UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization and cDNA cloning of a novel murine T cell surface antigen YE1/48 Chan, Po-Ying 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A1 C45.pdf [ 14.66MB ]
Metadata
JSON: 831-1.0097974.json
JSON-LD: 831-1.0097974-ld.json
RDF/XML (Pretty): 831-1.0097974-rdf.xml
RDF/JSON: 831-1.0097974-rdf.json
Turtle: 831-1.0097974-turtle.txt
N-Triples: 831-1.0097974-rdf-ntriples.txt
Original Record: 831-1.0097974-source.json
Full Text
831-1.0097974-fulltext.txt
Citation
831-1.0097974.ris

Full Text

CHARACTERIZATION AND cDNA CLONING OF A NOVEL MURINE T CELL SURFACE ANTIGEN TE1/48 BY PO-YING CHAN B.Sc, Simon Fraser University, 1983 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology) Ve accept this thesis as confirming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA October 1988 • Po-Ying Chan, 1988 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 DE-6(3/81i i i ABSTRACT T c e l l surface antigens are thought to play significant roles in immunological functions. They are involved in cel lular interactions and T c e l l activation and proliferation. Characterization of T c e l l antigens is important in understanding the molecular machanisms underlying immune responses. The subject of this thesis is to characterize a novel murine T c e l l surface antigen called YE1/48. YE1/48, defined by two rat monoclonal antibodies YE1/48.10.6 and YE1/32.8.5, is a dimeric glycoprotein with molecular size and charge resembling the murine T c e l l antigen receptor a/0. It was i n i t i a l l y detected at high levels on two T c e l l lymphomas, EL-4 and MBL-2. In my thesis studies, the YE1/48 antigen was characterized biochemically, a cDNA clone was isolated, and i ts expression in lymphoid c e l l populations was determined. The YE1/48 antigen was found to be distinct from the T c e l l receptor based on direct comparisons of their primary sequences as well as immunological analyses. It is l ike ly a homodimer with similar or identical subunits. No homology with any known proteins could be detected, including the human T c e l l activation antigen CD28 (T44) which also has a similar dimeric structure as YE1/48. No function of the YE1/48 antigen could be derived from its primary sequence or with the use of the two monoclonal antibodies because the antibodies do not appear to bind to the surface of intact normal T lymphocytes. Some intriguing characteristics of the YE1/48 antigen were observed in the current studies. The YE1/48 antigen belongs to a rare group of type II membrane proteins with orientation of the amino-terminus inside the c e l l and the carboxy-terminus outside. The YE1/48 gene may have two al le les among different mouse strains and may belong to a multigene family. YE1/48 is expressed at low levels on a wide range of T cel ls with no restr ict ion to i i i their differentiation stages, and on spleen B cells as well as bone marrow ce l l s . Its expression on lymphocytes is not related to activation or prol i ferat ion. However, YE1/48 expression appears to be induced at high levels by Abelson Murine Leukemia Virus-transformation of pre-B ce l l s . Moreover, the epitopes defined by the YE1/48.10.6 and YE1.32.8.5 antibodies seem to be exposed only on three T lymphomas but not on normal T ce l l s . It is thus tantalizing to speculate a correlation of the high level expression of YE1/48 antigen and its epitope exposure on transformed lymphocytes with ce l lular transformation. In summary, YE1/48 was found to be a novel T c e l l surface antigen which has similar dimeric structure as the murine T c e l l receptor a/|3 and human CD28 (T44). It has now been characterized biochemically, molecularly cloned, and i ts expression on lymphoid cel ls has been determined. Although the function of YE1/48 antigen remains unknown, a number of intriguing characteristics observed in the current studies have certainly called for further studies on the antigen and the determination of i ts function. i v TABLE OF CONTENTS Abstract i i L i s t of Tables v L i s t of Figures v i Acknowledgements v i i i L i s t of Abbreviations ix CHAPTER ONE. OVERVIEW: THE T CELL SURFACE ANTIGENS 1 1.1 General Concepts 2 1.2 Interactions Of T Lymphocytes With The Environment 10 1.3 C e l l Surface Antigens Related To Neoplastic Transformation Of Lymphocytes 42 1.4 Thesis Objectives 48 1.5 References 51 CHAPTER TWO. MATERIALS AND METHODS 80 2.1 Sources Of Materials 81 2.2 General Techniques For Biochemical Studies 84 2.3 P u r i f i c a t i o n Of YE1/48 Antigen 90 2.4 P a r t i a l Amino Acid Sequencing 93 2.5 cDNA Cloning 94 2.6 Genetic Analyses Using cDNA Clone 96 2.7 References 98 CHAPTER THREE. EXPRESSION AND BIOCHEMICAL ANALYSES OF A T CELL RECEPTOR a/|3-LIKE MOLECULE, YE1/48 101 3.1 Introduction 102 3.2 Results 103 3.3 Discussion 119 3.4 Summary 125 3.5 References 128 CHAPTER FOUR. COMPARISON OF THE YE1/48 ANTIGEN WITH THE T CELL RECEPTOR a/0 133 4.1 Introduction 134 4.2 Results 136 4.3 Discussion 148 4.4 Summary 152 4.5 References 153 CHAPTER FIVE. ISOLATION OF A cDNA CLONE ENCODING THE YE1/48 ANTIGEN' 157 5.1 Introduction 158 5.2 Results 158 5.3 Discussion 176 5.4 Summary 185 5.5 References 188 CHAPTER SIX. SUMMARY AND PERSPECTIVES 191 L I S T O F T A B L E S TABLE I. The T c e l l receptor/CD3 complexes 11 TABLE I I . Accessory molecules i n T c e l l a c t i v a t i o n 16 TABLE I I I . T c e l l a c t i v a t i o n antigens. 22 TABLE IV. Lymphocyte homing receptors to lymphoid tissues 30 TABLE V. Cytokines and their receptors involved i n T c e l l growth 35 TABLE VI. Surface binding of the YE1/48.10.6 and YE1/32.8.5 MAb's on normal c e l l s and c e l l l i n e s 106 TABLE VII. Immunoprecipitation of the YE1/48 antigen from normal lymphocytes 115 TABLE VIII. Immunoprecipitation of the YE1/48 antigen from lymphoid c e l l l i n e s 117 TABLE IX Amino acid sequences of the YE1/48 t r y p t i c peptides 147 TABLE X. Sequences of the redundant synthetic oligonucleotide probes used i n the i s o l a t i o n of the YEl/48-encoding clone M3-2 159 TABLE XI. T r y p t i c peptide sequences used to corroborate the YE1/48 cDNA clone 163 v i LIST OF FIGURES Figure 1. Flow cytometric analysis of YE1/48 expression on normal lymphoid tissue c e l l s , and EL-4 and MBL2(4.1) c e l l s 105 Figure 2. Immunoprecipitation of the YE1/48 antigen from EL-4 and MBL-2(4.1) c e l l s 107 Figure 3. Two dimensional gel analysis (IEF vs SDS-PAGE) of the YE1/48 antigen 108 Figure 4. T r y p t i c peptide analysis of the YE1/48 subunits from MBL-2(4.1) c e l l s 110 Figure 5. Endoglycosidase F digestion of the YE1/48 antigen from EL-4 c e l l s I l l Figure 6. Immunoprecipitation of the YE1/48 antigen from thymocytes and spleen c e l l s 114 Figure 7. Immunoprecipitation of the YE1/48 antigen from PNA+ and PNA- thymocytes 118 Figure 8. Diagonal gel analysis of the YE1/48 antigen and the T c e l l receptor a/0 from thymocyes 138 Figure 9. Sequential immunoprecipitation of the YE1/48 antigen and the T c e l l receptor a/0 from EL-4 c e l l s 139-140 Figure 10. Comparison of the YE1/48 antigen l e v e l and the T c e l l receptor a/0 expression on two MBL-2 variant clones 142 Figure 11. Assessment of the purity and the y i e l d of the p u r i f i e d YE1/48 antigen 143 Figure 12. Separation of the YE1/48 t r y p t i c peptides by C18 reverse phase HPLC chromatography 146 v i i LIST OF FIGURES (CONT'D) Figure 13. Strategy of DNA sequencing and the nucleotide and deduced amino acid sequences of the cDNA clone M3-2 161-162 Figure 14(a). Genomic Southern analysis showing no rearrangement of the YE1/48 gene 167 Figure 14(b). Genomic Southern analysis showing no amplification of the YE1/48 gene 168 Figure 15. Genomic Southern analysis showing a l l e l i c polymorphism of the YE1/48 gene and possible existence of other related genes 169-170 Figure 16. Northern blot analysis of YE1/48 mRNA in lymphoid c e l l populations 172-173 Figure 17. Northern blot analysis of YE1/48 mRNA in Abelson MuLV-transformed pre-B ce l l lines indicating possible correlation of YE1/48 expression with transformation 175 Figure 18. Detection of the YE1/48 antigen on Abelson MuLV-transformed pre-B c e l l lines by flow cytometric analysis and immunoprecipitation 177-178 v i i i ACKNOWLEDGEMENTS My gratitude to the following people cannot be adequately expressed. Dr. Fumio Takei, my thesis supervisor, introduced me to the sc ient i f ic research in immunology and gave me the privilege to learn and grow in a stimulating intel lectual environment. I would l ike to thank him for his guidance in my research and his patience with my ignorance. My advisory committee members, Drs. R. Keith Humphries, Douglas G. Kilburn, and Ju l ia Levy, have been very thoughtful and supportive throughout the course of my research project. I also thank them for c r i t i c a l reading of my thesis. Dr. Dixie Mager has never hesitated to answer my t i r ing questions. I am grateful for her enthusiasm and encouragement. I also thank Miss Wieslawa Dragowska for excellent assistance in flow cytometry, and Mr. Douglas Freeman for expert advice on DNA sequencing. To a l l the colleagues in the Terry Fox Laboratory, I would l ike to thank them for their friendly interactions. They have made my l i f e in the laboratory a pleasant one. I also thank the Medical Research Council of Canada for their f inancial support of this thesis research, and the Cancer Control Agency of Br i t i sh Columbia for their l ibrary f a c i l i t i e s and preparation of photographic prints . LIST OF ABBREVIATIONS A L L A c u t e l y m p h o b l a s t o i d l e u k e m i a ATL A d u l t T c e l l l e u k e m i a BL B u r k i t t lymphoma bp Base p a i r s BSA B o v i n e serum a l b u m i n CALLA Common a c u t e l y m p h o b l a s t o i d l e u k e m i a a n t i g e n CD C l u s t e r o f d i f f e r e n t i a t i o n ( a n t i g e n ) cDNA Complementary DNA Con A C o n c a n a v a l i n A cpm Counts p e r minute CTL C y t o t o x i c T c e l l EBV E p s t e i n - B a r r v i r u s E G F - R E p i d e r m a l growth f a c t o r r e c e p t o r FcR Fc r e c e p t o r FCS F e t a l c a l f serum F I T C F l u o r e s c e i n i s o t h i o c y a n a t e GaRIg Goat a n t i - r a t i m m u n o g l o b u l i n a n t i s e r u m GPI G l y c o s y l - p h o s p h a t i d y l i n o s i t o l HEBF H i g h e n d o t h e l i a l b i n d i n g f a c t o r H E B F L N P e r i p h e r a l lymph n o d e - s p e c i f i c HEBF HEBFpp P e y e r ' s p a t c h e s - s p e c i f i c HEBF HEPES N-2 - h y d r o x y e t h y l p i p e r a z i n e HEV H i g h e n d o t h e l i a l v e n u l e s H E V L N P e r i p h e r a l lymph n o d e - s p e c i f i c HEV HEVpp P e y e r ' s p a t c h e s - s p e c i f i c HEV H E V S N S y n o v i a l - s p e c i f i c HEV HPLC H i g h p e r f o r m a n c e l i q u i d chromatography H T L V - I Human T l y m p h o c y t e v i r u s type I ICAM -1 I n t e r c e l l u l a r a d h e s i o n mo lecu le-1 I E F I s o e l e c t r i c f o c u s s i n g I FN I n t e r f e r o n I g Immunog lobu l in I L - I n t e r l e u k i n -I n - R I n s u l i n r e c e p t o r kb K i l o b a s e s LFA L y m p h o c y t e - f u n c t i o n - a s s o c i a t e d a n t i g e n LCA L e u k o c y t e common a n t i g e n LGL L a r g e g r a n u l a r l y m p h o c y t e LMP L a t e n t i n f e c t i o n membrane p r o t e i n LPS B a c t e r i a l l i p o p o l y s a c c a r i d e s MAb M o n o c l o n a l a n t i b o d y MAG M y e l i n - a s s o c i a t e d g l y c o p r o t e i n MaRIg Mouse a n t i - r a t i m m u n o g l o b u l i n a n t i s e r u m M a R I g K Mouse a n t i - r a t i m m u n o g l o b u l i n K l i g h t c h a i n a n t i s e r u m 2ME 0 - m e r c a p t o e t h a n o l MHC Major h i s t o c o m p a t i b i l i t y complex M r R e l a t i v e m o l e c u l a r mass mRNA Messenger RNA MuLV Mur ine l e u k e m i a v i r u s MW M o l e c u l a r we ight NBRF N a t i o n a l B i o m e d i c a l R e s e a r c h F o u n d a t i o n NCAM N e u r a l c e l l a d h e s i o n m o l e c u l e NK N a t u r a l k i l l e r c e l l PBS Phospha te b u f f e r e d s a l i n e PDGF-R P l a t e l e t - d e r i v e d growth f a c t o r r e c e p t o r LIST OF ABBREVIATIONS (CONT'D) p f u P l a q u e f o r m i n g u n i t s p i I s o e l e c t r i c p o i n t PNA Peanut a g g l u t i n i n PTH P h e n y l t h i o h y d a n t o i n R R e c e p t o r RaMIg R a b b i t anti-mouse i m m u n o g l o b u l i n a n t i s e r u m RaRIG R a b b i t a n t i - r a t i m m u n o g l o b u l i n a n t i s e r u m rpm R e v o l u t i o n s per minute SDS-PAGE Sodium d o d e c y l s u l p h a t e - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s s i g S u r f a c e i m m u n o g l o b u l i n TAP T c e l l a c t i v a t i n g p r o t e i n TCR T c e l l r e c e p t o r TDL T h o r a c i c duct lymphocytes TFA T r i f l u o r o a c e t i c a c i d TGF-P T r a n s f o r m a t i n g growth f a c t o r - 0 Th T h e l p e r c e l l s u b s e t TL Thymic l e u k e m i a a n t i g e n TNF Tumor n e c r o s i s f a c t o r TSTA T u m o r - s p e c i f i c t r a n s p l a n t a t i o n a n t i g e n Chapter One p. 1 CHAPTER ONE OVERVIEW: THE T CELL SURFACE ANTIGENS 1.1 GENERAL CONCEPTS 1.1.1 The c e l l surface proteins 2 1.1.2 D i f f e r e n t i a t i o n antigens 5 1.1.3 Monoclonal antibodies 6 1.1.4 The T lymphocytes 8 1.2 INTERACTIONS OF T LYMPHOCYTES WITH THE ENVIRONMENT 1.2.1 Molecules involved i n T c e l l a c t i v a t i o n A) T c e l l receptor/CD3 complex 10 B) Accessory molecules 15 C) T c e l l a c t i v a t i o n antigens 21 D) Members of the immunoglobulin superfamily 25 1.2.2 Molecules involved i n T c e l l migration * 27 A) Homing receptors for lymphoid tissues 28 B) Accessory molecules involved i n lymphocyte homing 32 1.2.3 Receptors to soluble regulatory factors 33 A) Cytokines involved i n T c e l l growth 33 B) The interleukin-2 receptor 40 1.3 CELL SURFACE ANTIGENS RELATED TO NEOPLASTIC TRANSFORMATION OF LYMPHOCYTES 42 1.3.1 Murine leukemias/lymphomas 44 1.3.2 Human leukemias/lymphomas 46 1.4 THESIS OBJECTIVES 49 1.5 REFERENCES 51 Chapter One p. 2 In the vertebrate immune system, diverse immunological functions are ini t iated by events at the ce l l surface of lymphocytes. These events include 1) the transmission of positional information by c e l l - c e l l recognition, as in the homing of leukocytes to specific lymph organs; and 2) the triggering of ce l lu lar differentiation and proliferation by recognition of specific cognate antigens and soluble polypeptide factors, as in the maturation of B lymphocytes into antibody-producing plasma cel ls and T lymphocytes into cytolyt ic effectors, and in the clonal expansion of antigen-specific T and B ce l l s . These events are mediated by recognition elements anchored in the plasma membrane which are capable of transducing the external st imuli , either in the form of cell-bound or soluble ligands, into appropriate ce l lu lar responses. This chapter reviews the properties of various recognition proteins on the plasma membrane of T lymphocytes and their roles in e l i c i t i n g immunological functions. 1.1 G E N E R A L C O N C E P T S 1.1.1 The Cel l Surface Proteins The plasma membrane separates cel ls from their environment and from each other. Although i t is relatively permeable to water and small hydrophobic molecules, i t is impermeable to macromolecules and polar molecules. Membrane proteins mediate the active and passive transport of ions and metabolites into and out of the c e l l . In addition, membrane proteins mediate the transfer of information from the exterior of cel ls by f i r s t recognizing the external molecular ligands, then transducing the signal across the c e l l membrane, and f ina l ly in i t ia t ing a response inside the c e l l . Hormones and neurotransmitters are examples of circulating extracellular signals. Ce l l adhesion proteins Chapter One p. 3 such as extracellular matrix proteins and tissue-homing ligands are examples of signals localized on the surface of other ce l l s . To selectively e l i c i t a ce l lular response, the recognition of extracellular signals by the membrane protein receptors must be highly specific and the expression of these receptors must be restricted to the responding ce l l types. Moreover, these receptors must be as diverse as the population of external signals the ce l l s respond to. Very often, the combination of membrane receptors defines the functions and tissue types of the cel ls bearing them (Hood et a l . , 1984). From the few receptor proteins characterized, some general properties can be derived. Most receptor proteins are integral membrane proteins that span the plasma membrane. They have an extracellular recognition domain which speci f ical ly interacts with the external molecular signal. The interaction l ike ly depends on the complementarity of the binding sites on the receptor and ligand pair. It can occur between identical receptors on two different ce l l s . An example of such homophilic interactions is the interaction of nerve ce l l s via neural c e l l adhesion molecules (NCAM) (Hoffman et a l . , 1983). The complementary interaction can also be heterophilic and occurs between two different molecules. The interaction of hormones and growth factors with their receptors are well known examples. In addition, heterophilic interactions can involve two cells bearing different receptors with complementary binding sites. Examples are the antigen receptor on T lymphocytes recognizing foreign antigen in association with the major histocompatibility complex (MHC) antigen on antigen-presenting cel ls (Marrack and Kappler, 1986), and the lymphocyte-function-associated antigen 1 (LFA-1) on leukocytes interacting with the intercel lular adhesion molecule 1 (ICAM-1) on various tissue cel ls (Marlin and Springer, 1987; Makgoba et a l . , 1988). A special case of heterophilic interaction may involve identical receptors that recognize the same multivalent linker macromolecule. Fibronectin, a large extracellular matrix protein, is an example of linker molecules (Hynes, 1986). Chapter One p. 4 Upon interaction with the recognition domain, the external binding signal is transduced across the plasma membrane, which may involve conformational changes in a transducer domain or ligand-mediated aggregation of identical membrane receptors (Carpenter, 1987). These changes can in turn stimulate a number of intracel lular effector pathways via some functional sites in the cytoplasmic domain of the receptor. In some cases where the cytoplasmic domain is very small, the signal may be transduced to another membrane protein or membrane-associated cytosolic protein which is capable of in i t i a t ing the ce l lular response. A putative example is the T c e l l antigen receptor (TCR), which induces T ce l l activation mediated by a non-covalently associated integral membrane protein CD3 (CD = cluster of differentiation) (Brenner et a l . , 1985; Oettgen et a l . , 1985). Intracellular effector pathways may include 1) the reorganization of the cytoskeletal elements to modify c e l l movement, 2) the activation of nucleotide cyclases to produce second messengers such as cycl ic AMP (cAMP) or cycl ic GMP (cGMP) which in turn modulate the act iv i t i es of other enzymatic or regulatory proteins, 3) the activation of enzymatic properties inherent to the receptor molecules, such as tyrosine kinase act iv i t ies in many polypeptide growth factor receptors, and 4) the opening or closing of specific ion gates and the activation or deactivation of specif ic ionic pumps to change the intracel lular ionic environment or ionic potential . Another group of membrane proteins capable of external ligand recognition and signal transduction are proteins anchored to the plasma membrane via a glycosyl-phosphatidylinositol (GPI) moiety (Ferguson and Williams, 1988; Low and S a l t i e l , 1988). These receptors lack a transmembrane polypeptide domain. The carboxyl(C)-terminus is covalently linked to ethanolamine at the glycosyl-end of GPI by an amide bond whereas the fatty acid residue at the phosphatidylinositol-end is embedded into the plasma membrane l i p i d bi layer. The GPI anchorage allows a higher lateral diffusion mobility of the membrane proteins than the conventional polypeptide-anchored integral proteins do Chapter One p. 5 (Ishihara et a l . , 1987) and, at least in v i tro , allows receptor removal from the c e l l surface upon cleavage by GPI-specific phospholipase C. Examples of GPI-anchored proteins capable of e l i c i t i n g signal transduction include Thy-1 antigen on murine T lymphocytes (Gunter et a l . , 1984; Low and Kincade, 1985; Tse et a l . , 1985; Kroczek et a l . , 1986), Ly-6-related T c e l l activating protein (TAP) on mature murine T lymphocytes (Reiser et a l . , 1986a, 1986b; Rock et a l . , 1986), and lymphocyte-function-associated antigen 3 (LFA-3) on human thymic epithel ia l cel ls and monocytes (Krensky et a l . , 1983; Dustin et a l . , 1987b; Le et a l . , 1987). Thy-1 and TAP are involved in T lymphocyte activation whereas LFA-3 can induce cytokine production in thymic epi the l ia l ce l ls and monocytes in vitro (Le et a l . , 1987). Their mechanisms of signal transduction are unknown. The association of these GPI-anchored proteins with other membrane proteins has not been described. In Thy-1 and TAP-mediated responses, cross-linking of the antigens and the expression of T c e l l antigen receptor (TCR) on the c e l l surface are prerequisites for their ac t iv i t i es (Yeh et a l . , 1986a; Gunter et a l . , 1987; Schmitt-Verhulst et a l . , 1987). 1.1.2 Differentiation Antigens The diverse c e l l types with unique biochemical and morphological characteristics of a multicellular organism are the result of c e l l differentiat ion. Ce l l differentiation is the manifestation of qualitative and quantitative changes in gene expression, in a developmentally programmed manner as well as in response to extracellular signals. The eff icient functioning of the organism depends on the coordinate interaction of these ce l l s specialized for different tasks. The modification of c e l l surface antigens during differentiation has been known for decades. They are designated "differentiation antigens" because they define stages of differentiat ion. Many of them are thought to perform functions relevant to Chapter One p. 6 the external signals in the microenvironment even though their functions are not yet well characterized. The term "cell differentiation" is sometimes used to refer to the irreversible specialization of ce l l s . This may imply loss of genetic materials, gene translocation, or irreversible changes in gene regulatory mechanisms. It is becoming clear that, in many cases, c e l l differentiation is reversible as the pattern of gene expression, at least in v i tro , can be modified in response to environmental stimuli or by a disruption of the regulatory c ircuits between nucleus and cytoplasm (Nover, 1980; Blau et a l . , 1985). For instance, some neoplastic cel ls express oncofetal antigens that are normally only expressed during certain stages of embryogenesis (Shively, 1985). Similarly, the term "differentiation antigens" is often used to refer to protein markers of different ce l l lineages or specialized differentiated c e l l types, but recent studies have revealed that many of these antigens are shared by different ce l l types or subsets. This distribution of differentiation antigens among different ce l l populations is apprehensible considering that c e l l differentiation is a coordinate response to multiple external stimuli and involves complicated functional pathways. Some of these external stimuli are shared in different differentiation microenvironments. Thus, i t is the coordinate expression of differentiation antigens that determines the differentiation pathways and specialization of ce l l s . 1.1.3 Monoclonal Antibodies Monoclonal antibodies (MAb's) have been a basic tool in the identif ication and studies of c e l l surface antigens. They are derived from antibody-producing hybridomas devised by Kohler and Milstein (1975). The hybridomas are generated by fusion of a myeloma ce l l l ine with spleen cel ls from an animal, mouse or rat, which has been immunized with the antigen or Chapter One p. 7 cel ls expressing the antigen of interest. The fusion hybrids are immortal and they secrete antibodies characteristic of the parental antibody-secreting spleen B lymphocytes. Thus, the antibody secreted by each hybridoma is monoclonal in origin as i t is the product of a single immunoglobulin (Ig) gene rearrangement. It has the property of monospecific recognition of an antigenic determinant (epitope) on the immunizing antigen, in contrast to the polyclonal antiserum which carries antibodies of mult ispecif ic i t ies . However, two types of irrelevant cross-reactivities of MAb's are sometimes observed (Yelton et a l . , 1980). The f irs t type of cross-reactivity, in tr ins ic to any single antibody, refers to the same antibody binding site recognizing similar epitopes on more than one molecular species. The second type is due to antibody heterogeneity in the hybridoma culture supernatant. Other than the MAb derived from the parental spleen c e l l , the culture supernatant contains covalently-linked hybrid antibody molecules carrying either the l ight or heavy Ig polypeptide derived from the parental myeloma, depending on the variant myeloma l ine used. These multispecific recognition properties usually do not present serious problems in the identification of new surface antigens. In addition to the high precision recognition specif ic i ty of MAb's, hybridoma technology has also provided an unlimited supply of antibodies. Hybridomas secrete 10-50 ug MAb per ml of culture supernatant, and upon injection into the peritoneal cavity of mice, can produce up to 1-10 mg MAb per ml of ascites f luid (Kohler, 1986). With these two advantages, MAb's have been replacing conventional polyclonal antisera. They have proven to be extremely useful in identifying antigens on bacteria, viruses, cel ls and antigenic determinants on other biological materials. They are powerful tools in the definition and separation of c e l l subpopulations, in the discrimination of different stages in ontogeny, in the purification of antigens for structural characterization, and in the studies of functions of c e l l surface antigens by mimicking their natural ligands and promoting antigen cross-Chapter One p. 8 linkage. Recently, they have also been used in the targeting of drugs or toxins to the cel ls bearing particular c e l l surface antigens for therapeutic purposes. 1.1.4 The T Lymphocytes Thymus-dependent lymphocytes (T lymphocytes) are derived from hemopoietic stem cel ls in the bone marrow. T lymphocyte precursors enter the thymus where they differentiate and mature into immunocompetent cel ls capable of responding to foreign antigens. Upon completion of their intrathymic maturation, mature virgin T cel ls migrate from the thymus and form the peripheral pool of T lymphocytes. They recirculate via the blood stream and lymph between the body tissues and various peripheral lymph nodes which drain foreign antigens such as viruses and bacteria from the lymph circulat ion. It is in the lymph nodes that immune responses are usually in i t iated. Foreign antigens are rapidly phagocytosed, processed and presented by macrophages which are abundant at the sites of entry in the nodes. Upon encountering cognate antigens on the macrophages, the antigen-specific T lymphocytes become activated. They proliferate and differentiate into mature functional T ce l l s . Some activated T lymphocytes interact with B lymphocytes which also recirculate through the lymph nodes, and they in i t ia te a T cell-dependent humoral response by inducing B c e l l prol i feration and differentiation into antibody-secreting plasma ce l l s . The mature T cel ls eventually reenter the general c irculat ion. The shuffling of T lymphocytes through the lymph nodes allows the f u l l repertoire of lymphocyte speci f ic i t ies to be available throughout the body while also fac i l i t a t ing the c e l l - c e l l interactions necessary for the generation and regulation of T cell-dependent immune responses. T lymphocytes mediate two general types of immunological functions: effector and regulatory. Effector functions include the induction of Chapter One p. 9 cytotoxicity for allografts carrying foreign transplantation antigens (alloantigens), virus-infected cells and some tumor ce l l s , and the induction of delayed hypersensitivity against virus- or microorganism-infected cel ls by lymphokine-mediated activation of macrophages. The regulatory functions refer to the capability of T lymphocytes to cooperate with B lymphocytes in the stimulation of the latter to proliferate and differentiate into antibody-secreting plasma ce l l s , and also to their capability to induce the stimulation of other T ce l l s . Some of these effector and regulatory functions are dependent on the direct c e l l - c e l l interactions of T lymphocytes with other ce l l s l ike antigen-presenting accessory ce l l s , B lymphocytes, and target ce l l s . Some other functions, on the other hand, rely on the secretion of lymphokines from activated T lymphocytes to enhance the cytolytic act iv i ty of macrophages, as well as to promote the proliferation and differentiation of B ce l l s and other T ce l l s . Another mode of immunoregulation by T lymphocytes is the modulation of T ce l l functions in a negative manner by active suppressive influences. The diverse T c e l l functions had long suggested that T cel ls consist of specialized subpopulations. T ce l l heterogeneity was well appreciated about two decades ago by the identification of differentiation antigens on the surface of murine T cel ls using alloantisera and xenoantisera. Lyt-1, Lyt-2 and Lyt-3 are among the f i r s t surface antigens described. It was subsequently found that T cel ls with "helper" functions ( i . e . cooperation with B ce l l s ) and "inducer" functions ( i . e . secretion of lymphokines) express high levels of Lyt-1 antigen, whereas T cells with "cytotoxic" functions and "suppressor" functions and their precursors express Lyt-2 and Lyt-3. These differentiation antigens have been useful markers for the separation of T c e l l subpopulatons with dist inct functional potentials. The identification of many more differentiation antigens have accelerated since the advent of MAb technology. With the high specif ic i ty of MAb react ivi t ies , many differentiation antigens Chapter One p. 10 have been found to be important mediators of lymphocyte c e l l - c e l l interactions and receptors for soluble regulatory factors. Perturbations of these antigens (such as cross-linking) by MAb's on the c e l l surface induce enhancing or inhibitory effects on specific T ce l l functions and have given insight into the biological processes in which the antigens participate. However, in many cases, the precise functions of these surface antigens remain obscure. In the following section (1.2) of this chapter, selected c e l l surface antigens important in T c e l l activation, migration, and response to soluble regulatory factors are reviewed. 1.2 INTERACTIONS OF T LYMPHOCYTES WITH THE ENVIRONMENT 1.2.1 Molecules Involved In T Cel l Activation A) The T Cel l Receptor/CD3 Complex T lymphocytes are activated upon recognition of foreign antigens in the context of autologous major histocompatibility complex (MHC) antigens on the surface of antigen-presenting ce l l s , or upon recognition of alloantigens on target ce l l s . Antigen/MHC corecognition is mediated by the clonotypic T c e l l antigen receptor (TCR) (for reviews, see Reinherz et a l . , 1984; Al l i son et a l . , 1984). Two categories of TCR have been identified (see Table I ) . TCR-a/p (Haskins et a l . , 1983; Kappler et a l . , 1983b; Marrack et a l . , 1983a, 1983b; Meuer et a l . , 1983; Kaye and Janeway, 1984) is expressed on helper/inducer T ce l l s , cytotoxic T cel ls (CTL) and some suppressor T cel ls (Bensussan et a l . , 1984; Yoshikai et a l . , 1984; Hedrick et a l . , 1985; Kronenberg et a l . , 1985; Modlin et a l . , 1987). It consists of two disulphide-linked glycoproteins with variable and constant domains encoded by genes that rearrange specif ical ly in T cel ls (Acuto et a l . , 1983; Kappler et a l . , 1983a; Mclntyre and Al l i son , 1983; Chien et a l . , 1984; Hedrick et a l . , 1984; Saito et Chapter One p. 11 TABLE I THE T CELL RECEPTOR/CD3 COMPLEXES Antigen Mr Mouse Human Dist r i b u t i o n s Functions TCR-a/e a 45-50K 49K 0 45-50K 43K (Disulphide-linked) Most mature T c e l l s Recognition of antigens in the context of MHC TCR-y/S Y 35K 45K CD3+a/P~ T c e l l s ; Ligand unknown; 5 45K 43K Thy-1 + d e n d r i t i c may recognize MHC (Disulphide- linked epidermal c e l l s ; determinants or unlinked) CD3+ LGL's CD3 Y 21K 25K Most T c e l l s ; Possible s i g n a l 8 26K 20K Some NK c e l l s transduction upon e 25K 20K perturbation of TCR C 2xl6K 2xl6K and T C R - Y / S p21 21K Chapter One p. 12 a l . , 1984a, 1984b; Siu et a l . , 1984; Yanagl et a l . , 1984). The a and P gene rearrangements are the basis of the diverse repertoire of antigen recognition spec i f ic i t ies in T ce l l s , as analogous to that derived by the immunoglobulin (Ig) gene rearrangements in B lymphocytes. In mouse, the a and P subunits have similar relative molecular mass (Mr) of 45-50,000, whereas in human, the a subunit is 49,000 M r and the P subunit is 43,000 M r . The a subunits are more acidic than the P subunits. The a/p heterodimer is non-covalently associated with the CD3 protein complex (Reinherz et a l . , 1982; Meuer et a l . , 1983; Reinherz et a l . , 1983a; Kaye and Janeway, 1984; Weiss and Stobo, 1984; Brenner et a l . , 1985) consisting of several invariant subunits, Y(21,000 M r in mouse and 25,000 M r in human), 6(26,000 M r in mouse and 20,000 M r in human), e(25,000 M r in mouse and 20,000 M r in human), p21(21,000 M r in mouse only) and C(homodimer of 16,000 M r chains in both mouse and human) (Borst et a l . , 1983a, 1983b; Samelson et a l . , 1985a; Oettgen et a l . , 1986; Weissman et a l . , 1986). Expression of the a/p dimer requires a coexpression of CD3 molecules on the c e l l surface (Weiss and Stobo, 1984; Saito et a l . , 1987). Perturbations of the a/p/CD3 complex by antigen/MHC, alloantigens, or MAb's result in a cascade of early metabolic events that lead to T c e l l activation. The primary metabolic events largely stem from an increase in intracel lu lar Ca^ + , and the enhancement of the turnover of phosphoinositides mediated by guanine nucleotide binding regulatory proteins (G proteins) and phosphatidylinositol-specific phospholipase C, which leads to the activation of protein kinase C (Imboden and Stobo, 1985a; Imboden et a l . , 1985b; Nisbet-Brown et a l . , 1985; Gray et a l . , 1987; Imboden et a l . , 1987; Kuno and Gardner, 1987; Mustelin, 1987; Pecht et a l . , 1987; Treves et a l . , 1987; Imboden, 1988). Since the cytoplasmic ta i l s of the TCR-a/p polypeptides are very short and the CD3 subunits contain longer intracel lular domains (van de Elsen et a l . , 1984; van de Elsen et a l . , 1985; Rabbitts et a l . , 1985; Gold et a l . , 1986; Krissansen et a l . , 1986; Haser et a l . , 1987; Weissmen et a l . , 1988), i t is Chapter One p. 13 thought that CD3 mediates signal transduction upon antigen/MHC or alloantigen recognition by the a/p dimer. However, none of the CD3 genes cloned so far contains kinase domains or GTP binding sites. Some CD3 polypeptides are phosphorylated upon mitogenic stimulation which appears to mediate the down-regulation of the a/p7CD3 complex (Cantrell et a l . , 1985; Samelson et a l . , 1985b; Oettgen et a l . , 1986; Samelson et a l . , 1986b; Cantrell et a l . , 1987; Samelson et a l . , 1987). In abnormal lymphocytes of autoimmune mice (gld and l p r ) , constitutive tyrosine phosphorylation of the CD3-p21 subuit may be related to the decreased efficacy in signal transduction via a/p/CD3 (Samelson et a l . , 1986a). Since isolated a/pVCD3 complex does not have any kinase act iv i ty , a yet unknown kinase component may be involved in signal transduction. The other TCR, y/S heterodimer, has recently been identified on <%/0~CD3+ immature thymocytes and peripheral T lymphocytes largely of CD4~CD8~ phenotype (Moingeon et a l . , 1986; Lew et a l . , 1986; Borst et a l . , 1987; Brenner et a l . , 1987; Ioannides et a l . , 1987; Moingeon et a l . , 1987; Nakanishi et a l . , 1987), on Thy-1+CD3+CD4~CD8~ dendritic epidermal cel ls (Koning et a l . , 1987), as well as CD3+ large granular lymphocytes (LGL's) displaying natural k i l l e r (NK) act iv i t ies (Ang et a l . , 1987; Colamonici et a l . , 1988). Recently, using MAb's reactive with the native y/i> dimer, T C R - Y / S is also detected on a small subset of human CD4~CD8+ peripheral blood T cells (Jitsukawa et a l . , 1987; Borst et a l . , 1988). Like TCR-a/0, the y (35,000 M r in mouse and 45,000 M r in human) and the 5 (45,000 M r in mouse and 43,000 M r in human) subunits are variant glycoproteins encoded by rearranged variable and constant genes (Saito et a l . , 1984a, 1984b; Lefranc and Rabbits, 1985; Murre et a l . , 1985). The y/S heterodimers occur in disulphide-linked and unlinked forms depending on the y constant region gene used (Krangel et a l . , 1987; Lanier et a l . , 1987; Littman et a l . , 1987b; Pardoll et a l . , 1987). The y/5 dimer is non-covalently associated with CD3 proteins and is functional, as anti-CD3 or anti-y MAb's Chapter One p. 14 stimulate an increase in intracel lular Ca^ + via the phosphatidylinositol pathway, induce the production of interleukin-2 (IL-2) in C D 3 + Y / S + thymocytes and peripheral lymphocytes, and stimulate or inhibit MHC non-restricted NK-l ike act iv i ty in CD3 +y/& + clones derived from peripheral blood lymphocytes (Borst et a l . , 1987; Brenner et a l . , 1987; Ferrini et a l . , 1987; Moingeon et a l . , 1987; Pantaleo et a l . , 1987a; Colamonici et a l . , 1988; Faure and Anderson, 1988; Marusic-Galesic et a l . , 1988). The MHC non-restricted cytotoxicity of the TCR-y/6 dimer appears to be induced by IL-2 in the culture as i t is lost upon factor depletion, similar to that observed in some TCR-a/0 + clones (van de Griend et a l . , 1984; Phi l l ips et a l . , 1987; Borst et a l . , 1988). The dimer therefore is probably not involved in target c e l l recognition in such MHC non-restricted cytotoxicity. The nature of their physiological ligands has not been defined yet, although i t has recently been shown that MHC molecules may be the ligand for TCR-y/8 (Matis et a l . , 1987). In vi tro studies of helper/inducer T ce l l clones and CTL clones have revealed that at least two signals are required to induce T c e l l activation via TCR-a/0: 1) perturbation of the a/p/CD3 complex by antigen or MAb, in a manner that cross-linkage of the a/0/CD3 complex is induced by MAb coupled to sepharose beads, or by the presence of accessory cel ls capable of interacting with MAb through their surface Fc receptor (FcR); 2) influences from accessory ce l l s such as the secretion of interleukin-1 (IL-1) (Kaye et a l . , 1983; Meuer et a l . , 1984a; Hara and Fu, 1985a; Schwab et a l . , 1985; Williams et a l . , 1985). Signal (1) is generally referred as the primary signal and signal (2) as the secondary signal. These signals can be replaced by calcium ionophores and phorbol esters which activate cytosolic protein kinase C (Truneh et a l . , 1985), as well as by lectins such as concanavalin A (Con A) and phytohaemagglutinin (PHA) which probably cross-link various surface glycoproteins involved in T ce l l activation by binding to their carbohydrate side chains (Taylor et a l . , 1984; Gelfand et a l . , 1985; Leca et a l . , 1986). Chapter One p. 15 Two steps can be distinguished and dissociated in the activation of T ce l l s . The f i r s t step induces the expression of Ia (MHC class II) antigens and the receptor for interleukin-2 (IL-2R). The second step drives these activated cel ls into autocrine proliferation by stimulating IL-2 secretion (Cantrell and Smith, 1984; Klaus and Hawrylowicz, 1984). The molecular events following the binding of IL-2 to IL-2R are described in section 1.2.3 B. B) Accessory Molecules Although the interaction of TCR-a/p dimers with antigen/MHC or alloantigens alone can trigger the in i t ia t ion of an antigen-specific T c e l l immune response, several "accessory molecules" on T cel ls are found to participate in this reaction by enhancing the conjugate formation between T cel ls and antigen-presenting cel ls or target ce l l s . They include CD4 (also known as L3T4 in mouse and T4 in human), CD8 (also known as Lyt-2/Lyt-3 in mouse and T8 in human), LFA-1 (also known as CDlla), and CD2 (also known as LFA-2, T i l and sheep erythrocyte receptor) (see Table II) . They a l l have adhesive properties for complementary surface structures on the antigen-presenting cel ls or target ce l l s . The expression of CD4 and CD8 is mutually exclusive on mature resting T lymphocytes such that CD4 is expressed on MHC class II-restricted cel ls and CD8 on class I-restricted cel ls (Meuer et a l . , 1982; Swain, 1983). It is thought that CD4 and CD8 antigens interact with the MHC class II and class I molecules respectively on antigen-presenting cel ls and target cel ls (Biddison et a l . , 1982; Demic et a l . , 1987; Doyle and Strominger, 1987; Gabert et a l . , 1987; Gay et a l . , 1987; Ratnofsky et a l . , 1987). CD4 is a 52,000 M r glycoprotein found on MHC class II-restricted helper/inducer T cel ls and suppressor inducer T cel ls (Reinherz et a l . , 1979a; Ledbetter et a l . , 1981a; Dialynas et a l . , 1983). It is also expressed on brain ce l l s , macrophages (in rat and human but not in mouse), neutrophils and lymphoblastoid B c e l l lines Chapter One p. 16 TABLE II ACCESSORY MOLECULES IN T CELL ACTIVATION Antigen M r Distribution Functions CD4 52K Most helper/inducer and suppressor inducer T cel ls Recognition of MHC II determinants CD8 (Murine) (Human) a 34K 2x32K a' 38K 0 30K (Disulphide-linked dimers and multimers) Most cytotoxic and suppressor T cells Recognition of MHC I determinants LFA-1 a 180K f3 95K (Non-covalently linked dimer A l l leukocytes; some other hemopoietic cel ls Conjugate formation and antigen-independent cel lular interactions; ICAM-1 is a LFA-1 ligand CD2 50K A l l thymocytes; peripheral T cel ls ; some LGL's Antigen-independent interactions between cytotoxic T cel ls and target cel ls as well as antigen-presenting ce l l s ; also rosetting of sheep erythrocytes; LFA-3 is the CD2 ligand Chapter One p. 17 (Crocker et a l . , 1987; Littman, 1987a). CD8 is expressed mostly on MHC class I-restricted T cel ls with cytotoxic or suppressor act iv i t ies (Reinherz et a l . , 1979a). It is a family of disulphide-linked heterodimers in mouse composed of a (34,000 M r ) , a' (38,000 M r ) , and 0 (30,000 Mr) glycopolypeptide subunits (Ledbetter et a l . , 1981b; Walker et a l . , 1984). Both a and a' polypeptides, which differ in the length of their cytoplasmic ta i l s , are Lyt-2 gene products derived by di f ferent ia l mRNA splicing (Zamoyska et a l . , 1985). The 3 polypeptide is encoded by the Lyt-3 gene closely linked to Lyt-2 (Gorman et a l . , 1988) on the chromosome. Three dimeric combinations of a/|3, a ' / 0 and a/a' have been detected. Multimeric forms such as tetramers and hexamers have also been described on thymocytes (Ledbetter et a l . , 1981b). On peripheral T cel ls and some T lymphomas, a small fraction of CD8 exists as a/a homodimers (Nakauchi et a l . , 1985). In human, CD8 is a disulphide-linked homodimer of two 32,000 M r glycopolypeptides. It has also been found to be disulphide-linked to CD1 (MHC class I - l ike molecule of 43-49,000 M r) on thymocytes (Snow et a l . , 1983; Snow et a l . , 1985). LFA-1 is a non-disulphide-linked dimer of a (180,000 M r) and 0 (95,000 M r) glycoprotein subunits. It is c lassif ied as a member of the integrin family because of high sequence homology and structural s imi lar i t i e s . The integrins are c e l l surface integral proteins with adhesive properties to extracellular matrix substrates and other ce l l surface components (Hynes, 1987). They constitute a versatile recognition system providing cel ls with anchorage, traction for migration, and signals for polarity, position, differentiat ion, and possibly growth (Rouslathti and Pierschbacher, 1987). Integrins that bind to extracellular matrix include fibronectin receptor and vitronectin receptor on various ce l l types, and Glycoprotein I lb/IIIa on platelets . LFA-1, Mac-1 and pl50,95 on leukocytes are a subfamily of integrins that bind to specific c e l l surface components. They share the 3 subunit which contains several tandem repeats of high cysteine content in the Chapter One p. 18 e x t r a c e l l u l a r domain (Kishimoto et a l . , 1987b; Law et a l . , 1987). Their a subunits are homologous to each other but not to the 0 subunit, and contain a Ca^+/Mg2+ binding s i t e as well as an add i t i o n a l sequence not found i n other i n t e g r i n members (Corbi et a l . , 1987; Corbi et a l . , 1988). LFA-1 i s widely d i s t r i b u t e d on a l l leukocytes. It mediates conjugate formation and antigen-independent c e l l u l a r interactions (reviewed i n Springer et a l . , 1987). Mac-1 and pl50,95 are expressed on monocytes, macrophages and granulocytes which have been indicated i n various adhesive c e l l u l a r i n t e r a c t i o n s . They are important i n promoting adhesiveness to endothelial c e l l s at s i t e s of inflammation (reviewed i n Anderson and Springer, 1987). They also function as receptors to the C3bi fragment of complement. Leukocyte adhesion de f i c i e n c y i s a h e r i t a b l e disease caused by genetic defects i n the common 0 subunit shared by LFA-1, Mac-1 and pl50,95, and i s characterized by recurrent b a c t e r i a l i n f e c t i o n s and impaired wound healing (Anderson and Springer, 1987; Kishimoto et a l . , 1987a), implicating the importance of these molecules i n immune responses i n vivo. The i n t e r c e l l u l a r adhesion molecule-1 (ICAM-1, 90,000 Mr) has recently been i d e n t i f i e d as a LFA-1 ligand on a va r i e t y of human tissue c e l l s (Marlin and Springer, 1987; Boyd et a l . , 1988; Makogoba et a l . , 1988). I t s sequence i s highly homologous to NCAM and myelin associated glycoprotein (MAG) which are i n t e r c e l l u l a r adhesive molecules i n the nervous system (Simmons et a l . , 1988; Stauton et a l . , 1988). The expression of ICAM-1 i s strongest upon c e l l u l a r stimulation by inflammatory mediators l i k e gamma-inte r f e r o n (IFN-y) (Dustin et a l . , 1986; Dustin et a l . , 1988). The in t e r a c t i o n of LFA-1 and ICAM-1 i s an active process requiring incubation at 37°C i n the presence of Mg^ + (Marlin and Springer, 1987; Makogoba et a l . , 1988). However, since anti-ICAM-1 does not i n h i b i t a l l LFA-l-mediated adhesions (Rothlein et a l . , 1986), other LFA-1 ligands l i k e l y e x i s t and remain to be i d e n t i f i e d . The a l t e r n a t i v e LFA-1 ligands may provide di s c r i m i n a t i o n of the LFA-1 interactions with d i f f e r e n t c e l l types. Chapter One p. 19 CD2 i s a 50,000 Mr glycoprotein which was i n i t i a l l y i d e n t i f i e d as a receptor mediating the s p e c i f i c r osetting of sheep erythrocytes around human T lymphocytes (Kamoun et a l . , 1981). It i s expressed on a l l thymocytes, peripheral T lymphocytes, and some LGL's with NK a c t i v i t y (Krensky et a l . , 1983). CD2 s p e c i f i c a l l y binds to the LFA-3 antigen which i s widely expressed on most hemopoietic c e l l s including erythrocytes, and on thymic epithelium as well as f i b r o b l a s t s (Krensky et a l . , 1983; Dustin et a l . , 1987a, Plunkett et a l . , 1987; Selvaraj et a l . , 1987; Takai et a l . , 1987). Recent studies using human CTL clones and appropriate target c e l l s have shown that antigen-independent conjugate formation may occur concurrently with or precede antigen recognition, thus providing a s t a b i l i z i n g environment to enhance the i n t e r a c t i o n between the TCR-a/p dimer and the alloantigen (Shaw et a l . , 1986; Spits et a l . , 1986). This phenomenon probably occurs i n helper/inducer T c e l l s as well. Addition of MAb's against any of the accessory molecules mentioned above can p a r t i a l l y i n h i b i t TCR-a/0-mediated T c e l l a c t i v a t i o n (Golde et a l . , 1985; Hoffman et a l . , 1985; Shaw et a l . , 1986; Geppert and Lipsky, 1987; Leo et a l . , 1987b). For each accessory molecule, the l e v e l of i n h i b i t i o n of a c t i v a t i o n by MAb's i s inversely correlated to the a f f i n i t y of the TCR-a/p dimer for the antigen/MHC or alloantigen (MacDonald et a l . , 1982; Marrack et a l . , 1983a; Reinherz et a l . , 1983b; Golde et a l . , 1986). In addition to promoting the i n t e r a c t i o n of TCR-a/p with antigen, CD4 and CD8 are also involved in antigen-mediated T c e l l a c t i v a t i o n . In v i t r o studies have shown that the cross-linkage of TCR-a/p7CD3 complex to CD4 or CD8, using heteroantibodies or second antibodies, appears to d e l i v e r an antigen-independent a c t i v a t i o n s i g n a l that synergizes with the s i g n a l triggered by anti-TCR-a/p7CD3 alone (Emmrich et a l . , 1986; Anderson et a l . , 1987; Ledbetter et a l . , 1987; Owens et a l . , 1987). The cross-linkage phenomenon can be considered analogous to the simultaneous binding of TCR-a/P and CD4 or CD8 to antigen/MHC epitopes during antigen-mediated T c e l l a c t i v a t i o n (Kupfer et a l . , Chapter One p. 20 1987; Takada and Engelman, 1987; Weyland et a l . , 1987). However, under other experimental conditions, perturbations of CD4 and CD8 may d e l i v e r negative signals i n h i b i t i n g T c e l l a c t i v a t i o n (Band and Chess, 1985; Wassmer et a l . , 1985). Their exact roles i n c e l l u l a r a c t i v a t i o n remain to be f u l l y elucidated. Like CD4 and CD8, some MAb's to CD2 can synergize with anti-TCR-a /0/CD3 to induce T c e l l responses (Yang et a l . , 1986, 1988). In these experiments, anti-CD2 and anti - a / 0/CD3 can be used with or without promoting cross-linkage of the two MAb molecules. When anti-CD2 i s used without anti - a / 0/CD3, combinations of two anti-CD2 MAb's, one of which i s reactive with a neo-epitope induced by binding of the other MAb, are generally needed. The MAb combinations can induce both T helper a c t i v i t y for antibody response and antigen-independent k i l l i n g by CTL clones (Meuer et a l . , 1984b; B r o t t i e r et a l . , 1985; S i l i c i a n o et a l . , 1985). Perturbation of CD2 by MAb's induces an increase i n i n t r a c e l l u l a r Ca^+ (Alcover et a l . , 1986; O'Flynn et a l . , 1986) and stimulates the phosphatidylinositol pathway (Pantaleo et a l . , 1987b). In transf e c t i o n studies, the in t e r a c t i o n of CD2 with i t s natural ligand LFA-3 on antigen-presenting c e l l s can s i g n i f i c a n t l y enhance the antigen-dependent response (Bierer et a l . , 1988). In contrast, antigen-independent, CD2- and LFA-3-dependent conjugation between CTL's and target c e l l s does not r e s u l t i n increased Ca^+ l e v e l s . Therefore, the CD2 and LFA-3 i n t e r a c t i o n appears to merely enhance the a v i d i t y of antigen recognition by the TCR -a /0 dimer on CTL's (Springer et a l . , 1987). A recent report has suggested that, i n the helper c e l l system, LFA-3 can stimulate production of IL-1 by monocytes, thymic epithelium and skin keratinocytes upon binding to CD2 (Le et a l . , 1987). IL-1 may i n turn promote the secretion of lymphokines by activated T c e l l s and thus stimulate their autocrine p r o l i f e r a t i o n . Chapter One p. 21 C) T Ce l l Activation Antigens In addition to the CD4, CD8 and CD2 molecules which synergize with the TCR-a/0/CD3 complex in T ce l l activation, several T ce l l surface antigens have been identified to mediate T c e l l activation in the presence or absence of other supplementary signals. They include murine Thy-1, human CD28 (also known as T44), T ce l l activating protein (TAP) in mouse, CD45 (also known as leukocyte common antigen (LCA) and T200), and CD5 (also known as Lyt-1 in mouse and T l in human) (see Table III) . Thy-1 is a 18-25,000 M r GPI-anchored membrane glycoprotein expressed on a l l T lymphocytes, neurons, hemopoietic stem ce l l s , and some dendritic epidermal cel ls in mouse, but only on neurons and a small subpopulation of thymocytes in human (Williams, 1982a; Williams and Gagnon, 1982b; Low and Kincade, 1985; Tse et a l . , 1985). In mouse, some anti-Thy-1 antibodies alone can induce the activation of resting T ce l l s , but some require the addition of phorbol esters or the presence of FcR+ accessory cel ls (Jones and Janeway, 1981; Konaka et a l . , 1981; Gunter et a l . , 1984; MacDonald et a l . , 1985). IL-2 production induced by Thy-1 appears to require the expression of TCR-a/f3/CD3 complex on the c e l l surface (Gunter et a l . , 1987; Schmitt-Verhulst et a l . , 1987; Sussman et a l . , 1988), although Thy-1 alone is capable of signal transduction leading to an increase in intracel lular Ca^ + in transfected B cel ls and transfected TCR-a/0 variant clones (Kroczek et a l . , 1986; Gunter et a l . , 1987). Hence, Thy-l-mediated T c e l l activation may depend on elements associated with the TCR-a/|3/CD3 pathway. CD28, so far identified only in humans, is a homodimer of 44,000 M r glycopolypeptides expressed on a small subpopulation of thymocytes and the majority of peripheral T lymphocytes including helper/inducer T ce l l s , CTL's, but not suppressor cel ls (Lum et a l . , 1982; Hara et a l . , 1985b; Martin et a l . , 1986). It is also highly expressed on plasmacytomas and appears to be induced during B c e l l differentiation into plasma cel ls (Kozbor et a l . , 1987). Chapter One p. 22 TABLE III T CELL ACTIVATION ANTIGENS Antigen Mr D i s t r i b u t i o n s Functional Properties CD4 CD8 As i n Table II Involved i n Antigen-mediated T c e l l a c t i v a t i o n CD2 As i n Table II Synergism with anti-TCR/CD3; Two MAb's can stimulate alone Thy-1 18-25K A l l T c e l l s , neurons, (GPI- hemopoietic stem c e l l s , anchored) and some de n d r i t i c epidermal c e l l s i n mice; only neurons and some thymocytes i n human T c e l l a c t i v a t i o n i n the presence or absence of phorbol esters or accessory c e l l s CD28 2x44K Majority of peripheral (Homodimer) T c e l l s ; some thymocytes; plasma c e l l s T c e l l a c t i v a t i o n i n the presence of accessory c e l l s or phorbol esters; synergism with anti-TCR/CD3 CD5 67K A l l mature T c e l l s ; some B c e l l s Replaces macrophages i n T c e l l a c t i v a t i o n CD45 180K; 190K; 200K; 220K; 240K (Isoforms) A l l lymphoid and myeloid c e l l s s i m i l a r to CD5 TAP 12K Majority of peripheral (GPI- T c e l l s ; anchored) some thymocytes T c e l l a c t i v a t i o n i n the presence of accessory c e l l s or IL-1 Chapter One p. 23 Anti-CD28 stimulates resting T cel ls in the presence of accessory cel ls or phorbol esters. It can also augment anti-CD3-induced T c e l l responses by increasing IL-2R expression and IL-2 production (Hara et a l . , 1985b; Moretta et a l . , 1985; Martin et a l . , 1986; Weiss et a l . , 1986; Damle et a l . , 1988). It has been found that the expression of CD28 is confined to CD3+TCR-a/|3+ peripheral blood T cel ls (Poggi et a l . , 1987). However, unlike the TCR-a/$/CD3-mediated pathway which involves an increase in cAMP levels, a release of Ca^ + from internal storage, as well as an influx of extracellular Ca^ + , CD28 appears to trigger only the influx of extracellular Ca^ + (Pantaleo et a l . , 1986) and an increase in cGMP levels without affecting cAMP levels (Ledbetter et a l . , 1986). CD5 is a 67,000 M r glycoprotein expressed on a l l mature T cel ls and some B cel ls (Reinherz et a l . , 1979b; Antin et a l . , 1986). Anti-CD5 appears to provide a secondary signal for the activation of resting T cel ls stimulated by sepharose-bound anti-CD3, by enhancing IL-2R expression and IL-2 production (Ledbetter et a l . , 1985a; Ceuppens and Baroja, 1986). Similar to anti-CD28, anti-CD5 induces an increase in cGMP levels and a rise in intracel lular Ca^+ only via an ion influx from the extracellular environment (Ledbetter et a l . , 1986; June et a l . , 1987). The depletion of protein kinase C seems to uncouple signal transduction between CD5 and the calcium channel. The CD5 response may be dependent on the expression of CD3 on the ce l l surface (June et a l . , 1987). CD45 is a 180-220,000 M r glycoprotein expressed on a l l lymphoid and myeloid ce l l s . CD45 molecules (180,000 M r , 190,000 M r , 200,000 M r and 220,000 M r) on T cel ls (Tung et a l . , 1981; Sarmiento et a l . , 1982; Woollett et a l . , 1985) and B cel ls (240,000 M r , also called B220) (Coffman and Weissman, 1981) consist of distinct isoforms derived from the alternative use of 5' exons of the gene (Saga et a l . , 1987; Strueli et a l . , 1987; Thomas et a l . , 1987). Thymocytes express only the 180,000 M r isoform of CD45 whereas different functional supopulations of mature peripheral T cel ls express combinations of Chapter One p. 24 the four isoforms. Similar to anti-CD5, some anti-CD45 can replace macrophages when peripheral resting T cells are stimulated by sepharose-bound anti-CD3, by inducing IL-2R expression and IL-2 production (Ledbetter et a l . , 1985b; Martorell et a l . , 1987). CD45-mediated activation is restricted to CD4+ T ce l l s , whereas some anti-CD45 antibodies inhibit cytolytic act iv i t ies by CTL's and NK cel ls (Newman et a l . , 1983; Lefrancois and Bevan, 1985). TAP is a 12,000 M r GPI-anchored glycoprotein encoded by a gene mapped to the Ly-6 locus in mouse (Reiser et a l . , 1986a, 1986b). It is expressed on a small subpopulation of thymocytes and the majority of peripheral T cel ls (Yeh et a l . , 1986a, 1986b). Some anti-TAP antibodies are mitogenic to resting T cel ls in the presence of accessory cel ls or IL-1 (Rock et a l . , 1986; Yeh et a l . , 1987). Adult thymocytes can also be activated through the TAP molecule (Yeh et a l . , 1986a) and the activation appears to depend on the expression of the TCR-a/p/CD3 complex (Sussman et a l . , 1988). There has been evidence suggesting that TCR-a/|3+TAP - cort ical thymocytes are not immunocompetent and that TAP expression is neccessory for the Con A responsiveness of total thymocytes (Yeh et a l . , 1986a). It implicates that TAP may be important in defining the immunocompetent thymocyte compartment. Other Ly-6-encoded antigens have also been demonstrated to participate in T c e l l activation (Malek et a l . , 1986; Leo et a l . , 1987a). A l l the above surface antigens, upon perturbation by MAb's, are capable of triggering an increase in intracel lular Ca^ + . The increase in intracel lular Ca^ + is known to enhance the activation of protein kinase C, a biochemical pathway shared by the stimulation via the TCR-a/f3/CD3 complex. This may underlie the mechanisms by which these surface antigens mediate or enhance T c e l l activation. Alternatively, protein kinase C-independent mechanisms may be involved. The physiological ligands of these activation antigens have yet to be identified and their roles in the T cell-mediated response remain obscure. It is tantalizing to postulate that some of them may Chapter One p. 25 represent receptors to external activation signals such as growth factors, or to surface molecules involved in the interactions with membrane-bound ligands on antigen-presenting cel ls or target cel ls l ike CD2 does. Further studies have recently identified many other T ce l l antigens which may participate in T c e l l activation. They include Tp90 (90,000 M r) (Carrel et a l . , 1987b), Tp45 (45,000 M r) (Carrel et a l . , 1987a), and 2H1 (140,000 M r and 105,000 M r) (Morimoto et a l . , 1988) in human. Considering the complexity of events involved in cel lular activation, the l i s t of such surface antigens w i l l l ike ly continue to expand. D) Members Of The Immunoglobulin Superfamily The immunoglobulin (Ig) superfamily is a group of molecules with sequence homology to the variable and/or constant domains of Ig. Other than primary sequence homology, cr i t er ia for superfamily membership include a conserved Ig-l ike tertiary protein structure such that each member has one or more Ig-l ike homology unit. Each homolgy unit consists of approximately 110 amino acids which fold into two sheets of antiparal le l beta-strands. Some homology units have a conserved disulphide bond between two beta-strands but i t is not an invariant characteristic of a l l members (reviewed in Williams and Barclay, 1988). I n i t i a l members of the superfamily, including MHC class I (both heavy chain and 0 2 microglobulin), class II (both a and (3 chains), poly-Ig receptor and Thy-1, have led to the concept that Ig-l ike structures are membrane molecules that play a role in c e l l surface recognition (Williams and Gagnon, 1982b). In the last few years, with many more members added to the superfamily (a total of 25), this concept is greatly strengthened. The majority of the Ig-l ike molecules are surface antigens on lymphocytes involved in antigen recognition and c e l l - c e l l interactions, and are capable of triggering subsequent events at the c e l l surface related to a prol i ferative or Chapter One p. 26 differentiation response. They include TCR-a/P (Kronenberg et a l . , 1986), TCR-Y /6 (Hata et a l . , 1987), CD3-Y , 6 ,E subunits (Gold et a l . , 1987), CD4 (Clark et a l . , 1987; Littman, 1987a), CD8 (Both a and p subunits in mouse) (Johnson, 1987; Littman, 1987a), CD2 (Sewell et a l . , 1986; Sayre et a l . , 1987), CD28, (Aruffo and Seed, 1987) and Thy-1 (Williams and Gagnon, 1982b) on T ce l l s . Other members not found on lymphocytes have a diversity of functions and tissue distribution. They include poly-Ig receptor (Mostov et a l . , 1984), FcR for IgG2b and IgG^ (Lewis et a l . , 1986), receptors for platelet-derived growth factor (PDGF-R) and colony stimulating factor-1 (CSF-1R) (Sherr et a l . , 1985; Yarden et a l . , 1986; Williams and Barclay, 1988), and three neural adhesion antigens, NCAM (Cunningham et a l . , 1987), MAG (Salzer et a l . , 1987), and P 0 myelin protein (Lemke and Axel, 1985). Most of them are capable of mediating c e l l surface recognition, conforming with the functions of other members. Ig-homology units are found on the extracellular portion of a l l members of the superfamily. The transmembrane sequences and cytoplasmic domains show great diversity and vary in length. For example, IgM has only three amino acids in the cytoplasm (Kelry et a l . , 1980), and PDGF-R has a 543 amino acid cytoplasmic domain with tyrosine kinase act ivi ty (Yarden et a l . , 1986). Moreover, a few members do not have transmembrane and cytoplasmic domains but are anchored to the membrane via GPI. They include Thy-1 (Low and Kincade, 1985; Tse et a l . , 1985), LFA-3 (Dustin et a l . , 1987b; Seed, 1987), Qa-2 (one of the MHC class I antigens) (Stiernberg et a l . , 1987; Stroyhowski et a l . , 1987), and an isoform of NCAM (Barthels et a l . , 1987; Cunningham et a l . , 1987). Some members of the Ig superfamily are known to interact with each other on opposed c e l l surfaces. Examples of heterophilic recognition of superfamily members are poly-Ig receptor and FcR with soluble Ig (Fruitiger et a l . , 1986; Ravetch et a l . , 1986), CD2 with LFA-3 (Dustin et a l . , 1987a; Plunkett et a l . , Chapter One p. 27 1987; Selvaraj et a l . , 1987), TCR-a/0 with polymorphic epitopes on MHC antigens in conjunction with antigen (Allison et a l . , 1984; Reinherz et a l . , 1984), and probably CD4 with MHC class II as well as CD8 with MHC class I (Dembic et a l . , 1987; Doyle and Strominger, 1987; Gabert et a l . , 1987; Gay et a l . , 1987; Ratnofsky et a l . , 1987). Some other members, NCAM and P 0 myelin protein, are thought to exhibit homophilic interactions (Hoffman and Edelman, 1983; Lemke and Axel, 1985). The interactions between superfamily members may be a common phenomenon considering that pairs of Ig homology units can form unique domain structures within the same molecule. For instance, a variable domain in the Ig molecule is made up of one homology unit from the l ight chain and one from the heavy chain. Similar domains composed of two homology units may also be found in dimeric members l ike TCR-a/0, MHC class I, class II and CD8. These intramolecular and intermolecular interactions of Ig homology units have led to the hypothesis that heterophilic receptor pairs may have evolved from a homophilic interaction system (Matsunaga, 1985). In analogy to the Ig molecule, the Ig-l ike domains may provide a stable structure allowing the presentation of unique determinants for recognition via sequence variation at the bends of the beta-strands (Williams and Barclay, 1988). 1.2.2 Molecules Involved In T Cel l Migration Ce l l migration primarily occurs in two stages of T c e l l development. Prothymocytes, which are hemopoietic progenitors committed for differentiation in the T lymphoid lineage, migrate from the bone marrow to the thymus and are capable of restoring the thymic population of a lethally irradiated host (Ezine et a l . , 1984; Spangrude et a l . , 1988). After development in the thymus, emigrant T lymhocytes recirculate in the blood stream and lymphoid tissues and throughout the body unt i l they either encounter foreign antigens, specific prol iferative stimuli , or die (Weissman, 1967). There has been Chapter One p. 28 evidence suggesting that prothymocytes respond to chemotactic substances secreted by thymic epithelium and exhibit directional locomotion in a Zigmond migration chamber (Ben Slimane et a l . , 1983; Champion et a l . , 1986). However, polypeptide chemotactic factors and ce l l surface receptors have not been identif ied. On the other hand, substantial evidence has shown that migration of recirculating T lymphocytes is mediated by c e l l - c e l l adhesion involving specific homing receptors on T cells and surface components on specialized microvascular structures, high endothelial ce l l venules (HEV), which are located throughout peripheral lymph nodes, mucosal lymphoid organs (Peyer's patches and appendix), and inflamed synovium (joint tissue) in patients with rheumatoid ar thr i t i s (Jalkanen et a l . , 1986c; reviewed in Gallat in et a l . , 1986; Jalkanen et a l . , 1987; and Woodruff et a l . , 1988). Peripheral blood lymphocytes extravasate by f irs t binding to HEV and then migrating between the endothelial ce l l s , crossing the HEV. No HEV are present in the thymus and non-lymphoid organs. A) Homing Receptors For Lymphoid Tissues The interaction of lymhocytes with HEV was f irs t demonstrated in vivo by short-term localization ("homing") of intravenously injected lymphocytes, and in v i tro by c e l l adhesion assays of viable lymphocytes on frozen sections of lymphoid tissues (Jalkanen et a l . , 1986b). It was found that some lymphocyte clones can discriminate between HEV cel ls in the lymph nodes (HEVLN) a n a " in the mucosal lymphoid organs (HEVpp), whereas most normal virgin T and B lymphocytes bind to both classes of HEV. It suggests that at least two classes of homing receptors exist on lymphocytes, one specific for HEVLN A N C* the other for HEVpp. Most normal virgin T and B cells express both receptors (Jalkanen et a l . , 1986b). The existence of distinct homing receptors on lymphocyte surfaces was f i r s t confirmed by a rat MAb MEL-14 which blocks the binding of normal and transformed T and B lymphocyte populations to HEVLN U U T Chapter One p. 29 fa i l s to block their binding to HEVpp in mouse (Gallatin et a l . , 1983). The MEL-14 antigen is a glycoprotein of 90,000 M r and consists of a branching polyubiquitin near its amino-terminus which is important in defining the MEL-14 epitope (St. John et a l . , 1986; Siegelman et a l . , 1986). Ubiquitin is known in other systems to be required for intracel lular protein degradation (Hershko, 1983). It has been suggested that the ubiquitination of MEL-14 may lead to i ts rapid internalization and degradation so that the lymphocyte entry into lymph nodes is directional and irreversible (Siegelman et a l . , 1986). A similar homing receptor (Hermes-1) has recently been identified in human by the Hermes-1 and Hermes-3 MAb's (Jalkanen et a l . , 1986a, 1986b; Jalkanen et a l . , 1987). Hermes-1 MAb stains both HEVL^- and HEVpp-specific lymphoid c e l l l ines without blocking their binding to HEV, suggesting that i t identif ies a common determinant shared by both of these homing receptor classes. Hermes-3 MAb blocks lymphocyte binding to HEVpp only. A polyclonal antiserum against the Hermes-1 antigen from a HEVpp-specific c e l l l ine blocks lymphocyte binding to HEVT,N> HEVpp and synovial HEV (HEVg^). It implicates the presence of a class of 90,000 M r homing receptors on human lymphocytes. MEL-14 is l ike ly the murine homologue to this family as the MEL-14 MAb cross-reacts with the Hermes-1 antigen and blocks the binding of human lymphocytes to HEVLN (Jalkanen et a l . , 1987) (see Table IV). Another group of lymphocyte homing receptors called "high endothelial binding factors" (HEBF) have also been described in rat (Woodruff et a l . , 1988). They were identified by MAb's that were raised against shed molecules in the supernatants of cultured rat thoracic duct lymphocytes (TDL) and were able to inhibit the adhesion of TDL to HEV. Anti-HEBF L N blocks lymphocyte binding to HEVLN. a n d detects a surface protein of 80,000 M r . Anti-HEBFpp blocks lymphocyte binding to HEVpp and immunoprecipitates three polypeptides of 135,000 M r , 60,000 M r and 40,000 M r (Chin et a l . , 1980, 1984). These homing receptors are also detected on a large proportion of rat peripheral Chapter One p. 30 TABLE IV LYMPHOCYTE HOMING RECEPTORS TO LYMPHOID TISSUES Antigen Mr HEV as target of in t e r a c t i o n MEL-14 (Murine) 90K MEL-14 MAb blocks the binding to HEV L N £ Hermes-1 (Human) 90K Hermes-1 MAb stains HEVjjf- and HEVpp u-specific lymphocytes; Hermes-3 MAb blocks the binding to HEVpp; Anti-Hermes-1 antiserum blocks the binding to HEV L N, HEVpp and HEV S N C HEBF L N (Rat) 80K HEBF L N MAb blocks binding to HEV L N HEBFpp (Rat) 135K; 60K; 40K HEBFpp MAb blocks binding to HEVpp a LN = b PP = c SN = Peripheral lymph nodes Mucosal lymphoid tissues such as the Peyer's patches Inflamed synovium Chapter One p. 31 lymphcytes. Moreover, antigen similar to the rat HEBFL^J has been detected on 60-70% human peripheral blood lymphocytes (Woodruff et a l . , 1987). No physiological ligands to either mouse MEL-14, human Hermes-1, rat or human HEBFyvj and HEBFpp have so far been identified. It has been suggested that the MEL-14 antigen may interact with specific oligosaccharide structures on HEVLN because mannose-6-phosphate-rich polysaccharides can block the binding of mouse lymphocytes to HEVLN via the MEL-14 antigen (Yednock et a l . , 1987). However, i t remains possible that the actual endothelial c e l l ligand, although mimicked by mannose-6-phosphate, may in fact have an unrelated molecular structure. Recently, a murine endothelial c e l l surface molecule (58-60,000 M r ) , defined by MECA-367 MAb and selectively expressed on mucosal lymphoid organs, has been shown to be required for lymphocyte homing (Streeter et a l . , 1988). It is tentatively designated as a member of "vascular addressins", which possibly represent a family of endothelial c e l l surface proteins providing positional information for circulating blood ce l l s . The MECA-367 antigen is a putative ligand for a HEVpp-specific lymphocyte homing receptor, and its selective expression on mucosal lymphoid organs has suggested the presence of additional tissue-specific "vascular addressins" in other sites to direct lymphocyte extravasation. In young mice, T lymphocytes preferentially bind to HEVyq whereas B lymphocytes preferentially bind to HEVpp (Stevens et a l . , 1982). Similar binding differences have also been demonstrated between the CD8+ and CD8 - T c e l l subpopulations (Kraal et a l . , 1983). These findings suggest that selective lymphocyte migration may help control the relative ava i lab i l i ty of functionally dist inct virgin lymphocyte populations in mucosal versus non-mucosal lymphoid organs. Upon antigen stimulation, lymphocytes are sequestered in the lymphoid tissues, where they undergo localized clonal expansion and differentiation. In the mouse, submitogenic stimuli up-regulate and mitogenic stimuli down-regulate the MEL-14 antigen expression on the Chapter One p. 32 majority of lymphocytes, implicating a complex regulation of homing receptor expression (Hamman et a l . , 1988b). These regulatory phenomena may reflect the requirements for increased migration to lymphoid tissues by lymphocytes experiencing low level st imuli , and for the sequestration of actively dividing lymphocytes to interact with the local lymphoid microenvironment. Other homing receptors may be regulated appropriately too. Following the sessile differentiation in the lymphoid tissues, stimulated lymphocytes appear to reexpress only a single homing receptor that leads to their selective migration to the sites of immunization (Jalkanen et a l . , 1986b). Likewise, ligands to homing receptors on HEV cells may also be regulated by local factors associated with immunological ac t iv i t i es . For instance, the murine HEV-specific endothelial antigen, defined by MECA-325 MAb, can be speci f ica l ly induced by IFN-y in cultured endothelial cel ls from diverse sources, which is accompanied by the differentiation of endothelial cel ls to attain HEV-like morphological characteristics (cuboidal shape) (Duijvestijn et a l . , 1986). This may bear significance in the control of lymphocyte traf f ic to lymphoid tissues and to sites of inflammation in vivo. B) Accessory Molecules Involved In Lymphocyte Homing Recently, in vitro studies have demonstrated that LFA-1 serves as an organ non-specific adhesion molecule in lymphocyte-HEV interactions, analogous to i t s accessory role in strengthening weak interactions between TCR-oc/0 on T lymphocytes and antigen/MHC on antigen-presenting cel ls (Hamman et a l . , 1988a; Pals et a l . , 1988). MEL-14 h i S h cel ls which bind well to HEV L N cel ls are less susceptible to inhibit ion by anti-LFA-1 than poor binders (MEL-14l° w ) are (Hamman et a l . , 1988a). In vivo, anti-LFA-1 reduces lymphocyte migration to both peripheral lymph nodes and mucosal lymphoid tissues (Hamman et a l . , 1988a). Other studies have suggested that another adhesive molecule on T lymphocytes, CD2 (Plunkett et a l . , 1987), may also play an accessory role in Chapter One p. 33 lymphocyte migration. Final ly , specific c e l l - c e l l interactions between lymphocytes and HEV of various lymphoid tissues have so far indicated a group of dist inct adhesive molecules on lymphocytes. In light of the complexity of lymphocyte recirculation through the blood stream and body tissues, i t is l ike ly that more homing receptors w i l l be identified in the future. 1.2.2 Receptors To Soluble Regulatory Factors T lymphocytes are responsive to a variety of regulatory polypeptide factors at different stages of development. These factors include 1) thymic hormones l ike thymopoietin, thymulin and thymosin a, that appear to influence the differentiation of T lymphocytes (reviewed in Low and Goldstein, 1985); 2) other hormones l ike insulin and some neuropeptides that direct ly or indirect ly modulate T c e l l proliferation and functions (reviewed in Plaut, 1987); 3) hormone-like cytokines such as the interleukins and interferons that are secreted in the course of immunologic and inflammatory reactions, and serve as endogenous second signals in conjunction with antigenic stimuli to trigger prol i ferat ive responses as well as to stimulate functional differentiation (see below). The above hormones and factors interact with specific receptors on the c e l l surface to e l i c i t their act iv i t i es . The receptor spec i f ic i t ies of many of them, however, have not been ful ly characterized. This section reviews only the effects of cytokines on T ce l l proliferation and differentiat ion. A) Cytokines Involved In T Cel l Growth Cytokines are soluble intercel lular polypeptide mediators that regulate local and sometimes systemic inflammatory responses by modulating prol i ferat ion, mobility and differentiation of leukocytes as well as non-leukocytic ce l l s . Cytokines produced by T and B cel ls are called Chapter One p. 34 "lymphokines" and those produced by monocytes and macrophages are called "monokines". Cytokines were i n i t i a l l y described by their biological act iv i t ies that induce growth and differentiation of specific c e l l types, and were often prepared as unpurified or fractionated culture supernatants of the producer ce l l s . Recently, MAb's to individual cytokine factors have fac i l i tated their purification and have improved the specif ic i ty of bioassays. The molecular cloning of some of them have subsequently allowed sequence comparisons and have concluded that some factors defined by different bioassays are indeed identical . The avai labi l i ty of recombinant cytokines has also been invaluable in establishing their individual ac t iv i t i e s . In many cases, i t has been shown that a single cytokine can act on more than one c e l l type (being pleiotropic) and can induce similar or different responses in each target c e l l (being multifunctional). Thus, a cytokine may bear several different names, each reflecting the biological act ivi ty through which the protein has been independently discovered. Many cytokines are now renamed interleukins (proteins that carry messages between leukocytes) (O'Garra et a l . , 1988; reviewed in Sporn and Roberts, 1988). Given the complexity of requirements for proliferative and differentiational responses in the diverse leukocyte populations, more mediators l ike ly remain to be discovered. Interleukins acting on T cel ls are described as follows (also see Table V): 1) Interleukin-1 (IL-1), with former names l ike lymphocyte activating factor (LAF) and monocyte c e l l factor (MCF), is secreted by monocytes and macrophages as well as v ir tual ly a l l nucleated ce l l types when stimulated by a variety of agents. There are two major stable forms of IL-1 with similar M r of 17,000, called IL-loc and IL-13 (reviewed in Oppenheim et a l . , 1986, 1987). They have different isoelectric points and are encoded by two dist inct genes bearing only low sequence homology with each other. IL-13 is more abundantly secreted than I L - l a from monocytes stimulated by bacterial lipopolysaccharides (LPS). The two IL-1 forms appear to have similar biological act iv i t ies which include C h a p t e r One p. 35 TABLE V CYTOKINES AND THEIR RECEPTORS INVOLVED IN T CELL GROWTH C y t o k i n e ( M r ) R e c e p t o r ( M r ) D i s t r i b u t i o n s E f f e c t s on T c e l l s I L - 1 a (17K) 0 (17K) I L - 1 R (80K) A l l c e l l t y p e s ; C D 4 + s u b s e t o n l y ; u p - r e g u l a t e d i n a c t i v a t e d T c e l l s Augments I L - 2 , I L - 4 and IFN-Y p r o d u c t i o n by T c e l l s ; c o s t i m u l a t e s thymocytes w i t h l e c t i n s I L - 2 (15K) I L - 2 R a/0 0 s u b u n i t s on r e s t i n g (55K/75K) T , B c e l l s , and L G L ' s ; a/0 d imer o n l y on a c t i v a t e d T c e l l s A u t o c r i n e growth o f CD4+2H4-4B4+ T h l h e l p e r c e l l s I L - 4 (20K) I L - 4 R Many h e m o p o i e t i c and (55-60K) n o n - h e m o p o i e t i c c e l l s ; u p - r e g u l a t e d i n a c t i v a t e d T and B c e l l s A u t o c r i n e g rowth o f CD4+2H4+4B4- Th2 h e l p e r c e l l s I L - 5 (36 -62K) Induces CTL g e n e r a t i o n f rom thymocytes i n the p r e s e n c e o f I L - 2 I L - 6 (25 -30K) TNF (24K) TNF-R (138K; 90K; 75K; 54K) A l l c e l l t y p e s ; 138K p o l y p e p t i d e o n l y on c e l l l i n e s h i g h l y s e n s i t i v e to TNF c y t o t o x i c i t y S i m i l a r to I L - 1 and I L - 5 Induces I L - 6 p r o d u c t i o n ; I L - l - l i k e e f f e c t s TGF -0 (25K) TGF-0R (360K as 2x l80K d imer ) A l l c e l l t y p e s I n h i b i t i o n o f T c e l l p r o l i f e r a t i o n w i t h o u t e f f e c t s on I L - 2 and I L - 2 R e x p r e s s i o n I F N - y (20-25K) IFN-yR A l l c e l l t y p e s (140K on h e m o p o i e t i c c e l l s ; 95K on o t h e r c e l l s ) G e n e r a t i o n o f CTL a c t i v i t y i n mixed l y m p h o c y t e r e a c t i o n s Chapter One p. 36 augmenting the production of lymphokines such as IL-2, IL-4 and IFN-y (see below) from T ce l l s , comitogenic effects on thymocytes with lect ins , promoting T c e l l and B ce l l prol iferation, and enhancing differentiation and antibody production by B ce l l s . They also promote the growth or functional act iv i t ies of almost a l l non-lymphocytic ce l l types, accounting for the diverse manifestations such as leukocyte in f i l t ra t ion of inflammatory sites , fever, and bone and cartilage resorption. The ce l l surface receptors (80,000 M r) for I L - l a and IL-10 (IL-1R) are identical on both fibroblasts and T lymphocytes. (Bird & Saklatvala, 1986; Dower et a l . , 1986a, 1986b). Activated T cel ls express about three times more IL-1R than resting T cel ls do. The IL-1R expression on mature T cel ls appears to be restricted to the CD4+ subset (Lowthenthal and MacDonald, 1987). 2) Interleukin-2 (IL-2), formerly known as T ce l l growth factor (TCGF), is a 15,000 M r glycoprotein lymphokine mainly produced by the CD4+ helper subset of T cel ls upon mitogenic stimulation. It is the f irs t autocrine growth factor described for T cel ls and is thought to be the major factor that drives T cel ls into proliferation (reviewed in Cantrell and Smith, 1984). It also induces the production of other lymphokines by T ce l l s . Recently, i t has been demonstrated that only the human CD4+2H4~4B4+ Thl helper subset secretes IL-2 and uses i t as the autocrine growth factor (Kurt-Jones et a l . , 1987; Boom et a l . , 1988; Greenbaum et a l . , 1988), whereas the CD4+2H4+4B4- Th2 helper subset secretes IL-4 and uses i t as the autocrine growth factor (see below). It has also been shown in mice that only the Thl helper subset mediates delayed hypersensitivity act ivi ty and the Th2 subset is primarily responsible for delivering help to B cel ls (Mosmann et a l . , 1986; Mosmann and Coffman, 1987). IL-2 also interacts with non-T ce l l s , leading to the proliferation and enhanced NK act ivity of LGL's (Trinchieri et a l . , 1984), the prol i feration and antibody production of activated B cells (Mingari et a l . , 1984; Ralph et a l . , 1984), and the cytocidal induction of activated macrophages (Malkovsky et a l . , Chapter One p. 37 1987). The c e l l surface receptor for IL-2 (IL-2R) has been part ia l ly characterized (see below in part B of this section). 3) Interleukin-4 (IL-4), also known as B ce l l stimulating factor 1 (BSF1), is a 20,000 M r lymphokine produced by CD4+2H4+ Th2 helper T ce l l s . In earl ier studies, i t was found to costimulate with anti-Ig MAb the proliferation of resting B cel ls and their subsequent antibody production (reviewed in Sideras et a l . , 1988). More recent studies using recombinant IL-4 have shown that i t also stimulates the proliferation of CD3+ NK cel ls (Spits et a l . , 1987), thymocytes (Palacios et a l . , 1987; Zlotnik et a l . , 1987; Carding and Bottomly, 1988; Lowenthal et a l . , 1988b) and mature T cel ls (Hu-Li et a l . , 1985; Grabstein et a l . , 1987; Spits et a l . , 1987), as well as the generation of CTL's (Pfeifer et a l . , 1987; Widmer et a l . , 1987a, 1987b). It is the sole autocrine growth factor for CD4+2H4+ Th2 helper T cel ls l ike IL-2 is for the CD4+2H4- Thi subset (Ferandez-Botran et a l . , 1986; Kurt-Jones et a l . , 1987; Lichtman et a l . , 1987; Greenbaum et a l . , 1988). The c e l l surface receptor for IL-4 (IL-4R) is widely distributed in hemopoietic and non-hemopoietic cel ls (Ohara and Paul, 1987; Park et a l . , 1987; Lowenthal et a l . , 1988a). The expression of IL-4R on resting T and B cells is low but increases by 5-10 fold upon mitogenic stimulation (Ohara and Paul, 1987; Park et a l . , 1987). Aff in i ty cross-linking studies, in which radiolabeled IL-4 is chemically cross-linked to IL-4R on target cel ls and the ligand/receptor complex is visualized by SDS-PAGE analysis, have identified a putative IL-4R as a 55,000-60,000 M r protein (Ohara and Paul, 1987; Park et a l . , 1987). 4) Interlerkin-5 (IL-5) is a 46,000 M r T c e l l lymphokine also known as T c e l l replacing factor (TRF), B c e l l growth factor II (BCGF II) and eosinophil differentiation factor (EDF). Its functions include the stimulation of mitogen-activated B cel ls to proliferate, the induction of terminal differentiation of late-developing B cells to Ig-secreting B ce l l s , as well as the induction of the differentiatin of eosinophils (reviewed in Sideras et Chapter One p. 38 a l . , 1988). It has recently been shown that IL-5 can also induce CTL generation from immature thymocytes in the presence of IL-2, probably via the enhancement of IL-2R expression (Takatsu et a l . , 1987). The c e l l surface receptor for IL-5 (IL-5R) has not been described so far. 5) Interleukin-6 (IL-6) is also known as T c e l l activating factor (TAF), interferon 0 2 (I F N~02)' hybridoma growth factor (HGF), plasmacytoma growth factor, and B c e l l stimulatory factor 2 (BSF2). It is a 25-30,000 M r cytokine which, l ike IL-1, is produced by mitogen-stimulated leukocytes and a variety of c e l l types which are responsive to the factor (reviewed in Sehgal et a l . , 1987). IL-6 has I L - l - l i k e act iv i t ies in promoting T c e l l prol i ferat ion. For instance, i t stimulates IL-2 production and hence the proliferation of peripheral blood T cel ls and mature thymocytes in conjunction with a submitogenic dose of lectins (Garmen et a l . , 1987; Lotz et a l . , 1988; Uyttenhore et a l . , 1988). IL-6 also induces CTL generation from thymocytes in the presence of IL-2 and is needed for the production of serine esterase in CTL granules (Takai et a l . , 1988). The c e l l surface receptor for IL-6 (IL-6R) has yet to be reported. Other than the interleukins mentioned above, additional cytokines which may have biological act iv i t ies on T cells include tumor necrosis factor (TNF or TNF-a), transforming growth factor-0 (TGF-0), and interferons (IFN). TNF is a 24,000 Mr polypeptide mainly secreted by activated macrophages along with IL-1. TNF, in addition to causing tumor destruction by inducing hemorrhagic necrosis, also has I L - l - l i k e biological effects such as T c e l l stimulation and other events leading to the manifestation of fever, perhaps partly via the induction of IL-6 production (Ranges et a l . , 1988; and reviewed in Old, 1988). TNF shares the same receptor with lymphotoxin (LT; also known as TNF-0) which is 50% homologous to TNF (Aggarwal et a l . , 1985). Aff ini ty cross-l inking studies using radiolabeled TNF have identified the TNF receptor (TNF-R) as three or four non-covalently linked polypeptides (138,000 M r , 90,000 M r , Chapter One p. 39 75,000 M r , and 54,000 M r ) . The 138,000 M r polypeptide is least abundant or even absent on TNF-binding ce l l s . It is expressed only on a c e l l l ine (MCF-7) highly sensitive to the cytotoxic action of TNF, and not on the TNF-resistant MCF-7 variant. The exact association of the four polypeptides is as yet uncertain (Creasy et a l . , 1987). TGF-P is a 25,000 M r disulphide-linked homodimeric protein produced by platelets as well as activated monocytes and lymphocytes. It is i n i t i a l l y described as a factor that enhances the growth and induces the phenotypic transformation of normal cel ls in vitro (Roberts et a l . , 1981; Roberts et a l . , 1983). Recently, i t has been found to have multipotent immunoregulatory functions including chemoattractant act ivi ty for peripheral blood monocytes (Wahl et a l . , 1987), induction of IL-1 secretion by activated monocytes (Wahl et a l . , 1987), and inhibition of T (Kehrl et a l . , 1986b, Ristow, 1986) and B c e l l prol iferation (Kehrl et a l . , 1986a). The inhibitory effects of TGF-3 on T lymphocytes occur late in the proliferative response as the IL-l-induced expression of IL-2R, IL-2 and the transferrin receptor is not blocked. Hence, TGF-0 appears to serve as a negative feedback mechanism to l imit T c e l l clonal expansion, yet allowing the modulation of tissue repair mediated by IL-1 and other monokines (Wahl et a l . , 1988). The receptor for TGF-0 is a disulphide-linked dimeric glycoprotein of approximately 360,000 M r with subunits of similar size (Massague, 1985; Fanger et a l . , 1986). Preliminary studies show that the binding of TGF-g does not trigger clustering or autophosphorylation of i ts receptor (Fanger et a l . , 1986). IFN's were i n i t i a l l y identified by their ant iv ira l ac t iv i t i e s . IFN-a (18-20,000 M r) is produced primarily by leukocytes whereas IFN-3 (23,000 M r) is produced by cel ls of solid tissues such as fibroblasts upon v i r a l induction. IFN-y (20-25,000 Mr) is produced by T cells upon mitogenic activation. IFN-y can either augment or suppress cel lular and humoral immunity in vivo depending on the dose and time of administration. The Chapter One p. 40 mechanism of i ts variable act iv i t ies is not well understood. IFN-y may play role in the generation of CTL activity in mixed lymphocyte reactions. It als increases the expression of MHC class I and II molecules on many c e l l types, thus making them better targets for CTL k i l l i n g (reviewed in Oppenheim, 1987) IFN-a and IFN-p share the same receptor whereas the receptor for IFN-y (IFN-yR) is d is t inct . IFN receptors are expressed on most cel ls at various levels IFN-yR appears to exist in two molecular forms in human: 140,000 M r on peripheral blood monocytes and several c e l l lines of hemopoietic or ig in , and 95,000 M r on other ce l l types. The monocyte receptor is down-regulated upon IFN-y binding while the other receptor is not. The different molecular forms and their different regulation may correlate with the different responses of various cel ls to IFN-y (reviewed in Rubinstein, 1987). B) The Interkeukin-2 Receptor The expression of various cytokine receptors is important in rendering T cel ls responsive to the secondary signals necessary for promoting or inhibit ing their proliferation and differentiation. Among the interleukin receptors expressed on T ce l l s , the IL-2R has been best characterized. Its a subunit has been molecularly cloned (Leonard et a l . , 1984; Nikaido et a l . , 1984) and i ts ligand/receptor interaction has been characterized. Putative IL-1R and IL-4R have only been described by aff inity cross-linking studies, which have not revealed definitive information on their protein structures. Both IL-1R and IL-4R are expressed at low levels on resting T cel ls but are up-regulated upon mitogenic activation (Lowenthal and MacDonald, 1987; Ohara and Paul,1987; Park et a l . , 1987), whereas the functional IL-2R is only expressed upon activation. The functional IL-2R is a non-covalently associated complex of at least two subunits (a 55,000 M r ; |3 75,000 M r ) . Each subunit alone binds IL-2 with low af f in i ty but together they exhibit a high a f f in i t i y for IL-2 binding Chapter One p. 41 (reviewed in Smith, 1987, 1988). Only the high aff ini ty receptor (a/|3) is functional. The 3 subunit is constitutively expressed at low levels on T ce l l s and LGL's.(Dukovich et a l . , 1987; Sharon et a l . , 1988), whereas the a subunit is induced when T cel ls are stimulated by antigen/MHC or lectins (Leonard et a l . , 1984; Durand et a l . 1987). Thus, the expression of the functional IL-2R-a/{3 dimer is dependent on the induction of the a subunit which associates with the preexisting 3 subunit (Durand et a l . , 1987). Interaction of the high aff ini ty IL-2R with IL-2 further up-regulates the expression of the a subunit while down-regulating the 3 subunit, leading to an overall decrease of the high aff ini ty receptor and thus a transient loss of IL-2 responsiveness (Smith and Cantrel l , 1985). It constitutes an important feedback mechanism to dampen further proliferative response to IL-2 after the i n i t i a l mitogenic stimulation. The mechanism of signal transduction upon IL-2/IL-2R interaction has not been ful ly elucidated. The interaction of IL-2 with IL-2R results in the progression into the S phase of the ce l l cycle and sometimes the production of IFN-y- Like many other c e l l surface receptors for growth factors in non-lymphoid systems, such as the epidermal growth factor receptor (EGF-R), PDGF-R and the insulin receptor (In-R) (reviewed in Sibley et a l . , 1987), IL-2R is also phosphorylated (Gaulton and Eardley, 1986). The a subunit is phosphorylated equally in the presence or absence of IL-2 whereas the 3 subunit is phosphorylated only upon interaction with its ligand (Benedict et a l . , 1987). EGF-R, PDGF-R and In-R are tyrosine kinases that autophosphorylate. Their phosphorylation has been shown to regulate receptor functions. For instance, the phosphorylation of EGF-R and In-R at Ser/Thr residues reduces their af f in i t ies for ligand binding and their tyrosine kinase ac t iv i t i e s , and is essential for the internalization of the ligand/receptor complex as well as for signal transduction (Sibley et a l . , 1987). In contrast, the cytoplasmic domain of the a subunit of the IL-2R, as deduced Chapter One p. 42 from cDNA sequences, is too small (13 amino acids) to mediate any enzymatic act iv i ty (Leonard et a l . , 1984; Nikaido et a l . , 1984). Studies of mutant a subunits of the IL-2R have shown that the potential cytoplasmic phosphorylation sites are not essential for signal transduction or regulation of the IL-2R (Hetakeyama et a l . , 1986). Considering the inducible phosphorylation of the 8 subunit upon IL-2 binding, i t seems l ike ly that the 3 subunit is the moiety functioning in signal transduction and the a subunit merely serves to increase the ligand-binding af f in i ty . This hypothesis is further supported by the observations that some circulating T cel ls and LGL's bearing only the 8 subunit can proliferate and exhibit NK and lymphokine-activated k i l l e r (LAK) act iv i t ies in response to exogenous IL-2, leading to the subsequent induction of the a subunit and the expression of the high af f in i ty a /B receptor (Harbel-Bellan et a l . , 1986; Siegel et a l . , 1987; Tsudo et a l . , 1987). It has been reported that IL-2 binding can activate protein kinase C (Farrar and Anderson, 1985). However, additional mechanisms are l ike ly needed as phorbol esters alone cannot stimulate the prol i feration of IL-2-dependent c e l l lines (Albert et a l . , 1985; Koyasu et a l . , 1987). It is possible that, l ike other receptors for polypeptide factors, signal transduction via IL-2R may involve tyrosine kinase act iv i t ies on the 3 subunit or on an associated molecule (Saltman et a l . , 1988). 1.3 C E L L SURFACE ANTIGENS RELATED TO N E O P L A S T I C TRANSFORMATION OF LYMPHOCYTES The transformation of a normal ce l l into a neoplastic one is primarily marked by the acquisition of the potential for autonomous growth with no absolute requirements of exogenous growth signals, and the fai lure to respond to regulatory signals responsible for normal growth. When these transformed cel ls are introduced into a nude (athymic) mouse or an irradiated syngeneic animal, they form tumorous growths. Ce l l surface changes exhibited by Chapter One p. 43 transformed cel ls of various sources generally include alterations in the membrane glycoprotein compositions, the complexity of membrane glycol ipids , the level of s ia lylat ion of surface components, and the membrane microviscosity probably resulted from a less organized arrangemment of submembrane cytoskeleton (Nilsson, 1981; Hakomori, 1986; Watson et a l . , 1987). These membrane changes are intriguing as they may influence the neoplastic behavior of the transformed cel ls by modulating cel lular interactions, interactions with the extracellular matrix, and cel lular responses to external growth factors. Much effort has been made to identify glycoprotein and glycol ipid components whose expression or structural alterations may be associated with the neoplastic phenotypes of various c e l l types, in search for diagnostic tools for human malignancies, as well as a better understanding of the molecular mechanisms underlying oncogenesis and the basic control of c e l l prol i ferat ion. The existence of c e l l surface antigens or determinants unique to tumor cel ls but not found on normal cel ls is c lass ical ly demonstrated by the rejection of tumors when they are transplanted into a syngeneic animal previously immunized with the same tumors. These molecules are generally called tumor antigens, and their identification relies upon their ab i l i t y to e l i c i t an immune response in the host. Recent studies however have largely made use of MAb's generated against individual tumors which specif ical ly react with the same tumors but not with normal untransformed ce l l s . Tumor antigens found only on tumor cel ls but not on normal cel ls are considered tumor-specif ic . Other tumor antigens which are found on tumor cel ls as well as on some normal ce l l s , with the qualitative or quantitative differences in their expression permitting the tumor cel ls to be distinguished from the normal ce l l s , are considered tumor-associated. At present, most tumor antigens identif ied are tumor-associated but not tumor-specific. They are mostly differentiation antigens found on normal cel ls at much lower levels, or on Chapter One p. 44 cells of different differentiation stages and lineages, or in slightly altered forms. They are aberrantly expressed probably due to a general loss of stringent control of gene regulation in the transformed cells, but may also represent selective deregulation of gene expression that underlies the loss of growth control and the progression of tumor development. A notable example is the preferential down-regulation of the MHC class I antigens, which appears to be an important property that allows transformed cells to evade detection by the immune system (reviewed in Tanaka et a l . , 1988). L i t t l e is known about the identity of tumor-specific antigens. There has been a great deal of skepticism about their existence because antigens identified as tumor-specific may represent very rare normal determinants amplified at high quantity on expanded clones of transformed cells. Perhaps the likely candidates for tumor-specific antigens are those identified on chemically-induced neoplasms. Chemically-induced tumors generally possess tumor-specific transplantation antigens (TSTA's) that do not cross-react with TSTA's expressed on other tumors induced by the same chemical carcinogen. Although the identity of these TSTA's are s t i l l unclarified, they may be mutated cellular gene products, endogenous v i r a l proteins, or products of gene conversions (de Plaen et a l . , 1988). 1.3.1 Murine leukemias/lymphomas Most of the lymphocytic leukemias/lymphomas in mice studied so far are induced by exogenous murine leukemia retroviruses (MuLV) in the laboratory, or have arisen spontaneously. Moloney MuLV and Radiation MuLV cause T c e l l leukemias/lymphomas, whereas Abelson MuLV predominantly causes B c e l l leukemias/lymphomas. They seem to transform early hemopoietic progenitors committed to the lymphoid differentiation pathways (reviewed in Hehlmann et a l . , 1984 and Teich et a l . , 1984). MuLV-induced leukemias/lymphomas typically Chapter One p. 45 express on the c e l l surface v i r a l products, gp70 of the envelope (env) gene and glycosylated precursor proteins of the internal structure (gag) gene (reviewed in Dickson et a l . , 1984). In fact, spontaneous leukemias/lymphomas, l ike those derived from AKR mice, also express similar antigens of endogenous v i r a l origins (reviewed in Risser and Horowitz, 1983). Moreover, gp70 is produced in some normal virus-negative mouse tissues. It is the major envelope glycoprotein of 70,000 M r and is the principal antigen against which virus-neutralizing antibodies are generated. It carries antigenic determinants that are unique or shared by different MuLV. The c e l l surface gp70 molecules contain fewer terminal s i a l i c acid residues than those incorporated into virions produced by the same c e l l . It is associated with another env hydrophobic polypeptide pl5 (15,000 M r ) , which is not radiolabeled on the c e l l surface, either by disulphide bonds or by weaker non-covalent bonds. This association is thought to help anchor gp70 in the membrane. The normal gag products are not glycosylated and are structural constituents of the v ir ion capsid, the membrane and the internal ribonucleoprotein complex. The glycosylated precursor polypeptides gP956ag (95,000 M r) and gP85ga6 (85,000 M r) are however universally found on the surface of MuLV-infected ce l l s . Derepression of differentiation antigens is observed in some murine leukemias/lymphomas. Thymic leukemia (TL) antigen (45,000 M r) is a MHC class I heavy chain glycoprotein encoded by the Tia locus which is expressed on immature thymocytes in certain mouse strains. It has been detected on some thymic lymphomas from mouse strains that do not normally express i t (Old et a l . , 1963; Rothenberg, 1980). The activation of the Tia locus in the thymus shortly after the irradiation treatment of some mice has suggested that TL may be a marker for preleukemic changes in the thymus (Stockert and Old, 1977). Non-viral antigens distinct from other known cel lular differentiation antigens have also been detected in some leukemias/lymphomas induced by MuLV. Examples Chapter One p. 46 include the MCSA antigen (52,000 M r , 92,000 M r and 180-190,000 M r) in a Moloney MuLV-induced lymphoma (Troy et a l . , 1977), and the 6C3 antigen (125,000 M r and 160,000 Mr) in a l l Abelson MuLV-induced pre-B c e l l lymphomas (Pillemer et a l . , 1984). 1.3.2 Human leukemias/lymphomas Aberrant expression of differentiation antigens is commonly found on human lymphocytic leukemias/lymhomas. For instance, some differentiation antigens normally expressed on T lymphocytes are expressed on transformed B cel ls and other hemopoietic ce l l s , and vice versa (McCulloch, 1983; Smith et a l . , 1983). This "lineage infidel i ty" of antigen expression may represent a specific pattern for leukemic differentiation, or may represent an early stage of normal differentiation when cells not completely differentiated along a specific pathway can s t i l l express antigens common to cel ls of another lineage. The latter poss ibi l i ty conforms to the hypothesis that leukemias/lymphomas are resulted from clonal expansions of phenotypically normal hemopoietic cel ls which have become arrested at a certain stage of hemopoiesis or lymphopoiesis. A well characterized leukemia/lymphoma-associated antigen is the common acute lymphoblastic leukemia antigen (CALLA, also called CD10) in human. It is a membrane glycoprotein of 100,000 M r highly expressed on lymphoblasts from patients with acute lymphoblastic leukemia (ALL), some lymphomas, and some non-hemopoietic tumors, but also at very low levels on some lymphoid progenitor cel ls in normal bone marrow and thymus, and other normal non-hemopoietic cel ls (Newman et a l . , 1981; Pesando et a l . , 1983). The CALLA antigen is actively released from the ce l l surface of some lymphoblastoid c e l l l ines , which is associated with ce l l growth (Komada et a l . , 1986). No defined functions of CALLA have yet been described on normal or malignant ce l l s . Chapter One p. 47 Despite i ts leukemia non-specific expression, i ts presentation common to a l l ALL diseases has rendered i t a useful leukemia marker in c l i n i c a l diagnosis. Additional leukemia/lymphoma-associated surface antigens identified in human include a 150,000 M r glycoprotein by SN1 MAb, called TALLA (Seon et a l . , 1983). It appears to be specif ical ly expressed on T ce l l ALL. No reactivity of the SN1 MAb with various normal tissues has been detected (Matsuzaki and Seon, 1987). The human T lymphocyte virus type-I (HTLV-I) is thought to be an important causative agent of adult T ce l l leukemia (ATL). The HTLV-I provirus is found in a l l some of ATL and i ts genes are expressed in cultured c e l l l ines (Franchini et a l . , 1984). Antisera from ATL patients have identified on the ATL c e l l surface v i r a l envelope glycoproteins of 21,000 M r and 46,000 M r as well as their precursor of 65,000 M r in size (Schupbach et a l . , 1984; Sugamura et a l . , 1984; Matsushita et a l . , 1986). However, consistent v i r a l expression is not needed to maintain the neoplastic state, as no v i r a l transcription is detected in some fresh leukemia cel ls (Franchini et a l . , 1984) and the v i r a l envelope proteins are not present on HTLV-I-transformed non-producer cel ls (Schupbach et a l . , 1984). ATL cells appear to be restricted to the CD4+ T c e l l subset (Hattori et a l . , 1981). A notable characteristic of ATL cel ls and in v i tro HTLV-I-transformed cel ls is the constitutively high expression of the functional IL-2R on the c e l l surface (Depper et a l . , 1984; Gazzolo et a l . , 1987) and, in some cases, the production of IL-2 (Gootenberg et a l . , 1981; Inoue et a l . , 1986; Gazzolo et a l . , 1987). It has been shown that the HTLV-I genome contains a unique locus that produces a trans-activating factor tat-I (also known as x-lor or p40 x), which activates transcription from the promotors of IL-2 and IL-2R a genes (Cross et a l . , 1987; Maruyama et a l . , 1987; Siekevitz et a l . , 1987). The induced IL-2R a subunit then associates with the constitutively expressed IL-2R 6 subunit to form the functional IL-2R. The coexpression of IL-2 and IL-2R has implicated an aberrant IL-2 Chapter One p. 48 autocrine stimulation loop, which constitutes to the i n i t i a l continual prol i feration of HTLV-I-infected cel ls (Arima et a l . , 1986; Maruyama et a l . , 1987; Yamada et a l . , 1987), and may predispose them for the induction of chromosomal abnormalities characteristic of most tumorigenic ATL cel ls (Sanada et a l . , 1985). Epstein-Barr virus (EBV) is another human virus that is believed to be involved in the development of leukemias/lymhomas. It is a herpesvirus that causes infectious mononucleosis as a primary disease and remains latent in human B lymphocytes, transforming them into lymphoblastoid cel ls (Henle et a l . , 1967). It is frequently found in African Burkitt lymphoma (BL), a B c e l l neoplasia, as episomes or integrated into the host genome. In v i tro , EBV infection of human lymphocytes rapidly induces sustained c e l l prol i ferat ion (Pope et a l . , 1968). In EBV+ BL cel ls and in vitro-transformed ce l l s , the EBV genome encodes a latent infection membrane protein (LMP) (60,000 M r) which consists of six hydrophobic transmembrane domains and a large (200 amino acids) cytoplasmic carboxy-terminus (Fennewald et a l . , 1984). Recently, i t has been shown that the LMP antigen patches on the ce l l surface with strong association to the submembrane cytoskeletal protein vimentin, abruptly altering the distribution of vimentin which is normally organized into filaments (Liebowitz et a l . , 1987). The functional implication of such cytoskeletal interaction is s t i l l unknown. However, the significance of LMP in transformation has been suggested by transfection studies in which the LMP expression in fibroblast c e l l lines NIH3T3 and Rat-1 has led to the loss of contact inhibit ion of growth, the reduction in serum requirement, and anchorage independence (Wang et a l . , 1985). Nonetheless, the role of EBV and LMP in the generation of BL is s t i l l obscure because not a l l BL cel ls carry the EBV genome. The chromosomal translocation of c-myc oncogene in juxtaposition to the highly active enhancer of the Ig locus is more commonly observed (Zech et a l . , 1976). Chapter One 1.4 THESIS OBJECTIVES p. 49 T lymphocytes are central in maintaining a ful ly responsive immune system. The heterogeneity of T cel ls and the functional specialization of each subpopulation underlie the basis of their diverse' immunological functions. Many of the T ce l l functions, regulatory or effector, are known to involve ce l lular interactions, mediated either by direct c e l l contact or by response to soluble regulatory factors. T c e l l surface antigens are thought to play significant roles in these interactions. In the past, many T c e l l surface molecules have been identified by the use of MAb's and have been found useful in studying the functions and properties of different T c e l l subpopulations. They include antigens with important biological properties such as receptors for antigens, soluble regulatory factors, homing ligands, and other c e l l surface ligands in c e l l - c e l l interactions. Yet, the precise functions of many other antigens remain to be elucidated. The objective of my thesis is to characterize a novel T c e l l surface antigen, called YE1/48. YE1/48 is defined by two rat MAb's, YE1/48.10.6 and YE1/32.8.5, which were generated against mitogen-activated murine T lymphocytes. It is a disulphide-linked dimeric molecule of 90-95,000 M r , composed of 45-50,000 M r subunits with distinct isoelectric points. The molecular size and the apparent heterodimeric structure of the YE1/48 antigen resemble properties of the murine TCR-a/0 dimer. By flow cytometric analysis, the two anti-YEl/48 MAb's react with only two T lymphoma c e l l lines EL-4 and MBL-2(4.1), but not with normal resting or proliferating lymphocytes. This specific reactivity of the MAb's with only two T c e l l lines compares closely to the i n i t i a l identif ication of the TCR-a/0 by clonotypic MAb's on antigen-specific T c e l l clones. Since no other dimeric molecules of similar size had been identified at that time, i t appeared that YE1/48 might be the authentic murine TCR-a/0. Chapter One p. 50 The f i r s t phase of my research (described in Chapter Three) involved the biochemical analysis of the YE1/48 antigen and the determination of i ts expression in normal lymphoid ce l l populations by immunoprecipitation. Both the biochemical data and the antigen distribution revealed some s imi lar i t ies as well as differences between YE1/48 and murine TCR-a/6. In the second phase of my research (described in Chapter Four), I attempted to determine i f the YE1/48 antigen was the authentic murine TCR-a/8. Since the YE1/48.10.6 and YE1/32.8.5 MAb's do not show detectable binding on intact normal c e l l surface, no biological effects on T c e l l activation could be derived by perturbation of the YE1/48 antigen. Two approaches were used to direct ly compare YE1/48 with TCR-a/8. The f irs t approach employed immunological methods such as sequential immunoprecipitation of YE1/48 and TCR-a/6 from the EL-4 ce l l l ine . The second approach was to compare the part ia l amino acid sequences of YE1/48 to the published TCR sequences. These experiments together concluded that YE1/48 is distinct from TCR-a/8 or TCR-y/6. In the third phase of my research (described in Chapter Five), I undertook the molecular cloning of YE1/48 in an attempt to elucidate i t s possible function and correlation with other known antigens. Although the sequence of the YE1/48 cDNA clone isolated has not revealed definit ive conclusions on the function of the antigen and i ts correlation with other proteins, genetic analyses using the cDNA clone as a probe have demonstrated some intriguing properties of the YE1/48 antigens. In summary, this thesis w i l l describe the detailed characterization of a novel T c e l l surface antigen, YE1/48, encompassing its i n i t i a l identi f icat ion, i t s discrimination from TCR-a/6, and the isolation of a cDNA clone. Although the function of the YE1/48 antigen remains unknown, the data obtained has suggested possible correlation of the YE1/48 expression with lymphocyte transformation, and w i l l be useful in prospective studies. Chapter One p. 51 1.5 REFERENCES Acuto, 0., Meuer, S .C . , Hodgdon, J . C , Schlossman, S.F. and Reinherz, E . L . (1983) Peptide var iabi l i ty exists with a and 0 subunits of the T c e l l receptor for antigen. J . Exp. Med. 158:1368. Aggrawal, B .B . , Essalu, T . E . and Hass P.E. (1985) Charaterization of receptors for human tumour necrosis factor and their regulation by y-interferon. Nature 318:665. Albert, F . , Hua, C . , Thuneh, A . , Pierres, M. and Schmitt-Verhulst. (1985) Distinction between antigen receptor and IL2 receptor triggering events in the activation of alloreactive T ce l l clones with calcium ionophore and phorbol ester. J . Immunol. 134:3649. Alcover, A . , Weiss, M . J . , Daley, J . F . and Reinherz, E . L . (1986) The T i l glycoprotein is functionally linked to a calcium channel in precursor and mature T-lineage ce l l s . Proc. Natl. Acad. Sci . USA 83:2614. Al l i son , J . P . , Ridge, L . , Lund, J . , Gross-Pelose, J . G . , Lanier, L. and Mclntyre, B.W. (1984) Tumor-specific antigen of murine T-lymphoma defined with monoclonal antibody. J . Immunol. 129:2293. Anderson, P. , Blue, M . - L . , Morimoto, C. and Schlossman, S.F. (1987) Cross-l inking of T3 (CD3) with T4 (CD4) enhances the proliferation of resting T lymphocytes. J . Immunol. 139:678. Anderson, D.C. and Springer, T.A. (1987) Leukocyte adhesion deficiency: an inherited defect in the Mac-1, LFA-1, and pl50,95 glycoproteins. Ann. Rev. Med. 38:175. Ang, S . - L . , Seidman, J . G . , Peterman, G.M., Duby, A . D . , Benjamin, D. , Lee, S .J . and Hafler, D.A. (1987) Functional y chain-associated T c e l l receptors on cerebrospinal fluid-derived natural k i l l e r - l i k e T c e l l clones. J . Exp. Med. 165:1453. Antin, J . H . , Emerson, S .G. , Martin, P . , Gadol, N. and Ault, K.A. (1986) Leu-1 + (CD5+) B ce l l s . A major lymphoid subpopulation in human fetal spleen: phenotypic and functional studies. J . Immunol. 136:505. Arima, N . , Daitoku, Y . , Ohgaki, S., Fukumori, J . , Tanaka, H . , Yamamoto, Y . , Fujimoto, K. and Onoue, K. (1986) Autocrine growth of interleukin 2-producing leukemic cel ls in a patient with adult T c e l l leukemia. Blood 68:779. Aruffo, A. and Seed, B. (1987) Molecular cloning of a CD28 cDNA by a high-efficiency COS ce l l expression system. Proc. Natl . Acad. Sc i . USA 84:8573. Band, I . and Chess, L. (1985) Perturbation of the T4 molecule transmits a negative signal to T ce l l s . J . Exp. Med. 162:1294. Barthels, D. , Santoni, M . - J . , Wille, W. , Ruppert, C , C h i a x , J . - C , Hirsch, M.-R. , Fonteci l la , J . C . and Goridis, C. (1987) Isolation and nucleotide sequence of mouse NCAM cDNA that codes for a M r 79,000 polypeptide without a membrane-spanning region. EMB0 6:907. Chapter One p. 52 Ben Slimane, S., Houll ier, F . , Tucker, G. and Thiery, J . P . (1983) In vi tro migration of avian homopoietic cel ls to the thymus: preliminary characterization of a chemotactic mechanism. Ce l l d i f f . 13:1. Benedict, S .H. , Mi l l s , G.B. and Gelfand, E.W. (1987) Interleukin 2 activates a receptor-associated protein kinase. J . Immunol. 139:1694. Bensussan, A . , Acuto, 0., Hussey, R . E . , Milanese, C. and Reinherz, E . L . (1984) T3-Ti receptor triggering of T8 + suppressor T cel ls leads to unresponsiveness to interleukin-2. Nature 311:565. Biddison, W.E., Rao, P . E . , Tal le , M.A., Goldstein, G. and Shaw, S. (1982) Possible involvement of the 0KT4 molecule in T ce l l recognition of class II HLA antigens. J . Exp. Med. 156:1065. Bierer, B . E . , Peterson, A . , Barbosa, J . , Seed, B. and Burakoff, S .J . (1988) Expression of the T-ce l l surface molecule CD2 and an epitope-loss CD2 mutant to define the role of lymphocyte function-associated antigen 3 (LFA-3) in T - c e l l activation. Proc. Natl . Acad. Sci . USA 85:1194. Bird, T.A. and Saklatvala, J . (1986) Identification of a common class of high af f in i ty receptors for both types of porcine interleukin-1 on connective tissue ce l l s . Nature 324:263. Blau, H.M., Pavlath, G .K. , Harderman, E . C . , Chiu, C . - P . , Si lberstein, L. , Webster, S .G. , Mi l l er , S.C. and Webster, C. (1985) Plast ic i ty of the differentiated state. Science 230:758-766. Boom, W.H., Liano, D. and Abbas, A.K. (1988) Heterogeneity of helper/inducer T lymphocytes. II . Effects of interleukin 4- and interleukin 2-producing T c e l l clones on resting B lymphocytes. J . Exp. Med. 167:1350. Borst, J . , Alexander, S., Elder, J . and Terhorst, C. (1983a) The T3 complex on human T lymphocytes involves four structurally distinct glycoproteins. J . B i o l . Chem. 258:5135. Borst, J . , Prendivi l le , M.A. and Terhorst, C. (1983b) The T3 complex on human thymus-derived lymphocytes contains two different subunits of 20 kDa. Eur. J . Immunol. 13:576. Borst, J . , van de Griend, R . J . , van Oostveen, J.W., Ang, S . - L . , Melief, C . J . , Seidman, J . G . and Bolhuis, R .L .H. (1987) A T - c e l l receptor y/CD3 complex found on cloned functional lymphocytes. Nature 325:683. Borst, J . , van Dongen, J . J . M . , Bolhuis, R . L . H . , Peters, P . J . , Hafler, D .A. , de Vries, E . and van de Griend, R . J . (1988) Distinct molecular forms of human T c e l l receptor y/5 detected on viable T cel ls by a monoclonal antibody. J . Exp. Med. 167:1625. Brenner, M.B., Trowbridge, I.S. and Strominger, J . L . (1985) Cross-linking of human T ce l l receptor proteins: association between the T c e l l idiotype 8 subunit and the T3 glycoprotein heavy subunit. Cel l 40:183. Brenner, M.B., McLean, J . , Scheft, H . , Riberdy, J . , Ang, S . - L . , Seidman, J . G . , Devlin, P. and Krangel, M.S. (1987) Two forms of the T - c e l l receptor y protein found on peripheral blood cytotoxic T lymphocytes. Nature 325:689. Chapter One p. 53 Boyd, A.W., Wawryk, S.O., Burns, G.F. and Fecondo, J . V . (1988) Intercel lular adhesion molecule 1 (ICAM-1) has a central role in c e l l - c e l l contact-mediated immune mechanisms. Proc. Natl. Acad. Sci . USA 85:3095. Brott ier, P . , Boumsell, L . , Gelin, C. and Bernard, A. (1985) T c e l l activation via CD2 [T, gp50] molecules: accessory cells are required to trigger T c e l l activation via CD2-D66 plus CD2-9.6/Tll^ epitopes. J . Immunol. 35:1624. Cantrel l , D.A. and Smith, K.A. (1984) The interleukin-2 T-ce l l system: a new c e l l growth model. Science 224:1312. Cantrel l , D .A. , Davis, A.A. and Crumpton, M.J. (1985) Activators of protein kinase C down-reguate and phosphorylate the T3/T-ce l l antigen receptor complex of human T lymphocytes. Proc. Natl. Acad. Sci . USA 82:8158. Cantrel l , D. , Davis, A . A . , Londei, M. , Feldman, M. and Crumpton, M.J. (1987) Association of phosphorylation of the T3 antigen with immune activation of T lymphocytes. Nature 325:540. Carding, S.R. and Bottomly, K. (1988) IL-4 (B ce l l stimulatory factor 1) exhibits thymocyte growth factor act iv i ty in the presence of IL-2. J . Immunol. 140:1519. Carpenter, G. (1987) Receptors for epidermal growth factor and other polypeptide mitogens. Ann. Rev. Biochem. 56:881. Carrel , S., Is ler , P . , Salvi , S., Giuffre, L . , Pantaleo, G . , Mach, J . - P . and Cerott ini , J . - C . (1987a) Identification of a novel 45-kDa c e l l surface molecule involved in activation of the human Jurkat T c e l l l ine . Eur. J . Immunol. 17:1395. Carrel , S., Salvi , S., Giuffre, L . , Is ler , P. and Cerott ini , J . - C . (1987b) A novel 90-kDa polypeptide (Tp90) possibly involved in an antigen-independent pathway of T ce l l activation. Eur. J . Immunol. 17:835. Ceuppens, J . L . and Baroja, M.L. (1986) Monoclonal antibodies to the CD5 antigen can provide the necessary second signal for activation of isolated resting T cel ls by solid-phase-bound 0KT3. J . Immunol. 137:1816. Champion, S., Imhof, B .A. , Savagner, P. and Thiery, J . P . (1986) The embryonic thymus produces chemotactic peptides involved in the homing of hemopietic precursors. Ce l l 44:781. Chien, Y . - H . , Becker, D.M., Lindsten, T . , Okamura, M., Cohen, D.I . and Mavis, M.M. (1984) A third type of murine T ce l l receptor gene. Nature 312:31. Chin, Y . H . , Carey, G.D. and Woodruff, J . J . (1980) Lymphocyte recognition of lymph node high endothelium. II . Characterization of an in v i tro inhibitory factor isolated by antibody aff inity chromatography. J . Immunol. 125:1770. Chin, Y . - H . , Rasmussen, R., Cakiroglu, A.G. and Woodruff, J . J . (1984) Lymphocyte recognition of lymph node high endothelium. VI. Evidence of dist inct structures mediating binding to high endothelial cel ls of lymph nodes and Peyer's patches. J . Immunol. 133:2961. Clark, S . J . , Jefferies, W.A., Barclay, A.N. and Gagnon, J . (1987) Peptide and Chapter One p. 54 nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains. Proc. Natl . Acad. Sc i . USA 84:1649. Coffman, R.L. and Weissman, I . L . (1981) B220: a B ce l l - spec i f ic member of the T200 glycoprotein family. Nature 289:681. Colamonici, O.R., Ang, S., Quinones, R., Henkart, P . , Heikkila, R., Gress, R. , Fel ix , C . , Kirsch, I . , Longo, D. , Marti, G . , Seidman, J . G . and Neckers, L.M. (1988) IL-2-dependent expansion of CD3+ large granular lymphocytes expressing T c e l l receptor-yS: evidence for a functional receptor by anti-CD3 activation of cytolysis. J . Immunol. 140:2527. Corbi, A . L . , Mi l l er , L . J . , O'Connor, K . , Larson, R.S. and Springer, T.A. (1987) cDNA cloning and complete primary structure of the a subunit of a leukocyte adhesion glycoprotein, pl50,95. EMBO 6:4023. Corbi, A . L . , Larson, R .S . , Kishimoto, T.K. , Springer, T.A. and Morton, C C . (1988) Chromosomal location of the genes encoding the leukocyte adhesion receptors LFA-1, Mac-1 and pl50,95. J . Exp. Med. 167:1597. Creasey, A . A . , Yamamoto, R. and V i t t , C R . (1987) A high molecular weight component of the human tumor necrosis factor receptor is associated with cytotoxicity. Proc. Natl. Acad. Sci . USA 84:3293. Crocker, P.R. , Jefferies, W.A., Clark, S . J . , Chung, L .P . and Gordon, S. (1987) Species heterogeneity in macrophage expression of the CD4 antigen. J . Exp. Med. 166:613. Cross, S . L . , Feinberg, M.B., Wolf, J . B . , Holbrook, N . J . , Wong-Staal, F. and Leonard, W.J. (1987) Regulation of the human interleukin-2 receptor a chain promotor: activation of a nonfunctional promotor by the transactivator gene of HTLV-I. Ce l l 49:47. Cunningham, B . A . , Hemperly, J . J . , Murray, B .A. , Prediger, E . A . , Brackenbury, R. and Edelman, G.M. (1987) Neural c e l l adhesion molecule: structure, immunoglobulin-like domains, c e l l surface modulation, and alternative RNA spl ic ing. Science 236:799. Damle, N .K. , Doyle, L . V . , Grosmaire, L.S . and Ledbetter, J .A . (1988) Differential regulatory signals delivered by antibody binding to the CD28 (Tp44) molecule during the activation of human T lymphocytes. J . Immunol. 140:1753. Demic, Z . , Haas, W., Zamoyska, R., Parnes, J . , Steinmetz, M. and von Boehmer, H. (1987) Transfection of the CD8 gene enhances T - c e l l recognition. Nature 326:510. Depper, J . M . , Leonard, W.J . , Kronke, M. , Waldmann, T.A. and Greene, W.C. (1984) Augmented T c e l l growth factor receptor expression in HTLV-infected human leukemic T ce l l s . J . Immunol. 133:1691. Dialynas, D.P. , Quan, Z . S . , Wall, K . A . , Pierres, A . , Quintans, J . , Loken, M.R., Pierres, M. and Fitch, F.W. (1983) Characterization of the murine T c e l l surface molecule, designated L3T4, identified by monoclonal antibody GK1.5: s imilarity of L3T4 to the human Leu-3/T4 molecule. J . Immunol. 131:2445. Chapter One p. 55 Dickson, C , Eisenman, R., Fan, H . , Hunter, E. and Teich, N. (1984) Protein biosynthesis and assembly. In: RNA tumor viruses. Ed. Weiss, R., Teich, N . , Varmus, H. and Coffin, J . , Cold Spring Harbor Laboratory, NY. pp.558-572. Dower, S.K. , C a l l , S.M., G i l l i s , S. and Urdal, D.L. (1986a) Similarity between the interleukin 1 receptors on a murine T-lymphoma c e l l l ine and on a murine fibroblast c e l l l ine . Proc. Natl. Acad. Sci . USA 83:1060. Dower, S .K. , Kronheim, S.R., Hopp, T . P . , Cantrel l , M. , Deeley, M. , G i l l i s , S. , Henney, C S . and Urdal, D.L. (1986b) The ce l l surface receptors for interleukin- la and interleukin-10 are identical . Nature 324:266. Doyle, C. and Strominger, J . L . (1987) Interaction between CD4 and class II MHC molecules mediates ce l l adhesion. Nature 330:256. Duijvestijn, A . M . , Schreiber, A.B. and Butcher, E . C (1986) Interferon-y regulates an antigen specific for endothelial cel ls involved in lymphocyte traf f i c . Proc. Natl. Acad. Sci . USA 83:9114. Dukovich, M. , Wano, Y . , thi Bich Thuy, L . , Katz, P . , Cullen, B.R. , Kehr, J . H . and Greene, W.C. (1987) A second human interleukin-2 binding protein that may be a component of high-affinity interleukin-2 receptors. Nature 327:518. Durand, D.B. , Bush, M.R., Morgan, J . G . , Weiss, A. and Crabtree, G.R. (1987) A 275 basepair fragment at the 5' end of the interleukin 2 gene enhances expression from a heterologous promoter in response to signals from the T c e l l actigen receptor. J . Exp. Med. 165:395. Dustin, M . L . , Rothlein, R., Bhan, A . K . , Dinarello, C.A. and Springer, T .A. (1986) Induction by IL-1 and interferon-y: tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1). J . Immunol. 137:245. Dustin, M . L . , Sanders, M . E . , Shaw, S. and Springer, T.A. (1987a) Purified lymphocyte function-associated antigen 3 binds to CD2 and mediates T lymphocyte adhesion. J . Exp. Med. 165:677. Dustin, M . L . , Selvaraj, P . , Mattaliano, R . J . and Springer, T.A. (1987b) Anchoring mechanisms for LFA-3 c e l l adhesion glycoprotein at membrane surface. Nature 329:846. Dustin, M . L . , Singer, K . H . , Tuck, D.T. and Springer, T.A. (1988) Adhesion of T lymphoblasts to epidermal keratinocytes is regulated by interferon y and is mediated by intercel lular adhesion molecule 1 (ICAM-1). J . Exp. Med. 167:1323. van de Elsen, P. , Shepley, B . - A . , Borst, J . , Coligan, J . E . , Markman, A . F . , Orkin, S. and Terhorst, C. (1984) Isolation of cDNA clones encoding the 20K T3 glycoprotein of human T - c e l l receptor complex. Nature 312:413. van de Elsen, P. , Shepley, B . - A . , Cho, M. and Terhorst, C. (1985) Isolation and characterization of a cDNA clone encoding the murine homologue of the human 20K T3/T-ce l l receptor glycoprotein. Nature 314:542. Emmrich, F . , Strittmatter, U. and Eichmann, K. (1986) Synergism in the activation of human CD8 T cells by cross-linking the T - c e l l receptor Chapter One p. 56 complex with the T8 differentiation antigen. Proc. Natl . Acad. Sc i . USA 83:8298. Ezine, S., Weissman, I . L . and Rouse, R.V. (198A) Bone marrow cel ls give rise to dist inct c e l l clones within the thymus. Nature 309:629. Fanger, B .O. , Wakefield, L.M. and Sporn, M.B. (1986) Structure and properties of the cel lular receptor for transforming growth factor type-beta. Biochemistry 25:3083. Farrar, W.L. and Anderson, W.B. (1985) Interleukin-2 stimulates association of protein kinase C with plasma membrane. Nature 315:233. Faure, F . , Jitsukawa, S., Triebel , F. and Hercend, T. (1988) CD3/TiyA: a functional y-receptor complex expressed on human peripheral lymphocytes. J . Immunol. 140:1372. Fennewald, S., van Santen, V. and Kieff , E. (1984) Nucleotide sequence of an mRNA transcribed in latent growth-transforming virus infection indicates that i t may encode a membrane protein. J . V i r o l . 51:411. Ferguson, M.A.J , and Williams, A .F . (1988) Cel l surface anchoring of proteins via glycosyl-phosphatidylinositol structures. Ann. Rev. Biochem. In press. Fernandez-Botran, R., Sanders, V . M . , Oliver, K . G . , Chen, Y.-W., Krammer, P . H . , Uhr, J.W. and Vitetta , E.S. (1986) Interleukin 4 mediates autocrine growth of helper T cel ls after antigenic stimulation. Proc. Natl . Acad. Sc i . USA 83:9689. F e r r i n i , S., Bottino, C . , Biassoni, R., Poggi, A . , Sekaly, R . P . , Moretta, L. and Moretta, A. (1987) Characterization of CD3+, CD4~, CD8- clones expressing the putative T ce l l receptor y gene product: analysis of the activation pathways leading to interleukin 2 production and triggering of the l y t i c machinery. J . Exp. Med. 166:277. Franchini, G . , Wong-Staal, F. and Gallo, R.C. (1984) Human T - c e l l leukemia virus (HTLV-I) transcripts in fresh and cultured cel ls of patients with adult T - c e l l leukemia. Proc. Natl. Acad. Sci . USA 81:6207. Fruit iger , S. , Hughes, G . J . , Hanly, W . C , Kingzette, M. and Jaton, J . - C . (1986) The amino-terminal domain of rabbit secretory component is responsible for noncovalent binding to immunoglobulin A dimers. J . B i o l . Chem. 261:16673. Gabert, J . , Langlet, C , Zamoyska, R., Parnes, J . R . , Schmitt-Verhulst, A . -M. and Malissen, B. (1987) Recognition of MHC class I speci f ic i ty by transfer of the T ce l l receptor and Lyt-2 genes. Ce l l 50:545. Gal la t in , W.M., Weissman, I . L . and Butcher, E . C (1983) A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature 304:30. Gallatin^ M. , St. John, T . P . , Siegelman, M. , Reichert, R., Butcher, E . C . and Weissman, I . L . (1986) Lymphocyte homing receptors. Ce l l 44:673. Garman, R.D. , Jacobs, K . A . , Clark, S.C. and Raulet, D.H. (1987) B - c e l l -stimulatory factor 2 (02 interferon) functions as a second signal for interleukin 2 production by mature murine T ce l l s . Proc. Natl . Acad. Sc i . Chapter One p. 57 USA 84:7629. Gaulton, G.N. and Eardley, D.D. (1986) Interleukin 2-dependent phosphorylation of interleukin 2 receptors and other T ce l l membrane proteins. J . Immunol. 136:2470. Gay, D. , Maddon, P . , Sekaly, R. , Tal le , M.A., Godfrey, M. , Long, E . , Goldstein, G . , Chess, L . , Axel, R., Kappler, J . and Marrack, P. (1987) Functional interaction between human T-ce l l protein CD4 and the major histocompatibility complex HLA-DR antigen. Nature 328:626. Gazzolo, L. and Due Dodon, M. (1987) Direct activation of resting T lymphocytes by human T-lymhocyte virus type I. Nature 326:714. Gelfand, E.W., Cheung, R .K. , Mi l l s , G.B. and Grinstein, S. (1985) Mitogens trigger a calcium-independent signal for proliferation in phorbol-ester-treated lymphocytes. Nature 315:419. Geppert, T.D. and Lipsky, P.E. (1987) Accessory ce l l independent prol i ferat ion of human T4 cel ls stimulated by immobilized monoclonal antibodies to CD3. J . Immunol. 138:1660. Gold, D.P . , Puck, J . M . , Pettey, C . L . , Cho, M. , Coligan, J . , Woody, J . N . and Terhorst, C. (1986) Isolation of cDNA clones encoding the 20K non-glycosylated polypeptide chain of the human T-ce l l receptor/T3 complex. Nature 321:431. Gold, D.P . , Clevers, H . , Alarcon, B . , Dunlap, S. and Novotny, J . (1987) Evolutionary relationship between the T3 chains of the T - c e l l receptor complex and the immunoglobulin supergene family. Proc. Natl . Acad. Sc i . USA 84:7649. Golde, W.T., Kappler, J.W., Greenstein, J . , Malissen, B . , Hood, L. and Marrack, P. (1985) Major histocommpatibility complex-restricted antigen receptor on T ce l l s . VIII. Role of the LFA-1 molecule. J . Exp. Med. 161:635. Golde, W.T., Gay, D. , Kappler, J . and Marrack, P. (1986) The role of LFA-1 in class II restricted, antigen-specific T - c e l l responses. C e l l . Immunol. 103:73. Gootenberg, J . E . , Rescetti, F.W., Mier, J . M . , Gazdar, A. and Gallo, R.C. (1981) Human cutaneous T ce l l lymhoma and leukemic c e l l lines produce and respond to T c e l l growth factor. J . Exp. Med. 154:1403. Gorman, S.D., Sun, Y . H . , Zamoyska, R. and Parnes, J .R. (1988) Molecular linkage of the Ly-3 and Ly-2 genes: requirement of Ly-2 for Ly-3 surface expression. J . Immunol. 140:3646. Grabstein, K . H . , Park, L . S . , Morrissey, P . J . , Sassenfeld, H . , Price, V . , Urdal, D.L. and Widmer, M.B. (1987) Regulation of murine T c e l l prol iferation by B ce l l stimulatory factor-1. J . Immunol. 139:1148. Gray, L . S . , Gnarra, J .R. and Engelhard, V.H. (1987) Demonstration of a calcium influx in cytolytic T lymphocytes in response to target c e l l binding. J . Immunol. 138:63. Greenbaum, L . A . , Horowitz, J . B . , Woods, A . , Pasqualini, T . , Reich, E . - P . and Chapter One p. 58 Bottomly, K. (1988) Autocrine growth of CD4+ T ce l l s . Differential effects of IL-1 on helper and inflammatory T ce l l s . J . Immunol. 140:1555. van de Greind, R . J . , Giphart, M . J . , van Krimpen, B.A. and Bolhuis, R . L . H . (1984) Human T c e l l clones exerting multiple cytolytic act iv i t ies show heterogeneity in susceptibil ity to inhibition by monoclonal antibodies. J . Immunol. 133:1222. Gunter, K . C . , Malek, T.R. and Shevach, E.M. (1984) T cel l -act ivat ing properties of an anti-Thy-1 monoclonal antibody. Possible analogy to 0KT3/Leu-4. J . Exp. Med. 159:716. Gunter, K . C . , Germain, R .N. , Kroczek, R .A . , Saito, T . , Yokoyama, W.M., Chan, C , Weiss, A. and Shevach, E.M. (1987) Thy-l-mediated T - c e l l activation requires co-expression of CD3/Ti complex. Nature 326:505. Hakomori, S . -I . and Kannagi, R. (1983) Glycosphinolipids as tumor-associated and di f ferent ia l markers. J . Natl. Cancer Inst. 71:231. Hakomori, S . -I . (1986) Glycosphinolipids. Sci . Amer. May:44. Hamman, A . , Jablonski-Westrich, D. , Duijvestijn, A . , Butcher, E . C , Baisch, H . , Harder, R. and Thiele, H.-G. (1988a) Evidence for an accessory role of LFA-1 in lymphocyte-high endothelium interaction during homing. J . Immunol. 140:693. Hamman, A . , Jablonski-Westrich, D. , Scholz, K . - U . , Duijvestijn, A . , Butcher, E .C . and Thiele, H. -G. (1988b) Regulation of lymphocyte homing. I . Alterations in homing receptor expression and organ-specific high endothelial venule binding of lymphocytes upon activation. J . Immunol. 140:737. Hara, T. and Fu, S.M. (1985a) Human T ce l l activation: I. Monocyte-independent activation and proliferation induced by anti-T3 monoclonal antibodies in the presence of tumor promoter 12-o-Tetredecanoyl phorbol-13-acetate. J . Exp. Med. 161:641. Hara, T . , Fu, S.M. and Hansen, J .A . (1985b) Human T c e l l activation. II . A new activation pathway used by a major T c e l l population via a disul f ide-bonded dimer of a 44 kilodalton polypeptide (9.3 antigen). J . Exp. Med. 161:1513. Harel-Bellan, A . , Bertoglio, J . , Qui l let , A . , Marchiol, C , Wakasugi, H . , Mishall , Z. and Fradel iz i , D. (1986) Interleukin 2 (IL 2) up-regulates i ts own receptors on a subset of human unprimed peripheral blood lymphocytes and triggers their prol i feration. J . Immunol. 136:2463. Haser, W.G., Saito, H . , Koyama, T. and Tonegawa, S. (1987) Cloning and sequencing of murine T3 y cDNA from a subtractive cDNA l ibrary . J . Exp. Med. 166:1186. Haskins, K . , Kubo, R., White, J . , Pigeon, M., Kappler, J . and Marrack. P. (1983) The major histocompatibility comlex-restricted antigen receptor on T ce l l s . I . Isolation with a monoclonal antibody. J . Exp. Med. 157:1149. Hata, S., Brenner, M.B. and Krangel, M.S. (1987) Identification of putative human T c e l l receptor 8 complementary DNA clones. Science 238:678. Chapter One p. 59 Hatakeyama, M. , Minamoto, S. and Taniguchi, T. (1986) Intracytoplasmic phosphorylation sites of Tac antigen (p55) are not essential for the conformation, function, and regulation of the human interleukin 2 receptor. Proc. Natl. Acad. Sci . USA 83:9650. Hattori , T . , Uchiyama, T . , Toibana, T . , Takatsuki, K. and Uchino, H. (1981) Surface phenotype of Japanese adult T-ce l l leukemia cel ls characterized by monoclonal antibodies. Blood, 58:645. Hedrick, S.M., Cohen, D . I . , Nielsen, E.A. and Davis, M.M. (1984) Isolation of cDNA clones encoding T cel l -speci f ic membrane-associated proteins. Nature 308:149. Hedrick, S.M., Germain, R .N. , Bevan, M . J . , Dorf, M., Engel, I . , Fink, P . , Gascoigne, N . , Heber-Katz, E . , Kapp, J . , Kaufmann, Y . , Sorensen, C . , Taniguchi, M. and Davis, M.M. (1985) Rearrangement and transcription of a T c e l l receptor p^-chain gene in different T ce l l subsets. Proc. Natl . Acad. Sci . USA 82:531. Hehlmann, R. , Schetter, H . , Leib-Mosch, C. and Erf le , V. (1984) Current understanding of virus etiology in leukemia. Recent Results in Cancer Research. Vol . 93. Springer-Verlag Berl in. Heidelberg, pp.1-28. Henle, W. , Diehl, B . , Kohn, G . , zur Hausen, H. and Henle, G. (1967) Herpes type virus and chromosome marker in normal leukocytes after growth with irradiated Burkitt ce l l s . Science 157:1064. Hershko, A. (1983) Ubiquitin: roles in protein modification and breakdown. Ce l l 34:11. Hoffman, S. and Edelman, G.M. (1983) Kinetics of hemophilic binding by embryonic and adult forms of the neural c e l l adhesion molecule. Proc. Natl . Acad. Sci . USA 80:5762-5766. Hoffman, R.W., Bluestone, J . A . , Leo, 0. and Shaw, S. (1985) Lysis of ant i -T3-bearing murine hybridoma cells by human al lospecif ic cytotoxic T c e l l clones and inhibit ion of that lysis by anti-T3 and anti-LFA-1 antibodies. J . Immunol. 135:5. Hood, L . E . , Weissman, I . L . , Wood, W.B. and Wilson, J . H . ed. (1984) Molecular recognition at c e l l surfaces. In: Immunology. The Benjamin/Cummings Publishing Company, Inc. Second edition. Chapter five. pp. 131-167. Hu-Li , J . , Shevach, E . M . , Mizuguchi, J . , Ohara, J . , Mosmann, T. and Paul, W.E. (1987) B c e l l stimulatory factor 1 (interleukin 4) is a potent costimulant for normal resting T lymphocytes. J . Exp. Med. 165:157. Hynes, R.0. (1986) Fibronectins. Sci . Amer. June, p. 42-51. Hynes, R.0. (1987) Integrins: a family of c e l l surface receptors. Ce l l 48:549. Imboden, J . B . and Stobo, J .D. (1985a) Transmembrane signall ing by the T c e l l antigen receptor: perturbation of the T3-antigen receptor complex generates inositol phosphates and releases calcium ions from intracel lular stores. J . Exp. Med. 161:446. Imboden, J . B . , Weiss, A. and Stobo, J .D. (1985b) Transmembrane signall ing by the T3-antigen receptor complex. Immunol. Today 6:328. Chapter One p. 60 Imboden, J . , Weyand, C. and Goronzy, J . (1987) Antigen recognition by a human T c e l l clone leads to increases in inositol trisphosphate. J . Immunol. 138:1322. Imboden, J . B . (1988) The regulation of intracel lular signals during lymhocyte activation. Immunol. Today 9:17. Inoue, J . , Seiki , M., Taniguchi, T . , Tsuru, S. and Yoshida, M. (1986) Induction of interleukin 2 receptor gene expression by p40x encoded by human T - c e l l leukemia virus type I. EMBO 5:2883. Ioannides, C . G . , Itoh, K . , Fox, F . E . , Pahwa, R., Good, R.A. and Platsoucas, C D . (1987) Identification of a second T - c e l l antigen receptor in human and mouse by an anti-peptide y-chain-specific monoclonal antibody. Proc. Natl . Acad. Sci . USA 84:4244. Ishihara, A . , Hou, Y. and Jacobson, K. (1987) The Thy-1 antigen exhibits rapid lateral diffusion in the plasma membrane of rodent lymphoid cel ls and fibroblasts. Proc. Natl. Acad. Sci . USA, 84:1290-1293. Jalkanen, S .T . , Bargatze, R . F . , Herron, L.R. and Butcher, E . C (1986a) A lymphoid c e l l surface glycoprotein involved in endothelial c e l l recognition and lymphocyte homing in man. Eur. J . Immunol. 16:1195. Jalkanen, S., Reichert, R .A . , Gal lat in , W.M., Bargatze, R . F . , Weissman, I . L . and Butcher, E . C (1986b) Homing receptors and the control of lymphocyte migration. Immunol. Rev. 91:39. Jalkanen, S. , Steere, A . C , Fox, R.I . and Butcher, E .C. (1986c) A dist inct endothelial c e l l recognition system that controls lymphocyte traf f i c into inflamed synovium. Science 233:556. Jalkanen, S., Wu, N . , Bargatze, R.F. and Butcher, E .C . (1987) Human lymphocyte and lymphoma homing receptors. Ann. Rev. Med. 38:467. Jitsukawa, S., Faure, F . , Lipinski , M., Triebel , F. and Hercend, T. (1987) A novel subset of human lymphocytes with a T ce l l receptor-y complex. J . Exp. Med. 166:1192. Johnson, P. (1987) A human CD8 (Lyt-3) homologue exists: genomic sequence and expression. Immunogenetics 26:174. Jones, B. and Janeway, C A . (1981) Functional act iv i t ies of antibodies against brain-associated T c e l l antigen. I. Induction of T ce l l prol i ferat ion. Eur. J . Immunol. 11:584. June, C . H . , Rabinovitch, P.S. and Ledbetter, J .A . (1987) CD5 antibodies increase intracel lular ionized calcium concentration in T ce l l s . J . Immunol. 138:2782. Kamoun, M. , Martin, P . J . , Hansen, J . A . , Brown, M.A., Siadak, A.W. and Nowinski, R . C (1981) Identification of a human T lymphocyte surface protein associated with the E-rosette receptor. J . Exp. Med. 153:207. Kappler, J . , Kubo, R., Haskins, K . , Hannum, C , Marrack, P . , Pigeon, M. , Mclntyre, B . , Al l i son , J . and Trowbridge, I. (1983a) The major histocompatibility complex-restricted antigen receptor on T cel ls in mouse and man: identification of constant and variable peptides. Ce l l Chapter One p. 61 35:295. Kappler, J . , Kubo, R., Haskins, K . , White, J . and Marrack, P. (1983b) The mouse T c e l l receptor: comparison of MHC-restricted receptors on two T c e l l hybridomas. Ce l l 34:727. Kaye, J . , Porce l l i , S., Ti te , J . , Jones, B. and Janeway, C . A . J r . (1983) Both a monoclonal antibody and antisera specific for determinants unique to individual cloned helper T ce l l lines can substitute for antigen and antigen-presenting cel ls in the activation of T ce l l s . J . Exp. Med. 158:836. Kaye, J . and Janeway, C . A . , J r . (1984) The Fab fragment of a direct ly activating monoclonal antibody that precipitates a disulphide-linked heterodimer from a helper T c e l l clone blocks activation by either allogeneic Ia or antigen and se l f - l a . J . Exp. Med. 159:1397. Kehrl, J . H . , Roberts, A . B . , Wakefield, L . M . , Jakdowlew, S., Sporn, M.B. and Fauci, A.S. (1986a) Transforming growth factor-0 is an important immunomodulatory protein for human B lymhocytes. J . Immunol. 137:3855. Kehrl, J . H . , Wakefield, L . M . , Roberts, A . B . , Jakowlew, S., Alvarez-Mon, M. , Derynck, R., Sporn, M.B. and Fauci, A.S. (1986b) Production of transforming growth factor 0 by human T lymphoycytes and i ts potential role in the regulation of T ce l l growth. J . Exp. Med. 163:1037. Kehry, M. , Ewald, S., Douglas, R, Sibley, C , Raschke, W., Fambrough, D. and Hood, L. (1980) The Ig u chains of membrane-bound and secreted IgM molecules differ in their C-terminal segments. Ce l l 21:393. Kishimoto, T . K . , Hollander, N . , Roberts, T . M . , Anderson, D.C. and Springer, T.A. (1987a) Heterogeneous mutations in the 0 subunit common to the LFA-1, Mac-1, and pl50,95 glycoproteins cause leukocyte adhesion deficiency. Ce l l 50:193. Kishimoto, T . K . , O'Connor, K . , Lee, A . , Roberts, T.M. and Springer, T.A. (1987b) Cloning of the 0 subunit of the leukocyte adhesion proteins: homology to an extracellular matrix receptor defines a novel supergene family. Ce l l 48:681. Klaus, G.G.B. and Hawrylowicz, C M . (1984) Cell-cycle control in lymphocyte stimulation. Immunol. Today 5:15. Kohler, G. and Milstein, C. (1975) Continuous cultures of fused cel ls secreting antibody of predefined specif ic i ty . Nature 256:495-497. Kohler, G. (1986) Derivation and diversif ication of monoclonal antibodies. Science 233:1281-1286. Komada, Y . , Peiper, S., Tarnowski, B . , Melvin, S., Kamiya, H. and Sakurai, M. (1986) Shedding of the common acute lymphoblastic leukemia antigen (CALLA) by lymphoblastoid c e l l l ines. Leuk. Res. 10:665. Konaka, Y . , Norcross, M.A., Maino, V .C. and Smith, R.T. (1981) Anti-Thy-1-mediated T ce l l activation. Role of soluble factors and expression of interleukin 2 receptors on T ce l l s . Eur. J . Immunol. 11:445. Koning, F . , St ingl , G . , Yokoyama, W.M., Yamada, H . , Maloy, W.L. , Tschachler, Chapter One p. 62 E. , Shevach, E.M. and Coligan, J . E . (1987) Identification of a T3-associated yS T c e l l receptor on Thy-1 + dendritic epidermal c e l l l ines . Science 236:834. Koyasu, S., Suzuki, G . , Asano, Y . , Osawa, H . , Diamantstein, T. and Yahara, I . (1987) Signals for activation and proliferation of murine T lymphocyte clones. J . B i o l . Chem. 262:4689. Kozbor, D. , Moretta, A . , Messner, H.A. , Moretta, L. and Croce, C M . (1987) Tp44 molecules involved in antigen-independent T c e l l activation are expressed on human plasma ce l l s . J . Immunol. 138:4128. Kraal , G . , Weissman, I . L . and Butcher, E . C (1983) Differences in in vivo distribution and homing of T ce l l subsets to mucosal vs nonmucosal lymphoid organs. J . Immunol. 130:1097. Krangel, M.S. , Band, H . , Hata, S., McLean, J . and Brenner, M.B. (1987) Structurally divergent human T ce l l receptor y proteins encoded by dist inct Cy genes. Science 237:64. Krensky, A . M . , Sanchez-Madrid, F . , Robbins, E . , Nagy, J . A . , Springer, T.A. and Burakoff, S .J . (1983) The functional significance, distr ibution, and structure of LFA-1, LFA-2, and LFA-3: c e l l surface antigens associated with CTL-target interactions. J . Immunol. 131:611. Krissansen, G.W., Owen, M . J . , Verbi, W. and Crumpton, M.J. (1986) Primary structure of the T3 y subunit of the T3/T ce l l antigen receptor complex deduced from cDNA sequences: evolution of the T3 y and & subunits. EMBO 5:1799. Kroczek, R .A . , Gunter, K . C , Germain, R.N. and Shevach, E.M. (1986) Thy-1 functions as a signal transduction molecule in T lymphocytes and transfected B lymhocytes. Nature 322:181. Kronenberg, M. , Goverman, J . , Haars, R., Malissen M. , Kraig, E . , P h i l l i p s , L. , Delovitch, T . , Suciu-Foca, N. and Hood, L. (1985) Rearrangement and transcription of the 0-chain genes of the T c e l l antigen receptor in different types of murine lymphocytes. Nature 313:647. Kronenberg, M. , Siu, G . , Hood, L . E . and Shastri, N. (1986) The molecular genetics of the T - c e l l antigen receptor and T - c e l l antigen recognition. Ann. Rev. Immunol. 4:529. Kuno, M. and Gardner, P. (1987) Ion channels activated by inosi to l 1,4,5-trisphosphate in plasma membrane of human T-lymphocytes. Nature, 326:301. Kupfer, A . , Singer, S . J . , Janeway, C.A. and Swain, S.L. (1987) Coclustering of CD4 (L3T4) molecule with the T-ce l l receptor is induced by specific direct interaction of the helper T cel ls and antigen-presenting ce l l s . Proc. Natl . Acad. Sci . USA 84:5888. Kurt-Jones, E . A . , Hamberg, S., Ohara, J . , Paul, W. and Abbas, A.K. (1987) Heterogeneity of helper/inducer T lymphocytes. I. Lymphokine production and lymphokine responsiveness. J . Exp. Med. 166:1774. Lanier, L . L . , Federspiel, N.A. , Ruitenberg, J . J . , Ph i l l ips , J . H . , A l l i son , J . P . , Littman, D. and Weiss, A. (1987) The T c e l l antigen receptor complex expressed on normal peripheral blood CD4~, CD8~ T lymphocytes: a Chapter One p. 63 CD3-associated disulfide-linked y chain heterodimer. J . Exp. Med. 165:1076. Law, S .K .A . , Gagnon, J . , Hildreth, J . E . K . , Wells, C . E . , W i l l i s , A .C. and Wong, A . J . (1987) The primary structure of the 6-subunit of the c e l l surface adhesion glycoprotein LFA-1, CR3 and pl50,95 and i ts relationship to the fibronectin receptor. EMBO 6:915. Le, P . , Denning, S.M., Springer, T . A . . Haynes, B.F. and Singer, K.H. (1987) Anti-LFA-3 monoclonal antibody induces IL-1 release by thymic epi the l ia l cel ls and monocytes. Fdn. Proc. 46:447. (Abstr.) Leca, G . , Boumsell, L . , Fabbi, M. , Reinherz, E . L . and Kanellopoulos, J .M. (1986) The sheep erythrocyte receptor and both a and 6 chains of the human T-lymphocyte antigen receptor bind the mitogenic lect in (phytohaemagglutinin) from Phaseolus vulgaris. Scand. J . Immunol. 23:535. Ledbetter, J . A . , Evans, R . L . , Lipinski , M. , Cunningham-Rundles, C , Good, R.A. and Herzenberg, L .A. (1981a) Evolutionary conservation of surface molecules that distinguish T lymphocytes helper/inducer and cytotoxic/suppressor subpopulations in mouse and man. J . Exp. Med. 153:310. Ledbetter, J . A . , Seaman, W.E., Tsu, T .T . and Herzenberg, L .A. (1981b) Lyt-2 and Lyt-3 antigens are on two different polypeptide subunits linked by disulphide bonds: relationship of subunits to T c e l l cytolytic ac t iv i ty . J . Exp. Med. 153:1503. Ledbetter, J . A . , Martin, P . J . , Spooner, C . E . , Wofsy, D. , Tsu, T . T . , Beatty, P.G. and Gladstone, P. (1985a) Antibodies to Tp67 and Tp44 augment and sustain proliferative responses of activated T ce l l s . J . Immunol. 135:2331. Ledbetter, J . A . , Rose, L . M . , Spooner, C . E . , Beatty, P . G . , Martin, P . J . and Clark,. E.A. (1985b) Antibodies to common leukocyte antigen p220 influence human T ce l l proliferation by modifying IL 2 receptor expression. J . Immunol. 135:1819. Ledbetter, J . A . , Parsons, M. , Martin, P . J . , Hansen, J . A . , Rabinovitch, P.S. and June, C H . (1986) Antibody binding to CD5 (Tp67) and Tp44 T c e l l surface molecules: effects on cycl ic nucleotides, cytoplasmic free calcium, and cAMP-mediated suppression. J . Immunol. 137:3299. Ledbetter, J . , June, C , Grosmaire, L and Rabinovitch, P. (1987) Cross-l inking of surface antigens causes mobilization of intracel lular ionized calcium in T lymhocytes. Proc. Natl. Acad. Sci . USA 84:1384. Lefranc, M.P. and Rabbitts, T.H. (1985) Two tandemly organized human genes encoding the T - c e l l y constant-region sequences show multiple rearrangement in different T-ce l l types. Nature 316:464. Lefrancois, L. and Bevan, M.J. (1985) Functional modifications of cytotoxic T-lymphocyte T200 glycoprotein recognized by monoclonal antibodies. Nature 314:449. Lemke, G. and Axel, R. (1985) Isolation and sequence of a cDNA encoding the major structural protein of peripheral myelin. Ce l l 40:501. Chapter One p. 64 Leo, 0., Foo, M. , Henkart, P .A. , Perez, P . , Shinohara, N . , Segal, D.M. and Bluestone, J .A . (1987a) Role of accessory molecules in signal transduction of cytotoxic T lymhocyte by anti-T c e l l receptor and ant i -Ly-6.2C monoclonal antibodies. J . Immunol. 139:3556. Leo, 0., Foo, M. , Segal, D.M., Shevach, E. and Bluestone, J .A . (1987b) Activation of murine T lymphocytes with monoclonal antibodies: detection on Lyt-2 + cel ls of an antigen not associated with the T c e l l receptor comlex but involved in T c e l l activation. J . Immunol. 139:1214. Leonard, W.J . , Depper, J . M . , Crabtree, G.R., Rudikoff, S., Pumphrey, J . , Robb, R . J . , Kronke, M. , Svetlik, P .B. , Peffer, N . J . , Waldmann, T.A. and Greene, W.C (1984) Moelcular cloning and expression of cDNAs for the human interleukin-2 receptor. Nature 311:626. Lew, A . M . , Pardoll , D.M., Maloy, W.L., Fowlkes, B . J . , Kruisbeek, A . , Cheng, S . - F . , Germain, R .N. , Bluestone, J . A . , Schwartz, R.H. and Coligan, J . E . (1986) Characterization of T ce l l receptor gamma chain expression in a subset of murine thymocytes. Science 234:1401. Lewis, V . A . , Koch, T . , Plutner, H. and Mellman, I. (1986) A complementary DNA clone for a macrophage-lymphocyte Fc receptor. Nature 324:372. Lichtman, A . H . , Kurt-Jones, E.A. and Abbas, A.K. (1987) B-ce l l stimulatory factor 1 and not interleukin 2 is the autocrine growth factor for some helper T lymphocytes. Proc. Natl. Acad. Sci . USA 84:824. Liebowitz, D. , Kopan, R., Fuchs, E . , Sample, J . and Kieff , E. (1987) An Epstein-Barr virus transforming protein associates with vimentin in lymphocytes. Mol. C e l l . B io l . 7:2299. Littman, D.R. (1987a) The structure of the CD4 and CD8 genes. Ann. Rev. Immunol. 5:561. Littman, D.R., Newton, M. , Crommie, D. , Ang, S . - L . , Seidman, J . G . , Gettner, S.N. and Weiss, A. (1987b) Characterization of an expressed CD3-associated Ti y-chain reveals Cy domain polymorphism. Nature 326:85. Lotz, M. , J i r i k , F . , Kabouridis, P . , Tsoukas, C . , Hirano, T . , Kishimoto, T. and Carson, D.A. (1988) B c e l l stimulating factor 2/interleukin 6 is a costimulant for human thymocytes and T lymhocytes. J . Exp. Med. 167:1253. Low, M.G. and Kincade, P.W. (1985) Phosphatidylinositoi is the membrane-anchoring domain of the Thy-1 glycoprotein. Nature 318:62. Low, M.G. and Sa l t i e l , A.R. (1988) Structural and functional roles of glycosyl-phosphatidylinositoi in membranes. Science 239:268-275. Low, T . L . K . and Goldstein, A . L . (1985) Thymic hormines: an overview. Methods Enzymol. 116:213. Lowenthal, J.W. and MacDonald, H.R. (1987) Expression of interleukin 1 receptors is restricted to the L3T4+ subset of mature T lymphocytes. J . Immunol. 138:1. Lowenthal, J .W., Castle, B . E . , Christiansen, J . , Schreurs, J . , Rennick, D. , Ara i , N . , Hoy, P. , Takebe, Y. and Howard, M. (1988a) Expression of high Chapter One p. 65 af f in i ty receptors for murine interleukin 4 (BSF-1) on hemopoietic and nonhemopoietic ce l l s . J . Immunol. 140:456. Lowenthal, J .W., Ransom, J . , Howard, M. and Zlotnik, A. (1988b) Up-regulation of interleukin 4 recetor expression on immature (Lyt-2 _/L3T4~) thymocytes. J . Immunol. 140:474. Lum, L . G . , Orcutt-Thordarson, N . , Seigneuret, M.C. and Hansen, J . A . (1982) In vitro regulation of immunoglobulin synthesis by T c e l l subpopulations defined by a new human T ce l l antigen (9.3). C e l l . Immunol. 72:122. McCulloch, E.A. (1983) Stem cells in normal and leukemic hemopoiesis. Blood 62:1. MacDonald, H.R., Glasebrooke, A . L . , Bron, C . , Kelso, A. and Cerott ini , J . - C . (1982) Clonal heterogeneity in the functional requirement for Lyt-2/3 molecules on cytolytic T lymphocytes (CTL): possible implication for the af f in i ty of CTL antigen receptors. Immunol Rev. 68:89. MacDonald, H.R., Bron, C . , Rousseaux, M., Horvath, C. and Cerott ini , J . - C . (1985) Production and characterization of monoclonal anti-Thy-1 antibodies that stimulate lymphokine production by cytolytic T c e l l clones. Eur. J . Immunol. 15:495. Mclntyre, B.W. and Al l i son , J . P . (1983) The mouse T ce l l receptor: structural heterogeneity of molecules of normal T cel ls defined by xenoantiserum. Cel l 34:739. Makgoba, M.W., Sanders, M . E . , Ginther Luce, G . E . , Dustin, M . L . , Springer, T . A . , Clark, E . A . , Mannoni, P. and Shaw, S. (1988) ICAM-1 a ligand for LFA-1 dependent adhesion of B, T and myeloid ce l l s . Nature 331:86. Malek, T . R . , Ortega, G . , Chan, C . , Kroczek, R.A. and Shevach, E.M. (1986) Role of Ly-6 in lymphocyte activation. II. Induction of T c e l l activation by monoclonal anti-Ly-6 antibodies. J . Exp. Med. 164:709. Malkovsky, M. , Loveland, B . , North, M. , Asherson, G . L . , Gao, L . , Ward, P. and Fiers, W. (1987) Recombinant interleukin-2 directly augments the cytotoxicity of human monocytes. Nature 325:262. Marlin, S.D. and Springer, T.A. (1987) Purified intercel lular adhesion molecule-1 (ICAM-1) is a ligand for lymphocyte function-associated antigen 1 (LFA-1). Ce l l 51:813. Marrack, P. , Endres, R., Shimonkevitz, R., Zlotnik, A . , Dialynas, D. , F i tch , F. and Kappler, J . (1983a) The major histocompatibility complex-restricted antigen receptor on T ce l l s . II . Role of the L3T4 product. J . Exp. Med. 158:1077. Marrack, P . , Shimonkevitz, R., Hannum, C . , Haskins, K. and Kappler, J . (1983b) The major histocompatibility complex-restricted antigen receptor on T ce l l s : IV. An antiidiotypic antibody predicts both antigen and I -spec i f ic i ty . J . Exp. MEd. 158:1635. Marrack, P. and Kappler, J . (1986) The T ce l l and i ts receptor. Sc i . Amer. February, p. 36-45. Martin, P . J . , Ledbetter, J . A . , Morishita, Y . , June, C . H . , Beatty, P.G. and Chapter One p. 66 Hansen, J . A . (1986) A 44 kilodalton ce l l surface homodimer regulates interleukin 2 production by activated human T lymphocytes. J . Immunol. 136:3282. Martorell , J . , V i l e l l a , R., Borche, L . , Rojo, I. and Vives, J . (1987) A second signal for T ce l l mitogenesis provided by monoclonal antibodies CD45 (T200). Eur. J . Immunol. 17:1447. Marusic-Galesic, S., Pardoll , D.M., Saito, T . , Leo, 0., Fowlkes, B . J . , Coligan, J . , Germain, R .N. , Schwartz, R.H. and Kruisbeek, A.M. (1988) Activation properties of T c e l l receptor-yS hybridomas expressing diversity in both y- and 6 chains. J . Immunol. 140:411. Maruyama, M. , Shibuya, H . , Harada, H . , Hatakeyama, M. , Seiki , M. , Fuj i ta , T . , Inoue, J . - I . , Yoshida, M.and Taniguchi, T. (1987) Evidence for aberrant activation of the interleukin-2 autocrine loop by HTLV-I-encoded p40x and T3/Ti complex triggering. Cel l 48:343. Massague, J . (1985) Subunit structure of a high-affinity receptor for type beta-transforming growth factor. Evidence for a disulf ide-l inked glycosylated receptor complex. J . B io l . Chem. 260:7059. Matis, L . A . , Cron, R. and Bluestone, J .A . (1987) Major histocompatibility complex-linked specif ic ity of y& receptor-bearing T lymphocytes. Nature 330:262. Matsunaga, T. (1985) Evolution of the immunoglobulin superfamily by duplication of complementarity. Immunol. Today 6:260. Matsushita, S., Robert-Guroff, M. , Trepel, J . , Cossman, J . , Mitsuya, H. and Broder, S. (1986) Human monoclonal antibody directed against an envelope glycoprotein of human T-ce l l leukemia virus type I. Proc. Natl . Acad. Sci . USA 83:2672. Matsuzaki, H. and Seon, B.K. (1987) Molecular nature of a ce l l membrane antigen specific for human T-ce l l acute lymphoblastic leukemia. Cancer Res. 47:4283. Meuer, S .C . , Schlossman, S.F. and Reinherz, E . L . (1982) Clonal analysis of human cytotoxic T lymphocytes: T4 + and T8 + effector T cel ls recognize products of different major histocompatibility complex regions. Proc. Natl . Acad. Sci . USA 79:4395. Meuer, S .C . , Fitzgerald, K . A . , Hussey, R . E . , Hodgdon, J . C , Schlossman, S.F. and Reinherz, E . L . (1983) Clonotypic structures involved in antigen-specific human T ce l l function. Relationship to the T3 molecular complex. J . Exp. Med. 157:705. Meuer, S . C , Hussey, R . E . , Cantrel l , D.A. , Hodgdon, J . C , Schlossman, S . F . , Smith, K.A. and Reinherz, E . L . (1984a) Triggering of the T3-Ti antigen-receptor complex results in clonal T-ce l l proliferation through an interleukin 2-dependent autocrine pathway. Proc. Natl . Acad. Sc i . USA 81:1509. Meuer, S . C , Hussey, R . E . , Fabbi, M. , Fox, D. , Acuto, 0., Fitzgerald, K . A . , Hodgdon, J . C , Protentis, J . P . , Schlossman, S.F. and Reinherz, E . L . (1984b) An alternative pathway of T-ce l l activation: a functional role for the 50 kd T i l sheep erythrocyte receptor protein. Ce l l 36:897. Chapter One p. 67 Mingari, M . C , Gerosa, F . , Carra, G . , Accolla, R .S . , Moretta, A . , Zubler, R . H . , Valdmann, T.A. and Moretta, L. (1984) Human interleukin-2 promotes proliferation of activated B cel ls via surface receptors similar to those of activated T ce l l s . Nature 312:641. Modlin, R . L . , Brenner, M.B., Krangel, M.S. , duby, A.D. and Bloom, B.R. (1987) T - c e l l receptors of human suppressor ce l l s . Nature 329:541. Moingeon, P . , Ythier, A . , Goubin, G . , Faure, F . , Nowill, A . , Delmon, L . , Rainaud, M. , Forestier, F . , Daffos, F . , Bohuon, C. and Hercend, T. (1986) A unique T - c e l l receptor complex expressed on human fetal lymphocytes displaying natura l -k i l l er - l ike act iv i ty . Nature 323:638. Moingeon, P. , Jitsukawa, S., Faure, F . , Troalen, F, Triebel , F . , Graziani, M. , Forestier, F . , Bel ler, D. , Bohuon, C and Hercend, T. (1987) A y-chain complex forms a functional receptor on cloned human lymphocytes with natural k i l l e r - l i k e act iv i ty . Nature 325:723. Moretta, A . , Pantaleo, G . , Lopez-Botet, M. and Moretta, L. (1985) Involvement of T44 molecules in an antigen-independent pathway of T c e l l activation. Analysis of the correlations to the T ce l l antigen-receptor complex. J . Exp. Med. 162:823. Morimoto, C , Rudd, C . E . , Letvin, N . L . , Hagan, M. and Schlossman, S.F. (1988) 2H1 - a novel antigen involved in T lymphocyte triggering. J . Immunol. 140:2165. Mosmann, T . R . , Cherwinski, H . , Bond, M.W., Giedlin, M.A. and Coffman, R . L . (1986) Two types of murine helper T ce l l clone. I. Definition according to profiles of lymphokine act iv i t ies and secreted proteins. J . Immunol. 136:2348. Mosmann, T.R. and Coffman, R.L. (1987) Two types of mouse helper T - c e l l clone. Implications for immune regulation. Immunol. Today 8:223. Mostov, K . E , . , Friedlander, M. and Blobel, G. (1984) The receptor for transepithelial transport of IgA and IgM contains multiple immunoglobulin-like domains. Nature 308:37. Murre, C , Waldmann, R .A . , Morton, C C , Bongiovanni, K . F . , Waldmann, T . A . , SHows, T.B. and Seidman, J . G . (1985) Human y-chain genes are rearranged in leukemic T cel ls and map to the short arm of chromosome 7. Nature 316:549. Mustelin, T. (1987) GTP dependence of the transduction of mitogenic signals through the T3 complex in T lymphocytes indicates the involvement of a G-protein. FEBS 213:199. Nakanishi, N . , Maeda, K . , Ito, K . , Heller, M. and Tonegawa, S. (1987) T y protein is expressed on murine fetal thymocytes as disulphide-linked heterodimer. Nature 325:720. Nakauchi, H . , Nolan, G.P . , Hsu, C , Huang, H.S. , Kavathas, P. and Herzenberg, L .A. (1985) Molecular cloning of Lyt-2, a membrane glycoprotein marking a subset of mouse T lymphocytes: molecular homology to i ts human counterpart, Leu-2/T8, and to immunoglobulin variable regions. Proc. Natl . Acad. Sci . USA 82:5126. Chapter One p. 68 Newman, R .A . , Sutherland, R. and Greaves, M.F. (1981) The biochemical characterization of a ce l l surface antigen associated with acute lymphoblastic leukemia and lymphocyte precursors. J . Immunol. 126:2024. Newman, W., Fast, L.D. and Rose, L.M. (1983) Blockade of NK c e l l lys i s is a property of monoclonal antibodies that bind to distinct regions of T-200. J . Immunol. 131:1742. Nikaido, T . , Shimizu, A . , Ishida, N . , Sabe, H . , Teshigawara, K . , Maeda, M. , Uchiyama, T . , Yodoi, J . and Honjo, T. (1984) Molecular cloning of cDNA encoding human interleukin-2 receptor. Nature 311:631. Nilsson, K. (1981) Cel l surface antigens on leukemia/lymphoma ce l l s . In: Advances in comparative leukemia research. Ed. Yohn, D.S. and Blakeslee, C.R. , Elsevier North Holland, Inc., pp.181-188. Nisbet-Brown, E . , Cheung, R .K. , Lee, W.W. and Gelfand, E.W. (1985) Antigen-dependent increase in cytosolic free calcium in specific human T-lymphocyte clones. Nature 316:545. Nover, L. (1982) Molecular basis of c e l l differentiation. Chapter four, in: Cel l differentiation. Molecular basis and problems. Ed. Nover, L . , Luckner, M. and Parthier, B . . Springer-Verlag Press, p. 99. Oettgen, H . C , Terhorst, C , Cantley, L . C and Rosoff, P.M. (1985) Stimulation of the T3-T eel receptor complex induces a membrane-potential-sensitive calcium influx. Cel l 40:583-590. Oettgen, H . C , Pettey, C . L . , Maloy, W.L. and Terhorst, C. (1986) A T3-l ike protein complex associated with the antigen receptor on murine T ce l l s . Nature 320:272. O'Flynn, K . , Knott, L . J . , Russul-Saib, M. , Abdul-Gaffar, R., Morgan, G . , Beverley, P . C . L . and, Linch, D.C. (1986) CD2 and CD3 antigens mobilize Ca(2+) independently. Eur. J . Immunol. 16:580. 0'Garra, A . , Umland, S., de France, T. and Christiansen, J . (1988) "B-cell factors" are pleiotropic. Immunol. Today 9:45. Ohara, J . and Paul, W.E. (1987) Receptors for B-cel l stimulatory factor-1 expressed on cel ls of haematopoietic lineage. Nature 325:537. Old, L . J . , Boyse, E.A. and Stockert, E. (1963) Antigenic properties of experimental leukemias. I. Serological studies in vitro with spontaneous and radiation induced leukemias. J . Natl . Cancer Inst. 31:977. Old, L . J . (1988) Tumor necrosis factor. Sci . Amer. May:59. Olde, W.T., Gay, D. , Kappler, J . ana Marrack, P. (1986) The role of LFA-1 in class II restricted, antigen-specific T-ce l l responses. C e l l . Immunol. 103:73. Oppenheim, J . J . , Kovacs, E . J . , Matsushima, K. and Durum, S.K. (1986) There is more than one interleukin 1. Immunol. Today 7:45. Oppenheim, J . J . , Ruscetti, F.W. and Faltynek, C R . (1987) Interleukins & interferons. In: Basic and c l i n i c a l immunology, Ed: Stites, D.P . , Stobo, J .D. and Wells, J . V . , Sixth edition, Appleton & Lange, Norwalk, Chapter One p. 69 Connecticut/Los Altos, Cal i fornia, pp.82-95. Owens, T . , Fazekas de St. Groth, B. and Mi l ler , J . F . A . P . (1987) Coaggregation of the T - c e l l receptor with CD4 and other T-ce l l surface molecules enhances T - c e l l activation. Proc. Natl. Acad. Sci . USA 84:9209. Palacios, R., Sideras, P. and von Boehmer, H. (1987) Recombinant interleukin 4/BSF-l promotes growth and differentiation of intrathymic T c e l l precursors from fetal mice in v i tro . EMBO 6:91. Pals, S .T . , van Otter, A . , Miedema, F . , Kabel, P . , Keizer, G.D., Scheper, R . J . and Meijer, C . J . L . M . (1988) Evidence that leukocyte function-associated antigen-1 is involved in recirculation and homing of human lymphocytes via high endothelial venules. J . Immunol. 140:1851. Pantaleo, G . , Olive, D., Poggi, A . , Moretta, L. and Moretta, A. (1986) Signal transducing mechanisms involved in human T ce l l activation via surface T44 molecules. Comparison with signals transduced via the T c e l l receptor complex. Eur. J . Immunol. 16:1639. Pantaleo, G . , F e r r i n i , S., Zocchi, M.R., Bottino, C . , Biassoni, R. , Moretta, L. and Moretta, A. (1987a) Analysis of signal transducing mechanisms in CD3+CD4~CD8~ cel ls expressing the putative T ce l l receptor y gene product. J . Immunol. 139:3580. Pantaleo, G . , Olive, D. , Poggi, A . , Kozumbo, W.J . , Moretta, L. and Moretta, A. (1987b) Transmembrane signalling via the Til-dependent pathway of human T c e l l activation. Evidence for the involvement of 1,2-diacylglycerol and inosi to l phosphates. Eur. J . Immunol. 17:55. Pardoll , D .M., Fowlkes, B . J . , Bluestones, J . A . , Kruisbeek, A . , Maloy, W.L. , Coligan, J . E . and Schwartz, R.H. (1987) Differential expression of two dist inct T-ce l l receptors during thymocyte development. Nature 326:79. Park, L . S . , Friend, D., Grabstein, K. and Urdal, D .L. (1987) Characterization of the high-affinity cell-surface receptor for murine B-ce l l stimulating factor 1. Proc. Natl . Acad. Sci . USA 84:1669. Pecht, I . , Corcia, A . , L iuzz i , M.P.T. , Alcover, A. and Reinherz, E . L . (1987) Ion channels activated by specific Ti or T3 antibodies in plasma membranes of human T ce l l s . EMBO 6:1935. Pesando, J . M . , Tomaselli, K . J . , Lazarus, H. and Schlossman, S.F. (1983) Distribution and modulation of a human leukemia-associated antigen (CALLA) J . Immunol. 131:2038. Pfeifer, J.D., McKenzie, D .T . , Swain, S.L. and Dutton, R.W. (1987) B c e l l stimulatory factor 1 (interleukin 4) is sufficient for the prol i feration and differentiation of lectins-stimulated cytotoxic T lymphocyte precursors. J . Exp. Med. 166:1464. P h i l l i p s , J . H . , Weiss, A . , Gemlo, B . T . , Rayner, A.A. and Lanier, L . L . (1987) Evidence that the T ce l l antigen receptor may not be involved in cytotoxicity mediated by yl8 and a/p thymic c e l l l ines. J . Exp. Med. 166:1579. Pillemer, E . , Whitlock, C. and Weissman, I . L . (1984) Transformation-associated proteins in murine B-cel l lymphomas that are distinct from Abelson virus Chapter One p. 70 gene products. Proc. Natl. Acad. Sci . USA 81:4434. de Plaen, E . , Lurquin, C . , van Pel, A . , Mariame, B . , Szikora, J . - P . , Wolfel, T . , S i b i l l e , C . , Chomez, P. and Boon, T. (1988) Immunogenic (turn-) variants of mouse tumor P815: cloning of the gene of turn- antigen P91A and identif ication of the turn- mutation. Proc. Natl . Acad. Sc i . USA 85:2274. Plaut, M. (1987) Lymhocyte hormone receptors. Ann. Rev. Immunol. 5:621. Plunkett, M . L . , Sanders, M . E . , Selvaraj, P . , Dustin, M.L. and Springer, T.A. (1987) Rosetting of activated human T lymphocytes with autologous erythrocytes: definition of the receptor and ligand molecules as CD2 and lymphocyte function-associated antigen 3 (LFA-3). J . Exp. Med. 165:664. Poggi, A . , Bottino, C , Zocchi, M.R., Pantaleo, G . , Ciccone, E . , Mingari, C. , Moretta, L. and Moretta, A. (1987) CD3+WT31" peripheral T lymphocytes lack T44 (CD28), a surface molecule involved in activation of T cel ls bearing the a/6 heterodimer. Eur. J . Immunol. 17:1065. Pope, J . H . , Home, M.K. and Scott, W. (1968) Transformation of foetal human leukocytes in vitro by f i l trates of a human leukaemic c e l l l ine containing Herpes-like virus. Int. J . Cancer 3:857. Rabbitts, T . H . , Lefranc, M. -P . . Stinson, M.A., Sims, J . E . , Schroder, J . , Steinmetz, M. , Spurr, N . L . , Solomon, E. and Goodfellow, P.N. (1985) The chromosomal location of T-cel receptor genes and a T c e l l rearranging gene: possible correlation with specific translocations in human T c e l l leukaemia. EMBO 4:1461. Ralph, P . , Jeong, G . , Welte, K . , Mertelsmann, R., Rabin, H . , Henderson, L . E . , Souza, L . M . , Boone, T .C . and Robb, R . J . (1984) Stimulation of immunoglobulin secretion in human B lymphocytes as a direct effect of high concentrations of IL-2. J . Immunol. 133:2442. Ranges. G . E . , Zlotnik, A . , Espevik, T . , Dinarello, C A . , Cerami, A. and Palladino, M.A. (1988) Tumor necrosis factor a/cachectin is a growth factor for thymocytes. Synergistic interactions with other cytokines. J . Exp. Med. 167:1472. Ratnofsky, S . E . , Peterson, A . , Greenstein, J . L . and Burakoff, S .J . (1987) Expression and function of CD8 in a murine T c e l l hybridoma. J . Exp. Med. 166:1747. Ravetch, J . V . , Luster, A . D . , Weinschank, R., Kochan* J . , Pavlovec, A . , Portnoy, D.A. , Hulmes, J . , Pan, Y . - C E . and Unkeless, J . C . (1986) Structural heterogeneity and functional domains of murine immunoglobulin G Fc receptors. Science 234:718. Reinherz, E . L . , Rung, P . C . , Goldstein, G. and Schlossman, S.F. (1979a) Separation of functional subsets of human T cells by a monoclonal antibody. Proc. Natl. Acad. Sci . USA 76:1061. Reinherz, E . L . , Kuhg, P . C , Goldstein, G. and Schlossman, S.F. (1979b) A monoclonal antibody with selective reactivity with functionally mature human thymocytes and a l l peripheral human T ce l l s . J . Immunol. 123:1312. Reinherz, E . L . , Meuer, S . C , Fitzgerald, K . A . , Hussey, R . E . , Levine, H. and Chapter One p. 71 Schlossman, S.F. (1982) Antigen recognition by human T lymphocytes is linked to surface expression of the T3 molecular complex. Ce l l 30:735. Reinherz, E . L . , Meuer, S .C . , Fitzgerald, K . A . , Hussey, R . E . , Hodgdon, J . C , Acuto, 0. and Schlossman, S.F. (1983a) Comparison of T3-associated 49-and 43-kilodalton ce l l surface molecules on individual human T c e l l clones: evidence for peptide var iabi l i ty in T ce l l receptor structures. Proc. Natl . Acad. Sci . USA 80:4104. Reinherz, E . L . , Meuer, S . C and Schlossman, (1983b) The human T c e l l receptor: analysis with cytotxic T ce l l clones. Immunol. Rev. 74:83. Reinherz, E . L . , Acuto, 0., Fabbi, M. , Bensussan, A . , Milanese, C , Royer, H.D. , Meuer, S.C. and Schlossman, S.F. (1984) Clonotypic surface structure on human T lymphocytes: functional and biochemical analysis of the antigen receptor complex. Immunol. Rev. 81:95. Reiser, H . , Oettgen, H . , Yeh, E . T . H . , Terhorst, C , Low, M.G. , Benacerraf, B. and Rock, K . L . (1986a) Structural characterization of the TAP molecule: a phosphatidylinositol-linked glycoprotein distinct from the T c e l l receptor/T3 complex and Thy-1. Ce l l 47:365. Reiser, H . , Yeh, E . T . H . , Gramm, C . F . , Benacerraf, B. and Rock, K . L . (1986b) Gene encoding T-cel l -act ivating protein TAP maps to the Ly-6 locus. Proc. Natl . Acad. Sci . USA 83:2954. Risser, R. and Horowitz, J .M. (1983) Endogenous mouse leukemia viruses. Ann. Rev. Genet. 17:85. Ristow, H . - J . (1986) BSC-1 growth inhibitor/type 0 transforming growth factor is a strong inhibitor of thymocyte proliferation. Proc. Natl . Acad. Sc i . USA 83:5531. Roberts, A.B. , ' Anzano, M.A., Lamb, L . C , Smith, J .M. and Sporn, M.B. (1981) New class of transforming growth factors potentiated by epidermal growth factor: isolation from non-neoplastic tissues. Proc. Natl . Acad. Sc i . USA 78:5339. Roberts, A . B . , Frol ik , C . A . , Anzano, M. and Sporn, M.B. (1983) Transforming growth factors from neoplastic and non-neoplastic tissues. Fed. Proc. 42:2621. Rock, K . L . , Yeh, E . T . H . , Gramm, C . F . , Haber, S . I . , Reiser, H. and Benacerraf, B. (1986) TAP, a novel T cel l -act ivating protein involved in the stimulation of MHC-restricted T lymphocytes. J . Exp. Med. 163:315. Rothenberg, E . (1980) Expression of differentiation antigens is subpopulations of mouse thymocytes: regulation at the level of de novo synthesis. C e l l 20:1. Rothlein, R., Dustin, M . L . , Marlin, S.D. and Springer, T.A. (1986) A human intercel lular adhesion molecule (ICAM-1) distinct from LFA-1. J . Immunol. 137:1270. Rouslahti, E. and Pierschbacher, M.D. (1987) New perspecitves in c e l l adhesion: RGD and integrins. Science 238:491. Rubinstein, M. , Novick, D. and Fischer, D.G. (1987) The human interferon-y Chapter One p. 72 receptor system. Immunol. Rev. 97:29. Saga, Y . , Tung, J . - S . , Shen, F.-W. and Boyse, E.A. (1987) Alternative use of 5' exons in the specification of Ly-5 isoforms distinguishing hematopoietic c e l l lineages. Proc. Natl . Acad. Sci . USA 84:5364. St. John, T . , Gal lat in , W.M., Siegelman, M. , Smith, H . T . , Fried, V.A. and Weissman, (1986) Expression cloning of a lymphocyte homing receptor cDNA: ubiquitin is the reactive species. Science 231:845. Saito, H . , Kranz, D.M., Takagaki, Y . , Hayday, A . C . , Eisen, H.N. and Tonegawa, S. (1984a) Complete primary structure of a heterodimeric T - c e l l receptor deduced from cDNA sequences. Nature 309:757. Saito, H . , Kranz, D.M., Takagaki, Y . , Hayday, A . C . , Eisen, H.N. and Tonegawa, S. (1984b) A third rearranged and expressed gene in a clone of cytotoxic T lymphocytes. Nature 312:36. Saito, T . , Weiss, A . , Gunter, K . C . , Shevach, E.M. and Germain, R.N. (1987) Ce l l surface T3 expression requires the presence of both a- anf 8-chains of the T c e l l receptor. J . Immunol. 139:625. Saltzman, E . M . , Thorn, R.R. and Casnellie, J . E . (1988) Activation of a tyrosine protein kinase is an early events in the stimulation of T lymphoctes by interleukin-2. J . B io l . Chem. 263:6956. Salzer, . J . L , Holmes, W.P. and Colman, D.R. (1987) The amino acid sequences of the myelin-associated glycoproteins: homology to the Ig-superfamily. J . C e l l . B i o l . 104:957. Samelson, L . E . , Harford, J . B . and Klausner, R.D. (1985a) Identification of the components of the murine T c e l l antigen receptor complex. Ce l l 43:223. Samelson, L . E . , Harford, J . , Schwartz, R.H. and Klausner, R.D. (1985b) A 20-kDa protein associated with the murine T-ce l l antigen receptor is phosphorylated in response to activation by antigen or concanvalin A. Proc. Natl . Acad, Sci . USA 82:1969. Samelson, L . E . , Davidson, W.F., Morse, H.C.III . and Klausner, R.D. (1986a) Abnormal tyrosine phosphorylation on T - c e l l receptor in lymphoproliferative disorders. Nature 324:674. Samelson, L . E . , Patel, M.D., Weissman, A . M . , Harford, J . B . and Klausner, R.D. (1986b) Antigen activation of murine T cel ls induces tyrosine phosphorylation of a polypeptide associated with the T c e l l antigen receptor. Ce l l 46:1083. Samelson, L . E . , O'shea, J . J . , Luong, H . , Ross, P . , Urdahl, K . B . , Klausner, R.D. and Bluestone, J . (1987) T ce l l antigen receptor phosphorylation induced by an anti-receptor antibody. J . Immunol. 139:2708. Sanada, I . , Tanaka, R., Kumagai, E . , Tsuda, H . , Nishimura, H . , Yamaguchi, K . , Kawano, F . , Fujisawa, H. and Takatsuki, K. (1985) Chromosomal aberrations in adult T ce l l leukemia: relationship to the c l i n i c a l severity. Blood 65:649. Sarmiento, M. , Loken, M.R., Trowbridge, I .S . , Coffman, R.L. and Fitch, F.W. (1982) High molecular weight lymphocyte surface proteins are structurally Chapter One p. 73 related and are expressed on different c e l l populations at different times during lymphocyte maturation and differentiation. J . Immunol. 128:1676. Sayre, P . H . , Chang, H . - C , Hussey, R.E. , Brown, N.R., Richardson, N . E . , Spagnoli, G . , Clayton, L.K.. and Reinherz, E . L . (1987) Molecular cloning and expression of T i l cDNAs reveal a receptor-like structure on human T lymphocytes. Proc. Natl. Acad. Sci . USA 84:2941. Schmitt-Verhulst, A . - M . , Guimezanes, A . , Boyer, C , Poenie, M. , Tsien, R. , Buferne, M. , Hua, C. and Leserman, L. (1987) Pleitropic loss of activation pathways in a T - c e l l receptor a-chain deletion variant of a cytolytic T - c e l l clone. Nature 325:628. Schupbach, J . , Sarngadharan, M.G. and Gallo, R.C. (1984) Antigens on HTLV-infected cel ls recognized by leukemia and AIDS sera are related to HTLV v i r a l glycoprotein. Science 224:607. Schwab, R., Crow, M.K., Russo, C. and Weksler, M.E. (1985) Requirements for T c e l l activation by 0KT3 monoclonal antibody: role of modulation of T3 molecules and interleukin 1. J . Immunol. 135:1714. Seed, B. (1987) An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to i ts receptor CD2. Nature 329:840. Sehgal, P .B . , May, L . T . , Tamm, I. and Vilcek, J . (1987) Human 02 interferon and B-ce l l differectiation factor BSF-2 are identical . Science 235:731. Selvaraj, P . , Plunkett, M . L . , Dustin, M . L . , Sanders, M . E . , Shaw, S. and Springer, T.A. (1987) The T lymphocyte glycoprotein CD2 binds the c e l l surface ligand LFA-3. Nature 326:400. Seon, B .K . , Negoro, S. and Barcos, M. (1983) Monoclonal antibody that defines a unique human T - c e l l . Proc. Natl . Acad. Sci . USA 80:845. Sewell, W.A., Brown, M.H., Dunne, J . and Owen, M.J. (1986) Molecular cloning of the human T-lumphocyte surface CD2 (Ti l ) antigen. Proc. Natl . Acad. Sci . USA 83:8718. Sharon, M. , Siegel, J . P . , Tosato, G . , Yodoi, J . , Gerrard, T . L . and Leonard, W.R. (1988) The human interleukin 2 receptor 0 chain (p70). Direct identif icat ion. Part ial purif ication, and patterns of expression on peripheral blood mononuclear ce l l s . J . Exp. Med. 167:1265. Shaw, S., Ginther Luce, G . E . , Quinones, R., Gress, R . E . , Springer, T.A. and Sanders M.E. (1986) Two antigen-independent adhesion pathways used by human cytotoxic T-ce l l clones. Nature 323:262. Sherr, C . J . , Rettenmier, C.W., Sacca, R., Roussel, M.F . , Look, A.T. and Stanley, E.R. (1985) The c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor CSF-1. Ce l l 41:665. Shively, J . E . and Beatty, J .D. (1985) CEA-related antigens: molecular biology and c l i n i c a l significance. CRC C r i t . Rev. Oncol./Hematol. 2:355. Sibley, D.R., Benovic, J . L . , Caron, M.G. and Lefkowitz, R . J . (1987) Regulation of transmembrane signall ing by receptor phosphorylation. Ce l l 48:913. Chapter One p. 74 Sideras, P . , Noma, T. and Honjo, T. (1988) Structure and function of interleukin 4 and 5. Immunol. Rev. 102:189. Siegel, J . P . , Sharon, M. , Smith, P .L. and Leonard, W.J. (1987) The IL-2 receptor 6 chain (p70): role in mediating signals for LAK, NK, and prol i ferative act iv i t i es . Science 238:75. Siegelman, M. , Bond, M.W., Gal lat in , W.M., St. John, T . , Smith, H . T . , Fried, V.A. and Weissman, I . L . (1986) Cel l surface molecule associated with lymphocyte homing is a ubiquitinated branched-chain glycoprotein. Science 231:823. Siekevitz, M. , Feinberg, M.B., Holbrook, N . , Wong-Staal, F. and Greene, W.C. (1987) Activation of interleukin 2 and interleukin 2 receptor (Tac) promotor expression by the trans-activator (tat) gene product of human T-c e l l leukemia virus, type I. Proc. Natl . Acad. Sci . USA 84:5389. S i l i c iano , R . F . , Pratt, J . C , Schmidt, R . E . , Ritz , J . and Reinherz, E . L . (1985) Activation of cytolytic T lymphocyte and natural k i l l e r c e l l function through the T i l sheep erythrocyte binding protein. Nature 317:428. Simmons, D. , Makgoba, M.W. and Seed, B. (1988) ICAM-1, and adhesion ligand of LFA-1, is homologous to the neural c e l l adhesion molecule NCAM. Nature 331:624. Siu, G . , Clark, S.P. , Yoshikai, Y . , Malissen, M., Yanagi, Y . , Strauss, E. , Mak, T.W. and Hood, L. (1984) The human T ce l l antigen receptor is encoded by variable, diversity, and joining gene segments that rearrange to generate a complete V gene. Cel l 37:393. Smith, K.A. and Cantrel l , D.A. (1985) Interleukin 2 regulates i ts own receptors. Proc. Natl . Acad. Sci . USA 82:864. Smith, K.A. (1987) The two-chain structure of high-affinity IL-2 receptors. Immunol. Today 8:11. Smith, K.A. (1988) The bimolecular structure of the interleukin 2 receptor. Immunol. Today 9:36. Smith, L . J . , Curtis , J . E . , Messner, H.A. , Senn, J . S . , Furthmayr, H. and McCulloch, E.A. (1983) Lineage inf ide l i ty in acute leukemia. Blood 61:1138. Snow, P . , Spits, H . , de Vries, J . and Terhorst, C. (1983) Comparison of target antigens of monoclonal reagents 0KT5, 0KT8, and Leu2A, which inhibit effector function of human cytotoxic T lymphocytes. Hybridoma 2:187. Snow, P .M. , van de Rijn, M. and Terhorst, C (1985) Association between the human thymic differentiation antigens T6 and T8. Eur. J . Immunol. 15:529. Spangrude, G . , Muller-Sieburg, C . F . , Heimfeld, S. and Weissman, I . L . (1988) Two rare populations of mouse Thy-l-*-0 bone marrow cel ls repopulate the thymus. J . Exp.Med. 167:1671. Spits, H . , van Schooten, W., Keizer, H . , van Seventer, G . , van de Rijn , M. , Terhorst, C . and de Vries, J . (1986) Alloantigen recognition is preceded by nonspecific adhesion of cytotoxic T cel ls and target ce l l s . Science Chapter One p. 75 232:403. Spits, H . , Yssel, H . , Takebe, Y . , Arai , N . , Yokota, T . , Lee, F . , Ara i , K . I . , Banchereau, J . and de Vries, J . E . (1987) Recombinant interleukin 4 promotes the growth of human T ce l l s . J . Immunol. 139:1142. Sporn, M.B. and Roberts, A.B. (1988) Peptide growth factors are multifunctional. Nature 332:217. Springer, T . A . , Dustin, M . L . , Kishimoto, T.K. and Marlin, S.D. (1987) The lymphocyte function-associated LFA-1, CD2, and LFA-3 molecules: c e l l adhesion receptors of the immune system. Ann. Rev. Immunol. 5:223. Staunton, D . E . , Marlin, S.D., Stratowa, C . , Dustin, M.L. and Springer, T.A. (1988) Primary structure of ICAM-1 demonstrates interaction between members of the immunoglobulin and integrin supergene families. Ce l l 52:925. Stevens, S .K. , Weissman, I . L . and Butcher, E .C. (1982) Differences in the migration of B and T lymphocytes: organ-selective local ization in vivo and the role of lymphocyte-endothelial c e l l recognition. J . Immunol. 128:844. Stiernberg, J . , Low, M.G., Flaherty, L. and Kincade, P.W. (1987) Removal of lymphocyte surface molecules with phosphatidylinositol-specific phospholipase C: effects on mitogen responses and evidence that ThB and certain Qa antigens are membrane-anchored via phosphatifylinositol. J . Immunol. 138:3877. Stockert, E. and Old, L . J . (1977) Preleukemic expression of TL antigens in X-irradiated C57BL/6 mice. J . Exp. Med. 146:271. Streeter, P.R. , Lakey Berg, E . , Rouse, B . T . N . , Bargatze, R.F. and Butcher, E . C . (1988) A tissue-specific endothelial c e l l molecule involved in lymphocyte homing. Science 331:41. Stroynowski, I . , Soloski, M. , Low, M.G. and Hood, L. (1987) A single gene encodes soluble and membrane-bound forms of the Qa-2 antigen: anchoring of the product by a phospholipid t a i l . Cel l 50:759. Strue l i , M. , Ha l l , L . R . , Saga, Y . , Schlossman, S.F. and Saito, H. (1987) Differential usage of three exons generates at least five different mRNAs encoding human leukocyte common antigens. J . Exp. Med. 166:1548. Sugamura, K . , F u j i i , M. , Ueda, S. and Hinuma, Y. (1984) Identification of a glycoprotein, gp21, of adult T ce l l leukemia virus by monoclonal antibody. J . Immunol. 132:3180. Sussman, J . J . , Saito, T . , Shevach, E . M . , Germain, R.N. and Ashwell, J .D . (1988) Thy-1 and Ly-6-mediated lymphokine production and growth inhibit ion of a T ce l l hybridoma require co-expression of the T c e l l antigen receptor complex. J . Immunol. 140:2520. Swain, S.I. (1983) T ce l l subsets and the recognition of MHC class. Immunol. Rev. 74:129. Takada, S. and Engleman, E.G. (1987) Evidence for an associatin between CD8 molecules and the T ce l l receptor complex on cytotoxic ce l l s . J . Immunol. Chapter One p. 76 139:3231. Takai, Y . , Reed, M . L . , Burakoff, S .J . and Herrmann, S.H. (1987) Direct evidence for a receptor-ligand interaction between the T - c e l l surface antigen CD2 and lymphocyte-function-associated antigen 2. Proc. Natl . Acad. Sci . USA 84:6864. Takai, Y . , Wong, G . G . , Clark, S . C , Burakoff, S .J . and Herrmann, S.H. (1988) B c e l l stimulatory factor-2 is involved in the differectiat ion of cytotoxic T lymphocytes. J . Immunol. 140:508. Takatsu, K. , Kikuchi, Y . , Takahashi, T . , Honjo, T . , Matsumoto, M. , Harada, N . , Yamaguchi, N. and Tominaga, A. (1987) Interleukin 5, a T-cell-derived B-c e l l differentiation factor also induces cytotoxic T lymphocytes. Proc. Natl Acad. Sci . USA 84:4234. Tanaka, K . , Yoshioka, T . , Bieberich, C and Jay, G. (1988) Role of the major histocompatibility complex class I antigens in tumor growth and metastasis. Ann. Rev. Immunol. 6:359. Taylor, M.V., Metcalfe, J . C , Hesketh, T.R. , Smith, G.A. and Moore, J . P . (1984) Mitogens increase phosphorylation of phosphoinositides in thymocytes. Nature 312:462. Teich, N . , Wyke, J . , Mak, T . , Bernstein, A. and Hardy, W. (1984) Pathogenesis of retrovirus-induced disease. In: RNA tumor viruses. Ed. Weiss, R. , Teich, N . , Varmus, H. and Coffin, J . , Cold Spring Harbor Laboratory, NY. pp. 901-921. Thomas, M . L . , Reynolds, P . J . , Chain, A. and Ben-Neriah, Y. (1987) B-ce l l variant of mouse T200 (Ly-5): evidence for alternative mRNA spl ic ing . Proc. Natl . Acad. Sci . USA 84:5360. Treves, S., V i r g i l i o , F . D . , Cerundolo, V . , zanovello, P . , Collavo, D. and Pozzan, T. (1987) Calcium and inositolphosphates in the activation of T cell-mediated cytotoxicity. J . Exp. Med. 166:33. Tr inch ier i , G . , Matsumoto-Kobayashi, M. , Clark, S . C , Seehra, J . , London, L. and Perussia, B. (1984) Response of resting human peripheral blood natural k i l l e r cel ls to interleukin 2. J . Exp. Med. 160:1147. Troy, F . A . , Fenyo, E.M. and Klein, G. (1977) Moloney leukemia virus-induced c e l l surface antigen: detection and characterization in sodium dodecyl sulfate gels. Proc. Natl. Acad. Sci . USA 74:5270. Truneh, A . , Albert, F . , Golstein, P. and Schmitt-Verhulst, A . -M. (1985) Early steps of lymphocytes activation bypassed by synergy between calcium ionophores and phorbol ester. Nature 313:318. Tse, A . C D . , Barclay, N . , Watts, A. and Williams, A . F . (1985) A glycophospholipid t a i l at the carboxyl terminus of the Thy-1 glycoprotein of neurons and thymocytes. Science 230:1003. Tsudo, M. , Goldman, C R . , Bongiovanni, K . F . , Chan, W . C , Winton, E . F . , Yagita, M. , Grimm, E.A. ana Waldmann, T.A. (1987) The p75 peptide is the receptor for interleukin 2 expressed on large granular lymphocytes and is responsible for the interleukin 2 activation of these ce l l s . Proc. Natl . Acad. Sci . USA 84:5394. Chapter One p. 77 Tung, J . - S . , Scheid, M.P., P ierot t i , M.A., Hammerling, U. and Boyse, E.A. (1981) Structural features and selective expression of three Ly-5 + c e l l -surface molecules. Immunogenetics 14:101. Uyttenhove, C . , Coulie, P.G. and van Snick, J . (1988) T c e l l growth and differentiation in induced by interleukin-HPl/IL-6, the murine hybridoma/plasmacytoma growth factor. J . Exp. Med. 167:1417. Wahl, S.M., Hunt, D.A. , Wakefield, L . M . , McCartney-Francis, N . , Wahl, L . M . , Roberts, A.B. and Sporn, M.B. (1987) Transforming growth factor P induced monocyte chemotaxis and growth factor production. Proc. Natl . Acad. Sc i . USA 84:5788. Wahl, S.M., Hunt, D.A. , Wong, H . L . , Doughery, S., McCartney-Francis, N . , Wahl, L . M . , Ellingsworth, L . , Schmidt, J . A . , Hal l , G . , Roberts, A.B. and Sporn, M.B. (1988) Transforming growth factor-P is a potent immunosuppressive agent that inhibits IL-l-dependent lymphocyte prol i feration. J . Immunol. 140:3026. Walker, I . D . , Murray, B . J . , Hogarth, P.M., Kelso, A. and McKenzie, I . F . (1984) Comparison of thymic and peripheral T ce l l Ly-2/3 antigens. Eur. J . Immunol. 14:906. Wang, D. , Liebowitz, D. and Kieff , E. (1985) An EBV membrane protein expressed in immortalized lymphocytes transform established rodent ce l l s . Ce l l 43:831. Wassmer, P . , Chan, C . , Logdberg, L. and Shevach, E.M. (1985) Role of the L3T4-antigen in T ce l l activation. II . Inhibition of T c e l l activation by monoclonal anti-L3T4 antibodies in the absence of accessory ce l l s . J . Immunol. 135:2237. Watson, J . D . , Hopkins, N .H. , Roberts, J.W., Steitz, J . A . and Weiner, A.M. (1987) Molecular biology of the gene. Vol . II . Fourth edition. The Benjamin/Cummings Publishing Company, Inc.-, Menlo, CA. Chapter 25, pp. 992-1001. Weiss, A. and Stobo, J .D. (1984) Requirement for the co-expression of T3 and the T c e l l antigen receptor on a malignant human T ce l l l ine . J . Exp. Med. 160:1284. Weiss, A . , Manger, B. and Imboden, J . (1986) Synergy between the T3/antigen receptor complex and Tp44 in the activation of human T ce l l s . J . Immunol. 137:819. Weissman, I . (1967) Thymus ce l l migration. J . Exp. Med. 126:291. Weissman, A . M . , Samelson, L . E . and Klausner, R.D. (1986) A new subunit of the human T - c e l l antigen receptor complex. Nature 324:480. Weissman, A . M . , Baniyash, M. , Hou, D. , Samelson, L . E . , Burgess, W.H. and Klausner, R.D. (1988) Molecular cloning of the zeta chain of the T c e l l antigen receptor. Science 239:1018. Weyland, C M . , Goronzy, J . and Fathman, C.G. (1987) Modulation of CD4 by antigenic activation. J . Immunol. 138:1351. Widmer, M.B., Acres, R . B . , Sassenfeld, H.M. and Grabstein, K.H. (1987a) Chapter One p. 78 Regulation of cytolytic c e l l populations from human peripheral blood by B c e l l stimulatory factor 1 (interleukin 4). J . Exp. Med. 166:1447. Widmer, M.B. and Grabstein, K.H. (1987b) Regulation of cytolytic T-lymphocyte generation by B-ce l l stimulatory factor. Nature 326:795. Williams, A . F . (1982a) Surface molecules and c e l l interactions. J . Theoret. B i o l . 98:221. Williams, A . F . and Gagnon, J . (1982b) Neuronal c e l l Thy-1 glycoprotein: homology with immunoglobulin. Science 216:696. Williams, J . M . , Deloria, D. , Hansen, J . A . , Dinarello, C . A . , Loertscher, R., Shapiro, H.M. and Strom, T.B. (1985) The events of primary T c e l l activation can be staged by use of sepharose-bound anti-T3 (64.1) monoclonal antibody and purified interleukin 1. J . Immunol. 135:2249. Williams, A . F . and Barclay, A.N. (1988) The immunoglobulin superfamily -domains for c e l l surface recognition. Ann. Rev. Immunol. 6:381. Woodruff, J . J . , Clarke, L.M. and Chin, Y.H. (1988) Specific cell-adhesion mechanisms determining migration pathways of recirculating lymphocytes. Ann. Rev. Immunol. 6:201. Woollett, G.R., Barclay, A . N . , Puklavec, M. and Williams, A . F . (1985) Molecular and antigenic heterogeneity of the rat leukocyte-common antigen from thymocytes and T and B lymphocytes Eur. J . Immunol. 15:168. Yamada, G. , Kitamura, Y. , Sonoda, H. , Harada, H . , Taki, S., Mulligan, R . C , Osawa, H . , Diamantstein, T . , Yokoyama, S. and Taniguchi, T. (1987) Retroviral expression of the human IL-2 gene in a murine T c e l l l ine results in c e l l growth autonomy and tumorigenicity. EMBO 6:2705. Yanagi, Y . , Yoshikai, Y . , Leggett, K . , Clark, S.P., Aleksander, I . and Mak, T.W. (1984) A human T ce l l -speci f ic cDNA clone encodes a protein having extensive homology to immunoglobulin chains. Nature 308:145. Yang, S.O., Chouaib, S. and Dupont, B. (1986) A common pathway for T lymphocyte activation involving both the CD3-Ti complex and CD2 sheep erythrocyte receptor determinants. J . Immunol. 137:1097. Yang, S.O., Rhee, S., Welte, K. and Dupont, B. (1988) Differential in v i tro activation of CD8~CD4+ and CD4_CD8+ T lymphocytes by combinations of anti-CD2 and anti-CD3 antibodies. J . Immunol. 140:2115. Yarden, Y . , Escobedo, J . A . , Kuang, W . - J . , Yang-Feng, T . L . , Daniel, T . O . , Tremble, P .M. , Chen, E . Y . , ANdo, M . E . , Harkins, R .N. , Francke,U., Fried, V . A . , U l l r i c h , A. and Williams, L . T . (1986) Structure of the receptor for platlet-derived growth factor helps define a family of closely related growth factor receptors. Nature 323:226. Yednock, T . A . , Butcher, E . C , Stoolman, L.M. and Rosen, S.D. (1987) Receptors involved in lymphocyte homing: relationships between a carbohydrate-binding receptor and the MEL-14 antigen. J . Cel l B i o l . 104:725. Yeh, E . T . H . , Reiser, H . , Benacerraf, B. and Rock, K . L . (1986a) The expression, function, and ontogeny of a novel T cel l -act ivating protein, TAP, in the thymus. J . Immunol. 137:1232. Chapter One p. 79 Yeh, E . T . H . , Reiser, H . , Benacerraf, B. and Rock, K . L . (1986b) Expression of T-cel l -act ivat ing protein in peripheral lymphocyte subsets. Proc. Natl . Acad. Sci . USA 83:7424. Yeh, E . T . H . , Reiser, H . , Daley, J . and Rock, K . L . (1987) Stimulation of T cel ls via the TAP molecule, a member in a family of activating proteins encoded in the Ly-6 locus. J . Immunol. 138:91. Yelton, D . E . , Margulies, D .H. , Diamond, B. and Scharff, M.D. (1980) Plasmacytomas and hybridomas. Development and applications. In: Monoclonal antibodies. Hybridomas: a new dimension in biological analysis. Ed. Kennett, R . H . , McKearn, T . J . and Bechtol, K.B. Plenum Press, p. 3-17. Yoshikai, Y . , Yanagi, Y . , Suciu-Foca, N. and Mak, T.W. (1984) Presence of T c e l l receptor mRNA in functionally distinct T cel ls and elevation during intrathymic differentiation. Nature 310:506. Zamoyska, R. , Vollmer, A . C . , Sizer, K . C . , Liaw, C.W. and Parnes, J .R. (1985) Two Lyt-2 polypeptides arise from a single gene by alternative spl ic ing patterns of mRNA. Cel l 43:153. Zech, L . , Haglund, V . , Nilsson, K. and Klein, G. (1976) Characteristic chromosomal abnormalities in biopsies and lymphoid-cell l ines from patients with Burkitt and non-Burkitt lymphomas. Int. J . Cancer 17:47. Zlotnik, A . , Ransom, J . , Frank, G . , Fischer, M. and Howard, M. (1987) Interleukin 4 is a growth factor for activated thymocytes: possible role in T - c e l l ontogeny. Proc. Natl. Acad. Sci . USA 84:3856. Chapter Two p. 80 CHAPTER TWO MATERIALS AND METHODS 2.1 SOURCES OF MATERIALS 2.1.1 Animals .81 2.1.2 C e l l l i n e s 81 2.1.3 Monoclonal antibodies 82 2.1.4 Xenoantisera 83 2.1.5 Materials for genetic studies 83 2.2 GENERAL TECHNIQUES FOR BIOCHEMICAL STUDIES 2.2.1 C e l l preparations 84 2.2.2 Flow cytometry (FACS analysis) 85 2.2.3 Surface l a b e l i n g of c e l l s (Iodination) 86 2.2.4 Immunoprecipitation 87 2.2.5 Sequential immunoprecipitation 87 2.2.6 SDS-PAGE analysis 88 2.2.7 Two-dimensional gel analysis — I s o e l e c t r i c focussing (IEF)/SDS-PAGE 88 2.2.8 Diagonal gel analysis 89 2.2.9 T r y p t i c peptide mapping 89 2.2.10 Endoglycosidase F analysis 90 2.3 PURIFICATION OF YE1/48 ANTIGEN 2.3.1 Large scale preparation of c e l l lysates 90 2.3.2 A f f i n i t y chromatography 91 2.3.3 Preparative SDS-PAGE 92 2.3.4 Assessment of purity and y i e l d 93 2.4 PARTIAL AMINO ACID SEQUENCING 2.4.1 T r y p t i c digestion of the p u r i f i e d antigen 93 2.4.2 HPLC separation of t r y p t i c peptides 94 2.5 cDNA CLONING 2.5.1 Synthetic oligonucleotide probes 94 2.5.2 Screening of XgtlO cDNA l i b r a r y 94 2.5.3 DNA Sequencing 95 2.6 GENETIC ANALYSES USING cDNA CLONE 2.6.1 cDNA insert as probes 96 2.6.2 Northern blot analysis 96 2.6.3 Genomic Southern blot analysis 97 2.7 REFERENCES 98 Chapter Two 2.1 SOURCES OF MATERIALS p. 81 2.1.1 Animals C57BL/6 (B6), BIO.BR, BALB/c and C3H mice were obtained from Charles River Canada, Quebec, Canada. Time-mated pregnant C57BL/6 mice were obtained from the Jackson Laboratory, Bar Harbor, ME. 2.1.2 C e l l Lines The T lymphoma c e l l l i n e s EL-4 and MBL-2 are of C57BL/6 mouse o r i g i n . EL-4 c e l l s were chemically induced and MBL-2 c e l l s were induced by Moloney MuLV. They d i f f e r i n the expression of several c e l l surface markers including the r e t r o v i r u s envelope glycoprotein gp70, the Ly-6 related antigens, and the P C - l - l i k e antigens. BW5147 i s an AKR thymic leukemia. NS-1 i s a BALB/c myeloma. B10A/A2/2.2 and BALB/c/Al are two uncharacterized Abelson MuLV-transformed leukemias of BIO and BALB/c o r i g i n s , respectively. A l l of the above c e l l l i n e s were obtained from Dr. E.S. Lennox (MRC Laboratory of Molecular Biology, Cambridge, UK). Variant clones of the MBL-2 c e l l l i n e , MBL-2(4.1) and MBL-2(2.6), were derived i n our laboratory by cloning twice the parental l i n e i n methyl c e l l u l o s e media. AK-1 i s an AKR spontaneous thymic leukemia and BM-3 i s a BALB/c Moloney MuLV-transformed T leukemia. They were generated i n our laboratory from explants of leukemic thymocytes from the appropriate mice. 2PK3 and A20 are BALB/c B c e l l l i n e s obtained from Dr. R. McMaster (University of B r i t i s h Columbia, Vancouver, BC). P815, a DBA/2 mastocytoma and L1210, an uncharacterized DBA/2 leukemia, were obtained from Dr. J . Levy (Univeristy of B r i t i s h Columbia, Vancouver, BC). A l l of the above c e l l l i n e s were grown i n Dulbecco's modified minimum e s s e n t i a l medium containing 5% f e t a l c a l f serum (FCS), 50 U/ml p e n i c i l l i n and 50 ug/ml streptomycin. B6SutAl i s a hemopoietic progenitor c e l l l i n e derived from Friend MuLV-infected culture of C56B1.5 bone marrow c e l l s and was kindly Chapter Two p. 82 provided by Dr. G. Krystal (Terry Fox Laboratory, Vancouver, BC). It was propagated in RPMI 1640 medium containing 20% FCS and 5% pokeweed mitogen-stimulated mouse spleen ce l l conditioned medium. A panel of pre-B c e l l lines were obtained from Dr. F. Lemoine (Terry Fox Laboratory, Vancouver, BC). A l l of them were i n i t i a l l y derived from long term lymphoid bone marrow cultures established by the method of Whitlock and Witte (1982). H9 is a spontaneously transformed BALB/c pre-B c e l l l ine (Lemoine et a l . , 1988a). AB n , A B n B 2 , ABpD^ and AB n H 5 are Abelson MuLV-transformed pre-B c e l l lines (Lemoine et a l . , 1988b), a l l of (C57BL/6 x C3H/HeJ) ?i hybrid or ig in . B n B 2 and BpD^ are the parental untransformed lines of AB n B 2 and ABpD^ respectively. A l l of the transformed pre-B ce l l lines were maintained as feeder-independent cultures in RPMI 1640 medium containing 5% FCS and 50 uM 0-mercaptoethanol (2ME). 2.1.3 Monoclonal Antibodies The YE1 series of rat MAb's was generated in our laboratory from a fusion between rat myeloma Y3 and Fisher 344 rat spleen cel ls immunized with ECA17.9.8, a mouse T c e l l hybrid of EL-4BU and Con A activated AKR spleen cel ls (Takei and Horton, 1981). A l l hybridomas were cloned twice. YE1/48.10.6 and YE1/32.8.5 recognize the same molecule which is the antigen studied in this thesis. YE1/9.9.3 reacts with the transferrin receptor in a l l prol i ferating mouse cel ls (Takei, 1983). YE1/21.2.1 reacts with the CD45 (T200 or LCA) antigen (Trowbridge, 1978). YE1/30.4.1 reacts with the Thy-1 molecule (Williams and Gagnon, 1982). YE6/26.1.1, generated against the MBL-2 c e l l l ine in a similar fashion (Takei, 1987), reacts with the Moloney MuLV envelope protein gp70 (Nowinski et a l . , 1972). TIB 105 (Ledbetter and Herzenberg, 1979) reacts with the murine CD8 (Lyt-2) antigen and was purchased from the Americal Type Culture Collection. GK1.5-177 (Dialynas et a l . , 1983) which reacts with the murine CD4 (L3T4) antigen was a gift from Dr. D. Kilburn Chapter Two p. 83 (University of Br i t i sh Columbia, Vancouver). KJ16-133 reacts with the variable region of the 0 chain of the murine TCR-a/0 (Epstein et a l . , 1985; Roehm et a l . , 1985) on 20% of peripheral T c e l l and 10% of thymocytes (Haskins et a l . , 1984; Roehm et a l . , 1984). It was a gift from Drs. P. Marrack and J . Kappler (National Jewish Hospital and Research Center, Denver, CO). Undiluted culture supernatants of the hybridomas, which were grown in the same media as for the leukemic ce l l lines above, were used as MAb's. 2.1.4 Xenoantisera Polyclonal antisera containing rabbit anti-mouse Ig (RaMIg), rabbit ant i -rat Ig (RaRIg) and mouse anti-rat Ig (MaRIg) antibodies were developed and af f in i ty purified in our laboratory. A rat immune antiserum was also generated by immunizing a Fisher 344 rat with aff ini ty purified YE1/48 antigen (see 2.3.2 below). R3497 is a rabbit antiserum that reacts with the murine TCR-a/0 on a l l T cel ls (Bekoff et a l . , 1986). It was a gif t from Dr. R. Kubo (National Jewish Center for Immunology and Respiratory Medicine, Denver, CO). 2.1.5 Materials for Genetic Studies The oligo(dT)-cellulose was obtained from Pharmacia, Uppsala, Sweden. A l l DNA reaction enzymes and restrict ion enzymes used in this study were also obtained from Pharmacia, except exonuclease III and SI nuclease which were purchased from New England Biolabs, Beverly, MA. Nitrocellulose f i l t e r s were obtained from Schleicher & Schuell, Keene, NH, and nylon membranes (Zeta-Probe) were obtained from BIO-RAD Laboratories, Richmond, CA. A l l 3 2 p _ i a b e i e ( i nucleotides were purchased from New England Nuclear, Boston, MA, Chapter Two 2.2 GENERAL TECHNIQUES FOR BIOCHEMICAL STUDIES p. 84 2.2.1 Ce l l Preparations Single c e l l suspensions from different tissues were prepared by physical agitation. Erythrocytes were removed by lysis in Tris-NH^Cl (pH7.2) from contaminated tissues such as spleen and bone marrow. Separation of thymocytes by peanut lect in agglutination was carried out as described by Reisner et a l . (1976). In brief, thymocytes (2 x 10^ cells/ml) were incubated for 10 minutes at 20°C in phosphate buffered saline (PBS) (pH 7.5) containing 2.5X FCS and 0.5 mg/ml peanut agglutinin (PNA). The mixture was then layered onto a cushion of PBS containing 50% FCS and the agglutinated cel ls were sedimented for 20 minutes at 20°C. The top and bottom fractions were collected separately as PNA- and PNA+ cel ls respectively. Each fraction was washed twice in 0.25 M D-galactose to remove PNA from the ce l l surface. Mitogenic stimulation of spleen cel ls was performed by incubating 2 x 10^  cel ls in 10 ml RPMI 1640 containing 10% FCS, 50 U/ml pen ic i l l in , 50 ug/ml streptomycin, 50 uM 2ME, 10 mM N-2-hydroxyethylpiperazine (HEPES) and 2 ug/ml Con A or 10 ug/ml LPS for 2 days. Con A was subsequently removed by washing the cel ls with 0.1 M a-methylmannoside. Spleen T cel ls from 4-10 weeks old C57BL/6 mice were purified by a single passage of total spleen cel ls through scrubbed nylon wool column in RPMI 1640 containing 5% FCS (Dougherty et a l . , 1986). Spleen B cel ls were purified by panning on plastic surfaces coated with 1/100 dilution of unpurified RaMIg antiserum. In brief, total spleen cel ls were incubated in PBS (pH 7.5) containing 5% FCS (panning medium) on antiserum-coated plastic dishes for 30 minutes at 4°C. After thorough washing and incubation in the same buffer for one hour at 37°C, the adherent B cel ls were recovered by agitation. T c e l l subpopulations defined by CD8 (Lyt-2) and CD4 (L3T4) phenotypes were also purified by a similar panning method except that the selection was Chapter Two p. 85 in a negative manner and non-adherent cel ls were recovered. In the preparation of CD8~CD4~ thymocytes, total thymocytes from 4-5 weeks old mice were pre-incubated in a 1:1 mixture of TIB 105 and GK1.5-177 for one hour at 4°C, whereas in the preparation of CD8+CD4~ and CD8"CD4+ spleen T ce l l s , spleen T cel ls were pre-incubated with either GK1.5-177 or TIB 105, respectively. The cel ls were washed three times in panning medium before incubating for 30 minutes at 4°C on plastic dishes pre-coated with purified RaRIg antiserum. Non-adherent cel ls were then recovered by gentle swirling. The non-adherent populations were further enriched by subjection to two more cycles of panning procedures. The purified c e l l subpopulations were analysed by flow cytometry as described below (2.2.2), for Thy-1, CD45 (T200), and surface immunoglobulin (slg) expression using YE1/30.4.1, YE1/21.2.1 and RaMIg, respectively. 2.2.2 Flow Cytometry (FACS Analysis) Approximately 0.5-1 x 10^ cells were incubated with 50 y l MAb for 30 minutes at 4°C. They were then washed twice with RPMI 1640 containing 10% FCS, 10 mM HEPES and 0.1% NaN3 (or with PBS containing 5% FCS and 0.1% NaN3 i f they were freshly purified lymphocytes) before incubating for 30 minutes at 4°C in 50 p i pre-titrated fluorescein isothiocyanate (FITC)-conjugated purified (Fab') 2 fragments of second antibodies. FITC-conjugated (Fab')2 goat anti-rat IgG (FITC-GaRIg) was purchased from Cappel Laboratories (Cooper Biomedical, West Chester, PA). FITC-conjugated (Fab') 2 mouse anti-rat kappa l ight chain (FITC-MaRIgK) was prepared and kindly provided by Dr. P. Lansdorp (Terry Fox Laboratory, Vancouver, BC). Conjugated (Fab')2 fragments of purified RaRIg was prepared in our laboratory. In general, FITC-RaRIg or FITC-GaRIg were used in most analyses and FITC-MaRIgK was used in the analysis of spleen cel ls and pre-B ce l l s . Dead cel ls were stained by 10 yg/ml propidium iodide (5 minutes, 4°C) and were gated out on the basis of red Chapter Two p. 86 fluorescence. The cel ls were washed thrice before being analysed by flow cytometry (model FACS 440, Becton Dickenson Immunocytometry Systems, Mountain View, CA). In the analyses of purified lymphoid ce l l s , the dead cel ls were not stained by propidium iodide. Appropriate gates were set by l ight scatter parameters to exclude the dead cells after the total cel ls were fixed by 1% formalin in PBS and stored overnight. As negative controls, cel ls were stained by the second FITC-antibody alone or by an unrelated MAb in the f irs t incubation. As positive controls, other MAb's to surface markers highly expressed on the test cel ls were used. When unpurified c e l l populations were analysed and discrete fluorescent peaks given by the test MAb were detected on a logarithm scale, the high fluorescent peak could be direct ly translated into the percentage of positive ce l l s . The crossover channel number between the high and low fluorescent peaks in the mixed c e l l population was then used to determine the percentage of positive cel ls in the subsequent purified subpopulations. The percentage of cel ls in the purified subpopulation to the right of this channel was taken as positive. This method was rel iable and the selected channel number has always coincided with the crossover point between the negative control and the test MAb curves of the purified subpopulation ce l l sample. 2.2.3 Surface Labeling Of Cells (Iodination) Ce l l surface proteins were radiolabeled by the iodogen method (Markwell, 1978). In brief, 2-3 x 10^  cultured cells or 5 x 10^  fresh lymphocytes were agitated in an iodogen-coated (100 ug) v i a l in 0.5 ml PBS containing 0.5 mCi 125j_ (Amersham Corporation, Arlington Heights, IL) for one hour at 20°C. In the case of thymocytes, 1.0 mCi was used and the cel ls were incubated for 30 minutes to reduce ce l l death. Radiolabeled cel ls were then washed four times in PBS to remove residual unreacted 125j. Chapter Two p. 87 2.2.4 Immunoprecipitation Radiolabeled cel ls were lysed in 2-3 ml 50 mM Tris-HCl buffer (pH 7*5) containing, 1% (w/v) Triton X-100, 0.5% (w/v) bovine serum albumin (BSA), 0.15 M NaCl and 0.01% (w/v) NaNg. After removal of the nuclei and insoluble materials by microfuging for 10 minutes at 4°C, 30 y l MAb or 50 y l antiserum was added to the lysates and incubated on ice for one hour. Agarose beads (30-50 y l of 50% suspension) coupled with purified RaRIg antibodies (2-4 mg/ml) were then added to the mixture for another two hour incubation at 4°C with mild rotary mixing. For the immunoprecipitation from spleen ce l l s , MaRIg-coupled agarose beads were used to reduce non-specific binding. For the immunoprecipitation with the rabbit antiserum R3497, protein A-coupled agarose beads (Sigma, St. Louis, M0) were used in place of RaRIg-coupled beads. After the incubation, the beads were washed with the same lys is buffer without BSA, and the bound immune complex was eluted by boiling the beads in 50 y l SDS-PAGE sample buffer for 5 minutes. 2.2.5 Sequential Immunoprecipitation EL-4 cel ls (3 x 10 )^ were surface labeled with 125j a nd 3 ml of c e l l lysate was prepared as described above (2.2.3 and 2.2.4). The c e l l lysate was divided into three aliquots. The f irs t aliquot was incubated with 50 y l of YE1/48.10.6 MAb-coupled agarose beads (4 mg antibody/ml beads, 50% suspension of beads) overnight at 4°C. The second aliquot was incubated with 20 y l R3497 (anti-T c e l l receptor antiserum) for 2 hours on ice. Protein A-coupled agarose beads were then added to the mixture and incubated overnight at 4°C. The third aliquot was incubated overnight at 4°C without the addition of antibodies. After the incubation, the agarose beads were removed by centrifugation. The resultant immunodepleted ce l l lysates were then subjected to immunoprecipitation using YE1/48.10.6, R3497, control rat MAb and normal rabbit serum. Chapter Two p. 88 2.2.6 SDS-PAGE Analysis Sodium dodecylsulphate (SDS) polyacrylamide gel electrophoresis (PAGE) analysis was carried out by standard methods (Laemmli, 1970) either using a Protean apparatus (16 cm x 18 cm x 1.2 mm slab gel, BTO-RAD Laboratories, Richmond, CA) or a Mini-Slab apparatus (8 cm x 10 cm x 1 mm, Idea Sc ient i f ic , Corval l i s , OR). Non-reduced protein markers were prepared in our laboratory, consisting of human transferrin (90,000 molecular weight (MW)), BSA (67,000 MW), and ovalbumin (43,000 MW). Reduced protein markers were obtained from BIO-RAD Laboratories and include phosphorylase B (92,500 M r ) , BSA (66,200 M r ) , ovalbumin (45,000 M r ) , carbonic anhydrase (31,000 M r ) , soybean trypsin inhibitor (21,500 M r ) , and lysozyme (14,400 M r ) . Both sets of markers were visualized by Coomassie blue staining. In the analysis of immunoprecipitates from pre-B c e l l l ines, prestained reduced protein markers were used. They were obtained from BIO-RAD Laboratories and include phosphorylase B (130,000 M r ) , BSA (75,000 M r ) , ovalbumin (50,000 M r ) , carbonic anhydrase (39,000 M r ) , soybean trypsin inhibitor (27,000 M r ) , and lysozyme (17,000 M r ) . Specific radiolabeled antigens were detected by autoradiography on KODAK XAR films with Dupont Cronex intensifying screens (Du Pont, Wilmington. DE). 2.2.7 Two-Dimensional Gel Analysis — Isoelectric Focussing (IEF)/SDS-PAGE Two-dimensional gel analysis (IEF vs SDS-PAGE) was performed according to the O'Farrel l ' s method (1975) using ampholines of isoelectric points (pi) 3.5-10.0 (LKB, Bromma, sweden), a homemade IEF apparatus for tube gels (13 cm long), and the Protean Slab Gel apparatus (Bio-Rad Laboratories, Richmond, CA). A mixture of three proteins with known pi's were included in each sample and visualized by Coomassie blue staining after separation; they were human transferrin (pi 5.9), BSA (pi 4.9) and ovalbumin (pi 4.5). Chapter Two p. 89 2.2.8 Diagonal Gel Analysis Samples were separated on 10% SDS-PAGE gels under non-reducing and reducing conditions in the f irs t and second dimensions, respectively. The first-dimensional electrophoresis was performed in tube gels. The tube gels were then equilibrated in reducing sample buffer (containing 5% 2ME) before being turned 90° and laid across the top edge of the second dimension slab gels. Protein markers, BSA (67,000 MW), ovalbumin (43,000 MW) and carbonic anhydrase (31,000 MW), were included in each sample and their separation was visualized by Coomassie blue staining. 2.2.9 Tryptic Peptide Mapping The tryptic peptide mapping procedure was adapted from the modified method of Kappler et a l . (1983). The immunoprecipitate sample was reduced and the subunits were separated by two-dimensional gel analysis as described above (2.2.7). The gel was fixed with 25% isopropanol/10% acetic acid and then washed sequentially with 10% acetic acid and 25% isopropanol. SDS was removed by extensive washing with 10% methanol. The gel was then washed once with d i s t i l l e d water before being dried between dialysis membranes. The two subunits were located by autoradiography and excised. The gel s l ices were rehydrated with 1 ml 0.05 M NH4HCO3 containing 50 ug TPCK-treated trypsin (Sigma, St. Louis, M0). After rehydration, additional 3 ml of 0.05 M NH4HCO3 was added and the mixtures were shaken for 28 hours at 37°C. Supernatants containing the tryptic peptides were then collected and lyophilized thrice to remove NH4HCO3. Lyophilized tryptic peptides were dissolved in a minimal volume of the acidic electrophoresis buffer (acetic acid : formic acid : d i s t i l l e d Water = 15 : 5 : 80). Approximately 5-10 ul of the sample containing 6000 to 8000 counts per minute (cpm) was spotted onto a 20 x 20 x 0.01 cm cellulose-coated thin-layer glass plate (an E. Merck product, from BDH Chemicals Canada Limited, Toronto, ON). The first-dimensional electrophoresis Chapter Two p. 90 was performed at 1000 volts for one hour (Horizontal Electrophoretic Unit, BIO-RAD Laboratories, Richmond, CA). The second-dimensional separation was carried out by thin-layer chromatography in n-butanol : pyridine : acetic acid : d i s t i l l e d water = 35.5 : 25 : 5 : 20. The tryptic peptide fingerprints were visualized by autoradiography. 2.2.10 Endoglycosidase F Analysis Endoglycosidase F digestion was carried out according to Mclntyre and Al l i son (1984). A YE1/48 immunoprecipitate was prepared from 2 x 10^ surface iodinated EL-4 ce l l s . The resultant immunocomplex, composed of the YE1/48.10.6 MAb and the antigen bound to RaRIg-coupled agarose beads, was resuspended in 40 y l of 0.1 M sodium phosphate buffer (pH 6.1) containing 50 mM EDTA, 1% (v/v) Nonidet P-40, 0.1% SDS and 0-5 units of endoglycosidase F enzyme (New England Nuclear, Boston, MA). It was incubated at 37°C for 3 hours (with 0.5 unit of enzyme) or 22 hours (with 0.0, 2.0, 5.0 units of enzyme). The reaction was terminated by washing the beads with lys is buffer, 10 mM Tris-HCl (pH 7.5) containing 1% Triton X-100, 0.15 M NaCl and 0.01% NaN 3. The digested antigen was eluted from the beads by boil ing for 5 minutes in SDS-PAGE sample buffer containing 5% 2ME. It was then analysed by 10% SDS-PAGE under reducing conditions. 2.3 PURIFICATION OF YE1/48 ANTIGEN 2.3.1 Large Scale Preparation Of Cel l Lysates MBL-2(4.1) cel ls (0.7-1.0 x 10 1 0 ) were washed three times in PBS and lysed in 10 mM Tris-HCl buffer (pH 7.5) containing 1% Triton X-100, 0.15 M NaCl and 0.01% NaN3 (1.5 l i t res per 10 1 0 ce l l s ) . The lys is mixture was st irred on ice for 30 minutes and then centrifuged for 90 minutes at 14*000 revolutions per minute (rpm) (JA-14 rotor in a Beckman J2-21 Centrifuge), 4°C, Chapter Two p. 91 to remove the nuclei and insoluble materials. The lysate was then immediately used in af f in i ty purification or stored at -20°C for later use. For the purpose of tracing the course of antigen purif ication, a 2 ml lysate prepared from 2 x 10^ surface iodinated cel ls was added to the large-scale lysate just prior to af f in i ty chromatography. 2.3.2 Aff in i ty Chromatography The YE1/48 Mab was purified from ascites f luid by (NH^^SC^ precipitation (50% saturation) followed by DEAE Aff i -ge l blue chromatography (BIO-RAD Laboratories, Richmond, CA). The column fractions were analysed for IgG purity by SDS-PAGE as well as for specific antibody act iv i t ies by indirect binding assay (Takei, 1983) using MBL-2(4.1) cel ls as the target. The purified antibody fractions were then pooled, dialysed against 0.1 M NaHC03 (pH 8.0) and coupled to Aff i -ge l 10 agarose beads (Bio-Rad Laboratories, Richmond, CA) at 2-4 mg per ml of packed beads. After coupling, the beads were thoroughly washed with Earl 's balanced salt solution containing 0.5% BSA, 10 mM HEPES (pH 7.2) and 0.01% NaN3 to saturate the uncoupled active s i tes . The beads were prewashed extensively with the eluting buffer (see below) followed by lys is buffer immediately before each subsequent use. The large scale MBL-2(4.1) c e l l lysate was incubated with about 3 ml of YE1/48.10.6 MAb-coupled agarose beads on ice for 4 hours with constant agitation. The beads were then packed into a column and were thoroughly washed overnight with 10 mM Tris-HCl buffer (pH 7.5) containing 1% Triton X-100, 0.5 M NaCl and 0.01% NaN3 unt i l no radioactivity could be detected in the flow-through. The column was briefly washed with 10 mM Tris-HCl buffer (pH 7.5) containing 0.1% Triton X-100, 0.15 M NaCl and 0.01% NaN3 before the adsorbed antigen was eluted with 100 mM glycine-HCl buffer (pH 2.9) containing 0.05% Triton X-100, 0.15 M NaCl and 0.01% NaN 3. The radioactive fractions were pooled and immediately neutralized with a few drops of 1 M Tris -HCl Chapter Two buffer (pH 7.5). p. 92 2.3.3 Preparative SDS-PAGE Preparative SDS-PAGE was carried out using the Protean apparatus from BIO-RAD. Precautions were taken to minimize the destruction of amino acid residues on the purified protein by free radicals and oxidants which were trapped in the gel matrix (Hunkapillar et a l . , 1983; Guellaen et a l . , 1984). The acrylamide gels were polymerized overnight and extensively preelectrophoresed with a protein of low MW (such as lysozyme) before use. Sodium thioglycolate was always added at 0.1 mM in the cathodic buffer before electrophoresis. The af f ini ty purified YE1/48 antigen was concentrated by u l t r a f i l t r a t i o n in a Centricon 30 microconcentrator (Amicon Corp., Danvers, MS) at 20°C. An equal volume of SDS-PAGE sample buffer was added to the concentrated antigen which was then denatured for 15 minutes at 55°C to minimize protein aggregation (Hunkapillar et a l . , 1983). It was subsequently separated on a 7.5% preparative SDS-PAGE gel. The gel was heat-dried between two sheets of dialys is membranes and the 90,000 M r YE1/48 antigen was located by autoradiography. The radioactive band was excised, rehydrated in 1/2 x SDS-PAGE running buffer (25 mM Glycine, 12.5 mM Tris and 0.05% SDS), and subjected to electrophoretic elution in a sealed dialysis membrane tubing. The eluant was concentrated in a Centricon 30 microconcentrator. The antigen was then reconstituted to 0.1 M Tris-HCl (pH 8.0), 2% SDS and 50 mM di th iothre i to l , and was incubated in a boiling water bath for 10 minutes. Upon cooling, iodoacetamide was added to a f inal concentration of 50 mM and the mixture was incubated in the dark at 37°C for 45 minutes. The reduced and alkylated antigen was then electrophoresed on a 10% preparative SDS-PAGE gel after the addition of an equal volume of sample buffer. The 45,000 M r antigen subunits, in a single protein band, were located, eluted and concentrated as described Chapter Two p. 93 above. The p u r i f i e d antigen was stored at -20°C u n t i l use. 2.3.4 Assessment Of Purity and Y i e l d Small aliquots of the YE1/48 antigen p u r i f i e d from the i n i t i a l a f f i n i t y chromatography and the f i n a l reducing preparative SDS-PAGE were analysed on a 10% SDS-PAGE mini-gel. The gel was fixed and s i l v e r stained. The i n t e n s i t i e s of the p u r i f i e d antigen bands were then compared v i s u a l l y to those of BSA loaded on the same gel at 0.03-0.5 ug quantities. 2.4 PARTIAL AMINO ACID SEQUENCING 2.4.1 T r y p t i c Digestion Of The P u r i f i e d Antigen The procedure for protein p r e c i p i t a t i o n and t r y p t i c digestion was e s s e n t i a l l y based on the method described by Stearne et a l . (1985) with some modifications. Approximately 55 ug (500-600 pmoles) of the p u r i f i e d antigen was mixed with 9 volumes of precooled (-20°C) high performance l i q u i d chromatography (HPLC) grade methanol (BDH Chemicals, Toronto, ON) i n a s i l i c o n i z e d corex tube, immediately followed by the addition of TPCK-treated trypsin to 1% of the antigen (0.55 Mg). The mixture was incubated overnight at -20°C before centrifugation for 45 minutes at 18,000 rpm (JA-20 rotor i n a Beckman J2-21 centrifuge) and -5°C. This procedure removed the polyacrylamide polymers i n the sample which might cause severe a r t e f a c t s in the subsequent HPLC separation of t r y p t i c peptides and phenylthiohydantoin (PTH) d e r i v a t i v e s of amino acids. The protein p r e c i p i t a t e was a i r - d r i e d and resuspended in 100 p i of 0.1 M NH4HCO3 buffer (pH 8.0) containing 2 mM C a C l 2 and TPCK-treated try p s i n (1% of the antigen), making the f i n a l weight r a t i o of protein to t r y p s i n 50 : 1. The mixture was then incubated for 24 hours at 37°C and subsequently subjected to peptide separation by HPLC. C h a p t e r Two p. 94 2 . 4 . 2 HPLC S e p a r a t i o n Of T r y p t i c P e p t i d e s F o l l o w i n g t r y p t i c d i g e s t i o n , the sample was i m m e d i a t e l y r e c o n s t i t u t e d to 3 M g u a n i d i n e c h l o r i d e and 0.1% ( v / v ) t r i f l u o r o a c e t i c a c i d (TFA) i n 1 ml v o l u m e . I t was then l o a d e d d i r e c t l y onto a uBONDAPACK CIQ r e v e r s e phase HPLC co lumn (Waters A s s o c i a t e s , M i l f o r d , MS; 3 .9 mm x 30 cm) e q u i l i b r a t e d i n 0.1% T F A . A g r a d i e n t o f 0% to 60% ( v / v ) a c e t o n i t r i l e i n 0.1% TFA was r u n o v e r a 105 minute p e r i o d a t a f l o w r a t e o f 1 m l / m i n . A Waters HPLC s y s t e m w i t h two model 510 pumps, a U6K manual i n j e c t o r , a 660 automated g r a d i e n t c o n t r o l l e r , a 490 programmable m u l t i - w a v e l e n g t h d e t e c t o r and a SE 120 r e c o r d e r was u s e d . A b s o r b a n c e at 215 nm was r e c o r d e d a t a c h a r t r a t e o f 0 . 5 cm/min and a s c a l e o f 0 . 0 - 0 . 2 a b s o r b a n c e . The p e p t i d e peaks were m a n u a l l y c o l l e c t e d i n t o g l a s s tubes and s t o r e d a t - 2 0 ° C . S e l e c t e d p e p t i d e peaks were s e q u e n c e d by a gas phase s e q u e n c e r a t the T r i p a r t i t e M i c r o s e q u e n c i n g C e n t r e ( U n i v e r s i t y o f V i c t o r i a , V i c t o r i a , B C ) . 2.5 cDNA CLONING 2 . 5 . 1 S y n t h e t i c O l i g o n u c l e o t i d e p robes T h r e e 17 bases l o n g (17-mer) a n t i s e n s e o l i g o n u c l e o t i d e s F T 1 , FT2 and FT3 o f 2 4 - , 4 8 - and 3 2 - f o l d r e d u n d a n c i e s , r e s p e c t i v e l y , were d e r i v e d f rom t h r e e t r y p t i c p e p t i d e s e q u e n c e s (see C h a p t e r F i v e , T a b l e X ) , and were s y n t h e s i z e d by an A p p l i e d B i o s y s t e m s DNA s y n t h e s i z e r ( D r . M. S m i t h ' s l a b o r a t o r y , U n i v e r s i t y o f B r i t i s h C o l u l m b i a , V a n c o u v e r , B C ) . They were 5 ' e n d - l a b e l e d u s i n g T4 p o l y n u c l e o t i d e k i n a s e and [ y - 3 2 P ] A T P (3000 C i / m m o l ) . 2 . 5 . 2 S c r e e n i n g o f X g t l O cDNA l i b r a r y A n o n - s i z e - s e l e c t e d complementary DNA (cDNA) l i b r a r y o f M B L - 2 ( 4 . 1 ) was c o n s t r u c t e d i n X g t l O v e c t o r i n our l a b o r a t o r y . The method e m p l o y i n g RNase H and p o l y m e r a s e I was used i n the s y n t h e s i s o f the s e c o n d s t r a n d o f cDNA i n Chapter Two p. 95 order to enhance f u l l length construction (Gubler and Hoffman, 1983). The cDNA l ibrary was plated on E . c o l i C600Hfl at 3 x 10 4 plaque forming units (pfu) per 22 x 22 cm^ plate, which was l i f ted onto nitrocellulose f i l t e r s and lysed in s i tu (0.5 M NaOH). The f i l t ers were baked for 2 hours at 80°C under vacuum. They were prewashed for one hour at 42°C in 50 mM Tris-HCl (pH 8.0), 1 M NaCl, 1 mM EDTA and 0.1% SDS as described by Maniatis et a l . (1982), followed by prehybridization in 6 x SSC (1 x SSC = 0.15 M NaCl and 0.015 M sodium ci trate , pH 7.0), 10 x Denhardt's (1 x Denhardt's = 0.2 mg/ml F i c o l l , 0.2 mg/ml polyvinylpyrrolidone, and 0.2 mg/ml BSA), 0.1% SDS, 50 mM sodium phosphate (pH 6.5), and 0.1 mg/ml salmon sperm DNA for 2-3 hours at the hybridization temperatures (see below). FT2 was used for the i n i t i a l screening of the cDNA l ibrary . Hybridization was carried out overnight in 6 x SSC, 10 x Denhardt's, 50 mM sodium phosphate (pH 6.5), 1 mM EDTA and salmon sperm DNA, at 39°C, as derived from the formula EGC x 4°C + EAT x 2°C - 5°C (Suggs et a l . , 1981). The f i l t e r s were then washed in 2 x SSC as described by Davis et a l . (1986), for 2 x 15 minutes at 39°C and for 3 x 30 minutes at 29°C. The positive clones were isolated and purif ied. In order to distinguish from the cross-hybridization of redundant probes with XgtlO vector DNA, DNA isolated from these positive clones was digested with EcoRI and tested for hybridization with FT1 and FT3 , probes by Southern blot analysis. The temperatures for hybridization with FT1 and FT3 were 43°C and 37°C, respectively, and the stringency washes were done at 10°C lower. 2.5.3 DNA Sequencing The cDNA insert was excised by EcoRI digestion from the phage DNA of the positive cDNA clone M3-2, and was subcloned by standard methods (Maniatis et a l . , 1982) into the EcoRI site of pTZ19R plasmid (United States Biochemical Corporation, Cleveland, OH). The pTZ19R plasmid contains a priming s ite on Chapter Two p. 96 either side of the multiple cloning sites and thus allows double-strand DNA sequencing. Two series of deletion clones spanning across the cDNA insert were prepared by timed digestion with exonuclease III (Henikoff, 1984). DNA sequencing of the coding strand was performed by the dideoxy chain-termination method (Sanger et a l . , 1977) using [a- 3 2P]dATP (800 Ci/mmol). In addition, two internal sequences of the non-coding strand were determined using two synthetic 17-mer oligonucleotide primers derived from sequences of the coding strand. 2.6 GENETIC ANALYSES USING cDNA CLONE 2.6.1 cDNA Insert as Probes M3-2 cDNA insert excised by EcoRI from either the original XgtlO clone or the subcloned PTZ19R plasmid clone was used for the genetic analyses to be described in the following. In addition, cDNA fragments of 514 base pairs (bp) (M3-2/514), 400 bp (M3-2/400) and 245 bp (M3-2/245) in length were prepared by Hinfl digestion of the M3-2 cDNA insert, and a 151 bp fragment (M3-2/151) was prepared by Fokl digestion. A l l the cDNA insert and fragments were isolated and purified by agarose gel electrophoresis and electroelution. They were radiolabeled by oligolabeling (Feinberg and Vogelstein, 1983) (Oligolabeling K i t , Pharmacia, Uppsala, Sweden) using [a- 3 2P]dCTP (3000 Ci/mmol), except for M3-2/151 which was labeled by primer-extension. 2.6.2 Northern Blot Analysis Total ce l lular RNA was extracted from cultured cel ls and tissue cel ls using the acid guanidinium thiocyanate/phenol/chloroform method of Chomczynski and Sacchi (1987). Exceptions were EL-4, MBL-2(4.1), MBL-2(2.6), BW5147, AK-1 and NS-1 ce l l s , for which the urea sarkosyl/CsCl method of Glisen et a l . (1974) was used. Poly(A)+RNA was purified from total ce l lular RNA of MBL-Chapter Two p. 97 2(4.1), MBL-2(2.6) and NS-1 cel ls by oligo(dT)-cellulose af f in i ty chromatography. Total RNA (20 ug) or poly(A)+RNA (5 ug) was electrophoresed in 0.66 M formaldehyde/1.0% agarose gels (Davis et a l . , 1986), transferred onto nylon membranes in 20 x SSC by centrifugation (Wilkins and Snell , 1987), and fixed under ultraviolet illumination (Khandjian, 1986). Prehybridization and hybridization were performed for 1-2 hours and overnight, respectively, at 65°C in 1.5 x SSPE (1 x SSPE = 0.18 M NaCl, 10 mM sodium phosphate (pH 7.0), and 10 mM EDTA), 1% SDS, 0.5% (w/v) no-fat powdered milk and 0.5 mg/ml salmon sperm DNA. The blots were then washed with a f inal stringency wash for 30 minutes at 60°C in 0.1 x SSC and 1.0% SDS. Bound cDNA probe was removed at 65°C by agitation for 2 x 30 minutes in 50% formamide and 10 mM sodium phosphate (pH 6.7), followed by 0.1 x SSC and 1% SDS (Parkhurst and Corces, 1987). The blots were then rehybridized as above with a chicken 6-actin probe radiolabeled by nick translation (Nick Translation Reagent K i t , Bethesda Research Laboratories Life Technologies, Gaithersburg, MD) using [a-^^P]dCTP (800 Ci/mmol). Signals on a l l Northern blots were quantified by laser scanning densitometry (Model GS300, Hoefer Scientif ic Instruments, San Francisco, CA). 2.6.3 Genomic Southern Blot Analysis Genomic DNA was prepared from cultured cel ls and tissue cel ls by the SDS/proteinase K method (Gross-Bellard et a l . , 1977) followed by phenol/chloroform extraction. Either 5 or 10 ug of DNA was electrophoresed in 0.8% agarose gels in Tris-acetate buffer and alkaline (0.4 M NaOH) blotted onto nylon membranes. Prehybridization and hybridization conditions were the same as those in Northern blot analyses, except that they were performed at 68°C and the f inal stringency wash was performed at 50°C. Chapter Two p. 98 2.7 REFERENCES Bekoff, M. , Kubo, R. and Grey, H.M. (1986) Activation requirements for normal T ce l l s : Accessory cell-dependent and -independent stimulation by ant i -receptor antibodies. J . Immunol. 137:1411. Chomczyski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156. Davis, L . G . , Dibner, M.D. and Battey, J . F . (1986) Basic Methods In Molecular Biology, Elsevier Press, p.75. Dialynas, D.P. , Wilde, D.B. , Marrack, P. , Pierres, A . , Wall, K . A . , Havran, W., Otten, G . , Loken, M.R., Pierres, M., Kappler, J . and Fitch, F.W. (1983) Characterization of the murine antigenic determinant, designated L3T4a, recognized by monoclonal antibody GK1.5: expression of L3T4a by functional T ce l l clones appears to correlate primarily with class II MHC antigen-reactivity. Immunol. Rev. 74:29. Dougherty, G . J . , Al len, C.A. and Hogg, N.M. (1986) Applications of immunological techniques to the study of tumor-host relationship. In: Handbook of Experimental Immunology, Volume 4, Applications of Immunological Methods in Biomedical Sciences, Chapter 5, Ed. Weir, D.M. , Blackwell Scientif ic Publications., p.125.9. Epstein, R., Roehm, N . , Marrack, P. , Kappler, J . , Davis, M. , Hedrick, S. and Cohn, M. . (1985) Genetic markers of the antigen-specific T c e l l receptor locus. J . Exp. Med. 161:1219. Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restr ict ion endonuclease fragments to high specific act iv i ty . Anal. Biochem. 132:6. Glison, V . , Crkvenjakov, R. and Byus, C. (1974) Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13:2633. Gross-Bellard, M. , Oudet, P. and Chambon, P. (1977) Isolation of high-molecular-weight DNA from mammalian ce l l s . Eur. J . Biochem. 36:32. Gubler, U. and Hoffman, B . J . (1983) A simple and very efficient method for generating cDNA l ibrar ies . Gene 25:263. Guellaen, G . , Goodhardt, M. and Hanoune, J . (1984) Preparative SDS gel electrophoresis. In: Receptor Biochemistry and Methodology, Vol . 2. Ed. Venter, J . C . and Harrison, L . C , Alan R. Liss , Inc. , New York, p. 109. Haskins, K . , Hannum, C , White, J . , Roehm, N . , Kubo, R., Kappler, J . and Marrack, P. (1984) The antigen-specific, major histocompatibility complex-restricted receptor on T ce l l s . IV. An antibody to a receptor allotype. J . Exp. Med. 160:452. Henikoff, S. (1984) Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28:351. Hunkapillar, M.W., Lujan, E . , Ostrander, F. and Hood, L. (1983) Isolation of Chapter Two p. 99 microgram quantities of proteins from polyacrylamide gels for amino acid sequence analysis. Meth. Enzymol. 91:227. Kappler, J . , Kubo, R., Haskins, K . , Hannum, C . , Marrack, P . , Pigeon, M. , Mclntyre, B . , Al l i son , J . and Trowbridge, I. (1983) The major histocompatibility complex-restricted antigen receptor on T cel ls in mouse and man: identification of constant and variable peptides. Ce l l 35:739. Khandjian, E.W. (1986) UV crosslinking of RNA to nylon membrane enhances hybridization signals. Molec. B io l . Rep. 11:107. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680. Ledbetter, J . A . and Herzenberg, L.A. (1979) Xenogeneic monoclonal antibodies to mouse lymphoid differentiation antigens. Immnol. Rev. 47:63. Lemoine, F . M . , Humphries, R . K . , Abraham, S.D.M., Krystal , G. and Eaves, C . J . (1988a) Part ia l characterization of a novel stromal cell-derived pre-B c e l l growth factor active on normal and immortalized pre-B ce l l s . Exp. Hematol. 16:718. Lemoine, F . M . , Krystal , G. and Humphries, R.K. (1988b) Autocrine production of pre-B c e l l stimulating act ivity by a variety of transformed pre-B c e l l l ines. Cancer Res. In press. Mclntyre, B.W. and Al l i son , J . P . (1984) Biosynthesis and processing of murine T ce l l antigen receptor. Ce l l 38:659. Maniatis, T . , Fri tsch, E . F . and Sambrook, J . (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, New York, p.326. Markwell, M.A.K. and Fox, C F . (1978) Surface specific iodination of membrane proteins of viruses and eukaryotic cel ls using 1,3,4,6-tetrachloro-3,6-diphenylglycouril. Biochemistry 17:4807. Nowinski, R . C , Fleissner, E . , Sarkar, N.H. and Aoki, T. (1972) Chromatographic separation and antigenic analysis of proteins of the oncornaviruses. II . Mammalian leukemia-sarcoma viruses. J . V i r o l . 9:359. O'Farre l l , P.H. (1975)yHigh resolution two-dimensional electrophoresis of proteins. J . B io l . Chem. 250:4007. Parkhurst, S.M. and Corces, V.G. (1987) Developmental expression of Drosophila  melanogaster retrovirus-l ike transposable elements. EMBO 6:419. Reisner, Y . , Linker-Israel i , M. and Sharon, N. (1976) Separation of mouse thymocytes into two subpopulations by the use of peanut agglutinin. C e l l . Immunol. 25:129. Roehm, N . , Herron, L . , Cambier, J . , DiGuisto, D. , Haskins, K . , Kappler, J . and Marrack, P. (1984) The major histocompatibility complex-restricted antigen receptor on T cel ls : Distribution on thymus and peripheral T ce l l s . Ce l l 38:577. Roehm, N.W., Carbone, A . , Kushnir, E . , Taylor, B .A. , Riblet , R . J . , Marrack, P. and Kappler, J.W. (1985) The major histocompatibility complex-restricted Chapter Two p. 100 antigen receptor on T cel ls : The genetics of expression of an allotype. J . Immunol. 135:2176. Sanger, F . , Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl . Acad. Sci . USA 74:5463. Stearne, P .A. , van Dr ie l , I .R . , Grego, B . , Simpson, R . J . and Goding, J.W. (1985) The murine plasma ce l l antigen PC-1: purification and part ia l amino acid sequence. J . Immunol. 134:443. Suggs, S .V. , Wallace, R .B . , Hirose, T . , Kawashima, E.H. and Itakura, K. (1981) Use of synthetic oligonucleotides as hybridization probes: Isolation of cloned cDNA sequences for human 82-microglobulin. Proc. Natl . Acad. Sc i . USA 78:6613. Takei, F. and Horton, M.A. (1981) Ly-6 region regulates expression of multiple a l lospec i f i c i t i e s . Immunogenetics 13:435. Takei, F. (1983) Two surface antigens expressed on proliferating mouse T lymphocytes defined by rat monoclonal antibodies. J . Immunol. 130:2794. Takei, F. (1987) Murine T lymphoma cells exrpess a novel membrane-associated antigen with unique features. J . Immunol. 139:649. Trowbridge, I .S. (1978) Interspecies spleen-myeloma hybrid producing monoclonal antibodies against mouse lymphocyte surface glycoprotein, T200. J . Exp. Med. 148:313. Wilkins, R . J . and Snell , R.G. (1987) Centrifugal transfer and sandwich hybridization permit 12-hour Southern blot analyses. Nucl. Acid Res. 15:7200. Williams, A . F . and Gagnon, J . (1982) Neuronal ce l l Thy-1 glycoprotein: homology with immunoglobulin. Science 216:696. Chapter Three p. 101 CHAPTER THREE EXPRESSION AND BIOCHEMICAL ANALYSES OF A T CELL RECEPTOR o/6-LIKE MOLECULE, YE1/48, Data Reported i n J . Immunol. 1 3 6 : 1 3 4 6 - 1 3 5 3 ; February 1 9 8 6 and J . Immunol. 1 4 0 : 1 6 1 - 1 6 9 ; January 1 9 8 8 3.1 INTRODUCTION 102 3.2 RESULTS 3.2.1 Two monoclonal antibodies define the YE1/48 antigen 103 3.2.2 Biochemical analysis of the YE1/48 antigen 104 3.2.3 Expression on normal lymphoid cel ls A) A rat anti-YEl/48 antiserum 112 B) Immunoprecipitation as the assay for expression 112 C) T and B lymphocytes 113 D) Bone marrow cells 119 3.3 DISCUSSION 119 3.3.1 Homodimer or heterodimer 120 3.3.2 Expression of YE1/48 on lymphocytes 121 3.3.3 Differential expression and accessibi l i ty of MAb-defined epitopes 122 3.3.4 YE1/48 a l l e l i c polymorphism 125 3.4 SUMMARY 125 3.5 REFERENCES 128 Chapter Three 3.1 INTRODUCTION p. 102 The T c e l l antigen receptor (TCR) on human and murine T c e l l s has recently been i d e n t i f i e d by using T c e l l clone-specific MAb's (for reviews, see A l l i s o n et a l . , 1984 and Reinherz et a l . , 1984). I t i s a dimeric glycoprotein consisting of 40-50,000 Mr disulphide-linked polypeptide chains, a and 0 ( A l l i s o n et a l . , 1982; Haskins et a l . , 1983; Kappler et a l . , 1983b; Marrack et a l . , 1983; Meuer et a l . , 1983a, 1983b; Kaye and Janeway, 1984;). The two chains have different i s o e l e c t r i c points (pi's) and can be separated by two-dimensional gel electrophoresis, using SDS-PAGE versus IEF or nonequilibrated pH gradient electrophoresis (NEPHGE). Peptide analysis of the a and 0 chains has shown that they consist of variable and constant regions (Acuto et a l . , 1983b; Kappler et a l . , 1983a; Mclntyre and A l l i s o n , 1983). Several cDNA clones that are derived from rearranged genes and are expressed s p e c i f i c a l l y in T c e l l s were isolated, and their sequences were found to be homologous to the immunoglobulin (Ig) genes, composed of variable, d i v e r s i t y , j o i n i n g and constant regions (Chiens et a l . , 1984; Hedrick et a l . , 1984a, 1984b; Saito et a l . , 1984; Siu et a l . , 1984; Yanagi et a l . , 1984). Upon comparison of the predicted amino acid sequences deduced from the nucleotide sequences of the cloned cDNA's with the p a r t i a l amino acid sequences obtained from pur i f i e d human a and 0 chains (Acuto et a l . , 1984; Hannum et a l . , 1984), these cDNA's have been confirmed to code for the human TCR-a/0. Although the amino acid sequences of the murine a and 0 chains were not determined, the close s i m i l a r i t i e s between the nucleotide sequences of the human TCR-a/0 cDNA's and the putative murine receptor cDNA's have indicated that the cloned murine cDNA's encode the receptor molecules (Caccia et a l . , 1984; Clark et a l . , 1984; Jones et a l . , 1985). The constant region genes have been i d e n t i f i e d for the a and 0 chain genes. There appears to be no preferential expression of the constant genes in different T c e l l subsets (Royer et a l . , Chapter Three p. 103 1984; Hedrick et a l . , 1985; Kronenberg et a l . , 1985). I n i t i a l studies on the rearrangement and transcription of the 6 chain gene in various T c e l l lines have shown that the joining and constant segments of the 3 chain gene are deleted in most of the suppressor T ce l l lines tested (Hedrick et a l . , 1985; Kronenberg et a l . , 1985), leaving a possibi l i ty for the existence of other types of TCR molecules. However, both a and 6 gene rearrangements have been detected in several suppressor ce l l lines (Royer et a l . , 1984; Toyonaga et a l . , 1984; Yoshikai et a l . , 1984a, 1984b; Bal l inar i et a l . , 1985; de Santis et a l . , 1985; Imai et a l . , 1986; Modlin et a l . , 1987), and the a/6 heterodimer has been described in at least two reports (Bensussan et a l . , 1984; Modlin et a l . , 1987). Nevertheless, another TCR distinct from the a/6 dimer has recently been identif ied. The TCR-y/5 heterodimer can either be disulphide-linked or non-covalently associated. It was found on TCR-a/6~CD3+ T cel ls and Thy-1 + dendritic epidermal cel ls (Borst et a l . , 1987; Brenner et a l . , 1987; Ioannides et a l . , 1987; Koning et a l . , 1987; Moingeon et a l . , 1987; Nakanishi et a l . , 1987). We have isolated two rat MAb's that react with a TCR-a/6-like molecule, called YE1/48. The MAb's immunoprecipitate a disulphide-linked dimer of 45-50,000 M r under reducing conditions and 90-95,000 M r under non-reducing conditions. Their pi values are comparable to those of the TCR-a/6. In this chapter, the biochemical characterization of the YE1/48 antigen and i ts expression in lymphoid populations are described. 3 . 2 R E S U L T S 3.2.1 Two Monoclonal Antibodies Define The YE1/48 Antigen The YE1/48.10.6 (IgG2b) and YE1/32.8.5 (IgG 2 a ) MAb's were rat MAb's generated in our laboratory against a T ce l l hybrid of EL4-BU and Con A-activated AKR spleen cel ls (see Chapter Two, section 2.1.3). By flow Chapter Three p. 104 cytometric analysis using indirect fluorescent antibody staining, neither of the MAb's showed detectable binding to the surface of normal murine lymphoid populations, such as spleen cel ls and thymocytes, or other c e l l l ines tested except two T lymphoma c e l l lines EL-4 and MBL-2(4.1) (Figure 1 and Table VI). The antigen molecules immunoprecipitated from the surface iodinated EL-4 and MBL-2(4.1) cel ls by both YE1/48.10.6 and YE1/32.8.5 MAb's exhibited similar M r in SDS-PAGE analysis, at approxiamtely 90-95,000 M r under non-reducing conditions and 45-50,000 M r under reducing conditions (Figure 2) (as previously reported by Takei, 1983), indicating that the molecule has a disulphide-linked dimeric structure. By using sequential immunoprecipitation in which immunodepletion by either one MAb had led to the loss of the immunoprecipitation signal by the other MAb, i t was confirmed that the two MAb's react with the same protein molecule. However, the two MAb's appear to bind to different epitopes because they showed limited competitive inhibit ion of binding (16-43%) with each other (data not shown). The antigen is designated YE1/48. 3.2.2 Biochemical Analysis Of The YE1/48 Antigen Since the M r and the dimeric structure of the YE1/48 antigen were similar to those of the murine TCR a and 0 chains, and the specific react iv i t ies of the two MAb's with only two T lymphoma ce l l lines resemble the clonotypic binding of many anti-TCR-a/p MAb's, the antigen was considered as TCR-a/p-like and was dedicated to further characterization. By two-dimensional gel electrophoresis analysis (IEF vs SDS-PAGE), the two subunits of the YE1/48 antigen could be separated by their difference in pi 's (Figure 3) into an acidic chain and a more basic chain, similar to the a and 3 chains of the murine TCR-a/p heterodimer. The heterogeneity in the pi values of each subunit indicated that they were both glycopolypeptides. The two YEl/48 subunits were isolated from the two-dimensional gel and were separately Chapter Three p. 105 T H Y M U S S P L E E N L Y M P H N O D E B O N E M A R R O W C O N A L P S E L - 4 M B L - 2 \ \ A \ k A i A .. IA. A IA A A A A -A. -A DC 111 m ui o F L U O R E S C E N C E INTENSITY (log) Figure 1. Flow cytometric analysis of YE1/48 expression on normal lymphoid  tissue ce l l s , and EL-4 and MBL-2(4.1) ce l l s . C57BL/6 thymocytes, spleen ce l l s , lymph node ce l l s , bone marrow ce l l s , Con A- and LPS-stimulated spleen ce l l s , EL-4 and MBL-2(4.1) cel ls were indirectly stained by (a) an unrelated IgG2b MAb as a negative control, (b) YE1/48.10.6 MAb, and (c) YE1/21.2.1 MAb (anti-CD45) as a positive control, followed by FITC-conjugated (Fab'>2 mouse anti-rat Ig as the second antibody. Dead cells were stained by propidium iodide and were gated out on the basis of red fluorescence. The same fluorescence gain was applied for a l l samples except EL-4 and MBL-2(4.1), for which a lower gain was used. Chapter Three p. 106 TABLE VI SURFACE BINDING OF THE YE1/48.10.6 AND YE1/32.8.5 MAb'S ON NORMAL CELLS AND CELL LINES Normal Tissues 3 FACS Thymus 0' c Spleen 0 Bone marrow Lymph nodes Con A-stimulated spleen LPS-stimulated spleen Erythrocytes L i v e r 0 Cel l Line Origin Cel l Type FACS EL-4 C57BL/6 T ce l l l ine MBL-2(4.1) C57BL/6 T ce l l l ine BW5147 AKR T ce l l l ine AK-1 AKR T c e l l l ine AK-2 AKR T ce l l l ine SAK 8 AKR T c e l l l ine SL-3 AKR T c e l l l ine B M - 1 BALB/c T ce l l l ine BM-3 BALB/c T ce l l l ine BM-4 BALB/c T ce l l l ine A20 BALB/c B c e l l l ine 2PK3 BALB/c B c e l l l ine B9 BALB/c Pre-B ce l l l ine BIO BALB/c Pre-B ce l l l ine B12 BALB/c Pre-B ce l l l ine 17-lB BALB/c Pre-B ce l l l ine L1210 DBA/2 Uncharacterized B10A/A2/2.2 B10A Uncharacterized BALB/c/Al BALB/c Uncharacterized NS-1 BALB/c Myeloma P815 DBA/2 Mastocytoma B6SutA(JG-l) C57BL/6 Hemopoietic progenitor l ine Ltk-/8 C3H Fibroblast l ine a C57BL/6 and BlOBr mice tested. 0 Fetal tissues tested also. c New born mice tested also. Chapter Three p. 107 EL-4 MBL-2 Non-reducing O 3 ~ — C T~ O UJ o >• X10 3 MW. 9 0 45^ I Non-Reducing reducing - oo c *-O Ul o >• — 00 c *~ O UJ o >-• « 9 3 « 6 6 & 9 0 66> 45* Reducing - 00 c T -O UJ <93 « 6 6 4* « 4 5 Figure 2. Immunoprecipitation of the YE1/A8 antigen from EL-A and MBL-2(4.1)  c e l l s . 125j s u r f a c e labeled c e l l lysates were f i r s t incubated with YE1/A8.10.6 MAb or the parental myeloma Y3 culture supernatant ( c o n t r o l ) , and then with sepharose beads conjugated with rabbit a n t i - r a t Ig antibodies. The resultant immunoprecipitates were analysed by 10% SDS-PAGE under non-reducing and reducing conditions. Open arrows show the YE1/A8 antigen p r e c i p i t a t e d . Chapter Three p. 108 Figure 3. Two-dimensional gel analysis (IEF vs SDS-PAGE) of the YE1/48  antigen. YE1/48 immunoprecipitates from ^ 2 ^ I surface labeled EL-4 and MBL-2(4.1) c e l l s were reduced and analysed by i s o e l e c t r i c focussing i n the f i r s t dimension and 10% SDS-PAGE in the second dimension. Separation of human t r a n s f e r r i n ( p i 5.9) and bovine serum albumin ( p i 4.9) on the same gels was shown by arrows for reference. Chapter Three p. 109 analysed by tryptic peptide mapping (Figure 4). The majority of the tryptic peptides were shared between the two antigen subunits (solid spots) with only a few peptides being different (striped or open spots). This observation strongly indicates that the two YE1/48 subunits, unlike the TCR a and g chains, are very similar to each other. The YE1/48 antigen was analysed for glycosylation characteristics by endoglycosidase F digestion. The enzyme cleaves both the high-mannose and complex types of N-linked carbohydrate side chains which are attached to the polypeptide at specific asparagine residues. As shown by SDS-PAGE analysis under reducing conditions, the 45-50,000 M r YE1/48 subunits were diminished in size to 42,000 M r , 38,000 M r and 32,000 M r at a suboptimal dose of the enzyme (Figure 5, lanes b & c). This suggests that there are at least three N-linked glycosylation side chains attached to the YE1/48 polypeptides. This is comparable to the glycosylation characteristics of the murine TCR-a/0 (Mclntyre et a l . , 1984). Equal amounts of the 38,000 M r and 32,000 M r bands persisted when an increased level of enzyme was used for digestion (Figure 5, lane e). This has several implications. F i r s t , the two YE1/48 subunits may have different polypeptide lengths of 38,000 M r and 32,000 M r . Alternatively, the two subunits may have the same protein core size of 32,000 M r , and the 38,000 M r entity represents the part ial resistance of a carbohydrate side chain to complete digestion. It is also possible that the two subunits may contain different amounts of 0-linked carbohydrates insensitive to the endoglycosidase F digestion. Attempts to c lari fy these poss ib i l i t ies by two-dimensional gel analysis (IEF vs SDS-PAGE) of the deglycosylated antigen have not given conclusive results, because deglycosylation changes the pi values of the subunits making their separation ineff icient. Hence, with the current data, whether the two persisting deglycosylated forms represent one common protein core or two distinct polypeptide subunits remains unresolved. Chapter Three p. 110 M B L - 2 • t t * • • • t % • • % % ! I i • • ' ». o • °% Q • • 0 o Figure 4. Tr y p t i c peptide analysis of the YE1/48 subunits from MBL-2(4.1)  c e l l s . The subunits of the YE1/48 immunoprecipitate from MBL-2(4.1) c e l l s were separated as described i n Figure 3. After f i x a t i o n , SDS was removed from the gel and the two polypeptide subunits were located by autoradiography. The subunits were then digested by TPCK-treated trypsin while being eluted by a g i t a t i o n at 37°C. The eluted t r y p t i c peptides were concentrated and analysed by electrophoresis (from l e f t to right from the o r i g i n marked by dotted c i r c l e ) and thin-layer chromatography (from bottom to top). Schematic representations (b, d) of the autoradiographs (a, c) were shown to indicate peptides common to both YE1/48 subunits ( s o l i d spots) and those unique to the a c i d i c (b) or basic (d) subunits (open spots). Chapter Three p. I l l Figure 5. Endoglycosidase F digestion of the YE1/48 antigen from EL-4 c e l l s . The YE1/48 immunprecipitate prepared from surface iodinated EL-4 c e l l s was subjected to digestion by either (a & d) 0 unit/ml, (b) 12.5 units/ml, (c) 50 units/ml, or (e) 125 units/ml of endoglycosidase F at 37°C for 22 hours (except for 12.5 units/ml digestion i n 3 hours). After removal of the released carbohydrates, the digests were analysed on 10% (a-c) or 12.5% (d, e) SDS-PAGE gels under reducing conditions. Chapter Three p. 112 3.2.3 Expression On Normal Lymphoid Cells A) A Rat anti-YEl/48 Antiserum Although clonotypic MAb's have been used in identifying TCR-a/0 on T c e l l clones by blocking antigen-specific binding and antigen-mediated T c e l l activation, as well as in studying the biological effects of the activation, they cannot be used to study the expression of the receptor in normal T c e l l populations. To study the TCR-a/0 in normal T ce l l populations, polyclonal antisera or MAb's capable of reacting with the constant regions of the receptor on the c e l l surface are required. Considering the poss ibi l i ty that the YE1/32.8.5 and YE1/48.10.6 MAb's may react with the clonotypic epitopes on YE1/48 on EL-4 and MBL-2(4.1) ce l l s , and that YE1/48 may have constant regions similar to TCR-a/0, a rat immune antiserum was generated against the purified YE1/48 antigen in order to detect non-clonotypic determinants on the surface of YE1/48 antigen. The immunizing antigen was part ia l ly purified by af f in i ty chromatography from EL-4 cel ls which express the antigen at high levels (1.5-3.0 x 10^ molecules per ce l l ) . The anti-YEl/48 antiserum thus generated, although specif ical ly immunoprecipitating a molecule of similar M r from EL-4 and MBL-2(4.1) ce l l s , did not show detectable binding to the surface of normal thymocytes or spleen cel ls when tested by flow cytometry. B) Immunoprecipitation As The Assay For Expression The two MAb's and the anti-YEl/48 antiserum were further tested for their react ivi t ies with normal lymphoid c e l l populations by immunoprecipitation in l ight of two technical differences between immunoprecipitation and flow cytometric analysis. In flow cytometry, the binding of antibodies to antigens on the surface of intact cel ls is detected by indirect fluorescence staining, whereas in immunoprecipitation, the ce l l membrane is part ia l ly solubil ized by non-ionic detergents before the antibody binding is tested, and the signal is detected as radioactivity on the surface antigens bound by the antibodies. Second, the methods differ in their sensit ivit ies of detection. In general, Chapter Three p. 113 antigens expressed at lower than 1000 molecules per ce l l on the c e l l surface are not readily detectable by flow cytometry. In immunoprecipitation, the sensit iv i ty of detection depends on the efficiency of surface iodination of the antigen studied, which in turn relies on the number of tyrosine residues in the extracellular domain of the antigen and the spatial orientation of these residues favorable for the iodination reaction. For the YE1/48 antigen, i t can readily be surface iodinated and i ts detection by immunoprecipitation is very eff ic ient . MBL-2(2.6) ce l l s , which show no YE1/48.10.6 MAb binding by flow cytometry, give detectable immunoprecipitation signals. The antigen can also be detected in a ce l l lysate prepared from a mixture of 95.5% YE1/48" L1210 cel ls and 0.5% EL-4 ce l l s , both of which are transformed c e l l l ines of similar c e l l size. It was found that the YE1/48 antigen can be immunoprecipitated by both YE1/32.8.5, YE1/48.10.6 MAb's and the anti-YEl/48 antiserum from normal C57BL/6 thymocytes and spleen cel ls (Figure 6), albeit at much lower levels than detected from EL-4 and MBL-2(4.1) ce l l s . It suggests that the epitopes defined by both MAb's are not clonotypic as previously speculated. It seems that either these epitopes are somehow not accessible to binding on the surface of intact cel ls unless the ce l l membrane is part ia l ly solubi l ized, or the expression of the YE1/48 antigen on normal cel ls is below the detection l imit of flow cytometry. (This question w i l l be further addressed in Chapter Five, section 5.3.4.) C) T and B Lymphocytes Immunoprecipitation was used as an assay for YE1/48 expression in various lymphoid c e l l populations and subpopulations. The results are summarized in Table VII. The antigen is expressed on both C57BL/6 spleen T cel ls (75% Thy-1+, 12% s lg + ) and spleen B cells (95% s l g + , 2% Thy-1+) with the former detection signal considerably higher than the lat ter . Its expression on total spleen cel ls is however diminished after Con A or LPS stimulation. Among the Chapter Three p. 114 Figure 6. Immunoprecipitation of the YE1/48 antigen from thymocytes and  spleen c e l l s . C e l l lysates of 125j_ s u r f a c e labeled C57BL/6 thymocytes and spleen c e l l s were subjected to immunoprecipitation as described i n Figure 2, using (1) the parental myeloma Y3 culture supernatant as negative c o n t r o l , (2) YE1/32.8.5, and (3) YE1/48.10.6 MAb's. The resultant immunoprecipitates were analysed by 10% SDS-PAGE under non-reducing (NR) and reducing (R) conditions. Open arrows show the YE1/48 antigen detected. Chapter Three p. 115 TABLE VII IMMUNOPRECIPITATION OF THE YE1/48 ANTIGEN FROM NORMAL LYMPHOCYTES Cel l Population 3 Immunoprecipitation Thymocytes + CD8-CD4- + PNA+ + PNA~ + Spleen cel ls + Spleen T + Spleen B wD Con A-stimulated + LPS-stimulated v CD8+CD4- + CD8-CD4+ + Bone marrow cel ls w Lymphoid-depleted Mouse strains (spleen) C57BL/6 (B6) + BIO.BR + BALB/c w C3H a From C57BL/6 mice unless otherwise stated D w = weak. Chapter Three p. 116 spleen T ce l l s , the antigen is detected at comparable levels in both the CD8+CD4- (55% CD8+, 0% CD4+, 16% s lg + ) and CD8-CD4+ (0% CD8+, 68% CD4+, 13% s lg + ) subpopulations. Several T and B ce l l lines were also tested (Table VIII). None of them showed detectable expression of the YE1/48 antigen except EL-4, MBL-2(4.1), and MBL-2(2.6) ce l l s . EL-4 and MBL-2(4.1), as reported above, express very high levels of the YE1/48 antigen, whereas MBL-2(2.6) expresses a very low level . It is interesting to note that C57BL/6 and BIO.BR spleen cel ls gave a stronger YE1/48 signal than BALB/c and C3H spleen cel ls did (Table VII). It is possible that the YE1/48 expression is d i f ferent ia l ly regulated in different mouse strains or that the YE1/48 gene exhibits a l l e l i c polymorphism. This phenomenon of dif ferential detection in different mouse strains may then help explain the absence of YE1/48 detection in the other T c e l l lines tested, a l l of which are of origins other than C57BL/6. The poss ibi l i ty of the YE1/48 antigen being polymorphic w i l l be discussed in Chapter Five (section 5.3.3). The expression of the YE1/48 antigen in thymocyte subpopulations was tested by immunoprecipitation (Table VII). It was found that the YE1/48 antigen can be detected in CD8 -CD4 - (3% CD8+ and/or CD4+) C57BL/6 thymocytes which represent the most immature and the putative precursors of a l l thymocytes (Fowlkes et a l . , 1985; Kingston et a l . , 1985). Thymocytes from C57BL/6 mice were also separated by their PNA agglutination properties. The PNA+ subpopulation is generally considered as immature and the PNA-subpopulation as more mature (Reisner et a l . , 1976). As shown in Figure 7, the YE1/48 antigen was immunoprecipitated from both PNA+ and PNA- thymocytes. These observations are comparable to the observations of murine TCR-a/6 at the protein (Roehm et a l . , 1984) as well as the mRNA levels (Raulet et a l . , 1985). It should be noted that the PNA- cel ls gave a more intensive band than the PNA+ ce l ls did, suggesting that the YE1/48 antigen might be more abundant on the mature thymocytes than on the immature thymocytes. However, i t remains Chapter Three p. 117 TABLE VIII IMMUNOPRECIPITATION OF THE YE1/48 ANTIGEN FROM LYMPHOID CELL LINES Ce l l Line Origin Cel l Type Detection EL-4 C57BL/6 T + MBL-2(4.1) C57BL/6 T + BW5147 AKR T -AK-1 AKR T -BM-3 BALB/c T -2PK3 BALB/c B A20 BALB/c B -L1210 DBA Uncharacterized Chapter Three p. 118 THYMOCYTES PNA' co C M -r t o : • s * -*- ^ c 111 H I o > > o cr PNA" C O CM — ^ C O 2 111 UJ o > > o ft x i c r M.W. r «93 Figure 7. Immunoprecipitation of the YE1/48 antigen from PNA+ and PNA~  thymocytes. C e l l lysates of ^ 5 j surface labeled C57BL/6 PNA+ and PNA-thymocytes were subjected to immunoprecipitation as described i n Figure 2, using the parental myeloma Y3 culture supernatant, YE1/32.8.5, and YE1/48.10.6 MAb's. SDS-PAGE (10%) analysis of the resultant immunoprecipitates under reducing conditions was shown. Chapter Three p. 119 unknown whether i t is due to a higher surface expression on individual ce l l s or a larger subpopulation of cel ls expressing the antigen. D) Bone Marrow Cells Cells from other lineages in the hemopoietic system were tested for their expression of the YE1/48 antigen (Table VII). C57BL/6 bone marrow cel ls gave a weak immunoprecipitation detection signal relative to the lymphoid cel ls described above. After they were cultured for three days in long term culture conditions described by Dexter et a l . (1977), which should lead to the depletion of most cel ls of the lymphoid lineage while the myeloid and erythroid cel ls survive, no YE1/48 antigen was detected. It suggests that some lymphoid cel ls in the bone marrow, either originating from the blood circulat ion or as prothymocytes or immature precursor B ce l l s , are expressing the YE1/48 antigen. The expression in bone marrow w i l l also be reexamined by Northern blot analysis and w i l l be described in Chapter Five (see section 5.3.2). No antigen was detected on the B6SutAl (C57BL/6 hemopoietic progenitor l ine) and NS-1 (BALB/c myeloma) ce l l l ines. 3.3 D I S C U S S I O N The YE1/48 antigen described in this study resembled the murine TCR-a/0 in two major properties. The antigen is composed of two 45-50,000 M r disulphide-linked glycopolypeptide subunits, similar to TCR-a/0. The subunits exhibit pi values comparable to the TCR a and 0 chains. In addition, the YE1/48 antigen was i n i t i a l l y identified by specific reactivit ies of two MAb's with EL-4 and MBL-2(4.1) ce l l s , in similar manner to the identif ication of the TCR-a/0 by clonotypic MAb's. No other T c e l l surface antigens with similar features had been identified at the time of this work (the TCR-y/S had not been described and human CD28 (T44) had not been well characterized). In Chapter Three p. 120 fact, diagonal gel analysis (non-reducing vs reducing SDS-PAGE) of surface iodinated T c e l l surface molecules had shown that dimeric proteins in general are quite rare on T cel ls (Allison et a l . , 1982; Acuto et a l . , 1983a), and TCR-a/0 might be the only membrane protein that has a dimeric structure in this M r range. Hence, i t was of interest to characterize the YE1/48 antigen and elucidate i ts possible relationship with TCR-a/6. Other than the biochemical analyses and the antigen expression described in this chapter, the YE1/48 antigen has also been directly compared to the TCR-a/0 which w i l l be described in the next chapter. 3.3.1 Homodimer Or Heterodimer Unlike the heterodimeric a and 6 chains of TCR which dif fer considerably from each other in tryptic peptide fingerprints (Acuto et a l . , 1983b; Reinherz et a l . , 1984), the two YE1/48 subunits had very similar tryptic peptide maps. In addition, the tryptic peptide maps of both YE1/48 subunits were also very different from those of the TCR-a/0 chains even though the same mapping procedure was used. It could not be decided i f the minority of the tryptic peptides unique to each YE1/48 subunit represented some differences in post-translational modifications of two identical protein backbones, indicative of a homodimer, or i f the YE1/48 subunits indeed had some differences in their protein sequences, indicative of a heterodimer. The results of the endoglycosidase F analysis were also inconclusive. Because of the persistence of the 32,000 M r and 38,000 M r bands at a high dose of the enzyme, one could suggest that these bands represent the protein cores of the two subunits. The two protein cores however must have very similar primary structures in order to account for the two tryptic peptide maps. On the other hand, i t was possible that the 38,000 M r band represented an incompletely deglycosylated product of the 32,000 M r protein core due to secondary structures of the polypeptide or the presence of 0-linked carbohydrates insensitive to Chapter Three p. 121 endoglycosidase F. These analyses thus suggested that the YE1/48 antigen was unlikely to be identical to the TCR-a/6 dimer. Whether the YE1/48 antigen dimer was a homodimer or a heterodimer could not be determined by the current data. In Chapter Five (section 5.3.5), this issue w i l l be discussed again based on the YEl/48-encoding cDNA clone. 3.3.2 Expression of YE1/48 On Lymphocytes The two MAb's YE1/32.8.5 and YE1/48.10.6, which were i n i t i a l l y speculated to react with clonotypic determinants specif ical ly expressed on EL-4 and MBL-2(4.1) ce l l s , were shown to react with a wide range of T cel ls in normal lymphoid populations in the present study. This observation clearly indicated that the MAb-defined epitopes were not clonotypic. By immunoprecipitation, the YE1/48 antigen was detected in the thymus and spleen, including CD8~CD4~ and PNA+ immature thymocytes, PNA" mature thymocytes, CD8+CD4~ and CD8"CD4+ spleen T ce l l s . However, the percentage of positive cel ls and the expression levels in individual c e l l subpopulations could not be determined because neither of the MAb's gave detectable binding to normal T c e l l surface. The radioactivity of the YE1/48 immunoprecipitates from EL-4 and MBL-2(4.1) ce l l s is at least 30 fold higher than that from normal thymocytes or spleen ce l l s . Nonetheless, immunoprecipitation signals do not give rel iable representation of the expression level , because the efficiency of surface iodination and c e l l l y s i s , and the quality of the c e l l lysates, may vary among different c e l l sources, and thus may affect the amount of specific proteins immunoprecipitated. The relative expression levels w i l l be addressed in a more quantitative manner by Northern blot analysis of the YE1/48 transcript levels (see Chapter Five, section 5.2.4). At this point, there were two poss ib i l i t i e s , either the frequency of YEl/48 + normal T cel ls might be f a i r l y low, or the antigen was expressed on the majority of thymocytes and spleen ce l l s at a much lower density. Among 23 T ce l l hybrids generated in our Chapter Three p. 122 laboratory by fusing BW5147 AKR thymoma with C57BL/6 thymocytes and 10 hybrids by fusing BW5147 with C57BL/6 spleen T ce l l s , none was YE1/48+ by immunoprecipitation, indicating that the YEl/48 + cel ls might constitute less than 5% of thymocytes and 10% of spleen T ce l l s . Alternatively, the BW5147 thymoma which is YE1/48" may possess trans-acting suppressor act iv i ty that inhibits the expression of YE1/48 in the hybrid clones. Much weaker detection signals have also been noted on spleen B ce l l s , indicating that either the YE1/48 antigen is expressed at very low levels on B cel ls or very few B cells express the antigen. On the other hand, these data do not exclude the possibi l i ty that detection of the antigen was attributable to the 2% contaminating Thy-1 + T cel ls in the B c e l l preparation because of the high sensit ivity of the YE1/48 immunoprecipitation assay. This question was addressed by Northern blot analysis using the YE1/48 cDNA, the results of which suggest that the YE1/48 antigen is indeed expressed on B cel ls (see Chapter Five, section 5.2.4). Neither Con A nor LPS stimulation of spleen cel ls had led to an increase in the expression level of YE1/48 antigen as detected by immunoprecipitation. The detection of YE1/48 antigen in bone marrow cel ls appeared to be contributed by circulating lymphocytes since lymphoid c e l l depletion by selective culture conditions removed the immunoprecipitation signal. The possible expression of YE1/48 in the bone marrow w i l l be described and discussed again in Chapter Five (see section 5.2.4). 3.3.3 Differential Expression And Accessibi l i ty of MAb-defined Epitopes The detection of the YE1/48 antigen in a wide range of normal T cel ls has i n i t i a l l y suggested that the YE1/32.8.5 and YE1/48.10.6 MAb's may be reacting with the constant portions of the molecule analogous to TCR-a/0. However, the YE1/48 antigen can be detected on normal lymphoid cel ls only by immunoprecipitation and not by flow cytometry. There are at least two Chapter Three p. 123 possible explanations. Either the epitopes recognized by the MAb's (as well as the anti-YEl/48 antiserum) are somehow not accessible to binding on the surface of intact cel ls unless the ce l l membrane is part ia l ly solubi l ized, or the expression of YE1/48 on normal cel ls is below the detection l imit of flow cytometry. Even the rat anti-YEl/48 antiserum which should be reactive to multiple determinants on the molecule did not show apparent binding to normal T c e l l surface. It is possible that the exposed surface of the YE1/48 antigen on normal cel ls is very conserved between mouse and rat. In analogy, some conventional antisera produced against TCR-a/0 invariably f a i l to detect non-clonotypic determinants exposed on the T ce l l surface (Mclntyre and Al l i son , 1983; Brenner et a l . , 1984). This is probably not surprising because TCR-a/0 seems to be highly conserved between different species, as indicated by the high homology of the nucleotide sequences of the human and murine a and 0 genes (Caccia et a l . , 1984; Clark et a l . , 1984; Jones et a l . , 1985). Perhaps, in both the YE1/48 antigen and TCR-a/0, only those determinants which are normally masked on the surface of normal T cel ls are antigenic in rat. This could explain why the anti-YEl/48 antiserum cannot give detectable binding on normal T c e l l surface. Alternatively, i f YE1/48 expression level is indeed below the detection limit of flow cytometry, the binding of the antiserum to multiple determinants on the surface of the antigen may not be detectable. Previously, Haskins et a l . reported a MAb which reacts with a non-clonotypic determinant on the murine TCR-a/0 molecule (Haskin et a l . , 1984). The MAb KJ16-133 not only immunoprecipitates TCR-a/0 from detergent-solubil ized T cel ls but also binds to the surface of some normal T ce l l s . However, the surface binding is temperature dependent. The MAb binds well at 37°C in the presence of azide but poorly at 4°C, which may be attributed to the increased membrane f lu idi ty at higher temperatures. Unlike the KJ16-133 MAb, no detectable binding was observed by flow cytometry after the incubation of normal spleen cel ls with YE1/48.10.6 MAb at 37°C in the presence of azide. Chapter Three p. 124 It w i l l be interesting i f the epitopes defined by YE1/32.8.5 and YE1/48.10.6 MAb's are indeed accessible to surface binding by the antibodies only on EL-4 and MBL-2(4.1) cel ls but not on normal thymocytes and spleen ce l l s . There are three possible explanations for this unusual phenomenon: 1) the biochemical properties of the YE1/48 molecule on T lymphoma c e l l may be different from those on normal T cel ls ; 2) there may be some associated molecules whose properties differ between the lymphomas and normal ce l l s ; 3) normal and transformed T cells may differ in general membrane compositions resulting in differences in the way the YE1/48 molecule is embedded in the l i p i d bilayer. CD3 is a glycoprotein complex known to non-covalently associate with the TCR-a/0 and TCR-y/& heterodimers (Reinherz et a l . , 1982; Meuer et a l . , 1983a; Reinherz et a l . , 1983; Kaye and Janeway, 1984; Weiss and Stobo, 1984; Brenner et a l . , 1985) In mice, i t is composed of five subunits: Y(21,000 M r ) , 6(26,000 M r ) , e(25,000 M r ) , p21(21,000 M r) and C(a homodimer of 16,000 M r chains) (Borst et a l . , 1983a, 1983b; Al l i son and Lanier, 1985; Samelson et a l . , 1985; Oettgen et a l . , 1986). They can be coimmunoprecipitated with the TCR's in ce l l lysates prepared in digitonin detergent. To test i f the YE1/48 antigen is likewise non-covalently associated with other proteins and i f some changes in such associated molecules can affect the accessibi l i ty of the MAb-defined epitopes on the YE1/48 antigen, a SDS-PAGE gel of YE1/48 immunoprecipitate from a Triton X-100 detergent lysate of MB1-2(4.1) cel ls was allowed for prolonged autoradiograpic exposure. Coimmunoprecipitates of 32,000 M r , 24,000 M r and 16,000 M r were observed. However, they are probably not physically associated antigens because antisera raised separately against them can cross-react with the YE1/48 antigen, indicating that either they are degraded fragments of the antigen or they carry epitopes cross-reactive with the YE1/48.10.6 MAb. Furthermore, no coimmunoprecipitate was detected in the digitonin detergent lysates of MBL-2(4.1) ce l l s . Hence, i t appears unlikely that associated Chapter Three p. 125 molecules have contributed to the changes in epitope exposure on the YE1/48 antigen. It remains intriguing to speculate that the difference in the YE1/48 antigen on lymphomas and normal ce l l s , whether i t is epitope changes or di f ferent ia l expression, may correlate with the cel lular transformation of lymphocytes. This subject w i l l be discussed again in Chapter Five (see section 5.3.2) based on the data derived from Northern blot analysis using the YEl/48-encoding cDNA clone. 3.3.4 YE1/48 A l l e l i c Polymorphism It has been puzzling that, among a l l T c e l l lines tested, the YE1/48 antigen was only detected on EL-4, MBL-2(4.1) and MBL-2(2.6) by immunoprecipitation. A possible explanation emerges from the finding that YE1/48 is readily detected on C57BL/6 and BIO.BR spleen cel ls but less so on BALB/c and C3H spleen ce l l s . The three YE1/48 expressing c e l l l ines are the only C57BL/6 c e l l lines tested. No c e l l lines of BIO.BR origin were tested. From these data, i t remains undetermined i f the YE1/48 expression is d i f ferent ia l ly regulated in different mouse strains or the YE1/48 gene exhibits a l l e l i c polymorphism. Subsequent genomic Southern blot analysis using the YE1/48 cDNA clone has indicated that the di f ferent ia l immunoprecipitation signals may be due to a l l e l i c polymorphism of the YE1/48 gene (see Chapter Five, section 5.2.3). Since C57BL/6 carries a MHC b-haplotype whereas BIO.BR carries a k-haplotype, the a l l e l i c difference does not appear to correlate with the MHC. 3.4 SUMMARY A murine TCR-a/6-like antigen, YE1/48, with dimeric structure of 90-95,000 M r under non-reducing and 45-50,000 M r under reducing conditions, was detected by two rat MAb's YE1/32.8.5 and YE1/48.10.6 on the surface of two Chapter Three p. 126 murine T lymphoma c e l l lines EL-4 and MBL-2(4.1). By two-dimensional gel electrophoresis (IEF vs SDS-PAGE), the two YE1/48 subunits could be separated into an acidic and a more basic chains with pi values similar to those of the murine TCR-a/0 chains. Endoglycosidase F analysis suggested that at least three N-linked carbohydrate side chains are attached to the polypeptides. Tryptic peptide fingerprints of the YE1/48 subunits however showed that, unlike the TCR-a/0, the subunits are very similar to each other. These results suggest that the YE1/48 antigen is unlikely identical to the TCR-a/0 molecule. However, the current biochemical analyses alone have not def init ively shown any possible relationship between the two molecules, and whether the YE1/48 antigen is a homodimer or a heterodimer. The two MAb's which react with different epitopes on the YE1/48 molecule do not show detectable binding to the surface of normal lymphoid cel ls or c e l l l ines except EL-4 and MBL-2(4.1) as tested by flow cytometry. A rat ant i -YEl/48 antiserum does the same. In further analysis by immunoprecipitation from surface iodinated ce l l s , the YE1/48 antigen was detected on normal C57BL/6 thymocytes and spleen ce l l s . This indicates that, either prior solubi l izat ion of the ce l l membrane is required for MAb binding to the epitopes on normal cel ls and, for some unknown reasons, these epitopes are accessible for MAb binding on intact EL-4 and MBL-2(4.1) ce l l s , or the YE1/48 antigen is expressed on normal cel ls at very low levels undetectable by flow cytometry. An attempt to differentiate these two poss ibi l i t ies w i l l be presented in the discussion in Chapter Five (see section 5.3.4). By immunoprecipitation, the YE1/48 antigen can be detected in a wide range of thymocytes and spleen T ce l l s . The present data cannot show conclusively whether or not the antigen is expressed on B ce l l s . The YE1/48 expression on B cel ls w i l l be further demonstrated by Northern blot analysis in Chapter Five (see section 5.2.4). Analysis of spleen cells from different mouse strains suggests that the YE1/48 expression may be di f ferent ia l ly regulated or the Chapter Three p. 127 YE1/48 gene may be a l l e l i c . Chapter Three p. 128 3.5 REFERENCES Acuto, 0., Hussey, R . E . , Fitzgerald, K.A. , Protentis, J . P . , Meuer, S . C , Schlossman, S.F. and Reinherz, E . L . (1983a) The human T c e l l receptor: appearance in ontogeny and biochemical relationship of a and 0 subunits on IL 2-dependent clones and T c e l l tumors. Ce l l 34:717. Acuto, 0., Meuer, S . C , Hodgdon, J . C , Schlossman, S.F. and Reinherz, E . L . (1983b) Peptide var iabi l i ty exists with a and 6 subunits of the T c e l l receptor for antigen. J . Exp. Med. 158:1368. Acuto, 0., Fabbi, M. , Smart, J . , Poole, C . B . , Protentis, J . , Royer, H.D. , Schlossman, S.F. and Reinherz, E . L . (1984) Purification and NH2~terminal amino acid sequencing of the 0 subunit of a human T c e l l antigen receptor. Proc. Natl . Acad. Sci . USA 81:3851. Al l i son , J . P . , Mclntyre, B.W. and Bloch, D. (1982) Tumor-specific antigen of murine T-lymphoma defined with monoclonal antibody. J . Immunol. 129:2293. Al l i son , J . P . , Ridge, L . , Lund, J . , Gross-Pelose, J . G . , Lanier, L. and Mclntyre, B.W. (1984) Tumor-specific antigen of murine T-lymphoma defined with monoclonal antibody. J . Immunol. 129:2293. Al l i son , J . P . and Lanier, L . L . (1985) Identification of antigen receptor-associated structures on murine T ce l l s . Nature 314:107. B a l l i n a r i , D . , Cas te l l i , C , Traversari, C . , P ierot t i , M.A., Parmiani, G . , Ricciardi-Castagnoli , P. and Adorini, L. (1985) Disulphide-linked surface molecules of monoclonal antigen-specific suppressor T ce l l s : evidence for T c e l l receptor structure. Eur. J . Immuno. 15:855. Bensussan, A . , Acuto, 0., Hussey, R . E . , Milanese, C. and Reinherz, E . L . (1984) T3-Ti receptor triggering of T8 + suppressor T cel ls leads to unresponsiveness to interleukin-2. Nature 311:565. Borst, J . , Alexander, S., Elder, J . and Terhorst, C. (1983a) The T3 complex on human T lymphocytes involves four structurally distinct glycoproteins. J . B i o l . Chem. 258:5135. Borst, J . , Prendivi l le , M.A. and Terhorst, C. (1983b) The T3 complex on human thymus-derived lymphocytes contains two different subunits of 20 kDa. Eur. J . Immunol. 13:576. Borst, J . , van de Griend, R . J . , van Oostveen, J.W., Ang, S . - L . , Melief, C . J . , Seidman, J . G . and Bolhuis, R .L .H. (1987) A T-ce l l receptor y/CD3 complex found on cloned functional lymphocytes. Nature 325:683. Brenner, M.B. , Trowbridge, I .S . , McLean, J . and Strominger, J . L . (1984) Identification of shared antigenic determinants of the putative human T lymphocyte antigen receptor on T ce l l s . J . Exp. Med. 160:541. Brenner, M.B. , Trowbridge, I .S. and Strominger, J . L . (1985) Cross-linking of human T c e l l receptor proteins: association between the T c e l l idiotype 0 subunit and the T3 glycoprotein heavy subunit. Ce l l 40:183. Brenner, M.B. , McLean, J . , Scheft, H . , Riberdy, J . , Ang, S . - L . , Seidman, J . G . , Chapter Three p. 129 Devlin, P. and Krangel, M.S. (1987) Two forms of the T - c e l l receptor y protein found on peripheral blood cytotoxic T lymphocytes. Nature 325:689. Caccia, N . , Kronenberg, M. , Saxe, D. , Haars, R., Bruns, G . A . P . , Goverman, J . , Malissen, M. , Willard, H . , Yoshikai, Y . , Simon, M. , Hood, L. and Mak, T.W. (1984) The T ce l l receptor 0 chain genes are located on chromosome 6 in the mice and chromosome 7 in humans. Ce l l 37:1091. Chien, Y . - H . , Becker, D.M., Lindsten, T . , Okamura, M. , Cohen, D.I . and Mavis, M.M. (1984) A third type of murine T c e l l receptor gene. Nature 312:31. Clark, S.P. , Yoshikai, Y . , Taylor, S., Siu, G . , Hood, L. and Mak, T.W. (1984) Identification of a diversity segment of human T c e l l receptor 0-chain, and comparison with the analogous murine element. Nature 311:387. Dexter, T . M . , Al len, A.D. and Lajtha, L .G. (1977) Conditions controll ing the proliferation of haemopoietic stem cells in viro. J . Ce l l Physiol. 91:335. Fowlkes, B . J . , Edison,L. , Mathieson, B . J . and Chused, T.M. (1985) Early T lymphocytes. Differentiation in vivo of adult intrathymic precursor ce l l s . J . Exp. Med. 162:802. Hannum, C . H . , Kappler, J . , Trowbridge, I . , Marrack, P. and Freed, J . H . (1984) Immunoglobulin-like nature of the a-chain of a human T c e l l antigen/MHC receptor. Nature 312:65. Haskins, K . , Kubo, R., White, J . , Pigeon, M. , Kappler, J . and Marrack. P. (1983) The major histocompatibility comlex-restricted antigen receptor on T ce l l s . I. Isolation with a monoclonal antibody. J . Exp. Med. 157:1149. Haskins, K . , Hannum, C . , White, J . , Roehm, N . , Kubo, R., Kappler, J . and Marrack, P. (1984) The antigen-specific, major histocompatibility complex-restricted receptor on T ce l l s . VI. An antibody to a receptor allotype. J . Exp. Med. 160:452. Hedrick, S.M., Cohen, D . I . , Nielsen, E.A. and Davis, M.M. (1984a) Isolation of cDNA clones encoding T ce l l - speci f ic membrane-associated proteins. Nature 308:149. Hedrick, S.M., Nielsen, E . A . , Kavaler, J . , Cohen, D.I. and Davis, M.M. (1984b) Sequence relationships between putative T ce l l receptor polypeptides and immunoglobulins. Nature 308:153. Hedrick, S.M., Germain, R .N. , Bevan, M . J . , Dorf, M. , Engel, I . , Fink, P . , Gascoigne, N. , Heber-Katz, E . , Kapp, J . , Kaufmann, Y. , Sorensen, C , Taniguchi, M. and Davis, M.M. (1985) Rearrangement and transcription of a T c e l l receptor 0-chain gene in different T ce l l subsets. Proc. Natl . Acad. Sci . USA 82:531. Imai, K . , Kanno, M. , Kimoto, H . , Shigemoto, K . , Yamamoto, S. and Taniguchi, M. (1986) Sequence and expression of transcripts of the T - c e l l antigen receptor a-chain gene in a functional, antigen-specific suppressor-T-cell hybridoma. Proc. Natl . Acad. Sci . USA 83:8708. Ioannides, C . G . , Itoh, K . , Fox, F . E . , Pahwa, R,, Good, R.A. and Platsoucas, C D . (1987) Identification of a second T - c e l l antigen receptor in human Chapter Three p. 130 and mouse by an anti-peptide y-chain-specific monoclonal antibody. Proc. Natl . Acad. Sci . USA 84:4244. Jones, N . , Leiden, J . , Dialynas, D. , Fraser, J . , Clabby, M. , Kishimoto, T . , Strominger, J . L . , Andrews, D. , Lane, W. and Woody, J . (1985) Part ia l primary structure of the alpha and beta chains of human tumor T c e l l receptors. Science 227:311. Kappler, J . , Kubo, R., Haskins, K . , Hannum, C . , Marrack, P. , Pigeon, M. , Mclntyre, B . , Al l i son , J . and Trowbridge, I. (1983a) The major histocompatibility complex-restricted antigen receptor on T cel ls in mouse and man: identif ication of constant and variable peptides. C e l l 35:295. Kappler, J . , Kubo, R., Haskins, K . , White, J . and Marrack, P. (1983b) The mouse T c e l l receptor: comparison of MHC-restricted receptors on two T c e l l hybridomas. Ce l l 34:727. Kaye, J . and Janeway, C . A . , J r . (1984) The Fab fragment of a direct ly activating monoclonal antibody that precipitates a disulphide-linked heterodimer from a helper T ce l l clone blocks activation by either allogeneic Ia or antigen and se l f - l a . J . Exp. Med. 159:1397. Kingston, R. , Jenkinson, E . J . and Owen, J . J . T . (1985) A single stem c e l l can recolonize an embryonic thymus, producing phenotypically dist inct T - c e l l populations. Nature 317:811. Koning, F . , St ingl , G . , Yokoyama, W.M., Yamada, H . , Maloy, W.L. , Tschachler, E . , Shevach, E.M. and Coligan, J . E . (1987) Identification of a T3-associated y8> T ce l l receptor on Thy-1 + dendritic epidermal c e l l l ines . Science, 236:834. Kronenberg, M. , Goverman, J . , Haars, R., Malissen M. , Kraig, E . , P h i l l i p s , L. , Delovitch, T . , Suciu-Foca, N. and Hood, L. (1985) Rearrangement and transcription of the P-chain genes of the T ce l l antigen receptor in different types of murine lymphocytes. Nature 313:647. Mclntyre, B.W. and Al l i son , J . P . (1983) The mouse T c e l l receptor: structural heterogeneity of molecules of normal T cel ls defined by xenoantiserum. Ce l l 34:739. Mclntyre, B.W. and Al l i son , J . P . (1984) Biosynthesis and processing of murine T c e l l antigen receptor. Ce l l 38:659. Marrack, P . , Shimonkevitz, R., Hannum, C . , Haskins, K. and Kappler, J . (1983) The major histocompatibility complex-restricted antigen receptor on T ce l l s : IV. An antiidiotypic antibody predicts both antigen and I-speci f ic i ty . J . Exp. MEd. 158:1635. Meuer, S . C , Acuto, 0., Hussey, R . E . , Hodgdon, J . C , Fitzgerald, K . A . , Schlossman, S.F. and Reinherz, E . L . (1983a) Evidence for the T3-associated 90K heterodimer as the T c e l l antigen receptor. Nature 303:808. Meuer, S . C , Fitzgerald, K . A . , Hussey, R . E . , Hodgdon, J . C , Schlossman, S.F. and Reinherz, E . L . (1983b) Clonotypic structures involved in antigen-specific human T c e l l function. Relationship to the T3 molecular complex. J . Exp. Med. 157:705. Chapter Three p. 131 Modlin, R . L . , Brenner, M.B., Krangel, M.S. , duby, A.D. and Bloom, B.R. (1987) T - c e l l receptors of human suppressor ce l l s . Nature 329:541. Moingeon, P . , Jitsukawa, S., Faure, F . , Troalen, F, Triebel , F . , Graziani, M. , Forestier, F . , Beller, D. , Bohuon, C. and Hercend, T. (1987) A y-chain complex forms a functional receptor on cloned human lymphocytes with natural k i l l e r - l i k e act iv i ty . Nature 325:723. Nakanishi, N . , Maeda, K . , Ito, K . , Heller, M. and Tonegawa, S. (1987) T y protein is expressed on murine fetal thymocytes as disulphide-linked heterodimer. Nature 325:720. Oettgen, H . C . , Pettey, C . L . , Maloy, W.L. and Terhorst, C. (1986) A T3-l ike protein complex associated with the antigen receptor on murine T ce l l s . Nature 320:272. Raulet, D .H . , Garman, R.D. , Saito, H. and Tonegawa, S. (1985) Developmental regulation of T ce l l receptor gene expression. Nature 314:103. Reinherz, E . L . , Meuer, S . C , Fitzgerald, K . A . , Hussey, R . E . , Levine, H. and Schlossman, S.F. (1982) Antigen recognition by human T lymphocytes is linked to surface expression of the T3 molecular complex. Ce l l 30:735. Reinherz, E . L . , Meuer, S . C , Fitzgerald, K . A . , Hussey, R . E . , Hodgdon, J . C , Acuto, 0. and Schlossman, S.F. (1983) Comparison of T3-associated 49- and 43-kilodalton c e l l surface molecules on individual human T c e l l clones: evidence for peptide var iabi l i ty in T ce l l receptor structures. Proc. Natl . Acad. Sci . USA 80:4104. Reinherz, E . L . , Acuto, 0., Fabbi, M. , Bensussan, A . , Milanese, C , Royer, H.D. , Meuer, S . C and Schlossman, S.F. (1984) Clonotypic surface structure on human T lymphocytes: functional and biochemical analysis of the antigen receptor complex. Immunol. Rev. 81:95. Reisner, Y . , Linker-Israel i , M. and Sharon, N. (1976) Separation of mouse thymocytes into two subpopulations by the use of peanut agglutinin. C e l l . Immunol. 25:129. Roehm, N . , Herron, L . , Cambier, J . , DiGuisto, D. , Haskins, K . , Kappler, J . and Marrack, P. (1984) The major histocompatibility complex-restricted antigen receptor on T cel ls: distribution on thymus and peripheral T ce l l s . Ce l l 38:577. Royer, H.D. , Bensussan, A . , Acuto, 0. and Reinherz, E . L . (1984) Functional isotypes are not encoded by the constant region genes of the 0 subunit of the T c e l l receptor for antigen/major histocompatibility complex. J . Exp. Med. 160:947. Saito, H . , Kranz, D.M., Takagaki, Y . , Hayday, A . C , Eisen, H.N. and Tonegawa, S. (1984) A third rearranged and expressed gene in a clone of cytotoxic T lymphocytes. Nature 312:36. Siu, G . , Clark, S.P. , Yoshikai, Y . , Malissen, M. , Yanagi, Y . , Strauss, E . , Mak, T.W. and Hood, L. (1984) The human T c e l l antigen receptor is encoded by variable, diversity, and joining gene segments that rearrange to generate a complete V gene. Cel l 37:393. Samelson, L . E . , Harford, J . B . and Klausner, R.D. (1985) Identification of the Chapter Three p. 132 components of the murine T ce l l antigen receptor complex. Ce l l 43:223. de Santis, R., Givol , D. , Hsu, P . - L . , Adorini, L . , Doria, G. and Appella, E . (1985) Rearrangement and expression of the a- and 6-chain genes of the T-c e l l antigen receptor in functional murine suppressor T - c e l l clones. Proc. Natl . Acad. Sci . USA 82:8638. Takei, F. (1983) Two surface antigens expressed on proliferating mouse T lymphocytes defined by rat monoclonal antibodies. J . Immunol. 130:2794. Toyonaga, B . , Yanagi, Y . , Suciu-Foca, N . , Minden, M. and Mak, T.W. (1984) Rearrangements of T - c e l l receptor gene YT35 in human DNA from thymic leukaemia T - c e l l lines and functional T-ce l l clones. Nature 311:385. Weiss, A. and Stobo, J .D. (1984) Requirement for the co-expression of T3 and the T c e l l antigen receptor on a malignant human T c e l l l ine . J . Exp. Med. 160:1284. Yanagi, Y . , Yoshikai, Y . , Leggett, K . , Clark, S.P., Aleksander, I. and Mak, T.W. (1984) A human T ce l l -speci f ic cDNA clone encodes a protein having extensive homology to immunoglobulin chains. Nature 308:145. Yoshikai, Y . , Anatoniou, D. , Clark, S.P. , Yanagi, Y . , Sangster, R., van de Eisen, P. , Terhorst, C. and Mak, T.W. (1984a) Sequence and expression of transcripts of the human T ce l l receptor 6-chain genes. Nature 312:521. Yoshikai, Y . , Yanagi, Y . , Suciu-Foca, N. and Mak, T.W. (1984b) Presence of T c e l l receptor mRNA in functionally distinct T cel ls and elevation during intrathymic differentiation. Nature 310:506. Chapter Four p. 133 CHAPTER FOUR COMPARISON OF THE YE1/48 ANTIGEN WITH THE T CELL RECEPTOR a/p (Data reported in J. Immunol. 140:161-169, January 1988) 4.1 INTRODUCTION 134 4.2 RESULTS 4.2.1 YE1/48 antigen is l ike ly not the T ce l l receptor a/p 136 4.2.2 Purification of the YE1/48 antigen 141 4.2.3 Separation of the tryptic peptides by HPLC 145 4.2.4 Amino acid sequences 145 4.3 DISCUSSION 4.3.1 YE1/48 is distinct from the T ce l l receptor a/p 148 4.3.2 Comparison of YE1/48 with other known proteins ; 149 4.4 SUMMARY 152 4.5 REFERENCES 153 Chapter Four 4-1 INTRODUCTION p. 134 Disulphide-linked dimeric proteins are relatively rare on the T c e l l surface (Goding and Harris, 1981; Bal l inar i et a l . , 1985). Only four major T c e l l dimeric antigens have been characterized in deta i l . They are TCR-a/6, TCR-y/8, CD8 (also known as Lyt-2,3 in mouse and T8 in human) and CD28 (T44) antigens. TCR-a/6 is a heterodimeric molecule of 85,000 M r with an acidic a and a basic 6 subunit each of approximately 40-45,000 M r in mouse (All ison et a l . , 1982; Kappler et a l . , 1983; Samelson, 1985). In human, the a and 3 subunits are 49,000 and 43,000 M r , respectively (Meuer et a l . , 1983a, 1983b). TCR-y/8 is a heterodimer of 35,000(y) and 45,000(8) M r subunits in mouse and 40,000(y) and 43,000(8) in human (Lew et a l . , 1986; Moingeon et a l . , 1986; Borst et a l . , 1987; Brenner et a l . , 1987; Moigeon et a l . , 1987; Nakanishi et a l . , 1987; Pardoll et a l . , 1987). Both the a/3 and y/S receptors are glycoproteins encoded by T ce l l - speci f ic rearranged genes, and are non-covalently associated with the CD3 complex. The a/3 receptor is expressed on mature immunocompetent cel ls and recognizes foreign antigens in a MHC-restricted manner, leading to antigen-specific T ce l l activation. The y/8 receptor is instead expressed on CD3+a/3~ ce l l s , including the CD3+CD8~CD4-immature thymocytes, some peripheral T cel ls and some Thy-1 + dendritic epidermal ce l l s . Most y /S + c e l l lines exhibit MHC non-restrcited cytolyt ic ac t iv i t i e s via the y/8 CD3 complex (Bank et a l . , 1986; Moingeon et a l . , 1986; Alarcon et a l . , 1987; Borst et a l . , 1987; Brenner et a l . , 1987; Ferrini et a l . , 1987) but there is a report of one ce l l l ine that manifests MHC-linked proliferation and cytotoxicity (Matis et a l . , 1987). It is l ike ly that the MHC non-restricted cytotoxicity is induced by IL-2 in the culture as the cytoxicity is lost upon factor depletion (Phil l ips et a l . , 1987; Borst et a l . , 1988). CD8 is a homodimer of 34,000 M r subunits in human (Ledbetter et a l . , 1981a; Snow and Terhorst, 1983), and a heterodimer in mouse, composed of a Chapter Four p. 135 30,000 M r (0, Lyt-3) subunit linked to either a 38,000 M r(a of Lyt-2) or a 34,000 M r (a' of Lyt-2) subunit (Ledbetter et a l . , 1981b; Jay et a l . , 1982); Both the human and the mouse molecules can further exist in homomultimers or heteromultimers. It is thought to be a receptor for non-polymorphic regions of the MHC class I molecule and to be involved in enhancing T c e l l activation (Emmrich et a l . , 1986; Dembic et a l . , 1987; Gabert et a l . , 1987; Ratnofsky et a l . , 1987; Takada and Engelman, 1987). CD28, so far identified only in human, exists primarily as a homodimer of 44,000 M r subunits although monomers are also detected (Martin et a l . , 1986). It is expressed on the majority of CD4+ helper/inducer and CD8+ CTL's but not on CD8+ suppressor cel ls (Hara et a l . , 1985). Since i ts perturbation by MAb can enhance TCR-a/0/CD3-mediated T c e l l activation, CD28 has been speculated to be a receptor for accessory signals (Martin et a l . , 1986; Lesslauer et a l . , 1986; Poggi et a l . , 1987). Other disulphide-linked dimeric antigens have also been identif ied on T ce l l s . Al is a murine 90,000 M r homodimer of 45,000 M r subunits which shows no homology with the human CD28 (T44) molecule in peptide mapping analysis. It is detected on two T lymphomas EL-4 and C6VLB and no function has yet been identified (Nagasawa et a l . , 1987; Spiazzi et a l . , 1987). CD27 (Tp55) is a 120,000 M r homodimeric differentiation antigen of 55,000 M r subunits expressed on a large subset of peripheral T cel ls and most medullary thymocytes (van Lier et a l . , 1987). The transferrin receptor is a 180,000 M r homodimer of 95,000 M r subunits expressed in a l l proliferating cel ls (Omary and Trowbridge, 1981a, 1981b; Trowbridge and Lopez, 1982). It transports iron-bound transferrin molecules into dividing cel ls in which F e 2 + ions are released for use in DNA synthesis and electron transfer chain-reactions. An unidentified 96,000 M r molecule which is reduced to 32,000 M r under reducing conditions has also been detected on a T lymphoma ce l l l ine (Bal l inari et a l . , 1985). F ina l ly , on many retrovirus-transformed T c e l l l ines, the v i r a l envelope proteins gp70 and p!5 are often expressed as a disulphide-linked heterodimer Chapter Four p. 136 although pl5 is not radiolabeled by c e l l surface iodination (Ledbetter and Nowinski, 1977). We have identified by two rat MAb's, YE1/32.8.5 and YE1/48.10.6, a 90-95,000 M r disulphide-linked dimer of two 45-50,000 M r subunits called YE1/48. It is expressed on a wide range of thymocytes and spleen T ce l l s , and two T lymphomas EL-4 and MBL-2(4.1). The antigen resembles the murine TCR-a/0 in i t s molecular size and pi values, and thus has been described as a TCR-a/0-l ike antigen. No function of the YE1/48 antigen has been obtained comparable to that of TCR-a/0 because the two MAb's as well as the anti-YEl/48 antiserum do not give detectable surface binding on normal T ce l l populations or established T c e l l lines except the two T lymphomas. In Chapter Three tryptic peptide mapping of the YE1/48 subunits has suggested that YE1/48 is unlikely to be identical to TCR-a/0. Yet i t has not been def init ively concluded whether or not the YE1/48 antigen is related to either of the a/0 chains, and whether YE1/48 is a homodimer or a heterodimer. In this chapter, we have clearly demonstrated that the YE1/48 antigen is dist inct from TCR-a/0 by their sequential immunoprecipitation from EL-4 ce l l s , the d i f ferent ia l expression of the two molecules on two variant MBL-2 clones, and the direct comparison of part ia l amino acid sequences of the YE1/48 antigen with the published TCR sequences. 4.2 RESULTS 4.2.1 YE1/48 Antigen Is Likely Not The T Cel l Receptor a/0 It was i n i t i a l l y thought that the murine TCR-a/0 is the only major dimeric antigen on T ce l l surface with 40-50,000 M r under reducing and 80-90,000 M r under non-reducing conditions. Based on this assumption, diagonal gel analysis, in which SDS-PAGE is performed under non-reducing conditions in the f i r s t dimension and reducing conditions in the second, was used for the detection of TCR-a/0 when no MAb was available to detect i t in Chapter Four p. 137 polyclonal c e l l populations. As demonstrated in Figure 8a, from a surface-iodinated thymocyte lysate, a single spot was detected under the diagonal l ine at the region to which a protein of 80-90,000 M r under non-reducing and 40-50,000 M r under reducing conditions would separate. Such a protein had generally been thought to be the TCR-a/0 heterodimer. Indeed, the murine TCR-a /8 immunoprecipitated by the KJ16-133 MAb which reacts with 10% of thymocytes (Roehm et a l . , 1984) was detected in the diagonal gel as a similar spot (Figure 8, b3). No difference in separation could be noted in the YE1/48 antigen immunoprecipitated from the same lysate (Figure 8, b2). Given the s imilarity between YE1/48 and TCR-a/6 in their mobility on SDS-PAGE and diagonal analyses, experiments were carried out to test i f they may be the same molecule. Since no c e l l l ine was available that reacts with both KJ16-133 and YE1/48.10.6 MAb's, a rabbit antiserum R3497 (Bekoff et a l . , 1986) which recognizes TCR-a/8 on a l l T ce l l s , was used in conjunction with YE1/48 MAb to sequentially immunoprecipitate from EL-4 c e l l lysates. Upon depletion of a l l detectable YE1/48 antigen from the EL-4 ce l l lysate (Figure 9a, lane B2), the murine TCR-a/6 could s t i l l be immunoprecipitated by R3497 (Figure 9b, B). Conversely, when the amount of TCR-a/6 was drast ical ly reduced by immunoprecipitation with R3497 (Figure 9b, C), the amount of the YE1/48 antigen remained unchanged (Figure 9a, lane C2). The treatment of the lysate with either antibody did not affect the amount of an unrelated T c e l l surface antigen CD45 (T200) (Figure 9a, lanes 3), indicating that the antigen depletion was specif ic . Hence, the YE1/48 antigen and the murine TCR-a/6 appear to be distinct molecules. The difference between the YE1/48 antigen and the murine TCR-a/0 was further shown by their dif ferential expression on the MBL-2(4.1) and MBL-2(2.6) variant clones. The two clones have identical levels of c e l l surface antigen expression with YE1/48 being the only exception known. The high Chapter Four p. 138 a b 1 2 3 Figure 8. Diagonal gel analysis of the YE1/48 antigen and the T c e l l receptor q/6 from thymocytes. The c e l l lysates of surface iodinated C57BL/6 thymocytes were d i r e c t l y analysed (a) by diagonal SDS-PAGE gels (10% under non-reducing versus 10% under reducing conditions), or (b) were subjected to immunoprecipitation, using (1) a negative control, YE6/26.1.1 (anti-gp70), (2) YE1/48.10.6, and (3) KJ16-133 MAb's before analysis. Three protein markers, bovine serum albumin (67,000 MW), ovalbumin (43,00 MW), and carbonic anhydrase (31,000 MW) were included in the samples and were v i s u a l i z e d by Coomaise blue s t a i n i n g ( s o l i d squares and dots). Chapter Four p. 139 Figure 9. (next page) Sequential immunoprecipitation of the YE1/48 antigen  and the T c e l l receptor a/g from EL-4 ce l l s . A ce l l lysate prepared from surface iodinated EL-4 cel ls was pretreated with either (A) no antibody, (B) YE1/48 MAb, or (C) the rabbit anti-T ce l l receptor antiserum R3497 before subjected to immunoprecipitation using (1) a negative control, YE6/26.1.1 (anti-gp70), (2) YE1/48.10.6, (3) a positive control, YE1/21.2.1 (anti-CD45), a normal rabbit serum (not shown), and (b) the rabbit antiserum R3497. The resultant immunoprecipitates were analysed on a 10% SDS-PAGE gel(a) under reducing conditions except for the R3497 immunoprecipitates which were analysed on 10% diagonal gels(b). The normal rabbit serum immunoprecipitates were not shown. The protein markers on the diagonal gels were the same as in Figure 8. Chapter Four p. 140 Chapter Four ' p. 141 variant clone MBL-2(4.1) expresses 2.3-4.5 x 10^ molecules of YE1/48 antigen per c e l l , as determined by saturation binding of l^I - labe led YE1/48.10.6 MAb. The low variant clone MBL-2(2.6), based on the observation that no YE1/48 binding is detected by flow cytometry, expresses less than 1000 molecules per c e l l , at least 200 fold lower than MBL-2(4.1) does. The difference in the level of the YE1/48 antigen was readily shown by the difference in the intensities of the bands on SDS-PAGE (Figure 10, lanes c) . In contrast, the amount of TCR-a/0 immunoprecipitated by R3497 from the low variant clone MBL-2(2.6) was no less than that from the high variant MBL-2(4.1). (Figure lOd). The two clones also express approximately the same amounts of other unrelated surface antigens, such as transferrin receptor and CD45 (T200) (Figure 10, lanes a and b). These results again indicate that the YE1/48 antigen and the murine TCR-a/0 are l ike ly two distinct molecules. 4.2.2 Purif ication Of The YE1/48 Antigen The YE1/48 antigen was purified from MBL-2(4.1) cel ls using a three step purif ication scheme: af f ini ty chromatography and two cycles of preparative SDS-PAGE under non-reducing and reducing conditions. Batches of lysates derived from 0.7-1.0 x 10^ cells were subjected to purification with YE1/48.10.6 MAb aff ini ty column. When an aliquot of the eluted fraction was analysed on a SDS-PAGE gel followed by s i lver staining (Figure 11, lane f ) , a 90-95,000 M r band was detected as a major component with a few minor contaminating protein bands. The faint 50,000 M r contaminant band was previously found to have pi identical to that of the more basic YE1/48 subunit and hence might represent a monomer of the antigen. The typical y ie ld of the 90,000 M r a f f in i ty purified YE1/48 antigen was 100 yg (1.1 nmoles)/10 1 0 ce l l s . This corresponds to an extraction of 6.6 x 10^ molecules per c e l l , which is in reasonable agreement with the estimated antigen density of 2.3-4.5 x 10-> molecules/cell on the MBL-2(4.1) c e l l l ine considering inevitable protein loss Chapter Four p. 142 Figure 10. Comparison of the YE1/48 antigen level and the T c e l l receptor a/ft  expression on two MBL-2 variant clones. Surface iodinated cel ls of the MBL-2(4.1) and MBL-2(2.6) clones were subjected to immunoprecipitation using two positive controls (a) YE1/9.9.3 (anti-transferrin receptor) and (b) YE1/21.2.1 (anti-CD45), (c) YE1/48.10.6, and (d) the rabbit anti-T c e l l receptor antiserum R3497. The immunoprecipitates were analysed on a 10% SDS-PAGE gel under reducing conditions except for the R3497 immunoprecipitates which were analysed by 10% diagonal gel analysis. The protein markers on the diagonal gels were the same as in Figure 8. Chapter Four p. 143 a b c d e f g MW. Figure 11. Assessment of the p u r i t y and the y i e l d of the p u r i f i e d YE1/48  antigen. Small a l i q u o t s of the YE1/48 antigen p u r i f i e d from the i n i t i a l a f f i n i t y chromatography(f) and the f i n a l reducing preparative SDS-PAGE(g) were analysed on a 10% SDS-PAGE g e l under non-reducing c o n d i t i o n s . S o l i d arrows i n d i c a t e the YE1/48 proteins i n the i n i t i a l d i s u l p h i d e - l i n k e d form and the f i n a l unlinked form. Bovine serum albumin was included i n q u a n t i t i e s of (a) 0.5 yg, (b) 0.25 Mg, (c) 0.13 Mg, (d) 0.06 Mg and (e) 0.03 Mg as references f o r q u a n t i t a t i v e assessment. Chapter Four p. 144 in the large scale c e l l lysate preparation and the af f ini ty purif ication procedure. The af f in i ty enriched YE1/48 antigen was subjected to preparative SDS-PAGE to eliminate the contaminating proteins of higher and lower M r . The 90,000 M r protein band excised was reduced, alkylated and separated by preparative SDS-PAGE again. This reduction/alkylation step was essential because most contaminating 90,000 M r proteins are l ike ly to be monomeric proteins and, therefore, would be removed when the 45,000 M r reduced YE1/48 antigen was isolated. Furthermore, reduction and alkylation was necessary to cleave the intrachain as well as interchain disulphide bonds, in order to prevent the formation of disulphide-linked tryptic fragments. If not removed, these disulphide-linked tryptic fragments, which possess more than one amino-terminus, might give rise to mixed amino acid signals during subsequent sequencing. The analysis of the SDS-PAGE purified reduced/alkylated antigen by s i lver staining on an independent SDS-PAGE gel showed that the purified sample was essentially pure by M r , containing a major portion as the 45-50,000 M r monomer and a minor fraction as the 90-95,000 M r dimer (Figure 11, lane g). The persistence of the dimer band was probably due to an incomplete alkylation of the antigen such that redimerization of the purified 45-50,000 M r monomer had occurred. A faint band at higher M r may also represent a multimeric product of the 45-50,000 M r monomer, suggesting that the YE1/48 antigen may have a strong tendency to form multimeric complexes. The highest yie ld obtained with several batches of antigen purification was 50-60 ug (550-660 pmoles) per 10^ ce l l s , which corresponds to a 50-60% efficiency of the SDS-PAGE procedure as calculated from the aff ini ty enriched 90,000 M r antigen. Due to a poor recovery of the two subunits from two-dimensional gels (IEF vs SDS-PAGE), no attempts were made to separate and purify each subunit. Chapter Four p. 145 4.2.3 Separation Of The Tr y p t i c Peptides By HPLC Despite the various precautions taken to minimize the destruction or modification of amino acid residues during the preparative SDS-PAGE procedure (see Chapter Two, section 2.3.3), no amino acid sequences of the p u r i f i e d YE1/48 antigen (16 yg; 180 pmoles) could be obtained, suggesting that the amino-terminus might be blocked. The p u r i f i e d antigen (55 yg; 600 pmoles) was therefore digested with trypsin which cleaves s p e c i f i c a l l y a f t e r each l y s i n e and arginine residue except when arginine i s followed by a pr o l i n e . The t r y p t i c fragments were separated on a C^g reverse phase HPLC column, and the separation p r o f i l e i s shown in Figure 12. A l l of the t r y p t i c peptides were eluted within the range of 5-40% a c e t o n i t r i l e i n 0.1% t r i f l u o r o a c e t i c a c i d (TFA). The majority of the peptides were r e l a t i v e l y hydrophilic and were eluted i n 10-20% a c e t o n i t r i l e . Very few hydrophobic peptides were detected. A s i m i l a r p r o f i l e of peptide separation was obtained with another independent p u r i f i c a t i o n and digestion experiment. It i s l i k e l y that some of the hydrophobic sequences did not dissolve i n 3 M guanidine chloride and were l o s t i n the p r e f i l t r a t i o n of sample p r i o r to the HPLC separation. The observation that a su b s t a n t i a l amount of r a d i o a c t i v i t y was l o s t i n the p r e f i l t r a t i o n step supports this p o s s i b i l i t y . 4.2.4 Amino Acid Sequences Twelve t r y p t i c peptides separated from the HPLC column were selected for amino acid sequencing ( T r i p a r t i t e Microsequencing Centre, University of V i c t o r i a , V i c t o r i a , BC). While two of them were probably blocked at the amino-termini and another two contained mixed signals of amino acid residues, nine sequences were determined from eight peptide fract i o n s (Table IX). Eight out of the nine peptides were sequenced to completion with either arginine or l y s i n e as the l a s t residues. These nine sequences were reasonably unambiguous although the phenylthiohydantoin (PTH) derivatives of most amino acid residues Chapter Four p. 146 Figure 12. Separation of the YE1/48 tryptic peptides by C-)R reverse phase  HPLC chromatography. Approximately 55 ug of the purified reduced and alkylated YE1/48 antigen was digested with trypsin and subjected to peptide separation on a C^g column using a 0-60% acetonitri le gradient in 0.1% TFA. Only the 5-40% acetonitri le elution profi le which contained the major eluted peptides was shown here. The peaks marked a-h contained the peptides which were subsequently sequenced and presented in Table IX. Chapter Four p. 147 TABLE IX AMINO ACID SEQUENCES OF THE YE1/48 TRYPTIC PEPTIDES Peptide Sequence a Gln-Val-Arg-Pro-Glu-Glu-Thr-Lys b Thr-Glu-Ser-Gly-Glu-Lys c * Ile-Asp-Asp-Glu-Asp-Glu-Leu-Lys dl Leu-Ala-Leu-Asn-Thr-Arg d2 Leu-Ala-Leu-Asn-Thr-Pro-Ser-Lys e Ile-Phe-Gln-Tyr-Asp-Gln-Gln-Lys f * Thr-Val-Leu-Asp-Ser-Leu-Gln-His-Thr-Gly-Arg g * Asp-Trp-Ala-Trp-Ile-Asp-Asn-Arg-Pro-Ser- -Lys h Ser-Ile-Glu-Cys-Asp-Leu-Glu-Ser-Leu-Asn-JL Confirmed by two independent purification and tryptic digestion experiments. tt The tryptic peptide was not sequenced to completion. Chapter Four p. 148 were detected at a l e v e l of 10-150 pmoles. Indeed three peptide sequences c, f and g were confirmed by two independent p u r i f i c a t i o n , digestion and HPLC separation experiments. In peptide f r a c t i o n d, two amino acid s i g n a l s , arginine and proline, were detected at the s i x t h position. Since the seventh p o s i t i o n was not proline and the quantity of signals at the seventh and eighth positions decreased d r a s t i c a l l y from that at the s i x t h p o s i t i o n , i t i s possible that the arginine at the s i x t h p o sition defines the cleaved end of one t r y p t i c peptide whereas the proline at the same pos i t i o n belongs to another peptide ending i n ly s i n e at the eighth position. The two sequences d l and d2, sharing the f i r s t f i v e amino acid residues, probably possess s i m i l a r hydrophobic!ty and thus were eluted as a single peak, on the a c e t o n i t r i l e gradient. 4.3 DISCUSSION 4.3.1 YE1/48 Is D i s t i n c t From The T C e l l Receptor a /0 Based on the sequential immunoprecipitation from EL-4 c e l l s and the d i f f e r e n t i a l expression on MBL-2(4.1) and MBL-2(2.6) variant clones, i t appears that the YE1/48 antigen i s u n l i k e l y to be i d e n t i c a l to TCR-a/0. However, these data cannot conclusively rule out the p o s s i b i l i t y that, i n the sequential immunoprecipitation experiment, the YE1/48.10.6 MAb and the R3497 rabbit antiserum were recognizing two d i f f e r e n t i a l l y glycosylated forms of the same protein. Compatible with this hypothesis i s the gl y c o s y l a t i o n c h a r a c t e r i s t i c s of the YE1/48 antigen. Endoglycosidase F analysis of the YE1/48 antigen has revealed a minimum of three N-linked carbohydrate side chains. S i m i l a r l y , three N-linked carbohydrate side chains have been demonstrated on each of the 27-32,000 Mr murine TCR-a/0 polypeptide cores as well as predicted from th e i r cDNA clones (Chien et a l . , 1984; Hedrick et a l . , 1984; Kaye and Janeway, 1984; Mclntyre and A l l i s o n , 1984). Nevertheless, two Chapter Four p. 149 lines of evidence substantiate the distinction between the YE1/48 antigen and TCR-a/0. F i r s t , unlike the heterodimeric a and 0 chains of TCR which dif fer considerably from each other in tryptic peptide fingerprints (Acuto et a l . , 1983; Reinherz et a l . , 1984), the two YE1/48 subunits have very similar tryptic peptide maps. In addition, the tryptic peptide maps of both YE1/48 subunits are also very different from those of the TCR-a/0 even though the same mapping procedure was used. Second, the amino acid sequences of the purified YE1/48 antigen have shown no homology with the published murine TCR-a /0 sequences. It is further confirmed by similar comparison of the YEl/48-encoding cDNA sequence with the published a and 0 sequences which w i l l be described in Chapter Five (see section 5.2.2). Therefore, i t can be concluded that the YE1/48 antigen is not identical to the TCR-a/0 molecule. 4.3.2 Comparison Of YE1/48 With Other Known Proteins The YE1/48 antigen was purified and several amino acid sequences of the tryptic peptides were determined. The two subunits of the YE1/48 antigen were not separated from each other in the purification because of d i f f i cu l t i e s in isolating the two subunits separately with a high recovery. Therefore, the sequences of the tryptic peptides generated from the purified antigen cannot be assigned to each subunit at this time. Since the tryptic peptide mapping has previously shown that the two subunits share the majority of their tryptic peptides, i t is l ike ly that many of the sequences of the tryptic peptides reported here are shared by both protein subunits. Amino acid sequences of nine tryptic peptides generated from the purified YE1/48 antigen were analysed for possible homology with over 4000 other protein sequences in the National Biomedical Research Foundation (NBRF) data base (Release 11.0, January 1987). The WORDSEARCH program (University of Wisconsin, Genetics Computer Group, Madison, WI) based on the algorithm of Wilbur and Lipman (1983) was used for sequence alignment. Using a word size Chapter Four p. 150 of two for locating the sequence matches, the highest alignment scores obtained with the nine tryptic sequences ranged from 6 to 11. When a word size of one was used, which generally provides a higher sensit ivity but less speci f ic i ty of the sequence alignment, the highest scores were 8 to 14 and additional protein sequences emerged at the top of the score l i s t . On using the GAP program (University of Wisconsin Genetics Computer Group) for pair-wise sequence alignment allowing no gap insertions, the s imi lar i t ies of the tryptic peptide sequences with the protein sequences of the highest scores ranged from 37.5% to 83.3%, The proteins showing relatively high scores include bacterial and v i r a l proteins, cel lular and nuclear enzymes, neuropeptides, interferons, acetylcholine receptor, Ig superfamily members (T3§, CD8 and CD4) and oncogene products. The major proteins which share s imi lar i t ies with more than one tryptic peptide sequence are oncogene products (versus peptides a, c, f and e), Ig superfamily members (versus peptides a and b), v i r a l coat proteins (versus peptides a and h) and, at lower s imi lar i t i e s , leukemia v i r a l gag proteins (versus peptides a, d, f, g and h). The significance of these s imilari t ies has yet to be just i f ied because in many cases, combinations of several amino acid residues can be found in apparently unrelated proteins. Furthermore, since the tryptic peptides are only 6 to 11 residues in length, matches in a few residues of a random cause may have given some deceivingly favourable scores in s imi lar i t ies . In addition, as mentioned above, the sequences of the tryptic peptides cannot be assigned to each of the two subunits of the YE1/48 antigen, making i t d i f f i cu l t to determine whether the proteins sharing homology with more than one peptide are s ignif icant. Hence, the s imi lari t ies observed are not considered to be convincing and no homology with any known proteins can yet be determined. Longer primary sequences are needed for the analysis of possible homology of the YE1/48 antigen with other proteins (see Chapter Five, section 5.2.2). The purified YE1/48 antigen has a strong tendency to form dimers and Chapter Four p. 151 multimers, suggesting the presence of multiple cysteine residues within the molecule. Although only one cysteine residue has been identified in nine tryptic peptides, the complete YEl/48 protein sequence deduced from the cDNA clone isolated later indicates a relatively high cysteine content in the molecule (see Chapter Five, section 5.2.2). F inal ly , our data show that the YE1/48 antigen appears to be a novel murine T c e l l surface antigen. Its internal amino acid sequences are clearly different from the TCR a, 6 and y polypeptides. The human CD28 (T44) is another disulphide-linked molecule with similar molecular size as YE1/48. The MAb 9.3 which reacts with CD28 does not cross-react with mouse T cel ls (our unpublished observation), hence no direct comparison with the YE1/48 antigen by sequential immunoprecipitation is possible. The relationship of YE1/48 with CD28 (T44) was at the time unknown since the sequence of CD28 was not available during the amino acid sequencing of the YE1/48 antigen. When the human CD28 cDNA sequence was subsequently available, the YEl/48-encoding cDNA had also been isolated. The comparison of their sequences has revealed no significant homology (see Chapter Five, section 5.2.2). With the recent report on the Al molecule (Nagasawa et a l . , 1987; Spiazzi et a l . , 1987), we speculate that the YEl/48 antigen may be identical to A l . The YEl/48 antigen is similar to Al in molecular size, N-linked glycosylation patterns, their substantially easier detection by immunoprecipitation from two C57BL/6 T lymphomas compared to that from normal T lymphocytes, and the high tendency for their subunits to redimerize. Similar to the YEl/48 antigen, no functional data of the Al molecule has been derived because, in both cases, the MAb's do not show detectable binding to normal T cel ls in the thymus and spleen. Possible identity of YEl/48 with the Al molecule is unt i l now unclarif ied since the Al MAb is not available and the primary sequence of Al has not been described. Chapter Four 4.4 SUMMARY p. 152 The YE1/48 antigen is a disulphide-linked dimer of two 45-50,000 M r subunits expressed on murine T lymphocytes. It resembles the TCR-a/0 in molecular size and pi values, but i t appears different from the a /0 receptor by tryptic peptide fingerprints (see Chapter One). To further compare YE1/48 with TCR-a/0, their expression on EL-4 cel ls and MBL-2 variant clones were studied and the part ia l amino acid sequences of YE1/48 were determined. The two molecules can be distinguished on EL-4 cel ls by sequential immunoprecipitation using YE1/48.10.6 MAb and a rabbit antiserum reactive with a l l TCR-a/0 molecules. The MB1-2(4.1) and MBL-2(2.6) variant clones, which dif fer in the level of YE1/48 expression by more than 200 fold, express comparable amounts of the a /0 receptor. Hence, the YE1/48 antigen and TCR-a/0 appear to be different molecules. The YE1/48 antigen was purified from MBL-2(4.1) cel ls by aff ini ty chromatography and preparative SDS-PAGE, digested with trypsin and the resultant peptides were separated by reverse phase HPLC. The amino acid sequences of several YE1/48 tryptic peptides were determined. Upon comparison with the protein sequences in the data base, no identical sequences were detected including the published TCR sequences. It therefore confirms that YE1/48 is distinct from the TCR a , 0 and y gene products, and that YE1/48 is l ike ly a novel T c e l l antigen not previously described. However, the poss ibi l i ty of homology with other proteins remains undetermined because the tryptic peptides are too short to yie ld meaningful s t a t i s t i c a l comparison with the data base. Further comparisons have been made possible after the isolation of a YE1/48 cDNA clone (see Chapter Five). Chapter Four p. 153 4.5 REFERENCES Acuto, 0., Meuer, S . C , Hodgdon, J . C , Schlossman, S.F. and Reinherz, E . L . (1983) Peptide var iabi l i ty exists with a and |3 subunits of the T c e l l receptor for antigen. J . Exp. Med. 158:1368. Alarcon, B . , Vries, J . D . , Pettey, C , Boylston, A . , Yssel, H . , Terhorst, C. and Spits, H. (1987) The T - c e l l receptor y chain-CD3 complex: Implication in the cytotoxic act ivi ty of a CD3+CD4~CD8 human natural k i l l e r clone. Proc. Natl . Acad. Sci . USA 84:3861. Al l i son , J . P . , Mclntyre, M.W. and Bloch, D. (1982) Tumor-specific antigen of murine T-lymphoma defined with monoclonal antibody. J . Exp. Med. 157:1149. B a l l i n a r i , D . , Cas te l l i , C , Traversari, C , P ierot t i , M.A., Parmiani, G . , Palmieri, G . , Ricciardi-Castagnoli , P. and Adorini, L. (1985) Disulphide-linked surface molecules of monoclonal antigen-specific suppressor T ce l l s : evidence for T ce l l receptor structures. Eur. J . Immunol. 15:855. Bank, I . , DePinho, R .A . , Brenner, M.B., Cassimeris, J . , A l t . , F.W. and Chess, L. (1986) A functional T3 molecule associated with a novel heterodimer on the surface of immature human thymocytes. Nature 322:179. Bekoff, M. , Kubo, R. and Grey, H.M. (1986) Activation requirements for normal T ce l ls : Accessory cell-dependent and -independent stimulation by ant i -receptor antibodies. J . Immunol. 137:1411. Borst, J . , van de Griend, R . J . , van Ootstveen J.W., Ang, S . - L . , Melief, C J . , Seidman, J . G . and Bolhuis, R . L . H . (1987) A T - c e l l receptor y/CD3 complex found on cloned functional lymphocytes. Nature 325:683. Borst, J . , van Dongen, J . J . M . , Bolhuis, R . L . H . , Peters, P . J . , Hafler, D .A. , de Vries, E. and van de Griend, R . J . (1988) Distinct molecular forms of human T c e l l receptor y/8 detected on viable T cel ls by a monoclonal antibody. J . Exp. Med. 167:1625. Brenner, M.B. , McLean, J . , Scheft, H . , Riberty, J . , Ang, S . - L . , Seidman, J . G . , Devlin, P. and Krangel, M.S. (1987) Two forms of the T - c e l l receptor y protein found on peripheral blood cytotoxic T lymphocytes. Nature 325:689. Chien, Y . - H . , Becker, D.M., Lindsten, T . , Okamura, M. , Cohen, D.I . and Mavis, M.M. (1984) A third type of murine T ce l l receptor gene. Nature 312:31. Dembic, Z . , Haas, W., Zamoyska, R., Parnes, J . , Steinmetz, M. and von Boehmer, H. (1987) Transfection of the CD8 gene enhances T - c e l l recognition. Nature 326:510. Emmrich, F . , Strittmatter, U. and Eichmann, K. (1986) Synergism in the activation of human CD8 T cells by cross-linking the T - c e l l receptor complex with CD8 differectiation antigen. Proc. Natl . Acad. Sc i . USA 83:8298. F e r r i n i , S., Bottino, C , Biassoni, R., Poggi, A . , Sekaly, R . P . , Moretta, L. and Moretta, A. (1987) Characterization of CD3+, CD4", CD8- clones Chapter Four p. 154 expressing the putative T ce l l receptor y gene product. J . Exp. Med. 166:277. Gabert, J . , Langlet, C . , Zamoyska, R., Parnes, J . R . , Schmitt-Verhulst, A-M. and Malissen, B. (1987) Reconstitution of MHC class I speci f ic i ty by transfer of the T ce l l receptor and Lyt-2 genes. Ce l l 50:545. Goding, J.W. and Harris, A.W. (1981) Subunit structure of c e l l surface proteins: Disulphide bonding in antigen receptors, Ly-2/3 antigens, and transferrin receptors of murine T and B lymphocytes. Proc. Natl . Acad. Sci . USA 78:4530. Hara, T . , Fu, S.M. and Hansen, J .A . (1985) Human T c e l l activation II . A new activation pathway used by a major T ce l l population via a disulphide-bonded dimer of a 44 kilodalton polypeptide (9.3 antigen). J . Exp. Med. 161:1513. Hedrick, S.M., Cohen, D . I . , Nielsen, E.A. and Davis, M.M. (1984) Isolation of cDNA clones encoding T ce l l -speci f ic membrane-associated proteins. Nature 308:149. Jay, G . , Palladino, M.A., Khoury, G. and Old, L . J . (1982) Mouse Lyt-2 antigen: Evidence for two heterodimers with a common subunits. Proc. Natl . Acad. Sci . USA 79:2654. Kappler, J . , Kubo, R. , Haskins, K . , White, J . and Marrack, P. (1983) The mouse T c e l l receptor: comparison of MHC-restricted receptors on two T c e l l hybridomas. Ce l l 34:727. Kaye, J . and Janeway, C A . J r . (1984) The a- and 6-subunits of a murine T c e l l antigen/la receptor have a molecular weight of 31,000 in the absence of N-linked glycosylation. J . Immunol. 133:2291. Ledbetter, J . and Nowinski, R.C. (1977) Identification of the gross c e l l surface antigen associated with Murine Leukemia Virus-infected ce l l s . J . V i r o l . 23:315. Ledbetter, J . A . , Evans, R . L . , Lipinski , M. , Cunningham-Rundles, C , Good, R.A. and Herzenberg, L .A. (1981a) Evolutionary conservation of surface molecules that distinguish T lymphocytes helper/inducer and cytotoxic/suppressor subpopulations in mouse and man. J . Exp. Med. 153:310. Ledbetter, J . A . , Seaman, W.E., Tsu, T .T . and Herzenberg, L .A. (1981b) Lyt-2 and Lyt-3 antigens are on two different polypeptide subunits linked by disulphide bonds. J . Exp. Med. 153:1503. Lesslauer, W., Koning, F . , Ottenhoff, T . , Giphart, M., Goulmy, E. and van Rood, J . J . (1986) T90/44(9.3 antigen). A ce l l surface molecule with a function in human T ce l l activation. Eur. J . Immunol. S6:1289. Lew, A . M . , Pardoll , D.M., Maloy, W.L., Fowlkes, B . J . , Kruisbeek, A . , Cheng, S . - F . , Germain, R .N. , Bluestone, A . , Schwartz, R.H. and Coligan, J . E . (1986) Characterization of T ce l l receptor gamma chain expression in a subset of murine thymocytes. Science 234:1401. van Lier , R.A.W., Borst, J . , Vroom, T . M . , Klein, H . , van Mourik, P . , Zeijlemaker, W.P. and Melief, C J . M . (1987) Tissue distribution and Chapter Four p. 155 biochemical and functional properties of Tp55 (CD27), a novel T c e l l differentiation antigen. J . Immunol. 139:1589. Mclntyre, B.W. and Al l i son , J . P . (1984) Biosynthesis and processing of murine T c e l l antigen receptor. Ce l l 38:659. Martin, P . J . , Ledbetter, J . A . , Morishita, Y . , June, C . H . , Beatty, P.G. and Hansen, J . A . (1986) A 44 kilodalton ce l l surface homodimer regulates interleukin 2 production by activated human T lymphocytes. J . Immunol. 136:3282. Matis, L . A . , Cron, R. and Bluestone, J . A . (1987) Major histocompatibility complex-linked specif ic ity of y& receptor-bearing T lymphocytes. Nature 330:262. Meuer, S . C , Fitzgerald, K.A. , Hussey, R . E . , Hodgdon, J . C , Schlossman, S.F. and Reinherz, E . L . (1983a) Clonotypic structures involved in antigen-specific human T ce l l function. Relationship to the T3 molecular complex. J . Exp. Med. 157:705. Meuer, S . C , Acuto, 0., Hussey, R . E . , Hodgdon, J . C , Fitzgerald, K . A . , Schlossman, S.F. and Reinherz, E . L . (1983b) Evidence for the T3-associated 90K heterodimer as the T-ce l l antigen receptor. Nature 303:808. Moingeon, P . , Ythier, A . , Goubin, C , Faure, F . , Nowill, A . , Delmon, L . , Rainaud, M. , Forestier, F . , Daffos, F . , Bohuon and Hercend, T. (1986) A unique T - c e l l receptor complex expressed on human fetal lymphocytes displaying natura l -k i l l er - l ike act iv i ty . Nature 323:638. Moingeon, P. , Jitsukawa, S., Faure, F . , Troalen, F . , Triebel , F . , Graziani, M. , Forestier, F . , Bellet , D. , Bohuon, C. and Hercend, T. (1987) A y-chain complex forms a functional receptor on cloned human lymphocytes with natural k i l l e r - l i k e act iv i ty . Nature 325:723. Nagasawa, R. , Gross, J . , Kanagawa, 0., Townsend, K . , Lanier, L . L . , C h i l l e r , J . and Al l i son , J . P . (1987) Identification of a novel T c e l l surface disulphide-bonded dimer distinct from the a/3 antigen receptor. J . Immunol. 138:815. Nakanishi, N . , Maeda, K . , Ito, K . , Heller, M. and Tonegawa, S. (1987) Ty protein is expressed on murine fetal thymocytes as a disulphide-linked heterodimer. Nature 325:720. Omary, M.B. and Trowbridge, I .S. (1981a) Covalent binding of fatty acid to the transferrin receptor in cultured human ce l l s . J . B i o l . Chem. 256:4715. Omary, M.B. and Trowbridge, I.S. (1981b) Biosynthesis of the human transferrin receptor in cultured ce l l s . J . B io l . Chem. 256:12888. Pardoll , D.M., Fowlkes, B . J . , Bluestone, J . A . , Kruisbeek, A. and Schwartz, R.H. (1987) Differential expression of two distinct T c e l l receptors during thymocyte development. Nature 326:79. P h i l l i p s , J . H . , Weiss, A . , Gemlo, B . T . , Rayner, A.A. and Lanier, L . L . (1987) Evidence that the T ce l l antigen receptor may not be involved in cytotoxicity mediated by y/& and a/3 thymic c e l l l ines. J . Exp. Med. 166:1579. Chapter Four p. 156 Poggi, A . , Bott in i , C. , Zocchi, M.R., Pantaleo, G . , Ciccone, E . , Mingari, C . , Moretta, L. and Moretta, A. (1987) CD3+WT31- peripheral T lymphocytes lank T44(CD28), a surface molecule imvolved in activation of T ce l l s bearing the a/6 heterodimer. Eur. J . Immunol. 17:1065. Ratnofsky, S . E . , Peterson, A . , Greenstein, J . L . and Burakoff, S .J . (1987) Expression and function of CD8 in a murine T c e l l hybridoma. J . Exp. Med. 166:1747. Reinherz, E . L . , Acuto, 0., Fabbi, M. , Bensussan, A . , Milanese, C . , Royer, H.D. , Meuer, S.C. and Schlossman, S.F. (1984) Clonotypic surface structure on human T lymphocytes: functional and biochemical analysis of the antigen receptor complex. Immunol. Rev. 81:95. Roehm, N . , Herron, L . , Cambier, J . , DiGuisto, D. , Haskins, K . , Kappler, J . and Marrack, P. (1984) The major histocompatibility complex-restricted antigen receptor on T cel ls : Distribution on thymus and peripheral T ce l l s . Ce l l 38:577. Samelson, L . E . (1985) An analysis of the structure of the antigen receptor on a pigeon cytochrome c-specific T ce l l hybrid. J . Immunol. 134:2529. Snow, P.M. and Terhorst, C. (1983) The T8 antigen is a multimeric complex of two dist inct subunits on human thymocytes but consists of homomultimeric forms on peripheral blood T lymphocytes. J . B i o l . Chem. 258:14675. Spiazzi, A . , Corradin, G . , Nagasawa, R., Tridente, G . , MacDonald, R. and Bron, C. (1987) Biochemical characterization of a T-lymphoma-specific 90,000 molecular weight disulphide linked dimeric glycoprotein. Mol. Immunol. 24:719. Takada, S. and Engelman, E.G. (1987) Evidence for an association between CD8 molecules and the T ce l l receptor complex on cytotoxic T ce l l s . J . Immunol. 139:3231. Trowbridge, I .S. and Lopez, F. (1982) Monoclonal antibody to transferrin receptor blocks transferrin binding and inhibits human tumor c e l l growth in v i t ro . Proc. Natl . Acad. Sci . USA 79:1175. Wilbur, W.J. and Lipman, D .J . (1983) Rapid s imilarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci . USA 80:726. Chapter Five p. 157 CHAPTER F I V E I S O L A T I O N OF A cDNA CLONE ENCODING THE Y E 1 / 4 8 ANTIGEN 5.1 INTRODUCTION 158 5.2 RESULTS 5.2.1 Isolation of a YE1/48 cDNA clone 158 5.2.2 Nucleotide and deduced protein sequences of the cDNA clone 160 5.2.3 Genomic Southern analyses 166 5.2.4 Northern blot analyses 171 5.2.5 Expression of YE1/48 on transformed pre-B c e l l lines 174 5.3 DISCUSSION 176 5.3.1 Possible functional sites and domains 179 5.3.2 Expression on lymphoid cel ls and its possible correlation with cel lular transformation 181 5.3.3 A l l e l i c polymorphism and possible existence of related multigenes 182 5.3.4 Differential accessibi l i ty of epitopes on T lymphomas and normal T lymphocytes 183 5.3.5 Homodimer or heterodimer 184 5.4 SUMMARY 185 5.5 REFERENCES 188 Chapter Five 5.1 INTRODUCTION p. 158 In the preceeding two chapters, the biochemical analyses of the YE1/48 antigen and i t s detection i n normal lymphoid populations by immunoprecipitation have been described. I t has also been demonstrated that YE1/48 i s d i s t i n c t from the murine T c e l l receptor oc/0. Nevertheless, because the YE1/48.10.6 and YE1/32.8.5 MAb's do not show detectable binding on i n t a c t normal c e l l surface, no b i o l o g i c a l e f f e c t s upon the perturbation of the YE1/48 antigen could be derived. In order to elucidate the possible function of the YE1/48 antigen and i t s c o r r e l a t i o n with other known antigens, we undertook the cDNA cloning of YE1/48. In this chapter, we describe the i s o l a t i o n of a cDNA clone encoding the YE1/48 antigen and i t s deduced primary structure. Using the i s o l a t e d cDNA as a probe, the expression of the YE1/48 gene i n lymphoid c e l l populations was analysed and i t s possible c o r r e l a t i o n with c e l l u l a r transformation was implicated. Genomic Southern analysis has also demonstrated the a l l e l i c polymorphism of the YE1/48 gene and the presence of other genes with homologous sequences. 5.2 RESULTS 5.2.1 I s o l a t i o n Of A YE1/48 cDNA Clone Three mixtures of anti-sense synthetic oligonucleotides of 17 bases i n length were made based on three t r y p t i c peptide sequences previously reported (see Chapter Four). Two of the three t r y p t i c sequences were determined i n duplicate antigen p u r i f i c a t i o n and digestion experiments. The oligonucleotide mixtures contain a l l possible sequences encoding the hexapeptides; they correspond to codon degeneracies of 24, 32 and 48 (Table X). They were used to screen 100,000 recombinant plaques from a MBL-2(4.1) XgtlO cDNA l i b r a r y under low stringencies (see Chapter Two, section 2.5.2). A cDNA clone named Chapter Five p. 159 TABLE X SEQUENCES OF THE REDUNDANT SYNTHETIC OLIGONUCLEOTIDE PROBES USED IN THE ISOLATION OF THE YE1/48-ENCODING CLONE M3-2 Probe Redundancy Amino acid versus oligonucleotide sequences FT1 24 W A W I D N ACCCGAACCTAACTATT G G G T T C FT2 48 I D D E D E TAACTACTACTTCTACT G G G C G T FT 3 32 Q Y D Q Q K GTTATACTAGTTGTTTT C G G C C Chapter Five p. 160 M3-2 that hybridized to a l l three probes was isolated. It has an insert size of approximately 1.3 kb. It appears to be close to f u l l length because Northern blot analysis using the cDNA insert as a probe showed a single 1.4 kb band in the poly(A)+RNA extracted from MBL-2(4.1) ce l l s . 5.2.2 Nucleotide And Deduced Protein Sequences Of The cDNA Clone The YE1/48 cDNA was sequenced by the dideoxy chain-termination method, in conjunction with the preparation of deletion clones and the use of internal synthetic oligonucleotide primers (Figure 13a). The cDNA is 1272 bp in length. The longest open reading frame, beginning with an ATG methionine codon, extends from nucleotides 181 to 966, encoding a polypeptide of 262 amino acids (Figure 13b). Within this protein sequence, a l l of the tryptic peptide sequences previously reported can be located (Table XI). However, a few discrepant residues were noted: Trp at position 160 versus Glu in tryptic peptide b; Cys at position 163 versus Glu in the same tryptic peptide; Gly at position 223 versus Arg in peptide dl and Pro-Ser in peptide d2. Neither of these discrepancies can be explained by single base pair changes in the cDNA sequence. In light of the low molar quantities of these amino acid residue signals (40 pmoles and below), we consider the cDNA-deduced protein sequence more rel iable than those determined by peptide sequencing. Within the same reading frame, another ATG Met codon is located at nucleotide 208 (amino acid position 10), 25 nucleotides downstream to the f i r s t one. By the cr i t er ia that a purine (A at position 178) resides at the third nucleotide upstream to the f irs t ATG codon but a pyrimidine (T at position 205) upstream to the second ATG, and that the flanking sequence of the f i r s t ATG codon better conforms to the consenses sequence CCACCATGG (Kozak, 1986, 1987) c r i t i c a l to translation by eukaryotic ribosomes, i t is l ike ly that the f i r s t ATG in i t ia t ion codon is used. Thus, the cDNA contains a 5' untranslated sequence of at least 180 bp and a 3' untranslated sequence of Chapter Five p. 161 (a) « o iiiiiiiiihi 0.2 0.4 M3-2 cDNA 0.6 0.8 1.0 1.2 4 •llllltlll Figure 13. Strategy of DNA sequencing and the nucleotide and deduced amino  acid sequences of the cDNA clone M3-2. (a) The coding strand (solid squares) and the non-coding strand (open squares) of the cDNA were sequenced by the dideoxy chain-termination method. The forward and reverse priming sites in the pTZl9R pasmid vector were used to determine the end sequences. Two series of deletion clones prepared by exonuclease III digestion were used to determine twice the coding strand sequence of the entire cDNA. Two synthetic oligonucleotide primers were used to determine two sequences in the non-coding strand. Distance on the cDNA was marked in kilobases. (b) (next page) Nucleotides are numbered on both sides of the cDNA sequence and amino acid residues are numbered in parentheses on both sides of the deduced protein sequence. The potential polyadenylation signal is indicated by broken underline. Protein sequences corresponding to the tryptic peptides in Table XI are underlined. The transmembrane domain is marked by a thick broken l ine above the amino acid sequence, and on either side is marked by an arrow the cytoplasmic or extracellular portion. Positions of potential N-linked glycosylation sites are indicated by "CHO". Cysteine residues are marked by asterisks. The tripeptide Arg-Gly-Asp is highlighted as "RGD" above the amino acid sequence. Chapter F i v e p. 162 (b) 1 CATGAGGTTGAGTATCTCTCAGTGGAMTTTAGTTCTACCGTTTATTTTGGAGACACTTA 60 61 GGGGATATCMCCAGAAAAAGCCAACTTTTTCCTCCACCAGAACCACTTCNTGCTAGCGA 120 121 CACAGAAACCACTC&AGGCACCATTTGAACTGAGAACATACTrTATATATCAATCCCAAG 180 1) MetSerGluGlnGluValThrTyrSerMetValArgPheHisLysSerAlaGlyLeuGln (20) ATGAGTGAGCAGGAGGTCACTTATTCAATGGTGAGATTTCATAAATCTGCAGGATTGCAG 240 (21) LvsGlnValArgProGluGluThrLvsGlvProArgGluAlaGlvTvrArgArgCvsSer (40) 241 AAACAAGTGAGACCTGAGGAGACTAAAGGGCCCAGAGAAGCTGGCTACAGAAGGTGTTCA 300 'Cytoplasmic H••HMaaHaa•••••••• • • • • Transmembrane •••• (41) PheHisTrpLysPhelleVallleAlaLeuGlyllePheCysPheLeuLeuLeuValAla (60) 301 TTCCACTGGAAGTTCATTGTGATAGCTCTTGGCATCTTCTGTTTCCTTCTTCTGGTAGCT 360 Extracel1ula r (61) ValSerValLeuAlalleLvsIlePheGlnTvrAsDGlnGlnLvsAsnCvsGluGluPhe (80) 361 GTTTCAGTGTTGGCAATAAAAATTTITCAGTATGATCAGCAAAAAAACTGCGAGGAATTT 420 (81) LeuAsnHisHisAsnAsnCysSerAsnMetGinSerAspIleAsnLeuLysAspGluMet (100) 421 CTAAACCACCACAATAACTGCAGCAACATGCAAAGTGACATCAACTTGAAGGATGAAATG 480 :HC (101) LeuLvsAsnLysSerlleGluCvsAspLeuLeuGluSerLeuAsnArgAspGlnAsnArg (120) 481 CTGAAAAATAAGTCTATAGAGTGTGATCTTCTGGAATCCCTCAACAGGGATCAGAACAGA 540 :HC < R G D » (121) LeuTyrAsnLvsThrLvsThrValLeuAspSerLeuGlnHlsThrGlvArgGlvAspLvs (140) 541 TTGTATAATAAMCCAAGACTGTTTTAGATTCCTTACAGCACACAGGCAGAGGTGATAAA 600 * * (141) ValTyrTrpPheCysTyrGlyMetLysCysTyrTyrPheValMetAspArgLysTJirTrrj (160) 601 GTATACTGGTTCTGCTATGGTATGAAATGTTATTATTTCGTCATGGACAGAAAAACATGG 660 » * (161) SerGlvCvsLvsGlnAlaCvsGlnSerSerSerLeuSerLeuLeuLvsIleAspAspGlu (180) 661 AGTGGATGTAAACAGGCCTGCCAGAGTTCCAGTTTATCCCTTCTGAAGATAGATGATGAG 720 (181) AspGluLeuLvsPheLeuGlnLeuValValProSerAspSerCvsTrpValGlvLeuSer (200) I 721 GATGAACTGAAGTTCCTTCAGCTCGTGGTTCCTTCAGACAGTTGCTGGGTTGGAtTGTCA 780 I (201) TvrAspAsnLvsLvsLvsAspTrpAlaTrpIleAspAsnArgProSerLvsLeuAlaLeu (220) 781 TATGATAATAAGAAAAAAGATTGGGCATGGATTGACAATCGCCCATCTAAACTTGCCTTG 840 , • i (221) AsnThrGlvLvsTvrAsnlleArgAspGlvGlvCvsMetLeuLeuSerLvsThrArgLeu (240) ' 841 AACACAGGGAAATACAATATAAGAGATGGGGGATGTATGTTGTTATCTAAAACAAGACTA 900 j i I (241) AspAsnGlyAsnCysAspGlnValPhelleCysIleCysGlyLysArgLeuAspLysPhe (260) 901 GACAATGGTAACTGTGATCAaG t ATTCATCTGTATTTGTGGGAAGAGACTGGATAAATTC 960 (261) ProHisEnd 961 CCTCATTGACTCTCCAATGAGTGTTAAAGGAAAAAGTGAAATTTTCTTACTCTCATTTGT 1020 1021 TTCCTGTATTAATTAATGACACmGCAAACAAGTGTTTTGACCATTGGACTTAGTCTGC 1080 1081 AGTGCAAAGAGAGAGAGAGAAAATCTGGAAGATTTTGGGAATATTCTCTGAAACATGACA 1140 1141 TGACAGAGCAGATGACATCTTCCTTCCCTGTTGAGACTGGACAGATCTTCTCTGATACCC 1200 1201 CAAAGCTTGGACGAATCTGTTTTATTTGTTTGCATAAACTCTAA 1260 1261 ACCTTGATGACG 1272 Chapter Five p. 163 TABLE XI TRYPTIC PEPTIDE SEQUENCES USED TO CORROBORATE THE YEl/48 cDNA CLONE Peptide Probe 3 Sequence0 Position (Redundancy) a Gln-Val-Arg-Pro-Glu-Glu-Thr-Lys 22-29 b Thr(Glu)Ser-Gly(Glu)Lys 159-164 c FT2 (48) Ile-Asp-Asp-Glu-Asp-Glu-Leu-Lys 177-184 dl Leu-Ala-Leu-Asn-Thr(Arg) 218-222 d2 Leu-Ala-Leu-Asn-Thr(Pro-Ser)Lys 218-224 e FT3 (32) Ile-Phe-Gln-Tyr-Asp-Gln-Gln-Lys 68-75 f Thr-Val-Leu-Asp-Ser-Leu-Gln-His-Thr-Gly-Arg 127-137 g FT1 (24) Asp-Trp-Ala-Trp-Ile-Asp-Asn-Arg--Pro-Ser- Lys 207-217 h Ser-Ile-Glu-Cys-Asp-Leu-Leu-Glu- -Ser-Leu- Asn- C 105-115 a Redundant antisense 17-mer probes are based on the amino acid residues underlined. b Amino acid residues different from predicted by cDNA nucleotide sequence are indicated in parentheses. c This tryptic peptide was not sequenced to completion. Chapter Five p. 164 over 300 bp. Both of these untranslated regions contain termination codons in a l l reading frames. A polyadenylation signal sequence (AATAAA) is located 14 bp from the 3' end of the cDNA although a poly(A)-tail is missing. By hydrophobicity plotting (Kyte and Doolittle, 1982), no hydrophobic sequence characteristic of a leader sequence is found at the amino(N)-terminus of the deduced protein sequence. Beginning from residue 45 is a hydrophobic sequence of 22 amino acids, 19 of which are non-polar and none is charged. It is preceded by a cluster of basic amino acids (Arg-Arg-X-X-X-His-X-Lys from position 17 to 24) which is a common feature of the cytoplasmic domain just proximal to the transmembrane segment in a l l integral membrane proteins (Blobel, 1980; Sabatini et a l . , 1982). It indicates that the 22 residues-long segment is a transmembrane sequence and the N-terminal domain is located in the cytoplasm. Thus, YE1/48 is a type II membrane protein in which the transmembrane sequence serves as a leader segment in the translocation of proteins across the c e l l membrane as well as an anchorage of the protein in the membrane (Singer et a l . , 1987). It has 44 amino acids in the N-terminal cytoplasmic domain and 196 amino acids in the C-terminal extracellular domain. The predicted protein product is approximately 30,500 MW and contains 3 potential N-linked glycosylation sites (Asn-X-Ser/Thr) at amino acid positions 86, 103 and 123 in the C-terminal extracellular domain. The predicted molecular size is in close agreement with the 32,000 Mr core size suggested by previous endoglycosidase F analysis (see Chapter Three, section 3.2.2). The digestion pattern by endoglycosidase F also indicates that a l l of the three potential N-linked glycosylation sites are likely used. The predicted protein sequence contains 5.3% cysteine residues which is higher than the reported average of 2.8% in eukaryotic proteins (Klapper, 1977). This may explain the strong tendency of the YE1/48 protein to redimerize after reduction (see Chapter Four, section 4.2.1). A cysteine residue, which may be a site of fatty acylation via a thioester bond (Rose et a l . , 1984), is present within Chapter Five p. 165 the transmembrane sequence at position 77. A serine residue at position 40 in the N-terminal cytoplasmic domain is located in a Arg-Arg-X-Ser sequence which is a common site of phosphorylation by many cAMP- and cGMP-dependent protein kinases (Krebs and Beavo, 1979). However, no phosphorylation of the YEl/48 antigen has been detected so far. No significant homology was found when the YEl/48 cDNA and the deduced protein sequences were compared with the GENBANK nucleic acid (release 52.0, August 1987) and NBRF protein (release 13.0, June 1987) data base using the WORDSEARCH program (University of Wisconsin Genetics Computer Group, Madison, WI) based on the algorithm of Wilbur and Lipman (1983). Further comparison with sequences of other membrane antigens which are not included in the above database, such as human CD28 (T44) (Aruffo and Seed, 1987), human CD2 (Sewell et a l . , 1986), and the shared 6 subunit of human LFA-1, Mac-1 and pl50,95 (Kishimoto et a l . , 1987), also revealed no homology. Two interesting features were however noted. An Arg-Gly-Asp (RGD) tripeptide sequence, which accounts for the c e l l adhesive properties of many extracellular matrix proteins (Ruoslahti and Pierschbacher, 1987), is located at position 137-139 in the C-terminal extracellular domain. In this domain is also found a Cys-X4~Cys-Xi2-Cys-X3~Cys sequence from position 145 to 167. This sequence resembles a consensus pattern often found in zinc-binding proteins such as metallothionein and in finger proteins that can bind DNA (Berg, 1986; Evans and Hollenberg, 1988). In the consensus zinc-binding domain of the DNA-binding proteins, a zinc ion engages in hexahedral coordinate bonding to four cysteine residues and the long peptide sequence between the inner two cysteines forms the DNA-binding finger. In the DNA-binding finger, the C-terminal half often takes the configuration of an a-helix that spans a l l the way through the two Cysteine residues downstream. A Chou and Fasman propensity measure for oc-helices and 8-sheets (1978) of the deduced YEl/48 protein sequence, however, does not indicate a tendency for a-helix formation in the potential zinc-Chapter Five p. 166 binding domain. Whether these four cysteine residues on the YE1/48 antigen can bind zinc is yet unknown. 5.2.3 Genomic Southern Analyses Southern blot analysis of EL-4 and C57BL/6 mouse kidney genomic DNA digested with six different restrict ion enzymes and hybridized with the M3-2 cDNA insert probe did not show any rearrangement of the YE1/48 gene in EL-4 cel ls as compared to the germline (Figure 14a). Similar analysis of genomic DNA digested with Xbal from different sources including C57BL/6 l i v e r , spleen, thymocytes and bone marrow cel l s , from C57BL/6 T ce l l lines expressing YE1/48 including EL-4, MBL-2(4.1) and MBL-2(2.6), and from two other c e l l l ines not expressing YE1/48 such as BW5147 (AKR T cel ls) and A20 (BALB/c B ce l l s ) , did not reveal any gene amplication or translocation rearrangement of the YE1/48 gene (Figure 14b). Interestingly, Southern blot analysis of genomic DNA from C57BL/6, BALB/c and C3H mice digested with EcoRI and Hindl l l showed two different patterns (Figure 15a), indicating that the YE1/48 gene is at least dimorphic in that C57BL/6 mice carry an a l le le different from that in BALB/c and C3H mice. Moreover, since there is no EcoRI site within the M3-2 cDNA sequence and there is only one for H i n d l l l , the multiple banding patterns observed with both enzymes in either a l le le present two poss ibi l i t ies : either there are many introns within the gene, spanning a large region of DNA (about 40 kb), or there are other genes with highly conserved sequences. In an attempt to distinguish the above poss ib i l i t ies , three M3-2 fragments were prepared by Hinfl digestion, representing 514 bp of the 5' end (M3-2/514 probe), 400 bp of the middle portion (M3-2/400 probe) and 245 bp of the 3' end (M3-2/245 probe) of the cDNA insert. Hybridization using these three probes to a genomic Southern blot showed that the multiple banding patterns are primarily localized in the middle portion of the YE1/48 gene (Figure 15b, i i ) . If Chapter Five p. 167 Figure 14(a). Genomic Southern analysis shoving no rearrangement of the  YEl/48 gene. Genomic DNA (5 ug) from (1) C57BL/6 kidney or (2) EL-4, were digested with various restrict ion enzymes, separated on a 0.8% agarose gel , and alkaline blotted onto a zeta-probe nylon f i l t e r . The blot was then hybridized with the radiolabeled M3-2 cDNA insert probe. Chapter Five p. 168 1 2 3 4 5 6 7 8 9 Figure 14(b). Genomic Southern analysis shoving no amplification of the  YEl/48 gene. Genomic DNA (10 yg) from C57BL/6 (1) l i ver , (2) spleen, (3) thymus, (4) bone marrow, (5) a BALB/c B ce l l l ine, A20, (6) an AKR T c e l l l ine , BW5147, (7) MBL-2(2.6), (8) MBL-2(4.1), and (9) EL-4 ce l l s , were digested with Xbal, electrophoresed, blotted and hybridized as described in Figure 14(a). Chapter Five p. 169 (a) kb 2 3 . 0 . 9.4 -6 .6 -4 . 3 -2.3 2.0 EcoRI Hindlll 1 2 3 1 2 3 Figure 15. Genomic Southern analysis shoving a l l e l i c polymorphism of the  YEl/48 gene and possible existence of other related genes, (a) 3 yg of genomic DNA from (1) C3H, (2) BALB/c, and (3) C57BL/6 spleen c e l l s vere digested v i t h H i n d l l l and EcoRI, separated on a 0.8% agarose g e l , blotted and hybridized v i t h the M3-2 cDNA insert probe as described in Figure 14. (b) (next page) A s i m i l a r DNA blot was hybridized consecutively v i t h three radiolabeled M3-2 fragment probes of ( i ) 514 bp (M3-2/514), ( i i ) 400 bp (M3-2/400) and ( i i i ) 245 bp (M3-2/245) in length. The closed and open arrows mark two sets of DNA fragment bands detected by more than one probe, (c) (next page) 10 yg of genomic DNA from (1) BALB/c and (2) C57BL/6 spleen c e l l s were digested with H i n d l l l and EcoRI and prepared on a nylon f i l t e r as described above. It was hybridized consecutively with ( i ) the M3-2 insert probe and ( i i ) a M3-2 fragment of 151 bp (M3-2/151). The M3-2/151 sequence i s located within that of M3-2/400 (b, i i ) . Chapter Five p. 170 (b) (i) Hindlll EcoRI (ii) Hindlll EcoRI (iii) Hindlll EcoRI M3-2 k i (1272 bp) rizzmiiiiiimiiiiiiiiiiiiiiiiiiiiiiii v 54 bp M3-2/245 / / / / / 59 bp (c) (i) , A 6 \ M3-2/ f • \ 151 / v I YSZSSZ/Z/. I l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l M3-2/400 Chapter Five p. 171 YEl/48 is a single gene containing many introns, any two fragment probes that are closely proximal to each other should detect a single overlapping genomic restr ict ion fragment. As shown in Figure 15b, i and i i , single overlapping bands (marked by open arrows) were shared by the M3-2/514 and M3-2/400 probes. In contrast, two overlapping bands (marked by solid arrows in Figure 15b, i i and i i i ) were shared by the M3-2/400 and M3-2/245 probes. It therefore implicates that other related genes may exist, and that the mere existence of numerous introns in the YEl/48 gene cannot ful ly explain the multiple banding patterns observed. To further test this poss ibi l i ty , a 151 bp Fokl fragment (M3-2/151) located within the M3-2/400 sequence was prepared. Comparable multiple banding patterns were detected when the Fokl fragment was used for Southern blot hybridization (Figure 15c, i i ) , strongly implicating the existence of other genes with homologous sequences. 5.2.4 Northern Blot Analyses The expression of YEl/48 in lymphoid c e l l populations and established c e l l lines was analysed by Northern blot hybridization of total RNA using the M3-2 cDNA insert (Figure 16). To quantitatively compare the expression levels of YEl/48 in different c e l l populations, a l l Northern blots were rehybridized for actin message which presumably maintains a relatively constant level in a l l c e l l types. The signal intensity was monitored by laser scanning densitometry. In agreement with previous immunoprecipitation data (see Chapter Three, section 3.2.3 C), YEl/48 transcripts were detected in MBL-2(4.1) (a, lane 3) and EL-4 (data not shown) cel ls but not in two other T c e l l l ines BW5147 and AK-1 cel ls (a, lanes 1 and 2). The signal from MBL-2(2.6) ce l l s (a, lane 4) is about 40 fold lower than from MBL-2(4.1), approximately in paral le l with the 200-fold difference in YEl/48 antigen expression on their c e l l surface. The levels of YEl/48 transcripts in C57BL/6 bone marrow cel ls (a, lane 5) Chapter Five p. 172 Figure 16. (next page) Northern blot analysis of YEl/48 mRNA in lymphoid c e l l  populations. Total RNA (20 ug) from different ce l l sources were separated on 0.66 M formaldehyde/1.0% agarose gels, centrifugally blotted onto zeta-probe nylon f i l t e r s , and hybridized with the radiolabeled M3-2 cDNA insert probe (a and c) . The blots were then stripped and rehybridized with a radiolabeled chicken 6-actin plasmid probe (b and d) to show the relative amount of RNA loaded in each lane. RNA samples are as follows: In part (a) and (b), lane (1) BW5147, an AKR T lymphoma, (2) AK-1, an AKR T lymphoma, (3) MBL-2(4.1), (4) MBL-2(2.6), (5) C57BL/6 bone marrow, (6) C57BL/6 thymocytes and (7) C57BL/6 spleen ce l l s . In part (c) and (d), lane (1) MBL-2(4.1), (2) MBL-2(2.6), (3) C57BL/6 total spleen, (4) C57BL/6 spleen T ce l l s , (5) C57BL/6 spleen B ce l l s , (6) MBL-2(4.1), (7) MBL-2(2.6), (8) LPS-stimulated C57BL/6 spleen, (9) Con A-stimulated C57BL/6 spleen, (10) C57BL/6 spleen, (11) BALB/c spleen, and (12) C3H spleen. Chapter Five p. 173 Chapter Five p. 174 and thymocytes (a, lane 6) are comparable to that in MBL-2(2.6), allowing for the relative intensity of the YE1/48 and actin bands (b, lanes 4-6). No transcripts were detected in day 16.5 fetal thymocytes (63% CD4-CD8~) and day 14 fetal l iver (data not shown). However, by previous immunoprecipitation, the YE1/48 antigen could be detected from CD4_CD8- adult thymocytes (97% CD4~CD8~) (data not shown). The failure to detect YE1/48 mRNA in the Northern blot analysis of fetal thymocytes may be due to a lower sensit ivi ty of the Northern blot analysis compared to the immunoprecipitation assay. Alternatively, i t may be due to a lower percentage of specific message because of mRNA instabi l i ty or slow protein turnover, or an inherent difference in properties between the fetal and adult CD4~CD8~ thymocytes. The signal in spleen cel ls (a, lane 7) is approxiamately 5 fold higher than that in adult total thymocytes and is primarily contributed by T cells because a comparable signal was detected in spleen T cel ls (88% Thy-1 + , 96% T200+, and 4% s lg + ) (c, lane 4), whereas the signal in spleen B cel ls (96% s l g + , 2% Thy-1 + , and 99% T200+) (c, lane 5) is half the level of total spleen cel ls (c, lane 3). Activation of spleen cells by Con A or LPS did not increase the YE1/48 mRNA levels (c, lanes 9 and 8); in fact i t lowered them. Interestingly, the YE1/48 transcript level in spleen cel ls from BALB/c mice is about three fold lower than that from C57BL/6 mice and was undetected in C3H spleen cel ls (c, lanes 10 to 12), comparable to their relative YE1/48 immunoprecipitation signals (see Chapter Three, section 3.2.3 C). It suggests that either the YE1/48 expression is di f ferent ial ly regulated in different mouse strains or the YE1/48 coding regions in different mouse strains exhibit substantial sequence heterogeneity. 5.2.5 Expression Of YEl/48 On Transformed Pre-B Cel l Lines The YEl/48 mRNA was undetected on two normal pre-B c e l l l ines of (C57BL/6J x C3H/HeJ) F^ hybrid origin, B n B 2 and BpD^ (Figure 17a, lanes 8 and Chapter Five p. 175 (a) 1 2 3 4 5 6 7 8 9 1 0 1 1 1.4 kb Cb) 2.0 kb -Figure 17. Northern blot analysis of YEl/48 mRNA in Abelson MuLV-transformed  pre-B c e l l l i n e s i n d i c a t i n g possible c o r r e l a t i o n of YEl/48 expression v i t h  transformation. Total RNA (20 yg) from d i f f e r e n t sources vere separated, prepared on nylon f i l t e r s , and hybridized v i t h the (a) M3-2 insert and (b) 6-a c t i n probes as described i n Figure 16. Lane (1) MBL-2(4.1), (2) MBL-2(2.6), (3) B6SutAl, a C57BL/6 hemopoietic progenitor l i n e , (4) AB n, an Abelson MuLV-transformed pre-B l i n e , (5) H9, a spontaneously transformed pre-B l i n e , (6) MBL-2(4.1), (7) AB nB 2, an Abelson MuLV-transformed pre-B l i n e , (8) B nB 2, the untransformed parent of ABnB2> (9) ABpD^, an Abelson MuLV-transformed pre-B l i n e , (10) BpD^, the untransformed parent of ABpD^, and (11) ABnH5, an Abelson MuLV-transformed pre-B l i n e . A l l pre-B c e l l l i n e s are of (C57BL/6J x C3H/HeJ) Fl hybrid o r i g i n except H9 vhich i s of BALB/c o r i g i n . Chapter Five p. 176 10), which were maintained in long term cultures (Whitlock and Witte, 1982). However, two transformed pre-B ce l l l ines, ABnB2 and ABpD/^  (lanes 7 and 9), generated by Abelson MuLV infection of the above normal pre-B c e l l cultures were positive. Two additional Abelson MuLV-transformed pre-B c e l l l ines , AB n and ABnH5 (lanes 4 and 11), were also positive. The amounts of the YEl/48 mRNA varied from comparable levels (ABnB2 and ABpD4) to seven fold higher (ABn) than those observed in MBL-2(2.6) (lane 2) and C57BL/6 adult total thymocytes. The protein product of the YEl/48 gene was also detected on their c e l l surface by immunoprecipitation (Figure 18b, lanes 3). Despite the relat ively high transcript level and immunoprecipitation signal, none of the four pre-B c e l l lines could be surface stained by YEl/48.10.6 MAb as analysed by flow cytometry (Figure 18a). No transcript signal was detected in a BALB/c spontaneously transformed pre-B ce l l l ine H9 and a C57BL/6 hemopoietic progenitor c e l l l ine B6SutAl (Figure 17a, lanes 5 and 3). 5.3 D I S C U S S I O N A YEl/48-encoding cDNA clone, M3-2, has been isolated by screening a MBL-2(4.1) XgtlO l ibrary with three redundant synthetic oligonucleotide probes based on. the tryptic peptide sequences previously determined. The identity of the YEl/48 cDNA clone is primarily confirmed by the presence of eight tryptic peptide sequences in the cDNA-deduced protein sequence. It is also supported by Northern blot analysis showing a single 1.4 kb mRNA signal of M3-2 in poly(A)+RNA isolated from MBL-2(4.1) cel ls and a much lower signal from MBL-2(2.6) ce l l s , which agrees with the dif ferential YEl/48 expression detected on these two variant clones (see Chapter Three, section 3.2.3 B). No similar mRNA signal was detected in a YEl /48 - myeloma line NS-1. Chapter Five p. 177 Figure 18. (next page) Detection of the YEl/48 antigen on Abelson MuLV- transformed pre-B c e l l lines by flow cytometric analysis and  immunoprecipitation. (a) Cells were stained by the YEl/48.10.6 MAb using FITC-conjugated (Fab') 2 mouse anti-rat kappa light chain as the second antibody. As negative controls, medium alone or YE1/30.4.1 MAb (anti-Thy-1) was used for staining. As a positive control, YE1/9.9.3 MAb (anti-transferrin receptor) was used. Dead cells were stained by propidium iodide and were gated out on the basis of red fluorescence, (b) Cel l lysates in IX Triton-X 100 detergent were subjected to immunoprecipitation by (1) YE1/30.4.1 (anti -Thy-1), (2) YE1/9.9.3 (anti-transferrin receptor), and (3) YEl/48.10.6 MAb's, using sepharose-bound rabbit anti-rat Ig antiserum as the second antibody. The immunoprecipitates were analysed by SDS-PAGE (10%) under non-reducing conditions. The YEl/48 dimer was marked by open arrows. Chapter Five p. 178 (a) A B n A B ^ ABpD 4 ABpHg Chapter Five p. 179 5.3.1 Possible Functional Sites And Domains The M3-2 cDNA-deduced protein sequence predicts that the YEl/48 antigen is a type II integral membrane protein with a 196 amino acid C-terminal extracellular domain and a 44 amino acid N-terminal cytoplasmic domain. Type II membrane proteins are not as common as type I proteins which have N-terminal extracellular domains and C-terminal cytoplasmic domains. Examples of type II proteins are the transferrin receptor (Schneider et a l . , 1984), the asialoglycoprotein receptor (Drickamer et a l . , 1984; Spiess et a l . , 1985), the HLA-DR invariant chain (Strubin et a l . , 1984), and 4F2 on activated human lymphocytes (Lumadue et a l . , 1987). No correlation between the type II protein orientation in the ce l l membrane and their functional properties has been described. No apparent homology of the YEl/48 cDNA and the deduced protein sequences with other known sequences has been identified, including the TCR a , |3 and y products, and the T c e l l activation antigen CD28 (T44). The predicted protein carries an Arg-Gly-Asp (RGD) tripeptide which is the active binding s ite on many extracellular matrix proteins and platelet adhesion proteins such as fibronectin, vitronectin, type I collagen, fibrinogen, von Willebrand factor and osteopontin. Receptors for these ligands are col lect ively called the integrins (Hynes, 1987; Ruoslahti and Pierschbacher, 1987). A l l integrins are non-covalently linked heterodimers that carry homologous a and homologous 3 subunits. The RGD-binding integrins connect the extracellular matrix outside the cel ls indirectly to the cytoskeleton inside the ce l l s . This recognition system provides cel ls with anchorage, traction for migration, and signals for polarity, position, differentiation, and possibly growth. RGD sequences are however uncommon on membrane proteins. Examples other than YEl/48 are the HLA class I and class II antigens (Larhammar et a l . , 1983; Strachan et a l . , 1984), the human EGF-R (Lin et a l . , 1984; U l l r i ch et a l . , 1984; Xu et a l . , 1984), the human glucocorticoid receptor (Hollenberg et a l . , 1985), and the human Chapter Five p. 180 transferrin receptor (McClelland et a l . , 1984; Schneider et a l . , 1984). No adhesive properties dependent on the RGD sequence have been demonstrated in these membrane proteins. It is l ike ly that some uncharacterized protein sequences flanking the RGD tripeptide can signif icantly influence the adhesive property of the RGD-carrying domain. It is not known i f the RGD sequence on the YEl/48 protein functions in adhesive interactions. The predicted YEl/48 protein sequence contains 5.3% cysteine residues, above the reported average of 2.8% in eukaryotic proteins (Klapper, 1977); 12 out of 14 cysteine residues are in the extracellular domain. Many cysteine-rich proteins are known to bind metals such as zinc, cadmium, iron or copper (Berg et a l . , 1986). They include metallothionein (Furey et a l . , 1986) and some cel lular enzymes and proteins (Berg, 1986). More recently, cysteine-rich proteins carrying the consensus configuration of Cys-X 2_4-Cys-X4_i5-Cys/His-X2_4~Cys/His have been correlated to zinz-binding and DNA-binding properties (Berg, 1986; Evans and Hollenberg, 1988). Examples include intracel lular steroid hormone receptors (Arriza et a l . , 1987; Petkovich et a l . , 1987; Sabbah et a l . , 1987) and nuclear factors that influence transcription by RNA polymerases II and III (Hanas et a l . , 1983; Smith et a l . , 1984; Kadonaga et a l . , 1987). An extracellular sequence within YEl/48 (residues 145-167) conforms to this consensus configuration. However, no eukaryotic c e l l surface integral proteins have yet been described to have metal-binding properties, DNA-binding properties, or be capable of translocating from the c e l l membrane to the nucleoplasm. The high content of cysteines in the extracellular domain of YEl/48 may just be a property of the highly disulphide-bonded protein secondary structure. It may account for the strong tendency of the YEl/48 subunits to form dimers and multimers (See Chapter Four, section 4.2.2). Indeed, cysteine-rich domains have frequently been found in other integral membrane proteins and no unique implications have been specified. Chapter Five p. 181 5.3.2 Expression On Lymphoid Cells And Its Possible Correlation With Cel lular  Transformation Northern blot analysis using the M3-2 cDNA insert as a probe has provided a quantitative and rel iable estimation of YEl/48 expression in lymphoid c e l l populations. The results are in close paral le l with the previous immunoprecipitation data. YEl/48 is primarily expressed on spleen T cel ls but i t is also expressed on other lymphocytes at lower levels, including adult thymocytes and spleen B ce l l s . Its expression on total spleen cel ls decreases upon mitogenic stimulation by Con A. It appears to be expressed on cel ls of the lymphoid lineage in general and is not preferentially restricted to a particular T c e l l differentiation stage. The YEl/48 transcript was also detected in bone marrow ce l l s . Considering that i ts expression level in bone marrow is comparable to that in total thymocytes, the mRNA detected is unlikely to be completely contributed by mature circulating lymphocytes. It is not known which bone marrow cells express the YEl/48 gene. As suggested by previous immunoprecipitation of the YEl/48 antigen from long term cultured bone marrow ce l l s , the YEl/48 + cel ls in the bone marrow are probably of lymphoid origin (see Chapter Three, section 3.2.3 D). Although the YEl/48 gene is expressed on a wide range of lymphocytes, i t s level is quite low when compared with that on the T lymphoma lines EL-4 and MBL-2(4.1). It is undetectable on two normal pre-B ce l l l ines maintained in tissue culture but they become positive after the transformation by Abelson MuLV. One of the transformed pre-B l ines, AB n , expresses the gene at a level comparable to those in EL-4 and MBL-2(4.1) ce l l s . Since the M3-2 derived protein sequence does not show any homology with v i r a l sequences in the data base, the YEl/48 gene is l ike ly a cel lular gene induced during the transformation of pre-B lymphocyte. Other than EL-4 and MBL-2(4.1), two murine T lymphomas TIMI.4 (C57BL/6 origin) and R l . l (C58/J origin) have recently been tested in our laboratory. TIMI.4 expresses the YEl/48 antigen Chapter Five p. 182 at a high level whereas R l . l does not (data not shown). The expression on TIMI.4, l ike that on EL-4 and MBL-2(4.1), can be detected by flow cytometry. Thus, YEl/48 is highly expressed in a l l three T lymphoma c e l l lines of C57BL/6 origin so far tested. 5.3.3 A l l e l i c Polymorphism And Possible Existence Of Related Multigenes In the Southern blot analysis of genomic DNA from three mouse strains, C57BL/6, BALB/c and C3H, multiple banding patterns were detected with the entire M3-2 cDNA probe on the genomic blots. Similar multiple bands were detected even by the shortest fragment probe M3-2/151. Since i t is unlikely that the majority of introns are localized within a coding sequence of 151 bp, other related genes with homologous sequences must be present. These related genes are not expressed in MBL-2(4.1) cel ls as no additional mRNA bands were detected in the Northern blot analysis allowing 20% sequence mismatch with the M3-2 probe (data not shown). Whether the cross-hybridizing genes detected in the genomic Southern analysis are members of a multigene family expressed in other c e l l types or i f they are pseudogenes is not known. The genomic Southern blot analysis has also implicated possible restr ict ion fragment length polymorphism of the YEl/48 gene. This observation parallels with our earl ier immunoprecipitation data in which the YEl/48 antigen was more readily detected by both YE1/32.8.5 and YEl/48.10.6 MAb's from C57BL/6 spleen cel ls than from BALB/c and C3H spleen cel ls (see Chapter Three, section 3.2.3 C). We have previously speculated that the d i f ferent ia l immunoprecipitation signal is either due to di f ferent ia l regulation of the YEl/48 gene expression, or due to a l l e l i c polymorphism among the mouse strains. The finding of possible restrict ion fragment length polymorphism of the YEl/48 gene supports the latter poss ibi l i ty . On the other hand, the current Northern blot analysis results also suggest a di f ferent ia l YEl/48 mRNA detection, indicative of a di f ferent ia l regulation of the YEl/48 gene. To Chapter Five p. 183 intepret these observations, i t should be kept in mind that other related genes detected by the YEl/48 cDNA probe may contribute to the restr ict ion fragment length polymorphism observed. It is possible that the mouse strains exhibit both a l l e l i c polymorphism and dif ferential gene expression. However, u n t i l further analysis of the YEl/48 genomic sequences of different mouse strains is done, no definitive conclusion can be derived. 5.3.4 Differential Accessibi l i ty Of Epitopes On T Lymphomas And Normal T  Lymphocytes As discussed in Chapter Three (see section 3.2.3 B and 3.3.3), the YE1/32.8.5 and YEl/48.10.6 MAb's, which readily detect the YEl/48 antigen on intact EL-4 and MBL-2(4.1) ce l l s , do not seem to bind to the surface of normal C57BL/6 thymocytes and spleen ce l l s . However, the MAb's can immunoprecipitate the antigen from detergent-solubilized normal ce l l s . Since the normal thymocytes and spleen cel ls express YEl/48 at a substantially lower level than EL4 and MBL-2(4.1) cel ls do based on their relative immunoprecipitation signals, the fai lure to surface stain YEl/48 on normal cel ls may be due to the difference in the sensit ivi t ies between flow cytometric analysis and immunoprecipitation. Assuming a close paral le l of protein expression with the corresponding mRNA level , the current Northern blot data has indicated that total thymocytes and spleen cel ls may express the YEl/48 protein at a level detectable by flow cytometric analysis. Moreover, the Abelson MuLV-transformed pre-B ce l l l ine AB n , which exhibits a relatively high level of YEl/48 mRNA and an intense YEl/48 immunoprecipitation signal, do not show detectable binding of the anti-YEl/48 MAb's on the c e l l surface by flow cytometry. Therefore, i t is l ike ly that the epitopes defined by the two MAb's are masked and are not accessible for MAb binding on transformed pre-B c e l l l ines as well as intact normal lymphocytes. It is intriguing that these epitopes seem to become exposed on three T lymphomas, EL4, MBL-2(4.1) and Chapter Five p. 184 TIMI.4. 5.3.5 Homodimer Or Heterodimer Previous tryptic peptide mapping data has shown that the YEl/48 antigen subunits exhibit very similar fingerprints (see Chaper Three, Figure 4). It has however not been determined i f the two subunits differ in their protein core sequences or they differ only in post-translational modifications. A l l of the tryptic peptide sequences derived from the mixture of reduced YEl/48 subunits (see Chapter Four, Table VI) are now located in the M3-2 cDNA-deduced protein sequence. Assuming that a l l eight tryptic peptides non-selectively represent both YEl/48 subunits, i t appears that the M3-2 sequence encodes both polypeptides. It in turn implies that YEl/48 is l ike ly a homodimer with subunits differing in post-translational modifications, giving rise to their dist inct pi characteristics. Alternatively, i f the YEl/48 subunits are derived from two dissimilar mRNA's, the two mRNA's should share most of the sequence to account for the closely related tryptic peptide fingerprints. No additional mRNA bands other than the 1.4 kb band was detected in Northern blot analysis of RNA from MBL-2(4.1) ce l l s , using the M3-2 insert probe under conditions allowing a 20% sequence mismatch. Hence, unless the hypothetical mRNA has the same size of 1.4 kb, there is unlikely a dist inct mRNA which encodes a dist inct YEl/48 subunit to form a heterodimer. Although i t is unlikely that there is another mRNA encoding a YEl/48 subunit dist inct from that predicted by the M3-2 cDNA clone, i t remains possible that the single M3-2 mRNA may give rise to two translated proteins because two in-phase Met codons (25 nucleotides apart) are found at the start of the M3-2 open reading frame. The alternate use of Met codons on a single mRNA is common in viruses, but i t has also been demonstrated in eukaryotic ce l l s (Strubin et a l . , 1986). By comparing to the in i t ia tor consensus sequence common to most eukaryotic mRNA's, the f i r s t Met codon in the M3-2 Chapter Five p. 185 cDNA sequence l ike ly has a higher efficiency in in i t ia t ing translation than the second one. Although in i t ia t ion from the second Met codon remains possible, two observations seem to argue against the possiblity that another polypeptide produced by in i t ia t ion from the second Met codon is used to form a heterodimer with the polypeptide produced by in i t ia t ion from the f i r s t Met codon. F i r s t , only two charged amino acids (positions 3 and 5) are found between the two methionine residues, which probably cannot account for the difference in pi 's of the YEl/48 subunits observed in two-dimensional gel analysis (see Chapter Three, Figure 3). Second, i f the YEl/48 subunits use both in i t ia t ion codons, only one different tryptic peptide w i l l be predicted because there is no lysine or arginine residue between the two Met codons. Instead, four to five unique tryptic peptides are allocated to each subunit in the fingerprints. Therefore, i t seems unlikely that both in i t ia t ion codons are used to generate sequence-related polypeptides to form a YEl/48 disulphide-linked heterodimer. Current findings suggest that YEl/48 may be a homodimer with subunits that differ in post-translational modifications. However, i t is also possible that the pi characteristics and the tryptic peptide fingerprints of the YEl/48 subunits reflect some technical artefacts. For example, the basic YEl/48 subunit separated in two-dimensional gel analysis may represent protein aggregation near the top of the IEF tube gel , and the minority of tryptic peptides unique to each YEl/48 subunit may be due to protein contamination in sample preparation. The YEl/48 antigen may in fact be a homodimer with identical subunits. 5.4 SUMMARY YEl/48 is a murine ce l l surface disulphide-linked dimeric antigen of two 45-50,000 M r subunits expressed on thymocytes and spleen ce l l s . The two MAb's reactive with the antigen do not give detectable binding on the surface of Chapter Five p. 186 normal lymphocytes and no functional data has yet been obtained. A YEl/48-encoding cDNA clone, M3-2, has now been isolated based on the amino acid sequences determined from the purified antigen. The 1.3 kb cDNA clone represents a major portion of the f u l l length 1.4 kb mRNA and includes the entire open reading frame encoding a polypeptide of 262 amino acids and 30,500 MW. The predicted protein has a type II membrane protein orientation with 44 amino acids in the N-terminal cytoplasmic domain, 22 amino acids in the transmembrane domain, and 196 amino acids in the C-terminal extracellular domain. There are three potential N-linked glycosylation sites in the extracellular domain a l l of which are probably used. No signigicant homology can be identified with other known protein sequences in the data base or with human CD28. Hence YEl/48 is l ike ly a novel murine cel lular antigen undescribed. In the cDNA-deduced protein sequence, there are found a potential cell-adhesive binding site (RGD tripeptide), and a domain with potential metal-binding property. However, no act iv i t ies of these potential functional sites have yet been indicated. The isolation of the cDNA clone M3-2 has allowed further analyses of the YEl/48 protein structure, i ts expression on lymphocytes, and i ts genetic structure. The failure to detect another mRNA in MBL-2(4.1) cel ls closely homologous to the M3-2-defined mRNA has suggested that YEl/48 is a homodimer with subunits exhibiting di f ferent ia l translational processing, rather than a heterodimer with two sequence-related subunits. Genomic Southern analysis has suggested that the YEl/48 gene may have two al le les , one in C57BL/6 and the other in BALB/c and C3H mice. The genomic analysis has also strongly suggested the existence of other genes with sequences highly homologous to the YEl/48 gene. The YEl/48 gene appears to be expressed at low levels on a wide range of T lymphocytes with no restrict ion to their differentiation stages, and on spleen B cel ls as well as bone marrow ce l l s . The expression is not increased Chapter Five p. 187 by mitogenic stimulation of either spleen T or B lymphocytes. However, the high YEl/48 expression on some of the transformed T and pre-B c e l l so far tested suggests a possible correlation of the YEl/48 expression with lymphoid transformation. Furthermore, the two epitopes on YEl/48 antigen defined by the YEl/48.10.6 and YE1/32.8.5 MAb's appear to be masked on intact normal ce l l s but are specif ical ly exposed on the C57BL/6 T lymphomas EL-4, MBL-2(4.1), and TIMI.4. Chapter Five p. 188 5.5 R E F E R E N C E S Arr iza , J . L . , Weinberger, C . , C e r e l l i , G . , Glaser, T . M . , Handelin, B . L . , Housman, D.E. and Evans, R.M. (1987) Cloning of human mineralocorticoid receptor complementary DNA: Structural and functional kinship with the glucocorticoid receptor. Science 237:268. Aruffo, A. and Seed, B. (1987) Molecular cloning of a CD28 cDNA by a high-efficiency COS c e l l expression system. Proc. Natl . Acad. Sc i . USA 84:8573. Berg, J .M. (1986) Potential metal-binding domains in nucleic acid binding proteins. Science 232:485. Blobel, G. (1980) Intracellular protein topogenesis. Proc. Natl . Acd. Sc i . USA 77:1496. Chou, P.Y. and Fasman, G.D. (1978) Prediction of the secondary structure of proteins from their amino acid sequence. Adv. Enz. 47:45. Drickamer, K . , Mamon, J . F . , Binns, G. and Leung, J .O. (1984) Primary structure of the rat l iver asialoglycoprotein receptor. J . B i o l . Chem. 259:770. Evans, R.M. and Hollenberg, S.M. (1988) Zinc fingers: Gi l t by association. Ce l l 52:1. Furey, W.F., Robbins, A . H . , Clancy, L . L . , Winge, D.R., Wang, B.C. and Stout, C D . (1986) Crystal structure of Cd, Zn metallothionein. Science 231:704. Hanas, J . S . , Hazuda, D . J . , Bogenhagen, D . F . , Wu, Y . - H . and Wu, C.-W. (1983) Xenopus transcription factor A requires Zinc for binding to the 5 S RNA gene. J . B i o l . Chem. 258:14120. Hollenberg, S.M., Weinberger, C , Ong, E . S . , C e r e l l i , G . , Oro, A . , Lebo, R. , Thompson, E . B . , Rosenfeld, M.G. and Evans, R.M. (1985) Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 318:635. Hynes, R.O. (1987) Integrins: A family of c e l l surface receptor. Ce l l 48:549. Kadonaga, J . T . , Carner, K.R. , Masiarz, F.R. and Tjian, R. (1987) Isolation of cDNA encoding transcription factor Spl and functional analysis of the DNA binding domain. Ce l l 51:1079. Kishimoto, T . K . , O'Connor, K . , Lee, A . , Roberts, T.M. and Springer, T.A. (1987) Cloning of the 6 subunit of the leukocyte adhesion proteins: homology to an extracellular matrix receptor defines a novel supergene family. Ce l l 48:681. Klapper, M.H. (1977) The independent distribution of amino acid near neighbor pairs into polypeptides. Biochem. Biophys. Res. Commun. 78:1018. Kozak, M. (1986) Point mutations define a sequence flanking the AUG in i t i a tor codon that modulates translation by eukaryotic ribosomes. Ce l l 44:283. Kozak, M. (1987) An analysis of 5'-noncoding sequences from 699 vertebrate Chapter Five p. 189 messenger RNAs. Nucl. Acid Res. 15:8125. Krebs, E .G. and Beavo, J .A . (1979) Phosphorylation-dephosphorylation of enzymes. Ann. Rev. Biochem. 48:923. Kyte, J . and Dooli t t le , R.F. (1982) A simple method for displaying the hydropathic character of a protein. J . Mol. B io l . 157:105. Larhammar, D. , Andersson, G . , Andersson, M. , B i l l , P . , Bohme, J . , Claesson, L . , Denaro, M. , Emmoth, E . , Gustafsson, K . , Hammarting, U . , Heldin, E . , Hyldig-Nielson, J . J . , Lind, P . , Scherring, L . , Serveniw, G . , Widmark, E . , Pask, L. and Peterson, P.A. (1983) Molecular analysis of human class II transplantation antigens and their genes. Human Immunol. 8:95. L i n , C .R. , Chen, W.S., Kruiger, W., Stolarsky, L . S . , Weber, W., Evans, R .M. , Verma, I . M . , G i l l , G.N. and Rosenfeld, M.G. (1984) Expression cloning of human EGF receptor complementary DNA: Gene amplification and three related messenger RNA products in A431 ce l l s . Science 224:843. Lumadue, J . A . , Glick, A.B. and Ruddle, F .H. (1987) Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2. Proc. Natl. Acad. Sci . USA 84:9204. McClelland, A . , Kuhn, L . L . and Ruddle, F .H. (1984) The human transferrin receptor gene: Genomic organization, and the complete primary structure of the receptor deduced from a cDNA sequence. Cel l 39:267. Petkovich, M. , Brand, N . J . , Krust, A. and Chambon, P. (1987) A human retinoic acid receptor which belongs to the family of nuclear receptors. Nature 330:444. Rose, J . K . , Adams, G.A. and Gallione, C . J . (1984) The presence of cysteine in the cytoplasmic domain of the vesicular stomatitis virus glycoprotein is required for palmitate addition. Proc. Natl. Acad. Sci . USA 81:2950. Ruostahti, E . and Pierschbacher, M.D. (1987) New perspectives in c e l l adhesion: RGD and integrins. Science 238:491. Sabatini, D.D. , Kreibich, G . , Morimoto, T. and Adesnik, M. (1982) Mechanisms for the incorporation of proteins in membranes and organelles. J . C e l l B i o l . 92:1. Sabbah, M. , Redeuilh, G . , Secco, C. and Baulieu, E . - E . (1987) The binding act iv i ty of estrogen receptor to DNA and heat shock protein (M r 90,000) is dependent on receptor-bound metal. J . B i o l . Chem. 262:8631. Schneider, C , Owen, M . J . , Banville, D. and Williams, J . G . (1984) Primary structure of human transferrin receptor deduced from the mRNA sequence. Nature 311:675. Sewell, W.A., Brown, M.H., Dunne, J . and Owen, M.J. (1986) Molecular cloning of the human T-lumphocyte surface CD2 (Ti l ) antigen. Proc. Natl . Acad. Sci . USA 83:8718. Singer, S . J . , Maher, P.A. and Yaffe, M.P. (1987) On the transfer of integral proteins into membrane. Proc. Natl . Acad. Sci . USA 84:1960. Smith, D.R., Jackson, I . J . and Brwon, D.D. (1984) Domains of the positive Chapter Five p. 190 transcription factor specific for the xenopus 5S RNA gene. Ce l l 37:645. Spiess, M. , Schwartz, A . L . and Lodish, H.F. (1985) Sequence of human asialoglycoprotein receptor cDNA. J . B i o l . Chem. 260:1979. Strachan, T . , Sodoyer, R., Demotte, M. and Jordan, B.R. (1984) Complete nucleotide sequence of a funcitonal class I HLA gene, HLA-A3: implications for the evolution of HLA genes. EMBO 3:887. Strubin, M. , Mach, B. and Long, E.O. (1984) The complete sequence of the mRNA for the HLA-DR-associated invariant chain reveals a polypeptide with an unusual transmembrane polarity. EMBO 3:869. Strubin, M. , Long, E.O. and Mach, B. (1986) Two forms of the Ia antigen-associated invariant chain result from alternative in i t iat ions at two i n -phase AUGs. Ce l l 47:619. U l l r i c h , A . , Coussens, L . , Hayflick, J . S . , Dul l , T . J . , Gray, A . , Tarn, A.W., Lee, J . , Yarden, Y . , Libermann, T . A . , Schlessinger, J . , Downward, J . , Mayes, E . L . V . , Whittle, N . , Waterfield, M.D. and Seeburg, P.H. (1984) Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in 431 epidermal carcinoma ce l l s . Nature 309:418. Whitlock, C A . and Witte, O.N. (1982) Longterm culture of B lymphocytes and their precursors from murine bone marrow. Proc. Natl . Acad. Sc i . USA 79:3608. Wilbur, W.J. and Lipman, D .J . (1983) Rapid s imilarity searches of nucleic acid and protein data banks. Proc. Natl . Acad. Sci . USA 80:726. Xu, Y . , I s h i i , S., Clark, A . J . L . , Sullivan, M. , Wilson, R . K . , Ma, D .P . , Rue, B . A . , Merlino, G.T. and Pastan, I . (1984) Human epidermal growth factor receptor cDNA is homologous to a variety of RNAs overproduced in A431 carcinoma ce l l s . Nature 309:806. Chapter Six p. 191 CHAPTER SIX SUMMARY AND PERSPECTIVES In the immune system, T lymphocytes are known to play central roles in the execution and the regulation of an immune response. Many of the T c e l l functions rely on ce l l surface antigens as receptors for extrinsic signals, either in the form of soluble regulatory factors or in the form of surface components on other ce l l s . Characterization of these T c e l l surface antigens is important in the understanding of the molecular mechanisms by which an immune function takes place. In the past, MAb's have proven to be a valuable tool in the identif ication of novel T ce l l antigens. Moreover, they may provide important clues to how T ce l l surface molecules function since some MAb's influence T c e l l functions by mimicking natural ligands that act on the T c e l l surface or blocking the receptor-ligand interactions. However, the precise functions of many T c e l l surface antigens are not yet known. In our preliminary studies, rat MAb's were generated against mitogen-activated murine T lymphocytes to identify surface antigens which might be involved in immune functions. Two MAb's, YEl/48.10.6. and YE1/32.8.5, were found by flow cytometric analysis to react with only two T lymphoma c e l l l ines EL-4 and MBL-2(4.1), but not with normal resting or proliferating lymphocytes. Both MAb's define an identical disulphide-linked dimeric molecule of 90-95,000 M r , composed of 45-50,000 M r subunits of distinct pi characteristics. It was designated the YEl/48 antigen. The molecular size and the apparent heterodimeric structure of the YEl/48 antigen resemble properties of the murine TCR-a/6 dimer. Moreover, the specific reactivity of the MAb's with only two T c e l l lines suggested that they might recognize clonotypic epitopes on the YEl/48 antigen similar to those present on the murine TCR-a/6. The Chapter Six p. 192 TCR-a/0 antigen, which recognizes foreign antigens in the context of MHC molecules, is an essential element in the antigen-specific T c e l l immune response. MAb's to TCR-a/0 have been valuable tools in studying the molecular events involved in antigen-dependent T c e l l activation as well as T c e l l differentiat ion. Since no other dimeric molecules of similar size had been identif ied at that time, i t appeared that YEl/48 might be the authentic murine TCR-a/0. Therefore, the YEl/48 antigen was further characterized and compared with the murine TCR-a/0. In my i n i t i a l studies, the YEl/48 antigen was subjected to biochemical analyses. Endoglycosidase F digestion experiments showed that YEl/48 has glycosylation characteristics similar to those of TCR-a/0. However, the tryptic peptide maps of the YEl/48 subunits demonstrated substantial differences from the murine TCR-a/0, and suggested that YEl/48 might not be a heterodimer. Furthermore i t was found that, although the YEl/48.10.6 and YE1/32.8.5 MAb's did not show detectable binding to normal lymphocytes by flow cytometry, they could be used to immunoprecipitate the YEl/48 antigen from detergent-solubilized normal thymocytes and spleen ce l l s , albeit at a much lower level than that detected from EL-4 and MBL-2(4.1) ce l l s . Its detection on normal mixed populations of lymphocytes by immunoprecipitation, had once led to the speculation that the MAb's might recognize epitopes on the constant domain of a TCR-like antigen. Thus, I attempted to determine i f the YEl/48 antigen was the authentic murine TCR-a/0, or i f i t was a related molecule. Sequential immunoprecipitation of the YEl/48 antigen and the TCR-a/0 dimer from EL-4 cel ls suggested that YEl/48 and TCR-a/0 are l ike ly dist inct molecules. The dif ferent ia l expression of YEl/48 on two variant MBL-2 clones which express similar levels of TCR-a/0 also implied that YEl/48 is different from TCR-a/0. F inal ly , direct comparisons of the part ia l amino acid sequence of YEl/48 antigen with the murine TCR sequences def init ively distinguished the YEl/48 antigen from products of the TCR a, 0 and y genes. Chapter Six p. 193 During the progress of the above studies, i t had become apparent that the human CD28 (T44) dimeric antigen which may play significant roles in immune functions also has similar molecular size as YEl/48 does. L i t t l e was known about the molecular structure of CD28 at that time. Only lately a human CD28 cDNA clone was isolated. Since the YEl/48.10.6 and YE1/32.8.5 MAb's do not show detectable binding on intact normal c e l l surface, no biological effects upon the perturbation of the YEl/48 antigen could be derived. Thus, in order to elucidate the possible function of the YEl/48 antigen and i ts correlation with other known antigens, I undertook the molecular cloning of the YEl/48 molecule based on the part ia l amino acid sequences derived from the purified antigen. The isolated cDNA clone M3-2 contains the entire coding sequence of the YEl/48 antigen and represents a single 1.4 kb YEl/48 mRNA in cel ls expressing the antigen. It encodes a polypeptide of 262 amino acids and 30,5000 MW. The predicted protein has a type II membrane protein orientation with 44 amino acids in the N-terminal cytoplasmic domain and 196 amino acids in the C-terminal extracellular domain. Three potential N-linked glycosylation sites in the extracellular domain are l ike ly used as suggested by the previous endoglycosidase F digestion experiments. An Arg-Gly-Asp (RGD) tripeptide and a domain with potential zinc-binding property are also found in the extracellular domain. However, i t remains unknown i f they are functional in c e l l adhesion and metal-binding. So far, no significant sequence homology has been identified with other known proteins in the data base or with human CD28. Despite our failure to elucidate the function of the YEl/48 antigen from its primary sequence, the isolation of the YEl/48 cDNA clone has allowed a better understanding of i ts molecular structure. The comparison of the cDNA sequence to the part ia l amino acid sequences previously determined implicates that YEl/48 is l ike ly a homodimer of related subunits resulted from di f ferent ia l post-translational processing. Genomic Southern analyses suggest Chapter Six p. 194 that YEl/48 may have two al leles among different mouse strains, and that there may exist other genes with highly homologous sequences, which are probably not expressed on the T c e l l lines and lymphocytes so far tested. The expression of YEl/48 on lymphocytes presents the most intriguing characteristics of the YEl/48 antigen. By Northern blot analyses, the YEl/48 gene was found to be expressed at low levels in a wide range of T cel ls with no restr ict ion to their differentiation stages, and on spleen B cel ls as well as bone marrow ce l l s . The expression on spleen lymphocytes is not related to c e l l prol i feration as the mRNA levels were not increased by mitogenic stimulatin of either the T or B ce l l population. However, the YEl/48 expression appears to be induced by the Abelson MuLV-transformation of pre-B ce l l s , at a level comparable to that observed on EL-4 and MBL-2(4.1) c e l l l ines . In contrast to EL-4 and MBL-2(4.1) ce l l s , the high level of YEl/48 antigen on the transformed pre-B cel ls could not be detected by YEl/48.10.6 and YE1.32.8.5 MAb's by flow cytometry although i t could be immunoprecipitated. This difference in flow cytometric analysis and immunoprecipitation experiments is similar to the previous findings of YEl/48 expression on normal thymocytes and spleen ce l l s . It thus appears that the two MAb-defined epitopes on YEl/48 are masked on intact normal cel ls but are speci f ical ly exposed on the T lymphomas EL-4 and MBL-2(4.1). Another T lymphoma TIMI.4 was recently found to exhibit similar exposure of the two epitopes. It is tantalizing to speculate a correlation of the high expression of YEl/48 on transformed T and pre-B ce l l s , as well as the di f ferent ia l exposure of YEl/48 epitopes on transformed T cells versus normal lymphocytes, with the ce l lular transformation process. A number of questions concerning the YEl/48 antigen remain to be addressed. With respect to the function of YEl/48, the present studies were limited by the lack of reactivity of the YEl/48.10.6 and YE1.32.8.5 MAb's with the antigen on intact normal ce l l surface. To test for the possible Chapter Six p. 195 functions, one approach is to generate MAb's which recognize the YEl/48 antigen on intact normal c e l l surface. The presently available cDNA clone can be ut i l i zed in the large scale preparation of materials for immunization purposes. In view of the previous failure in generating appropriate antiserum in rats, other animals l ike hamsters may be used. The appropriate MAb's generated may then be tested for their effects on T c e l l functions such as activation, proliferation and c e l l adhesion. The possible correlation of high level YEl/48 expression with the Abelson MuLV-transformation of pre-B ce l l s is one of the intriguing findings in the present studies. It may be of interest to isolate a cDNA clone of the human homologue of YEl/48 and test whether i t s expression is correlated to leukemias/lymphomas. Moreover, the kinetics of YEl/48 expression during the course of Abelson MuLV-transformation of murine pre-B cel ls in culture can be determined. Final ly , the existence of other related genes has suggested that YEl/48 may be a member of a multigene family. It therefore implies that the YEl/48 antigen may have some important functions which are conserved among a family of similar gene products. The identificaton of the other multigenes and the analysis of their expression on other c e l l types may add insight to the functions and roles of the YEl/48 antigen on the T ce l l surface. o 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097974/manifest

Comment

Related Items