Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The molecular cloning and characterization of a Beta-glucosidase gene from an Agrobacterium Wakarchuk, Warren William 1987

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1987_A1 W34.pdf [ 6.94MB ]
Metadata
JSON: 831-1.0097515.json
JSON-LD: 831-1.0097515-ld.json
RDF/XML (Pretty): 831-1.0097515-rdf.xml
RDF/JSON: 831-1.0097515-rdf.json
Turtle: 831-1.0097515-turtle.txt
N-Triples: 831-1.0097515-rdf-ntriples.txt
Original Record: 831-1.0097515-source.json
Full Text
831-1.0097515-fulltext.txt
Citation
831-1.0097515.ris

Full Text

THE MOLECULAR CLONING AND CHARACTERIZATION OF A ft-GLUCOSIDASE GENE FROM AN AGROBACTERIUM by WARREN WILLIAM WAKARCHUK Sc., The University of B r i t i s h Columbia, 1984 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY In THE FACULTY OF GRADUATE STUDIES (Department of Microbiology) We accept th i s thesis as conforming to the desired standard THE UNIVERSITY OF BRITISH COLUMBIA March 1987 - © Warren William Wakarchuk, 1987 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 DE-6(3/81) i i ABSTRACT The <l-gl ucos Idase (Abg) from ATCC 21400, an Aarobacterlure species, was p u r i f i e d to homogeneity. The prote in was cleaved with cyanogen bromide and the peptides were p u r i f i e d by reversed phase high pressure l i q u i d chromatography. The p a r t i a l amlno-acid sequences for three CNBr peptides, CNBrl , CNBr2 and CNBr3, were determined by automated Edman degradation. A sequence from CNBr2 was used to synthesize a mixture of o l igonucleot ides which was used as a hybr id iza t ion probe to ident i fy a recombinant DNA clone car ry ing the gene for fl-glucosidase. A s ingle clone was isola ted which expressed an enzymatic a c t i v i t y that hydrolyzed several <l-glucos ides. The enzymatic a c t i v i t y produced by th i s clone could be adsorbed by rabbi t antiserum raised against the Aarobacterium enzvme. The d i r e c t i o n of t r ansc r ip t ion of the <J-gl ucos idase gene was determined by ver i fy ing the DNA sequence 3'- to the ol igonucleot ide probe binding s i t e . After subcloning the gene a high l eve l of expression was obtained In the plasmid vector pUC18 using the lacZ gene promoter. The nucleotide sequence of the 1599 bp insert in pABG5 was determined using the chain terminator method. The s tar t of the protein coding region was determined by a l ign ing the amino terminal sequence of the protein with the predicted amino ac id sequence of the cloned gene. The open reading frame was 1387 nucleotides and contained 458 codons. The molecular weight ca lcu la ted from the deduced amino ac id sequence agreed with that observed from both the native and recombinant enzymes. The predicted amino ac id composition from the open reading frame matched with that determined for the native 0-glucosidase. The stop codon of t h i s coding region was followed by a potent ia l stem loop structure which may be the t r ansc r ip t i ona l terminator. There was a region of the deduced Abg sequence which had homology to a region from two other j l -g l ucos idase sequences. This region of homology contained a putative ac t ive s i t e by analogy with the act ive s i t e of hen egg white lysozyme. i i i TABLE OF CONTENTS Page INTRODUCTION 1 I Background 1 A) Cel lu lase 1 B) Measurement of fl-glucosidase a c t i v i t y 2 II Propert ies of A-glucosidase 2 A) K i n e t i c properties 2 B) The ro le of fl-glucosidase ln ce l lu lose hydrolys is 6 I I I App l i ca t ion of molecular b iology to the study 7 of fl-glucosidase A) Approaches to the genetic improvement of 7 fl-glucosidase B) The molecular c loning of fl-glucosIdase 9 MATERIALS AND METHODS 14 I Bac te r i a l s t r a i n s , plasmids and phages 14 II Preparation of 0-glucosidase 14 I I I Enzymatic assays and prote in determination 16 IV Peptide production, p u r i f i c a t i o n and sequencing 17 A) Cyanogen bromide cleavage of the 0-glucosidase 17 B) Reversed phase chromatography 17 C) Sequence determination of the peptides and 18 amino ac id analysis of the prote in V DNA methodology 18 A) DNA Iso la t ion and analys is 18 B) Oligonucleotide synthesis and p u r i f i c a t i o n 19 C> Construction and detect ion of recombinant DNA 19 clones D) DNA sequencing 20 VI Polyacrylamide gel e lectrophoresis and 20 (J-gl ucos idase a c t i v i t y s t a in ing VII Immunodetection and immunoadsorption of 22 fl-glucosIdase i v VIII Induction of fl-glucosidase expression in s t ra ins 22 ear r ing recombinant pUC plasmids IX Mater ia ls 23 RESULTS AND DISCUSSION 24 I P u r i f i c a t i o n of fl-glucosidase 24 II P u r i f i c a t i o n and amino ac id sequence determination 24 of peptides generated by CNBr cleavage I I I Cloning strategy 35 IV Character izat ion of the cloned fl-glucosidase gene 38 A) Determination of the i den t i t y of the recombinant 38 prote in with the native fl-glucosidase B) Subcloning the abg gene 42 C) Determination of the d i r e c t i o n of t r ansc r ip t ion 46 of the abg gene V Increased expression of the ft-glucosidase gene 47 VI DNA sequence of the abg gene 48 A) The determination of the DNA sequence 48 B) The analysis of the sequence 51 1) Transcr ip t iona l and t r ans l a t i ona l control 51 s ignals 2) The structure of the abg gene product 51 a) General features of Abg 51 b) Comparisons of the Abg sequence with 56 other fl-glucosidase sequences 3) Codon usage of the abg gene 61 LITERATURE CITED 62 V LIST OF TABLES Table Page I Properties of various cellobiases 4 II Summary of cloned f3-gl ucos idase genes 10 III Bacterial s t r a i n s , plasmids and phages 15 IV P u r i f i c a t i o n of cellobiase from ATCC 21400 25 V ft-gl ucos idase a c t i v i t y in various E.. col i clones and 39 In Agrofract-erlym VI Comparison of the amino acid composition of the 55 fl-glucosIdase protein with the composition deduced from the abg gene VII Codon u t i l i z a t i o n of the abg gene 61 v l LIST OF FIGURES Figure Page 1. Structure of some common fl-glucosides 3 2. SDS-PAGE ana lys i s of samples obtained during the 26 p u r i f i c a t i o n of fl-glucosidase 3. DEAE-Sephacel e l u t i o n p r o f i l e of fl-glucosidase 27 4. E lu t ion p r o f i l e of fl-glucosidase from a second 28 DEAE-Sephacel column 5. Biogel-P-300 chromatography of the ft-glucosldase 29 a c t i v i t y peak from DEAE-Sephacel 6. FPLC anion exchange (MonoQ) chromatography of the 30 a c t i v i t y peak from Biogel-P-300 7. SDS-Urea-PAGE analys is of CNBr peptides from 32 fl-glucosidase 8. FPLC separation of the CNBr peptides from ATCC 21400 33 j l -g l ucos Idase 9. Amino ac id sequences of the CNBr peptides from the 34 fl-glucosidase, and the predicted sequence of those peptides as deduced from the DNA sequence 10. The amino terminal sequence of CNBr2 and the region 36 used to synthesize the ol igonucleot ide probes 11. Southern blot analys is of genomic DNA from 37 Aarobacterium and Escherichia co l 1 12. Western b lot ana lys is of (J-glucosidase samples using 40 rabbi t antiserum raised to the p u r i f i e d protein 13. Immunoadsorption of fi.. c o l l encoded fl-glucosIdase 41 by ant isera ra i sed against the Aarobacterlum fl-glucosidase 14. Detection of (5-gl ucos idase a c t i v i t y after SDS-PAGE 43 15. Southern blot analys is of pABGl 44 16. Linear representation of various ff-glucosidase 45 encoding plasmids 17. Exonuclease I I I d igest ion of pABG4F 47 18. SDS-PAGE analys is of whole c e l l extracts from 49 EL* co l 1 clones containing various fl-glucosidase encoding plasmids v i i 19. S e q u e n c i n g s t r a t e g y f o r the aba gene 50 20. N u c l e i c a c i d sequence and deduced amino a c i d 52 sequence o f the fl-glucosidase 21. N u c l e i c a c i d sequence homology o f the 5' f l a n k i n g 53 r e g i o n w i t h known promoter sequences 22. Regions o f amino a c i d homology i n the deduced 57 amino a c i d sequences of the fl-glucosidases from Aqroba,cterlu,m. ( A b g ) , §.. commune (Scb) and C_. p e l l i c u l o s a (Cpb) 23. The homology of v a r i o u s fl-glucanases at a p u t a t i v e 58 a c t i v e s i t e p roposed by a n a l o g y w i t h lysozyme v i i i ACKNOWLEDGEMENTS I would l i k e to thank Drs. R.A.J. Warren, R.C. M i l l e r , J r . , and D.G. K i l b u r n f o r t h e i r guidance and support d u r i n g t h i s work. A l s o , I wish to thank Dr. J.T. Beatty f o r h e l p f u l d i s c u s s i o n s . I would l i k e to thank Anthony Day and Steve Withers f o r i n f o r m a t i o n on the FPLC p u r i f i c a t i o n of the enzyme, Ms. Sandy K i e l l a n d and Dr. Robert O l a f s o n f o r the peptide sequencing, and Dr. D.J. M cKay f o r the N-terminal p r o t e i n sequence and amino a c i d a n a l y s i s , a l s o Dr. Tom Atk i n s o n and Dr. N i g e l Skipper f o r the o l i g o n u c l e o t i d e s y n t h e s i s and Dr. Michael Smith f o r H e l p f u l d i s c u s s i o n s c o n c e r n i n g the use of o l i g o n u c l e o t i d e probes and f i n a l l y B l a i r H e f f e l f l n g e r f o r t e c h n i c a l a s s i s t a n c e d u r i n g the p r o t e i n p u r i f i c a t i o n . I would a l s o l i k e to thank a l l the members of the C e l l u l a s e Group f o r t h e i r support when I needed i t . T h i s work was supported by an NSERC s t r a t e g i c grant G1726 to D.G.K, R.C.M, and R.A.J.W and a PILP grant to D.G.K, R.C.M, and R.A.J.W and A l l e l i x Inc. LIST OF ABBREVIATIONS aa, Amino acid(s) abg. Gene encoding the Agrobacter1um fl-glucosidase Abg, The protein encoded by abg ACN, A c e t o n l t r i l e Ap, A m p i c i l l i n BCIP, 5-bromo-4-chloro-3-indolyl-phosphate bp, Base pair(s) cob. Gene encoding the CandIda pel 1iculosa ft-glucosidase Cpb, The protein encoded by cob dA, Deoxyadenosine dC, Deoxycytosine dG, Deoxyguanosine dT, Deoxythymidine DEAE, Diethylaminoethyl anion exchange resin FPLC, Pharmacia Fast Protein Liquid Chromatography system IPTG, Isopropyl-ft-D-thiogalactos ide Kb, 1000 base pairs lacZ, E. c o l i fi-galactosidase gene LacZ*, The f i r s t 78 amino acids of fl-galactosidase including the operator and promoter regions of the gene. LB, Luria broth MCS, Multiple cloning s i t e MOI, M u l t i p l i c i t y of infection MUG, 4-methylumbel1iferyl-fl-D-glucoside nt, Nucleotide PAGE, Polyacrylamide gel electrophoresis PNP, p-nitrophenol PNPG, p-n i trophenyl-ft-D-glucos ide PNPGase,p-n i trophenyl-fl-D-glucos idase PTH, Phenylthiohydantoin scb, Gene encoding the Sch1zophvl1um commune fl-glucosidase Scb, The protein encoded by scb SDS, Sodium dodecyl sulfate ss, Single stranded SSC, Standard saline c i t r a t e TFA, T r i f l u o r o a c e t i c acid X X - g a l , 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - f t - D - g a l a c t o s i d e X - g l c , 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - f f - D - g l u c o s i d e 1 INTRODUCTION I Background A) C e l l u l a s e The enzyme 0 - g l u c o s l d a s e (fl-D-glucosIde g l u c o h y d r o l a s e E.C. 3.2.1.21) i s a component of the c e l l u l a s e complexes of many c e l l u l o l y t l c organisms (Shewale, 1982; Schiemann, 1983). T h i s type of enzyme i s a l s o found i n n o n - c e l l u l o l y t l c organisms, and i n m u l t i p l e forms i n a v a r i e t y of microorganisms (Schiemann, 1983). Many of them hy d r o l y z e a v a r i e t y of s u b s t r a t e s , i n c l u d i n g a r y l - f l - D - g l u c o s i d e s . T h i s d i s c u s s i o n c o n s i d e r s o n l y those fl-glucosidases e i t h e r involved i n or i m p l i c a t e d i n the h y d r o l y s i s of c e l l u l o s e . C e l l u l o s e h y d r o l y s i s Involves the s y n e r g i s t i c a c t i o n of endo-1,4-(!-glucanases (endoglucanase), exo-1,4 - 0-glucanases (exoglucanase or c e 1 l o b i o h y d r o l a s e ) and the fl-glucosidases ( e e l l o b i a s e s ) (Coughlan, 1985; E n a r i , 1983; and Mandels, 1982). The main products of the a c t i o n of endo- and exoglucanases are c e l l o b i o s e and glucose (Streamer e t a l . , 1975; Wood and McCrae, 1981). C e l l o b i o s e i n h i b i t s the endo-and exoglucanases. I t i s g e n e r a l l y thought t h a t one r o l e of fi-glucosidase in c e l l u l o s e h y d r o l y s i s i s to convert c e l l o b i o s e to g l u c o s e , thereby r e l i e v i n g endproduct i n h i b i t i o n of the endo- and exoglucanases and s t i m u l a t i n g the h y d r o l y s i s ( S ternberg e t a l . , 1977). 0-glucosidase c o u l d then be thought of as the r a t e l i m i t i n g enzyme f o r the s a c c h a r I f l c a t i o n of c e l l u l o s e . Although c e l l o b i a s e s are most a c t i v e on c e l l o b i o s e , the h y d r o l y s i s of h i g h e r e e l l o d e x t r i n s by fl-glucosidase may a l s o be important i n the s a c c h a r i f l c a t i o n of c e l l u l o s e ( Shewale, 1982). Furthermore, the t r a n s g l y c o s y l a t i o n a c t i v i t y of fl-glucosidase c o u l d generate molecules which are capable of inducing s y n t h e s i s of the c e l l u l a s e complex (Coughlan, 1985). 2 B) Measurement of fl-glucosIdase a c t i v i t y M u l t i p l e fl-glucosidase a c t i v i t i e s are found commonly In both c e l l u l o l y t i c fungi and b a c t e r i a (Wakarchuk et a l . , 1984; Schiemann, 1983; Shewale, 1982). In g e n e r a l , the s u b s t r a t e s p e c i f i c i t i e s of c e l l o b l a s e s are q u i t e broad, although r a t e s of h y d r o l y s i s vary g r e a t l y with the nature of the aglycone moiety (Shewale, 1982). Nonetheless, these enzymes are separable i n t o two broad groups: a r y l - 0 - D - g l u c o s l d a s e s which have hi g h a c t i v i t i e s on a r y l - and a l k y l - f l - D - g l u c o s i d e s ( f i g . 1) but u s u a l l y a r e l a t i v e l y low a c t i v i t y on c e l l o b i o s e ; and the true c e l l o b l a s e s which are h i g h l y a c t i v e on c e l l o b i o s e and higher e e l l o d e x t r i n s . The d i s t i n c t i o n between the groups i s not always c l e a r , however, because many fl-glucosidases are h i g h l y a c t i v e on both a r y l - f l - D - g l u c o s i d e s and c e l l o b i o s e (Table I ) . T h i s can f a c i l i t a t e the assay of a c t i v i t y because of the ease and s e n s i t i v i t y of measuring the h y d r o l y s i s of s u b s t r a t e s such as p - n l t r o p h e n y l - f l - D - g l u c o s l d e . The h i g h molar e x t i n c t i o n c o e f f i c i e n t (18.8 ml/pmol/cm, Stoppock et a l . , 1982) f o r the p - n l t r o p h e n o l a t e anion makes t h i s a s e n s i t i v e assay f o r 0 - g l u c o s i d a s e . The d e t e r m i n a t i o n of glucose u s u a l l y i n v o l v e s a two s t e p assay u t i l i z i n g an enzymatic d e t e c t i o n of glucose (glucose oxidase or hexokinase/ glucose-6-phosphate dehydrogenase) which i s not as s e n s i t i v e and i s more t e d i o u s . II P r o p e r t i e s of fl-glucosidases A) K i n e t i c p r o p e r t i e s In examining the synergy of c e l l u l a s e s and the e f f e c t of c e l l o b l a s e on t h a t synergy there are three p r o p e r t i e s of the enzyme which must be c o n s i d e r e d : 1) the c a t a l y t i c e f f i c e n c y of the c e l l o b l a s e ( t u r n o v e r number); 2) the c o m p a t i b i l i t y of c e l l o b i o s e h y d r o l y s i s c o n d i t i o n s (pH and temperature) with the s a c c h a r i f i c a t i o n c o n d i t i o n s ; 3) the s u s c e p t i b i l i t y of the c e l l o b l a s e to endproduct ( g l u c o s e ) i n h i b i t i o n . A l i s t of the p r o p e r t i e s of some r e l e v a n t c e l l o b l a s e s i s shown in Table I. Figure 1. Structure of some common fl-glucosIdes• R=l,l-O-methyl-0-D-glucoside> R=2, Cellobiose; R=3 4-n i trophenyl-fl-D-glucos ide» R=4, 4-methyl - umbel 11 feryl-(5-D-gl ucos ide 0 O 7 4 4 Table I . P r o p e r t i e s o f v a r i o u s c e l l o b l a s e s . Organism Km Kt pH T«C re fe rence (a) (b) (c) Cd) (d) A l t e r n a r i a a l t e r n a t e 0.81 2.44 NA 4 .5 70 Hacrii, 1984 A s o e r a i l l u s n i ae r 5.63 33.7 3 .0 4 .5 60--70 Dtkktr, 1986 Asp^rfliMMs ph<?^niqM 0.75 164 NA 4 .3 50 Sternberg *t a l . , 1977 A s o e r a i l l u s t e r r u s 0 .4 NA 3 .5 4 .8 50 Horktan and Day, 1982 A s o e r a i l l u s w e n t i i A=> 0.15 118 2 .8 4 .0 50 LegUr tt a l . , 1972,1980 Q«J«Jid«. p e l l i c u l a 37 NA 6.5 6 .5 50 Kohchi tt a l . , 1983 Dekkera i n t e rmed ia 55 NA 1.0 5.0 50 Blondin tt a l . , 1983 S c l e r o t i c r o l f s i i BQ3 5.84 175 NA 4.1 65 Shtwalt and Sadana, 1981 SDorotr ichum thermoohi le 0.28 NA NA 6 .3 50 Heytr and Cantvascini, 1981 Talaromvces entersonii BQ1 0.58 96.2 NA 4.1 70 HeHale and Coughlan, 1981 B64 1.47 79.8 NA 5.7 35 HcHal* and Coughlan, 1981 Trichoderma k o n i n a i i A 1.18 NA 1.05 4 .0 40-•50 Hood and HcCrae, 1982 B 0 .86 NA 0.66 4 .0 40-•50 Wood and HcCrat, 1982 Trichoderma r ee se i 1 2.65 66.2 NA 4 .8 50 Gong tt a l . , 1977 2 2 .5 116 NA 4 .8 50 Song «t a l . , 1977 3 2.71 44.6 NA 4 .8 50 Gong tt a l . , 1977 4 3 .3 NA NA 6 .5 28 Inglin tt a l . , 1980 Aarobacter ium ATCC21400 0.70 30.34 6.4 6.8 NA Day and Hithtri, 1986 B a c t e r o i d e s oolvaraamatus 100 0.13 NA 6 .0 NA Mackenzie and Pattl, 1986 B a c t e r o i d e s succinoaenes 4 .3 NA NA 6.8 39 Groltau and Forsberg, 1981 C l o s t r i d i u m thermocel lum 83 7.1 135 6.5 60 Ait tt a l . , 1982 Pseudomonas f luo rescens 5.89 NA NA 7.0 30 Huang and Suzuki, 1976 Ru,minocpccus a lbus 26 NA NA 6 .5 30-•35 Ohiyma tt a l . , 1983 StreDtomvces CB-12 2.56 NA NA 7.0 40 Holdovtanu and Klutpftl, 1983 Streotomvces f l a v o a r i s e u s 8.05 NA NA 6.5 40 Hoidovejnu and Klutpftl, 1983 a) mM c e l l o b i o s e b) umol/min/mg p r o t e i n w i t h c e l l o b i o s e as subs t r a t e c) mM glucose d) optimum va lues e) NA, not a v a i l a b l e 5 From Table I It can be seen t h a t the k i n e t i c p r o p e r t i e s are q u i t e v a r i e d . S i n c e many more fungal enzymes have been c h a r a c t e r i z e d than b a c t e r i a l enzymes, i t i s d i f f i c u l t to compare the enzymes as groups, but on an i n d i v i d u a l b a s i s the ftSP^rqUlMS P h o b i c IS and S c l e r o t l u m r o l f s l l BG3 enzymes are the most a c t i v e c e l l o b l a s e s so f a r d e s c r i b e d . Of the b a c t e r i a l enzymes l i s t e d , only the Aarobacterium enzyme has a high a f f i n i t y f o r c e l l o b i o s e . The A_. p h o e n l c l s and A s p e r g i l l u s n i a e r enzymes have been examined i n s a c c h a r i f l c a t i o n experiments with Trichoderma reese1 c e l l u l a s e , and both are compatible with the r e p o r t e d h y d r o l y s i s c o n d i t i o n s (Sternberg e t a l . , 1977). The c o m p a t i b i l i t y of the other enzymes with the v a r i o u s h y d r o l y s i s c o n d i t i o n s used with J_. r e e s e l c e l l u l a s e has not been examined. The i n h i b i t i o n of c e l l o b i a s e by glucose i s a l s o a very important p r o p e r t y of t h i s enzyme (Dekker, 1986). In order to o b t a i n maximum glu c o s e p r o d u c t i o n a r e l a t i v e l y high r e s i s t a n c e to endproduct i n h i b i t i o n i s r e q u i r e d . When examining the i n h i b i t i o n of c e l l o b i a s e by g l u c o s e , the e f f e c t i s o f t e n expressed as an i n h i b i t i o n c onstant Ki. This value i s d e f i n e d as the c o n c e n t r a t i o n of i n h i b i t o r a t which the r e a c t i o n r a t e i s reduced by 50%. The Ki values can be compared f o r some of the enzymes l i s t e d i n Table I. The enzyme which i s most s e n s i t i v e to glucose i s from J_. k o n l n a i i and the l e a s t s e n s i t i v e Is from Clostridium, thermocel lum. However, i t must be noted that the Km of the C_. thermocel 1 um c e l l o b i a s e i s very high compared to many of the c e l l o b l a s e s , so i t i s not unexpected that i t has a high Ki f o r g l u c o s e . The Ki f o r the A_. n i a e r c e l l o b i a s e i s only 3 mM, yet i t i s c l a i m e d t h a t t h i s enzyme s t i l l h y d r o l y z e s c e l l o b i o s e i n the presence of up to 0.83 M (15%) glucose (Dekker, 1986). From the data i n Table I i t i s c l e a r that c e l l o b l a s e s vary widely i n t h e i r a c t i v i t i e s . In g e n e r a l , the c e l l o b l a s e s from filamentous f u n g i are very a c t i v e on c e l l o b i o s e with the e x c e p t i o n of the A l t e r n a r i a a l t e r n a t a enzyme which has an u n u s a l l y low V m.» f o r a fungal c e l l o b i a s e . The two yeast c e l l o b l a s e s , from Candjfla, P g U l c q l o s a , and Dekkera Intermedia. 6 have a much lower a c t i v i t y on cellobiose compared to those from the other fungi, and they appear similar to the b a c t e r i a l enzymes. It should also be mentioned that a major difference between fungal and bacterial c e l l o b i a s e s is that the former are secreted enzymes whereas the l a t t e r are always c e l l associated. This is a very important property of these enzymes; i f they are to be p u r i f i e d for industrial use a secreted enzyme Is obviously more desirable. The b a c t e r i a l cellobiases have been less well characterized than the fungal enzymes. Again, there is a large variation in a c t i v i t y on c e l l o b i o s e , similar to the range seen with the fungal enzymes; however, the b a c t e r i a l enzymes overall have much higher K m values. The Vm.* values for the b a c t e r i a l enzymes are much lower than those reported for the fungal enzymes. The exception is the Agrobacter i um enzyme which k i n e t i c a l l y is very s i m i l a r to the A. niger ce11ob iase. B) The role of fl-glucosidase ln c e l l u l o s e hydrolysis The addition of p u r i f i e d cellobiase to enzymatic hydrolysis reactions stimulates c e l l u l o s e s a c c h a r i f i c a t i o n . Using T. reese i c e l l u l a s e and a X- reese i cellobiase a two fold stimulation of exoglucanase a c t i v i t y was noted with the addition of excess cellobiase (Berghem and Pettersson, 1974). With Trlchoderma koninaii c e l l u l a s e and cellobiase, the action of cellobiase and cellobiohydrolase accounts for 63% of the t o t a l hydrolysis compared to 32% for the cellobiohydrolase alone ( H a l l l w e l l and G r i f f i n , 1978). The level of hydrolysis with cellobiohydrolase and cellobiase was equal to the level of hydrolysis with cellobiohydrolase and endoglucanase together. From a separate study also using X* kon i n g l i c e l l u l a s e a stimulation by cellobiase was also demonstrated; however, the major synergistic components from this study were the cellobiohydrolase and the endoglucanase (Wood and McCrae, 1982). The extent of hydrolysis measured in these two studies was not the same and the d i f f e r e n t r e s u l t s from cellobiase 7 s t i m u l a t i o n are l i k e l y due to d i f f e r e n t l e v e l s of the v a r i o u s enzymes c o n t a i n e d In the h y d r o l y s i s r e a c t i o n s . The d i f f e r e n t assay techniques used f o r the d e t e r m i n a t i o n of h y d r o l y s i s l i k e l y a l s o c o n t r i b u t e d to the v a r i a t i o n In r e s u l t s . With the c e l l u l a s e and c e l l o b i a s e from £.. thermocellum. a s t i m u l a t i o n of c e l l u l o s e h y d r o l y s i s by the a d d i t i o n of c e l l o b i a s e was a l s o d e s c r i b e d ( A i t e t a l . , 1982). In t h i s study the s t i m u l a t i o n was approximately two f o l d over t h a t obtained with c e l l u l a s e a l o n e . The c e l l u l a s e system of X* r e e s i has p o t e n t i a l f o r the p r a c t i c a l s a c c h a r I f l c a t I o n of c e l l u l o s i c m a t e r i a l s (Mandels, 1982); however, X* r e e s e l c e l l u l a s e i s d e f i c i e n t i n c e l l o b i a s e a c t i v i t y ( S ternberg e t a l . , 1977). This has l e d to the idea of supplementing c e l l u l a s e s produced by one organism with c e l l o b i a s e from another. The a d d i t i o n of A., p h o e n l c i s c e l l o b i a s e to a X* v i r i d a e (reese i ) s a c c h a r i f i c a t i o n r e s u l t e d i n a 50% r e d u c t i o n i n the time taken to reach the maximum sugar r e l e a s e d (Sternberg et a l . , 1977). The a d d i t i o n of SchUophyUvm commune c e l l o b i a s e to a X- r e e s e l h y d r o l y s i s r e a c t i o n produced a 60% inc r e a s e i n the t o t a l g lucose r e l e a s e d (Desrochers et a l . , 1981). I t i s Important to note t h a t In a l l of the synergy experiments mentioned, the assay c o n d i t i o n s , amounts of enzyme and type of c e l l u l o s i c s u b s t r a t e were not the same. T h i s makes a d i r e c t comparison of r e s u l t s i m p o s s i b l e ; however, i t Is c l e a r that even under v a r i e d h y d r o l y s i s c o n d i t i o n s there i s a s i g n i f i c a n t e f f e c t of c e l l o b i a s e on the s a c c h a r I f i c a t i o n of c e l l u l o s e . I l l A p p l i c a t i o n of molecular b i o l o g y to the study of fl-glucosidase A) Approaches to the g e n e t i c improvement of ft-glucosidase In the past few years the study of p r o t e i n s t r u c t u r e and f u n c t i o n has been f a c i l i t a t e d by recombinant DNA technology. The a p p l i c a t i o n of t h i s technology to c e l l u l a s e enzymes has allowed the s e p a r a t i o n of m u l t i p l e components l n order to study i n d i v i d u a l enzymes and there has now been a r e p o r t of 8 the f i r s t c r y s t a l l i z a t i o n of a recombinant DNA encoded endoglucanase ( J o l l i f e t a l . , 1986). T h i s a r e a of r e s e a r c h has r e c e n t l y been reviewed (Beguin e t a l . , 1986) so t h i s d i s c u s s i o n w i l l be l i m i t e d to fl-glucosidases. G e n e t i c improvement of i n d u s t r i a l l y u s e f u l organisms t r a d i t i o n a l l y has been approached by e i t h e r chemical or r a d i a t i o n mutagenesis f o l l o w e d by s e l e c t i o n of the d e s i r e d mutant. Mutagenesis has been used to produce mutants of J_. r ees i which make fl-gl ucos idase t h a t i s r e s i s t a n t to end-product i n h i b i t i o n (Montenecourt et a l . , 1982). A mutant s t r a i n of A l t e r n a r i a a l t e r n a t a produces more c e l l o b l a s e compared to the p a r e n t a l s t r a i n and t h i s c e l l o b l a s e has' one of the h i g h e s t t h e r m o s t a b i l i t i e s r e p o r t e d f o r c e l l o b l a s e ( M a c r l s , 1984). A mutant s t r a i n of Cellulomonas which produces i n c r e a s e d l e v e l s of c e l l o b l a s e has an i n c r e a s e d l e v e l of c e l l u l o l y t i c a c t i v i t y (Hagget et a l . , 1978). Mutants which overproduce a p a r t i c u l a r c e l l u l a s e enzyme al l o w the study of i n d i v i d u a l components of the c e l l u l a s e complex. This component may then be p u r i f i e d , p o s s i b l y on a l a r g e s c a l e . As an a l t e r n a t i v e to t r a d i t i o n a l methods of mutagenesis and s e l e c t i o n , gene c l o n i n g o f f e r s the a b i l i t y to i s o l a t e and study s i n g l e genes i n organisms such as E s c h e r i c h i a c o l 1 and Saccharomvces c e r e v l s a e which are e a s i l y manipulated i n the l a b o r a t o r y and have been shown to express a l l the va r i o u s c e l l u l o l y t i c enzyme a c t i v i t i e s (Beguin et a l . , 1986). Once a gene has been i s o l a t e d , i t s s t r u c t u r e can be determined and t h i s i n f o r m a t i o n can be used to increase the l e v e l s of e x p r e s s i o n such that l a r g e q u a n t i t i e s of the recombinant p r o t e i n can be obtained f o r s t r u c t u r e and f u n c t i o n s t u d i e s or f o r i n d u s t r i a l a p p l i c a t i o n s ( O ' N e i l l et a l . , 1986; J o l i f f et a l . , 1986; B o l l o n , 1984). Once d e f i n e d the s t u c t u r e of the p r o t e i n can be a l t e r e d through the use of s i t e - d i r e c t e d mutagenesis and these changes may be used to a l t e r the a c t i v i t y or s u b s t r a t e s p e c i f i c i t i e s of enzymes. Se v e r a l f a c t o r s must be c o n s i d e r e d when a gene i s to be c l o n e d . The most important f a c t o r i s the d e t e c t i o n of the c l o n e d gene or i t s product. This can be accomplished in 9 s e v e r a l ways: 1) with a s p e c i f i c RNA or DNA h y b r i d i z a t i o n probe; 2) by immunodetection of the gene product with antibody r a i s e d a g a i n s t the n a t i v e p r o t e i n ; 3) by d i r e c t assay f o r the enzyme of i n t e r e s t . Again the reader i s r e f e r r e d to the e x c e l l e n t review by Beguin et a l . , (1986) f o r the d e t a i l e d e x p l a n a t i o n s of the a p p l i c a t i o n of these methods to the c l o n i n g of c e l l u l a s e genes. B) The molecular c l o n i n g of <5-gl ucos idases B a c t e r i a l fJ-gl ucos idase genes have been cloned from E s c h e r i c h i a a d e c a r b o x v l a t a (Armentrout and Brown, 1981), Erw in i a c a r o t o v o r a var chrysanthemi (Barras et a l . , 1984), Cel1ulomonas f 1 mi (Bates et a l . , 1986), Cellulomonas uda (Nakamura et a l . , 1986), C_. thermoce 11 um (Scharwz et a l . , 1985), C l o s t r i d i u m a c e t o b u t v l i c u m (Zappe et a l . , 1986), and Agrobacterium ATCC21400 (Wakarchuk et a l ., 1986). Fungal ff-glucosidase genes have been cl o n e d from CandIda pel 1 i c u l o s a (Kohchi and Toh-e, 1986), Kluvveromvces f r a g l l i s (Raynal and Guerineau, 1984), and A_. n i a e r ( P e n t i l a et a l . , 1984). A summary of the c l o n e d fl-glucosidases i s shown in Table I I . The b a c t e r i a l genes l i s t e d i n Table II have been c l o n e d into c o l i because there seem to be few b a r r i e r s to the e x p r e s s i o n of heterologous b a c t e r i a l genes in t h i s host. The fungal genes have been cloned into S. cerev i s l a e . a e u k a r y o t i c host, s i n c e the s t r u c t u r e of e u k a r y o t i c genes sometimes precludes t h e i r d i r e c t e x p r e s s i o n in c o l i . The gene from K.. f r a g i l l s was c l o n e d d i r e c t l y i n t o E_. c o l 1 I n d i c a t i n g that the gene from t h i s yeast does not c o n t a i n i n t e r v e n i n g sequences (Raynal and Guerineau, 1984). The gene from C_. p e 1 1 i c u l o s a a l s o does not c o n t a i n any i n t e r v e n i n g sequences; however no attempt was made to express t h i s gene in E.. c o l i . The r a t i o n a l e s f o r c l o n i n g these fl-glucosidase genes v a r i e d . The yeast genes were cloned with the aim of producing a s t r a i n of yeast capable of growing on c e l l o b i o s e and fermenting i t to e t h a n o l . R e l a t i v e l y few n a t u r a l l y o c u r r i n g yeasts ferment c e l l o b i o s e , and they do so i n e f f i c i e n t l y ( F r e e r and Detroy, 1983). Therefore, i f the d e s i r e d product from T a b l e I I . Summary o f c l o n e d fl-glucosidase genes Organism S c r e e n i n g Method E x p r e s s i o n l e v e l * r e f e r e n c e A a r o b a c t e r i u m ATCC21400 DNA p r o be h i g h Uakarchuk et a l . , 198S C l o s t r i d i u m a c e t o b u t v l i c u m enzyme " a c t i v i t y low Zapp* et al . , 1986 C l o s t r i d i u m t h e r m o c e l l u m i n d i c a t o r c p l a t e s low Schvarz et a l . , 1986 C e l l u l o m o n a s f i m i i n d i c a t o r p l a t e s h i g h Bates et al., unpublished observations C e l l u l o m o n a s uda i n d i c a t o r p l a t e s h i g h Nakaaura et al . , 1986 E r w i n e a c a r o t o v o r a c o m p l e m e n t a t i o n NA • Barras et a l . , 1984 E s c h e r i c h i a a d e c a r b o x v l a t a growth on c e l l o b i o s e low Anentrout and Brown, 1981 A s o e r a i l l u s n i a e r i n d i c a t o r p l a t e s v e r y low Pentillia et al . , 1984 C a n d i d a D e l l i c u l o s a i n d i c a t o r p l a t e s low Kohchi and Toh-e, 1986 K l u v v e r o m v c e s f r a a i l i s enzyme " a c t i v i t y h i g h Raynal and 6uerineau, 1984 a) Low e x p r e s s i o n i s d e f i n e d as e x p r e s s i o n below t h e l e v e l found i n t h e o r i g i n a l ft-glucosidase p r o d u c i n g o r g a n i s m . b) Enzyme a c t i v i t y was d e t e r m i n e d as gas p r o d u c t i o n from c e l l o b i o s e by £• c o l i c o n t a i n i n g r e c o mbinant p l a s m i d DNA. c ) I n d i c a t o r p l a t e s f o r £. t h e r m o c e l l u m and C. f i m i c o n t a i n e d t h e t h e f l u o r e s c e n t i n d i c a t o r 4-methyl-umbel 1 i f e r y l - $ - D - g l u c o s i d e . The i n d i c a t o r 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - f l - D - g l u c o s i d e was used f o r d e t e c t i n g t h e genes from £. uda. ft. n i q e r and £. p e l l i c u l o s a . d) Enzyme a c t i v i t y was d e t e r m i n e d by a s s a y i n g p o o l s of recombinant DNA c o n t a i n i n g g. c o l l f o r PNPGase. e) NA, not a v a i l a b l e A l l o f t h e b a c t e r i a l genes were c l o n e d i n t o §. c o l i . The £. c a r o t o v o r a ?enes were c l o n e d i n t o E. c a r o t o v o r a mutants a s w e l l as E. QQTT. he f u n g a l genes were c l o n e d i n t o Saccharomvces c e r e v i s i a e . The K. T r a g i l i s gene was a l s o c l o n e d i n t o E. c o l l . 11 c e l l u l o s e degradation is ethanol, an e f f i c i e n t cellobiose-fermentlng s t r a i n of yeast would be of i n d u s t r i a l i mportance. The n lger ff-gl ucos idase gene was isolated in an attempt to clone genes whose products would be of biotechnological importance, and which would provide information about the molecular biology of filamentous fungi. Information about gene structure and function in filamentous fungi is expanding since these organisms are capable of very high levels of protein secretion (Hendy et a l . , 1982). The enzymes naturally secreted by these fungi include amylase, fi-glucosidase, and c e l l u l a s e ( B a l l , 1984). The fl-gl ucos idase genes from E,. carotovora were cloned because t h i s organism is a plant pathogen capable of degrading plant c e l l walls and releasing cellobiose which can then be u t i l i z e d by t h i s organism (Barras et a l . , 1984). The characterization of the degradative enzymes of t h i s organism may aid in the e l u c i d a t i o n of the mechanisms of virulence. The remaining fl-glucosidase genes in Table II were cloned because t h e i r gene products are part of c e l l u l a s e complexes, and their study may enable reconst1 tut Ion of an optimized c e l l u l a s e complex. These cloned genes could also be u t i l i z e d in hosts d e f i c i e n t In production of this enzyme, or as a means of producing large quantities of enzyme for use ln supplementing i n d u s t r i a l scale sacchar1flcatIon reactions. The fl-gl ucos idase genes from both acetobutvl icum and C. thermoceHum were not characterized except for t h e i r a b i l i t y to cleave chromogenic ft-glucosides in screening plates (Schwarz et a l . , 1986; Zappe et a l . , 1986). The adecarboxvlata gene was introduced into the ethanol producing bacterium Zvmomonas mobi1 is which lacks cellobiase a c t i v i t y (Armentrout and Brown, 1984). This enzyme, l i k e l y a cellobiose phosphorylase, is membrane bound and requires a cytoplasmic factor for a c t i v i t y (Armentrout and Brown, 1981). These properties make i t unattractive for preparation in large amounts for supplementing sacchar1flcatIon reactions. 12 Two fl-glucosIdase genes from Cellulomonas uda were clo n e d and expressed at a h i g h l e v e l l n E. c o l 1 (Nakamura et a l . , 1986). Both genes encoded a r y l - f l - D - g l u c o s i d a s e a c t i v i t y ; however, only one of them allowed c o l 1 to grow on c e l l o b i o s e . There were no q u a n t i t a t i v e r e s u l t s r e p o r t e d f o r c e l l o b i o s e h y d r o l y s i s . The l e v e l of e x p r e s s i o n of the uda gene which al l o w s growth of c o l 1 on c e l l o b i o s e i s high compared to the p a r e n t a l organism; however, i t i s not yet known i f t h i s enzyme i s a true c e l l o b i a s e or a c e l l o b i o s e phosphorylase. The Aarobacterium c e l l o b i a s e gene has been i s o l a t e d f o r use with the recombinant c e l l u l a s e s of C_. f imi • The c e l l o b i a s e from f i m i has not yet been c h a r a c t e r i z e d ; however, a recombinant DNA clone encoding a r y l - f l - D - g l u c o s i d a s e and c e l l o b i a s e a c t i v i t y has been i s o l a t e d , and the l e v e l s expressed by the recombinant clone should allow biochemical s t u d i e s to be done on the recombinant enzyme(s) (Bates et a l . , unpublished o b s e r v a t i o n s ) . The Aarobacterium ( p r e v i o u s l y Alcal1genes f a e c a l i s ) c e l l o b i a s e was i n i t i a l l y c h a r a c t e r i z e d by Han and S r i n i v a s a n (1969). This enzyme is very a c t i v e on c e l l o b i o s e and has k i n e t i c p r o p e r t i e s s i m i l a r to the c e l l o b i a s e from A., n l g e r (Table I ) . In a d d i t i o n t h i s organism was o r i g i n a l l y i s o l a t e d from a mixed p o p u l a t i o n of Cellulomonas and other s p e c i e s growing on c e l l u l o s e (Han and S r i n i v a s a n , 1968; Han, 1968). The mixed p o p u l a t i o n of Agrobacterlum and Cellulomonas was used l n the p r o d u c t i o n of s i n g l e c e l l p r o t e i n from a c e l l u l o s i c s u b s t r a t e , where a 6 - f o l d Increase i n c e l l mass r e s u l t e d from t h e i r c o - c u l t u r e (Han, 1982). The only obvious c o n t r i b u t i o n from the Agrobacterium was c e l l o b i o s e u t i l i z a t i o n , so i t seemed l o g i c a l to clone the Agrobacterium c e l l o b i a s e gene f o r use with the c e l l u l a s e s of C_. f 1ml. Our l a b o r a t o r y has been s t u d y i n g the c e l l u l o l y t i c enzymes from Cellulomonas f l m l by molecular c l o n i n g with the goal of r e c o n s t r u c t i n g an optimized c e l l u l a s e complex f o r the p r o d u c t i o n of glucose from c e l l u l o s e . P r e v i o u s l y we d e s c r i b e d the molecular c l o n i n g and e x p r e s s i o n of both endo- and 13 exoglucanase genes from th i s organism (Gilkes et a l . , 1984). Experiments ln our laboratory to determine the optimal r a t i o of the cloned ce l lu l a ses are cur ren t ly underway. Cel lobiase is an important enzyme ln c e l l u l o s e hydrolysis and e f f i c i e n t hydrolys is may depend on determining the optimal concentration of t h i s enzyme in a mixture of c e l l u l a s e s . Since bac t e r i a l ce l lob iases are produced at low leve ls and are i n t r a c e l l u l a r enzymes a recombinant source of ce l lob iase should enable s u f f i c i e n t quant i t ies to be obtained for use in synergy exper1ments. This thesis describes the molecular c loning and expression of a fl-glucosidase from an Agrobacterium species . The work described here is presented in two parts : f i r s t , the p u r i f i c a t i o n of the protein and the molecular c loning of the gene; then the charac te r iza t ion of the gene by determination of the DNA sequence. 14 MATERIALS AND METHODS I Bacterial s t r a i n s , plasmids and phages ATCC 21400 served as the source of the fl-glucosidase gene. This organism was o r i g i n a l l y i d e n t i f i e d as Alcaliqenes  f a e c a l i s (Han and Srinivasan, 1968); however, the American Type Culture C o l l e c t i o n , ATCC, has r e c l a s s i f e d this isolate as a species of Aarobacterium. The Escherichia c o l i strains JM101, JM109 and JM83 were described previosly (Yanisch-Perron et a l . , 1985). The plasmids pUC13 and pUC18 were maintained in JM83 (Messing, 1983). The plasmids pTZ18U and pTZ19U were maintained in JM101 ( V i e i r a , 1985). The phage vectors M13mpl0/ll were maintained as phage preparations (Messing, 1983). JM101 and JM109 were maintained on M9 minimal medium plates ( M i l l e r 1972). The c h a r a c t e r i s t i c s of these b a c t e r i a l s t r a i n s , plasmids and phages is given in Table I I I . Plasmid containing str a i n s were grown in Luria broth (LB), ( M i l l e r 1972) containing 100 pg ampici11 in/ml . For small scale enzyme preparation cultures of both E_. col i and Aarobacterium were grown in M9 minimal medium with glycerol as carbon source for E. c o l i and cellobiose as carbon source for Aarobacterium. II Preparation of (S-gl ucos idase ATCC 21400 was grown at 30°C in M9 minimal medium supplemented with 0.1% yeast extract and 0.4% lactose. For large scale preparation 80 l i t e r s of c e l l s were grown in a s t i r r e d fermenter. C e l l s were harvested with a Sharpies centrifuge and the c e l l paste was stored at -20°C u n t i l needed. A l l subsequent manipulations were carr i e d out at 4°C, except the FPLC chromatography, which was done at room temperature. C e l l extracts were prepared by grinding the c e l l s with 2.5 times th e i r weight of alumina powder (Schleif and Wensink, 1981). The extraction buffer was 50 mM sodium phosphate pH 7.0, 10 mM 2-mercaptoethanol. T a b l e I I I . B a c t e r i a l s t r a i n s , p l a s m i d s a n d p h a g e s B a c t e r i a l S t r a i n G e n e t i c c h a r a c t e r i s t i c s R e f e r e n c e £ . c o l i JM83 a r a A< l a c - D r o A B ) r o s L 080 l a c Z A M 15 ( a ) c o l i JM101 S U D E t h i A ( l a c - D r o A B ) C F ' t r a D 3 6 ( a ) D r o A B l a c I " Z A M 1 5 ] £ . c o l 1 JM109 endA a v r A hsdR r e c A r e l A S U D E t h i ( a ) I F ' t r a D 3 6 D r o A B l a d q Z A M 1 5 ] ATCC 21400 c e l l o b i o s e u t i l i z a t i o n <b> P l a s m i d G e n e t i c c h a r a c t e r i s t i c s Re f e r e n c e pUC13 A D " l a c Z ' <c> pUC18 A p r l a c Z ' ( c ) p T Z 1 8 U A p - l a c Z ' or\f\ ( d ) p T Z 1 9 U A p - l a c Z / p r i H <d) Phage G e n e t i c c h a r a c t e r i s t i c s Re f e r e n c e M13mpl0 l a c Z / <c> M13mpl1 J ? c Z ' <c> M13K07 Km" ( d ) r e f e r e n c e s : a ) Y a n n i s c h - P e r r o n e t a l . , 1985 b ) Han a n d S r l n i v a s a n , 1969 c ) M e s s i n g , 1983 d ) V i e r a , 1985 16 The crude extract was c l a r i f i e d by centrifugation at 35,000 g for 30 min. Nucleic acids were prec i p i t a t e d with 1.5% streptomycin sulfate and the p r e c i p i t a t e was removed by centrifugation for 20 min at 20,000 g. The c l a r i f i e d extract was then pumped onto a DEAE-Sephace1 column, 2 cm x 60 cm, equilibrated with 50 mM sodium phosphate buffer, pH 7.0. The eluant was a 1-L linear gradient of 0 t-e 1 M NaCl in the s t a r t i n g buffer. Fractions containing ft-glucosidase were pooled, diluted 3 fold with s t a r t i n g buffer and pumped onto a 1.5 cm x 30 cm DEAE-Sephace1 column. The eluant was a 200 ml linear 0.2 M to 0.8 M NaCl gradient in s t a r t i n g buffer. Fractions containing a c t i v i t y were pooled and concentrated by u l t r a f i l t r a t i o n using Amicon YM-10 or YM-30 membranes. The pooled concentrated DEAE-Sephace1 eluate was loaded onto a Bio-gel P-300 column, 1.5 cm x 75 cm, which was equilibrated in s t a r t i n g buffer containing 100 mM NaCl. Protein was eluted with the same buffer. Fractions containing a c t i v i t y were pooled and loaded onto a Pharmacia MonoQ anion exchange column that was equilibrated in s t a r t i n g buffer. The protein was eluted with a 40 ml gradient of 0.2 M to 0.4 M NaCl in s t a r t i n g buffer. Those fractions with the highest s p e c i f i c a c t i v i t y were pooled and dialyzed against 10 mM NrUHCOa, pH 8.0. I l l Enzymatic assays and protein determination Cell extracts were prepared as follows: f i r s t , the c e l l s were concentrated 10 to 50-fold by centrifugation; second the c e l l p e l l e t s were resuspended In 1-2 ml of extraction buffer; f i n a l l y , the suspensions were sonicated using a Bronson s o n i f i e r , with a microprobe set at an intensity of 2 for 2 bursts of 15 seconds, ft-glucosidase a c t i v i t y was assayed by the release of prnitrophenol from p-nitrophenyl-fl-D-glucoside (PNPG). A c t i v i t y was also measured by the production of glucose from cellobiose. The assay conditions for PNPG and cellobiose hydrolysis were as 17 f o l l o w s : 0.5 ml of 50 mM sodium phosphate b u f f e r pH 7.0 c o n t a i n i n g 1.2 mM PNPG or 12.5 mM c e l l o b i o s e , was prewarmed to 37°C; to the prewarmed mixture 0.1 ml of s u i t a b l y d i l u t e d enzyme s o l u t i o n was added and g e n t l y mixed. PNPGase r e a c t i o n s were stopped by the a d d i t i o n of 0.6 ml of 1 M Na 2C0 3, mixed with a vortex mixer and then kept on i c e . C e l l o b i a s e r e a c t i o n s were stopped by the a d d i t i o n of D-gluconic a c i d l a c t o n e to a f i n a l c o n c e n t r a t i o n of 5 mM (Reese et a l . , 1971). The r e l e a s e of PNP was q u a n t i t a t e d s p e c t r o p h o t o m e t r i c a l l y by measuring the A -»oo of the s o l u t i o n . The molar e x t i n c t i o n c o e f f i c e n t at 400 nm f o r PNP in 0.5 M NasrCOo at 25 °C i s 18.8 ml/pmol/cm (Stoppock et a l ., 1982). The r e l e a s e of glucose from c e l l o b i o s e was q u a n t i t a t e d using D i a g n o s t i c k i t UV-15 (Sigma Chemical Co. St. L o u i s , M0). A u n i t of c e l l o b i a s e a c t i v i t y i s d e f i n e d as that amount of enzyme r e l e a s i n g 1 pmol of glucose from c e l l o b i o s e i n 1 min a t 37°C. A u n i t of PNPGase i s d e f i n e d as that amount of enzyme r e l e a s i n g 1 pmol of p - n i t r o p h e n o l from PNPG in 1 min a t 37°C. P r o t e i n was determined by the method of Lowry et a l . , (1951) using bovine serum albumin as a standard. IV Peptide p r o d u c t i o n , p u r i f i c a t i o n and sequencing A) Cyanogen bromide cleavage of the fl-glucosidase The p u r i f i e d p r o t e i n (10 nmol) was reduced and a l k y l a t e d with l o d o a c e t i c a c i d by the method of C r e s t f i e l d et a l . (1963), except that 6M guanidine h y d r o c h l o r i d e was used in p l a c e of 6M urea. The reduced and a l k y l a t e d p r o t e i n was d i a l y z e d e x h a u s t i v e l y a g a i n s t d i s t i l l e d H 20 and then l y o p h i l i z e d . The d r i e d product was d i s s o l v e d in 1 ml 70% f o r m i c a c i d and a 200-fold molar excess of s o l i d CNBr was added. The tube was f l u s h e d with argon, sealed and p l a c e d in the dark. The r e a c t i o n was incubated f o r 18-24 hr at 30°C. The r e a c t i o n was terminated by d i l u t i n g the r e a c t i o n mixture 10 - f o l d with d i s t i l l e d H 20 and then l y o p h i l i z i n g to near dryness. 18 B) Reversed phase chromatography The CNBr cleaved protein was d i l u t e d to a volume of 1 ml with 0.1% t r i f l u o r o a c e t i c acid (TFA). Aliquots of this mixture were applied to a Pharmacia proRPC 5/10 reversed phase FPLC column previously e q u i l i b r a t e d with 0.1% TFA. The peptides were eluted with a 25 ml l i n e a r gradient of 0 to 50% a c e t o n i t r i l e (ACN) in 0.1% TFA. The column effluent was monitored for absorbance at 280 nm. Fractions were then pooled and concentrated by evaporation in a Savant speedvac. C) Sequence determination of the peptides and amino acid analysis of the protein Peptides were sequenced by automated Edman degradation using an Applied Biosystems model 470A gas-phase sequenator u t i l i z i n g the resident sequencing program. The amino acid residues were analyzed by reversed phase HPLC chromatogaphy. This analysis was provided by the University of V i c t o r i a sequencing f a c i l i t y and the University of Calgary sequencing f a c i l i t y . The amino acid analysis was performed at the University of Calgary sequencing f a c i l i t y . The hydrolysis mixture included 0.1% phenol and 0.1% th i o - d i g l y c o l to protect the aromatic amino acids as well as methionine from oxidation during the hydrolysis (Dr. D. McKay, personal communication). V DNA methodology A) DNA i s o l a t i o n and analysis Chromosomal DNA was isolated as previously described (Mariur, 1961). Large scale preparations of plasmid pUC13 DNA were obtained by the CsCl method (Katz et a l . , 1973). Small scale plasmid preparations were made using the alkaline l y s i s method (Maniatis et a l . , 1982). Rest r i c t i o n endonuclease digestions were performed according to manufacturers' recommended procedures. Digestion was monitored by agarose gel electrophoresis (Maniatis et a l . , 19 1982). R e s t r i c t i o n fragments for cloning were isolated from low melting temperature agarose gels as previously described (Maniatis et al ., 1982). R e s t r i c t i o n fragments were transferred to n i t r o c e l l u l o s e paper by the method of Southern ( 1975) . B) Oligonucleotides synthesis and p u r i f i c a t i o n Oligonucleotides for hybridization screening were synthesized by Dr. T. Atkinson, at The University of B r i t i s h Columbia, using an Applied Biosystems automated DNA synthesizer model 380A. The oligonucleotides were p u r i f i e d by polyacrylamide gel electrophoresis (PAGE) on 20% acrylamide-7 M urea sequencing gels and reversed phase chromatography on Sep-Pak C i Q cartridges (Millipore/Waters Assoc., Milford,MA) (Atkinson and Smith, 1984). S p e c i f i c oligonucleotides to be used as primers for sequencing were synthesized and p u r i f i e d at A l l e l i x Inc., Missisauga, Ont. C) Construction and detection of recombinant DNA clones The cloning vector, pUC13, was digested with EcoRI and treated with c a l f i n t e s t i n a l a l k a l i n e phosphatase according to manufacturers' recommendations. Ligations were performed as previously described (Lathe et a l . , 1984). col i was transformed according to the method of Dagert and Eh r l i c h (1979). Bacterial colonies containing recombinant Agrobacterium DNA were grown on M9 minimal glucose medium plates supplemented with 5-bromo-4-chl oro-3- indol yl-|?-D-galactos idase (X-gal, 40 pg/ml), isopropyl-fl-D-thiogalactoside (IPTG, 0.2 mM), and 100 jjg ampici 11 in/ml (Yan 1 sch-Perron et a l . , 1985). Recombinant DNA from colonies was transferred to ni t r o c e l l u l o s e by the method of Grunstein and Wall is ( 1979). Oligonucleotides were l a b e l l e d at the 5' end with gamma-32P-ATP by the method of Z o l l e r and Smith (1983). Oligonucleotide hybridization reactions were performed in sealed p l a s t i c bags in 6X SSC/10X Denhardt's solution (0.9M 20 NaCl, 0.09M sodium c i t r a t e , 1% Bovine serum albumin, 1% polyvinylpyrrolidone, 1% F i c o l l ) at 37°C for 16 h. F i l t e r s were then washed at 37°C with several changes of 6X SSC. Radioautography was performed with Kodak XRP-1 film at -77°C with Intensifying screens. D) DNA sequencing Sequencing was performed by the enzymatic procedure of Sanger et a l . (1977) and the chemical cleavage method of Maxam and G i l b e r t (1980). The vectors used to obtain single stranded DNA were either M13mpl0 and M13mpll or pTZ18U and pTZ19U. Subclones for sequencing were generated by deletion with Exonuclease III and mungbean nuclease (Guo and Wu, 1983), or by cloning of s p e c i f i c r e s t r i c t i o n fragments. Single stranded M13 DNA template was prepared as previously described (Messing, 1983). Single stranded pTZ18/19 DNA was prepared as follows: a 2 ml culture of the recombinant clone was grown to an A s = 0 of 0.5-0.9 at 37°C in LB medium with 200 pg ampici11 in/ml. At thi s time helper phage M13K07 ( V i e i r a , 1985) was added at an MOI of 10 and the culture was shaken for an additional 1 h; 400 pi of this culture were then diluted into 10 ml of fresh LB medium containing 70 pg kanamycin/ml and this was allowed" to grow for 16-24 hr with vigorous shaking. The supernatents were then processed as described above for M13. For chemical sequencing, r e s t r i c t i o n fragments were label l e d with «- 3 2P-dATP using the Klenow fragment of DNA polymerase I (Maniatis et a l . , 1982). Uniquely end-labelled r e s t r i c t i o n fragments were generated by a second r e s t r i c t i o n endonuclease digestion and were recovered from preparative agarose gels using DEAE paper ( L i z a r d i , 1981). Samples were analyzed on 6,7 or 8% acrylamide gels (29:1 acrylamide to bis-acrylamide) containing 7 M urea and run as previously described (Sanger et a l . , 1977). Radioautography was done without intensifying screens for 4-24 hr at room temperature using Kodak XRP-1 f i l m . Sequence analysis was done using the SEQNCE program developed by Delaney Software (Vancouver, B.C) 21 or by the DNA Inspector II program (Textco, West Lebanon, New Hampshire). VI Polyacrylamide g e l e l e c t r o p h o r e s i s and fS-gl ucos idase a c t i v i t y s t a i n i n g Samples were analyzed by PAGE in sodium dodecyl s u l f a t e (SDS) c o n t a i n i n g g e l s as p r e v i o u s l y d e s c r i b e d (Laemmli, 1970). The s t a c k i n g g e l s were 3% acrylamide and the s e p a r a t i n g g e l s were 12% acrylamide (0.75 mm t h i c k ) . The r a t i o of acrylamide to b i s - a c r y l a m i d e was 30:0.8. E l e c t r o p h o r e s i s was performed at a constant c u r r e n t of 15 mA f o r s t a c k i n g and 30-50 mA f o r running. Gels were c o o l e d with running tap water. P r o t e i n was v i s u a l i z e d by s t a i n i n g with 0.03% coomassie b r i l l i a n t blue d i s s o l v e d in 10% a c e t i c a c i d and 25% 2-propanol. Excess s t a i n was removed by soaking the g e l in 10% a c e t i c a c i d u n t i l the background s t a i n i n g was minimal. fl-glucosidase a c t i v i t y in the g e l s was d e t e c t e d with 4- methyl-umbel 11 feryl-|?-D-glucos ide (MUG) or 5- bromo-4-chloro-3-indolyl-ft-D-glucoside (X-glc>. When a c t i v i t y was to be d e t e c t e d with MUG, 1 mU of PNPGase was loaded per lane on the g e l . Bands of f l u o r e s c e n c e c o u l d be d e t e c t e d by soaking the g e l i n a s o l u t i o n of 1.0 mM MUG i n 50 mM sodium phosphate b u f f e r , pH 7.0., and viewing the g e l under i l l u m i n a t i o n with UV l i g h t at 302nm. When X-glc was used to d e t e c t a c t i v i t y a t l e a s t 5 mU of PNPGase were loaded per lane on the g e l . A c t i v i t y was v i s u a l i z e d as a blue band a f t e r p l a c i n g the gel i n c o n t a c t with a 0.5% agarose o v e r l a y c o n t a i n i n g 50 pg X-glc/ml (100 pM) and 50 mM sodium phosphate b u f f e r , pH 7.0. (Wakarchuk et a l . , 1984). The MUG a c t i v i t y g e l s were photographed under U.V i l l u m i n a t i o n at 302 nm, using p o l a r o i d type 57 f i l m . The X-gl c s t a i n e d g e l s were f i x e d in 10% a c e t i c a c i d overnight and e i t h e r d r i e d under vacuum onto Whatman 3MM paper or between cel l o p h a n e s h e e t i n g . Both MUG and X-gl c were used i n agar p l a t e s f o r d e t e c t i o n of recombinant DNA c l o n e s e x p r e s s i n g fl-glucosidase a f t e r s u b c l o n i n g . For c l o n e s e x p r e s s i n g a low l e v e l of 22 fl-glucosidase a c t i v i t y , MUG was i n c o r p o r a t e d i n t o LB or M9 minimal g l y c e r o l media at a c o n c e n t r a t i o n of 100 pM. When hig h e r l e v e l s of e x p r e s s i o n were examined, X-glc was i n c o r p o r a t e d into the p l a t e s a l s o at a c o n c e n t r a t i o n of 100 pM. C o l o n i e s e x p r e s s i n g ft-glucosidase c o u l d e a s i l y be de t e c t e d as f l u o r e s c e n t c o l o n i e s on MUG c o n t a i n i n g media under long wave UV l i g h t (>300nm) or as blue c o l o n i e s on X-glc c o n t a i n i n g media. Pepti d e s were analyzed on 20% polyacrylamide g e l s c o n t a i n i n g 8 M urea in a d d i t i o n to SDS. VII Immunodetection and i mmunoadsorpt i on of <5-gl ucos idase Rabbit antiserum to p u r i f i e d fl-glucosidase was prepared as p r e v i o u s l y d e s c r i b e d ( W h i t t l e et a l . , 1982). D e t e c t i o n of ft-glucosidase by immunoblotting was performed as p r e v i o u s l y d e s c r i b e d (Towbin et a l . , 1979), u s i n g the a l k a l i n e phosphatase/ 5-bromo-4-chloro-3-indo1yl-phosphate (BCIP) d e t e c t i o n system (Blake et a l . , 1984). The IgG f r a c t i o n was p u r i f i e d by ammonium s u l f a t e f r a c t i o n a t i o n and coupled to Bio-Rad A f f i - g e l 10 a c c o r d i n g to manufacturers' recommended c o n d i t i o n s . fi-glucosidase was bound to the column at 4 °C f o r 16 h. B u f f e r c o n t a i n i n g 50 mM sodium phosphate, pH 7.0, 100 mM NaCl was used f o r a d s o r p t i o n of the enzyme to the column and f o r washing the column. An i d e n t i c a l column prepared with normal r a b b i t serum was used as a c o n t r o l . VIII I n d u c t i o n of fl-glucosidase e x p r e s s i o n in s t r a i n s c a r r y i n g recombinant pUC plasmids S t r a i n s which were to be ana l y s e d f o r i n d u c i b l e fl-glucosidase a c t i v i t y were prepared as f o l l o w s . The c e l l s were grown i n M9 minimal medium with 0.5% g l y c e r o l as s o l e carbon source and 100 pg ampici11 in/ml. The c e l l s were grown to A e = o of 0.2 at which time IPTG was added to a f i n a l c o n c e n t r a t i o n of 1 mM. Growth was monitored. When an A B B O of 23 2.0 was reached the c e l l s were harvested by centrifugation, and extracts were prepared by sonication. After sonication samples were centrifuged at 13,000 x g for 15 min at 4°C. The supernatant f r a c t i o n was then used as the source of fl-glucosidase for subsequent analysis. IX Materials Growth media components were obtained from Difco. A l l <5-gl ucos idase substrates were obtained from Sigma, St. Louis, MO, USA; DEAE-Sephacel, deoxynucleotides and dideoxynucleotides were obtained from Pharmacia, Dorval, P.Q, Canada. Bio-Gel P-300 and A f f i - g e l 10 were obtained from Bio-Rad, Missisauga, Ont., Canada. A l l solvents used for FPLC were HPLC grade and were obtained from Fisher or BDH, Vancouver, B.C., Canada. Enzymes used in the nucleic acid work were purchased from various suppliers. Radionuclides were from New England Nuclear Corp., Boston, MA, USA. 24 RESULTS AND DISCUSSION I P u r i f i c a t i o n of fl-glucosidase The p u r i f i c a t i o n scheme was based on that of Han and S r i n i v a s a n (1969) as modi f i ed by Day and Withers (1986) . The (5-glucos idase from ATCC 21400 was p u r i f i e d a p p r o x i m a t e l y 1900 - fo ld to homogeneity , as judged by SDS-PAGE (Table IV and F i g . 2 ) . R e p r e s e n t a t i v e chromatography p r o f i l e s are shown in F i g s . 3 to 6. The s i g n i f i c a n t f e a t u r e of the p u r i f i c a t i o n ( i l l u s t r a t e d in F i g s . 2 and 6) is t h a t the a c t i v i t y peak from the MonoQ column is c o r r e l a t e d w i t h the appearance of a p r o t e i n wi th an apparent m o l e c u l a r weight of 50-52 ,000 . The s p e c i f i c a c t i v i t y of the p u r i f i e d p r o t e i n was 286 U n i t s / m g w i t h c e l l o b i o s e as s u b s t r a t e and 88 U n i t s / m g w i t h PNPG as s u b s t r a t e . II P u r i f i c a t i o n and amino a c i d sequence d e t e r m i n a t i o n of p e p t i d e s g e n e r a t e d by CNBr c l e a v a g e Attempts to c l o n e the A g r o b a c t e r ium gene f o r fl-glucosidase by e x p r e s s i o n in E . c o l i were u n s u c c e s s f u l . The next approach to the molecu lar c l o n i n g was to o b t a i n a p a r t i a l amino a c i d sequence of the (3-gl ucos idase from which an o l i g o n u c l e o t i d e c o u l d be s y n t h e s i z e d f o r use as h y b r i d i z a t i o n p r o b e . However, the amino terminus of the p r o t e i n i n i t i a l l y appeared b l o c k e d to Edman d e g r a d a t i o n . To overcome t h i s problem i t was neces sary to generate and p u r i f y pept ide fragments f o r sequence a n a l y s i s . P e p t i d e s g e n e r a t e d from the c l eavage of p r o t e i n s can be d i f f i c u l t to p u r i f y because of t h e i r s o l u b i l i t y , and the c o m p l e x i t y of the mixture can make i s o l a t i o n of i n d i v i d u a l p e p t i d e s d i f f i c u l t . Enzymat ic c l e a v a g e methods generate l a r g e numbers of fragments due to the f requent occurrence of t h e i r c l eavage s i t e s . There are non-enzymat i c methods which r e l y on the low abundance in p r o t e i n s of e i t h e r t r y p t o p h a n or Table IV. P u r i f i c a t i o n of cellobiase from ATCC 21400 Fraction Total Total S p e c i f i c P u r i f i c a t i o n Yield Protein A c t i v i t y A c t i v i t y Factor (%) (mg) (Units) (U/mg) Crude Extract F i r s t DEAE Second DEAE 6991 78 30 1051 707 407 0. 15 9.06 13.56 60 90 100 67 39 Bio-gel P-300 6.8 352 51 .76 345 33 MonoQ 0.43 123 286 1906 12 The values in this table are average values from the p u r i f i c a t i o n of the enzyme from three 70g c e l l p e l l e t s . The units in this table are defined by cellobiose hydrolys i s . 26 F i g u r e 2. S D S - P o l y a c r y l a m i d e ge l e l e c t r o p h o r e t i c a n a l y s i s of samples o b t a i n e d d u r i n g the p u r i f i c a t i o n of ft-glucosidase. Samples of v a r i o u s f r a c t i o n s o b t a i n e d d u r i n g the p u r i f i c a t i o n of ff-glucosidase were a n a l y z e d on a 12% S D S - p o l y a c r y l a m i d e g e l . Lane A, crude c e l l e x t r a c t ; Lane B, poo led a c t i v e f r a c t i o n s from the f i r s t DEAE-Sephace1 column; Lane C , poo led a c t i v e f r a c t i o n s from the second DEAE-column; Lane D, poo led a c t i v e f r a c t i o n s from the B i o - g e l P-300 column; Lanes E - I are samples from s e q u e n t i a l f r a c t i o n s c o n t a i n i n g the a c t i v i t y peak e l u t e d from the MonoQ column. The arrow i n d i c a t e s the p o s i t i o n of the fl-glucosIdase p r o t e i n . The m o l e c u l a r weight markers were: phosphory lase B , 97 ,400; bovine serum a l b u m i n , 66,000; ova lbumin , 45,000; c a r b o n i c anhydrase , 29 ,000 . A B C D E F G H I 27 Figure 3. DEAE-Sephace 1 e l u t i o n p r o f i l e of (5-gl ucos idase . C e l l e x t r a c t (1100 ml, 6-7 g p r o t e i n ) was pumped onto the column at 1 ml/min. The column was washed with 300 ml of s t a r t i n g b u f f e r and then p r t e i n was e l u t e d with a 1 L g r a d i e n t as d e s c r i b e d i n M a t e r i a l s and Methods. The f r a c t i o n s i z e was 6 ml and the flow r a t e was 1 ml/min. The broken l i n e i n d i c a t e s the peak of PNPGase a c t i v i t y . The a c t i v i t y was monitored by a s s a y i n g 5 p i of each f r a c t i o n i n 25 p i of PNPGase assay mixture in a 96 well m i c r o t l t e r t r a y . Once the a c t i v i t y peak had been l o c a l i z e d each f r a c t i o n was assayed f o r PNPGase as d e s c r i b e d in M a t e r i a l s and Methods. FRACTION F i g u r e 4. E l u t i o n p r o f i l e of fl-glucosIdase from a second DEAE-Sephacel column. The a c t i v i t y peak from the f i r s t DEAE-Sephacel column was d i l u t e d 3-5 f o l d In s t a r t i n g b u f f e r and rechromatographed on a s m a l l e r column. The f r a c t i o n s i z e was 5ml and the flow r a t e was 1 ml/min. The broken l i n e i n d i c a t e s the peak of PNPGase a c t i v i t y . FRACTION 29 F i g u r e 5. Blogel-P-300 chromatography of the fl-glucosidase a c t i v i t y peak from DEAE-Sephacel. The a c t i v i t y peak from the second DEAE-Sephacel column was c o n c e n t r a t e d 5-6 f o l d ( f i n a l volume 5-7 ml) by u l t r a f i l t r a t i o n and then a p p l i e d to a Biogel-P-300 column. Sample a p p l i c a t i o n and chromatography were performed under g r a v i t y flow. The f r a c t i o n s i z e was 3.6 ml and the flow r a t e was 0.1 ml/min. The broken l i n e i n d i c a t e s the peak of PNPGase a c t i v i t y . 10 20 30 40 FRACTION 30 Figure 6. FPLC anion exchange (MonoQ) chromatography of the (l-glucos idase a c t i v i t y peak from Biogel-P-300. The sample (5-10 ml) was pumped onto the column at a flow rate of 1 ml/min. The g r a d i e n t was i n c r e a s e d q u i c k l y to 20% b u f f e r B (0.2 M NaCl in s t a r t i n g b u f f e r ) . When the major p r o t e i n peak was e l u t i n g (30% b u f f e r B), the g r a d i e n t was stopped u n t i l the peak had f i n i s h e d e l u t i n g ( A 2 a o ( 0.1). The broken l i n e i n d i c a t e s the g r a d i e n t as p l o t t e d on the c h a r t r e c o r d e r . The (?-gl ucos idase a c t i v i t y p a r a l l e l e d the major p r o t e i n peak. F r a c t i o n s i z e was 0.5 ml. 31 methionine (Huang et a l . , 1983;Gross, 1967). Cleavage at these rare amino acids generates fewer peptides, which s i m p l i f i e s t h e i r p u r i f i c a t i o n . Accordingly, fl-glucosidase was cleaved at i t s methionine residues with cyanogen bromide (CNBr). Reduced and alkylated ft-glucosidase was cleaved with CNBr. The peptides were analyzed by SDS-Urea PAGE (Fig. 7). Urea containing gels were used to ensure the s o l u b i l i t y of a l l the peptides (Fowler, 1978). The analysis showed the CNBr peptides to be of r e l a t i v e l y low molecular weight (approximately 3000). Therefore, reversed phase FPLC rather than gel f i l t r a t i o n was chosen for the p u r i f i c a t i o n of the peptides. A representative elu t i o n p r o f i l e of peptides is shown in F i g . 8. Both peptides CNBrl and CNBr2 were coll e c t e d from preparative reversed phase separations. CNBrl was pooled from these preparative separations whereas CNBr2 was col l e c t e d and sequenced from two independently prepared batches of enzyme. Amino acid sequencing of CNBrl determined 20 residues; sequencing of CNBr2 yielded 23 amino acids on each of two runs. During the second sequencing of CNBr2, a contaminating sequence was obtained at a higher level than that of CNBr2. Because the sequences were of unequal proportion, i t was possible to obtain 21 amino acid residues for this peptide (CNBr3). The amino acid sequences of these peptides are shown in Fig. 9. The estimated quantities of the CNBr peptides used for amino acid sequencing were: CNBrl, 1 nmol; CNBr2, 50 and 200 pmol; CNBr3, 200 pmol. These quantities were estimated from the level of the f i r s t residue analyzed from Edman degradation. Because only CNBr2 had been sequenced from two independent peptide preparations, a region from i t was chosen for synthesis of the screening oligonucleotide. The nature of the blocked amino terminus of the ft-glucosidase was not investigated; however, i t was determined to be a r t i f a c t u a l when a sample of the protein, p u r i f i e d during the l a t e r stages of this work, was used for amino acid sequencing and 20 residues from the amino terminus were 32 Figure 7. SDS-Urea-PAGE analysis of CNBr peptides from fl-glucosidase. Lane A, molecular weight markers (2 pg each); 18,000, myoglobin; 12,000, cytochrome C; 6500, aprotinin; Lane B, p u r i f i e d ft-glucosidase (0.5 pg); Lane C, CNBr peptides (6 pg). Samples were made up to 8 M urea by d i s s o l v i n g 25 mg of urea in 35 pi of sample. This was a 20% gel and i t was fixed in 12.5% t r i c h l o r o a c e t i c acid prior to st a i n i n g . A B C 33 Figure 8. FPLC s e p a r a t i o n of the CNBr pe p t i d e s from ATCC 21400 fl-glucosidase. A f t e r CNBr cleavage and c o n c e n t r a t i o n by 1 y o p h i 1 i z a t i o n , 500pg (10 nmoles) of fl-glucosidase were d i l u t e d to a volume of 1 ml with 0.1% t r i f l u o r o a c e t i c a c i d and a p p l i e d in two separate a l i q u o t s to a Pharmacia proRPC 5/10 re v e r s e d phase FPLC column. E l u t i o n was with a l i n e a r g r a d i e n t of i n c r e a s i n g a c e t o n i t r i l e c o n c e n t r a t i o n , 0 to 50% in a t o t a l volume of 25 ml, i n 0.1% t r i f 1 u o r o a c e t i c a c i d . Peptides were numbered i n order of t h e i r e l u t i o n . Peptides were c o l l e c t e d from two separate runs. F r a c t i o n s c o n t a i n i n g p e p t i d e s CNBrl and CNBr2 were l y o p h i l l z e d to near dryness and used f o r amino a c i d sequencing. F i g u r e 9. Amino a c i d s e q u e n c e s o f CNBr p e p t i d e s f r o m t h e (5-gl u c o s i d a s e , a n d t h e p r e d i c t e d s e q u e n c e o f t h e s e p e p t i d e s a s d e d u c e d f r o m t h e DNA s e q u e n c e . Amino a c i d s i n a g r e e m e n t have a * b e t w e e n them. R e s i d u e s i n ( ) were a l s o p r e s e n t , r e s i d u e s i n N were u n c e r t a i n , N a l o n e i n d i c a t e s a h o l e i n t h e d e t e r m i n e d amino a c i d s e q u e n c e w h i c h was f o l l o w e d by a n o t h e r r e s i d u e , - i n d i c a t e s a m i s s i n g r e s i d u e f r o m one o f t h e s e q u e n c e s when b o t h were c o m p a r e d . CNBr 1 a a s e q u e n c e D N F E W A E G Y R A L A L Q T Y A K T DNA s e q u e n c e M D N F E W A E G Y R M R F G L V H V Y D CNBr 2 aa s e q u e n c e P F ( G ) Y L ( F ) V ( A ) H V D Y E T * * * * * * * * * * DNA s e q u e n c e M R F G - L V H V D Y E T aa s e q u e n c e Q V S T V t W i N S G - W L Y it it it it it it it it it DNA s e q u e n c e Q V R T V K N S G K W - Y CNBr 3 a a s e q u e n c e S G H V F G R CH] [N1 G D I * * * * * * * * * * * DNA s e q u e n c e M P G H V F G R H N G D I aa s e q u e n c e A P D H Y C I N Q/W t ] E D * * * * * * * DNA s e q u e n c e A C D H Y N R W E E D N - t e r m i n a l a a s e q u e n c e [T] D P N T L A A [A] F P G * * * * * * * * * * * DNA s e q u e n c e T D P N T L A A R F P G aa s e q u e n c e D F L F G V A T i t i t i t i t i t i t i t i t DNA s e q u e n c e D F L F G V A T 35 determined ( F i g . 9). This type of a r t i f a c t u a l blocking is not uncommon when handling small samples because many compounds interfere with the modification and cleavage reactions. Also, the reagents used are very reactive and must be of the highest purity to prevent side reactions that w i l l interfere with the Edman degradation procedure (Dr. B. Olaffson, personal communication). I l l Cloning Strategy. An oligonucleotide pool was synthesized corresponding to the region of CNBr2 which would give the least degenerate DNA sequence. This region included the codon for amino acid 6 to the second nucleotide of the codon for amino acid 11. The oligonucleotide pool consisted of heptadecamers with 64 possible nucleotide sequences. The probes were synthesized as four separate pools of 16 sequences each so that a high s p e c i f i c a c t i v i t y of each radloactlvely labelled oligonucleotide could be maintained. Each of the four pools was identical except at nucleotide 6 (Fig. 10). Chromosomal DNAs from Agrobacter i um and E. c o l i were digested with EcoRI and analyzed by Southern b l o t t i n g using each of the probe pools. Pool 1 and 2 did not hybridize to either DNA. Pool 3 hybridized to a 4Kb fragment and a 1.4Kb fragment only in the Agrobacterium DNA, whereas pool 4 hybridized to higher molecular weight fragments in both E,. c o l i and Agrobacter i um DNA (Fig. 11). Pool 3 was chosen to screen recombinant DNA clones for the fl-glucosidase gene. Fragments in the size range i d e n t i f i e d by the Southern blot analysis of chromosomal DNA were prepared for cloning by extraction from a low melting temperature agarose gel. These fragments were 1igated into the EcoRI si t e of the plasmid vector pUC13 and introduced into E. c o l i JM109. The vector and host system was chosen because of several factors: f i r s t , the expression of foreign genes from the lacZ promoter in pUC plasmids is regulated with the lacI gene product (repressor). Second, host strains such as JM109 36 Figure 10. The amino terminal sequence of peptide CNBr2 and the region used to synthesize the oligonucleotide probes. The f i r s t 23 amino acids of peptide CNBr2 were i d e n t i f i e d as phenylthiohydantoin derivatives (PTH's) from automated Edman degradation. The PTHs were i d e n t i f i e d by HPLC analysis. The region corresponding to the codon for amino acid 6 to the f i r s t 2 nucleotides of the codon for amino acid 11 was used to synthesize a mixture of oligodeoxyribonucleotides to be used as hybridization probes. The mixture was synthesized as four pools. Each of the four pools was identical in sequence except at nucleotide 6, where pool 2 contained dT, pool 3 contained dG and pool 4 contained dC. Aalno Terminal Sequence of Peptide CNBr2 1 2 3 4 5 6 7 8 9 10 11 12 Pro Phe Tyr Leu Val His Val Asp Tyr Glu Thr Gin 12 13 14 15 16 17 18 19 20 21 22 23 Gin Val Ser Thr Val Trp Asn Ser Gly Trp Leu Tyr CNBr2 Probe Region Aalno ac ids : 6 His 7 Val 8 Asp 9 Tyr 10 Glu 11 Thr NucleotIdes: CAT/C GTN GAT/C TAT/C GAA/G AC 37 F i g u r e 11. Southern b l o t a n a l y s i s of genomic DNA from Agrobacter ium ATCC 21400 and Escher i ch i a c o l i . Lanes A and C , E . c o l i C600 DNA (5 ug) d i g e s t e d with E c o R I ; Lanes B and D, Agrobacter ium DNA (5 ug) d i g e s t e d wi th E c o R I . The probe f o r lanes A and B was 3 2 P l a b e l l e d o l i g o n u c l e o t i d e pool#3; Probe f o r lanes C and D was 3 2 P l a b e l l e d o l i g o n u c l e o t i d e pool#4. H y b r i d i z a t i o n s c o n t a i n e d 3 X 10* cpm of p r o b e . ( S p e c i f i c a c t i v i t y of the pool#3 probe was 6 X 10** cpm/pmol; pool#4 was 3 X 10 s cpm/pmol) . The r a d i o a u t o g r a p h was deve loped a f t e r 60 h at 25 * C . Arrows 1 and 2 i n d i c a t e the 4 .0 and 1.4 Kb EcoRI fragments from A g r o b a c t e r i u m DNA which h y b r i d i z e d with o l i g o n u c l e o t i d e pool#3. Arrow 3 i n d i c a t e s h i g h e r m o l e c u l a r weight fragments from both DNA samples which h y b r i d i z e d w i t h o l i g o n u c l e o t i d e pool#4. A B C D 38 contain the l a d * mutation which produces more repressor than the wild type so that the expression of p o t e n t i a l l y toxic gene products then occurs only by induction of the lacZ promoter (Messing, 1983). Third, the JM109 host s t r a i n contains the recA mutation which reduces recombination that may lead to i n s t a b i l i t y of cloned D N A fragments (Yanish-Perron et a l . , 1985). F i n a l l y , the high copy number of pUC plasmids is desirable to enhance the detection of recombinant DNA using hybridization probes. Colonies containing recombinant plasmids were screened with 3 2P labelled pool 3 oligonucleotides. 1061 clones were analyzed by colony hybridization. Five of these gave positive hybridization with the probe. Only one of these expressed (5-gl ucos idase a c t i v i t y ; the recombinant plasmid i t contained was designated pABG1. IV Characterization of the cloned (5-gl ucos idase gene A) Determination of the identity of the recombinant protein with the native (5-glucosidase The Aarobacter i um (5-gl ucos idase hydrolyzes cellobiose and PNPG (Han and Srinivasan, 1969; Day and Withers, 1986; t h i s t h e s i s ) . C e l l extracts of E. c o l i harbouring pABGl hydrolyzed PNPG and cell o b i o s e . Control c e l l extracts of E. c o l i containing pUC13 had no detectable enzymatic a c t i v i t y towards these substrates. The level of cellobiase a c t i v i t y produced by g.. col i / P A B G 1 was approximately 7% of the level in Aarobacterium (Table V). Further evidence that the cloned gene product and the native enzyme were iden t i c a l was provided by passing the c e l l extract from E. coli/pABG1 over an a f f i n i t y column containing bound rabbit antiserum prepared against p u r i f i e d native (5-gl ucos idase. The s p e c i f i c i t y of the antibody was checked using western b l o t t i n g analysis of the native enzyme (F i g . 12). The column removed PNPGase a c t i v i t y from E. c o l i / pABGl c e l l extracts (Fig.13). A column prepared with normal rabbit antiserum did not re t a i n s i g n i f i c a n t quantities of enzymatic Table V. /J-gl ucos Idase a c t i v i t y In va r i o u s E. c o l 1 c l o n e s and in Aarobacter1um. B a c t e r i a l S t r a i n C e l l o b i a s e <mU/mg) PNPGase < mU/mg) ATCC 112 34.5 21400 JM109 <0.1 <0.1 pUC13 JM109 7.6 2.0 pABGl JM109 ND * 2.0 pABG2 JM109 ND 2.2 pABG3 JM109 ND 1.9 pABG4F JM109 22.9 8.0 pUC13::dl1 b JM109 218 62.5 pABG5 JM109 14,300 4402 pABG5(IPTG) a) ND, not determined b) The plasmid pUC13::dll c o n t a i n s the same i n s e r t as pABG5 except that i t i s in the opposite o r i e n t a t i o n r e l a t i v e to the lacZ promoter. 40 F i g u r e 12. Western b l o t a n a l y s i s of (5-gl ucos idase samples us ing r a b b i t a n t i - s e r u m r a i s e d to the p u r i f i e d n a t i v e p r o t e i n . Lane A, crude c e l l e x t r a c t (50 pg)> Lane B, sample from the a c t i v i t y peak from DEAE-Sephacel (5 p g ) ; Lane C , sample from B i o g e l - P - 3 0 0 a c t i v i t y peak (5 pg) ; Lane D, MonoQ p u r i f i e d (5-gl ucos idase (0 .8 p g ) ; Lane E , crude c e l l e x t r a c t from g^. c o l i (80 p g ) . Lanes A - E are coomassie b lue s t a i n e d . Lanes F - J are e q u i v a l e n t to lanes A - E except t h a t t h i s p o r t i o n of the g e l was e l e c t r o b l o t t e d onto n i t r o c e l l u l o s e . The b l o t was incubated wi th the r a b b i t ant i s erum at a 1:500 d i l u t i o n in 1% bovine serum a lbumin in phosphate b u f f e r e d s a l i n e (1% BSA in PBS) f o r 16 h a t 4 ° C . Bound ant ibody was d e t e c t e d w i t h goat a n t i - r a b b i t IgG c o u p l e d with a l k a l i n e phosphatase . The ant ibody conjugate was used at 1:6000 in 1% BSA in PBS. The second a n t i b o d y i n c u b a t i o n was for 2 h at 3 0 ° C . The p o s i t i o n of bound a n t i b o d y was d e t e c t e d by the h y d o l y s i s of BCIP by a l k a l i n e phosphatase . The arrow i n d i c a t e s the band of s p e c i f i c a n t i b o d y b i n d i n g . The c r o s s r e a c t i v i t y of the a n t i - s e r u m wi th c o l i p r o t e i n s can be seen in lane J . 41 Figure 13. Immunoadsorpt Ion of col 1 / P A B G 1 encoded (5-glucosidase by antiserum raised against the Aarobacterium (5-gl ucos idase . E_. co 1 i ce 11 extracts containing (5-gl ucos idase a c t i v i t y were incubated with either immobilized normal rabbit serum or immobilized s p e c i f i c ant i-(5-gl ucos idase serum < see Materials and Methods). 5mU of PNPGase a c t i v i t y were incubated with 2 mis of antibody containing gel with shaking in flasks for 16 h. The mixture was poured into a column and unbound material was washed out of the column and assayed for PNPGase a c t i v i t y <A-*oo). The elu t i o n p r o f i l e from the normal rabbit serum column is shown with s o l i d c i r c l e s and elution from the s p e c i f i c anti-serum column is shown with open c i r c l e s . 0.20 — 0.18 — 0.12 — 0.08 — 0.04 -4 8 FRACTION 42 act i v i ty. The detection of enzymatic a c t i v i t y of the ft-glucosidase a f t e r SDS-PAGE was possible as long as the sample was not boiled p r i o r to loading on the g e l . Control experiments showed no noticeable difference in the migration of the proteins from gently heated (37°C) or boiled samples (F i g . 14). This observation made possible the i d e n t i f i c a t i o n of the cloned gene product (see F i g . 18). B) Subcloning of the abg gene Plasmid DNA from JM109/pABGl contained 5 EcoRI fragments of 1.4, 2.7, 4.0, 6.0 and 6.5 Kb. Because the r e s t r i c t i o n fragments were size selected before cloning, the presence of multiple EcoRI fragments is l i k e l y the result of polymerizing individual fragments during the l i g a t i o n reaction. A r e s t r i c t i o n map was not made for t h i s plasmid. Southern b l o t t i n g analysis, with the oligonucleotide pool#3 as a probe, showed that only a 1.4 Kb fragment hybridized ( F i g . 15). This suggested that the observed 4 Kb fragment which hybridized i n i t i a l l y was l i k e l y the r e s u l t of p a r t i a l digestion of the chromosomal DNA. The f i r s t subclone was obtained by cloning p a r t i a l EcoRI digestion products of pABGl. Clones which were positive on indicator plates containing MUG were examined for the loss of EcoRI fragments. The f i r s t subclone, pABG2, contained 3 of the o r i g i n a l 5 EcoRI fragments. The second subclone, pABG3, was obtained by i s o l a t i n g and cloning the 6.5 Kb PstI fragment of pABG2. This 6.5 Kb PstI fragment contained the entire vector sequence. A further subclone was generated by cloning the 2.7 Kb P s t l / S a l l fragment of pABG3 into pUC18. This clone was designated pABG4F since i t contained the r e s t r i c t i o n fragment in the opposite orientation (relative to the 1acZ promoter) compared to the previous subclones. R e s t r i c t i o n maps of these constructs are shown in F i g . 16 A l l of these subclones had comparable levels of enzymatic a c t i v i t y . (Table V). The fact that pABG4F determined si m i l a r levels of ft-glucosidase a c t i v i t y indicated that expression is 43 F i g u r e 14. Detect ion, of fl-gl ucos idase a c t i v i t y a f t e r SDS-PAGE. Samples from the DEAE-Sephace1 a c t i v i t y peak were p r e p a r e d f o r PAGE by mixing 1:1 wi th s o l u b i l i z a t i o n b u f f e r (2% SDS, 10% 2-mercaptoe thano l , 0.125 M t r l s - H C l pH 6 . 8 , 20% g l y c e r o l and 0.02% bromophenol b l u e ) . Samples for lanes A and C were heated at 3 7 ° C f o r 10 min p r i o r to l o a d i n g on the g e l ; Samples for lanes B and D were heated at 1 0 0 ° C f o r 2 min p r i o r to l o a d i n g . 10 ug of p r o t e i n was loaded in each l a n e . Lanes A and B, coomassie b lue s t a i n e d ; Lanes C and D, X - g l c a c t i v i t y s t a i n . The arrow i n d i c a t e s the p o s i t i o n of (S-gl ucos Idase a c t i v i t y . 44 F i g u r e 15. Southern b l o t a n a l y s i s of p A B G l . Lanes A and D> Hind III d i g e s t e d lambda phage DNA, Lanes B and E are Aarobacter i um genomic DNA (5 pg) d i g e s t e d wi th E c o R I ; Lanes C and F are pABGl DNA (1 pg) d i g e s t e d wi th E c o R I . Pane l 1 Is the e th id ium s t a i n e d agarose ge l and Panel 2 i s the r a d i o a u t o g r a p h of the southern b l o t of the ge l a f t e r p r o b i n g with o l i g o n u c l e o t i d e pool#3. The arrow i n d i c a t e s t h a t the 1.4 Kb EcoRI fragment h y b r i d i z e s to the p r o b e . The h y b r i d i z a t i o n in lane E is from the 4 Kb p a r t i a l l y d i g e s t e d genomic EcoRI fragment. A B C D E F 45 Figure 16. Linear representations of various fl-glucosidase encoding plasmids. The d i r e c t i o n of transcription from the lacZ promoter in pUC13 and pUC18 is shown with the arrow at the top. The darkened area represents the vector DNA. The cross-hatched area represents the area of the plasmid which hybridizes the oligonucelotide probe. Only relevent r e s t r i c t i o n s i t e s are shown. These s i t e s are represented as follows: Sc, Seal; E, EcoRI; P, PstI; S, S a i l ; H, H i n d l l l ; Ss, SstI. The dotted line indicates the region deleted from pABG2 to construct pABG3. l a c P Sc P E E P E S E Sc L i p A B G 2 Sc P P E S E Sc pABG3 Sc S E H P Sc p A B G 4 F Sc S s H E c p Sc pABG5 0 2 4 6 8 10 1 I I I I | | (Kb) 46 independent of the known t r a n s c r i p t i o n / t r a n s l a t i o n signals present on the vector, that Aarobacter i um t r a n s c r i p t i o n / t r a n s l a t i o n signals for this gene are present on the DNA fragment, and that they function in g.. col i . C) Determination of the d i r e c t i o n of transcription of the aba gene The pABG4F construct retained only 0.6 Kb of the 1.4 Kb EcoRI fragment. Therefore, the DNA sequence corresponding to the CNBr2 peptide (oligonucleotide probe s i t e ) should be contained in this r e s t r i c t i o n fragment. The 600 bp EcoRI/Sall fragment was sequenced in the M13 vectors M13mpl0/ll. The probe region was found 273 bases from the S a i l end using the M13mpl0 clone and the d i r e c t i o n of t r a n s c r i p t i o n was determined by v e r i f y i n g the predicted DNA sequence of the CNBr2 peptide (refer to Figs. 9 and 20). Given the apparent molecular weight of the gene product as 50-52,000 (this requires a mRNA of approximately 1.5 Kb) then the s t a r t of t r a n s c r i p t i o n must be near the f i r s t H i n d l l l s i t e at the PstI end of the insert in pABG4F, and the transcriptional terminator near the S a i l end (refer to Fig. 16). V Increased expression of the (J-glucosidase gene Once the 3* end of the (5-glucos idase gene had been l o c a l i z e d deletions near the 5' end were made using Exonuclease III and mung bean nuclease. Using pABG4F as substrate, DNA deletions were made sta r t i n g at the unique Ndel s i t e of pUC18 (this s i t e is 223 bp from the PstI s i t e in the multiple cloning s i t e of pUC18). Fragments were liberated from the vector by subsequent digestion with S a i l and were cloned into pUC13 which had been previously digested with Smal and S a i l (Fig. 17). The deletions were cloned into pUC13 with an orientation such that expression of (5-gl ucos idase would depend on retaining the Aarobacter ium t r a n s c r i p t ion/trans1at ion s ignals. Several active clones were examined for insert s i z e . The 47 F i g u r e 17. Exonuclease III d i g e s t i o n of pABG4F. DNA (12 ug, 7 pmol of 5' ends) was d i g e s t e d with NdeI. A f t e r phenol e x t r a c t i o n and e t h a n o l p r e c i p i t a t i o n the DNA was t r e a t e d wi th 135 U n i t s of Exonuclease I II in the f o l l o w i n g b u f f e r : 66 mM t r i s - H C l , pH 8 . 0 , 90 mM N a C l , 5 mM M g C U , 10 mM d i t h i o t h r e i t o 1 ( f i n a l volume 100 p i ) . Samples (25 p i ) were taken a t 20 min . i n t e r v a l s and the r e a c t i o n was t e r m i n a t e d by a d d i n g the samples to 6 p i of ice c o l d 5X SI b u f f e r (5X SI b u f f e r : 250 mM sodium a c e t a t e , pH 4 . 0 , 250 mM N a C l , 30 mM ZnSO*) . The samples then were t r e a t e d wi th 75 U n i t s of mung bean n u c l e a s e , and these r e a c t i o n s were t e r m i n a t e d by phenol e x t r a c t i o n and e thanol p r e c i p i t a t i o n . DNA taken at each time p o i n t was then d i g e s t e d with S a i l to l i b e r a t e the i n s e r t DNA from the v e c t o r DNA. Lane A, Hind I I I / E c o R I d i g e s t e d lambda DNA; Lanes B - E , 20 ,40 ,60 ,and 80 min. time p o i n t s r e s p e c t i v e l y . The arrow #1 i n d i c a t e s i n s e r t DNA and the arrow #2 i n d i c a t e s v e c t o r DNA. A B C D E 48 smallest Insert from an active clone contained 1.6 Kb of DNA. This fragment was then cloned in the opposite orientation ln pUC18 such that the presumed 5' end would be adjacent to the lacZ promoter/operator region. This plasmid was designated pABG5 (refer to Fig . 16.). The expression of ft-glucosidase from JM109/pUC13::d11 is about 10% the level observed in uninduced JM109/pABG5 (Table V). This gives an indication of the r e l a t i v e strength, in E. co1i, of the Agrobacter ium promoter present on this fragment, and indicates that expression from the pUC derived lacZ promoter is not f u l l y repressed in JM109 under these growth cond i 11ons. (5-gl ucos i dase was expressed in JM109/pABG5 without the addtion of IPTG; however, expression increased approximately 60-fold upon the addtion of IPTG to l i q u i d cultures (Table V). The induced gene product could be seen in whole c e l l extracts examined on SDS-PAGE and the induced protein from pABG5 was shown to have (5-gl ucos idase a c t i v i t y in the a c t i v i t y gel system (Fig.18.). The level of a c t i v i t y in JM109/pABG5 upon induction is approximately 100-fold higher than that found in the parent Agrobacterium s t r a i n . (5-gl ucos idase in this overproducing E.. col i s t r a i n was calculated to be 5% of the soluble protein. VI Sequence of the abg gene A) Determination of the sequence The strategy for the sequence determination is shown in Fi g . 19. The sequence was determined using the chain terminator method (Sanger's dideoxy) for the entire length and using the chemical method (Maxam and Gilbert) for one region. Parts of the region from nt. -920-1O70 we're ambiguous when sequenced by the dideoxy method; however, the ambiguities in this region were c l a r i f i e d using the chemical method. A l l r e s t r i c t i o n s i t e s in the insert of pABG5 used in the cloning of s p e c i f i c fragments were v e r i f i e d by sequencing through each of them. The 1599 bp sequence of the recombinant DNA fragment 49 F i g u r e 18. S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e t i c a n a l y s i s o f whole c e l l e x t r a c t s from E. c o l i c l o n e s c o n t a i n g v a r i o u s fl-gl ucos i d a s e e n c o d i n g p l a s m i d s . C u l t u r e s o f c o l 1 /JM109 e a r r i n g v a r i o u s p l a s m i d s e n c o d i n g (3-gl ucos i d a s e were examined f o r p r o t e i n s whose s y n t h e s i s was i n d u c e d a f t e r the a d d i t i o n o f IPTG. E a c h s t r a i n i s r e p r e s e n t e d by a p a i r o f l a n e s . The sec o n d l a n e o f e a c h p a i r i s from the c u l t u r e w h i c h r e c e i v e d IPTG. Lanes A and B a r e from JM109/pUC13; L a n e s C and D a r e from JM109/pABG5; Lane E i s p u r i f i e d A g r o b a c t e r i um Cl-gl ucos i d a s e ; L a n e s F and G a r e from JM 109/pUC 1 3: : d 1 1 w h i c h has the same i n s e r t as pABG5 but i n the o p p o s i t e o r i e n t a t i o n ; Lanes H and I a r e from JM109/pABGl; L a n e s J and K a r e from an X - g l c o v e r l a y g e l and a r e e q u i v a l e n t t o l a n e s D and E. F o r the c e l l e x t r a c t s 30 pg o f p r o t e i n were l o a d e d i n e a c h l a n e , f o r the p u r i f i e d fl-glucosidase 1 ug o f p r o t e i n was l o a d e d i n a lan e . 50 Fi g u r e 19. Sequencing s t r a t e g y f o r the abg gene. A) A schematic showing the l o c a t i o n of the abg coding r e g i o n w i t h i n the sequenced fragment. The i n i t i a t i o n codon and p u t a t i v e t e r m i n a t i o n codon are i n d i c a t e d . B) A l i n e a r r e p r e s e n t a t i o n of the i n s e r t DNA in pABG5 showing the r e s t r i c t i o n endonuclease s i t e s used in the c l o n i n g of s p e c i f i c fragments f o r sequencing. E, EcoRI; H, Hind I I I ; HS, h y b r i d Smal s i t e generated from l i g a t i n g a b l u n t ended exonuclease III d e l e t i o n fragment into the Smal s i t e of pUC18; R, R s a l ; S, S a i l . C) Summary of the sequencing r e a c t i o n s which were used i n the sequence d e t e r m i n a t i o n . The arrows denote the d i r e c t i o n and length of the sequence determined from each r e a c t i o n . Each arrow i s l a b e l l e d to i n d i c a t e the nature of the template DNA or the o r i g i n of the primer used i n that sequencing r e a c t i o n . 1, sequence obtained with c l o n e d r e s t r i c t i o n fragments; 2, sequence obtained with s p e c i f i c o l i g o n u c l e o t i d e primers; 3, sequence d e r i v e d from d e l e t i o n c l o n e s by the dideoxy method; 4, sequence d e r i v e d from Maxam and G i l b e r t chemical sequencing. ATG ABG 458aa TGA A) I I HS R H H E B) I 1 I L_l J • • ' . . I • I * > . 2 > . 1 . « 1 «. I • < 1 . , 2 I 4 — — 2 — — J « ^ , 1 I I I I I I I I I I I l _ l I I 1 0 500 1000 1500 (bp) 51 from pABG5 i s shown in F i g . 20. The sequence s t a r t s a t the f i r s t base a f t e r the 5' h a l f of the Smal s i t e of pUC18. The sequence ends at the l a s t n u c l e o t i d e of the S a i l s i t e . B) A n a l y s i s of the sequence 1) T r a n c r i p t i o n a l and t r a n s l a t i o n a l c o n t r o l s i g n a l s The DNA sequence upstream of the i n i t i a t i o n codon c o n t a i n s a r e g i o n of homology wi th two known E . c o l i promoters ( F i g . 21) . T h i s r e g i o n a l s o has homology with the n i t r o g e n r e g u l a t e d promoters from the Salmone11a tvph i mur i um a r g T r gene and the Pseudomonas put ida xy lA gene ( D i x o n , 1986). I t i s o n l y s p e c u l a t i o n that t h i s r e g i o n of homology f u n c t i o n s as a promoter; however, e x p r e s s i o n of abg i s independent of i t s o r i e n t a t i o n in pUC18 (Table V ) , which suggests a t r a n s c r i p t i o n i n i t i a t i o n s i g n a l i s present and f u n c t i o n s in E . c o l i . T h i s p u t a t i v e promoter r e g i o n i s not f o l l owed by a sequence homologous to the consensus ribosome b i n d i n g s i t e AGGA (Gold e t a l . , 1981). However, the sequence ATGGA ( n t . 42-46) o c c u r s in a p o s i t i o n where i t may f u n c t i o n as a ribosome b i n d i n g s i t e . The r e g i o n downstream from the t r a n s l a t i o n a l s top codon c o n t a i n s a sequence at n t . 1476-1496 which may be capable of forming a stem loop s t r u c t u r e . Such s t r u c t u r e s appear to be i n v o l v e d in t r a n s c r i p t i o n t e r m i n a t i o n (Rosenberg and C o u r t , 1979). 2) The s t r u c t u r e of the abg gene product a) G e n e r a l f e a t u r e s of Abg The deduced amino a c i d sequence i s g i v e n in the one l e t t e r amino a c i d code above the DNA sequence ( F i g . 20) . The t r a n s l a t i o n a l s t a r t s i t e of the gene was l o c a l i z e d to the ATG codon at n t . 54 by a l ignment of the amino t e r m i n a l p r o t e i n sequence. U s i n g the t r a n s l a t i o n s top codon at n t . 1431, a p r o t e i n of 458 a a , m o l e c u l a r weight 50 ,983 , c o u l d be p r o d u c e d . 52 Figure 20. Nucleic acid sequence and deduced amino acid sequence of the ft-glucosidase gene. Numbering starts at the f i r s t non-vector nucleotide af t e r the hybrid Smal si t e of pABG5. Peptide sequences obtained by amino acid sequencing are shown underlined. Sequences that may form stem loop stuctures are shown as opposing arrows. An 11 bp d i r e c t l y repeated sequence is also shown with arrows. The boxed area is the putative promoter sequence. -A B E E a P AOCCOAC/^GOTCTfcAACCCCTCCTOATCTTtr^ " " l 3 3 0 4 3 6 0 73 9 0 L F 0 V A T A S F Q I E G S T K A D C R K P S I U D A F C N M P 0 TOTTTOCCOTCeCAACTCCCTCOTTCCACATCCAACOTTCCACCAAGCCCCATCOCCCCAACCCCTCCATCTCGCATGCCTTCTCCAATATCCeCOCCC 114 139 144 139 174 189 H V F O R H N C D I A ATOTCTTCCCOCOTCACAATGGCGATATCOCCTGCGATCATTACAATCCCTGGGACCAAGACCTCeATCTCATCAAOGACATCGCOGTCGAGCCCTATC 213 228 243 238 273 268 R F S L A W P R I I P D O F O P X N E K O L D F Y D R L V D Q C K QTTTCTCGCTCCCCTGCCCGCCCATCATTCCCCATGGTTTCGOGCCCATCAACCACAAGGCTCTCGATTTCTACGACCGTCTCGTTGATGGCTGCAAGG 312 327 342 337 372 387 A R O I K T Y A T L Y H W D L P L T L M O D Q C W A S R S T A H A CACOCQCQATCAAOACCTATCCQACQCTQTACCATTGQOATCTGCCGC TCACCCTGATGGGGOATGOCOGCTCGOCTTCCCGCTCCACGGC ACATGCCT 411 426 441 436 471 486 F O R Y A K T V M A R L O D R L D A V A T F N E P W C A V W L S H TCCACCOTTACOCCAAGACCGTCATGGCCCGCCTAGGCGACCCGCTGGATGCGOTTGCGACCTTCAACCAGCCTTCGTGCGCCGTCTGGCTCACCCATC 310 323 340 333 370 383 L Y O V H A P Q E R N M E A A L A A M H H X N L A H Q F G V E A S TCTATOGC0TCCACCC0CC8OGCGACCCCAACATOGAOCCS0CCCTTOCCGCCATCCACCATATCAACCTCGCCCATGGTTTC0GCGTGGAAGCTTCCC 609 624 639 634 669 684 R H V A P K V P V 0 L V L N A H 8 A I P A S D O E A D L K A A E R CCCATGTCeCOCCCAAAOTCCCGOTCCGGCTGOTATTCAACGCCCATTCCCCTATTCCCGCCTCCCATCCCCACCCTCATCTCAACCCGCCCOACCCCO 708 723 738 733 768 783 A F a F H N O A F F D P V F K O E Y P A E M M E A L O D R M P V V CCTTCCAOTTCCACAATOGCOCOTTCTTTOACCCCOTCTTCAAGGGCOAATATCCCGCCOACATCATGCAAGCGCTGGOTGATCGTATGCCTGTCOTOO 807 822 837 832 867 882 E A E D L C I I S Q K L D U U O L N Y Y T P M R V A D D A T P O V AeCCGOAACACCTCCCCATCATCAGCCAGAACCTTOACTCOTCCCOCCTCAATTATTACACCCCCATOCCCCTCGCCCACGACCCCACACCCGCCCTCG 906 921 936 931 966 981 E F P A T M P A P A V S D V K T D I O W E V Y A P A L H T L V E T AATTCCCCOCeACTATOCCCCCACCOOCOOTCACCeATOTGAAOACCOATATCCCCTGOCAOOTTTACCCTCCCGCGCTGCATACOCTCOTCOACACCC 1003 1020 1033 1030 1063 1080 L Y E R Y D L P E C Y I T E N O A C Y N H O V E N O E V N D O P R TCTACOACCOTTACOACCTCCCOOAOTQCTACATCACCOAAAACCCCOCCTCCTACAATATOOQCQTCGAAAACCCCCAOOTQAATOACCACCCQCOTC 1104 1119 TT34 r 1149 1164 9 1179 D Y Y A E H L O I V A D L X R D O Y P M R O Y F A W S L M D N_ TCOATTATTACCCCGAACACCTCCGCATCOTCOCCGATCTCATCCCTOACCGTTACCCGATCCGCGGTTATTTCCCCTGCACCCTGATGCATAATTTCO 1203 1218 1233 1248 1263 1278 E U A E O Y R M R F O L V H V D Y E T Q V R T V K N S O K W V S A AATCOOCCOACOGTTACCGCATCCGTTTCCGGCTCOTGCATGTGGATTATGAGACCCAGCfTeCGOACOOTGAAGAATAGCGGCAAGTGGTACAGCGCGC 1302 1317 1332 1347 1362 1377 L A B O F P K O N H Q V A K C * > 4 ,, I t TC^TTCCOOTTTTCCOAAOGOOAACCATCGCOTTGCCAACGGOTOACOTTTTCTCTCCTCATCCCTCTCCTCOTCACATSGGTACTAGCCAOCCCAfTOT 1401 1416 1431 1446 1461 1476 COCCTGAOGGGAOTCTTTCCCCACCCCGAACGCGTeTCGOCTAAATTCCTGTCACAAOCACAGCAATOACGCTGGCCACGCCCCCTGATCCOTAA 1300 1313 1330 1343 1360 1373 AATTCAACTOTCOAC 1394 53 F i g u r e 2 1 . N u c l e i c a c i d s e q u e n c e h o m o l o g y o f t h e abg 5' f l a n k i n g r e g i o n w i t h known p r o m o t e r s e q u e n c e s . A) Homology w i t h t h e t y p i c a l " -35" a n d "-10" r e g i o n s o f p r o k a r y o t i c p r o m o t e r s ( H a w l e y a n d M c C l u r e , 1 9 8 3 ) . The ampC and a r a C g e n e s a r e b o t h E. c o l i g e n e s . B) Homology w i t h t h e n i f - 1 i k e p r o m o t e r s . The arg.Tr gene i s f r o m Salmone 11a t y p h i m u r i u m a n d t h e x y l A gene i s f r o m Psuedomonas p u t i d a . B o t h o f t h e s e p r o m o t e r s a r e r e g u l a t e d by n i t r o g e n l e v e l s i n t h e c e l l w h i c h a f f e c t t h e e x p r e s s i o n o f a p r o t e i n w h i c h a c t s a t a p o s i t v e r e g u l a t o r a t t h e s e s i t e s ( D i x o n , 1 9 8 6 ) . A) P r o k a r y o t i c " c o n s e n s u s " h o m o l o g y c o n s e n s u s ampC a b g a r a C "-35" TTGACA TTGTCA TGGTCT TGGACT 17bp 17bp "-10" TATAAT TACAATC TTCACAT 16bp GACACTT B) N i t r o g e n r e g u l a t e d p r o m o t e r h o m o l o g y c o n s e n s u s TGG C/T A C/T TTGC A/T axa.Tr ATGG C A T AAGACCTGC A abg ATGG T C T AAACCGCTGC T x v l A ATGG C A T GGCGGTTGC T 54 This agrees with the observed molecular weight of 50-52,000 for the native and recombinant proteins. The sequences of the amino termini of the protein and the 3 CNBr peptides are underlined. The agreement of the determined peptide sequences with the deduced sequences is shown in Figure 9. The differences between these sequences are l i k e l y due to amino acid sequencing a r t i f a c t s because of the small amounts of peptide material used for sequencing <Dr. R. Olaffson, personal communication). The peptide CNBrl was only 10 residues long as deduced from the DNA sequence; however, the determined sequence was 20 residues. It is possible that the preparation contained a small quantity of an incomplete cleavage product containing the adjacent (downstream) CNBr peptide. This would have produced the correct sequence for the f i r s t 10 residues then a very low level of the next amino acids which then were inc o r r e c t l y assigned because of high background signals. The amino acid compositions of the deduced protein and that determined for the native protein are shown in Table VI. The differences in the values for ser, glu+gln, gly, and lys are quite high. The reason for these anomalous values could be that minor protein contaminants contributed s i g n i f i c a n t l y and disproportionately to the estimation of the amounts of the amino acids (Dr. D. McKay, personal communication). An amino acid composition had previously been determined for Aarobacter1um ft-glucosidase p u r i f i e d by non-denaturing PAGE (Smith, 1972). It has been shown that impurities eluted from polyacrylamide gels can have a s i g n i f i c a n t influence on the amino acid composition (Brown and Howard, 1983). In addition, the reported hydrolysis conditions did not include t h i o - d i g l y c o l or phenol to protect methionine, phenylalanine and tyrosine from oxidative decomposition. For these reasons no comparison with that composition was made. It has been proposed that (5-gl ucos idase in some bacteria and yeasts is a periplasmic protein (Kohchi and Toh-e, 1986; Al t et a l . , 1982; Stoppok et a l . , 1982). One c h a r a c t e r i s t i c structure associated with periplasmic and other secreted Table VI. Comparison of the amino a c i d composition of the (5-glucosidase p r o t e i n with the composition deduced from the abg gene Amino ac id Prote in * DNA Asn + Asp 54 51 Thr 19 19 Ser 19 16 Gin + Glu 40 34 Pro 29 26 Gly 48 43 A l a 54 53 Val 32 30 Met 15 15 l i e 14 16 Leu 36 34 Tyr 21 22 Phe 21 22 His 17 17 Lys 19 16 Arg 23 24 Trp ND 13 Cys ND 6 T o t a l res idues 460 " 458 M.W 50-52,000 c 50,983 a) average values from two d e t e r m i n a t i o n s . b) r e s i d u e s c a l c u l a t e d assuming a M.W of 50,000 c) M.W was estimated from SDS-PAGE analys1s. 56 proteins Is a leader sequence. This amino acid sequence functions to help target proteins for transport across membranes (Pugsley and Schwartz, 1985). The c e l l u l a r l o c a t i o n of the Abg protein was not determined in this study, but i t may be in the periplasm (Smith, 1972). The abg gene product is not preceded by a potential leader sequence. This suggests either a cytoplasmic location for this protein or the presence of an internal sequence which is used as a signal for transport. b) Comparisons of the Abg sequence with other ft-glucosidase sequences At present, only two complete (5-glucos idase gene sequences have been determined , abg (This thesis) and the C_. pel 1iculosa gene, cpb (Kohchi and Toh-e, 1985). A DNA sequence has also been determined from an S. commune complimentary DNA clone containing part of the (1-glucos idase gene (Moranelli et a l . , 1986). A comparison of these DNA sequences did not reveal any s i g n i f i c a n t DNA homologies (data not shown). The deduced amino acid sequence of the C_. pel 1 iculosa fl-glucosidase (Cpb) contains a region with 43% homology to the p a r t i a l sequence deduced from the S_. commune fl-gl ucos idase (Scb) (Moranelli et a l . , 1986). A comparison was made of the homologous regions from Cpb and Scb with a region from Abg (Fig . 22). The homology between Abg and Cpb in this region was 10.9% (21/192), and there were 13/192 conservative amino acid changes). The homology with the Scb sequence was 17.2% (33/192), and there were 10/192 conservative changes. There was no s i g n i f i c a n t homology of Abg with Cpb outside of thi s reg i on. A potential active s i t e for the S_. commune fl-gl ucos idase has been proposed by analogy with the active s i t e of hen egg white lysozyme (Moranelli et a l . , 1986). A related arrangement of putative active s i t e residues also occurred in the C_. pe 11 icu 1 osa predicted amino acid sequence, and there was a similar arrangment in the predicted Abg amino acid 57 F i g u r e 22. Regions of amino a c i d homology In the deduced amino a c i d sequences of the fl-gl ucos ldases from Agrobacter 1 um (Abg), commune (Scb), and C. pel 1 I c u l o s a (Cpb). Regions of homology are shown In boxes. The f o l l o w i n g symbols are used: @, denotes a c o n s e r v a t i v e change In the amino a c l d ; . Q , a amino a c i d from Abg that has a c o n s e r v a t i v e change from the Cpb sequence. The p o s i t i o n s of the s t a r t i n g amino a c i d s from each sequence are as f o l l o w s Abg 195, Scb 1, and Cpb 499. Spaces have been Introduced In the sequences to maximize the homologies. Abg Scb Cpb N A A A J 4 J H H I N L A A Q T I A A A Ml D S R H © A P K © P D S G E G Y L T V E G N V ® G E E Q G D V & D G N V G L V Abg L N A H S A 0 P Scb A G D L N Cpb Y G D L N - S T L D G A W H D G W H N A V P D L A L L V N § I K A A 0 A E R e V A D A ] F ( § ) F H N G [ " A ] F -A N N I S S I N N T I V A V N T I v f l V Abg F D P V F K G -Scb pFl V FGI A I JTj T -cpbHS|G]Q Q L L I D L Y P A E A W I E @ P F i CJ n _IJD N M E - - A 9 G - D R M © 7 V P N V K A V V ist W S G L P G Nr E N V T A V iff I Y S S Y L G E A A G E D N AbgQG I - [ T | S Q K L ( f 3 ) W W - r G Scb S V ^ @ A D [i L Y G A Y N P S G R e § A K V | L F G D <D N P S G K L N N j Y T P M (R) V L P Y T I A K | S L P F T I A K A D D A T A D D Y p v N | D Y G oqEj A N V v©Hl Abg F P A T M P A P A V S D V Scb L Y E S S A N e Cpb K V D - - - -V P D - I D - Y S V P D @ P V D — • @ @ KJF T T D I G E G E f s I W E L L § Y V D Y R V D Y R P A L H T L V e A N G I H F D Y F D E E Y N K P Abg T Y L "E]R Scb P I R I F E F § Cpb V R Y E F 58 Figure 23. The homolgy of various {i-1,4-gl ucanases at a putative active s i t e proposed by analogy with Lysozyme. HEWL, hen egg white lsysozyme; Abg, Agrobacter i um fi-glucosidase; Cex, C. f i m i e xogl ucanase; EGI, S. commune, endogl ucanase I; CBHI, J_. reese i ce 11 ob i ohydrolase I; Scb, S_. commune ft-gl ucos idase ; CenA, f 1ml endogl ucanase A; Cpb, C_. pel 1 iculosa. (5-gl ucos idase; Awb, A. wentii, ft-glucosidase A3; Bab, B i t t e r almond ft-glucosidase A. The numbers above the HEWL sequence denote amino acids involved in the active s i t e of HEWL (these amino acids are shown in i t a l i c s ) . Spaces have been introduced into Abg, Cex, and CenA to allow alignment of the i n i t i a l glutamic acid residue. The symbols used are: *, a homologus amino acid; ©, a conservative change in amino acids. Enzyme AA* Active s i t e sequence Reference 1 2 3 4 HEWL 34 F E S N F N T Q A T N R N T D G s T D Y i * * @ * * Abg 310 V E F P A T M P A P - A V S D V K T D I i i * * * § Cex 33 S E F N L V V A E - N A M K W D A 7" E P i i i * * * @ EGI 32 N E S C A E F G N Q N I P G V K N T D Y i * @ * * * CBHI 64 N E T C A K N C C L D G A A Y A S T Y G i * @ * @ * Scb 159 Y E S s A Q V P D I D Y S E G L L V D y iv * @ * CenA 307 F E Y A V G F A L - N T S N Y Q T T A D i i i * @ * @ * Cpb b 606 I E K V D V P D P V D K F T E S I T V D iv Awbc A Z L G F Z G F V M S D W V @ * * * @ * * * * e * * Cpb* 259 Y L L N Y L L K E L G F Q a G F V -1, M T D W iv Babc I T H z Z G X V F G X D s v i a) The s t a r t i n g position in the amino acid sequence. b) This sequence was aligned with lysozyme. c) These amino acids were determined by protein sequencing of a peptide i d e n t i f i e d as being involved ln the active s i t e of these proteins. Refer to the text for d e t a i l s . d) This sequence was aligned with the went i i peptide. References: i . Palce et a l . , 1984 11. This work . 111. Warren et a l . , 1987 Iv. Morenelll et a l . , 1986 v. Bause and Legler, 1980 v i . Legler and Harder, 1978 59 s e q u e n c e ( F i g . 2 3 ) . These p o t e n t i a l a c t i v e s i t e s were f o u n d i n t h e r e g i o n o f h o m o l o g y d e s c r i b e d above ( F i g . 2 2 ) . I t was i n t e r e s t i n g t o n o t e t h a t t h i s a r r a n g e m e n t o f p o t e n t i a l l y s o z y m e l i k e a c t i v e s i t e r e s i d u e s h a s been f o u n d i n s e v e r a l g l y c o s i d a s e e n z y m e s . T h i s a n a l o g y was f i r s t p r o p o s e d f o r t h e e n d o g l u c a n a s e s I and I I f r o m S_. commune a n d t h e c e l l o b i o h y d r o l a s e I f r o m £. r e s s e 1 ( P a i c e e t a l . , 1 9 8 4 ) . The a n a l o g y h a s b e e n e x t e n d e d t o t h e m a j o r e n d o g l u c a n a s e , CenA, and e x o g l u c a n a s e ,Cex, o f C. f 1 m i ( W a r r e n e t a l . , 1 9 8 7 ) . The a c t i v e s i t e s o f two o t h e r fl-glucosidases have been i n v e s t i g a t e d u s i n g t h e c o v a l e n t i n h i b i t o r c o n d u r i t o l B e p o x i d e ( L e g l e r a n d H a r d e r , 1978; Bause a n d L e g l e r , 1 9 8 0 ) . P e p t i d e s w h i c h bound t h e i n h i b i t o r were i s o l a t e d a n d s e q u e n c e d . The amino a c i d s e q u e n c e s o f p e p t i d e s f r o m t h e a c t i v e s i t e s o f t h e A., went i i A 3 ft-glucos i d a s e (Awb) a n d t h e b i t t e r a l m o n d / J - g l u c o s i d a s e A ( B a b ) h a d l i t t l e h o m o l o g y a l t h o u g h t h e y b o t h c o n t a i n e d s i m i l a r t y p e s o f amino a c i d s ( F i g . 2 3 ) . T h e r e was a r e g i o n f r o m Cpb t h a t h a d a l m o s t p e r f e c t h o m o l o g y ' t o t h i s r e g i o n f r o m Awb ( F i g . 2 3 ) . The r e g i o n f r o m Cpb h o m o l o g o u s t o Awb was d i s t i n c t f r o m t h e r e g i o n w h i c h c o n t a i n e d t h e p u t a t i v e 1 y s o z y m e - 1 i k e a c t i v e s i t e . T h i s r a i s e s t h e i n t e r e s t i n g p o s s i b i l i t y t h a t t h e Cpb p r o t e i n may have more t h a n one a c t i v e s i t e . T h e r e was no h o m o l o g o u s p e p t i d e i n t h e p r e d i c t e d Abg o r p a r t i a l S c b s e q u e n c e s . The a s p a r t i c a c i d r e s i d u e w h i c h bound c o n d u r i t o l B e p o x i d e i n Awb had on one s i d e a h y d r o x y amino a c i d a n d on t h e o t h e r s i d e a n a r o m a t i c amino a c i d , w h i c h was i d e n t i c a l t o t h e a r r a n g e m e n t a r o u n d t h e e s s e n t i a l a s p a r t i c a c i d r e s i d u e o f HEWL. I t was u n f o r t u n a t e t h a t t h e p e p t i d e s e q u e n c e s f r o m Awb and Bab were n o t l o n g e r so t h a t a b e t t e r c o m p a r i s o n c o u l d have been made w i t h t h e 1 y s o z y m e - 1 i k e a c t i v e s i t e s e q u e n c e . I t i s n o t s u p r i s i n g t h a t t h e s e enzymes may have s i m i l a r a c t i v e s i t e s s i n c e t h e y a l l h y d r o l y z e (5-1, 4 - g l y c o s i d i c l i n k a g e s . The i n v e s t i g a t i o n o f t h e s e a c t i v e s i t e s s h o u l d now be f a c i l i t a t e d by a c o m b i n a t i o n o f t h e a b i l i t y t o o v e r e x p r e s s t h e c l o n e d gene p r o d u c t s , a n d i d e n t i f i c a t i o n o f e s s e n t i a l amino a c i d s t h r o u g h t h e use o f s i t e s p e c i f i c m u t a g e n e s i s o f 60 the cloned genes. 3) Codon usage in the abg gene The pattern of codon usage in a gene has been suggested to be involved in the regulation of gene expression (Varenne et a l . , 1984; Robinson et a l . , 1984; Grosjean and Fiers, 1982). This suggestion was based on the assumption that e f f i c i e n t translation would require the codon usage of a gene to be consistent with the cognate tRNA levels in the host. The codon usage of a heterologus gene then could be Important for i t s expression in g.. col i The codon usage in the abg gene is shown in Table VII. Of the 61 codons, 14 were not used in the abg gene. There was a 79% bias to G or C in the t h i r d p o s i t i o n of the codons used. The G+C contents of the f i r s t and second position of the codons were 64.4% and 43.4% respectively. The overall G+C content of the genus Agrobacter i um was determined to be 59.6-62.8% (Krieg, 1974), and the G+C content of the abg gene was 60.4%. The bias for G or C in the t h i r d position was higher than the 53% observed in col i , but was not as extreme as the bias observed in genes from organisms with higher G+C contents (O'Neill, 1986). Despite the bias for G or C in the t h i r d position of the codons, abg did not have a codon usage pattern very d i f f e r e n t from col 1 (data not shown). The problem of codon usage and heterologous gene expression in col 1 may not be that important. It has now been reported that the C. f i m i cex gene, which has a 98% bias for G or C in the th i r d position and many rare col i codons, has been overexpressed such that 20% of the total c e l l protein was the cex gene? product (O'Neill, 1986). 61 Table VII. Codon u t i l i z a t i o n of the abg gene. aa Codon # aa Codon # aa Codon # aa Codon # Phe UUU 3 UCU 19 Leu UUA 0 UUG 1 CUU 2 cue 13 CUA 1 CUG 17 Ile AUU 2 AUC 14 AUA 0 Met AUG 15 Val GUU 4 GUC 12 GUA 1 GUG 14 Ser UCU 0 UCC 7 UCA 0 UCG 3 Pro ecu 2 CCC 8 CCA 0 CCG 16 Thr ACU 2 ACC 9 ACA 1 ACG 7 Ala GCU 6 GCC 25* GCA 5 GCG 17 Tyr UAU 8 UAC 14 Och UAA 0 Amb UAG 0 His CAU 12 CAC 5 Gin CAA 0 CAG 6 Asn AAU 9 AAC 9 Lys AAA 1 AAG 15 Asp GAU 22 GAC 11 Glu GAA 11 GAG 18 Cys UGU 0 UGC 6 Opl UGA 1 Trp UGG 13 Arg CGU 10 CGC 11 CGA 0 CGG 3 Ser AGU 0 AGC 6 Arg AGA 0 AGG 0 Gly GGU 9 GGC 24 GGA 0 GGG 10 LITERATURE CITED A i t , N., Creuzet, N., and Catteneo, J. (1982) Properties of f$-gl ucos idase purifed from Clostridium thermoce 11 um . J. Gen. Microbiol. 128: 569-577 Armentrout, R.W., and Brown, R.D. (1981) Molecular cloning o genes for cellobiose u t i l i z a t i o n and their expression in Escherichia c o l i . Appl. Environ. Microbiol. 41: 1355-1362 Armentrout, R.W., and Brown, R.D. (1984) B i o l o g i c a l l y enginerred plasmid for the production of fl-glucosidase, organisms modified by this plasmid and methods of use, U.S. patent, US 4464671, 07 Aug. 1984 Atkinson, T., and Smith, M. (1984) In: Oligonucleotide Synthesis: a p r a c t i c a l approach. Gait, N.J. ed. IRL press Washington. B a l l , C. (1984) In: Genetics and breeding of in d u s t r i a l microorganisms. B a l l , C. ed. CRC press, Inc. USA. pp 159-188 Barras, F., Chambost, J.P., and Chippaux, M. (1984) Cellobiose metabolism in Erw in l a : a genetic study. Mol. Gen. Genet. 197: 486-490 Bause, E., and Legler, G. (1980) Isolation and structure of a t r y p t i c glycopeptide from the active s i t e of (5-gl ucos idase A s from Asperg i11 us went i i . Biochim. Biophys. Acta 626: 459-465 Beguin, P., Gilkes, N.R., Kilburn, D.G., M i l l e r , R.C, J r . , O'Neill, G., and Warren, R.A.J. (1986) Cloning of c e l l u l a s e genes. Accepted for publication in CRC C r i t i c a l Reviews of Biotechnology. Berghem, L., and Pettersson, L. (1974) The mechanism of enzymatic c e l l u l o s e degradation. Isolation and some properties of a fl-glucosidase from Tr ichoderma v i r ide. Eur. J Biochem. 46: 295-305 Blake, M.S., Johnston, K.H., Russe11-Jones, G.J., and Gotschlich, E.C. (1984) A rapid and sensitive method for detection of alkaline phosphatase conjugated anti-antibody on western blots. Anal. Biochem. 136: 175-179 Blondin, B., Ratomahenina, R., Arnaud, A., and Galzy, P. (1983) P u r i f i c a t i o n and properties of the ft-glucosidase of yeast capable of fermenting cellobiose to ethanol: Dekkera  intermedia van der Walt. Eur. J. Appl. Microbiol. Biotechnol 17: 1-6 63 B o l l o n , A.P. <1984) Recombinant DNA products: I n s u l i n , I n t e r f e r o n and growth hormone. B o l l o n , A.P. ed. CRC p r e s s , Inc., USA Brown, W.E., and Howard, G.C. (1983) Amino a c i d composition of p r o t e i n s e l u t e d from polyacrylamide g e l s . Methods in Enzymology 91: 36-41 Coughlan, M.P. (1985) The p r o p e r t i e s of fungal and b a c t e r i a l c e l l u l a s e s with comment on t h e i r p r o d u c t i o n and a p p l i c a t i o n . B i o t e c h . G e n e t i c E n g i n e e r i n g Rev. 3: 39-109 C r e s t f i e l d , A.M., Moore, S., and S t e i n , W.H. (1963) The p r e p a r a t i o n and enzymatic h y d r o l y s i s of reduced and S-carboxymethylated p r o t e i n s . J . B i o l . Chem. 193: 622-627 Dagert, M., and E h r l i c h , S.D. (1979) Prolonged i n c u b a t i o n in c a l c i u m c h l o r i d e improves the competence of Escher ich i a c o l i c e l l s . Gene 6: 23-28 Day, A.G., and Withers, S.G. (1986) The p u r i f i c a t i o n and c h a r a c t e r i z a t i o n of a ft-glucosidase from A l c a l j q e n e s f a e c a l i s . Can. J . Biochem. C e l l . B i o l . 64: 914-922 Dekker, R. F. H., (1986) K i n e t i c , i n h i b i t i o n , and s t a b i l i t y p r o p e r t i e s of a commercial (1-D-gl ucos idase ( c e l l o b i a s e ) . P r e p a r a t i o n from Asperqi11 us n i g e r and i t s s u i t a b i l i t y in the h y d r o l y s i s of 1ignoce11ulose. B i o t e c h n o l . Bioeng. 28: 1438-1442 Desrochers, M., Jurasek, L., and P a i c e , M.G (1981) High p r o d u c t i o n of fl-glucosidase in Sch izophvllum commune: I s o l a t i o n of the enzyme and the e f f e c t of the c u l t u r e f i l t r a t e on c e l l u l o s e h y d r o l y s i s . Appl. E n v i r o n . M i c r o b i o l . 41: 222-228 Dixon, R. (1986) The xylABC promoter from the Pseudomonas p u t i d a TOL plasmid i s a c t i v i t e d by n i t r o g e n r e g u l a t o r y genes in E s c h e r i c h i a c o l i . Mol. Gen. Genet. 203: 129-136 E n a r l , T. M. (1983) M i c r o b i a l c e l l u l a s e s . In M i c r o b i a l Enzymes and Biotechnology (Fogarty, W.M., ed) pp 183-223, A p p l i e d Science P u b l i s h e r s , London. F r e e r , S. N . , and Detroy, R. W. (1983) C h a r a c t e r i z a t i o n of c e l l o b i o s e fermentation to ethanol by y e a s t s . B i o t e c h n o l . Bioeng. 25:541-557 Fowler, A.V. ( 1978) Amino a c i d sequence of (3-galactos idase V I I . I s o l a t i o n of the 24 cyanogen bromide p e p t i d e s . J . B i o l . Chem. 253: 5499-5504 64 Gilkes, N.R., Kilburn, D.G., Langs ford, M.L., M i l l e r , R.C. J r . , Wakarchuk, W.W., Warren, R.A.J., Whittle, D.J., and Wong, W.K.R. ( 1984) Isolation and characterization of Escher ich ia c o l i clones expressing c e l l u l a s e genes from Cellulomonas f i m i • J . Gen. Microbiol. 130: 1377-1384 Gold, L., Pribnow, D., Schneider, T., Shinedling, S., Swebelius-Singer, B., and Storma, G. (1981) Translation i n i t i a t i o n in prokaryotes. Ann. Rev. Microbiol. 35: 365-403 Gong, G.S., Ladisch, M.R. and Tsao, G.T. (1977) Celloblase from Tr ichoderma v ir i d a e . P u r i f i c a t i o n , properties, k i n e t i c s and mechanism. Biotechnol. Bioeng. 19: 959-981 Groleau, D., and Forsberg, C.W. (1981) C e l l u l o l y t i c a c t i v i t y of the rumen bacterium Bactero i des succ inogenes. Can. J . Microbiol. 27: 517-530 Grosjean, H., and F i e r s , W. (1982) Preferential codon usage in prokaryotic genes: the optimal codon antl-codon Interaction energy and the selective codon usage in e f f i c i e n t l y expressed genes. Gene 18: 199-209 Gross, E. (1967) The cyanogen bromide reaction. Methods in Enzymology 11: 238-251 Grunstein, M., and Wallis, J . (1979) Colony hybridization. Methods in Enzymology 68: 379-389 Guo, Li-He, and Wu, R. (1983) Exonuclease III: use for DNA sequence analysis and in s p e c i f i c deletions of nucleotides. Methods in Enzymology 100: 468-500 Hagget, K.D., Choi, W.Y., and Dunn N.W. (1978) Mutants of Cellulomonas which produce increased levels of ft-glucosIdase. Eur. J. Appl. Microbiol. Biotechnol. 6:189-191 H a l l i w e l l , G., and G r i f f i n , M. (1978) A f f i n i t y chromatography of the cellulase system of Tr i chode rma kon i ngI 1. Biochem. J. 169: 713-715 Han, Y.W. (1982) Nutritional requirements and growth of a Ce11u1omonas species on c e l l u l o s i c substrates. J . Ferment. Technol. 60: 99-104 Han, Y.W., and Srinivasan, V.R. (1968) Isolation and characterization of a c e l l u l o s e u t i l i z i n g bacterium. Appl. Microbiol. 16:1140-1145 Han, Y.W., and Srinivasan, V.R. (1969) The p u r i f i c a t i o n and characterization of fi-glucosidase of Alcaligenes faecal i s . J. Bac t e r i o l . 100: 1355-1363 65 Hawley, D.K., and McClure, W. (1983) Compilation and analysis of Escherichia col 1 promoter DNA sequences. Nucleic Acids Res. 11: 2237-2255 Hendy, N.A., Wllke, CR. and Blanch, H.W. (1984) Enhanced ce l l u l a s e production in fed-batch culture of Tr ichoderma  reesei C30. Enzyme Microbial Technol. 6: 73-77 Huang, H.W., Bond, M.V., Hunkapiler, M.W., and Hood, L.E. (1983) Cleavage at tryptophanyl residues with dimethyl sulfoxide - hydrochloric acid and cyanogen bromide. Methods in Enzymology 91: 318-324 Hwang, J.T., and Suzuki, H. (1976) I n t r a c e l l u l a r d i s t r i b u t i o n and some properties of fl-glucosidases of a c e l l u l o l y t i c Pseudomonad. Agric. B i o l . Chem. 40: 2169-2175 Inglin, M., Feinberg, B.A., and Loewenberg, J.R (1980) P a r t i a l p u r i f i c a t i o n and c h a r a c t e r i s t i c s of a new i n t r c e l l u l a r ft-glucosidase of Trichoderma r e e s e i . Biochem. J . 185: 515-519 J o l i f f , G., Beguin, P., Juy, M., M i l l e t , J., Ryter, A., Poljak, R., and Aubert, J.P. (1986) Isolation, c r y s t a l l i z a t i o n , and properties of a new c e l l u l a s e of Clostridium thermoce11um overproduced in Escher icha c o l i . Bio/Technology 4: 896-900 Katz, L., Kinsbury, D.T., and Helinski, D.R. (1973) Stimulation by c y c l i c adenosine monophosphate of plasmid deoxyribonucleic acid r e p l i c a t i o n and catabolite repression of the plasmid deoxyribonucleic acid-protein complex. J. Ba c t e r i o l . 114: 577-591 Kohchi, C , Hayashi, M., and Nagai, S. (1985) P u r i f i c a t i o n and properties of ft-glucosidase from Cand ida pel 1iculosa var. acetaetherius. Agric. B i o l . Chem. 49:779-784 Kohchi, C , and Toh-e, A. (1985) Nucleotide sequence of Cand ida pel 1iculosa fi-glucosidase gene. Nucleic Acids Res. 13:6273-6282 Kohchi, C , and Toh-e, A. (1986) Cloning of Candida  pe11icu1osa ft-glucosidase gene and i t s expression in Saccharomvces cerev1s iae. Mol. Gen. Genet. 203: 89-94 Krieg, N.R. ( 1974) Genus Actrobacterium Conn. In: Buchanan and Gibbons (Editors), Bergey's Manual of Determinative Bacteriology 8 t h Ed., The Williams and Wilkins Co., Baltimore, pp 90-91. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of bacteriophage T4. Nature 227: 680-685 66 Lathe, R., Kieny, M.P., Skory, S., and Lecocq, J.P. (1984) Linker t a i l i n g : Unphosphorlyated li n k e r oligonucleotides for joining DNA termini. DNA 3: 173-182 Legler, G., and Harder, A. (1978) Amino acid sequence at the active s i t e of fl-glucosidase A from b i t t e r almonds. Biochim. Biophys. Acta 524: 102-108 Legler, G., von Radloff, M., and Kempfle, M. (1972) Composition, N-terminal amino acids and chain length of a fl-glucosidase from Asoergi11 us went 1i . Biochim. Biophys. Acta 257: 40-48 Legler, G., Sinnot, M.L, and Withers, S. (1980) Catalysis by f$-glucos idase A 3 of Asperg i11 us went 1i. J. Chem. Soc. Perkins Trans II: 1376-1382. L i z a r d i , P. (1981) Binding and recovery of DNA and RNA using NA-45 DEAE membrane. Schleicher and Schuell application update No. 364 Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randall, R.J. (1951) Protein measurements with the F o l i n phenol reagent. J. B i o l . Chem. 193: 265-276 MacKenzie C.R., and Patel, G.B. (1986) Cellodextrin u t i l i z a t i o n and <5-gl ucos idase production by Bactero ides  polypragmatus. Arch. Microbiol. 145: 91-96 Maoris, B.J. (1984) Production and characterization of ce l l u l a s e and fl-glucosidase from a mutant of Alternaria  alternata. Appl. Environ. Microbiol. 47: 560-565 Mandels, M. (1982) Cellulases. In: Annual reports on fermentation processes. G.T. Tsao ed. Academic press Inc., New York. vol . 5 Maniatis, T., F r i t s c h , E.F., and Sambrook, J. (1982) In: Molecular cloning. Cold Spring Harbor Laboratory, New York. Marmur, J. (1961) A procedure for the i s o l a t i o n of deoxyribonuce1ic acid from microorganisms. J. Mol. B i o l . 3: 208-218 Maxam, A.M., and G i l b e r t , W. (1980) Sequencing end-labelled DNA with base-specific chemical cleavages. Methods in Enzymology 65: 499-560 McHale, A., and Coughlan, M.P. (1981) The c e l l u l o l y t i c system of Talaromvces emersonli. P u r i f i c a t i o n and characterization of the e x t r a c e l l u l a r and i n t r a c e l l u l a r ft-glucosidases. Biochim. Biophys. Acta 662: 152-159 67 Messing, J. (1983) New M13 vectors for cloning. Methods In Enzymology 101C: 20-78 Meyer, H.P., and Canevascini, G. (1981) Separation and properties of two In t r a c e l l u l a r fl-glucosidases of Sporotrichum (Chvrsospor ium) thermoph i l e . Appl. Environ. Microbiol. 41: 924-931 M i l l e r , J.H. (1972) In: Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, New York. Moldeoveanu, N., and Kluepfel, D. (1983) Comparison of fi-glucosidase a c t i v i t i e s in d i f f e r e n t Streptomvces s t r a i n s . Appl. Environ. Microbiol. 46: 17-21 Montenecourt, B.S., Sheir-Neiss, G.I., Ghosh, A., and Ghosh B.K (1982) Mutational approach to enhance synthesis and secretion of c e l l u l a s e . Proceeding of the Royal Society of Canada. International symposium on ethanol from biomass. pp 397-412. Moranelli, F., Barbier, J.R., Dove, M.J., Mackay, R.M., Seligy, V.L., Yaguchi, M., and W i l l i c k , G.E. (1986) A clone coding for Schizophvl1um commune ft-glucosidase: homology with a yeast ft-glucosidase. Biochemistry International 12: 905-912 Nakamura, K., Misawa, N., and Kitamura, K. (1986) Cellulase genes of Ce11u1omonas uda CB4. I. Cloning and expression of ft-glucosidase genes in Escherichia c o l i . J. Biotechnology 3: 239-246 Ohmiya, K., S h i r a i , M., Kurachi, Y., and Shimizu, S. (1985) Isolation and properties of fl-glucosidase from Ruminococcus  albus. J . B a c t e r i o l . 161: 432-434 O'Neill, G.O. (1986) Structure of the gene encoding the exoglucanase of Cellulomonas fimi and i t s expression and secretion in Escher ich ia co1i. Ph . D thesis, The University of B r i t i s h Columbia. Paice, M.G., Desrochers, M., Rho, D., Jurasek, L., Roy, C , R o l l i n , C.F., Miguel, E.De., and Yaguchi, M. (1984) Two forms of endoglucanase from the basidiomycete Schizophvl1um commune and th e i r relationship to other fl-1,4-glycoside hydrolases. Bio/Technology 2: 535-539 P e n t t i l a , M.E., Helena-Nevalainen, K.M., Raynal, A., and Knowles, J.K.C. (1984) Cloning of Aspergillus niger genes in yeast. Expression of the gene coding Aspergi11 us ft-glucosidase. Mol. Gen. Genet. 194: 494-499 Pugsley, A.P., and Schwartz, M. (1985) Export and secretion of proteins by bacteria. FEMS Microbiol. Rev. 32: 3-38 68 Raynal, A., and Guerineau, M. (1984) Cloning and expression of the structural gene for (J-gl ucos i dase of Kl uvveromvces  frag i1i s in Escher ich ia c o l i and Saccharomvces cerev i s iae. Mol. Gen. Genet. 195: 108-115 Reese, E.T., Parrish, F.W., and E i t l i n g e r , M. (1971) Nojirimycin and D-gluconic acid lactone as i n h i b i t o r s of carbohydrases. Carbohydr. Res. 18: 381-388 Robinson, M., L i l l e y , R., Emtage, J.S., Yarranton, G., Stephens, P., M i l l i c a n , A., Eaton, M., and Humphreys, G. (1984) Codon usage can affect e f f i c i e n c y of t r a n s l a t i o n in Escher ich ia c o l i . Nucl. Acids Res. 12: 6663-6671 Rosenberg, M., and Court, D. (1979) Regulatory sequences involved in the promotion and termination of RNA tr a n s c r i p t i o n . Annu. Rev. Genet. 13: 319-353 Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with chain terminating i n h i b i t o r s . Proc. Natl. Acad. S c i . U.S.A. 74: 5463-5467 Sato, M., and Takahashl, H. (1967) Fermentation of C 1 4-labe1 led cellobiose by Cellulomonas f i m i . Agric. B i o l . Chem. 31: 470-474 Schwarz, W., Bronnenmeir, K., and Staudenbauer, W.L. (1985) Molecular cloning of Clostridium thermoce Hum genes involved in (3-glucan degradation in bacteriophage lambda. Biotechnol. Letters. 7:859-864 Schimz, K.L., B r o i l , B., and John, B. (1983) Cellobiose phosphorylase (EC 2.4.1.20) of Ce11ulomonas: occurence, induction and i t s role in cellobiose metabolism. Arch. Microbiol. 135: 241-249 Schl e i f , R.F., and Wensink, P.C. (1981) In: P r a c t i c a l Methods in Molecular Biology. Splnger-Verlag New York. Shewale, J.G. ( 1982) <3-gl ucos idase: Its role in c e l l u l a s e synthesis and hydrolysis of c e l l u l o s e . Eur. J. Biochem. 14: 435-443 Shewale, J.G., and Sadana J.C. (1981) P u r i f i c a t i o n and properties of ^-glucosidase enzymes from Sclerot i um r o l f s i i . Arch. Biochem. Biophys. 207: 185-196 Smith, E.O. ( 1972) Carbohydrases of Alcalioenes faecal is (ATCC 21400). Ph.D thesis, The Louisiana State University and Agricultural and Mechanical College. Southern, E.M. (1975) Detection of s p e c i f i c sequences among DNA fragments separated by gel electrophoresis. J. Mol. B i o l . 98: 503-517 69 S t e r n b e r g , D . , VI jayyakumar , P . , and Reese , E . T . (1977) (5-gl ucos Idase: M i c r o b i a l p r o d u c t i o n and e f f e c t on enzymat i c h y d r o l y s i s of c e l l u l o s e . Can. J . M i c r o b i o l . 23: 139-147 Stoppok, W. , Rapp, P . , and Wagner F . (1982) F o r m a t i o n , l o c a l i z a t i o n and r e g u l a t i o n of e n d o - 1 , 4 - A - g l u c a n a s e s and (S-gl ucos idases from Ce 11 u 1 omonas uda . A p p l . E n v i r o n . M i c r o b i o l . 44: 43-53 Streamer , M . , E r i k s s o n , K . E . , and P e t t e r s o n , B . (1975) E x t e r n a l enzyme system u t i l i z e d by the fungus S p o r o t r i c h u m  p u l v e r u l e n t u m f o r the breakdown of c e l l u l o s e . F u n c t i o n a l c h a r a c t e r i z a t i o n of f i v e endo-1 , 4-($-gl ucanases and one e x o - 1 , 4-(5-gl ucanase . E u r . J . Biochem. 59: 607-613 Towbin, H . , S t a e h l i n , T . , and Gordon , J . (1979) E l e c t r o p h o r e t i c t r a n s f e r of p r o t e i n s from p o l y a c r y l a m i d e g e l s to n i t r o c e l l u l o s e s h e e t s : procedure and some a p p l i c a t i o n s . P r o c . N a t l . A c a d . S c i . USA 76: 4350-4354 V a r r e n e , S . , Buc , J . , L l o u b e s , R . , and L a z d u n s k i , C . (1984) T r a n s l a t i o n i s a non-un i form p r o c e s s : E f f e c t of tRNA a v a i l a b i l i t y on the r a t e of e l o n g a t i o n of nascent p o l y p e p t i d e c h a i n s . J . M o l . B i o l . 180: 549-576 V i e i r a , J . (1985) U n i t e d S t a t e s B i o c h e m i c a l company t e c h n i c a l l i t e r a t u r e accompaning the v e c t o r s pTZ18 /19 . Wakarchuk, W.W., K i l b u r n , D . G . , M i l l e r , R . C . J r . , and Warren , R . A . J . (1984) The p r e l i m i n a r y c h a r a c t e r i z a t i o n of the (J-gl ucos idases of Ce 11 u 1 omonas f i m i . J . Gen. M i c r o b i o l . 130: 1385-1389 Wakarchuk, W.W., K i l b u r n , D . G . , M i l l e r , R . C , J r . , and Warren , R . A . J . (1986) The m o l e c u l a r c l o n i n g and e x p r e s s i o n of a c e l l o b i a s e gene from an A a r o b a c t e r i um in E s c h e r i c h i a c o l i . M o l . Gen . Genet . 205: 146-152 Warren, R . A . J . , Beck, C . F . , G i l k e s , N . R . , K i l b u r n , D . G . , L a n g s f o r d , M . L . , M i l l e r , R . C . J r . , O ' N e i l l , G . P . , and Wong, W . K . R . (1987) Sequence c o n s e r v a t i o n and r e g i o n s h u f f l i n g in two c e l l u l a s e s from Ce11u1omonas f i m i . Accepted f o r p u p l i c a t i o n i n : P r o t e i n s . W h i t t l e , D . J . , K i l b u r n , D . G . , M i l l e r , R . C J r . , and Warren , R . A . J . ( 1982) M o l e c u l a r c l o n i n g of a Ce l lu lomonas f i m i gene in E s c h e r i c h i a c o l i . Gene 17: 139-145 Wood, T . M . , and M c C r a e , S . I . (1982) P u r i f i c a t i o n and some p r o p e r t i e s of the e x t r a c e l l u l a r (5-D-gl ucos idase of the c e l l u l o l y t i c fungus Tr ichoderma k o n i n g i i . J . Gen. M i c b . 128: 2973-2982 Workman, W.E., and Day, D.F. (1982) P u r i f i c a t i o n and properties of f l-gl ucos i dase from Asperg i 11 us terrus . Appl. Environ. Microbiol. 44: 1289-1295 Yanisen-Perron, C , V i e i r a , J., and Messing, J. (1985) Improved M13 phage cloning vectors and host s t r a i n s : nucleotide sequence of the M13mpl8 and pUC19 vectors. Gene 103-119 Zappe, H., Jones, D.T., and Woods, D.R. (1986) Cloning and expression of Clostridium acetobutvlleum endoglucanase, cellobiase and amino acid biosynthesis genes in Escher ich ia  c o l i . J. Gen Microbiol. 132: 1376-1372 Z o l l e r , M.J., and Smith, M. (1983) 01igonucleotide-directed mutagenesis of DNA fragments cloned in M13-derived vectors. Methods in Enzymology 100B: 468-500 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097515/manifest

Comment

Related Items