Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of the steady-state levels of B800-850 complexes in Rhodobacter capsulatus by light and oxygen Zucconi, Anthony 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A6_7 Z82.pdf [ 3.18MB ]
Metadata
JSON: 831-1.0097821.json
JSON-LD: 831-1.0097821-ld.json
RDF/XML (Pretty): 831-1.0097821-rdf.xml
RDF/JSON: 831-1.0097821-rdf.json
Turtle: 831-1.0097821-turtle.txt
N-Triples: 831-1.0097821-rdf-ntriples.txt
Original Record: 831-1.0097821-source.json
Full Text
831-1.0097821-fulltext.txt
Citation
831-1.0097821.ris

Full Text

Regulation of the steady-state levels of B800-850 complexes in Rhodobacter capsulatus by Light and Oxygen by An thony Zuc con i B .Sc . Univers i ty of Brit ish Co l umb i a A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F M A S T E R O F S C I E N C E in T H E F A C U L T Y O F G R A D U A T E S T U D I E S (Department of Microb io logy) W e accep t this thes is a s conforming to the required s tandard T H E U N I V E R S I T Y O F BR IT ISH C O L U M B I A J anua r y 1988 ©Anthony Zu c con i In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 DE-6(3/81) ii ABSTRACT Photosynthetic organisms exhibit a variety of responses to changes in light intensity, including differential biosynthesis of chlorophyll-protein complexes. Cultures of Rhodobacter capsulatus grown anaerobically with a low intensity of light (2 W/m2) contained about four times as much B800-850 light harvesting complex as cells grown under high light intensity (140 W/m 2). The mRNA transcripts encoding B800-850 befa and alpha peptides were analyzed by Northern blot, S1 nuclease protection and capping with guanylyl transferase. It was found that the steady-state levels of B800-850 mRNAs in high light-grown cultures was about four times as great as in cells grown under low light intensity. Therefore the lesser amounts of mature B800-850 peptide gene products found in cells grown with high light intensity were the result of a posttranscriptional regulatory process. It was also found that there were two polycistronic messages encoding the B800-850 peptides. These messages shared a common 3' terminus but differed in their 5' end segments as a result of transcription initiation at two discrete sites. Moreover the half life of B800-850 mRNAs was about 10 minutes in cells grown with high light and approximately 19 minutes in low light-grown cultures. Transcriptional and translational fusions were constructed between the B800-850 transcription initiation region (from this point on referred to as the puc transcription initiation region; see Fig. 1) and the Escherichia coli lacZ gene. From these studies it was concluded that the rates of transcription initiation of the puc (B800-850) genes was higher in cells grown with high light illumination than in low light-grown cultures, and that the relative amount of B800-850 Ill complexes under these conditions was controlled by a translational or a posttranslational mechanism. The translational and transcriptional fusions also used for examination of oxygen regulated expression of the puc genes. iv Table of Contents List of Tables . . v i List of Figures . v i i Abbreviations and symbols . v i i i Acknowledgement i x Introduction . . . . . . . . . 1 Materials and Methods . 7 1 . Bacterial strains and growth conditions . . . 7 2 . Determination of bete-galactosidase activities . . . . 8 3. Construction of plasmid pJAJ103/ac903 . . . . 9 4 . Construction of the transcriptional fusions pAZIII and pAZIV 9 5 . Construction of the translational fusion pAZV . . . 1 2 6 . Conjugation of plasmids into R. capsulatus B10 . . . 1 2 7 . Probe Constructions . . . . . 1 5 8 . In vitro transcription of RNA probes . . . 1 5 9 . RNA isolation, blotting and hybridization . 1 6 1 0 . Capping of RNA with guanylyl transferase . . 1 6 1 1 . S1 nuclease protection experiments . . . 1 7 1 2 . Analytical methods . . . . . 1 8 V Results . 1 9 1. Use of puc-lac fusions . . . . 1 9 A. Oxygen effects i. Transcr ipt ional fusion studies . . . 2 0 ii. Translat ional fusion studies . . . 2 3 B. Light effects i. Transcr ipt iona l fus ion studies . . . 2 4 ii. Translat ional fusion studies. . . . . 2 7 2. Examination of steady state levels of puc m R N A and B800-850 comp lexes . . 2 7 A. Effects of different light intensities on cel l growth . 2 7 B. S iz ing and end-mapping of puc transcripts . . 2 9 C. Determination of half-life and steady-state level of puc m R N A 3 4 D. Local izat ion of puc transcription initiation sites . 3 6 Discussion . 3 8 1. Analys is of the results obtained with puc-lac fusions A . Regulation of puc gene expression by oxygen . . 3 8 B. Regulation of puc gene expression by light intensity . 3 9 C. Prob lems with p lasmid borne gene fusions . . . 3 9 2. Analys is of puc m R N A levels in cel ls grown with high and low light i l lumination . 4 2 References 5 0 v i List of Tables Table 1: Specific activities of befa-galactosidase in cultures grown with either high or low oxygen (corrected for plasmid loss) 2 1 Table 2: Specific activities of beta-galactosidase in cultures grown with either high or low oxygen (uncorrected for plasmid loss) . . . . 22 Table 3: Specific activities of bete-galactosidase in cultures grown with either high or low light illumination (corrected for plasmid loss) . . . 2 5 Table 4: Specific activities of befa-galactosidase in cultures grown with either high or low light illumination (uncorrected for plasmid loss) . . . . 2 6 vii List of Figures Figure 1: Diagramatic representation of the reaction centre, B870 and B800-850 complexes and the genes encoding the photosynthetic peptides . . 2 F i g u r e 2: Construction of the puc-lacZ transcriptional fusions pAZIII and pAZIV 10 F i g u r e 3: Construction of the puc-lacZ translational fusion pAZV . 13 F i g u r e 4: Spectral scans of high and low light grown ft capsulatus cells . . . 2 8 F i g u r e 5 : Representation of 3' and 5' probes used in S1 protection experiments . . . . . 3 0 F i g u r e 6: Northern blot of RNA isolated from ft capsulatus grown with either high or low light illumination . . . 3 1 F i g u r e 7: End-mapping analysis of puc mRNA isolated from high and low light grown ft capsulatus cells . 3 3 F i g u r e 8: Determination of the relative steady-state levels and half-lives of the puc transcript . . . 3 5 F i g u r e 9: Autoradiagram of the gel used for separation of capped -mRNA segments protected from S1 digestion by hybridization with the 5' probe . 3 7 F i g u r e 10: Sequence of the 5' and 3' regions flanking the pucA and pucB genes 44 • • a VIII Abreviations and Symbols ATP adenosine triphosphate bch a bacteriochlorophyll a bp base pair Ci Curie CPU . colony forming units dATP deoxyadenosine triphosphate dCTP deoxycytosine triphosphate dGTP deoxyguanosine triphosphate DNA deoxyribonucleic acid TTP thymidine triphosphate EDTA ethylenediaminetetraacetic acid kb kilobase kd kilodalton lacZ E. coli befa-galactosidase gene mA milliampere nt nucleotide pucA, pucB structural genes of B800-850 peptides pufA, pufB structural genes of the B870 peptides pufM, pufL, pufH structural genes of the reaction centre peptides CNPG o-nitrophenyl-6-D-galactoside FC . reaction centre RC-M, L, H peptide components of the reaction centre RNA ribonucleic acid Tc Tetracycline TTP thymidine triphosphate ix Acknowledgment To Dr. J . T. Beatty for his guidance and encouragement; I express my sincere gratitude. T o Mary Forrest, Cheryl Keen, Tim Lilburn, Vera Webb, Stephen Wellington and the members of the cellulase group for their help and advice but, more importantly for keeping me in good humour throughout my research. To my parents and Joanne Lee for their emotional support now and through the difficult times of my thesis work. 1 INTRODUCTION Rhodobacter capsulatus (formerly known as Rhodopseudomonas capsulata ; ref. 23) is a purple nonsulfur photosynthetic bacterium that is capable of growth by use of several different modes of energy generation, including aerobic respiration in darkness and anaerobic photosynthesis (20). During respiratory growth in the presence of high concentrations of oxygen, cells of R. capsulatus are in many respects indistinguishable from non-photosynthetic bacteria. When growing photosynthetically R. capsulatus produces metabolic energy by cyclic photosynthesis which results in protons being pumped across the cytoplasmic membrane, creating a proton gradient that drives ATP synthesis. Both aerobic and anaerobic forms bf energy metabolism are coupled to distinct electron-transport pathways which are embedded in two ultrastructurally and biochemically distinct forms of the cytoplasmic membrane (20). Therefore this bacterium provides an attractive model to study procaryotic cell differentiation, since the type of energy generation mechanism (such as chemotrophy or phototrophy) and cellular composition are dependent on the culture growth conditions. With a reduction in the amount of oxygen available to cultures, respiring cells develop an extensive intracytoplasmic membrane system (derived from the cytoplasmic membrane) into which "is placed the photosynthetic apparatus. There are three pigment-protein complexes produced by R. capsulatus which make up the photosynthetic apparatus (Fig. 1) : the reaction centre (RC), which is the site of charge separation, and two distinct light harvesting complexes (B870 and B800-850) which function to gather light energy and funnel it into 2 Fig. 1. Diagramatic representation of the reaction centre, B870 and B800-850 complexes in the membrane of R. capsulatus. The genes encoding the photosynthetic peptides are represented below as DNA fragments (the heavy segments represent the. structural genes). Although the pufX open reading frame is transcribed, it is not known if it encodes a peptide (Figure adapted from Drews et al ref. 18). 3 the reaction centre (19). The key pigment involved in photon capture is bacteriochlorophyll a (bch a), which is noncovalently bound to the photosynthetic peptides and is held in an orientation such that light energy can be either trapped and transferred to another complex (as in the light harvesting complexes), or can be used to excite electrons to initiate cyclic photosynthesis (as in the reaction centre) (20). The RC complex is made up of three subunits: designated M, L and H whereas the B870 complex is composed of two peptides called B870 alpha and beta (19). The genes encoding the B870 peptides and two of the three RC peptides have been cloned, sequenced and found to form an operon (6, 43). All genes in this operon are called puf genes, therefore the RC structural genes are designated pufM and pufL whereas the B870 genes are referred to as puf A and pufB (Fig. 1). The RC-H peptide seems not to be involved in the process of photosynthesis (33, 43) and the gene encoding the RC-H subunit, designated puhH, is on a separate operon. The B800-850 light harvesting complex of R capsulatus contains two peptides, referred to as the alpha and beta peptides, that bind bch a (22). The genes encoding the pigment-binding peptides (designated pucA and pucB) have been cloned and their DNA sequence determined, but it is not known how far away the puc genes map from the puf genes on the R capsulatus chromosome (44). The two puc (B800-850) structural genes are located very close to each other and have been assumed to form an operon (47). A third peptide, the 14 kD peptide, has been found to co-purify with the B800-850 alpha and beta peptides, but it does not bind pigments and its function is obscure (20, 22). 4 When R. capsulatus cells are shifted from a highly aerated culture condition to an oxygen limited growth condition the synthesis of all of the components of the photosynthetic unit is initiated to facilitate the photosynthetic growth mode. The specific bch a content increases 80 fold and the number of reaction centres, B870 and B800-850 complexes is increased approximately 10 to 20 fold (36). Clark et al (14) and Belasco er al (6) determined that there was more mRNA encoding the RC and B870 peptides in oxygen limited cultures than in highly aerated cultures. As well Zhu and Hearst (47) found 40 fold more puc mRNA in low oxygen grown cells than cells grown with high levels of oxygen. In high to low oxygen shift experiments Klug et al (26) found a transient 10 to 20 fold increase in puc and put mRNA which eventually dropped to a new higher steady state level. Bauer et al (4) constructed pufL-lacZ translational fusions on plasmids and conjugated them into R. capsulatus cells. When grown under high and low oxygen conditions the cells containing these plasmids were found to have 30 fold more £>ete-<jalactosidase activity in oxygen limited cultures. Since the amount of mRNA and the levels of lacZ expression both parallel the levels of photosynthetic peptides, oxygen is assumed to affect the transcription of the photosynthetic genes. Therefore oxygen regulated expression of the puc and put genes appears to act at the level of transcription. Beatty et al (5) constructed transcriptional fusions between the lac operon and progressive put promoter region deletions, and determined that the DNA . sequence responsible for oxygen regulated transcription is several hundred nucleotides upstream from the first structural gene in the put operon. Photosynthetically growing R. capsulatus cells have at least two mechanisms to adapt to variation in light intensity: cells can either change the number of photosynthetic units per cell, or alter the size of the photosynthetic 5 unit. Schumacher et al (37) found that in anaerobically growing cells shifted from high light to low light, the number of photosynthetic units doubled and their size had increased by 70%. As well bch a levels increased five fold and more intracytoplasmic membrane was produced. The relative amounts of RC and B870 complexes remain relatively constant with changes in illumination, whereas the amounts of B800-850, relative to RC and B870 complexes, increase in response to a reduction in light intensity during photosynthetic growth (21, 27, 37). Therefore the increased size of the photosynthetic unit in low light illumination is due to an increase in the number of B800-850 complexes. Because the light intensity has decreased the cell increases the efficiency of photon capture by producing relatively more B800-850 complexes, thus forming larger photosynthetic units. As the photosynthetic peptides cannot function in the absence of bch a, the synthesis of this pigment provides a convenient site for regulation of photosynthetic gene expression. In cells grown in low light more bch a is present than in high light grown cells (37). Since the B800-850 apo-peptides must bind bch a to participate in photosynthesis, the increase in the number of B800-850 complexes may be related to the increase in bch a content. The primary goal of my project was to determine how the anaerobically growing cell regulates the number of B800-850 complexes produced. In this investigation I used segments of the cloned puc (B800-850) genes as probes to determine the approximate transcriptional start and termination sites of puc mRNAs, and their relative steady state amounts, under photosynthetic conditions with either excess or growth rate-limiting levels of light. Also, puc-lac transcriptional and translational fusions were constructed on plasmids to 6 determine the relative rates of transcription and translation initiation of the puc genes in various growth conditions. The relative amounts of puc mRNAs were compared to the relative amounts of complexes, and a posttranscriptional regulatory mechanism was proposed to account for the relationship between mRNA levels and the amounts of mature B800-850 complexes. 7 MATERIALS AND METHODS 1. Bacterial strains and growth conditions. The wild type strain R. capsulatus B10 (30) and the deletion mutant R. capsulatus A R C 6 (13) were used throughout this study. The Escherichia coll strains J M 1 0 8 (42), J M 8 3 (42), RB404 (10), and HB101(9) were used . Cultures of R. capsulatus B10 containing a plasmid were routinely grown in R C V medium (40) supplemented with 0.5 ug tetracycline (Tc)/ml, 0.1% yeast extract and 10 mM phosphate buffer. For high and low oxygen growth experiments R. capsulatus cells were grown to stationary phase in 3 ml of liquid medium at 3 0 ° C for 16 hours. The cells were then diluted to an O . D . 6 5 0 of 0.003 and transferred to a 500 ml Erlenmeyer flask containing 40 ml of the liquid medium. This culture was grown at 3 4 ° C at 300 rpm until it reached a density of 150 to 200 Klett units. The sample was then diluted to 10 klett units in two Erlenmeyer flasks. The highly aerated sample had 40 ml of medium in a 500 ml flask grown at 300 rpm, while the low oxygen culture had 40 ml of medium in a 50 ml flask at 150 rpm. When both samples reached 80 Klett units (about 3 x 1 0 8 colony forming units (CFU)/ml) the cells were harvested, pelleted and frozen. Inocula for both high and low light grown samples were grown to stationary phase in 3 ml of the enriched R C V medium at 3 4 ° C under low aeration to induce the synthesis of the photosynthetic apparatus. The cells were then diluted to 10 Klett units and transferred to a completely filled 20 ml screw cap tube and incubated at 3 4 ° C with either 140 W / m 2 (high light) or 2 W / m 2 (low 8 light) incandescent tungsten illumination. Cells were harvested at a density of 3 x 10 8 CFU/ml to minimize the effects of self-shading. R. capsulatus B10 cultured with high and low light illumination for RNA isolation was grown as described in the previous section (except that no Tc was added to the culture medium). In experiments determining the half-life of the puc mRNA, 800 ml of cells were grown photosynthetically, with either high or low light illumination, in a ca. one litre Roux bottle at 34°C. The medium was bubbled continuously with filtered 95%N2-5%C0 2 gas. When cells reached a density of 3 x 10 8 CFU/ml a 25 ml sample was removed, transcription initiation was stopped by addition of rifampicin (200 ug/ml) to the culture, and subsequent samples were then taken at 20, 40, 60 and 80 min. for RNA extraction. Escherichia coll cultures were grown in LB medium as described (29). 2. Determination of befa-galactosidase activities. The R. capsulatus cell pellets were resuspended in 1 ml of Z-buffer ( 0.06 M N a 2 H P 0 4 . 7 H 2 0 , 0.04 M N a H 2 P 0 4 . H 2 0 , 0.01 M KCI, 0.001 M M g S 0 4 . 7 H 2 0 , and 0.05 M bera-mercaptoethanol, pH 7.0) (31) and sonicated to release the beta-galactosidase enzyme. The samples were centrifuged to pellet cellular debris. To measure the amount of bete-galactosidase enzyme in the supernatant fluid the substrate o-nitrophenyl-R-D-galactoside (ONPG) was used. When beta-galactosidase cleaves ONPG it releases o-nitrophenol which absorbs light . strongly at 420 nm, therefore by following the increase in absorbancy at 420 nm one can quantitate the amount of enzyme produced. The assay mixture contained 500 mM ONPG, various amounts of the sonicated extract and Z-buffer to 1 ml. 9 3. Construction of the plasmid pJAJl03/ac903. The broad host range plasmid pJAJ103 (24) was cut with SamHI and ligated to the 7.6 kb BamH\ to Bgl\ fragment from pMC931 (12) to give pJAJ103/ac903 (Fig. 2). This 7.6 kb segment has part of the trp operon fused upstream of the lacZYA structural genes. The 7.6 kb fragment contains the last 24 codons of the trpB gene, starting from a Hpal site which has been converted to a BamYW site (11), and downstream of the trpB gene is the entire 0.9 kb trpA gene plus 47 nt beyond the trpA stop codon (J. T. Beatty personal communication). These trp sequences had been fused in vivo (12) to the lac operator region 23 nt from the start codon of the lacZ structural gene, such that the lac promoter had been deleted. Upstream from the trp genes on pJAJ103/ac903 there are unique Pst\ and BamHI sites which were used to insert promoter fragments from the puc operon. Transcription initiated from the cloned promoter would then proceed through the trp genes and into the lac operon (see Fig. 2). 4. Construction of the transcriptional fusion between the puc promoter and the lacZ operon. The R. capsulatus pucA and pucB structural genes were previously isolated on a 5.75 kb EcoRI fragment cloned into pBR322 to give pRPSLHIl (44). The putative puc promoter was isolated from pRPSLHIl on a 2.9 kb Pst\-Cla\ fragment which contained the first 73 nt of the pucB structural gene and approximately 2.0 kb of upstream sequence as outlined in Figure 2. This 2.9 kb Psfi-Cla\ fragment from pRPSLHIl was inserted into Acc\ - Pst\ cut pUC13 to give pAZII. The 2.9 kb piece was cut out of pAZII with Psti and BamYW and ligated with pJAJ103/ac903 (see above) that had also been cut with Ps/I and SamHI. The resultant plasmid, pAZIII, now had the puc promoter transcriptionally fused to the lac operon. pAZIV was 10 Fig. 2. Construction of the puc-lacZ transcriptional fusions pAZIII and pAZIV. The open boxes represent the /acZgene, the hatched boxes are the trp genes (carried by pJAJ103) and the closed boxes are the puc genes. Abbreviations: A-Acc 1; B-Bam H1; C-C/a 1; E-Eco R1; P - P s M . 12 constructed by deleting the 1.5 kb Psti segment from pAZIII. 5. Construction of a translational fusion between the lacZ and the pucB structural genes. A plasmid containing a translational lacZ gene fusion to the pucB structural gene was constructed by first isolating a 6.8 kb BamYW fragment from pMC931 (12). This fragment contained the lac operon with a truncated form of the lacZ gene, which has the first eight codons of the amino-terminal end removed and a unique BamYW site inserted adjacent to the eighth codon. This segment was cloned into the BamYW site on pAZII, 3' of the pucB stuctural gene, to give pAZII(/acOF) (see Fig. 3). pAZII(/acOF) contains the puc promoter and the first 73 nt of the pucB structural gene fused to lacZ such that the pucB gene was in a different translational reading frame from lacZ. An in-frame (translational) fusion was created between the pucB and the lacZ genes by subjecting pAZII(/acOF) to a BamHI partial digest and isolating plasmid molecules that had been cut only once. The linear fragments were digested with mung bean nuclease, which degraded the 5' protruding BamHI ends, and then religated to form the translational fusion, pAZII(/aclF). This in-frame fusion was isolated from pAZII(/aclF) on an 8 kb Psfl - BamHI fragment and inserted into pJAJ103 (see above) to give pAZV, which was conjugated from E.coli JM108 into R.capsulatus B10 (see below). The final construct contains the puc transcription initiation region, pucB ribosome binding site and its first 25 codons fused inframe to the lacZ gene. 6 . Conjugation of recombinant plasmids into R. capsulatus B 1 0 . To transfer the plasmid constructs into R. capsulatus B10 a triparental mating was done (17). E. coli containing the recombinant plasmid was mixed with R capsulatus B10 and E. coli HB101 (pRK2013). The plasmid pRK2013 13 Fig. 3. Construction of the puc-lacZ translational fusion pAZV. The open box represents the lacZ gene whereas the closed box represents the puc genes. Abbreviations: B-Bam H1; E-Eco R1; P-Pst 1. loc'ZYA 15 encodes the mobilizing factors which allow the transfer of the recombinant plasmid from E. co//'to R. capsulatus B10. The three strains were mixed together, spotted onto an RCV plate and incubated overnight at 30°C. The cells in the spot were then streaked on another RCV plate containing 0.5 u.g/ml Tc. The E. coll strains used were multiply auxotrophic and therefore could not grow on the RCV minimal medium. In addition, the plate contained Tc which allowed only R. capsulatus cells containing the plasmid to grow. To check for E. coli contamination an isolated R. capsulatus colony was restreaked onto an RCV medium which in addition to Tc contained 0.1% yeast extract. The pure R. capsulatus colony was picked, grown up and frozen as a stock culture. 7. Probe constructions. The 5' probe used in S1 protection experiments was an anti-sense RNA molecule, which was transcribed by T7 RNA polymerase. The 270 nucleotide (nt) Sma\-Cla I fragment of pRPSLHIl (44) (labelled 5' in Fig. 5) was sub-cloned into the pT7-2 vector (Pharmacia), which contains the T7 promoter. The 3' probe was obtained as the 800 nt ApaL\-Sma\ segment (indicated as 3' in Fig. 5) from pRPSLHIl. The ApaU site was filled in (29) by incubation with the Klenow fragment of DNA polymerase I, and with dATP, dCTP, dGTP and 50 uCi of alpha- 3 2 P - T T P (600 Ci/mmole; New England Nuclear). 8. In vitro transcription of RNA probes. To produce homogeneously labelled 5' RNA probes, 1 -2 u.g of linearized DNA template were used with T7-RNA Polymerase as recommended by the commercial supplier (Pharmacia), and incubated at 37°C for one hour. Samples were then extracted with phenohchloroform (1:1), and the nucleic acids were precipitated twice from ethanol. The pellet was washed with 70% ethanol, dried, dissolved in 100 16 u.l of DNase I buffer (20 mM sodium acetate, 10 mM MgCl2 and 10 mM sodium chloride, pH 4.5) with 23 units of DNase I (Boehringer Mannheim) and incubated at 22°C for 30 min. The sample was then phenol extracted and the RNA was precipitated with ethanol. Usually 10-20 jig of RNA were obtained from 1-2 u,g of linearized DNA template, with a specific activity of 0.5-1.0 x 10 6 dpm/|ig RNA. 9. RNA isolation, blotting and hybridization. Isolation of RNA from R. capsulatus was done as described previously (39). The blotting procedure was done as follows: 5 ug of R. capsulatus RNA were dissolved in running buffer (20mM MOPS, 1 mM EDTA, 5 mM sodium acetate, pH 7.0) supplemented with 50% formamide and 2.2 M formaldehyde, heated to 70°C for 3 min., cooled, and loaded onto a 1% agarose-6.6% formaldehyde gel and run at 20-40 mA. The gel was then blotted for 16 hours onto a sheet of nitrocellulose paper which had been soaked in 20xSSC (29). The filter was baked for 2 hours at 80°C. Prehybridizations were done in 200 ug/ml denatured salmon sperm DNA, 5xSSPE (29), 0.3% SDS and 50% formamide at 42°C for 1-2 hours. This mixture was supplemented with 1x10^ dpm of radioactive probe for hybridizations of 12-16 hours at 42°C. The filters were washed three times, for 7 min each, at 70°C in O.lxSSPE, 0.1% SDS. 10. Capping of RNA with guanylyl transferase. Unfractionated RNA (10 u,g) from R. capsulatus cells grown with high light was incubated in guanylyl transferase buffer (25mM Tris-HCl, 2 mM MgCl2, 1 mM DTT, pH 7.5) with 150 uCi alpha- 3 2 P - G T P (600 Ci/mmole) and 10 units of guanylyl transferase (BRL) in a total volume of 100 u.l at 37°C for 30 min (32). The RNA was extracted twice with phenokchloroform, ethanol precipitated four times, washed and dried. The pellet was dissolved in 100 uJ 17 diethylpyrocarbonate-treated (29) sterile distilled water. 11. S1 nuclease protection experiments. A 5 ug sample of ft capsulatus RNA was ethanol precipitated with 0.2-0.4 ug of the 5' probe or 5 ng of the 3' probe and 5 ug of yeast tRNA. The pellet was washed in 70% ethanol and dried. The sample was dissolved in 30 ul of hybridization buffer (0.4 M sodium chloride, 0.04 M sodium phosphate, 0.4 mM EDTA, pH 6.5), heated to 95°C for 5 min., quickly transferred to 70°C and incubated for 16 hours under parafin oil. S1 nuclease (1500 units) in 300 ul of S1 buffer (0.28 M sodium chloride, 0.03 M sodium acetate, 4.5 mM zinc sulphate, pH 4.5) was added and the sample was incubated at 37°C for one hour. Then 50 ul of a solution of 4 M ammonium acetate, 0.1 M EDTA, with 20 ug carrier tRNA were added, followed by extraction with 350 u.l of buffered phenohchloroform (1:1). After the phenol extraction, an ether extraction was performed to remove the parafin oil. 400 uJ of isopropanol were then added to precipitate the nucleic acids. The RNA pellet was washed, dried and dissolved in sample buffer (80% formamide, 0.5xTBE (25), 0.02% bromphenol blue and 0.02% xylene cyanol), heated to 95°C for 5 min., cooled and loaded onto a 5% polyacrylamide-7M urea gel in 0.5xTBE. After electrophoresis the gel was dried and exposed to X-ray film. When capped RNA and unlabelled probe were used in S1 protection experiments the procedure was modified slightly. 10 ug of R capsulatus RNA and 0.2 u,g of the 5' probe were ethanol precipitated and then dissolved in hybridization buffer, heated to 95°C, cooled to 70°C and incubated for 12-16 hours under parafin oil. The sample was then digested with 1500 units of S1 nuclease for 1 hour, followed by incubation with 25 ng of RNase A for 15 min. at 20°C. The RNA was phenol extracted, ether extracted, ethanol precipitated and 18 subsequently dissolved in sample buffer. It was then heated to 95°C for 3 min, cooled to 0°C and loaded onto a 5% polyacrylaminde-7M urea gel. 12. Analytical Methods. The light intensity was measured with a Li-Cor Quantum Sensor (Model Li-185B). To measure total cell protein a version of the Lowry (28) protein assay was performed in which cells were boiled in 0.05 M NaOH for 1 min. and then cooled before adding the other reagents. The protein standard used was crystalline bovine serum albumin. Spectral scans were done on 5 ml. of cells (1.5 x10 9 CFU) that had been resuspended in 1 ml of 22.5% BSA (SIGMA). Autoradiograms were scanned with a Quick Scan Jr. (Helena Laboratories Corp.) densitometer, and the area under peaks was either measured by an integrator or the appropriate peaks were cut out and weighed. 19 RESULTS 1. Use of puc-lac fusions to estimate the relative levels of puc transcription and translation under different growth conditions. To measure the relative amounts of puc transcription the puc promoter and the first 73 nt of the pucB structural gene were fused to the lac operon on the plasmids, pAZIII and pAZIV (Fig. 2), and conjugated into R. capsulatus (see Materials and Methods). To evaluate the role of translation of the puc mRNA an in-frame fusion was made between the pucB structural gene and the lacZ gene on the plasmid pAZV (Fig. 3). The cells harbouring these plasmids were grown under four separate conditions: high oxygen, low oxygen, anaerobic high light and anaerobic low light. Once the cultures reached a predetermined cell density the cells were harvested, lysed and assayed for beta-galactosidase. As the pJAJ103 plasmid is a slightly unstable vector that is lost from a R. capsulatus culture at a rate of about four percent per generation (24), a correction factor was obtained which compensated for plasmid loss. To determine the degree of plasmid loss for each growth experiment cell samples were plated onto RCV (40) medium with and without Tc. Since only those cells with the pJAJ103 derivative would grow in the presence of Tc, it was possible to calculate the ratio of the total number of cells plated to the number of cells that had retained the plasmid. The enzyme activities were multiplied by this ratio to obtain a value corrected for plasmid loss. Tables 2 and 4 have the raw data whereas Tables 1 and 3 give the values corrected for plasmid loss. 20 A. Oxygen effects i. Expression of the pucB-lacZ transcriptional fusions in R.capsulatus cells grown with either high or low oxygen tension. The specific activities of befa-galactosidase in cultures of R. capsulatus B10(pAZIII) were 86 under low oxygen tension and 54 under high oxygen tension (Table 1, line 1). The specific activities of befa-galactosidase in extracts of R. capsulatus B10(pAZIV) were also higher in low oxygen growth conditions (Table 1, line 2). The uncorrected values also show more enzyme activity in low oxygen grown cells (Table 2, lines 1 and 2). Zhu and Hearst (47) have shown that there is more puc mRNA in cells grown in oxygen limited conditions than in highly aerated cultures, so these lacZ transcriptional studies support a theory that the increased amount of puc mRNA in oxygen limited cultures is partially due to increased transcription initiation. pAZIII was also conjugated into R. capsulatus ARC6 (13), which has the put structural genes replaced by the neomycin phosphotransferase structural gene (knr). R. capsulatus ARC6 is therefore unable to grow photosynthetically since the reaction centre structural genes are missing. As well, this strain produces extremely low amounts of B800-850 complexes because one of the put genes (pufQ) is necessary for synthesis of B800-850 light harvesting complexes (unpublished results).. The pufQ gene is encoded on the putoperon and is upstream of the pufB gene. It is not known what role pufQ has in the regulation of photosynthetic gene expression however when it was deleted from R. capsulatus, the cell could no longer produce B800-850 complexes, therefore pufQ may effect the transcription of the puc genes. To estimate the rates of transcription the puc-lacZ transcriptional fusion was conjugated into 21 TABLE 1. Specific activities of oefa-galactosidase in cultures grown in either highly aerated or oxygen limited growth conditions, (corrected for plasmid loss) 1. H I G H O X Y G E N B 1 0 ( p A Z I I I ) 2 5 4 4 ( 1 4 ) 8 6 (8 .4) B 1 0 ( p A Z I V ) 2 4 5 (3.6) 7 5 (11) B 1 0 ( p A Z V ) 3 7 . 4 x 1 0 3 ( 3 . 0 x 1 0 3 ) 2 . 2 x 1 0 4 ( 9 . 0 x 1 0 3 ) L O W O X Y G E N 1 T h e v a l u e s g i v e n a r e the m e a n of s e v e r a l e x p e r i m e n t s , a n d the n u m b e r s in p a r e n t h e s e s r e p r e s e n t the s t a n d a r d d e v i a t i o n of the e n z y m e activity v a l u e s . 2 pAZIII a n d p A Z I V a r e the puc-lac t r a n s c r i p t i o n a l f u s i o n s ( F i g . 2) 3 p A Z V is the puc-lac t r a n s l a t i o n a l f u s i o n ( F i g . 3) 4 S p e c i f i c act iv i t ies a r e e x p r e s s e d a s n m O N P G c l e a v e d p e r m i n . p e r m g protein-22 TABLE 2. Specific activities of befa-galactosidase in cultures grown in either highly aerated or oxygen limited growth conditions (uncorrected for plasmid loss) 1. HIGH L O W OXYGEN OXYGBsl B1 O(pAZIII) 20 (4) 44 (7) B10(pAZIV) 39 (5) 68 (4) B10(pAZV) 3 . 6 x 1 0 3 (3.0x102) 9 . 6 x 1 0 3 (5 .0x10 2 ) ARC6(pAZIII) 15 4 0 ARC6(pAZV) 4 . 3 x 1 0 3 1 .0x10 4 Data expressed as in Table 1. 23 R. capsulatus A R C 6 . The specific activities of befa-galactosidase of R. capsulatus A R C 6(pAZIII) were 15 in a high oxygen growth condition and 40 in low oxygen tension(Table 2, line 4). Therefore transcription of puc genes in the absence of the pufQ structural gene appeared to be the same as when this gene was present in the wild type R. capsulatus B10 strain. This indicated a posttranscriptional mechanism for regulation of puc expression by pufQ. ii. Expression of the pucB-lacZ translational fusions in R. capsulatus grown in either high or low oxygen conditions. A s translation may play a key role in regulating pucA and pucB gene expression, a translational fusion was constructed between the pucB and lacZ structural genes (Fig. 3). Extracts of R. capsulatus B10(pAZV) grown in a high oxygen environment yielded a befa-galactosidase specific activity of 7 .4x10 3 whereas low oxygen grown cells gave 2 .2x10 4 (Table 1, line 3). The uncorrected values showed the same trend (Table 2, line 3) The most striking difference between the transcriptional and translational fusions was that the levels of befa-galactosidase activity were about one hundred fold higher for the translational fusions. A possible reason for the 100 fold difference in befa-galactosidase expression between the transcriptional and translational fusions was that the R. capsulatus r ibosomes may initiate more efficiently from the pucB ribosome binding site on the translational fusion than the lacZ ribosome binding site on the transcriptional fusions. A second possibility could be that the trp genes which are between the lac operon and the puc promoter on the transcriptional fusions might interfere with lacZ gene expression. Within the trp sequence is an E. coli transcriptional terminator, which may be recognized by the 24 Ft.capsulatus RNA polymerase and therefore prematurely terminate transcription. However in spite of the vast differences in absolute amounts of bete-galactosidase produced, the translational fusion showed about the same degree of oxygen regulated production of beta-galactosidase as did the transcriptional fusions. As the pufQ gene appears not to affect the transcription of the puc genes, (see transcriptional fusion studies) it was of interest to determine if translation was regulated by pufQ. Therefore the translational fusion pAZV was conjugated into R. capsulatus ARC6 and cultured in high and low oxygen conditions. In oxygen limited cultures the specific activity of bete-galactosidase was 4.0x10 3 whereas highly aerated cultures gave 1.0x104 (Table 2, line 5). Both the transcriptional and the translational fusions gave the same relative amounts of lacZ expression in ARC6 as in the wild type strain. Therefore translation does not seem to be involved in regulation of puc expression by oxygen, or by pufQ. B. LIGHT EFFECTS: i. Expression of the p u c B - l a c Z transcriptional fusions in R. capsulatus grown anaerobically with high or low light intensity. The specific activities of beta-galactosidase in anaerobically grown cultures of R. capsulatus B10(pAZIII) were 152 in high light illumination and 110 in low light illumination (Table 3, line 1). As well B10(pAZIV), grown photosynthetically, yielded more befa-galactosidase enzyme activity when grown with saturating light intensity (Table 3, line 2). The uncorrected values also show more enzyme activity in high light grown cells. (Table 4, lines land 2). These results showed that there may be an increased 25 TABLE 3. Specific activities of befa-galactosidase in cultures grown with either high or low light illumination (corrected for plasmid loss) 1. HIGH LOW LIGHT LIGHT B1 O(pAZIII) 152 (38) 110 (21) B10(pAZIV) 212 (17) 110 B10(pAZV) 9 .7x10 3 2.8X10 4 (6.0X103) Data expressed as in Table 1. 26 TABLE 4. Specific activities of faefa-galactosidase in cells grown with either high or low light illumination (uncorrected for plasmid loss) 1. HIGH LOW LIGHT LIGHT B1 O(pAZIII) 56 (1) 28 (6) B10(pAZIV) 88 (6) 38 (11) B10(pAZV) 5 . 1 x10 3 (1.2x10 3 ) 7 . 5 x 10 3 (6.0x10 2 ) Data expressed as in Table 1. 27 rate of transcription initiation of puc genes in cells grown with high light i l luminat ion . ii. Expression of the pucB-lacZ translational fusion in cells grown with either high or low light illumination. T h e levels of lacZ expression from the translational fusion in R. capsulatus B10 grown photosynthetically with saturating or growth rate limiting light intensity were 9 . 7 x 1 0 3 in high light illumination and 2 .8x10 4 in low light illumination (Table 3, line 3). The specific activities of befa-galactosidase are higher in cells grown with growth rate limiting light intensity which is in contrast to the results obtained with the transcriptional fusions, in which the levels of befa-galactosidase activities were slightly higher in cells grown with high light illumination. Therefore it appeared that the rates of translation initiation m i g h t have been four fold greater in cells grown with low light illumination. These results taken as a whole suggest a different mechanism for oxygen and light regulation of expression of the puc genes. 2. Studies on the relative levels of puc mRNAs and B800-850 complexes in R. capsulatus. A. Effects of different levels of illumination on photosynthetic growth of R.capsulatus cells. A s can be seen in the spectral scans of intact cells shown in Fig. 4, substantially greater amounts of pigments were found in cells grown in low light than with high light illumination. The absorption at about 860 nm is due to a combination of B800-850, B870 and reaction centre complexes, whereas nearly all the 800 nm peak 28 Fig. 4. Spectral scans of high (a) and low (b) light grown R. capsulatus cells. 29 is due to B800-850 light absorption (45). Therefore the area under the 800 nm band is proportional to the number of B800-850 pigment-protein complexes in the R. capsulatus membrane. A comparison of the 800 nm peaks from the spectral scans shown in Fig.4 revealed that there were four fold more B800-850 complexes in cells grown with low light than with high light. The culture turbidity and protein content of equal numbers of colony forming units in cultures grown under both levels of illumination were within 10% of each other, indicating that there were no major differences in cell size. However the growth rate, expressed as the time required for a doubling in cell number, was twelve hours for cultures grown with low light and two hours for cultures grown with high light. It has been observed that the R N A content of R. capsulatus cells is proportional to growth rate (2), and it was found that cells grown with high light contained about three times as much total R N A as cells grown with low levels of illumination (that is, 7.5 u.g total R N A / 3 x 1 0 8 C F U in high light and 2.5 ug total R N A / 3 x 1 0 8 C F U for low light grown cells). B. S i z i n g a n d e n d - m a p p i n g of puc t r a n s c r i p t s . T h e approximate length of puc transcripts was estimated by Northern blot analysis of R N A from R.capsulatus cultures grown with either high or low light intensities. A radioactive anti-sense R N A probe was obtained by in vitro transcription of the 270 bp DNA fragment designated 5' in Fig. 5, which extends from a C/al site in the pucB gene to a Smal site 190 nt before the start codon of this gene. The results of a Northern blot experiment are shown in Fig. 6, and indicate that transcripts of about 530 nt in length were present under both growth conditions tested. Although this transcript was long enough to encode both 30 5 ' 3" Fig. 5. Representation of the 3' and 5' probes used in S1 protection experiments. At the top of the figure is a representation of a 1.25 kb Sma 1 fragment from pRPSLHII(44). The B800-850 pucA and pucB genes, which are transcribed from left to right, are shown as heavy regions. T h e endpoints of the 5' probe (270 nt) and the 3' probe (800 nt) are shown below. S-Sma 1, A-Apa L1, C-C/a 1. 31 L H M13 2527 1623 849 525 341 Fig. 6. Northern blot of RNA isolated from R. capsulatus grown with either high or low light illumination. The blot was hybridized with the in vitro transcribed 5' RNA probe. Radioactively labelled Hae III cut M13mp11 single stranded DNA fragments were used as molecular weight markers. H-high light, L-low light 32 the alpha and beta B800-850 peptides, it was possible that a second transcript was derived from the pucA gene, for the probe was complementary only to the pucB gene. To distinguish between these possibilities and learn more about the transcription of these genes, 5' and 3' end-mapping experiments were done. The 5' probe (Fig. 5) was protected from S1 nuclease digestion by hybridization with R. capsulatus RNA, and the protected fragments were visualized by gel electrophoresis and autoradiography. The results from a typical experiment are shown in Fig. 7A: two distinct R N A molecules hybridized with the 5' probe, suggesting that both of the puc genes might be encoded by polycistronic transcripts with different 5' ends. The two 5' ends would be separated by approximately 15 nt, with the end of the longer segment being about 125 nt upstream of the start codon of the pucB structural gene. The probe used to map the 3' end of the puc m R N A in S1 protection experiments was an end-labelled D N A molecule, which extends from an ApaU site within the pucA structural gene to a Sma\ site 700 bp downstream of the pucA stop codon (see Fig. 5). This 800 bp fragment was labelled at the ApaU site. As shown in Fig.7B, one DNA segment, of about 120 nt, was protected from nuclease digestion by the R N A in both high and low light samples. There seemed to be slightly more R N A from low light grown cells that was homologous to the 5' probe in the Northern blot experiment shown in Fig. 6, but in the end-mapping experiments (Fig. 7) the amount of protected probe in the two growth conditions was about equal. To quantify the relative amounts of puc m R N A in high and low light grown cells saturation hybridization experiments were performed as described in the following section. 33 B M13 HL C LL 1623 849 1 6 2 3 8 4 9 5 2 5 M13 LL HL C ****** - n m 309 309 169 117 1 6 9 1 5 8 1 1 7 1 0 6 9 8 Fig. 7. End-mapping analysis of B800-850 mRNA isolated from high and low light grown R. capsulatus cells. The results from the 5' end-mapping are given in panel A, which showed two protected fragments of 200 and 185 nt. The undigested probe (seen in all three lanes) ran as a 280 nt fragment. The 3' end-mapping, in panel B, showed a single 120 nt protected segment and the 800 nt end-labelled probe. Molecular weight markers were Hae III cut M13mp11 radioactively labelled single stranded DNA molecules. HL-high light, LL-low light, C-control(probe incubated with Yeast tRNA prior to S1 nuclease treatment). 34 C. Saturation hybridization and half-life determination of puc mRNAs. Although the end-mapping experiments implied that cells cultured in both growth conditions contained equal amounts of puc mRNA, it was possible that the concentration of the probe was too low to drive the homologous hybridizations to completion. In Fig.8 are shown the results of an experiment in which either 0.2 ng or 0.4 ug of 3 2 p . | a D e | | e c | 5> probe were used in an S1 protection experiment with 5 ug of high and low light R N A samples. Because there was no increase in the amount of R N A hybridized to the probe when the amount of probe was increased, it was concluded that in this experiment the amounts of puc m R N A s detected were accurate measurements of the relative steady state levels of these transcripts in cells grown with the two conditions of illumination. Densitometric scans showed that there was approximately 1.4 fold more puc m R N A (per u,g total RNA) in cells grown with high light as compared with low light grown cells. Because the faster-growing high light cells contained about three times as much total R N A as low light grown cells, the steady-state levels of puc m R N A in cells grown with high illumination would then seem to be four times as great as cells grown under low levels of light. Since the steady state levels of R N A s are in part a function of their decay rates it was of interest to determine the half-lives of the puc m R N A s . The decay rates of these transcripts were derived from densitometric scanning of autoradiograms such as the one shown in Fig, 8, in which the 5' probe was used. The half-lives were found to be 10 min. (+/- 1.0 min.) for R N A s from high light cells and 19 min. (+/- 2.5 min.) for R N A s from cells grown with low levels of light. The rate of decay of both of the transcripts detected with this probe were the same. Thus, although the steady-state levels of puc m R N A s are 35 HL LL • II i M13 0x2 0 20 40 60 80 0x2 0 20 40 60 80 C Fig. 8. Determination of the relative steady-state levels and half-lives of B800-850 mRNAs. S1 protection experiments were performed on 5 ng of R. capsulatus RNA from each time point, using 0.2 ug of the 5' RNA probe (0.4 ug on lanes labelled 0x2). Although only one representative autoradiogram is shown here, the half-lives of the B800-850 mRNA were determined by averaging the measurements from three separate experiments. Hae III cut M13mp11 radioactively labelled single stranded DNA fragments were used as molecular weight markers. HL-high light, LL-low light, C-control (probe incubated with Yeast tRNA prior to S1 nuclease digestion). 36 four fold greater in cells grown with high light, the rates of decay are also greater, so there must be more frequent initiations of transcription than in cells grown with low levels of illumination. D. L o c a l i z a t i o n of puc t r a n s c r i p t i o n in i t iat ion s i t e s . T h e R N A end segments detected with the 5' probe could be from either a pair of overlapping 5' transcripts or they could derive from 3' and 5' R N A ends. To specifically identify the 5" ends of molecules that resulted from transcription initiations, total R N A was incubated with alpha - 3 2 P - G T P and guanylyl transferase, in order to transfer 3 2 P - G M P to di- and triphosphates on 5' m R N A ends (32). The resultant labelled R N A was then hybridized to the unlabelled 5' probe and digested with S1 nuclease. Only those transcripts that hybridized to the probe and had a labelled 5' end (that is, a transcription initiation site) would be detected by gel electrophoresis and autoradiography after S1 digestion. It was found that the 5' probe protected two capped R N A molecules that must correspond to the two 5' ends detected in the previous S1 experiment, as shown in Fig. 9. There was greater variation between independent experiments in the relative intensities of the two capped transcripts (perhaps due to variation in the efficiency of capping) than there was in the standard S1 experiments. Therefore, it was concluded that the standard S1 protection experiments provided a more accurate estimate of the relative amounts ot the two transcripts. The difference in sequence composition and the presence of the additional 5'-5' linked (32) nucleotide probably account for the differences in electrophoretic mobility of these R N A segments, relative to the segments of the S1 protected R N A probe run in the adjacent lane. These results show that there are two sites, separated by 10 to 15 nt, at which transcription of the puc genes initiates. 37 1 Fig. 9. Autoradiogram of the gel used for separation of capped mRNA segments protected from S1 digestion by hybridization with the 5' probe. Lane 1 contains the radioactive probe and the two segments protected by hybridization with the puc mRNAs (compare with Fig. 7A). In lane 2 are the two radioactively capped mRNAs (arrows) protected from S1 digestion by hybridization with non-radioactive 5' probe. 38 DISCUSSION 1. Analysis of puc-lac plasmid fusions. A. Regulation of expression of the puc genes by oxygen. T h e transcriptional and translational fusions of the puc promoter to the lacZ gene have provided data on oxygen regulated transcription of the pucB and A genes. It has been estimated that there are at least 40 fold more puc transcripts in oxygen limited cultures than in highly aerated cells (47). Zhu and Hearst (46) proposed that the decreased amount of puc m R N A in highly aerated samples is due to a decrease in the rate of transcription initiation of the puc genes as well as an increase in the rate of decay of the message. In the transcriptional and translational fusions described in this thesis (Tables 1 and 2) there is less befa-galactosidase activity in cells grown in highly oxygenated samples than oxygen limited cultures. My results support the idea that the rate of transcription initiation of the puc genes in cells grown with low levels of oxygen is greater than in highly aerated cells. The half-life of the transcript also appears to play a role in regulating the levels of B800-850 complexes, for I have found approximately a two fold difference in the rate of transcription initiation of the puc genes in high and low oxygen grown cells but there is 40 fold more puc m R N A in low oxygen grown cells. Therefore exposure of the cell to oxygen appears to decrease the rate of transcription initiation as well as increase the rate of decay of the puc message. 39 B. Regulation of expression of the puc genes by incident light intensity. It w a s a l s o s h o w n that w h e n R. capsulatus c e l l s w e r e g r o w n a n a e r o b i c a l l y , inc ident light intensity a f f e c t e d the e x p r e s s i o n o f the puc g e n e s . A l t h o u g h the t ransc r ip t iona l f u s i o n g a v e m o r e befa-galactosidase activity in c e l l s g r o w n with h i g h light i l luminat ion t h a n low light i l l u m i n a t i o n , the t r a n s l a t i o n a l f u s i o n p r o d u c e d m o r e e n z y m e act iv i ty in c e l l s g r o w n with low light intens i ty ( T a b l e s 3 a n d 4) . T h i s i m p l i e d that init iation of t r a n s l a t i o n of the puc m R N A w a s m o r e eff ic ient in c e l l s g r o w n with low light i l l uminat ion . A s t h e r e w a s four fo ld m o r e puc m R N A in h igh light g r o w n c e l l s ( F i g . 8) but four fo ld m o r e B 8 0 0 - 8 5 0 c o m p l e x e s in low light g r o w n c e l l s ( F i g . 4 ) , o n e might e x p e c t t h e r e to b e a n e l e v a t e d level o f t rans lat ion o f the puc g e n e s in c e l l s g r o w n with l o w l ight i n t e n s i t y . C. Problems associated with plasmid borne gene fusions. A p o t e n t i a l s o u r c e of e r ror with p l a s m i d b o r n e t r a n s c r i p t i o n a l a n d t r a n s l a t i o n a l lacZ f u s i o n s is that a c h a n g e in c o p y n u m b e r c a n affect the a m o u n t of befa-g a l a c t o s i d a s e e n z y m e p r o d u c e d . F o r e x a m p l e , the c o p y n u m b e r of p B R 3 2 2 in E. coli H B 1 0 1 d e c r e a s e s a s growth rate i n c r e a s e s (25) . S i n c e the g r o w t h rate of R. capsulatus is s u b s t a n t i a l l y di f ferent in t h e four g r o w t h c o n d i t i o n s t e s t e d it is p o s s i b l e that the p l a s m i d c o p y n u m b e r c o u l d v a r y s ign i f i cant ly . In add i t ion to g r o w t h rate, p r o m o t e r s t rength c a n a l s o af fect p l a s m i d c o p y n u m b e r . If t r a n s c r i p t i o n f r o m a p r o m o t e r p r o c e e d s t h r o u g h the or ig in o f r e p l i c a t i o n of a p l a s m i d it c a n inter fere with p l a s m i d r e p l i c a t i o n . W o n g et al (41) o b s e r v e d that w h e n a s t r o n g p r o m o t e r w a s p l a c e d o n p B R 3 2 2 s u c h that t ranscr ip t ion r a n t h r o u g h the or ig in o f rep l i ca t ion the p l a s m i d c o p y n u m b e r d r o p p e d t h r e e to f ive fo ld . If the p r o m o t e r w a s p l a c e d in the o p p o s i t e or ientat ion t h e n n o d e c r e a s e in 40 plasmid copy number was seen. The theory is that R N A poymerase while transcribing the DNA template hinders R N A primer production (in the case of pBR322 derivatives). S ince the puc promoter is more active transcriptionally in oxygen limited cultures than highly aerated growth conditions it is possible that the higher rate of transcription initiation might interfere with plasmid replication thus lowering copy number. This would result in an underestimate of the degree of oxygen or light regulated transcription. To date no experiments have been done to determine the copy number of pJAJ103 derivatives in R. capsulatus grown under these conditions. Another problem with plasmid borne gene fusions is that transcription of the puc genes could be affected by D N A topology. It has been shown previously that transcription of some genes (for example lac in E. coli) is partially controlled by the degree of supercoilling of the D N A template (8). To test the lac promoter's response to D N A supercoiling in vitro transcriptions were performed on templates that were either relaxed or partially negatively supercoiled. A s the negative superhelicity increased the rate of transcription initiation also increased, until it reached a maximum above which introduction of new supercoils had the effect of lowering transcription initiation rates. In this system, the more negatively supercoiled the template the more efficiently R N A polymerase can melt apart the complementary strands until the template becomes so distorted with additional supercoils that R N A polymerase can no longer recognize the promoter thus accounting for the decrease in transcription rates at very high superhelicities. It has been observed by Balke and Gralla (3) that the linking number of the plasmid pBR322 changes when E.coli shifts from growth on glucose to 41 acetate. Balke and Gralla state that "When the external environment changes, global changes in metabolism are accompanied by changes in the topological state of the DNA...". In the growth studies of my project the same medium was used, but the cells were grown under different environmental conditions. The cellular metabolism of R. capsulatus cells grown with high light, low light, high oxygen and low oxygen are very different. For example, cells growing in oxygen limited cultures produce a vast intracytoplasmic membrane apparatus, large amounts of bch a, reaction centre and light harvesting peptides and grow extremely slowly. Highly aerated cells have no internal membrane apparatus, grow rapidly, and do not produce any of the components of the photosynthetic unit. The cellular environment within these two cells is very different and therefore the linking number of any plasmid could be different in cells grown under these conditions. If transcription of the puc genes is sensitive to supercoiling, there is no guarantee that the plasmid copy of the puc genes has the same superhelical density as the puc genes in the chromosome of R. capsulatus. The use of multicopy gene and operon fusions may give artefactual values when there is a frans-acting factor involved in regulation of gene expression. If in the puc system there exists a frans-acting regulatory factor its function might be obscured by the high number of binding sites available on plasmid copies. O n e way to avoid the problems of plasmid instability, variations in copy number and topology differences, would be to insert the transcriptional and translational lacZ fusions into the R. capsulatus chromosome at or near the puc locus. Once inserted into the genome the fusion will be maintained as a single stable copy. If DNA topology effects transcription of the puc genes, the fusion should have the same conformation as the wild type genes. 42 Another way to measure the levels of transcription of genes is to measure m R N A encoding the genes of interest. Due to the inherent problems with plasmid borne gene and operon fusions it was decided for the remainder of my thesis project to investigate the regulation of the levels of puc m R N A in cells grown with high and low light intensity. 2. Analysis of puc mRNA in cells grown with high and low light illumination. The mapped 3' and 5' ends of the two puc m R N A s gave overall transcript lengths of about 505 and 491 nt, which corresponds well to the size of the m R N A species found in the Northern blot (Fig. 6). Since the resolution of nucleic acids of this size in agarose gels is poor compared to polyacrylamide gels, the Northern blot could not distinguish between the two R N A transcripts, which may be why previous reports have only mentioned a single transcript of the puc genes (46, 47). Two transcription initiation sites of the puc genes have been identified. Both transcripts had the same decay rate and their relative amounts, although slightly variable between different experiments, were usually about equal. There could either be two promoters (one for each transcript) or a single promoter that directs transcription initiation at two sites. Most bacterial dual promoters examined, such as E. coli rRNA promoters, have two transcription initiation sites separated by a large distance, each m R N A being transcribed from separate -10 and -35 regions (35). The puc genes however have two transcription initiation sites separated by only 10 to 15 nucleotides. As an R. capsulatus promoter consensus sequence is not available and the resolution of the endmapping experiments was +/- 5 nt, it was not possible to positively identify -10 and -35 regions. 43 In other tandem promoter systems the individual promoters are usually regulated differently from each other. For example, the rrnA gene in E. coli (which encodes one of the rRNAs) is transcribed from two promoters (35). Transcription initiation from the most upstream promoter, P1 , is strongly growth rate dependent whereas transcription initiation from the downstream promoter, P2, is only weakly dependent on growth rate. Therefore in rapidly growing cells the majority of the transcripts originate from P1, but in slow growing cells the rate of transcription initiation from both promoters is approximately equal (34). The two puc transcripts however behave identically in the two growth conditions tested (see Figs. 7 and 8). In both high and low light growth conditions the ratio of the longer transcript to the shorter was approximately 1.0. Therefore the reason for having two transcription initiation sites for the puc genes was not immediately apparent. Upon examination of the nucleotide sequence upstream of the start sites no E. coli like -10 or -35 regions could be found. This was expected, as to date all R. capsulatus promoters tested have failed to function in E. coli (24). However, there exists a direct repeat of " A C A C T T G " in the D N A sequence upstream of where the 5' end of the longer puc m R N A transcript maps (Fig 10). The centres of these repeated sequences are separated by 14 nt, which was the approximate distance between the 5' ends of the two puc mRNA's . Moreover, the centre of the most upstream repeated sequence is approximately 25 nt from the start site of the longer transcript while the centre of the downstream sequence is about 26 nt from where the initiation site of where the shorter transcript maps. The spacing of the repeated sequences in relation to each other and to the puc 5' m R N A ends suggested that they may be involved in transcription initiation. 44 Fig. 10. Sequence of the 5' and 3' regions flanking the B800-850 pucA and pucB genes (44). The approximate positions of the 5' and 3' ends of the B800-850 transcript are shown by the lines above the sequence. Since there was some uncertainty in the interpretation of the sizes of the S1-protected segments of the probes the dashed lines represent a possible error of +/- 5 nt. The repeated sequence of " A C A C T T G " , which may be involved in transcription initiation, is designated by two heavy arrows pointing in the same direction. The 3' end of the B800-850 m R N A maps near a palindromic sequence that is indicated by two arrows pointing towards each other. The last four codons of the pucA gene are underlined. f CCCGACTTTACACTTGATCGCCGACACTTGGGCTCCCATAGTGCGTCTCACGAGGTCGGATCACAGACGG CCGGCTCAGTAATCTGCTGACCTTTGGGCCCACCGGCACCCGTCGGTCGGCATTCCCTCCGG 46 T h e 3" terminus of the puc transcript is in the region of a potential stem-loop structure (Fig. 10) which has been shown to serve as a transcriptional terminator (13). When R. capsulatus cultures were grown photosynthetically, four times as much puc m R N A was found in cells grown with high light as in cells grown with low light illumination. The steady state levels of m R N A s depend on both the rates of transcription and m R N A decay. In this study the puc m R N A s isolated from cells grown with high light illumination had a half-life of 10 min. whereas the same transcripts found in low light grown R. capsulatus cells had a half-life of 19 min. (Fig. 8). As the puc m R N A s isolated from high light grown R. capsulatus were degraded more rapidly yet were present at greater steady state amounts than in low light grown cells, the frequencies of transcription initiation must be greater in cells exposed to saturating light intensity. The puc-lac transcriptional fusions also showed that there was more transcription initiation in cells grown in high light intensity. In spite of this difference in the amount of puc m R N A s per cell, low light grown cells were found to contain four times as many B800-850 complexes. In some systems regulation of expression of cotranscribed genes is a result of segmental differences in stability of the transcript. For example, the ten to one stoichiometry of the B870 to reaction centre complexes in R. capsulatus is determined primarily by the different stabilities of segments of the polycistronic m R N A encoding the genes (6). The 2.7 kb puf primary transcript contains the puf A and pufB genes (B870 peptides) as well as the pufL and pufM structural genes (reaction centre peptides). The segment of the transcript which encodes the pufAB structural genes is approximately ten times 4 7 more stable than the pufML segment. As a result of this difference in half-life the fragment of m R N A encoding the pufA and pufB genes is ten times more abundant than the pufML fragment. The steady state levels of the puc m R N A were initially measured using a probe specific for the pucB gene (Fig. 5). Therefore it could only be said that the segment of m R N A encoding the pucB structural gene was more abundant in cells grown in saturating light intensity than in cells cultured with growth rate limiting light intensity. Subsequently the relative amount of the 3' end of the puc messages was measured by densitometric scans of the autoradiogram of the 3' end mapping experiments (Fig. 7B), in which the probe used was specific for the pucA structural gene. The scans of the 3' end mapping experiments showed that the high light : low light ratio of puc m R N A in 5 ug of R N A is approximately 1.1 : 1.0 which is close to the ratio of 1.4 : 1.0 found with the 5' probe. Therefore this demonstates that the entire puc transcript is more abundant in cells grown with high light intensity than low light intensity, and that there are no significant segmental differences in the half-life of the transcript. If it is assumed that the amounts of B800-850 peptides parallel the amounts of the m R N A s , then in high light grown cells there would have to exist a pool of these light harvesting peptides that had not yet bound bch a. It has been shown by Dierstein that the turnover rate of the B800-850 alpha peptide in a bch-less mutant strain of R. capsulatus , and in wild type cells exposed to inhibitors of bch a synthesis, is much greater than in untreated wild type cells (15, 16). Therefore in the presence of bch a the B800-850 peptides may be protected from degradation, perhaps because the apopeptides exist in a protease-sensitive conformation that changes to a protease-resistant conformation after binding bch a(15, 16). I have found that cells grown with saturating light 48 intensity have the capacity to produce four fold more B800-850 peptides than cells grown with low light illumination (due to the higher levels of puc m R N A ) . However, since less bch a is produced in high light grown R capsulatus, more of the newly translated peptides would be turned over as they would be unable to bind bch a molecules. No free bch a is detected in normal cells of photosynthetic bacteria, so the ratio of pigment-binding peptides to bch a must be equal to or greater than 1. It has been well established that the total bch a content of anaerobically grown R capsulatus increases as the light intensity decreases (2, 7, 20, 27, 37) ; therefore when cells are shifted from a high to a low light environment more bch a is produced, which could bind to pre-existent components of a B800-850 apopeptide pool. These protein-pigment complexes would be more resistant to proteolytic degradation and could then function in light absorption. However, it is also possible that there was control of translation of puc m R N A s , so that translation would be less efficient in cells grown with high light intensity. The lacZ translational fusions gave some evidence that translation was more efficient in cells grown with low light illumination. However since there are four fold more B800-850 complexes in cells grown with low light illumination but only one-quarter the amount of puc m R N A as cells grown with high light intensity one would expect translation to be sixteen times more efficient in cells grown with low light intensity. But only a three to four fold increase in translation efficiency was detected by the lacZ translational fusion which implies that expression of the puc genes may also be regulated posttranslationally. Regulation may occur at the level of bch a synthesis, bch a binding or insertion of the mature B800-850 complexes into the R capsulatus 49 membrane. Additional experiments would be necessary to better distinguish between translational and posttranslational regulatory mechanisms. It should be noted that with either model the amount of B800-850 complexes in the membranes of anaerobically grown R. capsulatus is limited by the availability of bch a. The regulation of bch a biosynthesis by light also seems to be largely posttranscriptional (7). It has been found that cells grown in darkness with high aeration contained significant levels of B870 and reaction centre peptide mRNAs although the cells did not absorb in the 800-900 nm range (6; and unpublished observations), since Dierstein has shown that the reaction centre L peptide, although more rapidly degraded in the absence than in the presence of bch a, can be immunologically detected in cells in the absence of bch a (15). Therefore it seems that a translational or posttranslational mechanism may be significant for both oxygen and light regulation of biogenesis of other photosynthetic complexes in R. capsulatus, as a supplement to the previously described transcriptional and posttranscriptional control processes (6, 14, 26, 46, 47). An advantage of this sort of posttranscriptional regulation might be that it would allow a very rapid increase in light harvesting capability, because the rate of that increase would be limited by the catalytic activity of the enzymes in the bch a biosynthetic pathway, and would not require de novo initiation of transcription of genes encoding pigment-binding peptides. 50 REFERENCES 1. Adams, C . W., and G . W. Hatfield. 1984. Effects of promoter strengths and growth conditions on copy number of transcription-fusion vectors. J . Biol. C h e m . 259 :7399-7403. 2. Aiking, H., and G . Sojka. 1979. Response of Rhodopseudomonas capsulata to illumination and growth rate in a light-limited continuous culture. J . Bacter io l . 139 :530-536 . 3 . Balke, V. L , and J . D. Gralla. 1987. Changes in the linking number of supercoiled DNA accompany growth transitions in Escherichia coli. J . Bacteriol . 169 : 4 4 9 9 - 4 5 0 6 . 4 . Bauer, C . E., M. Eleuterio, D. A. Young, and B. L. Marrs. 1987. Analysis of transcription through the Rhodobacter capsulatus puf operon using a translational fusion of pufMXo the E. coli lacZ gene. p. 669-705. J . Biggens (ed.). Progress in Photosynthetic Research. Vol. IV. Martinus Nijhoff Publishers, Dordrecht-Netherlands. 5 . Beatty, J . T., C . W. Adams, and S. N. Cohen. 1986. Regulation of expression of the rxcA operon of Rhodopseudomonas capsulata. p. 27-29. D. C . Youvan and F. Daldal (ed.). Current Communications in Molecular Biology (Cold Spring Harbor): Microbial Energy Transduction: Genetics, Structure, and Function of Membrane Proteins. 6 . Belasco, J . G. , J . T. Beatty, C . W. Adams, A. von Gabain, and S. N. Cohen.1985. Differential expression of photosynthesis genes in R. capsulatus results from segmental differences in stability within the polycistronic rxcA transcript. Cel l . 40 :171-181. 7 . Biel, A. J . 1986. Control of bacteriochlorophyll accumulation by light in Rhodobacter capsulatus. J . Bacteriol. 168:655-659. 51 8. Borowiec, J . , A., and Gralla, J . , D. 1987. All three elements of the / a c p s promoter mediate its transcriptional response to D N A supercoiling. J . Mol. Biol. 1 9 5 : 8 9 - 9 7 . 9 . Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of D N A in Escherichia coli. J . Mol. Biol. 4 1 : 459 1 0 . Brent, R, and M. Ptashne. 1980. The lexA gene product represses its own promoter. Proc. Natl. A c a d . Sc i . U S A . 7 7 : 1 9 3 2 - 1 9 3 6 . 1 1 . Casadaban, M. J . , and S. N. Cohen. 1980. Analysis of gene control signals by D N A fusion and cloning in Escherichia coli. J . Miol. Biol. 1 3 8 : 1 7 9 - 2 0 7 . 1 2 . Casadaban, M. J . , J . Chou, and S. N. Cohen. 1980. In vitro gene fusions that join an enzymatically active befa-galactosidase segment to amino-terminal fragments of exogenous proteins: Escherichia coli plasmid vectors for the detection and cloning of translational initiation signals. J . Bacteriol . 1 4 3 : 9 7 1 - 9 8 0 . 1 3 . Chen, C-Y. A., J . T. Beatty, S. N. Cohen, and J . G . Belasco. 1988. An intercistronic R N A stem-loop structure functions as a decay terminator necessary but insufficient for put m R N A stability. Cel l (in press). 1 4 . Clark, W. G . , E. Davidson, and B. L. Marrs. 1984. Variation of levels of m R N A coding for antenna and reaction center polypeptides in Rhodopseudomonas capsulata in response to changes in oxygen concentration. J . Bacteriol. 1 5 7 : 9 4 5 - 9 4 8 . 1 5 . Dierstein, R. 1983. Biosynthesis of pigment-protein complex polypeptides in bacteriochlorophyll-less mutant of Rhodopseudomonas capsulata Y S . F E B S . Lett. 1 6 0 : 2 8 1 - 2 8 6 . 1 6 . Dierstein, R. 1984. Synthesis of pigment-binding protein in toluene-treated Rhodopseudomonas capsulata and in cell-free systems. Eur. J . B i o c h e m . 1 3 8 : 5 0 9 - 5 1 8 . 52 1 7 . Ditta, G. , T. Schmidhauser, E. Yakobson, P. Lu, X.-W. Liang, D. R. Finlay, D. Guiney and D. R. Helinski. 1985. Plasmids related to the broad host range vector pRK290 useful for gene cloning and for monitoring gene expression. P lasmid. 13 :149-153. 1 8 . Drews, G. , J . Peters and R. Dierstein. 1983. Molecular organization and biosynthesis of pigment-protein complexes of Rhodopseudomonas capsulata. A n n . Microbiol.(Inst. Pasteur). 134b:151-158. 1 9 . Drews, G . 1985. Structure and functional organization of light-harvesting complexes and photochemical reaction centers in membranes of phototrophic bacteria. Microbiol. Rev. 49. 59-70. 2 0 . Drews, G . , and J . Oelze. 1981. Organization and differentiation of membranes of phototrophic bacteria, p.1-92. A . H. Rose and J . G . Morris (ed.). Advances in Microbial Physiology. Vol 22. Academic Press. 2 1 . Drews, G . 1986. Adaptation of the bacterial photosynthetic apparatus to different light intensities. Trends B iochem. Sc i . 11:255-257. 2 2 . Feick, R.. and G . Drews. 1978. Isolation and characterization of light harvesting bacteriochlorophyll-protein complexes from Rhodopseudomonas capsulata. Biochim. Biophys. Acta. 501:499-513. 2 3 . Imhoff J . F., H. G . Truper, and N. Pfennig. 1984. Rearrangement of the species and genera of the phototrophic "purple non-sulfur bacteria". Int. J . Syst. Bacteriol. 34 :340-343. 2 4 . Johnson, J . A., W. K. R. Wong, and J . T. Beatty. 1986. Expression of cellulase genes in Rhodobacter capsulatus by use of plasmid expression vectors. J . Bacteriol. 167:604-610. 2 5 . Klotsky, R-A. and I. Schwartz. 1987. Measurement of cat expression from growth rate-regulated promoters employing befa-lactamase activity as an indicator of plasmid copy number. G e n e . 55: 141-146. 53 2 6 . Klug, G . , N. Kaufmann, and G . Drews. 1985. Gene expression of pigment-binding proteins of the bacterial photosynthetic apparatus: Transcription and assembly in the membrane of Rhodopseudomonas capsulata . Proc. Natl. A c a d . Sc i . U S A . 82. 6485-6489. 2 7 . Lien, S., H. Gest, and A. San Pietro. 1973. Regulation of chlorophyll synthesis in photosynthetic bacteria. Bioenerg. 4 :423-434. 2 8 . Lowry, O. H., N. J . Rosebrough, A. L. Farr, and R. J . Randall. 1951. Protein measurement with the Folin phenol reagent. J . Biol. C h e m . 193:265-275. 2 9 . Maniatis, T., E. F. Fritsch, and J . Sambrook. 1982. Molecular cloning: a laboratory manual. Co ld Spring Harbour Laboratory, Co ld Spring Harbour, N.Y. 3 0 . Marrs, B. 1974. Genetic recombination in R. capsulata. Proc. Natl. Acad. Sci . U S A . 71:971-973. / 3 1 . Miller, J . H. (ed.). 1972. Experiments in molecular genetics, p. 352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 3 2 . Moss, B. 1981. 5' end labelling of R N A with capping and methylating enzymes, p.253-266. J . G . Chirikjian and T . S. Papas (ed.) Gene Amplification and Analysis, Vol . 2. Publishing Co. , Amsterdam. Elsevier-Holland. 3 3 . Okamura, M. Y., G . Feher and N. Nelson. 1982. Reaction centers, p.195-272. Govindjee (ed.). Photosynthesis: energy conversion by plants and bacteria. Vol 1. Academic Press. 3 4 - Sarmientos, P. and M. Cashe l . 1983. Carbon starvation and growth rate-dependent regulation of the Escherichia coli ribosomal R N A promoters: differential control of dual promoters. Proc. Natl. A c a d . Sc i . U S A . 8 0 : 7 0 1 0 - 7 0 1 3 . 3 5 . Sarmientos, P., J . E. Sylvester, S . Contente and M. Cashe l . 1983. Differential stringent control of the tandem E. coli ribosomal R N A promoters from the rrnA operon expressed in vivo in multicopy plasmids. Ce l l . 32:1337-1346. 54 3 6 . Schumacher, A., and G . Drews. 1978. The formation of bacteriochlorophyll-protein complexes of the photosynthetic apparatus of Rhodopseudomonas capsulata during early stages of development. Biochim. Biophys. Acta . 501 :183-194. 3 7 . Schumacher, A., and G . Drews. 1979. Effects of light intensity on membrane differentiation in Rhodopseudomonas capsulata. Biochim. Biophys. Acta. 547:417-42. 3 8 . Shiozawa, J . A., P. A. Cuendet, G . Drews, and H. Zuber. 1980. Isolation and characterization of the polypeptide components from light harvesting pigment-protein complex B800-850 of Rhodopseudomonas capsulata. Eur. J . B iochem. 1 1 1 :455-460 . 3 9 . Von Gabain, A., J . G . Belasco, J . L. Schottel, A. C . Y. Chang, and S. N. Cohen. 1983. Decay of m R N A in Escherichia coli: investigation of the fate of specific segments of transcripts. Proc. Natl. Acad . Sc i . U S A . 80:653-657. 4 0 . Weaver, P. F., J . D. Wall, and H. Gest. 1975. Characterization of Rhodopseudomonas capsulata . Arch. Microbiol. 105:207-216. 4 1 . Wong, E. M., M. A. Muesing, and B. Polinsky. 1982. Temperature-sensitive copy number mutants of ColE1 are located in an untranslated region of the plasmid genome. Proc. Natl. Acad . Sc i . U S A . 79:3570-3574. 4 2 . Yanisch-Perron, C , J . Vieira, and J . Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of M13 and p U C vectors. G e n e . 33:103-119. 4 3 . Youvan, D. C , E. J . Bylina, M. Alberti, H. Begusch, and J . E. Hearst. 1984. Nucleotide and deduced polypeptide sequences of the photosynthetic reaction-center, B870 antenna, and flanking polypeptides from R. capsulata. Cel l . 37:949-957. 4 4 . Youvan, D. C , and S . Ismail. 1985. Light harvesting II (B800-850 complex) structural genes from Rhodopseudomonas capsulata . Proc. Natl. Acad . Sc i . U S A . 82:58-62. 55 4 5 . Youvan, D. C , S. Ismail, and E. J . Bylina. 1985. Chromosomal deletion and plasmid complementation of the photosynthetic reaction center and light harvesting genes from Rhodopseudomonas capsulata . Gene . 38:19-30. 4 6 . Zhu, Y. S., D. N. Cook, F. Leach, G . A. Armstrong, M. Alberti, and J . E. Hearst. 1986. Oxygen-regulated m R N A s for light harvesting and reaction center complexes and for bacteriochlorophyll and carotenoid biosynthesis in Rhodobacter capsulatus during the shift from anaerobic to aerobic growth. J . Bacteriol. 168:1 1 8 0 - 1 1 8 8 . 4 7 . Zhu, Y. S., and J . E. Hearst. 1986. Regulation of expression of genes for light-harvesting antenna proteins LH-I and LH-II; reaction center polypeptides RC-L , R C - M and R C - H ; and enzymes of bacteriochloriophyll and carotenoid biosynthesis in Rhodobacter capsulatus by light and oxygen. Proc. Natl. A c a d . Sc i . U.S.A. 83:7613-7617. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097821/manifest

Comment

Related Items