Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Structure, expression and evolution of the 16 kilodalton heat shock protein gene family of C. elegans Russnak, Roland Hans 1986

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1987_A1 R87.pdf [ 10.49MB ]
Metadata
JSON: 831-1.0097509.json
JSON-LD: 831-1.0097509-ld.json
RDF/XML (Pretty): 831-1.0097509-rdf.xml
RDF/JSON: 831-1.0097509-rdf.json
Turtle: 831-1.0097509-turtle.txt
N-Triples: 831-1.0097509-rdf-ntriples.txt
Original Record: 831-1.0097509-source.json
Full Text
831-1.0097509-fulltext.txt
Citation
831-1.0097509.ris

Full Text

STRUCTURE, EXPRESSION AND EVOLUTION OF THE 16 KILODALTON HEAT SHOCK PROTEIN GENE FAMILY OF C. elegans By ROLAND HANS RUSSNAK B.Sc, The University of Calgary, 1979 A THESIS SUBMITTED IN THE REQUIREMENTS DOCTOR OF PARTIAL FULFILLMENT OF FOR THE DEGREE OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES Department of Biochemistry We accept t h i s thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA October 1986 © Roland H. Russnak In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. The University of British Columbia 1956 Main Mall Vancouver, Canada Department V6T 1Y3 DE-6f3/81) ( i ) Abstract Sequences coding for three related 16 kd heat shock proteins (hsps) of the nematode Caenorhabditis elegans were is o l a t e d and characterized. The extensive accumulation of hspl6 mRNA during heat stress f a c i l i t a t e d the i d e n t i f i c a t i o n of two cDNAs, CEHS48 and CEHS41, which encoded hspl6 variants. These plasmids were selected by t h e i r a b i l i t y to hybridize to mRNA which directed the synthesis of hspl6 i n v i t r o , and were further characterized by sequence analysis. Two-dimensional gel electrophoresis of hspl6 synthesized i n v i t r o from mRNA selected by hyb r i d i z a t i o n to eith e r of the cDNAs under conditions of low stringency revealed the existence of at least f i v e electrophoretic variants with s i g n i f i c a n t l y d i f f e r e n t i s o e l e c t r i c points. The above cDNAs were used as s p e c i f i c probes to i s o l a t e recombinant bacteriophage containing C. elegans genomic DNA. Overlapping phage clones were used to define a region of approximately 30 kilobases. The genes coding f o r hspl6-48, previously i d e n t i f i e d by cDNA cloning, and fo r another 16 kd hsp designated h s p l 6 - l were characterized by DNA sequencing. These two genes were arranged i n a head-to-head or i e n t a t i o n . Both the coding and flanking regions of these genes were located within a 1.9 kb region which was duplicated exactly to form a perfect 3.8 kb inverted repeat structure. This structure ended i n unusual G + C-rich sequences 24 bp i n length. The i d e n t i t y of the two arms of the inverted repeat at the nucleotide sequence l e v e l implied that the d u p l i c a t i o n event may have occurred r e l a t i v e l y recently i n evolution. A l t e r n a t i v e l y , gene conversion between the two modules could have maintained homology between the two gene p a i r s . ( i i ) Comparison of the hsp!6-48 gene with i t s corresponding cDNA revealed the presence of a s i n g l e , short intron. An intron of comparable length and i n an analogous p o s i t i o n was also found i n the hsp!6-l gene. The introns separated variable and conserved regions within the amino acid sequences of the encoded heat shock proteins. A domain of approximatey 80 amino acids i s contained within the conserved second exon and i s homologous to a s i m i l a r region i n the small hsps of Drosophila, Xenopus, soybean and man as well as the a - c r y s t a l l i n p rotein of the vertebrate lens. Each hsp!6 gene contained a TATA box upstream of the s t a r t of t r a n s c r i p t i o n . Promoter sequences, which have been shown to be required f o r heat i n d u c i b i l i t y i n various systems, were located upstream of either TATA box Northern b l o t analysis showed that the hsp!6-48 and hsp!6-l genes are expressed at l e v e l s approximately 20 - 40 f o l d lower than two c l o s e l y r e l a t e d genes, hsp!6-41 and hsp!6-2, upon temperature elevation. ( i i i ) TABLE OF CONTENTS Page Abstract i L i s t of Tables v i i i L i s t of Figures i x Abbreviations x i i Acknowledgements x i v I. INTRODUCTION 1 1.1 Response to Thermal Stress 1 1.1.1 Locua 6 7B: Puffing A c t i v i t y and Protein Synthesis . . . 3 1.1.2 Locus 67B: Gene Organization 6 1.1.3 Locus 67B: Protein Coding Regions 7 1.1.4 Locus 67B: A c t i v i t y During Development . . 11 1.2 Conserved shsp Function i n Eucaryotes 14 1.2.1 Higher Plants: Soybean 14 1.2.2 Avian and Mammalian Systems 16 1.2.3 Xenopus 23 1.2.4 Other Organisms 25 1.3 T r a n s c r i p t i o n a l Control and Induction Mechanisms 26 1.3.1 Gene Promoter Function 27 1.3.2 Heat Shock Regulons 30 1.3.3 A c t i v a t i o n of Transcription Factors 32 1.3.4 D i f f e r e n t i a l HSmRNA S t a b i l i t y • 35 (iv) Page 1.4 T r a n s l a t i o n a l Control 36 1.4.1 HSmRNA S e l e c t i v i t y 37 1.4.2 High mRNA Turnover 41 1.5 Recovery and Autoregulation 42 1.6 Function of shsps 44 1.6.1 I n t r a c e l l u l a r L o c a l i z a t i o n 45 1.6.2 Thermotolerance: Role of shsps 48 1.6.3 I n h i b i t i o n of the Heat Shock Response 51 1.7 The Biology of Caenorhabditia elegans 52 1.8 The Present Study 53 II . EXPERIMENTAL PROCEDURES 55 2.1 Maintenance of Nematodes 55 2.2 Analysis of Heat Shock Proteins 55 2.2.1 [ 3 5 S ] - s u l f a t e L a b e l l i n g of E. c o l i 55 2.2.2 In vivo L a b e l l i n g of C. elegans ( B r i s t o l ) Proteins and Induction of.Heat Shock Polypeptides . . 55 2.2.3 Analysis of i n v i t r o Labelled Proteins 56 2.2.4 Polyacrylamide Gel Electrophoresis of Proteins 56 2.3 RNA Analysis 57 2.3.1 I s o l a t i o n of RNA from B r i s t o l N2 Nematodes 57 2.3.2 Electrophoresis of RNA and Northern Transfers 58 2.3.3 SI Nuclease Mapping 58 2.4 I d e n t i f i c a t i o n of cDNAs 59 2.4.1 Screening of a cDNA Library . 59 (V) Page 2.4.2 Hybridization Selection Analysis of cDNAs 60 2.5 General Methods for Plasmid Analysis 61 2.5.1 B a c t e r i a l Strains 61 2.5.2 Transformations 61 2.5.3 P u r i f i c a t i o n of Plasmid DNA 62 2.6 Analysis of Bacteriophage -. . . 63 2.6.1 Screening of C. elegans B r i s t o l Genomic DNA L i b r a r i e s . . 63 2.6.2 Establishing High T i t e r Phage Stocks 64 2.6.3 I s o l a t i o n of Bacteriophage DNA 65 2.7 P u r i f i c a t i o n of C. elegans Genomic DNA 66 2.8 General DNA Techniques 6 7 2.8.1 R e s t r i c t i o n Endonuclease Digestion of DNA 67 2.8.2 Electrophoresis of DNA and Southern Transfers 67 2.8.3 P u r i f i c a t i o n of S p e c i f i c DNA Fragments 68 2.8.4 End-Labelling of DNA Fragments 68 2.9 DNA Sequencing 69 2.10 Preparation of Hybridization Probes 70 125 2.10.1 Preparation of [ I ] - l a b e l l e d RNA 70 2.10.2 P u r i f i c a t i o n and L a b e l l i n g of Oligodeoxynucleotides . . . 70 2.10.3 Preparation of Double-Stranded DNA Probes . . 71 2.11 Hybridization 72 2.12 Summary of B a c t e r i a l Strains Used 73 (vi) I I I . RESULTS Pase 3.1 The Heat Shock Response of Caenorhabditis elegans var. B r i s t o l , s t r a i n N2 74 3.2 I d e n t i f i c a t i o n of cDNAs Coding for Hspl6 76 3.3 Two-dimensional Gel Electrophoresis of Hspl6 81 3.4 Messages Coding f o r Hspl6 Are Not Transcribed i n Control Nematodes . . . . 83 3.5 Sequence Analysis of the cDNAs CEHS48 and CEHS41 83 3.6 I s o l a t i o n of B r i s t o l Genomic DNA Clones 89 3.7 Sequencing of the Hspl6 Genes and I d e n t i f i c a t i o n of a Perfect 1.9 kb Inverted Repeat 90 3.8 I d e n t i f i c a t i o n of the Small Heat Shock Genes 94 3.9 The shsp Genes of C. elesans Contain a Single Intron 101 3.10 Location of the Starts of Transcription 102 3 .11 The 3 * Flanking Regions 104 3.12 Organization of Inverted Repeats i n the Region Containing Genes Hspl6-l/48 105 3.13 D i f f e r e n t i a l Expression of Hspl6 Genes i n C. elegans I l l 3.14 Comparison of Locus Hspf6-l/48 i n Caenorhabditis elegans B r i s t o l and Bergerac Strains 113 IV. DISCUSSION 4.1 The Hspl6 Gene Family of C. elegans 118 4.2 Evolution of the Hspl6 Gene Family and i t s Relationship to Other sHsps and to Vertebrate a - C r y s t a l l i n s . . . 122 ( v i i ) Page 4.3 Gene Conversion Within Locus Hspl6-48/l 127 4.4 The Heat Shock Response of C. elegans 133 V. REFERENCES 1 4 3 ( v i i i ) LIST OF TABLES Page I I . Hsp25 Induction i n CEF C e l l s 17 I I I . Hsp25 Induction i n Mammalian C e l l s 20 IV. Genotypes of B a c t e r i a l Strains 73 V. Amino Acid Compositions of Hspl6-1 and Hspl6-48 97 VI. Association of G + C-Rich Sequences with Gene Conversion Boundaries 132 (ix) LIST OF FIGURES Page 1. Gene organization at locus 67B of Drosophila 8 2. A schematic diagram of the various amino acid homologies between the shsps of Drosophila 10 3. Induction of heat shock proteins i n C. elegans 75 4. S t a b i l i t y of the hsps of C. elegans 77 5. In v i t r o t r a n s l a t i o n products of mRNA from heat shocked c e l l s , and enrichment of messages coding for the shsps 78 6. In v i t r o t r a n s l a t i o n of RNA selected by hyb r i d i z a t i o n with pCEHS41 80 7. Two-dimensional gel electrophoresis of the products from t r a n s l a t i o n of hybrid-selected polyA +RNA 82 8. Northern b l o t and dot-blot analysis of polyA +RNA from control and heat shocked worms 84 9. Strategy used to determine the nucleotide sequence of CEHS48 and CEHS41 cDNA ins e r t s . 85 10. Complete nucleotide sequences of the cDNA inserts from pCEHS48 and pCEHS41 with the deduced amino acid sequence 86 11. Comparison of the deduced amino acid sequences of four small heat shock proteins from D. melanogaster, a - c r y s t a l l i n and two 16,000 dalton hsps from C. elegans 88 12. Organization of the hsp!6-48 and hsp!6-l genes of C. elegans, and the sequencing strategy 91 13. Analysis of C. elegans B r i s t o l genomic DNA 93 cy->- ft) V} It,'", ft-(X) Page 14. Complete sequence of a small heat shock gene c l u s t e r of C. elegans 95,96 15. RNA dot-blot analysis using a probe s p e c i f i c f o r the h s p l 6 - l gene . . 99 16. Comparison of the deduced amino acid sequences fo three shsps of C. elegans. the mouse a A ^ - c r y s t a l l i n chain, and the bovine a B ^ - c r y s t a l l i n chain 100 17. SI nuclease protection analysis of t r a n s c r i p t i o n s t a r t s i t e s of the hsp!6-48 and hsp!6-l genes, and comparison of the 5' flanking regions 103 18. Organization of the inverted repeats and G + C-rich boundary sequences i n locus h3p!6-l/48 106 19. Analysis of G + C-rich boundary sequences i n various recombinant phage and B r i s t o l genomic DNA 108 20. Detection of boundary sequences i n 3.3R by disruption of the 370 bp inverted repeat 110 21. Determination of the s p e c i f i c i t y of various probes used i n the mRNA expression studies . .- 112 22. Northern b l o t analysis of hsp!6 mRNA le v e l s using gene-s p e c i f i c probes 114 23. Detailed comparison of the 1.9 kb inverted repeat structure i n the c l o s e l y r e l a t e d s t r a i n s Bergerac and B r i s t o l 116 24. A comparison of the proteins encoded by the C. elegans 16 kd heat shock genes 119 25. A model f o r the evolutionary o r i g i n of the hsp!6 gene l o c i of C. elegans and the a - c r y s t a l l i n genes of vertebrates 123 (xi) Page 26. The leader sequences of the hsp!6 genes of C. elegans 135 27. A comparison of the intergenic regionsof hte two hsp!6 gene l o c i of C. elegans 137 ( x i i ) ABBREVIATIONS A adenine ATP adenosine-5'-triphosphate BUdR bromouridineodeoxyribonucieoside bp base pairs C cytosine cDNA complementary DNA cpm counts per minute DNA deoxyribonucleic acid dATP deoxyadenosine-5'-triphosphate dCTP deoxycytidine-5 *-triphosphate dGTP deoxyguanosine-5'-triphosphate dTTP deoxythymidine-5'-triphosphate ddTTP dideoxythymidine-5 *-triphosphate EDTA ethylenediamine t e t r a a c e t i c acid G guanine Gu-HCl guanidinium hydrochloride Hepes N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid hsg heat shock granule hsp heat shock protein hsmRNA heat shock messenger RNA HSTF heat shock t r a n s c r i p t i o n factor HSE, HIP heat shcok promoter element kb kilobases kd kilodaltons ( x i i i ) mRNA messenger RNA N adenine, cytosine, guanine or thymine PIPES piperazine-N,N'-bis(2-ethanesulfonic acid) P i i s o e l e c t r i c point polyA + polyadenylated polyA non-polyadenylated RNA ribonucleic acid RNP ribonucleoprotein rpm revolutions per minute SDS sodium dodecyl s u l f a t e shsps small heat shock protein T thymine tRNA transfer RNA T r i s t r i s (hydroxymethyl) aminomethane ts temperature s e n s i t i v e (xiv) ACKNOWLEDGEMENTS Persistence i s e s s e n t i a l i n the s c i e n t i f i c process and was encouraged under the s p e c i a l working conditions afforded to me during my graduate studies. Credit f o r t h i s goes to my supervisor, Peter Candido, who allowed the members of h i s laboratory to experiment. This also contributed to a s p i r i t of cooperation i n which ideas were e a s i l y exchanged. Involved i n various aspects of th i s project were Terry Snutch, Ann Rose, Eli z a b e t h Burgess, Rashmi Kothary, Peter Candido and Marlys Koschinsky. Special recognition goes to Don Jones who has been associated with the charac t e r i z a t i o n of the hsp!6 gene family since i t s conception and to Rob Kay whose elegant manipulation of the genes presented i n t h i s thesis together with his swim through the Faculty Club pond made i t a l l worthwhile. In addition, I would l i k e to acknowledge Susan Heming for her s k i l l and patience i n the preparation of t h i s document. A sincere thanks to E r i c Sommerman, Ev T r i p , Pieter C u l l i s and Craig Newton f o r a l l the dandelions. 1 I. INTRODUCTION 1.1 Response to Thermal Stress Most c e l l s respond to severe metabolic stress by dramatically a l t e r i n g t h e i r pattern of protein synthesis. A l l organisms studied, including b a c t e r i a , plants, fungi, protozoa and animals, both poikilothermic and homeothermic, react i n t h i s way to abrupt temperature increases, i . e . heat shock. Altered patterns of protein synthesis during thermal stress can be a re s u l t of the regulation of mRNA synthesis or mRNA t r a n s l a t i o n , the usual s i t u a t i o n being a coordination of both. In a l l cases, a well defined set of heat shock proteins (hsps) can be i d e n t i f i e d . H i s t o r i c a l l y , the heat shock response was f i r s t observed with the l i g h t microscope at the l e v e l of polytene chromosome puffing i n l a r v a l s a l i v a r y glands of dipterans (Ritossa, 1962, Ritossa, 1963). In Drosophila  melanogaster. there are nine heat inducible puffs. In 1974 the induction of a set of proteins upon heat shock was reported by T i s s i e r e s et a l . Since then i t has become c l e a r that the puffs are s i t e s of RNA t r a n s c r i p t i o n and that most of these new RNAs are translated into heat shock proteins. The seven major heat induced proteins of D. melanogaster are designated hsp83, hsp70, hsp68, hsp27, hsp26, hsp23 and hsp22 according to t h e i r apparent molecular weights on SDS polyacrylamide gels. Hsp83 i s encoded by a singl e gene which i s located at c y t o l o g i c a l locus 63B (Holmgren et a l . , 1979). The hsp83 t r a n s c r i p t i s characterized by a 1.2 kb intro n i n the 5' noncoding region (Holmgren et a l . , 1981; Hackett and L i s , 1983). Sequence analysis of a yeast hsp90 gene ( F a r r e l l y and F i n k e l s t e i n , 1984) and a chicken hsp90 gene ( C a t e l l i e t a l . , 1985a) has ~ ~ 2 demonstrated that the predicted proteins are related to hsp83 of Drosophila (Hackett and L i s , 1983). A polyclonal antibody prepared against chicken hsp90 reacts with proteins of s i m i l a r mobility i n heat shocked human, rodent and frog c e l l s (Kelly and Schlesinger, 1982). Although the function of Drosophila hsp83 i s unknown, hsp90 i s associated with non-transformed 8S s t e r o i d receptors i n chick oviduct ( C a t e l l i et a l . , 1985b) as well as src pp60 i n avian c e l l s infected with Rous sarcoma virus (Oppermann et a l . , 1981). Drosophila hsp83 and i t s related proteins are detectable under nonstress conditions, t h e i r l e v e l s increasing s i g n i f i c a n t l y during heat shock. In D. melanoRaater, the hsp70 gene family consists of both heat inducible and c o n s t i t u t i v e l y expressed genes. At least f i v e highly homologous heat inducible genes are d i s t r i b u t e d over l o c i 87A and 87C (Schedl et a l . , 1978; Livak et a l . , 1978; Moran et a l . , 1979; Artavanis-Tsakonas et a l . , 1979; Craig et a l . , 1979; Goldschmidt-Clermont, 1980; Ingolia et a l . , 1980). Hsp68 i s also heat inducible, and shows 75% homology to hsp70 and therefore can be considered part of the same family. I t i s encoded by a s i n g l e gene at locus 95D (Holmgren et a l . , 1979). Hsp70 relat e d proteins are also detectable i n normal c e l l s . They are the products of three c o n s t i t u t i v e l y expressed genes (heat shock cognate genes) referred to as h s c l . hsc2 and hsc4 which map c y t o l o g i c a l l y to 70C, 87D and 88E, r e s p e c t i v e l y (Ingolia and Craig, 1982a; Craig et a l . , 1983; P a l t e r et a l . , 1986). The h s c l and hsc2 genes contain introns while the heat inducible genes are uninterrupted. A. family of inducible and c o n s t i t u t i v e l y expressed genes related to -^••i^^S-a*?^' ' those: i n Drosophila are found in. yeast (Ingolia et a l . , 1982; Craig and 3 Jacobsen, 1984; Craig and Jabobsen, 1985; Craig et a l . , 1985), Caenorhabditis elegans (Snutch and B a i l l i e , 1984) and mouse (Lowe and Moran, 1984; Lowe and Moran, 1986). Heat inducible hsp70 sequences have been characterized i n rainbow trout (Kothary et a l . , 1984), Xenopus (Bienz, 1984a), Dictyostelium (Rosen et a l . , 1985) and man (Voellmy et a l . , 1985; Wu et a l . , 1985; Hunt and Morimoto, 1985). A related cognate gene has been characterized i n r a t (O'Malley et a l . , 1985). In E. c o l i , p r otein DnaK, which i s 48% homologous to Drosophila hsp70 (Bardwell and Craig, 1984), i s an extremely abundant protein at normal growth temperature, but i t s l e v e l increases during heat treatment (Neidhardt et §_1. , 1984). I t i s encoded by a s i n g l e gene (Bardwell and Craig, 1984). At the protein l e v e l , a heat inducible protein migrating with an apparent molecular weight of 70,000 has been i d e n t i f i e d i n every organism tested, making i t one of the most highly conserved proteins known. One of the c o n s t i t u t i v e l y expressed hsp70 species i n mammalian c e l l s has been i d e n t i f i e d as a c l a t h r i n uncoating enzyme with ATPase a c t i v i t y (Ungewickell, 1985; Chappell et a l . , 1986). The discussion which follows w i l l be confined to the structure and regulation of the genes within the heat shock puff at locus 67B of Drosophila and to r e l a t e d genes i n other organisms. This locus i s linked to the expression of hsp27, hsp26, hsp23 and hsp22. 1.1.1 Locus 67B: Puffing A c t i v i t y and Protein Synthesis o o If Drosophila larvae are subjected to a temperature of 37 C, 25 C being the normal culture temperature, puffing at locus 67B occurs within one minute. Puffs continue to grow for- 30 - 40 minutes before regressing. If protein synthesis i s blocked by incubating excised s a l i v a r y glands i n medium 4 containing cycloheximide, the induced puffs f a i l to regress unless the temperature i s returned to normal. Also, the severity of the temperature increase i s r e f l e c t e d i n the maximum s i z e of puff observed i n a given time. This c y t o l o g i c a l analysis led to two other important observations. F i r s t l y , most of the puffs e x i s t i n g p r i o r to heat shock regress upon temperature elevation. Upon prolonged exposure to high temperature, they return to normal following, the regression of the heat shock puffs. Secondly, locus 67B can be induced to puff by a var i e t y of other conditions including exposure to dina c t i n (Rensing, 1973), dinitrophenol (Ritossa, 1963; E l l g a r d and Rensing, 1972, 1973), hydrogen peroxide (Compton and McCarthy, 1978) and valinomycin (Rensing, 1973) or by recovery from anoxia (Ashburner, 1970; Zhimulev and Grafodatskaya, 1974). Thus, puffing a c t i v i t y f i r s t defined the parameters and k i n e t i c s of gene a c t i v i t y at locus 6 7B. Exposure to high temperature also r e s u l t s i n the rapid synthesis of approximately seven hsps whereas the rate of synthesis of most c e l l u l a r o ' proteins normally made at 25 C xs strongly reduced ( T i s s i e r e s et a l . , 1974). This phenomenon i s observed i n excised s a l i v a r y glands as well as t i s s u e from brain, malpighian tubules and wing imaginal disks. Various Drosophila melanosaster tissue culture l i n e s show si m i l a r protein metabolism (McKenzie et al.., 1975; Spradling et a l . , 1975; Moran et a l . , 1978; Mirault et a l . , 1978). Upon heat shock, polysomes from cultured c e l l s disaggregate and newly synthesized heat shock mRNA (hsmRNA) sediments as two new polysomal peaks i n sucrose density gradients (McKenzie et a l . , 1975). The 12S RNA f r a c t i o n contains hsmRNA that has been shown to d i r e c t the synthesis of 4 proteins with molecular weights of 22,000, 23,000, 26,000 and 27,000 i n a r a b b i t 5 r e t i c u l o c y t e lysate (Mirault et a l . , 1978; Moran et a l . , 1978) or i n an ascites c e l l - f r e e extract (McKenzie and Meselson, 1977). These proteins correspond to 4 of the 7 hsps i d e n t i f i e d i n vivo, the other three having molecular weights of 70,000, 68,000 and 83,000. Their corresponding t r a n s c r i p t s are found i n a 20S RNA polysomal f r a c t i o n . Pulse l a b e l l e d RNA extracted from the 12S RNA peak hybridizes i n s i t u to chromosomal s i t e 67B (Spradling et a l . , 1977; McKenzie and Meselson, 1977) and thus a d i r e c t l i n k can be made between puffing a c t i v i t y and hsmRNA synthesis at locus 67B and the appearance of a s p e c i f i c subset of hsps upon thermal s t r e s s . 35 Pulse l a b e l l i n g with [ S]methionine for 10 minutes at the s t a r t of a heat ahock i s s u f f i c i e n t to detect the i n i t i a t i o n of synthesis of a l l seven hsps. The maximum rate of synthesis i s reached between 90 and 120 minutes o with a subsequent decline to about 50% aft e r 6 - 8 hours at 37 C (Mirault et a l . , 1978). In contrast, when the c e l l s are returned to 25°C a f t e r a o heat shock at 37 C for 1 hour, and the rate of synthesis of hsps i s examined by pulse l a b e l l i n g at various times thereafter, there i s a gradual decrease of these proteins u n t i l , by 8 hours, no hsp synthesis i s detected and normal p r o t e i n synthesis has recovered completely. Mirault et a l . (1978) also demonstrated that hsps, pulse l a b e l l e d during a 1 hour heat shock, are stable f o r up to one day at 25°G. 6 1.1.2 Locus 67B: Gene Organization The cloning of sequences coding f o r hsp22, 23, 26 and 27 was greatly f a c i l i t a t e d by the f a c t that t h e i r t r a n s c r i p t s were highly enriched i n the 12S RNA polysomal peak a f t e r heat shock. Thus, cDNAs made to 12S RNA, and coding f o r hsp23 and hsp26, were i d e n t i f i e d by t r a n s l a t i o n a r r e s t (Voellmy et a l . , 1981) and h y b r i d i z a t i o n s e l e c t i o n (Wadsworth et a l . , 1980) experiments. These cDNAs do not cross-hybridize under normal stringency but do hybridize to locus 67B using i n s i t u h y b r i d i z a t i o n . Drosophila  melanoRaster genomic DNA clones were subsequently i d e n t i f i e d that contained coding regions f o r . a l l 4 proteins clustered within 11 kb (Craig and McCarthy, 1980; Corces et a l . , 1980; Voellmy et a l . , 1981). The orientations of the genes were determined using R-loop mapping; the polyA ends of the mRNA were i d e n t i f i e d by t h e i r h y b r i d i z a t i o n to poly(BUdR)-tailed plasmid pBR345 (Voellmy et a l . , 1981), or by the h y b r i d i z a t i o n of end-labelled DNA fragments derived from the clones to hsmRNA (Craig and McCarthy, 1980; Corces et a l . , 1980). The lack of intervening sequences was suggested at t h i s point by R-loop mapping data (Voellmy et a l . , 1981) and by the f a c t that the regions homologous to hsmRNA were mapped on the basis of t h e i r resistance to SI nuclease a f t e r h y b r i d i z a t i o n (Corces et a l . , 1980). These genomic clones selected messages which synthesized the 4 hsps i n v i t r o (Craig and McCarthy, 1980; Corces et a l . , 1980). Furthermore, the hsp27, 26 and 23 genes showed p a r t i a l homology under reduced stringency (Corces et a l . , 1980). The f i r s t h i n t that these genes were developmentally regulated came from workers who i d e n t i f i e d a genomic clone which hybridized more strongly to pupa-specific cDNA than to embryo-specific cDNA ( S i r o t k i n and Davidson, 7 1982). This clone hybridized i n s i t u to locus 67B and overlapped the clone i d e n t i f i e d by Corces et a l . (1980). Five regions homologous to pupa RNA were i d e n t i f i e d and the orientations of four of them were determined by R-loop mapping using poly(BUdR). Two of these genes code for hsp26 and hsp23 while the other three have been named genes 1, 2 and 3 (Southgate et §_1., 1985). Genes 1, 2 and 3 are heat inducible although t h e i r corresponding messages do not accumulate to the same high l e v e l s as those of hsp23 and 26. (Ayme and T i s s i e r e s , 1985). Gene 1 cross-hybridizes to the hsp27 gene while genes 2 and 3 share a weak homology to the hsp22 gene (Ayme and T i s s i e r e s , 1985). These seven genes, the organization of which i s shown i n Figure 1, w i l l be referred to c o l l e c t i v e l y as the small heat shock genes, and t h e i r products as the small hsps (shsps) of Drosophila. 1.1.3 Locus 6 7B: Protein Coding Regions The protein coding regions of the hsp_22, 23, 26. and 27. genes have been sequenced by two groups (Ingolia and Craig, 1982b; Southgate et a l . , 1983). Both sequence determinations indicate the same s t a r t and stop codons f o r the four uninterrupted open reading frames. However, there are some differences (96% homology at the amino acid l e v e l ) which are probably not due to sequencing errors since some changes demonstrably ei t h e r create or destroy 18 r e s t r i c t i o n s i t e s (Southgate et a l . , 1983). Since both clones were derived from s t r a i n Oregon R DNA, the differences must be due to polymorphism i n the f l y population. The protein coding region of gene 1 has been sequenced also (Ayme and T i s s i e r e s , 1985). The derived molecular weights for the unmodified proteins are 19,705, 20,603, 22,9976, 23,620 and 26,560 which correspond to hsp22, hsp23, hsp26, 8 gene2 hsp27 hsp23 gene! hsp26 hsp22 gene 3 • - i 1 kb Figure 1. Gene organization at locus 6 7B of Drosophila. The d i r e c t i o n of t r a n s c r i p t i o n i s indicated by the arrows except for gene 2 for which the o r i e n t a t i o n has not yet been determined. Genes 1, 2 and 3 are referred to as genes 1, A and 5 by S i r o t k i n and Davidson (1982) 9 hsp27 and the gene 1 product respectively. Although genes 1, 2 and 3 are heat inducible as measured by transient changes i n corresponding t r a n s c r i p t l e v e l s , p r o t e i n products have not been detected f or these genes. However, i n two-dimensional gel electrophoretic separations of both i n vivo (Mirault et a l . , 1978; Buzin and Peterson, 1982) and i n v i t r o (Buzin and Peterson, 1982) translated products, hsp27 consists of multiple spots. S i m i l a r l y , i n heat shocked s a l i v a r y glands from t h i r d i n s t a r larvae, hsp22 runs as 2 spots on two-dimensional gels (Buzin and Peterson, 1982). A schematic i l l u s t r a t i o n of p o t e n t i a l functional domains within the Drosophila shsps i s shown i n Figure 2. Hsp22, 23, 26 and 27 are homologous over a s t r e t c h of 108 amino acid residues i n which the same amino acid i s used i n a l l four proteins at 35% of the positions. The same amino acid i s used by three of the four proteins i n 71% of the positions. Among each other, hsp 27, 26 and 23 have nearly twice as many s i m i l a r i t i e s within t h i s region as hsp22 does with respect to the other three, thus confirming e a r l i e r h y b r i d i z a t i o n s e l e c t i o n experiments (Corces et a l . , 1980). The s i z e differences between these four proteins are accounted f o r by two heterologous regions, variable i n length, on eit h e r side of the conserved domain. Su r p r i s i n g l y , the f i r s t 83 amino acids of the conserved s t r e t c h of 108 amino acids shows a high degree of homology with amino acids 70 - 152 of the bovine a - c r y s t a l l i n B^ chain (van der Ouderaa et a l . , 1973), the a - c r y s t a l l i n s comprising one of the most abundant protein classes i n the vertebrate lens. I t i s t h i s 83 amino acid region which l i n k s the gene 1 product to the other shsps. The gene 1 product shows the most s i m i l a r i t y to hsp27 and, i n t e r e s t i n g l y , lacks the conserved 25 amino acid s t r e t c h on the carboxy-proximal side which i s common to the other four proteins. 10 Gene! 122 213 Hsp23 66 186 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Hsp22 174 Figure 2. A schematic diagram of the various amino acid homologies between the shsps of Drosophila melanoRaster. The predicted amino acid sequences are based on the nucleotide sequence of t h e i r coding regions (Ingolia and Craig, 1982b; Southgate et a l . , 1983; Ayme and T i s s i e r e s , 1985). The 83 amino acid domain which i s common to a l l shsps and to the vertebrate a - c r y s t a l l i n s i s shown by hatched boxes. Other homologous regions are defined by the amino-terminal 15 amino acid residues and the 25 amino acids located carboxy-proximal to the major domain. Also shown, for each protein, i s the amino acid numbering which corresponds to the regions discussed above. 11 A second region of weaker homology exi s t s within the f i r s t 15 predominantly hydrophobic amino acid residues of hsp23, 26, 27 and the gene 1 product. The si g n i f i c a n c e of t h i s hydrophobicity i n the N-terminal portion of 4 of the 5 proteins remains unknown; i t does not constitute a si g n a l peptide, since a comparison of i n vivo and i n v i t r o t r a n s l a t i o n products suggests that there i s no po s t - t r a n s l a t i o n a l processing (Mirault et a l . , 1978) . The most s t r i k i n g feature of hydropathy p r o f i l e s i s a prominent h y d r o p h i l i c peak spread over 16 amino acids i n the middle of the 83 amino acid conserved domain (Southgate et a l . , 1983). 1.1.4 Locus 67B: A c t i v i t y During Development Although a l l seven genes at locus 67B respond to an environmental stimulus such as heat shock, i t i s now well established that they are under complex and non-coordinate control during f l y development. The hsp22, 23, 26_ and 2_7 genes are normally transcribed from the t h i r d i n s t a r l a r v a l to the mid-pupal stages ( S i r o t k i n and Davidson, 1982; Cheney and Shearn, 1983; Mason et a l . , 1984; Ayme and T i s s i e r e s , 1985); however, t h e i r l e v e l s of expression vary. The hsp23 t r a n s c r i p t i s the most abundant by 2 - 5 f o l d as compared with hsp26 and hsp27 mRNAs, while hsp22 mRNA i s barely detectable (Ayme and T i s s i e r e s , 1985). Genes 1 and 3, but not gene 2, are also expressed during the same period ( S i r o t k i n and Davidson, 1982; Ayme and T i s s i e r e s , 1985), at l e v e l s equal to those of hsp23 and hsp26/27, re s p e c t i v e l y (Ayme and T i s s i e r e s , 1985). This period of development i n Drosophila i s characterized by high ecdysterone l e v e l s (Hodgetts et a l . , 1977).. 12 The e f f e c t s of ecdysterone on hsp synthesis can be mimicked i n v i t r o . Incubation of Drosophila t i s s u e culture (S3) c e l l s with ecdysterone induces the synthesis of hsp22, 23, 26 and 27 to leve l s consistent with t h e i r r e l a t i v e t r a n s c r i p t accumulation i n vivo (Ireland and Berger, 1982). In is o l a t e d imaginal disks from l a t e t h i r d i n s t a r larvae, hsp23, 26 and 2T_ mRNA le v e l s are further induced when disks are incubated i n ecdysterone (Ireland et a l . , 1982). Transcripts corresponding to genes 1 and 3 are only weakly induced i n eit h e r hormone treated S3 c e l l s or imaginal disks (Ireland et a l . , 1982). In primary c e l l cultures prepared from Drosophila g a s t r u l a t i o n stage embryos, ecdysterone and known teratogenic drugs such as coumarin and diphenylhydantoin i n h i b i t muscle and neuron development i n v i t r o . Under these conditions, only hsp22 and hsp23 are induced (Buzin and Bournias-Vardiabasis, 1984). A subset of the genes found at locus 67B are also expressed normally during embryogenesis. Messages corresponding to hsp27 and hsp26'. as well as hsp23, can be detected i n the f i r s t 4 hours of embryonic development (Zimmerman et a l . , 1983; Ayme and T i s s i e r e s , 1985) while gene 2 mRNA i s present i n 3 - 24 hour embryos ( S i r o t k i n and Davidson, 1982; Ayme and T i s s i e r e s , 1985). Early hsp27 and hsp26 mRNAs accumulate i n ovarian nurse c e l l s within the egg chamber and are passed into the oocyte (Zimmerman et a l . , 1983). Thus, these messages are also detected i n 3 - 5 day old females (Zimmerman e t a l . , 1983; Ayme and T i s s i e r e s , 1985). Hsp23 (Mason et a l . , 1984; Ayme and T i s s i e r e s , 1985) and gene 1 (Ayme and T i s s i e r e s , 1985) t r a n s c r i p t s are detectable i n fre s h l y eclosed male and female adult f l i e s . 13 I f a hyperthermic shock i s applied to animals from the l a r v a l to adult stages, t r a n s c r i p t i o n of the hsp22, 23, 26. and 27. genes increases s i g n i f i c a n t l y over t h e i r basal, developmentally controlled l e v e l s , the t r a n s c r i p t s accumulating to approximately the same l e v e l at a l l 6 stages tested (Ayme and T i s s i e r e s , 1985). The hsp23 gene, which gives the higher l e v e l of developmentally regulated t r a n s c r i p t s , i s comparatively less highly induced during heat shock than the hsp22, 26 and 27. genes. In contrast, genes 1 and 3 are heat shock induced to 10-fold higher lev e l s i n white pre-pupae and middle pupae than i n t h i r d i n s t a r larvae, l a t e pupae or adults. Gene 2 becomes moderately transcribed a f t e r heat shock i n a l l l a r v a l to adult stages. In pre-blastoderm embryos ( 0 - 3 hours), a period i n which there i s no nuclear RNA synthesis, the genes coding f or hsp22, 23, 26 and 27 are unresponsive to heat shock (Dura, 1981; Zimmerman et a l . , 1983). These complex patterns of t r a n s c r i p t i o n a l a c t i v i t y demonstrate that the seven genes clustered within 15 kb of DNA can each be regulated independently of i t s neighbors under non-stress conditions during development. Even under heat shock, there i s a variable stage-specific accumulation of t r a n s c r i p t s coding f o r the putative products of genes 1, 2 and 3. The s p e c i f i c induction of c e r t a i n genes such as the expression of gene 2 only i n 3 — 24 hour embryos, for example, suggests that t h e i r products may serve a v i t a l function i n normal development. 14 1.2 Conserved shsp Function i n Eucaryotes 1.2.1 Higher Plants: Soybean o o o Upon temperature elevation to 35 C - 43 C from 28 C, soybean (Glycine max) seedlings (Key et a l . , 1981; A l t s c h u l e r and Hascarenhas, 1982) and ti s s u e culture c e l l s (Barnett et a l . , 1980) respond by shutting down e x i s t i n g protein synthesis with the concomitant induction of heat shock pro t e i n synthesis i n a s i t u a t i o n analogous to that i n Drosophila. Hsp synthesis i s characterized by major protein products with molecular weights of 15,000 - 18,000 which are resolved into at least 10 components on two-dimensional gels (Key et a l . , 1981). The pattern of protein synthesis Is common to both root and hypocotyl t i s s u e as well as to both i n vivo and in v i t r o translated products. + Based on h y b r i d i z a t i o n s e l e c t i o n experiments, cDNAs made to polyA mRNA from heat shocked hypocotyl t i s s u e f a l l into 2 classes (Schoffl and Key, 1981). Class I cDNAs hybridize to mRNAs 800 - 900 nucleotides i n length and which code for 20 hsps i n the 15 - 18 kd s i z e range when translated i n v i t r o using a wheat germ lysate. A class II cDNA selects a message that codes for a s i n g l e 18 kd protein on two-dimensional gels. The characterization of several genomic DNA clones containing sequences coding f o r the shsp (hspl7) family of soybean has been undertaken by two groups. These genes and t h e i r corresponding protein products are l i s t e d i n Table I. 15 Table I. Soybean Hspl7 Gene Family Predicted Protein Gene cDNA Class Molecular Weight Amino Acid Residues Reference 17.5- -M I 17,544 153 Nagao et a l . , 1985 17.6- -L I 17,570 154 Nagao et a l . , 1985 17.5- -E II 17,533 154 Czarnecka ejb a l . , 1985 6871 I 17,345 153 Sch o f f l et a l . , 1984 6834 - - - S c h o f f l et a l . , 1984 The 6834 Rene i s incomplete and i s linked to the 6871 gene, separated by approximately 4 kb. The linkage of the other genes has not yet been determined. None of the four complete genes contain introns and at the amino acid l e v e l they show an o v e r a l l homology of 90%. The proteins contain a region i n t h e i r carboxy-terminal h a l f which shows extensive homology to the conserved domain of the proteins encoded by locus 67B i n Drosophila. Due to the apparent conservation of a fun c t i o n a l domain i t i s not su r p r i s i n g that L hydropathy p r o f i l e s of the soybean shsps display a prominent hydrophilic peak i n an analogous p o s i t i o n to that found i n Drosophila (Czarnecka et a l . , 1985). The shsps of soybean can also be induced with arsenite and cadmium (Czarnecka et a l . ,.. 1984).. . . . . 16 Homologous shsp genes are found i n other higher plants since hspl7 class I cDNAs cross-hydridize to other plant species such as pea, m i l l e t , maize, and sunflower (Key et a l . , 1983). At the protein l e v e l , major heat inducible products with s i m i l a r molecular weights occur i n a tobacco (Nicotiana tobacum) tissue culture c e l l l i n e (Barnett et §_1. , 1980), i n f i e l d grown cotton (Gossyupium hirsutum) (Burke et a l . , 1985), and i n suspension cultures of tomato (Lycopersicon peruvianum) (Scharf and Nover, 1982). In maize (Zea mays) seedlings, 4 - 8 hsps of 18 kd are seen on two-dimensional gels (Basczczynski et a l . , 1982). These proteins are synthesized i n a great v a r i e t y of maize tissues a f t e r heat shock (Cooper et a l . , 1984; Baszczynski et a l . , 1985). They are, however, not observed i n the germinating pollen grains of the maize plant (Cooper et a l . , 1984), a stage i n which RNA synthesis takes place under non-stress conditions. This non-responsiveness i s therefore analogous to that seen with hsp30 i n e a r l y Xenopus development (section 1.2.3). The absence of hsp synthesis i n germinating p o l l e n grains has also been observed i n another plant, Tradescantia paludosa (Xiao and Mascarenhas, 1985). 1.2.2 Avian and Mammalian Systems A 25 kd protein i s inducible i n chick embryo f i b r o b l a s t (CEF) c e l l s o o during a 41 C - 45 C incubation (Kelly and Schlesinger, 1978). The synthesis of t h i s hsp can also be induced with a wide var i e t y of agents which are summarized i n Table I I . 17 Table I I . Hsp25 Induction i n CEF C e l l s Inducer Reference 1. Amino Acid Analogues canavanine K e l l y and Schlesinger, 1978; Hightower , 1980 p-fluorophenylalanine Hightower , 1980 hydroxynorva1ine K e l l y and Schlesinger, 1978 o-methyl threonine K e l l y and Schlesinger, 1978 2. Copper Binding Ligands kethoxal bis(thiosemicarbazone) Levinson et a l . , 1978a d i s u l f i r a m Levinson et a l . , 1978b 3. Chelating Agents o-phenanthro1ine 8-hydroxyqu ino1ine 4. V i r a l Infection Herpes simplex virus Notarianni and Preston, 1982 Newcastle disease virus C o l l i n s et a l . , 1980 5. Metals copper, cadmium, zinc, mercury Levinson et a l . , 1980 Levinson et a l . , 1979 Levinson et a l . , 1979 18 Table I I . Hsp25 Induction i n CEF C e l l s (cont'd) Inducer Reference 6. Others arsenite Levinson et a l . , 1980 puromycin Hightower, 1980 Both i n vivo and i n v i t r o synthesized chicken hsp25 appears as two species on 2-D gels (Johnston et a l . , 1980; Wang et a l . , 1981). Minor amounts of hsp25 have also been observed i n uninduced c e l l s (Johnston et a l . , 1980; Wang et a l . , 1981). Using clones coding for Drosophila hsp27, 26 and 23, no h y b r i d i z a t i o n was found to chicken mRNA (White and Hightower, 1984). S i m i l a r l y , antibodies against hsp25 (Ke l l y et a l . , 1980) f a i l to react with c e l l extracts from other organisms including yeast, slime mold (Dictyostelium), maize seedling roots, Caenorhabditis elegans, Drosophila melanogaster, Xenopus kidney c e l l s , mouse L929 c e l l s and human WI38 c e l l s (Kelly and Schlesinger, 1982). However, anti-hsp25 cross-reacts with a protein i n extracts prepared from 11 day old embryonic chicken lens and thus can be considered analogous to the shsps of Drosophila, Xenopus and soybean (Schlesinger, 1985). Anti-hsp25 cross-reacts with an avian muscle protein of subunit molecular weight 22,000 which i s unusually abundant i n chicken embryonic heart as well, as i n s k e l e t a l muscle (Schlesinger, 1985). This antibody also 19 shows that small amounts of hsp25 are present i n unstressed c e l l s , confirming other observations. In developing chicken embryos, hsp25 displays variable l e v e l s of induction i n d i f f e r e n t tissues a f t e r a heat treatment. Hsp25 i s much more abundant i n heart and l i v e r t i s s u e than i n brain and lung (Voellmy and Bromley, 1982). S i m i l a r l y , other workers f a i l e d to detect the induction of hsp25 synthesis i n brain i s o l a t e d from 9 day old embryos under conditions i n which i t was e a s i l y seen i n limb and breast tissue (Atkinson et a l . , 1985). A 25 kd protein i s also one of the major inducible proteins i n primary cultures of Japanese q u a i l breast tissue (myoblasts) when these are o o subjected to a temperature of 43 - 46 C (Atkinson, 1981). In t e r e s t i n g l y i t loses i t s heat i n d u c i b i l i t y by 100 - 120 hours of development when the c e l l s have d i f f e r e n t i a t e d into myotubes, but i t s a b i l i t y to be induced by arsenite, copper or zinc remains (Atkinson et a l . , 1983). Arsenite also induces hsp25 i n chicken embryonic myotubes (Wang et a l . , 1981). Furthermore, q u a i l blood c e l l s (white and red) do not synthesize hsp25 when treated with copper or zinc (Atkinson et a l . , 1983) but have the a b i l i t y to produce hsp25 under heat shock conditions. These r e s u l t s suggest that d i f f e r e n t inducers of the heat shock response may act through d i f f e r e n t mechanisms. Quail hsp25 runs as a si n g l e band with a p i of 5.4 (Atkinson, 1981) and appears to be analogous to i t s chicken counterpart since i t reacts with anti-chicken hsp25 (Atkinson et a l . , 1983). The induction of a protein with an approximate molecular weight of 25,000 has been observed i n a va r i e t y of mammalian c e l l l i n e s which are reviewed i n Table I I I . 20 Table I I I . Hsp25 Induction i n Mammalian C e l l s C e l l Type Inducer Ref erence human HeLa heat Hickey and Weber, 1982 human lymphocytes ars eni te/ethano1 Rodenhiser et a l . , 1985 rat embryo f i b r o b l a s t s heat Welch and Feramisco, 1985 rat embryo f i b r o b l a s t s arsenite/proline analogue Welch, 1985 rat myoblasts heat/arsenite/arsenate Kim et a l . , 1983 rat primary f i b r o b l a s t s arsenate Kim et a l . , 1983 rat primary hepatoma arsenate Kim et a l . , 1983 rat p i t u i t a r y tumor arsenate Kim et a l . , 1983 rat hepatoma MH-7 7 77 heat Lamarche et a l . , 1985 mouse embryonal carcinoma mouse primary f i b r o b l a s t s mouse lymphocytes mouse myeloma mouse 3T3 f i b r o b l a s t s arsenite arsenite arsenite/ethano1 heat heat Bensaude and Morange, 1983 Bensaude and Morange, 1983 Rodenhiser et a l . , 1985 Hickey and Weber, 1982 Hickey and Weber, 1982 21 Table I I I . Hsp25 Induction i n Mammalian C e l l s (cont'd) C e l l Type Inducer Reference Chinese hamster ovary heat Bouche et a l . , 1979 Chinese hamster f i b r o b l a s t heat L i and Werb, 1982 hamster primary f i b r o b l a s t heat Atkinson and Pollock, 1982 rabbit lymphocyte arsenite/ethanol Rodenhiser et a l . , 1985 The human variant does not incorporate [ Slmethionine but can be 3 l a b e l l e d using [ Hjleucme (Hickey and Weber, 1982). Thus the induction of a shsp could not be observed i n human foreskin c e l l s (Levinson et a l . , 1980), i n a human fibrosarcoma (HT1080) c e l l l i n e (Slater et a l . , 1981) or 35 i n human lymphocytes (Atkinson and Dean, 1985) when [ S]methiomne was used i n the protein l a b e l l i n g procedure. In human epidermoid carcinoma (KB) 14 c e l l s , hsp25 i s not detected i n heat shocked, [ C]leucine treated c e l l s (Atkinson and Pollock, 1982) and may be an example of non-responsiveness i n c e r t a i n transformed states. Human hsp25 runs as two components on two-dimensional gels, the more o basic one being present m c e l l s grown at 37 C (Hickey and Weber, 1982). In non-human mammalian c e l l s , hsp25 can be detected using methionine as the radioactive amino acid. The only reported f a i l u r e to detect an 22 [ Slmethionyl hsp25 under conditions which r e a d i l y induced the other hsps as well as hsp25 i n CEF c e l l s , was for mouse L c e l l s and baby hamster kidney c e l l s (Kelly and Schlesinger, 1978). This cannot be a species s p e c i f i c 35 phenomenon since a [ Slmethionyl hsp25 i s induced i n Chinese hamster ovary and Chinese hamster f i b r o b l a s t c e l l s as well as a mouse primary f i b r o b l a s t c e l l culture (see Table III f o r references). As i n HeLa c e l l s and chicken c e l l s , other mammalian shsps appear as multiple components on two-dimensional gels. Three variants of hsp25 have been observed i n heat shocked primary cultures of hamster f i b r o b l a s t s (Atkinson and Pollock, 1982). The detailed analysis of hsp25 isoforms i n various rat c e l l types (Kim et a l . , 1983; Welch, 1985) emphasizes the complexity of shsp regulation. In rat myoblast c e l l s , 4 heat inducible proteins i n the 25 kd - 30 kd range can be distinguished on two-dimensional gels (Kim et al^. , 1983). Of these, 2 are not l a b e l l e d with methionine while ,arsenite or arsenate treatment induces an addi t i o n a l 2 proteins of comparable s i z e . The same authors have also shown that arsenate induces a 30 kd protein i n 13 day old chick embryo muscle i n addition to hsp25. Furthermore, the induction of these proteins varied i n the d i f f e r e n t rat tis s u e c e l l l i n e s that were used. Welch (1985) has reported the existence of four hsp25 isoforms i n rat embryo f i b r o b l a s t c e l l s , none of which are l a b e l l e d with methionine. The induction of these four proteins, which were shown to be related, d i f f e r e d depending upon the agent used which included heat, arsenite and amino acid analogues. In rat myoblast c e l l s , two hsp25 proteins are phosphorylated at s e r y l residues (Kim et a l . , 1984). S i m i l a r l y , i t has been shown that three hsp25 isoforms i n rat embryo f i b r o b l a s t c e l l s are phosphoproteins i n both normal 23 and stressed c e l i s (Welch, 1985). The phosphorylation of two of these proteins increases when the c e l l s are treated with a phorbol d i e s t e r (phorbol-12-myristate-13 acetate), a calcium ionophore, A23187, or i f quiescent c e l l s are given fresh serum. None of these treatments induces a stress response. The characterization of two genes rel a t e d to the 4 member gene family encoding human hsp25 has recently been reported (Hickey et a l . , 1986). One gene, designated HS11, i s a member of a c l u s t e r of three genes linked within a 14 - 18 kb region of the genome. SI nuclease protection experiments confirm that t h i s gene i s expressed at low levels i n control c e l l s but i s induced 20-fold during heat shock. The open reading frame, which i s interrupted by two intervening sequences of 723 and 120 bp, encodes a polypeptide of 22,300 deduced molecular weight. The second i s o l a t e d gene, designated HS8, appears to be a processed pseudogene lacking promoter elements and i s unlinked to the other members of the hsp25 gene family. The deduced amino acid sequence of hsp25 shows homology to the vertebrate a - c r y s t a l l i n s and to the shsps of Drosophila, soybean and Xenopus and thus i s i n d i c a t i v e of a c a r e f u l l y conserved e s s e n t i a l p h y s i o l o g i c a l r o l e . 1.2.3 Xenopus In Xenopus laevis somatic c e l l s or cultured f i b r o b l a s t s , a 30 kd o o p r o t e i n i s induced at temperatures between 32 C and 37 C (Bienz, 1982). In v i t r o t r a n s l a t i o n experiments demonstrate that i t s corresponding mRNA i s newly synthesized during heat shock and thus i s under t r a n s c r i p t i o n a l c o n t r o l , as are the genes at locus 67B i n Drosophila. 24 Sequences encoding hsp30 have been i s o l a t e d from cDNAs made to heat shocked Xenopus polyA RNA from an e p i t h e l i a l kidney f i b r o b l a s t c e l l l i n e (Bienz, 1984a). DNA sequence data reveals a 45% homology to the 83 amino acid domain of the Drosophila shsps. No homology i s detectable i n the preceding 80 amino acid residues or i n the carboxy-terminal 40 amino acid residues. Clones from a Xenopus l a e v i s blood c e l l genomic DNA l i b r a r y have been i s o l a t e d and two hsp30 coding regions have been i d e n t i f i e d as hsp30A and hsp30B (Bienz, 1984b). Neither gene i s completely i d e n t i c a l to the sequenced cDNA. Based on t h i s , along with unpublished genomic Southern b l o t r e s u l t s , Bienz (1984b) suggests that there may be a multi-gene family of 5 -10 members coding f or hsp30. This i s supported by the observation that 5 heat inducible 30 kd proteins can be separated on two-dimensional gels (Guedon et a l . , 1985). The hsp30 cDNA has been used to quantify corresponding mRNA le v e l s during Xenopus development and i n various somatic tissues (Bienz, 1984a). Whereas hsp70 mRNA can be heat induced at the b l a s t u l a stage, hsp30 i s not heat inducible u n t i l the swimming tadpole stage. This i s i n agreement with the observation that hsp30 could-not be induced i n Xenopus oocytes (Bienz and Gurdon, 1982; Bienz, 1982) but i n c o n f l i c t with Guedon et a l . (1985) who observed that i t could. Hsp30 also shows some degree of tissu e s p e c i f i c i t y , i t s messages accumulating to leve l s 10-fold higher i n the kidney and gut as compared to lung or l i v e r a f t e r heat shock. Although hsp30 genes may be repressed during early development i n Xenopus, becoming responsive to heat shock i n l a t e r stages, there i s no report of these genes being transcribed under non-stress conditions. 25 1.2.4 Other Organisms Based on s i m i l a r i t i e s i n molecular weight, many hsps reported i n other systems may be related to the shsps already discussed. A hsp p r o f i l e analogous to Drosophila melanogaster i s found i n another dipteran, Chironomus tentans (Tanguay and Vincent, 1981). In the skipper b u t t e r f l y (Calpodes e t h l i u s ) , a lepidopteran, shsps of 26 kd and 22 kd resolve into multiple components on two-dimensional gels (Dean and Atkinson, 1983). A 28 kd protein i s induced with cadmium and zinc i n chinook salmon embryo c e l l s ( Heikkila et a l . , 1982) while a p a i r of proteins approximately 30 kd i n s i z e are induced with heat and arsenite i n rainbow trout f i b r o b l a s t c e l l s (Kothary and Candido, 1982). H e i k k i l a et a l . (1982) have observed that the metal induced protein i s not induced by a temperature increase to 24°C but t h i s may have been below the threshold of induction since the hsps of trout are induced at 27°C (Kothary and Candido, 1982). Heat shock induces the synthesis of approximately 10 proteins i n the molecular weight range of 23,000 to 32,000 i n the slime mold Dictyostelium  discoideum (Loomis and Wheeler, 1982) and i n the protozoan Tetrahymena  pyriformis (Guttman et a l . , 1980). In Tetrahymena, these shsps are also induced by d e c i l i a t i o n or by a release from anoxia. In Volvox cultures, approximately 6 heat inducible proteins between 18 kd and 26 kd have been observed (Kirk and Kirk, 1985). In t e r e s t i n g l y , these proteins show d i f f e r e n t patterns when synthesized i n v i t r o or i n vivo, suggesting perhaps that p o s t - t r a n s l a t i o n a l modification i s involved. Fungal systems also synthesize shsps under hyperthermic conditions. A 23 kd hsp which runs as a s i n g l e basic band on two-dimensional gels has been i d e n t i f i e d i n Neurospora crassa (Kapoor, 1983). In yeast (Saccharomyces 26 c e r e v i s i a e ) . a 26 kd protein i s synthesized during heat shock. I t i s also induced early i n sporulation under normal growth conditions, which i s reminiscent of the developmental control of the genes at locus 67B i n Drosophila (Kurtz et a l . , 1986). 1.3 T r a n s c r i p t i o n a l Control and Induction Mechanisms The expression of shsps a l t e r s dramatically upon heat shock. The complexity of the response becomes evident when the same proteins are found to be induced by a wide v a r i e t y of agents and i s compounded by phenomena such as d i f f e r e n t i a l synthesis during c e r t a i n developmental stages, non-responsiveness to stress during gametogenesis and embryogenesis, t i s s u e s p e c i f i c regulation and the d i f f e r e n t i a l response to d i f f e r e n t stressors within the same c e l l type. Despite t h i s complexity, some important generalizations can be made. With the exception of early hsp27 and hsp26 expression i n Drosophila embryos due to stored mRNA i n the oocyte (Zimmerman et a l . , 1983), the appearance of shsps from plants to man i s due to new t r a n s c r i p t i o n a l a c t i v i t y . Although i t has been suggested that the induction of hsp25 i n canavanine-treated CEF c e l l s i s due to the t r a n s l a t i o n of e x i s t i n g message (White and Hightower, 1984) t h i s i s i n d i r e c t c o n f l i c t to i n h i b i t o r studies i n which hsp25 synthesis under the same conditions i s blocked by actinomycin D (Kelly and Schlesinger, 1978). Additional support for the above conclusion comes from the observation that i n CEF c e l l s , hsp25 synthesis can occur i n virus in f e c t i o n s only when the virus i s defective i n terminating host RNA synthesis ( C o l l i n s et a l . , 1980; Notarianni and Preston, 1982). 27 1.3.1 Gene Promoter Function The other generalization that can be made comes from the available sequence analysis of gene promoter regions. Without exception, a l l heat inducible genes including gene 1 and the genes coding f or hsp22, 23, 26 and 27 i n Drosophila. the genes coding for four hspl7 variants i n soybean, the human HS11 gene and the'gene coding for hsp30A i n Xenopus contain heat shock elements (HSEs) upstream from the TATA motif. These elements resemble the 14 bp palindromic consensus sequence which has been shown to confer heat i n d u c i b i l i t y upon genes (Bienz and Pelham, 1982; Pelham, 1982; Pelham and Bienz, 1982; Mirault et a l . , 1982). It should be mentioned that i n the hsp30B gene of Xenopus, which may be a pseudogene, the proximal HSE has diverged s i g n i f i c a n t l y compared to the hsp30A gene (Bienz, 1984b). I t i s becoming more evident that non-HSE promoter function may be responsible f or t r a n s c r i p t i o n a l a c t i v a t i o n i n the case of some inducers other than heat shock. An understanding of multiple promoter function has come from the deta i l e d analysis of promoter deletions reintroduced, preferably, into a homologous environment. A siz e variant of hsp27 (hsp!8.5) has been introduced into the Drosophila genome using P-element mediated transformation (Hoffman and Corces, 1984) where i t displays heat i n d u c i b i l i t y and temporal regulation through development i d e n t i c a l to endogenous hsp27. Deletion analysis of upstream sequences has demonstrated that heat i n d u c i b i l i t y and ecdysterone responsiveness functions are separate (Hoffman and Corces, 1986). Deletions that remove 80% of i t s heat i n d u c i b i l i t y (-2.1 kb to -1.1 kb) have no e f f e c t on hsp!8.5 mRNA le v e l s i n pre-pupal stages. A construct which retains only 124 bp 5' to the s t a r t of t r a n s c r i p t i o n completely abolishes heat 28 a c t i v a t i o n yet retains 30% of i t s hormone responsiveness. This region contains homologies to sequences shown to be important f o r ecdysterone induced expression of the Drosophila melanogaster glue genes (Muskavitch and Hogness, 1982; McGinnis et a l . , 1983; Bourouis and Richards, 1985). F u l l heat i n d u c i b i l i t y of the hsp27 gene may be due to the concerted e f f e c t of multiple HSEs, 4 clustered within 125 bp approximately 300 bp upstream of the mRNA i n i t i a t i o n s i t e , and 2 located 30 bp apart at a distance of greater than 1 kb from the t r a n s c r i p t i o n s t a r t and located, i n fa c t , within the adjacent hsp23 coding region (see Figure 1). By assaying various hsp27 promoter constructs i n Drosophila tissue culture c e l l s , Riddlhough and Pelham (1986) have also found that ecdysterone and heat i n d u c i b i l i t y elements are d i s t i n c t . These authors, however, separate the functional elements into two cl u s t e r s , each covering approximately 100 bp, some 300 and 500 bp upstream of the cap s i t e . The region between -579 and -455 i s necessary and s u f f i c i e n t f o r ecdysterone induction but i s not required f o r heat induction. F u l l heat i n d u c i b i l i t y i s accomplished by the multiple HSEs at approximately -300. The heat i n d u c i b i l i t y and developmental regulatory functions have also been shown to be d i s t i n c t at the promoter l e v e l f o r the hsp26 gene (Cohen and Meselson, 1985). Upstream regions of the hsp26 gene were fused to bacteriophage lambda DNA and introduced into Drosophila using the P-element system. Sequences required f o r the f u l l heat shock response are located within 341 bp upstream of the 5' end of the mRNA and contain 6 HSEs. Sequences approximately 200 bp further upstream are responsible f o r the normal ovarian and pupal responses. 29 Using P-element mediated transformation, Klemenz and Gehring (1986) have introduced promoter deletions of the hsp22 gene into a f l y s t r a i n which synthesizes an electrophoretic variant of hsp22. The hsp22 gene contains two c l o s e l y spaced HSEs which are j u s t upstream of the TATA box while a t h i r d d i s t a l element i s located a further 100 bp upstream. Although deletions r e t a i n i n g a l l three HSEs maintain f u l l heat inducible function and f u l l developmental expression, the authors suggest that the sequence requirements f o r the two modes of gene a c t i v a t i o n might not be completely congruent. A deletion containing both of the proximal HSEs s t i l l confers approximately 20% of the heat i n d u c i b i l i t y but expression during early pupal stages i s undetectable. The use of d i f f e r e n t promoter sequences for hormone and heat induction has also been shown for hsp23 using hsp23/beta- galactosidase hybrid genes i n Drosophila tissue culture c e l l s ( M e s t r i l et a l . , 1986). The soybean 17.5-E gene has been introduced into primary sunflower tumors with the T-DNA region of ARrobacterium tumefaciens (Gurley et a l . , 1986). A construct containing 3.2 kb of upstream sequences i s strongly induced by heat shock and arsenite and to a lesser degree by cadmium. Once again, a d d i t i o n a l analysis w i l l be required to ascertain whether the arsenite and/or cadmium responsive functions can be separated from the heat inducible ones. Cadmium and other heavy metal ions may exert t h e i r influence on heat shock gene induction through sequences s i m i l a r to the metal ion response element (MRE) which has been shown by deletion analysis to be e s s e n t i a l f o r induction of the human metallothionein-IIA gene by cadmium (Karin et a l . , 1984). S i g n i f i c a n t homologies to t h i s region have been reported i n the 30 soybean 17.5-E gene as two repeats between the TATA motif and the t r a n s c r i p t i o n s t a r t (Czarnecka et a l . , 1985). The f a c t that arsenite induces the expression of proteins which are not heat inducible i n ra t myoblast c e l l s (Kim et al.., 1983), i n chick embryo muscle t i s s u e (Kim et a l . , 1983) and i n rainbow trout f i b r o b l a s t c e l l s (Kothary and Candido, 1982) suggests that arsenite, as well, may be inducing gene a c t i v i t y through sequences other than HSEs. Furthermore, the hsp25 gene i s induced by arsenite, copper and zinc i n q u a i l myotubes which have l o s t t h e i r thermal s e n s i t i v i t y (Atkinson et a l . , 1983). 1.3.2 Heat Shock Regulons The number and variety of ways i n which shsps can be induced strongly suggests that a common mechanism may be involved for many of them. Consistent with t h i s model would be the a c t i v a t i o n of a factor during c e l l u l a r stress or damage which i n i t i a t e s t r a n s c r i p t i o n of a battery of genes (regulon) through a common sequence element. A heat shock t r a n s c r i p t i o n factor (HSTF) has been p a r t i a l l y p u r i f i e d from nuclear extracts of Drosophila ti s s u e culture c e l l s which i s s p e c i f i c a l l y required for t r a n s c r i p t i o n of a Drosophila hsp70 gene i n v i t r o (Parker and Topol, 1984). DNAsel fo o t p r i n t i n g data demonstrates that HSTF has a high a f f i n i t y for HSEs i n v i t r o (Parker and Topol, 1984; Topol et a l . , 1985). Cooperative binding occurs at a p a i r of adjacent HSEs located i n the Drosophila hsp70 gene (Topol et a l . , 1985). Both are required for maximal heat i n d u c i b i l i t y i n vivo (Dudler and Travers, 1984; Simon et a l . , 1985) and i n Drosophila melanogaster t i s s u e culture c e l l s (Amin et a l . , 1985). This region i s also protected by HSTF from exoIII nuclease digestion i n n u c l e i 31 p u r i f i e d from heat shocked Drosophila c e l l s but not i n n u c l e i i s o l a t e d from c e l l s grown at normal temperature (Wu, 1984). The procaryotic counterpart to HSTF i s a 32 kd sigma factor (sigma 32) that stimulates t r a n s c r i p t i o n i n i t i a t i o n from heat shock promoters (Grossman et a l . , 1984; Landick et a l . , 1984; Yura et a l . , 1984). Interestingly, a consensus sequence derived from s i x of the known heat shock genes of Escherichia c o l i consists of a -35 element which contains one h a l f of the eucaryotic HSE concensus (Cowing et a l . , 1985). Mutations within the gene coding f o r sigma 32 (rpoH gene) have shown that the heat shock genes are under the p o s i t i v e control of sigma 32. A nonsense mutation i n a s t r a i n (rpoH165) carrying a tRNA that suppresses o o . . amber mutations at 28 C but not 42 C, eliminates the synthesis of hsps a f t e r a s h i f t to the high temperature and, i n f a c t , the c e l l s die a f t e r a o b r i e f period at 42 C (Neidhart and Van Bogelen, 1981; Yamamori and Yura, 1982). S i g n i f i c a n t amounts of HSTF and sigma 32 are, however, found i n normally growing c e l l s (Beckman and Cooper, 1973; Parker and Topol, 1984). Whether or not they are required under normal conditions i s not yet known. I f the rpoH gene carrying a nonsense mutation i s placed i n a non-suppressing environment, the one hsp analyzed (groE) i s s t i l l synthesized at 30°C o although no induction i s observed at 42 C (Yura et a l . , 1984). This suggests that sigma 32. i s dispensable at low temperatures. HSTF i s probably activated during heat shock since HSTF derived from heat shocked c e l l s i s more active i n t r a n s c r i p t i o n assays (Parker and Topol, 1984). . , 32 An i n d i c a t i o n that sigma 32 may be found i n 2 d i f f e r e n t forms comes from the observation that sigma 32 from c e l l lysates migrates as 2 spots on two-dimensional gels, but only as 1 spot when copurified with RNA polymerase (Grossman et a l . , 1984). 1.3.3 A c t i v a t i o n of Transcription Factors The evidence already presented suggests that an activated t r a n s c r i p t i o n f a c t o r i n t e r a c t s with genes within the heat shock regulon to i n i t i a t e coordinate expression. Recently, several small molecules have been i d e n t i f i e d i n Salmonella  typhimurium and E. c o l i that accumulate under heat shock or ethanol stress. The i n t r a c e l l u l a r concentration of f i v e adenylated nucleotides (AppppA, AppppG, ApppG, ApppA, ApppGpp) increases 5 - 1 0 f o l d within 5 minutes a f t e r i n s u l t (Lee et a l . , 1983). The observation that these nucleotides s t i l l accumulate i n the absence of hsp synthesis i n the rpoH165 mutant led the authors to suggest that they were alarmones s i g n a l l i n g the onset of oxidative stress and t r i g g e r i n g the heat shock response. The accumulation of only ApppA occurs i n heat shocked yeast c e l l s (Denisenko, 1984). Adenylated nucleotides are believed to be synthesized i n vivo by a side reaction of aminoacyl-tRNA synthetases (Rapaport et a l . , 1975). Curiously, one of the hsps i n E. c o l i i s an inducible species of lysyl-tRNA synthetase encoded by the lysU gene (Van Bogelen et a l . , 1983). Many observations, however, c o n f l i c t with t h i s model. The k i n e t i c s of the accumulation of these alarmones i s not consistent with the fa c t that i n b a c t e r i a , t r a n s c r i p t i o n a f t e r heat shock i s observed within one minute and 33 has reached a maximum l e v e l and begun to decrease within 5 minutes of the temperature s h i f t . I n j e c t i o n of Xenopus oocyte n u c l e i with e i t h e r AppppA or ApppA does not induce hsp synthesis (Guedon et a l . , 1985). Also, i n Xenopus oocytes the accumulation of AppppA to 10 times i t s basal l e v e l occurs only under severe heat conditions such as 45°C whereas hsp synthesis r e a d i l y o proceeds at 33 C (Guedon et a l . , 1985). F i n a l l y , treatment of Drosophila t i s s u e culture c e l l s with cadmium chloride under conditions which induce the heat shock response (Courgeon et §_1. , 1984) does not s i g n i f i c a n t l y a f f e c t the c e l l u l a r pool of AppppN and ApppN nucleotides (Brevet et a l . , 1985). There i s mounting evidence that the heat shock response i s intimately associated with protein degradation systems. This should not be s u r p r i s i n g since most of the known inducers must indeed lead to protein damage. In some f l i g h t l e s s Drosophila mutants, molecular lesions i n a c t i n I II isoforms leads to the disruption of m y o f i b r i l s i n i n d i r e c t f l i g h t muscle, the only ti s s u e i n which they are expressed. This i s associated with c o n s t i t u t i v e hsp synthesis only within the same c e l l type ( K a r l i k et a l . , 1984; Hiromi and Hotta, 1985). P-element mediated transformation with these mutant a c t i n genes also r e s u l t s i n c o n s t i t u t i v e expression of the heat shock genes within the i n d i r e c t f l i g h t muscle (Hiromi et a l . , 1986). A mouse c e l l l i n e c a l l e d ts85 contains a thermolabile u b i q u i t i n -a c t i v a t i n g enzyme (E-l) (Finley et a l . , 1984). At the non-permissive o temperature of 39 C, s h o r t - l i v e d proteins and abnormal proteins are not e f f i c i e n t l y degraded since they do not become ubiquitinated (Ciechanover et a l . , 1984). At t h i s temperature, which i s well below the normal threshold of hsp induction, ts85 c e l l s synthesize hsps at high l e v e l s (Ciechanover-et a l . , 1984). 34 In E. c o l i , the synthesis of large amounts of aberrant polypeptides due to canavanine incorporation, the production of truncated proteins i n the presence of puromycin, the induction of t r a n s l a t i o n a l errors with streptomycin, or the synthesis of a cloned foreign protein (human t i s s u e plasminogen activator) leads to the induction of the heat shock response (Goff and Goldberg, 1985). This phenomenon i s not seen i n the rpoH165 mutant i n which the sigma f a c t o r s p e c i f i c to the heat shock regulon i s defective. The induction of the heat shock response by amino acid analogues i s , presumably, a d i r e c t r e s u l t of t h e i r incorporation Into newly synthesized proteins, rendering them nonfunctional. Homoarginine, which i s not incorporated into proteins (Nazario and Evans, 1974), does not induce a heat shock response i n CEF c e l l s (Hightower, 1980). The most d i r e c t evidence f o r a l i n k between protein degradation and the heat shock response comes from the work of Ananthan et a l . (1986). A Drosophila hsp70/beta-Ralactosidase hybrid gene i s activated i n Xenopus oocytes when co-injected with bovine beta-lactoglobulin or bovine serum albumin that has been denatured by reductive carboxymethylation. The native proteins have no e f f e c t . Native hemoglobin also has no e f f e c t , but globin monomers which r e s u l t from extraction of the heme groups do. Furthermore, the analysis of promoter deletions demonstrates that the proximal HSE i s required f or both heat shock induction and for a c t i v a t i o n by denatured protein. A l l of these re s u l t s suggest that a depletion of activated u b i q u i t i n pools i n eucaryotes and the overburdening of protein degradation systems i n procaryotes leads to the a c t i v a t i o n of the heat shock response. 35 Int e r e s t i n g l y , E. c o l i protease La i s a hsp under the regulation of sigma 32 (Goff et a l . , 1984; P h i l l i p s et a l . , 1984; Baker et a l . , 1984). S i m i l a r l y , i t has been shown that u b i q u i t i n mRNA and u b i q u i t i n synthesis increase 5-fold a f t e r heat shock i n chicken embryo f i b r o b l a s t s (Bond and Schlesinger, 1985). In eucaryotes, u b i q u i t i n a t i o n of damaged proteins could deplete activated u b i q u i t i n pools, mimicking the l e s i o n found i n ts85 c e l l s . Under these conditions, a l l a v a i l a b l e u b i q u i t i n stores would be mobilized to degradation pathways. This i s consistent with the observation that ubiquitinated histone H2A i s depleted i n ts85 c e l l s at the non-permissive temperature (Matsumoto et a l . , 1983; F i n l e y et §_1., 1984) or i n Drosophila c e l l s under heat shock (Glover, 1982a). Thus i t i3 possible that during heat shock or metabolic stress, HSTF may be activated by the conversion of a ubiquitinated form to a non-ubiquitinated form although there i s no d i r e c t evidence to support t h i s as yet. A l t e r n a t i v e l y , HSTF and sigma 32 may have a high turnover i n control c e l l s , being susceptible to protein degradation pathways. Under metabolic s t r e s s , general c e l l u l a r p rotein damage would d i v e r t the pathway and HSTF would be s t a b i l i z e d . S i m i l a r l y , a defective p r o t e i n degradation system such as i n ts85 c e l l s at 39°C, would s t a b i l i z e the t r a n s c r i p t i o n f a c t o r and lead to hsp synthesis. 1.3.4 D i f f e r e n t i a l HSmRNA S t a b i l i t y Although the heat shock response i s characterized by new t r a n s c r i p t i o n a l a c t i v i t y , v a r i a b i l i t y i n accumulated mRNA l e v e l s due to differences i n s t a b i l i t y may r e s u l t i n altered patterns of hsp synthesis. The synthesis of shsps i n heat shocked versus ecdysterone treated 36 Drosophila melanogaster tissue culture c e l l s i s one example of t h i s . The r a t i o of hsp23 to hsp22 varies from 3 during heat shock to 20 during ecdysterone treatment (Vitek and Burger, 1984). Under heat shock conditions, the mRNA levels f o r hsp23, 22, 26. and 27 increase r a p i d l y f o r 30 minutes and plateau at s i m i l a r l e v e l s . With hormone treatment, however, hsp23 mRNA increases s t e a d i l y f o r 24 hours, reaching a l e v e l approximately 50% that of heat shock. Hsp22 mRNA. on the other hand, increases during the f i r s t 4 hours and reaches a plateau so that by 24 hours, the r a t i o of hsp23 mRNA to hsp22 mRNA i s approximately 6. Under the same conditions hsp26 and hsp27 t r a n s c r i p t s r i s e to intermediate l e v e l s . Vitek and Burger (1984) further showed by pulse-chase experiments that the v a r i a b i l i t y i n steady-state mRNA levels i s due to differences i n mRNA s t a b i l i t y . o Int e r e s t i n g l y , hsmRNAs are more stable during a chase at 35 C as compared to 25°C. 1.4 T r a n s l a t i o n a l Control The changing patterns of protein synthesis during heat shock u s u a l l y include the repression of e x i s t i n g protein synthesis as well as the appearance of heat shock proteins. The degree to which t h i s occurs depends on the c e l l type i n question and the nature or severity of the s t r e s s . For example, there i s no cessation of t r a n s l a t i o n of ex i s t i n g messages upon heat shock i n Xenopus somatic c e l l s as there i s i n Xenopus oocytes (Bienz, 1982). Storage proteins i n the soybean embryo (seed) continue to be synthesized at high temperatures along the hsps (Altschuler and Mascarenhas, 1982). In Drosophila cel l s . , heat: shock, arsenite, and canavanine treatments 37 vary i n t h e i r a b i l i t y to shut down normal protein synthesis even though hsps are induced i n a l l three s i t u a t i o n s (Olsen et a l . , 1983). These changes i n protein synthesis might occur v i a changes i n the s p e c i f i c i t y of the t r a n s l a t i o n a l machinery so that a subset of mRNAs i s translated more e f f i c i e n t l y than another, or by changes i n the mRNA pools that are a v a i l a b l e to the ribosomes. Both of these mechanisms are used, the l a t t e r s i t u a t i o n being u t i l i z e d i n yeast. 1.4.1 HSmRNA S e l e c t i v i t y In most organisms pre-heat shock mRNAs (normal mRNAs) are stable under heat shock conditions since they are e f f i c i e n t l y translated i n a va r i e t y of in v i t r o systems but not i n vivo. In Drosophila c e l l s ( S t o r t i et a l . , 1980) and HeLa c e l l s (McCormick and Penman, 1969; Hickey and Weber, 1982) normal protein synthesis resumes i n the presence of actinomycin D upon return to normal temperature suggesting that t r a n s l a t i o n takes place on e x i s t i n g messages which have been i n a c t i v e during stress. E f f i c i e n t t r a n s l a t i o n of normal mRNAs i n v i t r o further suggests that they do not become modified i n any way even though they are p r e f e r e n t i a l l y ignored by the t r a n s l a t i o n a l machinery i n vivo. Polysome breakdown i s an immediate response to heat shock. This has been shown f o r Drosophila (McKenzie et a l . , 1975) and soybean (Key et a l . , 1981). In Drosophila, the percentage of ribosomes i n monosome form compared to polysome form increases from approximately 20% to 50% during heat shock (Lindquist, 1980; B a l l i n g e r and Pardue, 1983). These changes are not due to a flood of newly synthesized hsmRNA since they occur i n actinomycin D treated c e l l s (Lindquist, 1980). As discussed e a r l i e r , a bimodal 38 d i s t r i b u t i o n of polysomes i s found i n heat shocked Drosophila c e l l s , which r e f l e c t s the commitment of these c e l l s to the t r a n s l a t i o n of the two major si z e classes of hsmRNA. In v i t r o t r a n s l a t i o n of polysomal mRNA from heat shocked Drosophila c e l l s (Kruger and Benecke, 1981; B a l l i n g e r and Pardue, 1983) and azetidine (proline analogue) treated HeLa c e l l s (Thomas and Mathews, 1982) demonstrates, however, that a s i g n i f i c a n t proportion of normal messages are s t i l l associated with polysomes even though they are not being translated. Using s p e c i f i c h y b r i d i z a t i o n probes, i t was shown that alpha-tubulin, beta-tubulin and a c t i n f a l l into t h i s category (Kruger and Benecke, 1981). B a l l i n g e r and Pardue (1983) have estimated that there i s a 15 - 30 f o l d decrease i n the i n i t i a t i o n / e l o n g a t i o n rates of ribosomes on normal mRNAs in heat shocked Drosophila c e l l s . In HeLa c e l l s , hsp tr a n s l a t i o n i s more se n s i t i v e to cycloheximide suggesting that hsp mRNAs i n i t i a t e t r a n s l a t i o n more e f f i c i e n t l y than most normal mRNAs (Hickey and Weber, 1982). The p r e f e r e n t i a l t r a n s l a t i o n of hsmRNAs can be reproduced i n v i t r o using c e l l lysates prepared from heat shocked Drosophila tissue culture c e l l s ( S t o r t i et a l . , 1980; Kruger and Benecke, 1981). These lysates have an optimum temperature for protein synthesis of 28°C suggesting that a o stable change takes place during heat shock at 36 C. A lysate prepared o from c e l l s grown at 25 C translates both normal mRNAs and hsmRNAs. Fractionation of lysates and subsequent supplementation experiments demonstrated that the ribosomal f r a c t i o n (222,600 x g p e l l e t ) of control lysates could rescue normal mRNA t r a n s l a t i o n i n heat shock lysates (Scott and Pardue, 1981). The a b i l i t y to rescue normal t r a n s l a t i o n was diminished by a 0.5 M KC1 wash. None of the heat shock lysate fractions could cause 39 the 25 C lysate to change i t s s p e c i f i c i t y suggesting that there i s a negative c o n t r o l or i n a c t i v a t i o n of a component i n the heat shock lysate. A candidate f o r t h i s type of modification i s the dephosphorylation of ribosomal protein S6 during heat shock which has been shown to occur i n Drosophila (Glover, 1982b), i n suspension cultures of tomato (Scharf and Nover, 1982), i n primary cultures derived from human skin f i b r o b l a s t s and meningiomas (Richter, 1983), as well as i n human HeLa and baby hamster kidney c e l l s (Kennedy et a l . , 1984). The observations made by Olsen-et a l . (1983) are inconsistent with t h i s simple c o r r e l a t i o n : i n t h e i r studies, the rephouphorylation of S6 i n Drosophila c e l l s was found not to occur u n t i l recovery hod proceeded for 8 hours, well a f t e r normal protein synthesis had reuumed. Also, arsenite and canavanine treatment of Drosophila c e l l s induced hsp synthesis but dephosphorylation of S6 was not observed. Recently, i t was reported that the ribosomal supernatant from 25°C Drosophila c e l l lysates could rescue the t r a n s l a t i o n of normal mRNAs i n heat shock lysates (Sanders et a l . , 1986). The f a c t that these authors used higher i o n i c strength buffers i n t h e i r ribosomal p u r i f i c a t i o n s i s consistent with the i n i t i a l observation made by Scott and Pardue (1981) that rescue was reduced with s a l t washed ribosomes. Sanders et a l . (1986) also showed that a reconstituted system containing heat shocked ribosomes and a control supernatant had the a b i l i t y to synthesize normal proteins. The change i n the s p e c i f i c i t y of t r a n s l a t i o n during heat shock may therefore depend on soluble factors such as t r a n s l a t i o n i n i t i a t i o n f a c t o r s . Detailed immunoblot analysis of HeLa c e l l lysates demonstrates that a v a r i e t y of modifications occur i n various i n i t i a t i o n factors upon heat shock 40 (Duncan and Hershey, 1984). Also, phosphorylation of eIF-2 alpha occurs i n re t i c u l o c y t e lysates heated to 42°C (Ernst et a l . , 1982). In Drosophila c e l l s , some normal messages escape the t r a n s l a t i o n a l s e l e c t i v i t y during heat shock. Histone H2B synthesis increases 3 - 4 f o l d during heat shock (Sanders, 1981). Although t r a n s c r i p t i o n of the histone gene i s r e l a t i v e l y unaffected, a greater abundance of histone H2B s p e c i f i c mRNA i s found i n polysomes i s o l a t e d from heat shocked c e l l s as compared to control c e l l s (Farrell-Towt and Sanders, 1984). Also, i n Drosophila Schneider 2 c e l l s infected with the double stranded DNA virus HPS-1, HPS-1 s p e c i f i c proteins continue to be synthesized during heat shock (Scott ot aJL. , 1980). The sequences required f o r high temperature t r a n s l a t i o n are now under in v e s t i g a t i o n . Drosophila hsp70 genes with deleted leader sequences or fusions between hsp70 promoter sequences and an alcohol dehydrogenase (AdH) gene containing i t s own leader and coding regions have been introduced into Drosophila t i s s u e culture c e l l s (McGarry and Lindquist, 1985) and f l i e s (Klemenz et a l . , 1985). In both cases, t r a n s c r i p t s accumulate to high l e v e l s during heat shock but they are not translated u n t i l the c e l l s are returned to normal temperature. These r e s u l t s suggest that the 5' untranslated leader sequences of hsp mRNAs are required for p r e f e r e n t i a l t r a n s l a t i o n at elevated temperature. I n i t i a l observations (DiNocera and Dawid, 1983; Lawson et a l . , 1984) suggested that only the terminal sequences of heat shock mRNA leaders f u l f i l l e d t h i s function. The fusion of only the f i r s t 95 bp of the hsp70 250 bp leader sequence i to the wild type AdH leader i s s u f f i c i e n t to d i r e c t t r a n s l a t i o n at high temperature (Klemenz et a l . , 1985). Deletions of the same leader"between +3 41 and +26 or between +14 and +114 have no e f f e c t on wild type t r a n s l a t i o n (McGarry and Lindquist, 1985). Su r p r i s i n g l y , a tandem duplication between -29 and +2 which r e s u l t s i n an add i t i o n a l 39 bp attached to the 5' end of a p e r f e c t l y normal 250 bp leader, destroyed the t r a n s l a t i o n a l s e l e c t i v i t y of that mRNA upon heat shock (McGarry and Lindquist, 1985). Similar experiments demonstrate that only approximately the f i r s t 30 bp of the hsp22 mRNA 250 bp leader sequence are required f o r i t s t r a n s l a t i o n during stress (Hultmark et a l . , 1986). 1.4.2 High mRNA Turnover In yeast (Saccharomyces cerevi3iae), the pattern of protein synthesis a l t e r s r a p i d l y upon a o h i f t from 23°C to 36°C ovon though both temperatures are considered to be within i t s normal growth range (McAlister and F i n k e l s t e i n , 1980a; Lindquist, 1981). In th i s organism, however, the i n v i t r o t r a n s l a t i o n pattern f o r RNA i s o l a t e d from heat shocked c e l l s corresponds to that seen i n vivo (McAlister and F i n k e l s t e i n , 1980a; Lindquist, 1981). This suggest that the reduced synthesis of p a r t i c u l a r proteins during heat shock correlates with the degradation of t h e i r mRNAs. Hybridization of s p e c i f i c gene probes to mRNA supports t h i s since ura-3 mRNA le v e l s decrease 5 f o l d within 1 hour while lev-2 mRNA le v e l s decrease to 5% that of normal during the same time period (Lindquist, 1981). Both the appearance of hsmRNAs and the rapid disappearance of normal mRNAs are dependent upon new t r a n s c r i p t i o n . I f t r a n s c r i p t i o n i s i n h i b i t e d by the zinc-chelating a n t i b i o t i c lomofungin or- i f t s r n a l strains are used i n which RNA transport/processing i s defective at 36°C, then repression of protein synthesis i s greatly reduced ( M i l l e r et a l . , 1979; McAlister and 42 F i n k e l s t e i n , 1980a). This phenomenon, however, does not require protein synthesis since cycloheximide treatment or the use of stra i n s which have a temperature s e n s i t i v e defect i n t r a n s l a t i o n i n i t i a t i o n (ts!87) have no e f f e c t on changing mRNA pools during heat shock as assayed by i n v i t r o t r a n s l a t i o n (McAlister and F i n k e l s t e i n , 1980a). 1.5 Recovery and Autoregulation The e f f e c t s of heat shock and other stress conditions are always r e v e r s i b l e upon return to normal temperature, or to a lesser and more vari a b l e degree upon prolonged exposure to stress depending on the a d a p t i b i l i t y of the c e l l type. In most organisms such as Drosophila. mammals, and highor plants, the return to normal protein synthesis i s probably simply a matter of the resumption of t r a n s l a t i o n of e x i s t i n g messages, since recovery i s in s e n s i t i v e to i n h i b i t o r s of t r a n s c r i p t i o n . Yeast, on the other hand, requires new mRNA synthesis i n order to recover the pre-existing protein synthesis pattern. The s i t u a t i o n i n avian systems, s p e c i f i c a l l y i n chick embryo f i b r o b l a s t s , presents an enigma. Although i n v i t r o t r a n s l a t i o n r e s u l t s indicate that normal mRNAs are present i n heat shocked c e l l s ( K e l l y et a l . , 1980; Johnston et a l . , 1980; Voellmy and Bromley, 1982), recovery i s blocked by actinomycin D (Hightower, 1980; Schlesinger et a l . , 1982). I f cycloheximide i s present during an 8 hour recovery period and removed p r i o r to l a b e l l i n g of newly synthesized protein, the heat shock p r o f i l e i s seen, suggesting that there i s also a need f o r new protein synthesis i n order f o r recovery to proceed (Hightower, 1980; Schlessinger et a l . , 1982). 43 In Drosophila, a l l normal mRNAs resume t r a n s l a t i o n at the same rate i n recovering c e l l s ; on the other hand, the repression of hsp synthesis i s a-synchronous and occurs i n a reproducible order (DiDomenico et a_l., 1982a). Although recovery times can vary depending on the severity of the shock, the repression of hsp70 always occurs f i r s t , hsp83 l a s t and the shsps i n between. The repression of hsp70 i s correlated with the recovery of normal pro t e i n synthesis. Repression of hsp synthesis during recovery i s a r e s u l t of hsmRNA degradation i n Drosophila (Lindquist, 1980; DiDomenico et a l . , 1982a) and i n HeLa c e l l s (Hickey and Weber, 1982). The autoregulation of the heat shock response has been demonstrated i n canavanine treated Drosophila c e l l s (DiDomenico et a l . , 1982b). In these c e l l s , there i s no recovery of normal protein synthesis at 25°G a f t e r a 1 hour heat shock and hsp synthesis continues unabated. Also, i f cycloheximide i s added to normally growing c e l l s immediately before heat shock, synthesis of hsmRNAs continues for at least 4 hours upon recovery at o 25 C where they remain stable (DiDomenico et a l . , 1982b). The same authors also demonstrated that when the rate of hsp synthesis i s l i m i t e d by decreasing the concentration of hsmRNA with actinomycin D, both the repression of hsp synthesis and the re s t o r a t i o n of normal synthesis are delayed, apparently u n t i l a s p e c i f i c amount of functional hsp has accumulated. I f Drosophila c e l l s are maintained at high temperature f o r prolonged periods, repression of hsp synthesis and the onset of normal protein synthesis i n i t i a t e s upon the accumulation of hsps as before; however, the repression of hsp synthesis i s prolonged due to increased hsmRNA s t a b i l i t i e s at high temperature (DiDomenico et aj.. , 1982b) . 44 The k i n e t i c s of hsp70 repression and i t s close c o r r e l a t i o n with the recovery of normal protein synthesis implicates i t as the protein d i r e c t l y involved i n the feedback control mechanism which seems to be operable i n the heat shock response. In E. c o l i , t h i s hypothesis i s substantiated by the following observations. The dnaK gene of E. c o l i i s a heat shock gene whose product i s approximately 50% homologous to Drosophila hsp70 (Bardwell and Craig, 1984). Temperature s e n s i t i v e dnaK mutants such as dnaK756 f a i l to turn o f f the transient heat shock response at 43°C while bacteria that overproduce dnaK protein at a l l temperatures undergo a d r a s t i c a l l y reduced heat shock response ( T i l l y et a l . , 1983). The role played by the shsps i n autoregulation, i f any, remains to be elucidated. An analysis of hsmRNA sequences which are required for t h e i r own D2 d e s t a b i l i z a t i o n during recovery has begun. Drosophila s t r a i n Df(3R) kar contains an X-ray induced 3' delet i o n mutation of hsp70 and synthesizes a truncated protein (hsp40) during heat shock. In these f l i e s or i n ti s s u e culture c e l l s transfected with the truncated gene, hsp40 mRNA p e r s i s t s during recovery whereas endogenous hsp70 mRNA decreases r a p i d l y (Simcox et a l . , 1985). These data suggest that the 3' sequences of hsp70 mRNA are involved i n the active d e s t a b i l i z a t i o n of the hsp70 mRNA af t e r release from heat shock. 1.6 Function of shsps Sequence information f o r the shsp genes of Drosophila, soybean, Xenopus and man indicates that the proteins share a domain of approximately 80 amino acids with a - c r y s t a l l i n chains of vertebrates. Also, anti-chicken hsp25 reacts with a protein derived from 11 day old embryonic chicken lens. The 45 s i g n i f i c a n c e of t h i s homology i s not c l e a r . Vertebrate a - c r y s t a l l i n s are the major protein components of the vertebrate eye lens, forming large aggregates with an average molecular weight of 800,000 (Bloemendal et a l . , 1971). The aggregation properties of a l p h a - c r y s t a l l i n s are i n t e r e s t i n g i n l i g h t of the observations made for shsps during c e l l u l a r l o c a l i z a t i o n studies (see below). Ingolia and Craig (1982b) postulated that the region of homology between m - c r y s t a l l i n and the shsps of Drosophila represented a domain that promoted aggregation. Wistow (1985) has suggested that the domain represents a thermodynamically stable structure which pre-existed the lens and was borrowed from ancestral heat shock genes to b u i l d a protein capable of survLvLng for years without turnover i n the enucleated, avascular lens (Wannumacher and Spector, 1968). 1.6.1 I n t r a c e l l u l a r L o c a l i z a t i o n Early autoradiographic studies on Drosophila s a l i v a r y glands ( M i t c h e l l and Lipps, 1975; Velazquez et a l . , 1980) and tissue culture c e l l s (Velazquez et a l . , 1980; Arrigo et a l . , 1980) showed that newly synthesized hsps were r a p i d l y transported to the nucleus during heat shock. Subsequent c e l l u l a r f r a c t i o n a t i o n studies with Drosophila Kc c e l l s confirmed that hsp22, 23, 26 and 27 were associated with nuclear f r a c t i o n s during heat shock and were translocated to the cytoplasm during recovery (Arrigo et a l . , 1980; Tanguay and Vincent, 1982). Immunofluorescence studies using an antibody s p e c i f i c f o r hsp23 revealed a s i m i l a r pattern (Arrigo and Ahmad-Zadeh, 1981). The association of the shsps with the nuclear p e l l e t i s r e s i s t a n t to extensive 46 nuclease digestion and to 2.0 M s a l t treatment ( S i n i b a l d i and Morris, 1981; Levinger and Varshavsky, 1981). A nuclear function f o r the shsps i s now i n doubt, however, due to a better understanding of the changes which occur within the c e l l u l a r intermediate filament (10 nm) network during heat shock. I t was observed that during heat shock i n Drosophila, a 46 kd and a 40 kd protein, normally found i n microsomal f r a c t i o n s , became enriched i n n u c l e i (Faulkner and Biessman, 1980; Tanguay and Vincent, 1982). An antibody made to the 46 kd protein cross-hydridized to the 40 kd protein as well as to proteins with molecular weights of 55,000 and 52,000 which have been i d e n t i f i e d as vlmentin and dosmin, respectively, i n baby hamster kidney c e l l s (Faulkner ot a l . , 1981) . Thene protoino are major components of the vertebrate intermediate filament cytoakeletal system. Immunofluorescence studies, using the antibody made against the Drosophila 46 kd intermediate filament protein, showed that, upon heat shock, the protein was l o c a l i z e d i n the peripheral region of the nucleus (Faulkner et a l . , 1981). Immunoelectron microscopy further characterized the intermediate filament structure of Drosophila and confirmed that i t collapses upon the nucleus a f t e r heat shock (Walter and Biessman, 1984). Furthermore, antibodies made against hsp23 and hsp26 behave l i k e antibodies made to the 46 kd vimentin-like protein i n t h e i r s u b c e l l u l a r l o c a l i z a t i o n , (Leicht et a l . , 1986), suggesting that the shsps are associated with the intermediate filament network. Thus the apparent translocation of shsps into the nucleus upon heat shock may be a r t i f a c t u a l due to the collapse of the c y t o s k e l e t a l structure, throwing into doubt the v a l i d i t y of e a r l i e r f r a c t i o n a t i o n r e s u l t s . 47 Support for t h i s explanation comes from the observation that the shsps are found e n t i r e l y i n the cytoplasmic f r a c t i o n of ecdysterone treated Drosophila l a r v a l imaginal disks (Ireland at a l . , 1982). I n t e r e s t i n g l y , the c r y s t a l l i n s show immunological c r o s s - r e a c t i v i t y with keratins which are also members of the intermediate filament protein family (Kodama and Eguchi, 1983). In Drosophila, hsp22, 23, 26 and 27 become associated with cytoplasmic RNP p a r t i c l e s which sediment at approximately 20S i n sucrose density gradients (Arrigo et a l . , 1985; Shuldt and K l o e t z e l , 1985). The shsps are detected in control c o l l s at l e v e l s less than 10% of the amount which accumulates a f t e r 6 hours of recovery from heat shock. These RNP p a r t i c l e s are characterized by the presence of 16 - 20 proteins in the 20 - 30 kd range on two-dimensional gels, contain a set of small RNA species between 50 3 - 200 nucleotides and have a buoyant density of 1.365 - 1.380 g/cm i n CsCl a f t e r UV c r o s s l i n k i n g (Arrigo et a l . , 1985; Shuldt and K l o e t z e l , 1985). These p a r t i c l e s are very s i m i l a r to the prosome which has been characterized i n duck erythroblasts and mouse erythropoietic c e l l s (Schmid et a l . , 1984). Under the electron microscope they appear as ring shaped p a r t i c l e s , 12 nm i n diameter (Arrigo et a l . , 1985; Shuldt and K l o e t z e l , 1985). A 74 nucleotide long RNA associating with the Drosophila prosome has been sequenced (Arrigo et a l . , 1985) and shown to be homologous to mammalian U6 small nuclear RNA (Ohshima et a l . , 1981; Harada et a l . , 1980; Epstein et a l . , 1980). In suspension cultures of tomato, the shsps form cytoplasmic heat shock granules (hsg) which are r e s i s t a n t to RNase, 0.5 M KC1, EDTA, detergent and 48 sonication (Nover et a l . , 1983). These are d i f f e r e n t from Drosophila prosomes i n many respects. F i r s t of a l l , cytoplasmic granules are not seen i n the cytoplasm of Drosophila c e l l s . In tomatoes, hsgs undergo a massive and rapid accumulation upon heat shock and disappear slowly during recovery. In contrast, the prosome i s found i n equal amounts i n both control and heat shocked c e l l s , the amount of associated shsps increasing s u b s t a n t i a l l y a f t e r heat shock. The function of hsgs i n plants and of prosomes i n animal c e l l s i s not known. 1.6.2 Thermotolerance: Role of shsp3 Thermotolerance was f i r s t used to doacribe the phenomenon in which an i n i t i a l mild, non-lethal heat treatment causes c e l l s to be r e s i s t a n t to a b r i e f s h i f t to higher temperatures which are normally l e t h a l . In o Drosophila, a mild heat treatment at 35 C for 50 minutes protects a l l o developmental stages and tis s u e culture c e l l s from c e l l death at 40.5 C fo r 20 minutes ( M i t c h e l l et a l . , 1979). In Chinese hamster f i b r o b l a s t o c e l l s , a short 46 C treatment followed by a recovery period of 4 - 6 hours or treatment at 41°C f o r several hours protected the c e l l s from death at o o 45 C f o r 45 minutes ( L i and Werb, 1982). In yeast, a s h i f t to 36 C for o 90 minutes r e s u l t s i n a transient protection from death at 52 C (McAlister and F i n k e l s t e i n , 1980b). In a l l of the pre-treatments described, i t was demonstrated that hsp synthesis occurs. Furthermore, the persistence of thermotolerance f o r up to 36 hours a f t e r heat shock correlates well with the persistence of heat shock proteins i n hamster c e l l s ( L i and Werb, 1982). 49 Many inducers of the heat shock response also induce thermotolerance. P r i o r exposure of hamster c e l l s to arsenite and ethanol or a release from anoxia r e s u l t s i n an acquired tolerance to a subsequent l e t h a l heat challenge ( L i and Werb, 1982). I f amino acid analogues such as canavanine or azetidine are used to induce hsp synthesis i n hamster c e l l s , then thermotolerance i s not acquired ( L i and Lazlo, 1984), presumably because hsps incorporating analogues have altered function. Ethanol treated yeast c e l l s , i n which hsp synthesis i s less than i n heat shocked c e l l s , are correspondingly less thermotolerant (Plesset et a l . , 1982). Exposure of yeast c e l l s to i o n i z i n g r a d i a t i o n (gamma-rays) also induces thermal resistance (Mitchel and Morrison, 1982) although i t i s not known whethor there i s any heat shock protein synthesis under these conditions. These findings show a strong c o r r e l a t i o n between the expression of the hsps and the development of thermotolerance but they do not prove that these events are f u n c t i o n a l l y related. The requirement for heat shock induced t r a n s c r i p t i o n i n the a c q u i s i t i o n of thermotolerance has been demonstrated i n ts mutants of yeast i n which a defect i n RNA transport/processing r e s u l t s i n no increase of thermotolerance a f t e r heat shock. Thermotolerance i s acquired, however, i f the c e l l s are allowed to recover following a heat shock (McAlister and F i n k e l s t e i n , 1980b). Protein synthesis i n h i b i t o r studies have also been used to address t h i s question. The elimination of thermotolerance with cycloheximide treatment p r i o r to a pre-treatment has been demonstrated i n yeast by several workers (McAlister and F i n k e l s t e i n , 1980b; Mitchel and Morrison, 1982; Craig and Jacobsen, 1984) but not a l l . ( H a l l , 1983). H a l l (1983) also showed that yeast c e l l s treated with a phenylalanine analog did not become 50 thermotolerant i n agreement with experiments on analog treated hamster c e l l s ( L i and Lazlo, 1984). However, i f these c e l l s were given a heat treatment o at 37 C, a condition i n which hsps should s t i l l be non-functional, thermotolerance was acquired. Furthermore, whereas cycloheximide has been shown to block the thermotolerant state i n Dictyostelium (Loomis and Wheeler, 1982), treatment of rat embryonic f i b r o b l a s t (Rat-1) c e l l s with o o cycloheximide f o r 6 hours at 37 C a f t e r a 20 minute i n t e r v a l at 45 C i n h i b i t s p rotein synthesis, including hsp synthesis, but has no e f f e c t on o subsequent s u r v i v a l at 45 C (Widelitz et a l . , 1986). The reasons for these discrepancies are not known. The strongest evidence for a function of hsps i n thermotolerance i s found i n the rpoH165 mutant of E. c o l i i n which hsps are not synthesized. o These c e l l s also f a i l to acquire resistance to a 55 C challenge a f t e r a 42°C pre-treatment (Yamamori and Yura, 1982). Some observations suggest that the shsps may play a r o l e i n thermotolerance. In Drosophila c e l l s , tolerance i s acquired by continued exposure to ecdysterone i n which only the shsps are induced (Berger and Woodward, 1983). Also, Drosophila pupae (a developmental stage i n which the shsps are s p e c i f i c a l l y synthesized) appear to be more r e s i s t a n t to heat induced death ( M i t c h e l l et a l . , 1979; Berger and Woodward, 1983). A mutant c e l l l i n e of Dictyostelium discoideum c a l l e d HL122 has been i d e n t i f i e d due to i t s defect i n acquiring thermotolerance (Loomis and Wheeler, 1982). These c e l l s do not synthesize any of the shsps. However, even though hsp70 i s present i n heat shocked HL122 c e l l s , i t accumulates to l e v e l s well below those found i n wild type c e l l s and may a f f e c t the a b i l i t y of these c e l l s to develop thermotolerance. 51 The a c q u i s i t i o n of thermotolerance i n heat shocked Xenopus l a e v i s embryos argues against a r o l e for hsp30 i n t h i s phenomenon (Heikkila et a l . , 1985). Thermotolerance i s developed by the l a t e b l a s t u l a and early gastrula stages i n which the hsp30 genes are not responsive to heat shock (Bienz, 1984a). Also, i n yeast s t r a i n s containing an i n a c t i v e hsp26 gene, thermotolerance i s , nevertheless, developed i n log phase or i n stationary phase c e l l s , i n mature or germinating spores, and during spore development (Petko and Lindquist, 1986). 1.6.3 I n h i b i t i o n of the Heat Shock Response Both deuterium oxide and polyhydroxyl alcohols such as g l y c e r o l block the Induction of hsp synthesis by heat or arsenite in chick embryo f i b r o b l a s t s (Hightower et a l . , 1985). Both of these compounds are known to s t a b i l i z e macromolecules and to protect c e l l s from thermal k i l l i n g . They may protect s t r e s s - s e n s i t i v e proteins from i r r e v e r s i b l e denaturation, p o s s i b l y by d i r e c t i n t e r a c t i o n but more l i k e l y by generalized solvent e f f e c t s . I t has been suggested that hsps, which are r e s i s t a n t to denaturation by heat or ethanol, can n o n - s p e c i f i c a l l y s t a b i l i z e other proteins that are highly susceptible to i n a c t i v a t i o n (Minton et al. , 1982). This i s consistent with the idea that hsps play a r o l e i n protecting c e l l s against stress and i n the a c q u i s i t i o n of thermotolerance. I t also supports the model whereby protein damage may t r i g g e r the heat shock response, as discussed above. 52 1.7 The Biology of Caenorhabditis elegans Caenorhabditis elegans, a member of the family Rhabditidae, i s a microbivorous, f r e e - l i v i n g s o i l nematode. Adult nematodes are found as males or s e l f - f e r t i l i z i n g hermaphrodites, the l a t t e r being s l i g h t l y l a rger and reaching a length of 1 mm. The l i f e cycle of C. elegans i s rapid and o takes about 3.5 days at 20 C. A f t e r f e r t i l i z a t i o n , the eggs begin to cleave within the hermaphrodite and are l a i d at about the 3 0 - c e l l stage (mid-gastrula). Each hermaphrodite produces 200 - 300 progeny. A f t e r embryogenesis, a juvenile containing about 550 c e l l s hatches from the egg case and develops through four l a r v a l stages, L1-L4, before reaching the adult stage. Many c e l l d i v i s i o n s occur during the l a r v a l period, the somatic c e l l number Increasing to about 1000 i n mature adults. The f i r s t l a r v a l stage contains only two germ l i n e c e l l s while the adults contain 1000 - 2000 germ l i n e n u c l e i . L2 stage larvae can transform into a r e s i s t a n t stage known as dauer larvae under adverse environmental conditions. In t h i s state, the nematode can t o l e r a t e starvation for many months, resuming normal development when nutrients become av a i l a b l e . Since C. elegans i s transparent, development of the l i v i n g organism can be observed with a l i g h t microscope using Nomarski optics. In t h i s manner, a l l of the c e l l d i v i s i o n s , deaths, and migrations that produce a mature adult from a sin g l e egg have been determined (Sulston et a l . , 1983). This achievement i s a f i r s t f o r an organism of t h i s degree of complexity, and has been f a c i l i t a t e d also by the f a c t that nematode development i s invariant. This means that the fate and p o s i t i o n of a given precursor c e l l i s the same i n a l l i n d i v i d u a l s . The anatomy and wiring of the complete nervous system, which i s composed of only 302 neurons, has also been determined. 53 C. elegans i s i d e a l l y suited to genetic analysis. Thousands of mutations have been mapped to about 500 genes. Many include genes which a f f e c t c e l l fates during development, and others which a f f e c t neuromuscular function. C. elegans i s a d i p l o i d organism, containing f i v e autosomal chromosomes and one sex (x) chromosome. Hermaphrodites contain two sex chromosomes while males carry only one. The haploid DNA content i s 8 x 10 7 bp per genome (Sulston and Brenner, 1974), which i s only 20 times that of E. c o l i . R epetitive DNA makes up only 17% of the t o t a l DNA content which has an o v e r a l l low C/C base composition of 367, (Sulston and Brenner, 1974). The s i m p l i c i t y of the nematode genome haa sparked a cooperative e f f o r t to map the ontiro C. elegans genome. Prenontly, about 65% of the genome has been categorized into about 900 segments, many greater than 200 kb and one greater than 600 kb. 1.8 The Present Study By the end of 1980, the heat shock response had been well characterized i n Drosophila (see review by Ashburner and Bonner, 1979), but i t was becoming evident that the phenomenon was conserved i n a diverse group of organisms including Escherichia c o l i (Lemaux et a l . , 1978; Yamamori et a l . , 1978), protozoans such as Naegleria gruberi (Walsh, 1980) and Tetrahymena  pyriformis (Fink and Zeuthen, 1980; Guttman et a l . , 1980), slime molds including Dictyostelium discoideum (Loomis and Wheeler, 1980) and Polysphondylium pallidum (Francis and L i n , 1980), yeast (McAlister and F i n k e l s t e i n , 1980a; 1980b), sea urchin (Guidice et a l . , 1980), another dipteran Chironomus tentans (Vincent and Tanguay, 1979), plants including 54 tobacco and soybean (Bamett et a l . , 1980), Chinese hamster ovary c e l l s (Bouche et a l . , 1979) and chick embryo f i b r o b l a s t s (see Table I I , section 1.2.2) . The i n d u c i b i l i t y of the heat shock genes to high l e v e l s , i n a r e v e r s i b l e fashion, made them a t t r a c t i v e models for the study of gene a c t i v a t i o n . The l a t e seventies brought about intense a c t i v i t y directed towards the cloning and c h a r a c t e r i z a t i o n of the major heat inducible genes of Drosophila and at the end of 1980, Ingolia et a l . (1980) reported the DNA sequence of one complete hsp70 gene along with the comparison of three hsp70 5' flanking sequences. I t was at this time that the present investigation was undertaken to characterize sequences coding for the shsps of the nematode Caenorhabditis elegans. U n t i l then there had been no sequence information a v a i l a b l e regarding the shsp genes of any organism including Drosophila. In the next f i v e years i t would become cl e a r that the shsps from a v a r i e t y of systems were related and highly conserved throughout evolution. During the same period, other workers were focusing t h e i r attention on the hsp70 gene family of Caenorhabditis elegans (Snutch and B a i l i e , 1983; Snutch and B a i l l i e , 1984). 55 I I . EXPERIMENTAL PROCEDURES 2.1 Maintenance of Nematodes Caenorhabditis elegans s t r a i n s B r i s t o l (N2) and Bergerac (BO) were maintained on NG plates (0.3% NaCl, 0.25% bactotryptone, 5.0 yg/ml ch o l e s t e r o l , 1.0 mM C a C l 2 > 1.0 mM MgS04 and 25 mM KH 2P0 4 pH 6.0) containing E. c o l i 0P50 as described by Brenner (1974). 0P50 i s a u r a c i l requiring mutant which prevents the overgrowth of the b a c t e r i a l lawn. The o Bergerac s t r a i n was maintained at 17 C while the B r i s t o l s t r a i n was kept at ambient room temperature or at 17°C. Synchronous nematode populations were started from i s o l a t e d eggs by d i s s o l v i n g gravid adults in 2% sodium hypochlorite, 0.05M NaOH for 10 minutes (Emmons ot a l . , 1979). 2.2 Analysis of Heat Shock Proteins 35 2.2.1 [ S] s u l f a t e L a b e l l i n g of E. c o l i E. c o l i K12 was grown to stationary phase i n 100 ml of minimal medium 35 containing 5 mCi of [ S] s u l f a t e (New England Nuclear) according to the procedure of Bretscher and Smith (1972). 2.2.2 In vivo L a b e l l i n g of C. elegans ( B r i s t o l ) Proteins and Induction of Heat Shock Polypeptides In a t y p i c a l experiment, a plate of synchronous adult nematodes growing o o at room temperature (22 C) was transferred to a 35 C incubator. A f t e r 1 o hour, the nematodes were washed o f f with 35 C d i s t i l l e d water and allowed to s e t t l e by gravity at 35°C. The nematodes were then washed twice at 56 35 C and transferred to prewarmed NG plates onto which approximately 25 35 yCi of [ S ] - l a b e l l e d E. c o l i K12 paste had been spread. Following a o l a b e l l i n g period ranging from 30 minutes to 5 hours at 35 C, the nematodes were washed o f f as before and transferred to NG plates containing unlabelled b a c t e r i a (either E. c o l i K12 or E. c o l i OP50) for at l e a s t 30 minutes at the elevated temperature. This was c a r r i e d out to remove any l a b e l l e d b a c t e r i a remaining i n the gut. At t h i s time or a f t e r a recovery period at room temperature, the nematodes were washed thoroughly at room temperature and resuspended i n 25 - 50 p i of three times concentrated Laemmli sample buffer (Laemmli, 1970). Proteins were then s o l u b i l i z e d by 2 - 3 rapid freeze-thaw cycles followed by b o i l i n g f or 5 minutes and were analyzed using SDS-polyacrylamide gel electrophoresis and autoradiography. 2.2.3 Analysis of i n v i t r o Labelled Proteins Total RNA, polyadenylated RNA (polyA +RNA) or h y b r i d i z a t i o n selected RNA was translated i n a rabbit r e t i c u l o c y t e system (New England Nuclear) as 35 described (Pelham and Jackson, 1976) using [ S]methionine. Translation products were fractionated on SDS-polyacrylamide gels and analyzed by autoradiography. For two-dimensional gel electrophoresis, the 25 y l t r a n s l a t i o n reaction was p r e c i p i t a t e d i n 10 volumes of acetone at -20°C overnight. The p e l l e t was washed with ethanol, dried and resuspended i n O ' F a r r e l l loading buffer A ( O ' F a r r e l l , 1975). 2.2.4 Polyacrylamide Gel Electrophoresis of Proteins SDS slab gels (0.08 cm X. 7.5 cm X. 10 cm) containing 15% polyacrylamide with, a 4.5% stacking gel were prepared using the discontinuous b u f f e r system 57 of Laemmli (1970). Two-dimensional polyacrylamide gel electrophoresis was ca r r i e d out as described by O ' F a r r e l l (1975). Af t e r destaining, the gels were dried and autoradiography was ca r r i e d out using Kodak X-Omat AR f i l m . 2.3 RNA Analysis 2.3.1 I s o l a t i o n of RNA from B r i s t o l N2 Nematodes Control nematodes from which RNA was to be i s o l a t e d were washed o f f of NG plates with s t e r i l e 0.14 M NaCl at 4°C. The nematodes were then washed twice with cold 0.14 M NaCl a f t e r allowing them to s e t t l e on i c e by gravity and removing the supernatant by aspi r a t i o n . F i n a l l y they were centrifuged o o at 12,000 g for 5 minutes at 4 C and the p e l l e t was stored at -70 C. Nematodes were heat shocked by incubating NG plates at 35°C for 2 - 4 hours before carrying out the washing procedure described above. One hundred plates t y p i c a l l y yielded 1.5 - 2.0 gram of nematodes. The RNA i s o l a t i o n procedure was based on that of Chirgwin et a l . (1979) with the following modifications. Nematodes were passed twice through a pre-cooled French press at 8000 p s i i n ten volumes of 6 M guanidinium hydrochloride (Gu-HCl), 0.2 M sodium acetate pH 5.0, 0.1 M 6-mercaptoethanol o o at 4 C. Aft e r centrifugation at 12,000 g for 10 minutes at 4 C, 0.5 volume of 95% ethanol was added to the supernatant and the RNA was p r e c i p i t a t e d overnight at -20°C. The subsequent p u r i f i c a t i o n steps were as described (Chirgwin et a l . , 1979). Typical y i e l d s were 10 mg per gram of s t a r t i n g material. Control and heat shock polyA +RNA were prepared from t o t a l RNA by two passages through an oligo-dT c e l l u l o s e column (Collaborative Research Inc., Type 2) using the procedure of Aviv and Leder (1972) except that the f i n a l polyA +RNA fractions were eluted with 58 s t e r i l e d i s t i l l e d water. A l l glassware and solutions were treated with 0.1% diethylpyrocarbonate (DEP) and baked or autoclaved, respectively, before use. 2.3.2 Electrophoresis of RNA and Northern Transfers RNA was denatured with glyoxal according to the procedure of McMaster and Carmichael (1977) except that dimethylsulfoxide was omitted. A f t e r f r a c t i o n a t i o n on agarose gels i n 10 mM NaH^PO^ pH 7.0 with buffer r e c i r c u l a t i o n , the RNA was transferred d i r e c t l y to n i t r o c e l l u l o s e (Schleicher and Schuell) i n 20 X SSPE (Thomas, 1980). 1 X SSPE i s 0.1 mM EDTA, 10 mM Na^PO^, pH 7.0 and 0.18 M NaCl. A l t e r n a t i v e l y , RNA was denatured with formaldehyde and electrophoresed through formaldehyde agarose gels (Maniatis et a l . , 1982). Formaldehyde gels were processed a f t e r electrophoresis as described (Maniatis et a l . , 1982) and the RNA was transferred to n i t r o c e l l u l o s e as above. Af t e r transfer, the f i l t e r s were o a i r dried and baked at 80 C f o r 2 hours. 2.3.3 SI Nuclease Mapping SI nuclease protection analysis was car r i e d out e s s e n t i a l l y as described by Berk and Sharp (1977). For mapping the hsp!6-48 mRNA, 10 to 20 ng of a TagI-RsaI fragment (map coordinates +44 to -191), 5'-end l a b e l l e d 32 with polynucleotide kinase and [y- P]ATP at the TagI s i t e , was +• o hybridized with 200 ng of heat shock polyA RNA for 20 hours at 47 C m 10 y l of h y b r i d i z a t i o n b u f f e r (50% formamide, 0.4 M NaCl, 40 mM PIPES, 1.0 mM EDTA). For the hsp!6-l mRNA, 10 to 20 ng of an Alul-Xbal fragment (+28 to -85), 5'-end l a b e l l e d as above at the A l u l end, was hybridized to 500 ng 59 of the same RNA f o r 12 hours at 50 C i n 10 y l of hy b r i d i z a t i o n buffer without formamide. In each case, h y b r i d i z a t i o n was c a r r i e d out by f i r s t o heating the mixture at 85 C f o r 15 min and then quickly submerging the tube i n a water bath at the appropriate temperature. Hybridization was terminated by the addition of 300 p i of ic e - c o l d SI nuclease mixture containing 0.28 M NaCl, 50 mM sodium acetate pH 4.6, 4.5 mM ZnSO l ( and 200 4 U of SI nuclease (Boehringer-Mannheim). SI nuclease digestions were c a r r i e d o out at 37 C for 30 min and terminated with 50 y l of 4.0 M ammonium acetate-100 mM EDTA. The protected fragments were p r e c i p i t a t e d with isopropanol with 20 pg of E. c o l i tRNA as c a r r i e r and analyzed on 8% acrylamide gels containing 8 M urea (see DNA Sequencing). 2.4 I d e n t i f i c a t i o n of cDNAs 2.4.1 Screening of a cDNA Library A cDNA l i b r a r y made with polyA+mRNA p u r i f i e d from heat shocked B r i s t o l nematodes was kindl y provided by Don Jones. The cDNA had been inserted into the PstI s i t e of pBR322 using G-C t a i l i n g . Annealed DNA was used to transform E. c o l i RR1 to create the l i b r a r y which was used i n t h i s study. The cDNA l i b r a r y was screened by. the colony hy b r i d i z a t i o n method of 125 Grunstein and Hogness (1975), using as a probe [ I ] - l a b e l l e d heat shock mRNA which had been s i z e fractionated (see section 2.10.1 below). A m p i c i l l i n s e n s i t i v e , t e t r a c y c l i n e r e s i s t a n t colonies were i n d i v i d u a l l y transferred from a master p l a t e to a n i t r o c e l l u l o s e f i l t e r (Schleicher and o Schuell) and allowed to grow overnight at 37 C on LB (1.0% bactotryptone, 0.5% yeast extract, 1.0% NaCl pH 7.5) plates containing t e t r a c y c l i n e 60 (15 yg/ml). In some cases, the f i l t e r was transferred to an LB plate containing 170 yg/ml chloramphenicol a f t e r the colonies had grown to a diameter of approximately 1.0 mm and the plasmids were allowed to amplify f o r 12 hours at 37°C. This alternate procedure, however, did not s i g n i f i c a n t l y increase the h y b r i d i z a t i o n s i g n a l of p o s i t i v e recombinants. C e l l l y s i s was c a r r i e d out with SDS and NaOH as described by Maniatis et a l . (1982). The f i l t e r s were a i r dried and baked at 80°C f o r 2 hours p r i o r to hy b r i d i z a t i o n . Putative p o s i t i v e s were p u r i f i e d from the master plate and the plasmids were analyzed further. 2.4.2 Hybridization Selection Analysis of cDNAa 10 yg of plasmid DNA was l i n e a r i z e d with BamHI, phenol-extracted and p r e c i p i t a t e d with 2 volumes of 95% ethanol. The DNA was then applied to n i t r o - c e l l u l o s e f i l t e r s (Schleicher and Schuell, B-6) using a M i l l i p o r e sintered glass f i l t r a t i o n u n i t as described by Young et a l . (1980). Hybridization, washing and e l u t i o n were carried out using the protocol of Tilghman et a l . (1978). T y p i c a l l y , the f i l t e r s carrying plasmid DNA were incubated with 10 yg of heat shock polyA +RNA i n 400 y l of o h y b r i d i z a t i o n buffer f o r 20 hours at 43 C. Non-hybridized RNA i n the h y b r i d i z a t i o n buffer was p r e c i p i t a t e d with 2 volumes of 95% ethanol and 1 yg was used f or i n vivo t r a n s l a t i o n . Hybridized RNA was eluted i n 90% o formamide, 10 mM Tris-HCl pH 7.5 and 1.0 mM EDTA at 45 C f o r 1 hour, p r e c i p i t a t e d a f t e r the addition of 10 yg of c a r r i e r E. c o l i tRNA, and translated. 61 2.5 General Methods for Plasmid Analysis 2.5.1 B a c t e r i a l Strains E. c o l i RR1 was used to propagate pBR322 and pBR325-derived recombinants including the cDNA l i b r a r y and was grown i n LB medium. E. c o l i s t r a i n s JM101 and JM103 were used for transformation with M13 and pUC-derived plasmids and were grown i n YT medium (0.8% bactotryptone, 0.5% yeast extract, 0.5% NaCl pH 7.0). 2.5.2 Transformations B a c t e r i a l c e l l s were made competent for transformation using 50 mM CaCl^ as described by Messing (1983). Competent c e l l s were transformed with e i t h e r p u r i f i e d plasmid DNA, l i g a t i o n mixes or single-stranded M13 DNA. Ligations were usually c a r r i e d out with 10 ng of vector DNA and 20 -60 ng of i n s e r t DNA i n 20 y l of 50 mM Tris-HCl pH 7.4, 10 mM MgCl 2 > 10 mM d i t h i o t h r e i t o l , 1.0 mM spermidine, 1.0 mM ATP and 100 yg/ml bovine serum albumin. Ligations were done at 4°C or 15°C for at least 12 hours using 1.0 - 10 Weiss units of T4 DNA l i g a s e . DNA inserted into the PstI s i t e of pBR322 rendered the transformed colonies t e t r a c y c l i n e - r e s i s t a n t and a m p i c i l l i n - s e n s i t i v e . pBR325 derivatives containing in s e r t s i n the EcoRI s i t e were screened by t h e i r resistance to a m p i c i l l i n and t h e i r s e n s i t i v i t y to chloramphenicol. The concentrations of a n t i b i o t i c s used are taken from Maniatis et a l . (1982). Plaques infected with recombinant M13 phage were assayed for t h e i r i n a b i l i t y to cleave 5-bromo4-chloro3-indolylgalactoside (X-gal) as described by Messing (1983). The same color assay was used to screen bacterial, colonies containing pUC plasmids. 62 2.5.3 P u r i f i c a t i o n of Plasmid DNA For the large-scale i s o l a t i o n of plasmid DNA, 500 ml cultures were amplified i n the appropriate medium with chloramphenicol according to Maniatis et a l . (1982). pBR325 and i t s derivatives were amplified with spectinomycin at a concentation of 300 yg/ml. For the large-scale i s o l a t i o n of M13 r e p l i c a t i v e form DNA, 5.0 ml of an exponentially growing JM101 or JM103 culture and 100 - 200 y l of a M13 infectious phage supernatant (see sequencing section) were added to 500 ml of YT and o incubated at 37 C f o r 5.-7 hours. Plasmids were p u r i f i e d using the a l k a l i l y s i s procedure of Birnboim and Doly (1979) as described by Maniatis et a l . (1982). The f i n a l DNA p e l l e t was dissolved i n 8 ml of TE and was extracted once with an equal volume of phenol/chloroform (1:1) and once with the same volume of chloroform. RNaseA WBB added to a f i n a l concentration of 25 yg/ml and digestion was allowed to proceed at room temperature f o r one hour. The DNA was banded i n two 4 ml cesium chloride-ethidium bromide density gradients (Maniatis et a l . , 1982) o i n a Beckman VTi65 rotor at 60,000 rpm (12 - 16 hours, 20 C). A f t e r c o l l e c t i n g the plasmid DNA band from the gradient, the ethidium bromide was removed by several extractions with water-saturated i-butanol. The f i n a l aqueous phase was d i l u t e d 3-fold with water p r i o r to the addition of 2 o volumes of ethanol. P r e c i p i t a t i o n was allowed to proceed at -20 C overnight and the DNA was p e l l e t e d by centrifugation at 12,000 g f o r 20 minutes. The DNA was washed with 95% ethanol, dried and resuspended i n TE. Y i e l d s ranged from 100 yg to 1.0 mg per 500 ml culture depending on the nature of the plasmid. 63 Rapid small-scale plasmid i s o l a t i o n s were carried out on 1.5 ml of overnight cultures as described by Maniatis et a l . (1982) using the a l k a l i l y s i s procedure of Bimboim and Doly (1979). M13 r e p l i c a t i v e forms were p u r i f i e d i n the same manner from cultures infected with M13 phage. 2.6 Analysis of Bacteriophage 2.6.1 Screening of C. elegans B r i s t o l Genomic DNA L i b r a r i e s Two d i f f e r e n t B r i s t o l (N2) genomic DNA l i b r a r i e s were used i n t h i s study. One was a p a r t i a l EcoRI digest i n the lambda Charon4 vector. I t was constructed and kindly provided by Terry Snutch of Simon Fraser University. This phage was propagated i n E. c o l i DPSOsupF or LE392 hosts which were grown in NZYT (1.0% NZ-amine, 0.5% yeast extract, 0.2% casamino acids, 10 mM MgCl^ and 40 v»g/ml thymidine pH 7.0). B a c t e r i a l s t r a i n DP50supF required i n addition, diaminopimelic acid at a concentration of 0.1 yg/ml. The other l i b r a r y was a p a r t i a l Mbol digest cloned into the BaraHI s i t e of the lambda d e r i v a t i v e EMBL4. This l i b r a r y was constructed by Chris Link and k i n d l y provided by Mike Krause both at the University of Colorado, Boulder. This l i b r a r y was used i n conjunction with E. c o l i Q358 or Q359 st r a i n s i n NZYC media (1.0% NZ-amine, 0.1% yeast extract, 0.5% NaCl, 0.1% casamino acids and 10 mM MgCl 2 pH 7.0). Since t h i s l i b r a r y had a low percentage of wild type phage, the Q358 host, i n which wild type phage are vi a b l e , was preferred since i t gave larger plaques and stronger h y b r i d i z a t i o n s i g n a l s . I n i t i a l screening was c a r r i e d out on 50,000 - 100,000 plaques, representing approximately 5 - 1 0 genome equivalents based on the conservative estimate that each recombinant clone contained 10 kb of 64 C. elegans DNA. Phage were plated at a density of approximately 1,000 -2,000 plaques per 10 cm p e t r i p l a t e . Aliquots of bacteriophage i n a volume of 200 - 300 y l of \ d i l u t i o n b u f f e r (0.1 M NaCl, 0.01 M Tris-HCl pH 7.5, 0.01 M MgCl^ and 0.02% ge l a t i n ) were mixed with an equal volume of an o overnight culture of the appropriate bacteria and incubated at 37 C for 20 minutes before p l a t i n g i n the appropriate medium containing 0.7% agarose. Both phage l i b r a r i e s were screened as described by Maniatis et a l . (1982), based on the procedure of Benton and Davis (1977). Bacteriophage and agarose plugs containing phage clones were maintained i n \ d i l u t i o n buffer o at 4 C i n the presence of chloroform. Recombinant clones of i n t e r e s t were p u r i f i e d by subsequent rounds of re p l a t i n g and rescreening at decreasing den s i t i e s of phage u n t i l an i s o l a t e was completely homogeneous. 2.6.2 Est a b l i s h i n g High T i t e r Phage Stocks P u r i f i e d phage were plated as described above, at a density of approximately 10,000 plaques per plate. In t h i s case, however, 3 ml of media was added to the phage-host mixture before the addition of 3 ml of top agarose p r i o r to p l a t i n g . This resulted i n a more f l u i d top layer which could be r e a d i l y scraped o f f a f t e r the plaques had grown at 37°C. The plates were rinsed with an a d d i t i o n a l 2 ml of media. The phage suspension was centrifuged at 12,000 g f o r 5 minutes to remove the agarose. The o supernatant (approximately 3 ml) was stored at 4 C i n the presence of chloroform. This procedure co n s i s t e n t l y resulted i n a 10-fold increase i n phage concentration. 65 2.6.3 I s o l a t i o n of Bacteriophage DNA Phage DNA was routinely p u r i f i e d from 20 ml cultures. Consistent l y t i c i n f e c t i o n s were obtained with the following conditions. 200 y l of \ 6 o d i l u t i o n buffer containing 0.5 - 1.0 x 10 phage was incubated at 37 C fo r 20 minutes with 100 y l of a stationary phase (overnight) culture of LE392 or Q358 or 200 y l of DP50supF. This mixture was added to 20 ml of the appropriate growth medium i n a 125 ml Erlenmeyer f l a s k and incubated at o 37 C with vigorous shaking. Lysis usually occurred within 5 - 7 hours, at which time a few ml of chloroform was added to the culture which was l e f t shaking a further 5 - 1 0 minutes. The contents were transferred to a 30 ml glass (Corex) tube, being care f u l to leave most of the chloroform behind, and the sample was centrifuged at 12,000 g for 10 minutes. The supernatant was transferred to a clean tube and centrifugation was repeated i n order to remove a l l the b a c t e r i a l debris. To the supernatant were then added 3 ml of 5.0 M NaCl and 3 g of polyethyleneglycol (molecular weight 8,000 - 15,000). o The contents were mixed and l e f t at 4 C f o r at l e a s t 2 hours to p r e c i p i t a t e the phage p a r t i c l e s . A f t e r centrifugation at 12,000 g for 10 minutes, the phage p e l l e t was resuspended i n 500 y l of DNase buffer (50 mM Hepes pH 7.5, 5.0 mM MgCl 2 and 0.5 mM CaCl 2) to which was added 10 y l RNaseA (5 mg/ml) and 5 y l DNasel (1 mg/ml; Boehringer Mannheim, Grade I ) . RNaseA (Boehringer Mannheim; a n a l y t i c a l grade) was bo i l e d f o r 5 minutes to o i n a c t i v a t e contaminating DNase a c t i v i t y . A f t e r incubation at 37 C for 60 minutes, 50 y l of 10 x SET (0.1 M Tris-HCl pH 7.5, 0.2 M EDTA and 5% SDS) was added before digestion with 8 y l of proteinase K (25 mg/ml; Boehringer o Mannheim) f o r 60 minutes at 68 C. This mixture was extracted once with an equal volume of phenol/chloroform (1:1) and once with the same 66 volume of chloroform. The phases were separated by centrifugation at 15,000 g f o r 3 minutes. The DNA was p r e c i p i t a t e d from the aqueous phase with 2 volumes of 95% ethanol at room temperature for 2 minutes, and c o l l e c t e d by c e n t r i f u g a t i o n at 15,000 g f o r 5 minutes. The DNA p e l l e t was washed with 1.0 ml of 70% ethanol and recentrifuged. The f i n a l p e l l e t was dried and resuspended i n 50 y l of TE (10 mM Tris-HCl pH 7.5, 10 mM EDTA). T y p i c a l l y , 2 - 5 yg of phage DNA was obtained. RNA contamination was u s u a l l y high, but could be removed by RNaseA digestion during subsequent r e s t r i c t i o n endonuclease reactions (see below). 2.7 P u r i f i c a t i o n of C. elegans Genomic DNA B r i s t o l (N2) and Bergerac (BO) nematodes were c o l l e c t e d as described above for RNA i s o l a t i o n . DNA preparations were t y p i c a l l y done on 0.5 - 1.0 gram of nematodes. Nematode p e l l e t s were resuspended i n 10 ml of proteinase K buffer (0.1 M Tris-HCl pH 8.5, 0.05 M EDTA, 0.2 M NaCl and 1% SDS) as described by Emmons et a l . (1979). Proteinase K was added to a f i n a l concentration of 200 yg/ml and the s o l u t i o n was incubated at 65°C for 30 - 60 minutes at which time the sol u t i o n was c l e a r . This s o l u t i o n was extracted three times with phenol and once with chloroform i n a separatory funnel with gentle mixing. Phase separation was ca r r i e d out i n a desk top centrifuge at f u l l speed f o r 3 minutes. The aqueous phase was c h i l l e d and 2 o volumes of 957o ethanol at -20 C was gently layered over i t . The DNA was p r e c i p i t a t e d e i t h e r by winding i t upon a glass rod or by rotating the tube at an angle to disturb the i n t e r f a c e . The DNA was then washed with c h i l l e d 70% ethanol, dried and resuspended i n an appropriate volume of TE (1.0 - 2.0 ml). This usually resulted i n a DNA s o l u t i o n of approximately 1.0 mg/ml. 67 RNA was digested with RNaseA i n subsequent r e s t r i c t i o n enzyme reactions (see below). Banding of the DNA i n CsCl density gradients was found to be unnecessary. 2.8 General DNA Techniques 2.8.1 R e s t r i c t i o n Endonuclease Digestion of DNA DNA (0.5 - 2.0 yg) was usually digested i n a t o t a l volume of 15 y l using the buffer system described by Maniatis et a l . (1982). Bovine serum albumin (ultrapure grade) was added to a f i n a l concentration of 100 yg/ml. In most cases, 1.0 - 5.0 units of r e s t r i c t i o n enzyme was used f o r each reaction. R e s t r i c t i o n enzymes were purchased from Bethesda Research Laboratories, New England Biolabs, Boehringer Mannheim and Pharmacia. For phage DNA and C. elegans genomic DNA, 5.0 yg of RNaseA was included. R e s t r i c t i o n enzyme digestion mixtures were analyzed by electrophoresis i n agarose gels as described below a f t e r the addition of 0.1 volume of loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol and 25% f i c o l l ) . 2.8.2 Electrophoresis of DNA and. Southern Transfers DNA samples or r e s t r i c t i o n endonuclease reaction mixtures were analyzed on agarose gels which were poured and run i n 1 x TBE (89 mM Tris-borate pH 8.3, 89 mM borate and 2.0 mM EDTA) containing 0.5 yg/ml ethidium bromide. DNA bands were v i s u a l i z e d under u l t r a v i o l e t l i g h t and photographs were taken with a Polaroid camera using type 57 f i l m . The DNA was transferred to n i t r o c e l l u l o s e as described by Southern (1975) except that the acid depurination step was usually omitted. Transfer was c a r r i e d out i n e i t h e r 68 20 x SSPE or i n 1.0 M ammonium acetate pH 7.0, the l a t t e r being more o e f f i c i e n t . The f i l t e r s were then a i r dried and baked at 80 C for 2 hours. 2.8.3 P u r i f i c a t i o n of S p e c i f i c DNA Fragments DNA fragments were recovered from agarose gels by e l e c t r o e l u t i o n into d i a l y s i s tubing using 0.5 x TBE. The DNA was then p u r i f i e d by chromatography through RPC-5 analog (BRL) columns, NAGS PREPAC cartridges (BRL), or DE-52 columns. In a l l cases, the DNA was loaded and washed i n TE containing 0.2 M NaCl. The DNA was eluted i n 300 y l of TE containing 2.0 M NaCl. A f t e r the addition of 0.1 volumes of 3.0 M sodium acetate pH 5.2, the fragment was p r e c i p i t a t e d with 2.0 volumes of 95% ethanol and resuspended i n a small volume of s t e r i l e d i s t i l l e d water. 2.8.4 End-Labelling of DNA Fragments Fragment ends containing 5' overhangs generated by r e s t r i c t i o n enzyme digestions were l a b e l l e d i n one of two ways. The 3' ends were end-labelled using the Klenow fragment of E. c o l i DNA polymerase I and the appropriate 32 [a- Pldeoxynucleoside triphosphates, while the 5' ends were 32 end-labelled with T4 polynucleotide kinase and [y- P]adenosine triphosphate (ATP) a f t e r dephosphorylation with c a l f i n t e s t i n a l a l k a l i n e phosphatase (grade I ) . These reactions were ca r r i e d out according to Maniatis et a l . (1982). A l t e r n a t i v e l y , the 3' ends of 3' overhangs were 32 end-labelled with c a l f thymus terminal transferase and [a- P]cordycepm 5'-triphosphate as described by Tu and Cohen (1980). Single-end-labelled fragments were obtained by cleavage with a second r e s t r i c t i o n enzyme and were p u r i f i e d on 5% or 8% preparative polyacrylamide 69 slab gels (0.15 x 15 x 17 cm) containing acrylamide:bisacrylamide at a r a t i o of 29:1, 1 x TBE, 0.06% ammonium persulphate and 0.03% TEMED (N.N.N*,N',-tetramethylethylene diamine). Autoradiography was used to locate the fragment of i n t e r e s t . A f t e r e l e c t r o e l u t i o n into d i a l y s i s tubing as described above, the fragment was p r e c i p i t a t e d with 0.1 volumes of 3.0 M sodium acetate pH 5.2 and eit h e r 2 volumes of 95% ethanol or 1 volume of isopropanol. In addition, e i t h e r 20 yg of E, c o l i tRNA or 5 yg of pBR322 was used as c a r r i e r during the p r e c i p i t a t i o n step. 2.9 DNA Sequencing The cDNAs were sequenced using the base modification procedure of Maxam and G i l b e r t (1980). Maxam and G i l b e r t reactions were also used to determine mRNA i n i t i a t i o n s i t e s i n SI nuclease protection experiments. The sequence of the genomic DNA clones was determined using the dideoxynucleotide chain termination technique of Sanger et a l . (1977). A detai l e d d e s c r i p t i o n of methods used, including the subcloning of DNA fragments into M13 vectors, the preparation of single stranded phage DNA and the dideoxynucleotide reactions using the Klenow fragment of E. c o l i DNA polymerase I i s given i n Messing (1983). Fragments were cloned into M13mp8, M13mp9 or M13mpll by using e i t h e r cohesive-end or blunt-end l i g a t i o n s , the l a t t e r a f t e r the cohesive ends had been f i l l e d i n with Escherichia c o l i DNA polymerase I (Klenow fragment). In most cases, M13 clones were f i r s t screened using only ddTTP reactions i n order to avoid sequencing redundant clones. Fragments cloned into the RF i n the opposite o r i e n t a t i o n were sometimes screened by t h e i r a b i l i t y to form a. fi g u r e e i g h t - l i k e structure which migrates slower i n agarose gels (Messing, 1983). A l l sequencing reactions were analyzed on 6%. 70 polyacrylamide slab gels (0.035 x 15 x 35 cm). The gels contained an acrylamide:bisacrylamide r a t i o of 19:1 i n addition to 8.3 M urea, 1 x TBE, 0.06% ammonium persulphate and 0.03% TEMED. Electrophoresis was i n 1 x TBE at a constant current of 17.5 milliamperes. The gels were dried onto Whatman f i l t e r paper and autoradiographed using Kodak X-Omat RP f i l m . 2.10 Preparation of Hybridization Probes 125 2.10.1 Preparation of [ I ] - l a b e l l e d RNA Forty yg of heat shock polyA +RNA was fractionated on a denaturing 98% formamide-polyacrylamide slab gel (0.08 x 7.5 x 10 cm) as described by Maniatis et a l . (1975). The gel was cut into 1.0 cm s l i c e s and the RNA was electroeluted i n 20 mM Tris-acetate pH 8.0, 0.4 mM EDTA. Ten percent of each such f r a c t i o n was assayed i n a c e l l - f r e e t r a n s l a t i o n system a f t e r concentration by ethanol p r e c i p i t a t i o n . The RNA f r a c t i o n which directed the 125 t r a n s l a t i o n of hspl6 mRNA was lodinated with [ I]iod i d e (Amersham, 17 mCi/mg Nal) according to the procedure of Commerford (1971) to a s p e c i f i c a c t i v i t y of 2.5 x 10^ cpm per yg of RNA. 2.10.2 P u r i f i c a t i o n and La b e l l i n g of Oligodeoxynucleotides Two 18mer oligodeoxynucleotides were used as h y b r i d i z a t i o n probes: I. CGGGGCCGCGCGCACGCA I I . CAGGGCCGCGCGCACGCA The oligodeoxynucleotides were synthesized by Tom Atkinson i n the laboratory of Dr. M. Smith, UBC, with an Applied Biosystems 380A DNA synthesizer. Oligodeoxynucleotides were p u r i f i e d through 20% sequencing (urea) gels and i s o l a t e d by C SEP-PAK (M i l l i p o r e ) chromatography as described by 71 Atkinson and Smith (1984). To make hy b r i d i z a t i o n probes, 20 pmoles of 32 oligodeoxynucleotide was l a b e l l e d with [y- P]ATP and T4 polynucleotide kinase as described by Z o l l e r and Smith (1983). 2.10.3 Preparation of Double-Stranded DNA Probes 32 P u r i f i e d DNA fragments were nick translated with [a- P]dCTP and [a- 3 2p]dGTP by the method of Rigby et a l . (1977). M13 templates containing C. elegans genomic DNA fragments were also used to generate probes with high s p e c i f i c a c t i v i t i e s . An annealing mixture containing 3.0 y l of template (0.5 to 1.0 yg), 2.0 y l of universal primer (P-L Biochemicals; 0.03 A„,„ units per ml), 2.0 y l of 10 x 260 annealing buffer (100 mM Tris-hydrochloride, pH 7.5, 600 mM NaCl, 70 mM o MgC^), was incubated at 65 C for 15 min i n a 1.5-ml microfuge tube. A f t e r cooling to room temperature (5 to 10 min), 1.0 y l of 20 mM d i t h i o t h r e i t o l , 2.0 y l of 0.5 mM dATP, 2.0 y l of 0.5 mM dTTP, 2.5 y l each of [ 3 2P]dGTP and [ 3 2P]dCTP (25 yCi; 3,000 Ci/mmol), and 0.5 U of E. c o l i DNA polymerase I (Klenow fragment) were added. The reaction was allowed to proceed for 10 min at-room temperature and was then followed by a chase a f t e r the addition of 2.0 y l of 0.5 mM dGTP and 2.0 y l of 0.5 mM o dCTP f o r 5 min before termination by heating at 70 C f o r 10 mm. The primer-extended product was then digested with H a e l l l f o r 30 min. For both techniques, free triphosphates were separated from the l a b e l l e d strands by chromatography on 1.0 ml spun columns of Sephadex G50 (Maniatis et a l . , 1982). 72 2.11 Hybridization N i t r o c e l l u l o s e blots of DNA from b a c t e r i a l cDNA transformants were o prehybridized i n 4 x SSPE, 50% formamide f or 1 hour at 37 C. Hybridization was ca r r i e d out i n 4 x SSPE, 50% formamide containing 1.0 x 10 6 cpm per f i l t e r of [ 1 2 5 I ] - l a b e l l e d RNA at 37°C f or at least 12 hours. The f i l t e r s were washed i n two changes of 2 x SSPE, 0.1% SDS followed by two changes of 0.1 x SSPE, 0.1% SDS a l l at room temperature. o F i n a l washes were ca r r i e d out at 50 C i n 0.1 x SSPE, 0.1% SDS. In the case of double-stranded DNA probes, prehybridization was done i n 5 x SSPE, 50% formamide, 5 x Denhardt's reagent, 0.1% SDS and 100 - 200 yg/ml of sheared, denatured E. c o l i , c a l f thymus or salmon sperm DNA. Prehybridization was at 42°C f or at le a s t 1 hour. Hybridizations were ca r r i e d out for at least 12 hours at 42°C i n the solu t i o n described for the pr e h y b r i d i z a t i o n except that 1 x Denhardt's reagent was used and the 32 denatured [ P ] - l a b e l l e d probe was included. Washing of the f i l t e r s was i d e n t i c a l to the conditions described f o r the RNA probe above. For 5 ' - l a b e l l e d oligodeoxynucleotides, prehybridization and o h y b r i d i z a t i o n was done at 37 C f-or at le a s t 1 hour and 12 hours, r e s p e c t i v e l y , i n 6 x SSPE, 2 x Denhardt's reagent and 0.2% SDS. A l l washes were done i n 6 x SSPE. Washing was usually c a r r i e d out at room temperature o fo r 15 minutes, then 2 x 15 minutes at 37 C followed by 2 f i n a l washes at 48°C f o r 15 minutes each. 1 x SSPE i s 0.1 mM EDTA, 10 mM NaH 2P0 4 pH 7.0 and 0.18 M NaCl. 1 x Denhardt's reagent i s 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin and 0.02% f i c o l l . A f t e r washing, n i t r o c e l l u l o s e f i l t e r s from a l l of the hybridizations o described were a i r dried and fluorographed at -70 C using e i t h e r Kodak 73 X-Omat AR or X-Omat RP f i l m , the former being approximately 5-fold more s e n s i t i v e . 2.12 Summary of B a c t e r i a l Strains Used. Table IV. Genotypes of B a c t e r i a l Strains S t r a i n Genotype DP50, supF b. LE392 RRI d. f. Q358 Q359 JM101 JM103 F , tonA53, dapD8, l a c Y l , glnV44 (supE44), A(gal-uvrB)47, \~, t.yrT48(supF58), gyrA29, A(thyA57), hsdS3 F~, hudK514(r~,m^), supE44, supF58, l a c Y l or A(LaclZY)6, galK2, galT22, metBl, \~, trpR55 F~, hsdS20(r~, m^), ara-14, proA2, l a c Y l , galK2, rpsL20 (Sm r), xyl-5, mtl-1, supE44, X.-— + + R hsdR^, hsdH^, su , 80 + + R hsdR^, hsdM^, s u ^ , 80 , P2 Alacpro, supE, t h i , F'traD36, proAB, laci qZAM15 Alacpro, supE, t h i , F*traD36, strA, sbcB15, endA, hspR4, proAB, laci qZAM15 a,b,c - taken from Maniatis et a l . (1982) d,e, - taken from Karn et a l . (1980) f,g - taken from Messing (1983) The hosts JM103 and JM101 were streaked out on plates containing 0.2% glucose, 0.001% vitamin B l and minimal s a l t s as described i n Messing (1983). 74 I I I . RESULTS 3.1 The Heat Shock Response of Caenorhabditis elegans var. B r i s t o l , s t r a i n N2 C. elegans undergoes a t y p i c a l heat shock response at the elevated o temperature of 35 C, the normal growth temperature being approximately o 20 C. As shown i n Figure 3, there was a dramatic decrease i n general protein synthesis while a unique set of hsps was induced. From these i n vivo l a b e l l i n g experiments i t appeared that hsp81, hsp41, hsp38 and hsp29 are synthesized in control nematodes but thoy continue to be synthesized at o 35 C. These observations are in agrooment with Snutch and B a i l l i e (1983) except for hsp29 which they reported to bo uynthesized only during heat shock conditions. A protein with an apparent molecular weight of 36,000 accumulated for the f i r s t 3 hours of l a b e l l i n g but was not detectable by 5 hours. The simplest explanation for t h i s i s that t h i s p a r t i c u l a r protein has a high turnover rate and i s p r e f e r e n t i a l l y degraded during prolonged exposure of the nematodes to 35°C. Hsp70, hspl8 and hspl6 did not appear to be synthesized i n nematodes growing at normal temperature but were induced during heat shock, hspl8 and hspl6 accumulating to very high l e v e l s . The nematode hsp70 i s probably homologous to hsp70 of Drosophila and rainbow trout since C. elegans genomic DNA hybridizes to a Drosophila hsp70 genomic DNA clone (Snutch and B a i l l i e , 1983) and a trout hsp70 cDNA (Kothary et a l . , 1984). Hspl8 sometimes appeared as a doublet as shown i n Figure 3, and i s probably i d e n t i c a l to hspl9 described by Snutch and B a i l l i e (1983). In addition, Figure 3 shows the induction of a 50 kd protein i n a. synchronous population 75 F i g u r e 3. I n d u c t i o n o f h e a t s h o c k p r o t e i n s i n C. e l e g a n s . o S y n c h r o n o u s l y g r o w i n g a d u l t w o r m s w e r e i n c u b a t e d a t 35 C a n d l a b e l l e d 3 5 i n v i v o w i t h [ S ] - l a b e l l e d E . c o l i . T h e n u m b e r s b e l o w e a c h l a n e i n d i c a t e t h e d u r a t i o n o f e x p o s u r e , i n h o u r s , t o t h e r a d i o a c t i v e b a c t e r i a b e f o r e a 3 0 m i n u t e c h a s e a t 3 5 ° C . T h e l a n e o n t h e r i g h t ( C ) r e p r e s e n t s t o t a l p r o t e i n o s y n t h e s i s a t 2 2 C. T h e p o s i t i o n s o f t h e s h s p s a r e i n d i c a t e d b y s o l i d a r r o w s ; t h e p o s i t i o n s o f t h e o t h e r m a j o r h s p s a r e i n d i c a t e d b y l i n e s . N u m b e r s r e f e r t o a p p r o x i m a t e m o l e c u l a r w e i g h t s , i n k i l o d a l t o n s . 76 of adult nematodes. This protein may be analogous to the 50 kd protein that i s synthesized i n heat shocked dauer larvae (Snutch and B a i l l i e , 1983). They, however, f a i l e d to detect hsp50 i n normally growing nematodes which had been heat shocked. This discrepancy may be due to the difference i n l a b e l l i n g protocols. Snutch and B a i l l i e (1983) exposed the nematodes to radio a c t i v e b a c t e r i a p r i o r to heat shock. The higher background of normal protein synthesis may have masked the appearance of a heat inducible p r o t e i n i n the 50 kd range. Experiments were also c a r r i e d out to determine the s t a b i l i t y of pulse o l a b e l l e d hsps. I f the nematodes were l a b e l l e d f o r two hours at 35 C and allowed to recover at room temperature on unlabelled E. co 11, i t could be shown that the hsps of C. elegans, e s p e c i a l l y the c h a r a c t e r i s t i c 18 kd and 16 kd proteins, were s t i l l present at 24 hours. The r e s u l t s of th i s experiment are shown i n Figure 4. 3.2 I d e n t i f i c a t i o n of cDNAs Coding f o r Hspl6 In order to characterize the genes coding for hspl6 and hspl8, a cDNA l i b r a r y constructed from polyA +RNA i s o l a t e d from heat shocked B r i s t o l nematodes was screened. The probe used was a polyA +RNA f r a c t i o n (Figure 5, lane D) which was highly enriched f or messages coding for hspl6 and hspl8. T o t a l mRNA was fractionated by formamide polyacrylamide gel electrophoresis and monitored by i n v i t r o t r a n s l a t i o n i n a rabbit r e t i c u l o c y t e system as an assay for b i o l o g i c a l l y active mRNA coding f o r the 125 shsps. This enriched f r a c t i o n was then lodmated with I and used to screen f o r cDNAs s p e c i f i c to t h i s f r a c t i o n . 7 7 F i g u r e 4. S t a b i l i t y o f t h e h s p s o f C. e l e g a n s . S y n c h r o n o u s l y g r o w i n g c u l t u r e s c o n s i s t i n g o f l a t e l a r v a l s t a g e s w e r e o o l a b e l l e d f o r 2 h o u r s a t 3 5 C. A f t e r a c h a s e f o r 3 0 m i n u t e s a t 3 5 C i n t h e p r e s e n c e o f u n l a b e l l e d b a c t e r i a , t h e w o r m s w e r e a l l o w e d t o r e c o v e r a t n o r m a l t e m p e r a t u r e f o r t h e l e n g t h o f t i m e ( h o u r s ) s h o w n b e l o w e a c h l a n e . o L a n e C r e p r e s e n t s t o t a l p r o t e i n s y n t h e s i s a t 2 2 C. L a n e E i s a p r o f i l e o f i n v i v o l a b e l l e d p r o t e i n s o f E . c o l i K 1 2 . T h e p o s i t i o n s o f t h e s h s p s a r e i n d i c a t e d . 7 8 AB C D F i g u r e 5 . I n v i t r o t r a n s l a t i o n p r o d u c t s o f mRNA f r o m h e a t s h o c k e d c e l l s , a n d e n r i c h m e n t o f m e s s a g e s c o d i n g f o r t h e s m a l l h s p s . A p p r o x i m a t e l y 1.0 y g o f R N A w a s t r a n s l a t e d i n a r a b b i t r e t i c u l o c y t e 3 5 s y s t e m i n t h e p r e s e n c e o f [ S J m e t h i o n i n e . T r a n s l a t i o n p r o d u c t s w e r e s e p a r a t e d o n a 1 5 % S D S - p o l y a c r y l a m i d e g e l a n d i d e n t i f i e d b y a u t o r a d i o g r a p h y . L a n e s a r e A ) t o t a l c o n t r o l R N A ; B ) t o t a l h e a t s h o c k R N A ; C ) h e a t s h o c k p o l y A + R N A ; D) e n r i c h e d f r a c t i o n o f p o l y A R N A p u r i f i e d b y f o r m a m i d e p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . T r a n s l a t i o n o f t h e 1 8 k d a n d 16 k d h s p s i s i n d i c a t e d b y t h e s o l i d a r r o w s . O p e n a r r o w s i n d i c a t e e n d o g e n o u s l y - l a b e l l e d p r o t e i n s w h i c h a r e a l s o p r e s e n t w h e n n o RNA i s a d d e d t o t h e c e l l - f r e e t r a n s l a t i o n s y s t e m ( s e e F i g u r e 6, l a n e C ) . 79 Approximately 1000 transformants were screened by colony h y b r i d i z a t i o n . This yielded 27 putative p o s i t i v e colonies from which plasmid DNA was prepared. The DNA was r e s t r i c t e d with PstI and the li b e r a t e d cDNA ins e r t s were analyzed on a 1.5% agarose g e l . The DNA was transferred from the gel to n i t r o c e l l u l o s e and hybridized to the 125 . . [ I ] - l a b e l l e d probe. Of the o r i g i n a l 27 plasmids, 12 contained PstI i n s e r t s which hybridized to the r a d i o l a b e l l e d RNA (res u l t s not shown). To i d e n t i f y hybrid plasmids coding f o r hspl6 or hspl8, h y b r i d i z a t i o n s e l e c t i o n was c a r r i e d out. Seven plasmids were i d e n t i f i e d which selected mRNA s p e c i f i c a l l y coding for hspl6. A t y p i c a l p o s i t i v e s e l e c t i o n i s shown i n Figure 6. R e s t r i c t i o n enzyme analysis revealed that the p o s i t i v e cDNA inse r t s f e l l into two groups, based on the presence or absence of an EcoRI s i t e . Two cDNA clones, pCEHS48 and pCEHS41, were used for sequence analysis since they contained the longest cDNA inserts representing each group. In the h y b r i d i z a t i o n s e l e c t i o n experiments, the only mRNA selected by the cDNA hybrid plasmids tested were species coding for the 16,000 dalton hsp. Those plasmids which did not s e l e c t hspl6 mRNA gave completely negative r e s u l t s . This suggests that messages coding for hspl6 are e i t h e r very abundant, or that t h e i r structure i s p a r t i c u l a r l y well suited to cDNA synthesis under the conditions used. I t i s perhaps s u r p r i s i n g that no p o s i t i v e recombinant plasmids selected mRNAs coding for hspl8, which appears to be induced to the same high l e v e l s as hspl6. The hspl8 messages were not degraded during the h y b r i d i z a t i o n s e l e c t i o n , since t o t a l polyA +RNA removed from the h y b r i d i z a t i o n mix contained mRNA which was translated into a 18,000 dalton p r o t e i n as shown i n Figure 6 (lane T). Again, i t i s possible that the hspl8 mRNA may possess some s t r u c t u r a l feature which, i n t h i s case, 3 0 S T C 16k> F i g u r e 6. I n v i t r o t r a n s l a t i o n o f R N A s e l e c t e d b y h y b r i d i z a t i o n w i t h p C E H S A l . P l a s m i d p C E H S A l w a s b o u n d t o n i t r o c e l l u l o s e a n d h y b r i d i z e d t o p o l y A + R N A f r o m h e a t s h o c k e d n e m a t o d e s . A f t e r h y b r i d i z a t i o n , t h e R N A s e l e c t e d b y t h e r e c o m b i n a n t c D N A c l o n e w a s e l u t e d a n d t r a n s l a t e d i n v i t r o • 35 [ S ] - l a b e l l e d p r o d u c t s w e r e a n a l y z e d b y S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s a n d a u t o r a d i o g r a p h y . L a n e s a r e C ) c o n t r o l w i t h n o a d d e d R N A ; T ) n o n - h y b r i d i z e d o r t o t a l p o l y A + R N A a n d S ) s e l e c t e d p o l y A + R N A . T h e p o s i t i o n o f hspl6 i s s h o w n . 81 resulted i n poor synthesis of cDNA. This feature i s not the lack of a polyA sequence, r e s u l t i n g i n inadequate priming with oligo(dT), since t h i s mRNA binds to o l i g o ( d T ) - c e l l u l o s e (see Figure 5, lane C). In t e r e s t i n g l y , cDNAs coding f o r Drosophila hsp22 and hsp27 were not i d e n t i f i e d under conditions i n which cDNAs coding f o r hsp23 and hsp26 were (Wadsworth et a l . , 1980; Voellmy et a l . , 1981). 3.3 Two-dimensional Gel Electrophoresis of Hspl6 The f i n d i n g of two d i s t i n c t l y d i f f e r e n t cDNAs coding f o r hspl6 suggested the existence of more than one gene for t h i s protein. The possible existence of multiple forms of hspl6 was investigated by analyzing the t r a n s l a t i o n products of mRNA selected by pCEHS48 or pCEHS41 (Figure 6, lane S) on two-dimensional gels using the system of O' F a r r e l l (1975). The gel analysis was kindl y c a r r i e d out by Eliza b e t h Burgess. The r e s u l t s f o r pCEHS41 are shown i n Figure 7. Five polypeptides with d i s t i n c t l y d i f f e r e n t i s o - e l e c t r i c points, but i d e n t i c a l molecular weights were resolved. I d e n t i c a l r e s u l t s were obtained when pCEHS48 was used i n the s e l e c t i o n . This implies that, under the conditions used i n the h y b r i d i z a t i o n s e l e c t i o n experiments, both pCEHS48 and pCEHS41 hybridized to the same t r a n s c r i p t s . This i s not su r p r i s i n g since the cDNAs CEHS48 and CEHS41 cross-hybridize with each other strongly under normal h y b r i d i z a t i o n stringencies ( r e s u l t s not shown). These r e s u l t s are consistent with the existence of at le a s t two d i s t i n c t but rel a t e d hspl6 sequences as suggested by the cDNA r e s t r i c t i o n enzyme patterns. 32 IEF -5.0 16k 7.5 F i g u r e 7. T w o - d i m e n s i o n a l g e l e l e c t r o p h o r e s i s o f t h e p r o d u c t s f r o m t r a n s l a t i o n o f h y b r i d - s e l e c t e d p o l y A + R N A . P o l y A + R N A s e l e c t e d b y h y b r i d i z a t i o n t o p C E H S 4 1 w a s t r a n s l a t e d i n v i t r o ( s e e F i g u r e 6, l a n e S ) . T h e 25 p i t r a n s l a t i o n m i x t u r e w a s o p r e c i p i t a t e d i n 1 0 v o l u m e s o f a c e t o n e a t - 2 0 C o v e r n i g h t . T h e p e l l e t w a s w a s h e d w i t h e t h a n o l , d r i e d a n d r e s u s p e n d e d i n O ' F a r r e l l l o a d i n g b u f f e r A ( O ' F a r r e l l , 1 9 7 5 ) . T h e d i r e c t i o n s o f i s o - e l e c t r i c f o c u s i n g a n d S D S - g e l e l e c t r o p h o r e s i s a r e s h o w n b y a r r o w s . A r r o w s a l s o s h o w t h e m i g r a t i o n o f t h e t w o m o s t b a s i c p r o t e i n v a r i a n t s w h i c h a r e d i s c u s s e d i n s e c t i o n 4 . 1 . 83 3.4 Messages Coding f o r Hspl6 Are Not Transcribed i n Control Nematodes In v i t r o t r a n s l a t i o n of control RNA sometimes showed the existence of what appeared to be hspl6 (see Figure 5, lanes A and B). Hspl6 t r a n s c r i p t s might have been induced inadvertently during c o l l e c t i o n and washing of control batches of nematodes or they may be present under normal conditions. The a v a i l a b i l i t y of s p e c i f i c DNA probes f o r hspl6 mRNA made i t possible to address t h i s question. As shown i n Figure 8, no detectable h y b r i d i z a t i o n of CEHS41 cDNA to polyA +RNA from control nematodes was seen. I d e n t i c a l r e s u l t s (not shown) were obtained with the CEHS48 cDNA inse r t as probe. C l e a r l y , a very high d i f f e r e n t i a l synthesis of hspl6 mRNA occurs during heat uhock, demonstrating the strong i n d u c i b i l i t y of these genes. Hspl6 t r a n s c r i p t s do not display any size heterogeneity under these electrophoresis conditions. 3.5 Sequence Analysis of the cDNAs CEHS48 and CEHS41 The cDNAs were sequenced using Maxam and G i l b e r t base modification and chemical cleavage reactions on the end-labelled DNA fragments shown i n Figure 9. As seen i n Figure 10, the nucleotide sequences of CEHS48 and CEHS41 are very s i m i l a r . Numbering of the nucleotide and predicted amino acid sequences begins at the 5' end of CEHS48. CEHS48 encodes 135 amino acid residues. CEHS41 i s aligned with CEHS48, beginning at amino acid 32 since i t codes f o r 31 fewer amino acid residues at the 5' end. One of the most s t r i k i n g features of these sequences i s the contrast i n degree of homology between d i f f e r e n t regions. From nucleotides 92 to 112, the two cDNAs d i f f e r at a l l po s i t i o n s except four. Sequence analysis of the hsp!6-41 gene (Jones et a l . , 1986) has revealed that t h i s s t r e t c h i n CEHS41 8 4 HS o r i g i n F i g u r e 8. N o r t h e r n b l o t a n d d o t - b l o t a n a l y s i s o f p o l y A R N A f r o m c o n t r o l a n d h e a t s h o c k e d w o r m s . 1.0 y g o f p o l y A + R N A w a s d e n a t u r e d , s e p a r a t e d o n a 1 . 5 % a g a r o s e g e l a n d t r a n s f e r r e d t o n i t r o c e l l u l o s e . A 0.5 y g s a m p l e o f t h e s a m e R N A w a s t h e n a p p l i e d a s a s p o t t o t h e n i t r o c e l l u l o s e f i l t e r a t t h e t o p o f t h e t r a n s f e r r e d R N A l a n e s . T h e s e b l o t s w e r e t h e n p r o b e d f o r s e q u e n c e s c o d i n g 3 2 f o r h s p l 6 w i t h [ P ] - l a b e l l e d C E H S 4 1 c D N A . C o n t r o l a n d h e a t s h o c k l a n e s a r e i n d i c a t e d . 8 5 cehs48 Hpall PstI Bgl II EcoRI Taq I PstI Hpall cehs41 Hpall Hhal PstI SstI Pst I Hpa I 200 bp F i g u r e 9. S t r a t e g y u s e d t o d e t e r m i n e t h e n u c l e o t i d e s e q u e n c e o f C E H S 4 8 a n d C E H S 4 1 c D N A i n s e r t s . T h e c D N A i n s e r t s a r e s h o w n a s t h e y a r e o r i e n t e d r e l a t i v e t o t h e c o n v e n t i o n a l c l o c k w i s e n u m b e r i n g o f t h e p B R 3 2 2 s e q u e n c e . p B R 3 2 2 s e q u e n c e s a r e r e p r e s e n t e d b y t h i n l i n e s . H s p l 6 c o d i n g r e g i o n s a r e s h o w n b y o p e n b o x e w h i l e 3 ' n o n - c o d i n g r e g i o n s a r e s h o w n b y s h a d e d b o x e s . A r r o w s r e p r e s e n t t h d i r e c t i o n o f s e q u e n c i n g f r o m K l e n o w - l a b e l l e d f r a g m e n t s ( s q u a r e s ) o r f r o m t e r m i n a l t r a n s f e r a s e - l a b e l l e d f r a g m e n t s ( c i r c l e s ) . 86a Figure 10. Complete nucleotide sequences of the cDNA inserts from pCEHS48 and pCEHS41 with the deduced amino acid sequences. The coding strands of each cDNA are aligned with each other to demonstrate sequence homology. Asterisks represent differences i n the sequences at both the nucleotide and amino acid l e v e l s . The polyadenylation s i g n a l AATAAA, found 12 base pa i r s before the poly(A) s t r e t c h i n pCEHS48 i s also shown. 86 E*23IS48 G l g TCT GAT TCA AAT GTT CTC GAT CAT TTC TTG GAT GAA ATC ACT GGA TCT GTT CAA TTT pCEIIS-l l hspl6-48 S er Asp Ser Asn V a l Leu Asp H i s Phe Leu Asp G l u H e T h r G l y Ser V a l G i n Phe hsplfi-41 1 10 60 80 100 120 CCA TAT TGG AGA AAT GCT GAT CAC AAC TCA TTC AAT TTT T^C GA(j AAT ATT GGA GAG ATT GTA AAT GAC G w TA AAA TTG TGT TCT TTT f f f CAG ATT GTA AAT GAT i e 8 20 30 40 Phe Asn Phe *** Lys 160 TCT CAT TTC TCT CAT TTC Ser H i s Phe Ser H i s Phe 140 180 G l u S e r Lys Phe Ser V a l G i n Leu Asp V a l r s Lys P r o G l u Asp Leu Lys H e G l u Leu Asp *** *** : P r o G l u Asn Leu Lys H e Lys Leu Asp 50 60 GGA AGA°GAA CTA AAA ATT GAA GGA ATT "CAA GAA AAA AAA TCA GAG^CATGGATAC T£G AAA CGA TCA°TTT GGA AGA GAG CTC AAA An GAA GGG ATT CAA GAA ACA AAA K G GAA CAT GGA TAC TTG AAA CGC TCA TTT G l y Arg G l u Leu Lys H e G l u G l y H e G i n G l u Lys Lys Ser G l u H i s G l y T y r Ser Lys A r g S e r Phe #** *** G l y A r g G l u Leu Lys H e G l u G l y H e G i n G l u T h r Lys Ser G l u H i s G l y T y r Phe Lys Arg Ser Phe 70 80 280 300 90 100 CTT CAA ATT GAG GCT CCA AAG AAG^ACT AAC TCA TCT CGT TCT ATT°CCC"; CTC CAA ATT GAG GCT CCA AAG AAG ACA AAC TCA TCA CGT TCT ATT CCG , Leu G i n H e G l u A l a Pro Lys Lys Thr Asn Ser Ser A r g Ser H e Pro Leu G i n H e G l u A l a Pro Lys Lys Thr Asn Ser S e r A r g S e r H e Pro 120 130 ' 320 ATTTCG" "AAT GAA GGA ATT TCG AAT GAA GGA H e Ser Asn G l u G l y H e Ser Asn G l u G l y 110 400 AAT TTT GTT GCA AAA AAT TTT GTT GCA AAA Asn Phe V a l A l a Lys Asn Phe V a l A l a Lys 460 480 CAT TAA T,^TTTATT5TATJ^AAATAn$TTAATTTgAATAAAGTCATTAATTTAAAAAAAAAAAAAAAAAAAAAAAAC 5 CAT TAA CACTTTT6TT6AAGAGAA6CTACTTATTATTTGTTCTTCTTTTT^ H i s End H i s End 135 87 i s a c t u a l l y the 3' portion of a 58 bp intron, t h i s p a r t i c u l a r cDNA being the r e s u l t of reverse t r a n s c r i p t i o n of an unspliced message. CEHS48 corresponds to a c o r r e c t l y s p l i c e d t r a n s c r i p t , the intron being found between amino acid residues 38 and 39 i n Figure 10 (see section 3.9). From nucleotides 113 to the TAA termination codons, the homology i s 91% and r e s u l t s i n only 6 amino acid differences out of a t o t a l of 97. Non-conservative changes occur at amino acid positions 59 (Asp •* Asn), 63 (Glu -» Lys), 77 (Lys -> Thr), and 101 (Thr •* Pro). The 3' noncoding regions are highly divergent compared to the coding region, with a sequence homology of only 30%. CEHS48 contains a polyA stretch of 24 residues, 12 nucleotides a f t e r the polyadenylation signal AATAAA (Proudfoot and Brownlee, 1976). The length of the 3' noncoding regions, excluding the polyA s t r e t c h , i s 49 nucleotides for CEHS48 compared to at least 92 nucleotides f o r CEHS41 which i s incomplete at the 3' end. At the nucleotide l e v e l , thecDNAs have A/T base compositions of 67% and 69%. This high A/T content i s r e f l e c t e d i n the codon usage where A and T are preferred i n the wobble p o s i t i o n s . For example, ATT or ATA are used as codons f o r isoleucine 23 times-* whereas the ATC codon i s used only once. S i m i l a r l y , l y s i n e i s coded f o r by AAA 22 times while AAG i s used only 7 times. The codon usage f o r v a l i n e , serine, asparagine, aspartic acid, glutamic acid and glycine also r e f l e c t s t h i s trend. The deduced amino acid sequences of the shsps of D. melanogaster are very s i m i l a r i n a region of 83 amino acids which shows homology to a - c r y s t a l l i n , the major water-soluble protein component of the vertebrate lens (Ingolia and Craig, 1982b; Ayme and T i s s i e r e s , 1985). Due to the molecular weight difference and the f a c t that no other 16,000 dalton hsp had 8 8 DMHSP 2 7 DMHSP 2 6 DMHSP 2 3 DMHSP 2 2 A - C R Y S B 2 C E H S P 1 6 - 4 8 C E H S P 1 6 - 4 1 AA 8 7 -8 7 -6 7 -6 1 -7 2 -4 3 -4 3 -K D G K D G K D G K D G K D R C M C M C M L T L D V F S V D V D V A Q D V S Q S H K D HjL II V[KJH F [ S J P E E S K F S V Q L D V S H F K P E E S K F S V Q L D V S H F K P E N E S E S E S E E L T V K V V D N T V V V E L N V K V V D D S I L V E L V V G V Q D N S V L V E L [ K V K V L D G S V L V G L K J V K V L[G]D V I E V H L K L K G K H G K H G N H G K S G K H L D G R E L K I E L D G R E L K I E E E E E , , E G I Q E G I Q E E R G D G E R Q D D E R E D D Q Q F A E E R Q D[E K [ K S ^ E T K S - E H G H G H G Q G H G H G Y H G Y fl I Q H I M F I T G Y S F I S S L R H R H R V R K Y T L F V R R Y L V F V R R Y A L P L R R F V L P H R K Y R I K R S f"S K M I L L P E D V D L T K R S F S K M I L L P E D[A]D L|P AA K ' G L T P T K [ V | V [ S | T V f s l S D [ G ] V [ L ] T L - 1 5 9 D G Y K A E Q V V S Q L S S D G V L T V - 1 5 9 P G Y E A D K V A S T L S S D G V L T I - 1 3 9 E G Y E A D K V T S T L S S D G V L T I - 1 3 3 P [ A J D V D [ P L A | I I T [ S [S L [ S I S D | G | V | L | T V - 1 4 4 S V K S A I S N E G K L Q T I - 1 1 5 S V K S A I S N E G K L Q I - 1 1 5 Figure 11. Comparison of deduced amino acid sequences of four- shsps from D. melanosaster, a - c r y s t a l l i n and two 16,000 dalton hsps from C. elegans. The region shown corresponds to the 74 amino acid region which was used f o r comparison by Ingolia and Craig (1982a, Figure 4). The-sequence of bovine a - c r y s t a l l i n i s that of the chain (van der Ouderaa, et a l . , 1973) while the D. melanogaster sequences are taken from Ingolia and Craig (1982b). The regions of each protein used for the comparison are indicated by amino acid numbering. The d i f f e r e n t l e v e l s of homology are shown by open boxes and are discussed i n Section 3.5. The sing l e l e t t e r amino acid code i s A, alanine; C, cysteine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; H, h i s t i d i n e ; I, isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, p r o l i n e ; Q, glutamine; R, arginine; S, serine; T, threonine; V, vali n e ; W, tryptophan; Y, tyrosine. 89 been i d e n t i f i e d i n a eucaryotic system, i t was surp r i s i n g to f i n d that C. elegans hspl6-41 and hspl6-48 contained extensive homology to the shsps of Drosophila within the conserved block. The boxed regions i n Figure 11 show areas of amino acid homology at two d i f f e r e n t l e v e l s . F i r s t l y , amino acids shared by bovine a - c r y s t a l l i n (B^ chain) and the two hspl6 proteins of C. elegans are indicated. Amino acid numbering of the hspl6 proteins corresponds to that shown i n Figure 10. Over the regions shown, the same amino acid occurs at 26 positions out of 74. In the sub-region of amino acids 46 to 61 (numbering r e f e r s to the C. elegans hsps), the same amino acid i s used at 11 positions out of 16. Also indicated are the positions at which the same amino acid i s used by at least 6 of the 7 proteins. This occurs at 19 posi t i o n s , 7 f a l l i n g within the sub-region discussed above while another 5 are found over a region of 11 amino acids from positions 103 to 113. Extensive homology among hsp22, 23, 26 and 2 7 of Drosophila extends approximately 30 amino acids i n a 3* d i r e c t i o n from the 74 amino acid domain (see Figure 2). This i s also the case with the two hspl6 sequences where extensive homology i s maintained on the 3* side of the func t i o n a l domain and, i n f a c t , extends to the carboxyl termini. There are no s i m i l a r i t i e s between the C. elegans and D. melanogaster sequences i n t h i s region although a prol i n e residue j u s t 3* to the conserved domain shown i n Figure 10 has also been conserved (see Figure 16). 3.6 I s o l a t i o n of B r i s t o l Genomic DNA Clones The 0.5 kb cDNA coding f o r the hspl6-48 variant was used to screen two separate phage l i b r a r i e s , one a. p a r t i a l EcoRI digest of B r i s t o l . DNA in. Charon4 and the other a p a r t i a l Mbol digest i n EMBL4. By- r e s t r i c t i o n 90 enzyme mapping of overlapping recombinant phage clones i t was possible to define a region of 30 kb which i s shown i n Figure 12A. Southern b l o t t i n g of r e s t r i c t i o n digests was used to i d e n t i f y those EcoRI fragments which hybridized to the hspl6-48 cDNA. They included two fragments of 3.3 kb which comigrated and which could be distinguished by the presence or absence of a S a i l s i t e and w i l l be referred to as 3.3L and 3.3R, r e s p e c t i v e l y (Figure 12A). Another h y b r i d i z i n g EcoRI fragment of 1.0 kb was also i d e n t i f i e d . For more detai l e d r e s t r i c t i o n endonuclease analysis and f o r bulk preparation of s p e c i f i c DNA fragments, the 3.3L and 1.0 kb fragments were p u r i f i e d from the phage X.Charon4 A - l and subcloned into pBR325. The 3.3R fragment was subcloned into pUC13 a f t e r i s o l a t i o n from phage XEMBL4-2. A d e t a i l e d r e s t r i c t i o n map of these three adjacent EcoRI fragments, together covering 7.6 kb, i s also shown i n Figure 12A. 3.7 Sequencing of the Hspl6 Genes and I d e n t i f i c a t i o n of a Perfect 1.9 kb Inverted Repeat A contiguous region of approximately 4.4 kb was sequenced using the strategy shown i n Figure 12B. Sequence analysis i d e n t i f i e d the hsp!6-48 gene and another open reading frame which defines a gene coding for another 16 kd hsp designated hsp!6-l. The two genes are separated by 347 bp and are arranged i n d i f f e r e n t orientations. Detailed analysis of the lambda clones revealed that t h i s gene p a i r was duplicated nearby as a perfect 1.9 kb inverted repeat. This unusual organization i s shown i n Figure 12A. The 1.9 kb inverted repeats were separated by 416 bp of unique DNA which would form an unpaired loop, i f the otherwise palindromic structure were displayed i n a 91a Figure 12. Organization of the hsp!6-48 and hsp!6-l genes of C. elegans, and the DNA sequencing strategy. (A) Map of overlapping recombinant phage inserts and sequence organization of the small heat shock gene domain. The complete EcoRI and S a i l r e s t r i c t i o n maps of the 30 kb region are shown. So l i d c i r c l e s at the ends of the \EMBL4 phage ins e r t s represent Sau3A s i t e s . The 0.9 kb and 1.6 kb EcoRI fragments at the f a r l e f t ( i n parentheses) were i d e n t i f i e d i n \Charon4 B-3, but t h e i r orientations have not yet been determined. The 7.6 kb region defined by the 3.3L, 3.3R, and 1.9 kb EcoRI fragments has been enlarged to show the detailed r e s t r i c t i o n map and gene organization. The arms of the perfect 1.9 kb inverted repeat (IR) and the orientation of the small heat shock genes are indicated. S o l i d bars, coding sequences; open bars, introns. The 0.9 kb BamHI-Xbal fragment which was used to detect h s p l 6 - l s p e c i f i c mRNAs i s shown above the map. (B) Strategy used to sequence the 4.4 kb region which includes both arms of the inverted repeat, the loop region between them, and the d i s t a l boundary regions. A l l sequencing was done with M13 single-stranded phage. Arrows indicate the d i r e c t i o n and extent of the sequence obtained from the r e s t r i c t i o n s i t e s shown. The unlabelled s i t e s are Sau3A r e s t r i c t i o n s i t e s . 91 tn < < in sz JZ r. < < c (J O O "J UJ (J 5 ] 92 stem-loop configuration. The genes themselves w i l l be discussed in greater d e t a i l i n section 3.8. To show that t h i s sequence arrangement i s a c t u a l l y present i n G. elegans B r i s t o l genomic DNA, extensive Southern blo t analysis was c a r r i e d out with a v a r i e t y of probes (Figure 13). Probe A, the cDNA that was o r i g i n a l l y used to screen the phage l i b r a r i e s , i d e n t i f i e d an intense 3.3 kb EcoRI band which i s consistent with the phage map. On the other hand, no evidence of the expected 1.0 kb EcoRI fragment was seen. I t seemed possible that the predicted self-complementarity of t h i s fragment might be i n t e r f e r i n g with h y b r i d i z a t i o n of the cDNA, which i s complementary to part of the inverted repeat. To circumvent t h i s problem, an attempt was made to disrupt the inverted repeat structure by digesting B r i s t o l DNA with B e l l , a r e s t r i c t i o n enzyme which cleaves i n the loop region. Hybridization to probe B, an M13 clone containing a 150 bp B g l l l - B c l l i n s e r t , resulted i n genomic B e l l fragments of 0.8 and 0.65 kb, again consistent with the phage map. This probe also i d e n t i f i e d a 1.1 kb B g l l l band which was more intense since i t was derived from the two arms of the inverted repeat. The p o s s i b i l i t y that a probe which included the loop region might detect the 1.0 kb EcoRI fragment and help to i d e n t i f y other c h a r a c t e r i s t i c fragments from the inverted repeat was also investigated. Probe C, another M13 clone containing a 500 bp Ddel-EcoRI i n s e r t , of which 200 bp was s p e c i f i c to the loop region, was used. This probe i d e n t i f i e d the 1.0 kb EcoRI fragment along with a 1.1 kb B g l l l fragment, a 1.8 kb PstI fragment, a 3.75 kb S s t l l fragment, a 4.0 kb BamHI fragment, and a 4.1 kb Xhol fragment, a l l of which were predicted from the inverted repeat structure presented i n Figure 12A. 93 Figure 13. Analysis of C. elegans B r i s t o l genomic DNA. Approximately 2 yg of DNA was digested with the indicated r e s t r i c t i o n enzyme, separated by electrophoresis on e i t h e r 1.5% (probe B) or 0.7% (probes A and C) agarose gels, and transferred to n i t r o c e l l u l o s e . Probe A, CEHS16-48 cDNA; probes B and C, inserts i n M13 clones. Fragment sizes are shown i n kilobases. Below the r e s u l t s f o r each probe i s shown the region that i t represents, along with the lengths of the expected hybr i d i z i n g fragments for each r e s t r i c t i o n enzyme predicted from the map i n F i g . 12A. I, Regions from which probes B and C were derived; S, i d e n t i c a l sequences i n the other arm of the inverted repeat (IR). The markers used with probes A and C were a H i n d l l l digest of lambda DNA; those used with probe B were a mixture of AccI, Hindi!, and Hpall digests of pBR322. 94 In Figure 13, the hsp!6-48 cDNA (probe A) hybridized also to a 2.2 kb EcoRI fragment. This i s a t t r i b u t e d to sequences coding f o r the hsp!6-41 variant which have been cloned and characterized (Jones et a l . , 1986). The a d d i t i o n a l f a s t e r migrating bands seen i n Figure 12C are a r e s u l t of the palindromic character of t h i s region and can be explained by the formation of foldback structures during the r e s t r i c t i o n enzyme digestions done at higher temperatures. The a b i l i t y to form these structures i s d i r e c t l y c orrelated with the degree of nicking or single-strandedness found i n the DNA, which varied with d i f f e r e n t preparations. Thus, these foldback structures are not found i n high molecular weight genomic DNA which i s highly r e s i s t a n t to SI nuclease (data not shown). The absence of foldback structures can be seen i n Figure 23 i n which a d i f f e r e n t preparation of B r i s t o l DNA was used. 3.8 I d e n t i f i c a t i o n of the Small Heat Shock Genes As already mentioned, sequence analysis i d e n t i f i e d four open reading frames coding for two d i f f e r e n t hspl6s. Figure 14 shows 4.4.kb of DNA sequence which includes both arma of the 1.9 kb inverted repeat and a l l four shsp genes. In each case, the presumed i n i t i a t i o n s i t e of protein synthesis was taken to be the f i r s t ATG i n the open reading frame. The gene corresponding to CEHS48 coded for a protein of 143 amino acids, 8 residues longer at the NH^-terminal end than the protein sequence determined from the cDNA. The molecular weight of t h i s hsp was calculated from the amino acid composition (Table V) to be 16,299, which i s i n good agreement with the molecular weight derived from the r e s u l t s of SDS-polyacrylamide gel electrophoresis. 95a Figure 14. Complete sequence of a small heat shock gene clu s t e r of C. elegans. The sequence begins 5* to the border of the l e f t arm of the inverted repeat, which s t a r t s at p o s i t i o n 114 and ends at p o s i t i o n 2005. In t h i s arm we have underlined the noncoding strand of the hsp!6-l gene, and the coding strand of the hsp!6-48 gene has been translated. The converse i s shown i n the r i g h t arm, which begins at p o s i t i o n 2422 and continues to p o s i t i o n 4313. The TATA sequences and the polyadenylation signals f or a l l four reading frames are boxed. The HIPs of the hsp!6-l and hsp!6-48 genes are underlined and l a b e l l e d (see text f or discussion). The starts of t r a n s c r i p t i o n are shown with arrows over the coding strands of the hsp!6-48 (pos i t i o n 1344) and hsp!6-l (position 3339) genes. Potential Z-DNA-forming regions are shown straddling Rsal s i t e s between the two pairs of genes. Stretches (12bp) of alternating purine-pyrimidine residues are also shown within the G + C- r i c h boundary sequences. They are bordered by hexanucleotides which form inverted repeats as shown. The one-nucleotide change between the two inverted repeats i s shown at po s i t i o n 4304 i n the boundary sequence of the r i g h t arm. 95 DOE I 2 0 4 0 SO 8 0 tOO I 1 2 0 I R XHOI BAMHI Z 140. 160 1 8 0 2 0 0 2 2 0 2 4 0 T C G G G G C C G C G C G C A C G C A G C C C A A T A C G C A A A A A T T A A G C T G T T G G C G A A T C T C A A C T C G A G A C T G C C A C A C A G G T C A G C C C A T C C A A A A G T G C A A T G G A T A G G C C T C A C C A T G O O G A G C Boundary S e q u e r x * S A C 1 I 2 6 0 2 8 0 SCO 3 2 0 3 4 0 3 6 0 T C C C G C C T T C A T G A T C G C G A G A T A A C C C C C A G C C A G O T A A Q T T T A A G A A G T G G C G G T A A G A G A G G G T A A G G G T Q T T G T A T A G C A T G A C A T C T G G C G G G T T C C G C G G A C G A A T G C A G A A T G R S A I 3 8 0 4 0 0 4 2 0 4 4 0 4 6 0 4 8 0 T G T T A G G A T G G G A G G G G C T G T G C A A T A C C C A A A A A T A G G C A T T A T G C A A G A A G T A C A T T G C C G G C A T T T A C A T A T T T A T T A C T A A C T T T C A A A A A A T A T C A C A A A T T C A T A T T A T T T T T A A A T | T T T A T T J G A A A C A G A A T A C T G G A A T T T A T A G T A A T T A C A T G C A T A G T T C A A A A A A A T C A T A A A A T T A C A A T A A J T A T T C A G A A G T T T T T T G T T C A A C G G G C G C T T G C T G A A T T G G A A T B G L I I 6 2 0 6 4 0 6 6 0 6 8 0 7 0 O 7 2 0 A G A T C T T C C T T G A A T C G C T T C C T T C T T T G G T G C T T C A A T T G A A A G T T T T C C A T C T T C T G A A A G A T T T G A A G C A A C T G C A C C A A C A T C A A C A T C T T C G G G T A G A A G A A T A A C A C G A G A A A A 7 4 0 7 6 0 7 8 0 8 0 0 8 2 0 8 4 0 T G A T T T C T T T G A A T A T C C A T G T T C A G T C T T T A A T T C T T G T T C T C C T T G A A T T G A T A A T G T A T G T C C A T C C A A A T T A A T T T T C A A A T C T T C T G G C T T G A A C T G C G A G A C A T T G A G A T T T A T B C L I : t O O E I 8 6 0 S 8 0 9 O 0 9 2 0 9 4 0 9 6 0 G G C A A A C T T T T G A T C A T T G T T A A C A A T C T G A A A G A A A T C T T T T T T A T A C A A A C T C T T G A A A A A A A A A T G T G T T A C T T A C C T C A G A A G A T T C A G A T G G A G A G C C T C T G C A A A C T G G A G T A A DOE I 9 8 0 lOOO 1 0 2 0 1 0 4 0 1 0 6 0 1 0 8 0 A T T G A C G T T C C A T C T G A G C C A T A T C T C T C A T G A G A T C A C C A A A A A C A G A A C G T T G A G C T G C A C G G A A A T A G T G O T A A A G T G A C A T G A T T G T A G T T T G A A G A T T T C A C A A T T A G A G T G A A HSP16-1 XBAI 110O 1 1 2 0 1 1 4 0 1 1 6 0 1 1 8 0 1 2 0 O T G T T G T T T G G T T C G G T T T T G T C A C T G T A I T T T A T A I ^ T C A T T T C C A C C T T T T T C T A G A A C A T T C G A G C T G C T T C T T G C A A A A G G A G G G C G A C T C A C A T T C A G A A C A T T G A G A A A T A G T G T G C RSAI • H I P X B M p S T I Z 1 2 2 0 1 2 4 0 1 2 6 0 128Q m r - w ) 3 0 O 1 3 2 Q G T A C T G A A G A A A C C C A G A T A C T T T T T C A A T C T G C G T C T C T T T G C A C C T A T G G G G T G T A T T T T G A A A T G A A T G t HSP16~48 ^ M L M L R S P F S D S N V L D 1 3 6 0 1 3 8 0 1 4 0 0 1 4 2 0 1 4 4 0 A T A A ^ C C A A T C G T G T T C A G A G G A A A C C A A T A C A C T T T G T T C A A G T G C T T A C T G T T C A T T C T C T A A A C T T C A A G A A T G C T C A T G C T C C G T T C T C C A T T T T C T G A T T C A A A T G T T C T C G A T C H F L O E I T G S V O F P Y W R N A O H N S F N F S D N I G E B C L I 1 4 6 0 1 4 8 0 1SO0 1 5 2 0 1 5 4 0 1 5 6 0 A T T T C T T G G A T G A A A T C A C T G G A T C T G T T C A A T T T C C A T A T T G G A G A A A T G C T G A T C A C A A C T C A T T C A A T T T T T C C G A C A A T A T T G G A G A G G T A A G A A A A T A A T C T C T T T T T C A A T T G T I V N D E S K F S V Q L O V S H F K P E O L K I E L D G R E L BGLI I 1 5 8 0 16O0 1 6 2 0 1 6 4 0 1 6 6 0 1 6 8 0 TTATTTQTCAAATQTTTTATTTTTCAQATTQTAAATQACQAATCTAAATTCTCTGTTCAACTCGATGTTTCTCATTTCAAACCAGAAGATCTTAAAATTQAATTGGATGGAAGAGiAACTA K I E G I O E K K S E H G V S K R S F S K M I L L P E O V O L T S V K S A I S N E C O R I 1 7 0 0 1 7 2 0 1 7 4 0 1 7 6 0 1 7 8 0 1 8 0 O A A A A T T G A A G G A A T T C A A G A A A A A A A A T C A G A G C A T G Q A T A C T C G A A A C G A T C A T T T T C A A A A A T G A T T C T T C T A C C A G A A Q A T G T T G A T T T A A C T T C T O T C A A A T C T G C A A T T T C G A A T E G K L O I E A P K K T N S S R S I P I N F V A K H * 1 8 2 0 1 8 4 0 1 8 6 0 1 8 8 0 19O0 1 9 2 0 G A A G G A A A A C T T C A A A T T Q A G G C T C C A A A Q A A G A C T A A C T C A T C T C Q T T C T A T T C C C A T T A A T T . T T G T T G C A A A A C A T T A A T C T T T T A T T G T A T T C C A A A T A T T C T T A A T T T ( 3 A A TAA~A)S p o l y A site • 1 9 4 0 1 9 6 0 1 9 8 0 2 0 0 0 I 2 0 2 0 2 0 4 0 T C A T T A A T T T A A T T T A T T C A T G T T C T C T A G C A T A A C A A A A A C A T C A A A T C C G A C T T T C C A A T T C A A A T A T T T C A A A A C A A C A T A A I T T G A A G T T A T T C C A G A A A C T T T T T A T G C A A A A A A T I R » 1 206O 2080 2 tOO 2120 2140 2160 T T A T T A G T C T C A A T A A A T G T T T T A O C T T G A A T T T A T G C T T A A A A C A A A A A A C A T A A A A A A T G T T T T A A A A A A A T T A C A G T G C Q T G C A A C T T C T A C C A G G G C C C T C A T A A A A T A G G T T C T T DOE I B C L I 2180 2200 2220 2240 2260 2280 CAAGAOAAAAATCAOAAAATATTTTAAOCTACCAOCTACTTCGGCTTCTCJJ0AAAACTCCTGCGAC7T0ATAAAAACACTTAAAAACTGTCAAAAGCTGTTA7AAAMTGCAOTTGATjCi 96 2 3 C O 3 3 3 0 3 3 4 0 3 3 6 0 3 3 S O 3 4 0 0 ACACAGTTGTGAGCGAAATTAAGCTOAAAAACTQAATTTTGAAAAAQTTGCAAAAQTCGTTTGAAACGATGCAGGAATTTTTATAGCTAAACGTTTAACGGTTGGTAAAACGTAGCATGA 3 4 3 0 I 3 4 4 0 3 4 6 0 3 4 B O 2 5 0 0 2 5 2 0 QTATGCTQTAAAQTTGAQCCG|rTATGTTGTTTTGAAATATTTOAATTGGAAAGTCGGATTTGATGTTTTTGTTATGCTAGAGAACATGAATAAATTAAATTAATGAC|rTT ATT^SAAATTA 1 H R 3 3 4 0 3 5 6 0 3 5 8 0 3 6 0 0 3 6 3 0 3 6 4 0 AGAATATTTGGAATACAATAAAAGATTAATGTTTTGCAACAAAATTAATGGGAATAGAACGAGATGAGTTAGTCTTCTTTGGAGCCTCAATTTGAAGTTTTCCTTCATTCGAAATTGCAG E C O R I 3 6 6 0 3 6 8 0 3 7 0 0 3 7 3 0 3 7 4 0 3 7 6 0 ATTTGACAGAAGTTAAATCAACATCTTCTGGTAGAAGAATCATTTTTGAAAATGATCGTTTCGAGTATCCATGCTCTGATTTTTTTTCTTGAATTCCTTCAATTTTTAGTTCTCTTCCAT BGLII 3 7 8 0 3 8 0 0 3 8 3 0 3 8 4 0 2 8 6 0 2 8 8 0 CCAATTCAATTTTAAGATCTTCTGGTTTGAAATGAGAAACATCGAGTTGAACAGAGAATTTAGATTCGTCATTTACAATCTGAAAAATAAAACATTTGACAAATAAACAATTGAAAAAGA BCLI 2 9 O 0 2 9 3 0 2 9 4 0 2 9 6 0 2 9 8 0 3 0 O 0 GATTATTTTCTTACCTCTCCAATATTGTCGGAAAAATTGAATGAGTTGTGATCAGCATTTCTCCAATATGGAAATTGAACAGATCCAGTGATTTCATCCAAGAAATGATCGAGAACATTT PSTI 3 O 3 0 3 O 4 0 3 0 6 0 3 0 8 0 3 1 0 0 3 1 3 0 Q A A T C A G A A A A T G G A G A A C G G A G C A T G A G C A T . T C T T G A A G T T T A G A G A A T G A A C A G T A A G C A C T T G A A C A A A G T Q T A T T G G T T T C C T C T G A A C A C G A T T G G C | T T A T A T A ) C C C G T A T C C T G X 8 A 1 HSP16-48 R S A I 3 1 4 0 . 3 1 6 0 3 1 8 0 3 2 0 0 3 3 3 0 3 2 4 0 C A G C C G T T T A G A A T G T T O * T " A G A A G G T C C T ' A G A T G C A T T C A T T T C A A A A T A C A C C C C A T A G G T G C A A A G A G A C G C A G A T T G A A A A A G T A T C T G G G T T T C T T C A G T A C G C A C A C T A T T T C T C * H , P XBAI * Z 3260 3280 3300 3320 33fO 3360 AATGTTCTGAATGTGAGTCGCCCTCCTTTTGCAAGAAGCAGCTCGAATGTTCTAGAAAAAGGTGGAAATGAG|rATAAA|rACAGTGACAAAACCGAACCAAACAACATTCACTCTAATTGT ^ H l p M R O M A O M E R O F T P V C HSP16 —1 — " " " ^ ^ M 5 L » M Y F « P * 0 » » V F Q V L DOEI 3380 340O 3430 3440 3460 3480 GAAATCTTCAAACTACAATCATGTCACTTTACCACTATTTCCGTCCAGCTCAACGTTCTGTTTTTGG TGATCTCATGAGAGATATGGCTCAGATGGAACGTCAATTTACTCCAGTTTGC R G S P S E S S E I V N N D Q K - F A I N L . N V ODEI BCLI 35O0 3520 3540 3560^, ^ _ 3580 3600 AGAGGCTCTCCATCTGAATCTTCTGAGGTAAGTAACACATTTTTTTTTCAAGAGTTTGTATAAAAAAGATTTCTTTCAGATTGTTAACAATGATCAAAAGTTTGCCATAAATCTCAATGT S O F K P E D L K I N L O G H T L S I Q G E Q E L K T E H G Y S K K S F S R V I 3620 3640 3660 3680 3700 3720 CTCGCAGTTCAAGCCAGAAGATTTGAAAATTAATTTGGATGGACATACATTATCAATTCAAGGAGAACAAGAATTAAAGACTGAACATGGATATTCAAAGAAATCATTTTCTCGTGTTAT L L P E O V O V G A V A S N L S E O G K L S I E A P K K E A I O G R S I P I O O BGLII 3740 3760 3780 3800 3820 3840 TCTTCTACCCGAAGATGTTGATGTTGGTGCAGTTGCTTCAAATCTTTCAGAAGATGGAAAACTTTCAATTGAAGCACCAAAGAAGGAAGCGATTCAAGGAAGATCTATTCCAATTCAGCA AGCGCCCQTTGAACAAAAAACTTCTGAATAATTATTGTAATTTTATGATTTTTTTGAACTATGCATGTAATTACTATAAATTCCAGTATTCTGTTTCJAAT A AAA|TTTAAAAATAAT ATGA RSAI 3 9 8 0 4 0 O 0 4 0 2 0 4 0 4 0 4 0 6 0 4 0 8 0 ATTTGTGATATTTTTTGAAAGTTAGTAATAAATATGTAAATGCCGGCAATGTACTTCTTGCATAATGCCTATTTTTGGGTATTGCACAGCCCCTCCCATCCTAACACATTCTGCATTCGT SAC 11 BAMHI 4 1 0 0 4 1 2 0 4 1 4 0 4 1 6 0 4 1 8 0 4 2 0 0 CCGCGGAACCCGCCAGATGTCATGCTATACAACACCCTTACCCTCTCTTACCGCCACTTCTTAAACTTACCTGGCTGGGGGTTATCTCGCGATCATGAAGGCGGGATCCCCATGGTGAGG XHOI 4 2 2 0 4 2 4 0 4 2 6 0 4 2 8 0 I 4 3 0 0 CCTATCCATTGCACTTTTGGATGGGCTGACCTGTGTGGCAGTCTCGAGTTGAGATTCGCCAACAGCTTAATTTTTGCGTATC?GGGGCTGCGTGCGCGCGGCCCTGAAAAATATA TTAATA RSAI GC Boundary Sequence 4 3 3 5 4 3 5 0 4 3 6 5 4 3 8 0 4 3 9 5 44 10 CTGTTTTCAATAGTAATTGGCATAACGAATCAGTTTCAAGTAAAACGTACGTCA ATTTCAGTAGCAGAACGTTCAA ACAGTTTTCTATCTGATC 4 3 2 0 97 Table V. Amino Acid Compositions of Hspl6-1 and Hspl6-48 No. of residues  Amino Acid h s p l 6 - l hspl6-48 Ala 8 4 Arg 7 5 Asn 6 9 Asp 7 11 Cys 1 0 Gin 11 4 Glu 13 12 Gly 8 6 His 3 5 H e 9 11 Leu 11 12 Lys 10 13 Met 4 3 Phe - 6 9 Pro 8 6 Ser 16 19 Thr 4 3 Trp 0 1 Tyr 4 2 Va l 9 8 98 The other gene codes f o r a protein of 145 amino acid residues with a calculated molecular weight of 16,301. To determine whether t h i s gene i s transcribed under heat shock conditions, a 0.9 kb BamHI-Xbal fragment containing the gene f o r h s p l 6 - l (Figure 12A) was used to probe dot b l o t s of polyA +RNA p u r i f i e d from control and heat shocked nematodes. The re s u l t s of t h i s experiment are shown i n Figure 15. Transcripts s p e c i f i c to the hsp!6-l gene were abundant i n mRNA i s o l a t e d from heat shocked nematodes but were not detectable i n normally growing nematodes. This i s s i m i l a r to the high i n d u c i b i l i t y demonstrated for mRNA sequences complementary to CEHS48 and CEHS41 (Figure 8). Thus, two d i s t i n c t , heat inducible genn3 havo boon i d e n t i f i e d i n t h i s region, and t h i s gene p a i r hau been duplicated to form an inverted repeat. Hspl6-1 shows extensive homology with hsp!6-48 and hsp!6-41. and the three predicted amino acid sequences have been aligned i n Figure 16. The NH^-terminal regions of hspl6-48 and h s p l 6 - l are completely d i f f e r e n t . I t i s evident that t h i s divergent region defines an exon at the l e v e l of gene organization (section 3.9). The rest of the polypeptide chain which defines the second exon, i s very s i m i l a r among the three C. elegans hsps, 55 of 98 positio n s being i d e n t i c a l . This homologous region contains the approximately 80 amino acid domain that shows homology to the shsps of Drosophila melanogaster and to the a - c r y s t a l l i n proteins. In t h i s domain the same amino acid i s used by at least four of the f i v e proteins i n 32 of 80 p o s i t i o n s . Also shown are the 20 positions that are conserved between the proteins shown and the shsps of Drosophila. 99 Figure 15. RNA dot-blot analysis using a probe s p e c i f i c f o r the hsp!6-l gene. 0.5 yg of polyA RNA p u r i f i e d from control or heat shocked worms was applied to n i t r o c e l l u l o s e before baking and h y b r i d i z i n g . A 0.9 kb BamHI-Xbal fragment containing a hsp!6-l gene was used as the probe. 100a Figure 16. Comparison of the deduced amino acid sequences of three shsps of C. elegans, the mouse a A ^ - c r y s t a l l i n chain, and the bovine a B ^ - c r y s t a l l i n chain. The proteins have been aligned to demonstrate sequence homology and to emphasize the s i m i l a r locations of introns. The lo c a t i o n of the intron i n the hsp!6-41 gene i s taken from Jones et a l . (1986). Most of the mouse a A ^ c r y s t a l l i n amino acid sequence i s taken from King et a l . (1982), and the NH 2-terminal portion and the loc a t i o n of the two introns are taken from King and Piatigorsky (1983). The protein sequence of bovine a B ^ c r y s t a l l i n was included to i l l u s t r a t e the r e l a t i o n s h i p between the two a - c r y s t a l l i n classes and i s taken from van der Ouderaa et a l . (1973). I t i s not known at t h i s time whether the bovine a B 2 ~ c r y s t a l l i n gene contains introns, although the hamster a B 2 ~ c r y s t a l l i n gene has maintained the exon/intron organization shown by the murine <*A 2-crystallin gene (see section 3.9). Brackets show the borders of the 74 amino acid region which was used i n Figure 11. Positions of homology i n which the same amino acid i s shared by at least four of the f i v e proteins are boxed. S o l i d c i r c l e s indicate positions that have been conserved between these f i v e proteins and the shsps of D. melanogaster. H $ P 1 6 - 4 1 H S P 1 6 - 4 8 H 5 P 1 6 - 1 a l p h a • A 2 m o u s e ) W 0 V a l p h a • B 2 b o v i n e ) © 0 I T G S V 0 F P Y w R N A 0 L M P. 0 M A 0 M E R 0 F T T I s p Y Y - P. 0 - s L F S I s p F Y L R P P s F L • • P E M L K I K L 0 G R E L P E D L It I E L D G R E L P E D I K I H L D G H T L P 0 0 L T V K V L E 0 F V P E E L K V K V L _G_ D V I • • • • • P 5 V K s A I S N E G K L T S V K s A I s N E G K I G A V A s N L s E 0 G K L S A L S c 5 L s A D G M L L A I T s S L s S 0 G V L T I 0 H P W F K R A L G A I H H P U I R R P F F H N S F H F S 0 H r G E P V c R G S P S E s S E R - - T V L 0 S G i S E R A p S W I 0 T G L S E • • K I E G I Q E T X S - N o K I E G I 0 E K K s - N o S I 0 G E Q E L K I - M o E I H G K H N E R 0 - 2 n E _y_ H _G_ K H _E_ E R Q - I n • 0 I E A P K K T N s S R Q i E A P K K T N s S R S i E A P K K E A I QG R T F S G P K V Q S G L D T V 0 G P R K Q •- - - -® L M L R S P F ® S L Y P F - Y P S R L F D 0 F F G E P F H S P S R L 1 F 0 0 F F G E ! - 5 8 b p I n t r o n i I V N 0 E - 5 5 b p I n t r o n - I V II 0 E - 5 2 b p I n t r o n - I V N N 0 - 1 3 7 6 b p I n t r o n - V R S 0 R - I n t r o n ? - M R L E K • • I n t r o n j - - E H G Y L K R 5 I n t r o n - - E H G Y S K R S I n t r o n - - E H G Y s K K S d I n t r o n - 0 0 H G Y I S R E t r o n 7 - D E H G F I S _R_ E S I P I N F V A K H S I P I N F V A K H S I P I 0 0 A P V E 0 K T S E A G H S E R A I P V S R E E K A S G P E R T I P I T R E E K S D S N V L 0 H F L D E I H Y R F P A q R S V F G Y G L F E Y 0 i L P F L S S H L L E S D F L P - A s T • • • • • S K F S V 0 T D V S H F K s K F s V 0 L D V s H F K Q K F A I N L H V 5 0 F K D K F V I K I D V K H F s 0 R F S V H -L H V K H F 5 • • F S K M I I L P E 0 A 0 L F S K M I L I P E D V 0 L F S R V I L L P E D V D V F H R R Y R L P S N V 0 0 F H R K Y R I P A D V D P P - - S S A P S S P A V T A A P K K 101 3.9 The shsp Genes of C. elegans Contain a Single Intron Comparison of the hsp!6-48 gene with the CEHS48 cDNA revealed a short intron of 55 bp which divided the coding region into two exons. The h s p l 6 - l gene had a corresponding intron of 52 bp. The exon-intron boundary sequences match well with the consensus sequence described by Mount (1982). The lack of long pyrimidine t r a c t s preceding the 3' s p l i c e junction i s common to other C. elegans introns (Spieth et a l . , 1985) and may simply be a consequence of s i z e r e s t r a i n t s , the average intron being approximately 50 bp. The homology between the shsps of C. elegans and vertebrate a - c r y n t a l l i n was also r e f l e c t e d i n t h e i r gene organization. The p o s i t i o n of the intron i n the nematode heat shock genes was p r e c i s e l y analogous to the p o s i t i o n of the f i r s t intron i n the a A ^ - c r y s t a l l i n genes of mouse (King and Piatigorsky, 1983) and hamster (van den Heuvel et a l . , 1985) or the hamster a B ^ - c r y s t a l l i n gene (Quax-Jeuken et a l . , 1985). The a A ^ - c r y s t a l l i n genes contain within t h e i r f i r s t intron a 23 amino acid i n s e r t i o n sequence which i s expressed i n 10% of the messages due to a l t e r n a t i v e s p l i c i n g . I nterestingly, a l l of the c r y s t a l l i n genes mentioned above contain a second intron, not found i n the hsp genes, which interrupts the conserved domain. Introns have not been found i n the related shsp genes from Drosophila (Ingolia and Craig, 1982b; Southgate et a l . , 1983; Ayme and T i s s i e r e s , 1985), Xenopus (Bienz, 1984b) or soybean (see Table I ) . On the other hand, the functional gene coding f o r human hsp25 contains two introns (Hickey et a l . , 1986). Although human hsp25 shows more s i m i l a r i t y to the a - c r y s t a l l i n s than to any other shsps, the locations of the two introns have not been conserved. In the Caenorhabditis hsp!6 genes and the vertebrate a - c r y s t a l l i n genes, the f i r s t s p l i c e junction precedes the 102 region which shows the greatest homology between the shsps and the o - c r y s t a l l i n s . In the human hsp gene, the second exon corresponds to the hig h l y hydrophilic region of 23 amino acids which i s found within the larger 80 amino acid conserved domain. 3.10 Location of the Starts of Transcription The hsp!6-l and hsp!6-48 genes are clustered within a r e l a t i v e l y short region of DNA. Furthermore, they are transcribed i n opposite d i r e c t i o n s , with the r e s u l t that only 34 7 bp separate t h e i r respective ATG i n i t i a t i o n codons. Therefore, i t ia l i k e l y that a l l signals required f o r accurate heat inducible t r a n s c r i p t i o n w i l l be located i n t h i s region. SI nuclease protection wxpariments (Figure 17) suggested that the t r a n s c r i p t s began with adenine residues located at positions -42 and -51 f o r the hsp!6-l and hsp!6-48 genes, respectively ( r e l a t i v e to t h e i r ATG i n i t i a t i o n codons). In Figure 17, the 5' flanking sequences of the two genes have been aligned to compare the regions upstream from the putative t r a n s c r i p t i o n s t a r t s . In both genes there i s a Goldberg-Hogness or TATA box (M.L. Goldberg, Ph.D. t h e s i s , Stanford University, Stanford, CA, 1979), the f i r s t thymine of which f e l l exactly 26 bp from the t r a n s c r i p t i o n s t a r t . Approximately 30 bp further upstream were found excellent matches to the consensus sequence CT-GAA—TTC-AG, which was derived by comparing the 5' flanking regions of the D. melanogaster heat shock genes (Pelham, 1982). A synthetic promoter containing t h i s sequence has been shown to confer heat i n d u c i b i l i t y on non-heat inducible genes such as the Herpes simplex virus thymidine kinase gene (Pelham and Bienz, 1982). The hsp!6-48 gene contained 103a Figure 17. SI nuclease protection analysis of t r a n s c r i p t i o n s t a r t s i t e s of the hsp!6-48 and hsp!6-l genes, and comparison of the 5' flanking regions. (A) SI nuclease mapping. S p e c i f i c 5'-end-labelled double-stranded DNA fragments were allowed to anneal to heat shock poly(A) +RNA under the hyb r i d i z a t i o n conditions described. SI nuclease-resistant fragments were separated on denaturing polyacrylamide gels along with the Maxam and G i l b e r t cleavage reactions of the same end-labelled fragment. RNA-, Control lanes i n which the DNA fragment was taken through the same hybridization and SI digestion reactions i n the absence of mRNA. (B) The 5' flanking sequences of both small heat shock genes were aligned to show the re l a t i o n s h i p between the t r a n s c r i p t i o n s t a r t s (arrows), the TATA boxes, and the HIPs. For each gene, the A i n the f i r s t ATG a f t e r the mRNA s t a r t i s numbered +• 1. This numbering has also been used to designate the r e s t r i c t i o n fragments which were used i n the SI mapping experiments (section 2.3.3). The HIP elements have been underlined to demonstrate t h e i r palindromic nature, s o l i d v e r t i c a l l i n e s representing the dyad axis. The hsp!6-48 gene has two overlapping HIP elements, the second indicated with dots. The dashed v e r t i c a l l i n e shows the ce n t r a l axis of a large 22 bp palindrome with only three mismatches. 103 HSP 16-1 GC it G A T C \ HSP16-48 \ B H S P 1 6 - 1 G C C C T C C T T T T G C A A G A A G C A G C T C G A A T H S P 1 6 - 4 B A A A T G A A T G C A T C T A G G A c | c f T C T A | G A A C - 1 3 0 - 1 1 0 1 G T T C T A G A A A A A G G T G G A A T T C T A A A C G G C T G C A G G - 90 - 6 0 T - 4 0 A A T G A G T A T A A A T A C A G T G A C A A A A C C G A A C C A A A C A A C A T T C A C T C A T A C G G G T A T A T A A G C C A A T C G T G T T C A G A 6 G A A A C C A A T A C A C T T T -20 -1 A A T T G T G A A A T C T T C A A A C T A C A A T C A T G T C A C T T T A C C A C T A T T T T T C A A G T G C T T A C T G T T C A T T C T C T A A A C T T C A A G A A T G - 3 0 - 1 0 - 1 104 two of these heat inducible promoters (HIPs), which overlapped each other to form a 22 bp inverted repeat with only three mismatches (Figure 17). Only 128 bp separated the HIP sequences of the hsp!6-l and hsp!6-48 genes. Within t h i s region i s a 10 bp st r e t c h of alte r n a t i n g purine-pyrimidine residues overlapping the Rsal s i t e (Figure 14). Such sequences can p o t e n t i a l l y adopt a left-handed Z-DNA conformation (Arnott et a l . . 1980), and have been implicated i n the regulation of t r a n s c r i p t i o n of simian virus 40 as well as other DNA viruses and retroviruses (Nordheim and Rich, 1983). Adjacent to t h i s region was a 35 bp palindromic structure with the p o t e n t i a l to form a stem-loop structure. This structure would contain a 12 bp stem with 2 mismatches and an 11 bp Loopnd-out region. This region i s also shown i n Figure 27 and w i l l be discussed in more d e t a i l i n section 4.4. The leaders of the hsp!6-l and hsp!6-48 t r a n s c r i p t s were 42 and 51 nucleotides respectively, the differences i n length being due to insertions/deletions (see also Figure 26, section 4.4). When aligned to compensate f o r these events, the leaders show a substantial degree of s i m i l a r i t y , the sequences of which may be conserved to maintain s e l e c t i v e t r a n s l a t i o n at higher temperature. 3.11 The 3* Flanking Regions The polyadenylation s i g n a l AATAAA i s found i n the 3' noncoding region of both the hsp!6-l and hsp!6-48 genes (Figure 14). In the hsp!6-48 gene i t was found 33 bp downstream from the TAA termination codon . Sequence analysis of the cDNA placed the polyadenylation s i t e 12 nucleotide downstream of the signal (Figure 10), and 74 bp before the end of the 105 inverted repeat. The predicted length of the hsp!6-48 t r a n s c r i p t was 533 nucleotides a f t e r s p l i c i n g and processing have been completed, not including the poly(A) t a i l . The hsp!6-l gene contains two polyadenylation signals, one beginning at p o s i t i o n 3937 and the second at p o s i t i o n 3987 of Figure 14. Although a cDNA corresponding to hsp!6-l was not i d e n t i f i e d , SI nuclease mapping data suggests that the proximal one i s functional i n nematodes (Rob Kay, personal communication), the s i t e of polyadenylation occurring at p o s i t i o n 3961. This r e s u l t s i n a 3' untranslated region of 90 nucleotides and a s p l i c e d t r a n s c r i p t with a predicted length of 570 nucleotides. 3.12 Organization of Inverted Repeats i n the Region Containing Genes Hspl6-l/48 Unusual sequences were found at the d i s t a l boundaries of the 1.9 kb inverted repeat. This G + C-rich boundary sequence (Figure 14) i s characterized by a s t r e t c h of 12 al t e r n a t i n g purine-pyrimidine residues, flanked on either side by a G + C hexanucleotide i n an inverted repeat o r i e n t a t i o n . The single nucleotide difference between the two arms of the 1.9 kb inverted repeat was found i n t h i s boundary sequence. I t f a l l s on one of the flanking hexanucleotides, where a cytosine i s changed to a thymine. Further sequence analysis of 3.3R revealed the presence of another 370 bp inverted repeat which overlaps the one containing the heat shock genes. Its organization i s shown i n Figure 18. Unlike the larger one, t h i s inverted repeat was not perfect, having diverged by approximately 4%. Its r i g h t arm, however, contained a G + C - r i c h boundary sequence which shared perfect homology to i t s counterpart. In the smaller inverted repeat, the boundary 106a Figure 18. Organization of inverted repeats and G + C-rich boundary sequences i n locus hsp16-1/48. A) R e s t r i c t i o n map of the 7.6 kb region consisting of 3.3L, 3.3R, and the 1.0 kb EcoRI fragment. The l o c a t i o n of the 1.9 kb inverted repeat containing the heat shock genes and the overlapping 370 bp inverted repeat are indicated by open boxes. The two variant forms of the G + C-rich boundary sequences are shown at the borders of the inverted repeats by heavy l i n e s . Also shown, above the r e s t r i c t i o n map, are the regions which were analyzed f or RNA t r a n s c r i p t i o n . B) Strategy used to determine the DNA sequence of the 0.9 kb EcoRI-Sall fragment. C) Detailed map of the 370 bp inverted repeat structure showing the palindromic boundary sequences, the strategy used to sequence the r i g h t arm, and the locations of the Rsal and Hpall r e s t r i c t i o n s i t e s within the loop region which were used to disrupt the foldback structure. B) and C) A l l sequencing was done using M13 single-stranded phage, the d i r e c t i o n and extent of the sequence obtained from each r e s t r i c t i o n s i t e shown with arrows. A l l of the unlabelled r e s t r i c t i o n s i t e s are Sau3A s i t e s . 1.0 lb Sol-Bom 3.3 L 1.0 3.3R 1.0 lb Bam- Eco Xba Xbo Sol S i l l XholBam SnE Bal l Bel Xba It'll Bel BglEEco Das Bel ; Eco BglOcI Pit I Xba Bel Ba l l S i l l Bom x h o l XhoXBom SilH H h i a q Taq | 1.9 kb loTt 1.9kb,- ' r ight n. n. o OS Hpal l S i l l Bom X h o l Ria rl 1 -+ 1 h-HpoE Xhol Bom SnE H p o l 370 bp left 370 bp right' 107 sequences were located on the proximal borders, being separated by approximately 500 bp of unique sequence. The d i s t a l boundaries were characterized by a complete divergence of sequence, the l e f t one i n t e r e s t i n g l y located p r e c i s e l y at the functional polyadenylation signal of the hsp!6-l gene i n the r i g h t arm of the 1.9 kb inverted repeat. Since the boundary sequences of the larger inverted repeat p r e c i s e l y defined a locus of t r a n s c r i p t i o n a l a c t i v i t y , an e f f o r t was made to locate any genes that may have been to the r i g h t of the smaller inverted repeat. Northern bl o t analysis showed that there were no detectable messages i n t- + . control polyA , control polyA , or heat shock polyA RNA using as a probe the 3.3R-derived 1.0 kb BamHI-KcoRI fragment (not shown). Similar negative r e s u l t s were obtained using the 1.0 kb BamHI-Sall fragment of 3.3L which flanks the large inverted repeat on the other side. The locations of both of these probes are shown i n Figure 18. Thus i t would appear that there are no transcribed regions immediately adjacent to the inverted repeats of locus hsp!6-l/48 unless the t r a n s c r i p t s accumulate to le v e l s below the l i m i t s of detection. Furthermore, the completed sequence of the 0.9 kb EcoRI-Sail segment i n 3.3L (Figure 18) contained no open reading frames of substantial length i n e i t h e r d i r e c t i o n . To examine the frequency of occurrence of the boundary sequences i n the C. elegans genome, oligodeoxynucleotides s p e c i f i c f o r the two variant forms were used as probes. These oligodeoxynucleotides included the al t e r n a t i n g purine/pyrimidine stretch but contained only one of the hexanucleotide repeats to avoid self-complementarity. The single base difference between the two oligodeoxynucleotides i s located i n t h i s hexanucleotide. The r e s u l t s , using variant I as probe, are shown i n Figure 19. Under conditions 1 0 8 n N M ^ 1 1 S G 00 CD L U F i g u r e 1 9 . A n a l y s i s o f G + C - r i c h b o u n d a r y s e q u e n c e s i n v a r i o u s r e c o m b i n a n t p h a g e a n d B r i s t o l g e n o m i c DNA. A p p r o x i m a t e l y 2 . 0 y g o f B r i s t o l g e n o m i c D N A ( G ) a n d 0.5 y g o f DNA f r o m t h e i n d i c a t e d p h a g e w e r e d i g e s t e d w i t h E c o R I , t r a n s f e r r e d t o n i t r o c e l l u l o s e a f t e r a g a r o s e g e l e l e c t r o p h o r e s i s a n d h y b r i d i z e d t o o l i g o d e o x y n u c l e o t i d e v a r i a n t I . T h e m a r k e r s a r e a H i n d l l l d i g e s t o f l a m b d a DNA. P h a g e c l o n e s B - 3 a n d B-7 c o n t a i n t h e l e f t a n d r i g h t a r m s o f t h e 3.3 k b i n v e r t e d r e p e a t s t r u c t u r e , r e s p e c t i v e l y . C l o n e B-7 i n c l u d e s a l s o t h e o v e r l a p p i n g 3 7 0 b p i n v e r t e d r e p e a t s t r u c t u r e . P h a g e E M B L 4 - 1 0 c o n t a i n s DNA r e p r e s e n t i n g t h e h s p ! 6 - 2 / 4 1 l o c u s i n w h i c h t h e h s p ! 6 g e n e s a r e n o t d u p l i c a t e d . 109 i n which only 3.3L from phage \Charon4 B-3 (Figure 12) hybridized to the oligodeoxynucleotide s p e c i f i c to the boundary sequence i n that fragment, genomic B r i s t o l DNA digested with EcoRI gave a heterodisperse series of bands which indicates that such sequences are abundant i n the nematode genome. The s i g n a l was not abolished at washing temperatures as high as 53°C i n 6 X SSPE. This oligodeoxynucleotide, s u r p r i s i n g l y , did not hybridize to 3.3R from phage \Charon4 B-7 which contains at l e a s t two copies of the variant form. To ensure that the lack of h y b r i d i z a t i o n was not due to the s i n g l e base p a i r mismatch, an oligodeoxynucleotide s p e c i f i c for the boundary sequences found i n 3.3R was used as a probe (variant I I ) . Identical r e s u l t s to those shown i n Figure 19 were obtained even at low washing temperatures of 43°C. Considering the d i f f i c u l t i e s encountered in the genomic DNA analysis of the 1.9 kb inverted repeat, i t was possible that the lack of h y b r i d i z a t i o n to 3.3R was once again a r e s u l t of the formation of foldback structures derived from the smaller 370 bp inverted repeat. To examine t h i s p o s s i b i l i t y , the inverted repeat of 3.3R was disrupted with various r e s t r i c t i o n enzymes and probed again with the oligodeoxynucleotide. As shown i n Figure 20, there i s r e l a t i v e l y l i t t l e h y b r i d i z a t i o n to the 3.3R EcoRI fragment or the derived 700 bp BamHI fragment i n which the inverted repeat structure i s maintained. Digestion of the same amount of DNA with e i t h e r Hpall or Rsal r e s u l t s i n strong h y b r i d i z a t i o n to two fragments of 700 bp and 350 bp which contain the boundary sequence. Neither oligodeoxynucleotide hybridized to any EcoRI fragments derived from XEMBL4-10, the recombinant phage which contains a p a i r of related hsp16 genes (Jones et a l . , 1986). Although t h i s suggests that sequences 1 1 0 F i g u r e 2 0 . D e t e c t i o n o f b o u n d a r y s e q u e n c e s i n 3 . 3 R b y d i s r u p t i o n o f t h e 3 7 0 b p i n v e r t e d r e p e a t . A p p r o x i m a t e l y 0.5 u g o f a r e c o m b i n a n t p U C 1 3 p l a s m i d c o n t a i n i n g t h e 3 . 3 R E c o R I f r a g m e n t w a s d i g e s t e d w i t h t h e r e s t r i c t i o n e n z y m e s i n d i c a t e d . A f t e r e l e c t r o p h o r e s i s a n d S o u t h e r n t r a n s f e r , t h e DNA w a s h y b r i d i z e d t o o l i g o d e o x y n u c l e o t i d e v a r i a n t I I . T h e m a r k e r s a r e a H i n d l l l d i g e s t o f l a m b d a DNA. I l l homologous to the boundary sequences at locus hsp!6-l/48 may not be associated with the other heat shock gene locus, i t i s possible that t h e i r a ssociation with foldback structures dic t a t e s a more rigorous analysis with d i f f e r e n t r e s t r i c t i o n enzymes. In summary, G + C-rich sequences s i m i l a r or i d e n t i c a l to the boundary sequences described here are abundant i n the nematode genome. Their association with inverted repeat structures i n the present instance i s i n t e r e s t i n g but whether they can be generally correlated with other regions of s i m i l a r structure remains to be seen. 3.13 D i f f e r e n t i a l Expression of Hspl6 Genes i n C. elegans A p a i r of related hsp!6 genes i n C. elegans has been characterized by sequencing (Jones et a l . , 1986). The two genes are arranged in divergent orientations s i m i l a r to the hsp!6-48 and hsp!6-l genes. The two genes are designated hsp!6-2 and hsp!6-41, the l a t t e r corresponding to the cDNA CEHS41, and both are highly expressed during heat shock. The gene p a i r at locus hsp!6-2/41 i s not duplicated to form an inverted repeat but i s flanked by r e p e t i t i v e elements. To determine the r e l a t i v e l e v e l s of t r a n s c r i p t i o n from the four hsp!6 genes, M13 probes were used that showed minimal cross-hybridization between homologous genes. Probes corresponding to the second exons were avoided since the carboxy-terminal halves of the hsp!6-48 and hsp!6-41 genes, represented by t h e i r respective cDNAs, cross-hybridize strongly. Thus probes corresponding to e i t h e r the 3' untranslated regions (genes 1 and 2) or exon 1 (genes 48 and 41) were used. These M13 clones are l i s t e d i n the legend to Figure 21. The s p e c i f i c i t i e s of these probes were v e r i f i e d by hybridizing them to Southern transfers containing EcoRI digests 1 1 2 cn 2 i ! CO "J © en "~ i 1 CO o © tn y- co «-I I i i CO 1 CO t • t « » 1 - 3 . 3 - 2 . 2 2 1 41 48 F i g u r e 2 1 . D e t e r m i n a t i o n o f t h e s p e c i f i c i t y o f v a r i o u s p r o b e s u s e d i n t h e mRNA e x p r e s s i o n s t u d i e s . A p p r o x i m a t e l y 5 0 0 n g o f E c o R I - d i g e s t e d \ C h a r o n 4 B - 3 a n d X E M B L 4 - 1 0 p h a g e DNA w a s s e p a r a t e d o n a g a r o s e g e l s , t r a n s f e r r e d t o n i t r o c e l l u l o s e a n d h y b r i d i z e d t o p r o b e s d e r i v e d f r o m t h e h s p ! 6 g e n e s w h i c h a r e i n d i c a t e d . T h e p r o b e s w e r e d e r i v e d f r o m M13 t e m p l a t e s b y p r i m e r e x t e n s i o n a n d i n c l u d e t h e f o l l o w i n g s e q u e n c e s : 1 6 - 1 , S a u 3 A ( 2 5 3 ) - B g l H ( 6 0 1 ) ; 1 6 - 4 8 , B g l H ( 1 6 4 7 ) -B e l l ( 1 4 9 4 ) ; 1 6 - 2 , T a g I ( 1 9 7 4 ) - T a g I ( 1 9 1 0 ) ; 1 6 - 4 1 , T a g I ( 9 3 3 ) - T a g I ( 1 1 6 9 ) . F o r t h e h s p ! 6 - l g e n e a n d h s p ! 6 - 4 8 g e n e p r o b e s , t h e n u m b e r i n g i s t a k e n f r o m F i g u r e 14 w h i l e t h e n u m b e r i n g f o r t h e h s p ! 6 - 2 a n d h s p ! 6 - 4 1 g e n e p r o b e s i s t a k e n f r o m J o n e s e t a l . ( 1 9 8 6 ) . P h a g e \ C h a r o n 4 B - 3 c o n t a i n s a 3 . 3 k b E c o R I f r a g m e n t w h i c h c o d e s f o r h s p l 6 - l / 4 8 w h i l e X E M B L 4 - 1 0 c o n t a i n s a 2 . 2 k b E c o R I f r a g m e n t w h i c h c o d e s f o r h s p l 6 - 2 / 4 1 . 2 x 1 0 ^ C e r e n k o v c o u n t s w e r e u s e d i n e a c h h y b r i d i z a t i o n . 113 of the phage \Charon4 B-3 and XEMBL4-10 which correspond to the 1/48 and 2/41 l o c i , respectively (Figure 21). This experiment also v e r i f i e d that the probes were of comparable s p e c i f i c a c t i v i t i e s . Of the four probes used, only the one selected f o r the hsp!6-41 gene showed some degree of cross-hybridization to both phage clones but as the mRNA expression data show, t h i s was of no consequence. When these probes were applied i n d i v i d u a l l y to Northern transfers of polyadenylated RNA from heat shocked and control nematodes, mRNA leve l s from the hsp!6-2/41 genes appeared to be 10 to 20 times higher than those from the genes hsp!6-48 and hsp!6-l (Figure 22). Since there are presumably two functional copies of the l a t t e r gene p a i r , the r e l a t i v e t r a n s c r i p t i o n l e v e l per gene at the hsp!6-2/41 locus i s approximately 20 - 40 times that of the hsp!6-l/48 locus. Also, these blots indicated that the polyadenylated hsp!6 tr a n s c r i p t s are between 600 and 700 nucleotides i n length, as expected. 3.14 Comparison of Locus Hspl6-l/48 i n Caenorhabditis elegans B r i s t o l and Bergerac Strains The re l a t e d strains B r i s t o l and Bergerac can interbreed and thus any r e s t r i c t i o n fragment length differences (RFLDs) can be used as genetic markers to determine linkage. This can be done by making use of Bristol-Bergerac hybrid populations homozygous f o r a singl e p a r t i c u l a r B r i s t o l or Bergerac chromosome, the remaining chromosomes being heterozygous (Rose et a l . , 1982). The two st r a i n s d i f f e r at t h e i r nucleotide l e v e l by approximately 1% (Emmons et a l . , 1979; Rose et a l . , 1982). The observed frequency of RFLDs (Rose et a l . , 1982) i s consistent with the occurrence of 1 1 4 H m H m H C m H C m F i g u r e 2 2 . N o r t h e r n b l o t a n a l y s i s o f h s p ! 6 mRNA l e v e l s u s i n g g e n e - s p e c i f i c p r o b e s . A p p r o x i m a t e l y 1.0 y g o f p o l y A + R N A f r o m e i t h e r c o n t r o l ( C ) o r h e a t s h o c k e d ( H ) w o r m s w a s s e p a r a t e d o n a 1 . 2 % a g a r o s e - f o r m a l d e h y d e d e n a t u r i n g g e l , t r a n s f e r r e d t o n i t r o c e l l u l o s e a n d h y b r i d i z e d t o t h e p r o b e s i n d i c a t e d . T h e m a r k e r s (m) a r e a H i n d l l l d i g e s t o f l a m b d a DNA. F r a g m e n t s w e r e e n d - l a b e l l e d b y t h e f i l l i n g - i n r e a c t i o n u s i n g K l e n o w p o l y m e r a s e a n d t r a n s f e r r e d a l o n g w i t h t h e R N A t o n i t r o c e l l u l o s e . 115 a base p a i r change per 120 bp or one i n s e r t i o n / d e l e t i o n rearrangement per 52,000 bp. In an attempt to determine the linkage of locus hsp!6-48/l. several p u r i f i e d EcoRI fragments derived from \Charon4 A - l or A-4 were used to probe f i l t e r s containing both B r i s t o l and Bergerac genomic DNA digested with EcoRI. No differences were seen i n the migration of hybridizing bands between the two s t r a i n s (Ann Rose, personal communication). However, only a t o t a l of approximately 16,000 bp was analyzed, which i s well below the average distance required to detect an i n s e r t i o n / d e l e t i o n event (Rose et a l . , 1982). Snutch and B a i l l i e (1984) have proposed that the high mutation rate (10% sequence divergence) associated with a C. elegans hsp70 gene i s due to i t s status as a highly inducible gene. This does not appear to be the case with the hsp!6 genes which are also highly inducible. A det a i l e d comparison of the 1.9 kb inverted repeat was also undertaken. B r i s t o l and Bergerac DNA was digested with 12 d i f f e r e n t r e s t r i c t i o n enzymes which cut within each arm of the perfect inverted repeat. As a r e s u l t 136 bp of DNA was analyzed for mutations. As seen i n Figure 23, no r e s t r i c t i o n fragment polymorphisms could be detected, emphasizing the sequence conservation between the two str a i n s within t h i s p a r t i c u l a r locus. The probe used i n t h i s set of experiments was the same as that used i n Figure 13C. Foldback structures were not seen i n these p a r t i c u l a r DNA preparations i n which i t could be shown that there was a much lower degree of nicking. Since these two s t r a i n s cannot be distinguished morphologically, the s p e c i f i c i t y of the B r i s t o l and Bergerac DNA was v e r i f i e d by probing n i t r o c e l l u l o s e f i l t e r s containing genomic DNA with the plasmid pCeh2 which 1 1 6 Bell Eco BglD Pst Sstn Bam Xhol N2 BO N2 BO N2 BO N2 BO N2 BO N2 BO N2 BO -4.0 '375 1.0-Hpctl Nrul Ncol Ddel Rsa N2 BO N2 BO N2 BO N2 BO N2 BO 3 ,r 2 . 7 -F i g u r e 2 3 . D e t a i l e d c o m p a r i s o n o f t h e 1.9 k b i n v e r t e d r e p e a t s t r u c t u r e i n t h e c l o s e l y r e l a t e d s t r a i n s B e r g e r a c a n d B r i s t o l . A p p r o x i m a t e l y 2 j i g o f B r i s t o l ( N 2 ) a n d B e r g e r a c ( B O ) g e n o m i c DNA w a s d i g e s t e d w i t h t h e i n d i c a t e d r e s t r i c t i o n e n z y m e s , s e p a r a t e d b y e l e c t r o p h o r e s i s o n 1 . 0 % a g a r o s e g e l s a n d t r a n s f e r r e d t o n i t r o c e l l u l o s e . T h e p r o b e u s e d w a s a n M 1 3 c l o n e c o n t a i n i n g a 5 0 0 b p D d e l - E c o R I i n s e r t o f w h i c h 2 0 0 b p w e r e s p e c i f i c t o t h e l o o p r e g i o n o f t h e i n v e r t e d r e p e a t ( P r o b e C, F i g u r e 1 3 C ) . T h e s i z e o f t h e h y b r i d i z i n g b a n d i n e a c h c a s e i s s h o w n i n k i l o b a s e p a i r s . 117 contains a copy of T e l , a transposable element of C. elegans. This element was is o l a t e d from B r i s t o l DNA and was kindly provided by Linda Harris, University of B r i t i s h Columbia. When hybridized to genomic DNA, 20 - 30 bands could be observed with B r i s t o l DNA but a more complicated pattern was found with Bergerac DNA since the l a t t e r contains approximately 10 times as many copies of the transposable element (Emmons et a l . , 1983; Liao et a l . , 1983). These re s u l t s are not shown. 118 IV. DISCUSSION 4.1 The Hspl6 Gene Family of C. elegans The sequences presented i n t h i s thesis along with those of Jones et a l . (1986) define a family of four related hsp16 genes. They are arranged i n divergently transcribed p a i r s at two separate l o c i . The hsp!6-48/41 genes code f o r one class of hspl6, 143 amino acid residues long while the hsp!6-l/2 genes encode the other c l a s s , which i s two amino acid residues longer. Thus each locus and each gene p a i r codes for the two major types of hspl6. The complete amino acid sequences of a l l 4 proteins are aligned i n Figure 24 to show the relatedness of hspl6-41 to hspl6-48 and of hspl6-2 to h s p l 6 - l . The basis f or t h e i r c l a s s i f i c a t i o n into two d i s t i n c t groups i s most evident i n the comparison of t h e i r f i r s t exons. For example, only three amino acid changes occur between the related proteins i n t h i s region. Between the two classes of proteins, the regions encoded by exon 1 show no homology. In the region encoded by the second exon, 61 of the possible 98 amino acid positions which can be compared are i d e n t i c a l i n at l e a s t three of the four proteins as shown i n Figure 24. The second exons of hsp!6-41 and hsp!6-48 contain only 6 codon changes while the homology i n the same region of hsp!6-l and hsp!6-2 i s comparable, with only 7 codon differences. Less s i m i l a r i t y i s seen between genes of the same locus. For example, a comparison of the second exons of hsp!6-48 and hsp!6-l shows that there are 37 codon differences within 98 amino acids. Thus there i s a highly variable protein domain represented by the f i r s t exon while the remainder of the protein contains a conserved domain which shows homology to the shsps of 119 HSP16-41 M L M L R J S I P J Y S D S N A L D H F L D E L T G S V Q F P Y V & A D H N S F N F S D HSP16-48 M L M L R S P F S D S N V L D H F L D E I T G S V Q F P Y W R N A D H N S F N F S D HSP16-1 M S L Y H Y F R P A Q R S V F G D L M R D M A Q M E R Q F T P V C R G S P S H S P 1 6-2 I ^ L T Y J H Y F R P A Q R S V F G D L M R D M A L M E Y Q F A P V C R I S P S HSP16-41 NIGE- 58bp INTRON HSP16-48 NIGE- 55bp INTRON HSP16-1 ESSE- 52bp INTRON HSP16-2 ESS[E]- 46bp INTRON IVNDESKFSVQL IVNDESKFSVqi IVNNDQKFAl IVN|NDQ|KFAIN1L{N1V" DVSHFKPENLK DVSHFKPEDLK NpLjNjV'SQFKPEDLK SQFKPEDLK HSP 1 6-HSP1 6-HSP1 6-HSP 1 6-•41 •48 •1 •2. K L D G R E L E L D G R E L N L D G H T L S N L D G R T L S KI KlI I I E G I Q E T K S E H G Y L K R S F S K M I L L P E D A D L P S V E G I Q E K K S E H G Y S K R S F S K M I L L P E D V D L T S V C G E Q E L K T E H G Y S K K S F S R V I L L P E D V D V G A V Q G E Q E L K T D H G Y S K K S F S R V I I L L P E D V D I V G A I V H S P 1 6' H S P 1 6-HSP1 6-H S P 1 6-4 1 48 •1 2 K S A I K S A I A S N L S E D G K L S S N E G K L Q S N E G K L Q I E A P K K T N S S - R S I P I I E A P K K T N S S - R S I P I A S N L S E D G K L S I E A P K K E A I Q G R S I P I I E A P K K E A V Q GRSIPI N F V A K H N F V A K H Q Q A P V E Q K T S E Q Q A I V E E K S A E F i g u r e 2 4 . A c o m p a r i s o n o f t h e p r o t e i n s e n c o d e d b y t h e C. e l e g a n s 1 6 k d h e a t s h o c k g e n e s . I n t h e b o x e d r e g i o n s , a t l e a s t t h r e e o f t h e f o u r p r o t e i n s h a v e i d e n t i c a l a m i n o a c i d s . A l s o s h o w n a r e t h e h i g h l y v a r i a b l e a n d h i g h l y c o n s e r v e d d o m a i n s w h i c h a r e p r e c i s e l y d e f i n e d b y a s h o r t i n t r o n . T h e a m i n o a c i d s e q u e n c e s o f h s p l 6 - 2 a n d h s p l 6 - 4 1 a r e t a k e n f r o m J o n e s e t a l . ( 1 9 8 6 ) . 120 Drosophila, Xenopus, soybean and man. The structure of t h i s domain has been maintained i n the vertebrate eye lens protein a - c r y s t a l l i n . Two-dimensional gel electrophoresis of the i n v i t r o t r a n s l a t i o n products of RNA hybrid-selected by e i t h e r CEHS48 or CEHS41 revealed at l e a s t f i v e electrophoretic variants of hspl6 which had s i g n i f i c a n t l y d i f f e r e n t i s o e l e c t r i c points. The p o s s i b l i l i t y that another hspl6 gene ex i s t s cannot be excluded although i t i s also possible that a given gene product may e x i s t i n more than one electrophoretic form since acetylation of proteins has been shown to occur i n a rabbit r e t i c u l o c y t e system (Palmiter, 1977; Garrels and Hunter, 1979; Rubenstein and Deuchler, 1979). The shsps of Drosophila, Xenopus, plants and man are also encoded by multigene fam i l i e s . At the protein l e v e l , shsps are always present in at least two d i s t i n c t isoforms on two-dimensional gels, the only exception occurring i n q u a i l (Atkinson et a l . , 1981). The vertebrate a - c r y s t a l l i n s are characterized by two primary gene products which have been designated as ^2 t y P e s (basic) and A^ types (a c i d i c ) due to t h e i r i s o e l e c t r i c points (Schoenmakers and Bloemendal, 1968). In hamster, these proteins are encoded by s i n g l e copy genes which are located on d i f f e r e n t chromosomes (Quaz-Jeuken et a l . , 1985). In the vertebrate lens, the A^ and c r y s t a l l i n s form large aggregates with t h e i r deamidation products which have been designated A^ and B^. With age, a l l of the a - c r y s t a l l i n chains undergo C-terminal degradation (for a review see Bloemendal 1982). S i m i l a r l y , the shsps of Drosophila can be grouped according to t h e i r net charges: hsp27 and hsp26 are basic whereas hsp23 and hsp22 are a c i d i c (Mirault et a l . , 1978; S t o r t i e t a l . , 1980). 121 I t i s possible that the two classes of hspl6 i n C. elegans correspond to a c i d i c and basic types. Since each heat shock locus codes for both types and since t r a n s c r i p t s from one locus accumulate to levels much higher than those corresponding to the other, one could expect to see a poorly expressed a c i d i c variant and a poorly expressed basic variant. S i m i l a r l y there would be a more abundant a c i d i c and a more abundant basic isoform. This i s what i s observed on the two-dimensional gel shown i n Figure 7. For example, the r e l a t i v e abundance of the two most basic variants (shown by arrows) i s consistent with the r e l a t i v e accumulation of tr a n s c r i p t s from the two l o c i , one being 20 to 40 times higher than the other. Based on the o v e r a l l proportion of a c i d i c amino acid residues (glutamate and aspartate) to basic amino acid residues (lysine and arginine) as predicted by the derived amino acid sequences, i t i s not possible to assign the two classes of hspl6 into d i s t i n c t i s o e l e c t r i c forms. However, there are some in t e r e s t i n g charge differences within l o c a l i z e d regions or domains. The f i r s t exon of both hspl6-41 and hspl6-48 has a predicted net charge of -3 while the corresponding region of hspl6-2 and h s p l 6 - l has a net charge of +1. The second exons of hspl6-41 and hspl6-48 have a net charge of +3 and 0, respectively, while the second exons of both hspl6-2 and h s p l 6 - l have a net charge of -4. These differences i n net charge between corresponding domains may be important depending on the d i s t r i b u t i o n and s p a t i a l arrangement of charged groups as a r e s u l t of protein f o l d i n g . The a v a i l a b i l i t y of s p e c i f i c cloned sequences now makes i t possible to assign a s p e c i f i c i s o e l e c t r i c variant to a p a r t i c u l a r gene using hybridization s e l e c t i o n under stringent conditions and subsequent i n v i t r o t r a n s l a t i o n . 122 4.2 Evolution of the Hspl6 Gene Family and Its Relationship to Other shsps and to Vertebrate a - C r y s t a l l i n s The presence of homologous multigene fa m i l i e s coding f o r shsps of many organisms suggests that an ancestral heat shock gene has undergone a number of du p l i c a t i o n events. The same i s true f o r the homologous a - c r y s t a l l i n genes i n vertebrates. I t has been postulated that the progenitor heat shock gene and the progenitor a - c r y s t a l l i n gene arose from the duplication of a . single ancestral gene (van den Heuvel et a l . , 1985). I t i s proposed that t h i s progenitor a - c r y s t a l l i n gene then evolved through an in t e r n a l d u p l i c a t i o n within the sequences represented by the f i r s t exon, followed by a dup l i c a t i o n of the entire gene which gave r i s e to the aA and aB type genes. An alt e r n a t i v e proposal can be made i n which a single ancestral gene duplicated to form a p a i r of genes representing A and B types. This p a i r of genes gave r i s e to the a - c r y s t a l l i n genes and the hspl6 gene family. This scheme i s i l l u s t r a t e d i n Figure 24. The argument i n favor of th i s scheme comes from the comparison of the C. elegans hspl6 amino acid sequences with the a - c r y s t a l l i n s of the dogfish, Squalus acanthias. The a - c r y s t a l l i n s from t h i s species are considered to be p r i m i t i v e r e l a t i v e to those of other vertebrates based on immunological comparisons (Manski and Malinowsky, 1978; De Jong, 1982). This p r i m i t i v e a - c r y s t a l l i n also exists i n a c i d i c (A) and basic (B) forms. Computer analysis (Jones et a l . , 1986) using the program described by Delaney (1982) with a MINBLOCK parameter set of 2 revealed that hspl6-2 resembled the A form of dogfish c r y s t a l l i n more than the B form. Conversely, hspl6-41 showed greater s i m i l a r i t y to the B type c r y s t a l l i n of Squalus. 123 HSP 16-48 H ANCESTRAL GENE DUPLICATION / INVERSION A | B I E I E DIVERGENCE AND/OR EXON SHUFFLING • olpha-cryitaltm | g e n e s I E HSP 16-48 HSP16-1 • ™ DUPLICATION & MINOR DIVERGENCE DUPLICATION/INVERSION HSP 16-1 HSP 16-1 LOCUS 1 (CONVERSION UNIT ) HSP 16-48 HSP 16-41 HSP 16-2 LOCUS 2 Figure 25. A model for the evolutionary o r i g i n of the hspl6 gene l o c i of C. elegans and the a - c r y s t a l l i n genes of vertebrates. Open boxes show the separate exons, and hatching indicates a major divergence i n the f i r s t exon sequence. 124 The evolution of an ancestral gene into A and B types must have been followed by a major divergence i n the sequence of the f i r s t exon since i n C. elegans, genes within the same p a i r share l i t t l e or no homology i n t h i s region. This divergence may also have been brought about by exon s h u f f l i n g (van den Heuvel et a l . , 1985) since the diverged region i s demarcated by an intron i n the C. elegans genes. Furthermore, t h i s event probably took place a f t e r the divergence of plants and animals since the shsps of soybean are highly homologous to each other i n a l l regions of the proteins including the amino-terminal portion (Nagao, 1985); however, the amino acid sequences of only 4 out of at least 10 shsps have been determined. The shsps of Drosophila. on the other hand, show l i t t l e homology i n t h e i r amino-terminal regions (see Figure 2). In C. elegans. t h i s period of divergence must have been followed by a second d u p l i c a t i o n event which i s represented by the homologous gene p a i r s found at d i f f e r e n t chromosomal locations. Following the proposed second dupli c a t i o n , only minor changes have occurred i n the coding regions of the genes. Also, over the l a t t e r period the sequence of the f i r s t exon evidently changed at the same rate as that of the second. Perhaps the a c q u i s i t i o n of function at t h i s stage f i x e d the rate of mutation within the f i r s t exon. A t h i r d d u p l i c a t i o n and inversion event has occurred within the hsp!6-48/l locus, r e s u l t i n g i n a 1.9 kb inverted repeat. The perfect i d e n t i t y of the two "arms" of th i s repeat at the nucleotide sequence l e v e l implies that the duplication event was very recent or that sequence i d e n t i t y has been maintained by frequent intralocus gene conversion events. The argument f o r a gene conversion mechanism w i l l be presented i n section 4.3. 125 Thus, the evolution of the hspl6 genes of C. elegans has been characterized by a series of duplications, at least two of which were accompanied by inversions. Leigh-Brown and Ish-Horowicz (1981) have suggested that the ancestral organization of the Drosophila hsp70 genes was as inverted repeats for both the 87A and 87C l o c i . The two hsp70 genes at 87A are approximately 1.7 kb apart i n opposite orientations (Goldschmidt-Clermont, 1980). The copies at 87C are present i n two domains, a single proximal sequence separated from tandem d i s t a l sequences by about 38 kb (Ish-Horowicz and Pinchin, 1980). In the related species, D. simulans and D. mauritiana, t h i s 38 kb in s e r t i s missing, r e s u l t i n g i n two hsp70 genes which are i n a head to head configuration l i k e those at locus 87A. S i m i l a r l y , at locus 6 7B, i f the orientation of gene 2 (which i s not known) were opposite to that of gene 3, the shsp genes of Drosophila would e x i s t i n three gene p a i r s , the ori g i n s of which could be explained by inverted duplications (see Figure 1). Inverted duplication has been shown to occur during the amplification of a c e l l u l a r oncogene (c-myc) i n a va r i e t y of tumor c e l l l i n e s and during the ampli f i c a t i o n of the CAD gene i n N-(phosphonacetyl)-L-aspartate-reeistant c e l l l i n e s (Ford and Fr i e d , 1986). CAD i s an acronym for the multifunctional enzyme which catalyzes the f i r s t three steps i n uridine biosynthesis. These authors suggest that the wide occurrence of inverted duplications i s related to the mechanism of gene ampl i f i c a t i o n . The shsps of.C. elegans resemble the a - c r y s t a l l i n s of vertebrates more than they do the shsps of D. melanogaster. This i s c l e a r l y demonstrated by the amino acid comparisons shown i n Figures 11 and 16. For example, i n Figure 16, there are 32 positions conserved between the shsps of 126 C. elegans and the a - c r y s t a l l i n s while there are only 20 positions conserved between the shsps of C. elegans and Drosophila. Furthermore, the 30 amino acid residues at the carboxy-terminal of the a - c r y s t a l l i n s show no obvious homology to corresponding regions i n the Drosophila shsps sequences although there i s a s l i g h t s i m i l a r i t y with the C-terminal 20 amino acid residues of nematode hspl6 (Wistow, 1985). Also, each of the hspl6 genes contains a small intron i n a p o s i t i o n analogous to that of the f i r s t i ntron of the a - c r y s t a l l i n genes. This suggests that some common property of shsps and a - c r y s t a l l i n s has been more rigorously conserved i n C. elegans than i n Drosophila. Human hsp25 i s even more homologous to a - c r y s t a l l i n than any of the shsps including those of C. elegans (Hickey et a l . , 1986). Also, regions of amino acid i d e n t i t y between hsp25 and a - c r y s t a l l i n are found along almost the e n t i r e length of a - c r y s t a l l i n . The lack of a divergent amino terminal region, as demarcated by an intron i n the hsp!6 genes of C. elegans, suggests that the human hsp genes evolved from an ancestral p a i r of genes which did not experience major divergence and/or exon s h u f f l i n g . This i s supported by the fa c t that neither of the two introns of the human hsp25 gene i s i n a p o s i t i o n analogous to the single introns of the C. elegans  hsp!6 genes or to the f i r s t introns of the a - c r y s t a l l i n genes. The shsps of Drosophila (except hsp22) contain a hydrophobic N-terminal region of 14 amino acid residues. If t h i s domain has a property which i s required for the function of these proteins, then i t must have evolved a f t e r the divergence of nematodes and insects since the N-termini of the shsps of C. elegans do not show t h i s degree of hydrophobicity. Interestingly, the shsps of soybean contain an N-terminal hydrophobic region of approximately 127 10 amino acid residues (Nagao et a l . , 1985). Human hsp25 shows no degree of hydrophobicity within i t s amino terminal portion (Hickey et a l . , 1986). 4.3 Gene Conversion Within Locus Hspl6-48/l The hsp!6-l and hsp!6-48 genes, including t h e i r coding and flanking sequences, are located within a 1.9 kb region which, because of i t s compactness, functional unity, and r e p e t i t i o n , might be referred to as a module. Two such modules, duplicated p e r f e c t l y with only a single base p a i r change, e x i s t i n the genome i n an inverted orientation r e l a t i v e to each other and are separated by 416 bp of unrelated sequence. This novel gene organization was confirmed by three l i n e s of evidence. F i r s t l y , extensive genomic DNA analysis has been carried out using 12 d i f f e r e n t r e s t r i c t i o n enzymes which cut i n the region of i n t e r e s t . The fragments obtained were e n t i r e l y consistent with the predicted structure. Secondly, overlapping phage clones were i s o l a t e d from two independently constructed l i b r a r i e s which contained both the 3.3L and 3.3R EcoRI fragments. Thir d l y , both the r i g h t and l e f t modules were sequenced completely, and a single base p a i r d i f f e r e n c e was i d e n t i f i e d . The palindromic region has the p o t e n t i a l to adopt a structure i n which intra-strand p a i r i n g r e s u l t s i n a 1.9 kb double-stranded stem portion with a looped-out single-stranded region of approximately 400 nucleotides. This foldback form remains stable under otherwise denaturing conditions. DNA fragments containing t h i s alternate configuration migrate f a s t e r i n agarose gels as seen i n the genomic DNA analysis. More d i r e c t proof of the existence of foldback DNA at t h i s locus comes from the observation that the predicted 1.9 kb stem structure i s 128 r e s i s t a n t to SI nuclease digestion a f t e r samples of genomic DNA have been denatured (Don Jones, personal communication). Evidence at the molecular l e v e l f o r gene conversion has arisen from the sequencing of duplicated n o n a l l e l i c genes such as the tRNA (Amstutz et a l . , 1985) and cytochrome C (Ernst et a l . , 1981) genes of yeast, the a-globin genes of goats (Schon et a l . , 1982) and humans (Liebhaber et a l . , 1980, 1981), the human y-gl o b u l i n genes (Slightom et a l . , 1980; Shen et a l . , 1981), the human immunoglobin \2 chain genes (Olio and Rougeon, 1983), and the high-cysteine chorion genes of the s i l k moth, Bombyx mori (Iatrou et a l . , 1984). In each of these cases, there are regions of greater homology between genes than would be expected from normal rates of sequence divergence since the time of the o r i g i n a l d uplication event. In other words, these regions have not evolved independently. Gene conversion may be involved i n maintaining microdiversity among the immunoglobulin variable-region gene fa m i l i e s (Cohen et a l . , 1982; Dildrop et a l . , 1982) and among the class I (Lalanne et a l . , 1982; Mellor et a l . , 1983; Schulze et a l . , 1983) and class II (Widera and F l a v e l l , 1984; Denaro et a l . 1984) major histocompatability complex antigens. As an example, a converted region of only 39 bp has been discovered i n the gene family encoding the var i a b l e regions of human immunoglobulin kappa l i g h t chains (Bentley and Rabbits, 1983). This s t r e t c h accounts f o r 7 of 10 base substitutions over a length of 940 bp and i s evidence that gene conversion may lead to the s h u f f l i n g of gene segments. The bovine prepro-AVP-NPII (vasopressin) and prepro-OT-NPI (oxytocin) genes are rela t e d and probably arose from a duplication event. In t h i s case there i s a st r e t c h of 332 bp which has perfect sequence i d e n t i t y between the 129 two genes. The s i m i l a r i t y drops to 81% i n the preceding 60 bp, and the other side can be only poorly aligned (Ruppert et a l . , 1984). These authors have suggested the occurrence of two successive conversion events leading to the present sequence organization, the second one being very recent. The perfect homology between the two 1.9 kb modules containing the hsp!6-l and hsp!6-48 genes could be explained i f the duplication event were f o r t u i t o u s l y very recent. A l t e r n a t i v e l y , the homology could have been continuously maintained a f t e r the second duplication by repeated gene conversion events. The l a t t e r explanation i s favored f o r p r o b a b i l i s t i c reasons, because the sequence i d e n t i t y would be in a steady state and therefore detectable over a much longer period of evolution. This conversion process might be f a c i l i t a t e d by the proximity of the two modules and by the unusual sequences which have been found at either end of the inverted repeat structure. This mechanism must also be precise since the borders of the "conversion u n i t " are very sharply defined i n the present example, contrasting 100% sequence homology within the converted 1.9 kb region with complete divergence on e i t h e r side of i t . I t i s i n t e r e s t i n g that a procaryotic transposable element such as transposon Tn5, which has two IS50 modules of 1,530 bp i n an inverted repeat, can maintain the sequence i d e n t i t y of these modules. Perhaps i n the hsp gene c l u s t e r the elements occupy stable positions i n the genome (unlike transposable elements) but undergo strand exchange and mismatch repair frequently. I t has been demonstrated that intrachromosomal, nonreciprocal transfer or gene conversion can occur at a high frequency i n cultured mouse c e l l s (Liskay and Stachelek, 1983) and i n yeast (Klar and Strathern, 1984; Klein, 1984). 130 Given the postulate that the hsp!6-l/48 gene c l u s t e r i s a hot spot f or gene conversion, there should be sequences which are involved i n f a c i l i t a t i n g and delimiting t h i s phenomenon. The G + C-rich sequences discussed i n Section 3.12 are i n t r i g u i n g l y situated at the d i s t a l borders of the inverted repeat. This sequence i s 24 bp i n length and i s characterized by a s t r e t c h of 12 alt e r n a t i n g purine-pyrimidine residues, flanked on e i t h e r side by a G + C hexanucleotide i n an inverted repeat o r i e n t a t i o n . In f a c t , the e n t i r e 24 bp stret c h has the p o t e n t i a l to adopt a palindromic structure, the l e f t variant containing 2 mismatches i n a 12 bp stem, the r i g h t variant containing 3 mismatches. A l l of the base pairs i n these structures would be G - C p a i r s , t h e o r e t i c a l l y maximizing t h e i r s t a b i l i t y . Similar G 4- C-rich sequences are found at the 3' border of a conversion event between the human immunoglobulin a l and a2 constant region genes (Flanagan et a l . , 1984) (Table VI). S t r i k i n g l y , G + C hexanucleotides i d e n t i c a l to the ones i n the heat shock locus flank a 40 bp stret c h of al t e r n a t i n g purine-pyrimidine residues and are oriented i n an inverted repeat. These sequences are shown i n upper case l e t t e r s . The s i m i l a r i t y even extends to a cytosine to thymine change which breaks up the inverted repeat and which i s c h a r a c t e r i s t i c of the boundary sequence variant i n the r i g h t module of the hsp!6-l/48 locus. A 2.1 kb region of DNA containing a p a i r of chicken histone genes (H4 and H2A) has been duplicated and inverted, the two arms being 97% homologous and separated by approximately 2.0 kb of unrelated sequence which contains a si n g l e histone H3 gene (Wang et a l . , 1985). Once again the borders are defined by 10 bp G + C-rich sequences, the core of which i s i d e n t i c a l to the hexanucleotides found i n locus hsp!6-48/l (Table VI). In t h i s case, 131 however, the sequences are found at both the proximal and d i s t a l borders where they occur as inverted repeats and d i r e c t repeats, respectively. They are separated by DNA stretches which do not contain alternating purine/pyrimidine residues or, i n the case of the proximal borders, do not contribute to a large palindromic structure. A C/G to A/T t r a n s i t i o n has also occurred i n an analogous p o s i t i o n i n one of the d i r e c t repeats at the r i g h t d i s t a l border. A computer search of DNA sequences i n proximity to 13 recombinatorial breakpoints presumed to be a r e s u l t of gene conversion has located i n each case a palindromic sequence (Krawinkel et a l . , 1986). These sequences have stem structures ranging i n length from 9 to 16 bps with loop sizes ranging from 0 to 28 nucleotides. A c o r r e l a t i o n of conversion boundaries with d i r e c t repeats was not observed. These r e s u l t s , i n conjunction with those discussed above suggest that palindromic sequences may promote gene conversion and that they may serve as recognition s i t e s f o r one or more enzymes involved i n genetic recombination. The characterization of other s i m i l a r G + C-r i c h sequences, which appear to be abundant within the genome of C. elegans, should help i n understanding t h e i r function. Both the 1.9 kb and the 3/0 bp inverted repeat structures are associated with these sequences. The a v a i l a b i l i t y of s p e c i f i c oligodeoxynucleotide probes should f a c i l i t a t e the i d e n t i f i c a t i o n of other cloned foldback structures to determine whether they are associated with functional genes which have also undergone gene conversion processes. ' T a b l e V I . A s s o c i a t i o n o f G + C - R i c h S e q u e n c e s w i t h P a l i n d r o m i c S t r u c t u r e s L o c a t e d a t G e n e C o n v e r s i o n B o u n d a r i e s P a l i n d r o m i c S t r u c t u r e Location W a t s o n - C r i c k p a i r / L o o p S i z e S t e m L e n g t h G e n e B o u n d a r y C G G G G C c g c g c g G C C C C G a c g c a c 1 0 / 1 2 h s p l 6 - l / 4 8 l o c u s l e f t d i s t a l C A G G G C c g c g c g G C C C C G a c g c a c 9 / 1 2 0 h s P 1 6 - l / 4 8 l o c u s r i g h t d i s t a l g g C G G G G C g g c c G C C C C G c c 1 0 / 1 0 2 1 c h i c k e n h i s t o n e g e n e l o c u s l e f t a n d r i g h t p r o x i m a l C A G G G C G C C C C G 5/6 4 0 m o u s e I g - c o n s t a n t 3 " - b o u n d a r y a l a n d c < 2 g e n e s 133 4.4 The Heat Shock Response of C. elegans C. elegans undergoes a t y p i c a l response when exposed to hyperthermic conditions. In vivo l a b e l l i n g of nematodes at 35°C shows that most of the pre-existing p r o t e i n synthesis declines while approximately 10 proteins are abundantly synthesized. These experiments cannot d i s t i n g u i s h between those proteins whose synthesis i s induced at the higher temperature and those whose previous synthesis under normal temperatures i s unaffected by heat shock. For example, hsp70 consists of at least two primary gene products, one which i s synthesized only under heat shock conditions while the other i s a product of an hsp70 cognate gene which i s active at normal temperatures (Snutch and D a i l l i e , 1984). Hspl6, however, appears to be newly synthesized at the elevated temperature and t h i s has been v e r i f i e d by the hy b r i d i z a t i o n of s p e c i f i c cloned DNA sequences to polyA +RNA i s o l a t e d from heat shocked nematodes but not to a s i m i l a r RNA f r a c t i o n p u r i f i e d from normally growing nematodes. Thus the hsp!6 genes, of which there are at least four, are under a t i g h t t r a n s c r i p t i o n a l control mechanism. Although the transient nature of the heat shock response i n C. elegans has not been investigated, i t appears that the resumption of normal protein synthesis does not occur o within 5 - 6 hours i f the nematodes are maintained at 35 C (Figure 3). This i s s i m i l a r to the s i t u a t i o n seen i n HeLa c e l l s i n which normal protein synthesis does not resume f o r at l e a s t 10 hours i f the c e l l s are maintained at 42°C (Hickey and Weber, 1982). In contrast, resumption of ex i s t i n g o protein synthesis can occur within 10 - 20 minutes at 36 C i n yeast o (McAlister and F i n k e l s t e i n , 1980) or within 2 - 3 hours at 37 C i n Drosophila (DiDomenico et a l . , 1982b). Assuming that the heat shock proteins serve a protective r o l e during c e l l u l a r stress, then i t would be b e n e f i c i a l f o r them to possess 134 r e l a t i v e l y extended half l i v e s . The importance of t h i s property i s further emphasized by the presumably transient nature of the heat shock response: i t has been found that i n Drosophila. hsp70 represses i t s own synthesis upon continued stress. As shown i n Figure 4, the hsps of C. elegans. which were pul s e - l a b e l l e d at 35°C, are detectable i n c e l l s 24 hours following heat shock, at l e v e l s comparable to those observed during or immediately a f t e r the shock. In v i t r o t r a n s l a t i o n of polyA +RNA from heat shocked nematode cultures demonstrated that a t r a n s l a t i o n a l control also operates i n nematodes at high temperatures. Although pre-existing messages are s t i l l present in heat shocked c e l l s as detected by t r a n s l a t i o n i n v i t r o , they are not translated i n vivo (compare Figure 3 and Figure 5, lane C). In Drosophila. the leader sequences of hsp70 (McGarry and Lindquist, 1985; Klemenz et a l . , 1985) and hsp22 (Hultmark et a l . . 1986) mRNA are responsible for t h e i r s e l e c t i v e t r a n s l a t i o n , although i t i s not yet known how t h i s i s accomplished. The mechanism involved does not appear to have s p e c i f i c sequence (McGarry and Lindquist, 1985) or length (McGarry and Lindquist, 1985; Klemenz et a l . . 1985; Hultmark et a l . , 1986) requirements. The leader sequences of a l l 4 sequenced hsp!6 genes are shown i n Figure 26. When aligned to compensate f o r d e l e t i o n s / i n s e r t i o n s , the leaders of the C. elegans hsp!6 genes display a great deal of s i m i l a r i t y with an average length of approximately 45 nucleotides. The involvement of these leaders i n the a b i l i t y of hspl6 t r a n s c r i p t s to be recognized by heat shocked ribosomes awaits experiments i n which mutated leader regions are assayed for s e l e c t i v e t r a n s l a t i o n . Due to the divergent di r e c t i o n s of t r a n s c r i p t i o n , the 5' noncoding regions of the hsp!6 gene p a i r s are p r e c i s e l y defined. The intergenic 1 3 5 H S P 1 6 - 4 8 H S P 1 6 - 4 1 H S P 1 6 - 2 H S P 1 6 - 1 TATA BOX TRANSCRIPTION STARTS " » "I MET GGjGTATATA GG3TATATA TA J T A T A A A r AGCCAA lCGTGTTCA 13GAAACC 3GGCTC * - G A G 2AA G ZZ&ACA GAJGTATAAAfrlAbAGTGACHAAA W v CGTTGlAhAATAA GAG|GAA AjqqAATA TACC CCfeAAjCttl! V •ACAlAfcA AACAlAlCA CAC T T T G T T C A A - C G O T T T GMT C T A TTTG TTCAi GTG CTTACTGTTC k3TG rCTApTTpTGfVAATTAGAA- \ T C T T C rCTAlATTlGTGjAA I A T C T T C i &AACTA ATTCTC T AAACT1CAA GAATG ATCTAApAAACTT CGA 4AITG JAACT 1 rAA TC iTG :AAh~CiATG| Figure 26. The leader sequences of the hsp_16_ genes of C. elegans The TATA motifs and the t r a n s c r i p t i o n starts deduced from SI nuclease protection analysis are indicated. Positions where at least three out of four nucleotides are i d e n t i c a l are boxed. Gaps were introduced to give the best alignment. The hsp!6-2 and hsp!6-41 sequences and s t a r t s i t e s are taken from Jones et. a l . (1986). 136 regions of the hsp!6-41/2 and hsp!6-48/l gene pairs are aligned i n Figure 27. This region shows an o v e r a l l homology of 85% and contains only 26 nucleotide differences. The known f u n c t i o n a l l y important 5' sequences of the hsp!6 genes have been conserved. These include the TATA sequences and the HIP sequences; two of the l a t t e r overlap each other upstream of the hsp!6-48 and hsp!6-41 genes. The conserved regions include sequence elements the s i g n i f i c a n c e of which i s unknown, such as the s t r e t c h of a l t e r n a t i n g purine-pyrimidine residues situated adjacent to a prominent region of dyad symmetry. T r a n s c r i p t i o n a l studies of the hsp!6-48 and hsp!6-l gene p a i r i n mouse f i b r o b l a s t c e l l s have demonstrated that heat i n d u c i b i l i t y as well as arsenite i n d u c i b i l i t y i s dependent on the HIP sequences (Kay et a l . , 1986). A s i n g l e HIP sequence can function b i d i r e c t i o n a l l y , inducing the t r a n s c r i p t i o n of both genes when placed between the TATA boxes. In t h i s case, however, the e f f i c i e n c y i s reduced 10 f o l d r e l a t i v e to the wild type gene p a i r . Placing four overlapping promoter elements between the genes resulted i n inducible b i d i r e c t i o n a l t r a n s c r i p t i o n at l e v e l s higher than those found with the wild type gene p a i r . The high degree of s i m i l a r i t y between the intergenic regions of the two heat shock l o c i implies the existence of f u n c t i o n a l l y important sequences i n addition to the heat shock promoters. Although none have been i d e n t i f i e d as yet, i t i s possible that other metabolic stressors or p h y s i o l o g i c a l states a c t i v a t e the hsp!6 genes through a l t e r n a t i v e c i s - a c t i n g elements. Based on observations made i n Drosophila. there exists the p o s s i b i l i t y that hspl6 may serve some function during nematode development, i . e . the hsp!6 genes or a subset thereof may be activated i n a stage-specific manner. The a v a i l a b i l i t y of s p e c i f i c gene probes now allows a detailed analysis of RNA 1 3 7 MET V W HSP 1 S - 4 1 - C A T T T T C G A A G T T T T T T A GATQCACTAGA ACAAAGCGTGTTGGCTTCCTCTGAGCCCGCTT HSP 16 - 4 8 - C A T T C T T G A A G T T T A G A G A A T G A A C A G T A A G C A C T T G A A C A A A G T G T A T T G G T T T C C T C T G A A C A C G A T T GTA — H I P A TCCTT GGCTT ATATAJCCCGCATTCTGCAGCCTT ACAGAATGTTCTAGAAGGTCCTAGATGCATTCGTTTGAAA 'ATACTCCCGGT A T A T A C C C G T A T C C T G C A G C C G T T T A G A A T G T T C T A G A A G G T C C T A G A T G C A T T C A T T T C A A A A T A C A C C C C A T CRUCIFORM FIGURE GGGTGCJAA AGAGACGC AGACGGAA A ATGT ATCTGGGTCTCTTTJATJTGTGT AC ACfT ACTTTTCCATGTACCGA ATGTGAG I l P t . -r^-r-r^-rs* A AGGTGC^AAGAGACGCAGATT GAAAAAGT ATCTGGGTfTCTTpA lGTACGCACAC[TAf TTCTCAATGTTCTGA ATGTGAG HIP — * • V W T C G C C C T C C T T T T G C A A C A A G C A G C T C G A A T G T T C T A G A A A A A G G T G G A A A A T A G r A T A A A T A C C G T T G A A A A T A A A T A T C G C C C T C C T T T T G C A A G A A G C A G C T C G A A T G T T C T A G A A A A A G G T G G A A A T G A G [ T A T A A A T A | C A G T G A C A A A - - - A W MET C C G A A C - A A C A T T T G C T C T A A T T G T G A A A T T A G A A A T C T T C A A A C T A T A A T C A T G - H S P 1 6 - 2 C C G A A C C A A A C A A C A T T C A C T C T A A T T G T G A A A T C T T C A A A C T A C A A T C A T G - H S P 1 6 - 7 F i g u r e 27. A c o m p a r i s o n o f t h e i n t e r g e n i c r e g i o n s o f t h e t w o h s p ! 6 g e n e l o c i o f C . e l e g a n s . D o t s i n d i c a t e p o s i t i o n s o f s e q u e n c e d i f f e r e n c e s a n d g a p s w e r e i n t r o d u c e d t o o b t a i n t h e b e s t a l i g n m e n t . T h e h e a t i n d u c i b l e p r o m o t e r s ( H I P s ) a n d T A T A b o x e s a r e i n d i c a t e d , a s i s t h e p o s i t i o n o f t h e l a r g e c r u c i f o r m f i g u r e w i t h t h e p o t e n t i a l t o a d o p t a s t e m - l o o p s t r u c t u r e a n d i t s a d j o i n i n g p u r i n e - p y r i m i d i n e s e q u e n c e ( Z ) . T r a n s c r i p t i o n s t a r t s i t e s a r e i n d i c a t e d b y t r i a n g l e s , w i t h t h e m a j o r s i t e s s h o w n a s f i l l e d t r i a n g l e s . T h e h s p ! 6 - 2 / 4 1 i n t e r g e n i c r e g i o n i s t a k e n f r o m J o n e s e t a l . ( 1 9 8 6 ) . 138 p u r i f i e d from d i f f e r e n t developmental stages including eggs, adults and the four intermediate l a r v a l forms. Although the control RNA used i n t h i s t h e s i s was prepared from mixed cultures, i t i s l i k e l y that the t r a n s c r i p t i o n of a p a r t i c u l a r hsp!6 gene during one s p e c i f i c stage out of the s i x major i d e n t i f i a b l e ones would have gone undetected due to the limited s e n s i t i v i t y of Northern analysis. In vivo protein l a b e l l i n g experiments have shown that hspl6 i s heat inducible i n a l l of the above-mentioned developmental stages (Snutch and B a i l l i e , 1983). Remarkably, the two hsp!6 gene pai r s of C. elegans have r a d i c a l l y d i f f e r e n t expression levels during heat shock. This may r e f l e c t a d i f f e r e n c e i n t h e i r rates of t r a n s c r i p t i o n or i n t h e i r r e l a t i v e message s t a b i l i t i e s . The intergenic regions of the two gene pai r s are very s i m i l a r but not i d e n t i c a l . I t i s possible that some minor sequence v a r i a t i o n could a f f e c t the r e l a t i v e levels of heat inducible t r a n s c r i p t i o n . For example, a cytosine to thymine t r a n s i t i o n within the c e n t r a l l y located palindromic structure introduces a second base p a i r mismatch into the predicted 12 bp stem structure between the hsp!6-l/48 gene p a i r , which would be expected to s i g n i f i c a n t l y a f f e c t i t s s t a b i l i t y . A l t e r n a t i v e l y , three major features outside the intergenic regions d i s t i n g u i s h the two d i f f e r e n t gene p a i r s . These include nonhomologous 3' noncoding sequences, the presence of r e p e t i t i v e elements flanking the hsp!6-2/41 gene p a i r and the inverted d u p l i c a t i o n of the hsp!6-l/48 gene p a i r . The 3' noncoding regions of the two r e l a t e d genes hsp!6-48 and hsp!6-41 are r a d i c a l l y d i f f e r e n t i n length (38 versus 94 nucleotides) and show no sequence s i m i l a r i t y . The other two r e l a t e d genes, hsp!6-l and hsp!6-2. show homology extending 45 bp past the polyadenylation s i g n a l . Perhaps more 139 s i g n i f i c a n t i s the presence of an A + T - r i c h sequence i n the 3* noncoding region of the hsp!6-2 gene which could form a perfect 7 bp h a i r p i n . I t occurs i n a region which has been deleted i n the corresponding less a c t i v e l y expressed hsp!6-l gene. The other highly expressed gene, hsp!6-41. has a perfect 11 bp A + T-ri c h h a i r p i n located adjacent to the polyadenylation s i g n a l . I t i s conceivable that these secondary structures may be involved i n t r a n s c r i p t processing, polyadenylation or s t a b i l i t y . Three copies of the 200 bp r e p e t i t i v e element family CeRep-16 flank the more active hsp!6 locus (Jones et a l . , 1986). An EcoRI-EcoRV fragment containing the proximal h a l f of the single r e p e t i t i v e element at the 3' end of the hsp!6-41 gene was hybridized to phage clones \Charon4 B-3 and \Charon4 B-7, which represent the en t i r e 30 kb region shown in Figure 12. Under conditions i n which the related r e p e t i t i v e elements from the 3' end of the hsp!6-2 gene could be detected, there was no hybridization to any of the EcoRI fragments derived from the above-mentioned phage. These r e s u l t s (not shown) indic a t e that homologous sequences are not present within at l e a s t 10 kb on e i t h e r side of the less active locus containing the hsp!6-l/48 gene p a i r s . Members of the CeRep-16 element contain multiple repeats of the sequence of G TTTGC, which i s very s i m i l a r to part of the "enhancer G core" sequence GGTTTG found i n a v a r i e t y of v i r a l and c e l l u l a r enhancers ( S e r f l i n g et a l . , 1985). Thus i t i s possible that an enhancer-like mechanism may be regulating the expression of the heat shock genes at t h i s locus. Unfortunately, the d i f f e r e n t i a l expression of these gene pairs cannot be reproduced when transfected into mouse c e l l s (Rob Kay, personal communication) suggesting that the factors that mediate 20 f o l d higher t r a n s c r i p t l e v e l s of the hsp!6-2/41 gene p a i r r e l a t i v e to the hsp!6-l/48 140 gene p a i r i n C. elegans are not conserved i n mouse c e l l s . The use of a homologous transformation system, which has recently been developed for C. elegans (Stinchcomb et a l . , 1985), may prove to be h e l p f u l i n demonstrating the existence and nature of such factors. Another reason for the observed d i f f e r e n t i a l expression may simply l i e in the p o s s i b i l i t y that the two heat shock l o c i are situated i n d i f f e r e n t chromosomal environments or domains. The l o c i have not yet been g e n e t i c a l l y mapped but even i f they were linked, they would be separated by at le a s t 10 kb of DNA. In addition to t r a n s c r i p t i o n a l and t r a n s l a t i o n a l control, the presence of introns i n heat inducible genes introduces the p o s s i b i l i t y of regulating gene expression at the l e v e l of s p l i c i n g . I t i n i t i a l l y appeared that the presence of intervening sequences was confined to genes which were transcribed at normal growth temperatures. These include the c o n s t i t u t i v e l y expressed cognate genes of the Drosophila hsp70 gene family as well as the Drosophila hsp83 and human hsp25 genes which are expressed under normal conditions but are induced to much higher le v e l s during heat shock. The hsp16 genes of Caenorhabditis comprise a t h i r d group of intron-containing genes, being i n a c t i v e at normal temperatures. Hsp83 has a pattern of expression which i s d i f f e r e n t from any of the other hsps i n Drosophila (Yost and Lindquist, 1986). As already mentioned, o i t i s produced at substantial l e v e l s at 25 C Maximum expression i s o o observed between 33 C and 35 C, decreasing to barely detectable l e v e l s o o by 38 C. In contrast hsp70 i s highly induced at 38 C. Although the 6 amount of hsp83 mRNA remains constant at temperatures above 35 C, the decreased expression of hsp83 i s due to the re v e r s i b l e thermal s e n s i t i v i t y 141 of the s p l i c i n g apparatus, v i r t u a l l y a l l of the hsp83 mRNA being found as o unspliced precursor at 38 C (Yost and Lindquist, 1986). Similar observations were made by S t e l l a r and P i r r o t t a (1985) i n a transformed Drosophila s t r a i n carrying the white gene which had been linked to an hsp70 promoter. At 37°C, the white gene t r a n s c r i p t s , which contained a large intron, were i n e f f i c i e n t l y s p l i c e d . Proper s p l i c i n g resumes upon recovery at 25°C ( S t e l l e r and P i r r o t t a , 1985; Yost and Lindquist, 1986). I f a mild 35°C heat shock, which induces the synthesis of hsps, i s administered p r i o r to a severe 38°C heat shock, hsp83 t r a n s c r i p t processing occurs under otherwise r e s t r i c t i v e conditions (Yost and Lindquist, 1986). I t i s suggested by these authors that one of the functions of the heat shock response i s to protect the s p l i c i n g apparatus. I t remains to be seen whether RNA processing i s s i m i l a r l y more thermo-labile i n organisms other than Drosophila. I t i s possible that a si m i l a r phenomenon occurs i n C. elegans. Snutch and B a i l l i e (1983) have observed that hspl6 i s not expressed at higher temperatures. Also, the cDNA pCEHS41 corresponds to an unspliced t r a n s c r i p t . Although SI mapping indicated that hspl6-41 t r a n s c r i p t s were completely s p l i c e d (Jones et a l . , 1986), the mRNA used i n these studies was is o l a t e d independently from the RNA used i n the construction of the cDNA l i b r a r y and which was kindly provided by Terry Snutch, Simon Fraser University. Thus the nematodes from which RNA was isol a t e d were subjected to d i f f e r e n t heat shock conditions. C. elegans hsp70 i s expressed under severe heat shock conditions i n which hspl6 i s not (Snutch and B a i l l i e , 1983). Although one of the members of the hsp70 gene family contains an intron (Mark Heschl, personal communication), the presence of intervening sequences i n the other related genes has not 142 been determined. Thus the synthesis of hsp70 at higher temperatures may take place on t r a n s c r i p t s which have bypassed the s p l i c i n g mechanism. Human hsp25 mRNA i s completely s p l i c e d at 42°C i n HeLa c e l l s (Hickey et a l . , 1986) but t h i s temperature may be below the threshold of s p l i c i n g i n a c t i v a t i o n f o r a mammalian c e l l . The increased temperature s e n s i t i v i t y of s p l i c i n g r e l a t i v e to t r a n s c r i p t i o n and t r a n s l a t i o n may r e f l e c t a p h y s i o l o g i c a l l y relevant control mechanism i n which the expression of t r a n s c r i p t s containing intervening sequences i s i n h i b i t e d during severe stress. Also, the accumulation of unspliced t r a n s c r i p t s during heat shock re s u l t s i n the delayed expression of these RNAs into protein products since s p l i c i n g and subsequent t r a n s l a t i o n can only occur during recovery at lower temperatures or upon adaptation of the s p l i c i n g mechanism during maintained stress. 143 V. REFERENCES 1. Altschuler, M. and J.P. Mascarenhas. 1982. Plant Mol. B i o l . 1: 103-115. 2. Amin, J . , R. M e s t r i l , R. Lawson, H. Klapper, and R. Voellmy. 1985. Mol. C e l l . B i o l . 5: 197-203. 3. Amstutz, J . , P. Munz, W.-D. Heyer, U. Leupold, and J. Kohli. 1985. C e l l 40: 879-886. 4. Ananthan, J . , A.L. Goldberg, and R. Voellmy. 1986. Science 232: 522-524. 5. Amott, S., R. Chandrasekaran, D.L. B i r d s a l l , A.G.W. L e s l i e and R.L. R a t t l i f f . 1980. Nature 283: 743-745. 6. Arrigo, A.P., S. Fakan, and A. T i s s i e r e s . 1980. Dev. B i o l . 78: 86-103. 7. Arrigo, A.-P., and C. Ahmad-Zadeh. 1981. Mol. Gen. Genet. 184: 73-/9. 8. Arrigo, A.-P., J.-L. Da r l i x , E.W. Khandjian, M. Simon, and P.-F. Spahr. 1985. EMBO J. 4: 399-406. 9. Artavanis-Tsakonas, S., P. Schedl, M.-E. Mirault, L. Moran, and J. L i s . 1979. C e l l 17: 9-18. 10. Ashburner, M. 1970. Chromosoma 31: 356-376. 11. Ashburner, M., and J. J . Bonner. 1979. C e l l 17: 241-254. 12. Atkinson, B.G. 1981. J . C e l l B i o l . 89: 666-6 73. 13. Atkinson, B.G., and M. Pollock. 1982. Can. J. Biochem. C e l l B i o l . 60: 316-327. 14. Atkinson, B.G., T. Cunningham, R.L. Dean, and M. Somerville. 1983. Can. J. Biochem. C e l l B i o l . 61: 404-413. 15. Atkinson, B.G., T. Cunningham, R.L. Dean, and M. Somerville. 1983. Can. J. Biochem. C e l l B i o l . 61: 404-413. 16. Atkinson, B.G., and R.L. Dean. 1985. i n Changes i n Eukaryotic Gene  Expression i n Response to Environmental Stress (Atkinson, B.G., and D.B. Walden, Eds.) pp. 159-181, Academic Press, New York. 17. Atkinson, T., and M. Smith. 1984. i n Oligonucleotide Synthesis, a  P r a c t i c a l Approach (Gait, M.J., eds.) pp. 35-81, IRL Press Ltd., Oxford. 18. Aviv, H., and P. Leder. 1972. Proc. Nat. Acad. S c i . U.S.A. 69: 1408-1412. 144 19. Ayme, A., and A. T i s s i e r e s . 1985. EMBO J . 4: 2949-2954. 20. Baker, T.A., A.D. Grossman, and G.A. Gross. 1984. Proc. Nat. Acad. S c i . U.S.A. 81: 6779-6783. 21. B a l l i n g e r , D.G., and M.L. Pardue. 1983. C e l l 33: 103-114. 22. Bardwell, J.C.A., and E. Craig. 1984. Proc. Nat. Acad. S c i . U.S.A. 81: 848-852. 23. Barnett, T., M. Altschuler, CM. McDaniel, and J.P. Mascarenhas. 1980. Dev. Gen. 1: 331-340. 24. Baszczynski, C.L., D.B. Walden, and B.G. Atkinson. 1982. Can. J. Biochem. C e l l B i o l . 60: 569-579. 25. Baszczynski, C.L., D.B. Walden, and B.G. Atkinson. 1985. in Changes in Eukaryotic Gene Expression i n Response to Environmental Stress (Atkinuon, B.G., and D.B. Walden, eds.) pp. 349-371, Academic Press, New York. 26. Beckman, D. , and S. Cooper. 1973. J. B a c t e r i d . 116: 1336-1342. 27. Bensaude, 0., and M. Morange. 1983. EMBO J. 2: 173-177. 28. Bentloy, D.L., and T.H. Rabbitts. 1983. C e l l 32: 181-189. 29. Benton, W.D., and R.W. Davis. 1977. Science 196: 180-182. 30. Berger, E.M., and M.P. Woodward. 1983. Exp. C e l l . Res. 147: 437-442. 31. Berk. A.J., and P.A. Sharp. 1977. C e l l 12: 721-732. 32. Bienz, M. 1982. i n Heat Shock: From Bacteria to Man (Schlesinger, M.J., M. Ashburner, and A. T i s s i e r e s , eds.) pp. 177-181, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 33. Bienz, M., and H.R.B. Pelham. 1982. EMBO J. 1: 1583-1588. 34. Bienz, M., and J.B. Gurdon. 1982. C e l l 29: 811-819. 35. Bienz, M. 1984a. Proc. Nat. Acad. S c i . U.S.A. 81: 3138-3142. 36. Bienz, M. 1984b. EMBO J . 3: 2477-2483. 37. Birnboim, H.C., and J. Doly. 1979. Nucleic Acids Res. 7: 1513-1523. 38. Bloemendal, H. 1982. C r i t . Rev. Biochem. 12: 1-39. 39. Bloemendal, H., T. Berns, A. Zweers, H. Hoenders, and E.L. Benedetti. 1972. Eur. J. Biochem. 24: 401-409. 145 40. Bond, U., and M.H. Schlesinger. 1985. Mol. C e l l . B i o l . 5: 949-956. 41. Bouche, G., F. Amalric, M. Caizergues-Ferrer, and J.P. Zalta. 1979. Nucleic Acids Res. 7: 1739-1747. 42. Bourouis, M., and G. Richards. 1985. C e l l 40: 349-357. 43. Brenner, S. 1974. Genetics 22: 71-94. 44. Bretscher, M.S., and A.E. Smith. 1972. Anal. Biochem. 4_7: 310-312. 45. Brevet, A., P. Plateau, M. Best-Belpomme, and S. Blanquet. 1985. J. B i o l . Chem. 260: 15566-15570. 46. Burke, J . J . , J.L. H a t f i e l d , Robert R. K l e i n , and J.E. Mullet. 1985. Plant Physiol. 7_8: 394-398. 47. Buzin, C.H., and N.S. Peterson. 1982. J . Mol. B i o l . 158: 181-201. 48. Buzin, C.H., and N. Bournias-Vardiabasis. 1984. Proc. Nat. Acad. S c i . U.S.A. 79: 855-859. 49. C a t e l l i , M.G., N. Binart, J.R. Feramisco, and D.M. Helfman. 1985a. Nucleic Acid Res. 13: 6035-604/. 50. C a t e l l i , M.G., N. Binart, I. Jung-Testas, J.M. Renoir, E.E. Baulieu, J.R. Feramisco, and W.J. Welch. 1985b. EMBO J. 4: 3131-3135. 51. Chappell, T.G., W.J. Welch, D.M. Schlossman, K.B. Palter, M.J. Schlesinger, and J.E. Rothman. 1986. C e l l 45: 3-13. 52. Cheney, CM., and A. Shearn. 1983. Develop. B i o l . 95.: 325-330. 53. Chirgwin, J.M., A.E. Przybyla, R.J. MacDonald, and W.J. Rutter. 1979. Biochemistry 18: 5294-5299. 54. Ciechanover, A., D. Fin l e y , and A. Varshavsky. 1984. C e l l 3_7: 57-66. 55. Cohen, J.B., K. Effron, G. Rechavi, Y. Ben-Neriah, R. Zakut, and D. G i v o l . 1982. Nucleic Acids Res. 10: 3353-3370. 56. Cohen, R.S., and M. Meselson. 1985. C e l l 43: 737-746. 57. C o l l i n s , P.L., L.E. Hightower, and L.A. B a l l . 1980. J. Virology 35: 682-693. 58. Commerford, S.L. 1971. Biochemistry 10: 1993-1999. 59. Compton, J.L., and B.J. McCarthy. 1978. C e l l 14: 191-201. 146 60. Cooper, P., T.D. Ho, and R.M. Hauptmann. 1984. Plant Physiol. 75: 431-441. 61. Corces, V., R. Holmgren, R. Freund, R. Morimoto, and M. Meselson. 1980. Proc. Nat. Acad. S c i . U.S.A. 77.: 5390-5393. 62. Courgeon, A.M., C. Maisonhaute, and M. Best-Belpomme. 1984. Exp. C e l l Res. 153: 515-521. 63. Cowing, D.W., J.C.A. Bardwell, B.A. Craig, C. Woolford, R.W. Hendrix, and C.A. Gross. 1985. Proc. Nat. Acad. S c i . U.S.A. 82: 26 79-2683. 64. Craig, E.A., B.J. McCarthy, and S.C. Wadsworth. 1979. C e l l 16: 575-588. 65. Craig, E.A., and B.J. McCarthy. 1980. Nucleic Acids Re8. 8: 4441-4457. 66. Craig, E.A., T.D. Ingolia, and L.J. Manseau. 1983. Dev. B i o l . 99: 418-426. 67. Craig, E.A., and K. Jacobsen. 1984. C e l l 38: 841-849. 68. Craig, E.A., and K. Jacobsen. 1985. Mol. C e l l . B i o l . 3517-3524. 69. Craig, E.A., M.R. Slater, W.R. Boorstein, and K. Palter. 1985. UCLA Symp. Mol. C e l l B i o l . 30: 659-668. 70. Czarnecka, E., L. Edelman, F. S c h o f f l , and J.L. Key. 1984. Plant Mol. B i o l . 3: 45-58. 71. Czarnecka, E., W.B. Gurley, R.T. Nagao, L.A. Mosquera, and J.L. Key. 1985. Proc. Nat. Acad. S c i . U.S.A. 82: 3726-3730. 72. Dean, R.L., and B.G. Atkinson. 1983. Can. J. Biochem. C e l l B i o l . 61: 472-479. 73. De Jong, W.W. 1982. i n Macromolecular Sequences i n Systematic and  Evolutionary Biology (Goodman, M., eds.) pp. 75-114, Plenum Press, New York. 74. Delaney, A.D. 1982. Nucleic Acids Res. 10: 61-67. 75. Denaro, M., U. Hammerling, L. Rask, and P.A. Peterson. 1984. EMBO J. 3: 2029-2032. 76. Denisenko, O.N. 1984. FEBS Le t t . 178: 149-152. 77. DiDomenico, B.J., G.E. Bugaisky, and S. Lindquist. 1982a. Proc. Nat. Acad. S c i . U.S.A. 79: 6181-6185. 147 78. DiDomenico, B.J., G.E. Bugaisky, and S. Lindquist. 1982b. C e l l 31: 593-603. 79. Dildrop, R. , M. Bruggemann, A. Radbruch, R. Rajewsky, and K. Beyreuther. 1982. EMBO J . 1: 635-640. 80. DiNocera, P.P., and I.B. Dawid. 1983. Proc. Nat. Acad. S c i . U.S.A. 80: 7095-7098. 81. Dudler, R., and A. Travers. 1984. C e l l 38: 391-398. 82. Duncan, R., and J.W.B. Hershey. 1984. J. B i o l . Chem. 259: 11882-11889. 83. Dura, J.-M. 1981. Mol. Gen. Genet. 184= 381-385. 84. Ellgaard, E.G. 1972. Chromosoma 37.: 417-422. 85. Emmons, S.W., M.P. Klass, and D. Hirsch. 1979. Proc. Nat. Acad. S c i . U.S.A. 76: 1333-1337. 86. Emmons, S.W., L. Yesner, K. Ruan, and D. Katzenberg. 1983. C e l l 32: 55-65. 87. Epstein, P., R. Reddy, D. Henning, and H. Bush. 1980. J. B i o l . Chem. 255: 8901-8906. 88. Ernst, J.F., J.W. Stewart, and F. Sherman. 1981. Proc. Nat. Acad. S c i . U.S.A. 78: 6334-6338. 89. Ernst, V., E. Zukofsky-Baum, and P. Reddy. 1982. i n Heat Shock: From  Bacteria to Man (Schlesinger, M.J., M. Ashburner, and A. T i s s i e r e s , eds.) pp. 215-225, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 90. Farrell-Towt, J . , and M.M..Sanders. 1984. Mol. C e l l . B i o l . 4: 2676-2685. 91. F a r r e l l y , F.W., and D.B. F i n k e l s t e i n . 1984. J. B i o l . Chem. 259: 5745-5751. 92. Faulkner, F.G., and H. Biessmann. 1980. Nucleic Acids Res. 8: 943-955. 93. Faulkner, F.-G., H. Saumweber, and H. Biessman. 1981. J . C e l l B i o l . 91: 175-183. 94. Fink, K., and E. Zeuthen. 1980. Exp. C e l l Res. 128: 23-30. 95. F i n l e y , D., A. Ciechanover, and A. Varshavsky. 1984. C e l l 37: 43-55. 96. Flanagan, J.G., M.-P. Lefranc, and T.H. Rabbitts. 1984. C e l l 36: 681-688. 148 97. Ford, M., and M. Fried . 1986. C e l l 45: 425-430. 98. Francis, D., and L. L i n . 1980. Dev. B i o l . 79: 238-242. 99. Gamier, J . , D.J. Osguthorpe, and B. Robson. 1978. J. Mol. B i o l . 120: 97-120. 100. Garrels, J . I . , and T. Hunter. 1979. Biochim. Biophys. Acta. 564: 517-525. 101. Glover, C.V.C. 1982a. i n Heat Shock: From Bacteria to Man (Schlesinger, M.J., M. Ashburner, and A. T i s s i e r e s , eds.) pp. 227-234, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 102. Glover, C.V.C. 1982b. Proc. Nat. Acad. S c i . U.S.A. 79: 1781-1785. 103. Goff, S.A., L.P. Casson, and A.L. Goldberg. 1984. Proc. Nat. Acad. S c i . U.S.A. 81: 6647-6651. 104. Goff, S.A., and A.L. Goldberg. 1985. C e l l 41: 587-595. 105. Goldschmidt-Clermont, M. 1980. Nucleic Acids Res. 8: 235-252. 106. Grosschedl, R., and M.L. B i r n s t i e l . 1980. Proc. Nat. Acad. S c i . U.S.A. 77.: 1432-1436. 107. Grossman, A.D., J.W. Erickson, and C.A. Gross. 1984. C e l l 38: 383-390. 108. Grunstein, M., and D.S. Hogness. 1975. Proc. Nat. Acad. S c i . U.S.A. 79: 3961-3965. 109. Guedon, G., D. Sovia, J.P. Ebel, N. Befort, and P. Remy. 1985. EMBO J. 4: 3743-3749. 110. Guidice, G., M.C. Roccheri, and M.G. DiBernardo. 1980. C e l l . B i o l . Int. Rep. 4: 69-74. 111. Gurley, W..B., E. Czarnecka, R.T. Nagao, and J.L. Key. 1986. Mol. C e l l . B i o l . 6: 559-565. 112. Guttman, S.D., C. Glover, CD. A l l i s , and M.A. Gorovsky. 1980. C e l l 22: 299-307. 113. Hackett, R.W., and J.T. L i s . 1983. Nucleic Acids Res. 11: 7011-7030. 114. H a l l , B.G. 1983. J. B a c t e r i d . 156.: 1363-1365. 115. Harada, F., N. Kato, and S. Nishimura. 1980. Biochim. Biophys. Res. Commun. 95: 1332-1340. 116. H e i k k i l a , J . J . , G.A. Schultz, K. Iatrou, and L. Gedamu. 1982. J. B i o l . Chem. 257: 12000-12005. 149 117. H e i k k i l a , J . J . , M. Kloc, J. Bury, G.A. Schultz, and L.W. Browder. 1985. Dev. B i o l . 107: 483-489. 118. Hickey, E.D., and L.A. Weber. 1982. Biochemistry 21: 1521-1529. 119. Hickey, E., S.E. Brandon, R. Potter, G. Stein, J. Stein, and L.A. Weber. 1986. Nucleic Acids Res. 14: 4127-4145. 120. Hightower, L.E. 1980. J. C e l l . Physiol. 102: 407-427. 121. Hightower, L.E., P.T. Guidon, S.A. Whelan, and C.N. White. 1985. i n Changes i n Eukaryotic Gene Expression i n Response to Environmental  Stress (Atkinson, B.G., and D.B. Walden, eds.) pp. 197-210, Academic Press, New York. 122. Hiromi, Y., and Y. Hotta. 1985. EMBO J. 4: 1681-1687. 123. Hiromi, Y., H. Okamoto, W.J. Gehring, and Y. Hotta. 1986. C e l l 44: 293-301. 124. Hodgetts, R.B., B. Sage, and J.D. O'Connor. 1977. Dev. B i o l . 60, 310-317. 125. Hoffman, E.P., and V.G. Corces. 1984. Mol. C e l l . B i o l . 4: 2883-2889. 126. Hoffman, E.P., and V.G. Corces. 1986. Mol. C e l l . B i o l . 6: 663-673. 127. Holmgren, R., K. Livak, R. Morimoto, R. Freund, and M. Meselson. 1979. C e l l 18: 1359-1370. 128. Holmgren, R., V. Corces, R. Morimoto, R. Blackman, and M. Meselson. 1981. Proc. Nat. Acad. S c i . U.S.A. 78: 3775-3778. 129. Hultmark, D., R. Klemenz, and W.J. Gehring. 1986. C e l l 44: 429-438. 130. Hunt, C , and R.I. Morimoto,, 1985. Proc. Nat. Acad. S c i . U.S.A. 82: 6455-6459. 131. Iatrou, K., S.G. T s i t i l o u , and F.C. Kafatos. 1984. . Proc. Nat. Acad. S c i . U.S.A. 81: 4452-4456. 132. Ingo l i a , T.D., E.A. Craig, and B.J. McCarthy. 1980. C e l l 21:. 669-679. 133. Ingolia, T.D., and E.A. Craig. 1982a. Proc. Nat. Acad. S c i . U.S.A. 79: 525-529. 134. Ingolia, T.D., and E.A. Craig. 1982b. Proc. Nat. Acad. S c i . U.S.A. 7_9: 2360-2364. 135. Ingolia, T.D., M.J. Slater, and E.A. Craig. 1982. Mol. C e l l . B i o l . 2: 1388-1398. 150 136. Ireland, R.C., and E. Berger. 1982. Proc. Nat. Acad. S c i . U.S.A. 79: 855-859. 137. Ireland, R.C., E. Berger, K. S i r o t k i n , M.A. Yund, D. Osterbur, and J. Fristrom. 1982. Dev. B i o l . 93: 498-507. 138. Ish-Horowicz, D., and S.M. Pinchin. 1980. J. Mol. B i o l . 142: 231-245. 139. Johnston, D., H. Oppermanh, J. Jackson, and W. Levinson. 1980. J. B i o l . Chem. 255: 6975-6980. 140. Jones, D., R.H. Russnak, R.J. Kay and E.P.M. Candido. 1986. J. B i o l . Chem., 261: 12006-12015. 141. Kapoor, M. 1983. Int. J . Biochem. 15: 639-649. 142. Karin, M., A. Haslinger, H. Holtgreve, R.I. Richards, P. Krauter, H.M. Westphal, and M. Beata. 1984. Nature 308: 513-519. 143. K a r l i k , C.C., M.D. Coutu, and E.A. Fyrborg. 1984. C e l l 38: 711-719. 144. Karn, J . , S. Brenner, L. Barnett, and G. Cesareni. 1980. Proc. Nat. Acad. S c i . U.S.A. 77: 5172-5176. 145. Kay, R.J., R.J. Boissy, R.H. Russnak, and E.P.M. Candido. 1986. Mol. C e l l . B i o l . , 6: 3134-3143. 146. Kelley, P.M., and M.J. Schlesinger. 1978. C e l l 15: 1277-1285. 147. Kelley, P.M., G. A l i p e r t i , and M.J. Schlesinger. 1980. J. B i o l . Chem. 255: 3230-3233. 148. Kelley, P.M., and M.J. Schlesinger. 1982. Mol. C e l l . B i o l . 2: 267-274. 149. Kennedy, I.M., R.H. Burdon, and D.P. Leader. 1984. FEBS Lett. 169: 267-273. 150. Key, J.L., C.Y. L i n , and Y.M. Chen. 1981. Proc. Nat. Acad. S c i . U.S.A. 78: 3526-3530. 151. Key, J.L., E. Czarnecka, C.-Y. Li r i , J. Kimpel, C. Mothershed, and F. Sc h o f f l . 1983. i n Current Topics i n Plant Biochemistry and  Physiology, Vol. 2 (Randall, D.D., D.G. Blevins, R.L. Larson, and R.J. Rapp., eds.) pp. 107-117, University of Missouri Press, Columbia. 152. Kim, Y.-J., J. Shuman, M. Sette, and A. Przybyla. 1983. J. C e l l B i o l . 96: 393-400. 153. Kim, Y.-J., J. Shuman, M. Sette, and A. Przybyla. 1984. Mol. C e l l . B i o l . 4: 468-474. 151 154. King, C.R., T. Schinohara, and J. Piatigorsky. 1982. Science 215: 985-987. 155. King, C.R., and J. Piatigorsky. 1983. C e l l 32: 707-712. 156. Kirk, M.M., and D.L. Kirk. 1985. C e l l 41: 419-428. 157. Klar, A.J.S., and J.N. Strathern. 1984. Nature 310: 744-748. 158. K l e i n , H.L. 1984. Nature 310: 748-753. 159. Klemenz, R., D. Hultmark, and W.J. Gehring. 1985. EMBO J. 4: 2053-2060. 160. Klemenz, R., and W.J. Gehring. 1986. Mol. C e l l . B i o l . 6: 2011-2019. 161. Kodama, R., and G. Eguchi. 1983. Dev. Growth D i f f e r . 25: 261-270. 162. Kothary, R.K., and E.P.M. Candido. 1982. Can. J. Biochem. C e l l . B i o l . 60: 347-355. 163. Kothary, R.K., D. Jones, and E.P.M. Candido. 1984. Mol. C e l l . U i o l . 4: 1785-1791. 164. Krawinkel, U., G. Zoebelein, and A.L.M. Bothwell. 1986. Nucleic Acids Res. 14: 3871-3882. 165. Kruger, C , and B.-J. Benecke. 1981. C e l l 23: 595-603. 166. Kurtz, A., J. Rossi, L. Petko, and S. Lindquist. 1986. Science 231: 1154-1157. 167. Laemmli, U.K. 1970. Nature 227: 680-685. 168. Lalanne, J.L., F. Bregegere, C. Delarbre, J.P. Abastado, G. Gachelin, and P. Kourilsky. 1982. Nucleic Acids Res. 10: 1039-1049. 169. Lamarche, S., P. Chretien, and J. Landryl. 1985. Biochem. Biophys. Res. Commun. 131; 868-876. 170. Landick, R., V. Vaughn, E.T. Lau, R.A. Van Bogelen, J.W. Erickson, and F.C. Neidhart. 1984. C e l l 38: 175-182. 171. Lawson, R., R. M e s t r i l , P. S c h i l l e r , and R. Voellmy. 1984. Mol. Gen. Genet. 198: 116-124. 172. Lee, P.C., B.R. Bochner, and B.N. Ames. 1983. Proc. Nat. Acad. S c i . U.S.A. 80: 7496-7500. 173. Leicht, B.G., H. Biessmann, K.B. Palte r , and J.J . Bonner. 1986. Proc. Nat. Acad. S c i . U.S.A. 83: 90-94. 152 174. Leigh-Brown, A.J., and D. Ish-Horowicz. 1981. Nature 290: 677-682. 175. Lemaux, P.G., S.L. Herendeen, P.L. Bloch, and F.C. Niedhardt. 1978. C e l l 13_: 427-434. 176. Levinson, W., H. Oppermann, and J . Jackson. 1978a. Biochim. Biophys. Acta 518: 401-412. 177. Levinson, W., P. Mikelens, H. Oppermann, and J. Jackson. 1978b. Biochim. Biophys. Acta 519: 65-75. 178. Levinson, W., J. I d r i s s , and J. Jackson. 1979. B i o l . Trace Elements Res. 1: 15-23. 179. Levinson, W., H. Opperman, and J . Jackson. 1980. Biochim. Biophys. Acta 606: 170-180. "180. L i , G.C., and Z. Werb. 1982. Proc. Nat. Acad. S c i . U.S.A. 79: 3218-3222. 181. L i , G.C., and A. Lazlo. 1985. J. C e l l . Physiol. 122: 91-97. 182. Liao, L.W., B. Rosenweig, and D. Hirsh. 1983. Proc. Nat. Acad. S c i . U.S.A. 80: 3585-3589. 183. Liebhaber, S.A., M.J. Goossens, and Y.W. Kan. 1980. Proc. Nat. Acad. S c i . U.S.A. 77.: 7054-7058. 184. Liebhaber, S.A., M.J. Goossens, and Y.W. Kan. 1981. Nature 290: 26-29. 185. Lindquist, S.L. 1980. J. Mol. B i o l . 137: 151-158. 186. Lindquist, S. 1981. Nature 293: 311-314. 187. Liskay, R.M., and J.L. Stachelek. 1983. C e l l 35: 157-165. 188. Livak, K.F., R. Freund, M. Schweber, P.C. Wensink, and M. Meselson. 1978. Proc. Nat. Acad. S c i . U.S.A. 75: 5613-5617. 189. Loomis, W.F., and S.A. Wheeler. 1980. Dev. B i o l . 79: 399-408. 190. Loomis, W.F., and S.A. Wheeler. 1982. Dev. B i o l . 90: 412-418. 191. Lowe, D.G., and L.A. Moran. 1984. Proc. Nat. Acad. S c i . U.S.A. 81: 2317-2321. 192. Lowe, D.G., and L.A. Moran. 1986. J. B i o l . Chem. 261: 2102-2112. 193. Maniatis, T., A. J e f f r e y , and H. van de Sande. 1975. Biochemistry 14: 3787-3794. 153 194. Maniatis, T., E.F. F r i t s c h , and J. Sambrook. 1982. Molecular Cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 195. Manski, W., and K. Malinowsky. 1978. Immunochem. 15: 781-786. 196. Mason, P.J., L.M.C. H a l l , and J . Gausz. 1984. Mol. Gen. Genet. 194: 73-78. 197. Matsumoto, Y., H. Yasuda, T. Marunouchi, and M. Yamada. 1983. FEBS Lett. 151: 139-142. 198. Maxam, A., and W. G i l b e r t . 1980. Methods Enzymol. 65: 499-560. 199. McAlister, L. , and D.B. F i n k e l s t e i n . 1980a. J. B a c t e r i d . 143: 603-612. 200. McAlister, L., and D.B. F i n k e l s t e i n . 1980b. Biochim. Biophys. Res. Commun. 93: 819-824. 201. McCormick, W., and S. Penman. 1969. J. Mol. B i o l . 39: 315-333. 202. McGarry, T.J., and S. Lindquist. 1985. C e l l 42: 903-911. 203. McGinnis, W., A.W. Shermoen, J. Heemskerk, and S.K. Beckendorf. 1983. Proc. Nat. Acad. S c i . U.S.A. 80: 1063-1067. 204. McKenzie, S.L., S. Henikoff, and M. Meselson. 1975. Proc. Nat. Acad. S c i . U.S.A. 72: 1117-1121. 205. McKenzie, S.L., and M. Meselson. 1977. J . Mol. B i o l . 117: 279-283. 206. McMaster, G.K., and G.G. Carmichael. 1977. Proc. Nat. Acad. S c i . U.S.A. 74: 4835-4838. 207. Mellor, A.L., E.H. Weiss, K. Ramachandran, and R.A. F l a v e l l . 1983. Nature 306: 792-795. 208. Messing, J. 1983. Meth. Enzymol. 101; 20-78. 209. M e s t r i l , R. , P. S c h i l l e r , J. Amin, H. Klapper, J. Ananthan, and R. Voellmy. 1986. EMBO J. 5: 1667-1673. 210. M i l l e r , M.J., N. Xueng, and Geiduschek. 1979. Proc. Nat. Acad. S c i . U.S.A. 72: 1117-1121. 211. Minton, K.W., P. Karmin, G.M. Hahn, and A.P. Minton. 1982. Proc. Nat. Acad. S c i . U.S.A. 79: 7107-7111. 212. Mirault, M.-E., M. Goldschmidt-Clermont, L. Moran, A.P. Arrigo, and A. T i s s i e r e s . 1978. Cold Spring Harbor Symp. Quant. B i o l . 42: 819-827. 154 213. Mirault, M.-E., R. Southgate, and E. Delwart. 1982. EMBO J. 1: 1279-1285. 214. Mitchel, R.E.J., and D.P. Morrison. 1982. Radiat. Res. 90: 284-291. 215. M i t c h e l l , H.K., and L.S. Lipps. 1975. Biochem. Genet. 13: 585-602. 216. M i t c h e l l , J.K., G. Moller, N.S. Petersen, and L. Lipps-Sarmiento. 1979. Dev. Genet. 1: 181-192. 217. Moran, L., M.-E. Mirault, A.P. Arrigo, M. Goldschmidt-Clermont, and A. T i s s i e r e s . 1978. P h i l . Trans. Roy. Soc. Lond. B 283: 391-406. 218. Moran, L., M.-E. Mirault, A. T i s s i e r e s , J. L i s , P. Schedl, S. Artavanis-Tsakonas, and W.J. Gehring. 1979. C e l l 17.: 1-8. 219. Mount, S.M. 1982. Nucleic Acids Res. 10: 459-472. 220. Muskavitch, M., and D. Hogness. 1982. C e l l 29; 1041-1051. 221. Nazario, M., and J.A. Evans. 1974. J. B i o l . Chem. 249: 4934-4942. 222. Neidhardt, F.C., and R.A. Van Bogelson. 1981. Biochim. Biophys. Res. Commun. 100: 894-900. 223. Neidhardt, F.C., R.A. Van Bogelen, and V. Vaughn. 1984. Annu. Rev. Genet. 18: 295-329. 224. Nordheim, A., and A. Rich. 1983. Nature 303: 674-678. 225. Notarianni, E.L., and CM. Preston. 1982. Virology 123: 113-122. 226. Nover, L., K.-D. Scharf, and D. Neumann. 1983. Mol. C e l l . B i o l . 3: 1648-1655. 227. O ' F a r r e l l , P.H. 1975. J . B i o l . Chem. 250: 4007-4021. 228. Ohshima, Y., N. Okada, T. Tani, Y. Itoh, and M. Itoh. 1981. Nucleic Acids Res. 9: 5145-5157. 229. O l i o , R., and F. Rougeon. 1983. C e l l 32: 515-523. 230. Olsen, A.S., D.F. Triemer, and M.M. Sanders. 1983. Mol. C e l l . B i o l . 3: 2017-2027. 231. 0'Malley, K., A. Mauron, J.D. Barchas, and L. Kedes. 1985. Mol. C e l l . B i o l . 5: 3476-3483. 232. Oppermann, H., W. Levinson, and J.M. Bishop. 1981. Proc. Nat. Acad. S c i . U.S.A. 78: 1067-1071. 155 233. Palmiter, R.D. 1977. J . B i o l . Chem. 252: 8781-8783. 234. Pa l t e r , K.B., M. Watanabe, L. Stinson, A.P. Mahowald, and E.A. Craig. 1986. Mol. C e l l . B i o l . 6: 1187-1203. 235. Parker, C.S., and J. Topol. 1984. C e l l 37: 273-283. 236. Pelham, H.R.B., and R.J. Jackson. 1976. Eur. J. Biochem. 6_7: 247-256. 237. Pelham, H.R.B., and M. Bienz. 1982. EMBO J. 1: 1473-1477. 238. Pelham, H.R.B. 1982. C e l l 30: 517-528. 239. Petko, L. and S. Lindquist. 1986. C e l l 45: 885-894. 240. P h i l l i p s , T.A., R.A. Van Bogelen, and F.C. Neidhart. 1984. J. Ba c t e r i o l . 159: 283-287. 241. Plesset, J., C. PaLm, and C.S. McLaughlin. 1982. Biochim. Biophys. Res. Commun. 108: 1340-1345. 242. Proudfoot, N.J., and G.G. Brownlee. 19/6. Nature 263: 211-214. 243. Quax-Jeuken, Y., W. Quax, G. van Rens, P.M. Khan, and H. Bloemendal. 1985. Proc. Nat. Acad. S c i . U.S.A. 82: 5819-5823. 244. Rapaport, E., S.K. Svihovec, and P.C. Zamecnik. 1975. Proc. Nat. Acad. S c i . U.S.A. 72: 2653-2657. 245. Rensing, L. 1973. C e l l D i f f e r e n t i a t i o n 2: 221-228. 246. Richter, W.W., K.D. Zang, and O.-G. Issinger. 1983. FEBS Le t t . 153: 262-266. 247. Riddihough, G. and H.R.B. Pelham. 1986. EMBO J. 5: 1653-1658. 248. Rigby, P.W.J., M. Dieckmann, C. Rhodes, and P. Berg. 1977. J. Mol. B i o l . 113: 237-251. 249. Ritossa, F.M. 1962. Experientia 18: 571-573. 250. Ritossa, F.M. 1963. Drosophila Information Service 37.: 122-123. 251. Rodenhiser, D., J.H. Jung, and B.G. Atkinson. 1985. Can. J. Biochem. C e l l B i o l . 63: 711-722. 252. Rose, A.M., D.L. B a i l l i e , E.P.M. Candido, K.A. Beckenbach, and D. Nelson. 1982. Mol. Gen. Genet. 188: 286-291. 156 253. Rosen, E., A. Sivertsen, R.A. F i r t e l , S. Wheeler, and W.F. Loomis. 1985. i n Changes i n Eukaryotic Gene Expression i n Response to  Environmental Stress (Atkinson, B.G., and D.B. Walden, eds.) pp. 257-278, Academic Press, New York. 254. Rubenstein, P., and J. Deuchler. 1979. J. B i o l . Chem. 254: 11142-11147. 255. Ruppert, S., G. Scherer, and G. Schiitz. 1984. Nature 308: 554-557. 256. Sanders, M.M. 1981. J. C e l l . B i o l . 91: 579-583. 257. Sanders, M.M., D.F. Triemer, and A.S. Olsen. 1986. J. B i o l . Chem. 261: 2189-2186. 258. Sanger, F., S. Nicklen, and A.P. Coulson. 1977. Proc. Nat. Acad. S c i . U.S.A. 74: 5463-5467. 259. Scharf, K.-D., and L. Nover. 1982. C e l l 30: 427-437. 260. Schedl, P., S. Artavanis-Tsakonas, R. Stewart, W.J. Gehring, M.-E. Mirault, J. Goldschmidt-Clermont, L. Moran, and A. T i s s i e r e s . 1978. C e l l 14: 921-929. 261. Schlesinger, M.J., G. A l i p e r t i , P.M. Kelley. 1982. Trends Biochem. S c i . 7: 222-225. 262. Schlesinger, M.J. 1985. i n Changes i n Eukaryotic Gene Expression i n  Response to Environmental Stress (Atkinson, B.G., and D.B. Walden, eds.) pp. 183-195, Academic Press, New York. 263. Schmid, H.P., 0. Akhayat, C. Martin De Sa, F. Puvion, K. Koehler, and K. Scherrer. 1984. EMBO J. 3: 29-34. 264. Schoenmakers, J.G.G., and H. Bloemendal. 1968. Nature 220: 790-791. 265. S c h o f f l , F., and J.L. Key. 1982. J. Mol. Appl. Genet. 1: 301-314. 266. S c h o f f l , F., E. Rashke, and R.T. Nagao. 1984. EMBO J. 3: 2491-2497. 267. Schon, E.A., S.M. Wernke, and J.B. L i n g r e l . 1982. J. B i o l . Chem. 257: 6825-6835. 268. Schuldt, C , and P.-M. K l o e t z e l . 1985. Dev. B i o l . 110: 65-74. 269. Schulze, D.H., L.R. Pease, S.S. Geier, A.A. Reyes, L.A. Sarmiento, R.B. Wallace, and S.G. Nathenson. 1983. Proc. Nat. Acad. S c i . U.S.A. 80: 2007-2011. 270. Scott, M.P., J.M. F o s t e l , and M.L. Pardue. 1980. C e l l 22: 929-941. 157 271. Scott, M.P., and M.L. Pardue. 1981. Proc. Nat. Acad. S c i . U.S.A. 78: 3353-3357. 272. S e r f l i n g , E., M. Jasin, and W. Schaffner. 1985. Trends Genet. 1: 224-230. 273. Shen, S.-H., J.L. Slightom, and 0. Smithies. 1981. C e l l 26.: 191-203. 274. Simcox, A.A., CM. Cheney, E.P. Hoffman, and A. Shearn. 1985. Mol. C e l l . B i o l . 5: 3397-3402. 275. Simon, J.A., C.A. Sutton, R.B. L o b e l l , R.L. Glaser, and J.T. L i s . 1985. C e l l 40: 805-817. 276. S i n i b a l d i , R. , and P.W. Morris. 1981. J. B i o l . Chem. 256.: 10735-10738. 277. S i r o t k i n , K., and N. Davidson. 1982. Dev. B i o l . 89: 196-210. 278. Slater, A., A.C.B. Cato, CM. S i l l a r , J. Kieussis, and R.H. Burdon. 1981. Eur. J. Biochem. 117: 341-346. 279. Slightom, J.L., A.E. B l e c h l , and 0. Smithies. 1980. C e l l 21: 627-638. 280. Snutch, T.P., and D.L. B a i l l i e . 1983. Can. J. Biochem. C e l l . B i o l . 61: 480-487. 281. Snutch, T.P., and D.L. B a i l l i e . 1984. Mol. Gen. Genet. 195: 329-335. 282. Southern, E.M. 1975. J . Mol. B i o l . 98: 503-518. 283. Southgate, R., A. Ayme, and R. Voellmy. 1983. J. Mol. B i o l . 165: 35-57. 284. Southgate, R., M.-E. Mirault, A. Ayme and A. T i s s i e r e s . 1985. i n Changes i n Eukaryotic Gene Expression i n Response to Environmental  Stress (Atkinson, B.G., and D.B. Walden, eds.) pp. 1-30, Academic Press, New York. 285. Spieth, J . , K. Denison, E. Zucker, and T. Blumenthal. 1985. Nucleic Acid.s Res. 13: 7129-7138. 286. Spradling, A., S. Penman, and M.L. Pardue. 1975. C e l l 4: 395-404. 287. Spradling, A., M.L. Pardue, and S. Penman. 1977. J. Mol. B i o l . 109: 559-587. 288. S t e l l e r , H., and V. P i r r o t t a . 1985. EMBO J. 4: 3765-3772. 289. Stinchcomb, D.T., J.E. Shaw, S.H. Carr, and D. Hirsh. 1985. Mol. C e l l . B i o l . 5: 3484-3496. 158 290. S t o r t i , R.V., M.P. Scott, A. Rich, and M.L. Pardue. 1980. C e l l 22: 825-834. 291. Sulston, J.E., and S. Brenner. 1974. Genetics 77: 95-104. 292. Sulston, J.E., E. Schierenberg, and J.G. White. 1983. Dev. B i o l . 100: 64-119. 293. Tanguay, R.M., and M. Vincent. 1981. Can. J. Biochem. C e l l B i o l . 59: 67-73. 294. Tanguay, R.M., and M. Vincent. 1982. Can. J. Biochem. C e l l B i o l . 60: 306-315. 295. Thomas, G.P., and M.B. Mathews. 1982. i n Heat Shock: From Bacteria  to Man (Schlesinger, M.J., M. Ashburner, and A. T i s s i e r e s , eds.) pp. 207-213, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 296. Thomas, P.S. 1980. Proc. Nat. Acad. S c i . U.S.A. 77: 5201-5205. 297. Tilghman, S.M., P.J. C u r t i s , D.C. Tiemeier, P. Leder, and C. Weissmann. 1978. Proc. Nat. Acad. S c i . U.S.A. 75: 1309-1313. 298. T i l l y , K., N. McKittrick, M. Z y l i c z , and C. Georgopoulos. 1983. C e l l 34.: 641-646. 299. T i s s i e r e s , A., H.K. M i t c h e l l , and U.M. Tracy. 1974. J. Mol. B i o l . 84: 389-398. 300. Topol. J . , D.M. Ruden, and C.S. Parker. 1985. C e l l 42: 527-537. 301. Tu, S.-P.D., and S.N. Cohen. 1980. Gene 10: 177-183. 302. Ungewickell, E. 1985. EMBO J. 4: 3385-3391. 303. Van Bogelen, R.A., V. Vaughn, and F.C. Neidhardt. 1983. J. B a c t e r i o l . 153: 1066-1068. 304. van den Heuvel, R., W. Hendriks, W. Quax, and H. Bloemendal. 1985. J. Mol. B i o l . 185: 273-284. 305. van der Ouderaa, F.J., W.W. de Jong, A. Hilderink, and H. Bloemendal. 1973. Eur. J. Biochem. 39: 207-211. 306. Velazquez, J.M., B.J. DiDomenico, and S. Lindquist. 1980. C e l l 20: 679-689. 307. Vincent, M., and R.M. Tanguay. 1979. Nature 281: 501-503. 308. Vitek, M.P. , and. E.M. Berger. 1984. J. Mol. B i o l . 178: 173-189. 159 309. Voellmy, R., M. Goldschmidt-Clermont, R. Southgate, A. T i s s i e r e s , R. Levis, and W. Gehring. 1981. C e l l 23: 261-270. 310. Voellmy, R., and P.A. Bromley. 1982. Mol. C e l l . B i o l . 2: 479-483. 311. Voellmy, R., A. Ahmed, P. S c h i l l e r , P. Bromley, and D. Rungger. 1985. Proc. Nat. Acad. S c i . U.S.A. 82: 4949-4953. 312. Wadsworth, S., E.A. Craig, and B.J. McCarthy. 1980. Proc. Nat. Acad. S c i . U.S.A. 7_7: 2134-2137. 313. Walsh, C. 1980. J. B i o l . Chem. 255: 2629-2632. 314. Walter, M.F., and H. Biessmann. 1984. J. C e l l B i o l . 99: 1468-1477. 315. Wang, A.H.-J., G.J. Quigley, F.J. Kolpak, J.L. Crawford, J.H. van Boom, G. van der Marel, and A. Rich. 1979. Nature 282, 680-686. 316. Wang, C , R.H. Gomer, and E. Lazarides. 1981. Proc. Nat. Acad. S c i . U.S.A. 78: 3531-3535. 317. Wang, S.-W., A.J. Robins, R. d'Andrea, and J.R.E. Wells. 1985. Nucleic A c i d 3 Res. 13: 1369-1386. 318. Wannemacher, C.F. , and A. Spector. 1968. Exp. Eye Res. ]_: 623-625. 319. Welch, W.J. 1985. J. B i o l . Chem. 260: 3058-3062. 320. Welch, W.J., and J.R. Feramisco. 1985. Mol. C e l l . B i o l . 5: 1571-1581. 321. White, C.N., and L.E. Hightower. 1984. Mol. C e l l . B i o l . 4: 1534-1541. 322. Widelitz, R.B., B.E. Magun, and E.W. Gerner. 1986. Mol. C e l l . B i o l . 6: 1088-1094. 323. Widera, G.T., and R.A. F l a v e l l . 1984. EMBO J. 3: 1221-1225. 324. Wistow, G. 1985. FEBS Le t t . 181: 1-6. 325^_Wu, B., C. Hunt, and R. Morimoto. 1985. Mol. C e l l . B i o l . 5: 330-341. 326. Wu, C. 1984. Nature 309: 229-234. 327. Xiao, C.-M., and J.P. Mascarenhas. 1985. Plant Physiol. 78: 887-890. 328. Yamamori, T., K. Ito, Y. Nakamura, and T. Yura. 1978. J. B a c t e r i o l . 134: 1133-1140. 329. Yamamori, T., and T. Yura. 1982. Proc. Nat. Acad. S c i . U.S.A. 79: 860-864. 330. Yost, H.J., and S. Lindquist. 1986. C e l l 45: 185-193. 160 331. Young, E.T., T. Mattson, G. Selzer, G. Van Houwe, A. Bo l l e , and R. Epstein. 1980. J. Mol. B i o l . 138: 423-445. 332. Yura, T., T. Tobe, K. Ito, and T. Osawa. 1984. Proc. Nat. Acad. S c i . U.S.A. 81: 6803-6807. 333. Zhimulev, I., and V.E. Grafadatskaya. 1974. Drosophila Information Service 51: 96. 334. Zimmerman, J.L., W. P e t r i , and M. Meselson. 1983. C e l l 32: 1161-1170. 335. Z o l l e r , M.J., and M. Smith. 1983. Meth. Enzymol. 100: 468-500. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0097509/manifest

Comment

Related Items