Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Structure, function, and role in antibiotic resistance of outer membrane protein H1 in Pseudomonas aeruginosa Bell, Angus 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1989_A1 B43.pdf [ 10.37MB ]
Metadata
JSON: 831-1.0098139.json
JSON-LD: 831-1.0098139-ld.json
RDF/XML (Pretty): 831-1.0098139-rdf.xml
RDF/JSON: 831-1.0098139-rdf.json
Turtle: 831-1.0098139-turtle.txt
N-Triples: 831-1.0098139-rdf-ntriples.txt
Original Record: 831-1.0098139-source.json
Full Text
831-1.0098139-fulltext.txt
Citation
831-1.0098139.ris

Full Text

STRUCTURE, FUNCTION, AND ROLE IN ANTIBIOTIC RESISTANCE OF OUTER MEMBRANE PROTEIN H i IN PSEUDOMONAS AERUGINOSA By ANGUS BELL B.Sc.  (Hons.),  The U n i v e r s i t y  of Edinburgh,  1982  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR  THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY  We  OF GRADUATE  STUDIES  (Department  of M i c r o b i o l o g y )  accept  thesis  to  this  the r e q u i r e d  THE UNIVERSITY  conforming  standard  OF BRITISH COLUMBIA  October ©  as  1989  Angus B e l l ,  1989  In  presenting  degree  this  thesis  in  at the University of  partial  fulfilment  British Columbia,  of  the  I agree  requirements  for  an  advanced  that the Library shall make it  freely available for reference and study. I further agree that permission  for extensive  copying  head of  my  copying  or  of  department  this or  thesis by  for scholarly  his  publication of this thesis  or  her  DE-6 (2/88)  S  MlCfrOfelOL.06>/  Oazo^^a.  It  be is  granted  by the  understood  that  for financial gain shall not be allowed without  The University of British Columbia Vancouver, Canada  Date  may  representatives.  permission.  Department of  purposes  liSl  my written  ii  ABSTRACT  A d i v a l e n t c a t i o n - r e g u l a t e d outer of  Pseudomonas a e r u g i n o s a ,  solubilizations  of outer  HI,  membranes  ethylenediaminetraacetate cycles  purified  with  equi-molar  an  by  the  chain-containing  or h i g h e r  yields  used  analysis,  f o r N-terminal and  were d e s i g n e d protein.  using  Probing  digests with probably  the  amino a c i d  structural the  two  contaminated  E l e c t r o p h o r e s i s gave this  sequencing,  product amino  acid  production.  complementary  to  the  gene f o r p r o t e i n H i , oprH,  N-terminal  of Southern  in 0 side  an a s s o c i a t i o n  p r o t e i n H i , and  p o l y c l o n a l antiserum  of  either  sodium  enriched  suggesting  01igodeoxyribonucleotides u p s t r e a m end  and  c o n c e n t r a t i o n of  smooth LPS.  of p u r i f i e d  selective  gel electrophoresis.  t h a t was  molecules,  between p r o t e i n Hi and  or  f o r m e r method was  1 i p o p o l y s a c c h a r i d e , (LPS)  by  in detergent  of anion-exchange chromatography  Protein  was  purified  (EDTA) f o l l o w e d by  dodecylsulphate-polyacrylamide  higher  was  membrane p r o t e i n  blots  s e q u e n c e of  o f chromosomal  the o l i g o n u c l e o t i d e s r e v e a l e d  a s i n g l e - c o p y gene, and  the  allowed  DNA  t h a t oprH  i t t o be  was  cloned  iii  in  Escherichia co1i.  confirmed  N u c l e o t i d e sequence  the c l o n i n g of the c o r r e c t  derived  amino a c i d  protein  ( i n agreement w i t h  interacting with  with  probably  cells  basic  f u n c t i o n of  on LPS) o f 178 r e s i d u e s ,  segments.  HI was p r o d u c e d , p r o t e o l y t i c a l l y exported  carrying  cloned  a slightly  i t s proposed  t o t h e o u t e r membrane  processed  i n E_. c o l i  t h e c o m p l e t e oprH gene on p l a s m i d s .  oprH gene c o u l d be e x p r e s s e d the  gene, and t h e  indicated  anionic sites  two h y d r o p h o b i c Protein  and  sequence  analysis  DNA p r o v i d e d  weakly  from  that a p a r t i c u l a r  s e q u e n c e was n o t d e l e t e d .  This suggested  The  a p r o m o t e r on downstream that the  downstream r e g i o n was i n v o l v e d i n r e g u l a t i o n o f expression produced  o f t h e c l o n e d oprH gene.  at levels  much h i g h e r  P r o t e i n HI was  than  b a c k g r o u n d when e x t r a  copies  o f t h e oprH gene were p r e s e n t  vector  i n P. a e r u g i n o s a .  HI  caused  decreased  This overproduction  susceptibility  EDTA, b u t n o t by p o l y m y x i n confirmed J.  the hypothesis  Bacteriol.  resistance  i n an e x p r e s s i o n  of c e l l s  B or gentamicin. (T.I. Nicas  of protein  to k i l l i n g This  agents  partly  and R.E.W. Hancock,  143; 872-878, 1980) t h a t p r o t e i n  to these  by  by i n h i b i t i n g  their  HI  causes  self-  iv  promoted  uptake across  additional  the  and  on LPS) was a p p a r e n t l y  r e s i s t a n t phenotype.  observed  polymyxin  suppression  B resistance  by t h e p r o p e r t i e s  apparently  However, an  This  in cationic  required  f o r the  i d e a was s u p p o r t e d by  by LPS m u t a t i o n s of p r o t e i n  of the  Hl-overproducing  o f a P_. a e r u g i n o s a  cells,  strain  lacking protein H i .  Several produced  membrane.  a l t e r a t i o n ( p o s s i b l y an i n c r e a s e  substituents fully  the outer  species  of b a c t e r i a  envelope proteins  that  r e l a t e d t o P. a e r u g i n o s a were  i n d u c i b l e by growth  2+ in  Mg  - d e f i c i e n t medium, and one  molecular  weight  immunologically  20,000 f r o m P. c h l o r a p h i s ) with protein  a e r u g i n o s a , was p o l y m y x i n in  Mg  (a p r o t e i n  2+ - d e f i c i e n t medium.  Hi.  of apparent cross-reacted  P. c h l o r a p h i s ,  B r e s i s t a n t when  l i k e P_.  i t was grown  V  TABLE OF CONTENTS Page ABSTRACT  i i V  TABLE OF CONTENTS L I S T OF TABLES  ix  r  X  L I S T OF FIGURES L I S T OF ABBREVIATIONS  x i i  ACKNOWLEDGEMENTS  xiii  DEDICATION  xiv  INTRODUCTION  1  1.  Pseudomonas a e r u g i n o s a  2.  The o u t e r membrane o f P. a e r u g i n o s a Gram-negative b a c t e r i a a. b. c. d. e.  3.  c. 4.  General p r o p e r t i e s Phospholipid L i p o p o l y s a c c h a r i d e and d i v a l e n t Proteins F u n c t i o n s o f t h e o u t e r membrane  Antibiotic susceptibility P. a e r u g i n o s a a. b.  and o t h e r 3  cations . . .  Aims o f t h i s  14  study  strains,  14 16 18 23  METHODS  Bacterial  3 4 4 9 12  and r e s i s t a n c e i n  A n t i b i o t i c a c t i o n and r e s i s t a n c e E f f e c t s o f c h e l a t o r s and p o l y c a t i o n s on c e l l s A n t i b i o t i c u p t a k e pathways  MATERIALS AND 1.  1  25 plasmids,  and g r o w t h  conditions  25  2.  SDS-PAGE  30  3.  Protein purification  methods  30  vi Page 4. 5.  D e t e r m i n a t i o n o f N - t e r m i n a l amino a c i d s e q u e n c e and amino a c i d c o m p o s i t i o n of p r o t e i n HI . . . . Antiserum production immunoblotting,  and  and  32  purification,  cross-linking  6.  Oligonucleotide design  7.  DNA  techniques  35  8.  DNA  sequencing  36  9.  DNA  and  10.  protein  Whole c e l l cell  fractionation  Triparental  12.  Antibiotic  13.  Measurement of  14.  Growth of in  synthesis  and  LPS  and  . .  37  susceptibility cell  36  preparation  conjugation  P_.  34  sequence a n a l y s e s  protein  11.  and  32  testing  . . . . . .  37  . . . . . . . .  38  surface hydrophobicity  aeruginosa  i n chamber  . . .  40  implants  mice  40  15.  Cell  envelope  16.  O t h e r methods  isolation  40 41  RESULTS CHAPTER 1. PURIFICATION AND PROPERTIES OF PROTEIN HI AND CLONING AND NUCLEOTIDE SEQUENCE OF ITS STRUCTURAL GENE 1. P u r i f i c a t i o n o f p r o t e i n HI: o p t i m i z a t i o n of o u t e r membrane s o l u b i l i z a t i o n s 2. P u r i f i c a t i o n o f p r o t e i n HI from s o l u b i l i z e d membranes by a n i o n - e x c h a n g e c h r o m a t o g r a p h y . . . 3. P u r i f i c a t i o n of p r o t e i n HI from s o l u b i l i z e d membranes by SDS-PAGE 4.  Properties  of  purified  protein  Hi  5.  A n a l y s i s of P._ a e r u g i n o s a chromosomal DNA by hybridization w i t h o l i g o n u c l e o t i d e s complementary t o oprH  42 42 45 46 47  49  vii Page 6.  Molecular  7.  N u c l e o t i d e sequence a n a l y s i s  8.  A n a l y s i s o f t h e d e r i v e d amino a c i d p r o t e i n HI  9.  c l o n i n g o f oprH  2. 3. 4. 5.  57  sequence of 59 62  oprH  IN E. c o l i  AND  P. a e r u g i n o s a  E x p r e s s i o n o f oprH i n E . c o l i ; e f f e c t s medium, s u b c l o n i n g , and p r o m o t e r t y p e  .  Overproduction of p r o t e i n i n P. a e r u g i n o s a  64  o f growth 64  E x p r e s s i o n o f oprH i n E_. c o l i ; e x p o r t and processing of p r o t e i n Hi HI f r o m c l o n e d  71 oprH 72  E f f e c t o f oprH e x p r e s s i o n on susceptibility  antibiotic 74  Summary  77  CHAPTER 3. INTERACTION WITH LPS AND 1.  o f oprH  Summary  CHAPTER 2. EXPRESSION OF CLONED 1.  52  FUNCTION OF PROTEIN HI  Surface p r o p e r t i e s of p r o t e i n cells  . . .  .  80  Hl-overproducing  2.  Cross-linking  3.  E f f e c t o f LPS m u t a t i o n s i n c o m b i n a t i o n w i t h p r o t e i n H i o v e r p r o d u c t i o n on a n t i b i o t i c susceptibility  82  4.  A p p r o a c h e s t o m u t a g e n e s i s o f oprH  86  5.  P r o p e r t i e s o f P. a e r u g i n o s a  87  6.  Production in mice  7.  Summary  studies  80  of p r o t e i n  82  ATCC33354  HI by P. a e r u g i n o s a grown 89  '  89  viii Page CHAPTER 4. Mg -REGULATED CELL ENVELOPE PROTEINS OF SPECIES RELATED TO P. a e r u g i n o s a 2+  92  2+ 1.  E n v e l o p e p r o t e i n s i n d u c i b l e by g r o w t h i n Mg d e f i c i e n t medium and r e a c t i v i t y w i t h a n t i s e r u m t o p r o t e i n Hi  92  2.  Polymyxin  95  3.  Summary  B susceptibility  o f P_. c h l o r a p h i s  . . .  95  DISCUSSION  ^  1.  General  properties  of p r o t e i n  2.  Interaction  3.  Structure  4.  G e n e t i c s and r e g u l a t i o n synthesis  of p r o t e i n  and f u n c t i o n  HI  HI w i t h  6.  A model mechanism o f a n t i b i o t i c protein Hl-overproducing c e l l s New  LITERATURE  LPS  101  HI 103  HI i n a n t i b i o t i c  resistance  . . .  107  resistance for  p e r s p e c t i v e s on s e l f - p r o m o t e d CITED  98 Hi  of protein  Role  97 97  of p r o t e i n  5.  7.  of p r o t e i n  .  112 uptake  . . . .  119 121  ix  L I S T OF Table I II III IV V  VI  VII  TABLES  Title Bacterial  Page  strains  26-27  Plasmids Amino  acid  28-29 composition  o f p r o t e i n HI  Level of expression of cloned i n E_. c o l i and P. a e r u g i n o s a  oprH  50-51  DNA 65-66  Surface hydrophobicity of p r o t e i n H l o v e r p r o d u c i n g c e l l s measured by a d h e s i o n to xylene  81  E f f e c t o f LPS m u t a t i o n s i n c o m b i n a t i o n with p r o t e i n HI o v e r p r o d u c t i o n on s u s c e p t i b i l i t y to polymyxin B  84  S u s c e p t i b i l i t y t o p o l y m y x i n B and c a r b e n i c i 1 1 i n o f P_. a e r u g i n o s a PA01 ( s e r o t y p e 5) and ATCC33354 ( s e r o t y p e 6) grown i n M g - s u f f i c i e n t and Mg 2+-def i c i e n t medium  88  2 +  2+ VIII IX  Mg  -regulated  cell  envelope p r o t e i n s  S u s c e p t i b i l i t y t o p o l y m y x i n B and c a r b e n i c i 1 1 i n o f Pseudomonas s p e c i e s grown i n M g ^ - s u f f i c i e n t and M g - d e f i c i e n t medium 2 +  93  96  X  LIST OF Figure 1. 2.  3.  4.  5.  6.  7.  FIGURES  Title  Page  T e n t a t i v e s t r u c t u r e of the c o r e o l i g o s a c c h a r i d e of LPS i n P_. a e r u g i n o s a PA01 and d e r i v a t i v e s . . .  7  Coomassie B l u e - s t a i n e d SDS-polyacrylamide g e l electrophoretogram i l l u s t r a t i n g p u r i f i c a t i o n of p r o t e i n HI  43  SDS-polyacrylamide-urea g e l electrophoretogram o f p u r i f i e d p r o t e i n HI s a m p l e s , s i l v e r - s t a i n e d f o r LPS  48  N - t e r m i n a l amino a c i d s e q u e n c e o f t h e f i r s t r e s i d e n t s o f p r o t e i n HI, and s e q u e n c e s o f o l i g o n u c l e o t i d e s c o m p l e m e n t a r y t o oprH  53  22  A g a r o s e g e l e l e c t r o p h o r e t i c and S o u t h e r n b l o t a n a l y s i s of r e s t r i c t i o n f r a g m e n t s o f p G B l and pGB2  55  R e s t r i c t i o n map o f a 2.8kb EcoRI f r a g m e n t o f PA01 chromosomal DNA c o n t a i n i n g t h e oprH gene, and s e q u e n c i n g s t r a t e g y  56  N u c l e o t i d e s e q u e n c e o f t h e oprH r e g i o n d e r i v e d amino a c i d s e q u e n c e o f p r o t e i n  58  . . . .  8.  Hydropathy p l o t  9.  S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e t o g r a m and W e s t e r n immunoblot o f c e l l l y s a t e s o f E. c o l i c a r r y i n g p l a s m i d s w i t h oprH DNA, showing p r o d u c t i o n o f p r o t e i n HI  68  S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e t o g r a m and W e s t e r n immunoblot o f f r a c t i o n e d E. c o 1 i c e l l s p r o d u c i n g p r o t e i n Hi  69  11.  Diagram of p l a s m i d  pGB25  73  12.  SDS-polyacrylamide P. a e r u g i n o s a c e l l of p r o t e i n Hi from  e l e c t r o p h o r e t o g r a m of l y s a t e s showing o v e r p r o d u c t i o n oprH on a p l a s m i d  75  10.  for protein  and HI  HI  61  xi  Figure 13.  14.  15.  16.  17.  Title  Page  K i l l i n g o f P_. a e r u g i n o s a , o v e r p r o d u c i n g p r o t e i n HI f r o m t h e oprH gene on a p l a s m i d , by EDTA (+ T r i s )  76  K i l l i n g o f P. a e r u g i n o s a , o v e r p r o d u c i n g HI f r o m t h e oprH gene on a p l a s m i d , by polymyxin B  78  protein  S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e t o g r a m and W e s t e r n immunoblot s h o w i n g e x p r e s s i o n o f p r o t e i n HI by P. a e r u g i n o s a grown i n chamber i m p l a n t s in mice  90  SDS-polyacrylamide g e l electrophoretogram W e s t e r n immunoblot o f c e l l e n v e l o p e s o f P_. a e r u g i n o s a and P. c h l o r a p h i s  94  Schematic diagrams of L P S - d i v a l e n t c a t i o n b i n d i n g s i t e s i n t h e OM o f P. a e r u g i n o s a  and  114  xii  ABBREVIATIONS  AgQQ  a b s o r b a n c e a t 600nm  BM2  B a s a l Medium no. 2  DEAE  diethylaminoethyl  EDTA  ethylenediaminetetraacetate  kb  kilobase  pairs  KDO  2-deoxy-D-manno-octulosonic (ketodeoxyoctonic  LB LPS  acid  acid)  Luria-Bertani broth 1ipopolysaccharide  MIC  minimum  inhibitory  concentration  MW  molecular  OM  outer  PP2  P r o t e o s e P e p t o n e no. 2  SDS-PAGE  sodium d o d e c y l s u l p h a t e - p o l y a c r y l a m i d e  weight  membrane broth gel  electrophores is Tris-HCl  tris(hydroxymethyl)aminomethane  hydrochloride  xiii  ACKNOWLEDGEMENTS  I warmly thank Bob e n c o u r a g e m e n t , and discussions  and  my  Hancock  for advice  colleagues  i n Bob's  f o r p r o v i d i n g a working  was  . . . w e l l , s t i m u l a t i n g t o say  and  Richard  also who  the  S i e h n e l were e s p e c i a l l y  other  members of  help  greatly For  project  and  helpful  environment least.  helpful.  the Department  of  that  B a r b Angus I thank  Microbiology  the  support  I received  from  Sandie  Shewchuk  appreciated.  financial  support  I a c k n o w l e d g e the  Research C o u n c i l and  lab for  were o f a s s i s t a n c e . The  is  the  and  (United  at d i f f e r e n t Science  and  Kingdom), Dr.  Canadian C y s t i c F i b r o s i s  times  during  this  Engineering R.E.W. Hancock,  Foundation.  xiv  DEDICATION  To  I r e n e and  invaluable  Ian B e l l ,  my  contributions  parents, t o my  for  their  education.  1  INTRODUCTION  1.  Pseudornonas  aeruginosa  Pseudomonas a e r u g i n o s a asporogenous, its of  genus,  is a motile,  Gram-negative  i t can grow  a wide v a r i e t y  bacterium.  of sources of carbon  i n the environment,  sediments,  and  P. this  associated  (Palleroni,  with animals  become an  increasingly  u n i n j u r e d h o s t , presumably  by  and  injury  sites.  to i n i t i a t e  elements  or  i s compromised  a e r u g i n o s a can  Consequently,  opportunistic, aeruginosa respiratory  occasionally  i n the u r i n a r y  because  in a the  are  injury)  on  breached  or  i f the  d i s e a s e or treatment  cause  of  of  to defences  immunosuppressive  (e.g.  drug  d i s e a s e a t v a r i o u s body  pathogen. tract,  in spite  i t lacks  i f host b a r r i e r s  by  (especially  but  infection  P_. a e r u g i n o s a i s a l m o s t  nosocomial  tract  water,  is susceptible  However,  diabetes mellitus, P.  in s o i l ,  and  ( e . g . b u r n s , major s u r g e r y , eye  neoplasia, therapy),  unable  mucosa.  immune s y s t e m  It is  important pathogen  healthy,  the s k i n  expense  energy.  a saprophyte,  I t appears  invasive  o t h e r members o f  1981).  humans.  necessary  and  especially  aeruginosa i s b a s i c a l l y  i t has  Like  i n s i m p l e m i n e r a l media at the  ubiquitous  plants  rod-shaped,  exclusively  Infections  by  P.  b l o o d , wounds, and  the congested  an  lungs of  the cystic  2  fibrosis high  patients)  mortality  a r e now common  rate  and a r e a s s o c i a t e d  (Young, 1 9 8 4 ) .  Once e s t a b l i s h e d , P_.  aeruginosa produces t o x i n s ,  proteases,  polysaccharide  that  slime  layers  with a  l i p a s e s and  contribute  to i t s virulence  ( D o e r i n g et_ al_. , 1 9 8 7 ) . The  intrinsic  antimicrobial  resistance  agents  o f P. a e r u g i n o s a t o many  is indirectly  responsible  f o r both the  f r e q u e n c y and s e v e r i t y o f i n f e c t i o n s b y > t h i s o r g a n i s m . ability  to survive  hospital often  disinfectants  rapid  resistant  spread  (e.g.  i n the presence  cetrimide)  between p a t i e n t s .  diseases.  aminoglycosides,  Also,  P. a e r u g i n o s a i s  i n therapy of  some b e t a - l a c t a m s , q u i n o l o n e s  and ( f o r t o p i c a l u s e o n l y ) , p o l y m y x i n s . i s o l a t e d as a p a t h o g e n  widespread  antibiotic  By c o n t r a s t ,  s e c o n d most common (Botzenhart  therapy  before  about  h o s p i t a l pathogen  the i n t r o d u c t i o n of (Weinstein,  i n 1984 t o be t h e i n t h e U.S.A.  Production  and low p e r m e a b i l i t y  membrane t o a n t i b i o t i c s , a r e b e l i e v e d  resistance  P_. a e r u g i n o s a  of a n t i b i o t i c -  enzymes s u c h a s a m i n o g l y c o s i d e  acetyltransferases,  physiological  (Gilbert,  45 y e a r s ago  i t was e s t i m a t e d  and Rueden, 1 9 8 7 ) .  inactivating  to i t s  Among t h e few e f f e c t i v e a g e n t s a r e  was r a r e l y  1985).  o f some  contributes  t o many o f t h e a n t i b i o t i c s used  infectious  1985)  and even grow  Its  t o be t h e two m a j o r  characteristics conferring  on most  P. a e r u g i n o s a  of the outer  isolates  high  antibiotic  ( S a b a t h , 1984; s e e  3 below).  As t h i s  structure  thesis  i s about  and f u n c t i o n o f t h e o u t e r  overviewed  first,  to provide  mechanisms o f a n t i b i o t i c  2.  the l a t t e r ,  knowledge o f t h e  membrane w i l l  a background  be  f o r d i s c u s s i o n of  u p t a k e and a c t i o n t o f o l l o w .  The o u t e r membrane o f P. a e r u g i n o s a  and o t h e r  Gram-  negative bacteria a)  General  properties.  The o u t e r  membrane  (OM) o f  G r a m - n e g a t i v e b a c t e r i a i s a 7 . 5 n m - t h i c k membrane t h a t the  entire  s u r f a c e of the c e l l ,  lying  o u t s i d e the cytoplasmic  ( i n n e r ) membrane, p e r i p l a s m i c s p a c e and p e p t i d o g l y c a n (Inouye,  1979).  I t i s best  Enterobacteriaceae typhimurium, and of  which  knowledge o f o u t e r  reviews,  aeruginosa  by N i k a i d o  in particular)  a r e mentioned The  OM,  containing  like  here  proteins.  i n i t s outer  lipoproteins peptidoglycan  and  by N i k a i d o  to date.  Most i n two  (1985) and ( f o r P. and Hancock  repetitive  (1986),  citations. bilayer  I t has s e v e r a l u n i q u e f e a t u r e s , i s the presence  monolayer.  of 1 i p o p o l y s a c c h a r i d e  C e r t a i n OM p r o t e i n s and  are c o v a l e n t l y or n o n - c o v a l e n t l y layer,  aeruginosa  membranes i s c o v e r e d  and V a a r a  to avoid  Salmonella  i n P.  o t h e r membranes, i s a l i p i d  however, one o f w h i c h (LPS)  as E s c h e r i c h i a c o l i  G r a m - n e g a t i v e b a c t e r i a examined  the present  layer  in certain  but i t s p r o p e r t i e s a r e s i m i l a r  most o t h e r  recent  such  described  covers  and t h e r e may be s i t e s  attached  to the  o f f u s i o n between  4 cytoplasmic the  outermost  polymeric b) OM  and  layer  membranes.  of  the  The  cell,  Phospholipid.  The  although  cytoplasmic  i s t h e major  in  and  P.  aeruginosa  OM,  The  available  Enterobacteriaceae,  data  as  resistance  i t s major,  the  c)  and  c o n f i n e d to  outer  lipidic  such  aeruginosa,  in i t s outer  i n the o u t e r  this  monolayer  to  component.  s p e c i e s too  Since  cell  probably  Patches  m o n l a y e r h a v e been  or n o t  the  resistance is also  monolayer.  et_ al^. , 1 9 7 3 ) .  acid  of  reported,  P o s s i b l y , the phospholipid  conditions i s present  monolayer. L i p o p o l y s a c c h a r i d e and  amphipathic anchored  are  and  growth d e t e r m i n e whether outer  that  the  compounds, d e t e r g e n t s  of P.  of  the  octadecenoic  the  characteristic  (Gilleland  in  fatty  on  (see b e l o w ) ,  however  sole,  and  i n some s p e c i e s c o n f e r  phospholipases  phospholipid  that  l e a v i n g the  i f not  to hydrophobic  phospholipid  of  s p e c i e s of p h o s p h o l i p i d  the p h o s p h o l i p i d s  p r o p e r t i e s o f LPS  lacks  be  membrane e x c e p t  hexadecenoic suggest  i n n e r m o n o l a y e r o f t h e OM,  the  considered  t h e r e may  t h e most a b u n d a n t  components a r e h e x a d e c a n o i c ,  have LPS  be  phosphatidylethanolamine.  Phosphatidylethanolamine  acids.  can  phospholipid composition  to t h a t of the  c o n t a i n s more  the  OM  networks o u t s i d e i t .  is similar  t h e OM  outer  molecules,  i n the  outer  with  divalent cations.  hydrophobic  monolayer of  lipid  t h e OM  LPS  are  portions  and h y d r o p h i l i c  in  5  polysaccharide medium.  LPS  portions protruding into  consists  oligosaccharide, Structural  analyses  heterogeneity chemistry 1983).  and  of  of t h r e e domains:  some of  and  the  molecules  incomplete  i t s unusual  However, improved  chemistry,  surrounding  lipid  A,  core  0 side chain polysaccharide o f LPS  o f LPS  the  isolation  have been  (O-antigen).  limited  knowledge of  components  techniques  of  by  the  the  (Wilkinson,  carbohydrate  of mutants w i t h  altered  LPS  and  the  31 application nuclear  of p h y s i c o - c h e m i c a l  magnetic  understanding aeruginosa  resonance  o f LPS  LPS  has  techniques  spectroscopy  structure,  lagged  have  although  behind  such  as  P-  improved  our  knowledge of  t h a t of  P.  the  Enterobacteriaceae. The  lipid  A o f P_. a e r u g i n o s a  probably  consists  phosphoglucosaminyl-glucosamine-l-phosphate a beta  1-^6  l i n k a g e , to which about  are attached present  by  e s t e r and  are mainly  hydroxydodecanoic  amide  dodecanoic, acids,  and  t h e b a c k b o n e or t o h y d r o x y l chains acyl  ( W i l k i n s o n , 1983;  chains The  extend  core  into  attached  groups of  The  fatty  either  K r o p i n s k i e_t a_l. , 1 9 8 5 ) . the  interior  of  the  A glucosamine  chains acids  and directly  neighbouring  oligosaccharide is so-called  to a l i p i d  fatty-acyl  hydroxydecanoic  are attached  4-  d i s a c c h a r i d e with  linkages.  the 0 p o l y s a c c h a r i d e , i t i s present is  seven  of a  to  fatty-acyl The  fatty-  OM. because, u n l i k e  i n a l l LPS  molecules.  r e s i d u e , by  ester  It  linkage, acid and  to the  (KDO)  first  r e s i d u e of  i n the c o r e .  The  substituents varies  probably which  4-7  and  16,  and  the  antigen  have been p a r t l y  analogy  with  these  depending  how  The  basis  on  f o r the  serotyping  1988).  repeat  acetylated.  of  molecules  is  aeruginosa  suggest  The  PA01,  that  even more,  there  phosphate  aerugjnosa,  P_. a e r u g i n o s a  series  compared  mutants 0  By  of mutants of  " r o u g h " or  S_.  "deep-rough"  absent.  and  this  found  isolates  of n e u t r a l , i n P.  units,  heterogeneity  amino-, and  aeruginosa  most o f  repeat  in a single  a r e more common t h a n have s i d e c h a i n s  e_t a l . ,  acidic  (Knirel t r i - or  attached  cell.  o t h e r s , and  sugars,  e_t a l . , tetra-  t h e amino s u g a r s  units  i s the  Scheme  (see K n i r e l  i n unbranched  and  number o f  between m o l e c u l e s  units  aeruginosa  I n t e r n a t i o n a l A n t i g e n i c Typing  are  strains  of t h e 0 s i d e c h a i n p o l y s a c c h a r i d e  These are arranged  saccharide  varies  much c o r e  A wide v a r i e t y  some u n i q u e ,  most  characterized (Figure 1).  between s t r a i n s ,  o f P.  residues  c o r e o l i g o s a c c h a r i d e as w e l l as  are c a l l e d  composition  greatly  1988).  data  possibility  the w e l l - u n d e r s t o o d  typhimurium,  varies  Current  c o r e o l i g o s a c c h a r i d e i n P.  i n p a r t s of  but  t o t h a t o f P.  in Enterobacteriaceae.  deficient  arrangement of  between s t r a i n s ,  i s shown i n F i g u r e 1.  groups per with  exact  have a c o r e s i m i l a r  a r e between 10  3-deoxy-D-manno-octulosonic  to a  are  N-  core  C e r t a i n numbers o n l y 0.2-20% o f  a t a l l (Hancock, e t a l . , 1983;  7  CORE 0.9 Ala, 2 EtNPCv 8 P 0 LIPID A  4  K D O - K D O - H e p - H e p - -GalNI \ / \ /. Ala (KDO) (Hep)  -Glc.Rha-  -O-ANTIGEN  0 2  AK 1282  AK 1012  AK < 1401 AK1414, H222  F i g u r e J^. T e n t a t i v e s t r u c t u r e o f t h e c o r e o l i g o s a c c h a r i d e o f LPS i n P_. a e r u g i n o s a PA01 and d e r i v a t i v e s . The s t r u c t u r e shown i s an "average" one; f r a c t i o n s (e.g. A l a g 2) i n d i c a t e approximate f r e q u e n c y o f s u b s t i t u t i o n i n a p o p u l a t i o n o f m o l e c u l e s , and t h e p r e s e n c e o f r e s i d u e s i n parentheses i s variable. The s u b s t i t u e n t s above t h e h o r i z o n t a l l i n e a r e a t t a c h e d t o the core r e s i d u e s i n u n c e r t a i n l o c a t i o n s . The phosphate c o n t e n t shown may be an underestimate. L P S - a l t e r e d rough mutants AK1282 (deep-rough), AK1012 and AK1401 (semi-rough) a r e b e l i e v e d t o be d e f i c i e n t i n s t r u c t u r e t o t h e r i g h t o f t h e b o l d v e r t i c a l l i n e s b e s i d e each s t r a i n name. AK1414 core i s p r o b a b l y i n t e r m e d i a t e i n s t r u c t u r e between AK1012 and AK1401. P r e l i m i n a r y evidence s u g g e s t e d t h a t H222 may be s i m i l a r t o AK1414. A l a , L i - a l a n i n e ; EtN, ethanolamine; PO4, phosphate; KDO, 3-deoxy-D-manno-octulbsonic a c i d ; Hep, h e p t o s e ( p r o b a b l y L-glycero-D-manno-heptose); GalN, D-galactosamine; G l c , p_-glucose. I n f o r m a t i o n i s from K r o p i n s k i e t a l . , 1979 and 1985; B e r r y and K r o p i n s k i , 1986; and t h i s study.  8 Kropinski  e t a l . , 1985;  possessing are  full  core  usually called The  Rivera  et_ al_. , 1 9 8 8 ) .  o l i g o s a c c h a r i d e s but  Mutants  l a c k i n g O-antigen  "semi-rough."  investigation  of LPS  s t r u c t u r e i n P.  aeruginosa  was  1  further  complicated  population b a n d s " by neutral  Rivera  the  discovery  molecules. et^ a ^ .  s u g a r - r i c h LPS  separated gel  o f LPS  by  fractions of  e x c l u s i o n chromatography.  weight  of  total  LPS.  a distinct  These m o l e c u l e s ,  (1988) and  from the m a j o r i t y  of  They a r e  types  are  reported  McGroarty,  The  A-bands c o m p r i s e  chemically  to be  ("B-bands")  distinct  and  by  10-15% from  side chains,  i n s t e a d of phosphate. distinct,  "A-  can  molecules  A-bands  by  B-  fewer  The  two  are  among P_. a e r u g i n o s a  strains  1989).  i s s t r o n g l y associated with  2+  before,  LPS  more h i g h l y c o n s e r v e d  and  LPS  Mg  sulphate  also antigenically  apparently (Rivera  and  called  possibly related  bands, c o n t a i n i n g s h o r t e r p o l y s a c c h a r i d e amino-sugars,  sub-  d i v a l e n t c a t i o n s such  as  2+ and  Ca  i n t h e OM.  negatively-charged shown by  the  below),  p h o s p h a t e and  profoundly  cation-chelator these  These a c t  c a t i o n s are  essential  of  The  a charged,  carboxyl  groups  ethylenediaminetetraacetate  between a d j a c e n t  OM.  counter-ions  disruptive effects  interaction the  as  LPS,  LPS  crossbridged  to  the  molecules by  of  to  the  i n LPS.  the d i v a l e n t  (EDTA;  see  stability and  the  of  integrity  divalent cations,  hydrophilic layer different  from  As  the  forms  s u r f a c e of  a  pure p h o s p h o l i p i d hydrophobic of and  serum.  This  allows  compounds and t o r e s i s t Deep-rough m u t a n t s ,  Haemophilus  susceptible divalent  membrane.  that  permeability  the b a c t e r i o c i d a l e f f e c t s  and some s t r a i n s o f N e i s s e r i a  have r o u g h - t y p e LPS, a r e more  to these agents.  cations  t h e OM t o e x c l u d e  i s a major  b a r r i e r , which  Therefore, component  LPS t o g e t h e r  of the outer  i s discussed  i n more  with  membrane  detail  below. LPS  biosynthesis  Briefly, acids  lipid  A i s constructed  t o UDP-sugars, core  fashion,  and O - a n t i g e n  a glycosyl carrier transferred attaches  t h e OM.  lipid  a r e added  units  of f a t t y  i n stepwise  a r e added w i t h  ( G a b r i e l , 1987).  Proteins  The OM c o n t a i n s  the a i dof  LPS may be  make up n e a r l y , h a l f a large  membrane  depending  form p o r i n s  a r e dominant.  up t o n i n e m a j o r OM p r o t e i n s  on growth c o n d i t i o n s .  Several  Protein  of these  proteins  diameter) i n  ( e . g . l i p o s o m e s ) and p r o b a b l y  F forms n o n - s p e c i f i c  channels  In  a r e produced,  ( w a t e r - f i l l e d c h a n n e l s o f 0.6-2.3nm  model membrane s y s t e m s  o f t h e mass  number o f p r o t e i n  b u t a few ( t h e major OM p r o t e i n s )  aeruginosa,  cells.  repeat  by t h e a d d i t i o n  t o t h e OM a t z o n e s where t h e c y t o p l a s m i c  Proteins.  species, P_.  sugars  membrane.  t o t h e OM.  d) of  occurs at the cytoplasmic  i n whole  (Hancock e_t  a l . , 1979),  the phosphate s t a r v a t i o n - i n d u c i b l e p r o t e i n P  forms s m a l l  a n i o n - s p e c i f i c channels  (Hancock e t a l . , 1 9 8 2 a ) ,  10  the  g l u c o s e - i n d u c i b l e p r o t e i n DI  channels protein lactam also  (Hancock and D2  been  Protein  (Trias  reported  F and  and  (Nicas The  by  and  seem t o be  of  P_. a e r u g i n o s a  presumably and in  The integral and  F,  G and  are  HI) by  1989).  with (Woodruff  P r o t e i n Hi  is  iron  Proteases  Hancock, 1 9 8 3 ) .  boiling  "heat-modifiable"  (Mutharia OM  and  involved  a protein i n other  Several to  DI,  (Lambert  Proteins  resistant  species.  a l l believed  Proteins  i n sodium d o d e c y l on  OM  esterase  surface-exposed  fairly  t h e major  c h e l a t e s , and  are  o f P_. a e r u g i n o s a .  are  below.  starvation-inducible proteins,  i n uptake of  are  in detail  major p r o t e i n s , t h e  form t r i m e r i c a g g r e g a t e s .  denaturation so  and  Nakae,  between s t r a i n s  proteins described  OM  E have  roles  Most o f  u p t a k e have been d e s c r i b e d  to the  apparently  iron  enzymes.  m a j o r OM  Mutharia  is discussed  i s unknown.  contains  p o s s i b l y others,  1982;  D2,  and  well-conserved  involved  B.^  beta-  C and  associated  structural  In a d d i t i o n t o t h e s e  phospholipase vitamin  I are  and  and  in divalent cation-deficient conditions  H a n c o c k , 1980)  a l . , 1982).  and  f o r the  Proteins  Hancock et_ al_. , 1 9 8 1 a ) .  growth  et  selective  (Yoshihara  presumably p l a y  f u n c t i o n of p r o t e i n G  proteins  are  porins  uptake  T r i a s ejb a_l_. , 1 9 8 8 ) ,  e_t a l . , 1 9 8 9 ) .  t o be  H a n c o c k , 1989;  inducible  that  l i p o p r o t e i n s H2  peptidoglycan and  C a r e y , 1980;  forms c h a n n e l s  imipenem  forms g l u c o s e  DI,  D2 and  F and  proteins  to and  be F,  Booth, P (Dl,  complete sulphate  (SDS),  SDS-polyacrylamide gels.  The  and  11  native  secondary s t r u c t u r e s ,  dichroism, proteins  were m a i n l y  i  determined  beta-sheet  F and P and m a i n l y  for  by c i r c u l a r detergent-solubi1ized  alpha-helix  for  lipoprotein I  (Mizuno and Kageyama, 1979a and b ; Worobec et^ al_. , 1 9 8 8 ) . OM p r o t e i n s  are synthesized  bound p o l y r i b o s o m e s and e x p o r t e d of  adhesion  by c l e a v a g e o f l e a d e r  of the proteins  OM p r o t e i n s phospholipids Certain  t o t h e 0M  membrane-  possibly  f  between t h e c y t o p l a s m i c membrane and 0M  accompanied termini  on c y t o p l a s m i c  (Randall  presumably  to maintain  LPS m u t a t i o n s  (signal)  f  peptides  f r o m N-  et_ al_. , 1 9 8 7 ) .  i n t e r a c t with  the i n t e g r i t y  affect  at s i t e s  LPS and  o f t h e membrane.  the protein  composition  of the  j OM, and sometimes r e c e p t o r s conjugation it  for bacteriophage adsorption  a r e a combination  isdifficult  Protection  o f LPS and p r o t e i n .  t o measure p r o t e i n - L P S  by LPS f r o m d e n a t u r a t i o n  a l . , 1978).  Beher et_ a_l. (1980) measured b i n d i n g erythrocytes,  (1989) u s e d  an a f f i n i t y  protein-LPS  interactions  relevance intact  aeruginosa  o f E. c o l i  and r e c e n t l y  electrophoresis  association  demonstrated  of p r o t e i n  F with  o f OmpA ejb a l .  s y s t e m t o measure  i n Acinetobacter  r e m a i n s t o be e s t a b l i s h e d .  ( S c h w e i z e r et^  Borneleit  o f t h e s e methods t o p r o t e i n - L P S  cells  directly.  and p r o t e o l y s i s h a s been  f o r t h e OmpA p r o t e i n  LPS-coated  However,  interactions  demonstrated  to  or  calcoaceticus. interactions in However, i n P_. LPS h a s been  by c h e m i c a l c r o s s l i n k i n g and by  crossed  The  12  Immunoelectrophoresis Techniques expression  techniques  of molecular  (Lam  et a_l., 1983).  c l o n i n g and  have a d v a n c e d knowledge o f  heterologous  the  s t r u c t u r e and  function  o f OM  p r o t e i n s of v a r i o u s b a c t e r i a .  proteins  F and  P were c l o n e d  the p r o t e i n s i s o l a t e d bilayers  from  and  expressed  E. c o l i  (Woodruff e t a l . , 1986;  formed  P_.  channels  (Cornells  have been a n a l y s e d .  protein  fragment, type of  F was  introduced  gene, and  the p r o t e i n  cell  shape e)  dyes  the  into  P.  resulting  in antibiotic  (Woodruff  Functions  bilayers (e.g.  m u t a t e d by  X-100) and  to  used  The  u p t a k e and  monolayer  t h e OM  AK1282, F i g u r e 1 ) , as  a result  phospholipid  i n the o u t e r monolayer  interactions  between a d j a c e n t  of  antibiotics  D),  hydrophobic  (e.g. b i l e by  LPS  to  salts,  i n the  resist  of appearance  of  or of w e a k e n i n g  of  molecules.  outer  these  i n d e e p - r o u g h mutants  either  role  Phospholipid  of w i l d - t y p e  LPS  the  1989).  detergents  o f P_. a e r u g i n o s a  gene DNA  i n maintenance  membrane.  This resistance is lost  cloned  r e p l a c e the w i l d -  s u s c e p t i b l e to degradation presence  I  to c l a r i f y  rifamycins, actinomycin  The  agents.  mutant  and  permeable to hydrophobic  phospholipases. allows  aeruginosa  and  lipid  of a s e l e c t a b l e  Hancock, 1988,  (e.g. methylene blue)  Triton  insertion  of t h e o u t e r  are u s u a l l y  macrolides,  and  in  and  S i e h n e l e_t a _ l . , 1 9 8 8 a ) .  (Duchene et_ a_l. , 1988)  for  aeruginosa  i n E. c o l i ,  Sequences of p r o t e i n s F e_t a ^ . , 1989)  gene  (e.g.  Hydrophilic  13  compounds  (e.g.  most b e t a - l a c t a m s , t e t r a c y c l i n e ,  chloramphenicol)  presumably  porin  However, h y d r o p h i l i c p e r m e a b i l i t y i s  channels.  generally  limited  and c o n t a i n i n g  chemical  groups  to pass  b a r r i e r , allowing  via  transport  products,  while  influx  will  s u c h as t h e h y d r o c a r b o n  grow, s l o w l y ,  a 1. , 1 9 8 6 ) ,  hydrophilic can  substrates.  o f waste  compounds t o w h i c h  P_. a e r u g i n o s a ,  moreover,  hexadecane and e n e r g y  (on w h i c h i t source;  i s not l i m i t e d  to small  However, t h e p e r m e a b i l i t y  by c e r t a i n a g e n t s ,  as w i l l  Miguez  barrier  be d i s c u s s e d i n  below.  Besides  providing  penetration, infection. various  as s o l e c a r b o n  so p e r m e a b i l i t y  be d i s r u p t e d  detail  a s u b s t a n t i a l b a r r i e r to a n t i b i o t i c  t h e OM p l a y s The l i p i d  other  A portion  roles  structures, strain  o f LPS 0 s i d e c h a i n s , renders  an a n t i b o d y  non-protective  important  i n human  o f LPS i s r e s p o n s i b l e  t o x i c e f f e c t s o f P_. a e r u g i n o s a  heterogeneity  one  (sometimes  i n d u c i b l e mechanisms f o r t h e u p t a k e o f h y d r o p h o b i c  substances  et  of n u t r i e n t s  many h a r m f u l  Gram-negative b a c t e r i a are exposed. has  that are  as a s e l e c t i v e  pathways) and e f f l u x  excluding  the  shape o r s p e c i f i c  through channels  way, t h e OM a c t s  permeability  the various  enough t o p e n e t r a t e  the c o r r e c t charge,  required  In t h i s  specific  t h e OM t h r o u g h  t o compounds s m a l l  channels  selective.  cross  endotoxin.  t h e major  f o r the  The  antigenic  response t o the s u r f a c e of  against  others.  The  LPS-divalent  14  cation  surface  resistant  structure  to k i l l i n g  a l s o makes P_. a e r u g i n o s a  by serum and complement  highly  (Hancock,  1985).  i'" 3.  Antibiotic susceptibility a)  A n t i b i o t i c action  susceptible  and r e s i s t a n c e  and r e s i s t a n c e .  antibiotic  must be a b l e  sufficient  concentrations  and  this  may  to reach  P_. a e r u g i n o s a i s  require  disruption,  i t s target  penetration  or entry  An e f f e c t i v e  i n the c e l l i n  of the outer  transport  v i a transport  s y s t e m s s u c h as  systems; s p e c i f i c f o r  s t r u c t u r a l l y s i m i l a r to the a n t i b i o t i c .  antibiotic  must  membrane  membrane, by membrane  entry' v i a n o n - s p e c i f i c  some p o r i n s ,  bacteria.  t o c a u s e an i n h i b i t o r y o r k i l l i n g  sometimes the c y t o p l a s m i c  molecules  aeruginosa  or r e s i s t a n t to a n t i b a c t e r i a l a n t i b i o t i c s f o r  many o f t h e same r e a s o n s as a r e o t h e r  effect;  i n P.  The  t h e n be a c t i v e enough, g i v e n t h e i  concentration disrupt  a v a i l a b l e at the target  i t s target  sufficiently  effect.  affect  molecules concerned  biosynthesis  located  morphological inhibition, the  F o r example, b e t a - l a c t a m  due t o c e l l  lysis.  In a human h o s t ,  e f f e c t ive against  bacteria  cross  membrane,  wall  causing  weakening,  t h e OM  antibiotics  that  antibiotics  peptidoglycan  To a c h i e v e t h i s  b e t a - l a c t a m m o l e c u l e s must  quantities.  with  at the cytoplasmic  aberrations  and c e l l  t o i n h i b i t or  t o cause a b a c t e r i o s t a t i c or  bacteriocidal target  site,  growth  successfully, in sufficient  need  have p r o p e r t i e s  t o be that are  15  different et  from those  concentrations bacteria, host  the  p r o p e r t i e s to reach sufficient  Kelly  enough t o c a u s e  to a n t i b i o t i c s  f o r m e r may be p a s s e d  change  may be g e n e t i c  to the  in cell  physiology  that  Genetic  i s merely  disappears  o f most s t r a i n s  the  o f m u t a t i o n , DNA r e a r r a n g e m e n t  acquisition).  of a species)  using  Resistant  a periplasmic  (penicillin-binding reduced  combination reduced  c e l l s may i n a c t i v a t e  protein)  OM p e r m e a b i l i t y of these  (Sabath,  i n t r i n s i c , acquired,  studying  a temporary  soon a f t e r  removal  or acquired  (i.e.  o r new DNA  antibiotics  that binds  as an  the beta-lactam  enzyme, may s y n t h e s i z e  OM p e r m e a b i l i t y  antibiotics  o f some  Some o f t h e common mechanisms o f r e s i s t a n c e  be i l l u s t r a t e d by t a k i n g b e t a - l a c t a m  example.  cell  r e s i s t a n c e may be i n t r i n s i c ( e . g .  a property result  or adaptive;  and s o i s t h e r e s u l t  i n DNA, b u t t h e l a t t e r  the a n t i b i o t i c .  have  toxicity  on t o p r o g e n y o f t h e r e s i s t a n t  t h e absence of a n t i b i o t i c ,  can  the target  itself.  alteration  of  (e.g.  the s i t e of i n f e c t i o n i n  to i n h i b i t or k i l l  but not e x c e s s i v e  Resistance  of  in vitro  a l . , 1 9 8 9 ) , and t h e d r u g must have t h e n e c e s s a r y  pharmacokinetic  in  o f b a c t e r i a grown  an a l t e r e d  less  target  o f t h e d r u g , may  t o t h e d r u g , o r may u s e a 1984).  i s believed and a d a p t i v e  In P_.  aeruginosa,  t o be a s i g n i f i c a n t  cause  resistance to  (Hancock, 1 9 8 4 ) , b u t , b e c a u s e o f d i f f i c u l t i e s i n  permeability,  t h e p r e c i s e mechanisms have  rarely  16  been e x p l a i n e d . considered  The pathways o f a n t i b i o t i c  below, b u t f i r s t ,  antibacterial  agents  uptake w i l l  be  the e f f e c t s of c e r t a i n  important  in this  study w i l l  be  reviewed. b)  E f f e c t s of c h e l a t o r s  mentioned (e.g.  a b o v e , EDTA and o t h e r  nitrilotriacetate)  structure of  Tris  and p o l y c a t i o n s  (Nikaido  buffer)  proteins,  chelators  have p r o f o u n d  and V a a r a , 1 9 8 5 ) .  causes  release  morphological  of d i v a l e n t  EDTA  o f LPS and p e r i p l a s m i c  detergents  compounds, enhanced OM p e r m e a b i l i t y nitrocefin, chelation LPS  and ( a t h i g h  concentration)  increasing  to disrupt  electrostatic  molecules.  LPS-LPS  in  the outer  and  Vaara,  1985).  that  Since  associated  replaces  acts  The  with  anionic  adjacent the released uptake  LPS  (Nikaido  i t enhances uptake of v a r i o u s  t h e OM o f P_. a e r u g i n o s a  increases  Polymyxin tail,  lysis.  i n t e r a c t i o n s , p e r h a p s by  H a n c o c k , 1 9 8 6 ) , EDTA has been c a l l e d  acyl  beta-lactam  monolayer, enhancing hydrophobic  compounds a c r o s s  compound  enhanced  cell  r e p u l s i o n between  Possibly, phospholipid  s u r f a c e as  and h y d r o p h o b i c  to the  by EDTA o f d i v a l e n t c a t i o n s  i s believed  cations  ( i n the presence  a l t e r a t i o n s i n the c e l l  t o lysozyme,  As  e f f e c t s on OM  s e e n by f r e e z e - f r a c t u r e e l e c t r o n m i c r o s c o p y , susceptibility  on c e l l s .  OM  ( N i k a i d o and  a p e r m e a b i 1 i z e r (a  permeability).  B, a p o l y c a t i o n i c d e c a p e p t i d e w i t h p r i m a r i l y on c y t o p l a s m i c  membrane  a  fatty-  lipids,  17  causing  l e a k i n e s s o f t h e membrane  Polymyxin crosses  B i s too l a r g e to pass  t h e OM w i t h  morphological of  cells  (Hancock and N i c a s ,  t h r o u g h most p o r i n s , b u t  considerable  disruption  a b e r r a t i o n s s u c h as b l e b b i n g ,  t o lysozyme,  detergents,  high 1986) so  (Nikaido affinity  less  implies acid  agents),  of i t sl e t h a l  Polymyxin  ( k ^ of approximately  i s a l s o a permeabi 1 i z e r  much  polymyxin toxic  that  ring  B binds  a c t i o n on LPS w i t h  0.4uM; Moore e t a l . ,  B i s also a potent  to b a c t e r i a  (Nikaido  cytoplasmic  tail  i s required  p e r m e a b i l i z e r , but i s  with  i t s seven-amino  for insertion  into  breakdown o f  and d e a c y l a t e d  polymyxin  o f p o l y c a t i o n i c compounds p e r m e a b i l i z e  antibiotics  (Hancock and Wong, 1 9 8 4 ) .  d r u g s have  streptomycin,  The g r o u p  and t o b r a m y c i n .  l o n g been known t o a f f e c t  have a v a r i e t y  of other  effects  (Hancock 1981a and b; D a l h o f f ,  includes group,  Although  protein synthesis,  on c e l l s 1987).  B, a  t h e OM o f P_.  of the a m i n o g l y c o s i d e / a m i n o c y c l i t o l  gentamicin,  This  integrity.  In a d d i t i o n t o i n t a c t  aeruginosa  1985).  f o r p e r m e a b i 1 i z a t i o n , but  membranes l e a d i n g t o l e t h a l membrane  uptake,  OM.  and V a a r a ,  the p o l y c a t i o n i c peptide,  fatty-acyl  variety  o f t h e P_. a e r u g i n o s a  structure, is sufficient  phospholipid  as  1985).  and s e n s i t i z a t i o n  and e n h a n c e s h y d r o p h i l i c as w e l l as h y d r o p h o b i c  Deacylated  the  and V a a r a ,  (causing  and h y d r o p h o b i c  w h i c h may be a s u b s t a n t i a l component cells  1984).  such these they  i n c l u d i n g OM damage  A third  c l a s s of  18  compounds, m o n o v a l e n t cetrimide)  can  organic cations  p e r m e a b i l i z e t h e P.  concentrations  (Hancock and  ( s u c h as  aeruginosa  Wong, 1 9 8 4 ) .  Tris OM  The  and  at high  permeabi1izer  2+ compounds a r e g e n e r a l l y a n t a g o n i z e d Taken  t o g e t h e r , the data suggest  likely  to e x e r t t h e i r  divalent  cation  1984), e i t h e r displacement latter  has  polymyxin, with  LPS  effects  by  chelation  of d i v a l e n t  susceptibility  uptake  described  above.  to pass  s e e N i k a i d o and  through Vaara,  Enterobacteriaceae some b e t a - l a c t a m  B  However, t h e (e.g. on  of  pathways.  coli, porins 1985 may  LPS-  (Hancock,  The  of d a n s y l derivative,  different  in competition  LPS)  suggest  have t h e  that  with not  same  agent. The  porin  aminoglycosides (Nakae and  be  different  P_. a e r u g i n o s a  antibiotics,  pathway  of  antibiotics,  of t h i s  but  work),  i n P_. a e r u g i n o s a  mutants  but at  of  a r e more r e s i s t a n t  tetracycline,  as  have been  Nakae, 1982;  for a critique  Porin-deficient and  are  competitive  t o some s m a l l h y d r o p h i l i c  In E.  (see b e l o w ) .  surface  polymyxin  binding sites  uptake  t h e mechanism o f u p t a k e least  disruption  interaction  permeabi1izers  to a given  is available  assumed  s t u d i e s of  for binding sites  Antibiotic  by  ( e . g . EDTA) o r  a fluorescently-labeled  LPS-divalent cation  Ca  c a t i o n s (e.g. p o l y c a t i o n s ) .  been shown by  of d i f f e r e n t  and  permeabi1izers  a t t h e OM  (Moore e t a l . , 1 9 8 6 ) .  c)  that  added Mg  primarily  binding sites  dansy1-polymyxin all  action  by  2+  to  chloramphenicol  19  and  norfloxacin  for  the high  (Hancock and  intrinsic  compared  w i t h E. c o l i  molecules  of p r o t e i n  adopt  channels  hydrophobic  can  be  that  shown by  into  that  and  aeruginosa most  aeruginosa)  or v e r y  aeruginosa, with  narrow  of  moderately  addition  as  is virtually  d e s c r i b e d above.  a hydrophobic  probe,  antibiotic  uptake  can  be  enhanced  of p e r m e a b i 1 i z e r s ,  pathway, s e l f - p r o m o t e d  p o s t u l a t e d to o c c u r  other  Chemically-induced  species.  EDTA + T r i s  f o r polymyxin  and  cross-resistant  t o EDTA + T r i s ,  aminoglycosides  were i s o l a t e d  H a n c o c k , 1980) protein,  H i , by  deficient  2+ Mn  by  as  and up  found  i n P.  aeruginosa  and  m u t a n t s o f P_.  polymyxin  (strains  B  H181  to overproduce  to 2 4 - f o l d .  Wild-type  in certain  divalent  uptake,  B, possibly  aeruginosa  and and  H185;  Nicas  constitutively cells  grown i n  2+ media  1-  upon p e n e t r a t i o n of  I t s uptake  aminoglycosides  OM  reasons  above.  recently  and  o f P.  interior,  fluoresces  by  o f P_.  given time,  partition  experiments  of the  .  t h e OM  (Loh e_t al^. , 1 9 8 4 ) .  A third was  a t any  gives closed  i n w i l d - t y p e P.  deep-rough mutations mentioned  that  pathway o f u p t a k e ,  One  resistance  Hancock, 1986)  N-phenylnaphthylamine, membranes  be  1988).  ( t h e major p o r i n  antibiotics  non-existent This  may  ( N i k a i d o and  A second  antibiotic  F  a conformation  Bell,  c a t i o n s (Mg  2+ , Ca  ,  2+ , Sr  induced  ) had  similar  for protein  r e s i s t a n c e p r o p e r t i e s and  Hi e x p r e s s i o n  ( N i c a s and  were  Hancock,  1980,  an  20  1983b).  Cells  displayed  with mutational  altered  kinetics  overproduction  of s t r e p t o m y c i n  of p r o t e i n  uptake  Hi  (Hancock e t  2+ al.,  1981b) and  envelopes however, lactams  had  ( N i c a s and  and  tetracyclines,  levels  to other or  I t was  action  antibiotics  concluded  that  presumably  and  enhance t h e i r  hypothesized  to  inhibit  own  self-promoted  and  Hi  probably to  EDTA + T r i s .  the Since  could  u p t a k e by sites  on  replacing LPS.  The  i n t h e membrane, c o u l d n o t  the p e r m e a b i 1 i z e r s , and  (Nicas  P r o t e i n Hi i s  being  membrane d i s r u p t i o n  toeta-  they  protein,  by  as  (see a b o v e ) ,  c a t i o n s at n e g a t i v e l y charged  displaced  such  cation  uptake.  anchored  change,  LPS-divalent  divalent  stably  no  is essential  o f p o l y c a t i o n s and  p e r m e a b i l i z e t h e OM  cell  memhrane  that protein  compounds a r e known t o d i s r u p t  interactions  outer  nitrocefin  a common u p t a k e pathway  bacteriocidal  in their  T h e r e was  i n the  to the b e t a - l a c t a m  Hancock, 1 9 8 3 a ) . inhibits  Mg  Hancock, 1 9 8 0 ) .  in susceptibility  permeability  these  reduced  and  consequent  thus  could  uptake of  be  prevent  the  disrupting  polycation. These c o n c l u s i o n s were d i s p u t e d by (1982),  who  reported other  changes  Gilleland  i n OM  and  Conrad  p r o t e i n s and  lipids  •i in  H181  protein  and HI  H185,  and  i n these  concentrations mechanism o f  demonstrated  strains  of p o l y m y x i n  decreased  when grown B.  in  of  sub-inhibitory  They p r o p o s e d  r e s i s t a n c e i n the mutants  levels  that  is similar  the to that  21  found  i n P.  aeruginosa that  growing  i n polymyxin  content  caused  the c e l l et  by  made a d a p t i v e l y - r e s i s t a n t  involving  reduced  envelope  (Gilleland  polymyxin  i n the B  (mimicked  medium), and growing  i n the presence  failed  H185,  o t h e r than  could  account  Hancock  EDTA  growth  their  f o r the  However, Moore  between m u t a t i o n a l of a s t r a i n  in divalent occurring  of the drug. changes  resistant  in cultures  T h e i r more  (initial)  protein  from  Hi,  HI  low  and  that  Moreover,  Nicas  levels  susceptibility  were s h i f t e d  thorough  i n t h e m u t a n t s H181  phenotype.  shown t h a t  to  cation-deficient  o v e r p r o d u c t i o n of p r o t e i n  well with  when c e l l s  concentrations in  1984).  susceptibility  to demonstrate  (1983b) had  corresponded and  by  by  in phospholipid  cation  e_t al_. ,  adaptive a l t e r a t i o n s  study  and  initial  changes  divalent  a l . (1984) drew a d i s t i n c t i o n  alteration  B  B,  was  to  polymyxin  to high  2+ concentrations Recently, relationship and  levels  aeruginosa. other  than  resistance of  Mg  Said  e_t a l _ . (1987) f a i l e d  between s u s c e p t i b i l i t y  of p r o t e i n  HI.in twelve  However, t h e i r protein  Hi are  of p r o t e i n  data  HI  and  to f i n d  to polymyxin clinical  a B and  isolates  only confirm that  involved  to those agents,  the e f f e c t s  other  of  t h e need  P.  factors  in susceptibility  underscore  of  EDTA  or f o r study  o v e r p r o d u c t i o n independent  of  variables. A somewhat s i m i l a r  type of mutation  has  been d e s c r i b e d  22 in  Salmonella  typhimurium  m u t a n t s were r e s i s t a n t polymyxin  et_ a K  of  and p e r m e a b i l i z a t i o n by  o f 4 - a m i n o a r a b i n o s e and e t h a n o l a m i n e ,  (1987) f o u n d  m u t a n t s o f E. c o l i lower  The pmrA  a p p a r e n t l y owing t o  the net n e g a t i v e charges  Peterson  ejt a _ l . , 1 9 7 8 ) .  to k i l l i n g  B and EDTA + T r i s ,  overproduction reduced  (Makela  on LPS  (Vaara  that polymyxin  phosphate groups  had LPS w i t h a  owing t o i n c r e a s e d  i n the l i p i d  e t al_. , 1 9 8 1 ) .  B-resistant  (Meyers e t a_l. , 1974) a l s o  net n e g a t i v e charge,  A and c o r e  esterification  regions.  neither  s e t o f m u t a n t s , however, was o v e r p r o d u c t i o n  protein  involved.  Chapman and G e o r g o p a p a d o k o u suggested act  that the quinolone  as a c h e l a t o r o f d i v a l e n t  coli  i s also  antibiotic  and o f p o l y c a t i o n i c  a l . , 1988).  of  OM  fleroxacin,  which  t h e OM o f E.  u p t a k e pathway.  i n E_. c o l i peptides  (Seltmann  from  Gram-negative s p e c i e s  that  the self-promoted  than  P.  The  and W a l t e r ,  macrophages  (Sawyer  pathway may  ( s e e above)  operate  i n species  suggest other  aeruginosa.  The following  may  T h e s e o b s e r v a t i o n s and t h e s i m i l a r p r o p e r t i e s  of d i f f e r e n t  obscure,  o f an OM  i m p l i c a t e d i n the uptake of the p o l y c a t i o n i c  streptothricin  et  In  recently  cations, crosses  i n p a r t by t h e s e l f - p r o m o t e d  pathway  1987)  (1988) h a v e  antibiotic  which  p r e c i s e molecular disruption  nature  of LPS-cation  and i t s e l u c i d a t i o n  of the uptake  process  interactions  remains  probably  depends on a b e t t e r  23 understanding membranes.  There  accumulation membranes effects  o f abnormal s t r u c t u r e s i n L P S - c o n t a i n i n g i s electron microscopic  of transient  LPS  aggregates  that displacement  t o become r i g i d  rearrange  LPS p a c k i n g ,  (Peterson  e_t a l _ . , 1 9 8 5 ) .  Aims o f t h i s As  causing  antibiotics,  "cracks"  causes  a n t i b i o t i c s to  i n the structure  i s an  partly  important t o many  b e c a u s e o f i t s low o u t e r  The p o s s i b i l i t y  of a novel  pathway o f  u p t a k e , used by some o f t h e most e f f e c t i v e  Pseudomonas a g e n t s , understanding new  and a l l o w s  It i s highly resistant  membrane p e r m e a b i l i t y . antibiotic  s p i n p r o b e has  study  pathogen.  commonly-used  infections.  i s t h e r e f o r e of great  of t h i s  insights  into  self-promoted effective  One e l e m e n t  self-promoted  outer  A n a l y s i s of the  of c a t i o n s  d i s c u s s e d above, P_. a e r u g i n o s a  nosocomial  to  1986).  o f p o l y c a t i o n s on LPS u s i n g a c a t i o n i c  to the proposal  f o r the  in gentamicin-treated  ( M a r t i n and B e v e r i d g e ,  led  4.  holes  evidence  interest.  antiA deeper  u p t a k e pathway m i g h t  chemotherapy  lead  f o r P_. a e r u g i n o s a  t h a t may be i n v o l v e d i n b l o c k i n g  u p t a k e , OM p r o t e i n H i , was  investigated in this  study. There proteins function,  i s also substantial  general  interest  i n OM  as m o d e l s o f membrane p r o t e i n s t r u c t u r e and and r e s e a r c h  i n t o OM p r o t e i n s i s a d d r e s s i n g  some  24 fundamental b i o l o g i c a l problems. available, function, field  protein so  even The  of  and  role  N-terminal  to  construction  of  identify  cloned  the  Cloning  2).  the  1),  of  and  Some s t u d i e s  interaction  to  genetic.  to  unique  illuminate  investigate resistance The  amino a c i d  complementary  e f f e c t of  the  probes  gene p e r m i t t e d  studies  of  t h i s on  expression  antibiotic  are  presented  similar proteins examined  and  be  methods  of  of  presented  the  protein  (Chapter  4).  HI  The  following  and  to  i n E_.  analysis i s o l a t e d gene  susceptibility  in species  (Chapter  used.  sequence  has  purified  as  s t r u c t u r a l gene f o r p r o t e i n  the  investigations will  was  HI  oligonucleotides  w i t h LPS  was  protein  protein  allow  function  aeruginosa  of  structure,  to  the  of  the  sequencing,  of  occurrence  materials  information  have an  i t is likely  in a n t i b i o t i c  subjected  and  limited  a e r u g i n o s a may  I have t a k e n  molecular  (Chapter  the  further.  been c h i e f l y  coli.  P.  i n v e s t i g a t i o n of  approach  function,  Hi  On  Hi 3).  and  (Chapter its  Finally,  r e l a t e d to  P_.  r e s u l t s of  these  a summary o f  the  the  .1  25  MATERIALS AND  METHODS  1.  strains,  Bacterial The  in  bacterial  Table  I.  The  mutants are as  LPS  used  2%  growth c o n d i t i o n s  i n 8%  U.S.A.) e x c e p t  agar  H181,  8ug/ml p o l y m y x i n  on  X.  1%  w h i c h was  B sulphate.  E^ c o l i  ( M a n i a t i s et; al_. , 1 9 8 2 ) . f o r rough  s y r i n g a e , P.  X.  maltophilia Plasmids  following for  ampicillin  stutzeri,  JM101  P.  peptone  was  DH5o4F' was  agar  cepacia strains  with  maintained  on  with  maintained  Growth t e m p e r a t u r e s  a e r u g i n o s a mutants j P.  PP2  no.  Michigan,  supplemented  ( T a b l e I I ) were m a i n t a i n e d  25ug/ml  on  were  P_^_ c h l o r a p h i s , and  c o n c e n t r a t i o n s added ( i n LB)  or  15ug/ml  in bacteria  with  t o growth  media:  ( i n M9-glucose)  sodium, 12.5ug/ml t e t r a c y c l i n e h y d r o c h l o r i d e ,  25ug/ml k a n a m y c i n for  and  (30°C).  antibiotic  col i,  P^  on  kept  short-term  maltophi1ia  maintained  h y d r o c h l o r i d e , and  P.  were  (Difco L a b o r a t o r i e s , D e t r o i t ,  5ug/ml t h i a m i n e  37 °C e x c e p t  For  proteose  ( M a n i a t i s et^ al_. , 1982)  agar  aeruginosa  dimethylsulphoxide.  M9-glucose agar  LB  P^_  are d e s c r i b e d  A l l strains  a l l Pseudomonas s t r a i n s ,  Bacto  study  i n rough  i n F i g u r e 1.  c a l c o a c e t i c u s were m a i n t a i n e d (PP2)  and  in this  alterations  illustrated  maintenance,  2  strains  s t o c k s a t -70°C  A.  plasmids,  aeruginosa,  s u l p h a t e , 25ug/ml s t r e p t o m y c i n  sulphate;  150ug/ml t e t r a c y c l i n e h y d r o c h l o r i d e ,  the  26 Table I.  Bacterial  Species  P. a e r u g i n o s a  strains  Strain  PA01 H181  H222  R e l e v a n t Phenotype  p r o t o t r o p h , O-serotype 5  A.M. K r o p i n s k i  "r Px , p r o t e i n H1-overproducing mutant o f PA01  N i c a s and Hancock, 1980  s  Px , p r o t e i n H1-overproducing p s e u d o r e v e r t a n t o f H181 AK1282  Source o r r e f e r e n c e  rough mutant of PA01 (see F i g u r e 1)  N i c a s , T . I . and R.E.W. Hancock, unpublished A.M.  Kropinski  AK1012 AK1414  coli  OT684  PA01 l e u l y s r e s ( r e s t r i c t i o n deficient)  AK1401  rough mutant o f 0T684 (see F i g u r e 1)  ATCC33354  O-serotype 6  P.V. L i u  M2  virulent  S t i e r i t z and Holder, 1975  JM101  A l a c - p r o supE t h i F'traD36 proAB laciqzAM15  J.T. B e a t t y  DH5°CF'  F'4>80dlacZ Ml5 endAl r e c A l hsdRl7 ( r ^ , m^ ) supE44 t h i - 1 gyrA r e l A 1 A,( lacZYA-argF)U169  Bethesda Research Laboratories ^  strain  -  P. c h l o r a p h i s  ATCC9446  P. f l u o r e s c e n s  ATCC949  " P. p u t i d a  ATCC13525 ATCC4359  -  c  American Type Culture Collection*  type s t r a i n  Species  Strain  P. s t u t z e r i  ATTCC17588  P. s y r i n g a e  ATCC19310  P. c e p a c i a  ATTCC25416  it  ATCC25609  Xanthomonas maltophilia  ATCC13637  Acinetobacter calcoaceticus  8197  Relevant  Phenotype  Source o r r e f e r e n c e  American Type Culture C o l l e c t i o n  type  strain  C l i n i c a l isolate; var. haemolyticus/alcaligenes  A.W. Chow  A.M. K r o p i n s k i , Dept. o f M i c r o b i o l o g y and Immunology, Queen's U n i v e r s i t y , Kingston, Ontario b  P.V. L i u , U n i v e r s i t y o f L o u i s v i l l e , L o u i s v i l l e , Kentucky, U.S.A.  c J.T. B e a t t y , Dept. o f M i c r o b i o l o g y , U n i v e r s i t y of B r i t i s h Columbia, Vancouver, B.C. d  e  Bethesda R e s e a r c h L a b o r a t o r i e s , B u r l i n g t o n , O n t a r i o American Type C u l t u r e C o l l e c t i o n , R o c k v i l l e , Maryland, U.S.A.  f A.W. Chow, D i v i s i o n o f I n f e c t i o u s D i s e a s e s , Vancouver G e n e r a l H o s p i t a l , Vancouver, B.C. TC  Px , polymyxin B - r e s i s t a n t .  S  Px , polymyxin B - s u s c e p t i b l e .  28  Table I I .  Plasmids  Plasmid  Relevant p r o p e r t i e s  pUC8  ColE1 A  P  pUC9  ColE1 A  P  pUC18  ColE1 A  P  pTZ18R  ColE1 A  P  pTZ18U  ColE1 A  pLAFRI  IncP1  TC  pRK404  IncP1  TC  pRK767  IncP1 Tc  pRK2013  ColE1  pRK2045  pSC101 t r a ( R K 2 ) T c  pNM185  IncQ/P4 Km  pGB1  1.3kb P s t I fragment pUC18  pGB2  As p G B l , fragment  pGB3  As pGB1, i n pUC9  pGB4  As pGB2, i n pUC9  pGB5  As pGB1, i n pUC8  pGB6  As pGB2, i n pUC8  pGBl 1  0.5kb Smal-PstI fragment  pGB12  As p G B l l , fragment  Source o r r e f e r e n c e  p l a c lacZot  r  +  r  plac l a c Z <  r  + p l a c lacZoc.  r  plac  P  r  r  r  11  Yanisch-Perron e t a l . , 1985  + lacZoc  p l a c lacZoC+  r  V i e i r a and Messing, 1982  f1-ori  + + p l a c l a c Z « x mob t r a  +  r  Sm  r  •II  Friedman 1982  + + p l a c lacZ**. mob t r a  +  a  f1-ori  + Xcos mob t r a  tra(RK2) Km  U.S. B i o c h e m i c a l Corp.  ejb a l . ,  D i t t a et_ al_., 1985 G.S. D i t t a  b  F i g u r s k i and H e l i n s k i , 1979  r  r  p ( TOL) jn  mob t r a +  ( p a r t i a l oprH) i n  Mermod e t a l . , 1986 T h i s study  i n opposite o r i e n t a t i o n  ( p a r t i a l oprH) i n pTZl8R  i n opposite o r i e n t a t i o n  d  Plasmid  Relevant p r o p e r t i e s  pGB22  2.8kb EcoRI fragment  (oprH) i n pUCl8  pGB23  2.8kb EcoRI fragment  (oprH) i n pRK767  pGB24  As pGB23, fragment i n o p p o s i t e o r i e n t a t i o n  pGB25  As pGB23, i n pNM185 (see F i g u r e 11)  pGB32  1.8kb  pGB52  0.8kb Smal-Kpnl  pGB54  As pGB52, i n pTZ18U  pGB62  1.9kb  pGB122  As pGB22, fragment from H181  PGB123  2.8kb EcoRI fragment  PGB124  As pGBl23, fragment i n o p p o s i t e o r i e n t a t i o n  pGB142  1.4kb BamHI-Kpnl fragment  pGB162  As pGB62, fragment from H181  PGB172  2.3kb E c o R I - S a l l fragment  a  BamHI-Sall  Source o r r e f e r e n c e  fragment fragment  EcoRI-Kpnl fragment  (oprH) i n pUC18 (oprH) i n pTZ18R  (oprH) i n pTZ18U c  (oprH) from H181 i n pRK404  (oprH) from H181 i n pTZ18R  (oprH) from H181 i n pTZ18U  U n i t e d S t a t e s B i o c h e m i c a l Corp., C l e v e l a n d , O h i o , U.S.A.  b  c  G.S. D i t t a , Dept. o f B i o l o g y , U n i v e r s i t y o f C a l i f o r n i a a t San D i e g o , L a J o l l a , C a l i f o r n i a , U.S.A. Odd-numbered p l a s m i d s (e.g. pGBl) had oprH i n t h e same o r i e n t a t i o n as t h e v e c t o r promoter; even-numbered p l a s m i d s had oprH and t h e v e c t o r promoter i n opposite orientations. P l a s m i d s numbered below 100 c o n t a i n e d fragments from t h e chromosome o f P_^ a e r u g i n o s a PA01; those numbered above 100 c o n t a i n e d fragments from t h e chromosome o f P. a e r u g i n o s a H181.  d  F o r a r e s t r i c t i o n map o f t h e oprH r e g i o n , see F i g u r e 6.  30  300ug/ml (in  ( i n LB w i t h  low s a l t ,  i . e . l g / 1 N a C l ) o r 500ug/ml  BM2-succinate or M9-glucose)  kanamycin  sulphate.  Expression  of s t r e p t o m y c i n - r e s i s t a n c e or i n s e r t e d  pNMl85  co-induced  (for  was  E^ coli)  obtained  o r 2mM  genes i n  by a d d i t i o n o f s o d i u m b e n z o a t e t o (for  aeruginosa).  f r o m Sigma C h e m i c a l  Antibiotics  5mM were  Co., S t . L o u i s , M i s s o u r i ,  U.S.A.).  2.  SDS-PAGE Analysis  polyacrylamide separation  of p r o t e i n p r o f i l e s gels,  In some e x p e r i m e n t s ,  i n 2% t r i c h l o r o a c e t i c  before  solubilization  i n SDS  acid  a n a l y s i s o f LPS c o n t a i n e d  and  were p e r i o d a t e - t r e a t e d and s i l v e r  method o f T s a i  Protein purification isolation  were grown and  and F r a s c h  i n 1.51  Phibbs,  samples  were  and n e u t r a l i z e d w i t h  and e l e c t r o p h o r e s i s .  for  For  to permit  o f p r o t e i n s H i and H2, as d e s c r i b e d p r e v i o u s l y  pretreated  3.  done by SDS-PAGE on 14%  c o n t a i n i n g 85mM N a C l  (Hancock and C a r e y , 1 9 7 9 ) .  Tris  was  15% p o l y a c r y l a m i d e  Gels  and 6M  urea  s t a i n e d f o r LPS by t h e  (1982).  methods  of outer  membranes  (OM), PAOl and  c u l t u r e s i n B M 2 - s u c c i n a t e medium  H181 (Eagon  1971; and c o n t a i n i n g lOuM F e S 0 ) a t 37°C, 4  with 2+  vigorous  aeration.  C u l t u r e s o f AK1012 were grown  i n Mg  2+ deficient  (20uM Mg  ) BM2-succinate a t 30°C.  Cells  were  31  a t an AgQQ  harvested  DNase I , b r o k e n Instrument  o f 0.7-1.0.  i n a French pressure c e l l  Co., S i l v e r  fractionated  They were t r e a t e d  Spring, Maryland,  by s u c r o s e g r a d i e n t  previously  (Hancock  and C a r e y ,  detergents  as d e s c r i b e d  with  (American U.S.A.), and  s e d i m e n t a t i o n as d e s c r i b e d  1979).  OM were s o l u b i l i z e d i n  by Hancock e_t a l _ .  (1982b) .  a s s a y s were done by t h e method o f Sanderman,and  Protein  Strominger  'i  (1972).  !  Detergent-solubi1ized  OM were f r a c t i o n a t e d  e x c h a n g e columns c o n t a i n i n g sepharose running buffer 100,  resins  buffers  (Pharmacia, consisted  or carboxymethyl-  B a i e d'Urte, Que.).  o f 2% T r i t o n  phosphate  carboxymethyl-sepharose. continuous  gradient  buffer Proteins  were e l u t e d  o f 0 t o 0.3M N a C l  by d i a l y s i s  against  and 2% T r i t o n X-  (pH 6 . 0 ) , lOmM EDTA f o r  wash w i t h 0.5M o r IM N a C l .  concentrated  The b a s i c  X-100, 20mM T r i s HC1  (pH 8 . 0 ) , lOmM EDTA f o r D E A E - s e p h a c e l  20mM s o d i u m  a final  DEAE-sephacel  on i o n -  with a  i n running b u f f e r ,  Protein  samples  were  dry polyethylene glycol  20,000. Detergent-solubi1ized fractionated protein  methanol  on 1.5 mm-thick S D S - p o l y a c r y l a m i d e  bands e x c i s e d  described  o u t e r membranes were  and e l e c t r o e l u t e d  by P a r r e_t a ^ . (1986) , e x c e p t were o m i t t e d f r o m  also g e l s and  e s s e n t i a l l y as that  the e l e c t r o e l u t i o n  g l y c i n e and buffer.  with  32  4.  Determination acid  N-terminal  HI  0.1%  terminal  purified  SDS  by  SDS-PAGE was  in deionized  and  A spinning  cup  Inc.,  Alto, California,  Palo  sequenator  w a t e r and  also  performed  110°C  f o r 24,  by 48  72  (Dept.  Nof  used.  hydrolysis  followed  by  B.C.).  Instruments, Pure  protein against  Amino a c i d a n a l y s i s  amino a c i d  Ant i s e r u m p r o d u c t i o n and  to  dialyzed extensively  hours,  Beckman 119-CL automated  Kielland  U.S.A.) was  K i e l l a n d , by  and  extensively  subjected  (model 890-C; Beckman  lyophilized.  S.  S.  dialysed  U n i v e r s i t y of V i c t o r i a ,  f o r amino a c i d a n a l y s i s was  deionized  5.  w a t e r , and  Microbiology,  amino  Hi  amino a c i d s e q u e n c i n g by  Biochemistry  HI  amino a c i d s e q u e n c e and  compos i t i o n o f p r o t e i n  Protein against  of  i n 6M  was  HC1  at  a p p l i c a t i o n to a  analyzer.  purification,  immunoblotting,  and c r o s s - l i n k i n g Protein in  2%  HI  was  SDS-20mM T r i s  described protein  above and  HI  band was  molecules.  A total  to  a f e m a l e New  subcutaneous injection second  50%  purified HC1  pH  by  8.0  i n Chapter excised, of  Freund's  preparative  1 below.  The  rabbit a period  SDS-PAGE  OM as  heat-unmodified  was  administered  i n a s e r i e s of of  Freund's complete  incomplete  o f AK1012  some n o n - d e n a t u r e d  380ug of p r o t e i n HI  i n j e c t i o n s over 50%  and  to g i v e  Zealand white  included  solubilization  adjuvant.  11  weeks.  adjuvant When t h e  The and  first the  titre  33  against 1984)  SDS-solubi 1 ized  reached  immunosorbent puncture  10^, as d e t e r m i n e d assay,  proteins  antibodies  F-Sepharose  was k i n d l y  that  remained  resulting  immunoblots recognize  directed  affinity  unbound  a t -70°C. membrane  adsorbed,  (1979),  affinity-purified  a t 1/25 d i l u t i o n ,  of p r o t e i n s blotting)  from  (1986).  serum r e a c t e d  SDS g e l s  o f 10mA  antiserum to protein  anti-rabbit  immunoglobulin  B.C.) as t h e s e c o n d .  (Helix  Colony  method o f H e l f m a n et^ a_^.  (Hancock  by Towbin e_t Blots  et; a ^ . , 1984)  H i a t 1/25 d i l u t i o n as  phosphatase-conjugated  goat  B i o t e c h . L t d . , Richmond,  immunoblotting  was done by t h e  ( 1 9 8 3 ) , u s i n g t h e same  as f o r W e s t e r n b l o t s .  lysates.  to n i t r o c e l l u l o s e  f o r 18 h o u r s .  previously  a n t i b o d y , and a l k a l i n e  with  but i t d i d not  was done as d e s c r i b e d  using a current  purified  reactions  fraction  HI bands on W e s t e r n  using  stains  The serum  any o t h e r components o f P^ a e r u g i n o s a c e l l  (Western  first  ( P o o l e and Hancock, 1986)  by P o o l e and Hancock  as d e s c r i b e d  and  outer  by c a r d i a c  t o t h e column was t h e n a b s o r b e d t o  were d e v e l o p e d  the  and s t o r e d  against  column  as d e s c r i b e d  when used  ;Transfer  al.  was e x s a n g u i n a t e d  18,000 and 21,000-MW p r o t e i n  sheets  e_t a l . ,  enzyme-linked  p r o v i d e d by K. P o o l e .  w h o l e PA01 c e l l s  both  (Hancock  F and H2 were removed by p a s s i n g t h e serum o v e r a  that  The  the rabbit  by  and t h e serum was e x t r a c t e d  Contaminating  protein  o u t e r membranes  Molecular  were done on OM as d e s c r i b e d  antiboides  cross-linking  by R e i t h m e i e r and  34  Bragg  (1977) u s i n g  dithiobis  (succinimidyl  (Pierce Chemical  Co., R o c k f o r d ,  glutaraldehyde.  Products  SDS-PAGE and W e s t e r n  6.  Illinois,  were a n a l y s e d  propionate) U.S.A.) o r  by o n e - d i m e n s i o n a l  blotting.  O l i g o n u c l e o t i d e des i g n and s y n t h e s i s Oligodeoxyribonucleotides  DNA  synthesizer  (Applied Biosystems, Foster  U.S.A.) by T. A t k i n s o n , British  as d e s c r i b e d  N-terminal  Figure  U n i v e r s i t y of  Crude o l i g o n u c l e o t i d e s  by A t k i n s o n  i n the design  oligodeoxyribonucleotides  and S m i t h  (1984).  the s t r u c t u r a l  o f complementary  t h a t were used  as p r o b e s t o  gene f o r p r o t e i n H i , o p r H .  c o d o n u s a g e e s t a b l i s h e d f o r two P^ a e r u g i n o s a al.,  California,  amino a c i d s e q u e n c e o f p r o t e i n HI ( s e e  4) was used  identify  on a 380A/B  City,  Dept. of B i o c h e m i s t r y ,  C o l u m b i a , V a n c o u v e r , B.C.  were p u r i f i e d The  were s y n t h e s i z e d  1984; P r i t c h a r d and V a s i l ,  The  genes  1986) was used  (Gray e t  to l i m i t the  number o f d i s t i n c t Oligonucleotides  o l i g o n u c l e o t i d e m o l e c u l e s i n each p o o l . C C A AACC 1 c o n s i s t e d o f 5'-AATAATATCCAGAAGTGGAA-3', a  m i x t u r e o f 128 20-base  long  molecules  corresponding  amino a c i d s e q u e n c e NNIQKSK.  Nucleotides  positions  a t <7.5% f r e q u e n c y  9 and 18 were f o u n d  P. a e r u g i n o s a  2,  C  i n t h e two  Oligonucleotides  c  5'-AACTTCGTGGGCCTGACGTGGGGCGA-3',  separate  A and T i n  genes and were n o t i n c l u d e d . C  to the  s e q u e n c e o f amino a c i d s  corresponded  NFVGLTWGE.  to a  Oligonucleotides  35  2 were made l o n g e r  (26 b a s e s ) and l i m i t e d t o e i g h t  o l i g o n u c l e o t i d e m o l e c u l e s , w i t h a l l codons o c c u r r i n g of  residues  Balland  i n t h e P_. a e r u g i n o s a  ejt al_. , 1985; L a t h e ,  oligonucleotide  i n <10%  sequences e l i m i n a t e d (see  1985 f o r d i s c u s s i o n s o f  design). j  7.  DNA  techniques  All  DNA t e c h n i q u e s were c a r r i e d o u t as d e s c r i b e d  Maniatis  e t a_l. (1982) e x c e p t  (Goldberg  isolation  and Ohman, 1 9 8 4 ) , S o u t h e r n  o f chromosomal DNA  b l o t t i n g using  Zeta-  • J  TM  probe  by  c a t i o n i c nylon  Richmond, C a l i f o r n i a ,  membrane ( B i o - R a d L a b o r a t o r i e s , 32 ' : ! U.S.A.), P end l a b e l i n g o f 32  oligonucleotides of  (Woods, 1 9 8 4 ) ,  double-stranded  DNA  random hexamer  (Feinberg  P-labeling  and V o g e l s t e i n ,  1983) and  TM  subsequent Inc.,  purification  by E l u t i p - d  Keene, New H a m p s h i r e ,  size-fractionation membranes  U.S.A.), f r a g m e n t  on a g a r o s e g e l s  (NA45; S c h l e i c h e r  (Schleicher  using  & Schuell,  i s o l a t i o n and  DEAE-cellulose  & S c h u e l l ) , quick  lysis  plasmid  l  preparation  (Holmes and Q u i g l e y ,  agarose g e l e l e c t r o p h o r e s i s modification  1981),  (Sekar,  enzymes were o b t a i n e d  1987)  andjslot-lysis .  R e s t r i c t i o n and  from v a r i o u s !  and  were u s e d  into  oligonucleotides  portion on  as recommended.  of [  was measured by s u b j e c t i n g  of the l a b e l i n g mixture  a strip  Incorporation  o f DE81 p a p e r  to descending  (Whatman  Inc.,  manufacturers 32 -  P]ATP  a small  chromatography  Clifton,  New  Jersey,  36 U.S.A.) i n 0.3M ammonium the  strip  horizontally  scintillation  formate  (pH 8.0) and t h e n  and m e a s u r i n g  counter.  Clones  with  Cerenkov inserts  pRK v e c t o r s  were d i s t i n g u i s h e d f r o m c l o n e s  alone  X-gal  using  galactopyranoside; California,  8.  DNA  radiation  in a  i n pUC, pTZ o r containing  vector  (5-bromo-4-chloro-3-indoyl-Beta-DClontech  Laboratories, Palo  Alto,  U.S.A.).  sequencing  Isolation Carlson  dividing  of single  stranded  DNA  (Dente e_t a j _ . , 1983;  and M e s s i n g , 1984) and dideoxy-DNA  reactions  were done as recommended  Biochemical  Corp., C l e v e l a n d ,  sequencing  by U n i t e d  States  O h i o , U.S.A., u s i n g  [  SjdATP  TM and  Sequenase  .  polyacrylamide-7M  Products  were s e p a r a t e d  on 6%  u r e a - T r i s borate-EDTA b u f f e r g r a d i e n t  gels  TM (Biggin  et^ aj^. , 1983) u s i n g  (Hoefer  Scientific  U.S.A.) m a i n t a i n e d Research 9.  Instruments,  a Poker Face  San F r a n c i s c o ,  apparatus California,  a t 65°C o r a model S2 a p p a r a t u s  (Bethesda  Laboratories, Burlington, Ontario).  DNA and p r o t e i n s e q u e n c e S e q u e n c e s were a n a l y s e d  p r o g r a m , SEQNCE v e r s i o n 2.2 Vancouver, protein  either  B.C.).  analyses with  (Delaney  The amino a c i d  was compared w i t h  t h e a i d o f a computer Software  Ltd.,  sequence o f t h e mature  a d a t a b a n k o f 7,396 s e q u e n c e s  37  (BIONET) u s i n g  10.  t h e FASTA p r o g r a m  Whole c e l l  p r o t e i n and  (Pearson  and  LPS  preparation  LPS  preparations  Lipman,  and  1988).  cell  fractionation Whole c e l l SDS  boiling  cultures  method  of  and  and  reach  H a n c o c k , 1980)  mid-logarithmic  Mid-logarithmic  P_^_ a e r u g i n o s a  when c e l l s  (Nicas  coli  aeruginosa. of  p r o t e i n and  phase  using  i n most media  intended  f o r LPS  a n a l y s i s were d i g e s t e d  K per  p r o t e i n f o r 12  fractionated except and  on  i n the  a smaller  harvested  "envelope"  concentration  scale.  as  60°C. f o r OM  Cells  i n s t a t i o n a r y phase  fraction  centrifugation  same way  was  of  5mM),  with  rr r  and  the  proteinase  cells  were  (see  above)  i n M9-glucose  = 1.4).  (MgSO^ was  and  lysates  isolation  were grown (A . .  (Nicas  0.8ug  E^ c o l i  the m a t e r i a l p e l l e t e d  of broken c e l l s  P.  i s overproduced  In some e x p e r i m e n t s , whole c e l l  hours at  overnight  ( A ^ Q Q = 0.4-0.6) c u l t u r e s  Hancock, 1980).  ug  an  phase c u l t u r e s of  were used b e c a u s e p r o t e i n HI s t a t i o n a r y phase  were made by  The  by  added  high-speed to a  "soluble" fraction  was  the  supernatent.  11.  T r i p a r e n t a l conjugation To  t r a n s f e r plasmids  following  general  employed.  Donor  from  method o f (E. c o l i  E^ c o l i  triparental  with  t o P^  aerug i n o s a ,  conjugation  the plasmid  to  be  was  the  38  transferred),  helper  and  ( P ^ a e r u g i n o s a PA01)  recipient  overnight  (E^_ c o l i  i n the presence  were t h e n c e n t r i f u g e d , (E.  co 1 i )  the  same medium  (E.  coli)  bacteria  or l o w - s a l t  the  obtained E. c o l i  10  1  Antibiotic Strains  t o P^ a e r u g i n o s a susceptibi1ity  for antibiotic  Cells 0.9%  aeration  w/v  2 helpers:  membrane.  1  The  p l a t e and  NaCl, d i l u t e d  and  were  transferred  from  testing testing  of a n t i b i o t i c s ,  i n t h e same medium  o r 0.5-0.8  first  i f necessary,  with  ( f o r P^_ a e r u g i n o s a  (for E^ coli) .  5 u l of c u l t u r e  were  in antibiotic-free  t o an A g g g °^ 0.4-0.6  by a d d i n g  phase,  PA01.  and r e s u s p e n d e d  vigorous  species),  LB  were t h e n washed o f f  susceptibility  They were t h e n grown  determined  of 2 donors:  p l a s m i d pRK404 was  medium.  related  They  with appropriate a n t i b i o t i c s .  grown o v e r n i g h t i n t h e p r e s e n c e  and  grown  a t 37°C  At l o g a r i t h m i c  transconjugants per r e c i p i e n t  t h e n were c e n t r i f u g e d  pRK2045)  i f necessary.  up on an LB a g a r  2ml o f s t e r i l e  when t h e c o n t r o l DH5CXF  were f i r s t  in antibiotic-free  on t o a O.45um-pore  on l o w - s a l t LB a g a r 5  Approximately  12.  i n the r a t i o  a t 37°C f o r s i x h o u r s . into  or  (P_^_ a e r u g i n o s a ) , s u b c u l t u r e d i n t o  placed c e l l - s i d e  membrane  spread  resuspended LB  and f i l t e r e d  incubated  of a n t i b i o t i c s ,  (P^_ a e r u g i n o s a ) .  were mixed  membrane was  strains  pRK2013  and grown w i t h v i g o r o u s a e r a t i o n  o r 42° C  recipient  with e i t h e r  in duplicate  MICs  were  to lOOul of  39  doubling  dilutions  microtitre  trays.  of a n t i b i o t i c s  A f t e r i n c u b a t i o n , growth  m e a s u r e d by a T i t e r t e k Inc.,  Mississauga,  uninoculated defined >50%  result  and Hancock  (1983b).  c u l t u r e s were e x p o s e d concentrations  of  The MIC was  used  to select  as a  the plasmid-  were done as d e s c r i b e d by  One h u n d r e d - f o l d  d i l u t i o n s of  at various diluted  (pH 7.0) and s p r e a d  c u l t u r e s with  those  i n 30mM  on PP2 a g a r .  were c a l c u l a t e d by c o m p a r i n g  antibiotic-treated  causing a  were l o s t  f o r 5 m i n u t e s a t 22°C, t h e n  of survival  growth o f  medium, as shown by  to a n t i b i o t i c s  sodium phosphate b u f f e r Rates  assays  Laboratories  of a n t i b i o t i c  No p l a s m i d s  in antibiotic-free  Killing  (Flow  controls.  concentration  MICs f o r t h e a n t i b i o t i c s cells.  scanner  i n t h e w e l l s was  and compared w i t h  i n absorbance.  o f growth  carrying Nicas  Ontario)  as t h e l o w e s t  testing  Multiskan  and a n t i b i o t i c - f r e e  reduction  i n t h e same medium i n  colony  counts  of untreated  cont r o l s . Growth c o n d i t i o n s f o r a n t i b i o t i c  susceptibility  were as f o l l o w s :  f o r P^ a e r u g i n o s a  strains  oprH on a p l a s m i d  ( F i g u r e s 13 and 1 4 ) , 37°C  with  tests  and w i t h o u t  i n M9-glucose  2+ with  500uM r a t h e r t h a n  altered  ; f o r P^ a e r u g i n o s a L P S -  m u t a n t s and c o n t r o l s t r a i n s  succinate ImM  2mM Mg  (with e i t h e r  ( T a b l e V I ) , 30°C  i n BM2-  500uM o r 20uM MgSO^) s u p p l e m e n t e d  l e u c i n e and ImM l y s i n e ;  f o r P^ a e r u g i n o s a  PA01 and  ATCC33354, P. c h l o r a p h i s , P. f l u o r e s c e n s and P. p u t i d a  with  40 (Tables VII or  and  I X ) , 30°C  20uM M g S 0 ) ; and 4  glucose.  MIC  incubated  at  37°C, or  all  kanamycin  per  acid  mg  from  after  24  and  i f incubated  at  solid),  sulphate  carbenici11 in  xylene  Kelly  (Rosenberg  aerug inosa  aeruginosa  chambers  implanted  (Kelly  envelope  Cell  envelopes  Pseudomonas and  A/-  on  mg  h y d r o c h l o r i d e and  solid),  EDTA were  M2  cells,  measured by  suspensions  the  caused  by  e_t al_. , 1 9 8 0 ) .  i n chamber  implants  grown f o r t h r e e d a y s  i n m i c e , were k i n d l y p r o v i d e d  i n mice in Teflon by  N.M.  et a l . , 1987).  Cel1  fractionation  disodium.  Sigma.  absorbance of c e l l  Growth o f P.  sulphate  (677ug k a n a m y c i n p e r  was  to  M9-  30°C.  (8,100u/mg), g e n t a m i c i n  surface hydrophobicity of  in  hours i f  Cell  P.  an  hours  i n LB  hydrophobicity  adhesion  15.  37°C  ( w i t h 500uM, 50uM  Measurement o f e e l 1 s u r f a c e  reduction  14.  36  sodium, t e t r a c y c l i n e  obtained  13.  coli,  B sulphate  (577ug g e n t a m i c i n  ampicillin  for  p l a t e s were s c o r e d  Polymyxin  H2O,  in BM2-succinate  isolation were i s o l a t e d  related  s p e c i e s as  above, e x c e p t  o f 0.4-0.6.  from  30ml c u l t u r e s o f  described  for  cell  t h a t c u l t u r e s were h a r v e s t e d  C u l t u r e s were grown  i n BM2-succinate  at  41 with  500uM o r 20uM Mg  2+  with  the f o l l o w i n g 2+  species medium  that  exceptions:  for  2+  would  n o t grow i n 20uM Mg , Mg -deficient 2+ c o n t a i n e d 50uM Mg ; maltophilia required  supplementation  w i t h ImM  methionine;  stutzeri  was  grown i n  2+ M9-glucose medium  r a t h e r than 2+  t h e Ca  level  BM2-succinate was  reduced  16.  Other  and a n a l y s i s  uptake  et  described  envelopes.  1 9 7 5 ) , measurement o f  of l-N_-phenylnaphthylamine of i n t e r a c t i o n  of c e l l s  (Moore e_t a_K , 1 9 8 6 ) , t r a n s p o s o n  a l . , 1984; R e l l a  biparental  student  a s s i s t a n c e with the  focussing (O'Farrell,  1 9 8 4 ) , measurement polymyxin  Summer  methods  Isoelectric cellular  of c e l l  -deficient  t o 20uM).  S.C. B i n n i e p r o v i d e d some t e c h n i c a l preparation  ( i n Mg  (Loh et_ a l . , with  mutagenesis  e_t a ^ . , 1985) and p l a s m i d  conjugation previously.  (Simon e_t a_l_.,  dansyl(Tsuda  mobilization  1983) were done as  by  42  CHAPTER 1  PURIFICATION AND  PROPERTIES OF PROTEIN HI AND  AND  NUCLEOTIDE SEQUENCE OF ITS STRUCTURAL  1.  Purification membrane Outer  of p r o t e i n  membranes  P. a e r u g i n o s a  P A O l , H181  the p r o t e i n  as t h e m a j o r p r o t e i n  two  HI; O p t i m i z a t i o n o f o u t e r  (OM) p r e p a r e d  from  Lane 1 ) .  MW  ( N i c a s and Hancock, a t 100°C  appears.  gels;  a t 22°C o n l y  virtually  acid  a heat-modified  Triton  a l l of the p r o t e i n  1979; F i g u r e 2, l a n e s  the heat-unmodified  HI a p p e a r e d  X-100-Tris  form  X-100-Tris OM  with  sonication sequentially  was e n r i c h e d  X-100-Tris  HC1 pH  (Hancock et_ a_l. , 1 9 8 2 b ) , t h e  HCl-insoluble, Triton  fraction  i n SDS,  i n the H i * p o s i t i o n .  HC1 pH 8.0 and T r i t o n  8.0-EDTA as p r e v i o u s l y d e s c r i b e d  soluble  band  heat-unmodified  b e f o r e h e a t i n g a t 100°C  When t h e H181 OM was s o l u b i l i z e d  Triton  Hi gives  When t h e sample was p r e - t r e a t e d w i t h  trichloroacetic  in  1980; F i g u r e 2,  21,000, and a r e s i d u a l  When s o l u b i l i z e d  mutant o f  i n SDS, p r o t e i n  ( H i ) o f 18,000 (Hancock and C a r e y ,  1-4).  gradient  ( N i c a s and Hancock, 1 9 8 0 ) , c o n t a i n  When s o l u b i l i z e d  (Hi*) o f apparent  by s u c r o s e  Hl-overproducing  bands on S D S - p o l y a c r y l a m i d e  band  GENE  solubilizations  sedimentation  HI  CLONING  X-100-Tris  in protein  HI  HC1-EDTA-  ( F i g u r e 2,  F i g u r e 2* Coomassie B l u e - s t a i n e d SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m i l l u s t r a t i n g p u r i f i c a t i o n of p r o t e i n H1. Lanes: 1, OM o f H181; 2, OM o f AK1012 ( M g - d e f i c i e n t ) ; 3, T r i t o n X-100-Tris H C l - i n s o l u b l e , T r i t o n X - 1 0 0 - T r i s HC1-EDTA-soluble OM f r a c t i o n o f H181; 4, T r i t o n X - 1 0 0 - T r i s H C l - E D T A - i n s o l u b l e , SDS-Tris H C l - s o l u b l e OM f r a c t i o n from AK1012; 5 and 6, p r o t e i n H1 p u r i f i e d by SDS-PAGE and e l e c t r o e l u t i o n o f h e a t - m o d i f i e d (H1*) bands; 7 and 8, p r o t e i n H1 p u r i f i e d by SDS-PAGE and e l e c t r o e l u t i o n of h e a t - u n m o d i f i e d (H1) bands; 9, p r o t e i n H1 p u r i f i e d by anion-exchange chromatography. Lanes 1-4 c o n t a i n e d 20ug o f p r o t e i n each; l a n e s 5-8 c o n t a i n e d 12.5ug each; l a n e 9 c o n t a i n e d 6ug. Samples i n l a n e s 1-5, 7 and 9 were s o l u b i l i z e d a t 100°C b e f o r e l o a d i n g onto t h i s a n a l y t i c a l g e l ; samples i n l a n e s 6 and 8 were s o l u b i l i z e d a t 22°C. Running p o s i t i o n s o f r e l e v a n t MW standards ( i n thousands) a r e shown on the l e f t , and o f h e a t - m o d i f i e d (H1*) and h e a t - u n m o d i f i e d (H1) p r o t e i n H1 bands, on the r i g h t . 2 +  44 lane  3).  When t h i s  fraction  was a p p l i e d  anion-exchange columns, p r o t e i n other  outer  omitting  membrane  the s o n i c a t i o n during  purification outer  proteins,  was  improved  membranes w i t h  associated  proteins  solubilization  with  with  F, G and I .  the second  s o l u b i l i z a t i o n the  Neither  the detergents  3-14 s o l u b i l i z e d  o c t y l g l u c o s i d e or  Both o c t y l g l u c o s i d e and  almost  a l l outer  i n t h e a b s e n c e o f EDTA.  c a r b o x y m e t h y l s e p h a r o s e a l s o gave p o o r  outer  membrane  proteins.  by p a p a i n  outer  in  order  separation  membrane  I and F i g u r e  strain  OM  of to  a u r e u s V8  proteins  use was made o f t h i s  OM o f a rough mutant (Table  solubilized  H i was more r e s i s t a n t  and by S t a p h y l o c o c c u s  t h a n most o t h e r  shown), b u t no f u r t h e r  Protein  membrane  Cation-exchange  using  AK1012  digestion of  peptidoglycan-  c h r o m a t o g r a p h y o f T r i t o n X - 1 0 0 - T r i s HC1-EDTA  protease  By  (Hancock e t a _ l . , 1 9 8 1 a ) , n o r  Zwittergent  degradation  various  especially  lysozyme t o r e l e a s e  3-14 were h e l p f u l .  even  HI c o - e l u t e d  (see b e l o w ) .  Zwittergent  proteins  t o DEAE-Sephacel  ( d a t a not  observation.  o f P. a e r u g i n o s a PA01,  1) were a l s o  to minimize contamination  used  for purification  of p r o t e i n  HI by 2+  immunogenic  LPS O - a n t i g e n .  Cells  were grown i n Mg  deficient  medium t o i n d u c e s y n t h e s i s  lane  2).  Protein  only  sparingly  Hi i n outer  soluble  However, f u r t h e r  of p r o t e i n  membranes o f t h i s  i n T r i t o n X-100-Tris  solubilization  Hi (Figure strain  HC1-EDTA.  i n S D S - T r i s HC1 gave a  was  2,  45  fraction further  enriched purified  properties rough  of  the  2.  (see  protein  and  LPS  that  an i o n - e x c h a n g e Triton  (see  reducing  performing  cycle  a second void  that  protein  nature of  protein  Hi  the  and  4)  which  was  solubilitysmooth  LPS  and  were  association  depended  HI  from  s o l u b i l i z e d membranes  the two  above) were s u b j e c t e d  pH  of  cycles of  (0.1%  The cycle  by  chromatography  DEAE-sephacel  the of  to  protein to  i n the  middle  of  (Figure  2,  lane  9).  protein  HI  f o r every  Hi  was  7.0,  running  the  protein  0 to  in protein  T r i t o n X-100) and  volume c o n t a i n e d  various obtained  and  chromatography with d i f f e r e n t  fractions rich (2%  outer  r e s i n under  T r i t o n X-100) most p r o t e i n the  H181  an i o n - e x c h a n g e  running b u f f e r  T r i t o n X-100  column n e a r  gradient.  different  Optimum p u r i f i c a t i o n o f  concentrations  from the  lane  X-100-Tris HCl-EDTA-solubi1ized  conditions.  first  The  2,  i n o u t e r membranes o f  the  chromatography using  by  Hi  (Figure  type.  P u r i f i c a t i o n of  membranes  HI  below) .  s t r a i n s suggested  associated, on  in protein  Hi  that  However, t h e lOOug a p p l i e d  the  Hi was 0.3M  was  the  In  NaCl  part  virtually only first  the  eluted  were s u b j e c t e d  early  was  yield to  HI  buffer.  of  to  the  pure  about column.  5ug  of  46 3.  Purification  of protein  H i from s o l u b i l i z e d  membranes by  SDS-PAGE Solubilized loaded  OM o f H181 and AK1012  on p r e p a r a t i v e  bands were e x c i s e d  SDS-polyacrylamide gels  and e l e c t r o e l u t e d .  (HI*) bands were e x c i s e d membranes t h a t instances ran 2,  had been  treated  5 and 6 ) .  renature a f t e r  (Hi) bands were e x c i s e d  contained 2,  lanes  and  7 and 8 ) .  unmodified  from g e l s  a t 22°C  (Figure  the p r o t e i n  l o a d e d w i t h membranes pure  G.  Protein  19,000  that  protein  molecules  G gives  (Hancock  pure p r o t e i n  (Figure  loading  g e l depth, t o reduce smearing of protein  d i d not  When h e a t - u n m o d i f i e d  the r e s u l t i n g  o f a p p a r e n t MW  elution  protein  C a r e was t a k e n t o m i n i m i z e  stacking  band  the pure  volume  o f t h e HI a heat-  and C a r e y , H i was o b t a i n e d  o f HI bands w i t h o u t e l e c t r i c  current  (data  shown). The  over  that  from t h e g e l .  Completely non-denatured  careful  not  acid,  when s o l u b i l i z e d  indicated  t o 100°C,  bands and c o - e l u t i o n  by  even  solubilized  and i n some  b o t h d e n a t u r e d and n o n - d e n a t u r e d  maximize  1979).  loaded with  h e a t e d t o 100°C,  This  excision  were n o t h e a t e d  from g e l s  and p r o t e i n H i  When h e a t - m o d i f i e d  with t r i c h l o r o a c e t i c  i n t h e HI* p o s i t i o n lanes  ( s e e above) were  yield  ten-fold  above) .  of pure p r o t e i n  HI from  h i g h e r than t h e y i e l d  S i n c e SDS-PAGE was a l s o  became t h e method o f c h o i c e .  SDS-PAGE  (>50%) was  from chromatography (see  less  time-consuming, i t  7  4  4.  Properties  of  purified protein  HI ji  The are  LPS  compositions  shown i n F i g u r e  relatively  specific  c o r e b a n d ) , but some e x t e n t . detectable contained  The  at  least  with  0 side  did.the  i n the  of  LPS  from  resolve  the  the  with  of  but  the  Hi  a b s e n c e of from the  for  protein  HI  LPS  lacking  LPS  HI  may  not  with  No  be  results  disrupted  by  detected  was  point  attempt  sonicated  of  bulk  separated  In an  18,000).  on  with  However, t h e  protein  ( a p p a r e n t MW isoelectric  than  in  was  to  the  smooth LPS  m i x t u r e was  renaturation.  was  molecules  chains  These  HI. LPS  LPS  same g e l ,  of  in fractions well  the  of  have c o - p u r i f i e d  protein  no  cdntaminating  association.  and  to  ratio  the  0 side  associated  p u r i f i e d PA01  change t h e could  on  this association  any  renatured p o s i t i o n might  run  proportion  was  rough  stains  molar  a higher  column  protein  look  thick  chromatography  o u t e r membranes.  that  t h i s question,  LPS  The  The  fractions containing  SDS-PAGE t o  LPS.  shown).  to molecules  protein  pure, denatured  in  not  are  chromatography  p u r i f i e d by  A l t e r n a t i v e l y , the  eluted  the  Hi  contained  LPS  and  samples  SDS-PAGE c o n t a i n e d  p u r i f i e d by  amounts of  (data  o u t e r membranes, and  Hi  pattern  p u r i f i e d by  protein  chains  that  SDS-PAGE.  (ladder  protein  HI  staining conditions  c o m p a r i n g w i t h p u r e LPS  Hi  bulk  suggested  but  1:1.  pure p r o t e i n  gel  purified protein  ( i n d i v i d u a l bands) a l s o  protein  i n the  the  f o r LPS  substantial  e s t i m a t e d , by  The  protein  LPS,  to p r o t e i n  be  3.  of  analysed was  to  with on  observed Association  the  isoelectric  protein, focussing  48  1  2  F i g u r e ^ . SDS-15% p o l y a c r y l a m i d e - u r e a g e l e l e c t r o p h o r e t o g r a m o f p u r i f i e d p r o t e i n H1 samples, s i l v e r s t a i n e d f o r LPS. No p r o t e a s e treatment was included. Lane 1, p r o t e i n H1 p u r i f i e d by ion-exchange chromatography (6ug o f protein). Lane 2, p r o t e i n H1 p u r i f i e d by p r e p a r a t i v e SDS-PAGE (12.5ug o f protein). Rough c o r e LPS (rLPS) and O - a n t i g e n - c o n t a i n i n g LPS ( l a d d e r p a t t e r n : arrows) a r e i n d i c a t e d on t h e l e f t o f t h e f i g u r e .  49  gels,  perhaps because  r a n g e 4-7 measure and  ( O ' F a r r e l l , 1975).  inhibition  sites  detergent strongly  lanes and  with  HI o f i n t e r a c t i o n between LPS  a fluorescent  t o keep p r o t e i n  probe o f p o l y c a t i o n -  Hi i n s o l u t i o n  H i p u r i f i e d by SDS-PAGE  5 and 6) was u s e d  that  i t was n o t p o s s i b l e t o  interacted  the probe.  amino a c i d  with  was n o t i n t h e  (Newton, 1955; Moore e t a l . , 1 9 8 6 ) , b e c a u s e t h e  needed  Protein  point  Finally,  by p r o t e i n  dansyl-polymyxin,  biriding  its isoelectric  (HI* b a n d : F i g u r e  f o r N-terminal  analysis  amino a c i d  because of the high  yield  2,  sequencing obtained  method and t h e a b s e n c e o f LPS i n t h e p r o d u c t .  sequence o f t h e f i r s t determined  22 N - t e r m i n a l  amino a c i d s  t o be NH -ADNFVGLTWGETSNNIQKSKSL..  The  was  The r e s u l t s  1  of  amino a c i d  analyses  of p u r i f i e d p r o t e i n  H i a r e shown i n  Table I I I . Protein of  H i p u r i f i e d f r o m AK1012 by SDS-PAGE and e x c i s i o n  heat-unmodified  administered purified Western  5.  bands a c t e d  to a rabbit  (see M a t e r i a l s  a n t i s e r u m was used immunoblots  Analysis  immunogen when and M e t h o d s ) .  to i d e n t i f y protein  The  HI bands on  (see below).  o f P. a e r u g i n o s a  hybridization  as a good  with  chromosomal DNA by  oligonucleotides  complementary t o  oprH. The used  N-terminal  to design  amino a c i d  complementary  sequence of p r o t e i n  HI was  oligodeoxyribonucleotides  (see  50  Table  III.  Amino a c i d  Amino a c i d c o m p o s i t i o n  of p r o t e i n H1  ( o n e - l e t t e r code)  Number of r e s i d u e s  Analysis  Alanine  (A)  A r g i n i n e (R)  a.  b  Sequence"  11.3  11  5.2  7  A s p a r a g i n e (N)  17 27.6°  Aspartate Cysteine  (D)  10  (C)  0  O  a  Glutamate (E) 18.9  , a  Glutamine (Q) Glycine  7  10  (G)  29.2  23  2.6  2  6.7  7  18.6  20  10.1  11  0.4  1  6.2  7  1.5  3  S e r i n e (S)  17.4  16  T h r e o n i n e (T)  10.5 a  11  Tryptophan (W)  1  2  5.5  9  5.5  4  Histidine  (H)  Isoleucine Leucine Lysine  (I)  (L) (K)  M e t h i o n i n e (M) Phenylalanine Proline  Tyrosine  (P)  (Y)  .Valine (V) Total  (F)  178.2  3  178  51 Amino a c i d c o m p o s i t i o n a c c o r d i n g t o a n a l y s e s performed on p u r i f i e d H1. The p r o t e i n was assumed t o c o n t a i n 178 r e s i d u e s . C y s t e i n e and t r y p t o p h a n were n o t determined: f o r t h e purpose o f c a l c u l a t i o n , t h e number o f c y s t e i n e r e s i d u e s was assumed t o be 0, and t h e number o f t r y p t o p h a n r e s i d u e s , 1 ( s i n c e one t r y p t o p h a n r e s i d u e was found i n t h e N - t e r m i n a l amino a c i d sequence). Numbers a r e t h e median v a l u e s o f t h r e e s e p a r a t e assays rounded o f f t o one d e c i m a l p o i n t . b  Amino a c i d c o m p o s i t i o n a c c o r d i n g t o sequence o f t h e mature p r o t e i n , d e r i v e d from t h e n u c l e o t i d e sequence ( F i g u r e 7 ) . c d  Asparagine and a s p a r t a t e r e s i d u e s combined. Glutamate and glutamine r e s i d u e s combined.  52  Materials the  and Methods)  s t r u c t u r a l gene  P_. a e r u g i n o s a with  various  was  of  oprH  (data  present  HI, oprH  with  the  s i n g l y and i n  identical  transferred  to  radiolabeled  DNA  the  identification  f r o m t h e u p s t r e a m end  w i t h more t h a n  i n d i c a t i n g that gene.  identify  digested  In none o f t h e d i g e s t s  1 and 2 h y b r i d i z e  as a s i n g l e - c o p y  f r a g m e n t s were  had been  procedure allowed  n o t shown).  fragment,  that  to  (Figure 4 ) .  to e l e c t r o p h o r e s i s ,  fragments p o s s e s s i n g  oligonucleotides chromosomal  This  as p r o b e s  endonucleases  subjected  oligonucleotides. restriction  used  chromosomal DNA  b l o t s , and p r o b e d  of  were  for protein  restriction  combinations Southern  PA01  that  oprH was  d i d both one  probably  The s i z e s o f h y b r i d i z i n g  when chromosomal  DNA  f r o m H181  was  used.  6.  Molecular  cloning  By s c r e e n i n g oprH gene c o u l d the  cosmid  Goldberg  n o t be  A 1.3kb  identified  (1984).  were  PstI  oligonucleotides,  f r o m a PA01  Therefore,  of the o l i g o n u c l e o t i d e s  t h e gene  hybridized  the r a d i o l a b e l e d  pLAFRl, s i m i l a r to that  and Ohman  chromosomal DNA  contain  with  vector  hybridization  o f oprH  used  (estimated  strongly  library in  described  by  the data f o r with  i n an a l t e r n a t i v e  chromosomal  gene  fragment,  digested approach.  large  as 550-600 b a s e  enough t o  pairs),  with both o l i g o n u c l e o t i d e  the  probes  on  53  C C C 5'-AAC TTC G T Q GGC C T Q AC T G G GGC GA-3' (2) Q  NH  ^Ala-Asp-Asn-Phe-Val-Gly-Leu-Thr-Trp-Gly-Glu-Thr-  10  Z  c  5'-AA  C A A ACC , , A A ATC CAg A A Q AA-3' (1) x  T  T  t  g  g  Ser-Asn-Asn-Ile-Gln-Lys-Ser-Lys-Ser-Leu  20  F i g u r e 4^ N - t e r m i n a l amino a c i d sequence o f t h e f i r s t 22 r e s i d u e s o f p r o t e i n H1, and sequences o f o l i g o n u c l e o t i d e s complementary t o oprH. Compositions o f o l i g o n u c l e o t i d e mixtures 1 and 2 a r e shown above t h e c o r r e s p o n d i n g amino a c i d sequence.  54 Southern  blots.  fractionated contain  the  fraction  and  was  by  of  plasmid  located  Neither  confirmed  and  was  on  Two  clones  detect  detectable  protein  shown t h a t  the  oprH gene of  to  However, t h e oprH  using  the  gene.  correct  of  the  the  2.8kb EcoRI  fragment  The  1  plasmid  Western  Smal-PstI  N-terminal (see  PstI  in a  Figure  7  procedure  fragment  as  size-restricted  Chromosomal should  amino  fragment  cloning  0.5kb S m a l - P s t I fragment  on  therefore  found  The  DHSo^F .  PA01.  the  cloned  coli  i n E.  blotting  the  Hi  0.5kb  p r o t e i n was  a 2.8kb EcoRI  library  Southern  6).  purified  repeated  were  sub-fragment  of  the  by  hybridizing  sequencing  therefore  sub-genomic  The  nucleotide  of  were s c r e e n e d  to c o n t a i n  o p r H was  part  E.  (plasmid  c l o n i n g of  only  into  p o s i t i v e clones  a 0.5kb S m a l - P s t I  expressed  the  to This  transformed  transformants  orientations.  d i s c u s s i o n below).  entire  products  A sequence c o r r e s p o n d i n g  to  blotting.  The  sequence of  a probe  had  clone  by  contained  the  pGB2) were f o u n d  5 and  below).  fragment. acid  and  (Figures  (see  was  size-  into Pstl-digested,  hundred  in different  DNA  Southern  preparations.  pGBl  s e q u e n c e was  blots  pUC18 and  by  1.3kb  a g a r o s e g e l e l e c t r o p h o r e s i s and  designations  cloned  ligated  around  h y b r i d i z a t i o n , and  analysed  fragment,  shown  fraction  Several  filter  quick  the  then  JM101.  colony  was  c o r r e c t fragment  dephosphorylated coli  P s t l - d i g e s t e d chromosomal DNA  mapping  contain  containing  the  the 2.8kb  55  F i g u r e 5^ Agarose g e l e l e c t r o p h o r e t i c ( p a n e l A) and Southern b l o t ( p a n e l B) a n a l y s i s o f r e s t r i c t i o n fragments o f pGBl and pGB2. P a n e l A i s a 1.5% a g a r o s e - e t h i d i u m bromide g e l , and p a n e l B i s an a u t o r a d i o g r a m o f a Southern b l o t o f t h e g e l i n p a n e l A probed w i t h o l i g o n u c l e o t i d e s 1. Lane 1, pGBl d i g e s t e d w i t h BamHI; l a n e 2, pGBl d i g e s t e d w i t h P s t I ; l a n e 3, pGB1 d i g e s t e d w i t h Smal; lane 4, pGB2 d i g e s t e d w i t h BamHI; l a n e 5, pGB2 d i g e s t e d w i t h Smal. Running p o s i t i o n s o f r e l e v a n t MW standards ( i n kb) a r e shown between the panels. S i n c e t h e BamHI and Smal s i t e s a r e on t h e same s i d e o f t h e P s t I s i t e i n t h e m u l t i - c l o n i n g s i t e r e g i o n o f t h e v e c t o r pUC18, t h e s e r e s u l t s p r o v i d e e v i d e n c e f o r t h e r e s t r i c t i o n map shown i n F i g u r e 6 and show t h a t t h e 1.3kb P s t I fragments i n pGBl and pGB2 a r e i n o p p o s i t e o r i e n t a t i o n s . A b l o t probed with o l i g o n u c l e o t i d e s 2 gave r e s u l t s i d e n t i c a l t o t h o s e shown.  56  O.lkb  oprH E  A iB  C D  P  B.  S  s  pp  K  L  P  E  •T-  P  B  S  s  P  •I P  h s s  4 K  4  h  F i g u r e J5. R e s t r i c t i o n map o f a 2.8 kb EcoRI fragment o f PA01 chromosomal DNA c o n t a i n i n g t h e oprH gene, and s e q u e n c i n g s t r a t e g y . L i n e A, r e s t r i c t i o n map o f the e n t i r e 2.8kb fragment. L i n e B, map o f t h e 1.3kb P s t I fragment c o n t a i n e d i n p l a s m i d s pGBl through 6. L i n e C, t h e 0.5kb S m a l - P s t I fragment c o n t a i n e d i n p G B l l and 12. L i n e D, t h e 0.8kb Smal-Kpnl fragment c o n t a i n e d i n pGB52 and 54. B = BamHI, E = EcoRI, K = K p n l , L = S a i l , P = P s t I , S = Smal. The l a r g e arrow shows t h e l o c a t i o n and presumed d i r e c t i o n o f t r a n s c r i p t i o n of t h e c o d i n g r e g i o n o f oprH. The s m a l l arrows show t h e e x t e n t o f DNA sequencing a c h i e v e d u s i n g p l a s m i d s p G B l l , 12, 52 and 54.  57  fragment The  ligated  into  analogous plasmid  pGB122  (Table  fragment  7.  i s shown i n F i g u r e  Nucleotide  required  both  sequencing  sub-cloning  position  on b o t h  acid  Position mature amino  o f t h e DNA  site  strands,  region.  downstream  sequence.  and i s shown i n F i g u r e  From  of the coding  At  f o r 21  157.  r e g i o n f o r the  to the pre-determined  residues, before  7.  sequence  t h e ATG and p o s i t i o n  position  was  that s i g n a l e d the s t a r t of  N-terminal  157, t h e open  f o r a f u r t h e r 534 n u c l e o t i d e s ,  acid  information)  f r o m oprH  T h e r e was t h e c o d i n g  p r o t e i n , according  178 amino  region  o f two new  on p r e l i m i n a r y s e q u e n c e  r e s i d u e s between  frame c o n t i n u e d  o f t h e oprH  ( F i g u r e 6) and d e s i g n  157 was t h e s t a r t  acid  o f t h e 2.8kb EcoRI  6.  91 t h e r e was an ATG codon  oprH c o d i n g  amino  map  designated  The n u c l e o t i d e s e q u e n c e f r o m t h e Smal  t o c l o s e t o a Kpnl  completed  to  (based  u s e as p r i m e r s .  site  f r o m H181 was  pGB22.  s e q u e n c e a n a l y s i s o f oprH  oligonucleotides for  c o n t a i n i n g DNA  II). A restriction  Nucleotide  the  t h e v e c t o r pUC18 was d e s i g n a t e d  reading  corresponding  a n o n s e n s e codon  TAA was  reached. The e n t i r e consisted  n u c l e o t i d e s e q u e n c e shown i n F i g u r e 7  o f 63.0mol%  P_. a e r u g i n o s a usage was v e r y  G + C, w h i c h was c l o s e t o v a l u e  genome o f 67.2% ( P a l l e r o n i , similar  to that of other  1975).  f o r the  The codon  chromosomal  genes o f  58  Smal 'GGGTTCAGCAAGCGTTCAGGGGCGGTTCAGTACCCTGTCCGTACTCTGCAAGCCGTGAAC r  GACACGACTCTCGCAGAACGGAGAAACACCATGAAAGCACTCAAGACTCTCTTCATCGCC M  K  A  L  K  T  L, F  I  A  60 120 10  ACCGCCCTGCTGGGTTCCGCCGCCGGCGTCCAGGCCGCCGACAACTTCGTGGGCCTGACC 180 T A L L G S A A G V Q A A D N F V'! G L T 30 • TGGGGCGAGACCAGCAACAACATCCAGAAATCCAAGTCGCTGAACCGCAACCTGAACAGC W G E T S N N I Q K S K S L N R N L N S  210 50  CCGAACCTCGACAAGGTGATCGACAACACCGGCACCTGGGGCATCCGCGCCGGCCAGCAG 300 P N L D K V I D N T G T W G I K A ; , G Q Q 7 0 TTCGAGCAGGGCCGCTACTACGCGACCTACGAGAACATCTCCGACACCAGCAGCGGCAAC F E Q G R Y Y A T Y E N I S D T S' S G N  360 90  AAGCTGCGCCAGCAGAACCTGCTCGGCAGCTACGACGCCTTCCTGCCGATCGGCGACAAC K . L R Q Q K L L G S Y D A F L P I G D N  420 110  AACACCAAGCTGTTCGGCGGTGCCACCCTCGGCCTGGTCAAGCTGGAACAGGACGGCAAG N T K L F G G A T L G L V K L E Q'D G K PstI _ PstI GGCTTCAAGCGCGACAGCGATGTCGGCTACGCTGCCGGGCTGCAGGCCGGTATCCTGCAG G F K R D S D V G Y A A G L Q A G I L Q  480 130  GAGCTGAGCAAGAATGCCTCGATCGAAGGCGGCTATCGTTACCTGCGCACCAACGCCAGC E L S K N A S I E G G Y R Y L R Tj N A S  600 170  ACCGAGATGACCCCGCATGGCGGCAACAAGCTGGGCTCCCTGGACCTGC ACAGCAGCTCG T E M T P H G G N K L G S L D L H ' S S S 1 9  660 0  CAATTCTACCTGGGCGCCAACTACAAGTTCTAAATGACCGCGCAGCGCCC'GCGAGGGCAT Q F Y L G A N Y K F * •  720 200  GCTTCGATGGCCGGGCCGGAAGGT  744  j  540 150  F i g u r e 7. N u c l e o t i d e sequence (upper l i n e ) o f t h e oprH r e g i o n and d e r i v e d amino a c i d sequence (lower l i n e ) o f p r o t e i n H1. The presumed d i r e c t i o n o f t r a n s c r i p t i o n i s from l e f t t o r i g h t . , The p u t a t i v e l e a d e r ( s i g n a l ) sequence the p r o t e i n i s u n d e r l i n e d . I n v e r t e d complementary r e p e a t sequence i s i n d i c a t e d by arrows above t h e DNA sequence. R e s t r i c t i o n ) s i t e s a r e as indicated. N u c l e o t i d e 1 i s i n t h e m i d d l e o f t h e Smal s i t e ; amino a c i d 1 i s the f i r s t r e s i d u e o f n a s c e n t p r o t e i n H1. * , s t o p codon. •  59  P.  aeruginosa  1988).  The  contained  (excluding  pilin  90 b a s e p a i r s u p s t r e a m  no s e q u e n c e s  and  -10  sequences  -24  and  -14  o f E_. c o l i p r o m o t e r s  sequences  of ntrA  e t a l . , 1987),  Possibly  t h e oprH p r o m o t e r 148  o f t h e ATG  c l o s e l y resembling  (Deretic  positions  g e n e s ; West and  and  179  was  there  indicating a possible site  transcription mechanism.  and  such sequences  b a s e p a i r s downstream o f t h e oprH possible might  that  a region  be t r a n s c r i b e d  RNA  for termination  showed t h a t  the P s t I  oprH  a c t u a l l y two  PstI  site  sequences  i n the so  l a r g e r t h a n oprH  sites  found  15  of  attenuator  were f o u n d  coding  considerably  Between  i n t o a s i n g l e mRNA m o l e c u l e .  analysis was  (Figure 7).  the p o t e n t i a l f o r  i n the  consequently a p o t e n t i a l  However, no  promoters  regions  was  -35  1987 ) o r t h e  f u r t h e r upstream. 7)  codon  the consensus  (rpoN)-activated  stem-loop secondary s t r u c t u r e formation transcript,  start  (Travers,  nor any A T - r i c h  (Figure  Iglewski,  54  i t was itself  Sequence  i n the m i d d l e of  base p a i r s a p a r t  (Figure  7) .  8.  Analysis The  of  21  of the d e r i v e d  derived  residues  prokaryotic  amino a c i d s e q u e n c e  with  leader  residues  amino a c i d s e q u e n c e  the t y p i c a l  178  o f mature  the  amino a c i d s e q u e n c e matched  of p r o t e i n Hi  consisted  c h a r a c t e r i s t i c s of a  ( s i g n a l ) sequence  and  of p r o t e i n Hi  protein. that  (Randall The  first  e t a l _ . , 1987) 22  d e t e r m i n e d by  residues  of  N-terminal  60  sequencing the  of pure p r o t e i n  178-residue polypetide  determined was  for purified  expected  contained  18  residues. evenly acid HI  over  had  residues,  132  (Figure  because  indicated  according  amino  b a s i c i t y of  i t s absence  gels  protein  i n the  normal  ( s e e a b o v e ) , and  may  to a c i d i c  on  groups  o f t h e amino a c i d that  protein  extended  chain,  to the secondary  e_t a_l_. (1978) .  hydrophobic  regions  Hli was 28%  be LPS  Hydropathy  profile  t o be c a p a b l e o f  residues  91-103 and  might  cross  (Paul  and  fairly  analysis reveal  (Figure  hydrophobic  amino a c i d s  (around  residue  110  8). regions  small of  any  crossing  i n the b e t a - s h e e t c o n f o r m a t i o n I n t e r e s t i n g l y , the  to  turn,  116-130 o f t h e m a t u r e p r o t e i n )  1985).  of  prediction  thought  (from  of b a s i c  reverse  (1982) d i d not  were a t l e a s t two  Rosenbusch,  likely  structure  i n the a l p h a - h e l i c a l c o n f o r m a t i o n  t h e membrane  sequence  Doolittle  However, t h e r e  cluster  The  binding  analysis  by t h e method o f K y t e and  a membrane  7).  of  focussing  h e l i x , 28%  model o f G a m i e r  large,  since i t  below).  mature p r o t e i n  coil  2 h i s t i d i n e s and  protein  except f o r a c l u s t e r around  i n i t s proposed  discussion  34%  a t n e u t r a l pH  The  fairly  number  10%  III).  that  p o s i t i v e c h a r g e s were d i s t r i b u t e d  Computer-aided  and  basic  (Table  to  acidic  isoelectric  form about  Hi  identical  17  the p r o t e i n ,  significant (see  basic  amino a c i d c o m p o s i t i o n o f  virtually  protein  slightly  been p r e d i c t e d of  The  was  t o be  The  residue  range  the  Hi.  the  that  61  Hydropathy plot, for protein H 1  3  10  20  30  40 Residue  50  60  70 ,  80  90  number  3  -2  _T  -  111M11111111111M111111111111111  90  100  110  120  in  130 Residue  in1111111  140  150  11111111111  160  II  170  number  F i g u r e 8. Hydropathy p l o t f o r p r o t e i n HI. Hydropathy v a l v e s were c a l c u l a t e d a c c o r d i n g t o t h e model o f Kyte and D o o l i t t l e (1982). The more p o s i t i v e t h e v a l u e , t h e more hydrophobic t h e r e s i d u e ( i n t h e c o n t e x t o f i t s nearest; neighbours). The p l o t does not i n c l u d e t h e l e a d e r sequence; r e s i d u e 1 i s t h e f i r s t amino a c i d o f t h e mature p r o t e i n , i n c o n t r a s t t o F i g u r e 7.  62  m a t u r e p r o t e i n ) was s i t u a t e d between regions turn  and was f l a n k e d by r e s i d u e s  structure.  a site  This  of i n t e r a c t i o n  with  similarities  with  hemolysin  oprH o v e r This of  9.  and o t h e r  candidate f o r surface.  outer  The h i g h e s t  membrane  similarity  were no  p r o t e i n s whose s c o r e was  w h i c h had 26.3% i d e n t i t y  o f 95 amino a c i d  similarities  those i n  t h e FASTA p r o g r a m , t h e r e  to other  functional significance  residues  were p r o b a b l y (Doolittle,  found with  ( n o t shown).  too l i m i t e d  t o be  1986).  Summary Protein  detergent either of  to c o n t r i b u t e to  s e q u e n c e was compared w i t h  A o f E. c o l i ,  a stretch  hydrophobic  a n i o n i c LPS a t t h e c e l l  a s e q u e n c e d a t a b a n k by u s i n g  s e q u e n c e s a r e known.  likely  r e g i o n m i g h t be a l i k e l y  When t h e amino a c i d  striking  t h e two most  HI was p u r i f i e d  by s e l e c t i v e  and EDTA o f H181 o u t e r  solubilizations in  membranes, f o l l o w e d by  a n i o n - e x c h a n g e c h r o m a t o g r a p h y o r SDS-PAGE.  The y i e l d  p u r e p r o t e i n HI f r o m two c y c l e s o f c h r o m a t o g r a p h y  poor.  Purification  was  by SDS-PAGE, by c o n t r a s t , gave good  yields,  though with  some d e n a t u r a t i o n  Protein  HI p u r i f i e d  by c h r o m a t o g r a p h y was c o n t a m i n a t e d  equi-molar molecules between lacked  or higher with  concentration  0 side chains,  of the p r o t e i n .  o f LPS e n r i c h e d i n  suggesting  an a s s o c i a t i o n  t h e two, whereas p r o t e i n HI p u r i f i e d detectable  LPS.  For these  by an  reasons,  by SDS-PAGE  protein  purified  63 by SDS-PAGE was sequencing, Protein  suitable material  amino  HI c o u l d  r o u g h mutant  acid also  analysis,  f o r N-terminal and  be p u r i f i e d  AK1012 by d o i n g  antiserum  amino  acid  production.  f r o m o u t e r membranes o f t h e  alternative  detergent  solubilizations. Oligonucleotides the  s t r u c t u r a l gene  the  N-terminal  chromosomal oprH was cloned the  digests  with  Nucleotide  suggested  mechanism  of r e g u l a t i o n .  indicated  a slightly  fairly closely  H i , o p r H , were d e s i g n e d protein.  the o l i g o n u c l e o t i d e s  a single-copy  in E^ c o l i . and  for protein  t o t h e u p s t r e a m end o f  sequence of the p u r i f i e d  probably  cloning  complementary  gene,  sequence a n a l y s i s  The d e r i v e d  basic  protein  h y d r o p h o b i c segments. r e s e m b l e any o t h e r s  oprH  that t o be  confirmed  of attenuation  amino  o f 178  Probing of  revealed  and a l l o w e d  the p o s s i b i l i t y  using  acid  as a  sequence  residues,  with  two  However, t h e s e q u e n c e d i d not presently  known.  64 CHAPTER 2  EXPRESSION OF CLONED  1.  Expression  oprH  o f oprH  i n E. c o l i ;  medium, s u b c l o n i n g , Clones truncated blotting  of c e l l  and p r o m o t e r  l y s a t e s and p r o b i n g  p o l y c l o n a l antiserum grown  appropriate  induces  in either  only  50uM Mg  expression  expression  PstI  fragment  2+  was d e t e c t e d  fragment  was c l o n e d  of the cloned frames.  subcloned pGBl2).  of b l o t s with IV).  LB b r o t h  immuno-  a protein  Lysates  with  were  the p l a c  and 20uM Ca  into  2+  in divalent cations ).  from t h e l a c promoter  into  both  ( p l a c ) o f pu"C, pTZ  (pGBl,  to  induce  i fpossible. clone pGB2).  c o n t a i n i n g the The 1.3kb  o r i e n t a t i o n s o f pUC9  (to give  ( t o g i v e pGB5 and pGB6) t o g i v e  DNA  t o t h e l a c Z ' gene  The 0.5 kb SmaI f r a g m e n t pTZ18R i n b o t h  No e x p r e s s i o n  The f o r m e r medium  was d e s i g n e d  in either  i n pUC18  pGB3 and pGB4) and pUC8  reading  o f p r o t e i n HI o r  (Table  f r o m t h e p r o m o t e r o f oprH  No e x p r e s s i o n  fusion  o f growth  type  supplements) d e f i c i e n t  pRK v e c t o r s , and t h e l a t t e r  1.3kb  aeruginosa  i s o p r o p y l t h i o g a l a c t o s i d e o r i n M 9 - g l u c o s e medium  (containing  and  Effects  were t e s t e d f o r e x p r e s s i o n  made f r o m c e l l s  (with  AND P.  forms o f p r o t e i n H i by SDS-PAGE and W e s t e r n  Hl-specific  inducer  IN E . c o l i  i n a l l three o f pGB2 was  o r i e n t a t i o n s ( t o g i v e p G B l l and  of products  c r o s s - r e a c t i v e with  Table  IV.  Levels of expression  Host Strain  E.  coli  E. c o l i  JM101  Vector (promoter type)  o f cloned oprH DNA i n E . c o l i DNA fragment c o n t a i n i n g oprH  none  none  pUC18 ( p l a c )  1.3kb  PstI  pUC8 II  E.  coli D ^ ^ F '  0.5kb Smal-PstI  pUC18  aeruginosa.  Orientation  3  Level of expression i n M9-glucose BM2-succinate  LB  ND  pUC9  pTZ18R  Plasmid number  and P.  2.8kb EcoRI  pGBl  ND  pGB2  ND  pGB3  ND  pGB4  ND  pGB5  ND  pGB6  ND  pGBll  ND  pGB12  ND  pGB'22  II P  pRK767  GB122  pGB23  £  +  +/-  ++  ND  +/-  ++  ND  +++  ND  +++  ND  ++ ++  pRK404  pGB123  pRK767  pGB24  +/-  ND  pRK404  pGBl24  +/-  ND  pNMl85 (£ )  pGB25  +  + +  e f  ND  i  ++  ND  pUC18 ( p l a c )  1.8kb BamHI-Sall  pGB32  ND  pTZ18R  1.4kb  pGBl42  ND  "  BamHI-Kpnl  Host s train E. c o l i DH5<X.F' "  Vector DNA fragment (promoter type) c o n t a i n i n g oprH  Plasmid number  pTZ18R ( p l a c )  0.8kb Smal-Kpnl  pGB52  ND  pTZ18U  1.9kb EcoRI-Kpnl  pGB62  ND  pGB162  ND  pGB172  ND  "  "  2.3kb E c o R I - S a l l P. a e r u g i n o s a PA01 none pRK767  (plac)  2.8kb EcoRI  pNMl85 <p )  3  none  LB  Level of expression i n M9-glucose BM2-succinate  pGB23  +  +  ++  pGB123  +  +  ND  pGB25  + +  e  +  ++  +  +++  J  +++  none  +++  +++  Plasmids w i t h numbers below 100 ( e . g . pGBl) c o n t a i n e d oprH DNA fragments from the chromosome o f PA01; p l a s m i d s w i t h numbers above 100 ( e . g . pGB122) c o n t a i n e d DNA from the chromosome o f H181.  k O r i e n t a t i o n o f oprH r e l a t i v e C  Orientation  none  pRK404  P. a e r u g i n o s a H181  3  t o v e c t o r promoter: +, same; - o p p o s i t e .  L e v e l s o f e x p r e s s i o n of oprH were judged v i s u a l l y from appearance o f p r o t e i n HI bands ( o r bands c r o s s - r e a c t i n g w i t h p r o t e i n H i ) on SDS g e l s and Western immunoblots o f c e l l l y s a t e s . -, none d e t e c t e d ; +/- t r a c e ; +, ++, +++, i n c r e a s i n g amounts.  ^ P a r t i a l oprH gene (see r e s t r i c t i o n map, F i g u r e 6 ) . e C e l l s grown i n medium l a c k i n g benzoate. C e l l s grown i n medium w i t h benzoate added as c o - i n d u c e r of p : , not determined.  5mM  f o r E_. c o l i ; 2mM f o r P. a e r u g i n o s a .  67  protein the  HI  fact  that  base p a i r this  was  above  When t h e  protein  contained  HI  i n the  (Table  opposite  cloned  cloned  P.  (apparent  i n g e l s and  MW  of  b a r e l y or n o t  (Figure Ca ^  +  had  The  no  effect  levels on  Western b l o t s apparent  apparently  regulation  the  levels  MW  in c e l l s  of  21,000)  (Figures 9  still  grown  of e x p r e s s i o n  and  behaved  in  LB  i n M9-glucose  to the  ( i n pGB22) and  attached  were grown  o f p r o t e i n HI,  subject  was  of p r o t e i n  t h e d i v a l e n t c a t i o n s Mg^  not  and  24,000, w h i c h  Production  chromosomal oprH gene  oprH genes from PA01  similar  of  MW  i t s leader peptide  production  oprH gene was  The  Bands  d e t e c t a b l e when c e l l s  substantial  9).  as  plasmids  18,000) forms o f p r o t e i n  inconsistently.  observed  was  of  from the p l a c i n  (apparent  (preHl),  but  sequence  both  DNA.  with  broth,  90-  Possibly  pGBl22, p r o d u c t i o n  orientation  aeruginosa  In a d d i t i o n , a band o f  was  a  i n a 2.8kb EcoRI  Since  p r e s u m a b l y p r o t e i n HI  HI  (Figure 7).  attenuator  IV).  to the h e a t - m o d i f i e d  were o b s e r v e d  was  l a c Z ' by  of  I I ) , e x p r e s s i o n must have o r i g i n a t e d f r o m a  heat-unmodified  10).  oprH gene was  i n the  (Table  corresponding  by  in spite  (Figure 7).  detected  oprH  vector  and  frame  to the p o t e n t i a l  entire  was  clones,  connected  i n t o puC18 t o g i v e pGB22 and HI  promoter  of these  of o p e n - r e a d i n g  i s connected  fragment  i n any  i n p G B l l , oprH was  stretch  described  the  observed  so t h e  and cloned  same mechanism  i n P_. H181  +  of  aeruginosa. ( i n pGBl22)  i n an  otherwise  gave  68  F i g u r e 9_. S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e t o g r a m ( p a n e l A) and Western immunoblot ( p a n e l B) o f c e l l l y s a t e s of E_. c o l i c a r r y i n g p l a s m i d s w i t h oprH DNA, showing p r o d u c t i o n of p r o t e i n H1. P a n e l B i s a Western b l o t of a g e l i d e n t i c a l t o t h e one i n p a n e l A, probed w i t h a n t i s e r u m s p e c i f i c f o r p r o t e i n H1. Lane 1, P_. a e r u g i n o s a H181 o u t e r membrane ( p o s i t i v e c o n t r o l ) ; l a n e 2, IS. c o l i DH5«XF'/pUC18 ( n e g a t i v e c o n t r o l ) ; lane 3, DH5OCF'/pGB23; l a n e 4, DH5°CF'/ pGB24; l a n e 5, DH5°tF'/pGBl42; l a n e 6, D H 5 « F / p G B 5 2 . -|5 o f p r o t e i n was l o a d e d i n l a n e 1, and 30ug loaded i n each o f t h e o t h e r l a n e s . Running p o s i t i o n s o f p r o t e i n H1 bands a r e shown on t h e l e f t o f each p a n e l , and r u n n i n g p o s i t i o n s o f r e l e v a n t MW standards ( i n thousands) on t h e r i g h t . The E. c o l i c e l l s were grown i n M9-glucose w i t h a m p i c i l l i n . ,  ug  69  F i g u r e 10. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m ( p a n e l A ) and Western immunoblot (panel B) of f r a c t i o n a t e d IS. c o l i c e l l s p r o d u c i n g p r o t e i n H1. P a n e l B i s a Western b l o t o f a g e l i d e n t i c a l t o the one i n p a n e l A , probed with a n t i s e r u m s p e c i f i c f o r p r o t e i n H1. Lane 1, P_. a e r u g i n o s a H181 o u t e r membrane ( p o s i t i v e c o n t r o l ) . Lanes 2-6, IS. c o l i DH5°^F'/pGBl22 c e l l u l a r f r a c t i o n s : whole c e l l s ( l a n e 2 ) , o u t e r membranes ( l a n e 3 ) , i n n e r membranes (lane 4 ) , envelopes ( l a n e 5), and s o l u b l e f r a c t i o n ( l a n e 6 ) . 15ug of p r o t e i n was l o a d e d i n lanes 1, 3 and 4; 20ug i n lanes 5 and 6; and 30ug i n lane 2. Running p o s i t i o n s of p r o t e i n H1 bands, i n c l u d i n g t h e presumably unprocessed form (preH1), are shown on the l e f t of each p a n e l ; p o s i t i o n s of r e l e v a n t MW standards ( i n thousands) are on the r i g h t . IS_. c o l i c e l l s were grown i n M9glucose w i t h a m p i c i l l i n t o an A ^ Q Q of 1.4, then f r a c t i o n a t e d as d e s c r i b e d i n M a t e r i a l s and Methods.  70 identical carrying  f a s h i o n , except  the former plasmid  Subcloning BamHI-Kpnl Kpnl  that  ( i n e x p l i c a b l y ) E.  grew more p o o r l y  i n M9-glucose.  o f any o f t h e 0.8kb S m a l - K p n l  (pGB142), 1.8kb B a m H I - S a l l  (pGB62 and pGB162)  o r 2.3kb E c o R I - S a l l  I I and F i g u r e  abolished  production  o f p r o t e i n HI by E_. c o l i  suggested (Figure  that  IV).  This  orientation  (Figure  region  9 and  downstream o f oprH  a positive regulatory effect experiments,  i n w h i c h p l a c and oprH were  i n a high-copy  vectors  s u r p r i s i n g observation  In a l l o f t h e c l o n i n g and s u b c l o n i n g were o b t a i n e d  EcoRI-  6) i n t o pUC o r pTZ  t h e 0.5kb S a l l - E c o R I  6) was h a v i n g  1.4kb  (pGBl72)  (see Table  n o t shown; T a b l e  (pGB52),  (pGB32), 1.9kb  fragments  data  coli  number  vector,  on o p r H . no  clones  i n t h e same unless  t h e gene was  truncated. Cloning number oprH  o f t h e 2.8  vectors  could  kb EcoRI  fragment  pRK404 and pRK767 r e v e a l e d  a l s o be d r i v e n by p l a c  (Table  i n t o t h e low-copy that IV) .  expression Where  of  p l a c and  oprH were i n t h e same o r i e n t a t i o n (pGB23 and p G B l 2 3 ) , t h e levels from  o f p r o t e i n HI p r o d u c e d were h i g h e r  t h e oprH p r o m o t e r a l o n e  (Figures  9 and 1 0 ) .  orientations small  of  9).  driving  i n a high-copy  plac  those  number  of those  This  obtained  indicated that  much h i g h e r  obtained  vector  and oprH were i n o p p o s i t e  (pGB24 and pGB124), p r o t e i n H i l e v e l s  fraction  (Figure  Where  than  production  f r o m pGB23 and i n E. c o l i ,  were a  pGB123  p l a c was  capable  o f p r o t e i n HI t h a n was t h e  71 oprH p r o m o t e r . in  Presumably,  a h i g h - c o p y number v e c t o r  would be l e t h a l originate  from the twin  production  2.  protein  membrane  that  outer  fractionation cellular  foreign  cells  that  i n the s o l u b l e f r a c t i o n . alone  (Randall  i n the  However,  a r e not a r e l i a b l e  e_t a l _ . , 1 9 8 7 ) .  i n the outer  membrane  gradients  at least  i n d i c a t o r of one f r o m a  s i n c e the preHl  fraction  suggesting  may have been  rather  that  the r e s u l t of  (Figure 10).  i n the outer  argued  membrane.  that  than i n  its position  Nevertheless,  some o f t h e p r o t e i n H i m o l e c u l e s  processed  cell  T h i s may be  f o r p r o t e i n HI i n E. c o l i  of the p r o t e i n  proteolytically present  to the outer  membrane and i n n e r membrane f r a c t i o n s , b u t  true  the sucrose  fact  p r o t e i n HI  P r o t e i n HI bands w e r e ] f o u n d  i n n e r membrane o r c y t o p l a s m ,  aggregation  producing  l o c a t i o n of a p r o t e i n , e s p e c i a l l y  f o r m was f o u n d the  o f E. c o l i  studies  species  particularly  i n LB.  and p r o c e s s i n g o f  t h e p r o t e i n m i g h t be e x p o r t e d  none were d e t e c t e d  the  Export  pNM185 ( i n  P r o t e i n HI  i n M9-glucose than  i n E. c o l i :  also  HI  (Figure 10).  envelope,  o f oprH c o u l d  by added b e n z o a t e .  o f oprH  Fractionation suggested  Expression  occurred  p r o t e i n Hi l e v e l  p ^ promoters of the vector  was a l s o h i g h e r  Expression  from p l a c  the r e s u l t i n g  (see a b o v e ) .  pGB25) when c o - i n d u c e d  in  i f expression  p r o t e i n H i was  the  were probably  72  3.  Overproduction of p r o t e i n  HI  from c l o n e d  oprH i n  P. a e r u g i n o s a Protein  HI  i s produced  chromosomal oprH  a t a low  gene when P.  level  aerug inosa  from  PA01  the  i s grown i n  2+ Mg  -sufficient  m i n i m a l medium and  a high  level  when grown i n  2+ Mg  -deficient  production  medium  of p r o t e i n  ( N i c a s and HI,  Hancock, 1980).  independent  of e i t h e r  To b o o s t growth  in  2+ Mg  -deficient  and  pGBl23  (see T a b l e II and  triparental PA01 at  medium o r t h e m u t a t i o n  conjugation  containing  levels  significantly  when c e l l s (Table  were grown  IV).  produced, protein  Therefore, second  11).  produced  In t h i s  These and  slightly  transferred  range  m  not  fragment vector,  promoters  was  control  of p r o t e i n  H i , even  i t gave  the  shown). cloned  into a  could  from the  be  of the XylS  pGB25  active in  was  substantially  w i t h o u t added  now  TOL  are highly  (Mermod e_t al_. , 1 9 8 6 ) . i n which  were  pNM185, t o g i v e pGB25  derived  a r e under  Hi  medium  lower than  expression  i t s c o - i n d u c e r b e n z o a t e , and  t o PA01,  protein  higher levels  (data  PA01.  without a plasmid  substantially  by H181  by  aeruginosa  or BM2-succinate  p l a s m i d , oprH  promoters  Pseudomonas s p e c i e s  production  broth  t h e 2.8kb EcoRI  f r o m t h e t w i n p_  plasmid. protein  i n PP2  type of broad-host  (Figure driven  h i g h e r t h a n PA01  In M 9 - g l u c o s e ,  level  t o P.  pGB123 d i d not p r o d u c e  b u t t h e s e were s t i l l  HI  p l a s m i d s pGB23  above) were t r a n s f e r r e d  from E. c o l i  pGB23 and  i n H181,  elevated  benzoate  (Figure  73  F i g u r e 11. Diagram o f p l a s m i d pGB25. T h i n l i n e , pNMl85 DNA; t h i c k l i n e , P_. a e r u g i n o s a PA01 DNAP o s i t i o n s o f genes e t c . a r e i n d i c a t e d o u t s i d e t h e circle: oprH, s t r u c t u r a l gene f o r p r o t e i n H1; Sm, s t r e p t o m y c i n r e s i s t a n c e gene; o r i , o r i g i n o f r e p l i c a t i o n ; n i c , r e l a x a t i o n n i c k s i t e ; mob, genes f o r m o b i l i z a t i o n f u n c t i o n s ; r e p , genes f o r r e p l i c a t i v e f u n c t i o n s , Km, kanamycin r e s i s t a n c e gene; x y l S , gene f o r t h e p o s i t i v e r e g u l a t o r a c t i n g on p^; p^, t w i n TOL promoters. Arrowheads i n d i c a t e d i r e c t i o n o f t r a n s c r i p t i o n o f genes o r o r i e n t a t i o n of promoters. O n l y r e l e v a n t r e s t r i c t i o n s i t e s are shown. I n f o r m a t i o n on pNMl85 i s from Mermod et^ a l . , 1986.  74 12).  The  level  concentrations  was  similar  levels  H181), 7.1  H1/H2  remain  ratios  M 9 - g l u c o s e was expression.  source,  added Ca  tested,  none a f f e c t e d oprH  Effect  2+  , added  susceptibility not  NaCl,  to polymyxin  B  on  (Nicas  and (for  and  9.0  growth  level  components o f  antibiotic  ( d a t a not effect  i n view of the  LPS  and  Overproduction  coli,  highest  p r o t e i n HI  t o have an  (Nikaido  under  ( f o r P A 0 1 ) , 7.4  of  in oprH  M9-  (carbon  l a c k o f added Fe  background, e s p e c i a l l y structure  a standard  (not  2+  ) were  expression.  producing  been e x p e c t e d  constant  from BM2-succinate  o f oprH e x p r e s s i o n  E_. c o l i c l o n e s  had  the  of  envelopes  of g e l l a n e s  i n E.  However, when i n d i v i d u a l  t h a t were d i f f e r e n t  Ratios  added b e n z o a t e ) ,  As  to o b t a i n  glucose  4.  as  were 1.0  benzoate).  required  in c e l l  relatively  ( f o r PA01/pGB25 w i t h o u t  PA01/pGB25 w i t h  i n H181.  scanning  c o n d i t i o n s , so were u s e d  Hancock, 1 9 8 3 ) .  (for  densitometric  P r o t e i n H2  different  found  o f p r o t e i n H l / p r o t e i n H2  were d e t e r m i n e d by shown).  to that  Hancock,  of p r o t e i n Hi  susceptibility  had  unaltered  shown). in this  The  protein  different  substantially  different  1986).  from c l o n e d  oprH i n 2+-'  P.  aeruginosa,  with  or w i t h o u t  polymyxin of  PA01  by  grown  i n M9-glucose with  added b e n z o a t e , d i d not  B or g e n t a m i c i n EDTA  i n the  f o r the  2mM  or  500uM Mg  ,  affect  t h e MICs  of  organism.  presence of T r i s  was  However,  killing  a f f e c t e d by  75  -H1*  1  2  3  4  5  6  7  8  F i g u r e 12. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m o f P. a e r u g i n o s a c e l l l y s a t e s showing o v e r p r o d u c t i o n o f p r o t e i n H1 from oprH on a p l a s m i d . Lanes 1 and 2, PA01; lanes 3 and 4, H181; lanes 5 and 6, PA01/pNM185; l a n e s 7 and 8, PA01/pGB25. 30ug o f p r o t e i n was loaded i n each l a n e . The r u n n i n g p o s i t i o n of p r o t e i n H1 i s shown on t h e r i g h t . C e l l s were grown i n M9-glucose w i t h 500uM Mg t o a A ^ Q Q o f 0.4-0.6. C e l l s i n lanes 2, 4, 6 and 8 were grown w i t h added 2mM benzoate. 2 +  76  A. PAOI  HHl  E D T A killing; no benzoate j H181  Ull  p N M 1 8 5 K8%88l  P  GB25  100 f  O.  0.25mM EDTA  B.  10mM  concentration  EDTA killing + benzoate  0.1 mM  0.25mM EDTA  10mM  concentration  F i g u r e 13. K i l l i n g o f P. a e r u g i n o s a , o v e r p r o d u c i n g p r o t e i n H1 from t h e oprH gene on a p l a s m i d , by EDTA ( + T r i s ) . M i d - l o g a r i t h m i c phase c u l t u r e s i n M9g l u c o s e (500uM Mg2+) with (A) o r w i t h o u t (B) 2mM benzoate were exposed t o v a r i o u s c o n c e n t r a t i o n s o f EDTA ( i n 10mM T r i s , pH 8.5) f o r 5 minutes, then d i l u t e d and p l a t e d i n d u p l i c a t e f o r v i a b l e c o l o n i e s . pNM185, PA01 c a r r y i n g pNM185 ( v e c t o r a l o n e ) ; pGB25, PA01 c a r r y i n g pGB25 (pNMt85 + 2.8 kb EcoRI fragment w i t h o p r H ) .  77 production  of  protein  concentrations to  >40-fold  HI  f r o m 0.1  f r o m pGB25. to  lOmM, PA01  more s u r v i v o r s  than  Representative  13.  r e s u l t s were s i m i l a r w i t h  indicating  that  a b s e n c e of  benzoate  (Figure  phenotypic  change.  Since  detected not  i n PA01  shown) t h e  overproduction EDTA-treated treated  the  data  that  of  12)  to  of  HI.  protein  identical  other  difference  EDTA r e s i s t a n c e  the  new  the  added  pGB25  (Figure  apparently  Figure  benzoate,  in  to  exhibited  were grown w i t h  Protein  HI  the  cause  overproducing  cells.  and  H181  were  12  and  was  By  contrast, e f f e c t on  same way  (Figure  protein  So  and  the not HI  HI  data  H181  4-  and  full be  levels 12  therefore by  of  not  (Figures  and partly  protein  Hl-  overproduction  susceptibility 14  by  of  between  equal p r o t e i n  itself  data  caused  data  could  EDTA-resistance exhibited  detectable  i n the  by  the  s u r v i v a l rates  varied  added b e n z o a t e  overproduction  f o r the  13  12vector  in  polypeptides  EDTA c o n c e n t r a t i o n .  when c e l l s  B measured  sufficient  (Figure  PA01/pGB25, i n s p i t e of  no  only  produced  However, t h e  matched by  a l o n e had  HI  in s u r v i v a l rate  level  responsible  without  EDTA was  manner  d e p e n d i n g on  13).  or  was  acquired  resistance  pGB25 had  shown g r a p h i c a l l y  protein  no  had  100-fold of  are  carrying  EDTA  PA01/pGB25 were c o n s i s t e n t l y below t h o s e  i n an  shown); t h e  level  carrying  PA01  pNM185. The  Over a r a n g e o f  to  not  polymyxin shown).  78  A. p o l y m y x i n no PAOI  B killing  :  benzoate  MMU H181  iliil  pNMl85  pGB25  100  10  <0.1 0.5ug/ml  2.0ug/ml  20ug/ml  polymyxin B concentration  B.  polymyxin +  PAO!  HHI  B  killing  benzoate  H181  I . _ J pNM185 tSS$888i p G B 2 5  100  10  <0.1 0.5ug/ml  2.0ug/ml  20ug/ml  polymxin B concentration  F i g u r e 14. K i l l i n g o f p. a e r u g i n o s a , o v e r p r o d u c i n g p r o t e i n H1 from t h e oprH gene on a p l a s m i d , by polymyxin B. M i d - l o g a r i t h m i c phase c u l t u r e s i n M9g l u c o s e (500 uM M g ) w i t h (A) o r w i t h o u t (B) 2mM benzoate were exposed t o v a r i o u s c o n c e n t r a t i o n s o f p o l y m y x i n B i n 30mM phosphate b u f f e r , pH 7.0, f o r 5 minutes, then d i l u t e d and p l a t e d i n d u p l i c a t e f o r v i a b l e c o l o n i e s . pNM185, PA01 c a r y i n g pNM185; pGB25, PA01 c a r r y i n g pGB25. 2 +  79  5.  Summary Protein  DNA  HI was p r o d u c e d  on p l a s m i d s  was e i t h e r probably  provided  partly  exported  expressed  by E_. c o l i  or f u l l y  proteolytically  t o t h e o u t e r membrane.  from a promoter  of e x p r e s s i o n  promoters. than  on t h e c l o n e d  could  The s u s c e p t i b i l i t y  was n o t a f f e c t e d , however, by h i g h production  an  HI was p r o d u c e d  when e x t r a c o p i e s  expression  caused  vector  decreased  although  and  oprH c o u l d be DNA p r o v i d e d  that a higher  by t h e l a c o r TOL  was h i g h e r  i n M9-glucose  o f E. c o l i levels  mutant H181.  at levels  to polymyxin B  o f p r o t e i n HI  much h i g h e r  susceptibility  No c h a n g e s  gentamicin  were d e t e c t e d  protein  alone.  than  o f t h e oprH gene were p r e s e n t i n  i n P_. a e r u g i n o s a .  the r e s i s t a n c e l e v e l  HI  processed  i n E_. c o l i . .  Protein background  The p r o t e i n  However, much  be d i r e c t e d  P r o t e i n HI p r o d u c t i o n  in broth.  c a r r y i n g oprH  t h e gene was c o m p l e t e .  downstream s e q u e n c e was n o t d e l e t e d . levels  cells  of c e l l s  This  to k i l l i n g  d i d n o t match  in susceptibility as a r e s u l t  overproduction by EDTA,  that of the to polymyxin  B or  of o v e r p r o d u c t i o n of  80  CHAPTER 3  INTERACTION  1.  W I T H  LPS  AND  Surface properties To  and  extend  HI  Hl-overproducing  cells  protein  (Nicas  1983b; Hancock e t a l . , 1981b; Moore e t  H i by  cation-deficient  described cells  and  some e x p e r i m e n t s  overproduced divalent  of p r o t e i n  PROTEIN  the o b s e r v a t i o n s r e c o r d e d p r e v i o u s l y  Hancock, 1980  a l . , 1984),  FUNCTION OF  were p e r f o r m e d  virtue  of e i t h e r  overproducing protein by  adhesion  indicated  protein  HI.  that  growth i n  medium o r m u t a t i o n .  h e r e were d e s i g n e d t o i d e n t i f y  hydrophobicity  on c e l l s  The  surface  Measurement  studies  changes o f  of c e l l  to the hydrocarbon  surface  xylene 2+  PA01;  that  H181)  were l e s s  Hl-overproducing c e l l s hydrophobic  than  those  (Mg that  -deficient produced  2+  the p r o t e i n PAOl  a t a low  and  H181  in  uptake,  gentamicin H181 probe et  also  a probe  environments o r enhancement or  had  E D T A ,  (Mg  were a l s o  phenylnaphthylamine, hydrophobic  level  compared that  t h e same i n t e r a c t i o n  and  sites  the e f f e c t s  by  No  polymyxin  ( d a t a not  Table V).  uptake  is fluorescent  of uptake  were o b s e r v e d  PAOl;  to t h e i r  (Loh e_t a^. , 1 9 8 4 ) .  of p o l y c a t i o n - b i n d i n g  a l . , 1986),  -sufficient  of  1-N-  in differences B,  shown).  PAOl  and  with dansyl-polymyxin, a on  LPS  (Newton, 1955;  of c o m p e t i t i o n f o r probe  Moore  81  T a b l e V.  2+ [Mg ] uM  Strain  a  PA01  H181  a  Mg  S u r f a c e h y d r o p h o b i c i t y o f p r o t e i n H l - o v e r p r o d u c i n g c e l l s measured by adhesion t o x y l e n e .  2+  A  60o  b (control)  A  600  c  (xylene-treated)  Significance level**  Number o f c e l l s per d r o p l e t  500  0.640+/_0.022  0.456+/_0.027  p<0.01  20  0.496+/ 0.012  0.504+/ 0.011  control lower  500  0.698+/_0.016  0.723+/_0.004  c o n t r o l lower  <10  20  0.520+/ 0.007  0.681+/ 0.072  c o n t r o l lower  <10  6  >100 f  <10  c o n c e n t r a t i o n o f growth medium.  b  c  Absorbance a t 600nm (mean o f 4 experiments untreated c e l l s .  +/_ s t a n d a r d e r r o r o f mean) o f  600 °f aqueous phase a f t e r c e l l s were v o r t e x e d w i t h xylene and phases a l l o w e d t o s e p a r a t e . A r e d u c t i o n compared w i t h t h e c o n t r o l i n d i c a t e s adhesion t o x y l e n e by r e l a t i v e l y h y d r o p h o b i c c e l l s .  A  d  S i g n i f i c a n c e l e v e l , by Student t - t e s t , o f d i f f e r e n c e b e t w e e n xylene-treated values. t  c o n t r o l and  e Determined by m i c r o s c o p i c e x a m i n a t i o n with c e l l s .  o f xylene d r o p l e t s a f t e r v o r t e x i n g  f C o n t r o l absorbances may be lower because o f c o n t a m i n a t i o n o f t h e aqueous phases o f x y l e n e - t r e a t e d samples by o p t i c a l l y dense xylene d r o p l e t s d u r i n g pipetting. I t follows that a l l ^ Q Q values f o r xylene-treated c e l l s are probably.overestimates. a  82 binding I t was at  sites  by  difficult,  a molecular  2.  added Mg  for interaction  (see a b o v e ) .  i n an  attempt  found  constituent  o f PA01  Effect  of p r o t e i n  ( d a t a not  o f LPS  In p r e v i o u s  mutations on  isolated  that continued  regained  wild-type  susceptibility  changed  type  from  or any  other  demonstrated  by  or  protein  HI  R.E.W. Hancock, o f H181  protein  HI  to polymyxin  B.  second  smooth t o r o u g h .  alterations  were examined h e r e .  LPS  with  strains  H223, had  observations, a series  or p a r t l y - d e f i n e d  the  susceptibility  to overproduce  H222 and  these  LPS  s t u d i e s were  propionate)  ( N i c a s , T . I . and  pseudorevertants, LPS  with  in combination  antibiotic  studies  of  and  shown).  data), pseudorevertant  their  HI  HI  association.  o u t e r membranes c o u l d be  overproduction  unpublished  cross-linking  dithiobis(succinimidyl  glutaraldehyde  3.  between p r o t e i n  to demonstrate a c l o s e  cross-linking  either  s u r f a c e changes  during p u r i f i c a t i o n  Molecular  However, no  using  the  shown).  studies  o u t e r membranes was  done  ( d a t a not  level.  Cross-linking  protein  were i d e n t i c a l  t h e r e f o r e , to analyse  Some e v i d e n c e in  2+  of PA01 i n LPS  These s t r a i n s ,  were but  These  mutations In  light  derivatives  with  ( T a b l e I and in addition  had  that of defined  Figure  t o PA01,  1) H181  83 and  H222, were grown  2+  i n Mg  -sufficient  deficient  (20uM) medium and  their  polymyxin  B were measured by  the  Protein  Hi  production  was  (500uM) and  Mg  susceptibilities MIC  method  increased  2+  to  (Table  VI).  i n a l l of  the  2+ strains  by  growing  - d e f i c i e n t medium. H181 and H222 2+ o v e r p r o d u c e d p r o t e i n HI even i n Mg - s u f f i c i e n t medium, but 2+ p r o d u c e d more p r o t e i n s t i l l i n Mg -deficient conditions. 2+ Mg - d e f i c i e n t w i l d - t y p e s t r a i n s (PAOl and OT684) were significantly  i n Mg  less susceptible  to polymyxin  B than  the  same  2+ strains  grown  been o b s e r v e d all  of  the  i n Mg  -sufficient  previously  LPS-altered  (see  in s u s c e p t i b i l i t y  possible  that  decrease  in s u s c e p t i b i l i t y  activity  of  cations  (Table  Introduction).  VI) By  as  had  contrast,  m u t a n t s e x c e p t AK1401 showed no 2+  decrease  i n Mg  AK1282, AK1012 and  polymyxin  medium  B  that  i n low  - d e f i c i e n t medium.  such (It is  AK1414 d i d e x h i b i t some was  masked by  concentrations  (Newton, 1 9 5 4 ) , but  even  i f this  must have been much s m a l l e r  than  that  the  higher  of  divalent  were so  seen  the  decrease  i n P A O l , OT684  and  2+ AK1401.)  Mg  -sufficient  H181  was  less susceptible  than  7 +  PA01,  and  H222 was  Mg  - d e f i c i e n t H181  susceptible  susceptibility with  production  antigen  and  i n both media.  to polymyxin of p r o t e i n  AK1012, AK1414 and parts  H222. of  less susceptible  the  The  B therefore Hi  except  still,  level  of  correlated  i n mutants  inversely  AK1282,  These f o u r m u t a n t s a l l l a c k core  oligosacchoride  whereas  of  LPS  0(Figure  84  Table VI.  E f f e c t o f LPS mutations i n combination w i t h p r o t e i n H1 o v e r p r o d u c t i o n on s u s c e p t i b i l i t y t o polymyxin B. 2+ [ 9" jj] uM M  a  Strain  PA01  AK1282  AK1012  AK1414  0T684  AK1401  Geometric mean MIC o f polymyxin B, ug/ml  P r o t e i n H1 overproduced (  500 20  5.7 20*  +  500 20  1.3 2.2  +  500 20  1.8 1.8  +  500 20  4.0 6.3  +  500 20  2.8 20*  +  . 500 20  2.2 13*  +  20 90*  + ++  H181  500 20  H222  500 20  2.8 2.5  + ++  a LPS t y p e s o f s t r a i n s were v e r i f i e d by SDS-PAGE o f c e l l s t a i n i n g (see F i g u r e 1). b 2+ C o n c e n t r a t i o n o f Mg i n BM2-succinate medium.  l y s a t e s and s i l v e r -  c  d  Geometric mean o f s i x MIC d e t e r m i n a t i o n s . P r o t e i n H1 i n d u c t i o n was a s s e s s e d v i s u a l l y by SDS-PAGE o f c e l l l y s a t e s . 2+ S i g n i f i c a n t l y d i f f e r e n t from 500uM Mg v a l u e a t p = 0.05 by Wilcoxon Rank Sum t e s t .  85 1),  whereas AK1401 l a c k s  This  suggested  polymyxin  the  the  of  outer  protein  i f protein  resistance,  interaction in  that  HI  the  core  O - a n t i g e n but  this  with  region.  might  be  core.  involved mediated  a polymyxin-susceptible  I f the  longer  a wild-type  were d i r e c t l y  resistance  protein  would no  HI  has  s i t e were l o s t  protect  the  LPS  by  in by site  mutation,  from d i s r u p t i o n  by  antibiotic. By  contrast,  LPS  mutations  did  not  cause a b o l i t i o n  of 2+  the  resistance  deficient  cells  resistance. is  not  to g e n t a m i c i n (data  Testing  affected  H a n c o c k , 1980)  by  not of  the  was  to  EDTA + T r i s  shown), as  they d i d  seen  in  of  done as  protein  HI  Mg  for polymyxin  carbenici11 in s u s c e p t i b i l i t y , level  also  or  (Nicas  a c o n t r o l , and  B  which  and  the  data 2+  showed t h a t  the  LPS-altered  m u t a n t s was  increase  lack  of  not  in antibiotic  A n a l y s e s of  LPS  polymyxin  resistance  merely  c a u s e d by  susceptibility  of  cell  lysates  (data by  i n Mg a not  -deficient  general shown).  SDS-PAGE w i t h  silver-  s t a i n i n g d i d not show any q u a l i t a t i v e d i f f e r e n c e s between 2+ 2+ Mg - s u f f i c i e n t and Mg - d e f i c i e n t c e l l s o f any o f t h e s t r a i n s ( d a t a not shown). However, i t i s p o s s i b l e t h a t t h e r e may  be  subtle  changes  i n LPS  structure  responsible  for  the  2+ polymyxin  B-resistant  H181  above and  (see  the  LPS  mutations  the  changes.  p h e n o t y p e of Mg  Discussion  below).  somehow a b o l i s h e d  the  -deficient If this  cells  were  protective  and  true,  effect  of  86  4.  Approaches Several  of  t o m u t a g e n e s i s o f oprH  a p p r o a c h e s were used  PA01 c o m p l e t e l y  functional  d e f i c i e n t i n production  and a n t i b i o t i c - s u s c e p t i b i l i t y  Tn501-insertion and  t o t r y t o i s o l a t e a mutant  screened  mutants  f o r lack  of p r o t e i n studies.  for  Random  (Tsuda et_ a ^ . , 1984) were  of r e a c t i o n  Hi,  generated  with protein H l - s p e c i f i c 2+  antiserum The  and f o r l a c k  latter  might  s c r e e n was b a s e d  turned  up a p r o t e i n  6,000 c o l o n i e s  screened.  unsuccessful.  established used  that  (Nicas,  Columbia,  allowed  over  performed  ( R e l l a et_ a_l. , 1985)  i t had n o t been  University  firmly  f o r t h e phages  of B r i t i s h  o f t h e s t r u c t u r a l gene f o r p r o t e i n  efforts,  wild-type  gene  sites  i n PA01.  o f a DNA  within  HI, o p r H ,  fragment  t h e gene.  containing  In s p i t e o f  however, t h e mutant gene would n o t i n t h e chromosome o f PA01.  H l - d e f i c i e n t phenotype  conditions  HI  Neither  from  selection  HI was t h e r e c e p t o r  T . I . , Ph.D T h e s i s ,  Tn501 i n t o t h e P s t I  protein  However,  t h e i n s e r t i o n i_n v i t r o  extensive  protein  1982) .  Cloning  the  H l - d e f i c i e n t mutant Bacteriophage  protein  that  i n these c o n d i t i o n s .  Tn501- and T n 5 - 7 5 1 - i n s e r t i o n m u t a n t s  was a l s o  - d e f i c i e n t medium.  on t h e h y p o t h e s i s  be e s s e n t i a l f o r g r o w t h  method  on  o f g r o w t h on Mg  i s lethal  under  replace  P o s s i b l y the normal  87 5.  Properties It  all  was  of  P.  aeruginosa  shown p r e v i o u s l y  International Antigen  aeruginosa  overproduced  ATCC33354  that  Typing  representative  s t r a i n s of  Scheme s e r o t y p e s  a protein  of  the  of  P.  same a p p a r e n t MW  as  2+ HI  when grown  exception Thesis,  of  i n Mg strain  University  analysis  showed  HI  not  (data  - d e f i c i e n t medium, w i t h ATCC33354 of  that  British  the  (serotype  6;  Columbia,  1982).  ATCC33354 p r o d u c e d  no  single  Nicas,  T.I.,  Ph.D.  Western  detectable  blot  protein  therefore  T h i s s t r a i n and PAOl ( s e r o t y p e 5) were 2+ 2+ grown i n Mg - s u f f i c i e n t and Mg T d e f i c i e n t media  and  susceptibilities  their  largest  shown).  to polymyxin  change i n a n t i b i o t i c  B,  f o r which  susceptibility  the  i s seen,  were  2+ tested  (Table  medium d i d  VII).  Growth of ATCC33354  result in a s i g n i f i c a n t ,  i n Mg  2.2-fold  -deficient  decrease  in  2+ susceptibility ATCC33354. PAOl  to polymyxin  The  change was  ( 3 . 2 - f o l d ) , but  ATCC33354, u n l i k e drug c a r b e n i c i l l i n was in  possible, the  P A O l , was  than  to  that so.  i n Mg  induce  HI,  but  -sufficient  observed  for  However,  less susceptible 2+  when grown  therefore,  to  the  control  - d e f i c i e n t medium. resistance  the  It  to polymyxin  resistance  level  B  may  lower.  ATCC33354 was succinate  smaller  significantly  absence of p r o t e i n  have been  not  not  B compared w i t h Mg  as  able  medium s e v e r e l y  shown).  as  PAOl  and  H181  t o grow i n  deficient in divalent  Some g r o w t h o c c u r r e d  even  i n medium  cations  BM2(data  containing  88  Table VII.  S u s c e p t i b i l i t y t o polymyxin B and c a r b e n i c i l l i n o f P. a e r u g i n o s a PA01 ( s e r o t y p e 5) and ATTCC33354 ( s e r o t y p e 6) grown i n M g 2 + - s u f f i c i e n t and M g - d e f i c i e n t medium. 2 +  Geometric mean MIC 2+ [Mg ] uM  ug/ml  POLYMYXIN B  b  CARBENICILLIN  a  PA01  500  b  c  16 (p = 0.002)  C o n c e n t r a t i o n o f Mg  PA01  5.7  5.0  20  a  ATTCC33354  2+  13 (p = 0.04)  23 8.0 (p = 0.004)  ATCC33354  10 18 (p = 0.04)  i n BM2-succinate medium.  Geometric mean o f s i x MIC d e t e r m i n a t i o n s . S i g n i f i c a n c e l e v e l by Wilcoxon Rank Sum t e s t o f d i f f e r e n c e between 500uM M g and 20uM M g values. 2 +  2 +  89  only  200nM added Mg  conclusions results,  however,  Production Cells  chamber  I t i s hard  since  t o draw any f i r m  of protein  the genetic  distinct  of p r o t e i n  implants  The p r o t e i n  blot  (Mutharia e t a l . , 1982).  H i by P. a e r u g i n o s a  levels  (see a l s o  that  the f l u i d  expression,  strain  of protein  K e l l y et_ al_. , 1 9 8 9 ) .  cations  may have  to prevent  i n mice  M2 grown i n analysed  Hi (Figure 15).  b u t was n o t a p p a r e n t l y  i n s i d e t h e chambers  divalent  grown  ( K e l l y et^ a _ l ^ , 1987) were  f o r production  was p r e s e n t  high  sufficient  i n mice  H i b a s e d on t h e s e  b a c k g r o u n d s o f PAOl and  o f t h e v i r u l e n t P_. a e r u g i n o s a  on a W e s t e r n  7.  .  about t h e f u n c t i o n  ATCC33354 a r e q u i t e  6.  2+  produced at  This  suggested  contained  induction  o f oprH  b u t t h i s was n o t m e a s u r e d .  Summary The  anionic  function  of p r o t e i n  H i may be t o i n t e r a c t  g r o u p s on LPS a t t h e c e l l  stability  when d i v a l e n t  cations  surface,  are present  conferring i n low  concentrations.  However,  hypothesis  t o t h e u n a v a i l a b i l i t y o f an ijn v i t r o  for  protein  Protein  owing  Hi function  Hl-overproducing  hydrophobicity, could  i t was h a r d  with  to confirm  or of a p r o t e i n cells  o r deny  Hl-deficient  had a l t e r e d  surface  b u t no i n t e r a c t i o n between  protein  be d e m o n s t r a t e d by m o l e c u l a r  cross-linking.  this  assay mutant.  HI and LPS Certain  90  F i g u r e 15. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m ( p a n e l A) and Western immunoblot (panel B) showing e x p r e s s i o n of p r o t e i n H1 by P. a e r u g i n o s a grown i n chamber implants i n mice. Lane 1, l y s a t e of M2 c e l l s grown i n chambers (30ug of p r o t e i n ) . Lane 2, PA01 o u t e r membrane ( c o n t r o l ; 15ug of p r o t e i n ) . Some of t h e p r o t e i n i n l a n e 1 may be host m a t e r i a l . The r u n n i n g p o s i t i o n of p r o t e i n H1 i s shown on the r i g h t of each p a n e l .  91  LPS  mutations  affected  r e s u l t i n g i n the d e l e t i o n  the polymyxin  B  (but not  resistance  phenotype of p r o t e i n  properties  of a serotype  of c o r e  gentamicin  or EDTA)  Hl-overproducing  6 P_. a e r u g i n o s a  residues  strain  cells.  The  suggested 2+  that  the c e l l  medium, o t h e r antibiotic  chamber  antibiotic  have r e s p o n s e s  than  protein  to growth  i n Mg  Hl-overproduction,  that  -deficient affect  susceptibility.  Protein in  may  HI  was  implants  produced  low  levels in bacteria  i n m i c e , so was  u n l i k e l y to a f f e c t  susceptibility  in  at  vivo.  grown  92  CHAPTER  Mg P.  2+  -REGULATED  4  CELL ENVELOPE PROTEINS OF SPECIES RELATED TO  aeruginosa  2+ 1.  Envelope p r o t e i n s  i n d u c i b l e by g r o w t h  medium and r e a c t i v i t y Various (listed  species  i n Table  with  antiserum  of b a c t e r i a r e l a t e d 2+  I) were grown i n Mg  i n Mg  -deficient  to p r o t e i n Hi t o P.  aeruginosa  -sufficient  (500uM) o r  2+ Mg  -deficient  analysed  by SDS-PAGE  deficient observed 2+ Mg  (20 o r 50 uM) medium and t h e i r f o r any p r o t e i n s  conditions. a r e shown  The a p p a r e n t  i n Table  -regulated polypeptides  P_. a e r u g i n o s a . chloraphis, (Figure  Several  strains  in size  immunologically  16, i t was o n l y  very  p r o t e i n HI; a l t e r n a t i v e l y ,  been a s t r o n g l y - r e a c t i v e band p r e s e n t close  under Mg  produced  t o p r o t e i n HI o f  20,000 f r o m P_. with  p r o t e i n Hi  I f t h e r e a c t i v e p r o t e i n was t h e m a j o r  in Figure  r e a c t i v e with  similar  envelopes 2+  of the p o l y p e p t i d e s  one, o f a p p a r e n t MW  cross-reacted  16).  indicated  Only  VIII.  MW  induced  cell  t o t h e major b a n d .  weakly  band  cross-  t h e r e might  i n low copy  have  number  The P_. c h l o r a p h i s p r o t e i n was,  protein  H i , heat-modifiable  protein  when s o l u b i l i z e d  but the running  a t 22°C c o u l d  position  n o t be s e e n .  like  of the  93  T a b l e V I I I . Mg  - r e g u l a t e d c e l l envelope p r o t e i n s .  Apparent MW  Species  Strain  P. c h l o r a p h i s  u  p. f l u o r e s c e n s ^ II  ., b  p. p u t i d a  .b  p. s t u t z e r i p.  b syringae  p. c e p a c i a II  X. m a l t o p h i l i a  Ox  induced under Mg deficient conditions (thousands)  ATCC9446 ATCC949  c 19  ATCC4359  55,  ATCC17588  21  ATCC19310  -  ATCC25416  17  ATCC25609 ATCC13637 8197  R e a c t i v i t y of bands w i t h .antiserum t o p r o t e i n H1  +  20  ATCC13525  A. c a l c o a c e t i c u s  o f band(s)  d 22  -  -  15  -  E n v e l o p e s were s o l u b i l i z e d a t 100°C. Members o f rRNA homology group I , which i n c l u d e s P_^ a e r u g i n o s a . -, no band seen. -, no d e t e c t a b l e  r e a c t i v i t y with  antiserum.  94  F i g u r e 16. SDS-polyacrylamide g e l e l e c t r o p h o r e t o g r a m ( p a n e l A) and Western immunoblot (panel B) o f c e l l envelopes of P_. a e r u g i n o s a and P. c h l o r a p h i s . P a n e l B i s a Western b l o t of a g e l i d e n t i c a l t o t h e one i n p a n e l A, probed w i t h a n t i s e r u m s p e c i f i c f o r p r o t e i n H1. Lane 1, P_. a e r u g i n o s a PA01 (Mg2+s u f f i c i e n t ) ; lanes 2, PA01 ( M g 2 - d e f i c i e n t ) ; l a n e s 3 and 5, P_. c h l o r a p h i s ( M g 2 + - s u f f i c i e n t ) ; l a n e s 4 and 6, P. c h l o r a p h i s ( M g 2 + - d e f i c i e n t ) . Samples i n lanes 1-4 were s o l u b i l i z e d a t 100°C before l o a d i n g ; samples i n l a n e s 5 and 6 were s o l u b i l i z e d a t 22°C. 30ug of p r o t e i n was l o a d e d i n each l a n e . Running p o s i t i o n s of p r o t e i n H1 bands a r e shown on the l e f t o f each p a n e l . The H1l i k e p r o t e i n of P_. c h l o r a p h i s i s i n d i c a t e d by arrows. +  95  2.  Polymyxin  B susceptibility  P. c h l o r a p h i s , p r o d u c e any H l - l i k e to polymyxin  B i n Mg  o f P.  and two s p e c i e s proteins, 2+  chloraphis that  apparently  were t e s t e d  -sufficient  and Mg  2+  d i d not  for susceptibility - d e f i c i e n t media  2+ (Table  IX).  aeruginosa,  Mg  - d e f i c i e n t P. c h l o r a p h i s ,  demonstrated  like  P.  a s u b s t a n t i a l decrease i n  s u s c e p t i b i l i t y t o p o l y m y x i n B ( 5 - f o l d , p = 0.002) compared 2+ w i t h i t s Mg - s u f f i c i e n t counterpart. P. fluorescens d i s p l a y e d a s l i g h t but s t a t i s t i c a l l y i n s i g n i f i c a n t decrease 2+ (p = 0.18) i n 50uM Mg , w h i l e t h e s u s c e p t i b i l i t y o f P. putida  was u n c h a n g e d .  The H l - l i k e  protein  may have been a 2+  factor  contributing  deficient species  to the polymyxin  P. c h l o r a p h i s ,  resistance  but i t should  be n o t e d  was s u b s t a n t i a l l y more r e s i s t a n t t h a n  to both polymyxin  o f Mg  and c a r b e n i c i 1 1 i n r e g a r d l e s s  that  this  P_. a e r u g i n o s a 2+ o f Mg  concent rat i o n . 3.  Summary Several  produced  species  of b a c t e r i a  envelope proteins  that  r e l a t e d t o P.  aeruginosa  were i n d u c i b l e by growth i n  2+ Mg HI.  - d e f i c i e n t medium and s i m i l a r i n a p p a r e n t A protein  reacted  with  of apparent  antiserum  MW  MW  to p r o t e i n  20,000 f r o m P_. c h l o r a p h i s  to p r o t e i n  HI.  P_. c h l o r a p h i s ,  like  a e r u g i n o s a , was s u b s t a n t i a l l y l e s s s u s c e p t i b l e t o p o l y m y x i n 2+ 2+ i n Mg - d e f i c i e n t medium t h a n i t was i n Mg -sufficient medium.  P. B  Table IX.  S u s c e p t i b i l i t y t o polymyxin B and c a r b e n i c i l l i n o f Pseudomonas s p e c i e s grown i n 2+ . . 2+ Mg - s u f f i c i e n t and Mg - d e f i c i e n t medium. Geometric mean MIC  ug/ml CARBENICILLIN  POLYMYXIN B 2+ Mg uM  P. aerug. PAOl  P. c h l o r .  P. f l u o r . ATCC949  P. p u t i d a  500  5.0  23  110  2.4  50  9.0  180  2.0  c  c  a  20  16*  110*  C o n c e n t r a t i o n of Mg  i n BM2-succinate  P. aerug. PAOl 23  P. c h l o r .  P. f l u o r . ATCC949  720  9.0* 8.0*  510  1000  27*  -  -  medium. 2+  P. f l u o r e s c e n s and P. p u t i d a would n o t grow i n 20uM Mg from 500um Mg^  +  v a l u e a t p = 0.05 by W i l c o x o n Rank Sum  110  720  Geometric mean o f s i x MIC d e t e r m i n a t i o n s ( f o u r f o r P. p u t i d a ) .  *, s i g n i f i c a n t l y d i f f e r e n t  P. p u t i d a  test.  97  DISCUSSION  1.  General  properties  of  protein  O u t e r membrane p r o t e i n proteins  originally  ( 1 9 7 8 ) , but renamed HI latter  i s now  "protein escaped  H"  by  the  protein  bonds) and  i s not  Hancock e t  previously  of  a p p a r e n t MW  in p u r i f y i n g protein partially  purified  (especially  the  heat-unmodified  100°C  c a u s e d by  i n SDS  molecules  contains  to  fact  the  has  HI  is a  is  no  and  that  heat-  unaffected  disulphide  (Hancock and  HI  loading  gels. acid  of  in this  This  Carey,  in addition proportion  heat-modified  HI  reported little  bands  Figure  and  apparent  study  2)  sample volumes  observation,  treatment  i n the  band; see  large  because of  p r o t e i n were  Smearing of p r o t e i n  to cause a h i g h e r run  NaCl  Although  polypeptides  (Hancock e_t a^. , 1 9 8 2 b ) , but  trichloroacetic  the  two  Kageyama  containing  (1979) .  of  a l . , 1981a).  the  stacking  M i z u n o and  21,000 w h i c h  ( i . e . probably  seen.  shallow  i s one  Ward et_ al_. , 1 9 8 8 ) .  was  was  Carey  distinct  degradation  gels  by  nomenclature,  two  (e.g.  of  H"  l i n k e d to p e p t i d o g l y c a n  Difficulties instability  P_. a e r u g i n o s a  SDS-PAGE i n g e l s  Hancock and  c o n s i s t s of  2-mercaptoethanol  1979;  by  accepted  some a u t h o r s  modifiable by  H2  of  named " p r o t e i n  separated and  HI  HI  SDS  onto use  of  to h e a t i n g  at  of  the  on  protein  p o s i t i o n on  Hi  gels,  aided  98 in  the p u r i f i c a t i o n of the p r o t e i n  SDS-PAGE.  The y i e l d s o b t a i n e d  than  obtained  those  was d i f f i c u l t on  using  f r o m s o l u b i l i z e d OM by  by SDS-PAGE were much  higher  anion-exchange chromatography.  to separate protein  H i f r o m o t h e r OM  It  proteins  anion-exchange columns, perhaps because of f o r m a t i o n of  "mixed m i c e l l e s " protein  o f T r i t o n X-100  species).  denaturation avoided  (containing  more t h a n one  SDS-PAGE and e l e c t r o e l u t i o n c a u s e d  o f some p r o t e i n  by c a r e f u l p a s s i v e  HI m o l e c u l e s ,  but t h i s could  e l u t i o n of protein  be  from g e l  slices.  2.  Interaction Most  interact  surface-exposed with  fatty-acyl (Nikaido  of l i p i d  and V a a r a ,  OM s u r f a c e . difficult  As m e n t i o n e d  to determine  T h e r e may a l s o  LPS, a c t i n g  i n t e r a c t i o n with o f t h e membrane  be e l e c t r o s t a t i c  g r o u p s on p r o t e i n  and LPS a t t h e  i n the i n t r o d u c t i o n ,  the nature of these  i n model s y s t e m s o f q u e s t i o n a b l e  it  is  interactions  relevance  (Beher et^  e_t aJU , 1 9 8 9 ) .  HI has been h y p o t h e s i z e d as a s u b s t i t u t e  and Hancock, 1 9 8 0 ) , e v i d e n c e  interaction  are believed to  A i n the i n t e r i o r  between c h a r g e d  Since protein  (Nicas  OM p r o t e i n s  1985).  a l . , 1980; B o r n e l e i t  anionic  HI w i t h LPS  LPS, p r e s u m a b l y by h y d r o p h o b i c  tails  interaction  except  of protein  was s o u g h t  to s t a b i l i z e  for divalent for protein  i n t h i s study.  Since  cations Hl-LPS  detergent-  99  solubilization detergent protein  of a p r o t e i n  molecules  (Hjelmeland  for lipidic  the  of p r o t e i n  HI w i t h  lipidic  l o s s of O-antigen  might  i n d i c a t e that  interaction  that  seemed  HI  failed  i n OM  that  the d i f f e r e n t o f smooth  (H181) and  the i n t e r a c t i o n of  i n t h e OM  was  of the core)  HI and L P S .  t h e rough m u t a t i o n that  a l t e r e d (by  i n AK1012.  solubilized  of the detergent  of i n s o l u b l e  under  OM  aggregates),  protein  species  t h e same c o n d i t i o n s  that  t h e p r e s e n c e o f an e q u i - m o l a r  or l a r g e r  Hi  f r e e of other  HI  were  A second  LPS  protein  access  t h e OM t o  i n AK1012.  of  i n a n i o n - e x c h a n g e column f r a c t i o n s c o n t a i n i n g proteins  chromatography) a l s o high  content  molecules protein  Although  co-purified protein  ( a f t e r two c o n s e c u t i v e  suggested  o f smooth  associate  i t was  protein  by c h a n c e ,  HI and LPS were  protein  Hl-LPS i n t e r a c t i o n .  Hi p r e p a r a t i o n  most s t r o n g l y  u n l i k e l y that  amount  c y c l e s of  (O-antigen-containing)  i n the pure p r o t e i n  Hi might  This  The a l t e r n a t i v e  somehow c a u s e d  restricted  (e.g. formation  to s o l u b i l i z e  observation,  LPS.  and p a r t  u n l i k e l y s i n c e many o t h e r  successfully  surrounding the  t h e d e t e r g e n t s were d i s r u p t i n g an  a conformation  to p r o t e i n  The  HI  molecules  between p r o t e i n  explanation, adopt  molecules  (AK1012) s t r a i n s s u g g e s t e d  protein  s u b s t i t u t i o n of  and Chrambach, 1 9 8 4 ) ,  detergent-solubility rough  involves  with  LPS  suggested this  the p r o t e i n  that  type of  HI and LPS  i t is possible  that  mixed m i c e l l e s o f  intrinsically  more  stable  than  100 micelles an  containing  association  to prove t h a t OM.  observed  protein  Hl-LPS  OM p r o t e i n s  that  on  although  (Reithmeier  the required  Noyes, 1 9 8 4 ) . interaction also  the success reactive Attempts  of p r o t e i n  has been used and B r a g g ,  protein  strong HI  and LPS. to detect  1977).  Hl-LPS  available  to demonstrate p r o t e i n  bands  The  association depends  ( L u n d b l a d and Hl-LPS  of the pure p r o t e i n  by LPS were  unsuccessful. In c o n c l u s i o n ,  of  groups b e i n g  also  workers  of c r o s s - l i n k i n g cations  by r e n a t u r a t i o n  SDS-  p u r i f i e d by t h e  other  t e c h n i q u e d i d n o t d e m o n s t r a t e any p r o t e i n here,  in intact  some p r o t e i n  a r e complexes  cross-linking analysis  o f OM p r o t e i n s  difficult  The a b s e n c e o f LPS was  e_t a _ l . , 1 9 8 6 ) , a l t h o u g h  SDS-polyacrylamide gels  oligomers  i t was  H i p u r i f i e d by p r e p a r a t i v e  e_t a ^ l . , 1985) have r e p o r t e d  Molecular  i n the absence of  interaction existed  LPS c o n t a m i n a t i o n .  (Parr  even  Therefore,  f o r o t h e r P. a e r u g i n o s a  same method (Poxton  HI a l o n e ,  between t h e two.  Incidentally, protein  PAGE l a c k e d  on  protein  i s l i m i t e d evidence  HI and LPS i n t h e P_. a e r u g i n o s a  e v i d e n c e would be i n s u f f i c i e n t  binds  LPS a t t h e a n i o n i c  alteration molecules directed issue.  there  sites  or l o s s of s p e c i f i c in intact cells,  for interaction  OM,  b u t even  to prove that  of the l a t t e r .  sites  on p r o t e i n  presumably achieved  m u t a g e n e s i s , would be n e c e s s a r y The e f f e c t o f c e r t a i n m u t a t i o n s  protein  Defined HI and LPS  by  site-  to resolve  this  deleting parts  o f LPS  101 on  antibiotic  susceptibility  was  determined,  and  is  discussed  below.  3.  Structure From t h e  acid  not  N-terminal protein  nucleotide  from the  deduced weight 21  and  basic  had  two  a fairly  typical  protein  simplified  last  178  three  one  of  a leader  peptide  observed  residues  (Lugtenberg  and  protein  HI  may  anionic  LPS.  proteins van be  the  mature  residues  (giving  residues  at  the  two-thirds,  amino  the  i n E. full  fairly  coli 199  rich  ( p i = 8.6  so  of  e_t al_. , 1 9 8 7 ) .  acid(s)  Other e x c e p t i o n s  in asparagine  this  i t s proposed to  this  larger  presumably  contained  according  A l p h e n , 1 9 8 3 ) , so  exported  the  residues.  to  and  far characterized  r e l a t e d to  an  The  was  theoretical calculation; Sillero  Most OM  199  from T a b l e I I I ) .  p e r h a p s more s i g n i f i c a n t l y ,  acidic  of  From  the  N-terminal and  amino  respectively, giving i t  form c o n t a i n i n g  but,  protein,  hydrophobic  (Randall HI  methionine.  p o s i t i v e l y charged  alanyl residues  protein  the  It consisted  19,399, c a l c u l a t e d  mature p r o t e i n was  than  1989).  of  contain  mature p r o t e i n ,  unprocessed  glycine,  to  oprH gene, t h e  derived.  purified  prokaryotic  The  was  the  end,  of  Hi  HI. the  sequence of  characteristics  species  sequence of  N-terminal  remaining  valyl  protein  the  was  N-terminal  of  counting  a molecular  and  function  sequence of p r o t e i n  residues,  The  and  more  a  Ribeiro,  are  property function  r u l e are  and  acidic of in  binding  several  OM  102 proteins  of N e i s s e r i a  isoelectric The except the  points  gonorrhoeae,  above 8.4  c a t i o n i c residues  have  ( J o n e s et^ aj^. , 1 9 8 0 ) .  were f a i r l y  f o r a c l u s t e r of three,  evenly  distributed  w h i c h were p o s i t i o n e d  two most h y d r o p h o b i c segments o f t h e p r o t e i n .  hydrophobic  regions  m i g h t be a r r a n g e d  membrane-spanning b e t a - s h e e t outer  surface  containing cationic  the l y s y l  residues  This  model  protein  that  joined  and random c o i l  and a r g i n y l r e s i d u e s .  groups  i n the core  speculative,  there  are three  HI s e q u e n c e c l o s e  These a s p a r t y l  The two  at the  structure  In t h i s way, t h e  m i g h t be i n a p o s i t i o n t o i n t e r a c t w i t h  i s purely  drawback  between  in anti-parallel  conformation,  o f t h e OM by t u r n  negatively-charged  the  some o f w h i c h  residues  or l i p i d  A o f LPS.  however, and s u f f e r s aspartyl  residues  to the l y s i n e + arginine  might  from  i n the cluster.  n e u t r a l i z e the p o s i t i v e  charges. The  amino a c i d s e q u e n c e o f p r o t e i n  substantial  similarities  documented  supporting  the idea  its  b a s i c i t y was a t y p i c a l , t h e p r e d i c t e d  slight  structure  of p r o t e i n  that  t o any o t h e r  HI b o r e no  i t has a n o v e l  and V a a r a , 1 9 8 5 ) .  channels  in lipid  communication), in  function.  HI was low i n h e l i x , l i k e  (Nikaido  bilayers  However, p r o t e i n (R.E.W. Hancock,  and showed no m u l t i m e r s  the c r o s s - l i n k i n g studies  done h e r e .  sequences, Although  secondary most OM  porins  H i formed no personal  (typical No o t h e r  of porins) data  103  suggest  that  protein  Hi.  It  channel  formation  is difficult  at present  about  the  is  a v a i l a b l e assay  no  any  f o r the  I t remains  above,  the  that  will  of  be  supported  a  the  of  statements since  there  i_n v i t r o ,  nor  distinguishable  from the  i n t e r a c t s with by  Hi,  purified protein  likely,  protein  function  firm  protein  H l - d e f i c i e n t mutant w i t h  phenotype.  likely  t o make any  physiological function  protein  idea  i s the  r e s u l t s mentioned anionic  antibiotic  LPS,  studies  and  this  discussed  below.  4.  Genetics  and  regulation  of  protein  Protein  Hi  i s produced  at  low  Hi  synthesis  l e v e l s by  P.  aeruginosa  2+ PAOl  cells  grown  i n Mg  -sufficient  medium, but  induced  about  2+ 2 0 - f o l d i n Mg I n d u c t i o n can  1980).  quantities  1983b).  There are proteins  - d e f i c i e n t medium ( N i c a s and Hancock, be r e l i e v e d by a d d i t i o n o f s u f f i c i e n t 2+ 2+ 2+ o f Ca , Mn or Sr ( N i c a s and Hancock,  other (e.g.  examples o f Lipson  divalent  e_t a K ,  1988)  cation-regulated but  mechanism f o r t h i s t y p e o f  regulation.  element  the  of  the  concentration protein which  HI  cell and  proteins  relays  synthesis  influences i n E.  senses  (by  the  of  Epstein,  the  established  Presumably, in divalent  message t o  analogy with  expression  coli;  change  no  a  the  ompF and  1983).  LPS  cation  regulator EnvZ  some  of  osmosensor,  ompC genes f o r  has  also  been  OM  104 proposed et  to affect  a l . , 1980).  strains  o f OM p r o t e i n  The m u t a t i o n s  some i n d u c t i o n  these mutants.  stationary  phase c u l t u r e s  1980), but t h i s  derepress  of p r o t e i n  Protein  genes  i n the protein  H181 and H185 a p p a r e n t l y  although in  expression  the system, still  occurs  overproduced i n  i n most media  may be r e l a t e d  Beher  Hl-overproducing  Hi synthesis  Hi i s also  (e.g.  (Nicas  to divalent  and Hancock,  cation  depletion  2+ since  i t i s reversed  (author's  unpublished  influence  protein  cells and  succinate  levels  than  5mM  Mg  added  However, o t h e r  I t i s decreased  30-37°C  source  f a c t o r s do  (Kropinski  by g r o w i n g  e_t a _ l . , 1 9 8 7 ) ,  + galactose for  i n BM2 medium  (R.E.W.  Hancock,  result).  this  study, p r o t e i n  i n P_. a e r u g i n o s a  implants  with  by s u b s t i t u t i n g c i t r a t e  as t h e c a r b o n  unpublished In  result).  HI p r o d u c t i o n .  a t 15°C r a t h e r  increased  i n PP2 b r o t h  i n mice.  H i was p r o d u c e d  M2 c e l l s  The chambers  cultivated are perfused  at uninduced i n chamber by p e r i t o n e a l  fluid  b u t h o s t c e l l s a r e e x c l u d e d ( K e l l y et^ aj^. , 1 9 8 7 ) . 2+ 2+ L e v e l s o f Mg and Ca i n a n o t h e r body f l u i d , human serum, a r e 0.92 and 1.25mM r e s p e c t i v e l y ( B l a s e r and L u e t h y , 1 9 8 8 ) , 2+ 2+ w h i c h i s a b o v e t h e l e v e l i n Mg - s u f f i c i e n t BM2 (0.5mM Mg , 2+ and  no added Ca  cations which  ).  in peritoneal  i s also  reduced  p r e s e n c e o f serum  Probably fluid  there  are s u f f i c i e n t  to repress  i n P_. a e r u g i n o s a  in vitro  protein cells  (R.E.W. Hancock,  HI  grown  divalent synthesis, i n the  unpublished  105  result). cells  P r o t e i n H i was  isolated  directly  patient  (Anwar et^ a l . ,  protein  without  production  from  infected  candidate  proteins  probing copy  with  the  apparent  proteins  or  protein  promoter, was  concurred  as  judged  depended on  with  promoters are seems t o be  latter  no  of  the  giving  oprH, a t  genes p o s i t i o n e d b e h i n d  less OM  on  a  of  of  from  levels  its  These  t h a t most  of  of  own region,  results Pseudomonas  i n E. c o 1 i , whereas  promoters  be  (presumably i t s  a downstream  i n LB.  the  It could  much h i g h e r least  by  single-  i n E. c o l i ,  DNA  translation  E. c o l i  found,  the p r o d u c t i o n  observation  inactive  major b l o c k  by  cloned  i n M9-glucose than  relatively  cloned  to p r o t e i n H i .  the presence  the g e n e r a l  a  some o t h e r  o l i g o n u c l e o t i d e s , t o be  antiserum  Expression  higher  production  make p r o t e i n HI than  taken  These  l a c k o f p r o t e i n HI  When i t was  from p l a c , the  the  1982).  f r o m a p r o m o t e r on  HI.  cells  gene f o r p r o t e i n H i , o p r H , was  by  of  considered  i n P_. a e r u g i n o s a  6 in_ v i t r o ,  et_ a l ^ . ,  expressed,  recognized  expressed  must be  for a vaccine antigen  chromosomal gene.  fibrosis  same g r o u p more r e c e n t l y d e s c r i b e d  complementary  be  aeruginosa  identification  (Ward et^ a ^ . , 1 9 8 8 ) .  serotype  structural  gene c o u l d  and  the  (Mutharia  The  own)  and  the  antiserum  o f a " p r o t e i n H"  P_. a e r u g i n o s a  likely  as  i n P.  sputum o f a c y s t i c  1 9 8 4 ) , but  b u r n wounds  observations, by  from the  a specific  tenuous, e s p e c i a l l y the  reportedly detected  there  Pseudomonas  (Nakazawa  and  106  Inouye,  1986).  foreign  OM  and  However, p r o d u c t i o n  proteins  elsewhere  can be  lethal  (e.g. C o r n e l l s  o f l a r g e amounts o f  t o E_. c o l i ,  et_ al_. , 1 9 8 9 ) .  as shown h e r e The  isolated  2+  oprH  gene was  higher  not r e g u l a t e d  expression  o f oprH  by Mg  i n E. c o l l ,  i n M9-glucose  aeruginosa.  This  have  o r unmasked an a l t e r n a t i v e  created  mechanism. therefore, The  The  downstream that  affecting  DNA  a  influence  region  enzymic  occurred  i n P_.  o f t h e gene  may  regulatory  o f t h e downstream  might  enhances  region  o f oprH  long and  degradation  a c t as a s i t e  of  may,  interaction,for  t r a n s c r i p t i o n o f remote  supercoiling  (hypothetical)  transcript  isolation  the  n o t o p e r a t e i n t h e chromosome o f P.. a e r u g i n o s a .  a protein  of  suggested that  also  and  (Wang, 1 9 8 2 ) ,  mRNA s p e c i e s  i t might  (containing  downstream DNA)  than a s h o r t e r  or  genes  that  species  by be  part  the  i s more s t a b l e (Saunders  to  and  S a u n d e r s , 1987) . DNA in  sequence  analysis  failed  t h e 90 b a s e p a i r s u p s t r e a m o f t h e oprH  However, t h e p r o m o t e r  may  t o t h e known c o n s e n s u s  further  upstream.  (Duchene  (Siehnel  The  cloned  et_ a l . , 1 9 8 8 ) ,  coding  I  sequences, or genes  o f P.  ejt al_. , 1988b) had p r o m o t e r  a l l o f t h e s e were h i g h l y  AT-rich i t may  aerug inosa  sequences  13. c o l i active  promoter  region.  ( C o r n e l l s e_t a l . , 1989)  homology t o t h e c o r r e s p o n d i n g and  a likely  be n o t p a r t i c u l a r l y  similar  F  to f i n d  consensus  i n E. c o l i .  with  nor  be proteins and  P  strong  sequences, A potential  107 regulatory  s i g n a l was f o u n d  downstream o f t h e s t a r t inverted  complementary  stem-loop secondary possibly  causing  stem-loop  region  most a t t e n u a t o r s attenuation  of the coding  s e q u e n c e homology c o u l d  premature t e r m i n a t i o n was n o t f o l l o w e d (Landick  proteases did  explain  1987).  in.this  p r o t e i n may have been d e g r a d e d  terminator  To  o f oprH may be c o n s i d e r a b l y  as m e n t i o n e d summarize,  apparently  complex.  HI  synthesis  Studies  5.  is likely  of other  plasmid,  and  r a p i d l y by  Sequence a n a l y s i s  sequence region,  longer  of the cloned  may o p e r a t e It will  i n t h e 54 so t h e  t h a n t h e gene  gene have  revealed  o n l y when t h e gene i s  be a r g u e d  t o be r e g u l a t e d  below t h a t  co-ordinately  protein with  molecules.  R o l e o f p r o t e i n HI i n a n t i b i o t i c P.  Such an  t h e r e g u l a t i o n o f oprH e x p r e s s i o n i s  on a p l a s m i d .  synthesis  as a r e  above.  some f e a t u r e s , b u t t h e s e isolated  The  i n E. c o l i / p G B l l .  b a s e p a i r s downstream o f t h e oprH c o d i n g  itself,  rise to  transcript,  ( S a u n d e r s and S a u n d e r s , 1 9 8 7 ) .  transcript  give  the lack of a detectable  incomplete  not r e v e a l the expected  region of  by a r u n o f T b a s e s ,  fusion protein  However, t h e oprH gene was  This  of t r a n s c r i p t i o n .  and Y a n o f s k y ,  mechanism m i g h t  shortened  74 base p a i r s  region.  s t r u c t u r e i n t h e mRNA  beta-galactosidase-Hl  the  i n oprH, c e n t r e d  resistance in  aeruginosa  Studies  o f P. a e r u g i n o s a  cells  that  overproduced  protein  108  HI,  b e c a u s e of  mutation 1981b), for  growth  (Nicas led  to the  these  (see  studies  eliminated, (Nicas  approach HI  of  to  here,  by  plasmid obtain  the  protein  resolving  both  a protein  fruitful.  the  protein  and  The  the  cannot  This  an  be  The  polymyxin  B and  lacking  a plasmid  or  a protein  HI  that  carrying  latter  level  a p p r o a c h was  would be  used a  to  unable  physiological  to  responses  approach proved  protein  a strong  the  divalent  c a t i o n - d e f i c i e n t medium,  other  gentamicin  protein  i s o l a t e d oprH gene on  overproducing  oprH gene b e h i n d  to  ruled  One  a p p r o a c h would be  in divalent  than  a l t e r a t i o n s were  response  of  (potentially pleiotropic)  H185. of  and  drawback  i s to overproduce  Another  medium.  similar  of  and  r e t a i n any  P_. a e r u g i n o s a PA01,  spite  responsible  changes o t h e r  cells  H l - d e f i c i e n t mutant  in that  plasmid-borne  of  cellular  expression  would p r e s u m a b l y  be  is  aminoglycosides,  possible  the  i n P_. a e r u g i n o s a .  growth  HI  for d e t a i l s ) .  t h i s dilemma  conditions  obtaining  to  B,  i n the  several  i n s t r a i n s H181  overproduce  protein  possibility HI  or  1983b; Hancock e t a l . ,  H a n c o c k , 1983b; Moore et_ a_l. , 1 9 8 4 ) .  i n d e p e n d e n t l y of  mutations  to polymyxin  although and  and  that  Introduction  cation-deficient  but  hypothesis  i s that  overproduction  c a t i o n - d e f i c i e n t medium  H a n c o c k , 1980  cross-resistance  EDTA + T r i s  out  and  in divalent  Hi  promoter  susceptibility vector  alone.  i n PA01/pGB25 r o u g h l y  not  to  from a (pGB25), to  PA01  This  was  equal  had  in to  109  that  observed  overproduction to  I t was c o n c l u d e d  a l o n e was n o t s u f f i c i e n t  these agents.  overproduction of  i n H181.  The d a t a  6 P. a e r u g i n o s a  contributed  strain  HI  resistance  whether  H181, i n a s s o c i a t i o n w i t h some o t h e r  serotype  protein  to cause  d i d not t e l l  of the p r o t e i n  that  to the r e s i s t a n c e  alteration.  A  l a c k i n g p r o t e i n HI, 2+  ATCC33354, d i d d e m o n s t r a t e p o l y m y x i n deficient or  medium, s u g g e s t i n g  no p a r t  f r o m PAOl  in this  recognize 1982) not  phenotype.  (serotype  composition;  that  receptors  strictly  Therefore,  comparable  H i may p l a y  primarily the  t o c e r t a i n phages  on PAOl  (Mutharia  t h a n PAOl  the data  (this  potentiate  The r e s i s t a n c e  u s e d , and r e d u c t i o n  increased  s u r v i v a l rates  t h e e f f e c t s o f EDTA; N i k a i d o  the f u l l  alteration  level  of r e s i s t a n c e  was p r e s u m a b l y  was p r o b a b l y  study,  data  susceptibility  observed  Tris  o f t h e EDTA (Tris  i s used t o  and V a a r a ,  co-ordinately  of the l a t t e r ,  required. regulated  was  i s not l e t h a l a t  PA01/pGB25 was not as r e s i s t a n t t o EDTA + T r i s for  et_ a l . ,  f o r ATCC33354 a r e n o t  t o t h e EDTA component, s i n c e  concentration  that  to those f o r PAOl.  by EDTA + T r i s .  concentrations  little  j u s t LPS O - a n t i g e n  PA01/pGB25 d i d , however, have d e c r e a s e d to k i l l i n g  i n Mg  However, ATCC33354 i s d i s t i n c t  i t i s not s u s c e p t i b l e  and i t grows more s l o w l y shown).  protein  5) i n more t h a n  OM p r o t e i n  B resistance  This  1985).  as H181, so some  other  "second a l t e r a t i o n "  with p r o t e i n Hi  110  synthesis,  since  apparently  had o n l y  studies) 1980). for  the independent one m u t a t i o n  m u t a n t s H181 and H185 each  and b o t h had t h e same p h e n o t y p e This  "second  resistance  to polymyxin  conclusive  overproduction divalent  strongly these  alone.  targets  suggest  sites  B and g e n t a m i c i n . partial,  that  protein  of high  HI o v e r p r o d u c t i o n  l e v e l s of protein to polymyxin  examined protein  LPS d i f f e r s  influences  B.  greatly  were r e s p o n s i b l e  t h e E_. c o l i  was n o t  from  P.  phosphate  HI even  f o r polymyxin  s t r a i n s used were d e r i v a t i v e s o f t h e  s t u d y were n o t p o l y m y x i n  HI was o v e r p r o d u c e d .  t h a n P. a e r u g i n o s a  i f such  B resistance.  K-12, and some rOugh P_. a e r u g i n o s a  in this  This  and Hancock, 1 9 8 6 ) , so would be u n l i k e l y t o  i n t h e c o r r e c t way w i t h p r o t e i n  rough s t r a i n  the r e s u l t s  HI i n E_. c o l i d i d  LPS, e s p e c i a l l y i n i t s much l o w e r  Moreover,  other  below.  aeruginosa  interaction  HI  The p o s s i b l e mechanisms o f t h i s  b e c a u s e E. c o l i  interact  i t i s the  on LPS, and has no  surprising  (Nikaido  required  Although the  as f a r as c a n be e s t a b l i s h e d ,  affect its susceptibility  content  and Hancock,  EDTA i s w e l l - k n o w n t o a c t as  sites  be d i s c u s s e d  Production not  Since  i n some way.  influence w i l l  (Nicas  e v i d e n c e o f a p h e n o t y p e c a u s e d by p r o t e i n  cation-binding  significant  reversion  a l t e r a t i o n " may be t h e same one  E D T A - r e s i s t a n c e o f PA01/pGB25 was o n l y first  (based on  t o EDTA  E. c o l i  mutants  B-resistant  is less  (Hancock, 1984) and  when  susceptible  Ill  aminoglycosides  may  coli  Nakae, 1 9 8 2 ) , so  (Nakae and  use  the  p o r i n pathway o f u p t a k e these  a g e n t s were  E.  in not  tested. Mutations various  parts  aeruginosa  resulting of  the  core  abolished  to gentamicin  or  i n the  the  l o s s of  the  O-antigen  o l i g o s a c c h a r i d e of  and  LPS  in  P.  r e s i s t a n c e to polymyxin  B,  but  EDTA + T r i s ,  seen  in wild-type  cells  not  grown  2+  i n Mg  -deficient  explanations  f o r these  compositional about on  by  the  H185  There are  data.  The  effect  of  reduced  being  (which o c c u r s  suppressors  altering  LPS  polymyxin  simplest  at  of  the  the  gene The  i n LPS  s t r u c t u r e t o make t h e longer  involve (brought  concentration  f o r polymyxin level,  as  the  B H181  and  r o u g h m u t a t i o n s would  resistant  B r e s i s t a n c e no  would  divalent cation  responsible  mutant p h e n o t y p e s h o w s ) . as  several possible  or c o n f i g u r a t i o n a l c h a n g e s  gene e x p r e s s i o n )  resistance  act  medium.  then  phenotype, presumably changes  responsible  possible.  by  for  The  changes  not  be  in  2+  LPS on  o f Mg  g e l s , s i n c e no  analysis protein HI  -deficient  was HI  cells  d i f f e r e n c e was  done.  An  in that  overproduction  wild-type  would  observed  when s u c h  alternative explanation  changes could  be  i n LPS  an  could  in combination  responsible  detectable  involve  with  f o r polymyxin  protein B  2+  resistance  i n Mg  of O-antigen eliminate  plus  -deficient core  a binding  medium.  material  site  In t h i s  i n the  f o r p r o t e i n HI  instance,  rough mutants (e.g.  loss  might  a phosphate  in  112  the HI  outer  core),  could  no l o n g e r  polymyxin  6.  o r c h a n g e LPS c o n f o r m a t i o n  B  interact  A model mechanism o f a n t i b i o t i c  As  discussed  apparently  above, p r o t e i n  for  of the r e s i s t a n c e  by  likely  sites  Introduction,  to occur  OM  t o EDTA.  and c h e l a t o r s therefore  apparently  OM p r o t e i n s  (except  targets  i n the to these  at the l e v e l  agents  of uptake  (b) t h e across  and a l t e r a t i o n s i n p h o s p h o l i p i d s  HI) have v i r t u a l l y  and  i n these  cells  (Nicas  (c) a l t e r a t i o n s  been  t o polymyxin  o u t as  B, g e n t a m i c i n ,  i n LPS a r e a s s o c i a t e d  in susceptibility  various  mutants of Gram-negative s p e c i e s  certain  mutations  with  t o one o r more o f t h e s e a g e n t s i n  i n LPS s u p p r e s s e d seen  ruled  and  and Hancock, 1980; Moore e_t  changes  B usually  reasons:  by a l t e r a t i o n s i n LPS i t s e l f ;  causes of r e s i s t a n c e  polymyxin  change(s)  f o r permeabi1ization  cross-resistance  possible  a l . , 1984);  The a d d i t i o n a l  as d i s c u s s e d  occurs  (Introduction),  EDTA  cells  B and g e r i t a m i c i n , and  i n LPS, f o r t h e f o l l o w i n g  r e a d i l y be c a u s e d  resistance the  for protein  Hl-overproducing  to polymyxin  on LPS a r e t h e l i k e l y  polycations  might  resistance  have one o r more a d d i t i o n a l a l t e r a t i o n ( s ) t h a t a r e for resistance  is/are  required f o r  cells  required part  protein  resistance.  Hl-overproducing  (a)  i n the fashion  so t h a t  in protein  (Hancock, 1 9 8 4 ) ; (d)  the resistance to Hl-overproducing  cells  113 (this  study).  Furthermore,  were shown h e r e this  act  t o have a l t e r e d  would p r o b a b l y  protein  protein  be c a u s e d  Hi i t s e l f .  independently  Hl-overproducing  cells  s u r f a c e h y d r o p h o b i c i t y , and  by LPS c h a n g e s ,  The p r o p o s e d  i f n o t by  LPS a l t e r a t i o n ( s ) ,  then,  may  of or i n c o n c e r t with p r o t e i n Hi  overproduct ion. Various resistant  type  Adjacent  o f LPS a l t e r a t i o n  phenotype.  LPS-divalent the  types  cation  believed  contribute to the  F i g u r e 17 shows a s e r i e s binding sites.  of diagrams of  P a n e l A shows a s i t e o f  t o be common i n t h e OM o f P.  ("B-band") LPS m o l e c u l e s  phosphate groups  might  aeruginosa.  a r e c r o s s - b r i d g e d through  ( t h e s e c o u l d be r e p l a c e d by c a r b o x y l g r o u p s ) 2+  in  the core  explained  (or l i p i d  A) r e g i o n s by a Mg  i n the I n t r o d u c t i o n , these  2+  ( o r Ca  ) i o n . As  cross-bridges are  believed  t o be an i m p o r t a n t  component o f OM  (Nikaido  and V a a r a ,  They a r e g e n e r a l l y s u s c e p t i b l e ,  1985).  though, t o d i s r u p t i o n indicated  i n F i g u r e 17, p a n e l A.  alternative LPS  structures  that  simplified  as t h a t  molecule  different presumably  of those  B, g e n t a m i c i n Panels  could arise  (or o v e r p r o d u c t i o n of p r o t e i n  susceptibility  LPS  by p o l y m y x i n  stability  B t o F show from  alterations in  H i ) , and t h e l i k e l y  to the three agents.  one s i t e  could possess  a n i o n i c groups.  o r EDTA as  The d i a g r a m i s  i s c o n s i d e r e d at a time, different  types  of s i t e  b u t one  for  A l s o , the s u r f a c e of a c e l l  contain a mixture  of types  of s i t e ,  with the  its would  114  F i g u r e 17. Schematic diagrams (not t o s c a l e ) o f L P S - d i v a l e n t c a t i o n b i n d i n g s i t e s i n t h e OM o f P_. a e r u g i n o s a . Each p a n e l i s a c r o s s r - s e c t i o n o f t h e OM, two LPS m o l e c u l e s i n width, i n which t h e s i t e s a r e a r r a n g e d d i f f e r e n t l y . Only r e l e v a n t atoms a r e i n d i c a t e d . The l i k e l y s u s c e p t i b i l i t i e s o f each type of s i t e t o polymyxin B (Px), g e n t a m i c i n (Gm) and EDTA a r e shown: S, s u s c e p t i b l e ; R, r e s i s t a n t ; S/R, s u s c e p t i b l e o r r e s i s t a n t . The c h a r a c t e r i s t i c s o f each type of s i t e a r e e x p l a i n e d i n t h e t e x t .  115  overall  balance  determining  initial  (permeabi1ization) B also  Panel  accessibility  has  (e.g. p o s i t i o n s (perhaps  steric  hindrance  environment A->B  polymyxin  s t e p of s e l f - p r o m o t e d  been a l t e r e d  an  with p r o t e i n  or more o f  from  susceptibility  by  a change  to  the  uptake.  in configuration  of p h o s p h a t e s u b s t i t u t i o n ) or  t o one  the  cell's  d e p i c t s a c r o s s - b r i d g e , but i t s  i n f l u e n c e d by  interaction  the  alteration HI).  or a change surrounding  elsewhere  I t may  the agents,  conformation  now  be  i n LPS,  the  charge  site.  by  less susceptible  perhaps because of i n the  or  increased  distribution  Conversion  of  of  sites  i s t h e r e f o r e a p o s s i b l e mechanism f o r r e s i s t a n c e t o B,  gentamicin  measure s i n c e t h e r e  and  i s no  EDTA.  change  T h i s would be i n LPS  difficult  composition  as  to  a 31  result  of  nuclear with  c o n v e r s i o n , but  A-J*B  magnetic  a suitable  resonance probe.  might  be  spectroscopy  (Note  t h a t the  bound no  differently  Hl-overproducing  cells.)  However, t h i s  because p r o t e i n  or by  P-  binding studies  f l u o r e s c e n t probe  dansyl-polymyxin  unlikely  d e t e c t a b l e by  t o n o r m a l and  protein  mechanism seems  Hl-overproducing  cells  have  reduced  2+  envelope Also,  Mg  concentrations  i t would be  divalent  cation-deficient  requirement  the  LPS.  for cells  Hancock,  to adapt  medium w i t h o u t  f o r t h e c a t i o n s t h a t were  In p a n e l C, by  illogical  ( N i c a s and  t o growth i n  reducing  in short  make t h e  site  resistant  their  supply.  t h e n e g a t i v e l y - c h a r g e d g r o u p has  T h i s may  1980).  been  lost  to polymyxin  B  116  and  gentamicin,  t o be  as t h e i r  affinities  c o n s i d e r a b l y reduced.  resistant  molecules,  detergents  cells  cation  probably  and  changes  i n phosphate/KDO  ratios  t o be  more  resulting  and  antibiotics  likely  interaction in  hydrophobic because p r o t e i n  unaltered s u s c e p t i b i l i t y  hydrophobic  are  to c h e l a t e .  weakened  to detergents  had  site  certain  T h i s mechanism seems u n l i k e l y  overproducing  major  LPS  susceptibility  compounds.  i s no  c o n v e r s i o n would c a u s e  between a d j a c e n t enhanced  It i s also  t o EDTA s i n c e t h e r e  However, A - » C  f o r the  to  (Hancock, 1984) ( N i c a s and  Hl-  and  no  Hancock,  1983b). P a n e l D shows t h e a n i o n i c LPS otherwise  substituted,  thus  wiping  sites out  esterfied  or  the n e g a t i v e  charge  2+  and  eliminating  has  been p r o p o s e d  typhimurium (Peterson  An E)  ion.  to  The  f o r polymyxin  between LPS  A-»D  c o n v e r s i o n mechanism  B resistance  ( V a a r a et^ a ^ . , 1981)  e_t a l . , 1 9 8 7 ) .  interaction leading  t h e Mg  and  L i k e A-^C, molecules  E_. c o l i  alternative,  however,  lateral  would p r o b a b l y  and  more a t t r a c t i v e ,  increased substitution  o f LPS  charged  s u b s t i t u e n t s (e.g. ethanolamine),  lateral  interaction on  mutants  be  weakened,  increased hydrophobic p e r m e a b i l i t y .  w o u l d be  groups  i n S.  adjacent  substituent  between p h o s p h a t e LPS  molecules.  of a n e i g h b o u r i n g  LPS  The  alteration with  (panel  positively-  resulting  in  (or c a r b o x y l ) and  amino  positively-charged  molecule  would  thus  act  as  117 a substitute stability.  f o r the c a t i o n , Conversion  three agents, gentamicin  though  A-»E  o f A-^E  might  i t is also  possible  change t o s e p a r a t e  c o n v e r s i o n may  actually  occur  s i n c e t h e y had  substituents,  although  considered  by  these workers  conversion  would be  type  s i n c e i t would p r e s u m a b l y  cell,  o f enzymes  increased  substitution  LPS.  cells  however, A->E  detected  does not (Vaara  of  detailed  oligosaccharides overproducing  and  cells,  i n t h e S.  group.  typhimurium  cationic  et a l . , 1981). unfavourable  in divalent  A->E  for a  wild-  r e q u i r e d e r e p r e s s i o n of  lipid  catalyse A m o i e t i e s of  cation-deficient  to  Such a mechanism c o u l d p r o b a b l y  be  lipid  a logical  medium,  response  chemical  a n a l y s e s of the  such  the  core  A d i s a c c h a r i d e s of p r o t e i n  although  B or  seem t o have been  the c o r e or  c o n v e r s i o n would be  polymyxin  the c a t i o n i c  (e.g. t r a n s f e r a s e s ) to  growing  of c a t i o n s . by  this  to a l l  causing a  increases in  energetically  synthesis  paucity  resistance  that  i t from  pmrA m u t a n t s ,  For  cause  c o u l d a t t a c k the a n i o n i c group,  conformational The  p r e s e r v i n g the c r o s s - b r i d g e  c h e m i s t r y may  Hl-  be  difficult. Panel is  F  i s analogous  p r o v i d e d by  a protein  model o f N i c a s and resistance B and  interaction  by  HI  Hancock  t o EDTA b u t  gentamicin  to panel  seen  protein  E except  molecule. (1980),  and  A->F can  t h e amino conversion explain  unaltered susceptibility here. Hi  S i n c e a more  (A->B  to  group i s the  the polymyxin  indirect  c o n v e r s i o n , above) i s  118  u n l i k e l y , this is probably the mechanism by which the protein acts. Based on these s i m p l i f i e d models and the available data of this thesis and other works, I postulate that P. aeruginosa c e l l s have more than one response, at the level of gene expression, to growth in divalent c a t i o n - d e f i c i e n t conditions.  Overproduction of protein HI and increased  substitution of LPS by positively-charged groups (note that there is not yet any experimental evidence for the latter) are proposed to arise from the same regulatory mechanism, which is turned on c o n s t i t u t i v e l y in H181 and H185. Together, these alterations  (conversions A->E and A->F,  Figure 17) compensate for reduced divalent cation concentrations resistant  and in doing so, create OM sites that are more  to permeabi1ization by and self-promoted uptake of  polymyxin B, gentamicin, and EDTA + T r i s .  Protein HI  overproduction alone has been shown here to contribute substantially to the creation of EDTA-res istant the other alterations resistance,  must account for the rest of the EDTA-  and the sites resistant  gentamicin.  s i t e s , while  to polymyxin B and  In P. aeruginosa mutants with shortened core  oligosaccharides,  one or more polymyxin B-susceptible sites 2+  that are protected from the drug in Mg - d e f i c i e n t w i l d type c e l l s i s / a r e resistant  lost.  The rough mutants are no more  than wild-type, though, because polymyxin B is  119  better this  able  to insert i t s l i p i d i c  way, t h e r o u g h m u t a n t s  lack  tail  i n t o t h e rough OM.  the polymyxin  B  In  resistance  2+  usually  6.  seen  i n Mg  -deficient  New p e r s p e c t i v e s Hancock  cells.  on s e l f - p r o m o t e d  (1984) has p r o p o s e d  uptake  that  a v a r i e t y of 2+  polycatxons, use  chelators,  the self-promoted  various  host  killing  o f an o u t e r  overproduction  of a p r o t e i n  can i n h i b i t  species  with  size  there  membrane p r o t e i n , provides  i t has been  Hi.  uptake.  cation-regulated  may be c o u n t e r p a r t s  to protein  P.  No p r o t e i n s i n but the  envelope p r o t e i n s of  f r o m ]?. c h l o r a p h i s ,  HI) i n r e l a t e d s p e c i e s  So,  a mechanism by w h i c h  self-promoted  (one o f w h i c h ,  protein  t h e OM o f  study,  a r e known t o do t h e same t h i n g ,  presence of divalent similar  In t h i s  + DNA  by EDTA a t l e a s t c a n be r e d u c e d by  overproduction  aeruginosa  f a c t o r s and Ca  pathway o f u p t a k e a c r o s s  Gram-negative b a c t e r i a .  shown t h a t  other  defence  of b a c t e r i a Hi that  cross-reacted suggests  that  a r e not y e t  characterized. I have a l s o addition inhibit the  that  of c a t i o n i c substituents self-promoted  isolation  polycations 1984;  speculated  uptake.  a l t e r a t i o n i n LPS, i n v o l v i n g to the core  This  Galbraith  A, c a n  would be c o n s i s t e n t  o f c e r t a i n P. a e r u g i n o s a  that  or l i p i d  mutants  d i s p l a y LPS a l t e r a t i o n s  (e.g.  e t a l . , 1 9 8 4 ) , and may a l s o  with  r e s i s t a n t to Bryan  e_t a l . ,  be a common  120  mechanism for  this  i n other proposed  overproducing  species. "second  cells  generalizations.  should  However, e x p e r i m e n t a l  alteration" precede  any  evidence  in protein Hlfurther  121  LITERATURE  CITED  Anwar, H., M.R.W. Brown, A. Day, and P.H. W e l l e r . 1984. O u t e r membrane a n t i g e n s o f mucoid Pseudomonas a e r u g i n o s a i s o l a t e d d i r e c t l y f r o m t h e sputum o f a c y s t i c f i b r o s i s p a t i e n t . FEMS M i c r o b i o l . L e t t . 2_4: 235-239. A t k i n s o n , T., and M. S m i t h . 1984. S o l i d p h a s e s y n t h e s i s o f oligodeoxynucleotides by t h e p h o s p h i t e t r i e s t e r method, p. 35-81. Iji M.J. G a i t ( e d . ) , O l i g o n u c l e o t i d e s y n t h e s i s : A p r a c t i c a l a p p r o a c h . IRL P r e s s , O x f o r d . B a l l a n d , A., M. C o u r t n e y , S. J a l l a t , L.-H. T e s s i e r , P. S o n d e r m e y e r , H. De La S a l l e , R. H a r v e y , E . D e g r y s e , and P. T o l s t o s h e v . 1985. Use o f s y n t h e t i c o l i g o n u c l e o t i d e s i n gene i s o l a t i o n and m a n i p u l a t i o n . B i o c h i m i e 6J_: 725-736. B e h e r , M., A. P u g s l e y , and C. S c h n a i t m a n . 1980. C o r r e l a t i o n between t h e e x p r e s s i o n o f an E s c h e r i c h i a c o l i c e l l s u r f a c e p r o t e i n and t h e a b i l i t y o f t h e p r o t e i n t o b i n d t o l i p o p o l y s a c c h a r i d e . J . B a c t e r i o l . 143: 403-410. B e r r y , D., and A.M. K r o p i n s k i . 1986. E f f e c t o f l i p o p o l y s a c c h a r i d e m u t a t i o n s and t e m p e r a t u r e on p l a s m i d t r a n s f o r m a t i o n e f f i c i e n c y i n Pseudomonas a e r u g i n o s a . C a n . J . M i c r o b i o l . 32: 436-438. B i g g i n , M.D., T . J . G i b s o n , and G.F. Hong. 1983. B u f f e r g r a d i e n t g e l s and ? S l a b e l as an a i d t o r a p i d DNA sequence d e t e r m i n a t i o n . P r o c . N a t l . A c a d . S c i . USA 80: 3963-3965. 3  B l a s e r , J . , and R. L u e t h y . 1988. C o m p a r a t i v e s t u d y on a n t a g o n i s t i c e f f e c t s o f low pH and c a t i o n s u p p l e m e n t a t i o n on i n - v i t r o a c t i v i t y o f q u i n o l o n e s and a m i n o g l y c o s i d e s a g a i n s t Pseudomonas a e r u g i n o s a . J . A n t i m i c r o b . C h e m o t h e r . 22 : 15-22. B o r n e l e i t , P., B l e c h s c h m i d t . , B., and H.-P. K l e b e r . 1989. I n t e r a c t i o n between l i p o p o l y s a c c h a r i d e and o u t e r membrane p r o t e i n s o f A c i n e t o b a c t e r c a l c o a c e t i c u s s t u d i e d by. an a f f i n i t y e l e c t r o p h o r e s i s s y s t e m . E l e c t r o p h o r e s i s 10: 234-237. B o t z e n h a r t , K., and H. Rueden. 1987. H o s p i t a l i n f e c t i o n s c a u s e d by Pseudomonas a e r u g i n o s a . p . 1-15. I_n_ G. D o e r i n g , I.A. H o l d e r , and K. B o t z e n h a r t ( e d . ) , B a s i c r e s e a r c h and c l i n i c a l a s p e c t s o f Pseudomonas a e r u g i n o s a . K a r g e r , B a s l e .  122 B r y a n , L . E . , K. O'Hara, and S. Wong. 1984. L i p o p o l y s a c c h a r i d e changes i n i m p e r m e a b i l i t y - t y p e a m i n o g l y c o s i d e r e s i s t a n c e i n Pseudomonas a e r u g i n o s a . A n t i m i c r o b . Ag. Chemother. 26: 250-255. C a r l s o n , A.,  and  J . Messing.  1984.  J . B i o t e c h n o l . 1_:  253.  Chapman, J . S . , and N.H. G e o r g o p a p a d a k o u . 1988. R o u t e s o f quinolone permeation in E s c h e r i c h i a c o l i . A n t i m i c r o b . C h e m o t h e r . 3_2: 438-442.  Ag.  C o r n e l l s , P., A. B o u i a , A. B e l a r b i , A. G u y o n v a r c h , B. Kammerer, V. H a n n a e r t , and J . C . H u b e r t . 1989. C l o n i n g and a n a l y s i s o f t h e gene f o r t h e major o u t e r membrane l i p o p r o t e i n f r o m Pseudomonas a e r u g i n o s a . M o l . M i c r o b i o l . 3_: 421-428. D a l h o f f , A. 1987. P l e i o t r o p i c a c t i o n s o f a m i n o g l y c o s i d e s , p. 182-204. I_n G. D o e r i n g , I.A. H o l d e r , and K. B o t z e n h a r t ( e d . ) , B a s i c r e s e a r c h and c l i n i c a l a s p e c t s o f Pseudomonas aeruginosa. Karger, Basle. D e n t e , L., G. C e s a r i n i , and R. C o r t e s e . 1983. pEMBL: a new f a m i l y o f s i n g l e s t r a n d e d p l a s m i d s . N u c l e i c A c i d s Res. 11: 1645-1655. D e r e t i c , V., J . F . G i l l , and A.M. C h a k r a b a r t y . 1987. A l i g i n a t e b i o s y n t h e s i s : a model s y s t e m f o r gene r e g u l a t i o n and f u n c t i o n i n Pseudomonas. B i o / t e c h n o l . 5: 469-477. D i t t a , G., T. S c h m i d h a u s e r , E. Y a k o b s o n , P. Lu, X.-W Liang, D.R. F i n l a y , D. G u i n e y , and D.R. H e l i n s k i . 1985. Plasmids r e l a t e d t o t h e b r o a d h o s t r a n g e v e c t o r , pRK290, u s e f u l f o r gene c l o n i n g and f o r m o n i t o r i n g gene e x p r e s s i o n . P l a s m i d 13_: 149-153. D o e r i n g , G., M. M a i e r , E. M u e l l e r , Z. B i b i , B. Tuemmler, and A. K h a r a z m i . 1987. V i r u l e n c e f a c t o r s o f Pseudomonas a e r u g i n o s a . p. 136-148. I_n G. D o e r i n g , I.A. H o l d e r , and K. B o t z e n h a r t ( e d . ) , B a s i c r e s e a r c h and c l i n i c a l a s p e c t s o f Pseudomonas a e r u g i n o s a . K a r g e r , B a s l e . D o o l i t t l e , R.F. 1986. Of URFs and ORFs: a p r i m e r on how t o a n a l y z e d e r i v e d amino a c i d s e q u e n c e s . U n i v e r s i t y S c i e n c e Books, M i l l V a l l e y , C a l i f o r n i a . Duchene, M., A. S c h w e i z e r , F. L o t t s p e i c h , G. K r a u s s , M. M a r g e t , K. V o g e l , B.-E. von S p e c h t , and H. Domdey. 1988. S e q u e n c e and t r a n s c r i p t i o n a l s t a r t s i t e o f t h e Pseudomonas a e r u g i n o s a o u t e r membrane p o r i n p r o t e i n F gene. J . B a c t e r i d . 170: 155-162.  123  E a g o n , R.G., and P.V. P h i b b s J r . 1971. K i n e t i c s o f t r a n s p o r t o f g l u c o s e , f r u c t o s e , and m a n n i t o l by Pseudomonas a e r u g i n o s a . Can. J . B i o c h e m . 4_9_: 1031-1041. E p s t e i n , W. 1983. Membrane-mediated r e g u l a t i o n of gene e x p r e s s i o n i n b a c t e r i a , p. 281-292 . I_n J . B e c k w i t h , J . D a v i e s , and J.A. G a l l a n t ( e d . ) , Gene f u n c t i o n i n prokaryotes. C o l d S p r i n g Harbor L a b o r a t o r y , C o l d S p r i n g H a r b o r , New York. F e i n b e r g , A.P., and B. V o g e l s t e i n . 1983. A t e c h n i q u e f o r r a d i o l a b e l i n g DNA r e s t r i c t i o n e n d o n u c l e a s e fragments to h i g h s p e c i f i c a c t i v i t y . A n a l . B i o c h e m . 132: 6-13. F i g u r s k i , D.H., and D.R. H e l i n s k i . 1979. R e p l i c a t i o n o f an o r i g i n - c o n t a i n i n g d e r i v a t i v e o f p l a s m i d RK2 d e p e n d e n t on a p l a s m i d f u n c t i o n provided i n t r a n s . P r o c . N a t l . Acad. S c i USA 7_6: 1648-1652. F r i e d m a n , A.M., S.R. Long, S.E. Brown, W.J. Buikema, and F.M. A u s u b e l . 1982. C o n s t r u c t i o n o f a b r o a d h o s t r a n g e c o s m i d c l o n i n g v e c t o r and i t s use i n t h e g e n e t i c a n a l y s i s o f R h i z o b i u m m u t a n t s . Gene lj8_: 289-296. G a b r i e l , 0. 1987. B i o s y n t h e s i s o f s u g a r r e s i d u e s f o r glycogen, peptidoglycan, l i p o p o l y s a c c h a r i d e , and r e l a t e d s y s t e m s , p. 504-511. I_n F.C. N e i d h a r d t ( e d . ) , E s c h e r i c h i a c o l i and S a l m o n e l l a t y p h i m u r i u m : C e l l u l a r and m o l e c u l a r b i o l o g y . American S o c i e t y f o r M i c r o b i o l o g y , Washington, D.C. G a l b r a i t h , L., S.G. W i l k i n s o n , N.J. L e g a k i s , V. G e n i m a t a , T.S. K a t s o r c h i s , and E.T. R i e t s c h e l . 1984. Structural a l t e r a t i o n s i n the envelope of a g e n t a m i c i n - r e s i s t a n t r o u g h mutant o f Pseudomonas a e r u g i n o s a . Ann. M i c r o b i o l . ( I n s t . P a s t e u r ) 135B: 121-136. G a m i e r , J . , D.J. O s g u t h o r p e , and B. R o b s o n . 1978. Analysis o f t h e a c c u r a c y and i m p l i c a t i o n s o f s i m p l e methods f o r p r e d i c t i n g the secondary s t r u c t u r e of g l o b u l a r p r o t e i n s . J . M o l . B i o l . 120: 97-120. G i l b e r t , D.N., 1985. An e v a l u a t i o n o f a n t i p s e u d o m o n a l a n t i m i c r o b i c a g e n t s , p. 111-133. I_n D.P. S p e e r t and R.E. W. Hancock ( e d . ) , Pseudomonas a e r u g i n o s a : New therapeutic approaches from b a s i c r e s e a r c h . K a r g e r , B a s l e .  124  G i l l e l a n d , H.E., J r . , F.R. C h a m p l i n , and R.S'. C o n r a d . 1984. C h e m i c a l a l t e r a t i o n s i n c e l l e n v e l o p e s o f Pseudomonas a e r u g i n o s a upon e x p o s u r e t o p o l y m y x i n : a p o s s i b l e mechanism t o e x p l a i n a d a p t i v e r e s i s t a n c e t o p o l y m y x i n . Can. J . M i c r o b i o l . 30: 869-873. G i l l e l a n d , H.E., J r . , and R.S. C o n r a d . 1982. C h e m i c a l a l t e r a t i o n s i n c e l l envelopes of p o l y m y x i n - r e s i s t a n t m u t a n t s o f Pseudomonas a e r u g i n o s a grown i n t h e a b s e n c e o r p r e s e n c e o f p o l y m y x i n . A n t i m i c r o b . A g . C h e m o t h e r . 22: 1012-1016. G i l l e l a n d , H.E., J r . , J.D. S t i n n e t t , I . L . R o t h , and R.G. E a g o n . 1973. F r e e z e - e t c h s t u d y o f Pseudomonas a e r u g i n o s a : L o c a l i z a t i o n w i t h i n t h e c e l l w a l l o f an e t h y l e n e d i a m i n e t e t r a a c e t a t e - e x t r a c t a b l e component. J . B a c t e r i d . 113: 417-432. G o l d b e r g , J . B . , and D.E. Ohman. 1984. C l o n i n g and e x p r e s s i o n i n Pseudomonas a e r u g i n o s a o f a gene i n v o l v e d i n t h e p r o d u c t i o n o f a l g i n a t e . J . B a c t e r i o l . 158: 1115-1121. G r a y , G.L., D.H. S m i t h , J . S . B a l d r i d g e , R.N. H a r k i n s , M.L. V a s i l , E.Y Chen., and H.L. H e y n e k e r . 1984. C l o n i n g , n u c l e o t i d e s e q u e n c e , and e x p r e s s i o n i n E s c h e r i c h i a c o l i o f t h e e x t o x i n A s t r u c t u r a l gene o f Pseudomonas a e r u g i n o s a . P r o c . N a t l . A c a d . S c i . USA 8_1 : 2645-2649. H a n c o c k , R.E.W. 1981a. A m i n o g l y c o s i d e u p t a k e and mode o f a c t i o n - w i t h s p e c i a l r e f e r e n c e t o s t r e p t o m y c i n and g e n t a m i c i n : I . a n t a g o n i s t s and m u t a n t s . J . A n t i m i c r o b . C h e m o t h e r . 8_: 249-276. Hancock, R.E.W. 1981b. A m i n o g l y c o s i d e u p t a k e and mode o f a c t i o n - w i t h s p e c i a l r e f e r e n c e t o s t r e p t o m y c i n and g e n t a m i c i n : I I . e f f e c t s o f a m i n o g l y c o s i d e s on c e l l s . J . A n t i m i c r o b . Chemother. 8_: 429-445.. H a n c o c k , R.E.W. 1984. A l t e r a t i o n s i n o u t e r membrane p e r m e a b i l i t y . Annu. Rev. M i c r o b i o l . 3_8_: 237-264. H a n c o c k , R.E.W. 1985. The r o l e o f t h e c e l l s u r f a c e components of Pseudomonas a e r u g i n o s a i n v i r u l e n c e , p . 247-256. I_n G.G. J a c k s o n and H. Thomas ( e d . ) , The p a t h o g e n e s i s o f bacterial infections. Springer-Verlag, Berlin. H a n c o c k , R.E.W., and A. B e l l . 1988. A n t i b i o t i c u p t a k e i n t o Gram-negative b a c t e r i a . Eur. J . C l i n . M i c r o b i o l . I n f e c t . Dis. 7: 713-720.  125 H a n c o c k , R.E.W., and A.M. C a r e y . 1979. O u t e r membrane o f Pseudomonas a e r u g i n o s a : H e a t - and 2 - m e r c a p t o e t h a n o l m o d i f i a b l e p r o t e i n s . J . B a c t e r i o l . 140; 902-910. H a n c o c k , R.E.W., and A.M. C a r e y . 1980. P r o t e i n D l - a g l u c o s e - i n d u e i b l e , pore-forming p r o t e i n from the outer membrane o f Pseudomonas a e r u g i n o s a . FEMS M i c r o b i o l . L e t t . £ : 105-109. Hancock, R.E.W., G.M. D e c a d , and H. N i k a i d o . 1979. I d e n t i f i c a t i o n o f t h e p r o t e i n p r o d u c i n g transmembrane d i f f u s i o n p o r e s i n t h e o u t e r membrane o f Pseudomonas a e r u g i n o s a P A O l . B i o c h e m . B i o p h y s . A c t a 554 ; 323-331. Hancock, R.E.W., R.T. I r v i n , J.W. C o s t e r t o n , and A.M. C a r e y . 1981a. Pseudomonas a e r u g i n o s a o u t e r membrane: p e p t i d o g l y c a n - a s s o c i a t e d p r o t e i n s . J . B a c t e r i o l . 14 5: 628-631. Hancock, R.E.W., E.C.A. Mouat, and D.P. S p e e r t . 1984. Q u a n t i t a t i o n and i d e n t i f i c a t i o n o f outer-membrane p r o t e i n s of Pseudomonas a e r u g i n o s a i n s e r a o f p a t i e n t s w i t h c y s t i c f i b r o s i s . J . I n f e c t . D i s . 1 4 9 : 220-226. Hancock, R.E.W., L.M. M u t h a r i a , L . Chan, R.P. D a r v e a u , D.P. S p e e r t , and G.B. P i e r . 1983. Pseudomonas a e r u g i n o s a i s o l a t e s from p a t i e n t s w i t h c y s t i c f i b r o s i s : A c l a s s o f serum-sensitive, nontypable s t r a i n s d e f i c i e n t i n l i p o p o l y s a c c h a r i d e 0 s i d e c h a i n s . I n f e c t . Immun. 42: 170-177. Hancock, R.E.W., and T . I . N i c a s . 1984. R e s i s t a n c e t o a n t i b a c t e r i a l a g e n t s a c t i n g on c e l l membranes, p . 147-171. In L . E . B r y a n ( e d . ) , A n t i m i c r o b i a l d r u g r e s i s t a n c e . Academic P r e s s , I n c . , Orlando, F l o r i d a . H a n c o c k , R.E.W., K. P o o l e , and R. B e n z . 1 9 8 2 a . O u t e r membrane p r o t e i n P o f Pseudomonas a e r u g i n o s a : r e g u l a t i o n by p h o s p h a t e d e f i c i e n c y and f o r m a t i o n o f s m a l l a n i o n - s p e c i f i c c h a n n e l s i n l i p i d b i l a y e r membranes. J . B a c t e r i o l . 150: 730-738. Hancock, R.E.W., V . J . R a f f l e , and T . I . N i c a s . 1981b. I n v o l v e m e n t o f t h e o u t e r membrane i n g e n t a m i c i n and s t r e p t o m y c i n u p t a k e and k i l l i n g i n Pseudomonas a e r u g i n o s a . A n t i m i c r o b . Ag. Chemother, 19_: 777-785. Hancock, R.E.W., A.A. W i e c z o r e k , L.M. M u t h a r i a , and K. P o o l e . 1982b. M o n o c l o n a l a n t i b o d i e s a g a i n s t Pseudomonas a e r u g i n o s a o u t e r membrane a n t i g e n s : I s o l a t i o n and characterization. I n f e c t . Immun. 37: 166-171.  126  Hancock, R.E.W., and P.G.W. Wong. 1984. Compounds w h i c h i n c r e a s e t h e p e r m e a b i l i t y o f t h e Pseudomonas a e r u g i n o s a o u t e r membrane. A n t i m i c r o b . A g . C h e m o t h e r . 2_6: 48-52. H e l f m a n , D.M., J.R. F e r a m i s c o , J . C . F i d d e s , G.P. Thomas, and S.H. Hughes. 1983. I d e n t i f i c a t i o n o f c l o n e s t h a t encode c h i c k e n t r o p o m y o s i n by d i r e c t i m m u n o l o g i c a l s c r e e n i n g o f a cDNA e x p r e s s i o n l i b r a r y . P r o c . N a t l . A c a d . S c i . USA. 80: 31-35. H j e l m e l a n d , L.M., and A. Chrambach. 1984. S o l u b i l i z a t i o n o f f u n c t i o n a l membrane p r o t e i n s . M e t h . E n z y m o l . 104: 305-318. Holmes, D.S., and M. Q u i g l e y . 1 9 8 1 . A r a p i d b o i l i n g for thepreparation of b a c t e r i a l plasmids. Anal. 114: 193-197.  method Biochem.  I n o u y e , M. 1979. What i s t h e o u t e r membrane? p . 1-12. I_n_ M. Inouye ( e d . ) , B a c t e r i a l o u t e r membranes: b i o g e n e s i s and f u n c t i o n s . W i l e y - I n t e r s c i e n c e , New Y o r k . J o n e s , R.B., P.A. J e m i s o n , W.J. N e w h a l l V, and R.A. Haak. 1980. R e s o l u t i o n o f b a s i c g o n o c o c c a l o u t e r membrane p r o t e i n s by n o n e q u i 1 i b r i u m pH g r a d i e n t e l e c t r o p h o r e s i s . I n f e c t . Immun. 30_: 773-780. K e l l y , N.M., J . L . B a t t e r s h i l l , S. Kuo, J . P . A r b u t h n o t t , and R.E.W. H a n c o c k . 1987. C o l o n i a l d i s s o c i a t i o n and s u s c e p t i b i l i t y t o p h a g o c y t o s i s o f Pseudomonas a e r u g i n o s a grown i n a chamber i m p l a n t model i n m i c e . I n f e c t . Immun. 55: 2841-2843. K e l l y , N.M., A. B e l l , and R.E.W. Hancock. 1989. S u r f a c e c h a r a c t e r i s t i c s o f Pseudomonas a e r u g i n o s a grown i n a chamber i m p l a n t model i n m i c e and r a t s . I n f e c t . Immun. 57: 344-350. K n i r e l , Y.A., E.V. V i n o g r a d o v , N.A. K o c h a r o v a , N.A. Paramonov, N.K. K o t c h e t k o v , B.A. D m i t r i e v , E.S. S t a n i s l a v s k y , and B. L a n y i . 1988. The s t r u c t u r e o f 0s p e c i f i c p o l y s a c c h a r i d e s and s e r o l o g i c a l c l a s s i f i c a t i o n o f Pseudomonas a e r u g i n o s a . A c t a M i c r o b i o l . Hungar. _35_: 3-24. K r o p i n s k i , A.M., L.C. Chan, and F.H. M i l a z z o . 1979. The e x t r a c t i o n and a n a l y s i s o f 1 i p o p o l y s a c c h a r i d e s f r o m Pseudomonas a e r u g i n o s a s t r a i n PAO, and t h r e e r o u g h m u t a n t s . C a n . J . M i c r o b i o l . 2 5 : 390-398.  127  K r o p i n s k i , A.M., B. J e w e l l , J . K u z i o , F. M i l a z z o , and D. B e r r y . 1 9 8 5 . S t r u c t u r e and f u n c t i o n s o f Pseudomonas a e r u g i n o s a l i p o p o l y s a c c h a r i d e . p . 58-73 . I_n D.P. S p e e r t and R.E.W. Hancock ( e d . ) , Pseudomonas a e r u g i n o s a : New t h e r a p e u t i c a p p r o a c h e s from b a s i c r e s e a r c h . K a r g e r , B a s l e . K r o p i n s k i , A.M.B., V. L e w i s , and D. B e r r y . 1 9 8 7 . E f f e c t o f g r o w t h t e m p e r a t u r e on t h e l i p i d s , o u t e r membrane p r o t e i n s , and 1 i p o p o l y s a c c h a r i d e s o f Pseudomonas a e r u g i n o s a PAO. J . B a c t e r i o l . 169: 1960-1966. K y t e , J . , and R.F. D o o l i t t l e . d i s p l a y i n g the hydropathic B i o l . 1^7: 1 0 5 - 1 3 2 .  1982. A s i m p l e method f o r character of a protein. J . Mol.  Lam, J . S . , L.M. M u t h a r i a , R.E.W. Hancock, N. Hefiby, K. Lam, L. Baek, and J.W. C o s t e r t o n . 1 9 8 3 . I m m u n o g e n i c i t y o f Pseudomonas a e r u g i n o s a o u t e r membrane a n t i g e n s examined by c r o s s e d immunoelect r o p h o r e s i s . I n f e c t . Immun. 4_2_: 8 8 - 9 8 . L a m b e r t , P.A., and B.R. B o o t h . 1 9 8 2 . E x p o s u r e o f o u t e r membrane p r o t e i n s on t h e s u r f a c e o f Pseudomonas a e r u g i n o s a PAOl r e v e a l e d by l a b e l l i n g w i t h [ I ] lactoperoxidase. FEMS M i c r o b i o l . L e t t . 14_: 4 3 - 4 5 . 1 2 5  L a n d i c k , R., and C. Y a n o f s k y . 1 9 8 7 . T r a n s c r i p t i o n a t t e n u a t i o n , p . 1 2 7 6 - 1 3 0 1 . I_n F.C. N e i d h a r d t ( e d . ) , E s c h e r i c h i a c o l i and Salmone11a t y p h i m u r i u m : c e l l u l a r and m o l e c u l a r b i o l o g y . American S o c i e t y f o r M i c r o b i o l o g y , W a s h i n g t o n , D.C. L a t h e , R. 1 9 8 5 . S y n t h e t i c d i g o n u c l e o t i d e p r o b e s deduced amino a c i d s e q u e n c e d a t a : t h e o r e t i c a l and p r a c t i c a l c o n s i d e r a t i o n s . J . M o l . B i o l . 183: 1 - 1 2 .  from  L i p s o n , K.E., A.A. K o l h a t k a r , R.G. M a k i , and D.B. Donner. 1988. D i v a l e n t c a t i o n s r e g u l a t e glucagon b i n d i n g . Evidence f o r a c t i o n s on r e c e p t o r - N c o m p l e x e s and on r e c e p t o r s u n c o u p l e d f r o m N . B i o c h e m . 2J7_: 1 1 1 1 - 1 1 1 6 . s  g  L o h , B., C. G r a n t , and R.E.W. H a n c o c k . 1 9 8 4 . Use o f t h e f l u o r e s c e n t probe l-N_-phenylnapthylamine t o study the i n t e r a c t i o n s of aminoglycoside a n t i b i o t i c s with the outer membrane o f Pseudomonas a e r u g i n o s a . A n t i m i c r o b . A g . C h e m o t h e r . 2_6: 5 4 6 - 5 5 1 . L u g t e n b e r g , D., and L. Van A l p h e n . 1 9 8 3 . M o l e c u l a r a r c h i t e c t u r e and f u n c t i o n i n g o f t h e o u t e r membrane o f E s c h e r i c h i a c o 1 i and o t h e r G r a m - n e g a t i v e b a c t e r i a . B i o c h i m . B i o p h y s . A c t a 737: 5 1 - 1 1 5 .  <•  128  L u n d b l a d , R.L., and C M . Noyes. 1984. The c h e m i c a l c r o s s l i n k i n g o f p e p t i d e c h a i n s , p . 123-139. I n C h e m i c a l r e a g e n t s f o r p r o t e i n m o d i f i c a t i o n , volume I I . CRC P r e s s , I n c . , Boca R a t o n , F l o r i d a . M a k e l a , P.H., N. S a r v a s , S. C a l c a g n o , and K. Lounatmaa. 1978. I s o l a t i o n and g e n e t i c c h a r a c t e r i z a t i o n o f p o l y m y x i n r e s i s t a n t m u t a n t s o f S a l m o n e l l a . FEMS M i c r o b i o l . L e t t . 3_: 323-326. M a n i a t i s , T., E . F . F r i t s c h , and J . Sambrook. 1982. M o l e c u l a r c l o n i n g : A l a b o r a t o r y manual. Cold S p r i n g Harbor L a b o r a t o r y , C o l d S p r i n g H a r b o r , New Y o r k . M a r t i n , N.L., and T . J . B e v e r i d g e . 1986. G e n t a m i c i n i n t e r a c t i o n w i t h Pseudomonas a e r u g i n o s a c e l l envelope. A n t i m i c r o b . A g . C h e m o t h e r . 2_9_: 1079-1087. Mermod, N., J . L . Ramos, P.R. L e h r b a c h , and K.N. Timmis. 1986. V e c t o r f o r r e g u l a t e d e x p r e s s i o n o f c l o n e d genes i n a w i d e r a n g e o f G r a m - n e g a t i v e b a c t e r i a . J . B a c t e r i o l . 167: 447-454. M e y e r s , E . , W.L. P a r k e r , and W.E. Brown. 1974. EM49: A new p o l y p e p t i d e a n t i b i o t i c a c t i v e a g a i n s t c e l l membranes. Ann. N.Y. A c a d . S c i . 235: 493-501. M i g u e z , C.B., T . J . B e v e r i d g e , and J.M. Ingram. 1986. L i p o p o l y s a c c h a r i d e c h a n g e s and c y t o p l a s m i c polyphosphate g r a n u l e a c c u m u l a t i o n i n Pseudomonas a e r u g i n o s a d u r i n g g r o w t h on h e x a d e c a n e . C a n . J . M i c r o b i o l . 3_2_: 248-253. M i z u n o , T., and M. Kageyama. 1978. S e p a r a t i o n and c h a r a c t e r i z a t i o n o f t h e o u t e r membrane o f Pseudomonas a e r u g i n o s a . J . B i o c h e m . 8_4: 179-191. M i z u n o , T., and M. Kageyama. 1979a. I s o l a t i o n and c h a r a c t e r i z a t i o n o f a m a j o r o u t e r membrane p r o t e i n o f Pseudomonas a e r u g i n o s a : e v i d e n c e f o r t h e o c c u r r e n c e o f a l i p o p r o t e i n . J . B i o c h e m . 8_5_: 115-122. M i z u n o , T., and M. Kageyama. 1979b. I s o l a t i o n and c h a r a c t e r i z a t i o n o f m a j o r o u t e r membrane p r o t e i n s o f Pseudomonas a e r u g i n o s a s t r a i n PAO w i t h s p e c i a l r e f e r e n c e to p e p t i d o g l y c a n - a s s o c i a t e d p r o t e i n . J . B i o c h e m . 86: 979-989. Moore, R.A., N.C. B a t e s , and R.E.W. H a n c o c k . 1986. I n t e r a c t i o n o f p o l y c a t i o n i c a n t i b i o t i c s w i t h Pseudomonas a e r u g i n o s a 1 i p o p o l y s a c c h a r i d e and l i p i d A s t u d i e d by u s i n g d a n s y l - p o l y m y x i n . A n t i m i c r o b . Ag. C h e m o t h e r . 2_9: 496-500.  129  Moore, R.A., L. Chan, and R.E.W. H a n c o c k . 1984. E v i d e n c e f o r two d i s t i n c t mechanisms o f r e s i s t a n c e t o p o l y m y x i n B i n Pseudomonas a e r u g i n o s a . A n t i m i c r o b . A g . C h e m o t h e r . 26: 539-545. M u t h a r i a , L.M., and R.E.W. Hancock. 1983. S u r f a c e l o c a l i z a t i o n o f Pseudomonas a e r u g i n o s a o u t e r membrane p o r i n p r o t e i n F by u s i n g monoclonal a n t i b o d i e s . I n f e c t . Immun. 4_2_: 1027-1033. M u t h a r i a , L.M., T . I . N i c a s , and R.E.W. H a n c o c k . 1982. O u t e r membrane p r o t e i n s o f Pseudomonas a e r u g i n o s a s e r o t y p e s t r a i n s . J . I n f e c t . D i s . 1 4 6 : 770-779. Nakae, R., and T. Nakae. 1982. D i f f u s i o n o f a m i n o g l y c o s i d e a n t i b i o t i c s a c r o s s t h e o u t e r membrane o f E s c h e r i c h i a c o l i . A n t i m i c r o b . A g . Chemother. 2_2_: 554-559. Nakazawa, T., and S. I n o u y e . 1986. C l o n i n g o f Pseudomonas g e n e s i n E s c h e r i c h i a c o l i . p . 357-382 . I_n J.R. S o k a t c h ( e d . ) , The b a c t e r i a , volume X. A c a d e m i c P r e s s , O r l a n d o , Florida. Newton, B.A. 1954. S i t e o f a c t i o n o f p o l y m y x i n on Pseudomonas a e r u g i n o s a : A n t a g o n i s m by c a t i o n s . J . Gen. M i c r o b i o l . 10: 491-499. Newton, B.A. 1955. A f l u o r e s c e n t d e r i v a t i v e o f p o l y m y x i n : I t s p r e p a r a t i o n and u s e i n s t u d y i n g t h e s i t e o f a c t i o n o f t h e a n t i b i o t i c . J . Gen. M i c r o b i o l . 12^: 226-236. N i c a s , T . I . , and R.E.W. H a n c o c k . 1980. O u t e r membrane p r o t e i n HI o f Pseudomonas a e r u g i n o s a : i n v o l v e m e n t i n a d a p t i v e and mutational resistance to ethylenediaminetetraacetate, p o l y m y x i n B, and g e n t a m i c i n . J . B a c t e r i o l . 143: 872-878. N i c a s , T . I . , and R.E.W. H a n c o c k . 1983a. Pseudomonas a e r u g i n o s a o u t e r membrane p e r m e a b i l i t y : i s o l a t i o n o f a p o r i n p r o t e i n F - d e f i c i e n t m u t a n t . J . B a c t e r i o l . 153: 281-285 . N i c a s , T . I . , and R.E.W. H a n c o c k . 1983b. A l t e r a t i o n o f s u s c e p t i b i l i t y t o EDTA, p o l y m y x i n B and g e n t a m i c i n i n Pseudomonas a e r u g i n o s a by d i v a l e n t c a t i o n r e g u l a t i o n o f o u t e r membrane p r o t e i n H i . J . Gen. M i c r o b i o l . 129: 509-517. N i k a i d o , H., and R.E.W. Hancock. 1986. O u t e r membrane p e r m e a b i l i t y o f Pseudomonas a e r u g i n o s a . p . 145-193. Ijn J.R. S o k a t c h ( e d . ) . The b a c t e r i a , volume X. A c a d e m i c Press, Inc., Orlando, F l o r i d a .  130 Nikaido, outer  H., and M. V a a r a . 1985. M o l e c u l a r b a s i s o f b a c t e r i a l membrane p e r m e a b i l i t y . M i c r o b i o l . Rev. 4_9_: 1-32.  O ' F a r r e l l , P.H. 1975. H i g h r e s o l u t i o n t w o - d i m e n s i o n a l e l e c t r o p h o r e s i s o f p r o t e i n s . J . B i o l . Chem. 250: 4007-4021. P a l l e r o n i , N . J . 1975. G e n e r a l p r o p e r t i e s and taxonomy o f t h e genus Pseudomonas. p . 1-36. I_n P.H. C l a r k e and M.H. Richmond ( e d . ) , G e n e t i c s and b i o c h e m i s t r y o f Pseudomonas. J o h n W i l e y & S o n s , London. P a l l e r o n i , N . J . 1981. I n t r o d u c t i o n t o t h e F a m i l y Pseudomonadaceae. p. 655-665. I_n M.P. S t a r r , H. S t o l p , H.G. T r u e p e r , A. B a l o w s , and H.G. S c h l e g e l ( e d . ) , The p r o k a r y o t e s : A handbook on h a b i t a t s , i s o l a t i o n , and i d e n t i f i c a t i o n of b a c t e r i a . Springer-Verlag, B e r l i n . P a r r , T.R., J r . , K. P o o l e , G.W.K. C r o c k f o r d , and R.E.W. H a n c o c k . 1986. L i p o p o l y s a c c h a r i d e - f r e e E s c h e r i c h i a c o l i OmpF and Pseudomonas a e r u g i n o s a p r o t e i n P p o r i n s a r e f u n c t i o n a l l y a c t i v e i n l i p i d b i l a y e r membranes. J . B a c t e r i o l . 165: 523-526. P a u l , C , and J . P . R o s e n b u s c h . 1985. F o l d i n g p a t t e r n s o f p o r i n and b a c t e r i o h o d o p s i n . EMBO J . 4_: 1593-1597. P e a r s o n , W.R., and D . J . L i p m a n . 1988.'Improved t o o l s f o r b i o l o g i c a l s e q u e n c e c o m p a r i s o n . P r o c . N a t l . A c a d . S c i . USA 85: 2444-2448. P e t e r s o n , A.A., S.W. F e s i k , and E . J . M c G r o a r t y . 1987. Decreased binding of a n t i b i o t i c s t o 1ipopolysaccharides f r o m p o l y m y x i n - r e s i s t a n t s t r a i n s o f E s c h e r i c h i a c o l i and S a l m o n e l l a t y p h i m u r i u m . A n t i m i c r o b . A g . Chemother. 31: 230-237. P e t e r s o n , A.A., R.E.W. Hancock, and E . J . M c G r o a r t y . 1985. B i n d i n g o f p o l y c a t i o n i c a n t i b i o t i c s and p o l y a m i n e s t o 1 i p o p o l y s a c c h a r i d e s o f Pseudomonas a e r u g i n o s a . J . B a c t e r i o l . 164: 1256-1261. P o o l e , K. , and R.E.W. Hancock. 1986. I s o l a t i o n o f a Tn501 i n s e r t i o n mutant l a c k i n g p o r i n p r o t e i n P o f Pseudomonas a e r u g i n o s a . M o l . Gen. G e n e t . 202 : 403-409. P o x t o n , I.R., G.T. B e l l , and G.R. B a r c l a y . 1985. The a s s o c i a t i o n on S D S - p o l y a c r y l a m i d e g e l s o f l i p o p o l y s a c c h a r i d e and o u t e r membrane p r o t e i n s o f Pseudomonas a e r u g i n o s a a s r e v e a l e d by m o n o c l o n a l a n t i b o d i e s and W e s t e r n b l o t t i n g . FEMS M i c r o b i o l . L e t t . 27: 247-251.  131  P r i t c h a r d , A.E., and M.L. V a s i l . 1986. N u c l e o t i d e s e q u e n c e and e x p r e s s i o n o f a p h o s p h a t e - r e g u l a t e d gene e n c o d i n g a s e c r e t e d h e m o l y c i n o f Pseudomonas a e r u g i n o s a . J . B a c t e r i o l . 167: 291-298. R a n d a l l , L . L . , S . J . S . Hardy, and J.R. Thom. 1987. E x p o r t o f p r o t e i n : A b i o c h e m i c a l v i e w . Ann. Rev. M i c r o b i o l . 41: 507-541. R e i t h m e i e r , R.A.F., and P.D. B r a g g . 1977. C r o s s - l i n k i n g o f t h e p r o t e i n s i n t h e o u t e r membrane o f E s c h e r i c h i a c o l i . B i o c h i m . B i o p h y s . A c t a 466: 245-256. R e l l a , M., A. M e r c e n i e r , and D. Haas. 1985. T r a n s p o s o n i n s e r t i o n m u t a g e n e s i s o f Pseudomonas a e r u g i n o s a w i t h a Tn5 d e r i v a t i v e : a p p l i c a t i o n t o p h y s i c a l mapping of the a r c ~~ gene c l u s t e r . Gene 3_3: 293-303. R i v e r a , M., L . E . B r y a n , R.E.W. H a n c o c k , and E . J . M c G r o a r t y . 1988. H e t e r o g e n e i t y o f 1 i p o p o l y s a c c h a r i d e s f r o m Pseudomonas a e r u g i n o s a : a n a l y s i s o f l i p o p o l y s a c c h a r i d e c h a i n l e n g t h . J . B a c t e r i o l . 170: 512-521. R i v e r a , M., and E . J . M c G r o a r t y . 1989. A n a l y s i s o f a commona n t i g e n l i p o p o l y s a c c h a r i d e f r o m Pseudomonas a e r u g i n o s a . J . B a c t e r i o l . 171: 2244-2248. R o s e n b e r g , M., D. G u t n i k , and E . R o s e n b e r g . 1980. A d h e r e n c e of b a c t e r i a t o h y d r o c a r b o n s : a s i m p l e method f o r m e a s u r i n g c e l l - s u r f a c e h y d r o p h o b i c i t y . FEMS M i c r o b i o l . L e t t . 9_: 29-33. S a b a t h , L.D. 1984. B i o c h e m i c a l and p h y s i o l o g i c a l b a s i s f o r s u s c e p t i b i l i t y and r e s i s t a n c e o f Pseudomonas a e r u g i n o s a t o a n t i m i c r o b i a l a g e n t s . Rev. I n f e c t . D i s . 6_: S643-S656. S a i d , A.A., D.M. L i v e r m o r e , and R . J . W i l l i a m s . 1987. E x p r e s s i o n o f HI outer-membrane p r o t e i n o f Pseudomonas a e r u g i n o s a i n r e l a t i o n t o s e n s i t i v i t y t o EDTA and p o l y m y x i n B. J . Med. M i c r o b i o l . 2_£: 267-274 . Sandermann, H., J r . , and J . L . S t r o m i n g e r . 1972. P u r i f i c a t i o n and p r o p e r t i e s o f C 5 5 ~ i s o p r e n o i d a l c o h o l p h o s p h o k i n a s e f r o m S t a p h y l o c o c c u s a u r e u s . J . B i o l . Chem. 247: 5123-5131. S a u n d e r s , V.A., and J.R. S a u n d e r s . 1987. O p t i m i s a t i o n o f e x p r e s s i o n o f c l o n e d g e n e s , p. 219-264. I_n M i c r o b i a l g e n e t i c s a p p l i e d t o b i o t e c h n o l o g y : P r i n c i p l e s and t e c h n i q u e s o f gene t r a n s f e r and m a n i p u l a t i o n . M a c m i l l a n P u b l i s h i n g Co., New Y o r k .  132 Sawyer, J.G., N.L. M a r t i n , and R.E.W. H a n c o c k . 1988. I n t e r a c t i o n o f macrophage c a t i o n i c p r o t e i n s w i t h t h e o u t e r membrane o f Pseudomonas a e r u g i n o s a . I n f e c t . Immun. 56: 693-698. S c h w e i z e r , M., I . H i n d e n n a c h , W. G a r t e n , and U. H e n n i n g . 1978. Major p r o t e i n s o f t h e E s c h e r i c h i a c o l i outer c e l l e n v e l o p e membrane. I n t e r a c t i o n o f p r o t e i n I I * w i t h 1 i p o p o l y s a c c h a r i d e . E u r . J . B i o c h e m . 82_: 211-217. S e k a r , V. 1987. A r a p i d s c r e e n i n g p r o c e d u r e f o r t h e i d e n t i f i c a t i o n o f recombinant b a c t e r i a l c l o n e s . B i o t e c h n i q u e s 5_: 11-13. S e l t m a n n , G., and E . - J . W o l t e r . 1987. E f f e c t o f n o u r s e o t h r i c i n ( s t r e p t o t h r i c i n ) on t h e o u t e r membrane o f s e n s i t i v e and r e s i s t a n t E s c h e r i c h i a c o l i s t r a i n s . J . B a s i c M i c r o b i o l . 2_7_: 139-146. S i e h n e l , R . J . , E.A. Worobec, and R.E.W. H a n c o c k . 1988a. C l o n i n g o f t h e Pseudomonas a e r u g i n o s a o u t e r membrane p o r i n p r o t e i n P gene: e v i d e n c e f o r a l i n k e d r e g i o n o f DNA h o m o l o g y . J . B a c t e r i o l . 170: 2312-2318. S i e h n e l , R . J . , E.A. Worobec, and R.E.W. H a n c o c k . 1988b. R e g u l a t i o n o f components o f t h e Pseudomonas a e r u g i n o s a phosphate-starvation-inducible regulon i n E s c h e r i c h i a c o l i . M o l . M i c r o b i o l . 2_: 347-352. S i l l e r o , A., and J.M. R i b e i r o . 1989. I s o e l e c t r i c p o i n t s o f p r o t e i n s : t h e o r e t i c a l d e t e r m i n a t i o n . A n a l . B i o c h e m . 179: 319-325. Simon, R., V. P r i e f e r , and A. P u e h l e r . 1983. A b r o a d h o s t range m o b i l i z a t i o n system f o r i j i v i v o g e n e t i c e n g i n e e r i n g : T r a n s p o s o n m u t a g e n e s i s i n Gram n e g a t i v e b a c t e r i a . B i o / t e c h n o l o g y 1_: 784-791. S t i e r i t z , D.D., and I.A. H o l d e r . 1975. E x p e r i m e n t a l s t u d i e s of t h e p a t h o g e n e s i s o f i n f e c t i o n s due t o Pseudomonas a e r u g i n o s a : d e s c r i p t i o n o f a b u r n e d mouse m o d e l . J . I n f e c t . D i s . 131: 688-691. Towbin, H., T. S t a e h e l i n , and J . G o r d o n . 1 9 7 9 . E l e c t r o p h o r e t i c t r a n s f e r o f p r o t e i n s from p o l y a c y l a m i d e g e l s t o n i t r o c e l l u l o s e s h e e t s : P r o c e d u r e and some applications. P r o c . N a t l . A c a d . S c i . USA 76: 4350-4354. T r a v e r s , A.A. 1987. S t r u c t u r e and f u n c t i o n o f E . c o l i p r o m o t e r DNA. CRC C r i t . Rev. B i o c h e m . 22: 181-219.  133  T r i a s , J . , J . D u f r e s n e , R.C. L e v e s q u e , and H. N i k a i d o . 1989. D e c r e a s e d o u t e r membrane p e r m e a b i l i t y i n imipenemr e s i s t a n t m u t a n t s o f Pseudomonas a e r u g i n o s a . A n t i m i c r o b . Ag. Chemother. 33_: 1201-1206. T r i a s , J . , E.Y. R o s e n b e r g , and H. N i k a i d o . 1988. S p e c i f i c i t y o f t h e g l u c o s e c h a n n e l formed by p r o t e i n D l o f Pseudomonas a e r u g i n o s a . B i o c h e m . B i o p h y s . A c t a 938 ; 493-496. T s a i , C.-M., and C E . F r a s c h . 1982. A s e n s i t i v e s i l v e r for detecting 1ipopolysaccharides in polyacrylamide A n a l . B i o c h e m . 119: 115-119.  stain gels.  T s u d a , M., S. Harayama, and T. l i n o . 1984. Tn501 i n s e r t i o n m u t a g e n e s i s i n Pseudomonas a e r u g i n o s a PAO. M o l . Gen. G e n e t . 196: 494-500. V a a r a , M. , T. V a a r a , M. J e n s e n , I . H e l a n d e r , M. Nurminen, E.T. R i e t s c h e l , and P.H. M a k e l a . 1981. C h a r a c t e r i z a t i o n of t h e l i p o p o l y s a c c h a r i d e f r o m t h e p o l y m y x i n - r e s i s t a n t pmrA m u t a n t s o f S a l m o n e l l a t y p h i m u r i u m . FEBS L e t t . 129: 145-149. V i e i r a , J . , and J . M e s s i n g . 1982. The pUC p l a s m i d s , an M13mp7-derived s y s t e m f o r i n s e r t i o n m u t a g e n e s i s and s e q u e n c i n g w i t h s y n t h e t i c u n i v e r s a l p r i m e r s . Gene 19: 259-268. Wang, J . C . 1982. U n w i n d i n g a t t h e p r o m o t e r and t h e m o d u l a t i o n of t r a n s c r i p t i o n by DNA s u p e r c o i 1 i n g . p. 229-241 . Ijn R.L. R o d r i g u e z and M.J. C h a m b e r l i n (ed.), Promoters: S t r u c t u r e and f u n c t i o n . P r a e g e r P u b l i s h e r s , New Y o r k . Ward, K.H., H. Anwar, M.R.W. Brown, J . Wale, and" J . Gowar. 1988. A n t i b o d y r e s p o n s e t o outer-membrane a n t i g e n s o f Pseudomonas a e r u g i n o s a i n human b u r n wound i n f e c t i o n . J . Med. M i c r o b i o l . 27_: 179-190. W e i n s t e i n , L . 1985. G r a m - n e g a t i v e b a c t e r i a l i n f e c t i o n s : A l o o k a t t h e p a s t , a v i e w o f t h e p r e s e n t , and a g l a n c e at t h e f u t u r e . Rev. I n f e c t . D i s . 7_: S538-S544 . West, S.E.H., and B.H. I g l e w s k i . 1988. Codon usage i n Pseudomonas a e r u g i n o s a . N u c l e i c A c i d s R e s . 16_: 9323-9335. W i l k i n s o n , S.G. 1983. C o m p o s i t i o n and s t r u c t u r e o f 1 i p o p o l y s a c c h a r i d e s f r o m Pseudomonas a e r u g i n o s a . I n f e c t . D i s . 5: S941-S949.  Rev.  134  W o o d r u f f , W.A., and R.E.W. Hancock. 1988. C o n s t r u c t i o n and c h a r a c t e r i z a t i o n o f Pseudomonas a e r u g i n o s a p r o t e i n F d e f i c i e n t m u t a n t s a f t e r i n v i t r o and i n v i v o i n s e r t i o n m u t a g e n e s i s o f t h e c l o n e d g e n e . J . B a c t e r i o l . 170; 2592-2598. W o o d r u f f , W.A., and R.E.W. H a n c o c k . 1989. Pseudomonas a e r u g i n o s a o u t e r membrane p r o t e i n F : s t r u c t u r a l r o l e and r e l a t i o n s h i p t o t h e E s c h e r i c h i a c o l i OmpA p r o t e i n . J . B a c t e r i o l . 1 7 1 : 3304-3309. W o o d r u f f , W.A., T.R. P a r r , J r . , R.E.W. H a n c o c k , L . F . Hanne, T . I . N i c a s , and B.H. I g l e w s k i . 1986. E x p r e s s i o n i n E s c h e r i c h i a c o l i and f u n c t i o n o f Pseudomonas a e r u g i n o s a o u t e r membrane p o r i n p r o t e i n F . J . B a c t e r i o l . 167: 473-479. Woods, D. 1984. O l i g o n u c l e o t i d e s c r e e n i n g o f cDNA F o c u s ( G a i t h e r s b u r g , M a r y l a n d ) 6_: 1-3.  libraries.  Worobec, E.A., N.L. M a r t i n , W.D. M c C u b b i n , C M . Kay, G.D. B r a y e r , and R.E.W. Hancock. 1988. L a r g e - s c a l e p u r i f i c a t i o n and b i o c h e m i c a l c h a r a c t e r i z a t i o n o f c r y s t a l l i z a t i o n - g r a d e p o r i n p r o t e i n P f r o m Pseudomonas a e r u g i n o s a . Biochim. B i o p h y s . A c t a 939: 366-374. Y a n i s c h - P e r r o n , C , J . V i e i r a , and J . M e s s i n g . 1985. Improved M13 phage c l o n i n g v e c t o r s and h o s t s t r a i n s : n u c l e o t i d e s e q u e n c e s o f t h e Ml3mpl8 and pUC19 v e c t o r s . Gene 33: 103-119. Y o s h i h a r a , E . , and T. Nakae. 1989. I d e n t i f i c a t i o n o f p o r i n s i n t h e o u t e r membrane o f Pseudomonas a e r u g i n o s a t h a t f o r m s m a l l d i f f u s i o n p o r e s . J . B i o l . Chem. 264: 6297-6301. Young. 1984. The c l i n i c a l c h a l l e n g e o f i n f e c t i o n s due t o Pseudomonas a e r u g i n o s a . Rev. I n f e c t . D i s . 6: S603-S607.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098139/manifest

Comment

Related Items