d and V a s i l , 1986) was used to l i m i t the number of d i s t i n c t o l i g o n u c l e o t i d e molecules i n each p o o l . C C A AACC O l i g o n u c l e o t i d e s 1 c o n s i s t e d of 5'-AATAATATCCAGAAGTGGAA-3', a mixture of 128 20-base long molecules corresponding to the amino a c i d sequence NNIQKSK. N u c l e o t i d e s A and T i n p o s i t i o n s 9 and 18 were found at <7.5% frequency i n the two P. aeruginosa genes and were not i n c l u d e d . O l i g o n u c l e o t i d e s C C c 2, 5'-AACTTCGTGGGCCTGACGTGGGGCGA-3', corresponded to a separ a t e sequence of amino a c i d s NFVGLTWGE. O l i g o n u c l e o t i d e s 35 2 were made longer (26 bases) and l i m i t e d to e i g h t o l i g o n u c l e o t i d e molecules, with a l l codons o c c u r r i n g i n <10% of r e s i d u e s i n the P_. aeruginosa sequences e l i m i n a t e d (see B a l l a n d ejt al_. , 1985; Lathe, 1985 f o r d i s c u s s i o n s of o l i g o n u c l e o t i d e d e s i g n ) . j 7. DNA techniques A l l DNA techniques were c a r r i e d out as d e s c r i b e d by M a n i a t i s et a_l. (1982) except i s o l a t i o n of chromosomal DNA (Goldberg and Ohman, 1984), Southern b l o t t i n g using Zeta-• J T M probe c a t i o n i c nylon membrane (Bio-Rad L a b o r a t o r i e s , 3 2 ':! Richmond, C a l i f o r n i a , U.S.A.), P end l a b e l i n g of 32 o l i g o n u c l e o t i d e s (Woods, 1984), random hexamer P - l a b e l i n g of double-stranded DNA (Feinberg and V o g e l s t e i n , 1983) and T M subsequent p u r i f i c a t i o n by E l u t i p - d ( S c h l e i c h e r & S c h u e l l , Inc., Keene, New Hampshire, U.S.A.), fragment i s o l a t i o n and s i z e - f r a c t i o n a t i o n on agarose g e l s using D E A E - c e l l u l o s e membranes (NA45; S c h l e i c h e r & S c h u e l l ) , quick l y s i s plasmid l p r e p a r a t i o n (Holmes and Qu i g l e y , 1981), a n d j s l o t - l y s i s agarose g e l e l e c t r o p h o r e s i s (Sekar, 1987) . R e s t r i c t i o n and m o d i f i c a t i o n enzymes were obtained from v a r i o u s manufacturers ! 32 and were used as recommended. I n c o r p o r a t i o n of [ - P]ATP i n t o o l i g o n u c l e o t i d e s was measured by s u b j e c t i n g a small p o r t i o n of the l a b e l i n g mixture to descending chromatography on a s t r i p of DE81 paper (Whatman Inc., C l i f t o n , New Jer s e y , 36 U.S.A.) in 0.3M ammonium formate (pH 8.0) and then d i v i d i n g the s t r i p h o r i z o n t a l l y and measuring Cerenkov r a d i a t i o n i n a s c i n t i l l a t i o n counter. Clones with i n s e r t s i n pUC, pTZ or pRK v e c t o r s were d i s t i n g u i s h e d from clones c o n t a i n i n g vector alone using X-gal (5-bromo-4-chloro-3-indoyl-Beta-D-g a l a c t o p y r a n o s i d e ; Clontech L a b o r a t o r i e s , Palo A l t o , C a l i f o r n i a , U.S.A.). 8. DNA sequencing I s o l a t i o n of s i n g l e stranded DNA (Dente e_t aj_., 1983; C a r l s o n and Messing, 1984) and dideoxy-DNA sequencing r e a c t i o n s were done as recommended by United States Biochemical Corp., C l e v e l a n d , Ohio, U.S.A., using [ SjdATP TM and Sequenase . Products were separated on 6% polyacrylamide-7M u r e a - T r i s borate-EDTA b u f f e r g r a d i e n t g e l s TM (Big g i n et^ aj^. , 1983) using e i t h e r a Poker Face apparatus (Hoefer S c i e n t i f i c Instruments, San F r a n c i s c o , C a l i f o r n i a , U.S.A.) maintained at 65°C or a model S2 apparatus (Bethesda Research L a b o r a t o r i e s , B u r l i n g t o n , O n t a r i o ) . 9. DNA and p r o t e i n sequence analyses Sequences were analysed with the a i d of a computer program, SEQNCE v e r s i o n 2.2 (Delaney Software L t d . , Vancouver, B.C.). The amino a c i d sequence of the mature p r o t e i n was compared with a databank of 7,396 sequences 37 (BIONET) using the FASTA program (Pearson and Lipman, 1988). 10. Whole c e l l p r o t e i n and LPS p r e p a r a t i o n and c e l l  f r a c t i o n a t i o n Whole c e l l p r o t e i n and LPS p r e p a r a t i o n s were made by an SDS b o i l i n g method (Nicas and Hancock, 1980) using overnight c u l t u r e s of c o l i and m i d - l o g a r i t h m i c phase c u l t u r e s of P.  a e r u g i n o s a . M i d - l o g a r i t h m i c phase ( A ^ Q Q = 0.4-0.6) c u l t u r e s of P_^_ aeruginosa were used because p r o t e i n HI i s overproduced when c e l l s reach s t a t i o n a r y phase i n most media (Nicas and Hancock, 1980). In some experiments, whole c e l l l y s a t e s intended f o r LPS a n a l y s i s were d i g e s t e d with 0.8ug p r o t e i n a s e K per ug p r o t e i n f o r 12 hours at 60°C. E ^ c o l i c e l l s were f r a c t i o n a t e d i n the same way as f o r OM i s o l a t i o n (see above) except on a s m a l l e r s c a l e . C e l l s were grown i n M9-glucose and harvested i n s t a t i o n a r y phase (Arr.r. = 1.4). The "envelope" f r a c t i o n was the m a t e r i a l p e l l e t e d by high-speed c e n t r i f u g a t i o n of broken c e l l s (MgSO^ was added to a c o n c e n t r a t i o n of 5mM), and the " s o l u b l e " f r a c t i o n was the supernatent. 11. T r i p a r e n t a l c o n j u g a t i o n To t r a n s f e r plasmids from E^ c o l i to P^ aerug inosa, the f o l l o w i n g general method of t r i p a r e n t a l c o n j u g a t i o n was employed. Donor (E. c o l i with the plasmid to be 38 t r a n s f e r r e d ) , helper (E^_ c o l i with e i t h e r pRK2013 or pRK2045) and r e c i p i e n t (P^ aeruginosa PA01) s t r a i n s were f i r s t grown ov e r n i g h t i n the presence of a n t i b i o t i c s , i f necessary. They were then c e n t r i f u g e d , resuspended i n a n t i b i o t i c - f r e e LB (E. co 1 i) or l o w - s a l t LB (P_^ _ aeruginosa) , s u b c u l t u r e d i n t o the same medium and grown with vigorous a e r a t i o n at 37°C (E. c o l i ) or 42° C (P^_ aeruginosa) . At l o g a r i t h m i c phase, b a c t e r i a were mixed i n the r a t i o of 2 donors: 2 h e l p e r s : 1 r e c i p i e n t and f i l t e r e d on to a O.45um-pore membrane. The membrane was placed c e l l - s i d e up on an LB agar p l a t e and incubated at 37°C f o r s i x hours. C e l l s were then washed o f f the membrane i n t o 2ml of s t e r i l e 0.9% w/v NaCl, d i l u t e d and spread on l o w - s a l t LB agar with a p p r o p r i a t e a n t i b i o t i c s . 5 Approximately 10 transconjugants per r e c i p i e n t were obtained when the c o n t r o l plasmid pRK404 was t r a n s f e r r e d from E. c o l i DH5CXF 1 to P^ aeruginosa PA01. 12. A n t i b i o t i c s u s c e p t i b i 1 i t y t e s t i n g S t r a i n s f o r a n t i b i o t i c s u s c e p t i b i l i t y t e s t i n g were f i r s t grown o v e r n i g h t i n the presence of a n t i b i o t i c s , i f necessary, then were c e n t r i f u g e d and resuspended i n a n t i b i o t i c - f r e e medium. They were then grown i n the same medium with vi g o r o u s a e r a t i o n to an A g g g °^ 0.4-0.6 ( f o r P^ _ aerug inosa and r e l a t e d s p e c i e s ) , or 0.5-0.8 ( f o r E ^ c o l i ) . MICs were determined by adding 5ul of c u l t u r e i n d u p l i c a t e to lOOul of 39 d o u b l i n g d i l u t i o n s of a n t i b i o t i c s i n the same medium i n m i c r o t i t r e t r a y s . A f t e r i n c u b a t i o n , growth i n the w e l l s was measured by a T i t e r t e k M u l t i s k a n scanner (Flow L a b o r a t o r i e s Inc., M i s s i s s a u g a , Ontario) and compared with growth of un i n o c u l a t e d and a n t i b i o t i c - f r e e c o n t r o l s . The MIC was d e f i n e d as the lowest c o n c e n t r a t i o n of a n t i b i o t i c causing a >50% r e d u c t i o n i n absorbance. No plasmids were l o s t as a r e s u l t of growth i n a n t i b i o t i c - f r e e medium, as shown by t e s t i n g MICs f o r the a n t i b i o t i c s used to s e l e c t the plasm i d -c a r r y i n g c e l l s . K i l l i n g assays were done as d e s c r i b e d by Nicas and Hancock (1983b). One hundred-fold d i l u t i o n s of c u l t u r e s were exposed to a n t i b i o t i c s at v a r i o u s c o n c e n t r a t i o n s f o r 5 minutes at 22°C, then d i l u t e d i n 30mM sodium phosphate b u f f e r (pH 7.0) and spread on PP2 agar. Rates of s u r v i v a l were c a l c u l a t e d by comparing colony counts of a n t i b i o t i c - t r e a t e d c u l t u r e s with those of untreated cont r o l s . Growth c o n d i t i o n s f o r a n t i b i o t i c s u s c e p t i b i l i t y t e s t s were as f o l l o w s : f o r P^ aeruginosa s t r a i n s with and without oprH on a plasmid (Figures 13 and 14), 37°C i n M9-glucose 2+ with 500uM r a t h e r than 2mM Mg ; f o r P^ aeruginosa LPS-a l t e r e d mutants and c o n t r o l s t r a i n s (Table V I ) , 30°C i n BM2-s u c c i n a t e (with e i t h e r 500uM or 20uM MgSO^) supplemented with ImM l e u c i n e and ImM l y s i n e ; f o r P^ aeruginosa PA01 and ATCC33354, P. c h l o r a p h i s , P. f l u o r e s c e n s and P. p u t i d a 40 (Tables VII and IX), 30°C in BM2-succinate (with 500uM, 50uM or 20uM MgS0 4); and f o r c o l i , 37°C in LB and i n M9-g l u c o s e . MIC p l a t e s were scored a f t e r 24 hours i f incubated at 37°C, or 36 hours i f incubated at 30°C. Polymyxin B sulphate (8,100u/mg), gentamicin sulphate (577ug gentamicin per mg s o l i d ) , c a r b e n i c i 1 1 i n disodium. H2O, kanamycin a c i d sulphate (677ug kanamycin per mg s o l i d ) , a m p i c i l l i n sodium, t e t r a c y c l i n e h y d r o c h l o r i d e and EDTA were a l l o btained from Sigma. 13. Measurement of eel1 s u r f a c e h y d r o p h o b i c i t y C e l l s u r f a c e h y d r o p h o b i c i t y was measured by the r e d u c t i o n of absorbance of c e l l suspensions caused by adhesion to xylene (Rosenberg e_t al_. , 1980). 14. Growth of P. aerug inosa i n chamber implants i n mice P. aeruginosa M2 c e l l s , grown f o r three days in T e f l o n chambers implanted i n mice, were k i n d l y provided by N.M. K e l l y ( K e l l y et a l . , 1987). 15. Cel1 envelope i s o l a t i o n C e l l envelopes were i s o l a t e d from 30ml c u l t u r e s of Pseudomonas and r e l a t e d s p e c i e s as d e s c r i b e d f o r c e l l f r a c t i o n a t i o n above, except that c u l t u r e s were harvested at an A/-on of 0.4-0.6. C u l t u r e s were grown i n BM2-succinate 41 2+ with 500uM or 20uM Mg with the f o l l o w i n g e x c e p t i o n s : f o r 2+ 2+ s p e c i e s that would not grow i n 20uM Mg , Mg - d e f i c i e n t 2+ medium contained 50uM Mg ; m a l t o p h i l i a r e q u i r e d supplementation with ImM methionine; s t u t z e r i was grown i n 2+ M9-glucose r a t h e r than BM2-succinate ( i n Mg - d e f i c i e n t 2+ medium the Ca l e v e l was reduced to 20uM). Summer student S.C. B i n n i e provided some t e c h n i c a l a s s i s t a n c e with the p r e p a r a t i o n and a n a l y s i s of c e l l envelopes. 16. Other methods I s o e l e c t r i c f o c u s s i n g ( O ' F a r r e l l , 1975), measurement of c e l l u l a r uptake of l-N_-phenylnaphthylamine (Loh et_ a l . , 1984), measurement of i n t e r a c t i o n of c e l l s with d a n s y l -polymyxin (Moore e_t a_K , 1986), transposon mutagenesis (Tsuda et a l . , 1984; R e l l a e_t a^., 1985) and plasmid m o b i l i z a t i o n by b i p a r e n t a l c o n j u g a t i o n (Simon e_t a_l_., 1983) were done as d e s c r i b e d p r e v i o u s l y . 42 CHAPTER 1 PURIFICATION AND PROPERTIES OF PROTEIN HI AND CLONING  AND NUCLEOTIDE SEQUENCE OF ITS STRUCTURAL GENE 1. P u r i f i c a t i o n of p r o t e i n HI; O p t i m i z a t i o n of outer  membrane s o l u b i l i z a t i o n s Outer membranes (OM) prepared by sucrose g r a d i e n t sedimentation from the p r o t e i n Hl-overproducing mutant of P. aeruginosa PAOl, H181 (Nicas and Hancock, 1980), c o n t a i n HI as the major p r o t e i n (Nicas and Hancock, 1980; F i g u r e 2, Lane 1 ) . When s o l u b i l i z e d at 100°C i n SDS, p r o t e i n Hi giv e s two bands on SDS-polyacrylamide g e l s ; a heat-modified band (Hi*) of apparent MW 21,000, and a r e s i d u a l heat-unmodified band (Hi) of 18,000 (Hancock and Carey, 1979; F i g u r e 2, lanes 1-4). When s o l u b i l i z e d at 22°C only the heat-unmodified form appears. When the sample was p r e - t r e a t e d with t r i c h l o r o a c e t i c a c i d before h e a t i n g at 100°C i n SDS, v i r t u a l l y a l l of the p r o t e i n HI appeared i n the H i * p o s i t i o n . When the H181 OM was s o l u b i l i z e d with s o n i c a t i o n s e q u e n t i a l l y i n T r i t o n X-100-Tris HC1 pH 8.0 and T r i t o n X-100-Tris HC1 pH 8.0-EDTA as p r e v i o u s l y d e s c r i b e d (Hancock et_ a_l. , 1982b), the T r i t o n X-100-Tris H C l - i n s o l u b l e , T r i t o n X-100-Tris HC1-EDTA-s o l u b l e OM f r a c t i o n was enr i c h e d i n p r o t e i n HI (Figure 2, Figure 2* Coomassie Blue-stained SDS-polyacrylamide gel electrophoretogram i l l u s t r a t i n g p u r i f i c a t i o n of protein H1. Lanes: 1, OM of H181; 2, OM of AK1012 ( M g 2 + - d e f i c i e n t ) ; 3, T r i t o n X-100-Tris HCl-insoluble, T r i t o n X-100-Tris HC1-EDTA-soluble OM f r a c t i o n of H181; 4, T r i t o n X-100-Tris HCl-EDTA-insoluble, SDS-Tris HCl-soluble OM f r a c t i o n from AK1012; 5 and 6, p r o t e i n H1 p u r i f i e d by SDS-PAGE and e l e c t r o e l u t i o n of heat-modified (H1*) bands; 7 and 8, p r o t e i n H1 p u r i f i e d by SDS-PAGE and e l e c t r o e l u t i o n of heat-unmodified (H1) bands; 9, pr o t e i n H1 p u r i f i e d by anion-exchange chromatography. Lanes 1-4 contained 20ug of p r o t e i n each; lanes 5-8 contained 12.5ug each; lane 9 contained 6ug. Samples i n lanes 1-5, 7 and 9 were s o l u b i l i z e d at 100°C before loading onto t h i s a n a l y t i c a l g e l ; samples i n lanes 6 and 8 were s o l u b i l i z e d at 22°C. Running p o s i t i o n s of relevant MW standards (in thousands) are shown on the l e f t , and of heat-modified (H1*) and heat-unmodified (H1) p r o t e i n H1 bands, on the r i g h t . 44 lane 3 ) . When t h i s f r a c t i o n was a p p l i e d to DEAE-Sephacel anion-exchange columns, p r o t e i n HI c o - e l u t e d with v a r i o u s other outer membrane p r o t e i n s , e s p e c i a l l y F, G and I. By o m i t t i n g the s o n i c a t i o n d u r i n g the second s o l u b i l i z a t i o n the p u r i f i c a t i o n was improved (see below). Ne i t h e r d i g e s t i o n of outer membranes with lysozyme to r e l e a s e p e p t i d o g l y c a n -a s s o c i a t e d p r o t e i n s (Hancock et a_l., 1981a), nor s o l u b i l i z a t i o n with the detergents o c t y l g l u c o s i d e or Zwit t e r g e n t 3-14 were h e l p f u l . Both o c t y l g l u c o s i d e and Zwitt e r g e n t 3-14 s o l u b i l i z e d almost a l l outer membrane p r o t e i n s even i n the absence of EDTA. Cation-exchange chromatography of T r i t o n X-100-Tris HC1-EDTA s o l u b i l i z e d OM using carboxymethylsepharose a l s o gave poor s e p a r a t i o n of outer membrane p r o t e i n s . P r o t e i n Hi was more r e s i s t a n t to degradation by papain and by Staphylococcus aureus V8 protease than most other outer membrane p r o t e i n s (data not shown), but no f u r t h e r use was made of t h i s o b s e r v a t i o n . OM of a rough mutant s t r a i n of P. aeruginosa PA01, AK1012 (Table I and F i g u r e 1) were a l s o used f o r p u r i f i c a t i o n i n order to minimize contamination of p r o t e i n HI by 2 + immunogenic LPS O-antigen. C e l l s were grown i n Mg d e f i c i e n t medium to induce s y n t h e s i s of p r o t e i n Hi (Figure 2, lane 2 ) . P r o t e i n Hi i n outer membranes of t h i s s t r a i n was only s p a r i n g l y s o l u b l e i n T r i t o n X-100-Tris HC1-EDTA. However, f u r t h e r s o l u b i l i z a t i o n i n SDS-Tris HC1 gave a 45 f r a c t i o n e n r i c h e d i n p r o t e i n HI (Figure 2, lane 4) which was f u r t h e r p u r i f i e d (see below) . The d i f f e r e n t s o l u b i l i t y -p r o p e r t i e s of p r o t e i n Hi i n outer membranes of smooth and rough s t r a i n s suggested that p r o t e i n Hi and LPS were a s s o c i a t e d , and that the nature of the a s s o c i a t i o n depended on the LPS type. 2. P u r i f i c a t i o n of p r o t e i n HI from s o l u b i l i z e d membranes by  an ion-exchange chromatography T r i t o n X-100-Tris HCl-EDTA-solubi1ized H181 outer membranes (see above) were sub j e c t e d to an ion-exchange chromatography using DEAE-sephacel r e s i n under v a r i o u s c o n d i t i o n s . Optimum p u r i f i c a t i o n of p r o t e i n Hi was obtained by reducing the pH of the running b u f f e r to 7.0, and performing two c y c l e s of chromatography with d i f f e r e n t c o n c e n t r a t i o n s of T r i t o n X-100 i n the running b u f f e r . In the f i r s t c y c l e (0.1% T r i t o n X-100) most p r o t e i n Hi was e l u t e d from the column near the middle of the 0 to 0.3M NaCl g r a d i e n t . The f r a c t i o n s r i c h i n p r o t e i n HI were subjected to a second c y c l e (2% T r i t o n X-100) and the e a r l y part of the v o i d volume contained p r o t e i n Hi that was v i r t u a l l y pure (Figure 2, lane 9). However, the y i e l d was only about 5ug of p r o t e i n HI f o r every lOOug a p p l i e d to the f i r s t column. 46 3. P u r i f i c a t i o n of p r o t e i n Hi from s o l u b i l i z e d membranes by  SDS-PAGE S o l u b i l i z e d OM of H181 and AK1012 (see above) were loaded on p r e p a r a t i v e SDS-polyacrylamide g e l s and p r o t e i n Hi bands were e x c i s e d and e l e c t r o e l u t e d . When heat-modified (HI*) bands were e x c i s e d from g e l s loaded with s o l u b i l i z e d membranes that had been heated to 100°C, and i n some in s t a n c e s t r e a t e d with t r i c h l o r o a c e t i c a c i d , the pure p r o t e i n ran i n the HI* p o s i t i o n even when s o l u b i l i z e d at 22°C (Figure 2, lanes 5 and 6). This i n d i c a t e d t hat the p r o t e i n d i d not renature a f t e r e x c i s i o n from the g e l . When heat-unmodified (Hi) bands were e x c i s e d from g e l s loaded with membranes that were not heated to 100°C, the r e s u l t i n g pure p r o t e i n c o n tained both denatured and non-denatured molecules (Figure 2, lanes 7 and 8). Care was taken to minimize l o a d i n g volume and maximize s t a c k i n g g e l depth, to reduce smearing of the HI bands and c o - e l u t i o n of p r o t e i n G. P r o t e i n G give s a heat-unmodified band of apparent MW 19,000 (Hancock and Carey, 1979). Completely non-denatured pure p r o t e i n Hi was obtained by c a r e f u l e l u t i o n of HI bands without e l e c t r i c c u r r e n t (data not shown). The y i e l d of pure p r o t e i n HI from SDS-PAGE (>50%) was over t e n - f o l d higher than the y i e l d from chromatography (see above) . Since SDS-PAGE was a l s o l e s s time-consuming, i t became the method of c h o i c e . 4 7 4. P r o p e r t i e s of p u r i f i e d p r o t e i n HI ji The LPS compositions of the p u r i f i e d p r o t e i n HI samples are shown i n F i g u r e 3. The g e l s t a i n i n g c o n d i t i o n s are r e l a t i v e l y s p e c i f i c f o r LPS (ladder p a t t e r n and t h i c k rough core band), but p r o t e i n ( i n d i v i d u a l bands) a l s o s t a i n s to some ext e n t . The p r o t e i n p u r i f i e d by SDS-PAGE contained no d e t e c t a b l e LPS, but p r o t e i n p u r i f i e d by chromatography contained s u b s t a n t i a l amounts of LPS. The molar r a t i o of LPS to p r o t e i n i n the p r o t e i n Hi p u r i f i e d by chromatography was estimated, by comparing with pure LPS run on the same g e l , to be at l e a s t 1:1. (data not shown). The LPS cdntaminating the pure p r o t e i n Hi contained a higher p r o p o r t i o n of molecules with 0 s i d e chains to molecules l a c k i n g 0 s i d e chains than d i d . t h e bulk LPS of the outer membranes. These r e s u l t s suggested that p r o t e i n Hi was a s s o c i a t e d with smooth LPS i n outer membranes, and that t h i s a s s o c i a t i o n was d i s r u p t e d by SDS-PAGE. A l t e r n a t i v e l y , the LPS may have c o - p u r i f i e d with Hi i n the the absence of any a s s o c i a t i o n . However, the bulk of LPS e l u t e d from the column i n f r a c t i o n s w e l l separated from the f r a c t i o n s c o n t a i n i n g p r o t e i n HI. In an attempt to r e s o l v e t h i s q u e s t i o n , p u r i f i e d PA01 LPS was s o n i c a t e d with pure, denatured p r o t e i n HI and the mixture was analysed on SDS-PAGE to look f o r r e n a t u r a t i o n . No p r o t e i n was observed i n the renatured p o s i t i o n (apparent MW 18,000). A s s o c i a t i o n with LPS might change the i s o e l e c t r i c p o i n t of the p r o t e i n , but p r o t e i n HI could not be d e t e c t e d on i s o e l e c t r i c f o c u s s i n g 4 8 1 2 Figure ^. SDS-15% polyacrylamide-urea gel electrophoretogram of p u r i f i e d p r o t e i n H1 samples, s i l v e r stained f o r LPS. No protease treatment was included. Lane 1, pr o t e i n H1 p u r i f i e d by ion-exchange chromatography (6ug of p r o t e i n ) . Lane 2, pr o t e i n H1 p u r i f i e d by preparative SDS-PAGE (12.5ug of p r o t e i n ) . Rough core LPS (rLPS) and O-antigen-containing LPS (ladder pattern: arrows) are in d i c a t e d on the l e f t of the f i g u r e . 49 g e l s , perhaps because i t s i s o e l e c t r i c p o i n t was not i n the range 4-7 ( O ' F a r r e l l , 1975). F i n a l l y , i t was not p o s s i b l e to measure i n h i b i t i o n by p r o t e i n HI of i n t e r a c t i o n between LPS and dansyl-polymyxin, a f l u o r e s c e n t probe of p o l y c a t i o n -biriding s i t e s (Newton, 1955; Moore et a l . , 1986), because the detergent needed to keep p r o t e i n Hi i n s o l u t i o n i n t e r a c t e d s t r o n g l y with the probe. P r o t e i n Hi p u r i f i e d by SDS-PAGE (HI* band: F i g u r e 2, lanes 5 and 6) was used f o r N-terminal amino a c i d sequencing and amino a c i d a n a l y s i s because of the high y i e l d obtained with that method and the absence of LPS i n the product. The sequence of the f i r s t 22 N-terminal amino a c i d s was determined to be NH -ADNFVGLTWGETSNNIQKSKSL.. The r e s u l t s 1 of amino a c i d analyses of p u r i f i e d p r o t e i n Hi are shown i n Table I I I . P r o t e i n Hi p u r i f i e d from AK1012 by SDS-PAGE and e x c i s i o n of heat-unmodified bands acted as a good immunogen when administered to a r a b b i t (see M a t e r i a l s and Methods). The p u r i f i e d antiserum was used to i d e n t i f y p r o t e i n HI bands on Western immunoblots (see below). 5. A n a l y s i s of P. aeruginosa chromosomal DNA by h y b r i d i z a t i o n with o l i g o n u c l e o t i d e s complementary to  oprH. The N-terminal amino a c i d sequence of p r o t e i n HI was used to design complementary o l i g o d e o x y r i b o n u c l e o t i d e s (see 50 Table I I I . Amino a c i d composition of p r o t e i n H1 Amino a c i d (one-letter code) Number of residues a. b Analysis Sequence" Alanine (A) 11.3 11 Arginine (R) 5.2 7 Asparagine (N) 17 27.6° Aspartate (D) 10 Cysteine (C) 0 a O Glutamate (E) , 7 a 18.9 Glutamine (Q) 10 Glycine (G) 29.2 23 H i s t i d i n e (H) 2.6 2 Isoleucine (I) 6.7 7 Leucine (L) 18.6 20 Lysine (K) 10.1 11 Methionine (M) 0.4 1 Phenylalanine (F) 6.2 7 P r o l i n e (P) 1.5 3 Serine (S) 17.4 16 Threonine (T) 10.5 11 a Tryptophan (W) 1 2 Tyrosine (Y) 5.5 9 .Valine (V) 5.5 4 T o t a l 178.2 3 178 51 Amino a c i d composition according to analyses performed on p u r i f i e d H1. The p r o t e i n was assumed to contain 178 residues. Cysteine and tryptophan were not determined: f o r the purpose of c a l c u l a t i o n , the number of cysteine residues was assumed to be 0, and the number of tryptophan residues, 1 (since one tryptophan residue was found i n the N-terminal amino a c i d sequence). Numbers are the median values of three separate assays rounded o f f to one decimal point. b Amino a c i d composition according to sequence of the mature protei n , derived from the nucleotide sequence (Figure 7). c Asparagine and aspartate residues combined. d Glutamate and glutamine residues combined. 52 M a t e r i a l s and Methods) that were used as probes to i d e n t i f y the s t r u c t u r a l gene f o r p r o t e i n HI, oprH (Figure 4 ) . P_. aeruginosa PA01 chromosomal DNA that had been d i g e s t e d with v a r i o u s r e s t r i c t i o n endonucleases s i n g l y and i n combinations was subjected to e l e c t r o p h o r e s i s , t r a n s f e r r e d to Southern b l o t s , and probed with the r a d i o l a b e l e d o l i g o n u c l e o t i d e s . This procedure allowed the i d e n t i f i c a t i o n of r e s t r i c t i o n fragments p o s s e s s i n g DNA from the upstream end of oprH (data not shown). In none of the d i g e s t s d i d both o l i g o n u c l e o t i d e s 1 and 2 h y b r i d i z e with more than one chromosomal fragment, i n d i c a t i n g that oprH was probably present as a s i n g l e - c o p y gene. The s i z e s of h y b r i d i z i n g fragments were i d e n t i c a l when chromosomal DNA from H181 was used. 6. Molecular c l o n i n g of oprH By s c r e e n i n g with the r a d i o l a b e l e d o l i g o n u c l e o t i d e s , the oprH gene co u l d not be i d e n t i f i e d from a PA01 gene l i b r a r y i n the cosmid vector pLAFRl, s i m i l a r to that d e s c r i b e d by Goldberg and Ohman (1984). T h e r e f o r e , the data f o r h y b r i d i z a t i o n of the o l i g o n u c l e o t i d e s with d i g e s t e d chromosomal DNA were used i n an a l t e r n a t i v e approach. A 1.3kb PstI chromosomal fragment, l a r g e enough to c o n t a i n the gene (estimated as 550-600 base p a i r s ) , h y b r i d i z e d s t r o n g l y with both o l i g o n u c l e o t i d e probes on 53 C C C 5'-AAC TTC G T Q GGC C T Q ACQ T G G GGC GA-3' (2) NH ^Ala-Asp-Asn-Phe-Val-Gly-Leu-Thr-Trp-Gly-Glu-Thr-Z 10 c C A A ACC , , x 5'-AAT AA T ATC CAg A A Q t g g AA-3' (1) Ser-Asn-Asn-Ile-Gln-Lys-Ser-Lys-Ser-Leu 20 Figure 4^  N-terminal amino a c i d sequence of the f i r s t 22 residues of pro t e i n H1, and sequences of oligonucleotides complementary to oprH. Compositions of oligo n u c l e o t i d e mixtures 1 and 2 are shown above the corresponding amino acid sequence. 54 Southern b l o t s . P s t l - d i g e s t e d chromosomal DNA was s i z e -f r a c t i o n a t e d and the f r a c t i o n around 1.3kb was shown to c o n t a i n the c o r r e c t fragment by Southern b l o t t i n g . T h i s f r a c t i o n was then l i g a t e d i n t o P s t l - d i g e s t e d , dephosphorylated pUC18 and the products transformed i n t o E. c o l i JM101. S e v e r a l hundred transformants were screened by colony f i l t e r h y b r i d i z a t i o n , and p o s i t i v e clones were analysed by agarose g e l e l e c t r o p h o r e s i s and Southern b l o t t i n g of quick plasmid p r e p a r a t i o n s . Two clones (plasmid d e s i g n a t i o n s pGBl and pGB2) were found to c o n t a i n the c o r r e c t fragment, i n d i f f e r e n t o r i e n t a t i o n s . The h y b r i d i z i n g sequence was l o c a t e d on a 0.5kb Smal-PstI sub-fragment of the cloned DNA (Figures 5 and 6). Neither clone expressed d e t e c t a b l e p r o t e i n Hi on Western b l o t s (see below). The c l o n i n g of oprH was t h e r e f o r e confirmed by n u c l e o t i d e sequencing of the 0.5kb Smal-PstI fragment. A sequence corresponding to the N-terminal amino a c i d sequence of the p u r i f i e d p r o t e i n was found (see F i g u r e 7 and d i s c u s s i o n below). However, the cloned P s t I fragment con t a i n e d only p a r t of the oprH gene. The c l o n i n g procedure was t h e r e f o r e repeated using the 0.5kb Smal-PstI fragment as a probe to d e t e c t a 2.8kb EcoRI fragment i n a s i z e - r e s t r i c t e d sub-genomic l i b r a r y i n E. c o l i DHSo^F1. Chromosomal mapping had shown that the 2.8kb EcoRI fragment should c o n t a i n the e n t i r e oprH gene of PA01. The plasmid c o n t a i n i n g the 2.8kb 55 Figure 5^  Agarose gel electrophoretic (panel A) and Southern b l o t (panel B) analysis of r e s t r i c t i o n fragments of pGBl and pGB2. Panel A i s a 1.5% agarose-ethidium bromide gel, and panel B i s an autoradiogram of a Southern b l o t of the gel i n panel A probed with oligonucleotides 1. Lane 1, pGBl digested with BamHI; lane 2, pGBl digested with P s t I ; lane 3, pGB1 digested with Smal; lane 4, pGB2 digested with BamHI; lane 5, pGB2 digested with Smal. Running p o s i t i o n s of relevant MW standards ( i n kb) are shown between the panels. Since the BamHI and Smal s i t e s are on the same side of the PstI s i t e i n the mult i - c l o n i n g s i t e region of the vector pUC18, these r e s u l t s provide evidence f o r the r e s t r i c t i o n map shown i n Figure 6 and show that the 1.3kb PstI fragments i n pGBl and pGB2 are i n opposite o r i e n t a t i o n s . A b l o t probed with oligonucleotides 2 gave r e s u l t s i d e n t i c a l to those shown. 56 E A i-B C D P B. S oprH s pp K •T-O.lkb L P E P B S s h s s h P •I P 4 K 4 Figure J5. R e s t r i c t i o n map of a 2.8 kb EcoRI fragment of PA01 chromosomal DNA containing the oprH gene, and sequencing strategy. L i n e A, r e s t r i c t i o n map of the e n t i r e 2.8kb fragment. Line B, map of the 1.3kb PstI fragment contained i n plasmids pGBl through 6. Line C, the 0.5kb Smal-PstI fragment contained i n pGBll and 12. Line D, the 0.8kb Smal-Kpnl fragment contained i n pGB52 and 54. B = BamHI, E = EcoRI, K = Kpnl, L = S a i l , P = PstI, S = Smal. The large arrow shows the l o c a t i o n and presumed d i r e c t i o n of t r a n s c r i p t i o n of the coding region of oprH. The small arrows show the extent of DNA sequencing achieved using plasmids pGBll, 12, 52 and 54. 57 fragment l i g a t e d i n t o the vector pUC18 was designated pGB22. The analogous plasmid c o n t a i n i n g DNA from H181 was designated pGB122 (Table I I ) . A r e s t r i c t i o n map of the 2.8kb EcoRI fragment i s shown i n F i g u r e 6. 7. N u c l e o t i d e sequence a n a l y s i s of oprH N u c l e o t i d e sequencing of the DNA of the oprH region r e q u i r e d both s u b - c l o n i n g (Figure 6) and design of two new o l i g o n u c l e o t i d e s (based on p r e l i m i n a r y sequence information) f o r use as primers. The n u c l e o t i d e sequence from the Smal s i t e to c l o s e to a Kpnl s i t e downstream from oprH was completed on both s t r a n d s , and i s shown i n F i g u r e 7. At p o s i t i o n 91 there was an ATG codon that s i g n a l e d the s t a r t of the oprH coding r e g i o n . There was the coding sequence f o r 21 amino a c i d r e s i d u e s between the ATG and p o s i t i o n 157. P o s i t i o n 157 was the s t a r t of the coding r e g i o n f o r the mature p r o t e i n , according to the pre-determined N-terminal amino a c i d sequence. From p o s i t i o n 157, the open reading frame continued f o r a f u r t h e r 534 n u c l e o t i d e s , corresponding to 178 amino a c i d r e s i d u e s , before a nonsense codon TAA was reached. The e n t i r e n u c l e o t i d e sequence shown i n F i g u r e 7 c o n s i s t e d of 63.0mol% G + C, which was c l o s e to value f o r the P_. aeruginosa genome of 67.2% ( P a l l e r o n i , 1975). The codon usage was very s i m i l a r to that of other chromosomal genes of 58 r Smal 'GGGTTCAGCAAGCGTTCAGGGGCGGTTCAGTACCCTGTCCGTACTCTGCAAGCCGTGAAC 60 GACACGACTCTCGCAGAACGGAGAAACACCATGAAAGCACTCAAGACTCTCTTCATCGCC 120 M K A L K T L, F I A 10 ACCGCCCTGCTGGGTTCCGCCGCCGGCGTCCAGGCCGCCGACAACTTCGTGGGCCTGACC 180 T A L L G S A A G V Q A A D N F V'! G L T 30 • TGGGGCGAGACCAGCAACAACATCCAGAAATCCAAGTCGCTGAACCGCAACCTGAACAGC 210 W G E T S N N I Q K S K S L N R N L N S 50 CCGAACCTCGACAAGGTGATCGACAACACCGGCACCTGGGGCATCCGCGCCGGCCAGCAG 300 P N L D K V I D N T G T W G I K A ; , G Q Q 7 0 TTCGAGCAGGGCCGCTACTACGCGACCTACGAGAACATCTCCGACACCAGCAGCGGCAAC 360 F E Q G R Y Y A T Y E N I S D T S' S G N 90 AAGCTGCGCCAGCAGAACCTGCTCGGCAGCTACGACGCCTTCCTGCCGATCGGCGACAAC 420 K . L R Q Q K L L G S Y D A F L P I G D N 110 AACACCAAGCTGTTCGGCGGTGCCACCCTCGGCCTGGTCAAGCTGGAACAGGACGGCAAG 480 N T K L F G G A T L G L V K L E Q ' D G K 130 PstI _ PstI GGCTTCAAGCGCGACAGCGATGTCGGCTACGCTGCCGGGCTGCAGGCCGGTATCCTGCAG 540 G F K R D S D V G Y A A G L Q A G I L Q 150 GAGCTGAGCAAGAATGCCTCGATCGAAGGCGGCTATCGTTACCTGCGCACCAACGCCAGC 600 E L S K N A S I E G G Y R Y L R Tj N A S 170 ACCGAGATGACCCCGCATGGCGGCAACAAGCTGGGCTCCCTGGACCTGC ACAGCAGCTCG 660 T E M T P H G G N K L G S L D L H ' S S S 1 9 0 CAATTCTACCTGGGCGCCAACTACAAGTTCTAAATGACCGCGCAGCGCCC'GCGAGGGCAT 720 Q F Y L G A N Y K F * • 200 GCTTCGATGGCCGGGCCGGAAGGT j 744 Figure 7. Nucleotide sequence (upper l i n e ) of the oprH region and derived amino a c i d sequence (lower l i n e ) of p r o t e i n H1. The presumed d i r e c t i o n of t r a n s c r i p t i o n i s from l e f t to r i g h t . , The putative leader (signal) sequence the p r o t e i n i s underlined. Inverted complementary repeat sequence i s indicated by arrows above the DNA sequence. R e s t r i c t i o n ) s i t e s are as indi c a t e d . Nucleotide 1 i s i n the middle of the Smal s i t e ; amino a c i d 1 i s the f i r s t residue of nascent p r o t e i n H1. *, stop codon. • 59 P. aeruginosa (excluding p i l i n genes; West and I g l e w s k i , 1988). The 90 base p a i r s upstream of the ATG s t a r t codon c o n t a i n e d no sequences c l o s e l y resembling the consensus -35 and -10 sequences of E_. c o l i promoters (Travers, 1987 ) or the -24 and -14 sequences of ntrA ( r p o N ) - a c t i v a t e d promoters ( D e r e t i c et a l . , 1987), nor any A T - r i c h regions (Figure 7). P o s s i b l y the oprH promoter was f u r t h e r upstream. Between p o s i t i o n s 148 and 179 (Figure 7) there was the p o t e n t i a l f o r stem-loop secondary s t r u c t u r e formation i n the RNA t r a n s c r i p t , i n d i c a t i n g a p o s s i b l e s i t e f o r t e r m i n a t i o n of t r a n s c r i p t i o n and consequently a p o t e n t i a l a t t e n u a t o r mechanism. However, no such sequences were found i n the 54 base p a i r s downstream of the oprH coding sequences so i t was p o s s i b l e that a region c o n s i d e r a b l y l a r g e r than oprH i t s e l f might be t r a n s c r i b e d i n t o a s i n g l e mRNA molecule. Sequence a n a l y s i s showed that the PstI s i t e found i n the middle of oprH was a c t u a l l y two PstI s i t e s 15 base p a i r s apart (Figure 7) . 8. A n a l y s i s of the d e r i v e d amino a c i d sequence of p r o t e i n Hi The d e r i v e d amino a c i d sequence of p r o t e i n Hi c o n s i s t e d of 21 r e s i d u e s with the t y p i c a l c h a r a c t e r i s t i c s of a p r o k a r y o t i c leader ( s i g n a l ) sequence (Randall et a l _ . , 1987) and 178 r e s i d u e s of mature p r o t e i n . The f i r s t 22 re s i d u e s of the amino a c i d sequence matched that determined by N-terminal 60 sequencing of pure p r o t e i n H i . The amino a c i d composition of the 178-residue p o l y p e t i d e was v i r t u a l l y i d e n t i c a l to that determined f o r p u r i f i e d p r o t e i n Hi (Table I I I ) . The p r o t e i n was expected to be s l i g h t l y b a s i c at n e u t r a l pH s i n c e i t contained 18 b a s i c r e s i d u e s , 2 h i s t i d i n e s and 17 a c i d i c r e s i d u e s . The p o s i t i v e charges were d i s t r i b u t e d f a i r l y e venly over the p r o t e i n , except f o r a c l u s t e r around amino a c i d r e s i d u e number 132 (Figure 7 ) . The b a s i c i t y of p r o t e i n HI had been p r e d i c t e d because of i t s absence i n the normal range of i s o e l e c t r i c f o c u s s i n g g e l s (see above), and may be s i g n i f i c a n t i n i t s proposed b i n d i n g to a c i d i c groups on LPS (see d i s c u s s i o n below). Computer-aided a n a l y s i s of the amino a c i d sequence of the mature p r o t e i n i n d i c a t e d that p r o t e i n Hli was l i k e l y to form about 10% h e l i x , 28% extended c h a i n , 28% reverse t u r n , and 34% c o i l a c c o r d i n g to the secondary s t r u c t u r e p r e d i c t i o n model of G a m i e r e_t a_l_. (1978) . Hydropathy p r o f i l e a n a l y s i s by the method of Kyte and D o o l i t t l e (1982) d i d not r e v e a l any l a r g e , hydrophobic regions thought to be capable of c r o s s i n g a membrane i n the a l p h a - h e l i c a l conformation (Figure 8 ). However, there were at l e a s t two f a i r l y hydrophobic regions (from r e s i d u e s 91-103 and 116-130 of the mature p r o t e i n ) that might c r o s s the membrane i n the beta-sheet conformation (Paul and Rosenbusch, 1985). I n t e r e s t i n g l y , the sma l l c l u s t e r of b a s i c amino a c i d s (around r e s i d u e 110 of the 61 Hydropathy plot, for protein H 1 3 10 2 0 3 0 4 0 5 0 6 0 7 0 , 8 0 9 0 Res idue number 3 - 2 -_ T 111M11111111111M111111111111111 i n i n 1 1 1 1 1 1 1 11111111111 II 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 Res idue number 1 6 0 1 7 0 Figure 8. Hydropathy p l o t f o r p r o t e i n HI. Hydropathy valves were c a l c u l a t e d according to the model of Kyte and D o o l i t t l e (1982). The more p o s i t i v e the value, the more hydrophobic the residue ( i n the context of i t s nearest; neighbours). The p l o t does not include the leader sequence; residue 1 i s the f i r s t amino a c i d of the mature p r o t e i n , i n contrast to Figure 7. 62 mature p r o t e i n ) was s i t u a t e d between the two most hydrophobic r e g i o n s and was fla n k e d by re s i d u e s l i k e l y to c o n t r i b u t e to tur n s t r u c t u r e . This region might be a l i k e l y candidate f o r a s i t e of i n t e r a c t i o n with a n i o n i c LPS at the c e l l s u r f a c e . When the amino a c i d sequence was compared with those i n a sequence databank by using the FASTA program, there were no s t r i k i n g s i m i l a r i t i e s to other outer membrane p r o t e i n s whose sequences are known. The h i g h e s t s i m i l a r i t y score was found with hemolysin A of E. c o l i , which had 26.3% i d e n t i t y with oprH over a s t r e t c h of 95 amino a c i d r e s i d u e s (not shown). This and other s i m i l a r i t i e s were probably too l i m i t e d to be of f u n c t i o n a l s i g n i f i c a n c e ( D o o l i t t l e , 1986). 9. Summary P r o t e i n HI was p u r i f i e d by s e l e c t i v e s o l u b i l i z a t i o n s i n detergent and EDTA of H181 outer membranes, followed by e i t h e r anion-exchange chromatography or SDS-PAGE. The y i e l d of pure p r o t e i n HI from two c y c l e s of chromatography was poor. P u r i f i c a t i o n by SDS-PAGE, by c o n t r a s t , gave good y i e l d s , though with some d e n a t u r a t i o n of the p r o t e i n . P r o t e i n HI p u r i f i e d by chromatography was contaminated by an equi-molar or higher c o n c e n t r a t i o n of LPS e n r i c h e d i n molecules with 0 s i d e c h a i n s , suggesting an a s s o c i a t i o n between the two, whereas p r o t e i n HI p u r i f i e d by SDS-PAGE lacked d e t e c t a b l e LPS. For these reasons, p r o t e i n p u r i f i e d 63 by SDS-PAGE was s u i t a b l e m a t e r i a l f o r N-terminal amino a c i d sequencing, amino a c i d a n a l y s i s , and antiserum p r o d u c t i o n . P r o t e i n HI could a l s o be p u r i f i e d from outer membranes of the rough mutant AK1012 by doing a l t e r n a t i v e detergent s o l u b i l i z a t i o n s . O l i g o n u c l e o t i d e s complementary to the upstream end of the s t r u c t u r a l gene f o r p r o t e i n H i , oprH, were designed using the N-terminal sequence of the p u r i f i e d p r o t e i n . Probing of chromosomal d i g e s t s with the o l i g o n u c l e o t i d e s r e v e a l e d that oprH was probably a s i n g l e - c o p y gene, and allowed oprH to be cloned i n E^ c o l i . N u c l e o t i d e sequence a n a l y s i s confirmed the c l o n i n g and suggested the p o s s i b i l i t y of a t t e n u a t i o n as a mechanism of r e g u l a t i o n . The d e r i v e d amino a c i d sequence i n d i c a t e d a s l i g h t l y b a s i c p r o t e i n of 178 r e s i d u e s , with two f a i r l y hydrophobic segments. However, the sequence d i d not c l o s e l y resemble any others p r e s e n t l y known. 64 CHAPTER 2 EXPRESSION OF CLONED oprH IN E. c o l i AND P. aeruginosa 1. E x p r e s s i o n of oprH i n E. c o l i ; E f f e c t s of growth  medium, s u b c l o n i n g , and promoter type Clones were t e s t e d f o r e x p r e s s i o n of p r o t e i n HI or tr u n c a t e d forms of p r o t e i n Hi by SDS-PAGE and Western immuno-b l o t t i n g of c e l l l y s a t e s and probing of b l o t s with a p r o t e i n H l - s p e c i f i c p o l y c l o n a l antiserum (Table I V ) . Lysates were made from c e l l s grown i n e i t h e r LB broth with the p l a c inducer i s o p r o p y l t h i o g a l a c t o s i d e or i n M9-glucose medium (with a p p r o p r i a t e supplements) d e f i c i e n t i n d i v a l e n t c a t i o n s 2 + 2 + ( c o n t a i n i n g only 50uM Mg and 20uM Ca ). The former medium induces e x p r e s s i o n from the l a c promoter (plac) of pu"C, pTZ and pRK v e c t o r s , and the l a t t e r was designed to induce e x p r e s s i o n from the promoter of oprH i f p o s s i b l e . No e x p r e s s i o n was detected i n e i t h e r c l o n e c o n t a i n i n g the 1.3kb PstI fragment i n pUC18 (pGBl, pGB2). The 1.3kb fragment was cloned i n t o both o r i e n t a t i o n s of pUC9 (to gi v e pGB3 and pGB4) and pUC8 (to gi v e pGB5 and pGB6) to give f u s i o n of the cloned DNA to the l a c Z ' gene i n a l l three r e a d i n g frames. The 0.5 kb SmaI fragment of pGB2 was subcloned i n t o pTZ18R i n both o r i e n t a t i o n s (to gi v e p G B l l and pGBl2). No e x p r e s s i o n of products c r o s s - r e a c t i v e with Table IV. Levels of expression of cloned oprH DNA i n E. c o l i and P. aeruginosa. Host Vector DNA fragment Plasmid Level of expression i n St r a i n (promoter type) containing oprH number3 Orientation LB M9-glucose BM2-succinate E. c o l i E. c o l i JM101 E . c o l i D ^ ^ F ' none pUC18 (plac) pUC9 none 1 .3kb PstI pUC8 II pTZ18R pUC18 II pRK767 pRK404 pRK767 pRK404 pNMl85 (£ ) 0.5kb Smal-PstI 2.8kb EcoRI pGBl pGB2 pGB3 pGB4 pGB5 pGB6 pGBll pGB12 pGB'22 PGB122 £ pGB23 pGB123 pGB24 pGBl24 pGB25 + + + + +/-+/-++ ++ e f ++ ++ +++ +++ +/-+/-i ++ ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND pUC18 (plac) 1.8kb BamHI-Sall pGB32 ND pTZ18R " 1.4kb BamHI-Kpnl pGBl42 ND Host s t r a i n Vector DNA fragment Plasmid (promoter type) containing oprH number3 O r i e n t a t i o n L e v e l of expression i n LB M9-glucose BM2-succinate E. c o l i DH5<X.F' pTZ18R (plac) 0.8kb Smal-Kpnl pGB52 " " pTZ18U " 1.9kb EcoRI-Kpnl pGB62 pGB162 ND ND ND 2.3kb EcoRI-Sall pGB172 ND P. aeruginosa PA01 none none pRK767 (plac) pRK404 pNMl85 <p ) 2.8kb EcoRI pGB23 pGB123 pGB25 + + + + + + ++ ND e ++ J +++ + + P. aeruginosa H181 none none +++ +++ +++ 3 Plasmids with numbers below 100 (e.g. pGBl) contained oprH DNA fragments from the chromosome of PA01; plasmids with numbers above 100 (e.g. pGB122) contained DNA from the chromosome of H181. k O r i e n t a t i o n of oprH r e l a t i v e to vector promoter: +, same; - opposite. C Levels of expression of oprH were judged v i s u a l l y from appearance of p r o t e i n HI bands (or bands c r o s s - r e a c t i n g w i t h p r o t e i n Hi) on SDS gels and Western immunoblots of c e l l l y s a t e s . -, none detected; +/- t r a c e ; +, ++, +++, i n c r e a s i n g amounts. ^ P a r t i a l oprH gene (see r e s t r i c t i o n map, Figure 6). e C e l l s grown i n medium l a c k i n g benzoate. C e l l s grown i n medium with benzoate added as co-inducer of p : 5mM f o r E_. c o l i ; 2mM f o r P. aeruginosa. , not determined. 6 7 p r o t e i n HI was observed i n any of these c l o n e s , i n s p i t e of the f a c t that i n p G B l l , oprH was connected by l a c Z ' by a 90-base p a i r s t r e t c h of open-reading frame (Figure 7 ) . P o s s i b l y t h i s i s connected to the p o t e n t i a l a t t e n u a t o r sequence d e s c r i b e d above (Figure 7). When the e n t i r e oprH gene was cloned i n a 2.8kb EcoRI fragment i n t o puC18 to g i v e pGB22 and pGBl22, p r o d u c t i o n of p r o t e i n HI was detected (Table IV). Since both plasmids contained oprH in the o p p o s i t e o r i e n t a t i o n from the p l a c i n the v e c t o r (Table I I ) , e x p r e s s i o n must have o r i g i n a t e d from a promoter i n the cloned P. aeruginosa DNA. Bands cor r e s p o n d i n g to the heat-modified (apparent MW of 21,000) and heat-unmodified (apparent MW of 18,000) forms of p r o t e i n HI were observed i n g e l s and Western b l o t s (Figures 9 and 10). In a d d i t i o n , a band of apparent MW 24,000, which was presumably p r o t e i n HI with i t s leader p e p t i d e s t i l l attached ( p r e H l ) , was observed i n c o n s i s t e n t l y . P r o d u c t i o n of p r o t e i n HI was b a r e l y or not d e t e c t a b l e when c e l l s were grown in LB b r o t h , but was s u b s t a n t i a l i n c e l l s grown i n M9-glucose (Figure 9 ) . The l e v e l s of the d i v a l e n t c a t i o n s Mg^ + and Ca ^ + had no e f f e c t on p r o d u c t i o n of p r o t e i n HI, so the cloned oprH gene was apparently not s u b j e c t to the same mechanism of r e g u l a t i o n as the chromosomal oprH gene i n P_. aeruginosa. The oprH genes from PA01 ( i n pGB22) and H181 ( i n pGBl22) gave s i m i l a r l e v e l s of e x p r e s s i o n and behaved i n an otherwise 68 Figure 9_. S D S-polyacrylamide gel electrophoretogram (panel A) and Western immunoblot (panel B) of c e l l lysates of E_. c o l i c a r r y i n g plasmids with oprH DNA, showing production of protein H1. Panel B i s a Western b l o t of a gel i d e n t i c a l to the one i n panel A, probed with antiserum s p e c i f i c f o r p r o t e i n H1. Lane 1, P_. aeruginosa H181 outer membrane ( p o s i t i v e c o n t r o l ) ; lane 2, IS. c o l i DH5«XF'/pUC18 (negative c o n t r o l ) ; lane 3, DH5OCF'/pGB23; lane 4, DH5°CF'/ pGB24; lane 5, DH5°tF'/pGBl42; lane 6, DH5«F ,/pGB52. -|5 u g of pr o t e i n was loaded i n lane 1, and 30ug loaded i n each of the other lanes. Running p o s i t i o n s of p r o t e i n H1 bands are shown on the l e f t of each panel, and running p o s i t i o n s of relevant MW standards (in thousands) on the r i g h t . The E. c o l i c e l l s were grown i n M9-glucose with a m p i c i l l i n . 69 Figure 10. SDS-polyacrylamide gel electrophoretogram (panel A ) and Western immunoblot (panel B) of f r a c t i o n a t e d IS. c o l i c e l l s producing p r o t e i n H1. Panel B i s a Western b l o t of a gel i d e n t i c a l to the one i n panel A , probed with antiserum s p e c i f i c f o r p r o t e i n H1. Lane 1, P_. aeruginosa H181 outer membrane (p o s i t i v e c o n t r o l ) . Lanes 2-6, IS. c o l i DH5°^F'/pGBl22 c e l l u l a r f r a c t i o n s : whole c e l l s (lane 2), outer membranes (lane 3), inner membranes (lane 4), envelopes (lane 5), and soluble f r a c t i o n (lane 6). 15ug of p r o t e i n was loaded i n lanes 1, 3 and 4; 20ug i n lanes 5 and 6; and 30ug i n lane 2. Running p o s i t i o n s of p r o t e i n H1 bands, including the presumably unprocessed form (preH1), are shown on the l e f t of each panel; p o s i t i o n s of relevant MW standards ( i n thousands) are on the r i g h t . IS_. c o l i c e l l s were grown i n M9-glucose with a m p i c i l l i n to an A ^ Q Q of 1.4, then f r a c t i o n a t e d as described i n Materials and Methods. 70 i d e n t i c a l f a s h i o n , except that ( i n e x p l i c a b l y ) E. c o l i c a r r y i n g the former plasmid grew more p o o r l y i n M9-glucose. Subcloning of any of the 0.8kb Smal-Kpnl (pGB52), 1.4kb BamHI-Kpnl (pGB142), 1.8kb BamHI-Sall (pGB32), 1.9kb EcoRI-Kpnl (pGB62 and pGB162) or 2.3kb E c o R I - S a l l (pGBl72) fragments (see Table II and F i g u r e 6) i n t o pUC or pTZ ve c t o r s a b o l i s h e d p r o d u c t i o n of p r o t e i n HI by E_. c o l i (Figure 9 and data not shown; Table IV). This s u r p r i s i n g o b s e r v a t i o n suggested that the 0.5kb Sa l l - E c o R I region downstream of oprH (Figure 6) was having a p o s i t i v e r e g u l a t o r y e f f e c t on oprH. In a l l of the c l o n i n g and su b c l o n i n g experiments, no clones were obtained i n which p l a c and oprH were i n the same o r i e n t a t i o n i n a high-copy number v e c t o r , unless the gene was t r u n c a t e d . C l o n i n g of the 2.8 kb EcoRI fragment i n t o the low-copy number v e c t o r s pRK404 and pRK767 reve a l e d that e x p r e s s i o n of oprH could a l s o be d r i v e n by p l a c (Table IV) . Where p l a c and oprH were i n the same o r i e n t a t i o n (pGB23 and pGBl23), the l e v e l s of p r o t e i n HI produced were higher than those obtained from the oprH promoter alone i n a high-copy number vector (Figures 9 and 10). Where p l a c and oprH were i n opposite o r i e n t a t i o n s (pGB24 and pGB124), p r o t e i n Hi l e v e l s were a small f r a c t i o n of those obtained from pGB23 and pGB123 (Figure 9 ) . This i n d i c a t e d that i n E. c o l i , p l a c was capable of d r i v i n g much higher p r o d u c t i o n of p r o t e i n HI than was the 71 oprH promoter. Presumably, i f ex p r e s s i o n from p l a c occurred i n a high-copy number ve c t o r the r e s u l t i n g p r o t e i n Hi l e v e l would be l e t h a l (see above). Expre s s i o n of oprH could a l s o o r i g i n a t e from the twin p ^ promoters of the vector pNM185 (in pGB25) when co-induced by added benzoate. P r o t e i n HI pro d u c t i o n was a l s o higher i n M9-glucose than in LB. 2. E x p r e s s i o n of oprH i n E. c o l i : Export and p r o c e s s i n g of  p r o t e i n HI F r a c t i o n a t i o n of E. c o l i c e l l s producing p r o t e i n HI suggested that the p r o t e i n might be exported to the outer membrane (Figure 10). P r o t e i n HI bands were]found i n the envelope, outer membrane and inner membrane f r a c t i o n s , but none were detected i n the s o l u b l e f r a c t i o n . However, c e l l f r a c t i o n a t i o n s t u d i e s alone are not a r e l i a b l e i n d i c a t o r of the c e l l u l a r l o c a t i o n of a p r o t e i n , e s p e c i a l l y one from a f o r e i g n s p e c i e s (Randall e_t al_., 1987). This may be p a r t i c u l a r l y t rue f o r p r o t e i n HI i n E. c o l i s i n c e the preHl form was found i n the outer membrane f r a c t i o n r a t h e r than i n the inner membrane or cytoplasm, suggesting that i t s p o s i t i o n i n the sucrose g r a d i e n t s may have been the r e s u l t of aggregation of the p r o t e i n (Figure 10). Nev e r t h e l e s s , the f a c t that at l e a s t some of the p r o t e i n Hi molecules were p r o t e o l y t i c a l l y processed argued that p r o t e i n Hi was probably present i n the outer membrane. 72 3. Overproduction of p r o t e i n HI from cloned oprH i n  P. aeruginosa P r o t e i n HI i s produced at a low l e v e l from the chromosomal oprH gene when P. aerug inosa PA01 i s grown in 2+ Mg - s u f f i c i e n t minimal medium and a high l e v e l when grown i n 2+ Mg - d e f i c i e n t medium (Nicas and Hancock, 1980). To boost p r o d u c t i o n of p r o t e i n HI, independent of e i t h e r growth i n 2+ Mg - d e f i c i e n t medium or the mutation in H181, plasmids pGB23 and pGBl23 (see Table II and above) were t r a n s f e r r e d by t r i p a r e n t a l c o n j u g a t i o n from E. c o l i to P. aeruginosa PA01. PA01 c o n t a i n i n g pGB23 and pGB123 d i d not produce p r o t e i n Hi at l e v e l s s i g n i f i c a n t l y higher than PA01 without a plasmid when c e l l s were grown i n PP2 broth or BM2-succinate medium (Table IV). In M9-glucose, s l i g h t l y higher l e v e l s were produced, but these were s t i l l s u b s t a n t i a l l y lower than the p r o t e i n HI l e v e l produced by H181 (data not shown). Th e r e f o r e , the 2.8kb EcoRI fragment was cloned i n t o a second type of broad-host range v e c t o r , pNM185, to g i v e pGB25 (Fi g u r e 11). In t h i s plasmid, oprH e x p r e s s i o n could now be d r i v e n from the twin p_m promoters d e r i v e d from the TOL plasmid. These promoters are under c o n t r o l of the XylS p r o t e i n and i t s co-inducer benzoate, and are h i g h l y a c t i v e i n Pseudomonas s p e c i e s (Mermod e_t al_. , 1986). pGB25 was t r a n s f e r r e d to PA01, i n which i t gave s u b s t a n t i a l l y e l e v a t e d p r o d u c t i o n of p r o t e i n H i , even without added benzoate (Figure 73 Figure 11. Diagram of plasmid pGB25. Thin l i n e , pNMl85 DNA; thick l i n e , P_. aeruginosa PA01 DNA- Po s i t i o n s of genes etc. are i n d i c a t e d outside the c i r c l e : oprH, s t r u c t u r a l gene f o r p r o t e i n H1; Sm, streptomycin resistance gene; o r i , o r i g i n of r e p l i c a t i o n ; n i c , r e l a x a t i o n nick s i t e ; mob, genes f o r mo b i l i z a t i o n functions; rep, genes f o r r e p l i c a t i v e functions, Km, kanamycin resistance gene; xylS, gene f o r the p o s i t i v e regulator a c t i n g on p^; p^, twin TOL promoters. Arrowheads i n d i c a t e d i r e c t i o n of t r a n s c r i p t i o n of genes or o r i e n t a t i o n of promoters. Only relevant r e s t r i c t i o n s i t e s are shown. Information on pNMl85 i s from Mermod et^ a l . , 1986. 74 12). The l e v e l was s i m i l a r to that found i n H181. R a t i o s of c o n c e n t r a t i o n s of p r o t e i n H l / p r o t e i n H2 i n c e l l envelopes were determined by d e n s i t o m e t r i c scanning of g e l lanes (not shown). P r o t e i n H2 l e v e l s remain r e l a t i v e l y constant under d i f f e r e n t c o n d i t i o n s , so were used as a standard (Nicas and Hancock, 1983). H1/H2 r a t i o s were 1.0 (for PA01), 7.4 (for H181), 7.1 ( f o r PA01/pGB25 without added benzoate), and 9.0 (fo r PA01/pGB25 with benzoate). As i n E. c o l i , growth i n M9-glucose was r e q u i r e d to o b t a i n the highest l e v e l of oprH e x p r e s s i o n . However, when i n d i v i d u a l components of M9-glucose that were d i f f e r e n t from BM2-succinate (carbon 2+ 2+ source, added Ca , added NaCl, lack of added Fe ) were t e s t e d , none a f f e c t e d oprH e x p r e s s i o n . 4. E f f e c t of oprH e x p r e s s i o n on a n t i b i o t i c s u s c e p t i b i l i t y E_. c o l i clones producing p r o t e i n HI had u n a l t e r e d s u s c e p t i b i l i t y to polymyxin B (data not shown). The p r o t e i n had not been expected to have an e f f e c t i n t h i s d i f f e r e n t background, e s p e c i a l l y i n view of the s u b s t a n t i a l l y d i f f e r e n t LPS s t r u c t u r e (Nikaido and Hancock, 1986). Overproduction of p r o t e i n Hi from cloned oprH i n 2+-' P. aeruginosa, grown in M9-glucose with 2mM or 500uM Mg , with or without added benzoate, d i d not a f f e c t the MICs of polymyxin B or gentamicin f o r the organism. However, k i l l i n g of PA01 by EDTA i n the presence of T r i s was a f f e c t e d by 75 -H1* 1 2 3 4 5 6 7 8 Figure 12. SDS-polyacrylamide gel electrophoretogram of P. aeruginosa c e l l lysates showing overproduction of protein H1 from oprH on a plasmid. Lanes 1 and 2, PA01; lanes 3 and 4, H181; lanes 5 and 6, PA01/pNM185; lanes 7 and 8, PA01/pGB25. 30ug of pr o t e i n was loaded i n each lane. The running p o s i t i o n of protein H1 i s shown on the r i g h t . C e l l s were grown i n M9-glucose with 500uM Mg 2 + to a A ^ Q Q of 0.4-0.6. C e l l s i n lanes 2, 4, 6 and 8 were grown with added 2mM benzoate. 76 A. E D T A killing; no benzoate j PAOI HHl H181 U l l pNM185 K8%88l P G B 2 5 100 f O. 0.25mM 10mM EDTA concentration B. E D T A killing + benzoate 0.1 mM 0.25mM 10mM EDTA concentration Figure 13. K i l l i n g of P. aeruginosa, overproducing p r o t e i n H1 from the oprH gene on a plasmid, by EDTA (+Tris). Mid-logarithmic phase cultures i n M9-glucose (500uM Mg2+) with (A) or without (B) 2mM benzoate were exposed to various concentrations of EDTA ( i n 10mM T r i s , pH 8.5) f o r 5 minutes, then d i l u t e d and p l a t e d i n duplicate f o r viable colonies. pNM185, PA01 carrying pNM185 (vector alone); pGB25, PA01 carr y i n g pGB25 (pNMt85 + 2.8 kb EcoRI fragment with oprH). 77 p r o d u c t i o n of p r o t e i n HI from pGB25. Over a range of EDTA c o n c e n t r a t i o n s from 0.1 to lOmM, PA01 c a r r y i n g pGB25 had 12-to >40-fold more s u r v i v o r s than PA01 c a r r y i n g only the v e c t o r pNM185. Re p r e s e n t a t i v e data are shown g r a p h i c a l l y i n F i g u r e 13. The r e s u l t s were s i m i l a r with or without added benzoate, i n d i c a t i n g that the l e v e l of p r o t e i n HI produced i n the absence of benzoate (Figure 12) was s u f f i c i e n t to cause the phenotypic change. Since no other new p o l y p e p t i d e s were detected i n PA01 that had a c q u i r e d pGB25 (Figure 12 and data not shown) the r e s i s t a n c e to EDTA was a p p a r e n t l y caused by o v e r p r o d u c t i o n of p r o t e i n HI. However, the s u r v i v a l r a t e s of EDTA-treated PA01/pGB25 were c o n s i s t e n t l y below those of H181 t r e a t e d i n an i d e n t i c a l manner (Figure 13 and data not shown); the d i f f e r e n c e i n s u r v i v a l r a t e v a r i e d between 4- and 100-fold depending on the EDTA c o n c e n t r a t i o n . So the f u l l l e v e l of EDTA r e s i s t a n c e e x h i b i t e d by H181 could not be matched by PA01/pGB25, i n s p i t e of equal p r o t e i n HI l e v e l s when c e l l s were grown with added benzoate (Figures 12 and 13). P r o t e i n HI o v e r p r o d u c t i o n i t s e l f was t h e r e f o r e p a r t l y r e s p o n s i b l e f o r the EDTA-resistance e x h i b i t e d by p r o t e i n H l -overproducing c e l l s . By c o n t r a s t , p r o t e i n HI o v e r p r o d u c t i o n alone had no d e t e c t a b l e e f f e c t on s u s c e p t i b i l i t y to polymyxin B measured i n the same way (Figure 14 and data not shown). 78 A . p o l y m y x i n B k i l l ing : n o b e n z o a t e PAOI MMU H181 i l i i l pNMl85 pGB25 100 10 <0.1 0.5ug/ml 2.0ug/ml 20ug/ml polymyxin B concentration B. p o l y m y x i n B k i l l ing + b e n z o a t e P A O ! H H I H181 I . _J pNM185 tSS$888i pGB25 100 10 <0.1 0.5ug/ml 2.0ug/ml 20ug/ml polymxin B concentration Figure 14. K i l l i n g of p. aeruginosa, overproducing p r o t e i n H1 from the oprH gene on a plasmid, by polymyxin B. Mid-logarithmic phase cultures i n M9-glucose (500 uM Mg 2 +) with (A) or without (B) 2mM benzoate were exposed to various concentrations of polymyxin B i n 30mM phosphate buffer, pH 7.0, for 5 minutes, then d i l u t e d and pl a t e d i n duplicate f o r v i a b l e colonies. pNM185, PA01 carying pNM185; pGB25, PA01 car r y i n g pGB25. 79 5. Summary P r o t e i n HI was produced by E_. c o l i c e l l s c a r r y i n g oprH DNA on plasmids provided the gene was complete. The p r o t e i n was e i t h e r p a r t l y or f u l l y p r o t e o l y t i c a l l y processed and probably exported to the outer membrane. oprH could be expressed from a promoter on the cloned DNA provided that a downstream sequence was not d e l e t e d . However, much higher l e v e l s of e x p r e s s i o n could be d i r e c t e d by the l a c or TOL promoters. P r o t e i n HI p r o d u c t i o n was higher i n M9-glucose than i n b r o t h . The s u s c e p t i b i l i t y of E. c o l i to polymyxin B was not a f f e c t e d , however, by high l e v e l s of p r o t e i n HI pro d u c t i o n i n E_. c o l i . . P r o t e i n HI was produced at l e v e l s much higher than background when e x t r a copies of the oprH gene were present i n an e x p r e s s i o n v e c t o r i n P_. aerug i n o s a . This o v e r p r o d u c t i o n caused decreased s u s c e p t i b i l i t y of c e l l s to k i l l i n g by EDTA, although the r e s i s t a n c e l e v e l d i d not match that of the mutant H181. No changes i n s u s c e p t i b i l i t y to polymyxin B or gentamicin were detected as a r e s u l t of over p r o d u c t i o n of p r o t e i n HI alone. 80 CHAPTER 3 INTERACTION W I T H LPS AND FUNCTION OF PROTEIN HI 1. S u r f a c e p r o p e r t i e s of p r o t e i n Hl-overproducing c e l l s To extend the o b s e r v a t i o n s recorded p r e v i o u s l y (Nicas and Hancock, 1980 and 1983b; Hancock et a l . , 1981b; Moore et a l . , 1984), some experiments were performed on c e l l s that overproduced p r o t e i n Hi by v i r t u e of e i t h e r growth i n d i v a l e n t c a t i o n - d e f i c i e n t medium or mutation. The s t u d i e s d e s c r i b e d here were designed to i d e n t i f y s u r f a c e changes of c e l l s overproducing p r o t e i n HI. Measurement of c e l l s u r f a c e h y d r o p h o b i c i t y by adhesion to the hydrocarbon xylene 2+ i n d i c a t e d that p r o t e i n Hl-overproducing c e l l s (Mg - d e f i c i e n t PA01; H181) were l e s s hydrophobic than those that produced 2+ the p r o t e i n at a low l e v e l (Mg - s u f f i c i e n t PAOl; Table V ) . PAOl and H181 were a l s o compared to t h e i r uptake of 1-N-phenylnaphthylamine, a probe that i s f l u o r e s c e n t i n hydrophobic environments (Loh e_t a^. , 1984). No d i f f e r e n c e s i n uptake, or enhancement of uptake by polymyxin B, gentamicin or E D T A , were observed (data not shown). PAOl and H181 a l s o had the same i n t e r a c t i o n with dansyl-polymyxin, a probe of p o l y c a t i o n - b i n d i n g s i t e s on LPS (Newton, 1955; Moore et a l . , 1986), and the e f f e c t s of c o m p e t i t i o n f o r probe 81 Table V. Surface hydrophobicity of p r o t e i n Hl-overproducing c e l l s measured by adhesion to xylene. 2+ [Mg ] A60o b A600 c S i g n i f i c a n c e Number of c e l l s S t r a i n uM a (control) (xylene-treated) level** per d r o p l e t 6 PA01 500 0.640+/_0.022 0.456+/_0.027 p<0.01 >100 20 0.496+/ 0.012 0.504+/ 0.011 co n t r o l lower f <10 H181 500 0.698+/_0.016 0.723+/_0.004 con t r o l lower <10 20 0.520+/ 0.007 0.681+/ 0.072 con t r o l lower <10 a 2+ Mg concentration of growth medium. b Absorbance at 600nm (mean of 4 experiments +/_ standard error of mean) of untreated c e l l s . c A600 °f aqueous phase a f t e r c e l l s were vortexed with xylene and phases allowed to separate. A reduction compared with the control i n d i c a t e s adhesion to xylene by r e l a t i v e l y hydrophobic c e l l s . d Significance l e v e l , by Student t - t e s t , of difference tbetween c o n t r o l and xylene-treated values. e Determined by microscopic examination of xylene droplets a f t e r vortexing with c e l l s . f Control absorbances may be lower because of contamination of the aqueous phases of xylene-treated samples by o p t i c a l l y dense xylene droplets during p i p e t t i n g . I t follows that a l l a ^ Q Q values f o r xylene-treated c e l l s are probably.overestimates. 82 2+ b i n d i n g s i t e s by added Mg were i d e n t i c a l (data not shown). I t was d i f f i c u l t , t h e r e f o r e , to analyse the s u r f a c e changes at a molecular l e v e l . 2. C r o s s - l i n k i n g s t u d i e s Some evidence f o r i n t e r a c t i o n between p r o t e i n HI and LPS i n outer membranes was found d u r i n g p u r i f i c a t i o n of the p r o t e i n (see above). Molecular c r o s s - l i n k i n g s t u d i e s were done i n an attempt to demonstrate a c l o s e a s s o c i a t i o n . However, no c r o s s - l i n k i n g of p r o t e i n HI with LPS or any other c o n s t i t u e n t of PA01 outer membranes could be demonstrated by using e i t h e r d i t h i o b i s ( s u c c i n i m i d y l propionate) or g l u t a r a l d e h y d e (data not shown). 3. E f f e c t of LPS mutations i n combination with p r o t e i n HI  o v e r p r o d u c t i o n on a n t i b i o t i c s u s c e p t i b i l i t y In p r e v i o u s s t u d i e s (Nicas, T.I. and R.E.W. Hancock, unpublished d a t a ) , pseudorevertant s t r a i n s of H181 were i s o l a t e d t h a t continued to overproduce p r o t e i n HI but had regained w i l d - t y p e s u s c e p t i b i l i t y to polymyxin B. These pseudorevertants, H222 and H223, had second mutations that changed t h e i r LPS type from smooth to rough. In l i g h t of these o b s e r v a t i o n s , a s e r i e s of PA01 d e r i v a t i v e s with d e f i n e d or p a r t l y - d e f i n e d a l t e r a t i o n s i n LPS (Table I and F i g u r e 1) were examined here. These s t r a i n s , i n a d d i t i o n to PA01, H181 83 2+ 2 + and H222, were grown i n Mg - s u f f i c i e n t (500uM) and Mg d e f i c i e n t (20uM) medium and t h e i r s u s c e p t i b i l i t i e s to polymyxin B were measured by the MIC method (Table V I ) . P r o t e i n Hi p r o d u c t i o n was i n c r e a s e d i n a l l of the 2+ s t r a i n s by growing i n Mg - d e f i c i e n t medium. H181 and H222 2+ overproduced p r o t e i n HI even i n Mg - s u f f i c i e n t medium, but 2+ produced more p r o t e i n s t i l l i n Mg - d e f i c i e n t c o n d i t i o n s . 2+ Mg - d e f i c i e n t w i l d - t y p e s t r a i n s (PAOl and OT684) were s i g n i f i c a n t l y l e s s s u s c e p t i b l e to polymyxin B than the same 2+ s t r a i n s grown in Mg - s u f f i c i e n t medium (Table VI) as had been observed p r e v i o u s l y (see I n t r o d u c t i o n ) . By c o n t r a s t , a l l of the L P S - a l t e r e d mutants except AK1401 showed no such 2+ decrease i n s u s c e p t i b i l i t y i n Mg - d e f i c i e n t medium. (It i s p o s s i b l e that AK1282, AK1012 and AK1414 d i d e x h i b i t some decrease i n s u s c e p t i b i l i t y that was masked by the higher a c t i v i t y of polymyxin B i n low c o n c e n t r a t i o n s of d i v a l e n t c a t i o n s (Newton, 1954), but even i f t h i s were so the decrease must have been much sm a l l e r than that seen in PAOl, OT684 and 2 + AK1401.) Mg - s u f f i c i e n t H181 was l e s s s u s c e p t i b l e than 7 + PA01, and Mg - d e f i c i e n t H181 l e s s s u s c e p t i b l e s t i l l , whereas H222 was s u s c e p t i b l e i n both media. The l e v e l of s u s c e p t i b i l i t y to polymyxin B t h e r e f o r e c o r r e l a t e d i n v e r s e l y with p r o d u c t i o n of p r o t e i n Hi except i n mutants AK1282, AK1012, AK1414 and H222. These four mutants a l l lack 0-a n t i g e n and p a r t s of the core o l i g o s a c c h o r i d e of LPS (Figure 84 Table VI. E f f e c t of LPS mutations i n combination with p r o t e i n H1 overproduction on s u s c e p t i b i l i t y to polymyxin B. 2+ a [M9" jj] Geometric mean MIC Protein H1 ( S t r a i n uM of polymyxin B, ug/ml overproduced PA01 500 5.7 20 20* + AK1282 500 1.3 20 2.2 + AK1012 500 1.8 20 1.8 + AK1414 500 4.0 20 6.3 + 0T684 500 2.8 20 20* + AK1401 . 500 2.2 20 13* + H181 500 20 + 20 90* ++ H222 500 2.8 + 20 2.5 ++ a LPS types of s t r a i n s were v e r i f i e d by SDS-PAGE of c e l l lysates and s i l v e r -s t a i n i n g (see Figure 1). b 2+ Concentration of Mg i n BM2-succinate medium. c Geometric mean of s i x MIC determinations. d Protein H1 induction was assessed v i s u a l l y by SDS-PAGE of c e l l lysates. 2+ S i g n i f i c a n t l y d i f f e r e n t from 500uM Mg value at p = 0.05 by Wilcoxon Rank Sum t e s t . 85 1), whereas AK1401 l a c k s O-antigen but has a w i l d - t y p e c o r e . T h i s suggested that i f p r o t e i n HI were d i r e c t l y i n v o l v e d i n polymyxin r e s i s t a n c e , t h i s r e s i s t a n c e might be mediated by i n t e r a c t i o n of the p r o t e i n with a p o l y m y x i n - s u s c e p t i b l e s i t e i n the outer core r e g i o n . I f the s i t e were l o s t by mutation, p r o t e i n HI would no longer p r o t e c t the LPS from d i s r u p t i o n by the a n t i b i o t i c . By c o n t r a s t , LPS mutations d i d not cause a b o l i t i o n of 2+ the r e s i s t a n c e to gentamicin or to EDTA + T r i s seen i n Mg d e f i c i e n t c e l l s (data not shown), as they d i d f o r polymyxin B r e s i s t a n c e . T e s t i n g of c a r b e n i c i 1 1 i n s u s c e p t i b i l i t y , which i s not a f f e c t e d by the l e v e l of p r o t e i n HI (Nicas and Hancock, 1980) was a l s o done as a c o n t r o l , and the data 2+ showed that the lack of polymyxin r e s i s t a n c e i n Mg - d e f i c i e n t L P S - a l t e r e d mutants was not merely caused by a g e n e r a l i n c r e a s e i n a n t i b i o t i c s u s c e p t i b i l i t y (data not shown). Analyses of LPS of c e l l l y s a t e s by SDS-PAGE with s i l v e r -s t a i n i n g d i d not show any q u a l i t a t i v e d i f f e r e n c e s between 2+ 2+ Mg - s u f f i c i e n t and Mg - d e f i c i e n t c e l l s of any of the s t r a i n s (data not shown). However, i t i s p o s s i b l e that there may be s u b t l e changes in LPS s t r u c t u r e r e s p o n s i b l e f o r the 2+ polymyxin B - r e s i s t a n t phenotype of Mg - d e f i c i e n t c e l l s and H181 (see above and D i s c u s s i o n below). I f t h i s were t r u e , the LPS mutations somehow a b o l i s h e d the p r o t e c t i v e e f f e c t of the changes. 86 4. Approaches to mutagenesis of oprH S e v e r a l approaches were used to t r y to i s o l a t e a mutant of PA01 completely d e f i c i e n t i n p r o d u c t i o n of p r o t e i n H i , f o r f u n c t i o n a l and a n t i b i o t i c - s u s c e p t i b i l i t y s t u d i e s . Random Tn 5 0 1 - i n s e r t i o n mutants (Tsuda et_ a^., 1984) were generated and screened f o r lack of r e a c t i o n with p r o t e i n H l - s p e c i f i c 2+ antiserum and f o r lack of growth on Mg - d e f i c i e n t medium. The l a t t e r screen was based on the hypothesis that p r o t e i n HI might be e s s e n t i a l f o r growth i n these c o n d i t i o n s . N e i t h e r method turned up a p r o t e i n H l - d e f i c i e n t mutant from over 6,000 c o l o n i e s screened. Bacteriophage s e l e c t i o n performed on Tn501- and Tn5-7 5 1 - i n s e r t i o n mutants ( R e l l a et_ a_l. , 1985) was a l s o u n s u c c e s s f u l . However, i t had not been f i r m l y e s t a b l i s h e d that p r o t e i n HI was the receptor f o r the phages used (Nicas, T.I., Ph.D T h e s i s , U n i v e r s i t y of B r i t i s h Columbia, 1982) . C l o n i n g of the s t r u c t u r a l gene f o r p r o t e i n HI, oprH, allowed the i n s e r t i o n i_n v i t r o of a DNA fragment c o n t a i n i n g Tn501 i n t o the PstI s i t e s w i t h i n the gene. In s p i t e of ex t e n s i v e e f f o r t s , however, the mutant gene would not r e p l a c e the w i l d - t y p e gene i n the chromosome of PA01. P o s s i b l y the p r o t e i n H l - d e f i c i e n t phenotype i s l e t h a l under normal c o n d i t i o n s i n PA01. 87 5. P r o p e r t i e s of P. aeruginosa ATCC33354 I t was shown p r e v i o u s l y that r e p r e s e n t a t i v e s t r a i n s of a l l I n t e r n a t i o n a l Antigen Typing Scheme serotypes of P. aeruginosa overproduced a p r o t e i n of the same apparent MW as 2+ HI when grown i n Mg - d e f i c i e n t medium, with the s i n g l e e x c e p t i o n of s t r a i n ATCC33354 (serotype 6; N i c a s , T.I., Ph.D. T h e s i s , U n i v e r s i t y of B r i t i s h Columbia, 1982). Western b l o t a n a l y s i s showed that ATCC33354 produced no d e t e c t a b l e p r o t e i n HI (data not shown). This s t r a i n and PAOl (serotype 5) were 2+ 2+ t h e r e f o r e grown i n Mg - s u f f i c i e n t and Mg T d e f i c i e n t media and t h e i r s u s c e p t i b i l i t i e s to polymyxin B, f o r which the l a r g e s t change i n a n t i b i o t i c s u s c e p t i b i l i t y i s seen, were 2+ t e s t e d (Table V I I ) . Growth of ATCC33354 i n Mg - d e f i c i e n t medium d i d r e s u l t i n a s i g n i f i c a n t , 2 . 2 - f o l d decrease i n 2+ s u s c e p t i b i l i t y to polymyxin B compared with Mg - s u f f i c i e n t ATCC33354. The change was s m a l l e r than that observed f o r PAOl ( 3 . 2 - f o l d ) , but not s i g n i f i c a n t l y so. However, ATCC33354, u n l i k e PAOl, was l e s s s u s c e p t i b l e to the c o n t r o l 2+ drug c a r b e n i c i l l i n when grown i n Mg - d e f i c i e n t medium. I t was p o s s i b l e , t h e r e f o r e , to induce r e s i s t a n c e to polymyxin B i n the absence of p r o t e i n HI, but the r e s i s t a n c e l e v e l may have been lower. ATCC33354 was as able as PAOl and H181 to grow i n BM2-s u c c i n a t e medium s e v e r e l y d e f i c i e n t i n d i v a l e n t c a t i o n s (data not shown). Some growth occurred even i n medium c o n t a i n i n g 88 Table VII. S u s c e p t i b i l i t y to polymyxin B and c a r b e n i c i l l i n of P. aeruginosa PA01 (serotype 5) and ATTCC33354 (serotype 6) grown i n Mg2+-sufficient and M g 2 + - d e f i c i e n t medium. b Geometric mean MIC ug/ml 2+ [Mg ] POLYMYXIN B CARBENICILLIN uM a PA01 ATTCC33354 PA01 ATCC33354 500 20 5.0 16 (p = 0.002) 5.7 13 (p = 0.04) 23 8.0 (p = 0.004) 10 18 (p = 0.04) a 2+ Concentration of Mg i n BM2-succinate medium. b Geometric mean of s i x MIC determinations. c S i g n i f i c a n c e l e v e l by Wilcoxon Rank Sum t e s t of difference between 500uM Mg 2 + and 20uM Mg 2 + values. 89 2+ only 200nM added Mg . It i s hard to draw any f i r m c o n c l u s i o n s about the f u n c t i o n of p r o t e i n Hi based on these r e s u l t s , however, s i n c e the g e n e t i c backgrounds of PAOl and ATCC33354 are q u i t e d i s t i n c t (Mutharia et a l . , 1982). 6. Pr o d u c t i o n of p r o t e i n Hi by P. aeruginosa grown i n mice C e l l s of the v i r u l e n t P_. aeruginosa s t r a i n M2 grown i n chamber implants i n mice ( K e l l y et^ a_l^, 1987) were analysed on a Western b l o t f o r p r o d u c t i o n of p r o t e i n Hi (Figure 15). The p r o t e i n was present but was not appa r e n t l y produced at high l e v e l s (see a l s o K e l l y et_ al_. , 1989). T h i s suggested that the f l u i d i n s i d e the chambers may have contained s u f f i c i e n t d i v a l e n t c a t i o n s to prevent i n d u c t i o n of oprH e x p r e s s i o n , but t h i s was not measured. 7. Summary The f u n c t i o n of p r o t e i n Hi may be to i n t e r a c t with a n i o n i c groups on LPS at the c e l l s u r f a c e , c o n f e r r i n g s t a b i l i t y when d i v a l e n t c a t i o n s are present i n low c o n c e n t r a t i o n s . However, i t was hard to con f i r m or deny t h i s h y p o thesis owing to the u n a v a i l a b i l i t y of an ijn v i t r o assay f o r p r o t e i n Hi f u n c t i o n or of a p r o t e i n H l - d e f i c i e n t mutant. P r o t e i n Hl-overproducing c e l l s had a l t e r e d s u r f a c e h y d r o p h o b i c i t y , but no i n t e r a c t i o n between p r o t e i n HI and LPS could be demonstrated by molecular c r o s s - l i n k i n g . C e r t a i n 90 Figure 15. SDS-polyacrylamide gel electrophoretogram (panel A) and Western immunoblot (panel B) showing expression of p r o t e i n H1 by P. aeruginosa grown i n chamber implants i n mice. Lane 1, lysate of M2 c e l l s grown i n chambers (30ug of p r o t e i n ) . Lane 2, PA01 outer membrane (c o n t r o l ; 15ug of p r o t e i n ) . Some of the p r o t e i n i n lane 1 may be host material. The running p o s i t i o n of protein H1 i s shown on the r i g h t of each panel. 91 LPS mutations r e s u l t i n g i n the d e l e t i o n of core r e s i d u e s a f f e c t e d the polymyxin B (but not gentamicin or EDTA) r e s i s t a n c e phenotype of p r o t e i n Hl-overproducing c e l l s . The p r o p e r t i e s of a serotype 6 P_. aeruginosa s t r a i n suggested 2+ that the c e l l may have responses to growth i n Mg - d e f i c i e n t medium, other than p r o t e i n H l - o v e r p r o d u c t i o n , that a f f e c t a n t i b i o t i c s u s c e p t i b i l i t y . P r o t e i n HI was produced at low l e v e l s i n b a c t e r i a grown in chamber implants i n mice, so was u n l i k e l y to a f f e c t a n t i b i o t i c s u s c e p t i b i l i t y i n v i v o . 92 CHAPTER 4 2+ Mg -REGULATED CELL ENVELOPE PROTEINS OF SPECIES RELATED TO  P. aeruginosa 2+ 1. Envelope p r o t e i n s i n d u c i b l e by growth i n Mg - d e f i c i e n t  medium and r e a c t i v i t y with antiserum to p r o t e i n Hi Var i o u s s p e c i e s of b a c t e r i a r e l a t e d to P. aeruginosa 2+ ( l i s t e d i n Table I) were grown i n Mg - s u f f i c i e n t (500uM) or 2+ Mg - d e f i c i e n t (20 or 50 uM) medium and t h e i r c e l l envelopes 2+ analysed by SDS-PAGE f o r any p r o t e i n s induced under Mg d e f i c i e n t c o n d i t i o n s . The apparent MW of the p o l y p e p t i d e s observed are shown i n Table V I I I . S e v e r a l s t r a i n s produced 2+ Mg - r e g u l a t e d p o l y p e p t i d e s s i m i l a r i n s i z e to p r o t e i n HI of P_. aerug i n o s a . Only one, of apparent MW 20,000 from P_. c h l o r a p h i s , c r o s s - r e a c t e d immunologically with p r o t e i n Hi (Figure 16). If the r e a c t i v e p r o t e i n was the major band i n d i c a t e d i n F i g u r e 16, i t was only very weakly c r o s s -r e a c t i v e with p r o t e i n HI; a l t e r n a t i v e l y , there might have been a s t r o n g l y - r e a c t i v e band present i n low copy number c l o s e to the major band. The P_. c h l o r a p h i s p r o t e i n was, l i k e p r o t e i n H i , h e a t - m o d i f i a b l e but the running p o s i t i o n of the p r o t e i n when s o l u b i l i z e d at 22°C c o u l d not be seen. 93 Table VIII. Mg -regulated c e l l envelope proteins. Apparent MW of band(s) O x induced under Mg - R e a c t i v i t y of d e f i c i e n t conditions bands with .antiserum Species S t r a i n (thousands) to protein H1 P. u chloraphis ATCC9446 20 + p. fluorescens^ ATCC949 c II ATCC13525 19 d p. . , b putida ATCC4359 55, 22 -p. .b s t u t z e r i ATCC17588 21 -p. b syringae ATCC19310 -p. cepacia ATCC25416 17 -II ATCC25609 -X. ma l t o p h i l i a ATCC13637 -A. calcoaceticus 8197 15 -Envelopes were s o l u b i l i z e d at 100°C. Members of rRNA homology group I, which includes P_^  aeruginosa. -, no band seen. -, no detectable r e a c t i v i t y with antiserum. 94 Figure 16. SDS-polyacrylamide gel electrophoretogram (panel A) and Western immunoblot (panel B) of c e l l envelopes of P_. aeruginosa and P. chloraphis. Panel B i s a Western b l o t of a gel i d e n t i c a l to the one i n panel A, probed with antiserum s p e c i f i c f o r p r o t e i n H1. Lane 1, P_. aeruginosa PA01 (Mg2+-s u f f i c i e n t ) ; lanes 2, PA01 (Mg2 +-deficient); lanes 3 and 5, P_. chloraphis (Mg2+-sufficient); lanes 4 and 6, P. chloraphis (Mg2+-deficient). Samples i n lanes 1-4 were s o l u b i l i z e d at 100°C before loading; samples i n lanes 5 and 6 were s o l u b i l i z e d at 22°C. 30ug of protein was loaded i n each lane. Running positions of p r o t e i n H1 bands are shown on the l e f t of each panel. The H1-l i k e p r o t e i n of P_. chloraphis i s indicated by arrows. 95 2. Polymyxin B s u s c e p t i b i l i t y of P. c h l o r a p h i s P. c h l o r a p h i s , and two s p e c i e s that a p p a r e n t l y d i d not produce any H l - l i k e p r o t e i n s , were t e s t e d f o r s u s c e p t i b i l i t y 2+ 2+ to polymyxin B i n Mg - s u f f i c i e n t and Mg - d e f i c i e n t media 2+ (Table IX). Mg - d e f i c i e n t P. c h l o r a p h i s , l i k e P. aeruginosa, demonstrated a s u b s t a n t i a l decrease i n s u s c e p t i b i l i t y to polymyxin B ( 5 - f o l d , p = 0.002) compared 2+ with i t s Mg - s u f f i c i e n t c o u n t e r p a r t . P. f l u o r e s c e n s d i s p l a y e d a s l i g h t but s t a t i s t i c a l l y i n s i g n i f i c a n t decrease 2+ (p = 0.18) i n 50uM Mg , while the s u s c e p t i b i l i t y of P. p u t i d a was unchanged. The H l - l i k e p r o t e i n may have been a 2+ f a c t o r c o n t r i b u t i n g to the polymyxin r e s i s t a n c e of Mg d e f i c i e n t P. c h l o r a p h i s , but i t should be noted that t h i s s p e c i e s was s u b s t a n t i a l l y more r e s i s t a n t than P_. aeruginosa 2+ to both polymyxin and c a r b e n i c i 1 1 i n r e g a r d l e s s of Mg concent r a t i o n . 3. Summary S e v e r a l s p e c i e s of b a c t e r i a r e l a t e d to P. aeruginosa produced envelope p r o t e i n s that were i n d u c i b l e by growth i n 2+ Mg - d e f i c i e n t medium and s i m i l a r i n apparent MW to p r o t e i n HI. A p r o t e i n of apparent MW 20,000 from P_. c h l o r a p h i s r e a c t e d with antiserum to p r o t e i n HI. P_. c h l o r a p h i s , l i k e P. aerugino s a , was s u b s t a n t i a l l y l e s s s u s c e p t i b l e to polymyxin B 2+ 2+ in Mg - d e f i c i e n t medium than i t was i n Mg - s u f f i c i e n t medium. Table IX. S u s c e p t i b i l i t y to polymyxin B and c a r b e n i c i l l i n of Pseudomonas species grown i n 2+ . . 2+ Mg - s u f f i c i e n t and Mg - d e f i c i e n t medium. Geometric mean MIC ug/ml POLYMYXIN B CARBENICILLIN 2+ Mg uM a P. aerug. PAOl P. chlor. P. f l u o r . ATCC949 P. putida P. aerug. PAOl P. c h l o r . P. f l u o r . P. ATCC949 put i d a 500 5.0 23 110 2.4 23 720 1000 110 50 9.0 180 2.0 9.0* 720 27* 20 16* 110* c c 8.0* 510 - -Concentration of Mg i n BM2-succinate medium. Geometric mean of s i x MIC determinations (four f o r P. p u t i d a ) . 2+ P. fluorescens and P. putida would not grow i n 20uM Mg *, s i g n i f i c a n t l y d i f f e r e n t from 500um Mg^ + value at p = 0.05 by Wilcoxon Rank Sum t e s t . 97 DISCUSSION 1. General p r o p e r t i e s of p r o t e i n HI Outer membrane p r o t e i n HI of P_. aerug inosa i s one of two p r o t e i n s o r i g i n a l l y named " p r o t e i n H" by Mizuno and Kageyama (1978), but separated by SDS-PAGE in g e l s c o n t a i n i n g NaCl and renamed HI and H2 by Hancock and Carey (1979) . Although the l a t t e r i s now the accepted nomenclature, the f a c t that " p r o t e i n H" c o n s i s t s of two d i s t i n c t p o l y p e p t i d e s has escaped some authors (e.g. Ward et_ al_. , 1988). HI i s a heat-m o d i f i a b l e p r o t e i n of apparent MW 21,000 which i s u n a f f e c t e d by 2-mercaptoethanol ( i . e . probably c o n t a i n s no d i s u l p h i d e bonds) and i s not l i n k e d to p e p t i d o g l y c a n (Hancock and Carey, 1979; Hancock et a l . , 1981a). D i f f i c u l t i e s i n p u r i f y i n g p r o t e i n HI because of apparent i n s t a b i l i t y of the p a r t i a l l y p u r i f i e d p r o t e i n were repo r t e d p r e v i o u s l y (Hancock e_t a^. , 1982b), but i n t h i s study l i t t l e d e gradation was seen. Smearing of p r o t e i n HI bands ( e s p e c i a l l y the heat-unmodified band; see F i g u r e 2) on SDS g e l s was caused by l o a d i n g of l a r g e sample volumes onto shallow s t a c k i n g g e l s . T h i s o b s e r v a t i o n , and the use of t r i c h l o r o a c e t i c a c i d treatment i n a d d i t i o n to heating at 100°C in SDS to cause a higher p r o p o r t i o n of p r o t e i n Hi molecules to run i n the heat-modified p o s i t i o n on g e l s , aided 98 i n the p u r i f i c a t i o n of the p r o t e i n from s o l u b i l i z e d OM by SDS-PAGE. The y i e l d s obtained by SDS-PAGE were much higher than those obtained using anion-exchange chromatography. I t was d i f f i c u l t to separate p r o t e i n Hi from other OM p r o t e i n s on anion-exchange columns, perhaps because of formation of "mixed m i c e l l e s " of T r i t o n X-100 ( c o n t a i n i n g more than one p r o t e i n s p e c i e s ) . SDS-PAGE and e l e c t r o e l u t i o n caused d e n a t u r a t i o n of some p r o t e i n HI molecules, but t h i s could be avoided by c a r e f u l p a s s i v e e l u t i o n of p r o t e i n from g e l s l i c e s . 2. I n t e r a c t i o n of p r o t e i n HI with LPS Most surface-exposed OM p r o t e i n s are b e l i e v e d to i n t e r a c t with LPS, presumably by hydrophobic i n t e r a c t i o n with f a t t y - a c y l t a i l s of l i p i d A i n the i n t e r i o r of the membrane (Nikaido and Vaara, 1985). There may a l s o be e l e c t r o s t a t i c i n t e r a c t i o n between charged groups on p r o t e i n and LPS at the OM s u r f a c e . As mentioned i n the i n t r o d u c t i o n , i t i s d i f f i c u l t to determine the nature of these i n t e r a c t i o n s except i n model systems of q u e s t i o n a b l e r e l e v a n c e (Beher et^ a l . , 1980; B o r n e l e i t e_t aJU , 1989). Since p r o t e i n HI has been hypothesized to s t a b i l i z e a n i o n i c LPS, a c t i n g as a s u b s t i t u t e f o r d i v a l e n t c a t i o n s (Nicas and Hancock, 1980), evidence f o r p r o t e i n Hl-LPS i n t e r a c t i o n was sought i n t h i s study. Since detergent-99 s o l u b i l i z a t i o n of a p r o t e i n i n v o l v e s s u b s t i t u t i o n of detergent molecules f o r l i p i d i c molecules surrounding the p r o t e i n (Hjelmeland and Chrambach, 1984), the d i f f e r e n t d e t e r g e n t - s o l u b i l i t y of p r o t e i n HI i n OM of smooth (H181) and rough (AK1012) s t r a i n s suggested that the i n t e r a c t i o n of p r o t e i n HI with l i p i d i c molecules i n the OM was a l t e r e d (by the l o s s of O-antigen and pa r t of the core) i n AK1012. This might i n d i c a t e that the detergents were d i s r u p t i n g an i n t e r a c t i o n between p r o t e i n HI and LPS. The a l t e r n a t i v e e x p l a n a t i o n , that the rough mutation somehow caused the OM to adopt a conformation that r e s t r i c t e d access of the detergent to p r o t e i n HI (e.g. formation of i n s o l u b l e aggregates), seemed u n l i k e l y s i n c e many other OM p r o t e i n s p e c i e s were s u c c e s s f u l l y s o l u b i l i z e d under the same c o n d i t i o n s that f a i l e d to s o l u b i l i z e p r o t e i n HI i n AK1012. A second o b s e r v a t i o n , the presence of an equi-molar or l a r g e r amount of LPS i n anion-exchange column f r a c t i o n s c o n t a i n i n g p r o t e i n Hi f r e e of other p r o t e i n s ( a f t e r two c o n s e c u t i v e c y c l e s of chromatography) a l s o suggested p r o t e i n Hl-LPS i n t e r a c t i o n . The high content of smooth (O-antigen-containing) LPS molecules i n the pure p r o t e i n Hi p r e p a r a t i o n suggested that p r o t e i n Hi might a s s o c i a t e most s t r o n g l y with t h i s type of LPS. Although i t was u n l i k e l y that the p r o t e i n HI and LPS c o - p u r i f i e d by chance, i t i s p o s s i b l e that mixed m i c e l l e s of p r o t e i n HI and LPS were i n t r i n s i c a l l y more s t a b l e than 100 m i c e l l e s c o n t a i n i n g p r o t e i n HI alone, even i n the absence of an a s s o c i a t i o n between the two. Th e r e f o r e , i t was d i f f i c u l t to prove that p r o t e i n Hl-LPS i n t e r a c t i o n e x i s t e d i n i n t a c t OM. I n c i d e n t a l l y , p r o t e i n Hi p u r i f i e d by p r e p a r a t i v e SDS-PAGE lacked LPS contamination. The absence of LPS was a l s o observed f o r other P. aerug inosa OM p r o t e i n s p u r i f i e d by the same method (Parr e_t a_l., 1986), although other workers (Poxton e_t a^l., 1985) have reported that some p r o t e i n bands on SDS-polyacrylamide g e l s are complexes of p r o t e i n and LPS. Mole c u l a r c r o s s - l i n k i n g a n a l y s i s has been used to detect oligomers of OM p r o t e i n s (Reithmeier and Bragg, 1977). The technique d i d not demonstrate any p r o t e i n Hl-LPS a s s o c i a t i o n here, although the success of c r o s s - l i n k i n g c a t i o n s depends on the r e q u i r e d r e a c t i v e groups being a v a i l a b l e (Lundblad and Noyes, 1984). Attempts to demonstrate p r o t e i n Hl-LPS i n t e r a c t i o n by r e n a t u r a t i o n of the pure p r o t e i n by LPS were a l s o u n s u c c e s s f u l . In c o n c l u s i o n , there i s l i m i t e d evidence f o r i n t e r a c t i o n of p r o t e i n HI and LPS i n the P_. aeruginosa OM, but even st r o n g evidence would be i n s u f f i c i e n t to prove that p r o t e i n HI binds LPS at the a n i o n i c s i t e s of the l a t t e r . Defined a l t e r a t i o n or l o s s of s p e c i f i c s i t e s on p r o t e i n HI and LPS molecules i n i n t a c t c e l l s , presumably achieved by s i t e -d i r e c t e d mutagenesis, would be necessary to r e s o l v e t h i s i s s u e . The e f f e c t of c e r t a i n mutations d e l e t i n g p a r t s of LPS 101 on a n t i b i o t i c s u s c e p t i b i l i t y was determined, and i s d i s c u s s e d below. 3. S t r u c t u r e and f u n c t i o n of p r o t e i n HI. From the n u c l e o t i d e sequence of the oprH gene, the amino a c i d sequence of p r o t e i n Hi was d e r i v e d . I t c o n s i s t e d of 199 r e s i d u e s , not counting the N-terminal methionine. From the N-terminal sequence of the p u r i f i e d p r o t e i n , the mature p r o t e i n was deduced to c o n t a i n the l a s t 178 r e s i d u e s ( g i v i n g a molecular weight of 19,399, c a l c u l a t e d from Table I I I ) . The remaining 21 had two p o s i t i v e l y charged r e s i d u e s at the N-terminal end, a f a i r l y hydrophobic N-terminal t w o - t h i r d s , and v a l y l and a l a n y l r e s i d u e s three and one amino a c i d ( s ) from the mature p r o t e i n , r e s p e c t i v e l y , g i v i n g i t c h a r a c t e r i s t i c s t y p i c a l of a leader p e p t i d e of an exported p r o k a r y o t i c p r o t e i n (Randall e_t al_. , 1987). The l a r g e r s p e c i e s of p r o t e i n HI observed in E. c o l i was presumably the unprocessed form c o n t a i n i n g the f u l l 199 r e s i d u e s . The mature p r o t e i n was f a i r l y r i c h i n asparagine and g l y c i n e , but, perhaps more s i g n i f i c a n t l y , contained more b a s i c than a c i d i c r e s i d u e s (pi = 8.6 a c c o r d i n g to a s i m p l i f i e d t h e o r e t i c a l c a l c u l a t i o n ; S i l l e r o and R i b e i r o , 1989). Most OM p r o t e i n s so f a r c h a r a c t e r i z e d are a c i d i c (Lugtenberg and van Alphen, 1983), so t h i s p r o p e r t y of p r o t e i n HI may be r e l a t e d to i t s proposed f u n c t i o n i n b i n d i n g a n i o n i c LPS. Other exceptions to t h i s r u l e are s e v e r a l OM 102 p r o t e i n s of N e i s s e r i a gonorrhoeae, some of which have i s o e l e c t r i c p o i n t s above 8.4 (Jones et^ aj^. , 1980). The c a t i o n i c r e s i d u e s were f a i r l y evenly d i s t r i b u t e d except f o r a c l u s t e r of thre e , which were p o s i t i o n e d between the two most hydrophobic segments of the p r o t e i n . The two hydrophobic regions might be arranged i n a n t i - p a r a l l e l membrane-spanning beta-sheet conformation, j o i n e d at the outer s u r f a c e of the OM by turn and random c o i l s t r u c t u r e c o n t a i n i n g the l y s y l and a r g i n y l r e s i d u e s . In t h i s way, the c a t i o n i c r e s i d u e s might be i n a p o s i t i o n to i n t e r a c t with n e g a t i v e l y - c h a r g e d groups i n the core or l i p i d A of LPS. This model i s p u r e l y s p e c u l a t i v e , however, and s u f f e r s from the drawback that there are three a s p a r t y l r e s i d u e s i n the p r o t e i n HI sequence c l o s e to the l y s i n e + a r g i n i n e c l u s t e r . These a s p a r t y l r e s i d u e s might n e u t r a l i z e the p o s i t i v e charges. The amino a c i d sequence of p r o t e i n HI bore no s u b s t a n t i a l s i m i l a r i t i e s to any other documented sequences, s u p p o r t i n g the idea that i t has a novel f u n c t i o n . Although i t s s l i g h t b a s i c i t y was a t y p i c a l , the p r e d i c t e d secondary s t r u c t u r e of p r o t e i n HI was low i n h e l i x , l i k e most OM p o r i n s (Nikaido and Vaara, 1985). However, p r o t e i n Hi formed no channels i n l i p i d b i l a y e r s (R.E.W. Hancock, per s o n a l communication), and showed no multimers ( t y p i c a l of po r i n s ) i n the c r o s s - l i n k i n g s t u d i e s done here. No other data 103 suggest that channel formation i s the l i k e l y f u n c t i o n of p r o t e i n H i . I t i s d i f f i c u l t at present to make any f i r m statements about the p h y s i o l o g i c a l f u n c t i o n of p r o t e i n H i , s i n c e there i s no a v a i l a b l e assay f o r the p u r i f i e d p r o t e i n i_n v i t r o , nor any p r o t e i n H l - d e f i c i e n t mutant with a d i s t i n g u i s h a b l e phenotype. It remains l i k e l y , from the r e s u l t s mentioned above, that the p r o t e i n i n t e r a c t s with a n i o n i c LPS, and t h i s idea w i l l be supported by the a n t i b i o t i c s t u d i e s d i s c u s s e d below. 4. G e n e t i c s and r e g u l a t i o n of p r o t e i n Hi s y n t h e s i s P r o t e i n Hi i s produced at low l e v e l s by P. aeruginosa 2+ PAOl c e l l s grown i n Mg - s u f f i c i e n t medium, but induced about 2+ 2 0 - f o l d i n Mg - d e f i c i e n t medium (Nicas and Hancock, 1980). Induction can be r e l i e v e d by a d d i t i o n of s u f f i c i e n t 2+ 2+ 2+ q u a n t i t i e s of Ca , Mn or Sr (Nicas and Hancock, 1983b). There are other examples of d i v a l e n t c a t i o n - r e g u l a t e d p r o t e i n s (e.g. Lipson e_t a K , 1988) but no e s t a b l i s h e d mechanism f o r t h i s type of r e g u l a t i o n . Presumably, some element of the c e l l senses the change i n d i v a l e n t c a t i o n c o n c e n t r a t i o n and r e l a y s the message to a r e g u l a t o r of p r o t e i n HI s y n t h e s i s (by analogy with the EnvZ osmosensor, which i n f l u e n c e s e x p r e s s i o n of the ompF and ompC genes f o r OM p r o t e i n s i n E. c o l i ; E p s t e i n , 1983). LPS has a l s o been 104 proposed to a f f e c t e x p r e s s i o n of OM p r o t e i n genes (e.g. Beher et a l . , 1980). The mutations i n the p r o t e i n Hl-overproducing s t r a i n s H181 and H185 apparently derepress the system, although some i n d u c t i o n of p r o t e i n Hi s y n t h e s i s s t i l l occurs i n these mutants. P r o t e i n Hi i s a l s o overproduced i n s t a t i o n a r y phase c u l t u r e s i n most media (Nicas and Hancock, 1980), but t h i s may be r e l a t e d to d i v a l e n t c a t i o n d e p l e t i o n 2+ s i n c e i t i s reversed i n PP2 broth with 5mM Mg added (author's unpublished r e s u l t ) . However, other f a c t o r s do i n f l u e n c e p r o t e i n HI p r o d u c t i o n . I t i s decreased by growing c e l l s at 15°C rather than 30-37°C ( K r o p i n s k i e_t a_l., 1987), and i n c r e a s e d by s u b s t i t u t i n g c i t r a t e + g a l a c t o s e f o r s u c c i n a t e as the carbon source i n BM2 medium (R.E.W. Hancock, unpublished r e s u l t ) . In t h i s study, p r o t e i n Hi was produced at uninduced l e v e l s i n P_. aerug inosa M2 c e l l s c u l t i v a t e d i n chamber implants i n mice. The chambers are perf u s e d by p e r i t o n e a l f l u i d but host c e l l s are excluded ( K e l l y et^ aj^. , 1987). 2+ 2+ Le v e l s of Mg and Ca i n another body f l u i d , human serum, are 0.92 and 1.25mM r e s p e c t i v e l y (Blaser and Luethy, 1988), 2+ 2+ which i s above the l e v e l i n Mg - s u f f i c i e n t BM2 (0.5mM Mg , 2+ and no added Ca ). Probably there are s u f f i c i e n t d i v a l e n t c a t i o n s i n p e r i t o n e a l f l u i d to repress p r o t e i n HI s y n t h e s i s , which i s a l s o reduced i n P_. aeruginosa c e l l s grown i n the presence of serum i n v i t r o (R.E.W. Hancock, unpublished 105 r e s u l t ) . P r o t e i n Hi was r e p o r t e d l y d e t e c t e d i n P. aeruginosa c e l l s i s o l a t e d d i r e c t l y from the sputum of a c y s t i c f i b r o s i s p a t i e n t (Anwar et^ a l . , 1984), but the i d e n t i f i c a t i o n of the p r o t e i n without a s p e c i f i c antiserum must be considered tenuous, e s p e c i a l l y as the same group more r e c e n t l y d e s c r i b e d the p r o d u c t i o n of a " p r o t e i n H" i n P_. aeruginosa c e l l s taken from i n f e c t e d burn wounds (Ward et^ a^. , 1988). These o b s e r v a t i o n s , and the apparent lack of p r o t e i n HI production by P_. aeruginosa serotype 6 in_ v i t r o , make p r o t e i n HI a l e s s l i k e l y c a n d i d a t e f o r a v a c c i n e a n t i g e n than some other OM p r o t e i n s (Mutharia et_ al^., 1982). The s t r u c t u r a l gene f o r p r o t e i n H i , oprH, was found, by probing with complementary o l i g o n u c l e o t i d e s , to be a s i n g l e -copy chromosomal gene. When i t was cloned i n E. c o l i , the gene c o u l d be expressed, as judged by the p r o d u c t i o n of p r o t e i n s recognized by antiserum to p r o t e i n H i . It could be expressed from a promoter on the cloned DNA (presumably i t s own) or from p l a c , the l a t t e r g i v i n g much higher l e v e l s of p r o t e i n HI. Expression of oprH, at l e a s t from i t s own promoter, depended on the presence of a downstream r e g i o n , and was higher i n M9-glucose than i n LB. These r e s u l t s concurred with the general o b s e r v a t i o n that most Pseudomonas promoters are r e l a t i v e l y i n a c t i v e i n E. c o 1 i , whereas there seems to be no major block on t r a n s l a t i o n of Pseudomonas genes p o s i t i o n e d behind E. c o l i promoters (Nakazawa and 106 Inouye, 1986). However, p r o d u c t i o n of l a r g e amounts of f o r e i g n OM p r o t e i n s can be l e t h a l to E_. c o l i , as shown here and elsewhere (e.g. C o r n e l l s et_ al_. , 1989). The i s o l a t e d 2+ oprH gene was not r e g u l a t e d by Mg i n E. c o l l , and the higher e x p r e s s i o n of oprH i n M9-glucose a l s o occurred i n P_. aeruginosa. This suggested that i s o l a t i o n of the gene may have c r e a t e d or unmasked an a l t e r n a t i v e r e g u l a t o r y mechanism. The i n f l u e n c e of the downstream region may, t h e r e f o r e , not operate i n the chromosome of P.. aeruginosa. The downstream region might act as a s i t e of i n t e r a c t i o n , f o r a p r o t e i n that enhances t r a n s c r i p t i o n of remote genes by a f f e c t i n g DNA s u p e r c o i l i n g (Wang, 1982), or i t might be p a r t of a ( h y p o t h e t i c a l ) long mRNA s p e c i e s ( c o n t a i n i n g the t r a n s c r i p t of oprH and downstream DNA) that i s more s t a b l e to enzymic degradation than a s h o r t e r s p e c i e s (Saunders and Saunders, 1987) . DNA sequence a n a l y s i s f a i l e d to f i n d a l i k e l y promoter i n the 90 base p a i r s upstream of the oprH coding r e g i o n . However, the promoter may be not p a r t i c u l a r l y A T - r i c h nor s i m i l a r to the known consensus sequences, or i t may be f u r t h e r upstream. The cloned genes of P. aerug inosa p r o t e i n s F (Duchene et_ a l . , 1988), I ( C o r n e l l s e_t a l . , 1989) and P (Si e h n e l ejt al_. , 1988b) had promoter sequences with s t r o n g homology to the corresponding 13. c o l i consensus sequences, and a l l of these were h i g h l y a c t i v e i n E. c o l i . A p o t e n t i a l 107 r e g u l a t o r y s i g n a l was found i n oprH, centred 74 base p a i r s downstream of the s t a r t of the coding r e g i o n . T h i s r e g i o n of i n v e r t e d complementary sequence homology could give r i s e to stem-loop secondary s t r u c t u r e i n the mRNA t r a n s c r i p t , p o s s i b l y causing premature t e r m i n a t i o n of t r a n s c r i p t i o n . The stem-loop region was not fo l l o w e d by a run of T bases, as are most a t t e n u a t o r s (Landick and Yanofsky, 1987). Such an a t t e n u a t i o n mechanism might e x p l a i n the lack of a d e t e c t a b l e b e t a - g a l a c t o s i d a s e - H l f u s i o n p r o t e i n i n E. c o l i / p G B l l . However, the oprH gene was incomplete i n . t h i s plasmid, and the shortened p r o t e i n may have been degraded r a p i d l y by proteases (Saunders and Saunders, 1987). Sequence a n a l y s i s d i d not r e v e a l the expected terminator sequence i n the 54 base p a i r s downstream of the oprH coding r e g i o n , so the t r a n s c r i p t of oprH may be c o n s i d e r a b l y longer than the gene i t s e l f , as mentioned above. To summarize, the r e g u l a t i o n of oprH e x p r e s s i o n i s app a r e n t l y complex. Studi e s of the cloned gene have revealed some f e a t u r e s , but these may operate only when the gene i s i s o l a t e d on a plasmid. I t w i l l be argued below that p r o t e i n HI s y n t h e s i s i s l i k e l y to be r e g u l a t e d c o - o r d i n a t e l y with s y n t h e s i s of other molecules. 5. Role of p r o t e i n HI i n a n t i b i o t i c r e s i s t a n c e i n  P. aeruginosa S t u d i e s of P. aeruginosa c e l l s that overproduced p r o t e i n 108 HI, because of growth in d i v a l e n t c a t i o n - d e f i c i e n t medium or mutation (Nicas and Hancock, 1980 and 1983b; Hancock et a l . , 1981b), l e d to the hypothesis that p r o t e i n HI i s r e s p o n s i b l e f o r c r o s s - r e s i s t a n c e to polymyxin B, aminoglycosides, and EDTA + T r i s (see I n t r o d u c t i o n f o r d e t a i l s ) . The drawback of these s t u d i e s i s that the p o s s i b i l i t y of changes other than o v e r p r o d u c t i o n of p r o t e i n HI i n the c e l l s cannot be e l i m i n a t e d , although s e v e r a l p o s s i b l e a l t e r a t i o n s were r u l e d out (Nicas and Hancock, 1983b; Moore et_ a_l. , 1984). One approach to r e s o l v i n g t h i s dilemma i s to overproduce p r o t e i n HI independently of both the c e l l u l a r response to d i v a l e n t c a t i o n - d e f i c i e n t c o n d i t i o n s and the ( p o t e n t i a l l y p l e i o t r o p i c ) mutations i n s t r a i n s H181 and H185. T h i s approach was used here, by o b t a i n i n g e x p r e s s i o n of an i s o l a t e d oprH gene on a plasmid i n P_. aeruginosa. Another approach would be to o b t a i n a p r o t e i n H l - d e f i c i e n t mutant that would be unable to overproduce the p r o t e i n i n d i v a l e n t c a t i o n - d e f i c i e n t medium, but would presumably r e t a i n any other p h y s i o l o g i c a l responses to growth i n that medium. The l a t t e r approach proved not to be f r u i t f u l . P_. aeruginosa PA01, overproducing p r o t e i n Hi from a plasmid-borne oprH gene behind a s t r o n g promoter (pGB25), had s i m i l a r polymyxin B and gentamicin s u s c e p t i b i l i t y to PA01 l a c k i n g a plasmid or c a r r y i n g the v e c t o r alone. T h i s was i n s p i t e of a p r o t e i n HI l e v e l i n PA01/pGB25 roughly equal to 109 t h a t observed i n H181. I t was concluded t h a t p r o t e i n HI ov e r p r o d u c t i o n alone was not s u f f i c i e n t to cause r e s i s t a n c e to these agents. The data d i d not t e l l whether o v e r p r o d u c t i o n of the p r o t e i n c o n t r i b u t e d to the r e s i s t a n c e of H181, i n a s s o c i a t i o n with some other a l t e r a t i o n . A serotype 6 P. aeruginosa s t r a i n l a c k i n g p r o t e i n HI, 2+ ATCC33354, d i d demonstrate polymyxin B r e s i s t a n c e i n Mg d e f i c i e n t medium, suggesting that p r o t e i n Hi may pl a y l i t t l e or no pa r t i n t h i s phenotype. However, ATCC33354 i s d i s t i n c t from PAOl (serotype 5) i n more than j u s t LPS O-antigen composition; i t i s not s u s c e p t i b l e to c e r t a i n phages that r e c o g n i z e OM p r o t e i n r e c e p t o r s on PAOl (Mutharia et_ a l . , 1982) and i t grows more slowly than PAOl ( t h i s study, data not shown). Therefore, the data f o r ATCC33354 are not s t r i c t l y comparable to those f o r PAOl. PA01/pGB25 d i d , however, have decreased s u s c e p t i b i l i t y to k i l l i n g by EDTA + T r i s . The r e s i s t a n c e observed was p r i m a r i l y to the EDTA component, s i n c e T r i s i s not l e t h a l at the c o n c e n t r a t i o n s used, and r e d u c t i o n of the EDTA c o n c e n t r a t i o n i n c r e a s e d s u r v i v a l r a t e s ( T r i s i s used to p o t e n t i a t e the e f f e c t s of EDTA; Nikaido and Vaara, 1985). PA01/pGB25 was not as r e s i s t a n t to EDTA + T r i s as H181, so f o r the f u l l l e v e l of r e s i s t a n c e of the l a t t e r , some other a l t e r a t i o n was presumably r e q u i r e d . T h i s "second a l t e r a t i o n " was probably c o - o r d i n a t e l y r e g u l a t e d with p r o t e i n Hi 110 s y n t h e s i s , s i n c e the independent mutants H181 and H185 app a r e n t l y had only one mutation each (based on r e v e r s i o n s t u d i e s ) and both had the same phenotype (Nicas and Hancock, 1980). This "second a l t e r a t i o n " may be the same one r e q u i r e d f o r r e s i s t a n c e to polymyxin B and gentamicin. Although the EDTA-resistance of PA01/pGB25 was only p a r t i a l , i t i s the f i r s t c o n c l u s i v e evidence of a phenotype caused by p r o t e i n HI ove r p r o d u c t i o n alone. Since EDTA i s well-known to act as d i v a l e n t c a t i o n - b i n d i n g s i t e s on LPS, and has no other s i g n i f i c a n t t a r g e t s as f a r as can be e s t a b l i s h e d , the r e s u l t s s t r o n g l y suggest that p r o t e i n HI ove r p r o d u c t i o n i n f l u e n c e s these s i t e s i n some way. The p o s s i b l e mechanisms of t h i s i n f l u e n c e w i l l be d i s c u s s e d below. Production of high l e v e l s of p r o t e i n HI i n E_. c o l i d i d not a f f e c t i t s s u s c e p t i b i l i t y to polymyxin B. This was not s u r p r i s i n g because E. c o l i LPS d i f f e r s g r e a t l y from P. aeruginosa LPS, e s p e c i a l l y i n i t s much lower phosphate content (Nikaido and Hancock, 1986), so would be u n l i k e l y to i n t e r a c t i n the c o r r e c t way with p r o t e i n HI even i f such i n t e r a c t i o n were r e s p o n s i b l e f o r polymyxin B r e s i s t a n c e . Moreover, the E_. c o l i s t r a i n s used were d e r i v a t i v e s of the rough s t r a i n K-12, and some rOugh P_. aeruginosa mutants examined i n t h i s study were not polymyxin B - r e s i s t a n t when p r o t e i n HI was overproduced. E. c o l i i s l e s s s u s c e p t i b l e than P. aeruginosa to EDTA (Hancock, 1984) and I l l a m inoglycosides may use the p o r i n pathway of uptake i n E. c o l i (Nakae and Nakae, 1982), so these agents were not t e s t e d . Mutations r e s u l t i n g i n the l o s s of the O-antigen and v a r i o u s p a r t s of the core o l i g o s a c c h a r i d e of LPS i n P. aeruginosa a b o l i s h e d the r e s i s t a n c e to polymyxin B, but not to gentamicin or EDTA + T r i s , seen i n w i l d - t y p e c e l l s grown 2+ i n Mg - d e f i c i e n t medium. There are s e v e r a l p o s s i b l e e x p l a n a t i o n s f o r these data. The s i m p l e s t would i n v o l v e c o m p o s i t i o n a l or c o n f i g u r a t i o n a l changes in LPS (brought about by the e f f e c t of reduced d i v a l e n t c a t i o n c o n c e n t r a t i o n on gene expression) being r e s p o n s i b l e f o r polymyxin B r e s i s t a n c e (which occurs at the gene l e v e l , as the H181 and H185 mutant phenotype shows). The rough mutations would then act as suppressors of the r e s i s t a n t phenotype, presumably by a l t e r i n g LPS s t r u c t u r e to make the changes r e s p o n s i b l e f o r polymyxin B r e s i s t a n c e no longer p o s s i b l e . The changes in 2+ LPS of Mg - d e f i c i e n t w i l d - t y p e c e l l s would not be d e t e c t a b l e on g e l s , s i n c e no d i f f e r e n c e was observed when such an a n a l y s i s was done. An a l t e r n a t i v e e x p l a n a t i o n could i n v o l v e p r o t e i n HI i n that changes i n LPS i n combination with p r o t e i n HI o v e r p r o d u c t i o n could be r e s p o n s i b l e f o r polymyxin B 2+ r e s i s t a n c e i n Mg - d e f i c i e n t medium. In t h i s i n s t a n c e , l o s s of O-antigen plu s core m a t e r i a l i n the rough mutants might e l i m i n a t e a b i n d i n g s i t e f o r p r o t e i n HI (e.g. a phosphate i n 112 the outer c o r e ) , or change LPS conformation so that p r o t e i n HI could no longer i n t e r a c t i n the f a s h i o n r e q u i r e d f o r polymyxin B r e s i s t a n c e . 6. A model mechanism of a n t i b i o t i c r e s i s t a n c e f o r p r o t e i n  Hl-overproducing c e l l s As d i s c u s s e d above, p r o t e i n Hl-overproducing c e l l s a p p a r e n t l y have one or more a d d i t i o n a l a l t e r a t i o n ( s ) that are r e q u i r e d f o r r e s i s t a n c e to polymyxin B and geritamicin, and f o r p a r t of the r e s i s t a n c e to EDTA. The a d d i t i o n a l change(s) i s / a r e l i k e l y to occur i n LPS, f o r the f o l l o w i n g reasons: (a) s i t e s on LPS are the l i k e l y t a r g e t s f o r p e r m e a b i 1 i z a t i o n by p o l y c a t i o n s and c h e l a t o r s as d i s c u s s e d i n the I n t r o d u c t i o n , t h e r e f o r e c r o s s - r e s i s t a n c e to these agents might r e a d i l y be caused by a l t e r a t i o n s i n LPS i t s e l f ; (b) the r e s i s t a n c e a p p a r e n t l y occurs at the l e v e l of uptake across the OM ( I n t r o d u c t i o n ) , and a l t e r a t i o n s i n p h o s p h o l i p i d s and OM p r o t e i n s (except HI) have v i r t u a l l y been r u l e d out as p o s s i b l e causes of r e s i s t a n c e to polymyxin B, gentamicin, and EDTA i n these c e l l s (Nicas and Hancock, 1980; Moore e_t a l . , 1984); (c) a l t e r a t i o n s in LPS are a s s o c i a t e d with changes i n s u s c e p t i b i l i t y to one or more of these agents i n v a r i o u s mutants of Gram-negative s p e c i e s (Hancock, 1984); (d) c e r t a i n mutations i n LPS suppressed the r e s i s t a n c e to polymyxin B u s u a l l y seen i n p r o t e i n Hl-overproducing c e l l s 113 ( t h i s s t u d y ) . Furthermore, p r o t e i n Hl-overproducing c e l l s were shown here to have a l t e r e d s u r f a c e h y d r o p h o b i c i t y , and t h i s would probably be caused by LPS changes, i f not by p r o t e i n Hi i t s e l f . The proposed LPS a l t e r a t i o n ( s ) , then, may act independently of or i n concert with p r o t e i n Hi overproduct i o n . V a r i o u s types of LPS a l t e r a t i o n might c o n t r i b u t e to the r e s i s t a n t phenotype. F i g u r e 17 shows a s e r i e s of diagrams of L P S - d i v a l e n t c a t i o n b i n d i n g s i t e s . Panel A shows a s i t e of the type b e l i e v e d to be common i n the OM of P. aeruginosa. Adjacent ("B-band") LPS molecules are c r o s s - b r i d g e d through phosphate groups (these could be r e p l a c e d by c a r b o x y l groups) 2+ 2+ i n the core (or l i p i d A) regions by a Mg (or Ca ) i o n . As e x p l a i n e d i n the I n t r o d u c t i o n , these c r o s s - b r i d g e s are b e l i e v e d to be an important component of OM s t a b i l i t y (Nikaido and Vaara, 1985). They are g e n e r a l l y s u s c e p t i b l e , though, to d i s r u p t i o n by polymyxin B, gentamicin or EDTA as i n d i c a t e d i n F i g u r e 17, panel A. Panels B to F show a l t e r n a t i v e s t r u c t u r e s that could a r i s e from a l t e r a t i o n s i n LPS (or o v e r p r o d u c t i o n of p r o t e i n H i ) , and the l i k e l y s u s c e p t i b i l i t y of those to the three agents. The diagram i s s i m p l i f i e d as that one s i t e i s co n s i d e r e d at a time, but one LPS molecule could possess d i f f e r e n t types of s i t e f o r i t s d i f f e r e n t a n i o n i c groups. A l s o , the s u r f a c e of a c e l l would presumably c o n t a i n a mixture of types of s i t e , with the 114 Figure 17. Schematic diagrams (not to scale) of LPS-divalent cation binding s i t e s i n the OM of P_. aeruginosa. Each panel i s a crossr-section of the OM, two LPS molecules i n width, i n which the s i t e s are arranged d i f f e r e n t l y . Only relevant atoms are indicated. The l i k e l y s u s c e p t i b i l i t i e s of each type of s i t e to polymyxin B (Px), gentamicin (Gm) and EDTA are shown: S, susceptible; R, r e s i s t a n t ; S/R, susceptible or r e s i s t a n t . The c h a r a c t e r i s t i c s of each type of s i t e are explained i n the te x t . 115 o v e r a l l balance determining the c e l l ' s s u s c e p t i b i l i t y to the i n i t i a l (permeabi1ization) step of self-promoted uptake. Panel B a l s o d e p i c t s a c r o s s - b r i d g e , but i t s a c c e s s i b i l i t y has been a l t e r e d by a change i n c o n f i g u r a t i o n (e.g. p o s i t i o n s of phosphate s u b s t i t u t i o n ) or conformation (perhaps i n f l u e n c e d by an a l t e r a t i o n elsewhere i n LPS, or by i n t e r a c t i o n with p r o t e i n HI). I t may now be l e s s s u s c e p t i b l e to one or more of the agents, perhaps because of increased s t e r i c hindrance or a change i n the charge d i s t r i b u t i o n of the environment surrounding the s i t e . Conversion of s i t e s from A - > B i s t h e r e f o r e a p o s s i b l e mechanism f o r r e s i s t a n c e to polymyxin B , gentamicin and EDTA. T h i s would be d i f f i c u l t to measure s i n c e there i s no change in LPS composition as a 31 r e s u l t of A - J * B c o n v e r s i o n , but might be d e t e c t a b l e by P-n u c l e a r magnetic resonance spectroscopy or by b i n d i n g s t u d i e s with a s u i t a b l e probe. (Note that the f l u o r e s c e n t probe dansyl-polymyxin bound no d i f f e r e n t l y to normal and p r o t e i n H l-overproducing c e l l s . ) However, t h i s mechanism seems u n l i k e l y because p r o t e i n Hl-overproducing c e l l s have reduced 2+ envelope Mg c o n c e n t r a t i o n s (Nicas and Hancock, 1980). A l s o , i t would be i l l o g i c a l f o r c e l l s to adapt to growth i n d i v a l e n t c a t i o n - d e f i c i e n t medium without reducing t h e i r requirement f o r the c a t i o n s that were i n s h o r t supply. In panel C, the n e g a t i v e l y - c h a r g e d group has been l o s t by the LPS. This may make the s i t e r e s i s t a n t to polymyxin B 116 and gentamicin, as t h e i r a f f i n i t i e s f o r the s i t e are l i k e l y to be c o n s i d e r a b l y reduced. It i s a l s o c e r t a i n to be more r e s i s t a n t to EDTA s i n c e there i s no c a t i o n to c h e l a t e . However, A-»C conversion would cause weakened i n t e r a c t i o n between adjacent LPS molecules, probably r e s u l t i n g i n enhanced s u s c e p t i b i l i t y to detergents and hydrophobic compounds. This mechanism seems u n l i k e l y because p r o t e i n H l -overproducing c e l l s had u n a l t e r e d s u s c e p t i b i l i t y to detergents and hydrophobic a n t i b i o t i c s (Hancock, 1984) and no major changes i n phosphate/KDO r a t i o s (Nicas and Hancock, 1983b). Panel D shows the a n i o n i c LPS s i t e s e s t e r f i e d or otherwise s u b s t i t u t e d , thus wiping out the negative charge 2+ and e l i m i n a t i n g the Mg i o n . The A-»D c o n v e r s i o n mechanism has been proposed f o r polymyxin B r e s i s t a n c e i n S. typhimurium (Vaara et^ a^. , 1981) and E_. c o l i mutants (Peterson e_t a l . , 1987). L i k e A-^C, however, l a t e r a l i n t e r a c t i o n between LPS molecules would probably be weakened, l e a d i n g to i n c r e a s e d hydrophobic p e r m e a b i l i t y . An a l t e r n a t i v e , and more a t t r a c t i v e , a l t e r a t i o n (panel E) would be i n c r e a s e d s u b s t i t u t i o n of LPS with p o s i t i v e l y -charged s u b s t i t u e n t s (e.g. ethanolamine), r e s u l t i n g i n l a t e r a l i n t e r a c t i o n between phosphate (or carboxyl) and amino groups on adjacent LPS molecules. The p o s i t i v e l y - c h a r g e d s u b s t i t u e n t of a neighbouring LPS molecule would thus act as 117 a s u b s t i t u t e f o r the c a t i o n , p r e s e r v i n g the c r o s s - b r i d g e s t a b i l i t y . Conversion of A-^E might cause r e s i s t a n c e to a l l three agents, though i t i s a l s o p o s s i b l e that polymyxin B or gentamicin could a t t a c k the a n i o n i c group, causing a c o n f o r m a t i o n a l change to separate i t from the c a t i o n i c group. The A-»E c o n v e r s i o n may a c t u a l l y occur i n the S. typhimurium  pmrA mutants, s i n c e they had i n c r e a s e s i n c a t i o n i c s u b s t i t u e n t s , although t h i s does not seem to have been con s i d e r e d by these workers (Vaara et a l . , 1981). A->E conv e r s i o n would be e n e r g e t i c a l l y unfavourable f o r a w i l d -type c e l l , s i n c e i t would presumably r e q u i r e d e r e p r e s s i o n of s y n t h e s i s of enzymes (e.g. t r a n s f e r a s e s ) to c a t a l y s e i n c r e a s e d s u b s t i t u t i o n of the core or l i p i d A m o i e t i e s of LPS. For c e l l s growing i n d i v a l e n t c a t i o n - d e f i c i e n t medium, however, A->E c o n v e r s i o n would be a l o g i c a l response to the p a u c i t y of c a t i o n s . Such a mechanism could probably be detected by d e t a i l e d chemical analyses of the core o l i g o s a c c h a r i d e s and l i p i d A d i s a c c h a r i d e s of p r o t e i n H l -overproducing c e l l s , although such chemistry may be d i f f i c u l t . Panel F i s analogous to panel E except the amino group i s provided by a p r o t e i n HI molecule. A->F c o n v e r s i o n i s the model of Nicas and Hancock (1980), and can e x p l a i n the r e s i s t a n c e to EDTA but u n a l t e r e d s u s c e p t i b i l i t y to polymyxin B and gentamicin seen here. Since a more i n d i r e c t i n t e r a c t i o n by p r o t e i n Hi (A->B c o n v e r s i o n , above) i s 118 unlikely, this is probably the mechanism by which the protein acts. Based on these simplified models and the available data of this thesis and other works, I postulate that P. aeruginosa cel ls have more than one response, at the level of gene expression, to growth in divalent cation-deficient conditions. Overproduction of protein HI and increased substitution of LPS by positively-charged groups (note that there is not yet any experimental evidence for the latter) are proposed to arise from the same regulatory mechanism, which is turned on constitutively in H181 and H185. Together, these alterations (conversions A->E and A->F, Figure 17) compensate for reduced divalent cation concentrations and in doing so, create OM sites that are more resistant to permeabi1ization by and self-promoted uptake of polymyxin B, gentamicin, and EDTA + T r i s . Protein HI overproduction alone has been shown here to contribute substantially to the creation of EDTA-res istant si tes , while the other alterations must account for the rest of the EDTA-resistance, and the sites resistant to polymyxin B and gentamicin. In P. aeruginosa mutants with shortened core oligosaccharides, one or more polymyxin B-susceptible sites 2+ that are protected from the drug in Mg -deficient wild-type cel ls is/are lost . The rough mutants are no more resistant than wild-type, though, because polymyxin B is 119 b e t t e r able to i n s e r t i t s l i p i d i c t a i l i n t o the rough OM. In t h i s way, the rough mutants lack the polymyxin B r e s i s t a n c e 2+ u s u a l l y seen i n Mg - d e f i c i e n t c e l l s . 6. New p e r s p e c t i v e s on self-promoted uptake Hancock (1984) has proposed that a v a r i e t y of 2+ p o l y c a t x o n s , c h e l a t o r s , host defence f a c t o r s and Ca + DNA use the self-promoted pathway of uptake ac r o s s the OM of v a r i o u s Gram-negative b a c t e r i a . In t h i s study, i t has been shown that k i l l i n g by EDTA at l e a s t can be reduced by ov e r p r o d u c t i o n of an outer membrane p r o t e i n , H i . So, ove r p r o d u c t i o n of a p r o t e i n p r o v i d e s a mechanism by which P. aeruginosa can i n h i b i t self-promoted uptake. No p r o t e i n s i n other s p e c i e s are known to do the same t h i n g , but the presence of d i v a l e n t c a t i o n - r e g u l a t e d envelope p r o t e i n s of s i m i l a r s i z e (one of which, from ]?. c h l o r a p h i s , c r o s s - r e a c t e d with p r o t e i n HI) i n r e l a t e d s p e c i e s of b a c t e r i a suggests that there may be co u n t e r p a r t s to p r o t e i n Hi that are not yet c h a r a c t e r i z e d . I have a l s o s p e c u l a t e d that a l t e r a t i o n i n LPS, i n v o l v i n g a d d i t i o n of c a t i o n i c s u b s t i t u e n t s to the core or l i p i d A, can i n h i b i t self-promoted uptake. This would be c o n s i s t e n t with the i s o l a t i o n of c e r t a i n P. aerug inosa mutants r e s i s t a n t to p o l y c a t i o n s that d i s p l a y LPS a l t e r a t i o n s (e.g. Bryan e_t a l . , 1984; G a l b r a i t h et a l . , 1984), and may a l s o be a common 120 mechanism i n other s p e c i e s . However, experimental evidence f o r t h i s proposed "second a l t e r a t i o n " i n p r o t e i n H l -overproducing c e l l s should precede any f u r t h e r g e n e r a l i z a t i o n s . 121 LITERATURE CITED Anwar, H., M.R.W. Brown, A. Day, and P.H. W e l l e r . 1984. Outer membrane antigens of mucoid Pseudomonas aeruginosa i s o l a t e d d i r e c t l y from the sputum of a c y s t i c f i b r o s i s p a t i e n t . FEMS M i c r o b i o l . L e t t . 2_4: 235-239. A t k i n s o n , T., and M. Smith. 1984. S o l i d phase s y n t h e s i s of o l i g o d e o x y n u c l e o t i d e s by the phosphite t r i e s t e r method, p. 35-81. Iji M.J. G a i t (ed.), O l i g o n u c l e o t i d e s y n t h e s i s : A p r a c t i c a l approach. IRL Press, Oxford. B a l l a n d , A., M. Courtney, S. J a l l a t , L.-H. T e s s i e r , P. Sondermeyer, H. De La S a l l e , R. Harvey, E. Degryse, and P. T o l s t o s h e v . 1985. Use of s y n t h e t i c o l i g o n u c l e o t i d e s i n gene i s o l a t i o n and ma n i p u l a t i o n . B i o c h i m i e 6J_: 725-736. Beher, M., A. Pugsley, and C. Schnaitman. 1980. C o r r e l a t i o n between the exp r e s s i o n of an E s c h e r i c h i a c o l i c e l l s u r f a c e p r o t e i n and the a b i l i t y of the p r o t e i n to bind to l i p o p o l y s a c c h a r i d e . J . B a c t e r i o l . 143: 403-410. Berry, D., and A.M. K r o p i n s k i . 1986. E f f e c t of l i p o p o l y s a c c h a r i d e mutations and temperature on plasmid t r a n s f o r m a t i o n e f f i c i e n c y i n Pseudomonas aeruginosa. Can. J . M i c r o b i o l . 32: 436-438. B i g g i n , M.D., T.J. Gibson, and G.F. Hong. 1983. B u f f e r g r a d i e n t g e l s and 3?S l a b e l as an a i d to r a p i d DNA sequence d e t e r m i n a t i o n . Proc. N a t l . Acad. S c i . USA 80: 3963-3965. B l a s e r , J . , and R. Luethy. 1988. Comparative study on a n t a g o n i s t i c e f f e c t s of low pH and c a t i o n supplementation on i n - v i t r o a c t i v i t y of quinolones and aminoglycosides a g a i n s t Pseudomonas aerug i n o s a . J . A n t i m i c r o b . Chemother. 22 : 15-22. B o r n e l e i t , P., Blechschmidt., B., and H.-P. K l e b e r . 1989. I n t e r a c t i o n between l i p o p o l y s a c c h a r i d e and outer membrane p r o t e i n s of A c i n e t o b a c t e r c a l c o a c e t i c u s s t u d i e d by. an a f f i n i t y e l e c t r o p h o r e s i s system. E l e c t r o p h o r e s i s 10: 234-237. Botzenhart, K., and H. Rueden. 1987. H o s p i t a l i n f e c t i o n s caused by Pseudomonas aeruginosa. p. 1-15. I_n_ G. Doering, I.A. Holder, and K. Botzenhart (ed.), B a s i c research and c l i n i c a l aspects of Pseudomonas a e r u g i n o s a . Karger, B a s l e . 122 Bryan, L.E., K. O'Hara, and S. Wong. 1984. L i p o p o l y s a c c h a r i d e changes in impermeability-type aminoglycoside r e s i s t a n c e in Pseudomonas aeruginosa. A n t i m i c r o b . Ag. Chemother. 26: 250-255. C a r l s o n , A., and J . Messing. 1984. J . B i o t e c h n o l . 1_: 253. Chapman, J.S., and N.H. Georgopapadakou. 1988. Routes of quinolone permeation i n E s c h e r i c h i a c o l i . A n t i m i c r o b . Ag. Chemother. 3_2: 438-442. C o r n e l l s , P., A. Bouia, A. B e l a r b i , A. Guyonvarch, B. Kammerer, V. Hannaert, and J.C. Hubert. 1989. C l o n i n g and a n a l y s i s of the gene f o r the major outer membrane l i p o p r o t e i n from Pseudomonas ae r u g i n o s a . Mol. M i c r o b i o l . 3_: 421-428. D a l h o f f , A. 1987. P l e i o t r o p i c a c t i o n s of aminoglycosides, p. 182-204. I_n G. Doering, I.A. Holder, and K. Botzenhart (ed.), B a s i c research and c l i n i c a l aspects of Pseudomonas  aer u g i n o s a . Karger, B a s l e . Dente, L., G. C e s a r i n i , and R. C o r t e s e . 1983. pEMBL: a new f a m i l y of s i n g l e stranded plasmids. N u c l e i c A c i d s Res. 11: 1645-1655. D e r e t i c , V., J.F. G i l l , and A.M. Chakrabarty. 1987. A l i g i n a t e b i o s y n t h e s i s : a model system f o r gene r e g u l a t i o n and f u n c t i o n i n Pseudomonas. B i o / t e c h n o l . 5: 469-477. D i t t a , G., T. Schmidhauser, E. Yakobson, P. Lu, X.-W L i a n g , D.R. F i n l a y , D. Guiney, and D.R. H e l i n s k i . 1985. Plasmids r e l a t e d to the broad host range v e c t o r , pRK290, u s e f u l f o r gene c l o n i n g and f o r monitoring gene e x p r e s s i o n . Plasmid 13_: 149-153. Doering, G., M. Maier, E. M u e l l e r , Z. B i b i , B. Tuemmler, and A. Kharazmi. 1987. V i r u l e n c e f a c t o r s of Pseudomonas  aer u g i n o s a . p. 136-148. I_n G. Doering, I.A. Holder, and K. Botzenhart (ed.), B a s i c research and c l i n i c a l aspects of Pseudomonas aeruginosa. Karger, B a s l e . D o o l i t t l e , R.F. 1986. Of URFs and ORFs: a primer on how to analyze d e r i v e d amino a c i d sequences. U n i v e r s i t y Science Books, M i l l V a l l e y , C a l i f o r n i a . Duchene, M., A. Schweizer, F. L o t t s p e i c h , G. Krauss, M. Marget, K. Vogel, B.-E. von Specht, and H. Domdey. 1988. Sequence and t r a n s c r i p t i o n a l s t a r t s i t e of the Pseudomonas  aeruginosa outer membrane p o r i n p r o t e i n F gene. J . B a c t e r i d . 170: 155-162. 123 Eagon, R.G., and P.V. Phibbs J r . 1971. K i n e t i c s of t r a n s p o r t of glucose, f r u c t o s e , and mannitol by Pseudomonas  aeru g i n o s a . Can. J . Biochem. 4_9_: 1031-1041. E p s t e i n , W. 1983. Membrane-mediated r e g u l a t i o n of gene e x p r e s s i o n i n b a c t e r i a , p. 281-292 . I_n J . Beckwith, J . Davies, and J.A. G a l l a n t (ed.), Gene f u n c t i o n i n p r o k a r y o t e s . Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. F e i n b e r g , A.P., and B. V o g e l s t e i n . 1983. A technique f o r r a d i o l a b e l i n g DNA r e s t r i c t i o n endonuclease fragments to high s p e c i f i c a c t i v i t y . A n a l . Biochem. 132: 6-13. F i g u r s k i , D.H., and D.R. H e l i n s k i . 1979. R e p l i c a t i o n of an o r i g i n - c o n t a i n i n g d e r i v a t i v e of plasmid RK2 dependent on a plasmid f u n c t i o n provided i n t r a n s . Proc. N a t l . Acad. S c i USA 7_6: 1648-1652. Friedman, A.M., S.R. Long, S.E. Brown, W.J. Buikema, and F.M. Ausubel. 1982. C o n s t r u c t i o n of a broad host range cosmid c l o n i n g v e c t o r and i t s use i n the g e n e t i c a n a l y s i s of Rhizobium mutants. Gene lj8_: 289-296. G a b r i e l , 0. 1987. B i o s y n t h e s i s of sugar r e s i d u e s f o r glycogen, p e p t i d o g l y c a n , l i p o p o l y s a c c h a r i d e , and r e l a t e d systems, p. 504-511. I_n F.C. Neidhardt (ed. ) , E s c h e r i c h i a  c o l i and Salmonella typhimurium: C e l l u l a r and molecular b i o l o g y . American S o c i e t y f o r M i c r o b i o l o g y , Washington, D.C. G a l b r a i t h , L., S.G. W i l k i n s o n , N.J. L e g a k i s , V. Genimata, T.S. K a t s o r c h i s , and E.T. R i e t s c h e l . 1984. S t r u c t u r a l a l t e r a t i o n s i n the envelope of a g e n t a m i c i n - r e s i s t a n t rough mutant of Pseudomonas a e r u g i n o s a . Ann. M i c r o b i o l . ( I n s t . Pasteur) 135B: 121-136. G a m i e r , J . , D.J. Osguthorpe, and B. Robson. 1978. A n a l y s i s of the accuracy and i m p l i c a t i o n s of simple methods f o r p r e d i c t i n g the secondary s t r u c t u r e of g l o b u l a r p r o t e i n s . J . Mol. B i o l . 120: 97-120. G i l b e r t , D.N., 1985. An e v a l u a t i o n of antipseudomonal a n t i m i c r o b i c agents, p. 111-133. I_n D.P. Speert and R.E. W. Hancock (ed.), Pseudomonas aeruginosa : New t h e r a p e u t i c approaches from b a s i c r e s e a r c h . Karger, B a s l e . 124 G i l l e l a n d , H.E., J r . , F.R. Champlin, and R.S'. Conrad. 1984. Chemical a l t e r a t i o n s i n c e l l envelopes of Pseudomonas  aerug inosa upon exposure to polymyxin: a p o s s i b l e mechanism to e x p l a i n adaptive r e s i s t a n c e to polymyxin. Can. J . M i c r o b i o l . 30: 869-873. G i l l e l a n d , H.E., J r . , and R.S. Conrad. 1982. Chemical a l t e r a t i o n s i n c e l l envelopes of p o l y m y x i n - r e s i s t a n t mutants of Pseudomonas aeruginosa grown i n the absence or presence of polymyxin. A n t i m i c r o b . Ag. Chemother. 22: 1012-1016. G i l l e l a n d , H.E., J r . , J.D. S t i n n e t t , I.L. Roth, and R.G. Eagon. 1973. Freeze-etch study of Pseudomonas aeruginosa: L o c a l i z a t i o n w i t h i n the c e l l w a l l of an e t h y l e n e d i a m i n e t e t r a a c e t a t e - e x t r a c t a b l e component. J . B a c t e r i d . 113: 417-432. Goldberg, J.B., and D.E. Ohman. 1984. C l o n i n g and ex p r e s s i o n in Pseudomonas aeruginosa of a gene i n v o l v e d i n the pr o d u c t i o n of a l g i n a t e . J . B a c t e r i o l . 158: 1115-1121. Gray, G.L., D.H. Smith, J.S. B a l d r i d g e , R.N. Harkins, M.L. V a s i l , E.Y Chen., and H.L. Heyneker. 1984. C l o n i n g , n u c l e o t i d e sequence, and e x p r e s s i o n in E s c h e r i c h i a c o l i of the e x t o x i n A s t r u c t u r a l gene of Pseudomonas aeruginosa. Proc. N a t l . Acad. S c i . USA 8_1 : 2645-2649. Hancock, R.E.W. 1981a. Aminoglycoside uptake and mode of a c t i o n - with s p e c i a l r e f e r e n c e to streptomycin and gentamicin: I. an t a g o n i s t s and mutants. J . Antimicr o b . Chemother. 8_: 249-276. Hancock, R.E.W. 1981b. Aminoglycoside uptake and mode of a c t i o n - with s p e c i a l r e f e r e n c e to streptomycin and gentamicin: I I . e f f e c t s of aminoglycosides on c e l l s . J . An t i m i c r o b . Chemother. 8_: 429-445.. Hancock, R.E.W. 1984. A l t e r a t i o n s i n outer membrane p e r m e a b i l i t y . Annu. Rev. M i c r o b i o l . 3_8_: 237-264. Hancock, R.E.W. 1985. The r o l e of the c e l l s u r f a c e components of Pseudomonas aeruginosa i n v i r u l e n c e , p. 247-256. I_n G.G. Jackson and H. Thomas (ed.), The pathogenesis of b a c t e r i a l i n f e c t i o n s . S p r i n g e r - V e r l a g , B e r l i n . Hancock, R.E.W., and A. B e l l . 1988. A n t i b i o t i c uptake i n t o Gram-negative b a c t e r i a . Eur. J . C l i n . M i c r o b i o l . I n f e c t . D i s . 7: 713-720. 125 Hancock, R.E.W., and A.M. Carey. 1979. Outer membrane of Pseudomonas aeruginosa: Heat- and 2-mercaptoethanol-m o d i f i a b l e p r o t e i n s . J . B a c t e r i o l . 140; 902-910. Hancock, R.E.W., and A.M. Carey. 1980. P r o t e i n Dl - a g l u c o s e - i n d u e i b l e , pore-forming p r o t e i n from the outer membrane of Pseudomonas aer u g i n o s a . FEMS M i c r o b i o l . L e t t . £: 105-109. Hancock, R.E.W., G.M. Decad, and H. N i k a i d o . 1979. I d e n t i f i c a t i o n of the p r o t e i n producing transmembrane d i f f u s i o n pores i n the outer membrane of Pseudomonas  aeruginosa PAOl. Biochem. Biophys. Acta 554 ; 323-331. Hancock, R.E.W., R.T. I r v i n , J.W. C o s t e r t o n , and A.M. Carey. 1981a. Pseudomonas aeruginosa outer membrane: p e p t i d o g l y c a n - a s s o c i a t e d p r o t e i n s . J . B a c t e r i o l . 14 5: 628-631. Hancock, R.E.W., E.C.A. Mouat, and D.P. Spe e r t . 1984. Q u a n t i t a t i o n and i d e n t i f i c a t i o n of outer-membrane p r o t e i n s of Pseudomonas aeruginosa i n sera of p a t i e n t s with c y s t i c f i b r o s i s . J . I n f e c t . D i s . 149: 220-226. Hancock, R.E.W., L.M. Mutharia, L. Chan, R.P. Darveau, D.P. Speert, and G.B. P i e r . 1983. Pseudomonas aeruginosa i s o l a t e s from p a t i e n t s with c y s t i c f i b r o s i s : A c l a s s of se r u m - s e n s i t i v e , nontypable s t r a i n s d e f i c i e n t i n l i p o p o l y s a c c h a r i d e 0 s i d e c h a i n s . I n f e c t . Immun. 42: 170-177. Hancock, R.E.W., and T.I. Nicas . 1984. R e s i s t a n c e to a n t i b a c t e r i a l agents a c t i n g on c e l l membranes, p. 147-171. In L.E. Bryan (ed.), A n t i m i c r o b i a l drug r e s i s t a n c e . Academic Press, Inc., Orlando, F l o r i d a . Hancock, R.E.W., K. Poole, and R. Benz. 1982a. Outer membrane p r o t e i n P of Pseudomonas aeruginosa: r e g u l a t i o n by phosphate d e f i c i e n c y and formation of s m a l l a n i o n - s p e c i f i c channels i n l i p i d b i l a y e r membranes. J . B a c t e r i o l . 150: 730-738. Hancock, R.E.W., V.J. R a f f l e , and T.I. N i c a s . 1981b. Involvement of the outer membrane i n gentamicin and streptomycin uptake and k i l l i n g i n Pseudomonas aeruginosa. A n t i m i c r o b . Ag. Chemother, 19_: 777-785. Hancock, R.E.W., A.A. Wieczorek, L.M. Mutharia, and K. Poole. 1982b. Monoclonal a n t i b o d i e s a g a i n s t Pseudomonas  aeruginosa outer membrane a n t i g e n s : I s o l a t i o n and c h a r a c t e r i z a t i o n . I n f e c t . Immun. 37: 166-171. 126 Hancock, R.E.W., and P.G.W. Wong. 1984. Compounds which i n c r e a s e the p e r m e a b i l i t y of the Pseudomonas aerug inosa outer membrane. An t i m i c r o b . Ag. Chemother. 2_6: 48-52. Helfman, D.M., J.R. Feramisco, J.C. F i d d e s , G.P. Thomas, and S.H. Hughes. 1983. I d e n t i f i c a t i o n of cl o n e s that encode chi c k e n tropomyosin by d i r e c t immunological s c r e e n i n g of a cDNA ex p r e s s i o n l i b r a r y . Proc. N a t l . Acad. S c i . USA. 80: 31-35. Hjelmeland, L.M., and A. Chrambach. 1984. S o l u b i l i z a t i o n of f u n c t i o n a l membrane p r o t e i n s . Meth. Enzymol. 104: 305-318. Holmes, D.S., and M. Qu i g l e y . 1981. A r a p i d b o i l i n g method f o r the p r e p a r a t i o n of b a c t e r i a l p l asmids. A n a l . Biochem. 114: 193-197. Inouye, M. 1979. What i s the outer membrane? p. 1-12. I_n_ M. Inouye (ed.), B a c t e r i a l outer membranes: b i o g e n e s i s and f u n c t i o n s . W i l e y - I n t e r s c i e n c e , New York. Jones, R.B., P.A. Jemison, W.J. Newhall V, and R.A. Haak. 1980. R e s o l u t i o n of b a s i c gonococcal outer membrane p r o t e i n s by nonequi1ibrium pH g r a d i e n t e l e c t r o p h o r e s i s . I n f e c t . Immun. 30_: 773-780. K e l l y , N.M., J.L. B a t t e r s h i l l , S. Kuo, J.P. Arbuthnott, and R.E.W. Hancock. 1987. C o l o n i a l d i s s o c i a t i o n and s u s c e p t i b i l i t y to phagocytosis of Pseudomonas aerug inosa grown i n a chamber implant model i n mice. I n f e c t . Immun. 55: 2841-2843. K e l l y , N.M., A. B e l l , and R.E.W. Hancock. 1989. Surface c h a r a c t e r i s t i c s of Pseudomonas aeruginosa grown i n a chamber implant model i n mice and r a t s . I n f e c t . Immun. 57: 344-350. K n i r e l , Y.A., E.V. Vinogradov, N.A. Kocharova, N.A. Paramonov, N.K. Kotchetkov, B.A. D m i t r i e v , E.S. S t a n i s l a v s k y , and B. L a n y i . 1988. The s t r u c t u r e of 0-s p e c i f i c p o l y s a c c h a r i d e s and s e r o l o g i c a l c l a s s i f i c a t i o n of Pseudomonas aeruginosa. Acta M i c r o b i o l . Hungar. _35_: 3-24. K r o p i n s k i , A.M., L.C. Chan, and F.H. M i l a z z o . 1979. The e x t r a c t i o n and a n a l y s i s of 1 i p o p o l y s a c c h a r i d e s from Pseudomonas aeruginosa s t r a i n PAO, and three rough mutants. Can. J . M i c r o b i o l . 25: 390-398. 127 K r o p i n s k i , A.M., B. J e w e l l , J . Kuzio, F. M i l a z z o , and D. Berry . 1985. S t r u c t u r e and f u n c t i o n s of Pseudomonas  aeruginosa l i p o p o l y s a c c h a r i d e . p. 58-73 . I_n D.P. Speert and R.E.W. Hancock (ed.), Pseudomonas aeruginosa: New t h e r a p e u t i c approaches from b a s i c r e s e a r c h . Karger, B a s l e . K r o p i n s k i , A.M.B., V. Lewis, and D. Berr y . 1987. E f f e c t of growth temperature on the l i p i d s , outer membrane p r o t e i n s , and 1 i p o p o l y s a c c h a r i d e s of Pseudomonas aeruginosa PAO. J . B a c t e r i o l . 169: 1960-1966. Kyte, J . , and R.F. D o o l i t t l e . 1982. A simple method f o r d i s p l a y i n g the hydropathic c h a r a c t e r of a p r o t e i n . J . Mol. B i o l . 1^7: 105-132. Lam, J.S., L.M. Mutharia, R.E.W. Hancock, N. Hefiby, K. Lam, L. Baek, and J.W. C o s t e r t o n . 1983. Immunogenicity of Pseudomonas aeruginosa outer membrane anti g e n s examined by crosse d immunoelect rophores i s . I n f e c t . Immun. 4_2_: 88-98. Lambert, P.A., and B.R. Booth. 1982. Exposure of outer membrane p r o t e i n s on the s u r f a c e of Pseudomonas aeruginosa <• PAOl re v e a l e d by l a b e l l i n g with [ 1 2 5 I ] l a c t o p e r o x i d a s e . FEMS M i c r o b i o l . L e t t . 14_: 43-45 . Landick, R., and C. Yanofsky. 1987. T r a n s c r i p t i o n a t t e n u a t i o n , p. 1276-1301. I_n F.C. Neidhardt (ed.), E s c h e r i c h i a c o l i and Salmone11a typhimurium: c e l l u l a r and molecular b i o l o g y . American S o c i e t y f o r M i c r o b i o l o g y , Washington, D.C. Lathe, R. 1985. S y n t h e t i c d i g o n u c l e o t i d e probes deduced from amino a c i d sequence data: t h e o r e t i c a l and p r a c t i c a l c o n s i d e r a t i o n s . J . Mol. B i o l . 183: 1-12 . L i p s o n , K.E., A.A. Kol h a t k a r , R.G. Maki, and D.B. Donner. 1988. D i v a l e n t c a t i o n s r e g u l a t e glucagon b i n d i n g . Evidence f o r a c t i o n s on r e c e p t o r - N s complexes and on re c e p t o r s uncoupled from N g. Biochem. 2J7_: 1111-1116. Loh, B., C. Grant, and R.E.W. Hancock. 1984. Use of the f l u o r e s c e n t probe l-N_-phenylnapthylamine to study the i n t e r a c t i o n s of aminoglycoside a n t i b i o t i c s with the outer membrane of Pseudomonas aer u g i n o s a . A n t i m i c r o b . Ag. Chemother. 2_6: 546-551. Lugtenberg, D., and L. Van Alphen. 1983. Molecular a r c h i t e c t u r e and f u n c t i o n i n g of the outer membrane of E s c h e r i c h i a c o 1 i and other Gram-negative b a c t e r i a . Biochim. Biophys. Acta 737: 51-115. 128 Lundblad, R.L., and CM. Noyes. 1984. The chemical c r o s s -l i n k i n g of p e p t i d e c h a i n s , p. 123-139. In Chemical reagents f o r p r o t e i n m o d i f i c a t i o n , volume I I . CRC Press, Inc., Boca Raton, F l o r i d a . Makela, P.H., N. Sarvas, S. Calcagno, and K. Lounatmaa. 1978. I s o l a t i o n and g e n e t i c c h a r a c t e r i z a t i o n of polymyxin-r e s i s t a n t mutants of Sal m o n e l l a . FEMS M i c r o b i o l . L e t t . 3_: 323-326. M a n i a t i s , T., E.F. F r i t s c h , and J . Sambrook. 1982. Molecular c l o n i n g : A l a b o r a t o r y manual. Cold S p r i n g Harbor Laboratory, Cold Spring Harbor, New York. M a r t i n , N.L., and T.J. Beveridge. 1986. Gentamicin i n t e r a c t i o n with Pseudomonas aeruginosa c e l l envelope. A n t i m i c r o b . Ag. Chemother. 2_9_: 1079-1087. Mermod, N., J.L. Ramos, P.R. Lehrbach, and K.N. Timmis. 1986. Vector f o r r e g u l a t e d e x p r e s s i o n of cloned genes i n a wide range of Gram-negative b a c t e r i a . J . B a c t e r i o l . 167: 447-454. Meyers, E., W.L. Parker, and W.E. Brown. 1974. EM49: A new p o l y p e p t i d e a n t i b i o t i c a c t i v e a g a i n s t c e l l membranes. Ann. N.Y. Acad. S c i . 235: 493-501. Miguez, C.B., T.J. Beveridge, and J.M. Ingram. 1986. L i p o p o l y s a c c h a r i d e changes and c y t o p l a s m i c polyphosphate granule accumulation i n Pseudomonas aeruginosa d u r i n g growth on hexadecane. Can. J . M i c r o b i o l . 3_2_: 248-253. Mizuno, T., and M. Kageyama. 1978. S e p a r a t i o n and c h a r a c t e r i z a t i o n of the outer membrane of Pseudomonas  aeru g i n o s a . J . Biochem. 8_4: 179-191. Mizuno, T., and M. Kageyama. 1979a. I s o l a t i o n and c h a r a c t e r i z a t i o n of a major outer membrane p r o t e i n of Pseudomonas aeruginosa: evidence f o r the occurrence of a l i p o p r o t e i n . J . Biochem. 8_5_: 115-122. Mizuno, T., and M. Kageyama. 1979b. I s o l a t i o n and c h a r a c t e r i z a t i o n of major outer membrane p r o t e i n s of Pseudomonas aeruginosa s t r a i n PAO with s p e c i a l r e f e r e n c e to p e p t i d o g l y c a n - a s s o c i a t e d p r o t e i n . J . Biochem. 86: 979-989. Moore, R.A., N.C. Bates, and R.E.W. Hancock. 1986. I n t e r a c t i o n of p o l y c a t i o n i c a n t i b i o t i c s with Pseudomonas  aeruginosa 1 i p o p o l y s a c c h a r i d e and l i p i d A s t u d i e d by using dansyl-polymyxin. A n t i m i c r o b . Ag. Chemother. 2_9: 496-500. 129 Moore, R.A., L. Chan, and R.E.W. Hancock. 1984. Evidence f o r two d i s t i n c t mechanisms of r e s i s t a n c e to polymyxin B i n Pseudomonas aeruginosa. A n t i m i c r o b . Ag. Chemother. 26: 539-545. Mutharia, L.M., and R.E.W. Hancock. 1983. Surface l o c a l i z a t i o n of Pseudomonas aerug inosa outer membrane p o r i n p r o t e i n F by using monoclonal a n t i b o d i e s . I n f e c t . Immun. 4_2_: 1027-1033. Mutharia, L.M., T.I. Nicas, and R.E.W. Hancock. 1982. Outer membrane p r o t e i n s of Pseudomonas aeruginosa serotype s t r a i n s . J . I n f e c t . D i s . 146: 770-779. Nakae, R., and T. Nakae. 1982. D i f f u s i o n of aminoglycoside a n t i b i o t i c s across the outer membrane of E s c h e r i c h i a c o l i . A n t i m i c r o b . Ag. Chemother. 2_2_: 554-559. Nakazawa, T., and S. Inouye. 1986. C l o n i n g of Pseudomonas genes i n E s c h e r i c h i a c o l i . p. 357-382 . I_n J.R. Sokatch (ed.), The b a c t e r i a , volume X. Academic Press, Orlando, F l o r i d a . Newton, B.A. 1954. S i t e of a c t i o n of polymyxin on Pseudomonas  aeru g i n o s a : Antagonism by c a t i o n s . J . Gen. M i c r o b i o l . 10: 491-499. Newton, B.A. 1955. A f l u o r e s c e n t d e r i v a t i v e of polymyxin: I t s p r e p a r a t i o n and use i n stud y i n g the s i t e of a c t i o n of the a n t i b i o t i c . J . Gen. M i c r o b i o l . 12^: 226-236. Ni c a s , T . I . , and R.E.W. Hancock. 1980. Outer membrane p r o t e i n HI of Pseudomonas aeruginosa: involvement i n adaptive and mut a t i o n a l r e s i s t a n c e to e t h y l e n e d i a m i n e t e t r a a c e t a t e , polymyxin B, and gentamicin. J . B a c t e r i o l . 143: 872-878. Ni c a s , T.I., and R.E.W. Hancock. 1983a. Pseudomonas aeruginosa outer membrane p e r m e a b i l i t y : i s o l a t i o n of a p o r i n p r o t e i n F - d e f i c i e n t mutant. J . B a c t e r i o l . 153: 281-285 . Nicas, T.I., and R.E.W. Hancock. 1983b. A l t e r a t i o n of s u s c e p t i b i l i t y to EDTA, polymyxin B and gentamicin i n Pseudomonas aeruginosa by d i v a l e n t c a t i o n r e g u l a t i o n of outer membrane p r o t e i n H i . J . Gen. M i c r o b i o l . 129: 509-517. Ni k a i d o , H., and R.E.W. Hancock. 1986. Outer membrane p e r m e a b i l i t y of Pseudomonas aer u g i n o s a . p. 145-193. Ijn J.R. Sokatch (ed.). The b a c t e r i a , volume X. Academic Pr e s s , Inc., Orlando, F l o r i d a . 130 N i k a i d o , H., and M. Vaara. 1985. Molecular b a s i s of b a c t e r i a l outer membrane p e r m e a b i l i t y . M i c r o b i o l . Rev. 4_9_: 1-32. O ' F a r r e l l , P.H. 1975. High r e s o l u t i o n two-dimensional e l e c t r o p h o r e s i s of p r o t e i n s . J . B i o l . Chem. 250: 4007-4021. P a l l e r o n i , N.J. 1975. General p r o p e r t i e s and taxonomy of the genus Pseudomonas. p. 1-36. I_n P.H. C l a r k e and M.H. Richmond (ed.), Genetics and b i o c h e m i s t r y of Pseudomonas. John Wiley & Sons, London. P a l l e r o n i , N.J. 1981. I n t r o d u c t i o n to the Family Pseudomonadaceae. p. 655-665. I_n M.P. S t a r r , H. S t o l p , H.G. Trueper, A. Balows, and H.G. S c h l e g e l (ed.), The pr o k a r y o t e s : A handbook on h a b i t a t s , i s o l a t i o n , and i d e n t i f i c a t i o n of b a c t e r i a . S p r i n g e r - V e r l a g , B e r l i n . P a r r , T.R., J r . , K. Poole, G.W.K. C r o c k f o r d , and R.E.W. Hancock. 1986. L i p o p o l y s a c c h a r i d e - f r e e E s c h e r i c h i a c o l i OmpF and Pseudomonas aeruginosa p r o t e i n P p o r i n s are f u n c t i o n a l l y a c t i v e i n l i p i d b i l a y e r membranes. J . B a c t e r i o l . 165: 523-526. Paul, C , and J.P. Rosenbusch. 1985. F o l d i n g p a t t e r n s of p o r i n and bacter iohodops i n . EMBO J . 4_: 1593-1597. Pearson, W.R., and D.J. Lipman. 1988.'Improved t o o l s f o r b i o l o g i c a l sequence comparison. Proc. N a t l . Acad. S c i . USA 85: 2444-2448. Peterson, A.A., S.W. F e s i k , and E.J. McGroarty. 1987. Decreased b i n d i n g of a n t i b i o t i c s to 1 i p o p o l y s a c c h a r i d e s from p o l y m y x i n - r e s i s t a n t s t r a i n s of E s c h e r i c h i a c o l i and Salmonella typhimurium. A n t i m i c r o b . Ag. Chemother. 31: 230-237. Peterson, A.A., R.E.W. Hancock, and E. J . McGroarty. 1985. Bind i n g of p o l y c a t i o n i c a n t i b i o t i c s and polyamines to 1i p o p o l y s a c c h a r i d e s of Pseudomonas aeruginosa. J . B a c t e r i o l . 164: 1256-1261. Poole, K. , and R.E.W. Hancock. 1986. I s o l a t i o n of a Tn501 i n s e r t i o n mutant l a c k i n g p o r i n p r o t e i n P of Pseudomonas  aer u g i n o s a . Mol. Gen. Genet. 202 : 403-409. Poxton, I.R., G.T. B e l l , and G.R. B a r c l a y . 1985. The a s s o c i a t i o n on SDS-polyacrylamide g e l s of l i p o p o l y s a c c h a r i d e and outer membrane p r o t e i n s of Pseudomonas aeruginosa as re v e a l e d by monoclonal a n t i b o d i e s and Western b l o t t i n g . FEMS M i c r o b i o l . L e t t . 27: 247-251. 131 P r i t c h a r d , A.E., and M.L. V a s i l . 1986. N u c l e o t i d e sequence and e x p r e s s i o n of a phosphate-regulated gene encoding a s e c r e t e d hemolycin of Pseudomonas aerug i n o s a . J . B a c t e r i o l . 167: 291-298. R a n d a l l , L.L., S.J.S. Hardy, and J.R. Thom. 1987. Export of p r o t e i n : A biochemical view. Ann. Rev. M i c r o b i o l . 41: 507-541. Reithmeier, R.A.F., and P.D. Bragg. 1977. C r o s s - l i n k i n g of the p r o t e i n s i n the outer membrane of E s c h e r i c h i a c o l i . Biochim. Biophys. Acta 466: 245-256. R e l l a , M., A. Mercenier, and D. Haas. 1985. Transposon i n s e r t i o n mutagenesis of Pseudomonas aeruginosa with a Tn5 d e r i v a t i v e : a p p l i c a t i o n to p h y s i c a l mapping of the arc ~~ gene c l u s t e r . Gene 3_3: 293-303. R i v e r a , M., L.E. Bryan, R.E.W. Hancock, and E.J. McGroarty. 1988. Heterogeneity of 1 i p o p o l y s a c c h a r i d e s from Pseudomonas aeruginosa: a n a l y s i s of l i p o p o l y s a c c h a r i d e c h a i n l e n g t h . J . B a c t e r i o l . 170: 512-521. R i v e r a , M., and E . J . McGroarty. 1989. A n a l y s i s of a common-ant i g e n l i p o p o l y s a c c h a r i d e from Pseudomonas aeruginosa. J . B a c t e r i o l . 171: 2244-2248. Rosenberg, M., D. Gutnik, and E. Rosenberg. 1980. Adherence of b a c t e r i a to hydrocarbons: a simple method f o r measuring c e l l - s u r f a c e h y d r o p h o b i c i t y . FEMS M i c r o b i o l . L e t t . 9_: 29-33. Sabath, L.D. 1984. Biochemical and p h y s i o l o g i c a l b a s i s f o r s u s c e p t i b i l i t y and r e s i s t a n c e of Pseudomonas aerug inosa to a n t i m i c r o b i a l agents. Rev. I n f e c t . D i s . 6_: S643-S656. S a i d , A.A., D.M. Livermore, and R.J. W i l l i a m s . 1987. E x p r e s s i o n of HI outer-membrane p r o t e i n of Pseudomonas  aeruginosa i n r e l a t i o n to s e n s i t i v i t y to EDTA and polymyxin B. J . Med. M i c r o b i o l . 2_£: 267-274 . Sandermann, H., J r . , and J.L. Strominger. 1972. P u r i f i c a t i o n and p r o p e r t i e s of C55~isoprenoid a l c o h o l phosphokinase from Staphylococcus aureus. J . B i o l . Chem. 247: 5123-5131. Saunders, V.A., and J.R. Saunders. 1987. O p t i m i s a t i o n of e x p r e s s i o n of cloned genes, p. 219-264. I_n M i c r o b i a l g e n e t i c s a p p l i e d to b i o t e c h n o l o g y : P r i n c i p l e s and techniques of gene t r a n s f e r and m a n i p u l a t i o n . Macmillan P u b l i s h i n g Co., New York. 132 Sawyer, J.G., N.L. Ma r t i n , and R.E.W. Hancock. 1988. I n t e r a c t i o n of macrophage c a t i o n i c p r o t e i n s with the outer membrane of Pseudomonas aeruginosa. I n f e c t . Immun. 56: 693-698. Schweizer, M., I. Hindennach, W. Garten, and U. Henning. 1978. Major p r o t e i n s of the E s c h e r i c h i a c o l i outer c e l l envelope membrane. I n t e r a c t i o n of p r o t e i n I I * with 1 i p o p o l y s a c c h a r i d e . Eur. J . Biochem. 82_: 211-217. Sekar, V. 1987. A r a p i d s c r e e n i n g procedure f o r the i d e n t i f i c a t i o n of recombinant b a c t e r i a l c l o n e s . B i o t e c h n i q u e s 5_: 11-13. Seltmann, G., and E.- J . Wolter. 1987. E f f e c t of n o u r s e o t h r i c i n ( s t r e p t o t h r i c i n ) on the outer membrane of s e n s i t i v e and r e s i s t a n t E s c h e r i c h i a c o l i s t r a i n s . J . B a s i c M i c r o b i o l . 2_7_: 139-146. S i e h n e l , R.J., E.A. Worobec, and R.E.W. Hancock. 1988a. C l o n i n g of the Pseudomonas aeruginosa outer membrane p o r i n p r o t e i n P gene: evidence f o r a l i n k e d r e g i o n of DNA homology. J . B a c t e r i o l . 170: 2312-2318. S i e h n e l , R.J., E.A. Worobec, and R.E.W. Hancock. 1988b. R e g u l a t i o n of components of the Pseudomonas aeruginosa p h o s p h a t e - s t a r v a t i o n - i n d u c i b l e regulon i n E s c h e r i c h i a  c o l i . Mol. M i c r o b i o l . 2_: 347-352. S i l l e r o , A., and J.M. R i b e i r o . 1989. I s o e l e c t r i c p o i n t s of p r o t e i n s : t h e o r e t i c a l d e t e r m i n a t i o n . A n a l . Biochem. 179: 319-325. Simon, R., V. P r i e f e r , and A. Puehler. 1983. A broad host range m o b i l i z a t i o n system f o r iji v i v o g e n e t i c e n g i n e e r i n g : Transposon mutagenesis i n Gram negative b a c t e r i a . B i o / t e c h n o l o g y 1_: 784-791. S t i e r i t z , D.D., and I.A. Holder. 1975. Experimental s t u d i e s of the pathogenesis of i n f e c t i o n s due to Pseudomonas  aerug i n o s a : d e s c r i p t i o n of a burned mouse model. J . I n f e c t . D i s . 131: 688-691. Towbin, H., T. S t a e h e l i n , and J . Gordon. 1979. E l e c t r o p h o r e t i c t r a n s f e r of p r o t e i n s from polyacylamide g e l s to n i t r o c e l l u l o s e s h e e t s : Procedure and some a p p l i c a t i o n s . Proc. N a t l . Acad. S c i . USA 76: 4350-4354. T r a v e r s , A.A. 1987. S t r u c t u r e and f u n c t i o n of E. c o l i promoter DNA. CRC C r i t . Rev. Biochem. 22: 181-219. 133 T r i a s , J . , J . Dufresne, R.C. Levesque, and H. N i k a i d o . 1989. Decreased outer membrane p e r m e a b i l i t y i n imipenem-r e s i s t a n t mutants of Pseudomonas aeruginosa. A n t i m i c r o b . Ag. Chemother. 33_: 1201-1206. T r i a s , J . , E.Y. Rosenberg, and H. N i k a i d o . 1988. S p e c i f i c i t y of the glucose channel formed by p r o t e i n Dl of Pseudomonas  aerug i n o s a . Biochem. Biophys. Acta 938 ; 493-496. T s a i , C.-M., and C E . F r a s c h . 1982. A s e n s i t i v e s i l v e r s t a i n f o r d e t e c t i n g 1 i p o p o l y s a c c h a r i d e s i n p o l y a c r y l a m i d e g e l s . A n a l . Biochem. 119: 115-119. Tsuda, M., S. Harayama, and T. l i n o . 1984. Tn501 i n s e r t i o n mutagenesis in Pseudomonas aeruginosa PAO. Mol. Gen. Genet. 196: 494-500. Vaara, M. , T. Vaara, M. Jensen, I. Helander, M. Nurminen, E.T. R i e t s c h e l , and P.H. Makela. 1981. C h a r a c t e r i z a t i o n of the l i p o p o l y s a c c h a r i d e from the p o l y m y x i n - r e s i s t a n t pmrA mutants of Salmonella typhimurium. FEBS L e t t . 129: 145-149. V i e i r a , J . , and J . Messing. 1982. The pUC plasmids, an M13mp7-derived system f o r i n s e r t i o n mutagenesis and sequencing with s y n t h e t i c u n i v e r s a l primers. Gene 19: 259-268. Wang, J.C. 1982. Unwinding at the promoter and the modulation of t r a n s c r i p t i o n by DNA supercoi 1 i n g . p. 229-241 . Ijn R.L. Rodriguez and M.J. Chamberlin (ed.), Promoters: S t r u c t u r e and f u n c t i o n . Praeger P u b l i s h e r s , New York. Ward, K.H., H. Anwar, M.R.W. Brown, J . Wale, and" J . Gowar. 1988. Antibody response to outer-membrane antigens of Pseudomonas aeruginosa i n human burn wound i n f e c t i o n . J . Med. M i c r o b i o l . 27_: 179-190. Weinstein, L. 1985. Gram-negative b a c t e r i a l i n f e c t i o n s : A look at the past , a view of the present, and a glance at the f u t u r e . Rev. I n f e c t . D i s . 7_: S538-S544 . West, S.E.H., and B.H. I g l e w s k i . 1988. Codon usage in Pseudomonas aeruginosa. N u c l e i c A c i d s Res. 16_: 9323-9335. W i l k i n s o n , S.G. 1983. Composition and s t r u c t u r e of 1 i p o p o l y s a c c h a r i d e s from Pseudomonas aeruginosa. Rev. I n f e c t . D i s . 5: S941-S949. 134 Woodruff, W.A., and R.E.W. Hancock. 1988. C o n s t r u c t i o n and c h a r a c t e r i z a t i o n of Pseudomonas aeruginosa p r o t e i n F-d e f i c i e n t mutants a f t e r i n v i t r o and i n vi v o i n s e r t i o n mutagenesis of the cloned gene. J . B a c t e r i o l . 170; 2592-2598. Woodruff, W.A., and R.E.W. Hancock. 1989. Pseudomonas aeruginosa outer membrane p r o t e i n F: s t r u c t u r a l r o l e and r e l a t i o n s h i p to the E s c h e r i c h i a c o l i OmpA p r o t e i n . J . B a c t e r i o l . 171: 3304-3309. Woodruff, W.A., T.R. Parr, J r . , R.E.W. Hancock, L.F. Hanne, T.I. N i c a s , and B.H. Ig l e w s k i . 1986. E x p r e s s i o n i n E s c h e r i c h i a c o l i and f u n c t i o n of Pseudomonas aeruginosa outer membrane p o r i n p r o t e i n F. J . B a c t e r i o l . 167: 473-479. Woods, D. 1984. O l i g o n u c l e o t i d e s c r e e n i n g of cDNA l i b r a r i e s . Focus (Gaithersburg, Maryland) 6_: 1-3. Worobec, E.A., N.L. Ma r t i n , W.D. McCubbin, C M . Kay, G.D. Brayer, and R.E.W. Hancock. 1988. L a r g e - s c a l e p u r i f i c a t i o n and b i o c h e m i c a l c h a r a c t e r i z a t i o n of c r y s t a l l i z a t i o n - g r a d e p o r i n p r o t e i n P from Pseudomonas aer u g i n o s a . Biochim. Biophys. Acta 939: 366-374. Yanisch-Perron, C , J . V i e i r a , and J . Messing. 1985. Improved M13 phage c l o n i n g v e c t o r s and host s t r a i n s : n u c l e o t i d e sequences of the Ml3mpl8 and pUC19 v e c t o r s . Gene 33: 103-119. Yoshihara, E., and T. Nakae. 1989. I d e n t i f i c a t i o n of p o r i n s i n the outer membrane of Pseudomonas aerug inosa that form small d i f f u s i o n pores. J . B i o l . Chem. 264: 6297-6301. Young. 1984. The c l i n i c a l c h a l l e n g e of i n f e c t i o n s due to Pseudomonas aeruginosa. Rev. I n f e c t . D i s . 6: S603-S607. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098139/manifest

Comment

Related Items