Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The molecular cloning and characterization of a Beta-glucosidase gene from an Agrobacterium Wakarchuk, Warren William 1987

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1987_A1 W34.pdf [ 6.94MB ]
Metadata
JSON: 831-1.0097515.json
JSON-LD: 831-1.0097515-ld.json
RDF/XML (Pretty): 831-1.0097515-rdf.xml
RDF/JSON: 831-1.0097515-rdf.json
Turtle: 831-1.0097515-turtle.txt
N-Triples: 831-1.0097515-rdf-ntriples.txt
Original Record: 831-1.0097515-source.json
Full Text
831-1.0097515-fulltext.txt
Citation
831-1.0097515.ris

Full Text

THE MOLECULAR CLONING AND CHARACTERIZATION OF A ft-GLUCOSIDASE GENE FROM AN AGROBACTERIUM by WARREN WILLIAM WAKARCHUK Sc., The U n i v e r s i t y of B r i t i s h Columbia, 1984 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE  REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY In  THE FACULTY OF GRADUATE STUDIES (Department of M i c r o b i o l o g y ) We accept t h i s t h e s i s as conforming to the d e s i r e d standard  THE UNIVERSITY OF BRITISH COLUMBIA March -©  1987  Warren W i l l i a m Wakarchuk, 1987  In  presenting  degree  this  at the  freely available copying  of  department publication  of  in  partial  fulfilment  University of  British  Columbia,  for reference and study.  this or  thesis  thesis by  this  for scholarly  his thesis  or  her  the  I agree  I further agree  purposes  may be  representatives.  It  is  requirements  for  an  Department The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3  advanced  that the Library shall make it that permission granted  for extensive  by the head  understood  that  for financial gain shall not be allowed without  permission.  DE-6(3/81)  of  of  my  copying  or  my written  i i  ABSTRACT The <l-gl ucos Idase (Abg) from ATCC 21400, an Aarobacterlure s p e c i e s , was p u r i f i e d to homogeneity. The p r o t e i n was cleaved with cyanogen bromide and the peptides were p u r i f i e d by reversed phase high pressure l i q u i d chromatography. The p a r t i a l amlno-acid sequences for three CNBr peptides, CNBrl, CNBr2 and CNBr3, were determined by automated Edman degradation. A sequence from CNBr2 was used to synthesize a mixture of o l i g o n u c l e o t i d e s which was used as a h y b r i d i z a t i o n probe to i d e n t i f y a recombinant DNA clone c a r r y i n g the gene for fl-glucosidase. A s i n g l e clone was i s o l a t e d which expressed an enzymatic a c t i v i t y that hydrolyzed several <l-glucos ides. The enzymatic a c t i v i t y produced by t h i s clone could be adsorbed by r a b b i t antiserum r a i s e d against the Aarobacterium enzvme. The d i r e c t i o n of t r a n s c r i p t i o n of the <J-gl ucos idase gene was determined by v e r i f y i n g the DNA sequence 3'- to the o l i g o n u c l e o t i d e probe binding s i t e . After subcloning the gene a high l e v e l of expression was obtained In the plasmid vector pUC18 using the lacZ gene promoter. The nucleotide sequence of the 1599 bp i n s e r t in pABG5 was determined using the chain terminator method. The s t a r t of the p r o t e i n coding region was determined by a l i g n i n g the amino terminal sequence of the p r o t e i n with the predicted amino a c i d sequence of the cloned gene. The open reading frame was 1387 nucleotides and contained 458 codons. The molecular weight c a l c u l a t e d from the deduced amino a c i d sequence agreed with that observed from both the native and recombinant enzymes. The p r e d i c t e d amino a c i d composition from the open reading frame matched with that determined for the native 0 - g l u c o s i d a s e . The stop codon of t h i s coding region was followed by a p o t e n t i a l stem loop structure which may be the t r a n s c r i p t i o n a l terminator. There was a region of the deduced Abg sequence which had homology to a region from two other jl-gl ucos idase sequences. This region of homology contained a putative a c t i v e s i t e by analogy with the a c t i v e s i t e of hen egg white lysozyme.  i ii  TABLE OF CONTENTS Page INTRODUCTION I Background A) C e l l u l a s e B) Measurement of fl-glucosidase a c t i v i t y II P r o p e r t i e s of A-glucosidase A) K i n e t i c properties B) The r o l e of fl-glucosidase l n c e l l u l o s e h y d r o l y s i s I I I A p p l i c a t i o n of molecular b i o l o g y to the study of fl-glucosidase A) Approaches to the genetic improvement of fl-glucosidase B) The molecular c l o n i n g of fl-glucosIdase MATERIALS AND METHODS I II III IV  B a c t e r i a l s t r a i n s , plasmids and phages Preparation of 0-glucosidase Enzymatic assays and p r o t e i n determination Peptide production, p u r i f i c a t i o n and sequencing A) Cyanogen bromide cleavage of the 0-glucosidase B) Reversed phase chromatography C) Sequence determination of the peptides and amino a c i d a n a l y s i s of the p r o t e i n V DNA methodology A) DNA I s o l a t i o n and a n a l y s i s B) O l i g o n u c l e o t i d e synthesis and p u r i f i c a t i o n C> Construction and d e t e c t i o n of recombinant DNA clones D) DNA sequencing VI Polyacrylamide gel e l e c t r o p h o r e s i s and (J-gl ucos idase a c t i v i t y s t a i n i n g VII Immunodetection and immunoadsorption of fl-glucosIdase  1 1 1 2 2 2 6 7 7 9 14 14 14 16 17 17 17 18 18 18 19 19 20 20 22  iv  VIII Induction of fl-glucosidase expression in s t r a i n s e a r r i n g recombinant pUC plasmids IX M a t e r i a l s  22  RESULTS AND DISCUSSION  24  I P u r i f i c a t i o n of fl-glucosidase II P u r i f i c a t i o n and amino a c i d sequence determination of peptides generated by CNBr cleavage I I I Cloning strategy IV C h a r a c t e r i z a t i o n of the cloned fl-glucosidase gene A) Determination of the i d e n t i t y of the recombinant p r o t e i n with the native fl-glucosidase B) Subcloning the abg gene C) Determination of the d i r e c t i o n of t r a n s c r i p t i o n of the abg gene V Increased expression of the ft-glucosidase gene VI DNA sequence of the abg gene A) The determination of the DNA sequence B) The a n a l y s i s of the sequence 1) T r a n s c r i p t i o n a l and t r a n s l a t i o n a l c o n t r o l s ignals 2) The s t r u c t u r e of the abg gene product a) General features of Abg b) Comparisons of the Abg sequence with other fl-glucosidase sequences 3) Codon usage of the abg gene LITERATURE CITED  23  24 24 35 38 38 42 46 47 48 48 51 51 51 51 56 61 62  V  LIST OF TABLES Table  Page  I P r o p e r t i e s of v a r i o u s c e l l o b i a s e s  4  II Summary of cloned f3-gl ucos idase genes III B a c t e r i a l  strains,  plasmids  IV P u r i f i c a t i o n of c e l l o b i a s e  and  10  phages  15  from ATCC 21400  V ft-gl ucos idase a c t i v i t y in v a r i o u s E..  25  c o l i c l o n e s and  39  In Agrofract-erlym VI Comparison of the amino a c i d composition fl-glucosIdase  protein  of the  with the composition  55  deduced  from the abg gene VII Codon u t i l i z a t i o n of the abg gene  61  vl  LIST OF FIGURES Figure 1. Structure of some common fl-glucosides 2. SDS-PAGE a n a l y s i s of samples obtained during the p u r i f i c a t i o n of fl-glucosidase 3. DEAE-Sephacel e l u t i o n p r o f i l e of fl-glucosidase 4. E l u t i o n p r o f i l e of fl-glucosidase from a second DEAE-Sephacel column 5. Biogel-P-300 chromatography of the ft-glucosldase a c t i v i t y peak from DEAE-Sephacel 6. FPLC anion exchange (MonoQ) chromatography of the a c t i v i t y peak from Biogel-P-300 7. SDS-Urea-PAGE a n a l y s i s of CNBr peptides from fl-glucosidase 8. FPLC separation of the CNBr peptides from ATCC 21400 j l - g l ucos Idase 9. Amino a c i d sequences of the CNBr peptides from the fl-glucosidase, and the predicted sequence of those peptides as deduced from the DNA sequence 10. The amino terminal sequence of CNBr2 and the region used to synthesize the o l i g o n u c l e o t i d e probes 11. Southern b l o t a n a l y s i s of genomic DNA from Aarobacterium and E s c h e r i c h i a c o l 1 12. Western b l o t a n a l y s i s of (J-glucosidase samples using r a b b i t antiserum r a i s e d to the p u r i f i e d p r o t e i n 13. Immunoadsorption of fi.. c o l l encoded fl-glucosIdase by a n t i s e r a r a i s e d against the Aarobacterlum fl-glucosidase 14. Detection of (5-gl ucos idase a c t i v i t y a f t e r SDS-PAGE 15. Southern b l o t a n a l y s i s of pABGl 16. Linear representation of various ff-glucosidase encoding plasmids 17. Exonuclease I I I d i g e s t i o n of pABG4F 18. SDS-PAGE a n a l y s i s of whole c e l l e x t r a c t s from EL* c o l 1 clones c o n t a i n i n g various fl-glucosidase encoding plasmids  Page 3 26 27 28 29 30 32 33 34  36 37 40 41  43 44 45 47 49  vi i  19. S e q u e n c i n g s t r a t e g y 20. N u c l e i c  a c i d s e q u e n c e and  sequence o f the 21.  Nucleic region  f o r t h e a b a gene d e d u c e d amino a c i d  52  fl-glucosidase  a c i d sequence homology with  50  o f t h e 5' f l a n k i n g  53  known p r o m o t e r s e q u e n c e s  22. R e g i o n s o f amino a c i d h o m o l o g y amino a c i d s e q u e n c e s o f t h e  i n the deduced fl-glucosidases  57  from  Aqroba,cterlu,m. ( A b g ) , §.. commune ( S c b ) a n d C_. p e l l i c u l o s a 23.  The h o m o l o g y active  site  (Cpb)  of various  fl-glucanases  p r o p o s e d by a n a l o g y w i t h  at a p u t a t i v e lysozyme  58  viii  ACKNOWLEDGEMENTS  I would  like  t o t h a n k D r s . R.A.J. Warren, R.C. M i l l e r ,  Jr.,  a n d D.G. K i l b u r n  this  work.  Also,  discussions. Withers  f o r t h e i r guidance  and s u p p o r t  I wish t o thank D r . J . T . B e a t t y  I would  like  f o r information  on t h e FPLC p u r i f i c a t i o n o f t h e  peptide  s e q u e n c i n g , a n d D r . D . J . M Kay  protein  s e q u e n c e a n d amino a c i d a n a l y s i s , a l s o  c  synthesis  purification.  f o r the N-terminal  f o r Helpful  f o r technical assistance  C e l l u l a s e Group This  Smith  I would a l s o  D r . Tom  like  discussions  probes and f i n a l l y during  Blair  the protein  t o t h a n k a l l t h e members o f  f o r t h e i r support  when I needed i t .  work was s u p p o r t e d by a n NSERC s t r a t e g i c g r a n t G1726  t o D.G.K, R.C.M, a n d R.A.J.W a n d a P I L P g r a n t and  f o r the  f o r the o l i g o n u c l e o t i d e  t h e use o f o l i g o n u c l e o t i d e  Heffelflnger  the  Skipper  and Dr. M i c h a e l  concerning  for helpful  t o thank A n t h o n y Day and S t e v e  enzyme, Ms. Sandy K i e l l a n d a n d D r . R o b e r t O l a f s o n  A t k i n s o n and Dr. N i g e l  during  R.A.J.W a n d A l l e l i x I n c .  t o D.G.K, R.C.M,  LIST OF ABBREVIATIONS aa,  Amino a c i d ( s )  abg.  Gene encoding  Abg,  The  ACN,  Acetonltrile  Ap,  Ampicillin  BCIP,  5-bromo-4-chloro-3-indolyl-phosphate  bp,  Base p a i r ( s )  cob.  Gene encoding  Cpb,  The  dA,  Deoxyadenosine  dC,  Deoxycytosine  dG,  Deoxyguanosine  dT,  Deoxythymidine  DEAE,  Diethylaminoethyl  FPLC,  Pharmacia Fast P r o t e i n L i q u i d Chromatography system  IPTG,  I s o p r o p y l - f t - D - t h i o g a l a c t o s ide  Kb,  1000  lacZ,  E. c o l i  LacZ*,  The  the Agrobacter1um  p r o t e i n encoded by  fl-glucosidase  abg  the CandIda pel 1 i c u l o s a  p r o t e i n encoded by  ft-glucosidase  cob  anion exchange r e s i n  base p a i r s fi-galactosidase  first  gene  78 amino a c i d s of  fl-galactosidase  including  the operator and promoter r e g i o n s of the gene. LB,  L u r i a broth  MCS,  Multiple cloning site  MOI,  Multiplicity  of  infection  MUG,  4-methylumbel1iferyl-fl-D-glucoside  nt,  Nucleotide  PAGE,  Polyacrylamide  PNP,  p-nitrophenol  PNPG,  p-n i trophenyl-ft-D-glucos ide  gel e l e c t r o p h o r e s i s  PNPGase,p-n i trophenyl-fl-D-glucos idase PTH,  Phenylthiohydantoin  scb,  Gene encoding  the Sch1zophvl1um commune  Scb,  The  SDS,  Sodium dodecyl  ss,  Single  SSC,  Standard  TFA,  Trifluoroacetic  p r o t e i n encoded by sulfate  stranded saline  citrate acid  scb  fl-glucosidase  X  X-gal,  5-bromo-4-chloro-3-indolyl-ft-D-galactos ide  X-glc,  5-bromo-4-chloro-3-indolyl-ff-D-glucos ide  1  INTRODUCTION  I  Background A)  Cellulase enzyme 0 - g l u c o s l d a s e  The E.C.  3.2.1.21) i s a component  many c e l l u l o l y t l c This  type  and  microorganisms variety  forms  (Schiemann,  1983).  implicated Cellulose  found  in multiple  considers  1982;  only  in a variety  i n the h y d r o l y s i s  and  1985;  Enari,  are c e l l o b i o s e  fi-glucosidase  and  1981).  the  1983;  main p r o d u c t s o f the a c t i o n  exoglucanases.  glucose  exoglucanases  and  of  as  the r a t e  Although  cellobiose,  the h y d r o l y s i s  fl-glucosidase cellulose  may  ( Shewale,  transglycosylation  be  one  the  are  important of  molecules  which are c a p a b l e  of  cellulase  complex  (Coughlan,  cellobiose the  t h e n be  thought of  on by  i n the s a c c h a r i f l c a t i o n o f the  fl-glucosidase inducing  1985).  of  hydrolysis  most a c t i v e  Furthermore,  activity  endo-  role  i n h i b i t i o n of  of h i g h e r e e l l o d e x t r i n s  1982).  et a l . ,  f o r the s a c c h a r I f l c a t i o n  cellobiases  also  and  i s to c o n v e r t  stimulating  l i m i t i n g enzyme  cellulose.  that  0-glucosidase could  ( S t e r n b e r g e t a l . , 1977).  Mandels,  i n h i b i t s the  thought  in c e l l u l o s e h y d r o l y s i s  and  (Streamer  Cellobiose  It is generally  of  fl-glucosidases  of endo-  to g l u c o s e , t h e r e b y r e l i e v i n g endproduct e n d o - and  involved  exo-1,4-0-glucanases  (endoglucanase),  McCrae,  either  I n v o l v e s the s y n e r g i s t i c a c t i o n  (Coughlan,  Wood and  This  of c e l l u l o s e .  (eellobiases)  1975;  of  fl-glucosidases  o r c e 1 l o b i o h y d r o l a s e ) and  exoglucanases  1983).  Many o f them h y d r o l y z e a  those  hydrolysis  of  in non-cellulolytlc  (exoglucanase The  Schiemann,  including aryl-fl-D-glucosides.  endo-1,4-(!-glucanases  1982).  glucohydrolase  o f the c e l l u l a s e complexes  (Shewale,  is also  of s u b s t r a t e s ,  discussion or  organisms  o f enzyme  organisms,  in  (fl-D-glucosIde  could  synthesis  generate of  the  2  B)  Measurement o f Multiple  fl-glucosidase  both c e l l u l o l y t i c Schiemann,  fl-glucosIdase  1983;  fungi  of  of  vary g r e a t l y  moiety  celloblases  (Shewale,  separable  into  1982).  the  usually  true  aryl-  a relatively  celloblases  quite the  and  active  (Table  I).  of  e a s e and  the  on  This  substrates  low  sensitive glucose  nature  which are The  highly  many  of  the  assay  m e a s u r i n g the  Kinetic  p-nltrophenolate  involves  a  two  glucose  which and  cellobiose groups  anion The  is  cellobiose activity  because  hydrolysis The  of  high et  makes t h i s a  determination  step assay (glucose  and  are  ml/pmol/cm, S t o p p o c k  for 0-glucosidase.  of  utilizing  of  an  oxidase  or  hexokinase/  i s not  as  sensitive  fl-glucosidases  properties  In e x a m i n i n g on  the  that  celloblase  synergy of  synergy  enzyme w h i c h must be cellobiose  are  tedious.  II P r o p e r t i e s  the  on  p-nltrophenyl-fl-D-glucoslde.  dehydrogenase) which  celloblase  aglycone  fl-glucosidases of  facilitate  glucose-6-phosphate  A)  rates  cellobiose;  can  of  i s more  on  active  enzymatic d e t e c t i o n and  the  t h e s e enzymes  and  f o r the  usually  substrate  d i s t i n c t i o n between the  sensitivity  assay  of  both aryl-fl-D-glucosides  s u c h as  1982)  the  1984;  broad, although  activity  m o l a r e x t i n c t i o n c o e f f i c i e n t (18.8 al.,  al.,  In  alkyl-fl-D-glucosides ( f i g .  a l w a y s c l e a r , however, b e c a u s e  highly  (Wakarchuk e t  Nonetheless,  on  higher e e l l o d e x t r i n s . not  f o u n d commonly  In g e n e r a l ,  are  with  are  broad groups: a r y l - 0 - D - g l u c o s l d a s e s  two  have h i g h a c t i v i t i e s 1) but  bacteria  1982).  specificities hydrolysis  activities  and  Shewale,  activity  c e l l u l a s e s and  there are  considered:  1)  ( t u r n o v e r number);  hydrolysis  saccharification  conditions  conditions;  celloblase  to endproduct  properties  of  3)  the  effect  properties  of  catalytic efficency  the  compatibility  (pH  and  temperature) with  the  s u s c e p t i b i l i t y of inhibition.  celloblases  of  the  2)  (glucose)  some r e l e v a n t  three  the  i s shown  A  list  of  of the  the of  in Table  the I.  F i g u r e 1. S t r u c t u r e of some common fl-glucosIdes• R=l,l-O-methyl-0-D-glucoside> R=2, C e l l o b i o s e ; R=3 4-n i trophenyl-fl-D-glucos ide» R=4, 4-methyl - umbel 11 feryl-(5-D-gl ucos ide  O7  0 4  4  Table I. P r o p e r t i e s of v a r i o u s c e l l o b l a s e s . Organism  Alternaria  Km  (a) alternate  (b)  Kt  (c)  pH Cd)  T«C (d)  reference  0.81  2.44  NA  4.5  70  5.63  33.7  3.0  4.5  60--70 Dtkktr, 1986  Asp^rfliMMs ph<?^niqM  0.75  164  NA  4.3  50  Sternberg *t a l . , 1977  Asoeraillus terrus  0.4  NA  3.5  4.8  50  Horktan and Day, 1982  A s o e r a i l l u s w e n t i i A=>  0.15  118  2.8  4.0  50  LegUr tt a l . , 1972,1980  Q«J«Jid«. p e l l i c u l a  37  NA  6.5  6.5  50  Kohchi tt a l . , 1983  Dekkera i n t e r m e d i a  55  NA  1.0  5.0  50  Blondin tt a l . , 1983  S c l e r o t i c r o l f s i i BQ3  5.84  175  NA  4.1  65  Shtwalt and Sadana, 1981  SDorotrichum  0.28  NA  NA  6.3  50  Heytr and Cantvascini, 1981  Talaromvces entersonii BQ1 0 . 5 8  96.2  NA  4.1  70  HeHale and Coughlan, 1981  B64 1.47  79.8  NA  5.7  35  HcHal* and Coughlan, 1981  Asoeraillus  niaer  thermoohile  Hacrii, 1984  Trichoderma k o n i n a i i A  1.18  NA  1.05 4 . 0  40-•50 Hood and HcCrae, 1982  B  0.86  NA  0.66 4.0  40-•50 Wood and HcCrat, 1982  1  2.65  66.2  NA  4.8  50  Gong tt a l . , 1977  2  2.5  116  NA  4.8  50  Song «t a l . , 1977  3  2.71  44.6  NA  4.8  50  Gong tt a l . , 1977  4  3.3  NA  NA  6.5  28  Inglin tt a l . , 1980  0.70  30.34  6.4  6.8  NA  Day and Hithtri, 1986  0.13  NA  6.0  NA  Mackenzie and Pattl, 1986  4.3  NA  NA  6.8  39  Groltau and Forsberg, 1981  C l o s t r i d i u m thermocellum  83  7.1  135  6.5  60  Ait tt a l . , 1982  Pseudomonas  5.89  NA  NA  7.0  30  Huang and Suzuki, 1976  26  NA  NA  6.5  30-•35 Ohiyma tt a l . , 1983  2.56  NA  NA  7.0  40  Holdovtanu and Klutpftl, 1983  f l a v o a r i s e u s 8.05  NA  NA  6.5  40  Hoidovejnu and Klutpftl, 1983  Trichoderma reesei  A a r o b a c t e r i u m ATCC21400 Bacteroides  o o l v a r a a m a t u s 100  Bacteroides  succinoaenes  Ru,minocpccus  fluorescens albus  StreDtomvces CB-12 Streotomvces a) b) c) d) e)  mM c e l l o b i o s e umol/min/mg p r o t e i n w i t h c e l l o b i o s e as s u b s t r a t e mM g l u c o s e optimum v a l u e s NA, not a v a i l a b l e  5  From T a b l e  I  It can  are q u i t e v a r i e d .  Since  characterized  bacterial  than  be  seen  many more f u n g a l enzymes have enzymes,  compare t h e  enzymes a s g r o u p s ,  ftSP^rqUlMS  P h o b i c IS  the  most a c t i v e  bacterial  high a f f i n i t y  and  but  listed,  so  o n l y the  for cellobiose.  compatible et  with with  Trichoderma the  a l . , 1977). The  on  not  been  The obtain  The  to endproduct  reese1  cellulase,  of the  of c e l l o b i a s e t h i s enzyme  inhibition  a s an  by  glucose  (Dekker,  is required. by g l u c o s e ,  i n h i b i t i o n constant  reduced  Ki v a l u e s c a n  by  50%.  The  t h e enzymes l i s t e d  i n Table  sensitive  to g l u c o s e  sensitive  Is from  h i g h compared  Km  that  I.  i s from of  i t has  glucose  From the d a t a  (Dekker,  i n Table  in their  e x c e p t i o n o f the A l t e r n a r i a celloblases,  yet  rate  f o r some of i s most least  However,  i t must  cellobiase  i s very  i t i s not The  Ki  i t is claimed  i n the p r e s e n c e  I i t is clear  that  f o r the  that o f up  this to  celloblases  In g e n e r a l , the  very a c t i v e alternata  celloblases  on c e l l o b i o s e  with  enzyme w h i c h has  V .»  for a  from  Candjfla, P g U l c q l o s a , and  m  is defined  1986).  activities.  f u n g i are  the  is often  the  so  to  high r e s i s t a n c e  enzyme w h i c h  a h i g h Ki f o r g l u c o s e .  i s o n l y 3 mM,  In o r d e r  compared  the C_. t h e r m o c e l 1 um  0.83  low  be  J_. k o n l n a i i and  hydrolyzes cellobiose  unusally  the  very  a t w h i c h the r e a c t i o n  The  enzyme s t i l l  filamentous  1986).  This value  t o many o f the c e l l o b l a s e s ,  A_. n i a e r c e l l o b i a s e  from  are  cellulase  is also a  C l o s t r i d i u m , t h e r m o c e l lum.  t h a t the  vary widely  both  When e x a m i n i n g  Ki.  is  (15%)  a  Aspergillus  and  the e f f e c t  inhibitor  M  enzyme has  J_. r e e s e l  production a r e l a t i v e l y  of c e l l o b i a s e  unexpected  the  o t h e r enzymes w i t h  with  the c o n c e n t r a t i o n o f  noted  Of  are  sacchariflcation  as  be  enzymes  examined.  maximum g l u c o s e  expressed  to  b a s i s the  A_. p h o e n l c l s and in  compatibility  property of  inhibition  BG3  been  reported h y d r o l y s i s conditions (Sternberg  inhibition  important  individual  Aarobacterium  v a r i o u s h y d r o l y s i s c o n d i t i o n s used has  an  far described.  n i a e r enzymes have b e e n examined experiments  i t is d i f f i c u l t  Sclerotlum r o l f s l l  celloblases  enzymes  t h a t the k i n e t i c p r o p e r t i e s  fungal c e l l o b i a s e .  The  two  Dekkera  the  an  yeast Intermedia.  6  have a much lower a c t i v i t y on c e l l o b i o s e from the  other f u n g i , and  compared to those  they appear s i m i l a r to the  bacterial  enzymes. It should a l s o be between fungal are  secreted  and  bacterial cellobiases  enzymes whereas the  associated.  This  i s a very  enzymes; i f they are secreted  enzyme  The  to be  difference  i s that  l a t t e r are  important property of  variation  former  these  p u r i f i e d f o r i n d u s t r i a l use  Is o b v i o u s l y more  than the  the  always c e l l  fungal  a  desirable.  b a c t e r i a l c e l l o b i a s e s have been l e s s  characterized large  mentioned t h a t a major  enzymes.  well  Again, there  is a  in a c t i v i t y on c e l l o b i o s e , s i m i l a r to  range seen with the  fungal  enzymes; however, the  enzymes o v e r a l l have much h i g h e r K for  the  b a c t e r i a l enzymes are  for  the  fungal  enzymes.  The  enzyme which k i n e t i c a l l y  values.  m  The  the  bacterial Vm.*  values  much lower than those r e p o r t e d exception  i s the Agrobacter i um  is very s i m i l a r to the  A.  niger  ce11ob i a s e . B) The The  r o l e of addition  hydrolysis  fl-glucosidase  of p u r i f i e d c e l l o b i a s e  reactions  stimulates  Using T. reese i c e l l u l a s e and fold stimulation addition  ln c e l l u l o s e  cellulose saccharification.  a X-  reese i c e l l o b i a s e a  (Berghem and  With Trlchoderma k o n i n a i i c e l l u l a s e and of c e l l o b i a s e and total hydrolysis  cellobiohydrolase compared to 32%  alone ( H a l l l w e l l and  Griffin,  with c e l l o b i o h y d r o l a s e of h y d r o l y s i s together.  and  the  cellobiase  with c e l l o b i o h y d r o l a s e  cellulase a stimulation  by c e l l o b i a s e  1974).  of  l e v e l of  was  equal to the  the  hydrolysis level  endoglucanase  using X* was  action  cellobiohydrolase  The and  the  kon i n g l i  a l s o demonstrated;  major s y n e r g i s t i c components from t h i s study were  cellobiohydrolase  and  the  endoglucanase (Wood and  1982).  The  e x t e n t of h y d r o l y s i s  was  the  same and  not  Pettersson,  c e l l o b i a s e , the  f o r the  1978).  two  noted with  accounts f o r 63%  From a separate study a l s o  however, the  to enzymatic  of exoglucanase a c t i v i t y was  of excess c e l l o b i a s e  hydrolysis  the  measured in these two  McCrae, studies  d i f f e r e n t r e s u l t s from c e l l o b i a s e  7  stimulation  are l i k e l y  enzymes c o n t a i n e d assay  techniques  likely  also  cellulase of  In t h e h y d r o l y s i s used  contributed  t o the v a r i a t i o n  cellulose hydrolysis  The d i f f e r e n t  In r e s u l t s .  from £.. t h e r m o c e l l u m . a by t h e a d d i t i o n  ( A i t e t a l . , 1982).  approximately  reactions.  f o r the determination of h y d r o l y s i s  and c e l l o b i a s e  described was  due t o d i f f e r e n t l e v e l s o f t h e v a r i o u s  two f o l d  that  stimulation  o f c e l l o b i a s e was a l s o  In t h i s study  over  With the  the s t i m u l a t i o n  obtained with c e l l u l a s e  alone. The practical  saccharIflcatIon  1982); however, X* activity of  o f X*  c e l l u l a s e system reesel  (Sternberg  supplementing  of c e l l u l o s i c cellulase  e t a l . , 1977).  materials  from a n o t h e r .  cellobiase  t o a X*  i n a 50% r e d u c t i o n  This  has l e d t o t h e i d e a  The a d d i t i o n  viridae  (reese i ) s a c c h a r i f i c a t i o n r e s u l t e d  i n the time  (Sternberg  taken  to reach  e t a l . , 1977).  i n the t o t a l  p r o d u c e d a 60% i n c r e a s e  ( D e s r o c h e r s e t a l . , 1981).  impossible;  however,  glucose  to note  makes a d i r e c t c o m p a r i s o n  i t Is c l e a r t h a t  e v e n under  conditions  cellobiase  on t h e s a c c h a r I f i c a t i o n o f c e l l u l o s e .  Application  there  released  t h a t In  of c e l l u l o s i c  hydrolysis  Ill  hydrolysis  mentioned, the a s s a y  amounts o f enzyme a n d t y p e This  reesel  I t i s Important  of the synergy experiments  t h e maximum  The a d d i t i o n o f  reaction  were n o t t h e same.  with  o f A., p h o e n l c i s  t o a X-  conditions,  (Mandels,  is deficient in cellobiase  S c h U o p h y U v m commune c e l l o b i a s e  all  f o r the  c e l l u l a s e s p r o d u c e d by one o r g a n i s m  cellobiase  sugar r e l e a s e d  r e e s i has p o t e n t i a l  substrate  of r e s u l t s  varied  i s a s i g n i f i c a n t e f f e c t of  of molecular biology  t o the study o f  fl-glucosidase A)  Approaches t o the g e n e t i c  In function The  the past  few y e a r s  improvement o f  the study  has been f a c i l i t a t e d  by r e c o m b i n a n t  a p p l i c a t i o n of t h i s technology  allowed study  the s e p a r a t i o n  of p r o t e i n  of multiple  i n d i v i d u a l enzymes a n d t h e r e  DNA  ft-glucosidase s t r u c t u r e and technology.  t o c e l l u l a s e enzymes h a s components  l n order to  has now been a r e p o r t o f  8  the  first  crystallization  endoglucanase has  recently  discussion  (Jollif been  will  Genetic radiation mutant. J_.  industrially  followed  1984).  increased  Mutants  activity  strain  which  This  scale.  component  may  c o l 1 and  manipulated  i n the l a b o r a t o r y  d e t e r m i n e d and  Joliff  c a n be  The  factors most  of  such  cerevlsae  large  used  which are e a s i l y shown t o e x p r e s s (Beguin et a l . ,  to  Bollon,  1984).  o f the  Once d e f i n e d  be  specificities  used  gene o r i t s p r o d u c t .  This  and  function  the  1986;  stucture  of s i t e - d i r e c t e d  to a l t e r  the  o f enzymes.  must be c o n s i d e r e d  important f a c t o r  be the  (O'Neill et a l . ,  a l t e r e d t h r o u g h t h e use may  can  increase  quantities  applications  to  as  isolated, i t s structure c a n be  on a  o f f e r s the a b i l i t y  obtained for structure  these changes  or substrate  Several  level  methods o f  enzyme a c t i v i t i e s  such that  p r o t e i n c a n be  and  (Macrls,  purified, possibly  and have been  information  e t a l . , 1986;  activity  cloned  this  been  or f o r i n d u s t r i a l  mutagenesis  cloned.  cellulolytic  of expression  the p r o t e i n  of  produces  increased  i n organisms  Saccharomvces  Once a gene h a s  recombinant  for celloblase  s e l e c t i o n , gene c l o n i n g  Escherichia  studies  t h i s c e l l o b l a s e has' one  t h e n be  s t u d y s i n g l e genes  levels  more c e l l o b l a s e  As an a l t e r n a t i v e t o t r a d i t i o n a l  the v a r i o u s  A mutant  i n d i v i d u a l components o f t h e c e l l u l a s e  isolate  of  e t a l . , 1982).  o v e r p r o d u c e a p a r t i c u l a r c e l l u l a s e enzyme  and  and  of  e t a l . , 1978).  mutagenesis  1986).  and  desired  mutants  of C e l l u l o m o n a s which  (Hagget  organisms  i s r e s i s t a n t to  thermostabilities reported  the study o f  complex.  all  that  l e v e l s o f c e l l o b l a s e has an  cellulolytic  so t h i s  useful  t o produce  (Montenecourt  strain  research  by e i t h e r c h e m i c a l o r  used  make fl-gl u c o s i d a s e  A mutant  a r e a of  by s e l e c t i o n o f the  been  t o the p a r e n t a l  encoded  fl-glucosidases.  approached  inhibition  This  of A l t e r n a r i a a l t e r n a t a produces  highest  large  of  has  DNA  ( B e g u i n e t a l . , 1986)  l i m i t e d to  Mutagenesis  compared  allow  be  mutagenesis  end-product  the  reviewed  has been  r e e s i which  strain  e t a l . , 1986).  improvement  traditionally  of a recombinant  when a gene  i s the d e t e c t i o n  i s t o be o f the  c a n be a c c o m p l i s h e d i n  9  several  ways:  1) w i t h  probe;  2) by  raised  against  immunodetection the  interest.  excellent  review  explanations  B)  of  Again  by the  Escherichia  the  of  direct  (Armentrout  Cel1ulomonas  (Bates  and  genes have been c l o n e d  summary o f the  bacterial  host,  the  of heterologous  s i n c e the their  frag i l l s gene  was  from  sequences however no The  directly  this  yeast and was  rationales  a strain  of  fermenting  does not  Guerineau,  yeast yeast  1984).  The  a eukaryotic  sometimes The  gene  from  this  from  gene  C_.  i n E..  fl-glucosidase on  do  i f the  gene  i n t e r v e n i n g sequences;  Relatively they  The  with  of g r o w i n g  Therefore,  host.  contain intervening  c o n t a i n any  and  the  E_. c o l 1 I n d i c a t i n g t h a t  genes were c l o n e d  i t to e t h a n o l . 1983).  col i.  f o r c l o n i n g these  ferment c e l l o b i o s e ,  Detroy,  in  II. cloned  to  in t h i s  and A  in Table  cerev i s l a e .  made t o e x p r e s s  capable  (Raynal  barriers  genes  into  Fungal  I I have been  few  i n t o S.  cloned  attempt  The  and  bacterial  expression  a l s o d o e s not  varied.  i s shown  seem t o be  and  e t a l . , 1984).  in Table  direct  uda  CandIda p e l 1 i c u l o s a  s t r u c t u r e of e u k a r y o t i c genes  (Raynal  pe11iculosa  yeasts  there  genes have been c l o n e d  precludes K..  fl-glucosidases  1986).  fragllis  A_. n i a e r ( P e n t i l a  genes l i s t e d  c o l i because  fungal  from  1986), K l u v v e r o m v c e s  cloned  1981),  (Zappe e t a l . , 1986),  ff-glucosidase  1984), and  Brown,  from  (Scharwz e t a l . ,  ATCC21400 (Wakarchuk e t a l .,  expression  the  ( B a r r a s e t a l . , 1984),  Agrobacterium  into  detailed  e t a l . , 1986), C e l l u l o m o n a s  1985), C l o s t r i d i u m a c e t o b u t v l i c u m  Toh-e,  the  the  methods to  (Nakamura e t a l . , 1986), C_. thermoce 11 um  The  to  for  c l o n i n g of <5-gl ucos i d a s e s  var chrysanthemi  Guerineau,  assay  fJ-gl u c o s i d a s e genes have been c l o n e d  f 1 mi  antibody  genes.  adecarboxvlata  and  with  is referred  these  Erw i n i a c a r o t o v o r a  (Kohchi  hybridization  gene p r o d u c t  reader  application  molecular  Bacterial  the  o r DNA  B e g u i n e t a l . , (1986) f o r the  of c e l l u l a s e The  of  RNA  n a t i v e p r o t e i n ; 3) by  enzyme o f  cloning  a specific  the  aim  genes of  cellobiose  few so  coli.  naturally  producing  and ocurring  inefficiently  d e s i r e d product  (Freer  from  Table  II.  Summary o f c l o n e d  Organism  fl-glucosidase  Expression level  Screening Method  Aarobacterium  ATCC21400  DNA  probe  Clostridium  acetobutvlicum  enzyme " activity  Clostridium  thermocellum  indicator plates  genes  c  *  reference  high  Uakarchuk et a l . , 198S  low  Zapp* et a l . , 1986  low  Schvarz et a l . , 1986  Cellulomonas  fimi  indicator plates  high  Bates et a l . , unpublished observations  Cellulomonas  uda  indicator plates  high  Nakaaura et a l . , 1986  Erwinea  carotovora  c o m p l e m e n t a t i o n NA  •  Barras et a l . , 1984  Escherichia  adecarboxvlata  g r o w t h on cellobiose  low  Anentrout and Brown, 1981  Asoeraillus  niaer  indicator plates  very low  Pentillia et a l . , 1984  Candida D e l l i c u l o s a  indicator plates  low  Kohchi and Toh-e, 1986  Kluvveromvces  enzyme " activity  high  Raynal and 6uerineau, 1984  fraailis  a)  Low e x p r e s s i o n i s d e f i n e d a s e x p r e s s i o n b e l o w t h e l e v e l the o r i g i n a l ft-glucosidase producing organism.  b)  Enzyme a c t i v i t y was d e t e r m i n e d a s g a s p r o d u c t i o n £• c o l i c o n t a i n i n g r e c o m b i n a n t p l a s m i d DNA.  c)  I n d i c a t o r p l a t e s f o r £. t h e r m o c e l l u m and C. f i m i c o n t a i n e d t h e t h e f l u o r e s c e n t i n d i c a t o r 4-methyl-umbel 1 i f e r y l - $ - D - g l u c o s i d e . The i n d i c a t o r 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - f l - D - g l u c o s i d e was u s e d d e t e c t i n g t h e g e n e s f r o m £. u d a . ft. n i q e r and £. p e l l i c u l o s a .  d)  E n z y m e a c t i v i t y was d e t e r m i n e d b y c o n t a i n i n g g. c o l l f o r PNPGase.  e)  NA,  not  assaying  found i n  from c e l l o b i o s e  pools of recombinant  by  for DNA  available  A l l o f t h e b a c t e r i a l g e n e s w e r e c l o n e d i n t o §. c o l i . The £. c a r o t o v o r a e n e s w e r e c l o n e d i n t o E. c a r o t o v o r a m u t a n t s a s w e l l a s E. QQTT. he f u n g a l g e n e s were c l o n e d i n t o S a c c h a r o m v c e s c e r e v i s i a e . The K. T r a g i l i s g e n e was a l s o c l o n e d i n t o E. c o l l .  ?  11  c e l l u l o s e degradation  is ethanol,  an  efficient  cellobiose-fermentlng  s t r a i n of yeast  would be  of  industrial  i mportance. The  n l g e r ff-gl ucos idase gene was  i s o l a t e d in an  attempt to clone  genes whose products would be  biotechnological  importance, and  information  about the  which would  molecular b i o l o g y  Information about gene s t r u c t u r e and fungi high  i s expanding s i n c e  enzymes n a t u r a l l y s e c r e t e d and  provide  of filamentous  function  in filamentous  by  (Hendy et a l . , 1982).  these fungi  cellulase (Ball,  include  plant c e l l u t i l i z e d by  w a l l s and  were  r e l e a s i n g c e l l o b i o s e which can  t h i s organism (Barras  remaining  fl-glucosidase  et a l . , 1984).  t h e i r study may  c e l l u l a s e complex.  mechanisms of genes in Table  because t h e i r gene products are and  cloned  i s a p l a n t pathogen capable of degrading  a i d in the e l u c i d a t i o n of the The  The  amylase,  then be The  c h a r a c t e r i z a t i o n of the d e g r a d a t i v e enzymes of t h i s may  very  1984).  The fl-gl ucos idase genes from E,. c a r o t o v o r a because t h i s organism  fungi.  these organisms are capable of  l e v e l s of p r o t e i n s e c r e t i o n  fi-glucosidase,  of  organism  virulence. II were  cloned  part of c e l l u l a s e complexes,  enable reconst1 tut Ion of an These cloned  in hosts d e f i c i e n t In p r o d u c t i o n  genes  optimized  c o u l d a l s o be  utilized  of t h i s enzyme, or as a means  of producing l a r g e q u a n t i t i e s of enzyme f o r use  ln  supplementing  reactions.  industrial  scale sacchar1flcatIon  The fl-gl ucos idase genes from both C.  thermoceHum were not  a b i l i t y to c l e a v e  chromogenic  (Schwarz et a l . , 1986; The ethanol  characterized  a c e t o b u t v l icum except f o r t h e i r  ft-glucosides  introduced  into  (Armentrout and  requires a cytoplasmic  Brown, 1981). preparation  Brown, 1984).  This  (Armentrout  make i t u n a t t r a c t i v e  in l a r g e amounts f o r supplementing reactions.  lacks  i s membrane bound  factor for a c t i v i t y  These p r o p e r t i e s  sacchar1flcatIon  plates  the  producing bacterium Zvmomonas mobi1 i s which  enzyme, l i k e l y a c e l l o b i o s e phosphorylase, and  in s c r e e n i n g  Zappe et a l . , 1986).  a d e c a r b o x v l a t a gene was  cellobiase activity  and  for  and  12  Two and  fl-glucosIdase  expressed  1986).  at a high  l n E..  level  uda  were  cloned  c o l 1 (Nakamura e t a l . ,  Both genes encoded a r y l - f l - D - g l u c o s i d a s e a c t i v i t y ;  however, o n l y  one  cellobiose. cellobiose  of  compared  them a l l o w e d  T h e r e were no hydrolysis.  gene w h i c h a l l o w s known  g e n e s from C e l l u l o m o n a s  t o the  quantitative results  The  level  growth of  parental  i f t h i s enzyme  c o l 1 t o grow  for  o f the  uda  c e l l o b i o s e is high  o r g a n i s m ; however,  is a  reported  of e x p r e s s i o n  c o l 1 on  on  true c e l l o b i a s e  i t i s not  yet  or a c e l l o b i o s e  phosphorylase. The use  Aarobacterium  with  the  cellobiase  cellobiase  recombinant  from  fimi  however, a r e c o m b i n a n t and  cellobiase  expressed studies  by  the  t o be  cellulases has  DNA  activity  not  has  the  faecal is) cellobiase and  cellobiase  from A., n l g e r  was  has  originally  kinetic  isolated  Cellulomonas  and  other  Srinivasan,  1968;  Han,  A g r o b a c t e r l u m and single  cell  6-fold  Increase  (Han,  Agrobacterium with  i n i t i a l l y characterized  T h i s enzyme  is very a c t i v e to  I ) . In a d d i t i o n t h i s on  was  used  only  was  cellobiose utilization,  c o n t r i b u t i o n from so  Agrobacterium c e l l o b i a s e  l a b o r a t o r y has flml  r e c o n s t r u c t i n g an  optimized  of g l u c o s e  molecular  a  co-culture the  i t seemed gene  cellulase  expression  the  for  cellulolytic  c l o n i n g with  from c e l l u l o s e .  c l o n i n g and  of  use  f 1ml.  been s t u d y i n g by  and  of  s u b s t r a t e , where  The  Our  (Han  production  mass r e s u l t e d from t h e i r  o f C_.  organism  of  cellulose  l n the  on  the  Cellulomonas  the  et a l . ,  (previously  mixed p o p u l a t i o n  obvious  levels  biochemical  The  cellulases  molecular  allow  from a mixed p o p u l a t i o n  from C e l l u l o m o n a s  the  was  the  1968).  the  production  and  properties similar  (Table  for  The  enzyme(s) (Bates  s p e c i e s growing  in c e l l  to c l o n e  f imi •  Aarobacterium  p r o t e i n from a c e l l u l o s i c  1982).  logical  The  S r i n i v a s a n (1969).  cellobiose  should  recombinant  Alcal1genes and  isolated,  clone  observations).  Han  C_.  isolated  encoding aryl-fl-D-glucosidase  been  unpublished by  of  been  yet been c h a r a c t e r i z e d ;  clone  recombinant  done on  gene has  complex  the  goal  of  f o r the  P r e v i o u s l y we of both  enzymes  endo-  described  and  13  exoglucanase genes from t h i s organism ( G i l k e s et a l . , 1984). Experiments ln our laboratory to determine the optimal r a t i o of the cloned c e l l u l a s e s are c u r r e n t l y underway. C e l l o b i a s e i s an important enzyme ln c e l l u l o s e h y d r o l y s i s and e f f i c i e n t h y d r o l y s i s may depend on determining the optimal concentration of t h i s enzyme in a mixture of c e l l u l a s e s . Since b a c t e r i a l c e l l o b i a s e s are produced at low l e v e l s and are i n t r a c e l l u l a r enzymes a recombinant source of c e l l o b i a s e should enable s u f f i c i e n t q u a n t i t i e s to be obtained for use in synergy exper1ments. This t h e s i s describes the molecular c l o n i n g and expression of a fl-glucosidase from an Agrobacterium s p e c i e s . The work described here is presented in two p a r t s : f i r s t , the p u r i f i c a t i o n of the p r o t e i n and the molecular c l o n i n g of the gene; then the c h a r a c t e r i z a t i o n of the gene by determination of the DNA sequence.  14  MATERIALS  AND METHODS  I Bacterial  s t r a i n s , plasmids and phages  ATCC 21400 served as the source of the gene.  This organism  faecalis  was o r i g i n a l l y  (Han and S r i n i v a s a n ,  fl-glucosidase  i d e n t i f i e d as A l c a l i q e n e s  1968);  however, the American  Type Culture C o l l e c t i o n , ATCC, has r e c l a s s i f e d t h i s as a s p e c i e s of Aarobacterium.  isolate  The E s c h e r i c h i a c o l i  strains  JM101, JM109 and JM83 were d e s c r i b e d p r e v i o s l y (Yanisch-Perron e t a l . , were maintained  1985).  The plasmids pUC13 and pUC18  i n JM83 (Messing,  and pTZ19U were maintained phage v e c t o r s M13mpl0/ll p r e p a r a t i o n s (Messing,  1983). The plasmids pTZ18U  i n JM101  (Vieira,  The  were maintained as phage 1983).  maintained on M9 minimal  JM101 and JM109 were  medium p l a t e s ( M i l l e r  c h a r a c t e r i s t i c s of these b a c t e r i a l phages i s given i n Table I I I .  1972).  The  s t r a i n s , plasmids and  Plasmid c o n t a i n i n g s t r a i n s  were grown in L u r i a b r o t h ( L B ) , ( M i l l e r pg ampici11 in/ml .  1985).  1972) c o n t a i n i n g 100  For small s c a l e enzyme p r e p a r a t i o n  c u l t u r e s of both E_. c o l i and Aarobacterium were grown i n M9 minimal  medium with g l y c e r o l as carbon source f o r E. c o l i  and  c e l l o b i o s e as carbon source f o r Aarobacterium. II  P r e p a r a t i o n of (S-gl ucos idase ATCC 21400 was grown at 30°C i n M9 minimal  supplemented  with 0.1% yeast e x t r a c t and 0.4% l a c t o s e .  l a r g e scale p r e p a r a t i o n 80 l i t e r s stirred  medium  fermenter.  For  of c e l l s were grown i n a  C e l l s were harvested with a S h a r p i e s  c e n t r i f u g e and the c e l l  paste was s t o r e d at -20°C u n t i l  needed.  manipulations were c a r r i e d out a t  A l l subsequent  4°C, except the FPLC chromatography, which was done a t room temperature.  C e l l e x t r a c t s were prepared by g r i n d i n g the  c e l l s with 2.5 times t h e i r weight  of alumina  powder ( S c h l e i f and Wensink, 1981). was 50 mM sodium phosphate  The e x t r a c t i o n  pH 7.0, 10 mM  buffer  2-mercaptoethanol.  Table  III.  Bacterial  £.  Bacterial  Strain  strains,  Genetic  coli  JM83  ara  coli  JM101  SUDE  thi  endA  c o l 1 JM109  IF' ATCC  21400  and  phages  characteristics  A<lac-DroAB)  DroAB £.  plasmids  Reference  rosL  A(lac-DroAB)  0 8 0 l a c Z A M 15  (a)  traD36  (a)  thi  (a)  C F '  lacI"ZAM15] avrA  hsdR  traD36  recA  DroAB  cellobiose  relA  SUDE  lad ZAM15] q  <b>  utilization  Plasmid  Genetic  pUC13  AD"  lacZ'  <c>  pUC18  Ap  lacZ'  (c)  pTZ18U  Ap-  lacZ'  or\f\  (d)  pTZ19U  Ap-  lacZ/  priH  <d)  Phage  Genetic  M13mpl0  lacZ/  <c>  M13mpl1  J?cZ'  <c>  M13K07  Km"  (d)  references:  r  characteristics  characteristics  a)  Yannisch-Perron  b)  Han a n d  c)  Messing,  d)  Viera,  et  Srlnivasan, 1983 1985  a l . , 1969  1985  Re f e r e n c e  Re f e r e n c e  16  The  crude e x t r a c t was  c l a r i f i e d by c e n t r i f u g a t i o n at 35,000 g  f o r 30 min.  N u c l e i c a c i d s were p r e c i p i t a t e d with  streptomycin  s u l f a t e and  the p r e c i p i t a t e was  c e n t r i f u g a t i o n f o r 20 min The  c l a r i f i e d e x t r a c t was  then pumped onto a  x 60 cm,  sodium phosphate b u f f e r , pH 7.0. of 0 t-e 1 M NaCl  containing  ft-glucosidase  s t a r t i n g b u f f e r and  e q u i l i b r a t e d with 50  The  in the  eluant was  were pooled, eluant  x 30  The  to 0.8  in s t a r t i n g b u f f e r .  ultrafiltration The  pooled  and  concentrated  P r o t e i n was  cm  The  the same b u f f e r .  M to 0.4  M NaCl  mM Ill  p r o t e i n was  and  by  which 100  mM  loaded  was NaCl.  onto a Pharmacia  e q u i l i b r a t e d in s t a r t i n g  e l u t e d with a 40 ml g r a d i e n t  in s t a r t i n g b u f f e r .  of  0.2  Those f r a c t i o n s with and  the  dialyzed against  8.0.  Enzymatic assays and  protein  C e l l e x t r a c t s were prepared as c e l l s were concentrated second the c e l l  M  Fractions  loaded  s p e c i f i c a c t i v i t y were pooled  NrUHCOa, pH  l i n e a r 0.2  Fractions  x 75 cm,  MonoQ anion exchange column that was buffer.  ml  or YM-30 membranes.  in s t a r t i n g b u f f e r c o n t a i n i n g e l u t e d with  with  DEAE-Sephace1 eluate was  c o n t a i n i n g a c t i v i t y were pooled  highest  a 200  linear  cm  concentrated  using Amicon YM-10  onto a B i o - g e l P-300 column, 1.5 equilibrated  was  cm  mM  Fractions  diluted 3 fold  DEAE-Sephace1 column.  c o n t a i n i n g a c t i v i t y were pooled  a 1-L  starting buffer.  pumped onto a 1.5  M NaCl g r a d i e n t  removed by  at 20,000 g.  DEAE-Sephace1 column, 2 cm gradient  1.5%  determination follows:  first,  the  10 to 5 0 - f o l d by c e n t r i f u g a t i o n ;  p e l l e t s were resuspended  extraction buffer; f i n a l l y ,  the  In 1-2  ml  of  suspensions were s o n i c a t e d  using a Bronson s o n i f i e r , with a microprobe set at an i n t e n s i t y of 2 f o r 2 b u r s t s of a c t i v i t y was  15 seconds,  ft-glucosidase  assayed by the r e l e a s e of p r n i t r o p h e n o l  p-nitrophenyl-fl-D-glucoside measured by the p r o d u c t i o n  (PNPG). A c t i v i t y was of glucose  assay c o n d i t i o n s f o r PNPG and  from  also  from c e l l o b i o s e .  The  c e l l o b i o s e h y d r o l y s i s were as  10  17  follows:  0.5  containing to  ml 1.2  of mM  37°C; t o the  50  Na C0 , 2  12.5  mM  a d d e d and  were s t o p p e d  by  a vortex  Cellobiase  reactions  D-gluconic  acid lactone  0.1  gently  the  were s t o p p e d final  spectrophotometrically  by  measuring  The  25 °C  release  Diagnostic unit  i s 18.8  k i t UV-15  37°C.  al., IV  (1951) u s i n g  Peptide A)  bovine  l o d o a c e t i c a c i d by  (1963), except place  of  6M  dialyzed  urea. The  a c i d and  added.  The  a  dark.  The  r e a c t i o n was  dryness.  The  The  with  by  of  guanidine reduced  200-fold  r e a c t i o n was terminated H0 2  the  that  as  and  that  and  using  M0).  in  a  was  min  of 1  min et  standard.  sequencing fl-glucosidase r e d u c e d and  Crestfield  H0  alkylated  et a l .  was  and  2  dissolved  argon,  used was  i n 1 ml  18-24  the  in  then  sealed  for  diluting then  A  of  method of Lowry  alkylated protein  incubated and  M  1982).  amount  from PNPG  the  distilled  by  i n 0.5  amount  hydrochloride  with  mM  solution.  St. Louis,  m o l a r e x c e s s of s o l i d  flushed  5  quantitated  as  the  method o f  against  distilled  Co.  nmol) was  d r i e d product  tube was  the  10-fold  6M  exhaustively  lyophilized. formic  that  the  of  from c e l l o b i o s e i n 1  purification  (10  of  f o r PNP  serum a l b u m i n as  protein  ice.  quantitated  A-»oo o f  of p - n i t r o p h e n o l  determined  production,  purified  was  nm  is defined  Cyanogen b r o m i d e c l e a v a g e The  with  was  on  1 M  ( S t o p p o c k e t a l .,  of g l u c o s e  1 pmol  Protein  400  is defined  A u n i t o f PNPGase  37°C.  PNP  the  (Sigma C h e m i c a l  1 pmol  of  addition  from c e l l o b i o s e was  of c e l l o b i a s e a c t i v i t y  enzyme r e l e a s i n g at  ml/pmol/cm  of g l u c o s e  enzyme r e l e a s i n g at  of  molar e x t i n c t i o n c o e f f i c e n t a t at  ml  concentration  release  prewarmed  PNPGase  then kept the  7.0  suitably diluted  mixed.  by  The  NasrCOo  of  a d d i t i o n of 0.6  (Reese e t a l . , 1971). The  ml  m i x e r and  to a  b u f f e r pH  c e l l o b i o s e , was  prewarmed m i x t u r e  mixed w i t h  3  sodium phosphate  PNPG o r  enzyme s o l u t i o n was reactions  mM  CNBr and  lyophilizing  to  was  placed  hr at  reaction  70% in  30°C. mixture  near  18  B) Reversed phase chromatography The  CNBr c l e a v e d p r o t e i n was  with 0.1% mixture  t r i f l u o r o a c e t i c acid  d i l u t e d to a volume of 1 ml  (TFA).  A l i q u o t s of t h i s  were a p p l i e d to a Pharmacia proRPC 5/10  reversed  phase FPLC column p r e v i o u s l y e q u i l i b r a t e d with 0.1% p e p t i d e s were e l u t e d with a 25 ml acetonitrile monitored  (ACN)  in 0.1%  TFA.  f o r absorbance at 280  TFA.  l i n e a r g r a d i e n t of 0 to The  column e f f l u e n t  nm.  50%  was  F r a c t i o n s were then  pooled and c o n c e n t r a t e d by e v a p o r a t i o n  C) Sequence d e t e r m i n a t i o n of the  The  in a Savant speedvac.  peptides  and amino a c i d a n a l y s i s of the p r o t e i n Peptides were sequenced by automated Edman d e g r a d a t i o n using an A p p l i e d Biosystems model 470A gas-phase utilizing  the r e s i d e n t sequencing  program.  The  sequenator amino a c i d  r e s i d u e s were analyzed by r e v e r s e d phase HPLC chromatogaphy. This a n a l y s i s was  provided by the U n i v e r s i t y of V i c t o r i a  sequencing  facility  facility.  The  and  the U n i v e r s i t y of Calgary  amino a c i d a n a l y s i s was  performed at the  U n i v e r s i t y of Calgary sequencing  facility.  mixture  0.1%  i n c l u d e d 0.1%  phenol  and  sequencing  The h y d r o l y s i s  thio-diglycol  to  p r o t e c t the aromatic amino a c i d s as well as methionine  from  o x i d a t i o n d u r i n g the h y d r o l y s i s (Dr. D. M Kay, personal c  communication). V DNA  methodology  A) DNA  i s o l a t i o n and a n a l y s i s  Chromosomal DNA (Mariur, DNA  1961).  was  Large  i s o l a t e d as p r e v i o u s l y d e s c r i b e d  s c a l e p r e p a r a t i o n s of plasmid pUC13  were obtained by the CsCl method (Katz et a l . , 1973).  Small  s c a l e plasmid p r e p a r a t i o n s were made using the  lysis  method ( M a n i a t i s et a l . , 1982).  alkaline  Restriction  endonuclease d i g e s t i o n s were performed a c c o r d i n g to manufacturers' monitored  recommended procedures.  by agarose  Digestion  was  g e l e l e c t r o p h o r e s i s ( M a n i a t i s et a l . ,  19  1982). low  R e s t r i c t i o n fragments f o r c l o n i n g were i s o l a t e d  melting  temperature agarose g e l s as p r e v i o u s l y  ( M a n i a t i s e t a l ., 1982).  from  described  R e s t r i c t i o n fragments were  t r a n s f e r r e d to n i t r o c e l l u l o s e paper by the method of Southern ( 1975) . B) O l i g o n u c l e o t i d e s Oligonucleotides synthesized  s y n t h e s i s and p u r i f i c a t i o n f o r h y b r i d i z a t i o n s c r e e n i n g were  by Dr. T. A t k i n s o n ,  a t The U n i v e r s i t y of B r i t i s h  Columbia, using an A p p l i e d Biosystems automated DNA s y n t h e s i z e r model 380A. by polyacrylamide  The o l i g o n u c l e o t i d e s were p u r i f i e d  g e l e l e c t r o p h o r e s i s (PAGE) on 20%  acrylamide-7 M urea sequencing g e l s and reversed  phase  chromatography on Sep-Pak C i c a r t r i d g e s  (Millipore/Waters  Assoc., Milford,MA) (Atkinson  1984).  Q  and Smith,  Specific  o l i g o n u c l e o t i d e s to be used as primers f o r sequencing were synthesized  and p u r i f i e d a t A l l e l i x  Inc., Missisauga, Ont.  C) C o n s t r u c t i o n and d e t e c t i o n of recombinant DNA clones The  c l o n i n g vector, pUC13, was d i g e s t e d with EcoRI and  t r e a t e d with c a l f  i n t e s t i n a l a l k a l i n e phosphatase  to manufacturers' recommendations. as p r e v i o u s l y d e s c r i b e d transformed a c c o r d i n g (1979).  (Lathe  according  L i g a t i o n s were performed  e t a l . , 1984).  c o l i was  to the method of Dagert and E h r l i c h  Bacterial colonies containing  recombinant  Agrobacterium DNA were grown on M9 minimal glucose p l a t e s supplemented  medium  with  5-bromo-4-chl oro-3- indol yl-|?-D-galactos idase  (X-gal, 40  pg/ml), i s o p r o p y l - f l - D - t h i o g a l a c t o s i d e (IPTG, 0.2 mM), and 100 jjg ampici 11 in/ml  (Yan 1 sch-Perron e t a l . , 1985).  Recombinant  DNA from c o l o n i e s was t r a n s f e r r e d to n i t r o c e l l u l o s e by the method of Grunstein  and Wall i s ( 1979).  O l i g o n u c l e o t i d e s were l a b e l l e d a t the 5' end with gamma- P-ATP by the method of Z o l l e r and Smith (1983). 32  O l i g o n u c l e o t i d e h y b r i d i z a t i o n r e a c t i o n s were performed i n s e a l e d p l a s t i c bags i n 6X SSC/10X Denhardt's s o l u t i o n (0.9M  20  NaCl, 0.09M sodium c i t r a t e , polyvinylpyrrolidone,  1% Bovine serum albumin,  1% F i c o l l ) at 37°C f o r 16 h.  were then washed at 37°C with s e v e r a l changes Radioautography was with  of 6X  performed with Kodak XRP-1  1% Filters SSC.  f i l m at  -77°C  Intensifying screens.  D) DNA  sequencing  Sequencing was  performed by the enzymatic procedure of  Sanger et a l . (1977) and the chemical cleavage method of Maxam and G i l b e r t stranded DNA pTZ19U.  (1980).  The v e c t o r s used to o b t a i n  single  were e i t h e r M13mpl0 and M13mpll or pTZ18U and  Subclones f o r sequencing were generated by d e l e t i o n  with Exonuclease  III and mungbean nuclease (Guo and  1983), or by c l o n i n g of s p e c i f i c S i n g l e stranded M13 d e s c r i b e d (Messing,  DNA  restriction  template was  Wu,  fragments.  prepared as p r e v i o u s l y  1983).  S i n g l e stranded pTZ18/19 DNA  was  prepared as f o l l o w s : a  2 ml c u l t u r e of the recombinant clone was grown to an A 0.5-0.9 at 37°C this MOI  i n LB medium with 200 pg ampici11 in/ml.  time h e l p e r phage M13K07 ( V i e i r a , of 10 and the c u l t u r e was  shaken  1985) was into  At  added at an  f o r an a d d i t i o n a l  400 p i of t h i s c u l t u r e were then d i l u t e d  of  s = 0  1 h;  10 ml of f r e s h  LB medium c o n t a i n i n g 70 pg kanamycin/ml and t h i s was a l l o w e d " to grow f o r 16-24  hr with vigorous shaking.  The supernatents  were then processed as d e s c r i b e d above f o r M13. For  chemical sequencing, r e s t r i c t i o n  labelled  fragments were  with «- P-dATP using the Klenow fragment of 32  polymerase  I ( M a n i a t i s et a l . , 1982).  restriction  DNA  Uniquely e n d - l a b e l l e d  fragments were generated by a second  restriction  endonuclease d i g e s t i o n and were recovered from p r e p a r a t i v e agarose g e l s using DEAE paper ( L i z a r d i , analyzed on 6,7  1981).  Samples were  or 8% acrylamide g e l s (29:1 acrylamide to  b i s - a c r y l a m i d e ) c o n t a i n i n g 7 M urea and run as p r e v i o u s l y described without  (Sanger et a l . , 1977).  Radioautography was done  i n t e n s i f y i n g screens f o r 4-24  using Kodak XRP-1 SEQNCE program  film.  hr at room  Sequence a n a l y s i s was  developed by Delaney Software  temperature  done using the  (Vancouver,  B.C)  21  o r by the DNA  Inspector  II program  (Textco,  West L e b a n o n ,  New  Hampshire). VI  Polyacrylamide activity  g e l e l e c t r o p h o r e s i s and fS-gl ucos i d a s e  staining  Samples were a n a l y z e d  by PAGE  i n sodium d o d e c y l  (SDS) c o n t a i n i n g g e l s as p r e v i o u s l y d e s c r i b e d The  s t a c k i n g g e l s were  were  12% a c r y l a m i d e  to b i s - a c r y l a m i d e at  a constant  running.  Protein brilliant 10%  blue  acetic  was  and the s e p a r a t i n g  thick).  The r a t i o  fl-glucosidase  with  running  was  activity  with acid  loaded  detected mM  detect on  activity  the g e l .  placing buffer, gels  UV  light  at least  Activity  was  polaroid  type  acetic  Whatman 3MM  57  acid  film.  visualized with  DNA  When X - g l c were  as a blue  a n d 50 mM  were u s e d  For clones  MUG  be i n 50  used to  loaded  per  lane  band  after  overlay  The MUG  phosphate activity  a t 302 nm,  using  fixed in  d r i e d under vacuum  onto  sheeting.  i n agar p l a t e s f o r d e t e c t i o n  expressing  expressing  could  was  s t a i n e d g e l s were  and e i t h e r  was  the g e l under  sodium  illumination  The X - g l c  clones  When  o f 1.0 mM  a 0.5% a g a r o s e  (100 pM)  with  of PNPGase  and v i e w i n g  o f PNPGase  under U.V  overnight  and X - g l c  of recombinant subcloning.  1 mU  p a p e r o r between c e l l o p h a n e  B o t h MUG  (X-glc>.  (Wakarchuk e t a l . , 1984).  were p h o t o g r a p h e d  minimal.  Bands o f f l u o r e s c e n c e  a t 302nm.  5 mU  50 pg X - g l c / m l  pH 7.0.  MUG,  b u f f e r , pH 7.0.,  the g e l i n c o n t a c t  containing  10%  with  was  (MUG) o r  the g e l i n a s o l u t i o n  sodium p h o s p h a t e  illumination  with  on t h e g e l .  by s o a k i n g  the g e l i n  i n the g e l s was d e t e c t e d  t o be d e t e c t e d  per lane  coomassie  and 25%  staining  5- b r o m o - 4 - c h l o r o - 3 - i n d o l y l - f t - D - g l u c o s i d e was  0.03%  removed by s o a k i n g  the background  performed  tap water.  by s t a i n i n g  4- methyl-umbel 11 f e r y l - | ? - D - g l u c o s ide activity  acrylamide  f o r s t a c k i n g and 30-50 mA f o r  stain  until  gels  o f 15 mA  d i s s o l v e d i n 10% a c e t i c  acid  of  1970).  E l e c t r o p h o r e s i s was  visualized  Excess  (Laemmli,  30:0.8.  were c o o l e d  was  2-propanol.  (0.75 mm  current  Gels  3% a c r y l a m i d e  sulfate  fl-glucosidase  a low l e v e l  of  after  22  fl-glucosidase minimal higher  activity,  levels  of e x p r e s s i o n  detected  expressing  wave UV  light  containing  ft-glucosidase  were a n a l y z e d  8 M urea  Rabbit  antiserum  ft-glucosidase  on MUG  by  phosphatase/  system  of  100  be media  on  on 20% p o l y a c r y l a m i d e  under  X-glc  gels  i mmunoadsorpt i on o f <5-gl u c o s i d a s e  to p u r i f i e d (Whittle  immunoblotting  (Blake  IgG f r a c t i o n  fl-glucosidase  was  e t a l . , 1982). was  was p u r i f i e d  and c o u p l e d  Detection  of  performed as p r e v i o u s l y the a l k a l i n e (BCIP)  by ammonium s u l f a t e  to Bio-Rad  Affi-gel  conditions.  sodium p h o s p h a t e , pH 7.0,  100 mM  10 a c c o r d i n g  fi-glucosidase  bound t o t h e c o l u m n a t 4 °C f o r 16 h . t h e enzyme  prepared  e t a l . , 1984).  m a n u f a c t u r e r s ' recommended  identical  containing  5-bromo-4-chloro-3-indo1yl-phosphate  fractionation  of  was  easily  colonies  ( T o w b i n e t a l . , 1979), u s i n g  detection  When  i n a d d i t i o n t o SDS.  previously described  The  could  (>300nm) o r a s b l u e  I m m u n o d e t e c t i o n and  described  o f 100 pM.  media.  Peptides  as  i n t o LB o r M9  were e x a m i n e d , X - g l c  as f l u o r e s c e n t c o l o n i e s  containing  VII  incorporated  i n t o the p l a t e s a l s o a t a c o n c e n t r a t i o n  Colonies  long  was  g l y c e r o l media a t a c o n c e n t r a t i o n  incorporated pM.  MUG  was  Buffer containing  NaCl  was  used  with  normal  50  mM  f o r adsorption  t o t h e c o l u m n and f o r w a s h i n g t h e c o l u m n .  column p r e p a r e d  to  r a b b i t serum was  An u s e d as  a control. VIII  Induction carrying  Strains  carbon to  A  e =  o  fl-glucosidase  recombinant  w h i c h were  fl-glucosidase were grown  of  activity i n M9  source o f 0.2  concentration  and  pUC  expression plasmids  t o be a n a l y s e d were p r e p a r e d  minimal  medium w i t h  for inducible  as f o l l o w s .  o f 1 mM.  IPTG was  Growth was  The  cells  0.5% g l y c e r o l as s o l e  100 pg a m p i c i 1 1 i n / m l .  a t w h i c h time  in s t r a i n s  The c e l l s  added t o a  monitored.  were  grown  final  When an  ABBO  of  23  2.0 was reached the c e l l s were h a r v e s t e d by c e n t r i f u g a t i o n , and e x t r a c t s were prepared by s o n i c a t i o n .  After  sonication  samples were c e n t r i f u g e d a t 13,000 x g f o r 15 min a t 4°C.  The  supernatant f r a c t i o n was then used as the source of fl-glucosidase  for subsequent  analysis.  IX M a t e r i a l s Growth media components were obtained from D i f c o . A l l <5-gl ucos idase s u b s t r a t e s were o b t a i n e d from Sigma, S t . L o u i s , MO,  USA; DEAE-Sephacel,  d e o x y n u c l e o t i d e s and  d i d e o x y n u c l e o t i d e s were o b t a i n e d from Pharmacia, D o r v a l , Canada.  Bio-Gel P-300 and A f f i - g e l  Bio-Rad, M i s s i s a u g a , Ont., Canada.  P.Q,  10 were o b t a i n e d from A l l s o l v e n t s used f o r FPLC  were HPLC grade and were obtained from F i s h e r or BDH, Vancouver, B.C., Canada.  Enzymes used  i n the n u c l e i c a c i d  work were purchased from v a r i o u s s u p p l i e r s .  Radionuclides  were from New England Nuclear Corp., Boston, MA,  USA.  24  RESULTS AND DISCUSSION  I P u r i f i c a t i o n of The  fl-glucosidase  p u r i f i c a t i o n scheme was  Srinivasan  (1969)  (5-glucos idase  as  modified  to  Fig.  Representative  Figs.  3 to  homogeneity,  6.  (illustrated the  in F i g s . is  activity  2 and 6)  correlated  with c e l l o b i o s e  of  as  purified  the  feature  of  is  the  that  with  molecular  the  (Table  and 88  are  activity of was  IV and  shown  in  purification  appearance  weight  The  approximately  the  purified protein  substrate  Han and (1986).  chromatography p r o f i l e s  w i t h an a p p a r e n t  specific  of  j u d g e d by SDS-PAGE  The s i g n i f i c a n t  MonoQ c o l u m n  protein  as  on t h a t  by Day and W i t h e r s  from ATCC 21400 was  1900-fold 2).  based  peak of  a  50-52,000. 286  from The  Units/mg  U n i t s / m g w i t h PNPG  as  substrate.  II  P u r i f i c a t i o n and amino a c i d s e q u e n c e peptides  generated  Attempts fl-glucosidase next  to  clone  by  expression  approach to  amino a c i d  the  sequence  oligonucleotide probe.  However, it  fragments  was for  Peptides difficult  to  complexity peptides  the  the  of  the  A g r o b a c t e r ium gene in E . c o l i  amino t e r m i n u s to g e n e r a t e analysis.  generated  from the  low abundance  their  to  the of  as  either  initially  To overcome  of  isolation  frequent  hybridization  protein  this  peptide  proteins  solubility,  There are n o n - e n z y m a t i c in proteins  obtain a p a r t i a l  and p u r i f y  Enzymatic cleavage due  use  cleavage  m i x t u r e can make  fragments  sites.  of  to  The  from w h i c h an  the  Edman d e g r a d a t i o n .  sequence  the  was  for of  for  were u n s u c c e s s f u l .  (3-gl u c o s i d a s e  synthesized  p u r i f y because  of  cleavage  molecular c l o n i n g  necessary  difficult.  numbers of cleavage  of  the  c o u l d be  a p p e a r e d b l o c k e d to problem  by CNBr  determination  of  methods  and  the  individual generate  occurrence methods  c a n be  of  large  their  which r e l y  t r y p t o p h a n or  on  Table IV.  Purification  Fraction  Total Protein (mg)  Crude Extract  6991  of c e l l o b i a s e  Total Activity (Units)  1051  Specific Activity (U/mg)  from ATCC 21400  Purification Factor  Yield (%)  0. 15  100  First DEAE  78  707  9.06  60  67  Second DEAE  30  407  13.56  90  39  51 .76  345  33  1906  12  Bio-gel P-300  6.8  352  MonoQ  0.43  123  286  The values i n t h i s t a b l e are average values from the p u r i f i c a t i o n of the enzyme from three 70g c e l l p e l l e t s . The u n i t s i n t h i s t a b l e are d e f i n e d by hydrolys i s .  cellobiose  26  F i g u r e 2. S D S - P o l y a c r y l a m i d e g e l e l e c t r o p h o r e t i c a n a l y s i s o f samples o b t a i n e d d u r i n g the p u r i f i c a t i o n of ft-glucosidase. Samples of v a r i o u s f r a c t i o n s o b t a i n e d d u r i n g the p u r i f i c a t i o n of ff-glucosidase were a n a l y z e d on a 12% S D S - p o l y a c r y l a m i d e gel. Lane A , c r u d e c e l l e x t r a c t ; Lane B , p o o l e d a c t i v e f r a c t i o n s from the f i r s t DEAE-Sephace1 c o l u m n ; Lane C , p o o l e d a c t i v e f r a c t i o n s from the s e c o n d D E A E - c o l u m n ; Lane D , p o o l e d a c t i v e f r a c t i o n s from the B i o - g e l P - 3 0 0 c o l u m n ; L a n e s E - I a r e samples from s e q u e n t i a l f r a c t i o n s c o n t a i n i n g the a c t i v i t y peak e l u t e d from the MonoQ c o l u m n . The a r r o w i n d i c a t e s the p o s i t i o n of the fl-glucosIdase protein. The m o l e c u l a r w e i g h t markers were: p h o s p h o r y l a s e B , 9 7 , 4 0 0 ; b o v i n e serum a l b u m i n , 66,000; ovalbumin, 45,000; c a r b o n i c anhydrase, 29,000.  A  B C D E F G H I  27  F i g u r e 3. DEAE-Sephace 1 e l u t i o n p r o f i l e o f (5-gl ucos i d a s e . C e l l e x t r a c t (1100 ml, 6-7 g p r o t e i n ) was pumped o n t o the column a t 1 ml/min. The c o l u m n was washed w i t h 300 ml of s t a r t i n g b u f f e r and t h e n p r t e i n was e l u t e d w i t h a 1 L g r a d i e n t as d e s c r i b e d i n M a t e r i a l s and Methods. The f r a c t i o n s i z e was 6 ml and the f l o w r a t e was 1 ml/min. The b r o k e n l i n e i n d i c a t e s the peak o f PNPGase a c t i v i t y . The a c t i v i t y was m o n i t o r e d by a s s a y i n g 5 p i o f e a c h f r a c t i o n i n 25 p i o f PNPGase a s s a y m i x t u r e i n a 96 w e l l m i c r o t l t e r t r a y . Once the a c t i v i t y peak had been l o c a l i z e d e a c h f r a c t i o n was a s s a y e d f o r PNPGase as d e s c r i b e d i n M a t e r i a l s and M e t h o d s .  FRACTION  F i g u r e 4. E l u t i o n p r o f i l e of fl-glucosIdase from a s e c o n d DEAE-Sephacel column. The a c t i v i t y peak f r o m the f i r s t D E A E - S e p h a c e l c o l u m n was d i l u t e d 3-5 f o l d In s t a r t i n g buffer and r e c h r o m a t o g r a p h e d on a s m a l l e r c o l u m n . The f r a c t i o n size was 5ml and the f l o w r a t e was 1 ml/min. The b r o k e n l i n e i n d i c a t e s t h e peak o f PNPGase a c t i v i t y .  FRACTION  29  F i g u r e 5. B l o g e l - P - 3 0 0 chromatography of the fl-glucosidase a c t i v i t y peak from D E A E - S e p h a c e l . The a c t i v i t y peak from the s e c o n d D E A E - S e p h a c e l c o l u m n was c o n c e n t r a t e d 5-6 f o l d ( f i n a l volume 5-7 ml) by u l t r a f i l t r a t i o n and t h e n a p p l i e d t o a B i o g e l - P - 3 0 0 column. Sample a p p l i c a t i o n and c h r o m a t o g r a p h y were p e r f o r m e d u n d e r g r a v i t y f l o w . The f r a c t i o n s i z e was 3.6 ml a n d t h e f l o w r a t e was 0.1 ml/min. The b r o k e n l i n e indicates t h e peak o f PNPGase a c t i v i t y .  10  20  30  FRACTION  40  30  F i g u r e 6. FPLC a n i o n exchange (MonoQ) c h r o m a t o g r a p h y o f t h e ( l - g l u c o s i d a s e a c t i v i t y peak f r o m B i o g e l - P - 3 0 0 . The sample (5-10 ml) was pumped o n t o t h e c o l u m n a t a f l o w r a t e o f 1 ml/min. The g r a d i e n t was i n c r e a s e d q u i c k l y t o 20% b u f f e r B (0.2 M NaCl i n s t a r t i n g b u f f e r ) . When t h e major p r o t e i n peak was e l u t i n g ( 3 0 % b u f f e r B ) , t h e g r a d i e n t was s t o p p e d u n t i l the peak had f i n i s h e d e l u t i n g ( A ( 0 . 1 ) . The b r o k e n l i n e i n d i c a t e s t h e g r a d i e n t a s p l o t t e d on t h e c h a r t r e c o r d e r . The (?-gl ucos i d a s e a c t i v i t y p a r a l l e l e d t h e major p r o t e i n peak. F r a c t i o n s i z e was 0.5 ml. 2 a o  31  methionine  (Huang et a l . , 1983;Gross, 1967).  these r a r e amino a c i d s generates simplifies  their purification.  c l e a v e d at i t s methionine  Cleavage  at  fewer p e p t i d e s , which Accordingly,  fl-glucosidase  was  r e s i d u e s with cyanogen bromide  (CNBr). Reduced and a l k y l a t e d CNBr.  The  ft-glucosidase  was  c l e a v e d with  p e p t i d e s were analyzed by SDS-Urea PAGE ( F i g . 7 ) .  Urea c o n t a i n i n g g e l s were used to ensure the peptides (Fowler,  1978).  peptides to be of r e l a t i v e l y (approximately  3000).  a n a l y s i s showed the CNBr  low molecular weight  T h e r e f o r e , r e v e r s e d phase FPLC r a t h e r  than gel f i l t r a t i o n was peptides.  The  the s o l u b i l i t y of a l l  chosen f o r the p u r i f i c a t i o n of the  A representative elution p r o f i l e  shown in F i g . 8.  Both peptides CNBrl  and  of peptides i s  CNBr2 were c o l l e c t e d  from p r e p a r a t i v e r e v e r s e d phase s e p a r a t i o n s . from and  CNBrl  was  these p r e p a r a t i v e s e p a r a t i o n s whereas CNBr2 was sequenced from  two  pooled  collected  independently prepared batches  of  enzyme. Amino a c i d sequencing sequencing runs.  of CNBrl  determined  of CNBr2 y i e l d e d 23 amino a c i d s on each of  During the second  sequence was  sequencing  of CNBr2, a  o b t a i n e d at a higher l e v e l  Because the sequences were of unequal possible  20 r e s i d u e s ; two  contaminating  than that of CNBr2.  p r o p o r t i o n , i t was  to o b t a i n 21 amino a c i d r e s i d u e s f o r t h i s peptide  (CNBr3).  The  in F i g . 9.  amino a c i d sequences of these p e p t i d e s are shown  The  estimated q u a n t i t i e s of the CNBr peptides  f o r amino a c i d sequencing 200 pmol; CNBr3, 200 pmol. from the l e v e l degradation. independent  were: CNBrl,  1 nmol; CNBr2, 50  used and  These q u a n t i t i e s were estimated  of the f i r s t r e s i d u e analyzed from Edman Because only CNBr2 had been sequenced from  p e p t i d e p r e p a r a t i o n s , a r e g i o n from  i t was  two  chosen  for s y n t h e s i s of the s c r e e n i n g o l i g o n u c l e o t i d e . The nature ft-glucosidase  of the blocked amino terminus  was  to be a r t i f a c t u a l  not  i n v e s t i g a t e d ; however, i t was  when a sample of the p r o t e i n ,  d u r i n g the l a t e r stages of t h i s work, was sequencing  and  of the  used  determined  purified f o r amino a c i d  20 r e s i d u e s from the amino terminus were  32  Figure 7. SDS-Urea-PAGE a n a l y s i s of CNBr p e p t i d e s from fl-glucosidase. Lane A, molecular weight markers (2 pg each); 18,000, myoglobin; 12,000, cytochrome C; 6500, a p r o t i n i n ; Lane B, p u r i f i e d ft-glucosidase (0.5 pg); Lane C, CNBr p e p t i d e s (6 pg). Samples were made up to 8 M urea by d i s s o l v i n g 25 mg of urea in 35 p i of sample. T h i s was a 20% g e l and i t was f i x e d in 12.5% t r i c h l o r o a c e t i c a c i d p r i o r to s t a i n i n g .  A  B  C  33  F i g u r e 8. FPLC s e p a r a t i o n o f the CNBr p e p t i d e s from ATCC 21400 fl-glucosidase. A f t e r CNBr c l e a v a g e and c o n c e n t r a t i o n by 1 y o p h i 1 i z a t i o n , 500pg (10 n m o l e s ) o f fl-glucosidase were d i l u t e d t o a volume o f 1 ml w i t h 0.1% t r i f l u o r o a c e t i c a c i d and a p p l i e d i n two s e p a r a t e a l i q u o t s t o a P h a r m a c i a proRPC 5/10 r e v e r s e d phase FPLC c o l u m n . E l u t i o n was w i t h a l i n e a r g r a d i e n t o f i n c r e a s i n g a c e t o n i t r i l e c o n c e n t r a t i o n , 0 t o 50% i n a t o t a l volume o f 25 ml, i n 0.1% t r i f 1 u o r o a c e t i c a c i d . P e p t i d e s were numbered i n o r d e r o f t h e i r e l u t i o n . Peptides were c o l l e c t e d from two s e p a r a t e r u n s . Fractions containing p e p t i d e s C N B r l and CNBr2 were l y o p h i l l z e d t o n e a r d r y n e s s and used f o r amino a c i d s e q u e n c i n g .  F i g u r e 9. Amino a c i d s e q u e n c e s o f CNBr p e p t i d e s from t h e (5-gl u c o s i d a s e , a n d t h e p r e d i c t e d s e q u e n c e o f t h e s e p e p t i d e s a s d e d u c e d f r o m t h e DNA s e q u e n c e . Amino a c i d s i n agreement have a * between them. R e s i d u e s i n ( ) were a l s o p r e s e n t , r e s i d u e s i n N were u n c e r t a i n , N a l o n e i n d i c a t e s a h o l e i n t h e d e t e r m i n e d a m i n o a c i d s e q u e n c e w h i c h was f o l l o w e d b y a n o t h e r r e s i d u e , - i n d i c a t e s a m i s s i n g r e s i d u e f r o m one o f t h e s e q u e n c e s when b o t h were c o m p a r e d .  CNBr 1 aa DNA  sequence sequence  D N F E W A E G Y R A L A L Q T Y A K T M D N F E W A E G Y R M R F G L V H V Y D  CNBr 2 aa DNA aa DNA  sequence sequence  P F(G) Y L ( F ) V(A) H V D Y E T * * * * * * * * * * M R F G - L V H V D Y E T  sequence sequence  Q V S T V t W i N S G - W L Y it  it  it it  Q V R T V  K  it it it  it  it  N S G K W - Y  CNBr 3 aa DNA aa DNA  sequence sequence sequence sequence  S G H V F G R CH] * * * * * * * M P G H V F G R H  [N1 * N  A P D H Y C I N Q/W  *  * * *  A C D H Y N R W  *  G D I * * * G D I  t ] E D E  * * ED  N-term i n a l aa DNA aa DNA  sequence sequence sequence sequence  [T] D P N T L A A * * * * * * * * T D P N T L A A D F L F G V A T  i t i t i t i t i t i t i t i t  D F L F G V A T  [A] F P G * * * R F P G  35  determined  ( F i g . 9).  This type of a r t i f a c t u a l  b l o c k i n g i s not  uncommon when h a n d l i n g small samples because many compounds i n t e r f e r e with the m o d i f i c a t i o n and cleavage the reagents  used are very r e a c t i v e and  reactions.  Also,  must be of the h i g h e s t  p u r i t y to prevent  s i d e r e a c t i o n s that w i l l  Edman d e g r a d a t i o n  procedure  i n t e r f e r e with  the  (Dr. B. O l a f f s o n , personal  communication). Ill  Cloning Strategy. An o l i g o n u c l e o t i d e pool was  s y n t h e s i z e d corresponding  the r e g i o n of CNBr2 which would give the l e a s t degenerate sequence.  to DNA  This r e g i o n included the codon f o r amino a c i d 6 to  the second n u c l e o t i d e of the codon f o r amino a c i d  11.  o l i g o n u c l e o t i d e pool c o n s i s t e d of heptadecamers with p o s s i b l e n u c l e o t i d e sequences.  The  The 64  probes were s y n t h e s i z e d as  four separate p o o l s of 16 sequences each so that a high specific activity  of each r a d l o a c t l v e l y  o l i g o n u c l e o t i d e c o u l d be maintained. was  i d e n t i c a l except  labelled  Each of the four pools  at n u c l e o t i d e 6 ( F i g . 10).  Chromosomal DNAs from Agrobacter i um and E. c o l i d i g e s t e d with EcoRI and analyzed by Southern each of the probe p o o l s . e i t h e r DNA. fragment only  Pool  Pool  1 and  blotting  using  2 d i d not h y b r i d i z e to  3 h y b r i d i z e d to a 4Kb  i n the Agrobacterium  were  fragment and a  DNA,  1.4Kb  whereas pool 4  h y b r i d i z e d to h i g h e r molecular weight fragments in both E,. coli  and Agrobacter i um DNA  screen recombinant DNA  ( F i g . 11).  clones f o r the  Fragments i n the s i z e range b l o t a n a l y s i s of chromosomal DNA  Pool 3 was fl-glucosidase  i d e n t i f i e d by the were prepared  chosen to gene. Southern  f o r c l o n i n g by  e x t r a c t i o n from a low melting temperature agarose  gel.  fragments were 1igated into the EcoRI s i t e of the  plasmid  v e c t o r pUC13 and The  introduced into E. c o l i  v e c t o r and  host system was  JM109.  chosen because of s e v e r a l  factors: f i r s t ,  the e x p r e s s i o n of f o r e i g n genes from the  promoter in pUC  plasmids  product  (repressor).  These  i s r e g u l a t e d with the l a c I gene  Second, host s t r a i n s such as JM109  lacZ  36  Figure 10. The amino terminal sequence of peptide CNBr2 and the r e g i o n used to s y n t h e s i z e the o l i g o n u c l e o t i d e probes. The f i r s t 23 amino a c i d s of peptide CNBr2 were i d e n t i f i e d as p h e n y l t h i o h y d a n t o i n d e r i v a t i v e s (PTH's) from automated Edman d egr ad at io n. The PTHs were i d e n t i f i e d by HPLC a n a l y s i s . The r e g i o n corresponding to the codon f o r amino a c i d 6 to the f i r s t 2 n u c l e o t i d e s of the codon f o r amino a c i d 11 was used to s y n t h e s i z e a mixture of o l i g o d e o x y r i b o n u c l e o t i d e s to be used as h y b r i d i z a t i o n probes. The mixture was s y n t h e s i z e d as four pools. Each of the four pools was i d e n t i c a l in sequence except at n u c l e o t i d e 6, where pool 2 contained dT, pool 3 contained dG and pool 4 c o n t a i n e d dC.  Aalno Terminal Sequence of Peptide CNBr2 1 Pro  2 Phe  3 Tyr  4 Leu  5 Val  6 His  7 Val  8 Asp  9 Tyr  10 Glu  11 Thr  12 Gin  12 Gin  13 Val  14 Ser  15 Thr  16 Val  17 Trp  18 Asn  19 Ser  20 Gly  21 Trp  22 Leu  23 Tyr  CNBr2 Probe Region Aalno a c i d s :  6 His  7 Val  8 Asp  9 Tyr  10 Glu  NucleotIdes:  CAT/C  GTN  GAT/C  TAT/C  GAA/G  11 Thr AC  37  F i g u r e 11. S o u t h e r n b l o t a n a l y s i s of g e n o m i c DNA from A g r o b a c t e r i u m ATCC 21400 and E s c h e r i c h i a c o l i . Lanes A and C , E . c o l i C600 DNA (5 ug) d i g e s t e d w i t h E c o R I ; L a n e s B and D , A g r o b a c t e r i u m DNA (5 ug) d i g e s t e d w i t h E c o R I . The probe f o r l a n e s A and B was P l a b e l l e d o l i g o n u c l e o t i d e pool#3; Probe f o r l a n e s C and D was P labelled oligonucleotide pool#4. H y b r i d i z a t i o n s c o n t a i n e d 3 X 10* cpm o f p r o b e . (Specific a c t i v i t y of the p o o l # 3 p r o b e was 6 X 10** c p m / p m o l ; p o o l # 4 was 3 X 10 cpm/pmol). The r a d i o a u t o g r a p h was d e v e l o p e d a f t e r 60 h a t 25 * C . A r r o w s 1 and 2 i n d i c a t e the 4 . 0 and 1.4 Kb EcoRI fragments from A g r o b a c t e r i u m DNA which h y b r i d i z e d w i t h o l i g o n u c l e o t i d e pool#3. Arrow 3 i n d i c a t e s h i g h e r m o l e c u l a r w e i g h t fragments from b o t h DNA samples w h i c h h y b r i d i z e d w i t h oligonucleotide pool#4. 3 2  3 2  s  A B  C D  38  c o n t a i n the l a d *  mutation which produces  more r e p r e s s o r than  the w i l d type so that the e x p r e s s i o n of p o t e n t i a l l y t o x i c gene products then occurs o n l y by (Messing,  1983).  i n d u c t i o n of the l a c Z promoter  T h i r d , the JM109 host s t r a i n c o n t a i n s the  recA mutation which reduces recombination i n s t a b i l i t y of cloned D N A fragments 1985). F i n a l l y ,  that may  (Yanish-Perron et a l . ,  the high copy number of pUC  plasmids i s  d e s i r a b l e to enhance the d e t e c t i o n of recombinant hybridization 3 2  P  using  plasmids were screened  l a b e l l e d pool 3 o l i g o n u c l e o t i d e s .  analyzed by colony h y b r i d i z a t i o n . h y b r i d i z a t i o n with the probe. (5-gl ucos idase a c t i v i t y ; was  DNA  probes.  C o l o n i e s c o n t a i n i n g recombinant with  lead to  1061  c l o n e s were  Five of these gave p o s i t i v e  Only one  the recombinant  of these plasmid  expressed i t contained  designated pABG1.  IV C h a r a c t e r i z a t i o n of the c l o n e d (5-gl ucos idase gene A) Determination of the  i d e n t i t y of the  recombinant  p r o t e i n with the n a t i v e (5-glucosidase The Aarobacter i um (5-gl ucos idase hydrolyzes c e l l o b i o s e PNPG (Han and S r i n i v a s a n , thesis).  1969;  Day  C e l l e x t r a c t s of E. c o l i  PNPG and c e l l o b i o s e .  Control c e l l  and Withers,  1986;  by g.. c o l i  /PABG  Aarobacterium  The  1 was  this  harbouring pABGl h y d r o l y z e d e x t r a c t s of E.  coli  c o n t a i n i n g pUC13 had no d e t e c t a b l e enzymatic a c t i v i t y these s u b s t r a t e s .  and  l e v e l of c e l l o b i a s e a c t i v i t y  towards  produced  approximately 7% of the l e v e l in  (Table V).  Further evidence that the c l o n e d gene product and n a t i v e enzyme were i d e n t i c a l was e x t r a c t from E. coli/pABG1  the  provided by p a s s i n g the  cell  over an a f f i n i t y column c o n t a i n i n g  bound r a b b i t antiserum prepared a g a i n s t p u r i f i e d n a t i v e (5-gl ucos idase.  The  s p e c i f i c i t y of the antibody was  checked  using western b l o t t i n g a n a l y s i s of the native enzyme ( F i g . 12). cell  The column removed PNPGase a c t i v i t y extracts (Fig.13).  from E. c o l i /  A column prepared with normal  antiserum d i d not r e t a i n s i g n i f i c a n t q u a n t i t i e s of  pABGl rabbit  enzymatic  T a b l e V. /J-gl u c o s Idase a c t i v i t y In v a r i o u s E. c o l 1 c l o n e s a n d i n A a r o b a c t e r 1 u m .  Bacterial Stra in  Cellobiase <mU/mg)  ATCC 21400  112  PNPGase < mU/mg)  34.5  JM109 pUC13  <0.1  <0.1  JM109 pABGl  7.6  2.0  JM109 pABG2  ND *  2.0  JM109 pABG3  ND  2.2  JM109 pABG4F  ND  1.9  22.9  8.0  JM109 pUC13::dl1  b  JM109 pABG5 JM109 pABG5(IPTG)  218 14,300  62.5 4402  a)  ND, n o t d e t e r m i n e d  b)  The p l a s m i d p U C 1 3 : : d l l c o n t a i n s t h e same i n s e r t a s pABG5 e x c e p t t h a t i t i s i n t h e opposite o r i e n t a t i o n r e l a t i v e t o the lacZ promoter.  40  F i g u r e 12. W e s t e r n b l o t a n a l y s i s of (5-gl ucos i d a s e samples u s i n g r a b b i t a n t i - s e r u m r a i s e d to the p u r i f i e d n a t i v e p r o t e i n . Lane A , c r u d e c e l l e x t r a c t (50 pg)> Lane B , sample from the a c t i v i t y peak from D E A E - S e p h a c e l (5 p g ) ; Lane C , sample from B i o g e l - P - 3 0 0 a c t i v i t y peak (5 p g ) ; Lane D, MonoQ p u r i f i e d (5-gl ucos i d a s e ( 0 . 8 p g ) ; Lane E , c r u d e c e l l e x t r a c t from g^. c o l i (80 p g ) . Lanes A - E are coomassie blue s t a i n e d . Lanes F - J a r e e q u i v a l e n t to l a n e s A - E e x c e p t t h a t t h i s p o r t i o n o f the g e l was e l e c t r o b l o t t e d onto n i t r o c e l l u l o s e . The b l o t was i n c u b a t e d w i t h the r a b b i t a n t i s e r u m a t a 1:500 d i l u t i o n i n 1% b o v i n e serum a l b u m i n in p h o s p h a t e b u f f e r e d s a l i n e ( 1 % BSA i n PBS) f o r 16 h a t 4 ° C . Bound a n t i b o d y was d e t e c t e d w i t h g o a t a n t i - r a b b i t IgG c o u p l e d w i t h a l k a l i n e p h o s p h a t a s e . The a n t i b o d y c o n j u g a t e was used a t 1:6000 i n 1% BSA i n P B S . The s e c o n d a n t i b o d y i n c u b a t i o n was f o r 2 h a t 3 0 ° C . The p o s i t i o n of bound a n t i b o d y was d e t e c t e d by the h y d o l y s i s of BCIP by a l k a l i n e phosphatase. The a r r o w i n d i c a t e s the band o f s p e c i f i c antibody binding. The c r o s s r e a c t i v i t y o f the anti-serum with c o l i p r o t e i n s c a n be s e e n i n l a n e J .  41  Figure 13. Immunoadsorpt Ion of c o l 1 / P A B G 1 encoded (5-glucosidase by antiserum r a i s e d a g a i n s t the Aarobacterium (5-gl ucos idase . E_. co 1 i ce 11 e x t r a c t s c o n t a i n i n g (5-gl ucos idase a c t i v i t y were incubated with e i t h e r immobilized normal r a b b i t serum or immobilized s p e c i f i c ant i-(5-gl ucos idase serum < see M a t e r i a l s and Methods). 5mU of PNPGase a c t i v i t y were incubated with 2 mis of antibody c o n t a i n i n g g e l with shaking in f l a s k s f o r 16 h. The mixture was poured into a column and unbound m a t e r i a l was washed out of the column and assayed f o r PNPGase a c t i v i t y <A-*oo). The e l u t i o n p r o f i l e from the normal r a b b i t serum column i s shown with s o l i d c i r c l e s and e l u t i o n from the s p e c i f i c anti-serum column i s shown with open circles.  0.20  —  0.18  —  0.12  —  0.08  —  0.04  -  4 FRACTION  8  42  act i v i ty. The  d e t e c t i o n of enzymatic a c t i v i t y of the  a f t e r SDS-PAGE was  p o s s i b l e as  long as  b o i l e d p r i o r to l o a d i n g on the g e l . showed no n o t i c e a b l e proteins 14).  difference  gene product (see F i g .  Plasmid DNA 1.4,  experiments  migration  made p o s s i b l e the  B) Subcloning of the abg  of  not  of  the  from g e n t l y heated (37°C) or b o i l e d samples ( F i g .  This observation  cloned  the sample was  Control  in the  ft-glucosidase  2.7,  gene  from JM109/pABGl c o n t a i n e d  4.0,  6.0  and  m u l t i p l e EcoRI fragments  6.5  Kb.  r e s t r i c t i o n map  was  not  the  5 EcoRI  Because the  is l i k e l y  fragments d u r i n g  the  18).  fragments were s i z e s e l e c t e d before individual  i d e n t i f i c a t i o n of  fragments  restriction  c l o n i n g , the presence of the r e s u l t of  polymerizing  l i g a t i o n reaction.  made f o r t h i s plasmid.  A  Southern  b l o t t i n g a n a l y s i s , with the o l i g o n u c l e o t i d e pool#3 as a probe, showed that only a 1.4  Kb  fragment h y b r i d i z e d  suggested that the observed 4 Kb initially  was  chromosomal The  likely  fragment which h y b r i d i z e d  the r e s u l t of p a r t i a l d i g e s t i o n of  subclone was  obtained  d i g e s t i o n products of pABGl. EcoRI fragments.  The  first  original  5 EcoRI fragments.  was  obtained  by  i s o l a t i n g and  This 6.5  v e c t o r sequence. the  2.7  was  designated  Kb PstI  were examined f o r the The  c l o n i n g the  in the opposite  fragment contained  i t contained  maps of these c o n s t r u c t s  l e v e l s of  Kb PstI  are  ft-glucosidase  The  3 of  generated by the  subclones.  fragment cloning  This  clone  restriction 1acZ  Restriction  shown in F i g . 16  of these subclones had V).  l o s s of  the e n t i r e  o r i e n t a t i o n ( r e l a t i v e to the  promoter) compared to the previous  (Table  6.5  fragment of pABG3 into pUC18.  pABG4F since  EcoRI  second subclone, pABG3,  A f u r t h e r subclone was  Kb P s t l / S a l l  activity.  by c l o n i n g p a r t i a l  subclone, pABG2, contained  the  All  the  Clones which were p o s i t i v e on  i n d i c a t o r p l a t e s c o n t a i n i n g MUG  fragment  This  DNA.  first  of pABG2.  ( F i g . 15).  comparable l e v e l s of enzymatic  f a c t that pABG4F determined s i m i l a r  activity  i n d i c a t e d that e x p r e s s i o n  is  43  F i g u r e 14. D e t e c t i o n , of fl-gl ucos i d a s e a c t i v i t y a f t e r S D S - P A G E . Samples from the DEAE-Sephace1 a c t i v i t y peak were p r e p a r e d f o r PAGE by m i x i n g 1:1 w i t h s o l u b i l i z a t i o n b u f f e r (2% S D S , 10% 2 - m e r c a p t o e t h a n o l , 0.125 M t r l s - H C l pH 6 . 8 , 20% g l y c e r o l and 0.02% bromophenol b l u e ) . Samples f o r l a n e s A and C were h e a t e d a t 3 7 ° C f o r 10 min p r i o r to l o a d i n g on the g e l ; S a m p l e s f o r l a n e s B and D were h e a t e d a t 1 0 0 ° C f o r 2 min p r i o r to loading. 10 ug o f p r o t e i n was l o a d e d i n e a c h l a n e . Lanes A and B , c o o m a s s i e b l u e s t a i n e d ; L a n e s C and D, X - g l c activity stain. The arrow i n d i c a t e s the p o s i t i o n o f (S-gl ucos Idase a c t i v i t y .  44  F i g u r e 15. S o u t h e r n b l o t a n a l y s i s of p A B G l . L a n e s A and D> H i n d I I I d i g e s t e d lambda phage DNA, L a n e s B and E a r e A a r o b a c t e r i um g e n o m i c DNA (5 pg) d i g e s t e d w i t h E c o R I ; L a n e s C and F a r e pABGl DNA (1 pg) d i g e s t e d w i t h E c o R I . P a n e l 1 Is the e t h i d i u m s t a i n e d a g a r o s e g e l and P a n e l 2 i s the r a d i o a u t o g r a p h o f the s o u t h e r n b l o t o f the g e l a f t e r p r o b i n g with o l i g o n u c l e o t i d e pool#3. The arrow i n d i c a t e s t h a t the 1.4 Kb EcoRI f r a g m e n t h y b r i d i z e s t o the p r o b e . The h y b r i d i z a t i o n in lane E i s from the 4 Kb p a r t i a l l y d i g e s t e d g e n o m i c EcoRI fragment.  A B C  D E F  45  F i g u r e 16. L i n e a r r e p r e s e n t a t i o n s of v a r i o u s fl-glucosidase encoding plasmids. The d i r e c t i o n of t r a n s c r i p t i o n from the l a c Z promoter i n pUC13 and pUC18 i s shown with the arrow at the t o p . The darkened area r e p r e s e n t s the vector DNA. The c r o s s - h a t c h e d area r e p r e s e n t s the area of the plasmid which h y b r i d i z e s the o l i g o n u c e l o t i d e probe. Only r e l e v e n t r e s t r i c t i o n s i t e s are shown. These s i t e s are represented as f o l l o w s : Sc, S e a l ; E, EcoRI; P, P s t I ; S, S a i l ; H, H i n d l l l ; Ss, SstI. The d o t t e d l i n e i n d i c a t e s the r e g i o n d e l e t e d from pABG2 to c o n s t r u c t pABG3.  lacP Sc  Sc  E  PE  Li  E  P  E  Sc p ABG2  P  P  S  E  S  E  Sc pABG3  Sc  S  E  H  P  Sc pABG4F  Sc  SsHEcp  Sc pABG5  0 1  2  I  4  I  6  I  8  I  10  |  | (Kb)  46  independent of the p r e s e n t on  the  known t r a n s c r i p t i o n / t r a n s l a t i o n  v e c t o r , that  transcription/translation the  DNA C)  fragment, and Determination of aba  The  they f u n c t i o n  the  d i r e c t i o n of  pABG4F c o n s t r u c t r e t a i n e d T h e r e f o r e , the  CNBr2 peptide  contained  in the  found 273  M13mpl0 clone and  DNA  the  CNBr2 peptide  ( r e f e r to F i g s .  molecular weight of the  the  transcription of the  must be  insert  9 and  t e r m i n a t o r near the  Sail  end  V Increased e x p r e s s i o n of Once the  3*  end  of  DNA 20).  gene product as  the  the  1.5  Kb)  first  in pABG4F, and  the  multiple  cloning  from the  vector by  an  the  5' end  bp  such that  depend on r e t a i n i n g  the  to  be The the  was  Given the  the  apparent  50-52,000 ( t h i s then the  start  of  s i t e at the  PstI  been  were made u s i n g Using pABG4F as  from the  unique Ndel  PstI s i t e  Fragments were with S a i l  been p r e v i o u s l y  deletions  Kb  using  (5-glucos idase gene had  i s 223  1.4  EcoRI/Sall  sequence of  were made s t a r t i n g at the  into pUC13 which had  orientation  end  gene  subsequent d i g e s t i o n The  Sail  (J-glucosidase  s i t e of pUC18).  ( F i g . 17).  bp  16).  mung bean n u c l e a s e .  of pUC18 ( t h i s s i t e  600  ( r e f e r to F i g .  Exonuclease III and  Sail  on  transcriptional  near the  deletions  The  Hindlll  l o c a l i z e d deletions s u b s t r a t e , DNA  the  transcription  predicted  near the  of  v e c t o r s M13mpl0/ll.  of  r e q u i r e s a mRNA of approximately  Kb  probe s i t e ) should  M13  direction  verifying  and  of  sequence c o r r e s p o n d i n g  bases from the  determined by  cloned  transcription  only 0.6  (oligonucleotide  sequenced  probe r e g i o n was  site  present  in g.. c o l i .  in t h i s r e s t r i c t i o n fragment.  fragment was  end  f o r t h i s gene are  gene  EcoRI fragment. the  A a r o b a c t e r i um  signals  that  signals  in  the  liberated and  were  d i g e s t e d with Smal  were cloned  into pUC13 with  e x p r e s s i o n of (5-gl ucos idase would Aarobacter ium  t r a n s c r i p t ion/trans1at ion s i g n a l s . Several active  c l o n e s were examined for  insert size.  The  47  F i g u r e 17. E x o n u c l e a s e I I I d i g e s t i o n o f pABG4F. DNA (12 u g , 7 pmol of 5' e n d s ) was d i g e s t e d w i t h N d e I . A f t e r phenol e x t r a c t i o n and e t h a n o l p r e c i p i t a t i o n the DNA was t r e a t e d w i t h 135 U n i t s of E x o n u c l e a s e I I I i n the f o l l o w i n g b u f f e r : 66 mM t r i s - H C l , pH 8 . 0 , 90 mM N a C l , 5 mM M g C U , 10 mM d i t h i o t h r e i t o 1 ( f i n a l volume 100 p i ) . Samples (25 p i ) were t a k e n a t 20 m i n . i n t e r v a l s and the r e a c t i o n was t e r m i n a t e d by a d d i n g the samples to 6 p i of i c e c o l d 5X SI b u f f e r (5X SI b u f f e r : 250 mM sodium a c e t a t e , pH 4 . 0 , 250 mM N a C l , 30 mM Z n S O * ) . The samples t h e n were t r e a t e d w i t h 75 U n i t s o f mung bean n u c l e a s e , and t h e s e r e a c t i o n s were t e r m i n a t e d by p h e n o l e x t r a c t i o n and ethanol p r e c i p i t a t i o n . DNA t a k e n a t e a c h time p o i n t was t h e n d i g e s t e d w i t h S a i l to l i b e r a t e the i n s e r t DNA from the v e c t o r DNA. Lane A , H i n d I I I / E c o R I d i g e s t e d lambda DNA; L a n e s B - E , 2 0 , 4 0 , 6 0 , a n d 80 m i n . time p o i n t s r e s p e c t i v e l y . The a r r o w #1 i n d i c a t e s i n s e r t DNA and the a r r o w #2 i n d i c a t e s v e c t o r DNA.  A  B  C  D  E  48  smallest  I n s e r t from an a c t i v e clone contained  This fragment was then cloned  i n the opposite  1.6 Kb of DNA. orientation ln  pUC18 such that the presumed 5' end would be adjacent l a c Z promoter/operator r e g i o n . pABG5 ( r e f e r The about V). and  expression  of  10% the l e v e l  ft-glucosidase  designated  observed  from JM109/pUC13::d11 i s  i n uninduced JM109/pABG5 of the r e l a t i v e  of the Agrobacter ium promoter present  i n d i c a t e s that e x p r e s s i o n  promoter  was  to F i g . 16.).  This g i v e s an i n d i c a t i o n  co1i,  T h i s plasmid  to the  strength,  on t h i s  from the pUC d e r i v e d  i s not f u l l y repressed  (Table i n E.  fragment, lacZ  i n JM109 under these  growth  cond i 11ons. (5-gl ucos i dase was expressed addtion  i n JM109/pABG5 without the  of IPTG; however, e x p r e s s i o n  increased  approximately  6 0 - f o l d upon the addtion  of IPTG to l i q u i d c u l t u r e s (Table V ) .  The  c o u l d be seen i n whole c e l l  induced  gene product  extracts  examined on SDS-PAGE and the induced  p r o t e i n from pABG5 was  shown to have (5-gl ucos idase a c t i v i t y  i n the a c t i v i t y g e l  system ( F i g . 1 8 . ) . induction  The l e v e l of a c t i v i t y  i s approximately  the parent  100-fold higher  Agrobacterium s t r a i n .  overproducing  in JM109/pABG5 upon than that found i n  (5-gl ucos idase  in t h i s  E.. c o l i s t r a i n was c a l c u l a t e d to be 5% of the  soluble p r o t e i n . VI Sequence of the abg gene A) Determination The Fig.  of the sequence  s t r a t e g y f o r the sequence d e t e r m i n a t i o n  19.  i s shown i n  The sequence was determined using the chain  terminator  method (Sanger's dideoxy) f o r the e n t i r e length and  using the chemical  method (Maxam and G i l b e r t ) f o r one r e g i o n .  P a r t s of the r e g i o n from n t . -920-1O70 we're ambiguous when sequenced by the dideoxy method; however, the a m b i g u i t i e s i n t h i s r e g i o n were c l a r i f i e d using the chemical restriction sites of s p e c i f i c of them.  i n the i n s e r t  method. A l l  of pABG5 used i n the c l o n i n g  fragments were v e r i f i e d by sequencing through each  The 1599 bp sequence of the recombinant DNA fragment  49  F i g u r e 18. S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e t i c a n a l y s i s o f whole c e l l e x t r a c t s from E. c o l i c l o n e s c o n t a i n g various fl-gl u c o s i d a s e e n c o d i n g p l a s m i d s . Cultures of c o l 1 /JM109 e a r r i n g v a r i o u s p l a s m i d s e n c o d i n g (3-gl u c o s i d a s e w e r e e x a m i n e d f o r p r o t e i n s w h o s e s y n t h e s i s was i n d u c e d a f t e r t h e a d d i t i o n o f IPTG. E a c h s t r a i n i s r e p r e s e n t e d by a p a i r o f l a n e s . The second lane o f e a c h p a i r i s from the c u l t u r e w h i c h r e c e i v e d IPTG. Lanes A and B a r e from JM109/pUC13; L a n e s C a n d D a r e f r o m J M 1 0 9 / p A B G 5 ; L a n e E i s p u r i f i e d A g r o b a c t e r i um C l - g l u c o s i d a s e ; L a n e s F a n d G a r e f r o m JM 1 0 9 / p U C 1 3: : d 1 1 w h i c h h a s t h e same i n s e r t a s pABG5 b u t i n t h e o p p o s i t e o r i e n t a t i o n ; Lanes H and I a r e from JM109/pABGl; Lanes J and K a r e from an X-glc o v e r l a y g e l and are e q u i v a l e n t to lanes D and E. F o r t h e c e l l e x t r a c t s 30 p g o f p r o t e i n w e r e l o a d e d in each lane, f o r the p u r i f i e d fl-glucosidase 1 ug o f p r o t e i n was l o a d e d in a lane .  50  F i g u r e 19. S e q u e n c i n g s t r a t e g y f o r the abg gene. A) A s c h e m a t i c s h o w i n g the l o c a t i o n o f the abg c o d i n g r e g i o n w i t h i n the s e q u e n c e d f r a g m e n t . The i n i t i a t i o n c o d o n and p u t a t i v e t e r m i n a t i o n codon are i n d i c a t e d . B) A l i n e a r r e p r e s e n t a t i o n o f the i n s e r t DNA i n pABG5 s h o w i n g the r e s t r i c t i o n e n d o n u c l e a s e s i t e s used i n the c l o n i n g of s p e c i f i c fragments f o r s e q u e n c i n g . E, E c o R I ; H, H i n d I I I ; HS, h y b r i d Smal s i t e g e n e r a t e d from l i g a t i n g a b l u n t ended e x o n u c l e a s e I I I d e l e t i o n f r a g m e n t i n t o the Smal s i t e o f pUC18; R, R s a l ; S, S a i l . C) Summary o f t h e s e q u e n c i n g r e a c t i o n s w h i c h were used i n the s e q u e n c e d e t e r m i n a t i o n . The a r r o w s d e n o t e the d i r e c t i o n and l e n g t h o f t h e sequence d e t e r m i n e d from e a c h r e a c t i o n . Each a r r o w i s l a b e l l e d t o i n d i c a t e the n a t u r e o f the t e m p l a t e DNA o r the o r i g i n o f the p r i m e r used i n t h a t s e q u e n c i n g r e a c t i o n . 1, sequence o b t a i n e d w i t h c l o n e d r e s t r i c t i o n f r a g m e n t s ; 2, sequence o b t a i n e d w i t h s p e c i f i c o l i g o n u c l e o t i d e p r i m e r s ; 3, sequence d e r i v e d from d e l e t i o n c l o n e s by t h e d i d e o x y method; 4, sequence d e r i v e d from Maxam and G i l b e r t c h e m i c a l sequencing.  A)  ATG I  ABG 458aa  HS B)  R  I  1  J  •  •  . ,  1  0  .  H  HE  I  L_l  . .  « 1 «.  I  I  •  I  I  *  I  I 500  I  I  I  .  I  2  <  2  I  >  •  4—— ——J  I  2  I  1  '  TGA I  I 1000  «  I  ^  l _ l  >  1.  ,  I  I 1500  1  (bp)  51  from pABG5  is  first  after  the  5'  ends a t  the  last  base  sequence  B)  A n a l y s i s of  the  The  DNA s e q u e n c e a region  21).  This  regulated the  of  speculation  initiation This sequence  homology  this  to  the  al.,  42-46)  in a p o s i t i o n  ribosome  binding  The  region  contains  1981).  Sail  The  site.  control  Salmone11a  of  with  nitrogen  1986).  homology is  the  promoters  t v p h i mur i um a r g T r  (Dixon,  abg  codon  known E . c o l i  homology  of  signals  gene  It  is  functions  as  independent  of  a  its  and f u n c t i o n s is  not  in E . c o l i . followed  consensus ribosome However, where  the  it  by a  binding  sequence  site  ATGGA  may f u n c t i o n  as  (nt.  a  site. downstream  a sequence  at  f o r m i n g a stem l o o p involved  has  region  present  AGGA ( G o l d e t occurs  the  pUC18.  initiation  two  promoter r e g i o n  homologous  the  of  at  (Table V ) , which suggests a t r a n s c r i p t i o n  is  putative  the  with  expression  signal  of  put i d a x y l A gene  i n pUC18  starts  Smal s i t e  and t r a n s l a t i o n a l upstream of  that  however,  the  nucleotide  from the  Pseudomonas  orientation  of  region also  promoters  promoter;  half  The s e q u e n c e  sequence  Trancriptional  (Fig.  only  i n F i g . 20.  1)  contains  and  shown  nt.  from the  translational  stop  codon  1476-1496 w h i c h may be c a p a b l e  structure.  Such s t r u c t u r e s  in t r a n s c r i p t i o n termination  appear  (Rosenberg  and  of  to  be  Court,  1979). 2)  The s t r u c t u r e a)  The letter  General  of  the  features  abg gene  of Abg  d e d u c e d amino a c i d s e q u e n c e  amino a c i d code  translational codon at  nt.  start  of  54 by a l i g n m e n t  sequence.  U s i n g the  protein  458  of  above  site  aa,  product  the the of  translation  is  given  DNA s e q u e n c e gene was the  (Fig.  localized  amino t e r m i n a l  s t o p codon at  molecular weight  i n the  50,983,  nt.  one 20).  to  The  the ATG  protein 1431,  a  c o u l d be p r o d u c e d .  52  Figure 20. N u c l e i c a c i d sequence and deduced amino a c i d sequence of the ft-glucosidase gene. Numbering s t a r t s at the f i r s t non-vector n u c l e o t i d e a f t e r the h y b r i d Smal s i t e of pABG5. Peptide sequences obtained by amino a c i d sequencing are shown u n d e r l i n e d . Sequences that may form stem loop s t u c t u r e s are shown as opposing arrows. An 11 bp d i r e c t l y repeated sequence i s a l s o shown with arrows. The boxed area is the p u t a t i v e promoter sequence.  AOCCOAC/^GOTCTfcAACCCCTCCTOATCTTtr^ ""l3 30  -A 43  60  73  B  E  E  a  P  90  L F 0 V A T A S F Q I E G S T K A D C R K P S I U D A F C N M P 0 TOTTTOCCOTCeCAACTCCCTCOTTCCACATCCAACOTTCCACCAAGCCCCATCOCCCCAACCCCTCCATCTCGCATGCCTTCTCCAATATCCeCOCCC 114 139 144 139 174 189 H V F O R H N C D I A ATOTCTTCCCOCOTCACAATGGCGATATCOCCTGCGATCATTACAATCCCTGGGACCAAGACCTCeATCTCATCAAOGACATCGCOGTCGAGCCCTATC 213 228 243 238 273 268 R F S L A W P R I I P D O F O P X N E K O L D F Y D R L V D Q C K QTTTCTCGCTCCCCTGCCCGCCCATCATTCCCCATGGTTTCGOGCCCATCAACCACAAGGCTCTCGATTTCTACGACCGTCTCGTTGATGGCTGCAAGG 312 327 342 337 372 387 A R O I K T Y A T L Y H W D L P L T L M O D Q C W A S R S T A H A CACOCQCQATCAAOACCTATCCQACQCTQTACCATTGQOATCTGCCGC T C A C C C T G A T G G G G O A T G O C O G C T C G O C T T C C C G C T C C A C G G C A C A T G C C T 411 426 441 436 471 486 F O R Y A K T V M A R L O D R L D A V A T F N E P W C A V W L S H TCCACCOTTACOCCAAGACCGTCATGGCCCGCCTAGGCGACCCGCTGGATGCGOTTGCGACCTTCAACCAGCCTTCGTGCGCCGTCTGGCTCACCCATC 310 323 340 333 370 383 L Y O V H A P Q E R N M E A A L A A M H H X N L A H Q F G V E A S TCTATOGC0TCCACCC0CC8OGCGACCCCAACATOGAOCCS0CCCTTOCCGCCATCCACCATATCAACCTCGCCCATGGTTTC0GCGTGGAAGCTTCCC 609 624 639 634 669 684 R H V A P K V P V 0 L V L N A H 8 A I P A S D O E A D L K A A E R CCCATGTCeCOCCCAAAOTCCCGOTCCGGCTGOTATTCAACGCCCATTCCCCTATTCCCGCCTCCCATCCCCACCCTCATCTCAACCCGCCCOACCCCO 708 723 738 733 768 783 A F a F H N O A F F D P V F K O E Y P A E M M E A L O D R M P V V CCTTCCAOTTCCACAATOGCOCOTTCTTTOACCCCOTCTTCAAGGGCOAATATCCCGCCOACATCATGCAAGCGCTGGOTGATCGTATGCCTGTCOTOO 807 822 837 832 867 882 E A E D L C I I S Q K L D U U O L N Y Y T P M R V A D D A T P O V AeCCGOAACACCTCCCCATCATCAGCCAGAACCTTOACTCOTCCCOCCTCAATTATTACACCCCCATOCCCCTCGCCCACGACCCCACACCCGCCCTCG 906 921 936 931 966 981 E F P A T M P A P A V S D V K T D I O W E V Y A P A L H T L V E T AATTCCCCOCeACTATOCCCCCACCOOCOOTCACCeATOTGAAOACCOATATCCCCTGOCAOOTTTACCCTCCCGCGCTGCATACOCTCOTCOACACCC 1003 1020 1033 1030 1063 1080 L Y E R Y D L P E C Y I T E N O A C Y N H O V E N O E V N D O P R TCTACOACCOTTACOACCTCCCOOAOTQCTACATCACCOAAAACCCCOCCTCCTACAATATOOQCQTCGAAAACCCCCAOOTQAATOACCACCCQCOTC  1104  1119  TT34  r  1149  1164  9  1179  D Y Y A E H L O I V A D L X R D O Y P M R O Y F A W S L M D N_ TCOATTATTACCCCGAACACCTCCGCATCOTCOCCGATCTCATCCCTOACCGTTACCCGATCCGCGGTTATTTCCCCTGCACCCTGATGCATAATTTCO 1203 1218 1233 1248 1263 1278 E U A E O Y R M R F O L V H V D Y E T Q V R T V K N S O K W V S A AATCOOCCOACOGTTACCGCATCCGTTTCCGGCTCOTGCATGTGGATTATGAGACCCAGCfTeCGOACOOTGAAGAATAGCGGCAAGTGGTACAGCGCGC 1302 1317 1332 1347 1362 1377 L A B O F P K O N H Q V A K C * > 4 ,, It TC^TTCCOOTTTTCCOAAOGOOAACCATCGCOTTGCCAACGGOTOACOTTTTCTCTCCTCATCCCTCTCCTCOTCACATSGGTACTAGCCAOCCCAfTOT 1401  1416  1431  1446  1461  1476  COCCTGAOGGGAOTCTTTCCCCACCCCGAACGCGTeTCGOCTAAATTCCTGTCACAAOCACAGCAATOACGCTGGCCACGCCCCCTGATCCOTAA 1300 1313 1330 1343 1360 1373  AATTCAACTOTCOAC 1394  53  F i g u r e 2 1 . N u c l e i c a c i d s e q u e n c e h o m o l o g y o f t h e a b g 5' f l a n k i n g r e g i o n w i t h known p r o m o t e r s e q u e n c e s . A) Homology w i t h the t y p i c a l "-35" and "-10" r e g i o n s of p r o k a r y o t i c promoters (Hawley and McClure, 1983). T h e ampC a n d a r a C g e n e s a r e b o t h E. c o l i g e n e s . B) Homology w i t h t h e n i f - 1 i k e promoters. The arg.Tr g e n e i s f r o m S a l m o n e 11a t y p h i m u r i u m a n d the x y l A gene i s from Psuedomonas p u t i d a . Both of these promoters a r e r e g u l a t e d by n i t r o g e n l e v e l s i n t h e c e l l which a f f e c t the expression of a p r o t e i n which acts a t a positve r e g u l a t o r a t these s i t e s (Dixon, 1986).  A) P r o k a r y o t i c  "consensus"  homology "-10"  "-35"  TATAAT  consensus  TTGACA  ampC  TTGTCA  17bp  TACAATC  abg  TGGTCT  17bp  TTCACAT  araC  TGGACT  16bp  GACACTT  B) N i t r o g e n consensus  regulated  promoter  TGG C/T A C/T  axa.Tr  ATGG  C  abg  ATGG  T  xvlA  ATGG  C  A  T  C A  homology TTGC A/T  AAGACCTGC  A  T AAACCGCTGC T T  GGCGGTTGC  T  54  T h i s agrees with  the  f o r the n a t i v e and The  observed molecular  recombinant  proteins.  sequences of the amino t e r m i n i of the p r o t e i n and  3 CNBr peptides  are  underlined.  determined peptide shown in Figure  The  sequences with  9.  The  agreement of  l i k e l y due  the  small amounts of peptide 10 r e s i d u e s  material  The  peptide  long as deduced from the DNA  p o s s i b l e that the p r e p a r a t i o n incomplete cleavage  product  (downstream) CNBr p e p t i d e . sequence f o r the  20 r e s i d u e s .  contained  containing  The  CNBrl  was  It is  a small q u a n t i t y of the  10 r e s i d u e s  the  then a very  low  incorrectly  because of high background s i g n a l s . amino a c i d compositions of the deduced p r o t e i n  and  that determined f o r the n a t i v e p r o t e i n are shown in Table The  d i f f e r e n c e s in the  are q u i t e high. be and  The  values  reason f o r these  anomalous values  VI. lys  could  significantly  d i s p r o p o r t i o n a t e l y to the e s t i m a t i o n of the amounts of M Kay, personal c  An amino a c i d composition f o r Aarobacter1um PAGE (Smith,  ft-glucosidase  1972).  from polyacrylamide  I t has  a d d i t i o n , the r e p o r t e d thio-diglycol  had  p r e v i o u s l y been determined  p u r i f i e d by  been shown that (Brown and  yeasts  impurities eluted  h y d r o l y s i s c o n d i t i o n s d i d not  that composition  was  on  In include  phenylalanine  For these  reasons  made.  been proposed that (5-gl ucos idase is a p e r i p l a s m i c p r o t e i n (Kohchi  A l t et a l . , 1982;  influence  Howard, 1983).  t y r o s i n e from o x i d a t i v e decomposition. It has  non-denaturing  or phenol to p r o t e c t methionine,  no comparison with  the  communication).  g e l s can have a s i g n i f i c a n t  the amino a c i d composition  and  f o r s e r , glu+gln, g l y , and  that minor p r o t e i n contaminants c o n t r i b u t e d  amino a c i d s (Dr. D.  and  an  adjacent  This would have produced  first  <Dr.  sequence;  of the next amino a c i d s which then were  assigned  sequences  used f o r sequencing  communication).  however, the determined sequence was  level  the  to amino a c i d sequencing a r t i f a c t s because of  R. O l a f f s o n , personal  correct  the  the deduced sequences i s  d i f f e r e n c e s between these  are  only  weight of 50-52,000  Stoppok et a l . , 1982).  s t r u c t u r e a s s o c i a t e d with p e r i p l a s m i c and  in some b a c t e r i a and  One  Toh-e,  1986;  characteristic  other  secreted  T a b l e V I . C o m p a r i s o n o f t h e amino a c i d composition of the (5-glucosidase p r o t e i n w i t h the c o m p o s i t i o n d e d u c e d from t h e a b g gene  Prote in *  Amino a c i d  DNA  Asn + Asp  54  51  Thr  19  19  Ser  19  16  Gin + Glu  40  34  Pro  29  26  Gly  48  43  Ala  54  53  Val  32  30  Met  15  15  lie  14  16  Leu  36  34  Tyr  21  22  Phe  21  22  His  17  17  Lys  19  16  Arg  23  24  Trp  ND  13  Cys  ND  6  Total  r e s idues  M.W  a) average  460 " 50-52,000  values  c ) M.W was e s t i m a t e d analys1s.  50,983  c  from two  b) r e s i d u e s c a l c u l a t e d a M.W o f 50,000  458  determinations.  assuming  from SDS-PAGE  56  proteins  Is a leader sequence.  T h i s amino a c i d  f u n c t i o n s to h e l p t a r g e t p r o t e i n s f o r t r a n s p o r t membranes (Pugsley and Schwartz, 1985).  sequence across  The c e l l u l a r  location  of the Abg p r o t e i n was not determined in t h i s study, but i t may be in the periplasm  (Smith, 1972).  is not preceded by a p o t e n t i a l e i t h e r a cytoplasmic location of an i n t e r n a l  The abg gene product  l e a d e r sequence.  This suggests  f o r t h i s p r o t e i n or the presence  sequence which i s used as a s i g n a l f o r  transport. b) Comparisons of the Abg sequence with other ft-glucosidase  sequences  At p r e s e n t , only two complete (5-glucos idase gene sequences have been determined , abg (This t h e s i s ) and the C_. pel 1 i c u l o s a  gene, cpb (Kohchi and Toh-e,  1985).  A DNA  sequence has a l s o been determined from an S. commune complimentary DNA clone c o n t a i n i n g part of the (1-glucos idase gene ( M o r a n e l l i e t a l . ,  1986).  A comparison of these DNA  sequences d i d not r e v e a l any s i g n i f i c a n t DNA homologies not  (data  shown). The deduced amino a c i d sequence of the C_. pel 1 i c u l o s a  fl-glucosidase partial  (Cpb) c o n t a i n s a r e g i o n with 43% homology  to the  sequence deduced from the S_. commune fl-gl ucos idase  (Scb) ( M o r a n e l l i e t a l . ,  1986).  A comparison was made of the  homologous r e g i o n s from Cpb and Scb with a r e g i o n from Abg ( F i g . 22). The homology was  between  Abg and Cpb i n t h i s r e g i o n  10.9% (21/192), and there were 13/192 c o n s e r v a t i v e amino  a c i d changes).  The homology  with the Scb sequence was 17.2%  (33/192), and there were 10/192 c o n s e r v a t i v e changes. was no s i g n i f i c a n t homology  There  of Abg with Cpb outside of t h i s  reg i on. A potential active site  f o r the S_. commune fl-gl ucos idase  has been proposed by analogy with the a c t i v e s i t e of hen egg white lysozyme ( M o r a n e l l i e t a l . ,  1986).  A related  arrangement of p u t a t i v e a c t i v e s i t e residues a l s o occurred i n the C_. pe 11 icu 1 osa p r e d i c t e d amino a c i d sequence, and there was a s i m i l a r arrangment  i n the p r e d i c t e d Abg amino a c i d  57  F i g u r e 22. R e g i o n s o f amino a c i d homology In t h e d e d u c e d amino a c i d s e q u e n c e s o f t h e fl-gl ucos l d a s e s from A g r o b a c t e r 1 um ( A b g ) , commune ( S c b ) , and C. p e l 1 I c u l o s a ( C p b ) . R e g i o n s o f homology a r e shown In b o x e s . The f o l l o w i n g symbols a r e u s e d : @, d e n o t e s a c o n s e r v a t i v e change In t h e amino a c l d ; . Q , a amino a c i d from Abg t h a t h a s a c o n s e r v a t i v e change from t h e Cpb s e q u e n c e . The p o s i t i o n s o f t h e s t a r t i n g amino a c i d s from e a c h sequence a r e as f o l l o w s Abg 195, S c b 1, and Cpb 499. S p a c e s have been I n t r o d u c e d In t h e s e q u e n c e s t o maximize t h e h o m o l o g i e s .  Abg  A AJ4JH H I N L  Scb  A  AQT  A  A  Cpb  N  Abg  A  I  R H© A P  Ml D S - S  D  A G  D  L N  A  W  H  D G  Cpb  Y G  D  L N  T L  W  H  N A  Abg  F  Scb  V  F  pFl V F G I A  cpbHS|G]Q  K  G  -  I JTj T Q  LLI  D  L  D L  G  Scb  P  © P  V  V  A  L  P  L  K  A A E R  A ] F ( § ) F  V N A e A N § V A D I0 N I S S I N  - -  -  H  N  P A T M P A P A V S D V  Abg  F  Scb  L Y E S S A N V P D  D - - - -  Abg  T Y L "E]R  Scb  P IRIF  Cpb  V  E  F  §  V  R Y E  F  -  V  V E A E D R M © 7 A W I E P N V K A V V W S G L P G N A G N @ i CJ n r ist iff P F _IJD N E N V T A V I Y S S Y L G M E  Y P A E  A  9  G  D  <D  e  G["A]F  N T I vfl  I - [ T | S Q K L ( f 3 ) W W - r G L N N j Y T P M (R) VA D D A T Y Scb S V A D [i L Y G A Y N P S G R L P Y T I A K | S A D D ^ @ § F A K V|L e G D N P S G K L P F T I A K p v N|D Y  K  V  N T I V AV  AbgQG  Cpb  G L  D S G E G Y L T V E G N & V ® G E EQ G D V D G N  A  L N A H S A 0 P  D  K  -  I  @  T D I  D - Y S E  G  W  E  G  L  L  A N V  v©Hl  P A L H T L V  @ @ § V P D P V D KJF T E f s I Y V —•  G oqEj  D D  YR H YR Y  F F  D D  A N G Y N  V  e I K  E E P  58  F i g u r e 23. The homolgy of v a r i o u s {i-1,4-gl ucanases a t a p u t a t i v e a c t i v e s i t e proposed by analogy with Lysozyme. HEWL, hen egg white lsysozyme; Abg, Agrobacter i um fi-glucosidase; Cex, C. f i m i e xogl ucanase; EGI, S. commune, endogl ucanase I; CBHI, J_. reese i ce 11 ob i ohydrolase I; Scb, S_. commune ft-gl ucos idase ; CenA, f 1ml endogl ucanase A; Cpb, C_. pel 1 i c u l o s a . (5-gl ucos idase; Awb, A. w e n t i i , ft-glucosidase A ; Bab, B i t t e r almond ft-glucosidase A. The numbers above the HEWL sequence denote amino a c i d s i n v o l v e d in the a c t i v e s i t e of HEWL (these amino a c i d s are shown i n italics). Spaces have been introduced into Abg, Cex, and CenA to a l l o w alignment of the i n i t i a l g l u t a m i c a c i d r e s i d u e . The symbols used a r e : *, a homologus amino a c i d ; ©, a c o n s e r v a t i v e change i n amino a c i d s . 3  Enzyme  AA*  Active s i t e 1  HEWL  34  sequence  Reference  2  34  F E S N F N T Q A T N R N T D G  *  *  V E F P A T M P A P  -  @  *  s  *  A V S D V K T D I  Abg  310  Cex  33  S  EGI  32  N  CBHI  64  N  Scb  159  Y  CenA  307  F  Cpb  606  I E K V D V P D P V D K F T E S I T V D  b  c  Bab  *  F N L V V A E S C A E  * * T C A K @ * S s A Q @  @  Y A V G @  -  *  N A M K W D A  *  259  c  ii  § 7" E P  i i i  * @ F G N Q N I P G V K N T D Y * N C C L D G A A Y A S T Y G @ * V P D I D Y S E G L L V D y * N T S N Y Q T T A D F A L * @ * A Z L G F Z G F V M S D  Awb  Cpb*  * E * E * E * E * E *  i  T D Y  i i iv i i i iv  W  V  * * * * * * T D W Y L L N Y L L K E L G F Q G F V M e a @  * * *  @  I T  H  z  Z G  -1,  X  V  X  F G s D  iv vi  a) The s t a r t i n g p o s i t i o n i n the amino a c i d sequence. b) T h i s sequence was a l i g n e d with lysozyme. c) These amino a c i d s were determined by p r o t e i n sequencing of a peptide i d e n t i f i e d as being i n v o l v e d l n the a c t i v e s i t e of these p r o t e i n s . Refer to the t e x t f o r d e t a i l s . d) This sequence was a l i g n e d with the went i i p e p t i d e . References:  i . Palce e t a l . , 1984 11. This work . 111. Warren e t a l . , 1987 Iv. M o r e n e l l l e t a l . , 1986 v. Bause and L e g l e r , 1980 vi. L e g l e r and Harder, 1978  59  sequence in  (Fig. 23).  the region It  was  potential several for  interesting  lysozyme  The  active  investigated (Legler  I from  amino a c i d  sites  using  contained  similar  from  Cpb t h a t  region  from  Awb  Awb was d i s t i n c t  Scb  The epoxide other  the  acid  residue  around  sites  1980).  been  B epoxide Peptides The  sites  of the  almond both  There  homology'to  was a  this  Cpb h o m o l o g o u s t o  c o n t a i n e d the p u t a t i v e the  may h a v e  which  interesting  more t h a n o n e  active  i n the predicted  the essential  since  The  c l o n e d gene  amino a c i d  Abg o r  which  was i d e n t i c a l  aspartic a better active  acid  residue of  comparison site  to the  from could  Awb have  sequence.  t h e s e e n z y m e s may h a v e  similar  t h e y a l l h y d r o l y z e (5-1, 4 - g l y c o s i d i c  investigation  of these active  sites  by a c o m b i n a t i o n o f the a b i l i t y p r o d u c t s , and i d e n t i f i c a t i o n  through  B  and on t h e  the peptide sequences  the 1ysozyme-1ike that  bound c o n d u r i t o l  a hydroxy  n o t l o n g e r so t h a t  facilitated  amino a c i d s  which  an a r o m a t i c amino a c i d ,  i s not suprising  linkages.  have  (Fig. 23).  This raises  i n Awb h a d o n o n e s i d e  Bab were  active  1987).  conduritol  from  The  CenA,  homology a l t h o u g h they  The r e g i o n  I t was u n f o r t u n a t e t h a t  It  1984).  et a l . ,  the active  was no h o m o l o g o u s p e p t i d e  b e e n made w i t h  be  site.  proposed  and sequenced.  perfect  the region  found i n  sequences.  arrangement and  et al.,  fl-glucosidases  isolated  t h e Cpb p r o t e i n  aspartic  side  HEWL.  active  that  There  partial  from  has been  (Awb) a n d t h e b i t t e r  (Fig. 23).  of  was f i r s t  and L e g l e r ,  had almost  22).  endoglucanase,  t y p e s o f amino a c i d s  region  possibility  (Paice  o f p e p t i d e s from idase  found  S_. commune a n d t h e  o f two o t h e r  A (Bab) had l i t t l e  1ysozyme-1ike  residues  t o the major  were  were  arrangement  This analogy  1978; Bause  ft-glucos  /J-gl ucos idase  site  sites  (Fig.  this  the covalent i n h i b i t o r  sequences 3  that  £. r e s s e 1  the i n h i b i t o r  A., w e n t i i A  above  , C e x , o f C. f 1 m i ( W a r r e n  and Harder,  bound  active  I and I I from  has been extended  exoglucanase  site.  active  enzymes.  the endoglucanases  which  t o note  like  glycosidase  analogy  potential  o f homology d e s c r i b e d  cellobiohydrolase and  These  t h e use o f s i t e  specific  s h o u l d now  to overexpress  of essential mutagenesis  of  60  the c l o n e d genes.  3) Codon usage in the abg gene The p a t t e r n of codon usage to be i n v o l v e d  i n a gene has been suggested  i n the r e g u l a t i o n of gene e x p r e s s i o n (Varenne  et a l . ,  1984; Robinson e t a l . ,  1982).  This suggestion was based on the assumption that  efficient  1984; Grosjean and F i e r s ,  t r a n s l a t i o n would r e q u i r e the codon usage of a gene  to be c o n s i s t e n t with the cognate tRNA l e v e l s  in the h o s t .  The codon usage of a heterologus gene then could be Important for  i t s expression  in g.. c o l i  The codon usage in the abg gene  i s shown in Table V I I .  Of the 61 codons, 14 were not used i n the abg gene.  There was  a 79% b i a s to G or C in the t h i r d p o s i t i o n of the codons used. The G+C  contents of the f i r s t and second p o s i t i o n of the  codons were 64.4% and 43.4% r e s p e c t i v e l y .  The o v e r a l l  G+C  content of the genus Agrobacter i um was determined to be 59.6-62.8% was 60.4%.  (Krieg,  1974), and the G+C  content of the abg gene  The b i a s f o r G or C i n the t h i r d p o s i t i o n  was  higher than the 53% observed  in  extreme as the b i a s observed  in genes from organisms with  higher G+C  contents ( O ' N e i l l ,  c o l i , but was not as  1986).  Despite the b i a s f o r G  or C i n the t h i r d p o s i t i o n of the codons, abg d i d not have a codon usage p a t t e r n very d i f f e r e n t  from  c o l 1 (data not  shown). The problem of codon usage and heterologous gene expression  in  c o l 1 may not be that  important.  I t has now  been r e p o r t e d that the C. f i m i cex gene, which has a 98% b i a s f o r G or C in the t h i r d p o s i t i o n and many rare has been overexpressed such that  c o l i codons,  20% of the t o t a l c e l l  was the cex gene? product ( O ' N e i l l ,  1986).  protein  61  Table V I I .  Codon u t i l i z a t i o n  of the abg gene.  aa  Codon #  aa  Codon #  aa  Codon #  aa  Codon  #  Phe  UUU  3  Ser  UCU  0  Tyr  UAU  8  Cys  UGU  0  UCU  19  UCC  7  UAC  14  UGC  6  UUA  0  UCA  0  Och  UAA  0  Opl  UGA  1  UUG  1  UCG  3  Amb  UAG  0  Trp  UGG  13  CUU  2  ecu  2  His  CAU  12  Arg  CGU  10  cue  13  CCC  8  CAC  5  CGC  11  CUA  1  CCA  0  CAA  0  CGA  0  CUG  17  CCG  16  CAG  6  CGG  3  AUU  2  ACU  2  AAU  9  AGU  0  AUC  14  ACC  9  AAC  9  AGC  6  AUA  0  ACA  1  AAA  1  AGA  0  Met  AUG  15  ACG  7  AAG  15  AGG  0  Val  GUU  4  GCU  6  GAU  22  GGU  9  GUC  12  GCC  25*  GAC  11  GGC  24  GUA  1  GCA  5  GAA  11  GGA  0  GUG  14  GCG  17  GAG  18  GGG  10  Leu  Ile  Pro  Thr  Ala  Gin Asn Lys Asp Glu  Ser Arg Gly  LITERATURE CITED A i t , N., Creuzet, N., and Catteneo, J . (1982) P r o p e r t i e s of f$-gl ucos idase p u r i f e d from C l o s t r i d i u m thermoce 11 um . J . Gen. M i c r o b i o l . 128: 569-577 Armentrout, R.W., and Brown, R.D. (1981) Molecular c l o n i n g o genes f o r c e l l o b i o s e u t i l i z a t i o n and t h e i r e x p r e s s i o n in E s c h e r i c h i a c o l i . Appl. E n v i r o n . M i c r o b i o l . 41: 1355-1362 Armentrout, R.W., and Brown, R.D. (1984) B i o l o g i c a l l y e n g i n e r r e d plasmid f o r the p r o d u c t i o n of fl-glucosidase, organisms modified by t h i s plasmid and methods of use, U.S. patent, US 4464671, 07 Aug. 1984 A t k i n s o n , T., and Smith, M. (1984) In: O l i g o n u c l e o t i d e S y n t h e s i s : a p r a c t i c a l approach. G a i t , N.J. ed. IRL press Washington. B a l l , C. (1984) In: Genetics and breeding of i n d u s t r i a l microorganisms. B a l l , C. ed. CRC p r e s s , Inc. USA. pp 159-188 B a r r a s , F., Chambost, J.P., and Chippaux, M. (1984) C e l l o b i o s e metabolism in Erw in l a : a g e n e t i c study. Mol. Genet. 197: 486-490  Gen.  Bause, E., and L e g l e r , G. (1980) I s o l a t i o n and s t r u c t u r e of a t r y p t i c g l y c o p e p t i d e from the a c t i v e s i t e of (5-gl ucos idase A s from Asperg i11 us went i i . Biochim. Biophys. Acta 626: 459-465 Beguin, P., G i l k e s , N.R., K i l b u r n , D.G., M i l l e r , R.C, J r . , O ' N e i l l , G., and Warren, R.A.J. (1986) Cloning of c e l l u l a s e genes. Accepted f o r p u b l i c a t i o n in CRC C r i t i c a l Reviews of Biotechnology. Berghem, L., and P e t t e r s s o n , L. (1974) The mechanism of enzymatic c e l l u l o s e degradation. I s o l a t i o n and some p r o p e r t i e s of a fl-glucosidase from Tr ichoderma v i r ide. Eur. J Biochem. 46: 295-305 Blake, M.S., Johnston, K.H., Russe11-Jones, G.J., and G o t s c h l i c h , E.C. (1984) A r a p i d and s e n s i t i v e method f o r d e t e c t i o n of a l k a l i n e phosphatase conjugated a n t i - a n t i b o d y western b l o t s . Anal. Biochem. 136: 175-179  on  B l o n d i n , B., Ratomahenina, R., Arnaud, A., and Galzy, P. (1983) P u r i f i c a t i o n and p r o p e r t i e s of the ft-glucosidase of yeast capable of fermenting c e l l o b i o s e to e t h a n o l : Dekkera intermedia van der Walt. Eur. J . Appl. M i c r o b i o l . B i o t e c h n o l 17: 1-6  63  B o l l o n , A.P. <1984) Recombinant DNA p r o d u c t s : Insulin, I n t e r f e r o n and g r o w t h hormone. B o l l o n , A.P. ed. CRC press, Inc., USA Brown, W.E., and Howard, G.C. ( 1 9 8 3 ) Amino a c i d c o m p o s i t i o n p r o t e i n s e l u t e d from p o l y a c r y l a m i d e g e l s . Methods i n E n z y m o l o g y 91: 36-41  of  C o u g h l a n , M.P. (1985) The p r o p e r t i e s o f f u n g a l and b a c t e r i a l c e l l u l a s e s w i t h comment on t h e i r p r o d u c t i o n and a p p l i c a t i o n . B i o t e c h . G e n e t i c E n g i n e e r i n g Rev. 3: 39-109 C r e s t f i e l d , A.M., Moore, S., and S t e i n , W.H. (1963) The p r e p a r a t i o n and e n z y m a t i c h y d r o l y s i s of r e d u c e d and S - c a r b o x y m e t h y l a t e d p r o t e i n s . J . B i o l . Chem. 193: 622-627 D a g e r t , M., and E h r l i c h , S.D. c a l c i u m c h l o r i d e improves the c e l l s . Gene 6: 23-28  (1979) Prolonged incubation in competence of E s c h e r i c h i a c o l i  Day, A.G., and W i t h e r s , S.G. (1986) The p u r i f i c a t i o n and c h a r a c t e r i z a t i o n of a ft-glucosidase from A l c a l j q e n e s f a e c a l i s . Can. J . B i o c h e m . C e l l . B i o l . 64: 914-922 D e k k e r , R. F. H., (1986) K i n e t i c , i n h i b i t i o n , and s t a b i l i t y p r o p e r t i e s o f a c o m m e r c i a l (1-D-gl u c o s i d a s e ( c e l l o b i a s e ) . P r e p a r a t i o n from A s p e r q i 1 1 us n i g e r and i t s s u i t a b i l i t y i n the h y d r o l y s i s of 1 i g n o c e 1 1 u l o s e . B i o t e c h n o l . B i o e n g . 28: 1438-1442 D e s r o c h e r s , M., J u r a s e k , L., and P a i c e , M.G (1981) H i g h p r o d u c t i o n of fl-glucosidase i n Sch i z o p h v l l u m commune: I s o l a t i o n o f the enzyme and the e f f e c t of the c u l t u r e f i l t r a t e on c e l l u l o s e h y d r o l y s i s . A p p l . E n v i r o n . M i c r o b i o l . 41: 222-228 D i x o n , R. (1986) The x y l A B C p r o m o t e r from the Pseudomonas p u t i d a TOL p l a s m i d i s a c t i v i t e d by n i t r o g e n r e g u l a t o r y genes in E s c h e r i c h i a c o l i . Mol. Gen. G e n e t . 203: 129-136 E n a r l , T. M. (1983) M i c r o b i a l c e l l u l a s e s . Enzymes and B i o t e c h n o l o g y ( F o g a r t y , W.M., A p p l i e d S c i e n c e P u b l i s h e r s , London.  In M i c r o b i a l ed) pp 183-223,  F r e e r , S. N . , and D e t r o y , R. W. ( 1 9 8 3 ) C h a r a c t e r i z a t i o n of c e l l o b i o s e f e r m e n t a t i o n to e t h a n o l by y e a s t s . Biotechnol. B i o e n g . 25:541-557 F o w l e r , A.V. ( 1978) Amino a c i d s e q u e n c e o f ( 3 - g a l a c t o s i d a s e V I I . I s o l a t i o n of the 24 c y a n o g e n b r o m i d e p e p t i d e s . J. Biol. Chem. 253: 5499-5504  64  G i l k e s , N.R., K i l b u r n , D.G., Langs f o r d , M.L., M i l l e r , R.C. J r . , Wakarchuk, W.W., Warren, R.A.J., W h i t t l e , D.J., and Wong, W.K.R. ( 1984) I s o l a t i o n and c h a r a c t e r i z a t i o n of Escher i c h ia c o l i clones e x p r e s s i n g c e l l u l a s e genes from Cellulomonas f i m i • J . Gen. M i c r o b i o l . 130: 1377-1384 Gold, L., Pribnow, D., Schneider, T., S h i n e d l i n g , S., Swebelius-Singer, B., and Storma, G. (1981) T r a n s l a t i o n i n i t i a t i o n in prokaryotes. Ann. Rev. M i c r o b i o l . 35: 365-403 Gong, G.S., L a d i s c h , M.R. and Tsao, G.T. (1977) C e l l o b l a s e from Tr ichoderma v i r i d a e . P u r i f i c a t i o n , p r o p e r t i e s , k i n e t i c s and mechanism. B i o t e c h n o l . Bioeng. 19: 959-981 Groleau, D., and F o r s b e r g , C.W. (1981) C e l l u l o l y t i c a c t i v i t y of the rumen bacterium Bactero i des succ inogenes. Can. J . M i c r o b i o l . 27: 517-530 Grosjean, H., and F i e r s , W. (1982) P r e f e r e n t i a l codon usage in p r o k a r y o t i c genes: the optimal codon antl-codon I n t e r a c t i o n energy and the s e l e c t i v e codon usage in e f f i c i e n t l y expressed genes. Gene 18: 199-209 Gross, E. (1967) The cyanogen bromide r e a c t i o n . Enzymology 11: 238-251  Methods i n  G r u n s t e i n , M., and W a l l i s , J . (1979) Colony h y b r i d i z a t i o n . Methods in Enzymology 68: 379-389 Guo, Li-He, and Wu, R. (1983) Exonuclease I I I : use f o r DNA sequence a n a l y s i s and i n s p e c i f i c d e l e t i o n s of n u c l e o t i d e s . Methods in Enzymology 100: 468-500 Hagget, K.D., Choi, W.Y., and Dunn N.W. (1978) Mutants of Cellulomonas which produce i n c r e a s e d l e v e l s of ft-glucosIdase. Eur. J . Appl. M i c r o b i o l . B i o t e c h n o l . 6:189-191 H a l l i w e l l , G., and G r i f f i n , M. (1978) A f f i n i t y chromatography of the c e l l u l a s e system of Tr i chode rma kon i ngI 1. Biochem. J . 169: 713-715 Han, Y.W. (1982) N u t r i t i o n a l requirements and growth of a Ce11u1omonas s p e c i e s on c e l l u l o s i c s u b s t r a t e s . J . Ferment. Technol. 60: 99-104 Han, Y.W., and S r i n i v a s a n , V.R. (1968) I s o l a t i o n and c h a r a c t e r i z a t i o n of a c e l l u l o s e u t i l i z i n g bacterium. M i c r o b i o l . 16:1140-1145  Appl.  Han, Y.W., and S r i n i v a s a n , V.R. (1969) The p u r i f i c a t i o n and c h a r a c t e r i z a t i o n of fi-glucosidase of A l c a l i g e n e s f a e c a l i s . J . B a c t e r i o l . 100: 1355-1363  65  Hawley, D.K., and McClure, W. (1983) Compilation and a n a l y s i s of E s c h e r i c h i a c o l 1 promoter DNA sequences. N u c l e i c Acids Res. 11: 2237-2255 Hendy, N.A., Wllke, C R . and Blanch, H.W. (1984) Enhanced c e l l u l a s e p r o d u c t i o n in fed-batch c u l t u r e of Tr ichoderma r e e s e i C30. Enzyme M i c r o b i a l Technol. 6: 73-77 Huang, H.W., Bond, M.V., Hunkapiler, M.W., and Hood, L.E. (1983) Cleavage a t tryptophanyl r e s i d u e s with dimethyl s u l f o x i d e - h y d r o c h l o r i c a c i d and cyanogen bromide. Methods in Enzymology 91: 318-324 Hwang, J.T., and Suzuki, H. (1976) I n t r a c e l l u l a r d i s t r i b u t i o n and some p r o p e r t i e s of fl-glucosidases of a c e l l u l o l y t i c Pseudomonad. A g r i c . B i o l . Chem. 40: 2169-2175 I n g l i n , M., F e i n b e r g , B.A., and Loewenberg, J.R (1980) P a r t i a l p u r i f i c a t i o n and c h a r a c t e r i s t i c s of a new i n t r c e l l u l a r ft-glucosidase of Trichoderma r e e s e i . Biochem. J . 185: 515-519 J o l i f f , G., Beguin, P., Juy, M., M i l l e t , J . , R y t e r , A., P o l j a k , R., and Aubert, J.P. (1986) I s o l a t i o n , c r y s t a l l i z a t i o n , and p r o p e r t i e s of a new c e l l u l a s e of C l o s t r i d i u m thermoce11um overproduced in Escher icha c o l i . Bio/Technology 4: 896-900 Katz, L., Kinsbury, D.T., and H e l i n s k i , D.R. (1973) S t i m u l a t i o n by c y c l i c adenosine monophosphate of plasmid d e o x y r i b o n u c l e i c a c i d r e p l i c a t i o n and c a t a b o l i t e r e p r e s s i o n of the plasmid d e o x y r i b o n u c l e i c a c i d - p r o t e i n complex. J . B a c t e r i o l . 114: 577-591 Kohchi, C , Hayashi, M., and Nagai, S. (1985) P u r i f i c a t i o n and p r o p e r t i e s of ft-glucosidase from Cand ida pel 1 i c u l o s a v a r . a c e t a e t h e r i u s . A g r i c . B i o l . Chem. 49:779-784 Kohchi, C , and Toh-e, A. (1985) Nucleotide sequence of Cand ida pel 1 i c u l o s a fi-glucosidase gene. N u c l e i c A c i d s Res. 13:6273-6282 Kohchi, C , and Toh-e, A. (1986) C l o n i n g of Candida pe11icu1osa ft-glucosidase gene and i t s e x p r e s s i o n in Saccharomvces cerev1s i a e . Mol. Gen. Genet. 203: 89-94 K r i e g , N.R. ( 1974) Genus Actrobacterium Conn. In: Buchanan and Gibbons ( E d i t o r s ) , Bergey's Manual of Determinative Bacteriology 8 Ed., The Williams and W i l k i n s Co., Baltimore, pp 90-91. t h  Laemmli, U.K. (1970) Cleavage of s t r u c t u r a l p r o t e i n s d u r i n g the assembly of bacteriophage T4. Nature 227: 680-685  66  Lathe, R., Kieny, M.P., Skory, S., and Lecocq, J.P. (1984) L i n k e r t a i l i n g : Unphosphorlyated linker oligonucleotides for j o i n i n g DNA t e r m i n i . DNA 3: 173-182 L e g l e r , G., and Harder, A. (1978) Amino a c i d sequence at the a c t i v e s i t e of fl-glucosidase A from b i t t e r almonds. Biochim. Biophys. Acta 524: 102-108 L e g l e r , G., von R a d l o f f , M., and Kempfle, M. (1972) Composition, N-terminal amino a c i d s and c h a i n length of a fl-glucosidase from Asoergi11 us went 1i . Biochim. Biophys. Acta 257: 40-48 L e g l e r , G., S i n n o t , M.L, and Withers, S. (1980) C a t a l y s i s by f$-glucos idase A of Asperg i11 us went 1 i . J . Chem. Soc. Perkins Trans I I : 1376-1382. 3  L i z a r d i , P. (1981) B i n d i n g and r e c o v e r y of DNA and RNA using NA-45 DEAE membrane. S c h l e i c h e r and S c h u e l l a p p l i c a t i o n update No. 364 Lowry, O.H., Rosebrough, N.J., F a r r , A.L., and R a n d a l l , R.J. (1951) P r o t e i n measurements with the F o l i n phenol reagent. J . B i o l . Chem. 193: 265-276 MacKenzie C.R., and P a t e l , G.B. (1986) C e l l o d e x t r i n u t i l i z a t i o n and <5-gl ucos idase p r o d u c t i o n by Bactero ides polypragmatus. Arch. M i c r o b i o l . 145: 91-96 Maoris, B.J. (1984) Production and c h a r a c t e r i z a t i o n of c e l l u l a s e and fl-glucosidase from a mutant of A l t e r n a r i a a l t e r n a t a . Appl. E n v i r o n . M i c r o b i o l . 47: 560-565 Mandels, M. (1982) C e l l u l a s e s . In: Annual r e p o r t s on fermentation p r o c e s s e s . G.T. Tsao ed. Academic press Inc., York. vol . 5  New  M a n i a t i s , T., F r i t s c h , E.F., and Sambrook, J . (1982) In: Molecular c l o n i n g . Cold S p r i n g Harbor Laboratory, New York. Marmur, J . (1961) A procedure f o r the i s o l a t i o n of deoxyribonuce1ic a c i d from microorganisms. J . Mol. B i o l . 208-218  3:  Maxam, A.M., and G i l b e r t , W. (1980) Sequencing e n d - l a b e l l e d DNA with b a s e - s p e c i f i c chemical c l e a v a g e s . Methods in Enzymology 65: 499-560 McHale, A., and Coughlan, M.P. (1981) The c e l l u l o l y t i c system of Talaromvces e m e r s o n l i . P u r i f i c a t i o n and c h a r a c t e r i z a t i o n of the e x t r a c e l l u l a r and i n t r a c e l l u l a r ft-glucosidases. Biochim. Biophys. Acta 662: 152-159  67  Messing, J . (1983) New M13 v e c t o r s f o r c l o n i n g . Methods In Enzymology 101C: 20-78 Meyer, H.P., and C a n e v a s c i n i , G. (1981) Separation and p r o p e r t i e s of two I n t r a c e l l u l a r fl-glucosidases of Sporotrichum (Chvrsospor ium) thermoph i l e . Appl. E n v i r o n . M i c r o b i o l . 41: 924-931 M i l l e r , J.H. (1972) In: Experiments i n Molecular Cold S p r i n g Harbor Laboratory, New York.  Genetics.  Moldeoveanu, N., and K l u e p f e l , D. (1983) Comparison of fi-glucosidase a c t i v i t i e s i n d i f f e r e n t Streptomvces s t r a i n s . Appl. E n v i r o n . M i c r o b i o l . 46: 17-21 Montenecourt, B.S., S h e i r - N e i s s , G.I., Ghosh, A., and Ghosh B.K (1982) Mutational approach to enhance s y n t h e s i s and s e c r e t i o n of c e l l u l a s e . Proceeding of the Royal S o c i e t y of Canada. I n t e r n a t i o n a l symposium on ethanol from biomass. pp 397-412. M o r a n e l l i , F., B a r b i e r , J.R., Dove, M.J., Mackay, R.M., S e l i g y , V.L., Yaguchi, M., and W i l l i c k , G.E. (1986) A clone coding f o r Schizophvl1um commune ft-glucosidase: homology with a yeast ft-glucosidase. Biochemistry I n t e r n a t i o n a l 12: 905-912 Nakamura, K., Misawa, N., and Kitamura, K. (1986) C e l l u l a s e genes of Ce11u1omonas uda CB4. I. C l o n i n g and e x p r e s s i o n of ft-glucosidase genes i n E s c h e r i c h i a c o l i . J . Biotechnology 3: 239-246 Ohmiya, K., S h i r a i , M., K u r a c h i , Y., and Shimizu, S. (1985) I s o l a t i o n and p r o p e r t i e s of fl-glucosidase from Ruminococcus a l b u s . J . B a c t e r i o l . 161: 432-434 O ' N e i l l , G.O. (1986) S t r u c t u r e of the gene encoding the exoglucanase of Cellulomonas f i m i and i t s expression and s e c r e t i o n in Escher ich ia c o 1 i . Ph . D t h e s i s , The U n i v e r s i t y of B r i t i s h Columbia. P a i c e , M.G., Desrochers, M., Rho, D., Jurasek, L., Roy, C , R o l l i n , C.F., Miguel, E.De., and Yaguchi, M. (1984) Two forms of endoglucanase from the basidiomycete Schizophvl1um commune and t h e i r r e l a t i o n s h i p to other fl-1,4-glycoside h y d r o l a s e s . Bio/Technology 2: 535-539 P e n t t i l a , M.E., Helena-Nevalainen, K.M., Raynal, A., and Knowles, J.K.C. (1984) C l o n i n g of A s p e r g i l l u s n i g e r genes i n yeast. E x p r e s s i o n of the gene coding Aspergi11 us ft-glucosidase. Mol. Gen. Genet. 194: 494-499 Pugsley, A.P., and Schwartz, M. (1985) Export and s e c r e t i o n of p r o t e i n s by b a c t e r i a . FEMS M i c r o b i o l . Rev. 32: 3-38  68  Raynal, A., and Guerineau, M. (1984) C l o n i n g and e x p r e s s i o n of the s t r u c t u r a l gene f o r (J-gl ucos i dase of Kl uvveromvces frag i 1 i s in Escher ich ia c o l i and Saccharomvces cerev i s i a e . Mol. Gen. Genet. 195: 108-115 Reese, E.T., P a r r i s h , F.W., and E i t l i n g e r , M. (1971) N o j i r i m y c i n and D-gluconic a c i d l a c t o n e as i n h i b i t o r s of carbohydrases. Carbohydr. Res. 18: 381-388 Robinson, M., L i l l e y , R., Emtage, J.S., Yarranton, G., Stephens, P., M i l l i c a n , A., Eaton, M., and Humphreys, G. (1984) Codon usage can a f f e c t e f f i c i e n c y of t r a n s l a t i o n in Escher ich ia c o l i . N u c l . Acids Res. 12: 6663-6671 Rosenberg, M., and Court, D. (1979) Regulatory sequences involved in the promotion and t e r m i n a t i o n of RNA t r a n s c r i p t i o n . Annu. Rev. Genet. 13: 319-353 Sanger, F., N i c k l e n , S., and Coulson, A.R. (1977) DNA sequencing with c h a i n t e r m i n a t i n g i n h i b i t o r s . Proc. N a t l . Acad. S c i . U.S.A. 74: 5463-5467 Sato, M., and Takahashl, H. (1967) Fermentation of C - l a b e 1 l e d c e l l o b i o s e by Cellulomonas f i m i . A g r i c . Chem. 31: 470-474 14  Biol.  Schwarz, W., Bronnenmeir, K., and Staudenbauer, W.L. (1985) Molecular c l o n i n g of C l o s t r i d i u m thermoce Hum genes i n v o l v e d in (3-glucan d e g r a d a t i o n in bacteriophage lambda. B i o t e c h n o l . L e t t e r s . 7:859-864 Schimz, K.L., B r o i l , B., and John, B. (1983) C e l l o b i o s e phosphorylase (EC 2.4.1.20) of Ce11ulomonas: occurence, i n d u c t i o n and i t s r o l e in c e l l o b i o s e metabolism. Arch. M i c r o b i o l . 135: 241-249 S c h l e i f , R.F., and Wensink, P.C. (1981) In: P r a c t i c a l in Molecular B i o l o g y . S p l n g e r - V e r l a g New York.  Methods  Shewale, J.G. ( 1982) <3-gl ucos idase: I t s r o l e in c e l l u l a s e s y n t h e s i s and h y d r o l y s i s of c e l l u l o s e . Eur. J . Biochem. 14: 435-443 Shewale, J.G., and Sadana J.C. (1981) P u r i f i c a t i o n and p r o p e r t i e s of ^ - g l u c o s i d a s e enzymes from S c l e r o t i um r o l f s i i . Arch. Biochem. Biophys. 207: 185-196 Smith, E.O. ( 1972) Carbohydrases of A l c a l i o e n e s f a e c a l i s (ATCC 21400). Ph.D t h e s i s , The L o u i s i a n a State U n i v e r s i t y and A g r i c u l t u r a l and Mechanical C o l l e g e . Southern, E.M. (1975) D e t e c t i o n of s p e c i f i c sequences among DNA fragments separated by gel e l e c t r o p h o r e s i s . J . Mol. B i o l . 98: 503-517  69  S t e r n b e r g , D . , V I j a y y a k u m a r , P . , and R e e s e , E . T . ( 1 9 7 7 ) (5-gl ucos I d a s e : M i c r o b i a l p r o d u c t i o n and e f f e c t on e n z y m a t i c h y d r o l y s i s of c e l l u l o s e . C a n . J . M i c r o b i o l . 23: 139-147 S t o p p o k , W . , R a p p , P . , and Wagner F . (1982) F o r m a t i o n , l o c a l i z a t i o n and r e g u l a t i o n of e n d o - 1 , 4 - A - g l u c a n a s e s and (S-gl ucos i d a s e s from Ce 11 u 1 omonas u d a . A p p l . E n v i r o n . M i c r o b i o l . 44: 4 3 - 5 3 S t r e a m e r , M . , E r i k s s o n , K . E . , and P e t t e r s o n , B . (1975) E x t e r n a l enzyme s y s t e m u t i l i z e d by the fungus S p o r o t r i c h u m p u l v e r u l e n t u m f o r the breakdown of c e l l u l o s e . F u n c t i o n a l c h a r a c t e r i z a t i o n o f f i v e e n d o - 1 , 4-($-gl u c a n a s e s and one e x o - 1 , 4-(5-gl u c a n a s e . E u r . J . B i o c h e m . 5 9 : 607-613 T o w b i n , H . , S t a e h l i n , T . , and G o r d o n , J . (1979) E l e c t r o p h o r e t i c t r a n s f e r of p r o t e i n s from p o l y a c r y l a m i d e g e l s to n i t r o c e l l u l o s e s h e e t s : p r o c e d u r e and some a p p l i c a t i o n s . P r o c . N a t l . A c a d . S c i . USA 76: 4350-4354 V a r r e n e , S . , B u c , J . , L l o u b e s , R . , and L a z d u n s k i , C . (1984) T r a n s l a t i o n i s a n o n - u n i f o r m p r o c e s s : E f f e c t o f tRNA a v a i l a b i l i t y on the r a t e of e l o n g a t i o n of n a s c e n t p o l y p e p t i d e c h a i n s . J . M o l . B i o l . 180: 549-576 V i e i r a , J . (1985) U n i t e d S t a t e s B i o c h e m i c a l company l i t e r a t u r e a c c o m p a n i n g the v e c t o r s p T Z 1 8 / 1 9 .  technical  W a k a r c h u k , W . W . , K i l b u r n , D . G . , M i l l e r , R . C . J r . , and W a r r e n , R . A . J . (1984) The p r e l i m i n a r y c h a r a c t e r i z a t i o n o f the (J-gl ucos i d a s e s of Ce 11 u 1 omonas f i m i . J . G e n . M i c r o b i o l . 130: 1385-1389 W a k a r c h u k , W . W . , K i l b u r n , D . G . , M i l l e r , R . C , J r . , and W a r r e n , R . A . J . ( 1 9 8 6 ) The m o l e c u l a r c l o n i n g and e x p r e s s i o n of a c e l l o b i a s e gene from an A a r o b a c t e r i um i n E s c h e r i c h i a c o l i . M o l . G e n . G e n e t . 205: 146-152 Warren, R . A . J . , Beck, C . F . , G i l k e s , N . R . , K i l b u r n , D . G . , L a n g s f o r d , M . L . , M i l l e r , R . C . J r . , O ' N e i l l , G . P . , and Wong, W . K . R . ( 1 9 8 7 ) Sequence c o n s e r v a t i o n and r e g i o n s h u f f l i n g i n two c e l l u l a s e s from Ce11u1omonas f i m i . Accepted for puplication in: Proteins. W h i t t l e , D . J . , K i l b u r n , D . G . , M i l l e r , R . C J r . , and W a r r e n , R . A . J . ( 1982) M o l e c u l a r c l o n i n g o f a C e l l u l o m o n a s f i m i gene i n E s c h e r i c h i a c o l i . Gene 17: 139-145 Wood, T . M . , and M C r a e , S . I . (1982) P u r i f i c a t i o n and some p r o p e r t i e s o f the e x t r a c e l l u l a r (5-D-gl ucos i d a s e of the c e l l u l o l y t i c fungus T r i c h o d e r m a k o n i n g i i . J . G e n . M i c b . 128: 2973-2982 c  Workman, W.E., and Day, D.F. (1982) P u r i f i c a t i o n and p r o p e r t i e s of fl-gl ucos i dase from Asperg i 11 us t e r r u s . Appl. E n v i r o n . M i c r o b i o l . 44: 1289-1295 Yanisen-Perron, C , V i e i r a , J . , and Messing, J . (1985) Improved M13 phage c l o n i n g vectors and host s t r a i n s : n u c l e o t i d e sequence of the M13mpl8 and pUC19 v e c t o r s . Gene 103-119 Zappe, H., Jones, D.T., and Woods, D.R. (1986) Cloning and e x p r e s s i o n of C l o s t r i d i u m acetobutvlleum endoglucanase, c e l l o b i a s e and amino a c i d b i o s y n t h e s i s genes in Escher ich i a c o l i . J . Gen M i c r o b i o l . 132: 1376-1372 Z o l l e r , M.J., and Smith, M. (1983) 0 1 i g o n u c l e o t i d e - d i r e c t e d mutagenesis of DNA fragments cloned in M13-derived v e c t o r s . Methods in Enzymology 100B: 468-500  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097515/manifest

Comment

Related Items