Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cellulase gene transcription in Cellulomonas fimi and an Agrobacterium Greenberg, Norman Michael 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A1 G73.pdf [ 7.24MB ]
Metadata
JSON: 831-1.0098055.json
JSON-LD: 831-1.0098055-ld.json
RDF/XML (Pretty): 831-1.0098055-rdf.xml
RDF/JSON: 831-1.0098055-rdf.json
Turtle: 831-1.0098055-turtle.txt
N-Triples: 831-1.0098055-rdf-ntriples.txt
Original Record: 831-1.0098055-source.json
Full Text
831-1.0098055-fulltext.txt
Citation
831-1.0098055.ris

Full Text

CELLULASE GENE TRANSCRIPTION IN CELLULOMONAS FIMI AND AN AGROBACTERIUM by NORMAN MICHAEL GREENBERG B . S c , t h e U n i v e r s i t y o f T o r o n t o , 1982 A THESIS SUBMITTED IN PARTIAL FULFILLMENT THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES (Department o f M i c r o b i o l o g y ) We a c c e p t t h i s t h e s i s as c o n f o r m i n g t o t h e r e q u i r e d s t a n d a r d THE UNIVERSITY OF B R I T I S H COLUMBIA Ma r c h , 1988 ©Norman M i c h a e l G r e e n b e r g , 198 8 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Microbiology The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date March 15, 1988 i i ABSTRACT T r a n s c r i p t i o n a l a n a l y s i s was u s e d t o i n v e s t i g a t e t h e m o l e c u l a r m e c h a n i s m s w h i c h e f f e c t c e l l u l a s e g e n e e x p r e s s i o n i n t h e g r a m - p o s i t i v e b a c t e r i u m Cellulomonas fimi s t r a i n ATCC 484 a n d t h e g r a m - n e g a t i v e b a c t e r i u m Agrobacterium s p . s t r a i n ATCC 2 1 4 0 0 . The cenA, cex a n d c e n B g e n e s o f C. fimi e n c o d i n g t h e e x t r a c e l l u l a r { 3 - 1 , 4 - e n d o g l u c a n a s e , EngA (EC 3.2.1.4; M r 4 8 , 7 0 0 ) , t h e e x t r a c e l l u l a r (3-1, 4 - e x o g l u c a n a s e , E x g (EC 3. 2 . 1 . 9 1 ; M r 47,300) a n d t h e e x t r a c e l l u l a r 0-1,4-e n d o g l u c a n a s e EngB (EC 3.2.1.4; M r 110,000) r e s p e c t i v e l y , were c h a r a c t e r i s e d . By n o r t h e r n b l o t a n a l y s i s , c e n A mRNA was d e t e c t e d i n C. fimi RNA p r e p a r e d f r o m g l y c e r o l - a n d c a r b o x y m e t h y l c e l l u l o s e (CMC)-grown c e l l s b u t n o t i n RNA f r o m g l u c o s e - g r o w n c e l l s . The cex mRNA was f o u n d o n l y i n RNA f r o m CMC-grown c e l l s . The cenB mRNA was f o u n d i n a l l t h r e e p r e p a r a t i o n s o f RNA. T h e r e f o r e , t h e e x p r e s s i o n o f t h e s e g e n e s i s s u b j e c t t o r e g u l a t i o n b y t h e c a r b o n s o u r c e p r o v i d e d t o C. fimi. H i g h r e s o l u t i o n n u c l e a s e S I p r o t e c t i o n s t u d i e s w i t h u n i q u e 5 ' - l a b e l e d DNA p r o b e s a n d C. fimi RNA i s o l a t e d in vivo, w e r e u s e d t o map t h e 5' t e r m i n i o f c e n A a n d cex mRNAs. Two cenA mRNA 5' e n d s , 11 b a s e s a p a r t , mapped 51 and 62 b a s e s u p s t r e a m o f t h e c e n A s t a r t c o d o n , s u g g e s t i n g t h a t in vivo, cenA t r a n s c r i p t i o n was d i r e c t e d f r o m t w o p r o m o t e r s i n t a n d e m . The c e x mRNA 5' e n d was f o u n d t o map 28 b a s e s u p s t r e a m o f t h e cex s t a r t c o d o n . U s i n g S I m a p p i n g w i t h u n l a b e l e d DNA p r o b e s a n d C. fimi RNA w h i c h h a d b e e n i s o l a t e d i i i in vivo b u t w h i c h h a d b e e n 5 ' - l a b e l e d in v i t r o w i t h v a c c i n i a v i r u s c a p p i n g e n zyme c o n f i r m e d t h a t t r u e t r a n s c r i p t i o n i n i t i a t i o n s i t e s f o r cenA a n d cex mRNA h a d b e e n i d e n t i f i e d . The S I m a p p i n g r e v e a l e d mRNA 3' t e r m i n i 1,438, 1,449, a n d 1, 464 b a s e s f r o m t h e m a j o r cenA s t a r t s i t e , a n d one 3' t e r m i n u s 1,564 b a s e s f r o m t h e m a j o r cex mRNA s t a r t s i t e , i n g o o d a g r e e m e n t w i t h t h e n o r t h e r n b l o t d a t a . H i g h r e s o l u t i o n S I s t u d i e s w e r e a l s o u s e d t o show t h a t a b u n d a n t mRNA 5' ends mapped u p s t r e a m o f t h e cenB s t a r t c o d o n i n RNA p r e p a r e d f r o m CMC-grown c e l l s , w h i l e l e s s - a b u n d a n t s p e c i e s mapped 52 b a s e s c l o s e r t o t h e ATG c o d o n i n RNA p r e p a r e d f r o m C. fimi grown on an y one o f t h e t h r e e s u b s t r a t e s . T h e s e r e s u l t s seem t o i n d i c a t e a t a n d e m p r o m o t e r a r r a n g e m e n t w i t h an A T G - p r o x i m a l p r o m o t e r d i r e c t i n g l o w - l e v e l c o n s t i t u t i v e cenB t r a n s c r i p t i o n a n d a more d i s t a l p r o m o t e r d i r e c t i n g h i g h e r l e v e l s o f c e n B t r a n s c r i p t i o n a s a r e s u l t o f C. fimi g r o w t h on c e l l u l o s i c s u b s t r a t e . S t e a d y - s t a t e l e v e l s w e r e d e t e r m i n e d f o r cenA, cex a n d cenB mRNAs w i t h RNA p r e p a r e d f r o m g l y c e r o l - , g l u c o s e - , a n d CMC-grown c u l t u r e s o f C. fimi i n s l o t - b l o t h y b r i d i s a t i o n s w i t h r a d i o l a b e l e d o l i g o d e o x y r i b o n u c l e o t i d e p r o b e s . A c e x - l i n k e d gene (clg) was i d e n t i f i e d b y s e q u e n c e i n s p e c t i o n a n d S I map p i n g . T r a n s c r i p t s o f t h e abg g e n e e n c o d i n g t h e [ 3 - g l u c o s i d a s e (Abg, EC 3.2.2.21/ M r 50,000) o f Agrobacterium s p . s t r a i n ATCC 21400 w e r e a l s o c h a r a c t e r i s e d . N o r t h e r n b l o t a n a l y s i s o f Agrobacterium RNA r e v e a l e d t h e s i z e o f t h e in vivo abg i v mRNA was a p p r o x i m a t e l y 1,500 b a s e s i n l e n g t h . H i g h r e s o l u t i o n S I m a p p i n g d e t e r m i n e d abg mRNA 5' e n d s 22 b a s e s u p s t r e a m o f t h e abg ATG c o d o n a n d 3' ends 71 b a s e s d o w n s t r e a m o f t h e abg s t o p c o d o n . V TABLE OF CONTENTS Page ABSTRACT i i TABLE OF CONTENTS v L I S T OF TABLES i x L I S T OF FIGURES x ABBREVIATIONS, NOMENCLATURE AND SYMBOLS x i i i ACKNOWLEDGEMENTS x v 1. INTRODUCTION 1 1.1. B a c k g r o u n d 1 1.2. C e l l u l o s e a n d c e l l u l a s e s 2 1.3. Cellulomonas fimi ( S t r a i n ATCC 484) 4 1.4. Agrobacterium s p . ( S t r a i n ATCC 21400) 8 2. MATERIALS AND METHODS 11 2.1. B a c t e r i a l s t r a i n s , p h a g e s and p l a s m i d s 11 2.2. Enzymes and r e a g e n t s 11 2.3. M e d i a a n d g r o w t h c o n d i t i o n s 11 2.4. R N a s e - f r e e work 13 2.5. RNA e x t r a c t i o n 13 2.6. DNA e x t r a c t i o n a n d p u r i f i c a t i o n 15 32 2.7. P r e p a r a t i o n o f P l a b e l e d DNA 15 2.8. P r e p a r a t i o n o f h y b r i d i s a t i o n p r o b e s 16 v i 2.9. DNA s e q u e n c i n g and s e q u e n c e a n a l y s i s 16 2.10. DNA m o l e c u l a r w e i g h t m a r k e r s 17 i 2.11. N o r t h e r n b l o t a n a l y s i s 17 2.12. I n v i t r o c a p l a b e l i n g o f RNA 18 2.13. H y b r i d p r o t e c t i o n a n a l y s i s 19 2.14. S y n t h e t i c o l i g o d e o x y r i b o n u c l e o t i d e h y b r i d i s a t i o n p r o b e s 20 2.15. S l o t - b l o t h y b r i d i s a t i o n s 22 3. RESULTS 24 3.1. C h a r a c t e r i z a t i o n o f t h e cenA t r a n s c r i p t s o f C. fimi 24 3.1.1. R e g u l a t i o n b y c a r b o n s o u r c e a n d a p p r o x i m a t e l e n g t h o f cenA mRNA 24 3.1.2. M a p p i n g t h e 5' e n d o f cenA mRNA 29 3.1.2.1. M a p p i n g t h e cenA mRNA 5 1 e n d w i t h a 5 ' - l a b e l e d DNA p r o b e 2 9 3.1.2.2. M a p p i n g t h e cenA mRNA 5' t e r m i n u s w i t h c a p p e d RNA 32 3.1.3. M a p p i n g t h e - 3 ' e n d o f cenA mRNA 3 6 3.1.4. S t e a d y s t a t e l e v e l s o f cenA mRNA 42 3.2. C h a r a c t e r i z a t i o n o f t h e cex t r a n s c r i p t s o f C.fimi.45 3.2.1. R e g u l a t i o n b y c a r b o n s o u r c e and a p p r o x i m a t e l e n g t h o f cex mRNA 45 3.2.2. M a p p i n g t h e 5' e n d o f c e x mRNA 45 3.2.2.1. M a p p i n g t h e cex mRNA 5' e n d v i i w i t h a 5 ' - l a b e l e d DNA p r o b e 50 3.2.2.2. M a p p i n g t h e c e x mRNA 5' t e r m i n u s w i t h c a p p e d RNA 55 3.2.3. M a p p i n g t h e 3' e n d o f c e x mRNA 55 3.2.4. S t e a d y s t a t e l e v e l s o f c e x mRNA 63 3.3. C h a r a c t e r i z a t i o n o f t h e cenB t r a n s c r i p t s o f C. fimi 66 3.3.1. R e g u l a t i o n by c a r b o n s o u r c e a n d a p p r o x i m a t e l e n g t h o f cenB mRNA 66 3.3.2. M a p p i n g t h e 5' e n d o f cenB mRNA w i t h a 5 ' - l a b e l e d DNA p r o b e 68 3.3.3. S t e a d y s t a t e l e v e l s o f cenB mRNA 73 3.4. I d e n t i f i c a t i o n o f a C. fimi c e x - l i n k e d gene 76 3.4.1. Sequence i n s p e c t i o n t o i d e n t i f y p u t a t i v e C. fimi genes 7 6 3.4.2. H y b r i d p r o t e c t i o n a n a l y s i s t o c o n f i r m t h e p r e s e n c e o f a c e x - l i n k e d gene 76 3.5. C h a r a c t e r i z a t i o n o f t h e abg t r a n s c r i p t s o f Agrobacterium s p . s t r a i n ATCC 21400 83 3.5.1. A p p r o x i m a t e l e n g t h o f abg mRNA 83 3.5.2. M a p p i n g t h e 5' e n d o f abg mRNA w i t h a 5 ' - l a b e l e d DNA p r o b e 8 3 3.5.3. M a p p i n g t h e 3' e n d o f abg mRNA w i t h a 3 ' - l a b e l e d DNA p r o b e 8 8 4. DISCUSSION 95 V l l l 4.1. The cenA, cex and cenB t r a n s c r i p t s o f C. f i m i . . . 95 4.2. The abg t r a n s c r i p t s o f Agrobacterium sp S t r a i n ATCC 21400 113 , REFERENCES 115 i x L I S T OF TABLES TABLE PAGE I . C h a r a c t e r i s t i c s o f t h e cenA, cex, cenB and abg s t r u c t u r a l genes 10 I I . B a c t e r i a l s t r a i n s , p h ages and p l a s m i d s 12 I I I . O l i g o d e x y r i b o n u c l e o t i d e h y b r i d i s a t i o n p r o b e s 21 I V . S t e a d y s t a t e l e v e l s o f C. fimi cenA mRNA 44 V. S t e a d y s t a t e l e v e l s o f C. fimi cex mRNA 65 V I . S t e a d y s t a t e l e v e l s o f C. fimi cenB mRNA 77 X L I S T OF FIGURES FIGURE PAGE 1. P a r t i a l r e s t r i c t i o n map o f t h e cenA gene 25 2. S u b c l o n i n g t h e 5' f l a n k i n g and t e r m i n a l cenA DNA....26 3. I s o l a t i o n o f a c e n A - s p e c i f i c n o r t h e r n b l o t p r o b e . . . . 2 7 4. N o r t h e r n b l o t a n a l y s i s o f c e n A - s p e c i f i c t r a n s c r i p t s . 2 8 5. I s o l a t i o n o f a cenA 5' m R N A - s p e c i f i c S I p r o b e 30 6. M a p p i n g t h e 5' end o f cenA mRNA 31 7. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5 1 t e r m i n a l r e g i o n o f cenA mRNA 33 8. H y b r i d p r o t e c t i o n w i t h c a p p e d RNA 35 9. M a p p i n g cenA mRNA 5' t e r m i n u s w i t h c a p p e d RNA 37 10. S u b c l o n i n g t h e 3' t e r m i n a l a n d f l a n k i n g DNA o f t h e cenA s t r u c t u r a l gene 38 11. I s o l a t i o n o f a 3' cenA m R N A - s p e c i f i c S I p r o b e 39 12. M a p p i n g t h e 3' e n d o f cenA mRNA 40 13. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 3' t e r m i n a l r e g i o n o f cenA mRNA 41 14. P a r t i a l r e s t r i c t i o n map o f t h e c e x gene 46 15. A p a r i a l r e s t r i c t i o n map o f t h e p l a s m i d pUC12A25....47 16. I s o l a t i o n o f a c e x - s p e c i f i c n o r t h e r n b l o t p r o b e 48 17. N o r t h e r n b l o t a n a l y s i s o f c e x - s p e c i f i c t r a n s c r i p t s 4 9 18. S u b c l o n i n g t h e 5' f l a n k i n g a n d t e r m i n a l DNA o f t h e c e x s t r u c t u r a l gene 51 x i ' 19. I s o l a t i o n o f a c e x 5' m R N A - s p e c i f i c S I p r o b e 53 20. M a p p i n g t h e 5' e n d o f cex mRNA 54 21. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5' t e r m i n a l r e g i o n o f cex mRNA 56 22. R e p r e s e n t a t i o n o f t h e p l a s m i d pUC13Bam31 58 23. M a p p i n g t h e cex mRNA 5' t e r m i n u s w i t h c a p p e d RNA ...59 24. S u b c l o n i n g t h e 3' t e r m i n a l a n d f l a n k i n g DNA o f t h e cex s t r u c t u r a l gene 60 25. I s o l a t i o n o f a 3' cex m R N A - s p e c i f i c S I p r o b e 61 26. M a p p i n g t h e 3' end o f c e x mRNA 60 27. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 3 ' t e r m i n a l r e g i o n o f c e x mRNA 64 28. P a r t i a l r e s t r i c t i o n map o f t h e cenB gene 67 29. R e p r e s e n t a t i o n o f t h e p l a s m i d pUC19C3PS 69 30. N o r t h e r n b l o t a n a l y s i s o f c e n B - s p e c i f i c t r a n s c r i p t s . 7 0 31. I s o l a t i o n o f a cenB 5' m R N A - s p e c i f i c S I p r o b e 71 32. M a p p i n g t h e 5' end o f cenB mRNA 72 33. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5' t e r m i n a l r e g i o n o f cenB mRNA 75 34. R e p r e s e n t a t i o n o f t h e c l o n e d C. fimi DNA c o n t a i n i n g t h e 5' t e r m i n a l p o r t i o n o f t h e c e x - l i n k e d gene 7 9 35. I s o l a t i o n o f a h y b r i d i s a t i o n p r o b e t o map t h e 5' t e r m i n u s o f a p u t a t i v e C. fimi gene t r a n s c r i p t 80 36. M a p p i n g t h e 5' end o f a c e x - l i n k e d gene t r a n s c r i p t . . 8 1 37. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5' t e r m i n a l p o r t i o n o f c l g mRNA 82 x i i 38. P a r t i a l r e s t r i c t i o n map o f t h e abg gene 84 39. R e p r e s e n t a t i o n o f t h e p l a s m i d pTZ19-B 85 40. N o r t h e r n b l o t a n a l y s i s o f abg t r a n s c r i p t s 86 41. R e p r e s e n t a t i o n o f t h e p l a s m i d pUC13::A9R5 87 42. M a p p i n g t h e 5' end o f abg mRNA 89 43. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5' t e r m i n a l r e g i o n o f abg mRNA 91 44. R e p r e s e n t a t i o n o f t h e p l a s m i d pABG5 92 45. M a p p i n g t h e 3' end o f abg mRNA 93 46. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 3' t e r m i n a l r e g i o n o f abg mRNA 94 47. P r o m o t e r r e g i o n s i m i l a r i t i e s 101 48. C o n s e r v e d DNA s e q u e n c e s f l a n k i n g mapped 5' ends o f C. fimi c e l l u l a s e g enes 107 x i i i ABBREVIATIONS, NOMENCLATURE AND SYMBOLS A A d e n i n e aa Amino a c i d ( s ) abg Gene e n c o d i n g t h e Agrobacterium (3- g l u c o s i d a s e Abg The abg gene p r o d u c t ATCC A m e r i c a n Type C u l t u r e C o l l e c t i o n Ap A m p i c i l l i n bp B a s e p a i r (s) C C y t o s i n e cenA Gene e n c o d i n g t h e e n d o - | 3 - l , 4 - g l u c a n a s e A o f Cellulomonas fimi cenB Gene e n c o d i n g t h e endo - ( 3-l, 4 - g l u c a n a s e B o f Cellulomonas fimi cex Gene e n c o d i n g t h e exo - ( 3-l, 4 - g l u c a n a s e o f Cellulomonas fimi CIAP C a l f i n t e s t i n a l a l k a l i n e p h o s p h a t a s e CMC C a r b o x y m e t h y l c e l l u l o s e DNA D e o x y r i b o n u c l e i c a c i d ds D o u b l e - s t r a n d e d dNTP d e o x y r i b o n u c l e o s i d e t r i p h o s p h a t e EDTA E t h y l e n e d i a m i n e t e t r a a c e t i c a c i d EngA The cenA gene p r o d u c t EngB The cenB gene p r o d u c t E x g The cex gene p r o d u c t x i v G G u a n i n e HEPES N - 2 - h y d r o x y e t h y l p i p e r a z i n e - N ' - 2 - e t h a n e s u l f o n i c a c i d kb 1000 b a s e p a i r s kDa 1000 d a l t o n s l a c Z ' The f i r s t 78 amino a c i d s o f t h e E. c o l i p4-g a l a c t o s i d a s e i n c l u d i n g t h e o p e r a t o r a n d p r o m o t e r r e g i o n s o f t h e gene mA M i l l i a m p e r e s MCS M u l t i p l e c l o n i n g s i t e MOPS M o r p h o l i n e p r o p a n e s u l f o n i c a c i d M r R e l a t i v e m o l e c u l a r mass N Any (deoxy-) r i b o n u c l e o t i d e n t N u c l e o t i d e s PAGE P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s PNK P o l y n u c l e o t i d e k i n a s e P P i P y r o p h o s p h a t e R e s i s t a n t RBS Ribosome b i n d i n g s i t e / s e q u e n c e SDS Sodium d o d e c y l s u l f a t e s s S i n g l e - s t r a n d e d SSC S t a n d a r d s a l i n e c i t r a t e T Thymine TAE T r i s / A c e t a t e / E D T A b u f f e r TE T r i s / E D T A b u f f e r XV ACKNOWLEDGEMENTS I w i s h t o t h a n k D r . R.C. M i l l e r , J r . f o r b e i n g my g r a d u a t e s u p e r v i s o r a n d D r s . R . A . J . W a r r e n , D.G. K i l b u r n , a n d P.P. D e n n i s f o r s h a r i n g t h e i r k n o w l e d g e a n d f o r t h e i r a d v i c e t h r o u g h o u t t h e c o u r s e o f t h i s w o r k . I a l s o w i s h t o t h a n k D r s . N.R. G i l k e s , J.T. B e a t t y , P. B e g u i n a n d G.B. S p i e g e l m a n f o r a l l t h e i r h e l p . To my f e l l o w g r a d u a t e s t u d e n t s , t h e s t a f f a n d f a c u l t y o f t h e D e p a r t m e n t o f M i c r o b i o l o g y - t h a n k s f o r t h e m e m o r i e s . I am g r a t e f u l t o t h e N a t u r a l S c i e n c e s a n d E n g i n e e r i n g R e s e a r c h C o u n c i l o f Canada f o r s u p p o r t i n g t h e UBC c e l l u l a s e r e s e a r c h g r o u p a n d f o r my 1 9 8 4 - 8 5 a n d 1 9 8 5 - 8 6 p o s t g r a d u a t e f e l l o w s h i p s . T h i s one's f o r t h e m i s h p o c h a . 1 1. INTRODUCTION 1.1. B a c k g r o u n d C e l l u l o l y t i c m i c r o o r g a n i s m s e l a b o r a t e e n z y m e s , b r o a d l y c l a s s i f i e d a s c e l l u l a s e s , w h i c h c a n h y d r o l y s e (3-1,4-g l u c o s i d i c b o n d s . Many c e l l u l o l y t i c b a c t e r i a a n d f u n g i h ave now b e e n i d e n t i f i e d a n d a r e b e i n g c h a r a c t e r i z e d ( f o r r e c e n t r e v i e w s , s e e B e g u i n , et al.,1987 a n d C o u g h l a n , 1 9 8 5 ) . C h a r a c t e r i z a t i o n o f t h e i n d i v i d u a l e n z y m a t i c c o m p o n e n t s i n v o l v e d i n c e l l u l o l y s i s h a s b e e n c o m p l i c a t e d b y t h e m u l t i p l i c i t y o f c e l l u l a s e a c t i v i t i e s m o s t c e l l u l o l y t i c m i c r o o r g a n i s m s p r o d u c e a n d b y t h e m e c h a n i s m s w h i c h r e g u l a t e c e l l u l a s e e x p r e s s i o n a n d f u n c t i o n s ( B e g u i n , e t al., 1 9 7 7 ; C o u g h l a n , 1 9 8 5 ; D u o n g e t al., 1 9 8 3 ) . On t h e b a s i s o f p h e n o t y p i c o b s e r v a t i o n s a n d a c t i v i t y c o m p l e m e n t a t i o n s t u d i e s , r e p r e s s i o n a n d i n d u c t i o n h a v e b e e n s u g g e s t e d a s m e c h a n i s m s r e g u l a t i n g c e l l u l a s e b i o s y n t h e s i s a n d e n d - p r o d u c t i n h i b i t i o n h a s b e e n s u g g e s t e d t o a f f e c t enzyme a c t i v i t y ( B e g u i n , et al., 1 9 7 7 ; C o u g h l a n , 1 9 8 5 ; P o s t m a , 1986) . I t i s g e n e r a l l y b e l i e v e d t h a t e n h a n c e d c e l l u l a s e p r o d u c t i o n , t h r o u g h g e n e t i c e n g i n e e r i n g , w i l l f a c i l i t a t e t h e d e v e l o p m e n t o f a n e c o n o m i c a l l y f e a s i b l e p r o c e s s o f c e l l u l o s e h y d r o l y s i s t o p r o d u c e f u e l s f r o m b i o m a s s a n d a g r i c u l t u r a l c e l l u l o s i c w a s t e m a t e r i a l ( B e g u i n , e t al., 1 9 8 7 ; E v e l e i g h , 1 9 8 3 ; R y u a n d M a n d e l s , 1 9 8 0 ) . T h e r e f o r e , t h e m o l e c u l a r c l o n i n g o f c e l l u l a s e e n c o d i n g g e n e s i s c u r r e n t l y t h e t o p i c o f i n t e n s e 2 i n v e s t i g a t i o n ( B e g u i n e t al., 1 9 8 7 ) . W h i l e t h e s t r u c t u r e s o f c e l l u l a s e e n c o d i n g g e n e s , a n d t h e u n i q u e p r o p e r t i e s o f t h e i r p r o t e i n p r o d u c t s a r e b e i n g d e t e r m i n e d ( b u i l d i n g t h e g e n e t i c a l l y e n h a n c e d c e l l u l o l y t i c s y s t e m t o c o n v e r t c e l l u l o s e t o g l u c o s e i s a d r i v i n g f o r c e ) , t h e m o l e c u l a r m e c hanisms w h i c h g o v e r n t h e i r n a t i v e e x p r e s s i o n h a v e r e m a i n e d r e l a t i v e l y u n c h a r a c t e r i z e d . S i n c e m o l e c u l a r c l o n i n g h a s b e e n u s e d t o i s o l a t e c e l l u l a s e g e n e s f r o m Cellulomonas fimi s t r a i n ATCC 484 ( r e v i e w e d b y B e g u i n , e t al., 1987) a n d a ( 3 - g l u c o s i d a s e gene f r o m Agrobacterium s p . s t r a i n ATCC 21400 (Wakarchuk e t al., 1 9 8 6 ) , t h e a v a i l a b i l i t y o f t h e s e c l o n e d g e n e s f a c i l i t a t e s a s t u d y o f t h e i r e x p r e s s i o n a t t h e t r a n s c r i p t i o n a l l e v e l . S u c h a c h a r a c t e r i z a t i o n i s a l s o o f i n t e r e s t s i n c e t r a n s c r i p t i o n i n e i t h e r o f t h e s e b a c t e r i a h a d n o t b een p r e v i o u s l y i n v e s t i g a t e d . 1.2. C e l l u l o s e and c e l l u l a s e s C e l l u l o s e , t h e m a j o r c e l l w a l l a n d s t r u c t u r a l p o l y s a c c h a r i d e o f p l a n t s , i s t h e m o s t a b u n d a n t o r g a n i c m a t e r i a l on e a r t h . C e l l u l o s e o c c u r s a s l o n g c h a i n s o f g l u c o s e r e s i d u e s , up t o 14,000 u n i t s i n l e n g t h , h e l d t o g e t h e r b y P ~ l , 4 - g l u c o s i d i c b o n d s . The b a s i c r e p e a t i n g u n i t o f c e l l u l o s e i s t h e d i s a c c h a r i d e c e l l o b i o s e ( s e e F a n et al., 1980; L e h n i n g e r , 1975; Thomas, 1 9 8 3 , ) . C h a i n s o f c e l l u l o s e a r e o r g a n i z e d i n b u n d l e s o f p a r a l l e l 3 c h a i n s t o f o r m f i b r i l s . T h e s e f i b r i l s d i s p l a y b o t h h i g h l y o r d e r e d s t r u c t u r e , t h e c r y s t a l l i n e r e g i o n s , a n d l e s s o r d e r e d s t r u c t u r e , t h e a m o r p h o u s r e g i o n s . I n i t s n a t u r a l s t a t e , c e l l u l o s e i s f o u n d a s s e m i - c r y s t a l l i n e , i n s o l u b l e f i b r i l s c e m e n t e d t o g e t h e r w i t h i n a c o m p l e x o r g a n i c m a t r i x . T h i s m a t r i x i s p r i m a r i l y c o m p o s e d o f t w o c o m p o n e n t s : h e m i c e l l u l o s e s , w h i c h a r e ( 3 - 1 , 4 - l i n k e d p o l y m e r s o f D - x y l o s e w i t h s i d e c h a i n s o f a r a b i n o s e and o t h e r s u g a r s ; a n d l i g n i n , w h i c h i s a p o l y m e r o f a r o m a t i c a l c o h o l s ( G a r d n e r a n d B l a c k w e l l , 1974; Rees e t al., 1 9 8 2 ) . The c e l l u l o l y t i c p r o c e s s a p p e a r s t o i n v o l v e s e v e r a l t y p e s o f e nzymes, o f w h i c h t h e e n d o g l u c a n a s e s , e x o g l u c a n a s e s a n d |3-g l u c o s i d a s e s a r e p e r h a p s e t h e b e s t c h a r a c t e r i z e d . The e n d o g l u c a n a s e s (E.C.3.2.1.4) h y d r o l y s e t h e i n t e r n a l 0-1,4-g l u c o s i d i c l i n k a g e s i n t h e c e l l u l o s e c h a i n s , g e n e r a t i n g new, n o n - r e d u c i n g e n d s . The e x o g l u c a n a s e s a t t a c k t h e n o n - r e d u c i n g e n d s o f t h e c e l l u l o s e c h a i n s c r e a t e d b y e n d o g l u c a n a s e h y d r o l y s i s . E x o g l u c a n a s e s may be [5-1, 4 - c e l l o b i o h y d r o l a s e s (E.C. 3.2.1.91) w h i c h e f f e c t t h e r e l e a s e o f c e l l o b i o s e , o r t h e y may be [5-1, 4 - g l u c a n g l u c o h y d r o l a s e s ( E . C . 3.2.1.74) w h i c h r e l e a s e g l u c o s e f r o m t h e n o n - r e d u c i n g ends o f c e l l u l o s e a n d c e l l o d e x t r i n s . C e r t a i n e n d o g l u c a n a s e s a n d e x o g l u c a n a s e s c a n a c t s y n e r g i s t i c a l l y t o h y d r o l y s e s e m i - c r y s t a l l i n e c e l l u l o s i c s u b s t r a t e s ( C o u g h l a n , 1985) . T h e s h o r t o l i g o s a c c h a r i d e p r o d u c t s o f e n d o - a n d e x o g l u c a n a s e h y d r o l y s i s c a n be f u r t h e r h y d r o l y s e d t o g l u c o s e 4 t h r o u g h t h e a c t i o n o f P - g l u c o s i d a s e s (E.C.3.2.1.21) . W h i l e t h e e n d o - a n d e x o g l u c a n a s e s a r e u s u a l l y f o u n d a s e x t r a c e l l u l a r e n z y m e s , P - g l u c o s i d a s e s a r e p r i m a r i l y c e l l -a s s o c i a t e d . The a c t i o n o f P - g l u c o s i d a s e s may be t h e r a t e l i m i t i n g f a c t o r i n t h e h y d r o l y s i s o f c e l l u l o s e t o g l u c o s e ; i t may a l s o r e l i e v e t h e e n d - p r o d u c t i n h i b i t i o n o f t h e e ndo- and e x o g l u c a n a s e s b y c e l l o b i o s e (Han a n d S r i v i n a s a n , 1 9 6 9 ; S h e w a l e , 1 9 8 2 ) . W h i l e a number o f P - g l u c o s i d a s e s h a v e b e e n c h a r a c t e r i z e d , o n l y t h r e e h a v e b e e n b o t h c l o n e d a n d s e q u e n c e d ( W a k a r c h u k , 1987; W a k a r c h u k , e t al., 1986, 1 9 8 8 ; K o h c h i a n d Toh-e, 1 9 8 5 ) . W h i l e o t h e r c o m p o n e n t s , b o t h e n z y m a t i c a n d n o n - e n z y m a t i c , a r e a s s o c i a t e d w i t h t h e c e l l u l o l y t i c s y s t e m s o f f u n g i a n d b a c t e r i a , t h e i r r o l e s i n c e l l u l o l y s i s a r e s t i l l n o t c l e a r l y u n d e r s t o o d a n d a r e b e y o n d t h e s c o p e o f t h i s i n t r o d u c t i o n . A g a i n t h e r e a d e r i s r e f e r e d t o r e c e n t r e v i e w s ( C o u g h l a n , 1985, E n a r i and N i k u - P a a v o l a , 1 9 8 7 ) . The f o l l o w i n g i s a b r i e f a c c o u n t o f t h e C. fimi a n d A g r o j b a c t e r i u m s p . genes w h i c h were s u b j e c t s o f t h i s s t u d y . 1.3. The cenA, cex a n d cenB genes o f Cellulomonas fimi C. fimi i s one o f t h e m o s t i n v e s t i g a t e d c e l l u l o l y t i c b a c t e r i a ( B e g u i n e t al., 1 9 8 7 ) . I t i s a g r a m - p o s i t i v e , r o d -s h a p e d m e s o p h i l e w i t h DNA o f 72 m o l e % G+C ( B e r g e y e t al, 1 9 7 4 ; K e d d i e , 1 9 7 4 ; S t a c k e b r a n t a n d K a n d l e r , 1979) . E n d o g l u c a n a s e , e x o g l u c a n a s e a n d c e l l o b i a s e a c t i v i t i e s a r e i n d u c e d when C. fimi i s g r o w n on c e l l u l o s i c m a t r e r i a l 5 ( L a n g s f o r d , et al., 1 9 8 4 ) . To d a t e , 5 g e n e s e n c o d i n g c e l l u l o l y t i c e n z y m e s h a v e b e e n i s o l a t e d f r o m C. fimi a n d c l o n e d i n t o E. c o l i ( B a t e s , 1 9 8 7 ; B e g u i n e t al., 1 9 8 7 ; G i l k e s e t al., 1984 ; O ' N e i l l , e t al., 1986 ; O w o l a b i e t al., 1988 ; W h i t t l e , e t al., 1 9 8 2 ; Wong e t a l . , 1 9 8 6 ; B. M o s e r , p e r s o n a l c o m m u n i c a t i o n ) . Of t h e s e f i v e g e n e s , cenA, cex a n d c e n B , a r e t h e s u b j e c t s o f t h i s s t u d y a n d a r e d e s c r i b e d b e l o w . The cenC gene e n c o d i n g e n d o g l u c a n a s e C i s c u r r e n t l y b e i n g c h a r a c t e r i z e d b y B e r n h a r d M o s e r a n d t h e cbg g e n e e n c o d i n g a c e l l o b i a s e i s c u r r e n t l y b e i n g c h a r a c t e r i z e d b y F r a n c o i s P a r a d i s , b o t h a t UBC. A l l f i v e g e n e s w e r e i s o l a t e d a s i n d i v i d u a l c l o n e s . The c e n A , cex a n d c e n B g e n e s w e r e n o t f o u n d t o map t o g e t h e r a f t e r s c r e e n i n g a C. fimi l a m b d a l i b r a r y . W h e t h e r o r n o t t h e cenC a n d cbg g e n e s map t o g e t h e r o r w i t h t h e o t h e r t h r e e g e n e s i s n o t y e t known. The p r o d u c t s o f t h e s e f i v e g e n e s a r e a l l b e l i e v e d t o p l a y a r o l e i n C. fimi c e l l u l o l y t i c g r o w t h . The c e n A g e n e e n c o d e s t h e m a j o r e n d o g l u c a n a s e o f C. . f i m i ( G i l k e s e t a l . , 1 984b; Wong, e t a l . , 1 9 8 6 ) . I t s n u c l e o t i d e s e q u e n c e h a s b e e n d e t e r m i n e d (Wong e t a l . , 198 6 ) . I t e n c o d e s a p o l y p e p t i d e , EngA, o f 449 amino a c i d s , i n i t i a t i n g a t an ATG c o d o n a n d t e r m i n a t i n g w i t h a TGA c o d o n p o s i t i o n e d 1347 n u c l e o t i d e s d o w n s t r e a m . T h e n a t i v e f o r m o f E n g A i s e x t r a c e l l u l a r a n d t h e c e n A n u c l e o t i d e s e q u e n c e p r e d i c t s a l e a d e r p e p t i d e o f 31 a m i n o a c i d s w h i c h f u n c t i o n s t o e x p o r t EngA t o t h e p e r i p l a s m o f E. c o l i (Wong e t al., 1 9 8 6 ) . B o t h 6 t h e n a t i v e a n d r e c o m b i n a n t f o r m s o f EngA h a v e b e e n p u r i f i e d t o h o m o g e n e i t y ( G i l k e s e t al., 1 9 8 4 ; L a n g s f o r d , p e r s o n a l c o m m u n i c a t i o n ; Wong, 1 9 8 6 ) . The n u c l e o t i d e s e q u e n c e p r e c e d i n g t h e ATG s t a r t c o d o n o f t h e c e n A s t r u c t u r a l g ene c o n t a i n s a p u t a t i v e r i b o s o m e - b i n d i n g s i t e (Wong, e t a l . , 1986; S h i n e a n d D a l g a r n o , 1974) w h i c h a p p e a r s t o f u n c t i o n i n E. c o l i c l o n e s h a r b o u r i n g t h e r e c o m b i n a n t g e n e ( G i l k e s e t al., 1 9 8 4 a ; Wong,et a l . , 1986 a n d W.K.R. Wong, p e r s o n a l c o m m u n i c a t i o n ) . T r a n s c r i p t i o n o f t h e cenA gene i n E. c o l i i s n o t d i r e c t e d b y t h e e n d o g e n o u s C. fimi 5' f l a n k i n g s e q u e n c e (Wong, e t a l . , 1 9 8 6 ) . The cex g e n e e n c o d e s t h e m a j o r e x o g l u c a n a s e o f C. fimi ( G i l k e s e t al., 1 9 8 4 a , b ; L a n g s f o r d e t a l . , 1 984; O ' N e i l l e t al., 1 9 8 6 a , b , c ) . I t s n u c l e o t i d e s e q u e n c e h a s b e e n d e t e r m i n e d ( O ' N e i l l , 1 9 8 6 a ) . I t e n c o d e s a p o l y p e p t i d e , E x g , o f 484 a m i n o a c i d s , i n i t i a t i n g w i t h an ATG c o d o n a n d t e r m i n a t i n g w i t h a TGA c o d o n 1452 b a s e s d o w n s t r e a m . The cex s e q u e n c e p r e d i c t s a 41 a m i n o a c i d l e a d e r p e p t i d e w h i c h f u n c t i o n s t o e x p o r t E x g t o t h e p e r i p l a s m o f E. c o l i ( G i l k e s e t al., 1 9 8 4 a ; O ' N e i l l e t al., 1986b) B o t h t h e n a t i v e a n d r e c o m b i n a n t f o r m s o f E x g h a v e b e e n p u r i f i e d t o h o m o g e n e i t y . The s e q u e n c e p r e c e d i n g t h e ATG s t a r t c o d o n o f t h e cex s t r u c t u r a l g e n e c o n t a i n s a p u t a t i v e r i b o s o m e - b i n d i n g s i t e ( O ' N e i l l e t al., 1 9 8 6 a ; S h i n e a n d D a l g a r n o , 1974) w h i c h a p p e a r s t o be f u n c t i o n i n E. c o l i c l o n e s h a r b o u r i n g t h e gene ( O ' N e i l l et al., 1 9 8 6 a a n d G. O ' N e i l l , p e r s o n a l 7 c o m m u n i c a t i o n ) . T r a n s c r i p t i o n o f t h e r e c o m b i n a n t cex gene i n E. c o l i i s n o t d i r e c t e d b y t h e e n d o g e n o u s C. fimi DNA 5' f l a n k i n g s e q u e n c e . R e p l a c e m e n t o f t h e 5' f l a n k i n g e n dogenous C. fimi DNA s e q u e n c e s w i t h a h e t e r o l o g o u s E. c o l i p r o m o t e r a n d r i b o s o m e - b i n d i n g s i t e h a s f a c i l i t a t e d e x p r e s s i o n o f E x g i n E.coli t o l e v e l s e x c e e d i n g 2 0 % o f t h e t o t a l c e l l u l a r p r o t e i n ( O ' N e i l l e t al, 1 9 8 6 b ) . The c e n B g e n e e n c o d e s t h e e n d o g l u c a n a s e B (EngB) o f C. fimi ( G i l k e s e t al., 1 9 8 4 a , ; O w o l a b i e t a l . , 1 9 8 7 ) . A l t h o u g h t h e gene h a s b e e n c l o n e d i n E. c o l i , o n l y a p a r t i a l DNA s e q u e n c e h a s s o f a r b e e n d e t e r m i n e d . I t e n c o d e s a p o l y p e p t i d e o f a b o u t 110, 000 KDa ( O w o l a b i e t al., 1988) p r e d i c t i n g a c o d i n g s e q u e n c e o f a t l e a s t 3000 bp w h i c h a p p e a r s t o i n i t i a t e w i t h an ATG c o d o n ( O w a l a b i e t al., 1 9 8 8 ) . The n u c l e o t i d e s e q u e n c e d e t e r m i n e d f o r c e n B a l s o p r e d i c t s a l e a d e r p e p t i d e o f 33 a m i n o a c i d s w h i c h f u n c t i o n s t o e x p o r t r e c o m b i n a n t EngB t o t h e p e r i p l a s m i c s p a c e i n E. c o l i ( G i l k e s e t al., 1 9 8 4 a ; O w o l a b i e t al., 1 9 8 8 ) . A t t e m p t s h a v e b e e n made t o p u r i f y n a t i v e a n d r e c o m b i n a n t EngB t o h o m o g e n e i t y ( O w o l a b i e t al., 1 9 8 8 ) . The C. fimi DNA s e q u e n c e p r e c e d i n g t h e ATG c o d o n c o n t a i n s a p u t a t i v e r i b o s o m e - b i n d i n g s i t e w h i c h a p p e a r s t o f u n c t i o n i n E. c o l i ( O w o l a b i , 1 9 8 8 ) . H o w e v e r , t r a n s c r i p t i o n o f t h e c e n B g e n e i n E. c o l i i s n o t d i r e c t e d f r o m t h e e n d o g e n o u s C. fimi 5' f l a n k i n g s e q u e n c e s ( G r e e n b e r g e t al., 1987b; O w o l a b i e t al., 1 9 8 8 ) . 8 1.4. The abg gene o f Agrobacterium s p . s t r a i n ATCC 21400 A" g r a m - n e g a t i v e , r o d - s h a p e d m e s o p h i l e , p r e v i o u s l y -c l a s s i f i e d a s Alcaligenes f a e c a l i s (Han a n d S r i n i v a s a n , 1 9 6 9 ) , was i s o l a t e d f r o m a m i x e d p o p u l a t i o n o f Cellulomonas a n d o t h e r s p e c i e s g r o w i n g on c e l l u l o s e (Han a n d S r i n i v a s a n , 1 9 6 8 , 1 9 6 9 ) . T h i s s p e c i e s , now c l a s s i f i e d b y t h e ATCC a s an Agrobacterium, p r o d u c e s a P ~ g l u c o s i d a s e w h i c h i s v e r y a c t i v e on c e l l o b i o s e (Day a n d W i t h e r s , 1 9 8 6 ; W a k a r c h u k e t al., 1986) . C. fimi p r o d u c e s a t l e a s t t w o d i f f e r e n t P~ g l u c o s i d a s e s (Wakarchuk, e t al., 1 9 8 4 ) , o f w h i c h t h e m a j o r one i s p r o b a b l y a p h o s p h o - P - D - g l u c o s i d a s e . To d a t e o n l y one o f t h e g e n e s , cbg, e n c o d i n g t h e c e l l o b i a s e C b g h a s b e e n c l o n e d a n d r e m a i n s r e l a t i v e l y u n c h a r a c t e r i z e d . The s e c o n d g ene h a s n o t y e t b e e n i s o l a t e d . However, t h e gene (abg) f o r t h e Agrobacterium P ~ g l u c o s i d a s e was c l o n e d ( W a k a r c h u k e t al., 1986) w i t h t h e h o p e o f s u p p l e m e n t i n g t h e c l o n e d C. fimi e n d o - a n d e x o c e l l u l a s e g e n e s i n a r e c o n s t r u c t e d , g e n e t i c a l l y e n h a n c e d c e l l u l o l y t i c s y s t e m . W h e r e a s t h e C. fimi c e l l o b i a s e g e n e ( s ) h a d n o t y e t b e e n w e l l c h a r a c t e r i z e d a t t h e m o l e c u l a r l e v e l , t h e abg gene h a d b e e n w e l l s t u d i e d m a k i n g abg more s u i t a b l e f o r t h e s e i n v e s t i g a t i o n s . The abg g e n e e n c o d e s a p o l y p e p t i d e , A b g , o f 459 a m i n o a c i d s i n i t i a t i n g w i t h an ATG c o d o n a n d t e r m i n a t i n g w i t h a TGA c o d o n 1377 n u c l e o t i d e s d o w n s t r e a m ( W a k a r c h u k e t al.,1988). B o t h t h e n a t i v e a n d r e c o m b i n a n t f o r m s o f t h e enzyme h a v e b e e n p u r i f i e d t o h o m o g e n e i t y , a nd t h e enzyme h a s b e e n f o u n d n o t t o 9 p o s s e s s a l e a d e r p e p t i d e . The s e q u e n c e p r e c e d i n g t h e ATG c o d o n c o n t a i n s a p u t a t i v e r i b o s o m e - b i n d i n g s i t e w h i c h f u n c t i o n s i n E. c o l i . The a d j a c e n t Agrobacterium p r o m o t e r s e q u e n c e s a p p e a r t o f u n c t i o n i n E. c o l i ( W a k a r c h u k e t al., 1986 and 1988) . The g e n e r a l f e a t u r e s o f t h e c e n A , c e x , c e n B a n d abg g e n e s a r e s u m m a r i z e d i n T a b l e 1. TABLE I . C h a r a c t e r i s t i c s o f t h e cenA, cex, cenB and abg s t r u c t u r a l g e nes #Amino A c l d s t S o u r c e o f gene Gene S t a r t ORF S t o p L e a d e r M a t u r e M r ^ codon codon p e p t i d e p e p t i d e P r e d i c t e d O b s e r v e d Cellulomonas fimi ATCC 4 84 cenA ATG 1347 TGA 31 418 43, 8 0 0 ¥ 48, 7 0 0 * cex ATG 1452 TGA 41 443 47, 100* 47, 3 0 0 * cenB ATG 3000 N/D 33 1000± N/D 110, 0 0 0 * Agrobacterium sp. ATCC 21400 abg ATG 1377 TGA N/D 459 50, 980 50, 000 — for references, see text ^ values determined from nucleotide and protein sequence data ^ i) predicted values for mature form proteins based on the cenA, cex and abg gene sequences i i ) observed values from SDS PAGE of p u r i f i e d (mature form) recombinant proteins (N.R. Gilkes, unpublished observations) ¥ mature form ( i . e . lacking leader peptide signal sequence) + predicted values (see text) N/D not determined 11 2. MATERIALS AND METHODS 2.1. B a c t e r i a l s t r a i n s , p h a g e s and p l a s m i d s A l i s t o f t h e b a c t e r i a l s t r a i n s , p l a s m i d s a n d p h a g e s u s e d i n t h e s e s t u d i e s i s g i v e n i n T a b l e I I . S t o c k c u l t u r e s o f b a c t e r i a w e r e m a i n t a i n e d a t -20 °C o r -80 °C i n LB o r M9-g l u c o s e medium c o n t a i n i n g 15% g l y c e r o l . 2.2. Enzymes and r e a g e n t s R e s t r i c t i o n e n d o n u c l e a s e s and DNA and RNA m o d i f y i n g enzymes w e r e p u r c h a s e d f r o m B e t h e s d a R e s e a r c h L a b o r a t o r i e s , I n c . , P h a r m a c i a P-L B i o c h e m i c a l s , B o e h r i n g e r - M a n n h e i m I n c . , a n d New E n g l a n d B i o l a b s . R a d i o n u c l i d e s w ere f r o m New E n g l a n d N u c l e a r (Dupont-NEN) a n d Amersham I n c . A l l o t h e r c h e m i c a l s w e r e o f r e a g e n t g r a d e o r h i g h e r a n d w e r e p u r c h a s e d f r o m c o m m e r c i a l s u p p l i e r s . 2.3. M e d i a and g r o w t h c o n d i t i o n s C. fimi S t r a i n ATCC 4 84 was grown i n b a s a l medium ( S t e w a r t a n d L e a t h e r w o o d , 1976) s u p p l e m e n t e d w i t h 0.2% (w/v) g l y c e r o l , 0.2% (w/v) g l u c o s e , 1.0% (w/v) CMC ( S i g m a ; l o w v i s c o s i t y ) as c a r b o n s o u r c e (s) . E. c o l i s t r a i n s w e r e g r o w n i n 2 X YT medium ( M e s s i n g , 1983) o r M 9 - g l u c o s e medium ( M i l l e r , 1 9 7 2 ) . Agrobacterium sp. S t r a i n ATCC 21400 was g r o w n i n l o w s a l t - L B ( LSLB) medium w h i c h c o n t a i n e d p e r l i t r e : 0.5 g N a c l , 5 g B a c t o - y e a s t e x t r a c t and 10 g B a c t o - t r y p t o n e . 12 Table I I . B a c t e r i a l s t r a i n s , phages and plasmids B a c t e r i a l s t r a i n Genotype Reference ATCC 4 84 ATCC 21400 E. coli JM83 E. coli JM101 c e l l u l o s e u t i l i z a t i o n Stackebrandt and Kandler,1979. aba Han and S r i v i n a s a n , 1969 ar a A(lac-proAB) r p s L 08O 1&£ZAM15 Yanisch-Perron e t a l . , 1985 SUpE t h i A(lac-proAB) [F' tmD36 proAB l a s i q lacZAM15] Yanisch-Perron e t a l . , 1985 Phage Gen e t i c c h a r a c t e r i s t i c s Reference M13mp8::BamO.8kb M13npll X.CI857 cenA  l a c £lindlts857 S_am7 Wong, 1987 Messing, 1983 Man i a t i s et a l . , 1982 Plasmid Genetic c h a r a c t e r i s t i c s Reference pABG5 r Ap 1 ar.Z • aba Wakarchuk et a l . , 1988 pBR322 r Ap r Tc B o l i v a r , et a l . 197 7 pEC2.1 r Ap cenA Wong et a l . , 198 6 pTZ190-B r Ap lacZ • o r i f1 aba Wakarchuk, 1987 pUC12 r Ap l a c Z ' Messing, 1983 pOC12A25 r Ap las.z• £eji2585 O ' N e i l l , 1986 pDC13 r Ap la c Z ' Messing, 1983 pUC13Bam31 r Ap l a c Z ' Acex397 O ' N e i l l , 1986 pOC13A9R5 r Ap 1acZ'aba Wakarchuk, 1987 pUC18 r Ap lacZ ' Yanisch-Perron et a l . , pUC19 r Ap la£Z ' Yanisch-Perron et a l . . pUC19C3PS r Ap l i C Z ' cenB Owolabi, 1988 13 A l l s t r a i n s w e r e grown a t 30'C, e x c e p t where o t h e r w i s e i n d i c a t e d . When s o l i d medium was r e q u i r e d , a g a r ( D i f c o L a b o r a t o r i e s ) was a d d e d t o 1.5% (w/v) e x c e p t f o r b a s a l medium c o n t a i n i n g CMC, i n w h i c h 1.0% a g a r was u s e d . When -1 a p p r o p r i a t e , a m p i c i l l m (Sigma) was a d d e d t o 100 |lg ml i n l i q u i d o r s o l i d medium. 2.4. R N a s e - f r e e work C h e m i c a l s a n d r e a g e n t s u s e d f o r RNA work were p u r c h a s e d s o l e y f o r t h i s p u r p o s e a n d were k e p t s e p a r a t e f r o m r e g u l a r l a b o r a t o r y s u p p l i e s . A l l g l a s s s w a r e u s e d f o r RNA work was e i t h e r b a k e d a t 300 'C f o r 3 h o r was b o u g h t as d i s p o s a b l e l a b w a r e . When a p p r o p r i a t e , s o l u t i o n s were t r e a t e d w i t h 0.2% (v/v) d i e t h y l p y r o c a r b o n a t e as d e s c r i b e d p r e v i o u s l y ( E h r e n b e r g e t al., 1976; M a n i a t i s e t al., 1 9 8 2 ) . A l l p l a s t i c s ( p i p e t t e t i p s a n d m i c r o f u g e t u b e s ) w e r e s t e r i l i z e d b y a u t o c l a v i n g w i t h o u t f u r t h e r p r e t r e a t m e n t . 2.5. RNA e x t r a c t i o n RNA was p r e p a r e d f r o m a l l b a c t e r i a l s t r a i n s b y a m o d i f i c a t i o n o f p u b l i s h e d p r o c e d u r e s ( s e e M i l l e r e t al., 1 9 8 1 ; K e n n e l l a n d B i c k n e l l , 1 9 7 3 ; G r e e n b e r g e t al., 1 9 8 7 ) . B r i e f l y , c u l t u r e s (up t o 100 ml) were r a p i d l y c h i l l e d on i c e a n d w e r e t r a n s f e r e d t o p r e - c h i l l e d c e n t r i f u g e t u b e s (-20°C). C e l l s w e r e r e c o v e r e d b y c e n t r i f u g a t i o n f o r 5 m i n a t 6,000 x g. C e l l s w e r e t h e n r e s u s p e n d e d i n 1/25 t o 1/10 v o l u m e o f 50 14 mM T r i s - H C l (pH 6.8 at 20"C)-2 mM EDTA-1.0% SDS, t r a n s f e r e r ! t o a c l e a n c e n t r i f u g e tube and p l a c e d immediately i n t o a b o i l i n g water bath f o r up to 2 min. The tubes were c h i l l e d on i c e f o r 5 min and 1/2 v o l of i c e - c o l d 5M NaCI was added and mixed b r i e f l y on a Vortex mixer. A f t e r 5 min on i c e , the r e s u l t a n t s l u r r y was c e n t r i f u g e d f o r 10 min at 10,000 x g and the c l e a r e d supernatant f l u i d was decanted t o a 30 ml Corex (Corning G l a s s Works) g l a s s tube. The n u c l e i c a c i d s were p r e c i p i t a t e d w i t h 2.5 v o l s of 95% e t h a n o l at -20°C f o r 12 to 16 h and r e c o v e r e d by c e n t r i f u g a t i o n f o r 20 min at 10,000 x g. The p e l l e t s were washed w i t h 70% e t h a n o l at -20 °C and r e d i s s o l v e d i n 0.4 to 2.0 ml of 10 mM T r i s - H C l (pH 7.5)-40 mM Nacl-5 mM M g C l 2 . Samples were t r e a t e d w i t h 5 u n i t s of RQ1 DNasel (Promega) f o r 15 min at 37°C, EDTA was added to 5 mM and the mixture was e x t r a c t e d twice w i t h p h e n o l - c h l o r o f o r m (1:1) and once w i t h c h l o r o f o r m . The o r g a n i c phases were combined and back e x t r a c t e d w i t h 0.2 t o 2 ml of TE (pH 7.5). The aqueous phases were p o o l e d and RNA was r e c o v e r e d by p r e c i p i t a t i o n w i t h 2.5 t o 3 v o l s o f 95% e t h a n o l and c e n t r i f u g a t i o n f o r 10 min at 10, 000 x g. The p e l l e t s were washed w i t h 70% e t h a n o l and r e d i s s o l v e d i n 20 mM NaPO^ (pH 6 . 5 ) - l mM EDTA (RNA storage b u f f e r ) . The RNA p r e p a r a t i o n s were compared f o r s i m i l a r banding p a t t e r n s a f t e r a n a l y t i c a l e l e c t r o p h o r e s i s on agarose g e l s and subsequent s t a i n i n g with e t h i d i u m bromide. RNA c o n c e n t r a t i o n s were determined by A0(-n, and samples were d i v i d e d i n t o a l i q u o t s and s t o r e d at 15 -70°C. 2.6. DNA e x t r a c t i o n a n d p u r i f i c a t i o n P l a s m i d DNA was i s o l a t e d by a m o d i f i c a t i o n o f t h e a l k a l i n e -l y s i s p r o c e d u r e ( B i r n b o i m a n d D o l y , 197 9 ) . When r e q u i r e d f o r t h e p r e p a r a t i o n o f h i g h s p e c i f i c - a c t i v i t y p r o b e s , DNA was f u r t h e r p u r i f i e d b y c e n t r i f u g a t i o n t o e q u i l i b r i u m i n C s C l d e n s i t y g r a d i e n t s c o n t a i n i n g e t h i d i u m b r o m i d e ( M a n i a t i s e t a l , 1 9 8 2 ) . 32 2.7. P r e p a r a t i o n o f P l a b e l e d DNA To e n d - l a b e l DNA r e s t r i c t i o n f r a g m e n t s , p l a s m i d DNA was d i g e s t e d w i t h r e s t r i c t i o n e n z y m e a t t h e t e m p e r a t u r e recommended b y t h e s u p p l i e r . D i g e s t i o n s w e r e m o n i t o r e d b y a g a r o s e g e l e l e c t r o p h o r e s i s . D i g e s t e d DNA was e x t r a c t e d t w i c e w i t h p h e n o l - c h l o r o f o r m (1:1) a n d p r e c i p i t a t e d w i t h 95% e t h a n o l . F o r 5' e n d - l a b e l i n g r e a c t i o n s , t h e DNA was t r e a t e d w i t h c a l f i n t e s t i n a l a l k a l i n e p h o s p h a t a s e ( C I A P ) a n d t h e n l a b e l e d w i t h [ y - 3 2 P ] - A T P ( 3 , 0 0 0 - 7 , 0 0 0 C i m m o l - 1 ) a n d T4 p o l y n u c l e o t i d e k i n a s e (PNK) as d e s c r i b e d p r e v i o u s l y ( M a n i a t i s e t al., 1 9 8 2 ) . The 3' ends w e r e l a b e l e d w i t h an a p p r o p r i a t e 32 -1 [a- P] dNTP (3,000 C i mmol ) and t h e K l e n o w f r a g m e n t o f DNA p o l y m e r a s e I a s d e s c r i b e d p r e v i o u s l y ( M a n i a t i s e t al., 1 9 8 2 ) . F o r n i c k - t r a n s l a t i o n s , p l a s m i d DNA was i n c u b a t e d w i t h DNase 32 I a n d [a- JdNTPs a n d DNA p o l y m e r a s e l a n d r e c o v e r e d f r o m S e p h a d e x G50 c o l u m n s a s d e s c r i b e d p r e v i o u s l y ( M a n i a t i s e t 16 al., 1 9 8 2 ) . I n c o r p o r a t i o n o f l a b e l was m o n i t o r e d by l i q u i d s c i n t i l l a t i o n s p e c t r o m e t r y i n a n I S O C A P - 3 0 0 ( N u c l e a r C h i c a g o ) . 2.8. P r e p a r a t i o n o f h y b r i d i s a t i o n p r o b e s 32 P - e n d - l a b e l e d dsDNA was d i g e s t e d w i t h a n a p p r o p r i a t e r e s t r i c t i o n e n d o n u c l e a s e t o l i b e r a t e f r a g m e n t s u n i q u e l y l a b e l e d a t one e n d ( s t r a n d s p e c i f i c ) . The d i g e s t i o n s w e r e r o u t i n e l y p e r f o r m e d u n d e r c o n d i t i o n s r e c o m m e n d e d b y t h e s u p p l i e r s . The h y b r i d i s a t i o n p r o b e s w e r e p u r i f i e d b y e l e c t r o p h o r e s i s i n 5% p o l y a c r y l a m i d e g e l s , e l e c t r o e l u t i o n and p r e c i p i t a t i o n w i t h e t h a n o l as d e s c r i b e d p r e v i o u s l y ( M a n i a t i s -1 et al., 1982) . I n some i n s t a n c e s , y e a s t t R N A (20 (ig m l ) was a d d e d as c a r r i e r i n t h e f i n a l p r e c i p i t a t i o n . P e l l e t s w e r e w a s h e d w i t h 7 0 % e t h a n o l , d r i e d b r i e f l y i n a i r , a n d r e d i s s o l v e d i n TE (pH 7.5) . S a m p l e s w e r e r e m o v e d f o r q u a n t i t a t i o n b y l i q u i d s c i n t i l l a t i o n c o u n t i n g . T y p i c a l 6 7 — 1 s p e c i f i c a c t i v i t i e s w e r e 5 x 10 t o 1 x 10 cpm |lg o f DNA p r o b e . 2.9. DNA S e q u e n c i n g and s e q u e n c e a n a l y s i s DNA was s e q u e n c e d b y t h e b a s e - s p e c i f i c c h e m i c a l c l e a v a g e m e t h o d (Maxam a n d G i l b e r t , 1 9 8 0 ) . S e q u e n c e s w e r e a n a l y s e d w i t h t h e SEQNCE p r o g r a m d e v e l o p e d b y D e l a n e y S o f t w a r e ( V a n c o u v e r , B r i t i s h C o l u m b i a , C a n a d a ) on a n A m d a h l ™ - V8 M a i n f r a i m (UBC C o m p u t i n g C e n t r e ) o r w i t h t h e DNA I n s p e c t o r I I p r o g r a m ( T e x t c o , W e s t L e b a n o n , N.H., USA) o n an A p p l e ™ 17 Macintosh™ SE m i c r o c o m p u t e r . 2.10. DNA m o l e c u l a r w e i g h t s t a n d a r d s To p r e p a r e dsDNA m o l e c u l a r w e i g h t s t a n d a r d s , lambda DNA was d i g e s t e d w i t h H i n d i I I a n d l a b e l e d a t t h e 3 ' - t e r m i n i a s d e s c r i b e d a b o v e . To p r e p a r e s s D N A m o l e c u l a r w e i g h t s t a n d a r d s , M 1 3 m p l l ssDNA was d i g e s t e d w i t h H a e l l l ( s e e v o n G a b a i n et al., 1983) a n d t h e n 5 1 - e n d l a b e l e d a s d e s c r i b e d a b o v e . F r a g m e n t s i z e s w e r e d e t e r m i n e d f r o m p u b l i s h e d n u c l e o t i d e s e q u e n c e s ( v a n Wezenbeek e t al., 1 9 8 0 ; Y a n i s c h -P e r r o n e t al., 1 9 8 5 ) . The 5 2 5 - b a s e f r a g m e n t o f M 1 3 m p l l a r i s e s f r o m p a r t i a l d i g e s t i o n ( G r e e n b e r g e t al., 1 9 8 7 a , b ) . 2.11. N o r t h e r n b l o t a n a l y s i s F o r N o r t h e r n (RNA b l o t ) a n a l y s i s , 20 |ig o f t o t a l RNA were p r e c i p i t a t e d w i t h e t h a n o l , r e d i s s o l v e d i n 10 | l l o f 30 mM MOPS-1 mM EDTA-5mM s o d i u m a c e t a t e ( r u n n i n g b u f f e r [pH 7] w i t h 5 0 % f o r m a m i d e a n d 2.2 M f o r m a l d e h y d e , h e a t e d f o r 15 m i n a t 68°C, a n d c o o l e d b r i e f l y on i c e . L o a d i n g d y e was a d d e d ( t o g i v e 3% [w/v] F i c o l l [ P h a r m a c i a ] a n d 0.02% [w/v] b r o m p h e n o l b l u e a n d x y l e n e c y a n o l ) a n d s a m p l e s w e r e e l e c t r o p h o r e s e d 32 a l o n g s i d e P - l a b e l e d m o l e c u l a r w e i g h t m a r k e r s i n 1.0% a g a r o s e - 6 . 6 % f o r m a l d e h y d e g e l s a t 20 t o 40 mA w i t h r e c i r c u l a t i o n o f r u n n i n g b u f f e r . N u c l e i c a c i d s w e r e b l o t t e d t o B i o T r a n s membranes ( P a l l , I n c . ) i n 20X SSC ( I X SSC i s 0.15 M NaCI p l u s 0.15 M s o d i u m c i t r a t e ) f o r 12 t o 16 h ( S o u t h e r n , 18 1 9 7 5 ) , a n d t h e membranes w e r e a l l o w e d t o d r y i n a i r a n d t h e n b a k e d a t 80°C f o r 1 t o 2 h . P r e h y b r i d i s a t i o n s a n d h y b r i d i s a t i o n s w e r e p e r f o r m e d e s s e n t i a l l y b y t h e p r o t o c o l s s u p p l i e d w i t h t h e membranes. B r i e f l y , p r e h y b r i d i s a t i o n s were d o n e i n 5X S S C - 5 0 % f o r m a m i d e - 4 m M P P . - 5 X D e n h a r d t b u f f e r I ( M a n i a t i s e t a l . , 1982) 1 0 % d e x t r a n s u l f a t e - 2 5 0 j i g o f h e a t _ i d e n a t u r e d (100°C f o r 5 m i n ) s a l m o n s p e r m DNA m l I n c u b a t i o n s w e r e f o r 1- 2 h a t 42°C w i t h c o n s t a n t a g i t a t i o n . -1 F o r h y b r i d i s a t i o n s , t h e p r o b e DNA (2 t o 10 n g m l ) a n d c a r r i e r w e r e d e n a t u r e d t o g e t h e r b y h e a t i n g . The p r o b e s w e r e a l l o w e d t o h y b r i d i s e t o f i l t e r s f o r 16 t o 24 h a t 42°C w i t h c o n s t a n t a g i t a t i o n . B l o t s w e r e w a s h e d a t 22 °C w i t h t h r e e c h a n g e s o f 2X SSC- 0.1% SDS a n d t h e n a t 60 °C w i t h t h r e e c h a n g e s o f 0.1X SSC- 0.1% SDS, d r i e d t o Whatman 3MM p a p e r u n d e r vacuum a n d e x p o s e d t o X - r a y f i l m (Eastman Kodak Co.) a t -70°C w i t h i n t e n s i f y i n g s c r e e n s . 2.12. I n v i t r o c a p l a b e l i n g o f RNA To c h a r a c t e r i s e p r i m a r y t r a n s c r i p t s , t o t a l C. fimi RNA f r o m CMC-grown c u l t u r e s was l a b e l e d in vitro a t t h e 5' e n d by u s i n g t h e v a c c i n i a v i r u s c a p p i n g enzyme, g u a n y l y l t r a n s f e r a s e , a s d e s c r i b e d p r e v i o u s l y ( M o s s , 1 9 8 1 ; W i c h e t a l . , 1 9 8 6 ) . B r i e f l y , up t o 60 |lg o f t o t a l C. fimi RNA were l a b e l e d i n 0.1 ml m i x t u r e s c o n t a i n i n g 25 mM T r i s - H C l (pH 7. 5 ) - 2 mM M g C l 2 - l mM d i t h i o t h r e i t o l - 2 5 0 |0.Ci o f [ 0 C- 3 2P]-GTP (3, 000 C i m m o l " 1 ) -10 t o 25 u n i t s o f g u a n y l y l t r a n s f e r a s e . A f t e r 30 min a t 37°C 19 t h e r e a c t i o n was s t o p p e d b y t h e a d d i t i o n o f EDTA t o 4mM a n d SDS t o 0.2%. The RNA was e x t r a c t e d t w i c e w i t h p h e n o l -c h l o r o f o r m (1:1) a n d p r e c i p i t a t e d t w i c e f r o m e t h a n o l i n t h e p r e s e n c e o f 2M ammonium a c e t a t e . The RNA was f i n a l l y r e c o v e r e d b y e t h a n o l p r e c i p i t a t i o n f r o m 0.3M s o d i u m a c e t a t e . 5 5 T y p i c a l s p e c i f i c a c t i v i t i e s w e r e 1 X 10 t o 3 X 10 cpm |ig R N A - 1 . 2.13. H y b r i d p r o t e c t i o n a n a l y s i s The mRNA 5' a n d 3' t e r m i n i w e r e mapped w i t h l a b e l e d DNA p r o b e s e s s e n t i a l l y a s p r e v i o u s l y d e s c r i b e d ( F a v a l o r o e t a l . , 1 9 8 0 ; B e r k a n d S h a r p , 1977, 1978; Weaver a n d W e i s s m a n , 197 9) . Up t o 30 j i g o f RNA were p r e c i p i t a t e d w i t h e n d - l a b e l e d DNA p r o b e , r e d i s s o l v e d i n 30 j l l o f h y b r i d i s a t i o n b u f f e r (0.4 M N a C l - 0 . 0 4 M s o d i u m p h o s p h a t e [pH 6.5]-0.4mM EDTA-80% f o r m a m i d e ) , h e a t e d f o r 15 m i n a t 85°C, a n d h e l d a t 60°C (C. fimi) o r 49°C (Agrrojbacterium) f o r 3 h. S a m p l e s w e r e r a p i d l y d i l u t e d w i t h 300 |Hl o f i c e - c o l d S I b u f f e r (30 mM s o d i u m a c e t a t e [pH 4 . 5 ] - 2 8 mM N a C l - 4 . 5 mM Z n S 0 4 ) a n d t r e a t e d w i t h a b o u t 1000 u n i t s o f S I n u c l e a s e f o r 30 m i n a t 37°C. The r e a c t i o n s w e r e t e r m i n a t e d b y t h e a d d i t i o n o f 75 ( l l o f s t o p b u f f e r (2.5mM ammonium a c e t a t e - 5 0 m M EDTA), a n d 20 \ig y e a s t t R N A w e r e a d d e d . The u n d i g e s t e d n u c l e i c a c i d s w e r e p r e c i p i t a t e d w i t h 400 [ l l o f i s o p r o p a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . When c a p p e d RNA a n d u n l a b e l e d DNA p r o b e s w e r e u s e d i n t h e m a p p i n g e x p e r i m e n t s , t h e p r o c e d u r e was m o d i f i e d a s f o l l o w s 20 ( W h i c h e t a l . , 1986) : up t o 50 Jig o f c a p p e d RNA were p r e c i p i t a t e d w i t h up t o 500 ng o f u n l a b e l e d DNA p r o b e , r e d i s s o l v e d i n h y b r i d i s a t i o n b u f f e r , h e a t e d t o 8 5 ° C , h e l d a t t h e a p p r o p r i a t e h y b r i d i s a t i o n t e m p e r a t u r e f o r 3 h and t h e n t r e a t e d w i t h SI n u c l e a s e as d e s c r i b e d a b o v e . A f t e r t h e SI t r e a t m e n t , t h e 0 .33 ml samples were i n c u b a t e d w i t h 25 ng o f RNaseA f o r 15 m i n a t 22 °C t o r e d u c e t h e b a c k g r o u n d o f u n h y b r i d i s e d , l a b e l e d RNA. T h i s r e a c t i o n was t e r m i n a t e d by t h e a d d i t i o n o f SDS t o 0.25% and two e x t r a c t i o n s w i t h p h e n o l -c h l o r o f o r m ( 1 : 1 ) . T r i m m e d h y b r i d s we re r e c o v e r e d by p r e c i p i t a t i o n w i t h e t h a n o l . A f t e r e i t h e r o f t h e s e p r o c e d u r e s , p e l l e t s were d i s s o l v e d i n s e q u e n c i n g dye b u f f e r (90% formamide , 0.02% [w/v] b rompheno l b l u e and x y l e n e c y a n o l ) ( M a n i a t i s e t a l . , 1982) and h e a t e d t o 9 0 ' C f o r 2 m i n . The r e d i s s o l v e d samples were f r a c t i o n a t e d i n p o l y a c r y l a m i d e g e l s w i t h a p p r o p r i a t e s i z e marke r s (see f i g u r e l e g e n d s ) . The g e l s were d r i e d t o Whatman 3MM f i l t e r p a p e r and e x p o s e d t o X - r a y f i l m (Eas tman Kodak) a t - 7 0 ° C w i t h i n t e n s i f y i n g s c r e e n s . 2 . 1 4 . S y n t h e t i c o l i g o d e o x y r i b o n u c l e o t i d e h y b r i d i s a t i o n p robes The o l i g o d e o x y r i b o n u c l e o t i d e 30-mers u s e d i n t h e s e s t u d i e s ( T a b l e I I I ) we re s y n t h e s i s e d c h e m i c a l l y on an A p p l i e d B i o s y s t e m s 380A DNA S y n t h e s i s e r by Tom A t k i n s o n u s i n g p h o s p h i t e t r i e s t e r c h e m i s t r y , e s s e n t i a l l y as d e s c r i b e d ( A t k i n s o n and S m i t h , 1984 ) . The o l i g o d e o x y r i b o n u c l e o t i d e 30 -21 TABLE I I I . O l i g o d e o x y r i b o n u c l e o t i d e h y b r i d i s a t i o n p r o b e s Gene O l i g o d e o x y r i b o n u c l e o t i d e p r o b e s e q u e n c e cenA 5' CAGCGCTGCGGCGGTTCTGCGGGTGGACAT 3' cex 5' GTGGCCGGGTGCGGGCGTGGTCCTAGGCAT 3' cenB 5' GACGAGCGTGCGTGGGACTTGGCGGAGCAT 3' 22 m e r s w e r e s e p a r a t e d f r o m i n c o m p l e t e s y n t h e s i s p r o d u c t s b y e l e c t r o p h o r e s i s i n a 1 6 % p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l , l o c a t e d b y U V - s h a d o w i n g , a n d e x t r a c t e d f r o m t h e g e l by t h e c r u s h a n d s o a k m e t h o d ( A t k i n s o n a n d S m i t h , 1 9 8 4 ) . O l i g o m e r s w e r e t h e n f u r t h e r p u r i f i e d b y r e v e r s e - p h a s e c h r o m a t o g r a p h y u s i n g Sep-Pak C^g c a r t r i d g e s ( M i l l i p o r e / W a t e r s A s s o c . , M i l f o r d , MA), a n d e l u t i o n w i t h 2 0 % a c e t o n i t r i l e - 8 0 % w a t e r . The p u r i f i e d o l i g o m e r s w e r e l y o p h i l i s e d t h e n s t o r e d a t -20°C. F o r 5' e n d - l a b e l i n g , 20 | l l r e a c t i o n m i x t u r e s c o n t a i n i n g 250 n g o f o l i g o m e r i n s t e r i l e d i s t i l l e d w a t e r ( a b o u t 10 | l l ) , 2 f l l b u f f e r (500 mM T r i s - H C l [pH 8 ] - 5 0 0 mM N a C l - 1 0 0 mM M g C l 2 ) , 250 | i C i [ y - 3 2 P ] - A T P a n d 10 u n i t s o f T4 p o l y n u c l e o t i d e k i n a s e were i n c u b a t e d a t 37°C f o r 30 m i n . The l a b e l e d o l i g o m e r s were r e c o v e r e d f r o m S e p h a d e x G-50 c o l u m n s a n d s t o r e d f r o z e n a t -20°C u n t i l n e e d e d . S p e c i f i c a c t i v i t i e s w ere d e t e r m i n e d b y l i q u i d s c i n t i l l a t i o n s p e c t r o m e t r y i n an ISOCAP 300 ( N u c l e a r C h i c a g o ) . . 2.15. S l o t B l o t H y b r i d i s a t i o n s The S c h l i e c h e r & S c h u e l l Minifold™ I I (SRC 072/0) m i c r o -s a m p l e f i l t r a t i o n m a n i f o l d was u s e d f o r t h e q u a n t i t a t i o n o f s p e c i f i c RNAs i n s a m p l e s . A l l s a m p l e s were d i s s o l v e d i n 100 (XI o f D E P C - t r e a t e d d H 2 0 a n d 300 | l l o f a s o l u t i o n o f 6.15M f o r m a l d e h y d e - l O X SSC, t h e n i n c u b a t e d a t 65 °C f o r 15 m i n . P l a s m i d DNA s t a n d a r d s ( d i l u t e d w i t h 10X S S C - 6 . 1 5 M f o r m a l d e h y d e ) were b r o u g h t t o 4 |ig t o t a l w e i g h t w i t h c a r r i e r 23 RNA. E a c h 4 |ig s a m p l e was l o a d e d i n t o a w e l l o f t h e m a n i f o l d u n d e r vacuum ( a c c o r d i n g t o t h e m e t h o d o f G. W a h l , t e c h n i c a l b u l l e t i n #371 a c c o m p a n y i n g t h e M i n i f o l d I I , S & S ™ , 1983) . S a m p l e s w e r e w a s h e d w i t h 400 | l l o f 10X SSC a n d t h e B i o T r a n s membrane f i l t e r ( P a l l , I n c . ) was a i r d r i e d a n d t h e n b a k e d a t 80 °C f o r 1 t o 2 h. P r e h y b r i d i s a t i o n s w e r e f o r 1 t o 2 h a t 55°C i n 1 m l o f 6X SSC-5X D e n h a r d t ' s s o l u t i o n ( M a n i a t i s e t 2 a l . , 1982) p e r 25 cm o f membrane. H y b r i d i s a t i o n s w e r e f o r 16 t o 24 h a t 55°C w i t h 1 X 1 0 6 cpm o f 3 2 P - l a b e l e d o l i g o n u c l e o t i d e p r o b e m l 1 . The p r e h y b r i d i s a t i o n s a n d h y b r i d i s a t i o n s were p e r f o m e d i n h e a t s e a l e d Seal-a-meal™ b a g s ( S e a r s , I n c . ) u n d e r a sponge i n a w a t e r - f i l l e d p o l y p r o p e l y n e b o x s u b m e r g e d i n a w a t e r b a t h . F i l t e r s w e r e w a s h e d a t room t e m p e r a t u r e (22°C) w i t h 6X SSC f o l l o w e d b y w a s h i n g s a t 60°C w i t h one c h a n g e e a c h o f 2X SSC/ 0.1% SDS, I X SSC/ 0.1% SDS a n d 0.1X SSC/ 0.1% SDS. F i l t e r s w e r e w r a p p e d i n Saran-Wrap™ a n d e x p o s e d t o X - r a y f i l m (Kodak) w i t h i n t e s i f y i n g s c r e e n s a t -70°C. D e v e l o p e d a u t o r a d i o g r a m s w e r e s c a n n e d w i t h a H e l e n a I n d u s t r i e s Q u i c k Scan i n t e g r a t i n g d e n s i t o m e t e r (model 1 1 1 1 ) . 24 3. R e s u l t s 3.1. C h a r a c t e r i z a t i o n o f t h e cenA t r a n s c r i p t s o f C. fimi. 3.1.1. R e g u l a t i o n b y c a r b o n s o u r c e a n d a p p r o x i m a t e l e n g t h o f cenA mRNA. A q u a l i t a t i v e n o r t h e r n b l o t a n a l y s i s was u s e d t o d e t e r m i n e t h e a p p r o x i m a t e l e n g t h o f cenA mRNA a n d t h e i n f l u e n c e o f t h e c a r b o n s o u r c e p r o v i d e d f o r C. fimi g r o w t h on cenA t r a n s c r i p t i o n . F o r t h e s e e x p e r i m e n t s , C. fimi RNA was p r e p a r e d f r o m c u l t u r e s g r o w n i n b a s a l medium s u p p l e m e n t e d w i t h e i t h e r 0.2%(w/v) g l y c e r o l ( 0.214 g e n e r a t i o n h r - 1 ) , 0.2%(w/v) g l u c o s e (0.226 g e n e r a t i o n h r - 1 ) o r 1.0%(w/v) CMC (0 . 1 9 3 g e n e r a t i o n h r - 1 ) . The i n t r a g e n i c 123 bp S s t l - S a l l f r a g m e n t o f c e n A ( F i g . 1, A) was u s e d a s t h e h y b r i d i s a t i o n p r o b e . The p r o b e , i s o l a t e d f r o m p l a s m i d p N G l O l ( F i g . 2) was 5' e n d - l a b e l e d a t t h e S a i l s i t e ( F i g . 3 ) . A v e r y i n t e n s e s i g n a l was o b s e r v e d i n h y b r i d i s a t i o n s b e t w e e n C. fimi RNA e x t r a c t e d f r o m CMC-grown c e l l s a n d t h e l a b e l e d p r o b e . The s p e c i e s o f RNA d e t e c t e d b y t h e p r o b e was a p p r o x i m a t e l y 1400 b a s e s i n l e n g t h ( F i g . 4, l a n e 3 ) . A l e s s i n t e n s e s i g n a l was d e t e c t e d i n h y b r i d i s a t i o n s b e t w e e n t h e p r o b e a n d RNA f r o m g l y c e r o l - g r o w n c e l l s ( F i g . 4, l a n e 1 ) . T h i s s i g n a l a l s o c o r r e s p o n d e d t o a s p e c i e s o f RNA o f a b o u t 1 4 0 0 b a s e s i n l e n g t h . No s i g n a l was d e t e c t e d i n h y b r i d i s a t i o n s b e t w e e n t h e p r o b e a n d RNA f r o m g l u c o s e - g r o w n 25 F I G U R E 1. P a r t i a l r e s t r i c t i o n map o f t h e c e n A g e n e . R e p r e s e n t a t i o n o f t h e c l o n e d 2 . 2 - k i l o b a s e B a m H l - S m a l s e g m e n t o f C. fimi DNA c o n t a i n i n g t h e cenA g e n e . The s t r u c t u r a l gene i s shown as a b o x e d r e g i o n , a n d i s t r a n s l a t e d f r o m l e f t t o r i g h t ( 5 ' -> 3 ' ) . A, S s t l - S a l l n o r t h e r n b l o t p r o b e ; B, Smal-Sall 5' S I p r o b e ; C, Bglll-Smal 3' SI p r o b e . The r e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d a s f o l l o w s : B g , B g l l l ; Bm, B a m H l ; S a , S a i l ; Sm, Smal; S s , S s t l . Bm S m Ss Sa Sm I III I cenA C 0 500 bp 26 FIGURE 2 . S u b c l o n i n g 5 ' f l a n k i n g and t e r m i n a l cenA DNA. To f a c i l i t a t e t h e i s o l a t i o n o f cenA 5 ' - s p e c i f i c h y b r i d i s a t i o n p r o b e s ( F i g . l , A and B) , a p o r t i o n o f C. f i m i DNA was s u b c l o n e d f rom M13mp8::Bam 0 .8kb (Wong, 1986) t o t h e v e c t o r pUC18. The M13mp8::Bam 0 .8kb dsDNA was d i g e s t e d w i t h BamEl, f r a c t i o n a t e d i n a 1.0% low m e l t i n g p o i n t ( l . m . p . ) aga rose g e l and t h e 0 .75 kb BamHl f ragment was r e c o v e r e d ( M a n i a t i s e t a l . , 1 9 8 2 ) . T h i s was t h e n d i g e s t e d w i t h S a i l and l i g a t e d t o B a m H l - S a l l c u t pUC18 DNA. A m p i c i l l i n r e s i s t a n t ( A p r ) L a c -JM101 t r a n s f o r m a n t s were s c r e e n e d by m i n i - l y s a t e p l a s m i d i s o l a t i o n and s u b s e q u e n t r e s t r i c t i o n enzyme a n a l y s i s . A p l a s m i d c a r r y i n g t h e 0 .64 kb B a m H l - S a l l f ragment o f cenA i n t h e m u l t i p l e c l o n i n g s i t e (MCS) o f pUC18 was i s o l a t e d and d e s i g n a t e d p N G l O l . R e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d as f o l l o w s : Bm, BamEl; H3 , H i n d l l l ; R l , £ c o R l ; S a , S a i l ; Sm, Smal ; Ss , S s t l . Ss ATG Sa Bm Sm Bm Rl Bm Sa I 1 I -BamHl digest -isolate753 bp fragment -Sail digest -BamHl + Sail digest -ligate BamHl-Sall 635bp to BamHl-Sall cut pUC18 -transform JM101 -screen transformants Bm Sa Ss Sm Legend Vector DNA wwwwwwvw C. fimi DNA 27 FIGURE 3. I s o l a t i o n o f a cenA s p e c i f i c n o r t h e r n b l o t p r o b e . P l a s m i d p N G l O l was d i g e s t e d w i t h S a i l , t r e a t e d w i t h CIAP a n d 5 ' - e n d l a b e l e d w i t h [ y - 3 2 p ] _ A T P a n d T4 PNK. L i n e a r , e n d -l a b e l e d p l a s m i d DNA was d i g e s t e d w i t h S s t l a n d f r a c t i o n a t e d b y e l e c t r o p h o r e s i s i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 123 bp S s t l - S a l l p r o b e was e x c i s e d . The p r o b e was t h e n e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . 3181 bp 123 bp -Sail digest -CIAP -Kinase -Sstl digest -5% PA gel -Autoradiography -excise gel slice with 123 bp probe -electroelute into TAE buffer -ethanol precipitate -recover by centrifugation Legend Vector DNA ^^ ^^ xxsv».^ .^ .vc C. fimi DNA 28 F I G U R E 4. N o r t h e r n b l o t a n a l y s i s o f cenA- specif i c t r a n s c r i p t s . RNA was e x t r a c t e d f r o m C. fimi c u l t u r e s grown i n b a s a l medium s u p p l e m e n t e d w i t h g l y c e r o l , o r g l u c o s e , o r CMC, f r a c t i o n a t e d i n a f o r m a l d e h y d e g e l c o n t a i n i n g 1.0% a g a r o s e , a n d b l o t t e d t o a B i o t r a n s membrane. The b l o t was t h e n h y b r i d i s e d w i t h t h e cenA i n t r a g e n i c S s t l - S a i l p r o b e ( F i g . 1, A) l a b e l e d a t t h e 5' S a i l s i t e ( F i g . 3 ) . L a n e s : M, H a e l l l r e s t r i c t i o n f r a g m e n t s o f s i n g l e - s t r a n d e d M 1 3 m p l l , 5'-l a b e l e d w i t h 32p ( s i z e s i n n u c l e o t i d e s a r e i n d i c a t e d on t h e l e f t ) ; 1, RNA f r o m g l y c e r o l - g r o w n c e l l s ; 2, RNA f r o m g l u c o s e -grown c e l l s ; 3, RNA f r o m CMC-grown c e l l s . A r r o w i n d i c a t e s t h e m a j o r h y b r i d . > =3 O _i - i 5 M G O O 29 c e l l s ( F i g . 4, l a n e 2 ) . 3.1.2. M a p p i n g t h e cenA mRNA 5 1 e n d s . Two c o m p l e m e n t a r y h y b r i d p r o t e c t i o n s t u d i e s w e r e u s e d t o c o n f i r m t h e d i r e c t i o n o f cenA t r a n s c r i p t i o n a n d t o d e t e r m i n e t h e 5' ends o f cenA mRNA. 3 . 1 . 2 . 1 . M a p p i n g t h e cenA 5' e n d s w i t h a 5 ' - l a b e l e d DNA p r o b e . T r a n s c r i p t s s y n t h e s i z e d i n v i v o w e r e a n a l y s e d b y h i g h r e s o l u t i o n S I n u c l e a s e m a p p i n g . The 315 bp Smal-Sail DNA r e s t r i c t i o n f r a g m e n t ( F i g . 1, B) i s o l a t e d f r o m t h e p l a s m i d p N G l O l ( F i g . 5) was u s e d a s t h e h y b r i d i s a t i o n p r o b e . The p r o b e , l a b e l e d a t t h e 5' S a i l s i t e , was d e n a t u r e d i n s o l u t i o n a n d h y b r i d i s e d w i t h t o t a l C. fimi RNA a n d S I n u c l e a s e was u s e d t o d e g r a d e t h e u n p r o t e c t e d p o r t i o n s o f t h e DNA p r o b e i n any o f t h e r e s u l t i n g RNA-DNA h y b r i d s . The l e n g t h s o f t h e p r o t e c t e d p r o b e s p e c i e s s t i l l b e a r i n g t h e 32p l a b e l e d 5 ' - S a i l t e r m i n u s w e r e t h e n d e t e r m i n e d b y g e l e l e c t r o p h o r e s i s u n d e r d e n a t u r i n g c o n d i t i o n s . As s e e n i n F i g . 6, an a u t o r a d i o g r a p h o f t h e a n a l y t i c a l g e l r e v e a l e d f o u r d i s t i n c t s p e c i e s o f p r o t e c t e d p r o b e ( l a n e 6 ) . T h e s e s p e c i e s a l l mapped u p s t r e a m o f t h e cenA t r a n s l a t i o n i n i t i a t i o n c o d o n . T h r e e o f t h e s e s p e c i e s w e r e c l o s e l y s p a c e d ( F i g . 6 ; - 1 , +1, +2), t h e f o u r t h m i g r a t e d s l i g h t l y s l o w e r ( F i g . 6 ; - 1 1 ) . 30 FIGURE 5. I s o l a t i o n o f a cenA 5' m R N A - s p e c i f i c S I p r o b e . The p l a s m i d p N G l O l was d i g e s t e d w i t h S a i l , t r e a t e d w i t h CIAP a n d 5 ' - e n d l a b e l e d w i t h [y-32p]-ATP a n d T4 PNK. L i n e a r 5'-e n d l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h S m a l a n d f r a c t i o n a t e d b y e l e c t r o p h o r e s i s on a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 315 bp Smal-Sail p r o b e was e x c i s e d . The p r o b e was t h e n e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . Sm -Sail digest -CIAP -Kinase -Smal digest -5% PA gel -autoradiography 2990 bp 31$bp -excise gel slice with 31£Tbp probe -electroelute into TAE buffer -ethanol precipitate -recover by centrifugation Legend Vector DNA «\\\\\\\\\\\> C. fimi DNA 31 F I G URE 6. M a p p i n g t h e 5' e n d s o f cenA mRNA . A f t e r h y b r i d i s a t i o n w i t h RNA a n d t r e a t m e n t w i t h S I n u c l e a s e t h e r e m a i n i n g Smal-Sall p r o b e ( l a b e l e d a t t h e 5' S a i l s i t e ) was a n a l y s e d i n an 8% p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e s e q u e n c e d b y t h e b a s e - s p e c i f i c c h e m i c a l c l e a v a g e method (Maxam a n d G i l b e r t , 1 9 8 0 ) . L a n e s 1 t h r o u g h 4 c o n t a i n e d t h e c h e m i c a l s e q u e n c i n g l a d d e r s o f t h e p r o b e : G>A, G+A, T+C, a n d C>T, r e s p e c t i v e l y . N u m b ers on t h e r i g h t i d e n t i f y s p e c i e s o f p r o t e c t e d p r o b e . A. P r o t e c t i o n o f t h e S m a l - S a l l p r o b e b y : RNA f r o m g l u c o s e - g r o w n C. fimi ( l a n e 5 ) , RNA f r o m CMC-grown C. fimi ( l a n e 6 ) , and y e a s t tRNA ( l a n e 7) . B. P r o t e c t i o n o f t h e Smal-Sall p r o b e b y RNA f r o m g l y c e r o l - g r o w n c e l l s ( l a n e 5 ) . A. 8* 32 Of t h e f o u r s p e c i e s o f p r o b e o b s e r v e d when RNA f r o m CMC-grown C. fimi was u s e d i n t h e a n a l y s i s ( F i g . 6 A , l a n e 6 ) , o n l y t h e most p r o m i n e n t s p e c i e s (+1) was a l s o o b s e r v e d , a l b e i t as a r e l a t i v e l y w e a k e r s i g n a l , i n m a p p i n g s t u d i e s w i t h RNA f r o m g l y c e r o l - g r o w n C. fimi ( F i g . 6B, l a n e 5 ) . The l a b e l e d p r o b e was n o t p r o t e c t e d i n m a p p i n g s t u d i e s w i t h RNA f r o m g l u c o s e g r o w n C. fimi ( F i g . 6 A , l a n e 5) o r w i t h y e a s t t R N A ( F i g . 6 A , l a n e 7 ) . T h e s e r e s u l t s c o n f i r m e d t h o s e o f t h e n o r t h e r n b l o t e x p e r i m e n t s ( s e e s e c t i o n 3.1.1.) w h i c h h a d d e t e c t e d cenA mRNA i n t h e RNA f r o m CMC-gromwn a n d g l y c e r o l - g r o w n C. fimi, b u t n o t f r o m g l u c o s e - g r o w n C. fimi. The m o s t p r o m i n e n t p r o t e c t e d s p e c i e s , +1, mapped t o a G r e s i d u e , 51 b a s e s f r o m t h e t r a n s l a t i o n i n i t i t a t i o n c o d o n o f t h e u n p r o c e s s e d cenA gene p r o d u c t ( F i g . 7; Wong e t al., 1986) a n d 164 b a s e s f r o m t h e 3 2 p - i a b e l e d 5' end o f t h e p r o b e . 3.1.2.2. M a p p i n g t h e cenA mRNA 5' t e r m i n u s w i t h c a p p e d RNA. The h y b r i d p r o t e c t i o n s t u d y w i t h t h e S m a l - S a l l DNA p r o b e l a b e l e d a t t h e 5' S a i l s i t e ( s e c t i o n 3 . 1 . 2 . 1 . a b o v e ) c o u l d h a v e i d e n t i f i e d t h e 5' e n d s o f cenA mRNAs w h i c h w e r e e i t h e r i n t a c t o r p a r t i a l l y d e g r a d e d a t t h e i r 5' t e r m i n i . T h e r e f o r e , a s e c o n d i n d e p e n d e n t a p p r o a c h was t a k e n t o c o n f i r m t h a t p r i m a r y t r a n s c r i p t i n i t i a t i o n s i t e s h a d b e e n i d e n t i f i e d f o r c e n A mRNA. T o t a l RNA f r o m CMC-grown C. fimi was l a b e l e d in v i t r o w i t h t h e v a c c i n i a v i r u s g u a n y l y l t r a n s f e r a s e enzyme w h i c h o n l y r e c o g n i z e s t h o s e RNAs p o s s e s s i n g 5' d i - o r t r i -33 5 ' - > 3 + 1 =======> =======> AAATCCTCATCCGCTCGCGCCGTGGGGCATTCGTCGGGTTTCCTCGTCGGG cenApl > cenAp2 ACCCGCACGACGAGCGTGCCACGAGGCCCGAACCCAGGGAGCTCCTTGJiTG < ***** RBS FIGURE 7 . DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5 ' - t e r m i n a l r e g i o n o f c e n A mRNA. O n l y t h e s e n s e s t r a n d i s shown. The v e r t i c a l a r r o w s d e n o t e t h e 3 ' n u c l e o t i d e s o f t h e p r o t e c t e d f r a g m e n t s o f t h e 5 ' S I p r o b e . The ATG c o d o n i s o u t l i n e d . A p u t a t i v e r i b o s o m e b i n d i n g s i t e (RBS) i s u n d e r s c o r e d w i t h a s t e r i s k s . The p u t a t i v e cenApl a n d cenAp2 p r o m o t e r r e g i o n s a r e u n d e r l i n e d . A d i r e c t r e p e a t i s o v e r s c o r e d w i t h t h i c k a r r o w s a n d an i n v e r t e d r e p e a t i s u n d e r s c o r e d w i t h t h i n a r r o w s . 34 p h o s p h a t e s ( i . e . t h e i n t a c t 5' e n d s o f p r i m a r y t r a n s c r i p t s ) a s s u i t a b l e r e c e p t o r s i n a c a p p i n g r e a c t i o n ( F i g . 8 ) . By u s i n g [ f X -32p]-GTP a s t h e d o n o r i n t h e c a p p i n g r e a c t i o n , p r i m a r y t r a n s c r i p t s w h i c h h a d b e e n i s o l a t e d in vivo, w e r e t h e r e b y 5' l a b e l e d in vitro. The RNA p r e p a r e d f r o m CMC-grown C. fimi was u s e d i n t h e c a p p i n g e x p e r i m e n t s s i n c e s u c h p r e p a r a t i o n s h a d b e e n shown t h r o u g h n o r t h e r n b l o t a n d S I s t u d i e s t o be e n r i c h e d f o r cenA mRNA. To map t h e cenA mRNA 5' e n d b y e x p l o i t i n g t h e s u b s t r a t e s p e c i f i c i t y o f t h e c a p p i n g e n z yme i n t h e RNA l a b e l i n g r e a c t i o n , t h e Smal-Sall p r o b e ( F i g . l , B) was t e s t e d f o r i t s a b i l i t y t o p r o t e c t a b o u t 164 b a s e s o f t h e 5' e n d o f a c a p p e d RNA s p e c i e s f r o m n u c l e a s e d i g e s t i o n . T h i s s i z e was p r e d i c t e d f r o m t h e d i s t a n c e b e t w e e n t h e +1 s i t e i d e n t i f i e d i n F i g . 6 and t h e S a i l e n d o f t h e p r o b e . A p r o t e c t e d f r a g m e n t o f a b o u t t h i s s i z e was i n d e e d o b s e r v e d a f t e r n u c l e a s e d i g e s t i o n o f t h e RNA-DNA h y b r i d s ( F i g . 9, l a n e 2) w h i c h was c o n s p i c u o u s l y a b s e n t i n t h e c o n t r o l ( F i g . 9, l a n e 1, RNA w i t h o u t p r o b e ) . The s l i g h t l y s l o w e r m i g r a t i o n o f t h e c a p p e d t r a n s c r i p t may be e x p l a i n e d b y t h e p r e s e n c e o f t h e 5' c a p s t r u c t u r e ( G 5 ' p p p 5 ' N p . . ) . S i n c e i n t h i s e x p e r i m e n t a s p e c i e s o f p a r t i a l l y p r o t e c t e d c a p p e d RNA c o r r e s p o n d i n g t o t h e h i g h e r (-11) b a n d o b s e r v e d i n F i g . 6 was n o t d e t e c t e d , t h e S I map p i n g d a t a a t b e s t s u g g e s t s t h e p o s s i b i l i t y o f a -11 s t a r t s i t e ( s e e d i s c u s s i o n s e c t i o n ) . 35 FIGURE 8. H y b r i d p r o t e c t i o n w i t h c a p p e d RNA. A. The r e a c t i o n c a t a l y s e d b y t h e v a c c i n i a v i r u s g u a n y l y l t r a n s f e r a s e enzyme b e t w e e n a [ a-32p]-QTP d o n o r a n d a t y p i c a l p r o c a r y o t i c RNA p r i m a r y t r a n s c r i p t . T h i s r e s u l t s i n a ' c a p p e d 1 RNA s p e c i e s , u n i q u e l y l a b e l e d a t t h e 5' t e r m i n u s ( a d a p t e d f r o m Moss, 1981) . B. S c h e m a t i c r e p r e s e n t a t i o n o f a h y b r i d p r o t e c t i o n a n a l y s i s u s i n g a s u i t a b l e DNA p r o b e t o map t h e 5' t e r m i n u s o f a c a p p e d RNA. The c a p p e d RNA i s a l l o w e d t o h y b r i d i s e t o t h e DNA p r o b e . A f t e r t r e a t m e n t w i t h S I n u c l e a s e a n d RNaseA t h e r e s u l t i n g h y b r i d s a r e s u b j e c t e d t o e l e c t r o p h o r e t i c a n a l y s i s i n a d e n a t u r i n g p o l y a c r y l a m i d e g e l . A u t o r a d i o g r a p h y r e v e a l s t h e s i z e o f t h e p r o t e c t e d c a p p e d RNA r e l a t i v e t o m a r k e r s r u n i n p a r a l l e l . T h i s d e t e r m i n e s t h e d i s t a n c e f r o m t h e known p o s i t i o n o f t h e 5' end o f t h e c o m p l e m e n t a r y DNA p r o b e t o t h e p o s i t i o n o f t h e 5' (capped) end o f t h e RNA. A. ^ 5' 5' j GTP + (p)ppN(pN)n ** ». G-p-p-pN(pN)n + PPi j 5' RNA 3' 3, DNA 5. -SI nuclease -RNase A • -denaturing PAGE -autoradiography T M 1 2 Lane M: Lane 1: Lane 2: Size markers RNA - probe RNA + probe 36 3.1.3. M a p p i n g t h e 3' e n d o f cenA mRNA. To i d e n t i f y t h e 3' e n d o f cenA mRNA, t r a n s c r i p t s s y n t h e s i s e d in vivo were a n a l y s e d b y S I n u c l e a s e m a p p i n g w i t h a 575 bp Bglll-Smal DNA p r o b e ( F i g . 1, C) . The p r o b e , i s o l a t e d f r o m t h e p l a s m i d pNG102 ( F i g . 10) was l a b e l e d a t t h e 3' B g l l l s i t e w i t h 32p ( F i g . 1 1 ) . The p r o b e was d e n a t u r e d i n s o l u t i o n a n d h y b r i d i s e d w i t h t o t a l C. fimi RNA a n d S I n u c l e a s e was u s e d t o d e g r a d e t h e u n p r o t e c t e d p o r t i o n s o f t h e DNA p r o b e i n a n y o f t h e r e s u l t i n g RNA-DNA h y b r i d s . The l e n g t h s o f t h e p r o t e c t e d p r o b e s p e c i e s s t i l l b e a r i n g t h e 32p l a b e l e d 3 ' - B g I I I t e r m i n u s w e r e t h e n d e t e r m i n e d b y g e l e l e c t r o p h o r e s i s u n d e r d e n a t u r i n g c o n d i t i o n s . As s e e n i n F i g . 12, a n a u t o r a d i o g r a p h o f t h e a n a l y t i c a l g e l r e v e a l e d t h r e e d i s t i n c t s p e c i e s o f p r o t e c t e d p r o b e ( l a n e 6 ) . T h e s e s p e c i e s mapped t o p o s i t i o n s 1 4 3 8, 1 4 4 9 , a n d 1464 b a s e s f r o m t h e +1 s i t e o f cenA mRNA, a n d a l l t h r e e w e r e d o w n s t r e a m o f t h e cenA t r a n s l a t i o n t e r m i n a t i o n c o d o n ( F i g . 13; Wong e t a l . , 1 9 8 6 ) . T h e s e s p e c i e s w e r e n o t o b s e r v e d i n m a p p i n g s t u d i e s w i t h RNA f r o m g l u c o s e - g r o w n C. fimi ( F i g . 12, l a n e 5) o r w i t h y e a s t tRNA ( n o t s h o w n ) . The cenA mRNA 3' ends were f o u n d t o map t o a r e g i o n o f i n v e r t e d r e p e a t s . 37 FIGURE 9. M a p p i n g t h e cenA mRNA 5' t e r m i n u s w i t h c a p p e d RNA. The C. fimi RNA l a b e l e d w i t h g u a n y l y l t r a n s f e r a s e a n d [oc-3 2 p ] - G T P a n d t h e cenA Smal-Sall p r o b e ( F i g . l , B) w e r e h y b r i d i s e d i n s o l u t i o n a n d t r e a t e d w i t h S I n u c l e a s e a n d R N a s e A . The h y b r i d s w e r e t h e n a n a l y s e d i n a 5% p o l y a c r y l a m i d e - 7 M u r e a g e l . The numbers on t h e l e f t i n d i c a t e t h e s i z e a n d m i g r a t i o n o f 5 ' - l a b e l e d M 1 3 m p l l H a e l l I f r a g m e n t s . The a r r o w on t h e r i g h t i n d i c a t e s t h e s p e c i f i c p r o b e - p r o t e c t e d RNA s p e c i e s ( l a n e 2, RNA + p r o b e ) . The r e s u l t s o f t h e p a r a l l e l n e g a t i v e c o n t r o l e x p e r i m e n t w i t h o u t p r o b e a d d e d t o t h e l a b e l e d RNA a r e a l s o shown ( l a n e 1, RNA -p r o b e ) . 38 FIGURE 1 0 . S u b c l o n i n g t h e 3 ' t e r m i n a l and f l a n k i n g DNA o f t h e cenA s t r u c t u r a l g e n e . The cenA 3 ' - s p e c i f i c h y b r i d i s a t i o n p robe ( F i g . l , C) was i s o l a t e d from a p o r t i o n o f C. f i m i DNA w h i c h had been s u b c l o n e d f rom p E C 2 . 1 (Wong e t a l . , 1986) t o t h e MCS o f pUC18. The p E C 2 . 1 DNA was d i g e s t e d w i t h Smal, f r a c t i o n a t e d i n a 1% low m e l t i n g p o i n t aga rose g e l and t h e 939 bp Smal f ragment was r e c o v e r e d ( M a n i a t i s e t a l . , 1982) . T h i s was l i g a t e d t o pUC18 w h i c h had been d i g e s t e d w i t h Smal and t r e a t e d w i t h C I A P . A m p i c i l l i n r e s i s t a n t ( A p r ) , L a c - JM101 t r a n s f o r m a n t s were s c r e e n e d by m i n i - l y s a t e p l a s m i d i s o l a t i o n and s u b s e q u e n t r e s t r i c t i o n enzyme a n a l y s i s f o r a p l a s m i d b e a r i n g t h e 939 bp Smal fragment i n t h e MCS o f pUC18. The p l a s m i d i s o l a t e d was d e s i g n a t e d pNG102. Bm -Smal digest -isolate 939 bp Sm-Sm fragment Sm -Smal digest -CIAP -Ligate -Transform -Screen Legend Vector DNA WMMKMN*!*: C. fimi DNA 39 FIGURE 1 1 . I s o l a t i o n o f a 3' c e n A mRNA s p e c i f i c S I p r o b e . The p l a s m i d pNG102 was d i g e s t e d w i t h B g l l l a n d 3'-end l a b e l e d w i t h [0C-32p] -dGTP a n d t h e K l e n o w f r a g m e n t o f E. c o l i DNA p o l y m e r a s e I . L i n e a r 3' e n d - l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h Smal a n d f r a c t i o n a t e d b y e l e c t r o p h o r e s i s i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 575 bp Bglll-Smal p r o b e was e x c i s e d . The p r o b e was t h e n e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l and r e c o v e r e d by c e n t r i f u g a t i o n . -Bglll digest -Fill in with[o<- T ] dGTP and Klenow -Smal digest -5% PAGE -Autoradiography -Excise 575bp probe -Elecrroelute into TAE -Ethanol precipitation -Recover by centrifugation Legend Vector DNA C. fimi DNA 40 FIGURE 1 2 . M a p p i n g t h e 3 ' end o f cenA mRNA. A f t e r h y b r i d i s a t i o n w i t h C. f i m i RNA and t r e a t m e n t w i t h SI n u c l e a s e , t h e c e n A - s p e c i f i c DNA p r o b e was a n a l y s e d i n a 5% p o l y a c r y l a m i d e - 8 . 3 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e sequenced by t h e c h e m i c a l c l e a v a g e method (Maxam and G i l b e r t , 1 9 8 0 ) . The cenA S m a l - B g l l l ( s i t e o f t h e 3 ' end l a b e l e d w i t h J Z -P ) p robe ( F i g . 1, C) was h y b r i d i s e d w i t h RNA from g l u c o s e -grown c e l l s ( l a n e 5) and CMC-grown c e l l s ( l a n e 6) . Lanes 1 t h r o u g h 4 c o n t a i n e d c h e m i c a l s e q u e n c i n g l a d d e r s G>A, G+A, T+C, and O T , r e s p e c t i v e l y . Numbers on t h e r i g h t d e n o t e d i s t a n c e ( i n bases) from the +1 s i t e ( F i g . 6 ) . 1 S 3 4 5 6 _ / 1 4 6 4 I- 1 4 4 9 ^ 1 4 3 8 41 5 ' - > 3 ' ===============> TG^GCTGAGACCTCGCCCACGACGAGCCCGCGGACGGCG 1438 1449 1464 <=============== CACGTGCGTCCGCGGGCTCGTCCGTCCGGCCGCCGCGGG FIGURE 1 3 . DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 3 ' - t e r m i n a l r e g i o n o f c e n A mRNA. O n l y t h e s e n s e s t r a n d i s shown. The v e r t i c a l a r r o w s d e n o t e t h e 5' n u c l e o t i d e s o f t h e p a r t i a l l y p r o t e c t e d f r a g m e n t s o f t h e 3' S I p r o b e . The TGA s t o p c o d o n i s o u t l i n e d . The n u c l e o t i d e s e q u e n c e s w h i c h may f o r m s t e m l o o p s t r u c t u r e s a r e shown a s o p p o s i n g o v e r l i n e d h o r i z o n t a l a r r o w s . 42 3.1.4. S t e a d y s t a t e l e v e l s o f cenA mRNA. The e f f e c t s o f t h e c a r b o n s o u r c e s p r o v i d e d t o C. fimi on c e n A e x p r e s s i o n w e r e f u r t h e r c h a r a c t e r i z e d b y h y b r i d i s a t i o n a n a l y s i s t o d e t e r m i n e t h e s t e a d y s t a t e l e v e l s o f c e n A mRNA. I n t h e s e e x p e r i m e n t s , RNA was i s o l a t e d f r o m g l y c e r o l - , g l u c o s e - , o r CMC-grown m i d - l o g p h a s e c u l t u r e s o f C. fimi a n d a n a l y s e d in v i t r o b y q u a n t i t a t i v e f i l t e r h y b r i d i s a t i o n s . S y n t h e t i c o l i g o d e o x y r i b o n u c l e o t i d e s , 30 b a s e s i n l e n g t h a n d c o m p l e m e n t a r y i n s e q u e n c e t o t h e f i r s t 10 c o d o n s o f t h e cenA 32 s t r u c t u r a l g e n e , w e r e 5' l a b e l e d w i t h P a n d u s e d a s h y b r i d i s a t i o n p r o b e s . T h i s a p p r o a c h was f o l l o w e d s i n c e i t a l l o w e d f o r t h e r a p i d d e t e c t i o n a n d q u a n t i t a t i o n o f m u l t i p l e RNA s a m p l e s . A s e r i e s o f 2 - f o l d d i l u t i o n s o f p l a s m i d p N G l O l DNA b e a r i n g t h e t a r g e t s e q u e n c e ( F i g . 2) s e r v e d a s t h e i n t e r n a l s t a n d a r d s f o r q u a n t i t i a t i v e d e t e r m i n a t i o n s . The r e s u l t s o f t h e s e d e t e r m i n a t i o n s a r e s u m m a r i s e d i n T a b l e I V . A s e x p e c t e d , t h e s t e a d y s t a t e l e v e l s o f c e n A mRNA i n e x p o n e n t i a l l y g r o w i n g c e l l s w e r e f o u n d t o be a f f e c t e d b y t h e c a r b o n s o u r c e . W h e r e a s t h e RNA f r o m CMC-grown c e l l s showed a b o u t 5 - f o l d more c e n A mRNA t h a n RNA f r o m g l y c e r o l - g r o w n c e l l s b y t h i s a n a l y s i s , t h e n o r t h e r n a n d S I d a t a s u g g e s t e d e v e n a g r e a t e r d i f f e r e n c e . T h i s d i s c r e p e n c y p r o b a b l y r e s u l t s f r o m t r a n s c r i p t s w h i c h w e r e n o t f u l l l e n g t h y e t c o u l d s t i l l b i n d t h e p r o b e a n d t h e r e b y c o n t r i b u t e t o t h e s i g n a l i n t h e s l o t b l o t s b u t w h i c h w o u l d be u n a b l e t o c o n t r i b u t e t o t h e s i g n a l i n t h e n o r t h e r n a n d SI a n a l y s i s . 43 The RNA f r o m g l u c o s e - g r o w n c e l l s h a d l e s s c e n A mRNA t h a n e i t h e r o f t h e o t h e r t w o p r e p a r a t i o n s . T h e s e r e s u l t s , t o g e t h e r w i t h t h e d a t a o b t a i n e d t h r o u g h n o r t h e r n b l o t a n d S I f i n e - m a p p i n g s t u d i e s showed cenA e x p r e s s i o n i n C. fimi t o be a f f e c t e d as a f u n c t i o n o f t h e c a r b o n s o u r c e p r o v i d e d d u r i n g g r o w t h . I t a l s o a p p e a r e d t h a t cenA e x p r e s s i o n was i n d u c e d by g r o w t h on s o l u b l e c e l l u l o s i c s u b s t r a t e (CMC) a n d r e p r e s s e d by g r o w t h on g l u c o s e . I t s h o u l d b e n o t e d t h a t t h e a n a l y s i s p e r f o r m e d d e t e c t e d o n l y s t e a d y s t a t e c e n A mRNA l e v e l s , a n d t h e r a t e s o f c e n A t r a n s c r i p t i n i t i a t i o n w e r e n o t m e a s u r e d . T h e r e f o r e t h e p o s s i b i l i t y e x i s t s t h a t t h e r e g u l a t i o n o f cenA e x p r e s s i o n c o u l d a l s o be p o s t - t r a n s c r i p t i o n a l , f o r e x a m p l e a t t h e l e v e l o f RNA s t a b i l i t y a n d t u r n o v e r , w h i c h c o u l d a l s o a c c o u n t f o r t h e o b s e r v e d c h a n g e s i n t h e r e l a t i v e l e v e l s o f mRNA. 44 C a r b o n s o u r c e cenA mRNA G l y c e r o l 4 8±6 G l u c o s e 13+4 CMC 257±8 T amol cenA mRNA p e r Lig t o t a l C. fimi RNA TABLE I V . S t e a d y s t a t e C. fimi cenA mRNA l e v e l s . T o t a l RNA was p r e p a r e d f r o m e x p o n e n t i a l l y g r o w i n g c u l t u r e s o f C. fimi p r o v i d e d w i t h b a s a l medium s u p p l e m e n t e d w i t h g l y c e r o l ( 0 . 2 % ) , g l u c o s e ( 0.2%) o r CMC (1.0%) a s c a r b o n s o u r c e . S a m p l e s o f RNA w e r e i m m o b i l i z e d on n y l o n membranes a n d t h e n h y b r i d i s e d w i t h 5' 3 2 p - i a b e l e d o l i g o d e o x y r i b o n u c l e o t i d e p r o b e s 30 b a s e s i n l e n g t h a n d c o m p l e m e n t a r y t o t h e f i r s t 10 c o d o n s o f t h e 7 _ i c e n A s t r u c t u r a l g ene ( s p e c i f i c a c t i v i t y 5 X 10 cpm fig L ) . F o l l o w i n g h y b r i d i s a t i o n s a t 52°C (10 n g p r o b e p e r m l ; 1 ml 2 p e r 100 cm membrane), t h e f i l t e r s w e r e w a s h e d a t 52°C w i t h t h r e e c h a n g e s o f 2X SSC / 0.1 % SDS a n d one c h a n g e o f I X SSC / 0.1 % SDS. The f i l t e r s w e r e t h e n w a s h e d a t 60 °C w i t h 0.IX SSC / 0.1 % SDS a n d e x p o s e d t o X- r a y f i l m a t -70 °C w i t h i n t e n s i f y i n g s c r e e n s . A u t o r a d i o g r a p h i c s i g n a l s w e r e q u a n t i t a t e d w i t h a H e l e n a Q u i c k S c a n d e n s i t o m e t e r e q u i p p e d w i t h an i n t e g r a t o r . T i t r a t e d amounts o f t h e p l a s m i d s p N G l O l , pNG202 a n d pNG301 s p e c i f i c f o r t h e c e n A , c e x a n d c e n B p r o b e s , r e s p e c t i v e l y , s e r v e d a s t h e i n t e r n a l s t a n d a r d s . A l k a l i - t r e a t e d (0.2N NaOH f o r 2 h a t 37°C) RNA s a m p l e s s e r v e d a s t h e n e g a t i v e c o n t r o l s . A l l s a m p l e s a p p l i e d t o t h e membranes c o n t a i n e d 4 fig o f t o t a l n u c l e i c a c i d . The r e s u l t s a r e e x p r e s s e d a s t h e mean (± SD) f r o m two d e t e r m i n a t i o n s i n atom m o l e s (amol) o f cenA mRNA p e r j i g o f t o t a l C. fimi RNA. 45 3.2. C h a r a c t e r i z a t i o n o f t h e cex t r a n s c r i p t s o f C. fimi. 3.2.1. R e g u l a t i o n b y c a r b o n s o u r c e a n d a p p r o x i m a t e l e n g t h o f cex mRNA. A q u a l i t a t i v e n o r t h e r n b l o t a n a l y s i s was u s e d t o d e t e r m i n e t h e a p p r o x i m a t e l e n g t h o f cex mRNA a n d t h e i n f l u e n c e o f t h e c a r b o n s o u r c e f o r C. fimi g r o w t h on cex e x p r e s s i o n . F o r t h e s e e x p e r i m e n t s , C. fimi RNA was p r e p a r e d f r o m c u l t u r e s g r o w n i n b a s a l medium s u p p l e m e n t e d w i t h e i t h e r 0.2%(w/v) g l y c e r o l , 0.2%(w/v) g l u c o s e o r 1.0%(w/v) CMC. The i n t r a g e n i c 122 bp S t y l - S a l l f r a g m e n t o f cex ( F i g . 14, A) was u s e d as t h e h y b r i d i s a t i o n p r o b e . The p r o b e , i s o l a t e d f r o m t h e p l a s m i d pUC12A25 ( F i g 1 5; O ' N e i l l , 1986) was 5* l a b e l e d a t t h e S a i l s i t e ( F i g 1 6 ) . A s t r o n g s i g n a l was o b s e r v e d i n h y b r i d i s a t i o n s b e t w e e n C. fimi RNA e x t r a c t e d f r o m CMC-grown c e l l s a n d t h e l a b e l e d S t y l - S a l l p r o b e . The s p e c i e s o f RNA d e t e c t e d b y t h e p r o b e was a p p r o x i m a t e l y 1500 b a s e s i n l e n g t h ( F i g 17, l a n e 3 ). No s i g n a l s w e r e d e t e c t e d i n t h e h y b r i d i s a t i o n s b e t w e e n t h e p r o b e a n d RNA f r o m g l y c e r o l - ( l a n e 1) o r g l u c o s e - ( l a n e 2) grown c e l l s . 3.2.2. M a p p i n g t h e 5' ends o f cex mRNA. Two c o m p l e m e n t a r y h y b r i d p r o t e c t i o n s t u d i e s w e r e u s e d t o c o n f i r m t h e d i r e c t i o n o f cenA t r a n s c r i p t i o n a n d t o d e t e r m i n e t h e 5' ends o f cenA mRNA. 46 FIGURE 1 4 . P a r t i a l r e s t r i c t i o n map o f t h e cex g e n e . R e p r e s e n t a t i o n o f t h e c l o n e d 2 . 6 kb BamRl-Sall segment o f C. f i m i DNA c o n t a i n i n g t h e cex gene . The s t r u c t u r a l gene i s shown as a b o x e d r e g i o n and i s t r a n s l a t e d from l e f t t o r i g h t ( 5 ' -> 3 ' ) . A , S t y l - S a l l n o r t h e r n b l o t p r o b e ; B , P s t l -B a n l 5 ' SI p r o b e ; B ' , 5 a u 3 A l f r a g m e n t u s e d i n t h e 5 ' mapp ing e x p e r i m e n t s w i t h r a d i o l a b e l e d RNA; C, S a u 3 A l - S a l l 3 ' SI p r o b e . The r e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d as f o l l o w s : Bm, BamRl; B n , Banl; P s , P s t l ; S3 , S a u 3 A l ; Sa, S a i l ; S t , S t y l . B m S3 ft St Bn S3 Sa S3 Sa Sa cex M B I l c o 500bp 47 FIGURE 1 5 . A p a r t i a l r e s t r i c t i o n map o f t h e p l a s m i d PUC12A25. The p l a s m i d c a r r i e s 2 . 6 kb o f C. f i m i DNA w i t h t h e c e x gene and i t s f l a n k i n g r e g i o n s w i t h i n t h e MCS o f pUC12. The r e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d as f o l l o w s : Bm, B a m H l ; H3 , H i n d l l l ; N , Narl; P s , P s t l ; S a , S a i l ; S3, S a u 3 A l , S t , S t y l . Legend Vector DNA MctftMxoieceN C. fimi DNA 48 FIGURE 16. I s o l a t i o n o f a c e x - s p e c i f i c n o r t h e r n b l o t p r o b e . The p l a s m i d pUC12A25 was d i g e s t e d w i t h S a i l , t r e a t e d w i t h C I A P a n d 5 ' - l a b e l e d w i t h [y-32p]-ATP a nd T4 PNK. L i n e a r 5' e n d - l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h S t y l a n d f r a c t i o n a t e d i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l f r a g m e n t w i t h t h e 1222 bp S t y l - S a l l p r o b e was e x c i s e d . The p r o b e was e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . BamHl Sail -Sail digest -CIAP -Kinase -Styl digest -5% PA gel -Autoradiograph 3416 bp 1222 bp 376 bp 244 bp -excise gel fragment with 1222 bp probe -electroelute into TAE buffer -ethanol precipitate probe Legend — Vector DNA C. fimi DNA 49 F I G U R E 17 . N o r t h e r n b l o t a n a l y s i s o f c e x - s p e c i f i c t r a n s c r i p t s . RNA was e x t r a c t e d f r o m C. fimi c u l t u r e s grown i n b a s a l medium s u p p l e m e n t e d w i t h g l y c e r o l , o r g l u c o s e , o r CMC, f r a c t i o n a t e d i n a f o r m a l d e h y d e g e l c o n t a i n i n g 1.0% a g a r o s e , a n d b l o t t e d t o a B i o t r a n s membrane. The b l o t was t h e n h y b r i d i s e d w i t h t h e cex i n t r a g e n i c S t y l - S a l l p r o b e ( F i g . 15, A) l a b e l e d a t t h e 5' S a i l s i t e . L a n e s : 1, RNA f r o m g l y c e r o l - g r o w n c e l l s ; 2, RNA f r o m g l u c o s e - g r o w n c e l l s ; 3, RNA f r o m CMC- g r o w n c e l l s . The n u m b e r s on t h e l e f t d e s i g n a t e t h e s i z e a n d m i g r a t i o n o f H a e l l l r e s t r i c t i o n f r a g m e n t s o f s i n g l e - s t r a n d e d M 1 3 m p l l DNA. o o o 2 5 2 7 1 6 2 3 8 4 9 5 2 5 1 2 3 50 3.2.2.1. M a p p i n g t h e cex mRNA 5' e n d s w i t h a 5' l a b e l e d DNA p r o b e . T r a n s c r i p t s s y n t h e s i z e d i n v i v o w e r e a n a l y s e d b y h i g h r e s o l u t i o n S I n u c l e a s e m a p p i n g . The 136 bp P s t l - B a n l DNA r e s t r i c t i o n f r a g m e n t was u s e d as t h e h y b r i d i s a t i o n p r o b e ( F i g 14, B ) . To i s o l a t e t h i s p r o b e , a 136 bp P s t l - W a r l f r a g m e n t was f i r s t i s o l a t e d f r o m pUC12A25 a n d s u b c l o n e d t o pUC18 g e n e r a t i n g pNG200. A 216 bp Smal-PvuII f r a g m e n t c o n t a i n i n g two e x t r a n e o u s S a n l s i t e s was t h e n d e l e t e d , g e n e r a t i n g pNG201 ( F i g . 1 8 ) , f r o m w h i c h t h e cex 5' S I p r o b e was e x c i s e d a s a Pstl-Banl f r a g m e n t ( F i g . 1 9 ) . The l a b e l e d p r o b e was d e n a t u r e d i n s o l u t i o n a n d a l l o w e d t o h y b r i d i s e w i t h C. fimi t o t a l RNA. The r e s u l t i n g RNA-DNA h y b r i d s w e r e t r e a t e d w i t h S I n u c l e a s e t o d e g r a d e t h e u n h y b r i d i s e d s e g m e n t s o f t h e DNA p r o b e . The l e n g t h o f t h e RNA p r o t e c t e d 5' p o r t i o n o f t h e DNA p r o b e was d e t e r m i n e d b y p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s u n d e r d e n a t u r i n g c o n d i t i o n s . A s s e e n i n F i g . 20, a u t o r a d i o g r a p h y r e v e a l e d f o u r a d j a c e n t s p e c i e s o f cex s p e c i f i c p r o b e w h i c h h a d b e e n p r o t e c t e d a t t h e i r 5' t e r m i n i f r o m n u c l e a s e S I d i g e s t i o n b y RNA f r o m CMC-grown C. fimi ( l a n e 6) . The c o r r e s p o n d i n g s p e c i e s o f p r o t e c t e d p r o b e DNA were n o t o b s e r v e d i n s t u d i e s w i t h y e a s t tRNA ( F i g . 20, l a n e 7) o r RNA f r o m e i t h e r g l u c o s e -g r o w n ( F i g . 2 0 , l a n e 5) o r g l y c e r o l - g r o w n C. fimi ( n o t shown). 51 FIGURE 18. S u b c l o n i n g 5' f l a n k i n g a n d t e r m i n a l cex DNA. To f a c i l i t a t e t h e i s o l a t i o n o f a cex mRNA 5' s p e c i f i c h y b r i d i s a t i o n p r o b e , a segment o f C. fimi DNA was s u b c l o n e d f r o m pUC12A25 t o pUC18. The pUC12A25 a n d pUC18 DNAs w e r e d i g e s t e d w i t h N a r l a n d P s t l a n d f r a c t i o n a t e d i n a 2.0% a g a r o s e g e l . The 136 bp N a r l - P s t l pUC12A25 f r a g m e n t a n d t h e 2498 b p pUC18 f r a g m e n t w e r e r e c o v e r e d , l i g a t e d t o g e t h e r ( M a n i a t i s , e t al. , 1982) a n d u s e d t o t r a n s f o r m J M 1 0 1 . A m p i c i l l i n r e s i s t a n t ( A p r ) , L a c - c o l o n i e s w e r e t h e n s c r e e n e d by m i n i - l y s a t e p l a s m i d i s o l a t i o n a n d s u b s e q u e n t r e s t r i c t i o n e nzyme a n a l y s i s . A p l a s m i d c a r r y i n g t h e 136 bp Narl-Pstl f r a g m e n t o f cex w i t h i n t h e u n i q u e N a r l a n d Pstl s i t e s o f pUC18 was i s o l a t e d a n d d e s i g n a t e d pNG200. W h i l e t h e h y b r i d N a r l s i t e o f pNG200 a p p e a r e d t o be a p o o r s u b s t r a t e f o r e n d o n u c l e a s e c l e a v a g e ( u n p u b l i s h e d o b s e r v a t i o n s ) , t h e N a r l i s o s c h i z o m e r Banl a p p e a r e d t o b e b e t t e r a t c l e a v i n g t h e h y b r i d s i t e ( u n p u b l i s h e d o b s e r v a t i o n s ) . To f a c i l i t a t e t h e r e c o v e r y o f t h e p r o b e , t w o e x t r a n e o u s Banl s i t e s ( B a n l r e c o g n i z i n g t h e h e x a n u c l e o t i d e s e q u e n c e 5 ' G t G P y P u C c 3 ' ) were e l i m i n a t e d f o l l o w i n g d i g e s t i o n o f pNG200 w i t h P v u I I a n d Smal a n d d i l u t e l i g a t i o n . T h i s c r e a t e d pNG201 w h i c h , w i t h o n l y t w o Banl s i t e s , was t h e s o u r c e o f cex 5 ' - s p e c i f i c S I DNA p r o b e f o r t h e m a p p i n g e x p e r i m e n t s w i t h u n l a b e l e d RNA. 52 Narl -Narl + Pstl digest -gel electrophoresis -isolate 136 bp Pstl-Narl fragment Smal Pstl — Bn pUC18 2.7 kb -Narl + Pstl digest -gel electrophoresis -isolate 2498 bp Pstl-Narl fragment PvuII. B -Ligate pNG200 f 2.6 kb V .K Smal Pstl Narl -PvuII + Smal digest -dilute ligation (P/S) V > * N a r l (Bn) pNG201 2.4 kb Legend Vector DNA VV,VK>V.VVVVXV> c. fimi DNA 53 FIGURE 19. I s o l a t i o n o f a cex 5' m R N A - s p e c i f i c S I p r o b e . The p l a s m i d pNG201 was d i g e s t e d w i t h Banl, t r e a t e d w i t h CIAP a n d 5' l a b e l e d w i t h [y-32p]-ATP and T4 PNK. L i n e a r 5' l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h P s t l a n d f r a c t i o n a t e d i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l f r a g m e n t w i t h t h e 136 bp Pstl-Banl p r o b e was e x c i s e d . The p r o b e was e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . Banl 1.2kb l.Okb 0.14kb Pstl Banl -Banl digest -CIAP -T4 PNK with [<- P]-ATP -Pstl digest -5% PA gel -Autoradiography -excise gel fragment with 136 bp probe -electroelute into TAE buffer -ethanol precipitate -recover by centrifugation Legend Vector DNA M M N O M K B M K c. fimi DNA 54 F I G U R E 2 0 . M a p p i n g t h e 5 1 e n d o f c e x mRNA. A f t e r h y b r i d i s a t i o n w i t h RNA a n d t r e a t m e n t w i t h S I n u c l e a s e t h e r e m a i n i n g Pstl-Banl p r o b e ( l a b e l e d a t t h e 5' Banl s i t e ) was a n a l y s e d i n an 8% p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e s e q u e n c e d b y t h e b a s e - s p e c i f i c c h e m i c a l c l e a v a g e m e t h o d (Maxam a n d G i l b e r t , 1 9 8 0 ) . P r o t e c t i o n o f t h e P s t l - B a n l p r o b e b y : RNA f r o m g l u c o s e - g r o w n C. fimi ( l a n e 5 ) , RNA f r o m CMC-grown C. fimi ( l a n e 6 ) , and y e a s t tRNA ( l a n e 7) . L a n e s 1 t h r o u g h 4 c o n t a i n e d t h e c h e m i c a l s e q u e n c i n g l a d d e r s o f t h e p r o b e : G>A, G+A, T+C, a n d C>T, r e s p e c t i v e l y . Numbers on t h e r i g h t i d e n t i f y s p e c i e s o f t h e p r o t e c t e d p r o b e . 1 2 3 a 5 6 7 55 The m o s t p r o m i n e n t p r o t e c t e d s p e c i e s , +1, mapped t o a C r e s i d u e , 28 b a s e s u p s t r e a m o f t h e t r a n s l a t i o n i n i t i a t i o n c o d o n f o r t h e u n p r o c e s s e d cex gene p r o d u c t ( F i g . 2 1 ; O ' N e i l l e t a l . , 1986) a n d 72 b a s e s f r o m t h e 3 2 p - i a b e l e d 5' e n d o f t h e p r o b e . 3.2.2.2. M a p p i n g t h e cex mRNA 5' t e r m i n u s w i t h RNA l a b e l e d in v i t r o w i t h g u a n y l y l t r a n s f e r a s e a n d [a-32p]-QTP. The h y b r i d p r o t e c t i o n s t u d y w i t h t h e P s t l - B a n l DNA p r o b e l a b e l e d a t t h e 5' B a n l s i t e ( 3 . 2 . 2 . 1 . a b o v e ) c o u l d h a v e i d e n t i f i e d t h e 5' e n d s o f cex mRNAs w h i c h w e r e e i t h e r i n t a c t o r p a r t i a l l y d e g r a d e d a t t h e i r 5' t e r m i n i . T h e r e f o r e , i n a s e c o n d h y b r i d p r o t e c t i o n a n a l y s i s , a n a l o g o u s t o t h a t p r e s e n t e d i n s e c t i o n 3.1.2.2. a b o v e , t o t a l RNA f r o m CMC-grown C. fimi was l a b e l e d in v i t r o w i t h v a c c i n i a v i r u s g u a n y l y l t r a n s f e r a s e enzyme a n d [OC-32P]-GTP a n d u s e d i n a h y b r i d p r o t e c t i o n a n a l y s i s w i t h an u n l a b e l e d , cex 5 ' - s p e c i f i c DNA p r o b e . To map t h e cex mRNA 5' t e r m i n u s i n t h i s f a s h i o n , t h e 136 bp P s t l - B a n l p r o b e was t e s t e d f o r i t s a b i l i t y t o p r o t e c t a b o u t 70 b a s e s o f t h e 5' e n d o f a c a p p e d RNA s p e c i e s f r o m n u c l e a s e d i g e s t i o n . However, t h e a n a l y s i s d i d n o t r e s o l v e a s p e c i f i c s i g n a l f r o m t h e b a c k g r o u n d o f n u c l e a s e - t r e a t e d u n h y b r i d i s e d c a p p e d RNA i n t h i s s i z e r a n g e ( n o t shown) . A S a u 3 A l DNA r e s t r i c t i o n f r a g m e n t s p a n n i n g a l a r g e r 5 1 f l a n k i n g 56 5 ' - > 3 CACCTCCCGCGGACGGGCCCCCACGTCACAGGGTG cex.pl +1 C A C C C G G C A C T G G C T C G A C G A G G A G G A C A T C A T G . kkkkkkkk RBS FIGURE 2 1 . DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5 ' - t e r m i n a l r e g i o n o f cex mRNA. O n l y t h e s e n s e s t r a n d i s shown. The v e r t i c a l a r r o w s d e n o t e t h e 3' n u c l e o t i d e s o f t h e p r o t e c t e d f r a g m e n t s o f t h e 5' S I p r o b e . The ATG c o d o n i s o u t l i n e d . The p u t a t i v e r i b o s o m e b i n d i n g s i t e (RBS) i s u n d e r l i n e d w i t h a s t e r i s k s . The p u t a t i v e cexpl p r o m o t e r r e g i o n i s u n d e r l i n e d . An i n v e r t e d r e p e a t i s o v e r s c o r e d w i t h h o r i z o n t a l a r r o w s . 57 a n d t e r m i n a l p o r t i o n o f t h e cex s t r u c t u r a l gene ( F i g . 14, B') was t h e r e f o r e t e s t e d f o r i t s a b i l i t y t o p r o t e c t a b o u t 246 b a s e s o f a c a p p e d RNA s p e c i e s f r o m n u c l e a s e d i g e s t i o n . T h i s S a u 3 A l f r a g m e n t was i s o l a t e d f r o m t h e p l a s m i d pUC13Bam31 ( F i g . 2 2 ) , k i n d l y p r o v i d e d b y G. O ' N e i l l . A s p e c i e s o f p r o t e c t e d RNA a b o u t 2 4 6 b a s e s l o n g was r e s o l v e d b y e l e c t r o p h o r e t i c a n a l y s i s f o l l o w i n g t h e n u c l e a s e - t r e a t m e n t o f t h e h y b r i d s t h a t f o r m e d b e t w e e n t h e c a p p e d RNA a n d t h e S a u 3 A l p r o b e ( F i g . 23, l a n e 2) w h i c h was n o t v i s i b l e i n t h e c o n t r o l e x p e r i m e n t ( F i g . 23, l a n e 1, RNA w i t h o u t p r o b e ) . 3.2.3. M a p p i n g t h e 3' ends o f cex mRNA. To i d e n t i f y t h e 3' e n d s o f cex mRNA, t r a n s c r i p t s s y n t h e s i z e d in vivo w e r e a n a l y s e d b y h i g h r e s o l u t i o n S I n u c l e a s e m a p p i n g w i t h a 254 bp 5 a u 3 A l - S a I l DNA p r o b e ( F i g . 14, C) . The p r o b e , i s o l a t e d f r o m t h e p l a s m i d pNG202 ( F i g . 24) was l a b e l e d a t t h e 3' 5 a u 3 A l s i t e w i t h 32p ( F i g . 2 5 ) . The p r o b e was d e n a t u r e d i n s o l u t i o n a n d h y b r i d i s e d w i t h t o t a l C. fimi RNA a n d S I n u c l e a s e was u s e d t o d e g r a d e t h e p o r t i o n s o f t h e p r o b e w h i c h were n o t p r o t e c t e d b y RNA. The l e n g t h s o f t h e p r o t e c t e d p r o b e s p e c i e s s t i l l b e a r i n g t h e 3' 3 2 p - i a b e l e d -S a u 3 A l t e r m i n u s w e r e t h e n d e t e r m i n e d b y g e l e l e c t r o p h o r e t i c a n a l y s i s u n d e r d e n a t u r i n g c o n d i t i o n s . As s e e n i n F i g . 26, an a u t o r a d i o g r a p h o f t h e a n a l y t i c a l g e l r e v e a l e d a s i n g l e s p e c i e s o f p r o t e c t e d p r o b e ( l a n e 6 ) . T h i s s p e c i e s mapped t o a p o s i t i o n 1564 b a s e s f r o m t h e +1 s i t e o f cex mRNA, 58 FIGURE 2 2 . R e p r e s e n t a t i o n o f t h e p l a s m i d pUC13Bam31. The 556 bp S a u 3 A l - S a u 3 A l f r agmen t o f pUC12A25 was s u b - c l o n e d i n t o t h e u n i q u e BamEl s i t e o f pUC13 t o g e n e r a t e pUC13Bam31 (G. O ' N e i l l , p e r s o n a l c o m m u n i c a t i o n ) . The i n s e r t e d f ragment was l i b e r a t e d as a 596 bp E c o R l - H l n d l l l f r agmen t f o r t h e h y b r i d p r o t e c t i o n a n a l y s i s w i t h capped RNA. EcoRl Sau3A A T G Styl Sau3A Hind.ni Legend Vector DNA >K«wa»?wa C. fimi DNA FIGURE 2 3 . M a p p i n g c e x mRNA 5' t e r m i n u s w i t h c a p p e d RNA. C. fimi RNA l a b e l e d w i t h g u a n y l y l t r a n s f e r a s e a n d [oc-32p]GTP, an d t h e c e x 5 a u 3 A l p r o b e ( F i g . 14, B') w e r e h y b r i d i s e d i n s o l u t i o n and t r e a t e d w i t h S I n u c l e a s e and RNaseA. The h y b r i d s w e r e t h e n a n a l y s e d i n a 5% p o l y a c r y l a m i d e - 7 M u r e a g e l . The n u m b ers on t h e l e f t i n d i c a t e t h e s i z e a n d m i g r a t i o n o f 5' r a d i o l a b e l e d M 1 3 m p l l ssDNA H a e l l l f r a g m e n t s . The a r r o w on t h e r i g h t i n d i c a t e s t h e s p e c i f i c p r o b e - p r o t e c t e d RNA s p e c i e s ( l a n e 2, RNA + p r o b e ) . The r e s u l t s o f t h e p a r a l l e l n e g a t i v e c o n t r o l e x p e r i m e n t w i t h o u t p r o b e a d d e d t o t h e l a b e l e d RNA a r e a l s o shown ( l a n e 1, RNA - p r o b e ) . 60 FIGURE 24. S u b c l o n i n g t h e 3' t e r m i n a l a n d f l a n k i n g DNA o f t h e cex s t r u c t u r a l g e n e . The cex 3 ' - s p e c i f i c h y b r i d i s a t i o n p r o b e ( F i g . 14, C) was i s o l a t e d f r o m a segment o f C. fimi DNA w h i c h h a d b e e n s u b c l o n e d f r o m p U C12A25 t o pUC18. The pUC1 2 A 2 5 DNA was d i g e s t e d w i t h S a i l , f r a c t i o n a t e d b y e l e c t r o p h o r e s i s t h r o u g h a 1.5% a g a r o s e g e l a n d t h e 375 bp S a i l f r a g m e n t r e c o v e r e d ( M a n i a t i s e t a l . , 1 9 8 2 ) . T h i s was t h e n d i g e s t e d w i t h S a u 3 A l a n d l i g a t e d w i t h pUC18 DNA w h i c h h a d b e e n d i g e s t e d w i t h BamHl a n d S a i l . A m p i c i l l i n r e s i s t a n t ( A p r ) , L a c - JM101 t r a n s f o r m a n t s w e r e s c r e e n e d b y m i n i - l y s a t e p l a s m i d i s o l a t i o n a n d s u b s e q u e n t r e s t r i c t i o n enzyme a n a l y s i s f o r a p l a s m i d b e a r i n g t h e 0.25 k b S a u 3 A l - S a l l f r a g m e n t o f cex i n t h e MCS o f pUC18. By v i r t u e o f a C r e s i d u e 3' f l a n k i n g t h e S a u 3 a l s i t e o f t h e cex f r a g m e n t , t h e B a m H l s i t e o f t h e v e c t o r was r e s t o r e d b y l i g a t i o n . The p l a s m i d i s o l a t e d was d e s i g n a t e d pNG202. Bm Sa : 'Sa -Sail digest -gel electrophoresis -isolate375 bp fragment -digest with Sau3Al -BamHl + Sail digest -Ligate -Transform JM101 -Screen for 0.25 kb insert in pUC18 that regenerates the BamHl site Bm (S3) Sa Legend Vector DNA .wxvw^vw» C. fimi DNA 61 FIGURE 2 5 . I s o l a t i o n o f a cex mRNA 3 * - s p e c i f i c S I p r o b e . The p l a s m i d pNG202 was d i g e s t e d w i t h BamHl a n d 3'-end l a b e l e d w i t h [cc-32p]-dGTP a n d t h e K l e n o w f r a g m e n t o f E. c o l i DNA p o l y m e r a s e I . L i n e a r 3'-end l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h S a i l a n d f r a c t i o n a t e d b y e l e c t r o p h o r e s i s i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 254 bp 5 a u 3 A l - B a m H l p r o b e was e x c i s e d . The p r o b e was t h e n e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . Bm (S3) Sa -BamHl digest -Fill in with [Of-and Klenow -Sail digest -5%PA gel -Autoradiograph Pl-GTP 2674 bp 254 bp -Excise gel fragment with 254 bp probe -electroelute into TAE buffer -Ethanol precipitate probe Legend • • ^ ^ K Vector DNA i < W S ^ > X V O S V S N C S X W c. fimi DNA 62 F IGURE 2 6 . M a p p i n g t h e 3 ' e n d o f cex mRNA. A f t e r h y b r i d i s a t i o n w i t h C. f i m i RNA and t r e a t m e n t w i t h SI n u c l e a s e , t h e c e x - s p e c i f i c DNA p r o b e was a n a l y s e d i n a 5% p o l y a c r y l a m i d e - 8 . 3 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e sequenced by t h e c h e m i c a l c l e a v a g e method (Maxam and G i l b e r t , 1 9 8 0 ) . The cex BamB.1-Sau3Al ( s i t e o f t h e 3 ' - e n d l a b e l e d w i t h 32p) p r o b e ( F i g . 14, C) was h y b r i d i s e d w i t h RNA from g l u c o s e - g r o w n c e l l s ( l a n e 5) and CMC-grown c e l l s ( l a n e 6) . Lanes 1 t h r o u g h 4 c o n t a i n e d c h e m i c a l s e q u e n c i n g l a d d e r s G>A, G+A, T+C, and C>T, r e s p e c t i v e l y . Numbers on t h e r i g h t deno te d i s t a n c e ( i n bases) from the +1 s i t e ( F i g . 2 0 ) . 1 2 3 A 5 6 63 d o w n s t r e a m o f t h e cex t r a n s l a t i o n t e r m i n a t i o n c o d o n ( F i g . 27; O ' N e i l l e t al., 1986). T h i s s p e c i e s was n o t o b s e r v e d i n m a p p i n g s t u d i e s w i t h RNA f r o m g l u c o s e - g r o w n C. fimi ( F i g . 26, l a n e 5) o r w i t h y e a s t t R N A ( n o t shown) . The cex mRNA t e r m i n a t i o n s i t e was f o u n d t o map t o a r e g i o n o f i n v e r t e d r e p e a t s ( F i g . 2 7 ) . 3.2.4. S t e a d y s t a t e l e v e l s o f cex mRNA. The e f f e c t s on cex e x p r e s s i o n b y t h e c a r b o n s o u r c e s p r o v i d e d t o C. fimi w e r e f u r t h e r c h a r a c t e r i z e d b y h y b r i d i s a t i o n a n a l y s i s t o d e t e r m i n e t h e s t e a d y s t a t e l e v e l s o f cex mRNA. I n t h e s e e x p e r i m e n t s , RNA was i s o l a t e d f r o m g l y c e r o l - , g l u c o s e - , o r CMC-grown c u l t u r e s o f C. fimi a n d a n a l y s e d i n v i t r o b y q u a n t i t a t i v e f i l t e r h y b r i d i s a t i o n s . S y n t h e t i c o l i g o d e o x y r i b o n u c l e o t i d e s , 30 b a s e s i n l e n g t h a n d c o m p l e m e n t a r y i n s e q u e n c e t o t h e f i r s t 10 c o d o n s o f t h e cex 3 2 s t r u c t u r a l g e n e , w e r e 5' l a b e l e d w i t h P a n d u s e d a s h y b r i d i s a t i o n p r o b e s . A s e r i e s o f 2 - f o l d d i l u t i o n s o f pNG201 p l a s m i d DNA ( F i g . 19) s e r v e d a s t h e s t a n d a r d s f o r q u a n t i t a t i v e d e t e r m i n a t i o n s . T h e r e s u l t s o f t h e s e d e t e r m i n a t i o n s a r e s u m m a r i z e d i n T a b l e V. As e x p e c t e d , t h e s t e a d y s t a t e l e v e l s o f cex mRNA i n e x p o n e n t i a l l y g r o w i n g c e l l s w e r e a f f e c t e d b y t h e c a r b o n s o u r c e , w i t h t h e RNA f r o m CMC-grown c e l l s h a v i n g a b o u t 2 - f o l d more cex mRNA t h a n RNA f r o m g l y c e r o l - o r g l u c o s e - g r o w n c e l l s . T h e s e r e s u l t s , t o g e t h e r w i t h t h e d a t a o b t a i n e d t h r o u g h n o r t h e r n b l o t and SI 64 5 ' - > 3 ' TGLCGGGCCGTCGGTCGTCGGGTCCCGACGGGCCCGGGCACCGGGCCGGTGGT 1 5 6 4 ====> <=====================!, CGCGCACGCCGCGCGGTCACCGGCCCGGCGCCGTCTGCGTCGATACGCTGGGC FIGURE 27. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 3'- t e r m i n a l r e g i o n o f cex mRNA. O n l y t h e s e n s e s t r a n d i s shown. The v e r t i c a l a r r o w d e n o t e s t h e 5' n u c l e o t i d e o f t h e p a r t i a l l y p r o t e c t e d 3' S I p r o b e . The TGA s t o p c o d o n i s o u t l i n e d . The s e q u e n c e s w h i c h may f o r m s t e m l o o p s t r u c t u r e s a r e o v e r l i n e d w i t h h o r i z o n t a l a r r o w s . The n u m b e r i n g c o r r e s p o n d s t o t h e number o f b a s e s f r o m t h e +1 s i t e ( F i g . 2 1 ) . 65 C a r b o n s o u r c e cex mRNA G l y c e r o l 18±3 G l u c o s e 10±2 CMC 77±9 amol cex mRNA p e r |lg t o t a l C. fimi RNA TABLE V. S t e a d y s t a t e l e v e l s o f C. fimi cex mRNA. T o t a l RNA was p r e p a r e d f r o m c u l t u r e s o f C. fimi grown e x p o n e n t i a l l y i n b a s a l medium s u p p l e m e n t e d w i t h g l y c e r o l ( 0 . 2 % ) , g l u c o s e (0.2%) o r CMC (1.0%) as c a r b o n s o u r c e . S a m p l e s o f RNA were i m m o b i l i z e d on n y l o n membranes a n d f i l t e r s w e r e h y b r i d i s e d w i t h 5' 3 2 p - l a b e l e d o l i g o d e o x y r i b o n u c l e o t i d e p r o b e s 30 b a s e s i n l e n g t h a n d c o m p l e m e n t a r y t o t h e f i r s t 10 c o d o n s o f t h e c e n A s t r u c t u r a l g ene ( s p e c i f i c a c t i v i t y 5 X 1 0 7 cpm ( i g - 1 ) . F o l l o w i n g h y b r i d i s a t i o n s a t 52°C (10 n g p r o b e p e r m l ; 1 ml p e r 100 c m 2 membrane), t h e f i l t e r s w e r e w a s h e d a t 52°C w i t h t h r e e c h a n g e s o f 2X SSC / 0.1 % SDS a n d one c h a n g e o f I X SSC / 0.1 % SDS. The f i l t e r s w e r e t h e n w a s h e d a t 60°C w i t h 0.IX SSC / 0.1 % SDS a n d e x p o s e d t o X- r a y f i l m a t -70 °C w i t h i n t e n s i f y i n g s c r e e n s . A u t o r a d i o g r a p h i c s i g n a l s w e r e q u a n t i t a t e d w i t h a H e l e n a Q u i c k S c a n d e n s i t o m e t e r e q u i p p e d w i t h an i n t e g r a t o r . T i t r a t e d amounts o f t h e p l a s m i d s p N G l O l , pNG202 a n d pNG301 s p e c i f i c f o r t h e c e n A , cex a n d c e n B p r o b e s , r e s p e c t i v e l y , s e r v e d a s t h e i n t e r n a l s t a n d a r d s . A l k a l i - t r e a t e d (0.2N NaOH f o r 2 h a t 37 °C) RNA s a m p l e s s e r v e d a s t h e n e g a t i v e c o n t r o l s . A l l s a m p l e s a p p l i e d t o t h e membranes c o n t a i n e d 4 |lg °f t o t a l n u c l e i c a c i d . The r e s u l t s a r e e x p r e s s e d a s t h e mean (± SD) o f t w o d e t e r m i n a t i o n s i n atom m o l e s (amol) o f cex mRNA p e r fig o f t o t a l C. fimi RNA. 66 f i n e - m a p p i n g s t u d i e s s u g g e s t t h a t cex e x p r e s s i o n c o u l d be r e g u l a t e d b y C. fimi a t t h e t r a n s c r i p t i o n a l l e v e l b y t h e c a r b o n s o u r c e p r o v i d e d d u r i n g g r o w t h a n d t h a t cex e x p r e s s i o n i s i n d u c e d b y g r o w t h on s o l u b l e c e l l u l o s i c s u b s t r a t e a n d i s m i n i m a l w i t h e i t h e r g l u c o s e o r g l y c e r o l p r o v i d e d a s t h e c a r b o n s o u r c e . . H o w e v e r , s i n c e t h e r a t e s o f t r a n s c r i p t i n i t i a t i o n w e r e n o t m e a s u r e d u n d e r t h e t h r e e g r o w t h c o n d i t i o n s e m p l o y e d , t h e p o s s i b i l i t y e x i s t s t h a t cex e x p r e s s i o n c o u l d a l s o b e r e g u l a t e d a t t h e p o s t -t r a n s c r i p t i o n a l l e v e l . 3.3. C h a r a c t e r i z a t i o n o f t h e cenB t r a n s c r i p t s o f C. fimi. 3.3.1. R e g u l a t i o n by c a r b o n s o u r c e a n d a p p r o x i m a t e l e n g t h o f cenB mRNA. A q u a l i t a t i v e n o r t h e r n b l o t a n a l y s i s was u s e d t o d e t e r m i n e t h e a p p r o x i m a t e l e n g t h o f cenB mRNA a n d t h e i n f l u e n c e on cenf3 t r a n s c r i p t i o n o f t h e c a r b o n s o u r c e p r o v i d e d f o r C. fimi g r o w t h . F o r t h e s e e x p e r i m e n t s , C. fimi RNA was p r e p a r e d f r o m c u l t u r e s g r o w n i n b a s a l medium s u p p l e m e n t e d w i t h e i t h e r 0.2%(w/v) g l y c e r o l , 0.2%(w/v) g l u c o s e o r 1.0%(w/v) CMC. The i n t r a g e n i c Pstl-Smal f r a g m e n t o f cenB ( F i g . 28, A) was u s e d as t h e h y b r i d i s a t i o n p r o b e . The p r o b e , c a r r i e d on t h e p l a s m i d pUC19C3PS ( F i g . 29) was l a b e l e d b y n i c k - t r a n s l a t i o n . A n i n t e n s e s i g n a l was o b s e r v e d i n h y b r i d i s a t i o n s b e t w e e n C. fimi RNA e x t r a c t e d f r o m CMC-grown c e l l s a n d t h e l a b e l e d 67 FIGURE 2 8 . P a r t i a l r e s t r i c t i o n map o f t h e c e n B g e n e . R e p r e s e n t a t i o n o f t h e c l o n e d 5 . 6 - k i l o b a s e BamEl-BamHl segment o f C . f i m i DNA c o n t a i n i n g t h e cenB g e n e . The s t r u c t u r a l gene i s shown as a b o x e d r e g i o n w i t h t h e 3 ' end a p p r o x i m a t e d f rom t h e n o r t h e r n b l o t d a t a ( t h i s s e c t i o n ) . T r a n s l a t i o n i s f rom l e f t t o r i g h t ( 5 ' -> 3 ' ) . A , Pstl-Smal N o r t h e r n b l o t p r o b e ; B , BamEl-Pstl 5 ' SI p r o b e . The r e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d as f o l l o w s : Bm, BamEl; P s , P s t l ; Sm, Smal . Bm Ps Sm Bm cenB H B 0 lOOObp 68 p r o b e . The s p e c i e s o f RNA d e t e c t e d b y t h e p r o b e was a p p r o x i m a t e l y 3200 b a s e s i n l e n g t h ( F i g . 30, l a n e 3 ) . L e s s i n t e n s e s i g n a l s a l s o c o r r e s p o n d i n g t o RNA s p e c i e s o f a b o u t 3200 b a s e s i n l e n g t h w e r e d e t e c t e d i n h y b r i d i s a t i o n s b e t w e e n t h e p r o b e a n d RNA f r o m g l y c e r o l - a n d g l u c o s e - g r o w n c e l l s ( F i g . 30, l a n e s 1 and 2, r e s p e c t i v e l y ) . 3.3.2. M a p p i n g t h e 5' ends o f cenB mRNA. A h y b r i d p r o t e c t i o n s t u d y was u s e d t o c o n f i r m t h e d i r e c t i o n o f cenB t r a n s c r i p t i o n a n d t o i d e n t i f y t h e 5' e n d s o f cenB mRNA. T r a n s c r i p t s s y n t h e s i z e d i n v i v o w e r e a n a l y s e d b y h i g h r e s o l u t i o n S I n u c l e a s e m a p p i n g . The 400 bp B a m H l - P s t l DNA r e s t r i c t i o n f r a g m e n t ( F i g . 28, A) i s o l a t e d f r o m t h e p l a s m i d pNG301 ( F i g . 31) was u s e d a s t h e h y b r i d i s a t i o n p r o b e . The p r o b e , l a b e l e d a t t h e 5' P s t l s i t e , was d e n a t u r e d i n s o l u t i o n a n d h y b r i d i s e d w i t h t o t a l C. fimi RNA a n d S I n u c l e a s e was u s e d t o d e g r a d e t h e u n p r o t e c t e d p o r t i o n s o f t h e DNA p r o b e i n any o f t h e r e s u l t i n g RNA-DNA h y b r i d s . The l e n g t h s o f t h e p r o t e c t e d p r o b e s p e c i e s , s t i l l b e a r i n g t h e 32p l a b e l e d 5'-P s t l t e r m i n u s , w e r e t h e n d e t e r m i n e d b y g e l e l e c t r o p h o r e s i s u n d e r d e n a t u r i n g c o n d i t i o n s . As s e e n i n an a u t o r a d i o g r a p h o f t h e a n a l y t i c a l g e l ( F i g u r e 32), t h e a n a l y s i s r e v e a l e d f o u r d i s t i n c t s p e c i e s o f p r o t e c t e d p r o b e . T h e s e s p e c i e s a l l mapped u p s t r e a m o f t h e cenB t r a n s l a t i o n i n i t i a t i o n c o d o n . T h r e e o f t h e s e s p e c i e s w e re c l o s e l y s p a c e d ( F i g . 34, +1, +2, +3) a nd t h e f o u r t h , m i g r a t e d f u r t h e r down t h e g e l 69 FIGURE 29. R e p r e s e n t a t i o n o f t h e p l a s m i d pUC19C3PS. The 2.0 kb Pstl-Smal f r a g m e n t o f cenB i s c a r r i e d on t h e v e c t o r pUC19. T h i s p l a s m i d was n i c k - t r a n s l a t e d w i t h [oc-32p]- dCTP an d [0C-32p ]-dGTP ( s p e c i f i c a c t i v i t y 5 X 1 0 7 cpm p i g - 1 ) a n d u s e d as an i n t r a g e n i c p r o b e f o r cenB mRNA i n n o r t h e r n b l o t e x p e r i m e n t s . The r e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d a s f o l l o w s : R l , EcoRl; H3, H i n d l l l ; P s , P s t l ; Sm, Sma 1. 1—H3 Legend Vector DNA »>\\\\\\\\\\v» C. fimi DNA 70 F I G U R E 3 0 . N o r t h e r n b l o t a n a l y s i s o f cenB-s p e c i f i c t r a n s c r i p t s . RNA was e x t r a c t e d f r o m C. fimi c u l t u r e s grown i n b a s a l medium s u p p l e m e n t e d w i t h g l y c e r o l , o r g l u c o s e , o r CMC, f r a c t i o n a t e d i n a f o r m a l d e h y d e g e l c o n t a i n i n g 1.0% a g a r o s e , a n d t r a n s f e r r e d t o a B i o t r a n s membrane. The b l o t was h y b r i d i s e d w i t h t h e n i c k - t r a n s l a t e d p l a s m i d pUC19C3PS c a r r y i n g t h e c e n B i n t r a g e n i c Pstl-Smal f r a g m e n t ( F i g . 28 a n d 2 9 ) . L a n e s : M, l a b e l e d H i n d l l l r e s t r i c t i o n f r a g m e n t s o f l a m b d a DNA ( s i z e s i n b a s e p a i r s a r e i n d i c a t e d on t h e l e f t ) ; 1, RNA f r o m g l y c e r o l - g r o w n c e l l s ; 2, RNA f r o m g l u c o s e - g r o w n c e l l s ; 3, RNA f r o m CMC-grown c e l l s . A r r o w i n d i c a t e s t h e m a j o r h y b r i d , t h e g e l ( F i g . 32, +52). 71 FIGURE 3 1 . I s o l a t i o n o f a c e n B 5' m R N A - s p e c i f i c S I p r o b e . The p l a s m i d p U C 1 9 C 3 ( o r i 2 ) c a r r i e s a 5.2 kb C. fimi DNA i n s e r t w i t h t h e cenB s t r u c t u r a l gene i n t h e MCS o f pUC19. The cenB g e n e i s t r a n s l a t e d i n t h e R l -> H3 o r i e n t a t i o n . The ATG s t a r t c o d o n i s o u t l i n e d . To i s o l a t e a p l a s m i d w i t h a u n i q u e P s t l s i t e , p U C l 9 C 3 ( o r i 2 ) was d i g e s t e d t o c o m p l e t i o n w i t h P s t l a n d r e l i g a t e d u n d e r d i l u t e c o n d i t i o n s . The L a c - A p r JM101 t r a n s f o r m a n t s w e r e s c r e e n e d b y m i n i - l y s a t e p l a s m i d i s o l a t i o n a n d s u b s e q u e n t r e s t r i c t i o n enzyme a n a l y s i s . A p l a s m i d c a r r y i n g o n l y t h e 0.4 kb B a m H l - P s t l f r a g m e n t o f p U C l 9C3 ( o r i 2 ) i n t h e MCS o f p U C 19 was i s o l a t e d a n d d e s i g n a t e d pNG301. To i s o l a t e a c e n B mRNA 5 ' - s p e c i f i c S I p r o b e , pNG301 was d i g e s t e d w i t h P s t l , t r e a t e d w i t h C I A P a n d 5 ' - e n d l a b e l e d w i t h [ y - 3 2 P ] - A T P a n d T4 PNK. L i n e a r , e n d -l a b e l e d p l a s m i d DNA was d i g e s t e d w i t h BamHl a n d f r a c t i o n a t e d i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 0.4 kb P s t l - B a m H l p r o b e was e x c i s e d . The p r o b e was t h e n e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a nd r e c o v e r e d by c e n t r i f u g a t i o n . Ps Legend Vector DNA » » M W M » I » C. fimi DNA -Pstl digest -CIAP -Kinase -BamHl digest -5% PA gel -Autoradiography 2.6 kb 0.4 kb -excise 0.4 kb band -electroelute into TAE -precipitate with ethanol -recover by precipitation 72 F I G U R E 3 2 . M a p p i n g t h e 5' e n d o f c e n B mRNA. A f t e r h y b r i d i s a t i o n w i t h RNA a n d t r e a t m e n t w i t h S I n u c l e a s e , t h e c e n B - s p e c i f i c l a b e l e d DNA p r o b e was a n a l y s e d i n a n 8% p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e s e q u e n c e d b y t h e b a s e - s p e c i f i c c h e m i c a l c l e a v a g e m e t h o d (Maxam a n d G i l b e r t , 1980) . S I p r o t e c t i o n o f cenB BamRl-Pstl ( s i t e o f 5' e n d l a b e l e d w i t h 3 2 P ) f r a g m e n t by RNA f r o m CMC-g r o w n C . f i m i ( l a n e 5 ) , RNA f r o m g l u c o s e - g r o w n C. fimi ( l a n e 6 ) , RNA f r o m g l y c e r o l - g r o w n C. fimi ( l a n e 7 ) , a n d y e a s t tRNA ( l a n e 8) . L a n e s 1 t h r o u g h 4 c o n t a i n e d c h e m i c a l s e q u e n c i n g l a d d e r s G>A, G+A, T+C, a n d C>T, r e s p e c t i v e l y . Numbers on t h e r i g h t i d e n t i f y s p e c i e s o f t h e p r o t e c t e d p r o b e . 1 2 3 4 5 6 7 ! • 3 73 ( F i g . 3 2 , + 5 2 ) . The most p r o m i n e n t s p e c i e s r e s o l v e d i n t h e a n a l y s i s , +1, ( F i g . 32, l a n e 5) c o r r e s p o n d e d t o a G r e s i d u e 201 b a s e s f r o m t h e 3 2 p - i a b e ] _ e c i 5 1 - e n d o f t h e p r o b e a n d 75 b a s e s u p s t r e a m o f t h e i n i t i a t i o n c o d o n o f t h e u n p r o c e s s e d cenB gene p r o d u c t ( F i g . 33; O w a l a b i e t al., 1 9 8 8 ) . The +1, +2 a n d +3 s p e c i e s w e r e c l e a r l y v i s i b l e i n m a p p i n g e x p e r i m e n t s w i t h RNA f r o m CMC-grown C. fimi ( F i g . 32, l a n e 5 ) , w h i l e t h e f o u r t h , w e a k e r s p e c i e s was s e e n u p on p r o l o n g e d a u t o r a d i o g r a p h i c e x p o s u r e o f t h e d r i e d g e l t o X - r a y f i l m ( n o t s h o w n ) . When RNA i s o l a t e d f r o m g l u c o s e - g r o w n c u l t u r e s was u s e d i n m a p p i n g e x p e r i m e n t s , o n l y t h e +52 s p e c i e s was d e t e c t e d ( F i g . 32, l a n e 6) . I n m a p p i n g s t u d i e s w i t h RNA i s o l a t e d f r o m g l y c e r o l - g r o w n c e l l s , t h e +52 s p e c i e s was d e t e c t e d a s t h e m a j o r s p e c i e s ( F i g . 32, l a n e 7) , w h i l e t h e + 1, +2, a n d +3 s p e c i e s w e r e d e t e c t e d o n l y a f t e r p r o l o n g e d a u t o r a d i o g r a p h i c e x p o s u r e t o X - r a y f i l m ( n o t s h o w n ) . No h y b r i d s w e r e d e t e c t e d i n c o n t r o l e x p e r i m e n t s w i t h y e a s t tRNA ( F i g . 32, l a n e 8 ) . 3.3.3. S t e a d y s t a t e l e v e l s o f cenB mRNA. The e f f e c t s o f t h e c a r b o n s o u r c e s p r o v i d e d t o C. fimi on ce n B e x p r e s s i o n w e r e f u r t h e r c h a r a c t e r i z e d b y h y b r i d i s a t i o n a n a l y s i s t o d e t e r m i n e t h e s t e a d y s t a t e l e v e l s o f cenB mRNA. I n t h e s e e x p e r i m e n t s , RNA was i s o l a t e d f r o m g l y c e r o l - , g l u c o s e - , o r CMC-grown c u l t u r e s o f C. fimi a n d a n a l y s e d in v i t r o b y q u a n t i t a t i v e f i l t e r h y b r i d i s a t i o n s . S y n t h e t i c 74 o l i g o d e o x y r i b o n u c l e o t i d e s , 30 b a s e s i n l e n g t h a n d c o m p l i m e n t a r y i n s e q u e n c e t o t h e f i r s t 10 c o d o n s o f t h e cenB 3 2 s t r u c t u r a l g e n e , w e r e 5 ' - l a b e l e d w i t h P a n d u s e d a s h y b r i d i s a t i o n p r o b e s . A s e r i e s o f 2 - f o l d d i l u t i o n s o f pNG301 p l a s m i d DNA ( F i g . 31) s e r v e d a s i n t e r n a l s t a n d a r d s f o r q u a n t i t a t i v e d e t e r m i n a t i o n s . The r e s u l t s o f t h e s e d e t e r m i n a t i o n s a r e s u m m a r i z e d i n T a b l e V I . As e x p e c t e d , t h e s t e a d y s t a t e l e v e l s o f c e n B mRNA i n e x p o n e n t i a l l y g r o w i n g c e l l s w e r e a f f e c t e d b y t h e c a r b o n s o u r c e p r o v i d e d d u r i n g g r o w t h , w i t h t h e RNA f r o m CMC-grown c e l l s h a v i n g a b o u t 10 t o 2 0 - f o l d more c e n B mRNA t h a n RNA f r o m g l y c e r o l - o r g l u c o s e -g r o w n c e l l s . T h a t o n l y l o w a m o u n t s o f c e n B mRNA w e r e d e t e c t e d i n t h e RNA p r e p a r e d f r o m g l y c e r o l - o r g l u c o s e - g r o w n c e l l s was i n k e e p i n g w i t h t h e f i n d i n g s o f t h e 5' S I m a p p i n g s t u d i e s . T o g e t h e r w i t h t h e d a t a o b t a i n e d t h r o u g h n o r t h e r n b l o t a n d S I f i n e - m a p p i n g s t u d i e s , t h e s e r e s u l t s showed t h a t t h e l e v e l o f c e n B e x p r e s s i o n was a f u n c t i o n o f t h e c a r b o n s o u r c e p r o v i d e d t o C. fimi d u r i n g g r o w t h . I t a l s o a p p e a r s f r o m t h e d a t a i n F i g . 32 t h a t cenB t r a n s c r i p t i o n i s d i r e c t e d f r o m t w o t a n d e m p r o m o t e r s , cenBpl a n d cenBp2, o f w h i c h t h e more d i s t a l cenBpl i s i n d u c i b l e a s a f u n c t i o n o f g r o w t h on c e l l u l o s i c s u b s t r a t e . 75 5 ' - > 3 ' + 1 GCTGAATCGT TTAGGGCGTTGACCTGCGGACGGACCCGTCTGGACGATGCG CCA cenBpl +52 < = = I GGCGTCGTGCGGGTGCGACTGCGGACAGCACGGGTCGCCGACCACCACTCCCGT cenBp2 GCCCGGAAGAGGACCCCJkTS. . . •kiz'k'k'k'k'k'k'k RBS FIGURE 3 3 . DNA sequence c o r r e s p o n d i n g t o the 5 ' - t e r m i n a l region of cenB mRNA. Only the sense s t r a n d i s shown. The 3' n u c l e o t i d e s of the p a r t i a l l y p r o t e c t e d 5' SI probe are shown as v e r t i c a l arrows. The ATG codon i s o u t l i n e d . The p u t a t i v e ribosome b i n d i n g s i t e (RBS) i s u n d e r l i n e d w i t h a s t e r i s k s . The p u t a t i v e cenBpl and cenBpl promoter r e g i o n s are u n d e r l i n e d . An i n v e r t e d repeat i s shown o v e r l i n e d w i t h b o l d arrows. 76 3.4. I d e n t i f i c a t i o n o f a C. fimi c e x - l i n k e d gene. 3 . 4 . 1 . S e q u e n c e i n s p e c t i o n t o i d e n t i f y p u t a t i v e C. fimi g e n e s . C. fimi DNA s e q u e n c e s f l a n k i n g t h e cenA, cex a n d c e n B g e n e s w e r e i n s p e c t e d t o i d e n t i f y p u t a t i v e open r e a d i n g f r a m e s b e g i n n i n g w i t h a n i n i t i a t i o n ATG c o d o n , p r e c e d e d b y a r i b o s o m e - b i n d i n g s i t e (RBS) a n d p u t a t i v e C. fimi p r o m o t e r s e q u e n c e s ( a s f o u n d p r e c e d i n g t h e cenA, cex a n d c e n B g e n e s ) . One s u c h s t r e t c h o f DNA was f o u n d a b o u t 700 b a s e s u p s t r e a m o f , a n d i n t h e o p p o s i t e o r i e n t a t i o n t o t h e cex s t r u c t u r a l g ene ( F i g . 3 4 ) . A l t h o u g h t h e d i s t a l DNA s e q u e n c e c o n t i g u o u s t o t h e BamEl s i t e h a d n o t b e e n d e t e r m i n e d , t h e p r e s e n c e o f a C. fimi p r o m o t e r - l i k e s e q u e n c e , RBS s e q u e n c e a n d an ATG i n a p p r o p r i a t e c o n f i g u r a t i o n p r o m p t e d f u r t h e r i n v e s t i g a t i o n t o i d e n t i f y a t r a n s c r i p t a n d, i f f o u n d , t o map t h e 5' t e r m i n u s w i t h i n t h e known f l a n k i n g s e q u e n c e . 3.4.2. H y b r i d p r o t e c t i o n a n a l y s i s t o c o n f i r m t h e p r e s e n c e o f a c e x - l i n k e d gene. C. fimi RNA s y n t h e s i z e d in vivo was a n a l y s e d b y h i g h -r e s o l u t i o n S I n u c l e a s e m a p p i n g . The 644 bp BamKl-Pstl DNA r e s t r i c t i o n f r a g m e n t i s o l a t e d f r o m t h e p l a s m i d pUC12A25 ( F i g . 35) was u s e d as t h e h y b r i d i s a t i o n p r o b e . The p r o b e , l a b e l e d a t t h e 5' B a m H l s i t e , was d e n a t u r e d a n d h y b r i d i s e d i n s o l u t i o n w i t h t o t a l C. fimi RNA and SI n u c l e a s e was u s e d t o 77 C a r b o n s o u r c e cenB mRNA^ G l y c e r o l 32±5 G l u c o s e 24+5 CMC 2 61±5 amol cenB mRNA p e r |lg t o t a l C. fimi RNA TABLE V I . S t e a d y s t a t e l e v e l s o f C. fimi cenB mRNA. T o t a l RNA was p r e p a r e d f r o m c u l t u r e s o f C. fimi g r o w i n g e x p o n e n t i a l l y i n b a s a l medium s u p p l e m e n t e d w i t h g l y c e r o l ( 0 . 2 % ) , g l u c o s e ( 0 . 2 % ) o r CMC ( 1 . 0 % ) a s c a r b o n s o u r c e . S a m p l e s o f RNA w e r e i m m o b i l i z e d o n n y l o n membranes a n d f i l t e r s w e r e h y b r i d i s e d w i t h 5' 3 2 p l a b e l e d o l i g o d e o x y r i b o n u c l e o t i d e p r o b e s 30 b a s e s i n l e n g t h a n d c o m p l i m e n t a r y t o t h e f i r s t 10 c o d o n s o f t h e cenB s t r u c t u r a l g e n e ( s p e c i f i c a c t i v i t y 5 X 1 0 7 cpm | i g - 1 ) . F o l l o w i n g h y b r i d i s a t i o n s a t 52°C (10 ng p r o b e m l - 1 ; 1 m l p e r 100 cm 2 membrane), t h e f i l t e r s w ere washed a t 52°C w i t h t h r e e c h a n g e s o f 2X SSC / 0.1 % SDS a n d one c h a n g e o f I X SSC / 0.1 % SDS. The f i l t e r s w e r e t h e n w a s h e d a t 60°C w i t h 0.IX SSC / 0.1 % SDS a n d e x p o s e d t o X- r a y f i l m a t -70 °C w i t h i n t e n s i f y i n g s c r e e n s . A u t o r a d i o g r a p h i c s i g n a l s w e r e q u a n t i t a t e d w i t h a H e l e n a Q u i c k S c a n d e n s i t o m e t e r e q u i p p e d w i t h an i n t e g r a t o r . T i t r a t e d a m o u n t s o f t h e p l a s m i d s p N G l O l , pNG202 a n d pNG301 s p e c i f i c f o r t h e c e n A , c e x a n d c e n B p r o b e s , r e s p e c t i v e l y , s e r v e d as t h e i n t e r n a l s t a n d a r d s . A l k a l i - t r e a t e d (0.2N NaOH f o r 2 h a t 37°C) RNA s a m p l e s s e r v e d a s t h e n e g a t i v e c o n t r o l s . A l l s a m p l e s a p p l i e d t o t h e membranes c o n t a i n e d 4 j i g o f t o t a l n u c l e i c a c i d . The r e s u l t s a r e e x p r e s s e d a s t h e mean (+ SD) o f t w o d e t e r m i n a t i o n s i n atom m o l e s (amol) o f cenB mRNA p e r |ig o f t o t a l C. fimi RNA. 78 d e g r a d e t h e u n p r o t e c t e d p o r t i o n s o f t h e DNA p r o b e i n any o f t h e r e s u l t i n g RNA-DNA h y b r i d s . The l e n g t h s o f t h e p r o t e c t e d 32 p r o b e s p e c i e s s t i l l b e a r i n g t h e P - l a b e l e d 5' BamHl t e r m i n u s w e r e d e t e r m i n e d b y g e l e l e c t r o p h o r e t i c a n a l y s i s u n d e r d e n a t u r i n g c o n d i t i o n s . A s s e e n i n F i g u r e 3 6 , a n a u t o r a d i o g r a p h o f t h e a n a l y t i c a l g e l r e v e a l e d d i s t i n c t s p e c i e s o f p r o t e c t e d p r o b e . T h e s e s p e c i e s w h i c h m i g r a t e d c l o s e l y t o g e t h e r a l l mapped u p s t r e a m o f t h e RBS- l i k e s e q u e n c e . No h y b r i d s w e r e s e e n i n c o n t r o l e x p e r i m e n t s w i t h y e a s t t R N A ( F i g . 36, l a n e 8 ) . The most p r o m i n e n t s p e c i e s , 32 +1, mapped t o an A r e s i d u e , 48 b a s e s u p s t r e a m o f t h e P-l a b e l e d 5' e n d o f t h e p r o b e , a n d 39 b a s e s f r o m t h e ATG p r o p o s e d a s t h e t r a n s l a t i o n i n i t i a t i o n c o d o n f o r t h i s p r e v i o u s l y u n i d e n t i f i e d g ene ( F i g . 37) . The g e n e h a s b e e n named c l g f o r ' c e x - l i n k e d gene'. The most p r o m i n e n t s p e c i e s o f p r o t e c t e d p r o b e were o b s e r v e d i n m a p p i n g e x p e r i m e n t s w i t h RNA f r o m g l y c e r o l - , g l u c o s e - , and C M C -grown C. fimi. H o w e v e r , t h e y a p p e a r e d t o be l e s s a b u n d a n t when C. fimi was g r o w n on g l y c e r o l . Q u i t e i n c o n t r a s t t o t h e d a t a o b t a i n e d w i t h cenA, c e x , a n d cenB ( s e e s e c t i o n 3 . 3 ) , e x p r e s s i o n o f c l g d i d n o t a p p e a r t o be r e d u c e d d r a m a t i c a l l y b y g r o w t h on g l u c o s e as t h e r e w e r e a b u n d a n t c l g t r a n s c r i p t s p r e s e n t i n RNA p r e p a r e d f r o m g l u c o s e - g r o w n c e l l s . A c o m p a r i s o n o f t h e p u t a t i v e c l g p r o m o t e r s e q u e n c e w i t h o t h e r p u t a t i v e C. fimi p r o m o t e r s i s p r e s e n t e d i n t h e D i s c u s s i o n ( s e c t i o n 4 ) . 79 FIGURE 34. R e p r e s e n t a t i o n o f c l o n e d C. fimi DNA c o n t a i n i n g t h e 5' t e r m i n a l p o r t i o n o f t h e c l g g e n e a n d i t s s p a t i a l r e l a t i o n s h i p t o t h e cex g e n e . The r e s t r i c t i o n e n d o n u c l e a s e r e c o g n i t i o n s i t e s a r e a b b r e v i a t e d as f o l l o w s : Bm, B a m H l ; P s , P s t l ; S t , S t y l . The C. fimi DNA s e q u e n c e p r o x i m a l t o t h e BamHl s i t e o f pUC12A25 i s shown w i t h t h e r i b o s o m e b i n d i n g s i t e (RBS) a n d c l g t r a n s l a t i o n s t a r t c o d o n ( u n d e r l i n e d w i t h an a r r o w ) . Bm Ps St Sa 3' -> 5' ...CCTAGGCGTACGGGCGAGGAGGGACAG... RBS BamHl 80 FIGURE 35. I s o l a t i o n o f a h y b r i d i s a t i o n p r o b e t o map t h e 5' t e r m i n u s o f a p u t a t i v e C. fimi gene t r a n s c r i p t . The p l a s m i d PUC12A25 was d i g e s t e d w i t h BamHl, t r e a t e d w i t h C I A P a n d 5'-l a b e l e d w i t h [ y - 3 2 P ] - A T P . a n d T4 PNK. L i n e a r 5 ' - l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h P s t l a n d f r a c t i o n a t e d i n a 5% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l f r a g m e n t w i t h t h e 644 bp B a m H l - P s t l p r o b e was e x c i s e d . The p r o b e was e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . BamHl Sail Sail -BamHl digest -CIAP -Kinase -Pstl digest -5% PA gel -Autoradiography 4.6 kb -excise 0.64 kb band -electroelute into TAE -precipitate with ethanol -recover by precipitation 0.64 kb Legend Vector DNA C. fimi DNA 81 FIGURE 3 6 . M a p p i n g t h e 5 ' end o f a c e x - l i n k e d gene t r a n s c r i p t . A f t e r h y b r i d i s a t i o n w i t h RNA and t r e a t m e n t w i t h SI n u c l e a s e t h e r e m a i n i n g BamRl-Pstl p r o b e ( l a b e l e d a t t h e 5 ' BamHl s i t e ) was a n a l y s e d i n an 8% p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e s e q u e n c e d by t h e b a s e -s p e c i f i c c h e m i c a l c l e a v a g e method (Maxam and G i l b e r t , 1 9 8 0 ) . P r o t e c t i o n o f t h e p r o b e b y : RNA from g l y c e r o l - g r o w n C. f i m i ( l a n e 5 ) , RNA from g l u c o s e - g r o w n C . f i m i ( l a n e 6 ) , RNA from CMC-grown C . f i m i ( l a n e 7) and y e a s t tRNA ( l a n e 8 ) . Lanes 1 t h r o u g h 4 c o n t a i n e d t h e c h e m i c a l s e q u e n c i n g l a d d e r s o f t h e p r o b e : G>A, G+A, T+C, C>T, r e s p e c t i v e l y . Numbers on t h e r i g h t i d e n t i f y t h e s p e c i e s o f p r o t e c t e d p r o b e . 82 5 * - > 3 ' GAACGGCCGCGGGACCTCGGGCCCATCCGTCGGAGCCTCCC + 1 ACGGGACACGATGGACAAGTCGTCCGAGGGGCGGGCGGCGA clg pi CAGGGAGGAGCGGGCATGCGGATCC RBS FIGURE 37. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5' t e r m i n a l p o r t i o n o f clg. O n l y t h e s e n s e s t r a n d o f t h e BamHl p r o x i m a l p o r t i o n o f t h e c l o n e d C. fimi DNA c a r r i e d o n pUC12A25 c o n t a i n i n g clg i s s h o w n . The a r r o w s d e n o t e t h e 3' n u c l e o t i d e s o f t h e p r o t e c t e d f r a g m e n t s o f t h e 5' S I p r o b e . The ATG c o d o n i s o u t l i n e d . The p u t a t i v e r i b o s o m e b i n d i n g s i t e (RBS) i s u n d e r l i n e d w i t h a s t e r i s k s . The p u t a t i v e clg p r o m o t e r r e g i o n i s u n d e r l i n e d . The BamHl s i t e i s u n d e r l i n e d w i t h d o u b l e l i n e s . 83 3 . 5 . C h a r a c t e r i z a t i o n o f t h e abg t r a n s c r i p t s o f Agrobacterium sp. S t r a i n ATCC 21400. 3.5.1. A p p r o x i m a t e l e n g t h o f abg mRNA. A q u a l i t a t i v e n o r t h e r n b l o t a n a l y s i s was u s e d t o d e t e r m i n e t h e a p p r o x i m a t e l e n g t h o f abg mRNA i s o l a t e d f r o m Agrobacterium s p . S t r a i n ATCC 2 1 4 0 0 . F o r t h i s e x p e r i m e n t , Agrobacterium RNA was p r e p a r e d f r o m c u l t u r e s g r o w n i n l o w -s a l t LB medium. The i n t r a g e n i c 241 bp H i n d i I I f r a g m e n t o f abg ( F i g . 38, A) was u s e d as t h e h y b r i d i s a t i o n p r o b e . The p r o b e f r a g m e n t , c a r r i e d on t h e p l a s m i d p T Z 1 9 - B ( F i g . 39/ p r o v i d e d b y W.W. W a k a r c h u k ) , was l a b e l e d b y n i c k - t r a n s l a t i o n . The s p e c i e s o f t h e in vivo abg t r a n s c r i p t d e t e c t e d b y t h e p r o b e was a p p r o x i m a t e l y 1500 b a s e s i n l e n g t h ( F i g . 4 0 ) . T h i s t r a n s c r i p t i s o f s u f f i c i e n t l e n g t h t o e n c o d e t h e abg s t r u c t u r a l gene (see T a b l e I ; Wakarchuk e t a l . , 1 9 8 8 ) . 3.5.2. M a p p i n g t h e 5' ends o f abg mRNA. A h y b r i d p r o t e c t i o n s t u d y was u s e d t o c o n f i r m t h e d i r e c t i o n o f abg t r a n s c r i p t i o n a n d t o l o c a l i s e t h e abg t r a n s c r i p t 5' e n d s . T r a n s c r i p t s s y n t h e s i z e d in vivo w e r e a n a l y s e d b y h i g h r e s o l u t i o n S I n u c l e a s e m a p p i n g . The 0.4 kb EcoRl-Styl DNA r e s t r i c t i o n f r a g m e n t ( F i g . 3 8 , B) i s o l a t e d f r o m t h e p l a s m i d pUC13::A9R5 ( F i g . 41) was u s e d a s t h e h y b r i d i s a t i o n p r o b e . The p r o b e , l a b e l e d a t t h e 5' S t y l s i t e , was d e n a t u r e d i n s o l u t i o n a n d h y b r i d i s e d w i t h t o t a l Agrobacterium RNA and 84 F I G U R E 3 8 . P a r t i a l r e s t r i c t i o n map o f t h e abg g e n e . R e p r e s e n t a t i o n o f c l o n e d Agrobacterium s p . S t r a i n ATCC 21400 DNA c o n t a i n i n g t h e abg gene. The s t r u c t u r a l gene i s shown as a b o x e d r e g i o n a n d i s t r a n s l a t e d f r o m l e f t t o r i g h t ( 5 1 -> 3 ' ) . A, H i n d l l l - t f i n d l l l i n t r a g e n i c n o r t h e r n b l o t p r o b e ; B, E c o R l - S t y l 5 ' S I p r o b e ; C, N c o l - S a l l 3' S I p r o b e . The r e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d as f o l l o w s : R l , EcoRl; H3, Hindlll; N c , N c o l ; RV, EcoRV; S a , S a i l ; S t , Styl. Ec St Nc Hd Nc Sa I i I 1 B C 0 500 bp 85 FIGURE 39. R e p r e s e n t a t i o n o f t h e p l a s m i d pTZ19-B. The 0.24 kb H i n d l l l f r a g m e n t o f abg i s c a r r i e d on t h e v e c t o r pTZ19R ( V i e i r a , J . , U.S. B i o c h e m i c a l company t e c h n i c a l l i t e r a t u r e a c c o m p a n y i n g t h e v e c t o r s p T Z 1 8 / 1 9 , 1985) . P l a s m i d DNA was p u r i f i e d b y C s C l - E t B r g r a d i e n t c e n t r i f u g a t i o n ( M a n i a t i s et al., 1 9 8 2 ) . U s i n g [cc-32p ] -dTTP, dATP, dGTP , dCTP a n d E. c o l i DNA p o l y m e r a s e I , t h e p l a s m i d was n i c k - t r a n s l a t e d t o a s p e c i f i c a c t i v i t y o f 5 X 1 0 ^ cpm ( i g - 1 DNA a n d u s e d a s t h e i n t r a g e n i c abg h y b r i d i s a t i o n p r o b e i n t h e n o r t h e r n b l o t e x p e r i m e n t s . The r e s t r i c t i o n e n d o n u c l e a s e r e c o g n i t i o n s i t e s i n t h e v e c t o r MCS a r e a b b r e v i a t e d a s f o l l o w s : Bm, B a m H l ; H3, H i n d l l l ; Kp, Kpnl; P s , P s t l ; R l , B c o R l ; S a , S a i l ; Sc, S a c l ; Sm, Smal; and Xb, Xbal. 86 FIGURE 40. N o r t h e r n b l o t a n a l y s i s o f abg t r a n s c r i p t s . RNA was p r e p a r e d f r o m Agrobacterium s p . S t r a i n ATCC 21400 grown i n l o w - s a l t LB medium, f r a c t i o n a t e d i n a f o r m a l d e h y d e g e l c o n t a i n i n g 1.0% a g a r o s e a n d t r a n s f e r r e d t o a B i o t r a n s membrane. The b l o t was h y b r i d i s e d w i t h n i c k - t r a n s l a t e d p l a s m i d pTZ19-B DNA. The a r r o w i n d i c a t e s t h e m a j o r h y b r i d . M, l a b e l e d HindiII r e s t r i c t i o n f r a g m e n t s o f lam b d a DNA ( s i z e s i n b a s e s a r e i n d i c a t e d on t h e l e f t ) . M 2 5 2 7 1 6 2 3 87 FIGURE 4 1 . R e p r e s e n t a t i o n o f t h e p l a s m i d pUC13::A9R5. An EcoRl-EcoRV 0.4 k b DNA f r a g m e n t f r o m Agrobacterium s p . S t r a i n ATCC 21400 i s c a r r i e d w i t h i n t h e MCS o f t h e p l a s m i d pUC13 (Wakarchuk, 1 9 8 7 ) . T h i s p l a s m i d was t h e s o u r c e o f t h e DNA p r o b e u s e d t o d e t e c t t h e 5' t e r m i n u s o f abg mRNA i n SI m a p p i n g e x p e r i m e n t s . The p l a s m i d was d i g e s t e d w i t h Styl, t r e a t e d w i t h CIAP, a n d 5 ' - l a b e l e d w i t h [y-32p]_ATP and T4 PNK. The l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h EcoRl a n d f r a c t i o n a t e d b y e l e c t r o p h o r e s i s i n a 5.0% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 232 bp EcoRl-Styl f r a g m e n t l a b e l e d a t t h e 5' S t y l s i t e was e x c i s e d . The p r o b e was e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . R e s t r i c t i o n e n d o n u c l e a s e s a r e a b b r e v i a t e d as f o l l o w s : H3, H i n d l l l ; R l , B c o R l ; S t , S t y l ; . RV/Sm d e n o t e s t h e h y b r i d Smal-EcoRv s i t e c r e a t e d b y l i g a t i o n d u r i n g t h e c o n s t r u c t i o n o f t h e p l a s m i d . The p o s i t i o n o f t h e t r a n s l a t i o n i n i t i a t i o n (ATG) c o d o n i s a l s o shown. The t r a n s l a t i o n o f t h e abg gene i s i n t h e R l -> H3 o r i e n t a t i o n . R l H3 [RV/Sm] St A T G -Styl digest -CIAP -Kinase -Eco Rl digest -5% PA gel -Autoradiography 2.9 kb -excise 0.2 kb band -electroelute into TAE -precipitate with ethanol -recover by centrifugation 0.2 kb Legend Agrobacterium sp . DNA Vector DNA 88 S I n u c l e a s e was u s e d t o d e g r a d e t h e u n p a i r e d p o r t i o n s o f t h e DNA-RNA h y b r i d s . The l e n g t h s o f t h e p r o t e c t e d p r o b e s p e c i e s s t i l l b e a r i n g t h e 3 2 p - i a D e l e d 5 ' - S t y l t e r m i n u s w e r e t h e n d e t e r m i n e d b y g e l e l e c t r o p h o r e s i s u n d e r d e n a t u r i n g c o n d i t i o n s . A s s e e n i n F i g u r e 42, a u t o r a d i o g r a p h y o f t h e a n a l y t i c a l g e l r e v e a l e d s e v e r a l c l o s e l y s p a c e d s p e c i e s o f p r o b e ( l a n e 5) w h i c h may ha v e r e s u l t e d f r o m t h e S I t r e a t m e n t . The m a j o r s p e c i e s c o r r e s p o n d e d t o abg mRNA 5' e n d w h i c h was 115 b a s e s f r o m t h e 3 2 p - i a D e l e d 5' e n d o f t h e p r o b e a n d 22 b a s e s u p s t r e a m o f t h e t r a n s l a t i o n i n i t i a t i o n c o d o n (ATG) d e t e r m i n e d f o r t h e abg gene p r o d u c t ( F i g . 4 3 ; W a k a r c h u c k e t a l . , 1 9 8 8 ) . T h e s e s p e c i e s w e r e n o t d e t e c t e d i n c o n t r o l e x p e r i m e n t s w i t h y e a s t tRNA ( l a n e 6 ) . 3.5.3. M a p p i n g t h e 3' end o f abg mRNA. To i d e n t i f y t h e 3' e n d o f abg mRNA, t r a n s c r i p t s s y n t h e s i z e d in vivo w e r e a n a l y s e d b y S I n u c l e a s e m a p p i n g u s i n g t h e 184 bp N c o l - S a l l DNA r e s t r i c t i o n f r a g m e n t a s t h e h y b r i d i s a t i o n p r o b e ( F i g . 38, C ) . The p r o b e , i s o l a t e d f r o m t h e p l a s m i d pABG5, was l a b e l e d a t t h e 3' N c o l s i t e w i t h 32p ( F i g . 44) . The p r o b e was d e n a t u r e d i n s o l u t i o n a n d h y b r i d i s e d w i t h t o t a l Agrobacterium RNA a n d S I n u c l e a s e was u s e d t o d e g r a d e t h e u n p r o t e c t e d p o r t i o n s o f t h e r e s u l t i n g DNA-RNA h y b r i d s . The l e n g t h o f t h e p r o t e c t e d p r o b e s p e c i e s s t i l l b e a r i n g t h e 32p-i a£, ei ed 3'-NcoI t e r m i n u s was d e t e r m i n e d b y g e l e l e c t r o p h o r e s i s u n d e r d e n a t u r i n g c o n d i t i o n s . A s s e e n 89 i n F i g u r e 45, a u t o r a d i o g r a p h y o f t h e a n a l y t i c a l g e l r e v e a l e d a d i s t i n c t s p e c i e s o f p r o t e c t e d p r o b e ( l a n e 5 ) . T h i s s p e c i e s c o r r e s p o n d e d t o abg mRNA 3' e n d w h i c h was 1474 b a s e s f r o m t h e + 1 s i t e ( F i g . 49) . T h i s i s i n g o o d a g r e e m e n t w i t h t h e n o r t h e r n b l o t d a t a ( F i g . 43) w h i c h i n d i c a t e d t h a t t h e t r a n s c r i p t was a p p r o x i m a t e l y 1500 bp l o n g . The abg mRNA 3' e n d was 71 b a s e s d o w n s t r e a m o f t h e t r a n s l a t i o n a l s t o p c o d o n (TGA) o f t h e abg s t r u c t u r a l gene and was a l s o 91 b a s e s f r o m t h e 3 2 p - i a b e i e c i e n d o f t h e p r o b e DNA. T h i s s p e c i e s o f p r o b e was n o t o b s e r v e d i n t h e c o n t r o l e x p e r i m e n t s w i t h y e a s t t R N A ( F i g . 4 8, l a n e 6) . F r o m t h e r e s u l t s o f t h e n o r t h e r n b l o t a n d S I m a p p i n g e x p e r i m e n t s , a n d s i n c e no open r e a d i n g f r a m e was f o u n d i m m e d i a t e l y d o w n s t r e a m o f t h e abg s t o p c o d o n , t h e abg g e n e a p p e a r s t o b e m o n o c i s t r o n i c . 90 FIGURE 4 2 . M a p p i n g t h e 5 ' end o f abg mRNA . F o l l o w i n g h y b r i d i s a t i o n o f t h e S c o R l - S t y l DNA w i t h RNA ( l a n e 5, Agrobacterium s p . S t r a i n ATCC 21400 RNA; l a n e 6, y e a s t tRNA) and d i g e s t i o n w i t h SI n u c l e a s e , p r o b e DNA was a n a l y s e d i n an 8.0% p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e sequenced by t h e c h e m i c a l c l e a v a g e method (Maxam and G i l b e r t , 1980) . Lanes 1 t h r o u g h 4 c o n t a i n t h e sequence l a d d e r s G>A, G+A, T+C, C>T, r e s p e c t i v e l y . The a r r o w i n d i c a t e s t h e m i g r a t i o n o f t he major p r o t e c t e d probe s p e c i e s . 91 5' -> 3' GCCGAACCCGACTGTACCTCGCAGGCGACATGGTCTAAA abgpl +1 CCGCTGCTGATCTTTTCACATCCGATGGACTCTCCG&TCa, ****** RBS FIGURE 4 3 . DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 5 1 - t e r m i n a l r e g i o n o f abg mRNA. O n l y t h e s e n s e s t r a n d i s shown. The a r r o w s d e n o t e t h e 3' n u c l e o t i d e s o f t h e p r o t e c t e d f r a g m e n t s o f t h e 5' S I p r o b e . The ATG c o d o n i s o u t l i n e d . The p u t a t i v e r i b o s o m e b i n d i n g s i t e (RBS) i s u n d e r s c o r e d w i t h a s t e r i s k s . The p u t a t i v e abgpl p r o m o t e r s e q u e n c e i s u n d e r l i n e d . 92 FIGURE 44. R e p r e s e n t a t i o n o f t h e p l a s m i d pABG5. An EcoRl-H i n d l l l 1.6 kb DNA f r a g m e n t o f Agrobacterium s p . S t r a i n ATCC 21400 i s c a r r i e d on t h e p l a s m i d pUC18 ( W a k a r c h u k , 1 9 8 7 ) . T h i s p l a s m i d was t h e s o u r c e o f t h e DNA p r o b e u s e d t o d e t e c t t h e abg mRNA 3 ' - t e r m i n u s i n S I m a p p i n g e x p e r i m e n t s . The p l a s m i d was d i g e s t e d w i t h Ncol, a n d 3 ' - l a b e l e d w i t h [oc-32p]-dATP, dCTP a n d t h e K l e n o w f r a g m e n t o f DNA p o l y m e r a s e I t o a s p e c i f i c a c t i v i t y o f 5 X 10^ cpm j i g D N A - 1 . The l a b e l e d p l a s m i d DNA was t h e n d i g e s t e d w i t h S a i l a n d f r a c t i o n a t e d by e l e c t r o p h o r e s i s i n a 5.0% p o l y a c r y l a m i d e g e l . A f t e r a u t o r a d i o g r a p h y , a g e l s l i c e w i t h t h e 183 bp Ncol-Sail f r a g m e n t l a b e l e d a t t h e 3' N c o l s i t e was e x c i s e d . The p r o b e was e l e c t r o e l u t e d i n t o TAE b u f f e r , p r e c i p i t a t e d w i t h e t h a n o l a n d r e c o v e r e d b y c e n t r i f u g a t i o n . T h e r e s t r i c t i o n e n d o n u c l e a s e r e c o g n i t i o n s i t e s a r e a b b r e v i a t e d a s f o l l o w s : N c, Ncol; S a , S a i l ; a n d S t , S t y l . Sm/Exo d e n o t e s t h e h y b r i d S m a l s i t e g e n e r a t e d f r o m t h e l i g a t i o n o f a b l u n t -e n d e d e x o n u c l e a s e I I I d e l e t i o n f r a g m e n t i n t o t h e MCS S m a l s i t e o f pUC18 (Wakarchuk. 1 9 8 7 ) . [Sm/Exo] -Ncol digest -Fill in with Klenow and dCTP and [c(-3*P]-dATP -Sail digest -5% PA gel ^ ^  -Autoradiography 1 i 3.4 kb ^ -excise gel slice with 0.18kb probe 0.74 kb -electroelute into TAE buffer -precipitate with ethanol I -recover by centrifugation 0.18 kb H X N X V W X X X N X X W V O C C Legend Agrobacterium sp . DNA Vector DNA 93 FIGURE 45. M a p p i n g t h e 3' e n d o f abg mRNA. F o l l o w i n g t h e h y b r i d i s a t i o n o f t h e Ncol-Sail DNA w i t h RNA ( l a n e 5, Agrobacterium s p . S t r a i n ATCC 21400 RNA; l a n e 6, y e a s t tRNA) a n d d i g e s t i o n w i t h S I n u c l e a s e , p r o b e DNA was a n a l y s e d i n an 8.0% p o l y a c r y l a m i d e - 7 M u r e a s e q u e n c i n g g e l a l o n g s i d e p r o b e s e q u e n c e d b y t h e c h e m i c a l c l e a v a g e method (Maxam and G i l b e r t , 1980) . L a n e s 1 t h r o u g h 4 c o n t a i n t h e s e q u e n c e l a d d e r s G>A, G+A, T+C, C>T, r e s p e c t i v e l y . The a r r o w i n d i c a t e s t h e m i g r a t i o n o f t h e p r o t e c t e d p r o b e . 1 2 3 4 5 6 94 5' -> 3 > < TGaGGTTTTCTCTCCTCATCCCTCTGCTCGTCACAGGGTACTAGC 1474 > < J, CAGCCCAAGTCCTTGGGCTGAGGGGAGTCTTTCGCCACGCGGAAC FIGURE 46. DNA s e q u e n c e c o r r e s p o n d i n g t o t h e 3'- t e r m i n a l r e g i o n o f abg mRNA. O n l y t h e s e n s e s t r a n d i s shown. The v e r t i c a l a r r o w d e n o t e s t h e 5' n u c l e o t i d e o f t h e p r o t e c t e d f r a g m e n t o f t h e 3' S I DNA p r o b e . The TGA s t o p c o d o n i s o u t l i n e d . The n u c l e o t i d e s e q u e n c e s w h i c h may f o r m s t e m - l o o p s t r u c t u r e s a r e shown as o p p o s i n g h o r i z o n t a l a r r o w s . 95 4. D i s c u s s i o n 4.1. The cenA, cex and cenB t r a n s c r i p t s o f C. fimi The in vivo t r a n s c r i p t s o f t h e cenA, cex, a n d c e n B g e n e s e n c o d i n g t h e e x t r a c e l l u l a r e n z y m e s EngA, E x g a n d EngB, r e s p e c t i v e l y , o f C. fimi s t r a i n ATCC 484 h a v e b e e n i n v e s t i g a t e d . By n o r t h e r n (RNA) b l o t a n a l y s i s o f C. fimi RNA p r e p a r e d f r o m c e l l s grown on t h e s o l u b l e c e l l u l o s i c s u b s t r a t e CMC, t h e c e n A , cex a n d c e n B g e n e s a p p e a r e d t o be t r a n s c r i b e d a s mRNAs 1,400, 1,500 a n d 3,200 b a s e s l o n g , r e s p e c t i v e l y . W h i l e t h e d a t a s u g g e s t s t h a t t h e s e mRNA a r e m o n o c i s t r o n i c , t r a n s c r i p t i o n a n d RNA p r o c e s s i n g c o u l d a l s o r e s u l t i n a p p a r e n t m o n o c i s t r o n i c mRNA w h i c h w e r e a c t u a l l y g e n e r a t e d f r o m l o n g e r t r a n s c r i p t s . T h i s i s a l s o d i s c u s s e d b e l o w w i t h t h e S I m a p p i n g d a t a . B o t h c e n A a n d c e n B mRNAs w e r e d e t e c t e d b y n o r t h e r n b l o t a n a l y s i s i n RNA p r e p a r e d f r o m c e l l s g r o w n on g l y c e r o l , a c a r b o n s o u r c e n o t known t o i n d u c e , b u t w h i c h may r e p r e s s c e l l u l a s e e x p r e s s i o n i n Cellulomonas spp. ( B e g u i n et al., 1 9 7 7 ) . No cex mRNA was d e t e c t e d by n o r t h e r n b l o t a n a l y s i s i n t h e s e p r e p a r a t i o n s . A l t h o u g h n o t q u a n t i t a t i v e , t h e n o r t h e r n b l o t d a t a d i d i n d i c a t e t h a t u n d e r n o n - i n d u c i n g g r o w t h c o n d i t i o n s t h e r e l a t i v e l e v e l s f o r cenA a n d cenB mRNAs ( b o t h e n c o d i n g e n d o g l u c a n a s e s ) a p p e a r e d t o be g r e a t e r t h a n t h o s e o b s e r v e d f o r cex mRNA ( e n c o d i n g an e x o g l u c a n a s e ) . T h e s e f i n d i n g s s u g g e s t e d t h a t t h e s u b s t r a t e p r o v i d e d d u r i n g C. fimi 96 g r o w t h was somehow a f f e c t i n g t h e e x p r e s s i o n o f cenA, cex and cenB. The in vivo cenA, cex a n d c e n B mRNA 5' t e r m i n i w e r e l o c a l i s e d b y n u c l e a s e S I h y b r i d - p r o t e c t i o n s t u d i e s u s i n g 5'-32 P - l a b e l e d DNA p r o b e s . I t s h o u l d be n o t e d t h a t t h i s t y p e o f a n a l y s i s o n l y d e f i n e s t h e e n d s o f t h e t r a n s c r i p t s , a n d t h e s e e n d s do n o t n e c e s s a r i l y c o r r e s p o n d t o t r u e t r a n s c r i p t s t a r t a n d s t o p s i t e s ( i . e . t h e y c o u l d map mRNA t e r m i n i w h i c h r e s u l t f r o m t h e p r o c e s s i n g o f l o n g e r ' r e a d - t h r o u g h ' t r a n s c r i p t s ) . T h e r e f o r e , t h e S I m a p p i n g s t u d i e s w e r e u s e d t o l o c a l i s e t h e r e g i o n s o f C. fimi DNA p o t e n t i a l l y r e s p o n s i b l e f o r d i r e c t i n g t h e i n i t i a t i o n a n d t e r m i n a t i o n o f t r a n s c r i p t i o n s i n c e no o t h e r s y s t e m was y e t a v a i l a b l e t o d e f i n e t h e s e c o n t r o l e l e m e n t s . I t s h o u l d a l s o be m e n t i o n e d t h a t t h e s e w e r e t h e f i r s t e x p e r i m e n t s t o l o c a l i s e t h e C. fimi t r a n s c r i p t i o n a l r e g u l a t o r y r e g i o n s a n d no o t h e r C. fimi p r o m o t e r s e q u e n c e s w e r e a v a i l a b l e f o r d i r e c t c o m p a r i s o n s . F u r t h e r g e n e t i c a n a l y s i s i s t h e r e f o r e r e q u i r e d t o u n e q u i v o c a l l y i d e n t i f y t h e f u n c t i o n a l C. fimi p r o m o t e r s and t e r m i n a t o r s o f t h e s e g e n e s . W i t h t h e c e n A mRNA 5 ' - s p e c i f i c p r o b e , f o u r cenA mRNA 5' t e r m i n i w e r e f o u n d b e t w e e n 62 a n d 50 b a s e s u p s t r e a m f r o m t h e ATG c o d o n , t h r e e c l o s e l y s p a c e d a n d t h e f o u r t h a b o u t 11 b a s e s f u r t h e r u p s t r e a m ( F i g . 6 ) . S i n c e h e t e r o g e n e i t y due t o S I a r t i f a c t s a r e o f t e n a s s o c i a t e d w i t h t h e a n a l y s i s o f G+C r i c h DNA, t h i s d a t a a t b e s t s u g g e s t e d cenA t r a n s c r i p t i o n was b e i n g d i r e c t e d f r o m t w o p r o m o t e r s ( F i g . 7 ) : p r o m o t e r cenApl 97 d i r e c t i n g t r a n s c r i p t i o n f r o m p o s i t i o n +1 ( w h i c h a p p e a r e d t o be t h e s t r o n g e s t a u t o r a d i o g r a p h i c s i g n a l i n F i g . 6 ) , a n d t h e p r o m o t e r cenAp2 w h i c h was d i r e c t i n g t r a n s c r i p t i o n f r o m p o s i t i o n -11 (a wea k e r s i g n a l r e l a t i v e t o +1 i n F i g . 6, ) . W i t h t h e c e x mRNA 5 ' - s p e c i f i c S I DNA p r o b e , f o u r p o s s i b l e c e x mRNA 5' t e r m i n i w e r e i d e n t i f i e d b e t w e e n 29 a n d 26 b a s e s u p s t r e a m f r o m t h e ATG c o d o n . T a k i n g i n t o a c c o u n t t h e 'end-h e t e r o g e n e i t y ' i n h e r e n t i n S I a n a l y s i s , t h e t r a n s c r i p t i o n o f t h e c e x gene a p p e a r e d t o be d i r e c t e d f r o m a s i n g l e p r o m o t e r , cexpl (see F i g . 2 1 ) . To d e m o n s t r a t e t h a t t r u e 5' t e r m i n i h a d b e e n l o c a l i s e d f o r b o t h t h e c e n A a n d c e x g e n e s , t h e v a c c i n i a v i r u s c a p p i n g enzyme was e m p l o y e d t o in v i t r o l a b e l t h e 5' t e r m i n i o f C. fimi t r a n s c r i p t s s y n t h e s i z e d in vivo. T h e s e c a p p e d t r a n s c r i p t s w e r e u s e d i n h y b r i d p r o t e c t i o n s t u d i e s w i t h u n l a b e l e d DNA r e s t r i c t i o n f r a g m e n t p r o b e s . S i n c e p r i m a r y t r a n s c r i p t s w e r e t h e o n l y s u i t a b l e s u b s t r a t e s f o r t h e l a b e l i n g r e a c t i o n , t h e n o n l y s u c h t r a n s c r i p t s , a p r i o r i , c o u l d be p r o t e c t e d b y cenA o r c e x s p e c i f i c DNA p r o b e s i n t h e h y b r i d p r o t e c t i o n s t u d i e s . As a r e s u l t o f t h e s e p r o c e d u r e s i t was c o n f i r m e d t h a t t r u e 5' t e r m i n i h a d b e e n mapped f o r b o t h t h e c e n A a n d c e x g e n e s ( F i g . 9 a n d 2 3 ) . H o w e v e r , i t was n o t p o s s i b l e t o d e m o n s t r a t e t h e p r e s e n c e o f t h e c e n A d i s t a l (cenAp2 d i r e c t e d ) s t a r t s i t e b y t h i s a p p r o a c h , p o s s i b l y o w i n g t o t h e r a t h e r l o w s p e c i f i c - a c t i v i t y o f t h e c a p p e d RNA ( a b o u t 1/10 t h a t o f t h e 3 2 P - l a b e l e d DNA p r o b e ) 98 c o u p l e d w i t h t h e r e l a t i v e l y l o w abu n d a n c e o f t h e mRNA s p e c i e s (as d e t e r m i n e d f r o m t h e a u t o r a d i o g r a m s o f S I a n a l y t i c a l g e l s ) . T h e r e f o r e , i d e n t i f i c a t i o n o f a cenAp2 p r o m o t e r was b a s e d s o l e l y on t h e r e s u l t s o f t h e S I m a p p i n g d a t a u s i n g t h e l a b e l e d DNA p r o b e . H y b r i d p r o t e c t i o n s t u d i e s w e r e a l s o u s e d t o l o c a l i s e t h e in vivo cenB mRNA 5' t e r m i n i . T h r e e 5' t e r m i n i w e r e r e s o l v e d i n t h e S I e x p e r i m e n t s . T h e s e w e r e c l u s t e r e d u p s t r e a m o f t h e c e n B ATG t r a n s l a t i o n i n i t i a t i o n c o d o n . S i m i l a r c l u s t e r i n g s w e r e a l s o o b s e r v e d i n t h e c e n A a n d cex m a p p i n g s t u d i e s , p o s s i b l y r e f l e c t i n g some f l e x i b i l i t y i n t h e s e l e c t i o n o f a t r a n s c r i p t i n i t i a t i o n s i t e b y C. fimi RNA p o l y m e r a s e o r t h e h e t e r o g e n e i t y i n h e r e n t i n S I a n a l y s e s as a l r e a d y m e n t i o n e d . I t s h o u l d b e m e n t i o n e d t h a t s i m i l a r c l u s t e r i n g s o f p r o t e c t e d s p e c i e s h a v e b e e n o b s e r v e d i n t h e m a p p i n g e x p e r i m e n t s c o n d u c t e d b y a n o t h e r i n v e s t i g a t o r i n o u r l a b who was m a p p i n g t h e 5' e n d s o f C. fimi cenC mRNA e n c o d i n g e n d o g l u c a n a s e E n g C ( B . M o s e r , p e r s o n a l c o m m u n i c a t i o n ) . A l e s s a b u n d a n t cenB t r a n s c r i p t 5' e n d was f o u n d 52 b a s e s c l o s e r ( + 52) t o t h e c e n B ATG c o d o n a n d was d e t e c t e d i n m a p p i n g e x p e r i m e n t s w i t h RNA f r o m C. fimi grown on any one o f t h e t h r e e s u b s t r a t e s . The +52 s p e c i e s was a v e r y m i n o r p r o d u c t o f t h e a n a l y s i s a n d t h e o n l y c o n t r o l w h i c h s u g g e s t e d t h e a u t h e n t i c i t y o f t h i s s p e c i e s was t h e c o n t r o l e x p e r i m e n t w i t h y e a s t tRNA. M a p p i n g e x p e r i m e n t s w i t h c a p p e d RNA w e r e n o t p e r f o r m e d f o r c e n B a s t h e c o s t s o f t h e s e a n a l y s i s h a d 99 become p r o h i b i t i v e . A t b e s t , t h e c e n B m a p p i n g d a t a c a n b e i n t e r p r e t e d t o s u g g e s t two t a n d e m f u n c t i o n i n g p r o m o t e r s ( s e e F i g . 3 3 ) : t h e d i s t a l cenBpl d i r e c t i n g t r a n s c r i p t i o n p r e d o m i n a n t l y f r o m t h e +1 p o s i t i o n ( t h e s t r o n g e s t s i g n a l on t h e a u t o r a d i o g r a m s ) a n d t h e p r o x i m a l ( a n d v e r y t e n t a t i v e ) cenBp2 d i r e c t i n g t r a n s c r i p t i o n f r o m p o s i t i o n +52. T r a n s c r i p t i o n f r o m cenBpl was e v i d e n t l y i n d u c e d a s a f u n c t i o n o f C. fimi g r o w t h on CMC w h i l e cenBp2 a p p e a r e d t o d i r e c t l o w - l e v e l ( a n d m o s t l i k e l y c o n s t i t u t i v e ) t r a n s c r i p t i o n t h a t was n o t i n d u c e d a s a f u n c t i o n o f C M C - s u p p o r t e d g r o w t h . Why f e w e r t r a n s c r i p t s m i g h t i n i t i a t e a t s i t e +52 i n c e l l s g r o w n i n CMC-medium t h a n i n c e l l s g r o w n i n e i t h e r g l y c e r o l - o r g l u c o s e - m e d i u m may r e s u l t f r o m i n i t i a t i o n s a t t h e cenBpl p r o m o t e r i n t e r f e r i n g w i t h t h e f r e q u e n c y o f i n i t i a t i o n s a t t h e cenBp2 p r o m o t e r . T h i s t a n d e m a r r a n g e m e n t o f a r e g u l a t e d , ( i n d u c i b l e ) p r o m o t e r a n d a c o n s t i t u t i v e p r o m o t e r c l o s e l y r e s e m b l e s t h a t r e p o r t e d f o r t h e p r o m o t e r s o f t h e S t r e p t o m y c e s l i v i d a n s g a l a c t o s e o p e r o n ( F o r n w a l d e t a l . , 1 9 8 7 ) . The f i n d i n g t h a t p r e d o m i n a n t l y G a n d C r e s i d u e s c o r r e s p o n d e d t o t h e 5' e n d s mapped b y h y b r i d p r o t e c t i o n a n a l y s i s f o r a l l b u t t h e c l g t r a n s c r i p t s ( w h i c h i n i t i a t e d w i t h A) was n o t u n e x p e c t e d c o n s i d e r i n g t h e h i g h G+C c o n t e n t o f C. fimi DNA. H o w e v e r , t h i s o b s e r v a t i o n i s o f i n t e r e s t s i n c e t h e m a j o r i t y o f p r o k a r y o t i c g e n e t r a n s c r i p t s s o f a r mapped i n i t i a t e w i t h pppG o r pppA ( H a w l e y a n d M c C l u r e , 1983; 100 R o s e n b e r g a n d C o u r t , 1 9 7 9 ; M o r a n e t al., 1 9 8 2 ) . A n o t h e r i n t e r e s t i n g o b s e r v a t i o n was t h a t a l t h o u g h C. fimi DNA i s v e r y G+C r i c h , t h e 5' t e r m i n i mapped f o r t h e cenA, c e x a n d c e n B t r a n s c r i p t s f e l l w i t h i n r e g i o n s t h a t w e r e r e l a t i v e l y A+T r i c h , c h a r a c t e r i s t i c o f t h e t r a n s c r i p t i o n a l r e g u l a t o r y r e g i o n s o b s e r v e d f o r m o s t p r o k a r y o t i c g e n e s ( H a w l e y a n d M c C l u r e , 1 9 8 3 ; R o s e n b e r g a n d C o u r t , 1 9 7 9 ; M o r a n e t al., 1 9 8 2 ) . To i d e n t i f y r e g i o n s w h i c h c o u l d r e p r e s e n t t h e DNA s e q u e n c e s r e c o g n i z e d b y C. fimi RNA p o l y m e r a s e , c o m p a r i s o n s w e r e made b e t w e e n t h e s e q u e n c e s i m m e d i a t e l y p r e c e d i n g t h e mapped 5' t e r m i n i t h e m s e l v e s t o s e e i f any common DNA s e q u e n c e s c o u l d b e f o u n d . A s w e l l , c o m p a r i s o n s w e r e made t o t h e c h a r a c t e r i z e d p r o k a r y o t i c p r o m o t e r '-10' a n d '-35' r e g i o n s o f o t h e r o r g a n i s m s t o s e e w h e t h e r t h e C. fimi DNA s e q u e n c e s i n t h e s e r e g i o n s m a t c h e d w i t h known p r o m o t e r s e q u e n c e s . T h e s e c o m p a r i s o n s w e r e a l s o u s e d i n t h e i d e n t i f i c a t i o n o f t h e c l g g e n e b y s e q u e n c e i n s p e c t i o n . The b e s t -35 a n d -10 r e g i o n s i m i l a r i t i e s a r e s u m m a r i z e d i n F i g u r e s 47A a n d 47B. 101 F I G U R E 4 7 . P r o m o t e r r e g i o n s i m i l a r i t i e s . A. The DNA s e q u e n c e s ( s e n s e s t r a n d ) f l a n k i n g t h e mapped c e n A , cex, cenB, clg, a n d abg t r a n s c r i p t i o n a l s t a r t s i t e s a r e c o m p a r e d f o r s i m i l a r i t i e s w i t h t h e - 3 5 a n d -10 r e g i o n s o f c h a r a c t e r i z e d p r o m o t e r s pBR322 tet ( H a w l e y a n d M c C l u r e , 1 9 8 3 ) ; E. c o l i a 7 ^ c o n s e n s u s p r o m o t e r ( H a w l e y a n d M c C l u r e , 1 9 8 3 ) ; t s r p l (Hopwood e t al., 1 9 8 6 ) ; ermpl a n d ermp2 ( B i b b , J a n s s e n and Ward., 1 9 8 5 ) . B. The p r o m o t e r r e g i o n s o f t h e C. fimi g e n e s a r e c o m p a r e d t o e a c h o t h e r t o i d e n t i f y t h e i r -35 a n d -10 r e g i o n s i m i l a r i t i e s . The mapped 5' e n d s a r e u n d e r l i n e d . A . PROMOTER ' - 3 5 ' AND ' - 1 0 ' REGION SIMILARITIES 5 ' -> 3 ' z35 -10  1. cenApl: TCCTCATCCGCTCGCGCCGTGGGGCATTCGTCGGGTTTCCTCGTCGGG pBR322 tet TTGACA • TTTAAT ermpl TGGACA TAGGAT 2 . cenAp2: CGATTAGGAAATCCTCATCCGCTCGCGCCGTGGGGCATTCGTCGGG-TT E. COli O 7 0 TTGACA TATAAT 3. cenBp2: GCCAGGCGTCGTGCGGGTGCGACTGCGGACAGCACGGGTCGCCGACCACCAC.TC t s r p 2 AGGGCA TAGGGT 4. cexpl : TTCAGCACCTCCCGCGGACGGGCCCCCACGTCACAGGGTGCACC.CG t s r p 2 AGGGCA TAGGGT 5. cenBpl: TTTAGGGCGTTGACCTGCGGACGGACCCGTCTGGACGATGCG.CC e r m p 2 TTGACG GAGGAT 6. Clgpl : CCTCGGGCCCATCCGTCGGAGCCTCCCACGGGACACGATGGACAAGT ermp2 TTGACG GAGGAT 7. abgpl GACTGTACCTCGCAGGCGACATGGTCTAAACCGCTGCTGATCTTTTC E. COli O 7 0 TTGACA TATAAT n if GGTAT TGCT C C A t—1 o C. fimi PROMOTER REGION SIMILARITIES 5' -> 3' '-35' '-10' 5'-> cenApl: TCCTCATCC GCTCGCG CCGTGGGGCATTCGTC GGGTTT CCTCGTCG.GG cenAp2: CGATTAGGA AATCCTC ATCCGCTCGCGCCGTGG GGCATT CGTCGGGTT cenBp2: GCCAGGCGT CGTGCGG GTGCGACTGCGGACAGC ACGGGT CGCCGACCACCACTC cexpl : TTCAGCACC TCCCGCG GACGGGCCCCCACGTCA CAGGGT GCACC.CG cenBpl: TTTAGGGCG TTGACCT GCGGACGGACCCGTCTG GACGAT GC£CC clgpl : CCTCGGGCC CATCCGT CGGAGCCTCCCACGGGA CACGAT GGACAAGT 104 A f t e r c o m p a r i s o n w i t h known p r o m o t e r s e q u e n c e s , some m a t c h e s ( f o r -10 a n d -35 r e g i o n s i m i l a r i t i e s ) w e r e o b s e r v e d b e t w e e n t h e Streptomyces spp. p r o m o t e r s a n d t h e C. fimi s e q u e n c e s i m m e d i a t e l y u p s t r e a m o f t h e mapped cenA, cex a n d ce n B mRNA 5' t e r m i n i . I n t h e a b s e n c e o f f u n c t i o n a l d a t a on C. fimi p r o m o t e r s , n o t much c a n b e d r a w n i n t h e way o f c o n c l u s i o n s f r o m t h e s e c o m p a r i s o n s . H o w e v e r , t h a t t h e b e s t m a t c h e s w e r e t o t h e Streptomyces sp. p r o m o t e r s was n o t s u r p r i s i n g , s i n c e S t r e p t o m y c e s sp., l i k e C. fimi, a r e gram-p o s i t i v e b a c t e r i a w i t h h i g h G+C DNA. T h e r e f o r e , one m i g h t e x p e c t t h a t t h e s e q u e n c e s w h i c h s i g n a l t h e p r o m o t i o n o f t r a n s c r i p t i o n i n t h e s e b a c t e r i a m i g h t b e s i m i l a r . F o r e x a m p l e , i m m e d i a t e l y u p s t r e a m o f t h e cenB +1 s i t e ( p u t a t i v e cenBpl) t h e s e q u e n c e TTGACC i s v e r y s i m i l a r t o t h e Streptomyces erythraeus ermp2 -35 s e q u e n c e TTGACG ( B i b b , J a n s s e n a n d Ward, 1985) a n d t h e C. fimi s e q u e n c e GACGAT i s v e r y s i m i l a r t o t h e Streptomyces -10 s e q u e n c e GAGGAT w i t h a r e a s o n a b l e 18 bp s p a c i n g b e t w e e n t h e two s t r e t c h e s o f C. fimi s e q u e n c e . The p u t a t i v e cexpl s e q u e n c e CAGGGT s h o w e d a s i m i l a r i t y w i t h Streptomyces t s r p l -10 r e g i o n s e q u e n c e TAGGGT ( B i b b e t al, 1985) . As w e l l , t h e p u t a t i v e clgpl p r o m o t e r s e q u e n c e CACGAT showed h o m o l o g y w i t h t h e ermp2 p r o m o t e r -10 s e q u e n c e GAGGAT. I t i s c u r i o u s t h a t t h e b e s t p r o m o t e r m a t c h e s w e r e -10 r e g i o n m a t c h e s b e t w e e n t h e C. fimi c e l l u l a s e e n c o d i n g g e n e s a n d t h e a n t i b i o t i c r e s i s t a n c e g e n e s o f Streptomyces, w i t h f e w e r -35 r e g i o n s i m i l a r i t i e s . P o s s i b l y , 105 t h e C. fimi RNA p o l y m e r a s e r e c o g n i z e s d i f f e r e n t b i n d i n g s i t e s e q u e n c e s ('-35') t h a n t h e Streptomyces p o l y m e r a s e , y e t t h e y may r e c o g n i s e s i m i l a r s e q u e n c e s ('-10') w h i c h s i g n a l f o r t h e i n i t i a t i o n o f t r a n s c r i p t i o n . M a p p i n g s t u d i e s h a v e b e e n p e r f o r m e d t o d e t e r m i n e w h e t h e r p u t a t i v e C. fimi p r o m o t e r s w e r e f u n c t i o n a l i n h e t e r o l o g o u s h o s t s . W i t h RNA i s o l a t e d f r o m E. c o l i c e l l s c a r r y i n g r e c o m b i n a n t p l a s m i d s w i t h p u t a t i v e C. fimi p r o m o t e r DNA, t r a n s c r i p t s w e r e n o t f o u n d w h i c h i n i t i a t e d w i t h i n t h e i n s e r t s ( G r e e n b e r g , e t al, 1987b) . The c e n A a n d c e x g e n e s f r o m C. fimi h a v e a l s o b e e n p l a c e d on a p l a s m i d s h u t t l e - v e c t o r t o f a c i l i t a t e t h e i r e n g i n e e r i n g i n E. c o l i a n d s u b s e q u e n t i n t r o d u c t i o n i n t o t h e n o n - c e l l u l o l y t i c g r a m - p o s i t i v e b a c t e r i a B r e v i j b a c t e r i u / n lactofermentum ( P a r a d i s e t al., 1 9 8 8 ) . A l t h o u g h t h e c e n A a n d c e x g e n e s w e r e f u n c t i o n a l l y e x p r e s s e d i n t h e Brevibacterium, S I m a p p i n g e x p e r i m e n t s h a v e s i n c e d e m o n s t r a t e d t h e s e q u e n c e s w h i c h s i g n a l t h e i n i t i a t i o n o f t r a n s c r i p t i o n o f t h e s e g e n e s i n Brevibacterium w e r e p r o b a b l y w i t h i n t h e v e c t o r DNA a n d n o t w i t h i n t h e f l a n k i n g C. fimi DNA i n s e r t s ( F . P a r a d i s , p e r s o n a l c o m m u n i c a t i o n ) . T h e r e a r e a t l e a s t t h r e e p o s s i b i l i t i e s a s t o why t h e a p p r o p r i a t e l y i n i t i a t i n g t r a n s c r i p t s f r o m t h e r e c o m b i n a n t c e l l u l a s e g e n e s may n o t h a v e b e e n d e t e c t e d i n t h e h e t e r o l o g o u s h o s t s . F i r s t l y , t h e E. c o l i a n d Brevibacterium RNA p o l y m e r a s e s may n o t h a v e b e e n a b l e t o r e c o g n i z e t h e C. fimi p r o m o t e r s . S e c o n d l y , t h e RNA p o l y m e r a s e s may h a v e r e c o g n i z e d t h e 106 p r o m o t e r s b u t w e r e i n c a p a b l e o f i n i t i a t i n g o r e l o n g a t i n g t h e t r a n s c r i p t s . T h i r d l y , t h e r e s u l t i n g ' h y b r i d 1 t r a n s c r i p t s may h ave b e e n i n t r i n s i c a l l y u n s t a b l e . P r e v i o u s l y d e t e r m i n e d DNA s e q u e n c e s f l a n k i n g t h e c e n A , c e x a n d c e n B g e n e s w e r e i n s p e c t e d f o r r e g i o n s f i t t i n g a ' p r o m o t e r - r i b o s o m e b i n d i n g s i t e - ATG c o d o n ' p a r a d i g m . T h i s l e a d t o t h e i d e n t i f i c a t i o n o f a p r e v i o u s l y u n c h a r a c t e r i z e d g e n e , u p s t r e a m o f , a n d d i v e r g e n t t o , t h e cex g e n e . T h i s ' f o u n d g e n e ' h a s b e e n d e s i g n a t e d c l g f o r ' c e x - l i n k e d g e n e ' . H y b r i d p r o t e c t i o n a n a l y s i s h a s c o n f i r m e d t h e e x i s t e n c e o f a c l g t r a n s c r i p t a n d h a s l o c a l i s e d t h e c l g mRNA 5' t e r m i n u s . T h i s a p p r o a c h p r o v e d t h a t t h e p u t a t i v e c e n A , c e x a n d c e n B p r o m o t e r s e q u e n c e s a l r e a d y l o c a l i s e d t h r o u g h h y b r i d -p r o t e c t i o n a n a l y s i s c o u l d b e u s e d t o i d e n t i f y o t h e r t r a n s c r i p t i o n a l u n i t s b y i n s p e c t i o n o f C. fimi DNA. W h i l e t h e s t r u c t u r e o f c l g i s n o t y e t known ( t h e e n t i r e gene h a s y e t t o be c l o n e d a n d s e q u e n c e d ) a n d t h e f u n c t i o n o f t h e c l g g e n e - p r o d u c t r e m a i n s u n c h a r a c t e r i z e d , i t was i n t e r e s t i n g t o f i n d c l g RNA i n a b u n d a n c e f r o m b o t h g l u c o s e - a n d CMC-grown c e l l s . A c o m p a r a t i v e a n a l y s i s o f t h e 5' f l a n k i n g DNA s e q u e n c e s o f t h e cenA, cex, cenB, a n d c l g g e n e s h a s r e v e a l e d a r e g i o n o f 50 b a s e s i n w h i c h t h e s e f o u r s e q u e n c e s d i s p l a y a t l e a s t 6 4% h o m o l o g y ( F i g . 48) . The m o s t i m p o r t a n t f e a t u r e f r o m t h e s e c o m p a r i s o n s was t h a t i n e a c h c a s e , a 'GAA-box' c o u l d be 107 FIGURE 48. C o n s e r v e d DNA s e q u e n c e s f l a n k i n g mapped 5' mRNA en d s o f C. fimi g e n e s . Gaps h a v e b e e n i n t r o d u c e d i n t o t h e s e q u e n c e s t o a l l o w f o r b e s t m a t c h e s . M a t c h e s a r e d e n o t e d b y a s t e r i s k s . The +1 s i t e s f o r cenBpl, cexpl, cenApl, a n d c l g a r e u n d e r l i n e d , a n d t r a n s c r i p t s a r e i n d i c a t e d b y d o t s . Shown a r e t h e n u c l e o t i d e s w h i c h a r e 100% ( 4 / 4 ) , 7 5 % (3/4) a nd 50% (2/4) c o n s e r v e d . DNA SEQUENCE 5' -> 3' cenB: GCTGAA TCGTTTAGGGCGTTGACCTGCGGACGGACCCGTC TGG AC GATGCG.. . . ** *** *** ** * * ** ******** *** * * ** * *** cex: GCCGAAAT GATTCAGCACCT CCC GCGGACGGGCCCCACGTCACA GGGTGCAC£. . . ****** *** * * * * * * * * **** **** **** * cenA: TAGGAAATCC TCATCCGCT CGC GCCGTGGGGCATT CGTC GGGTTTCCTCGTCG.. . . *** * * * * * * * * * * * * ** ****** * * clg: CCTGAACGGCCGCGGGAC CT CGGGCCCATCCGTCGGAGCCTCCCACGGGACACGATGGACAA. . . BEST MATCHES: 4/4 GAA T C G C C T G 3/4 C GAA T T G C C T C C G C G CGG C C TC A GGGT 2/4: GCTGAAATCC TTCAGCCGCT CCC GCCGICGGGCCC CGTC CACGGGTGCCC G G " G G G A 108 f o u n d u p s t r e a m o f t h e mapped mRNA 5' t e r m i n i . S u c h a 'GAA-b o x ' h a s b e e n shown t o be p r e s e n t u p s t r e a m o f t h e cenC gene (B. M o s e r , u n p u b l i s h e d o b s e r v a t i o n s ) . T h i s c o n s e r v e d 5' f l a n k i n g s e q u e n c e may r e p r e s e n t a c i s - r e g u l a t o r y e l e m e n t i n v o l v e d i n t h e e x p r e s s i o n o f t h e C.fimi g e n e s . I t s h o u l d be i n t e r e s t i n g t o s e e , o n c e a s u i t a b l e g e n e - t r a n s f e r s y s t e m i s d e v e l o p e d f o r r e - i n t r o d u c t i o n o f c l o n e d DNA i n t o C. fimi, w h i c h s t r u c t u r a l f e a t u r e s o f t h e 5' f l a n k i n g r e g i o n s a r e i n f a c t r e c o g n i z e d e i t h e r in vivo o r i n v i t r o b y t h e C. fimi t r a n s c r i p t i o n m a c h i n e r y . To s e e w h e t h e r t h e r e g i o n s l o c a l i s e d b y S I m a p p i n g do r e p r e s e n t p r o m o t e r s o r r e c o g n i t i o n s i t e s f o r r e g u l a t o r y p r o t e i n s , g e l r e t a r d a t i o n s t u d i e s c o u l d be p e r f o r m e d w i t h f r a c t i o n a t e d C. fimi p r o t e i n e x t r a c t s and t h e e n d - l a b e l e d DNA f r a g m e n t s u s e d a s 5' p r o b e s i n t h e m a p p i n g e x p e r i m e n t s . As w e l l , m e t h y l a t i o n p r o t e c t i o n (DNA f o o t p r i n t i n g ) s t u d i e s c o u l d a l s o b e p e r f o r m e d t o w a r d s t h e same e n d . T h e s e e x p e r i m e n t s a r e d e s i g n e d t o g i v e a h i g h r e s o l u t i o n p i c t u r e o f t h o s e r e g i o n s o f f l a n k i n g DNA w h i c h s e r v e as c o n t a c t p o i n t s f o r DNA b i n d i n g p r o t e i n s o r RNA p o l y m e r a s e . T r a n s c r i p t 3 1 t e r m i n i w e r e mapped f o r t h e c e n A a n d cex mRNAs b y h y b r i d p r o t e c t i o n a n a l y s i s w i t h e n d - l a b e l e d DNA p r o b e s . T h e s e e x p e r i m e n t s i d e n t i f i e d 3' e n d s w h i c h may h a v e a r i s e n e i t h e r f r o m t r u e t r a n s c r i p t t e r m i n a t i o n o r v i a p r o c e s s i n g o f l o n g e r t r a n s c r i p t s . I n v e r t e d r e p e a t s w e r e f o u n d i m m e d i a t e l y d o w n s t r e a m o f t h e c e n A a n d c e x 109 t r a n s l a t i o n a l s t o p c o d o n s (a TGA f o r b o t h g e n e s ) , a n d t h e 3' t e r m i n i m a p p e d c l o s e l y t o t h e s e r e g i o n s . S i n c e t h e s e s t r u c t u r e s r e s e m b l e d r h o - i n d e p e n d e n t t e r m i n a t i o n s i g n a l s as f o u n d i n E. c o l i ( R o s e n b e r g a n d C o u r t , 1 9 7 9 ) , a l t h o u g h none o f t h e s e C. fimi s t r u c t u r e s p r e c e d e a r u n o f c o n s e c u t i v e T r e s i d u e s a s f o u n d i n E. c o l i , t h e y may r e p r e s e n t C. fimi t r a n s c r i p t i o n t e r m i n a t o r s i g n a l s . I t s h o u l d be i n t e r e s t i n g t o s e e w h e t h e r cenB a n d cenC mRNA 3' t e r m i n i a r e i d e n t i f i e d d o w n s t r e a m o f s i m i l a r s e q u e n c e s . The s t e a d y s t a t e l e v e l s f o r cenA, cex a n d cenB mRNAs were d e t e r m i n e d b y h y b r i d i s a t i o n s w i t h s y n t h e t i c o l i g o n u c l e o t i d e p r o b e s l a b e l e d t o h i g h s p e c i f i c a c t i v i t i e s . I n t e r e s t i n g l y , t h e t r a n s c r i p t s o f t h e t w o e n d o g l u c a n a s e g e n e s , c e n A a n d ce n B w e r e f o u n d t o be p r e s e n t a t s i m i l a r l e v e l s ( a b o u t 250 -1 a m o l u.g RNA ) u n d e r i n d u c i n g (CMC) g r o w t h c o n d i t i o n s w h i l e t h e s t e a d y s t a t e cex t r a n s c r i p t s w e r e f o u n d t o b e l e s s a b u n d a n t (77 a m o l j i g RNA 1 ; o r 3 1 % o f t h e c e n A a n d cex l e v e l s ) u n d e r s i m i l a r g r o w t h c o n d i t i o n s . The l e v e l o f ce n A mRNA u n d e r g l y c e r o l - g r o w t h (=50 a m o l |lg RNA ) was f o u n d t o be s l i g h t l y g r e a t e r t h a n f o r e i t h e r cenB (=30 amol |lg RNA "*") -1 o r cex (=20 a m o l [ig RNA ) mRNAs. T h a t u n d e r n o n - i n d u c i n g g r o w t h c o n d i t i o n s t h e n o r t h e r n b l o t s h a d d e t e c t e d l e v e l s o f b o t h c e n A a n d c e n B mRNAs b u t n o t cex mRNA may r e f l e c t t h e r e l a t i v e l y l o w e r s p e c i f i c - a c t i v i t i e s o f t h e n o r t h e r n b l o t p r o b e s r e l a t i v e t o t h e s l o t - b l o t o l i g o - p r o b e s . The t r a n s c r i p t l e v e l s w e r e c l e a r l y l o w e s t i n t h e RNA 110 s a m p l e s f r o m g l u c o s e - g r o w n c e l l s . The s t e a d y s t a t e l e v e l o f cenA mRNA was r e d u c e d some 2 0 - f o l d a s a f u n c t i o n o f g l u c o s e -g r o w t h when c o m p a r e d t o CMC-growth. The cex a n d c e n B mRNA l e v e l s w e r e s i m i l a r i l y r e d u c e d 5- t o 6 - f o l d a s a f u n c t i o n o f g l u c o s e - g r o w t h . G l y c e r o l may r e p r e s s c e n A e x p r e s s i o n , a l t h o u g h t h e s t r e n g t h o f t h i s r e p r e s s i o n may be l e s s t h a n o b s e r v e d w i t h g l u c o s e . The h i g h e r l e v e l o f c e n A mRNA c o m p a r e d t o e i t h e r cex o r c e n B mRNA i n t h e p r e s e n c e o f g l y c e r o l c o u l d be e x p l a i n e d b y e i t h e r cenA b e i n g t r a n s c r i b e d a t h i g h e r l e v e l s (more i n i t i a t i o n s ) o r t h a t cenA mRNA i s more s t a b l e u n d e r g l y c e r o l g r o w t h . I t i s t e m p t i n g t o s p e c u l a t e on t h e m o l e c u l a r m e c h a n i s m s g o v e r n i n g c e l l u l a s e gene e x p r e s s i o n i n C. fimi. The p a t t e r n s o f g e n e e x p r e s s i o n o b s e r v e d a t t h e t r a n s c r i p t i o n a l l e v e l a s f u n c t i o n s o f t h e s u b s t r a t e p r o v i d e d d u r i n g C. fimi g r o w t h a r e c o n s i s t e n t w i t h r e p r e s s i b l e a n d i n d u c i b l e r e g u l a t o r y m e c h a n i s m s , a l t h o u g h n e i t h e r a r e p r e s s o r p r o t e i n n o r t r u e i n d u c e r m o e i t y h a s e v e r b e e n d e m o n s t r a t e d . H o w e v e r , t h e e l u c i d a t i o n o f i n d u c i b l e a n d c o n s t i t u t i v e t r a n s c r i p t i o n , does i m p l y t h a t t h i s o r g a n i s m c a n d i s c r i m i n a t e b e t w e e n v a r i o u s c a r b o n s o u r c e s a n d r e s p o n d i n a manner c o n t r o l l e d , a t l e a s t i n p a r t , a t t h e t r a n s c r i p t i o n a l l e v e l . T h i s i s i n c o n t r a s t t o Clostridium thermocellum w h i c h p r o d u c e s a number o f c o n s t i t u t i v e e n d o g l u c a n a s e a c t i v i t i e s t h r o u g h o u t i t s v e g a t a t i v e g r o w t h p h a s e (Hammerstrom e t a l . , 1 9 5 5 ; G a r c i a -M a r t i n e z e t a l . , 1 9 8 0 ) . I l l I n l a t t e r e x p e r i m e n t s ( n o t p r e s e n t e d h e r e ) , t h e s t e a d y s t a t e l e v e l s o f c e n A , cex a n d c e n B mRNAs i n RNA p r e p a r e d f r o m c e l l s grown i n t h e p r e s e n c e o f CMC and g l u c o s e c o u l d n o t be d e m o n s t r a t e d t o be s i g n i f i c a n t l y g r e a t e r t h a n t h e l e v e l s o b s e r v e d f o r s i m i l a r c u l t u r e s g r o w n o n g l u c o s e a l o n e . H o w e v e r i t was n o t e d t h a t C. fimi g r o w n on g l u c o s e + CMC s u p p l e m e n t e d p l a t e a g a r d i d p r o d u c e e x o g l u c a n a s e a c t i v i t y as d e t e r m i n e d b y t h e h y d r o l y s i s o f t h e s y n t h e t i c s u b s t r a t e 4-m e t h y l u m b e 1 1 i f e r y 1 - p - D - c e l l o b i o s i d e (MUC) . No MUCase a c t i v i t y was d e t e c t e d f r o m C. fimi g r o w n on p l a t e a g a r s u p p l e m e n t e d w i t h g l u c o s e a l o n e . An e x p l a n a t i o n f o r t h i s d i s p a r i t y i s n o t y e t k n o w n , b u t may i n v o l v e a s y e t u n c h a r a c t e r i z e d components o f t h e C. f i m i c e l l u l a s e s y s t e m . A l o w l e v e l o f c o n s t i t u t i v e e x p r e s s i o n o f e x t r a c e l l u l a r c e l l u l a s e s , most n o t a b l y e n d o g l u c a n a s e s , h a s b e e n o b s e r v e d i n many c e l l u l o l y t i c o r g a n i s m s ( B e g u i n e t a l . , 1987; C o u g h l a n , 1 9 8 5 ; C a n e v a s c i n i e t a l . , 1 9 7 9 ; E n a r i a n d N i k u - P a a v o l a , 1987) . C. fimi g r o w n on g l u c o s e - o r g l y c e r o l - s u p p l e m e n t e d m i n i m a l m e d i a a g a r s t i l l e x p r e s s e s some e n d o g l u c a n a s e a c t i v i t y ( G r e e n b e r g e t a l . , u n p u b l i s h e d o b s e r v a t i o n ) a l t h o u g h w h i c h e n d o g l u c a n a s e s a r e e l a b o r a t e d i s n o t known. A c o n s t i t u t i v e l o w - l e v e l e x p r e s s i o n o f one o r two e n d o g l u c a n a s e a c t i v i t i e s b y C. fimi seems p r e f e r a b l e t o t h e p r o d u c t i o n o f a f u l l c o m p l e m e n t o f c e l l u l a s e s i n t h e a b s e n c e o f a n a p p r o p r i a t e s u b s t r a t e . I t i s e a s i l y e n v i s a g e d t h a t o n c e c e l l u l o s e w e r e e n c o u n t e r e d , i t c o u l d b e h y d r o l y z e d a n d o r m o d i f i e d b y t h e e x t r a c e l l u l a r e n d o g l u c a n a s e a c t i v i t i e s t o 112 p r o d u c e an (as o f y e t u n c h a r a c t e r i z e d ) i n d u c e r m o e i t y . The i n d u c e r , u p o n e n t e r i n g t h e c e l l w o u l d t h e n be a b l e t o e f f e c t c e l l u l a s e g e n e e x p r e s s i o n . The d r o p i n t h e i n t r a c e l l u l a r l e v e l o f t h e g l o b a l i n d u c e r ( e i t h e r t h r o u g h m e t a b o l i s m o r r e p r e s s o r t i t r a t i o n ) w o u l d p r o b a b l y c o i n c i d e w i t h e x h a u s t i o n o f c e l l u l o s i c s u b s t r a t e , a n d t h e n C. fimi w o u l d r e t u r n t o b a s a l - l e v e l c e l l u l a s e p r o d u c t i o n . T h a t t h e i n d u c t i o n o f c e l l u l a s e gene e x p r e s s i o n i n C. fimi s h o u l d o c c u r i n a t r a n s - a c t i n g ( i . e . g l o b a l ) m a n n e r i s s u g g e s t e d b o t h b y t h e a p p a r e n t m o n o c i s t r o n i c n a t u r e o f t h e c e l l u l a s e g e n e s so f a r c h a r a c t e r i z e d (no p o l y c i s t r o n i c mRNA e n c o d i n g c e l l u l a s e s h a v e y e t b e e n i d e n t i f i e d ; s e e a l s o B e g u i n e t al., 1986) a n d t h a t t h e s e g e n e s do n o t a p p e a r t o be t i g h t l y l i n k e d a t t h e DNA l e v e l a s d e t e r m i n e d f r o m l i n k a g e s t u d i e s w i t h a C. fimi l a m b d a - l i b r a r y (N.M. G r e e n b e r g , u n p u b l i s h e d o b s e r v a t i o n s ) . T h e s e o b s e r v a t i o n s seem t o s u g g e s t b o t h c i s - a n d t r a n s - a c t i n g r e g u l a t o r y e l e m e n t s f a c i l i t a t i n g c o o r d i n a t e c e l l u l a s e e x p r e s s i o n / r e p r e s s i o n i n r e s p o n s e t o c h a n g i n g e n v i r o n m e n t a l c o n d i t i o n s . C a t a b o l i t e r e p r e s s i o n ( J a c o b a n d Monod, 1961) h a s b e e n s u g g e s t e d a s one p o s s i b l e f o r m o f r e g u l a t o r y c o n t r o l o f c e l l u l a s e b i o s y n t h e s i s i n C. fimi ( B e g u i n e t al., 1 9 7 7 ; G r e e n b e r g e t al., 1 9 8 7 a , b ) a n d o t h e r p r o k a r y o t i c a n d e u c a r y o t i c c e l l u l o l y t i c o r g a n i s m s ( C o u g h l a n , 1 9 8 5 ) . However t h e m o l e c u l a r m e c h a n i s m o f t h i s r e p r e s s i o n i n C. fimi h a s r e m a i n e d u n c h a r a c t e r i z e d . The r e s u l t s w h i c h d e m o n s t r a t e d t h e 113 l o w - l e v e l s o f c e l l u l a s e g e n e e x p r e s s i o n i n g l u c o s e - g r o w n c e l l s c o u l d be e x p l a i n e d b y c a t a b o l i t e r e p r e s s i o n , a l t h o u g h t h e a d d i t i o n o f c y c l i c AMP (cAMP) t o g r o w i n g c u l t u r e s d i d n o t a p p e a r t o o v e r c o m e t h i s r e p r e s s i o n ( B e g u i n et al., 1977, a n d N.M. G r e e n b e r g , u n p u b l i s h e d o b s e r v a t i o n s ) a s h a s b e e n o b s e r v e d i n E. c o l i . 4.2. The abg t r a n s c r i p t s o f Agrobacterium s p . S t r a i n ATCC 21400. The i n v i v o t r a n s c r i p t s o f t h e abg gene e n c o d i n g t h e (3-g l u c o s i d a s e Abg o f Agrobacterium s p . w e r e a l s o i n v e s t i g a t e d i n t h e s e s t u d i e s . The ( 3 - g l u c o s i d a s e s a r e e s s e n t i a l i n c e l l u l o l y s i s , a s t h e y a r e r e s p o n s i b l e f o r t h e h y d r o l y s i s o f c e l l o b i o s e t o g l u c o s e , w h i c h t h e c e l l c a n u s e a s a s o u r c e o f c a r b o n a n d e n e r g y . B y n o r t h e r n b l o t a n a l y s i s o f Agrobacterium s p . RNA, t h e abg g e n e was f o u n d t o be t r a n s c r i b e d a s a mRNA o f a p p r o x i m a t e l y 1,500 b a s e s i n l e n g t h . The in vivo abg mRNA 5' t e r m i n i w e r e l o c a l i s e d b y n u c l e a s e S I h y b r i d p r o t e c t i o n a n a l y s i s w i t h a 5 ' - l a b e l e d DNA p r o b e . The m a j o r 5' e n d mapped 22 b a s e s u p s t r e a m o f t h e abg t r a n s l a t i o n i n i t i a t i o n c o d o n . To i d e n t i f y r e g i o n s w h i c h c o u l d r e p r e s e n t t h e DNA s e q u e n c e s r e c o g n i z e d b y Agrobacterium s p . ATCC 21400 RNA p o l y m e r a s e , c o m p a r i s o n s w e r e made b e t w e e n t h e s e q u e n c e i m m e d i a t e l y u p s t r e a m o f t h e mapped 5' e n d a n d c h a r a c t e r i z e d p r o k a r y o t i c p r o m o t e r -10 a n d -35 r e g i o n s . The b e s t m a t c h e s a r e s u m m a r i z e d i n F i g u r e 4 7. I t was n o t u n e x p e c t e d t h a t t h e r e w e r e h e x a n u c l e o t i d e s e q u e n c e s r e s e m b l i n g t h e E. c o l i 70 a c o n s e n s u s p r o m o t e r s e q u e n c e s ( H a w l e y a n d M c C l u r e , 1983) a t a p p r o p r i a t e d i s t a n c e s u p s t r e a m o f t h e abg mRNA 5' t e r m i n u s , s i n c e t h e r e c o m b i n a n t abg g e n e was f o u n d t o be e x p r e s s e d i n E. c o l i r e g a r d l e s s o f i t s o r i e n t a t i o n w i t h r e s p e c t t o v e c t o r p r o m o t e r s ( W a k a r c h u k , 1 9 8 7 ; W a k a r c h u k e t al., 1 9 8 8 ) . The p u t a t i v e abg p r o m o t e r r e g i o n was a l s o f o u n d t o r e s e m b l e t h e nif p r o m o t e r r e g i o n s a s i d e n t i f i e d i n K l e b s i e l l a spp (Kim e t al., 1 9 8 6 ) . The t r a n s c r i p t 3' e n d was d e t e r m i n e d f o r abg mRNA b y h y b r i d p r o t e c t i o n a n a l y s i s w i t h a 3 ' - l a b e l e d DNA p r o b e . The i n v e r t e d r e p e a t s i m m e d i a t e l y d o w n s t r e a m o f t h e Abg s t o p (TGA) co d o n r e s e m b l e d a r h o - i n d e p e n d e n t t e r m i n a t i o n s i g n a l as f o u n d f o r E. c o l i g e n e s ( R o s e n b e r g a n d C o u r t , 1979; Y a n o f s k y , 1981) and u n l i k e t h e C. fimi g e n e s , p r e c e d e d a r u n o f c o n s e c u t i v e T r e s i d u e s . The m a p p i n g o f t h e abg mRNA 3' t e r m i n u s i n t h i s r e g i o n s u g g e s t s t h a t t h e i n v e r t e d r e p e a t s e q u e n c e s may f u n c t i o n a s t e r m i n a t i o n s i g n a l s i n t h i s Agrobacterium s p . T h e r e f o r e , t h e i n i t i a t i o n a n d t e r m i n a t i o n s i t e s f o r abg mRNA w e r e f o u n d t o be a b o u t 1,480 b a s e s a p a r t , a f i n d i n g i n g o o d a g r e e m e n t w i t h t h e s i z e o b s e r v e d f o r abg mRNA i n t h e n o r t h e r n b l o t e x p e r i m e n t . 115 5. REFERENCES 1. A t k i n s o n , T a n d M. S m i t h . 1 9 8 4 . I n ; O l i g o n u c l e o t i d e s y n t h e s i s : a p r a c t i c a l a p p r o a c h . G a i t , N . J . (ed.) I R L P r e s s , W a s h i n g t o n . 2. B a t e s , N. 1987. C h a r a c t e r i z a t i o n o f cbg: a c l o n e d gene e n c o d i n g a n e x t r a c e l l u l a r ( 3 - g l u c o s i d a s e f r o m Cellulomonas f i m i . M.Sc. T h e s i s , U n i v e r s i t y o f B r i t i s h C o l u m b i a , V a n c o u v e r , Canada. 3. B e g u i n , P., H. E i s e n , a n d A W. R o u p a s . 1977. F r e e a n d c e l l u l a s e - b o u n d c e l l u l a s e s i n a Cellulomonas s p e c i e s . J . Gen. M i c r o b i o l . 101:191-196. 4. B e g u i n , P., M. R o c a n c o u r t , M.-C. C h e b r o u , a n d J . - P . A u b e r t . 1986. M a p p i n g o f mRNA e n c o d i n g e n d o g l u c a n a s e A f r o m Clostridium thermocellum. M o l . Gen. G e n t . 202:251-254 . 5. B e g u i n , P., N.R. G i l k e s , D.G. K i l b u r n , R.C. M i l l e r , J r . , G.P. O ' N e i l l , R . A . J . W a r r e n . 1987. C l o n i n g o f c e l l u l a s e g e n e s . CRC C r i t i c a l Rev. B i o t e c h n o l o g y . 6:129-162. CRC P r e s s , I n c . 6. B e r g e y , D.H., R.S. B r e e d , R.W. Hammer, F.-C. H a r r i s o n , a n d F.M. H u n t o o n . 1974. 6 2 9 - 6 3 1 . I n : R.E. B u c h a n a n a n d N.E. G i b b o n s ( e d . ) , B e r g e y ' s m a n u a l o f d e t e r m i n a t i v e b a c t e r i o l o g y , 8 t h e d . The W i l l i a m s & W i l k i n s Co., B a l t i m o r e . 7. B e r k , A . J . , a n d P.A. S h a r p . 1977. S i z i n g a n d m a p p i n g o f e a r l y a d e n o v i r u s mRNAs b y g e l e l e c t r o p h o r e s i s o f S I e n d o n u c l e a s e d i g e s t e d h y b r i d s . C e l l 12:721-732. 8. B e r k A . J . , a n d P.A. S h a r p . 1 9 7 8 . S t r u c t u r e o f t h e a d e n o v i r u s 2 e a r l y mRNAs. C e l l 14:695-711. 9. B i b b , M.J., M.J. B i b b , J.M. Ward, a n d S.N. C o h e n . 1985. 116 N u c l e o t i d e s e q u e n c e s e n c o d i n g a n d p r o m o t i n g e x p r e s s i o n o f t h r e e a n t i b i o t i c r e s i s t a n c e g e n e s i n d i g e n o u s t o Streptomyces. M o l . Gen. G e n e t . 199:26-36. 10. B i b b , , M.J., G.R. J a n s s e n , a n d J.M. Ward. 1985. C l o n i n g a n d a n a l y s i s o f t h e e r y t h r o m y c i n r e s i s t a n c e gene (ermE) o f Streptomyces erythraeus. Gene 38:215-22 6. 11. B i r n b o i m , H . C . , a n d J . D o l y . 1 9 7 9 . A r a p i d a l k a l i n e e x t r a c t i o n p r o c e d u r e f o r s c r e e n i n g r e c o m b i n a n t p l a s m i d DNA. N u c l e i c A c i d s R e s . 7:1513-1523. 12. B o l i v a r , F . R . , R.L. R o d r i g u e z , P . J . G r e e n e , M.C. B e t l a c h , H.L. H e y n e k e r , A.W. B o y e r , J.H. C r o s a , a n d S. F a l k o w . 1977. C o n s t r u c t i o n a n d c h a r a c t e r i z a t i o n o f new c l o n i n g v e h i c l e s . I I . A m u l t i p u r p o s e c l o n i n g s y s t e m . Gene 2:95-113. 13. C o u g h l a n , M.P. 1 9 8 5 . The p r o p e r t i e s o f f u n g a l a n d b a c t e r i a l c e l l u l a s e s w i t h comment on t h e i r p r o d u c t i o n a n d a p p l i c a t i o n . B i o t e c h . G e n e t i c E n g i n e e r i n g Rev. 3:39-109. 14. Day,A.G., a n d S.G. W i t h e r s . 1986. The p u r i f i c a t i o n a n d c h a r a c t e r i z a t i o n o f a P - g l u c o s i d a s e f r o m Alcaligenes f a e c a l i s . Can. J . B i o c h e m . C e l l B i o l . 64:914-922. 15. D u c k w o r t h , H.E. a n d E.A. Thompson. 1982. E d s . , P r o c . I n t l . Symp. on E t h a n o l f r o m B i o m a s s , The R o y a l S o c i e t y o f Canada, Winnepeg, Canada. 16. Duong, T . - V . C , E.A. J o h n s o n , a n d A . L . D e m a i n . 1 9 8 3 . T h e r m o p h i l i c , a n a e r o b i c a n d c e l l u l o l y t i c b a c t e r i a . Top. Enzyme F e r m e n t . B i o t e c h n o l . , 7:156. 17. E h r e n b e r g , L., I . F e d o r c s a k , a n d F. S o l y m o s y . 1 9 7 6 . D i e t h y l p y r o c a r b o n a t e i n n u c l e i c a c i d s r e s e a r c h . J . M o l . B i o l . 16:189-262. 117 18. F a v o l o r o , J . , R. T r i e s m a n , a n d R. Kamen. 1 9 8 0 . T r a n s c r i p t i o n maps o f p o l y o m a v i r u s - s p e c i f i c RNA: a n a l y s i s b y t w o - d i m e n s i o n a l n u c l e a s e S I g e l m a p p i n g . M e t h o d s E n z y m o l . 65:718-749. 19. E n a r i , T-M., a n d M-L. N i k u - P a a v o l a . 1 9 8 7 . E n z y m a t i c h y d r o l y s i s o f c e l l u l o s e : I s t h e c u r r e n t t h e o r y o f t h e m e c h a n i s m s o f h y d r o l y s i s v a l i d ? CRC C r i t i c a l R e v . B i o t e c h n o l . CRC P r e s s , I n c . 20. E v e l e i g h , D.E. 1983. The f e r m e n t a t i o n o f b i o m a s s . p . 3 6 5 -391 In: B i o m a s s u t i l i z a t i o n . W.A. C o t e (ed.) P l e n u m P r e s s , N.Y. 21. F a n , L.T., Y.H. L e e a n d D.H. B e a r d m o r e . 1 9 8 0 . M a j o r c h e m i c a l a n d p h y s i c a l f e a t u r e s o f c e l l u l o s i c m a t e r i a l s a s s u b s t r a t e s f o r e n z y m a t i c h y d r o l y s i s . A d v . B i o c h e m . Eng. 14:101-117. 22. F o r n w a l d , J.A., F . J . S c h m i d t , C.W. Adams, M. R o s e n b e r g , an d M.E. B r a w n e r . 1987. Two p r o m o t e r s , one i n d u c i b l e a n d o n e c o n s t i t u t i v e , c o n t r o l t r a n s c r i p t i o n o f t h e Streptomyces l i v i d a n s g a l a c t o s e o p e r o n . P r o c . N a t l . A c a d . S c i . USA 84:2130-2134. 23. G a r c i a - M a r t i n e z , D.V., A. S h i n m y o , A. M a d i a , A . L . D e m a i n . 1 9 8 0 . S t u d i e s o n c e l l u l a s e p r o d u c t i o n b y Clostridium thermocellum. E u r . J . A p p l . M i c r o b i o l . B i o t e c h n o l . 9:189. 24. G a r d n e r , K.H. a n d J . B l a c k w e l l . 1974. The s t r u c t u r e o f n a t i v e c e l l u l o s e . B i o p o l y m e r s 1 3:1975-2001. 25. G i l k e s , N.R., D.G. K i l b u r n , M.L. L a n g s f o r d , R.C. M i l l e r , J r . , W.W. W a k a r c h u k , R . A . J . W a r r e n , D . J . W h i t t l e a n d W.K.R. Wong. 1 9 8 4 a . I s o l a t i o n a n d c h a r a c t e r i z a t i o n o f Escherichia c o l i c l o n e s e x p r e s s i n g c e l l u l a s e g e n e s f r o m Cellulomonas fimi. J . Gen. M i c r o b i o l . 130:1377-1384. 26. G i l k e s , N.R., M.L. L a n g s f o r d , D.G. K i l b u r n , R.C. M i l l e r , 118 J r . , a n d R . A . J . W a r r e n . 1 9 8 4 b . Mode o f a c t i o n a n d s u b s t r a t e s p e c i f i c i t y s o f c l o n e d b a c t e r i a l g e n e s . J . B i o l . Chem. 2 5 9:10455-10459. 27. G r e e n b e r g , N.M., R . A . J . W a r r e n , D.G. K i l b u r n , a n d R.C. M i l l e r , J r . 1 9 8 7 a . R e g u l a t i o n , i n i t i a t i o n a n d t e r m i n a t i o n o f t h e c e n A a n d cex t r a n s c r i p t s o f Cellulomonas fimi. J . B a c t e r i o l . 169:646-653. 28. G r e e n b e r g , N.M., R . A . J . W a r r e n , D.G. K i l b u r n , a n d R.C. M i l l e r , J r . 19 8 7 b . R e g u l a t i o n a n d i n i t i a t i o n o f c e n B t r a n s c r i p t s o f Cellulomonas fimi. J . B a c t e r i o l . 1 6 9:4674-4677. 29. H a l l , D.O. 1 9 8 3 . B i o m a s s f o r e n e r g y - f u e l s now a n d i n t h e f u t u r e , p. 1-22, In: B i o m a s s u t i l l i z a t i o n , W.A. C o t e . , e d . Pl e n u m P r e s s , N.Y. 30. Hammerstrom, R.A., K.D. C l a u s , J.W. C o g h l a n , a n d R.H. M c B e e . 1 9 5 5 . The c o n s t i t u t i v e n a t u r e o f b a c t e r i a l c e l l u l a s e s . A r c h . B i o c h e m . B i o p h y s . 56:123. 31. H a w l e y D.K., a n d W.R. M c C l u r e . 1 9 8 3 . C o m p i l a t i o n a n d a n a l y s i s o f Escherichia c o l i p r o m o t e r DNA s e q u e n c e s . N u c l e i c A c i d s R e s . 1 1:2237-2255. 32. Han, Y.W., a n d V.R. S r i n i v a s a n . 1 9 6 8 . I s o l a t i o n a n d c h a r a c t e r i z a t i o n o f a c e l l u l o s e u t i l i s i n g b a c t e r i u m . A p p l . M i c r o b i o l . 1 6:1140-1145. 33. Han, Y.W., a n d V.R. S r i n i v a s a n . 1 969. The p u r i f i c a t i o n a n d c h a r a c t e r i z a t i o n o f ( 5 - g l u c o s i d a s e o f Alcaligenes f a e c a l i s . J . B a c t e r i o l . 100:1355-1363. 34. Hopwood, D.A., M.J. B i b b , K.F. C h a t e r , G.R. J a n s s e n , F. M a l p a r t i d a , a n d C P . S m i t h . 1986. R e g u l a s t i o n o f gene e x p r e s s i o n i n a n t i b i o t i c p r o d u c i n g Streptomyces. Symp. Soc . Gen. M i c r o b i o l . 39:251-276. 119 35. J a c o b , F., a n d J . Monod. 1 9 6 1 . G e n e t i c r e g u l a t o r y m e c h a n i s m s i n t h e s y n t h e s i s o f p r o t e i n s . J . M o l . B i o l . 3:318-356. 36. K e d d i e , R.M. 1974. G e n u s I I I . Cellulomonas B e r g e y e t a l . 1 9 2 3 , 154, emend, mut. c h a r . C l a r k 1 952, 50, p. 6 2 9 - 6 3 1 . I n : R.E. B u c h a n a n a n d N.E. G i b b o n s ( e d . ) , B e r g e y ' s m a n u a l o f d e t e r m i n a t i v e b a c t e r i o l o g y , 8 t h e d . The W i l l i a m s & W i l k i n s Co., B a l t i m o r e . 37. K e n n e l l , D., a n d I . B i c k n e l l . 1 973. D e c a y o f m e s s e n g e r r i b o n u c l e i c a c i d f r o m t h e l a c t o s e o p e r o n o f Escherichia c o l i a s a f u n c t i o n o f g r o w t h t e m p e r a t u r e . J . M o l . B i o l . 74:21-31. 38. K i m , Y.-M., K . - J . A h n , T. B e p p u , a n d T. V o z u m i . 1986. N u c l e o t i d e s e q u e n c e o f t h e n i f L A o p e r o n o f K l e b s i e l l a oxytoca NG13 a n d c h a r a c t e r i z a t i o n o f t h e gene p r o d u c t s . M o l . Gen. G e n e t . 205:253-259. 39. K o h c h i , C , a n d A. Toh-e. 1985. N u c l e o t i d e s e q u e n c e o f Candida p e l l i c u l o s a ( 3 - g l u c o s i d a s e g e n e . N u c l e i c A c i d s R e s . 1 3:6273-6282. 40. L a n g s f o r d . M.L., N.R. G i l k e s , W.W. W a k a r c h u k , D.G. K i l b u r n , R.C. M i l l e r , J r . , a n d R . A . J . W a r r e n . 1984. The c e l l u l a s e s y s t e m o f Cellulomonas fimi. J . Gen. M i o r o b i o l . 130:1367-1376. 41. L e h n i n g e r , A.L. S u g a r s , s t o r a g e p o l y s a c c h a r i d e s a n d c e l l w a l l s . p. 2 4 9 - 2 7 7 . In: B i o c h e m i s t r y , S e c o n d E d . , W o r t h Pub. I n c . , New Y o r k . 42. M a n i a t i s , T., E . F . F r i t s c h , a n d J . S a m b r o o k . 1 9 8 2 . M o l e c u l a r c l o n i n g : a l a b o r a t o r y m a n u a l . C o l d S p r i n g H a r b o u r L a b o r a t o r y . C o l d S p r i n g H a r b o u r , N.Y. 43. Maxam A.M., and W. G i l b e r t . 1980. S e q u e n c i n g e n d - l a b e l e d DNA w i t h b a s e - s p e c i f i c c h e m i c a l c l e a v a g e s . M e t h o d s 120 E n z y m o l . 65:499-560. 44. M e s s i n g , J . 1 9 8 3 . New M13 v e c t o r s f o r c l o n i n g . M e t h o d s E n z y m o l . 101:20-79. 45. M i l l e r , J . H . 1 9 7 2 . In: E x p e r i m e n t s i n m o l e c u l a r g e n e t i c s . C o l d S p r i n g H a r b o r L a b o r a t o r y , New Y o r k . 46. M i l l e r , R.C. J r . , E.T. Y o u n g I I , R.H. E p s t e i n , H.M. K r i s c h , T. M a t t s o n , a n d A. B o l l e . 1 9 8 1 . R e g u l a t i o n o f s y n t h e s i s o f t h e T4 DNA p o l y m e r a s e (gene 4 3 ) . V i r o l o g y 1 1 0 :98-112. 47. M o r a n , C P . , N. L a n g , S.F.C. L e G r i c e , G. L e e , M. S t e p h e n s , A.L. S o n e n s h e i n , J . P e r o , a n d R. L o s i c k . 1982. N u c l e o t i d e s e q u e n c e s t h a t s i g n a l t h e i n i t i a t i o n o f t r a n s c r i p t i o n a n d t r a n s l a t i o n i n B a c i l l u s s u b t i l i s . M o l . Gen. G e n e t . 186:339-346. 48. Moss, B. 1981. 5' e n d l a b e l i n g o f RNA w i t h c a p p i n g a n d m e t h y l a t i n g e n z y m e s , p . 2 5 3 - 2 6 6 . In J.G. C h i r i k j i a n a n d T . S . P a p a s ( e d . ) , Gene a m p l i f i c a t i o n a n d a n a l y s i s , v o l . 2. E l s e v i e r / N o r t h H o l l a n d P u b l i s h i n g Co., Amsterdam. 49. O ' N e i l l , C P . , D.G. K i l b u r n , R . A . J . W a r r e n a n d R.C. M i l l e r , J r . 1 9 8 6 a . O v e r p r o d u c t i o n f r o m a c e l l u l a s e gene w i t h a h i g h g u a n o s i n e - p l u s - c y t o s i n e c o n t e n t i n E s c e r i c h i a c o l i . A p p l . E n v i r o n . M i c r o b i o l . 52.:737-743. 50. O ' N e i l l , C P . , D.G. K i l b u r n , R . A . J . W a r r e n a n d R . C . M i l l e r , J r . 19 8 6 b . S e c r e t i o n o f Cellulomonas fimi e x o g l u c a n a s e b y Escherichia c o l i . Gene 44:331-336. 51. O ' N e i l l , C P . , S.H. Goh, D.G. K i l b u r n , R . A . J . W a r r e n a nd R.C. m i l l e r , J r . 1986. S t r u c t u r e o f t h e g e n e e n c o d i n g t h e e x o g l u c a n a s e o f Cellulomonas f i m i . Gene 44:325-330. 52. O w o l a b i , J . B . , P. B e g u i n , D.G. K i l b u r n , R.C. M i l l e r , J r . , a n d R . A . J . W a r r e n . 1 9 8 8. The s t r u c t u r a l g ene f o r e n d o g l u c a n a s e B o f Cellulomonas fimi a n d i t s e x p r e s s i o n 121 i n Escherichia c o l i . J . A p p l . E n v i r o n . M i c r o b i o l . ( i n p r e s s ) . 53. P a r a d i s , F.W., R . A . J . W a r r e n , D.G. K i l b u r n a n d R.C. M i l l e r , J r . 1988. The e x p r e s s i o n o f Cellulomonas fimi c e l l u l a s e g e n e s i n Brevibacterium lactofermentum. Gene ( i n p r e s s ) . 54. P o s t m a , P.W. 1 9 8 6 . C a t a b o l i t e r e p r e s s i o n a n d r e l a t e d p r o c e s s e s . Symp. S o c . Gen. M i c r o b i o l . 39:319-353. 55. R e e s , D.A., M o r r i s , E.R., Thorn,D., a n d J . K . Madden. 19 8 2 . S h a p e s a n d i n t e r a c t i o n s o f c a r b o h y d r a t e c h a i n s , p . 1 9 5 - 2 9 0 In: P o l y s a c c h a r i d e s , v o l . 1 . A c a d e m i c P r e s s , N.Y. 56. R o s e n b e r g , M., a n d D. C o u r t . 1979. R e g u l a t o r y s e q u e n c e s i n v o l v e d i n t h e p r o m o t i o n a n d t e r m i n a t i o n o f RNA t r a n s c r i p t i o n . Ann. Rev. G e n e t . 13:319-353. 57. R y u , D.D.Y., a n d M. M a n d e l s . 1 9 8 0 . C e l l u l a s e s : b i o s y n t h e s i s a n d a p p l i c a t i o n s . Enzyme M i c r o b . T e c h n o l . 2:91-101. 58. S h e w a l e , J.G. 1982. ( 3 - g l u c o s i d a s e : I t s r o l e i n c e l l u l a s e s y n t h e s i s a n d h y d r o l y s i s o f c e l l u l o s e . E u r . J . B i o c h e m . 1 4:435-443. 59. S h i n e , J . a n d L. D a l g a r n o . 1974. The 3' t e r m i n a l s e q u e n c e o f Escherichia c o l i 16S r i b o s o m a l RNA: c o m p l i m e n t a r y t o n o n s e n s e t r i p l e t s a n d r i b o s o m e b i n d i n g s i t e s . P r o c . N a t l . A c a d . S c i . USA 71:1342-134 6. 60. S o u t h e r n , E.M. 1 9 7 5 . D e t e c t i o n o f s p e c i f i c s e q u e n c e s amoung DNA f r a g m e n t s s e p a r a t e d b y g e l e l e c t r o p h o r e s i s . J . M o l . B i o l . 98:503-517. 61. S t a c k e b r a n d t , E., a n d 0. K a n d l e r . 1979. Taxonomy o f t h e g e n u s Cellulomonas, b a s e d on p h e n o t y p i c c h a r a c t e r s a n d 122 d e o x y r i b o n u c l e i c a c i d - d e o x y r i b o n u c l e i c a c i d h o m o l o g y , a n d p r o p o s a l o f s e v e n n e o t y p e s t r a i n s . I n t . J . S y s t . B a c t e r i o l . 29:273-282. 62. S t e w a r t , B . J . , a n d J.M. L e a t h e r w o o d . 1976.. D e r e p r e s s e d s y n t h e s i s o f c e l l u l a s e b y Cellulomonas. J . B a c t e r i o l . 128:609-615. 63. T h a y e r , D.W., S.V. L o w t h e r , a n d J.G. P h i l l i p s . 1 9 8 4 . C e l l u l o l y t i c a c t i v i t i e s o f s t r a i n s o f t h e g e n u s Cellulomonas. I n t . J . S y s t . B a c t e r i o l . 34:432-438. 64. Thomas, R . J . 1983. Wood anatomy a n d p e r m e a b i l i t y , p. 1-32. I n : Wood a n d A g r i c u l t u r a l R e s i d u e s : R e s e a r c h on U s e s f o r F e e d , F u e l s a n d C h e m i c a l s , J . S l o t e s ( e d . ) , A c a d e m i c p r e s s , New Y o r k . 65. v a n W e z e n b e e k , P.M.G.F., T.J.M. H u l s e b o s , a n d J.G.G. S h o e n m a k e r s . 1 9 8 0 . N u c l e o t i d e s e q u e n c e o f t h e f i l a m e n t o u s b a c t e r i o p h a g e M13 DNA genome: c o m p a r i s o n w i t h p hage f d . Gene 11:12 9-148. 66. V i e r a , J . , a n d J . M e s s i n g . 1 982. The pUC p l a s m i d s a n d M 1 3 m p 7 - d e r i v e d s y s t e m f o r i n s e r t i o n m u t a g e n e s i s a n d s e q u e n c i n g w i t h s y n t h e t i c u n i v e r s a l p r i m e r s . Gene 1 9:259-268. 67. v o n G a b a i n , A., J.G. B e l a s c o , J . L . S c h o t t e l , C.Y. Chang, a n d S.N. C o h e n . 1 9 8 3 . D e c a y o f mRNA i n Escherichia c o l i : i n v e s t i g a t i o n o f t h e f a t e o f s p e c i f i c s e g m e n t s o f t r a n s c r i p t s . P r o c . N a t l . A c a d . S c i USA 80:653-657. 68. W a k a r c h u k , W.W. 1 9 8 7 . The m o l e c u l a r c l o n i n g a n d c h a r a c t e r i z a t i o n o f a j 3 - g l u c o s i d a s e g e n e f r o m an Agrobacterium. Ph.D. T h e s i s , U n i v e r s i t y o f B r i t i s h C o l u m b i a , V a n c o u v e r , Canada. 69. W a k a r c h u k , W.W., N.M. G r e e n b e r g , D.G. K i l b u r n , R.C. M i l l e r , J r . , a n d R . A . J . W a r r e n . 1 9 8 8 . S t r u c t u r e a n d t r a n s c r i p t i o n a n a l y s i s o f t h e gene e n c o d i n g a c e l l o b i a s e 123 f r o m Agrobacterium s p . s t r a i n ATCC 2 1 4 0 0 . J . B a c t e r i o l . 170:000-000. 70. W a k a r c h u k , W.W., D.G. K i l b u r n , R.C. M i l l e r , J r . , a n d R . A . J . W a r r e n . 1 984. The p r e l i m i n a r y c h a r a c t e r i s z a t i o n o f t h e ( 3 - g l u c o s i d a s e s o f Cellulomonas f i m i . J . Gen. M i c r o b i o l . 130:1385-1389. 71. W a k a r c h u k , W.W., D.G. K i l b u r n , R.C. M i l l e r , J r . , a n d R . A . J . W a r r e n . 1 9 8 6 . The m o l e c u l a r c l o n i n g a n d e x p r e s s i o n o f a c e l l o b i a s e g ene f r o m Agrobacterium i n Escherichia c o l i . M o l . Gen. G e n e t . 205:14 6-152. 72. Weaver, R.F., a n d C. Weissman. 1979. M a p p i n g o f RNA by a m o d i f i c a t i o n o f t h e B e r k a n d S h a r p p r o c e d u r e : t h e 5' t e r m i n i o f 15S ( 3 - g l o b i n mRNA p r e c u r s s o r a n d m a t u r e 10S | 3 - g l o b i n mRNA ha v e i d e n t i c a l map u n i t s . N u c l e i c A c i d s Res. 7:1175-1193. 73. W h i t t l e , D . J . , D.G. K i l b u r n , R . A . J . W a r r e n , a n d R.C. M i l l e r , J r . 1 9 8 2 . M o l e c u l a r c l o n i n g o f a Cellulomonas fimi c e l l u l a s e g ene i n Escherichia c o l i . Gene 17:139-145. 74. W i c h , G., H. Hummel, M. J a r s c h , U. B a r , a n d A. B o c k . 1 9 8 6 . T r a n s c r i p t i o n s i g n a l s f o r s t a b l e RNA g e n e s i n Methanococcus. N u c l e i c A c i d s R e s . 1 4:2459-2479. 75. Wong, W.K.R. 1986. The c l o n i n g a n d c h a r a c t e r i z a t i o n o f an e n d o g l u c a n a s e g e n e o f Cellulomonas f i m i . Ph.D. T h e s i s , U n i v e r s i t y o f B r i t i s h C o l u m b i a , V a n c o u v e r , Canada. 76. Wong, W.K.R., B. G e r h a r d , Z.M. Guo, D.G. K i l b u r n , R . A . J . W a r r e n a n d R.C. M i l l e r , J r . 1986. C h a r a c t e r i z a t i o n a n d s t r u c t u r e o f an e n d o g l u c a n a s e gene cenA o f Cellulomonas f i m i . Gene 44:315-324. 77. Y a n i s c h - P e r r o n , C , J . V i e r a , a n d J . M e s s i n g . 1 9 8 5 . 124 I m p r o v e d M13 p h a g e c l o n i n g v e c t o r s a n d h o s t s t r a i n s : n u c l e o t i d e s e q u e n c e s o f t h e M l 3 mpl8 a n d pUC19 v e c t o r s . Gene 33:103-119. Y a n o f s k y , C. 1 9 8 1 . A t t e n u a t i o n i n t h e c o n t r o l o f e x p r e s s i o n o f b a c t e r i a l o p e r o n s . N a t u r e ( l o n d o n ) 289:751-758 . 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0098055/manifest

Comment

Related Items