Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on the processing of rubella virus structural proteins by analysis of the endoproteolytic cleavage… McDonald, Helen L 1990

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1990_A6_7 M42.pdf [ 7.63MB ]
Metadata
JSON: 831-1.0098023.json
JSON-LD: 831-1.0098023-ld.json
RDF/XML (Pretty): 831-1.0098023-rdf.xml
RDF/JSON: 831-1.0098023-rdf.json
Turtle: 831-1.0098023-turtle.txt
N-Triples: 831-1.0098023-rdf-ntriples.txt
Original Record: 831-1.0098023-source.json
Full Text
831-1.0098023-fulltext.txt
Citation
831-1.0098023.ris

Full Text

Studies on the Processing of Rubella Virus Structural Proteins by Analysis of the Endoproteolytic Cleavage Sites By Helen L. McDonald B.Sc, Queen's University,  1981  A thesis submitted i n p a r t i a l f u l f i l l m e n t of the requirements for the degree of Master of Science in the Faculty of Graduate Studies Genetics Program  We accept this thesis as conforming to the required standard  The University of B r i t i s h Columbia May,  1990  (£) Helen L. McDonald, 1990  In  presenting  degree freely  at  the  available  copying  of  department publication  this  of  in  partial  fulfilment  University  of  British  Columbia,  for  this or  thesis  reference  thesis by  this  for  his thesis  and  scholarly  or for  her  Department The University of British Columbia Vancouver, Canada  (2/88)  I  I further  purposes  gain  the  shall  requirements  agree  that  agree  may  representatives.  financial  permission.  DE-6  study.  of  be  It not  that  the  be  Library  an  advanced  shall  permission for  granted  is  for  by  understood allowed  the  make  extensive  head  that  without  it  of  copying my  my or  written  Abstract Rubella virus i s a small enveloped p o s i t i v e strand RNA v i r u s .  Two  species of v i r a l RNA are found i n infected c e l l s : a f u l l - l e n g t h genomic RNA and a subgenomic species corresponding RNA molecule.  to the 3' one t h i r d of the genomic  The 24S subgenomic RNA s p e c i f i e s a polyprotein which i s  c o t r a n s l a t i o n a l l y processed by endoproteolytic cleavage by host signal peptidase  to y i e l d three s t r u c t u r a l proteins, E l , E2 and capsid.  E l and E2  are membrane glycoproteins forming the v i r i o n spikes, and C protein binds to 40S genomic RNA to form a nucleocapsid.  E l and E2 proteins contain N-  linked oligosaccharide as a consequence of their passage through the endoplasmic reticulum (ER) and Golgi apparatus. hypothesis,  According  to the signal  translocation of secretory and membrane proteins into the ER i s  mediated by a hydrophobic signal peptide.  The signal peptides for E2 and  E l have been l o c a l i z e d by in vivo expression of E l and E2 cDNAs. Oligonucleotide-directed mutagenesis was used to define the cleavage s i t e s between C, E2, and E l , as well as the e f f e c t of the cleavages transport and processing of E2 and E l . mutants was studied in vitro  on the  The expression of the cleavage s i t e  and in vivo.  I t was found that uncleaved  precursor polypeptides were retained i n the ER and very l i t t l e E2 or E l polypeptide was observed at either the Golgi apparatus or the plasma membrane.  The E2 and E l polypeptides  can cross the ER membrane without the  cleavage of the signal peptide while the transport of E2 and E l beyond the ER requires the cleavage of E2 from C and E l from E2. The C-termini of the C and E2 proteins, which were not previously defined, have been p a r t i a l l y characterized.  Capsid protein does not appear  to undergo further p r o t e o l y t i c processing a f t e r i t i s cleaved from E2 by signal peptidase, but E2 may be processed C-terminus by a t r y p s i n - l i k e enzyme. ii  at a second cleavage s i t e at i t s  Table of Contents Abstract Table of Contents L i s t of Tables L i s t of Figures L i s t of Abbreviations Acknowledgements  i i i i i v vi viii x  Introduction I n t r a c e l l u l a r Protein Transport The signal hypothesis model Signal peptidase Topogenic sequences Protein transport and modification Role of conformation i n transport The Togaviridae Alphaviruses Rubella virus Objectives of thesis study Materials and Methods Materials B a c t e r i a l strains and growth of b a c t e r i a Transformation of E. coli I s o l a t i o n of plasmid and M13 DNA from E. coli Plasmid mini-prep procedure Large scale plasmid preparation I s o l a t i o n of phage DNA Oligonucleotide-directed mutagenesis Dot b l o t analysis Plasmid constructs In v i t r o t r a n s c r i p t i o n using SP6 Polymerase In v i t r o t r a n s l a t i o n In vivo expression COS c e l l transfection Cell labelling Immunoprecipitation and Endo-fl-N-acetylglucosaminidase H digestion Indirect immunofluorescence  1 1 1 4 5 7 8 10 11 15 20 "  Results and Discussion I. Mutation of the serine protease-like sequence i n the capsid protein I I . Analysis of the s t r u c t u r a l polyprotein cleavages by s i g n a l peptidase i ) Role of conformation i n cleavage Requirement f o r a minimum length of peptide E f f e c t of glycosylation on signal peptidase cleavage i i ) Mutation of the cleavage s i t e between C and E2 In vitro analysis In vivo analysis Immunofluorescence studies iii  21 " 21 21 22 22 22 23 23 24 26 26 27 29 29 29 29 30 31 32 32 37 37 37 37 40 40 46 50  i i i ) Mutagenesis o f the cleavage s i t e s between E2 and E l In vitro analysis In vivo a n a l y s i s Immunofluorescence s t u d i e s  55 56 60  Summary and Conclusions  65  References  67  iv  List of Tables Table 1.  L i s t of mutagenic oligonucleotides  v  List of Figures Figure 1.  The Signal Hypothesis model  3  Figure 2.  Cleavage s i t e s of several v i r a l glycoproteins  9  Figure 3.  Model f o r the topogenesis  and processing of the SFV  s t r u c t u r a l polyprotein  14  Figure 4.  The expression of the RV polyprotein  17  Figure 5.  Model f o r the topogenesis  and processing of the RV  s t r u c t u r a l polyprotein  19  Figure 6.  Rubella v i r u s cDNA constructs  28  Figure 7.  A comparison of a conserved sequence  33  Figure 8.  Mutation  of the capsid protease-like sequence  34  Figure 9.  Characterization of the mutant capsid p r o t e i n  35  Figure 10. In vitro analysis of a minimum length requirement for t r a n s l o c a t i o n and s i g n a l peptidase cleavage Figure 11. In v i t r o study of the s i g n a l peptidase processing of an E2 g l y c o s y l a t i o n - d e f i c i e n t mutant Figure 12. Mutation of the signal peptidase cleavage s i t e between C and E2 Figure 13. In vitro cleavage  38 41 42  analysis of the C/E2 precursor s i t e mutant  43  Figure 14. Endo H digestion of C/E2 t r a n s l a t i o n products  45  Figure 15. In vivo  47  study of the C/E2 cleavage s i t e mutant  Figure 16. Endo H digestion of the in vivo expression products of the mutant C/E2 Figure 17. I n d i r e c t immunofluorescence of c e l l s transfected with C/E2 cDNAs: E2 l o c a l i z a t i o n  49 51  Figure 18. I n d i r e c t immunofluorescence of c e l l s transfected with C/E2 cDNAs: C l o c a l i z a t i o n and c e l l surface s t a i n i n g  52  Figure 19. I n d i r e c t immunofluorescence of c e l l s transfected with 24S cDNAs: C l o c a l i z a t i o n  53  Figure 20. Indirect immunofluorescence of c e l l s transfected with 24S cDNAs: E2 l o c a l i z a t i o n  54  vi  Figure 21: Mutation of the cleavage s i t e s between E2 and E l  57  Figure 22. In vitro  58  analysis of the E2/E1 double mutant  Figure 23: In vivo study of the E2/E1 double mutant  59  Figure 24. Indirect immunofluorescence of c e l l s transfected with E2/E1 cDNAs: E2 l o c a l i z a t i o n  61  Figure 25. Indirect immunofluorescence of c e l l s transfected with E2/E1 cDNAs: E l l o c a l i z a t i o n  62  Figure 26. Indirect immunofluorescence of c e l l s transfected with E2/E1 cDNAs: c e l l surface s t a i n i n g  64  vii  L i s t of A b b r e v i a t i o n s ATP  adenosine  triphosphate  BSA  bovine  DNA  deoxyribonucleic  DNase  deoxyribonuclease  dNTP  deoxyribonucleoside  endo H  endo-6-N-acetylglucosaminidase  EDTA  ethylenediaminetetraacetic  ER  endoplasmic  GTP  guanosine  kD  kilodalton  mg  milligram  serum a l b u m i n acid  triphospate  reticulum  triphosphate  microgram ml  milliliter  ill  microliter  mM  millimolar  M  molar  NTP  nucleoside  PBS  phosphate  RNA  ribonucleic  RNase  ribonuclease  RV  rubella  S  Svedberg  SDS  sodium d o d e c y l  sulfate  SFV  Semliki  virus  SRP  signal  SV  Sindbis  viii  triphospate buffered  saline  acid  virus unit  Forest  recognition virus  particle  H  acid  trishydroxymethylaminomethane tetramethylrhodamine isothiocyanate  Acknowledgements I would l i k e to thank both my supervisor as an undergraduate student, Dr. Jerry Wyatt, and the supervisor of this project, Dr. Shirley Gillam, f o r the encouragement to pursue graduate studies. I am grateful f o r the technical and f i n a n c i a l assistance of Dr. Shirley Gillam throughout this study. As well, a special thanks i s owed to Tom Hobman, f o r h i s technical help and i n t e r e s t i n this work. I wish to e s p e c i a l l y thank Doug f o r h i s long-lasting patience and support of t h i s project.  x  Introduction V i r a l envelope proteins are transported and modified by the host system which processes secretory and resident transmembrane proteins. v i r a l polypeptide ER, where i t may  The nascent  i s c o t r a n s l a t i o n a l l y inserted into the lumen of the rough be modified by ER-resident  enzymes, and then i s directed  to the host c e l l organelle where virus assembly occurs.  Budding may  occur  at d i f f e r e n t host c e l l membranes depending on the v i r u s , such as the plasma membrane (alphaviruses  [Garoff et a l . , 1983]), the rough ER  (coronaviruses  [Rottier et a l . , 1984]), or the smooth ER and Golgi apparatus (bunyaviruses and f l a v i v i r u s e s [Kuismanen et a l . , 1984; Strauss and Strauss, 1985).  Westaway, 1980]) (reviewed i n  The i n s e r t i o n of the v i r a l peptide  into the ER  requires the presence of a signal sequence, and the transmembrane function i s s p e c i f i e d by a stop transfer sequence (discussed below). The  i n t r a c e l l u l a r transport of proteins i s u n i d i r e c t i o n a l from the rough  ER to the Golgi stacks, which reside i n a juxtanuclear p o s i t i o n (Rothman, 1981).  The Golgi stacks may  be divided into compartments, the c i s , medial  and trans Golgi, where d i f f e r e n t enzymatic modifications occur during v e c t o r i a l transport (reviewed i n Tarkatoff, 1983). transport between organelles and,  l a s t l y , to the c e l l surface are mediated  by v e s i c u l a r c a r r i e r s (Jamieson and Palade, 1967;  I n t r a c e l l u l a r Protein  A l l intracellular  Palade, 1975).  Transport  The Signal Hypothesis The Signal Hypothesis was  formulated by Blobel and Dobberstein (1975a,b)  as a model for the transport of secretory proteins across the ER membrane. B r i e f l y , the model states that nascent secretory and transmembrane proteins  1  B r i e f l y , the model states that nascent secretory and transmembrane proteins are translocated across the ER membrane through a proteinaceous tunnel or pore a f t e r recognition of the signal peptide by one or more membrane components.  An alternate model suggests that the nascent s i g n a l peptide i s  passively inserted into the l i p i d b i l a y e r through hydrophobic interactions (von Heijne and Blomberg, 1979).  In favour of the Signal Hypothesis model,  there i s recent evidence to suggest the presence of large aqueous channels i n the membrane of the rough ER (Simon et a l . , 1989).  which could accomodate protein transport  The number of channels open was found to be  influenced greatly by GTP, but ATP had no e f f e c t (Simon et a l . , 1989). The Signal Hypothesis model i s shown i n Figure 1.  I n i t i a l l y , an  N-terminal stretch of hydrophobic amino acids of a peptide, defined as a signal peptide, emerges from a ribosome and interacts with a ribonucleoprotein complex c a l l e d Signal Recognition and Dobberstein, 1978; Walter and Blobel, 1980).  P a r t i c l e (SRP) (Warren  This i n t e r a c t i o n r e s u l t s  i n t r a n s l a t i o n a l arrest, by an undetermined mechanism. the arrested t r a n s l a t i o n a l complex to an SRP receptor protein) on the ER membrane (Walter and Blobel, 1981). for  the translocation of many peptides  Then SRP d i r e c t s (also c a l l e d docking Since the p o t e n t i a l  i s normally r e s t r i c t e d to a b r i e f  i n t e r v a l of time during the early stages of the protein's synthesis, the function of SRP-induced t r a n s l a t i o n a l arrest may be to r e t a i n the nascent polypeptide  i n a translocation-competent  membrane (Rothman and Lodish, 1977).  state u n t i l i t reaches the ER  The i n t e r a c t i o n between SRP and i t s  receptor on the ER membrane f a c i l i t a t e s the release of t r a n s l a t i o n a l arrest by changing the a f f i n i t y of SRP for the ribosome-protein complex (Meyer et a l . , 1982).  SRP i s then released into the cytoplasm and recycled.  The  free signal sequence of the nascent polypeptide becomes associated with another membrane protein, the signal sequence receptor  2  (SSR) (Wiedman et  A  Signal receptor  peptidase  Figure 1. The Signal Hypothesis model of translocation. (A) Soluble SRP (a) has different a f f i n i t i e s f o r free ribosomes (b), ribosomes translating signal sequences (c), and the SRP receptor on the ER membrane (e). (B) When the signal sequence of a nascent peptide emerges from a ribosome, SRP binds to the signal sequence (c), and the a f f i n i t y of SRP f o r the t r a n s l a t i n g ribosome i s enhanced (shown by arrow). Translational arrest results from this interaction. (C) SRP targets the arrested t r a n s l a t i o n a l complex to the SRP receptor on the rough ER membrane. The i n t e r a c t i o n between SRP and i t s receptor causes the termination of t r a n s l a t i o n a l arrest and SRP i s then released from the ribosome and recycled (a-e). (D) After the release of SRP, the synthesizing ribosome interacts with other transmembrane proteins and translocation through an aqueous pore i n the ER membrane i s i n i t i a t e d . Signal peptidase i s on the lumenal side of the ER membrane and often cleaves translocated peptides at the C-terminus of the signal peptide sequence. (from Perara and Lingappa, 1988)  3  a l . , 1987), and translocation across the membrane i s i n i t i a t e d .  The  signal sequence i s believed to be inserted into the membrane i n a loop configuration (Inouye et a l . , 1977).  The nature of the translocation  machinery i s unknown and the components of the proteinaceous tunnel have not been i d e n t i f i e d .  However, i t i s possible that the SSR forms part of  the proteinaceous tunnel since i t has been i s o l a t e d from the ER membrane and was found to be present i n amounts at least equimolar to membrane-bound ribosomes (Hartman et a l . , 1989). On the lumenal side of the ER the signal sequence i s often cleaved by signal peptidase, an integral membrane protein (Blobel and Dobberstein, 1975a,b).  Translocation occurs concomitant with protein synthesis u n t i l  either the entire protein has been translocated, or, i n the case of transmembrane proteins, u n t i l another hydrophobic  stretch of amino acids i s  inserted i n the membrane as a transmembrane anchor (Sabatini et a l . , 1982).  Signal Peptidase Signal peptidase i s an integral membrane protein that cleaves at the Cterminus of signal sequences i n the lumen of the ER (Jackson and Blobel, 1977).  This a c t i v i t y has been p u r i f i e d from canine microsomes as a t i g h t l y  associated complex of s i x peptides of Mr=25, 23, 22, 21, 19, and 12 kD (Evans et a l . , 1986).  B a c t e r i a l signal peptidase I i s f u n c t i o n a l l y  interchangeable with canine signal peptidase (Watts et a l . , 1983; Muller et a l . , 1982), yet i t consists of a single 36 kD monomer (Wolfe et a l . , 1983). This suggests that the enzymatic a c t i v i t y of the eukaryotic complex may be r e s t r i c t e d to only one of the s i x peptides.  cDNA clones corresponding to  the 23 kD and the 21 kD peptides have been i s o l a t e d (Shelness et a l . , 1988; Greenburg et a l . , 1989).  The deduced amino acid sequence f o r the 21 kD  4  peptide was found to be homologous to the yeast SEC11 gene product which i s required for signal peptidase cleavage i n yeast (Bohni et a l . , 1988). Therefore i t was suggested that the individual peptides of the canine signal peptidase complex may have counterparts i n the yeast system and that expression of these peptides i n yeast secretory mutants may help to elucidate t h e i r functions (Greenburg et a l . , 1989).  Topogenic Sequences According to the Signal Hypothesis model, information specifying the i n i t i a t i o n and termination of translocation i s encoded i n discrete "topogenic sequences" of a peptide (Blobel, 1980). A signal peptide sequence i s essential for translocation across the rough ER membrane of eukaryotes and the outer membrane of bacteria, and i t i s not usually part of the mature protein (Blobel and Dobberstein, 1975a,b).  Several signal  sequences of b a c t e r i a l and eukaryotic proteins  have been examined to determine the features of the signal peptide, as well as the s p e c i f i c i t y  of the signal peptidase cleavage (Perlman and Halvorson,  1983; von Heijne 1985, 1986).  Rather than finding amino acid sequence  homologies, three separate domains were found to be common to a l l signal sequences: an N-terminal region of basic amino acids, a hydrophobic region with at least s i x hydrophobic  central  residues, and a C-terminal sequence  that i s cleaved by signal peptidase. Since there i s no primary homology between signal peptides, i t i s l i k e l y that the s p e c i f i c i t y  required for SRP recognition and f o r translocation  i n i t i a t i o n resides within the secondary structure of the nascent peptide. Structural analysis of signal sequences predicts that the hydrophobic stretch w i l l assume a periodic structure, either i n the form of an a-helix or a R-sheet,  followed by a 6-turn or extensive random c o i l at the  5  the cleavage s i t e , but c e r t a i n amino acids are preferred, especially at the (-1) and (-3) positions with respect to cleavage (von Heijne, 1986).  The  (-1) residue i s normally small and neutral (often Ala, Gly, Ser, Cys, or Gin) and the (-3) residue cannot be aromatic, charged, or large and polar. Also, proline i s usually absent from the (-1) to the (-3) positions. The regions beyond the signal peptidase recognized peptidase.  cleavage s i t e have also been  as having an influence on translocation and cleavage by signal Andrews et a l . (1988) found that the size of a translocated  domain had an e f f e c t on i n vitro  processing of a nascent polypeptide.  Some signal sequences are not cleaved, as i s found with ovalbumin, a secretory protein (Palmiter et a l . , 1978), or the p62 peptide of SFV, a transmembrane protein (Melancon and Garoff, 1987). peptidase  The function of signal  cleavage i n secretory protein synthesis i s unknown, but the  cleavage of internal signal peptide sequences i s important for the processing of several v i r a l polyproteins. Another topogenic sequence i s the "stop transfer" sequence which serves as a membrane anchor f o r transmembrane proteins.  There are no sequence,  homologies between stop transfer sequences (Sabatini et a l . , 1982), so the information necessary for this function must reside within some general feature of the secondary structure.  Generally, there are 20 to 30  hydrophobic and neutral amino acid residues i n the membrane-spanning region,- followed by a cytoplasmic residues.  " t a i l " of one or more p o s i t i v e l y charged  I t has been suggested that the basic residues serve to s t a b i l i z e  the protein through interactions with the negatively-charged phospholipid head groups (Sabatini et a l . , 1982).  6  membrane  Protein Transport and Modification Modifications of peptides that may occur in the ER include cleavage of the signal sequence by signal peptidase, intrachain disulphide bond formation (Freedman, 1984), and asparagine (N) -linked glycosylation (reviewed in Kornfeld and Kornfeld, 1985; Parent, 1988; Runge, 1988).  As  well, there is evidence that fatty acylation occurs either in the ER or in a pre-Golgi structure (Bonatti et a l . , 1989).  N-linked glycosylation  occurs at Asn residues in the sequence Asn-X-Ser/Thr, where X is any amino acid except proline.  The oligosaccharide, Glc Man,GlcNAc 3  2  [ (Glucose) (Mannose) (N-Acetylglucosamine) ] , is transferred to asparagine 3  9  2  from the l i p i d carrier dolichol pyrophoshate, and then trimmed to the core structure, Man GlcNAc (Hubbard and Ivatt, 1981). 8  2  endo-6-N-acetylglycosaminidase H (endo H) intracellular location of glycoproteins.  The enzyme  is useful for monitoring the It recognizes a specific mannose  linkage present only in the ER- and cis Golgi- forms of  N-linked  carbohydrate, therefore i t indicates whether a core-glycosylated protein has been transported beyond the cis Golgi region (Dunphy and Rothman, 1985).  In the medial and trans Golgi the core structure is further  processed to a complex form, by trimming of mannose residues, and the addition of galactose,  fucose, and s i a l i c acid residues.  Another type of carbohydrate addition occurs in the Golgi apparatus which is O-linked (reviewed in Kornfeld and Kornfeld, 1980; Kobata, 1984; Montreuil, 1987).  These oligosaccharides are synthesized in the Golgi and  are attached to the hydroxyl side chains of some serine and threonine residues (Dunphy and Rothman, 1985).  Unlike  N-linked carbohydrate  addition, there is no consensus sequence surrounding this attachment site (Dunphy and Rothman, 1985).  7  There are Golgi-specific proteases, but these have not been well characterized.  A large number of unrelated viruses, including members of  the alphavirus, paramyxovirus, retrovirus, flavivirus, and myxovirus groups, have a cleavage site in one of their proteins which is homologous to sites recognized by a cellular enzyme that processes prohormones and is resident in either the Golgi apparatus or in transport vesicles (Strauss et al.,  1987; Figure 2).  A generalized consensus sequence for the cleavage  site is Arg-X-Arg/Lys-Arg, with proteolysis occurring after a pair of basic residues.  An additional modification can occur following cleavage,  since  one or more amino acids are often removed from the newly-exposed C-terminus (Strauss et a l . , 1987).  Role of Conformation in Transport In general, the transport of proteins to a particular destination is influenced by the overall conformation of a protein rather than by specific sequences within the protein or specific post-translational modifications (reviewed in Strauss and Strauss, 1985).  The importance of conformation in  transport has been shown by studies of temperature-sensitive mutants of alphaviruses which are defective in transport.  The El glycoproteins of two  SV mutants, tslO and ts23, were shown to be retained in the Golgi apparatus rather than be transported to the plasma membrane (Saraste et a l . , 1980). Sequence analysis of the SV ts mutants revealed three mutations; tslO had a single amino acid change and ts23 had two amino acid changes in El respectively (Arias et a l . , 1983).  The three amino acid changes were  widely spaced, which would suggest that they each have an effect by altering the three-dimensional structure of the protein, rather than a specific sequence determining the protein's intracellular address. Some peptides need to interact with other subunits in order to be  8  VIRUS  PROTEIN  CLEAVAGE  I  ALPHAVIRUS SIN VEE  CGSSG3SKR pE2 -> E3 + E2  SFV  SVIDGF  AAVKC^KRR  STEELF  CRNGT3HRR  SVSQHF  E P S K K 3EKR  GLFGAI  TLSKK3KRR  FLGFLL  LIPTR^RRR  FAGVVI  MYXOVIRUS FPV  HA  HA1 + HA2  PARAMYXOVIRUS RSV SV5  F  F2 + F l  RETROVIRUS RSV  pr95 -> gp85 + gp35  SRTGIRRKR  SVSHLD  MLV  pr95 -> gp70 + p l 5 E  FERSN^HKR  EPVSLT  AGRSR3SRR  AIDLPT  FLAVIVIRUS YF MVE  prM  M + ?  DEN2  ARHSK3SRR  SITVQT  TGEMR3EKR  SVALVP  Figure 2 . Amino acid sequences around the cleavage sites containing basic amino acids for a number of virus precursor glycoproteins. Cleavage of the precursor glycoprotein occurs after translation and during transport of the glycoprotein or during virus maturation. The precursor glycoproteins and their cleavage products are shown. (from Strauss et a l . , 1987)  9  transported correctly. The El glycoprotein of alphaviruses requires the presence of the p62  peptide in order to exit the ER. Similarly, the  hemagglutinin protein of influenza virus has been shown to assemble into its trimer structure in the ER, and mutant proteins which are incorrectly folded do not leave the ER (Gething et a l . , 1986). Some mutant peptides which escape the correct processing events can also be targeted to their normal destinations.  For example, the p62 peptide of  SFV is normally cleaved in the Golgi apparatus, but can be transported to the c e l l surface in the absence of cleavage (Lobigs and Garoff, 1990). However, the mutant peptide was shown to lack the fusion function of the virus which is essential for infectivity (Lobigs and Garoff, 1990).  The Togaviridae Togaviruses are positive strand enveloped RNA viruses that have nucleocapsids of icosahedral symmetry (Harrison et a l . , 1974; Enzman and Welland, 1979).  Since the genus Flavivirus was removed to form a separate  family in 1985 (Westaway et a l . , 1985), there are now three genera within the Togaviridae: Alphavirus, Rubivirus, and Pestivirus. (RV),  Rubella virus  the causative agent of German measles, is the sole member of the  genus Rubivirus (Mathews, 1982). Within the Togaviridae, RV closely resembles the alphaviruses in its general genomic organization and strategy of gene expression (Oker-Blom et al.,  1984; Soderlund et a l . , 1985).  Both groups express their structural  and nonstructural genes from separate species of capped and polyadenylated mRNA (Garoff et a l . , 1980a,b; Strauss et a l . , 1984; Oker-Blom et a l . , 1984).  The nonstructural genes, which specify functions involved in  replication, are encoded at the 5' two thirds of the genome (Strauss et  10  replication, are encoded at the 5' two thirds of the genome (Strauss et al.,  1984).  They are expressed early in infection from the full-length  genomic RNA molecule.  The structural proteins are translated from a  subgenomic mRNA species which corresponds to the 3' one third of the genome (Simmons and Strauss, 1974; Oker-Blom et a l . , 1984).  This subgenomic mRNA  is more abundantly expressed in infected cells than the genomic RNA, yet only the full-length molecule is packaged into virions (Garoff et a l . , 1983) . In spite of their structural similarities, RV and the alphaviruses have l i t t l e homology at the nucleotide or amino acid sequence level.  The  complete nucleotide sequence of three alphaviruses is known (Garoff et a l . , 1980a,b; Strauss et a l . , 1984; Takkinen, 1986; Levinson et a l . , 1990) but so far only approximately 4000 nucleotides at the 3' end of the RV genome have been determined (Vidgren et a l . , 1987; Nakhasi et a l . , 1986, 1989; Clarke et a l . , 1987; Zheng et a l . , 1989).  Three regions of sequence were  found to be conserved between the alphaviruses and RV: one is a stretch of nucleotides in the region immediately 5' to the start of the coding region of the subgenomic RNA, another is a tripeptide in the putative v i r a l polymerase, and a third is a conserved peptide sequence resembling the active site of serine proteases which is found in the capsid protein (Frey and Marr, 1988).  Alphaviruses The alphaviruses are a group of arthropod-borne viruses, some of which are human and veterinary pathogens (Shope, 1980).  The two best  characterized members are Semliki Forest virus (SFV) and Sindbis virus (SV).  The alphavirus virion consists of an icosahedral nucleocapsid  containing the genomic RNA complexed with a capsid protein, surrounded by a  11  are inserted into the envelope of SV to form the v i r a l spikes, and a third glycoprotein, E3, is associated with the spike complex in SFV, but is secreted in SV-infected cells (Garoff et a l . , 1974; Welchand Sefton, 1979). A small acylated structural peptide, the 6K peptide, has recently been identified as another component of the envelope of SV and SFV (Gaedigk-Nitshko and Schlesinger, 1990; Gaedigk-Nitschko et a l . , 1990). The processing of the alphavirus structural polyprotein has been well characterized (reviewed in Soderlund et a l . , 1985; Strauss and Strauss, 1986; Strauss et a l . , 1987), but l i t t l e is known about the nonstructural polyprotein (Strauss and Strauss, 1977; Schlesinger and Kaariainen, 1980 ). The alphavirus genomic RNA is approximately 12,000 nucleotides in length and the nonstructural genes, which are encoded at the 5' two thirds of the genome, are translated from this RNA species (Strauss et a l . , 1984).  There  are four nonstructural gene products, named by the order in which they are translated: nsPl, nsP2, nsP3, and nsP4 (Strauss et a l . , 1984; Takkinen, 1986).  Many of the alphavirus genomes, with the exception of the SFV  genome, have an opal stop codon between the coding regions of nsP3 and nsP4, as well as multiple termination codons following nsP4 (reviewed in Strauss and Strauss, 1986).  The opal stop codon causes termination of  translation at the end of nsP3, but a small amount of translational readthrough allows the expression of the nsP4 gene. Thus, two precursors to the nonstructural proteins exist in some alphavirus-infected cells, a f u l l length precursor and a precursor to three of the four nonstructural proteins.  The sites of cleavage of the SFV and SV precursors have been  deduced from N-terminal amino acid analysis of nonstructural peptides (Kalkkinen et a l . , 1981; Soderlund et a l . , 1985; Takkinen, 1986).  A  proteinase activity for the proteolysis of the nonstructural precursor has been mapped to the nsP2 protein by the in vitro  12  expression of deletion  mutants of SV (Hardy and Strauss, 1989; Ding and Schlesinger, 1989).  From  the analysis of temperature-sensitive mutants of the protease (Hahn et a l . , 1989), and inhibitor studies (Brzeski et a l , 1977), i t appears that the proteolytic activity of nsP2 is similar to that of known cysteine proteases. The structural proteins of alphaviruses are expressed from a 26S subgenomic mRNA, as a 130 kD precursor polyprotein (Wirth et a l . , 1971). The processing of the SFV structural polyprotein has been studied in detail (Garoff et a l . , 1978; Cutler et a l . , 1986; Melancon and Garoff, 1987).  The  polyprotein is cotranslationally inserted into the rough ER, and processed during passage through the intracellular organelle network.  Melancon and  Garoff (1987) proposed the model shown in Figure 3 for the cotranslational insertion and intracellular processing of the SFV precursor. cleavages yield the capsid (C), p62, 6K, and El peptides.  Three early  The f i r s t  cleavage occurs in the cytoplasm and separates C, which is a cytoplasmic protein, from the envelope proteins.  Several lines of evidence demonstrate  that C is an autoprotease: in vitro translation of SFV 26S mRNA in the presence of amino acid analogs abolishes cleavage (Aliperti and Schlesinger, 1978); expression of a cDNA clone in which the putative active site was altered also prevented cleavage (Melancon and Garoff, 1987); and sequence analysis of several alphavirus capsid proteins shows the presence of a conserved sequence with homology to the catalytic site of several serine proteases (Boege et a l . , 1981).  The p62, 6K, and El peptides are  inserted into the ER membrane by signal sequences (represented by white boxes), and are anchored in the membrane by C-terminal hydrophobic transmembrane domains (represented by black boxes) which halt translocation.  Two cleavages by signal peptidase (shown by arrows) at the  C-termini of the signal sequences of 6K and E l , generate the transmembrane  13  Figure 3. Model for the topogenesis and processing of the SFV structural polyprotein. The SFV structural polyprotein is cotranslationally inserted into the ER membrane. The capsid protein is released in the cytoplasm by an autocatalytic cleavage. The orientation of the polyprotein in the membrane is directed by signal sequences (indicated by white boxes) which initiate translocation, and transmembrane anchor domains (indicated by black boxes) which halt translocation. Translocation is initiated by the N-terminal signal•sequence of the p62 peptide (a), which is not removed by signal, peptidase, but is glycosylated (shown by black dot) and internalized (b). Translocation is halted by the hydrophobic transmembrane anchor of the p62 peptide (c) and is reinitiated by the insertion of the signal sequence of the 6K peptide (d). Cleavages by signal peptidase (shown by arrows) separate the polyprotein into the three transmembrane peptides, p62, 6K, and El (f) . The signal sequence domains at the C-termini of the p62 and 6K peptides f l i p out of the ER membrane and become cytoplasmic tails of these two peptides. (from Melancon and Garoff, 1987)  14  proteins, p62, 6K, and E l .  The signal sequence of p62 is unusual in that  i t becomes N-glycosylated and remains uncleaved.  It is believed that the  signal peptides of 6K and E l , that are at the C-termini of the p62 and 6K peptides respectively,  f l i p out of their membrane orientation and become  cytoplasmic tails (Cutler et a l . , 1986). The final cleavage in the maturation of the SFV envelope proteins (not shown in the above model) occurs in the Golgi apparatus (DeCurtis and Simmons, 1988).  This cleavage separates the p62 peptide into the E2 and E3  envelope glycoproteins, and is thought to be mediated by a Golgi protease that recognizes pairs of basic amino acids.  Interestingly,  the cleavage of  p62 requires El (Cutler and Garoff, 1986; Cutler et a l . , 1986).  The  cleavage of SFV p62 peptide is essential for infectivity (White et a l . , 1983), but the cleavage of SV p62 is not necessary for the production of infectious virions (Presley and Brown, 1989). The envelope proteins are transported from the Golgi apparatus to the plasma membrane, where virus assembly occurs.  Although SFV E2 may be  transported alone to the c e l l surface without the co-expression of E l , El requires the presence of E2 for transport from the ER (Kondor-Koch et a l . , 1983).  Rubella virus The RV virion contains a nucleocapsid consisting of a 40S genomic RNA molecule and a single species of capsid protein (Mr=33 kD) (Hovi and Vaheri,1970; Oker-Blom et a l . , 1983).  The nucleocapsid is enveloped within  a host-derived l i p i d bilayer containing the three glycoproteins, El (Mr=58kD), E2a (Mr-46kD), and E2b (Mr=42kD) (Oker-Blom et a l . , 1983).  The  two forms of the E2 protein result from heterogeneous glycosylation of an  15  identical apoprotein moiety coded by the E2 gene (Kalkkinen et a l . , 1984). The  N-terminal amino acid sequences of E2 and El have been determined by N-  terminal amino acid analysis of E2 and El (Kalkkinen et a l . , 1984). L i t t l e is known about the RV nonstructural genes and their products. However, the subgenomic mRNA which specifies the structural proteins has been cloned and the sequence determined for different strains of RV (Vidgren et a l . , 1987; Nakhasi et a l . , 1986, 1989; Clarke et a l . , 1987; Zheng et a l . , 1989) . The  structural genes are expressed from a 24S subgenomic mRNA, and are  translated in the order NH2-C-E2-E1-COOH (Oker-Blom, 1984; Figure 4). expression of RV structural genes in vitro  The  and in vivo has revealed some  features of the processing of the structural polyprotein.  Firstly, the  capsid protein does not appear to possess an autoprotease activity, since i t is not cleaved from the precursor polyprotein during in vitro translations unless microsomes are present (Clarke et a l . , 1987). However, RV capsid protein has an amino acid sequence at its C-terminus that resembles the conserved sequence of the catalytic site of the alphavirus capsid autoprotease (Frey and Marr, 1988).  Secondly, the  envelope glycoproteins, E2 and E l , can be targeted to the ER either independently or in the same precursor peptide via signal peptide sequences which have been identified at the C-termini of the adjacent proteins in the polyprotein precursor, C and E2, respectively (Hobman et a l . , 1988; Hobman and  Gillam, 1989).  Thirdly, after insertion into the ER membrane and  during transport, the envelope proteins are modified by glycosylation and acylation (Oker-Blom et a l . , 1983; Clarke et a l . , 1988; Hobman et a l . , 1988; Hobman and Gillam 1989; T. Hobman, PhD. thesis).  Transport studies  also show that E2 can be transported to the c e l l surface in the absence of  16  © 40 S (-11.000 b) cap-  7  7  iAA(A)n  +  © 24 S (-3500 b) 5'H  •AA(A) 3' n  jj^ translation NH  2  ^  h  p110  1  HCOOH  1  processing  capsid I  Ih-  C 33K  envelope U E2 30K ' ^ glycosylation E2a (47K) . E2b (42K)  E1 53K ^ 58K  Figure 4. The expression of the rubella virus structural polyprotein. The RV structural polyprotein is translated from the subgenomic 24S RNA which is identical to the 3' third of the genome. The unprocessed structural polyprotein precursor is 110 kD in size. The polyprotein is cotranslationally processed to the three peptides, capsid, E2 and E l . The two envelope proteins, E2 and E l , are processed to higher molecular weight forms by glycosylation. (from Oker-Blom, 1984)  17  El (Hobman and Gillam, 1989), whereas El requires E2 for the transport of El to the c e l l surface (T. Hobman, PhD. thesis).  Depending on the host  c e l l type, E2 and El may either concentrate at the Golgi apparatus or at the plasma membrane for budding to occur (Bardeletti et a l . , 1979; T. Hobman, PhD. the sis). Based on these results, a model for the co-translational insertion of the RV structural polyprotein into the ER membrane is proposed (Figure 5). The nascent E2 and El peptides are inserted into the ER membrane by signal sequences which are N-terminal to the peptides in the structural polyprotein.  Translocation is halted by the C-terminal hydrophobic regions  of El and E2 which serve as transmembrane anchors.  Cleavage by signal  peptidase (shown by arrows) at the C-termini of the two signal sequences releases the capsid protein into the cytoplasm, and separates E2 and E l . It is not known whether the capsid protein retains the signal sequence of E2 at its C-terminus, or i f it is further processed to produce mature capsid protein. . A possible trypsin-like protease cleavage site has been proposed to occur after the transmembrane anchor of E2 and before the signal peptide of E l , in the cytoplasmic t a i l of E2 (Vidgren et a l . , 1987).  This cleavage  w i l l release the signal sequence of El from the C-terminus of E2 (Vidgren et a l . , 1987) and may alter the conformation of the C-terminus of E2 in such a way that i t w i l l be held within the ER membrane, by only one hydrophobic domain rather than by two hydrophobic domains.  This change in  conformation of E2 may influence the transport of E2 and El proteins.  18  capsid  ER lumen  E2  Et  Figure 5. Model for the topogenesis and processing of the rubella virus structural polyprotein. The envelope proteins, E2 and E l , are inserted into the ER membrane by signal peptide sequences (white boxes) at the C-termini of capsid and E2, and are anchored in the membrane by C-terminal transmembrane anchor domains (black b oxes). The two cleavages by signal peptidase (shown by white arrows) release capsid into the cytoplasm and separate E2 and El proteins. A third cleavage (shown by black arrow) has been proposed to occur in an arginine-rich region in the cytoplasmic t a i l of E2.  19  Objectives of Thesis Projects Although the N-terminal amino acid sequences of E2 and El glycoproteins have been determined (Kalkkinen et a l . , 1984) and the putative cleavage sites for signal peptidase between C/E2 and E2/E1 can be assigned from the cDNA sequences, i t was not known i f these cleavage sites are the only ones used in the processing of the rubella virus structural polyprotein. The purpose of this study was to define the cleavage sites of signal peptidase between C, E2, and E l , and to evaluate the importance of the cleavages for the processing of E2 and El proteins. Another aspect of this study was to determine the carboxy termini of C and E2 proteins by expressing the constructed cleavage site mutants of C and E2 in in vitro  and in vivo  systems.  The minimum length of the  translated E2 required for the cleavage to take place was also examined by truncation of cDNA clones. One major difference in polyprotein processing between RV and SFV (Melancon and Garoff. 1987) is that the RV capsid protein is cleaved from the polyprotein by signal peptidase, whereas the SFV capsid protein is an autoprotease. A peptide sequence similar to that of a conserved serine protease sequence is also present in the RV capsid protein. This sequence was changed to more closely resemble the conserved sequence of serine proteases to determine i f i t has any potential function with respect to autocatalytic activity.  20  Materials and Methods  Materials Restriction endonucleases and DNA modifiying enzymes were purchased from commercial suppliers and used according to manufacturers'  specifications.  [a- P]-ATP (3000 Ci/mmole), [&- P]-ATP (3000 Ci/mmole) and L32  32  [ S]-Methionine (600-800 Ci/mmole) were from New England Nuclear. 35  Fluorescein-conjugated goat anti-human IgG was from Kirkegaard and Perry Laboratories or Tago Inc., and Rhodamine (TRITC)-conjugated goat anti-mouse antibody was from Zymed.  Anti-rubella human serum was a gift from Dr.  Aubrey Tingle (Department of Pediatrics, University of British Columbia). Mouse monoclonals to El were produced in this laboratory previously, and others were obtained from Dr. John Safford, Abbott Laboratories. monoclonal antibody was also obtained form Dr. John Safford.  Anti-C  Monoclonals  to E2 were a gift from Dr. Jerry Wolinsky, Department of Neurology, University of Texas, Houston.  TRITC-conjugated lectins were from Sigma.  COS cells were obtained from Dr. David Russell (Department of Molecular Genetics, University of Texas, Dallas).  Bacterial Strains and Growth of Bacteria E. coli  strains DH5a and DH5aF' from Bethesda Research Laboratories, and  E. coli. CJ236 from BioRad were used for the propagation of recombinant clones.  DH5Q! cells containing recombinant plasmids were grown in LB (1%  tryptone; 0.5% yeast extract; 0.5% NaCl) with the addition of 100 ug/ml ampicillin for the selection of antibiotic resistance.  DH5aF' cells were  propagated in 2xYT (1.6% tryptone; 1% yeast extract; 0.5% NaCl) and CJ236 cells were grown in LB medium containing 30 Mg/ml chloramphenicol.  21  Transformation of E. coli Competent cells were prepared either according to the method described in Promega Biotec Technical Bulletin 018 or by the method of Chung et a l . (1989).  Recombinant DNA was incubated with 0.2 ml of competent cells on  ice for 20-30 minutes and then heat-shocked for 45 sec. at 42°C.  DH5a  cells were then diluted with 0.9 ml of LB medium and grown at 37°C for one hour.  These cells were then plated out on LB plates containing 100 ug/ml  ampicillin.  The heat-shocked DH5aF' cells and CJ236 cells were diluted  into 2.5 ml of prewarmed YT top agar (0.6% agar; 0.8% tryptone; 0.5% yeast extract; 0.5% NaCl) and plated onto YT plates.  When screening for M13  recombinants, the YT top agar contained 0.02 ml of lOOmM isopropyl-6-D-thiogalactopyranoside (IPTG) and 0.05 ml of 5-bromo-4-4-chloro-3-indoyl-B-D-galactoside  (XGAL) at 2 mg/ml in  dimethyformamide.  Isolation of Plasmid and M13 DNA from E. coli Plasmid mini-prep procedure Small-scale isolation of DNA was performed as described in Maniatis et al.  (1982).  Approximately 1 ml of overnight culture was spun down in a  microfuge for 3 min. and the pellet was resuspended in 0.1 ml of 50 mM glucose; 25mM T r i s / C l (pH 8.0);  10 mM EDTA.  Then 0.2 ml of 0.2N NaOH; 1%  SDS was added with gentle mixing and the mixture was incubated on ice for 5 min.  Chromosomal DNA and proteins were precipitated by the addition of  0.15 ml of 3M K ; 5M CH3C00" (pH 4.8), with a 5 min. incubation on ice, +  followed by centrifugation in a microfuge for 5 min.  The supernatant was  extracted with an equal volume of phenol/chloroform (1:1), and the plasmid DNA was precipitated with the addition of 2 volumes of 95% EtOH.  22  DNA was  spun down for 5 min., rinsed in 70% ETOH, and dried in a Speed-Vac Concentrator.  The DNA was resuspended in TE (lOmM T r i s / C l [pH 8.0]; ImM  EDTA) containing 20 /ig/ml RNase A and incubated at 37°C for 20 min. Following a phenol/chloroform extraction, the DNA was then reprecipitated in 95% EtOH.  Plasmids were stored in TE at -20°C.  Large Scale Plasmid Preparation The large scale isolation of plasmid DNA from a 250 ml overnight culture was according to the method described in Promega Biotec technical bulletin 009, except that the buffer used for resuspension of the bacterial pellet was 50mM glucose; lOmMEDTA; 25mM T r i s / C l (pH 8.0) containing 2 mg/ml lysozyme.  Isolation of Phage DNA Phage DNA was isolated from 2 ml cultures of DH5aF' or CJ236 cells. cultures were grown for 4-6 hours at 37  oc  phase cells which The E. coli  starting from 10  jLil  The  of stationary  had been inoculated with cored plaques of M13 phage.  cells were spun down for 5 min. at RT and 1.2 ml of the  supernatant was transferred single-stranded DNA.  to a fresh tube for the isolation of  The pellet was saved for the isolation of RF DNA  which was performed according to the plasmid mini-prep procedure.  The  phage particles in the supernatant were precipitated by the addition of 0.3 ml of 20% PEG(MW 8000); 2. 5M NaCl, vortexing and incubation at RT for 20 min, followed by centrifugation in a microfuge for 5 min.  The phage pellet  was resuspended in 0.1 ml TE, and extracted once with 30 [Ml phenol and twice with 500 fJ,l chloroform.  Single-stranded DNA was precipitated with  the addition of 10 fJLl of 3M sodium acetate (pH 5.5) and 0.25 ml of 95% EtOH.  The DNA was spun down in a microfuge, rinsed in 70% EtOH, dried and  23  TE for use in oligonucleotide-directed mutagenesis or sequencing reactions.  Oligonucleotide-Directed Mutagenesis The method of oligonucleotide-directed mutagenesis described by Kunkel (1985) was used to alter sequences in the structural genes of rubella virus. The synthetic deoxyribonucleotides were obtained from the laboratory of M. Smith (University of British Columbia) and are listed in Table 1. Crude oligonucleotides were purified by electrophoresis through a 20% acrylamide gel containing 7M urea and 0.5 TBE buffer.  The gel slice  containing the oligonucleotide was incubated overnight at 37°C in 0.5M ammonium acetate; lOmM Mg(0Ac) , then concentrated to 2M ammonium acetate 2  and EtOH precipitated.  Oligonucleotides were kinased with T4  polynucleotide kinase in 50mM Tris/Cl (pH 7.5); lOmM DTT; lOmM MgC12 containing either 0.33mM ATP for mutagenesis or 30 jiCi ^-["P]-ATP for screening mutants. cDNA templates were cloned into M13mpl8 or M13mpl9 and then were propagated in the E. coli CJ236 dUTPase", Ung" strain.  The mutagenic  oligonucleotides were annealed to the templates under various temperature conditions in 20mM T r i s / C l (pH 7.4); lOmM MgCl ; 50mM NaCl. 2  DNA synthesis  was initiated by the addition of T4 DNA Polymerase and T4 DNA Ligase in buffer containing 0.5mM each dNTP; ImM ATP; 30mM Tris/Cl (pH 7.4); 15mM MgCl ; 50mM NaCl; 2mM DTT. 2  Synthesis was. continued for 90 min. at 37°C;  and terminated by a 6-fold dilution with lOmM Tris/ lOmM EDTA. DH5aF' competent cells were transformed with aliquots of the synthesis mixture, as described previously.  Transformants were screened for  potential mutants either by dot blot analysis of the single-stranded phage, or, i f the mutagenic oligonucleotide created a new restriction site, by  24  Table 1. List of mutagenic oligonucleotides.  Sequence  Function  5'CTGGAGCCCGGGGCGCGCGG 3'  change alanine to proline at (-1) position at cleavage site between C and E2  5'AGCCTCCTCGCGATAGGCGG 3'  change glycine to arginine at (-1) position at cleavage site between C and E2  5'GGCGGCGCCGCCCGGGGGACAGGCGCG 3 '  change arginine cluster at proposed cleavage site in the C-terminus of E2  5'AAGCGGGGCTCCCGAGTCGCCGTCGAG 3'  alter serine protease-like sequence in capsid protein  from the original RV sequence are underlined.  25  restriction endonuclease digestion of the RF form of the phage.  The  presence of mutations was confirmed by dideoxysequencing of the clones according to the Sequenase protocol (U.S. Biochemicals), based on the method of Sanger (1977).  Confirmed mutant cDNAs were then subcloned into  plasmid expression vectors.  Dot Blot analysis Two U.1 of each single-stranded phage DNA preparation that was to be screened were spotted onto a Zeta-Probe membrane (BioRad).  The membrane  was dried, and prehybridized in 6.0xSSC (lxSSC=0.15M NaCl; 0.015M Na citrate [pH 7.0]); lOx (0.2%) Denhardt's solution (1% each F i c o l l ; polyvinylpyrrolidine; BSA); 1% SDS at 65°C for a minimum of 30 min. Hybridization was carried out in the same mixture containing the mutagenic oligonucleotide that had been kinased with X - [ p]-ATP and T4 DNA 32  Polymerase.  The temperature of the hybridization reaction depended on the  oligonucleotide length. After two hours, the hybridization solution was removed and the membrane was washed in 6xSSC at 42°C, then the temperature of the washing was progressively increased until the approximate T of the m  mutagenic oligonucleotide was reached and the probe had been washed off of the non-mutagenized DNAs.  Following the washes at different temperatures,  the membrane was autoradiographed to monitor the binding of the probe to the control and mutagenized DNA.  Plasmid constructs RV cDNAs were  cloned into the vector pSPTl9 (Pharmacia) for in vitro  studies and into pCMV5, an in vivo transient expression vector containing the human cytomegalovirus major immediate early gene promoter (D. Russell,  26  Texas) for in vivo studies.  The cDNA coding for the structural genes of  RV, pSPT19 C/E2/E1, described by Clarke et a l . (1987) was subcloned into the EcoRI and Hindlll laboratory.  sites of pCMV5 and renamed p24S by T. Hobman in this  The plasmid, pE2El, was derived from p24S (Hobman and Gillam,  1988) and codes for 8 amino acids of the amino-terminus of capsid, 56 amino acids of the carboxy-terminus of capsid, and the entire E2 and El proteins. pE2El contains the translational initiation codon of the RV structural polyprotein from the capsid gene.  The plasmid, pCE2, was derived from p24S  by the excision of a PstI fragment containing the coding region of E l , and codes for the capsid and E2 proteins.  Plasmid constructs in which the  coding regions of genes were truncated, or altered by site-directed mutagenesis are described in the Results section.  The physical maps of  p24S, pE2El, and pCE2 are shown in Figure 6.  In Vitro  transcription using SP6 Polymerase  Plasmid DNA (2 £lg) was linearized either at the Hindlll  site of the  vector, or at a site within the cDNA with appropriate restriction enzymes. In vitro  transcription of the linearized DNA was carried out in 50 / i l of a  mixture containing 40mM Tris/Cl (pH7.5); 6mM MgCl ; 2mM spermidine; lOmM 2  NaCl; lOmM DTT; 100 /ig/ml nuclease-free bovine serum albumin; 0.5mM each NTP; and 600 units/ml SP6 Polymerase (Promega) at 37°C for 60-90 min. The DNA template was digested with 15 units of DNase I for 5 min. at 37°C, and the RNA was extracted with an equal volume of phenol/chloroform and precipitated with 95% EtOH.  RNA was stored at -20°C in EtOH.  27  E2 24S  si  El  Y Y  JO.  f-  T S  E2 E2E1  v  ft  TS  E2 CE2  5 1  El  J£  PH  v Y  H , 33  H , 33  ,  1  Figure 6. Schematic diagram of rubella virus cDNA constructs. The coding regions of capsid (C), E2, and El are shown. The translation i n i t i a t i o n site, encoded at the 5' end of the capsid gene, is included in each construct (shown by arrow). The transmembrane anchor domains (T), signal peptide regions (S), and the cytoplasmic t a i l region of E2 which is rich in arginine residues (r) are indicated. The positions of the coding regions for each of the three N-linked glycosylation sites in both E2 and El proteins are shown (Y). The cDNAs are cloned into the EcoRI (E) and HindiII (H) sites of the expression vector, pCMV5.  28  In vitro  translation  SP6-derived RNA was resuspended in 20 / i l of TE and approximately 2 /il were used in each translation reaction.  The translation reaction was  carried out at 30°C for one hour in a total volume of 25 jLil containing SP6derived RNA, nuclease-treated rabbit reticulocyte lysate (Promega), 0.02 mM amino acid mixture minus methionine, RNasin at 1600 units/ml.  [ S]-methionine (1200 Ci/ml) and 35  For protein translocation assays, 1 Hi of canine  pancreatic microsomes was added to the translation mix.  Translation  products were analyzed by SDS-PAGE according to Laemmli (1970).  In vivo expression COS cell transfection COS cells were transfected with pCMV5 cDNA constructs according to the method of Adams and Rose (1985), with some modifications.  Subconfluent  monolayers grown in DMEM/5%FCS (Dulbecco's modified Eagle medium plus 5% fetal calf serum) were washed twice with prewarmed Tris-saline (25mM T r i s / C l [pH 7.4]; 140mM NaCl; 3mM KC1; ImM CaCl ; 0.5mM MgCl ; 0.9mM 2  Na HP0 ) . 2  4  2  Cells were then incubated with a DNA mix containing 5 Mg/ml  plasmid DNA, and 1 mg/ml DEAE-Dextran (Mr=5X10) in Tris-saline for 30 min. 5  at 37°C.  Then the DNA solution was removed and replaced with medium  containing 80 /iM chloroquine.  After three hours of incubation at 37°C, the  cells were subjected to a shock treatment of 10% dimethylsulfoxide/DMEM for three minutes at room temperature, followed by two washes with Tris-saline, and incubation in DMEM/5% FCS.  Cell labelling Approximately 48 hours following transfection, COS cells were washed  29  with DMEM minus methionine containing 5% dialyzed FCS, then starved in this medium for 30 min. at 37°C.  Cells were then incubated in the same medium  containing 100 jLtCi [ S]-methionine for a pulse period of 30 min.  Protein  35  labelling and synthesis were then inhibited by the addition of DMEM/5% FCS containing 100  jLtg/ml  cycloheximide and 2mM methionine.  For processing  studies, labelled cells were incubated for various chase periods in this mixture.  After labelling, cells were washed with Tris-saline, and then  lysed in 400 /xl of cold lysis buffer (1% Triton X-100; lOmM EDTA; 50mM Tris [pH 7.5]; 1% sodium deoxycholate; 0.15M NaCl; 0.1% SDS).  Cell lysates  were spun down at RT for 5 min., and the supernatants were removed for immunoprecipitation.  Immunoprecipitation and Endo-B-N-acetylglucosaminidase H digestion Protein A Sepharose (Pharmacia) was preincubated 4 hours to overnight at 4°C  with human polyclonal serum (a gift from Dr. A. Tingle) in binding  buffer (lOOmM T r i s / C l [pH 7.4]; 400mM NaCl) with constant mixing.  The  serum-coated beads were then washed twice with binding buffer, and once in lysate buffer (25mM T r i s / C l [pH 7.4]; 100 mM NaCl; ImM EDTA; 1% Nonidet P40 [NP-40] ).  Transfected c e l l lysates or in vitro  translation products  were mixed with the serum-coated beads in lysis buffer overnight at 4°C. Beads were washed once with lysate buffer, twice with wash buffer (25mM triethanolamine; 172mM NaCl; 1% deoxycholate; 0.1% SDS; ImM EDTA), three times with lOmM T r i s / C l (pH 7.4),  and once with d i s t i l l e d water.  The  immune complexes were released from the beads by boiling in lOOmM sodium citrate (pH5.5); 0.15 % SDS for 5 min., vortexing, and pelleting the beads by centrifugation.  Supernatants were removed, and some were digested with  endo-B-N-acetylendoglucosaminidase H (Genzyme) at 25 milliunits/ml overnight.  The immunoprecipitated products were analyzed by SDS-PAGE  30  (Laemmli, 1970) and then fluorography.  Indirect  Immunofluorescence  Transfected COS cells grown on polylysine-coated 9mm plastic coverslips were washed three times with PBS, and fixed for 20 min. at room temperature in 2% formaldehyde/PBS, followed by washing with PBS.  Some cells were  permeabilized with 0.06% NP-40/PBS for 30 min. prior to blocking with 1% BSA/PBS.  A l l washes and solutions after this step include BSA/PBS.  Coverslips were overlaid with diluted human serum (1:200) or mouse monoclonals (1:75) incubated for 60 min. at RT, then washed.  Incubation  with secondary antibody, fluorescein-conjugated goat anti-human or antimouse IgG (Tago) diluted 1:100, was for 60 min. mounted, examined using epifluorescence, labelling using lectin-conjugates,  Coverslips were washed,  and photographed.  For double-  permeabilized cells were incubated with  Wheat Germ agglutinin-Rhodamine (WGA-TRITC) to visualize Golgi and postGolgi structures or Concanavalin A-Rhodamine (Con A-TRITC) for ER staining at 10-15 Mg/ l for 30 min. at RT prior to blocking with BSA. m  31  Results and Discussion  I. Mutation of the Serine Protease-Like Sequence in the Capsid Protein The  RV capsid protein has an amino acid sequence at its C-terminus that  resembles the sequence surrounding the catalytic site of several serine proteases, vitro  including the alphavirus capsid protein (Figure 7).  However, in  studies have shown that the RV capsid protein has no protease  activity (Oker-Blom et a l . , 1984; Clarke et a l . , 1987). To examine the potential function of this sequence in the RV capsid protein, i t was mutated to a sequence that more closely resembles the conserved sequence.  By oligonucleotide-directed mutagenesis,  the threonine  was changed to a serine at the active site, and an additional amino acid, glycine, was inserted after the serine (Figure 8).  However, sequencing of  the wild type and mutant clones revealed an error in the published sequence (Clarke et a l . , 1987); a codon specifying serine, not threonine, was already present at this site in the wild type construct (Figure 8). Sequencing of this region is difficult due to a high GC content, so it is possible that errors also exist in the published sequences for the two vaccine strains of RV, HPV77 and RA27/3. Even though a serine residue was already present in the conserved sequence, the mutagenesis s t i l l altered the sequence by the addition of an amino acid.  The mutant capsid protein was cloned into the pSPT19 vector at  the EcoRI site.  The resulting plasmid, called pGC5'E2, encodes the entire  capsid and the N-terminal 124 amino acids of E2. In vitro  translation of SP6 Polymerase transcripts in the absence of  microsomes shows that the mutant capsid was not cleaved from E2 (Figure 9) . Our  preparation of microsomes did not efficiently translocate and cleave  32  Chymotrypsin SV SFV  GDSGGPL GDSGRPI GDSGGPI  RV Therien RV M33 RV HPV77 RV RA27/3  GDSAPL GDTAPL GDTAPL GDTAPL  Figure 7. A comparison of the conserved amino acid sequence surrounding the serine catalytic residue of serine proteases and a similar sequence in the capsid protein of different Rubella virus strains. The catalytic serine residues are highlighted. Sequence data for chymotrypsin are from Sakinari et a l . , 1989. The sequence data for Sindbis virus (SV) are from Strauss et a l , 1984; for Semliki Forest virus (SFV) from Garoff et a l . , 1980; for Rubella virus (RV) M33 strain from Clarke et a l . , 1987; for RV Therien strain from Frey and Marr, 1988; for RV RA27/3 strain from Nakhasi et a l . , 1989; for RV HPV77 strain from Zheng et a l . , 1989.  33  D  S  A  wt  pC5 E2  GAC AGC G C C  mutant  pGC5 E2  GAC T C G G G A G C C  /  /  D  S *  G * •  A  Figure 8. Mutation of the capsid serine protease-like site. (A) A representation of the coding regions of the cDNA which served as the template for site-directed mutagenesis is shown. The cDNA, which codes for capsid protein ( C ) and 1 2 4 amino acids of E 2 , was cloned into the EcoRI site of the M13 vector. (B) The changes introduced by mutagenesis are shown by the sequencing gel. Asterisks denote the altered nucleotides.  34  pGC5 E 2 m ic  97.4  -  pC5/E2 +  •  43^  29^ **E2 18.4»-  F i g u r e 9. C h a r a c t e r i z a t i o n o f the mutagenized c a p s i d p r o t e i n . The M13 cDNAs coding f o r w i l d type and mutagenized c a p s i d p r o t e i n as w e l l as p a r t o f E2 (see F i g u r e 8) were c l o n e d i n t o the EcoRI s i t e o f pSPT19, and c a l l e d pC5'E2 and pGC5'E2 r e s p e c t i v e l y . The c o n s t r u c t s were l i n e a r i z e d a t the Hindlll s i t e o f the v e c t o r and the t r a n s c r i p t i o n was c a r r i e d out as d e s c r i b e d i n the M a t e r i a l s and Methods. The t r a n s l a t i o n p r o d u c t s were a n a l y z e d by SDS-PAGE. The cleavage p r o d u c t s , c a p s i d (C) and a t r u n c a t e d E2 p r o t e i n (E2) are i n d i c a t e d . The p o s i t i o n s o f p r o t e i n m o l e c u l a r weight standards ( i n kD) are marked.  35  a l l peptides, and consequently an uncleaved precursor protein i s seen i n a l l the products of i n vitro  translations i n the presence of microsomes.  Translation i n the presence of microsomes results i n two cleavage  products,  a f u l l - l e n g t h capsid of Mr=35kD, and a truncated, core-glycosylated  E2  peptide which i s seen as a doublet of approximately 20kD. The o r i g i n of the doublet  i s unknown, but perhaps arose from premature termination  translation.  of  The cleavage i n the wild type (pC5'E2), i s i d e n t i c a l to that  of the mutant. The r e s u l t s show that changing the serine protease-like sequence of RV to more c l o s e l y resemble the conserved sequence had no e f f e c t on the capsid protein cleavage. cleavage.  The mutant capsid s t i l l required signal peptidase  There i s also a tetrapeptide sequence, Pro-Ala-His-Val,  common between the capsid protease of 0'Nyong-nyong virus (an and the RV capsid protein (Levinson et a l . , 1990;  for  in  alphavirus)  Clarke et a l . , 1987).  This sequence surrounds the h i s t i d i n e residue of the c a t a l y t i c t r i a d of the protease of this alphavirus, but i t i s not as conserved among the alphaviruses as the sequence which surrounds the serine c a t a l y t i c (Garoff et a l . , 1980;  Strauss et a l . , 1984;  Takkinen, 1986).  the RV capsid protein does not have a protease a c t i v i t y may  residue  A reason that be that i t i s  lacking the t h i r d s i t e which contains the aspartic acid residue of the catalytic triad  of a serine protease.  Further experiments w i l l be  required to determine i f there i s a p o t e n t i a l function for the conserved sequence surrounding the serine residue i n the RV capsid protein with respect to autocatalytic cleavage.  36  II. Analysis of the Structural Polyprotein Cleavages by Signal Peptidase i)Role of Conformation in Cleavage Requirement for a minimum length of peptide It has been reported that the passenger domain beyond the signal peptidase cleavage site is important for efficient processing of a signal sequence-containing peptide (Andrews et a l . , 1988).  Andrews et a l . (1988)  examined the effect on the in vitro processing of progressive deletions in the region beyond the signal peptidase cleavage site of bovine preprolactin.  The deletions caused a reduction in the amount of cleavage  by signal peptidase, which was shown by protease protection assays to be caused by a failure of the deletion mutants to translocate across the microsomal membrane.  The deletion of amino acid sequences immediately  following the cleavage site had the most profound effect on translocation. It was suggested that the correct folding of the peptide near the signal sequence was important for the initiation of translocation.  However,  another study has shown that a signal sequence can be fused to a normally cytoplasmic domain and that this chimeric protein is  efficiently  translocated and processed (Lingappa et a l . , 1984).  From these apparently  contradictory results i t appears that the conformational requirements for translocation initiation are general features of protein structure, which may be found within some cytoplasmic domains, as well as following the signal peptide sequences of translocated proteins. The effect of truncated passenger domains on RV polyprotein processing was studied using run-off transcripts specifying full-length capsid and E2 of different lengths.  Figure 10 shows the in vitro  translation products of  the SP6 transcripts in the presence and absence of microsomes. protein (C) is the only cleavage product shown.  37  Capsid  It was found that only the  E2  1  IATG  H  SPI  B  X  T  T  _J\  T  TM  SP 1  5P6  pC5E2  pCE2X  "H  h  D  B  mic  B  -  +  D  +  i  974 »•  68 43^  Figure 10. In vitro analysis of a minimum length requirement for signal peptidase's cleavage. A representation of the cDNA coding for capsid (C) and E2 proteins is shown above. The restriction sites BstEII (B) , BstXI (X), PstI (?) , EcoRI (E), and Hindlll (H) , and signal peptide (SP) and transmembrane (TM) domains are indicated. [A]-[D] represent linearized cDNAs cloned into pSPT19 which were used for transcription and which code for capsid and different lengths of E2: [A] codes for f u l l length capsid and E2, and was derived from the cDNA, p24S, by linearization of the construct at the PstI site at the 3'terminus of E2; [B] is a cDNA clone, pC5'E2, which encodes capsid and 124 amino acids of E2, the 3' end of which is denoted by an asterisk, which has been linearized at the Hindlll site of the vector; [C] is a cDNA clone, pCE2X, which codes for capsid and 86 amino acids of E2. pCE2X was constructed by cutting pC5'E2 at the BstXI site of E2, f i l l i n g in the 3' end using T4 DNA polymerase, and religating to the Smal site of the vector. The resulting cDNA was linearized at the Hindlll site of the vector; [D] codes for capsid protein and 25 amino acids of E2 and was derived from pC5'E2 by linearization at the BstEII site at the 5'terminus of E2. The translation products derived from SP6 transcripts were analyzed by SDS-PAGE. Translations were in the presence and absence of microsomes (mic). Capsid protein (C) is indicated. 38  smallest was  translation product,  not  cleaved  by the  results  suggest  that  translocation in  obtained The  of  most  important for  became  be  recognition  Jn  of  Strauss  protein  in  the  nascent  F o r example, that  protein  the  prevents  its  RV C a n d E2 was  of  site, was  correct  Peptidase  is  glycosylation i n vitro.  potential and  in  It  appears  peptide  conformation  for  T h e minimum  inserted  into  occurs the  known t o  the  influence  the  influenza virus  can r e s u l t  lumen o f  influence  on p r o t e i n c o n f o r m a t i o n  can also in  cleavage  deleted  signal  N-linked glycosylation  effect  glycosylation  observed.  acid  Cleavage  Glycosylation is  and i t  were  apparatus.  been  amino  a decrease  the  is  proteins.  peptide  a mutation  studied  the  the  peptidase  residues  which  also  translocational  following  translocation  (Kawaoka a n d W e b s t e r ,  influence  these  These  results).  found that signal  cleavage  into  that  1977).  the  E2,  the  has  E2 ( u n p u b l i s h e d  peptidase  among  shown  1985),  to  for  result  of  D).  RV E2 g l y c o p r o t e i n ,  (1988)  directly  the  has  some c a s e s b y  and S t r a u s s ,  peptide.  The  to  G l y c o s y l a t i o n on S i g n a l  as  of  acids  (lane  requirement  d e t e r m i n i n g the  peptide  of  of  amino  microsomes  A similar  al.  respect  and f o l d e d  (Rothman and L o d i s h ,  transport  the  of  by components  cotranslationally ER  adjacent  translated  analysis  vitro  E2.  When some o f  required probably varies  Effect  of  and c l e a v a g e by s i g n a l  a minimum l e n g t h to  with  polypeptide.  the  cleavage  o f Andrews e t  (+22)  of  recombinant  the  residues  length  peptidase  amino a c i d s  studies  c a p s i d a n d 25  a minimum l e n g t h  to  translocation  needs  is  (+1)  nascent  distal  peptidase  from  were  that  a n d 86  in vitro  the  there  in a vaccinia virus  residues site  signal  and s i g n a l  b e t w e e n 25  specifying  the  protein  (reviewed  cleavability  in of  hemagglutinin  i n enhanced  cleavability  of  1989). on the  signal  A cDNA c l o n e  39  peptidase coding  for  cleavage  between  c a p s i d and  86  a  amino acids of E2, called pCE2X (C in Figure 10), was used in this study. There are two N-linked glycosylation sites of E2 encoded in this cDNA, and in  the mutant, called pCE2X-Gl/2, these sites have been altered (Figure  11A) .  In vitro  translation of transcripts from these clones, in the  presence and absence of microsomes, (Figure 11B) shows that there is no detectable difference between the signal peptidase cleavage of the non-glycosylated peptide and the glycosylated" peptide (C is the only cleavage product shown). important for the in vitro  This indicates that glycosylation is not signal peptidase cleavage of this polyprotein  precursor.  i i ) Mutation of the Signal Peptidase Cleavage Site between Capsid and E2 In  The  vitro  analysis  signal peptidase cleavage site between C and E2 was altered by  oligonucleotide-directed mutagenesis in a cDNA encoding entire capsid and 124 amino acids of E2 (Figure 10-B, Figure 12).  In vitro  expression of the  mutant cDNA (pCP5'E2) shows that the change at the cleavage site did not completely abolish cleavage, but caused a reduction in the amount of cleavage compared to the wild type (Figure 13).  When translation was  carried out in the presence of microsomes, capsid (C) was cleaved from the C/E2  precursor.  Also, a new higher molecular weight peptide which migrates  slower than the C/E2 precursor appears in the -translation products of the mutant construct (Figure 13, lane 4).  This higher molecular weight peptide  probably corresponds to the mutant precursor peptide which has been translocated, and is core glycosylated, but was not cleaved by signal peptidase. It is possible that the alanine at the (-3) position serves as an alternate cleavage site in the mutant precursor, since i t has the general  40  SP6  w  pCE2X pCE2X-Gl/2  pCE2X  mic  B  -  pCE2X-G1/2  -h  974^ 68>-  43i  Figure 11. In vitro study of the signal peptidase processing of an E2 glycosylation-deficient mutant. (A) The wild-type cDNA, pCE2X (C in Figure 10), is represented and the two sites in this construct which encode the sequence for N-linked glycosylation are indicated by arrows. The mutant cDNA construct, pCE2XGl/2, was derived as follows from an E2 cDNA clone previously constructed in this laboratory which had been altered at the f i r s t two N-linked glycosylation sites of E2: The BstXI fragment from the E2 mutant cDNA was purified, blunt-ended with T4 DNA Polymerase, and then cut with BstEII. The digested E2 fragment was then ligated into the BstEII- and Smaldigested C/E2 clone, pC5'E2. The changes in amino acid sequence of the mutant E2 protein derived from pCE2X-Gl/2 are shown, with the altered amino acids indicated by asterisks. (B) The translation products from transcripts derived from the Hindllllinearized cDNAs, pCE2X and pCE2X-Gl/2. Capsid protein (C) is the cleavage product shown which appears when microsomes (mic) are added to the translation mixture. Protein molecular weight standards are indicated (in kD) . 41  A  B  mutant  3 'G G C  G  A  T  C  Figure 12. Mutation of the signal peptidase cleavage site between capsid and E2. (A) The cDNA construct, pC5'E2 (B in Figure 10), was used as a template for the mutagenesis of the cleavage site between capsid and E2. The altered sequence surrounding the cleavage site is shown. (B) An autoradiograph of the sequencing gel which confirmed the presence of the mutation is shown. The altered nucleotides are indicated by asterisks.  42  C / E 2  2  mic  +  3 -  4 +  RV  97.4»68»43»-  F i g u r e 13. In vitro a n a l y s i s o f the C/E2 s i g n a l p e p t i d a s e c l e a v a g e s i t e mutant. The cDNA c o n s t r u c t s , pC5'E2 and pCP5'E2, were l i n e a r i z e d w i t h Hindlll and t r a n s c r i b e d by SP6 Polymerase. SP6 t r a n s c r i p t s were t r a n s l a t e d i n the presence and absence o f microsomes (mic) and the t r a n s l a t i o n p r o d u c t s were s e p a r a t e d by SDS-PAGE. The c a p s i d (C) cleavage p r o d u c t i s shown. Lanes 1 and 2: pC5'E2 t r a n s l a t i o n p r o d u c t s . Lanes 3 and 4: pCP5'E2 t r a n s l a t i o n products. The u n c l e a v e d C/E2 p r e c u r s o r i s a p p r o x i m a t e l y 45 kD. Lane 5 i s the t r a n s l a t i o n product o f the SP6 t r a n s c r i p t from S m a l - d i g e s t e d pCP5'E2. Lane 6 shows the r a d i o l a b e l l e d RV v i r i o n p r o t e i n s , C, E2, and E l . Protein m o l e c u l a r weight standards are i n d i c a t e d ( i n kD).  43  features of a cleavage site according to von Heijne (1986) , and would also release a capsid protein of approximately the same size as the wild type protein.  Although N-terminal amino acid sequencing of E2 has defined the  second alanine as the signal peptidase cleavage site (Kalkkinen et a l . , 1984), i t appears that the alanine at the (-3) position is a cryptic cleavage site which has been unmasked by the mutagenesis of the original site. The mutagenesis introduced a new Smal site into the clone between the coding regions of C and E2.  Therefore, transcripts derived from the  Smal-linearized clone w i l l specify a capsid protein corresponding to the entire coding region of C.  In Figure 13, lane 5 shows the translation  product of this transcript, and lane 6 the three RV structural proteins, which are from radiolabelled mature virions.  A comparison of C in these  two lanes shows that mature C is similar, i f not identical, to the in vitro translation product in size.  Since the C-terminus of C has not previously  been defined, this is the f i r s t indication of the length of the mature protein.  It appears that no further processing of C occurs after the  signal peptidase cleavage separating C from E2, and that the signal peptide of E2 is withdrawn from the ER membrane and remains at the C-terminus of mature C. Figure 14 confirms that the higher molecular weight peptide resulting from the in vitro translation of the C/E2 cleavage site mutant is a glycosylated, uncleaved form of the precursor peptide.  Endo H digestion of  the translation products shown in Figure 13 results in a loss of this higher molecular weight band, and a corresponding increase in the amount of deglycosylated precursor (Figure 14, lanes 5 and 6).  A shift in the  mobility of the truncated E2 peptide is also seen after endo H treatment, from a 20 kD core-glycosylated form to a 15 kD deglycosylated form.  44  The  C/E2 3  endoH  —  —  mic  —  -f  +  4  5  6  -  -  +  ~  +  +  68»-  «5 E2 /  184»14^  Figure 14. Endo H digestion of C/E2 in vitro translation products. The in vitro translation products of pC5'E2 and pCP5'E2 (shown in Figure 13) were immunoprecipitated with human anti-RV serum, and then digested with endo H, and analyzed by SDS-PAGE. The cleavage products from the translations with microsomes (mic) added are capsid (C), and a truncated E2 from the 5' coding region (5'E2). The uncleaved C/E2 precursor is approximately 45kD. A glycosylated form of this precursor is seen in Lane 5, above the 45kD peptide. Lanes 1-3: pC5'E2 translation products Lanes 4-6: pCP5'E2 translation products.  45  glycosylation of the mutant precursor peptide shows that i t has been translocated into microsomal vesicles, which indicates that alteration of the signal peptidase cleavage site does not affect the translocation of E2 protein.  In vivo analysis The cleavage site mutants, pCPE2 and p24S-CPE2, were derived by replacing the BstEII/EcoRI  fragment of the wild type cDNAs, pCE2 and p24S  (Figure 6) with the corresponding fragment from the mutant cDNA construct. The C/E2 constructs encode capsid protein and E2, and the 24S constructs encode the three RV structural proteins, C, E2, and E l . Intracellular proteins of transfected COS cells were labelled with [ S]-Methionine for a 35  pulse period of 30 minutes, and in some cases were chased for a period of either 30 minutes or 2 hours.  The labelled products were  immunoprecipitated with human serum and analyzed by SDS-PAGE. Figure 15 A shows the immunoprecipitated products from the C/E2 transfected lysates.  After a pulse of 30 minutes, there is a C/E2  precursor peptide in the wild type and mutant products (lanes 1 and 2), and when chased, this band disappears from the wild type products (lanes 3 and 5), but s t i l l remains in the mutant products (lanes 4 and 6).  Cleavage of  the C/E2 precursor to a C protein of Mr=35 kD and to the core-glycosylated E2 protein of Mr=39 kD occurs quickly for the wild type precursor (lane 1). Wild type E2 requires a longer chase period to achieve the higher molecular weight of the virion form shown in lane 7 (T. Hobman, PhD. thesis), therefore the virion form is not seen in these products.  The polypeptide  that migrates slightly slower than the C/E2 precursor may be BiP protein which has a reported molecular weight of 77 kD, and has been found in  46  C/E2  min  1  2  3  4  0  0  30  30  5  6  120 120  7 R  v  974»-«C/E2  68^ 43>-  ^E2(39kD)  24S  B min  1  2  3  4  5  6  0  0  30  30  120  120  7 R V  974»* -«C/E2  68»-  -*E1  43»-  ^2(39kD)  Figure 15. In vivo pulse-chase study of the C/E2 signal peptidase cleavage site mutants. COS cells were transfected with the pCMV5-cDNAs which were mutant and wild type at the cleavage site between capsid (C) and E2 proteins. Transfected cells were labelled with [ S]-methionine for a pulse period of 30 min. and chased for a period of either 30 min. or 2 hours (shown in min.). Labelled lysates were immunoprecipitated with human anti-RV serum and separated by SDS-PAGE. The 74 kD C/E2 precursor and the cleavage products,C and a 39 kD form of E2, are indicated by arrows. (A) The immunoprecipitated products of pCE2 (wild type) and pCPE2 (mutant). Lanes 1, 3, and 5: pCE2 transfected products. Lanes 2, 4, and 6: pCPE2 transfected products. Lane 7 shows the radiolabelled RV virion proteins, C, E2, and E l . (B) The immunoprecipitated products of p24S (wild type) and p24S-CPE2 (mutant). Lanes 1, 3, and 5: p24S transfected products. Lanes 2, 4, and 6: p24S-CPE2 transfected products. Lane 7 shows the radiolabelled RV structural proteins. 35  47  association with misfolded proteins in the ER as well as with some v i r a l glycoproteins (Kozutsumi et a l . , 1988; Rose et a l . , 1988; Hurtley et a l . , 1988).  The cleavage products of the mutant precursor take a longer time to  appear, and are most abundant after a 2 hour chase period (lane 6).  These  results suggest that the kinetics of the cleavages of the wild type and mutant precursor peptides are different; the cleavage of the wild type C/E2 precursor appears to be faster and efficient, whereas the cleavage of the mutant C/E2 is relatively slow and incomplete. The results from the in vivo expression of the 24S constructs (Figure 15B) are similar to those found for the C/E2 constructs.  The cleavage of  El from the mutant structural polyprotein occurs normally even though the C/E2 cleavage site is altered (lanes 2, 4, and 6).  This indicates that the  aberrant conformation of E2 within the ER membrane does not affect the processing of E l . Endo H digestion of the 2 hour chase products shows that the oligosaccharide structures on the mutant C/E2 precursor are endo H-sensitive, as seen by the shift in mobility of the polypeptide from 74 kD to approximately 65 kD (Figure 16).  This suggests that the mutant  precursor is retained within the ER, where oligosaccharide structures show endo H sensitivity.  Several v i r a l glycoproteins, such as the influenza  virus hemagglutin, must be folded correctly as a prerequisite of transport from the ER (Gething et a l . , 1986), therefore i t is possible that the RV E2 glycoprotein also must be in the correct conformation to exit the ER. The 57 kD El and 39 kD E2 glycoproteins also display an increase in mobility after endo H treatment.  Only the immunoprecipitated products of p24S-CPE2-  and pCPE2- transfected cells have a C/E2 precursor present after a 2 hour chase period following synthesis.  A l l wild type C/E2 precursor is cleaved  after 2 hours.  48  pCE2 endo H  —  +  pCPE2  p24S  1  p24S-CPE2  - + -  +  97.4»* «C/E2 «E1  68»43>  -<E2  29"  Figure 16. Endo H digestion of the in vivo expression products of the C/E2 constructs. The immunoprecipitated products of transfected COS cells which had been labelled with [ S]-methionine and chased for 2 hours (Figure 15A,B: Lanes 5 and 6) were digested with endo H and analyzed by SDS-PAGE. The endo Hsensitive (core-glycosylated) forms of the C/E2 precursor, E l , and E2 are indicated by arrows. Protein molecular weight standards are shown (in kD). Wild type (pCE2, p24S). Cleavage site mutant (pCPE2, p24S-CPE2). 35  49  Immunofluorescence studies Transfected COS cells were processed for indirect immunofluorescence studies on the subcellular localization of the C/E2 mutant and wild type precursor polypeptides and their cleavage products.  Figures 17 and 18 show  the distribution of C and E2 in cells transfected with pCE2 and pCPE2, the wild type and mutant C/E2 constructs.  Monoclonal antibodies were used to  localize these antigens, and some cells were also treated with Rhodamine-conjugated WGA to identify Golgi and post-Golgi structures (Virtanen et a l . , 1980), or with Con A to identify the ER. The E2 expressed in pCE2-transfected cells is localized in a predominantly juxtanuclear position (Figure 17A), which corresponds to the position of the Golgi apparatus (Figure 17B).  In contrast, E2 expressed from pCPE2  (Figure 17C) shows a reticular staining pattern, similar to that of the ER reticular network (Figure 17D).  Figure 17E shows another c e l l  transfected  with pCPE2, with a reticular staining pattern which does not correspond to the staining pattern of the Golgi complex (Figure 17F). In Figure 18A, wild type C expressed from pCE2 is diffuse throughout the c e l l cytoplasm, rather than concentrated in the Golgi region which is indicated in Figure 18B.  The staining pattern of pCPE2-derived C is very  different, suggesting a reticular location of this protein, probably corresponding to the ER (Figure 18C).  Cell-surface staining using human  polyclonal serum (Figure 18 D,E) indicates that RV E2 antigens are present on the surface of both mutant-and wild type-transfected  cells.  Figures 19 and 20 show the subcellular distribution of C and E2 expressed from the 24S cDNA constructs, p24S and p24S-CPE2. El and C are co-expressed,  When wild type  a strong juxtanuclear staining pattern which  corresponds to the Golgi region is observed for C (Figure 19A.B), in  50  f  o  e  e  e  e  Figure 17. Indirect immunofluorescence of pCE2- and pCPE2-transfected COS cells: E2 localization. Cells were permeabilized with detergent for the detection of intracellular antigens and treated with anti-E2 serum. (A) pCE2-transfected c e l l , anti-E2 (B) same c e l l , TRITC-WGA (C) pCPE2-transfected c e l l , anti-E2 (D) same c e l l , TRITC-Con A (E) pCPE2-transfected c e l l , anti-E2 (F) same c e l l , TRITC-WGA.  51  Figure 18. Indirect immunofluorescence of pCE2- and pCPE2-transfected COS cells: capsid localization and c e l l surface immunofluorescence. Frames A-C, cells were permealilized and treated with anti-capsid (C) serum. (A) pCE2-transfected cells, anti-C (B) same c e l l , TRITC-WGA (C) pCPE2-transfected c e l l , anti-C. Frames D and E, c e l l surface antigens were detected with human polyclonal anti-RV serum. (D) pCE2-transfected c e l l (E) pCPE2-transfected c e l l .  52  Figure 19. Indirect immunofluorescence of p24S- and p24S-CPE2- transfected COS cells: capsid localization. A l l cells were permeabilized and treated with anti-capsid (C) serum. (A) p24S-transfected c e l l , anti-C (B) same c e l l , TRITC-WGA (C) p24S-CPE2transfected c e l l , anti-C (D) same c e l l , TRITC-Con A.  53  •  •  Figure 20. Indirect immunofluorescence of p24S- and p24S-CPE2- transfected COS cells: E2 localization. A l l cells were permeabilized and treated with anti-E2 serum. (A) p24Stransfected c e l l , anti-E2 (B) p24S-CPE2- transfected c e l l , anti-E2 (C) same c e l l , TRITC-Con A.  54  contrast to the diffuse cytoplasmic distribution observed when C is expressed in the absence of El (Figure 18A).  It has been proposed that in  COS cells C concentrates at the Golgi membrane in association with the cytoplasmic t a i l of El (T. Hobman, PhD. thesis).  Capsid protein expressed  from p24S-CPE2 is less concentrated in the juxtanuclear region and appears to reside in the reticular network of the ER (Figure 19C,D). The E2 protein expressed from the wild type construct, p24S, is predominantly in a juxtanuclear position which indicates that i t has been transported to the Golgi apparatus (Figure 20A).  However, E2 expressed  from p24S-CPE2 shows a more diffuse staining pattern which is similar to the pattern of Con A staining (Figure 20 B,C). In summary, the immunofluorescence studies show an abnormal subcellular distribution of C and E2 expressed from the mutant constructs.  The  staining patterns for these two antigens, expressed from the mutant constructs, are mostly reticular, which suggests that the majority of the mutant C/E2 precursor remains uncleaved by signal peptidase, and that the mutant precursor is not transported beyond the ER. The cell surface staining shows the presence of antigen at the cell surface of mutant-transfected cells.  The SDS-PAGE analysis of the COS cell products  revealed that some cleavage of the mutant precursor occurs (Figure 15) , so i t is likely that there may be some cleaved E2 which has been transported to the c e l l surface.  Further-studies are required,- however, to determine  whether any of the uncleaved precursor is transported to the c e l l surface.  i i i ) Mutation of the Cleavage Sites between E2 and El In vitro  analysis  The cleavage(s) between the E2 and El proteins were studied using a double mutant in which both the signal peptidase cleavage site and the  55  proposed trypsin-like cleavage site in the cytoplasmic t a i l of E2 were altered.  The signal peptidase site (-1) residue was changed from a glycine  to an arginine, and three consecutive arginine residues of the cytoplasmic t a i l region of E2 were changed to other amino acids by site-directed mutagenesis (Figure 21).  In vitro analysis of the double mutant (Figure  22) shows that the mutant E2/E1 precursor product is not readily cleaved by the signal peptidase present in the microsomal membranes.  The mutant  precursor shifts to a higher molecular weight form when microsomes are added to the translation mix.  Therefore, like the mutant C/E2 precursor,  the mutant E2/E1 precursor is translocated normally and is glycosylated, but is not cleaved efficiently by signal peptidase.  The wild type E2/E1  precursor is cleaved in the presence of microsomes to yield E2, which is seen as a doublet, and E l .  The El protein has a much weaker signal than E2  since i t contains fewer methionine residues.  A protein which corresponds  in size to the lower molecular weight band of the E2 doublet is seen in the translation products processed by microsomes of the mutant E2/E1 transcripts.  If this peptide corresponds to E2, then some cleavage of the  mutant precursor occurred.  The origin of the lower molecular weight E2  peptide is unknown, but i t has been observed in other in vitro studies and was suggested to result from the processing of the C-terminus of E2 (T. Hobman, PhD. thesis).  In vivo  analysis  In vivo expression of the two pCMV5 constructs, the wild type construct, pE2El, and the mutant construct, pE2(-tl)REl,  showed that the presence of  the double mutation greatly inhibited cleavage of the E2/E1 precursor in vivo  (Figure 23).  Transfected COS cells were labelled with  [ S ]-Methionine for a period of 30 minutes and some were chased for 35  56  2  PE2E  , '^|.  El  E2  H /  5  tf 1 2  [TJ  wt  C G C C G C G C C TGT C G C C G C C G C R  R  A  C  R  R  R  i I I  mutant  CGC C C G GGC P  P  G  • El -3 [2]  wt  GCC A  mutant  -2  -1  TAJ GGC Y  "5"  +1 GAG E  CGC R  Figure 21. Mutation of the cleavage sites between E2 and E l . The wild type cDNA, pE2El (described in Figure 6), is represented, with the signal peptide (s) and transmembrane (t) domains and arginine-rich region of E2 (r) indicated. The positions of the two cleavage sites between E2 and El which are altered by site-directed mutagenesis in the double mutant, pE2(-tl)REl, are shown by arrows. [1] shows the site of the proposed trypsin-like processing between the transmembrane anchor of E2 and the signal peptide of E l . The entire nucleotide sequence and deduced amino acid sequence of this cytoplasmic t a i l region of E2 is shown. The coding region for three consecutive arginine residues is altered in the mutant sequence. [2] shows the site of signal peptidase cleavage between E2 and E l . The (-1) residue with respect to the cleavage site was changed from a glycine to an arginine residue in the mutant. An autoradiograph of the sequencing gel which confirmed the presence of the mutant sequence in the E2 cytoplasmic t a i l region is shown. The altered sequences are denoted by asterisks. 57  E2/E1 B mic  -  +  - + RV  200»* 92.5»69»-  -«E2/E1 -*E1  46^  «E2  30»-  Figure 22. In vitro analysis of the E2/E1 cleavages, using a double mutant. The wild type cDNA construct, pE2El, and the double mutant construct, pE2(tl)REl, were cloned into the vector pSPT19. SP6 transcripts were derived from Hindlll-linearized templates and were translated in the presence and absence of microsomes (mic). The translation products were separated by SDS-PAGE. The unglycosylated precursor polypeptide, E2/E1, and the three RV virion proteins, C, E2 and E l , are indicated by arrows. Radiolabelled protein molecular weight standards are shown (in kD).  58  E2/E1  min 20O-  1  2  0  0  3  4  120 120  -  «E2/E1  92.5»69^  -«E1  46»*  2E2  30'  F i g u r e 23. In vivo p u l s e - c h a s e study o f the E2/E1 c l e a v a g e s , u s i n g a double mutant. The cDNAs, p E 2 E l and p E 2 ( - t l ) R E l , were c l o n e d i n t o pCMV5 f o r in vivo e x p r e s s i o n i n COS c e l l s . The t r a n s f e c t e d c e l l s were l a b e l l e d w i t h [ S ] methionine f o r a p u l s e p e r i o d o f 30 min. and chased f o r 2 hours (chase p e r i o d i s i n d i c a t e d i n min.). The l a b e l l e d t r a n s f e c t i o n p r o d u c t s were immunoprecipitated w i t h human anti-RV serum and s e p a r a t e d by SDS-PAGE. Lanes 1 and 3 show the immunoprecipitated p r o d u c t s o f p E 2 E l - t r a n s f e c t e d c e l l s , and Lanes 2 and 4 show the immunoprecipitated p r o d u c t s o f pE2(tl)REl-transfected cells. The 92kD E2/E1 u n c l e a v e d p r e c u r s o r , a 57 kD c l e a v e d E l , and a 39kD E2 cleavage p r o d u c t and i t s more p r o c e s s e d form o f 42kD, a r e i n d i c a t e d by arrows. R a d i o l a b e l l e d p r o t e i n m o l e c u l a r standards are shown ( i n kD). 35  59  hours.  Wild type E2/E1 precursor is very efficiently cleaved during the  pulse period and very l i t t l e precursor remains.  After the chase period,  two forms of the E2 protein are seen, a 39 kD core-glycosylated form and a more processed 42 kD form.  In contrast, no cleavage products of the mutant  E2/E1 precursor are seen either after the pulse or chase period. The E2/E1 glycosylated precursor is approximately the same size as the molecular weight marker of 92 kD. kD and 53 kD respectively,  Since core-glycosylated E2 and El are 39  the size of this E2/E1 precursor is in agreement  with a predicted size for a core-glycosylated precursor.  Immunofluorescence studies Monoclonal antibodies were used to localize E2 and El within transfected COS cells (Figures 24 and 25).  E2 which was expressed from pE2El is found  mainly in a juxtanuclear position which costains with WGA, but some is also seen in a reticular distribution (Figure 24 A,B). expressed from pE2(-tl)REl  In contrast, E2  shows a diffuse staining pattern, which does  not correspond to the Golgi-staining pattern (Figure 24 C,D). El which was expressed from pE2El is distinctly concentrated in the juxtanuclear region, corresponding to the Golgi complex (Figure 25 A,B), whereas El expressed from pE2(-tl)REl shows a more diffuse staining pattern which may indicate the ER (Figure 25 C,D).  The intracellular  immunofluorescence of El expressed from the mutant construct was found to be weak when using a monoclonal antibody specific for a hemagglutination-inhibition (HAI) epitope.  In the uncleaved E2/E1  precursor, El would be constrained at both its N-terminus and its C-terminus in the ER membrane, and this would result in an abnormal conformation of certain epitopes. expressed from the mutant construct  The immunofluorescence staining of El was brighter when a non-HAI monoclonal  60  9  *  o *  e  Figure 24. Indirect immunofluorescence of pE2El- and pE2(-tl)REltransfected cells: E2 localization. Cells were permeabilized and treated with anti-E2 serum. (A) pE2Eltransfected c e l l , anti-E2 (B) same c e l l , TRITC-WGA (C) pE2(-tl)REltransfected c e l l , anti-E2 (D) same c e l l , TRITC-WGA.  61  Figure 25. Indirect immunofluorescence of pE2El- and pE2(-tl)REltransfected cells: El localization. Cells were permeabilized and treated with anti-El serum. (A) pE2Eltransfected c e l l , anti-El (B) same c e l l , TRITC-WGA (C) pE2(-tl)REltransfected c e l l , anti-El (D) same c e l l , TRITC-WGA.  62  antibody was used. Figure 26 shows the c e l l surface staining of the E2/E1 transfected COS cells.  El at the c e l l surface of pE2El-transfected cells displays a very  bright immunofluorescence and E2 from the same construct is also seen at the c e l l surface (Figure 26 A,B).  The double mutant, pE2(-tl)REl,  expresses some El and E2 at the c e l l surface, but the staining of El is very weak (Figure 26 C-F). In summary, the immunofluorescence studies of the double cleavage mutant of the E2/E1 precursor show an abnormal distribution of E2 and El within transfected COS cells, which indicates that transport of the uncleaved precursor beyond the ER did not occur.  Although the SDS-PAGE analysis of  the transfection products did not show any cleavage of the mutant E2/E1 precursor, i t is possible that some cleavage did occur, and that E2 and/or El was transported to the c e l l surface, as is suggested by the c e l l surface staining of the mutant-transfected cells.  The predominantly ER-specific  localization of the E2 and El antigens indicates that transport of the uncleaved precursor beyond the ER did not occur.  There are no alternate  amino acid sequences near the normal signal peptidase cleavage site that conform to the requirements of a cleavage site according to von Heijne (1986).  There is an alanine residue at the (-3) position, but i t is not  likely to serve as a cleavage site since there is a proline in the position.  (-4)  It is possible that the cleavage of the mutant peptide occurred  at an alternate site in the cytoplasmic t a i l region of E2 because in this region there are two consecutive arginine residues which were not mutagenized (Figure 21), and these may serve as an alternate cleavage site for a trypsin-like protease.  However, they are unlikely to be used as a  site of normal processing since they immediately follow the transmembrane  63  \ I  .* til) '  D  7. . .  F i g u r e 26. I n d i r e c t immunofluorescence o f pE2El- and p E 2 ( - t l ) R E l transfected COS c e l l s : c e l l s u r f a c e immunofluorescence. The c e l l s were s t a i n e d f o r s u r f a c e a n t i g e n s w i t h E2 and E l monoclonal s e r a . (A) p E 2 E l - t r a n s f e c t e d c e l l , a n t i - E l (B) p E 2 E l - t r a n s f e c t e d c e l l , a n t i - E 2 (C) p E 2 ( - t l ) R E l - t r a n s f e c t e d c e l l , a n t i - E l (D) same c e l l , phase c o n t r a s t (E) p E 2 ( - t l ) R E l - t r a n s f e c t e d c e l l , a n t i - E 2 (F) same c e l l , phase c o n t r a s t .  64  anchor of E2, and basic residues on the cytoplasmic side of transmembrane anchors are found to be important for the stabilization of a transmembrane domain (Sabatini et a l . , 1982).  Summary and Conclusions The results of this study indicate that mutation of the signal peptide cleavage sites of the RV structural polyprotein does not affect the translocation of the envelope proteins, E2 and E l , across the ER membrane. However, a profound effect on the intracellular transport of these proteins was observed.  Most of the uncleaved C/E2 and E2/E1 precursor polypeptides  were found to be retained in the ER region of the c e l l .  The E2 and El  peptides which were not cleaved by signal peptidase at their N-termini may be held within the ER membrane at both their N- and C-termini in an abnormal configuration.  Normally, the N-termini of E2 and El are free in  the lumen of the ER to assume the correct tertiary structure for transport. The incorrect folding of E2 and El may have prevented their exit from the ER. A difference between the two cleavage site mutants was observed during both in vitro and in vivo expression studies.  The expression of the C/E2  precursor cleavage site mutants showed partial cleavage of the precursor, which indicated that an alternate cleavage site was used.  However, very  l i t t l e or no cleavage of the E2/E1 precursor was observed in the cleavage site mutant.  An in vitro  translation product of the E2/E1 mutant may have  corresponded to cleaved E2 protein, but further studies are required to confirm the identity of this translation product. This study has confirmed one of the differences between the processing of the alphavirus structural precursor polyprotein and that of RV.  The  alphavirus capsid protein is separated from the rest of the structural  65  protein i t s e l f (Melancon and Garoff, 1987).  Even though a sequence similar  to that surrounding the catalytic serine residue of the protease is found in RV capsid, i t does not appear to be able to function in autoproteolysis, even when mutagenized to more closely resemble the alphavirus sequence. The C-terminus of mature RV capsid protein appears to contain the signal peptide of E2, since a capsid protein translation product containing the signal peptide of E2  is approximately the same size, i f not identical to,  capsid protein found in virions. the arginine-rich region.  The C-terminus of E2 may be processed at  To determine whether a proteolysis at this  potential trypsin-like cleavage site is able to separate the E2 and El proteins, a single mutant E2/E1 cDNA construct in which only the signal peptidase cleavage site is altered has been constructed and w i l l be expressed in COS cells.  This study is now in progress.  66  References Adams, G.A. and Rose, J . K . (1985) Structural requirements of a membranespanning domain for protein anchoring and c e l l surface transport. Cell 41;1007-1015). A l i p e r t i , G. and Schlesinger, M.J. (1978) Evidence for an autoprotease activity of Sindbis virus capsid protein. Virology 90: 366-369. Andrews, D., Perara, E . , Lesser, C. and Lingappa, V. (1988) Sequences beyond the cleavage site influence signal peptide function. J . Biol. Chem. 263: 15791-15798. Arias, C . , Bell, J . R . , Lenches, E . M . , Strauss, E.G. and Strauss,J.H. (1984) Sequence analysis of two mutants of Sindbis virus defective in the intracellular transport of their glycoproteins. J . Mol. Biol. 168: 87. Bardeletti, G..Tektoff, J . and Gautheron, D. (1979) Rubella virus maturation and production in two host c e l l systems. Intervirology 11: 97103. Blobel, G. and Dobberstein, B. (1975a) Transfer of proteins across membranes I. Presence of proteolytically processed and unprocesed nascent immunoglobulin murine myeloma. J . Cell Biol. 67: 835-851. Blobel, G. and Dobberstein, B. (1975b) Transfer of proteins across membranes II. Reconstitution of functional rough microsomes from heterologous components. J . Cell Biol. 67: 852-862. Blobel, G. (1980) Intracellular protein transport. U.S.A. 77: 1496-1500.  Proc. Natl. Acad. Sci.  Boege, U . , Wengler, G . , Wengler, G. and Wittmann-Liebold, B. (1981) Primary structure of the core proteins of the alphaviruses Semliki Forest virus and Sindbis virus. Virology 113: 293-303. Bohni, P. C , Deshares, R . J . and Schekman, R.W. (1988) SEC11 is required for signal processing and yeast c e l l growth. J . Cell Biol. 106: 1035-1042. Bonatti, S., Migliaccio, G. and Simons, K. (1989) Palmitylation of v i r a l membrane glycoproteins takes place after exit from the endoplasmic reticulum. J . Biol. Chem. 264: 12590-12595. Brzeski, H. and Kennedy, S.I.T. (1977) Synthesis of Sindbis virus nonstructural polyprotein in chicken embryo fibroblasts. J . V i r o l . 22: 420-429. Chou, P. Y. and Fasman, G.D. (1978) Empirical predictions of protein conformation. Ann. Rev. Biochem. 47: 251-276. Chung, C . T . , Niemela, S.L. and Miller, R.H. (1989) One step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. U.S.A. 86: 2172-2175.  67  Clarke, D.M., Loo, T.W., Hui, I . , Chong, P. and Gillam, S. (1987) Nucleotide sequence and in vitro expression of rubella virus 24S subgenomic mRNA encoding the structural proteins E l , E2, and C. Nucl. Acids Res. 15: 3041-3057. Clarke, D.M., Loo, T . , McDonald, H. and Gillam, S. (1988) Expression of rubella virus cDNA coding for the structural proteins. Gene 65: 23-30. Cutler, D.F. and Garoff, H. (1986) Mutants of the membrane-binding region of Semliki Forest virus E2 protein. I. Cell surface transport and fusogenic activity. J . Cell Biology 102: 889-901. Cutler, D . F . , Melancon, P. and Garoff, H. (1986) Mutants of the membranebinding region of Semliki Forest virus E2 protein. II. Topology and membrane binding. J . Cell Biol. 102: 902-910. De Curtis, I. and Simmons, K. (1988) Dissection of Semliki Forest virus glycoprotein delivery from the trans-Golgi network to the c e l l surface in permeabilized BHK cells. Proc. Natl. Acad. Sci. U.S.A. 85: 8052-8056. Ding, M and Schlesinger, S.J. (1989) Evidence that Sindbis virus nsP2 is an autoprotease which processes the virus nonstructural polyprotein. Virology 171: 280-284. Dunphy, W.G. and Rothman, J . E . (1985) Compartmental organization of the Golgi stack. Cell 42: 13-21 Enzmann, P. and Welland, F. (1979) Studies on the morphology of alphaviruses. Virology 95: 501. Evans, E . A . , Gilmore, R. and Blobel, G. (1986) Purification of microsomal signal peptidase as a complex. Proc. Natl. Acad. Sci. U.S.A. 83: 581-585. Freedman, R. (1984) Native disulfide bond formation in protein biosynthesis: evidence for the role of protein disulfide isomerase. Biol. Sci. 9: 438-441.  Trends  Frey, T.K. and Marr, I.D. (1988) Sequence of the region coding for virion proteins C and E2 and the carboxy terminus of the nonstructural proteins of rubella virus: comparison to alphaviruses. Gene 62: 85-99. Gaedigk-Nitschko, K. and Schlesinger, M.J. (1990) The Sindbis virus 6K protein can be detected in virions and is acylated with fatty acids. Virology 175: 274-281. Gaedigk-Nitschko, K. and Schlesinger, M.J. (1990) Site-directed mutations in the Sindbis virus 6K protein reveal sites for fatty acylation and the underacylated protein affects virus release and virion structure. Virology 175: 282-291. Garoff, H . , Simons, K. and Renkonen, 0. (1974) Isolation and characterization of the membrane proteins of Semliki Forest virus. Virology 61: 493-504.  68  Garoff, H . , Simons, K. and Dobberstein, B. (1978) Assembly of Semliki Forest virus membrane glycoproteins in the membrane of the endoplasmic reticulum in vitro. J . Mol. Biol. 124: 587-600. Garoff, H . , Frischauf, A.M., Simons, K., Lehrach, H. andDelius, H. (1980a) The capsid protein of Semliki Forest virus has clusters of basic amino acids and prolines in its amino-terminal region. Proc. Natl. Acad. Sci. U.S.A. 77: 6376-6380. Garoff, H . , Frischauf, A.M., Simons, K., Lehrach, H. andDelius, H. (1980b) Nucleotide sequences of cDNA coding for Semliki Forest virus glycoproteins. Nature (London) 288: 236-241. Garoff, H . , Kondor-Koch, C. and Riedel, H. (1983) Structure and assembly of alphaviruses. Curr. Top. Microbiol. Immunol. 99: 1-50. Gething, M.J. and Sambrook, J . (1986) Expression of wild-type and mutant forms of influenza hemagglutinin: the role of folding in intracellular transport. Cell 46: 939-950. Greenburg, G. ,* Shelness, G. and Blobel, G. (1989) A subunit of mammalian signal peptidase is homologous to yeast SEC11 protein. J . Biol. Chem. 264: 15762-15765. Hahn, Y . S . , Strauss, E.G. and Strauss, J . H . (1989) Mapping of RNA" mutants of Sindbis virus: assignment of complementation groups A, B, and G to nonstructural proteins. J . Virol. 63: 3142-3150. Hardy, W.R. and Strauss, J . H . (1989) Processing of the nonstructural polyprotein of Sindbis virus: nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans. J . V i r o l . 63: 46534664. Harrison, S., Jack, A . , Goodenough, D. and Sefton, B. (1974) J . Supramol. Str. 2: 486. Hartmann, E . , Wiedmann, M. and Rapoport, T. (1989) A membrane component of the endoplasmic reticulum that may be essential for protein translocation. Embo J . 8: 2225-2229. Hobman, T . C . , Shukin, R. and Gillam, S. (1988) Translocation of rubella virus glycoprotein El into the endoplasmic reticulum. J . V i r o l . 62: 42594264. Hobman, T.C. and Gillam, S. (1989) In vitro and in vivo expression of rubella virus glycoprotein E2: The signal peptide is contained in the Cterminal region of capsid protein. Virology 173: 241-250. Hobman, T. (1989) Molecular c e l l biology of rubella virus structural proteins. PhD. Thesis, University of British Columbia. Hovi, T. and Vaheri, A. (1970) Infectivity and some physicochemical characteristics of rubella virus ribonucleic acids. Virology 42: 1-8. Hubbard, S.C. and Ivatt, R . J . (1981) Synthesis and processing of asparagine-linked oligosaccharides. Ann. Rev. Biochem. 50: 555. 69  Hurtley, S.M., Bole, D.G., Hoover-Litty, H . , Helenius, A. and Copeland, C.S. (1989) Interactions of raisfolded Influenza virus hemagglutinin with binding protein (BiP). J . Cell Biol. 108: 2117-2126. Inouye, S., Wang., S., Sekizawa, J . , Halegoua, S. and Inouye, M. (1977) Amino acid sequence for the peptide extension on the prolipoprotein of the Escherichia coli outer membrane. Proc. Natl. Acad. Sci. U.S.A. 74: 10041008. Jackson, R.C. and Blobel, G. (1977). Posttranslational cleavage of presecretory proteins with and extract of rough microsomes from dog pancreas containing signal peptidase activity. Proc. Natl. Acad. Sci. U.S.A. 74: 5598-5602. Jamieson, J . and Palade, G. (1967) Intracellular transport of secretory proteins in the pancreatic exocrine c e l l . I. Role of the peripheral elements of the Golgi complex. J . Cell Biol. 34: 577-596. Kalkkinen, N . , Laaksonen, M., Soderlund, H. and Jornvall, H. (1981) Radiosequence analysis of in vivo multilabelled nonstructural protein ns86 of Semliki Forest virus. Virology 113: 188-195. Kalkkinen, N . , Oker-Blom, C. and Petterson, R.F. (1984) Three genes code for rubella virus structural proteins, E l , E2a, E2b, and C. J.Gen. V i r o l . 65: 1549-1557. Kawaoka, Y. and Webster, R.G. (1989) Interplay between the carbohydrate in the stalk and the length of the conecting peptide determines the cleavability of influenza virus hemagglutinin. J . V i r o l . 63: 3996-3400. Kobata, A. (1984) In Biology of Carbohydrates. Vol.2, pp. 87-161. (V. Ginsberg and P.W. Robbins, eds.) Wiley (Interscience), New York. Kondor-Koch, C , Burke, B. and Garoff, H. (1983) Expression of Semliki Forest virus proteins from cloned complementary DNA. I. The fusion activity of the spike glycoprotein. J . Cell Biol. 9 7 : 644-651. Kornfeld, R. and Kornfeld, S. (1980) In The Biochemistry of Glycoproteins and Proteoglycans, pp. 1-34. (W.J. Lennarz, ed.) Plenum Press, New York. Kornfeld, R. and Kornfeld, S. (1985) Assembly of asparagine-linked oligosaccharides. Ann. Rev. Biochem. 54:631-664. Kozutsumi, Y . , Segal, M., Normington, K . , Gething, M.J. and Sambrook, J . (1988) The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose-regulated proteins. Nature (London) 332: 462-464. Kuismanen, E . , Bang, B., Huime, M. and Petterson, R. (1984) Uukuniemi Virus maturation: immunofluorescence microscopy with monoclonal glycoprotein-specific antibodies. J . V i r o l . 51: 137-146. Kunkel, T.A. (1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. U.S.A. 82: 4753-4757.  70  Laemmli, U.K. (1970) Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature (London) 227: 680-685. Levinson, R.S., Strauss, J . H . and Strauss, E.G. (1990) Complete sequence of the genomic RNA of O'Nyong-nyong virus and its use in the construction of alphavirus phylogenetic trees. Virology 175: 110-125. Lingappa, V.R. , Chaidez, J . , Yost, C S . and Hedgpeth, J . (1984) Determinants for protein localization: 6-lactamase signal sequence directs globin across microsomal membranes. Proc. Natl. Acad. Sci. U.S.A. 81: 9498. Lobigs, M. and Garoff, H. (1990) Fusion function of the SFV spike is activated by proteolytic cleavage of the envelope glycoprotein precursor p62. J . V i r o l . 64: 1233-1240. Maniatis, T . , Fritsch, E.F and Sambrook, J . (1982) Molecular Cloning. A laboratory manual. Cold Spring Harbor Laboratory. Mathews, R.E.F. (1982) Classification and nomenclature of viruses. report of the International Committee on Taxonomy of Viruses. Intervirology 17: 1-199.  Third  Melancon, P. and Garoff, H. (1987) Processing of the Semlili Forest virus structural polyprotein: Role of the capsid protease. J . V i r o l . 61: 13011309. Meyer, D . I . , Krause, E. and Dobberstein, B. (1982) Secretory protein translocation across membranes: The role of "docking protein". Nature (London) 297: 647-650. Montreuil, J . (1987) Structure and conformation of glycoprotein glycans. In Vertebrate Lectins, pp.1-26. (K. Olden and J . B . Parent, eds.) Van Nostrand Reinhold, New York. Muller, M . , Ibrahimi, I . , Chang, C . N . , Walter, P. and Blobel, G. (1982) A bacterial secretory protein requires SRP for translocation across the endoplasmic reticulum. J . Biol. Chem. 257: 11860-11863. Nakhasi, H . L . , Meyer, B.C. and Liu, T . - Y . (1986) Rubella virus cDNA. Sequence and expression of El envelope protein. J . Biol. Chem. 261: 1661616621. Nakhasi, H . L . , Thomas, D., Zheng, D. and Liu, T . - Y . (1989) Nucleotide sequence of capsid, E2 and El genes of Rubella virus vaccine strain RA/273. Nucl. Acids Res. 17; 4393-4394. Oker-Blom, C , Kalkkinen, N . , Kaariainen, L. and Pettersson, R.F. (1983) Rubella virus contains one capsid protein and three envelope glycoproteins, E l , E2a, and E2b. J . V i r o l . 46: 964-973. Oker-Blom, C. (1984) the gene order for rubella virus structural proteins is NH2-C-E2-E1-COOH. J . V i r o l . 51: 354-358.  71  Oker-Blom, C , Ulmanen, I . , Kaariainen, L. and Pettersson, R.F. (1984) Rubella virus 40S RNA specifies a 24S subgenomic RNA that codes for a precursor to structural proteins. J . V i r o l . 49: 403-408. Palade, G. (1975) Intracellular aspects of the process of protein secretion. Science 189: 347-358. Palmiter, R.D., Gagnon, J . and Walsh, K.A. (1978). Ovalbumin: A secreted protein without a transient hydrophobic leader sequence. Proc. Natl. Sci. U.S.A. 75: 94-98. Parent, J . P . (1988) Role of carbohydrate in glycoprotein traffic and secretion. In Protein transfer and organelle biogenesis, pp.51-90. (R.C. Das and P.W. Robbins, eds.) Academic Press, San Diego. Perara, E. and Lingappa, V.R. (1988) Transport of proteins across the endoplasmic reticulum membrane. In Protein transfer and organelle biogenesis, p. 3-47. (R.C.Das and P.W. Robbins ed.) Academic Press, San Diego. Perlman, D. and Halvorson, H.O. (1983) A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides. J . Mol. Biol. 167:391-409. Presley, J . F . and Brown, D.T. (1989) The proteolytic cleavag of PE2 to envelope glycoprotein E2 is not s t r i c t l y required for the maturation of Sindbis virus. J . V i r o l . 42: 725-729. Rothman, J . E . and Lodish, H.F. (1977) Synchronized transmembrane insertion and glycosylation of a nascent membrane protein. Nature (London) 269:775780. Rothman, J . (1981) The Golgi apparatus: two organelles in tandem. Science 213: 1212. Rottier, P., Brandenburg, D., Armstrong, J . , Van der Zeijst, B . , Warren, G. (1984) Assembly in vitro of a spanning membrane protein of the endoplasmic reticulum: The El glycoprotein of coronavirus mouse hepatitus virus A59. Proc. Natl. Acad. Sci. U.S.A. 81: 1421-1425. Runge, K.W. (1988) Posttranslational modification during protein secretion. In Protein transfer and organelle biogenesis, p. 159-199. (R.C.Das and P.W. Robbins ed.). Academic Press, San Diego. Sabatini, D.D., Kreibich, G . , Morimoto, T. and Adesnik, M. (1982) Mechanisms for the incorporation of proteins into membranes and organelles. J . Cell Biol. 92: 1-22. Sakanari, J . , Staunton, C . E . , Eakin, A . E . , Craik, C.S. and McKerrow, J . H . (1989) Serine proteases from nematode and protozoan parasites: Isolation of sequence homologs using generic molecular probes. Proc. Natl. Acad. Sci. U.S.A. 86: 4863-4867. Sanger, F . , Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467.  72  Saraste, J . , von Bonsdorff, C . H . , Hashimoto, K., Kaariainen, L. and Keranen, S. (1980) Semliki Forest virus mutants with temperature-sensitive transport defect of envelope proteins. Virology 100: 229. Schmidt, M.F.G. (1983) Fatty acid binding: A new kind of posttranslational modification of membrane proteins. Curr. Topics Microbiol. Immunol. 102: 101. Schlesinger, M.J. and Kaariainen, L. (1980) Translation and processing of alphavirus proteins, pp. 371-392. In The Togaviruses (R.W. Schlesinger, ed.) Academic Press, New York. Shelness, G.S., Kanwar, Y.S. and Blobel, G. (1988) cDNA-derived primary structure of the glycoprotein component of canine microsomal signal peptidase complex. J . Biol. Chem. 263: 17063-17070. Shope, R.E. (1980) Medical significance of togaviruses: an overview of diseases caused by togaviruses in man and in domestic and wild vertebrate animals. Chap. 3. In The Togaviruses (R.W. Schlesinger, ed.) Academic Press, New York. Simmons, D.T. and Strauss, J . H . (1974) Translation of Sindbis virus 26S RNA and 49S RNA in lysates of rabbit reticulocytes. J . Mol. Biol. 86: 397-409. Simon, S.M., Blobel, G. and Zimmerberg, H. (1989) Large aqueous channels in membrane vesicles derived from the rough endoplasmic reticulum of canine pancreas or the plasma membrane of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 86: 6176-6180. Soderlund, H . , Takkinen, K., Jalanko, A. and Kalkkinen, N. (1985) The expression and organization of the alphavirus genome, pp. 323-337. In Viral Messenger RNA (Y. Becker, ed.) Martinus Nijhoff Publishing, Strauss, E. (1978) Mutants of Sindbis Virus. III. Host polypeptides present in purified HR and tsl03 virus particles. J . V i r o l . 28: 466-474. Strauss, J . H . and Strauss, E.G. (1977) Togaviruses. pp. 111-166. In The Molecular Biology of Animal Viruses. Vol I. (D.P. Nayak, ed.) Marcel Dekker, New York. Strauss, E. G . , Rice, C M . and Strauss, J . H . (1984) Complete nucleotide sequence of the genomic RNA of Sindbis virus. Virology 133: 92-110. Strauss, E.G. and Strauss, J . H . (1985) Virus structure and assembly, pp. 206-234. In Assembly of Enveloped Viruses (S. Casjens, ed.) Jones and Bartlett, Boston. Strauss, E.G. and Strauss, J . H . (1986) Structure and replication of the alphavirus genome, pp. 35-90. In The Togaviridae and Flaviviridae. (S. Schlesinger and M.J. Schlesinger, eds.) Plenum Publishing Corp., New York. Strauss, J . H . , Strauss, E . G . , Hahn, C.S., Hahn, Y . S . , Galler, R., Hardy, W.R. and Rice, C M . (1987) Replication of alphaviruses and flaviviruses: Proteolytic processing of polyproteins. pp. 209-225. In Positive Strand RNA Viruses. Alan R. Liss Inc., New York.  73  Takkinen, K. (1986) Complete nucleotide sequence coding for the alphavirus nonstructural genes of Semliki Forest virus. Nucl. Acids Res. 14: 56675682. Tarkatoff, A.M. (1983) Perturbation of vesicular traffic with the carboxylic ionophore monensin. Cell 32: 1026. Vidgren, G . , Takkinen, K . , Kalkkinen, N . , Kaariainen, L. and Pettersson, R.F. (1987) Nucleotide sequence of the genes coding for the membrane glycoproteins El and E2 of rubella virus. J . Gen. V i r o l . 68: 2347-2357. von Heijne, G. and Blomberg, C. (1979) Transmembrane translocation of proteins. The direct transfer model. Eur. J . Biochem. 97: 175-181. von Heijne, G. (1985) Signal sequences: The limits of variation. Biol. 184: 99-105.  J . Mol.  von Heijne, G. (1986) A new method for predicting signal sequence cleavage sites. Nucl. Acids Res. 14: 4683-4691. Walter, P. and Blobel, G. (1980) Purification of a membrane-associated protein complex required for translocation across the endoplasmic reticulum. Proc. Natl. Acad. Sci. U.S.A. 77: 7112-7116. Walter, P. and Blobel, G. (1981) Translocation of proteins across the endoplasmic reticulum III. Signal recognition particle (SRP) causes signal sequence-dependent and site-specific arrest of elongation that is released by microsomal membranes. J . Cell Biol. 91: 557-561. Warren, G. and Dobberstein, M. (1978) Protein transfer across microsomal membranes reassembled from separated membrane components. Nature (London) 273: 569-571. Watts, C , Wickner, W. and Zimmerman, R. (1983) M13 procoat and preimmunoglobulin share processing specificity but use different membrane receptor mechanisms. Proc. Natl. Acad. Sci. U.S.A. 80: 2809-2813. Welch, W.J. and Sefton, B.M. (1979) Two small virus-specific polypeptides are produced during infection with Sindbis virus. J . V i r o l . 29: 1186-1195. Westaway, E.G. (1980) Replication of flaviviruses. pp. 531-581. Togaviruses (R.W. Schlesinger, ed.) Academic Press, New York.  In The  Westaway, E . G . , Brinton, M.A., Gaidamavich, S.Y., Horzinek, M.C., Igarashi, A., Kaariainen, L . , Lvov, D.K., Porterfield, J . S . , Russell, P.K. and Trent, D.W. (1985) Flaviviridae. Intervirology 24: 183-192. White, J . , Kielian, M. and Helenius, A. (1983) Membrane fusions proteins of enveloped animal viruses. Quart. Rev. Biophys. 16: 151-195. Wiedmann, M., Kurzchalia, T . , Hartmann, E. and Rapoport, T.A. ( 1987) A signal sequence receptor in the ER membrane that may be essential for protein translocation. Nature (London) 328: 830-833.  74  Wirth, D . F . , Katz, F . , Small, B., and Lodish, H.F. (1977) How a single Sindbis virus mRNA directed the synthesis of one soluble protein and two integral membrane proteins. Cell 10: 253-263. Wolfe, P.B., Wickner, W. and Goodman, J.M. (1983) Sequence of the leader peptidase gene of Escherichia coli and the orientation of leader peptidase in the bacterial envelope. J . Biol. Chem. 258: 12073-12080. Zheng, D.X., Dickens, L . , Liu, T.-Y. and Nakhasi, H.L. (1989) Nucleotide sequence of the 24S subgenomic messenger RNA of a vaccine strain of rubella virus - Comparison with a wild-type strain (M33). Gene 82: 343-349.  75  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098023/manifest

Comment

Related Items