UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of the Caenorhabditis elegans var. Bristol (strain N2) Tc1 elements and related transposable… Harris, Linda Janice 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A1 H37.pdf [ 10.79MB ]
Metadata
JSON: 831-1.0098058.json
JSON-LD: 831-1.0098058-ld.json
RDF/XML (Pretty): 831-1.0098058-rdf.xml
RDF/JSON: 831-1.0098058-rdf.json
Turtle: 831-1.0098058-turtle.txt
N-Triples: 831-1.0098058-rdf-ntriples.txt
Original Record: 831-1.0098058-source.json
Full Text
831-1.0098058-fulltext.txt
Citation
831-1.0098058.ris

Full Text

CHARACTERIZATION OF THE CAENORHABDITIS ELEGANS VAR. BRISTOL (STRAIN N2) TCI ELEMENTS AND RELATED TRANSPOSABLE ELEMENTS IN CAENORHABDITIS BRIGGSAE By LINDA JANICE HARRIS B.Sc, Simon Fraser U n i v e r s i t y , 1982 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES GENETICS PROGRAMME We accept t h i s thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA March 1988 ® L i n d a Janice H a r r i s , 1988 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date Trtu 23,1988 DE-6(3/81) i i ABSTRACT The regulat ion and evolution of the inverted repeat transposable element T e l , found in the nematode Caenorhabditis elegans, was s tudied. The s t a b i l i t y of Tel elements in the N2 s t r a i n genome was investigated by cloning seventeen N2 Tel elements. To examine t h e i r s t ructura l i n t e g r i t y , s ixteen cloned N2 Tel elements were r e s t r i c t i o n mapped and, in the case of some var iant s , t h e i r DNA was p a r t i a l l y sequenced. Two r e s t r i c t i o n s i t e var iant s , Tcl(Eco).12 and Tcl (Hpa-) .9 , were found. Tel(1.5) .10b had lo s t 89 bp from one end, while Tc l (1 .7 ) .28 contained a 55 bp i n s e r t i o n . Two addit ional elements, Tc l (0 .9 ) . 2 and Tc l (0 .9 ) .14 , had d i f fe rent internal de le t ions . Each element was about 900 bp in length. The majority of Tel elements cloned from the N2 s t r a i n were found to have ident i ca l r e s t r i c t i o n maps. Somatic exc i s ion of Tel elements in the N2 genome was demonstrated. Tel elements in N2 are apparently both s t r u c t u r a l l y and funct iona l ly i n t a c t . Nevertheless, mobi l i za t ion of Tel elements in the N2 germline i s r e s t r i c t e d . Two new transposable element f a m i l i e s , Barney (also known as TCbl) and TCb2, were discovered in a c lo se ly related nematode, Caenorhabditis briggsae due to Tel i d e n t i t y . These two f a m i l i e s , d i s t inguished through d i f f e r e n t i a l inter-element h y b r i d i z a t i o n , showed mul t ip le banding differences between s t r a i n s . The open reading frames (ORFs) of Tel and Barney share 71% DNA sequence and 74% amino acid sequence i d e n t i t y . The putative terminus of Barney exh ib i t s 68% i d e n t i t y with the 54 bp terminal repeat of T e l . P a r t i a l i i i sequencing of TCb2 revealed that i t s ORF i s equally diverged from Barney and T e l . The basis of the sequence heterogeneity observed in the C. briggsae transposons and not in the C. elegans transposons could be due to e i ther horizontal transfer or alternate paths of divergence. S i gn i f i c an t sequence i d e n t i t y was found between T e l , Barney, and HB1 (a transposable element from Drosophila melanogaster) w i th in t h e i r coding regions and terminal repeats. These sequence s i m i l a r i t i e s define a subclass of inverted repeat transposable elements inhabi t ing two d i f fe rent p h y l l a , Arthropoda and Nematoda. iv TABLE OF CONTENTS ABSTRACT i i TABLE OF CONTENTS iv LIST OF TABLES vi LIST OF FIGURES v i i LIST OF ABBREVIATIONS x ACKNOWLEDGEMENTS xi INTRODUCTION 1 A. Eukaryotic Transposable Elements , 2 B. The Inverted Repeat Class of Transposable Elements 6 C. The Caenorhabditis elegans Transposable Element Tel 10 D. Tel Elements in the C. elegans N2 S t ra in 17 E. T e l - h y b r i d i z i n g Repet i t ive Element Families in C. briggsae 18 F. Character izat ion of Tel Elements in C. elegans and Barney and TCb2 Elements in C. briggsae 19 MATERIALS AND METHODS A. Nematode Culture Conditions and Strains 21 B. Mater ia l s 22 C. Nematode DNA Preparation. 23 D. Molecular B io log i ca l Techniques 24 1. Bacter ia l Strains 24 2. Agarose Gel Electrophoresis 25 3. E lec t roe lu t ion 25 4. Nick Translat ion 26 5. Southern Hybr id izat ion 27 E. I so la t ion of Phage . .28 1. L ibrary Screening and Bacteriophage P u r i f i c a t i o n 28 2. Phage DNA I so la t ion 29 F. Plasmid Preparation Techniques 30 1. Plasmid Ligat ion 30 2. Plasmid Transformation 31 3. Colony Hybr id izat ion 31 4. Plasmid Macropreparation - Lysis by Tr i ton X-100 32 5. Plasmid Minipreparation - A l k a l i n e Lysis 33 G. DNA Sequencing 34 1. Plasmid P u r i f i c a t i o n and Denaturation 34 2. Deletion Clones 35 3. Dideoxy DNA Sequencing 37 4. Computer Sequence Analysis 38 V RESULTS A. Character izat ion of C. elegans S tra in N2 Tel Elements 40 1. L ibrary Screening and Subcloning of N2 Tel elements 40 2. Mapping, Res t r i c t ion S i t e , and DNA Sequence Analysis of N2 Tel elements 43 a. Tc l (0 .9 ) . 2 54 b. Te l .6 58 c. Te l .7 58 d . Tcl(Hpa-) .9 62 e. Tel.-10a 62 f . Tcl(1 .5) .10b 64 g. Tcl(Eco).12 69 h. Tel .13 70 i . Tc l (0 .9) .14 70 j . Tel .18 72 k. Tc l (1 .7 ) .28 72 1. Tel .30 75 3. Analysis of N2 Tel Insert ion DNA 75 4. Closer Examination of a N2 Tel RFLD S i te 79 B. Tel Somatic and Germline Excis ion 85 1. Tel Excis ion from the N2 Genome , 85 2. BO Tel Excis ion from the N2 Genome 85 3. Tcl(Hin) Germline Excis ion 95 C. Character izat ion of C. briggsae Repet i t ive Elements 97 1. Detection of Tel Identi ty in C. briggsae 97 2. L ibrary Screening of Te l -hybr id i z ing C. briggsae Elements 97 3. D i s t r i b u t i o n of Tel Identi ty 101 4. Inter-element Hybr id iza t ion 101 5. C. briggsae S tra in Hybrid izat ion 104 6. Hybr id izat ion of Barney and TCb2 to C. elegans DNA 108 7. P a r t i a l DNA Sequencing of Barney and TCb2 108 DISCUSSION A. Character izat ion of N2 Tel Elements 129 B. Character izat ion of the C. briggsae T e l - h y b r i d i z i n g Elements 138 C. Summary 143 D. Proposals for Future Research 144 APPENDIX A. Genetic Mapping of Molecular RFLD Probes 147 APPENDIX B. Lethal Analysis 150 1. Lethal Screening 150 2. Recombination Mapping 151 LITERATURE CITED 154 vi LIST OF TABLES 1. Classes of eukaryotic transposable elements 4 2. C. elegans/'briggsae s t r a in names 12 3. Summary of cloned N2 Tel elements 42 4. N2 Tel element placement 55 5. Analys i s of N2 Tel in ser t ion DNA 78 6. Summary of C. briggsae Te l -hybr id i z ing elements 100 7. Summary of mapped l e tha l a l l e l e s 152 v i i LIST OF FIGURES 1. Structure of the transposable element Tel 13 2. I d e n t i f i c a t i o n of cloned N2 fcoRI fragments containing Tel elements 44 3. N2/B0 hybr id iza t ion pattern of the f lanking sequence of Tel .30 45 4. R e s t r i c t i o n map of Tel 46 5. Character izat ion of internal fragments of N2 Tel elements..49 6. N2/B0 hybr id iza t ion pattern of the f lanking sequences of f i v e N2 Tel elements 52 7. R e s t r i c t i o n fragment length differences exhibited by Te l .6 and T e l . 18 53 8. N2 Tel var iant structures - R e s t r i c t i o n mapping 56 9. Linkage group mapping of the hP3 s i t e 59 10. Mapping of the hP3 s i t e between unc-43 and unc-22 (LGIV) . . . . 6 1 11. R e s t r i c t i o n map of pCeh62 63 12. N2 Tel var iant structures - Extent of DNA sequencing 65 13. DNA sequence of a portion of Tcl(1 .5) .10b 66 14. N2 Tel var iant structures - DNA sequencing 68 15. DNA sequence of a port ion of Tc l (0 .9) .14 71 16. Linkage group mapping of the hP2 s i t e 73 17. DNA sequence of a segment of Tel(1.7) .28 74 18. Analys i s of N2 Tel inser t ion s i te s for r e p e t i t i v e sequence 76 19. R e s t r i c t i o n maps of N2 and BO DNA at the hP2 s i t e 80 20. Hybridizat ions with BO Charon 4 phage at the hP2 s i t e 81 21. Hybridizat ions with N2 Charon 4 phage containing Tel .18 83 22. N2 Tel somatic exc i s ion . 86 23. R e s t r i c t i o n map of Tcl(Hin) 88 24. Construction of s t r a i n KR324 - Genetic out l ine 89 LIST OF FIGURES cont. 25. Construction of s t r a in KR324 (Introduction of BO Tcl(Hin) into the N2 genome) - Character izat ion of Dpy-5 s t r a i n i so la tes with respect to the sPl RFLD 91 26. Introduction of Tcl(Hin) into the KR324 (dpy-14) genome 93 27. Somatic excis ion of Tcl(Hin) in N2 and BO stra ins 94 28. Evidence for germline excis ion of Tcl(Hin) 96 29. C. briggsae DNA contains T c l - h y b r i d i z i n g sequences 98 30. Hybr id iza t ion of Tel fragments to Barney elements 102 31. Two fami l ie s of C. briggsae r e p e t i t i v e sequences 103 32. Detection of Barney and TCb2-containing fcoRI fragments in C. briggsae s t r a i n G16 DNA 105 33. Determination of the banding pattern of Barney and TCb2 elements in BamHl and Xbal digestions of C. briggsae G16 DNAs 106 34. D i s t r i b u t i o n of Barney elements wi th in three C. briggsae s t ra ins 107 35. Character izat ion of Barney elements wi th in three C. briggsae s t ra ins 109 36. Character izat ion of Barney and TCb2 cros s -hybr id iz ing sequences in C. elegans s t ra ins N2 and BO genomic DNAs 110 37. Construction of a series of deleted plasmids of p C b h l 7 . . . . 112 38. Sequencing strategy of the pCbh 12/17 plasmids 113 39. DNA sequence of pCbhl2/17 2.3 kb inser t 114 40. Stop codon map of Barney.10 and surrounding sequence 116 41. Comparison of Barney.10 and Tel sequences 117 42. Comparison of putative terminal inverted repeat sequences 120 i x LIST OF FIGURES cont. 43. Comparison of a p a r t i a l TCb2 sequence with Tel and Barney. 10 122 44. Comparison of T e l , Barney, and HB1 sequence 126 45. Sample genome from a linkage group I mapping s t r a i n 148 46. RFLD mapping using N2/B0 s tra ins 149 47. Lethal a l l e l e s posit ioned on LGI map 153 LIST OF ABBREVIATIONS ATP riboadenosine 5'-triphosphate bp basepair (s) BSA bovine serum albumin contig contiguous regions of the C. elegans genome i so la ted as overlapping clones cpm counts per minute CsCl cesium chlor ide DNA deoxyribonucleic acid dATP deoxyriboadenosine 5'-triphosphate ddATP dideoxyriboadenosine 5'-triphosphate dCTP deoxyribocytidine 5'-triphosphate ddCTP dideoxyribocytidine 5'-triphosphate dGTP deoxyriboguanosine 5'-triphosphate ddGTP dideoxyriboguanosine 5'-triphosphate dTTP deoxyribothymidine 5'-triphosphate ddTTP dideoxyribothymidine 5'-triphosphate dNTP deoxyribonucleotide triphosphate EDTA ethylene diamine tetraacetate EtBr ethidium bromide hr hour (s) IPTG isopropylthiogalactos ide KAc potassium acetate kb kilobase pa i r (s) 1 1 i t e r LB Luria-Bertani LG l inkage group NH4Ac ammonium acetate M molar mg mi l l igram (s) min minute (s) ml m i l l i l i t e r (s) mM m i l l i m o l a r m.u. map unit (s) ng nanogram (s) ORF open reading frame PEG polyethylene g lycol pfu plaque-forming units RFLD r e s t r i c t i o n fragment length dif ference RNA r ibonucle ic acid rpm revolut ions per minute SDS sodium dodecyl sulfate sec second (s) TE Tris-EDTA buffer TEMED N,N,N',N'-tetramethyl-ethylenediamine T r i s t r i s (hydroxymethyl) aminomethane ug microgram V vo l t (s) Xgal 5-dibromo 4-chloro 3- indolylga lactos ide x i ACKNOWLEDGEMENTS I would l i k e to thank my research supervisor, Dr. Ann Rose, for her enthusiasm, encouragement and guidance. Thank you to my colleagues in the lab , Nasrin Mawji, Frances Lee, Terry S tar r , Ann Marie Howell , K e l l y McNei l , Ken Peters, Joe Babity, Kim McKim, Jennifer McDowall, and Ricardo Mancebo, for t h e i r technical ass istance, ideas, and moral support. Thank you to my graduate committee, Dr. David B a i l l i e , Dr. Steve Wood, and Dr. Caroline A s t e l l , for t h e i r support and c r i t i c a l comments. Thank you to Dr. Fred D i l l for darkroom assistance and to Dr. Don Moerman for reading my t h e s i s . Thank you to the Medical Research Council of Canada for t h e i r studentship support during th i s research. And a very special thank you to Mom, Dad, Rosemarie, and Clancy. 1 INTRODUCTION Transposable elements are p o t e n t i a l l y mobile DNA sequences found in a var ie ty of organisms. These r e p e t i t i v e elements have been shown to be dispersed throughout the genome. Genomes which contain transposable elements range from bacter ia l to human, and a l l transposable elements share, more or l e s s , a s i m i l a r organizat ion . An i n t r i g u i n g problem concerns the regulat ion of the mobi l i ty of transposable elements in t h e i r host genomes. In the nematode Caenorhabditis elegans, the transposable element Tel (Emmons et a l . , 1983) i s extremely stable in most s t ra ins but show germline m o b i l i t y in a few others (Liao et a l . , 1983; Moerman and Waterston, 1984; Eide and Anderson, 1985a,b). The basis for th i s dif ference in a c t i v i t y can be studied through the appl ica t ion of genetic and molecular techniques. An examination of the evolutionary d i s t r i b u t i o n of Tel i s also possible due to the a c c e s s i b i l i t y of other nematode species. Using these approaches, I have undertaken an inves t iga t ion of the s t ructura l d i v e r s i t y of Tel in two species of nematode and interpreted these resu l t s with regard to the evolution and regulat ion of mobi l i ty of th i s transposable element. 2 A. Eukarvotic Transposable Elements At one time, chromosomes were believed to be conservative structures with an exact amount of genetic information in a d e f i n i t e order. McClintock (1951, 1956) observed many phenomena including chromosome breakage, rearrangements, and delet ions and was the f i r s t to propose that they were mediated by transposable elements. Transposable elements are present in a genome in mul t ip le copies which can mediate t h e i r own movement to other locat ions in the genome. Transposable elements have been described in eukaryotes as diverse as yeast (Cameron et a l . , 1979), f r u i t f l i e s (Finnegan et a l . , 1978), sea urchins (Liebermann et a l . , 1983), frogs (Garrett and C a r r o l l , 1986), snapdragons (Bonas et a l . , 1984), and humans (Paulson et a l . , 1985). McClintock had focused on the effect of transposable elements on genes and gene expression, designating them as " c o n t r o l l i n g elements" (1951,1956). Many of the transposable elements studied in other organisms can d r a s t i c a l l y a l t e r gene expression, but i t i s widely believed that t h i s i s not t h e i r fundamental funct ion . The ro le of transposable elements remains an enigma. Possible roles range from being purely p a r a s i t i c e n t i t i e s (Orgel and C r i c k , 1980; Sapienza and D o o l i t t l e , 1981) to providing a mechanism for the rapid reorganization of a genome (Cohen, 1976; Never and Saedler, 1977; McClintock, 1984). In order to d i s t ingu i sh between these two scenarios, a more thorough understanding of the nature of transposable elements must be achieved. The varied array of eukaryotic transposable elements 3 i so la ted from numerous organisms can be loosely categorized into three classes (Table 1). The retrotransposons (Boeke et a l . , 1985) are the best studied class and are s t r u c t u r a l l y re lated to r e t r o v i r a l proviruses (Weiner et a l . , 1986). The foldback elements have long and complex inverted terminal repeats, composed l a rge ly of tandem copies of simple sequence DNA (Truett et a l . , 1981; Liebermann et a l . , 1983). The t h i r d c lass are the inverted repeat elements; these elements have short terminal inverted repeats ranging from 11 to 213 bp in length (Rosenzweig et a l . , 1983a; Jacobson et a l . , 1986; L i l l i s and Free l ing , 1986; O'Hare and Rubin, 1983; Streck et a l . , 1986). Copia of Drosophila melanogaster (Rubin, 1983) and Tyl of Sacchromyces cerevisiae (Cameron et a l . , 1979; Fink et a l . , 1986) are two representatives of the retrotransposons. Research regarding these two elements has y ie lded evidence for an evolutionary re l a t ionsh ip between retrotransposons and re t rov i ruses . Copia, T y l , and retroviruses have long d i r e c t terminal repeats, homology to a putative tRNA primer, and terminal redundancy of retrotransposon RNA (Emori et a l . , 1985; Fink et a l . , 1986; Rubin, 1983). Tyl has s i g n i f i c a n t sequence homology in an open reading frame (ORF) to r e t r o v i r a l reverse transcr iptase (Fink et a l . , 1986). The strongest evidence comes from the i s o l a t i o n of v i r u s - l i k e p a r t i c l e s in yeast c e l l s which over-express Tyl and from Drosophila t i ssue cul ture c e l l s . These p a r t i c l e s are associated with both reverse t ranscr iptase a c t i v i t y and f u l l - l e n g t h RNA copies of the retrotransposons (Emori et a l . , 1985; Garfinkel et a l . , 1985; McGinnis et a l . , 1983; Shiba and Saigo, 1983). The i n t r a c e l l u l a r 4 Table 1. Classes of eukaryotic transposable elements CI ass Structure Transposition Mechani sm Class Members (Host Genome) Reference Retrotransposon Long d i r e c t retrotranspo- Tyl Cameron terminal s i t i o n : (yeast) et a l . , 1979 repeats reverse copia Rubin et a l . t r a n s c r i p t i o n gypsy 1981, 1983. of a RNA 412 Modolell intermediate ( f r u i t f l y ) et a l . , 1983 Tas Aeby et a l . , (nematode) 1986. Mys Wichman (mouse) et a l . , 1985 Bsl Johns et a l . (maize) 1985 Foldback long terminal mechanism FB Potter inverted unknown ( f r u i t f l y ) et a l . , 1980 repeats with high internal Tsp Liebermann r e p e t i t i v e - (sea urchin) et a l . , 1983 ness Inverted short mechani sm Tel Emmons Repeat terminal unknown (nematode) et a l . , 1983 inverted repeats of Tam3 Sommer 11 to 213 bp (snapdragon) et a l . , 1985 P Rubin et a l . hobo 1982, Streck mariner et a l . , 1986 HB Jacobson ( f r u i t f l y ) et a l . , 1986 B r i e r l e y and Potter , 1985 Ac/Ds McClintock, Mu 1951 (maize) Doring et a l . , 1984 Strommer et a l . , 1982 5 p a r t i c l e s , at least in yeast, do not appear to be infect ious (Garfinkel et a l . , 1985). Temin (1980) commented that i t was u n l i k e l y that the degree of s i m i l a r i t y between retroviruses and retrotransposons had occurred through convergent evo lu t ion . He proposed that retroviruses had evolved from transposable elements. Conversely, retrotransposons could be retroviruses which have lo s t t h e i r i n t e r c e l l u l a r mobi l i ty (Mellor et a l . , 1985). The least-represented class at t h i s time are the foldback elements which have members in f r u i t f l i e s (FB) (Potter et a l . , 1980; Potter , 1982a) and sea urchins (Tsp) (Liebermann et a l . , 1983). The foldback fami l ies are usual ly quite heterogeneous in composition, which i s hypothesized to be due to a high incidence of unequal recombination among the highly repeated ends (Truett et a l . , 1981; Potter , 1982b). Mutations caused by foldback sequences are often unstable and can generate novel forms by intra-element rearrangements (Laevis et a l . , 1982). Another widespread class of eukaryotic transposable elements i s the inverted repeat elements. Members of t h i s c lass include Tel of Caenorhabditis elegans (Emmons et a l . , 1983); Mu (Strommer et a l . , 1982) and Ac/Ds (McClintock, 1951; Doring et a l . , 1984) of lea mays; mariner of Drosophila mauritiana (Jacobson et a l . , 1986); P (Rubin et a l . , 1982; Bingham et a l . , 1982), HB (Br ie r l ey and Pot ter , 1985), and hobo (Streck et a l . , 1986) of Drosophila melanogaster. While the retrotransposons share numerous s t ructura l and behavioral c h a r a c t e r i s t i c s , the inverted repeat elements show considerable v a r i a t i o n . B. The Inverted Repeat Class of Transposable Elements 6-One member of the inverted repeat class can be found in the maize genome. A high mutator maize s t r a i n was described by Robertson (1978). This s t r a i n , known as Robertson's mutator, produced new recessive mutants at a rate f i f t y times that observed for normal maize l i n e s . Strommer et a l . (1982) cloned an Adh-1 mutant i so la ted from a Robertson's mutator s t r a i n and discovered the Mul element. Mul i s 1367 bp long and has 213 bp terminal inverted repeats (Barker et a l . , 1984). Four ORFs are present but there i s no evidence that any of these are t ranscr ibed . Mu creates a nine bp target s i t e dup l i ca t ion upon i n s e r t i o n . Other s t r u c t u r a l l y s i m i l a r Mu elements have been described. A major form, Mul .7 , i s re la te to Mul . It d i f f e r s by a 300 bp i n s e r t i o n , numerous s ingle base changes, and a few small delet ions and inser t ions (Taylor and Walbot, 1987). The Mul.7 elements are often present at one to ten copies per genome, yet are not required for mutator a c t i v i t y (Alleman and Free l ing , 1986). Sequences homologous to Mu termini without Mu internal sequences have also been detected (Chandler et a l . , 1986). The genomic copy number of Mul and Mul.7 elements ranges from twenty to f i f t y copies (Alleman and Free l ing , 1986). Mu a c t i v i t y appears to be correlated with the lack of Mu DNA modif icat ion (Chandler and Walbot, 1986). Maize l ine s that have los t Mu t ranspos i t ion a c t i v i t y have Mu elements in which the DNA appears to be modified since cleavage of Mu DNA sequence by cer ta in 7 r e s t r i c t i o n enzymes i s i n h i b i t e d . Methylation i s the most l i k e l y candidate for t h i s DNA modif icat ion (Bennetzen, 1987). It has been shown that the loss of Mutator a c t i v i t y i s more l i k e l y the re su l t of internal modif icat ion of Mu elements than of Mu genomic copy number (Bennetzen, 1987). Methylation has also been shown to regulate the transposase a c t i v i t y of the Ac c o n t r o l l i n g element (Schwartz and Dennis, 1986). The 2.9 kb Drosophila melanogaster P element, which i s a mediator of hybrid dysgenic events (Rubin et a l . , 1982), has inverted repeats of 31 bp (O'Hare and Rubin, 1983). Numerous, i n t e r n a l l y deleted, nonautonomous P sequences can be mobilized by the complete 2.9 kb element. The P element contains four ORF, a l l of which are required to produce the P transposase (Karess and Rubin, 1983; Rio et a l . , 1986). Recent studies have shed l i g h t on how P elements are se l f - regu la ted . P element mobi l i ty i s r e s t r i c t e d to germ c e l l s due to a t i s s u e - s p e c i f i c mRNA s p l i c i n g mechanism which i s probably mediated by c e l l u l a r factors (Laski et a l . , 1986). In add i t ion , genomic copy number i s thought to be regulated by a trans-act ing repressor, perhaps a port ion of the transposase protein (Engels, 1983; Engels et a l . , 1986). The inverted repeat HB family of Drosophila melanogaster was discovered due to one member being inserted into the foldback element FB4 (Potter , 1982a). The o r i g i n a l hypothesis was that the HB1 sequence was an integral part of FB. It was l a t e r shown by B r i e r l e y and Potter (1985) that, th i s sequence, HB1, was present in only one foldback element and other HB homologous sequences were 8 i n d i v i d u a l l y dispersed throughout the genome with a copy number of approximately twenty. HB1 i s 1654 bp in length and the inverted terminal repeats are each about 30 bp. Other HB family members contain numerous internal deletions and are quite heterogeneous. When HB was hybridized to a number of D. melanogaster s t r a i n s , the banding pattern was almost ident i ca l among s t r a i n s . Consequently, i t has been suggested that t h i s element i s not presently mobile in Drosophila melanogaster (Br i e r l ey and Potter , 1985). The Drosophila melanogaster genome also harbours the hobo family of elements. Hobo was f i r s t discovered as a 1.3 kb in se r t ion into the Sgs-4 locus (McGinnis et a l . , 1983). Hobo sequences vary in copy number and pos i t ion among D. melanogaster s t r a i n s . A complete copy of hobo i s 3.0 kb with 12 bp inverted terminal repeats (Streck et a l . , 1986). As seen with P elements, many smaller de le t ion der ivat ives of hobo are also present. The 3.0 kb element has a 2 kb long ORF, p o t e n t i a l l y coding for a 644 amino acid pro te in . A hybrid dysgenic system involving hobo elements has also been described (Blackman et a l . , 1987) which i s s i m i l a r to P element-mediated hybrid dysgenesis. A hobo element inserted into the Decapentaplegic gene complex promoted numerous chromosome rearrangements and delet ions when a hobo + s t r a in was crossed to a hobo" s t r a i n . The hobo+ s t r a i n contains complete 3 kb hobo elements while the hobo" s t r a in contains deleted der iva t ive s . Rudimentary gonads resembling those seen in GD s t e r i l i t y were observed in some of the of fspr ing of these crosses. Thus, the hobo 9 family appears to be a two-component system l i k e the P element family (Streck et a l . , 1986). A study of spontaneous white mutations in Drosophila mauritiana resulted in the i s o l a t i o n of the transposable element mariner (Jacobson et a l . , 1986). This element displays a high rate of somatic excis ion as the mariner-induced wP c n mutant reverted at a frequency of 10" 3 to 1 0 ' 2 . The somatic mosaicism appears to be influenced by a dominant factor on chromosome III (Bryan et a l . , 1987). Mariner i s 1286 bp with 28 bp inverted repeats at i t s termini (Jacobson et a l . , 1986). The element contains a s ingle ORF which could code for a protein of 346 amino acids . Mariner i s well conserved as four other mariner elements were found to be i d e n t i c a l to the sequenced element at the r e s t r i c t i o n enzyme s i t e l e v e l . The genomic copy number in D. mauritiana i s twenty. A few related Drosophila species examined contained zero to seven copies of mariner-hybridiz ing sequences. Drosophila melanogaster contained no detectable mariner sequences. The inverted repeat transposable elements d i sp lay both s i m i l a r i t i e s and di f ferences . A l l the elements have various sizes of terminal repeats. A few elements display a high frequency of somatic exc i s ion but the timing of th i s excis ion varies between element f a m i l i e s . Tel and Mu are present as extrachromosomal forms (Sundaresan and Free l ing , 1987; Rose and Snutch, 1984; Ruan and Emmons, 1984). Such forms have not been detected with the other class members although low concentrations may make i s o l a t i o n d i f f i c u l t . Retrotransposons are also found in extrachromosomal 10 f rac t ions (Mossie et a l . , 1985) which may be a general t r a i t of mobile elements. P and hobo have been documented as mediators of hybrid dysgenic events. The phenomenon of hybrid dysgenesis has also been shown to be induced by the action of a non-inverted repeat class mobile element in Drosophila known as the I factor (Bucheton et a l . , 1984; Fawcett et a l . , 1986). High mutator s t ra ins have been shown to be the re su l t of high t ranspos i t ional a c t i v i t y of T e l , P, Mu, and hobo. The more c lo se ly studied inverted repeat elements appear to have an e f fec t ive system of t ranspos i t ion regulat ion which l i m i t s the genomic copy number. D. The Caenorhabditis elegans transposable element Tel One of the more extensively-studied members of the inverted repeat c lass of transposable elements i s Tel which resides in the genome of the nematode Caenorhabditis elegans. During an analysis of DNA sequence conservation among d i f f e rent s t ra ins of C. elegans inc luding N2 and BO, Emmons et a l . (1979) found that many of the DNA clones from the N2 genome contained short sequences of r e p e t i t i v e DNA. One clone hybridized to a 7.0 kb band in EcoRI-digested N2 genomic DNA and a 8.7 kb band in BO DNA, creat ing a 1.7 kb r e s t r i c t i o n fragment length difference (RFLD) (Table 2 contains a descr ipt ion of these s t r a i n s ) . This N2 clone was used to i so l a te the homologous sequence from the BO genome. Closer examination of the BO 8.7 kb sequence revealed that the cause of the RFLD was a transposable element inserted within the 11 8.7 kb EcoRl fragment of BO DNA. This element was not present in N2 DNA (Emmons et a l . , 1983). Hybr id izat ion of the BO subclone to r e s t r i c t i o n digested genomic DNA revealed mult ip le copies of t h i s Tel element. Tel (Jransposon Caenorhabditis I) has t h i r t y members in the N2 genome and approximately three hundred in the BO genome (Emmons et a l . , 1983; Liao et a l . , 1983). Tel was shown to be randomly dispersed throughout the genome with no tandem arrays (Emmons et a l . , 1983). Digestion of genomic DNA with H a e l l l (which cleaves Tel at s ix s i tes ) followed by hybr id iza t ion with a Tel probe indicated strong conservation of Tel sequences since few var iant - s i zed bands were observed in e i ther N2 or BO DNA. A s ingle Tel from the BO genome has been completely sequenced (Rosenzweig et a l . , 1983a). The 1610 bp length of t h i s Tel includes 54 bp terminal perfect inverted repeats (Figure 1) . Two open reading frames (ORFs) were l o c a l i z e d in d i f fe rent frames on the same strand. The longer ORF begins with an ATG s tar t codon at pos i t ion 523 and ends at pos i t ion 1342 with a TAA (ochre) codon. This ORF has the coding potentia l for a 273 amino acid protein and i s flanked by correct punctuation s ignals (CAAT box at -107, TATA at -67, and putative termination signal (AATAA) 201 bp past the ochre codon). The second ORF, extending from pos i t ion 605 to 941, could code for a 112 residue prote in , although i t lacks a recognizable promoter region. No RNA sp l i ce consensus sequences were found. There i s the p o s s i b i l i t y , however, that t ranscr ip t s o r i g ina t ing at the same promoter could be processed to u t i l i z e both ORFs. No Tel-encoded RNA t ranscr ip t s have been detected. A Tel element inserted into the unc-22 locus has also been p a r t i a l l y 12 Table 2. Caenorhabditis eleaans/briqasae S tra in Names Abbreviated Name F u l l Name Stra in Orig in Caenorhabditis eleijans N2 B r i s t o l B r i s t o l , England BO Bergerac Bergerac, France Caenorhabditis brioosae G16 India Z Zuckerman U.S .A. BO D. Hirsh obtained a Z s t r a i n from B.Zuckerman in 1978. Sent to CGC* in 1980 and frozen. Received in Rose lab from CGC Jan,1984. # CGC - Caenorhabditis Genetics Center, Columbia, Mi s sour i , USA. 13 Figure 1. Structure of the transposable element Tel 0RF1 ATG TAA 54 bp 0RF2 > 54 bp IR IR 14 sequenced. This member d i f f e r s from the above BO Tel at 6 out of the 772 bp sequenced (Plasterk, 1987). It i s not c lear whether Tel creates an inser t ion s i t e dup l i ca t ion (Rosenzweig et a l . , 1983b). Sequencing of twenty-four target s i t e s has revealed the presence of the dinucleot ide TA f lanking the 1610 bp of Tel in each case (Mori et a l . , 1988; Eide and Anderson, 1988). This data could also be interpreted as a 1612 bp element in ser t ing between an unduplicated T and A residue. Tel has also been detected in C. elegans extrachromosomal DNA (Rose and Snutch, 1984; Ruan and Emmons, 1984). The extrachromosomal copies of Tel ex i s t for the most part in the form of 1.6 kb l i n e a r molecules whose ends are the termini of the inverted repeats; however, some 1.6 kb closed c i r c u l a r Tel elements are detected. The copy number of extrachromosomal c i r c u l a r and l i n e a r forms has been estimated at 0.1 to 1.0 per c e l l (Ruan and Emmons, 1984). It has been speculated that these extrachromosomal forms are e i ther the product of high-frequency somatic exc i s ion and/or an intermediate in the t ranspos i t ion process. These extrachromosomal Tel forms have been detected in BO only and not in N2 (Rose and Snutch, 1984). Excis ion of Tel from the BO s t r a i n has been observed (Rose et a l . , 1982; Emmons et a l . , 1983). This excis ion was shown to occur at high frequency (up to 10%) in the somatic c e l l s of the BO s t r a i n (Emmons and Yesner, 1984). Emmons and Yesner (1984) proposed that somatic excis ion could be regulated by a factor recognizing or involved with a germline/soma di f ference . Excis ion of Tel from the N2 s t r a i n was not invest igated. 15 The behavior of Tel varies d r a s t i c a l l y among s t r a i n s . As mentioned previous ly , the Tel copy number in BO i s a magnitude higher than in N2 (Liao et a l . , 1983). Examination of other C. elegans s t ra ins i so la ted from the wi ld showed the majority of s t ra ins to have Tel banding patterns resembling that of N2 (Emmons et a l . , 1983; Liao et a l . , 1983). The Tel elements in N2 have been very stable over long periods of time. Liao et a l . (1983) examined N2 lab s t ra ins and found no differences in the Tel banding pattern and loca t ion despite f i v e hundred generations of separation. Tel i s r e l a t i v e l y stable in the N2 genome and mobile in the BO genome. The unc-22 locus has been demonstrated to be a s i t e prone to Tel in se r t ions . When Moerman and Waterston (1984) examined nine C. elegans s t ra ins for spontaneous induction of unc-22 mutations, BO was the only s t r a in to exh ib i t a detectable induction rate (frequency 1 0 " 4 ) . These unc-22 mutations were unstable, revert ing at a frequency of 10" 3 to 10" 4 . This mutator a c t i v i t y could be d i l u t e d by outcrosses to N2. Spontaneous mutations in unc-54 were studied by Eide and Anderson (1985a, 1985b). None of s i x t y - f i v e unc-54 mutations in N2 were the re su l t of transposable element in se r t ions . In contrast , ten of eighteen unc-54 a l l e l e s in BO were Tel-induced and genet ica l ly unstable. Tel shares more behavioral t r a i t s with Mu than with P. The Mu element also undergoes frequent, spontaneous somatic excis ion (Robertson, 1978; Robertson, 1980). The Tel element excises continously throughout the nematode l i f e cycle (Emmons and Yesner, 1984); Mu somatic excis ion appears to be r e s t r i c t e d to quite l a t e in organ development (based on the small s ize of revertant sectors) (Robertson, 1980). In contrast , P mobi l iza t ion i s repressed in somatic t i s sue (Laski et a l . , 1986). Therefore, a germline/soma dif ference i s important in the regulat ion of these elements but P elements are commonly act ive in the germline while Tel and Mu elements are act ive in somatic t i s sues . Extrachromosomal forms of the Mul and Mul.7 elements have been detected as covalently closed c i r c u l a r DNA (Sundaresan and F r e e l i n g , 1987). Linear molecules were not found, unl ike the high proportion of extrachromosomal l i n e a r Tel elements (Rose and Snutch, 1984; Ruan and Emmons, 1984). The presence of these Mu extrachromosomal forms i s correlated with Mutator a c t i v i t y but not with Mu genomic copy number (Sundaresan and Free l ing , 1987). Extrachromosomal Tel l eve l s are also not correlated with copy number (Rose and Snutch, 1984; K.Beckenbach, Simon Fraser Univer s i ty , pers. comm.). No extrachromosomal forms of P have been detected. Transposable elements have proven to be useful tools in molecular b io logy. Tel elements, which create r e s t r i c t i o n fragment length differences (RFLDs) between s t r a i n s , can be mapped. This s i m p l i f i e s c loning of cer ta in genes or regions of the genome and the alignment of the genetic and physical map (Rose et a l . , 1982; F i l e s et a l . , 1983; B a i l l i e et a l . , 1985, Cox et a l . , 1985). The Robertson's mutator system has been exp lo i ted , much l i k e the C. elegans Tel mutator s t r a i n s , to tag genes of in teres t for c loning purposes ( L i l l i s and Free l ing , 1986; Moerman et a l . , 1986). Mutant a l l e l e s i so la ted in hybrid dysgenic crosses have been cloned using a P element as a probe (Searles et a l . , 1983). These mutator systems are influenced s i g n i f i c a n t l y by genetic background (Moerman and 17 waterston, 1984; Moerman et a l . , 1986; Bennetzen et a l . , 1987). Precise exc i s ion of a transposable element means that the DNA sequences of the inser t ion s i t e before the element inserts and af ter the element has vacated are i d e n t i c a l . Ac, T e l , and P have been demonstrated to undergo precise and imprecise e x c i s i o n ; with P elements, imprecise excis ion may occur as high as 75% of the time (Schwarz-Sommer et a l . , 1985; Daniels et a l . , 1985; Eide and Anderson, 1988; K i f f et a l . , 1988). The existence of imprecise exc i s ion allows these elements to leave " f o o t p r i n t s " (Schwarz-Sommer et a l . , 1985) at the s i te s they have vacated, poss ibly contr ibut ing to the evolut ion of these regions. D. Tel Elements in the C. elegans N2 Stra in The conservation of Tel elements in C. elegans was suggested to be r e l a t i v e l y high (Emmons et a l . , 1983; Liao et a l . , 1983). A c t u a l l y , only one Tel element has been completely sequenced (Rosenzweig et a l . , 1983a) and i t was from the BO s t r a i n . A survey of Tel elements in N2 and BO to invest igate conservation was carr ied out using a s ingle the r e s t r i c t i o n enzyme tfaelll (Emmons et a l . , 1983; Liao et a l . , 1983). A r e s t r i c t i o n s i t e variant of Tel was known to be present in BO (Rose et a l . , 1982; A. Rose, Univers i ty o f B r i t i s h Columbia, pers. comm.) C l e a r l y , a c loser examination of Tel s t ructura l homology was necessary to gain a better overa l l p icture o f the conservation of Tel family members. 18 E. T c l - h v b r i d i z i n q Repet i t ive Element Families in C. briggsae Transposable elements in nematodes other than C. elegans have not been studied extens ively . Two retrotransposon candidates have been i s o l a t e d . A retrotransposon, Tas, was cloned from Ascaris lumbricoides, a p a r a s i t i c nematode of the pig (Aeby el a l . , 1986). Tas has 256 bp long terminal repeats with an internal unique region of about 7 kb. A. lumbricoides undergoes chromatin e l iminat ion and two variant forms of Tas d i f f e r in the pattern of t h e i r e l i m i n a t i o n . PAT-1 i s a putative retrotransposon from Panagrellus redivivus, a gonochorist ic (male-female), f r e e - l i v i n g nematode (Link et a l . , 1987). PAT-1 was i d e n t i f i e d as an inser t ion in a spontaneous unc-22 mutant. Tel was the only inverted repeat transposable element known in nematodes p r i o r to t h i s study. A second species of nematode, Caenorhabditis briggsae, (Nigon and Dougherty, 1949) d i f f e r s anatomically from Caenorhabditis elegans in the arrangement of the male t a i l bursal rays only (Friedman et a l . , 1976). Sudhaus (1976) has compiled an evolutionary tree of the Caenorhabditis species. Emmons et a l . (1979) estimated overa l l nucleotide divergence at 20% from examining randomly co l l ec ted r e s t r i c t i o n fragment.length differences (RFLDs). When protein e lectrophoret ic comparisons were made (Butler et a l . , 1981), coding sequence divergence was estimated at 2% and But ler and associates proposed a lower l i m i t of ten m i l l i o n years for the separation of the two species. It has been d i f f i c u l t to estimate time of divergence as few morphological changes have occurred in the evolution of these species. It has been found that the coding 19 regions are conserved between the two nematode species (Snutch, 1984) and t h i s c r i t e r i a has been used advantageously in the search for coding regions in C. elegans (Heine and Blumenthal, 1986; S. Prasad, Simon Fraser Univer s i ty , pers. comm.; T. S tar r , Univers i ty of B r i t i s h Columbia, pers. comm.). F. Character izat ion of Tel Elements in C. elegans and Barney and  TCb2 Elements in C. briggsae In t h i s the s i s , I describe the cloning of a major proportion of the Tel elements in the N2 s t r a i n . The a b i l i t y of Tel elements in the N2 s t r a i n to somatical ly excise has been documented (Harris and Rose, 1986). These elements were compared by t h e i r r e s t r i c t i o n maps and, in some cases, DNA sequences. A few variant Tel structures were present but the majority of the elements were quite highly conserved. The genomic locat ion of these cloned elements, the nature of t h e i r in ser t ion s i t e s , and the possible co-habitat ion of these s i t e s by Tel elements in the BO s t r a i n was s tudied. I describe here the discovery of two fami l ies of transposable elements, Barney and TCb2, in the genome of C. briggsae. These element cross-hybridize at low stringency to Tel sequences. The C. briggsae elements have been p a r t i a l l y sequenced and show high sequence ident i ty with Tel in the major ORF. I have examined the basis of Tel s t a b i l i t y in the C. elegans N2 genome. Cloning of indiv idua l Tel elements from N2 followed by determination of t h e i r structure showed that the N2 elements are in general intact and exhib i t high sequence 20 conservation. N2 Tel elements were found to be capable of somatic e x c i s i o n . The p o s s i b i l i t y that Tel i s not confined to the C. elegans species was invest igated. This led to the i s o l a t i o n and character iza t ion of two related T c l - h y b r i d i z i n g transposable elements in the C. briggsae genome. 21 MATERIALS AND METHODS A. Nematode cul ture conditions and s t ra ins Nematodes were cultured in 60 mm petr i plates which had been f i l l e d with nematode growth media (see below) and streaked with E. coli 0P50 (a u r a c i l - r e q u i r i n g mutant) (Brenner, 1974). To grow nematode s t ra ins for DNA i s o l a t i o n , large plates (90 mm) were streaked with another E. coli s t r a in (K-12 t h i ) . Stocks were maintained at 16°C or 20°C, while a l l matings were car r ied out at 20°C. A mating general ly consisted of 8 to 10 mutant hermaphrodites and 12 to 16 males on a s ingle 60 mm pet r i p la te . Nematode growth media 75 mM NaCI 1.7 % agar 2.0 % bacto-peptone autoclaved and added: 26 uM cholesterol ( in 95% ethanol) 1 mM CaCl^ 1 mM MgS04 25 mM KH 2 P0 4 The C. elegans var. B r i s t o l ( s t ra in N2) and C. briggsae ( s t r a in G16) and ( s t ra in Z) were obtained from D. B a i l l i e , Simon Fraser U n i v e r s i t y , Burnaby, B r i t i s h Columbia and C. elegans 22 var. Bergerac ( s t ra in BO) was from D. Hi r sh , Univers i ty of Colorado, Boulder, Colorado, USA. The Caenorhabditis Genetics Center (CGC), Columbia, Mis sour i , USA provided the C. briggsae ( s t ra in BO). A l l the C. elegans mutant s t ra ins used in t h i s research were o r i g i n a l l y derived from the N2 s t r a in and were obtained from S. Brenner, Medical Research Counc i l , Cambridge, England, and the Caenorhabditis Genetics Center, Columbia, Mi s sour i , USA. Gene designations used are unc and dpy. The C. elegans nomenclature used in t h i s thesis follows the published guidel ines of Horvi tz et a l . (1979). B. Mater ia l s A l l chemicals were ana ly t i ca l or reagent grade. R e s t r i c t i o n enzymes were purchased from New England Biolabs , Bethesda Research Laboratories , Pharmacia, or Boehringer Mannheim and used as speci f ied by the supp l ie r . Mung bean nuclease, E. coli DNA Polymerase I (Klenow fragment), and E. coli DNA Polymerase I (Kornberg enzyme) were supplied by Pharmacia. Exonuclease I I I , SI nuclease, Low Melting Point (LMP) Agarose, and Proteinase K (chromatographically pur i f ied) were obtained from Bethesda Research Laboratories . T4 DNA l igase was supplied by Bethesda Research Laboratories and D. B a i l l i e , Simon Fraser Univer s i ty , Burnaby, B r i t i s h Columbia. DNAse I was supplied by Sigma Chemical CO. Pronase (Ex Strep. Griseus) was purchased from Calbiochem-Behring Corp. TEMED, Plus-X pan professional f i l m (10.2 X 12.7 cm), and X-OMAT RP diagnostic f i l m were supplied by the Eastman Kodak Co. Acrylamide was from Matheson, Coleman and Bel l Manufacturing Chemists. Bacto-tryptone and Bacto-peptone were 23 obtained from Difco Laboratories. [ c * 3 2 P ] dNTPs (2000-3000 Ci/mmol) were from e i ther New England Nuclear or Amersham Corp. N i t r o c e l l u l o s e and Nytran f i l t e r s were purchased from Schleicher and Schue l l . M13 ol igonucleot ide primers were supplied by M. Smith, Univer s i ty of B r i t i s h Columbia, Vancouver, B r i t i s h Columbia. Deoxy NTPs and dideoxy NTPs were obtained from BRL and Pharmacia. A l l other chemicals used were supplied by e i ther Fisher S c i e n t i f i c , Sigma Chemical Co . , or BDH Chemicals. C. Nematode DNA Preparation. Nematode DNA was i so la ted using a method modified from Emmons et a l . (1979). Large plates (10 to 120) were seeded with e i ther 1 to 10 nematodes or a 1 cm2 block of agar excised from a nematode maintenance p la te . The v a r i a b i l i t y in number of plates and s ize of i n i t i a l seeding was dependent on the amount of DNA required and the v i a b i l i t y of the s t r a i n . The nematodes were allowed to grow u n t i l a maximum y i e l d was reached. The nematodes were washed of f the plates using 20 to 40 ml of a 125 mM NaCI s o l u t i o n . Excess bacteria was removed by 3 centr i fugat ions at 1000 rpm for 5 min in a Western S i lencer H-103N centr i fuge. Pel leted nematodes were rinsed in 20 ml of fresh NaCI so lut ion after each sp in . Af ter the f i n a l centr i fuga t ion , the nematodes were resuspended in 2 to 10 volumes of a IX proteinase K buffer [0.1 M Tr i s (pH 8 .5) , 50 mM EDTA, 0.2 M NaCI, 1% SDS] and 200 ug/ml proteinase K. The sample was incubated at 65°C for 20 to 30 min, invert ing the tube gently and occas ional ly u n t i l the solut ion became viscous and c l e a r . 24 The sample was extracted 3 times with phenol and once with chloroform/isoamyl alcohol [24:1 ( v / v ) ] . The DNA was prec ip i ta ted for 1 hr to overnight at -20°C with 2.5 volumes of 95% ethanol . The DNA p e l l e t was dr ied and resuspended in 9 ml IX TE (10 mM T r i s , 1 mM EDTA; pH 7.4) . CsCl (8 g) and 1 ml EtBr (10 mg/ml) were added before loading into Beckman polyallomer heat-sealable centrifuge tubes. A CsCl gradient was produced by centr i fugat ion in a Beckman 70Ti rotor at 60,000 rpm for 20 hr at 20°C. The band of genomic DNA was co l l ec ted using a 20 gauge needle and the EtBr removed with sa l t - saturated (5 M NaCI, 10 mM T r i s , 1 mM EDTA; pH 8.5) isopropanol extract ions (Davis et a l , 1980). The DNA solut ion was d i l u t e d with 2 volumes of H 20 and DNA prec ip i ta ted by the addit ion of 6 volumes of 95% ethanol (-20°C overnight) . The pel leted DNA was r insed with 70% ethanol , followed by drying and resuspension in IX TE. The DNA was treated with one-twentieth volume boi led RNAse I (1 mg/ml) for 30 min at 37°C and stored at 4°C. D. Molecular B io log i ca l Techniques 1. Bacter ia l Strains E. coli CgQQ [ r k ~ m k + ] p la t ing c e l l s were used to propagate X Charon 4 bacteriophage. E. coli JM83 (Messing, 1979) [ara A( l ac -pro ) rpsL t h i ^>80dlacZAM15] was used to propagate pUC19 plasmids. DH5<x(Hl; Bethesda Research Laboratories Focus V o l . 8 , No.2, p .8 , 1986)[F" endAl hsdR17 ( r k " , m k +) supE44 t h i - 1 X recAl gyrA96 re lA lA( l acZYA-argF ) U169^80dlacZAM15] was used to propagate Bluescr ipt vector clones. Growth was in LB medium (10 g/1 Bacto-tryptone, 5 g/1 yeast extract , 10g/l NaCI). LB/agar medium for plates also contained 10 g/1 agar. 25 2. Agarose gel electrophoresis DNA samples were electrophoresed in agarose gels (Maniatis et a l , 1982) at concentrations ranging from 0.5% for genomic samples to 1.0% for small plasmid fragments. The agarose was prepared with IX Tris-borate buffer (89 mM T r i s , 89 mM boric ac id , 2.5 mM EDTA; pH 8.3) and contained 0.75 mg/ml EtBr. One-tenth volume loading buffer (10X LB = 25% F i c o l l 400, 0.25% bromophenol blue, 0.25% xylene cyanol prepared with IX Tris-borate buffer) was added p r i o r to e lectrophores i s . The 0.5% or 0.7% agarose gels (of dimensions of e i ther 4 X 145 X 200 mm or 4 X 145 X 250 mm) were run at 40 V overnight. The 1.0% agarose gels were run at 60 V overnight. Small 0.7% agarose gels (3 X 62 X 101 mm) were run for 1 to 2 hr at 100 V. DNA samples were v i sua l i zed by fluorescence with e i ther 302 or 365 nm u l t r a v i o l e t l i g h t . 3. E lec t roe lu t ion Individual DNA bands were i so la ted from agarose gels by exc i s ion with a spatula (Maniatis et a l , 1982). Each band was placed wi th in a 10 X 120 mm d i a l y s i s tubing (pre-washed and boi led i n i t i a l l y in a 2% NaHC0 3/l mM EDTA solut ion and f i n a l l y in dH20) with 0.5X Tris-borate buffer . The tubing was clamped shut and placed in a submarine gel box containing 0.5X Tris-borate buffer , perpendicular to the current . E lec t roe lu t ion was at 200 V for 1 hr . The d i a l y s i s tubing was then removed and suspended in a 5 ml test tube. The bottom of the tubing was punctured care fu l ly with a 27 gauge needle and the test tube was centrifuged for 5 min at 1470 g. The eluted 26 sample was ethanol-precipi tated at -20°C after the addit ion of one-tenth volume 3 M KAc. The DNA fragment was resuspended in IX TE and the concentration estimated on a agarose/EtBr plate (Davis et a l , 1980). 4. Nick Translat ion DNA probes used in plaque h y b r i d i z a t i o n , colony h y b r i d i z a t i o n , and plasmid and genomic hybr id iza t ion were l a b e l l e d by n i c k - t r a n s l a t i o n (Rigby et a l , 1977; Maniatis et a l , 1982). The basic react ion was carr ied out with 100-250 ng DNA, 2.5 ul 10X nick t r a n s l a t i o n buffer [10X NTB = 0.5 M Tris(pH 7.5) , 0.5mg/ml BSA, 0.1 M M g C l 2 , 10 mM DTT], 2.5 ul dXTP-NTP (0.2 mM each dXTP minus dNTP containing 3 2 P ) , 1 ul DNAse 1(100 p g / u l , f reshly d i l u t e d from 1 ug/ul stock in IX nick t r ans l a t ion buf fer ) , 3.5 units DNA Polymerase I (Kornberg enzyme), 30 to 50 uCi (<x?2P) dNTP, plus H 20 to 25 u l . The react ion was incubated for 2 hr at 16°C and 25 ul of a stop mix (0.02 M EDTA, 2 mg/ml sonicated c a l f thymus DNA, 0.2% SDS) was added. The unincorporated r a d i o a c t i v i t y was removed by passage through a spin column (Snutch, 1984). Preparation of a spin column involved packing Sephadex G25 medium beads (suspended in 0.2X TE) in a 1 ml pipette t i p ( t i p end plugged with s i l a n i z e d glass wool) . The packing was accomplished using a vacuum, succeeded by a 2 min - 1470 g centrifuge spin with 50 ul IX TE. The nick t r ans l a t ion reaction was added to the column and spun for an addit ional 2 min. The eluted probe had an average spec i f i c a c t i v i t y of 4 X 10 7 cpm/ug for fragment probes and 1 X 10 8 cpm/ug for whole plasmids (Cerenkov counts) . 27 5. Southern Hybr id i za t ion . DNA electrophoresed in agarose gels was t ransferred , e i ther b i d i r e c t i o n a l l y (Smith and Summers, 1980) or u n i d i r e c t i o n a l l y (Meinkoth and Wahl, 1984), to n i t r o c e l l u l o s e or Nytran for 2 hr to overnight. To prepare the agarose for the t rans fer , the gel was soaked in the f o l l o w i n g : a 0.25 M HCI so lut ion at room temperature for 30 min, a 0.5 M Na0H/1.5 M NaCI so lut ion for 30 min, and a 1 M NH4Ac so lut ion for 1 hr . F i l t e r s were baked for 1 to 2 hr at 80°C. While heating, n i t r o c e l l u l o s e was kept under vacuum. The prehybr id iza t ion/hybr id iza t ion so lut ion u t i l i z e d was 5X SSPE [5X = 0.9 M NaCI, 0.05 M disodium hydrogen phosphate, 5 mM EDTA (pH 7.0)]/0.3% SDS (approximately 0.5 to 1.0 ml per 100 cm3 of f i l t e r ) . The probe was denatured p r i o r to hybr id iza t ion in b o i l i n g H2O for 10 min, followed by quick c h i l l i n g on i c e . Genomic hybr id iza t ions were preceded by pre-hybr id izat ion at the incubation temperature for 0.5 hr . F i l t e r s were hybridized for at least 20 hr at 62°C. The fol lowing types of washes (with constant ag i ta t ion in a waterbath) were carr ied out for 2 hr with two changes of wash: a) low stringency - 45°C in 2X SSPE, 0.2% SDS. b) moderate stringency - 62°C in 2X SSPE, 0.2% SDS. c) medium stringency - 52°C in 0.2X SSPE, 0.1% SDS. d) high stringency - 68°C in 0.2X SSPE, 0.1% SDS F i l t e r s were exposed to Kodak X-0MAT RP f i l m with in tens i fy ing screens at room temperature. 28 E. I so la t ion of Phage 1. L ibrary Screening and Bacteriophage 7\ P u r i f i c a t i o n . Host bacter ia c e l l s were grown overnight in 10 ml LB medium and pe l le ted in a centrifuge at 2000 rpm for 10 min. C e l l s were resuspended in 5 ml of 10 mM MgS04. Phage stocks were d i l u t e d with bacteriophage /\ de le t ion mixure (7) d i l ) [10 mM T r i s (pH 7.5) , 10 mM MgSO^ to obtain the desired concentration. P la t ing bacter ia (0.2 ml) were mixed with phage and incubated at room temperature for 13 min to allow phage adsorption. Top agar (2.5 ml of 0.7% at 45°C) was added to the cell/phage mixture and immediately plated onto nutr ient agar p la tes . The plates were incubated at 37°C for 12 to 15 hr . Bacteriophage lambda recombinant l i b r a r i e s were screened by plaque hybr id iza t ion (Benton and Davis, 1977; Maniatis et a l , 1982). Phage were plated out in LB medium/top agar (0.7 g/1 agar) with a maximum density of 5 X 10 3 co lonies /p la te and incubated overnight at 37°C. N i t r o c e l l u l o s e f i l t e r s (82.5 mm diameter) were l a i d down over the top agar u n t i l moistened and needle holes were inserted to aid in f i l t e r o r i e n t a t i o n . The f i l t e r was washed for at least 30 sec in 3 successive so lu t ions : a) 0.1 M NaOH, 1.5 M NaCI, b) 0.2 M T r i s , 2 mM EDTA, and c) 2X SSPE (see section H). The f i l t e r s were baked under vacuum at 80°C for 1 hr . Hybridizat ion was carr ied out as per southern hybr id iza t ion using 5 X 10^ cpm(Cerenkov) of l abe l l ed probe/round f i l t e r . Plaques tes t ing pos i t ive in the hybr id iza t ion were picked with a toothpick and suspended in 1 ml 7\ d i l with 10 ul CHC1 3. Three successive plaque hybr id izat ions were carr ied out for each pos i t ive phage clone to ensure p u r i t y . 29 Phage stocks were prepared by p la t ing 5 X 10^ pfu (plaque forming units) on a 85 mm pla te . Plates were incubated at 37°C u n t i l confluent l y s i s occurred. Plates were overlayed with 5 ml cold d i l and l e f t at 4°C for 12 hr . The ^ d i 1 was co l l ec ted with a pasteur pipette and 100 ul of C H C I 3 added. Any bacter ia l debris was pe l le ted by centr i fugat ion at 1000 rpm for 5 min in a Western S i lencer H-103N centr i fuge . The supernatant was stored at 4°C af ter 20 ul chloroform had been added. 2. Phage DNA I s o l a t i o n . Bacteriophage DNA was p u r i f i e d using a PEG/NaCl p r e c i p i t a t i o n method (Maniatis et a l , 1982). Each phage clone was plated on 10 LB medium/agar plates with about 5 X 10^ pfu, using 2.5 ml top agarose, and allowed to grow to confluent l y s i s . Cold d i l (5 ml) was overlayed each plate and the plates stored at 4°C for 12 to 16 hr . The?) d i l was removed from the plates to a 50 ml centrifuge tube and centrifuged at 12,000 g for 10 min after the addit ion of 100 ul C H C I 3 . The supernatant (phage t i t e r at least 1 X 1 0 1 0 pfu/ml) was transferred to a fresh tube. NaCI (3 g) and PEG 6000 (5 g) were added successively and dissolved slowly by s w i r l i n g . The phage mixture was kept in an ice water bath for 1 hr to allow p r e c i p i t a t i o n of phage p a r t i c l e s . The phage were centrifuged at 39,000 g for 10 min at 4°C. The p e l l e t was dissolved in 9 ml d i l , ensuring complete resuspension before the addit ion of 6.75 g CsCl . The so lut ion was transferred to heat-sealable centrifuge tubes and centrifuged at 60,000 rpm for 20 hr at 20°C (Beckman 70Ti r o t o r ) . The phage band was recovered and the phage/CsCl sample was stored at -4 °C. 30 The DNA was extracted from the phage p a r t i c l e s using a formamide procedure (Davis et a l , 1980). One volume of the phage/CsCl sample (usually 150 ul) was mixed with one-tenth volume 2 M T r i s / 0 . 2 M EDTA (pH 8.5) in a polypropylene microfuge tube. After the addit ion of one volume of formamide, the sample was stored in the fumehood at room temperature for 1 to 3 hr . One volume of H 20 and 6 volumes of 95% ethanol were added and DNA sedimented in a microfuge at 16,000 g for 4 sec. The prec ip i t a te was r insed with 70% ethanol and the DNA resuspended in IX TE. F. Plasmid Preparation Techniques 1. Plasmid Ligat ion To subclone phage fragments, phage DNA fragments ( i so la ted with formamide) were digested with r e s t r i c t i o n enzymes and the r e s t r i c t i o n enzymes denatured by heating to 70°C for 10 min. Plasmid inserts to be subcloned were i so la ted by electrophoresis and e l ec t roe lu t ion of desired bands. pUC19 (Yanisch-Perron et a l . , 1985) and Bluescr ipt (-) plasmid vectors were used for subcloning. A l i g a t i o n reaction (Maniatis et a l , 1982) contained 50 ng cut plasmid, 0.5 ug cut inser t or phage (10X excess inser t over plasmid), 5 ul 10X l i g a t i o n buffer [0.66 M Tr i s (pH 7.6) , 66 mM M g C l 2 ] , 5 ul 10 mM ATP, 5 ul 1 mg/ml BSA, 5 ul 0.1 M DTT, and H 20 to 50 u l . The react ion mixture was incubated for 3 hr at room temperature to overnight at 16°C. Post-1igation mixes were stored at -20°C. 31 2. Plasmid Transformation Bacter ia l c e l l s were made competent by incubation in CaCl2 (Morrison, 1979). Addit ion of g lycerol (14%) allowed storage of competent c e l l s at -70°C for 1 to 2 years. For transformation of plasmids, c e l l s were removed from the freezer and allowed to thaw on ice for 10 min. Plasmid l i g a t i o n mixture (5 ul) was mixed with 50 ul c e l l s and kept at 0°C for 30 min. C e l l s were heat-shocked at 42°C for 2 min and d i l u t e d into 50 volumes of LB medium. Af ter a 15 min incubation at 37°C, 50 to 200 ul of transformation mix were plated on LB medium/agar plates (supplemented with 50 ug/ml a m p i c i l l i n , 40 ug/ml Xgal , 160 ug/ml IPTG) and incubated for 14 to 20 hr at 37°C. To confirm that the desired plasmid was obtained, colony hybr id iza t ions were often performed in addit ion to s i z i n g the inser t by gel e lectrophores i s . 3. Colony Hybrid izat ion Bacter ia l colonies which contained recombinant plasmid DNA were screened by a modified colony hybr id iza t ion method i n i t i a l l y developed by Grunstein and Hogness (1975). A n i t r o c e l l u l o s e f i l t e r (82.5. mm diameter) was divided into squares with a f e l t - t i p marker (usual ly 25 to 42 squares per f i l t e r ) and placed on an ampicillin-supplemented nutrient agar p la te . Single white colonies from a transformation plate were picked and streaked for s ingle co lonies . Single colonies were transferred to the n i t r o c e l l u l o s e f i l t e r . Bacter ia l s t r a i n s , containing DNA which would act as pos i t ive and negative controls during the h y b r i d i z a t i o n , were also 32 transferred to the f i l t e r . Colonies were allowed to grow overnight. The f i l t e r was then treated in the fol lowing manner: f i l t e r s were removed from the plate and f loated on a) 1 N NaOH for 5 to 10 min, b) 1 M T r i s (pH 7.4) for 1 min, c) 1.5 M NaCl/0.5 M Tr i s (pH 7.4) for 5 min, and allowed to dry for 5 min. The f i l t e r was inverted (DNA-side down) onto a pronase so lut ion (2X SSPE, 2 mg/ml pronase) for 15 min at room temperature and then dried r i ght - s ide up. Washings were car r ied out successively in 95% ethanol, CHC1 3, and 0.3 M NaCI. The n i t r o c e l l u l o s e was baked at 80°C for 1 hr and hybridized as per plaque hybr id i za t ions . 4. Plasmid Macropreparation - Lysis bv Tr i ton X-100 Af ter chloramphenicol ampl i f i c a t ion , plasmid DNA was prepared by Tr i ton X-100 l y s i s of transformed bacter ia l c e l l s by the modified cleared lysate procedure (Kahn et a l , 1979). A 10 ml LB medium cul ture containing a m p i c i l l i n (50 ug/ml) was innoculated with a s ingle transformed bacter ia l colony. After overnight growth at 37°C, i t was used to innoculate 500 ml LB in a 2 1 f l a sk . The cul ture was incubated at 37°C for 3.5 to 5 hr with vigorous shaking u n t i l e i ther the ODQQQ equalled 0.4 or a v i sual estimation of t h i s stage was reached. Ampl i f i ca t ion of plasmid DNA in t h i s cul ture was by the addit ion of 1 ml chloramphenicol (80 mg/ml in 95% ethanol) and continued incubation for 12 to 16 hr . The c e l l s were harvested by centr i fugat ion at 7000 rpm for 10 min at 4°C. The supernatant was discarded and c e l l s were resuspended in 5 ml cold 25% sucrose in 50 mM T r i s (pH 8 .0 ) . To th i s mixture were added 1 ml lysozyme [5 mg/ml in 0.25 M Tr i s (pH 8.0)] and 2 ml 0.25 M EDTA (pH 8.0) . The sample 33 was swir led on ice for 10 min. Tr i ton l y t i c mixture [0.1% Tr i ton X-100, 60 mM EDTA (pH 8 .0) , 5 mM Tr i s (pH 8.0)] (8.5 ml) was added and stored on ice an addit ional 15 min. Centrifugation was at 19,000 rpm for 1 hr at 4°C. The top 15 ml of supernatant was transferred to another tube containing 23 ml of a saturated CsCl so lut ion and 1 ml EtBr . The DNA was ul tracentr i fuged and further treated as described in the nematode DNA preparation section (see section C) . 5. Plasmid Minipreoaration - A l k a l i n e Lysis An a l k a l i n e l y s i s procedure was used in small-scale plasmid DNA p u r i f i c a t i o n (Maniatis et a l , 1982). LB medium (5 ml) containing 50 ug/ml a m p i c i l l i n was innoculated and grown overnight at 37°C. Bacter ia was centrifuged for 5 min at 2000 rpm and supernatant removed by a s p i r a t i o n . The p e l l e t was resuspended in a 100 ul i ce -co ld so lut ion of 50 mM glucose, 10 mM EDTA, 25 mM Tr i s (pH 8.0) and transferred to a 1.5 ml microfuge tube. This mixture was stored at room temperature p r i o r to the addit ion of a 200 ul freshly-prepared, i ce-co ld 0.2 N NaOH/1% SDS s o l u t i o n . The tube was inverted several times to mix and stored on ice for 5 min. Ice-cold 3 M potassium acetate-acetic acid so lut ion (prepared by adding 11.5 ml g l a c i a l acet ic acid and 28.5 ml h^O to 60 ml 5 M potassium acetate) (150 u l ) was added. The tube was vortexed gently in an inverted pos i t ion for 10 seconds and stored on ice for 5 min. The plasmid preparation was spun in a microfuge for 10 min at 4°C and the supernatant removed to a new tube. An equal volume of 50% phenol/50% chloroform/isoamyl alcohol (24:1 (v/v)) was mixed with the sample and, af ter a 5 min centr i fugat ion , the top layer was 34 transferred to another tube. Two volumes of 95% ethanol at room temperature were added and the DNA centrifuged for 10 min at 15,000 g. The p e l l e t was rinsed with 70% ethanol and dried under vacuum. 45 ul of IX TE and 5 ul 1 mg/ml boi led RNAse were added and incubated for 30 min at 37°C. At t h i s point , the plasmid miniprep could be r e s t r i c t i o n digested (using 1 to 3 ul plasmid prep/agarose gel l ane) . G. DNA Sequencing 1. Plasmid p u r i f i c a t i o n and denaturation To prepare plasmid minipreps for sequencing, 30 ul of a 20% PEG 6000/2.5 M NaCI so lut ion were mixed well with the TE-RNAse plasmid mix and stored on ice for 1 hr (Hattori and Sakaki, 1986). Af te r a 15 min centr i fuga t ion , as much as possible of the PEG so lut ion was removed. The tube was rinsed with 70% ethanol and recentri fuged. The DNA was dried under vacuum and e i ther stored at -20°C or resuspended in 20 ul IX TE p r i o r to loading on a 0.8% low melting point agarose g e l . Af ter e lectrophores i s , the supercoiled plasmid band was excised from the g e l . IX TE was added to the agarose block (placed in a 1.5 ml microfuge tube) to a f i n a l volume of 0.5 ml . The agarose was extracted two times at 75°C with an equal volume of IX TE-saturated phenol. The aqueous so lut ion was extracted once more with an equal volume of chloroform/isoamyl alcohol [24:1 ( v / v ) ] . The DNA was prec ip i ta ted with 2.5 volumes of 95% ethanol and a 0.5 volume of 5 M ammonium acetate at -20°C for 1 hr . Af ter centr i fuga t ion , the DNA was rinsed with 70% ethanol and dr ied under vacuum. 35 P r i o r to sequencing, the DNA was a lka l ine denatured (Hattori and Sakaki , 1986). IX TE (36 ul) was added to the supercoiled plasmid and the so lut ion s p l i t into two a l iquot s . 2 N NaOH (2 ul) was added to each a l iquo t . Af ter 5 min at room temperature, 8 ul of f i l t e r - s t e r i l i z e d 5 M ammonium acetate (pH 7.4) and 100 ul 95% ethanol were used to prec ip i t a te the DNA at -70°C in 5 min. A 15 min centr i fugat ion and 70% ethanol r inse were followed by dess icat ion under vacuum. This denatured DNA p e l l e t was stored at -20°C for up to 3 weeks before sequencing. 2. Deletion Clones To prepare successively deleted clones of a plasmid i n s e r t , the exonuclease III/S1 nuclease delet ion procedure of Henikoff (Henikoff, 1987) was performed. The plasmid was digested with one r e s t r i c t i o n enzyme to create a 5' overhang adjacent to the inser t and with a second r e s t r i c t i o n enzyme to create a 3' overhang adjacent to the plasmid sequences. After digest ion was f u l l y complete, an equal volume of 50% phenol/50% chloroform/isoamyl alcohol [24:1 (v/v)] was added and an extract ion of the aqueous layer was carr ied out. The DNA was prec ip i ta ted with 95% ethanol in the presence of 0.2 N NaCI. The dr ied p e l l e t was resuspended in 60 ul Exonuclease buffer [66mM T r i s (pH 8 .0) , 0.66 mM M g C l 2 ] . The concentration was checked to ensure approximately 5 ug of DNA were present. The sample was incubated at 37°C and 500 units of exonuclease III were added. At 30 sec in terva l s af ter the exonuclease add i t ion , 2.5 ul a l iquots were removed to ind iv idua l 0.5 ml microfuge tubes containing 7.5 ul SI Mix (see below) and stored on i c e . Eight a l iquots were co l lec ted for 36 every 1 kb of i n s e r t . Once a s u f f i c i e n t number of a l iquots were t rans ferred , the SI sample mixes were kept at room temperature for 30 min. SI Stop mix (0.3 M Tris-OH, 0.05 M EDTA) (1 ul) was added to each tube. The samples were incubated for 10 min at 70°C. The tubes were then placed in a 37°C incubator. A 5 min incubation with 1 ul Klenow Mix [0.2 M T r i s - H C l , 0.1 M MgCl 2 , 0.1 unit of DNA Polymerase I (Klenow)/l ul Klenow Mix] was followed by a 5 min incubation with 1 ul of a 0.125 mM dNTPs s o l u t i o n . Af ter removal to room temperature, each sample was mixed with 40 ul Ligase mix (see below). L igat ion was carr ied out overnight at 16°C. To transform, 2 to 3 ul of each l i g a t i o n sample were removed and pooled together. Freshly thawed c e l l s (100 ul) were added to the pooled samples, mixed, and stored on ice for 30 min. Af ter a 2 min heat shock, the transformation mixture was d i lu ted with 1 ml LB medium and incubated at 37°C for 15 min. The c e l l s (100 to 200 ul) were plated on ampicill in-supplemented nutr ient agar p la tes . SI Mix 27 ul 10X SI buffer 172 ul H 20 60 units SI nuclease IPX SI buffer 0.3 M potassium acetate 2.25 M NaCI 45% glycerol 10 mM ZnS04 37 Liqase Mix 125 ul 10X Ligase buffer 870 ul H 20 25 units T 4 DNA l igase IPX Liqase buffer 0.66 M T r i s (pH 7.6) 10 mM MgCl 2 10 mM d i t h i o t h r e i t o l 0.1 mg/ml BSA 1 mM spermidine 0.2 mM ATP 3. Dideoxv DNA Sequencing Deletion clones were sequenced by the dideoxy chain terminator method (Sanger et a l , 1977) with double-stranded templates (Hattori and Sakaki, 1986). Dessicated, denatured plasmid DNA (1 to 2 ug) was mixed with 1 ul M13 ol igonucleot ide primer (5 n g / u l ) , 1.5 ul 10X Klenow buffer (70 mM Tr i s (pH 7.5) , 0.2 M NaCI, 70 mM MgCl 2 , 1 mM EDTA), and 9.5 ul H 2 0. The M13 forward primer was the 17-mer 5'-TCACGACGTTGTAAAAC-3' and the reverse primer was 5'-CAGGAAACAGCTATGAC-3'. The sample was heated for 15 min at 60°C and removed to room temperature for another 15 min. DNA Polymerase I (Klenow fragment) (3 units) and 20 uCi t l 2 P)dATP were added. The mixture was divided into 4 tubes, each containing 2 ul of one of the four dideoxynucleotide mixes (see below). Reactions were conducted 38 at a constant temperature ( in the range of 42 to 48°C) for 10 min. A chase so lut ion (0.5 mM dATP) (1 ul) was added and kept at the same temperature for an addit ional 10 min. The addit ion of 5 ul of a formamide dye so lut ion (95% formamide, 12.5 mM EDTA, 0.1% bromophenol blue, 0.1% xylene cyanol) preceded the transfer of samples to i c e . Samples were heated at 80 to 90°C for 3 min before loading 1 or 2 ul (volume dependent on use of 24 or 48 well sharkstooth comb) on a 6% or 8% acrylamide-7 M urea sequencing g e l . Af ter loading, the sequencing samples were immediately stored on i c e . Electrophoresis was ca r r i ed out at 50 W (constant power) using 0.5X Tris-borate as a running buffer . An aluminum plate was clamped to the front of the gel plate to d i s t r i b u t e heat evenly. Each react ion was loaded at times 0 and 1.5 hr with a f i n a l electrophoresis time of 3 hr . Af ter e lectrophores i s , the gel was transferred to Whatmann 3 MM paper and dr ied at 80°C using a vacuum gel dryer . Autoradiography was at room temperature without in tens i fy ing screens for 4 to 48 hr . 4. Computer Sequence Analysis DNA sequences were entered into a computer and analyzed using the Delaney sequence program. Overlapping sequences were aligned using the DB system (Staden, 1980). Sequence figures were presented with the aid of the ESEE sequence edi tor (provided by E. Cabot, Simon Fraser U n i v e r s i t y ) . ddNTP Mixes in um ddATP mix ddCTP mix ddGTP mix ddTTp mix dCTP cGTP dTTP ddATP ddCTP ddGTP ddTTP Re 110 110 110 25 jady-made ddN" 16 110 110 150 "P mixes fror 110 11 110 200 i Pharmacia v 110 110 11 1000 *ere also us 40 RESULTS A. Character izat ion of C. elegans s t r a in N2 Tel Elements 1. L ibrary screening and subcloning of N2 Tel elements In order to examine the structure and locat ion of N2 Tel elements, Tel-containing phage were i so lated from phage l i b r a r i e s containing DNA from C. elegans s t r a i n N2 or N2/B0. Two screens of a 7) Charon 4 (par t i a l fcoRl) l i b r a r y (provided by T. Snutch, Simon Fraser Univers i ty) y ie lded a to ta l of 27 phage. In the second screen, both strongly hybr id iz ing and weakly hybr id iz ing phage were picked. This was done to ensure that phage containing p a r t i a l or degenerate Tcls would be recovered. A l l of the weakly hybr id iz ing plaques picked were demonstrated not to contain T e l - h y b r i d i z i n g sequences and were discarded. A l l phage were p u r i f i e d by p la t ing and rehybr id iz ing with Tel three times. DNA i so la ted from the phage clones was analyzed by fcoRl digest ion and agarose gel e lectrophores i s . Southern hybr id iza t ion with a Tel probe (an fcoRV e lectroe luted fragment of the central 1572 bp of a 1610 bp Tel) showed that each of these phage contained only one T e l - h y b r i d i z i n g FcoRl band. The Tel-containing fcoRl fragment of each phage was subcloned into the fcoRl s i t e of pUC19, with the fol lowing 41 exceptions. Three phage, KR#38, KR#45, and KR#59, had inserts too large to be subcloned in t h i s way. For KR#38 and KR#59, an EcoRl /W/ndl l l inser t was subcloned into pUC19. For KR#45, an £coRl/5a7I fragment containing a subfragment of Tel .30 was subcloned into pUC19. R e s t r i c t i o n enzyme maps of the Tel-containing plasmids were constructed using s ingle and double digestions with the enzymes Hindlll, Sail, Xhol, and EcoRV. Plasmids with s i m i l i a r r e s t r i c t i o n maps had t h e i r co- ident i ty confirmed by cros s -hybr id iza t ion with Tel f lanking sequences. Duplicate cloned Tcls were discarded. From the 27 p u r i f i e d phage, 13 d i s t i n c t N2 Tel elements were obtained. Several addit ional elements were obtained from other inves t iga tor s . The Tel element contained wi th in pCeh27 was i so la ted by J . McDowall in t h i s laboratory from a ?> gtlO l i b r a r y constructed by K. Beckenbach using DNA from C. elegans s t r a in KR408. This l i b r a r y was made from a N2/B0 hybrid s t r a i n . The Tel element of pCeh57 was i so la ted by R. Mancebo from a N2 EMBL4 (pa r t i a l Mbol) l i b r a r y (constructed by C. Link, Univers i ty of Colorado). An addit ional two N2 Tel elements were contained in a plasmid named pCel005 (a g i f t from V. Ambros, Harvard U n i v e r s i t y ) . This plasmid contained a 6.3 kb N2 Hindlll fragment in the vector pBR329. A 4.0 kb fcoRl fragment (containing both Tcls) was subsequently subcloned into pUC19 and named pCeh62. With the addit ion of these four T c l s , seventeen out of the approximately t h i r t y Tcls in the N2 genome have been subcloned and characterized (Table 3 ) . The copy number of t h i r t y i s estimated from 42 Table 3. Summary of cloned N2 Tel elements Phage Canonical Plasmid fcoRl Genomic KR# Tel Tc l-conta ining Tel-deleted Band Size 45 .30 pCehl5 - >10.0 38 (1.7).28 pCehl4 pCeh45 >10.0 59 .26 pCehl3 pCeh44 >10.0 40 .21 pCehll pCeh42 8.0 39 .18 pCehlO pCes237 5.2 60 .17 pCeh57 pCeh59 5.0 55 (0.9).14 pCeh9 - 4.2 43 .13 pCeh8 pCeh41 4.2 54 (Eco).12 pCeh7 pCeh63 4.0 - .10a pCeh62(pCeh64) - 4.0 (1.5).10b (pCeh66) 35 (Hpa-).9 pCeh6 pCeh51 4.0 58 .7 pCeh4 pCeh29 3.2 34 .6 pCeh3 pCeh39 2.6 44 .3 pCeh2 pCeh38 2.1 36 (0.9) .2 pCehl pCeh37 2.0 62 .1 pCeh27 pCeh47 2.0 kb A l i s t of the Tel elements and t h e i r associated plasmids i s l i s t e d above. Tel.10a and Tel(1.5).10b are both contained within pCeh62 and i n d i v i d u a l l y subcloned wi th in pCeh64 and pCeh66. the number of bands in an EcoRl digest of genomic N2 DNA probed with a T c l - s p e c i f i c probe. The cloned Tel elements have been ordered and named by numbering the T c l - h y b r i d i z i n g bands beginning with the smallest band (e .g . T c l . l ) (Figure 2 ) . Three addit ional elements have been t e n t a t i v e l y l abe l l ed Te l .26 , Te l .28 , and Te l .30 . These elements reside on large fcoRI fragments that have not been d i r e c t l y cloned and c o r r e c t l y s i zed . Consequently, i t i s d i f f i c u l t to a l ign these fcoRI fragments unequivocally to the Tel genomic bands. The Tel.30 inser t ion has apparently occurred in r e p e t i t i v e DNA sequences. The 2.8 kb sequence f lanking Tel .30 hybridize to three major and f ive minor N2 DNA bands, a l l l a rger than 9 kb (Figure 3 ) . The upper major band on the o r i g i n a l autoradiograph was c l e a r l y a doublet. This pattern has been reproduced on other b l o t s . When t h i s f i l t e r i s hybridized with a unique probe, no bands due to p a r t i a l digests are seen. 2. Mapping. Res t r i c t ion s i t e and DNA sequence analysis of N2  Tel elements The majority (11/16 examined) of the N2 Tel elements have the same r e s t r i c t i o n map. The r e s t r i c t i o n maps of the N2 Tcls were compared to the r e s t r i c t i o n map derived from a BO Tel sequenced by Rosenzweig et a l . (1983a) (Figure 4) . A c o l l e c t i o n of r e s t r i c t i o n enzymes with four to s ix basepair recognit ion s i te s known to cut at least twice in the canonical Tel sequence was used. These enzymes are: EcoRV, Sa7I, Xhol, Avail, Rsal, Ddel, Hpall, and BstM. 44 Figure 2. I d e n t i f i c a t i o n of cloned N2 EcoRl fragments containing Tel elements Mixed fcoRl digests of 12 plasmids containing 13 N2 Tel elements were loaded in each of two lanes in a 0.5% agarose g e l . Each lane contained a to ta l of 1 ng of each cut plasmid. The adjacent lane was loaded with 4 ug of fco-digested N2 genomic DNA. After e lectrophores is , the gel was blotted to Nytran and hybridized under medium stringency conditions with a fcoRV Tel fragment probe of T c l . l (an fcoRV fragment of the central 1572 bp of T e l ) , lane a) N2 Tel elements [ T c l . l , T c l ( 0 . 9 ) . 2 , T e l . 3 , T e l . 6 , T e l . 7 , Tcl (Hpa-) .9 , Tel .10a, Tcl (1 .5) .10b, Te l .13 , Tc l (0 .9 ) .14 , Te l .17 , Te l .18 , and Tel.30] lane b) N2 genomic, lane c) N2 Tel elements (repeat of lane a) . The genomic N2 Tel bands were numbered consecutively beginning at the lowest molecular weight band ( T c l . l ) . The genomic bands corresponding to the cloned Tel elements are l a b e l l e d . The T c l - h y b r i d i z i n g fcoRl bands in the N2 lane are not a l l c l e a r l y resolved. The numbering of T c l . l and Tc l (0 .9 ) .2 as well as Tcl(Hpa-).9 and Tc l . l 0a /Tc l (1 .5 ) .10b i s a r b r i t r a r y . Size markers on the l e f t of the gel are posit ions of fragments from SstIl/Hindl11 ? and are 20.3, 9.4, 4.4, 3.8, 2.8, 2 .3 , and 2.0 kb. 45 F igu re 3 . N2/B0 h y b r i d i z a t i o n pa t te rn o f the f l a n k i n g sequence of T e l . 3 0 N2 and BO genomic DNA was d i g e s t e d w i th fcoRI and f r a c t i o n a t e d by e l e c t r o p h o r e s i s i n a 0.5% agarose gel (4 u g / l a n e ) . The DNA was t r a n s f e r r e d to Nytran and h y b r i d i z e d at medium s t r i n g e n c y w i th the 2.8 kb Xhol/EcoRl fragment f l a n k i n g T e l . 3 0 . Th is fragment was ob ta ined from p lasmid pCeh l5 . The s i z e markers to the l e f t r e f e r to Sstll/Hindlll 7> fragments o f 20.3 and 9.5 kb. 46 Figure 4. R e s t r i c t i o n Map of Tel SRD HX A RS D P BRR H B D H JJU I L J L H _ L PR I I D V I I I 1576 bp fcoRV 373 bp 247 bp 956 bp fcoRV/5a7I 450 bp Avail L i s t of R e s t r i c t i o n Enzymes Abbreviation Name Tel Cut Sites A Avail 116, 566 B BstHl 822, 1008 D Ddel 423, 940, 1061, 1554 V EcoRV 15, 1591 H HinFl 485, 947, 1146, 1282 P Hpall 494, 1138, 1383 R Rsal 416, 614, 827, 850, 1387 S Sail 388, 635 X Xhol 503, 713 This r e s t r i c t i o n map i s derived from the DNA sequence of the BO T e l sequenced by Rosenzweig et a l . (1983a). The Tel 0RF1 begins at p o s i t i o n 523 and ends at pos i t ion 1342. The terminal inverted repeats are located at 1 t o 54 and from 1557 to 1610. The to ta l length of the Tel sequence is 1610 bp. 47 A l l Tel elements were r e s t r i c t i o n mapped with the exception of Tel .30 which was only p a r t i a l l y cloned. A subfragment of the Tel .30 element was subcloned from the genomic fcoRl fragment as an £coRI/5a7I fragment. The subfragment of Tel .30 contains the f i r s t region of Tel up to the Sail s i t e at pos i t ion 388. The N2 phage from which Tel.30 was subcloned did contain, however, a 1.6 kb fcoRV-cut Te l -hybr id i z ing band. Two elements, Tel.10a and Tel(1 .5) .10b, are in the same genomic fcoRl fragment. They were subcloned for ind iv idua l analysis as 1.6 and 1.75 kb T c l - h y b r i d i z i n g FcoRV fragments repect ive ly into the FcoRV s i t e of the Bluescr ipt (-) vector (pCeh64 and pCeh66; Table 3) . The 1.6 kb FcoRV-digested Tel (Tel.10a) subclone was ca l l ed pCeh64 and the 1.75 kb T c l - h y b r i d i z i n g fragment (Tel.10b) subclone was ca l l ed pCeh66. Sixteen plasmids containing d i f fe rent N2 Tel inser t ions were digested with d i f f e rent r e s t r i c t i o n endonucleases and probed with the highly conserved 1.6 kb fcoRV internal Tel fragment. Autoradiographs of Avail-, FcoRV-,and 5a7I/EcoRV-digested N2 Tel elements are shown in Figure 5 as examples. In the Avail digest of Figure 5a, a 450 bp band i s expected as well as two addit ional bands of at least 120 and 960 bp corresponding to the end fragments of the Tel terminating in the f lanking sequence. When there i s only a s ingle addit ional band, t h i s i s most compatible with hybr id iza t ion with the 956 bp fragment of T e l . There i s most l i k e l y another Avail s i t e very close to the other end of the Tel in the f lanking sequence, r e su l t ing in a second band of less than 400 bp which would not be v i sua l i zed on t h i s g e l . 48 One of f i f t e e n Tel elements [Tcl (0 .9) .2] digested in Figure 5a i s missing the 450 bp band in a Avail digest (lane b) . I f a Tel i s conserved, a 1572 bp band i s expected in the FcoRV digest (Figure 5b). Four of f i f t e e n Tel elements [Tc l (0 .9 ) . 2 , Tc l (1 .5) .10b , Tc l (0 .9 ) . 14 , and Tcl (1 .7) .28] digested with FcoRV showed RFLDs (Figure 5b, lanes b, h, j , and n) . Three internal fragments of 956, 373, and 247 bp are expected of a conserved Tel in the FcoRV/5a7I digest shown in Figure 5c. T c l ( 0 . 9 ) . 2 , Tc l (1 .5 ) .10b , Tc l (0 .9 ) .14 , and Tc l (1 .7 ) .28 showed RFLDs in the FcoRV/Sa7I digest (Figure 5c, lanes b, h, j , and n) . The Tel probe has hybridized to larger molecular weight bands r e su l t ing from p a r t i a l digests in panel 5c. Other enzymes were used to give the complete r e s t r i c t i o n maps. Of the sixteen r e s t r i c t i o n mapped cloned Tel elements, the fo l lowing s ix were detected to have a variant sequence: T c l ( 0 . 9 ) . 2 , Tcl (Hpa-) .9 , Tcl (Eco) .12, Tc l (0 .9 ) .14 , Tc l (1 .7 ) . 28 , and Tel(1 .5) .10b. To excise the internal 1572 bp of T e l , plasmids were r e s t r i c t e d with FcoRV and subsequently re l iga ted ( B a i l l i e et a l . , 1985). This resulted in the removal of Tel and the retent ion of f lanking sequences. This method of Tc l -de le t ion was not feas ib le with Tcl (Eco) .12 , Te l .30 , Tel .10a, and Tel(1 .5) .10b. Since Tcl(Eco).12 in pCeh7 possessed only one FcoRV s i t e , an a l te rnat ive method was used to subclone the f lanking sequences. The plasmid containing Tcl(Eco).12 was digested with FcoRV/5a7I and treated with Mung Bean nuclease to blunt-end the Sa7I s i t e . This was followed by a blunt-end l i g a t i o n so that , in the re su l t ing plasmid (pCeh63), 49 Figure 5. Character izat ion of internal fragments of N2 Tel elements 1 ug of each of the Tcl-conta ining plasmids were digested and s ize- f rac t ionated on a 1% agarose g e l . Hybr id izat ion was at medium stringency with an fcoRV Tel fragment probe from T c l . l . Size markers are fragment posi t ions and are indicated by horizontal l i n e s . The size of the expected Tel internal fragments derived from the canonical BO Tel sequence (Rosenzweig et a l . , 1985a) i s l i s t e d below and i l l u s t r a t e d in Figure 4. The Tel internal fragments are indicated by arrows in panels A, B, and C. Digestion Common Tel bands Size markers (kb) Gel A ) . Avail 450 bp 4.4, 3.8, 2.8, 2 .3 , 2.0 1.5, 1.1, 0.6 {Sstll/ Hindlll 7\) Gel B) . fcoRV 1576 bp 5.2, 4 .2 , 3.4, 2.0, 1.9, 1.6, 1.3, 1.0, 0.8 (EcoRl/ Hindlll *) Gel C ) . £coRV/5a7I 247, 373, 956 bp 9.4, 4.4, 3.8, 2.8, 2 .3 , 2.0, 1.5, 1.1, 0.6 {Sstll/Hindlll ^) Lane A ) . T c l . l (pCeh27) B) . Tc l (0 .9 ) . 2 (pCehl) C) . Te l .3 (pCeh2) D) . Te l .6 (pCeh3) E) . Te l .7 (pCeh4) F) . Tcl(Hpa-) .9 (pCeh6) G) . Tel.10a (pCeh64) H) . Tcl(1 .5) .10b (pCeh66) I) . Tel .13 (pCeh8) J ) . T e l (0 .9 ) .1 4 (pCeh9) K) . Tel .17 (pCeh57) L ) . Tel .18 (pCehlO) M). Tel .21 (pCehll) N ) . Tc l (1 .7 ) .28 (pCehl4) 0 ) . Tel .26 (pCehl3) The o r i g i n a l autoradiograph showed a f a in t 450 bp band in panel 5a, lanes E and J , which could not be reproduced successful ly in the photograph while in panel 5a, lane b [Te l (0 .9 ) .2 ] , the 450 bp band i s missing. In the fcoRV digest of panel 5b, four Tel elements show banding patterns not consistent with the expected bands. In panel 5b, lane b [Tc l (0 .9 ) .2 ] exhib i t s a 0.9 kb band, lane h [Tel(1.5).10b] exhibits a 1.75 kb band, lane j [Tel(0.9) .14] exhib i t s a 0.9 kb band, while in lane n [Tc l (1 .7 ) .28 , a 1.7 kb band can be v i s u a l i z e d . In the £coRV/5a7I digest of panel 5c, four lanes show altered banding patterns. In panel 5c, lane b [Tcl (0 .9) .2] i s missing the 247 and 373 bp bands. In panel 5c, lane h [Tel(1.5).10b] i s missing the expected band at 373 bp which has been shi f ted to a higher molecular weight of 520 bp. In panel 5c, lane j [Tel(1.7) .28] i s missing the 956 bp band. In panel 5c, lane e does show a f a in t 247 bp band on the o r i g i n a l autoradiograph. 50 51 only the f lanking sequence remains. The f lanking sequence probe of Tel .30 was a 2.8 kb EcoRl/Xhol fragment as both ends of the Tel containing the EcoRV s i tes had not been subcloned. A sequence flanked by Tel.10a and Tel(1.5) .10b was in the form of a 280 bp Avall/EcoRV fragment. A l l the Tel-excised plasmids and Tel f l anking sequence fragments were used as probes in N2/B0 genomic h y b r i d i z a t i o n s . The f lanking sequence of some Tel elements hybridized to fcoRI fragments of the same s ize in both the N2 and BO s t r a i n s . The corresponding Tel elements were assumed to s i tuated in the same r e s t r i c t i o n enzyme fragment at the same genomic locat ion in the two s t r a i n s . Eleven out of the f i f t een Tcls tested were found to be present in the same fragment in N2 as in BO; they caused no r e s t r i c t i o n fragment length differences (RFLDs) between s t r a i n s . Figure 6 shows the genomic blots of f ive f lanking sequences cons i s t ing of four of the eleven Tel elements common to both s t ra ins as well as one Tel element which could not be determined. Four of the f ive f lanking sequences hybridize to a major band of equal s ize in both s t ra ins (Figure 6, panel A, B, D, and E) . This determination could not be carr ied out with Tcl (0 .9) .14 as i t s f lanking sequence is highly repeated in the genome (Figure 6, panel C) . The remaining four of the f i f t een Tel elements exhib i t banding differences between N2 and BO. The f lanking sequence of Tel .6 (Figure 7, panel A,B) and Tel .18 (Figure 7, panel C,D) i d e n t i f i e d RFLDs between N2 and BO. This enabled Te l .6 and Tel .18 to be mapped genet i ca l ly using s p e c i a l l y constructed N2/B0 mapping s tra ins (Rose et a l . , 1982) (see appendix A ) . The mapping resul t s w i l l be discussed l a t e r in the 52 Figure 6. N2/B0 hybr id iza t ion patterns of the f lanking sequences of f i ve N2 T e l e l e m e n t s fcoRl-digested N2 and BO genomic DNAs were fract ionated on a 0.5% g e l . Hybridizat ion of the Tel f lanking sequences was carr ied out at moderate stringency for f i l t e r A and at medium stringency for the remaining three f i l t e r s . Size markers indicated by horizontal l i n e s for f i l t e r s A and C are f coRI /W/ndl l l 7i fragments - 22, 5.2, 4 .2, 3.4, 2.0, 1.9, 1.6, and 1.3 kb. Size markers for f i l t e r B are the posi t ions of fragments from a SstIl/Hindl11 A digest - 9.4, 4.4, 3.8, 2.8, 2 .3, and 2.0 kb. Size markers for f i l t e r D and E are also SstIl/Hindl11 7\ digest - 9.4, 4.4, 3.8, 2.8, 2.3, 2.0, and 1.5 kb. Arrows indicate the genomic band containing the T e l . F i l t e r A ) . Probe; pCeh63 delet ion plasmid (Tel.12 deleted) F i l t e r B) . Probe; pCeh41 delet ion plasmid (Tel.13 deleted) F i l t e r C) . Probe; fcoRI/fcoRV pCeh9 fragment probe [Tel(0.9).14 not present] F i l t e r D). Probe; pCeh59 delet ion plasmid (Tel.17 deleted) F i l t e r E) . Probe; pCeh42 delet ion plasmid (Tel.21 deleted) See Table 3 regarding plasmids and related Tel elements. 53 a b c d F igu re 7. R e s t r i c t i o n fragment leng th d i f f e r e n c e s e x h i b i t e d by T e l . 6 and T e l . 1 8 E c o R l - d i g e s t e d N2 ( lanes a and c) and BO ( lanes b and d) genomic DNA (4 ug / l ane ) was s i z e - f r a c t i o n a t e d through e l e c t r o p h o r e s i s i n a 0.5% agarose g e l . Lanes a , b ) . H y b r i d i z a t i o n at medium s t r i n g e n c y w i th a pCeh39 d e l e t i o n p lasmid probe ( T e l . 6 d e l e t e d ) . The RFLD i s represen ted by 2.6 kb band in N2 and 2.4 kb band in BO. S i z e markers to the l e f t are f c o R I / W / n d l l l A f ragments - 5 . 2 , 4 .2, 3 .4, 2 . 0 , and 1.6 kb. Lanes c , d ) . H y b r i d i z a t i o n at medium s t r i n g e n c y w i th a pCes237 d e l e t i o n p lasmid probe (Te l . 18 d e l e t e d ) . The RFLD i s represented by a 5.2 kb band in N2 and a 4.6 kb band in BO. S i z e markers to the l e f t o f the f i l t e r are Sstll/Hindlll A fragment p o s i t i o n s - 9.4, 4.4, 3 . 8 , 2 . 8 , 2 . 3 , 2 . 0 , and 1.5 kb. The 2.7 kb band in lane d i s most l i k e l y pUC p lasmid con tam ina t i on . 54 t e x t . The RFLD associated with Tel.10a and Tcl(1.5) .10b could not be prec i se ly defined due to the r e p e t i t i v e nature of the f lanking sequence (data not shown). These resul t s are summarized in Table 4. The o r i g i n a l phage for 13 of the d i s t i n c t Tel elements were sent to J . Sulston and A. Coulson at the MRC Laboratories , Cambridge, England, to help es tab l i sh the genomic locat ion of these elements. Sulston and Coulson are in the process of constructing a physical map of the C. elegans genome (Coulson et a l . , 1986). They were able to assign 5 Tcl-conta ining phage to pre-ex i s t ing contigs (Table 4) . A contig i s a group of clones with contiguous nucleotide sequences (Staden, 1980). The other Charon 4 phage gave too few f ingerpr in t bands to allow an unequivocal assignment. a. Tc l (0 .9 ) . 2 The plasmid containing Tc l (0 .9 ) .2 y ie lded an fcoRV fragment of approximately 0.9 kb. As t h i s Tel i s a s t ructura l var iant which i s 0.9 kb in length, the Tel has been named Tcl(0 .9) according to the nomenclature used by Rose et al (1985) for the var iant T c l ( H i n ) . This Tel i s contained wi th in the second smallest fcoRI N2 fragment; hence, i t i s i d e n t i f i e d as T c l ( 0 . 9 ) . 2 . R e s t r i c t i o n s i t e mapping showed Tc l (0 .9 ) .2 does not contain the Avail s i t e at 116 or any of the r e s t r i c t i o n s i te s from pos i t ion 116 to the pa i r of Rsal s i tes at 827 and 850 (Figure 8 ) . At least one of the two Rsal s i te s i s present, however, and a l l s i t e s fo l lowing pos i t ion 850 leading to the end of the element are i n t a c t . Therefore, th i s data i s consistent with Tc l (0 .9 ) .2 having been deleted between the fcoRV s i t e at pos i t ion 19 and the 55 Table 4. N2 Tel element placement Tel fcoRl Genomic Band Size RFLD N2/BO Contig Assignment .30 >10.0 N/D LIN14-LGX-272kb .28 >10.0 No .26 >10.0 No .21 8.0 No .18 5.2 Yes - hP2 hP2 TCCED3-LGIV-238kb .17 5.0 No .14 4.2 N/D .13 4.2 No C0L6-LGII-137kb .12 4.0 No .lOab 4.0 Yes .9 4.0 No .7 3.5 No MSP72ps-170kb .6 3.1 Yes - hP3 hP3 MSP76-LGIV-75kb .3 2.1 No .2 2.0 No .1 2.0 kb No This column contains entr ies re fe r r ing to RFLD s i t e , name of C. elegans gene contained wi th in the same cont ig , l inkage group, and s ize of cont ig . 56 Figure 8. N2 Tel variant structures - r e s t r i c t i o n mapping Legend A - Avail B - BstHl D - Ddel H - Hinfl P - Hpall R - Rsal R l - fcoRI S - 5a7I V - fcoRV X - Xhol Intact Tel - e .g. T c l . l P D P V A SRD HX A RS X BRR H B D H H PR D V i i i i i i i i I N i I N i i i I i i i i I I T c l f 0 . 9 K 2 D P V R H B D H H P R D V LL I I I I I I I I I I 1 850 Tcl(Hpa-) .9 P D V A SRD HX A RS X BRR H B D H PR D V U I III II i n I i n i l l l I M LJJ Tcl f1 .5 ) .10b P D P SRD HX A RS X BRR H B D H H PR D V i n II i II i M l i l l I I II i n Tcl(Eco).12 P D P V A SRD HX A RS X BRR H B D H H PR Rl I I I I I I I I i l l I III I I I I I i l l 57 Figure 8 cont. Tc l f0 .9 ) .14 P V A SRD HX A RS X D V U I M i II | u_ Tcin.71.28 713 1554 P D P V A SRD HX A RS X BRR H B D H H PR D V LL J III II L_U I LU I l_LI A 70 bp 58 Rsal s i t e at pos i t ion 850. b. Te l .6 Te l .6 was mapped to linkage group IV using the N2/B0 RFLD that i t creates at the hP3 s i t e . The f lanking sequence of Te l .6 was hybridized to a mapping f i l t e r (prepared by N. Mawji, Univers i ty of B r i t i s h Columbia) (Figure 9) (see Appendix A ) . DNA (prepared by K. Beckenbach, Simon Fraser Univers i ty) from recombinant ind iv idua l s in the unc-43 unc-22 in terva l ( i so la ted by L. Turner, Simon Fraser Univers i ty ) was used to map hP3 very close to the r i ght of unc-43. Of nine N2 unc-43 - BO unc-22 recombinant s t ra ins hybridized with the hP3 probe, seven gave the N2 pattern (Figure 10). hP3 maps in the same area as sP5. sP5 was previously mapped using the same recombinant s t ra ins and showed the i d e n t i c a l N2/B0 pattern ( B a i l l i e et a l . , 1985). The phage containing Te l .6 was found to be associated with the same 75 kb contig as a male sperm protein gene (MSP76) mapped to l inkage group IV (Sulston and Coulson, pers. comm., Ward et a l . , 1988). c. Te l .7 The phage in which Tel .7 was found was shown to l i e wi th in a contig of approximately 170 kb which also contains a male sperm protein pseudogene (MSP72ps) (not yet mapped to a spec i f i c linkage group) (Sulston and Coulson, pers. comm., Ward et a l . , 1988) 59 Figure 9. Linkage group mapping of the hP3 s i t e The pCeh39 delet ion plasmid probe (Tel.6 deleted) was hybridized at medium stringency to a mapping f i l t e r prepared by N. Mawji (Univers i ty of B r i t i s h Columbia). Size markers indicated by horizontal l ine s are EcoRl/Hindlll 7) fragment posi t ions - 5.2, 4.2, 3.4, and 2.0 kb. Lane a) . LGII mapping DNA Lane b) . BO genomic control Lane c ) . LGI mapping DNA Lane d ) . LGIV mapping DNA Lane e ) . LGV mapping DNA Lane f ) . BO genomic control Lane g ) . N2 genomic control Any probe detecting a RFLD between two C. elegans s t ra ins can be gene t i ca l ly mapped using spec i a l ly constructed recombinant s t ra ins (Rose et a l . , 1982). The s t ra ins N2 and BO are general ly used but mapping RFLDs between N2 and any other C. elegans s t r a in i s equally as f ea s ib le . In order to map the RFLD to a spec i f i c l inkage group, i t i s necessary to construct a special s t r a in representing each linkage group (Figure 45). Each s t r a i n w i l l be homozygous N2 for a cer ta in chromosome (marked with a cent ra l ly - loca ted v i s i b l e genetic marker) and heterozygous N2/B0 for a l l other chromosomes. Therefore, i f a probe does not map to the l inkage group which i s homozygous N2 in the constructed s t r a i n , then equal hybr id i za t ion to both a N2 and BO band w i l l r e s u l t . On the other hand, the probe w i l l hybridize to only one band c h a r a c t e r i s t i c of the N2 s t r a i n i f the l inkage group i t maps to i s homozygous N2 in that s t r a i n ' s DNA. See appendix A for further d e t a i l . Lane d exhib i t s a s ingle band corresponding to the N2 genomic band, demonstrating that hp3 can be assigned to LG IV. 60 a b e d e f g 61 Figure 10. Mapping of the hP3 s i t e between unc-43 and unc-22 (LGIV) fcoRI-digested DNA (4 ug/lane) from indiv idua l N2/B0 recombinant s t ra ins between unc-43 and unc-22 as well as N2 and BO were electrophoresed in a 0.5% agarose gel and hybridized at medium stringency with the pCeh39 probe. Arrows indicate the 2.6 (N2) and 2.4 (BO) kb bands. Lane A ) . N2 genomic control Lane B) . unc-43 unc-22 recombinant s t r a i n BC1411 Lane C) . " " BC1412 Lane D). " " BC1413 Lane E) . " " BC1414 Lane F ) . " " BC1415 Lane G). " " BC1416 Lane H). " " BC1417 Lane I ) . " " BC1418 Lane J ) . " " BC1419 Lane K) . BO genomic control The recombinants have the fol lowing type of DNA in LGIV: unc-43 i N2 DNA unc^2 BO DNA As seven of the nine recombinant s tra ins exhib i t the N2 banding pattern and two exhib i t the BO pattern, t h i s means the hP3 s i t e i s close to the r ight side of unc-43. The double banding pattern seen in lane B is probably due to a second crossover event and the N2 band can be disregarded in th i s analysis (D. B a i l l i e , Simon Fraser Univer s i ty , pers. comm.). 62 d . Tcl(Hpa-1.9 Tcl(Hpa-) .9 i s one of the two Tel elements which have a s ingle r e s t r i c t i o n s i t e var i ant . The tfpall s i t e at pos i t ion 1138 i s missing in the Tel contained wi th in pCeh6 (Figure 8; missing W p a l l s i t e marked with * ) . This produced a / / p a l l T c l - h y b r i d i z i n g band of 900 bp which i s the re su l t of digest ion at the two Hpall s i t e s (posit ions 494 and 1383; two s i tes marked with # in Figure 8) on e i ther side of the absent s i t e . e. Tel.10a This 1.6 kb Tel i s conserved at the r e s t r i c t i o n s i t e leve l and i s separated from Tel.10b by about 280 bp (Figure 11). The 280 bp of intervening DNA can be excised from pCeh62 using fcoRV and Avail (the Avail s i t e i s 24 bp wi th in Tel.10b) and the fragment used as a probe in N2/BO hybr id iza t ions . An RFLD i s detected in the resultant blot (data not shown). There i s a 4.0 kb fcoRI band in the N2 lane but no corresponding band in the BO lane. The corresponding band in the BO s t r a in cannot be i d e n t i f i e d due to background Tel hybr id iza t ion (the probe contains about 40 bp of Tel sequence). 63 Figure 11. R e s t r i c t i o n map of pCeh62 Legend A - Avail R l - EcoRl S - Sail V - fcoRV Tcl(1 .5) .10b Tel.10a Rl V i i SA S II I VA J_L S AS I I l V Rl 4.0 kb insert J — 1 in pCeh62 (pUC19) pCeh66 (Bluescript) pCeh64 (Bluescr ipt ) 280 bp f anking sequence probe The two Tel elements contained within the plasmid pCeh62 are pictured above. The arrows represent the extent and or ienta t ion of the two T c l s . The bars below the r e s t r i c t i o n map represent fragments which had e i ther been subcloned into other plasmids ( in brackets) or used as fragment probes. 64 f . T c i n . 5 ) . 1 0 b Tel(1.5) .10b lacks 89 bp at one end. This produces a 1.5 kb Tel element missing one terminal repeat. When digested with FcoRV, the Tel(1.5) .10b plasmid gave a 1.75 kb T c l - h y b r i d i z i n g band (Figure 5B). This plasmid contains the r e s t r i c t i o n s i te s expected for Tel except for the loss of one terminal FcoRV s i t e (Figure 8 ) . The DNA sequence at the end of the pCeh66 inser t was determined. The sequencing strategy i s shown in Figure 12. The l a s t s ixteen bases of the Tel inverted repeat and 150 bases of unique sequence DNA unrelated to Tel followed the FcoRV r e s t r i c t i o n s i t e . One of the FcoRV s i te s was part of the inverted repeat of the neighboring Tel (Tel .10a) . When Tcl(1 .5) .10b was subcloned from pCeh62 using FcoRV, the FcoRV s i t e from the intact Tel.10a became one end of the 1.75 kb fragment. In order to sequence into the Tel element, a number of deleted der iva t ives of pCeh66 were produced (Figure 12). When these plasmids were sequenced, i t was ascertained that Tcl(1 .5) .10b was missing one of i t s inverted repeats. One group of sequences extended 60 bp upstream of Tcl(1 .5) .10b and l ined up with the Tel beginning at pos i t ion 90 (Figure 13). The sequences continued from Tel pos i t ion 90 to pos i t ion 430 and was ident i ca l to the sequenced BO Tel (Rosenzweig et a l , 1983), except for the inser t ion of one thymine at pos i t ion 361. Tel(1.5).10b had been deleted up to pos i t ion 90, 24 bp from the Avail s i t e and about 260 bp away from the other Tel (Figure. 14). Consequently, th i s Tel i s only 1520 bp long and is named Tel(1 .5) .10b. 65 Figure 12. N2 Tel variants - extent of DNA sequencing Upright bars on the l ine s indicate 100 bp i n t e r v a l s . Arrows indicate the regions sequenced and arrows pointed in opposite d i rec t ions are meant to indicate opposite strands sequenced. Brackets {} indicate the presence of a de let ion and p § | indicates the pos i t ion of an i n s e r t i o n . With respect to TclTl?5).10b, the double l i n e i s non-Tel sequence and the | represents the inverted repeat of the neighboring Tel.10a. 1= Telf1 .5) .10b - pCeh66 and delet ion der ivat ives (reverse primer) 90 -> -> Guide for Figure 13 J T c l . l O b l T c l . l 0 b 2 Tel(Ecol .12 - pCeh7 (reverse primer) . T c l . l 0 b 3 I I I L J i i Rl TcHO.91.14 - pCeh82 and pCeh83. pCeh82 < pCeh83 J L pCeh82 pCeh83 Tel (1 .7) .28 - pCeh85 (reverse primer) J I 66 Figure 13. DNA sequence of a portion of Tcl(1 .5) .10b a) . T c l . l O b l (see f igure 12) i s a segment of the DNA sequence of the inser t in pCeh66 which, after 60 bp, can be aligned with the sequenced BO Tel (Rosenzweig et a l . , 1983a) at pos i t ion 90. X indicates a nucleotide dif ference between the two sequences. T e l . l O b l CCTGCAATAGAGAGAAAGAAACGAATAACACAAACGAAGATAACTCAAAAACTTATTTAT 60 Tel-30 GGTTTTTTGTGTGTAACTTTTTTCTCAAGCATCGATTTGACTTGAATTTTTCCGTGTGCA 60 XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 60 T e l . l O b l TAAAGCGAAATGTTACGCAAATTTGCGGACCAAACATTACATGATTATCGATTTTTTCTG 120 Tel-30 TAAAGCGAAATGTTACGCAAATTTGCGGACCAAACGTTACATGATTATCGATTTTTTCTG 120 60 T c l - 3 0 b l AATTTTATTTCAATTT 180 60 T e l . l O b l ATCAATAAAACGCACTCTGTTTGTTGCACTGGATTTGTTTGGTTGATAAATTATTTTTAA 240 Tel-30 ATCAATAAAACGCACTCTGTTTGTTGCACTGGATTTGTTTGGTTGATAAATTATTTTTAA 240 60 T e l . l O b l GGTATGGTAAAATCTGTTGGGTGTAAAAATCTTTCCTTGGACGTCAAGAAAGCCATTGTA 300 Tel-30 GGTATGGTAAAATCTGTTGGGTGTAAAAATCTTTCCTTGGACGTCAAGAAAGCCATTGTA 300 60 T e l . l O b l GCTGGCTTCGAACAAGGAATACCCACGAAAATGCTCGCGCTGCAAATTCAACGTTCTCCG 360 Tel-30 GCTGGCTTCGAACAAGGAATACCCACGAAAA-GCTCGCGCTGCAAATTCAACGTTCTCCG 359 X 61 T c l . l O b l Tcl-30 TCGACTATTTGGAAAGTAATCAAGAAGTACCAAACTGAGGTGCACCC TCGACTATTTGGAAAGTAATCAAGAAGTACCAAACTGAGGTGCACCC 407 406 61 67 Figure 13 cont. b ) . T c l . l 0 b 2 (see f igure 12) i s a segment of Tcl(1 .5) .10b which can be aligned with an intac t Tel s t a r t ing at pos i t ion 706. A s ingle base change i s indicated by an X. Tel.10b2 CGCATGGCTCGAGTTGCGTGGGCAAAAGCGCATCTTCGTTGGGGACGTCAGGAATGGGCT 60 Tel-706 CGCATGGCTCGAGTTGCGTGGGCAAAAGCGCATCTTCGTTGGGGACGTCAGGATTGGGCT 60 X 1 Tel.10b2 AAACACATCTGGTCTGACGAAAGCAAGTTCAATTTGTTCGGGAGTGATGGAAATTCCTGG 120 Tcl-706 AAACACATCTGGTCTGACGAAAGCAAGTTCAATTTGTTCGGGAGTGATGGAAATTCCTGG 120 1 Tel.10b2 GTACGTCGTCCTGTTGGCTCTAGGTACTCTCCAAAGTATCAATGCCCAACGTTAAGCATG 180 Tcl-706 GTACGTCGTCCTGTTGGCTCTAGGTACTCTCCAAAGTATCAATGCCCAACGTTAAGCATG 180 1 T c l . l 0 b 2 GAGGTGGGAGCGTCATGGTGT 201 Tcl-706 GAGGTGGGAGCGTCATGGTGT • 201 c ) . The sequence of Tcl(1 .5) .10b l a b e l l e d T c l . l 0 b 3 in f igure 12 i s aligned with the B0 Tel beginning at pos i t ion 1068. There are three base differences between the two sequences, indicated by Xs. Tel.10b3 TACTTCTCTTCATGTGCGTTCCTGGTTTCAACGTCGTCGTGTGCATTTGCTCGATTGGCC 60 Tel-1068 TACTTCTCTTCATGTGCGTTCATGGTTTCAACGTCGTCATGTGCATTTGCTCGATTGGCC 60 X X 2 Tel.10b3 AAGTCAATCTCCGGACTTGAATCCAATAGAGCATTTGTGGGAAGAGTTGGAAAGACGTCT 120 Tel-1068 AAGTCAGTCTCCGGACTTGAATCCAATAGAGCATTTGTGGGAAGAGTTGGAAAGACGTCT 120 X 3 Tel.10b3 TGGAGGTATTCGGGCTTCAAATGCAGATGCCAAATTCAACCAGTTGGAAAACG 173 Tel-1068 TGGAGGTATTCGGGCTTCAAATGCAGATGCCAAATTCAACCAGTTGGAAAACG 173 68 Fiqure 14. N2 Tel variant structures - DNA sequencing DNA sequencing of four Tcls allowed for further d e f i n i t i o n of t h e i r s t ructures . The endpoints of Tel sequence in these variants i s indicated by a number representing the pos i t ion in T e l . Legend A - Avail B - BstHl D - Ddel H - Hinfl P - Hpall R - Rsal R l - EcoRl S - Sa7I V - fcoRV X - Xhol Tcl(1.51.10b P SRD HX i n M RS I I BRR I I I D H _L B D i i P H PR 1 I D V [ I I 90 T c l ( E c o h l 2 P D P V A SRD HX A RS X BRR H B D H H PR Rl U I I I I l l I l l I M l i l l i i H i Tcl (0 .9) .14 P V A SRD HX A RS X BRR D V I i i i n II i l l I I I I [ [ i l l 855 1538 T c H l . 7 1 . 2 8 110 7\ 55 bp P SRD HX A RS X _L BRR D H B D P H H PR D V 69 Two other regions of Tel(1.5).10b were also sequenced. 201 bases beginning at pos i t ion 706 were ident i ca l to the sequenced BO Tel except a T to A transversion at pos i t ion 759 (Figure 13). The Tel(1.5) .10b sequence from pos i t ion 1068 to 1240 has three base changes at pos i t ions 1089, 1106, and 1134. In t o t a l , 715 bases of Tel(1.5) .10b were sequenced and f ive s ingle basepair changes were discovered, r e su l t ing in a divergence from the conserved Tel sequence of 0.7%. g. T c l ( E c o l . l 2 This Tel contains an fcoRI s i t e not normally found in Tel (Figure 4 ) . Tcl(Eco).12 contains only one EcoRV s i t e . An fcoRl/fcoRV digest of the Tcl(Eco).12 plasmid y ie lded a 1.4 kb T c l - h y b r i d i z i n g band, suggesting t h i s p a r t i c u l a r Tel contains an fcoRI s i t e (Figure 8 ) . The phage th i s Tel had been i so lated from contained only one T c l - h y b r i d i z i n g fragment so that the other end of the Tel was not contained wi th in the phage. A search of the published Tel sequence revealed a s ix basepair sequence at pos i t ion 1451 which d i f f e r s by one basepair from the fcoRI recognit ion s i t e . In order to test whether th i s basepair was a l te red , the region surrounding the Tel was sequenced. The M13 forward primer was used to sequence from one end of the cloning vector into the Tel carr ied in pCeh7 (Figure 12). The data show a T to C t r a n s i t i o n at the s i t e 1451 as predicted. Consequently, a GAATTT hexanucleotide sequence had been changed to the fcoRI recognit ion sequence, GAATTC (Figure 14). This Tel has been named Tcl (Eco) .12 . 70 h. Tel .13 The phage containing Tel.13 maps to LGII and i s included in a 137 kb contig that also harbours the col-6 gene (Sulston and Coulson, pers. comm.). i . Tc l (0 .9) .14 Tcl (0 .9) .14 i s approximately 900 bp in length. This Tel i s deleted between the Xhol s i t e at 713 bp and the l a s t Ddel s i t e at 1554 bp (Figure 8 ) . The open reading frame would be disrupted in t h i s case. The 1.0 kb FcoRV Tel fragment from pCeh9 was subcloned into the FcoRV s i t e in the Bluescr ipt vector in both or i en ta t ions , y i e l d i n g the plasmids pCeh82 and pCeh83. The M13 reverse and forward primers were used to sequence in from each end of these two plasmids (Figure 12). Sequencing revealed that there i s a simple 682 bp delet ion from pos i t ion 855 to 1536 (or 856 to 1537), y i e l d i n g a Tel 928 bp long (Figures 14,15). The f i r s t 113 bp s t a r t i n g at the FcoRV s i t e were ident i ca l to the sequenced BO Tel (Figure 15a). With the exception of the delet ion i t s e l f , only one bp was a l tered from the sequenced BO Tel in the sequences f lanking the delet ion s i t e (Figure 15b). 71 Figure 15. DNA sequence of a portion of TcUO.91.14 a) . Tc l ( . 9 ) . 14 i s aligned with the BO Tel (sequenced by Rosenzweig et a l . , 1983a) beginning at pos i t ion 17 (at the fcoRV s i t e ) and continuing for 103 bp. No differences are apparent. T c l ( 9) H - GATATCCACTTTTGGTTTTTTGTGTGTAACTTTTTTCTCAAGCA 44 Tel 1-119 CAGTGCTGGCCAAAAAGATATCCACTTTTGGTTTTTTGTGTGTAACTTTTTTCTCAAGCA 60 T c l ( 9) 14 TCCATTTGACTTGMTTTTTCCGTGTGCATAAAGCGAAATGTTACGCAAATTTACGGAC 103 .Tel 1-119 TCCATTTGACTTGAATTTTTCCGTGTGCATAAAGCGAAATGTTACGCAAATTTGCGGAC 119 b) . Tc l ( . 9 ) . 14 i s aligned with the intac t BO Tel beginning at pos i t ion 726 and continuing to the s i t e of the de le t ion at pos i t ion 855/6. The sequence alignment after the delet ion i s shown s t a r t ing at 1536/7. The X indicates a base difference between the two sequences. T e l ( . 9 ) . 1 4 GGCAAAAGCGCATCTTCGTTGGGGACGTCAGGAATGGGCTAAACACATCTGGTCTGACGA 60 x 0 Tel 726- GGCAAAAGCGCATCTTCGTTGGGGACGTCAGGATTGGGCTAAACACATCTGGTCTGACGA 60 Tel 1513- 0 T e l ( . 9 ) . 1 4 AAGCAAGTTCAATTTGTTCGGGAGTGATGGAAATTCCTGGGTACGTCGTCCTGTTGGCTC 120 0 Tel 726- AAGCAAGTTCAATTTGTTCGGGAGTGATGGAAATTCCTGGGTACGTCGTCCTGTTGGCTC 120 Tel 1513- TTTTGTGAACACTGT 15 T e l ( . 9 ) . 1 4 TAGGTACTCTCAAAACAAAATAACCACTTAGAAAAAAGTTACACACAAAAAACCAAAAGT 180 854-TC-1538 2 Tel 726- TAGGTACTCTCCAAAGTATCAATGC 145 Tel 1513- GGTGAAGTTTCAAAACAAAATAACCACTTAGAAAAAAGTTACACACAAAAAACCAAAAGT 75 T e l ( . 9 ) . 14 GGATATC 187 Tel 726-Tc l 1513- GGATATCTTTTTGGCCAGCACTG 145 98 72 j . Tel .18 Tel .18 (giving r i s e to the RFLD hP2) maps to the r i g h t of unc-31 on LG IV. The hP2 s i t e was mapped by hybr id iz ing the f lanking sequence of Tel .18 to. a mapping f i l t e r prepared by N. Mawji (Univers i ty of B r i t i s h Columbia) (Figure 16). hP2 was mapped more prec i se ly using DNA (prepared by K. Beckenbach, Simon Fraser Univers i ty ) from N2/B0 recombinants between unc-22 and unc-31 i so la ted by T. Rogalski at Simon Fraser Univer s i ty . The hP2 s i t e was found to be contained wi th in a 300 kb contig that also includes the ced-3 gene. k. Tel(1.71.28 Tc l (1 .7 ) .28 also appeared to be a larger Tel (1.68 kb) from i t s r e s t r i c t i o n map (Figure 8 ) . The r e s t r i c t i o n map of t h i s Tel was o r i g i n a l l y prepared by T. Starr (Univers i ty of B r i t i s h Columbia). pCeh85 contained the fcoRV fragment of th i s T e l . The M13 reverse primer was used to sequence into the beginning of the Tel in pCeh85 (Figure 12). Tc l (1 .7 ) .28 had a 55 bp inser t ion between the f i r s t fcoRV s i t e and f i r s t Avail s i t e (Figure 14). Sequencing had posit ioned t h i s inser t ion after Tel nucleotide 110, 111 or 112. The inser t ion i s flanked by two T's which makes i t d i f f i c u l t to determine the i n s e r t i o n ' s exact boundaries. There i s a 1 bp change in the 180 bp sequenced of Tc l (1 .7 ) .28 compared to the sequenced BO T e l . The in se r t ion sequence contains many d i rec t repeats of a sequence 5' of the in se r t ion (Figure 17). 73 a b c cl e f g Figure 16. Linkage group mapping of the hP2 s i t e The pCes237 delet ion plasmid probe (Tel.18 deleted) was hybridized at moderate stringency to a mapping f i l t e r prepared by N. Mawji (Univers i ty of B r i t i s h Columbia). The double arrows on the r ight indicate the 5.2 kb N2 and 4.6 kb BO RFLD bands. Addit ional c ros s -hybr id iz ing bands are due to the reduced stringency of h y b r i d i z a t i o n . Size markers indicated by horizontal l ine s are FcoRI/r/7/7dIII > fragment posi t ions - 5.2, 4 .2, 3.4, and 2.0 kb. Lane a) . LGII mapping DNA Lane b) . BO genomic control Lane c ) . LGI mapping DNA Lane d) . LGIV mapping DNA Lane e) . LGV mapping DNA Lane f ) . N2 genomic control Lane g) . N2 genomic control A s ingle band in lane d correspond to N2 band indicates hP2 i s on LG IV. 74 Figure 17. DNA sequence of a segment of Tc l (1 .7 ) .28 Tc l (1 .7 ) .28 i s aligned with the sequence of an intac t BO Tel (Rosenzweig et a l . , 1983a), beginning at the fcoRV s i t e at pos i t ion 17. The dotted interva l in the Tel sequence indicates the in se r t ion present in Tel (1 .7) .28 . Underlined sequence indicates d i r e c t repeats in the inser t ion and the sequence preceding the i n s e r t i o n . The X indicates a nucleotide difference between the Tel and Tc l (1 .7 ) .28 sequence. Tel (1.7) 28 GATATCCACTTTTGGI I 11 I IGTGTGTAACI I 11 I' ICTCAAGCA 44 0 Tel CAGTGCTGGCCAAAAAGATATCCACTTTTGGTTTTTTGTGTGTAACI 1 111 ICTCAAGCA 60 Tel (1 .7)28 TCCATTTGACTTGMTTTTTCCGTGTGCATAAAGCGAAATGTTTCGCAAATTAAGCAAAT 104 x 0 Tel TCCATTTGACTTGAATTTTTCCGTGTGCATAAAGCGAAATGTTACGCAAATT 112 Tel (1 .7)28 AAAGTTTCGCAAAGMTTAAATTGTTTCGCAAACGAAACGCAAATTTGCGGACCAAACAT 164 0 Tel TGCGGACCAAACAT 126 Tel (1 .7)28 TACATGAnATCGATTTTTTCTGMTTTTAnTCMnTTTTGATTTTTTCGTTTTTCCA 224 0 ' Tel TACATGATTATCGATTTTTTCTGAATTTTATTTCAAIIII!IGATTTTTTCGTTTTTCCA 186 Tel (1 .7)28 ATTTTCATTA 234 0 Tel ATTTTCATTA 196 75 1. Tel.30 The f lanking sequence of Tel.30 hybridized to mult ip le genomic bands, a l l of which were larger than 9 kb (Figure 3) and varied s i g n i f i c a n t l y between s t r a i n s . The phage containing Tel.30 was located wi th in a large (300 kb) contig that also contained lin-14 (Sulston and Coulson, pers. comm.). The remaining ten cloned N2 Tel elements show no deviat ion from the expected r e s t r i c t i o n s i t e pattern. No Tcl(Hin) was detected. As these r e s t r i c t i o n enzyme recognit ion s i te s to ta l 116 bp, 7.2% of the Tel sequence has been analyzed for conservation by r e s t r i c t i o n mapping. 3. Analysis of N2 Tel inser t ion ONA The fol lowing experiment was designed to invest igate whether N2 Tel elements t y p i c a l l y inhabit unique or r e p e t i t i v e sequence in the genome. A s ingle agarose gel with a l l lanes loaded with fcoRI-digested N2 DNA was electrophoresed and transferred b i d i r e c t i o n a l l y to Nytran. The Nytran was cut so that each s t r i p contained one lane of N2 DNA. The f lanking sequence probes of nine N2 Tcls were hybridized i n d i v i d u a l l y to two N2 lane s t r ip s at 62°C. Each s t r i p was washed separately, one at medium stringency and one at high stringency. The hybr id iza t ion pattern observed for each probe can be seen in Figure 18 and the number of bands was recorded in Table 5. At medium stringency, a l l nine probes 76 Figure 18. Analysis of N2 Tel inser t ion s i tes for r e p e t i t i v e sequence fcoRI-digested N2 genomic DNA was s ize- f rac t ionated in nine lanes (4.5 ug/lane) through electrophoresis in a 0.5% agarose g e l . A b i d i r e c t i o n a l transfer of the gel was carr ied out. Each N2 lane was i n d i v i d u a l l y hybridized at one of two str ingencies to a d i f f e rent Tel f l anking DNA probe. Size markers on the l e f t are posi t ions of Sstll/Hindlll ^fragments - 9.4, 4.4, 3.8, 2.8, 2 .3 , and 2.0 kb. Panel A ) . Medium hybr id iza t ion stringency Panel B) . High hybr id iza t ion stringency Lane Lane Lane Lane Lane Lane Lane Lane Lane pCeh37 pCeh38 pCeh39 pCeh29 pCeh63 pCeh59 pCes237 pCeh42 pCeh45 delet ion delet ion delet ion delet ion delet ion delet ion delet ion delet ion delet ion plasmid plasmid plasmid plasmid piasmid piasmid plasmi piasmid plasmid probe probe probe probe probe probe d probe probe probe Tc l (0 .9 ) . 2 deleted] Te l .3 deleted) Te l .6 deleted) Te l .7 deleted) Tcl(Eco).12 deleted] Tel.17 deleted) Tel .18 deleted) Tel.21 deleted) Tc l (1 .7 ) .28 deleted] Unique bands were found only at high hybr id i za t ion stringency with probe pCeh37 (lane a) , pCeh63 (lane e) , and pCes237 (lane g) . At high str ingency, the remaining s i x probes hybridized to mult ip le bands and at medium str ingency, a l l probes hybridized to mult ip le bands. The number of bands i d e n t i f i e d with each probe i s l i s t e d in Table 5. g h i 78 Table 5. Analysis of N2 Tel inser t ion DNA Deletion plasmid probe Number of hybric High stringency i z i n g fragments Med.stringency pCeh45 (Tel.28 deleted) 3 major 1 minor 5 major 2 minor pCeh42 (Tel.21 deleted) 1 major 3 minor 1 major 30 minor pCes237 (Tel.18 deleted) 1 major 2 major 20 minor pCeh59 (Tel.17 deleted) 1 major 4 minor 1 major 6 minor pCeh63 (Tel.12 deleted) 1 major 1 major 9 minor pCeh40 (Tel .7 deleted) 1 major 2 minor 1 major 5 minor pCeh39 (Tel .6 deleted) 3 major 3 major 7 minor pCeh38 (Tel .3 deleted) 1 major 2 minor 2 major 50 minor pCeh37 (Tel .2 deleted) 1 major 1 minor 2 major 4 minor The number of hybr id iz ing bands are derived from the o r i g i n a l autoradiograph and may not correspond to the number of bands v i s i b l e in the Figure 18 photographs. 79 hybridized to mult ip le bands while at high stringency, three of the nine hybridized to s ingle bands. When compared to random probes i so la ted by other researchers (Emmons et a l . , 1979; Rose et a l . , 1982), these probes seem to ident i fy more r e p e t i t i v e regions. 4. Closer examination of N2 Tel RFLD s i te s An unusual aspect of the two N2 Tel RFLDs caused by Tcl.6(/7P3) and TclA8(hP2) i s the s ize difference between N2 and BO fcoRI bands. General ly, other Tel RFLDs show a 1.6 kb genomic band s ize d i f ference . The N2/B0 band difference for hP2 and hP3 are 600 and 200 bp, respect ively (Figure 7) . Examination of DNA at the hP2 s i t e in N2 and BO suggests a DNA rearrangement, perhaps involv ing Tel .18 has occurred. The s i t e in BO corresponding to the hP2 RFLD in N2 has been cloned from a BO ?\ Charon 4 l i b r a r y . Using a 2.0 kb fcoRI/fcoRV f lanking probe from pCehlO (Figure 19), two unique BO phage were i so l a t ed . Each fcoRI-digested phage contained a 4.6 kb band that hybridized to the fcoRI/fcoRV pCehlO probe and a 2.7 kb band that hybridized to a Tel probe (Figure 20). The 2.7 kb fcoRI BO fragment contained a Tel var iant (missing one fcoRV s i te ) and was cloned into pCehl05. None of the three d i f fe rent N2 phage i so la tes y i e l d i n g Tel .18 contained any 80 Figure 19. Res t r i c t ion maps of N2 and BO DNA at the hP2 s i t e  5.2 kb N2 fcoRl fragment RV X SAXS A RV H Rl Tel .18 pCehlO (N2) Rl H I I RV J fcoRI/fcoRV 2.0 kb probe 4.6 kb BO EcoRI fragment Rl H RV pCehl04 (BO) pCehl05 (BO) 2.7 kb BO FcoRl fragment Rl RV X SXS S Rl I J_ Tel * fcoRI/FcoRV 0.5 kb probe Sa7I 0.4 kb probe Hindlll 0.5 kb probe X S X H Rl J I I I | 5a7I/£coRI 0.8 kb probe (pCehl06) * The = l i n e s represent the approximate l i m i t s of the variant Tel represents the minimal l i m i t s of the T c l - h y b r i d i z i n g sequences. The Key 1.0 kb Rl RV H A S X EcoRl £coRV Hindlll Avail Sail Xhol 81 Figure 20. Hybridizations with BO Charon 4 phage at the hP2 s i t e Two BO Charon 4 phage, KR#80 (lanes a, b, c) and KR#81 (lanes d, e, f ) , were digested with fcoRI (lanes a and d ) , FcoRV (lanes b and e ) , and fcoRI/fcoRV (lanes c and f) and electrophoresed in a 0.7% agarose g e l . fcoRI/W /nd l l l-cut i s in lane g. The gel was v i s u a l i z e d under UV l i g h t using EtBr and i s reproduced below. a b c d e f g - - - M L Jtb _ _ _ Z _ -s.x 1k>- _ - - - - -1.* 3.M — i .^ _ _ _ — I.to - - 1.1 B ~ — — -- i.a - 0.5 The above gel was b i d i r e c t i o n a l l y transferred and hybridized at medium stringency with: F i l t e r B. 2.0 kb EcoRl/EcoRM pCehlO fragment F i l t e r C. fcoRV Tel fragment Size markers are derived from gel digested lane - 22, 5.2, 4.2, 3.4, 2.0, 1.9, and 1.6 kb. B. C . a b e d e f a b e d e f <|L1 82 other fragments with Tel homology. Probes from e i ther side of the BO variant Tel in pCehl05 did not hybridize to the N2 Tel .18 fragment. A r e s t r i c t i o n map of these N2 and BO inserts i s shown in Figure 19. The Tel .18-containing 5.2 kb EcoRl fragment i s homologous to the lefthand end of the BO 4.6 kb fcoRl fragment which contains no Tel sequences. However, Tel .18 and the unique f lanking sequence (0.5 kb Hindlll pCehlO probe) to the r i g h t of Tel .18 do not hybridize to the BO 4.6 kb fcoRl fragment. The 0.8 kb Sail fragment from the righthand end of the 4.6 kb BO fragment did not hybridize to the 5.2 kb N2 sequence. The o r i g i n a l N2 phage containing Tel.18 were hybridized with the 0.8 kb 5a71 probe from the 5.2 kb BO fragment and a 0.4 kb 5a7I probe from the 2.7 kb BO T c l - h y b r i d i z i n g i n s e r t . Both probes were homologous to a 5.6 kb fcoRl band (Figure 21). As the 5.2 and 5.6 kb fcoRl fragments from the N2 phage are present in a l l three phage, th i s suggests that these fragments are adjacent in the genome. A tentat ive model incorporating t h i s data suggests that an invers ion/de le t ion event involving Tel.18 has occurred in the BO s t r a i n (Figure 21). During t h i s rearrangement, Tel .18 and DNA extending into the adjacent 5.6 kb fragment were inverted. At the same time, sequences f lanking Tel.18 on the righthand side and part of the Tel .18 termini were deleted. This created the BO defect ive Tel and resulted in sequences f lanking the defective Tel being derived so le ly from the 5.6 kb fragment. A new fcoRl s i t e must also have been created as the old fcoRl s i t e separating the 5.2 and 5.6 kb fragments would have been lo s t in the de le t ion . 83 Figure 21. Hybridizat ions with N2 Charon 4 phage containing Tel .18 Section A ) . Three N2 Charon 4 phage, each containing Te l .18 , were fcoRl-digested , electrophoresed in a 0.7% agarose g e l , and the bands v i s u a l i z e d through ethidium bromide-staining. Lane a) , phage KR#56, Lane b) . phage KR#39, Lane c ) . phage KR#47, Lane d ) . fcoRI/rY/ndl l l -digested 7> - fragment s izes are 22, 5.2, 4 .2, 3.4, 2 .0, 1.9, 1.6, 1.3, 1.0, and 0.8 kb. Section B) . The gel of section A was b i d i r e c t i o n a l ! y transferred to n i t r o c e l l u l o s e and hybridized at medium stringency with the 0.8 kb 5a7I/£coRI fragment in pCehl06. Size markers between sections B and C are 22, 5.2, 4 .2, 3.4, 2.0, 1.9, and 1.6 kb. Section C) . The 0.4 kb 5a7I fragment from pCehl05 was hybridized at medium stringency to the second f i l t e r obtained from the b i d i r e c t i o n a l t rans fer . Size markers as in section B. Model of Inversion/Deletion Event RV Rl RV N2 5.2 kb fragment RV Tel .18 creat ion of Rl s i t e * / Rl Rl j ;AV.VAW%^WWJW^^^ j 5.6 kb fragment Deletion Inversion Rl BO RV ^ ^ ^ ^ R j ^ , RV Rl 4.6 kb fragment 2.7 kb fragment variant Tel \ H / Sa71 0.4 kb probe from pCehl06 / 5a7I/£coRI 0.8 kb probe from pCehl05 84 B. Tel Somatic and Germline Excis ion 85 1. Tel exc i s ion from the N2 genome The f lanking sequence of Tel .7 was hybridized to N2 and BO genomic DNA (Figure 22). The probe detected a s ingle fcoRI fragment of 3.2 kb in both s t r a i n s . A minor band can also be observed 1.6 kb below the parent band in both N2 and BO. As 1.6 kb i s the s ize of the Tel element at t h i s s i t e , these re su l t s are compatible with t h i s band being a somatic excis ion band. The somatic exc i s ion bands associated with BO Tel elements have been cloned and shown to be precise or nearly precise (two to four bp remaining behind at the in se r t ion s i te ) excis ions of the Tel element (Ruan and Emmons, 1987; Eide and Anderson, 1988). Therefore, a Tel present in the same region in the N2 and BO genomes i s able to excise at comparable l eve l s in both s t r a i n s . The N2 Tel i s not immobile. These resu l t s have been published in Harris and Rose (1986). 2. BO Tel excis ion from the N2 genome In the previous experiment, the excis ion of a Tel integrated at the same loca t ion in the N2 and BO genomes was examined. Although the elements studied were in the same l o c a t i o n , there could be s t ructura l differences between elements that would affect t h e i r a b i l i t y to excise . I constructed a r e s t r i c t i o n map of the BO fcoRI fragment cloned into pSWll by S. Wood to help ascertain that a 1.6 kb DNA inser t ion was caused by a Tel element. The inser t ion contained r e s t r i c t i o n enzyme cut s i te s expected wi th in Tel as well as a 86 N2 BO Figure 22. N2 Tel somatic excis ion fcoRI-digested DNA from N2 ( l e f t lane) (4 ug/lane) and BO (r ight lane) (3.5 ug/lane) was hybridized at medium stringency with the 1.6 kb fcoRI insert from the pCeh29 delet ion plasmid (Tel .7 deleted) . The parent band is at 3.2 kb and the band at 1.6 kb i s compatible with somatic excis ion of the Tel .7 element. Size markers from £"coRI//77/7dIII-digested 7\ DNA are shown at 3.4, 2.0, and 1.6 kb. The band at 2.7 kb i s probably due to low-level pUC contamination since a l l blots prepared with th i s N2 DNA exhibited t h i s 2.7 kb band when probed with plasmid sequences. 87 Hindlll s i t e not found in the conserved Tel sequence. The r e s t r i c t i o n map of the 3.2 kb E c o R I / W n d l l l fragment of pSWll i s shown i n Figure 23. This Tel was shown to be a Tel(Hin) var iant and the re su l t s published in Rose et a l . (1985). This Tel could be s p e c i f i c a l l y i d e n t i f i e d by i t s pos i t ion at the sPl s i t e in the BO genome and i t was not present at the same s i t e in N2. Therefore, Tcl(Hin) was a good candidate for an experiment comparing Tel exc i s ion in a BO and a N2 genetic background. To examine behavior of the same Tel in these two s t r a i n s , the s t r a i n KR324 was constructed in the fol lowing manner (as i l l u s t r a t e d in Figure 24): Three genetic markers (dpy-5, dpy-14, and unc-13) c l o se ly l inked to the sPl s i t e were used to recombine the region of BO linkage group I that contained Tcl (Hin) into the N2 genome. The desired s t r a i n would contain BO DNA between dpy-5 and unc-13 while the rest of the genome would be derived from N2. Two- and three-factor crosses were carr ied out, followed by extensive backcrossing to N2. In t h i s way, the exc i s ion of the BO Tcl(Hin) could be examined in a l a rge ly N2 genetic background in the constructed s t r a i n and could be compared to excis ion in an e n t i r e l y BO genome. F i r s t , the r i ght ha l f of l inkage group I (LGI) from BO was introduced into the N2 genome. BO hermaphrodites were mated to dpy-5 dpy-14 heterozygous N2 males. The cross was undertaken in t h i s way as BO males do not mate. Forty Fj wildtype hermaphrodites were allowed to s e l f - c ro s s . Twelve of the for ty produced the progeny expected of a dpy-5 dpy-14 heterozygous N2/B0 hermaphrodite Figure 23. Res t r i c t ion map of Tcl(Hin) Rl B RV A S XASX i i i i i H J_ RV J T J_ H J L Rl RV A H S X EcoRl fcoRV Avail Hindlll Sail Xhol Tcl(Hin) 0.5 kb 89 igure 24. Construction of s t r a i n KR324 - Genetic o u t l i n e N2 DNA v/v\B0 DNA + + + /VvVVvVWVWVvVWvVVN B O A ^ V W W v V V V W M M W V V \ + + + B O R X 300 Tcls/genome dpy-5 dpy-14 + N2 ~ + +~N2 30 Tcls/genome cr* + + + dpy-5 dpy-14 + N2 0 Wildtype : Dpy-5 Dpyl4 and Dpy recombinants 3:1 1.5% Dpy-5 recombinants picked dpy-5 + + ^A/WVVVVVVvVVV\ + + dpy-14 unc-13 N2 x d dpy-5 + + + + N2 + dpy-14 unc-13 : ^vvVVVVvvvvvvVvVvVvVVVV^ Dpy-5 + + 0 Unc-13 recombinants picked and Dpy-5 Unc-13 homozygotes saved dpy-5 + unc-13 »WVVV«VVVVVvVl -A \VVV\A/WVWVVV. dpy-5 + unc-13 Small number of BO Tcls captured (= 1-10 BO Tcls) 90 (Dpy-5 Dpy-14s, wildtypes , and recombinants). Dpy-5 recombinants from these twelve were i so la ted (Dpy-5 and Dpy-14 nematodes are ea s i ly d i s t inguishable) and se l f -crossed. The eleven independent Dpy-5 recombinants obtained had a LGI which was ha l f N2 and h a l f BO DNA. Each of these s tra ins was grown for DNA. EcoRl-digested genomic hybr id izat ions were performed using the sPl probe (Figure 25). A l l eleven Dpy-5 N2/B0 hybrid s t ra ins exhibited the BO sPl band pattern, suggesting that the sPl s i t e was to the r i ght or very close to the l e f t of dpy-14. The second stage of the s t r a i n construction was intended to replace the majority of the remaining BO LGI DNA with N2 DNA, with the exception of the DNA between the genetic markers. Two Dpy-5 N2/BO s t ra ins were each used in the fol lowing cross . Dpy-5 N2/B0 hermaphrodites were mated to dpy-14 unc-13 heterozygous N2 males. Homozygous Dpy-5 Unc-13 recombinants were generated in a manner s i m i l a r to that described above for the Dpy-5 recombinants. Six Unc-13 recombinants were co l l ec ted from one Dpy-5 s t r a i n and f ive from the other s t r a i n . Eleven Dpy Unc homozygous s t ra ins were tested through genomic b l o t t i n g with the sPl probe to determine whether Tcl(Hin) was present. A l l 11 tested p o s i t i v e . Consequently, the sPl s i t e maps very close to dpy-14 since no recombinants which separated the Tel(Hin) at the sPl s i t e and the dpy-14 gene were recovered. Successive backcrosses to N2 were performed to d i l u t e the BO component of the genome. One Dpy-5 Unc-13 s t r a i n (shown to contain the sPl RFLD) was picked and backcrossed to N2 males. Af ter each 91 e f g h i j k I - f t ' Figure 25. Construction of s t r a i n KR324 (Introduction of BO TcHHin)  into the N2 genome) - Character izat ion of Dpy-5 s t r a in  i so la tes with respect to the sPl RFLD fcoRI-digested genomic DNA from N2, BO, and Dpy-5 s tra ins ( l abe l led with KR s t r a in numbers) was s ize- fract ionated through electrophoresis in a 0.7% agarose g e l . The DNA was transferred to n i t r o c e l l u l o s e and hybridized with the sPl probe [the 5.5 kb fcoRI inser t from pCeh57 derived from the N2 s t ra in and lacking Tcl (Hin) ] at moderate stringency. The double arrow indicates the 7.2 kb BO band [containing the 1.6 kb Tcl(Hin) element] and the s ingle arrow indicates the 5.5 kb N2 band [ lacking the Tcl(Hin) element]. Size markers are of £coRI///7/7dIII /\ fragments of 5.2, 4 .2 , and 3.4 kb. Lane N2 control BO control KR188 - BO KR185 - BO KR190 - BO KR200 - BO KR191 - BO KR194 - BO KR201 - BO KR195 - BO KR187 - BO KR196 - BO pattern pattern pattern pattern pattern pattern pattern pattern pattern pattern A fa in t band is v i s i b l e in lane g in the o r i g i n a l autoradiograph. 92 cross , the hermaphrodites were allowed to se l f -cross to ensure they were homozygous. This procedure was repeated seven times to y i e l d the s t r a i n KR324. The constructed s t r a i n , KR324, contained a chromosome I cons i s t ing of BO genome for less than 2 map units (m.u.) between the v i s i b l e markers dpy-5 and unc-13 and of N2 DNA for the remainder of LG I . The remaining chromosomes are predicted to be greater than 99% N2 (0.5 9 ) since each backcross of a N2/B0 hybrid s t r a i n to N2 w i l l reduce the remaining BO component by an estimated 50%. This c a l c u l a t i o n takes into account the seven backcrosses to N2 as well as the f i r s t two crosses to N2-derived mutant s t r a i n s . As there are about 300 Tel elements in BO (Emmons et a l . , 1983; Liao et a l . , 1983) and approximately 300 m.u. in the genome, one to three BO Tcls were expected to be l e f t behind in KR324. In f ac t , Tel hybridized to a southern blot of fcoRl-cut N2 and KR324 DNA revealed seven addit ional bands in the N2/B0 hybrid (Figure 25). In add i t ion , one N2 Tel was missing from the KR324 DNA. The exc i s ion of Tcl(Hin) from the sPl s i t e in KR324 was examined and compared with the same event in B0 with N2 as a control (Figure 27). Excis ion of Tcl(Hin) can be seen in the KR324 s t r a in at a rate v i s u a l l y comparable to that in BO, although somewhat reduced. The N2 genetic background does not prevent the excis ion of a Tel derived from the BO genome. 93 -5.3Kb -4.3Kb -3.4Kb Figure 26. Introduction of Tcl(Hin) into the KR324 (dpy-14) genome fcoRI-digested KR324 ( labe l led dpy-14 on the f igure , as t h i s i s the gene the BO sequences are centered around) and N2 DNA was hybridized with a 1.6 kb fcoRV Tel fragment. Tel bands not common to both s tra ins are marked. Symbols: ->, Tel band present in KR324 but not N2; <-, Tel present in N2 but not in KR324. Size markers are from fcoRI /W/ndl l l > fragment pos i t ions . The f igure i l l u s t r a t e s that there are at least seven T c l - h y b r i d i z i n g bands present in the KR324 lane and not present in the N2 lane, of which one at 7.6 kb corresponds in s ize to the expected EcoRl fragment containing T c l ( H i n ) . 94 Figure 27. Somatic excis ion of Tcl(Hin) in N2 and BO s tra ins FcoRI-digested genomic DNAs (4 ug/lane) from BO (lane 1), KR324 (greater than 99% N2) (lane 2) , and KR383 (greater than 99% N2) (lane 3) probed with the 1.6 kb EcoRl/Hindlll fragment from pCesl8 ( f lanking sequence of Tcl(Hin) subcloned from the N2 genome) (Rose et a l . , 1982). KR383 i s derived from KR324 and has been backcrossed to N2 s tra ins two addit ional times. The parent band (>) i s at 7.2 kb and the minor 5.5 kb band ( » ) i s v i s i b l e in a l l s t r a i n s , compatible with somatic excis ion of T c l ( H i n ) . 3. Tcl(Hin) qermline excis ion 95 One BO s t r a i n , maintained on p la tes , appeared to have l o s t the Tcl(Hin) at the sPl s i t e . A routine DNA preparation was carr ied out with t h i s BO s t r a i n to obtain addit ional BO DNA. ,In an experiment using N2 and BO genomic DNA as references for the RFLD s P l , DNA i so la ted from these BO worms f a i l e d to exh ib i t the 7.6 kb band expected (Figure 28). A Tel probe was hybridized to the i d e n t i c a l f i l t e r to ensure the BO lane s t i l l showed the BO Tel pattern (data not shown). This was the f i r s t evidence that the Tel var iant Tcl(Hin) could be mobilized in the germline. 96 A B C F i g u r e 28. E v i d e n c e f o r g e r m l i n e e x c i s i o n of T c i ( H i n ) f c o R I - d i g e s t e d genomic DNAs o f B 0 [ T c l(Hin)-] (DNA p r e p a r a t i o n #49) ( l a n e A ) , N2 ( l a n e B) , and B 0 [ T c l(Hin)+] (DNA p r e p a r a t i o n #51) ( l a n e C) was e l e c t r o p h o r e s e d i n a 0.5% a g a r o s e g e l and h y b r i d i z e d w i t h t h e sPl probe (1.6 kb EcoRI/t f /ndl l l fragment from pCesl8). S i z e m a rkers a r e from fcoRI/rZ /ndll l 7\ - 5.2, 4 .2, and 3.4 k b . The BO s t r a i n ( l a n e a) e x h i b i t s a band i d e n t i c a l t o N2 ( l a n e b) a t 6.0 kb w h i c h i s c o m p a t i b l e w i t h T c l ( H i n ) h a v i n g undergone g e r m l i n e e x c i s i o n w i t h i n a r e c e n t a n c e s t o r o f t h i s BO s t r a i n . The BO s t r a i n DNA i n l a n e c e x h i b i t s a 7.6 kb band e x p e c t e d i f T c l ( H i n ) were s t i l l p r e s e n t . 97 C. Character izat ion of C. briggsae Repet i t ive Elements 1. Detection of Tel Identi ty in C. briggsae C. briggsae genomic hybr id iza t ion revealed the presence of r e p e t i t i v e sequences with Tel i d e n t i t y . An fcoRV-cut Tel probe was hybridized at low stringency to genomic DNAs of C. elegans var . N2 and C. briggsae var . G16 (Figure 29). Approximately 30 bands in the G16 lane hybridized with a weaker signal than bands in the N2 lane. 2. L ibrary Screening of T c l - h y b r i d i z i n g C. briQQsae Elements A 7^  Charon 4 C. briggsae var. G16 l i b r a r y (constructed by T. Snutch) was screened with a Tel probe to invest igate whether these T c l - h y b r i d i z i n g sequences belonged to one or several r e p e t i t i v e f a m i l i e s . Ten unique phage were i so l a ted , each containing a s ing le , T c l - h y b r i d i z i n g fcoRI fragment ranging from 2.4 to greater than 10 kb in s i z e . These fcoRI fragments were each subcloned into pUC19 and named pCbhl through pCbhlO (Table 6) . The subclone pCbh8 was hybridized at medium stringency back to a l l ten Charon 4 phage. Only one fcoRI fragment in each phage was seen to hybr id i ze . This experiment was performed to af f irm that 98 Figure 29. C. brippsae DNA contains T c l - h y b r i d i z i n g sequences fcoRI-digested genomic DNAs of C. briggsae s t r a i n G16 ( l e f t lane) and C. elegans s t r a in N2 was electrophoresed in a 0.5% agarose gel and hybridized with a C. elegans 1.6 kb fcoRV Tel fragment probe at low str ingency. Size markers are SstIl/Hindl11 7) fragment posi t ions - 9.4, 4.4, 3.8, 2.8, 2 .3, and 2.0 kb. Mul t ip l e bands in the G16 lane hybridized with less i n t e n s i t y to the Tel probe than the mult ip le bands v i s i b l e in the N2 1 ane. 99 100 Table 6. Summary of C. briggsae Te l -hybr id i z ing elements PIasmid Genomic fcoRl Band Size Repet i t ive Element Family Spec i f i c Name pCbhlO >10.0 kb Barney Barney.14 pCbh9 >10.0 Barney Barney.13 pCbh8 6.2 Barney Barney.10 pCbh7 5.0 Barney Barney.9 pCbh6 3.8 Barney Barney.5 pCbh5 >10.0 TCb2 pCbh4 >10.0 TCb2 pCbh3 9.0 TCb2 pCbh2 2.6 TCb2 pCbhl 2.4 TCb2 101 the Tel i d e n t i t y and the r e p e t i t i v e sequences are confined to a s ingle fcoRl band in each phage. 3. D i s t r i b u t i o n of Tel Identi ty The i d e n t i t y detected in low stringency hybr id iza t ions could have been due to any part of T e l . Tel may be hybr id iz ing to a short sequence repeated tandemly or a transposable element family randomly dispersed in the C. briggsae genome. To d i s t ingu i sh between these hypotheses, several d i f fe rent fragments of Tel were separately hybridized to the r e p e t i t i v e element subclones (Figure 30). A l l of the Tel regions tested hybridized with comparable in tens i ty to the C. briggsae sequences, suggesting that the inter-species i d e n t i t y i s d i s t r i b u t e d over at least the Tel large open reading frame. 4. Inter-element Hybr id izat ion One of the subclones, pCbh8, was found to have i t s T c l - h y b r i d i z i n g sequences confined to a 2.3 kb 5a7I/fcoRI fragment. When t h i s 2.3 kb fragment of pCbh8 was hybridized at high stringency to a l l ten subclones (pCbhl through pCbhlO), d i f f e r e n t i a l hybr id i za t ion was observed (Fig 31). Using hybr id iza t ion in tens i ty as a c r i t e r i a , these subclones were divided into two f a m i l i e s , one represented by pCbhl and the other by pCbh8 (Table 6) . These may not be absolute d i v i s i o n s as there i s considerable va r i a t ion in hybr id iza t ion among the ten sequences. At a s l i g h t l y lower stringency (washing f i l t e r s at 62°C instead of 68 °C) , a l l 102 Figure 30. Hybr id izat ion of Tel Fragments to Barney Elements Legend A - Avail H - Hinfl S - 5a7I T - Thai V - fcoRV T V A S H A S H H T U I I I I l l I M I L U I L J I t I 450 bp Avail 0RF1 956 bp 5a7I/fcoRV 462 bp Hinfl 965 bp Thai |—| indicates C. elegans Tel fragments which were e lectroe luted and i n d i v i d u a l l y hybridized to Barney and TCb2 elements. A l l four fragments hybridized with equal in tens i ty to the C. briggsae r e p e t i t i v e subclones. 103 Figure 31. Two f a m i l i e s of C. briggsae r e p e t i t i v e sequences Ten plasmids (pCbhl through pCbhlO) containing d i s t i n c t C. briggsae sequences i s o l a t e d due t h e i r p o s i t i v e h y b r i d i z a t i o n with Tel were digested with fcoRl and electrophoresed on a 0.7% agarose gel (1 ug/lane). The gel was b i d i r e c t i o n a l l y transferred to n i t r o c e l l u l o s e and each f i l t e r hybridized at high stringency with one of two probes. Size markers are positions of SstIl/Hindl11 fragments - 9.4, 4.4, 3.8, 2.8, 2.3, and 2.0 kb. Left f i l t e r ) . pCbh8 probe (lane h) - 2.3 kb EcoRI/Sall pCbh8 fragment -> hybridizes to Barney elements Right f i l t e r ) . pCbhl probe (lane a)- 2.4 kb EcoRl pCbhl fragment -> hybridizes to TCb2 elements Lane a) . pCbhl Lane b) . pCbh2 Lane c) . pCbh3 Lane d) . pCbh4 Lane e) . pCbh5 Lane f) . pCbh6 Lane g) . pCbh7 Lane h) . pCbh8 Lane i) . pCbh9 Lane J) . pCbhlO pCbh8 hybridizes strongly to lanes f through h and weakly to lanes i and j . pCbhl hybridizes strongly to lanes a through e and very weakly to lanes g and h. This c r o s s - h y b r i d i z a t i o n i s due to the presence of sequence with Tel i d e n t i t y and the divergent nature of these elements. 104 subclones w i l l hybridize to e i ther pCbhl or pCbh8 to some degree. This i s in d i r e c t contrast to the high sequence conservation exhibi ted by Tel elements in C. elegans. The family of sequences represented by pCbh8 was named Barney (TCbl - I ransposon Caenorhabditis briggsae I ) and the family represented by pCbhl was named TCb2. Further evidence of sequence var i a t ion in the C. briggsae r e p e t i t i v e sequences was uncovered in C. briggsae var . G16 genomic hybr id i za t ions . S t ra in G16 exhibited s t r i k i n g genomic band pattern differences when probed with e i ther pCbhl or pCbh8 (Figure 32). pCbhl (TCb2) hybridized to t h i r t y - t h r e e bands and pCbh8 (Barney) to f i f t e e n bands in s t r a in G16 DNA. V i s u a l l y , i t appeared that some but not a l l of the f i f t e e n pCbh8-hybridizing bands are included in the pCbhl banding pattern. S imi la r resu l t s were also obtained in hybr id izat ions with e i ther BamHl- or /oa l-digested genomic DNAs (Figure 33). 5. C. briggsae S t ra in Hybrid izat ion Genomic DNAs of three C. briggsae s t r a i n s , G16, Z, and BO (Table 2) , were probed with the 2.3 kb Sa7I/£coRI pCbh8 fragment (Figure 34). The banding patterns of G16 and Z d i f fered at approximately s ix s i t e s , while between Z and BO, there was at least one band d i f ference . Using pCbhl as a probe, a s i m i l i a r pattern emerged (data not shown). There were numerous band differences between G16 and Z with fewer differences between Z and BO. fcoRI digests of plasmids containing a l l f i ve Barney 105 Pi B Figure 32. Detection of Barney and TCb2-containinq EcoRl  fragments in C. briaasae s t r a i n G16 ONA fcoRI-digested C. briggsae s t r a i n G16 DNA (4 ug/lane) was s i z e - f r a c t i o n a t e d through e l e c t r o p h o r e s i s . Two f i l t e r s containing one lane of DNA each were separately hybridized at high stringency to e i t h e r a Barney probe (lane A) (2.3 kb EcoRI/Sa7I pCbh8 fragment) or a TCb2 probe (lane B) (2.4 kb EcoRl pCbhl fragment). Size markers are S s t l l / t f / n d l l l fragments - 9.4, 4.4, 3.8, 2.8, 2.3, and 2.0 kb. The Barney probe hybridized to 15 bands (lane a) while the TCb2 probe hybridized to 33 bands (lane b ) . 106 A 1 C O Figure 33. Determination of the banding pattern of Barney and TCb2  elements in BamHl- and Xbal digestions of C.  briggsae G16 DNAs BamHl- and A"6al-digested C. briggsae s t r a i n G16 genomic DNA (3.5 ug/lane) was electrophoresed on a 0.7% agarose gel and b i d i r e c t i o n a l l y transferred to n i t r o c e l l u l o s e . Each f i l t e r was hybridized at high stringency with one of two probes. Size markers were posit i o n s of 5stII/A/7*/7dIII fragments - 9.4, 4.4, 3.8, 2.8, 2.3, and 2.0 kb. Lane A ) . BamHl d i g e s t i o n Lane B). Xbal digestion Above two lanes hybridized with Barney probe (2.3 kb £ c o R I / 5 a 7 I pCbh8 fragment) Lane C). BamHl digestion Lane D). Xbal d i g e s t i o n Above two lanes hybridized with TCb2 probe (1.3 kb BamHl pCbhl fragment) The banding patterns of TCb2 and Barney are d i s t i n c t using e i t h e r BamHl or Xbal to r e s t r i c t G16 genomic DNA, suggesting that TCb2 and Barney are two separate f a m i l i e s . 107 Figure 34. D i s t r i b u t i o n of Barney elements within three  C. briggsae s t r a i n s fcoRl-digested genomic DNAs from C. briggsae s t r a i n s BO (lane A ) , Z (lane B), and G16 (lane C) were electrophoresed in a 0.5% agarose g e l , southern b l o t t e d , and hybridized at high stringency with a Barney probe (2.3 kb £ c o R I / S a 7 I pCbh8 fragment). Size markers are Sstll/Hindl11 fragment positions - 9.4, 4.4, 3.8, 2.8, 2.3, and 2.0 kb. A l l three s t r a i n s e x h i b i t multiple banding d i f f e r e n c e s . This i s compatible with germline t r a n s p o s i t i o n of Barney elements. 108 elements were electrophoresed with fcoRI-digested G16, Z, and BO DNAs (Figure 35). This enabled these Barneys to be named r e l a t i v e to the numbering of the bands in the G15 lane and also determined which Barney elements were present in the other s t r a i n s . 6. Hybr id izat ion of Barney and TCb2 to C. elepans DNA An in teres t ing question was whether Tel was the only sequence in C. elegans with i d e n t i t y to the C. briggsae r e p e t i t i v e elements. I t might be possible that Barney or TCb2 could be unveil another family of sequences in C. elegans. Representatives of the Barney and TCb2 classes (pCbh7 and pCbh3) were hybridized at low stringency to C. elegans s t ra ins N2 and BO genomic DNAs (Figure 36). The pattern that emerged with both probes appeared i d e n t i c a l to the N2 and BO Tel pattern. However, the BO pattern i s so r e p e t i t i v e that any addit ional bands would not be detected. Tel i s the only sequence in C. elegans s t r a i n N2 with t h i s high degree of homology with Barney and TCb2 elements. 7. P a r t i a l DNA Sequencing of Barney and TCb2 One representative of the class of Barney elements, Barney.10, was chosen for p a r t i a l sequencing. P a r t i a l sequencing of pCbhl, a TCb2 element, was also accomplished. The Sall/EcoRl fragment of pCbh8 with Tel i d e n t i t y and C. briggsae repet i t iveness had been subcloned and was contained wi th in pCbhl l . However, the r e s t r i c t i o n 109 Figure 35. Characterizat ion of Barney elements wi th in three  C. briggsae s t ra ins 1 ug of each of the f ive Barney elements (pCbhS, pCbh7, pCbh8, pCbh9, and pCbhlO - the order of these plasmids corresponds to the increasing s ize of the fcoRI fragment) (see Table 6) was pooled and digested with fcoRI in a to ta l volume of 200 u l . A 100 ul 100-fold d i l u t i o n of the digest ion mix was prepared. 10 ul (0.5 ng of each plasmid) (lane b) and 20 ul (1 ng of each plasmid) (lane d) was loaded onto a 0.5% agarose gel along with fcoRI-digested genomic DNAs of C. briggsae s t ra ins G16 (lane a), Z (lane c ) , and BO (lane e ) . Af ter e lectrophores i s , the gel was southern blotted and hybridized at high stringency with a Barney probe (2.3 kb £coRI/Sa7I pCbh8 fragment). The genomic bands in lane a (G16 DNA) were numbered consecutively, beginning at the lowest molecular weight band. Arrows and numbers on the l e f t indicate the genomic bands of cloned Barney elements. The p > marker indicates a vector band (pUC) present in lanes b and c. Size markers on the r i ght are SstIl/Hindl11 fragment posi t ions - 9.4, 4.4, 3.8, 2.8, 2 .3 , and 2.0 kb. 110 Figure 36. Characterization of Barney and TCb2 cross-hybr id iz ing  sequences in C. elegans s t ra ins N2 and BO fcoRI-digested C. elegans s t ra ins N2 and BO genomic DNAs were s ize-fract ionated through electrophoresis in a 0.5% agarose gel and hybridized at low stringency with one of two probes. Size markers are S s t l l / H i n d l l l fragments - 9.4, 4.4, 3.8, 2.8, 2 .3 , and 2.0 kb. Lane A ) . N2 Lane B) . BO The above two lanes were hybridized with a Barney probe (pCbh7 plasmid). Lane C) . N2 Lane D). BO The above two lanes were hybridized with a TCb2 probe (pCbh3 piasmid). The two probes hybridized to mult iple bands in the N2 lane and a smear in the BO lane, consistent with these probes hybr id iz ing to C. elegans genomic fragments containing Tel elements. The N2 banding pattern appears to be ident ica l to the pattern expected for N2 Tel elements. I l l s i te s present in the pUC19 l i n k e r were inadequate for the methods to be used. Consequently, the 2.4 kb fragment was transferred into the B luescr ip t (-) vector . Both or ientat ions are represented in pCbhl2 and pCbhl7. These two plasmids were digested with S a d (3' overhang) and Xbal (5' overhang) to f a c i l i t a t e the un id i rec t iona l exonuclease a c t i v i t y . Figure 37 shows a number of deleted plasmids derived from pCbhl7. The sequencing strategy of the 2.3 kb inser t of pCbhl2 and pCbhl7 i s out l ined in Figure 38 and the ent i re sequence i s displayed in Figure 39. A stop codon map of the 2.3 kb inser t containing Barney in pCbhl2 i s displayed in Figure 40. The largest ORF of Barney, 0RF1, s tar t s and stops at the same s i te s as the Tel 0RF1 i f the Tel sequence pos i t ion 264 i s l i n e d up with f i r s t bp of the 2.25 kb C. briggsae sequence (Figure 41). Within the ORFls, the overa l l nucleotide sequence i d e n t i t y i s 71% and the amino acid sequence i d e n t i t y i s 74%. The s i m i l a r i t i e s between Tel and Barney are d i s t r i b u t e d f a i r l y evenly throughout the ORFs. In contrast , in the 263 bp preceding the ORFs, the sequence i d e n t i t y i s 84/263. The i d e n t i t y i s 39% in the 200 bp fol lowing the TAA stop codons of the ORFs. No RNA t ranscr ip t s of Tel have been detected. The high conservation in the ORF between Tel and Barney is the f i r s t evidence that T c l ' s ORF1 actua l ly may code for a p ro te in . A second, smaller ORF, 0RF2, i s present in Barney.10 on the opposite strand of 0RF1. There i s an ATG codon at pos i t ion 1432 and a TGA stop codon at 2053. 0RF2 could putat ive ly code for a protein of 207 amino acids . There i s a possible CAT box at 1287. This ORF i s not conserved in T e l . 112 a b c d e f g h i j k I m Figure 37. Construction of a series of deleted plasmids of pCbh!7 Deletion clones of pCbhl7 (prepared using the Exonuclease III/S1 nuclease method of Henikoff (1987)) were pur i f i ed in plasmid minipreparations and approximately 1 ug digested with Xhol (1 cut s i t e in Bluescr ipt vector l i n k e r ) . These s ingly-cut plasmids were electrophoresed in a 0.7% gel and v i sua l i zed under UV l i g h t using EtBr. Lane a) . undeleted pCbhl7 Lane b to k ) . de let ion clones of pCbhl7 Lane 1) . Bluescr ipt vector only Lane m). 5stII//V//7dIII - s ize markers are 20.3, 9.4, 4.4, 3.8, 2.8, 2 .3, 2.0, 1.5, 1.1, and 0.6 kb. Figure 38. Sequencing Strategy of the pCbh12/17 plasmids pCbhl2 < < — < < < < < < < — < < < < < < < < — < < <- < < — < < > > > > — > > > > > > > -> pCbhl7 sequence i d e n t i t y with Tel 114 Figure 39. DNA seouence of pCbhl2/17 2.3 kb inser t pCbhl2/17 CCTTCAATAMCTCCTTTTTCCATGAGGGTACATTGATTATTGCCACAGAACAGATGAGC 60 pCbhl2/17 AAAGGGTTTCTGGAMTTGTTGCTCTATCTATATTTTAGATAAGACnCCTTACAAAAAT 120 pCbhl2/17 ATGCMTTTTCTATACMTGTGCTACCGGGTTTTTGAGCCAAATTGGAGCAAATCGAGCA 180 pCbhl2/17 CAATTGTAATGAGCAATCCACATGCAATAGCGACAAAAAATGTAGCGCAACAGATTATAT 240 pCbhl2/17 nCGGGCTAGCTGAMAAAATGGTTTCAAAAnGACmATTTTTGAATTATCTAGGTCA 300 pCbh 12/17 CGACCTMTTTrTATTTTCTAGGTC 360 pCbhl2/17 ATCCTTCMTTTTTTTCAATTTTAGAMCTTGCCATMTATGACGAATATTCTCCTTGAC 420 pCbh12/17 CTGAAACTGTTGAGCCAGTCTATAAGTACCGGGAGTTGAAAATCTCTTGCCTAGCTGAAT 480 pCbhl2/17 ATTTATGAACCATMCGTAAAATATATCTGAMTTTTTCCTTTTTTTTTATAAAATTATC 540 pCbhl2/17 CTCTTCTTTCCACTCACCACGCATACAAAAACAACACAAATGATACATAAAGAATCCGCA 600 pCbhl2/17 ATTATAAATGGTATCCGATTATTGACCATAAAATAAGCAAACGGAAAACTTATACAATGA 660 pCbhl2/17 ACCGAAAAAAGAAGACCCACTCCGATATAGGTTCGTGGTGTTCGCTCGTAGTCCCTGTGA 720 pCbhl2/17 AAAAAAGTGAAAAATGAACACACTTGTGTACGCCTTTTGTTCAAGGAGAATCGATGCTTC 780 pCbhl2/17 CGTAGCGCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGGTCGTGAGTTCGAGCCTCAC 840 pCbh12/17 CGGGAGCAATTCCTTTTTCGTTTGCTTTTTTTGATTCTTTTTTGCAAGCTAATTTGATCA 900 pCbhl2/17 CTTACAGTACTGGCCATAAAGAATGCGACAACTTGTTTTTTGAAGATAACTTTTTGAAAA 960 pCbhl2/17 CTCMCTTTTCMTCCGAA1TTTTGGTAAGATTTTTTCAGCACTATCAAAAACTTTTAGG 1020 pCb h12/17 CTAAGTTGGTTTTAATATTCTGCTACAATTTTTTTGAAAATTAATTTTTTTCGAAAATTC 1080 pCbhl2/17 ATGAAAATGACATTTTTGGAGATCTATACAAAGAAGCTCAAGAAACACCGGAGGTCAAAA 1140 pCbhl2/17 ACAAAATAAAGGTAACAATAAAAAGTGATTTAATATTTCGTTGGGTATCCTTTCGCATCG 1200 pCbhl2/17 ATAACAGCCTTGCATCTACGTGGCATCGACTCCAGGAGCGTCTGAACCACCGTCATCGGG 1260 pCbhl2/17 ATACTCTTCCAAGCAGCTTCGAGTTGAGCAAACTTTTGATTGGCATTGGATGCTCTGACT 1320 pCbhl2/17 CCTTTGAGGCGGCGTTCCAGCTCCTCCCACATATGCTCGATGGGATTCAAGTCTGGAGAT 1380 pCbhl2/17 TGACTTGGCCATTCTAGGAGGTTCACACGGCGACGTCTGAACCAATTGGCGACATGACCC 1440 pCbhl2/17 GAAGTATGCTTCGGGTCATTGTCCTGTTGGAACACCCACGATCGGCCCAAATTTGCTCTT 1500 115 pCbhl2/17 GCCCATGGTCTCATTGTGTTCTCCAGGATGTCTTCGTACACATATCGATCCATGGTTCCA 1560 pCbhl2/17 ACGATTCTCTTCAATGGTCCCATAGAAGTGTCGGAGAAGCATCCCCAAACCATCACAGAT 1620 pCbhl2/17 CCACCTCCATGTTTCACAGTTGGACATTGGTACTGTGGAGCATACCTGGAGCCAATGGGA 1680 pCbh12/17 CGTCGAATCCACTGAATACCATCAGTTCCGAACATATTGAACTTCGATTCATCGCTCCAG 1740 pCbh12/17 ATGTGATTTGCCCACTCACGGGGGCCCCAGGACAAGTGCTGTTTAGCCCATTCAACGCGA 1800 pCbhl2/17 GCTTTTCGG1TTTTCAMCTGACGAGTGGTTTTTTGACTGGTCTTCGTCCGTGCAGTCCA 1860 pCbhl2/17 GCAACTTGCAAACGTCTTCTAATAGTTCTTCTCGATGGTACCGGTTCATTTGGAGACGTC 1920 pCbhl2/17 ACAGAAAGTTGAATATCCGTAGATGTGCGTCTAGGATCTTCTCGGCATGCGCGCAAAATG 1980 pCbhl2/17 TTCCGATCCATATTTCTGGAAGTGGTTCGGGGTCTTCCTGGAGATTGGCGATGAACAACG 2040 pCbhl2/17 CCATTCTAAATTGTTAAATTTAGTTGAGAAAGCTGATTGAAACCTCACATCCATCTCGAT 2100 pCbhl2/17 TTTTCTTCAGAACTATCGGTAAATTTGGCTGGAAGAACAACTAAACTGAGTTGCAAGTAT 2160 pCbhl2/17 CTTCGGATGCGCGCCGAGTTCATGACCACGCACAATGCTTTTTCGCTGTTATCATGTTGA 2220 pCbhl2/17 TAGTACACTTTCTTGTCTTTCATGACCGAACGGT 2254 Figure 40. Stop Codon Map of Barney.10 and surrounding sequence putative extent of Barney.10 c = complementary strand. 117 Figure 41. Comparison of Barney.10 and Tel sequences The nucleotide sequence of Barney.10 and Tel are aligned so that t h e i r ORFls begin at the same place. Bars bridging the DNA sequence point out sequence s i m i l a r i t i e s . The bottom two l i n e s contain the putative amino acid sequence of the ORFs ( labe l led Barney pro and Tel pro) . The Tel amino acid sequence i s shown in f u l l while the Barney.10 amino acid sequence has been d i r e c t l y compared to the Tel sequence. Dots represent an i d e n t i c a l amino acid while lower case l e t t e r s indicate a conservative amino acid change (less than 20% degrees of dif ference as described by D o o l i t t l e , 1979). Barney.10 ATGGATCGGAACATTTTGCGCGCATGCCGAGAAGATCCTAGACGCACATCTACGGATATT 60 Tel ATGGATCGCAACATCCTCCGATCAGCAAGAGAAGATCCGCATAGGACCGCCACGGATATT 60 Barney pro A c . . . . R . . S . . . 3 Tel pro M D R N I L R S A R E D P H R T A T D I 2 0 Barney.10 CAACTTTCTGTGACGTCTCCAAATGAACCGGTACCATCGAGAAGAACTATTAGAAGACGT 120 Tel CAAATGATTATAAGTTCTCCAAATGAACCTGTACCAAGTAAACGAACTGTTCGTCGACGT 120 Barney pro . 1 S v t . . . . . . . . r . . i . . . 4 Tel pro Q M I I S S P N E P V P S K R T V R R R 4 0 Barney.10 TTGCAAGTTGCTGGACTGCACGGACGAAGACCAGTCAAAAAACCACTCGTCAGTTTGAAA 180 Tel TTACAGCAAGCAGGACTACACGGACGAAAGCCAGTCAAGAAACCGTTCATCAGTAAGAAA 180 Barney pro . . V . r L v . L . 7 Tel pro L Q Q A G L H G R K P V K K P F I S K K 6 0 Barney.10 AACCGAAAAGCTCGCGTTGAATGGGCTAAACAGCACTTGTCCTGGGGCCCCCGTGAGTGG 240 Tel AATCGCATGGCTCGAGTTGCGTGGGCAAAAGCGCATCTTCGTTGGGGACGTCAGGAATGG 240 Barney pro . . K . . . E . . . Q . . S . . P R . . 1 3 Tel pro N R M A R V A W A K A H L R W G R Q E W 8 0 Barney.10 GCAAATCACATCTGGAGCGATGAATCGAAGTTCAATATGTTCGGAACTGATGGTATTCAG 300 Tel GCTAAACACATCTGGTCTGACGAAAGCAAGTTCAATTTGTTCGGGAGTGATGGAAATTCC 300 Barney pro . N m . . t . . I Q 16 Tel pro A K H I W S D E S K F N L F G S D G N S 100 Barney.10 TGGATTCGACGTCCCATTGGCTCCAGGTATGCTCCACAGTACCAATGTCCAACTGTGAAA 350 Tel TGGGTACGTCGTCCTGTTGGCTCTAGGTACTCTCCAAAGTATCAATGCCCAACCGTTAAG 360 Barney pro . i . . . i . . . . A . Q 18 Tel pro W V R R P V G S R Y S P K Y Q C P T V K 120 Barney.10 CATGGAGGTGGATCTGTGATGGTTTGGGGATGCTTCTCCGACACTTCTATGGGACCATTG 420 Tel CATGGAGGTGGGAGCGTCATGGTGTGGGGGTGCTTCACCAGCACTTCCATGGGCCCACTA 420 Barney pro s D 19 Tel pro H G G G S V M V W G C F T S T S M G P L 1 4 0 Barney.10 AAGAGAATCGTTGGAACCATGGATCGATATGTGTACGAAGACATCCTGGAGAACACAATG 480 Tel AGGAGAATCCAAAGCATTATGGATCGTTTTCAATACGAAAACATCTTTGAAACTACAATG 480 Barney pro k . . V G T . . . y V . . D . L . N . . 2 6 Tel pro R R I Q S I M D R F Q Y E N I F E T T M 160 Barney.10 AGACCATGGGCAAGAGCAAATTTGGGCCGATCGTGGGTGTTCCAACAGGACAATGACCCG 540 Tel CGACCCTGGGCACTTCAAAATGTGGGCCGTGGCTTCGTGTTTCAGCAGGATAACGATCCT 540 Barney pro . . . . R A . 1 . . S w 29 Tel pro R P W A L Q N V G R G F V F Q Q D N D P 180 118 Barney.10 AAGCATACTTCGGGTCATGTCGCCAATTGGTTCAGACGTCGCCGTGTGAACCTCCTAGAA 600 Tel AAGCATACTTCTCTTCATGTGCGTTCATGGTTTCAACGTCGTCATGTGCATTTGCTCGAT 600 Barney pro . . . . G . . A N . . R . . R . N . . e 35 Tel pro K H T S L H V R S W F Q R R H V H L L O 200 Barney.10 TGGCCAAGTCAATCTCCAGACTTGAATCCCATCGAGCATATGTGGGAGGAGCTGGAACGC 660 Tel TGGCCAAGTCAGTCTCCGGACTTGAATCCAATAGAGCATTTGTGGGAAGAGTTGGAAAGA 660 Barney pro m 35 Te l pro W P S Q S P D L N P I E H L W E E L E R 220 Barney.10 CGCCTCAAAGGAGTCAGAGCATCCAATGCCAATCAAAAGTTTGCTCAACTCGAAGCTGCT 720 Tel CGTCTTGGAGGTATTCGGGCTTCAAATGCAGATGCCAAATTCAACCAGTTGGAAAACGCT 720 Barney pro . . K . v N Q . . A . . . A . 40 Tel pro R L G G I R A S N A D A K F N Q L E N A 240 Barney.10 TGGAAGAGTATCCCGATGACGTTGGTTCAGACGCTCCTGGAGTCGATGCCACGTAGATGC 780 Tel TGGAAAGCTATCCCCATGTCAGTTATTCACAAGCTGATCGACTCGATGCCACGTCGTTGT 780 Barney pro . . S . . . t 1 v Q T . 1 e 43 Tel pro W K A I P M S V I H K I I D S M P R R C 260 Barney.10 AAGGCTGTTATCGATGCGAAAGGATACCCAACGAAATATTAA 822 Tel CAAGCTGTTATTGATGCAAACGGATACGCGACAAAGTATTAA 822 Barney pro K K . . p . . . * 45 Tel pro Q A V I D A N G Y A T K Y * 273 119 The Tel 0RF2 i s located in Tel running from pos i t ion 603 to 940. Examination of Barney sequence reveals 2 stop codons in the equivalent region of sequence with an amino acid sequence i d e n t i t y of 50/114. I t cannot be conclus ively stated that th i s ORF i s not functional in T e l . The retrotransposon Tyl has been shown to use a frameshift event to produce a fusion protein from two overlapping ORFs (Fink et a l , 1986). However, t h i s region probably i s not used in Barney as coding sequence. Tel and Barney may have s i m i l a r t e r m i n i . There i s a sequence in Barney that i s 1 bp frameshifted from the righthand Tel t e r m i n i . This Barney sequence i s conserved for 37 of the 54bp long Tel inverted repeat (68% ident i ty ) (Figure 42). This putative Barney terminus i s not present anywhere else in the 2.25 kb sequence and the opposite end may not have been cloned. Spec i f i c fragments of a TCb2 element in pCbhl were i so la ted to allow p a r t i a l sequencing of regions with Tel i d e n t i t y . A strongly T c l - h y b r i d i z i n g SauIIIA fragment of 150 bp and a weakly T c l - h y b r i d i z i n g fragment of 350 bp from pCbhl were each subcloned into the BamHl s i t e of pUC19. Both of these SauIIIA fragments hybridized strongly with another TCb2 element (pCbh4). In add i t ion , the fcoRl insert of pCbhl i s 2.4 kb which was divided into two BamHl fragments to ease handling and reduce the number of r e s t r i c t i o n s i te s present in the whole i n s e r t . The 1.3 kb BamHl fragment i s present in pCbhl3 and the 1.1 kb fragment i s represented by pCbhl5. P r i o r to producing deleted der iva t ive s , pCbhl3 was digested with S s t l I and Xbal and p a r t i a l sequencing of these deleted der ivat ives was carr ied out. 120 Figure 42. Comparison of putative terminal inverted repeat sequences The putative termini of HB1, T e l , and Barney.10 are shown below, with the end of the elements on the r i g h t . Bars bridging DNA sequences point out ident i ca l sequence between HB1 and Tel as well as Tel and Barney. * indicate ident ica l nucleotides between HB1 and Barney not in common with T e l . HB1 sequence taken from B r i e r l e y and Potter , 1985. HB1 IR GCACTGCTATTTTTATGAACACAGCTGTAC 1*111 111*11 II III Tel IR AGAAAAAAGTTACACACAAAAAACCAAAAGTGGATATCTTTTTGGCCAGCACTG M I N I M I MM MM I I I I M i l l II M i l l IIII Barney IR TTCAAAAAGnATCTTCAAAAMCMGTTGTCGCATTCTTTATGGCCAGTACTG 121 The TCb2 sequences are shown and compared with Barney.10 and Tel sequences in Figure 43. Two groups of TCb2 sequences are contained wi th in the large ORF. The nucleic acid and amino acid sequence i d e n t i t y between Barney.10 and TCb2 is 71% for the f i r s t 338 bp sequence and 76% for the second 112bp sequence. Tel and TCb2 appear equally diverged from Barney.10. Other inverted repeat elements were examined for any sequence i d e n t i t y with T e l . Computer-assisted comparisons of nucle ic acid sequence and potentia l amino acid sequence revealed no s i m i l a r i t i e s between Tel and e i ther Mu (Barker et a l , 1984), P (O'Hare and Rubin, 1983), or mariner (Jacobson et a l , 1986). However, D. B a i l l i e (Simon Fraser Univers i ty) has pointed out that another less-s tudied transposable element family in Drosophila melanogaster named HB (Br ier ley and Potter , 1985) showed a surpr i s ing amount of i d e n t i t y with Tel (D. B a i l l i e , pers comm.). Tel and HB1 show some i d e n t i t y between t h e i r terminal repeats but none in the sequences leading up to t h e i r ORFs. In Figure 42, the termini of T e l , HB1, and Barney (putative termini) have been compared. HB1 matches Tel and/or Barney termini for 16 out of 30 bp. At f i r s t inspect ion, i t seemed that the sequence i d e n t i t y of Tel and HB1 was l i m i t e d to the l a s t t h i r d of the ORF. However, i f three small delet ions of 3, 1 and 3 bp are created at posi t ions 307, 415, and 434 from the s tar t of 0RF1 in HB1, the rest of the ORF becomes favorably aligned to that of T c l ' s as well (Figure 44). HB1 does contain three in-frame stop codons but sequences preceding and fo l lowing these stop signals show equal conservation with T e l . I f 122 Figure 43. Comparison of a p a r t i a l TCb2 sequence with Tel and  Barney.10 The DNA and amino acid sequences of Barney.10, TCb2, and Tel are compared. Bars bridging the sequences indicate ident i ca l nucleot ides . Barney.10 ACCGTTCGGTCATGAAAGACAAGAAAGTGTACTATCAACATGATAACAGCGAAAAAGCAT 60 TCb2 0 Tel . TTATTTTTAAGGTATGGTAAAATCTGTTGGGTGTAAAAATCTTTCCTTGGACGTCAAGAA 60 Barney pro 0 TCb2 pro 0 Tel pro 0 Barney.10 TGTGCGTGGTCATGAACTCGGCGCGCATCCGAAGATACTTGCAACTCAGTTTAGTTGTTC 120 TCb2 0 Tel AGCCATTGTAGCTGGCTTCGAACAAGGAATACCCACGAAAAGCTCGCGCTGCAAATTCAA 120 Barney pro 0 TCb2 pro 0 Tel pro 0 Barney.10 TTCCAGCCAAATTTACCGATAGTTCTGAAGAAAAATCGAGATGGATGTGAGGTTTCAATC 180 TCb2 0 Tel CGTTCTCCGTCGACTATTTGGAAAGTAATCAAGAAGTACCAAACTGAGGTGAGTTCGAAA 180 Barney pro 0 TCb2 pro 0 Tel pro 0 Barney.10 AGCTTTCTCAACTAAATTTAACAATTTAGAATGGCGTTGTTCATCGCCAATCTCCAGGAA 240 TCb2 - 0 Tel AATATTATTTTTTAATAATAAATGTTTAGAAATCCGTCGCTTTGAGAATCTCGCCCGGCA 240 Barney.10 GACCCCGAACCACTTCCAGAAATATGGATCGGAACATTTTGCGCGCATGCCGAGAAGATC 300 TCb2 - - - - - 0 Tel GGCCTCGAGTGACAACCCATAGGATGGATCGCAACATCCTCCGATCAGCAAGAGAAGATC 300 123 Barney.10 CTAGACGCACATCTACGGATATTCAACTTTCTGTGACGTCTCCAAATGAACCGGTACCAT 360 TCb2 --TACGGACATTCAGATGGTCG 47 Tel CGCATAGGACCGCCACGGATATTCAAATGATTATAAGTTCTCCAAATGAACCTGTACCAA 360 Barney p r o P R R T S T D I Q L S V T S P N E P V P - 3 2 I I I I I I I I I TCb2 pro T D I Q M V V K T P N E V T P 15 I I I I I I I I I Tel pro P H R T A T D I Q M I I S S P N E P V P 32 Barney.10 CGAGAAGAACTATTAGAAGACGTTTGCAAGTTGCTGGACTGCACGGACGAAGACCAGTCA 420 TCb2 CCCTGAGAACCGTCAGAAGACGTCTTCAA 107 Tel GTAAACGAACTGTTCGTCGACGTTTACAGCAAGCAGGACTACACGGACGAAAGCCAGTCA 420 Barney pro S R R T I R R R L Q V A G L H G R R P V 52 I I I I I I I I I I I I I I I I TCb2 pro S L R T V R R R L Q D A G L H G R R P A 35 I I I I I I I I I I I I I I I I Tel pro S K R T V R R R L Q Q A G L H G R K P V 52 Barney.10 AAAAACCACTCGTCAGTTTGAAAAACCGAAAAGCTCGCGTTGAATGGGCTAAACAGCACT 480 TCb2 AGAAACCATCGATCAGCAAGAAGAACAGAATCGCCCGCGTAGCATGGGCCAGAGCTCATC 167 Tel AGAAACCGTTCATCAGTAAGAAAAATCGCATGGCTCGAGTTGCGTGGGCAAAAGCGCATC 480 Barney pro K K P L V S L K N R K A R V E W A K Q H 72 I I I I I I I I I I I I I TCb2 pro K K P S I S K K N R I A R V A W A R A H 55 I I I I I I I I I I I I I I I I I Tel pro K K P F I S K K N R M A R V A W A K A H 72 Barney.10 TGTCCTGGGGCCCCCGTGAGTGGGCAAATCACATCTGGAGCGATGAATCGAAGTTCAATA 540 TCb2 TCCACTGGGGACGTCAGGATTGGGCTAATCAC^ 227 Tel TTCGTTGGGGACGTCAGGAATGGGCTAAACACATCTGGTCTGACGAAAGCAAGTTCAATT 540 Barney pro L S W G P R E W A N H I W S D E S K F N 92 I I I . M i l I I I I I I I TCb2 pro L H W G R Q D W A N H V F S D E S K F N 75 I I I I I I I I I I I I I I I Tel pro L R W G R Q E W A K H I W S D E S K F N 92 124 Barney.10 TGTTCGGAACTGATGGTATTCAGTGGATTCGACGTCCCATTGGCTCCAGGTATGCTCCAC 600 TCb2 TGTTCGGTACTGACGGTATCAAGU 287 Tel TGTTCGGGAGTGATGGAAATTCCTGGGTACGTCGTCCTGTTGGCTCTAGGTACTCTCCAA 600 Barney pro M F G T D G I Q W I R R P I G S R Y A P 112 I I I I I I I I I I I I I I TCb2 pro L F G T D G I K W I R R P V G C R F D P 95 I I I I I I I I I I I I i Tel pro L F G S D G N S W V R R P V G S R Y S P 112 Barney.10 AGTACCAATGTCCAACTGTGAAACATGGAGGTGGATCTGTGATGGTTTGGGGATGCTTCT 660 TCb2 GCTACCAGCTCCA^ 338 Tel AGTATCAATGCCCAACCGTTAAGCATGGAGGTGGGAGCGTCATGGTGTGGGGGTGCTTCA 660 Barney pro Q Y Q C P T V K H G G G S V M V W G C F 132 I I I I I I I I I I I I I I TCb2 pro S Y Q L Q T V K H G G G S V M V W 112 I I I I I I I I I I I I I I Tel pro K Y Q C P T V K H G G G S V M V W G C F 132 Barney.10 CCGACACTTGTATGGGACCATTGAAGAGAATCGTTGGAACCATGGATCGATATGTGTACG 720 TCb2 GGATCGCTTTGTCTATG 355 Tel CCAGCACTTCCATGGGCCCACTAAGGAGAATCCAAAGCATTATGGATCGTTTTCAATACG 720 Barney pro S D T S M G P L K R I V G T M D R Y V Y 152 I I I I TCb2 pro D R F V Y 117 I I I I Tel pro T S T S M G P L R R I Q S I M D R F Q Y 152 Barney.10 AAGACATCCTGGAGAACACAATGAGACCATGGGCAAGAGCAAATTTGGGCCGATCGTGGG 780 TCb2 AAGACATCTTGGAGAACACAATGAGACCCTGG 415 Tel AAAACATCTTTGAAACTACAATGCGACCCTGGGCACTTCAAAATGTGGGCCGTGGCTTCG 780 Barney pro E D I L E N T M R P W A R A N L G R S W 172 I I I I I I I I I I I I I I I TCb2 pro E D I L E N T M R P W A ' R S T V G R A F 137 I I I I I I I I I I I I I Tel pro E N I F E T T M R P W A L Q N V G R G F 172 125 Barney.10 TGTTCCAACAGGACAATGACCCGAAGCATACTTCGGGTCATGTCGCCAATTGGTTCAGAC 840 TCb2 TTTTCCMCAGGATAACGACCCGAAGCACACCTCGAAGCACATCAAGGAGTGGTTCCGAC 475 Tel TGTTTCAGCAGGATMCGATCCTAAGC^ 840 Barney pro V F Q Q D N D P K H T S G H V A N W F R 192 I I I I I I I I I I I I I I I I' TCb2 pro V F Q Q D N D P K H T S K H I K E W F R 157 I I I I I I I I I I I I I I I Tel pro V F Q Q D N D P K H T S L H V R S W F Q 192 Barney.10 GTCGCCGTGTGAACCTCCTAGAATGGCCAAGTCAATCTCCAGACTTGAATCCCATCGAGC 900 TCb2 GCCGCCACGTGGATC 490 I II II III II Tel GTCGTCATGTGCATTTGCTCGATTGGCCAAGTCAGTCTCCGGACTTGAATCCAATAGAGC 900 Barney pro R R R V N L L E W P S Q S P D L N P I E 212 I I I TCb2 pro R R H V D - 152 I I I I Tel pro R R H V H L L D W P S Q S P D L N P I E 212 126 Figure 44. Comparison of T e l , Barney, and HB1 sequence The nucleotide sequences of Barney, T e l , and HB1 are aligned at t h e i r putative coding regions. Three delet ions in the HB1 DNA sequence were included in order to maximize the alignment. The amino acid coding potent ia l i s compared. A dot indicates an amino acid of Barney or HB1 in common with the Tel amino acid sequence. A lower case l e t t e r represents a conservative amino acid change (less than 20% degrees of dif ference as described by D o o l i t t l e , 1979) and a cap i t a l l e t t e r indicates a non-conservative change. Barney ATGGATCGGAACATTTTGCGCGCATGCCGAGAAGATCCTAGACGCACATCTACGGATATT 60 Tel ATGGATCGCAACATCCTCCGATCAGCAAGAGAAGATCCGCATAGGACCGCCACGGATATT 60 HB1 ACCACAGATATAGAGGATCGACGCATTGTTTCTTACAGCAAAGTCTATCGTTTTGCATCC 60 Barney pro A c . . . . R . . S . . . 3 . Tel pro M D R N I L R S A R E D P H R T A T D I 2 0 H B l p r o T T D I E D . R I V S Y S K V Y R F A S 1 9 Barney CAACTTTCTGTGACGTCTCCAAATGAACCGGTACCATCGAGAAGAACTATTAGAAGACGT 120 Tel CAAATGATTATAAGTTCTCCAAATGAACCTGTACCAAGTAAACGAACTGTTCGTCGACGT 120 HB1 TTTAGGGACATAAAGTCTGAGCTGAACTTGGGAATCAGCGACGTTACTATTCGTAGACGA 120 Barney pro . 1 S v t r . . i . . . 4 Tel pro Q M I I S S P N E P V P S K R T V R R R 4 0 HB1 pro F R D . K . E L N L G I . D V . i . . . 31 Barney TTGCAAGTTGCTGGACTGCACGGACGAAGACCAGTCAAAAAACCACTCGTCAGTTTGAAA 180 Tel TTACAGCAAGCAGGACTACACGGACGAAAGCCAGTCAAGAAACCGTTCATCAGTAAGAAA 180 HB1 CTACTGAATCAAAATTTCAGTGCGAGGAGTCCACGAAAGGTTCCCCTACCTAGCCCAAGG 180 Barney pro . . V r L v . L . 7 Tel pro L Q Q A G L H G R K P V K K P F I S K K ' 6 0 HB1 pro . L n Q N F S a . S . R . V . L P . P r 42 Barney AACCGAAAAGCTCGCGTTGAATGGGCTAAACAGCACTTGTCCTGGGGCCCCCGTGAGTGG 240 Tel AATCGCATGGCTCGAGTTGCGTGGGCAAAAGCGCATCTTCGTTGGGGACGTCAGGAATGG 240 HB1 CATATTAAGGCAAGGTTAAGCTTAGCTAAAACCTACCTAAACTGGCCAGTCTCCAAATGG 240 Barney pro . . K . . . E . . . Q . . S . . P R . . 1 3 Tel pro N R M A R V A W A K A H L R W G R Q E W 8 0 HB1 pro H I K . . 1 S L . . T Y . N . p V S K . 5 3 Barney GCAAATCACATCTGGAGCGATGAATCGAAGTTCAATATGTTCGGAACTGATGGTATTCAG 300 . Tel GCTAAACACATCTGGTCTGACGAAAGCAAGTTCAATTTGTTCGGGAGTGATGGAAATTCC 300 HB1 CGTAATATCCTTTGGACTGATGGGTCAAAAATCATGCTATTTGGTGGAACTGGTTCACTA 300 Barney pro . N m . . t . . I Q 16 Tel pro A K H I W S D E S K F N L F G S Q G N S 100 HB1 pro R N I 1 . t . G . . I M . . . G T . S L 63 Barney TGGATT—CGACGTCCCATTGGCTCCAGGTATGCTCCACAGTACCAATGTCCAACTGTG 357 Tel TGGGTA—CGTCGTCCTGTTGGCTCTAGGTACTCTCCAAAGTATCAATGCCCAACCGTT 357 HB1 CAGTATATCTGACGACCTCCAAACACGGAGTATCACCCAAAACACCCAGTGAAGACTTTC 360 Barney pro . i . . . i . . . . A . Q 18 Tel pro W V R R P V G S R Y S P K Y Q C P T V 119 HB1 pro Q Y I * . . P N t E . H . . H P V K . F 7 5 127 Barney AAACATGGAGGTGGATCTGTGATGGTTTGGGGATGCTTCTCCGACACTTCTATG-GGACC 416 Tel AAGCATGGAGGTGGGAGCGTCATGGTGTGGGGGTGCTTCACCAGCACTTCCATG-GGCCC 416 HB1 AATCACGGTGGACCTAAAATCATGGTATGGGCTTGTTTTTTTTATAATGGTATGAGTCAT 420 Barney pro s D 19 Tel pro K H G G G S V M V W G C F T S T S M G P 1 3 9 HB1 pro N . . p K i . . . a . . F Y N G . V M 83 Barney ATTGAAGAGAATC—GTTGGAACCATGGATCGATATGTGTACGAAGACATCCTGGAGAA 473 Tel ACTAAGGAGAATC—CAAAGCATTATGGATCGTTTTCAATACGAAAACATCTTTGAAAC 473 HB1 GCTATGGATTATGATTTATGGTATTATAGACCAAAACGCATATGTAAATATACTTAGTGA 480 Barney pro . k . . V G T . . . y V . . D . L . N 26 Tel pro L R R I Q S I M D R F Q Y E N I F E T 1 5 8 HB1 pro . U I m I Y G . i . Q N A . V . . L S D 95 Barney CACAATGAGACCATGGGCAAGAGCAAATTTGGGCCGATCGTGGGTGTTCCAACAGGACAA 533 Tel TACAATGCGACCCTGGGCACTTCAAAATGTGGGCCGTGGCTTCGTGTTTCAGCAGGATAA 533 HB1 TGTCTTATTGTCATATTCTGAATAAAATATACCCTTAAAATGGACATTCCAACAGGATAA 540 Barney pro R A . 1 . . S w 29 Tel pro T M R P W A L Q N V G R G F V F Q Q D N 178 HB1 pro V I L S y S E * . i p L K w T . 103 Barney TGACCCGAAGCATACTTCGGGTCATGTCGCCAATTGGTTCAGACGTCGCCGTGTGAACCT 593 Tel CGATCCTAAGCATACTTCTCTTCATGTGCGTTCATGGTTTCAACGTCGTCATGTGCATTT 593 HB1 TGATCAGAAACGCAGATGTAAATCGGCTAAGAATAGGTTCACCCAAAATAGAATAGATGC 600 Barney pro G . . A N . . R . . R . N . 35 Tel pro D P K H T S L H V R S W F Q R R H V H L 198 HB1 pro . Q . R R C K S A k N R ' . T Q N R i D A 118 Barney CCTAGAATGGCCAAGTCAATCTCCAGACTTGAATCCCATCGAGCATATGTGGGAGGAGCT 653 Tel GCTCGATTGGCCAAGTCAGTCTCCGGACTTGAATCCAATAGAGCATTTGTGGGAAGAGTT 653 HB1 AATGCCGTGGCAAGCACCACCTTCCCATTTAAACCCGATTGAAAACCTGTATGGGGACAT 660 Barney pro . e m . . . . 35 Tel pro L D W P S Q S P D L N P I E H L W E E L 218 HB1 pro m P . Q A P P S . H N . y G d i 127 Barney GGAACGCCGCCTCAAAGGAGTCAGAGCATCCAATGCCAATCAAAAGTTTGCTCAACTCGA 713 Tel GGAAAGACGTCTTGGAGGTATTCGGGCTTCAAATGCAGATGCCAAATTCAACCAGTTGGA 713 HB1 TAAACAGTTTGTGTCGAAGAAGTCCCCGACGTCTAAGACTCAGATTTGGCAAGTTGTGCA 720 Barney pro . K . v N Q . . A . . . 39 Tel pro E R R L G G I R A S N A D A K F N Q L E 238 HB1 pro K Q F v S K K S p . t S K T Q I w q V v Q 141 Barney AGCTGCTTGGAAGAGTATCCCGATGACGTTGGTTCAGACGCTCCTGGAGTCGATGCCACG 773 Tel AAACGCTTGGAAAGCTATCCCCATGTCAGTTATTCACAAGCTGATCGACTCGATGCCACG 773 HB1 GGATACATGGGCAAAAATTCCTCCCAAACCTTGCTAGGACTTGGTGGACTTCATGCCGCG 780 Barney pro A . . . S . . . t 1 v q T . 1 e . . . . 43 Tel pro N A W K A I P M S V I H K L I D S M P R 253 HB1 pro D T . A K . . P K P C * D . v . F . . . 151 Barney TAGATGCAAGGCTGTTATCGATGCGAAAGGATACCCAACGAAATATTAA 822 Tel TCGTTGTCAAGCTGTTATTGATGCAAACGGATACGCGACAAAGTATTAA 822 HB1 TGGGTGTAAGGCTGTGCTGGCTAACAAAGGCTATCCAGCCAAGTATTAG 829 Barney pro . K K . . p . . . * 45 Tel pro R C Q A V I D A N G Y A T- K Y * 273 HB1 pro G . K . . 1 A N K . . p A . . * 157 128 these stop codons are read through, HB1 and Tel could code for proteins with 30% amino acid i d e n t i t y , 42% including conservative changes. The c r i t e r i a for conservative changes was based on s i m i l a r changes involv ing amino acids with less than 20% degrees of dif ferentness (Sneath, 1966; D o o l i t t l e , 1979). When both the DNA and potentia l amino acid sequences of T e l , HB1, and Barney are compared (Figure 44), many regions of shared homology become apparent. There are seven blocks of amino acids with very high conservation s ta r t ing at amino acid posi t ions 36, 87, 118, 172, 208, and 256. Two new transposable element f a m i l i e s , Barney and TCb2, have been described in C. briggsae with homology to T e l . The C. briggsae elements show more s t ructura l v a r i a b i l i t y between members than do the Tel family . Nevertheless, the coding region shows high sequence i d e n t i t y with Tel as well as an inverted repeat element in Drosophila melanogaster named HB1. 129 DISCUSSION A. Character izat ion of N2 Tel Elements Unlike the Tel elements in the BO s t r a i n , Tel elements from the N2 s t r a i n appeared quiescent and were previously thought to be incapable of movement. The basis for t h i s s t a b i l i t y had not been invest igated . I cloned seventeen of the t h i r t y Tel elements from the N2 s t r a i n (Table 3) to determine whether the s t a b i l i t y was a re su l t of s t ructura l de ter iora t ion and i n a c t i v a t i o n . A major proportion of the N2 Tel elements were intact as determined by r e s t r i c t i o n mapping. DNA sequencing of variants revealed high sequence conservation (Figures 13,15,17). Thus, the N2 Tel elements are s t r u c t u r a l l y intact and by th i s c r i t e r i o n should be capable of m o b i l i t y . Furthermore, I have shown Tel elements in the N2 genome can be mobilized during a somatic excis ion event. This was demonstrated with a native N2 Tel (Figure 22) as well as a BO Tel introduced into a N2 genetic background (Figure 25). Therefore, N2 Tel elements are not incapable of movement and the explanation for t h e i r low a c t i v i t y does not apppear to be s t r u c t u r a l . The majority of the N2 Tel elements are s t r u c t u r a l l y conserved by the c r i t e r i o n of r e s t r i c t i o n enzyme s i t e mapping [using enzymes recognizing 7.2% of the Tel sequence (Figure 4)] and, in some cases, DNA sequencing. There are two r e s t r i c t i o n s i t e var i ant s : Tcl(Eco).12 which contains an fcoRl s i t e at pos i t ion 1451 130 (confirmed by DNA sequencing) and Tel(Hpa-) .9 , which i s missing an Hpa II s i t e at pos i t ion 1138 (Figure 14). Tc l (0 .9 ) .2 and Tcl (0 .9) .14 have large internal delet ions at d i f fe rent s i te s (Figure 14). Tc l (0 .9 ) .14 was shown by DNA sequencing to be a simple delet ion of sequences between Tel posi t ions 855 and 1538 (Figure 15). The sequences bordering the delet ion do not read i ly suggest a mechanism for the lo s s . The DNA sequence of Tel s t ructura l variants i s highly conserved. The de le t ion of sequences in Tel(1.5) .10b and Tcl (0 .9) .14 would probably e i ther inact ivate them or at least render them non-autonomous. Nevertheless, only about one of every 200 bp i s a l tered when aligned with the sequenced BO Tel (Rosenzweig et a l . , 1983a) (Figures 13,15). Greater sequence d r i f t might be expected in s tat ionary elements. Tc l (1 .7 ) .28 contains a curious 55 bp inser t ion near the l e f t end of the element at pos i t ion 110, 111, or 112 (Figure 17). An A / T - r i c h 11 bp sequence immediately 5' to the inser t ion is d i r e c t l y repeated twice wi th in the i n s e r t i o n . The three d i r e c t repeats are separated by 13 and 9 bp, re spect ive ly . These regions interspersed between the repeats are also A / T - r i c h . The l a s t 8 bp of the 11 bp repeat i s found once again at the end of the i n s e r t i o n . This 55 bp in se r t ion could have arose from the nearby sequences or from elsewhere in the genome. The inser t ion could be used as a probe to search for i t s presence in another pos i t ion in the genome. On the other hand, delet ions and insert ions in the P elements of Drosophila often involve tandemly repeated sequences as well as 131 base changes. A s i m i l a r event may have occurred in Te l (1 .7 ) .28 . O'Hare and Rubin (1983) speculate that the mechanism responsible for these var iant sequences involves strand slippage and recopying of the same template sequence by a DNA polymerase. The t ranspos i t ion process may require DNA r e p l i c a t i o n at some stage. Perhaps t h i s r e p l i c a t i o n apparatus i s not as e f f i c i e n t as regular chromosomal r e p l i c a t i o n and i s more error-prone. Tel(1.5) .10b has also been al tered at i t s lefthand end (Figure 14). The f i r s t 89 bp of the conserved Tel sequence are l o s t in Tcl (1 .5) .10b (Figure 13). Tel(1.5) .10b i s posit ioned 260 bp away from Tel.10a in the same FcoRl fragment: hence, the a and b names (Figure 11). A s i m i l a r arrangement of two P elements has been noted (O'Hare and Rubin, 1983). It involved an invers ion event which had taken place between two P elements. The transposase was thought to have made a chromosome break at one end of both elements, which was followed by an invers ion and r e l i g a t i o n . However, during t h i s event, one of the P elements l o s t sequences from i t s terminus. A s i m i l a r occurrence could have happened between Tel.10a and Tel(1 .5) .10b. The a b i l i t y of Tel to excise from the genome of C. elegans s t r a i n N2 was invest igated. Previous ly , Emmons and Yesner (1984) had shown that Tel elements wi th in the BO s t r a in excised at a high frequency and that th i s excis ion occurred predominantly in somatic c e l l s . Research for t h i s thesis demonstrated that , in the N2 s t r a i n , Tel exc i s ion occurred at a frequency comparable to that of the BO s t r a i n (Harris and Rose, 1986). Two approaches were taken. In the f i r s t approach, the excis ion of a element found to be present 132 in the same locat ion in both s t ra ins was examined. The N2 T e l . 7 , i d e n t i f i e d by the f lanking sequence wi th in pCeh29, enabled the comparison of Tel exc i s ion in N2 and BO to take place. The re su l t s c l e a r l y show minor bands in both s t ra ins in the pos i t ion expected i f they had resulted from Tel excis ion (Figure 22). The Tel elements used in the f i r s t approach, although present in the same locat ion in both genomes, were not shown to be i d e n t i c a l . Thus, a second approach was taken which involved the genetic manipulation of a BO Tel var iant , T c l ( H i n ) . The r e s t r i c t i o n map of Tcl(Hin) had been determined to aid in the confirmation that i t was a r e s t r i c t i o n enzyme variant of Tel (Figure 23) (Rose et a l , 1985). Tcl(Hin) was observed to undergo germline excis ion in the BO s t r a i n so that i t was capable of mobi l i ty (Figure 28). T c l ( H i n ) , which creates the RFLD sPl, was genet i ca l ly inserted into a N2 LG I by using f lanking markers (Figure 24). The a b i l i t y of t h i s BO Tcl(Hin) to excise was retained after i t s introduct ion into the N2 genome (Figure 25) (Harris and Rose, 1986). Some reduction in detectable l eve l s of excis ion was observed but t h i s reduction was no more than two- to three- fo ld . It i s assumed that t h i s high frequency exc i s ion occurs in the somatic t i ssue of the N2 s t r a i n as i t does in the BO s t r a i n . Somatic excis ion of Tel elements in an N2 genetic background has also been recently described by Emmons et a l . (1986) and Moerman et a l . (1986). The N2 genome has ten-fold fewer Tel elements than the BO s t r a i n and yet excis ion was c l e a r l y not ten-fo ld reduced. Thus, somatic excis ion from the N2 genome is not dependent on Tel copy 133 number. In our l ab , three laboratory s t ra ins with a l tered Tel patterns have been observed (Starr and Babity, Univers i ty of B r i t i s h Columbia, pers. comm.). The resul t s regarding N2 Tel conservation and exc i s ion suggest that N2 Tel elements are capable of somatic and germline t r anspos i t ion . The construction of the N2/B0 hybrid s t r a i n containing the BO Tel(Hin) enabled the sPl s i t e to be mapped very close to dpy-14. Our laboratory i s interested in the organization of t h i s region of LGI. A number of the l e tha l a l l e l e s I have mapped l i e in t h i s region (Appendix B) . The connection provided by the sPl s i t e between the genetic and physical map may allow these genes to be i so la ted at the molecular l e v e l . In the s t r a i n construct ion, s ix addit ional BO Tel elements were i d e n t i f i e d wi th in 1.5 m.u. around dpy-14 (LG I) (Figure 26). I f the approximately 300 BO Tcls are assumed to be d i s t r i b u t e d randomly throughout the 300 m.u. of the genome, less than 2 BO Tel members would have been expected in the 1.5 m.u. between dpy-5 and unc-13. B a i l l i e et a l . (1985) i so la ted s ix BO Tel elements in a 1 m.u. in terva l to the l e f t of unc-22 compared with one Tel in the adjacent m.u. to the r i g h t . The m.u. to the l e f t i s gene dense (30 i d e n t i f i e d genes) in contrast to the m.u. to the r i g h t which i s gene poor (3 genes) (Rogalski and B a i l l i e , 1985). The dpy-14 region i s wi th in a gene dense region of LG I and has been predicted on the basis of radiation-induced map expansion to contain more DNA per m.u. than the average for the genome (Kim and Rose, 1987). Thus, there are possibly more Tel consensus s i tes avai lable 134 for occupation. The number of Tel elements in a s p e c i f i c region could be a r e f l e c t i o n on the amount of DNA and the number of in se r t ion consensus sequences. The BO s t r a i n has been described as a genome in which control had been l o s t and a p r o l i f e r a t i o n of the Tel elements of a N2- l ike ancestor occurred (Emmons et a l . , 1983). This idea was invest igated by asking whether the N2 Tel elements cloned inhabited the same pos i t ion in the BO s t r a i n . Eleven of fourteen Tel inser t ion s i te s tested showed ident ica l banding patterns and were assumed to be common to both N2 and BO (Figure 6; Table 4 ) . This high proportion of commonly loca ted Tel elements argues for an expansion of Tel copy number of a N2- l ike s t r a i n to produce the present BO Tel pattern. I t i s possible that a Tel may not be present at the same s i t e in BO and a RFLD would not be detected. For example, i f one of the r e s t r i c t i o n s i t e s were to be mutated in BO and the next avai lable recognit ion s i t e was about 1.6 kb away, a band equal in s ize to the N2 band would be seen even though no BO Tel was present at th i s s i t e . The BO Tel may also be located in the same fcoRI fragment but not at the same pos i t ion as the N2 T e l . The equivalent BO inser t ion s i t e of Tcl(Hpa-) .9 has been cloned by N. Mawji in t h i s lab (pers. comm.). A Tel was found to reside at the same s i t e in BO as N2, at the leve l of r e s t r i c t i o n mapping. Thus, in the case of Tcl (Hpa-) .9 , the above assumption holds t rue . Despite the above possible exceptions, t h i s data supports the hypothesis that the BO s t r a i n i s derived from a N2-l ike s t r a i n . Some event occurred to promote t ranspos i t ion and increase the copy number by an order of 135 magnitude. This population expansion took place while preserving the o r i g i n a l N2- l ike in ser t ion s i t e s . It would be expected that i f , at any one s i t e , a Tel was present in the N2 genome but not in the BO genome, a 1600 bp RFLD would be v i s u a l i z e d . However, in the two c l e a r l y defined RFLDs, hP2 and hP3, the s ize differences were instead 600 and 200 bp, respect ive ly (Figure 7) . In order to invest igate t h i s fur ther , the equivalent s i t e in BO of the N2 hP2 s i t e was i so la ted from a BO Charon 4 l i b r a r y . Res t r i c t ion mapping and hybr id iza t ion experiments of N2 and BO DNA at t h i s s i t e suggests that a DNA rearrangement involv ing Tel .18 has occurred (Figures 19,20,21). I hypothesize that t h i s rearrangement was an inver s ion/de le t ion event bounded on one side by the termini of Tel .18 and accompanied by the creat ion of a new fcoRI s i t e . D. Clark , R.C. Johnsen, and K.S.McKim (Simon Fraser Univer s i ty , Univers i ty of B r i t i s h Columbia, pers. comm.) i so la ted l e t h a l mutations induced in a Tel mutator s t r a i n to examine what kind of mutations are caused by transposable elements. They discovered that out of 24 l e tha l mutations induced on LGV, seven were de f i c ienc ie s of various s i ze s . Tel has been shown to excise imprecisely (Ruan and Emmons, 1987; K i f f et a l . , 1988, Eide and Anderson, 1988). Therefore, de let ion events often accompany Tel mobi l i ty and the ac t iva t ion of Tcls in the B0 s t r a in could have resulted in Tel .18 at the hP2 s i t e promoting a DNA rearrangement event. Other transposable elements of the inverted repeat c l a s s , such as P elements, have been shown to ins t iga te many d i f ferent types of DNA rearrangements (Engels and Preston, 1984; 0'Hare, 1985). Any 136 further speculation on the nature of the rearrangement w i l l have to await r e s t r i c t i o n s i t e analysis of the hP2 phage DNA. The RFLDs created at the s i tes occupied by Te l .6 and Tel .18 allowed these s i te s to be posit ioned on the C. elegans genetic map. Using N2/B0 recombinant s t r a i n s , hP2 was mapped to between unc-22 and unc-31 on LG IV while hP3 was mapped very close to the r i ght of unc-43 (LG IV) (Figures 9,10,16). Five of the cloned N2 Tel elements were assigned to previously ex i s t ing contigs of cosmids, pos i t ioning them to wi th in 100-200 kb of known genes and to l inkage groups (Sulston and Coulson, pers. comm.) (Table 4 ) . These molecular tags are valuable for l i n k i n g the genetic and molecular maps of C. elegans together. It has been observed that Tel elements in many wild-type C. elegans s t r a i n s , i so la ted from d i f fe rent regions in the world, d i sp lay very s i m i l a r hybr id iza t ion patterns (Liao et a l , 1983). Despite the fact that an inser t ion s i t e consensus sequence has been derived (Mori et a l . , 1988, Eide and Anderson, 1988), as can be seen in high copy number s t r a i n s , Tel elements can reside at a s i g n i f i c a n t number of s i t e s . There may be an addit ional reason for the Tel s i t e conservation among s t ra ins besides low transpos i t ion ra te . These "ancient" s i t e s may represent regions in the genome in which the Tel can reside without adversely af fect ing the organism and being selected against, or without being activated to excise completely. This proposal was tested. 137 Nine N2 Tel f lanking sequence probes were used under moderate and high stringency conditions in hybr id iza t ions to N2 genomic DNA (Figure 18; Table 5) . At moderate str ingency, a l l probes showed mul t ip le banding patterns and, even at high stringency, only two of the nine probes hybridized to a unique band. In addit ion to the nine tested, the f lanking sequence of Te l .9 and Tel .30 are r e p e t i t i v e at a high hybr id iza t ion str ingency. Studies on the average repet i t iveness of the C. elegans genome have been carr ied out. The genome i s composed of seventeen percent r e p e t i t i v e DNA, a c a l c u l a t i o n based on renaturation k ine t i c s (Sulston and Brenner, 1984). Emmons et a l . (1979) randomly cloned f i f t e e n BamHl fragments. Under f a i r l y low stringency hybr id iza t ion condit ions , four of the f i f t e e n hybridized to a s ingle band. A s i m i l a r survey was carr ied out by Rose et a l . (1982). They i so la ted 27 random fcoRI fragments and hybridized them back to genomic DNA. They discovered that two-thirds of the probes hybridized to only one band, despite the low hybr id iza t ion str ingency. The regions inhabited by N2 Tel elements are more r e p e t i t i v e than an average region of the genome. These s i t e s may therefore be areas the Tel can remain in for a very long time without d i s turb ing the genome. For example, inser t ion into unique DNA may disrupt genes current ly being used or sequences which may become useful in the future. 138 The f lanking sequence hybr id iza t ion of Tel .30 was i n t r i g u i n g . The banding pattern varied s i g n i f i c a n t l y between s tra ins (Figure 3 ) . A l l fcoRI bands were greater than 9 kb in s i z e . The banding pattern differences between s tra ins could indicate the presence of another transposable element. This f lanking sequence c e r t a i n l y warrants further inves t i ga t ion . B. Character izat ion of the C. briggsae  T c l - h y b r i d i z i n g Elements The inverted repeat c lass of transposable elements includes many members found in a wide var ie ty of eukaryotes. The question of whether the Tel element was or was not l i m i t e d to the C. elegans species was asked. Hybr id izat ion of Tel to the c lo se ly re lated s t r a i n C. briggsae revealed the presence of T c l - h y b r i d i z i n g r e p e t i t i v e elements (Figure 29). Two transposable element f a m i l i e s , Barney (also known as TCbl - Transposon Caenorhabditis briggsae I) and TCb2 (Transposon Caenorhabditis briggsae 2) , contained homology to the Tel sequence. Five unique members of each of these fami l ies were cloned (Table 6) . The s i m i l a r i t y between Tel and the C. briggsae r e p e t i t i v e elements was dispersed across a major port ion of Tel (Figure 30). The Barney and TCb2 famil ies are much more heterogeneous in structure than are Tel elements. The T c l - h y b r i d i z i n g r e p e t i t i v e elements were separated into two famil ies by the c r i t e r i a of 139 inter-element d i f f e r e n t i a l hybr id iza t ion (Figure 31). Five elements, represented by pCbhl, f a l l into the TCb2 family while the other f i v e , represented by pCbh8, are included in the Barney fami ly . These fami l ies are not e n t i r e l y d i s t i n c t as there i s some hybr id iza t ion overlap and much v a r i a t i o n wi th in f a m i l i e s . TCb2 and Barney do d i f f e r remarkably in t h e i r genomic fcoRl banding patterns (Figure 32). TCb2 hybridizes to about 33 bands while Barney hybridizes to 15. Some but not a l l of the 15 Barney bands may correspond to TCb2 bands. Three s t ra ins of C. briggsae are avai lable - G16, Z, and BO. TCb2 and Barney show several band differences among s t r a i n s , even between Z and BO which have only been separated for approximately 300 generations (Figure 34). N2-derived s t ra ins separated for up to 500 generations show no Tel banding differences (Liao et a l , 1983). There have been N2-derived unc-13 s t ra ins found in t h i s lab to exh ib i t alternate banding patterns, but they are a c l ea r exception (Starr and Babity, Univers i ty of B r i t i s h Columbia, pers. comm.). Barney and TCb2 elements do appear to be transposable at a rate greater than Tel mobi l i ty in the N2 s t r a i n . The T c l - h y b r i d i z i n g sequences of one Barney element, Barney.10, were p a r t i a l l y determined and compared to the Tel sequence (Figure 41). Tel l i n e s up with sequences in the f i r s t ha l f of the 2.25 kb fragment. DNA sequences in t h e i r ORFs and termini are conserved (Figures 41,42). The ORF in Barney and Tel share sequence i d e n t i t y of 71% for the DNA and 74% for the amino acids in a putative transposase [85% for amino acids , i f conservative changes are 140 included ( D o o l i t t l e , 1979)] (Figure 41). A sequence frameshifted 1 bp from alignment with the Tel sequence i s a possible terminus of Barney and has 68% sequence i d e n t i t y with the Tel inverted repeat (Figure 42). The absence of any sequence i d e n t i t y between Tel and Barney from the ORF to the inverted repeat of Tel suggests that t h i s putat ive terminus i s funct iona l ly conserved. The s i m i l a r composition of the two transposable elements' coding regions, which code for c lo se ly re lated proteins (transposases), argues for s i m i l a r transposase substrates or transposon t e r m i n i . Sequences from portions of a TCb2 element are compared with the p a r t i a l l y sequenced Barney element in Figure 43. One 300 bp TCb2 sequence l i n e d up with Barney in the ORF at Barney pos i t ion 314 and had 71% DNA and amino acid sequence i d e n t i t y with Barney. A second sequence of 150 bp showed 76% sequence i d e n t i t y when l i n e d up with Barney s t a r t ing at pos i t ion 704. Another T c l - h y b i d i z i n g TCb2 sequence could not be l ined up s a t i s f a c t o r i l y with Barney but appeared s i m i l a r to a region in Barney and Tel with long runs of A's and T ' s . TCb2 and Barney are much more divergent than expected. In f ac t , in the regions sequenced, they are jus t as divergent from each other as they are from T e l , a transposable element from another species. The most l o g i c a l hypothesis at t h i s time for the divergence seen for the three Caenorhabditis elements involves horizontal t rans fer . An ancestral element was perhaps present in C. briggsae and probably in at least one other Caenorhabditis species. In the C. briggsae genome, t h i s element diverged slowly 141 into two f a m i l i e s . The a b i l i t y of these transposable elements to become mobil ized i n a s i m i l a r manner was preserved through the conservation of t h e i r ORFs. I f C. elegans carr ied a Tel element when i t diverged from C. briggsae then i t was e i ther l o s t or degenerated to such a degree that now i t i s no longer recognizable as having i d e n t i t y with these other elements. I suggest Tel was recent ly introduced into the C. elegans genome from e i ther another nematode or other unknown source. This would explain the strong sequence conservation observed in T e l . Research inves t iga t ing the evolutionary or ig ins of P elements have demonstrated that P elements do not fol low a pattern expected i f they were inher i ted exc lus ive ly in a v e r t i c a l fashion (Lansman et a l . , 1985). P element-hybridizing sequences were found throughout the subgenus Sophophora, although the DNA of some subspecies groups did not hybridize to P elements. P elements of Drosophila melanogaster showed the highest conservation with P-hybr id iz ing sequences in Drosophila willistoni and Drosophila sultans yet these species are quite far apart e v o l u t i o n a r i l y . Species most c lo se ly re lated to Drosophila melanogaster contained P - l i k e sequences with much less homology than in D. willistoni and D. sul tans . Lansman et a l . (1987) cloned two P-hybr id iz ing sequences from D. nebulosa and found these sequences to be degenerate P elements. The two elements had numerous de le t ions , in se r t ions , and s ingle basepair changes, some of which disrupted a l l four open reading frames. The D. nebulosa sequences were more divergent from each other than from D. melanogaster P elements. The P 142 elements in D. nebulosa appear to have become inact ivated a long time ago and t h e i r sequences d r i f t e d apart. P elements are also highly conserved in sequence. The smaller P elements d i f f e r from each other and the complete P factors by s ing le de le t ion events (O'Hare and Rubin, 1983). Other s ingle base changes have not had a chance to accumulate. D. melanogaster Q s t ra ins (intermediate genet ica l ly between P and M s t ra ins ) co l l ec ted in Japan contained P elements each with a s ingle in terna l d e l e t i o n . Otherwise, the DNA showed high conservation with American s t ra ins (Sakoyama et a l , 1985). This data supported e a r l i e r suggestions that P element had recently invaded D. melanogaster and horizontal t ransfer seemed to be a l i k e l y explanation. The authors proposed that P sequences may have invaded Drosophila species many times from other Drosophil ids or other sources. Tel i s even more widespread than Nematoda, as sequence i d e n t i t y with a Drosophila transposable element, HB1, has been discovered (D. B a i l l i e , Simon Fraser Univer s i ty , pers. comm.) (Figure 44). HB i s included in the inverted repeat class of elements. This i s the f i r s t example of sequence i d e n t i t y between inverted repeat transposable element from such diverse or ig ins as the phyla Nematoda and Arthropoda (Harr i s , B a i l l i e , and Rose, submitted). When both the DNA and potential amino acid sequences of T e l , HB1, Barney, and TCb2 are compared, many regions of shared homology become apparent (Figure 44). There are several blocks of amino acids with very high conservation. Further studies expanding on sequence comparison with other inverted repeat elements may prove 143 to be very rewarding in the e luc idat ion of transposase domains and t ranspos i t ion mechanisms. HB, Barney, and Tel probably share a common ancestry. Combined with the suggestion that HB i s no longer ac t ive , one could hypothesize that HB was mobile in the past, but was recently incapacitated and accumulated stop codons and frameshifts . Previous ly , the inverted repeat transposable elements were grouped together on the basis of s t ructura l and behavioral s i m i l a r i t i e s . The T e l , Barney, and HB elements form a sequence-conserved subclass of the inverted repeat transposons. C. Summary 1. I have cloned and s t r u c t u r a l l y characterized a major proportion of the N2 Tel elements. 2. I have shown a Tel from the N2 s t r a i n , as well as a BO Tel in N2 genetic background, can somatically excise , although at a s l i g h t l y lower rate than in the BO genetic background. 3. I have shown the majority of Tel elements in N2 are also present in the same s i t e in BO; one exception i s a Tel which has mediated a DNA rearrangement in BO. 4. I have found N2 Tel elements occupy more r e p e t i t i v e than average regions in the genome. 144 5. I have discovered two new transposable element fami l ies in a re la ted nematode species. P a r t i a l DNA sequencing revealed the presence of high sequence i d e n t i t y in a representative of each of the two fami l ie s with the Tel ORF. D. Proposals for Future Research Lis ted below are a number of experiments that could be carr ied out to further invest igate the resu l t s of t h i s research. 1. Sequencing of an in tac t (by r e s t r i c t i o n mapping) N2 Tel and comparison with the sequenced BO T e l . An in teres t ing question i s how the intac t Tel elements and variant Tcls compare with respect to sequence conservation. 2. Analys i s of the DNA at the hP2 and hP3 s i t e s of the N2 and BO s t ra ins using associated phage or cosmids in order to determine the nature of the putative DNA rearrangements. 3. Invest igat ion of the f lanking sequence of Te l .9 to determine the basis of i t s high genomic repet i t iveness . 4. Analysis of the f lanking sequence of Tel .30 (exhib i t ing i n t e r s t r a i n genomic banding pattern differences) in order to determine whether t h i s may be a transposable element or r e p e t i t i v e gene family . 145 5. Hybr id iza t ion to C. elegans genomic DNA of the 55 bp sequence found inserted into Tel(1 .7) .28 so as to determine whether i t i s present elsewhere in the genome. 6. E l iminat ion of the T c l - h y b r i d i z i n g sequences of the Avall/EcoRV pCeh62 probe so as to define and map the associated RFLD. Examination of the equivalent s i t e in BO to discover the status of the two Tcls (Tel.10a and Tel(1.5) .10b) in the BO s t r a i n . 7. Further inves t iga t ion into the locat ion of Tel elements in the N2 genome as further progress towards the cosmid mapping of the genome permits addit ional assignments of Tel elements to cont igs . This could reveal whether Tel elements fol low the same type of d i s t r i b u t i o n as the genes. 8. The C. briggsae transposable elements may be mobile in the C. elegans genome. Transformation of Barney/TCb2 element DNA into C. elegans could allow the study of the behavior of these elements ( i f they are mobile in th i s genome) without the interference of native elements. The derepression of Tel elements in the BO s t r a in may also induce t ranspos i t ion of Barney. Var iat ions on t h i s type of experiment could be the replacement of the Barney 0RF1 or termini with the Tel 0RF1 or t e r m i n i . 146 9. Cloning of s i te s not containing Barney in C. briggsae s t r a i n Z which are occupied by Barney in G16. Sequencing of a s i t e in the Z s t r a i n in which Barney i s absent w i l l allow d e f i n i t i o n of the element's termini as well as help examine the p o s s i b i l i t y of an in se r t ion s i t e consensus sequence. 10. Completion of sequencing of Barney and TCb2 elements. 11. Comparison of the structures of d i f fe rent Barney/TCb2 elements to further define the f a m i l i e s . 12. Examination of other Nematoda species or species from other phyla for Tel h y b r i d i z a t i o n , preferably using a highly conserved probe (conserved between Tcl /Barney/HBl) , to discover how widespread t h i s subclass of transposable elements i s . 13. Hybr id iza t ion of HB sequences to other Sophophora species in order to locate a species in which HB i s more act ive so that an act ive element can be character ized. 14. Search for evidence of somatic excis ion or extrachromosomal forms of the Barney and TCb2 elements. 147 Appendix A Genetic Mapping of Molecular RFLD Probes Any probe detecting a RFLD between two C. elegans s t ra ins can be gene t i ca l ly mapped using spec i a l ly constructed recombinant s t ra ins (Rose et a l . , 1982). The s t ra ins N2 and BO are general ly used but mapping RFLDs between N2 and any other C. elegans s t r a i n i s equally as f ea s ib le . In order to map the RFLD to a s p e c i f i c l inkage group, i t i s necessary to construct a special s t r a in representing each linkage group (Figure 44). Each s t r a in w i l l be homozygous N2 for a cer ta in chromosome (marked with a cent ra l ly - loca ted v i s i b l e genetic marker) and heterozygous N2/B0 for a l l other chromosomes. Therefore, i f a probe does not map to the l inkage group which i s homozygous N2 in the constructed s t r a i n , then equal hybr id iza t ion to both a N2 and BO band w i l l r e s u l t . On the other hand, the probe w i l l hybridize to only one band i f the l inkage group i t maps to i s homozygous N2 in that s t r a i n ' s DNA. A hypothetical mapping experiment i s shown in Figure 45. A f a in t band i s often v i sua l i zed with the strongly hybr id iz ing band when the probe i s some distance away from the genetic marker due to recombination events. The strength of the secondary band can often provide a clue to the distance of the probe from the genetic marker. To map a s i t e more s p e c i f i c a l l y on a l inkage group, N2/B0 recombinant chromosomes are constructed using two l inked v i s i b l e markers. The fol lowing figures are adapted from Rose et a l . (1982). 148 Figure 45. Sample genome from a linkage group I mapping s t r a in As LGI has N2 dpy-5 genetic markers, t h i s means LGI should be N2 homozygous DNA. None of the other l inkage groups are selected for so that they w i l l be randomly e i ther N2 or BO. Key: — i s N2 DNA and = i s BO DNA dpy-5 LGI 1  dpy-5 | LGH LGIII = = = = = = = = = = = = = = = = = = = LGIV LGV = = = = = = = = = LGX 149 This page does not e x i s t . 150 Appendix B  Lethal Analysis To gain a deeper understanding of C. elegans genetics , I was involved in the screening and mapping of essent ia l gene mutations. This work was part of an on-going project of genetic analysis of the l e f t t h i r d of LGI. 1. Lethal screening A free d u p l i c a t i o n , sDp2, was used to recover and maintain l e t h a l a l l e l e s whose locat ions are prec i se ly defined by the extent of the dup l i ca t ion (Rose et a l . , 1984; Howell et a l . , 1987). The s t r a in KR235 was used for the l e tha l screening. KR235 contains the dup l i ca t ion sDp2 as well as two d i f f e r e n t i a l l y marked homologues {dpy-5 unc-13 and dpy-5 unc-15) of LGI and has a wildtype phenotype. The se l fcross of KR235 generates wi ldtype, Dpy, Unc, and Dpy Unc progeny. EMS mutagenesis was carr ied out in a large-scale screen. When a l e tha l mutation i s induced on one of the two dpy unc chromosomes, t h i s can be detected by the absence of v iab le Dpy Unc ind iv idua l s in the F 2 generation. The le thal-bear ing s t ra ins can then be maintained by simply t rans ferr ing wildtype hermaphrodites which w i l l be carrying the d u p l i c a t i o n . 151 2. Recombination Mapping Unc-13 hermaphrodites of the le thal-bear ing s t r a in were crossed to N2 males. The progeny of t F j wildtype hermaphrodites were scored. From t h i s data, the l e tha l was l e f t - r i g h t posit ioned and two-factor mapped r e l a t i v e to dpy-5. When the l e tha l was s i tuated to the r i ght of dpy-5, Dpy and Unc recombinants were recovered. The number of Dpys re f lected the cYpy-5-lethal a l l e l e recombination distance. On the other hand, Dpy Uncs and Uncs were recovered when the l e tha l was located to the l e f t of dpy-5. The number of Dpy Uncs was used to ca lculate the l e tha l recombination distance from dpy-5, while Unc progeny were proportional to the dpy-5 - unc-13 distance. The recombination f r ac t ion R was ca lculated as 2(number of one recombinant c l a s s ) /4 /3 ( to ta l progeny) and p was equal to 1-/1-2R. Thi r ty l e tha l a l l e l e s were recombinationally mapped (Table 6) . Seven a l l e l e s were found to be inseparable from dpy-5. Six l e tha l mutations were calculated to l i e to the r i ght of dpy-5. Thirteen a l l e l e s were less than 10 mu to the l e f t of dpy-5 and four were greater than 10 mu away. One l e tha l a l l e l e , hl98, showed s i g n i f i c a n t l y reduced recombination (0.9 m.u. + 0.3 m.u.) between dpy-5 and unc-13. The suppression of recombination could indicate the presence of a de let ion or genetic rearrangement. The remaining l e tha l a l l e l e s showed a wide range of dpy-5 unc-13 map distances, but no other ones were s i g n i f i c a n t l y d i f fe rent from the expected 1.5 m.u. dis tance. 152 Table 7. Summary of mapped le tha l a l l e l e s Lethal Right /Lef t Pos i t ion Map Distance (m.u.) Map distance(m.u.) name of l e tha l a l l e l e of l e tha l from between r e l a t i v e to dpy-5 dpy-5 (p) df>y - 5~ < - M c - / 3 hl91 L 0.4 1.7 hl92 L 4.3 2.4 hl93 L 11.2 2.0 hl94 L 0.8 2.5 hl95 - - 1.5 hl96 R 0.7 0.4 hl97 L 3.7 1.8 hl98 L 0.1 0.9 hl99 - - 1.2 h200 - - 2.2 h211 L 3.7 2.3 h212 L 2.3 1.6 h213 - - 1.9 h214 - - 2.3 h215 R 0.2 1.5 h216 L 0.6 2.2 h217 R 1.0 1.0 h218 L 0.5 2.6 h219 - - 1.5 h220 L 17.9 1.1 h221 R 1.2 1.3 h222 L 0.2 2.2 h223 L 0.4 1.7 h224 L 31.0 1.2 h225 R 0.1 1.6 h226 L * 7.7 1.0 h227 L 18.0 1.9 h228 R 1.0 0.1 h229 L 0.1 1.4 h230 - - 1.6 * This map distance between dpy-5 and h226 may be higher than the actual value due to the la te time of action of the l e tha l phenotype. Dpy Unc ind iv idua l s containing eggs were counted but these eggs were not necessar i ly l a i d . 153 Figure 47. Lethal a l l e l e s positioned on LGI map hl95 hl91hl99 hl98h200 h218h213 h l 9 6 h220 h222h214 h217 h224 hl97 hl94 h223h219h215 h221 h227 hl93 h226 hl92 h221 h212 h216 h229h230h225 h228 unc-35 dpy-5 unc-13 154 LITERATURE CITED Aeby,P. , Sp icher ,A . , Chastonay,Y.de, M u l l e r , F . and H.Tobler. (1986) Structure and genomic organization of proretrovirus-1 ike elements p a r t i a l l y el iminated from the somatic genome of Ascaris lumbricoides. EMBO 5:3353-3360. Alleman,M. and M.Free l ing . (1986) The Mu transposable element of maize - evidence for t ranspos i t ion and copy number regulat ion during development. Genetics 112:107-119. B a i l l i e , D . L . , Beckenbach,K.A. and A.M.Rose. (1985) Cloning wi th in the unc-43 to unc-31 in terva l (LGIV) of the Caenorhabditis elegans genome using Tel l inkage s e l e c t i o n . Can. J . Genet. C y t o l . 27:457-466. B a r k e r , R . F . , Thompson,D.V., Ta lbot ,D .R . , Swanson,J. and J .L.Bennetzen. (1984) Nucleotide sequence of the maize transposable element Mul. Nuc. Acids Res. 12:5955-5969. Bennetzen,J .L. (1987) Covalent DNA modif icat ion and the regulat ion of Mutator element t ranspos i t ion in maize. Mol . Gen. Genet. 208:45-51. Bennetzen, J . L . , Fracasso,R.P. , Morr i s ,D.W. , Robertson,D.S. and M.J.Skogen-Hagenson. (1987) Concomitant regulat ion of Mul t ranspos i t ion and Mutator a c t i v i t y in maize. Mol . Gen. Genet. 208:57-62. Benton,W.D. and R.W.Davis (1977) Screening lambda gt recombinant clones by hybr id iza t ion to s ingle plaques in s i t u . Science 196:180-182. Bingham,P.M., K idwel l ,M.G. and G.M.Rubin. (1982) The molecular basis of P-M hybrid dysgenesis: The role of the P element, a P - s t r a i n - s p e c i f i c transposon family . Ce l l 29:995-1004. Blackman,R.K., G r i m a i l a , R . , Koehler,N.D. and W.B.Gelbart. (1987) M o b i l i z a t i o n of hobo elements res id ing wi th in the Decapentaplegic gene complex: Suggestion of a new hybrid dysgenesis system in Drosophila melanogaster. Ce l l 49:497-505. Boeke.J .D. , G a r f i n k e l , D . J . , S t y l e s , C . A . , and G.R.Fink. (1985) Ty elements transpose through an RNA intermediate. C e l l 40:491-500. Bonas,U., Sommer.H. and H.Saedler. (1984) The 17 kb Taml element of Antirrhinium majus induces a 3 bp dupl ica t ion upon integrat ion into the chalcone synthase gene. EMBO J . 3:1015-1019. 155 Brenner,S. (1974) The genetics of Caenorhabditis elegans. Genetics 77:71-94. B r i e r l e y . H . L . and S .S .Pot ter . (1985) D i s t i n c t charac te r i s t i c s of loop sequences of two Drosophila foldback transposable elements. Nucl . Acids Res. 13:485-500. B r y a n , G . J . , Jacobson,J.W. and D . L . H a r t l . (1987) Heri table somatic exc i s ion of a Drosophila transposon. Science 235:1636-1538. Bucheton,A., Paro,R. , Sang,H.M., Pe l i s son ,A. and D.J.Finnegan. (1984) The molecular basis of I-R hybrid dysgenesis in Drosophila melanogaster: I d e n t i f i c a t i o n , c lon ing , and properties of the I f ac tor . C e l l 38:153-163. B u t l e r , M . H . , w a l l , S . M . , Luehrsen,K.R., Fox,G.E. and R.M.Hecht. (1981) Molecular re la t ionships between c lose ly re lated s t ra ins and species of nematodes. J . Mol . Evo l . 18:18-23. Cameron,J.R., Loh,E.Y. and R.W.Davis. (1979) Evidence for t ranspos i t ion of dispersed r e p e t i t i v e DNA famil ies in yeast . Ce l l 16:739-751. Chandler ,V. , R i v i n , C , and V. Walbot. (1986) Stable, non-mutator stocks of maize have sequences homologous to the Mul transposable element. Genetics 114:1007-1021. Chandler,V. and V. Walbot. (1986) DNA modif icat ion of a maize transposable element correlates with loss of a c t i v i t y . Proc. N a t l . Acad. S c i . , USA 83:1767-1771. Cohen,S.N. (1976) Transposable genetic elements and plasmid evo lu t ion . Nature 263:731-735. Coulson,A. , S u l s t o n , J . , Brenner,S. and J .Karn . (1986) Toward a physical map of a genome of a nematode C. elegans. Proc. N a t l . Acad. S c i . USA 83:7821-7825. Cox ,G.N. , C a r r , S . , Kramer,J.M. and D.Hirsh . (1985) Genetic mapping of Caenorhabditis elegans collagen genes using DNA polymorphisms as phenotypic markers. Genetics 109:513-528. D a n i e l s , S . B . , McCarron,M., L o v e , C , and A.Chovnick. (1985) Dysgenesis-induced i n s t a b i l i t y of Rosy locus transformation in Drosophila melanogaster: Analysis of excis ion events and the se lec t ive recovery of control element de le t ions . Genetics 109:95-117. Davis ,R.W., Bo t s t e in .D . , and J .R .Roth . (1980) Advanced bacter ia l genetics : A manual for genetic engineering. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. D o o l i t t l e , R . F . (1979) Protein evolut ion , from The Proteins , V o l . IV, 3rd edn. , eds. H.Neurath and R . L . H i l l (Academic Press Inc.) pp.1-118. 156 Dor ing ,H.P . , T i l lman ,E . and P .S ta r l inger . (1984) DNA sequence of the maize transposable element Ds. Nature 307:127-130. Eide,D. and P.Anderson. (1985a) The gene structures of spontaneous mutations a f fect ing a Caenorhabditi s elegans myosin heavy chain gene. Genetics 109:67-79 Eide,D. and P.Anderson. (1985b) Transposition of Tel in the nematode C. elegans. Proc. N a t l . Acad. S c i . USA 82:1756-1760. Eide ,A. and P.Anderson. (1988) Insertion and excis ion of Caenorhabditis elegans transposable element T e l . Mol . C e l l . B i o l . 8:737-746. Emmons,S.W., K la s s ,M.R . , and D.Hir sh . (1979) Analysis of the constancy of DNA sequences during development and evolut ion of the nematode Caenorhabditis elegans. Proc. N a t l . Acad. S c i . U.S .A. 76:1333-1337. Emmons,S.W., Yesner ,L . , Ruan,K., and D.Katzenberg. (1983) Evidence for a transposon in C. elegans. Ce l l 32:55-65. Emmons,S.W. and L.Yesner. (1984) High-frequency excis ion of tranposable element Tel in the nematode C. elegans i s l i m i t e d to somatic c e l l s . Ce l l 36:599-605 Emmons,S.W., Roberts ,S . , and K.Ruan. (1986) Evidence in a nematode for regulat ion of transposon excis ion by t i s s u e - s p e c i f i c fac tors . Mol. Gen. Genet. 202:410-415. Emori ,Y. , Shiba ,T . , Kanaya,S., Inouye,S., Y u k i , S . and K.Saigo. (1985) The nucleotide sequence of copia and copia-related RNA in Drosophila v i r u s - l i k e p a r t i c l e s . Nature 315:773-776. Engels,W.R. (1983) The P family of transposable elements in Drosophila. Ann. Rev. Genet. 17:315-344. Engels,W.R., and C.R.Preston (1984) Formation of chromosome rearrangements by P factors in Drosophila. Genetics 107:657-678. Engels,W.R., Robertson,H. and C.Preston. (1986) The P factor repressor: A truncated transposase responsible for the P cytotype. Presented at EMB0 Workshop on the molecular and developmental biology of Drosophila. Fawcett .D.H. , L i s t e r , C . K . , K e l l e t t . E . and D.J.Finnegan. (1986) Transposable elements c o n t r o l l i n g I-R hybrid dysgenesis in D. melanogaster are s i m i l a r to mammalian LINEs. Ce l l 47:1007-1015. F i l e s , J . G . , Carr ,S . and D.Hirsh . (1983) Act in gene family of C. elegans. J . Mol . B i o l . 164:355-375. 157 F i n k , 6 . R . , Boeke,J.D. and D . J . G a r f i n k e l . (1986) The mechanism and consequences of re t ro t ranspos i t ion . Trends Genet. 2:118-123. Finnegan,D.J . , Rubin,G.M. , Young,M.W. and D.S.Hogness. (1978) Repeated gene fami l ies in Drosophila melanogaster. Cold Spring Harbor Symp. Quant. B i o l . 42:1053-1063. Friedman,P.A., P l a t z e r , E . G . , and J .E .Eby. (1976) Species d i f f e r e n t i a t i o n in Caenorhabditis briggsae and Caenorhabditis elegans. J . of Nemat. 9:197-203. G a r f i n k e l , D . J . , Boeke,J.D. and G.R.Fink. (1985) Ty element t r anspos i t i on : Reverse transcriptase and v i r u s - l i k e p a r t i c l e s . Ce l l 42:507-517. G a r r e t t , J . E . and D . C a r r o l l . (1986) TX1: a transposable element from Xenopus laevis with some unusual propert ies . Mol . C e l l . B i o l . 6:933-941. Grunstein,M. and D.Hogness. (1975) Colony h y b r i d i z a t i o n : A method for the i s o l a t i o n of cloned DNAs that contain a s p e c i f i c gene. Proc. N a t l . Acad. S c i . USA 72:3961. H a r r i s , L . J . and A.M.Rose. (1986) Somatic excis ion of transposable element Tel from the B r i s t o l genome of Caenorhabditis elegans. Mol . C e l l . B i o l . 6:1782-1786. H a t t o r i , M . and Y.Sakaki . (1986) Dideoxy sequencing method using denatured plasmid templates. Ana l . Biochem. 152:232-238. Heine,U. and T.Blumenthal. (1986) Character izat ion of regions of the Caenorhabditis elegans X chromosome containing v i t e l l o g e n i n genes. J . Mol . B i o l . 188:301-312. Henikof f ,S . (1987) Unid i rec t iona l digest ion with Exonuclease III in DNA sequence ana lys i s . Methods Enzymol. ( in press) H o r v i t z , H . R . , Brenner,S . , Hodgkin,J . and R.K.Herman. (1979) A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol. Gen. Genet. 175:129-133. H o w e l l , A . M . , Gi lmour .S .G. , Mancebo.R.A. and A.M.Rose. (1987) Genetic analysis o f . a large autosomal region in C. elegans by the use of a free d u p l i c a t i o n . Genet. Res., Camb. 49:207-213. Jacobson,J.W., Medhora.M.M. and D . L . H a r t l . (1986) Molecular structure of a somatical ly unstable transposable element in Drosophila. Proc. N a t l . Acad. S c i . USA 83;8684-8688. Johns,M.A., Mot t inger , J . and M.Free l ing . (1985) A low copy number, c o p i a - l i k e transposon in maize. EMBO J . 4:1093-1102. 158 Kahn,M., K o l t e r , R . , Thomas,C, F i g u r s k i , D . , Meyer,R., Remaut,E. and D . R . H e l i n s k i . (1979) Plasmid cloning vehicles derived from plasmids Col E l , F, R6K, and RK2. Methods Enzymol. 68:268-280. Karess ,R.E. and G.M.Rubin. (1983) Analysis of P transposable element functions in Drosophila. Ce l l 38:135-146. K i f f , J . E . , Moerman,D.G., S c h r i e f e r . L . A . and R.H.waterston. (1988) Transposon-induced deletions in unc-22 of Caenorhabditis elegans associated with near normal gene a c t i v i t y . Nature 331:631-633. Kim, J .S . and A.M.Rose (1987) The effect of gamma rad ia t ion on recombination frequency in Caenorhabditis elegans. Genome 29:457-462. Laev i s ,R . , C o l l i n s , M . and G.R.Rubin. (19821 FB elements are the common basis for the i n s t a b i l i t y of the vrLl and w c Drosophila mutations. Ce l l 30:551-565. Lansman,R.A., S tacey.S .N. , G r i g l i a t t i , T . A . and H.W.Brock. (1985) Sequences homologous to the P mobile element of Drosophila melanogaster are widely d i s t r ibu ted in the subgenus Sophophora. Nature 318:561-563. Lansman,R.A. Shade,R.O., G r i g l i a t t i , T . A . and H.W.Brock. (1987) Evolution of P transposable elements: Sequences of Drosophila nebulosa P elements. Proc. N a t l . Acad. S c i . , USA, 84:6491-6495. L a s k i . F . A . , R i o , D . C , and G.M.Rubin. (1986) Tissue s p e c i f i c i t y of Drosophila P element t ranspos i t ion i s regulated at the l eve l of mRNA s p l i c i n g . C e l l 44:7-19. L i a o , L . W . , Rosenzweig,B. and D.Hirsh . (1983) Analysis of a transposable element in C. elegans. Proc. N a t l . Acad. S c i . USA 80:3585-3589. Liebermann,D., Hoffman-Liebermann,B., W e i n t h a l , J . , C h i l d s . G . , Maxson,R., Mauron,A., Cohen,S.N. and L.Kedes. (1983) An unusual transposon with long terminal inverted repeats in the sea urchin Strongylocentotus purpuratus. Nature 306:342-347. L i l l i s . M . and M.Free l ing . (1986) Mu transposons in maize. Trends Genet. 2:183-187. L i n k , C D . , Graf-Whitse l , J . and W.B.Wood. (1987) I so la t ion and character iza t ion of a nematode transposable element from Panagrellus redivivus. Proc. N a t l . Acad. S c i . , USA 84:5325-5329. M a n i a t i s , T . , F r i t s c h , E . F . and J.Sambrook. (1982) Molecular c lon ing : A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 159 McCl intock ,B . (1951) Chromosome organization and genie expression. Cold Spring Harbor Symp. Quant. B i o l . 16:13-47. McCl intock ,B . (1956) Contro l l ing elements and the gene. Cold Spring Harbor Symp. Quant. B i o l . 21:197-216. McCl intock ,B . (1984) The s igni f icance of responses of the genome to chal lenge. Science 226:792-801. McGinnis,W., Shermoen,A.W. and S.K.Beckendorf. (1983) A transposable element inserted jus t 5' to a Drosophila glue protein gene a l t e r s gene expression and chromatin s t ructure . Ce l l 34:75-84. Meinkoth, J . and G.Wahl. (1984) Hybrid izat ion of nucle ic acids immobilized on s o l i d supports. Ana l . Biochem. 138:267-284. M e l l o r , J . , M a l i n , M . H . , G u l l , K . , T u i t e , M . F . , McCready,S., Dibbayawan,T., Kingsman,S. and A.Kingsman. (1985) Reverse t ranscr iptase a c t i v i t y and Ty RNA are associated with v i r u s - l i k e p a r t i c l e s in yeast . Nature 318:583-586. Messing,J . (1979) A multipurpose cloning system based on the single-stranded DNA bacteriophage M13. Recombinant DNA technical b u l l e t i n , National Ins t i tutes of Health publ icat ion no. 79-99.2, no. 2, p. 43-48. National Ins t i tutes of Health, Bethesda, Md. M o d o l e l l . J . , Bender,W. and M.Meselson. (1983) Drosophila melanogaster mutations suppress ive by the suppressor of Hairy-wing are inser t ions of a 7.3 kb mobile element. Proc. N a t l . Acad. S c i . USA 80:1678-1682. Moerman,D.G. and R.H.Waterston. (1984) Spontaneous unstable unc-22 IV mutations in C. elegans var. Bergerac. Genetics 108:859-877. Moerman,D.G., Benian,G.M. and R.H.Waterston. (1986) Molecular cloning of the muscle gene unc-22 in C. elegans by transposon tagging. Proc. N a t l . Acad. S c i . , USA 83:2579-2583. M o r i , I . , Benian.G.M., Moerman,D.G. and R.H.Waterston. (1988) The transposon Tel of C. elegans recognizes s p e c i f i c target sequences for in tegra t ion . Proc. N a t l . Acad. S c i . USA 85:861-864. Morrison,D.A. (1979) Transformation and preservation of competent bacter ia l c e l l s by f reez ing . In Methods in Enzymology 68:326-331. Moss ie ,K .G. , Young,M.W. and H.E.Varmus. (1985) Extrachromosomal DNA forms of c o p i a - l i k e transposable elements, F elements, and middle r e p e t i t i v e DNA sequences in Drosophila melanogaster. J . Mol . B i o l . 182:31-43. Never,P. and H.Saedler. (1977) Transposable genetic elements as agents of gene i n s t a b i l i t y and chromosome rearrangements. Nature 268:109-115. 160 Nigon,V. and E.C.Dougherty. (1949) Reproductive patterns and attempts at rec iprocal crossing of Rhabditis elegans Maupas, 1900, and Rhabditis briggsae Dougherty and Nigon, 1949 (Nematoda: Rhabditae) J . Exper. Zoo l . 112:485-503. 0'Hare,K. and G.M.Rubin. (1983) Structures of P transposable elements and t h e i r s i t e s of inser t ion and excis ion in the Drosophila melanogaster genome. Ce l l 34:25-35. 0 'Hare,K. (1985) The mechanism and control of P element t ranspos i t ion in Drosophila melanogaster. Trends Genet. 1:250-254. 0 r g e l , L . E . and F . H . C . C r i c k . (1980) Se l f i sh DNA: The ultimate paras i te . Nature 284:604-606. Paul son ,K .E . , Deka.N., Schmid,C.W., M i s r a , R . , Schindler ,C .W. , Rush,M.G., Kadyk,L. and L.Leinwand. (1985) A transposon-1ike element in human DNA. Nature 316:359-361. P l a s t e rk ,R .H .A . (1987) Differences between Tel elements from the C. elegans s t r a i n Bergerac. Nucl . Acids Res. 15:10050. Pot ter , T r u e t t , M . , P h i l l i p s , M . and A.Maher. (1980) Eukaryotic transposable genetic element with inverted terminal repeats. Ce l l 20:639-647. Po t te r , S . S . (1982a) DNA sequence analysis of a Drosophila foldback transposable element rearrangement. Mol . Gen. Genet. 188:107-110. Pot ter ,S .S . (1982b) DNA sequence of a foldback transposable element in Drosophila. Nature 297:201-204. Rigby,P.W., Dieckmann,M., Rhodes ,C, and P.Berg. (1977) Label l ing deoxynucleic acid to high spec i f i c a c t i v i t y in v i t r o by nick t r ans l a t ion with DNA Polymerase I . J . Mol . B i o l . 113:237-251. R i o . D . C , L a s k i , F . A . and G.M.Rubin. (1986) I d e n t i f i c a t i o n and immunochemical analysis of b i o l o g i c a l l y act ive Drosophila P element transposase. C e l l 44:21-32. Robertson,D.S. (1978) Character izat ion of a mutator system in maize. Mutat. Res. 51:21-28. Robertson,D.S. (1980) The timing of Mu a c t i v i t y in maize. Genetics 94:969-978. Rogalski ,T .R. and D . L . B a i l l i e . (1985) Genetic organization of the unc-22 IV region of Caenorhabditis elegans. Mol . Gen. Genet. 201:409-414. Rose,A.M., B a i l l i e , D . L . , Candido,E.P.M. , Beckenbach.K.A., and D.Nelson. (1982) The linkage mapping of cloned r e s t r i c t i o n fragment length differences in C. elegans. Mol . Gen. Genet. 188:286-291. 161 Rose,A.M., B a i l l i e , D . L . and J .Curran. (1984) Meiot ic pa i r ing behavior of two free dupl icat ions of l inkage group I in Caenorhabditis elegans. Mol . Gen. Genet. 195:52-56. Rose,A.M. and T.P.Snutch. (1984) I so la t ion of the closed c i r c u l a r form of the transposable element Tel in C. elegans. Nature 311:485-486. Rose,A.M., H a r r i s , L . J . , Mawji ,N.R. , and W.J .Morr i s . (1985) Tcl(Hin) a form of the transposable element Tel found in C. elegans. Can J . Biochem. Ce l l B i o l . 63: 752-756. Rosenzweig,B., L i a o , L . W . , and D.Hirsh . (1983a) Sequence of the C. elegans transposable element T e l . Nuc. Acids Res. 11:4201-4209. Rosenzweig,B., Liao,L.W. and D.Hirsh . (1983b) Target sequences for the C. elegans transposable element T e l . Nucl . Acids Res. 11:7137-7140. Ruan,K. and S.W.Emmons. (1984) Extrachromosomal copies of transposon Tel in the nematode C. elegans. Proc. N a t l . Acad. S c i . USA 81:4018-4022. Ruan,K. and S.W.Emmons. (1987) Precise and imprecise somatic exc i s ion of the transposon Tel in the nematode C. elegans. Nuc l . Acids Res. 15:6875-6881. Rubin,G.M. , B r o r e i n , W . J . , J r . , Dunsmuir.P., F l a v e l l , A . J . , L e v i s , R . , S t r o b e l , E . , T o o l e , J . J . and E.Young. (1981) Copia- l ike transposable elements in the Drosophila genome. Cold Spring Harbor Symp. Quant. B i o l . 45:619-628. Rubin,G.R. , K idwel l ,M.G. and P.M.Bingham. (1982) The molecular basis of P-M hybrid dysgenesis: The nature of induced mutations. Ce l l 29:987-994. Rubin,G.M. (1983) Dispersed Repet i t ive DNAs in Drosophila. from Mobile Genetic Elements, Academic Press, Inc . , p. 329-361. Sakoyama,Y., Todo,T., Ishiwa-Chigusa,S. , Honjo.T. and S.Kondo. (1985) Structures of defect ive P transposable elements prevalent in natural Q and Q-derived M s t ra ins of Drosophila melanogaster. Proc. N a t l . Acad. S c i . USA 82:6236-6239. Sanger,F. , Coulson,A.R. , B a r r e l ! , B . G . , Smi th ,A . J .H . and B.A.Roe. (1977) DNA sequencing with chain-terminating i n h i b i t o r s . Proc. N a t l . Acad. S c i . U.S .A. 74:5463-5467. Sapienza,C. and W . F . D o o l i t t l e . (1981) Genes are things you have whether you want them or not. Cold Spring Harbor Symp. Quant. B i o l . 45:177-182. 162 Schwartz,D. and E.Dennis. (1986) Transposase a c t i v i t y of the Ac c o n t r o l l i n g element in maize i s regulated by i t s degree of methylation. Mol . Gen. Genet. 205:476-482. Schwarz-Sommer,Z., G i e r l , A . , Cuypers,H., Peterson,P.A. and H.Saedler. (1985) Plant transposable elements generate the DNA sequence d i v e r s i t y needed in evo lut ion . EMBO J . 4:591-598. S e a r l e s , L . L . , J oker s t ,R .S . , Bingham,P.M., Voelker ,R.A. and A.L .Greenleaf . (1983) Molecular cloning of sequences from a Drosophila RNA polymerase locus by P element transposon tagging. C e l l 31:585-592. Shiba,T. and K.Saigo. (1983) Ret rov i rus - ! ike p a r t i c l e s containing RNA homologous to the transposable element copia in Drosophila melanogaster Nature 302:119-123. Smith,G.E. and M.D.Summers. (1980) The b i d i r e c t i o n a l transfer of DNA and RNA to n i t r o c e l l u l o s e or DBM paper. Ana l . Biochem. 109:123-129. Sneath,P.H.A. (1966) Relations between chemical s tructure and b i o l o g i c a l a c t i v i t y in peptides. J . Theor. B i o l . 12:157-195. Snutch,T.P. (1984) A molecular and genetic analysis of the heat shock response of C. elegans. Ph.D. thes i s , August, 1984, Simon Fraser U n i v e r s i t y , Burnaby,Bri t i sh Columbia. Sommer,H., Carpenter,R. , H a r r i s o n , B . J . and H.Saedler. (1985) The transposable element Tam3 of Antirrhinum majus generates a novel type of sequence a l tera t ions upon exc i s ion . Mol . Gen. Genet. 199:225-231. Staden,R. (1980) A new computer method for the storage and manipulation of DNA gel reading data. N.A.R. 8:3673-3694. S t reck ,R .D . , MacGaffey,J .E. , and S.K.Beckendorf. (1986) The structure of hobo transposable elements and t h e i r in ser t ion s i t e s . EMBO J . 5:3615-3623. Strommer,J.N., Hake,S. , Bennetzen,J .L. , Taylor,W.C. and M.Free l ing . (1982) Regulatory mutants of the maize Adhl gene caused by DNA i n s e r t i o n s . Nature 300:542-544. Sudhaus,W. (1976) Vergleichende untersuchungen zur phylogenie, systematik, okologie , b io log ie und ethologie der Rhabditidae (Nematoda). Zoologica Stuttgart 125:1-229. Su l s ton , J .E . and S.Brenner. (1974) The DNA of Caenorhabditis elegans. Genetics 77:95-104. Sundaresan,V. and M.Free l ing . (1987) An extrachromosomal form of the Mu transposons of maize. Proc. N a t l . Acad. S c i . USA 84:4924-4928. 163 T a y l o r , L . P . and V.Walbot. (1987) I so la t ion and character izat ion of a 1.7 kb transposable element from a mutator l i n e of maize. Genetics 117:297-307. Temin,H.M. (1980) Or ig in of retroviruses from c e l l u l a r moveable genetic elements. Ce l l 21:599-600. T r u e t t , M . A . , Jones,R.S. and S .S .Pot ter . (1981) Unusual structure of the FB family of transposable elements in Drosophila. Ce l l 24:753-762. Ward,S., Burke ,D . J . , S u l s t o n , J . E . , Coulson,A.R. , A lber t son ,D .G. , Ammons,D., Klass ,M. and E.Hogan. (1988) Genomic organization of major sperm protein genes and pseudogenes in the nematode Caenorhabditis elegans. J . Mol . B i o l . 199:1-13. Weiner ,A.M. , D e i n i n g e r , P . L . , and A . E f s t r a t i a d i s (1986) Nonviral retroposons: Genes, pseudogenes and transposable elements generated by the reverse flow of genetic information. Ann. Rev. Biochem. 55:631-661. Wichman.H.A., Pot ter ,S .S . and D.S .Pine. (1985) Mys, a family of mammalian transposable elements i so la ted by phylogenetic screening. Nature 317:77-81. Yanisch-Perron,C. , V i e i r a , J . and J .Messing. (1985) Improved M13 phage cloning vectors and host s t r a i n s : nucleotide sequences of the M13mpl8 and pUC19 vectors . Gene 33:103-119. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0098058/manifest

Comment

Related Items