Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The sequence TNNCT modulates transcription of a Drosophila Melanogaster tRNA ₄ gene Sajjadi, Fereydoun G. 1987

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1987_A1 S24.pdf [ 8.93MB ]
Metadata
JSON: 831-1.0097510.json
JSON-LD: 831-1.0097510-ld.json
RDF/XML (Pretty): 831-1.0097510-rdf.xml
RDF/JSON: 831-1.0097510-rdf.json
Turtle: 831-1.0097510-turtle.txt
N-Triples: 831-1.0097510-rdf-ntriples.txt
Original Record: 831-1.0097510-source.json
Full Text
831-1.0097510-fulltext.txt
Citation
831-1.0097510.ris

Full Text

THE SEQUENCE TNNCT MODULATES TRANSCRIPTION OF A DROSOPHILA MELANOGASTER t R N A V a l „ GENE BY FEREYDOUN G. SAJJADI B.A. The U n i v e r s i t y of North C a r o l i n a , 1982 M.Sc.The U n i v e r s i t y of B r i t i s h Columbia, 1985 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES (The Genetics Programme) We accept t h i s t h e s i s as conforming to the r e q u i r e d standard THE UNIVERSITY OF BRITISH COLUMBIA SEPTEMBER 1987 © F e r e y d o u n G. S a j j a d i , 1987 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. d Department of k Ert G I I C£ The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date DE-6(3/81) ABSTRACT The t r a n s c r i p t i o n e f f i c i e n c y o f t r a n s f e r RNA genes i s m o d u l a t e d by s e q u e n c e s c o n t a i n e d i n t h e i r 5 ' - f l a n k i n g Va 1 r e g i o n . F o r a tRNA ^ gene a p e n t a n u c l e o t i d e w i t h t h e s e q u e n c e TCGCT was i d e n t i f i e d between p o s i t i o n s - 3 3 and - 3 8 . I have p r e v i o u s l y p r o p o s e d t h a t t h i s s e q u e n c e may be i n v o l v e d i n s p e c i f i c a l l y d e t e r m i n i n g t h e r a t e of t r a n s c r i p t i o n o f t h i s gene. A g e n e r a l f o r m o f t h i s s e q u e n c e , TNNCT was f o u n d a s s o c i a t e d w i t h o t h e r D r o s o p h i l a tRNA genes w h i c h showed h i g h i l l v i t r o t r a n s c r i p t i o n e f f i c i e n c y . To f u r t h e r e l u c i d a t e t h e r o l e o f TCGCT i n tRNA t r a n s c r i p t i o n , s i n g l e and d o u b l e b a s e - p a i r changes were c r e a t e d i n t h e s e q u e n c e TCGCT u s i n g s i t e - s p e c i f i c m u t a g e n e s i s . M u t a t i o n s i n t h e n u c l e o t i d e s - 3 8 T , - 3 5 C and - 3^T showed d e c r e a s e d l e v e l s o f t r a n s c r i p t i o n whereas n u c l e o t i d e c h a n g es a t t h e n u c l e o t i d e s - 3 7 C and - 3 6 G d i d n o t r e d u c e t e m p l a t e a c t i v i t y . T h e r e f o r e t h e s e q u e n c e w h i c h m o d u l a t e s t r a n s c r i p t i o n o f t h e t R N A V a 1 ^ gene does have t h e g e n e r a l f o r m TNNCT. C o m p e t i t i o n e x p e r i m e n t s between t h e V a l 4 mutant -38G.-35A and a t R N A S e r > 7 gene showed t h e TNNCT mutant t o be a b e t t e r c o m p e t i t o r f o r t r a n s c r i p t i o n t h a n t h e w i l d t y p e t e m p l a t e . E x p e r i m e n t s a n a l y z i n g t h e t i m e - c o u r s e o f t r a n s c r i p t i o n , t h e e f f e c t s o f t e m p e r a t u r e and t h e e f f e c t s o f i o n i c s t r e n g t h i n d i c a t e d t h a t TNNCT was n o t i n v o l v e d i n d e t e r m i n i n g t h e e f f i c i e n c y o f s t a b l e complex f o r m a t i o n . I t i s p r o p o s e d t h a t t h e p e n t a n u c l e o t i d e i s p r o b a b l y r e s p o n s i b l e i i i f o r i n f l u e n c i n g the r a t e of i n i t i a t i o n of t r a n s c r i p t i o n . A sequence TGCCT contained i n the anticodon stem/loop r e g i o n of the V a l ^ gene was a l s o mutagenized and shown to be i n v o l v e d i n complex s t a b i l i t y or the e l o n g a t i o n of V a l ^ tRNAs. Using d e l e t i o n a n a l y s i s of the 5 ' - f l a n k i n g sequences of a t R N A S e r ^ gene, a second p o s i t i v e t r a n s c r i p t i o n r e g u l a t o r y element was d e l i m i t e d . This sequence was a l s o found i n the 5'- f l a n k s of the t R N A V a l 4 and a t R N A A r g gene. i v TABLE OF CONTENTS Page Abs t r a c t i i Table of Contents i i i L i s t of Tables v i i i L i s t of F i g u r e s i x Acknowledgements x i i i A b b r e v i a t i o n s x i v I n t r o d u c t i o n 1 I. C l a s s I I I genes 1 I I . T r a n s c r i p t i o n in. v i t r o 3 I I I . T r a n s c r i p t i o n c o n t r o l regions f o r 5S RNA and tRNA genes 4 IV. Modulation of tRNA gene t r a n s c r i p t i o n by 5 ' - f l a n k i n g sequences 13 V. Present i n v e s t i g a t i o n s 18 M a t e r i a l s and Methods 20 I. S i t e - s p e c i f i c mutagenesis 20 A. P r e p a r a t i o n of d l l - c o n t a i n i n g s i n g l e - s t r a n d e d template 20 B. T e s t i n g pEMBL and pTZ f o r dU content 22 C. P u r i f i c a t i o n of d e o x y o l i g o n u c l e o t i d e s 22 D. Mutagenesis 23 I I . Chain-terminator sequencing 24 I I I . Sequencing by chemical degradation 25 IV. Gel r e t a r d a t i o n assay 26 V. In, v i t r o t r a n s c r i p t i o n and a n a l y s i s of RNA products 27 VI. C a l c u l a t i o n s and s t a t i s t i c a l a n a l y s i s 28 VII. L a r g e - s c a l e i s o l a t i o n of plasmid DNA 28 V I I I . S m a l l - s c a l e i s o l a t i o n of plasmid DNA 30 IX. D i g e s t i o n of DNA with r e s t r i c t i o n end onuc leases 30 X. Agarose g e l e l e c t r o p h o r e s i s 31 XI. P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s 31 XII. I s o l a t i o n of DNA from agarose gels 32 X I I I . I s o l a t i o n of DNA from p o l y a c r y l a m i d e g e l s 33 XIV. Treatment of DNA with exonuclease BAL-31 33 XV. E n d - l a b e l l i n g and f i l l - i n r e a c t i o n s of DNA 35 XVI. Autoradiography 36 XVII. L i g a t i o n of DNA fragments 36 A. BAL-31 d e l e t i o n s e r i e s 36 B. pV4a.5-45 37 C. t R N A V a l 4 5 ' - f l a n k 38 D. pV4a.5-138 38 XVIII. Transformation of E. c o l i s t r a i n s JM83 and NM522 39 XIX. Screening of recombinant clones 40 Results 42 I. C o n s t r u c t i o n of recombinant plasmids 42 A. Subcloning of pV4a.5-45 42 B. Subcloning of pV4a.5-138 45 C. Subcloning of the pV4a.5-179 5'-flank 46 D. Subcloning of the t R N A S e r > 7 gene and 5 ' - f l a n k i n g d e l e t i o n d e r i v a t i v e s 47 I I . S i t e - s p e c i f i c mutagenesis 53 A. pV4a.5-45 53 B. pV4a.5-138 59 v i I I I . T r a n s c r i p t i o n of mutant TNNCTs and d e l e t i o n d e r i v a t i v e s i n a D r o s o p h i l a (Schneider I I ) c e l l - f r e e e x t r a c t 78 A. 5 ' - f l a n k i n g TNNCT mutants 78 B. I n t e r n a l TNNCT mutants 96 C. D e l e t i o n mutants 106 IV. Gel r e t a r d a t i o n assay and t r a n s c r i p t i o n and t r a n s c r i p t i o n competition with i s o l a t e d 5 1-fla n k of pV4a.5-179 114 A. Gel r e t a r d a t i o n 114 B. T r a n s c r i p t i o n competition between the tRNA V a 1,. 5'-flank and pV4a.5-138 7...118 V. T r a n s c r i p t i o n competion between pV4a.5-138, -38G.-35A and pS7a.5-119 121 A. Simultaneous a d d i t i o n 122 B. Preformed complexes 126 VI. E f f e c t of 140 mM NaCl on the t r a n s c r i p t i o n of pV4a.5-138 and pV4a . 5-1 38 ,-38G ,-35A 132 A. E f f e c t on t r a n s c r i p t i o n r a t e 132 B. E f f e c t on t r a n s c r i p t i o n over time 140 C. NaCl c o n c e n t r a t i o n curve 141 VII. E f f e c t of temperature on the t r a n s c r i p t i o n of pV4a.5-138 and p V4a . 5-1 3 8 ,-38G ,-35 A 148 A. E f f e c t of i n c r e a s i n g temperature on t r a n s c r i p t i o n 148 B. E f f e c t on the r a t e of t r a n s c r i p t i o n 148 VII I . A n a l y s i s of the time course f o r the t r a n s o r i p t i o n of pV4a.5-138 wild type and pV4a.5-138,-38G,-35A.151 IX. T r a n s c r i p t i o n i n i t i a t i o n i n pV4a.5-138 wild type and pV4a . 5-1 38 ,-38G ,-35A 156 D i s c u s s i o n 161 I. Mutations i n 5 ' - f l a n k i n g TNNCT 1 61 I I . F a c t o r i n t e r a c t i o n with the 5'-flank 167 v i i I I I . Mutations i n the i n t e r n a l TNNCT 168 IV. T r a n s c r i p t i o n p r o p e r t i e s of a template mutant i n S ' - f l a n k i n g TNNCT 171 A. T r a n s c r i p t i o n competition 173 B. E f f e c t of NaCl 17M C. E f f e c t of temperature 177 D. Time course of t r a n s c r i p t i o n 178 E. T r a n s c r i p t i o n i n i t i a t i o n 180 V. Modulation of t r a n s c r i p t i o n by 5 ' - f l a n k i n g sequences of a tRNA S e r^, g e n e 181 VI. Modulation of pV4a. 5-138 t r a n s c r i p t i o n 183 References 189 v i i i LIST OF TABLES Page Table 1 Vmax values f o r 5 ' - f l a n k i n g TNNCT mutants 83 Table 2 Vmax values f o r i n t e r n a l TNNCT mutants 101 Table 3 Vmax values f o r 5 * - f l a n k i n g d e l e t i o n mutants Of pS7a. 5-119 107 Table 4 C o r r e l a t i o n of t r a n s c r i p t i o n e f f i c i e n c y and the p e n t a n u c l e o t i d e TNNCT 165 i x L I S T OF FIGURES Page F i g u r e 1 R e s t r i c t i o n maps o f V a l u A 5 ' - 1 3 8 and pV4a.5-138 43 F i g u r e 2 The DNA s e q u e n c e s o f i s o l a t e d 5 ' - f l a n k i n g r e g i o n o f pV4a.5-179 48 F i g u r e 3 The DNA s e q u e n c e s o f pS7a.5-119 (A) and pS7a.5-31 (B) 51 F i g u r e 4 S c r e e n i n g o f d e l e t i o n m u t a n t s 54 F i g u r e 5 The DNA s e q u e n c e s o f p S 7 a . 5 - 2 4 ( A ) and pS7a.5-1 8 ( B ) 56 F i g u r e 6 The DNA s e q u e n c e o f pV4a . 5-45 ,-38G 60 F i g u r e 7 The DNA s e q u e n c e s o f pV4a.5-138 (A) and pV4a.5-138,-38G (B) 62 F i g u r e 8 The DNA s a e q u e n c e s o f pV4a.5-138,-38G,-35A (A) and pV4a.5-138,-38G,-35G (B) 65 F i g u r e 9 The DNA s e q u e n c e s o f pV4a.5-138,-34A (A) and pV4a.5-138,-35A (B) 68 F i g u r e 10 The DNA s e q u e n c e s o f pV4a.5-138,-36T (A) and pV4a.5-138,-37A (B) 70 F i g u r e 11 The DNA s e q u e n c e s o f pV4a.5-138 w i l d t y p e (A) and pV4a.5-138,+29A,+32G , + 3 3 C (B) 72 F i g u r e 12 The DNA s e q u e n c e s o f pV4a.5-138,-38G,-35A (A) and pV4a.5-138,-38G,-35A,+29A,+32G,+33C (B) 74 F i g u r e 13 The s e q u e n c e o f pV4a 76 F i g u r e 14-A A u t o r a d i o g r a m o f p r o d u c t s f r o m t h e t r a n s c r i p t i o n o f pV4a.5-138 ( w i l d t y p e ) and pV4a.5-138G,-35A 80 F i g u r e 14-B D o u b l e r e c i p r o c a l p l o t o f d a t a f r o m t r a n s c r i p t i o n s p f pV4a.5-138 w i l d t y p e and pV4a.5-1 38 , -38G.-35A 80 F i g u r e 15 A u t o r a d i o g r a m o f p r o d u c t s f r o m t h e t r a n s c r i p t i o n o f pV4a.5-45 and p V4a . 5-45 ,-38G 84 F i g u r e 16 A u t o r a d i o g r a m o f p r o d u c t s f r o m t h e t r a n s c r i p t i o n o f pV4a.5-138 and p V4a . 5-1 3 8 , -3 8G 86 F i g u r e 17 A u t o r a d i o g r a m o f p r o d u c t s f r o m t h e t r a n s c r i p t i o n X of pV4a.5-138 and pV4a.5-138,-35A 88 F i g u r e 18 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a. 5-138, 90 F i g u r e 19 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a . 5-1 38 ,-35G 92 F i g u r e 20 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,-36T 94 F i g u r e 21 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,-37A 97 F i g u r e 22 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,+29,+32G,+33C 99 F i g u r e 23 Autoradiogram of products from the t r a n s c r i p t i o n of pVUa.5-138 and pV4a.5-138,-38G,-35A,+29A, + 32G.+33C 102 F i g u r e 24 The sequence of pS7a 104 F i g u r e 25 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pS7a.5-119 and pS7a.5-31 108 Fi g u r e 26 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pS7a.5-119 and pS7a.5-24 110 F i g u r e 27 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pS7a.5-119 and pS7a.5-l8 112 Fi g u r e 28 Gel r e t a r d a t i o n assay 115 F i g u r e 29 T r a n s c r i p t i o n c o m petition between the Valj, 5'-flank and pV4a,5-138 7 119 F i g u r e 30-A T r a n s c r i p t i o n c ompetition between pV4a.5-138 -38G,-35A and pS7a.5-119 123 F i g u r e 30-B Graph of data from t r a n s c r i p t i o n competition between pV4a.5-138 wild type pV4a.5-138,-38G, -35A and pS7a.5-1 19 123 F i g u r e 31-A T r a n s c r i p t i o n competition between preformed complexes of pV4a.5-138,-38G,-35A and pS7a.5-119 127 F i g u r e 31-B Graph of data from t r a n s c r i p t i o n c ompetition between preformed complexes of pV4a.5-138 wild type pV4a.5-138,-38G.-35A and pS7a.5-119 127 F i g u r e 31-C Graph showing the e f f e c t of competition between preformed complexes of pV4a.5-138 x i w i l d type and pV4a.5-138,-38G,-35 A on the t r a n s c r i p t i o n of pS7a.5-119 127 F i g u r e 32-A E f f e c t of 140 mM NaCl on t r a n s c r i p t i o n r a t e s of pV4a.5-138 and pV4a . 5-1 38 ,-38G ,-35A 133 F i g u r e 32-B Graph of d a t a showing the e f f e c t of 140 mM NaCl on t r a n s c r i D t i o n r a t e s of pV4a.5-138 and pV4a.5-138,-3 8G,-35A 133 F i g u r e 33-A Time c o u r s e of the e f f e c t of NaCl d u r i n g t r a n s c r i p t i o n of pV4a.5-138 w i l d t y p e 136 F i g u r e 33-B Time c o u r s e of the e f f e c t of NaCl d u r i n g t r a n s c r i p t i o n of pV4a . 5-1 38 ,-38G,-35A 136 F i g u r e 33-C Graph of d a t a showing the e f f e c t of 140 mM NaCl on the t r a n s c r i p t i o n s of pV4a.5-138 and pV4a. 5-138 ,-38G.-35A over time 136 F i g u r e 34-A E f f e c t of d i f f e r e n t NaCl c o n e e n t r a t i u o n s on the t r a n s c r i p t i o n s of pV4a.5-138 w i l d type and pV4a.5-138,-3 8G,-35A 142 F i g u r e 34-B Graph of d a t a showing the e f f e c t s of v a r y i n g c o n c e n t r a t i o n s of NaCl on the t r a n s c r i p t i o n s of pV4a.5-138 and poV4a.5-138,-38G,-35A 142 F i g u r e 35-A E f f e c t of i n c r e a s i n g temperature on the t r a n s c r i p t i o n s of pV4a.5-138 w i l d type and pV4a.5-138,-3 8G,-35A 145 F i g u r e 35-B Graph odata showing the e f f e c t of v a r i o u s t e m p e r a t u r e s on preformed complexes of pV4a.5-138 and p V4a . 5-1 38 ,-38G ,-35 A 145 F i g u r e 36 Autoradiogram of p r o d u c t s from the t r a n s c r i p t i o n s of pV4a.5-138 w i l d t y pe and pV4a.5-138,-38G.-35A at 23.5 and 28° C 149 F i g u r e 37-A Time c o u r s e of t r a n s c r i p t i o n f o r pV4a.5 -138 152 F i g u r e 37-B Time c o u r s e of t r a n s c r i p t i o n f o r pV4a.5 -138-38G.-35A 152 F i g u r e 37-C Graph showing Time c o u r s e of t r a n s c r i p t i o n f o r pV4a.5-138 w i l d t y pe and pV4a.5-138,-38G,-37A152 F i g u r e 38-A Autoradiogram of p r o d u c t s from the t r a n s c r i p t i o n s of pV4a.5-138 and pV4a.5-138, -38G,-35A w i t h [ Q - 3 2 P ] UTP 158 F i g u r e 38-B Autoradiogram of p r o d u c t s from the x i i t r a n s c r i p t i o n s of pVMa.5-138 and pV4a.5-138, -38G.-35A with iY-^2?} GTP 158 F i g u r e 39 A model f o r the mechanism of tRNA gene t r a n s c r i p t i o n 187 x i i i ACKNOWLEDGEMENTS I thank the members of my committee: Tom A. G r i g l i a t t i , Robert, C. M i l l e r , J r . , George B. Spiegelman and Gordon M. Tener. I am g r a t e f u l to George B. Spiegelman f o r h i s help and advice throughout t h i s p r o j e c t . I thank Loverne Duncan fo r p r e p a r a t i o n of the S-100 e x t r a c t and D. Goodin f o r the g i f t of BW313. I a l s o thank my wife Nancy f o r her continued support. A b b r e v i a t i o n s BME 2 - m e r c a p t o e t h a n o l bp b a s e p a i r ( s ) BSA b o v i n e serum a l b u m i n C s C l c e s i u m c h l o r i d e d H 2 o d i s t i l l e d w a t e r DNA d e o x y r i b o n u c l e i c a c i d DTT d i t h i o t h r e i t o l EDTA e t h y l e n e d i a m i n e t e t r a a c e t i c a c i d hr hour IPTG i s o p r o p y l - B - D - t h i o g a l a c t o p y r a n o s i d e Kb k i l o b a s e s Kd k i l o d a l t o n s L l i t e r min m i n u t e ml m i l l i l i t e r Mr m o l e c u l a r w e i g h t NaCl sodium c h l o r i d e NaOAc sodium a c e t a t e NHjjOAc ammonium a c e t a t e PEG p o l y e t h y l e n e g l y c o l pmol p i c o m o l e RNA r i b o n u c l e i c a c i d RNase r i b o n u c l e a s e SDS sodium d o d e c y l s u l f a t e TEMED N , N , N ' , N ' - t e t r a m e t h y l e t h y l e n e d i a m i n e T r i s - C l [ T r i s ( h y d r o x y m e t h y l ) a m i n o m e t h a n e h y d r o c h l o r i d e tRNA t r a n s f e r r i b o n u c l e i c a c i d u l m i c r o l i t e r V a l 4 t R N A V a l 4 X - g a l 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y ] / y - D - g a l a c t o p y r a n o s i d e INTRODUCTION I. C l a s s I I I genes RNA polymerase I I I (or polymerase C, M p ~700,000) i s an enzyme composed of two l a r g e subunlts and a c o l l e c t i o n of 10-12 s m a l l e r components (Huet et a l . , 1985) r e s p o n s i b l e f o r the t r a n s c r i p t i o n of a c l a s s of RNAs which have become def i n e d as c l a s s I I I genes. The s t r u c t u r e and c h a r a c t e r i s t i c s of RNA polymerase I I I have been e x t e n s i v e l y reviewed (Roeder, 1976; S p i n d l e r , 1978; Sentenac, 1 9 8 5 ) . Genes t r a n s c r i b e d by RNA polymerase I I I i n c l u d e the Alu fa m i l y of r e p e t i t i v e sequences which are b e l i e v e d to f u n c t i o n i n regions of DNA r e p l i c a t i o n (Duncan et a l . , 1979; J e l i n e k et a l . , 1980; Fuhrman et a l . , 1981; Haynes et a l . , 1981; Hess et a l . , 1985), the B2 repeated f a m i l y , whose t r a n s c r i p t i o n i s enhanced by SV 40 t r a n s f o r m a t i o n (Singh et a l . , 1985; Carey et a l . , 1986a) and human 7SL RNAs which are r e l a t e d to the Alu sequences ( U l l u and Weiner, 1985). In a d d i t i o n , a 270 n u c l e o t i d e RNA from Tetrahymena has been shown to be t r a n s c r i b e d by RNA polymerase I I I i n response to heat shock (Kraus et a l . , 1987). V i r a l c l a s s I I I genes i n c l u d e E p s t e i n - B a r r v i r u s DNA (Jat and Arrand, 1982) and Aden o v i r u s - a s s o c i a t e d (VA) RNAl and VA RNAll (Thimmappaya et a l . , 1979; Weil et a l . , 1979; Wu, 1980; G u i l f o y l e and Weinmann, 1981). Other genes i n c l u d e the i d e n t i f i e r (I.D.) sequences which encode repeated " b r a i n - s p e c i f i c " small RNAs of 82 n u c l e o t i d e s i n l e n g t h . Data suggests that I.D. 2 s e q u e n c e s p r e s e n t i n t h e i n t r o n s o f g enes i n t h e b r a i n a r e r e s p o n s i b l e f o r t h e a c t i v a t i o n o f RNA p o l y m e r a s e II t r a n s c r i p t i o n f r o m t h o s e genes ( S u t c l i f f e , e t a l . , 1984a; 1984b; M c K i n n o n e t a l . , 1 9 8 6 ) . More r e c e n t l y t h e c a p p e d U6 s m a l l n u c l e a r RNA, p r o p o s e d t o be i n v o l v e d i n t h e p a c k a g i n g o f hnRNPs was a l s o f o u n d t o be t r a n s c r i b e d by RNA p o l y m e r a s e I I I ( K u n k e l e t a l . , 1986; K r o l e t a l . , 1987; Reddy e t a l . , 1987; Das e t a l . , 1 9 8 7 ) . But p e r h a p s t h e most s t u d i e d c l a s s I I I genes a r e 5S RNA g enes ( W e i l e t a l . , 1979; Ng e t a l . , 1979; Bogenhagen e t a l . , 1980; S a k o n j u e t a l . , 1980; G o t t e s f e l d and B l o o m e r , 1982; B o g e n h a g e n , 1985; B i e k e r and R o e d e r , 1986) and tRNA genes ( S p r a g u e e t a l . , 1980; H o f s t e t t e r e t a l . , 1981; C i l i b e r t o e t a l . , 1982a; 1982b; K l e k a m p and W e i l , 1982; F o l k and H o f s t e t t e r , 1983; S c h a a c k e t a l . , 1984; S t . L o u i s and S p i e g e l m a n , 1985; Chang e t a l . , 1986; L o f q u i s t and S h a r p , 1986; S a j j a d i e t a l . , 1 9 8 7 ) . Genes t r a n s c r i b e d by RNA p o l y m e r a s e I I I a l l s h a r e c e r t a i n c h a r a c t e r i s t i c s . One o f t h e f e a t u r e s o f c l a s s I I I genes i s t h e p r e s e n c e o f a c l u s t e r o f T r e s i d u e s i n t h e n o n -c o d i n g s t r a n d o f t h e i r 3 ' - f l a n k i n g s e q u e n c e s . RNA p o l y m e r a s e I I I was shown t o t e r m i n a t e t r a n s c r i p t i o n i n 5S RNA and tRNA g e n e s a t f o u r o r more T r e s i d u e s w i t h o u t t h e a d d i t i o n o f p r o t e i n f a c t o r s o t h e r t h a n t h o s e r e q u i r e d f o r t r a n s c r i p t i o n i n i t i a t i o n . The a b s e n c e o f t h e t e r m i n a t i o n s i g n a l r e s u l t s i n t h e p r o d u c t i o n o f r u n - o n t r a n s c r i p t s ( B ogenhagen and Brown, 1981; C o z z a r e l l i e t a l . , 1983; Watson e t a l . , 1984; A d e n i y i - J o n e s e t a l . , 1 9 8 4 ) . One e x c e p t i o n 3 has been f o u n d f o r t h e t e r m i n a t i o n o f t r a n s c r i p t i o n i n an A l u r e p e a t (Hess et a l . , 1985) w h i c h was shown t o t e r m i n a t e a t an i m p e r f e c t h a i r p i n s t r u c t u r e formed a t t h e 3 ' end o f t h e r e p e a t . The c o d i n g s e q u e n c e o f c l a s s I I I genes i s c a p a b l e o f p r o m o t i n g t r a n s c r i p t i o n . E u k a r y o t i c tRNA genes a l l c o n t a i n two h i g h l y c o n s e r v e d i n t e r n a l p r o m o t e r s e q u e n c e s r e f e r r e d t o as Box A and Box B ( T r a b o n i e t a l . , 1982) or D c o n t r o l and T c o n t r o l r e g i o n s ( S h a r p et a l . , 1 9 8 1 ) . A l u f a m i l y and VA RNA genes a l s o c o n t a i n Box A and B - l i k e s e q u e n c e s ( F o w l k e s and Shenk, 1980; C i l i b e r t o e t a l . , 1983; Rohan and K e t n e r , 1 9 8 7 ) . The 5S RNA c o d i n g s e q u e n c e s h a r e s homology and i s f u n c t i o n a l l y e q u i v a l e n t t o o n l y t h e Box A o f tRNA genes ( C i l i b e r t o e t a l . , 1 9 8 3 ) . The c o n s e r v e d s e q u e n c e s have been shown t o b i n d f a c t o r s r e q u i r e d f o r t h e p r o m o t i o n o f t r a n s c r i p t i o n by RNA p o l y m e r a s e I I I ( T a y l o r and S e g a l l , 1985; J o h n s o n - B u r k e and S o i l , 1 9 8 5 ) . I I . T r a n s c r i p t i o n i n v i t r o E a r l y t r a n s c r i p t i o n s t u d i e s showed t h a t p u r i f i e d RNA p o l y m e r a s e I I I i s o l a t e d f r o m Xenopus l a e v i s c o u l d not s u p p o r t s e l e c t i v e t r a n s c r i p t i o n o f c l o n e d 5S RNA g e n e s , even though t h e enzyme m a i n t a i n e d p o l y m e r i z i n g a c t i v i t y on 5S RNA o o c y t e c h r o m a t i n t e m p l a t e s ( P a r k e r and Roeder, 1977) . T h i s s u g g e s t e d t h e p o s s i b l e r e q u i r e m e n t o f a d d i t i o n a l t r a n s c r i p t i o n f a c t o r s f o r a c t i v i t y . 4 S o l u b l e c e l l - f r e e e x t r a c t s to enable f a i t h f u l RNA polymerase I I I t r a n s c r i p t i o n i l l v i t r o were f i r s t developed f o r VA RNA using human KB c e l l s ( H a r r i s and Roeder, 1978; Weil et a l . , 1 979; Wu, 1980 ) and HeLa c e l l s ( G u i l f o y l e and Weinmann, 1981). These c e l l - f r e e e x t r a c t s were found to a l s o t r a n s c r i b e the Alu f a m i l y of sequences (Duncan et a l . , 1979; J e l i n e k et a l . , 1980). Subsequently other c e l l - f r e e t r a n s c r i p t i o n systems from S-100 e x t r a c t s have been used to f a i t h f u l l y t r a n s c r i b e VA, 5S RNA and tRNA genes. A l s o , i t has been shown that heterologous e x t r a c t s have decreased s t r i n g e n c y i n d i r e c t i n g tRNA t r a n s c r i p t i o n i i i v i t r o . The s t r i n g e n c y v a r i e s between d i f f e r e n t organisms, s i n c e c e r t a i n e x t r a c t s such as HeLa and Xenopus are l e s s s e l e c t i v e i n d i r e c t i n g t r a n s c r i p t i o n of D r o s o p h i l a heterologous tRNA genes than are yeast e x t r a c t s (Schaack et a l . , 1984; Schaack and S o i l , 1985). In a d d i t i o n , most t r a n s c r i p t i o n systems s t u d i e d have shown m u l t i p l e rounds of t r a n s c r i p t i o n i n i t i a t i o n . I l l . T r a n s c r i p t i o n c o n t r o l regions of 5S and tRNA genes A promoter i s d e f i n e d as the sequence of DNA r e q u i r e d to d i r e c t b i n d i n g of polymerase to i n i t i a t e t r a n s c r i p t i o n . T e l f o r d et a l . (1 979 ) were able to d e l i m i t the promoter region f o r a t R N A M e t i gene to w i t h i n 22 bp of the 5'-flank by i n j e c t i o n of a s e r i e s of 5' and 3' d e l e t i o n s of a 120 n u c l e o t i d e Xenopu3 b o r e a l i s 5S RNA gene i n t o Xenopus oocytes. The aim was to d e l i m i t the c o n t r o l regions f o r i n v i t r o RNA s y n t h e s i s (Sakonju et a l . , 1980). I t was found that the 5 ' - f l a n k i n g sequences and up to 50 n u c l e o t i d e s of the gene could be d e l e t e d before a f f e c t i n g t r a n s c r i p t i o n . The 3 ' boundary f o r the c o n t r o l region of the 5S RNA gene was found to be at approximately +83 r e l a t i v e to the i n i t i a t i o n p o i n t of the gene (+1). Thus the c o n t r o l region r e q u i r e d f o r t r a n s c r i p t i o n was d e f i n e d by p o s i t i o n s +50 and +83. A l s o , the p o s i t i o n of the c o n t r o l r e g i o n w i t h i n the 5S RNA gene along with the immediate 5 ' - f l a n k i n g sequences was found to s p e c i f y the s i t e of i n i t i a t i o n , some 50 bp upstream of the i n t e r n a l c o n t r o l region (Sakonju et a l . , 1980; Bogenhagen et a l . , 1980). Though the t r a n s c r i p t i o n of tRNA genes was found to have a g r e a t e r requirement f o r the 5 ' - f l a n k i n g sequences than the 5S RNA genes, two i n t e r n a l conserved sequences (Box A and Box B) were i d e n t i f i e d w i t h i n tRNA genes ( C i l i b e r t o et a l . , 1983; Murphy and B a r a l l e , 1984; Stewart et a l . , 1985). The c o n t r o l regions had p r e v i o u s l y been shown to be r e s p o n s i b l e f o r d i r e c t i n g t r a n s c r i p t i o n of a Xenopus l a e v i s t R N A M e t 1 gene ( H o f s t e t t e r et a l . , 1981). Since i t was observed that the 5 ' - f l a n k i n g sequences of s e v e r a l c l a s s I I I genes rev e a l e d very l i t t l e or no apparent sequence homology, i t seemed l i k e l y that the i n t e r n a l sequences played a major r o l e i n promoter r e c o g n i t i o n . Therefore the n o t i o n that c l a s s I I I promoters were i n t e r n a l became strengthened ( H o f s t e t t e r et a l . , 1981). 6 C i l i b e r t o et a l . (1983) have shown that 5S RNA and tRNA genes f a l l i n t o two d i f f e r e n t c l a s s e s . F i r s t they showed th a t the 31* bp i n t e r n a l c o n t r o l region (ICR) of the somatic 5S RNA gene from Xenopus b o r e a l i s c o n s i s t s of two separate components and can be s p l i t by i n s e r t i o n of n u c l e o t i d e s to produce a t r a n s c r i p t i o n a l l y a c t i v e maxigene. Second, the f i r s t 11 bp of the ICR were shown to be homologous and f u n c t i o n a l l y e q u i v a l e n t to the Box A of a t R N A P r o gene, s i n c e h y b r i d genes c o n s t r u c t e d from the 5S and tRNA genes were e f f i c i e n t l y t r a n s c r i b e d i n Xenopus l a e v i s oocytes. However, no Box B consensus sequence was found i n 5S RNA genes. In a d d i t i o n tRNA and 5S RNA genes i n i t i a t e t r a n s c r i p t i o n at very d i f f e r e n t d i s t a n c e s from t h e i r mature coding sequences. F i n a l l y , 5S RNA genes bind a s p e c i f i c t r a n s c r i p t i o n f a c t o r that does not i n t e r a c t with tRNA genes (Sakonju et a l . , 1981). The l i m i t s of the i n t e r n a l c o n t r o l regions i n tRNA genes have been more c l e a r l y d e f i n e d f o r a D r o s o p h i l a tRNA A r f5 gene (pArg; Sharp et a l . , 1981). One promoter element was bound by p o s i t i o n s +8 to + 25 and was r e f e r r e d to as the D - c o n t r o l or Box A (Sharp et a l . , 1982). P o s i t i o n s +50 to +58 encode the T - c o n t r o l or Box B i n t e r n a l promoter. In a d d i t i o n , the 5 f - h a l f of tRNA A r? genes c o n t a i n i n g the D-c o n t r o l r e g i o n plus f l a n k i n g sequences ( i . e . 5' end of the gene) was found to d i r e c t RNA s y n t h e s i s i n Kc c e l l and Xenopus oocyte e x t r a c t s . D e l e t i o n of the 5 ' - f l a n k i n g sequences and D - c o n t r o l r e g i o n a b o l i s h e d t r a n s c r i p t i o n i n Kc c e l l e x t r a c t , but not i n Xenopus oocyte e x t r a c t (Sharp et a l . , 1983b). The d i s t a n c e s e p a r a t i n g the D and T c o n t r o l regions i n pArg could be i n c r e a s e d between 12 and 77 n u c l e o t i d e s without de c r e a s i n g the e f f i c i e n c y of t r a n s c r i p t i o n or the a b i l i t y to compete i n the b i n d i n g of t r a n s c r i p t i o n f a c t o r s i n D r o s o p h i l a Kc c e l l e x t r a c t (Dingermann et a l . , 1983). The d i s t a n c e between the D and T c o n t r o l r e g ions i s v a r i a b l e among n a t u r a l l y o c c u r r i n g tRNA genes. Some tRNAs c o n t a i n i n t e r v e n i n g sequences and i t i s not unusual to f i n d c o n s i d e r a b l e v a r i a t i o n i n the lengths of t h e i r e x t r a arms (Standring et a l . , 1981; B a l d i et a l . , 1983). An experiment i n c r e a s i n g the d i s t a n c e between the two c o n t r o l regions of a C. elegans t R N A P r o gene found that a d i s t a n c e of kO to 50 n u c l e o t i d e s allows f o r optimal t r a n s c r i p t i o n . In a d d i t i o n , a h y b r i d tRNA gene c o n t a i n i n g c o n t r o l r e g ions from a t R N A L e u and t R N A P r o genes was found to be t r a n s c r i b e d e f f i c i e n t l y i n Xenopus oocytes, showing that at l e a s t i n t h i s case the c o n t r o l regions are independent t r a n s c r i p t i o n u n i t s ( C i l i b e r t o et a l . , 1982a). A number of s t u d i e s have focused on the e f f e c t s of changes i n the conserved i n t e r n a l c o n t r o l regions of tRNA genes. Using s i t e - d i r e c t e d i n v i t r o mutagenesis, s i n g l e and double p o i n t mutations were created i n the i n v a r i a n t n u c l e o t i d e s of c e r t a i n tRNA genes which r e s u l t e d i n a decrease i n t r a n s c r i p t i o n . Such e f f e c t s f u r t h e r strengthened the n o t i o n that promoters of tRNA genes were i n t e r n a l . A l t h o u g h t h e s e r e s i d u e s a r e i m p l i c a t e d i n f a c t o r b i n d i n g , t h e r e have been i n c o n s i s t e n c i e s i n t h e e f f e c t s o f n u c l e o t i d e c h a n g es i n t h e i n t e r n a l c o n t r o l s e q u e n c e s o f d i f f e r e n t tRNA genes ( S t e w a r t e t a l . , 1985 ; S h a rp et a l . , 1 9 8 5 ) . F u r t h e r m o r e , i t would a p p e a r t h a t s u b s t i t u t e d b a s e s i n t h e i n t e r n a l c o n t r o l r e g i o n a f f e c t t r a n s c r i p t i o n d i f f e r e n t l y i n d i f f e r e n t t r a n s c r i p t i o n s y s t e m s ( S t e w a r t et a l . , 1 9 8 5 ) . F o l k and H o f s t e t t e r (19 8 3) c a r r i e d out an e x t e n s i v e m u t a g e n e s i s s t u d y o f t h e Xenopus tRNA^ e^^ gene t o d e t e r m i n e t h e e f f e c t s o f t h e s e m u t a t i o n s on t r a n s c r i p t i o n . T r a n s c r i p t i o n was r e d u c e d between t h r e e t o t w e n t y - f o l d f o r m u t a t i o n s i n t h e i n t e r n a l c o n t r o l r e g i o n s o f t h e gene. M u t a t i o n s i n t h e 3 1 i n t e r n a l c o n t r o l r e g i o n o f a C. e l e g a n s t R N A P r o gene (Goodman et a l . , 1977) were f o u n d t o s e v e r e l y a f f e c t t r a n s c r i p t i o n . An e x t e n s i v e s e r i e s of m u t a t i o n s were c r e a t e d i n t h e y e a s t t R N A T v r gene ( A l l i s o n e t a l . , 1 9 8 3 ) . M u t a t i o n s w h i c h r e d u c e d t e m p l a t e a c t i v i t y were c o n f i n e d t o t h e i n t e r n a l c o n t r o l r e g i o n s o f t h e tRNA^yr gene. However, t h e r e s u l t s showed t h a t m u t a t i o n s a t c o r r e s p o n d i n g p o s i t i o n s o f a l l t h e s e tRNA genes d i s p l a y e d v e r y d i f f e r e n t e f f e c t s on t r a n s c r i p t i o n . N u c l e o t i d e c h a n g es o u t s i d e t h e c o n t r o l r e g i o n s o f tRNA genes have a l s o been shown t o a f f e c t t r a n s c r i p t i o n e f f i c i e n c y . F o r example, m u t a t i o n s i n t h e e x t r a arms o f a y e a s t t R N A S e r gene ( W i l l i s et a l . , 1 9 8 4 ) , a C. e l e g a n s t R N A P r o gene ( T r a b o n i et a l . , 1984) and a y e a s t t R N A T v r gene 9 ( C i a m p i et a l . , 1982) a l l r e s u l t e d i n d e c r e a s e d t r a n s c r i p t i o n a c t i v i t i e s . I t has been s u g g e s t e d t h a t t h e e x t r a arm may r e p r e s e n t an e x t e n s i o n o f t h e 3 ' i n t e r n a l c o n t r o l r e g i o n ( S h a r p et a l . , 1 9 8 5 ) . M u t a t i o n s i n t h e a n t i c o d o n s t e m / l o o p r e g i o n between t h e two i n t e r n a l c o n t r o l r e g i o n s have a l s o been shown t o be i m p o r t a n t f o r p r o m o t e r f u n c t i o n ( F o l k and H o f s t e t t e r , 1 9 8 3 ) . However, m u t a t i o n s i n t h e a n t i c o d o n stem o f t h e y e a s t gene ( A l l i s o n et a l . , 1983) and a y e a s t t R N A S e r gene ( S h a r p et a l . , 1985) d i d n o t r e d u c e t e m p l a t e a c t i v i t y . In c o n t r a s t , m u t a t i o n s i n t h e a n t i c o d o n l o o p o f a D r o s o p h i l a t R N A A r § gene r e s u l t e d i n a d e c r e a s e i n t r a n s c r i p t i o n a l a c t i v i t y ( S t e w a r t et a l . , 1 9 8 5 ) . The r e s u l t s t h e r e f o r e i n d i c a t e t h a t s e q u e n c e s o u t s i d e t h e i n t e r n a l c o n t r o l r e g i o n s o f tRNA genes a r e i n v o l v e d i n t h e p r o m o t i o n o f t r a n s c r i p t i o n and may t h e r e f o r e i n t e r a c t w i t h t r a n s c r i p t i o n f a c t o r s . The r o l e o f P o l I I I t r a n s c r i p t i o n c o m p l e x e s f o r 5S RNA and tRNA genes has been r e v i e w e d by Brown ( 1 9 8 4 ) , L a s s a r et a l . (1983) and s t u d i e d i n d e t a i l by Andrews et a l . (1984) and L a s s a r et a l . ( 1 9 8 5 ) . Some o f t h e f a c t o r s t h a t a r e r e q u i r e d f o r P o l I I I t r a n s c r i p t i o n have been a n a l y z e d by f r a c t i o n a t i o n o f c r u d e c e l l u l a r e x t r a c t s ( S e g a l l et a l . , 1980; S h a s t r y et a l . , 1982; Klekamp and W e i l , 1982; J o h n s o n -Burke et a l . , 1 9 8 3 ) . The f i r s t t r a n s c r i p t i o n f a c t o r p u r i f i e d and shown t o b i n d t o t h e i n t e r n a l c o n t r o l r e g i o n o f 5S RNA genes was a p o l y p e p t i d e o f a p p r o x i m a t e l y 40 Kd ( T F I I I A ) ( E n g e l k e et a l . , 1 9 8 0 ) . 10 T r a n s c r i p t i o n - c o m p e t i t i o n a s s a y s were d e v e l o p e d i n o r d e r t o measure t h e a b i l i t y o f i n c r e a s i n g amounts o f one gene t o i n h i b i t t r a n s c r i p t i o n o f a s e c o n d gene. Wormington et a l . (1981) found t h a t t h e 40 Kd p r o t e i n w hich i s a p o s i t i v e t r a n s c r i p t i o n f a c t o r a c t s as a l i m i t i n g component i n t h e c o m p e t i t i o n a s s a y . F u r t h e r m o r e , d e l e t i o n o f t h e 5'-f l a n k i n g r e g i o n r e d u c e d t h e c o m p e t i t i v e s t r e n g t h o f s o m a t i c 5S DNA, but d i d n o t a f f e c t o o c y t e 5S DNA i n o o c y t e n u c l e a r e x t r a c t . Dingermann et a l . (1983) p r o p o s e d a model i n w hich two t r a n s c r i p t i o n f a c t o r s i n t e r a c t w i t h t h e D and T c o n t r o l r e g i o n s r e s p e c t i v e l y and r e s u l t i n t e m p l a t e a c t i v a t i o n by a c o o p e r a t i v e mechanism. In t h i s model, t h e S f a c t o r b i n d s t o t h e D c o n t r o l r e g i o n and t h e T f a c t o r t o t h e T c o n t r o l r e g i o n t o b r i n g a b o u t s t a b l e complex f o r m a t i o n . S e p a r a t i o n o f t h e two c o n t r o l r e g i o n s i n t e r f e r e s w i t h c o o p e r a t i v e s t a b l e complex f o r m a t i o n as measured by c o m p e t i t i o n e x p e r i m e n t s . T r a n s c r i p t i o n c o m p e t i t i o n a s s a y s u s i n g 5' and 3' d e l e t i o n d e r i v a t i v e s o f a t R N A A r * gene ( p A r g ) showed t h a t t h e p r e s e n c e o f b o t h t h e D and T c o n t r o l r e g i o n s i s n e c e s s a r y f o r maximum c o m p e t i t i v e s t r e n g t h and t h a t b o t h t h e 5 1 and 3' f l a n k i n g s e q u e n c e s c o n t r i b u t e t o t h e c o m p e t i t i v e a b i l i t y o f t h e D and T c o n t r o l r e g i o n s r e s p e c t i v e l y ( S h a r p et a l . , 1983a; Schaack et a l . , 1983). Two t r a n s c r i p t i o n f a c t o r s d e s i g n a t e d T F I I I B or F a c t o r B(<B) (Mr 260 Kd) and T F I I I C or F a c t o r C (T) (Mr 300 Kd) , a r e r e q u i r e d f o r t h e t r a n s c r i p t i o n o f tRNA genes ( S t i l l m a n et a l . , 1984a; 1984b; 1985; Ruet et a l . , 1984; Johnson-Burke and S o i l , 1985; Camier et a l . , 1985 Klekamp and W e i l , 1986; M a r z o u k i et a l . , 1986; Klekamp and W e i l , 1987). DNA f o o t p r i n t a n a l y s i s of t h e s e f a c t o r s has shown t h a t w h i l e T F I I I C i n t e r a c t s p r i m a r i l y w i t h the T c o n t r o l r e g i o n , p r o t e c t i o n can be extended t o the D c o n t r o l r e g i o n as w e l l (Camier et a l . , 1 9 8 5 ; Baker et a l . , 1 9 8 6 ; Carey et a l . , 1 9 8 6 b ) . More r e c e n t l y , Y oshinaga et a l . ( 1 9 8 7 ) have s e p a r a t e d T F I I I C i n t o two f u n c t i o n a l components TFIIIC1 and T F I I I C 2 . T F I I I C 2 was shown t o b i n d t o the T c o n t r o l r e g i o n and p r o t e c t i o n was extended t o the D c o n t r o l r e g i o n by the a d d i t i o n of T F I I I C 1 . An RNA polymerase I I I f a c t o r ( T F I I I D ) i s o l a t e d from s i l k w o r m , has been shown t o f u n c t i o n i n a s i m i l a r f a s h i o n t o T F I I I C 2 and i s p r o b a b l y analogous to T F I I I C 2 ( O t t o n e l l o et a l . , 1 9 8 7 ) . Although b i n d i n g of T F I I I B t o the DNA i n the absence of T F I I I C has not been d e m o n s t r a t e d , i t s presence i s e s s e n t i a l f o r s t a b l e complex f o r m a t i o n ( L a s s a r et a l . , 1983; Johnson-Burke and S o i l , 1 985). In a d d i t i o n t o T F I I I B and T F I I I C , 5S RNA genes r e q u i r e a t h i r d t r a n s c r i p t i o n f a c t o r T F I I I A ( G o t t e s f e l d and Bloomer, 1982; Hanas et a l . , 1984; Smith et a l . , 1984; Bogenhagen et a l . , 1985) t o promote the f o r m a t i o n of the s t a b l e complex p r i o r t o t r a n s c r i p t i o n by RNA polymerase I I I . The b i n d i n g o r d e r of t r a n s c r i p t i o n f a c t o r s i n 5S RNA genes i s b e l i e v e d t o be T F I I I A , T F I I I C and then T F I I I B ( S e t z e r and Brown, 1985). The o r d e r of b i n d i n g of f a c t o r s i n tRNA genes i s b e l i e v e d t o be T F I I I C f o l l o w e d by T F I I I B , as shown by t r a n s c r i p t i o n c o m p e t i t i o n e x p e r i m e n t s w i t h b o t h t h e 5' and 3 1 c o n t r o l r e g i o n s o f t h e gene ( L a s s a r et a l . , 1983; 1985). I n t e r e s t i n g l y , s t a b l e complex f o r m a t i o n has been shown t o be i n f l u e n c e d by t h e 5 ' - f l a n k i n g s e q u e n c e s i n b o t h tRNA and 5S RNA genes ( S c h a a c k e t a l . , 1984; J o h n s o n - B u r k e and S o i l , 1985; T a y l o r and S e g a l l , 1985). I n a d d i t i o n , d e l e t i o n o f t h e 5 * - f l a n k i n g s e q u e n c e s o f a VA RNAI gene ( F o w l k e s and Shenk, 1980) was shown t o r e s u l t i n r e d u c e d c o m p e t i t i o n a b i l i t y f o r t h e f a c t o r s . F r a c t i o n s c o n t a i n i n g i s o l a t e d f a c t o r s have been used i n DNase I p r o t e c t i o n a n a l y s i s t o s t u d y t h e i n t e r a c t i o n o f f a c t o r s w i t h t h e gene d u r i n g complex f o r m a t i o n (Fuhrman et a l . , 1984). F o r a y e a s t SUP53 tRNA gene, a m u t a t i o n i n t h e 3' i n t e r n a l c o n t r o l r e g i o n was shown t o p r e v e n t f a c t o r i n t e r a c t i o n and d e c r e a s e i t s c o m p e t i t i v e s t r e n g t h (Newman et a l . , 1983). However, m u t a t i o n s i n t h e 5* ICR d i d n o t a f f e c t b i n d i n g o f f a c t o r s . A l s o , f o r a t R N A T y r SUP4-o gene, s t a b l e c o m p l e x e s were formed w i t h t h e f a c t o r a l o n e (Ruet et a l . , 1984). I n t e r e s t i n g l y , Wingender et a l . (1986; 1987) have shown t h a t c o m p l e x e s o f T F I I I B , T F I I I C and RNA p o l y m e r a s e I I I a r e c a p a b l e o f f o r m i n g i n t h e a b s e n c e o f t e m p l a t e DNA. The f o r m a t i o n o f s t a b l e c o m p l e x e s f o r tRNA genes has been s t u d i e d by u s i n g c o m p e t i t o r and r e f e r e n c e genes i n v a r i o u s a s s a y s t o t e s t t h e a b i l i t i e s o f v a r i o u s genes i n i n h i b i t i n g t h e t r a n s c r i p t i o n o f t h e r e f e r e n c e gene ( S t . L o u i s and S p i e g e l m a n , 1985). S i m i l a r s t u d i e s have shown t h e 3' i n t e r n a l c o n t r o l r e g i o n t o be most i m p o r t a n t i n t h e c o m p e t i t i o n e x p e r i m e n t s ( S h a r p et a l . , 1983a; Schaack et a l . , 1983). The 5' ICR was a l s o shown t o c o n t r i b u t e t o t h e f o r m a t i o n o f s t a b l e c o m p l e x e s , s i n c e d e l e t i o n o f t h e 5'-f l a n k r e d u c e d c o m p e t i t i v e a b i l i t y . S chaack e t a l . (1983) a l s o showed t h a t w h i l e s t a b l e complex f o r m a t i o n o c c u r r e d w i t h i n f i v e m i n u t e s f o r pArg ( i n d e p e n d e n t o f t e m p e r a t u r e between 2h and 30° C ) , t r a n s c r i p t i o n was d e t e c t e d a f t e r t e n t o t h i r t y m i n u t e s and was i n t u r n t e m p e r a t u r e d e p e n d e n t . The r e s u l t s t h e r e f o r e showed t h a t two s t e p s were i n v o l v e d i n t h e f o r m a t i o n o f s t a b l e c o m p l e x e s , t h e s e c o n d p e r h a p s i n v o l v i n g t h e i n t e r a c t i o n o f a n o t h e r f a c t o r or a r e a r r a n g e m e n t o f t h e formed complex (Sharp et a l . , 1985). IV. M o d u l a t i o n o f tRNA gene t r a n s c r i p t i o n by 5 ' - f l a n k i n g  s e q u e n c e s I t i s w e l l e s t a b l i s h e d t h a t 5 ' - f l a n k i n g s e q u e n c e s o f tRNA genes m o d u l a t e t r a n s c r i p t i o n . The s t u d y o f tRNA gene t r a n s c r i p t i o n r e v e a l e d a g r e a t e r r e q u i r e m e n t f o r t h e 5'-f l a n k i n g s e q u e n c e s t h a n f o r 5S RNA genes ( D e F r a n c o et a l . , 1980). A c l o n e d Bombyx m o r i t R N A A l a 2 gene l a c k i n g a l l but 11 n u c l e o t i d e s o f i t s 5 * - f l a n k was u n a b l e t o d i r e c t e f f i c i e n t t r a n s c r i p t i o n i n Bombyx e x t r a c t , but was t r a n s c r i b e d i n Xenopus e x t r a c t ( S p r a g u e et a l . , 1980). I t was l a t e r shown t h a t t h e 5 ' - f l a n k i n g s e q u e n c e s o f t h e t R N A A ^ a gene between p o s i t i o n s -37 and -16 r e l a t i v e t o t h e mature c o d i n g s e q u e n c e were r e q u i r e d f o r e f f i c i e n t 14 tran s c r i p t i o n in a homologous extract (Larson et a l . , 1983; Young et a l . , 1986). Conserved sequences in the 5'-flank of Ala tRNA genes which were also found upstream of silkworm 5S genes (Morton and Sprague, 1982) were postulated to interact with the RNA polymerase III complex during transcription i n i t i a t i o n . The 5*-flanking sequence requirements have also been shown for a C_. elegans tRNA P r o gene ( C i l i b e r t o et a l . , 1982a) and a yeast tRNA T y r gene (Shaw and Olson, 1984). In fact, i t has been shown that the 5'-flanking region of a yeast tRNA L e u^ gene is s u f f i c i e n t to constitute an RNA polymerase III promoter with either the A or B Box sequences in homologous c e l l - f r e e extracts (Johnson and Raymond, 1984). A deletion of the 5'-flanking sequence of this yeast tRNA^ e u^ gene to position -2 was s t i l l active in Xenopus extracts, but nearly inert in a homologous extract (Raymond and Johnson, 1983; Johnson and Raymond, 1984). The 5'-flanking sequences of tRNA genes studied to date are characterized by the lack of conserved nucleotide sequences. These differences between the 5'-flanks may r e f l e c t the s p e c i f i c i t i e s of various RNA polymerase III enzyme complexes for d i f f e r e n t control elements in d i f f e r e n t organisms. This has best been demonstrated by the observation of very d i f f e r e n t t r a nscription e f f i c i e n c i e s for tRNA genes transcribed in heterologous extracts (Sharp et a l . , 1982; Schaack et a l . , 1984; Schaack and S o i l , 1985; Glew et a l . , 1986). The differences may suggest that some c o m p o n e n t ( s ) i n t h e h e t e r o l o g o u s e x t r a c t does n o t b i n d i n t h e same manner as t h e homologous c o m p o n e n t ( s ) t o t h e p r o m o t e r ( J o h n s o n - B u r k e and S o i l , 1985). The exchange o f 5 ' - f l a n k i n g s e q u e n c e s between d i f f e r e n t tRNA genes has shown t h a t a s p e c i f i c i t y i s r e q u i r e d between t h e gene and i t s 5 ' - f l a n k i n g r e g i o n . T h i s has been d e m o n s t r a t e d f o r a t R N A H i s pseudogene o f D r o s o p h i l a ( C o o l e y e t a l . , 1984). The t R N A H i s pseudogene was a poor t e m p l a t e f o r t r a n s c r i p t i o n i n homologous e x t r a c t s , whereas i t s c o u n t e r p a r t , a t R N A H i s gene, w h i c h p o s s e s s e s d i f f e r e n t f l a n k i n g s e q u e n c e s , was v e r y e f f i c i e n t i n d i r e c t i n g t r a n s c r i p t i o n . When t h e 5 ' - f l a n k o f t h e pseudogene was r e p l a c e d w i t h t h a t o f t h e w i l d t y p e t R N A H i s gene, t r a n s c r i p t i o n a c t i v i t y was r e s t o r e d . However, r e p l a c e m e n t of t h e 5 ' - f l a n k o f t h e t R N A H i s pseudogene w i t h t h e 5'-f l a n k i n g s e q u e n c e s o f t h e a c t i v e p A r g gene, d i d n o t r e s t o r e t r a n s c r i p t i o n a l a c t i v i t y . I n a d d i t i o n , w h i l e HeLa c e l l e x t r a c t has been u s e d t o t r a n s c r i b e e f f i c i e n t l y a l l tRNA genes examined t o d a t e , t h i s e x t r a c t f a i l e d t o d i r e c t e f f i c i e n t t r a n s c r i p t i o n o f e i t h e r tRNA***s genes ( C o o l e y et a l . , 1984). A t e r m i n a t i o n - l i k e s e q u e n c e as p a r t o f an u n d e c a n u c l e o t i d e was f o u n d t o be r e s p o n s i b l e f o r r e d u c e d t e m p l a t e a c t i v i t y i n D r o s o p h i l a t R N A L y s 2 g e n e s w n e n p r e s e n t i n t h e 5 ' - f l a n k i n g r e g i o n . The i n h i b i t o r y e f f e c t s o f t h i s s e q u e n c e were r e d u c e d by i t s p o s i t i o n i n g away f r o m t h e mature c o d i n g s e q u e n c e and i n h i b i t i o n by t h e s e q u e n c e was 16 removed by i t s d e l e t i o n from the 5'-flank (DeFranco et a l . , 1981) . S i m i l a r sequences have been found i n the 5 ' - f l a n k i n g r e g i o n of a D r o s o p h i l a tRNA A r6 gene (Dingermann et a l . , 1982) , a D r o s o p h i l a t R N A L e u gene (Glew et a l . , 19 8 6) and a D r o s o p h i l a t R N A 7 3 1 ^ g e n e which i s the s u b j e c t of t h i s study. A d e l e t i o n s e r i e s i n the 5'-flank of the t R N A V a 1 ^ gene (pV4a.5-179) d e l i m i t e d a n e g a t i v e modulatory sequence c o n s i s t i n g of thymidylate t r a c t s f l a n k e d by purines between p o s i t i o n s -70 and -50 r e l a t i v e to the mature coding sequence ( S a j j a d i et a l . , 1987). The only other i n h i b i t o r y sequence found has been a 12 bp a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequence i n the 5 ' - f l a n k i n g r e g i o n of two t R N A M e t genes from Xenopus l a e v i s (Hipskind and C l a r k s o n , 19 8 3 ) . The most ex t e n s i v e d e l e t i o n s t u d i e s of the 5'-f l a n k i n g sequences of RNA polymerase I I I genes have been f o r a D r o s o p h i l a t R N A A r S 2 g e n e by Schaack et a l . (1984) and a Va 1 D r o s o p h i l a tRNA ^ g e n e by S a j j a d i et a l . (1987). For pArg, d e l e t i o n of the 5 ' - f l a n k i n g sequences to p o s i t i o n -36 r e s u l t e d i n a higher l e v e l of t r a n s c r i p t i o n than f o r pArg. The i n c r e a s e d e f f i c i e n c y of t r a n s c r i p t i o n was a b o l i s h e d by d e l e t i o n to p o s i t i o n - 3 3 and t r a n s c r i p t i o n was only 12$ of pArg f o r d e l e t i o n -32 (Schaack et a l . , 1985). Fur t h e r d e l e t i o n of the 5*-flank to p o s i t i o n -17 r e s u l t e d i n a gradual l o s s i n t r a n s c r i p t i o n e f f i c i e n c y , with d e l e t i o n -11 t r a n s c r i b i n g at l e s s than \% of pArg. As a r e s u l t , the 5 1-f l a n k i n g modulatory sequences of pArg were d e l i m i t e d to p o s i t i o n - 6 0 , -33 and -11 ( S c h a a c k e t a l . , 1 9 8 4 ) , but no c o n s e r v e d p o s i t i v e m o d u l a t o r y s e q u e n c e s were i d e n t i f i e d . One p o s s i b l e p o s i t i v e m o d u l a t o r y s e q u e n c e has been d e l i m i t e d f o r a human t R N A G l u gene t h a t i s v e r y e f f i c i e n t i n d i r e c t i n g t r a n s c r i p t i o n (Goddard e t a l . , 1 9 8 3 ) . T h i s gene c o n t a i n e d a s e q u e n c e w i t h t h e p o t e n t i a l t o f o r m a t R N A - l i k e s t r u c t u r e i n i t s 5 ' - f l a n k . U n t i l r e c e n t l y tRNA genes from h i g h e r e u k a r y o t e s were t h o u g h t n o t t o be m o d u l a t e d t r a n s c r i p t i o n a l l y by t h e i r 5 ' - f l a n k s ( S c h a a c k and S o i l , 1 9 8 5 ) . A r n o l d e t a l . (1986; 1987) have shown t h a t d i f f e r e n t 5 * - f l a n k i n g s e q u e n c e s o f human t R N A V a * genes c o n t a i n e x t r a g e n i c c o n t r o l s e q u e n c e s r e s p o n s i b l e f o r e f f e c t i n g t r a n s c r i p t i o n e f f i c i e n c y . I n a d d i t i o n , t h e 5 ' - f l a n k i n g r e g i o n s o f mouse t R N A H i s genes have a l s o been shown t o m o d u l a t e t h e i r t r a n s c r i p t i o n ( M o r r y and H a r d i n g , 1 9 8 6 ) . W h i l e a c o n s e r v e d s e q u e n c e i n t h e 5 ' - f l a n k o f a number o f D r o s o p h i l a 5S and tRNA genes has been i d e n t i f i e d , t h e e f f e c t s o f t h i s s e q u e n c e on t h e t r a n s c r i p t i o n o f t h o s e genes have n o t been examined ( I n d i k and T a r t o f , 1 9 8 2 ) . F o r a D r o s o p h i l a t R N A V a ^ ^ g e n e ( S a j j a d i e t a l . , 1985; 1 9 8 7 ) , d e l e t i o n o f 5 * - f l a n k i n g s e q u e n c e s t o p o s i t i o n - 4 9 r e s u l t e d i n a 44$ i n c r e a s e i n t r a n s c r i p t i o n r e l a t i v e t o t h e w i l d t y p e t e m p l a t e . F u r t h e r d e l e t i o n s t o p o s i t i o n - 3 9 g r a d u a l l y l o w e r e d t h e Vmax and d e l e t i o n t o p o s i t i o n - 3 7 r e s u l t e d i n a s h a r p d r o p i n t r a n s c r i p t i o n e f f i c i e n c y . A d d i t i o n a l d e l e t i o n s o f t h e 5 ' - f l a n k s e v e r e l y r e d u c e d t h e l e v e l o f t r a n s c r i p t i o n . T h e s e r e s u l t s d e l i m i t e d a s e q u e n c e o f t h e g e n e r a l f o r m TNNCT where N i s any n u c l e o t i d e . TNNCT was a l s o f ound a s s o c i a t e d w i t h e f f i c i e n t t r a n s c r i p t i o n o f o t h e r D r o s o p h i l a tRNA g e n e s . V. P r e s e n t i n v e s t i g a t i o n s The d e l e t i o n o f 5 ' - f l a n k i n g s e q u e n c e s i n pV4a.5-179 ( S a j j a d i e t a l . , 1985; 1987) s u g g e s t e d t h e s e q u e n c e TNNCT was a p o s i t i v e m o d u l a t o r o f tRNA gene t r a n s c r i p t i o n . In a d d i t i o n , t h e e f f e c t s o b s e r v e d i n d i c a t e d t h a t f o r c e r t a i n d e l e t i o n e n d - p o i n t s , a TNNCT p r e s e n t i n n e a r b y v e c t o r s e q u e n c e s was r e s p o n s i b l e f o r i n f l u e n c i n g t R N A V a 1 ^ t r a n s o r i p t i o n . T h e r e f o r e t o d e t e r m i n e t h e p o s s i b l e m o d u l a t o r y e f f e c t s o f TNNCT i n t h e a b s e n c e o f v e c t o r s e q u e n c e s , a number o f s i t e - s p e c i f i o c hanges have been c r e a t e d i n t h e s e q u e n c e TNNCT between p o s i t i o n s -33 and -38 o f pV4a.5-138, a t e m p l a t e w h i c h d i r e c t s t r a n s c r i p t i o n a t w i l d t y p e l e v e l s . I n a d d i t i o n , a number o f t r a n s c r i p t i o n e x p e r i m e n t s were c a r r i e d out t o d e t e r m i n e t h e f u n c t i o n o f TNNCT i n d i r e c t i n g t r a n s c r i p t i o n . T hese s t u d i e s were e x t e n d e d t o e x p e r i m e n t s i n wh i c h t e m p e r a t u r e and i o n i c s t r e n g t h were a l t e r e d t o d e t e r m i n e t h e r o l e o f TNNCT i n s t a b l e complex f o r m a t i o n . The r e s u l t s showed t h a t t h e p e n t a n u c l e o t i d e was n o t i n v o l v e d i n d e t e r m i n i n g t h e e f f i c i e n c y o f f o r m a t i o n or t h e m a i n t e n a n c e o f complexes on t h e gene b u t i s p r o b a b l y r e s p o n s i b l e f o r a f f e c t i n g t h e r a t e o f t r a n s o r i p t i o n i n i t i a t i o n . In an a d d i t i o n a l s t u d y a s e r i e s o f d e l e t i o n s e x t e n d i n g i n t o t h e 5 ' - f l a n k o f a D r o s o p h i l a t R N A i e r ^ gene l a c k i n g a TNNCT s e q u e n c e were c r e a t e d . R e s u l t s o b t a i n e d f r o m t r a n s c r i p t i o n o f d e l e t i o n e n d - p o i n t s d e l i m i t e d a s e c o n d p o s s i b l e p o s i t i v e m o d u l a t o r y s e q u e n c e w h i c h was a l s o p r e s e n t i n t h e t R N A V a l j , gene. 20 MATERIALS AND METHODS I. S i t e - s p e c i f i c mutagenesis A. P r e p a r a t i o n of dU c o n t a i n i n g s i n g l e - s t r a n d e d template A loop of g l y c e r o l c u l t u r e from a stock of E. c o l i s t r a i n BW313 (Hfr KL 16 P0/45 [ l y s A (61-62)], dut1 , ung1 , t h i l , relA1 ; Kunkel et a l . , 1987) was used to i n o c u l a t e 2 mis of 2YT (16 g yeast e x t r a c t ; 10 g bacto t r y p t o n e ; 10 g NaCl). The c u l t u r e was grown at 37° C on a f a s t r o l l e r to AggQ=0.8, and streaked f o r s i n g l e c o l o n i e s on a 2YT agar p l a t e , i n c u b a t i n g at 37° C ov e r n i g h t . I t i s important to prepare the b a c t e r i a i n t h i s manner, otherwise the s i n g l e -stranded template w i l l have a low y i e l d and w i l l be contaminated with a high amount of helper phage DNA, chromosomal DNA and RNA. A s i n g l e BVI313 colony was picked and used to i n o c u l a t e 2 mis of 2YT. The c u l t u r e was grown as d e s c r i b e d above to A660= 0.2. Of t h i s c u l t u r e 200 u l was t r a n s f e r r e d to 2 mis of 2YT c o n t a i n i n g 1 u l of the a p p r o p r i a t e phage supernatant of the d e s i r e d clone ( e i t h e r pTZ [USB] or pEMBL8- [Dente et a l . , 1983] at 1 0 1 1 pfu/ml) d i l u t e d 10 2-10 3 times (see s e c t i o n A.4). C e l l s were placed at 37° C f o r 30 min and 100 u l of the c u l t u r e was p l a t e d on a 2YT p l a t e supplemented with 70 ug/ml a m p i c i l l i n . C o l o n i e s were grown overnight at 37° C. A s i n g l e t r a n s f e c t e d colony was grown i n 2 mis of 2 Y T / a m p i c i l l i n as d e s c r i b e d above to A g g Q = o . 5 . The c u l t u r e was s u p e r i n f e c t e d with 40 u l of M13K07 helper phage ( 2 X 1 0 1 1 pfu/ml; Pharmacia) f o r 1 hr at 37° C and then t r a n s f e r r e d to 50 mis of 2YT supplemented with 70 ug/ml kanamycin (Boehringer Mannheim) and 0.25 ug/ml u r i d i n e (Sigma). C e l l s were grown f o r 18 hrs and separated from the supernatant by two c o n s e c u t i v e c e n t r i f u g a t i o n s at 6000xg f o r 15 min i n a SS34 r o t o r . The phage were c o l l e c t e d by 1) p r e c i p i t a t i o n with the a d d i t i o n of 1/4 volume of 20? PEG i n 3.5 M NHjjOAc ( F i s h e r ) and i n c u b a t i o n on i c e f o r 30 min, and 2) c e n t r i f u g a t i o n at 6000xg f o r 15 min. The phage p e l l e t s were suspended i n 200 u l of dH 2 o and e x t r a c t e d at l e a s t three times with an equal volume of phenol/chloroform (24:24:1, phenol:chloroform:isoamyl a l c o h o l ) and f i n a l l y with an equal volume of ch l o r o f o r m . The s o l u t i o n was made 3 M by the a d d i t i o n of 7.5 M NH^OAc (BDH) and the DNA was p r e c i p i t a t e d by the a d d i t i o n of 2.5 volumes of 9535 e t h a n o l . The DNA was c o l l e c t e d by c e n t r i f u g a t i o n and the p e l l e t was then suspended i n 0.25 M NaOAc (BDH) and p r e c i p i t a t e d with 95% e t h a n o l . The p e l l e t was washed with 1 ml of 80$ e t h a n o l , d r i e d under vacuum and suspended i n 50 u l of dH20. 5 u l was e l e c t r o p h o r e s e d on a 0.7% agarose g e l to estimate y i e l d and p u r i t y of s i n g l e - s t r a n d e d plasmid DNA. M13K07 was prepared from areas of densely packed s i n g l e plaques on a 2YT/kanamycin p l a t e which were used to i n o c u l a t e 50 mis of 2YT/kanamycin as d e s c r i b e d above, except that the phage were not p r e c i p i t a t e d . 22 B. T e s t i n g pEMBL and pTZ f o r dO content 2 mis of 2YT were i n o c u l a t e d with E. c o l i BW313 and NM522 (hsd A 5 , A ( l a c - p r o ) , [ F ' . l a c I^Z AM15,pro+]) s e p a r a t e l y and grown to an A g 6 ( ) = n.2 at 37° C. The c e l l s were i n f e c t e d with 1 u l (~10 1 1 pfu/ml) of phage supernatant from A1. A f t e r 30 min, 100 u l of c e l l s from each i n f e c t i o n was p l a t e d on 2YT p l a t e s c o n t a i n i n g 70 ug/ml a m p i c i l l i n . P l a t e s were incubated at 3 7 ° C o v e r n i g h t . On the average only a few c o l o n i e s of BW313 appeared on the p l a t e while there were over one hundred thousand c o l o n i e s of NM522. C. P u r i f i c a t i o n of d e o x y o l i g o n u c l e o t i d e s The f o l l o w i n g o l i g o n u c l e o t i d e s were s y n t h e s i z e d on an Applied Biosystems Model 380-A DNA s y n t h e s i z e r by T. Atkinson ( U n i v e r s i t y of B r i t i s h Columbia): 5'-CGTTGAGGGCGCTGAAG-3'; 5 1-CAGTTGAGG(GA)CG(CAG)(TAG)GAAG-3 1 ;_ 5'-GTTGAGGTCGATGAAGTTGGC-31; 5'-GTTGAGGTCGCAGAAGTTGGCC-3'5 5'-GTTGAGGGCGATGAAGTTG-31; 5'-GTTGAGGGCGGTGAAGTTG-3'; 5'-GCAGTTGAGGTTAGCTGAAGTTG-3'5 51-GCAGTTGAGGTCTCTGAAGTTG-3'i 5'-GCGGTTATCACATCAGCGCAACACGCAGAAGG-31. N u c l e o t i d e s i n brackets i n d i c a t e mixed o l i g o n u c l e o t i d e sequence. O l i g o n u c l e o t i d e s were separated by e l e c t r o p h o r e s i s on 16$ or 20$ p o l y a c r y l a m i d e g e l s c o n t a i n i n g 7 M urea, the DNA was detected by U.V. shadowing of a f l u o r e s c e n t T.L.C. p l a t e and the l e a s t mobile band was excised from the g e l . Gel fragments were crushed, covered with 0.5 M NH^QAc i n 1.5 ml Eppendorf tubes and incubated overnight at 37°. The el u a t e was c l e a r e d of g e l fragments by passage through a 45 u M i l l i p o r e d i s c ( M i l l e x HV4) and the DNA p u r i f i e d on a re v e r s e phase C18 SEP-PAK c a r t r i d g e (Waters) as p r e v i o u s l y d e s c r i b e d (Atkinson and Smith, 1984). D. Mutagenesis D e o x y r i b o n u c l e o t i d e s were phosphorylated and used i n the two-primer mutagenesis procedure as p r e v i o u s l y d e s c r i b e d ( Z o l l e r and Smith, 1984) except that 10 pmoles of phosphorylated o l i g o n u c l e o t i d e was used and the primer extended at 16° C f o r 45 min followed by a second 45 min i n c u b a t i o n at 25° C. Forward and r e v e r s e sequencing primers (Pharmacia) were used f o r pTZ19U and pEMBL8- plasmids r e s p e c t i v e l y . Reaction mixtures were d i l u t e d f i v e - f o l d i n 50 mM C a C l 2 / i o mM T r i s - C l (pH=8.0) and used to transform NM522 prepared as d e s c r i b e d by M a n i a t i s et a l . (1982). C e l l s were p l a t e d on 2YT p l a t e s c o n t a i n i n g 70 ug/ml a m p i c i l l i n and incubated at 37° C o v e r n i g h t . C o l o n i e s were used to i n o c u l a t e 2 mis of 2 Y T / a m p i c i l l i n as d e s c r i b e d i n A.1. F o l l o w i n g s u p e r i n f e c t i o n with M13K07, 120 u l of c u l t u r e were t r a n s f e r r e d to 3 mis of 2YT/kanamycin and grown f o r 18 h r s . S i n g l e - s t r a n d e d plasmid was prepared as i n A.1. except that c e n t r i f u g a t i o n s were f o r 2 mis of c u l t u r e i n a microfuge (Eppendorf). P r i o r to phenol/chloroform e x t r a c t i o n , phage p e l l e t s were suspended i n 100 u l of 50 mM T r i s - C l (pH=7.5), 5 mM MgCl 2, o.5 mM C a C l 2 and t r e a t e d with 100 ug of RNase A (Sigma) f o r 30 min at 37° C. A f t e r d e p r o t e i n i z a t i o n , the DNA was p r e c i p i t a t e d twice with ethanol and suspended i n 12 u l of dH o . Four u l were analyzed by e l e c t r o p h o r e s i s on a 0.7$ agarose g e l to assess DNA y i e l d and p u r i t y . I I . Chain-terminator sequencing A l l dideoxy and d e o x y r i b o n u c l e o s i d e t r i p h o s p h a t e s (Pharmacia) were adjusted to pH 7.0 with T r i s base and t h e i r c o n c e n t r a t i o n s determined by spectrophotometry at the a p p r o p r i a t e wavelengths as d e s c r i b e d by M a n i a t i s et a l . (1982). A l l d i d e o x y n u c l e o t i d e mixes were prepared as d e s c r i b e d by Messing et a l . (1981 ). Stocks of d i d e o x y n u c l e o t i d e s (5 mM) and deoxynucleotides (10 mM) were a l i q u o t e d , maintained at -20° C and thawed only once. S i n g l e - s t r a n d e d DNA (1-2 ug) was used f o r dideoxy sequencing as d e s c r i b e d by Sanger et a l . (1977) using both the forward (pTZ190) and r e v e r s e (pEMBL8-) primers s u p p l i e d i n s o l u t i o n (Pharmacia). Reactions contained 7 u l of DNA i n d H 2 o , 1 u l of 10X Hin b u f f e r (66 mM T r i s . C I [pH 7.4], 66 mM M g C l 2 > 165 mM NaCl and 66 mM BME) and 2 u l of the a p p r o p r i a t e primer s o l u t i o n . The mixtures were incubated at 55° C f o r 5 min and an a d d i t i o n a l 5 min at room temperature, at which time 1 u l of 0.1 M DTT, 1 u l of 15 uM d ATP, 1 u l (10 uCi) of [ &~ 3 2P] dATP, NEN, 3.16x103 Ci/mmole) and 1 u l ( 3 u n i t s ) of Klenow DNA polymerase (BRL) were added. Three u l of the mixture was a l i q u o t e d i n t o f o u r tubes c o n t a i n i n g 2 u l of the a p p r o p r i a t e d i d e o x y n u c l e o s i d e t r i p h o s p h a t e /deoxynucleoside t r i p h o s p h a t e mix. Reactions were c a r r i e d out at 30° C. A f t e r i n c u b a t i o n f o r 15 min, 1 u l of c o l d chase n u c l e o t i d e mix c o n t a i n i n g 0.3 mM dNTPs and 0.3 u n i t s of Klenow polymerase was added to each of the four r e a c t i o n tubes and i n c u b a t i o n continued f o r an a d d i t i o n a l 15 min. Reactions were terminated by the a d d i t i o n of 7 u l of stop mix (90$ formamide [BRL], 25 mM EDTA and 0.01$ xylene cyanol and bromophenol blue) and heated at 90° C f o r 3 min p r i o r to e l e c t r o p h o r e s i s . I l l . Sequencing by chemical degradation Twenty ug of the tRNA^ a^^ gene pV4a.5-45, cloned i n the E c o R I / H i n d l l l s i t e of pEMBL8- were t r e a t e d with Aval (40 units,New England B i o l a b s ) . One ug was subjected to e l e c t r o p h o r e s i s on a 0.7$ agarose m i n i - g e l to ensure l i n e a r i z a t i o n of the DNA fragment. The remaining DNA was e n d - l a b e l l e d using the Klenow polymerase (15 units,BRL) with 50 uCi of [CL-32p] d C T p ( 6 o o ci/mmol,NEN) i n the same b u f f e r , as d e s c r i b e d by M a n i a t i s et a l . (1982). The DNA was p r e c i p i t a t e d with 95$ e t h a n o l , d i g e s t e d with EcoRI (40 units,Pharmacia) and analyzed d i r e c t l y on a n a t i v e 5$ p o l y a c r y l a m i d e g e l by e l e c t r o p h o r e s i s . The g e l was subjected to autoradiography f o r 3 min and the 106 bp EcoRI/Aval fragment was excised from the g e l . DNA was recovered from the g e l p i e c e s by soaking i n 0.5 M NH^QAc/10 mM MgOAc at 50° C o v e r n i g h t . The e l u a t e was e x t r a c t e d with an equal volume of phenol/chloroform and p r e c i p i t a t e d with 95$ e t h a n o l . DNA was r e p r e c i p i t a t e d with ethanol i n the presence of 0.25 M NaOAc, washed with 1 ml of 80$ ethanol 26 and d e s i c c a t e d under vacuum. DNA was suspended i n 50 u l of d H 2 ° a n d 1° u l (1.4x10** cpm) was subjected to chemical degradation sequencing as d e s c r i b e d by Maxam and G i l b e r t (1980). Cleavage products were r e s o l v e d on an 8% p o l y a c r y l a m i d e / 7 M urea g e l and subjected to autoradiography. IV. G e l - r e t a r d a t i o n assay Twenty f i v e ug of DNA c o n t a i n i n g the V a l ^ 5«_fiank cloned i n the H i n d l l l s i t e of pEMBL8- was d i g e s t e d with H i n d l l l (90 u n i t s , Pharmacia) and e n d - l a b e l l e d i n the same b u f f e r with 15 u n i t s of Klenow polymerase and 100 uCi (3000 Ci/mmol) [CL-3 2 P ] dATP as d e s c r i b e d by M a n i a t i s et a l . (1982). Products were analyzed by e l e c t r o p h o r e s i s on a n a t i v e 5% p o l y a c r y l a m i d e g e l and subjected to autoradiography f o r 15 seconds. The 185 bp fragment was excised from the g e l , covered with 0.2 M NaCl i n T r i s -EDTA (T.E., 10mM T r i s - C l [pH = 8.0], 1 mM EDTA) and e l u t e d at 55° C o v e r n i g h t . The e l u a t e was run on a NACS PREPAC minicolumn as d e s c r i b e d by the NACS manual (BRL) and the DNA p r e c i p i t a t e d with e t h a n o l . DNA was washed with 80$ e t h a n o l , d e s i c c a t e d under vacuum and suspended i n 20 u l of T.E. Binding r e a c t i o n s (30 mM T r i s -C l [pH= 7 . 9 ] , 120 mM KC1, 0.5 mM M g C l 2 > 0.5 mM DTT) contained 30,000 cpm ("0.5 ng) of l a b e l l e d probe DNA, 1.5 ug of pUC13 or 3 ug of poly dl-dC (Pharmacia) as n o n - s p e c i f i c DNA and between 0.05-0.9 u l of S-100 e x t r a c t i n a t o t a l volume of 20 u l . Reactions were composed on i c e and f o l l o w i n g a 10 min i n c u b a t i o n at 23-5° C, l a b e l l e d DNA was added and i n c u b a t i o n continued f o r 45 min. Two u l of running b u f f e r (50$ g l y c e r o l , 2XTGE, 0.1$ bromophenol blue and xylene cyanol) were added to each and samples were a p p l i e d to a 4$ n a t i v e p o l y a c r y l a m i d e g e l . Samples were e l e c t r o p h o r e s e d i n TGE (50 mM T r i s - C l [pH= 8.5 ], 380 mM g l y c i n e , 2 mM EDTA) as d e s c r i b e d by Singh et a l . (1986 ). The g e l was t r a n s f e r r e d onto Whatman 3MM paper, d r i e d and subjected to autoradiography o v e r n i g h t . V. In v i t r o t r a n s c r i p t i o n and a n a l y s i s of RNA products T r a n s c r i p t i o n r e a c t i o n s (50 u l ) contained 19 mM T r i s - C l [pH = 7.9], 110 mM KC1, 7 mM M g C l 2 > 3 m M D T T , 2.5 ug/ml a -amanitin (Boehringer Mannheim), 6.5 u n i t s / m l c r e a t i n e phosphokinase, 5 mM phosphocreatine, 6 mM ATP, GTP, CTP, 25 uM [CL- 3 2P] OTP (410 Ci/mmol), 5 to 100 ng of template DNA (unless otherwise i n d i c a t e d ) , up to 1 ug of pUC8 or 13 DNA and 25 u l of D r o s o p h i l a Schneider I I S-100 c e l l e x t r a c t , as d e s c r i b e d by Rajput et a l . (1982). Reactions were c a r r i e d out at 23.5° C f o r 90 min (unless otherwise s p e c i f i e d ) and terminated by the a d d i t i o n of 60 u l stop mix (170 ug/ml tRNA [Pharmacia], 0.5$ SDS, 50 mM NaOAc) and 90 u l of d H 2 o . The mixture was e x t r a c t e d with 200 u l of phenol and the aqueous phase p r e c i p i t a t e d with two volumes of 95$ ethanol and 10 u l of 0.04 M ATP. The p e l l e t was d r i e d under vacuum, suspended i n 5 u l of T.E. (pH=7.5), 9 u l running dye (10 M urea, 20 mM T r i s - C l [pH=7.5], 1 mM EDTA, 0.1$ bromophenol blue and xylene cyanol) and heated at 90° C f o r 3 min. Products were analyzed by e l e c t r o p h o r e s i s on 8 $ , 10$ or 15$ p o l y a c r y l a m i d e g e l s c o n t a i n i n g 7 M urea. F o l l o w i n g autoradiography, g e l s l i c e s c o n t a i n i n g r a d i o a c t i v e tRNA bands were excised from the g e l and counted f o r Cerenkov r a d i a t i o n i n order to q u a n t i t a t e the amount of product. VI. C a l c u l a t i o n s and s t a t i s t i c a l a n a l y s i s A l l t r a n s c r i p t i o n s were the r e s u l t of two d i f f e r e n t S-100 e x t r a c t s (unless otherwise s p e c i f i e d ) . C o n t r o l t r a n s c r i p t i o n s were i n c l u d e d i n every experimental run. Values f o r Vmax were d e r i v e d from the c a l c u l a t i o n and p l o t of a l i n e a r r e g r e s s i o n of a Lineweaver-Burke p l o t (1/V vs. 1/S) and expressed r e l a t i v e to Vmax f o r the c o n t r o l f o r that experiment. Vmax values expressed as $ i n c r e a s e or decrease r e l a t i v e to the c o n t r o l f o r each template d e r i v e d from experiments with separate e x t r a c t s were reported as the average between the two e x t r a c t s . VII. L a r g e - s c a l e i s o l a t i o n of plasmid DNA E i t h e r a loop of g l y c e r o l c u l t u r e or a loop of c e l l s from a p l a t e c o n t a i n i n g the pUC or pEMBL plasmid clones was used to i n o c u l a t e 25 mis of 2YT supplemented with 70 ug/ml a m p i c i l l i n (2YT/amp) i n a 100 ml f l a s k and shaken at 3 7 ° C u n t i l the c u l t u r e reached l a t e l o g phase ( A g g 0 = u . 7 ) ; a n 0 f t h i s c u l t u r e was used to i n o c u l a t e 500 ml of 2 YT/amp i n a 2 L f l a s k which was incubated at 3 7 ° C with vigorous shaking u n t i l l a t e log was reached, at which p o i n t 2.5 ml of chloramphenicol (34 mg/ml i n ethanol) was added ( f i n a l c o n c e n t r a t i o n was 170 ug/ml). Incubation was continued with vigorous shaking f o r a f u r t h e r 18 h r s . The a l k a l i l y s i s procedure d e s c r i b e d by M a n i a t i s et a l . (1982) was used to i s o l a t e DNA, with the f o l l o w i n g m o d i f i c a t i o n s . C e l l s were harvested i n a S o r v a l GSA r o t o r at 10,000xg, 4° C, f o r 12 min. Treatment with lysozyme and subsequent l y s i s was c a r r i e d out as d e s c r i b e d , except that the c e l l s were maintained i n 250 ml p l a s t i c b o t t l e s . The l y s a t e was c e n t r i f u g e d i n a S o r v a l GSA r o t o r at 4° C, 13,000xg f o r 20 min and the c l e a r e d l y s a t e t r a n s f e r r e d to two 50 ml polycarbonate tubes. F o l l o w i n g p r e c i p i t a t i o n with i s o p r o p a n o l , the DNA was recovered by c e n t r i f u g a t i o n at 12,000xg i n a S o r v a l SS34 r o t o r f o r 30 min at 23° C. The n u c l e i c a c i d p e l l e t was then washed with 5 ml of 70$ ethanol and f o l l o w i n g b r i e f d e s i c c a t i o n was d i s s o l v e d i n 5.5 ml of T.E. (pH=8.0). CsCl (6.5 g) was added and d i s s o l v e d by gen t l e a g i t a t i o n , followed by the a d d i t i o n of 0.7 ml ethidium bromide (2 mg/ml i n dR " 2 o ) . The i n s o l u b l e m a t e r i a l was removed by a 5 min c e n t r i f u g a t i o n i n a S o r v a l SS34 r o t o r at 6,000xg. The s o l u t i o n of DNA and CsCl was t r a n s f e r r e d to 13.5 ml p o l y a l l o m e r tubes and c e n t r i f u g e d to e q u i l i b r i u m i n a Beckman 70.1 T i r o t o r at 109,000xg, at 8° c f o r 40 h r s . The s u p e r c o i l e d plasmid DNA band was removed, ex t r a c t e d with dH^O-saturated n-butanol and d i a l y z e d against three l o t s of 4 L of T.E. (pH = 7.5) at 4° C f o r 2 h r s . Fo l l o w i n g the d e t e r m i n a t i o n of plasmid c o n c e n t r a t i o n at 0D 2gg (1 0D26Q=50 ug/ml of DNA), 1 ug of DNA was run on a 0 .7$ agarose g e l to assess the degree of s u p e r h e l i c i t y . V I I I . S m a l l - s c a l e i s o l a t i o n of recombinant DNA The a l k a l i - l y s i s method, e s s e n t i a l l y as de s c r i b e d by Ma n i a t i s et a l . (1982), was used to i s o l a t e recombinant plasmid DNA from 2 ml c u l t u r e s . F o l l o w i n g e x t r a c t i o n with phenol/chloroform, the DNA was extracted with 1/2 volume of chlo r o f o r m and 1/2 volume of 7.5 M NH^OAc was added and the DNA s t o r e d on i c e f o r 20 min. The s o l u t i o n was c e n t r i f u g e d i n a microfuge (Eppendorf) f o r 15 min and the p e l l e t d i s c a r d e d . The supernatant was p r e c i p i t a t e d with two volumes of 95$ e t h a n o l , washed with 1 ml 80$ ethanol and d e s i c c a t e d under vacuum. The DNA p e l l e t was then suspended i n an a p p r o p r i a t e volume of the d e s i r e d r e s t r i c t i o n b u f f e r f o r f u r t h e r a n a l y s i s . DNA was t r e a t e d with RNase A (40 ug/ml) at the same time as d i g e s t i o n with r e s t r i c t i o n en zymes. IX. D i g e s t i o n of DNA with r e s t r i c t i o n endonucleases R e s t r i c t i o n endonucleases were obtained from New England B i o l a b s and Pharmacia and were used i n accordance with the manufacturer's s p e c i f i c a t i o n s . In g e n e r a l , 10 u n i t s of r e s t r i c t i o n enzyme per ug of DNA were used and i n c u b a t i o n was f o r 2 hrs at 3 7 ° C (1 u n i t of enzyme a c t i v i t y 31 i s the amount of enzyme r e q u i r e d to completely d i g e s t 1 ug of lambda DNA i n 60 min i n a t o t a l of 50 u l at 3 7 ° C. X. Agarose g e l e l e c t r o p h o r e s i s A l l n a t i v e gels contained TBE b u f f e r (0.089 M T r i s -base, 0.089 M B o r i c A c i d , 0.002 M EDTA); the sample running dye contained 50$ g l y c e r o l , 2xTBE, 0.1$ bromophenol blue and xylene c y a n o l . E i t h e r 0 . 6 $ , 0 . 7 $ , 0 . 8 $ or 1$ agarose gels (Biorad) were used to analyze s u p e r c o i l e d or r e s t r i c t i o n endonuclease t r e a t e d plasmid DNA as w e l l as s i n g l e - s t r a n d e d DNA. M i n i - g e l s were oast on 5 cm x 7.5 cm g l a s s s l i d e s and contained 0.001$ ethidium bromide ( E t B r ) . The g e l s were subjected to e l e c t r o p h o r e s i s at 60 mA, with constant c u r r e n t . XI. P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s Native p o l y a c r y l a m i d e g e l s (17 cm x 23 cm or 14 cm x 18 cm), e i t h e r 4$, 5$, 6 $ , 7$ or 8$, were prepared from a stock s o l u t i o n of 45$ p o l y a c r y l a m i d e (43.5$ aorylamide:1.5$ N,N'-methylene-bis-aorylamide). TBE b u f f e r (as above), 0.05$ ammonium p e r s u l f a t e (w/v) and 0.1$ (v/v) TEMED (Biorad) were used i n a l l these g e l s . DNA samples were ele c t r o p h o r e s e d at 200 v o l t s , constant v o l t a g e and the g e l was s t a i n e d i n 0.1$ EtBr i n TBE f o r 15 min p r i o r to viewing with a UV t r a n s i l l u m i n a t o r . Denaturing po l y a c r y l a m i d e gels (8$, 10$ or 15$ p o l y a c r y l a m i d e c o n t a i n i n g 7 M urea) were used f o r a n a l y s i s 32 of t r a n s c r i p t i o n products. C o n d i t i o n s f o r g e l p r e p a r a t i o n were as d e s c r i b e d above except that the TBE b u f f e r contained 0.05 M T r i s - b a s e , 0.05 M b o r i c a c i d and 0.001 M EDTA. Products were run at 600 v o l t s , constant v o l t a g e f o r 1.5 hrs and tRNA bands detected by autoradiography at -70° C. For DNA sequencing g e l s (20 cm x 44 cm), 3 u l of denatured samples were loaded onto the w e l l s of e i t h e r 6$, 8$ or 10$ gels c o n t a i n i n g 7 M urea. C o n d i t i o n s f o r the p r e p a r a t i o n of gels were as d e s c r i b e d f o r t r a n s c r i p t i o n g e l s , except that the running dye contained 90$ formamide (BRL), 25 mM EDTA and 0.1$ bromophenol blue and xylene c y a n o l ; g e l s were run at 1700 v o l t s , at constant v o l t a g e . Native p o l y a c r y l a m i d e , denaturing p o l y a c r y l a m i d e and DNA sequencing g e l s were 1.5 mm, 0.75 mm and 0.4 mm i n t h i c k n e s s , r e s p e c t i v e l y . X I I . I s o l a t i o n of DNA from agarose gels R e s t r i c t i o n fragments were recovered from 0.6$, 0.7$ or 0.8$ agarose m i n i - g e l s by e l e c t r o p h o r e s i s of the d e s i r e d band onto an ion-exchange D E A E - n i t r o c e l l u l o s e membrane (NA45, S c h l e i c h e r and S c h u e l l ) , which had been placed i n f r o n t of the l e a d i n g edge of the band. NA45 membranes were a c t i v a t e d as d e s c r i b e d i n the S c h l e i c h e r and S c h u e l l manual. The membrane was placed i n a 1.5 ml Eppendorf tube, covered with 500 u l of 1 M NaCl i n T.E. (pH=7.5) and the DNA e l u t e d from the membrane at 55° C f o r 30 min. The s o l u t i o n was e x t r a c t e d onoe with dH-0-washed n-butanol to remove EtBr and 33 p r e c i p i t a t e d with two volumes of 95% e t h a n o l . The sample was washed with 1 ml 70$ ethanol and d r i e d under vacuum. DNA was suspended i n dH 2 o and an a l i q u o t eleotrophoresed on an agarose m i n i - g e l to assess the c o n c e n t r a t i o n of recovered DNA. X I I I . I s o l a t i o n of DNA from p o l y a c r y l a m i d e gels F o l l o w i n g d i g e s t i o n and e l e c t r o p h o r e s i s of DNA fragments, p o l y a c r y l a m i d e gels were s t a i n e d by EtBr and g e l s l i c e s c o n t a i n i n g the d e s i r e d DNA fragment were excised from the g e l . Gel s l i c e s were cut up and placed i n t o 1.5 ml Eppendorf tubes and covered with 0.2 M NaCl i n T.E. (pH=7.2). The tubes were then placed at 50° C f o r 16 hrs and the el u a t e c o n t a i n i n g the d e s i r e d DNA fragment was removed and p u r i f i e d on NACS PREPAC (BRL) ion-exchange m i n i -columns. Procedures f o r b i n d i n g , e l u t i o n and p r e c i p i t a t i o n of DNA were as de s c r i b e d i n the NACS A p p l i c a t i o n s Manual (BRL). XIV. Treatment of DNA with exonuolease BAL-31 To c r e a t e a s e r i e s of d e l e t i o n s i n the 5 ' - f l a n k i n g sequences of the tRNA S e r* 7 gene, a 750 bp Ec o R I / H i n d l l l fragment c o n t a i n i n g the gene, 5' and 3 ' - f l a n k i n g sequences was i s o l a t e d from the pEMBL8- vecto r and r e s o l v e d on a k% p o l y a c r y l a m i d e g e l . The DNA was eluted and p u r i f i e d on a NACS mini-column. An a l i q u o t of the fragment was analyzed by e l e c t r o p h o r e s i s on a 0.7$ agarose m i n i - g e l to assess recovery and y i e l d . Approximately 8 ug of the 750 bp fragment was i n turn d i g e s t e d with Hhal (80 u n i t s ) and the products r e s o l v e d on a 5$ p o l y a c r y l a m i d e g e l . The 391 bp fragment c o n t a i n i n g the gene, 125 bp of 5 ' - f l a n k i n g sequence and 185 bp of 3'-f l a n k i n g sequence was excised from the g e l , the DNA elu t e d and p u r i f i e d on a NACS mini-column. An a l i q u o t of the fragment was analyzed by e l e c t r o p h o r e s i s on a 1$ agarose m i n i - g e l to assess recovery and y i e l d . Approximately 1 ug of the 391 bp fragment was t r e a t e d with 1 u n i t of BAL-31 i n a t o t a l volume of 50 u l at 30° C i n each of three separate tubes. Reactions were terminated a f t e r 0.5, 1.0 and 1.5 min by the a d d i t i o n of 50 u l of dH 2 o and 100 u l of phenol/chloroform. The DNA was p r e c i p i t a t e d with 95$ ethanol i n the presence of 2.5 M NH^OAc and the p e l l e t washed with 1 ml of 80$ eth a n o l . The d r i e d p e l l e t s were suspended i n 20 u l of dH 2 o and l a b e l l e d with Klenow polymerase i n the presence of u n l a b e l l e d dCTP, dGTP, TTP and 10 uCi of C d - 3 2 P ] d ATP (see s e o t i o n XV). Reactions were analyzed by e l e c t r o p h o r e s i s on a 5$ n a t i v e polyacrylamide g e l with the a p p r o p r i a t e DNA s i z e c o n t r o l ( i . e . the same 391 bp fragment l a b e l l e d , but not t r e a t e d with exonuclease) and subjected to autoradiography f o r 3 h r s . Areas of the g e l corresponding to fragments ranging i n s i z e between 390 and 260 bp were el u t e d from the g e l (see s e c t i o n M) and p u r i f i e d on a NACS mini-column. Fragments were subsequently cloned 35 i n t o the Smal s i t e of pEMBL8- and used to transform E. o o l i NM522. D e l e t i o n end-points recovered from t h i s BAL-31 s e r i e s contained at l e a s t 117 bp of 5 ' - f l a n k i n g undeleted DNA. In order to c r e a t e a more extensive s e r i e s of d e l e t i o n s in the 5'-flank of the t R N A S e r 7 gene, a d e l e t i o n clone c o n t a i n i n g 119 bp of 5 ' - f l a n k i n g sequence and 184 bp of 3 1-f l a n k i n g DNA was d i g e s t e d with EcoRI and H i n d l l l and the i n s e r t p u r i f i e d from a 5% p o l y a c r y l a m i d e g e l as d e s c r i b e d above. Approximately 4 ug of i n s e r t DNA were t r e a t e d with 2 u n i t s of BAL-31 i n a t o t a l volume of 40 u l at 30° C. A l i q u o t s were removed from the r e a c t i o n at 0.5, 1.0, 1.5 and 2.0 min and r e a c t i o n s terminated as p r e v i o u s l y d e s c r i b e d . A l l f u r t h e r manipulations were as o u t l i n e d above. XV. E n d - l a b e l l i n g and f i l l - i n r e a c t i o n s of DNA The Klenow fragment of E. o o l i DNA polymerase was used to l a b e l and f i l l - i n 5'extended ends generated by d i g e s t i o n of r e s t r i c t i o n endonucleases or exonuclease BAL-31-Reactions were c a r r i e d out i n a t o t a l of 30 u l at 25° C i n Hin b u f f e r and contained 1.5 u l of the a p p r o p r i a t e dNTPs (2 mM stock) and 1-3 u l (10-30 uCi) of [C1- 3 2P] dATP or [ C l - 3 2 P ] dCTP as w e l l as 3 u n i t s of Klenow (BRL) enzyme. The u n l a b e l l e d dNTP was omitted from the r e a c t i o n c o n t a i n i n g the l a b e l l e d dNTP. Reactions were c a r r i e d out f o r 20 min at which time 1.5 u l of the remaining absent u n l a b e l l e d dNTPs 36 were added and the r e a c t i o n continued f o r a f u r t h e r 5 min before t e r m i n a t i o n . XVI. Autoradiography Gels c o n t a i n i n g r a d i o a c t i v e l y l a b e l l e d DNA or RNA were covered with a l a y e r of p l a s t i c (Saran Wrap) and subjected to autoradiography using 3M H i L i t e X-Ray f i l m . Native and denaturing gels were placed at 4° C and -70° C r e s p e c t i v e l y . DNA sequencing g e l s and g e l s c o n t a i n i n g bound p r o t e i n s were d r i e d onto Whatman 3MM chromatography paper using a Biorad Slab Gel d r i e r Model 1125B p r i o r to autoradiography at room temperature. Exposure times f o r t r a n s c r i p t i o n and sequencing g e l s were f o r 14-18 hrs and the X-Ray f i l m was developed according to the manufacturer's s p e c i f i c a t i o n s . XVII. L i g a t i o n of DNA fragments A. BAL-31 d e l e t i o n s e r i e s The v e c t o r pEMBL8- (Dente et a l . , 1 983) (5 ug i n 30 u l ) was d i g e s t e d with 20 u n i t s of Smal f o r 2 hrs at 37° C and the DNA p u r i f i e d on a NACS oolumn. An a l i q u o t was eleotrophoresed on a 0.7% agarose g e l to assess l i n e a r i z a t i o n and DNA y i e l d . Vector DNA was suspended i n dH 2o to a f i n a l c o n c e n t r a t i o n of 0.1 ug/ul and stored at -20° C. The amount of l a b e l l e d i n s e r t DNA recovered f o l l o w i n g p u r i f i c a t i o n on NACS had to be approximated. L i g a t i o n r e a c t i o n s were c a r r i e d out i n a t o t a l volume of 15 u l c o n t a i n i n g 50 mM T r i s - C l (pH=7.8), 10 mM MgCl 1 5 37 mM DTT, 0.5 mM ATP and 50 ug/ml BSA. The t o t a l amount of DNA i n the r e a c t i o n was "0.2 ug at a 2:1 molar r a t i o of vec t o r to i n s e r t . Four u n i t s of T^ DNA l i g a s e (BRL) and 0.2 u n i t s of Tjj RNA l i g a s e (Pharmacia) were added to each l i g a t i o n r e a c t i o n and r e a c t i o n s were incubated at 16° C f o r 16 hrs . B. pV4a.5-45 The Valjj d e l e t i o n end-point pV4a.5-45 (185 bp) had been p r e v i o u s l y cloned i n the Smal s i t e of pUC8 along with two s i m i l a r - s i z e d fragments of pBR322 (present at the H i n d l l l s i t e 3' to the gene; S a j j a d i , 1985). To l i b e r a t e the pBR322 sequences, 8 ug of t h i s c o n s t r u c t were d i g e s t e d with 80 u n i t s of H i n d l l l at 37° C f o r 2 hrs and el e c t r o p h o r e s e d on a 0.6$ agarose g e l . The l a r g e s t fragment c o n t a i n i n g the pUC8 vector and the V a l ^ i n s e r t was i s o l a t e d and p u r i f i e d from the g e l as d e s c r i b e d i n s e c t i o n XII except that the DNA was f u r t h e r p u r i f i e d on a NACS column. An a l i q u o t was analyzed by e l e c t r o p h o r e s i s on a 0.6$ agarose g e l to assess the amount of DNA recovered. The DNA was r e c i r c u l a r i z e d at the H i n d l l l s i t e by l i g a t i o n as de s c r i b e d i n s e c t i o n XVII.A, except that T^ RNA l i g a s e was omitted from the r e a c t i o n . To c l o n e the 185 bp pV4a.5-45 fragment i n pEMBL8-, 20 ug of the pUC8 vecto r h arboring the d e l e t i o n were di g e s t e d with 200 u n i t s of EcoRI and H i n d l l l . The products were a p p l i e d d i r e c t l y to a 6$ po l y a c r y l a m i d e g e l and separated by e l e c t r o p h o r e s i s . The l i b e r a t e d fragment was excised and p u r i f i e d as de s c r i b e d i n s e c t i o n X I I I . Vector DNA was 38 prepared by digestion of 8 ug of p EMBL8- with EooRI and H i n d l l l and electrophoresis on a 0.6$ agarose gel to l i b e r a t e the multiple cloning s i t e . The vector was excised from the gel and p u r i f i e d as described in section XII. Aliquots of p u r i f i e d insert and vector were analyzed by electrophoresis on a 1$ agarose gel to estimate DNA y i e l d . Ligation reactions were as described above. C. tRNA V a l, [ 5'-flank A construct ( g i f t of D. Horvath) in the vector pUC8 was used as the source for the Val^ 5'-flank (179 bp plus 2 nucleotides of the s t r u c t u r a l gene) whioh had been isolated and cloned using H i n d l l l l i n k e r s . Since the sequences at the 3 1 end of the 5'-flank had not been characterized, the 5'-flank was reoloned in a separate vector. 5 ug of pEMBL8-were digested with H i n d l l l and p u r i f i e d as described in XVII.A. 15 ug of the pUC8 construct were digested with H i n d l l l and the 5*-flank resolved by electrophoresis on a 5% polyacrylamide g e l . The insert was excised and p u r i f i e d on a NACS column as previously described. Aliquots of vector and insert were electrophoresed on a 1$ agarose gel prior to l i g a t i o n as described in XVII.B. D. pVUa.5-138 p EMBL8- was digested with EcoRI and H i n d l l l and p u r i f i e d as described in XVII.B. The Val^ deletion end-point A5'-138 (276 bp) had previously been cloned in the Smal s i t e of pUC8 (Sajjadi, 1985) along with pBR322 sequences. The pOC8 clone containing this construct (30 ug) was d i g e s t e d with 100 u n i t s of EcoRI and H i n d l l l at 37° C f o r 2 hrs and analyzed on an Q% p o l y a c r y l a m i d e g e l by e l e c t r o p h o r e s i s to separate the i n s e r t from pUC8 and the pBR322 fragment (338 bp). The 276 bp fragment was excised and p u r i f i e d on a NACS column. Vector and i n s e r t were l i g a t e d as d e s c r i b e d i n XVII.B. The pV^a.5-138 cloned i n pTZ19U was c o n s t r u c t e d i n s i m i l a r f a s h i o n . Vector pTZ190 (4 ug, USB) was d i g e s t e d with EcoRI and H i n d l l l and p u r i f i e d as d e s c r i b e d i n XVII.B. D e l e t i o n end-point pV4a.5-138 was used as i n s e r t i n c l o n i n g as o u t l i n e above. S i n g l e and double p o i n t mutants i n the 5'-flank of V a l ^ which had been cre a t e d i n pTZ19U were subcloned back i n t o the E c o R I / H i n d l l l s i t e of pEMBL8- as d e s c r i b e d above. XVIII. Transformation of E. o o l i s t r a i n s JM83 and NM522 The procedure d e s c r i b e d by M a n i a t i s et a l . (1982) was used, except that c e l l s were grown i n 2YT medium and only 1/4 the volume of c e l l s (25 ml) was t r e a t e d with C a C l 2 / T r i s -C l (pH=8.0). A l l subsequent volumes were adjusted to account f o r the decreased number of c e l l s . E i t h e r 1 hr or 16 hr C a C l ^ - t r e a t e d competent c e l l s were transformed with the e n t i r e volume of the l i g a t i o n mix which had been d i l u t e d f i v e - f o l d . C e l l s were heat-shocked and f o l l o w i n g the a d d i t i o n of 1 ml 2YT media, were incubated at 37° C f o r 1 hr to allow expression of a m p i c i l l i n r e s i s t a n c e before p l a t i n g . 40 Fo l l o w i n g i n o u b a t i o n , 90 u l of the transformant c e l l suspension was p l a t e d on 2YT/amp p l a t e s with 50 u l of 2$ X-g a l (Sigma) (plus 10 u l of 100 mM IPTG f o r NM522 c e l l s only) and incubated overnight at 37° C. White c o l o n i e s c a r r y i n g recombinant plasmids were picked and grown i n 2 ml of 2YT/amp media at 37° C with vigorous a e r a t i o n f o r plasmid s c r e e n i n g . Recombinants were stored at -70° C i n v i a l s c o n t a i n i n g 4 ml of 2YT/amp, 20$ g l y c e r o l ( v / v ) . XIX. Screening of recombinant clones White c o l o n i e s c o n t a i n i n g recombinant pUC8, pEMBL8- or pTZ19U clones were used to i n o c u l a t e 2 ml 2YT/amp f o r s m a l l -s c a l e plasmid p r e p a r a t i o n as o u t l i n e d i n s e c t i o n H. Plasmid DNA was suspended i n 20 u l of d H 2 o . One h a l f the amount was used f o r r e s t r i c t i o n a n a l y s i s and the remainder was stored at -20° C. Reactions were normally c a r r i e d out i n a t o t a l volume of 30 u l c o n t a i n i n g the a p p r o p r i a t e r e s t r i c t i o n b u f f e r and 40 ug of RNase A. The BAL-31 d e l e t i o n s e r i e s was screened by r e s t r i c t i o n of clones with EcoRI and H i n d l l l and e l e c t r o p h o r e s i s of products on a 7$ p o l y a c r y l a m i d e g e l with H i n f l d i g e s t e d pBR322 as molecular s i z e markers. The pUC8 clone c o n t a i n i n g the pV4a.5-45, was d i g e s t e d with H i n d l l l and run on a 0.6$ agarose g e l . Reclones of pV4a.5-45 were d i g e s t e d with EcoRI and H i n d l l l and run on 6$ po l y a c r y l a m i d e g e l s . The V a l ^ 5'-flank was i s o l a t e d from the H i n d l l l s i t e of pUC8 on an 8$ p o l y a c r y l a m i d e g e l as were the r e c l o n e s i n pEMBL8-. A l l recombinants c a r r y i n g the V a l ^ pV4a.5-138 or p o i n t mutants i n p EMBL8- or pTZ19U were d i g e s t e d w i t h EcoRI and H i n d l l l and e l e c t r o p h o r e s e d on 5% p o l y a c r y l a m i d e g e l s t o r e l e a s e t h e i r i n s e r t s . 42 RESULTS I. C o n s t r u c t i o n of recombinant plasmids A. Subcloning of pV4a.5-45 The plasmid used f o r s u b c l o n i n g was a d e r i v a t i v e of plasmid pDt55-0.3. pDt55-0.3 contained a 317 bp D r o s o p h i l a i n s e r t coding f o r tRNA V a l J t cloned i n t o the H i n d l l l s i t e of pBR322 i n both o r i e n t a t i o n s (Rajput et a l . , 1982). This plasmid was a d e r i v a t i v e of pDt55, which contained two i d e n t i c a l t R N A V a l j j genes (from 70 BC on the l e f t arm of chromosome 3) 525 bp apart and i n opposite p o l a r i t y (Dunn et a l . , 1979: Addison et a l . , 1982). A number of plasmids with d e l e t i o n s i n the S'-flank were cre a t e d i n the 692 bp EcoRI/BamHI fragment of pDt55-0.3 and cloned i n t o the Smal s i t e of pUC8 ( V i e i r a and Messing, 1982). The 3'-flank of the V a l ^ gene was p r o t e c t e d from the exonuclease a c t i v i t y of BAL-31 by the 346 bp Hindlll/BamHI fragment of pBR322 from pDt55-0.3- The d e l e t i o n s e r i e s gave r i s e to a number of mutants i n c l u d i n g plasmids pV4a.5-45 and pV4a.5-138 (F i g u r e 1) used i n t h i s study ( S a j j a d i , 1985). During the a n a l y s i s of pV4a.5-45, t h i s clone was found to c o n t a i n two DNA fragments. The plasmid c o n t a i n i n g the pV4a.5-45 double i n s e r t was d i g e s t e d with H i n d l l l and f o l l o w i n g p u r i f i c a t i o n of v e c t o r and d e s i r e d i n s e r t from the sequences present at the 3' end of the gene, the plasmid was r e c i r c u l a r i z e d and used to transform E. c o l i JM83. Plasmid 43 F i g u r e 1_ R e s t r i c t i o n maps of V a l ^ ^ ' - I S S and pV4a.5-138 A- The f i g u r e shows a BAL-31 d e l e t i o n d e r i v a t i v e of pDt55-0.3. The EcoRI/BamHI fragment c o n t a i n i n g the gene encoding t R N A V a ^ ( t h i c k band; 73 bp) 138 bp of 5 ' - f l a n k i n g sequence and 65 bp of 3 ' - f l a n k i n g sequence was subcloned i n the Smal s i t e of pUC8 along with 338 bp of pBR322. B- The 276 bp fragment from A was subcloned i n t o the E c o R I / H i n d l l l s i t e of p EMBL8- to generate pV4a.5-138. This c o n s t r u c t was used f o r s i t e - s p e c i f i c mutagenesis i n t h i s study. ^ 7 6 b p p V 4 a . 5 . 1 3 8 4 - 3K6 45 DNA was i s o l a t e d and screened by d i g e s t i o n with EcoRI and H i n d l l l . A l l nine c o l o n i e s picked contained a s i n g l e 185 bp i n s e r t i n plasmid pUC8. Double-stranded DNA from one colony was prepared and sequenced. The sequence demonstrated the presence of a s i n g l e V a l ^ d e l e t i o n pV4a.5-45. Plasmid DNA was prepared and t r a n s c r i b e d and was found to have a Vmax 36$ higher than pV4a.5-179 ( S a j j a d i et a l . , 1987). For s i t e - s p e c i f i c mutagenesis of the sequence TCGCT i n pV4a.5-45, the 185 bp fragment was i s o l a t e d by d i g e s t i o n with EcoRI and H i n d l l l and subcloned i n t o E c o R I / H i n d l l l - c u t pEMBL8- which can be used to generate s i n g l e - s t r a n d e d plasmid DNA (Dente et a l . , 1983). Ten transformants of pV4a.5-45 i n pEMBL8- were picked randomly from p l a t e s , each c o n t a i n i n g "200 transformants and i n o c u l a t e d i n t o 2 mis of 2YT/amp. Mini-prep plasmid DNA, prepared from these c u l t u r e s as d e s c r i b e d i n M a t e r i a l s and Methods, was d i g e s t e d with EcoRI and H i n d l l l and analyzed on a 6% p o l y a c r y l a m i d e g e l by e l e c t r o p h o r e s i s . A l l clones contained the c o r r e c t i n s e r t . S i n g l e - s t r a n d e d plasmid DNA was prepared from one clone and the i n s e r t was sequenced i n i t s e n t i r e t y u s ing the r e v e r s e primer (Pharmacia) to confirm the clone as pV4a.5-45 i n pEMBL8-. B. Subcloning of pV4a.5-138 The pV4a.5-138 clone (276 bp) c o n t a i n i n g a 338 bp pBR322 fragment i n the Smal s i t e of pUC8 ( S a j j a d i , 1985) (Figure 1 ) was d i g e s t e d with EcoRI and H i n d l l l and the 276 bp fragment c o n t a i n i n g the tRNA gene was i s o l a t e d a f t e r 46 s e p a r a t i o n on an 6% p o l y a c r y l a m i d e g e l . The E c o R I / H i n d l l l fragment was cloned i n t o pEMBL8- as o u t l i n e d above. Ten transformants were screened by d i g e s t i o n of t h e i r plasmid DNA with EcoRI and H i n d l l l and e l e c t r o p h o r e s i s on an 8% p o l y a c r y l a m i d e g e l . Eight of the clones c a r r i e d the 276 bp fragment, while two clones contained both the 276 bp and 338 bp fragments. Two of the clones with the 276 bp fragment were sequenced i n t h e i r e n t i r e t y to show that they contained pV4a.5-138 i n pEMBL8-. In a d d i t i o n , the combination of pUC8 vector and 5 ' - f l a n k i n g sequences had r e c r e a t e d the Smal s i t e i n these c o n s t r u c t s ( F i g u r e 1). The l i g a t i o n of the 276 bp E c o R I / H i n d l l l fragment i n t o the E c o R I / H i n d l l l s i t e of the s i n g l e - s t r a n d e d plasmid pTZ19U (USB) was c a r r i e d out as d e s c r i b e d f o r the pEMBL8- v e c t o r . Four clones were sequenced completely, except that the forward primer was used i n sequencing. A l l clones were found to c o n t a i n the pV4a.5-138 i n s e r t . C. Subcloning of the pV4a.-179 5'-flank In a previous study a s e r i e s of 3 1 d e l e t i o n s gave r i s e to c l o n e s i n the v e c t o r pUC8 which contained the i n t a c t V a^4 gene and 179 bp of 5 ' - f l a n k i n g sequence, but lacked the 3 ' - f l a n k i n g r e g i o n (data not p r e s e n t e d ) . One 3' d e l e t i o n was f u r t h e r extended to p o s i t i o n +2 by D. Horvath (personal communication). The +2 d e l e t i o n was c r e a t e d i n pUC8 with H i n d l l l l i n k e r s . However, the c o n s t r u c t c o n t a i n i n g the 5'-f l a n k i n pUC8 was found to c o n t a i n extraneous DNA sequences which could not be i d e n t i f i e d (data not shown). In order to 47 i s o l a t e the 5'-flank of the tRNA^al^ gene, the + 2 d e l e t i o n was d i g e s t e d with H i n d l l l and the i n s e r t i s o l a t e d and p u r i f i e d . The 5'-flank fragment was then subcloned i n t o the H i n d l l l s i t e of pEMBL8-. I s o l a t e d plasmid DNA from twelve white c o l o n i e s were screened by d i g e s t i o n with H i n d l l l and ten were found to c o n t a i n the 5'-flank alone. S i n g l e -stranded DNA was i s o l a t e d from two p o s i t i v e clones and used f o r sequencing the e n t i r e i n s e r t with the r e v e r s e primer. The sequence confirmed the presence of the i s o l a t e d 5'-flank of t R N A V a l M g e n e ( F i g u r e 2 ) . D. Subcloning of the t R N A S e r > 7 g e n e a n q 5 1 - f i a n k i n g d e l e t i o n  d e r i v a t i v e s A P v u I I / C l a l fragment c o n t a i n i n g the t R N A S e r 7 g e n e (81 bp), "420 bp of 5'-flank and 200 bp of 3 ' - f l a n k i n g sequences had been cloned i n t o the Smal s i t e of pEMBL8- to generate pS5#1 (D. S t . L o u i s , p e r s o n a l communication). To remove some of the 5 ' - f l a n k i n g sequences, the Hhal s i t e at p o s i t i o n -125 r e l a t i v e to the mature coding sequence could be used to d e l e t e "300 bp of 5 ' - f l a n k i n g sequence. However, due to the presence of a l a r g e number of Hhal s i t e s i n pEMBL8, a fragment c o n t a i n i n g the Ser^ gene was f i r s t subcloned i n d i r e c t l y as f o l l o w s . The E c o R I / H i n d l l l fragment ("750 bp) c o n t a i n i n g the e n t i r e D r o s o p h i l a DNA i n pS5#1 was i s o l a t e d from the v e c t o r and p u r i f i e d . Next, the i s o l a t e d fragment was d i g e s t e d with Hhal (a second Hhal s i t e i s at 48 F i g u r e 2 The DNA sequence of i s o l a t e d 5 ' - f l a n k i n g r e g i o n of pV4a.5-179 The DNA sequence was determined as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 r e p r e s e n t the se q u e n c i n g r e a c t i o n s w i t h the r e v e r s e p r i m e r s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The j u n c t i o n between the v e c t o r and 5 ' - f l a n k i s marked by an arrow and the DNA sequence i s shown on the s i d e of the a u t o r a d i o g r a m . A- Sequence of the 5' j u n c t i o n of V a l ^ 5 ' - f i a n k ( p o s i t i o n -179, non-coding s t r a n d ) . B- Sequence of the 3 1 j u n o t i o n of Valjj 5 ' - f l a n k ( p o s i t i o n +2, non-coding s t r a n d ) . 49 p o s i t i o n +272) and the fragments were separated on a 5% p o l y a c r y l a m i d e g e l . The d i g e s t r e s u l t e d i n the i s o l a t i o n of a 391 bp Hhal fragment c o n t a i n i n g the gene, 125 bp of 5'-f l a n k i n g sequence and 185 bp of 3 ' - f l a n k i n g sequence, a "295 bp EcoRI/Hhal fragment and a ~65 bp H h a l / H i n d l l l fragment. The 391 bp Hhal fragment was recovered from the g e l and f o l l o w i n g a l i m i t e d BAL-31 exonuclease treatment and s e p a r a t i o n on a polyaorylamide g e l , the d e l e t e d fragments were cloned i n t o the Smal s i t e of pEMBL8. Plasmid DNA was prepared from 24 white c o l o n i e s and screened by d i g e s t i o n with EcoRI and H i n d l l l and eleotrophoresed with H i n f l - o u t pBR322 s i z e markers. I n s e r t s contained i n these clones d i d not appear to have been d e l e t e d to a great extent. F i v e c o l o n i e s were sequenced i n t h e i r e n t i r e t y and none was d e l e t e d more than 6 bp i n the 5 ' - f l a n k . I n t e r e s t i n g l y , the 3'-flank of these c o n s t r u c t s was not d e l e t e d beyond p o s i t i o n +266, i n d i c a t i n g that only the sequences from the m u l t i p l e c l o n i n g s i t e of pEMBL had been removed. T h e r e f o r e , only two clones were obtained from t h i s d e l e t i o n s e r i e s : pS7a.5-123F and pS7a.5-119R (F i g u r e 3) (F and R r e f e r to the o r i e n t a t i o n of the i n s e r t : i n the R p o s i t i o n , the 5* end of the coding strand of the gene i s c l o s e s t to the reverse sequencing priming s i t e ) . To extend the 5 ' - f l a n k i n g d e l e t i o n s e r i e s c l o s e r to the t R N A S e r ^ gene, the D r o s o p h i l a i n s e r t contained i n pS7a.5-119 was i s o l a t e d a f t e r d i g e s t i o n of plasmid DNA with EcoRI and H i n d l l l and was subjected to f u r t h e r exonuclease a c t i o n F i g u r e 1 The DNA sequences of pS7a.5-119 (A) and pS7a.5-31 (B) The DNA sequences were determined as d e s o r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 r e p r e s e n t the sequenoing r e a c t i o n s w i t h the r e v e r s e p r i m e r s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The j u n c t i o n between the v e c t o r and 5 ' - f l a n k i s marked by an arrow and the DNA sequence i s shown on the s i d e of the a u t o r a d i o g r a m s . B 53 by BAL-31. This scheme would prevent the migration of deleted fragments from the vector into the areas of gel containing deleted, liberated insert molecules had a di f f e r e n t approach involving Bal-31 deletion of lin e a r plasmids been adopted. The smearing was a s i g n i f i c a n t problem since the deleted vector molecules contaminating the deleted insert fragments were cloned in preference to the ins e r t , thus reducing the cloning e f f i c i e n c y of the desired fragments. Deleted fragments were cloned into the Smal s i t e of pEMBL8- and used to transform E. c o l i NM522. Forty white colonies were screened as described in Materials and Methods (Figure 4). Clones which appeared to contain deleted insert were sequenced in their entirety. The following deletion end-points were obtained: pS7a.5-98R, pS7a.5-31F and R (Figure 3), pS7a.5-26F, pS7a.5-24R and pS7a.5-l8F (Figure 5). A l l clones were found to retain 184 bp of 3'-flanking sequence. I I . S i t e - s p e c i f i c mutagenesis A. pV4a.5-45 The pV4a.5-45 clone in pEMBL8- was used for oligonucleotide-directed mutagenesis (Zoller and Smith, 1984; Kunkel, 1985) using a 17mer oligonucleotide containing a single mismatch with the template. Three factors were found to influence mutagenesis e f f i c i e n c y . F i r s t , the standard 16 hr primer extension was found to result in few or no transformant colonies. Extension reaction times were 54 F i g u r e k Screening of d e l e t i o n mutants A 7% p o l y a c r y l a m i d e g e l c o n t a i n i n g 12 cloned d e l e t i o n d e r i v a t i v e s of pS7a.5-119 i s shown. F o l l o w i n g m i n i -prep i s o l a t i o n of plasmid DNAs and d i g e s t i o n with EcoRI and H i n d l l l , products were eleotrophoresed along with 2 ug of H i n f l cut pBR322 (H). U l 56 Figure 5. The DNA sequences of pS7a.5-24 (A) and pS7a.5-l8 (B) The DNA sequences were determined as described in Materials and Methods. Lanes 1-4 represent the sequencing reactions with the reverse primer s p e c i f i c for C, T, A and G respectively. The junction between the vector and 5'-flank is marked by an arrow and the DNA sequence i s shown on the side of the autoradiograms. The non-coding strand of deletion end-point -18 was sequenced. 57 shortened as d e s c r i b e d i n M a t e r i a l s and Methods. Second, the commercial source of Klenow polymerase and DNA l i g a s e were found to i n f l u e n c e the recovery of transformant c o l o n i e s . Another group had found t h e i r source of DNA l i g a s e r e s p o n s i b l e f o r decreased f r e q u e n c i e s of transformants (Naumovski and F e i n b e r g , 1986). S e v e r a l commercial sources of Klenow and DNA l i g a s e were tes t e d to f i n d the source r e s u l t i n g i n the best t r a n s f o r m a t i o n f r e q u e n c i e s . F i n a l l y , a 12 bp r e g i o n i n the f1 o r i g i n of r e p l i c a t i o n of p EMBL8- was found to h y b r i d i z e to the mutagenic o l i g o n u c l e o t i d e . This became apparent by the appearance of a secondary sequence when the mutagenic o l i g o n u c l e o t i d e was used as a primer f o r sequence a n a l y s i s on the pV4a.5-45 template. In a d d i t i o n , a t e s t of priming to the secondary h y b r i d i z a t i o n s i t e was c a r r i e d out by primer extension of both s i n g l e - s t r a n d e d pVUa.5-U5 and M13K07 helper phage (1 hr at 25° C) and e l e c t r o p h o r e s i s of r e a c t i o n products on a 0.7$ agarose g e l . The extension of h y b r i d i z e d primer would convert the template to double-stranded form which would migrate to a d i f f e r e n t p o s i t i o n on the g e l from s i n g l e - s t r a n d e d template. I t was found that both the clone and the helper phage s i n g l e -stranded DNA were primed and retarded on the g e l (data not shown). De s p i t e the apparent primer extension from the secondary h y b r i d i z a t i o n s i t e , mutagenesis of the pV4a.5-45 clone r e s u l t e d i n the appearance of very few c o l o n i e s per p l a t e . E l e v e n c o l o n i e s w e r e s e q u e n c e d w i t h t h e r e v e r s e p r i m e r t o o b t a i n t w o m u t a t e d c l o n e s . D i d e o x y s e q u e n c e a n a l y s i s o f t h e m u t a n t c l o n e s h o w e d a T t o G t r a n s v e r s i o n a s a c o m p r e s s i o n i n t h e s e q u e n c e GGGCGCT w h i c h h a d r e s u l t e d f r o m t h e c o n t r i b u t i o n o f a G - C r i c h s e q u e n c e a t t h e c l o n i n g s i t e o f p V 4 a . 5 - 4 5 . T h e s e q u e n c e c o m p r e s s i o n w a s r e s o l v e d b y M a x a m a n d G i l b e r t c h e m i c a l s e q u e n c i n g a s d e s c r i b e d i n M a t e r i a l s a n d M e t h o d s ( F i g u r e 6 ) . B . p V 4 a . 5 - 1 3 8 T h e p V 4 a . 5 - 1 3 8 c l o n e i n p E M B L 8 - w a s u s e d f o r o l i g o n u c l e o t i d e d i r e c t e d m u t a g e n e s i s o f ~ 3 8 - p c G C T " 3 4 i n i t s 5 ' - f l a n k u s i n g a n I 8 m e r m i x e d o l i g o n u c l e o t i d e . A s i n s e c t i o n I I . A . v e r y f e w t r a n s f o r m a n t c o l o n i e s w e r e o b t a i n e d a n d o f t h e 15 c l o n e s s e q u e n c e d , t w o w e r e f o u n d t o h a v e s i n g l e p o i n t m u t a t i o n s . O n l y a T t o G t r a n s v e r s i o n a t p o s i t i o n - 3 8 w a s r e c o v e r e d . N e i t h e r o f t h e s e m u t a n t s s h o w e d s e q u e n c e c o m p r e s s i o n i n t h e - 3 8 r e g i o n w h e n c o m p a r e d t o p V 4 a . 5 - 4 5 ( F i g u r e s 6 a n d 7 ) . T h e e x t e n s i o n o f r e v e r s e p r i m e r a n d m u t a g e n i c o l i g o n u c l e o t i d e s i n p E M B L 8 - o c c u r r e d i n c l o s e p r o x i m i t y t o t h e f 1 o r i g i n o f r e p l i c a t i o n ( t h e s i t e o f s e c o n d a r y h y b r i d i z a t i o n i d e n t i f i e d i n s e c t i o n A ) w h i c h i m p e d e d s e c o n d s t r a n d s y n t h e s i s . B e c a u s e s i n g l e - s t r a n d e d DNA i s v e r y i n e f f i c i e n t a s a s u b s t r a t e f o r t r a n s f o r m a t i o n , i t w a s r e a s o n e d t h a t p r i m e r e x t e n s i o n a w a y f r o m t h e s e c o n d a r y h y b r i d i z a t i o n s i t e w o u l d r e s u l t i n p l a s m i d m o l e c u l e s w i t h a m o r e e x t e n s i v e d o u b l e - s t r a n d e d r e g i o n a n d h e n c e a F i g u r e J5 The DNA sequence of pV4a . 5-45 ,-38G The DNA sequenoes were determined as d e s c r i b e d i n M a t e r i a l s and Methods. A- Lanes 1-4 represent the dideoxy sequencing r e a c t i o n s with the r e v e r s e primer s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequence compression i s marked by an arrow and the DNA sequence i s shown on the s i d e of the autorad iogram. B- Lanes 1-4 represent the Maxam and G i l b e r t sequencing r e a o t i o n s s p e c i f i c f o r C, C+T, A+G and G r e s p e c t i v e l y . The DNA sequence i s shown on the s i d e of the autoradiogram. The sequenoe reads i n the 3' to 5* d i r e c t i o n . 61 F i g u r e X The DNA sequences of pV4a.5-138 (A) and pV4a.5-138.-38G (B) The DNA sequences were determined as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 represent the sequencing r e a c t i o n s with the r e v e r s e primer s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequences of wild type and mutant TNNCTs are shown on the s i d e of the autoradiograms. The band corresponding to p o s i t i o n -38 are i n d i c a t e d by a dot on the autoradiogram. 63 64 g r e a t e r t r a n s f o r m a t i o n e f f i c i e n c y . S ince the s i t e of secondary h y b r i d i z a t i o n showed homology with sequences between p o s i t i o n s -42 and -27 i n the 5'-flank of t R NA V a l 1 | gene, i t was not p o s s i b l e to s h i f t e f f e c t i v e l y the priming s i t e of the mutagenic o l i g o n u c l e o t i d e e i t h e r 3 1 or 5' to 3^TCGCT~ 3 i* i n order to minimize homology with the second s i t e at the f1 o r i g i n of r e p l i c a t i o n . The E c o R I / H i n d l l l i n s e r t contained i n pV4a.5-138 i n pEMBL8- was t h e r e f o r e subcloned i n t o the E c o R I / H i n d l l l s i t e of pTZ19U. Due to the o r i e n t a t i o n of the i n s e r t i n pTZ190, the mutagenic primer could be extended i n the d i r e c t i o n away from the f1 o r i g i n of r e p l i c a t i o n . S i t e - s p e c i f i c mutagenesis was c a r r i e d out on pV4a.5-138 i n pTZ19U with the mixed o l i g o n u c l e o t i d e . Dideoxy sequence a n a l y s i s of e i g h t clones with the forward primer re v e a l e d two s i n g l e p o i n t mutants, both having a T to G t r a n s v e r s i o n at p o s i t i o n -38. Thus, a mutagenic bia s appeared to e x i s t with the mixed o l i g o n u c l e o t i d e and other mixed o l i g o n u c l e o t i d e s were not used i n l a t e r mutagenesis experiments. The mutated D r o s o p h i l a DNA from pTZ19U was not subcloned i n pEMBL8- p r i o r to t r a n s c r i p t i o n a n a l y s i s s i n c e the -38G mutant had a l r e a d y been created i n pEMBL8-. A 33% mutagenesis e f f i c i e n c y was achieved f o r recovery of the double-mutant "^GCGAT - 3 1* (2 of 6 t r a n s f ormants sequenced) ( F i g u r e 8 ). A second 19mer mutagenic o l i g o n u c l e o t i d e was used to produce the double-mutant ~ 3 8GCGGT - 3 1* using the -^GCGCT - 3 1* mutant as template ( F i g u r e F i g u r e 8 The DNA sequences of pV4a.5-138,-38G,-35A (A) and pV4a.5-138,-38G.-35G (B) The DNA sequences were determined as de s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 represent the sequencing r e a c t i o n s with the r e v e r s e primer s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequenoes of mutant TNNCTs are shown on the s i d e of the autoradiograms. The bands corresponding to p o s i t i o n s -38 and -35 are i n d i c a t e d by dots on the autoradiograms. 8). A l l other point mutants were generated with the wild type template. A 21mer oligonucleotide was used to create ~ 3 8TCGAT~ 3 1* with a 50$ mutagenesis frequency (Figure 9). For the creation of ~ 3 > 3TAGCT~ 3^, _ 3 8TCTCT~ 3 1 1 and TCGCA"^^ 22mer oligonucleotides were used, each of which resulted in an e f f i c i e n c y of 75$ mutants. This more closely r e f l e c t e d the e f f i c i e n c i e s expected from this procedure (Kunkel, 1985). A l l mutants were subcloned into the pEMBL8- vector and resequenced to ensure presence of the expected mutations in the 5'-flank (Figures 9 and 10). Since the longer length of mutagenic oligonucleotides had resulted in higher mutation frequencies, a 32 nucleotide mutagenic primer was used to create three nucleotide changes in the sequence + 29TGCCT + 3 3 i n pV4a.5-138 (Figure 11) and pV4a.5-138,-38G.-35A (Figure 12) contained in pEMBL8-. The oligonucleotide was found not to hybridize to sequences contained in the vector. Single-stranded template DNA of two transformants from pV4a.5-138 and two from pV4a.5-138, -38G,-35A were sequenced with the reverse primer. One half the clones recovered were found to contain the three nucleotide changes desired ( + 29AGCGC + 3 3) between the D and T control regions (Figure 13). F i g u r e 9. The DNA sequences of pV4a . 5-1 38 ,-34A (A) and pVUa.5-138,-35A (B) The DNA sequences were determined as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 represent the sequencing r e a c t i o n s with the r e v e r s e primer s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequences of mutant TNNCTs are shown on the s i d e of the autoradiograms. The bands corresponding to p o s i t i o n s -34 and -35 are i n d i c a t e d by dots on the autoradiograms. 69 r e 10 The DNA sequences of pV4a.5-138,-36T (A) and pV4a.5-138,-37A (B) The DNA sequenoes were determined as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 r e p r e s e n t the sequencing r e a c t i o n s w i t h the r e v e r s e p r i m e r s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequences of mutant TNNCTs are shown on the s i d e of the a u t o r a d i o g r a m s . The bands c o r r e s p o n d i n g t o p o s i t i o n s -36 and -37 are i n d i c a t e d by a dot on the a u t o r a d i o g r a m s . 71 F i g u r e 11 The DNA sequences of pV4a.5-138 wild type (A) and pVUa.5-138,+29A,+32G,+33C (B) The DNA sequences were determined as des c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 represent the sequencing r e a c t i o n s with the r e v e r s e primer s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequences of wi l d type and mutant i n t e r n a l TNNCTs are shown on the s i d e of the autoradiograms. Arrow heads mark the p o s i t i o n of TNNCT i n the 5 ' - f l a n k . The bands corresponding to p o s i t i o n s +29 are i n d i c a t e d by a dot on the autoradiograms. F i g u r e 12 The DNA sequences of pV4a.5-138,-38G,-35A (A) and pV4a.5-138,-38G,-35A,+29A,+32G,+33C (B) The DNA sequences were determined as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4 represent the sequencing r e a c t i o n s with the r e v e r s e primer s p e c i f i c f o r C, T, A and G r e s p e c t i v e l y . The sequences of wild type and mutant i n t e r n a l TNNCTs are shown on the s i d e of the autoradiograms. Arrow heads mark the p o s i t i o n of -38G.-35A i n the 5' - f l a n k . The bands corresponding to p o s i t i o n +29 are i n d i c a t e d by a dot on the autoradiograms. 75 76 F i g u r e 13 The sequence of pV4a. Sequence of the non-coding strand of pV4a. i s shown to p o s i t i o n -140. The 3 ' - f l a n k i n g r e g i o n f o l l o w i n g poly T t e r m i n a t i o n s i g n a l i s not shown. The sequence AGTTG i s u n d e r l i n e d and the TNNCTs are double u n d e r l i n e d . The f i r s t n u c l e o t i d e of the mature tRNA V a l 1 J gene, the D and T c o n t r o l sequences are i n bold l e t t e r s . The n u c l e o t i d e sequence of t R N A V a l j j arranged as a c l o v e r l e a f i s shown below the sequence. 77 "^ ^TTGGGTCTCCTTGAAACATTTCCCATAAAAATCACTCAAATAGATACAATA~9° o Q ~ TACGATTTTATTCAAGCAACCAGTTTTATTTTTGACCCTTGGCAGTTGAGG"3^ T ft " 3 TCGCTGAAGTTGGCCTCTCTGCCGCTTAAGTTTCAACTGTTTCCGTGGTGT+13 1 i i AGCGGTTATCACATCTGCCTAACACGCAGAAGGCCCCCGGTTCGATCCCGG+61* ' 6 5GCGGAAACAGGTGATAAACTTTTTTTTTAGTTTTT + 1 19 A O H 7 6 C A P G • C P U • A U • A 70 Um-.A 5 C • G C • G 60 u 10 >? ' U G G G C C U - , A r G A 1 0 U V ^ V V G ^ - V..nm'G C C C G G c G GUG C 5 0 C G CAC 5 5 ° U A U " A A G ^ 20 * • A C • G U • A 30 G * C 4 0 C • G Cm m5C U A I A C 35 78 I I I . T r a n s c r i p t i o n of mutant TNNCTs and d e l e t i o n  d e r i v a t i v e s i n a D r o s o p h i l a (Schneider I I ) o e l l - f r e e e x t r a c t A. 5 ' - f l a n k i n g TNNCT mutants Point mutants i n the 5'-flank of t R N A V a 1 ^ genes were t r a n s c r i b e d in_ v i t r o i n a homologous Schneider II S-100 c e l l - f r e e e x t r a c t as d e s c r i b e d i n M a t e r i a l s and Methods. In a l l t r a n s c r i p t i o n s pUC8 or pUC13 DNA was added to a t o t a l of 1 ug per r e a c t i o n to counter an i n h i b i t o r reported to be present (St. Louis and Spiegelman, 1985; S a j j a d i , 1985). Fo l l o w i n g a 90 min r e a c t i o n time, the product was separated from the r e a c t i o n mix on p o l y a c r y l a m i d e g e l s and the amount of t r a n s c r i p t i o n product determined by Cerenkov counting the a p p r o p r i a t e g e l s l i c e s . Values corresponding to the v e l o c i t y of t r a n s c r i p t i o n (V= cpm of product per 90 min r e a c t i o n time= r a t e of r e a c t i o n ) were c o r r e c t e d to cpm per hour and analyzed by the method of St. Louis and Spiegelman (1985). The method assumes that the k i n e t i c s of t r a n s c r i p t i o n conform to those of a c l a s s i c one s u b s t r a t e enzyme r e a c t i o n and can be analyzed by the Lineweaver-Burke method. The r e c i p r o c a l of the values f o r v e l o c i t y of the r e a c t i o n and s u b s t r a t e input (S= ug of template DNA) were p l o t t e d and the Vmax was d e r i v e d by l i n e a r - r e g r e s s i o n of 1/V vs 1/S data. To counter day to day v a r i a t i o n s , t r a n s c r i p t i o n of the mutant templates was compared to t r a n s c r i p t i o n of pV4a.5-45 or pV4a.5-138 performed i n p a r a l l e l . 79 The values f o r Vmax were expressed as percent i n c r e a s e or decrease of the value of Vmax f o r pV4a.5-45 or pV4a.5-138 t r a n s c r i b e d on the same day. Each template c o n t a i n i n g the mutant TNNCT sequences was t r a n s c r i b e d with two d i f f e r e n t a c t i v e S-100 c e l l - f r e e e x t r a c t s to t e s t the v a r i a b i l i t y i n t r a n s c r i p t i o n e f f i c i e n c y between d i f f e r e n t S-100 pr e p a r a t i o n s ( S a j j a d i , 1985). However, the percent i n c r e a s e or decrease i n Vmax, when compared to the wild type gene, f o r a l l p o i n t mutants was n e a r l y the same i n a l l e x t r a c t s . The percent i n c r e a s e or decrease i n Vmax f o r each TNNCT mutant was c a l c u l a t e d and the average of the two values from the two d i f f e r e n t e x t r a c t s was reported (Table 1). An example of the d o u b l e - r e c i p r o c a l p l o t obtained with data from the t r a n s c r i p t i o n s of pV4a.5-138 and pV4a.5-138, -38G,-35A i s presented i n F i g u r e 14-B. The Vmax could be estimated g r a p h i c a l l y from the i n t e r c e p t s . However, they were c a l c u l a t e d n u m e r i c a l l y from the i n t e r c e p t s of l e a s t squares l i n e s d e s c r i b i n g the data. F i g u r e 15 shows 12-point input t r a n s c r i p t i o n s ranging from 3 to 150 ng of DNA f o r pV4a.5-45,-38G and i t s c o n t r o l . The Vmax f o r the t r a n s v e r s i o n was decreased 10$. In c o n t r a s t to pV4a.5-45,-38G, the -38G mutation i n pV4a.5-138 ( F i g u r e 16) r e s u l t e d i n a 28.2$ decrease i n Vmax. Point mutants at the other conserved n u c l e o t i d e s of TNNCT (-34A and -35A) r e s u l t e d i n a s l i g h t l y g r e a t e r drop i n Vmax than f o r -38G (Table 1; F i g u r e s 17 and 18). Double p o i n t mutants d i s p l a y e d the lowest template a c t i v i t i e s with a decreased 80 F i g u r e 1 4 A Autoradiogram of p r o d u c t s from the t r a n s c r i p t i o n of pV4a.5-138 ( w i l d t y p e ) and pV4a.5-138,-38G, -35A Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 (wild type) and pV4a.5-138,-38G,-35A are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on polyacrylamide gels as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 show the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. B Double r e c i p r o c a l p l o t of data from t r a n s c r i p t i o n of pV4a.5-138 (wild type) (A) and pV4a.5-138,-38G,-35A (•) Gel s l i c e s corresponding to t r a n s c r i p t i o n products were excised and the amount of product was determined by Cerenkov c o u n t i n g . The data were p l o t t e d as 1/V (V= cpm of t r a n s c r i p t / h r of r e a c t i o n ) versus 1/S (S= mass of template i n ug). The l i n e s were d e r i v e d by the method of l e a s t squares with c o e f f i c i e n t s of 0.998 f o r pV4a.5-138 wild type (A) and 0.999 f o r pV4a.5-138,-38G.-35A (•). wild-type 1 2 3 4 5 6 7 8 9 10 -38G;-35A 1 2 3 4 5 6 7 8 9 10 83 Table ± Vmax values f o r S ' - f l a n k i n g TNNCT mutants Template $ change i n Vmax pV4a.5-45 - 3 8 T C G C T - 3 J 4 " GCGCT ^ 10.0$ pV4a.5-138 - 3 8 T C G C T ~ 3 4 (wild type) n GCGCT ^ 28.2$ n TCGAT | 32.0$ ii TCGCA | 32.8$ ti GCGGT 4 38.0$ n GCGAT 4r 42.0$ it TCTCT | 1 .1$* it TAGCT f 12.6$ Vmax was c a l c u l a t e d from data obtained from ten or twelve p o i n t DNA input t r a n s c r i p t i o n experiments f o r each of the mutants and i s expressed as percent i n c r e a s e or decrease over the value f o r pV4a.5-45 or pV4a.5-138 t r a n s c r i b e d i n p a r a l l e l . Vmax values are the average of determinations using two d i f f e r e n t S-100 e x t r a c t s except f o r *. 84 F i g u r e 15 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-45 and pV4a.5-45,-38G Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-45 and pV4a.5-45,-38 G are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a o t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on po l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-12 show the t r a n s c r i p t i o n products of 3 , 5, 7, 10, 15, 18, 25, 40, 50, 6 6 . 7 , 100 and 150 ng of template DNA. CM CD co CO 52 co CO lO co C\J CM LO <f i LO CO > a. 9 CO h -(0 LO »* CO CM F i g u r e 16 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pVUa.5-138,-38G Autoradiograms r e p r e s e n t i n g the e l e o t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-38G are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on p o l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 show the t r a n s c r i p t i o n products of 5, 10, 15, 20, 25, 33, 40, 50, 6 6 . 7 and 100 ng of template DNA. 87 r e 17 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,-35A Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-35A are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on polyaorylamide g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 show the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 6 6 . 7 , 84 and 100 ng of template DNA. 89 F i g u r e 18 Autoradiogram of p r o d u c t s from the t r a n s o r i p t i o n of pV4a.5-138 and pV4a.5-138,-34A Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-34A are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on p o l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 show the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. pV4a.5-138 " 3 4 A 5 6 7 8 9 10 1 2 3 4 5 6 re 19 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,-38G,-35G Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-38G,-35G are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a o t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on p o l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 show the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. o LO co i O 00 CO CO CO N -CD LD "* CO CM CO CO I ID rrj > a o CO CO N CO LD CO CM F i g u r e 20 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,-36T Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-36T are shown. T r a n s c r i p t i o n s were c a r r i e d out u s i n g a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on po l y a c r y l a m i d e gels as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 show the t r a n s o r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. pV4a.5-138 -36T 5 6 7 8 9 10 1 2 3 4 5 6 96 Vmax of 38$ and 42% (Table 1;Figures 19 and 14A). However, a mutation at p o s i t i o n N36 l e d to only a 1.1% decrease i n Vmax (F i g u r e 20). The n u c l e o t i d e change at p o s i t i o n N37 r e s u l t e d i n a 12.6% i n c r e a s e i n Vmax r e l a t i v e to pV4a.5-138 ( F i g u r e 21). There f o r e the r e s u l t s showed a sequence of the form TNNCT to be r e s p o n s i b l e f o r the modulation of t r a n s c r i p t i o n i n pV4a.5-138, but the mechanism of t h i s modulation remained to be determined. B. I n t e r n a l TNNCT mutants The t R N A V a l j j clone contained TNNCT sequences i n the 5 ' - f l a n k i n g r e g i o n as w e l l as i n the mature coding sequence ( F i g u r e 13). Since TNNCT was found to modulate t r a n s c r i p t i o n from the 5 ' - f l a n k i n g r e g i o n of the gene, the TNNCT i n the stem/loop r e g i o n of pV4a.5-138 was a l s o mutated to determine i t s e f f e c t on t r a n s c r i p t i o n . The template c o n t a i n i n g the i n t e r n a l TNNCT mutant was found to t r a n s c r i b e at a 46.4% lower e f f i c i e n c y than pV4a.5-138 (Table 2 ) . T h i s may have been i n part due to the abundance of what appeared to be p a r t i a l t r a n s c r i p t i o n products on the g e l (Fi g u r e 22) s i n c e only the mature l e n g t h t r a n s c r i p t s were q u a n t i t a t e d by Cerenkov co u n t i n g . The template mutant i n both i n t e r n a l and 5 ' - f l a n k i n g TNNCTs had a t r a n s c r i p t i o n e f f i c i e n c y 54.3% lower than pV4a.5-138 (Table 2 ) . Although p a r t i a l t r a n s c r i p t s were a l s o present f o r the double TNNCT mutant ( F i g u r e 23), the lowered a c t i v i t y d i d not allow t h e i r easy d e t e c t i o n by autoradiography. F i g u r e 21 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and p V4a.5-138,-37A Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-37A are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on po l y a c r y l a m i d e gels as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 rep r e s e n t the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. pV4a.5-138 -37A 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 CX> F i g u r e 22 Autoradlogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,+29A,+32G,+33C Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,+29A,+32G,+33C are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on p o l y a c r y l a m i d e g e l s as des c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 represent the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. CO N (£> if) 101 Table 2 Vmax values f o r i n t e r n a l TNNCT mutants Template % change i n Vmax pV4a. 5 -138 ~ 3 8TCGCT" 3 2 t + 2 9 T G C C T + 3 3 " " AGCGC + 46.4$ " GCGAT AGCGC +54 . 3 $ Vmax was c a l c u l a t e d from data obtained from ten po i n t DNA input t r a n s c r i p t i o n experiments f o r each of the mutants and i s expressed as percent i n c r e a s e or decrease over the value f o r pV4a.5-138 t r a n s c r i b e d i n p a r a l l e l . 102 F i g u r e 23 Autoradiogram of products from the t r a n s c r i p t i o n of pV4a.5-138 and pV4a.5-138,-38G,-35A,+29A,+32G + 33C Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 and pV4a.5-138,-38G, -35A, +29A, +32G, +33C are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n produots were analyzed on polyacrylamide gels as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 repr e s e n t the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50, 66.7, 84 and 100 ng of template DNA. 103 F i g u r e 24 The sequence of pS7a. Sequence of the non-coding strand of pS7a. i s shown to p o s i t i o n -130. The 3 ' - f l a n k i n g r e g i o n f o l l o w i n g the poly T t e r m i n a t i o n s i g n a l i s not shown. The sequence AGTTG i s u n d e r l i n e d and the i n t e r n a l TNNCTs are double u n d e r l i n e d . The f i r s t mature n u c l e o t i d e of the tRNA „ gene and the D and T c o n t r o l sequences are i n bold l e t t e r s . 105 CTTGGCGCTCAAATTCAAGTAACACACACATGCAGTGTTGTCAAATGAGCA-80 AGGTTCCGAAATGTGTGTTCAGTCTTGGATTCTCCCATGCAATCAACATTA" 29  GTTGCC AATTTGCCGTGTC ATACC AAC AGC AGTCGTGGCCGAGCGGTTAAG"1*23 GCGTCTGACTAGAAATC AGATTCCCTCTGGGAGCGTAGGTTCGAATCCTAC + ^^ CGACTGCGAGAAGGTTTACGGATTTTTTTTATTTTT + 1 1 0 C. D e l e t i o n mutants In c o n t r a s t to the tRNA 1^ 1^ gene which appeared to modulate i t s t r a n s c r i p t i o n by the sequence TNNCT, the t R N A S e r 7 ^ n e contained i n pS7a.5-125 (F i g u r e 24) d i r e c t e d t r a n s c r i p t i o n i n the absence of a TNNCT i n the 5 ' - f l a n k i n g r e g i o n . Therefore a number of d e l e t i o n mutants were created i n pS7a.5-125 to d e f i n e the sequences r e s p o n s i b l e f o r i t s e f f i c i e n t t r a n s c r i p t i o n . For t r a n s c r i p t i o n of the 5 1-f l a n k i n g d e l e t i o n s e r i e s i n pS7a.5-125, the values f o r Vmax were expressed as the percent i n c r e a s e or decrease of the Vmax value f o r pS7a.5-119 (Table 3 ) . D e l e t i o n of sequences to p o s i t i o n -31 d i d not reduce the l e v e l of t r a n s c r i p t i o n and r e s u l t e d i n a small i n c r e a s e (8.2$) i n Vmax (Figure 25). D e l e t i o n of an a d d i t i o n a l seven n u c l e o t i d e s to p o s i t i o n -24 r e l a t i v e to the mature coding sequence reduced the Vmax 57.1$ r e l a t i v e to the c o n t r o l ( F i g u r e 26). D e l e t i o n end-po i n t -24 r e s u l t e d i n the removal of the sequence "^AGTTG" 2 5 which was a l s o present i n the 5'-flank of pV4a.5-138 and a t R N A A r s gene. Furt h e r d e l e t i o n of 5 ' - f l a n k i n g sequences to p o s i t i o n -18 s e v e r e l y decreased the l e v e l of t r a n s c r i p t i o n (Table 3) (81.5$ decrease i n Vmax) as shown i n Fi g u r e 27. 107 Table 3_ Vmax values f o r 5 ' - f l a n k i n g d e l e t i o n mutants of pS7a.5-119 Template % change i n Vmax pS7a.5-119 pS7a.5-31 t 8.2$ pS7a.5-24 ^57.1$ pS7a.5-l8 |81.5$ Vmax was c a l c u l a t e d from data obtained from ten po i n t DNA input t r a n s c r i p t i o n experiments f o r each of the mutants and i s expressed as percent i n c r e a s e or decrease over the value f o r pS7a.5-119 t r a n s c r i b e d on p a r a l l e l . F i g u r e 25 Autoradiogram of products from the t r a n s c r i p t i o n of pS7a.5-119 and pS7a.5-31 Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pS7a.5-119 and pS7a.5-31 are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on po l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 represent the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33 , 40, 50, 66.7, 84 and 100 ng of template DNA. pS7a.5-119 pS7a.5-31 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 110 F i g u r e 26 Autoradiogram of products from the t r a n s o r i p t i o n of pS7a.5-119 and pS7a.5-24 Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pS7a.5-119 and pS7a.5-2U are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on po l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 represent the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33 , 40, 50, 66.7, 84 and 100 ng of template DNA. pS7a. 5-119 pS7a.5-24 5 6 7 8 9 10 1 2 3 4 5 6 7 re 27 Autoradiogram of products from the t r a n s c r i p t i o n of pS7a.5-119 and pS7a.5-l8 Autoradiograms r e p r e s e n t i n g the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pS7a.5-119 and pS7a.5-l8 are shown. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on po l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-10 represent the t r a n s c r i p t i o n products of 10, 15, 20, 25, 33, 40, 50 , 66.7, 84 and 100 ng of template DNA. 113 114 IV. Gel r e t a r d a t i o n assay and t r a n s c r i p t i o n competition with  i s o l a t e d 5'-flank of pV4a.5-179 In an attempt to d e f i n e TNNCT f u n c t i o n and i t s importance i n d i r e c t i n g e f f i c i e n t t r a n s c r i p t i o n , the f o l l o w i n g experiments were c a r r i e d out. A. Gel r e t a r d a t i o n Gel r e t a r d a t i o n has been used as a t o o l f o r d e t e c t i o n of p r o t e i n f a c t o r s which bind s p e c i f i c a l l y to sequences in v o l v e d i n promoter and enhancer f u n c t i o n of v a r i o u s v i r a l and e u k a r y o t i c genes (Kovesdi et a l . , 1986; Jones et a l . , 1987). Since one p o s s i b l e mechanism f o r the f u n c t i o n of modulatory sequences of tRNA genes could i n v o l v e the i n t e r a c t i o n of t r a n s c r i p t i o n f a c t o r s with 5 ' - f l a n k i n g sequences, a g e l r e t a r d a t i o n assay was used to d e t e c t b i n d i n g to the i s o l a t e d 5'-flank of pV4a.5-179. To determine whether t r a n s c r i p t i o n f a c t o r ( s ) i n t e r a c t e d with the 5'-flank of the t R N A 7 3 1 ^ gene, the H i n d l l l fragment c o n t a i n i n g 179 bp of 5 ' - f l a n k i n g sequence i n pEMBL8- was i s o l a t e d and l a b e l l e d with dATP using Klenow polymerase at both ends as d e s c r i b e d i n M a t e r i a l s and Methods. The l a b e l l e d probe was then used i n a g e l r e t a r d a t i o n assay as o u t l i n e d i n M a t e r i a l s and Methods. F i g u r e 28 shows an autoradiogram of the g e l of pV4a.5-179 5'-flank used as probe a f t e r i n c u b a t i o n with i n c r e a s i n g amounts of S-100 e x t r a c t . The c o n t r o l i n t h i s experiment was the l a b e l l e d 5'-flank (lane 1, F i g u r e 28) which migrated a l o n g s i d e the unbound probe i n r e a c t i o n s c o n t a i n i n g S-100 115 F i g u r e 28 Gel r e t a r d a t i o n assay The f i g u r e shows g e l r e t a r d a t i o n of l a b e l l e d probe (179 bp Valjj 5 '-flank) with i n c r e a s i n g amounts of S-100 e x t r a c t . Each lane c o n t a i n s 30,000 cpm of 5' - f l a n k . Lanes 1-8 c o n t a i n 1.56 ug of pUC13 DNA as competitor Lanes 8-14 c o n t a i n 3 ug of poly dl-dC DNA as competitor Lane 1 = no S-100 Lanes 2&9 = 0. 05 u l S- 100 Lanes 3&10 = 0 . 1 u l S- 100 Lanes 4&11 = 0 .3 u l S- 100 Lanes 5&12 = 0 .5 u l S- 100 Lanes 6&13 = 0 .7 u l S- 100 Lanes 7&14 = 0 .9 u l S- 100 Lane 8 = 0.9 u l S-100, with both pOC 13 and p o l y dl-dC DNA Binding r e a c t i o n s were performed as d e s c r i b e d i n M a t e r i a l s and Methods. Products were eleotrophoresed on a k% p o l y a c r y l a m i d e g e l c o n t a i n i n g TGE. The g e l was d r i e d p r i o r to autoradiography. F = f r e e probe; B = bound probe; W = p o s i t i o n of w e l l 4~W 4-F e x t r a c t . Previous r e s u l t s had shown that no r e t a r d a t i o n was detected when the probe was incubated i n the e x t r a c t without the a d d i t i o n of n o n - s p e c i f i c competitor DNA (data not shown). In t h i s experiment, p r o t e i n i n t e r a c t i o n was not detected when pUC DNA (normally r e q u i r e d f o r e f f i c i e n t t r a n s c r i p t i o n in_ v i t r o ) was used as competitor DNA ( F i g u r e 28, lanes 2-7). However, a s i n g l e r e t a r d e d band was observed when poly dl-dC was used as n o n - s p e c i f i c competitor DNA ( F i g u r e 28, lanes 9-14). As l i t t l e as 0.1 u l of S-100 was r e q u i r e d to d e t e c t b i n d i n g a c t i v i t y . I t became evident that a nuclease a c t i v i t y was present i n the S-100 e x t r a c t which r e s u l t e d i n the degradation of l a b e l l e d probe, as seen i n lanes 2-7 i n F i g u r e 28. T h i s nuclease a c t i v i t y was diminished when poly dl-dC was used as n o n - s p e c i f i c DNA i n the assay. However, when i n c r e a s i n g amounts of e x t r a c t were added to r e a c t i o n s c o n t a i n i n g poly dl-dC, more f r e e probe became degraded due to i n c r e a s i n g l e v e l s of nuclease a c t i v i t y (lanes 9-14, F i g u r e 28). When both poly dl-dC and pUC DNA were present ( F i g u r e 28, lane 8), the f r e e probe was p r o t e c t e d , but no retarded band was observed. Therefore i t appears that pUC DNA competes very s u c c e s s f u l l y f o r the p r o t e i n which, i n i t s absence, binds to the l a b e l l e d 5'-flank of the tRNA template. On the other hand, poly dl-dC d i d not compete with the template f o r the S-100 t r a n s c r i p t i o n f a c t o r ( s ) . In a separate experiment b i n d i n g of p r o t e i n was s t i l l d e t e c t a b l e even when up to 30 ug of poly dl-dC was i n c l u d e d i n an assay c o n t a i n i n g 0.7 u l of S-100 e x t r a c t (data not shown). B. T r a n s c r i p t i o n competition between the tRNA V a l | [ 5 ' - f i a n k  and pV4a.5-138 I t was reasoned that i f the f a c t o r b i n d i n g to the 5 ' -f l a n k of pV4a.5-179 was r e q u i r e d f o r d i r e c t i n g e f f i c i e n t t r a n s c r i p t i o n , then i t might be p o s s i b l e to remove the t r a n s c r i p t i o n f a c t o r ( s ) from the template c o n t a i n i n g a tRNA gene by the a d d i t i o n of i n c r e a s i n g amounts of plasmid DNA c o n t a i n i n g the t R N A V a l 4 5 ' - f l a n k . The pV4a.5-179 5 ' - f l a n k i n pEMBL8- was used as competitor f o r the t r a n s c r i p t i o n of 0.01 ug of pV4a.5-138. Competition experiments were c a r r i e d out by the a d d i t i o n of 0 to 1 . 2 ug of competitor DNA e i t h e r s i m u l t a n e o u s l y or to preformed (40 min) s t a b l e complexes ( F i g u r e 2 9 , lanes 7-10). A l l t r a n s o r i p t i o n r e a c t i o n s contained pUC13 DNA to a t o t a l of 1 . 2 ug per r e a c t i o n except f o r the r e a c t i o n c o n t a i n i n g 1 . 2 ug of 5 ' - f l a n k (lane 6 , F i g u r e 2 9 ) . Reactions were c a r r i e d out f o r 90 min before t e r m i n a t i o n . Products were analyzed on a polyacrylamide g e l and f o l l o w i n g autoradiography, the amount of product from each r e a c t i o n wa3 determined as d e s c r i b e d i n M a t e r i a l s and Methods . Results i n d i c a t e d no change i n the l e v e l of pV4a.5-138 t r a n s c r i p t i o n r e g a r d l e s s of whether competitor DNA was added si m u l t a n e o u s l y with the pV4a.5-138 gene or a f t e r preformed complexes of pV4a.5-138. Therefore the t R N A V a 1 ^ 5 ' - f l a n k was unable to compete f o r f a c t o r ( s ) i n tRNA^ a^. 119 F i g u r e 29 T r a n s c r i p t i o n competition between the V a l ^ 5'-flank and pV4a.5-138 The autoradiogram shows the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 used i n a competition assay with the V a l . 5'-flank contained i n p EMBL8 -. A l l lanes contained 0.01 ug of pV4a.5-138 s e r v i n g as template DNA. Lanes 147 = 0 ug competitor DNA ( V a l ^ 5 ' -f l a n k ) n 2&8 = 0.4" " " ii 3&9 = 0.6" " " n 4&10 = 0 . 8 " " " it 5&6 = 1.0 and 1.2 ug competitor DNA r e s p e c t i v e l y n 2-6 = competitor and pV4a.5-138 DNAs added si m u l t a n e o u s l y it 8-10 = competitor DNA added f o l l o w i n g the formation of a 40 min s t a b l e complex of pV4a.5-138. A l l r e a c t i o n s contained pUC13 DNA to a t o t a l of 1.2 ug per r e a o t i o n , exoept f o r lane 6, to which no pUC DNA was added. o o o CD 1 0 CO e g t r a n s c r i p t i o n , when i s o l a t e d from i t s gene. Results obtained from the g e l r e t a r d a t i o n experiment ( s e c t i o n A) and from the t r a n s c r i p t i o n c o m petition suggested that while the S-100 e x t r a c t contained a p r o t e i n capable of b i n d i n g to the 5'-flank of pVUa. 5-179 and pUC DNA, the f a c t o r d i d not appear to be r e q u i r e d f o r t r a n s c r i p t i o n . T h e r e f o r e , i t was u n l i k e l y that the 5'-flank sequestered t r a n s c r i p t i o n f a c t o r ( s ) e s s e n t i a l f o r e f f i c i e n t t r a n s c r i p t i o n , at l e a s t i n the absence of D and T c o n t r o l r e g i o n s . I t may be that pUC DNA had a g r e a t e r a f f i n i t y f o r the f a c t o r than the i s o l a t e d 5 * - f l a n k . However, the pUC DNA was absent i n one of the t r a n s c r i p t i o n competition r e a c t i o n s (lane 6, F i g u r e 29) and i n t h i s r e a c t i o n the 5'-flank of the t R N A V a ^ gene completely lacked c o m p e t i t i v e a b i l i t y , which i n d i c a t e d that i t was not b i n d i n g a f a c t o r r e q u i r e d f o r t r a n s c r i p t i o n . V. T r a n s c r i p t i o n competition between pV4a.5-138,-38G,-35A  and pS7a.5-119 Competition experiments have p r e v i o u s l y been used to compare the the a b i l i t y of v a r i o u s templates i n b i n d i n g t r a n s c r i p t i o n f a c t o r s f o r s t a b l e complex formation and i n the e f f i c i e n c y of d i r e c t i n g t r a n s c r i p t i o n (Dingermann et a l . , 1983; Johnson-Burke et a l . , 1983; Fuhrman et a l . , 1984; Johnson-Burke and S o i l , 1985; L o f q u i s t and Sharp, 1986). The f o l l o w i n g experiments were c a r r i e d out to determine the e f f i c i e n c y of complex formation f o r the template mutant i n 5 ' - f l a n k i n g TNNCT. 122 A. Simultaneous a d d i t i o n To determine the r e l a t i v e c o m p e t i t i v e s t r e n g t h of the templates mutant i n 5 ' - f l a n k i n g TNNCT i n t r a n s c r i p t i o n , the pV4a.5-138,-38G,-35A mutant was used as competitor DNA ag a i n s t pS7a.5-119. The tRNASer^ a n d ^ ^ V a l ^ g e n e s w e r e comparable i n t r a n s c r i p t i o n e f f i c i e n c y ( S t. Louis and Spiegelman, 1985) and s i n c e the t R N A S e r 7 g e n e t r a n s c r i p t i s longer i n l e n g t h than the t R N A 7 3 1 ^ g e n e t r a n s c r i p t , the two could be e f f e c t i v e l y separated on a po l y a c r y l a m i d e g e l . Thus the products of both template DNAs i n the competition assay could be separated and q u a n t i f i e d . The c o n t r o l i n t h i s experiment was pV4a.5-138 (wild t y p e ) . T r a n s c r i p t i o n s from s i x d i f f e r e n t c o n c e n t r a t i o n s of template DNA (10-50 ng) were c a r r i e d out simultaneously by premixing v a r y i n g amounts of pV4a.5-138, or pV4a.5-138, -38G,-35A DNAs with 10 ng of pS7a.5-119 p r i o r to the a d d i t i o n of S-100 e x t r a c t . Reactions were c a r r i e d out f o r 90 min and products were analyzed as de s c r i b e d i n M a t e r i a l s and Methods ( F i g u r e 30-A). The amount of product f o r each r e a c t i o n was q u a n t i f i e d and the data p l o t t e d ( F i g u r e 30-B) i n two ways. When data from the v e l o c i t y of t r a n s c r i p t i o n s of pV4a.5-138 w i l d type and mutant were graphed as a f u n c t i o n of DNA i n p u t , the r e s u l t s showed no apparent e f f e c t s on t h e i r r e l a t i v e t r a n s c r i p t i o n r a t e s ( i . e . the w i l d type tRNAVa 1^ g e n e s t i l l d i s p l a y e d a higher Vmax than the 5 ' - f l a n k i n g TNNCT mutant). However, when the data from the t r a n s c r i p t i o n s of pS7a.5-119 were p l o t t e d , the mutant F i g u r e 30-A T r a n s c r i p t ion competition between pV4a.5-138, -38G.-35A and pS7a.5-119 The autoradiogram shows the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 wild type (lanes 1-6, lower band) and pV4a.5-138,-38G,-35A (lanes 7-12, lower band) used i n a competition experiment with pS7a.5-119 (lanes 1-12, upper band). A l l lanes contained 10 ng of pS7a.5-119 and pUC13 DNA to a t o t a l of 1.0 ug. T r a n s c r i p t i o n s were c a r r i e d out at 23.5° C and t r a n s c r i p t i o n products were analyzed on a 10$ poly a c r y l a m i d e g e l as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-6 and 7-12 represent the t r a n s c r i p t i o n products of 10, 15, 20, 33, 40 and 50 ng of pV4a.5-138 and pV4a.5-138,-38G,-35A competitor dNAs r e s p e c t i v e l y . B Graph of data from t r a n s c r i p t i o n competition between pV4a.5-138 wi l d type ( A ) , pV4a.5-138,-38G,-35A (•) and pS7a.5-119 Gel s l i c e s corresponding to t r a n s c r i p t i o n products were excised and the amount of product determined by Cerenkov c o u n t i n g . The data were p l o t t e d as cpm of t r a n s c r i p t per hour of r e a c t i o n versus competitor template DNA i n p u t . The l e f t panel shows t r a n s c r i p t i o n from pV4a.5-138 wi l d type ( A ) and pV4a.5-138,-38G,-35A (•). The r i g h t panel shows t r a n s o r i p t i o n of pS7a.5-119 i n the presence of pV4a.5-138 ( A ) and pV4a.5-138,-38G.-35A (0). 124 1 26 pV4a.5-138,-38G,-35A was a b e t t e r competitor of pS7a.5-119 than was pV4a.5-138 (wild t y p e ) , because the t r a n s c r i p t i o n S 6 X* of the tRNA ^ gene was lowered more by the 5 ' - f l a n k i n g TNNCT mutant than pV4a.5-138 ( r i g h t p a n e l , F i g u r e 30-B). This d i f f e r e n c e became apparent i n the presence of 10 ng of competitor DNA and inc r e a s e d with g r e a t e r amounts of competitor i n the r e a c t i o n . When t h i s experiment was repeated using 10-50 ng of competitor DNA, but with 25 and 50 ng of pS7a.5-119, s i m i l a r r e s u l t s were obtained (data not shown). These r e s u l t s i n d i c a t e d that the 5 ' - f l a n k i n g TNNCT mutant competed b e t t e r than the wild type f o r the S-100 t r a n s c r i p t i o n f a c t o r ( s ) even though t h i s a l t e r e d template had a lower Vmax than the wild type; t h i s was unexpected. The data i m p l i e d that complexes on the mutant template were s t a b l e . B. Preformed complexes To assess the r e l a t i v e s t a b i l i t y of complexes formed on wild type and 5 ' - f l a n k i n g TNNCT mutant templates, preformed complexes of pV4a.5-138,-38G,-35A and pV4a.5-138 wild type were used i n competition with pS7a.5-119. Complexes were formed with 40 ng of pV4a.5-138 wild type and mutant templates and at 0, 10, 20, 30, 40 and 50 min f o l l o w i n g i n c u b a t i o n with the S-100 e x t r a c t , 10 ng of pS7a.5-119 was added to the r e a c t i o n s . T r a n s c r i p t i o n was allowed to proceed f o r a f u r t h e r 60 min before t e r m i n a t i o n and a n a l y s i s of products as d e s c r i b e d i n M a t e r i a l s and Methods (Figure 31-A). F o l l o w i n g autoradiography, the amount of product F i g u r e 31-A T r a n s c r i p t i o n competition between preformed complexes of pV4a.5-138-38G,-35A and pS7a.5-119 The autoradiogram shows the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from HO ng preformed complexes of pV4a.5-138 wild type (lanes 1-6, lower band) and pV4a.5-138,-38G.-35A (lanes 7-12, lower band) i n competition with 10 ng of pS7a.5-119 (lanes 1-12, upper band). A l l lanes contained pDC13 DNA to a t o t a l of 1.0 ug. Complexes of w i l d type and mutant pV4a.5-138 were formed by the a d d i t i o n of the S-100 e x t r a c t to the template and f o l l o w i n g i n c u b a t i o n at 23.5° C f o r 0, 10, 20, 30, 40 and 50 min (lanes 1-6 and 7-12 r e s p e c t i v e l y ) , pS7a.5-119 template was added and t r a n s c r i p t i o n s were allowed to continue f o r an a d d i t i o n a l 60 min p r i o r to t e r m i n a t i o n and a n a l y s i s of products on a 10$ p o l y a c r y l a m i d e g e l as d e s c r i b e d i n M a t e r i a l s and Methods. B Graph of d a t a from t r a n s c r i p t i o n c o m p e t i t i o n between p r e -formed complexes of pV4a.5-138 w i l d type ( A ) , pV4a.5-138, -38G,-35A (to) and pS7a.5-119 Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pV4a.5-138 wild type and mutant templates ( F i g u r e 31-A, lanes 1-12, lower bands) were excised and the amount of product was determined by Cerenkov c o u n t i n g . The data were p l o t t e d as cpm of t r a n s c r i p t per r e a c t i o n versus i n c u b a t i o n time f o r pV4a. 5-138 w i l d type and mutant templates i n the S-100 e x t r a c t p r i o r to the a d d i t i o n of pS7a.5-119 DNA. C Graph showing the e f f e c t of competition between preformed complexes of pV4a.5-138 wild type ( A ) and pV4a.5-138,-38G, -35A (to) on the t r a n s c r i p t i o n of pS7a.5-119 Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pS7a.5-119 i n the presence of pV4a.5-138 wild type and mutant preformed complexes (Figure 31-A, lanes 1-12, upper bands) were excised and the amount of product was determined by Cerenkov c o u n t i n g . The data were p l o t t e d as cpm of t r a n s o r i p t versus i n c u b a t i o n time f o r complexes of pV^a.5-138 i n S-100 e x t r a c t p r i o r to the a d d i t i o n of pS7a.5-119. e g o oo CD m 00 c\j I 1 1 1 1 l _ 0 10 20 30 40 50 Incubation (min) ro 130 I I I I I L_ 0 10 20 30 40 50 Incubation (min) produced from both tRNAVa 1^ a n a t R N A S e r 7 templates was determined and the data p l o t t e d . F i g u r e 31-B shows the data obtained from t r a n s c r i p t i o n of preformed complexes of pV4a.5-138 mutant and w i l d type templates when pS7a.5-119 DNA was added to the r e a c t i o n s . The graph showed that the t r a n s c r i p t i o n from w i l d type template i n c r e a s e d f a s t e r with time than t r a n s c r i p t i o n from the 5 ' - f l a n k i n g TNNCT mutant. When the r a t i o of s l o p e s from the graph ( F i g u r e 31-B) was compared to the r a t i o of s l o p e s f o r an experiment where no c o m p e t i t i v e DNA was present (see F i g u r e 37-C; s l o p e s were determined w i t h i n the same time i n t e r v a l i n the l i n e a r range of t r a n s c r i p t i o n ) only a ~10% d i f f e r e n c e was observed, suggesting that n e i t h e r complex was a f f e c t e d by the t R N A S e r > 7 gene. When the amount of t R N A S e r 7 t r a n s c r i p t s were q u a n t i f i e d ( F i g u r e 31-C), the r e s u l t s showed that t r a n s c r i p t i o n of pS7a.5-119 was e q u a l l y a f f e c t e d by both the mutant and w i l d type pV4a.5-138 templates as seen by a sharp decrease i n t R N A S e r ? t r a n s c r i p t i o n i n the presence of e i t h e r w i l d type or mutant pV4a.5-138. This i n d i c a t e d that complex formation occurred e f f e c t i v e l y f o r both mutant and w i l d type Val genes and that formed complexes on pV4a. 5-1 38 ,-38G,-35A were e q u a l l y s t a b l e . T h e r e f o r e the TNNCT i n the 5'-flank d i d not appear to a f f e c t complex s t a b i l i t y . VI. E f f e c t of 140 mM NaCl on the t r a n s c r i p t i o n of pV4a.5-138  and pV4a.5-138.-38G.-35A Since S t i l l m a n et a l . (1984a) had p r e v i o u s l y shown that 140 mM NaCl n e g a t i v e l y a f f e c t e d the bi n d i n g of t r a n s c r i p t i o n f a c t o r s to tRNA genes, NaCl was used i n the f o l l o w i n g experiments to determine whether any d i f f e r e n c e s might e x i s t i n the complexes formed on the w i l d type and 5 ' - f l a n k i n g TNNCT mutant tRNA^3-1^ g e n e s . A. E f f e c t on t r a n s c r i p t i o n r a t e To determine the i n f l u e n c e of 140 mM NaCl on the r a t e of t r a n s c r i p t i o n of pV4a.5-138 mutant and w i l d type templates, 10, 20, 33, and 50 ng of template DNA was preincubated with the S-100 e x t r a c t f o r 30 min. Fo l l o w i n g the i n c u b a t i o n f o r 30 min, NaCl was added to a f i n a l c o n c e n t r a t i o n of 140 mM and t r a n s c r i p t i o n continued f o r an a d d i t i o n a l 60 min. Reactions were terminated and analyzed f o r products as d e s c r i b e d i n M a t e r i a l s and Methods. The c o n t r o l t r a n s c r i p t i o n s contained an equal volume of dH^o s u b s t i t u t e d f o r the volume of NaCl added to the r e a c t i o n s ( F i g u r e 32-A). The amount of product f o r each r e a c t i o n was determined and the data p l o t t e d ( F i g u r e 32-B). When Vmax values f o r mutant and w i l d type templates were c a l c u l a t e d , the r e s u l t s showed a 76$ decrease i n Vmax f o r pV4a.5-138 w i l d type and a 85$ decrease i n Vmax f o r the mutant pV4a.5-138,-38G,-35A templates. Therefore 140 mM NaCl s e v e r e l y decreased the r a t e of t r a n s c r i p t i o n of both w i l d type and F i g u r e 32-A E f f e c t of 140 mM NaCl on t r a n s c r i p t i o n r a t e s of pV4a.5-138 and pV4a.5-138,-38G,-35A The autoradiograms show the e l e c t r o p h o r e t i c s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 wi l d type (lanes 1-8) and pV4a.5-138,-38G,-35A mutant (lanes 8-16) templates. Lanes 1-4, 5-8, 9-12 and 13-16 represent the t r a n s c r i p t i o n products of 10, 20, 33 and 50 ng of template DNA which had been preincubated with S-100 e x t r a c t p r i o r to the a d d i t i o n of NaCl (lanes 5-8 and 13-16) or an equal volume of dH 2o (lanes 1-4 and 9-12). T r a n s c r i p t i o n was continued f o r another 60 min before t e r m i n a t i o n . A l l t r a n s c r i p t i o n s were o a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and t r a n s c r i p t i o n products were analyzed on 8% p o l y a c r y l a m i d e g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Graph of data showing the e f f e o t of 140 mM NaCl on t r a n s c r i p t i o n r a t e s of DV4a.5-138 ( A ) and pV4a.5-138,-38G, -35A (•) Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pV4a.5-138 wi l d type ( l e f t panel) and mutant ( r i g h t panel) templates i n the presence of 140 mM NaCl ( f i g u r e 32-A) were excised and the amount of product was determined by Cerenkov c o u n t i n g . The data were p l o t t e d as cpm of t r a n s o r i p t per hour of r e a c t i o n versus template DNA i n p u t . The presence (+) or absence (-) of NaCl i s shown next to the curves. 136 F i g u r e 33-A Time course of the e f f e o t of NaCl d u r i n g t r a n s c r i p t i o n of pV4a.5-138 wild type The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 wi l d type. 40 ng of template were incubated with the S-100 e x t r a c t f o r 60 min u n t i l r e a c t i o n s were i n the l i n e a r range of t r a n s c r i p t i o n and NaCl was added to the r e a c t i o n s (lanes 7-12) to a f i n a l c o n c e n t r a t i o n of 140 mM. An equal volume of dH 2o was added to a second set of r e a c t i o n s (lanes 1-o). Reactions were continued f o r 10, 20, 30, 40, 50 and 60 min (lanes 1-6 and 7-12 r e s p e c t i v e l y ) before t e r m i n a t i o n . A l l t r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C and products were analyzed on an 8% p o l y a c r y l a m i d e g e l as d e s c r i b e d i n M a t e r i a l s and Methods. B Time course of the e f f e c t of NaCl during the t r a n s c r i p t i o n of pV4a.5-138,-38G,-35A The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138,-38G,-35A. Co n d i t i o n s used were i d e n t i c a l to those d e s c r i b e d i n F i g u r e 33-A. Lanes 13-18 and 19-24 r e f e r to t r a n s c r i p t i o n s i n the presence of dH_o or 140 mM NaCl f o r 10, 20, 30, 40, 50 and 60 min r e s p e c t i v e l y . C Graph of data showing the e f f e c t of 140 mM NaCl on the t r a n s c r i p t i o n s of pV4a.5-138 wild type ( A ) and pV4a.5-138 -38G.-35A (•) over time Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pV4a.5-138 wild type ( F i g u r e 33-A) and mutant (Figure 33-B) templates f o l l o w i n g t r a n s c r i p t i o n i n the presence of 0 or 140 mM NaCl were excised and the amount of product determined by Cerenkov c o u n t i n g . The data were p l o t t e d as opm of t r a n s c r i p t versus i n c u b a t i o n time of pV4a.5-138 wi l d type ( l e f t panel) and pV4a.5-138 mutant ( r i g h t panel) templates i n the presence of 140 mM NaCl. The presence (+) or absence (-) of NaCl i s shown next to the curves. Incubation (min) (JO 5 * - f l a n k i n g mutant templates by d e s t a b i l i z i n g t h e i r t r a n s c r i p t i o n complexes. B. E f f e c t on t r a n s c r i p t i o n over time A time course of the e f f e c t of 140 mM NaCl was c a r r i e d out to assess any d i f f e r e n c e s which may e x i s t between the times at which complexes on w i l d type and 5 ' - f l a n k i n g TNNCT Val mutant tRNA ^ gene became s u s c e p t i b l e to the NaCl. To determine the time course f o r the e f f e c t of NaCl on t r a n s c r i p t i o n , complexes were formed with 40 ng of pV4a.5-138 w i l d type and mutant templates f o r 60 min and NaCl added to a f i n a l c o n c e n t r a t i o n of 140 mM. T r a n s c r i p t i o n s were terminated at 10, 20, 30, 40, 50 and 60 min f o l l o w i n g the a d d i t i o n of NaCl and the products were analyzed as d e s c r i b e d i n M a t e r i a l s and Methods ( F i g u r e 33-A). The c o n t r o l t r a n s c r i p t i o n s contained an equal volume of dH 2o s u b s t i t u t e d f o r the volume of NaCl added ( F i g u r e 33-B). The amount of product f o r each r e a c t i o n was q u a n t i t a t e d and the data p l o t t e d ( F i g u r e 33-C). The lower l i n e s i n both panels of the f i g u r e r e f e r to t r a n s c r i p t i o n i n the presence of 140 mM NaCl. I t was observed that f o r the r e a c t i o n s c o n t a i n i n g no NaCl, t r a n s c r i p t i o n i n c r e a s e d by approximately 50$ f o r both pV4a.5-138 (upper l i n e , l e f t panel) and 5 ' - f l a n k i n g mutant (upper l i n e , r i g h t panel) templates over the 60 min i n t e r v a l . However, only a "10$ i n c r e a s e i n t r a n s c r i p t i o n was observed i n the presence of NaCl f o r both w i l d type and mutant templates over the 60 min time range showing that that t r a n s c r i p t i o n was s e v e r e l y a f f e c t e d by 140 mM NaCl i n both pV4a.5-138 w i l d type and pV4a.5-138,-38G,-35A mutant templates w i t h i n ten minutes f o l l o w i n g the a d d i t i o n of NaCl. T h e r e f o r e , the TNNCT mutant d i d not d i s p l a y g r e a t e r s e n s i t i v i t y to the e f f e c t s of 140 mM NaCl than pV4a.5-138. C. NaCl c o n c e n t r a t i o n curve The previous experiments ( o u t l i n e d above) had determined that NaCl at a c o n c e n t r a t i o n of 140 mM s e v e r e l y i n h i b i t e d t r a n s c r i p t i o n r a t e s and complex s t a b i l i t i e s of both w i l d type and 5 ' - f l a n k i n g mutant tRNA^ 3 1^ genes. To examine the e f f e c t s of NaCl at d i f f e r e n t c o n c e n t r a t i o n s on the t r a n s c r i p t i o n s of pV4a.5-138 and pV4a.5-138,-38G,-35A, 40 ng of w i l d type and mutant templates were incubated with the S-100 e x t r a c t f o r 60 min at which time NaCl was added to f i n a l c o n c e n t r a t i o n s of 0, 30, 60, 90 , 120 and 140 mM. T r a n s c r i p t i o n s were continued f o r a f u r t h e r 60 min at 23.5° C f o l l o w i n g the a d d i t i o n of NaCl and the products analyzed as d e s c r i b e d i n M a t e r i a l s and Methods ( F i g u r e 34-A). The amount of product f o r each r e a c t i o n was determined and the data p l o t t e d ( F i g u r e 34-B). The r e s u l t s showed that t r a n s c r i p t i o n decreased by approximately 51$ f o r both pV4a.5-138 and pV4a.5-138,-38G,-35A templates over the NaCl c o n c e n t r a t i o n range i n d i c a t i n g that complexes were e q u a l l y a f f e c t e d . Therefore the complexes formed on the mutant template d i d not appear to be more s e n s i t i v e to i o n i c s t r e n g t h than w i l d type complexes. 142 F i g u r e 34-A E f f e c t of d i f f e r e n t NaCl c o n c e n t r a t i o n s on the t r a n s c r i p t i o n s of pV4a.5-138 w i l d type and and pV4a.5-138,-38G,-35A The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 w i l d type (lanes 1-6) and mutant (lanes 7-12) templates. 40 ng of template DNA were incubated with the S-100 e x t r a c t f o r 60 min u n t i l r e a c t i o n s were i n the l i n e a r range of t r a n s c r i p t i o n and NaCl was added to f i n a l c o n c e n t r a t i o n s of 0, 30, 60, 90, 120 and 140 mM (lanes 1-6 and 7-12 r e s p e c t i v e l y ) . Reactions were terminated a f t e r 60 min and the products separated on an 8% p o l y a c r y l a m i d e g e l as d e s c r i b e d i n M a t e r i a l s and Methods. A l l t r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C. B Graph of data showing the e f f e c t s of v a r y i n g c o n c e n t r a t i o n s of NaCl on the t r a n s c r i p t i o n s of pV4a.5-138 ( A ) and pV4a.5-138,-38G,-35A (•) Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pV4a.5-138 w i l d type and mutant templates ( F i g u r e 34-A) i n the presence of d i f f e r e n t NaCl c o n c e n t r a t i o n s were excised and the amount of product determined by Cerenkov counting. The data were p l o t t e d as cpm of t r a n s c r i p t versus NaCl c o n c e n t r a t i o n . 143 F i g u r e 35-A E f f e c t of i n c r e a s i n g temperature on the t r a n s c r i p t i o n s of pV4a.5-138 w i l d type and pV4a.5-138,-38G.-35A The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 wi l d type (lanes 1-6) and mutant (lanes 7-12) templates. 40 ng of template DNA were incubated with the S-100 e x t r a c t f o r 60 min at 23.5° C u n t i l r e a c t i o n s were i n the l i n e a r range of t r a n s c r i p t i o n . Reactions were then t r a n s f e r r e d to inc u b a t o r s preset at 23.5, 26, 28, 31, 34 and 37° C (lanes 1-6 and 7-12 r e s p e c t i v e l y ) . Reactions were terminated a f t e r 60 min and the products separated on a 8% p o l y a c r y l a m i d e g e l as d e s c r i b e d i n M a t e r i a l s and Methods. A l l t r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n . Graph of data showing the e f f e c t of v a r i o u s temperatures on preformed complexes of pV4a.5-138 ( A ) and pV4a.5-138, -38G.-35A (•) Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pV4a.5-138 w i l d type and mutant templates ( F i g u r e 35-A) at v a r i o u s temperatures were excised and the amount of product determined by Cerenkov counting. Data corresponding to the cpm of t r a n s c r i p t were c o r r e c t e d to percent t r a n s c r i p t i o n r e l a t i v e to the amount of product at 23.5° C and p l o t t e d a g a i n s t temperature. P o i n t s corresponding to t r a n s c r i p t i o n at 31° C were omitted due to temperature f l u c t u a t i o n s of the incubator used i n t h i s experiment. C\J o 00 CD LO CO % Transcription to o o 0) o 00 o ~1 o o V I I . E f f e c t of temperature on the t r a n s c r i p t i o n of pV4a.5- 138 and pV4a5-138.-38G.-35A A. E f f e c t of i n c r e a s i n g temperature on t r a n s c r i p t i o n To t e s t the e f f e c t s of i n c r e a s e d temperature on the t r a n s c r i p t i o n of pV4a.5-138 w i l d type and 5 ' - f l a n k i n g TNNCT mutant, 40 ng of template DNA were incubated with the S-100 e x t r a c t at 23.5° C f o r 60 min. Reactions were then incubated at 26, 28, 31 , 34 and 37° C f o r a f u r t h e r 60 min before being terminated and the products analyzed as d e s c r i b e d i n M a t e r i a l s and Methods ( F i g u r e 35-A). The percent t r a n s c r i p t i o n at i n c r e a s e d temperatures r e l a t i v e to t r a n s c r i p t i o n at 23.5° C was c a l c u l a t e d ( F i g u r e 35-B). R e s u l t s showed that both the w i l d type and mutant were e q u a l l y a f f e c t e d by i n c r e a s e d temperatures. In both cases there was a s l i g h t i n c r e a s e at 26° C which then d e c l i n e d s h a r p l y at temperatures above 28° C. Therefore both the w i l d type and mutant complexes appeared e q u a l l y s u s c e p t i b l e to the e f f e c t s of i n c r e a s e d temperatures. B. E f f e c t on the r a t e of t r a n s c r i p t i o n In t h i s experiment complexes were formed i n the presence of S-100 e x t r a c t , with 10, 20, 33 and 50 ng of pV4a.5-138 w i l d type and mutant template DNA f o r 30 min at 23.5° C. The r e a c t i o n s were t r a n s f e r r e d to 28° C f o r a f u r t h e r 60 min and products were analyzed as d e s c r i b e d i n M a t e r i a l s and Methods ( F i g u r e 36). F o l l o w i n g q u a n t i f i c a t i o n of tRNA products from r e a c t i o n s at 23.5 and 28° C, values corresponding to the v e l o c i t y of t r a n s c r i p t i o n (cpm per 149 F i g u r e 36 Autoradiogram of products from the t r a n s c r i p t i o n s of pV4a.5-138 wi l d type and pV4a.5-138,-38G,-35A at 23.5 and 28° c Autoradiograms r e p r e s e n t i n g the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 wild type (lanes 1-4 and 9-12) and mutant (lanes 5-8 and 13-16) templates are shown. T r a n s c r i p t i o n s were c a r r i e d out f o r 60 min using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C (lanes 1-8) and 28° C (lanes 9-16) f o l l o w i n g a 30 min i n c u b a t i o n at 23.5° C. T r a n s c r i p t i o n products were analyzed on 8$ polyacrylamide g e l s as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-4, 5-8, 9-12 and 13-16 show the t r a n s c r i p t i o n products of 10 , 20, 33 and 50 ng of template DNA r e s p e c t i v e l y . CD LO CO CO CNJ C\J O 05 O o LO CO CM CO N-CD LO <^ co CNJ hour) were used to d e r i v e Vmax values f o r the wild type and mutant templates. The i n c r e a s e i n temperature r e s u l t e d i n a 26.1$ i n c r e a s e i n Vmax f o r pV4a.5-138 and a 12.4$ i n c r e a s e i n Vmax f o r pV4a.5-138,-38G,-35A r e l a t i v e to t r a n s c r i p t i o n at 23.5° C. Although the Vmax in c r e a s e d f o r both templates, the r e l a t i v e i n c r e a s e i n t r a n s c r i p t i o n was l e s s f o r the 5'-f l a n k i n g TNNCT mutant than the wild type by two f o l d . V I I I . A n a l y s i s of the time course f o r the t r a n s c r i p t i o n of  pV4a.5-138 wild type and pV4a.5-138,-38G,-35A To examine the t r a n s c r i p t i o n of pV4a.5-138 wild type and 5 * - f l a n k i n g TNNCT mutant during the course of a 2 hr r e a c t i o n , 40 ng of template DNA were incubated with the S-100 e x t r a c t i n a standard r e a c t i o n c o n t a i n i n g a t o t a l of 1.0 ug of DNA at 23.5° C as d e s c r i b e d i n M a t e r i a l s and Methods. At 10 min i n t e r v a l s r e a c t i o n s were terminated and the products e l e c t r o p h o r e s e d on p o l y a c r y l a m i d e gels ( F i g u r e 37-A and B). F o l l o w i n g autoradiography, the amount of product f o r each r e a c t i o n was determined and values corresponding to the v e l o c i t y of t r a n s c r i p t i o n were p l o t t e d a g a i n s t r e a c t i o n times ( F i g u r e 37-C). Re s u l t s showed that t r a n s c r i p t i o n was d e t e c t a b l e w i t h i n 10 min of the a d d i t i o n of S-100 e x t r a c t , i n both the wild type and mutant templates. In a d d i t i o n , both templates showed a n o n - l i n e a r curve f o r t r a n s c r i p t i o n . E x t r a p o l a t i o n from the l i n e r e p r e s e n t i n g the l i n e a r p o r t i o n of the curves to the ax i s showed the i n t e r c e p t s to be at 152 F i g u r e 37-A Time course of t r a n s c r i p t i o n f o r pV4a.5-138 The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 wi l d type. T r a n s c r i p t i o n s were c a r r i e d out with 40 ng of template DNA f o r 2 hrs at 23.5° C. Reactions were terminated at 10 min i n t e r v a l s and e l e c t r o p h o r e s e d on an 8% denaturing p o l y a c r y l a m i d e g e l as d e s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-12 represent t r a n s c r i p t i o n products from 10, 20, 30, 40, 50, 60, 70, 80 90, 100, 110 and 120 min of r e a c t i o n r e s p e c t i v e l y . B Time course of t r a n s c r i p t i o n f o r pV4a.5-138,-38G,-35A The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs f r o pV4a.5-138 mutant i n 5 ' - f l a n k i n g TNNCT. C o n d i t i o n s f o r t r a n s c r i p t i o n and a n a l y s i s of products were as d e s c r i b e d i n F i g u r e 37-A. C Graph showing the time course of t r a n s c r i p t i o n f o r pV4a. 5-138 w i l d type ( A ) and pV4a.5-1 38 ,-38G,-35 A (•) Gel s l i c e s corresponding to t r a n s c r i p t i o n products of pV4a.5-138 w i l d type and mutant templates ( F i g u r e 37-A and B) at v a r i o u s time p o i n t s during the course of t r a n s c r i p t i o n were excised and the amount of product determined by Cerenkov counting. Data was p l o t t e d as opm of t r a n s c r i p t versus r e a c t i o n time.' CM O G> 00 N-CD LO 00 CM C\J o CD 00 CO i n CO C\J 155 *r i i i | | | i | i 1 l _ 10 20 30 40 50 60 70 80 90 100 110 120 Time (min) 156 approximately the same p o s i t i o n . Therefore no s i g n i f i c a n t l a g i n i n i t i a t i o n time of the 5 ' - f l a n k i n g TNNCT mutant r e l a t i v e to the wild type template was observed. The slope of the t r a n s c r i p t i o n curve f o r the mutant was lower than the s l o p e of that f o r the wild type. Since i t was p o s s i b l e that the r a t e of t r a n s c r i p t i o n i n i t i a t i o n may have been a f f e c t e d , an experiment was c a r r i e d out to measure s p e c i f i c a l l y the r a t e of t r a n s c r i p t i o n i n i t i a t i o n . IX. T r a n s c r i p t i o n i n i t i a t i o n i n pV4a.5-138 wild type and  pV4a.5-138.-38G.-35A I t was p r e v i o u s l y shown that i n i t i a t i o n of t r a n s c r i p t i o n i n pV4a.5-179 occurred at p o s i t i o n -9G ( S a j j a d i et a l . , 1987). In order to analyze s p e c i f i c a l l y t r a n s c r i p t i o n of tRNA 7* 1^ gene wild type and 5 ' - f l a n k i n g mutant templates i n i t i a t i n g at -9G, V/-^2?~\ GTP was s u b s t i t u t e d f o r [CL- 3 2P] UTP i n standard t r a n s c r i p t i o n r e a c t i o n s . F i r s t , a GTP c o n c e n t r a t i o n ourve was c a r r i e d out to determine the optimal c o n c e n t r a t i o n of GTP r e q u i r e d i n the r e a c t i o n f o r e f f i c i e n t t r a n s o r i p t i o n . In t h i s experiment, 40 ng of pV4a.5-138 DNA were used as template i n twelve standard 90 min t r a n s c r i p t i o n assays (as d e s c r i b e d i n M a t e r i a l s and Methods) c o n t a i n i n g 0 to 1000 uM GTP. F o l l o w i n g the a n a l y s i s of t r a n s c r i p t i o n products, the r e s u l t s showed that the S-100 e x t r a c t contained a s u f f i c i e n t c o n c e n t r a t i o n of GTP and no a d d i t i o n a l GTP was r e q u i r e d f o r e f f i c i e n t t r a n s c r i p t i o n (data not shown). Next, t r a n s o r i p t i o n s were c a r r i e d out with both pV4a.5-138 w i l d type and 5 ' - f l a n k i n g mutant templates at s i x d i f f e r e n t c o n c e n t r a t i o n s of input DNA as de s c r i b e d i n M a t e r i a l s and Methods, except that 5 uCi of [ 7 ^ 3 2 P ] GTP (752 Ci/mmol) was s u b s t i t u t e d f o r [GU 3 2P] UTP and the r e a c t i o n s contained 6 mM u n l a b e l l e d UTP. A r e p l i c a t e of the experiment under standard c o n d i t i o n s with [Gl- 3 2P] UTP, was c a r r i e d out i n p a r a l l e l and served as c o n t r o l . F o l l o w i n g t e r m i n a t i o n of t r a n s c r i p t i o n , the products of the r e a c t i o n s were separated by e l e c t r o p h o r e s i s on 15$ denaturing p o l y a c r y l a m i d e g e l s to de t e c t p a r t i a l t r a n s c r i p t s ( F i g u r e 38-A and B). The amount of product f o r each r e a c t i o n i n the presence of K1- 3 2P] UTP and [')^-32P] GTP was determined and the data used to d e r i v e Vmax values f o r each template. Although only t r a n s c r i p t s longer than ten n u c l e o t i d e s could be r e s o l v e d under these c o n d i t i o n s , there was no evidence of s h o r t e r p a r t i a l t r a n s c r i p t s from the mutant template. The r e s u l t s showed that pV4a.5-138,-38G,-35A was d e f e c t i v e i n i n i t i a t i o n with a 34$ decrease i n Vmax f o r r e a c t i o n s with [ % 3 2 P ] GTP and a 39$ decrease i n Vmax with B3.-32P] UTP as the l a b e l l e d n u c l e o t i d e . F i g u r e 3 8 -A Autoradiogram of products from t r a n s c r i p t i o n s of pVUa.5-138 and pV4a.5-138-38G-35A with [CX- 3 2P] UTP The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 w i l d type (lanes 1-6) and 5 ' - f l a n k i n g mutant (lanes 7-12) templates. T r a n s c r i p t i o n s were c a r r i e d out using a t o t a l DNA c o n c e n t r a t i o n of 1.0 ug per r e a c t i o n at 23.5° C with l a b e l l e d [ C L- 3 2P] UTP and t r a n s c r i p t i o n products were analyzed on a 15$ denaturing p o l y a c r y l a m i d e g e l as de s c r i b e d i n M a t e r i a l s and Methods. Lanes 1-6 and 7-12 repr e s e n t the t r a n s c r i p t i o n products of 10, 20, 33, 50, 66.7 and 100 ng of template DNA r e s p e c t i v e l y . B Autoradiogram of products from the t r a n s c r i p t i o n s of pV4a.5-138 and pV4a.5-138,-38G,-35A with [ 7 ^ 3 2 P ] GTP The autoradiogram shows the e l e o t r o p h o r e t i o s e p a r a t i o n of l a b e l l e d tRNAs from pV4a.5-138 w i l d type (lanes 1 - 6 ) and 5 ' - f l a n k i n g mutant (lanes 7-12) templates. T r a n s c r i p t i o n c o n d i t i o n s were as d e s c r i b e d f o r F i g u r e 38-A, except that [ 7 ^ 3 2 P ] GTP was used as the l a b e l l e d n u c l e o t i d e . The f a i n t bands present i n a l l lanes which appear above and below the V a l ^ t r a n s c r i p t s are not template s p e c i f i c ( i . e . do not vary with template DNA input) and are normally w e l l separated from the primary t r a n s c r i p t i n 8$ polyacrylamide g e l s . C\J o CD 00 CD LD 00 C\J 160 161 DISCUSSION I. Mutations i n 5 f - f l a n k i n g TNNCT The purpose of t h i s study was to demonstrate s p e c i f i c a l l y the r o l e of the sequence TCGCT i n the modulation of pV4a.5-138 t r a n s c r i p t i o n and to shed l i g h t on the mechanism of i t s a c t i o n . An e x t e n s i v e d e l e t i o n s e r i e s i n t o the 5'-flank of pV^a.5-179 had shown that d e l e t i o n of sequences to p o s i t i o n -38 r e l a t i v e to the mature coding sequence of t R N A V a l 4 g e n e d i a n o t r e s u l t i n a lower Vmax than f o r the w i l d type gene ( S a j j a d i et a l . , 1987). However, d e l e t i o n of one a d d i t i o n a l n u c l e o t i d e r e s u l t e d i n a M3$ decrease i n Vmax and d e l e t i o n of the remaining TCGCT sequence r e s u l t e d i n a 85$ decrease i n Vmax r e l a t i v e to pV4a.5-179. In a d d i t i o n , i t was a l s o demonstrated that the sequence TCGCT at p o s i t i o n -19 d i d not p o s i t i v e l y modulate the l e v e l of t r a n s c r i p t i o n ( S a j j a d i , 1985). A homology search i n the 5'-flank of other D r o s o p h i l a tRNA genes which d i r e c t e d t r a n s c r i p t i o n e f f i c i e n t l y d i d not r e v e a l a sequence TCGCT. However, a sequence of the g e n e r a l form TNNCT was found and i t was suggested that the p e n t a n u c l e o t i d e may be a p o s i t i v e modulator of tRNA gene t r a n s c r i p t i o n . Since some of the e f f e c t s observed f o r the d e l e t i o n end-points may have been c o n t r i b u t e d by the c l o s e r p o s i t i o n i n g of v e c t o r sequences to the gene, f u r t h e r s t u d i e s on the e f f e c t s of TCGCT i n the context of a w i l d type f l a n k were r e q u i r e d . To assess p r e c i s e l y the c o n t r i b u t i o n of conserved n u c l e o t i d e s 162 i n the sequence TNNCT to e f f i c i e n t t r a n s c r i p t i o n , a number of p o i n t mutants were created i n the 5'-flank of the t R N A V a l M ? e n e . Nu c l e o t i d e changes were created i n pV4a.5-138 which was i d e n t i c a l to pV4a.5-179 i n t r a n s c r i p t i o n e f f i c i e n c y . Both pV4a.5-138 and -45 were sub-cloned i n t o the E c o R I / H i n d l l l s i t e of pEMBL8-, sequenced i n t h e i r e n t i r e t y and t h e i r r e l a t i v e t r a n s c r i p t i o n e f f i c i e n c i e s determined. Table 1 shows the l i s t of po i n t mutants created i n pV4a.5-138. The -38G mutation r e s u l t e d i n a 28$ decrease i n Vmax r e l a t i v e to the wild type template. Mutations at the other conserved n u c l e o t i d e s r e s u l t e d i n approximately 32$ decrease i n the l e v e l of tRNA V a l 1 J t r a n s c r i p t i o n . In a d d i t i o n , double mutants at the conserved n u c l e o t i d e s , -38G.-35G and -38G,-35A r e s u l t e d i n approximately 40$ decrease i n Vmax r e l a t i v e to pV4a.5-138. In c o n t r a s t , the -36T mutation reduced t r a n s c r i p t i o n e f f i c i e n c y by only 1$ and a mutation at the second v a r i a b l e p o s i t i o n , -37A r e s u l t e d i n a 12$ i n c r e a s e i n Vmax r e l a t i v e to wild type a c t i v i t y . S i nce the C to A t r a n s v e r s i o n r e s u l t e d i n a 12$ i n c r e a s e i n Vmax and an i d e n t i c a l t r a n s v e r s i o n at the conserved n u c l e o t i d e at p o s i t i o n -35 r e s u l t e d i n a 32$ decrease i n Vmax, the drop i n t r a n s c r i p t i o n f o r the conserved n u c l e o t i d e was most l i k e l y not due to the nature of the n u c l e o t i d e change. The data showed that mutations i n the conserved n u c l e o t i d e s r e s u l t e d i n a decrease i n t r a n s o r i p t i o n , whereas n u c l e o t i d e changes at the v a r i a b l e p o s i t i o n s of TCGCT d i d not s i g n i f i c a n t l y reduce template a c t i v i t y . This was the f i r s t i n d i c a t i o n that the the two n u c l e o t i d e s at p o s i t i o n s -37 and -36 were indeed v a r i a b l e . These r e s u l t s are c o n s i s t e n t with having a general sequence of the form TNNCT f o r a p o s i t i v e modulator of t r a n s c r i p t i o n i n the 5* - f l a n k . I t i s i n t e r e s t i n g that double n u c l e o t i d e changes at the conserved p o s i t i o n s d i d not d i s p l a y t r a n s c r i p t i o n a l a c t i v i t i e s very much g r e a t e r than some of the s i n g l e p o i n t mutants (Table 1). While i t may be p o s s i b l e that TNNCT f u n c t i o n s as a u n i t , no c o n c l u s i o n s f o r the absence of a d d i t i v e e f f e c t s can be drawn at t h i s time. A n u c l e o t i d e change i n TNNCT was a l s o created i n pV4a.5-M5. The t r a n s c r i p t i o n e f f i c i e n c y of pV4a.5-45 had been shown to be 36$ higher than that of pV4a.5-179. This was p o s t u l a t e d to be due to the removal of upstream n e g a t i v e modulatory sequences ( S a j j a d i et a l . , 1987). The s i n g l e t r a n s v e r s i o n at p o s i t i o n -38 r e s u l t e d i n only a 10$ decrease i n Vmax r e l a t i v e to pV4a.5-45 (Table 1). Note that the -38 t r a n s v e r s i o n i n the pV4a.5-138 template r e s u l t e d i n a decrease i n t r a n s c r i p t i o n that was approximately t h r e e - f o l d g r e a t e r than the drop observed f o r the pV4a.5-M5 template. A p o s s i b l e e x p l a n a t i o n f o r the d i f f e r e n t e f f e c t s of the -38 mutation i n TNNCT of pV4a.5-H5 and -138 templates may be that the i n h i b i t o r y sequence p r e v i o u s l y i d e n t i f i e d i n the S'-flank of pV4a.5-179 ( S a j j a d i et a l . , 1987) p r i m a r i l y a f f e c t e d the p o s i t i v e modulatory r o l e of sequences at p o s i t i o n -45. Since t h i s t e r m i n a t o r - l i k e sequence was 164 d e l e t e d i n pV4a.5-45, the i n h i b i t o r y e f f e c t s on the -45 sequences were removed and the template d i r e c t e d e f f i c i e n t t r a n s c r i p t i o n with a reduced dependenoe on the f u n c t i o n of TNNCT. The mechanism u n d e r l y i n g the increased a c t i v i t y of the pV4a.5-45 template w i l l r e q u i r e f u r t h e r study. Table 4 c o n t a i n s a l i s t of tRNA genes from D r o s o p h i l a whose in v i t r o t r a n s c r i p t i o n p r o p e r t i e s have been determined. The l i s t shows that 5 ' - f l a n k i n g sequences of genes which do not c o n t a i n a TNNCT e i t h e r f a i l to d i r e c t t r a n s c r i p t i o n or t r a n s c r i b e at very low e f f i c i e n c i e s i n  v i t r o . The exce p t i o n , pDt5-Ser 7 w i n be di s c u s s e d i n s e c t i o n V. Genes c o n t a i n i n g the sequence TNNCT i n t h e i r 5 1-f l a n k g e n e r a l l y d i r e c t t r a n s c r i p t i o n very e f f i c i e n t l y . While the pLeu gene appears to be an exce p t i o n , the 5'-flank of t h i s gene c o n t a i n s m u l t i p l e T t r a c t s which have p r e v i o u s l y been shown to be i n h i b i t o r y to t r a n s c r i p t i o n (DeFranco et a l . , 1981; Dingermann et a l . , 1982; S a j j a d i et a l . , 1987). In a d d i t i o n , i n order to have an e f f e c t , i t appears that the p o s i t i v e modulatory sequenoe TNNCT must be loc a t e d 30 bp or f u r t h e r upstream from the mature coding sequence ( S a j j a d i , 1985). This hypothesis i s supported by the o b s e r v a t i o n that p48His (Cooley et a l . , 1984) which c o n t a i n s a TNNCT at p o s i t i o n -18 i n i t s 5' - f l a n k , i s an i n e f f i c i e n t template f o r t r a n s c r i p t i o n . In c o n t r a s t , pHis which has the TNNCT l o c a t e d at p o s i t i o n -42 d i r e c t s t r a n s c r i p t i o n e f f i c i e n t l y . T herefore the occurrence of TNNCT i n the 5'-flank would appear to be c o r r e l a t e d with Table k C o r r e l a t i o n of t r a n s c r i p t i o n e f f i c i e n c y and the pe n t a n u c l e o t i d e TNNCT 165 TemDlat e P o s i t i o n of TNNCT a T r a n s c r i p t i o n * 5 Ref, pYH48-Arg ~ 3 8TTTCT + 1 pE1 .8-Arg - 5 2 T T G C T - U 0 T A T C T c pDt67R-Arg - 8 8 T C T C T - 8 U T T T C T - 6 9 T T G C T - 3 6 T G C C T c pDt17R-Arg • 1 5 1 T A A C T " 1 2 6 T A G C T ~ 1 0 6 ACT~ 8 0TTCCT" 5 3TCCCT" 3 8 TCT C TGTCT" 8 9TG TTGCT~ 3 3TT +° p11F-Arg No TNNCT (to -40) -( + ) 2 p35D-Arg No TNNCT -( + ) 2 p17D-Arg No TNNCT - 2 pAva4-Arg No TNNCT0 _d pAsn8-Asn _ 1 | 2TGGCT" 3 7TGGCT" 3 3 + 3 p Asn6-Asn No TNNCT (to -48) + (-) 3 pAsn7-Asn No TNNCT (to -48) -( + ) 3 pHis-His - 4 6 T T G C T + 4 p48His-His " 2 2TTGCT -( + ) 4 pLeu-Leu - 5 8 T T G C T - 4 2 T T T C T ( t Q_ 140) -( + ) 5 pDt39R-Lys 5 " 3 6TACCT + 6 pDt59R-Lys 5 " 3 8TTCGT + 6 pDt5-Ser^ No TNNCT + 7 pDtl6H#1-Ser 7 7 J t - 3 9 T A G C T + (-) 7 p D t l 6 H # 5 - S e r ? 7 7 No TNNCT + (-) 7 pDt55-0.6-Valjj ~ 3 9TGGCT + 8 pV4a.5-179- V a l ^ " 3 8TCGCT" 2 3TCTCT + 9 pDt92R-Val 4 "^TTACT~ 4 8TTGCT TATCT "^TAACT + (- ) d 10 pD t 7 8 R - V a l 3 b No TNNCT - 11 166 Footnotes to Table 4: aNumbers i n d i c a t e the p o s i t i o n of the 5'T i n the TNNCT sequence i n the 5 ' - f l a n k i n g DNA, r e l a t i v e to the mature coding sequence (+1). ^Symbols f o r t r a n s c r i p t i o n e f f i c i e n c i e s are: + = e f f i c i e n t ( w i t h i n 10% of pV4a.5-179); + ( - ) = i n e f f i c i e n t ( l e s s than 15% of pV4a.5-179); -(+)=very i n e f f i c i e n t ( l e s s than 1% of pV4a.5-179); -=no d e t e c t a b l e t r a n s c r i p t i o n . For e n t r i e s where e v a l u a t i o n of t r a n s c r i p t i o n e f f i c i e n c y i s taken from the l i t e r a t u r e , the l e v e l s do not r e l a t e to pV4a.5-179. C. Newton, J.L. Leung and G.M. Tener, p e r s o n a l communication. d L . Dunoan and G.B. Spiegelman, unpublished r e s u l t s . 1 Schaack et a l . , 1984 2 Dingermann et a l . , 1982 3 L o f q u i s t and Sharp, 1986 4 Cooley et a l . , 1984 5 Glew et a l . , 1986 6 De Franco et a l . , 1982 7 St. Louis and Spiegelman, 1985 8 Rajput et a l . , 1982 9 S a j j a d i et a l . , 1987 10 Addison et a l . , 1982 11 Leung et a l . , 1 984 167 t r a n s c r i p t i o n e f f i c i e n c y . As can be seen from Table 4, of the twenty three genes l i s t e d , f ourteen have a TNNCT between p o s i t i o n s -29 and -46. Of the genes which are t r a n s c r i b e d at moderate to high e f f i c i e n c y , only three of the f i f t e e n do not c o n t a i n a TNNCT i n the -29 to -46 re g i o n of the 5*-f l a n k . Thus the a s s o c i a t i o n of the sequence TNNCT with genes which are a c t i v e templates does not appear random, although the c o r r e l a t i o n i s not p e r f e c t . I I . F a c t o r i n t e r a c t i o n with the 5'-flank The above experiments demonstrated that TNNCT was re q u i r e d f o r the maximum l e v e l of t r a n s c r i p t i o n i n pV4a.5-138. Although TNNCT i s only f i v e n u c l e o t i d e s i n l e n g t h , i t may s t i l l be able to sequester a t r a n s c r i p t i o n f a c t o r r e q u i r e d f o r t r a n s c r i p t i o n , as shown f o r other eukaryotic sequences of f i v e n u c l e o t i d e s i n length (Hatamochi et a l . , 1986; Miksicek et a l . , 1987). To explore the p o s s i b i l i t y of t r a n s c r i p t i o n f a c t o r i n t e r a c t i o n with TNNCT or other sequences contained i n the 5'-flank, the 5'-flank of pV4a.5-179 was i s o l a t e d and subcloned i n t o the H i n d l l l s i t e of pEMBL8- as p r e v i o u s l y d e s c r i b e d . The i s o l a t e d 5'-flank was subsequently used i n a g e l r e t a r d a t i o n assay i n the presence of S-100 e x t r a c t ( F i g u r e 28). Results showed that while the 5'-flank was retarded i n the assay i n the presence of poly dl-dC, no f a c t o r b i n d i n g was observed when pUC DNA was used as competitor f o r n o n - s p e c i f i c b i n d i n g . Incubation of l a b e l l e d probe with both pUC and poly dl-dC DNA f a i l e d to 168 produce a r e t a r d e d band, suggesting that pUC DNA was able to bind and compete f o r bound p r o t e i n on the 5'-flank, suggesting that the i n t e r a c t i o n was n o n - s p e c i f i o . The clone c o n t a i n i n g the i s o l a t e d 5'-flank was a l s o used i n a t r a n s c r i p t i o n competition experiment with pV4a.5-138, the wild type t R N A V a l 1 | gene. Competition experiments were c a r r i e d out by the a d d i t i o n of competitor DNA ( 5 1 -f l a n k ) both s i m u l t a n e o u s l y as w e l l as to preformed complexes of pV4a.5-138. Results showed that the 5'-flank did not reduce the t r a n s c r i p t i o n of the i n t a c t t R N A ^ a ^ gene. The t r a n s c r i p t i o n competition data and the r e s u l t s from the g e l r e t a r d a t i o n assay together suggest that the 5'-f l a n k i n g sequences of pV4a.5-179 cannot bind f a c t o r s r e q u i r e d f o r e f f i c i e n t tRNA t r a n s c r i p t i o n when separated from the i n t e r n a l c o n t r o l regions of the gene. The r e s u l t s do not r u l e out the p o s s i b i l i t y f o r i n t e r a c t i o n of RNA polymerase I I I or other p r o t e i n s with the 5 ' - f l a n k , once a s t a b l e complex has been formed. Since such an i n t e r a c t i o n would r e q u i r e the r e c o g n i t i o n of a s t a b l e complex on the template, RNA polymerase I I I whioh has been shown to r e c o g n i z e these complexes p r i o r to t r a n s c r i p t i o n i n i t i a t i o n , appears to be a good candidate f o r i n t e r a c t i o n with TNNCT. I l l . Mutations i n the i n t e r n a l TNNCT The tRNA ^ gene c o n t a i n s the sequence TGCCT i n the anticodon stem/loop r e g i o n ( F i g u r e 13). Sinoe the TNNCT in the 5 ' - f l a n k i n g region of the gene was shown to be i n v o l v e d i n modulation of t r a n s c r i p t i o n , the i n t e r n a l TNNCT sequence was mutagenized to determine whether i t too c o n t r i b u t e d to t r a n s c r i p t i o n e f f i c i e n c y . In a d d i t i o n , the experiment sought to explore the p o s s i b i l i t y f o r the requirement of TNNCT sequences i n both e x t r a g e n i c and i n t r a g e n i c r e g i ons of the gene, which would shed l i g h t on the problem of 5'-flank/gene c o m p a t i b i l i t y d i s c u s s e d e a r l i e r ( s e c t i o n IV. of I n t r o d u c t i o n ) . Three n u c l e o t i d e changes were crea t e d between p o s i t i o n s +29 and +33 of pV4a.5-138 by s i t e - s p e c i f i c mutagenesis to produce a Hhal s i t e . The newly created s i t e would s i m p l i f y the mutant sc r e e n i n g procedure and would allow the c o n s t r u c t i o n of maxigenes f o r f u t u r e s t u d i e s . When f u l l -l e n g t h t r a n s c r i p t s were q u a n t i f i e d , the template mutant i n the i n t e r n a l TNNCT had a Vmax 46% lower than i t s co u n t e r p a r t , pV4a.5-138 w i l d type. In a d d i t i o n , the autoradiogram showed an abundance of s h o r t e r bands present on the g e l which appeared to be p a r t i a l t r a n s c r i p t i o n products ( F i g u r e 22). I t should be noted that a l l S-100 e x t r a c t s used i n t h i s study were t e s t e d f o r high e f f i c i e n c y of t r a n s c r i p t i o n and the absence of p r o c e s s i n g a c t i v i t y under the c o n d i t i o n s employed. Ther e f o r e i f p a r t i a l t r a n s c r i p t s were a l s o q u a n t i f i e d along with f u l l - l e n g t h t r a n s c r i p t s , then i t i s p o s s i b l e that no decrease i n Vmax would be detected f o r the template mutant i n the i n t e r n a l TNNCT, i n d i c a t i n g no d i f f e r e n c e s i n the r a t e s of i n i t i a t i o n of w i l d type and mutant templates. Mutants crea t e d i n the stem/loop r e g i o n of other tRNA genes have not y i e l d e d c o n s i s t e n t r e s u l t s i n terms of t h e i r e f f e c t s on t r a n s c r i p t i o n r a t e s (Sharp et a l . , 1985). I t i s co n c e i v a b l e that the changes reported here may have i n f a c t i n creased the r a t e s of t r a n s c r i p t i o n . However, t h i s i s the only r e p o r t i n which mutations i n the anticodon stem/loop region have a f f e c t e d the e l o n g a t i o n of t r a n s c r i p t s , suggesting that the mutations may have a l t e r e d the i n t e r a c t i o n of t r a n s c r i p t i o n f a c t o r s or RNA polymerase I I I with the template. The n u o l e o t i d e changes i n the i n t e r n a l TNNCT were a l s o c r e a t e d i n the template mutant i n 5 ' - f l a n k i n g TNNCT (pV4a.5-138,-38G,-35A) whose t r a n s c r i p t i o n e f f i c i e n c y was 42$ lower than w i l d type. The new c o n s t r u c t which was mutant i n both 5 ' - f l a n k i n g and i n t e r n a l TNNCT sequences had a t r a n s c r i p t i o n e f f i c i e n c y 54$ lower than pV4a.5-138 wi l d type when f u l l -l ength t r a n s c r i p t s were q u a n t i f i e d . F a i n t bands corresponding to s h o r t e r bands from the i n t e r n a l TNNCT mutant were a l s o present i n the g e l from the template mutant i n both TNNCTs (F i g u r e 23). The decrease i n the l e v e l of f u l l - l e n g t h t r a n s c r i p t i o n f o r 5 ' - f l a n k i n g and i n t e r n a l TNNCT sequences was not a d d i t i v e . The drop i n Vmax may r e p r e s e n t , f o r the grea t e r p a r t , the l e v e l of t r a n s c r i p t i o n f o r a template l a c k i n g TNNCTs i n the 5'-flank alone. I t i s u n l i k e l y that mutating the i n t e r n a l TNNCT i s r e s p o n s i b l e f o r s p e c i f i c a l l y a f f e c t i n g the s i t e of i n i t i a t i o n of t r a n s c r i p t i o n , s i n c e the s i z e of the sh o r t e r bands would r e q u i r e i n i t i a t i o n to occur w i t h i n the i n t e r n a l c o n t r o l sequences c o n t a i n i n g bound t r a n s c r i p t i o n f a c t o r s . A p o s s i b l e e x p l a n a t i o n f o r the premature t e r m i n a t i o n of t r a n s c r i p t s i s that the i n t e r n a l TNNCT c o n t r i b u t e s to the i n t e r a c t i o n of f a c t o r s with the template and that the s h o r t e r bands represent p a r t i a l t r a n s c r i p t s r e s u l t i n g from u n s t a b l e complexes. Stewart et a l . (1985) created two n u c l e o t i d e changes i n the anticodon of a D r o s o p h i l a tRNA A r i? gene between p o s i t i o n s + 34 and +36 which r e s u l t e d i n a 25% decrease i n the l e v e l of t r a n s c r i p t i o n . However, complex formation f o r t h i s gene as measured i n a competition assay with a r e f e r e n c e competitor was reported to be at almost wi l d type l e v e l s . The tRNA A r? gene a l s o contained a TNNCT between p o s i t i o n +29 and +33, which was not mutagenized. While these r e s u l t s show that the anticodon stem/loop r e g i o n i s important i n t r a n s c r i p t i o n , the mechanism i s open to s p e c u l a t i o n at t h i s time. IV. T r a n s o r i p t i o n p r o p e r t i e s of a template mutant i n 5'-f l a n k i n g TNNCT The experiments o u t l i n e d above showed that the sequence TNNCT contained i n the 5 ' - f l a n k of pV4a.5-138 was req u i r e d f o r e f f i c i e n t tRNA t r a n s c r i p t i o n . However, i t was not known whether TNNCT f u n c t i o n was r e l a t e d to i t s r o l e i n i n f l u e n c i n g complex formation or i n d i r e c t l y a f f e c t i n g the e f f i c i e n c y of t r a n s c r i p t i o n i n i t i a t i o n . The present model f o r the formation of complexes on tRNA genes i s based on data obtained from the t r a n s c r i p t i o n of Xenopus 5S RNA genes (Lassar et a l . , 1983; Setzer and Brown, 1985). Studies have shown that complex formation i s i n i t i a t e d by the b i n d i n g of TFIIIC to the T c o n t r o l r e gion (Johnson-Burke and S o i l , 1985) , which occurs w i t h i n one minute f o l l o w i n g the a d d i t i o n of e x t r a c t to the template. The i n t e r a c t i o n r e s u l t s i n a metastable complex which i s s t a b i l i z e d by the bi n d i n g of TFIIIB (Lassar et a l . , 1983; Johnson-Burke and S o i l , 1985). The r e s u l t i s a s t a b l e " p r e i n i t i a t i o n " complex which i s i n turn recognized by RNA polymerase I I I to form an a c t i v e i n i t i a t i o n "open" complex. T r a n s o r i p t i o n by the enzyme probably r e s u l t s i n the d e n a t u r a t i o n of the template ( S u l l i v a n and F o l k , 1987), but i s not b e l i e v e d to d i s r u p t the complex of TFIIIB, TFIIIC and the DNA (Wolffe et a l . , 1986) . For the f o l l o w i n g d i s c u s s i o n , the d e f i n i t i o n of a s t a b l e complex i s a template c o n t a i n i n g s t a b l y bound TFIIIB and TFIIIC. F o l l o w i n g the t e r m i n a t i o n of t r a n s c r i p t i o n , RNA polymerase I I I i s r e l e a s e d from the template and r e a s s o c i a t e s again with a t r a n s c r i p t i o n f a c t o r complex to r e i n i t i a t e t r a n s c r i p t i o n (Setzer and Brown, 1985). A number of experiments were c a r r i e d out to shed some l i g h t on the mechanism of 5 ' - f l a n k i n g TNNCT f u n c t i o n during t r a n s o r i p t i o n which would i n turn allow the f o r m u l a t i o n of a model to e x p l a i n the r o l e of TNNCT i n template a c t i v i t y . 173 A. T r a n s o r i p t i o n competition The p V 4 a . 5 - 1 3 8 , - 3 8 G , - 3 5 A template was used i n a t r a n s c r i p t i o n competition experiment with pS7a.5-119, the t R N A S e r 7 gene subcloned from pDt5. Competition experiments have been used to demonstrate the a b i l i t y of various templates i n forming s t a b l e t r a n s c r i p t i o n complexes by assaying t h e i r a b i l i t y to a f f e c t t r a n s c r i p t i o n of a re f e r e n c e gene (Schaack et a l . , 1983; S t . Louis and Spiegelman, 1985; L o f q u i s t and Sharp, 1986). T r a n s c r i p t i o n f o r pVUa.5-138 wi l d type and 5 ' - f l a n k i n g TNNCT mutant was c a r r i e d out with the simultaneous a d d i t i o n of pS7a.5-119. As can be seen from F i g u r e 30-A and 30-B, the l e v e l of tRNA^ e r* 7 gene t r a n s c r i p t i o n was reduced more i n the presence of the TNNCT mutant than with the wi l d type template. Therefore the TNNCT mutant was a b e t t e r competitor f o r pS7a.5-119 t r a n s c r i p t i o n than pV4a.5-138 wild type and d i d not appear to be d e f i c i e n t i n the formation of s t a b l e complexes. Hence the lowered Vmax of 5 ' - f l a n k i n g TNNCT mutant when compared to i t s p a r e n t a l wild type, cannot be due to a l e s s e r number of s t a b l e complexes formed as a r e s u l t of the slow formation of the complex (due to reduced b i n d i n g of t r a n s c r i p t i o n f a c t o r s ) or the i n s t a b i l i t y of a formed complex. I t i s p o s s i b l e that f o l l o w i n g complex formation on the Va 1 tRNA jj gene, the RNA polymerase I I I was bound to the complex on the mutant template, but due to the mutation in the TNNCT was unable to i n i t i a t e as f r e q u e n t l y as the wild type template. In suoh an i n s t a n c e the polymerase would be l e s s a v a i l a b l e f o r bi n d i n g and d i r e c t i n g t r a n s o r i p t i o n on the pS7a.5-119 complex. The c y c l i n g of RNA polymerase I I I has p r e v i o u s l y been demonstrated f o r t r a n s o r i p t i o n of 5S RNA genes (Setzer and Brown, 1985). In a separate competition experiment aimed at a s s e s s i n g the r a t e of complex formation f o r mutant and wild type pV4a.5-138, complexes were preformed by i n c u b a t i o n of a constant amount of template DNA with S-100 e x t r a c t f o r 0 to 50 minutes. To the preformed complexes was added pS7a.5-119 DNA and the e f f e c t s on t r a n s c r i p t i o n e f f i c i e n c i e s of the templates was determined. As shown i n F i g u r e 31-B, the t r a n s o r i p t i o n complexes on the pV4a.5-138 wild type and mutant templates appeared to be e q u a l l y s t a b l e . R e s u l t s from the pS7a.5-119 template ( F i g u r e 31-C) showed that the t R N A S e r 7 t r a n s c r i p t i o n was e q u a l l y a f f e c t e d by both the Va 1 tRNA i 1 ( w i l d type and 5 ' - f l a n k i n g TNNCT mutant templates. Therefore complexes on pV4a.5-138 wild type and mutant templates were formed i n s i m i l a r f a s h i o n and were not a f f e o t e d by mutations i n the 5 ' - f l a n k i n g TNNCT. B. E f f e c t of NaCl Previous s t u d i e s on the bi n d i n g of t r a n s o r i p t i o n f a c t o r s to a yeast t R N A L e u 3 g e n e had shown that NaCl a f f e c t e d the e f f i c i e n c y of t r a n s c r i p t i o n through the bin d i n g of t r a n s c r i p t i o n f a c t o r s . The bi n d i n g of TFIIIB was found to be more s e n s i t i v e to NaCl c o n c e n t r a t i o n of lUOmM than bi n d i n g of TFIIIC to the T c o n t r o l r e g i o n ( S t i l l m a n et a l . , 1984a). Since one p o s s i b l e e f f e c t of the TNNCT would be to change the b i n d i n g of t r a n s c r i p t i o n f a c t o r s , the wild type and mutant pV4a.5-138 templates were t e s t e d to determine whether they responded d i f f e r e n t l y to the e f f e c t s of NaCl dur i n g t r a n s c r i p t i o n . In one set of experiments, four d i f f e r e n t c o n c e n t r a t i o n s of wild type and mutant pV4a.5-138 were incubated with the S-100 e x t r a c t f o r 30 min to form s t a b l e complexes and r e a c t i o n s made 140 mM by the a d d i t i o n of NaCl. F o l l o w i n g a 60 min t r a n s c r i p t i o n , products were analyzed ( F i g u r e s 32 A and B) and Vmax values d e r i v e d f o r the template. The a d d i t i o n of NaCl to the r e a c t i o n s r e s u l t e d i n an approximately 80$ deorease i n Vmax f o r both wild type and 5 ' - f l a n k i n g TNNCT mutant templates, i n d i c a t i n g s i m i l a r s u s c e p t i b i l i t y of t h e i r complexes to the e f f e c t s of 140 mM NaCl. Although f o r the yeast tRNA gene reported by S t i l l m a n et a l . (1984a) 140 mM NaCl p r i m a r i l y a f f e c t e d the bindin g of TFIIIB, i t would appear that t h i s s a l t c o n c e n t r a t i o n may have d i s r u p t e d b i n d i n g of both TFIIIB and TFIIIC to the Va 1 tRNA ^ genes, thereby s e v e r e l y reducing the l e v e l of t r a n s c r i p t i o n . Since i t was p o s s i b l e that f a c t o r s may have g r a d u a l l y d i s s o c i a t e d from the templates i n the presence of 140 mM NaCl, an experiment was c a r r i e d out to t e s t the e f f e c t of 140 mM NaCl on preformed complexes with time. The time course of the e f f e c t of 140 mM NaCl during the course of t r a n s c r i p t i o n s of pV4a.5-138 wi l d type and mutant templates was a l s o analyzed. Complexes were allowed to form on a constant input of mutant and w i l d type template DNA f o r one hour and r e a c t i o n s made 140 mM by the a d d i t i o n of NaCl. At v a r i o u s times f o l l o w i n g the a d d i t i o n of NaCl, t r a n s c r i p t i o n was terminated and the products analyzed. F i g u r e 33-C shows a graph of data obtained i n t h i s experiment. R e s u l t s showed that the NaCl c o n c e n t r a t i o n s e v e r e l y i n h i b i t e d the t r a n s c r i p t i o n of both w i l d type and mutant templates w i t h i n ten minutes of i t s a d d i t i o n to the r e a c t i o n s . T h e r e f o r e preformed complexes of both w i l d type and the template mutant i n 5 ' - f l a n k i n g TNNCT d i d not appear to be d i f f e r e n t with r e s p e c t to the e f f e c t s of 140 mM NaCl. Since i t was p o s s i b l e that the r a t h e r high s a l t c o n c e n t r a t i o n of 140 mM masked any d i f f e r e n c e s i n s e n s i t i v i t y to NaCl c o n c e n t r a t i o n s between the w i l d type and mutant pV4a.5-138 templates, v a r i o u s NaCl c o n c e n t r a t i o n s were t e s t e d f o r t h e i r e f f e c t s on t r a n s c r i p t i o n . S t a b l e t r a n s c r i p t i o n complexes of w i l d type and mutant pV4a.5-138 were formed as before and NaCl added to the r e a c t i o n s at d i f f e r e n t c o n c e n t r a t i o n s . F i g u r e 34-B shows the e f f e c t of d i f f e r e n t NaCl c o n c e n t r a t i o n s on preformed complexes pV4a.5-138 w i l d type and mutant templates. I t can be seen from the Fi g u r e that both templates were e q u a l l y a f f e c t e d by the d i f f e r e n t NaCl c o n c e n t r a t i o n s , suggesting the e x i s t e n c e of complexes having s i m i l a r s t a b i l i t i e s on both the w i l d type and mutant templates. In a d d i t i o n , while DNase I f o o t p r i n t data by S t i l l m a n et a l . (1984a) showed s t a b l e TFIIIB a s s o c i a t i o n at an NaCl c o n c e n t r a t i o n of 120 mM, the r e s u l t s 177 reported here show that t r a n s o r i p t i o n was a f f e c t e d at NaCl c o n c e n t r a t i o n s below 120 mM (30 mM and above) f o r both wild type and mutant templates. Therefore i f the b i n d i n g of TFIIIB from D r o s o p h i l a was to occur with the same a f f i n i t y to the yeast tRNA gene, then some other component must be a f f e c t e d i n the t R N A V a l l t genes, due to the higher s e n s i t i v i t y of the D r o s o p h i l a tRNA genes to i o n i c s t r e n g t h . C. E f f e c t of temperature Previous s t u d i e s on the b i n d i n g of t r a n s c r i p t i o n f a c t o r s to the yeast t R N A L e u 3 gene had shown that temperatures i n the range of 0 to 20° C a f f e c t e d the b i n d i n g of f a c t o r s to the tRNA gene with the most s t a b l e i n t e r a c t i o n o c c u r r i n g at 20° C ( S t i l l m a n et a l . , 1985a). The s t a b i l i t y of b i n d i n g was analyzed by f o o t p r i n t a n a l y s i s and the data showed that a g r e a t e r amount of b i n d i n g occurred by i n c r e a s i n g the temperature to 20° C. S i m i l a r r e s u l t s were obtained by Andrews et a l . (1984) and Ruet et a l . (1984). In a d d i t i o n , Schaack et a l . (1983) showed that while s t a b l e complex formation on pArg occurred w i t h i n f i v e minutes and was independent of temperature between 24 and 30° C, the i n i t i a t i o n step which followed was a f f e c t e d by temperatures i n the same range. Two experiments were c a r r i e d out to determine the i n f l u e n c e of i n c r e a s e d temperatures on the t r a n s c r i p t i o n s of s t a b l e complexes formed on pV4a.5-138 w i l d type and 5 ' - f l a n k i n g TNNCT mutant templates. F i r s t , s t a b l e complexes were formed at 23.5° C f o r one hour and subsequently t r a n s f e r r e d to higher temperatures where t r a n s c r i p t i o n was continued f o r a f u r t h e r hour. F i g u r e 35-B summarizes the r e s u l t s obtained from t h i s experiment. As seen from the graph, there was an i n c r e a s e i n the percent t r a n s c r i p t i o n of both w i l d type and mutant complexes at 28° C, but t r a n s c r i p t i o n r a t e decreased with i n c r e a s i n g temperature to 34° C and s e v e r e l y diminished at 37° C I t i s important to note that both w i l d type and mutant templates followed a s i m i l a r p a t t e r n f o r the e f f e c t of i n c r e a s e d temperatures. The i n i t i a l i n c r e a s e i n t r a n s c r i p t i o n r a t e s due to a s h i f t to 28° C may simply r e f l e c t i n c r e a s e d p o l y m e r i z i n g a c t i v i t y by the polymerase enzyme. However, the e f f e c t s observed at higher temperatures probably i n v o l v e the d e s t a b i l i z a t i o n of s p e c i f i c f a c t o r s . In the second experiment, s t a b l e complexes were formed with a DNA input range of pV4a.5-138 w i l d type and mutant templates at 23.5° C and then t r a n s f e r r e d to 28° C. T r a n s c r i p t i o n products were analyzed ( F i g u r e 36) and Vmax values d e r i v e d f o r both templates at 23.5 and 28° C. Res u l t s showed that while t r a n s c r i p t i o n of both mutant and wi l d type templates i n c r e a s e d , the Vmax f o r pV4a.5-138 w i l d type i n c r e a s e d by two-fold over the Vmax f o r the 5 ' - f l a n k i n g TNNCT mutant. D. Time course of t r a n s c r i p t i o n The r e s u l t s from s e c t i o n s IV.B and IV.C i n v e s t i g a t i n g the e f f e c t s of temperature and i o n i c s t r e n g t h showed that s t a b l e complex formation f o r the t R N A V a 1 ^ genes was not a f f e c t e d by a l t e r i n g the 5 ' - f l a n k i n g TNNCT sequence. In a d d i t i o n , the r e s u l t s from the competition experiments showed that the mutation i n 5 ' - f l a n k i n g TNNCT was probably r e s p o n s i b l e f o r a f f e c t i n g the r a t e of t r a n s c r i p t i o n i n i t i a t i o n due to the a r r e s t of RNA polymerase I I I on the mutant template (see s e c t i o n IV.A). To determine whether any d i f f e r e n c e s e x i s t e d i n the time f o r t r a n s o r i p t i o n i n i t i a t i o n between the wild type and mutant pV4a.5-138 templates during the course of a t r a n s c r i p t i o n r e a c t i o n , template DNAs were incubated with the S-100 e x t r a c t under standard c o n d i t i o n s and t r a n s c r i p t i o n s were terminated every ten minutes f o r a t o t a l of two hours. Previous s t u d i e s on the time course of t r a n s c r i p t i o n had shown that the r e a c t i o n i s n o n - l i n e a r and i s c h a r a c t e r i z e d by a lag time preceding the time i n t e r v a l i n which t r a n s c r i p t i o n becomes l i n e a r with time (Rajput et a l . , 1982; Schaack et a l . , 1983). Data obtained from the t r a n s c r i p t i o n s are shown i n F i g u r e 37-C. Results showed that t r a n s c r i p t i o n could be detected w i t h i n ten minutes f o l l o w i n g the a d d i t i o n of S-100 e x t r a c t f o r both pV4a.5-138 wild type and mutant templates. Therefore no s i g n i f i c a n t d i f f e r e n c e i n lag e x i s t e d f o r complex formation and t r a n s c r i p t i o n i n i t i a t i o n between the wild type and mutant templates. The previous r e s u l t s showed that complexes formed on both mutant and wild type templates were e q u a l l y s t a b l e . In a d d i t i o n , the present experiment showed that the r a t e of formation of these complexes d i d not vary between the two templates. Therefore the data suggest that the a l t e r e d r a t e of t r a n s c r i p t i o n i n i t i a t i o n may be one p o s s i b i l i t y f o r the e f f e c t s observed. E. T r a n s c r i p t i o n i n i t i a t i o n The purpose of the f o l l o w i n g experiment was to measure s p e c i f i c a l l y the r a t e of t r a n s c r i p t i o n i n i t i a t i o n f o r f u l l -l e n gth t r a n s c r i p t s of pV4a.5-138 wild type and 5 ' - f l a n k i n g TNNCT mutant templates. Since the i n i t i a t i n g n u c l e o t i d e had p r e v i o u s l y been i d e n t i f i e d as -9G by S1 mapping ( S a j j a d i et a l . , 1987), t r a n s o r i p t i o n i n the presence of C7-^2P] GTP would allow the d e t e c t i o n of f u l l - l e n g t h , complete t r a n s c r i p t s i n i t i a t i n g at t h i s n u c l e o t i d e , although p a r t i a l e l o n g a t i o n products of i n i t i a t i o n would not be d e t e c t e d . T r a n s c r i p t i o n s were c a r r i e d out with both wild type and mutant templates, at s i x d i f f e r e n t DNA c o n c e n t r a t i o n s , i n the presence of e i t h e r [ & - 3 2P] TJTP or C/-^2?'] GTP. I f the 5 ' - f l a n k i n g TNNCT mutant was not d e f i c i e n t i n t r a n s c r i p t i o n i n i t i a t i o n , then both wild type and mutant templates would have a s i m i l a r value f o r Vmax f o r t r a n s c r i p t i o n s i n the presence of [7^- 3 2P] GTP. Resu l t s showed that the template d e f e c t i v e i n 5 ' - f l a n k i n g TNNCT was d e f e c t i v e i n the i n i t i a t i o n of t r a n s c r i p t i o n and had a Vmax 3^% lower than pV4a.5-138 wi l d type. The drop i n Vmax f o r t r a n s c r i p t i o n s i n the presence of ICL- 3 2P] DTP was 39% and hence very s i m i l a r to that observed with C/-^2?~\ GTP. Though only t r a n s c r i p t s longer than ten n u c l e o t i d e s could be detected on these g e l s , no accumulation of short or incomplete t r a n s c r i p t s was detected f o r e i t h e r the mutant or wi l d type 181 templates. I t t h e r e f o r e would appear that the 5 ' - f l a n k i n g mutations i n TNNCT do not a l t e r the r a t i o of s t a r t to complete t r a n s c r i p t s , i n d i c a t i n g that the mutations do not a f f e c t the e l o n g a t i o n r e a c t i o n . Hence i t would appear that TNNCT i s r e s p o n s i b l e f o r determining the e f f i c i e n c y of the s p e c i f i c i n i t i a t i o n of t r a n s c r i p t i o n of the t R N A V a l l t gene. V. Modulation of t r a n s o r i p t i o n by 5 ' - f l a n k i n g sequences  of a t R N A S e r 7 gene The t R N A S e r 7 gene from pDt5 (Table 4) d i r e c t s t r a n s c r i p t i o n at an e f f i c i e n c y comparable to pV4a.5-179. However, t h i s gene does not c o n t a i n a TNNCT i n i t s 5'-flank ( F i g u r e 24). Since the presence of TNNCT i n the 5'-flank was s t r o n g l y c o r r e l a t e d with e f f i c i e n t t r a n s c r i p t i o n , the tRNA 7 gene represented an exception to t h i s r u l e and became t h e r e f o r e the s u b j e c t of f u r t h e r study. To d e l i m i t the sequences r e q u i r e d f o r d i r e c t i n g e f f i c i e n t t r a n s c r i p t i o n of the S e r 7 gene, approximately 300 bp of 5'-flank was de l e t e d from a subclone of pDt5 by r e s t r i c t i o n with Hhal. The Hhal fragment was subjeoted to d i g e s t i o n with exonuclease BAL-31 and cloned i n t o p EMBL8-. When de l e t e d clones were sequenced i n t h e i r e n t i r e t y , i t was found that a l l c lones contained v a r y i n g amounts of 5 ' - f l a n k i n g d e l e t i o n s , but a l l r e t a i n e d 184 bp of 3 ' - f l a n k i n g sequence. BAL-31 t e r m i n a t i o n p r e f e r e n c e s i t e s had p r e v i o u s l y been encountered i n the 5'-flank of pV4a.5-138 ( S a j j a d i , 1985). 182 Table 3 shows the t r a n s c r i p t i o n e f f i c i e n c i e s of some of the d e l e t i o n d e r i v a t i v e s of pS7a.5-125. D e l e t i o n end-point pS7a.5-119 was found to d i r e c t t r a n s c r i p t i o n at wild type l e v e l s (pS5#1 , data not shown). Furt h e r d e l e t i o n of 5 1-f l a n k i n g sequences to p o s i t i o n -31 r e s u l t e d i n a s l i g h t i n c r e a s e i n Vmax (8$) r e l a t i v e to wild type. However, d e l e t i o n to p o s i t i o n -24 r e l a t i v e to the mature coding sequence r e s u l t e d i n a 57$ decrease i n the l e v e l of Ser^ t r a n s c r i p t i o n . D e l e t i o n end-point -24 had r e s u l t e d i n the removal of the sequence " 2^AGTTG" 2 5. I n t e r e s t i n g l y , the sequence i s a l s o present i n the 5*-flank of pV4a.5-138, lift _ H 1 - A G T T G . The d i s r u p t i o n of t h i s sequence i n the 5'-Va 1 f l a n k of the tRNA ^ gene had p r e v i o u s l y been shown to r e s u l t i n a 25$ decrease i n the l e v e l of t r a n s c r i p t i o n r e l a t i v e to pV4a.5-49 ( S a j j a d i et a l . , 1987). This suggests that AGTTG repr e s e n t s a second p o s i t i v e modulatory element i n the 5'-flank of the tRNA V a l l t gene. The sequence was a l s o found i n the 5'-flank of a t R N A A r g gene, pDt17R at p o s i t i o n " 4 0 A G T T G " 3 6 . The pDt17R gene (Table 4) which a l s o c o n t a i n s eight TNNCTs i n i t s 5*-flank i s reported to be the most e f f i c i e n t template f o r t r a n s o r i p t i o n which has yet been i d e n t i f i e d (C. Newton, p e r s o n a l oommunication) , though the c o n t r i b u t i o n of any of the 5 ' - f l a n k i n g sequences to i t s t r a n s c r i p t i o n e f f i c i e n c y remains to be determined. F u r t h e r d e l e t i o n of the t R N A S e r ? 5 « _ f i a n k to p o s i t i o n -18 r e s u l t e d i n an 81.5$ decrease i n Vmax. Therefore no f u r t h e r d e l e t i o n s of the 5'-flank were c r e a t e d . The r e l a t i v e p o s i t i o n o f t h e AGTTG s e q u e n c e i n t h e 5 ' - f l a n k o f t h e A r g i n i n e , S e r i n e and V a l i n e tRNA genes s u g g e s t s t h a t u n l i k e TNNCT w h i c h a p p e a r s t o r e q u i r e a d i s t a n c e o f 30 n u c l e o t i d e s f r o m t h e gene f o r e f f i c i e n t m o d u l a t i o n o f t r a n s c r i p t i o n , t h e AGTTG f u n c t i o n s v e r y e f f i c i e n t l y by i t s c l o s e r p r o x i m i t y t o t h e m a t u r e c o d i n g s e q u e n c e . The r e s u l t s i n d i c a t e t h a t t h e t R N A S e r 7 gene o n l y r e q u i r e s t h e i m m e d i a t e 30 n u c l e o t i d e s o f i t s 5 ' - f l a n k t o d i r e c t e f f i c i e n t t r a n s c r i p t i o n . However, i t may be p o s s i b l e f o r t h e p S 7 a . 5 -119 t e m p l a t e t o d i r e c t t r a n s c r i p t i o n more e f f i c i e n t l y ( p e r h a p s c o m p a r a b l e t o t h a t o f pDt17R o r pYH48 o r pViJa. 5 - 4 9 ) i f a TNNCT was p r e s e n t a t p o s i t i o n -35 i n i t s 5 ' - f l a n k . T h e r e f o r e t h e p o s i t i v e m o d u l a t i o n o f t r a n s c r i p t i o n by 5'-f l a n k i n g s e q u e n c e s a p p e a r s t o be more c o m p l i c a t e d t h a n s i m p l y h a v i n g a TNNCT p r e s e n t i n t h e 5 ' - f l a n k . A d d i t i o n a l m o d u l a t o r y s e q u e n c e s may s t i l l e x i s t w h i c h may o p e r a t e i n c o n c e r t w i t h TNNCT and AGTTG t o d e t e r m i n e t h e e f f i c i e n c y o f tRNA t r a n s c r i p t i o n . The mechanism o f f u n c t i o n f o r AGTTG i s open t o s p e c u l a t i o n and i n a d d i t i o n t o t h e i n t r a g e n i c TNNCT s e q u e n c e p r e s e n t i n t h e t R N A V a l 1 | gene r e q u i r e s f u r t h e r s t u d y . V I . M o d u l a t i o n o f p V t a . 5 - 1 3 8 t r a n s o r i p t i o n The r e s u l t s o f e x p e r i m e n t s r e p o r t e d i n t h i s s t u d y s u g g e s t t h a t t h e s e q u e n c e TNNCT i n t h e 5 ' - f l a n k o f pVUa.5-138 i s n o t i n v o l v e d i n e i t h e r t h e r a t e o f c o m p l e x f o r m a t i o n ( s e c t i o n I V . A ) , t h e m a i n t e n a n c e o f a s t a b l e c o m p l e x ( s e c t i o n s IV.B,C,D) or the r a t e of e l o n g a t i o n of a preformed complex ( s e c t i o n IV.E). Although s t a b l e complex formation has been p r e v i o u s l y shown to be dependent on the 5 ' - f l a n k i n g r e g i o n s , of 5S and tRNA genes (Schaack et a l . , 1984; Johnson-Burke and S o i l , 1985; T a y l o r and S e g a l l , 1985), i t does not appear that TNNCT a f f e c t s complex formation, although the pole of other sequences i n the 5'-flank of the Va 1 tRNA ^ gene i n i n f l u e n c i n g complex formation cannot be r u l e d out. In a d d i t i o n , the 5*-flank of the tRNA V a l ] t gene i s not capable of bi n d i n g a t r a n s o r i p t i o n f a c t o r r e q u i r e d f o r e f f i c i e n t t r a n s o r i p t i o n , at l e a s t i n the absence of a tRNA gene ( s e c t i o n I I ) . As disoussed e a r l i e r , the c u r r e n t model f o r t r a n s o r i p t i o n of tRNA genes i n v o l v e s the formation of s t a b l e complexes by b i n d i n g of f a c t o r TFIIIC and TFIIIB which are recognized by RNA polymerase I I I . S t a b l e t r a n s c r i p t i o n complexes are formed by the i n t e r a c t i o n of TFIIIC with the T c o n t r o l r e g i o n as a f i r s t step i n complex formation to form a metastable complex (Lassar et a l . , 1983; Johnson-Burke et a l . , 1985). The bi n d i n g of TFIIIB to the metastable complex serves to s t a b i l i z e t h i s a s s o c i a t i o n (Sharp et a l . , 1985). The tRNA gene c o n t a i n i n g a s t a b l e " p r e i n i t i a t i o n " t r a n s o r i p t i o n complex i s then recognized by RNA polymerase I I I to form an "open" complex which would i n turn i n i t i a t e t r a n s c r i p t i o n upstream of the f a c t o r b i n d i n g s i t e s . The r o l e of TNNCT i n the model assumes that f o l l o w i n g the a s s o c i a t i o n of polymerase with the s t a b l e complex, the polymerase would a l s o contact the modulatory sequences (such as TNNCT or AGTTG) present i n the 5'-flank of the gene. The d i r e c t i n t e r a c t i o n of RNA polymerase I I I with the s t a b l e complex and the 5 ' - f l a n k i n g TNNCT would determine the r a t e of t r a n s c r i p t i o n i n i t i a t i o n by the bound polymerase. F o l l o w i n g one round of t r a n s c r i p t i o n on the template, the polymerase would d i s s o c i a t e , l e a v i n g TFIIIB and TFIIIC bound on the template. The c y c l e would then be repeated ( F i g u r e 39). Recent s t u d i e s have shown that f o l l o w i n g s t a b l e complex formation, TFIIIC and TFIIIB remain s t a b l y bound to the template p r i o r to r e i n i t i a t i o n by RNA polymerase I I I ( G o t t e s f e l d , 1986; F e l t s et a l . , 1987). The 5 ' - f l a n k i n g TNNCT of tRNA^al^ g e n e m & y b e i n v o l v e d i n p r o v i d i n g a s i g n a l d u r i n g the i n t e r a c t i o n between the 5'-f l a n k and the polymerase to i n f l u e n c e the frequency of t r a n s c r i p t i o n i n i t i a t i o n . The r e s u l t s of experiments re p o r t e d i n t h i s study have shown that formation of a s t a b l e complex was not a f f e c t e d by the mutation i n 5 ' - f l a n k i n g TNNCT. The lowered t r a n s c r i p t i o n r a t e s of the TNNCT mutant suggest that the i n i t i a t i o n of t r a n s c r i p t i o n has been a f f e c t e d . The r e s u l t s are t h e r e f o r e c o n s i s t e n t with a p o s s i b l e r o l e f o r TNNCT i n the step f o l l o w i n g complex formation i n a two-step model f o r s t a b l e complex formation (Sharp et a l . , 1985; see a l s o s e c t i o n I I I . i n the I n t r o d u c t i o n ) . The i n t e r a c t i o n of RNA polymerase I I I with the 5 ' - f l a n k i n g sequences of tRNA genes has been p r e v i o u s l y considered by Morton and Sprague (1982) and more r e c e n t l y by L o f q u i s t and Sharp (1986) and may be e v e n t u a l l y demonstrated i n a p u r i f i e d t r a n s c r i p t i o n system. The e f f e c t s observed f o r the mutation i n the i n t r a g e n i c TNNCT are probably u n r e l a t e d to those observed with the 5'-f l a n k i n g TNNCT mutant. This suggests that the model f o r the c o n t r o l of tRNA gene t r a n s o r i p t i o n i s more complicated, s i n c e i n a d d i t i o n to the modulatory e f f e c t s of 5 ' - f l a n k i n g sequences on the D and T c o n t r o l r e g i o n s , a d d i t i o n a l sequences i n the gene a l s o p l a y a r o l e i n d i r e c t i n g t r a n s c r i p t i o n . The many d i f f e r e n t c o n t r o l sequences present i n the 5'-f l a n k i n g r e g i o ns of tRNA genes and the i n c o m p a t i b i l i t y of 5 ' - f l a n k i n g and i n t r a g e n i c sequences between d i f f e r e n t tRNA genes (Cooley et a l . , 1985) r e f l e c t the degree of complexity r e q u i r e d to b r i n g about t r a n s c r i p t i o n a l r e g u l a t i o n of the vast number of tRNA genes jtn v i v o . 187 F i g u r e 39 A model f o r the mechanism of tRNA gene t r a n s c r i p t i o n The model shows the s t r u c t u r e of a tRNA gene and var i o u s c o n t r o l sequence elements. Tn, T, D, i and TNNCT correspond to the poly T t e r m i n a t i o n s i g n a l , the T - c o n t r o l , and the D - c o n t r o l r e g i o n s , the region of t r a n s c r i p t i o n i n i t i a t i o n and the p o s i t i v e modulatory sequence r e s p e c t i v e l y . Arrows d e f i n e the boundaries of DNA or p r o t e i n c o n t a c t s f o r t r a n s c r i p t i o n f a c t o r s and RNA polymerase I I I . The pathway to s t a b l e complex formation i s i n i t i a t e d by the i n t e r a c t i o n of TFIIIC2 with the T - c o n t r o l r e g i o n and TFIIIC1 with the D-c o n t r o l r e g i o n . T h i s metastable complex i s then recognized by TFIIIB which serves to s t a b i l i z e the complex by p r o t e i n - p r o t e i n c o n t a c t s alone. F i n a l l y , RNA polymerase I I I re c o g n i z e s the s t a b l e complex of TFIIIC2, TFIIIC1 and TFIIIB and by bi n d i n g to the complex, con t a c t s TNNCT i n the 5 ' - f l a n k i n g r e g i o n . The r a t e of t r a n s c r i p t i o n i n i t i a t i o n i s modulated by TNNCT and f o l l o w i n g t e r m i n a t i o n of t r a n s c r i p t i o n , the enzyme d i s s o c i a t e s , l e a v i n g the s t a b l e complex f r e e to r e a s s o c i a t e with RNA polymerase I I I . TNNCT D Tn -TFIIIC1 -TFIIIC2 Metastable Complex TNNCT TFIIIB — D << TFIIIC1 1 -TFIIIC2 Tn Stable "Preinitiation" Complex TNNCT -TFIIIB D i 1 ^ TFIIIC1 -RNA POLYMERASE III Tn -TFIIIC2 Active Initiation "open-Complex REFERENCES Addison, W.R., A s t e l l , C.R., Delaney, A.D., G i l l a m , I.C., Hayashi, S., M i l l e r , R.C., Rajput, B., Smith, M., T a y l o r , D.M. and Tener, G.M. ( 1 9 8 2 ) . The s t r u c t u r e s of genes h y b r i d i z i n g with t R N A 7 3 1 . f r o m D r o s o p h i l a melanogaster. J . B i o l . Chem. 257: 6 7 0 - 6 7 3 . Adeniyi-Jones, S., Romeo, P.H. and Z a s l o f f , M. (1984). Generation of long read-through t r a n s c r i p t s in. v i v o and i n v i t r o by d e l e t i o n of 3 ' t e r m i n a t i o n and p r o c e s s i n g sequences i n the human t R N A M e t i g e n e . Nucl. Acids Res. 1_2: 1101-1115. A l l i s o n , D.S., Goh, S.H. and H a l l , B.D. (1983). The promoter sequence of a yeast t R N A T y r gene. C e l l 3_4: 655-664 . Andrews, D.L., M i l l s t e i n , L., Hamkalo, B.A. and G o t t e s f e l d , J.M. (1984). Competition between Xenopus s a t e l l i t e I sequences and P o l I I I genes f o r s t a b l e complex formation. Nucl. Acids Res. 12: 7753-7769. Arnold, G.J., Schmutzler, C , Thomann, U., van T o l , H. and Gross, H. (1986). The human t R N A V a l gene f a m i l y : o r g a n i z a t i o n , n u c l e o t i d e sequences and homologous t r a n s c r i p t i o n of three s i n g l e - c o p y genes. Gene 4_4: 287-297. Arnold, G.J. and Gross, H.J. (1987). Unrelated l e a d e r sequences can e f f i c i e n t l y promote human tRNA gene t r a n s c r i p t i o n . Gene 5J_: 237-246. Atkinson, T. and Smith, M. (1984). In o l i g o n u c l e o t i d e s y n t h e s i s : a p r a c t i c a l approach, (ed. M.J. G a i t ) . IRL Press Oxford, England, pp.35-81. Baker, R.E., G a b r i e l s o n , 0. H a l l , B.D. (1986). E f f e c t s of TRNA T v r p o i n t mutations on the b i n d i n g of yeast RNA polymerase I I I t r a n s c r i p t i o n f a c t o r C. J . B i o l . Chem. 261: 5275-5282. B a l d i , M.I., M a t t o c c i a , E. and T o c c h i n i - V a l e n t i n i , G.P. (1983). Role of RNA s t r u c t u r e i n s p l i c i n g : E x c i s i o n of the i n t e r v e n i n g sequence i n yeast tRNA t e u_ j . s dependent on the formation of a D stem. C e l l 3_5: 109-115. B i e k e r , J . J . and Roeder, R.G. (1986). C h a r a c t e r i z a t i o n of the n u c l e o t i d e requirement f o r e l i m i n a t i o n of the r a t e -l i m i t i n g step i n 5S RNA gene t r a n s c r i p t i o n . J . B i o l . Chem. 261 : 9732-9738. Bogenhagen, D.F., Sakonju, S. and Brown, D.D. (1980). A c o n t r o l r e g i o n i n the center of the 5S RNA gene d i r e c t s s p e c i f i c i n i t i a t i o n of t r a n s c r i p t i o n : I I . The 3 ' border of the r e g i o n . C e l l 19.: 27-35. 190 Bogenhagen, D.F. and Brown, D.D. (1981). N u c l e o t i d e sequences i n Xenopus 5S DNA r e q u i r e d f o r t r a n s c r i p t i o n t e r m i n a t i o n . C e l l 24: 261-270. Bogenhagen, D.F. (1985). The i n t r a g e n i c c o n t r o l r e g i o n of the Xenopu3 5S RNA gene con t a i n s two f a c t o r A bindin g domains that must be a l i g n e d p r o p e r l y f o r e f f i c i e n t t r a n s c r i p t i o n i n i t i a t i o n . J . B i o l . Chem. 260: 6466-6471. Brown, D.D. (1984). The r o l e of s t a b l e complexes that r e press and a c t i v a t e e u k a r y o t i c genes. C e l l 3_7_: 359-365. Camier, S., G a b r i e l s o n , 0., Baker, R. and Sentenac, A. (1985). A s p l i t b i n d i n g s i t e f o r t r a n s c r i p t i o n f a c t o r on the t R N A G l u 3 gene. EMBO J . 4: 491-500. Carey, M.F., Singh, K., Botchan, M. and C o z z a r e l l i , N. (1986a). I n d u c t i o n of s p e c i f i c t r a n s c r i p t i o n by RNA polymerase I I I i n transformed c e l l s . Mol. C e l l . B i o l . 3068-3076. Carey, M.F., Gerrard, S.P. and C o z z a r e l l i , N.R. (1986b). A n a l y s i s of RNA polymerase I I I t r a n s c r i p t i o n complexes by g e l f i l t r a t i o n . J . B i o l . Chem. 261 : 4309-4317. Chang, Y.N., P i r t l e , I.L. and P i r t l e , R.M. (1986). N u c l e o t i d e sequence and t r a n s c r i p t i o n of a human tRNA gene c l u s t e r with four genes. Gene 4_8: 165-174. Ciampi, M.S., Melton, D.A. and Cortese, R. (1982). S i t e -d i r e c t e d mutagenesis of a tRNA gene: base a l t e r a t i o n s i n the coding r e g i o n a f f e c t t r a n s c r i p t i o n . Proc. N a t l . Acad. S c i . USA 79: 1388-1392. C i l i b e r t o , G., C a s t a g n o l i , L., Melton, D.A. and Cortese, R. (1982a). Promoter of a eu k a r y o t i c t R N A P r o gene i s composed of noncontiguous r e g i o n s . Proc. N a t l . Acad. S c i . USA 79: 1195-1199. C i l i b e r t o , G. , Tra b o n i , C. and Cortese, R. (1982b). R e l a t i o n s h i p between the two components of the s p l i t promoter of e u k a r y o t i c tRNA genes. Proc. N a t l . Acad. S c i . USA X£: 1921-1925. C i l i b e r t o , G., Raugei, G., Costanzo, F., Dente, L. and Cortese, R. (1983). Common and i n t e r c h a n g e a b l e elements i n the promoters of genes t r a n s c r i b e d by RNA polymerase I I I . C e l l 3.2: 725-733. Cooley, L., Schaack, J . , Johnson-Burke, D., Thomas, B. and S o i l , D. (1984). T r a n s c r i p t i o n f a c t o r b i n d i n g i s l i m i t e d by the 5_'-flanking r e g ions of a D r o s o p h i l a t R N A H i s gene and a t R N A H i s pseudogene. Mol. C e l l . B i o l . 4: 2714-2722. 191 C o z z a r e l l i , N.R., Gerrard, S.P., S c h l i s s e l , M., Brown, D.D. and Bogenhagen, D.F. (1983). P u r i f i e d RNA polymerase I I I a c c u r a t e l y and e f f i c i e n t l y terminates t r a n s c r i p t i o n of 5S RNA genes. C e l l 3_4: 829-835 . Das, G., Henning, D. and Reddy, R. (1987). S t r u c t u r e , o r g a n i z a t i o n and t r a n s c r i p t i o n of D r o s o p h i l a U6 small n u c l e a r RNA genes. J . B i o l . Chem. 262: 1187-1193. DeFranco, D., Sharp, S.J. and S o i l , D. (1981). I d e n t i f i c a t i o n of r e g u l a t o r y sequences contained i n the 5'-f l a n k i n g r e g i o n of D r o s o p h i l a l y s i n e tRNA_ genes. J . B i o l . Chem. 256: 1 2 4 2 U -1 2 4"29T DeFranco, D., Burke, K.B., Hayashi, S., M i l l e r , R.C. and S o l i , D. (1982). Genes f o r t R N A L v s f r o m D r 0 3 0 p n i l a  melanogaster. Nucl. Acids Res. J_0: 5799-5o08. Dente, L., C e s a r i n i , G. and Cortese, R. (1983). pEMBL: a new f a m i l y of s i n g l e - s t r a n d e d plasmids. Nucl. Acids Res. 11 : 1645-1655. Dingermann, T., Johnson Burke, D., Sharp, S., Schaack, J . and S o i l , D. (1982). The 5 ' - f l a n k i n g sequences of D r o s o p h i l a tRNA A rS genes c o n t r o l t h e i r in_ v i t r o t r a n s c r i p t i o n i n a D r o s o p h i l a c e l l e x t r a c t . J . B i o l . Chem. 257: 14738-14744. Dingermann, T., Sharp, S., Schaack, J . and S o l i , D. (1983). S t a b l e t r a n s c r i p t i o n complex formation of eu k a r y o t i c tRNA genes i s dependent on a l i m i t e d s e p a r a t i o n of the two i n t r a g e n i c c o n t r o l r e g i o n s . J . B i o l . Chem. 258: 10395-10402. Duncan C , B i r o , P.A., Chondary, P.V., E l d e r , J.T., Wang, R.R.C., Forget, B., De R i e l , J.K. and Weissman, S.M. (1979). RNA polymerase I I I t r a n s c r i p t i o n a l u n i t s are i n t e r s p e r s e d among human non-Ct-globin genes. Proc. N a t l . Acad. S c i . USA 16: 5095-5099. Dunn, R., Delaney, A.D., G i l l a m , I.C., Hayashi, S., Tener, G.M., G r i g l i a t t i , T., M i s r a , V., Spuer, M.G., T a y l o r , D.M. and M i l l e r , R.C. J r . (1979). I s o l a t i o n and c h a r a c t e r i z a t i o n of recombinant DNA plasmids c a r r y i n g D r o s o p h i l a tRNA genes. Gene 7: 197-215. F e l t s , S.J., Weil, P.A. and Chalkey, R. (1987). Novobiocin i n h i b i t s i n t e r a c t i o n s r e q u i r e d f o r yeast TFIIIB s e q u e s t r a t i o n d u r i n g s t a b l e t r a n s c r i p t i o n complex formation i n v i t r o . Nucl. Acids Res. J_5: 1493-1506. Fol k , W.R. and H o f s t e t t e r , H. (1983). A d e t a i l e d mutational a n a l y s i s of the e u k a r y o t i c t R N A M e t 1 gene promoter. C e l l 33: 585-593. 192 Fowlkes, D.M. and Shenk, T. (1980). T r a n s c r i p t i o n c o n t r o l r e g i o ns of adenovirus VAI RNA gene. C e l l 22: 405-413. Fuhrman, S.A., D e i n i n g e r , P^L., LaPorte, P., Friedman, T. and Geiduschek, E.P. (1981). A n a l y s i s of t r a n s c r i p t i o n of the human Alu f a m i l y u b i q u i t o u s r e p e a t i n g element bu e u k a r y o t i c RNA polymerase I I I . Nucl. Acids Res. 9_: 6439-6446. Fuhrman, S.A., Engelke, D.R. and Geiduschek, E.P. (1984). HeLa c e l l polymerase I I I t r a n s c r i p t i o n f a c t o r s . F u n c t i o n a l c h a r a c t e r i z a t i o n of a f r a c t i o n i d e n t i f i e d by i t s a c t i v i t y i n a second template rescue assay. J . B i o l . Chem. 259 : 1934-1943. G a r c i a , A.D., O'Connell, A.M. and Sharp, S. (1987). Formation of an a c t i v e t r a n s c r i p t i o n complex i n the D r o s o p h i l a melanogaster 5S RNA gene i s dependent on an upstream r e g i o n . Mol. C e l l . B i o l . 7_: 2046-2051 . Goddard, J.P., S q u i r e , M., Bienz, M. and Smith, J.D. (1983). A human tRNA G* u gene of high t r a n s c r i p t i o n a l a c t i v i t y . N ucl. Acids Res. JJ_: 2551-2560. Goodman, H.M., Olson, M.V. and H a l l , B.D. (1977). N u c l e o t i d e sequence of a mutant e u k a r y o t i c gene: the yeast t y r o s i n e -i n s e r t i n g ochre suppressor SUP4-o. Proc. N a t l . Acad. S c i . 74: 5453-5457. G o t t e s f e l d , J . and Bloomer, L.S. (1982). Assembly of t r a n s c r i p t i o n a l l y a c t i v e 5S RNA gene chromatin i n v i t r o . C e l l 28: 781-791. G o t t e s f e l d , J.M. (1986). Novobiocin i n h i b i t s RNA polymerase I I I t r a n s c r i p t i o n i n v i t r o by a mechanism d i s t i n c t from DNA topoisomerase I I . Nucl. Acids Res. J_4: 2075-2088. Glew, L., Lo, R., Reece, T., N i c h o l s , M., S o l i , D. and B e l l , J . (1986). The n u c l e o t i d e sequence, l o c a l i z a t i o n and t r a n s c r i p t i o n a l p r o p e r t i e s of a tRNA^eu^,yQ gene from D r o s o p h i l a melanogaster. Gene 4_4_: 307-314. G u i l f o y l e , R. and Weinmann, R. (1981). C o n t r o l r e g i o n f o r adenovirus VA RNA t r a n s c r i p t i o n . Proc. N a t l . Acad. S c i . USA 78: 3378-3382. Hanas, J.S., Bogenhagen, D.F. and Wu, C.W. (1984). DNA unwinding a b i l i t y of Xenopus t r a n s c r i p t i o n f a c t o r A. Nucl. Acids Res. J_2: 1265-1275. Haynes, S.R. and J e l i n e k , W.R. (1981). Low molecular weight RNAs t r a n s c r i b e d i n v i t r o by RNA polymerase I I I from Alu-type d i s p e r s e d repeats i n Chinese hamster DNA are a l s o found i n v i v o . Proc. N a t l . Acad. S c i . USA 78.: 6130-6134. 193 H a r r i s , J.S. and Roeder, R.G. (1978). S t r u c t u r a l r e l a t i o n s h i p s of low molecular weight v i r a l RNAs sy n t h e s i z e d by RNA polymerase I I I i n n u c l e i from Adenovirus 2 - i n f e c t e d c e l l s . J . B i o l . Chem. 2J53_: 4120-4127. Hatamochi, A., Paterson, B. and de Crambougghe, B. (1986). D i f f e r e n t i a l b i n d i n g of a CCAAT DNA b i n d i n g f a c t o r to the promoters of the mouse 0.2(1) and CL1(III) c o l l a g e n genes. J . B i o l . Chem. 261: 11310-11314. Hess, J . , P e r e z - S t a b l e , C , Wu, G.J., Weir, B., Tinoco, I. and Shen, C.K. (1985). End-to-end t r a n s c r i p t i o n of an Alu f a m i l y r e p e a t . A new type of Polymerase-III-dependent terminator and i t s e v o l u t i o n a r y i m p l i c a t i o n . J . Mol. B i o l . 184: 7-21. H i p s k i n d , R.A. and C l a r k s o n , S.G. (1983). 5 ' - f l a n k i n g sequences that i n h i b i t iri v i t r o t r a n s c r i p t i o n of a Xenopus  l a e v i s tRNA gene. C e l l 3_4 : 881-890. H o f s t e t t e r , H., Kressman, A. and B i r n s t i e l , M.L. (1981). A s p l i t promoter f o r a e u k a r y o t i c tRNA gene. C e l l 2_4: 573-585. Huet, J . , Riva, M., Sentenac, A. and Fromageot, P. (1985). Yeast RNA polymerase C and i t s s u b u n i t s . S p e c i f i c a n t i b o d i e s as s t r u c t u r a l and f u n c t i o n a l probes. J . B i o l . Chem. 260: 15304-1510. Indik, Z.K. and T a r t o f f , K.D. (1982). Glutamate tRNA genes are adjacent to 5S RNA genes i n D r o s o p h i l a and r e v e a l a conserved upstream sequence (the ACT-TA box). Nucl. Acids Res. 1_0: 4159-4173. Jahn, D., Wingender, E. and S e i f a r t , K.H. (1987). T r a n s c r i p t i o n complexes f o r v a r i o u s c l a s s I I I genes d i f f e r i n parameters of formation and s t a b i l i t y towards s a l t . J . Mol. B i o l . 121: 303-313. J a t , P. and Arrand, J.R. (1982). In. v i t r o t r a n s c r i p t i o n of two Epstein-Bar v i r u s s p e c i f i e d s m a l l RNA molecules. Nucl. Acids Res. 1_0: 3407-3414. J e l i n e k , W.R., Toomey, T.P., Leinward, L., Duncan, C.H., Bivo, P.A., Chondary, P.V., Weissman, S.M., Rubin, CM., Houck, CM., D e i n i n g e r , P.L. and Schmid, CW. (1980). U b i q u i t o u s , i n t e r s p e r s e d repeated sequences i n mammalian genomes. Proc. N a t l . Acad. S c i . USA JJ_: 1398-1402. Johnson, J.D. and Raymond, G.J. (1984). Three regions of a yeast t R N A L e u gene promote RNA polymerase I I I t r a n s c r i p t i o n . J. B i o l . Chem. 259: 5990-5994. 194 Johnson-Burke, D. , Schaack, J . , Sharp, S. and S o i l , D. (1983). P a r t i a l p u r i f i c a t i o n of D r o s o p h i l a Kc c e l l RNA polymerase I I I t r a n s c r i p t i o n components. Evidence f o r shared 5S RNA and tRNA gene f a c t o r s . J . B i o l . Chem. 258: 15224-15231• Johnson-Burke, D. and S o i l , D. (1985). F u n c t i o n a l a n a l y s i s of f r a c t i o n a t e d D r o s o p h i l a Kc c e l l tRNA gene t r a n s c r i p t i o n components. J . B i o l . Chem. 260: 816-823. Jones, K.A., Kadonga, J.T., Rosenfeld, P.J., K e l l y , T.J. and T i j i a n , R. (19 8 7 ) . A c e l l u l a r DNA-binding p r o t e i n that a c t i v a t e s e u k a r y o t i c t r a n s c r i p t i u o n and DNA r e p l i c a t i o n . C e l l 48.: 79-89. Klekamp, M.S. and Weil, P.A. (1982). S p e c i f i c t r a n s c r i p t i o n of homologous c l a s s I I I genes i n y e a s t - s o l u b l e c e l l - f r e e e x t r a c t s . J . B i o l . Chem. 257: 8432-8441. Klekamp, M.S. and Weil, P.A. (1986 ). P a r t i a l p u r i f i c a t i o n and c h a r a c t e r i z a t i o n of the Saccharomyces c e r e v i s i a e t r a n s c r i p t i o n f a c t o r TFIIIB. J . B i o l . Chem. 261: 2819-2827. Klekamp, M.S. and Weil, P.A. (1987). P r o p e r t i e s of y e a 3 t t r a n s c r i p t i o n f a c t o r TFIIIB: I m p l i c a t i o n s r e g a r d i n g mechanism of a c t i o n . J . B i o l . Chem. 262: 7 8 7 8 - 7 8 8 3 . Kovesdi, I . , R e i c h e l , R. and Nevins, J.R. (1986). I d e n t i f i c a t i o n of a c e l l u l a r t r a n s c r i p t i o n f a c t o r i n v o l v e d i n E1A t r a n s - a c t i v a t i o n . C e l l 45.: 219-228. Kraus, K.W., Good, P.J. and H a l l b e r g , R.L. (1987). A heat shock-induced, polymerase I l l - t r a n s c r i b e d RNA s e l e c t i v e l y a s s o c i a t e s with polysomal ribosomes i n Tetrahymena  thermophila. Proc. N a t l . Acad. S c i . USA 8|: 383-387. K r o l , A., Carbon, P., Eb e l , J.P. and Appel, B. (1987). Xenopus t r o p i c a l i s U6 snRNA genes t r a n s c r i b e d by Pol I I I co n t a i n the upstream promoter elements used by Pol I I dependent U snRNA genes. Nucl. Acids Res. 15: 2463-2478. Kunkel, G.R., Maser, R.L., C a l v e t , J . P. and Pederson, T. (1986). U6 smal l n u c l e a r RNA i s t r a n s c r i b e d by RNA polymerase I I I . Proc. N a t l . Acad. S c i . USA 83_: 8575-8579. Kunkel, T.A. (1985). Rapid and e f f i c i e n t s i t e - s p e c i f i c mutagenesis without phenotypic s e l e c t i o n . Proc. N a t l . Acad. S c i . USA 82.: 488-492. Kunkel, T.A., Roberts, J.D. and Zakour, R.A. (1987). Rapid and e f f i c i e n t s i t e - s p e c i f i c mutagenesis without phenotypic s e l e c t i o n . Methods i n Enzymol. i n pr e s s . L a r s o n , D., B r a d f o r d - W i l c o x , J . , Young, L.S. and Sprague, K.U. (1983). A s h o r t 5 ' - f l a n k i n g r e g i o n c o n t a i n i n g conserved sequences i s r e q u i r e d f o r s i l k w o r m a l a n i n e tRNA gene a c t i v i t y . P r o c . N a t l . Acad. S c i . USA 80.: 3416-3420. L a s s a r , A.B., M a r t i n , P.L. and Roeder, R.G. (1983). T r a n s c r i p t i o n of c l a s s I I I genes: F o r m a t i o n of p r e i n i t i a t i o n complexes. S c i e n c e 222: 740-748. L a s s a r , A.B., Hamer, D.H. and Roeder, R.G. (1985). S t a b l e t r a n s c r i p t i o n complex on a c l a s s I I I gene i n a minichromosome. M o l . C e l l . B i o l . 5_: 40-45. Leung, J . , A d d i s o n , W.R., Delaney, A.D., Mackay, R.M., M i l l e r , R . C , Spiegelman, G.B., G r i g l i a t t i , T.A. and Tener, G.M. (1984). D r o s o p h i l a m elanogaster t R N A V a l _ , genes and t h e i r allogenesT Gene 34": 207-217. L o f q u i s t , A. and Sharp, S. (1986). The 5 ' - f l a n k i n g sequences of D r o s o p h i l a m e l a n o g a s t e r t R N A A s n genes d i f f e r e n t i a l l y a r r e s t RNA polymerase I I I . J . B i o l . (Jhem. 261 : 14600-14606. M a n i a t i s , T., F r i t s c h , E.F. and Sambrook, J . (1982). M o l e c u l a r C l o n i n g , a L a b o r a t o r y Manual. ( C o l d S p r i n g Harbor, New York: C o l d S p r i n g Harbor L a b o r a t o r y ) . M a r z o u k i , N., Camier, S., Ruet, A., Moenne, A. and Sentenac, A. (1986). S e l e c t i v e p r o t e o l y s i s d e f i n e s two DNA b i n d i n g domains i n y e a s t t r a n s c r i p t i o n f a c t o r . Nature 3 2 3 : 1 7 6 -178. Maxam, A.M. and G i l b e r t , W. (1980). Sequencing e n d - l a b e l l e d DNA w i t h b a s e - s p e c i f i c c l e a v a g e s . Methods i n Enzymol. 65.: 499-560. McKinnon, R.D., S h i n n i c k , T.M. and S u t c l i f f e , J.G. (19 86) . The n e u r o n a l i d e n t i f i e r element i s a c i s - a c t i n g p o s i t i v e r e g u l a t o r of gene e x p r e s s i o n . P r o c . N a t l . Acad. S c i . USA 83: 3751-3755. M e s s i n g , J . , C r e a , R. and Seeberg, P.H. (1981). A system f o r shotgun DNA s e q u e n c i n g . N u c l . A c i d s Res. £: 309-320. M i k s i c e k , R., Borgmeyer, U. and Nowok, J . (1987). I n t e r a c t i o n of the TGGCA-binding p r o t e i n w i t h upstream sequences i s r e q u i r e d f o r e f f i c i e n t t r a n s c r i p t i o n of mouse mammary tumor v i r u s . EMB0 J . 6.: 1355-1360. Morry, M.J. and H a r d i n g , J.D. (1986). M o d u l a t i o n of t r a n s c r i p t i o n a l a c t i v i t y and s t a b l e complex f o r m a t i o n by 5'-f l a n k i n g r e g i o n s of mouse t R N A H i s genes. M o l . C e l l . B i o l . 6_: 105-115. 196 Morton, G.D. and Sprague, K.U. (1982). Silkworm 5S RNA and tRNA genes share h i g h l y conserved 5 ' - f l a n k i n g and coding sequences. Mol. C e l l . B i o l . 2: 1524-1531. Murphy, M.H. and B a r a l l e , F.E. (1984). C o n s t r u c t i o n and f u n c t i o n a l a n a l y s i s of a s e r i e s of s y n t h e t i c RNA polymerase I I I promoters. J . B i o l . Chem. 25_9_: 10208-10201 1 . Naumovski, L. and F e i n b e r g , E.C. (1986). A n a l y s i s of the e s s e n t i a l and e x c i s i o n r e p a i r f u n c t i o n s of RAD3 gene of Saocharomyces c e r e v i s i a e by mutagenesis. Mol. C e l l . B i o l . 6_: 1218-1227. Newman, A.J.. Ogden, R.C. and Abelson, J . (1983). tRNA gene t r a n s c r i p t i o n i n yeast : E f f e c t s of base s u b s t i t u t i o n s i n the i n t r a g e n i c promoter. C e l l 3_5_: 117-125. Ng, S.Y., Parker, C.S. and Roeder, R.G. (1979). T r a n s c r i p t i o n of cloned Xenopus 5S RNA genes by X. l a e v i s RNA polymerase I I I i n r e c o n s t i t u t e d systems. Proc. N a t l . Acad. S c i . USA 7_6: 136-140. O t t o n e l l o , S., R i v i e r , D.H., D o o l i t t l e , G.M., Young, L.S. and Sprague, K.U. (1987). The p r o p e r t i e s of a new polymerase I I I t r a n s c r i p t i o n f a c t o r r e v e a l that t r a n s c r i p t i o n complexes can assemble by more than one pathway. EMBO J . 6.: 1921-1927. Parker, C.S. and Roeder, R.G. (1977). S e l e c t i o n and ac c u r a t e t r a n s c r i p t i o n of the Xenopus l a e v i s 5S RNA genes i n i s o l a t e d chromatin by p u r i f i e d RNA polymerase I I I . Proc. N a t l . Acad. S c i . USA 21: 44-48. Rajput, B., Duncan, L., D e M i l l e , D., M i l l e r , R.C. J r . and Spiegelman, G.B. (1982). T r a n s c r i p t i o n of cloned t r a n s f e r RNA genes from D r o s o p h i l a melanogaster i n a homologous c e l l -f r e e e x t r a c t . Nucl. Acids Res. _1_0: 6541-6550. Raymond, G.J. and Johnson, J.D. (1983). The r o l e of non-coding DNA sequences i n t r a n s c r i p t i o n and p r o c e s s i n g of a yeast tRNA. Nucl. Acids Res. J M : 5969-5988. Reddy, R., Henning, D., Das, G., H a r l e s s , M. and Wright, D. (1987). The capped U6 small n u c l e a r RNA i s t r a n s c r i b e d by RNA polymerase I I I . J, B i o l . Chem. 262: 75-81. Roeder, R.G. (1976). E u k a r y o t i c n u c l e a r RNA polymerases. In RNA polymerases, R. Lo s i c k and M. Chamberlain ( e d s . ) . Cold Spring Harbor Laboratory, New York, pp. 285-329. Rohan, R.M. and Ketner, G. (1987). A comprehensive c o l l e c t i o n of po i n t mutations i n the i n t e r n a l promoter of Ade n o v i r a l VAj g e n e . J . B i o l . Chem. 262: 8500-8507. 197 Ruet, A., Camier, S., Smagowisz, W., Sentenac, A. and Framageot, P. ( 1 9 8 4 ) . I s o l a t i o n of a c l a s s C t r a n s c r i p t i o n f a c t o r which forms a s t a b l e complex with tRNA genes. EMBO J . 3_: 3 4 3 - 3 5 0 . S a j j a d i , F.G. ( 1 9 8 5 ) . M.Sc. T h e s i s , U n i v e r s i t y of B r i t i s h Columbia. S a j j a d i , F.G., M i l l e r J r . , R.C. and Spiegelman, G.B. ( 1 9 8 7 ) . I d e n t i f i c a t i o n of sequences i n the 5 ' - f l a n k i n g r e g i o n of a D r o s o p h i l a melanogaster t R N A V a l g e n e that modulate i t s t r a n s c r i p t i o n i n v i t r o . Molec. Gen. Genet. 206: 279 - 2 8 4 . Sakonju, S., Bogenhagen, D.F. and Brown, D.D. ( 1 9 8 0 ) . A c o n t r o l r e g i o n i n the center of the 5S gene d i r e c t s s p e c i f i c i n i t i a t i o n of t r a n s c r i p t i o n : I . The 5' border of the r e g i o n . C e l l 1_9_: 13-25. Sankonju, S., Brown, D.D., Engelke, D., Ng, S.Y., Shastry, B.S. and Roeder, R.G. ( 1 9 8 1 ) . The b i n d i n g of a t r a n s c r i p t i o n f a c t o r to d e l e t i o n mutants of a 5S ribosomal RNA gene. C e l l 2_3_: 6 6 5 - 6 6 9 . Sakonju, S. and Brown, D.D. ( 1 9 8 2 ) . Contact p o i n t s between a p o s i t i v e t r a n s c r i p t i o n f a c t o r and the Xenopus 5S RNA gene. C e l l 2J_: 395-405 . Sanger, F., N i c k l e n , S. and Coulson, A.R. ( 1 9 7 7 ) . DNA sequencing with c h a i n - t e r m i n a t i n g i n h i b i t o r s . Proc. N a t l . Acad. S c i . USA 14.: 5 4 6 3 - 5 4 6 7 . S e t z e r , D.R. and Brown, D.D. ( 1 9 8 5 ) . Formation and s t a b i l i t y of the 5S RNA t r a n s c r i p t i o n complex. J . B i o l . Chem. 260: 24 8 3 - 2 4 9 2 . Schaack, J . , Sharp, S., Dingermann, T. and S o i l , D. ( 1 9 8 3 ) . T r a n s c r i p t i o n of e u k a r y o t i c tRNA genes in. v i t r o . I I . Formation of s t a b l e complexes. J . B i o l . Chem. 258: 2447-2 4 5 3 . Schaack, J . , Sharp, S., Dingermann, T., Johnson Burke, D., Cooley, L. and S o i l , D. ( 1 9 8 4 ) . The extent of a eu k a r y o t i c gene: 5'- and 3 ' - f l a n k i n g sequence dependence f o r t r a n s c r i p t i o n and s t a b l e complex fo r m a t i o n . J . B i o l . Chem. 259: 1 4 6 1 - 1 4 6 7 . Schaack, J . and S o l i , D. ( 1 9 8 5 ) . T r a n s c r i p t i o n of a D r o s o p h i l a tRNA A rS gene i n a yeast e x t r a c t : 5 ' - f l a n k i n g sequence dependence f o r t r a n s c r i p t i o n i n a heterologous system. Nucl. Acids Res. 1_3: 28 0 3 - 2 8 1 4 . Sentenac, A. ( 1 9 8 5 ) . E u k a r y o t i c RNA polymerases. CRC C r i t . Rev. Biochem. 18: 31-90 . S e t z e r , D.R. and Brown, D.D. (1985). Formation and s t a b i l i t y of the 5S RNA gene t r a n s c r i p t i o n complex. J . B i o l . Chem. 260; 2483-2492. Sharp, S., DeFranco, D. , Dingermann, T., F a r r e l l , P. and S o i l , D. (1981). I n t e r n a l c o n t r o l r e g i o ns f o r t r a n s c r i p t i o n of e u k a r y o t i c tRNA genes. Proc. N a t l . Acad. S c i . USA 78: 6 6 5 7 - 6 6 6 1 . Sharp, S., Dingermann, T. and S o l i , D. (1982). The minimum i n t r a g e n i c sequences r e q u i r e d f o r promotion of e u k a r y o t i c tRNA gene t r a n s c r i p t i o n . Nucl. Acids Res. 1_0: 5393-5406. Sharp, S., Dingermann, T., Schaack, J . , DeFranco, D. and S o l i , D. ( 1 9 8 3 a ) . T r a n s c r i p t i o n of e u k a r y o t i c tRNA genes i n v i t r o . I . A n a l y s i s of c o n t r o l r e g i o ns using a competition assay. J . B i o l . Chem. 258; 2440-2446. Sharp, S., Dingermann, T., Schaack, J . , Sharp, J.A., Burke, D.J., DeRobertis, E.M. and S o i l , D. (1983b). Each element of a D r o s o p h i l a tRNA A rS s p l i t promoter d i r e c t s t r a n s c r i p t i o n i n Xenopus oocytes. Nucl. Acids Res. 1J_; 8677-8690. Sharp, S.J., Schaack, J . , Cooley, L., Johnson-Burke, D. and S o i l , D. (1985). S t r u c t u r e and t r a n s c r i p t i o n of e u k a r y o t i c tRNA genes. CRC C r i t . Rev. Biochem. 1_9_: 107-144. Shaw, K.J. and Olson, M.V. (1984). E f f e c t s of a l t e r e d 5»-f l a n k i n g sequences on the iri v i v o expression of a Saccharomyces c e r e v i s i a e t R N A T v r gene. Mol. C e l l . B i o l . 4_: 657-665. Singh, H., Sen, R., Ba l t i m o r e , D. and Sharp, P. (1 9 86). A n u c l e a r f a c t o r t h at binds to a conserved sequence motif i n t r a n s c r i p t i o n a l c o n t r o l elements of immunoglobulin genes. Nature 319; 154-158. Singh, K., Carey, M., S a r a g o s t i , S. and Botchan, M. (1985). Expression of enhanced l e v e l s of sm a l l RNA polymerase I I I t r a n s c r i p t s encoded by the B2 repeats i n simian v i r u s 40-transformed mouse c e l l s . Nature 314; 553-556. Smith, D.R., Jackson, I . J . and Brown, D.D. (1984). Domains of the p o s i t i v e t r a n s c r i p t i o n f a c t o r s p e c i f i c f o r the Xenopus 5S RNA gene. C e l l 3_X: 645-652. S p i n d l e r , S.R., D ' A l e s s i o , J.M., Duester, G.L. and Paule, M.R. (1978). DNA-dependent RNA polymerase I I I from Acanthamoeba c a s t e l l a n i l . A r a p i d procedure f o r l a r g e s c a l e p r e p a r a t i o n of homogeneous enzyme. J . B i o l . Chem. 253: 6242-6248. 199 Sprague, K.U., Larson, D. and Morton, D. (1980). 5 ' - f l a n k i n g sequence s i g n a l s are r e q u i r e d f o r a c t i v i t y of silkworm a l a n i n e tRNA genes i n homologous .in v i t r o t r a n s c r i p t i o n systems. C e l l 22: 171-178. S t a n d r i n g , D.H., Venegas, A. and Rutter, W.J. (1981). Yeast t R N A L e u 3 gene t r a n s c r i b e d and s p l i c e d i n a HeLa c e l l e x t r a c t . Proc. N a t l . Acad. S c i . USA Z8: 5963-5967. Stewart, T.S., S o i l , D. and Sharp, S. (1985). P o i n t mutations i n the 5 1 ICR and anticodon r e g i o n of a D r o s o p h i l a tRNA A r8 gene decrease i n v i t r o t r a n s c r i p t i o n . Nucl. Acids Res. 1_3_: 435-447. S t i l l m a n , D.J., S i v e r t s e n , A.L., Zentner, P.G. and Geiduschek, E.P. (1984a). C o r r e l a t i o n s between t r a n s c r i p t i o n of a yeast tRNA gene and t r a n s c r i p t i o n factor-DNA i n t e r a c t i o n s . J . B i o l . Chem. 259: 7955-7962. S t i l l m a n , D.J. and Geiduschek, E.P. (1984b). D i f f e r e n t i a l b i n d i n g of a S. c e r e v i s i a e RNA polymerase I I I t r a n s c r i p t i o n f a c t o r to two promoter segments of a tRNA gene. EMBO J . 3_: 847-853. S t i l l m a n , D.J., Caspers, P. and Geiduschek, E.P. (1985a). E f f e c t s of temperature and s i n g l e - s t r a n d e d DNA on the i n t e r a c t i o n of an RNA polymerase I I I t r a n s c r i p t i o n f a c t o r with a tRNA gene. C e l l 40: 311-317. S t i l l m a n , D.J., B e t t e r , M. and Geiduschek, E.P. (1985b). Ele c t r o n - m i c r o s c o p e examination of the b i n d i n g of a l a r g e RNA polymerase I I I t r a n s c r i p t i o n f a c t o r to a tRNA gene. J . Mol. B i o l . 185: 451-455. St. L o u i s , D. and Spiegelman, G.B. (1985). S t e a d y - s t a t e k i n e t i c a n a l y s i s of cloned t R N A S e r genes from D r o s o p h i l a  melanogaster. Eur. J . Biochem. 148: 305-313. S u l l i v a n , M.A. and F o l k , W.R. (1987). T r a n s c r i p t i o n of e u k a r y o t i c t R N A m e t 1 a n d 5 S R N A g e n e s by RNA polymerase I I I i s blocked by base mismatches i n the i n t r a g e n i c c o n t r o l r e g i o n s . Nucl. Acids Res. 1_5 : 2059-2068. S u t c l i f f e , J.G., M i l n e r , R.J., G o t t e s f e l d , J.M. and Lerner, R.A. (1984a). I d e n t i f i e r sequences are t r a n s c r i b e d s p e c i f i c a l l y i n the b r a i n . Nature 308: 237-241. S u t c l i f f e , J.G., M i l n e r , R.J., G o t t e s f e l d , J.M. and Reynolds, W. (1984b). C o n t r o l of neuronal gene e x p r e s s i o n . S c ience 225: 1308-1315. 200 T a y l o r , M.J. and S e g a l l , J . (1985). C h a r a c t e r i z a t i o n of f a c t o r s and DNA sequences r e q u i r e d f o r accurate t r a n s c r i p t i o n of the Sacoharomyoes c e r e v i s i a e 5S RNA gene. J. B i o l . Chem. 260.: 4531-4540. T e l f o r d , J.L., Kressman, A., K o s k i , R.A., Grosschedl, R., M u l l e r , F., C l a r k s o n , S.G. and B i r n s t i e l , M.L. (1979). D e l i m i t a t i o n of a promoter f o r RNA polymerase I I I by means of a f u n c t i o n a l t e s t . Proc. N a t l . Acad. S c i . USA £6: 2590-2594. Thimmappaya, B., Jones, N. and Shenk, T. (1979). A mutation which a l t e r s i n i t i a t i o n of t r a n s c r i p t i o n by RNA polymerase I I I on the Ad5 chromosome. C e l l 1_8: 947-954. T r a b o n i , C , C i l i b e r t o , G. and Cortese, R. (1982). A novel method f o r s i t e - d i r e c t e d mutagenesis: i t s a p p l i c a t i o n to an e u k a r y o t i c t R N A P r o gene. EMB0 J . 1: 415-420. U l l u , E. and Weiner, A.M. (1985). Upstream sequences modulate the i n t e r n a l promoter of the human 7SL RNA gene. Nature 2J_8: 371-374. V i e i r a , J . and Messing, J . (1982). The pUC plasmids, an M13mp7-derived system f o r i n s e r t i o n mutagenesis and sequencing with s y n t h e t i c u n i v e r s a l primers. Gene 1_9_: 259-268. Watson, J.B., Chandler, D.W. and G r a l l a , J.D. (1984). S p e c i f i c t e r m i n a t i o n of .in v i t r o t r a n s c r i p t i o n by c a l f thymus RNA polymerase I I I . Nucl. Acids Res. J_2: 5369-5384. Weil, P.A., S e g a l l , J . , H a r r i s , B., Ng, S.Y. and Roeder, R.G. (1979). F a i t h f u l t r a n s c r i p t i o n of e u k a r y o t i c genes by RNA polymerase I I I i n systems r e c o n s t i t u t e d with p u r i f i e d DNA templates. J . B i o l . Chem. 254: 6163-6173. W i l l i s , I . , H o t t i n g e r , H., Pearson, D., Chisholm, V., Leopold, U. and S o l i , D. (1984). Mutations a f f e c t i n g t r a n s c r i p t i o n and p r o c e s s i o n g i n a d i m e r i c tRNA gene from Schizosaccharomyces pombe. EMB0 J . 3_: 1573-1578. Wingender, E. , Jahn, D. and S e i f a r t , K.H. (1986). A s s o c i a t i o n of RNA polymerase I I I with t r a n s c r i p t i o n f a c t o r s i n the absence of DNA. J . B i o l . Chem. 261: 1409-1413. Wolffe, A.P., Jordan, E. and Brown, D.D. (1986). A bacteriphage RNA polymerase t r a n s c r i b e s through a Xenopus 5S RNA gene t r a n s c r i p t i o n complex without d i s r u p t i n g i t . C e l l 44: 381-389 . Wormington, W.M., Bogenhagen, D.F., Jordan, E. and Brown, D.D. (1981). A q u a n t i t a t i v e assay f o r Xenopus 5S RNA gene t r a n s c r i p t i o n i n v i t r o . C e l l 24.: 809-817. 201 Wu, G.J. ( 1 9 8 0 ) . F a i t h f u l t r a n s c r i p t i o n of Adenovirus 5 . 5 S RNA gene by RNA polymerase I I I i n a human KB c e l l - f r e e e x t r a c t . J . B i o l . Chem. 2 5 5 ; 2 5 1 - 2 5 8 . Yoshinaga, S.K., Boulanger, P.A. and Berk, A.J. ( 1 9 8 7 ) . R e s o l u t i o n of human t r a n s c r i p t i o n f a c t o r TFIIIC i n t o two f u n c t i o n a l components. Proc. N a t l . Acad. S c i . USA 84_: 3 5 8 5 -3 5 8 9 . Young, L.S., Takahashi, N. and Sprague, K.U. ( 1 9 8 6 ) . Upstream sequences confer d i s t i n c t i v e t r a n s c r i p t i o n a l p r o p e r t i e s on genes encoding s i l k g l a n d - s p e c i f i c t R N A A l a < Proc. N a t l . Acad. S c i . USA 83_: 3 7 4 - 3 7 8 . Z o l l e r , M.J. and Smith, M. ( 1 9 8 4 ) . O l i g o n u c l e o t i d e d i r e c t e d mutagenesis: a simple method using two o l i g o n u c l e o t i d e primers and a s i n g l e - s t r a n d e d DNA template. DNA 3_: 4 7 9 - 4 8 8 . 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097510/manifest

Comment

Related Items