UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The cloning and characterization of an endoglucanase gene of Cellulomonas fimi Wong, Wan Keung Raymond 1986

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1986_A1 W64.pdf [ 9.46MB ]
Metadata
JSON: 831-1.0097344.json
JSON-LD: 831-1.0097344-ld.json
RDF/XML (Pretty): 831-1.0097344-rdf.xml
RDF/JSON: 831-1.0097344-rdf.json
Turtle: 831-1.0097344-turtle.txt
N-Triples: 831-1.0097344-rdf-ntriples.txt
Original Record: 831-1.0097344-source.json
Full Text
831-1.0097344-fulltext.txt
Citation
831-1.0097344.ris

Full Text

THE CLONING AND CHARACTERIZATION OF AN ENDOGLUCANASE GENE OF CELLULQMQNAS FIMI by WAN KEUNG RAYMOND WONG M . S c , The U n i v e r s i t y of R e g i n a , 1982 THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of M i c r o b i o l o g y ) We accept t h i s t h e s i s as conforming to the r e q u i r e d s t a n d a r d THE UNIVERSITY _ 0 |F ' v B R l) ,ISH Cobt^MBIA June 1986 ©Wan Keung Raymond Wong, 1986 In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f the requirements f o r an advanced degree a t the U n i v e r s i t y o f B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and study. I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e copying o f t h i s t h e s i s f o r s c h o l a r l y purposes may be granted by the head o f my department o r by h i s or her r e p r e s e n t a t i v e s . I t i s understood t h a t copying o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l not be allowed without my w r i t t e n p e r m i s s i o n . Department o f i UAsO The U n i v e r s i t y o f B r i t i s h Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date E-6 (3/81) Abs t r a c t Recombinant plasmid pEC2, which was formed by i n s e r t i n g a 5.2 kb BamHI fragment of C. fi m l DNA into the BamHI s i t e of pBR322, expresses endoglucanase a c t i v i t y in E. c o l 1 (55). Three d e l e t i o n mutants of pEC2, designated pEC2.1, pEC2.2 and pEC2.3, c o n t a i n i n s e r t s of C. f i m i DNA of 1.9, 2.4 and 3.5 kb, r e s p e c t i v e l y . pEC2 and the d e l e t i o n mutants expressed the same l e v e l of endoglucanase a c t i v i t y . The' a c t i v e p o l y p e p t i d e produced by the four plasmids had a Mr of 53,000. R e s t r i c t i o n analyses showed that the a c t i v i t y was determined by a 1.4 kb fragment of the 5.2 kb C. f i m i i n s e r t which was common to a l l four plasmids. This 1.4 kb fragment Is contiguous with the N-termlnal coding r e g i o n of the T c R gene of pBR322. Promoter d e l e t i o n and f r a m e s h l f t i n g experiments showed that the T c R promoter and t r a n s l a t i o n a l s i g n a l s were r e q u i r e d f o r the expression of the endoglucanase a c t i v i t y . The a c t i v i t y was found in a f u s i o n polypeptide (53 kDa) comprised of the N-terminus of the T c R determinant and the endoglucanase, which was l a c k i n g i t s N-terminus. A p a r t i a l BamHI d i g e s t of C. f i m i DNA was used to i s o l a t e a new clone determining the same endoglucanase. As confirmed by Southern a n a l y s i s , the new plasmid, pcEC2, contained an a d d i t i o n a l 0 . 8 kb of C. f i m} DNA which was contiguous with the 5' end of the 5.2 kb i n s e r t of pEC2. The expression of endoglucanase a c t i v i t y by pcEC2 was dependent upon the T c R promoter but was independent of the T c R determinant t r a n s l a t i o n s i g n a l s . T h i s i n d i c a t e d that the e n t i r e coding sequence of the endoglucanase gene was con t a i n e d w i t h i n i i a 2.2 kb (0.8+1.4) fragment of C_. f lml DNA. The n u c l e o t i d e sequences of the 0.8 and 1.4 kb DNA fragments were determined by sequencing o v e r l a p p i n g d e l e t i o n s u s i n g the dideoxy t e r m i n a t i o n method. The o v e r l a p p i n g d e l e t i o n s of the 1.4 kb fragment were generated by the u n i d i r e c t i o n a l ExoIII method, whereas those of the 0.8 kb component were c r e a t e d by a novel method. The complete gene sequence i s 1347 bp long, with the f i r s t 226 bp contained in the 0.8 kb fragment and the remainder in the 1.4 kb fragment. The t o t a l G+C content of the gene i s 72.5%. This high G+C content i s r e f l e c t e d i n a very r e s t r i c t e d codon usage. The gene encodes a po l y p e p t i d e of 449 amino a c i d s , with the f i r s t 31 amino a c i d s c o n s t i t u t i n g a p u t a t i v e l e a d e r peptide which i s not found at the N-terminus of the mature enzyme p u r i f i e d from C_. f i m i . This l e a d e r p e p t i d e appears to f u n c t i o n in the export of the endoglucanase in E_. c o l i . A strong compression of n u c l e o t i d e s was found dur i n g the sequencing of the non-coding s t r a n d w i t h i n the r e g i o n encoding t h i s l e a d er p e p t i d e , and s u b c l o n i n g procedures were used to r e s o l v e the compression. The c a l c u l a t e d molecular weight of the p r e d i c t e d mature p r o t e i n (418 amino a c i d s ) i s 51,837. A s t r i k i n g p r o l i n e - t h r e o n i n e sequence repeat of 23 re s i d u e s occurs in the p r e d i c t e d amino a c i d sequence. This repeat i s very s i m i l a r to one found in the p r e d i c t e d amino a c i d sequence of a C_. f i m i exoglucanase (137). The f u n c t i o n s of these repeated p r o l i n e - t h r e o n i n e sequences are yet to be determined. Immunoadsorbent chromatography was used to p u r i f y i i i the endoglucanase from E_. c o l 1. The endoglucanase gene was subcloned i n Saccharomyces cerev i s l a e and Rhodobacter  c a p s u l a t u s . In 5. cerev i s i a e . the endoglucanase gene was fused to the yeast p r e p r o t o x i n gene; the encoded f u s i o n p o l y p e p t i d e was s e c r e t e d into the c u l t u r e medium using the s i g n a l peptide of the k i l l e r t o x i n . In R. c a p s u l a t u s , the endoglucanase gene was fused to the rxcA B870& gene; the encoded f u s i o n p o l y p e p t i d e i s presumed to be l a r g e l y c y t o p l a s m i c . i v Table of Contents Page, A b s t r a c t i i Table of Contents v L i s t of Tables v i i i L i s t of F i g u r e s x Acknowledgements x i i A b b r e v i a t i o n s X i i i 1. Introduct i on i 1.1. General background 1 1.2. The nature of c e l l u l o s i c m a t e r i a l s 3 1.2.1. The b a s i c s t r u c t u r e of c e l l u l o s e 3 1.2.2. C r y s t a l l i n e c e l l u l o s e 5 1.2.3. S t r u c t u r a l f e a t u r e s of c e l l u l o s i c m a t e r i a l s determining t h e i r s u s c e p t i b i l i t y to enzymatic h y d r o l y s i s 6 1.2.3.1. A c c e s s i b i l i t y to and moisture content of the c e l l u l o s e f i b e r s 6 1.2.3.2. C r y s t a l 1 i n i t y and degree of p o l y m e r i z a t i o n of c e l l u l o s e 7 1.3. Pretreatments of raw c e l l u l o s i c m a t e r i a l s 8 1.4. C e l l u l a s e s 8 1.4.1. D i s t r i b u t i o n of c e l l u l a s e s in nature 8 1.4.2. C e l l u l a s e components and t h e i r modes of a c t i o n 11 1.4.2.1. Types of c e l l u l a s e 11 1.4.2.2. Modes of a c t i o n of c e l l u l a s e s 13 1.4.2.2.1. Substrate s p e c i f i c i t i e s of 6 - g l u c o s i d a s e s 13 1.4.2.2.2. Substrate s p e c i f i c i t y of endoglucanases 14 1.4.2.2.3. Substrate s p e c i f i c i t y of c e l l o b i o h y d r o l a s e s 15 1.4.2.2.4. Substrate s p e c i f i c i t y of g l u c o h y d r o l a s e s 16 1.4.2.2.5. Mechanism of degra d a t i o n of c r y s t a l l i n e c e l l u l o s e 16 1.4.3. The c o m p l e x i t i e s of c e l l u l a s e systems 20 1.5. Cellulomonas 20 1.6. Recombinant DNA technology 26 1.6.1. In c e l l u l a s e r e s e a r c h 26 v Table of Contents ( c o n ' t ) Page 2. The c h a r a c t e r i z a t i o n of the endoglucanase gene 30 2 . 1 . Background 30 2 . 2 . M a t e r i a l s and methods 34 2 . 2 . 1 . B a c t e r i a l s t r a i n s 34 2 . 2 . 2 . Media and growth c o n d i t i o n s 34 2 . 2 . 3 . P lasmids 35 2 . 2 . 4 . A n t i s e r a 35 2 . 2 . 5 . Enzymes and reagents 35 2 . 2 . 6 . B u f f e r s 36 2 . 2 . 7 . E x t r a c t i o n of DNAs 36 2 . 2 . 8 . Gel e l e c t r o p h o r e s i s 36 2 . 2 . 9 . S u b c l o n i n g of pEC2 37 2 . 2 . 1 0 . C l o n i n g of the N- terminus of the endoglucanase gene 38 2 . 2 . 1 1 . Southern h y b r i d i z a t i o n of DNA 39 2 . 2 . 1 2 . Enzyme assays 39 2 . 2 . 1 3 . I d e n t i f i c a t i o n of the endoglucanase product encoded by pEC2 and i t s d e r i v a t i v e s 40 2 . 2 . 1 3 . 1 . The m a x i c e l l t echnique 40 2 . 2 . 1 3 . 2 . L y s i s of the l a b e l l e d c e l l s 41 2 . 2 . 1 3 . 3 . I m m u n o p r e c i p i t a t i o n 42 2 . 3 . R e s u l t s 44 2 . 3 . 1 . The l o c a l i z a t i o n of the endoglucanase gene in pEC2 44 2 . 3 . 2 . The e x p r e s s i o n of c e l l u l a s e a c t i v i t y by pEC2 and i t s d e l e t i o n d e r i v a t i v e s 50 2 . 3 . 3 . T r a n s c r i p t i o n a l and t r a n s l a t i o n a l s i g n a l s for the CMCase a c t i v i t y encoded by pEC2 56 2 . 3 . 4 . C l o n i n g of the N- terminus of the endoglucanase gene 59 2 .4 . D i s c u s s i o n 69 3. The s t r u c t u r e of the endoglucanase gene and the p u r i f i c a t i o n of the c l o n e d enzyme 71 3 . 1 . Background 71 3 . 2 . M a t e r i a l s and methods 73 3 . 2 . 1 . B a c t e r i a l s t r a i n s 73 3 . 2 . 2 . Media and growth c o n d i t i o n s 73 3 . 2 . 3 . Recombinant DNAs 73 3 . 2 . 4 . Enzymes and reagents 73 3 . 2 . 5 . B u f f e r s 74 3 . 2 . 6 . N u c l e o t i d e sequenc ing of the endoglucanase gene 74 3 . 2 . 6 . 1 . Exonuclease I II d e l e t i o n s t r a t e g y 74 3 . 2 . 6 . 2 . R e s t r i c t i o n d e l e t i o n s t r a t e g y 75 3 . 2 . 6 . 3 . Sequencing r e a c t i o n s 75 3 . 2 . 6 . 4 . Sequencing g e l s 76 vi Table of Contents (con't) Page 3.2.7. A n a l y s i s of c e l l s f o r the l o c a t i o n of enzyme a c t i v i t i e s 76 3.2.8. P u r i f i c a t i o n of pEC2 encoded endoglucanase 78 3.2.8.1. P r e p a r a t i o n of osmotic-shock f l u i d 78 3.2.8.2. Immunoadsorbent chromatography 79 3.3. Re s u l t s 81 3.3.1. The sequence of the endoglucanase gene 81 3.3.2. T r a n s c r i p t i o n a l and t r a n s l a t i o n a l s i g n a l s f o r the endoglucanase gene 102 3.3.3. The leader sequence of the endoglucanase gene 102 3.3.4. The Pro-Thr sequence of the endoglucanase gene 104 3.3.5. P u r i f i c a t i o n of the endoglucanase from E. c o l i 104 3.4. Discuss ion 115 4. The c l o n i n g and e x p r e s s i o n of the endoglucanase gene in organisms other than E. c o l i 118 4.1. Background 118 4.1.1. Saccharomyces cere v i s iae 118 4.1.2. Rhodobacter c a p s u l a t u s 119 4.2. M a t e r i a l s and methods 121 4.2.1. Organisms 121 4.2.2. Media and growth c o n d i t i o n s 121 4.2.3. Vectors 122 4.2.4. Enzymes and reagents 122 4.2.5. Plasmid t r a n s f e r and i s o l a t i o n 123 4.2.6. Measurement of CMCase a c t i v i t y 123 4.3. Results 124 4.3.1. Cloning and e x p r e s s i o n of the endoglucanase gene in S.. cere v i s iae 124 4.3.2. Cloning and e x p r e s s i o n of the endoglucanase gene in B- c a p s u l a t u ? 129 4.4. D i s c u s s i o n 142 5. References 144 6. Appendices 162 6.1. Appendix I. Glucose standard curve 163 6.2. Appendix I I . P r o t e i n standard curve 165 v i i L i s t of Tables I. A summary of the examples of v a r i o u s types of pretreatment methods Page I I . Examples of c e l l u l o l y t i c microorganisms in nature 1 2 I I I . C e l l u l a s e a c t i v i t y of the C i , Cx and 6-glucosidase components of j . s o l a n i c e l l u l a s e , alone and in combination 21 IV. The c e l l u l a s e system of T. v i r i d e 24 V. The c l o n i n g of c e l l u l a s e genes from v a r i o u s sources in E.. c o l i 28 VI. A Summary of v a r i o u s r e s t r i c t i o n s i t e s in pEC2 45 VI I . Generation of d e l e t i o n s In pEC2 47 V I I I . CMCase a c t i v i t i e s In clones h a r b o r i n g pEC2 and the d e l e t i o n mutants 53 IX. CMCase a c t i v i t i e s produced by v a r i o u s d e r i v a t i v e s of pEC2 58 X. CMCase a c t i v i t i e s determined by pcEC2 and i t s d e r i v a t i v e s 68 XI. Reaction mixes f o r M13-dldeoxy t e r m i n a t i o n sequencing 77 XII. The p r e d i c t e d amino a c i d composition of the mature endoglucanase 100 X I I I . The base composition of the endoglucanase gene 101 XIV. Codon usage f o r the endoglucanase gene 103 XV. The l o c a t i o n of enzyme a c t i v i t i e s in £. co11 C600 c a r r y i n g pEC2 and pcEC2 105 XVI. CMCase a c t i v i t y in E. c o l i C600 <pEC2> 108 XVII. E f f e c t of NaSCN on the CMCase a c t i v i t y of osmotic-shock f l u i d 111 XVIII. Summary of Immunoadsorpt1 on chromatography of CMCase a c t i v i t y from £. c o l i C600 (pEC2) 112 v i i i L i s t of Tables (con't) Page XIX. Synthesis of endoglucanase in yeast i s determined by the cloned C. f1m i gene 132 XX. C h a r a c t e r i z a t i o n of JR_. c a p s u l a t u s c l o n e s expressing CMCase a c t i v i t y 141 ix L i s t of Fi g u r e s Pag_e 1. The s t r u c t u r e of a c e l l u l o s e molecule 4 2. The C i - C * hypothesis f o r the degradation of c r y t s t a l 1 i n e c e l l u l o s e 18 3. Schematic r e p r e s e n t a t i o n of c e l l u l a s e a c t i o n on c r y s t a l l i n e c e l l u l o s e 22 4. CMC p l a t e assay 31 5. R e s t r i c t i o n map of pEC2 46 6. R e s t r i c t i o n a n a l y s i s of pEC2 and i t s d e l e t i o n mutants 49 7. S t r u c t u r e s of pEC2 and i t s d e l e t i o n d e r i v a t i v e s 51 8. Cellulomonas f i m1 p o l y p e p t i d e s encoded by pEC2 and i t s d e l e t i o n d e r i v a t i v e s 54 9. R e s t r i c t i o n a n a l y s i s of pEC2.2 and pEC2.2i 57 10. The r e a d i n g frames of the endoglucanase gene with res p e c t to the s t a r t i n g ATG of the TcR gene In pEC2.1, pEC2.1Ks and pEC2.lAHB 60 11. C o n f i r m a t i o n of c o r r e c t f r a m e s h i f t i n g in pEC2.1Ks by DNA sequencing 61 12. R e s t r i c t i o n a n a l y ses of pEC2 and pcEC2 64 13. C o n t i g u i t y of the 0.8 kb and 5.2 kb BamHI fragments on the C. f i m i genome 66 14. The M13mpl8 sequencing vect o r 82 15. The g e n e r a t i o n of d e l e t i o n s in the RF DNA of mpl8EC2.2 with ExoIII 83 16. Agarose gel e l e c t r o p h o r e s i s of d e l e t i o n mutant phage DNAs 85 17. R e s t r i c t i o n a n a l y s i s of DNA from d e l e t i o n mutants of mpl8EC2.2 86 18. Sequencing s t r a t e g y f o r the endoglucanase encoding r e g i o n of pEC2.2 87 19. Subcloning of the endoglucanase encoding r e g i o n of pEC2.2 89 x L i s t of F i g u r e s (con't) Page 20. P r o t o c o l f o r g e n e r a t i n g d e l e t i o n mutants of the 0.8 kb BamHI fragment of pcEC2 90 21. I d e n t i f i c a t i o n of d e l e t i o n mutants by the C t e s t 92 22. R e s o l u t i o n of the compressed n u c l e o t i d e s in the leader sequence of the non-coding s t r a n d 93 23. The n u c l e o t i d e sequence of the endoglucanase gene and the deduced amino a c i d sequence of the endoglucanase 95 24. Subcloning s t r a t e g y f o r r e s o l v i n g n u c l e o t i d e compressions 97 25. Sequence c o n s e r v a t i o n in the Pro-Thr sequences of the C_. f i m i endoglucanase and exoglucanase and t h e i r genes 106 26. Immunoadsorbent chromatography of the endoglucanase from E_. c o l i C600 (pEC2) 109 27. P u r i t y of the endoglucanases prepared from E. c o l i C600 (pEC2) 114 28. The yeast e x p r e s s i o n / s e c r e t i o n vector pOP 125 29. The c o n s t r u c t i o n of pL5.19 126 30. The c o n s t r u c t i o n of pK2.4 128 31. The c o n s t r u c t i o n of pNve 130 32. The CMC p l a t e assay of yeast transformants c a r r y i n g pL5.19, pK2.4 and pNve as shown 131 33. S e c r e t i o n of endoglucanase by yeast 133 34. The c o n s t r u c t i o n of pRW6 136 35. The c o n s t r u c t i o n of pREC2.2 138 36. Glucose standard curve f o r the d e t e r m i n a t i o n of CMCase a c t i v i t y 163 37. Standard curve of bovine K'-globulin (Bio-Rad p r o t e i n standard I) f o r the d e t e r m i n a t i o n of p r o t e i n c o n c e n t r a t i o n 165 xi Acknowledgements I c o n s i d e r myself very f o r t u n a t e to have been part of the c e l l u l a s e group at U.B.C. From t h i s large group I have obtained a valuable education and I am most g r a t e f u l f o r t h e i r h o s p i t a l i t y , f r i e n d s h i p and help. S p e c i a l thanks are giv e n to the f o l l o w i n g people: the r e s e a r c h e r s i n Rm 12, f o r t h e i r c o l l a b o r a t i o n , exchanging of ideas and companionship when I was working there; Dr. N. G i l k e s , f o r h i s t e c h n i c a l advice and help; Drs. R. M i l l e r , D. K i l b u r n and T . Warren, who are the d r i v i n g f o r c e and leaders of t h i s group, f o r t h e i r guidance, patience and encouragement; the members of my s u p e r v i s o r y committee, f o r t h e i r advice and c o r r e c t i o n s of t h i s t h e s i s ; the members of the Molecular B i o l o g y D i v i s i o n of A l l e l i x Inc., f o r t h e i r h o s p i t a l i t y and t e c h n i c a l advice when I was s t a y i n g there; my family members, e s p e c i a l l y my parents, who have provided me with i n f i n i t e support and encouragement; my s i s t e r , Joyce, and her fa m i l y , as well as my aunt's f a m i l y , f o r t h e i r h o s p i t a l i t y ; my brother, Stephen, f o r h i s help in using the computer programmes f o r t h i s t h e s i s ; and l a s t of a l l , f o r Katherine, f o r her i n c r e d i b l e patience and understanding. T h i s work was supported by the Natural S c i e n c e s and E n g i n e e r i n g Research Council of Canada. x i i Abbrev i a t ions Ap amp i c i 11 in bp base p a i r s BSA bovine serum albumin CMC c a r b o x y m e t h y l c e l l u l o s e CMCase c a r b o x y m e t h y l c e l l u l a s e DNS d i n i t r o s a l i c y l i c ExoIII exonuclease III HS-PBS h i g h - s a l t phosphate b u f f e r e d s a l i n e kb 1000 bp kDa k i l o d a l t o n ( s ) LB L u r i a-BertanI PAGE polyacrylamide gel e l e c t r o p h o r e s i s PBS phosphate b u f f e r e d s a l i n e R r e s i s t a n t RF r e p l i c a t i v e form s s e n s i t i v e SAC Staphylococcus aureus Cowan I SDS sodium dodecyl s u l f a t e Tc t e t r a c y c l i n e U u n i t x i i i I. I n t r o d u c t i o n 1.1. General background C e l l u l a s e a c t i o n In v i t r o was observed f i r s t e i g h t y years ago with s n a i l h e p a t o p a n c r e a t i c j u i c e (43, 141, 148). However, e x p l o r a t i o n of the modes of a c t i o n of c e l l u l a s e s on c e l l u l o s i c s u b s t r a t e s d i d not s t a r t u n t i l an i n v e s t i g a t i o n began of m i c r o b i a l sources which were r e s p o n s i b l e f o r the d e t e r i o r a t i o n of a large q u a n t i t y of c e l l u l o s i c items of the U.S. Army in the t r o p i c s d u r i n g World War II (147). Among the c a u s a l c e l l u l o l y t l c microorganisms, some s t r a i n s of the fungus Trichoderma were the best sources of c e l l u l a s e s (85, 107, 108, 144, 147). The work l e d to the f i r s t p o s t u l a t i o n of a biochemical model (the C i - C x hypothesis) f o r the enzymatic h y d r o l y s i s of n a t i v e c e l l u l o s e (146, 148). These c o n t r i b u t i o n s s t i m u l a t e d f u r t h e r r e s e a r c h on c e l l u l a s e s and on c e l l u l o s e degradation, e s p e c i a l l y in the areas of the p u r i f i c a t i o n of c e l l u l a s e s , the modes of a c t i o n of c e l l u l a s e s , and the i n t e r a c t i o n of the enzymes with t h e i r s u b s t r a t e s . Furthermore, because of the b e t t e r understanding of c e l l u l o s e h y d r o l y s i s from the expanded re s e a r c h a c t i v i t i e s , the p o t e n t i a l u t i l i z a t i o n of c e l l u l o s e as a feedstock f o r v a r i o u s products became the s u b j e c t of many a c t i v e r e s e a r c h p r o j e c t s (5, 59, 68, 85). C e l l u l o s e i s the most abundant org a n i c substance in nature. It i s a major component of the s k e l e t a l support systems of t r e e s and other p l a n t s , and as such i t r e p r e s e n t s a major i l r e n e w a b l e s o u r c e o f e n e r g y a n d r a w m a t e r i a l s . I t c a n be o b t a i n e d c h e a p l y i n l a r g e q u a n t i t i e s f r o m a g r i c u l t u r a l , f o r e s t r y , a n d u r b a n w a s t e s ( 1 3 , 6 0 , 6 8 , 1 3 9 ) . T h e r e f o r e , t h e u t i l i z a t i o n o f c e l l u l o s i c w a s t e s t o p r o d u c e e n e r g y a n d c h e m i c a l s i s p o t e n t i a l l y o f g r e a t i m p o r t a n c e . C e l l u l o s e c a n be h y d r o l y s e d t o g l u c o s e by e i t h e r a c i d s o r e n z y m e s . The h i g h c a p i t a l c o s t o f i n s t a l l a t i o n o f c o r r o s i o n -r e s i s t a n t e q u i p m e n t , t h e h i g h o p e r a t i n g c o s t o f a c i d r e c o v e r y , t h e l o w y i e l d a n d d e g r a d a t i o n o f p r o d u c t , a n d t h e p o s s i b i l i t y o f c a u s i n g e n v i r o n m e n t a l p o l l u t i o n , make a c i d h y d r o l y s i s o f c e l l u l o s i c s i m p r a c t i c a l ( 4 6 , 1 5 3 , 1 7 1 ) . On t h e o t h e r h a n d , t h e c o m p a r a t i v e l y l o w e r c a p i t a l a n d o p e r a t i n g c o s t s , a n d t h e h i g h e r y i e l d o f p u r e e n d p r o d u c t , make e n z y m e s a t t r a c t i v e f o r t h e h y d r o l y s i s o f c e l l u l o s e on a n i n d u s t r i a l s c a l e ( 4 6 , 1 5 3 , 1 7 1 ) . A t p r e s e n t , t h e r e a d y a v a i l a b i l i t y o f o i l a s a s o u r c e o f c h e m i c a l s a n d e n e r g y makes c e l l u l o s i c s n o n - c o m p e t i t i v e , a n d t h e e n z y m a t i c h y d r o l y s i s o f c e l l u l o s i c s I s g e n e r a l l y n o t p r a c t i s e d o n a c o m m e r c i a l s c a l e . The o i l c r i s i s o f t h e 1 9 7 0 ' s , h o w e v e r , d i d f o c u s a t t e n t i o n on c e l l u l o s i c s a s a s o u r c e o f c h e m i c a l s a n d e n e r g y ( 5 , 6 8 , 8 5 , 1 4 0 ) . The c o m p l e x i t i e s o f b o t h t h e c e l l u l o s i c m a t e r i a l s a n d t h e c e l l u l a s e s y s t e m s p r e s e n t d i f f i c u l t i e s f o r t h e e n z y m a t i c h y d r o l y s i s o f c e l l u l o s e on a c o m m e r c i a l s c a l e . On t h e one h a n d , t h e c r y s t a l l i n e ( h i g h l y o r d e r e d ) s t r u c t u r e o f c e l l u l o s e , a n d t h e p r e s e n c e o f o t h e r c o n s t i t u e n t s , f o r e x a m p l e , l i g n i n , i n n a t i v e c e l l u l o s i c s u b s t r a t e s , make i t r e s i s t a n t t o e n z y m a t i c a t t a c k . On t h e o t h e r h a n d , c e l l u l a s e e n z y m e s may e x i s t a s a 2 complex In which the I n d i v i d u a l components are r e q u i r e d to i n t e r a c t with each other before maximum s u b s t r a t e h y d r o l y s i s i s achieved. T h e r e f o r e , an understanding of the p r o p e r t i e s of the nat i v e c e l l u l o s i c s and the c e l l u l a s e complex, as well as of t h e i r i n t e r a c t i o n . Is a necessary p r e l i m i n a r y to the use of the enzymes on a commercial s c a l e . 1.2. The nature of c e l l u l o s i c m a t e r i a l s The middle secondary l a y e r of the wood c e l l wall i s composed predominantly of ar r a y s of c e l l u l o s e f i b r i l s running more or l e s s p a r a l l e l to the l o n g i t u d i n a l c e l l a x i s (184). T h i s arrangement of c e l l u l o s e chains in the c e l l w all p r o v i d e s the wood with high l o n g i t u d i n a l t e n s i l e s t r e n g t h (184). The f i b r i l s , t ogether with the cementing l l g n i n and h e m i c e l l u l o s e , form the s k e l e t o n of a l l t r e e s and other p l a n t s . The combination of the h i g h l y ordered c e l l u l o s e molecules and the l i g n i n i n wood makes i t r e s i s t a n t to degr a d a t i o n by m i c r o b i a l enzymes (30, 171). 1.2.1. The b a s i c s t r u c t u r e of c e l l u l o s e C e l l u l o s e i s a l i n e a r polymer of D-anhydroglucopyranose u n i t s l i n k e d by fi-1,4-glycosidle bonds (30, 31, 46, 48, 61, 184). The glucopyranose u n i t s l n a c e l l u l o s e molecule adopt a c h a i r c o n f i g u r a t i o n , and every a l t e r n a t e sugar r e s i d u e i s r o t a t e d 180° around the main a x i s to form the u n s t r a i n e d l i n e a r polymer (46, 48). An i n t r a m o l e c u l a r hydrogen bond i s formed between the hydroxyl group of the t h i r d carbon atom of one glucose r e s i d u e and the r i n g oxygen atom of the next c h a i n u n i t in the same c e l l u l o s e molecule ( F i g . 1; r e f s . 46, 48). 3 F i g . 1. The structure of a c e l l u l o s e molecule. 4 Depending on the source and treatment of the c e l l u l o s e , the number of glucose r e s i d u e s per c e l l u l o s e molecule (degree of p o l y m e r i z a t i o n ) ranges from 15 or l e s s to as high as 14,000 (31, 54). 1.2.2. C r y s t a l l i n e c e l l u l o s e Native c e l l u l o s e polymers normally have a high degree of p o l y m e r i z a t i o n . The numerous i n t e r m o l e c u l a r hydrogen bonds and Van der Waals f o r c e s of the glucose r e s i d u e s cause n e i g h b o r i n g c e l l u l o s e chains to bind l a t e r a l l y and f i r m l y t o gether, to form the elementary f i b r i l s or p r o t o f i b r i l s (30, 31, 48, 50, 54). These c e l l u l o s e molecules are l i k e l y to be a s s o c i a t e d in an a n t i p a r a l l e l f a s h i o n , and i n v a r i o u s degrees of p a r a l l e l i s m (23, 31, 54). The regions with h i g h l y ordered molecules are c a l l e d c r y s t a l l i t e s , whereas the l e s s ordered r e g i o n s are c a l l e d p a r a c r y s t a l 1 i t e s , or amorphous regions (31, 48, 160). A c l o s e study of the c e l l u l o s e chains in the c r y s t a l l i n e r e g i o n s shows that only a l t e r n a t e g l u c o s y l bonds are exposed and hence s u s c e p t i b l e to enzymatic a t t a c k ; the other g l u c o s y l bonds face into the body of the c e l l u l o s e m i c e l l e (96). T h e r e f o r e , c e l l o b i o s e i s c o n s i d e r e d as the r e p e a t i n g u n i t i n the c r y s t a l l i t e (96, 208). The r e l a t i v e amount of the c r y s t a l l i n e and amorphous re g i o n s In a c e l l u l o s e f i b e r i s c a l l e d the c r y s t a l 1 in Ity, which is estimated to be from 50 to 90 percent (32, 49). The enzymatic s u s c e p t i b i l i t y of these two r e g i o n s i s very d i f f e r e n t (see l a t e r ) . An aggregate of a number of the elementary f i b r i l s forms a d i s t i n c t e n t i t y , the m i c r o f i b r i l . M i c r o f i b r i l s aggregate to 5 form l a r g e r c e l l u l o s e f i b e r s i n the c e l l wall of wood (31> 48, 54). In e l e c t r o n micrographs, the m i c r o f i b r i l s are seen as d i s t i n c t bundles, and c e l l u l o s e molecules from one bundle seldom c r o s s over to another (31, 48). The arrangement of the c e l l u l o s e molecules in the p r o t o f i b r i l s , and the s t r u c t u r e of the m i c r o f i b r i l s remain to be determined, although models have been proposed f o r them (23, 31, 48, 54). 1.2.3." S t r u c t u r a l f e a t u r e s of c e l l u l o s i c m a t e r i a l s determining t h e i r s u s c e p t i b i l i t y to enzymatic h y d r o l y s i s C e l l u l o s i c m a t e r i a l s are h i g h l y complex, both p h y s i c a l l y and c h e m i c a l l y . This complexity a f f e c t s s i g n i f i c a n t l y the s u s c e p t i b i l i t y of c e l l u l o s i c s u b s t r a t e s to enzymatic a t t a c k . 1.2.3.1..Accessibi11ty to and moisture content of the c e l l u l o s e f i b e r s The spaces between m i c r o f i b r i l s and c e l l u l o s e molecules i n the amorphous r e g i o n s (the c e l l - w a l l c a p i l l a r i e s ) of n a t i v e c e l l u l o s e are occupied by v a r i e t i e s of chemicals, l l g n i n , and h e m l c e l l u l o s e (30-32, 50). The d e p o s i t i o n of these v a r i o u s substances In the c e l l - w a l l c a p i l l a r i e s reduces the a c c e s s i b i l i t y of the c e l l u l o s e molecules to enzymatic h y d r o l y s i s . There Is very l i t t l e v o i d space i n these r e g i o n s i n the absence of moisture, hence, dry c e l l u l o s i c m a t e r i a l s are e f f e c t i v e l y p r o t e c t e d from enzymatic degradation by microorganisms (31, 48). Moisture in c r e a s e s the t o t a l s u r f a c e area of the c e l l - w a l l c a p i l l a r i e s , and the c e l l u l o s e molecules become more a c c e s s i b l e to c e l l u l a s e a t t a c k . Furthermore, water i s a r e a c t a n t In the enzymatic cleavage of the g l y c o s i d l c bonds (31, 48). Although water can cause the amorphous r e g i o n s to 6 swell ( i n t e r c r y s t a l 1 i n e s w e l l i n g ) , i t has no e f f e c t on the c r y s t a l l i n e r e g i o n s . The c r y s t a l l i n e r e g i o n s ( i n t r a c r y s t a l 1 i n e s w e l l i n g ) can be swollen with some a c i d , a l k a l i , or s a l t s o l u t i o n s <50, 160). The cementing l i g n i n presents the s t r o n g e s t p h y s i c a l b a r r i e r to the enzymatic degradation of n a t i v e c e l l u l o s i c s u b s t r a t e s (31, 48, 50, 160). The a s s o c i a t i o n between l i g n i n and c e l l u l o s e f i b r i l s appears to be l a r g e l y p h y s i c a l in nature (31, 32, 48). A negative c o r r e l a t i o n e x i s t s between l i g n i n content and the d i g e s t i b i l i t y of c e l l u l o s i c m a t e r i a l s (50, 123, 191). Therefore, removal or m o d i f i c a t i o n of the l i g n i n network is a necessary p r e l i m i n a r y to the e f f i c i e n t enzymatic h y d r o l y s i s of c e l l u l o s i c f e e d s t o c k s . 1.2.3.2. C r y s t a l 1 in 1ty and degree of p o l y m e r i z a t i o n of e e l l u l o s e The c r y s t a l 1 i n i t y and the degree of p o l y m e r i z a t i o n of c e l l u l o s e have profound e f f e c t s on i t s a c c e s s i b i l i t y to enzymatic a t t a c k . The r e s i s t a n c e of c r y s t a l l i n e c e l l u l o s e has two causes: i t s i n s o l u b i l i t y in water, and the presence of both hydrogen bonds and g l y c o s i d i c bonds (49, 160). The g r e a t e r the c r y s t a l 1 i n i t y of c e l l u l o s e , the more r e s i s t a n t i t is to enzymatic h y d r o l y s i s . An increase in the degree of p o l y m e r i z a t i o n of c e l l u l o s e molecules r e s u l t s in the formation of longer hydrogen-bonded c h a i n s . T h i s in turn r e s u l t s i n g r e a t e r c r y s t a l 1 i n i t y (142). C e l l u l a s e s degrade the more r e a d i l y a c c e s s i b l e amorphous regions, but are unable to a t t a c k the c r y s t a l l i n e r e g i o n s of 7 v a r i o u s c e l l u l o s i c s u b s t r a t e s (22, 49, 52, 130). However, treatments that d i s r u p t the degree of p a r a l l e l i s m of the c r y s t a l l i t e s , such as l n t r a c r y s t a l 1 i n e s w e l l i n g , increase the s u s c e p t i b i l t y of the c e l l u l o s e to enzymat ic h y d r o l y s i s (31 , 49, 50, 160). 1.3. Pre treatments of raw c e l l u l o s i c m a t e r i a l s Among the v a r i o u s r e s i s t a n t s t r u c t u r a l f e a t u r e s of c e l l u l o s i c m a t e r i a l s , the c r y s t a l l i n e s t r u c t u r e and the l i g n i n c o a t i n g are the major o b s t a c l e s to enzymat ic h y d r o l y s i s (50, 70, 108, 188). V a r i o u s pre treatments are used to increase the s u s c e p t i b i l i t i e s of c e l l u l o s l c s to enzymat ic h y d r o l y s i s . These pre trea tment methods are of three main t y p e s : the c h e m i c a l , the p h y s i c a l and the b i o l o g i c a l methods ( r e f s . 50, 70; Table I) 1.4. C e l l u l a s e s C e l l u l a s e s are enzymes which can h y d r o l y z e the fi-1,4-g l y c o s l d i c l i n k a g e s of the c e l l u l o s e molecule (46, 54, 112, 145, 199). They are a l r e a d y used c o m m e r c i a l l y in the food (43 , 52, 186, 187, 190) and p h a r m a c e u t i c a l (43, 190) i n d u s t r i e s . They are p o t e n t i a l l y of g r e a t use f o r the c o n v e r s i o n of c e l l u l o s i c biomass to g lucose to serve as a chemica l f e e d s t o c k . Great e f f o r t s have been made to deve lop economica l systems f o r such c o n v e r s i o n s (13, 46, 108). T h i s has l e d to the development of v a r i o u s methods of pre trea tment as we l l as to a b e t t e r u n d e r s t a n d i n g of these i n t e r e s t i n g enzymes. 1 . 4 . 1 . D i s t r i b u t i o n of c e l l u l a s e s in nature C e l l u l a s e s are widespread in n a t u r e . In p l a n t s , c e l l u l a s e s are i n v o l v e d in t i s s u e d i f f e r e n t i a t i o n and development (104, 8 T a b l e I . A s u m m a r y o f t h e e x a m p l e s o f v a r i o u s t y p e s o f p r e t r e a t m e n t m e t h o d s P r e t r e a t m e n t E x a m p l e s G e n e r a l d e s c r i p t i o n R e f s . A . P h y s i c a l 1 . M e c h a n i c a l 1. B a l 1 mi 1 1 i n g M e c h a n i c a l f o r c e i s 5 0 , 2 . Hammer m i 1 1 i n g u s e d t o g r i n d t h e 1 2 3 , 3 . V i b r o e n e r g y m i 1 1 i n g r e s i d u e s i n t o f i n e p a r t i c l e s o f l a r g e r s u r f a c e - t o - v o l u m e r a t i o , d i s r u p t t h e c r y s t a l l i n e s t r u c t u r e a n d b r e a k d o w n t h e c h e m i c a l b o n d s o f t h e l o n g c h a i n m o l e c u l e s . 124 & 153 2 . N o n - 1 . S t e a m e x p l o s i o n H a r s h e x t e r n a l f o r c e 2 3 , m e c h a n i c a l 2 . P y r o l y s i s ( h i g h p r e s s u r e , h i g h 5 0 , 3 . H i g h e n e r g y r a d i a t i o n t e m p e r a t u r e , g a m m a i r r a d i a t i o n , e t c . ) i s e m p l o y e d t o d e c o m p o s e 1 i g n i n c e l l u l o s e c o m p l e x . 108 & 123 B . Chem i c a l 1 . A l k a l i 1 . NaOH T h e y a r e i n t r a - 2 3 , 2 . NH 3 c y s t a l l i n e r e a g e n t s , w h i c h c a n s w e l l t h e c r y s t a l 1 1 t e s b y b r e a k i n g t h e h y d r o g e n -b o n d i n g o f t h e c e l l u l o s e . R e s u l t s a r e : i n c r e a s e o f i n t e r n a l s u r f a c e a r e a , d e c r e a s e i n c r y s t a l 1 i n i t y , d e c r e a s e i n d e g r e e o f p o l y m e r i z a t i o n , a n d d i s r u p t i o n o f l i g n i n -c e l l u l o s e a s s o c i a t i o n . 5 0 , 1 0 8 , 123 & 160 2 . A c i d 1 . H 2 S 0 4 T h e y c a n be u s e d a s i n t r a c r y s t a l 1 i n e 2 3 , 5 0 , 2 . H 3 P O 4 r e a g e n t s . D e g r a d e d p r o d u c t s r e s u l t b e c a u s e t h e s e r e a g e n t s c a u s e some h y d r o l y s i s o f t h e c e l l u l o s e . 7 3 , 1 0 8 , 1 2 3 , 160 & 188 3 . Chem i c a l 1. C a d o x e n T h e s e r e a g e n t s a r e s o l v e n t 2 . CMCS ( s o d i u m t a r t r a t e + f e r r i c c h l o r i d e + s o d i um s u l f i t e + NaOH) a b l e t o t r a n s f o r m s o l i d e e l l u l o s e r e a d i l y i n t o a s o l u b l e f o r m w h i c h c a n t h e n be h y d r o l y s e d e a s i l y . 5 0 & 188 9 Table I (con't.) Pretreatment Examples General d e s c r i p t i o n Refs. B. Chemical 4. Gas 5. Solvent de1IgnI-f i c a t i o n 1. Chlor ine dI oxIde 2. Nitrogen ox ides Functions of gas pretreatment are: s o l u b 1 1 l z a t I o n or degradation of the l i g n i n component, d i s r u p t i o n of the 1 i g n i n - c e l l u l o s e a s s o c i a t i o n , and o x i a t i o n of the c e l l u l o s e molecules by c o n v e r t i n g COH to COOH groups, with the breakage of hydrogen bonds. 23, 50, 70, 123 & 160 1. Ethanol-water system 2. Aqueous-phenol system The t r e a t e d r e s i d u e s can be separated into three p a r t s : l i g n i n which has d i s s o l v e d in the o r g a n i c phase; h e m i c e l l u l o s e which has d i s s o l v e d in the aqueous phase; and c e l l u l o s e which stays behind as an i n s o l u b l e r e s i d u e . 50 & 139 C. B i o l o g i c a l 1. Fungal 2. B a c t e r i a l 1. White r o t s 2. Red r o t s T h i s type of p r e t r e a t -ment i n v o l v e s the use of l i g n i n a t t a c k i n g organisms. The fungal r o t s are well-known fo r t h e i r wood a c t i o n . They are a l s o c e l l u l o l y t i c . The 1 i s t e d b a c t e r i a l organisms have a l l been shown to degrade l i g n i n from va r i o u s sources. Only the Streptomyces spp. 1, 50, 89, 108 & 160 1. Streptomyces spp. 2. Pseudomonas spp. 3. Xanthomonas spp. 4. A c i n e t o b a c t e r spp. are c e l l u l o l y t i c . O x i d i z i n g enzymes may be i n v o l v e d i n l i g n i n d e g r a d a t i o n , which include the aromatic a l c o h o l dehydrogenases, the phenol oxidases, and the mono- and d i -oxygenases. 10 163, 193). In lower animals, such as molluscs, s n a i l s , and i n s e c t s , and in microorganisms, c e l l u l a s e s allow the use of c e l l u l o s e as a food source (147). Some of these organisms produce a complex mixture of c e l l u l a s e s , others produce o n l y one or two enzymes. T r a d i t i o n a l l y , only those organisms producing a f u l l complement of c e l l u l a s e s (see l a t e r ) are considered to be t r u l y c e l l u l o l y t i c (13, 69, 108). C e l l u l o l y t i c fungi and b a c t e r i a (Table I I ) are very convenient sources of c e l l u l a s e s . 1.4.2. C e l l u l a s e components and t h e i r modes of a c t i o n The systematic name of c e l l u l a s e i s 1,4-ft-D-glucan 4-glucanohydrolase (44, 199): 1,4-ft-D-glucan i n d i c a t e s that the ft-1,4 polymers of D-glucose r e s i d u e s are the s u b s t r a t e ; 4-glucanohydrolase I n d i c a t e s that the ft-1,4 l i n k a g e s of the substrate are those hydrolyzed by the enzyme (199). 1.4.2.1. Types of c e l l u l a s e There are four d i f f e r e n t types of c e l l u l a s e s : c e l l o b i a s e s (or ft-glucosidases; EC 3.2.1.21); endo-fi-1,4-glucanases (endoglucanases or CMCases; EC 3.2.1.4); and two types of e x o c e l l u l a s e s , the 1,4-fi-D-glucan ce11ob1ohydrolases ( c e l l o b i o -hydrolases or A v i c e l a s e s ; EC 3.2.1.91), and glucan 1,4-ft-g l u c o s i d a s e s (glucohydro1ases; EC 3.2.1.74) (44, 54, 64, 71, 96, 108, 109, 127, 205). F r a c t i o n a t i o n techniques used to separate and c h a r a c t e r i z e c e l l u l a s e s from v a r i o u s microorganisms include e l e c t r o p h o r e s i s , gel f i l t r a t i o n , Ion-exchange chromatography, e l e c t r o f o c u s I n g , a f f i n i t y chromatography with c o n c a n a v a l i n A (62, 101, 102, 11 Table I I . Examples of c e l l u l o l y t i c microorganisms in nature M icroorganisms Examples Re f s . B a c t e r l a Cellulomonas spp. Ce11v i b r i o spp. C l o s t r i d i um thermoce Hum  Bactero ides succ i nogenes  Rum inococcus albus  Pseudomonas f1uorescens  Streptomyces f l a v o g r i seus  Thermomonospora c u r v a t a 146 & 179 8 & 146 53 & 198 69 & 71 69 & 71 210 97 13 & 147 Fung i Ascomycetes Bas i d iomyce tes Phycomycetes Aspera i11 us spp. Fusar ium spp. P e n i c i I I i u m spp. Tr ichoderma spp. White r o t t e r s : Fomes fomentar1 us  Polyporus vers i c o l o r  Sporotr ichum spp. Brown r o t t e r s : P o r i a mont i c o l a  Lenz i t e s trabea  S c l e r o t ium r o i f s 1 i  K a r l i n g i a rosea  Rhizopus a r r h i z u s 146 13, 147 & 207 13, 146, 147 & 207 107, 108, 144 & 147 50 & 160 1, 146 & 147 1, 146, 147 & 207 1, 146 & 147 1, 146 & 147 147 146 & 147 146 & 147 12 209) or c r o s s - l i n k e d c e l l u l o s e (197), high pressure l i q u i d chromatography (14, 15), and immunoadsorbent chromatography using s p e c i f i c a n t i b o d i e s (47, 101, 133, 159). Most p r e p a r a t i o n s from c e l l - f r e e c u l t u r e f i l t r a t e s of c e l l u l o l y t i c microorganisms c o n t a i n mainly the endoglucanase and the ft-glucosidase components. Exoce11ulases are u s u a l l y obtained from fungal c e l l u l a s e systems, which c o n t a i n a g r e a t e r p r o p o r t i o n of these components (102, 108). Many of these p u r i f i e d e x o c e l l u l a s e s proved to be ce11obiohydrolases (102). Improved methods are a v a i l a b l e f o r the d e t e c t i o n of e x o c e l l u l a s e a c t i v i t i e s (34, 102, 155). Recently, a b a c t e r i a l e e l l o b i o h y d r o l a s e was c h a r a c t e r i z e d f o r the f i r s t time (57), suggesting that b a c t e r i a l and fungal c e l l u l a s e systems c o n t a i n s i m i l a r components. Both b a c t e r i a l and fungal c e l l u l a s e systems may be complex; they can c o n t a i n m u l t i p l e forms of a given type of c e l l u l a s e which o f t e n d i f f e r only s l i g h t l y in i s o e l e c t r i c pH and t h e i r modes of a c t i o n towards a g i v e n c e l l u l o s i c s u b s t r a t e (54, 108). 1.4.2.2. Modes of a c t i o n of c e l l u l a s e s 1.4.2.2.1. Substrate s p e c i f i c i t i e s of ft-glucosidases ft-Glucosidases can act on c e l l o b i o s e , s a l i c i n , and P-ni t r o p h e n y l - f t g l u c o s i d e , to y i e l d g l u c o s e , s a l i g e n i n , and p-n i t r o p h e n o l as t h e i r r e s p e c t i v e measurable products (96, 108, 109). The glucose product is r e l e a s e d in i t s ft-configuration (96, 108, 153). They have no a c t i o n on c e l l u l o s e , but they may hydrolyse ce11 o d e x t r i n s up to c e l l o h e x o s e , with the a c t i v i t y i n v e r s e l y p r o p o r t i o n a l to c h a i n l e n g t h . fi-glucosidases which 1 3 can act on c e l l o b i o s e or ce11 o d e x t r i n s are termed c e l l o b i a s e s , and they are involved in ce11u1o1ysis. Those a c t i n g p r i m a r i l y on a r y l - f i - g l u c o s i d e s ( f o r example, s a l i c i n and P-nitropheny1 fi-g l u c o s i d e ) are not involved in c e l l u l o l y s i s (96). fi-gl ucos idases may hydrolyse fi(l-»l), fi(l-»2), fi(l-»6), as well as fi(l-»4) bonds in the s u b s t r a t e s ( 102, 108, 153). The pro d u c t i o n of c e l l o b i a s e may be induced by growth on c e l l o b i o s e (108, 194), but i t i s produced c o n s t i t u t i v e 1 y in many organisms (108, 176). The h y d r o l y s i s of c e l l o b i o s e may be i n h i b i t e d s t r o n g l y by glucose and gluconolactone (43, 96, 102, 108). fi-g l u c o s i d a s e s may be i n t r a c e l l u l a r (108, 176, 194) or e x t r a c e l l u l a r (9, 63), although no examples of e x t r a c e l l u l a r a c t i v i t y have been re p o r t e d in b a c t e r i a (176). 1.4.2.2.2. Substrate s p e c i f i c i t y of endoglucanases Endoglucanases are a c t i v e on amorphous c e l l u l o s e ( f o r example, phosphoric a c i d swollen c e l l u l o s e ) , e e l l o d e x t r I n s ( a c t i v i t y increases as chain length i n c r e a s e s ) , and some water-s o l u b l e c e l l u l o s e d e r i v a t i v e s , such as carboxymethylcel1ulose (CMC), h y d r o x y e t h y l c e l l u l o s e , and m e t h y l c e l l u l o s e (43, 102, 107, 108, 148). They do not hydrolyse c e l l o b i o s e or i n s o l u b l e c r y s t a l l i n e c e l l u l o s e . CMC i s used r o u t i n e l y to detect or measure endoglucanase a c t i v i t y (13, 43, 102, 108, 110, 148, 205). CMC is formed by s u b s t i t u t i n g the hydrogen atoms of the primary and the secondary hydroxyl groups of c e l l u l o s e with carboxymethyl groups (32, 67, 148). It i s con s i d e r e d to be the best s u b s t r a t e 14 f o r the d e t e r m i n a t i o n of endoglucanase a c t i v i t y when i t has a degree of s u b s t i t u t i o n (the average number of s u b s t i t u t e d groups per anhydroglucose u n i t in the c e l l u l o s e ) between 0.4 and 0.5 (110). Like oC-amylases a c t i n g on amylose (28), endoglucanases hydrolyse the ft-1,4-glycosidic l i n k a g e s of t h e i r s u b s t r a t e s randomly (96, 102, 108, 205). They hydrolyze i n t e r n a l l i n k a g e s more f r e q u e n t l y than terminal ones (96). The major products of the r e a c t i o n are c e l l o b i o s e and c e l l o t r i o s e , but c e 1 l o d e x t r i n s are formed as the t r a n s i e n t intermediate products (108, 205). These products r e t a i n t h e i r ft-configuration (108, 153). The s y n t h e s i s of endoglucanases i s induced by CMC (101), sophorose (13, 108, 147, 175), and low c o n c e n t r a t i o n s of c e l l o b i o s e (175, 176); i t i s r e p r e s s e d by glucose (13, 175, 176). Endoglucanases are i n h i b i t e d by c e l l o b i o s e and m e t h y l c e l l u l o s e , but not by glucose (13, 108, 153, 175, 176). 1.4.2.2.3. Substrate s p e c i f i c i t y of c e l l o b i o h y d r o l a s e s C e l l o b i o h y d r o l a s e s hydrolyse ce11 o d e x t r i n s ( a c t i v i t y i n creases as c h a i n length i n c r e a s e s ) , amorphous c e l l u l o s e , and c r y s t a l l i n e c e l l u l o s e s such as c o t t o n and A v i c e l (13, 43, 107, 108, 205). They have only l i m i t e d a c t i o n on CMC, and none at a l l on c e l l o b i o s e (108). The enzymes remove c e l l o b i o s e u n i t s s u c c e s s i v e l y from the non-reducing end of the c e l l u l o s e c h a i n (13, 108, 153, 205). This i s analogous to the a c t i o n of fi-amylases on amylose (28). C h a r a c t e r i s t i c a l l y , the c e l l o b i o s e u n i t s are r e l e a s e d with i n v e r s i o n of c o n f i g u r a t i o n (108, 153). C e l l o b i o h y d r o l a s e s y n t h e s i s i s induced by l a c t o s e and 1 5 various c r y s t a l l i n e c e l l u l o s e s ; i t i s r e p r e s s e d by glucose (13, 147). The enzymes are i n h i b i t e d by m e t h y l c e l l u l o s e and c e l l o b i o s e , but not by glucose (13, 108). 1.4.2.2.4. Substrate s p e c i f i c i t y of g l u c o h y d r o l a s e s Glucohydrolases have not been s t u d i e d i n t e n s i v e l y , although they occur in s e v e r a l microorganisms (143). They a c t on the same s u b s t r a t e s as the ce11obiohydrolases (13, 109, 127), showing the most a c t i v i t y with e e l l o d e x t r i n s c o n t a i n i n g four to seven glucose r e s i d u e s (102). They do not hydrolyze c e l l o b i o s e (143). Unlike ce11obiohydrolases, which r e l e a s e c e l l o b i o s e , g lucohydrolases remove glucose u n i t s s u c c e s s i v e l y from the non-reducing ends of the glucan. Both types of enzyme, however, hydrolyse fi-1,4 g l u c o s i d i c bonds with i n v e r s i o n of c o n f i g u r a -t i o n (96). Glucohydrolases are not i n h i b i t e d by gluconolactone (96, 143). Although both endoglucanases and exoglucanases can hydrolyse amorphous c e l l u l o s e , t h e i r modes of a t t a c k on t h i s substrate are d i f f e r e n t . The random a t t a c k of endoglucanases causes a r a p i d drop in the degree of p o l y m e r i z a t i o n of the su b s t r a t e , whereas the endwise a t t a c k of the exoglucanases r e s u l t s in l i t t l e change in the degree of p o l y m e r i z a t i o n of the same substrate (54, 205, 207). 1.4.2.2.5. Mechanism of degradation of c r y s t a l l i n e c e l l u l o s e E f f e c t i v e degradation of n a t i v e c r y s t a l l i n e c e l l u l o s e r e q u i r e s synergism between d i f f e r e n t types of c e l l u l a s e (13, 108, 153, 205, 207, 208). In 1950, Reese and coworkers 1 6 presented the f i r s t hypothesis f o r the degradation of c r y s t a l l i n e c e l l u l o s e . This C i - C x hypothesis was based on work with fungi ( r e f s . 146, 148; F i g . 2 ) . It was p o s t u l a t e d that the Ci component had no h y d r o l y t i c f u n c t i o n ; i t modified or " a c t i v a t e d " the na t i v e c e l l u l o s e so that the l a t t e r was s u s c e p t i b l e to h y d r o l y s i s by the Cx component. The ft-glucosldase component hydrolysed the c e l l o b i o s e to r e l e a s e glucose. The "x" in the Cx component i n d i c a t e d the presence of several h y d r o l y t i c a c t i v i t i e s ( 1 4 5 ) . It was noted that the Ci component at t a c k e d c r y s t a l l i n e and amorphous c e l l u l o s e s , whereas the C* component a t t a c k e d only amorphous and s o l u b l e c e l l u l o s e s ( 1 1 1 ) . However, the two components acted s y n e r g i s t i c a l 1 y when recombined, the a b i l i t y of Ci to hydrolyse the nativ e c e l l u l o s e i n c r e a s i n g s t r i k i n g l y . Synergism d i d not occur with CMC as s u b s t r a t e ( 1 1 1 ) . I t was qui t e c l e a r at that time that Cx was composed of endoglucanases ( 5 8 , 7 4 , 9 8 , 119, 1 6 2 ) . The nature and mode of a c t i o n of the Ci component was un c l e a r and was c o n t r o v e r s i a l . In 1969, E r i k s s o n (45 ) proposed that C i Is a e e l l o b i o h y d r o l a s e , and that the order of a c t i o n of C i and Cx should be reversed. He exp l a i n e d the synergism between Ci and Cx as f o l l o w s . The Cx component f i r s t h y d r o l y s e s ft-1,4-g l y c o s l d l c l i n k a g e s at random. The C i component then removes c e l l o b i o s e u n i t s stepwise from the free chain-ends, which would otherwise be r e s e a l e d because the hydrogen bonds s t i l l h old the glucoses In p o s i t i o n at the s i t e of Cx a c t i o n . Therefore, In 1? C i Cx /3-glucosidase crystalline reactive ^cellobiose *- glucose cellulose cellulose F i g . 2. The C i - C * h y p o t h e s i s f o r the d e g r a d a t i o n of c r y s t a l l i n e e e l l u l o s e . 18 h i s model, C x r a t h e r than C i i n i t i a t e d the a t t a c k on n a t i v e ce11ulose . In the e a r l y 1970's, the C i components from s e v e r a l c e l l u l o l y t i c fungi were shown to be ce11obiohydrolases (43, 72, 206-208). I t was demonstrated that C x and C i acted ln concert to degrade nati v e c e l l u l o s e (205, 206). F u r t h e r , C x r a t h e r than C i had the a b i l i t y to hydrate c o t t o n f i b e r (111, 205). This s w e l l i n g phenomenon was thought to be a pre-r e q u i s i t e f o r the i n i t i a t i o n of the enzymatic h y d r o l y s i s of c r y s t a l l i n e c e l l u l o s e (205). The C i component alone had no observable e f f e c t on c r y s t a l l i n e c e l l u l o s e (205). Such data supported E r i k s s o n ' s hypothesis (45). The synergism of c e l l o b i o h y d r o l a s e s , but not of g l u c o h y d r o l a s e s , with endoglucanases c o u l d r e s u l t from the conformation and the s t e r i c r i g i d i t y of the anhydroglucose u n i t s i n the c e l l u l o s e c r y s t a l l i t e s (208). I t was suggested that only a l t e r n a t e g l u c o s y l bonds in the c r y s t a l l i t e s are exposed to enzymatic attack (96). Although g l u c o h y d r o l a s e s show l i m i t e d a c t i o n on the free chain-ends in c e l l u l o s e c r y s t a l l i t e s , they can r e a d i l y h y d r o l y s e chain-ends in the amorphous r e g i o n s . I t should be noted, however, that not a l l c e l l o b i o h y d r o l a s e s can act s y n e r g i s t i c a l 1 y with endoglucanases, and not a l l endoglucanases can act s y n e r g i s t i c a l 1 y with a competent c e l l o b i o h y d r o l a s e (103, 207, 208). Synergism between c e l l o b i o h y d r o l a s e s and endoglucanases in the h y d r o l y s i s of c r y s t a l l i n e c e l l u l o s e i s not r e s t r i c t e d to enzymes d e r i v e d from the same organism. Enzymes from two 1 9 d i f f e r e n t organisms e x h i b i t e d the same l e v e l of synergism as those from a s i n g l e o r i g i n (207, 208). There i s a l s o synergism between c e l l o b l a s e and the c e l l u l a s e s (Table I I I , r e f . 207). This probably r e s u l t s from the removal of c e l l o b i o s e by the c e l l o b l a s e . C e l l u l a s e s show end-product i n h i b i t i o n by c e l l o b i o s e . A commonly accepted scheme f o r s y n e r g i s t i c d egradation of c r y s t a l l i n e c e l l u l o s e can be represented as shown i n F i g . 3 ( r e f . 200). 1.4.3. The c o m p l e x i t i e s of c e l l u l a s e systems C e l l u l a s e systems i n c e l l u l o l y t i c microorganisms g e n e r a l l y are complex. A g i v e n system u s u a l l y c o n t a i n s endoglucanase and exoglucanase a c t i v i t i e s . In many Instances, each type of c e l l u l a s e i s present in m u l t i p l e forms (54, 64, 207, 208). A system of extreme complexity i s that produced by J . v i r ide (Table IV). B a c t e r i a of the genus, Cellulomonas, can degrade n a t i v e c e l l u l o s e (40, 57, 66, 101). T h i s i n d i c a t e s that i t c o n t a i n s c e l l u l a s e s which can a c t s y n e r g i s t i c a l 1 y on c r y s t a l l i n e c e l l u l o s e , and suggests that i t s c e l l u l a s e system may be complex. Th e r e f o r e , s t u d i e s of i t s c e l l u l a s e system may shed l i g h t on c e l l u l a s e s and t h e i r I n t e r a c t i o n s In g e n e r a l . Cel1ulomonas i s p r o k a r y o t i c , so i t should be s i m p l e r g e n e t i c a l l y than c e l l u l o l y t i c eukaryotes, which i s p o t e n t i a l l y advantageous f o r both Its g e n e t i c s and Its b i o c h e m i s t r y . 1.5. Cellulomonas Among the c e l l u l o l y t i c b a c t e r i a , Cellulomonas i s one of 20 Table I I I . C e l l u l a s e a c t i v i t y of the C i , components of F. s o l a n i c e l l u l a s e , alone C x and ft-glucosidase and i n c o m b i n a t i o n 3 Enzyme Cotton s o l u b i l i z l n g a c t i v i t y (%) C i 2 C x 1 6-glucosidase 1 C i + C x 5 8 C i + C x + ft-glucosidase 71 O r i g i n a l c u l u r e f i l t r a t e 71 aTaken from Wood and McCrae ( r e f . 207). 2 1 F i g . 3. S c h e m a t i c r e p r e s e n t a t i o n o f c e l l u l a s e a c t i o n on c r y s t a l l i n e c e l l u l o s e . A . EG ( e n d o g l u c a n a s e ) b i n d s r a n d o m l y t o t h e s u r f a c e o f t h e c e l l u l o s e m i c r o f i b r i l , a n d l t b r e a k s a g l u c o s y l b o n d w i t h i n a g l u c a n c h a i n . B . EG l e a v e s t h e m i c r o f i b r i l s u r f a c e . The n i c k i n t h e g l u c a n e x p o s e s a r e d u c i n g a n d a n o n - r e d u c i n g e n d . C . CBH ( c e l l o b i o h y d r o l a s e ) a c t s on t h e f r e e n o n - r e d u c i n g e n d o f a g l u c a n c h a i n a n d c l e a v e s a c e l l o b i o s e u n i t f r o m t h i s e n d . D. The r e l e a s e d c e l l o b i o s e m o l e c u l e i s s p l i t i n t o g l u c o s e monomers by ft-G ( f t - g l u c o s l d a s e ) . EG c r e a t e s more f r e e c h a i n e n d s f o r CBH t o a c t o n . The a b o v e h y d r o l y t i c p r o c e s s e s a r e r e p e a t e d t o a t t a i n t h e s y n e r g i s t i c d e g r a d a t i o n o f t h e c r y s t a l l i n e c e l l u l o s e . The f i g u r e was t a k e n f r o m W h i t e ( r e f . 200). 22 2 3 Table IV. The c e l l u l a s e system of T. v i r i d e a Component Estimated molecular weight (kDa) Carbohydrate c o n t e n t 6 6-Glucos idase fi-1,4-G1ucan ce11ob i ohydrolase 6-1,4-Glucan glucanohydrolase (low molecular weight) (high molecular weight) 76 47 71 46 41.8 48.9 53 53 53 53 18 12.5 52 58.9 62.4 60.2 50 37 52 49 A B C D NG N i l NG 3.3% 9.2% 11.3% 1 . 4% 5.8% 10.4% 6.7% NG 21% NG 17% 16% 10% 12% 4.5? 15% 15.25 aTaken from G i l b e r t and Tsao ( r e f . 54). bExpressed as percentage of the t o t a l molecular weight 'Not given, the best c h a r a c t e r i z e d genera. Ce11u1omonas c e l l s are i r r e g u l a r l y rod-shaped, Gram-positive, a e r o b i c and m e s o p h i l i c ; the DNA ranges from 71.7 to 72.7 moles percent G+C (82). In the 8*M e d i t i o n of Bergey's Manual of Determinative B a c t e r i o l o g y (82), a l l s t r a i n s of Cellulomonas were included In a s i n g l e s p e c i e s , C. f l a v i g e n a . However, d e t a i l e d s t u d i e s of the s e r o l o g i c a l c r o s s - r e a c t i v i t y of c e l l - w a l l antigens (18), the biochemical a n a l y s i s of c e l l - w a l l composition, the comparison of the a b i l i t y to u t i l i z e v a r i o u s carbon sources, and DNA c r o s s - h y b r i d i z a t i o n (173) of v a r i o u s Cellulomonas s t r a i n s , r e v e a l e d at l e a s t seven s p e c i e s . These include C. b l a z o t e a , C. f l a v l g e n a , C. c e I l a s e a , C. flm1. C. ge1 Ida, C. uda, and C. c a r t a l y t l e u m (173). Moreover, these d i f f e r e n t s p e c i es of Cellulomonas produce d i f f e r e n t l e v e l s of c e l l u l o l y t i c a c t i v i t y d u r i n g growth under s p e c i f i c c u l t u r e c o n d i t i o n s (179). The s p e c i e s have been d i v i d e d into two groups acc o r d i n g to t h e i r r e l a t i v e a b i l i t i e s to act on s p e c i f i c c e l l u l o s i c s u b s t r a t e s (179). Cel1ulomonas has great p o t e n t i a l f o r the c o n v e r s i o n of c e l l u l o s i c m a t e r i a l s to u s e f u l products such as glucose, s i n g l e - c e l l p r o t e i n (16, 80, 95, 152) and amino a c i d s (16). Among the s p e c i e s , C. f 1 m i i s the most e x t e n s i v e l y s t u d i e d with r e s p e c t to the h y d r o l y s i s of c e l l u l o s i c s u b s t r a t e s . When C. f 1 m1 i s grown on A v l c e l , the c u l t u r e supernatant c o n t a i n s up to 10 components with CMCase a c t i v i t y , as determined by non-denaturing polyacrylamIde g e l e l e c t r o p h o s e s i s (101). In a d d i t i o n , three to four components with CMCase a c t i v i t y are 2 5 b o u n d t o t h e r e s i d u a l A v i c e l . A t l e a s t t w o o f t h e s u b s t r a t e -b o u n d c o m p o n e n t s a r e g l y c o s y l a t e d ( 1 0 1 ) . I t was h y p o t h e s i z e d t h a t t h e d i v e r s e s u p e r n a t a n t a c t i v i t i e s r e s u l t e d f r o m p r o t e o l y s i s a n d / o r d e g l y c o s y l a t i o n e i t h e r o f e n z y m e s w h i c h d i d n o t b i n d t o t h e s u b s t r a t e , o r o f s u b s t r a t e - b o u n d e n z y m e s a s t h e y w e r e r e l e a s e d b y d e g r a d a t i o n o f t h e s u b s t r a t e ( 1 0 1 ) . S t u d i e s o f t h e v a r i o u s c e l l u l a s e s a n d t h e i r p r o p e r t i e s r e q u i r e s t h e i r p u r i f i c a t i o n . A c e 1 1 o b i o h y d r o l a s e a n d a n e n d o g l u c a n a s e h a v e b e e n p u r i f i e d t o h o m o g e n e i t y b y b i o c h e m i c a l a p p r o a c h e s ( 5 7 ) . B o t h o f t h e s e e n z y m e s b i n d t o c e l l u l o s e a n d t h e y a r e g l y c o s y l a t e d ( 5 7 ) . P u r i f i c a t i o n o f o t h e r a c t i v i t i e s h a s p r o v e d v e r y d i f f i c u l t . G e n e c l o n i n g o f f e r s a n a l t e r n a t i v e a n d a t t r a c t i v e a p p r o a c h t o i d e n t i f i c a t i o n a n d c h a r a c t e r i z a t i o n o f t h e c e l l u l a s e s . T h e p r o d u c t o f a c l o n e d c e l l u l a s e g e n e c a n be o b t a i n e d i n e e l l u l a s e - f r e e h o s t m i c r o o r g a n i s m s ( 5 5 , 5 7 , 201 ) , w h i c h f a c i l i t a t e s i t s p u r i f i c a t i o n f r e e o f o t h e r c e l l u l a s e s . The n u m b e r o f g e n e s e x p r e s s e d i n t h e f o r e i g n h o s t c a n r e f l e c t t h e c o m p l e x i t y o f t h e c e l l u l a s e s y s t e m i n q u e s t i o n . E x a m i n a t i o n o f t h e c l o n e d g e n e p r o d u c t s c a n s h e d l i g h t o n t h e p r o p e r t i e s o f t h e n a t i v e c e l l u l a s e s . L a s t l y , t h e p r o d u c t s o f t h e c l o n e d g e n e s c a n s u b s t i t u t e f o r o r be c o m b i n e d w i t h t h e n a t i v e e n z y m e s f o r t h e d e g r a d a t i o n o f c e l l u l o s i c s u b s t r a t e s . 1 . 6 . R e c o m b i n a n t DNA t e c h n o l o g y 1 . 6 . 1 . I n c e l l u l a s e r e s e a r c h I t i s e x p e n s i v e t o p r o d u c e s u f f i c i e n t q u a n t i t i e s o f 2 6 c e l l u l a s e s f o r the l a r g e - s c a l e s a c c h a r i f i c a t i o n of c e l l u l o s i c wastes. The high cost r e s u l t s from both the low s p e c i f i c a c t i v i t i e s of the enzymes, and the r e l a t i v e l y low amounts produced by a given organism (147). T r a d i t i o n a l g e n e t i c approaches y i e l d e d mutants derepressed f o r c e l l u l a s e s y n t h e s i s (24, 108, 147), mutants r e s i s t a n t to c a t a b o l i t e r e p r e s s i o n (175), and mutants producing enzymes which were r e s i s t a n t to end-product i n h i b i t i o n (25). In s p i t e of t h i s , enzyme production i s s t i l l a l i m i t i n g f a c t o r in the development of l a r g e - s c a l e p r o c e s s e s . Recombinant DNA technology a f f o r d s an a l t e r n a t i v e approach to t h i s problem. Not only does i t allow the g r e a t l y increased e x p r e s s i o n of g i v e n c e l l u l a s e genes, but a l s o the use of pure enzymes combined from d i f f e r e n t sources i n p r o p o r t i o n s determined to be optimal f o r the process. The f i r s t r e p o r t of the c l o n i n g of a c e l l u l a s e gene appeared in 1982 (201), when a gene from C. f i m i was expressed in E. c o l i . Since then, c e l l u l a s e genes from s e v e r a l other c e l l u l o l y t i c microorganisms have been c l o n e d in E_. c o l i (Table V). Such experiments confirmed the biochemical evidence f o r the complexity of c e l l u l a s e systems because d i f f e r e n t s t r u c t u r a l genes cloned from a given organism encode the same type of c e l l u l a s e (55, 122). Work at U.B.C. has concerned the c e l l u l a s e system of C_. f i m i . The genes f o r three c e l l u l a s e s have been cloned to date (55). Two of the genes have been c h a r a c t e r i z e d in d e t a i l (137, 204). The f i r s t of these encodes a ce11obiohydrolase, the f i r s t 2 7 T a b l e V . The c l o n i n g o f c e l l u l a s e g e n e s f r o m v a r i o u s s o u r c e s i n E . c o l 1 M i c r o b i a l s o u r c e Type o f c e l l u l a s e g e n e ( s ) Y e a r Re f e r e n e e C . f l m l C e l l o b l o h y d r o l a s e *» 1982 201 C . t h e r m o c e l l u m E n d o g l u c a n a s e 1983 29 T h e r m o m o n o s p o r a s p . E n d o g l u c a n a s e 1983 27 T . r e e s e l C e l l o b l o h y d r o l a s e 1983 167 T . r e e s e l C e l l o b l o h y d r o l a s e 1983 182 C . f i m i C e l l o b l o h y d r o l a s e 1984 55 a n d e n d o g l u c a n a s e C . t h e r m o c e l l u m C e l l o b l o h y d r o l a s e b 1985 122 a n d e n d o g l u c a n a s e a C o n f l r m a t l o n f o r l t I s i n r e f . 5 7 . b C o n f l r m a t i v e p r o o f f o r t h e c e l l o b l o h y d r o l a s e g e n e s was n o t p r o v i d e d . 2 8 such enzyme from a p r o k a r y o t e to be d e s c r i b e d in d e t a i l ( 57 ) . The second encodes the major endoglucanase of C. f im i (57 ) . T h i s t h e s i s d e s c r i b e s the c h a r a c t e r i z a t i o n of the endoglucanase gene and i t s e x p r e s s i o n in s e v e r a l w ide ly d i f f e r e n t microorgan i sms . 2 9 2. The c h a r a c t e r i z a t i o n of the endoglucanase gene 2.1. Background The c h a r a c t e r i z a t i o n of c l o n e d genes and t h e i r encoded products i s f a c i l i t a t e d by a v a r i e t y of a n a l y t i c a l techniques and methods. The presence of a c l o n e d gene can f r e q u e n t l y be determined from the enzymatic a c t i v i t y of i t s product. The s t r u c t u r e of the gene can be r e v e a l e d by r e s t r i c t i o n a n a l y s i s and DNA sequencing. L a s t l y , the p o l y p e p t i d e c o r r e s p o n d i n g to the a c t i v i t y can be i d e n t i f i e d by polyacrylamide g e l e l e c t r o p h o r e s i s (PAGE). The d e t e c t i o n of c e l l u l a s e a c t i v i t i e s from microorganisms i s f a c i l i t a t e d by the a v a i l a b i l i t y of some convenient and s e n s i t i v e s c r e e n i n g assays. Simple p l a t e assays employing d i f f e r e n t s u b s t r a t e s can be used to d i f f e r e n t i a t e c e l l u l a s e s q u a l i t a t i v e l y . Such assays have proved very u s e f u l i n d i s t i n g u i s h i n g the products of c l o n e d c e l l u l a s e genes. For example, the CMC p l a t e assay i s used to screen f o r endoglucanase-posIt 1ve c l o n e s (181). The technique i s simple, s e n s i t i v e and s p e c i f i c ( F i g . 4). P l a t e assays are a v a i l a b l e f o r the r a p i d d e t e c t i o n of other c e l l u l a s e types. These include the commonly used 4-methylumbe11lferyl-ft-D-glucoside (MUG; r e f . 194) and 4-methylumbell1feryl-fi-ce1 l o b l o s i d e (MUC; r e f . 192) assays, which are used to screen f o r fi-glucosidase and e e l l o b l o h y d r o l a s e a c t i v i t i e s , r e s p e c t i v e l y . The f i r s t E. c o l 1 c l o n e s e x p r e s s i n g c e l l u l a s e a c t i v i t i e s were detected by immunological s c r e e n i n g (201). An antiserum r a i s e d a g a i n s t c e l l u l o s e induced C. f imi e x t r a c e l l u l a r enzymes 3 0 F i g . 4. CMC p l a t e assay. E. c o l i c e l l s h a r b o r i n g endoglucanase encoding plasmids were grown on CMC medium (see M a t e r i a l s and Methods) f o r 20 hr at 37°C.The c o l o n i e s were washed o f f the agar s u r f a c e . The medium was s t a i n e d with Congo red s o l u t i o n and excess dye was removed by washing with s a l t s o l u t i o n (see M a t e r i a l s and Methods). C l e a r zones on the s t a i n e d background r e s u l t from enzymatic h y d r o l y s i s of CMC to oligomers with fewer than 5 sugar u n i t s ( r e f . 181). 3 1 was used to screen f o r p o t e n t i a l c e l l u l a s e p o s i t i v e E. c o l 1 c l o n e s . The advantage of t h i s assay i s the s e l e c t i o n of a l l p o s s i b l e c e l l u l a s e c l o n e s , r e g a r d l e s s of type, i n a s i n g l e s c r e e n i n g procedure. The s e l e c t e d c l o n e s can then be screened f o r s p e c i f i c c e l l u l a s e a c t i v i t i e s by the s p e c i f i c methods. C e l l u l a s e a c t i v i t i e s can a l s o be assayed q u a n t i t a t i v e l y by measuring the r a t e s of r e l e a s e of products from a p p r o p r i a t e s u b s t r a t e s under s p e c i f i e d c o n d i t i o n s . The s u b s t r a t e s which can be used f o r q u a n t i t a t i v e assays of d i f f e r e n t c e l l u l a s e s were d e s c r i b e d In S e c t i o n 1.4.2.2. D i f f e r e n t techniques have been developed f o r i d e n t i f y i n g p o l y p e p t i d e s encoded by cloned genes. A l l of them depend on the e x p r e s s i o n of the d e s i r e d gene products under c o n d i t i o n s suppressing or p r e v e n t i n g the s y n t h e s i s of other p r o t e i n s . These techniques include the use of b a c t e r i a l m l n l c e l l s (42, 51), the m a x i c e l l system (156), ln_ v 1 tro. t r a n s c r i p t i o n -t r a n s l a t i o n systems (26, 93, 212), and s e l e c t i v e s y n t h e s i s of plasmid encoded products a f t e r prolonged drug treatment of the host c e l l s (128, 189). The i d e n t i f i c a t i o n of the p r o t e i n s from these systems can be f u r t h e r f a c i 1 i t a t e d by immunopreclpltatIng them with s p e c i f i c a n t i s e r a p r i o r to (55, 166) or a f t e r (92) g e l f r a c t i o n a t i o n . The s i z e of the p o l y p e p t i d e Is determined by SDS-PAGE. The coding r e g i o n of a c l o n e d gene can be d e l i n e a t e d by d e l e t i o n analyses with r e s t r i c t i o n endonucleases (39, 149 185). The base sequence of the gene i s then determined by the 3 2 chemical (114, 115) or the enzymatic dldeoxy (157) methods, r a t i o n a l e and methodology of these procedures are d e s c r i b e d d e t a i l in the l i t e r a t u r e (12, 76, 114, 115, 118, 157). 33 2.2. M a t e r i a l s and methods 2.2.1. B a c t e r i a l s t r a i n s C. fImi ATCC 484 (201) was the source of the endoglucanase gene f o r g e n e t i c manipulations and c h a r a c t e r i z a t i o n . JS. c o l 1 C600 ( F _ , t h i - 1 , t h r - 1 , leuB6, l a c Y l , tonA21, supE44, X", r e f . 113) was the host f o r c l o n i n g and maintenance of recombinant plasmids between pBR322 and C. f imi DNAs; i t was a l s o the host in which the endoglucanase a c t i v i t i e s encoded by the recombinant plasmids were assayed. E. c o l i CSR603 ( r e c A l , uvrA6, phr-1; r e f . 156) was the host in which the immunoprecip1tated endoglucanase was i d e n t i f i e d . F o r m a l i n -f i x e d , h e a t - l n a c t 1 v a t e d Staphylococcus aureus Cowan I (SAC, at 10% (v/v) i n PBS-azide; obtained from Dr. K. Maltman; r e f s . 88, 94) was employed as the adsorbent f o r immune complexes in lmmunopreclpltation. 2.2.2. Media and growth c o n d i t i o n s The b a s a l medium supplemented with CMC as the energy source (201) f o r growth of C. f1ml, and the Lurla-Bertan1 (LB; r e f . 113) and M9 media (21, 113) f o r growth of E. c o l 1 s t r a i n s were d e s c r i b e d p r e v i o u s l y . If s o l i d media were r e q u i r e d , D i f c o agar was added to the media to a f i n a l c o n c e n t r a t i o n of 1.5%. CMC agar p l a t e s (181) f o r s e l e c t i n g CMCase-positive E. c o l i c lones were prepared by i n c o r p o r a t i n g into the M9 medium (113) a f i n a l c o n c e n t r a t i o n of 0.9% high v i s c o s i t y CMC and 1.2% of D i f c o agar. To s e l e c t f o r plasmid transformants, the media were r o u t i n e l y supplemented with 70 Ug per ml of a m p i c i l l i n . C. f i m i c e l l s were grown a e r o b i c a l l y at 30°C as d e s c r i b e d 34 (201); E. c o l 1 s t r a i n s were grown a e r o b l c a l l y at 37°C unless otherwise s p e c i f i e d . B a c t e r i a l s t r a i n s that were used r e g u l a r l y were maintained by s u b c u l t u r i n g onto appropriate f r e s h agar media every four to s i x weeks. Permanent stocks were s t o r e d at -20°C in l i q u i d c u l t u r e made 40% in g l y c e r o l . 2.2.3. Plasmids pBR322 (17) was used as the v e c t o r f o r the endoglucanase gene. 2.2.4. A n t i s e r a The monoclonal antibody A2/23.11.32 (101), the p o l y c l o n a l a n t i b o d i e s (201) ag a i n s t c e l l u l o s e - i n d u c e d C. f1m i e x t r a c e l l u l a r enzymes, and the normal r a b b i t serum were obtained from Dr. D. G. K i l b u r n . 2.2.5. Enzymes and reagents A l l r e s t r i c t i o n endonucleases were purchased from e i t h e r Bethesda Research L a b o r a t o r i e s , New England B i o l a b s or PL B1 ochemicals. A l l modifying enzymes were obtained from PL Blochemlcals, except f o r c a l f I n t e s t i n a l phosphatase, which was from Boehrlngei—Mannheim. Ribonuclease A, low and hi g h v i s c o s i t y CMC, Congo red dye, ethidium bromide and a n t i b i o t i c s were obtained from Sigma Chemicals. Bacteriophage X DNA was from Bethesda Research L a b o r a t o r i e s . Bovine serum albumin (BSA, f r a c t i o n V) was from M i l e s L a b o r a t o r i e s , Inc. U n l a b e l l e d deoxyribonucleoside 5'-triphosphates were from PL B l o c h e m l c a l s ; r a d i o a c t i v e n u c l e o t i d e s and [35s] me th i on I ne were from New 35 England Nuclear. A l l other chemicals used were of a n a l y t i c a l grade and obtained from chemical s u p p l i e r s . 2.2.6. B u f f e r s Tris-Borate-EDTA (TBE) and Tris-Acetate-EDTA (TAE) b u f f e r s used f o r gel e l e c t r o p h o r e s i s of DNAs were d e s c r i b e d p r e v i o u s l y (113). B u f f e r s f o r res u s p e n s i o n of DNAs, f o r Southern h y b r i d i z a t i o n , f o r DNA r e s t r i c t i o n , d e p h o s p h o r y l a t i o n and l i g a t i o n , f o r Klenow and T4 DNA polymerease r e a c t i o n s , and for l o a d i n g of DNA samples were d e s c r i b e d p r e v i o u s l y (113). B u f f e r s f o r SDS-polyacrylamide gel e l e c t r o p h o r e s i s of p r o t e i n s (4), f o r the ma x i c e l l procedure (21), and f o r immunoprecipitation (88) were d e s c r i b e d p r e v i o u s l y , unless s p e c i f i e d otherwise. 2.2.7. E x t r a c t i o n of DNAs Plasmids f o r a n a l y t i c a l and p r e p a r a t i v e purposes were i s o l a t e d from E. c o l i by the a l k a l i n e l y s i s procedure (113). Whenever i t was necessary, the i s o l a t e d DNAs were p u r i f i e d f u r t h e r by banding in CsCl-ethidium bromide d e n s i t y g r a d i e n t s (113). Genomic DNA from C. f i m i f o r c l o n i n g work and Southern h y b r i d i z a t i o n (172) was prepared by B. Gerhard a c c o r d i n g to the procedure d e s c r i b e d (201). 2.2.8. Gel e l e c t r o p h o r e s i s A n a l y t i c a l and p r e p a r a t i v e agarose g e l e l e c t r o p h o r e s i s was a l l done in h o r i z o n t a l submerged gel systems (113). The g e l s r o u t i n e l y contained ethidium bromide at a c o n c e n t r a t i o n of 0.5 tfg per ml. When the e l e c t r o p h o r e s i s time was long, ethidium bromide was a l s o added to the b u f f e r in the anode chamber to a 36 c o n c e n t r a t i o n of 0.5 tfg per ml. The c o n c e n t r a t i o n of the g e l , the a p p l i e d voltage and the e l e c t r o p h o r e s i s time v a r i e d from experiment to experiment; the c o n d i t i o n s are s p e c i f i e d in the legends to the f i g u r e s . Photographs of the g e l s were taken with P o l a r o i d type 57 4X5 Land f i l m and an orange f i l t e r . The f r a c t i o n a t i o n of the DNA sequencing mixtures generated by the chemical cleavage method (114, 115) was done on 6% denaturing polyacrylamide g e l s (12) with dimensions of 0.4cm X 19.7cm X 85cm (SI model, Bethesda Research L a b o r a t o r i e s ) f o r 5 hr at a constant voltage of 2500. A f t e r e l e c t r o p h o r e s i s , , the gel s were exposed to X-ray f i l m s (type XAR-5, Kodak) o v e r n i g h t , with or without an i n t e n s i f y i n g screen. SDS-polyacrylamide gel e l e c t r o p h o r e s i s of p r o t e i n s was performed with the di s c o n t i n u o u s b u f f e r system ( 4 ) . The gel f r a c t i o n a t i n g system (3% s t a c k i n g g e l and 10% s e p a r a t i n g g e l ) , the running c o n d i t i o n s (the ones s p e c i f i e d f o r slow e l e c t r o p h o r e s i s ) , and the r e c i p e s f o r the s t a i n i n g and d e s t a i n i n g s o l u t i o n s were d e s c r i b e d p r e v i o u s l y ( 4 ) . A f t e r e l e c t r o p h o r e s e s , g e l s were d r i e d with a s l a b gel d r i e r (Hoefer S c i e n t i f i c Instruments). 2.2.9. Subcloning of pEC2 About 2 Ug of pEC2 were used f o r each d e l e t i o n experiment. The plasmid was c l e a v e d with 4 u n i t s of A v a l , Pvu11 or S a l I in 20 Ul of an a p p r o p r i a t e r e s t r i c t i o n b u f f e r at 37°C. An a l i q u o t of 4 Ul of each d i g e s t was withdrawn every 20 min and the r e a c t i o n was stopped by adding 1 Ul of Na 2EDTA (0.05 M, pH 7.5). 3 7 The a l i q u o t s of the same r e a c t i o n were then pooled and the mixture was e x t r a c t e d once with phenol, once with phenol/chloroform and once with c h l o r o f o r m . The DNA was p r e c i p i t a t e d by the a d d i t i o n of sodium acetate and three volumes of c o l d 95% e t h a n o l . The DNA p e l l e t was washed twice with 100 Ul of 70% e t h a n o l , then d r i e d by l y o p h i l i z a t i o n . Each p e l l e t was resuspended in 20 ^1 of l i g a t i o n b u f f e r , and the l i g a t i o n was conducted by adding 2 Weiss u n i t s of T4 DNA l i g a s e and incubating at 16°C f o r 18 hr (113). Afterwards, 10 Ul of each l i g a t i o n mixture were used to transform E. c o l i c e l l s made competent by the C a C l 2 procedure (113). Transformants were s e l e c t e d on LB p l a t e s supplemented with a m p i c i l l i n and were then screened f o r CMCase a c t i v i t y on CMC p l a t e s . CMCase-p o s i t i v e clones were saved f o r f u r t h e r c h a r a c t e r i z a t i o n . 2.2.10. Cloning of the N-terminus of the endoglucanase gene This experiment was performed in c o l l a b o r a t i o n with B. Gerhard of our l a b o r a t o r y . D e t a i l s of the f o l l o w i n g steps can be obtained from r e f . 113, unless s p e c i f i e d otherwise. Five tubes were prepared, each c o n t a i n i n g 5 Ug of C. f i m i DNA and 5 u n i t s of BamHI i n 100 ul of BamHI r e s t r i c t i o n b u f f e r . The tubes were incubated at 37°C, then one of them was withdrawn every 15 min and the r e a c t i o n was stopped with N a 2 E D T A . The d i g e s t s were f r a c t i o n a t e d on a 1.2% low-melting p o i n t agarose (Bio-Rad L a b o r a t o r i e s ) g e l . DNA fragments b i g g e r than 5 kb were r e t r i e v e d by c u t t i n g them out of the g e l . The f i v e b l o c ks of gel were pooled, melted at 65°C, and the DNA fragments were p u r i f i e d by repeated phenol and chloroform 38 e x t r a c t i o n s . The DNA was t h e n p r e c i p i t a t e d by e t h a n o l p r e c i p i t a t i o n , washed and d r i e d as d e s c r i b e d p r e v i o u s l y . The DNA p e l l e t was t h e n r e s u s p e n d e d i n 100 Ul o f l i g a t i o n b u f f e r t o g e t h e r w i t h BamHI c l e a v e d pBR322 i n a m o l a r r a t i o o f 3:1 ( i n s e r t : v e c t o r ) . The l i g a t i o n was c o n d u c t e d a t 16°C f o r 24 h r ; t h e n the l i g a t i o n m i x t u r e was used to t r a n s f o r m E. c o I i c e l l s made competent by the C a C l 2 p r o c e d u r e . Those t r a n s f o r m a n t s which were b o t h Ap R and C M C a s e - p o s i t i v e were s a v e d f o r f u r t h e r c h a r a c t e r i z a t i on. 2.2.11. S o u t h e r n h y b r i d i z a t i o n of DNA About 30 Ug o f _C. f i m i DNA were c o m p l e t e l y d i g e s t e d w i t h Smal; t h e n 5 Ug a l i q u o t s of the d i g e s t e d DNA were d i g e s t e d c o m p l e t e l y w i t h BamHI, P v u I I , X h o l , and M l u l . D o u b l y d i g e s t e d DNAs were t h e n h y b r i d i z e d (172) t o the p r o b e DNA. The p r o b e was a l a b e l l e d A v a l I f r a g m e n t of pcEC2 ( s e e R e s u l t s , F i g . 13). I t was p r e p a r e d by f i l l i n g i n the ends o f 1 ug o f the f r a g m e n t w i t h 20 UCi (2 Ul) o f e a c h o f the the t h r e e r a d i o a c t i v e »• 32 > n u c l e o t i d e s [«- P J d A T P , -dGTP and -dCTP, u s i n g the Klenow fragment o f DNA p o l y m e r a s e I. 2.2.12. Enzyme a s s a y s Q u a l i t a t i v e l y , the e n d o g l u c a n a s e a c t i v i t y c o u l d be d e t e c t e d by the CMC p l a t e a s s a y ( 1 8 1 ) , which was m o d i f i e d to g i v e b e t t e r c o n t r a s t . C e l l s were grown on the p l a t e s u n t i l c o l o n i e s were about 2 mm i n d i a m e t e r . The c o l o n i e s were washed o f f the p l a t e s which were t h e n s t a i n e d w i t h 0.2% Congo r e d s o l u t i o n f o r 10 min w i t h g e n t l e s h a k i n g , and e x c e s s dye was removed by wa s h i n g w i t h 39 5% NaCl s o l u t i o n . H y d r o l y s i s of CMC by the enzyme was i n d i c a t e d by the appearance of yellow c l e a r i n g zones on the red background (see F i g . 4). Q u a n t i t a t i v e l y and r o u t i n e l y , CMCase a c t i v i t y in c e l l e x t r a c t s was measured c o l o r i m e t r i c a l l y with the d i n i t r o s a l i c y l i c (DNS) reagent (120). The absorbance values at O.D.530 were read a g a i n s t blanks c o n t a i n i n g e q u i v a l e n t amounts of enzyme which had been i n a c t i v a t e d by the DNS reagent before i n c u b a t i o n . One u n i t of CMCase a c t i v i t y r e l e a s e d 1 /(mol of glucose e q u i v a l e n t s per min at 37°C as determined by r e f e r e n c e to a standard curve (Appendix I ) . The s p e c i f i c a c t i v i t y of CMCase is expressed as u n i t s of CMCase a c t i v i t y per mg of p r o t e i n in the sample. The amount of p r o t e i n was determined by the Bio-Rad p r o t e i n assay (Bio-Rad P r o t e i n Assay Instrument Manual) by re f e r e n c e to the standard curve of bovine Y -g l o b u l i n (Bio-Rad p r o t e i n standard I; Appendix I I ) . 2.2.13. I d e n t i f i c a t i o n of the endoglucanase product encoded by pEC2 and i t s d e r i v a t i v e s 2.2.13.1. The m a x i c e l l technique This technique was done b a s i c a l l y a c c o r d i n g to the procedure d e s c r i b e d p r e v i o u s l y (21), except f o r the f o l l o w i n g m o d i f i c a t i o n s . E. c o l 1 CSR603 (with pEC2 or d e r i v a t i v e s ) was grown overnight in M9 medium supplemented with IH casamino a c i d , 1% glucose and a m p i c i l l i n . The next day, 2 ml of c u l t u r e were t r a n s f e r r e d to 30 ml of the same medium. The c u l t u r e was incubated i n a side-arm f l a s k u n t i l the c e l l d e n s i t y was 2 X 10 8 per ml determined as d e s c r i b e d p r e v i o u s l y . A f t e r c h i l l i n g 40 o n i c e f o r 10 m i n , 10 ml o f c u l t u r e w e r e p i p e t t e d i n t o a s t e r i l e p e t r i d i s h . The c e l l s w e r e i r r a d i a t e d w i t h a U V S - 5 4 m i n e r a l i g h t f r o m a d i s t a n c e o f 5 0 cm a b o v e ( t h e l i g h t s o u r c e a n d p e t r i d i s h w e r e e n c l o s e d i n a n a l u m i n i u m f o i l w r a p ) f o r 10 s e c . 9 ml o f i r r a d i a t e d c e l l s w e r e p i p e t t e d i n t o a s t e r i l e E r l e n m e y e r f l a s k a n d t h e c e l l s w e r e i n c u b a t e d a n d t r e a t e d w i t h c y c l o s e r i n e ( f i n a l c o n c e n t r a t i o n , 2 0 0 tfg/ml) a s d e s c r i b e d p r e v i o u s l y . A f t e r w a r d s , t h e c e l l s w e r e s p u n d o w n f o r 15 m i n a t 1 5 , 0 0 0 x g a n d 4 ° C . The p e l l e t was w a s h e d o n c e w i t h 9 m l o f M9 b u f f e r ( 2 0 ml o f 10X M9 s a l t t o ISO ml H 2 0 ) , a n d t h e c e l l s w e r e p e l l e t e d a s d e s c r i b e d a b o v e . The p e l l e t was r e s u s p e n d e d i n 4 . 5 ml o f s u p p l e m e n t e d M9 m e d i u m w i t h o u t s u l f a t e , a n d 1 . 5 ml o f t h e c e l l s w e r e t r a n s f e r r e d t o a s t e r i l e s c i n t i l l a t i o n v i a l , w h i c h was t h e n i n c u b a t e d a t 3 7 ° C f o r 1 h r . S u b s e q u e n t l y , 5 0 UCi o f ( 35S) m e t h i o n i n e w e r e a d d e d , a n d t h e i n c u b a t i o n was c o n t i n u e d f o r a n o t h e r h r . The c e l l s w e r e t h e n t r a n s f e r r e d t o a s t e r i l e m i c r o f u g e t u b e , a n d w e r e p e l l e t e d a t 4 ° C f o r 15 m i n . T h e c e l l p e l l e t was w a s h e d o n c e w i t h 1 . 5 ml o f M9 b u f f e r , a n d t h e c e l l s w e r e p e l l e t e d a s d e s c r i b e d b e f o r e . 2 . 2 . 1 3 . 2 . L y s i s o f t h e l a b e l l e d c e l l s C e l l s w e r e l y s e d a c c o r d i n g t o t h e p r o c e d u r e d e s c r i b e d p r e v i o u s l y ( 2 0 3 ) . The c e l l p e l l e t was r e s u s p e n d e d i n 100 Ul o f T r i s - H C l ( 5 0 mM, pH 8 . 0 ) . A f t e r t h e a d d i t i o n o f 67 Ul o f N a 2 E D T A ( 0 . 2 5 M , pH 8 . 0 ) , t h e t u b e was c h i l l e d o n i c e f o r 5 m i n s . T h e n 100 Ul o f f r e s h l y p r e p a r e d l y s o z y m e s o l u t i o n ( 1 0 mg p e r ml l n 10 mM T r i s - H C l , pH 8 . 0 ) w e r e a d d e d a n d t h e t u b e w a s i n c u b a t e d a t 3 7 ° C f o r 20 m i n . A f t e r a d d i n g 30 Ul o f T r i t o n X -41 100 BSA mixture (5% T r i t o n X-100, 5% BSA (w/v) in 10 mM T r i s -HCl, pH 8.0), the mixture was f r o z e n q u i c k l y on dry i c e , then thawed q u i c k l y at 37°C. The freeze-thaw c y c l e was repeated u n t i l the l y s a t e was s l i g h t l y y e l l o w i s h and v i s c o u s . C e l l d e b r i s were removed by s p i n n i n g in, a microfuge f o r 5 min and the supernatant was t r a n s f e r r e d to a s t e r i l e microfuge tube. 2.2.13.3. Immunoprecipitation P r o t e i n s were immunoprecipitated using a m o d i f i c a t i o n of the method of I v a r i e and Jones ( r e f . 88). The supernatant was mixed with 100 Ul of normal r a b b i t serum (about 50 ug of IgG) and the mixture was c h i l l e d on ice f o r 20 min. Then 100 Ul of SAC c e l l s (which had been washed twice with PBS and resuspended in PBS) were added and the i n c u b a t i o n in ice was continued f o r another 30 min. The c e l l s were p e l l e t e d f o r 5 min in a microfuge and the supernatant was saved. The supernatant was mixed with 5 Ul of a n t i - c e 1 1 u l a s e antiserum (about 50 Ug of IgG) and the mixture was c h i l l e d on ice f o r 16 hr. Then 100 Ul of washed SAC c e l l s were added and the i n c u b a t i o n on ice was continued f o r 30 min more. The c e l l s were p e l l e t e d and the supernatant was d i s c a r d e d . The c e l l p e l l e t was a g i t a t e d on a vortex mixer and then mixed with 0.5 ml of BSA mixture (0.5% BSA, 1% T r i t o n X-100 and 0.05% sodium azide in PBS). The mixture was c e n t r i f u g e d f o r 5 min in a microfuge, and the c e l l p e l l e t again washed with BSA mixture. The c e l l s were washed twice with 0.5 ml of T r i t o n X-100 mixture (1% T r i t o n X-100 and 0.05% sodium azide in PBS). The f i n a l c e l l p e l l e t was 42 resuspended In 90 tfl of c r a c k i n g b u f f e r (21). J u s t p r i o r to SDS-PAGE, the c e l l s were b o i l e d f o r 5 min. The d e b r i s were spun down, 0.2% bromophenol blue was added to the supernatant to give a f i n a l c o n c e n t r a t i o n of 0.01%, and the e n t i r e mixture was e l e c t r o p h o r e s e d . 43 2 . 3 . R e s u l t s 2 . 3 . 1 . The l o c a l i z a t i o n o f t h e e n d o g l u c a n a s e g e n e i n p E C 2 The o r i g i n a l l i b r a r y o f C . f i m i DNA w a s c o n s t r u c t e d b y l i g a t i n g a BamHI d i g e s t o f g e n o m i c DNA i n t o t h e BamHI s i t e o f p B R 3 2 2 . E . c o 1 1 C 6 0 0 was t r a n s f o r m e d w i t h t h e p l a s m i d m i x t u r e . R S A m p i c i 1 1 i n - r e s i s t a n t ( A p ) , t e t r a c y c l i n e - s e n s i t i v e ( T c ) c l o n e s w e r e s c r e e n e d f o r e x p r e s s i o n o f C . f i m i c e l l u l a s e s w i t h a n t i b o d y p r e p a r e d a g a i n s t p r o t e i n s s e c r e t e d b y £ . f i m i d u r i n g g r o w t h o n c e l l u l o s e . P o s i t i v e c l o n e s w e r e c h a r a c t e r i z e d f u r t h e r b y d e t e r m i n a t i o n o f e n z y m a t i c a c t i v i t i e s ( 5 5 , 2 0 1 ) . S e v e r a l c l o n e s c o n t a i n e d a p l a s m i d , p E C 2 , e n c o d i n g a n e n d o g l u c a n a s e ( 5 7 ) o n a n i n s e r t o f a b o u t 5 . 2 k b ( 5 5 ) . I t was n e c e s s a r y t o l o c a l i z e t h e e n d o g l u c a n a s e g e n e w i t h i n t h e i n s e r t i n o r d e r t o r e d u c e t h e a m o u n t o f DNA t o be s e q u e n c e d . A r e s t r i c t i o n map o f t h e p l a s m i d was c o n s t r u c t e d a s a p r e l i m i n a r y s t e p ( T a b l e V I a n d F i g . 5 ) . T h e n s u b c l o n e s o f p E C 2 w e r e made b y d e l e t i n g p o r t i o n s o f t h e i n s e r t u s i n g A v a l , P v u I I a n d S a i l , a l l o f w h i c h c u t many t i m e s i n t h e i n s e r t b u t o n l y o n c e i n p B R 3 2 2 ( T a b l e V I ) . The p l a s m i d was p a r t i a l l y d i g e s t e d w i t h e a c h o f t h e e n z y m e s , d i l u t e d a n d r e l i g a t e d . T h i s r e s u l t e d i n t h e e x c i s i o n o f v a r i o u s l e n g t h s o f DNA. T r a n s f o r m a n t s ( T a b l e V I I ) w e r e s c r e e n e d f o r a c t i v i t y b y t h e CMC p l a t e a s s a y ( s e e F i g . 4 ) . The p l a s m i d s f r o m t h e p o s i t i v e c l o n e s w e r e c o m p a r e d w i t h p E C 2 b y a g a r o s e g e l e l e c t r o p h o r e s i s . T h r e e d e l e t i o n m u t a n t s w e r e o b t a i n e d . T w o , d e s i g n a t e d p E C 2 . 1 a n d p E C 2 . 2 , w e r e g e n e r a t e d w i t h A v a l ; t h e t h i r d , p E C 2 . 3 was g e n e r a t e d w i t h P v u I I . The t h r e e d e l e t i o n m u t a n t s w e r e c h a r a c t e r i z e d f u r t h e r b y I4.U T a b l e VI. A summary o f v a r i o u s r e s t r i c t i o n s i t e s i n pEC2 R e s t r i c t i o n enzyme No. o f s i t e s i n i n s e r t No . of s i t e s i n pBR322 C l a l 1 EcoRI 1 EcoRV 0 1 H i n d l l l i SphI 1 Xbal 0 Bali, i 0 Kpnl 1 0 P s t l 1 PvuII 3 1 M l u l 4 0 Smal 0 5 Xmal 0 A v a l 1 B a l l 1 H i n d l l 2 Nael 4 N r u l 1 P v u l >5 1 R s a l 3 S a i l 1 S a u l 1 Xhol 0 Xma.HI 1 45 0.19 itl 0.38 f I 1.12 2.67 B 3.31 4.36 A _ L P EHRBPV B g J R B 5.20 4.70 3.50 2.40 (0.86 I F i g . 5. R e s t r i c t i o n map of pEC2. The open bar r e p r e s e n t s pBR322 DNA; the s o l i d bar represents C. f i m i DNA; the numbers i n d i c a t e the lengths of the r e s t r i c t i o n fragments i n kb. R e s t r i c t i o n enzymes are: A, Aval; B, BamHI; Bg, BgJ 11; E, EcoRI; H, H i n d l l l ; K, Kpnl; P, P s j l ; Pv, P v u l l ; and R, EcoRV. 46 Table V I I . Generation of d e l e t i o n s in pEC2 Enzyme used Number of E. c o l l transformants Number of CMCase-pos i t ive transformants Number of transformants harbor ing genuine mutants Aval 838 16 2 S a i l 183 13 not screened PvuII 23 3 1 4 7 r e s t r i c t i o n analyses ( F i g . 6 ) . L i n e a r i z a t i o n with Bgl 11 showed pEC2, pEC2.1, pEC2.2 and pEC2.3 to be 9.6, 5.2, 6.8 and 6.2 kb r e s p e c t i v e l y . When the plasmids were c l e a v e d with BamHI, pEC2 gave fragments of 5.2 ( i n s e r t ) and 4.4 kb ( v e c t o r ) . However, pEC2.1 and pEC2.3 gave s i n g l e fragments of 5.2 and 6.2 kb, r e s p e c t i v e l y . T h e r e f o r e , one of the two BamHI s i t e s in pEC2 was d e l e t e d in pEC2.1 and pEC2.3, and the d e l e t i o n s must have removed p a r t s of the pBR322 v e c t o r . pEC2.2 gave fragments of 4.4 and 2.4 kb, showing i t s d e l e t i o n to be e n t i r e l y w i t h i n the i n s e r t . A f t e r d i g e s t i o n with P s t l , pEC2 gave the expected two bands (see F i g . 5). However, pEC2.1 and pEC2.2 were only l i n e a r i z e d by t h i s enzyme. The remaining P s t l s i t e in each of them must be in the ve c t o r because they r e t a i n the Ap R phenotype. pEC2.3, s t i l l gave two fragments with P s t l , but the l a r g e r fragment was reduced in s i z e in t h i s d e l e t a n t . The f o l l o w i n g c o n c l u s i o n s can be drawn from the r e s t r i c t i o n a n a l y s e s : 1. The r e t e n t i o n of the Bg_l 11 s i t e but the l o s s of the P s t l s i t e in the i n s e r t i n pEC2.1 showed that the d e l e t i o n in t h i s plasmid s t a r t e d somewhere between these two s i t e s , extending through the rlghtward BamHI s i t e , and f i n a l l y t e r m i n a t i n g at the Aval s i t e in pBR322 ( F i g . 5 ) . Since pEC2.1 was 4.4 kb sma l l e r than pEC2, the d e l e t i o n s t a r t e d 1.9 kb from the BamHI s i t e at the l e f t w a r d end of the I n s e r t . 2. The r e t e n t i o n of the Bgl11 s i t e and the d e l e t i o n of the P s t l s i t e showed that the d e l e t i o n in pEC2.2 a l s o s t a r t e d between 48 E M II BamH I PstI 1 2 3 4 5 6 7 8 9 10 11 12 13 14 23-1 0.56 F i g . 6 . R e s t r i c t i o n a n a l y s i s o f p E C 2 a n d i t s d e l e t i o n m u t a n t s . D i g e s t s w e r e e l e c t r o p h o r e s e d o n a 0 . 7 % a g a r o s e g e l f o r 4 h r a t a c o n s t a n t v o l t a g e o f 7 0 . L a n e s 1 a n d 14 a r e A DNA r e s t r i c t e d w i t h H i n d l 1 1 , a n d t h e n u m b e r s r e p r e s e n t t h e s i z e s o f t h e f r a g m e n t s i n k b . L a n e s 2 t o 13 a r e t h r e e d i f f e r e n t s e t s o f r e s t r i c t i o n a n a l y s e s a s i n d i c a t e d b y t h e n a m e s o f e n z y m e s o n t o p o f t h e l a n e s . L a n e s 2 , 6 a n d 10 a r e f o r p E C 2 ; l a n e s 3 , 7 a n d 11 a r e f o r p E C 2 . l ; l a n e s 4 , 8 a n d 12 a r e f o r p E C 2 . 2 , a n d l a n e s 5 , 9 a n d 13 a r e f o r p E C 2 . 3 . 4 9 these two s i t e s . The l o s s of the Kpnl s i t e ( F i g . 5) showed that the d e l e t i o n removed t h i s s i t e . 3. The r e t e n t i o n of the P s t l s i t e in the i n s e r t in pEC2.3 i n s p i t e of the d e l e t i o n of a 3.4 kb fragment showed that the d e l e t i o n i n t h i s plasmid extended from the PvulI s i t e in the middle of the i n s e r t to the PvulI s i t e in pBR322. The exact l o c a t i o n of the d e l e t i o n in pEC2.2 was determined by d i g e s t i n g the plasmid s i m u l t a n e o u s l y with BamHI and Smal ( F i g . 7A). Since Aval r e c o g n i z e s the sequence CPyCGPuG, i t can a l s o recognize the Smal s i t e , which i s CCCGGG. pEC2.2 was generated by Aval c u t t i n g f o r t u i t o u s l y at the two Smal or Aval (S/A) s i t e s in the C_. f i m i fragment of pEC2 ( F i g . 7B). The r e s t r i c t i o n maps of the plasmids are summarized i n F i g . 7B. 2.3.2. The ex p r e s s i o n of c e l l u l a s e a c t i v i t y by pEC2 and i t s d e l e t i o n d e r i v a t i v e s E. c o l i clones harboring pEC2 and the d e l e t i o n mutants were assayed q u a n t i t a t i v e l y f o r CMCase a c t i v i t y (Table V I I I ) . A l l three mutants expressed CMCase a c t i v i t y equal to that of pEC2. This suggested that the endoglucanase coding sequence was contained w i t h i n the 1.4 kb BamHI -Smal fragment of C_. f i m i DNA common to the three mutants ( F i g . 7B). Since pEC2 and the three mutants a l l encoded a C. f i m i p o l y p eptide with a Mr of 53,000 ( F i g . 8), i t was concluded that the sequence encoding the CMCase a c t i v i t y and a n t i g e n i c i t y l a y w i t h i n t h i s 1.4 kb fragment. However, a fragment of 1.4 kb i s not q u i t e s u f f i c i e n t to encode a 53 kDa p o l y p e p t i d e . It would s u f f i c e i f the CMCase 50 F i g . 7. S t r u c t u r e s of pEC2 and i t s d e l e t i o n d e r i v a t i v e s . (A) A n a l y s i s of pEC2 and i t s d e r i v a t i v e s a f t e r d i g e s t i o n with BamHI plus Smal. Dige s t s were e l e c t r o p h o r e s e d on a 1.2% agarose g e l f o r 4.5 hr at a constant voltage of 50. Lanes 1 to 4 are, r e s p e c t i v e l y , pEC2, pEC2.1, pEC2.2 and pEC2.3. Numbers 1 to 7 repr e s e n t the seven fragments obtained f o r pEC2 in the double d i g e s t i o n (see B f o r t h e i r l o c a t i o n s ) . Lane 5 i s X DNA r e s t r i c t e d with H i n d l l l plus EcoRI; s i z e s of fragments are In kb as i n d i c a t e d . (B) R e s t r i c t i o n maps of pEC2 and i t s d e r i v a t i v e s . The plasmids are shown i n a l i n e a r f a s h i o n f o r the convenience of comparison. (a) pEC2; (b) pEC2.l; (c) pEC2.2; and (d) pEC2.3. The open bar r e p r e s e n t s pBR322 DNA; the s o l i d bar r e p r e s e n t s C. f1ml DNA; the dashed l i n e s r e present the regions d e l e t e d in each d e r i v a t i v e . The t o t a l length of each plasmid Is i n d i c a t e d ; the i n s e r t s are 5.2 kb i n (a ) ; 1.9 kb in ( b ) ; 2.4 kb in (c) and 3.5 kb in ( d ) . The d e l e t i o n s in (b) and (d) extend to the Aval s i t e (A) and the PvuII s i t e (Pv) of pBR322, r e s p e c t i v e l y . However, the PvulI s i t e of (d) was not regenerated a f t e r r e l l g a t l o n . The d e l e t i o n In (c) was c o n f i n e d w i t h i n the two Smal or Aval s i t e s (S/A) of the I n s e r t . Numbers 1 to 7 represent the r e s t r i c t i o n fragments obtained by d i g e s t i n g pEC2 with BamHI p l u s Smal. R e s t r i c t i o n enzymes a r e : A, Aval; B, BamHI; Bg, B g J I l ; E, EcoRI; H, H i n d l l l ; K, Kpnl; P, P s t I ; Pv, Py_ull; R, EcoRV; and S, Smal. 5 1 9.6 kb 5.2 kb S/A s/A 6.8 kb 6.2 kb • 1 « • » • 52 Table V I I I . CMCase a c t i v i t i e s in clones h a r b o r i n g pEC2 and the d e l e t i o n mutants Plasmid CMCase s p e c i f i c a c t i v i t y 3 pEC2 0.22 pEC2.1 0.28 pEC2.2 0.26 pEC2.3 0.23 a S p e c i f i c a c t i v i t y i s expressed as u n i t (U) of enzyme/mg of p r o t e i n , where U i s tfmol of glucose e q u i v a l e n t s r e l e a s e d per min. A l l plasmids were In E. c o l i s t r a i n C600. 5 3 Fig. 8. Ce 11 u 1 omonas f i in i polypeptides encoded by pEC2 and its deletion derivatives. E. coli CSR603 was transformed with either pEC2, pEC2.1 or pEC2.3. The proteins encoded by each plasmid were labelled as described (Materials and Methods; ref. 21). The labelled proteins then were precipitated with antibodies against the endoglucanase, and the precipitates were analysed by gel electrophoresis on an SDS-10% po1yacry1 amide gel. Four sets of protein samples are shown, each derived from the indicated plasmid. Lanes 1, the labelled proteins before treatment with antisera; lanes 2, the protein precipitated with a monoclonal antibody A2/23.11.32 (ref. 101) directed against C. f i m i cellulase; lanes 3, the protein precipitated with antisera raised against CMC-induced C_. f i m i extracellular enzymes (ref. 201). The open triangle indicates the immunoprecipitated protein in lanes 2 and lanes 3 of al l four sample. Close triangles represent molecular weight markers; and numbers refer to sizes (kDa). 54 pEC2 PEC2.1 pEC2.2 pEC2.3 1 2 3 1 2 3 1 2 3 1 2 3 55 activity determined by the plasmids was a fusion polypeptide containing a fragment of the TcR determinant and the endoglucanase. In this case, the endoglucanase gene would lack the C_. f i m i transcriptional and translational signals controlling the expression of the gene, and a portion of the N-terminal coding sequence. 2.3.3. Transcriptional and translational signals for the CMCase activity encoded by pEC2 The involvement of the TcR promoter in the expression of the endoglucanase gene was determined i n two ways. Firstly, the C. f im i insert i n pEC2.2 (Fig. 7B) was inverted. Since pEC2.2 retained both BamHI sites of pEC2, it was digested to completion with BamHI, then religated. The plasmids in ApR, Tcs transformants were screened by restriction analysis (Fig. 9) for those containing the insert in the opposite orientation to that of pEC2.2. Such a plasmid, designated pEC2.2i, produced only 0.3 percent of the CMCase activity produced by pEC2.2 (Table IX). Secondly, a similar reduction in the level of expression was found for pEC2.lAHB (Table IX), which was formed by deleting the smaller H i ndl11-BamHI fragment of pEC2.1 (Fig. 7B), f i l l ing in the larger fragment with the Klenow fragment of DNA polymerase I, and religating the resulting blunt ends. The deleted smaller fragment contained the TcR promoter of pBR322 (177). It was concluded that the endoglucanase gene in pEC2 was transcribed from the TcR promoter. The involvement of the TcR translational signals in the 56 1 2 3 4 5 F i g . 9. R e s t r i c t i o n a n a l y s i s of pEC2.2 and pEC2.2i. Samples were el e c t r o p h o r e s e d on a 0.7% agarose g e l f o r 3 hr at a constant voltage of 50. Lane 1, * DNA r e s t r i c t e d with H i n d l l l ; the numbers i n d i c a t e the s i z e s of fragments In kb. Lanes 2 to 5, samples r e s t r i c t e d with B g l I I p l u s P s t I ; lanes 2 and 3, pEC2.2 (see F i g . 7B); and lanes 4 and 5, pEC2.2i (see F i g . 7B) . 57 Table IX. pEC2 CMCase a c t i v i t i e s produced by v a r i o u s d e r i v a t i v e s of Plasmid CMCase s p e c i f i c a c t i v i t y 3 pEC2.2 0.26 pEC2.2i 0.0008 pEC2.1 0.28 pEC2.lAHB 0.0006 pEC2.IKs 0.006 pEC2.lARB 0.006 aExpressed as U of enzyme/mg of p r o t e i n , where U i s tfmol of glucose e q u i v a l e n t s r e l e a s e d per min. A l l plasmids were i n E. c o l 1 s t r a i n C600. 58 expression of the endoglucanase gene was determined by changing the reading frame after the BamHI site of pEC2.1, which retained only one of the two BamHI sites of pEC2 (Fig. 7B). The reading frame was changed by -1 in two ways (Fig. 10). Firstly, pEC2.1Ks was made by linearizing pEC2.1 with BamHI, f i l l ing in the sticky ends and ligating the resulting blunt ends. Secondly, pEC2.1&RB was made in a similar manner by digesting pEC2.1 with EcoRV and BamHI, f i l l ing in the BamHI end, and religating the larger fragment. The frameshift in pEC2.1Ks and the small deletion and frameshift in pEC2.1aRB were confirmed by restriction analysis and DNA sequencing (Fig. 11). For both of the frameshifted mutants, the level of expression of CMCase activity was only 2 percent of that for pEC2.1 (Table IX), showing that the TcR translational signals were also essential for maximum expression of the endoglucanase gene in pEC2. 2.3.4. Cloning of the N-terminus of the endoglucanase gene It was clear that in pEC2, CMCase activity was expressed as a fusion polypeptide in which the N-terminus of the TcR determinant replaced the N-terminus of the endoglucanase. The determination of the sequence of the entire endoglucanase gene required the isolation and identification of its N-terminal coding sequence. This was accomplished in collaboration with B. Gerhard. Since pEC2 had been prepared from a complete BamHI digest of C. f i m i DNA (201), it was decided to repeat the cloning procedure using a partial digest with this enzyme. The digest was fractionated by agarose gel electrophoresis. DNA fragments 59 86 185 375 p E C 2 . 1 A T G / T G G / A T C / C C N D D Q L U C A N A O C Q g M g f i l l e d B a m H I s i t e p E C 2 . 1 K s A T G / BNDQaLUCANA8« « g N g R - . : f i l l e d 8 s i t e p E C 2 . 1 A R B A T G / G A T / G A T / C C g N D O Q L U C A N A a g O R N g , F i g . 10. The rea d i n g frames of the endoglucanase gene with respect to the s t a r t i n g ATG of the T c R gene (at p o s i t i o n 86 i n pBR322; r e f s . 138, 178) in pEC2.1, pEC2.1Ks and pEC2.lAHB. The dashed l i n e s i n d i c a t e the i n t e r v e n i n g TcR gene sequences. The slashes denote the readi n g frames. The n u c l e o t i d e sequence boxed with broken l i n e s at p o s i t i o n 185 i s the r e c o g n i t i o n s i t e of EcoRV. The n u c l e o t i d e sequence boxed with s o l i d l i n e s at p o s i t i o n 375 i s the r e c o g n i t i o n s i t e of BamHI. The s o l i d t r i a n g l e s denote the corresponding cleavage p o i n t s in these two s i t e s . The endoglucanase gene sequence i s represented by the arrows. The p r e d i c t e d r e a d i n g frame of the endoglucanase gene in pEC2.1 can be obtained from the BamHI s i t e . The p r e d i c t e d reading frames of the endoglucanase gene in pEC2.1Ks and pEC2.lARB can be obtained r e s p e c t i v e l y from the f i l l e d BamHI s i t e and the R e f i l l e d B s i t e (Ec_gRV s i t e fused with the f i l l e d BamHI s i t e ) , r e s p e c t i v e l y . Both of these plasmids have a -1 reading frame f o r the endoglucanase gene with respect to the ATG; In pEC2.1 the endoglucanase Is in-frame. 60 F i g . 11. Co n f i r m a t i o n of c o r r e c t f r a m e s h i f t i n g in pEC2.1Ks by DNA sequencing. pEC2.1Ks DNA was r e s t r i c t e d with Pst1 plus S a l I (there i s a S a l I s i t e 23 bp downstream of the unique BamHI s i t e in the i n s e r t of pEC2.1, as shown in F i g . 7B). The 1.1 kb P s t l - S a l I fragment was p u r i f i e d by agarose g e l e l e c t r o p h o r e s i s . The SaJI end was l a b e l l e d with (o(-32P) dATP with the Klenow fragment of DNA polymerase I. The l a b e l l e d fragment was then sequenced by the chemical method (114, 115). The sequence at the f i l l e d BamHI (B) s i t e (5'-GGATCGATCC-3') Is i n c l d a t e d . 6 1 >5 kb in s i z e were r e c o v e r e d from the ge l and l i g a t e d to BamHI d i g e s t e d pBR322. The p lasmids from CMCase p r o d u c i n g c l o n e s so obta ined were d i g e s t e d to c o m p l e t i o n wi th BamHI. Most of the p lasmids were i n d i s t i n g u i s h a b l e from pEC2, but one p l a s m i d , d e s i g n a t e d pcEC2, gave C_. f i m i D N A fragments of 5.2 and 0 . 8 kb ( F i g . 12). F u r t h e r r e s t r i c t i o n a n a l y s i s ( F i g . 12) showed tha t the 0 . 8 kb fragment in pcEC2 l a y between the T c R promoter r e g i o n of pBR322 and the 5.2 kb fragment of C . f i m i D N A . The 0 . 8 kb and 5.2 kb fragments were shown to be t r u l y c o n t i g u o u s on the C. f i m i genome by Southern h y b r i d i z a t i o n a n a l y s i s ( F i g . 13) . The 0 . 8 kb BamHI fragment from pcEC2 was p u r i f i e d and l i g a t e d in to BamHI d i g e s t e d p E C 2 . 1 . When the fragment was Inser ted in the same o r i e n t a t i o n as in pcEC2, the p l a s m i d , d e s i g n a t e d p c E C 2 . 1 , expressed the same l e v e l of CMCase a c t i v i t y as pcEC2 (Table X ) . However, when the fragment was i n s e r t e d in the o p p o s i t e o r i e n t a t i o n , the p l a s m i d , d e s i g n a t e d p c i E C 2 . 1 , expressed very l i t t l e CMCase a c t i v i t y (Table X ) . T h i s suggested that the 0 . 8 kb fragment c o n t a i n e d a t r a n s l a t i o n I n i t i a t i o n s i g n a l , and that the e n t i r e endoglucanase c o d i n g sequence l a y w i t h i n the 2.2 kb c o m p r i s i n g the 0 . 8 kb fragment and the f i r s t 1.4 kb of the 5.2 kb fragment of C . f i m i D N A ( F i g s . 7B and 12B). D e l e t i o n of the s m a l l e r Hindl11-BamHI fragment c o n t a i n i n g the T c R promoter from pcEC2.1 v i r t u a l l y e l i m i n a t e d the e x p r e s s i o n of CMCase a c t i v i t y (Table X, pcEC2. lAHB) i n d i c a t i n g that e x p r e s s i o n of the endoglucanase gene in pcEC2 was s t i l l dependent on the T c R promoter . 63 F i g , 12. R e s t r i c t i o n analyses of pEC2 and pcEC2. (A) R e s t r i c t i o n p a t t e r n s of pEC2 and pcEC2. D i g e s t s were e l e c t r o p h o r e s e d on a 0.7% agarose gel f o r 3.5 hr at a constant voltage of 50. Lane 1, \ DNA r e s t r i c t e d with H i n d l l l ; the numbers represent the s i z e s of the fragments in kb. The three s e t s of r e s t r i c t i o n analyses are Indicated on top of the l a n e s . Lanes 2/ 4 and 6 are pEC2; lanes 3> 5 and 7 are pcEC2. The 0.8 kb fragment of pcEC2 Is Indicated by the arrow. The l a r g e r s i z e of the s m a l l e r P s t l fragment of pcEC2 (lane 7) compared to that of pEC2 (lane 6) Indicated that the 0.8 kb fragment was at the 5' end of the 5.2 kb BamHI fragment. (B) R e s t r i c t i o n map of pcEC2. The open bar r e p r e s e n t s pBR322 DNA; the s o l i d bar represents the 5.2 kb fragment of C. f1m1 DNA; the hatched bar r e p r e s e n t s the 0.8 kb fragment of Q. f l m l DNA. The s i z e of pcEC2 i s approximately 10.4 kb; I n c l u d i n g an Insert of 6 kb. The s m a l l e r P s t l fragment of pcEC2 Is 4.3 kb (lane 7 l n A). R e s t r i c t i o n enzymes a r e : A, A v a l ; B, BamHI; Bg> B g l I I ; E, EcpRl; H, H i n d l l l ; K, Kpnl; P, P s t l ; Pv, PvuII; S, Smal; and Sa, S a i l . 64 (A) BamHI & BamHI Pst l Pstl 1 2 3 4~~5 6~~7 0.56 (B) 4.3 kb B A _ L P v P E HRB SSaBPvS Bg S S P J - M l » I K I I I L_L Pv K S Pv S B I kb 65 F i g . 13. C o n t i g u i t y o f the 0.8 kb and 5.2 kb BamHI f r a g m e n t s on the C. f i m1 genome. C. f1m1 genomic DNA was d i g e s t e d to c o m p l e t i o n w i t h Smal. Then the DNA was d i g e s t e d f u r t h e r w i t h e i t h e r M l u I , XhoI, P v u I I , o r BamHI. The f i n a l d i g e s t s were e l e c t r o p h o r e s e d on a 1.2% a g a r o s e g e l and the f r a g m e n t s t h e n h y b r i d i z e d w i t h a r a d i o a c t i v e 1 y l a b e l l e d A v a i l fragment ( M a t e r i a l s and M e t h o d s ) . The A v a i l fragment l a y w i t h i n the 0.8 kb f r a g m e n t ( a s shown i n b ) , and was l a b e l l e d w i t h [ot- 3 2P] dATP, -dGTP, and -dCTP w i t h the Klenow fragment of DNA p o l y m e r a s e I . (a) R a d 1 o a u t o g r a p h o f the g e l a f t e r h y b r i d i z a t i o n . Lane 1, pcEC2 d i g e s t e d w i t h Smal. Lane 2, jC_. f i m i DNA d i g e s t e d w i t h Smal . Lane 3, C_. f i m i DNA d i g e s t e d w i t h Smal and Ml u I • Lane 4, C. f1ml DNA d i g e s t e d w i t h Smal and XhoI. Lane 5, C. f i m i DNA d i g e s t e d w i t h Smal and P v u I I . Lane 6, C. f i m i DNA d i g e s t e d w i t h Smal and BamHI. The a r r o w s i n d i c a t e the f r a g m e n t s t h a t would be e x p e c t e d , g i v e n the r e s t r i c t i o n map of pcEC2, i f the 0.8 and 5.2 kb f r a g m e n t s a r e c o n t i g u o u s . The numbers i n d i c a t e the p o s i t i o n s o f the s m a l l e r s i z e m a rkers ( i n kb) of X DNA d i g e s t e d w i t h EcoRI and H i n d l 1 1 . (b) R e s t r i c t i o n map of the Smal f r a g m e n t d e r i v e d from pcEC2. The h a t c h e d b a r r e p r e s e n t s p a r t o f the 0.8 kb BamHI f r a g m e n t ; the open bar r e p r e s e n t s p a r t of the 5.2 kb BamHI f r a g m e n t ; the s o l i d b ar r e p r e s e n t s the A v a i l f r a g m e n t used as the p r o b e . The numbers, in bp, i n d i c a t e the l e n g t h of the r e s t r i c t i o n f r a g m e n t s . R e s t r i c t i o n enzymes a r e : B, BamHI; M, M l u l ; Pv, P v u I I ; S, Smal; and X, X h o I . a 1 2 3 4 5 6 1 6 0 4 1 0 . S I V 0 JO 4 4 0 X v M — r r 7 9 0 8 4 0 9 3 0 6 7 Table X. CMCase activit ies determined by pcEC2 and its derivatives Plasmid CMCase specific act iv i ty 3 pcEC2 0.15 pcEC2.1 0.15 pciEC2.1 0.0005 pcEC2.lAHB 0.0009 Expressed as U of enzyme/mg of protein, where U Is «mol of glucose equivalents released per min. A l l plasmids were in E. coli strain C600. 68 2.4. D i s c u s s i o n The e x p r e s s i o n of the endoglucanase gene fragment in pEC2 and i t s d e r i v a t i v e s as an a c t i v e f u s i o n p o l y p e p t i d e shows that the N-terminal fragment of the nat i v e enzyme is not e s s e n t i a l f o r enzyme a c t i v i t y . It remains to be determined whether i t s absence a f f e c t s the k i n e t i c s or s u b s t r a t e b i n d i n g of the enzyme. It i s p o s s i b l e that the N-terminus of the T c R determinant s u b s t i t u t e s to a high degree f o r the missing segment of the enzyme, since i t is approximately the same length (96 amino a c i d s ) as the missing endoglucanase fragment (76 amino a c i d s , see Chapter 3). In order to answer these questions, i t i s necessary to i s o l a t e mutants with d e l e t i o n s l y i n g between the true N-terminus of the n a t i v e enzyme and the j u n c t i o n of the 0.8 and 5.2 kb fragments of pcEC2. A l l three d e l e t i o n mutants encoded s l i g h t l y h i g h e r CMCase a c t i v i t i e s than d i d pEC2 (Table V I I I ) . T h i s c o u l d r e s u l t from an increase in plasmid copy number because of t h e i r reduced s i z e s (20, 135). The r e s i d u a l c e l l u l a s e a c t i v i t i e s expressed by pEC2.2i and pEC2.lAHB (Table IX), in which the endoglucanase gene was no longer t r a n s c r i b e d from the T c R promoter, c o u l d be a consequence of incomplete t e r m i n a t i o n of t r a n s c r i p t i o n s , i . e . readthrough, from other promoters that have been i d e n t i f i e d in pBR322 (177). A l t e r n a t i v e l y , i t c o u l d be due to t r a n s c r i p t i o n s i n i t i a t e d from some u n i d e n t i f i e d weak "promoters" i n pBR322. The l e v e l s of CMCase a c t i v i t y expressed by the two f r a m e s h i f t e d mutants: pEC2.1Ks and pEC2.lARB, were approximately 8-10 f o l d higher than those expressed by pEC2.2i and pEC2.lAHB (Table 69 IX). This probably resulted from translational reinitiation after a nonsense codon (158). Such reinitiation can start at either an AUG, a GUG or a UUG (174). This could occur at sites either in the TcR gene sequence upstream of the endoglucanase gene, or within the endoglucanase gene itself, in the two frameshifted mutants. Other than locating the endoglucanase related DNA, the deletants of pEC2 (Fig. 7) proved very useful in other ways. The deletion of one BamHI site in the formation of pEC2.1 made the remaining BamHI site of this plasmid very useful in Identifying the transcriptional and translational signals determining the expression of the endoglucanase activity encoded by pEC2. On the other hand, the retention of both BamHI sites in pEC2.2 made this plasmid a convenient source of an endoglucanase cartridge for sequencing the gene (see Chapter 3; ref. 204) and transfer of the gene segment to Saccharomyces  cerev is iae (see Chapter 4; ref. 168) and Rhodobacter capsulatus (see Chapter 4; ref. 90). 7 0 3 . The s t r u c t u r e o f t h e e n d o g l u c a n a s e g e n e a n d t h e p u r i f i c a t i o n o f t h e c l o n e d e n z y m e 3 . 1 . B a c k g r o u n d DNA c a n be s e q u e n c e d b y e i t h e r t h e c h e m i c a l ( 1 1 4 , 1 1 5 ) o r t h e e n z y m a t i c ( 1 5 7 ) m e t h o d . The a v a i l a b i l i t y o f some v e r s a t i l e s e q u e n c i n g v e c t o r s ( 1 1 7 , 1 1 8 , 1 3 1 , 2 1 1 ) a n d i t s r e l a t i v e s i m p l i c i t y m a k e s t h e l a t t e r t h e m e t h o d o f c h o i c e f o r s e q u e n c i n g l a r g e p i e c e s o f DNA. V a r i o u s s t r a t e g i e s a r e e m p l o y e d f o r t h e s u b d i v i s i o n o f DNA f r a g m e n t s i n t o s m a l l e r s e g m e n t s s u i t a b l e f o r s e q u e n c i n g . T h e a p p r o a c h e s t o g e n e r a t i n g s m a l l , o v e r l a p p i n g f r a g m e n t s f o r e n z y m a t i c s e q u e n c i n g a r e b r o a d l y c l a s s i f i e d i n t o r a n d o m ( 2 , 1 1 8 ) a n d n o n r a n d o m ( 3 , 6 5 , 7 6 , 1 2 5 ) s u b c l o n i n g p r o c e d u r e s . A m o n g s t t h e l a t t e r , t h e u n i d i r e c t i o n a l e x o n u c l e a s e I I I ( E x o I I I ) d e l e t i o n p r o c e d u r e ( 6 5 , 7 6 ) h a s many a d v a n t a g e s : a r e l a t i v e l y s m a l l n u m b e r o f m a n i p u l a t i o n s ; t h e v a r i a t i o n o f t h e r e a c t i o n c o n d i t i o n s t o a c q u i r e f r a g m e n t s o f a d e s i r a b l e l e n g t h f o r s e q u e n c i n g ; a n d t h e e a s e o f o r d e r i n g t h e o v e r l a p p i n g f r a g m e n t s b y v i s u a l e x a m i n a t i o n o f a u t o r a d i o g r a m s . The m e t h o d , a s d o a l l o t h e r n o n r a n d o m m e t h o d s , d e p e n d s o n h a v i n g a r e s t r i c t i o n map o f t h e t a r g e t DNA. S e v e r a l m e t h o d s h a v e b e e n i n t r o d u c e d t o i m p r o v e t h e r e s o l u t i o n o f t h e DNA b a n d s o n s e q u e n c i n g g e l s , a n d h e n c e f a c i l i t a t e t h e r e a d i n g o f t h e s e q u e n c e s o f f t h e a u t o r a d i o g r a m s . T h e s e i n c l u d e t h e u s e o f b u f f e r g r a d i e n t g e l s ( 1 2 ) , d e , o x y a d e n o s i n e 5 ' - (oC - 3 5 S ) t r i p h o s p h a t e i n t h e s e q u e n c i n g r e a c t i o n s ( 1 2 ) , s h a r k - t o o t h c o m b s ( 1 0 ) , a n d w e d g e - s h a p e d g e l s 7 1 (C. Newton, personal communication). This chapter d e s c r i b e s the sequencing and the s t r u c t u r e of the endoglucanase gene, and the use of immunoadsorbent chromatography to p u r i f y the endoglucanase from E. c o l i . A leader peptide of 31 amino a c i d s was deduced from the sequence of the gene; the f u n c t i o n of t h i s leader f o r the export of the endoglucanase i n E. c o l i i s d i s c u s s e d . 7 2 3.2. M a t e r i a l s and methods 3.2.1. B a c t e r i a l s t r a i n s E. c o l i C600 ( S e c t i o n 2.2.1.) was the host f o r the c l o n i n g and e x p r e s s i o n of the endoglucanase gene. E. co1i JM101 (Alacpro, supE, t h i , F' traD36, proAB, l a c i q Z&M15; r e f . 117, 118) was the host f o r M13mpl8 and i t s endoglucanase der i vat i ves. 3.2.2. Media and growth c o n d i t i o n s The media used f o r the c u l t i v a t i o n of E. c o l i C600 with or without pEC plasmids were d e s c r i b e d p r e v i o u s l y ( S e c t i o n 2.2.2. ). 2XYT medium, glucose M9 minimal medium and B medium were used f o r the c u l t i v a t i o n , i n f e c t i o n and t r a n s f e c t i o n , r e s p e c t i v e l y , of E. c o l i JM101 (118). A l l IS. co 1 i s t r a i n s were grown r o u t i n e l y at 37°C. 3.2.3. Recombinant DNAs pBR322 was the vecto r f o r the c l o n i n g and e x p r e s s i o n of the endoglucanase gene ( S e c t i o n 2.2.3.; r e f . 17). pEC2, pEC2.2 and pcEC2 were c h a r a c t e r i z e d and d e s c r i b e d p r e v i o u s l y ( S e c t i o n 2; r e f . 204). Phage M13mpl8 (211) was used as the v e c t o r f o r sequencing the endoglucanase gene. The phage RF and v i r a l DNAs were i s o l a t e d from i n f e c t e d c u l t u r e s as d e s c r i b e d p r e v i o u s l y ( 118) . 3.2.4. Enzymes and reagents The sources f o r r e s t r i c t i o n endonucleases, modifying enzymes, a n t i b i o t i c s , bacteriophage * DNA, deoxyribo-n u c l e o t i d e s , r a d i o a c t i v e dATP, chemicals and reagents are given in S e c t i o n 2.2.5. 5-bromo-4-chloro-3-indo1y1-&-D-7 3 g a l a c t o p y r a n o s i d e ( X G a l ) , i s o p r o p y l - f i - D - t h i o g a l a c t o p y r a n o s i d e ( I P T G ) a n d o - n 1 t r o p h e n y l - f i - D - g a l . a c t o s I d e w e r e f r o m S i g m a . N i t r o c e f i n was a g i f t f r o m G l a x o G r o u p R e s . L t d . M 1 3 m p l 8 v e c t o r , d i d e o x y r i b o n u c l e o t i d e s a n d s e q u e n c i n g p r i m e r s w e r e o b t a i n e d f r o m P L B i o c h e m i c a l s . 3 . 2 . 5 . B u f f e r s The b u f f e r s u s e d r o u t i n e l y a r e g i v e n i n S e c t i o n 2 . 2 . 6 . The H i n b u f f e r f o r t h e d i d e o x y t e r m i n a t i o n s e q u e n c i n g r e a c t i o n s (M13 C l o n i n g ' D i d e o x y * S e q u e n c i n g M a n u a l , B R L ) , t h e b u f f e r s f o r t h e o s m o t i c - s h o c k p r o c e d u r e ( 1 3 2 ) , t h e p h o s p h a t e b u f f e r e d s a l i n e ( P B S , pH 7 . 2 , 0 . 1 3 7 M N a C l ; r e f . 8 4 ) , t h e h i g h - s a l t p h o s p h a t e b u f f e r e d s a l i n e ( H S - P B S , pH 7 . 2 , 0 . 6 3 7 M N a C l ; r e f . 1 3 6 ) , a n d t h e g l y c i n e - H C l b u f f e r ( 0 . 1 M , pH 2 . 5 ; r e f . 8 4 ) f o r t h e i m m u n o a d s o r b e n t c h r o m a t o g r a p h y w e r e a l l d e s c r i b e d p r e v i o u s l y . 3 . 2 . 6 . N u c l e o t i d e s e q u e n c i n g o f t h e e n d o g l u c a n a s e g e n e 3 . 2 . 6 . 1 . E x o n u c l e a s e I I I d e l e t i o n s t r a t e g y The s t r a t e g y f o r g e n e r a t i n g u n i d i r e c t i o n a l o v e r l a p p i n g d e l e t i o n s o f t h e 2 . 4 k b BamHI i n s e r t o f p E C 2 . 2 ( t h e s c h e m e i s s h o w n i n F i g . 15) i s e s s e n t i a l l y t h e same a s d e s c r i b e d ( 7 6 ) e x c e p t f o r t h e f o l l o w i n g c h a n g e s . The BamHI i n s e r t was b l u n t e n d e d u s i n g t h e K l e n o w f r a g m e n t o f DNA p o l y m e r a s e I a n d w a s l i g a t e d i n b o t h o r i e n t a t i o n s w i t h E c o R I c l e a v e d M 1 3 m p l 8 ( s t i c k y - e n d s f i l l e d i n b y t h e K l e n o w f r a g m e n t o f DNA p o l y m e r a s e I ) . 5 « g o f t h e r e c o m b i n a n t RF DNA ( o f e a c h o r i e n t a t i o n ) w e r e u s e d a s t h e s t a r t i n g m a t e r i a l . The DNA was c l e a v e d c o m p l e t e l y w i t h BamHI t o g i v e a n E x o I I I s u s c e p t i b l e e n d a n d w i t h P s t I t o 7 4 produce an ExoIII r e s i s t a n t end. 12 samples were removed at i n t e r v a l s of 30 sec during ExoIII d i g e s t i o n . The ExoIII r e a c t i o n was stopped with NaCl-EDTA s o l u t i o n as d e s c r i b e d p r e v i o u s l y . The samples were then t r e a t e d s u c c e s s i v e l y with SI nuclease, the Klenow fragment of DNA polymerase I and DNA l i g a s e . 20 Ul of each l i g a t e d sample was used to t r a n s f e c t E. c o l i JM101 c e l l s by standard procedures (118). RF DNA was prepared from i n d i v i d u a l plaques (118) f o r r e s t r i c t i o n a n a l y s e s . Clones c o n t a i n i n g DNA i n s e r t s of a p p r o p r i a t e s i z e s were chosen f o r sequencing. 3.2.6.2. R e s t r i c t i o n d e l e t i o n s t r a t e g y S e q u e n t i a l d e l e t i o n s of the 0.8 kb fragment were generated by a novel method as o u t l i n e d in F i g . 20. 3.2.6.3. Sequencing r e a c t i o n s The procedure employed was a m o d i f i c a t i o n of the Bethesda Research L a b o r a t o r i e s method (M13 C l o n i n g 'Dideoxy* Sequencing Manual, BRL). R e a c t i o n mixtures, in 400 Ul polypropylene tubes, contained 5 Ul of s i n g l e - s t r a n d e d template (about 0.5 tfg; prepared as d e s c r i b e d in r e f . 118), 5 Ul of s t e r i l e drhO, 1 Ul of commercial sequencing primer (15 or 17 n u c l e o t i d e s l o n g ) , and 1 Ul of 10X Hin b u f f e r . The contents were mixed and the l i d of the tube was c l o s e d and wrapped around t i g h t l y with a small piece of aluminium f o i l . The tube was p l a c e d in a waterbath at 85°C-90°C, then allowed to cool to room temperature on the bench ( i t took about 50 min). While the mixture was c o o l i n g , a set of four tubes was prepared f o r the G, A, T and C sequencing r e a c t i o n s . Each tube c o n t a i n e d 2 Ul of the a p p r o p r i a t e combined 75 r e a c t i o n mixture (Table XI). A f t e r the a n n e a l i n g mixture had f 32 \ reached room temperature, 2 Ul of [«- PJ dATP (20 UC i ; 800Ci per mmol), 1 i l l of 0.1 H d i t h i o t h r e i t o l and 1 Ul of the Klenow fragment of DNA polymerase I (1 u n i t ) were added to i t and the contents of the tube mixed thoroughly. A 3 Ul sample of the f i n a l mixture was added to each of the four r e a c t i o n tubes, and t h e i r contents mixed thoroughly. A f t e r 15 min at room temperature, 1 Ul of a s o l u t i o n 0.2 mM in each deoxynucleoside t r i p h o s p h a t e , was added to each tube. A f t e r a f u r t h e r 15 min at room temperature, the r e a c t i o n s were stopped by the a d d i t i o n of 10 ul of formamide dye (99% (v/v) d e i o n i z e d formamide c o n t a i n i n g 0.05% (w/v) of xylene cyanol and bromophenol b l u e ) . 3.2.6.4. Sequencing g e l s The dideoxy-terminated fragments were f r a c t i o n a t e d on 6% denaturing polyacrylamide g e l s (12) with dimensions of 0.4mm X 19.7cm X 40cm at a constant voltage of 1800 (the running time depended on the number of sample l o a d i n g s ) . A f t e r e l e c t r o p h o r e s i s , the g e l s were d r i e d i n a s l a b gel d r i e r (Hoefer S c i e n t i f i c Instruments), and were then exposed to X-AR5 f i l m (Kodak) f o r 2 hr (with an i n t e n s i f y i n g screen) or overnight (without the i n t e n s i f y i n g s c r e e n ) . The arrangement and a n a l y s i s of the sequencing data were f a c i l i t a t e d with the SEQNCE program developed by A. Delaney (Delaney Software L t d . ) . 3.2.7. A n a l y s i s of c e l l s f o r the l o c a t i o n of enzyme a c t i v i t i e s Whole c e l l e x t r a c t s were prepared with a French pressure c e l l (201). P e r i p l a s m i c p r o t e i n s were i s o l a t e d by the osmotic-76 Table XI. Reaction mixes f o r M13-dideoxy t e r m i n a t i o n sequencing 10X Hin S t e r i l e 0.5mM(ll) lOmhKfll) Mix buffer<«l) drhCKtfl) dGTP dTTP dCTP ddGTP ddATP ddTTP ddCTP 20 57.5 1.5 20 20 2.5 20 77.5 20 20 20 - 2.5 20 54 20 1 20 20 58.5 20 20 1.5 7? s h o c k p r o c e d u r e ( 1 3 2 ) . C y t o p l a s m i c p r o t e i n s w e r e p r e p a r e d b y r u p t u r i n g t h e o s m o t i c a l l y - s h o c k e d c e l l s w i t h a F r e n c h p r e s s u r e c e l l . CMCase a c t i v i t y was a s s a y e d a s d e s c r i b e d i n S e c t i o n 2 . 2 . 1 2 . ft-lactamase a c t i v i t y was d e t e r m i n e d w i t h n i t r o c e f i n ( 1 3 4 ) . fi-galactosidase a c t i v i t y was m e a s u r e d w i t h o_-n i t r o p h e n y l - f i - D - g a l a c t o s i d e ( 1 2 1 ) . 3 . 2 . 8 . P u r i f i c a t i o n o f p E C 2 e n c o d e d e n d o g l u c a n a s e 3 . 2 . 8 . 1 . P r e p a r a t i o n o f o s m o t i c - s h o c k f l u i d P e r i p l a s m i c p r o t e i n s w e r e p r e p a r e d f r o m 20 l i t e r s o f E . c o l i p E C 2 b e a r i n g c e l l s b y o s m o t i c - s h o c k ( 1 3 2 ) . The c e l l s w e r e g r o w n i n a m p i c i 1 1 i n - s u p p l e m e n t e d L B t o a d e n s i t y o f a b o u t 5 X 10 c e l l s p e r m l . 10 ml o f t h e c u l t u r e w e r e r e m o v e d f o r d e t e r m i n a t i o n o f t o t a l C M C a s e a c t i v i t y . The r e s t o f t h e c e l l s w e r e c o l l e c t e d b y c e n t r i f u g a t i o n i n a J C F - Z r o t o r ( B e c k m a n ) . The c e l l s w e r e w a s h e d t w i c e w i t h 2 l i t e r s o f c o l d 0 . 0 1 M T r i s -H C l ( p H 7 . D - 0 . 0 3 M N a C l b u f f e r b y c e n t r i f u g a t i o n . The c e l l s w e r e r e s u s p e n d e d i n 1 . 2 l i t e r s o f 0 . 0 3 3 M T r i s - H C l ( p H 7 . 1 ) a t r o o m t e m p e r a t u r e . The s u s p e n s i o n w a s s t i r r e d w i t h a m a g n e t i c s t i r r e r d u r i n g t h e a d d i t i o n o f a n e q u a l v o l u m e o f 40% s u c r o s e -0 . 0 3 3 M T r i s - H C l ( p H 7 . 1 ) , f o l l o w e d b y 2 . 4 6 ml o f 0 . 1 M N a 2 E D T A ( p H 7 . 1 ) . The m i x t u r e was s w i r l e d a t r o o m t e m p e r a t u r e f o r 10 m i n o n a r o t a r y s h a k e r a t 180 r p m . A f t e r c e n t r i f u g a t i o n f o r 3 0 m i n a t 9 , 0 0 0 x g a n d 4 ° C , t h e s u p e r n a t a n t was d i s c a r d e d , a n d t h e p e l l e t d r a i n e d o n p a p e r t o w e l . The p e l l e t was d i s p e r s e d r a p i d l y i n 1 . 8 l i t e r s o f i c e - c o l d 0 . 5 mM M g C l . The s u s p e n s i o n was t h e n s t i r r e d f o r 10 m i n o n a r o t a r y s h a k e r a t 180 r p m a n d 4 ° C . T h e c e l l s w e r e r e m o v e d b y c e n t r i f u g a t i o n . To t h e s u p e r n a t a n t , 2 0 0 78 ml of 10X PBS <pH 7.2), 2 ml of phenylmethyl-sulfonyl fluoride CPMSF; at a concentration of 20 mg per ml of 95% ethanol) and 4 ml of NaN3 (5%) were added. The osmotic-shock fluid was filtered twice by suction filtration through glass microfibre filters (Whatman) and was then stored at 4°C until used. 3.2.8.2. Immunoadsorbent chromatography The activation of Sepharose 4B (Pharmacia) with CNBr and the coupling of the activated agarose with antibodies were done by G. O'Neill of our laboratory according to a modified procedure (136) of the method of Cuatrecasas et a l . (36-38). The ratio (w/w) between the decanted Sepharose (extensively washed with water) and CNBr used was 2:1, whereas the ratio (w/w) between the activated agarose and the antiserum proteins used was 30:1. After blocking excess active groups in the antibody-agarose gel by alternate washings with 0.2 M glycine-HC1 (pH 2.8) and 1 M ethanolamine, the coupled agarose was washed extensively with HS-PBS, and it was then packed into a fractionating column. The final volume of the anti-ce11u1ase adsorbent was 74 ml, and that of the anti-E. col i , -pBR322 adsorbent was 12 ml. The packed columns were stored at 4 C under PBS. Before loading the columns, they were washed twice with two column volumes of 0.1 M glycine-HCl (pH 2.5) and then with ten volumes of HS-PBS. The anti-ce11ulase column was loaded with the osmotic-shock fluid and the effluent was collected in 10 ml fractions at intervals of 10 min. After loading, the 79 column was washed with five volumes of HS-PBS. Bound proteins were eluted with 3 M NaSCN (100) in PBS. All the above manipulations were done at 4°C. The partially purified endoglucanase from the anti-ce11ulase column was passed through the anti-E. col i , -pBR322 immunoadsorbent column. The effluent was collected as a single fraction. After al l the enzyme solution had been loaded on the column, the adsorbent was washed with five volumes of HS-PBS. The washings were added to the loading effluent. The samples collected from the above two columns were stored at 4 °C until they were analysed for CMCase activity (Section 2.2.12.) and purity by SDS-PAGE (Section 2.2.8.) as described previously. 8 0 3.3. R e s u l t s 3.3.1. The sequence of the endoglucanase gene The endoglucanase gene spanned the j u n c t i o n between the 0.8 and 5.2 kb BamHI fragments of C. f i m i DNA in pcEC2, with the C-terminal coding r e g i o n l y i n g w i t h i n the f i r s t 1.4 kb of the 5.2 kb fragment. The 2.4 kb BamHI fragment from pEC2.2 ( F i g . 7B) was used as the s t a r t i n g m a t e r i a l f o r the sequencing of t h i s 1.4 kb fragment. The 2.4 kb fragment was subclbned i n t o the EcoRI s i t e of Ml3mpl8 ( F i g . 14; r e f . 211) to give mpl8EC2.2wt ( i n which the endoglucanase gene was t r a n s c r i b e d i n the same d i r e c t i o n as the lacZ gene of the phage), and mpl8EC2.2i ( i n which the endoglucanase gene was t r a n s c r i b e d i n the opposite d i r e c t i o n to the lacZ gene). A s e r i e s of u n i d i r e c t i o n a l , o v e r l a p p i n g d e l e t i o n s was generated with ExoIII In the RF DNA of each phage ( F i g . 15). The s i z e s of the r e s u l t i n g d e l e t i o n mutants c o u l d be estimated roughly by agarose gel e l e c t r o p h o r e s i s ( F i g . 16). The s i z e s were obtained more p r e c i s e l y by r e s t r i c t i o n a n a l y s i s ( F i g . 17). A l l mutants were l i n e a r i z e d by H indl11 ( F i g . 17A), showing that ExoIII was not d i g e s t i n g DNAs from the PstI ends ( F i g . 14). F u r t h e r , with C l a l d i g e s t i o n ( F i g . 17B), a l l RF DNAs gave a 2.9 kb fragment ( F i g . 14), and a l a r g e r fragment which decreased in s i z e i n p r o p o r t i o n to the time of d i g e s t i o n with ExoIII. From the C l a l a n a l y s i s ( F i g . 17B), mutants with d e l e t i o n s ending w i t h i n or j u s t beyond 1.4 kb from the BamHI s i t e were s e l e c t e d f o r sequencing ( F i g . 18). There were two regions of the 1.4 kb fragment f o r which o v e r l a p p i n g d e l e t i o n s were not obtained 81 EcoRI BamHI Pstl Hindlll ^ Clal 2526 F i g . 14. The M13mpl8 sequencing v e c t o r ( r e f . 211). The m u l t i p l e - c l o n i n g s i t e s (m.c.s.) and the sequencing primer-h y b r i d i z a t i o n s i t e (hatched bar) are Indi c a t e d . The H i n d l l l s i t e in the m.c.s. and the two C l a l s i t e s (2526 and 6881) were used to c h a r a c t e r i z e the ExoIII d e l e t i o n mutants of mpl8EC2.2wt and mpl8EC2.21 ( F i g . 17). 8 2 F i g . 15. The gen e r a t i o n of d e l e t i o n s in the RF DNA of mpl8EC2.2 with ExoIII. The hatched bar re p r e s e n t s C. fim i DNA; the open bar re p r e s e n t s M13mpl8. D e t a i l s of the procedure are gi v e n in M a t e r i a l s and Methods. B/Es denote the hybr i d s i t e s which were formed by blunt-end l i g a t i o n between the BamHI d i g e s t e d C. f1mi DNA and the EcoRI c l e a v e d M13mpl8 vector (the s t i c k y - e n d s of both DNA fragments were f i l l e d in by the Klenow fragment of DNA polymerase I ) . R e s t r i c t i o n enzymes are: B, BamHI and P, P s t l . 83 s a m p l e s r e m o v e d a t i n t e r v a l s 1,2,——>n; SI nuclease t r a n s f e c t i o n ; p l a t i n g ; p l a q u e s e l a c t i o n sequencing 8 4 1 2 3 4 5 6 7 8 9 10 11 12 13 1 4 1 5 16 17 18 F i g . 16. Agarose g e l e l e c t r o p h o r e s i s of d e l e t i o n mutant phage DNAs. The phage DNAs were prepared as d e s c r i b e d p r e v i o u s l y (118). The DNAs were e l e c t r o p h o r e s e d on a 0.7% agarose g e l f o r 4 hr at a cons tant v o l t a g e of 50. Lanes 1 to 9 are mutants of mpl8EC2.2wt; lanes 12 to 18 are mutants of m p l 8 E C 2 . 2 i ; lane 10 Is m p l 8 E C 2 . 2 l ; lane 11 is M13mpl8. 85 A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 F i g . 1 7 . R e s t r i c t i o n a n a l y s i s o f DNA f r o m d e l e t i o n m u t a n t s o f m p l 8 E C 2 . 2 . RF DNAs w e r e d i g e s t e d w i t h H _ i n d I I I ( A ) o r C l a l ( B ) . D i g e s t s w e r e e l e c t r o p h o r e s e d o n a 0 . 7 % a g a r o s e g e l f o r 4 h r a t a c o n s t a n t v o l t a g e o f 6 0 . L a n e 1 , X DNA H i n d i 11 f r a g m e n t s . L a n e 2 , m p l 8 E C 2 . 2 i . L a n e 3 , M 1 3 m p l 8 . L a n e s 4 t o 1 3 , d e l e t i o n m u t a n t s o f m p l 8 E C 2 . 2 w t . L a n e s 14 t o 2 0 , d e l e t i o n m u t a n t s o f m p l 8 E C 2 . 2 i . The a r r o w i n B i n d i c a t e s t h e common 2 . 9 k b f r a g m e n t f r o m a l l RF DNAs ( s e e F i g . 1 4 ) . 86 B 1.4kb F i g . 18. Sequencing s t r a t e g y f o r the endoglucanase encoding r e g i o n of pEC2.2. The d i r e c t i o n of e x p r e s s i o n of the gene Is i n d i c a t e d by the open arrow (cj>). Each d i v i s i o n r e p r e s e n t s 100 bp. The arrows r e p r e s e n t the o v e r l a p p i n g sequences determined f o r the complementary s t r a n d s . The unboxed sequences were obtained from the d e l e t i o n mutants; the t a i l s of the arrows d e f i n e the end p o i n t s of d e l e t i o n s . The boxed sequences were obtained from subcloned fragments (see F i g . 19). R e s t r i c t i o n enzymes a r e : B, BamHI and S, Smal. 8? ( F i g - 18); they were sequenced by s u b c l o n i n g a p p r o p r i a t e r e s t r i c t i o n fragments in to M13mpl8 ( F i g . 19). A novel procedure was used to generate and s c r e e n d e l e t i o n s f o r use in sequencing the 0.8 kb BamHI fragment from pcEC2 ( F i g . 20) . The C t e s t for s c r e e n i n g p o t e n t i a l d e l e t i o n s is r e l i a b l e , and i t g i v e s unambiguous r e s u l t s ( F i g . 21 and r e f s . 3, 118). The procedure r e s u l t e d in a set of s i x o v e r l a p p i n g sequences , three f o r each complementary s t r a n d , which covered the e n t i r e 0.8 kb fragment . The on ly s e r i o u s d i f f i c u l t y in sequenc ing the endoglucanase gene came with a compressed r e g i o n of approx imate ly 12 n u c l e o t i d e s in the l e a d e r sequence of the non-cod ing s t r a n d of the 0.8 kb fragment ( F i g . 22) , which probab ly r e s u l t e d from the very h i g h G+C content in tha t r e g i o n ( F i g . 23) . . The use of d e o x y i n o s i n e t r i p h o s p h a t e i n s t e a d of deoxguanosine t r i p h o s p h a t e in the sequencing r e a c t i o n s , and e l e c t r o p h o r e s i s at h i g h temperature f a i l e d to r e s o l v e the compress ion . The problem was s o l v e d by s u b c l o n i n g s u i t a b l e fragments of the 0.8 kb fragment so that the c h a i n t e r m i n a t i o n sequencing r e a c t i o n s c o u l d be i n i t i a t e d at s i t e s very c l o s e to the compress ion ( F i g . 24) . The sequence c o r r e s p o n d i n g to the endoglucanase gene was l o c a t e d and i t s r e a d i n g frame was e s t a b l i s h e d by matching the amino a c i d sequences p r e d i c t e d by the n u c l e o t i d e sequence w i t h the sequence of the f i r s t 31 amino a c i d s at the N- terminus of the endoglucanase p u r i f i e d from _C. f i m i ( F i g . 23; M. L . L a n g s f o r d , u n p u b l i s h e d r e s u l t s ) . The n u c l e o t i d e sequence 88 _ J I I 1 | F i g . 19 Subcloning of the endoglucanase encoding r e g i o n of pEC2.2. Open t r i a n g l e s i n d i c a t e the r e s t r i c t i o n s i t e s of the fragments 1 to 5 to be subcloned i n M13mpl8. These fragments correspond to the unboxed sequences shown c o n s e c u t i v e l y In F i g . 18. Each d i v i s i o n r e p r e s e n t s 100 bp. R e s t r i c t i o n enzymes a r e : B, BamHI; S, Smal; Sa, S a i l ; and X, Xhipl. 8 9 F i g . 20. P r o t o c o l f o r g e n e r a t i n g d e l e t i o n mutants of the 0.8 kb BamHI fragment of pcEC2. (A) The 0.8 kb BamHI fragment (open bar; arrows i n d i c a t e d i r e c t i o n of t r a n s c r i p t i o n ) was subcloned into the EcoRI s i t e of M13mpl8 (m.c.s. r e p r e s e n t s the m u l t i p l e -c l o n i n g s i t e s ) . Phage c a r r y i n g i n s e r t s were screened by r e s t r i c t i o n a n a l y s i s of RF DNAs. pWT and pF c a r r i e d the 0.8 kb fragment in opposite o r i e n t a t i o n s . (B) The RF DNA from each phage type was c l e a v e d with S a i l , d i l u t e d , and r e l l g a t e d . (C) The d e l e t i o n mutants were i d e n t i f i e d by a r a p i d phage h y b r i d i z a t i o n t e s t (C t e s t ; F i g . 21). Each unknown phage of the c l a s s pASaWT was annealed with an unknown phage of the c l a s s pASaF. Those which d i d not anneal were then annealed with pF and pWT, r e s p e c t i v e l y . Those which annealed were sequenced. The same procedure was used to generate Smal (S) d e l e t i o n s f o r sequencing. R e s t r i c t i o n enzymes ar e : B, BamHI; H, H i n d l 1 1 ; S, Smal; and Sa, S a i l . 90 Sequence pASaWT & pASaF 9 1 F i g . 21. I d e n t i f i c a t i o n of d e l e t i o n mutants by the C t e s t . Phage DNA samples a f t e r h y b r i d i z a t i o n were e l e c t r o p h o r e s e d on a 0.7% agarose gel f o r 3 hr at a constant voltage of 50. Lanes 1 and 2: h y b r i d i z a t i o n of pASaWT with pF ( F i g . 20). Lane 3: h y b r i d i z a t i o n of pASaWT with pASaF. Lane 4: h y b r i d i z a t i o n of pASaWT alone. 9 2 F i g . 2 2 . R e s o l u t i o n o f t h e c o m p r e s s e d n u c l e o t i d e s i n t h e l e a d e r s e q u e n c e .of t h e n o n - c o d i n g s t r a n d . ( A ) P r i m e d s y n t h e s i s was s t a r t e d f r o m t h e S m a l s i t e a t p o s i t i o n - 2 0 6 ( p A S F , F i g . 2 4 ) o f t h e n u c l e o t i d e s e q u e n c e . A s e v e r e c o m p r e s s i o n was l o c a t e d a t p o s i t i o n 29 i n t h e l e a d e r s e q u e n c e a s s h o w n . The n u m b e r s 1 , 7 a n d 6 4 i n d i c a t e t h e p o s i t i o n s o f t h e A r e s i d u e s i n t h e s e q u e n c e ( F i g . 2 3 ) . ( B ) P r i m e d s y n t h e s i s was s t a r t e d f r o m t h e A v a 1 1 s i t e a t p o s i t i o n - 4 7 ( p A I I F , F i g . 2 4 ) o f t h e s e q u e n c e . The n u c l e o t i d e a t p o s i t i o n 29 was r e s o l v e d a s a T r e s i d u e , a s s h o w n . (C) P r i m e d s y n t h e s i s s t a r t e d a t t h e H a e I I s i t e ( p o s i t i o n 2 4 ; p H a F , F i g . 2 4 ) w i t h i n t h e c o m p r e s s e d r e g i o n . HS r e p r e s e n t s t h e h y b r i d s i t e w h i c h was f o r m e d b y l i g a t i o n o f t h e b l u n t -e n d e d H a e 1 1 s i t e w i t h t h e S m a l s i t e o f t h e M13 v e c t o r . 9 3 9 4 F i g . 23. The n u c l e o t i d e sequence of the endoglucanase gene and the deduced amino a c i d sequence of the endoglucanase. The coding r e g i o n s t a r t s at +1 and ends at +1347. A ShIne-Dalgarno (S.D.) type sequence before the s t a r t s i t e i s u n d e r l i n e d . The s o l i d t r i a n g l e (•) i n d i c a t e s the le a d e r sequence p r o c e s s i n g s i t e . The un d e r l i n e d amino r e s i d u e s were determined by automated Edman degradation of the p u r i f i e d n a t i v e endoglucanase ( M . L. Langsford, unpublished d a t a ) . The BamHI s i t e between the 0.8 kb and 5.2 kb fragments of £. f1m1 DNA i n pcEC2 i s boxed. A sequence of 23 amino a c i d s composed e n t i r e l y of p r o l i n e and threonine is o v e r l l n e d . A 16 ba s e - p a i r p a l i n d r o m i c sequence f o l l o w i n g the stop codon i s i n d i c a t e d by the i n v e r t e d arrows. 95 5 G G * r c c G C * c r ; c T G C G C G r c G r c c c c c A C * c c c * C G c c c r G C * c * C f i 4 C C -51* -446 TTCCCCCACGTCGCGGACCTCGCGCGGCAGrGCCGGT r C G G C G*CTMCGGC*CG*GCGGGAGCCGGGGrGCGCGGrf^GnCCGGCCGrCG4GrCGGGCG4CCrGCCGGCCCGCCGGC r - 4 5 / -4 3 -r - 4 t / - 39 ' 'iff GGACTCCTGGCGGCGCC TGGAGCGCGAGOCCGCC T A C C A G G C A C G K G C A G C C A C G C ^ G G C T C C ^ -3Jfl - 3 i d -it* - 2 / a -2Sd OCOCGOCCCGCCGCGTCCGCGG*GCrG*CGGGCCCGGr , A G C C C C C C * G C C G G G C G G T G C G G*G T C C G C rXSGCGCCAGCGGGTGTCfUAGCGACGGGrCCAACCGCGCCAACGTCGCCC -219 - 149 - 1/9 - 159 *' J'i C A T C C C C A A C T G A A G C G A T T A G G A A A TCC TCATCCCC TCGCGCCGTCGGGCA T T C G T C G G C X T T C C TCGTCCCGACCCGCACGAGCGTCCCACGAGGCCCGAACCCAGCGAGC T C C I T G -IQQ -80 -60 -40 -2Q " Hat Sor Thr Arg Arg Thr Ata A l * A l a Lau Lau A l a A l a A l a A l a Val A l a Vol G l y G l y Lau Thr Al« Lau Thr Thr Trip A l a A l a G i n A T Q T C C ACC C G C AGA ACC CCC GCA GCG CTQ CTG GCG GCC CCC GCC GTC GCC GTC GGC GGT CTG ACC GCC CTC *CC ACC A C C GCC GCG CAG ^ IS 30 4 3 SO 7 5 90 A t a A l a P r o G l y Cy» Arg Val_ Aap Tyr A l a Val Thr Aan Gin Tro Pro G l y Gly Pha G l y A l a Asn Val Thr I l a Thr A an Lau G l y Aap GCG OCT CCC GCC TGC CGC GTC GAC r*C CCC GTC ACC AAC CAG TGG CCC GGC GCC TTC GGC GCC AAC GTC ACC A T C ACC A A C CTC GGC GAC 105 120 133 tSO 165 '80 Pro Val S«r Sar Trp.Lys Lau Asp Trp Thr Tyr Thr A l a G l y G i n Arg H a G i n G i n Lau Trp Asn G l y Thr A l a Sar Thr Aan G l y G l / CCC C T C T C G T C C TCC AAG CTC GAC TGG ACC TAC ACC GCA CGC CAG O J G G ' A T C C ] A G CAG CTG TCG AAC GGC ACC GCG TCG ACC AAC GCC GGC (93 21Q 223 BjmHI 2 4 0 2 5 5 2 7 0 O l n Val Sar Val Thr Sar Lau Pro Trp Aan G l y 5»r 11a Pro Thr Gty G l y Thr A t a Sar Pha G l y Pha Aan G l y Sar Trp A l a G l y Sar CAG CTC TCC CTC ACC ACC CTG CCC TGG AAC GGC AGC ATC CCC ACC GGC GGC ACG GCC TCG TTC G G G TTC AAC GCC TCG TGG CCC CGC TCC 283 300 3 1 3 330 343 350 Asn P r o Thr P r o A l a Sar Pha Sar Lau Asn G l y Thr Thr Cya Thr G l y Thr Val P r o Thr Thr Sar Pro Thr Pro Thr Pro Thr P r o Thr AAC CCD ACQ CCQ GCG TCC TTC TCG CTC AAC CGC ACC ACC TCC ACG GGC ACC GTC CCC ACG ACC AGC CCC ACG CCC ACC CCC ACG CCG ACG 373 390 403 420 433 430 Thr P r o Thr Pro Thr Pro Thr Pro Thr P r o Thr Pro Thr P r o Thr Val Thr Pro G i n P r o Thr Sar G l y Pha Tyr Val Aap Pro Thr Thr ACC CCC ACQ CCG ACC CCG ACC CCC ACC CCC ACC CCC ACG CCG ACG GTC ACG CCC CAC CCC ACC AGC GGC TTC TAC GTC GAC CCG ACC ACG 463 480 4 9 3 3 1 0 323 340 G i n G l y Tyr Arg A l a Trp G i n A l a A l a Ser G l y Thr Aap Lys A l a Lau Lau G l u l y s H o A l a Lau Thr Pro G i n A l a Tyr Trp Val G l / CAO CCC TAC CGC GCG TCC CAC CCC GCG TCC CGC ACC GAC AAG CCG CTG CTC GAC AAC ATC CCG CTC ACC CCG CAG GCG TAC TGG GTC CGC 333 370 365 600 6 13 630 Asn Trp A l a Asp A l a Sar H i s A l a G i n A l a G l u Val A l a Asp Tyr Thr G l y Arg A l a V a l A l a A l a G l y Lys Thr Pro Mat Lau V a l V a l AAC TGC GCC CAC GCG TCG CAC GCG CAG GCC CAG CTC GCC CAC TAC ACC CGC CGC CCC CTC GCC GCC CCG AAG ACG CCG ATC CTC GTC GTC 643 660 C73 690 7C3 730 Ty r A l a l i s P r o G l y Arg Asp Cya G l y Sar H i s Sar G l y Gly C l y Val Sar G l u Sar G l u Tyr A l a Arg Trp Vat Asp Thr v a l A l a G i n TAC CCG ATC CCG CGC CCC CAC TCC CCC TCC CAC TCC GCC GGT GGT GTG TCC GAC TCC GAG TAC CCC CCC TGG CTC GAC ACC GTC GCG CAG 733 730 763 780 795 B 10 G l y l i s Lys C l y Asn Pro H a Val 11a Lau G l u Pro Asp A l a Lau A l a G i n Lau C l y Aap Cys Sar G l y G i n C l y Asp Arg Val G l y Pha CGC ATC AAC CGC AAC CCC ATC GTG ATC CTC GAG CCC CAC GCC CTC CCC CAC CTC CCC GAC TCC TCC CGC CAC GGT GAC CGC CTC GCC TTC 83S 840 853 870 885 SCO Lau Lys Tyr A l a A l a Lys Sar Lau Thr Lau Lys C l y A l a Arg Val Tyr I l a Asp A l a C l y H i s A l a Lys Trp Lau Sar Val Asp Thr P r o CTC AAG TAC GCC CCC AAC TCC CTC ACC CTC AAC GGC CCC CGC CTC TAC ATC CAC CCG GGC CAC CCC AAC TGG CTG TCC CTC GAC ACC CCC 9 f 3 930 9*3 960 »?3 990 V s l Asn Arg Lau Asn Gin Val G l y Pha G l u Tyr A l a Val G l y Pha A l a Lau Asn Thr Sar Asn Tyr G i n Thr Thr A l a Asp Sar Lys A l a GTG AAC CGC CTC AAC CAO CTC GCC TTC C*0 TAC GCC OTC GCC TTC GCC CTC AAC ACC TCG AAC TAC CAO ACC ACG GCG CAC ACC AAC CCC I COS » 020 1 033 1 030 I 065 I 080 Tyr G l y G i n O l n I l a Sar Qln Arg Lau C l y C l y Lys Lys Pha Val I l a Asp Thr Sar A r g Asn C l y Asn C l y Sar Asn G l y C l u Trp C y l TAC GGC CAO CAG ATC TCO CAC CCC CTG GGC GCC AAC AAC TTC CTC ATC GAC ACC TCG CGC AAC GCC AAC GGC TCG AAC CCC GAC TGC TGC I OSS 1 MO 1 *29 1 l«0 I 139 t WO Asn P r o A r g G l y Arg A l a Lau G l y C l u A r g Pro V a l A l a Val Asn A t o C l y Sar C l y Lau A i p Ata Lau Lau Trp Val l y s Lau P r o C l y AAC CCG CGC GGC CGC CCO CTC CGC CAA CGC CCO OTC CCQ OTQ AAC CAC GGC TCC CCC CTG CAC GCC CTC CTG TCO GTC AAQ CTQ CCC CCC I 185 1 200 I 219 I 230 I 243 I 360 G l u Sar Aap G l y Ata Cys Asn G l y G l y P r o A l a A l a C l y O n Trp Trp G i n G l u I l a A l a Lau C l u »st A l a A r g Asn A l a Arg Trp GAG TCC CAC GCC CCG TCC AAC CGC GGC CCO CCC CCC GCC CAC TGG TCG C»G GAG ATC GCC CTG CAC ATC CCG CCC AAC CCC ACC TGC TGA I 375 1 290 I 309 f 320 1 339 » 390 aCTCACACCTC<%CCACCACGAGCCCC<GCACGGCGCACGTGCGTCCC£GGGC1CCrCCGTCCGGCCGC^ 1363 1380 1393 MIO 1433 M40 1455 ACGACCWCCCACCCCACCACCCACCCCCCGCGCTCGACCTCTCGCCCCCCCACCCCGCACGCGTCCCCACCCCGGCCCCGCCCACCGCCCTCCCGTTC *49« 1499 1 3 U 1329 1344 1539 1S'« ACGTGGCCCCCCGCAACGCGCTCGAGGrGCCCGrCCCGCCGGACGGCGGCCGrCCAGGCCCrCCACGGCCCGCCGCACACCCCCC *' 1398 1608 1618 1626 1638 1648 1638 1668 J 96 F i g . 24. Subcloning s t r a t e g y f o r r e s o l v i n g n u c l e o t i d e compressions. pF recombinant phage DNA ( F i g . 20) was used as the s t a r t i n g m a t e r i a l . The open bar r e p r e s e n t s the 0.8 kb fragment; the arrow i n d i c a t e s the d i r e c t i o n of t r a n s c r i p t i o n ; the numbers i n d i c a t e the p o s i t i o n s of the r e s t r i c t i o n s i t e s ( F i g . 23); the s i n g l e l i n e r e p r e s e n t s M13mpl8 DNA; the hatched bar r e p r e s e n t s the primer sequence. The sequence of events f o r g e n e r a t i n g the two products, pAIIF and pHF, f o r r e s o l v i n g the compressions ( F i g . 22) i s o u t l i n e d . In step C, the H a e l l fragment was obtained a f t e r f i r s t p u r i f y i n g the EcoRI-HIndl11 fragment because there were 6 other HaeII s i t e s i n the v e c t o r . R e s t r i c t i o n enzymes are A l l , A v a i l ; E, EcoRI; H, H i n d l l l ; Ha, HaeII; and S, Smal. 97 206 148 24 -47 -206 A l l Ha Ha A l l S _L_l I I I Ireli pF r gation All Ha Ha All S _L_J I I I p A S F IAII (GG^CC); gel purification; K l e n O W ; ligation with S cleaved M13mpl8 E Ha Ha H pAIIF s e q u e n c i n g E a n d H ; gel purification E Ha Ha H 1 Ha (PuGCGCPy); T 4 DNA Polymerase; ligation with S cleaved M13mpl8 ' 4 ' rrn\ pHaF s e q u e n c i n g 9 8 determining these 31 amino a c i d s f a l l s e n t i r e l y w i t h i n the 0.8 kb BamHI fragment of pcEC2. A p u t a t i v e t r a n s l a t i o n a l s t a r t codon (ATG) occurs 93 n u c l e o t i d e s upstream from the t r i p l e t d e f i n i n g the N-terminal a l a n i n e of the mature endoglucanase. The f i r s t t r a n s l a t i o n a l stop codon in-frame with t h i s ATG i s a TGA 1347 n u c l e o t i d e s downstream from i t . T h i s TGA codon was demonstrated to be the r e a l t r a n s l a t i o n a l stop codon of the gene (Z. M. Guo, unpublished r e s u l t s ) in an Exo III d e l e t i o n a n a l y s i s wherein the a c t i v i t y of the expressed gene product was analysed in a set of d e l e t i o n s approaching the gene from the 3' end. A d e l e t i o n mutant ending 1579 bases from the +1 base of the i n i t i a t i n g ATG codon s t i l l encoded CMCase a c t i v i t y , whereas a d e l e t i o n ending 1311 bases away d i d not. These d e l e t i o n s bracketed the TGA codon s t a r t i n g at n u c l e o t i d e 1348 ( F i g . 23). T h i s means that the primary t r a n s l a t i o n product of the endoglucanase gene i s 449 amino a c i d s long, and that the f i r s t 31 amino a c i d s at the N-termlnus are removed to generate the mature endoglucanase of 418 amino a c i d s . The p r e d i c t e d amino a c i d composition of the mature enzyme (Table XII) agrees c l o s e l y with that determined f o r the enzyme p u r i f i e d from C. f i m1 (M. L. Langsford, unpublished o b s e r v a t i o n s ) . The p r e d i c t e d sequence g i v e s a p r o t e i n with a Mr of 51,837 (Table X I I ) . The enzyme as p u r i f i e d from C. f1m1 has an apparent Mr of 58,000; however, t h i s form of the enzyme is g l y c o s y l a t e d (101). The G+C content of the endoglucanase coding r e g i o n i s 72.5% (Table XIII) which i s very s i m i l a r to that of the C. f imi exoglucanase gene (71%; r e f . 137). Remarkably, 98% of the 99 Table XII. The p r e d i c t e d amino a c i d composition of the mature endoglucanase Amino a c i d Number Mr Alan Ine 45 4009.5 Arg i n ine 16 2787.2 Asparaglne 22 2906.2 Aspartate 19 2528.9 Cysteine 6 726.6 Glutamine 20 2924.0 Glutamate 11 1618.1 G l y c i n e 53 3980.3 H i s t id i n e 3 465.6 I s o l e u c l n e 12 1574.4 Leucine 25 3280.0 Lysine 13 2375.1 Methionine 2 298.4 Phenylalanine 9 1486.8 P r o l i n e 32 3683.2 Serine 29 3047.9 Threonine 44 5240.4 Tryptophan 16 3267.2 TyrosIne 13 2355.6 V a l i n e 28 3281 .6 T o t a l 418 51837.0 1 0 0 Table X I I I . The base compos i t i on of the endoglucanase gene P o s i t i o n 1 P o s i t i o n 2 P o s i t i o n 3 T o t a l No. % No. % No. % No. % A 107 23.8 102 22.7 4 0 .9 213 15. 8 G 172 38.5 100 22.3 178 39.6 450 33. 4 C 101 22.5 164 36.5 262 58. 4 527 39. 1 T 69 15.4 83 18.5 5 1 . 1 157 1 1 . 7 101 c o d o n s u s e d I n t h e t h i r d b a s e h a v e a G o r C r e s i d u e ( T a b l e X I I I ) . M o r e o v e r , o n l y 35 o f t h e 61 c o d o n s a r e u s e d i n t h e g e n e ( T a b l e X I V ) ; 25 o f t h e u n u s e d c o d o n s e n d w i t h e i t h e r a n A o r a U ( T a b l e X I V ) . 3 . 3 . 2 . T r a n s c r i p t i o n a l a n d t r a n s l a t i o n a l s i g n a l s f o r t h e e n d o g l u c a n a s e g e n e The TGA s t o p c o d o n i s f o l l o w e d c l o s e l y b y a p e r f e c t 16 b p p a l i n d r o m e ( F i g . 2 3 ) w h i c h c o u l d be a t r a n s c r i p t i o n a l s t o p s i g n a l ( 1 5 1 ) . The s e q u e n c e p r e c e d i n g t h e ATG s t a r t c o d o n c o n t a i n s a p o t e n t i a l r i b o s o m e - b i n d i n g s i t e ( r e f . 1 6 5 ; F i g . 2 3 ) , b u t i t d o e s n o t c o n t a i n a s e q u e n c e r e s e m b l i n g o t h e r p r o k a r y o t i c p r o m o t e r s e q u e n c e s ( 7 5 , 1 2 6 , 1 5 1 ) . H o w e v e r , S I m a p p i n g o f C . f i m i t r a n s c r i p t s i n d i c a t e d a p o t e n t i a l t r a n s c r i p t i o n a l s t a r t s i t e 46 n u c l e o t i d e s u p s t r e a m f r o m t h e s t a r t c o d o n o f t h e e n d o g l u c a n a s e g e n e ( N . G r e e n b e r g , u n p u b l i s h e d d a t a ) . T h e e x p r e s s i o n o f t h e g e n e i n E . c o l i d e p e n d s o n t h e T c R p r o m o t e r . When t h e H i n d l 1 1 - B a m H I f r a g m e n t c o n t a i n i n g t h e T c R p r o m o t e r (177) was r e m o v e d f r o m p c E C 2 . 1 , t h e l e v e l o f e x p r e s s i o n o f t h e e n d o g l u c a n a s e g e n e was r e d u c e d b y 9 4 p e r c e n t ( T a b l e X ; p c E C 2 . l A H B ) . T h i s s u g g e s t s t h a t t h e p r e s u m e d p r o m o t e r f r o m _C-f i m i was n o t f u n c t i o n a l i n E . c o l i . 3 . 3 . 3 . The l e a d e r s e q u e n c e o f t h e e n d o g l u c a n a s e g e n e The n u c l e o t i d e s e q u e n c e o f t h e e n d o g l u c a n a s e g e n e ( F i g . 2 3 ) p r e d i c t s a n i n i t i a l s e q u e n c e o f 31 a m i n o a c i d s h a v i n g many o f t h e f e a t u r e s o f p r o t e i n s i g n a l s e q u e n c e s : p o s i t i v e l y c h a r g e d A r g r e s i d u e s a t t h e N - t e r m i n u s , a l e n g t h y h y d r o p h o b i c s e q u e n c e i n t h e m i d d l e , a n d a n A l a r e s i d u e a t t h e f i n a l p o s i t i o n o f t h e 102 Table XIV. Codon usage f o r the endoglucanase gene Aa Codon No. Aa Codon No Phe UUU 0 Ser UCU 0 Phe UUC 9 Ser UCC 10 Leu UUA 0 Ser UCA 0 Leu UUG 0 Ser UCG 15 Leu CUU 0 Pro ecu 0 Leu cue 17 Pro CCC 10 Leu CUA 0 Pro CCA 0 Leu CUG 12 Pro CCG 22 H e AUU 0 Thr ACU 0 l i e AUC 12 Thr ACC 29 H e AUA 0 Thr ACA 0 Met AUG 3 Thr ACG 21 Val GUU 0 A l a GCU 1 Val GUC 24 A l a GCC 21 Val GUA 0 A l a GCA 2 Val GUG 6 A l a GCG 33 Aa Codon No. Aa Codon No. Tyr UAU 0 Cys UGU 0 Tyr UAC 13 Cys UGC 6 Och UAA 0 Opl UGA 0 Amb UAG 0 Trp UGG 16 His CAU 0 Arg CGU 0 His CAC 3 Arg CGC 14 Gin CAA 0 Arg CGA 0 Gin CAG 21 Arg CGG 2 Asn AAU 0 Ser AGU 0 Asn AAC 22 Ser AGC 5 Lys AAA 0 Arg AGA 1 Lys AAG 13 Arg AGG 1 Asp GAU 0 Gly GGU 4 Asp GAC 19 Gly GGC 48 Glu GAA 1 Gly GGA 0 Glu GAG 10 Gly GGG 3 1 0 3 signal sequence (86, 99, 195, 202). This sequence appears to function in the export of the endoglucanase to the periplasm in E. co1i. More than 50 percent of the CMCase activity determined by pcEC2 is found in the periplasm (Table XV). This contrasts with the cellular location of the polypeptide determined by pEC2. The endoglucanase leader sequence is missing in this plasmid, and only 15 percent of the CMCase activity it determines is found in the periplasm (Table XV). This latter "endoglucanase" is a hybrid protein, with the N-terminus of the TcR determinant of pBR322 replacing the first 76 amino acids of the pre-endoglucanase. The TcR determinant is an integral membrane protein (129, 178), which implies that its N-terminus has features which lead to the incorporation of the TcR protein into the membrane (99, 129, 202). Not surprisingly, the foreign fragment does not function as efficiently for secretion of the endoglucanase as does its own leader. 3.3.4. The Pro-Thr sequence of the endoglucanase gene The predicted amino acid sequence of the mature endoglucanase (Fig. 23) contains a very striking feature. Amino acid residues 143-165 are either threonine or proline. The sequence of these residues corresponds very closely with a sequence containing only proline and threonine which occurs in the predicted amino acid sequence of an exoglucanase from C. fimi ( 137; Fig. 25). The functions of these repeated proline-threonine sequences are yet to be determined. 3.3.5. Purification of the endoglucanase from _E. coli 104 Table XV. The l o c a t i o n of enzyme a c t i v i t i e s in E . c o l i C600 c a r r y i n g pEC2 and pcEC2 T o t a l Cytoplasm i c Per ip lasm i c A c t i v i t y P l a s m i d e x t r a c t f r a c t i on f r a c t ion CMCase pEC2 0.063 0.063 0.0095 (0 .22) (0 .17) (0 .53) pcEC2 0.0047 0.0022 0.0026 (0.015) (0 .006) (0 .15) ft-lactamase pEC2 815.93 47. 18 700 (2550) (125.2) (39002) pcEC2 911.7 53.45 745 (2348) (117.3) (35975) 6 - g a l a c t o s idase pEC2 0.92 1.11 0.0057 (2 .88) (2 .95) (0 .32) pcEC2 0.94 1.13 0.0066 (2 .42) (2 .48) (0 .32) The unbracketed numbers are the a c t i v i t i e s in U of enzyme/ml of c e l l c u l t u r e . The b r a c k e t e d numbers are the s p e c i f i c a c t i v i t i e s in U of enzyme/mg of p r o t e i n . U f o r CMCase a c t i v i t y is /(mol of g lucose e q u i v a l e n t s r e l e a s e d per min. U f o r fi-lactamase a c t i v i t y i s nmol of n i t r o c e f o i c a c i d produced per min . U f o r fi-g a l a c t o s idase a c t i v i t y is nmol of p_-n i t ropheno l produced per min. 1 0 5 E n d o g l u c a n a s e : 23 a m i n o r e s i d u e s 5' t h r t h r t h r t h r p r o p r o p r o p r o CCCACGCCGACCCCGACGCCGACG p r o p r o p r o t h r t h r t h r p r o p r o t h r t h r t h i \ C C C C CACGCCGACGCCGACCCCGACCCCCACCCCCACGCCGACG 3 ' p r o p r o p r o p r o p r o p r o t h r t h r t h r t h r t h r CCGACGCCGACGCCCACCACGCCGIUXCCGACGCCCACGACGCCGACGCCGACCCCGACG 3 t h r t h r t h r t h r p r o p r o p r o p r o p r o t h r t h r t h r t h r E x o g l u c a n a s e : 20 a m i n o r e s i d u e s F i g . 25. Sequence c o n s e r v a t i o n in the P r o - T h r sequences of the C . f i m i endoglucanase and exoglucanase and t h e i r genes . E l e v e n of the amino a c i d r e s i d u e s are c o n s e r v e d and boxed; f o r t y - o n e of the n u c l e o t i d e s are homologous and b r i d g e d by dashed l i n e s . Both sequences use o n l y CCC and CCG of the four p r o l i n e codons , and ACC and ACG of the four t h r e o n i n e codons . 1 0 6 A l t h o u g h t h e e n z y m e e n c o d e d b y p E C 2 b o u n d t o D E A E -S e p h a c e l , i t c o u l d n o t be r e l e a s e d a g a i n , n o t e v e n b y h i g h c o n c e n t r a t i o n s o f d i s s o c i a t i n g a g e n t s . T h e r e f o r e , a d i f f e r e n t a p p r o a c h was t a k e n . The a v a i l a b i l i t y o f p o t e n t a n t i -e n d o g l u c a n a s e a n t i s e r a ( F i g . 8 ) l e d t o t h e u s e o f i m m u n o a d s c r b e n t - a f f i n i t y c h r o m a t o g r a p h y t o p u r i f y t h e e n z y m e . S i n c e t h e s p e c i f i c a c t i v i t y o f t h e C M C a s e i n t h e p e r i p l a s m i c f r a c t i o n o f t h e c e l l s was 2 - 3 f o l d h i g h e r t h a n i n t h e t o t a l c e l l e x t r a c t o r t h e c y t o p l a s m i c f r a c t i o n , t h e p e r i p l a s m i c f r a c t i o n was u s e d a s a s o u r c e o f c r u d e e n z y m e ( T a b l e X V I ) . O s m o t i c - s h o c k f l u i d was p a s s e d t h r o u g h t h e c o l u m n u n t i l t h e i m m u n o a d s o r b e n t was s a t u r a t e d , a s d e t e r m i n e d b y t h e a p p e a r a n c e o f C M C a s e a c t i v i t y i n t h e e f f l u e n t . T h e n t h e c o l u m n was w a s h e d t h o r o u g h l y w i t h H S - P B S ( M a t e r i a l s a n d M e t h o d s ) t o r e m o v e n o n - s p e c i f i c a l 1 y a d s o r b e d p r o t e i n s ( F i g . 2 6 ) . I m m u n o -a d s o r b e d p r o t e i n s w e r e e l u t e d w i t h 3 M N a S C N ( F i g . 2 6 ) , a c o n c e n t r a t i o n w h i c h c a u s e s l i t t l e i n a c t i v a t i o n o f t h e C M C a s e a c t i v i t y ( T a b l e X V I I ) . The l o n g t a i l i n g o f t h e e l u t e d C M C a s e a c t i v i t y i n t h e l a t e r f r a c t i o n s o f t h e c h r o m a t o g r a p h ( F i g . 2 6 ) c o u l d r e s u l t f r o m t h e u s e o f . p o l y c l o n a l a n t i - c e 1 1 u l a s e a n t i b o d i e s . F u r t h e r , t h e c o n s t a n t A 2 8 0 m e a s u r e m e n t i n t h e s e l a t t e r f r a c t i o n s was p r o b a b l y d u e t o t h e p r e s e n c e o f 3 M N a S C N . The r e c o v e r y f r o m t h e c o l u m n was 62 p e r c e n t ( T a b l e X V I I I ) . T h e c o l u m n b e h a v e d q u i t e r e p r o d u c i b l y f r o m r u n t o r u n . The m o s t a c t i v e f r a c t i o n s w e r e p o o l e d a n d d i a l y s e d a g a i n s t P B S . A f t e r c o n c e n t r a t i o n t o 10 m l , t h e e n z y m e was p a s s e d t w i c e t h r o u g h a n i m m u n o a d s o r b e n t c o l u m n c o n t a i n i n g a n t i b o d i e s d i r e c t e d a g a i n s t 1 0 7 Table XVI. CMCase a c t i v i t y in E. c o l i C600 (pEC2) CMCase T o t a l P r o t e i n S p e c i f i c F r a c t i o n a c t i v i t y a c t i v i t y c o n c e n t r a t i o n a c t i v i t y (U/ml) (U) (mg/ml) (U/mg p r o t e i n ) T o t a l c e l l e x t r a c t 0.066 1320 0.32 0.21 Osmot i c -shock f l u i d 0. 13 260 0.30 0.43 The p r e p a r a t i o n of the t o t a l c e l l e x t r a c t and the osmotic-shock f l u i d Is d e c r l b e d In M a t e r i a l s and Methods. The osmotic-shock f l u i d was used f o r the immunoadsorbent chromatograph shown i n F i g . 26. U is tfmol of glucose e q u i v a l e n t s r e l e a s e d per min. 108 F i g . 26. Immunoadsorbent chromatography of the endoglucanase from E. c o l i C600 (pEC2). Osmotic-shock f l u i d was passed through the column u n t i l the immunoadsorbent was s a t u r a t e d . N o n - s p e c i f i c a l 1 y adsorbed p r o t e i n s were e l u t e d with HS-PBS. When the e f f l u e n t was p r o t e i n f r e e , s p e c i f i c a l l y adsorbed p r o t e i n s were e l u t e d with 3 M NaSCN. Flow r a t e , 60 ml/hr; f r a c t i o n s i z e , 10 ml. Fraction number Table XVII. E f f e c t of NaSCN on the CMCase a c t i v i t y of osmotic-shock f l u i d NaSCN CMCase a c t i v i t y A c t i v i t y remaining (M) (U/ml) <%) 0 0.13 100 0.5 0.13 100 1.0 0.13 100 1.5 0. 125 96.2 2.0 0. 123 94.6 2.5 0.119 91.5 3.0 0. 116 89.2 111 Table XVIII. Summary of immunoadsorption chromatography of CMCase a c t i v i t y from E. c o l i C600 (pEC2) T o t a l S p e c i f i c P u r i f i ' Step Vol P r o t e i n CMCase A c t i v i t y Recovery a c t i v i t y c a t i o n <JLD (ma/ml) (U/ml) (U) {JL1 Osmot i c -shock f l u i d 630 a 0.30 0.13 81.9 100 0.43 1 NaSCN el u a t e 70 0.05 0.72 50.4 62 14.4 33 Removal of E. c o l i and pBR322 10 0.034 4.13 41.3 50 121.5 283 p o l y -pept ides aVolume r e q u i r e d to s a t u r a t e immunoadsorbent. U i s Umol of glucose e q u i v a l e n t s r e l e a s e d per min. S p e c i f i c a c t i v i t y i s expressed as U of enzyme/mg of p r o t e i n . 112 E_. c o l i and pBR322 encoded p r o t e i n s . The s p e c i f i c a c t i v i t y of the f i n a l p r e p a r a t i o n was 283 t imes g r e a t e r than that of the s t a r t i n g m a t e r i a l . I t appeared v i r t u a l l y homogeneous by SDS-PAGE ( F i g . 27) . 113 A B 1 2 3 4 5 1 2 F i g . 27. P u r i t y of the endoglucanases prepared from E. c o l 1 C600 <pEC2). Gel (A) c o n t a i n s pEC2 encoded p r o t e i n s . The arrow marks the 53 KDa endoglucanase. Lane 1, molecular weight markers. Lane 2, t o t a l c e l l e x t r a c t . Lane 3, osmotic-shock f l u i d . Lane 4, pooled f r a c t i o n s from the immunoadsorbent column. Lane 5, ma t e r i a l in lane 4 a f t e r two passages through anti-£. c o l i column. Gel <B) lane 1, m a t e r i a l shown in lane A5 a f t e r passage once more through the a n t i - E . c o l i column; lane 2, molecular weight marker. S i z e s of markers are in kDa. 114 3.4. D i scuss i on Although pEC2 encoded a TcR-endoglucanase fusion poly-peptide, a higher level of CMCase activity was encoded by this plasmid than by pcEC2, which contains a complete endoglucanase gene. This may be a consequence of the endoglucanase gene being translated from the C. fimi ribosome-binding site in pcEC2 rather than the much stronger TcR ribosome-binding site, as in pEC2. Furthermore, more than 500 bases separate the TcR promoter and the ribosome-binding site of the endoglucanase gene in pcEC2. This could reduce drastically the level of expression of the gene (158). It is unlikely that the lower expression results from overlapping translations initiated upstream of the endoglucanase gene, because stop codons occur 5' to the ATG but before the endoglucanase gene in al l three reading frames. The N-terminal 76 amino acids are not essential for either the activity or the antigenicity of the endoglucanase since the TcB-endoglucanase fusion product retains both properties. On the other hand, deletion of DNA coding for the last 12 amino acids from the C-terminal end of the endoglucanase gene by ExoIII digestion resulted in the loss of al l endoglucanase activity. This demonstrates that the C-terminus of the endoglucanase is crucial for activity. However, it is not yet clear if these amino acids are directly or indirectly involved in active site function. Although the fusion polypeptide encoded by pEC2 lacks the putative signal peptide of the endoglucanase, some 15 percent 1 1 5 of i t is s t i l l exported into the p e r i p l a s m in E. c o l i . The s e c r e t i o n of the h y b r i d p r o t e i n c o u l d be d i r e c t e d by the N-terminus of the T c R determinant, which is an i n t e g r a l membrane p r o t e i n (129, 178), in c o n j u n c t i o n with the endoglucanase component, which comes from an exported p r o t e i n . I t w i l l be i n t e r e s t i n g to see i f the nat i v e enzyme i s s e c r e t e d in the absence of i t s s i g n a l p e p t i d e . The endoglucanase and the major exoglucanase (137) of C. f i m i both c o n t a i n a s t r i k i n g p r o l i n e - t h r e o n i n e sequence of v i r t u a l l y the same le n g t h , but at widely separated l o c a t i o n s i n the two p r o t e i n s . The two p r o t e i n s are of s i m i l a r length (418 r e s i d u e s f o r the endoglucanase and 443 r e s i d u e s f o r the exoglucanase). Perhaps an immunological approach c o u l d t e l l whether t h i s s p e c i a l sequence repeat i s a common f e a t u r e shared by a l l c e l l u l a s e s of C. f 1 m1. The endoglucanase and the exoglucanase genes are s t r i k i n g l y s i m i l a r i n G+C content (72.5% f o r the endoglucanase gene and 71% f o r the exoglucanase gene), in a strong b i a s in the use of G or C in the t h i r d base of the codons (98% f o r the endoglucanase gene and 98.5% f o r the exoglucanase gene) and In the r e s t r i c t e d use of codons (both of the genes use only 35 of the 61 amino a c i d codons). This suggests that they are indeed c l o s e l y r e l a t e d genes. The f a c i l e p r e p a r a t i o n of pure endoglucanase by immunoadsorbent chromatography shows that gene c l o n i n g Is a r e a l i s t i c approach to the o b t a i n i n g of pure c e l l u l a s e s devoid of any r e l a t e d a c t i v i t i e s . The s p e c i f i c r e a c t i o n between the p r o t e i n s and the a n t i b o d i e s g r e a t l y f a c i l i t a t e s the s e p a r a t i o n 1 1 6 of the cloned c e l l u l a s e s from u n r e l a t e d p o l y p e p t i d e s . The procedure is simple and r e p r o d u c i b l e , and the y i e l d of the p u r i f i e d c e l l u l a s e i s good, as demonstrated by the recovery of at l e a s t h a l f of the t o t a l a c t i v i t y and 283-fold increase in the s p e c i f i c a c t i v i t y of the endoglucanase (Table X V I I I ) . The y i e l d of the p u r i f i e d endoglucanase at t h i s stage is c o n s i d e r e d as minimal because of the large q u a n t i t y of s t a r t i n g m a t e r i a l to be handled in the p u r i f i c a t i o n . It is b e l i e v e d that the y i e l d can be maximized by s t a r t i n g with a h i g h l y expressed c l o n e , in which the endoglucanase gene i s fused to a high-copy-number plasmid and/or expressed under the c o n t r o l of s t r o n g r e g u l a t o r y s i g n a l s . With the a v a i l a b i l t y of a n t i b o d i e s a g a i n s t other cloned C. f i m i c e l l u l a s e s , the same approach can be a p p l i e d to p u r i f y them f o r the s t u d i e s of t h e i r b i o c h e m i s t r y and k i n e t i c s , as well as t h e i r s y n e r g i s t i c a c t i o n . 1 1 7 4. The c l o n i n g and ex p r e s s i o n of the endoglucanase gene in organisms other than E. c o l i 4.1. Background 4.1.1. Saccharomyces c e r e v i s l a e The yeast S. cere v i s iae has long been known f o r i t s important r o l e s i n the fermentation and baking i n d u s t r i e s . Nowadays i t is r e c e i v i n g much a t t e n t i o n because of i t s p o t e n t i a l u s e f u l n e s s as a model system f o r molecular a n a l y s i s of e u k a r y o t i c organisms. I t s well c h a r a c t e r i z e d g e n e t i c s , i t s biochemical and p h y s i o l o g i c a l s i m i l a r i t y to b a c t e r i a , i t s r a p i d growth under d e f i n e d c u l t u r e c o n d i t i o n s , i t s growth as d i s c r e t e c o l o n i e s on s o l i d media, and the ease and s a f e t y of i t s manipulation on a l a r g e s c a l e , make i t a d e s i r a b l e e u k a r y o t i c host f o r clo n e d genes (33, 161, 164). Yeast c e l l s are transformable (6, 78, 83). Many c l o n i n g v e c t o r s can be transformed with high e f f i c i e n c y i n t o yeast where they r e p l i c a t e autonomously (79, 81, 161). Many of the vect o r s can a l s o r e p l i c a t e In E. c o l 1, thereby a l l o w i n g a m p l i f i c a t i o n and c h a r a c t e r i z a t i o n of the c l o n e d genes In t h i s organism before t h e i r t r a n s f e r to yeast. The s u c c e s s f u l c l o n i n g of genes in yeast make i t an a t t r a c t i v e v e h i c l e f o r the pro d u c t i o n of u s e f u l p r o t e i n s or chemicals. A good example i s i t s p o t e n t i a l as a host f o r c e l l u l a s e genes. Yeast can ferment glucose to e t h a n o l , but It Is n o n - c e 1 1 u l o l y t I c . The c l o n i n g and e x p r e s s i o n of c e l l u l a s e genes in yeast c o u l d allow i t to u t i l i z e waste 1 i g n o c e l l u l o s i c s u b s t r a t e s as fermentation s u b s t r a t e s . The recent s u c c e s s f u l 118 e x p r e s s i o n of c e l l u l a s e genes in yeast (154, 168) and i t s s e c r e t i o n of an endoglucanase (168) suggests that the c o n v e r s i o n of yeast to a c e l l u l o l y t i c organism may indeed be poss i b l e . 4.1 .2 . Rhodobacter c a p s u l a t u s R. c a p s u l a t u s ( f o r m e r l y known as Rhodopseudomonas c a p s u l a t a ; r e f . 90) is a Gram-negat ive p h o t o t r o p h i c and p h o t o s y n t h e t i c bac ter ium (106) . It is a f a c u l t a t i v e p h o t o -t r o p h : i t can grow a e r o b i c a l l y in the d a r k , or a n a e r o b i c a l 1 y in the l i g h t (77, 105). Under p h c t o s y n t h e t i c ( a n a e r o b i c ) c o n d i t i o n s of growth , and in the absence of NH4* or N 2 , i t c o n v e r t s carbon s u b s t r a t e s s t o i c h i o m e t r i c a l l y to H 2 and C0 2 (77, 105). However, under a n a e r o b i c c o n d i t i o n s in the presence of N 2 , the n i t r o g e n a s e enzymes in R. c a p s u l a t u s w i l l reduce N 2 to NH3 (77, 105, 106). The e x i s t e n c e of these d i f f e r e n t pathways in R. c a p s u l a t u s suggests that t h i s organism may be a p o t e n t i a l cand ida te f o r the b i o l o g i c a l t r a n s f o r m a t i o n of c a r b o n s u b s t r a t e s such as c e l l u l o s e to p r o d u c t s of wider use . The i n t r o d u c t i o n of f o r e i g n genes in to R. c a p s u l a t u s has been a c h i e v e d by c o n j u g a t i o n and the use of some b r o a d - h o s t -range p lasmids (7, 180). I f c e l l u l a s e genes c l o n e d from c e l l u l o l y t i c microorganisms can be m o b i l i z e d in to R_. c a p s u l a t u s , t h e i r e x p r e s s i o n might a l l o w i t to c o n v e r t c e l l u l o s i c s u b s t r a t e s to u s e f u l end p r o d u c t s . F u r t h e r , s i n c e l i t t l e is known about gene e x p r e s s i o n in t h i s s p e c i e s (7, 196), the i n t r o d u c t i o n of an e a s i l y d e t e c t a b l e and measurable marker, such as c e l l u l a s e , c o u l d f a c i l i t a t e the s t u d i e s of 1 1 9 d i f f e r e n t aspects of gene r e g u l a t i o n i n t h i s organism. This chapter d e s c r i b e s the s u c c e s s f u l c l o n i n g and e x p r e s s i o n of the major endoglucanase gene from C_. f i m i i n yeast (168) and R. capsulatus (90). 120 4.2. M a t e r i a l s and methods 4.2.1. Organ isms E. c o l i RR1 (F , hsdS20 ( r ~ , m~ ) , a r a - 1 4 , p r o A 2 , l a c Y l , g a l K 2 , r p s L 2 0 ( S m R ) , x y l - 5 , mt1 - 1, supE44, X~; r e f . 113) was used as the h o s t f o r the a n a l y s i s and a m p l i f i c a t i o n o f r e c o m b i n a n t DNAs f o r c l o n i n g i n y e a s t . E_. c o l i HB101 (same as RRl e x c e p t f o r a l s o b e i n g r e c A 1 3 ; r e f . 113) was used as the h o s t f o r the h e l p e r p l a s m i d w h i c h m e d i a t e d c o n j u g a t i v e t r a n s f e r of g e n e t i c e l e m e n t s between E. c o l i and R. c a p s u l a t u s . A hsdR d e r i v a t i v e (11) o f _E. c o l i C600 ( S e c t i o n 2.2.1.) was used as the h o s t f o r the s t u d y o f g e n e t i c c o n s t r u c t s between C. f i m i and R. c a p s u l a t u s . E. c o l i JM101 used as the h o s t f o r M13 phages was d e s c r i b e d p r e v i o u s l y ( S e c t i o n 3 . 2 . 1 . ) . S. c e r e v i s i a e 20B12 ( t r p l , ^ pep4.3; r e f . 91) was used as the h o s t f o r the C. f i m i / y e a s t r e c o m b i n a n t p l a s m i d s . R. c a p s u l a t u s BIO (196) was used as the h o s t f o r the C. f i m i / R . c a p s u l a t u s r e c o m b i n a n t p l a s m i d s . 4.2.2. Media and growth c o n d i t i o n s The media and growth c o n d i t i o n s f o r the c u l t i v a t i o n o f E_. c o l i c e l l s w i t h or w i t h o u t pEC p l a s m i d s ( S e c t i o n 2.2.2.) o r M13 phages ( S e c t i o n 3.2.2.) were d e s c r i b e d . The media f o r g r o w t h and s e l e c t i o n of E. c o l i t r a n s f o r m a n t s h a r b o r i n g pOP o r i t s d e r i v a t i v e s , or pJAJ21 o r i t s d e r i v a t i v e s , were b a s i c a l l y the same as t h o s e d e s c r i b e d p r e v i o u s l y ( S e c t i o n 2 . 2 . 2 . ) . F o r E. c o l i c e l l s h a r b o r i n g pJAJ103 o r i t s d e r i v a t i v e s , the same media were used e x c e p t t h a t t h e y were s u p p l e m e n t e d w i t h t e t r a c y c l i n e ( f i n a l c o n c e n t r a t i o n 10 Ug p e r ml) i n s t e a d o f a m p i c i l l i n . 121 The YEPD (35) and tryptophan-supplemented media (168) used to grow or maintain S. cere v i s iae 20B12, and the selective media (168) used to screen for yeast transformants and to detect CMCase-positive clones were described previously. All yeast strains were cultivated aerobically at 30 °C (168). The RCV medium used to grow or maintain JR. capsulatus BIO, and the selective media used to screen for R. capsulatus transconjugants and to detect CMCase-positive clones were described previously (90). Cultures of R_. capsulatus were grown photosynthetical1y in screw-cap tubes at 34°C (90). 4.2.3. Vectors The yeast expression/secretion vector, pOP, was described previously (ref. 168; Fig. 28). M13mp8 phage (118) was used as an intermediate vector to obtain the proper reading frame of the endoglucanase gene when the latter was ligated with pOP to form pL5.19 (ref. 168; Fig. 29). pJAJ21 and pJAJ103 involved in the cloning of the endoglucanase gene in R. capsulatus were described previously (ref. 90; Figs. 34 and 35). pRK2013 (41) was used as the helper plasmid for mobilizing the transfer of plasmids from the donor E. coli cells to the recipient R. capsulatus cells. 4.2.4. Enzymes and reagents The sources of restriction endonucleases, modifying enzymes, antibiotics, bacteriophage X DNA, chemicals and reagents were described previously (Section 2.2.5.). M13mp8 was obtained from PL Biochemica1s. 122 4.2.5. Plasmid t r a n s f e r and i s o l a t i o n C e l l s of E. c o l i , yeast and _R. c a p s u l a t u s c o n t a i n i n g plasmids of i n t e r e s t were obtained by CaCl 2-mediated t r a n s f o r m a t i o n (113), L i C l - m e d i a t e d t r a n s f o r m a t i o n (87) and co n j u g a t i o n (41, 90), r e s p e c t i v e l y . Plasmids were i s o l a t e d from E. c o l i and J?. c a p s u l a t u s transformants by the a l k a l i n e l y s i s procedure (113). Plasmids were i s o l a t e d from yeast transformants by the r a p i d procedure d e s c r i b e d p r e v i o u s l y (116). 4.2.6. Measurement of CMCase a c t i v i t y The CMCase a c t i v i t i e s were determined with the DNS reagent ( S e c t i o n 2.2.12.; r e f . 120). C e l l e x t r a c t s of R. c a p s u l a t u s were made by s o n i c a t i o n . 1 2 3 4.3. R e s u l t s 4.3.1. Cl o n i n g and exp r e s s i o n of the endoglucanase gene in S. cere v1s iae The yeast c l o n i n g v e c t o r pOP ( F i g . 28; r e f . 168) was provided by A l l e l i x Inc. It i s a s h u t t l e v e c t o r f o r yeast and E. c o l i . The major feature of pOP i s the presence of the yeast p r e p r o t o x i n gene, the leader sequence of which can be used to f a c i l i t a t e the s e c r e t i o n of the product of a gene c l o n e d behind i t (35, 169). The source of the endoglucanase gene was the 2.4 kb BamHI fragment of pEC2.2 ( F i g . 7B). The endoglucanase coding fragment was i n s e r t e d into pOP in three d i f f e r e n t ways. F i r s t l y , the endoglucanase gene was fused In phase to the f i r s t three codons of the p r e p r o t o x i n gene ( F i g . 29). To accomplish t h i s in-frame gene f u s i o n , the endoglucanase i n s e r t was f i r s t c l o n e d into the BamHI s i t e of M13mp8 (118). I t was r e l e a s e d from the phage DNA by d i g e s t i o n with EcoRI and Hindi 11. The EcoRI and the H i n d l l l ends were blunt-ended with the Klenow fragment of DNA polymerase I. Then the fragment was l i g a t e d to pOP which had been d i g e s t e d with BamHI and then blunt-ended with the Klenow fragment. The r e s u l t i n g recombinant plasmid, from which a l l but the f i r s t three codons of the p r e p r o t o x i n gene were d e l e t e d , was designated pL5.19 (168). Secondly, the endoglucanase coding fragment of pEC2.2 was fused in phase to the f i r s t 52 codons of the p r e p r o t o x i n gene ( F i g . 30). This was accomplished simply by r e l e a s i n g the fragment from pEC2.2 with BamHI, then l l g a t i n g It to pOP which had been l i n e a r i z e d with Bgl11. In t h i s c o n s t r u c t . 124 ATG T A G F i g . 28. The yeast e x p r e s s i o n / s e c r e t i o n v e c t o r pOP. pOP c o n t a i n s the f o l l o w i n g components: 1) a 1.1 kb BamHI fragment (hatched bar) which c a r r i e s the cDNA sequence of the yeast p r e p r o t o x i n dsRNA (the s t a r t codon, the l e a d e r sequence (••) and the stop codon are shown); 2) the yeast a l c o h o l dehydrogenase 1 (ADC1) promoter (the d i r e c t i o n of t r a n s c r i p t i o n i s i n d i c a t e d by the s o l i d arrow); 3) the yeast iso-1-cytochrome c (CYCl) t r a n s c r i p t i o n a l t e rminator; 4) the r e p l i c a t i o n o r i g i n of the yeast 2 K m - c l r c l e ; 5) the yeast TRP1 gene which encodes N-(5*-phosph o r i b o s y l ) a n t h r a n i l a t e isomerase; and 6) the pBR322 sequence which c a r r i e s the o r i g i n of r e p l i c a t i o n ( o r l ) and the ApR determinant. R e s t r i c t i o n enzymes a r e : B, BamHI and Bg, B g l l l . 1 2 5 F i g . 29. The c o n s t r u c t i o n of pL5.19. Eg gene and m.c.s. represent the endoglucanase gene and the m u l t i p l e - c l o n i n g s i t e s of M13mp8, r e s p e c t i v e l y . R e s t r i c t i o n enzymes a r e : B, BamHI; Bg, B g J I l ; E, EcoRI; and H, H i n d l l l . 1 2 6 B E B B g 8 H E P I U SH l i g a t i o n P R E P R O T O X I N c D N A M 1 3 m p 8 127 F i g . 30. The c o n s t r u c t i o n of pK2.4. Eg gene re p r e s e n t s the endoglucanase gene. R e s t r i c t i o n enzymes a r e : B, BamHI and Bg, B g l l l . 128 the endoglucanase gene was joined to the leader sequence of the preprotoxin gene. The resulting plasmid was designated pK2.4 ( 168). Lastly, to serve as a negative control, the endoglucanase insert was simply fused with the BamHI cleaved pOP (Fig. 31). The endoglucanase gene inserted in this way was out of phase with the start codon of the preprotoxin gene. The resulting plasmid was designated pNve. The three endoglucanase gene-carrying plasmids were used to transform the tryptophan-dependent yeast strain 20B12 by the LiCl procedure (87), with selection on minimal medium. Yeast clones containing pL5.19 and pK2.4 produced CMCase activity, but those containing pNve did not (Fig. 3 2 ) . Further analyses showed clearly that the CMCase activity expressed by the cells containing pL5.19 and pK2.4 was encoded by the plasmid-carried endoglucanase gene (Table XIX). Since no detectable activity was found in either the broken spheroplasts or the periplasmic materials of the two CMCase-positive yeast clones, it was concluded that the activities seen (Fig. 32) were due to secretion but not cell lysis (168). The large difference between the activities encoded by pL5.19 and pK2.4 (Fig. 32) reflected the abilities of the two types of transformants to secrete endoglucanase (Fig. 33; ref 168). 4.3.2. Cloning and expression of the endoglucanase gene in R. capsulatus The 2.4 kb BamHI fragment of pEC2.2 (Fig. 7B) was again used as the source of the endoglucanase gene. Since 129 F i g . 31. The c o n s t r u c t i o n of pNve. Eg gene r e p r e s e n t s the endoglucanase gene. R e s t r i c t i o n enzymes a r e : B, BamHI and Bg, B g l l l . 130 pNve F i g . 3 2 . The CMC p l a t e a s s a y o f y e a s t t r a n s f o r m a n t s c a r r y i n g p L 5 . 1 9 , p K 2 . 4 a n d p N v e a s s h o w n . 1 3 1 Table XIX. S y n t h e s i s of endoglucanase in yeast i s determined by the cloned C. f i m i gene Yeast s t r a i n Experiment 20B12 20B12(pL5.19) 20B12(pK2.4) Formation of c l e a r zones on CMC p l a t e s - + + Plasmid p r e s e n t 3 nd pL5.19 pK2.4 Curing of CMCase-p o s i t i v e phenotype 6 nd 45.5% 46.3% CMCase a c t i v i t y in c u l t u r e supernatant - - + a P l a s m i d s prepared from the yeast s t r a i n s were used to transform E. c o l i . C o n f i r m a t i v e analyses were done on the IS. c o l 1 transformants. b C u r i n g experiments were done by growing yeast transformants in YEPD broth f o r 20 hr, then p l a t i n g on n o n - s e l e c t i v e CMC p l a t e s . The numbers are the percentage of the r e s u l t i n g c o l o n i e s which d i d not give c l e a r i n g of the CMC. The number of c o l o n i e s screened f o r 20B12 (pL5.19) and 20B12 (pK2.4) were 1024 and 1227, r e s p e c t i v e l y , nd: not done. 132 F i g . 33. S e c r e t i o n of endoglucanase by y e a s t . Yeast transformants were grown at 30°C to a d e n s i t y of 1 X 10 8 to 2 X 10 8 c e l l s / m l in s e l e c t i v e medium (supplemented with 20 Ug L-tryptophan/ml f o r the untransformed s t r a i n 20B12). C u l t u r e supernatants were concentrated by u l t r a f i l t r a t i o n , d i a l y s e d a g a i n s t water, and l y o p h i l i z e d . The m a t e r i a l was d i s s o l v e d in water, and the CMCase a c t i v i t i e s in samples were measured by the DNS procedure. C u l t u r e s : a, 20B12(pK2.4); b, untransformed 20B12; and Q, 20B12(pL5.19). 10 Ul of concentrate c o n t a i n e d 16, 28, and 26 Kg of p r o t e i n f o r c u l t u r e s a to £, r e s p e c t i v e l y . The CMCase a c t i v i t y of supernatant a was 1.6 U/ml; the s p e c i f i c a c t i v i t y was 0.34 U/mg of p r o t e i n . U Is expressed as Kmol of glucose e q u i v a l e n t s r e l e a s e d per min. 133 134 heterologous promoters may be transcribed poorly or not at a l l in R. capsulatus, the endoglucanase gene was fused in-frame to a gene transcribed from a R^  capsulatus promoter (90). This would result in expression of the endoglucanase as a fusion polypeptide. It was assumed, because of the TcR-endoglucanase fusion of pEC2 (Section 2.3.3.) and the yeast toxin-endoglucanase fusions of pL5.19 and pK2.4 (Section 4.3.1.), that the new fusion polypeptide would also be enzymatical1y active. The BamHI fragment was first subcloned into pJAJ21 (Fig. 34; ref. 90). This plasmid, a derivative of pUC13, carries the R. capsulatus rxcA promoter and the 5'-terminal portion of the B870fi gene. Blunt-end ligation of the BamHI fragment (sticky ends fi l led in by the Klenow fragment of DNA polymerase I) and the Xmal digested pJAJ21 (sticky ends f i l led in with the Klenow fragment of DNA polymerase I) joined the endoglucanase coding sequence in-frame to the B870ft gene. The resultant plasmid was designated pRW6 (Fig. 34; ref. 90). It expressed CMCase activity in E. col i . Digestion of pRW6 with BamHI released the 2.4 kb fragment, which confirmed that the plasmid had the expected structure (Fig. 34). The rxcA promoter region and the B870& endoglucanase gene fusion were isolated as a fragment by partial digestion of pRW6 with BamHI plus PstI (Fig. 35). The fragment was then ligated with PstI plus BamHI digested pJAJ103 (Fig. 35). This is a broad-host-range vector for Gram-negative bacteria (90). The resultant plasmid was designated pREC2.2 (Fig. 35; ref. 90). _E_. coli transformants harboring this plasmid produced CMCase 1 3 5 F i g . 34. The c o n s t r u c t i o n of pRW6. (a) O u t l i n e of the c o n s t r u c t i o n . rxcAp i s the promoter of the r e a c t i o n centre A (rxcA) operon of R. c a p s u l a t u s ; d i r e c t i o n of t r a n s c r i p t i o n Is i n d i c a t e d by the arrow. Adjacent to the rxcA promoter i s the 5'-terminal p o r t i o n of the B870fi gene; ATG i s the s t a r t codon of the gene. R e s t r i c t i o n enzymes are: B, BamHI; Bg, B g l l l ; P, P s t l ; Xo, XhoII; and Xm, Xmal . (b) R e s t r i c t i o n a n a l y s i s of plasmids from CMCase producing c l o n e s . Samples were e l e c t r o p h o r e s e d on a 0.7% agarose gel f o r 3 hr at a constant voltage of 50. Lane 1, x DNA r e s t r i c t e d with Hindi 11. Lanes 2 and 3, pRWD d i g e s t e d with P s t l plus Bgl 11 (lane 2) or j£aj>HI (Lane 3). This plasmid c a r r i e d two BamHI fragments in tandem. Lanes 4 and 5, pRW6 d i g e s t e d with Pst I plus Bgl 11 (Lane 4) or BamHI (lane 5 ) . The ve c t o r fragment is marked by the s o l i d t r i a n g l e , the 2.4 kb C. f i m i fragment by the open t r i a n g l e . 1 3 6 expression B Bg 2.4 kb insert of PEC2.2 Xm C C C G G G A T C C 1 2 3 4 5 137 F i g . 3 5 . The c o n s t r u c t i o n o f p R E C 2 . 2 <a) An o u t l i n e o f t h e c o n s t r u c t i o n . R e s t r i c t i o n e n z y m e s a r e : B , BamHI i B g , B g 1 1 1 ; a n d P , P s t l . ( b ) R e s t r i c t i o n a n a l y s i s o f p l a s m i d s f r o m C M C a s e -p o s i t l v e c l o n e s . The d i g e s t s w e r e e l e c t r o p h o r e s e d on a 0 . 8 % a g a r o s e g e l f o r 3 h r a t a c o n s t a n t v o l t a g e o f 5 0 . L a n e 1 , X DNA r e s t r i c t e d w i t h H i n d i 1 1 . l a n e s 2 t o 9 : t h e p l a s m i d s f r o m f o u r d i f f e r e n t c l o n e s w e r e d i g e s t e d w i t h BamHI ( l a n e s 2 t o 5 ) , o r BamHI p l u s P s t l ( l a n e s 6 t o 9 ) . The f o u r p l a s m i d s w e r e I d e n t i c a l a n d t h e y g a v e t h e f r a g m e n t s e x p e c t e d f r o m p R E C 2 . 2 . The p J A J 1 0 3 f r a g m e n t , t h e e n d o g l u c a n a s e f r a g m e n t a n d t h e r x c A p r o m o t e r f r a g m e n t a r e i n d i c a t e d by t h e s o l i d t r i a n g l e , t h e o p e n t r i a n g l e a n d t h e a r r o w , r e s p e c t i v e l y . 138 139 activity, and one such transformant was used as donor in a conjugation with R. capsulatus (41, 90). TcR R. capsulatus clones were screened for CMCase activity and for the presence of pREC2.2. All clones expressing CMCase activity contained the plasmid (Table XX). The DNA fragment containing the rxcA promoter and the B870fi gene of pREC2.2 (Fig. 35) was replaced by the regulatory region of the lacZ gene, with the lacZ and the endoglucanase genes fused in-frame. E. coli cells harboring this new plasmid (pRKEC2.2; ref. 90) expressed CMCase activity. However, significant activity could not be detected in. R. capsulatus cells harboring the same plasmid (90). Therefore, expression of the endoglucanase gene in R. capsulatus relied on homologous expression signals. 140 Table XX. Characterization of R. capsulatus clones expressing CMCase a c t i v i t y Characterizat ion Result Reisolation of pREC2.2 from the clones Halo formation on CMC plates Sp e c i f i c CMCase a c t i v i t y from total c e l l extract 8.75 U/mg protein 3 Growth rates of the s t r a i n +/• pREC2.2 Identleal Use of CMC as sole carbon source U is expressed as #mol of glucose equivalents released per min. J. A. Johnson, unpublished observation. 141 4 . 4 . D i s c u s s i o n A l t h o u g h y e a s t s t r a i n 2 0 B 1 2 ( p K 2 . 4 ) i s a b l e t o p r o d u c e a n d s e c r e t e a s i g n i f i c a n t q u a n t i t y of C M C a s e a c t i v i t y i n t o t h e c u l t u r e s u p e r n a t a n t ( F i g . 3 3 ) , t h e c e l l s l a c k d e t e c t a b l e a c t i v i t y . T h i s c o u l d r e f l e c t t h e f o r m a t i o n o f i n a c t i v e e n d o g l u c a n a s e i n t h e c y t o p l a s m of y e a s t , a s h a s b e e n o b s e r v e d f o r o t h e r n a t u r a l l y s e c r e t e d f o r e i g n p r o t e i n s i n t h e same o r g a n i s m ( 1 5 0 , 1 7 0 ) , o r t h e c o u p l i n g of s y n t h e s i s t o s e c r e t i o n . A n t i b o d y s p e c i f i c t o t h e e n d o g l u c a n a s e s h o u l d a l l o w r e s o l u t i o n o f t h i s p o i n t . The e x p r e s s i o n o f t h e C . f i m i e n d o g l u c a n a s e g e n e i n y e a s t a n d t h e s e c r e t i o n o f t h e e n z y m e ( 1 6 8 ) h a v e p r o v i d e d a n i m p e t u s t o f u t u r e r e s e a r c h o n y e a s t w i t h r e s p e c t t o c e l l u l o s e s a c c h a r i f i c a t i o n a n d p r o t e i n s e c r e t i o n . I t i s p o s s i b l e t h a t y e a s t c o u l d be c o n v e r t e d i n t o a c e l l u l o l y t i c o r g a n i s m s e c r e t i n g c e l l u l a s e s . A l t h o u g h a t t h i s s t a g e t h e c e l l u l a s e a c t i v i t y s e c r e t e d b y y e a s t i s l o w when c o m p a r e d t o t h a t o f a C . f i m i c e l l u l a s e c o m p l e x ( 1 0 1 ) , i t i s a n t i c i p i t a t e d t h a t w i t h p r o p e r g e n e t i c a n d r e c o m b i n a n t DNA m a n i p u l a t i o n s , c e l l u l a s e a c t i v i t y o f y e a s t c o u l d c o m p a r e f a v o r a b l y w i t h t h o s e f r o m n a t u r a l c e l l u l o l y t i c m i c r o o r g a n i s m s . C o n c e i v a b l y , i t c o u l d t h e n p r o d u c e e t h a n o l f r o m c e l l u l o s i c s u b s t r a t e s . The C . f i m i e n d o g l u c a n a s e g e n e w a s a l s o t r a n s f e r r e d t o a n d e x p r e s s e d i n R. c a p s u l a t u s . The f u s i o n b e t w e e n t h e B 8 7 0 f t g e n e a n d t h e e n d o g l u c a n a s e g e n e r e s u l t e d i n h i g h l e v e l o f e x p r e s s i o n o f C M C a s e a c t i v i t y i n R. c a p s u l a t u s ( T a b l e X X ) , w h i c h i s a b o u t 40 t i m e s t h e a m o u n t d e t e c t e d f o r t h e a n a l o g o u s p B R 3 2 2 - d e r i v e d 142 c o n s t r u c t i n E . c o l i ( p E C 2 . 2 ) ( T a b l e V I I I ) . A l t h o u g h t h e r e a s o n f o r s u c h a s t r o n g e x p r e s s i o n i n R. c a p s u l a t u s i s n o t c l e a r , i t i s p o s s i b l e t h a t t h i s b a c t e r i u m c o u l d be c o n v e r t e d t o a c e l l u l o l y t i c o r g a n i s m f o r t h e t r a n s f o r m a t i o n o f c e l l u l o s e t o u s e f u l e n d p r o d u c t s . F u r t h e r m o r e , t h e e n d o g l u c a n a s e e x p r e s s i o n s y s t e m m i g h t be u t i l i z e d t o e x a m i n e g e n e e x p r e s s i o n a n d r e g u l a t i o n i n R. c a p s u l a t u s , a b o u t w h i c h r e l a t i v e l y l i t t l e i s k n o w n ( 7 , 1 9 6 ) . I t i s c o n c e i v a b l e t h a t t h e B 8 7 0 & g e n e p r o d u c t s p a n s t h e i n n e r m e m b r a n e o f R. c a p s u l a t u s ( T . B e a t t y , p e r s o n a l c o m m u n i c a t i o n ; r e f . 1 8 3 ) , a s d o e s t h e T c R d e t e r m i n a n t i n _E. c o l i ( 1 2 9 , 1 7 8 ) . I t w i l l be i n t e r e s t i n g t o s e e i f a n y o f t h e B 8 7 0 f i - e n d o g l u c a n a s e p o l y p e p t i d e i s f o u n d i n t h e p e r i p l a s m o f E . c o l i a n d / o r R. c a p s u l a t u s , g i v e n t h a t some o f t h e T c R — e n d o g l u c a n a s e f u s i o n p o l y p e p t i d e i s f o u n d i n t h e p e r i p l a s m o f E . c o l i . W i t h t h e a t t a c h m e n t o f a n a p p r o p r i a t e s i g n a l p e p t i d e t o t h e e n d o g l u c a n a s e (may be t h e n a t u r a l one f o r t h e e n d o g l u c a n a s e ) a n d t h e u s e o f a l e a k y R. c a p s u l a t u s m u t a n t ( a s h a s b e e n d e s c r i b e d f o r E . c o l i ; r e f . 5 6 ) , t h e e n d o g l u c a n a s e m i g h t a p p e a r e x t r a c e 1 1 u l a r l y . T h i s m i g h t i n t u r n a l l o w t h e f o r m u l a t i o n o f a common s y s t e m f o r e x p r e s s i o n a n d s e c r e t i o n / l e a k a g e o f c e l l u l a s e s i n R. c a p s u l a t u s . A s w i t h y e a s t , t h e c l o n e d e n d o g l u c a n a s e g e n e c o u l d be u s e d t o s t u d y t h e b a s i c a s p e c t s o f p r o t e i n s e c r e t i o n i n R. c a p s u l a t u s . 1 4 3 5. References 1. Ander, P., and K.E. E r i k s s o n . 1978. L i g n i n degradation and u t i l i z a t i o n by microorganisms. Progress in Ind. M i c r o b i o l . l_4:l-58. 2. Anderson, S. 1981. Shotgun DNA sequencing s t r a t e g y using cloned DNase I-generated fragments. Nucl. Acids Res. 9:3015-3027. 3. Barnes, W.M., M. Bevan, and P.H. Son. 1983. K i l o -sequencing: c r e a t i o n of an ordered nest of asymmetric d e l e t i o n s across a large t a r g e t sequence c a r r i e d on phage M13. Methods Enzymol. 101:98-122. 4. Barton, R. 1982. Gel e l e c t r o p h o r e s i s . In: Biochemical Research Techniques. Biochemistry Department, U.B.C., pp. 151-208. 5. Bassham, J.A. 1975. General c o n s i d e r a t i o n s . B i o t e c h n o l . & Bloeng. Symp. 5:9-19. 6. Beggs, J.D. 1978. Transformation of yeast by a r e p l i c a t i n g h y b r i d plasmid. Nature (London) 275:104-109. 7. Belasco, J.G., J.T. Beatty, C.W. Adams, A. von Gabain, and S.N. Cohen. 1985. D i f f e r e n t i a l e x p r e s s i o n of photosynthesis genes in R. c a p s u l a t a r e s u l t s from segmental d i f f e r e n c e s in s t a b i l i t y w i t h i n the p o l y c i s t r o n i c rxcA t r a n s c r i p t . C e l l 40:171-181. 8. Berg, B., B. Hofsten, and G. P e t t e r s s o n . 1972. Growth and c e l l u l a s e formation by C e l l v i b r i o f u l v u s . J . Appl. B a c t e r i o l . 35:201-214. 9. Berghem, L. E. R., and L. G. P e t t e r s s o n . 1974. The mechanism of enzymatic c e l l u l o s e d e g r a d a t i o n : i s o l a t i o n and some p r o p e r t i e s of a ft-glucosidase from Trichoderma  v i r i d e . Eur. J . Biochem. 45:295-305. 10. Bethesda Research L a b o r a t o r i e s . 1984. New d o u b l e - f i n e sharkstooh comb. Focus 6.(4) :8. 11. Bibb, M.J., and S.N. Cohen. 1982. Gene e x p r e s s i o n i n Streptomyces: c o n s t r u c t i o n and a p p l i c a t i o n of promoter-probe plasmid v e c t o r s in Streptomyces 1i v idans. Mol. Gen. Genet. 187:265-277. 12. B i g g i n , M.D., T.J. Gibson, G.F. Hong. 1983. B u f f e r g r a d i e n t g e l s and 3 5S l a b e l as an a i d to r a p i d DNA sequence d e t e r m i n a t i o n . Proc. N a t l . Acad. S c i . U.S.A. 80:3963-3965. 144 1 3 . B l s a r i a , V . S . , a n d T . K . G h o s e . 1 9 8 1 . B 1 o d e g r a d a t i o n o f c e l l u l o s i c m a t e r i a l s : s u b s t r a t e s , m i c r o o r g a n i s m s , e n z y m e s a n d p r o d u c t s . E n z y m e M i c r o . T e c h n o l . 3 _ : 9 0 - 1 0 4 . 1 4 . B i s s e t t , F . H . 1 9 7 9 . A n a l y s i s o f c e l l u l a s e p r o t e i n s b y h i g h - p e r f o r m a n c e l i q u i d c h r o m a t o g r a p h y . J . C h r o m a t o g . 1 7 8 : 5 1 5 - 5 2 3 . 1 5 . B i s s e t t , F . H . , R . E . A n d r e o t t i , a n d M . M a n d e l s . 1 9 8 1 . E f f e c t s o f s t r a i n a n d s u b s t r a t e o n c o m p o s i t i o n p r o p e r t i e s , a n d s a c c h a r i f I c a t i o n p o t e n t i a l o f T r i c h o d e r m a  r e e s e i c e l l u l a s e . I n : B i o c o n v e r s i o n a n d B i o c h e m i c a l E n g i n e e r i n g ( T . K . G h o s e , e d . ) , s y m p o s i u m 2 , v o l 1 . I I T New D e l h i , p p . 3 7 3 - 3 8 8 . 1 6 . B l o o m , F . R . , a n d P . J . K r e t s c h m e r . 1 9 8 3 . E f f e c t s o f g e n e t i c e n g i n e e r i n g o f m i c r o o r g a n i s m s o n t h e f u t u r e p r o d u c t i o n o f a m i n o a c i d s f r o m a v a r i e t y o f c a r b o n s o u r c e s . I n : O r g a n i c c h e m i c a l s f r o m B i o m a s s ( D . L . W i s e , e d . ) . T h e B e n j a m i n / C u m m i n g s P u b l i s h i n g C o m p a n y , M e n l o P a r k , C a l i f o r n i a , p p . 1 4 5 - 1 7 1 . 1 7 . B o l i v a r , F . , R . L . R o d r i g u e z , P . J . G r e e n e , M . V . B e t l a c h , H . L . H e y n e k e r , H . W . B o y e r , J . H . C r o s a , a n d S . F a l k o w . 1 9 7 7 . C o n s t r u c t i o n a n d c h a r a c t e r i z a t i o n o f new c l o n i n g v e h i c l e s . I I . A m u l t i p u r p o s e c l o n i n g s y s t e m . G e n e _ 2 : 9 5 -1 1 3 . 1 8 . B r a d e n , A . R . , a n d D . W . T h a y e r . 1 9 7 6 . S e r o l o g i c a l s t u d y o f C e l l u l o m o n a s . I n t . J . S y s t . B a c t e r i o l . 2 6 : 1 2 3 - 1 2 6 . 1 9 . B r a d f o r d , M . M . 1 9 7 6 . A r a p i d a n d s e n s i t i v e m e t h o d f o r t h e q u a n t i t a t i o n o f m i c r o g r a m q u a n t i t i e s o f p r o t e i n u t i l i z i n g t h e p r i n c i p l e o f p r o t e i n - d y e b i n d i n g . A n a l . B i o c h e m . 7 2 : 2 4 8 - 2 5 4 . 2 0 . B r o d a , P . 1 9 7 9 . R e p l i c a t i o n . I n : P l a s m i d s . W . H . F r e e m a n a n d C o m p a n y L i m i t e d , L o n d o n , p p . 5 3 - 8 2 . 2 1 . C a l h o u n , D . H . , a n d J . E . G r a y . 1 9 8 1 . D e t e c t i o n o f p r o t e i n s c o d e d b y c l o n e d DNA s e g m e n t s . F o c u s 3 _ ( 4 ) : 1 , 1 0 . 2 2 . C a u f i e l d , D . F . , a n d W . E . M o o r e . 1 9 7 4 . E f f e c t o f v a r y i n g c r y s t a l 1 i n i t y o f c e l l u l o s e o n e n z y m i c h y d r o l y s i s . Wood S c i . 6 : 3 7 5 - 3 7 9 . 2 3 . C h a n g , M . M . , T . Y . C . C h o u , a n d G . T . T s a o . 1 9 8 1 . S t r u c t u r e , p r e t r e a t m e n t a n d h y d r o l y s i s o f c e l l u l o s e . A d v . B i o c h e m . E n g . 2 0 : 1 5 - 4 2 . 145 24. Choi, W.Y., K.D. Haggett, and N.W. Dunn. 1978. I s o l a t i o n of a co t t o n wool degrading s t r a i n of Ce11u1omonas: mutants with a l t e r e d a b i l i t y to degrade c o t t o n wool. Aust. J . of B i o l . S c i . 3_l:553-564. 25. Choudhury, N., P.P. Gray, and N.W. Dunn. 1980. S a c c h a r i f i c a t i o n of sugar cane bagasse by an enzyme p r e p a r a t i o n from Ce11u1omonas: r e s i s t a n t to product i n h i b i t i o n . B i o t e c h n o l . L e t t . 2:427-428. 26. C o l l i n s , J . 1979. C e l l - f r e e s y n t h e s i s of p r o t e i n s coding for m o b i l i s a t i o n f u n c t i o n s of c o l E l and t r a n s p o s i t i o n f u n c t i o n s of Tn3. Gene 5:29-42. 27. Collmer, A., and D.B. Wilson. 1983. Cl o n i n g and exp r e s s i o n of a Thermomonospora YX e n d o c e l l u l a s e gene in E. c o l i . Biotechnology 1:594-601. 28. Conn, E.E., and P.K. Stumpt. 1976. Cabohydrates. In: O u t l i n e s of Biochemistry, 4 t h edn. John Wiley & Sons, N.Y., pp.25-56. 29. Cornet, P., J . M i l l e t , P. Beguin, and J.P. Aubert. 1983. C h a r a c t e r i z a t i o n of two ce1 ( c e l l u l o s e degradation) genes of C l o s t r id i um thermoce Hum coding f o r endoglucanases. Biotechnology 1:589-594. 30. Cowling, E.B. 1963. S t r u c t u r a l f e a t u r e s of c e l l u l o s e that i n f l u e n c e i t s s u s c e p t i b i l i t y to enzymatic h y d r o l y s i s . In: Advances in enzymic h y d r o l y s i s of c e l l u l o s e and r e l a t e d m a t e r i a l s (E.T. Reese, ed.). Pergamon Press, N.Y., pp. 1-32. 31. Cowling, E.B. 1975. P h y s i c a l and chemical c o n s t r a i n t s i n the h y d r o l y s i s of c e l l u l o s e and 1ignoce11ulosic m a t e r i a l s . B i o t e c h n o l . & Bioeng. Symp. 5:163-181. 32. Cowling, E.B., and W. Brown. 1969. S t r u c t u r a l f e a t u r e s of c e l l u l o s i c m a t e r i a l s In r e l a t i o n to enzymatic h y d r o l y s i s . Adv. Chem. Ser. 95:152-187. 33. Cramer, J.H., and M. Sta v e r . 1983. The yeast Saccharomyces c e r e v I s l a e : i t s p o t e n t i a l as a model p l a n t system. Develop. Ind. M i c r o b i o l . 24:43-55. 34. Creuzet, N., Berenger, J.F., and C. F r i x o n . 1983. C h a r a c t e r i z a t i o n of exoglucanase and s y n e r g i s t i c h y d r o l y s i s of c e l l u l o s e in C l o s t r i d i u m s t e r c o r a r i u m . FEMS M i c r o b i o l . L e t t . 20:347-350. 1 4 6 35. Crosby, W.L., and D.Y. Thomas. 1983. Gene c l o n i n g in yeast. In: Techniques in the L i f e S c i e n c e s (R.A. F l a v e l l , ed.). E l s e v i e r , I r e l a n d , pp. 1-19. 36. Cuatrecasas, P. 1970. P r o t e i n p u r i f i c a t i o n by a f f i n i t y chromatography. J . B i o l . Chem. 245:3059-3065. 37. Cuatrecasas, P., and C.B. A n f i n s e n . 1971. A f f i n i t y chromatography. Methods Enzymol. 22:345-378. 38. Cuatrecasas, P. M. Wilchek, and C.B. A n f i n s e n . 1968. S e l e c t i v e enzyme p u r i f i c a t i o n by a f f i n i t y chromatography. Proc. N a t l . Acad. S c i . U.S.A. 61:636-643. 39. Danna, K., and D. Nathans. 1971. S p e c i f i c cleavage of simian v i r u s 40 DNA by r e s t r i c t i o n endonuclease of Hemophllus Influenzae. Proc. N a t l . Acad. S c i . U.S.A. 68: 2913-2917. 40. Dermoun, Z., and J.P. B e l a i c h . 1985. M i c r o c a l o r l m e t r I c study of c e l l u l o s e d e g r a d a t i o n by Ce11ulomonas uda ATCC 21399. B i o t e c h n o l . Bioeng. 27:1005-1011. 41. D i t t a , G., T. Schmidhauser, E. Yakobson, P. Lu, X.W. Liang, D.R. F i n l a y , D. Guiney, and D.R. H e l i n s k i . 1985. Plasmls r e l a t e d to the broad host range v e c t o r pRK290 us e f u l f o r gene c l o n i n g and f o r monitoring gene ex p r e s s i o n . Plasmid 13:149-153. 42. Dougan, G., and M. Kehoe. 1984. The m i n i c e l l system as a method f o r studying e x p r e s s i o n from plasmid DNA. Methods M i c r o b i o l . 17:233-258. 43. Emert, G.H., E.K. Gum, J.A. L i u , T.H. L i u , and R.D. Brown, J r . 1974. C e l l u l a s e s . Adv. Chem. Ser. 136:79-100. 44. Enzyme Nomenclature. 1984. Recomendat1ons of the nomenclature committee of the I n t e r n a t i o n a l Union of Biochemistry. P u b l i s h e d f o r the I n t e r n a t i o n a l Union of Biochemistry, Academic Pr e s s , N.Y. 45. E r i k s s o n , K.E. 1969. The f r a c t i o n a t i o n of the e x t r a c e l l u l a r enzymes from Chrysosporium 1Ignorum• Adv. Chem. Ser. 95:58-59. 46. E v e l e i g h , D.E. 1983. The ferm e n t a t i o n of biomass. In: Biomass u t i l i z a t i o n (W.A. Cote, e d . ) . Plenum Press, N.Y., pp.365-391. 47. Fagerstam, L.G., and L.G. P e t t e r s s o n . 1979. The c e l l u l o l y t i c complex of Trlchoderma resse i QM9414: an Immunochemical approach. FEBS L e t t e r s 98:363-367. 14? 48. Fan, L.T., Y.H. Lee, and D.H. Beardmore. 1980. Major chemical and p h y s i c a l f e a t u r e s of c e l l u l o s i c m a t e r i a l s as su b s t r a t e s f o r enzymatic h y d r o l y s i s . Adv. Biochem. Eng. U.-101-117. 49. Fan, L.T., Y.H. Lee, and D.H. Beardmore. 1980. Mechanism of the enzymatic h y d r o l y s i s of c e l l u l o s e : e f f e c t s of major s t r u c t u r a l f e a t u r e s of c e l l u l o s e on enzymatic h y d r o l y s i s . B i o t e c h n o l . Bloeng. 22:177-199. 50. Fan, L.T., Y.H. Lee, and M.M. Gharpuray. 1982. The nature of 1 i g n o c e l l u l o s i c s and t h e i r pretreatments f o r enzymatic h y d r o l y s i s . Adv. Biochem. Eng. 23:157-187. 51. F r a z e r , A.C., and R. C u r t i s s I I I . 1975. Pr o d u c t i o n , p r o p e r t i e s and u t i l i t y of b a c t e r i a l m i n i c e l l . Curr. Top. M i c r o b i o l . Immunol. 69:1-84. 52. Ghose, T.K., and J . A. K o s t i c k . 1969. Enzymatic s a c c h a r i f i c a t i o n of c e l l u l o s e in semi- and c o n t i n u o u s l y a g i t a t e d systems. Adv. Chem. Ser. 95:415-446. 53. G i a l l o , J . , C. Gaudin, J.P. B e l a i c h , E. Petitdemange, and F.C. Mangin. 1983. Metabolism of glucose and c e l l o b i o s e by c e l l u l o l y t i c m e s o p h l l l c C l o s t r i d i u m sp. s t r a i n H10. Appl. E n v i r o n . M i c r o b i o l . 45:843-849. 54. G i l b e r t , I.G., and G.T. Tsao. 1983. I n t e r a c t i o n between s o l i d s u b s t r a t e and c e l l u l a s e enzymes i n c e l l u l o s e h y d r o l y s i s . Ann. Rept. Ferm. Proc. 6:323-358. 55. G i l k e s , N.R., D.G. K i l b u r n , M.L. Langsford, R.C., M i l l e r , J r . , W.W. Wakarchuk, R.A.J. Warren, D.J. W h i t t l e , and W.K.R. Wong. 1984. I s o l a t i o n and c h a r a c t e r i z a t i o n of E s c h e r i c h i a c o l i clones e x p r e s s i n g c e l l u l a s e genes from Cellulomonas f i m i . J . Gen. M i c r o b i o l . 130:1377-1384. 56. G i l k e s , N.R., D.G. K i l b u r n , R.C. M i l l e r , J r . , and R.A.J. Warren. 1984. A mutant of Escher i c h i a c o l i that l e a k s c e l l u l a s e a c t i v i t y encoded by cloned c e l l u l a s e genes from Cellulomonas f i m i . Biotechnology 2:259-263. 57. G i l k e s , N.R., M.L. Langsford, D.G. K i l b u r n , R.C. M i l l e r , J r . , and R.A.J. Warren. 1984. Mode of a c t i o n and su b s t r a t e s p e c i f i c i t i e s of c e l l u l a s e s from c l o n e d b a c t e r i a l genes. J . B i o l . Chem. 259:10455-10459. 58. G i l l i g a n , W., and E.T. Reese. 1954. Evidence f o r m u l t i p l e components in m i c r o b i a l c e l l u l a s e s . Can. J . M i c r o b i o l . 1:90-107. 148 59. G o l d s t e i n , I.S. 1977. The place of c e l l u l o s e under energy s c a r c i t y . In: C e l l u l o s e Chemistry and Technology (J.C. Arthur, J r . , ed.). ACS Symposium s e r i e s 48, American Chemical S o c i e t y , Washington, D.C, pp. 382-386. 60. G o l d s t e i n , I.S. 1981. Biomass a v a i l a b i l i t y and u t i l i t y f o r chemicals. In: Organic Chemicals from Biomass ( I . S . G o l d s t e i n , e d.). CRC Press, Boca Raton, F l o r i d a , pp. 1-7. 61. G o l d s t e i n , I.S. 1983. H y d r o l y s i s of c e l l u l o s e by a c i d s . In: Biomass u t i l i z a t i o n (W.A. Cote, ed.). Plenum Pr e s s , N.Y., pp. 559-566. 62. Gong> C.S., L.F. Chen, and G.T. Tsao. 1979. A f f i n i t y chromatography of endoglucanase of Trichoderma v l r i d e by concana v a l l n A-agarose. B i o t e c h n o l . Bloeng. 21:167-171. 63. Gong, C.S., M.R. L a d i s c h , and G.T. Tsao. 1977. C e l l o b l a s e from Tr ichoderma v i r i d e : p u r i f i c a t i o n , p r o p e r t i e s , k i n e t i c s , and mechanism. B i o t e c h n o l . Bioeng. 19:959-981. 64. Gong, C.S., M.R. L a d i s c h , and G.T. Tsao. 1979. B i o s y n t h e s i s , p u r i f i c a t i o n , and mode of a c t i o n of c e l l u l a s e s of Tr ichoderma reese i . Adv. Chem. Ser. 181:261-287. 65. Guo, L.H., and R. Wu. 1982. New r a p i d methods f o r DNA sequencing based on exonuclease III d i g e s t i o n f o l l o w e d by r a p a l r s y n t h e s i s . Nucl. Acids Res. 10:2065-2084. 66. Haggett, K.D., P.P. Gray, and N.W. Dunn. 1979. C r y s t a l l i n e c e l l u l o s e degradation by a s t r a i n of Cellulomonas and i t s mutant d e r i v a t i v e s . Eur. J . Appl. M i c r o b i o l . B i o t e c h n o l . 8: 183-190. 67. H a i g l e r , C.H., and M. Benziman. 1982. B i o g e n e s i s of c e l l u l o s e I m i c r o f i b r i l s occurs by c e l l - d i r e c t d s e l f -assembly ln Acetobacter xylinum. In: C e l l u l o s e and Other Natural Systems. (R.C. Brown, J r . , ed.). Plenum P r e s s , N.Y., pp. 273-297. 68. H a l l , D.O. 1983. Biomass f o r e n e r g y - f u e l s now and In the f u t u r e . In: Biomass u t i l i z a t i o n (W.A. Cote, e d . ) . Plenum Press, N.Y., pp.1-22. 69. H a l l i w e l l * G. 1963. Measurement of c e l l u l a s e and f a c t o r s a f f e c t i n g i t s a c t i v i t y . In: Advances in Enzymlc H y d r o l y s i s of C e l l u l o s e and Rel a t e d M a t e r i a l s (E.T. Reese, ed.). Pergamon Press, N.Y., pp. 71-92. 14-9 70. H a l l i w e l l , G. 1978. C e l l u l o s i c m a t e r i a l s and t h e i r pre treatment. In: B i o c o n v e r s i o n of C e l l u l o s i c Substances into Energy, Chemicals and M i c r o b i a l P r o t e i n (T.K. Ghose, ed.). New D e l h i , IIT D e l h i , pp. 81-95. 71. H a l l i w e l l , G. 1979. M i c r o b i a l fi-glucanases. Progress in Ind. M i c r o b i o l . 15:1-60. 72. H a l l i w e l l , G., and M. G r i f f i n . 1973. The nature and mode of a c t i o n of the c e l l u l o l y t i c component C i of Tr ichoderma  kon ing i i on na t i v e c e l l u l o s e . Biochem. J . 135:587-594. 73. Han, Y.W., and C D . C a l l l h a n . 1974. C e l l u l o s e fermentation: e f f e c t of s u b s t r a t e pretreatment on m i c r o b i a l growth. Appl. M i c r o b i o l . 27:159-169. 74. Hash, J.H., and K.W. King. 1958. On the nature of the fi-g l ucos Idases of Myrothec1um v e r r u c a r i a . J . B i o l . Chem. 232: 381-393. 75. Hawley, D.K., and W.R. McClure. 1983. Compilation and a n a l y s i s of Escher ich i a c o l i promoter DNA sequences. Nucl. Acids Res. 11:2237-2255. 76. Henikoff, S. 1984. U n i d i r e c t i o n a l d i g e s t i o n with exonuclease III c r e a t e s t a r g e t e d breakpoints f o r DNA sequencing. Gene 28: 351-359. 77. H i l l m e r , P., and H. Gest. 1977. H2 metabolism in the p h o t o s y n t h e t i c bacterium Rhodopseudomonas c a p s u l a t a : H2 pro d u c t i o n by growing c u l t u r e s . J . B a c t e i o l . 129:724-731. 78. Hinnen, A., J.B. Hicks, and G.R. Fink. 1978. Transformation of yeast. Proc. N a t l . Acad. S c i . U.S.A. 75:1929-1933. 79. Hinnen, A., and B. Meyhack. 1982. Vectors f o r c l o n i n g i n yeast. Curr. Top. M i c r o b i o l . Immunol. 96:101-117. 80. H i t c h n e r , E.V., and J.M. Leatherwood. 1980. Use of a c e l l u l a s e - d e r e p r e s s e d mutant of Cellulomonas in the pr o d u c t i o n of a s i n g l e - c e l l p r o t e i n product from c e l l u l o s e . Appl. E n v i r o n . M i c r o b i o l . 39:382-386. 81. H o l l e n b e r g , C P . 1982. Clo n i n g with 2-tfm DNA v e c t o r s and the e x p r e s s i o n of f o r e i g n genes in Saccharomyces  cerev i s l a e . Curr. Top. M i c r o b i o l . Immunol. 96: 1 19-144. 82. H o l t , J.E. ( e d . ) . 1979. Cellulomonas. In: The S h o r t e r Bergey's Manual of Determinative B a c t e r i o l o g y , 8 t h edn. The W i l l i a m & w i l k i n s Co., Ba l t i m o r e , p. 232. 1 5 0 8 3 . H s i a o , C . L . , a n d C a r b o n , J . 1 9 7 9 . H i g h - f r e q u e n c y t r a n s f o r m a t i o n o f y e a s t b y p l a s m i d s c o n t a i n i n g t h e c l o n e d y e a s t ARG4 g e n e . P r o c . N a t l . A c a d . S c i . U . S . A . 7 6 _ : 3 8 2 9 -3 8 3 3 . 8 4 . H u d s o n , L . , a n d F . C . H a y . 1 9 7 6 . P r a c t i c a l I m m u n o l o g y . B l a c k w e l l S c i e n t i f i c P u b l i c a t i o n s , O x f o r d . 8 5 . H u m p h r e y , A . E . 1 9 7 9 . The h y d r o l y s i s o f c e l l u l o s i c m a t e r i a l s t o u s e f u l p r o d u c t s . A d v . C h e m . S e r . 1 8 1 : 2 5 - 5 3 . 8 6 . I n o u y e , M . , a n d S . H a l e g o u a . 1 9 8 0 . S e c r e t i o n a n d m e m b r a n e l o c a l i z a t i o n o f p r o t e i n s i n E s c h e r i c h i a c o l i . CRC C r i t . R e v . B i o c h e m . 7 : 3 3 9 - 3 7 1 . 8 7 . I t o , H . , Y . F u k u d a , K . M u r a t a , a n d A . K i m u r a . 1 9 8 3 . T r a n s f o r m a t i o n o f i n t a c t y e a s t c e l l s t r e a t e d w i t h a l k a l i c a t i o n s . J . B a c t e r i o l . 1 5 3 : 1 6 3 - 1 6 8 . 8 8 . I v a r i e , R . D . a n d P . P . J o n e s . 1 9 7 9 . A r a p i d , s e n s i t i v e a s s a y f o r s p e c i f i c p r o t e i n s y n t h e s i s i n c e l l s a n d c e 1 1 -f r e e t r a n s l a t i o n : u s e o f S t a p h y l o c o c c u s a u r e u s a s a n a d s o r b e n t f o r immune c o m p l e x e s . A n a l . B i o c h e m . 9 7 : 2 4 - 3 5 . 8 9 . J a n s h e k a r , H . , a n d A . F i e c h t e r . 1 9 8 3 . l i g n i n : b i o s y n t h e s i s , a p p l i c a t i o n , a n d b i o d e g r a d a t i o n . A d v . B i o c h e m . E n g . 2 7 : 1 1 9 - 1 7 8 . 9 0 . J o h n s o n , J . A . , W . K . R . W o n g , a n d J . T . B e a t t y . 1 9 8 6 . E x p r e s s i o n o f c e l l u l a s e g e n e s i n R h o d o b a c t e r c a p s u l a t u s b y u s e o f p l a s m i d e x p r e s s i o n v e c t o r s . J . B a c t e r i o l . , 1 6 7 : 6 0 4 - 6 1 0 . 9 1 . J o n e s , E . 1 9 7 7 . P r o t e i n a s e m u t a n t s o f S a c c h a r o m v c e s c e r e v i s i a e . G e n e t i c s 8 5 : 2 3 - 3 3 . 9 2 . K e h o e , M . , R . S e l l w o o d , P . S h i p l e y , a n d G . D o u g a n . 1 9 8 1 . G e n e t i c a n a l y s i s o f K 8 8 - m e d i a t e d a d h e s i o n o f e n t e r o t o x i g e n i c E s c h e r i c h i a c o l i . N a t u r e ( L o n d o n ) 291 : 1 2 2 - 1 2 6 . 9 3 . K e n n e d y , N . , L . B e u t i n , M . A c h t m a n , R. S k u r r a y , U . R a h m s d o r f , a n d P . H e r r i i c h . 1 9 7 7 . C o n j u g a t i o n p r o t e i n s e n c o d e d b y t h e F s e x f a c t o r . N a t u r e ( L o n d o n ) 2 7 0 : 5 8 0 - 5 8 5 . 9 4 . K e s s l e r , S . W . 1 9 7 5 . R a p i d i s o l a t i o n o f a n t i g e n s f r o m c e l l s w i t h a s t a p h y l o c o c c a l p r o t e i n A - a n t i b o d y a d s o r b e n t : p a r a m e t e r s o f t h e i n t e r a c t i o n o f a n t i b o d y - a n t i g e n c o m p l e x e s w i t h p r o t e i n A . J . I m m u n o l . 1 1 5 : 1 6 1 7 - 1 6 2 4 . 1 5 1 9 5 . K i m , B . H . , a n d J . W . T . W i m p e n n y . 1 9 8 1 . S C P p r o d u c t i o n f r o m d o m e s t i c r e f u s e p a p e r f r a c t i o n s u s i n g t h e c e l l u l o l y t i c b a c t e r i u m C e 1 1 u 1 o m o n a s f l a v i g e n a . J . F e r m e n t . T e c h n o l . 5 9 : 2 7 5 - 2 8 0 . 9 6 . K i n g , K . W . , a n d M . I . V e s s a l . 1969. E n z y m e s o f t h e c e l l u l a s e c o m p l e x . A d v . C h e m . S e r . 9 5 : 7 - 2 5 . 9 7 . K l u p f e l , D . , L . B i r o n , a n d I . I s h a q u e . 1 9 8 0 . S i m u l t a n e o u s p r o d u c t i o n o f c e l l u l a s e c o m p l e x a n d g l u c o s e i s o m e r a s e b y S t r e p t o m v c e s f l a v o g r i s e u s . B i o t e c h n o l . L e t t . 2 _ : 3 0 9 - 3 1 4 . 9 8 . K o o i m e n , P . , P . A . R o e l o f s e n , a n d S . S w e e r i s . 1 9 5 3 . Some p r o p e r t i e s o f c e l l u l a s e f r o m M y r o t h e c i um v e r r u c a r i a . E n z y m o l o g i a . l _ 6 : 2 3 7 - 2 4 6 . 9 9 . K r e i 1 , G . 1 9 8 1 . T r a n s f e r o f p r o t e i n s a c r o s s m e m b r a n e s . A n n . R e v . B i o c h e m . 5 0 : 3 1 7 - 3 4 8 . 1 0 0 . K r i s t i a n s e n , T . 1 9 7 8 . M a t r i x - b o u n d a n t i g e n s a n d a n t i b o d i e s . I n : A f f i n i t y c h r o m a t o g r a p h y ( 0 . H o f f m a n n -o s t e n h o f , M . B r e i t e n b a c h , F . K o l l e r , D. K r a f t , a n d 0 . S c h e i n e r , e d s . ) . P e r g a m o n P r e s s , O x f o r d , p p . 1 9 1 - 2 0 6 . 1 0 1 . L a n g s f o r d , M . L . , N . R . G i l k e s , W . W . W a k a r c h u k , D . G . K i l b u r n , R . C . M i l l e r , J r . , a n d R . A . J . W a r r e n . 1 9 8 4 . The c e l l u l a s e s y s t e m o f C e l l u l o m o n a s f i m i . J . G e n . M i c r o b i o l . 1 3 0 : 1 3 6 7 - 1 3 7 6 . 1 0 2 . L e e , Y . H . , a n d L . T . F a n . 1 9 8 0 . P r o p e r t i e s a n d mode o f a c t i o n o f c e l l u l a s e . A d v . B i o c h e m . E n g . 1 7 : 1 0 1 - 1 2 9 . 1 0 3 . L i , L . H . , R . M . F l o r a , a n d K . W . K i n g . 1 9 6 5 . I n d i v i d u a l r o l e s o f c e l l u l a s e c o m p o n e n t s d e r i v e d f r o m T r i c h o d e r m a  v i r i d e . A r c h . B i o c h e m . B i o p h y s . I l l : 4 3 9 - 4 4 7 . 1 0 4 . M a c l a c h l a n , G . A . 1 9 7 6 . A p o t e n t i a l r o l e f o r e n d o - c e 1 1 u l a s e I n c e l l u l o s e b i o s y n t h e s i s . A p p l . P o l y m . S y m p . 28. : 6 4 5 - 6 5 8 . 1 0 5 . M a c l e r , B . A . , R . A . P e l r o y , a n d J . A . B a s s h a m . 1 9 7 9 . H y d r o g e n f o r m a t i o n i n n e a r l y s t o i c h i o m e t r i c a m o u n t s f r o m g l u c o s e b y a R h o d o p s e u d o m o n a s s p h a e r o i d e s m u t a n t . J . B a c t e r i o l . 1 3 8 : 4 4 6 - 4 5 2 . 1 0 6 . M a d i g a n , M . , S . S . C o x , a n d R . A . S t e g e m a n . 1 9 8 4 . N i t r o g e n f i x a t i o n a n d n i t r o g e n a s e a c t i v i t i e s i n m e m b e r s o f t h e f a m i l y R h o d o s p i r a l l a c e a e . J . B a c t e r i o l . 1 5 7 : 7 3 - 7 8 . 1 0 7 . M a n d e l s , M . 1 9 7 5 . M i c r o b i a l s o u r c e s o f c e l l u l a s e . B i o t e c h n o l . & B i o e n g . S y m p . 5 : 8 1 - 1 0 5 . 1 0 8 . M a n d e l s , M . 1 9 8 2 . C e l l u l a s e s . A n n . R e p t . F e r m . P r o c . j 3 : 3 5 -7 8 . 1 5 2 109. Mandels, M., R. A n d r e o t t i , and C. Roche. 1976. Measurement of s a c c h a r i f y i n g c e l l u l a s e . B i o t e c h n o l . & Bioeng. Symp. 6:21-33. 110. Mandels, M., and E.T. Reese. 1963. I n h i b i t i o n of c e l l u l a s e s and 6- g l u c o s i d a s e s . In: Advances in Enzymic H y d r o l y s i s of C e l l u l o s e and Related M a t e r i a l s (E.T. Reese, ed.). Pergamon Press, N.Y., pp. 115-157. 111. Mandels, M., and E.T. Reese. 1964. Fungal c e l l u l a s e s and the m i c r o b i a l decomposition of c e l l u l o s i c f a b r i c . Develop. Ind. M i c r o b i o l . 5:5-20. 112. Mandels, M., and J . Weber. 1969. The p r o d u c t i o n of c e l l u l a s e s . Adv. Chem. Ser. 95:391-414. 113. M a n i a t l s , T., E.F. F r i t s c h , and J . Sambrook. 1982. Molecular C l o n i n g : a Labo r a t o r y Manual. Cold S p r i n g Harbor Laboratory. Cold S p r i n g Harbor, N.Y. 114. Maxam, A.M., and W. G i l b e r t . 1977. A new method f o r sequencing DNA. Proc. N a t l . Acad. S c i . U.S.A. 7_i: 560-564. 115. Maxam, A.M., and W. G i l b e r t . 1980. Sequencing e n d - l a b e l e d DNA with b a s e - s p e c i f i c chemical c l e a v a g e s . Methods Enzymol. 65:499-560. 116. McNeil, J.B., and J.D. F r i e s e n . 1981. E x p r e s s i o n of the Herpes s1mplex v i r u s thymidine kinase gene in Saccharomyces c e r e v i s iae• Mol. Gen. Genet. 184:386-393. 117. Messing, J . 1979. A multipurpose c l o n i n g system based on the s i n g l e - s t r a n d e d DNA bacteriophage M13. Recombinant DNA T e c h n i c a l B u l l e t i n , NIH P u b l i c a t i o n No. 79-99. V o l . 2, No. 2, pp. 43-48. 118. Messing, J . 1983. New M13 v e c t o r s f o r c l o n i n g . Methods Enzymol. 101:20-79. 119. M i l l e r , G.L., and R. B I r z a l l s . 1961. Carboxymethyl c e l l u l a s e and c e l l o p e n t a s e a c t i v i t i e s of e l e c t r o p h o r e t i c f r a c t i o n s of c e l l u l a s e . Arch. Biochem. Biophys. 95:19-24. 120. M i l l e r , G.L., R. Blum, W.E. Glennon, and A.L. Burton. 1960. Measurement of carboxymethylce11ulase a c t i v i t y . Anal. Biochem. 2:127-132. 121. M i l l e r . J.H. 1972. Experiments i n Molecular G e n e t i c s . Cold Spring Harbor Laboratory, Cold S p r i n g Harbor, N.Y. 1 5 3 122. M i l l e t , J . , D. Petre, P, Beguin, 0. Raynaud, and J.P. Aubert. 1985. Cloning of ten d i s t i n c t DNA fragments of C l o s t r i d i u m thermocellum coding f o r c e l l u l a s e s . FEMS M i c r o b i o l . L e t t . 29:145-149. 123. M i l l e t t , M.A., A.J. Baker, and L.D. S a t t e r . 1975. Pretreatments to enhance chemical, enzymatic, and m i c r o b i o l o g i c a l a t t a c k of c e l l u l o s i c m a t e r i a l s . B i o t e c h n o l . & Bioeng. Symp. 5:193-219. 124. M i l l e t t , M.A., M.J. E f f l a n d , and D.F. C a u l f l e l d . 1979. Influence of f i n e g r i n d i n g on the h y d r o l y s i s of c e l l u l o s i c m a t e r i a l s - a c i d vs. enzymatic. Adv. Chem. Ser. 181:71-89. 125. Mlsra, T.K. 1985. A new s t r a t e g y to c r e a t e ordered d e l e t i o n s f o r r a p i d n u c l e o t i d e sequencing. Gene 34:263-268. 126. Moran, J r . , C. P., N. Lang, S.F.J. L e G r i c e , G. Lee, M. Stephens, A. L. Sonenshein, J . Pero, and R. L o s l c k . 1982. Nucleotide sequences that s i g n a l the i n i t i a t i o n of t r a n s c r i p t i o n and t r a n s l a t i o n in Bac111 us subt i 1 i s. Mol. Gen. Genet. 186:339-346. 127. M u l l i n g s , R. 1985. Measurement of s a c c h a r i f i c a t i o n by c e l l u l a s e s . Enzyme Microb. Technol. 7:586-591. 128. Neidhardt, R.C., R. Wirth, M.W. Smith, and R.A. VanBogelen. 1980. S e l e c t i o n s y n t h e s i s of plasm id-coded p r o t e i n s by E s c h e r i c h i a c o l i d u r i n g r e c o v e r y from chloramphenicol treatment. J . B a c t e r i o l . 143:535-537. 129. Nguyen, T.T., K. P o s t l e , and K.P. Ber t r a n d . 1983. Sequence homology between the t e t r a c y c l i n e - r e s i s t a n c e determinants of TnlO and pBR322. Gene 25:83-92. 130. Norkrans, B. 1950. Influence of c e l l u l o l y t i c enzymes from Hymenomycetes on c e l l u l o s e p r e p a r a t i o n s of d i f f e r e n t c r y s t a l 1 i n i t y . Physio. P l a n t . 3:75-87. 131. Norrander, J . , T. Kempe, and J . Messing. 1983. Improved M13 ve c t o r s using o l i g o n u c l e o t i d e - d i r e c t e d mutagenesis. Gene 26:101-106. 132. Nossal, N.G., and L.A. Heppel. 1966. The r e l e a s e of enzymes by osmotic shock from EscherIch i a c o l i In exponential phase. J . B i o l . Chem. 241:3055-3062. 133. Nummi, M., M.L. Nlku-Paavola, T.M. E n a r i , and V. Raunio. 1980. Immunoelectrophoretic d e t e c t i o n of c e l l u l a s e s . FEBS L e t t . 113:164-166. 154 1 3 4 . O ' C a l l a g h a n , C . H . , A . M o r r i s , S . M . K i r b y , a n d A . H . S h i n g l e r . 1 9 7 2 . N o v e l m e t h o d f o r d e t e c t i o n o f fi-lactamase b y u s i n g a c h r o m o g e n i c c e p h a l o s p o r i n s u b s t r a t e . A n t i m i c r o b . A g . C h e m o t h e r . l . : 2 8 3 - 2 8 8 . 1 3 5 . O l d , R . W . , a n d S . B . P r i m r o s e . 1 9 8 5 . P l a s m i d s a s c l o n i n g v e h i c l e s f o r u s e i n E.. c o l i . I n : P r i n c i p l e s o f G e n e M a n i p u l a t i o n : a n I n t r o d u c t i o n t o G e n e t i c E n g i n e e r i n g , 3 e d n . B l a c k w e l l S c i e n t i f i c P u b l i c a t i o n s , L o n d o n , p p . 4 7 -7 3 . 1 3 6 . O ' N e i l l , P . 1 9 8 1 . S t u d i e s o n t h e i m m u n o s u p p r e s s i v e e f f e c t o f h u m a n a l p h a - f e t o p r o t e i n o n c e 1 1 - m e d i a t e d immune r e a c t i o n s i_n v i t r o . M. S c . T h e s i s , M c G i l l U n i v e r s i t y . M o n t r e a l , Q u e b e c . 1 3 7 . O ' N e i l l , G . , S . H . G o h , R . A . J . W a r r e n , D . G . K i l b u r n , a n d R . C . M i l l e r , J r . 1 9 8 6 . S t r u c t u r e o f t h e g e n e e n c o d i n g t h e e x o g l u c a n a s e o f C e 1 1 u 1 o m o n a s f i m i . G e n e 1 4 : 3 2 5 - 3 3 0 . 1 3 8 . P e d e n , K . W . C . 1 9 8 3 . R e v i s e d s e q u e n c e o f t h e t e t r a c y c l i n e -r e s i s t a n c e g e n e o f p B R 3 2 2 . G e n e 2 2 : 2 7 7 - 2 8 0 . 1 3 9 . P h i l l i p s , J . A . , a n d A . E . H u m p h r e y . 1 9 8 3 . P r o c e s s t e c h n o l o g y f o r t h e b i o l o g i c a l c o n v e r s i o n o f 1 i g n o c e l l u l o s i c m a t e r i a l s t o f e r m e n t a b l e s u g a r s a n d a l c o h o l s . I n : Wood a n d A g r i c u l t u r a l R e s i d u e s - R e s e a r c h o n Use f o r F e e d , F u e l s , a n d C h e m i c a l s ( J . S l o t e s , e d . ) . A c a d e m i c P r e s s , p p . 5 0 3 - 5 2 8 . 1 4 0 . P h i l l i p s , J . A . , a n d A . E . H u m p h r e y . 1 9 8 3 . A n o v e r v i e w o f p r o c e s s t e c h n o l o g y f o r t h e p r o d u c t i o n o f l i q u i d f u e l s a n d c h e m i c a l f e e d s t o c k s v i a f e r m e n t a t i o n . I n : O r g a n i c C h e m i c a l s f r o m B i o m a s s ( D . L . W i s e , e d . ) . The B e n j a m i n / C u m m i n g s P u b l i s h i n g C o m p a n y , M e n l o P a r k , C a l i f o r n i a , p p . 2 4 9 - 3 0 4 . 1 4 1 . P i g m a n , W. 1 9 6 3 . I n t r o d u c t o r y r e m a r k s . I n : A d v a n c e s i n E n z y m i c H y d r o l y s i s o f C e l l u l o s e a n d R e l a t e d M a t e r i a l s ( E . T . R e e s e , e d . ) . P e r g a m o n p r e s s , N . Y . , p p . x i - x i i . 1 4 2 . P u r i , V . P . 1 9 8 4 . E f f e c t o f c r y s t a l 1 i n i t y a n d d e g r e e o f p o l y m e r i z a t i o n o f c e l l u l o s e o n e n z y m a t i c s a c c h a r i f i c a t i o n . B i o t e c h n o l . B i o e n g . 2 6 : 1 2 1 9 - 1 2 2 2 . 1 4 3 . R e e s e , E . T . 1 9 6 9 . E s t i m a t i o n o f e x o - f i - 1 - 4 - g l u c a n a s e i n c r u d e c e l l u l a s e s o l u t i o n s . A d v . C h e m . S e r . 9 5 . : 2 6 - 3 3 . 1 4 4 . R e e s e , E . T . 1 9 7 5 . S u m m a r y s t a t e m e n t o n t h e e n z y m e s y s t e m . B i o t e c h n o l . & B i o e n g . S y m p . 5 : 7 7 - 8 0 . 155 145. Reese, E.T. 1976. H i s t o r y of the c e l l u l a s e program at the U.S. Army Natick development c e n t e r . B i o t e c h n o l . & Bioeng. Symp. 6:9-20. 146. Reese, E.T. and H.S. Levlnson. 1952. A comparative study of the breakdown of c e l l u l o s e by microorganisms. Physio. Plantarum. 5:345-366. 147. Reese, E.T., and M. Mandels. 1984. R o l l i n g with the times: production and a p p l i c a t i o n s of Tr ichoderma reese 1 c e l l u l a s e . Ann. Rept. Ferm. Proc. 7:1-20. 148. Reese, E.T., R.G.H. S l u , and H.S. Levl n s o n . 1950. The b i o l o g i c a l d e g r a d a t i o n of s o l u b l e c e l l u l o s e d e r i v a t i v e s and i t s r e l a t i o n s h i p to the mechanism of c e l l u l o s e h y d r o l y s i s . J . B a c t e r i o l . 59:485-497. 149. Roberts, R.J. 1983. R e s t r i c t i o n and m o d i f i c a t i o n enzymes and t h e i r r e c o g n i t i o n sequences. Nucl. Acids Res. ]_i : r l 3 5 - r l 6 7 . 150. Roggenkamp, R., B. Kustermann-Kuhn, and C P . H o l l e n b e r g . 1981. E x p r e s s i o n and p r o c e s s i n g of b a c t e r i a l fi-lactamase in the yeast Saccharomyces cerev i s i a e . Proc. N a t l . Acad. S c i . U.S.A. 78:4466-4470. 151. Rosenberg, M., and D. Court. 1979. Regulatory sequences involved in the promotion and t e r m i n a t i o n of RNA t r a n s c r i p t i o n . Ann. Rev. Genet. 13:319-353. 152. Royer, J . C , and J.P. Nakas. 1983. P o t e n i a l s u b s t r a t e s f o r s i n g l e c e l l p r o t e i n p r o d u c t i o n . In: Biomass u t i l i z a t i o n (W.A. Cote, e d . ) . Plenum Press, N.Y., pp. 443-459. 153. Ryu, D.D.Y., and M. Mandels. 1980. C e l l u l a s e s : b i o s y n t h e s i s and a p p l i c a t i o n s . Enzyme Microb. Technol. 2:91-101. 154. Sacco, M., J . M i l l e t , and J.P. Aubert. 1984. Clo n i n g and expr e s s i o n in Saccharomyces cerev1s iae of a c e l l u l a s e gene from C l o s t r i d i u m thermoce Hum. Ann. M i c r o b i o l . ( I n s t . Pasteur) 135A:485-488. 155. Saddler, J.N., and Khan, A.W. 1980. C e l l u l a s e p r o d u c t i o n by Ace t i v i br i o ce11u1o1yt i c u s . Can. J . M i c r o b i o l . 26:760-765. 156. Sancar, A., A. Hack, and W.D. Rupp. 1979. A simple method fo r i d e n t i f i c a t i o n of plasmid coded p r o t e i n s . J . b a c t e r i o l . 137:692-693. 156 157. Sanger, F., S. N i c k l e n , and A.R. Coulson. 1977. DNA sequencing with c h a i n t e r m i n a t i n g i n h i b i t o r s . Proc. N a t l . Acad. S c i . U.S.A. 74:5463-5467. 158. S c h o t t e l , J . L., J . J . Sninsky, and S.N. Cohen. 1984. E f f e c t s of a l t e r a t i o n s in the t r a n s l a t i o n c o n t r o l r e g i o n on b a c t e r i a l gene e x p r e s s i o n : use of cat gene c o n s t r u c t s t r a n s c r i b e d from the l a c promoter as a model system. Gene 28:177-193. 159. S c h u l e i n , M., H.E. S c h i f t , P. Schneider, and C. Dambmann. 1981. Immunoelectrophoretic c h a r a c t e r i z a t i o n of c e l l u l o l y t i c enzymes from Trichoderma reese i • In: Bio c o n v e r s i o n and Biochemical E n g i n e e r i n g (T.K. Ghose, ed.), symposium 2, v o l . 1. IIT New D e l h i , pp. 97-105. 160. Schurz, J . 1978. How to make n a t i v e 1ignoce11u1osic m a t e r i a l s a c c e s s i b l e to chemical and m i c r o b i a l a t t a c k . In: B i o c o n v e r s i o n of C e l l u l o s i c Substances into Energy, Chemicals and M i c r o b i a l P r o t e i n (T.K. Ghose, e d . ). New D e l h i , IIT D e l h i , pp. 37-58. 161. S c o t t , J.F. 1982. Baker's yeast: a s u c c e s s f u l I n d u s t r i a l microorganism i s now a f a v o r a b l e host f o r molecular c l o n i n g . B a s i c L i f e Science 19:75-85. 162. Selby, K. 1961. The degra d a t i o n of c o t t o n c e l l u l o s e by the e x t r a c e l l u l a r c e l l u l a s e of Myrothec i um v e r r u c a r i a . Biochem. J . 79:562-566. 163. Sheldrake, A.R. 1970. C e l l u l a s e and c e l l d i f f e r e n t i a t i o n in Acer pseudoplatanus. P l a n t a 95:167-178. 164. Sherman, F., and C.W. Lawrence. 1974. Saccharomyces. In: Handbook of Genetics (R.C. King, e d.K Plenum Pr e s s , N.Y., pp. 359-393. 165. Shine, J . , and L. Dalgarno. 1974. The 3'-termlnal sequence of Escher i c h i a c o l i 16S ribosomal RNA: complementary to nonsense t r i p l e t s and rlbosome b i n d i n g s i t e s . Proc. N a t l . Acad. S c i . U.S.A. 71 : 1342-134.6. 166. S h i p l e y , P., G. Dougan, and S. Falkow. 1981. I d e n t i f i c a t i o n and c l o n i n g of the g e n e t i c determinant that encodes f o r the K88ac adherence a n t i g e n . J . B a c t e r i o l . 145:920-925. 167. Shoemaker, S., V. Schweickart, M. Ladner, D. Gelfand, S. Kwok, K, Myambo, and M. I n n i s . 1983. Molecular c l o n i n g of e x o - c e l l o b l o h y d r o l a s e I d e r i v e d from Tr ichoderma reese 1 s t r a i n L27. Biotechnology 1:691-696. 157 168. Skipper, N., M. Sutherland, R.W. Davies, D. K i l b u r n , R.C. M i l l e r , J r . , A. Warren, and R. Wong. 1985. S e c r e t i o n of a b a c t e r i a l c e l l u l a s e by yeast. Science 230:958-960. 169. Skipper, N., D.Y. Thomas, and P.C.K. Lau. 1983. C l o n i n g and sequencing of the p r e p r o t o x i n - c o d i n g r e g i o n of the yeast Ml double-stranded RNA. EMBO J . 3:107-111. 170. Smith, R.A., M.J. Duncan, and D.T. Moir. 1985. Heterologous p r o t e i n s e c r e t i o n from y e a s t . Science 229:1219-1224. 171. S o l t e s , E . J . 1983. C e l l u l o s e : e l u s i v e component of the p l a n t c e l l w a l l . In: Biomass u t i l i z a t i o n (W.A. Cote, ed.). Plenum Press, N.Y., pp. 271-298. 172. Southern, E.M. 1975. D e t e c t i o n of s p e c i f i c sequences among DNA fragments separated by g e l e l e c t r o p h o r e s i s . J . Mol. B i o l . 98:503-517. 173. Stackebrandt, E., and 0. Kandler. 1979. Taxonomy of the genus Cellulomonas, based on phenotypic c h a r a c t e r s and d e o x y r i b o n u c l e i c a c i d - d e o x y r i b o n u c l e i c a c i d homology, and proposal of seven neotype s t r a i n s . I n t . J . S y s t . B a c t e r i o l . 29:273-282. 174. Steege, D.A. 1977. 5'-Terminal n u c l e o t i d e sequence of E s c h e r i c h i a c o l i l a c t o s e r e p r e s s o r mRNA: f e a t u r e s of t r a n s l a t i o n a l i n i t i a t i o n and r e i n i t i a t i o n s i t e s . Proc. N a t l . Acad. S c i . U.S.A. 74:4163-4167. 175. Stewart, B.J., and J.M. Leatherwood. 1976. Derepressed s y n t h e s i s of c e l l u l a s e by Cellulomonas. J . B a c t e r i o l . 128:609-615. 176. Stoppok, W., P. Rapp, and F. Wagner. 1982. Formation, l o c a t i o n , and r e g u l a t i o n of endo-1,4-ft-glucanases and 6-g l u c o s i d a s e s from Cellulomonas uda. Appl. E n v i r o . M i c r o b i o l . 39:382-386. 177. Stuber, D., and H. Bujard. 1981. O r g a n i z a t i o n of t r a n s c r i p t i o n a l s i g n a l s In plasmids pBR322 and pACYC184. Proc. N a t l . Acad. S c i . U.S.A. 78:167-171. 178. S u t c l l f f e , J.G. 1979. Complete n u c l e o t i d e sequence of the E s c h e r i c h i a c o l i plasmid pBR322. Cold S p r i n g Harbor Symp. Quant. B i o l . 43:77-90. 179. Thayer, D.W., S.V. Lowther, and J.G. P h i l l i p s . 1984. C e l l u l o l y t i c a c t i v i t i e s of s t r a i n s of the genus Cellulomonas. I n t . J . S y s t . B a c t e r i o l . 34:432-438• 158 180. T a y l o r , D.P., S.N. Cohen, W.G. C l a r k , and B.L. Marrs. 1983. Alignment of g e n e t i c and r e s t r i c t i o n maps of the photo s y n t h e s i s r e g i o n of the Rhodopseudomonas c a p s u l a t a chromosome by a conjugation-mediated marker rescue technique. J . B a c t e r i o l . 154:580-590. 181. Teather, R.M., and P.J. Wood. 1982. Use of Congo r e d -p o l y s a c c h a r i d e i n t e r a c t i o n s in enumeration and c h a r a c t e r i z a t i o n of c e l l u l o l y t i c b a c t e r i a from bovine rumen. Appl. E n v i r o n . M i c r o b i o l . 43:777-780. 182. T e e r i , T., I. S a l o v u o r i , and J . Knowles. 1983. The molecular c l o n i n g of the major c e l l u l a s e gene from TrIchoderma reese1. Biotechnology 1:697-699. 183. T h e i l e r , R., F. Suter, V. Wiemken, and H. Zuber. 1984. The l i g h t - h a r v e s t i n g p o l y p e p t i d e s of Rhodopseudomonas  sphaero ides R-26.1. I. I s o l a t i o n , p u r i f i c a t i o n and sequence a n a l y s e s . Hoppe-Seyler*s Z. P h y s i o l . Chem. 365:703-719. 184. Thomas, R.J. 1983. Wood anatomy and p e r m e a b i l i t y . In: Wood and A g r i c u l t u r a l Residues-Research on Use f o r Feed, F u e l s , and Chemicals ( J . S l o t e s , e d . ) . Academic Pr e s s , N.Y., pp. 1-32. 185. Thompson, R., S.G. Hughes, and P. Broda. 1974. Plasmid I d e n t i f i c a t i o n using s p e c i f i c endonucleases. Mol. Gen. Genet. 133:141-149. 186. Toyama, N. 1963. Degradation of f o o d s t u f f s by c e l l u l a s e and r e l a t e d enzymes. In: Advances in Enzymic H y d r o l y s i s of C e l l u l o s e and Related M a t e r i a l s (E.T. Reese, e d . ) . Pergamon Press, N.Y., pp. 235-253. 187. Toyama, N. 1969. A p p l i c a t i o n s of c e l l u l a s e s in Japan. Adv. Chem. Ser. 95:359-390. 188. Tsao, G.T., M. L a d i s c h , C. L a d i s c h , T.A. Hsu, B. Dale, and T. Chou. 1978. Fermentation s u b s t r a t e s from c e l l u l o s i c m a t e r i a l s : p r o d u c t i o n of fermentable sugars from c e l l u l o s i c m a t e r i a l s . Ann. Rept. Ferm. Proc. _2:1 — 21 -189. T y l e r , J . and D.J. S h e r r a t t . 1975. S y n t h e s i s of E c o l i c i n s in E s c h e r i c h i a c o l i . Mol. Gen. Genet. 140:349-353. 190. U n d e r k o f l e r , 1963. A p p l i c a t i o n s f o r c e l l u l a s e s . In: Advances In enzymic h y d r o l y s i s of c e l l u l o s e and r e l a t e d m a t e r i a l s (E.T. Reese, e d . ) . Pergamon Press, N.Y., pp. 255-256. 191. Van Soest, P.J. 1969. Composition, maturity and the n u t r i t i o n value of forages. Adv. Chem. Ser. 95:262-278. 159 192. van T i l b e u r g h , H., M. Claeyssens, and C.K. de Bruyne. 1982. The use of 4-methylumbe11ifery1 and other chromophorlc g l y c o s i d e s in the study of c e l l u l o l y t i c enzymes. FEBS L e t t . 149:152-156. 193. Verma, D.P.S., V. Kumar, and G.A. Maclachlan. 1982. fi-glucanases in higher p l a n t s : l o c a l i z a t i o n , p o t e n t i a l f u n c t i o n s , and r e g u l a t i o n . In: C e l l u l o s e and Other Natural Polymer Systems (R.B. Brown, J r . , e d . ) . Plenum Press, N.Y., pp. 459-488. 194. Wakarchuk, W.W., D.G. K i l b u r n , R.C. M i l l e r , J r . , and R.A.J. Warren. 1984. The p r e l i m i n a r y c h a r a c t e r i z a t i o n of the ft-glucosldases of Ce11ulomonas f1m i . J . Gen. M i c r o b i o l . 130:1385-1389. 195. Watson, M.E.E. 1984. Compi l a t i o n of p u b l i s h e d s i g n a l sequences. Nucl. Acids Res. 12:5145-5164. 196. Weaver, P.F., J.D. Wa l l , and H. Gest. 1975. C h a r a c t e r i z a t i o n of Rhodopseudomonas c a p s u l a t a . Arch. M i c r o b i o l . 105:207-216. 197. Weber, M., M.J. F o g l i e t t i , and F. Percheron. 1980. A f f i n i t y chromatography of a c e l l u l a s e complex from TrIchoderma v i r ide on c r o s s - l i n k e d c e l l u l o s e . J . Chromatog. 188:377-382. 198. Weimer, P.J., and J.G. Z e i k u s . 1977. Fermentation of c e l l u l o s e and c e l l o b i o s e by C l o s t r i d i u m thermoceHum in the absence and presence of Methanobacter ium  thermoautotrophleum. Appl. E n v i r o n . M i c r o b i o l . 33:289-297. 199. Whitaker, D.R. 1963. C r i t e r i a f o r c h a r a c t e r i z i n g c e l l u l a s e s . In: Advances in Enzymic H y d r o l y s i s of C e l l u l o s e and Related M a t e r i a l s (E.T. Reese, e d . ) . Pergamon Press, N.Y., pp.51-70. 200. White, A.R. 1982. V i s u a l i z a t i o n of c e l l u l a s e s and c e l l u l o s e d e g r a d a t i o n . In: C e l l u l o s e and Other Nat u r a l Polymer Systems (R.B. Brown, J r . , ed.). Plenum Pr e s s , N.Y., pp. 489-509. 201. W h i t t l e , D.J., D.G. K i l b u r n , R.A.J. Warren, and R.C. M i l l e r , J r . 1982. Molecular c l o n i n g of a Cellulomonas  f i m1 c e l l u l a s e gene In E s c h e r I c h l a c o l I. Gene 17: 139-145. 202. Wlckner, W.T., and H.F. L o d i s h . 1985. M u l t i p l e mechanisms of p r o t e i n i n s e r t i o n into and acr o s s membranes. Science 230:400-407. 160 203. Wong, W.K.R. 1982. The Isolation and partial characterization of plasmids from twenty-eight strains of Pse udomonas ac idovorans. M. Sc. Thesis, University of Regina. Regina, Saskatchewan. 204. Wong, W.K.R.,, B. Gerhard, Z.M. Guo, D.G. Kilburn, R.A.J. Warren, and R.C. Miller, Jr. 1986. Characterization and structure of an endoglucanase gene cenA of Ce11ulomonas limi. Gene 44:315-324. 205. Wood, T.M. 1975. Properties and mode of action of cellulases. Biotechnol. & Bioeng. Symp. _5 : 1 11 — 1 37 . 206. Wood, T.M., and S.I. McCrae. 1972. The purification and properties of the C component of Tr ichoderma kon ingi i cellulase. Biochem. J . 128:1183-1192. 207. Wood, T.M., and S.I. McCrae. 1978. The mechanism of cellulase action with particular reference to the C i component. In: Bioconversion of Cellulosic Substances into Energy, Chemicals and Microbial Protein (T.K. Ghose, ed.). New Delhi, IIT Delhi, pp. 111-141. 208. Wood, T.M., and S.I. McCrae. 1979. Synergism between enzymes involved in the solubilization of native cellulose. Adv. Chem. Ser. 181:181-209. 209. Wood, T.M., S.I. McCrae, and C.C. MacFarlane. 1980. The Isolation, purification and properties of the ce1 lobiohydrolase component of Penici11ium funiculosum cellulase. Biochem. J . 189:51-65. 210. Yamane, K., H. Suzuki, and K. Nisizawa. 1970. Purification properties of extracellular and cell-bound cellulase components of Pseudomonas fluorescens var. eellulosa. J . Biochem. (Tokyo) 67:19-35. 211. Yanisch-Perron, C , J . Vieira, and J . Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119. 212. Zubay, G., D.A. Chambers, and L.C. Cheong. 1970. Cell-free studies on the regulation of the lac operon. In: The Lactose Operon. Cold Spring Harbor, N.Y., pp. 375-391. 161 6. Appendices 162 Appendix I Glucose standard curve F i g . 36. Glucose standard curve f o r the d e t e r m i n a t i o n of CMCase a c t i v i t y . The curve was prepared by p l o t t i n g flmol of glucose versus A 5 3 0 determined by the DNS assay (120). ON yumol glucose equivalents Appendix II Protein standard curve Fig . 37. Standard curve of bovine Y-globulln (Bio-Rad protein standard I) for the determination of protein concentration. The curve was prepared according to the procedure of Bradford (ref. 19). 0.7-1 4.97 9.94 14.91 19.88 24.85 29.82 34.79 39.76 44.73 49.70 54.67 yUg Protein 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097344/manifest

Comment

Related Items