Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on the processing of rubella virus structural proteins by analysis of the endoproteolytic cleavage… McDonald, Helen L 1990

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1990_A6_7 M42.pdf [ 7.63MB ]
Metadata
JSON: 831-1.0098023.json
JSON-LD: 831-1.0098023-ld.json
RDF/XML (Pretty): 831-1.0098023-rdf.xml
RDF/JSON: 831-1.0098023-rdf.json
Turtle: 831-1.0098023-turtle.txt
N-Triples: 831-1.0098023-rdf-ntriples.txt
Original Record: 831-1.0098023-source.json
Full Text
831-1.0098023-fulltext.txt
Citation
831-1.0098023.ris

Full Text

Studies on the Processing of Rubella Virus Structural Proteins by Analysis of the Endoproteolytic Cleavage Sites By Helen L. McDonald B.Sc, Queen's University, 1981 A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in the Faculty of Graduate Studies Genetics Program We accept this thesis as conforming to the required standard The University of British Columbia May, 1990 (£) Helen L. McDonald, 1990 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) Abstract Rubella virus is a small enveloped positive strand RNA virus. Two species of v i r a l RNA are found in infected c e l l s : a full-length genomic RNA and a subgenomic species corresponding to the 3' one third of the genomic RNA molecule. The 24S subgenomic RNA specifies a polyprotein which is cotranslationally processed by endoproteolytic cleavage by host signal peptidase to yield three structural proteins, E l , E2 and capsid. El and E2 are membrane glycoproteins forming the virion spikes, and C protein binds to 40S genomic RNA to form a nucleocapsid. El and E2 proteins contain N-linked oligosaccharide as a consequence of their passage through the endoplasmic reticulum (ER) and Golgi apparatus. According to the signal hypothesis, translocation of secretory and membrane proteins into the ER is mediated by a hydrophobic signal peptide. The signal peptides for E2 and El have been localized by in vivo expression of El and E2 cDNAs. Oligonucleotide-directed mutagenesis was used to define the cleavage sites between C, E2, and El, as well as the effect of the cleavages on the transport and processing of E2 and El . The expression of the cleavage site mutants was studied in vitro and in vivo. It was found that uncleaved precursor polypeptides were retained in the ER and very l i t t l e E2 or El polypeptide was observed at either the Golgi apparatus or the plasma membrane. The E2 and El polypeptides can cross the ER membrane without the cleavage of the signal peptide while the transport of E2 and El beyond the ER requires the cleavage of E2 from C and El from E2. The C-termini of the C and E2 proteins, which were not previously defined, have been partially characterized. Capsid protein does not appear to undergo further proteolytic processing after i t is cleaved from E2 by signal peptidase, but E2 may be processed at a second cleavage site at it s C-terminus by a trypsin-like enzyme. i i Table of Contents Abstract i i Table of Contents i i i Lis t of Tables v List of Figures v i Lis t of Abbreviations v i i i Acknowledgements x Introduction 1 Intracellular Protein Transport 1 The signal hypothesis model 1 Signal peptidase 4 Topogenic sequences 5 Protein transport and modification 7 Role of conformation in transport 8 The Togaviridae 10 Alphaviruses 11 Rubella virus 15 Objectives of thesis study 20 Materials and Methods 21 Materials " " 21 Bacterial strains and growth of bacteria 21 Transformation of E. coli 22 Isolation of plasmid and M13 DNA from E. coli 22 Plasmid mini-prep procedure 22 Large scale plasmid preparation 23 Isolation of phage DNA 23 Oligonucleotide-directed mutagenesis 24 Dot blot analysis 26 Plasmid constructs 26 In vitro transcription using SP6 Polymerase 27 In vitro translation 29 In vivo expression 29 COS c e l l transfection 29 Cell labelling 29 Immunoprecipitation and Endo-fl-N-acetylglucosaminidase H digestion 30 Indirect immunofluorescence 31 Results and Discussion 32 I. Mutation of the serine protease-like sequence in the capsid protein 32 II. Analysis of the structural polyprotein cleavages by signal peptidase 37 i) Role of conformation in cleavage 37 Requirement for a minimum length of peptide 37 Effect of glycosylation on signal peptidase 37 cleavage i i ) Mutation of the cleavage site between C and E2 40 In vitro analysis 40 In vivo analysis 46 Immunofluorescence studies 50 i i i i i i ) Mutagenesis of the cleavage s i t e s between E2 and E l In vitro analysis 55 In vivo analysis 56 Immunofluorescence studies 60 Summary and Conclusions 65 References 67 i v List of Tables Table 1. L i s t of mutagenic oligonucleotides v List of Figures Figure 1. The Signal Hypothesis model 3 Figure 2. Cleavage sites of several v i r a l glycoproteins 9 Figure 3. Model for the topogenesis and processing of the SFV structural polyprotein 14 Figure 4. The expression of the RV polyprotein 17 Figure 5. Model for the topogenesis and processing of the RV structural polyprotein 19 Figure 6. Rubella virus cDNA constructs 28 Figure 7. A comparison of a conserved sequence 33 Figure 8. Mutation of the capsid protease-like sequence 34 Figure 9. Characterization of the mutant capsid protein 35 Figure 10. In vitro analysis of a minimum length requirement for translocation and signal peptidase cleavage 38 Figure 11. In vitro study of the signal peptidase processing of an E2 glycosylation-deficient mutant 41 Figure 12. Mutation of the signal peptidase cleavage site between C and E2 42 Figure 13. In vitro analysis of the C/E2 precursor cleavage site mutant 43 Figure 14. Endo H digestion of C/E2 translation products 45 Figure 15. In vivo study of the C/E2 cleavage site mutant 47 Figure 16. Endo H digestion of the in vivo expression products of the mutant C/E2 49 Figure 17. Indirect immunofluorescence of cells transfected with C/E2 cDNAs: E2 localization 51 Figure 18. Indirect immunofluorescence of cells transfected with C/E2 cDNAs: C localization and c e l l surface staining 52 Figure 19. Indirect immunofluorescence of cells transfected with 24S cDNAs: C localization 53 Figure 20. Indirect immunofluorescence of cells transfected with 24S cDNAs: E2 localization 54 v i Figure 21: Mutation of the cleavage sites between E2 and El 57 Figure 22. In vitro analysis of the E2/E1 double mutant 58 Figure 23: In vivo study of the E2/E1 double mutant 59 Figure 24. Indirect immunofluorescence of cells transfected with E2/E1 cDNAs: E2 localization 61 Figure 25. Indirect immunofluorescence of cells transfected with E2/E1 cDNAs: El localization 62 Figure 26. Indirect immunofluorescence of cells transfected with E2/E1 cDNAs: c e l l surface staining 64 v i i L i s t ATP BSA DNA DNase dNTP endo H EDTA ER GTP kD mg m l ill mM M NTP PBS RNA RNase RV S SDS SFV SRP SV of Abbreviations a d e n o s i n e t r i p h o s p h a t e b o v i n e serum a l b u m i n d e o x y r i b o n u c l e i c a c i d d e o x y r i b o n u c l e a s e d e o x y r i b o n u c l e o s i d e t r i p h o s p a t e e n d o-6 - N - a c e t y l g l u c o s a m i n i d a s e H e t h y l e n e d i a m i n e t e t r a a c e t i c a c i d e n d o p l a s m i c r e t i c u l u m guanos ine t r i p h o s p h a t e k i l o d a l t o n m i l l i g r a m microgram m i l l i l i t e r m i c r o l i t e r m i l l i m o l a r m o l a r n u c l e o s i d e t r i p h o s p a t e phosphate b u f f e r e d s a l i n e r i b o n u c l e i c a c i d r i b o n u c l e a s e r u b e l l a v i r u s Svedberg u n i t sodium d o d e c y l s u l f a t e S e m l i k i F o r e s t v i r u s s i g n a l r e c o g n i t i o n p a r t i c l e S i n d b i s v i r u s v i i i trishydroxymethylaminomethane tetramethylrhodamine isothiocyanate Acknowledgements I would like to thank both my supervisor as an undergraduate student, Dr. Jerry Wyatt, and the supervisor of this project, Dr. Shirley Gillam, for the encouragement to pursue graduate studies. I am grateful for the technical and financial assistance of Dr. Shirley Gillam throughout this study. As well, a special thanks is owed to Tom Hobman, for his technical help and interest in this work. I wish to especially thank Doug for his long-lasting patience and support of this project. x Introduction V i r a l envelope proteins are transported and modified by the host system which processes secretory and resident transmembrane proteins. The nascent v i r a l polypeptide is cotranslationally inserted into the lumen of the rough ER, where i t may be modified by ER-resident enzymes, and then is directed to the host c e l l organelle where virus assembly occurs. Budding may occur at different host c e l l membranes depending on the virus, such as the plasma membrane (alphaviruses [Garoff et a l . , 1983]), the rough ER (coronaviruses [Rottier et a l . , 1984]), or the smooth ER and Golgi apparatus (bunyaviruses and flaviviruses [Kuismanen et a l . , 1984; Westaway, 1980]) (reviewed in Strauss and Strauss, 1985). The insertion of the v i r a l peptide into the ER requires the presence of a signal sequence, and the transmembrane function is specified by a stop transfer sequence (discussed below). The intracellular transport of proteins is unidirectional from the rough ER to the Golgi stacks, which reside in a juxtanuclear position (Rothman, 1981). The Golgi stacks may be divided into compartments, the cis, medial and trans Golgi, where different enzymatic modifications occur during vectorial transport (reviewed in Tarkatoff, 1983). A l l intracellular transport between organelles and, lastly, to the c e l l surface are mediated by vesicular carriers (Jamieson and Palade, 1967; Palade, 1975). Intracellular Protein Transport The Signal Hypothesis The Signal Hypothesis was formulated by Blobel and Dobberstein (1975a,b) as a model for the transport of secretory proteins across the ER membrane. Briefly, the model states that nascent secretory and transmembrane proteins 1 Briefly, the model states that nascent secretory and transmembrane proteins are translocated across the ER membrane through a proteinaceous tunnel or pore after recognition of the signal peptide by one or more membrane components. An alternate model suggests that the nascent signal peptide is passively inserted into the l i p i d bilayer through hydrophobic interactions (von Heijne and Blomberg, 1979). In favour of the Signal Hypothesis model, there is recent evidence to suggest the presence of large aqueous channels in the membrane of the rough ER which could accomodate protein transport (Simon et a l . , 1989). The number of channels open was found to be influenced greatly by GTP, but ATP had no effect (Simon et a l . , 1989). The Signal Hypothesis model is shown in Figure 1. I n i t i a l l y , an N-terminal stretch of hydrophobic amino acids of a peptide, defined as a signal peptide, emerges from a ribosome and interacts with a ribonucleoprotein complex called Signal Recognition Particle (SRP) (Warren and Dobberstein, 1978; Walter and Blobel, 1980). This interaction results in translational arrest, by an undetermined mechanism. Then SRP directs the arrested translational complex to an SRP receptor (also called docking protein) on the ER membrane (Walter and Blobel, 1981). Since the potential for the translocation of many peptides is normally restricted to a brief interval of time during the early stages of the protein's synthesis, the function of SRP-induced translational arrest may be to retain the nascent polypeptide in a translocation-competent state u n t i l i t reaches the ER membrane (Rothman and Lodish, 1977). The interaction between SRP and it s receptor on the ER membrane faci l i t a t e s the release of translational arrest by changing the a f f i n i t y of SRP for the ribosome-protein complex (Meyer et a l . , 1982). SRP is then released into the cytoplasm and recycled. The free signal sequence of the nascent polypeptide becomes associated with another membrane protein, the signal sequence receptor (SSR) (Wiedman et 2 A Signal peptidase receptor Figure 1. The Signal Hypothesis model of translocation. (A) Soluble SRP (a) has different a f f i n i t i e s for free ribosomes (b), ribosomes translating signal sequences (c), and the SRP receptor on the ER membrane (e). (B) When the signal sequence of a nascent peptide emerges from a ribosome, SRP binds to the signal sequence (c), and the affinity of SRP for the translating ribosome is enhanced (shown by arrow). Translational arrest results from this interaction. (C) SRP targets the arrested translational complex to the SRP receptor on the rough ER membrane. The interaction between SRP and it s receptor causes the termination of translational arrest and SRP is then released from the ribosome and recycled (a-e). (D) After the release of SRP, the synthesizing ribosome interacts with other transmembrane proteins and translocation through an aqueous pore in the ER membrane is initiated. Signal peptidase is on the lumenal side of the ER membrane and often cleaves translocated peptides at the C-terminus of the signal peptide sequence. (from Perara and Lingappa, 1988) 3 a l . , 1987), and translocation across the membrane is initiated. The signal sequence is believed to be inserted into the membrane in a loop configuration (Inouye et a l . , 1977). The nature of the translocation machinery is unknown and the components of the proteinaceous tunnel have not been identified. However, i t is possible that the SSR forms part of the proteinaceous tunnel since i t has been isolated from the ER membrane and was found to be present in amounts at least equimolar to membrane-bound ribosomes (Hartman et a l . , 1989). On the lumenal side of the ER the signal sequence is often cleaved by signal peptidase, an integral membrane protein (Blobel and Dobberstein, 1975a,b). Translocation occurs concomitant with protein synthesis un t i l either the entire protein has been translocated, or, in the case of transmembrane proteins, un t i l another hydrophobic stretch of amino acids is inserted in the membrane as a transmembrane anchor (Sabatini et a l . , 1982). Signal Peptidase Signal peptidase is an integral membrane protein that cleaves at the C-terminus of signal sequences in the lumen of the ER (Jackson and Blobel, 1977). This activity has been purified from canine microsomes as a tightly associated complex of six peptides of Mr=25, 23, 22, 21, 19, and 12 kD (Evans et a l . , 1986). Bacterial signal peptidase I is functionally interchangeable with canine signal peptidase (Watts et a l . , 1983; Muller et a l . , 1982), yet i t consists of a single 36 kD monomer (Wolfe et a l . , 1983). This suggests that the enzymatic activity of the eukaryotic complex may be restricted to only one of the six peptides. cDNA clones corresponding to the 23 kD and the 21 kD peptides have been isolated (Shelness et a l . , 1988; Greenburg et a l . , 1989). The deduced amino acid sequence for the 21 kD 4 peptide was found to be homologous to the yeast SEC11 gene product which is required for signal peptidase cleavage in yeast (Bohni et a l . , 1988). Therefore i t was suggested that the individual peptides of the canine signal peptidase complex may have counterparts in the yeast system and that expression of these peptides in yeast secretory mutants may help to elucidate their functions (Greenburg et a l . , 1989). Topogenic Sequences According to the Signal Hypothesis model, information specifying the in i t i a t i o n and termination of translocation is encoded in discrete "topogenic sequences" of a peptide (Blobel, 1980). A signal peptide sequence is essential for translocation across the rough ER membrane of eukaryotes and the outer membrane of bacteria, and i t is not usually part of the mature protein (Blobel and Dobberstein, 1975a,b). Several signal sequences of bacterial and eukaryotic proteins have been examined to determine the features of the signal peptide, as well as the specificity of the signal peptidase cleavage (Perlman and Halvorson, 1983; von Heijne 1985, 1986). Rather than finding amino acid sequence homologies, three separate domains were found to be common to a l l signal sequences: an N-terminal region of basic amino acids, a hydrophobic central region with at least six hydrophobic residues, and a C-terminal sequence that is cleaved by signal peptidase. Since there is no primary homology between signal peptides, i t is likely that the specificity required for SRP recognition and for translocation i n i t i a t i o n resides within the secondary structure of the nascent peptide. Structural analysis of signal sequences predicts that the hydrophobic stretch w i l l assume a periodic structure, either in the form of an a-helix or a R-sheet, followed by a 6-turn or extensive random c o i l at the 5 the cleavage site, but certain amino acids are preferred, especially at the (-1) and (-3) positions with respect to cleavage (von Heijne, 1986). The (-1) residue is normally small and neutral (often Ala, Gly, Ser, Cys, or Gin) and the (-3) residue cannot be aromatic, charged, or large and polar. Also, proline is usually absent from the (-1) to the (-3) positions. The regions beyond the signal peptidase cleavage site have also been recognized as having an influence on translocation and cleavage by signal peptidase. Andrews et a l . (1988) found that the size of a translocated domain had an effect on in vitro processing of a nascent polypeptide. Some signal sequences are not cleaved, as is found with ovalbumin, a secretory protein (Palmiter et a l . , 1978), or the p62 peptide of SFV, a transmembrane protein (Melancon and Garoff, 1987). The function of signal peptidase cleavage in secretory protein synthesis is unknown, but the cleavage of internal signal peptide sequences is important for the processing of several v i r a l polyproteins. Another topogenic sequence is the "stop transfer" sequence which serves as a membrane anchor for transmembrane proteins. There are no sequence, homologies between stop transfer sequences (Sabatini et a l . , 1982), so the information necessary for this function must reside within some general feature of the secondary structure. Generally, there are 20 to 30 hydrophobic and neutral amino acid residues in the membrane-spanning region,- followed by a cytoplasmic " t a i l " of one or more positively charged residues. It has been suggested that the basic residues serve to stabilize the protein through interactions with the negatively-charged membrane phospholipid head groups (Sabatini et a l . , 1982). 6 Protein Transport and Modification Modifications of peptides that may occur in the ER include cleavage of the signal sequence by signal peptidase, intrachain disulphide bond formation (Freedman, 1984), and asparagine (N) -linked glycosylation (reviewed in Kornfeld and Kornfeld, 1985; Parent, 1988; Runge, 1988). As well, there is evidence that fatty acylation occurs either in the ER or in a pre-Golgi structure (Bonatti et a l . , 1989). N-linked glycosylation occurs at Asn residues in the sequence Asn-X-Ser/Thr, where X is any amino acid except proline. The oligosaccharide, Glc3Man,GlcNAc2 [ (Glucose)3(Mannose)9(N-Acetylglucosamine)2] , is transferred to asparagine from the l ip id carrier dolichol pyrophoshate, and then trimmed to the core structure, Man8GlcNAc2 (Hubbard and Ivatt, 1981). The enzyme endo-6-N-acetylglycosaminidase H (endo H) is useful for monitoring the intracellular location of glycoproteins. It recognizes a specific mannose linkage present only in the ER- and cis Golgi- forms of N-linked carbohydrate, therefore i t indicates whether a core-glycosylated protein has been transported beyond the cis Golgi region (Dunphy and Rothman, 1985). In the medial and trans Golgi the core structure is further processed to a complex form, by trimming of mannose residues, and the addition of galactose, fucose, and sialic acid residues. Another type of carbohydrate addition occurs in the Golgi apparatus which is O-linked (reviewed in Kornfeld and Kornfeld, 1980; Kobata, 1984; Montreuil, 1987). These oligosaccharides are synthesized in the Golgi and are attached to the hydroxyl side chains of some serine and threonine residues (Dunphy and Rothman, 1985). Unlike N-linked carbohydrate addition, there is no consensus sequence surrounding this attachment site (Dunphy and Rothman, 1985). 7 There are Golgi-specific proteases, but these have not been well characterized. A large number of unrelated viruses, including members of the alphavirus, paramyxovirus, retrovirus, flavivirus, and myxovirus groups, have a cleavage site in one of their proteins which is homologous to sites recognized by a cellular enzyme that processes prohormones and is resident in either the Golgi apparatus or in transport vesicles (Strauss et a l . , 1987; Figure 2). A generalized consensus sequence for the cleavage site is Arg-X-Arg/Lys-Arg, with proteolysis occurring after a pair of basic residues. An additional modification can occur following cleavage, since one or more amino acids are often removed from the newly-exposed C-terminus (Strauss et a l . , 1987). Role of Conformation in Transport In general, the transport of proteins to a particular destination is influenced by the overall conformation of a protein rather than by specific sequences within the protein or specific post-translational modifications (reviewed in Strauss and Strauss, 1985). The importance of conformation in transport has been shown by studies of temperature-sensitive mutants of alphaviruses which are defective in transport. The El glycoproteins of two SV mutants, tslO and ts23, were shown to be retained in the Golgi apparatus rather than be transported to the plasma membrane (Saraste et a l . , 1980). Sequence analysis of the SV ts mutants revealed three mutations; tslO had a single amino acid change and ts23 had two amino acid changes in El respectively (Arias et a l . , 1983). The three amino acid changes were widely spaced, which would suggest that they each have an effect by altering the three-dimensional structure of the protein, rather than a specific sequence determining the protein's intracellular address. Some peptides need to interact with other subunits in order to be 8 V I R U S P R O T E I N A L P H A V I R U S S I N V E E pE2 -> E3 + E2 S F V M Y X O V I R U S F P V P A R A M Y X O V I R U S R S V S V 5 R E T R O V I R U S RSV MLV F L A V I V I R U S Y F MVE D E N 2 HA HA1 + HA2 F F2 + F l pr95 -> gp85 + gp35 pr95 -> gp70 + pl5E prM M + ? C G S S G 3 S K R A A V K C ^ K R R C R N G T 3 H R R E P S K K 3EKR T L S K K 3 K R R L I P T R ^ R R R S R T G I R R K R F E R S N ^ H K R A G R S R 3 S R R A R H S K 3 S R R T G E M R 3 E K R C L E A V A G E I S V I D G F S T E E L F S V S Q H F G L F G A I F L G F L L F A G V V I S V S H L D E P V S L T A I D L P T S I T V Q T S V A L V P Figure 2 . Amino acid sequences around the cleavage sites containing basic amino acids for a number of virus precursor glycoproteins. Cleavage of the precursor glycoprotein occurs after translation and during transport of the glycoprotein or during virus maturation. The precursor glycoproteins and their cleavage products are shown. (from Strauss et a l . , 1987) 9 transported correctly. The El glycoprotein of alphaviruses requires the presence of the p62 peptide in order to exit the ER. Similarly, the hemagglutinin protein of influenza virus has been shown to assemble into its trimer structure in the ER, and mutant proteins which are incorrectly folded do not leave the ER (Gething et a l . , 1986). Some mutant peptides which escape the correct processing events can also be targeted to their normal destinations. For example, the p62 peptide of SFV is normally cleaved in the Golgi apparatus, but can be transported to the cell surface in the absence of cleavage (Lobigs and Garoff, 1990). However, the mutant peptide was shown to lack the fusion function of the virus which is essential for infectivity (Lobigs and Garoff, 1990). The Togaviridae Togaviruses are positive strand enveloped RNA viruses that have nucleocapsids of icosahedral symmetry (Harrison et a l . , 1974; Enzman and Welland, 1979). Since the genus Flavivirus was removed to form a separate family in 1985 (Westaway et a l . , 1985), there are now three genera within the Togaviridae: Alphavirus, Rubivirus, and Pestivirus. Rubella virus (RV), the causative agent of German measles, is the sole member of the genus Rubivirus (Mathews, 1982). Within the Togaviridae, RV closely resembles the alphaviruses in its general genomic organization and strategy of gene expression (Oker-Blom et a l . , 1984; Soderlund et a l . , 1985). Both groups express their structural and nonstructural genes from separate species of capped and polyadenylated mRNA (Garoff et a l . , 1980a,b; Strauss et a l . , 1984; Oker-Blom et a l . , 1984). The nonstructural genes, which specify functions involved in replication, are encoded at the 5' two thirds of the genome (Strauss et 10 replication, are encoded at the 5' two thirds of the genome (Strauss et a l . , 1984). They are expressed early in infection from the full-length genomic RNA molecule. The structural proteins are translated from a subgenomic mRNA species which corresponds to the 3' one third of the genome (Simmons and Strauss, 1974; Oker-Blom et a l . , 1984). This subgenomic mRNA is more abundantly expressed in infected cells than the genomic RNA, yet only the full-length molecule is packaged into virions (Garoff et a l . , 1983) . In spite of their structural similarities, RV and the alphaviruses have l i t t l e homology at the nucleotide or amino acid sequence level. The complete nucleotide sequence of three alphaviruses is known (Garoff et a l . , 1980a,b; Strauss et a l . , 1984; Takkinen, 1986; Levinson et a l . , 1990) but so far only approximately 4000 nucleotides at the 3' end of the RV genome have been determined (Vidgren et a l . , 1987; Nakhasi et a l . , 1986, 1989; Clarke et a l . , 1987; Zheng et a l . , 1989). Three regions of sequence were found to be conserved between the alphaviruses and RV: one is a stretch of nucleotides in the region immediately 5' to the start of the coding region of the subgenomic RNA, another is a tripeptide in the putative viral polymerase, and a third is a conserved peptide sequence resembling the active site of serine proteases which is found in the capsid protein (Frey and Marr, 1988). Alphaviruses The alphaviruses are a group of arthropod-borne viruses, some of which are human and veterinary pathogens (Shope, 1980). The two best characterized members are Semliki Forest virus (SFV) and Sindbis virus (SV). The alphavirus virion consists of an icosahedral nucleocapsid containing the genomic RNA complexed with a capsid protein, surrounded by a 11 are inserted into the envelope of SV to form the viral spikes, and a third glycoprotein, E3, is associated with the spike complex in SFV, but is secreted in SV-infected cells (Garoff et a l . , 1974; Welchand Sefton, 1979). A small acylated structural peptide, the 6K peptide, has recently been identified as another component of the envelope of SV and SFV (Gaedigk-Nitshko and Schlesinger, 1990; Gaedigk-Nitschko et a l . , 1990). The processing of the alphavirus structural polyprotein has been well characterized (reviewed in Soderlund et a l . , 1985; Strauss and Strauss, 1986; Strauss et a l . , 1987), but l i t t l e is known about the nonstructural polyprotein (Strauss and Strauss, 1977; Schlesinger and Kaariainen, 1980 ). The alphavirus genomic RNA is approximately 12,000 nucleotides in length and the nonstructural genes, which are encoded at the 5' two thirds of the genome, are translated from this RNA species (Strauss et a l . , 1984). There are four nonstructural gene products, named by the order in which they are translated: nsPl, nsP2, nsP3, and nsP4 (Strauss et a l . , 1984; Takkinen, 1986). Many of the alphavirus genomes, with the exception of the SFV genome, have an opal stop codon between the coding regions of nsP3 and nsP4, as well as multiple termination codons following nsP4 (reviewed in Strauss and Strauss, 1986). The opal stop codon causes termination of translation at the end of nsP3, but a small amount of translational readthrough allows the expression of the nsP4 gene. Thus, two precursors to the nonstructural proteins exist in some alphavirus-infected cells, a ful l length precursor and a precursor to three of the four nonstructural proteins. The sites of cleavage of the SFV and SV precursors have been deduced from N-terminal amino acid analysis of nonstructural peptides (Kalkkinen et a l . , 1981; Soderlund et a l . , 1985; Takkinen, 1986). A proteinase activity for the proteolysis of the nonstructural precursor has been mapped to the nsP2 protein by the in vitro expression of deletion 12 mutants of SV (Hardy and Strauss, 1989; Ding and Schlesinger, 1989). From the analysis of temperature-sensitive mutants of the protease (Hahn et a l . , 1989), and inhibitor studies (Brzeski et al , 1977), i t appears that the proteolytic activity of nsP2 is similar to that of known cysteine proteases. The structural proteins of alphaviruses are expressed from a 26S subgenomic mRNA, as a 130 kD precursor polyprotein (Wirth et a l . , 1971). The processing of the SFV structural polyprotein has been studied in detail (Garoff et a l . , 1978; Cutler et a l . , 1986; Melancon and Garoff, 1987). The polyprotein is cotranslationally inserted into the rough ER, and processed during passage through the intracellular organelle network. Melancon and Garoff (1987) proposed the model shown in Figure 3 for the cotranslational insertion and intracellular processing of the SFV precursor. Three early cleavages yield the capsid (C), p62, 6K, and El peptides. The f irst cleavage occurs in the cytoplasm and separates C, which is a cytoplasmic protein, from the envelope proteins. Several lines of evidence demonstrate that C is an autoprotease: in vitro translation of SFV 26S mRNA in the presence of amino acid analogs abolishes cleavage (Aliperti and Schlesinger, 1978); expression of a cDNA clone in which the putative active site was altered also prevented cleavage (Melancon and Garoff, 1987); and sequence analysis of several alphavirus capsid proteins shows the presence of a conserved sequence with homology to the catalytic site of several serine proteases (Boege et a l . , 1981). The p62, 6K, and El peptides are inserted into the ER membrane by signal sequences (represented by white boxes), and are anchored in the membrane by C-terminal hydrophobic transmembrane domains (represented by black boxes) which halt translocation. Two cleavages by signal peptidase (shown by arrows) at the C-termini of the signal sequences of 6K and E l , generate the transmembrane 13 Figure 3. Model for the topogenesis and processing of the SFV structural polyprotein. The SFV structural polyprotein is cotranslationally inserted into the ER membrane. The capsid protein is released in the cytoplasm by an autocatalytic cleavage. The orientation of the polyprotein in the membrane is directed by signal sequences (indicated by white boxes) which initiate translocation, and transmembrane anchor domains (indicated by black boxes) which halt translocation. Translocation is initiated by the N-terminal signal•sequence of the p62 peptide (a), which is not removed by signal, peptidase, but is glycosylated (shown by black dot) and internalized (b). Translocation is halted by the hydrophobic transmembrane anchor of the p62 peptide (c) and is reinitiated by the insertion of the signal sequence of the 6K peptide (d). Cleavages by signal peptidase (shown by arrows) separate the polyprotein into the three transmembrane peptides, p62, 6K, and El (f) . The signal sequence domains at the C-termini of the p62 and 6K peptides f l ip out of the ER membrane and become cytoplasmic tails of these two peptides. (from Melancon and Garoff, 1987) 14 proteins, p62, 6K, and E l . The signal sequence of p62 is unusual in that i t becomes N-glycosylated and remains uncleaved. It is believed that the signal peptides of 6K and E l , that are at the C-termini of the p62 and 6K peptides respectively, fl ip out of their membrane orientation and become cytoplasmic tails (Cutler et a l . , 1986). The final cleavage in the maturation of the SFV envelope proteins (not shown in the above model) occurs in the Golgi apparatus (DeCurtis and Simmons, 1988). This cleavage separates the p62 peptide into the E2 and E3 envelope glycoproteins, and is thought to be mediated by a Golgi protease that recognizes pairs of basic amino acids. Interestingly, the cleavage of p62 requires El (Cutler and Garoff, 1986; Cutler et a l . , 1986). The cleavage of SFV p62 peptide is essential for infectivity (White et a l . , 1983), but the cleavage of SV p62 is not necessary for the production of infectious virions (Presley and Brown, 1989). The envelope proteins are transported from the Golgi apparatus to the plasma membrane, where virus assembly occurs. Although SFV E2 may be transported alone to the cell surface without the co-expression of E l , El requires the presence of E2 for transport from the ER (Kondor-Koch et a l . , 1983). Rubella virus The RV virion contains a nucleocapsid consisting of a 40S genomic RNA molecule and a single species of capsid protein (Mr=33 kD) (Hovi and Vaheri,1970; Oker-Blom et a l . , 1983). The nucleocapsid is enveloped within a host-derived l ipid bilayer containing the three glycoproteins, El (Mr=58kD), E2a (Mr-46kD), and E2b (Mr=42kD) (Oker-Blom et a l . , 1983). The two forms of the E2 protein result from heterogeneous glycosylation of an 15 identical apoprotein moiety coded by the E2 gene (Kalkkinen et a l . , 1984). The N-terminal amino acid sequences of E2 and El have been determined by N-terminal amino acid analysis of E2 and El (Kalkkinen et a l . , 1984). Little is known about the RV nonstructural genes and their products. However, the subgenomic mRNA which specifies the structural proteins has been cloned and the sequence determined for different strains of RV (Vidgren et a l . , 1987; Nakhasi et a l . , 1986, 1989; Clarke et a l . , 1987; Zheng et a l . , 1989) . The structural genes are expressed from a 24S subgenomic mRNA, and are translated in the order NH2-C-E2-E1-COOH (Oker-Blom, 1984; Figure 4). The expression of RV structural genes in vitro and in vivo has revealed some features of the processing of the structural polyprotein. Firstly, the capsid protein does not appear to possess an autoprotease activity, since i t is not cleaved from the precursor polyprotein during in vitro translations unless microsomes are present (Clarke et a l . , 1987). However, RV capsid protein has an amino acid sequence at its C-terminus that resembles the conserved sequence of the catalytic site of the alphavirus capsid autoprotease (Frey and Marr, 1988). Secondly, the envelope glycoproteins, E2 and E l , can be targeted to the ER either independently or in the same precursor peptide via signal peptide sequences which have been identified at the C-termini of the adjacent proteins in the polyprotein precursor, C and E2, respectively (Hobman et a l . , 1988; Hobman and Gillam, 1989). Thirdly, after insertion into the ER membrane and during transport, the envelope proteins are modified by glycosylation and acylation (Oker-Blom et a l . , 1983; Clarke et a l . , 1988; Hobman et a l . , 1988; Hobman and Gillam 1989; T. Hobman, PhD. thesis). Transport studies also show that E2 can be transported to the cell surface in the absence of 16 c a p -© 40 S (-11.000 b) 7 7 + iAA(A)n © 24 S (-3500 b) 5'H NH 2 h p110 ^ 1 jj^  translation 1 processing c a p s i d I Ih-C 33K envelope U •AA(A)n3' HCOOH E2 E1 30K ' 53K ^ glycosylation ^ E2a (47K) . 58K E2b (42K) Figure 4. The expression of the rubella virus structural polyprotein. The RV structural polyprotein is translated from the subgenomic 24S RNA which is identical to the 3' third of the genome. The unprocessed structural polyprotein precursor is 110 kD in size. The polyprotein is cotranslationally processed to the three peptides, capsid, E2 and E l . The two envelope proteins, E2 and E l , are processed to higher molecular weight forms by glycosylation. (from Oker-Blom, 1984) 17 El (Hobman and Gillam, 1989), whereas El requires E2 for the transport of El to the cell surface (T. Hobman, PhD. thesis). Depending on the host cell type, E2 and El may either concentrate at the Golgi apparatus or at the plasma membrane for budding to occur (Bardeletti et a l . , 1979; T. Hobman, PhD. the sis). Based on these results, a model for the co-translational insertion of the RV structural polyprotein into the ER membrane is proposed (Figure 5). The nascent E2 and El peptides are inserted into the ER membrane by signal sequences which are N-terminal to the peptides in the structural polyprotein. Translocation is halted by the C-terminal hydrophobic regions of El and E2 which serve as transmembrane anchors. Cleavage by signal peptidase (shown by arrows) at the C-termini of the two signal sequences releases the capsid protein into the cytoplasm, and separates E2 and El . It is not known whether the capsid protein retains the signal sequence of E2 at its C-terminus, or i f it is further processed to produce mature capsid protein. . A possible trypsin-like protease cleavage site has been proposed to occur after the transmembrane anchor of E2 and before the signal peptide of El , in the cytoplasmic ta i l of E2 (Vidgren et a l . , 1987). This cleavage will release the signal sequence of El from the C-terminus of E2 (Vidgren et a l . , 1987) and may alter the conformation of the C-terminus of E2 in such a way that it will be held within the ER membrane, by only one hydrophobic domain rather than by two hydrophobic domains. This change in conformation of E2 may influence the transport of E2 and El proteins. 18 capsid ER lumen E2 Et Figure 5. Model for the topogenesis and processing of the rubella virus structural polyprotein. The envelope proteins, E2 and E l , are inserted into the ER membrane by signal peptide sequences (white boxes) at the C-termini of capsid and E2, and are anchored in the membrane by C-terminal transmembrane anchor domains (black b oxes). The two cleavages by signal peptidase (shown by white arrows) release capsid into the cytoplasm and separate E2 and El proteins. A third cleavage (shown by black arrow) has been proposed to occur in an arginine-rich region in the cytoplasmic ta i l of E2. 19 Objectives of Thesis Projects Although the N-terminal amino acid sequences of E2 and El glycoproteins have been determined (Kalkkinen et a l . , 1984) and the putative cleavage sites for signal peptidase between C/E2 and E2/E1 can be assigned from the cDNA sequences, i t was not known i f these cleavage sites are the only ones used in the processing of the rubella virus structural polyprotein. The purpose of this study was to define the cleavage sites of signal peptidase between C, E2, and E l , and to evaluate the importance of the cleavages for the processing of E2 and El proteins. Another aspect of this study was to determine the carboxy termini of C and E2 proteins by expressing the constructed cleavage site mutants of C and E2 in in vitro and in vivo systems. The minimum length of the translated E2 required for the cleavage to take place was also examined by truncation of cDNA clones. One major difference in polyprotein processing between RV and SFV (Melancon and Garoff. 1987) is that the RV capsid protein is cleaved from the polyprotein by signal peptidase, whereas the SFV capsid protein is an autoprotease. A peptide sequence similar to that of a conserved serine protease sequence is also present in the RV capsid protein. This sequence was changed to more closely resemble the conserved sequence of serine proteases to determine i f i t has any potential function with respect to autocatalytic activity. 20 Materials and Methods Materials Restriction endonucleases and DNA modifiying enzymes were purchased from commercial suppliers and used according to manufacturers' specifications. [a-32P]-ATP (3000 Ci/mmole), [&-32P]-ATP (3000 Ci/mmole) and L-[35S]-Methionine (600-800 Ci/mmole) were from New England Nuclear. Fluorescein-conjugated goat anti-human IgG was from Kirkegaard and Perry Laboratories or Tago Inc., and Rhodamine (TRITC)-conjugated goat anti-mouse antibody was from Zymed. Anti-rubella human serum was a gift from Dr. Aubrey Tingle (Department of Pediatrics, University of British Columbia). Mouse monoclonals to El were produced in this laboratory previously, and others were obtained from Dr. John Safford, Abbott Laboratories. Anti-C monoclonal antibody was also obtained form Dr. John Safford. Monoclonals to E2 were a gift from Dr. Jerry Wolinsky, Department of Neurology, University of Texas, Houston. TRITC-conjugated lectins were from Sigma. COS cells were obtained from Dr. David Russell (Department of Molecular Genetics, University of Texas, Dallas). Bacterial Strains and Growth of Bacteria E. coli strains DH5a and DH5aF' from Bethesda Research Laboratories, and E. coli. CJ236 from BioRad were used for the propagation of recombinant clones. DH5Q! cells containing recombinant plasmids were grown in LB (1% tryptone; 0.5% yeast extract; 0.5% NaCl) with the addition of 100 ug/ml ampicillin for the selection of antibiotic resistance. DH5aF' cells were propagated in 2xYT (1.6% tryptone; 1% yeast extract; 0.5% NaCl) and CJ236 cells were grown in LB medium containing 30 Mg/ml chloramphenicol. 21 Transformation of E. coli Competent cells were prepared either according to the method described in Promega Biotec Technical Bulletin 018 or by the method of Chung et al . (1989). Recombinant DNA was incubated with 0.2 ml of competent cells on ice for 20-30 minutes and then heat-shocked for 45 sec. at 42°C. DH5a cells were then diluted with 0.9 ml of LB medium and grown at 37°C for one hour. These cells were then plated out on LB plates containing 100 ug/ml ampicillin. The heat-shocked DH5aF' cells and CJ236 cells were diluted into 2.5 ml of prewarmed YT top agar (0.6% agar; 0.8% tryptone; 0.5% yeast extract; 0.5% NaCl) and plated onto YT plates. When screening for M13 recombinants, the YT top agar contained 0.02 ml of lOOmM isopropyl-6-D-thiogalactopyranoside (IPTG) and 0.05 ml of 5-bromo-4-4-chloro-3-indoyl-B-D-galactoside (XGAL) at 2 mg/ml in dimethyformamide. Isolation of Plasmid and M13 DNA from E. coli Plasmid mini-prep procedure Small-scale isolation of DNA was performed as described in Maniatis et al . (1982). Approximately 1 ml of overnight culture was spun down in a microfuge for 3 min. and the pellet was resuspended in 0.1 ml of 50 mM glucose; 25mM Tris /Cl (pH 8.0); 10 mM EDTA. Then 0.2 ml of 0.2N NaOH; 1% SDS was added with gentle mixing and the mixture was incubated on ice for 5 min. Chromosomal DNA and proteins were precipitated by the addition of 0.15 ml of 3M K+; 5M CH3C00" (pH 4.8), with a 5 min. incubation on ice, followed by centrifugation in a microfuge for 5 min. The supernatant was extracted with an equal volume of phenol/chloroform (1:1), and the plasmid DNA was precipitated with the addition of 2 volumes of 95% EtOH. DNA was 22 spun down for 5 min., rinsed in 70% ETOH, and dried in a Speed-Vac Concentrator. The DNA was resuspended in TE (lOmM Tris /Cl [pH 8.0]; ImM EDTA) containing 20 /ig/ml RNase A and incubated at 37°C for 20 min. Following a phenol/chloroform extraction, the DNA was then reprecipitated in 95% EtOH. Plasmids were stored in TE at -20°C. Large Scale Plasmid Preparation The large scale isolation of plasmid DNA from a 250 ml overnight culture was according to the method described in Promega Biotec technical bulletin 009, except that the buffer used for resuspension of the bacterial pellet was 50mM glucose; lOmMEDTA; 25mM Tris /Cl (pH 8.0) containing 2 mg/ml lysozyme. Isolation of Phage DNA Phage DNA was isolated from 2 ml cultures of DH5aF' or CJ236 cells. The cultures were grown for 4-6 hours at 37oc starting from 10 jLil of stationary phase cells which had been inoculated with cored plaques of M13 phage. The E. coli cells were spun down for 5 min. at RT and 1.2 ml of the supernatant was transferred to a fresh tube for the isolation of single-stranded DNA. The pellet was saved for the isolation of RF DNA which was performed according to the plasmid mini-prep procedure. The phage particles in the supernatant were precipitated by the addition of 0.3 ml of 20% PEG(MW 8000); 2. 5M NaCl, vortexing and incubation at RT for 20 min, followed by centrifugation in a microfuge for 5 min. The phage pellet was resuspended in 0.1 ml TE, and extracted once with 30 [Ml phenol and twice with 500 fJ,l chloroform. Single-stranded DNA was precipitated with the addition of 10 fJLl of 3M sodium acetate (pH 5.5) and 0.25 ml of 95% EtOH. The DNA was spun down in a microfuge, rinsed in 70% EtOH, dried and 23 TE for use in oligonucleotide-directed mutagenesis or sequencing reactions. Oligonucleotide-Directed Mutagenesis The method of oligonucleotide-directed mutagenesis described by Kunkel (1985) was used to alter sequences in the structural genes of rubella virus. The synthetic deoxyribonucleotides were obtained from the laboratory of M. Smith (University of British Columbia) and are listed in Table 1. Crude oligonucleotides were purified by electrophoresis through a 20% acrylamide gel containing 7M urea and 0.5 TBE buffer. The gel slice containing the oligonucleotide was incubated overnight at 37°C in 0.5M ammonium acetate; lOmM Mg(0Ac)2, then concentrated to 2M ammonium acetate and EtOH precipitated. Oligonucleotides were kinased with T4 polynucleotide kinase in 50mM Tris/Cl (pH 7.5); lOmM DTT; lOmM MgC12 containing either 0.33mM ATP for mutagenesis or 30 jiCi ^-["P]-ATP for screening mutants. cDNA templates were cloned into M13mpl8 or M13mpl9 and then were propagated in the E. coli CJ236 dUTPase", Ung" strain. The mutagenic oligonucleotides were annealed to the templates under various temperature conditions in 20mM Tris /Cl (pH 7.4); lOmM MgCl2; 50mM NaCl. DNA synthesis was initiated by the addition of T4 DNA Polymerase and T4 DNA Ligase in buffer containing 0.5mM each dNTP; ImM ATP; 30mM Tris/Cl (pH 7.4); 15mM MgCl2; 50mM NaCl; 2mM DTT. Synthesis was. continued for 90 min. at 37°C; and terminated by a 6-fold dilution with lOmM Tris/ lOmM EDTA. DH5aF' competent cells were transformed with aliquots of the synthesis mixture, as described previously. Transformants were screened for potential mutants either by dot blot analysis of the single-stranded phage, or, i f the mutagenic oligonucleotide created a new restriction site, by 24 Table 1. List of mutagenic oligonucleotides. Sequence Function 5'CTGGAGCCCGGGGCGCGCGG 3' change alanine to proline at (-1) position at cleavage site between C and E2 5'AGCCTCCTCGCGATAGGCGG 3' change glycine to arginine at (-1) position at cleavage site between C and E2 5'GGCGGCGCCGCCCGGGGGACAGGCGCG 3 ' change arginine cluster at proposed cleavage site in the C-terminus of E2 5'AAGCGGGGCTCCCGAGTCGCCGTCGAG 3' alter serine protease-like sequence in capsid protein from the original RV sequence are underlined. 25 restriction endonuclease digestion of the RF form of the phage. The presence of mutations was confirmed by dideoxysequencing of the clones according to the Sequenase protocol (U.S. Biochemicals), based on the method of Sanger (1977). Confirmed mutant cDNAs were then subcloned into plasmid expression vectors. Dot Blot analysis Two U.1 of each single-stranded phage DNA preparation that was to be screened were spotted onto a Zeta-Probe membrane (BioRad). The membrane was dried, and prehybridized in 6.0xSSC (lxSSC=0.15M NaCl; 0.015M Na citrate [pH 7.0]); lOx (0.2%) Denhardt's solution (1% each Ficol l ; polyvinylpyrrolidine; BSA); 1% SDS at 65°C for a minimum of 30 min. Hybridization was carried out in the same mixture containing the mutagenic oligonucleotide that had been kinased with X - [32p]-ATP and T4 DNA Polymerase. The temperature of the hybridization reaction depended on the oligonucleotide length. After two hours, the hybridization solution was removed and the membrane was washed in 6xSSC at 42°C, then the temperature of the washing was progressively increased until the approximate Tm of the mutagenic oligonucleotide was reached and the probe had been washed off of the non-mutagenized DNAs. Following the washes at different temperatures, the membrane was autoradiographed to monitor the binding of the probe to the control and mutagenized DNA. Plasmid constructs RV cDNAs were cloned into the vector pSPTl9 (Pharmacia) for in vitro studies and into pCMV5, an in vivo transient expression vector containing the human cytomegalovirus major immediate early gene promoter (D. Russell, 26 Texas) for in vivo studies. The cDNA coding for the structural genes of RV, pSPT19 C/E2/E1, described by Clarke et al . (1987) was subcloned into the EcoRI and Hindlll sites of pCMV5 and renamed p24S by T. Hobman in this laboratory. The plasmid, pE2El, was derived from p24S (Hobman and Gillam, 1988) and codes for 8 amino acids of the amino-terminus of capsid, 56 amino acids of the carboxy-terminus of capsid, and the entire E2 and El proteins. pE2El contains the translational initiation codon of the RV structural polyprotein from the capsid gene. The plasmid, pCE2, was derived from p24S by the excision of a PstI fragment containing the coding region of El , and codes for the capsid and E2 proteins. Plasmid constructs in which the coding regions of genes were truncated, or altered by site-directed mutagenesis are described in the Results section. The physical maps of p24S, pE2El, and pCE2 are shown in Figure 6. In Vitro transcription using SP6 Polymerase Plasmid DNA (2 £lg) was linearized either at the Hindlll site of the vector, or at a site within the cDNA with appropriate restriction enzymes. In vitro transcription of the linearized DNA was carried out in 50 /i l of a mixture containing 40mM Tris/Cl (pH7.5); 6mM MgCl2; 2mM spermidine; lOmM NaCl; lOmM DTT; 100 /ig/ml nuclease-free bovine serum albumin; 0.5mM each NTP; and 600 units/ml SP6 Polymerase (Promega) at 37°C for 60-90 min. The DNA template was digested with 15 units of DNase I for 5 min. at 37°C, and the RNA was extracted with an equal volume of phenol/chloroform and precipitated with 95% EtOH. RNA was stored at -20°C in EtOH. 27 24S s i f-E2 El JO. T S Y Y H , 3 3 E2E1 ft E2 El TS v v Y H , 3 3 E2 CE2 5 1 PH , J £ 1 Figure 6. Schematic diagram of rubella virus cDNA constructs. The coding regions of capsid (C), E2, and El are shown. The translation initiation site, encoded at the 5' end of the capsid gene, is included in each construct (shown by arrow). The transmembrane anchor domains (T), signal peptide regions (S), and the cytoplasmic tai l region of E2 which is rich in arginine residues (r) are indicated. The positions of the coding regions for each of the three N-linked glycosylation sites in both E2 and El proteins are shown (Y). The cDNAs are cloned into the EcoRI (E) and HindiII (H) sites of the expression vector, pCMV5. 28 In vitro translation SP6-derived RNA was resuspended in 20 /i l of TE and approximately 2 /il were used in each translation reaction. The translation reaction was carried out at 30°C for one hour in a total volume of 25 jLil containing SP6-derived RNA, nuclease-treated rabbit reticulocyte lysate (Promega), 0.02 mM amino acid mixture minus methionine, [35S]-methionine (1200 Ci/ml) and RNasin at 1600 units/ml. For protein translocation assays, 1 Hi of canine pancreatic microsomes was added to the translation mix. Translation products were analyzed by SDS-PAGE according to Laemmli (1970). In vivo expression COS cell transfection COS cells were transfected with pCMV5 cDNA constructs according to the method of Adams and Rose (1985), with some modifications. Subconfluent monolayers grown in DMEM/5%FCS (Dulbecco's modified Eagle medium plus 5% fetal calf serum) were washed twice with prewarmed Tris-saline (25mM Tris /Cl [pH 7.4]; 140mM NaCl; 3mM KC1; ImM CaCl2; 0.5mM MgCl2; 0.9mM Na2HP04) . Cells were then incubated with a DNA mix containing 5 Mg/ml plasmid DNA, and 1 mg/ml DEAE-Dextran (Mr=5X105) in Tris-saline for 30 min. at 37°C. Then the DNA solution was removed and replaced with medium containing 80 /iM chloroquine. After three hours of incubation at 37°C, the cells were subjected to a shock treatment of 10% dimethylsulfoxide/DMEM for three minutes at room temperature, followed by two washes with Tris-saline, and incubation in DMEM/5% FCS. Cell labelling Approximately 48 hours following transfection, COS cells were washed 29 with DMEM minus methionine containing 5% dialyzed FCS, then starved in this medium for 30 min. at 37°C. Cells were then incubated in the same medium containing 100 jLtCi [35S]-methionine for a pulse period of 30 min. Protein labelling and synthesis were then inhibited by the addition of DMEM/5% FCS containing 100 jLtg/ml cycloheximide and 2mM methionine. For processing studies, labelled cells were incubated for various chase periods in this mixture. After labelling, cells were washed with Tris-saline, and then lysed in 400 /xl of cold lysis buffer (1% Triton X-100; lOmM EDTA; 50mM Tris [pH 7.5]; 1% sodium deoxycholate; 0.15M NaCl; 0.1% SDS). Cell lysates were spun down at RT for 5 min., and the supernatants were removed for immunoprecipitation. Immunoprecipitation and Endo-B-N-acetylglucosaminidase H digestion Protein A Sepharose (Pharmacia) was preincubated 4 hours to overnight at 4°C with human polyclonal serum (a gift from Dr. A. Tingle) in binding buffer (lOOmM Tris /Cl [pH 7.4]; 400mM NaCl) with constant mixing. The serum-coated beads were then washed twice with binding buffer, and once in lysate buffer (25mM Tris /Cl [pH 7.4]; 100 mM NaCl; ImM EDTA; 1% Nonidet P-40 [NP-40] ). Transfected cell lysates or in vitro translation products were mixed with the serum-coated beads in lysis buffer overnight at 4°C. Beads were washed once with lysate buffer, twice with wash buffer (25mM triethanolamine; 172mM NaCl; 1% deoxycholate; 0.1% SDS; ImM EDTA), three times with lOmM Tris /Cl (pH 7.4), and once with disti l led water. The immune complexes were released from the beads by boiling in lOOmM sodium citrate (pH5.5); 0.15 % SDS for 5 min., vortexing, and pelleting the beads by centrifugation. Supernatants were removed, and some were digested with endo-B-N-acetylendoglucosaminidase H (Genzyme) at 25 milliunits/ml overnight. The immunoprecipitated products were analyzed by SDS-PAGE 30 (Laemmli, 1970) and then fluorography. Indirect Immunofluorescence Transfected COS cells grown on polylysine-coated 9mm plastic coverslips were washed three times with PBS, and fixed for 20 min. at room temperature in 2% formaldehyde/PBS, followed by washing with PBS. Some cells were permeabilized with 0.06% NP-40/PBS for 30 min. prior to blocking with 1% BSA/PBS. A l l washes and solutions after this step include BSA/PBS. Coverslips were overlaid with diluted human serum (1:200) or mouse monoclonals (1:75) incubated for 60 min. at RT, then washed. Incubation with secondary antibody, fluorescein-conjugated goat anti-human or anti-mouse IgG (Tago) diluted 1:100, was for 60 min. Coverslips were washed, mounted, examined using epifluorescence, and photographed. For double-labelling using lectin-conjugates, permeabilized cells were incubated with Wheat Germ agglutinin-Rhodamine (WGA-TRITC) to visualize Golgi and post-Golgi structures or Concanavalin A-Rhodamine (Con A-TRITC) for ER staining at 10-15 Mg/ml for 30 min. at RT prior to blocking with BSA. 31 Results and Discussion I. Mutation of the Serine Protease-Like Sequence in the Capsid Protein The RV capsid protein has an amino acid sequence at its C-terminus that resembles the sequence surrounding the catalytic site of several serine proteases, including the alphavirus capsid protein (Figure 7). However, in vitro studies have shown that the RV capsid protein has no protease activity (Oker-Blom et a l . , 1984; Clarke et a l . , 1987). To examine the potential function of this sequence in the RV capsid protein, i t was mutated to a sequence that more closely resembles the conserved sequence. By oligonucleotide-directed mutagenesis, the threonine was changed to a serine at the active site, and an additional amino acid, glycine, was inserted after the serine (Figure 8). However, sequencing of the wild type and mutant clones revealed an error in the published sequence (Clarke et al . , 1987); a codon specifying serine, not threonine, was already present at this site in the wild type construct (Figure 8). Sequencing of this region is difficult due to a high GC content, so it is possible that errors also exist in the published sequences for the two vaccine strains of RV, HPV77 and RA27/3. Even though a serine residue was already present in the conserved sequence, the mutagenesis s t i l l altered the sequence by the addition of an amino acid. The mutant capsid protein was cloned into the pSPT19 vector at the EcoRI site. The resulting plasmid, called pGC5'E2, encodes the entire capsid and the N-terminal 124 amino acids of E2. In vitro translation of SP6 Polymerase transcripts in the absence of microsomes shows that the mutant capsid was not cleaved from E2 (Figure 9) . Our preparation of microsomes did not efficiently translocate and cleave 32 Chymotrypsin GDSGGPL SV GDSGRPI SFV GDSGGPI RV Therien GDSAPL RV M33 GDTAPL RV HPV77 GDTAPL RV RA27/3 GDTAPL Figure 7. A comparison of the conserved amino acid sequence surrounding the serine catalytic residue of serine proteases and a similar sequence in the capsid protein of different Rubella virus strains. The catalytic serine residues are highlighted. Sequence data for chymotrypsin are from Sakinari et a l . , 1989. The sequence data for Sindbis virus (SV) are from Strauss et al , 1984; for Semliki Forest virus (SFV) from Garoff et a l . , 1980; for Rubella virus (RV) M33 strain from Clarke et a l . , 1987; for RV Therien strain from Frey and Marr, 1988; for RV RA27/3 strain from Nakhasi et a l . , 1989; for RV HPV77 strain from Zheng et a l . , 1989. 33 D S A wt pC5 /E2 GAC AGC G C C mutant pGC5 /E2 GAC TCG GGA GCC D S G A * * • Figure 8. Mutation of the capsid serine protease-like site. (A) A representation of the coding regions of the cDNA which served as the template for site-directed mutagenesis is shown. The cDNA, which codes for capsid protein ( C ) and 1 2 4 amino acids of E 2 , was cloned into the EcoRI site of the M13 vector. (B) The changes introduced by mutagenesis are shown by the sequencing gel. Asterisks denote the altered nucleotides. 34 m i c pGC5 E 2 - + p C 5 / E 2 97.4 • 4 3 ^ 2 9 ^ **E2 1 8 . 4 » -Figure 9. Characterization of the mutagenized capsid protein. The M13 cDNAs coding for wild type and mutagenized capsid p r o t e i n as well as part of E2 (see Figure 8) were cloned into the EcoRI s i t e of pSPT19, and c a l l e d pC5'E2 and pGC5'E2 respectively. The constructs were l i n e a r i z e d at the Hindlll s i t e of the vector and the t r a n s c r i p t i o n was c a r r i e d out as described i n the Materials and Methods. The t r a n s l a t i o n products were analyzed by SDS-PAGE. The cleavage products, capsid (C) and a truncated E2 protein (E2) are indicated. The positions of pr o t e i n molecular weight standards ( i n kD) are marked. 35 a l l peptides, and consequently an uncleaved precursor protein is seen in a l l the products of in vitro translations in the presence of microsomes. Translation in the presence of microsomes results in two cleavage products, a full-length capsid of Mr=35kD, and a truncated, core-glycosylated E2 peptide which is seen as a doublet of approximately 20kD. The origin of the doublet is unknown, but perhaps arose from premature termination of translation. The cleavage in the wild type (pC5'E2), is identical to that of the mutant. The results show that changing the serine protease-like sequence of RV to more closely resemble the conserved sequence had no effect on the capsid protein cleavage. The mutant capsid s t i l l required signal peptidase for cleavage. There is also a tetrapeptide sequence, Pro-Ala-His-Val, in common between the capsid protease of 0'Nyong-nyong virus (an alphavirus) and the RV capsid protein (Levinson et a l . , 1990; Clarke et a l . , 1987). This sequence surrounds the histidine residue of the catalytic triad of the protease of this alphavirus, but i t is not as conserved among the alphaviruses as the sequence which surrounds the serine catalytic residue (Garoff et a l . , 1980; Strauss et a l . , 1984; Takkinen, 1986). A reason that the RV capsid protein does not have a protease activity may be that i t is lacking the third site which contains the aspartic acid residue of the catalytic triad of a serine protease. Further experiments w i l l be required to determine i f there is a potential function for the conserved sequence surrounding the serine residue in the RV capsid protein with respect to autocatalytic cleavage. 36 II. Analysis of the Structural Polyprotein Cleavages by Signal Peptidase i)Role of Conformation in Cleavage Requirement for a minimum length of peptide It has been reported that the passenger domain beyond the signal peptidase cleavage site is important for efficient processing of a signal sequence-containing peptide (Andrews et a l . , 1988). Andrews et a l . (1988) examined the effect on the in vitro processing of progressive deletions in the region beyond the signal peptidase cleavage site of bovine preprolactin. The deletions caused a reduction in the amount of cleavage by signal peptidase, which was shown by protease protection assays to be caused by a failure of the deletion mutants to translocate across the microsomal membrane. The deletion of amino acid sequences immediately following the cleavage site had the most profound effect on translocation. It was suggested that the correct folding of the peptide near the signal sequence was important for the initiation of translocation. However, another study has shown that a signal sequence can be fused to a normally cytoplasmic domain and that this chimeric protein is efficiently translocated and processed (Lingappa et a l . , 1984). From these apparently contradictory results i t appears that the conformational requirements for translocation initiation are general features of protein structure, which may be found within some cytoplasmic domains, as well as following the signal peptide sequences of translocated proteins. The effect of truncated passenger domains on RV polyprotein processing was studied using run-off transcripts specifying full-length capsid and E2 of different lengths. Figure 10 shows the in vitro translation products of the SP6 transcripts in the presence and absence of microsomes. Capsid protein (C) is the only cleavage product shown. It was found that only the 37 E 2 IATG 1 B T X T T _J\ H SPI TM SP 1 5P6 p C 5 E 2 pCE2X B D h m i c 974 »• 68 4 3 ^ "H - + B + i D Figure 10. In vitro analysis of a minimum length requirement for signal peptidase's cleavage. A representation of the cDNA coding for capsid (C) and E2 proteins is shown above. The restriction sites BstEII (B) , BstXI (X), PstI (?) , EcoRI (E), and Hindlll (H) , and signal peptide (SP) and transmembrane (TM) domains are indicated. [A]-[D] represent linearized cDNAs cloned into pSPT19 which were used for transcription and which code for capsid and different lengths of E2: [A] codes for ful l length capsid and E2, and was derived from the cDNA, p24S, by linearization of the construct at the PstI site at the 3'terminus of E2; [B] is a cDNA clone, pC5'E2, which encodes capsid and 124 amino acids of E2, the 3' end of which is denoted by an asterisk, which has been linearized at the Hindlll site of the vector; [C] is a cDNA clone, pCE2X, which codes for capsid and 86 amino acids of E2. pCE2X was constructed by cutting pC5'E2 at the BstXI site of E2, f i l l ing in the 3' end using T4 DNA polymerase, and religating to the Smal site of the vector. The resulting cDNA was linearized at the Hindlll site of the vector; [D] codes for capsid protein and 25 amino acids of E2 and was derived from pC5'E2 by linearization at the BstEII site at the 5'terminus of E2. The translation products derived from SP6 transcripts were analyzed by SDS-PAGE. Translations were in the presence and absence of microsomes (mic). Capsid protein (C) is indicated. 38 s m a l l e s t t r a n s l a t i o n p r o d u c t , s p e c i f y i n g c a p s i d and 25 amino a c i d s o f E 2 , was n o t c l e a v e d b y the s i g n a l p e p t i d a s e o f the microsomes ( l a n e D ) . These r e s u l t s s u g g e s t t h a t t h e r e i s a minimum l e n g t h r e q u i r e m e n t f o r t h e t r a n s l o c a t i o n and s i g n a l p e p t i d a s e c l e a v a g e o f RV E2 g l y c o p r o t e i n , w h i c h i s i n be tween 25 and 86 amino a c i d s o f E 2 . A s i m i l a r r e s u l t has a l s o b e e n o b t a i n e d i n a v a c c i n i a v i r u s r e c o m b i n a n t o f E2 ( u n p u b l i s h e d r e s u l t s ) . The i n v i t r o s t u d i e s o f Andrews e t a l . (1988) f o u n d t h a t t h e amino a c i d r e s i d u e s f r o m (+1) to (+22) w i t h r e s p e c t to the s i g n a l p e p t i d a s e c l e a v a g e s i t e were t h e most i m p o r t a n t f o r d e t e r m i n i n g t h e t r a n s l o c a t i o n a l p o t e n t i a l o f the n a s c e n t p o l y p e p t i d e . When some o f t h e s e r e s i d u e s were d e l e t e d and d i s t a l r e s i d u e s became a d j a c e n t to the c l e a v a g e s i t e , a d e c r e a s e i n t r a n s l o c a t i o n and c l e a v a g e by s i g n a l p e p t i d a s e was o b s e r v e d . I t a p p e a r s t h a t a minimum l e n g t h o f p e p t i d e d i r e c t l y f o l l o w i n g t h e s i g n a l p e p t i d e needs to be t r a n s l a t e d and f o l d e d i n t o the c o r r e c t c o n f o r m a t i o n f o r r e c o g n i t i o n b y components o f the t r a n s l o c a t i o n a p p a r a t u s . The minimum l e n g t h r e q u i r e d p r o b a b l y v a r i e s among p r o t e i n s . E f f e c t o f G l y c o s y l a t i o n on S i g n a l P e p t i d a s e C l e a v a g e J n vitro a n a l y s i s has shown t h a t N - l i n k e d g l y c o s y l a t i o n o c c u r s c o t r a n s l a t i o n a l l y as the n a s c e n t p e p t i d e i s i n s e r t e d i n t o t h e lumen o f the ER (Rothman and L o d i s h , 1977) . G l y c o s y l a t i o n i s known to i n f l u e n c e p r o t e i n t r a n s p o r t i n some c a s e s b y i t s e f f e c t on p r o t e i n c o n f o r m a t i o n ( r e v i e w e d i n S t r a u s s and S t r a u s s , 1985) , and i t c a n a l s o i n f l u e n c e the c l e a v a b i l i t y o f a p e p t i d e . F o r example , a m u t a t i o n i n the i n f l u e n z a v i r u s h e m a g g l u t i n i n p r o t e i n t h a t p r e v e n t s g l y c o s y l a t i o n c a n r e s u l t i n e n h a n c e d c l e a v a b i l i t y o f t h e p r o t e i n (Kawaoka and W e b s t e r , 1989) . The i n f l u e n c e o f g l y c o s y l a t i o n on the s i g n a l p e p t i d a s e c l e a v a g e between RV C and E2 was s t u d i e d i n vitro. A cDNA c l o n e c o d i n g f o r c a p s i d and 86 39 amino acids of E2, called pCE2X (C in Figure 10), was used in this study. There are two N-linked glycosylation sites of E2 encoded in this cDNA, and in the mutant, called pCE2X-Gl/2, these sites have been altered (Figure 11A) . In vitro translation of transcripts from these clones, in the presence and absence of microsomes, (Figure 11B) shows that there is no detectable difference between the signal peptidase cleavage of the non-glycosylated peptide and the glycosylated" peptide (C is the only cleavage product shown). This indicates that glycosylation is not important for the in vitro signal peptidase cleavage of this polyprotein precursor. i i ) Mutation of the Signal Peptidase Cleavage Site between Capsid and E2 In vitro analysis The signal peptidase cleavage site between C and E2 was altered by oligonucleotide-directed mutagenesis in a cDNA encoding entire capsid and 124 amino acids of E2 (Figure 10-B, Figure 12). In vitro expression of the mutant cDNA (pCP5'E2) shows that the change at the cleavage site did not completely abolish cleavage, but caused a reduction in the amount of cleavage compared to the wild type (Figure 13). When translation was carried out in the presence of microsomes, capsid (C) was cleaved from the C/E2 precursor. Also, a new higher molecular weight peptide which migrates slower than the C/E2 precursor appears in the -translation products of the mutant construct (Figure 13, lane 4). This higher molecular weight peptide probably corresponds to the mutant precursor peptide which has been translocated, and is core glycosylated, but was not cleaved by signal peptidase. It is possible that the alanine at the (-3) position serves as an alternate cleavage site in the mutant precursor, since i t has the general 40 SP6 w pCE2X p C E 2 X - G l / 2 B mic 974^ 68>-43i pCE2X - -h pCE2X-G1/2 Figure 11. In vitro study of the signal peptidase processing of an E2 glycosylation-deficient mutant. (A) The wild-type cDNA, pCE2X (C in Figure 10), is represented and the two sites in this construct which encode the sequence for N-linked glycosylation are indicated by arrows. The mutant cDNA construct, pCE2X-Gl/2, was derived as follows from an E2 cDNA clone previously constructed in this laboratory which had been altered at the f irst two N-linked glycosylation sites of E2: The BstXI fragment from the E2 mutant cDNA was purified, blunt-ended with T4 DNA Polymerase, and then cut with BstEII. The digested E2 fragment was then ligated into the BstEII- and Smal-digested C/E2 clone, pC5'E2. The changes in amino acid sequence of the mutant E2 protein derived from pCE2X-Gl/2 are shown, with the altered amino acids indicated by asterisks. (B) The translation products from transcripts derived from the Hindlll-linearized cDNAs, pCE2X and pCE2X-Gl/2. Capsid protein (C) is the cleavage product shown which appears when microsomes (mic) are added to the translation mixture. Protein molecular weight standards are indicated (in kD) . 41 A B mutant 3 ' G G C G A T C Figure 12. Mutation of the signal peptidase cleavage site between capsid and E2. (A) The cDNA construct, pC5'E2 (B in Figure 10), was used as a template for the mutagenesis of the cleavage site between capsid and E2. The altered sequence surrounding the cleavage site is shown. (B) An autoradiograph of the sequencing gel which confirmed the presence of the mutation is shown. The altered nucleotides are indicated by asterisks. 42 C / E 2 mic 97.4»-68»-2 + 3 4 - + R V 43»-Figure 13. In vitro analysis of the C/E2 si g n a l peptidase cleavage s i t e mutant. The cDNA constructs, pC5'E2 and pCP5'E2, were l i n e a r i z e d with Hindlll and transcribed by SP6 Polymerase. SP6 t r a n s c r i p t s were tran s l a t e d i n the presence and absence of microsomes (mic) and the t r a n s l a t i o n products were separated by SDS-PAGE. The capsid (C) cleavage product i s shown. Lanes 1 and 2: pC5'E2 t r a n s l a t i o n products. Lanes 3 and 4: pCP5'E2 t r a n s l a t i o n products. The uncleaved C/E2 precursor i s approximately 45 kD. Lane 5 i s the t r a n s l a t i o n product of the SP6 t r a n s c r i p t from Smal-digested pCP5'E2. Lane 6 shows the r a d i o l a b e l l e d RV v i r i o n proteins, C, E2, and E l . Protein molecular weight standards are indicated ( i n kD). 43 features of a cleavage site according to von Heijne (1986) , and would also release a capsid protein of approximately the same size as the wild type protein. Although N-terminal amino acid sequencing of E2 has defined the second alanine as the signal peptidase cleavage site (Kalkkinen et a l . , 1984), i t appears that the alanine at the (-3) position is a cryptic cleavage site which has been unmasked by the mutagenesis of the original site. The mutagenesis introduced a new Smal site into the clone between the coding regions of C and E2. Therefore, transcripts derived from the Smal-linearized clone will specify a capsid protein corresponding to the entire coding region of C. In Figure 13, lane 5 shows the translation product of this transcript, and lane 6 the three RV structural proteins, which are from radiolabelled mature virions. A comparison of C in these two lanes shows that mature C is similar, i f not identical, to the in vitro translation product in size. Since the C-terminus of C has not previously been defined, this is the first indication of the length of the mature protein. It appears that no further processing of C occurs after the signal peptidase cleavage separating C from E2, and that the signal peptide of E2 is withdrawn from the ER membrane and remains at the C-terminus of mature C. Figure 14 confirms that the higher molecular weight peptide resulting from the in vitro translation of the C/E2 cleavage site mutant is a glycosylated, uncleaved form of the precursor peptide. Endo H digestion of the translation products shown in Figure 13 results in a loss of this higher molecular weight band, and a corresponding increase in the amount of deglycosylated precursor (Figure 14, lanes 5 and 6). A shift in the mobility of the truncated E2 peptide is also seen after endo H treatment, from a 20 kD core-glycosylated form to a 15 kD deglycosylated form. The 44 C /E2 endoH — — mic — - f 68»-184»-14^ 3 + 4 5 6 - - + ~ + + «5/E2 Figure 14. Endo H digestion of C/E2 in vitro translation products. The in vitro translation products of pC5'E2 and pCP5'E2 (shown in Figure 13) were immunoprecipitated with human anti-RV serum, and then digested with endo H, and analyzed by SDS-PAGE. The cleavage products from the translations with microsomes (mic) added are capsid (C), and a truncated E2 from the 5' coding region (5'E2). The uncleaved C/E2 precursor is approximately 45kD. A glycosylated form of this precursor is seen in Lane 5, above the 45kD peptide. Lanes 1-3: pC5'E2 translation products Lanes 4-6: pCP5'E2 translation products. 45 glycosylation of the mutant precursor peptide shows that i t has been translocated into microsomal vesicles, which indicates that alteration of the signal peptidase cleavage site does not affect the translocation of E2 protein. In vivo analysis The cleavage site mutants, pCPE2 and p24S-CPE2, were derived by replacing the BstEII/EcoRI fragment of the wild type cDNAs, pCE2 and p24S (Figure 6) with the corresponding fragment from the mutant cDNA construct. The C/E2 constructs encode capsid protein and E2, and the 24S constructs encode the three RV structural proteins, C, E2, and El . Intracellular proteins of transfected COS cells were labelled with [35S]-Methionine for a pulse period of 30 minutes, and in some cases were chased for a period of either 30 minutes or 2 hours. The labelled products were immunoprecipitated with human serum and analyzed by SDS-PAGE. Figure 15 A shows the immunoprecipitated products from the C/E2 transfected lysates. After a pulse of 30 minutes, there is a C/E2 precursor peptide in the wild type and mutant products (lanes 1 and 2), and when chased, this band disappears from the wild type products (lanes 3 and 5), but s t i l l remains in the mutant products (lanes 4 and 6). Cleavage of the C/E2 precursor to a C protein of Mr=35 kD and to the core-glycosylated E2 protein of Mr=39 kD occurs quickly for the wild type precursor (lane 1). Wild type E2 requires a longer chase period to achieve the higher molecular weight of the virion form shown in lane 7 (T. Hobman, PhD. thesis), therefore the virion form is not seen in these products. The polypeptide that migrates slightly slower than the C/E2 precursor may be BiP protein which has a reported molecular weight of 77 kD, and has been found in 46 C /E2 1 min 0 974»-68^ 2 3 4 5 6 7 0 30 30 120 120 R v -«C/E2 43>-^E2(39kD) B 1 min 0 974»* 68»-43»-24S 2 3 4 5 6 7 0 30 30 120 120 R V -«C/E2 -*E1 ^2(39kD) Figure 15. In vivo pulse-chase study of the C/E2 signal peptidase cleavage site mutants. COS cells were transfected with the pCMV5-cDNAs which were mutant and wild type at the cleavage site between capsid (C) and E2 proteins. Transfected cells were labelled with [35S]-methionine for a pulse period of 30 min. and chased for a period of either 30 min. or 2 hours (shown in min.). Labelled lysates were immunoprecipitated with human anti-RV serum and separated by SDS-PAGE. The 74 kD C/E2 precursor and the cleavage products,C and a 39 kD form of E2, are indicated by arrows. (A) The immunoprecipitated products of pCE2 (wild type) and pCPE2 (mutant). Lanes 1, 3, and 5: pCE2 transfected products. Lanes 2, 4, and 6: pCPE2 transfected products. Lane 7 shows the radiolabelled RV virion proteins, C, E2, and E l . (B) The immunoprecipitated products of p24S (wild type) and p24S-CPE2 (mutant). Lanes 1, 3, and 5: p24S transfected products. Lanes 2, 4, and 6: p24S-CPE2 transfected products. Lane 7 shows the radiolabelled RV structural proteins. 47 association with misfolded proteins in the ER as well as with some viral glycoproteins (Kozutsumi et a l . , 1988; Rose et a l . , 1988; Hurtley et a l . , 1988). The cleavage products of the mutant precursor take a longer time to appear, and are most abundant after a 2 hour chase period (lane 6). These results suggest that the kinetics of the cleavages of the wild type and mutant precursor peptides are different; the cleavage of the wild type C/E2 precursor appears to be faster and efficient, whereas the cleavage of the mutant C/E2 is relatively slow and incomplete. The results from the in vivo expression of the 24S constructs (Figure 15B) are similar to those found for the C/E2 constructs. The cleavage of El from the mutant structural polyprotein occurs normally even though the C/E2 cleavage site is altered (lanes 2, 4, and 6). This indicates that the aberrant conformation of E2 within the ER membrane does not affect the processing of E l . Endo H digestion of the 2 hour chase products shows that the oligosaccharide structures on the mutant C/E2 precursor are endo H-sensitive, as seen by the shift in mobility of the polypeptide from 74 kD to approximately 65 kD (Figure 16). This suggests that the mutant precursor is retained within the ER, where oligosaccharide structures show endo H sensitivity. Several viral glycoproteins, such as the influenza virus hemagglutin, must be folded correctly as a prerequisite of transport from the ER (Gething et a l . , 1986), therefore i t is possible that the RV E2 glycoprotein also must be in the correct conformation to exit the ER. The 57 kD El and 39 kD E2 glycoproteins also display an increase in mobility after endo H treatment. Only the immunoprecipitated products of p24S-CPE2-and pCPE2- transfected cells have a C/E2 precursor present after a 2 hour chase period following synthesis. A l l wild type C/E2 precursor is cleaved after 2 hours. 48 pCE2 endo H — + 97.4»* 68»-43> pCPE2 p24S 1 p24S-CPE2 - + - + «C/E2 «E1 -<E2 29" Figure 16. Endo H digestion of the in vivo expression products of the C/E2 constructs. The immunoprecipitated products of transfected COS cells which had been labelled with [35S]-methionine and chased for 2 hours (Figure 15A,B: Lanes 5 and 6) were digested with endo H and analyzed by SDS-PAGE. The endo H-sensitive (core-glycosylated) forms of the C/E2 precursor, E l , and E2 are indicated by arrows. Protein molecular weight standards are shown (in kD). Wild type (pCE2, p24S). Cleavage site mutant (pCPE2, p24S-CPE2). 49 Immunofluorescence studies Transfected COS cells were processed for indirect immunofluorescence studies on the subcellular localization of the C/E2 mutant and wild type precursor polypeptides and their cleavage products. Figures 17 and 18 show the distribution of C and E2 in cells transfected with pCE2 and pCPE2, the wild type and mutant C/E2 constructs. Monoclonal antibodies were used to localize these antigens, and some cells were also treated with Rhodamine-conjugated WGA to identify Golgi and post-Golgi structures (Virtanen et a l . , 1980), or with Con A to identify the ER. The E2 expressed in pCE2-transfected cells is localized in a predominantly juxtanuclear position (Figure 17A), which corresponds to the position of the Golgi apparatus (Figure 17B). In contrast, E2 expressed from pCPE2 (Figure 17C) shows a reticular staining pattern, similar to that of the ER reticular network (Figure 17D). Figure 17E shows another cel l transfected with pCPE2, with a reticular staining pattern which does not correspond to the staining pattern of the Golgi complex (Figure 17F). In Figure 18A, wild type C expressed from pCE2 is diffuse throughout the cel l cytoplasm, rather than concentrated in the Golgi region which is indicated in Figure 18B. The staining pattern of pCPE2-derived C is very different, suggesting a reticular location of this protein, probably corresponding to the ER (Figure 18C). Cell-surface staining using human polyclonal serum (Figure 18 D,E) indicates that RV E2 antigens are present on the surface of both mutant-and wild type-transfected cells. Figures 19 and 20 show the subcellular distribution of C and E2 expressed from the 24S cDNA constructs, p24S and p24S-CPE2. When wild type El and C are co-expressed, a strong juxtanuclear staining pattern which corresponds to the Golgi region is observed for C (Figure 19A.B), in 50 f o e e e e Figure 17. Indirect immunofluorescence of pCE2- and pCPE2-transfected COS cells: E2 localization. Cells were permeabilized with detergent for the detection of intracellular antigens and treated with anti-E2 serum. (A) pCE2-transfected cel l , anti-E2 (B) same cel l , TRITC-WGA (C) pCPE2-transfected cel l , anti-E2 (D) same cel l , TRITC-Con A (E) pCPE2-transfected cel l , anti-E2 (F) same cel l , TRITC-WGA. 51 Figure 18. Indirect immunofluorescence of pCE2- and pCPE2-transfected COS cells: capsid localization and cell surface immunofluorescence. Frames A-C, cells were permealilized and treated with anti-capsid (C) serum. (A) pCE2-transfected cells, anti-C (B) same cel l , TRITC-WGA (C) pCPE2-transfected cel l , anti-C. Frames D and E, cel l surface antigens were detected with human polyclonal anti-RV serum. (D) pCE2-transfected cell (E) pCPE2-transfected cel l . 52 Figure 19. Indirect immunofluorescence of p24S- and p24S-CPE2- transfected COS cells: capsid localization. Al l cells were permeabilized and treated with anti-capsid (C) serum. (A) p24S-transfected cel l , anti-C (B) same cel l , TRITC-WGA (C) p24S-CPE2-transfected cel l , anti-C (D) same cel l , TRITC-Con A. 53 • • Figure 20. Indirect immunofluorescence of p24S- and p24S-CPE2- transfected COS cells: E2 localization. A l l cells were permeabilized and treated with anti-E2 serum. (A) p24S-transfected cel l , anti-E2 (B) p24S-CPE2- transfected cel l , anti-E2 (C) same cel l , TRITC-Con A. 54 contrast to the diffuse cytoplasmic distribution observed when C is expressed in the absence of El (Figure 18A). It has been proposed that in COS cells C concentrates at the Golgi membrane in association with the cytoplasmic ta i l of El (T. Hobman, PhD. thesis). Capsid protein expressed from p24S-CPE2 is less concentrated in the juxtanuclear region and appears to reside in the reticular network of the ER (Figure 19C,D). The E2 protein expressed from the wild type construct, p24S, is predominantly in a juxtanuclear position which indicates that i t has been transported to the Golgi apparatus (Figure 20A). However, E2 expressed from p24S-CPE2 shows a more diffuse staining pattern which is similar to the pattern of Con A staining (Figure 20 B,C). In summary, the immunofluorescence studies show an abnormal subcellular distribution of C and E2 expressed from the mutant constructs. The staining patterns for these two antigens, expressed from the mutant constructs, are mostly reticular, which suggests that the majority of the mutant C/E2 precursor remains uncleaved by signal peptidase, and that the mutant precursor is not transported beyond the ER. The cell surface staining shows the presence of antigen at the cell surface of mutant-transfected cells. The SDS-PAGE analysis of the COS cell products revealed that some cleavage of the mutant precursor occurs (Figure 15) , so i t is likely that there may be some cleaved E2 which has been transported to the cel l surface. Further-studies are required,- however, to determine whether any of the uncleaved precursor is transported to the cell surface. i i i ) Mutation of the Cleavage Sites between E2 and El In vitro analysis The cleavage(s) between the E2 and El proteins were studied using a double mutant in which both the signal peptidase cleavage site and the 55 proposed trypsin-like cleavage site in the cytoplasmic ta i l of E2 were altered. The signal peptidase site (-1) residue was changed from a glycine to an arginine, and three consecutive arginine residues of the cytoplasmic ta i l region of E2 were changed to other amino acids by site-directed mutagenesis (Figure 21). In vitro analysis of the double mutant (Figure 22) shows that the mutant E2/E1 precursor product is not readily cleaved by the signal peptidase present in the microsomal membranes. The mutant precursor shifts to a higher molecular weight form when microsomes are added to the translation mix. Therefore, like the mutant C/E2 precursor, the mutant E2/E1 precursor is translocated normally and is glycosylated, but is not cleaved efficiently by signal peptidase. The wild type E2/E1 precursor is cleaved in the presence of microsomes to yield E2, which is seen as a doublet, and E l . The El protein has a much weaker signal than E2 since i t contains fewer methionine residues. A protein which corresponds in size to the lower molecular weight band of the E2 doublet is seen in the translation products processed by microsomes of the mutant E2/E1 transcripts. If this peptide corresponds to E2, then some cleavage of the mutant precursor occurred. The origin of the lower molecular weight E2 peptide is unknown, but i t has been observed in other in vitro studies and was suggested to result from the processing of the C-terminus of E2 (T. Hobman, PhD. thesis). In vivo analysis In vivo expression of the two pCMV5 constructs, the wild type construct, pE2El, and the mutant construct, pE2(-tl)REl, showed that the presence of the double mutation greatly inhibited cleavage of the E2/E1 precursor in vivo (Figure 23). Transfected COS cells were labelled with [35S ]-Methionine for a period of 30 minutes and some were chased for 2 56 PE2E, 5 ' ^ | . E2 tf 1 2 El H / [TJ wt C G C C G C G C C TGT C G C C G C C G C R R A C R R R i I I mutant C G C C C G G G C P P G • El -3 -2 -1 +1 [2] wt GCC T A J G G C G A G A Y "5" E mutant C G C R Figure 21. Mutation of the cleavage sites between E2 and E l . The wild type cDNA, pE2El (described in Figure 6), is represented, with the signal peptide (s) and transmembrane (t) domains and arginine-rich region of E2 (r) indicated. The positions of the two cleavage sites between E2 and El which are altered by site-directed mutagenesis in the double mutant, pE2(-tl)REl, are shown by arrows. [1] shows the site of the proposed trypsin-like processing between the transmembrane anchor of E2 and the signal peptide of E l . The entire nucleotide sequence and deduced amino acid sequence of this cytoplasmic ta i l region of E2 is shown. The coding region for three consecutive arginine residues is altered in the mutant sequence. [2] shows the site of signal peptidase cleavage between E2 and El . The (-1) residue with respect to the cleavage site was changed from a glycine to an arginine residue in the mutant. An autoradiograph of the sequencing gel which confirmed the presence of the mutant sequence in the E2 cytoplasmic ta i l region is shown. The altered sequences are denoted by asterisks. 57 E2/E1 m i c 200»* 92.5»-69»-46^ - + B - + R V -«E2/E1 -*E1 «E2 30»-Figure 22. In vitro analysis of the E2/E1 cleavages, using a double mutant. The wild type cDNA construct, pE2El, and the double mutant construct, pE2(-tl)REl, were cloned into the vector pSPT19. SP6 transcripts were derived from Hindlll-linearized templates and were translated in the presence and absence of microsomes (mic). The translation products were separated by SDS-PAGE. The unglycosylated precursor polypeptide, E2/E1, and the three RV virion proteins, C, E2 and El , are indicated by arrows. Radiolabelled protein molecular weight standards are shown (in kD). 58 E2/E1 min 20O- -92.5»-69^ 46»* 1 2 0 0 3 4 120 120 «E2/E1 -«E1 2E2 30' Figure 23. In vivo pulse-chase study of the E2/E1 cleavages, using a double mutant. The cDNAs, pE2El and pE2(-tl)REl, were cloned into pCMV5 for in vivo expression i n COS c e l l s . The transfected c e l l s were l a b e l l e d with [ 3 5S]-methionine f o r a pulse period of 30 min. and chased f o r 2 hours (chase period i s indicated i n min.). The l a b e l l e d t r a n s f e c t i o n products were immunoprecipitated with human anti-RV serum and separated by SDS-PAGE. Lanes 1 and 3 show the immunoprecipitated products of pE2El-transfected c e l l s , and Lanes 2 and 4 show the immunoprecipitated products of pE2(-t l ) R E l - t r a n s f e c t e d c e l l s . The 92kD E2/E1 uncleaved precursor, a 57 kD cleaved E l , and a 39kD E2 cleavage product and i t s more processed form of 42kD, are indicated by arrows. Radiolabelled p r o t e i n molecular standards are shown ( i n kD). 59 hours. Wild type E2/E1 precursor is very efficiently cleaved during the pulse period and very l i t t l e precursor remains. After the chase period, two forms of the E2 protein are seen, a 39 kD core-glycosylated form and a more processed 42 kD form. In contrast, no cleavage products of the mutant E2/E1 precursor are seen either after the pulse or chase period. The E2/E1 glycosylated precursor is approximately the same size as the molecular weight marker of 92 kD. Since core-glycosylated E2 and El are 39 kD and 53 kD respectively, the size of this E2/E1 precursor is in agreement with a predicted size for a core-glycosylated precursor. Immunofluorescence studies Monoclonal antibodies were used to localize E2 and El within transfected COS cells (Figures 24 and 25). E2 which was expressed from pE2El is found mainly in a juxtanuclear position which costains with WGA, but some is also seen in a reticular distribution (Figure 24 A,B). In contrast, E2 expressed from pE2(-tl)REl shows a diffuse staining pattern, which does not correspond to the Golgi-staining pattern (Figure 24 C,D). El which was expressed from pE2El is distinctly concentrated in the juxtanuclear region, corresponding to the Golgi complex (Figure 25 A,B), whereas El expressed from pE2(-tl)REl shows a more diffuse staining pattern which may indicate the ER (Figure 25 C,D). The intracellular immunofluorescence of El expressed from the mutant construct was found to be weak when using a monoclonal antibody specific for a hemagglutination-inhibition (HAI) epitope. In the uncleaved E2/E1 precursor, El would be constrained at both its N-terminus and its C-terminus in the ER membrane, and this would result in an abnormal conformation of certain epitopes. The immunofluorescence staining of El expressed from the mutant construct was brighter when a non-HAI monoclonal 6 0 9 o * e * Figure 24. Indirect immunofluorescence of pE2El- and pE2(-tl)REl-transfected cells: E2 localization. Cells were permeabilized and treated with anti-E2 serum. (A) pE2El-transfected cel l , anti-E2 (B) same cel l , TRITC-WGA (C) pE2(-tl)REl-transfected cel l , anti-E2 (D) same cel l , TRITC-WGA. 61 Figure 25. Indirect immunofluorescence of pE2El- and pE2(-tl)REl-transfected cells: El localization. Cells were permeabilized and treated with anti-El serum. (A) pE2El-transfected cel l , anti-El (B) same cel l , TRITC-WGA (C) pE2(-tl)REl-transfected cel l , anti-El (D) same cel l , TRITC-WGA. 62 antibody was used. Figure 26 shows the cell surface staining of the E2/E1 transfected COS cells. El at the cell surface of pE2El-transfected cells displays a very bright immunofluorescence and E2 from the same construct is also seen at the cell surface (Figure 26 A,B). The double mutant, pE2(-tl)REl, expresses some El and E2 at the cell surface, but the staining of El is very weak (Figure 26 C-F). In summary, the immunofluorescence studies of the double cleavage mutant of the E2/E1 precursor show an abnormal distribution of E2 and El within transfected COS cells, which indicates that transport of the uncleaved precursor beyond the ER did not occur. Although the SDS-PAGE analysis of the transfection products did not show any cleavage of the mutant E2/E1 precursor, i t is possible that some cleavage did occur, and that E2 and/or El was transported to the cell surface, as is suggested by the cel l surface staining of the mutant-transfected cells. The predominantly ER-specific localization of the E2 and El antigens indicates that transport of the uncleaved precursor beyond the ER did not occur. There are no alternate amino acid sequences near the normal signal peptidase cleavage site that conform to the requirements of a cleavage site according to von Heijne (1986). There is an alanine residue at the (-3) position, but i t is not likely to serve as a cleavage site since there is a proline in the (-4) position. It is possible that the cleavage of the mutant peptide occurred at an alternate site in the cytoplasmic ta i l region of E2 because in this region there are two consecutive arginine residues which were not mutagenized (Figure 21), and these may serve as an alternate cleavage site for a trypsin-like protease. However, they are unlikely to be used as a site of normal processing since they immediately follow the transmembrane 63 \ I .* til) ' D 7. . . Figure 26. Indirect immunofluorescence of pE2El- and pE2( - t l ) R E l -transfected COS c e l l s : c e l l surface immunofluorescence. The c e l l s were stained for surface antigens with E2 and E l monoclonal sera. (A) pE2El-transfected c e l l , a n t i - E l (B) pE2El-transfected c e l l , anti-E2 (C) pE2(-tl)REl-transfected c e l l , a n t i - E l (D) same c e l l , phase contrast (E) pE2(-tl)REl-transfected c e l l , anti-E2 (F) same c e l l , phase contrast. 64 anchor of E2, and basic residues on the cytoplasmic side of transmembrane anchors are found to be important for the stabilization of a transmembrane domain (Sabatini et a l . , 1982). Summary and Conclusions The results of this study indicate that mutation of the signal peptide cleavage sites of the RV structural polyprotein does not affect the translocation of the envelope proteins, E2 and El , across the ER membrane. However, a profound effect on the intracellular transport of these proteins was observed. Most of the uncleaved C/E2 and E2/E1 precursor polypeptides were found to be retained in the ER region of the cel l . The E2 and El peptides which were not cleaved by signal peptidase at their N-termini may be held within the ER membrane at both their N- and C-termini in an abnormal configuration. Normally, the N-termini of E2 and El are free in the lumen of the ER to assume the correct tertiary structure for transport. The incorrect folding of E2 and El may have prevented their exit from the ER. A difference between the two cleavage site mutants was observed during both in vitro and in vivo expression studies. The expression of the C/E2 precursor cleavage site mutants showed partial cleavage of the precursor, which indicated that an alternate cleavage site was used. However, very l i t t l e or no cleavage of the E2/E1 precursor was observed in the cleavage site mutant. An in vitro translation product of the E2/E1 mutant may have corresponded to cleaved E2 protein, but further studies are required to confirm the identity of this translation product. This study has confirmed one of the differences between the processing of the alphavirus structural precursor polyprotein and that of RV. The alphavirus capsid protein is separated from the rest of the structural 65 protein itself (Melancon and Garoff, 1987). Even though a sequence similar to that surrounding the catalytic serine residue of the protease is found in RV capsid, i t does not appear to be able to function in autoproteolysis, even when mutagenized to more closely resemble the alphavirus sequence. The C-terminus of mature RV capsid protein appears to contain the signal peptide of E2, since a capsid protein translation product containing the signal peptide of E2 is approximately the same size, i f not identical to, capsid protein found in virions. The C-terminus of E2 may be processed at the arginine-rich region. To determine whether a proteolysis at this potential trypsin-like cleavage site is able to separate the E2 and El proteins, a single mutant E2/E1 cDNA construct in which only the signal peptidase cleavage site is altered has been constructed and will be expressed in COS cells. This study is now in progress. 66 References Adams, G.A. and Rose, J.K. (1985) Structural requirements of a membrane-spanning domain for protein anchoring and cell surface transport. Cell 41;1007-1015). Aliperti , G. and Schlesinger, M.J. (1978) Evidence for an autoprotease activity of Sindbis virus capsid protein. Virology 90: 366-369. Andrews, D., Perara, E . , Lesser, C. and Lingappa, V. (1988) Sequences beyond the cleavage site influence signal peptide function. J . Biol . Chem. 263: 15791-15798. Arias, C. , Bell , J .R. , Lenches, E.M., Strauss, E.G. and Strauss,J.H. (1984) Sequence analysis of two mutants of Sindbis virus defective in the intracellular transport of their glycoproteins. J . Mol. Biol. 168: 87. Bardeletti, G..Tektoff, J . and Gautheron, D. (1979) Rubella virus maturation and production in two host cel l systems. Intervirology 11: 97-103. Blobel, G. and Dobberstein, B. (1975a) Transfer of proteins across membranes I. Presence of proteolytically processed and unprocesed nascent immunoglobulin murine myeloma. J . Cell Biol. 67: 835-851. Blobel, G. and Dobberstein, B. (1975b) Transfer of proteins across membranes II. Reconstitution of functional rough microsomes from heterologous components. J . Cell Biol . 67: 852-862. Blobel, G. (1980) Intracellular protein transport. Proc. Natl. Acad. Sci. U.S.A. 77: 1496-1500. Boege, U. , Wengler, G., Wengler, G. and Wittmann-Liebold, B. (1981) Primary structure of the core proteins of the alphaviruses Semliki Forest virus and Sindbis virus. Virology 113: 293-303. Bohni, P. C , Deshares, R.J. and Schekman, R.W. (1988) SEC11 is required for signal processing and yeast cel l growth. J . Cell Biol. 106: 1035-1042. Bonatti, S., Migliaccio, G. and Simons, K. (1989) Palmitylation of viral membrane glycoproteins takes place after exit from the endoplasmic reticulum. J . Biol . Chem. 264: 12590-12595. Brzeski, H. and Kennedy, S.I.T. (1977) Synthesis of Sindbis virus nonstructural polyprotein in chicken embryo fibroblasts. J . Virol . 22: 420-429. Chou, P. Y. and Fasman, G.D. (1978) Empirical predictions of protein conformation. Ann. Rev. Biochem. 47: 251-276. Chung, C.T. , Niemela, S.L. and Miller, R.H. (1989) One step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. U.S.A. 86: 2172-2175. 67 Clarke, D.M., Loo, T.W., Hui, I . , Chong, P. and Gillam, S. (1987) Nucleotide sequence and in vitro expression of rubella virus 24S subgenomic mRNA encoding the structural proteins E l , E2, and C. Nucl. Acids Res. 15: 3041-3057. Clarke, D.M., Loo, T. , McDonald, H. and Gillam, S. (1988) Expression of rubella virus cDNA coding for the structural proteins. Gene 65: 23-30. Cutler, D.F. and Garoff, H. (1986) Mutants of the membrane-binding region of Semliki Forest virus E2 protein. I. Cell surface transport and fusogenic activity. J . Cell Biology 102: 889-901. Cutler, D.F., Melancon, P. and Garoff, H. (1986) Mutants of the membrane-binding region of Semliki Forest virus E2 protein. II. Topology and membrane binding. J . Cell Biol. 102: 902-910. De Curtis, I. and Simmons, K. (1988) Dissection of Semliki Forest virus glycoprotein delivery from the trans-Golgi network to the cell surface in permeabilized BHK cells. Proc. Natl. Acad. Sci. U.S.A. 85: 8052-8056. Ding, M and Schlesinger, S.J. (1989) Evidence that Sindbis virus nsP2 is an autoprotease which processes the virus nonstructural polyprotein. Virology 171: 280-284. Dunphy, W.G. and Rothman, J . E . (1985) Compartmental organization of the Golgi stack. Cell 42: 13-21 Enzmann, P. and Welland, F. (1979) Studies on the morphology of alphaviruses. Virology 95: 501. Evans, E.A. , Gilmore, R. and Blobel, G. (1986) Purification of microsomal signal peptidase as a complex. Proc. Natl. Acad. Sci. U.S.A. 83: 581-585. Freedman, R. (1984) Native disulfide bond formation in protein biosynthesis: evidence for the role of protein disulfide isomerase. Trends Biol. Sci. 9: 438-441. Frey, T.K. and Marr, I.D. (1988) Sequence of the region coding for virion proteins C and E2 and the carboxy terminus of the nonstructural proteins of rubella virus: comparison to alphaviruses. Gene 62: 85-99. Gaedigk-Nitschko, K. and Schlesinger, M.J. (1990) The Sindbis virus 6K protein can be detected in virions and is acylated with fatty acids. Virology 175: 274-281. Gaedigk-Nitschko, K. and Schlesinger, M.J. (1990) Site-directed mutations in the Sindbis virus 6K protein reveal sites for fatty acylation and the underacylated protein affects virus release and virion structure. Virology 175: 282-291. Garoff, H. , Simons, K. and Renkonen, 0. (1974) Isolation and characterization of the membrane proteins of Semliki Forest virus. Virology 61: 493-504. 68 Garoff, H. , Simons, K. and Dobberstein, B. (1978) Assembly of Semliki Forest virus membrane glycoproteins in the membrane of the endoplasmic reticulum in vitro. J . Mol. Biol. 124: 587-600. Garoff, H. , Frischauf, A.M., Simons, K., Lehrach, H. andDelius, H. (1980a) The capsid protein of Semliki Forest virus has clusters of basic amino acids and prolines in its amino-terminal region. Proc. Natl. Acad. Sci. U.S.A. 77: 6376-6380. Garoff, H. , Frischauf, A.M., Simons, K., Lehrach, H. andDelius, H. (1980b) Nucleotide sequences of cDNA coding for Semliki Forest virus glycoproteins. Nature (London) 288: 236-241. Garoff, H. , Kondor-Koch, C. and Riedel, H. (1983) Structure and assembly of alphaviruses. Curr. Top. Microbiol. Immunol. 99: 1-50. Gething, M.J. and Sambrook, J . (1986) Expression of wild-type and mutant forms of influenza hemagglutinin: the role of folding in intracellular transport. Cell 46: 939-950. Greenburg, G. ,* Shelness, G. and Blobel, G. (1989) A subunit of mammalian signal peptidase is homologous to yeast SEC11 protein. J . Biol. Chem. 264: 15762-15765. Hahn, Y.S. , Strauss, E.G. and Strauss, J.H. (1989) Mapping of RNA" mutants of Sindbis virus: assignment of complementation groups A, B, and G to nonstructural proteins. J . Virol . 63: 3142-3150. Hardy, W.R. and Strauss, J.H. (1989) Processing of the nonstructural polyprotein of Sindbis virus: nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans. J . Virol . 63: 4653-4664. Harrison, S., Jack, A. , Goodenough, D. and Sefton, B. (1974) J . Supramol. Str. 2: 486. Hartmann, E . , Wiedmann, M. and Rapoport, T. (1989) A membrane component of the endoplasmic reticulum that may be essential for protein translocation. Embo J . 8: 2225-2229. Hobman, T .C . , Shukin, R. and Gillam, S. (1988) Translocation of rubella virus glycoprotein El into the endoplasmic reticulum. J . Virol . 62: 4259-4264. Hobman, T.C. and Gillam, S. (1989) In vitro and in vivo expression of rubella virus glycoprotein E2: The signal peptide is contained in the C-terminal region of capsid protein. Virology 173: 241-250. Hobman, T. (1989) Molecular cell biology of rubella virus structural proteins. PhD. Thesis, University of British Columbia. Hovi, T. and Vaheri, A. (1970) Infectivity and some physicochemical characteristics of rubella virus ribonucleic acids. Virology 42: 1-8. Hubbard, S.C. and Ivatt, R.J. (1981) Synthesis and processing of asparagine-linked oligosaccharides. Ann. Rev. Biochem. 50: 555. 69 Hurtley, S.M., Bole, D.G., Hoover-Litty, H. , Helenius, A. and Copeland, C.S. (1989) Interactions of raisfolded Influenza virus hemagglutinin with binding protein (BiP). J . Cell Biol. 108: 2117-2126. Inouye, S., Wang., S., Sekizawa, J . , Halegoua, S. and Inouye, M. (1977) Amino acid sequence for the peptide extension on the prolipoprotein of the Escherichia coli outer membrane. Proc. Natl. Acad. Sci. U.S.A. 74: 1004-1008. Jackson, R.C. and Blobel, G. (1977). Posttranslational cleavage of presecretory proteins with and extract of rough microsomes from dog pancreas containing signal peptidase activity. Proc. Natl. Acad. Sci. U.S.A. 74: 5598-5602. Jamieson, J . and Palade, G. (1967) Intracellular transport of secretory proteins in the pancreatic exocrine ce l l . I. Role of the peripheral elements of the Golgi complex. J . Cell Biol. 34: 577-596. Kalkkinen, N. , Laaksonen, M., Soderlund, H. and Jornvall, H. (1981) Radio-sequence analysis of in vivo multilabelled nonstructural protein ns86 of Semliki Forest virus. Virology 113: 188-195. Kalkkinen, N. , Oker-Blom, C. and Petterson, R.F. (1984) Three genes code for rubella virus structural proteins, E l , E2a, E2b, and C. J.Gen. Virol . 65: 1549-1557. Kawaoka, Y. and Webster, R.G. (1989) Interplay between the carbohydrate in the stalk and the length of the conecting peptide determines the cleavability of influenza virus hemagglutinin. J . Virol . 63: 3996-3400. Kobata, A. (1984) In Biology of Carbohydrates. Vol.2, pp. 87-161. (V. Ginsberg and P.W. Robbins, eds.) Wiley (Interscience), New York. Kondor-Koch, C , Burke, B. and Garoff, H. (1983) Expression of Semliki Forest virus proteins from cloned complementary DNA. I. The fusion activity of the spike glycoprotein. J . Cell Biol. 9 7 : 644-651. Kornfeld, R. and Kornfeld, S. (1980) In The Biochemistry of Glycoproteins and Proteoglycans, pp. 1-34. (W.J. Lennarz, ed.) Plenum Press, New York. Kornfeld, R. and Kornfeld, S. (1985) Assembly of asparagine-linked oligosaccharides. Ann. Rev. Biochem. 54:631-664. Kozutsumi, Y . , Segal, M., Normington, K., Gething, M.J. and Sambrook, J . (1988) The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose-regulated proteins. Nature (London) 332: 462-464. Kuismanen, E . , Bang, B., Huime, M. and Petterson, R. (1984) Uukuniemi Virus maturation: immunofluorescence microscopy with monoclonal glycoprotein-specific antibodies. J . Virol . 51: 137-146. Kunkel, T.A. (1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. U.S.A. 82: 4753-4757. 7 0 Laemmli, U.K. (1970) Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature (London) 227: 680-685. Levinson, R.S., Strauss, J .H. and Strauss, E.G. (1990) Complete sequence of the genomic RNA of O'Nyong-nyong virus and its use in the construction of alphavirus phylogenetic trees. Virology 175: 110-125. Lingappa, V.R. , Chaidez, J . , Yost, C S . and Hedgpeth, J . (1984) Determinants for protein localization: 6-lactamase signal sequence directs globin across microsomal membranes. Proc. Natl. Acad. Sci. U.S.A. 81: 94-98. Lobigs, M. and Garoff, H. (1990) Fusion function of the SFV spike is activated by proteolytic cleavage of the envelope glycoprotein precursor p62. J . Virol . 64: 1233-1240. Maniatis, T . , Fritsch, E.F and Sambrook, J . (1982) Molecular Cloning. A laboratory manual. Cold Spring Harbor Laboratory. Mathews, R.E.F. (1982) Classification and nomenclature of viruses. Third report of the International Committee on Taxonomy of Viruses. Intervirology 17: 1-199. Melancon, P. and Garoff, H. (1987) Processing of the Semlili Forest virus structural polyprotein: Role of the capsid protease. J . Virol . 61: 1301-1309. Meyer, D.I . , Krause, E. and Dobberstein, B. (1982) Secretory protein translocation across membranes: The role of "docking protein". Nature (London) 297: 647-650. Montreuil, J . (1987) Structure and conformation of glycoprotein glycans. In Vertebrate Lectins, pp.1-26. (K. Olden and J.B. Parent, eds.) Van Nostrand Reinhold, New York. Muller, M., Ibrahimi, I . , Chang, C.N., Walter, P. and Blobel, G. (1982) A bacterial secretory protein requires SRP for translocation across the endoplasmic reticulum. J . Biol. Chem. 257: 11860-11863. Nakhasi, H .L . , Meyer, B.C. and Liu, T.-Y. (1986) Rubella virus cDNA. Sequence and expression of El envelope protein. J . Biol. Chem. 261: 16616-16621. Nakhasi, H .L . , Thomas, D., Zheng, D. and Liu, T.-Y. (1989) Nucleotide sequence of capsid, E2 and El genes of Rubella virus vaccine strain RA/273. Nucl. Acids Res. 17; 4393-4394. Oker-Blom, C , Kalkkinen, N., Kaariainen, L. and Pettersson, R.F. (1983) Rubella virus contains one capsid protein and three envelope glycoproteins, E l , E2a, and E2b. J . Virol . 46: 964-973. Oker-Blom, C. (1984) the gene order for rubella virus structural proteins is NH2-C-E2-E1-COOH. J . Virol . 51: 354-358. 71 Oker-Blom, C , Ulmanen, I . , Kaariainen, L. and Pettersson, R.F. (1984) Rubella virus 40S RNA specifies a 24S subgenomic RNA that codes for a precursor to structural proteins. J . Virol . 49: 403-408. Palade, G. (1975) Intracellular aspects of the process of protein secretion. Science 189: 347-358. Palmiter, R.D., Gagnon, J . and Walsh, K.A. (1978). Ovalbumin: A secreted protein without a transient hydrophobic leader sequence. Proc. Natl. Sci. U.S.A. 75: 94-98. Parent, J.P. (1988) Role of carbohydrate in glycoprotein traffic and secretion. In Protein transfer and organelle biogenesis, pp.51-90. (R.C. Das and P.W. Robbins, eds.) Academic Press, San Diego. Perara, E. and Lingappa, V.R. (1988) Transport of proteins across the endoplasmic reticulum membrane. In Protein transfer and organelle biogenesis, p. 3-47. (R.C.Das and P.W. Robbins ed.) Academic Press, San Diego. Perlman, D. and Halvorson, H.O. (1983) A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides. J . Mol. Biol. 167:391-409. Presley, J . F . and Brown, D.T. (1989) The proteolytic cleavag of PE2 to envelope glycoprotein E2 is not strictly required for the maturation of Sindbis virus. J . Virol . 42: 725-729. Rothman, J . E . and Lodish, H.F. (1977) Synchronized transmembrane insertion and glycosylation of a nascent membrane protein. Nature (London) 269:775-780. Rothman, J . (1981) The Golgi apparatus: two organelles in tandem. Science 213: 1212. Rottier, P., Brandenburg, D., Armstrong, J . , Van der Zeijst, B., Warren, G. (1984) Assembly in vitro of a spanning membrane protein of the endoplasmic reticulum: The El glycoprotein of coronavirus mouse hepatitus virus A59. Proc. Natl. Acad. Sci. U.S.A. 81: 1421-1425. Runge, K.W. (1988) Posttranslational modification during protein secretion. In Protein transfer and organelle biogenesis, p. 159-199. (R.C.Das and P.W. Robbins ed.). Academic Press, San Diego. Sabatini, D.D., Kreibich, G., Morimoto, T. and Adesnik, M. (1982) Mechanisms for the incorporation of proteins into membranes and organelles. J . Cell Biol. 92: 1-22. Sakanari, J . , Staunton, C .E . , Eakin, A . E . , Craik, C.S. and McKerrow, J .H. (1989) Serine proteases from nematode and protozoan parasites: Isolation of sequence homologs using generic molecular probes. Proc. Natl. Acad. Sci. U.S.A. 86: 4863-4867. Sanger, F . , Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467. 72 Saraste, J . , von Bonsdorff, C.H., Hashimoto, K., Kaariainen, L. and Keranen, S. (1980) Semliki Forest virus mutants with temperature-sensitive transport defect of envelope proteins. Virology 100: 229. Schmidt, M.F.G. (1983) Fatty acid binding: A new kind of posttranslational modification of membrane proteins. Curr. Topics Microbiol. Immunol. 102: 101. Schlesinger, M.J. and Kaariainen, L. (1980) Translation and processing of alphavirus proteins, pp. 371-392. In The Togaviruses (R.W. Schlesinger, ed.) Academic Press, New York. Shelness, G.S., Kanwar, Y.S. and Blobel, G. (1988) cDNA-derived primary structure of the glycoprotein component of canine microsomal signal peptidase complex. J . Biol. Chem. 263: 17063-17070. Shope, R.E. (1980) Medical significance of togaviruses: an overview of diseases caused by togaviruses in man and in domestic and wild vertebrate animals. Chap. 3. In The Togaviruses (R.W. Schlesinger, ed.) Academic Press, New York. Simmons, D.T. and Strauss, J.H. (1974) Translation of Sindbis virus 26S RNA and 49S RNA in lysates of rabbit reticulocytes. J . Mol. Biol. 86: 397-409. Simon, S.M., Blobel, G. and Zimmerberg, H. (1989) Large aqueous channels in membrane vesicles derived from the rough endoplasmic reticulum of canine pancreas or the plasma membrane of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 86: 6176-6180. Soderlund, H. , Takkinen, K., Jalanko, A. and Kalkkinen, N. (1985) The expression and organization of the alphavirus genome, pp. 323-337. In Viral Messenger RNA (Y. Becker, ed.) Martinus Nijhoff Publishing, Strauss, E. (1978) Mutants of Sindbis Virus. III. Host polypeptides present in purified HR and tsl03 virus particles. J . Virol . 28: 466-474. Strauss, J .H. and Strauss, E.G. (1977) Togaviruses. pp. 111-166. In The Molecular Biology of Animal Viruses. Vol I. (D.P. Nayak, ed.) Marcel Dekker, New York. Strauss, E. G., Rice, CM. and Strauss, J.H. (1984) Complete nucleotide sequence of the genomic RNA of Sindbis virus. Virology 133: 92-110. Strauss, E.G. and Strauss, J.H. (1985) Virus structure and assembly, pp. 206-234. In Assembly of Enveloped Viruses (S. Casjens, ed.) Jones and Bartlett, Boston. Strauss, E.G. and Strauss, J.H. (1986) Structure and replication of the alphavirus genome, pp. 35-90. In The Togaviridae and Flaviviridae. (S. Schlesinger and M.J. Schlesinger, eds.) Plenum Publishing Corp., New York. Strauss, J . H . , Strauss, E.G. , Hahn, C.S., Hahn, Y.S. , Galler, R., Hardy, W.R. and Rice, CM. (1987) Replication of alphaviruses and flaviviruses: Proteolytic processing of polyproteins. pp. 209-225. In Positive Strand RNA Viruses. Alan R. Liss Inc., New York. 73 Takkinen, K. (1986) Complete nucleotide sequence coding for the alphavirus nonstructural genes of Semliki Forest virus. Nucl. Acids Res. 14: 5667-5682. Tarkatoff, A.M. (1983) Perturbation of vesicular traffic with the carboxylic ionophore monensin. Cell 32: 1026. Vidgren, G., Takkinen, K., Kalkkinen, N., Kaariainen, L. and Pettersson, R.F. (1987) Nucleotide sequence of the genes coding for the membrane glycoproteins El and E2 of rubella virus. J . Gen. Virol . 68: 2347-2357. von Heijne, G. and Blomberg, C. (1979) Transmembrane translocation of proteins. The direct transfer model. Eur. J . Biochem. 97: 175-181. von Heijne, G. (1985) Signal sequences: The limits of variation. J . Mol. Biol. 184: 99-105. von Heijne, G. (1986) A new method for predicting signal sequence cleavage sites. Nucl. Acids Res. 14: 4683-4691. Walter, P. and Blobel, G. (1980) Purification of a membrane-associated protein complex required for translocation across the endoplasmic reticulum. Proc. Natl. Acad. Sci. U.S.A. 77: 7112-7116. Walter, P. and Blobel, G. (1981) Translocation of proteins across the endoplasmic reticulum III. Signal recognition particle (SRP) causes signal sequence-dependent and site-specific arrest of elongation that is released by microsomal membranes. J . Cell Biol. 91: 557-561. Warren, G. and Dobberstein, M. (1978) Protein transfer across microsomal membranes reassembled from separated membrane components. Nature (London) 273: 569-571. Watts, C , Wickner, W. and Zimmerman, R. (1983) M13 procoat and pre-immunoglobulin share processing specificity but use different membrane receptor mechanisms. Proc. Natl. Acad. Sci. U.S.A. 80: 2809-2813. Welch, W.J. and Sefton, B.M. (1979) Two small virus-specific polypeptides are produced during infection with Sindbis virus. J . Virol . 29: 1186-1195. Westaway, E.G. (1980) Replication of flaviviruses. pp. 531-581. In The Togaviruses (R.W. Schlesinger, ed.) Academic Press, New York. Westaway, E .G. , Brinton, M.A., Gaidamavich, S.Y., Horzinek, M.C., Igarashi, A. , Kaariainen, L . , Lvov, D.K., Porterfield, J .S . , Russell, P.K. and Trent, D.W. (1985) Flaviviridae. Intervirology 24: 183-192. White, J . , Kielian, M. and Helenius, A. (1983) Membrane fusions proteins of enveloped animal viruses. Quart. Rev. Biophys. 16: 151-195. Wiedmann, M., Kurzchalia, T. , Hartmann, E. and Rapoport, T.A. ( 1987) A signal sequence receptor in the ER membrane that may be essential for protein translocation. Nature (London) 328: 830-833. 74 Wirth, D.F., Katz, F . , Small, B., and Lodish, H.F. (1977) How a single Sindbis virus mRNA directed the synthesis of one soluble protein and two integral membrane proteins. Cell 10: 253-263. Wolfe, P.B., Wickner, W. and Goodman, J.M. (1983) Sequence of the leader peptidase gene of Escherichia coli and the orientation of leader peptidase in the bacterial envelope. J . Biol. Chem. 258: 12073-12080. Zheng, D.X., Dickens, L . , Liu, T.-Y. and Nakhasi, H.L. (1989) Nucleotide sequence of the 24S subgenomic messenger RNA of a vaccine strain of rubella virus - Comparison with a wild-type strain (M33). Gene 82: 343-349. 75 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0098023/manifest

Comment

Related Items