UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Mutational analysis of the transcript 3' end signal of the CYC1 gene of yeast Spence, Andrew Michael 1985

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1986_A1 S63.pdf [ 17.15MB ]
Metadata
JSON: 831-1.0097328.json
JSON-LD: 831-1.0097328-ld.json
RDF/XML (Pretty): 831-1.0097328-rdf.xml
RDF/JSON: 831-1.0097328-rdf.json
Turtle: 831-1.0097328-turtle.txt
N-Triples: 831-1.0097328-rdf-ntriples.txt
Original Record: 831-1.0097328-source.json
Full Text
831-1.0097328-fulltext.txt
Citation
831-1.0097328.ris

Full Text

MUTATIONAL ANALYSIS OF THE TRANSCRIPT 3 ' END SIGNAL OF THE CYC1 GENE OF YEAST By Andrew M ichae l Spence B.Sc.(4 y r . ) , The U n i v e r s i t y of Winn ipeg , 1980 A T h e s i s Submi t ted i n P a r t i a l F u l f i l l m e n t of the Requirements f o r the Degree of Doctor of Ph i l osophy , ; i n The F a c u l t y of Graduate S tud ies Department of B iochemis t r y We accept t h i s t h e s i s as conforming t o the r e q u i r e d s tandard THE UNIVERSITY OF BRITISH COLUMBIA November 1985 @ Andrew M ichae l Spence, 1985 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make i t freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of 8 .' o c M ^ ^ \ , si, The University of British Columbia 2075 Wesbrook Place Vancouver, Canada V6T 1W5 D a t e Afr>( ^ i r C I O / - 7 Q \ ABSTRACT T h i s t h e s i s d e s c r i b e s an at tempt t o d e f i n e the n u c l e o t i d e sequences i n v o l v e d i n s p e c i f y i n g the l o c a t i o n of the 3 ' ends of t r a n s c r i p t s of the CYCl gene of the yeas t Saccharomyces c e r e v i s i a e . The boundar ies o f t he 3 ' end s i g n a l were d e f i n e d w i t h the a i d o f two s e t s of p lasmid-borne d e l e t i o n v a r i a n t s of C Y C l . Mutants i n each s e t l acked sequences ex tend ing f o r v a r y i n g d i s t a n c e s toward the CYCl t r a n s c r i p t 3 ' end s i t e f rom a f i x e d s i t e e i t h e r upstream o r downstream. The p r o p e r t i e s o f yeas t s t r a i n s c a r r y i n g t h e a l t e r e d genes suggested t h a t the CYCl 3 ' end s i g n a l occup ied no more than 50 base p a i r s , 119-168 base p a i r s downstream of t he cod ing sequence and t h e r e f o r e immediate ly upstream o f the 3 ' end s i t e i t s e l f . A fragment c a r r y i n g the i n t a c t 3 ' end s i g n a l was i n s e r t e d between the CYCl promoter and the E . c o l i l acZ gene on an a u t o n o m o u s l y - r e p l i c a t i n g p l asm id c a l l e d a p A l l p l a s m i d . Sequences w i t h i n the i n s e r t e d fragment were capab le of supp ress ing the e x p r e s s i o n of l acZ f rom the p l asm id i n y e a s t . The d i s t a l boundary of sequences r e s p o n s i b l e f o r t h i s e f f e c t c o i n c i d e d w i t h the d i s t a l boundary o f the 3 ' end s i g n a l i t s e l f . I t e n t a t i v e l y conc luded t h a t the suppress ion of l acZ e x p r e s s i o n depended on 3 ' end s i g n a l f u n c t i o n . Mu ta t i ons were i n t roduced throughout t he 3 ' end s i g n a l u s i n g a new procedure of i n v i t r o mutagenesis r e l y i n g on l i m i t e d p r imer ex tens ion on a gapped he te rodup lex and subsequent m i s i n c o r p o r a t i o n o f an e x c i s i o n - r e s i s t a n t a - t h i o n u c l e o t i d e . The mutant 3 ' end s i g n a l f ragments were i n t roduced i n t o p A l l p lasmids and assayed f o r t h e i r e f f e c t s on lacZ e x p r e s s i o n i n y e a s t . S e v e r a l . o f the p lasmids c a r r y i n g - i i -mutant f ragments suppor ted l a c Z e x p r e s s i o n a t g r e a t e r l e v e l s than the p a r e n t a l , " w i l d - t y p e " p l a s m i d , sugges t i ng t h a t the muta t ions i n t e r f e r e d w i t h 3 ' end s i g n a l a c t i v i t y . Those 3 ' end s i g n a l fragments which suppressed l acZ e x p r e s s i o n from p A l l p lasmids were a l s o capable of caus i ng the s y n t h e s i s o f t r unca ted c y c l t r a n s c r i p t s when i n s e r t e d i n t o a s i t e w i t h i n the CYCl cod ing sequence, i n d i c a t i n g t h a t they indeed r e t a i n e d 3 ' end s i g n a l a c t i v i t y . Those fragments which a l l owed e l e v a t e d l acZ e x p r e s s i o n from p A l l p lasmids d i d not cause p roduc t i on of t r unca ted c y c l t r a n s c r i p t s from analogous c o n s t r u c t s . These obse rva t i ons conf i rmed t h a t l acZ e x p r e s s i o n f rom a p A l l p l asm id c o u l d be a u s e f u l s c r e e n i n g d e v i c e f o r 3 ' end s i g n a l d e f e c t s . Seme 3 ' - ex tended t r a n s c r i p t s were produced f rom a l l o f the t r u n c a t e d genes sugges t i ng t h a t max imal ly e f f i c i e n t 3 ' end gene ra t i on r e q u i r e d sequences o u t s i d e the r e g i o n d e f i n e d by d e l e t i o n a n a l y s i s . F i v e o f s i x muta t ions t e s t e d wh ich i n t roduced GC base p a i r s i n t o the 3 ' end s i g n a l impa i red i t s a c t i v i t y , sugges t i ng t h a t a h i g h o v e r a l l AT con ten t may be an impor tan t f e a t u r e o f the 3 ' end s i g n a l . "Termina to r " sequences recogn i zed by Zare t and Sherman i n 1982 [ C e l l 28: 563-573] and Hen i ko f f and c o l l e a g u e s i n 1983 [ C e l l 33 : 607-614] indeed seem t o be i n v o l v e d i n 3 ' end gene ra t i on i n CYCl t r a n s c r i p t s , a l though n e i t h e r comp le te l y d e s c r i b e s the sequence requ i rements of the 3 ' end s i g n a l . - i i i -TABLE o f CONTENTS ABSTRACT i i LIST o f TABLES x i LIST o f FIGURES x i i ACKNOWLEDGEMENTS xv LIST of ABBREVIATIONS x v i Chapter I. INTRODUCTION 1 TRANSCRIPT 3 'END GENERATION: PERSPECTIVES 1 Why Have 3 ' End S i g n a l s ? 2 TRANSCRIPT 3 ' END GENERATION i n PRCCARYOTES 4 Factor - Independent T r a n s c r i p t Te rm ina t i on 4 Factor-Dependent T r a n s c r i p t Te rm ina t i on 5 3 ' End P r o c e s s i n g i n P roca ryo tes 7 T r a n s c r i p t Termina t ion as a R e g u l a t o r y Dev ice i n Procaryo tes 7 Rho-Dependent T r a n s c r i p t Te rm ina t i on and T r a n s l a t i o n a l P o l a r i t y 7 A n t i t e r m i n a t i o n i n Bac te r iophage Lambda 8 A n t i t e r m i n a t i o n i n rRNA Operons 10 A t t e n u a t i o n i n B a c t e r i a l B i o s y n t h e t i c Operons 11 TRANSCRIPT 3' END GENERATION i n EUCARYOTES 12 Large Ribosomal RNA Genes 12 Smal l Ribosomal and T r a n s f e r RNA Genes 15 Evidence f o r T r a n s c r i p t Te rm ina t ion 15 Termina t ion S i g n a l s f o r RNA Polymerase I I I 16 5S T r a n s c r i p t 3' End Gene ra t i on i n Other Systems 19 3 ' End Genera t ion i n tRNA T r a n s c r i p t i o n 19 Genes T r a n s c r i b e d by RNA Polymerase I I 23 - i v -3 ' - T e r m i n a l P o l y ( A ) , and the O r i g i n of E u c a r y o t i c mRNA 23 T r a n s c r i p t Te rm ina t i on v s . 3 ' End P r o c e s s i n g 27 Termina t ion S i t e s f o r RNA Polymerase I I T r a n s c r i p t i o n 31 Termina t ion S i g n a l s f o r RNA Polymerase I I 36 P o l y a d e n y l a t i o n S i g n a l s i n "H ighe r " Eucaryo tes 38 P o l y a d e n y l a t i o n i n C e l l - F r e e Systems 49 Nonpolyadeny la ted mRNA 55 S i g n a l s Requ i red f o r H i s tone mRNA 3 ' End Genera t ion 61 Ev idence f o r 3 ' End P r o c e s s i n g o f H is tone Gene T r a n s c r i p t s 65 H is tone T r a n s c r i p t Te rm ina t i on 68 The F u n c t i o n o f Po ly (A ) i n E u c a r y o t i c mRNA 69 3 ' End Genera t ion as a Regu la to r y Dev ice i n Eucaryo tes 77 C o n t r o l Over T r a n s c r i p t Termina t ion 78 C o n t r o l Over P o l y a d e n y l a t i o n S i t e S e l e c t i o n 81 Po ly (A) Sequences i n Yeas t mRNA 83 Chapter I I . MATERIALS AND METHODS 95 REAGENTS 95 Enzymes 95 O l i g o n u c l e o t i d e s 95 N u c l e o t i d e s 97 G a l a c t o s i d e s 97 Phenol 98 G l y o x a l 98 - v -Formamide 98 Formaldehyde 98 Agarose 98 Acry lamide 99 Components of C u l t u r e Media 99 Others 99 S u p p l i e s f o r Autorad iography 99 MICROBIAL STRAINS 99 B a c t e r i a 99 Yeas t 100 CULTURE MEDIA AND CONDITIONS 100 E . c o l i 100 Yeas t 101 PLASMIDS and BACTERIOPHAGE 102 TRANSFORMATION o f E . c o l i 102 ISOLATION o f PLASMID DNA from E . c o l i 104 L a r g e - S c a l e P lasm id I s o l a t i o n 105 T r i t o n L y s i s Procedure 105 A l k a l i n e L y s i s Procedure 106 P u r i f i c a t i o n of P lasm id DNA by Cesium C h l o r i d e Grad ien t C e n t r i f u g a t i o n 107 P lasmid " M i n i p r e p s " : T r i t o n Procedure 109 A l k a l i n e L y s i s Procedure 110 P r e p a r a t i o n o f P lasmid DNA f o r Sequencing 111 P r e p a r a t i o n o f Ml3 DNA 111 S i n g l e - S t r a n d e d Phage DNA 111 Clone O r i e n t a t i o n 113 - v i -P r e p a r a t i o n o f Ml3 RF 113 P r e p a r a t i o n o f S i n g l e - S t r a n d e d pA4 P lasmid DNA 114 S i l a n i z a t i o n of Con ta ine rs f o r Use w i t h N u c l e i c A c i d S o l u t i o n s 115 AGAROSE GEL ELECTROPHORESIS of DNA 116 E l e c t r o p h o r e s i s and Fragment P u r i f i c a t i o n Us ing LMP Agarose 116 ACRYLAMIDE GEL ELECTROPHORESIS 118 Autorad iography 120 RESTRICTION ENDONUCLEASE DIGESTION 120 PHOSPHATASE TREATMENT of DNA 123 LIGATIONS 123 L i n k e r L i g a t i o n s " 124 Assay ing L i n k e r L i g a t i o n and Removal 124 PLASMID CONSTRUCTIONS 125 C o n s t r u c t i o n of CYC1AH5' D e l e t i o n s 125 C o n s t r u c t i o n of YEp213CYCl&H5" P lasmids 127 C o n s t r u c t i o n of CYC1AK3' and CYC1&K5' D e l e t i o n s 128 C o n s t r u c t i o n of YEpl3CYClAK3" P lasmids 131 De te rm ina t ion o f A K 3 ' D e l e t i o n Endpoin ts 132 C o n s t r u c t i o n of pYeCYClAK5 ' /AK3 ' P lasmids (P romo te r /3 ' End S i g n a l Fus ions ) 132 C o n s t r u c t i o n of D e l e t i o n s i n mp l lCYC lT2 : The pA4 P lasmids 134 C o n s t r u c t i o n of p l acZ 136 C o n s t r u c t i o n o f YRp72, YRp73 138 C o n s t r u c t i o n of YEp73 139 - v i i -C o n s t r u c t i o n of pA5s 141 C o n s t r u c t i o n of pA6 P lasmids 143 C o n s t r u c t i o n o f pA7 P lasmids 145 C o n s t r u c t i o n o f pAlO P lasmids 145 C o n s t r u c t i o n of p A l l P lasmids 145 C o n s t r u c t i o n of mplOAl 147 C o n s t r u c t i o n of p A l l s C a r r y i n g P o i n t Mu ta t ions i n 3 ' End S i g n a l 149 C o n s t r u c t i o n of p A l 2 , pA l2A, and pAl2B P lasmids 150 OLIGONUCLEOTIDE-DIRECTED MUTAGENESIS 154 Sc reen ing f o r Muta t ions 157 T r a n s f e r o f O l i g o n u c l e o t i d e - M u t a g e n i z e d CYCl Genes t o Yeas t P lasmids 161 Sequence C o n f i r m a t i o n o f O l i g o n u c l e o t i d e - D i r e c t e d Muta t ions i n CYCl 162 SEGMENT-DIRECTED MUTAGENESIS 163 Annea l i ng 163 L i m i t e d Pr imer Ex tens ion on a Gapped Duplex 165 M i s i n c o r p o r a t i o n 166 Gap Repa i r 167 DNA SEQUENCING 168 Cha in Terminator Method 168 Pr imer :Templa te Annea l i ng 168 S i n g l e - S t r a n d e d Template 168 Double-St randed Template 169 Sequencing R e a c t i o n s 169 Sequencing by B a s e - S p e c i f i c Chemica l Cleavage 171 - v i i i -P u r i f i c a t i o n o f Fragments P r i o r t o Sequencing 171 B a s e - M o d i f i c a t i o n R e a c t i o n s 172 C R e a c t i o n 172 (C+T) R e a c t i o n 172 G R e a c t i o n 172 (A+G) R e a c t i o n 172 P u r i f i c a t i o n and H y d r o l y s i s o f M o d i f i e d DNA 172 TRANSFORMATION o f YEAST 173 ISOLATION Of YEAST RNA 175 RNA M i n i p r e p s 177 P r e p a r a t i o n o f Glassware and S o l u t i o n s f o r Hand l ing RNA 178 GEL ELECTROPHORESIS of RNA 179 E l e c t r o p h o r e s i s A f t e r Dena tu ra t ion w i t h G l y o x a l 179 E l e c t r o p h o r e s i s A f t e r Dena tu ra t ion w i t h Formaldehyde 179 T r a n s f e r of RNA t o N i t r o c e l l u l o s e 180 P r e h y b r i d i z a t i o n / H y b r i d i z a t i o n 180 R a d i o a c t i v e L a b e l l i n g o f a CYCl H y b r i d i z a t i o n Probe 181 QUANTITATIVE ASSAY o f ft-GAIACTOSIDASE i n YEAST TRANSFORMANTS 181 Chapter I I I . RESULTS and DISCUSSION 184 The CYCl 3 ' End S i g n a l Res ides W i t h i n 300 bp o f the Cod ing Sequence 184 D e l e t i o n of the 3 ' End S i g n a l Causes the Syn thes i s of Extended T r a n s c r i p t s 189 Mapping the Boundar ies of the CYCl 3 ' End S i g n a l 192 P o i n t Mu ta t ions W i t h i n the 3 ' End S i g n a l Region of the I n t a c t CYCl Gene 199 - i x -A Sc reen ing System f o r 3 ' End S i g n a l Muta t ions 205 Mutagenesis o f P o s i t i o n s +472 t o +474 W i t h i n the CYCl 3 ' End S i g n a l 209 T e s t i n g V a r i o u s P r o m o t e r : 3 ' End S i g n a l ; l a c Z F u s i o n P lasmids 209 The p A l l S e r i e s o f P lasmids 217 What Might l acZ E x p r e s s i o n from p A l l P lasmids Measure? 220 S a t u r a t i o n Mutagenesis of a CYCl 3 ' End S i g n a l Fragment 223 Comments on the Mutagenic Procedure 232 T a r g e t i n g of Mu ta t ions 232 E f f i c i e n c y of Mutagenesis 236 Types of Mu ta t i on Induced 238 E f f e c t s o f Mu ta t ions i n t he 3 ' End S i g n a l Fragment on l acZ E x p r e s s i o n from p A l l P lasmids 239 3 ' End S i g n a l F u n c t i o n i n Truncated CYCl Genes 240 Sequence Requirements f o r CYCl T r a n s c r i p t 3 ' End Genera t ion 251 A p p l i c a t i o n s of the p A l l Sc reen ing System 260 D e f i n i t i o n of the 3 ' End S i g n a l 260 I d e n t i f i c a t i o n o f Genes Requ i red f o r 3 ' End Genera t i on 261 Other Sc reen ing Systems f o r 3 ' End S i g n a l Defec ts 263 Chapter IV . REFERENCES 267 - x -LIST OF TABLES TABLE I. L IST OF OLIGONUCLEOTIDES 96 TABLE I I . PLASMIDS AND BACTERIOPHAGE VECTORS 103 TABLE I I I . BUFFERS FOR RESTRICTION ENDONUCLEASE DIGESTION 121 TABLE IV. SUMMARY OF OLIGONUCLEOTIDE-DIRECTED MUTAGENESIS EXPERIMENTS 156 TABLE V . COMPOSITION OF ddNTP/dNTP TERMINATOR MIXES 170 TABLE V I . RESULTS OF MISINCORPORATION MUTAGENESIS EXPERIMENTS 234 TABLE V I I . COMPARISON OF THE ZARET AND SHERMAN CONSENSUS SEQUENCE TO MUTANT 3 ' END SIGNALS 254 - x i -LIST OF FIGURES F i g u r e 1. C o n s t r u c t i o n o f A H 5 ' D e l e t i o n s 126 F i g u r e 2 . C o n s t r u c t i o n o f CYCl A K 5 ' and CYCl A K 3 " D e l e t i o n s 129 F i g u r e 3 . C o n s t r u c t i o n o f the pA4 P r o m o t e r : 3 ' End S i g n a l Fus ions 135 F i g u r e 4 . R e s t r i c t i o n Maps o f pMCl403 and p lacZ 137 F i g u r e 5 . R e s t r i c t i o n Maps o f YRp73 and YEp73 140 F i g u r e 6 . S t r u c t u r e and D e r i v a t i o n o f pA5 P lasmids 142 F i g u r e 7 . R e s t r i c t i o n Maps o f pA6a, pA6, pA7, and pAlO 144 F igu re 8 . S t r u c t u r e of the p A l l P lasmids 146 F igu re 9 . C o n s t r u c t i o n o f mplOAl 148 F i g u r e 10. R e c o n s t r u c t i o n o f p A l l P lasmids C a r r y i n g P o i n t Mu ta t ions i n the CYCl 3 ' End S i g n a l 151 F i g u r e 11 . A . C o n s t r u c t i o n of pA l2 P lasmids 153 B. O r i e n t a t i o n o f the Truncated c y c l Gene i n the pAl2A and pAl2B P lasmids 153 F i g u r e 12. O l i g o n u c l e o t i d e - D i r e c t e d Mutagenesis 158 F i g u r e 13. O u t l i n e of Segment-Di rected Mutagenesis 164 F i g u r e 14. H y b r i d i z a t i o n of a CYCl Probe t o T o t a l Yeas t RNA 185 F i g u r e 15 . R e s t r i c t i o n Map of CYCl and F l a n k i n g Regions 186 F i g u r e 16. H y b r i d i z a t i o n of a CYCl Probe to RNA from S t r a i n s Bea r i ng D e l e t i o n s D i s t a l t o CYCl 190 F i g u r e 17. Endpo in ts of the CYC1AH5' and CYC1AK3" D e l e t i o n s 193 F i g u r e 18. H y b r i d i z a t i o n of a CYCl Probe t o RNA from Transformants of GM-3C-2 C a r r y i n g CYC1&H5' Genes 195 - x i i -F i g u r e 19. H y b r i d i z a t i o n o f CYC1 Probe t o RNA from GM-3C-2 Transformants C a r r y i n g CYC1AK3' Genes 197 F i g u r e 20 . Sequence o f the CYCl 3 ' End S i g n a l and F l a n k i n g Regions 200 F i g u r e 21 . H y b r i d i z a t i o n of a CYCl Probe t o RNA from GM-3C-2 Transformants C a r r y i n g YEp l3CYCl (2 .5 ) (WT), YEpl3CYClGG462, YEpl3CYClC482, o r YEpl3CYClGG462C482 204 F i g u r e 22. S t r a t e g y f o r Sc reen ing f o r Mu ta t ions i n the 3 ' End S i g n a l o f CYCl 208 F i g u r e 23 . A . Sequence i n t he V i c i n i t y of the GT473 and C474 M u t a t i o n s , and the Cor respond ing W i l d -Type Sequence 210 B. H y b r i d i z a t i o n o f a CYCl Probe t o RNA from GM-3C-2 Transformants C a r r y i n g YEpl3CYC1(2.5) (WT), YEpl3CYClGT473, o r YEpl3CYClC474 210 F i g u r e 24. D e l e t i o n Endpo in ts i n the pA4 P r o m o t e r : 3 ' End S i g n a l F u s i o n s , f o r use i n Promoter: 3 ' End S i g n a l : l acZ P lasmids 213 F i g u r e 25 . L e v e l of ^ - G a l a c t o s i d a s e Produced by GM-3C-2 Transformants C a r r y i n g p A l l P lasmids 219 F i g u r e 26 . Annea l i ng of mplOAl and mplO/Smal 228 F i g u r e 27. L i m i t e d Pr imer E x t e n s i o n on a Gapped Heterodup lex 230 F i g u r e 28 . S i n g l e - T r a c k (T) Sequences o f 12 C lones Obta ined i n Exper iment T l 233 F i g u r e 29 . Sequences of 3 ' End S i g n a l Regions o f Va r i ous p A l l P lasmids 241 - x i i i -F i g u r e 30 . L e v e l s o f ^ - G a l a c t o s i d a s e A c t i v i t y i n Yeas t Transformants C a r r y i n g p A l l P lasmids w i t h 3 ' End S i g n a l Mu ta t ions 243 F i g u r e 31 . H y b r i d i z a t i o n of a CYCl Probe t o RNA from Yeas t Transformants C a r r y i n g pAl2A and pAl2B P lasmids 246 - x i v -ACKNOWLEDGEMENTS I would l i k e t o thank my s u p e r v i s o r , D r . M i c h a e l Sm i t h , f o r p r o v i d i n g me w i t h a s t i m u l a t i n g environment i n which t o work, f o r encourag ing me t o pursue my i d e a s , and f o r g i v i n g them sober second thought . I am a l s o g r a t e f u l f o r h i s p a t i e n c e d u r i n g the r a t h e r p r o t r a c t e d g e s t a t i o n p e r i o d of my t h e s i s . The members o f my a d v i s o r y oommittee, D r s . Pa t Dennis and C a r o l i n e A s t e l l , p rov ided u s e f u l c r i t i c i s m a t v a r i o u s s tages of the work, and f o r t h i s , I thank them. Dr . Steve McKnight served as a source of t e c h n i c a l adv i ce and con t inues t o be a source o f i n s p i r a t i o n . I owe a s p e c i a l debt o f g r a t i t u d e t o C a r o l i n e B e a r d , who performed some o f the exper iments d e s c r i b e d i n t h i s t h e s i s and has been a sound ing-board f o r i deas and a foun t o f t e c h n i c a l i n f o r m a t i o n . I thank , though I cannot l i s t a l l of them, t h e f r i e n d s and c o l l e a g u e s who made my t ime i n Vancouver t he h a p p i e s t imag inab le . In p a r t i c u l a r , I would l i k e t o thank my f e l l o w s tuden t , Susan P o r t e r , f o r her v e r y impor tan t f r i e n d s h i p . My s i s t e r , Jane t Hen r i kson , ve ry k i n d l y undertook t o type much of the w r i t t e n d r a f t o f my t h e s i s , a t c o n s i d e r a b l e r i s k t o her e y e s i g h t and sense of o r d e r . I am a l s o g r a t e f u l t o Sharon Berg f o r t y p i n g p a r t of t he i n t r o d u c t i o n . D r . Tom Hat ton deserves acknowledgement f o r hav ing rescued my hap less t h e s i s f rom a c a p r i c i o u s computer on s e v e r a l o c c a s i o n s . I am of course g r a t e f u l t o the N a t u r a l Sc iences and Eng inee r i ng Research C o u n c i l o f Canada f o r i t s suppo r t , i n the form of a 1967 Sc ience S c h o l a r s h i p . F i n a l l y , and most of a l l , I thank my w i f e , Donna H e n r i k s o n , f o r endu r i ng , and f o r c o n t i n u i n g t o l ove me and b e l i e v e i n me. - x v -LIST OF ABBREVIATIONS A Adenosine A 2 6 Q Absorbance a t 260 nm Ap A m p i c i l l i n $ - g a l t3 - g a l a c t o s i d a s e BSA bov ine serum a lbumin C C y t i d i n e cc c l o s e d c i r c u l a r (DNA) ddNTP 2 ' , 3 1 - d i d e o x y n u c l e o s i d e t r i phospha te (nuc leos ide may be s p e c i f i e d as A , C , G , o r T) DEP d i e t h y l pyrocarbonate DNA d e o x y r i b o n u c l e i c a c i d ds doub le -s t randed (DNA) dNTP 2 ' - deoxynuc leos ide t r i p h o s p h a t e (nuc leos ide may be s p e c i f i e d as A , C , G , o r T) DTT 1 , 4 - d i t h i o t h r e i t o l EDTA e t h y l e n e d i a m i n e t e t r a a c e t i c a c i d EGTA - e t h y l e n e g l y c o l - b i s - ( O j -am inoe thy l ether) N , N , N ' , N ' -t e t r a a c e t i c a c i d G guanosine GART g lyc inamide r i b o n u c l e o t i d e t rans fo rmy lase HEPES N-2-hyobroxyet± iy lp iperaz i r ie -N ' -2-e thanesu l fon ic a c i d IPTG i s o p r o p y l - D - t h i o g a l a c t o s i d e LaRNP r i b o n u c l e o p r o t e i n b e a r i n g a n t i g e n i c determinant La IMP low m e l t i n g p o i n t (agarose) MOPS 3 - (N-morpho l ino ) -2 -hydroxypropanesu l fon ic a c i d mRNA messenger RNA - x v i -NTP r i b o n u c l e o s i d e t r i phospha te (nuc leos ide may be s p e c i f i e d as A , C , G , o r U) OAc a c e t a t e oc open c i r c u l a r (DNA) ODgQQ o p t i c a l d e n s i t y a t 600 nm ONPG o - n i t r o p h e n y l ^ - D - g a l a c t o s i d e o r i o r i g i n o f r e p l i c a t i o n PEG p o l y e t h y l e n e g l y c o l PMSF p h e n y l m e t h y l s u l f o n y l f l u o r i d e RF r e p l i c a t i v e form RNA r i b o n u c l e i c a c i d Rot the p roduc t o f i n i t i a l RNA c o n c e n t r a t i o n (Ro) and t ime o f h y b r i d i z a t i o n (t) rRNA r i bosoma l RNA SC y e a s t s y n t h e t i c complete medium SC-X y e a s t s y n t h e t i c complete medium, l a c k i n g growth f a c t o r X SDS sodium d o d e c y l s u l f a t e snRNP s m a l l n u c l e a r r i b o n u c l e o p r o t e i n ss s i n g l e - s t r a n d e d (DNA) SSC s tandard s a l i n e c i t r a t e (0.15 M N a C l , 0.015 M sodium c i t r a t e ) T thymid ine TBE T r i s : b o r a t e : E D T A e l e c t r o p h o r e s i s b u f f e r TE T r i s : E D T A (concen t ra t i ons s p e c i f i e d ) TEMED N , N , N ' , N ' - t e t r a m e t h y l e t h y l e n e d i a m i n e T r i s t r is (hydroxymethy l )a in inomethane tRNA t r a n s f e r RNA -xvii-U u r i d i n e UV u l t r a v i o l e t VRC vanady l r i b o n u c l e o s i d e complexes WT w i l d - t y p e XGAL 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - $ - D - g a l a c t o s i d e P lease n o t e : In f i g u r e s showing n u c l e i c a c i d sequences, the a b b r e v i a t i o n s f o r the n u c l e o s i d e s a re used , and the phosphod ies te r l i n k a g e s a re om i t t ed f o r c l a r i t y . - x v i i i -INTRODUCTION TRANSCRIPT 3'END GENERATION: PERSPECTIVES B e n z e r ' s (1955) a n a l y s i s of g e n e t i c f i n e s t r u c t u r e i n the bac te r iophage T4 po r t r ayed the gene as a d i s c r e t e f u n c t i o n a l element fo rming a cont iguous segment o f a l i n e a r a r r a y o f mu ta t i ona l and recomb ina t i ona l s i t e s . A l though more recen t work has shown t h a t a gene p roduc t may be s p e c i f i e d by s e v e r a l non-cont iguous segments o f the a r r a y (Berget e t a l . , 1977; K l e s s i g , 1977) and t h a t more than one gene may occupy a g i v e n segment (Sanger e t a l . , 1977b) i t remains t r u e t h a t a gene i s a f u n c t i o n a l l y d i s t i n c t subset o f a s t r u c t u r a l cont inuum. The p rocess of gene e x p r e s s i o n demands t h a t s i g n a l s o f some s o r t i d e n t i f y t he gene as a r e g i o n which i s t o be t r a n s c r i b e d , mark those p o r t i o n s o f t he t r a n s c r i p t which a r e t o be conserved through a v a r i e t y of p o s s i b l e p r o c e s s i n g r e a c t i o n s , s p e c i f y s i t e s a t which t r a n s c r i p t m o d i f i c a t i o n r e a c t i o n s a r e t o t ake p l a c e , and f o r the t r a n s c r i p t s of most genes, determine what r eg i ons o f t he t r a n s c r i p t a re t o be t r a n s l a t e d i n t o p r o t e i n . S i n c e n u c l e o t i d e sequence i s the o n l y i n t r i n s i c f e a t u r e o f the genome which d i s t i n g u i s h e s one r e g i o n from another (Watson and C r i c k , 1953) a l l o f these s i g n a l s must u l t i m a t e l y r e s i d e i n p a r t i c u l a r n u c l e o t i d e sequences. The work t o be d e s c r i b e d i n t h i s t h e s i s r ep resen ts an e f f o r t t o i d e n t i f y the n u c l e o t i d e sequences wh ich c o n s t i t u t e a s i g n a l f o r t r a n s c r i p t 3 ' end g e n e r a t i o n i n t he y e a s t , Saccharomyces c e r e v i s i a e . Cons ide rab le e f f o r t has a l r e a d y been expended on unders tand ing the s i g n a l s and mechanisms i n v o l v e d i n 3 ' end gene ra t i on i n bo th p roca ryo tes and e u c a r y o t e s . Be fo re r e v i e w i n g t h e f r u i t s o f t h i s e f f o r t , i t i s u s e f u l - 1 -t o consider the importance of t r a n s c r i p t i o n a l 3' end s i g n a l s to the organization and function of the genome. Why Have 3' End Signals? Promoter s i g n a l s , which s p e c i f y s i t e s of t r a n s c r i p t i n i t i a t i o n and c o n t r o l the frequency of i n i t i a t i o n , o f f e r a potent way of c o n t r o l l i n g gene expression, but the p o s s i b l e r o l e s of signals which s p e c i f y s i t e s of 3' end generation are perhaps l e s s r e a d i l y appreciated. The minimum requirement that may be imagined f o r a f u n c t i o n a l t r a n s c r i p t i s that i t contain a l l of the sequences which form a part of or encode the gene's ultimate product. Since the uncontrolled synthesis of incomplete t r a n s c r i p t s would i n general i n t e r f e r e with gene expression and regulation, the t r a n s c r i p t i o n a l apparatus should have a low p r o b a b i l i t y of randomly terminating t r a n s c r i p t i o n . On the other hand, 3' end generation must take place i f t r a n s c r i p t s are t o be released from t h e i r templates. At l e a s t i n eucaryotes, t r a n s c r i p t release i s p r e r e q u i s i t e f o r t r a n s c r i p t function. E f f i c i e n t t r a n s c r i p t release would demand a s i g n a l - d i r e c t e d process of 3' end generation, although i t would not impose a requirement f o r s i t e - s p e c i f i c 3'-end generation. For example, a 3 '-end s i g n a l might simply e s t a b l i s h a boundary beyond which 3' end generation would be permitted t o occur randomly, perhaps as a r e s u l t of some modification i n template organization or t r a n s c r i p t i o n complex str u c t u r e . A requirement f o r s i t e - s p e c i f i c 3' end generation might e x i s t i f sequences or structures at the 3' terminus of a t r a n s c r i p t could influence subsequent steps i n i t s processing or i t s function. E i t h e r -2-t e r m i n a t i o n s i g n a l s o r 3 ' end p r o c e s s i n g s i g n a l s cou ld serve the purpose of e n s u r i n g the r e l e a s e of f u n c t i o n a l t r a n s c r i p t s w i t h a p p r o p r i a t e 3 ' - t e r m i n a l sequences. A t e r m i n a t i o n s i g n a l would a t t he same t ime d e f i n e the downstream boundary o f a t r a n s c r i p t i o n a l u n i t , the reby s e r v i n g the a d d i t i o n a l purpose of l i m i t i n g the domain o f i n f l u e n c e of a promoter and i t s a s s o c i a t e d r e g u l a t o r y sequences and a l l o w i n g the independent c o n t r o l o f genes l o c a t e d f u r t h e r downstream. A 3 ' end p r o c e s s i n g s i g n a l c o u l d se rve the same purpose o n l y i f f o r some reason t r a n s c r i b e d sequences downstream of the p r o c e s s i n g s i t e were n o n - f u n c t i o n a l and r e g u l a t o r y s i g n a l s downstream o f the p r o c e s s i n g s i t e were not v u l n e r a b l e t o d i r e c t i n t e r f e r e n c e from polymerases " r e a d i n g th rough" f rom the p r o c e s s i n g s i t e . Such a p r o c e s s i n g s i g n a l would be " p h e n o t y p i c a l l y e q u i v a l e n t t o a t e r m i n a t o r " , as B i r n s t i e l and c o l l e a g u e s pu t i t i n a recen t rev iew ( B i r n s t i e l e t a l . , 1 9 8 5 ) . A 3 ' end s i g n a l which ac ted as a b a r r i e r t o the e x p r e s s i o n of g e n e t i c i n f o r m a t i o n l o c a t e d downstream would o f f e r a p o i n t a t wh ich the e x p r e s s i o n o f t h a t i n f o r m a t i o n c o u l d be c o n t r o l l e d i f t h e e f f i c i e n c y of the 3 ' end s i g n a l c o u l d be r e g u l a t e d . Termina t ion s i g n a l s a re w i d e l y used as r e g u l a t o r y g e n e t i c elements i n p r o c a r y o t e s , and i t i s becoming apparent t h a t 3 ' end gene ra t i on i s a l s o used as a r e g u l a t o r y dev i ce by e u c a r y o t e s . D i f f e r e n c e s i n " p r o c a r y o t i c " and " e u c a r y o t i c " mechanisms of r e g u l a t i o n a t t he l e v e l o f 3 ' end gene ra t i on r e f l e c t d i f f e r e n c e s i n both genomic and c e l l u l a r a r c h i t e c t u r e . - 3 -TRANSCRIPT 3' END GENERATION IN PROCARYOTES  Fac tor - Independent T r a n s c r i p t Te rm ina t ion C e r t a i n t r a n s c r i p t s found i n E . c o l i can be produced by RNA polymerase upon t r a n s c r i p t i o n o f the a p p r o p r i a t e template i n v i t r o , i n t he absence of any o the r p r o t e i n s . The 3' ends of such t r a n s c r i p t s must be s p e c i f i e d by s i g n a l s which cause RNA polymerase t o t e rm ina te t r a n s c r i p t i o n . These s i g n a l s a r e commonly c a l l e d f ac to r - i ndependen t t e r m i n a t o r s , a l though t h e i r e f f i c i e n c y may be i n f l u e n c e d by p r o t e i n s o ther than RNA polymerase ( e g . , see Rosenberg e t a l . , 1975) . T r a n s c r i p t s produced by f ac to r - i ndependen t t e rm ina to r s c h a r a c t e r i s t i c a l l y end i n a s e r i e s of template-encoded U r e s i d u e s , immedia te ly preceded by a G C - r i c h sequence w i t h hyphenated dyad symmetry. (See Rosenberg and C o u r t , 1979, f o r examples. ) S t u d i e s o f the i n v i t r o t r a n s c r i p t i o n o f templa tes c o n t a i n i n g m u t a t i o n a l l y a l t e r e d and s y n t h e t i c t e r m i n a t o r s i l l u s t r a t e the importance o f both o f these sequence elements' t o f ac to r - i ndependen t t e r m i n a t i o n ( C h r i s t i e e t a l _ . , 1981) . S e v e r a l workers suggested t h a t the G C - r i c h dyad might h inde r t he movement o f RNA polymerase a l ong i t s t emp la te , e i t h e r by caus ing ve ry s t a b l e b a s e - p a i r i n g of t r a n s c r i p t and templa te ( G i l b e r t , 1976) , o r by a l l o w i n g the fo rmat ion of secondary s t r u c t u r e s i n t he t r a n s c r i p t , t h e t emp la te , o r bo th (Adhya and Gottesman, 1978) . Mu ta t i ons which reduce the p o i n t symmetry o f t he dyad i n t e r f e r e w i t h t e r m i n a t i o n , sugges t i ng t h a t secondary s t r u c t u r e fo rmat ion i s impor tan t t o the p rocess ( rev iewed by P i a t t , 1981; Yano fsky , 1981) . S t u d i e s o f i n v i t r o t r a n s c r i p t i o n u s i n g n u c l e o t i d e analogs suggest t h a t the impor tan t b a s e - p a i r i n g i n t e r a c t i o n s i n the G C - r i c h dyad i n v o l v e RNA, bu t no t DNA (Farnham and P i a t t , 1982) . - 4 -On the b a s i s o f the o b s e r v a t i o n t h a t rU-dA base p a i r s a r e u n u s u a l l y u n s t a b l e , M a r t i n and T inoco (1980) proposed t h a t weak p a i r i n g between the templa te and the 3 ' t e r m i n a l u r i d y l a t e t r a c t of the t r a n s c r i p t might f a c i l i t a t e f ac to r - i ndependen t t e r m i n a t i o n . S t a b i l i z i n g t r a n s c r i p t - t e m p l a t e i n t e r a c t i o n s i n the v i c i n i t y of t he o l i g o u r i d y l a t e t r a c t d u r i n g i n v i t r o t r a n s c r i p t i o n , whether by l ower ing the tempera ture , by i n c o r p o r a t i n g base ana logs i n t o the t r a n s c r i p t o r t emp la te , o r by r e d u c i n g the number o f U r e s i d u e s encoded by the temp la te , i n t e r f e r e s w i t h t e r m i n a t i o n (Farnham and P i a t t , 1980; 1982; rev iewed by P i a t t , 1981) . These s t u d i e s suppor t t h e i d e a t h a t f ac to r - i ndependen t t e r m i n a t i o n depends i n p a r t on the l a b i l i t y of the i n t e r a c t i o n between the templa te and the 3 ' end o f the t r a n s c r i p t . Factor -Dependent T r a n s c r i p t Te rmina t ion In 1969, Rober ts r e p o r t e d the d i s c o v e r y o f a p r o t e i n c a l l e d rho f a c t o r which caused E . c o l i RNA polymerase t o te rm ina te t r a n s c r i p t i o n i n  v i t r o i n response t o s p e c i f i c s i g n a l s i n \ DNA which c o u l d not be recogn i zed by the polymerase a l o n e . Cons ide rab le g e n e t i c and b i o c h e m i c a l ev idence suppor ts t he invo lvement o f rho i n t e r m i n a t i o n o f t r a n s c r i p t i o n of many phage and c e l l u l a r operons (reviewed by Adhya and Gottesman, 1978; Rosenberg and C o u r t , 1979; P i a t t , 1981; P i a t t and B e a r , 1983) . Rho p r o t e i n i s a c t i v e as a hexamer o f 46 Kd subun i t s (F inger and R i c h a r d s o n , 1979) . I t b inds t o s i n g l e - s t r a n d e d RNA w i t h l i t t l e s e q u e n c e - s p e c i f i c i t y o the r than a p re fe rence f o r c y t i d y l a t e - c o n t a i n i n g polymers (R icha rdson , 1982; Lowery and R i c h a r d s o n , 1977) . Upon b i n d i n g t o RNA, rho e x h i b i t s n u c l e o s i d e t r i p h o s p h a t a s e a c t i v i t y , p r e f e r e n t i a l l y h y d r o l y s i n g ATP (Lcwery-Goldhammer and R i c h a r d s o n , 1974). Both i t s -5-RNA-b ind ing and NTPase a c t i v i t i e s a r e necessary f o r rho-media ted t r a n s c r i p t t e r m i n a t i o n (Howard and DeCrombrugghe, 1976; Sharp and P i a t t , 1984) . Rho-mediated t e r m i n a t i o n does not u s u a l l y occur a t o n l y one s i t e i n a t r a n s c r i p t i o n u n i t , bu t r a t h e r a t s e v e r a l s i t e s , which may span a r e g i o n of over one hundred n u c l e o t i d e s (Kupper e t a l . , 1 9 7 8 ; Morgan e t a l . , 1 9 8 3 a ) . There i s no obv ious sequence homology between s i t e s o f rho-media ted t e r m i n a t i o n ( P i a t t , 1981; Morgan e t a l . , 1985) , ye t the p rocess i s c l e a r l y sequence-dependent: d e l e t i o n o f a r e g i o n of rho-dependent t e r m i n a t i o n downstream of t he t r p operon causes readthrough i n t o ad jacen t operons i n v i v o (Wu e t a l . , 1 9 8 1 ) and p reven ts a c t i v a t i o n of the rho NTPase i n v i t r o (Sharp and P i a t t , 1984) . Morgan e t a l . (1983a,b; 1984) c a r r i e d out a d e t a i l e d a n a l y s i s of i n  v i t r o t r a n s c r i p t i o n and t e r m i n a t i o n i n a fragment o f > DNA i n c l u d i n g the rho-dependent t e r m i n a t o r , t R l . In the absence of r h o , RNA polymerase paused a t f i v e s i t e s co r respond ing t o t he s i t e s of rho-dependent t e r m i n a t i o n i n the t ^ r e g i o n . Paus ing a l s o occu r red a t more p romoter -p rox ima l s i t e s , a l t hough the a d d i t i o n o f rho d i d not cause t e r m i n a t i o n a t the p rox ima l pause s i t e s . When randomly-paused t r a n s c r i p t i o n complexes were prepared and i ncuba ted w i t h r h o , o n l y those t r a n s c r i p t s l onger than 290 n u c l e o t i d e s were r e l e a s e d f rom the complexes. C e r u z z i e t a l . (1985) r epo r t ed t h a t t r a n s c r i p t s o f the tR-^ r e g i o n wh ich were longer than 290 n u c l e o t i d e s were p r e f e r e n t i a l l y bound by r h o . Morgan and c o l l e a g u e s (1985) have proposed t h a t rho b inds t o c e r t a i n r e g i o n s i n nascent t r a n s c r i p t s , such as the r e g i o n 290 n u c l e o t i d e s d i s t a l t o the r i gh tward promoter o f X , because these reg i ons l a c k s t a b l e secondary s t r u c t u r e s f o r a t l e a s t 60 n u c l e o t i d e s and c o n t a i n c y t i d y l a t e - 6 -r e s i d u e s . The au thors compared the sequences o f s e v e r a l r eg i ons of rho-dependent t e r m i n a t i o n and i n each case found a t r a c t w i t h t hese f e a t u r e s . The same workers have suggested t h a t once bound t o t he nascent t r a n s c r i p t , rho i s a b l e t o cause i t s r e l e a s e f rom a t r a n s c r i p t i o n complex paused a t any p o i n t downstream. The manner i n which rho causes t r a n s c r i p t r e l e a s e i s no t unders tood , a l though a r o l e f o r t he rho NTPase seems l i k e l y , and g e n e t i c ev idence suggests i n t e r a c t i o n s between rho and the ^ subun i t of RNA polymerase (Guarente and Beckw i th , 1978). 3 ' End P r o c e s s i n g i n P roca ryo tes A l though i t seems t h a t most t r a n s c r i p t 3 ' ends i n b a c t e r i a a re the d i r e c t p roduc ts of t r a n s c r i p t t e r m i n a t i o n , t he re i s ev idence f o r 3 ' end p r o c e s s i n g . C e r t a i n t r a n s c r i p t s of "X DNA bear s h o r t 3 ' - t e r m i n a l t r a c t s o f adeny la te r e s i d u e s wh ich a re not template-encoded (Smith and Hedgepeth, 1975; Rosenberg e t a l . , 1 9 7 5 ) . Gopa lak r i shna e t a l . (1981) de tec ted po l yadeny la te t r a c t s i n about 20% o f t he p u l s e - l a b e l l e d RNA i n E . c o l i , and o the r workers have s i n c e de tec ted po l yadeny la ted t r a n s c r i p t s i n a v a r i e t y of e u b a c t e r i a (Hussain e t a l . , 1 9 8 2 ; Crouch e t a ^ . , 1983; Majumder and McFadden, 1984) and an archaebac ter ium (Brown and Reeve, 1985) . The po l yadeny la te t r a c t s i n p roca ryo tes tend t o be f a i r l y s h o r t ( l e s s than 20 r e s i d u e s ) and ve ry u n s t a b l e . No s p e c i f i c po l yadeny la ted t r a n s c r i p t has been c h a r a c t e r i z e d , and the s i g n i f i c a n c e o f the p r o c e s s i n g r e a c t i o n remains obscu re . T r a n s c r i p t Te rm ina t ion as a Regu la to r y Dev ice i n P roca ryo tes Rho-Dependent T r a n s c r i p t Te rm ina t ion and T r a n s l a t i o n a l P o l a r i t y Muta t ions which i n t e r f e r e w i t h the t r a n s l a t i o n of one gene o f t e n - 7 -e x e r t an i n h i b i t o r y " p o l a r e f f e c t " on the e x p r e s s i o n of downstream genes i n the same operon . In v i t r o t r a n s c r i p t i o n exper iments r e v e a l e d the e x i s t e n c e o f rho-dependent t e rm ina to rs w i t h i n t he l a c and g a l operons (De Crombrugghe e t a ^ . , 1973) . R i cha rdson e t a l . (1975) and Adhya and Gottesman (1978) suggested t h a t rho-dependent t e r m i n a t o r s r e s i d i n g w i t h i n operons a r e no rma l l y masked by r iboscmes engaged i n t r a n s l a t i o n , but t h a t muta t ions wh ich p reven t t r a n s l a t i o n a l l o w rho t o g a i n access t o the nascen t t r a n s c r i p t and cause i t s premature r e l e a s e from paused t r a n s c r i p t i o n complexes. The d i s c o v e r y t h a t suA mu ta t i ons , which suppress p o l a r i t y , cause the p roduc t i on o f a l t e r e d rho f a c t o r (R ichardson e t al^. ,1975; Ra tne r , 1976) , s u b s t a n t i a t e d the i d e a t h a t p o l a r i t y i s a consequence of rho-dependent t e r m i n a t i o n w i t h i n operons . The e x i s t e n c e of l a t e n t t e rm ina to r s w i t h i n operons i l l u s t r a t e s the importance of c o u p l i n g between t r a n s c r i p t i o n and t r a n s l a t i o n t o gene e x p r e s s i o n i n b a c t e r i a . The b i n d i n g p re fe rences of rho might be expected t o have p l a c e d c o n s t r a i n t s on the l eng th and s t r u c t u r e o f i n t e r g e n i c u n t r a n s l a t e d sequences w i t h i n operons. A n t i t e r m i n a t i o n i n Bac te r iophage Lambda T r a n s c r i p t t e r m i n a t i o n i s a p i v o t a l event i n t he r e p r o d u c t i v e c y c l e o f bac te r iophage "X . The p roduc t o f gene N, pN, i s r e q u i r e d f o r the e x p r e s s i o n o f a l l X genes d i s t a l t o the t L l and t R l t e r m i n a t o r s . I t a c t s t o p reven t t r a n s c r i p t t e r m i n a t i o n a t tj-j and t R ^ , as Rober ts proposed i n 1969. Adhya e t a l . (1974) suggested t h a t pN somehow conve r t s RNA polymerase i n t o a " t r a n s c r i p t i o n a l j ugge rnau t " , unable t o respond t o sequences wh ich no rma l l y cause t e r m i n a t i o n . The e f f e c t i s no t r e s t r i c t e d t o any p a r t i c u l a r t e r m i n a t o r , but on f i r s t examinat ion i t seems t o be - 8 -s p e c i f i c t o t r a n s c r i p t i o n o r i g i n a t i n g a t the * p romoters , p ^ a n d p^ (Adhya e t a l . , 1 9 7 4 ; F r a n k l i n , 1974) . S a l s t r c m and S z y b a l s k i (1978) i d e n t i f i e d a s i t e between p^ and t L ^ which i s r e q u i r e d i n c i s f o r pN-mediated a n t i t e r m i n a t i o n , and which they c a l l e d nu tL . A homologous nutR s i t e e x i s t s between p^ and tR-^ (Rosenberg e t a l . , 1978) . The presence of a nut s i t e w i t h i n a t r a n s c r i p t i o n u n i t i s bo th necessary and s u f f i c i e n t f o r pN t o a c t as an a n t i t e r m i n a t o r o f t r a n s c r i p t i o n a t t e r m i n a t o r s d i s t a l t o the nut s i t e (de Crombrugghe e t a l . , 1 9 7 9 ) . Fr iedman (1971) undertook t o d e f i n e the p r o t e i n s i n v o l v e d i n i n t e r a c t i o n s w i t h pN by s e l e c t i n g mutants o f E . c o l i which f a i l e d t o suppor t N-dependent growth of X . Seve ra l genes a re now i d e n t i f i e d by nus ( N - u t i l i z a t i o n substance) mu ta t i ons . Among them a re the genes encoding rho p r o t e i n (nusD), the § - s u b u n i t o f RNA polymerase (nusC) , and r ibosoma l p r o t e i n S10 (nusE) (Friedman and Gottesman, 1983) . The nusA gene o r i g i n a l l y i d e n t i f i e d by Fr iedman encodes a p r o t e i n which b inds t i g h t l y and s p e c i f i c a l l y t o bo th pN and RNA polymerase core enzyme (Greenb la t t and L i , 1981a ,b ) . The nusA p r o t e i n i s d i s p l a c e d from RNA polymerase by t h e 6 subun i t o f the polymerase (Greenb la t t and L i , 1981b). NusA p r o t e i n causes an i n c r e a s e i n the l eng th o f t ime f o r which RNA polymerase pauses a t some t e r m i n a t o r s , sugges t ing a r o l e i n t e r m i n a t i o n a t these s i t e s (Greenb la t t e t a l . , 1 9 8 1 ; Farnham e t a l . , 1 9 8 2 ) . A b i n d i n g s i t e f o r nusA has been i d e n t i f i e d i n the v i c i n i t y o f the nu t s i t e s o f lambdoid phages and i n those c e l l u l a r operons i n which nusA i s i n v o l v e d i n t e r m i n a t i o n (Olson e t a l . , 1 9 8 2 ; Fr iedman and O l s o n , 1983) . C e l l - f r e e e x t r a c t s wh ich suppor t pN-mediated a n t i t e r m i n a t i o n d u r i n g t r a n s c r i p t i o n o f added DNA templa tes promise t o be u s e f u l i n d e c i p h e r i n g the i n t e r a c t i o n s of pN and the v a r i o u s nus p roduc ts d u r i n g - 9 -a n t i t e r m i n a t i o n (Ghosh and Das, 1984; Das and Wo lska , 1984; Goda and G r e e n b l a t t , 1985) . E x p r e s s i o n o f the l a t e genes o f X depends not o n l y upon pN-mediated a n t i t e r m i n a t i o n , but a l s o upon the product o f gene Q, pQ. The c o i n c i d e n c e o f the g e n e t i c a l l y - d e f i n e d s i t e o f a c t i o n o f pQ and the rho- independent " X 6S" t e rm ina to r l e d t o the sugges t i on t h a t Q, l i k e N, encodes an a n t i t e r m i n a t o r (Rober t s , 1975) . Forbes and Herskowi tz (1982) demonstrated t h a t pQ, l i k e pN, can suppress the p o l a r e f f e c t s o f muta t ions l y i n g d i s t a l t o i t s s i t e o f a c t i o n . Grayhack and Rober ts (1982) showed t h a t p u r i f i e d pQ causes RNA polymerase t o t r a n s c r i b e through the X 6S te rm ina to r i n v i t r o i n the absence o f o the r p r o t e i n s . Comparison o f t he mechanisms o f a c t i o n o f pQ and pN promises t o be ve ry i n t e r e s t i n g i n v iew o f t h e i r appa ren t l y q u i t e d i f f e r e n t requ i remen ts . A n t i t e r m i n a t i o n i n rRNA Operons A n t i t e r m i n a t i o n o f t r a n s c r i p t i o n i s not the s o l e p rope r t y of bac te r iophage X and i t s c o h o r t . Holben and Morgan (1984) r e p o r t e d t h a t muta t ions wh ich a re s t r o n g l y p o l a r t o t r a n s c r i p t i o n from the l a c o r a r a promoters have no p o l a r e f f e c t on t r a n s c r i p t i o n o r i g i n a t i n g from the r r nC promoter . L i e t a l . (1984) found t h a t a 67-base p a i r fragment from the r rnG l eade r r e g i o n rendered t r a n s c r i p t i o n f rom any of t h ree promoters t e r m i n a t i o n - r e s i s t a n t . The a c t i v e fragment con ta ined sequences homologous t o t he nusA-b ind ing s i t e s and nut s i t e s of the lambdoid phages. C h a r a c t e r i z a t i o n o f the t r a n s - a c t i n g f a c t o r s i n v o l v e d i n a n t i t e r m i n a t i o n o f r r n t r a n s c r i p t i o n promises t o be i n t e r e s t i n g from both a b i o c h e m i c a l and an e v o l u t i o n a r y p o i n t o f v iew . -10-Attenuation i n Bacterial Biosynthetic Operons Many biosynthetic operons in E. c o l i and related bacteria are regulated by means of transcript termination signals called attenuators, which are located upstream of the structural genes in their respective operons (Kolter and Yanofsky, 1982). The archetypal attenuator i s that of the trp operon of E. c o l i , which has been intensively studied by Yanofsky and his colleagues. The f r u i t of their efforts i s a detailed model of attenuation which was most eloquently reviewed by Yanofsky i n 1981. The transcript of the trp attenuator region contains several different potential hairpin structures. One of these i s a typical rho-independent terminator, the attenuator i t s e l f . A second hairpin can form shortly upstream of the attenuator, and i t s formation precludes the formation of the attenuator hairpin. The efficiency of termination i n the attenuator region depends upon which of these secondary structures forms each time the region i s transcribed. Regulation of trp expression i s achieved by regulating the formation of the two alternative structures. The attenuator l i e s within a short open reading frame which encodes a 14-amino acid peptide containing two adjacent tryptophan residues. While transcription i s underway, ribosomes bind to the nascent transcript and begin translation of the short open reading frame. If toyptophanyl-tRNATrP i s i n short supply, the riboscme s t a l l s over the tandem Trp codons. In this position, i t st e r i c a l l y prevents the formation of the attenuator hairpin but allows the competing hairpin to form. Transcription consequently continues into the structural genes of the operon. If on the contrary the c e l l i s well-supplied with -11-t r yp tophan , r ibosomes t r a n s l a t e the e n t i r e l eade r pep t i de cod ing sequence. Format ion o f the a t t enua to r h a i r p i n i s a l l o w e d , and t r a n s c r i p t i o n te rm ina tes w i thou t r e a c h i n g the s t r u c t u r a l genes of t he operon . T h i s model o f a t t e n u a t i o n i s suppor ted i n d e t a i l by a wea l t h o f g e n e t i c e v i d e n c e , f o r which the reader i s d i r e c t e d t o t he rev iew by Yanofsky (1981) and the r e f e r e n c e s t h e r e i n . TRANSCRIPT 3 ' END GENERATION i n EUCARYGTES The n u c l e i o f e u c a r y o t i c organisms c o n t a i n t h r e e types o f DNA-dependent RNA po lymerase. Each i s r e s p o n s i b l e f o r the t r a n s c r i p t i o n o f a p a r t i c u l a r c l a s s o f genes. RNA polymerase I produces p r e c u r s o r s c o n t a i n i n g the sequences of 18S, 28S, and 5.8S rRNAs, w h i l e RNA polymerase I I i s r e s p o n s i b l e f o r the s y n t h e s i s of mRNAs o r t h e i r p r e c u r s o r s , and RNA polymerase I I I t r a n s c r i b e s genes encoding 5S RNA and tRNA. [For a r ev i ew , see Roeder, 1976; Sentenac and H a l l (1981) r e v i e w the c h a r a c t e r i s t i c s o f yeas t nuc l ea r RNA po lymerases . ] The p rocess of 3 ' end gene ra t i on w i l l be d e s c r i b e d s e p a r a t e l y f o r each c l a s s o f t r a n s c r i p t s . Large Ribosomal RNA Genes Genes encod ing r ibosoma l RNAs a re a m p l i f i e d t o v a r y i n g degrees i n e u c a r y o t e s . The oocy tes of amphibians have been p a r t i c u l a r l y f avou rab le s u b j e c t s f o r the s tudy of r i bosoma l RNA genes because the genes a re h i g h l y r e i t e r a t e d and because c l oned genes, i n c l u d i n g v a r i a n t s c r e a t e d by i n v i t r o m a n i p u l a t i o n , may be i n t roduced i n t o the c e l l s by m i c r o i n j e c t i o n f o r a n a l y s i s o f t h e i r e x p r e s s i o n . A c t i v e r i bosoma l RNA t r a n s c r i p t i o n u n i t s f rom Xenopus oocy tes have been d i r e c t l y observed i n t he e l e c t r o n microscope ( M i l l e r and B e a t t y , 1969) . Nascent t r a n s c r i p t s a re v i s i b l e as f i b r i l s p r o j e c t i n g r a d i a l l y f rom an a x i a l f i b r e , which i s the DNA temp la te . The f i b r i l s a re c l u s t e r e d i n ve ry s h a r p l y - d e f i n e d r e g i o n s a l ong t h e a x i a l f i b r e , these r e g i o n s d e f i n i n g t h e ex ten t of the r i bosoma l RNA t r a n s c r i p t i o n u n i t s . Ne ighbour ing t r a n s c r i p t i o n u n i t s a re separa ted by r e g i o n s which a re comp le te l y f r e e of r a d i a l f i b r i l s and a re t h e r e f o r e n o n - t r a n s c r i b e d . W i t h i n each t r a n s c r i p t i o n u n i t , t h e f i b r i l s c o n t i n u a l l y i n c r e a s e i n l eng th from one end o f the u n i t t o the o t h e r . The s h o r t - f i b r i l end o f t he t r a n s c r i p t i o n u n i t must r ep resen t t he s i t e o f t r a n s c r i p t i n i t i a t i o n , w h i l e the l o n g - f i b r i l end cor responds t o the s i t e o f t r a n s c r i p t t e r m i n a t i o n . The t e r m i n a t i o n s i t e has been l o c a t e d on the p h y s i c a l map of the rDNA repea t u n i t by d i g e s t i n g a c t i v e t r a n s c r i p t i o n u n i t s w i t h r e s t r i c t i o n endonucleases p r i o r t o v i s u a l i z a t i o n i n t he e l e c t r o n m ic roscope . The l o c a t i o n o f t he t e r m i n a t i o n s i t e co r responds , w i t h i n the r e s o l u t i o n o f measurements made on e l e c t r o n micrographs (about 200 base p a i r s ) , t o the l o c a t i o n of t he 3 ' end of t he 40S rRNA p r e c u r s o r , which was a c c u r a t e l y determined by S i nuc lease d i g e s t i o n o f RNA-DNA h y b r i d s (Sol lner -Webb and Reeder , 1979) . The mature 28S rRNA happens t o share e x a c t l y t he same 3 ' end as the 40S p r e c u r s o r , and i t appears t h a t t h i s end i s generated by t e r m i n a t i o n o f t r a n s c r i p t i o n , a l though r a p i d p r o c e s s i n g o f a s h o r t 3 ' - t e r m i n a l e x t e n s i o n has not been f o r m a l l y e x c l u d e d . The 3 ' end o f the 40S pre-rRNA o f Xenopus maps immedia te ly upstream - 1 3 -of a c l u s t e r o f 4 T / A b a s e - p a i r s . Bakken e t a l . (1982) p rov ided ev idence t h a t t h i s T / A c l u s t e r compr ises a t l e a s t part, o f the t e r m i n a t i o n s i g n a l f o r t r a n s c r i p t i o n by RNA polymerase I. They i n j e c t e d Xenopus oocy tes w i t h p lasmids c a r r y i n g v a r i o u s rDNA fragments and mapped the ex ten t o f the polymerase I t r a n s c r i p t i o n u n i t on each p lasm id u s i n g the e l e c t r o n m ic roscope . They found t h a t d e l e t i o n o f the l a s t b a s e - p a i r i n the (T /A)^ c l u s t e r and a l l d i s t a l rDNA sequences d i d not p reven t t r a n s c r i p t i o n f rom t e r m i n a t i n g a t the normal s i t e . D e l e t i o n o f the l a s t two T / A base p a i r s , however, caused t r a n s c r i p t i o n t o proceed beyond the normal 3 ' end s i t e . These r e s u l t s l o c a t e d the d i s t a l boundary o f the t e r m i n a t i o n s i g n a l , but t he p o s i t i o n o f i t s p rox ima l boundary was no t de te rmined . The T / A c l u s t e r i s preceded by a sequence hav ing hyphenated dyad symmetry, which means t h a t the t e r m i n a t i o n s i g n a l f o r RNA polymerase I bears a t l e a s t a s u p e r f i c i a l resemblance t o f ac to r - i ndependen t t e rm ina to r s i g n a l s i n p r o c a r y o t e s . The r ibosomal DNA repea t u n i t i n yeas t i s tandemly repeated about 120 t imes on chromosome X I I . A s i n g l e repea t u n i t i n c l u d e s one t r a n s c r i p t i o n u n i t encoding the 18S, 5 . 8 S , and 25S rRNAs l i n k e d t o a d i v e r g e n t l y t r a n s c r i b e d 5S rRNA gene (reviewed by Warner, 1982) . K l o o t w i j k e t a l . ( 1 9 7 9 ) argued t h a t the 37S r ibosomal rRNA p r e c u r s o r o f yeas t i s a pr imary t r a n s c r i p t because i t i s t he l a r g e s t p re- rRNA d e t e c t a b l e i n normal c e l l s and i t s 5 ' end c a r r i e s the ha l lmark of i n i t i a t i o n , a n u c l e o s i d e t r i p h o s p h a t e . The au thors i s o l a t e d a unique 3 ' t e r m i n a l o l i g o n u c l e o t i d e from the 37S molecu le and showed t h a t i t s sequence resembled those found i n amphib ian rRNA t e r m i n a t i o n s i t e s and i n f ac to r - i ndependen t t e rm ina to rs from b a c t e r i a . They suggested on these grounds t h a t the 3 ' end o f the 37S pre-rRNA i s the product o f t r a n s c r i p t t e r m i n a t i o n . The 3 ' end i s l o c a t e d e x a c t l y 7 n u c l e o t i d e s beyond the 3 ' end of the mature 26S rRNA ( c i t e d i n Warner, 1982) . Smal l Ribosomal and T r a n s f e r RNA Genes  Ev idence f o r T r a n s c r i p t Te rmina t ion At tempts t o produce c e l l - f r e e systems which suppor t polymerase I l l - m e d i a t e d t r a n s c r i p t i o n met w i t h success e a r l i e r than s i m i l a r e f f o r t s t o make polymerases I and I I f u n c t i o n p r o p e r l y i n v i t r o . Such systems proved t o be power fu l t o o l s f o r a n a l y z i n g the s i g n a l s and i n t e r a c t i o n s i n v o l v e d i n t r a n s c r i p t i o n o f 5S and tRNA genes. Brown and Gurdon (1977, 1978) demonstrated t h a t Xenopus 5S RNA genes i n t r oduced i n t o Xenopus oocy tes as h i g h mo lecu la r we ight DNA o r i n recombinant p lasmids were t r a n s c r i b e d t o produce a u t h e n t i c 5S RNA. B i r k e n m e i e r , Brown and Jordan (1978) and Ng, Pa rke r and Roeder (1979) subsequent ly prepared e x t r a c t s o f Xenopus oocy tes which c a r r i e d ou t t he accu ra te t r a n s c r i p t i o n o f c l oned 5S RNA genes. In each case the 3 ' end of 5S RNA mapped t o a c l u s t e r o f 4 T /A base p a i r s i n the DNA, which i f t r a n s c r i b e d encoded u r i d y l a t e r e s i d u e s . The m a j o r i t y o f t r a n s c r i p t s ended w i t h two such r e s i d u e s , but some he te rogene i t y was observed . I n a d d i t i o n t o a u t h e n t i c 5S RNA, a r e l a t e d s p e c i e s b e a r i n g a 3 ' t e r m i n a l e x t e n s i o n was o c c a s i o n a l l y produced i n the e x t r a c t s , o r i n i n t a c t oocy tes (Brown and Gurdon, 1978; B i rkenme ie r e t a l . , 1978) . In the c e l l - f r e e e x t r a c t , bo th 5S and the extended RNA accumulated a t cons tan t r a t e s a f t e r an i n i t i a l l a g , which c o u l d be e l i m i n a t e d by p r e i n c u b a t i o n of the e x t r a c t w i t h the DNA template i n the absence o f one n u c l e o s i d e t r i p h o s p h a t e . These r e s u l t s argued - 1 5 -a g a i n s t a p r e c u r s o r - p r o d u c t r e l a t i o n s h i p f o r the extended mo lecu le and 5S RNA and suggested i n s t e a d t h a t bo th were pr imary t r a n s c r i p t s o f the 5S gene. The 3 ' end o f mature 5S RNA was h e l d t o be the p roduc t o f s i t e - s p e c i f i c t e r m i n a t i o n o f t r a n s c r i p t i o n , and the extended RNA was thought t o be produced by polymerases wh ich read through the normal t e r m i n a t i o n s i t e and te rmina ted s h o r t l y downstream a t a second c l u s t e r o f 4 T / A base p a i r s i n the DNA. The p o s s i b i l i t y t h a t r a p i d p r o c e s s i n g r a t h e r than t e r m i n a t i o n gave r i s e t o the observed 3 ' ends was e f f e c t i v e l y l a i d t o r e s t by the r e s u l t s o f C o z z a r e l l i e t § ^ . ( 1 9 8 3 ) , who found t h a t pure RNA polymerase I I I f rom X . l a e v i s a c c u r a t e l y te rm ina ted t r a n s c r i p t i o n o f c l oned 5S RNA genes i n t he absence o f o the r p r o t e i n s . T r a n s c r i p t i o n was not i n i t i a t e d s p e c i f i c a l l y a t the beg inn ing o f the 5S gene i n t h i s system, but i t was s t i l l p o s s i b l e t o assay f o r c o r r e c t t e r m i n a t i o n by h y b r i d i z i n g the t r a n s c r i p t s t o a DNA probe which extended beyond the 3 ' end o f the 5S ced ing sequence f rom a s i t e w i t h i n the gene, and d i g e s t i n g the h y b r i d s w i t h RNase Tj_. The l eng th of the RNA fragments p r o t e c t e d f rom d i g e s t i o n p rov i ded a d i r e c t measure o f the d i s t a n c e between the 3 ' ends of the t r a n s c r i p t s and a f i x e d , w e l l - d e f i n e d s i t e w i t h i n the gene. Termina t ion a t the normal s i t e immediate ly downstream of the 5S sequences and a t s i t e s f u r t h e r downstream occu r red w i t h the same e f f i c i e n c y as i n the crude oocy te e x t r a c t . Termination S i g n a l s f o r RNA Polymerase I I I Brown and h i s c o l l e a g u e s have ana lyzed i n c o n s i d e r a b l e d e t a i l the sequences t h a t a re r e q u i r e d t o b r i n g about t e r m i n a t i o n o f t r a n s c r i p t i o n - 1 6 -by RNA polymerase I I I . In 1981, Bogenhagen, Sakon ju , and Brown repo r t ed t h a t a Xenopus 5S RNA gene l a c k i n g a l l but 4 n u c l e o t i d e s of i t s normal 3 ' f l a n k i n g sequence c o u l d s t i l l d i r e c t the s y n t h e s i s o f a u t h e n t i c 5S RNA i n a c e l l - f r e e e x t r a c t . On the o the r hand, a d e l e t i o n which extended 9 base p a i r s f u r t h e r upst ream, removing the l a s t 5 n u c l e o t i d e s of the 5S cod ing sequence as w e l l as the 3 ' f l a n k i n g sequences, comp le te l y a b o l i s h e d t e r m i n a t i o n a t the normal s i t e . These r e s u l t s f o r m a l l y demonstrate t h a t the d i s t a l boundary o f sequences r e q u i r e d f o r t r a n s c r i p t t e r m i n a t i o n r e s i d e s i n the 9 base p a i r sequence GGCTTTTGC which spans the t e r m i n a t i o n s i t e . The 5S gene and i t s normal f l a n k i n g sequences d i r e c t e d the s y n t h e s i s o f ah extended t r a n s c r i p t , as w e l l as a u t h e n t i c 5S RNA, i n the oocy te n u c l e a r e x t r a c t . T h i s t r a n s c r i p t te rm ina ted 8 n u c l e o t i d e s beyond the main 5S 3 ' t e r m i n a t i o n s i t e , i n a c l u s t e r o f 4 U r e s i d u e s . D e l e t i o n o f sequences downstream of the co r respond ing T / A t r a c t i n the DNA, t o w i t h i n 2 base p a i r s o f t he t r a c t i t s e l f , d i d not a f f e c t s y n t h e s i s o f t h e extended t r a n s c r i p t , but removal of 8 a d d i t i o n a l base p a i r s i n c l u d i n g the T / A c l u s t e r p revented the appearance o f the extended t r a n s c r i p t . The boundary r e g i o n f o r the t e r m i n a t i o n s i g n a l t h a t g i v e s r i s e t o t he extended t r a n s c r i p t has the sequence ACTTTTGC. Taken toge the r these r e s u l t s suggested t h a t an impor tan t component o f an RNA polymerase I I I t e r m i n a t i o n s i g n a l i s a c l u s t e r o f T /A base p a i r s l o c a t e d a t the s i t e o f t e r m i n a t i o n i t s e l f . The p o s s i b i l i t y t h a t sequences upstream of the T c l u s t e r a l s o form p a r t o f t he t e r m i n a t i o n s i g n a l had not been exc luded a t t h i s s t a g e . Bogenhagen and Brown (1981) conf i rmed the importance o f the T c l u s t e r t o t e r m i n a t i o n of 5S gene t r a n s c r i p t i o n . T h e y showed t h a t a gene wh ich r e t a i n e d the T c l u s t e r a t the main t e r m i n a t i o n s i t e and o n l y 2 base p a i r s o f normal downstream f l a n k i n g sequence gave r i s e t o normal 5S RNA, but a d e r i v a t i v e l a c k i n g the l a s t 3 Ts o f t he c l u s t e r c o u l d not suppor t t e r m i n a t i o n . They a l s o l o c a l i z e d the upstream boundary of t he t e r m i n a t i o n s i g n a l by j o i n i n g f ragments which i n c l u d e d the T c l u s t e r , and v a r y i n g l eng ths o f upstream f l a n k i n g sequence t o fragments c o n t a i n i n g the s i g n a l s r e q u i r e d f o r t r a n s c r i p t i n i t i a t i o n . A fragment c o n t a i n i n g o n l y 14 base p a i r s upstream of t he T c l u s t e r caused t e r m i n a t i o n w i t h i n the c l u s t e r when j o i n e d t o the f i r s t 83-115 base p a i r s o f the 5S gene, sugges t i ng t h a t sequences 14-36 base p a i r s upstream of the T c l u s t e r a r e not r e q u i r e d f o r t e r m i n a t i o n . I f sequences f u r t h e r upstream a re i n v o l v e d i n t e r m i n a t i o n , i t seems t h a t t h e i r d i s t a n c e from the T c l u s t e r i s o f no consequence. Fragments c o n t a i n i n g o n l y 3 o r 4 base p a i r s upstream o f the T c l u s t e r were j o i n e d t o the f i r s t 97 base p a i r s o f t he 5S gene and found t o cause t e r m i n a t i o n w i t h i n the T c l u s t e r . The e f f i c i e n c y o f t e r m i n a t i o n was reduced i n c o n s t r u c t s r e t a i n i n g o n l y 3 base p a i r s upstream of the T c l u s t e r , which l e d the au thors t o conc lude t h a t the immediate con tex t o f the T c l u s t e r i n f l u e n c e d the e f f i c i e n c y w i t h which i t c o u l d be r e c o g n i z e d . Any c l u s t e r o f 4 o r more T /A base p a i r s (T r e s i d u e s i n the sense DNA s t rand) f l a n k e d by G C - r i c h sequences was capab le o f f u n c t i o n i n g as a s i g n a l f o r t e r m i n a t i o n o f p o l I I I t r a n s c r i p t i o n . C l u s t e r s o f T / A base p a i r s f l a n k e d by a preponderance o f A /T base p a i r s f u n c t i o n e d i n e f f i c i e n t l y o r no t a t a l l as t e r m i n a t i o n s i g n a l s . - 1 8 -5S Transcript 3" End Generation in Other Systems Although the 3' end of the predominant primary transcript of Xenopus 5S genes coincides with that of mature RNA, precursors of 5S RNA bearing 3' terminal extensions have been detected in other organisms. Hamada et al.(1979) found that isolated nuclei of rat liver or HeLa cells produce, in addition to authentic 5S RNA, a molecule with 8 extra nucleotides at its 3' end. The extended 5S RNA was also detected by pulse-labelling cultured cells, and i t was shown to give rise to mature 5S RNA during a chase period. Tekamp et al.(1980) detected a similar 3'-extended "5S" RNA after transcription of a fraction of yeast chromatin enriched in ribosomal RNA genes with exogenous RNA polymerase III. In this case, the 3' termini of the extended transcripts were slightly heterogeneous, spanning a 7 nucleotide region. The extended transcripts could be converted to authentic 5S RNA by a processing activity present in the supernatant of the chromatin fraction. The sequence of the yeast 5S gene suggests that the 3' end of the 5S precursor is produced by transcript termination in response to the same signal as that recognized by Xenopus RNA polymerase III. The 3' end of the precursor maps precisely to a cluster of 8 consecutive T/A base pairs in the DNA. 3' End Generation in tRNA Gene Transcription Genes encoding transfer RNAs are also accurately transcribed upon injection into Xenopus oocytes or incubation with cell-free extracts derived from various cell types. DeRobertis and Olson (1979) reported that a yeast tE^NA*1^ gene is transcribed in Xenopus oocytes to produce a -19-molecu le which comigra tes w i t h mature t R N A ^ 3 - upon g e l e l e c t r o p h o r e s i s and a number o f l a r g e r m o l e c u l e s . The t ime course o f the r e a c t i o n showed these mo lecu les t o be p r e c u r s o r s of the mature s p e c i e s . A t r a n s c r i p t o f 108 n u c l e o t i d e s was i d e n t i f i e d as t h e p r imary t r a n s c r i p t because i t was the f i r s t and l a r g e s t p r e c u r s o r t o be s y n t h e s i z e d and because i t c o u l d be l a b e l l e d w i t h [ 3 2 P ] A T P . The authors d i d not p r e c i s e l y l o c a t e the 3' end o f t h i s m o l e c u l e , but i t c o u l d have been no more than a few n u c l e o t i d e s beyond the tRNA sequence, and i n t h i s r e g i o n a c l u s t e r o f 6 T / A base p a i r s i s p resen t i n the DNA. A s i m i l a r o r i d e n t i c a l t R N A T ^ r - r e l a t e d s p e c i e s has been i d e n t i f i e d i n yeas t c e l l s which a re d e f e c t i v e i n p r o c e s s i n g v a r i o u s p r e c u r s o r RNAs (Hopper and K u r j a n , 1981), sugges t i ng t h a t RNA p o l I I I f rom yeas t r ecogn i zes the same t e r m i n a t i o n s i g n a l as the Xenopus enzyme. S tand r i ng e t al.(1981) made s i m i l a r obse rva t i ons concern ing the t r a n s c r i p t i o n o f a yeas t t R N A L e u gene i n a HeLa c e l l e x t r a c t . In t h i s case the molecu le presumed t o be the p r imary t r a n s c r i p t had heterogeneous/3 ' t e r m i n i spanning a r e g i o n o f 6 n u c l e o t i d e s , 4-9 n u c l e o t i d e s d i s t a l t o the tRNA sequence, and co r respond ing p r e c i s e l y t o a s e r i e s o f 6 consecu t i ve T /A base p a i r s downstream o f t h e gene. F u r t h e r ev idence t h a t a c l u s t e r of T /A base p a i r s p rov i des the s i g n a l f o r tRNA gene t r a n s c r i p t t e r m i n a t i o n has come from s t u d i e s on the t r a n s c r i p t i o n o f mutant yeas t t R N A T ^ r genes i n Xenopus e x t r a c t s . K o s k i e t al.(1980) observed t h a t two d i f f e r e n t muta t ions i n t he SUP4 gene caused the s y n t h e s i s o f t r a n s c r i p t s which were c o n s i d e r a b l y s h o r t e r than the normal t R N A ' ^ r p r e c u r s o r . N e i t h e r sho r t t r a n s c r i p t seemed t o be the p roduc t of p r o c e s s i n g o f a l a r g e r m o l e c u l e . Sequence a n a l y s i s o f t he -20-shor tened t r a n s c r i p t s i n d i c a t e d t h a t both i n i t i a t e d a t the normal s i t e and te rm ina ted heterogeneous ly near the s i t e s o f the mutat ions i n t h e i r r e s p e c t i v e genes. One muta t ion c r e a t e d a c l u s t e r o f 6 consecu t i ve T r e s i d u e s i n the t r a n s c r i p t - i s o p a r a l l e l s t r a n d of the gene, 40-45 base p a i r s downstream of the i n i t i a t i o n s i t e , and the o the r produced a c l u s t e r s l i g h t l y f u r t h e r downstream. Te rm ina t i on a t the Tg c l u s t e r i n the f i r s t mutant appeared t o be about 80% e f f i c i e n t , w h i l e the T^ c l u s t e r f u n c t i o n e d as a t e r m i n a t i o n s i g n a l w i t h about 50% e f f i c i e n c y . The sequences f l a n k i n g each c l u s t e r were not p a r t i c u l a r l y G C - r i c h , which suggests t h a t perhaps a c l u s t e r o f 5 o r 6 c o n s e c u t i v e T / A base p a i r s i s e f f e c t i v e as a p o l I I I t e r m i n a t i o n s i g n a l i n any c o n t e x t . A l t e r n a t i v e l y , t e rm ina to r s i g n a l r e c o g n i t i o n i n tRNA gene t r a n s c r i p t i o n may d i f f e r s l i g h t l y f rom t h a t i n v o l v e d i n 5S gene e x p r e s s i o n . I t i s i n t e r e s t i n g t o note t h a t two muta t ions wh ich c r e a t e d c l u s t e r s o f 4, T /A base p a i r s w i t h i n the SUP4 gene d i d not cause premature t e r m i n a t i o n , p r o v i d i n g suppor t f o r t he n o t i o n t h a t t he l eng th o f a T c l u s t e r i s c r u c i a l t o i t s r e c o g n i t i o n as a t e r m i n a t o r . The t r a n s c r i p t i o n o f the same mutant SUP4 genes i n an e x t r a c t of yeas t c e l l s has been ana lyzed more r e c e n t l y by K o s k i e t a l . ( 1 9 8 2 ) . Mu ta t ions which c r e a t e d c l u s t e r s o f 5 o r 6 consecu t i ve T r e s i d u e s w i t h i n the gene cause t r a n s c r i p t i o n i n the y e a s t e x t r a c t t o te rm ina te upon r e a c h i n g these c l u s t e r s , j u s t as had been observed i n t he Xenopus e x t r a c t . In the same s tudy , the authors showed t h a t d e l e t i o n o f the T c l u s t e r immedia te ly downstream of the cod ing sequence a b o l i s h e d the s y n t h e s i s o f the normal t J * N A T v r p r e c u r s o r . Te rm ina t i on occu r red i n s t e a d a t the next c l u s t e r o f T r e s i d u e s . T h i s r e s u l t adds f o r c e t o the i d e a - 2 1 -t h a t the mechanism of t r a n s c r i p t t e r m i n a t i o n by RNA polymerase I I I has been w i d e l y conserved amongst e u c a r y o t e s . A c a u t i o n a r y note must be added i n l i g h t of the r e s u l t s o f Hopper and Kur jan (1981), who f a i l e d t o d e t e c t p remature ly te rm ina ted t r a n s c r i p t s o f the same mutant SUP4 genes i n yeas t c e l l s . A p o s s i b l e e x p l a n a t i o n f o r the d i s c r e p a n c y between r e s u l t s ob ta ined i n v i v o and i n v i t r o i s t h a t t he p remature ly te rm ina ted t r a n s c r i p t s were r a p i d l y degraded i n y e a s t . F u r t h e r ev idence i n suppor t of the i d e a t h a t RNA polymerase I I I f rom any eucaryo te r e c o g n i z e s the same type o f t e r m i n a t i o n s i g n a l was p rov ided by Watson e t a l . ( 1 9 8 4 ) . They found t h a t the RNA polymerase I I I ' i n a p r e p a r a t i o n c o n t a i n i n g a l l 3 n u c l e a r RNA polymerases f rom c a l f thymus te rm ina ted t r a n s c r i p t i o n of P v u I I - l i n e a r i z e d SV40 DNA s p e c i f i c a l l y i n a c l u s t e r o f 8 consecu t i ve T /A base p a i r s . In mammalian c e l l s , the pr imary t r a n s c r i p t s o f p o l I I I genes a r e g e n e r a l l y a s s o c i a t e d w i t h a 50 Kd p r o t e i n b e a r i n g an a n t i g e n i c determinant known as L a . S te fano (1984) p u r i f i e d the L a - a n t i g e n i c p r o t e i n f rom HeLa c e l l s and t e s t e d i t s a b i l i t y t o b i n d a v a r i e t y o f model p o l I I I t r a n s c r i p t s c o n s t r u c t e d by l i g a t i n g the 3 ' end of y e a s t t R N A p ^ e t o v a r i o u s o l i g o r i b o n u c l e o t i d e s . Model s u b s t r a t e s bea r i ng o l i g o u r i d y l a t e s t r e t c h e s o f 2-6 n u c l e o t i d e s a t the 3 ' end a l l bound t o the p r o t e i n i f i t was p resen t i n s u f f i c i e n t e x c e s s , bu t b i n d i n g r e a c t i o n s c a r r i e d out w i t h lower q u a n t i t i e s o f p r o t e i n showed t h a t i t p r e f e r e n t i a l l y bound s u b s t r a t e s w i t h 4 o r more 3 ' - t e r m i n a l u r i d y l a t e r e s i d u e s . P ro te in -RNA complexes i n v o l v i n g RNAs w i t h 4-6 3 ' - t e r m i n a l u r i d y l a t e r e s i d u e s were somewhat more s t a b l e t o s a l t and hepa r i n than those i n v o l v i n g RNAs w i t h s h o r t e r o l i g o u r i d y l a t e t a i l s . RNAs w i t h t a i l s ending i n a 3 ' -OH formed - 2 2 -much more s t a b l e complexes than those b e a r i n g a 3 ' phosphate group. Model s u b s t r a t e s w i t h t a i l s o f o the r n u c l e o t i d e s bound La a n t i g e n l e s s e f f i c i e n t l y than analogous o l i g o ( U ) - t a i l e d s u b s t r a t e s , and (U) 5OH d i s s o c i a t e d complexes c o n t a i n i n g s u b s t r a t e s w i t h non-U t a i l s more e a s i l y than those c o n t a i n i n g o l i g o ( U ) - t a i l e d s u b s t r a t e s . Normal t e r m i n a t i o n by p o l I I I produces p r imary t r a n s c r i p t s bea r i ng 3 ' - t e r m i n a l o l i g o ( U ) t r a c t s , and S t e f a n o ' s r e s u l t s suggest t h a t such t r a c t s may be impor tan t i n a l l o w i n g an t i gen La t o b i n d t o the t r a n s c r i p t s . S te fano suggested t h a t b i n d i n g o f La p r o t e i n might be r e q u i r e d f o r the p r o c e s s i n g or n u c l e a r l o c a l i z a t i o n o f p o l I I I t r a n s c r i p t s . I t might a l s o a f f o r d a means o f p r o t e c t i n g a u t h e n t i c pr imary t r a n s c r i p t s f rom d e g r a d a t i o n . In any even t , t he apparent a f f i n i t y o f the 3 ' ends of p o l I I I t r a n s c r i p t s f o r La a n t i g e n suggests t h a t c o r r e c t t e r m i n a t i o n o f t r a n s c r i p t i o n i s o f some consequence, not o n l y i n terms o f d e f i n i n g boundar ies o f e x p r e s s i o n i n the genome, but a l s o f o r metabo l ism o f the immediate p roduc ts o f gene e x p r e s s i o n . Genes T r a n s c r i b e d by RNA Polymerase I I 3 ' - T e r m i n a l P o l y ( A ) , and the O r i g i n o f E u c a r y o t i c mRNA Messenger RNA i n e u c a r y o t i c c e l l s was f i r s t r e c o g n i z e d , by ana logy w i t h the p r o p e r t i e s o f b a c t e r i a l messengers, as an uns tab le c l a s s o f p o l y s c m e - a s s o c i a t e d RNA which c o u l d bes t be observed a f t e r b r i e f l a b e l l i n g w i t h r a d i o a c t i v e RNA p r e c u r s o r s , and which had a broad s i z e d i s t r i b u t i o n and a base compos i t i on l i k e t h a t o f DNA (see Penman e t a l . , 1963; Penman, Vesco , and Penman, 1968) . P r i o r t o t h e advent o f cDNA c l o n i n g , the on l y i n d i v i d u a l mRNAs t o be i s o l a t e d were a few of those produced i n r e l a t i v e abundance by s p e c i f i c c e l l t y p e s , such as the g l o b i n mRNAs and , because o f t h e i r u n u s u a l l y s m a l l s i z e and c h a r a c t e r i s t i c p a t t e r n o f s y n t h e s i s , a few h i s t o n e mRNAs ( fo r rev iew see Lew in , 1975). Most i n d i v i d u a l mRNAs a r e i m p o s s i b l e t o i s o l a t e w i t hou t c l o n i n g because each c o n s t i t u t e s a ve ry sma l l f r a c t i o n of t he t o t a l mRNA p o p u l a t i o n i n t h e c e l l . On the o the r hand, t he comp lex i t y o f the p o p u l a t i o n as a whole makes i t s a n a l y s i s comp l i ca ted and means t h a t t he r e s u l t s o f such an a n a l y s i s do not n e c e s s a r i l y d e s c r i b e the p r o p e r t i e s o f any p a r t i c u l a r mRNA. In 1971, t h r e e groups repo r ted t h a t messenger RNA i s o l a t e d from human o r mouse c e l l s con ta ined f a i r l y l ong t r a c t s o f adenosine r e s i d u e s which c o u l d be de tec ted by v i r t u e o f t h e i r r e s i s t a n c e t o the combined a c t i o n o f RNases A and (Edmonds, Vaughan and Nakagato, 1971; L e e , Mendecki and Brawerman, 1971; D a r n e l l , Wa l l and T u s h i n s k i , 1971a) . S i m i l a r po l y (A ) t r a c t s were a l s o found i n t he heterogeneous RNA o f the nuc leus (hnRNA). Seve ra l exper imenta l approaches l e d t o the c o n c l u s i o n t h a t po ly (A) t r a c t s i n bo th mRNA and hnRNA a r e c o v a l e n t l y a t tached t o the 3 ' ends of the m o l e c u l e . A l k a l i n e h y d r o l y s i s of i s o l a t e d po ly (A) r e l e a s e d AMP and adenosine i n the r a t i o o f about 2 0 0 : 1 , sugges t ing a 3 ' - t e r m i n a l l o c a t i o n and a l eng th of about 200 r e s i d u e s f o r the po ly (A) t r a c t (Mendecki e t a l . , 1972; Nakazato e t a l . , 1973) . The presence of a f r e e 3'OH group on po l y (A ) i s o l a t e d from e i t h e r mRNA o r hnRNA was conf i rmed by i t s s u s c e p t i b i l i t y t o d i g e s t i o n w i t h nuc leases s p e c i f i c f o r 3'OH t e r m i n i (Mo l loy e t a l . , 1972; Sheldon e t a l . , 1972) . Po ly (A) i s o l a t e d by d i g e s t i o n o f hnRNA o r mRNA w i t h RNase T-^  was f r e e o f GMP r e s i d u e s , and t h a t r e l e a s e d by RNase A con ta ined no p y r i m i d i n e s , sugges t ing t h a t a l l c leavage s i t e s f o r these nuc leases r e s i d e d upstream of the po l y (A ) (Mo l loy and D a r n e l l , 1973). The r a p i d appearance of a [ H] adenos ine l a b e l i n cy top lasm ic po ly (A) suggested t h a t po ly (A) must be the l a s t p a r t o f an mRNA molecu le t o be s y n t h e s i z e d , which i s a l s o c o n s i s t e n t w i t h a 3 ' - t e r m i n a l l o c a t i o n (Mendecki e t a l . , 1972; Sheldon e t a l . , 1972) . The presence o f 3 ' - t e r m i n a l po ly (A) t r a c t s i n mRNA and hnRNA added t o a l i s t o f s i m i l a r i t i e s between the two c l a s s e s o f RNA which c o l l e c t i v e l y suggested t h a t mRNA might be d e r i v e d from hnRNA: both a re u n s t a b l e , they resemble t o t a l c e l l u l a r DNA i n t h e i r base compos i t i on , they e x h i b i t broad s i z e d i s t r i b u t i o n s , and the s y n t h e s i s o f bo th c l a s s e s i s i n h i b i t e d by l e v e l s of ac t i nomyc in D about t e n - f o l d h ighe r than the l e v e l s r e q u i r e d t o i n h i b i t r i bosomal RNA s y n t h e s i s . On the o the r hand, hnRNA i s on average much l a r g e r than mRNA, and i t s sequence comp lex i t y exceeds t h a t o f t he mRNA p o p u l a t i o n , u s u a l l y by a f a c t o r s i m i l a r t o the s i z e d i f f e r e n c e (see Lew in , 1980,pp .728-750) . The i n s t a b i l i t y and h igh comp lex i t y o f hnRNA i m p l i e d t h a t a l a r g e f r a c t i o n of the hnRNA s y n t h e s i z e d d u r i n g any g i v e n t ime p e r i o d s u f f e r e d r a p i d deg rada t i on w i t h i n the n u c l e u s . T h i s made i t d i f f i c u l t t o demonstrate t h a t a s i g n i f i c a n t f r a c t i o n of a r a d i o a c t i v e l a b e l i n hnRNA found i t s way i n t o mRNA. However, t he k i n e t i c s of l a b e l l i n g o f po ly (A) w i t h t r i t i a t e d adenos ine d i d suggest t h a t po ly (A) i s s y n t h e s i z e d i n the nuc leus and subsequent ly t r a n s p o r t e d t o the cy top lasm. D a r n e l l e t a l . (1971b) observed t h a t a f t e r a 15-minute p e r i o d of l a b e l l i n g , most o f the r a d i o a c t i v e po l y (A ) was l o c a t e d i n the nuc leus and t h a t the f r a c t i o n p resen t i n the cy top lasm i n c r e a s e d w i t h the l eng th o f t he l a b e l l i n g - 2 5 -p e r i o d . More d e t a i l e d obse rva t i ons were made by J e l i n e k e t a l . (1973) , who found t h a t over 90% of the po ly (A) l a b e l l e d i n a 1.5 minute p e r i o d was l o c a t e d i n the nuc leus and t h a t a f t e r l a b e l l i n g f o r 20 minutes or l o n g e r , the amount o f n u c l e a r po l y (A ) remained cons tan t , w h i l e t h a t i n the cy top lasm i n c r e a s e d l i n e a r l y . The amount o f po ly (A) i n the cy top lasm a f t e r a s h o r t p e r i o d of l a b e l l i n g con t i nued t o i n c r e a s e f o r 30-40 minutes i f f u r t h e r s y n t h e s i s was i n h i b i t e d w i t h 3 ' deoxyadenosine t r i p h o s p h a t e (co rdycep in t r i p h o s p h a t e ) . Dur ing the " co rdycep in chase" the amount o f n u c l e a r po ly (A) d e c l i n e d . The same au thors were unable t o d e t e c t any f r e e po ly (A) i n He la c e l l s , which suggested t h a t po l y (A ) was not assembled p r i o r t o i t s at tachment t o RNA, but i n s t e a d formed by the p o l y m e r i z a t i o n o f adeny la te r e s i d u e s onto an RNA p r i m e r . Edmonds e t a l . (1971) had i n i t i a l l y suggested t h a t po l y (A ) was s y n t h e s i z e d by t e m p l a t e - d i r e c t e d t r a n s c r i p t i o n because i t s s y n t h e s i s c o u l d be i n h i b i t e d by ac t i nomyc in D. However, doses of ac t i nomyc in D s u f f i c i e n t t o i n h i b i t t h e s y n t h e s i s of hnRNA and mRNA by over 90% had much l e s s d ramat i c e f f e c t s on the i n c o r p o r a t i o n o f l a b e l l e d adeny la te i n t o p o l y ( A ) , a t l e a s t d u r i n g s h o r t p e r i o d s of drug t reatment and l a b e l l i n g ( D a r n e l l e t a l . , 1971b; J e l i n e k e t . a l , 1973) . I n h i b i t i o n of po l y (A ) s y n t h e s i s became more severe over l onger p e r i o d s , but t h i s c o u l d have r e f l e c t e d the u t i l i z a t i o n o r e l i m i n a t i o n o f a l l a v a i l a b l e p r imers f o r po l y (A ) s y n t h e s i s , r a t h e r than a d i r e c t e f f e c t on t h e s y n t h e t i c p r o c e s s . Cordycep in t r i p h o s p h a t e i n h i b i t e d the i n c o r p o r a t i o n o f l a b e l l e d adenos ine i n t o n u c l e a r po l y (A ) over a 30 minute p e r i o d by 90%, but d u r i n g the same p e r i o d , s y n t h e s i s o f hnRNA was i n h i b i t e d by o n l y 50%, aga in sugges t i ng t h a t po l y (A ) was s y n t h e s i z e d by some p rocess o t h e r than t r a n s c r i p t i o n . Proof o f a p r e c u r s o r - p r o d u c t r e l a t i o n s h i p between hnRNA and mRNA r e q u i r e d t h a t t h e sequence of a p a r t i c u l a r mRNA be de tec ted i n a l a r g e r n u c l e a r RNA, and t h a t t he mRNA be shown t o a r i s e from t h e l a r g e r s p e c i e s i n a pu l se - chase exper iment . By h y b r i d i z i n g p u l s e - l a b e l l e d n u c l e a r RNA t o a cDNA probe prepared a g a i n s t g l o b i n mRNA, Ross (1976) de tec ted a 15S RNA c o n t a i n i n g g l o b i n sequences, as w e l l as mature g l o b i n mRNA of about 10S. Dur ing a chase w i t h u n l a b e l l e d n u c l e o t i d e s , t he l a b e l l e d 15S m a t e r i a l d i s a p p e a r e d , and l a b e l accumulated i n the 10S peak. G l o b i n mRNA t h e r e f o r e seemed t o be d e r i v e d from a p r e c u r s o r about 3 - f o l d l a r g e r than the message i t s e l f . Go ldberg e t a l . (1977) used the techn ique of UV t r a n s c r i p t i o n mapping t o show t h a t the average t r a n s c r i p t i o n u n i t i n He la c e l l s i s 4 - 7 - f o l d l a r g e r than the average mRNA, sugges t i ng t h a t many mRNAs i n mammalian c e l l s might be d e r i v e d from l a r g e r p r e c u r s o r s . T r a n s c r i p t Te rm ina t i on v s . 3' End P r o c e s s i n g The demonst ra t ion t h a t e u c a r y o t i c mRNAs may d e r i v e from l a r g e r p r e c u r s o r s r a i s e s ques t i ons o f whether the mRNAs and t h e i r p r e c u r s o r s share the same 3 ' t e r m i n i and of whether these 3 ' t e r m i n i a r e genera ted by t r a n s c r i p t t e r m i n a t i o n o r n u c l e o l y t i c p r o c e s s i n g . The f i r s t q u e s t i o n was answered i n the a f f i r m a t i v e f o r ft-globin mRNA and i t s 15S p r e c u r s o r , by G r o s v e l d and c o l l e a g u e s (1981). They used the S i nuc lease mapping procedure o f Berk and Sharp (1977) t o show t h a t the mRNA and i t s p r e c u r s o r were 3 ' - c o t e r m i n a l . The second q u e s t i o n i s more d i f f i c u l t t o answer, because the f a i l u r e t o d e t e c t t r a n s c r i p t s ex tend ing beyond a po l y (A ) s i t e c o u l d r e f l e c t e i t h e r t r a n s c r i p t t e r m i n a t i o n a t t h a t s i t e o r the r a p i d deg rada t i on of d i s t a l p o r t i o n s of the t r a n s c r i p t . Two approaches have been used t o d e t e c t s h o r t - l i v e d t r a n s c r i p t sequences ( rev iewed by D a r n e l l , 1982) . The f i r s t employs ve ry sho r t p u l s e - l a b e l s of l i v i n g c e l l s . Fo r t h i s approach t o be u s e f u l , t h e s p e c i e s o f i n t e r e s t must be s y n t h e s i z e d a t h i g h r a t e s , t o a l l o w i t t o be d e t e c t a b l y l a b e l l e d i n a sho r t t ime i n t e r v a l . The second approach i n v o l v e s l a b e l l i n g nascent t r a n s c r i p t s which have been i n i t i a t e d i n v i v o by a l l o w i n g t h e i r e l o n g a t i o n t o con t i nue i n i s o l a t e d n u c l e i i n the presence of r a d i o a c t i v e n u c l e o s i d e t r i p h o s p h a t e s . T h i s approach would not n e c e s s a r i l y y i e l d meaningfu l r e s u l t s i f t r a n s c r i p t e l o n g a t i o n c o u l d con t i nue i n d e f i n i t e l y i n i s o l a t e d n u c l e i , because i t might proceed beyond s i t e s a t which i t would te rm ina te i n v i v o . However, o n l y a few hundred n u c l e o t i d e s a re added t o nascent t r a n s c r i p t s a f t e r n u c l e a r i s o l a t i o n , and new c h a i n s a re not i n i t i a t e d (Weber e t a d , 1977) . There fo re t h e d i s t r i b u t i o n o f l a b e l l e d t r a n s c r i p t ends shou ld r e f l e c t t h e i r d i s t r i b u t i o n p r i o r t o the i s o l a t i o n o f n u c l e i , t o w i t h i n a few hundred n u c l e o t i d e s . V i r a l t r a n s c r i p t s a r e u s e f u l s u b j e c t s f o r the s tudy of t r a n s c r i p t i o n and RNA p r o c e s s i n g because i n many cases they a r e s y n t h e s i z e d a t h i g h r a t e s d u r i n g l y t i c i n f e c t i o n . D a r n e l l and h i s c o l l e a g u e s s i z e - f r a c t i o n a t e d p u l s e - l a b e l l e d nascent RNA syn thes i zed l a t e i n adenov i rus i n f e c t i o n and t e s t e d the a b i l i t y of each f r a c t i o n t o h y b r i d i z e t o v a r i o u s r e s t r i c t i o n fragments of adenov i rus DNA. T h e i r r e s u l t s i n d i c a t e d t h a t most o f the l a t e adenov i rus t r a n s c r i p t s were d e r i v e d from a s i n g l e t r a n s c r i p t i o n a l u n i t , which began near map u n i t 16 and con t inued - 2 8 -a t l e a s t as f a r as map u n i t 99 , near the end of the genome (Weber e t a l , 1977) . F i v e d i f f e r e n t s e t s o f 3 ' c o t e r m i n a l mRNAs a re produced from t h i s t r a n s c r i p t i o n u n i t by p o l y a d e n y l a t i o n a t each o f 5 d i f f e r e n t s i t e s . Nev ins and D a r n e l l (1978) showed t h a t r e s t r i c t i o n f ragments i n c l u d i n g any o f the 5 p o l y a d e n y l a t i o n s i t e s h y b r i d i z e d t o equ imolar amounts o f p u l s e - l a b e l l e d n u c l e a r RNA from i n f e c t e d c e l l s . In f a c t , t r a n s c r i p t i o n con t i nued a t the same l e v e l beyond the l a s t p o l y a d e n y l a t i o n s i t e , which c l e a r l y i n d i c a t e d t h a t none of the p o l y a d e n y l a t i o n s i t e s served t o cause t r a n s c r i p t i o n t o t e r m i n a t e . F r a s e r e t a l . (1979a) p rov i ded c o r r o b o r a t i n g ev idence by showing t h a t nonpo lyadeny la ted n u c l e a r t r a n s c r i p t s con ta ined o l i g o n u c l e o t i d e s encoded downstream of the l a s t p o l y a d e n y l a t i o n s i t e , a l though these o l i g o n u c l e o t i d e s were absent f rom po l yadeny la ted n u c l e a r t r a n s c r i p t s and c y t o p l a s m i c RNA. The s e n s i t i v i t y t o UV i r r a d i a t i o n o f t r a n s c r i p t i o n downstream o f t he l a s t po ly (A) s i t e suggested t h a t t h i s t r a n s c r i p t i o n d i d o r i g i n a t e a t the major l a t e i n i t i a t i o n s i t e a t map u n i t 16 .4 . T r a n s c r i p t i o n beyond p o l y a d e n y l a t i o n s i t e s i s not a p e c u l i a r i t y o f the adenov i rus major l a t e t r a n s c r i p t i o n u n i t . Nev ins e t a l . (1980) showed t h a t p u l s e - l a b e l l e d RNA s y n t h e s i z e d e a r l y i n adenov i rus i n f e c t i o n i n c l u d e d molecu les d e r i v e d from e a r l y t r a n s c r i p t i o n u n i t s 2 and 4 wh ich extended beyond the r e s p e c t i v e po ly (A) a d d i t i o n s i t e s o f those u n i t s . The s i z e of the nascent t r a n s c r i p t s and UV t r a n s c r i p t i o n mapping i n d i c a t e d t h a t t r a n s c r i p t i o n beyond the po l y (A ) s i t e s was no t t h e r e s u l t o f t e r m i n a t i o n and r e i n i t i a t i o n , but r a t h e r was due t o the ex tens ion of t r a n s c r i p t s i n i t i a t e d a t the promoters o f e a r l y r e g i o n s 2 and 4 . Fo rd and Hsu (1978) t e s t e d p u l s e - l a b e l l e d RNA from S V 4 0 - i n f e c t e d - 2 9 -c e l l s f o r i t s a b i l i t y t o h y b r i d i z e w i t h r e s t r i c t i o n f ragments c o l l e c t i v e l y r e p r e s e n t i n g the e n t i r e SV40 genome and found t h a t t r a n s c r i p t i o n o r i g i n a t i n g a t the SV40 l a t e i n i t i a t i o n s i t e r e g u l a r l y proceeded a t l e a s t 1000 n u c l e o t i d e s beyond the 3 ' t e r m i n i o f the l a t e SV40 mRNAs. T r a n s c r i p t i o n has s i n c e been shown t o con t inue beyond the p o l y a d e n y l a t i o n s i t e s o f s e v e r a l c e l l u l a r t r a n s c r i p t i o n u n i t s . Ho fe r and D a r n e l l (1981) l a b e l l e d nascent t r a n s c r i p t s i n i s o l a t e d n u c l e i o f DMSO-induced e ry th ro leukemia c e l l s and t e s t e d f o r h y b r i d i z a t i o n t o c loned fragments o f the ft -major g l o b i n t r a n s c r i p t i o n u n i t . They found t h a t t he l a b e l l e d t r a n s c r i p t s h y b r i d i z e d i n equ imolar amounts t o each o f a s e r i e s of r e s t r i c t i o n fragments spanning a r e g i o n from the i n i t i a t i o n s i t e t o 1 kb beyond t h e p o l y a d e n y l a t i o n s i t e . The h y b r i d i z i n g t r a n s c r i p t s were a l l encoded by the sense DNA s t r a n d , and the minimum s i z e o f t r a n s c r i p t s h y b r i d i z i n g t o a p a r t i c u l a r DNA fragment r e f l e c t e d the d i s t a n c e of t h a t fragment f rom the cap s i t e , sugges t i ng t h a t a l l o f the h y b r i d i z i n g t r a n s c r i p t s o r i g i n a t e d a t t he cap s i t e . Weintraub e t a l . (1981) r epo r t ed t h a t t r a n s c r i p t i o n of the of - g l o b i n genes i n ch i cken embryos proceed f o r s e v e r a l hundred n u c l e o t i d e s beyond the r e s p e c t i v e po l y (A ) s i t e s , and s i m i l a r o b s e r v a t i o n s r e g a r d i n g the d - g l o b i n gene i n e ry th ro leukemia c e l l s (She f f e r y e t al_. ,1984) and the r a b b i t ^ ^ g l o b i n gene i n f e t a l l i v e r c e l l s (Rohrbaugh e t a l . , 1 9 8 5 ) have been p u b l i s h e d more r e c e n t l y . Hagenbuchle e t a l^ . (1984) found t h a t t r a n s c r i p t i o n of t he mouse ot -amylase gene Pmy*a proceeded w e l l beyond the p o l y a d e n y l a t i o n s i t e . In each o f these s t u d i e s , nascent t r a n s c r i p t s l a b e l l e d i n i s o l a t e d n u c l e i were h y b r i d i z e d t o c l oned fragments o f genomic DNA. - 3 0 -Whether or not transcription proceeded beyond poly(A) sites in a l l genes was u n t i l recently a natter of controversy. Roop et a l . (1980) had shown that the largest ovalbumin mRNA precursor detectable i n steady-state RNA populations shared the same 3' end as the mature message, and Tsai et a l . (1980) were unable to find evidence of transcription downstream of the poly(A) site using pulse-labelled RNA. The authors concluded that transcription terminated at or very near the poly(A) s i t e . However, LeMeur et al.(1984) have recently shown that transcription proceeds at least 900 nucleotides beyond the poly(A) site, terminating within the next 170 nucleotides. It seems reasonable to conclude that poly(A) sites in higher eucaryotes are sites of nucleolytic processing and are not generally sites of transcript termination. Earlier failures to detect transcripts of sequences distal to the poly(A) site of the ovalbumin gene must be attributed to the i n s t a b i l i t y of such transcripts. Hofer and Darnell (1981) showed that transcribed sequences downstream of the globin poly(A) site are confined to the nucleus and are very unstable, exhibiting substantial turnover within a 3-minute labelling period. Those portions of the major late primary transcript of adenovirus which are dis t a l to the last poly(A) site are similarly confined to the nucleus, but their rate of accumulation i n the nucleus with increasing labelling periods suggests a h a l f - l i f e of about 20 min., similar to the average h a l f - l i f e of hnRNA in the host cells (Fraser et a l . , 1979a). Termination Sites for RNA Polymerase II Transcription Precise transcript termination at the end of any RNA pol II transcription unit has yet to be demonstrated. -31-T r a n s c r i p t i o n o f t h e major l a t e a d e n o v i r u s t r a n s c r i p t i o n u n i t a p p e a r s t o t e r m i n a t e w i t h i n t h e l a s t 2% o f t h e genome l e n g t h , a r e g i o n o f about 700 b p . A l t h o u g h n a s c e n t l a t e t r a n s c r i p t s h y b r i d i z e i n e q u i m o l a r amounts t o a l l r e g i o n s o f t h e genome between map u n i t s 1 6 . 4 and 9 8 . 2 , much l o w e r l e v e l s o f h y b r i d i z a t i o n t o a f r a g m e n t s p a n n i n g map u n i t s 9 8 . 2 - 1 0 0 were d e t e c t e d by F r a s e r e t a l . ( 1 9 7 9 a ) . No more t h a n a m i n o r i t y o f t h e p o l y m e r a s e complexes t r a n s c r i b i n g t h e m a j o r l a t e t r a n s c r i p t i o n u n i t c a n c o n t i n u e a l l t h e way t o t h e end o f t h e genome, b u t t h e d a t a do n o t a l l o w t h e p r e c i s e s i t e ( s ) o f t e r m i n a t i o n t o be d e d u c e d . E l e c t r o n m i c r o s c o p i c a n a l y s i s o f t r a n s c r i p t i o n complexes i n t h e major l a t e t r a n s c r i p t i o n a l u n i t s i m i l a r l y s u g g e s t e d t h a t t e r m i n a t i o n o c c u r s w i t h i n t h e l a s t 650 bp o f t h e genome ( F r a s e r and H s u , 1 9 8 0 ) . H o f e r e t a l . (1982) a t t e m p t e d t o l o c a l i z e t h e t e r m i n a t i o n s i t e f o r ft - g l o b i n gene t r a n s c r i p t i o n . I n agreement w i t h t h e i r e a r l i e r s t u d y , t h e y f o u n d t h a t t r a n s c r i p t s l a b e l l e d i n i s o l a t e d n u c l e i o f e r y t h r o l e u k e m i a c e l l s h y b r i d i z e d i n e q u i m o l a r amounts t o r e s t r i c t i o n f r a g m e n t s f r o m w i t h i n t h e c o d i n g r e g i o n and f r o m as f a r a s 1400 bp downstream o f t h e p o l y ( A ) s i t e . C o n s i d e r a b l y l o w e r l e v e l s o f h y b r i d i z a t i o n t o a fragment l o c a t e d 1400-2000 bp downstream o f t h e p o l y ( A ) s i t e were o b s e r v e d , and h y b r i d i z a t i o n t o a f r a g m e n t i m m e d i a t e l y downstream was a l m o s t u n d e t e c t a b l e . The r e s u l t s s u g g e s t e d t h a t o v e r 95% o f t h e p o l y m e r a s e s w h i c h t r a n s c r i b e t h e ft-globin gene t e r m i n a t e i n a r e g i o n 1400-2000 n u c l e o t i d e s downstream o f t h e p o l y ( A ) s i t e , b u t no e v i d e n c e c o u l d be f o u n d f o r a d i s c r e t e t e r m i n a t i o n s i t e . A r e p o r t o f a d i s c r e t e t e r m i n a t i o n s i t e f o r ft - m a j o r g l o b i n t r a n s c r i p t s ( S a l d i t t - G e o r g i e f f and D a r n e l l , 1983) was l a t e r r e t r a c t e d ( S a l d i t t - G e o r g i e f f and D a r n e l l , 1984) . C i t r o n e t a l . ( 1 9 8 4 ) a l s o f a i l e d t o demonstrate t e r m i n a t i o n a t a d i s c r e t e s i t e d i s t a l t o the ^ - g l o b i n gene. T r a n s c r i p t i o n of the mouse Amy 0C-amylase gene does not t e rm ina te a t a w e l l - d e f i n e d s i t e (Hagenbuchle e t a l . , 1 9 8 4 ) . The l e v e l o f h y b r i d i z a t i o n o f nascent t r a n s c r i p t s , l a b e l l e d by l i m i t e d e x t e n s i o n i n i s o l a t e d n u c l e i , t o c loned DNA fragments i n d i c a t e d t h a t the number o f polymerases on the DNA templa te g r a d u a l l y drops over a 2 kb r e g i o n , 2-4 kb downstream o f the po ly (A) s i t e . N u c l e a r , non-po lyadeny la ted t r a n s c r i p t s spanning the Amy^ a po ly (A) s i t e were de tec ted i n p a n c r e a t i c n u c l e i , and t h e i r 3 ' t e r m i n i were mapped by S-^  nuc lease d i g e s t i o n o f the h y b r i d s formed between these t r a n s c r i p t s and 3 ' e n d - l a b e l l e d DNA r e s t r i c t i o n f ragments ex tend ing beyond the po ly (A) s i t e . Heterogeneous t e r m i n i were de tec ted throughout the r e g i o n 2 .5-4 kb downstream of the po ly (A) s i t e . I f a d i s c r e t e t e r m i n a t i o n s i t e e x i s t e d f o r the Amy^ a gene, t he heterogeneous d i s t r i b u t i o n o f 3 ' ends c o u l d r e s u l t f rom r a p i d e x o n u c l e o l y t i c deg rada t i on of the te rmina ted t r a n s c r i p t s . However, the d i l u t i o n o f polymerases r e v e a l e d by h y b r i d i z a t i o n a n a l y s i s o f nascent c h a i n s i s i ncompa t i b l e w i t h t e r m i n a t i o n a t a s i n g l e s i t e , and t oge the r the da ta suggest t h a t t e r m i n a t i o n occu rs a t many s i t e s over a r e g i o n of about 2 k b . The major l a t e t r a n s c r i p t i o n u n i t o f adenov i rus i s a c t i v e a t e a r l y s tages o f i n f e c t i o n , though i t s a c t i v i t y i s about 3 0 - f o l d lower than a f t e r DNA r e p l i c a t i o n beg ins (F rase r e t a l . , 1979b). The same techn iques t h a t were used t o a n a l y z e l a t e t r a n s c r i p t i o n have been brought t o bear upon the " e a r l y " t r a n s c r i p t s of the major l a t e t r a n s c r i p t i o n u n i t . H y b r i d i z a t i o n o f p u l s e - l a b e l l e d RNA t o c l oned r e s t r i c t i o n f ragments and - 3 3 -UV t r a n s c r i p t i o n mapping, i n d i c a t e t h a t p r i o r t o v i r a l DNA r e p l i c a t i o n t r a n s c r i p t i o n from the major l a t e promoter t e rm ina tes be fo re r e a c h i n g map u n i t 70 (Nevins and W i l s o n , 1981) . A l though the s i t e ( s ) o f t e r m i n a t i o n of these e a r l y t r a n s c r i p t s c l e a r l y d i f f e r f rom those u t i l i z e d l a t e r i n i n f e c t i o n , no ev idence f o r p r e c i s e t e r m i n a t i o n a t w e l l - d e f i n e d s i t e s e x i s t s i n e i t h e r c a s e . P u l s e - l a b e l l e d nascent RNA cha ins from the major l a t e t r a n s c r i p t i o n a l u n i t e x h i b i t a bimodal s i z e d i s t r i b u t i o n i n d i c a t i v e o f some s o r t o f d i s c o n t i n u i t y i n t r a n s c r i p t i o n about 2000 bp downstream of the major l a t e promoter (Evans e t a l . , 1979) . The au thors a t t r i b u t e d the d i s c o n t i n u i t y t o premature t e r m i n a t i o n . They t e s t e d t h e i r hypo thes i s by h y b r i d i z i n g b r i e f l y - l a b e l l e d nuc lea r RNA t o v a r i o u s r e s t r i c t i o n f ragments under c o n d i t i o n s o f DNA e x c e s s . T r a n s c r i p t s from the f i r s t 2 kb o f t he l a t e t r a n s c r i p t i o n u n i t were p resen t i n a 3-6 f o l d molar excess over t r a n s c r i p t s o f more p r o m o t e r - d i s t a l sequences (Evans e t a l . , 1979) . F r a s e r e t a l . (1979b) de tec ted a s e r i e s o f major l a t e p romoter -p rox ima l t r a n s c r i p t s 100-800 n u c l e o t i d e s long amongst the RNA l a b e l l e d over a 5 h r p e r i o d l a t e i n i n f e c t i o n . A n a l y s i s o f o l i g o n u c l e o t i d e s r e l e a s e d from the heterogeneous t r a n s c r i p t s by RNase T-^  suggested t h a t many o f the t r a n s c r i p t s i n i t i a t e d a t the same s i t e as t h e major l a t e t r a n s c r i p t . Two- th i rds o r more of the t r a n s c r i p t s i n i t i a t e d a t the major l a t e promoter appa ren t l y t e rm ina te w i t h i n 2 kb o f the promoter , but i f a s p e c i f i c t e r m i n a t i o n s i t e e x i s t s w i t h i n t h i s r e g i o n , i t s a c t i v i t y i s obscured i n these s t u d i e s by subsequent deg rada t ion of the te rm ina ted t r a n s c r i p t s . Mok e t al_. (1984) have found t h a t premature t e r m i n a t i o n o f t r a n s c r i p t i o n i n the major l a t e t r a n s c r i p t i o n u n i t o f adenov i rus occurs - 3 4 -o n l y a t l a t e s tages o f i n f e c t i o n and genera tes two predominant t r a n s c r i p t s of 120 and 175 n u c l e o t i d e s . The l a r g e r p rematu re l y - te rm ina ted t r a n s c r i p t s seen by F r a s e r e t a l . were not ev iden t i n t h i s s tudy . T r a n s c r i p t t e r m i n a t i o n has been repo r ted t o occur a t a s p e c i f i c s i t e i n the l a t e t r a n s c r i p t i o n u n i t o f SV40. Hay e t a l . (1982) i s o l a t e d the n u c l e i o f S V 4 0 - i n f e c t e d c e l l s and ana l yzed the RNA t h a t became l a b e l l e d when the n u c l e i were b r i e f l y i ncuba ted w i t h 0C[^^P]UTP. A prominent RNA f r a c t i o n o f sed imen ta t ion c o e f f i c i e n t 5S was d e t e c t e d , wh ich h y b r i d i z e d t o r e s t r i c t i o n fragments p rox ima l t o the SV40 promoter r e g i o n . The au thors l a t e r demonstrated i t s r e l e a s e f rom the templa te (Hay and A l o n i , 1984) , thereby e x c l u d i n g the p o s s i b i l i t y t h a t t he RNA was a t r a n s i t o r y s p e c i e s r e s u l t i n g f rom paus ing of RNA po lymerase . Pre t rea tment o f t he c e l l s w i t h DRB, wh ich i s b e l i e v e d t o enhance premature t e r m i n a t i o n , a l though not n e c e s s a r i l y a t t e r m i n a t i o n s i t e s u t i l i z e d i n i t s absence , (F rase r e t a l . , 1978 ;1979b ) i n c r e a s e d the l e v e l s o f the 94 n u c l e o t i d e , 5S s p e c i e s ( S k o l n i k - D a v i d e t a l . , 1982). V a r i o u s authors have suggested t h a t premature t e r m i n a t i o n of t r a n s c r i p t i o n i s a common occur rence d u r i n g t r a n s c r i p t i o n o f nuc l ea r genes . The sugges t i on i s based on obse rva t i ons of a heterogenous p o p u l a t i o n of s h o r t , capped t r a n s c r i p t s i n the n u c l e i o f v a r i o u s c e l l l i n e s ( S a l d i t t - G e o r g i e f f e t a l . , 1983). These t r a n s c r i p t s form a d i s t i n c t peak upon s i z e - f r a c t i o n a t i o n of t o t a l n u c l e a r RNA, sugges t i ng t h a t a d i s c o n t i n u i t y o f some s o r t , perhaps a t e r m i n a t i o n s i t e , occu rs w i t h i n a few hundred base p a i r s o f many c e l l u l a r p romoters . There has been no p r o o f , however, t h a t these t r a n s c r i p t s a r i s e because of t e r m i n a t i o n a t d i s c r e t e s i t e s i n t h e gencme. Tamm and K i k u c h i (1979) found t h a t most o f the [ HjUridine incorporated by isolated HeLa cell nuclei entered short transcripts of 1-300 nucleotides, suggesting a numerical excess of short nascent transcripts over longer ones. Pulse-chase experiments gave, ambiguous results, since the failure of a radioactive label in short RNA to enter longer RNA during a chase could have reflected either termination or the demise of the transcriptional apparatus in the isolated nuclei. Conversely, the production of larger labelled RNA molecules during the chase could have indicated that no promoter-proximal termination sites exist, or that they are not active in isolated nuclei. Termination Signals for RNA Polymerase II Since little evidence exists for sequence-specific termination of transcription by RNA polymerase II, it is reasonable to suspect that signals which specify exact termination sites are rare amongst polll transcription units. Termination does, however, occur reproducibly within broadly defined regions of the template, and signals might exist which establish the boundaries of such regions. Falck-Pedersen et al. (1985) introduced the 1.5 kb termination region of the mouse ^ -major globin gene into the adenovirus ElA transcriptional unit. They found that transcription which initiated at the ElA promoter terminated within the inserted globin sequence, suggesting that the insert indeed carries some sort of termination signal. Hagenbuchle et al. (1984) suggested a variety of forms which a "sloppy" termination signal might take, including the presence of a downstream transcription unit, or a particular pattern of DNA modification or chromatin structure. Termination might result from the absence of some condition which f a c i l i t a t e s t r a n s c r i p t e l o n g a t i o n . For example the r e g i o n between a promoter and the l a s t p o l y a d e n y l a t i o n s i t e o f a t r a n s c r i p t i o n u n i t might be ma in ta ined i n a r e l a t i v e l y open chromat in s t r u c t u r e wh ich o f f e r s l i t t l e o r no h indrance t o t h e movement o f t he t r a n s c r i p t i o n complex. Beyond the p o l y a d e n y l a t i o n s i t e , a more compact chromat in s t r u c t u r e might l e a d t o more f requen t and extended paus ing of t h e polymerase and so i n c r e a s e the p r o b a b i l i t y o f t e r m i n a t i o n and t r a n s c r i p t r e l e a s e . The s y n t h e s i s o f d i s c r e t e premature ly te rm ina ted t r a n s c r i p t s o f SV40 suggests t h a t RNA polymerase I I i s capab le of s i t e - s p e c i f i c t e r m i n a t i o n i n response t o an a p p r o p r i a t e s i g n a l . Hay et_ a l . ( 1 9 8 2 ) have es t imated the l o c a t i o n o f the 3 ' end o f t he 94 n u c l e o t i d e p remature ly te rm ina ted RNA, and they f i n d t h a t the 3 ' t e r m i n a l sequence bears c o n s i d e r a b l e resemblance t o a rho- independent b a c t e r i a l t e r m i n a t o r . The RNA appears t o end i n a s e r i e s of U r e s i d u e s encoded by 4 consecu t i ve T / A base p a i r s i n the DNA. Immediately p reced ing the U t r a c t i n t h e RNA i s a G C - r i c h sequence w i t h dyad symmetry, wh ich shou ld be capable o f fo rming a s t a b l e s tem-and- loop s t r u c t u r e . The au tho rs suggest t h a t t e r m i n a t i o n a t t h i s s i t e occu rs by e s s e n t i a l l y the same mechanism as t e r m i n a t i o n a t a rho- independent t e rm ina to r i n b a c t e r i a , which i s t o say t h a t RNA polymerase pauses upon t r a n s c r i b i n g the p o t e n t i a l s tem-and- loop s t r u c t u r e and r e l e a s e s the t r a n s c r i p t w h i l e paused, r e l e a s e be ing f a c i l i t a t e d by the i n s t a b i l i t y of the rU-dA base p a i r s between t r a n s c r i p t and t emp la te . Paus ing by RNA polymerase i n S V 4 0 - i n f e c t e d c e l l s a t t he SV40 a t t enua to r s i t e has s i n c e been demonstrated ( S k o l n i k - D a v i d and A l o n i , 1983) . Exper iments d e s c r i b e d by H a t f i e l d e t a l . (1983) suppor t t he i d e a t h a t e u c a r y o t i c RNA polymerases may respond i n t he same way as - 3 7 -t h e b a c t e r i a l enzymes t o s e q u e n c e s w i t h t h e c a r d i n a l f e a t u r e s o f r h o - i n d e p e n d e n t t e r m i n a t o r s . T h e s e w o r k e r s l i n k e d t h e m a j o r l a t e p r o m o t e r o f a d e n o v i r u s t o a t e r r n i n a t o r f r o m b a c t e r i o p h a g e ^ and a l l o w e d t h e r e s u l t i n g c o n s t r u c t t o be t r a n s c r i b e d i n a HeLa c e l l e x t r a c t . " R u n o f f " f r o m t h e e n d o f t h e t e m p l a t e p r o d u c e d a 311 n u c l e o t i d e RNA, b u t a 2 7 3 n u c l e o t i d e s p e c i e s was a l s o p r o d u c e d . I t s 3 ' end mapped t o w i t h i n a f e w n u c l e o t i d e s o f t h e c o r r e s p o n d i n g s i t e o f t e r m i n a t i o n i n A - i n f e c t e d E . c o l i , i n a s e r i e s o f b a s e p a i r s i m m e d i a t e l y d o w n s t r e a m o f a G C - r i c h d y a d symmet ry . A n a n a l y s i s o f t h e t i m e c o u r s e o f t h e i n v i t r o t r a n s c r i p t i o n showed t h a t t h e p o l y m e r a s e p a u s e d upon r e a c h i n g t h e i n s e r t e d t e r m i n a t o r s e q u e n c e and a f t e r p a u s i n g , e i t h e r c o n t i n u e d s y n t h e s i s o f t h e r u n o f f t r a n s c r i p t o r , a b o u t 30% o f t h e t i m e , t e r m i n a t e d t o p r o d u c e t h e 273 n u c l e o t i d e s p e c i e s . N e i t h e r o f two o t h e r t e r m i n a t o r s f r o m phage c a u s e d p a u s i n g o r t e r m i n a t i o n b y RNA p o l y m e r a s e I I i n HeLa c e l l s ( u n p u b l i s h e d work c i t e d by H a t f i e l d e t a l . , 1 9 8 3 ) a l t h o u g h o n e o f t h o s e t e s t e d i s a t y p i c a l r h o - i n d e p e n d e n t t e r m i n a t o r . E u c a r y o t i c RNA p o l y m e r a s e I I c a n a p p a r e n t l y r e s p o n d t o some o f t h e t e r m i n a t o r s r e c o g n i z e d by t h e E . c o l i e n z y m e , b u t f e a t u r e s w h i c h a r e n o t f o u n d i n t h e s e t e r m i n a t o r s may be r e q u i r e d f o r e f f i c i e n t t e r m i n a t i o n . Of c o u r s e , e f f i c i e n t t e r m i n a t i o n a t a s i n g l e s i t e d o e s n o t seem t o b e t h e r u l e amongst RNA p o l y m e r a s e I I t r a n s c r i p t i o n u n i t s . P o l y a d e n y l a t i o n S i g n a l s i n " H i g h e r " E u c a r y o t e s S i g n a l s w h i c h s p e c i f y s i t e s o f p o l y a d e n y l a t i o n f o r p o l y m e r a s e I I t r a n s c r i p t s s e r v e f u n c t i o n s a n a l o g o u s t o t h o s e o f t h e t e r m i n a t i o n s i g n a l s i n o t h e r t y p e s o f t r a n s c r i p t i o n u n i t i n a s m u c h a s t h e y s e t d o w n s t r e a m l i m i t s t o t h e r e g i o n s o f t h e genome w h i c h c a n be e x p r e s s e d f r o m - 3 8 -p a r t i c u l a r p romoters . Even though t r a n s c r i p t i o n seems t o proceed beyond a c t i v e p o l y a d e n y l a t i o n s i t e s , t h e t r a n s c r i p t s so produced never f i n d t h e i r way out o f the nuc leus and a re r a p i d l y degraded. S i t e s o f p o l y a d e n y l a t i o n a re much more p r e c i s e l y s p e c i f i e d than a re s i t e s o f t e r m i n a t i o n f o r polymerase I I t r a n s c r i p t s , and consequent ly t he t ask of i d e n t i f y i n g the s i g n a l s i n v o l v e d i n p o l y a d e n y l a t i o n i s s imp le r i n p r i n c i p l e than t h a t o f f i n d i n g polymerase I I t e r m i n a t o r s . In 1976, Proud foo t and Brownlee compared the sequences f l a n k i n g the po l y (A ) t a i l s o f s i x e u c a r y o t i c messenger RNAs and n o t i c e d t h a t the hexanuc leo t i de AAUAAA was common t o a l l s i x . I t occu r red about 20 n u c l e o t i d e s upstream of the po l y (A ) t a i l , and the au tho rs suggested t h a t i t might c o n s t i t u t e some s o r t o f s i g n a l i n v o l v e d i n mRNA p r o c e s s i n g o r t r a n s p o r t . Subsequent DNA sequencing s t u d i e s and t r a n s c r i p t mapping have shown t h a t the sequence AAUAAA i s indeed w i d e l y conserved amongst t h e 3 ' -u n t r a n s l a t e d r e g i o n of many mRNAs from h ighe r e u c a r y o t e s . Wickens and Stephenson (1984) compared the sequences of 161 po l yadeny la ted mRNAs f rom v e r t e b r a t e s and found t h a t 90% of them con ta ined the AAUAAA hexanuc leo t i de i n t h e i r 3 ' u n t r a n s l a t e d r e g i o n s . Those wh ich l a c k the c a n o n i c a l sequence g e n e r a l l y have a v a r i a n t sequence which d i f f e r s by o n l y a s i n g l e n u c l e o t i d e . The f i r s t d i r e c t t e s t s o f the r o l e p layed by the sequence AATAAA i n t he p r o d u c t i o n o f a e u c a r y o t i c mRNA were d e s c r i b e d by F i t z g e r a l d and Shenk i n 1981. By s e q u e n t i a l l y d i g e s t i n g SV40 DNA w i t h a r e s t r i c t i o n enzyme and S^ n u c l e a s e , t he au thors produced d e l e t i o n s i n the v i c i n i t y of t he AATAAA hexanuc leo t i de l o c a t e d 12 bp upstream of t he p o l y a d e n y l a t i o n s i t e f o r the SV40 l a t e mRNAs. S e v e r a l of the v i r u s e s they recovered a f t e r i n f e c t i n g monkey c e l l s con ta ined d e l e t i o n s on one s i d e or t he o the r o f the AATAAA sequence, but none had l o s t t he hexanuc leo t i de i t s e l f . The procedures used t o c o n s t r u c t the d e l e t i o n s shou ld not o f themselves have prevented d e l e t i o n s from ex tend ing i n t o the AATAAA h e x a n u c l e o t i d e . The f a i l u r e t o i s o l a t e such d e l e t i o n s t h e r e f o r e i m p l i e d t h a t removal of t he h e x a n u c l e o t i d e , when i t o c c u r r e d , rendered the v i r u s i n v i a b l e . The au thors a l s o c o n s t r u c t e d a d e r i v a t i v e o f SV40 c o n t a i n i n g a tandem d u p l i c a t i o n o f a 240 bp fragment wh ich i n c l u d e d the l a t e p o l y a d e n y l a t i o n s i t e and AATAAA h e x a n u c l e o t i d e . The l a t e mRNAs produced by t h i s v i r u s were po l yadeny la ted w i t h approx imate ly equal e f f i c i e n c y a t e i t h e r of the d u p l i c a t e s i t e s . D e l e t i o n of a 16 bp f ragment , i n c l u d i n g the sequence AATAAA, f rom e i t h e r copy o f the d u p l i c a t e d r e g i o n a b o l i s h e d p o l y a d e n y l a t i o n a t the co r respond ing p o l y a d e n y l a t i o n s i t e . I n s t e a d , p o l y a d e n y l a t i o n occu r red e f f i c i e n t l y 12 bp downstream of the rema in ing AATAAA h e x a n u c l e o t i d e . These r e s u l t s suggest t h a t the sequence AATAAA i s a t l e a s t p a r t o f a s i g n a l wh ich i s e s s e n t i a l f o r p o l y a d e n y l a t i o n . In the same s tudy , F i t z g e r a l d and Shenk mapped the 3 ' t e r m i n i o f t he l a t e mRNAs produced by SV40 mutants w i t h d e l e t i o n s immediate ly downstream of the AATAAA hexanuc leo t i de near t h e l a t e p o l y a d e n y l a t i o n s i t e . They found t h a t the s i t e o f p o l y a d e n y l a t i o n o f t hese mRNAs was s h i f t e d downstream, w i t h the r e s u l t t h a t the hexanuc leo t i de and the p o l y a d e n y l a t i o n s i t e were a lways separated by 11-19 n u c l e o t i d e s . The hexanuc leo t i de i t s e l f , o r some sequence o u t s i d e the d e l e t e d r e g i o n might be r e s p o n s i b l e f o r m a i n t a i n i n g t h i s s p a c i n g . An i n d i c a t i o n t h a t sequences upstream of the AATAAA hexanuc leo t i de might be i n v o l v e d was p rov i ded by the a n a l y s i s o f a mutant which had s h o r t d e l e t i o n s on bo th - 4 0 -s i d e s o f the h e x a n u c l e o t i d e . T r a n s c r i p t s produced by t h i s mutant were po l yadeny la ted immediate ly downstream of the hexanuc leo t ide as w e l l as a t s i t e s f u r t h e r downstream. No s p e c i f i c sequence occu r red a t a l l s i t e s o f po l y (A ) a d d i t i o n , a l though the sequence CA was a p r e f e r r e d s i t e . These o b s e r v a t i o n s a re c o n s i s t e n t w i t h the i d e a t h a t some f a c t o r r e c o g n i z e s the sequence AATAAA (or i t s RNA hcmologue) and c l eaves the t r a n s c r i p t w i t h i n a n a r r o w l y - d e f i n e d r e g i o n downstream, the s p e c i f i c s i t e o f c leavage w i t h i n t h a t r e g i o n be ing one t h a t f u l f i l l s a s imp le sequence requi rement such as XA, where X i s any n u c l e o t i d e , C be ing p r e f e r r e d . The au thors p o i n t e d out t h a t the AATAAA hexanuc leo t i de cannot be the o n l y s p e c i f i c sequence requi rement f o r p o l y a d e n y l a t i o n , because the same sequence occu rs w i t h i n the cod ing r e g i o n of the SV40 e a r l y t r a n s c r i p t i o n a l u n i t , where i t does not se rve as a s i g n a l f o r p o l y a d e n y l a t i o n . The importance of the AATAAA hexanuc leo t i de as p a r t o f the p o l y a d e n y l a t i o n s i g n a l i n v a r i o u s e u c a r y o t i c genes has been w e l l - e s t a b l i s h e d by s e v e r a l s t u d i e s i n which the e f f e c t s of p o i n t muta t ions i n the hexanuc leo t i de were a s s e s s e d . Wickens and Stephenson (1984) shewed t h a t a 220 bp fragment i n c l u d i n g the po ly (A) s i t e o f the SV40 l a t e t r a n s c r i p t i o n u n i t i s s u f f i c i e n t , when l i g a t e d i n t o pBR322 and i n t roduced i n t o Xenopus o o c y t e s , t o cause c leavage and p o l y a d e n y l a t i o n o f t r a n s c r i p t s i n i t i a t e d i n the v e c t o r . Four d i f f e r e n t muta t ions were i n t r oduced i n t o the AATAAA hexanuc leo t i de i n the c loned SV40 f ragment . Each o f the mutant p lasmids d i r e c t e d the s y n t h e s i s o f t h e same l e v e l s o f RNA as the " w i l d - t y p e " when i n j e c t e d i n t o o o c y t e s . However, most o r a l l o f the RNA produced f rom the mutant p lasmids f a i l e d t o undergo c leavage and p o l y a d e n y l a t i o n . No c o r r e c t l y c l e a v e d RNA c o u l d be de tec ted - 4 1 -in oocytes carrying plasmids with the sequence AACAAA or AATGAA in place of AATAAA. Low levels of cleaved RNA were produced by plasmids carrying the sequence AATACA (10%) or AATTAA (<5%), and in each case, all of the cleaved RNA was polyadenylated. This suggests that mutations in the AATAAA hexanucleotide interfere with cleavage at the polyadenylation site, and that once cleavage has occurred, polyadenylation occurs normally. The AATAAA sequence may not be required for the polyadenylation reaction itself, but only for the (normally) prerequisite cleavage step. A similar effect was noted by Montell et al. (1983), who altered the sequence AATAAA near the polyadenylation site of the adenovirus EIA transcription unit to AAGAAA. Very low levels of correctly cleaved EIA mRNA were produced by the mutant virus in HeLa cells, but at least 80-90% of the correctly cleaved RNA was polyadenylated. Two types of evidence excluded the possibility that a substantial amount of correctly cleaved RNA was not polyadenylated but escaped detection because it was rapidly degraded. First, the levels of nuclear RNA containing EIA sequences were very similar in cells infected with the wild-type and mutant viruses. Second, Zeevi et al. (1982) had shown that inhibition of polyadenylation of adenovirus EIA and EIB transcripts did not alter their stability within the nucleus. Higgs et al. (1983) found the first example of a naturally occurring cleavage/polyadenylation signal defect in a patient with a particular form of OC-thalassemia. The patient's Ot-^  globin gene was completely inactive as a result of a frameshift mutation, and the c<2 gene had undergone a single mutation which altered the sequence AATAAA near the poly(A) site to AATAAG. This mutation apparently reduced the level of d 2 mRNA i n the p a t i e n t ' s r e t i c u l o c y t e s by about 20-fold. When the d e f e c t i v e «2 gene was c l oned and i n t roduced i n t o HeLa c e l l s on an SV40 v e c t o r , i t d i r e c t e d the p roduc t i on o f normal l e v e l s o f mRNA, but a l l o f the t r a n s c r i p t s were extended beyond the normal p o l y a d e n y l a t i o n s i t e i n t o v e c t o r sequences. These r e s u l t s suggest t h a t the oc2 mu ta t ion prevented t r a n s c r i p t c leavage and t h e r e f o r e p o l y a d e n y l a t i o n a t the normal s i t e . "Readthrough" t r a n s c r i p t s were not de tec ted i n the p a t i e n t ' s r e t i c u l o c y t e s , perhaps because they were not s u f f i c i e n t l y s t a b l e . O r k i n e t a l . (1984) d e s c r i b e d a ^ - t h a l a s s e m i a gene i n which the AATAAA sequence of the normal p o l y a d e n y l a t i o n s i g n a l had been a l t e r e d t o AACAAA. The e f f e c t o f t h i s muta t ion on the e f f i c i e n c y of p o l y a d e n y l a t i o n a t the normal s i t e i n e r y t h r o i d c e l l s c o u l d not be es t ima ted because the muta t ion has been found o n l y i n he te rozygo tes . When expressed i n HeLa c e l l s , however, the mutant gene d i r e c t e d the s y n t h e s i s o f t r a n s c r i p t s w i t h the normal 3' end a t l e v e l s 5-10 f o l d lower than d i d t he normal ^ - g l o b i n gene ,. In bo th HeLa c e l l s and e r y t h r o i d c e l l s i n ^ —thalassemia p a t i e n t s , the mutant gene a l s o caused the p roduc t i on o f an extended t r a n s c r i p t . T h i s t r a n s c r i p t was po l yadeny la ted about 900 n u c l e o t i d e s 3' t o the normal s i t e , 10-15 n u c l e o t i d e s from the nex t AATAAA sequence. C o n s i d e r a b l e e f f o r t has r e c e n t l y been devoted t o i d e n t i f y i n g sequences o r s t r u c t u r e s wh ich might be r e q u i r e d a l ong w i t h the AAUAAA hexanuc leo t i de f o r t r a n s c r i p t c leavage and p o l y a d e n y l a t i o n . No o the r sequence i n the 3' f l a n k i n g r e g i o n s of e u c a r y o t i c genes i s as w i d e l y conserved as the sequence AATAAA, but sequence homologies have none the less been i d e n t i f i e d . B e n o i s t e t a l . (1980) noted t h a t the -43-sequence uIJUUCACUGC is located immediately upstream of the polyadenylation sites of five different mRNAs. Berget (1984) compared the sequences around the polyadenylation sites of 61 different vertebrate mRNA precursors. (The sequences were deduced from the DNA sequences of the respective genes.) She identified the sequence CAYUG (Y=pyrimidine) as a conserved element located either immediately upstream or immediately downstream of the polyadenylation site. This sequence occurs within the conserved sequence noted by Benoist et al. (1980). The polyadenylation site itself was usually marked by the sequence NAA, in which N is most frequently C, less frequently G, and sti l l less often U. Fitzgerald and Shenk (1981) observed the same sequence preference at sites of poly(A) addition in the mutants of the SV40 late transcription unit. McDevitt et al.(1984) introduced deletions into the 3' flanking sequences of the adenovirus E2 gene and assayed their effects on the production of E2 mRNA and protein after introducing the altered genes into human cells. A gene retaining as few as 35 bp of the sequence normally found downstream of the polyadenylation site produced normal levels of functional E2 mRNA. In marked contrast, deletions which extended to within 20 or fewer base pairs of the polyadenylation site from downstream abolished the synthesis of E2 protein. NO discrete polyadenylated RNA which could hybridize to an E2 probe was produced in cells transfected with E2 genes retaining 2, 12, or 20 bp of 3' flanking sequence. However, total RNA from these cells did protect part of an E2 probe from SI nuclease digestion. The region protected by transcripts of each plasmid extended from the proximal end of the probe as far as the site of the deletion breakpoint in the plasmid, suggesting that the deletions prevented transcript cleavage and caused the transcripts to be extended downstream for an unknown distance. Sequences required for correct cleavage and polyadenylation of adenovirus E2 transcripts must have a boundary 20-35 bp downstream of the polyadenylation site, but what feature of the boundary region is involved in transcript processing is not known. The authors note that a CAYUG-related sequence (CATG) occurs within the boundary region. A different CAYUG analog occurs immediately after the poly(A) site. A 12 bp sequence within the boundary region is an inverted repeat of a sequence which is located upstream of the poly(A) site and which includes the first 5 bp of the AAUAAA hexonucleotide. Pairing between the two inverted repeats might be involved in poly(A) site recognition (McDevitt et al. , 1984), but this notion has yet to be tested. Gil and Proudfoot (1984) produced deletions extending towards the AATAAA poly(A) signal of the rabbit $ -globin gene from a point 355 bp downstream. For each deleted variant, a fragment extending from the deletion breakpoint to a fixed site in the 3' untranslated sequence was excised and introduced into an intact ^ -globin gene, upstream of its AATAAA hexanucleotide. The resultant genes contained two AATAAA hexanucleotides, the first of which retained a variable length of its normal 3' flanking sequence. Polyadenylation occurred efficiently after the first AAUAAA sequence if it retained 51 bp of its 3' flanking sequence. Transcripts of a gene in which the first AATAAA was flanked distally by only 15 bp of a "wild type" sequence were polyadenylated exclusively near the second AAUAAA sequence. Sequences required for recognition of the ^-globin poly(A) site therefore extend 15-51 bp beyond the AATAAA hexanucleotide. This region includes a CAYUG-related sequence, but again, whether or not it is specifically required is not known. Woychik et al. (1984) have analyzed the sequence requirements for correct polyadenylation of transcripts of the bovine growth hormone gene. Fragments extending from a fixed point in the first exon of the gene to different positions in the 3' flanking sequences were'cloned into a eucaryotic expression vector in such a way as to place the gene under the control of the SV40 late promoter. The resulting plasmids were introduced into C0S1 cells, and the 3' ends of the growth hormone gene transcripts were located by S-^  nuclease mapping. A plasmid which included 84 bp of the 3' flanking sequence of the growth hormone gene produced transcripts which were polyadenylated exclusively at the normal site. One which lacked the entire 3' flanking sequence of the growth hormone gene and 37 bp upstream of the normal poly(A) site produced transcripts which were polyadenylated in adjacent vector sequences about 200 bp downstream of the deletion breakpoint. This plasmid lacked the AATAAA sequence which is presumably involved in polyadenylation at the normal site. A plasmid containing the sequences normally found upstream of the poly(A) site and 1 bp of 3' flanking sequence produced some transcripts which extended to the polyadenylation site in the vector, but most were polyadenylated in the inmediate vicinity of the normal site. The inclusion of 10 or 13 bp of 3' flanking sequences in the same type of plasmid eliminated the extended transcripts but did not completely restore polyadenylation to the normal site. Efficient polyadenylation at the normal site therefore requires sequences extending 13-84 bp beyond the site itself. This region could theoretically base-pair with proximal sequences to produce an extended region of secondary structure, but the significance of this observation is unknown. A CAYUG sequence spans the poly(A) site of the growth hormone gene: whether or not it is required, it cannot account for the apparent requirement for more distal sequences for correct polyadenylation. Conway and Wickens (1985) extended earlier analyses of the SV40 late polyadenylation signal by producing various deletions of sequences distal to the AATAAA hexanucleotide and assaying the ability of the remaining sequences to cause polyadenylation in frog oocytes. They found that sequences in the immediate vicinity of the polyadenylation site affected both the efficiency and the specificity of polyadenylation. Efficient polyadenylation also required sequences residing up to 26 base pairs distal to the normal poly(A) site. Sadofsky and Alwine (1984) reported that some of the SV40 mutants constructed by Fitzgerald and Shenk (1981) produced higher levels of extended late transcripts than the wild-type virus. The data are difficult to interpret, in part because high molecular weight fragments of the probes used for S-^  nuclease analysis were apparently protected from the nuclease by all RNA samples, suggesting the presence of relatively abundant extended transcripts in all samples or of partial S-^  digestion products. No explanation for the presence of these large fragments was offered. Furthermore, in none of the figures were the levels of correctly cleaved and extended transcripts directly compared, because different probes were used to analyze the two classes of transcript. The authors suggest that extended transcripts comprise up to -47-6% of the late transcripts in some of the mutant viruses compared to 0.1% in the wild-type virus, and that sequences 3-60 bp downstream of the AATAAA hexanucleotide affect the efficiency of cleavage at the normal polyadenylation site. Of the hands which were attributed to protection of the probe by extended transcripts, only 1 was observed when polyadenylated RNA was used in the analysis, suggesting the presence of a cryptic polyadenylation signal downstream of the normal one. Simonsen and Levinson (1983) have begun to characterize the signals involved in polyadenylation of transcripts of the hepatitis B surface antigen gene. The sequence AATAAA is absent from the region in which the transcript is cleaved and polyadenylated, but the variant TATAAA occurs 12-19 bp upsteam of the poly(A) sites. Deletion of this sequence, along with downstream flanking sequences, prevents the synthesis of HBsAg mRNA in COS1 cells. In fact, 11-30 bp of the sequence downstream from the TATAAA hexanucleotide are required for production of the mRNA, and normal levels are not produced unless at least 45 bp of normal sequence are retained downstream of the hexanucleotide. The sequence CAYUG is not present in the region known to be required for polyadenylation. The full extent of the sequences required for polyadenylation at any defined site have not been determined; nor is it clear to what extent the polyadenylation signals characterized to date depend for their activity upon their location with respect to other functional genetic elements. Cole and Santangelo (1983) showed that certain sequences which in their normal location do not cause transcript cleavage or polyadenylation can do so if transferred to a different context. They constructed a derivative of the Herpes virus tk gene from which all sequences more than -48-23 bp downstream of the protein-coding region had been deleted. This derivative, in contrast to one which retained 500 bp of 3' untranslated and flanking sequences, did not direct the synthesis of tk mRNA when introduced into COS1 cells on an expression plasmid. Various DNA fragments containing sequences known to be involved in polyadenylation of their respective transcrips were able to restore the expression of the defective gene when inserted downstream from it. Moreover, an 88 bp fragment of the SV40 early transcription unit which included the sequence AATAAA, but which does not cause SV40 transcripts to be cleaved or polyadenylated in its vicinity, also acted as a polyadenylation signal when joined to the defective tk gene. This result not only illustrated the importance of the AATAAA sequence in transcript polyadenylation, but also suggested that sequences which may be quite far removed from the hexanucleotide are important in allowing it to function. The authors point out two different possibilities which must be considered: that some sequence in the SV40 early transcriptional unit prevents the unused AATAAA from being recognized (formally, this includes the possibility that the polyadenylation signal of the early transcription unit competes with the upstream hexanucleotide for some essential factor), or that some sequence in the tk gene might facilitate recognition of the hexanucleotide. Polyadenylation in Cell-Free Systems Little is known of the mechanism by which primary transcripts are cleaved at appropriate sites for polyadenylation. Nor is it known whether polyadenylation is an automatic consequence of cleavage at the correct site, or whether signals in addition to those which specify the -49-cleavage site are required for the polyadenylation reaction. Berget (1984) proposed that U4 snRNA might be involved in the recognition of polyadenylation sites by analogy with the role of Ul snRNA in splice site recognition (Rogers and Wall, 1980; Lerner et al., 1980). U4 contains two copies of a pentnucleotide complementary to the first 5 bp of the sequence AAUAAA, and two pentnucleotides complementary to CAUUG and CACUG, respectively. The potential recognition elements for AAUAAA and CAYUG are appropriately ordered in U4 to allow them to pair simultaneously with their cognate sequences in an mRNA precursor. Such pairing was hypothesized to bring the polyadenylation site into an appropriate position and/or conformation for the cleavage reaction to occur. The cleavage enzyme in this model might be a component of U4 snRNP. Several laboratories have recently succeeded in making cell sub-fractions or extracts which specifically polyadenylate mRNA precursors. These systems promise to be powerful tools in defining the steps in the process of polyadenylation, their relationships to each other, the nucleotide sequence requirements and trans-acting factor requirements for each step. Chen-Kiang et al. (1982) isolated nuclecprotein complexes engaged in transcription from adenovirus-infected HeLa cells. Under appropriate conditions these complexes produced transcripts of the major late transcription unit of adenovirus which were polyadenylated at the sites normally used in vivo. Manley et al. (1982) demonstrated correct polyadenylation of adenovirus late transcripts in nuclei isolated from infected HeLa cells. They shewed that the polyadenylated transcripts were derived from larger precursors by cleavage. Soluble extracts of HeLa cells capable of specifically initiating -50-transcription at some polll promoters had been developed in 1980 by Manley and colleagues. Transcript cleavage and polyadenylation did not occur under the conditions used for transcript initiation in these extracts, and specific 3' termini were produced only by "runoff" of the polymerase from the end of a linear template. In 1983, Manley reported that certain runoff transcripts prepared in cell extracts were efficiently polyadenylated if subsequently incubated in a mixture containing a different concentration of the extract. Of ten runoff transcripts tested, only two were efficently polyadenylated ( 70% of input was retained on oligo(dT) cellulose after processing). One common feature of these two was that their 3' ends were located within 50 nucleotides of the 3' ends of the corresponding transcripts found in vivo. This suggested that polyadenylation in the cell extract depended upon the same signals as those required for polyadenylation in the cell. In each case, poly(A) was added to the end generated by runoff transcription, indicating that the endonuclease which cleaves transcripts at poly(A) sites was not active in the cell extract. Transcripts truncated 237 nucleotides upstream of an efficiently-polyadenylated site were not polyadenylated at all, suggesting that an essential sequence resided within 237 bp of the efficiently-utilized 3' terminus, which itself was located near the poly(A) site of the SV40 late transcription unit. The nature of this essential sequence was investigated by Manley et al. (1985). They first showed that two different runoff transcripts containing the 237 nucleotide SV40-encoded segment at their 3 ' termini were polyadenylated efficiently in vitro, while the corresponding transcripts without the 237 nucleotide segment were not polyadenylated at all. Deletions extending into the 237 bp SV40 segment from either end were produced, and runoff transcripts were prepared from the altered plasmids (which were linearized at the promoter-distal end of the SV40 sequence). The transcripts were tested for their ability to undergo polyadenylation. Two copies of the hexanucleotide AAUAAA are present within 50 nucleotides upstream of the normal poly(A) site of SV40 early transcripts. Runoff transcripts which retained one copy of this sequence were efficiently polyadenylated in vitro but transcripts lacking the AAUAAA hexanucleotide were not detectably polyadenylated. Formally, the results showed that either of two regions, one 22 nucleotides and the other 38 nucleotides, contained sequences required for in vitro polyadenylation. Similarity between the two regions was restricted to the sequence AAUAAA and 3 flanking nucleotides on either side. The same regions could direct polyadenylation of 3' termini located 275-375 nucleotides downstream, although these termini were processed less efficiently than termini only 50 nucleotides downstream. These results provided the first indication that the AAUAAA hexanucleotide is specifically required for polyadenylation as distinct from transcript cleavage. The hexanucleotide alone is not sufficient for polyadenylation in vitro, since a runoff transcript terminated 60 nucleotides downstream of the internal AAUAAA in the SV40 early transcription unit is not a substrate (Manley, 1983). Poly(A) polymerases have been purified from a variety of cell types (reviewed by Edmonds and Winters, 1976). The purified enzymes show no endonucleolytic activity, nor do they show any requirement for specific sequences in the RNA primers. An attractive hypothesis is that the endonuclease and polyadenylate polymerase activities form part of a complex which includes a single sequence recognition factor. One must suppose that in the HeLa whole cell extract the endonuclease is inactive for some reason (eg. loss from complex, lack of cofactor). This hypothesis would account for the coupling between cleavage and polyadenylation that is observed in isolated nuclei (Manley et al., 1982) and for the fact that the same nucleotide sequence is required for both activities (Manley et al. , 1985; and refs. cited earlier). Berget's (1984) hypothesis could be accommodated by supposing that U4 snRNP is the recognition factor in the hypothetical endonuclease/polymerase complex, but Manley et al. (1985) caution against this supposition by citing unpublished results which suggest that anti-sriRNP antibodies have no effect on the in vitro polyadenylation reaction. Moore and Sharp (1984) have also developed a HeLa whole-cell extract which polyadenylates mRNA "precursors" generated by in vitro transcription. Their extract, like that of Manley (1983), polyadenylated 3' termini of RNA generated by runoff transcription in a separate reaction. They also observed, however, that under appropriate conditions, transcripts generated in the whole cell extract could be polyadenylated in the same extract at a site normally used in vivo, namely the L3 polyadenylation site of adenovirus. Polyadenylation at the normal site was only observed when the transcript was generated in situ, yet the reaction did not seem to be directly coupled to transcription. Pulse-chase experiments showed that there was a considerable lag between the synthesis of a transcript and its polyadenylation. As well, t r a n s c r i p t s s y n t h e s i z e d i n a 50 min p e r i o d were c l eaved and po l yadeny la ted over the nex t 4 h r i n the presence of i n h i b i t o r s wh ich p reven ted f u r t h e r t r a n s c r i p t i o n . Moore and Sharp suggest t h a t a s t r u c t u r e which i s subsequent ly r e q u i r e d f o r t r a n s c r i p t 3' end p r o c e s s i n g assembles d u r i n g t r a n s c r i p t i o n . They note i n t h i s con tex t the r e s u l t s o f Economidis and Pedersen (1983), who found t h a t p o l l l t r a n s c r i p t s s y n t h e s i z e d i n v i t r o c o u l d be assembled i n t o r i b o n u c l e o p r o t e i n p a r t i c l e s i n the same e x t r a c t , but t h a t assembly o f exogenous RNA. i n t o such p a r t i c l e s was i n e f f i c i e n t . The mechanism by which the 3' t e r m i n i f o r p o l y a d e n y l a t i o n were generated i n t he e x t r a c t c o u l d not be d i r e c t l y determined because the e f f i c i e n c y o f p o l y a d e n y l a t i o n was r e l a t i v e l y low and t h e background o f heterogeneous non-po lyadeny la ted t r a n s c r i p t s was h i g h . N e v e r t h e l e s s , g i v e n the ev idence t h a t e n d o n u c l e o l y t i c c leavage occurs a t t he L3 po ly (A) s i t e i n v i v o (Nevins and D a r n e l l , 1978; F r a s e r e t a l . , 1979) and i n i s o l a t e d n u c l e i (Manley e t a l . , 1982) the au thors conc luded t h a t the same mechanisnm p robab ly opera ted i n the c e l l e x t r a c t . More r e c e n t l y , Moore and Sharp (1985) have repo r t ed t h a t a n u c l e a r e x t r a c t o f HeLa c e l l s a c c u r a t e l y and e f f i c i e n t l y c l e a v e d and po l yadeny la ted exogenous runo f f t r a n s c r i p t s . A n t i b o d i e s t o U l snRNP, o r t o determinants shared by U l , U2, U4, U5 and U6 snRNP, o r t o LaRNP i n h i b i t e d the i n v i t r o p o l y a d e n y l a t i o n r e a c t i o n i n n u c l e a r o r w h o l e - c e l l e x t r a c t s (Moore and Sharp , 1984; 1985). S i nce such a n t i b o d i e s appa ren t l y f a i l t o i n h i b i t p o l y a d e n y l a t i o n o f exogenous RNA s u b s t r a t e s ( c i t e d i n Manley e t a l . , 1985) i t would seem t h a t one o r more snRNPs may be i n v o l v e d i n c leavage a t po l y (A ) s i t e s , but a re not r e q u i r e d f o r p o l y a d e n y l a t i o n per s e . The r e l a t i o n s h i p s between the endonuclease wh ich genera tes 3 ' t e r m i n i f o r p o l y a d e n y l a t i o n , t he po l y (A ) polymerase i t s e l f , and the f a c t o r ( s ) r e q u i r e d t o con fe r sequence s p e c i f i c i t y on each o f t hese enzymes remain obscure f o r the t ime b e i n g , but exper iments w i t h i n v i t r o p o l y a d e n y l a t i o n systems o f f e r t he e x c i t i n g p rospec t o f u n r a v e l l i n g these r e l a t i o n s h i p s . Nonpolyadeny la ted mRNA One u b i q u i t o u s c l a s s o f e u c a r y o t i c mRNAs commonly l a c k s p o l y ( A ) : t he mRNAs which encode the major h i s t o n e s of ch romat in . H i s tone mRNAs were o r i g i n a l l y r ecogn i zed as components o f sma l l polysomes which appeared d u r i n g S phase o f t h e c e l l c y c l e and which d i r e c t e d the i n c o r p o r a t i o n o f r a d i o l a b e l l e d amino a c i d s i n p r o p o r t i o n s expected f o r h i s t o n e - s y n t h e s i z i n g p a r t i c l e s (Borun e t a l . , 1967) . Adesn ik and D a r n e l l (1972) showed t h a t l i t t l e i f any o f the r a d i o a c t i v e adenos ine i n c o r p o r a t e d i n t o the h i s t o n e mRNAs of HeLa c e l l s c o u l d be recovered i n t he R N a s e - r e s i s t a n t form expected of po ly (A) sequences. The l e v e l o f n u c l e a s e - r e s i s t a n t m a t e r i a l , and the approximate average l eng th o f the mRNAs suggested t h a t no more than 8 consecu t i ve A r e s i d u e s cou ld be p resen t per m o l e c u l e . H is tone mRNAs from a v a r i e t y o f organisms and c e l l t ypes have s i n c e been shown t o s i m i l a r l y l a c k po l y (A ) (see Hens tsche l and B i r n s t i e l , 1981, f o r r e v i e w ) . [ I t i s a l s o t r u e , however, t h a t h i s t o n e mRNAs i n Tetrahymena and y e a s t , (Bannon e t a l . , 1983; Fahrner and H e r e f o r d , 1983) and a f r a c t i o n o f t h e h i s t o n e mRNAs i n amphibian o o c y t e s , ( S l a t e r and S l a t e r , 1974) a re p o l y a d e n y l a t e d . Messenger RNAs encod ing v a r i a n t h i s t o n e s a re a l s o u s u a l l y po l yadeny la ted (Doenecke and T o n j e s , 1984) . ] - 5 5 -Whether or not any mRNAs other than those encoding histones lack poly(A) has been a matter of some dispute. Greenberg and Perry (1972) found that 62% of the polysomal RNA of L cells which was labelled in the presence of a low concentration of actinomycin D (to prevent labelling of rRNA) bound to poly(U) in solution, suggesting that it contained poly(A). In the fraction which apparently lacked poly(A), they found histone mRNAs and a heterogeneous population which they described as non-messenger polysomal RNA. They concluded that the vast majority of cytoplasmic mRNAs are polyadenylated, histone messengers being the only species which completely lack poly(A). However, Greenberg (1976) showed that about 30% of the RNA in L cells lacks poly(A), and judging from the association with polysomes and its labelling in the presence of inhibitors of rRNA synthesis this poly(A)~ fraction is genuine mRNA. About 50% of the RNA in this fraction is larger than histone mRNA. Two years earlier, Milcarek, Price, and Penman (1974) isolated HeLa cell mRNA from polysomes and showed that about 30% of it failed to bind to oligo(dT) cellulose. RNA which fails to bind to oligo(dT) cellulose may sti l l have a short poly(A) tract of up to about 15 nucleotides (Brawerman, 1981). However, Milcarek and colleagues showed that the poly(A)-fraction of HeLa cell mRNA contained no more than 6-8 consecutive A residues per molecule, on average, and that these short tracts were internal rather than 3'-terminal in location. RNase digestion of the poly(A)~ fraction released only short oligomers of adenylate residues, and the content of adenosine measured after alkaline hydrolysis was much lower than expected if all were 3' terminal in location. Even mRNA which genuinely lacks poly(A) could conceivably be derived from polyadenylated -56-species. While measures which guard against RNA degradation during extraction procedures should prevent artif actual loss of the poly(A) segment, there is evidence that such loss can occur in the cell. Sheiness and Darnell (1973) showed that the average length of the poly(A) segments on mRNA declines after the mRNA arrives in the cytoplasm. While poly(A) in nuclear RNA or in newly-synthesized cytoplasmic mRNA has an average length of about 250 nucleotides, the most abundant size class of cytoplasmic poly(A) includes tracts of about 50 residues (Sheiness et al., 1975). Harpold et al. (1981) studied the synthesis and processing of nine specific mRNAs in CHO cells by testing the hybridization of their respective cloned cDNAs to poly(A)~ and poly(A)+ mRNA fractions. They found that after a brief period of labelling with radioactive nucleoside, over 90% of the labelled RNA which hybridized to any of the 9 cDNA clones was polyadenylated. After longer labelling periods, up to 45% of the mRNA detected by certain, of the cDNA probes failed to bind to oligo(dT) cellulose, suggesting the loss of poly(A) from this fraction of the steady-state mRNA. These observations were not defended as proof that all mRNAs are initially polyadenylated [after all, cDNA probes prepared against poly(A)+ RNA would not be expected to detect RNAs which never have poly(A)], but they do show that nonpolyadenylated species may be derived from polyadenylated ones. If all poly(A)~ RNAs are derived from poly(A)+ mRNA, one would expect to find that all sequences present in the poly(A)~ RNA fraction are represented in the polyadenylated fraction. Milcarek, Price, and Penman (1974) showed that this is not the case in HeLa cells, because a cDNA probe prepared against the poly(A)+ population hybridized to -57-poly(A)- mRNA to less than 20% of the extent of its hybridization to the poly(A)+ fraction. Milcarek (1979) reported that excess unlabelled poly(A)+ mRNA could compete effectively with labelled poly(A)+ mRNA for hybridization sites in genomic DNA, but that it had no effect on the hybridization to DNA of labelled poly(A)~ mRNA. This suggested that the two mRNA fractions were encoded by different DNA sequences. [A similar experiment with unlabelled poly(A)~ RNA gave ambiguous results, in that the unlabelled RNA reduced the extent of hybridization of either a poly(A)~ or poly(A)+ tracer to DNA by only about 30%. The reasons for this result were not explained, but included amongst them may have been the fact that the unlabelled RNA used as competitor contained a vast excess of non-mRNA sequences as compared to poly(A)~ mRNA.] The kinetics of hybridization of poly(A)+ and poly(A)~ mRNA fractions to a DNA probe made against poly(A)+ mRNA suggested that some sequence overlap existed between the two fractions. Most abundant polyadenylated mRNAs were found to be represented in the poly(A)~ fraction, about 10% also being abundant in the latter fraction and the remainder occurring much less frequently. About 60% of the remaining "scarce" polyadenylated RNAs were found to be unique to that fraction, while 40% were also present amongst the nonpolyadenylated RNAs. Milcarek (1979) therefore suggested that HeLa cell mRNAs could be assigned to one of three classes based on their possession of poly(A): one class consisted of sequences which occurred mainly in polyadenylated form, a second of sequences which for the most part lacked poly(A), and a third of sequences which were represented in both fractions. Similar approaches have been used to identify nonpolyadenylated -58-mRNAs in ether cell types. Nemer et al. (1974) found that in sea urchin blastulae, about 50% of the mRNA failed to bind to oligo(dT) cellulose. The level and size-distribution of RNase A+T-^ -resistant material in adenosine-labelled, non-polyadenylated RNA indicated that no more than 2% of the molecules in the poly(A)- RNA fraction could contain tracts of 30 or more A residues, and that on average, a molecule in that fraction contained no more than 5 consecutive A residues. Histone mRNAs were the major nonpolyadenylated RNA species, but 70% of the poly(A)~ fraction consisted of heterogeneous species larger than histone mRNA. Hybridization of the poly(A)- RNA with a cDNA probe prepared against poly(A)+ RNA suggested that very little sequence overlap existed between the two fractions. Grady et al. (1978) reported that poly(A)+ and poly(A)~ mRNAs in mouse liver comprise two essentially nonoverlapping sequence populations, with the nonpolyadenylated sequences accounting for about 43% of the total complexity. The same group, however, later found that about 20% of the total sequence complexity of the rat liver RNA was represented in both the poly(A)+ and poly(A)- populations, while about 35% was unique to the nonpolyadenylated fraction (Grady et al.,1981). Attempts to identify specific nonpolyadenylated, nonhistone gene transcripts have not generally been very successful. One approach has been to compare the in vitro translation products of poly(A)+ and poly(A)~ RNA fractions. Proteins encoded by poly(A)~ RNA in these experiments seem to comprise a subset of the much larger array of proteins encoded by the poly(A)+ fraction (Kaufmann et al. , 1977). Chikaraishi (1979) reported that 12 of 18 in vitro translation products of a complex poly(A)~ fraction of brain mRNA were not found amongst the products of the poly(A)+ fraction, but a skeptic would say that the data did not reliably distinguish these products, which were present in very low levels, from peptides of very similar mobilities encoded by the poly(A)+ mRNA. Another approach is to search for cDNA clones which hybridize to poly(A)-, and not to poly(A)+ mRNA, although it should be noted that standard procedures for cDNA synthesis are applicable only to polyadenylated mRNAs. The failures of both types of approach have quite recently been cited as evidence against the existence of nonpolyadenylated, nonhistone mRNAs (Darnell, 1982). Both approaches, however, are biased in favour of detecting abundant transcripts, and it is conceivable that their failure could result from the low abundance of any transcipts which exist only in nonpolyadenylated form. The skeptic would perhaps have been impressed with a recent report from Brilliant, Sueoka, and Chikaraishi (1984). The authors constructed a partial library of rat genomic DNA enriched in those sequences which hybridized at high K^T values to brain mRNA. From this library they retrieved nine clones which hybridized to rare transcripts in brain, or in brain and other tissues. Two of the clones hybridized to transcripts which could only be detected in the poly(A)~ fraction of polysomal RNA. Although at least two nonhistone, nonpolyadenylated mRNAs exist in the steady state mRNA population in the brain, it remains possible that they are synthesized in polyadenylated form and rapidly lose their poly(A) tracts. It will be interesting to know, when the regions encoding the 3' ends of these transcripts are sequenced, whether or not any of the signals associated with the generation of polyadenylated 3' - 6 0 -termini are present. Signals Required for Histone mRNA 3' End Generation A haze of uncertainty still surrounds the origins and identities of nonhistone, nonpolyadenylated RNAs, and nothing whatsoever is known of the signals and processes involved in generating their 3' ends. In striking contrast, the signals which specify the locations of the 3' ends of histone mRNAs can be described quite precisely, and recent reports suggest that a detailed understanding of the mechanisms of 3' end generation in these mRNAs will soon be at hand. The studies of Birnstiel and his colleagues on the embryonic histone genes of sea urchins have contributed much of our current understanding of histone gene organization and expression. In 1979, Busslinger, Portmann, and Birnstiel identified two regions of nucleotide sequence conservation shortly downstream from the coding sequences of nine histone genes from two species of sea urchin. The first conserved sequence was 23 bp long and included a 6 bp inverted repeat: AACGGC(C/T)CTTTTCAG(G/A)GCCACCA. Hentschel et al.(1980a) mapped the 3' terminus of each of the mRNAs encoded by the major embryonic histone repeat unit of Psammechinus miliaris to within a few nucleotides of the 3' end of the 23 bp conserved sequence. The same sequence has since been found shortly downstream of various histone genes of Drosophila, Xenopus, chicken, mouse, and humans (reviewed by Hentschel and Birnstiel, 1981). The mRNA of a histone H4 gene from Xenopus is polyadenylated at the 3' end of the 23 nucleotide conserved sequence (Zernik et al., 1980), but the mRNAs of most genes flanked by the 23 bp -61-sequence are not polyadenylated. Conversely, those histone genes which are transcribed to produce polyadenylated mRNAs generally lack the 23 bp conserved sequence (Doenecke and Tonjes, 1984).. Hentschel et al. (1980b) showed that all 5 histone genes of the sea urchin h22 repeat are transcribed upon injection into Xenopus oocyte nuclei to produce mRNAs with the same 5' and 3' terminii as those found in sea urchin embryos. (However, correct 5' ends of the Hi and H4 mRNAs and correct H3 mRNA 3' ends were generated very inefficently. The latter observation proved to be very useful, as will be discussed later.) Birchmeier et al.(1982) made use of the Xenopus oocyte as a histone gene expression system to test the functional importance of the 23 bp conserved sequence downstream of the sea urchin H2A gene. They found that a deletion which removed 12 bp from within the 23 bp sequence completely prevented the H2A gene from directing synthesis of normal H2A mRNA in the oocyte nucleus. S-^  nuclease mapping showed that the mutant gene encoded transcripts which had the same 5' end as authentic H2A mRNA, but which extended beyond the site of the normal 3' end. The removal of sequences extending from the 3' end of the conserved inverted repeat to a point within the coding sequence of the downstream Hi gene also prevented correct 3' end generation in H2A transcripts. On the other hand, deletion of the entire H2A coding region, and part of the 5' untranslated sequence, did not affect the production of normal transcript 3' ends. The deletion analysis pointed to the importance of the 23 bp conserved sequence, and possibly downstream intergenic sequences, in H2A transcript 3' end generation. The involvement of downstream spacer sequences was also suggested by the observation that a 60 bp fragment which included the last 4 bp of the H2A coding sequence and extended 4 bp beyond the 23 bp conserved sequence could not cause 3' end generation when inserted into the H2B gene. The 3' ends of all the transcripts of the gene carrying the insertion mapped to the normal H2B 3' end site. In a second report, Birchmeier et al.(1983) showed that an H2A gene which retained 24 bp of spacer DNA downstream of the conserved sequence, but not one which had only 4 bp of spacer DNA, could direct the synthesis of a correctly "terminated" transcript. However, 80 bp of spacer DNA was required for the correct transcript 3' end to be produced with maximum efficiency. They also showed that all 3' untranslated sequences upstream of the 23 bp conserved element could be deleted without affecting 3' end generation. To find out whether the inverted repeat within the 23 bp conserved sequence was a required feature for H2A transcript 3' end generation, Birchmeier et al. (1983) subjected the sequence to bisulfite mutagenesis in vitro. Three different mutations which reduced complementarity between the two halves of the inverted repeat either abolished or severely curtailed the production of correct H2A mRNA 3' termini from the mutant genes in Xenopus oocytes. Sequence complementarity was restored by replacing the unaltered half of the inverted repeat with a synthetic duplex oligonucleotide containing the appropriate mutant sequence. The two double mutant genes so prepared contained inverted repeats of different sequences from the wild-type gene, yet both directed the production of H2A mRNAs with correct 3' termini in oocytes. This result was interpreted to mean that some sequence alteration in the conserved inverted repeat could be tolerated as long as the point symmetry of the repeat was maintained. The importance of symmetry suggests that the two halves of the repeat interact with each other either at the DNA or RNA level. Birchmeier and colleagues distinguished between the two possibilites by constructing and injecting into oocytes heteroduplex templates containing the wild-type inverted repeat in one strand and a variant sequence in the other. They found that mutations which abolished complementarity between the halves of the inverted repeat prevented 3' end generation if included in the RNA-antiparallel strand, but had little effect if present only in the RNA-isoparallel strand. If the postulated interaction between the halves of the inverted repeat occurred at the DNA level, mutations in either strand could have prevented the interaction. The observed results were more consistent with the idea of an interaction at the RNA level, since only the RNA-antiparallel DNA strand could influence the structure of the transcript. The 10 bp sequence CAAGAAGAA was the second conserved sequence found by Busslinger and colleagues. It occurred 6-8 bp downstream of the 23 bp element. The first 9 bp of this sequence appear to be quite strictly conserved amongst sea urchin histone genes but only weakly so amongst the histone genes of other organisms (Hentschel and Birnstiel, 1981). The studies of Birchmeier and colleagues clearly demonstrated that sequences downstream of the 23 bp conserved element were important for H2A transcript 3' end generation, but they did not establish whether or not the second conserved element was functionally important. Georgiev et al. (1985) have removed any doubts as to its role in 3' end generation by producing a variety of nested deletions and "linker scanner" mutations (McKnight and Kingsbury, 1982) in the 3' flanking sequences of the sea urchin H3 gene and testing their transcription in the Xenopus oocyte. Deletions which extended into either the 23 bp or the 9 bp conserved sequence completely prevent the production of H3 transcripts with correct 3' termini. Furthermore, the spacing between these two elements appeared to be crucial to 3' end generation, because the insertion of as few as 6 extra base pairs between the two abolished 3' end generation at the normal site. This observation led the authors to suggest that the two elements should be considered portions of a single 3' end signal. The deletion of sequences downstream of the conserved nonamer also reduced the efficiency of the 3' end generation at the normal si t e , but i t was not possible to attribute this effect to a particular sequence within the spacer DNA. Evidence for 3' End Processing of Histone Gene Transcripts The inverted repeat sequence near the 3' termini of histone mRNAs was reminiscent of rho-independent terminator sequences near the 3' ends of procaryotic transcripts. For this reason, i t was considered l i k e l y that the 3' termini of histone mRNAs were the products of transcript termination (Busslinger et al.,1979; Hentschel and Birnstiel,1981). Recent results have made this opinion untenable. Birchmeier et a l . (1984) reasoned that i f histone mRNA 3' termini are produced by a processing reaction, i t should be possible to uncouple their formation from transcription. They linked the sea urchin H2A gene to the P L promoter of bacteriophage \ linearized the recombinant molecule at a si t e downstream of the H2A gene and transcribed i t i n v i t r o using E. c o l i RNA polymerase. The runoff transcripts so produced included 230 nucleotides of spacer sequence downstream of the H2A transcript 3' end -65-site. After being injected into Xenopus oocyte nuclei, the runoff transcripts were processed to molecules whose 3' termini mapped at the same site as that of authentic H2A mRNA. Analogous runoff transcripts of an H2A gene with two point mutations in the conserved inverted repeat were not processed at all upon injection into the oocyte, and nor were runoff transcripts which included only 4 nucleotides of spacer sequences. Transcripts which included 24 nt of spacer were processed very inefficiently, and the efficiency of processing increased as the amount of spacer sequence included in the transcript increased. Transcripts with 200 nt 3' spacer extensions were processed completely under the conditions of the assays. The fact that the processing of injected histone pre-mRNAs exhibited the same sequence requirements as the production of histone mRNAs from injected plasmids strongly suggested that processing is the normal mechanism for generating the 3' ends of histone mRNAs. Krieg and Melton (1984) used a similar approach to study the mechanism by which the 3' ends of transcripts of the chicken H2B gene are produced in Xenopus oocytes. A plasmid including the complete gene with its promoter and 3' flanking regions was correctly transcribed in oocytes to produce authentic H2B mRNA. A 3'-extended H2B transcript, produced in vitro by runoff transcription from a linked phage SP6 promoter, was correctly processed to a molecule with the same 3' end as H2B mRNA upon injection into oocytes. A runoff transcript containing only 76 nucleotides downstream of the mature 3' end was processed, indicating that it contained all sequences required for processing. Histone transcript 3' end processing is not a unique feature of the -66-Xenopus oocyte. Price and Parker (1984) found that it also occurs in a nuclear extract of cultured Drosophila cells. They prepared a DNA fragment including the 3' end of the Drosophila H3 gene and its downstream flanking sequences and added a single-stranded tail of dCMP residues to the 3' end of the RNA-antiparallel strand. Partially purified RNA polymerase II from Drosophila initiated transcription at the single-stranded tail and produced a runoff transcript which extended 55 nucleotides beyond the site of the mature H3 mRNA 3' end. If a nuclear extract of a Drosophila was added after a short preincubation of the template with polymerase, the runoff transcript gradually disappeared and was replaced by a shorter species whose 3' end coincided with that of mature H3 mRNA. The precursor-product relationship between the extended and mature RNAs was confirmed by showing that the purified extended RNA could be processed to the mature RNA upon addition to nuclear extract in the absence of ongoing transcription. The authors suggested that processing involved a specific endonucleolytic cleavage of the extended transcript, because transcripts with 55-nucleotide and 1 kb 3' extensions were processed with the same kinetics. The processing activity in the nuclear extract has been partially purified, fuelling the hope that its structure and mode of action will soon be understood in detail. A factor responsible for the production of the 3' termini of mature transcripts of the sea urchin H3 gene was identified in 1982 by Stunnenberg et al_. They made use of the earlier observation that H3 mRNA 3' termini are produced very inefficiently in Xenopus oocytes (Hentschel et al. 1980b) and searched for a component of sea urchin embryos which would allow efficient H3 mRNA synthesis in oocytes. Such a component was - 6 7 -found in a salt wash fraction of chromatin prepared from over 104 embryos. The component had a sedimentation coefficient of about 12S, and Galli et al.(1983) showed i t to be an snRNP. It contained a non-polyadenylated RNA of about 60 nucleotides which itself allowed efficient H3 mRNA production when injected into Xenopus oocytes prior to the injection of the H3 gene. Although the 12S snRNP was f i r s t referred to as a termination factor, i t is now believed to be a 3' end processing factor. Birchmeier et al . (1984) showed that 3' extended H3 transcripts synthesized in vitro could be processed to molecules with mature 3' termini in Xenopus oocytes only i f the oocytes were fi r s t injected with the 60-nucleotide RNA found in the 12S factor. The 60-nucleotide RNA, which is estimated to be present in no more than 10^  copies/cell in sea urchin embryos (Galli et al.,1983), is referred to as U7 RNA. Its 5' end is complementary to the conserved sequences found downstream of sea urchin histone coding sequences, and Strub et al.(1984) advanced the hypothesis that the 3' end processing activity of U7 rests on its ability to base pair with these sequences. It is not clear why, when the 23 bp and 9 bp sequences to which U7 RNA is complementary are common to a l l sea urchin histone mRNA precursors, the requirement for exogenous U7 RNA for processing in Xenopus oocytes is only apparent with H3 mRNA precursors. Histone Transcript Termination Birchmeier et aJU (1984) investigated the question of histone transcript termination by mapping the transcripts produced from an H2A gene which lacked the conserved inverted repeat and retained varying amounts of downstream spacer. They reasoned that the absence of the inverted repeat would prevent H2A transcript processing, but that readthrough into the downstream Hi gene would occur only i f any -68-t e rm ina to r s i g n a l s i n the normal spacer DNA were a l s o absen t . They found t h a t a p l asm id c o n t a i n i n g 230 bp o f spacer DNA produced a lmost no readthrough t r a n s c r i p t s , but t h a t a p lasmid c o n t a i n i n g 130 bp o f spacer DNA a l l owed h i ghe r l e v e l s o f readthrough t r a n s c r i p t i o n , and maximal l e v e l s r e s u l t e d from the d e l e t i o n o f a l l but 25 bp of spacer DNA. T h i s suggested t h a t most t r a n s c r i p t i o n o r i g i n a t i n g a t the H2A promoter t e rm ina tes he te rogeneous ly w i t h i n 230 bp of the 3 ' end o f the gene. The F u n c t i o n o f Po ly (A ) i n E u c a r y o t i c mRNA The presence o f 3 ' - t e r m i n a l po l y (A ) t r a c t s i n most e u c a r y o t i c mRNAs n a t u r a l l y r a i s e s s u s p i c i o n s t h a t the sequence i s impor tant t o some aspec t o f mRNA s y n t h e s i s o r f u n c t i o n . In 14 yea rs s i n c e t h e d i s c o v e r y o f po l yadeny la te i n mRNA and hnRNA, many p l a u s i b l e r o l e s f o r po l y (A ) have been proposed, but few have been p roven . The mere e x i s t e n c e o f nonpo lyadeny la ted t r a n s c r i p t s , such as those of most h i s t o n e genes, does not i n any way argue a g a i n s t an e s s e n t i a l r o l e f o r po l yadeny la te i n those t r a n s c r i p t s i n wh ich i t i s found . The same e s s e n t i a l r o l e may s imp ly be served by o the r sequences o r s t r u c t u r e s i n p o l y ( A ) ~ mRNAs. The e f f e c t s o f muta t ions i n c l e a v a g e / p o l y a d e n y l a t i o n s i g n a l s i n a v a r i e t y o f genes have c l e a r l y i n d i c a t e d the importance o f the normal 3 ' end gene ra t i on p rocess t o the p roduc t i on of s t a b l e , f u n c t i o n a l t r a n s c r i p t s , but they have not s i n g l e d out a r o l e f o r p o l y a d e n y l a t i o n i t s e l f . Most hnRNA i s degraded w i thou t ever l e a v i n g the nuc leus (Soe i ro e t al_., 1968) . The i d e a t h a t mRNA i s d e r i v e d f rom hnRNA must t h e r e f o r e imply t h a t some mechanism s e l e c t s those hnRNA molecu les o r segments which a re t o g i v e r i s e t o mRNA. D a r n e l l e t a l . ( 1971b ) suggested t h a t po l y (A ) might be i n v o l v e d i n t h e s e l e c t i o n mechanism on the b a s i s o f the k i n e t i c s o f po ly (A) accumula t ion i n the nuc leus and cy top lasm. L a b e l l e d po l y (A ) accumulated q u i t e r a p i d l y i n t he cy top lasm t o l e v e l s which exceeded those i n the n u c l e u s , whereas the t o t a l l a b e l l i n g o f hnRNA g r e a t l y exceeded t h a t o f c y t o p l a s m i c mRNA f o r s e v e r a l hou rs . T h i s o b s e r v a t i o n suggested t h a t po ly (A) was more e f f i c i e n t l y conserved between nuc leus and cy top lasm than b u l k hnRNA sequences. J e l i n e k e t a l . ( 1 9 7 3 ) extended the e a r l i e r obse rva t i ons o f D a r n e l l and coworkers by showing t h a t l a b e l l i n g o f HeLa c e l l nuc l ea r po ly (A) reached a p l a t e a u a f t e r about 30 m inu tes , w h i l e the amount o f l a b e l i n c y t o p l a s m i c po l y (A ) con t i nued t o i n c r e a s e l i n e a r l y . The au thors (and see a l s o D a r n e l l e t a l . , 1 9 7 3 ) i n t e r p r e t e d t h e i r f i n d i n g s as i n d i c a t i n g t h a t the r a t e o f n u c l e a r s y n t h e s i s o f po ly (A) was matched by the r a t e o f i t s t r a n s p o r t t o t he cy top lasm, and t h e r e f o r e t h a t po ly (A) was e f f i c i e n t l y , perhaps c o m p l e t e l y , conserved between the two compartments. P e r r y and h i s c o l l e a g u e s d i s p u t e d the i d e a o f complete nuc l eocy top lasm ic c o n s e r v a t i o n o f po l y (A ) a f t e r f i n d i n g t h a t the s p e c i f i c a c t i v i t y o f the RNA p r e c u r s o r p o o l i n t he nuc leus i n c r e a s e d throughout l a b e l l i n g p e r i o d s o f s e v e r a l hou rs . The r a t e o f c y top lasm ic accumula t ion o f l a b e l l e d po l y (A ) under these c i rcumstances would i n c r e a s e c o n t i n u a l l y r a t h e r than remain cons tan t i f po ly (A) was comp le te l y conse rved . P e r r y e t a l . ( 1 9 7 4 ) t h e r e f o r e argued t h a t some po ly (A) must t u r n ove r i n t he n u c l e u s , and t h a t po l y (A ) a d d i t i o n by i t s e l f cou ld not^guarantee the c o n s e r v a t i o n o f a sequence as mRNA. The argument r e s t e d i n p a r t on the n o t i o n t h a t t he h a l f - l i f e o f e u c a r y o t i c mRNA i s long i n compar ison t o the l a b e l l i n g p e r i o d s used i n the accumula t ion exper iments . Rap id c y t o p l a s m i c deg rada t i on of some mRNAs c o u l d have prevented an i n c r e a s e i n poo l s p e c i f i c a c t i v i t y f rom be ing r e f l e c t e d i n the accumula t ion cu rve f o r c y t o p l a s m i c p o l y ( A ) . P u c k e t t e t a l . ( 1 9 7 5 ) were a b l e t o demonstrate the e x i s t e n c e i n L c e l l s o f a c l a s s o f mRNA w i t h a s h o r t h a l f - l i f e by p u l s e - l a b e l l i n g w i t h [ H] -guanos ine and chas ing w i t h excess u n l a b e l l e d n u c l e o s i d e s . The chase became e f f e c t i v e w i t h i n about 2 h r , as r e v e a l e d by a l e v e l l i n g - o f f i n the t o t a l amount of r a d i o a c t i v i t y i n c o r p o r a t e d i n t o RNA. A f t e r 4 h r the amount of l a b e l l e d p o l y ( A ) + mRNA began t o dec rease . I t dropped by 50% over the nex t 2-3 h r , sugges t i ng t h a t perhaps h a l f o f t he mRNA belonged t o a r a p i d l y - t u r n i n g over c l a s s . A s p e c i f i c member o f a s i m i l a r uns tab le mRNA c l a s s i n CHO c e l l s was de tec ted by Harpo ld e t a l . , ( 1 9 8 1 ) , who measured the r a t e of accumula t ion o f r a d i o a c t i v e mRNAs capab le o f h y b r i d i z i n g t o n i ne cDNA c l o n e s . One of the n i ne c l o n e s de tec ted an rriRNA which had a h a l f - l i f e o f o n l y 1-2 h r . The o t h e r s h y b r i d i z e d t o more s t a b l e t r a n s c r i p t s , but these t r a n s c r i p t s became more abundant i n r e l a t i o n t o t he r e s t o f t he l a b e l l e d RNA as the p e r i o d of l a b e l l i n g i n c r e a s e d , i m p l y i n g t h a t much o f the mRNA i n CHO c e l l s must have been q u i t e u n s t a b l e . The e x i s t e n c e of r a p i d l y t u r n i n g - o v e r mRNA made i t p o s s i b l e t o propose a model wh ich c o u l d account f o r the observed k i n e t i c s of accumula t ion o f po ly (A) and changes i n poo l s p e c i f i c a c t i v i t y w h i l e assuming complete c o n s e r v a t i o n of po l y (A ) between nuc leus and cy top lasm. Nev ins and D a r n e l l (1978) addressed the q u e s t i o n of whether po l y (A ) might p l a y a r o l e i n mark ing mRNA sequences f o r c o n s e r v a t i o n by comparing the r a t e s o f accumula t ion o f s p e c i f i c adenov i rus l a t e c y t o p l a s m i c mRNAs t o the r a t e s o f accumula t ion of the same sequences i n p o l y ( A ) + and t o t a l - 7 1 -nuclear RNA. The rate of accumulation in total nuclear RNA of newly-labelled sequences specifically found in a given mRNA family exceeded the rate of accumulation of the mRNAs themselves by three- to ten-fold, suggesting degradation of a substantial fraction of the nuclear adenovirus-specific RNA. However, the rate of appearance of the cognate sequences in polyadenylated nuclear RNA was similar to their rate of accumulation in cytoplasmic RNA, suggesting that polyadenylation might be sufficient to distinguish a nuclear RNA molecule destined for conservation as mRNA from those destined for degradation. Early studies of the effects of cordycepin on RNA synthesis in eucaryotic cells (Penman et al.,1970) showed that the drug greatly inhibited the accumulation of labelled cytoplasmic mRNA without affecting the synthesis of hnRNA. The subsequent finding that cordycepin prevented polyadenylation of hnRNA (Darnell et al_. ,1971b) suggested that poly(A) addition was required for some step in the production of mRNA from hnRNA. It might play a role in some subsequent obligatory step in mRNA processing, or it could conceivably be directly involved in nucleocytoplasmic transport. Nevins and Darnell (1978) observed that late adenovirus transcripts were polyadenylated within about one minute of transcription of their poly(A) sites, and that the first polyadenylated transcripts to be produced were unspliced. Transcripts of SV40 (Lai et al.,1979), the ovalbumin gene (Tsai et al.,1980) and a globin gene (Grosveld et al.,1981) are also polyadenylated before being spliced. In view of these observations and of the fact that no nonpolyadenylated, spliced mRNA was known, Zeevi et al.(1981) asked whether or not polyadenylation might be a prerequisite for splicing. They treated adenovirus-infected HeLa cells briefly with cordycepin so as to completely inhibit polyadenylation while allowing transcription to continue at near-normal rates for the duration of the experiment. Pulse-labelled nuclear RNA was isolated from the cells, and adenovirus ElB and E2 transcripts were selected by hybridization to filter-bound, cloned DNA. Poly(A) could not be detected in the hybrid-selected transcripts, but in both cases, normally spliced transcripts were detected. These experiments did not exclude the possibility that splicing was dependent on correct transcript cleavage at poly(A) sites, but they showed that polyadenylation itself was not a prerequisite for splicing. The more recent demonstration that runoff transcripts terminated at a site remote from known poly(A) sites were substrates for in vitro splicing (Padgett et al.,1983) further suggests that splicing is not obligatorily dependent upon normal 3' end generation. Zeevi, Nevins and Darnell (1982) went on to consider the possibility that polyadenylation was involved in nucleocytcplasmic transport of mRNA. They found that after brief cordycepin treatment of adenovirus-infected cells, nonpolyadenylated, spliced transcripts of the ElA, ElB and E2 adenovirus transcription units accumulated in the cell nuclei at about the same rate as the normal transcripts for about 40 minutes. These nonpolyadenylated adenovirus mRNAs could be detected in total cytoplasmic or polysomal RNA, but they accumulated in the cytoplasmic compartment at a much lower rate than normal, poly (A)+ transcripts in untreated cells. The shorter the period of labelling, the smaller was the difference between ElB cytoplasmic mRNA levels in cordycepin-treated and untreated cells, suggesting that nucleocytoplasmic transport itself was not i n h i b i t e d by co rdycep in t rea tmen t , but t h a t the r e s u l t i n g p o l y ( A ) ~ t r a n s c r i p t s were uns tab le i n the cy top lasm. The authors were l e d t o conc lude t h a t po l y (A ) has no o b l i g a t o r y r o l e i n t he c e l l n u c l e u s , and t h a t i t s s o l e f u n c t i o n may be t o s t a b i l i z e cy top lasm ic mRNA. They went so f a r as t o propose t h a t the apparent s e l e c t i o n of c e r t a i n hnRNA sequences f o r t r a n s p o r t t o the cy top lasm may be a consequence o f the r a p i d deg rada t i on o f nonpo lyadeny la ted sequences a f t e r t r a n s p o r t . However, they c o u l d not exc lude the p o s s i b i l i t y t h a t non-po lyadeny la ted n u c l e a r RNA sequences a re s u b j e c t t o i n t r a n u c l e a r d e g r a d a t i o n , o r t h a t t he t r a n s p o r t appara tus no rma l l y e x h i b i t s a p re fe rence f o r po l yadeny la ted sequences. A l though nonpo lyadeny la ted t r a n s c r i p t s d i d e n t e r polysomes, they appeared t o do so about h a l f as e f f i c i e n t l y as p o l y a d e n y l a t e d m o l e c u l e s . Whether t h i s was a consequence of the reduced s t a b i l i t y o f the p o l y ( A ) ~ t r a n s c r i p t s , o r whether i t was i n d i c a t i v e o f a r o l e f o r po l y (A ) i n f a c i l i t a t i n g polysome assembly , was not c l e a r . Deadeny la t ion of p u r i f i e d , po l yadeny la ted mRNAs f a i l e d t o p revent t h e i r t r a n s l a t i o n i n c e l l - f r e e sys tems, which argued a g a i n s t an e s s e n t i a l r o l e f o r po ly (A) i n r ibosome b i n d i n g o r p r o t e i n s y n t h e s i s . (For rev iews see Brawerman, 1976; L i t t a u e r and S o r e q , 1982.) However, Huez e t a l . ( 1 9 7 4 ) demonstrated t h a t po ly (A) i s impor tant t o the f u n c t i o n a l s t a b i l i t y o f p u r i f i e d g l o b i n mRNA i n j e c t e d i n t o Xenopus o o c y t e s . Deadeny la t ion o f a sample o f the normal , p o l y ( A ) + g l o b i n message was c a r r i e d out by t reatment w i t h p o l y n u c l e o t i d e phosphory lase . Both t h e po l yadeny la ted mRNA and i t s deadeny la ted coun te rpa r t were t r a n s l a t e d upon i n j e c t i o n i n t o o o c y t e s , but t r a n s l a t i o n o f the p o l y ( A ) + mRNA con t inued f o r l onge r p e r i o d s than t h a t of the p o l y ( A ) ~ message. The d i f f e r e n c e i n - 7 4 -translational activity of the two mRNAs was detectable after one hour, and the functional half-life of the poly(A)~ mRNA was estimated at 5-10 hours. Marbaix et al.(1975) measured the levels of poly(A)+ and poly(A) mRNA remaining 56 hours after injection into oocytes and found that while poly(A)+ mRNA remained at about the same level as immediately after injection, the amount of poly(A)~ mRNA had declined to 15% of its original level. To prove that the reduced stability of the deadenylated RNA was a direct effect of the removal of its poly(A) tail, and not of the possible removal of adjacent sequences, Huez et al.(1975) readenylated the poly(A)- mRNA, adding about 30 adenosine residues per 3' end with E. coli ATP-RNA adenyl transferase. The readenylated sample, like authentic globin mRNA, supported globin synthesis in Xenopus oocytes for at least 48 hours after injection. The behaviour of authentic, deadenylated, and readenylated globin mRNAs in HeLa cells was later shown to be similar to their behaviour in oocytes (Huez et al.,1981). The length of the poly(A) segment proved to be of importance to the functional stability of globin mRNA oocytes: while a partially deadenylated mRNA sample retaining on average 32 adenosine residues per 3' end was as stable as authentic globin mRNA, a sample with only 16 adenosine residues per 3' end was no more stable than poly(A)- mRNA (Nudel et al.,1976). The discovery that poly(A) shortening takes place normally in the cytoplasm (Sheiness and Darnell, 1973) and that both the shortening process and mRNA turnover could be slowed by an inhibitor of translation (Sheiness et al.,1975) led to speculation that the rate of poly(A) shortening might control the rate of mRNA turnover. Darnell and his colleagues (Sheiness et al.,1975) suggested a model in which poly(A) decayed by random endonucleolytic cleavage, and a poly(A) tract of at least a certain threshold length was required to protect an mRNA molecule from degradation. The above-mentioned data of Nudel et al.(1976) suggested that for globin mRNA in oocytes, the threshold length of poly(A) might be about 30 residues. The results of Huez et al.(1977) also hinted at a relationship between translation and mRNA degradation, since deadenylated globin mRNA proved to be less stable in oocytes if injected with haemin, which increases the efficiency of translation of the mRNA, than if injected in the absence of haemin. Combined with the earlier results of the same group, this study suggested that the role of poly(A) may be to protect mRNA from translation-associated degradative processes. Poly(A) binding proteins which could conceivably be involved in the protective role of poly(A) have been found, but their true significance remains a matter of speculation (Brawerman, 1981). Factors other than the mere presence of poly(A) must influence mRNA stability, because different polyadenylated mRNAs can display quite different half-lives (see, for example, Harpold et al.,1981). Whether or not these differences depend on different rates of poly(A) shortening is not known (Wilson et al.,1978). Brawerman (1981) and Littauer and Soreq (1982) invoked differences in primary or secondary structure of 3' untranslated regions to explain the differences in stability of different poly(A)+ mRNAs. If this explanation is correct, it requires further elaboration to account for changes which can occur in the stability of a given mRNA. Yeast histone mRNAs, which are polyadenylated, are more -76-stable in S phase than in other phases of the cell cycle (Hereford et al.,1981;Osley et al.,1981 ). Prolactin induces a 17-25-fold increase in the half-life of casein mRNA in breast tissue explant culture (Guyette et al.,1979), and mitogenic stimulation of arrested fibroblasts is accompanied by a dramatic increase in the half-life of c-myc mRNA (Blanchard et al.,1985). In at least one case, neither the poly(A) tail nor the adjacent 3' untranslated sequences seem to affect mRNA stability, in Xenopus oocytes. Sehgal et al.(1978) reported that deadenylated fibroblast interferon mRNA exhibited the same functional stability as the intact mRNA in oocytes. Large stretches of 3' untranslated sequences could also be removed without affecting the stability of the interferon mRNA molecules (Weissenbach et al.,1980). At present, it seems that the only safe conclusion regarding the function of polyadenylate in mRNA is that it stabilizes the mRNA in the cytoplasm sometimes. 3' End Generation as a Regulatory Device in Eucaryotes The physical compartmentalization of the eucaryotic cell prevents coupling between transcription and translation, and it therefore excludes the possibility of regulating gene expression by means of polar effects or attenuators of the sort found in bacteria. Nonetheless, 3' end generation is important in regulating the expression of some genes in eucaryotes. Regulation is achieved either by controlling the efficiency of termination, or by controlling the efficiency of polyadenylation at two or more alternative sites. The first case is formally similar to bacterial attenuation in that the expression of genes downstream of a terminator depends upon the efficiency of that terminator. The second case controls the relative level of two or more different pre-mRNAs from a given transcription unit. The transcripts may subsequently undergo different processing pathways to produce different mRNAs encoding different polypeptides. Control Over Transcript Termination At least two cases of gene regulation by means of transcript termination have been described in eucaryotes and their viruses. The adenovirus major late transcription unit is active early in infection as well as after the commencement of DNA synthesis. Transcripts initiated at the major late promoter at early stages of infection do not extend beyond map unit 99 on the genome, as do those produced at later stages. Nevins and Wilson (1981) mapped the extent of the major "late" transcription unit prior to DNA replication by measuring the sensitivity to UV irradiation of transcription from various regions of the genome. The results suggested that transcripts originating from the major late promoter did not extend much further than map unit 60. Akusjarvi and Persson (1981) isolated pulse-labelled nuclear RNA from infected cells in the presence of a DNA synthesis inhibitor and measured its ability to protect various fragments of the genome from Si nuclease. A fragment containing the L3 polyadenylation site at about map unit 60 was not protected, suggesting that most of the nuclear transcripts terminated before reaching this point. The results of Nevins and Wilson differed slightly in that they suggested that some mRNAs of the L3 family were produced early in infection, but in any event, termination seemed to prevent the synthesis of the L4 and L5 families. No evidence concerning the mechanism by which transcript termination is regulated during infection has been reported, but Nevins (1982) and Thomas and Matthews (1980) speculated that transcription from the oppositely-oriented E2 promoter might block transcription from the "late" promoter. Transcript termination may also regulate the expression of the SV40 late genes during lytic infection. The discovery of a 94-nucleotide prematurely-terminated transcript from the SV40 late transcription unit was reported in 1982 by Hay and Aloni (see Termination Sites for RNA Polymerase II Transcription). At the time the authors noted that the 94-nucleotide transcript could potentially fold into either of two alternative secondary structures which were analogous to those available to the leader transcripts of bacterial biosynthetic operons. One structure contained a stem-and-loop followed by a tract of uridylate residues, which resembled a factor-independent terminator. The other structure contained an overlapping stem-and-loop, the formation of which would prevent formation of the terminator. The analogy between the 94-nucleotide RNA and the leader transcript of a bacterial biosynthetic operon could be extended further, in that the 94-nucleotide species could in principle encode a small peptide, the so-called agnoprotein. The authors suggested that the agnoprotein might serve to modulate the formation of the terminator hairpin, thereby regulating the expression of the structural gene downstream (VPl). They specifically postulated that in the nucleus, the agnoprotein would bind to nascent SV40 transcripts, stabilizing the terminator hairpin and preventing transcription of the VPl gene, and that in the cytoplasm, the same type of binding would enhance translation of VPl by masking the agnoprotein initiator codon. It is difficult to see how this mode of regulation would be of any advantage to the virus. Nonetheless, Hay and Aloni (1985) have provided some circumstantial evidence which supports the idea of a relationship between the synthesis of agnoprotein and the synthesis of the 94-nucleotide prematurely-terminated RNA. Synthesis of the 94-nucleotide RNA was followed in isolated nuclei, and synthesis of the agnoprotein was monitored by labelling infected cells for 3 hours with [-^ Cj-arginine. Nuclei isolated from cells 48 hours after infection produced the 94-nucleotide RNA, whereas nuclei isolated at the beginning of the late stage of infection (24 hours post-infection) did not. Synthesis of agnoprotein was detected 50 hours after infection, but not at earlier times. Nuclei isolated from several mutant viruses which do not encode agnoprotein exhibited reduced levels of prematurely-terminated RNA. However, since each of the mutations in the viruses tested could have affected the secondary structures available to nascent late transcripts, proof of a causal relationship between agnoprotein synthesis and premature termination is still lacking. A case of regulated transcript termination with more obvious physiological significance was reported in 1984 by Mather and colleagues. They analyzed nascent transcripts of the immunoglobulin heavy chain locus after limited extension in isolated nuclei and found that the region of transcript termination differed according to the state of differentiation of the cells from which the nuclei were isolated. In B lymphoma lines arrested at early stages of B cell differentiation, transcription proceeded through the adjacentand S heavy chain genes, but in IgM-secreting hybridomas and plasmacytomas, transcription terminated between the and 6 coding regions. -80-Control Over Polyadenylation Site Selection Selection of alternative polyadenylation sites is also important in regulating the expression of the immunoglobulin heavy chain gene. Immunoglobulin /*• chains are produced either in secreted or membrane-bound form. The two differ in their C-terminal regions: the last 21 amino acids of the secreted form are replaced in the membrane-bound form by a 41-amino acid membrane-spanning domain. They are encoded by different mRNAs produced from the same transcriptional unit (Early et al.,1980). The mRNA encoding the secreted form is polyadenylated downstream of the fourth exon of the <y* gene, while that encoding the membrane-bound /* chain is polyadenylated at the 3' end of the sixth exon. Somehow the 3' end processing apparatus is able to ignore the first polyadenylation site under appropriate conditions and allow the incorporation of the last two exons into the mRNA precursor. The fifth exon encodes the membrane-spanning segment of the membrane-bound /* chain. Selection of each of the alternative poly(A) sites is controlled inasmuch as B lymphocytes express mainly the membrane-bound /*- chain, while plasma cells synthesize large amounts of secreted /*• chains. Mather et al.(1984) found that transcription proceeds through all six C^ exons and the seven Cg exons downstream in B lymphomas expressing surface immunoglobulin. Control over the production of mRNAs encoding /* s, ,/*m/ and 6 immunoglobulin heavy chains must therefore be exerted at the level of mRNA processing. In other systems cleavage and polyadenylation precede splicing (Nevins and Darnell, 1978; Lai et al.,1979) so it is assumed that the choice of one of several available -81-polyadenylation sites restricts the splicing pattern subsequently available to a given transcript. Consistent with this notion, Mather and colleagues observed that 8 sequences are much less abundant in polyadenylated nuclear RNA from lymphomas expressing only IgM than are /< sequences. It seemed that although transcription proceeded through the Cg exons, polyadenylation at sites adjacent to the C^ exons precluded the possibility of producing 6 mRNA. In one lymphoma expressing both and 6 heavy chains, it seemed that both splice site selection and polyadenylation site selection may have been important in controlling the production of j< and 8 mRNAs. Nuclear transcripts polyadenylated distal to the 8 exons seemed to have already undergone splicing, suggesting that a rapid splicing event may have influenced selection of a poly(A) site. Rosenfeld and colleagues have uncovered a clear case of regulation at the level of polyadenylation in the gene encoding calcitonin. Calcitonin is encoded by an mRNA polyadenylated downstream of the fourth exon in the gene. A different mRNA containing two additional exons is produced from the same gene and encodes a previously-undescribed neuropeptide (reviewed by Rosenfeld et al.,1984). The relative levels of the two mRNAs are differentially regulated in thyroid C cells and in various cells of the central nervous system. Amara et al.(1984) showed that transcription continued beyond the second of the two polyadenylation sites in the calcitonin gene in a thyroid tumour cell line which produced calcitonin, but not the related neuropeptide. The same pattern of transcription was detected in a cell line producing only the neuropeptide mRNA, indicating that the differential production of the two mRNAs resulted from differences in mRNA processing, not differences in -82-transcription. The existence of unspliced or partially spliced transcripts extending from the cap site to either of the two polyadenylation sites suggested that polyadenylation preceded splicing and that 3' end processing, not splicing controlled the relative levels of the two alternative mRNAs. Poly(A) Sequences in Yeast mRNA McLaughlin et al. (1973) reported that about 2-3% of the radioactive adenine incorporated into RNA by Saccharomyces cerevisiae in a 10-minute period could be recovered in the form of RNase (A+T )^-resistant polyadenylate. Much of the labelled poly(A) sedirrented with polysomes in a sucrose gradient, and it accounted for about 4% of the radioactivity in the polysomal region of the gradient. As the period of labelling increased, the proportion of the polysomal radioactivity which was due to poly(A) decreased: after several generations of labelling and a 2 hour chase, essentially no labelled poly(A) was associated with the polysomes. Together these observations suggested that the polysomal poly(A) was associated with an unstable type of RNA. Disruption of the polysomes in low-Mg buffer released ribosomal subunits and polydisperse ribonucleoprotein complexes which had previously been identified as containing mRNA. Almost all of the poly(A) sedimented with the polydisperse ribonucleoproteins, suggesting that the poly(A) in yeast, as in mammalian cells, was associated with mRNA. The possibility of artifactual association between poly(A) and polysomal mRNA was excluded by experiments with a mutant having a temperature-sensitive defect in -83-protein synthesis. Polysomes in the mutant were disrupted by a temperature shift and concomitant with their disruption, the sedimentation rate of the labelled poly(A) decreased to coincide approximately with that of free ribosomes. Unlabelled polysomes did not affect the sedimentation rate of the labelled poly(A) when added to the extract of temperature-shifted mutant cells prior to centrifugation. Poly(A) which had been labelled for a 10-minute period in spheroplasts of normal yeast cells was isolated from the rest of the labelled RNA by digestion with RNases A and T-|_. Upon alkaline hydrolysis, it released AMP and adenosine in the ratio of about 50:1, suggesting that it was about 50 nucleotides long and located at the 3' ends of mRNA molecules. Its electrophoretic mobility also suggested a length of about 50-70 nucleotides. Groner et al. (1974) estimated the average length of pulse-labelled yeast poly(A) to be about 60 nucleotides, which is about one-quarter as long as newly-synthesized poly(A) in mammalian cells (Sheiness and Darnell, 1973). After a 100-minute period of labelling, which would be expected to completely label the mRNA population (Hutchison et al., 1969), the poly(A) had a broader size distribution, ranging from 60 nucleotides to 20 or perhaps fewer (Groner et al. , 1974). [RNase-resistant poly(A) was purified by binding to oligo(dT) cellulose prior to electrophoretic analysis, and the authors cited control experiments showing that poly(A) containing fifteen adenylate residues failed to bind to oligo(dT) cellulose.] The finding that poly(A) tracts in steady-state mRNA tended to be shorter on average than those in pulse-labelled mRNA suggested that poly(A) may undergo gradual shortening after synthesis, as it does in mammalian cells -84-(Sheiness and D a r n e l l , 1973). About 64% o f the po lysomal RNA l a b e l l e d i n a 3-minute p u l s e was found t o b i n d t o o l i g o ( d T ) c e l l u l o s e (Groner e t a l . , 1974). The m a t e r i a l which f a i l e d t o b i n d i n c l u d e d a s u b s t a n t i a l amount o f 18S rRNA as w e l l as a s m a l l amount of heterogeneous RNA. McLaugh l in e t a l . (1973) a l s o de tec ted p o l y d i s p e r s e po lysomal RNA which would not b i n d t o o l i g o ( d T ) c e l l u l o s e , and they suggested t h a t some y e a s t mRNAs may l a c k p o l y ( A ) . The po l y (A ) con ten t o f the m a t e r i a l wh ich f a i l e d t o b i n d t o o l i g o ( d T ) c e l l u l o s e was indeed ve ry low, but the assay i t s e l f depended upon b i n d i n g t o o l i g o ( d T ) c e l l u l o s e and t h e r e f o r e d i d not exc lude the p o s s i b i l i t y t h a t ve ry s h o r t po ly (A) cha ins may have been p r e s e n t . The p o s s i b i l i t y t h a t mo lecu les wh ich g e n u i n e l y l a c k e d po ly (A) were the p roduc ts o f r a p i d p r o c e s s i n g of po l yadeny la ted mo lecu les a l s o remained open. Here fo rd and Rosbash (1977) determined the sequence comp lex i t y o f yeas t RNA by measur ing t h e r a t e and e x t e n t o f i t s h y b r i d i z a t i o n t o genomic DNA and t o cDNA prepared a g a i n s t po l yadeny la ted yeas t RNA. Po l yadeny la ted y e a s t RNA, i s o l a t e d on o l i go (dT ) c e l l u l o s e , s a t u r a t e d the same p r o p o r t i o n (20%) of a s i n g l e - c o p y yeas t DNA t r a c e r as d i d t o t a l yeas t RNA, sugges t i ng t h a t e s s e n t i a l l y a l l o f the sequence comp lex i t y o f yeas t RNA i s rep resen ted amongst the po l yadeny la ted sequences. I f any RNA e x i s t s i n e x c l u s i v e l y non-po lyadeny la ted form i n y e a s t , i t must c o n s t i t u t e a low-comp lex i t y sequence c l a s s . Both po lysomal po l yadeny la ted RNA and t o t a l po l yadeny la ted RNA h y b r i d i z e d a t the same r a t e and t o t he same ex ten t t o cDNA probes prepared a g a i n s t p o l y ( A ) + RNA, which f u r t h e r suggested t ha t the mRNA p o p u l a t i o n o f the yeas t c e l l c o n t a i n s a l l o f t he sequences found -85-in total polyadenylated yeast RNA. The transcripts of many specific yeast genes have since been shown to bear poly(A) tails, but perhaps the most telling observations regarding the ubiquity of poly(A) in yeast mRNA were those of Fahrner et al. (1980). These authors found that yeast histone mRNAs bound to oligo(dT) cellulose almost quantitatively and were susceptible to reverse transcription from an oligo(dT) primer. The observation that yeast histone mRNAs contain poly(A) makes the supposition that all yeast mRNAs are polyadenylated seem quite plausible. How the 3' ends of yeast mRNAs or their precursors are generated prior to their polyadenylation is not known. Sequence complexity measurements (Hereford and Rosbash, 1977) and the size distribution of rapidly-labelled yeast RNA (Groner et al. , 1974) both suggest that large mRNA precursors are not common in yeast. However, neither type of result rules out the possibility that in yeast, as in higher eucaryotes, transcription may proceed beyond poly(A) sites, and that mature mRNA 3' ends may be the products of rapid processing reactions. Because the mechanism of mRNA 3' end generation in yeast is not known, signals involved in the process will simply be referred to as 3' end signals. Comparison of the 3' untranslated and flanking sequences of various yeast genes gives an indication that 3' end signals in yeast might be different from those in other eucaryotes. The hexanucleotide AATAAA is found downstream from the coding sequences of some but by no means all yeast genes (Bennetzen and Hall, 1982; Zaret and Sherman, 1982), in contrast to its near-universal occurrence near poly(A) sites in the genomes of other eucaryotes. -86-One yeast gene which is not flanked by the sequence AATAAA is CYCl, which encodes the more abundant of the two iscr-cytochromes c of yeast (Sherman et al. , 1966). It has been subjected to more intensive study than any other yeast gene. CYCl was cloned in 1978 by Montgomery et al., who identified it in a library of cloned yeast DNA fragments by virtue of its hybridization to a synthetic oligonucleotide. Synthesis of an oligonucleotide complementary to 13 nucleotides of the CYCl coding region was possible because Stewart and Sherman (1974) had deduced 44 bp of the CYCl coding sequence from the amino acid sequences of the products of cycl frameshift alleles. The sequence of the entire coding region of the gene and 250 and 280 bp of its 5' and 3' flanking sequences, respectively, was reported in 1979 by Smith et al. The authors noted the absence of the hexanucleotide AATAAA from the 280 bp following the CYCl coding sequence but recognized the possibility that the 3' end of the CYCl transcript might be encoded further downstream. However, Boss et al.(1981) reported the sequence of the CYCl transcript, which showed that the junction between transcribed sequences and polyadenylate tail was located 172-175 nucleotides beyond the coding region. If, as seemed likely, the CYCl 3' end signal resided near the 3' end site, then it could not include the sequence AATAAA. Zaret and Sherman (1982) found that the cycl-512 allele, one of about 500 cycl alleles characterized by Sherman and his colleagues (Sherman et al.,1974), lacked a 38 bp sequence found downstream of the coding sequence in the wild-type allele. Mutants carrying the cycl-512 allele produced 5-10% of the normal amount of iso-1-cytochrome c. Whereas the transcript of the CYCl"1" allele was about 630 nucleotides long, including its poly(A) tail, cycl-512 mutants produced a family of discrete transcripts, ranging in length from 630 to about 2400 nucleotides, which could be detected by a CYCl probe. The aberrant transcripts extended beyond the normal poly(A) site of CYCl mRNA, which indicated that the 38 bp deletion in the cycl-512 allele disrupted a signal required for 3' end generation at that site. All of the transcripts of the cycl-512 allele bound almost quantitatively to poly(U)-Sepharose, suggesting that they were polyadenylated. Zaret and Sherman proposed that the deletion in the cycl-512 allele impaired transcript termination at the normal poly(A) site, and that the extended transcripts were the products of coupled termination and polyadenylation at a series of downstream sites. The iso-1-cytochrome c deficiency of the cycl-512 mutant correlated with the lower abundance of CYCl transcripts in the mutant as compared to the wild-type strain. Zaret and Sherman suggested that the extended transcripts of the cycl-512 allele were less stable than normal CYCl mRNA. A somewhat different point of view is that the extended, polyadenylated transcripts seen in the steady-state RNA represent the few stable products of a gene with very inefficient transcriptional 3' end signals. Several cases have been described of mutations in other eucaryotes which disrupt 3' end signals and concomitantly limit the expression of the corresponding genes by preventing the efficient synthesis of stable transcripts (Higgs et al., 1983; Orkin et al., 1985). A third possibility is that the rate of transcription of the cycl-512 allele was actually lower than that of CYC1+. While i t seems unlikely that a mutation in the 3' flanking sequences of a polymerase II-transcribed gene would directly limit the -88-activity of its promoter, Zaret and Sherman noted that the cycl-512 deletion caused overlapping transcription of cycl-512 and a downstream, oppositely oriented gene which came to be called UTRl (Zaret and Sherman, 1984). The UTRl transcript in CYC1+ yeast is about 1450 nucleotides long, whereas that produced in cycl-512 cells is about 2000 nucleotides long and extends through the CYCl coding region. Transcripts of both CYCl and UTRl are less abundant in cells carrying the cycl-512 allele than in their CYCl"1" counterparts, and the authors suggested that overlapping, convergent transcription of the two genes might limit the rate at which they could be transcribed. Whatever the exact reason for the iso-1-cytochrome c deficiency of cells with the cycl-512 mutation, i t proved to be very useful, in that it allowed Kotval et al. (1983) and Zaret and Sherman (1984) to select revertants which synthesized higher levels of cytochrome c. Amongst the mutations found in the revertants were several chromosomal rearrangments which were genetically linked to CYCl, unlinked suppressor mutations in two different genes, and many vstrictly local' mutations which behaved genetically as intragenic CYCl mutations. Zaret and Sherman (1984) analyzed the physical structure of the CYCl alleles in some of the revertants and compared the CYCl transcripts produced by the revertants to those of the cycl-512 mutant. In those revertants with gross genetic aberrations, the sequences flanking the 3' end of the cycl-512 allele had been replaced by other sequences, and the 3' ends of the major CYCl transcripts in each revertant mapped within these new flanking sequences. In each case it seemed that the genetic rearrangement downstream of the CYCl coding region had introduced new 3' -89-end signals which were stronger than those associated with the cycl-512 allele. Two insertions which had not been detected as rearrangements by genetic analysis similarly introduced new 3' end signals downstream from the cycl-512 allele. The remaining revertants produced various subsets of the transcripts found in the cycl-512 mutant or transcripts which were at least similar in size to those found in the mutant. Many of the revertants owed their increased levels of iso-1-cytochrome c to mutations which allowed the most CYCl-proximal 3' end site to be used more efficiently than in the cycl-512 mutant. Others produced heterogeneous CYCl transcripts with various size distributions, suggesting that control over 3' end site selection might be quite complex. Revertants which carried sut2 suppressor mutations accumulated the extended, 1650-2400 nucleotide transcripts in higher levels than the mutant, which suggested to the authors that sut2 mutations inhibited the degradation of these hypothetically unstable transcripts. The complexity and variety of patterns of 3' end generation observed amongst the revertants analyzed by Zaret and Sherman (1984) give cause for concern that the signals involved in 3' end generation might exhibit parallel complexity and variety. In an attempt to identify signals involved in transcript 3' end generation, Zaret and Sherman (1982) compared the sequences downstream of the coding regions of CYCl and a number of other yeast genes. They identified a conserved sequence which in the case of CYCl occurred in the 38 bp region that was lacking from the cycl-512 allele. The consensus for this conserved "terminator" sequence was TAG...TA(T)GT...TTT. Sequences flanking the central element -90-of t h i s t r i p a r t i t e sequence tended t o be A-T r i c h , w i t h a b i a s towards hav ing Ts i n the mRNA-pa ra l l e l s t r a n d . No d i r e c t t e s t o f the r o l e o f the consensus i n 3 ' end gene ra t i on has y e t been r e p o r t e d , but Zare t and Sherman (1984) r e p o r t e d the sequences of two r e v e r t a n t a l l e l e s d e r i v e d f rom c y c l - 5 1 2 . Both sequences d i f f e r e d f rom the mutant a l l e l e i n a r e g i o n w i t h some homology t o the t r i p a r t i t e " t e r m i n a t o r " sequence. Each r e v e r t a n t a l l e l e d i f f e r e d a t two ad jacen t p o s i t i o n s f rom the c y c l - 5 1 2 , and s u r p r i s i n g l y , the d i f f e r e n c e s d i d not improve homology t o any of the t h ree conserved elements o f the consensus sequence. Ins tead they permuted the sequence of an A-T r i c h t r a c t found between the homologues o f t he second and t h i r d conserved e lements . Hen iko f f and h i s c o l l e a g u e s have at tempted t o l o c a t e and i d e n t i f y t he sequences r e q u i r e d t o s p e c i f y t h e 3 ' end o f t r a n s c r i p t s o f a D r o s o p h i l a gene i n y e a s t . A segment of the D r o s o p h i l a g l yc inamide r i b o n u c l e o t i d e t r ans fo rmy lase (GAR t rans fo rmy lase ) gene complements a y e a s t ade8 mu ta t i on , and i t s t r a n s c r i p t s i n y e a s t a r e po l yadeny la ted a t a s i t e near an AAUAAA h e x a n u c l e o t i d e , which r a i s e d the q u e s t i o n o f whether yeas t r ecogn i zed the same type of 3 ' end s i g n a l as o the r euca ryo tes . Hen iko f f e t a l . (1983) produced nes ted d e l e t i o n s wh ich extended toward the GAR t r ans fo rmy lase cod ing sequence f o r v a r y i n g d i s t a n c e s from a s i t e downstream o f the po ly (A) s i t e . D e l e t i o n s wh ich d i s r u p t e d the 3 ' end s i g n a l caused the p r o d u c t i o n o f a 3 ' -ex tended 1.5 kb t r a n s c r i p t s i n p l a c e o f the 1.0 kb t r a n s c r i p t made from the i n t a c t gene. The downstream boundary o f the 3 ' end s i g n a l was f i r s t mapped t o a 29 bp r e g i o n , and the e f f e c t s o f d e l e t i o n s w i t h p rox ima l endpo in ts w i t h i n t h i s r e g i o n showed t h a t the sequence TTTTTATA d e f i n e d the boundary of the 3 ' end s i g n a l . Deletions which left this sequence intact allowed normal 3' end generation, but the removal of even the terminal A residue caused about 50% of the transcripts to extend beyond the normal 3' end site. Deletions which extended still further upstream reduced the efficiency of correct 3' end generation, to the point that a deletion extending 8 bp upstream of the TTTTTATA sequence abolished correct 3' end generation. The same octanucleotide occurs in the CYCl, CYC7 and GPP genes of yeast, in each case downstream of the coding region. Suspicions that it might be a general feature of 3' end signals in yeast were tempered by the finding that 14 other yeast genes lack the sequence. In a continuation of the same study, Henikoff and Cohen (1984) analyzed the effects of nested deletions which approached the 3' end site from a fixed site upstream. The results were surprising: a deletion which ended only 12 bp upstream of the last A in the sequence TTTTTATA produced normal transcripts and only low levels of extended transcripts. Not until the entire octanucleotide and 23 bp downstream were deleted was the synthesis of correctly "terminated" transcripts abolished. In principle this result could be explained by the presence of a duplicated signal, one copy of which is sufficient to cause 3' end generation. In fact, Henikoff et al. (1983) had noticed that a second copy of the sequence TTTTTATA was present 18 bp downstream of the first. Deletions approaching the region from upstream inactivated the 3' end signal only when they disrupted the second copy of the octanucleotide. This suggested that each octanucleotide comprised part of a separate, at least partly autonomous 3' end signal, or as the authors had it, terminator signal. Henikoff and Cohen tested the degree to which the first copy of the -92-signal could function autonomously by deleting its normal flanking sequences on both sides, so that the signal resided on a 25-36 bp fragment in a new sequence context. Surprisingly, the signal functioned very inefficiently, allowing detectable 3' end generation in only one of three constructs tested. The normal sites of 3' end generation were absent from downstream of the signal fragment in each construct. Re-introducing these sites allowed some improvement in the efficiency of 3' end generation. In general terms, these results indicated that the 3' end signal as delimited by deletion analysis was not functionally autonomous. At the very least, its activity depended upon the presence of suitable 3' end sites downstream. In their earlier study, Henikoff et al. (1983) had noted a distinct sequence preference in the precise sites at which 3' end generation occurred. Sites with the sequence CAA...CTTTG seemed to be preferred, although their use was not exclusive of 3' end generation at other sites. Roughly constant spacing was maintained between the 3' end signal and the sites of 3' end generation in a given deletion mutant, suggesting that the factors responsible for 3' end generation might recognize the signal and act if a suitable site could be found within a certain range of signal. The range in the case of the Drosophila GAR transformylase gene in yeast seemed to be 50-90 nucleotides. Neither the signals involved in 3' end generation in yeast nor the manner of their involvement can presently be described completely, yet the facility of genetic manipulation in yeast offers at least a clear approach toward defining the signals. The study to be described here was undertaken in an effort to define the limits of the sequences required to specify the 3' end site of CYCl mRNA, and to develop a genetic screen for defects in 3' end generation. Coupled with an efficient means of mutagenizing the CYCl 3' end signal region, such a screen should make it possible to identify precisely the sequences which constitute the 3' end signal. Mutations which complement defects in 3' end generation should also be detectable using the same screen and amongst them might be mutations in genes whose products interact with 3' end signals. Gaining access to these genes and their products would be an important step in determining how the process of 3' end generation takes place in yeast. -94-MATERIALS AND METHODS REAGENTS Enzymes Restriction endonucleases used in this work were from Bethesda Research Laboratories (BRL) or New England Biolabs (NEBL). DNA polymerase I (Klenow fragment), T4 DNA ligase, T4 polynucleotide kinase, bacterial alkaline phosphatase, and RNase T^  were also from BRL. Exonuclease I I I and nuclease BAL31 were from NEBL. Si nuclease was from P-L Biochemicals, RNaseA and lysozyme were from Sigma, proteinase K was from Boehringer Mannheim, and Glusulase was supplied by Endo. The conditions under which each enzyme was used are described later in this chapter. Units are those defined by the supplier. Oligonucleotides Table I lists the sequences and suppliers of the oligodeoxyribonucleotides used in this work. Oligonucleotides synthesized in this laboratory were purified by electrophoresis in 20 x 40 cm x 0.2 mm thick gels containing 20% acrylamide, 0.67% bis-acrylamide, and 7 M urea in TBE electrophoresis buffer (50 mM Tris base; 50 mM boric acid; 1 mM EDTA; Maxam and Gilbert, 1980). Formamide was added to the crude oligonucleotide in water to a concentration of 50%, and the mixture was heated for 3 minutes at 90°. About 2 A26O units of crude material (in 10 pi) was loaded into each 1 cm wide slot. Electrophoresis was carried out at 1,500 V for 4 - 6 hours, and the bands were visualized by shadowing against fluorescent silica thin-layer plates under UV illumination. The band containing the full length oligonucleotide was excised with a -95-TABLE I LIST OF OLIGONUCLEOTIDES Name Sequence Supplier oASl oAS2 cAS3 oAS4 OAS5 OAS6 oAS7 M13FP1 M13RP1 5'-d(ATTTATTTGGTTATAG)-3' 5'-d(GTTCTTGATACTAA)-3' 5'-d(TATAGTTAGTTTAGTATT) -3' 5'-d(TATAGTTATCTTAGTATT)-3' 5'-d(TTAATAATGACTGG)-3' 5'-d(AATTCCAGTCATT ATTAA)-3' 5'-d(ATGCATGTGCTCTGTAT)-3' 5'-d(TCACGACGTTGTAAAAC)-3' 5 '-d(TCACACAGGAAACAGCT)-3' P-L Biochemicals T. Atkinson (UBC) R. Barnett (UBC) -96-scalpel, cut into small pieces, and transferred to a 1.5 ml Eppendorf tube. The oligonucleotide was eluted by overnight incubation in 500 / i l of 0.5 M NH4OAC, 10 mM MgCl2. The eluate was transferred to a clean tube, the gel pieces were rinsed with 500/il of the same solution, and the rinse was combined with the eluate. Repeated extraction with n-butanol reduced the volume to about 100 JJLI. The oligonucleotide was then precipitated by the addition of 1 ml of ethanol, followed by storage at -70° for 30 minutes. The precipitate was collected by centrifugation in an Eppendorf microfuge for 10 minutes at 4°. Nucleotides 2'-Deoxyribonucleoside triphosphates, tx-thiodeoxyribonucleoside triphosphates, and 2' ,3 '-dideoxyribonucleoside triphosphates were from P-L Biochemicals. They were dissolved in water at an approximate concentration of 10 mM and the pH was adjusted to 7 by adding Tris from a 50 mM solution. The exact concentration of each stock was determined spectrophotcmetrically. Stocks were stored frozed at -20°. a[32p]-2'-deoxyribonucleoside triphosphates, and /[32p]-adenosine triphosphate were purchased from New England Nuclear. They had specific activities of about 3,000 Ci/mmol and were supplied as aqueous solutions containing 10 juCi^ ul. Vanadyl ribonucleoside complexes (VRC) were obtained as a 0.2 M solution from Bethesda Research Laboratories. Galactosides o-Nitrophenyl ft -D-galactoside (ONPG), isopropyl 6 -D-thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl ^ -D-galactoside (XGAL) were from Sigma. All were stored at -20°. IPTG was dissolved in water at a concentration of 0.1 M and XGAL was -97-made up as a 2% solution in dimethylformamide. Both solutions were stored at -20°. ONPG was dissolved as needed. Phenol Phenol was purchased from Fisher as a 90% solution and was purified by distillation. It was stored frozen at -20° under an atmosphere of argon. Aliquots were thawed, saturated with TE10:1 (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) and kept at 4° for periods of up to about a month. Glyoxal Glyoxal was purchased as a 6 M aqueous stock, which was deionized by repeated passage through BioRad AG50lX8(D) resin before use. Deionization was considered complete when, after the glyoxal had been passed through a column of resin three times, the resin retained its blue colour (McMaster and Carmichael, 1980). If the resin changed colour, it was replaced and the procedure repeated. Formamide Formamide (99%) was purchased from Aldrich and deionized by stirring with BioRad mixed bed resin AG501-X8-D (1 g/20 ml) for 15-20 minutes, then filtering through glass wool to remove the resin. It was stored frozen at -20° in small aliquots. Formaldehyde Formaldehyde was purchased as a 37% solution from Fisher. The pH of this solution was about 4. It was stirred with AG501-X8-D mixed bed resin and filtered before being used. This treatment raised its pH to 6.5. Agarose Sigma Type 1 agarose was used for analytical agarose gel electrophoresis. Low melting point agarose for preparative gels was -98-from BRL. Acrylamide Acrylamide and bis-acrylamide from BioRad ("electrophoresis purity reagents") were used without further purification. Components of Culture Media Bacto-tryptone, Bacto-yeast extract, Bacto-peptone, and Bacto-yeast nitrogen base without amino acids were from Difco. Amino acids, purines and pyrimidines, and vitamins were from Sigma and Calbiochem. Ampicillin was from Ayerst, and chloramphenicol was from Calbiochem. Others Nuclease-free bovine serum albumin (BSA) was from BRL. Technical grade CsCl was from KBI, a division of Cabot Corporation. Other chemicals were of reagent grade where applicable and were used without further purification. Supplies for Autoradiography Kodak XRP-1 film was used for autoradiography of gels or filters carrying 32p-labelled nucleic acids. Developer and fixer were from Kodak and were used in accordance with the manufacturer's instructions. Dupont Cronex intensifying screens were occasionally used. MICROBIAL STRAINS  Bacteria The following strains of E. coli were used as hosts for recombinant DNA molecules: E. coli RR1, F", hsdS20, ara-14, proA2, lacYl,, galK2, rpsL20, xyl-5, mtl-1, supE44, \~, was constructed by Bolivar et al.(1977). E. coli JM101,^ (lac,pro), supE, thi, strA, sbcB!5, endA, hspR4, - 9 9 -F'traD36, proAB, lad , lacZ ML5, was constructed by Messing (1981). Yeast Strain GM-3C-2, described by Faye et. al_. (1981), was used as a host for plasmids carrying deletions of the CYCl 3' end signal. Its genotype wastx, leu2-3,112, trpl-1, his4-519, cycl-1, cyp3-l. Strain RP123, which was used as a host for CYCl:lacZ fusion plasmids, was provided by S. Roeder (Yale). Its genotype was as follows: <X , leu2,, adel, trpl, metl4, ura3. Strain D311-3A (Sherman et. al., 1966) is a standard CYC1+ strain, with the following genotype: a lys2-l, nisi, trp2. CULTURE MEDIA AND CONDITIONS E. coli The following media were used for the growth of E. coli: LB-glucose 1.0% Bacto-tryptone, 0.5% Bacto-yeast extract, 0.5% NaCl, 0.1% glucose YT 0.8% Bacto-tryptone, 0.5% Bacto-yeast extract, 0.5% NaCl 2YT 1.6% Bacto-tryptone, 1.0% Bacto-yeast extract, 0.5% NaCl (Sanger et. al., 1980) M9S 50 mM Na2HP04, 25 mM KH2PO4, 8.5 mM NaCl, 20 mM NH4CI, 1 mM MgS04, 0.1 mM CaCl2, 10 mM glucose, 0.001% thiamine. (Miller, 1972) For plates, Bacto-agar was added to the appropriate liquid medium at 20 g/1. Soft agar for overlays contained 7 g Bacto-agar/1. Strains containing plasmids were grown in media containing 50 ug/ml -100-ampicillin. To screen Ml3 recombinants for insertional inactivation of the lacZ Ot-peptide coding region, infected cells were plated in soft YT agar, supplemented with 0.03% XGAL and 0.3 mM IPTG. E. coli was cultured at a temperature of 37°. Growth was monitored by measuring ODggo o n a Bausch and Lomb Spectronic 21 spectrometer. Yeast Media for the culture of yeast have been described by Sherman et. al. (1981). The following were used in this study: YPD 2% Bacto-Peptone, 1% Bacto-Yeast extract, 2% glucose, pH 5.8. YPG Same as YPD except 3% glycerol substituted for glucose. YPL same as YPD except 3% lactic acid substituted for glucose. SD 0.7% Bacto-Yeast Nitrogen Base without amino acids, 2% glucose, pH 5.8. SC SD, with the following supplements: adenine, uracil, histidine, arginine, methionine, tryptophan (20 mg/1 each); lysine, isoleucine, tyrosine, leucine (30 mg/1 each); phenylalanine (50 mg/1); sodium glutamate, sodium aspartate (100 mg/1 each); valine (150 mg/1); threonine (200 mg/1); serine (375 mg/1). For plates, the above media were solidified by adding agar to a concentration of 2%. -101-R (regeneration) agar SD supplemented with 1 M sorbitol, 2% YPD, 3% agar. RC (complete regeneration) agar SC, supplemented with 1 M sorbitol, 2% YPD, 3% agar. Yeast Ca-Free XGAL agar (Ruby et al., 1983) 0.1 M (KH2PO4 + K2HPO4, pH 7); 15 mM (NH4)2S04; 1 mM MgS04, 2uM FeCl3; 0.11 M glucose; adenine, uracil, and amino acids as in SC; thiamine, pyridoxine, pantothenic acid (0.4 mg/1 each); biotin (2 ug/1); myo-inositol (2 mg/1); XGAL (40 mg/1; 2% agar. Yeast cultures were incubated at 30°. Liquid cultures were shaken on a rotary platform at 200 rpm. Growth in liquid was monitored by measuring OD550 on a Bausch and Lomb Spectronic 21 spectrometer. PLASMIDS and BACTERIOPHAGE Bacteriophage and plasmids constructed during the course of this study are described in detail in later sections of this chapter. Those provided by other workers are listed in Table II with references to a published description of each. TRANSFORMATION of E. coli Competent cells of E. coli were prepared and transformed as described by Dagert and Ehrlich (1979). A single colony of strain RRl or JM101 was used to inoculate 3 ml of LB-glucose or M9S, respectively, and the culture was incubated overnight at 37°. The next morning, 50 ml of the same medium was inoculated with 0.1 - 0.5 ml of the overnight culture and incubated until the culture had an ODgQO o f °-l t o 0.15. The culture was chilled on ice for 10 minutes and the cells were - 1 0 2 -TABLE II PLASMIDS and BACTERIOPHAGE VECTORS Name Reference Source pBR322 pYeCYCl(2.5) YEpl3 pYeCEN3(41) 2H26, 4H40 PMC1403 pLG669Z pAAR6 Ml3mp vectors pUCl3 pEMBL vectors IR1 Bolivar et al.(1977) Faye et al.(1981) Broach et al.(1979) Clarke and Carbon (1980) Faye et al.(1981) Casadaban et al.(1982) Guarente and Ptashne (1981) Ammerer (1983) Messing (1983) Messing (1983) Dente et al.(1983) Dente et al.(1983) D.W. Russell (UBC) S. Bektesh (U. of Washington) S. Bektesh S. Bektesh G. Faye (U. of Washington) P. Dennis (UBC) L. Guarente (MIT) J. Ngsee (UBC) J. Messing (U. of Minnesota) J. Messing R. Cortese (EMBO) R. Cortese -103-harves ted by c e n t r i f u g a t i o n a t 5,000 rpm i n a SS-34 r o t o r a t 4 f o r 10 m inu tes . The c e l l p e l l e t was resuspended i n i c e - c o l d 0.1 M CaCl2 (50 mM CaCl2 was sometimes used w i t h s t r a i n JM101; e i t h e r c o n c e n t r a t i o n seemed t o be e q u a l l y e f f e c t i v e ) and kept on i c e f o r 20 -30 m inu tes . The c e l l s were ha rves ted by c e n t r i f u g a t i o n as be fo re and resuspended i n 1 - 2 ml o f i c e - c o l d 0.1 M (or 50 mM) CaCl2 - They c o u l d then be used i n t r a n s f o r m a t i o n , but they were u s u a l l y kep t on i c e f o r 12 - 18 hours p r i o r t o t r a n s f o r m a t i o n s i n c e t h i s r e s u l t e d i n h i ghe r t r a n s f o r m a t i o n e f f i c i e n c y , as r epo r t ed by Dagert and E h r l i c h (1979) . P lasm id o r phage DNA (up t o 0.1 / jg i n 10jol o r l e s s ) was added t o 0.1 ml a l i q u o t s o f competent c e l l s i n g l a s s c u l t u r e tubes and the c e l l s were l e f t on i c e f o r 20 - 40 m inu tes . They were t r a n s f e r r e d t o a 42° water ba th f o r 1 - 2 minutes and removed t o room tempera ture . LB -g lucose (1 ml) was added t o each t ube , and they were incuba ted f o r 30 - 60 minutes a t 37° on a shake r . A l i q u o t s of 50 - 100 ^ul were then p l a t e d on a p p r o p r i a t e s e l e c t i v e o r i n d i c a t o r media . The p l a t e s were i ncuba ted a t 37° o v e r n i g h t , and the remainder o f the t ransformed c e l l suspens ion was saved a t 4 ° i n case i t was necessary t o p l a t e out more samples. ISOLATION o f PLASMID DNA from E . c o l i Two d i f f e r e n t procedures were used f o r the p r e p a r a t i o n o f p lasmid DNA from E . c o l i , the f i r s t r e l y i n g on c e l l l y s i s by T r i t o n X -100 , the second u s i n g a l k a l i and SDS t o l y s e the c e l l s . Both p rocedures a re d e s c r i b e d be low, as a p p l i e d t o c u l t u r e s of 50 - 500 ml and as used f o r "m in i p reps " f rom 1 - 5 ml c u l t u r e s . Both were s a t i s f a c t o r y , bu t t he a l k a l i n e l y s i s procedure was much f a s t e r and somewhat more r e l i a b l e . - 1 0 4 -Large-Scale Plasmid Isolation A single ampici11in-resistant colony was used to inoculate 5 ml of LB-glucose-Ap and the culture was incubated overnight at 37°. M9S medium (500 ml), supplemented with leucine (0.4 mg/ml) and proline (0.8 mg/ml) to allow growth of E. coli RRl derivatives, was inoculated with 2.5 ml of the saturated culture and incubated at 37° until it attained an OD5Q0 of 0.2-0.25. Chloramphenicol (100 mg/ml in ethanol) was added to a concentration of 0.2 mg/ml, and incubation was continued for 14-18 hours. Cells were harvested by centrifugation at 4° in a Sorvall GSA rotor at 8,000 rpm for 10 minutes, resuspended in a total of 50 ml of TE (10 mM Tris-HCl pH 7.5: 1 mM EDTA) and centrifuged as before. The pellet was frozen at -20°. Triton Lysis Procedure This procedure is from Davis et al. (1980). The frozen cell pellet from a 500 ml culture was resuspended in 10 ml of ice-cold sucrose:TE(50 mM sucrose; 35 mM Tris-HCl pH 8; 100 mM EDTA), and 2 ml of a freshly prepared solution of lysozyme (10 mg/ml in sucrose:TE) was added. The suspension was kept on ice for 5-10 minutes, and 4 ml of 0.25 M EDTA was then added with gentle mixing. The suspension was put at room temperature, and 0.5 ml of a solution of RNaseA (2 mg/ml in 50 mM NaOAc, pH5) which had been boiled for 10 minutes and cooled to room temperature was added. After 5 minutes, the suspension was added slowly to 20 ml of Triton mix (1.0% Triton X-100; 50 mM Tris-HCl pH 8; 15 mM EDTA) with gentle mixing. The lysate was centrifuged at 30,000 rpm for 1 hour at 10° in a Beckman 35 rotor in a Beckman Model L3-40 centrifuge. The supernatant was carefully transferred to a clean, 150 ml Corex glass bottle. An equal volume of TE-saturated phenol was -105-added and after 10 minutes of mixing, the phases were separated by centrifugation in a Sorvall GSA rotor at 5,000 rpm for 10 minutes at 4°. The upper aqueous phase was removed to a new 150 ml bottle, and 2-2.5 volumes of ethanol were added. The mixture was kept at -20° overnight, and the precipitate was pelleted by centrifugation in a GSA rotor at 5,000 rpm for 20 minutes at 4°. After brief drying under vacuum, the pellet was dissolved in TE50:10 (50 mM Tris-HCl pH8: 10 mM EDTA). The plasmid DNA was further purified by CsCl gradient centrifugation, as will be described below. Alkaline Lysis Procedure This procedure was described by Maniatis et cd.(1982) and is a modification of the method of Birnboim and Doly (1979). The frozen cell pellet from a 500 ml culture was resuspended in 10 ml of Glucose-TE (50 mM Glucose; 25 mM Tris-HCl pH 8.0; 10 mM EOT A) and powdered lysozyme was added to a concentration of 5 mg/ml. The suspension was kept at room temperature for 5 minutes; and 20 ml of an ice-cold solution of NaOH (0.2 M) and SDS (1%) was added. The suspension was mixed by inverting gently several times and kept on ice for 10 minutes before adding 15 ml of a ice-cold solution containing 3 M KOAc and 2 M HOAc (pH approximately 4.5). The lysate was mixed by inverting several times and kept on ice for 10 minutes. It was then centrifuged for 60 minutes at 4° in a Sorvall SS-34 rotor at 20,000 rpm. The supernatant was transferred to a Corex glass bottle and extracted with an equal volume of phenol/chloroform (1:1). The phases were separated by centrifugation as described above. The aqueous phase was transferred to a new bottle and one-half volume of isopropanol was added. The mixture was kept at room temperature for 30 minutes and -106-then centrifuged at room temperature in a GSA rotor for 20 minutes at 5,000 rpm. The pellet was rinsed by adding about 50 ml of ethanol and repeating the last centrifugation step. The pellet was dried briefly under vacuum and dissolved in TE50:10 in preparation for CsCl gradient centrifugation. Purification of Plasmid DNA by Cesium Chloride Gradient Centrifugation The plasmid DNA isolated from a 500 ml culture by either the Triton lysis or alkaline lysis procedure was split into two equal portions. The volume of each portion was adjusted to 9.5 ml with TE50:10. Cesium chloride (9.4 g) was added to each portion. After the CsCl had dissolved, the solution was transferred to a Beckman quick-seal polyallomer tube. Approximately 0.9 ml of a solution of ethidium bromide (10 mg/ml in H/p) was added to each tube, allowing a small air space to remain beneath the stem of the tube. With plasmids prepared by the alkaline lysis method, ethidium bromide was added before transferring to a quick-seal tube, and the solution was centrifuged at 9,000 rpm in a Sorvall SS34 rotor for 5 minutes to remove the purple precipitate that formed. The tubes were sealed using the Beckman tube sealer, inverted a few times to mix the contents thoroughly and then centrifuged in a Beckman 50Ti rotor at 37,000 rpm for 40 hours at 10° in an L3-40 centrifuge, or in a 70.1 Ti rotor at 65,000 rpm for 16 hours at 20° in an L8-70 centrifuge. After centrifugation, the tubes were mounted on a retort stand and illuminated with an ultraviolet lamp. Two bands of DNA were generally visible, although the upper band was often very faint, especially when the alkaline lysis procedure had been used. The lower band, containing -107-supercoiled plasmid DNA, was withdrawn by means of an 18-guage hypodermic needle inserted through the side of the tube just below the position of the band. The needle was removed from the syringe before expelling the DNA into a 15 ml Corex glass tube. Ethidium bromide was removed from the DNA solution by adding an equal volume of n-butanol, mixing, allowing a minute or two for the phases to separate and removing the upper (butanol) phase with a Pasteur pipet. The extraction was repeated 5 or 6 times, or until all traces of ethidium bromide (pink) had disappeared. The solution was diluted with two or three volumes of water, and ethanol (2.5 times the total aqueous volume) was added to precipitate the DNA. The mixture was chilled at -20° for 4-24 hours and the precipitate was collected by centrifugation in a Sorvall SS-34 rotor at 9,000 rpm for 20 minutes at 4°. The supernatant was discarded, and the precipitate was rinsed by adding about 5 ml of cold 70% ethanol and repeating the centrifugation. The precipitate was dried briefly, dissolved in 0.4 ml of water and transferred to a 1.5 ml Eppendorf tube. Sodium acetate (40yul of a 3 M stock) and ethanol (1.0 ml) were added, and the tube was chilled at -70° for 30 minutes. The precipitate was collected by centrifugation for 5 minutes at 4° in an Eppendorf centrifuge, rinsed with 1 ml cold 70% ethanol, centrifuged for 2 minutes at 4°, dried, and dissolved in 0.5 - 1.0 ml TE10:1. An aliquot of this solution was diluted and its ultraviolet absorption spectrum measured. The A260/A280 ratio, which was 1.8 - 2.0, showed the DNA to be free from protein. Its concentration was estimated from its A26O' assuming a concentration of 50 /ag/ml to have an A260 °f 1-0 (Davis et al., 1980). -108-Plasmid "Minipreps": Triton Procedure The following procedure was originally described by Ferguson et al.(1981). Single colonies of ampici11in-resistant E. coli transformants were picked into 5 ml aliquots of LB-glucose containing ampici11in and incubated overnight at 37°. Cells were pelleted by centrifugation at 4° in a Sorvall SS-34 rotor at 5,000 rpm for 5 minutes. Each pellet was resuspended in 1.2 ml of cold TE10:1, transferred to a 1.5 ml Eppendorf tube, and pelleted again by brief (1 minute) centrifugation in an Eppendorf centrifuge. All subsequent centrifugations in this procedure were carried out with the Eppendorf centrifuge. The pellet was resuspended in 0.45 ml of cold sucrose:TE (50 mM sucrose; 35 mM Tris-HCl pH8; 100 mM EDTA), and 65/al of a freshly-prepared solution of lysozyme (10 mg/ml in sucrose:TE) was added. The suspension was kept on ice for 10 minutes before adding 0.5 ml of cold Triton mix. After a further 10 minutes on ice, the lysate was heated at 80° for 5 minutes and chilled to 0°. It was kept on ice for 15 minutes and then centrifuged for 15 minutes at room temperature. The clear supernatant was decanted into a new microfuge tube and 2.5 jal of diethyl pyrocarbonate (DEP) was added. The mixture was heated for 15 minutes in a 65° water bath and then centrifuged for 3 minutes at room temperature. The supernatant was transferred to a clean tube and 1 ml of ethanol was added. After 1 hour at -20°, the precipitate was pelleted by centrifugation for 5 minutes at room temperature. The pellet was dried, dissolved in 0.4 ml of water, and 40 jal of 3 M NaOAc and 1 ml of ethanol were added. The mixture was again chilled for 1 hour at -20° and centrifuged for 5 minutes at 4°. The pellet was -109-rinsed by adding 1 ml of 70% ethanol and centrifuging for 2 minutes and removing the supernatant, dried briefly under vacuum, and dissolved in 50 ul TE10:1. Alkaline Lysis Procedure This procedure, described by Maniatis et al. (1982), is a modification of the method of Birnboim and Doly (1979). Aliquots of 2 ml of LB:glucose:ampicillin were each inoculated with a single colony of an ampici11in-resistant transformant and incubated overnight at 37°. A 1.5 ml portion of each culture was poured into a 1.5 ml centrifuge tube, and the cells were harvested by centrifugation for 1 minute in an Eppendorf centrifuge. The pelleted cells were resuspended in 0.1 ml of a freshly prepared solution of lysozyme (4 mg/ml) in glucoserTE (50 mM glucose;25 mM Tris-HCl, pH 8; 10 mM EDTA). The suspension was kept at room temperature for 5 minutes, and 0.2 ml of a freshly-prepared ice-cold solution of 0.2 M NaOH and 1% SDS was added. The suspension was mixed by inverting the tube sharply once or twice and then kept on ice. After 5 minutes, 0.15 ml of a solution containing 3 M KOAc and 2 M HOAc (pH 4.5) was added, and the suspension was mixed by vortexing briefly. After another 5 minutes storage on ice, the tube was spun for 5 minutes at 4°. The supernatant was decanted into another 1.5 ml tube and extracted with an equal volume of phenol/chloroform (1:1). The phases were separated by centrifugation for 1 minute, and the aqueous phase was transferred to a clean 1.5 ml tube. Ethanol was added to f i l l the tube, and after 5 minutes at room temperature, the tube was centrifuged for 5 minutes at room temperature. The pellet containing plasmid DNA and RNA was rinsed with 70% ethanol, as previously described, then dried briefly under vacuum and dissolved in 50 ul of TE10:1. -110-P r e p a r a t i o n o f P l asm id DNA f o r Sequencing P lasm id DNA was i s o l a t e d f rom 1 ml c u l t u r e s u s i n g the a l k a l i n e l y s i s procedure as p r e v i o u s l y d e s c r i b e d . I t was prepared f o r DNA sequencing u s i n g a procedure deve loped by C a r o l i n e Beard i n t h i s l a b o r a t o r y . P lasmids prepared by the a l k a l i n e l y s i s procedure were r e d i s s o l v e d i n 200 pi o f T E 1 0 : 1 , and 100 JJ! of 7.5M NH4OAC was added t o e a c h . The m ix tu re was kept on i c e f o r 1-16 hou rs , a f t e r which the p r e c i p i t a t e o f h i g h mo lecu la r weight RNA was removed by c e n t r i f u g a t i o n f o r 15 minutes a t 4° i n an Eppendorf c e n t r i f u g e . The supernatant was t r a n s f e r r e d t o a c l e a n tube and 0.6 ml o f e thano l was added t o p r e c i p i t a t e the remain ing n u c l e i c a c i d . The p r e c i p i t a t e was c o l l e c t e d by c e n t r i f u g a t i o n f o r 5 minutes a t 4 ° (Eppendor f ) , r i n s e d w i t h 70% e t h a n o l , d r i e d and d i s s o l v e d i n 50 p\ TE10:1 c o n t a i n i n g RNaseA (40 /ag/ml) and RNase T^ (40 u / m l ) . A f t e r i n c u b a t i o n a t 37° f o r 2 hou rs , t he s o l u t i o n was e x t r a c t e d once w i t h an equa l volume of T E - s a t u r a t e d p h e n o l , once w i t h p h e n o l / c h l o r o f o r m ( 1 : 1 ) , and tw ice w i t h e t h e r . R e s i d u a l e t h e r was evapo ra ted , and the DNA was p r e c i p i t a t e d by add ing 5 p\ 3 M NaOAc, 1 2 5 ^ 1 e t h a n o l , and c h i l l i n g t o - 7 0 ° f o r 30 m inu tes . The p r e c i p i t a t e was c o l l e c t e d by c e n t r i f u g a t i o n f o r 5 minutes a t 4 ° , r i n s e d i n 70% e t h a n o l , d r i e d , and d i s s o l v e d i n 50pi TE10 :1 . A 5 - 8 j u l a l i q u o t o f t h i s s o l u t i o n was u s u a l l y used f o r DNA sequenc ing . P r e p a r a t i o n of Ml3 DNA S i n g l e St randed Phage DNA The procedure of Sanger e t a l . (1980) was f o l l o w e d f o r the i s o l a t i o n o f s i n g l e - s t r a n d e d phage DNA from sma l l p h a g e - i n f e c t e d c u l t u r e s . An ove rn igh t c u l t u r e o f E . c o l i JM101 was grown i n M9S b ro th - 1 1 1 -from a single colony. An aliquot of this culture was used to inoculate 50-100 volumes of 2YT broth, and the new culture was incubated for about an hour at 37°. Aliquots of 1 ml were transferred to 13x100 mm culture tubes. Using a sterile capillary, a single plaque was picked from a fresh (1-2 days old) plate and transferred to a 1 ml aliquot of the 2YT culture. The infected cultures were incubated at 37° for 4-5 hours with vigourous shaking. Each culture was then poured into a 1.5 ml Eppendorf tube and the cells were pelleted by centrifugation for 1 minute in an Eppendorf centrifuge. The supernatant containing phage particles (up to lO /^ml) was transferred to a clean tube and the pellet was discarded. To the supernatant, 0.2 ml of PEG/NaCl (20% PEG 6,000/2.5M NaCl) was added, and after mixing, the tube was left at room temperature for 15 minutes. The phage precipitated during this interval and were collected by centrifugation for 10 minutes at room temperature in an Eppendorf centrifuge. The supernatant was discarded, and the tube was given a brief (10 second) spin in the centrifuge to cause any supernatant which had been adhering to the walls of the tube to accumulate in the bottom of the tube. This residual liquid was removed with a drawn-out capillary and discarded. The phage pellet was resuspended in 100 pi TE10:1. This phage suspension could be used directly for certain applications, such as screening for hybridization with a [32p]-labelled oligonucleotide. If pure phage DNA was required, as for DNA sequencing, the phage suspension was extracted with an equal volume of TE-saturated phenol. The aqueous phase was transferred to a clean tube and residual phenol was removed by repeated ether extraction. Sodium acetate was added to 0.3M and the DNA was precipitated at -70° for 30 minutes after adding 2.5 volumes of -112-ethanol. The precipitate was collected by centrifugation, rinsed with 70% ethanol, dried and dissolved in 50 ul TE10:1. An aliquot of 5 p i was sufficient for DNA sequencing. Clone Orientation The procedure of Winter and Fields (1980) was used in some instances to identify Ml3 clones which carried the same inserts in opposite orientations. One clone was chosen as a reference, against which others were tested. Phage DNA of the clone to be tested {2pl) and that of the reference clone (2jal) were mixed in a total volume of 10 p i , containing 40 mM Tris-HCl pH 7.5, 4 mM MgCl2, 0.2 M NaCl, 85% glycerol, 0.1% SDS, and 0.02% bromophenol blue. The mixture was heated at 68° for one hour and quickly chilled in an ice-water bath before loading on a 0.5% agarose gel. After electrophoresis, the gel was stained with ethidium bromide. If the test and reference clones carried the same inserted sequences in opposite orientations, they formed a hybrid of markedly lower mobility than either clone alone. If they did not hybridize, the mobility of each clone in the mixture was unaffected by the presence of the other. Preparation of Ml3 RF The replicative forms of Ml 3 and its derivatives were isolated from the cells of 50 or 500 ml infected cultures which were prepared as follows: a single colony of E. coli JM101 was introduced into 5 ml of M9S medium and incubated overnight. A 50 pi aliquot of this culture was used to inoculate 2 - 3 ml of 2YT. One hour later, a phage plaque was picked into this culture. The remainder of the overnight culture was used to inoculate 500 ml of M9S. Both cultures were incubated at 37° for 5 hours. At this time, the large culture had an Aggo o f -113-0.3 (about 3 x 10 cells/ml). The cells in the small, infected culture were pelleted by centrifugation, and 2 ml of the supernatant (about 10l2 phage/ml) was added to the large culture. The large infected culture was incubated for 3 hours and the cells were pelleted by centrifugation at 5,000 rpm for 10 minutes in a Sorvall GSA rotor at 5°. The supernatant was discarded, and the cell pellets were resuspended and combined in a total of about 100 ml of ice-cold TE10:1. The cells were again pelleted by centrifugation and the pellet was frozen at -20°. Phage replicative form DNA was isolated from the cell pellet using either the Triton lysis or alkaline lysis procedure of plasmid purification and further purified by centrifugation in CsCl with ethidium bromide as described earlier. Preparation of Single-Stranded pA4 Plasmid DNA Miniprep pA4 DNA was introduced into E. coli JM101, selecting for ampicillin-resistant transformants. The procedure used to isolate single-stranded plasmid DNA was described by Dente et al^ . (1983). Aliquots of LB:glucose:Ap (2 ml) were inoculated with pA4 transformants of JM101 and incubated until slightly cloudy (AgQO °f u - l ~ 0.2, corresponding to a cell density of 1 - 2 x 10 /^ml). Each culture was then infected with about 10^  pfu of helper phage IRl. (A stock of this helper phage had been prepared by PEG/NaCl precipitation of the supernatant of an infected 40 ml culture of JM101, in the manner normally used for preparation of Ml3 phage. The precipitate was resuspended in 20 ml of TE and stored frozen in 1 ml aliquots. It had a titre of 5 x lO-Ll pfu/ml on JM101.) The pA4 transformant cultures were incubated for 6 hours after infection with IRl, after which "phage" were precipitated from the culture supernatants with PEG and -114-NaCl as for Ml3. The phage pellets were resuspended, phenol-extracted and the DNA precipitated twice, first from 0.9 M NaCl04 and 30% isopropanol, and then from 0.3 M NaOAc and 70% ethanol. The final precipitate, containing a mixture of IRl phage DNA and single-stranded pA4 DNA, was dissolved in 30 ul TE for sequencing. For reasons that remain unclear, about 40% of the cultures treated in this manner yielded no single-stranded DNA at all, or less often, yielded only the DNA of the superinfecting phage. Loss of the F' episcme from pA4 transformants of JM101 would prevent superinfection with phage IRl and thus prevent production of single-stranded DNA. However, plating the transformants on proline-deficient medium before inoculation of the 2 ml cultures for superinfection, which should have selected for the maintenance of the F' episome, did not improve the success rate for isolating single-stranded DNA. The absence of pA4 DNA from some of the preparations of single-stranded DNA implies selective production or packaging of IRl DNA, not absence of pA4 from the cell, since all media contained ampicillin to select for the presence of pA4). Samples of all preparations were subjected to electrophoresis on agarose minigels to ensure that the preparations used for sequencing did in fact contain pA4 DNA. Preparations containing pA4 single-stranded DNA were sequenced exactly as Ml3 clones, using M13FP1 as sequencing primer. The IRl DNA present in each preparation did not interfere in the least with sequencing the pA4s. Silanization of Containers for use with Nucleic Acid Solutions Glass tubes, bottles and capillaries, and polypropylene microfuge tubes to be used for storing or transferring nucleic acid solutions were silanized by placing in a vacuum desiccator over a tray containing -115-a few milliliters of a 10% solution of dimethyldichlorosilane in toluene. The desiccator was partially evacuated on a water aspirator and left overnight. The tubes were then baked at 90° for a few hours, rinsed with distilled water, autoclaved and dried. Silanizing made the recovery of small volumes and small quantities of nucleic acid more efficient by preventing aqueous solutions from sticking to glass or plastic surfaces. AGAROSE GEL ElZCTROPHORESIS of DNA Agarose gel electrophoresis was routinely used to display the products of restriction digests. Gels containing 0.5 - 2.0% agarose were prepared by weighing an appropriate quantity of agarose into TBE electrophoresis running buffer (50 mM Tris base; 50 mM boric acid; 1 mM EDTA; pH 8.3), heating to dissolve the agarose, cooling to approximately 50-55°, and pouring onto a clean, dry glass plate. "Minigels", about 2 mm thick, were poured on 5 x 7 cm lantern slides, while 10 x 17 cm plates were used for 100 ml gels. Plastic combs served as moulds for the sample wells, which measured 0.5x3xl.5mm deep for minigels, or 1.5 x 5 x 4 M I deep for 100 ml gels. Gels were allowed to set at room temperature. Electrophoresis was carried out horizontally with the gel submerged in TBE buffer to a depth of about 2 mm, at a voltage gradient of 2-5 V/cm. Gels were stained in ethidium bromide (1 yug/ml in H2O) for 15-20 minutes at room temperature and photographed over a UV transilluminator using Polaroid film in a Polaroid MP-4 camera. Electrophoresis and DNA Fragment Purification Using LMP Agarose Specific DNA fragments were easily purified after electrophoresis of restriction digests in low melting point (LMP) agarose as described - 1 1 6 -by Maniatis et al. , 1982. Gels containing 0.7-1.0% LMP agarose in TBE buffer were prepared in the same way as normal agarose gels. They were poured onto 10 x 17 cm glass plates at 4°, because the LMP agarose did not set well at room temperature. Sample wells of 1.5 x 5 x 4 mm deep to 1.5 x 15 x 4 mm deep were made, according to the quantity of DNA that was to be loaded. Gels were run submerged in TBE at either 4° or room temperature at approximately 2-3 V/cm. They were stained with ethidium bromide in the same way as ordinary agarose gels and DNA bands were observed under UV illumination either from a hand-held lamp or a transilluminator. The desired bands were immediately excised with a scalpel in an effort to minimize their exposure to UV. The excised gel fragments were placed in 1.5 ml Eppendorf tubes and melted by incubating in a water bath at 70° for 10 minutes. Sufficient TE was added to each tube to bring the total volume of liquid to 0.7 ml. If the melted gel slice had a volume greater than 0.35 ml, it was divided between 2 tubes and each portion was diluted to 0.7 ml. An equal volume (0.7 ml) of TE-saturated phenol was added to each tube. After vortexing for about 1 minute, the phases were separated by centrifugation for 1 minute in an Eppendorf centrifuge. The aqueous phase was transferred to a new 1.5 ml tube. Care was taken to avoid the white interfacial material, and if some was transferred with the aqueous layer, a second extraction with phenol was carried out. The aqueous solution was extracted with an equal volume of phenol:chloroform and then with chloroform, each time by adding the organic solvent, mixing, centrifuging to separate the phases, and transferring the aqueous layer to a clean tube. After chloroform extraction the aqueous solution was extracted several (2-5) times with -117-n-bu tano l t o reduce i t s volume t o about 0.2 m l . A s i n g l e e x t r a c t i o n w i t h e t h e r se rved t o remove r e s i d u a l b u t a n o l , and r e s i d u a l e t h e r was evaporated i n a i r a t room temperature . Sodium a c e t a t e was added t o a c o n c e n t r a t i o n o f 0.3 M, and 2.5 volumes of e thano l were added t o p r e c i p i t a t e the DNA. The tube was c h i l l e d a t - 2 0 ° o v e r n i g h t , and the p r e c i p i t a t e was c o l l e c t e d by c e n t r i f u g a t i o n f o r 5 minutes i n an Eppendorf c e n t r i f u g e . The p e l l e t was r i n s e d by adding 1 ml o f c o l d ( -20°) 70% e t h a n o l , c e n t r i f u g i n g f o r 2 minutes and removing the superna tan t . The p e l l e t was d r i e d b r i e f l y and d i s s o l v e d i n 10-100 u l of T E 1 0 : 1 . The c o n c e n t r a t i o n of t he p u r i f i e d fragment was es t ima ted by e l e c t r o p h o r e s i n g an a l i q u o t th rough an agarose g e l , s t a i n i n g w i t h e th id ium bromide and comparing the f l u o r e s c e n c e w i t h t h a t of markers o f known c o n c e n t r a t i o n . ACRYLAMIDE GEL ELECTROPHORESIS A s tock c o n t a i n i n g 43.5% ac ry lam ide and 1.5% b i s - a c r y l a m i d e i n d e i o n i z e d water was prepared and s t o r e d a t 4° i n the d a r k . Non-denatur ing g e l s were prepared by m i x i ng a p p r o p r i a t e volumes of t h i s s tock and a t e n - f o l d concen t ra te o f TBE e l e c t r o p h o r e s i s b u f f e r w i t h wa te r , then add ing ammonium p e r s u l f a t e t o 0.05% from a 1.6% s tock and N , N , N ' , N ' - t e t r a m e t h y l e t h y l e n e d i a m i n e (TEMED) t o a c o n c e n t r a t i o n of 0.05%. The p r e p a r a t i o n of dena tu r i ng g e l s d i f f e r e d on l y i n t h a t u rea was d i s s o l v e d i n t he m ix tu re a t a c o n c e n t r a t i o n of 7M be fo re t h e a d d i t i o n o f c a t a l y s t s . Ge l p l a t e s were washed w i t h soap and wa te r , r i n s e d and d r i e d . T h e i r i n n e r s u r f a c e s were r i n s e d w i t h 1% d i m e t h y l d i c h l o r o s i l a n e i n t o l u e n e , then w i t h e t h a n o l , then d r i e d . P l a s t i c spacers (0.2 - 1.0 mm t h i c k ) were p l a c e d a l ong the l ong edges of the f r o n t ( r ec tangu la r ) - 1 1 8 -p l a t e . The back (notched) p l a t e was p l a c e d on top o f the spacers and the bottom and s i d e s o f the assembly were s e a l e d w i t h 3M Type 56 e l e c t r i c a l t a p e . The p l a t e s were h e l d on an i n c l i n e of about 30° w h i l e the g e l s o l u t i o n was s l o w l y poured down one s i d e o f the space between the p l a t e s . A p l a s t i c comb was clamped i n t o the opening a t the top of the g e l p l a t e s . The t e e t h of the comb, wh ich formed the sample w e l l s of the g e l , measured 6-15 mm w ide . P o l y m e r i z a t i o n was a l l owed t o con t inue f o r a t l e a s t 20 minutes w i t h the g e l s l i g h t l y i n c l i n e d from the h o r i z o n t a l be fo re the comb was removed and the sample w e l l s were tho rough ly f l u s h e d out w i t h wate r . The tape a l ong the bottom edge o f the g e l p l a t e s was then removed and the g e l was clamped i n t o a v e r t i c a l e l e c t r o p h o r e s i s appara tus . Aluminum p l a t e s (20X30 cm X 3 mm t h i c k ) were clamped on to g e l s wh ich were t o be run a t h i g h v o l t a g e , such as those used f o r DNA sequenc ing . Upper and lower r e s e r v o i r s were f i l l e d w i t h TBE e l e c t r o p h o r e s i s b u f f e r , and the sample w e l l s were f l u s h e d immediate ly be fo re l o a d i n g . Non-denatur ing g e l s were run a t 2-10 V / cm, w h i l e dena tu r i ng g e l s were run a t 30-40 V / cm. A f t e r e l e c t r o p h o r e s i s , the g e l was p l a c e d on a benchtop, t he tape was removed from t h e edges o f the g e l p l a t e s , and the p l a t e s were separa ted by i n s e r t i n g a k n i f e between them. The g e l u s u a l l y remained on the bottom p l a t e . I t c o u l d then be s t a i n e d i n e th id ium bromide (1 yug/ml i n H^O) f o r about 30 minutes p r i o r t o photography under UV i l l u m i n a t i o n . I f the DNA had been r a d i o a c t i v e l y - l a b e l l e d , t he g e l was au to rad iographed d i r e c t l y , o r t r a n s f e r r e d t o Whatman 3MM paper and d r i e d , then au to rad iographed . A BioRad g e l d r y e r was used i n the l a t t e r c a s e . -119-Autoradiography Autoradiography of dried gels was carried out at room temperature using Kodak XRP-1 film. Gels which had been neither fixed nor dried were frozen at -20° during autoradiography. Occasionally it was convenient to use an intensifying screen to shorten exposure time. In such cases, autoradiography was allowed to proceed at -70°. RESTRICTION ENDONUCLEASE DIGESTION Restriction endonuclease digestion was performed using the buffers recommended by Davis et al. (1980). The composition of each buffer and the enzymes for which it was suitable are indicated in Table III. Each buffer was made from sterile stock solutions as a 10-fold concentrate which was stored at -20°. Analytical digests were performed on samples of 0.2-1 pq DNA, while quantities of 5-100 /ag were digested when it was necessary to purify particular restriction fragments or use the products of the digest in subsequent reactions. The volume of the reaction mixture was chosen to give a DNA concentration of 0.02-0.2 jug/ml and the reaction was carried out in Eppendorf centrifuge tubes. The DNA sample to be digested was generally in TE10:1 to begin with. The appropriate 10X buffer concentrate was added (one-tenth of the final volume of the mixture), along with an equal volume of a sterile solution of nuclease-free bovine serum albumin (BSA; lmg/ml) and sufficient water to bring the mixture to the correct volume. Miniprep DNA contained large quantities of RNA and analysis of the DNA was facilitated if RNaseA was added to the mixture to a final concentration of 50 /ig/ml (from a 10 mg/ml stock in 50 mM NaOAc which had been boiled for 10 minutes and stored in aliquots at -20°). About 0.5-2 u of the appropriate restriction -120-TABLE III BUFFERS FOR RESTRICTION ENTONUCLEASE DIGESTION Buffer Composition (Final Concentrations, mM) Enzymes Tris-HCl, MgCl2 NaCl DTT KCl pH 7.5 Kpn 10 10 _ 1 _ Kpnl, SstI, SacI Hin 10 10 50 1 _ Hindlll, BamHI, PstI, Aval, Hinfl Eco ( 50 10 100 _ _ XhoIa, Salla, EcoRI Sma 10 10 _ 1 20 Smal a These enzymes also worked in Hin buffer. -121-endonuclease were then added per pq of DNA using a drawn-out capillary micropipet. The reaction mixture was incubated at 37°. An incubation time of 1 - 4 hours was generally sufficient to ensure complete digestion; preparative digests were sampled periodically and the samples electrophoresed through agarose minigels and stained with ethidium bromide to check the extent of digestion. One-fifth volume of glycerol dye mix (50% glycerol; 0.1 M EDTA; 0.15% bromophenol blue; 0.15% xylene cyanol) was added to those samples or digests which were to be directly analyzed by electrophoresis. If the DNA was to be purified before further treatment or analysis, EDTA was added to the digest to a concentration of 12 mM. Proteins were removed by one or two extractions of the digest with an equal volume of TE-saturated phenol. The phases were separated by centrifugation for 1 minute in an Eppendorf centrifuge at room temperature, and the aqueous phase was transferred to a new tube. Residual phenol was removed by 2 or 3 extractions with ether, and residual ether was removed by evaporation in air at room temperature. Sodium acetate was added to 0.3 M, and the DNA was precipitated by adding 2-2.5 volumes of ethanol and chilling at -70° for 30 minutes. The precipitate was collected by centrifugation for 5 minutes at 4° in an Eppendorf centrifuge, then rinsed by adding cold (-20°) 70% ethanol, centrifuging for 2 minutes and discarding the supernatant. The pellet was briefly dried under vacuum and dissolved in water or TE10:1 as appropriate for the next step in its treatment. Simultaneous digestion with more than one restriction enzyme was performed whenever necessary as long as all the enzymes had the same salt requirements, or if one enzyme was sufficiently "relaxed" with -122-r e s p e c t t o i t s s a l t requi rement t o f u n c t i o n i n the b u f f e r r e q u i r e d by ano ther . D i g e s t i o n s i n v o l v i n g enzymes w i t h i ncompa t i b l e s a l t requ i rements were c a r r i e d out s e q u e n t i a l l y , the enzyme w i t h the lower s a l t requ i rement be ing used f i r s t i n t he a p p r o p r i a t e b u f f e r . When the f i r s t r e c t i o n was complete ( a f t e r 1 - 2 hou rs , o r as judged by m i n i g e l e l e c t r o p h o r e s i s of a l i q u o t s ) the s a l t c o n c e n t r a t i o n of the m ix tu re was a p p r o p r i a t e l y a d j u s t e d , and the second enzyme was added. PHOSPHATASE TREATMENT of DNA R e s t r i c t i o n endonuc lease-d iges ted v e c t o r s were o c c a s i o n a l l y t r e a t e d w i t h b a c t e r i a l a l k a l i n e phosphatase i n o rde r t o p revent t h e i r subsequent r e c i r c u l a r i z a t i o n d u r i n g l i g a t i o n r e a c t i o n s . DNA t o be t r e a t e d w i t h phosphatase was e t h a n o l - p r e c i p i t a t e d , washed i n 70% e thano l as d e s c r i b e d , and r e d i s s o l v e d i n 10 mM T r i s . H C l pH 8 a t a c o n c e n t r a t i o n o f 0 .01-0 .02 pq/pl. F i f t y u n i t s o f b a c t e r i a l a l k a l i n e phosphatase were added per microgram o f DNA, and the m ix tu re was incuba ted a t 65° f o r one hour . The m ix tu re was e x t r a c t e d t h ree t imes w i t h an equal volume o f phenol t o ensure complete removal of the enzyme. E t h e r e x t r a c t i o n removed r e s i d u a l p h e n o l , and the DNA c o u l d then be used d i r e c t l y i n a l i g a t i o n r e a c t i o n . I t was u s u a l l y e t h a n o l - p r e c i p i t a t e d and r e d i s s o l v e d i n TE10:1 a t about 0.1 pg/pl be fo re b e i n g u s e d . LIGATIONS L i g a t i o n r e a c t i o n s were u s u a l l y done i n a volume o f 10-20 pi w i t h 0 .05 -1 .0 pg of an a p p r o p r i a t e l y - t r e a t e d v e c t o r and a t h r e e t o f i v e - f o l d molar excess o f i n s e r t f ragment . Fragments w i t h cohes i ve s i n g l e - s t r a n d e d ends were l i g a t e d i n L b u f f e r , c o n t a i n i n g 66 mM T r i s - H C l pH 7 . 5 , 10 mM MgCl2/ 10 mM DTT and 1.0 mM ATP. About 0.1 u -123-of T4 DNA ligase was added, and the mixture was incubated at room temperature for 4-16 hours. Fragments with at least one blunt end were ligated in LK buffer, containing 66 mM Tris-HCl pH 7.5, 10 mM MgCl2/ 15 mM DTT, 1 mM spermidine, 0.2 mg/ml BSA. Incubation proceeded at room temperature for 12-18 hours. Ligation mixes were used without further treatment to transform E. coli as described earlier. Linker Ligations Synthetic oligonucleotide linkers were phosphorylated at 37° in 5 jul of LK buffer (66 mM Tris-HCl pH 7.5; 1 mM spermidine; 10 mM MgG.2; 15 mM DTT; 0.2 mg/ml BSA). T4 polynucleotide kinase (1-2 u) and y[32p]MT> were added to start the reaction, and after 10 minutes, unlabelled ATP was added to a final concentration of 1.0 mM. Incubation continued for 30 minutes. DNA to which linkers were to be attached was rendered blunt-ended by incubation for 30 minutes at room temperature in 10-20 u of LK buffer containing 50 jM dNTPs and 1 u of DNA polymerase I (Klenow). The linker phosphorylation mixture was added directly to this reaction mixture. T4 DNA ligase (2.5 u) and ATP (1.0 mM) were added, and incubation was continued at room temperature for 12-18 hours. Assaying Linker Ligation and Removal To assess the efficiency of linker ligation and of the subsequent removal of excess linkers, samples were removed before and after the ligation reaction, and after restriction digestion of the ligated products. These samples were analyzed by electrophoresis through a 20 x 40 cm x 0.2 mm thick gel containing 7% acrylamide, 0.23% bis, at 10 V/cm for 2 hours. Autoradiography revealed a single band corresponding to monomeric linkers, and a ladder of bands corresponding to polymeric -124-ligation products. The ladder was generally sti l l present after digestion with the cognate restriction enzyme, but much less extensive linker polymerization was evident. PLASMID CONSTRUCTIONS  Construction of CYC1AH5" Deletions The construction of the pYeCYCl£H5' plasmids is diagrammed in Figure 1. Ten micrograms of plasmid pYeCYCl(2.5) was linearized by digestion with Hindlll. The DNA was purified from the reaction mix and incubated at 37° with 5 u of exonuclease III in 100 ul of exo buffer, containing 10 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM DTT. Samples of 10 pi were removed at intervals of 30 seconds after starting the reaction and added directly to a tube containing 100 pi of 2 x SI buffer (0.1 M NaOAc pH 4.6, 0.3 M NaCl, 1 mM ZnS04). (Exonuclease III is inactivated by Zn2+ in the SI buffer.) SI nuclease (12 u) was added and the mixture was kept at room temperature for 30 minutes. The DNA was purified by phenol extraction and ethanol precipitation and treated for 30 minutes at room temperature with DNA pol I (Klenow fragment) in 20 pi of LK buffer containing 50 uM dNTPs. The blunt-ended DNA was ligated to 30 pmol of phosphorylated, 8 bp PstI linkers in the manner described in the previous section. The DNA was purified by phenol extraction and ethanol precipitation and digested with BamHI (16 u) and PstI (150 u) in 100 pi. (A large quantity of PstI was used in an effort to ensure complete digestion of the large excess of PstI linkers present in the mixture.) The DNA was again purified by phenol extraction and ethanol precipitation and electrophoresed through 0.7% LMP agarose. BamHI-PstI fragments of 2.2-2.4 kb were purified and ligated into pUCl3 which had been digested -125-0 H CONSTRUCTION OF AH5' DELETIONS B-B J -Hind III H =1 Exo III , SI Nuclease H PB -t=*= 1 = * Pst Linkers, T4 Ligase BamHI, Pst I BamHI, Pstl T4 Ligase PUC CYCIAH5' CLONES Figure 1. Construction of AH5' Deletions The CYCl coding sequence is indicated by stippling. Open boxes represent flanking yeast DNA. pBR322 is represented by a single line. Recognition sites for restriction endonucleases are indicated as follows: B, BamHI; H, Hindlll; P, Pstl. -126-with BamHI and Pstl. Transformants of E. coli JM101 were identified by plating on LB-glucose-Ap-XGAL medium, and plasmid DNA was prepared from small cultures of ApR lacZ" transformants. Digestion with EcoRI and Pstl allowed the approximate deletion endpoint of the CYC1AH5" derivative in each plasmid to be estimated. The exact deletion endpoints of those derivatives chosen for further study were determined by sequencing of EcoRI-digested plasmid DNA from the M13RP1 primer (Table I). [Some of the CYC1AH5" derivatives were originally isolated in pEMBL8(+) and were transferred as BamHI-Hindlll fragments to Ml3mpl0 for sequencing from M13FP1 because of problems experienced in isolating single-stranded pEMBL DNA for sequencing.] Construction of YEp213CYClAH5" Plasmids Selected pUC13CYClAH5', or pEMBL8CYClAH5' plasmids were digested with BamHI and Hindlll, and the 2.2-2.4 kb CYC1&H5' fragments released from each was purified after electrophoresis in LMP agarose. The Hindlll site of the pUC/pEMBL polylinker is located immediately downstream of the Pstl site which marks the CYC1&H5" endpoint. Digestion with Hindlll rather than Pstl allowed the CYC1AH5" fragment to be ligated into a yeast vector more easily. Each BamHI-Hindlll CYC1AH5" fragment was ligated to YEp213 which had been digested with BamHI and Hindlll and treated with bacterial alkaline phosphatase. The ligation mixtures were used to transform E. coli JM101 to ampicillin resistance, and plasmids prepared from 1.5 ml cultures of individual transformants were screened by digestion with BamHI/Hindlll and with EcoRI/Pstl. Suitable plasmids, denoted YEp213CYCl&H5' plasmids, were then introduced into yeast strain GM-3C-2 using the transformation procedure -127-to be described. Construction of CYCL&K3' and CYC1AK5" Deletions The starting material for constructing deletions from the Kpnl site of the CYCl gene was plasmid pYeCYCl(2.5) which had been digested to completion with Kpnl, purified from the reaction mixture by phenol extraction and ethanol precipitation, and dissolved in TE10:1 at 1 /jg/ul. The procedure used to generate deletion plasmids is illustrated in Figure 2. Ten micrograms of the linearized plasmid was treated with 1 u of nuclease Bal31 at 30° in a 100 pi mixture containing 20 mM Tris-HCl pH8, 12 mM CaO-2, 12 mM MgO-2, 200 mM NaCl, 1 mM EDTA, and 250 jug/ml BSA. Samples of 25 pi , removed at 1 minute intervals beginning 5 minutes after the addition of enzyme, were immediately added to separate tubes containing 2.5 ul of 0.2 M EGTA to inactivate the nuclease. The reason for keeping the samples separate at this stage was to check the extent of nuclease digestion at each time point. A 1 pi aliquot of each sample was diluted to 10 pi with Kpn restriction buffer and digested with Hind III (2 u) at 37° for 2 hours. The products of the digest were labelled by adding a[32P]dATP (10pCi), DNA polymerase I (Klenow fragment ; 1 u) and incubating at room temperature for 15 minutes. The labelled DNA was purified from each digest by phenol extraction and ethanol precipitation and redissolved in 4 pi water and 1 pi glycerol dyes. Aliquots (2 pi) were electrophoresed through a 7% acrylamide thin gel beside a labelled Hinfl digest of pBR322 at 10 V/cm. Digestion of pYeCYCl(2.5) with Kpnl and Hindlll releases a 360 bp fragment. In the Bal31-treated samples, this fragment was replaced by a series of fragments ranging in length from about 350 bp to less than -128-Figure 2. Construction of CYC1AK5' and CYC1&K3' Deletions CYCl coding sequences are indicated by stippling. Restriction sites are indicated as follows: B, BamHI; H, HinduI; K, Kpnl. -129-75 bp . The d i s t r i b u t i o n o f fragment s i z e s was q u i t e heterogenous a t each t ime p o i n t , though the s h i f t towards s m a l l e r fragment s i z e s w i t h i n c r e a s i n g d i g e s t i o n t ime was o b v i o u s . S ince a l l samples con ta ined d e l e t i o n endpo in ts i n the r e g i o n o f i n t e r e s t (50-250 bp f rom the H i n d l l l s i t e ) , the rema in ing p o r t i o n s of a l l 4 samples were p o o l e d . The poo led DNA was p u r i f i e d by phenol e x t r a c t i o n and e thano l p r e c i p i t a t i o n and r e d i s s o l v e d i n 5 jol of wa te r . A f t e r ove rn i gh t i n c u b a t i o n , r e a c t i o n m ix tu re was d i l u t e d t o 50 / z l and EDTA was added t o 12 mM. The m ix tu re was d e p r o t e i n i z e d by p h e n o l - e x t r a c t i o n , and r e s i d u a l phenol was removed by e the r e x t r a c t i o n . A f t e r the r e s i d u a l e t h e r had evapora ted , the r e a c t i o n p roduc ts were loaded onto a 1.5 ml Sephadex G-100 column. The column was e l u t e d w i t h TE10:1 and 0.1 ml f r a c t i o n s were c o l l e c t e d . The f i r s t peak of r a d i o a c t i v i t y e l u t e d i n f r a c t i o n s 4 - 8 , wh ich were poo led and p r e c i p i t a t e d w i t h e t h a n o l . The DNA was then d i g e s t e d w i t h Kpn l (40u). A f t e r d i g e s t i o n EDTA was added t o t he r e a c t i o n m ix tu re t o 12 mM, and the DNA was d e p r o t e i n i z e d by e x t r a c t i o n w i t h p h e n o l , f o l l o w e d by e t h e r . The p lasm id DNA was separa ted from r e l e a s e d l i n k e r s by g e l f i l t r a t i o n on Sephadex G-100 as b e f o r e . F r a c t i o n s o f 0.1 ml were aga in c o l l e c t e d , and f r a c t i o n s 6 - 9 , c o n t a i n i n g the f i r s t peak of r a d i o a c t i v i t y , were p o o l e d . The DNA was e t h a n o l - p r e c i p i t a t e d and d i g e s t e d s e q u e n t i a l l y w i t h Kpn l and BamHI i n 50 jol. The DNA was p u r i f i e d by phenol e x t r a c t i o n and e thano l p r e c i p i t a t i o n , r e d i s s o l v e d , loaded on a 0.7% LMP agarose g e l and e l e c t r o p h o r e s e d a l ongs ide a H i n d l l l d i g e s t o f A DNA a t 5 V/cm f o r 5 hou rs . Two bands were v i s i b l e a f t e r s t a i n i n g w i t h e th id ium bromide: one c o n t a i n i n g f ragments o f about 4 . 0 - 4 . 2 kb c a r r i e d sequences downstream o f the Kpn l s i t e of C Y C l , w h i l e a p o p u l a t i o n of f ragments o f -130-about 1.9 - 2.1 kb carried the 5' end of the gene. The DNA in each band was purified as described and dissolved in 20/al of TE10:1 (approximately 0.02/ag/ial). The 2.2 kb and 4.3 kb BamHI/Kpnl fragments of pYeCYCl(2.5) were also purified from 0.7% IMP agarose for ligation to the resected fragments as described below. One quarter of the recovered 4 kb fragment pool (about 0.2 /ag) was ligated to 0.4/ag of the 2.2 kb BamHI/Kpnl fragment of pYeCYCl(2.5) to produce the pYeCYClAK3' plasmids. Compared to pYeCYCl(2.5), these plasmids carry deletions extending from the Kpnl site toward the 3' end of CYCl. Similarly, one quarter of the recovered 2 kb fragment pool was ligated to 0.7/ag of the 4.3 kb BamHI/Kpnl fragment of pYeCYCl(2.5) to produce the pYeCYClAK5' plasmids which, compared to pYeCYCl(2.5), carry deletions extending from the Kpnl site toward the 5' end of CYCl. Both ligation mixes were used to transform E. coli RRl to ampici11in resistance. Plasmid DNA was prepared from 1 ml cultures of individual transformants. The extent of each AK3' deletion was estimated from the size of the small KpnI/Hindlll fragment released by digestion of the miniprep DNA. Digestion of the pYeCYClAK5' plasmids with Kpnl and Xhol allowed the extent of theAK5' deletions to be similarly estimated. Digests were initially analyzed on agarose gels, and those of interest were also electrophoresed in 7% acrylamide gels to allow more accurate estimation of the size of the small fragments involved. Construction of YEpl3CYC1AK3" Plasmids E. coli transformants carrying pYeCYCl&K3' plasmids with suitable deletion endpoints were replated and a single colony of each was picked separately into 3 ml of LB-glucose-Ap. Plasmid DNA isolated from these -131-c u l t u r e s was d i g e s t e d w i t h BamHI and H i n d l l l , and the 2 . 2 - 2 . 4 kb fragments c a r r y i n g the 3 ' p o r t i o n o f CYCl were p u r i f i e d from 0.7% IMP agarose . These fragments were l i g a t e d i n t o YEp l3 wh ich had been d i g e s t e d w i t h BamHI and H i n d l l l and t r e a t e d w i t h b a c t e r i a l a l k a l i n e phosphatase. The l i g a t i o n m ix tu res were used t o t r ans fo rm E . c o l i RRl t o a m p i c i l l i n r e s i s t a n c e , and m in ip rep p lasm id DNA i s o l a t e d f rom the t rans fo rmants was screened by d i g e s t i o n w i t h BamHI and H i n d l l l . S u i t a b l e t r a n s f o r m a n t s , c a r r y i n g p lasmids w i t h B a m / H i n d l l l f ragments o f 10.4 and approx imate ly 2.4 k b , were r e p l a t e d , and 50 ml c u l t u r e s were grown f rom s i n g l e c o l o n i e s f o r p l asm id DNA i s o l a t i o n . The p lasmids were screened by d i g e s t i o n w i t h s e v e r a l r e s t r i c t i o n enzymes t o c o n f i r m t h e i r s t r u c t u r e . They were then i n t r oduced i n t o yeas t s t r a i n GM-3C-2, s e l e c t i n g f o r LEU2+ t r ans fo rman ts . De te rmina t ion o f A K 3 " D e l e t i o n Endpo in ts P u r i f i e d YEp l3CYClAK3 ' p lasmids were d i g e s t e d w i t h BamHI and Hind I I I , and t h e 2 . 2 - 2 . 4 kb CYC1AK3" fragment from each was l i g a t e d i n t o Ml3mpl0 RF which had been c leaved w i t h BamHI and H i n d l l l . The l i g a t i o n m ix tu res were used t o t r a n s f e c t E . c o l i JM101. C o l o u r l e s s p laques were p i c k e d i n t o 1 ml 2YT c u l t u r e s of JM101 f o r i s o l a t i o n o f phage DNA, as d e s c r i b e d . The DNA was sequenced u s i n g d i d e o x y n u c l e o t i d e c h a i n t e r m i n a t o r s f rom t h e u n i v e r s a l p r i m e r , M13FP1 (see Tab le I ) . The sequence a c r o s s the Kpn l s i t e mark ing the d e l e t i o n endpo in t was r e a d . C o n s t r u c t i o n o f pYeCYClAK5 ' /AK3" P lasmids (P romote r /3 ' End S i g n a l  Fus ions ) As ment ioned e a r l i e r , s e v e r a l pYeCYCl K 5 ' p l a s m i d s , c a r r y i n g d e l e t i o n s ex tend ing towards the CYCl promoter f rom the Kpn l s i t e w i t h i n the gene, were screened by d i g e s t i o n w i t h Xho l and K p n l . Four out o f - 1 3 2 -twe lve o f t hese p lasmids had X h o l / K p n l f ragments o f about 230-250 bp , i n d i c a t i n g t h a t they l acked a l l o r most of the cod ing sequence upstream of the K p n l s i t e . Transformants c a r r y i n g these p lasmids were r e p l a t e d and p l a s m i d DNA was p u r i f i e d f rom 50 ml c u l t u r e s grown f rom s i n g l e c o l o n i e s . Each p lasm id was d i g e s t e d w i t h BamHI and K p n l , and the 1.9-2 kb BamHI/Kpnl fragment c a r r y i n g the 5 ' f l a n k i n g sequences of CYCl was p u r i f i e d f rom 0.75% LMP agarose . Each o f these fragments was l i g a t e d t o the p u r i f i e d 4.2 kb BamHI/Kpnl fragment o f pYeCYClAK3 >449 c a r r y i n g the 3 ' end o f the CYCl gene. E . c o l i RRl was t ransformed t o a m p i c i l l i n r e s i s t a n c e w i t h these l i g a t i o n m i xes . P l a s m i d DNA p repared from 3 ml c u l t u r e s o f i n d i v i d u a l t rans fo rmants was d i g e s t e d w i t h BamHI and H i n d l l l , and t h e 2 kb fragment c a r r y i n g a AK5 ' / A K 3 ' d e l e t e d d e r i v a t i v e o f CYCl was p u r i f i e d f rom IMP agarose . Each fragment was l i g a t e d i n t o B a m H I - H i n d l l l d i g e s t e d Ml3mpl0 RF . The l i g a t i o n m ix tu res were used t o t r a n s f e c t E . c o l i JM101, and 2 c o l o u r l e s s p lagues d e r i v e d from each • l i g a t i o n m ix tu re were p i c k e d i n t o separa te 2 ml 2YT c u l t u r e s o f JM101. Phage DNA was prepared and a r e g i o n i n c l u d i n g the fused & K 5 ' a n d A K 3 ' d e l e t i o n endpo in ts was sequenced f rom M13FP1. In one of the c o n s t r u c t s , mplOCYClAK-26/+449, t h e A K 3 ' d e l e t i o n endpo in t a t p o s i t i o n +449 o f the CYCl sequence was j o i n e d th rough a Kpn l l i n k e r , t o p o s i t i o n -26 of the CYCl promoter r e g i o n . The B a m H I / H i n d l l l f ragment t h a t had been i n s e r t e d i n t o mplOCYClAK-26/+449 was s i m i l a r l y i n t r oduced i n t o B a m H I / H i n d l l l - d i g e s t e d M l 3 m p l l . Phage DNA was prepared f rom s e v e r a l c o l o u r l e s s p l a q u e s , and the presence o f the C Y C I A K i n s e r t was conf i rmed by h y b r i d i z a t i o n t o the DNA of mpl0CYC1AK-26/+449 u s i n g the procedure of Win te r and F i e l d s [(1980),-see " c l o n e o r i e n t a t i o n " ] . One of these phage was taken as mp l lCYClAK-2 6/+4 49 and used as a templa te f o r - 1 3 3 -mutagenesis with oligonucleotides oAS3 and oAS4. Clones were isolated which carried the GT473 and C474 mutations. They were referred to as mpllCYClTl and mpllCYClT2, respectively. Double-stranded RF DNA of mpllCYClT2 was isolated from a 500 ml culture of infected JM101 for use in the experiments described below. Construction of Deletions in mpllCYClT2: The pA4 Plasmids The construction of deletion derivatives of mpllCYClT2 is outlined in Figure 3. The replicative form of mpllCYClT2 was linearized by digesting with Hindlll and purified by phenol extraction and ethanol precipitation. Ten micrograms of the linear DNA was treated with 2 u of exonuclease III in 100 /al of exo buffer. Samples of 15 / i l were removed at intervals of 30 sec after starting the reaction and transferred to SI buffer to inactivate the exonuclease. The pooled samples were treated with 6 u of SI nuclease in 300 /al of SI buffer for 30 minutes at room temperature. The DNA was purified by phenol extraction and ethanol precipitation and made blunt-ended by treatment with DNA polymerase I (Klenow) and dNTPs as described earlier. Oligonucleotide oAS5 and 0 A S 6 (150 pmol each) were mixed, phosphorylated, and ligated to the resected, blunt-ended DNA overnight at room temperature under the conditions described. After deproteinization and ethanol precipitation, the DNA was digested with BamHI (16 u) and EcoRI (100 u). The DNA was purified from the digest and electrophoresed through 0.8% LMP agarose. A region containing fragments of 1.9 - 2.0 kb was excised from the gel and the DNA within this region was purified. The fragment pool was ligated to pEMBL9(+) which had been digested with BamHI and EcoRI and purified after electrophoresis through 0.7% LMP agarose. The ligation mix was used to -134-PROMOTER E K K =1 -24 3'END SIGNAL H J DELETE FROM Kpnl SITE K H + 448 | LIGATE K H -24A448 DELETE FROM Hind III SITE LIGATE TO ATG/EcoRI ADAPTER K Kiwi d J BamHI, EcoRI 1.9- 2.1 kb fragments I LIGATE TO pEMBL9(+) i pA4 PLASMIDS Figure 3. Construction of the pA4 Promoter:3' End Signal Fusions Restriction sites are labelled as follows: E, EcoRI; K, Kpnl; H, HinduI. The sequence of the ATG/EcoRI adapter is noted in the text, and in Table I. -135-transform E. coli RRl to ampici 11 in-resistance. The use of RRl rather than JM101 precluded the possibility of screening for plasmids with inserts on XGAL plates, but at the time, my stock of JM101 gave very low transformation efficiencies. Plasmid DNA was prepared from 1.5 ml cultures of transformants using the alkaline SDS lysis procedure. Digestion with Sail and EcoRI revealed that about 50% of the plasmids, referred to as pA4s, carried the CYCl insert. Deletion endpoints were estimated from the electrophoretic mobility of the smaller fragment in XhoI/EcoRI digests of the plasmids. The exact endpoints of deletions of interest were determined by sequencing single-stranded pA4 DNA, which was isolated as described earlier. As well as defining the deletion endpoint, the sequence confirmed the presence of the C474 mutation in each plasmid which sti l l retained position +474 of the CYCl sequence. Plasmids with deletion endpoints of interest were digested with EcoRI and BamHI, and the digested DNA was electrophoresed through 0.7% IMP agarose. The 1.9-2 kb BamHI/EcoRI fragment of each plasmid was purified for use in constructing promoter /3' end signal/ lacZ fusion plasmids. Construction of placZ Plasmid pMC1403 (Casadaban et al., 1980, see Figure 4), carrying lacZ 'YA, was used to construct a plasmid carrying only LacZ'. The lacA gene and most of lacY can be deleted by eliminating the largest Aval fragment from pMC1403 (Casadaban et al^., 1983). Accordingly, 5 pq of the plasmid was digested with Aval (8 u) in 50 pi, and samples of 10 pi were removed at 15-minute intervals. Aliquots were examined after electrophoresis on agarose. Samples removed after 60 minutes and 75 -136-Figure 4. Restriction Maps of pMC1403 and placZ Restriction sites are denoted as follows: Aval, A; BamHI, B; EcoRI, E; PstI, P; Sail, S; Smal, Sm. The inset is a photograph of ethidium bromide-stained Aval digests of pMCl403 (lane 1) and placZ (lane 2), showing that placZ lacks the largest Aval fragment of PMC1403. -137-minutes contained very little full length linear plasmid, indicating that most molecules had been cut at 2 or more Aval sites. These samples were digested to completion with Sail, which cuts pMCl403 once, within the large Aval fragment. The object of this step was to reduce the "background" of plasmids retaining the large Aval fragment but lacking other fragments. DNA was purified from each digest by phenol extraction and ethanol precipitation, and 0.05 pq was recircularized with T4 DNA ligase in a volume of 20 pi. The ligation mixes were used to transform E. coli RRl to ampicillin-resistance, and plasmids isolated from 1.5 ml cultures of individual transformants were screened by Aval digestion. Eight of 36 transformants screened retained all but the largest of the Aval fragments of pMC1403 and were shown to contain no extra fragments by digestion with Sacl. One was chosen as placZ and was isolated from a 500 ml culture grown from a single colony. Digestion with seven restriction enzymes, alone and in all pairwise combinations, confirmed that placZ differed from pMC1403 only insofar as i t lacked the largest Aval fragment. Construction of YRp72, YRp73 Plasmid pAAR6 (Ammerer, 1983) is a derivative of YRp7 (Struhl et al_. ,1979) lacking both of the EcoRI sites of that plasmid and carrying the promoter and 3' flanking sequences of the ADC1 gene on a BamHI fragment. A sample of pAAR6 was digested to completion with BamHI and purified by phenol extraction and ethanol precipitation, and 0.1pq of the digested DNA was recircularized in a volume of 20 ul. E. coli RRl was transformed to ampicillin resistance with the ligation mix and plasmids isolated from several transformants were screened by restriction with Hindlll, Sail, and EcoRI alone or in combination. A -138-p lasm id l a c k i n g the BamHI fragment o f pAAR6 was i d e n t i f i e d and r e f e r r e d t o as YRp72 (see F i g u r e 5 f o r map). The p lasm id was p u r i f i e d from c e l l s o f a 50 ml c u l t u r e grown from a s i n g l e c o l o n y . P lasm id YRp72 (F igu re 5) has 2 P s t l s i t e s , one i n sequences d e r i v e d from pBR322, and one i n the yeas t a r s l sequence. To f a c i l i t a t e the i s o l a t i o n o f BamHI/Pst I o r S a l l / P s t I f ragments c a r r y i n g bo th TRPl and a r s l , the second o f these P s t l s i t e s was e l i m i n a t e d as f o l l o w s : f i v e micrograms o f the p lasm id was d i g e s t e d w i t h 5 u o f P s t l a t 3 7 ° , and samples were removed a t 10 minute i n t e r v a l s . The 20 - and 30-minute samples were poo led because g e l e l e c t r o p h o r e s i s of an a l i q u o t o f each showed them t o c o n t a i n a s u b s t a n t i a l p r o p o r t i o n of s i n g l y - c u t m o l e c u l e s . The DNA was p u r i f i e d by phenol e x t r a c t i o n and e thano l p r e c i p i t a t i o n and t r e a t e d w i t h DNA polymerase I (Klenow) i n a 20 pi mix tu re c o n t a i n i n g 50 / iM dNTPs i n LK b u f f e r . An a l i q u o t o f t h i s m i x tu re was then t r e a t e d wth T4 DNA l i g a s e , and the l i g a t i o n mix was used t o t r ans fo rm E . c o l i RRl t o a m p i c i 1 1 i n - r e s i s t a n c e . P lasm ids p repared f rom the t rans fo rmants were screened by d i g e s t i o n w i t h BamHI and P s t l . A p l asm id l a c k i n g the P s t l s i t e i n a r s l was chosen and subsequent ly r e f e r r e d t o as YRp73 (For map, see F i g u r e 5 ) . C o n s t r u c t i o n o f YEp73 About 3 pg o f YRp73 was d i g e s t e d t o comp le t ion w i t h BamHI. The l i n e a r i z e d DNA was p u r i f i e d by phenol e x t r a c t i o n and e thano l p r e c i p i t a t i o n , and 1 pg was t r e a t e d w i t h b a c t e r i a l a l k a l i n e phosphatase. The DNA was p u r i f i e d once more, and 0.1 pg was l i g a t e d t o a p u r i f i e d 1.5 kb Sau3AI fragment of YEpl3 which c a r r i e s 2u c i r c l e sequences necessary f o r r e p l i c a t i o n a t h i g h copy number i n yeas t (Broach, 1983) . E . c o l i RR l was t rans fo rmed t o a m p i c i l l i n - r e s i s t a n c e - 1 3 9 -(E) IRQ S B F i g u r e 5 . R e s t r i c t i o n Maps o f YRp73 and YEp73 The s i n g l e l i n e d e n o t e s pBR322 s e q u e n c e s . F r a g m e n t s o f y e a s t DNA a r e l a b e l l e d a p p r o p r i a t e l y . R e s t r i c t i o n s i t e s a r e d e n o t e d a s f o l l o w s : BamHI, B ; E c o R I , E ; P s t l , P . R e s t r i c t i o n s i t e s d e s t r o y e d d u r i n g c o n s t r u c t i o n o f t h e p l a s m i d s a r e e n c l o s e d i n p a r e n t h e s e s . P l a s m i d YRp72 d i f f e r s f r o m YRp73 o n l y i n r e t a i n i n g t h e P s t l s i t e i n a r s l . -140-w i t h the l i g a t i o n mix and p l a s m i d DNA i s o l a t e d f rom 1.5 ml c u l t u r e s o f i n d i v i d u a l t rans fo rman ts was d i g e s t e d w i t h BamHI and P s t l . A p l asm id was i d e n t i f i e d wh ich c a r r i e d t h e 2u c i r c l e i n s e r t and r e t a i n e d a BamHI s i t e on the s i d e o f the i n s e r t d i s t a l t o t he T R P l - a r s l fragment of the v e c t o r . [The Sau3A fragment i n v o l v e d extends from p o s i t i o n 344 t o 1915 of t he B form of 2u c i r c l e , and the sequence a t one end of t he fragment (Ha r t l ey & Done lson , 1980) a l l o w s the fo rmat ion of a BamHI s i t e when t h a t end i s l i g a t e d t o a BamHI fragment t e rm inus . ] T h i s p l asm id was r e f e r r e d t o as YEp73. A s i n g l e co lony d e r i v e d f rom a YEp73 t rans fo rmant o f RRl was used t o i n o c u l a t e a 50 ml c u l t u r e , f rom which the p l asm id was then p u r i f i e d f o r use i n c o n s t r u c t i n g the pA7s and p A l l s (see b e l o w ) . C o n s t r u c t i o n o f pA5s The f i r s t s e t o f p romote r :3 'end s i g n a l : l a c Z f u s i o n p lasmids t o be cons t ruc ted was the pA5 s e r i e s . P lasmids i n t he s e r i e s had the s t r u c t u r e shown i n F i g u r e 6. Each pA5 was c o n s t r u c t e d by l i g a t i n g , i n a s i n g l e r e a c t i o n , the 2 kb BamHI/EcoRI fragment o f a pA4 t o t he 2.4 kb BamHI/Pst I fragment of YRp73 and t h e 5.6 kb E c o R l / P s t I fragment of p l a c Z . A l l f ragments were p u r i f i e d from 0.7% LMP agarose f o r use i n the l i g a t i o n r e a c t i o n . P lasmids were i s o l a t e d f rom sma l l c u l t u r e s o f the a m p i c i l l i n - r e s i s t a n t t rans fo rman ts o f E . c o l i RRl produced by each l i g a t i o n m i x , and pA5 p lasmids were i d e n t i f i e d by d i g e s t i o n w i t h EcoRI and Pstl. Each pA5 p lasm id was then p u r i f i e d from a 50 ml c u l t u r e grown f rom a s i n g l e co lony o f a t r ans fo rman t . The p u r i f i e d DNA was used t o t r ans fo rm yeas t s t r a i n RP123 t o t ryp tophan p r o t o t r o p h y . T h i s s t r a i n was conven ien t t o use because i t c a r r i e d both t r p l and ura3 markers , a l l o w i n g s e l e c t i o n of t rans fo rman ts c a r r y i n g pA5 p lasmids - 1 4 1 -YRp73 \ 2 .4 kb B/P fragment TRPI pA4 2 kb B / E fragment t 5.6 kb E / P fragment placZ Figure 6. Structure and Derivation of pA5 Plasmids Restriction sites are as follows: BamHI, B; EcoRI, E; Hindlll, H; Kpnl, K; PstI, P; Smal, Sm. Labels enclosed in parentheses denote restriction sites which were destroyed during plasmid construction. The CYCl 3 ' end signal fragment is indicated by the black box. -142-(TRP1+) or pLG669Z (URA3+), the l a t t e r s e r v i n g as a p o s i t i v e c o n t r o l f o r ^ - g a l a c t o s i d a s e a s s a y s . C o n s t r u c t i o n o f pA6 P lasmids As shown i n F i g u r e 7 , the pA6 p lasmids d i f f e r f rom the pA5s i n t h a t they c a r r y i n a d d i t i o n t o the a r s l o r i g i n of r e p l i c a t i o n , sequences f rom the centromere of chromosome 3, CEN3. A 2.2 kb B a m H I / B g l l l CEN3 fragment was p u r i f i e d from the p l asm id pYeCEN3(41). One of the pA4 p lasmids ( I t s s p e c i f i c i d e n t i t y doesn ' t mat ter f o r t h i s c o n s t r u c t i o n . ) was d i g e s t e d w i t h BamHI, t r e a t e d w i t h b a c t e r i a l a l k a l i n e phosphatase and, a f t e r d e p r o t e i n i z a t i o n and e thano l p r e c i p i t a t i o n , l i g a t e d t o the CEN3 f ragment . E . c o l i RRl was t rans formed t o a m p i c i l l i n - r e s i s t a n c e w i t h t h e l i g a t i o n p r o d u c t s , and p lasmids i s o l a t e d from the t rans fo rmants were screened f o r the presence and o r i e n t a t i o n o f the CEN3 i n s e r t by d i g e s t i o n w i t h BamHI and EcoRI . When a B a m H I / B g l l l f ragment i s i n s e r t e d i n t o a BamHI s i t e a BamHI s i t e i s r e s t o r e d a t one end of the i n s e r t . A p l asm id i n which the r e s t o r e d BamHI s i t e was a t the end of the i n s e r t d i s t a l t o the CYCl r e g i o n of the p lasm id was chosen as pA6a (see F i g u r e 7 ) . To c o n s t r u c t a g i v e n pA6 p l a s m i d , the 6.5 kb S a l l / P s t I fragment of the co r respond ing pA5 was l i g a t e d i n a s i n g l e r e a c t i o n t o the 2.4 kb BamHI/Pst I fragment of YRp73 and t h e 3.2 kb BamHI /Sa l l fragment of pA6a. A l l f ragments were f i r s t p u r i f i e d f rom LMP Agarose . The l i g a t i o n m ix tu res were used t o t r ans fo rm E . c o l i RRl t o a m p i c i l l i n - r e s i s t a n c e , and p lasmids i s o l a t e d f rom the t rans fo rmants were screened by d i g e s t i o n w i t h BamHI and P s t I . P lasmids hav ing the s t r u c t u r e expected o f the pA6 s e r i e s were i n t r oduced i n t o yeas t s t r a i n RP123, s e l e c t i n g f o r TRP1+ t r ans fo rman ts . - 1 4 3 -F i g u r e 7 . R e s t r i c t i o n Maps o f pA6a, pA6, pA7, and pAlO P lasmids The s i n g l e t h i n l i n e denotes pBR322 sequences. Other sequences, i n d i c a t e d by a t h i c k l i n e o r by boxes , a re l a b e l l e d a p p r o p r i a t e l y . R e s t r i c t i o n s i t e s a re l a b e l l e d as f o l l o w s : B, BamHI; E , EcoRI ; K, K p n l ; P , P s t l ; S , S a i l . S i t e s des t royed d u r i n g p lasmid c o n s t r u c t i o n a re i n d i c a t e d by parentheses f l a n k i n g the app rop r i a t e l a b e l . -144-C o n s t r u c t i o n o f pA7 P lasmids The pA7 p lasmids d i f f e r f rom t h e co r respond ing pA5. p l a s m i d s i n t h a t they c a r r y a 1.6 kb Sau3A fragment o f the yeas t 2y- c i r c l e wh ich con ta i ns an o r i g i n o f r e p l i c a t i o n and c i s - a c t i n g sequences needed f o r maintenance a t h i g h copy number i n yeas t (Broach, 1983; see F i g u r e 7 ) . Each pA7 was c o n s t r u c t e d by l i g a t i n g , i n a s i n g l e r e a c t i o n , the 5.2 kb E c o R I / P s t I fragment of p l a c Z , the 4 .0 kb BamHI/Pst I fragment o f YEp73, and the 2 kb BamHI/EcoRI fragment of pA4. P lasmids were i s o l a t e d from a few a m p i c i l l i n - r e s i s t a n t t rans fo rmants o f E . c o l i R R l , and pA7s were i d e n t i f i e d f rom the p a t t e r n produced by d i g e s t i o n w i t h BamHI and P s t I . M i n i p r e p pA7 p l asm id DNA was used t o t r ans fo rm y e a s t s t r a i n RP123 t o t r yp tophan p r o t o t r o p h y . C o n s t r u c t i o n o f pAlO P lasmids The pAlO p lasmids (F igu re 7) d i f f e r f rom the co r respond ing pA5s i n t h a t they c a r r y a lacZYA fragment of pMC1403 r a t h e r than the l acZ fragment o f p l a c Z . Each was c o n s t r u c t e d by l i g a t i n g the 9 kb E c o R I / P s t I fragment of pMC1403 t o the 4 kb E c o R I / P s t I fragment o f the co r respond ing pA5. The l i g a t i o n mixes were used t o t r ans fo rm E . c o l i RRl t o a m p i c i l l i n - r e s i s t a n c e , and p lasmids i s o l a t e d from the t rans fo rmants were i d e n t i f i e d as pAlOs from the p a t t e r n s produced by d i g e s t i o n w i t h S a l l / E c o R I and E c o R I / P s t I . C o n s t r u c t i o n o f p A l l P lasmids An example o f a p A l l p l a s m i d i s shown i n F i g u r e 8. I t c a r r i e s the CYCl p r o m o t e r : 3 ' end s i g n a l c l i n k e r r e g i o n of a pA5, j o i n e d t o a l a c i ' Z fragment d e r i v e d f rom pLG669Z, as w e l l as the yeas t T R P l - a r s l f ragment , 2n c i r c l e sequences necessary f o r h i g h copy-number maintenance i n y e a s t , and pBR322. - 1 4 5 -< Figure 8 . Structure of the pAll Plasmids Restriction sites are labelled as follows: B, BamHI; E, EcoRI; K, Kpnl; P, Pstl; S, Sail; Sm, Smal. The various functional elements of the plasmid are labelled as such. -146-P lasm id pLG669Z (2 /ag) was d i g e s t e d t o comp le t ion w i t h BamHI, and the r e s u l t i n g s i n g l e - s t r a n d e d ends were f i l l e d i n by i n c u b a t i n g w i t h DNA polymerase I (Klenow) and 100 /oM dNTPs. The p lasm id was p u r i f i e d by phenol e x t r a c t i o n and e thano l p r e c i p i t a t i o n and d i g e s t e d w i t h P s t l . The 5 kb B l u n t / P s t I fragment c a r r y i n g l a c i ' 1 was p u r i f i e d from the d i g e s t a f t e r e l e c t r o p h o r e s i s through LMP agarose . Each pA5 p l asm id was s i m i l a r l y d i g e s t e d w i t h BamHI and t r e a t e d w i t h DNA polymerase I (Klenow) and dNTPs, p u r i f i e d , and then d i g e s t e d w i t h S a i l . The 1.1 kb S a i l / B l u n t fragment c a r r y i n g the CYCl p r o m o t e r : 3 ' end s i g n a l r e g i o n was p u r i f i e d f rom IMP agarose . These 2 fragments were l i g a t e d i n a s i n g l e r e a c t i o n w i t h the 4.2 kb S a l l / P s t I fragment of YEp73, E . c o l i RR l was t rans fo rmed t o a m p i c i l l i n - r e s i s t a n c e w i t h each l i g a t i o n m i x t u r e , and p lasmids i s o l a t e d from s m a l l c u l t u r e s o f the t rans fo rmants were d i g e s t e d w i t h EcoRI t o a l l o w i d e n t i f i c a t i o n o f the p A l l s . S e v e r a l independent r e p r e s e n t a t i v e s of each p A l l were used t o t r ans fo rm yeas t s t r a i n RP123 t o t ryp tophan p ro to t r ophy . C o n s t r u c t i o n o f mplOAl P l a s m i d p A l l - 7 1 was d i g e s t e d w i t h Xmal and the 430 bp fragment c a r r y i n g the CYCl p r o m o t e r : 3 ' end s i g n a l r e g i o n was p u r i f i e d a f t e r e l e c t r o p h o r e s i s through LMP agarose . T h i s fragment (about 0.2 /ag) was l i g a t e d t o mplO RF DNA (about 0.05 /ag) wh ich had been l i n e a r i z e d by d i g e s t i o n w i t h Xmal . The l i g a t i o n mix was used t o t r a n s f e c t E . c o l i JM101. S i n g l e - s t r a n d e d phage DNA was prepared f rom s e v e r a l sma l l JM101 c u l t u r e s , each i n f e c t e d w i t h one o f the c o l o u r l e s s p laques produced by t r a n s f e c t i o n . The phage DNA was screened f o r the presence o f the 430 bp Xmal fragment by copy ing i t f rom M13FP1 w i t h DNA polymerase I (Klenow) and 50 /oM dNTPs, then d i g e s t i n g w i t h S a i l and EcoRI . The 450 - 1 4 7 -F i g u r e 9 . C o n s t r u c t i o n o f mplOAl R e c o g n i t i o n s i t e s f o r r e s t r i c t i o n endonuc leases a re denoted as f o l l o w s : B, BamHI; E , EcoRI ; H, H i n d l l l ; K, K p n l ; S , S a i l ; Xm, Xmal ; X , X h o l . The p r im ing s i t e f o r o l i g o n u c l e o t i d e F P l (Table I ) i s i n d i c a t e d by a s m a l l arrow on the map o f mp lOAl . The 3 ' end s i g n a l fragment i s i n d i c a t e d by c r o s s - h a t c h i n g . - 1 4 8 -bp fragment so r e l e a s e d from c l o n e s c a r r y i n g the Xmal i n s e r t was e a s i l y seen a f t e r agarose g e l e l e c t r o p h o r e s i s o f the d i g e s t , f o l l owed by e th id ium brcmide s t a i n i n g . One c lone c a r r y i n g the i n s e r t was chosen as a r e f e r e n c e f o r check ing the o r i e n t a t i o n o f the i n s e r t i n the o ther c l o n e s , u s i n g the procedure of Win te r and F i e l d s (1980). Two c l ones c a r r y i n g the i n s e r t i n oppos i t e o r i e n t a t i o n s were r e p l a t e d on JM101, and a s i n g l e i s o l a t e d p laque of each was used t o prepare a phage inoculum f o r i n f e c t i o n o f 50 ml c u l t u r e of JM101. Phage DNA prepared from these c u l t u r e s was sequenced from M13FP1. The c lone i n which the mRNA-pa ra l l e l s t r a n d of the CYCl r e g i o n was l i n k e d t o the + s t r a n d of Ml3 mplO was used i n m i s i n c o r p o r a t i o n mutagenesis exper iments . I t i s r e f e r r e d t o as mp lOA l , and i t i s diagrammed i n F i gu re 9 . C o n s t r u c t i o n o f p A l l s C a r r y i n g P o i n t Mu ta t ions i n 3' End S i g n a l S i n g l e - s t r a n d e d DNA (about 1 / i g ) o f an mplOAl d e r i v a t i v e c a r r y i n g a muta t ion i n the CYCl 3' end s i g n a l was annealed w i t h M13FP1 and t r ea ted w i t h DNA polymerase I (Klenow fragment) i n 20 / i l of Kpn bu f f e r c o n t a i n i n g 0.1 mg/ml BSA and 0.2 mM dNTPs. A f t e r 2 hours a t room tempera ture , the m ix tu re was heated t o 70° f o r 10 minutes t o i n a c t i v a t e the po lymerase. Potass ium c h l o r i d e was added t o a c o n c e n t r a t i o n of 20 mM, and the DNA was d i g e s t e d w i t h Smal. The d i g e s t was e l e c t r o p h o r e s e d through 0.8% LMP agarose and the 430 bp CYCl fragment was p u r i f i e d . The fragment was l i g a t e d t o p A l l . l l which had been d i g e s t e d w i t h Smal and t r e a t e d w i t h b a c t e r i a l a l k a l i n e p h o s p h a t a s e . E . c o l i RRl was t rans fo rmed t o a m p i c i l l i n r e s i s t a n c e w i th the l i g a t i o n m i x t u r e , and p lasmid DNA was prepared from s e v e r a l of the t r ans fo rman ts . D i g e s t i o n w i t h X h o l and EcoRI r e v e a l e d the presence and -149-o r i e n t a t i o n of the 430 bp Smal fragment and a l l owed i t t o be c l e a r l y d i s t i n g u i s h e d from the s h o r t e r fragment d e r i v e d from p A l l . l l (See F i g u r e 1 0 ) . Treatment w i t h a l k a l i n e phosphatase shou ld have prevented r e l i g a t i o n o f the 2 Smal f ragments o f p A l l . l l , and XhoI /EcoRI d i g e s t i o n of the p lasmids recovered from the t rans fo rmants i n d i c a t e d t h a t a l l con ta ined a s m a l l fragment o f the same s i z e as t h a t i n p A l l . 7 1 , which was the source o f the Smal fragment i n mp lOAl . Each o f the p A l l s c a r r y i n g p o i n t muta t ions i n the 3 ' end s i g n a l was i n t r oduced i n t o yeas t s t r a i n RP123, s e l e c t i n g f o r TRP1+ t r ans fo rman ts . The rema in ing m in ip rep DNA was p u r i f i e d f o r DNA sequencing as d e s c r i b e d e a r l i e r , and a r e g i o n i n c l u d i n g about 100 bp of the CYCl promoter r e g i o n , the 3 ' end s i g n a l f ragment , and about 100 bp o f the ad jacen t l a c i ' 1 gene was sequenced from oAS7 (see Tab le I f o r o l i g o n u c l e o t i d e sequence) . C o n s t r u c t i o n o f p A l 2 , pA l2A, and pAl2B P lasmids The s i n g l e - s t r a n d e d DNA of each d e r i v a t i v e o f mplOAl (1 .0 / ig ) was annealed w i t h M13FP1 (12 pmol) i n 20 u l of Kpn b u f f e r c o n t a i n i n g 0.1 mg/ml BSA and 0.4 mM dNTPs. The m ix tu re was i ncuba ted w i t h l u o f DNA polymerase I (Klenow fragment) f o r 1 hour a t 2 3 ° , a f t e r which the enzyme was i n a c t i v a t e d by h e a t i n g t o 65° f o r 10 m inu tes . The DNA was d i g e s t e d w i t h Kpn l and H i n d l l l and p u r i f i e d by phenol e x t r a c t i o n and e thano l p r e c i p i t a t i o n . O n e - f i f t h o f t he p r e c i p i t a t e d DNA was l i g a t e d t o 0.1 / i g o f pYeCYCl (2 .5 ) which had been d i g e s t e d w i t h Kpn l and H i n d l l l and t r e a t e d w i t h BAP. A f t e r ove rn i gh t i n c u b a t i o n a t 2 3 ° , the l i g a t i o n m ix tu re was used t o t r a n s f o r m E . c o l i RRl t o a m p i c i 1 1 i n - r e s i s t a n c e . P lasmids were i s o l a t e d from 1.5 ml ove rn i gh t c u l t u r e s o f i n d i v i d u a l t rans fo rmants and screened by r e s t r i c t i o n - 1 5 0 -F i g u r e 10. R e c o n s t r u c t i o n o f p A l l P lasmids C a r r y i n g P o i n t Mu ta t ions i n t he CYCl 3 ' End S i g n a l The c o n s t r u c t i o n o f p A l l . T l . 3 6 i s shown as an example. R e s t r i c t i o n s i t e s a r e l a b e l l e d as f o l l o w s : K, K p n l ; Sm, Smal . The i n s e t i s a photograph o f an e th id ium b romide -s ta ined e lec t ropherogram showing the fragments produced by XhoI /EcoRI d i g e s t i o n o f v a r i o u s p l a s m i d s : l ane 1, p A l l . T l . 3 6 ; l ane 2, p A l l . G 3 . 7 ; l ane 3 , p A l l . l l ; l ane 4 , p A l l . 7 1 . The s m a l l e s t XhoI /EcoRI fragment v i s i b l e c a r r i e s the 3 ' end s i g n a l r e g i o n . I t i s apparent t h a t the f ragments produced by d i g e s t i o n of p A l l . l l and p A l l . 7 1 a r e r e a d i l y d i s t i n g u i s h e d , and t h a t the p lasmids c o n t a i n i n g 3 ' end s i g n a l muta t ions y i e l d fragments of t he same s i z e as p A l l . 7 1 , not p A l l . l l . - 1 5 1 -* S m J V S m pAll.ll 1 1 Smal fragments 400 bp ,23 4 - 1 5 2 -Figure 11 A. Construction of pAl2 Plasmids Restriction sites are labelled as follows: B, BamHI; H, Hindlll; K, Kpnl; Sm, Smal. The CYCl coding sequence is stippled, and the 3' end signal fragment is cross-hatched. B. Orientation of the Truncated cycl Gene in the pAl2A and pAl2B Plasmids. Restriction sites are labelled as in A, with the following additions: E, EcoRI; P, Pstl. -153-digestion. Plasmids in which the 355 bp KpnI/Hindlll fragment of pYeCYCl(2.5) had been replaced by the small (70 bp) KpnI/Hindlll fragment of the mplOAl derivatives were chosen as pAl2 plasmids (Figure 11).. Each pAl2 plasmid was digested with BamHI, and the 2 kb fragment carrying the truncated CYCl gene and 3' end signal fragment was purified from LMP agarose for ligation into BamHI, BAP-digested YEpl3. Plasmids were isolated from ampicillin-resistant transformants of E. coli RRl and screened by digestion with EcoRI and Xbal/Hindlll. Those in which the inserted CYCl gene was oriented towards 2p circle sequences in the vector were referred to as the pAl2A series. Those in which the insert had the opposite orientation were called the pAl2B series (Figure 11). Both series were introduced into yeast strain GM-3C-2, selecting for LEU2+ transformants. RNA isolated from these transformants was analyzed for hybridization to a CYCl probe after electrophoresis and transfer to nitrocellulose. OLIGONUCLEOTIDE-PIRECTED MUTAGENESIS Oligonucleotide-directed mutagenesis was carried out using the procedure described by Zoller and Smith (1982,'1983). Each mutagenic oligonucleotide was 14-18 nucleotides long and was equivalent in sequence to a region of interest on one strand or the other of the 2.5 kb BamHI/Hindlll CYCl fragment of pYeCYCl(2.5), except at certain positions. At those positions, the oligonucleotide sequence matched the desired mutant sequence. The template used for mutagenesis was the single-stranded DNA of an Ml3 clone carrying the CYCl strand complementary to the oligonucleotide. A particular mutagenic oligonucleotide was chosen on the basis of a computer search of the -154-sequences of t he 2 .5 kb B a m H l / H i n d l l l CYCl fragment and Ml3 phage DNA u s i n g the programme ADDL:SEQNCE (Delaney, 1982) , which i n d i c a t e d t h a t the o l i g o n u c l e o t i d e was u n l i k e l y t o form a s t a b l e dup lex w i t h the templa te mo lecu le a t any s i t e o the r than the in tended t a r g e t i n C Y C l . The c r i t e r i o n used t o determine which o l i g o n u c l e o t i d e s would be u s e f u l was t h a t an o l i g o n u c l e o t i d e : t e m p l a t e dup lex formed a t any s i t e o the r than the t a r g e t shou ld c o n t a i n a t l e a s t two more mismatched base p a i r s than the dup lex formed a t the t a r g e t s i t e . The s p e c i f i c o l i g o n u c l e o t i d e s and templa tes used t o produce p a r t i c u l a r muta t ions a re l i s t e d i n Tab le IV . The mutagenic o l i g o n u c l e o t i d e was phosphory la ted w i t h T4 p o l y n u c l e o t i d e k i n a s e and ATP i n LK b u f f e r and used f o r mutagenesis w i thou t f u r t h e r p re t rea tmen t . About 0 .3 pmol of s i n g l e - s t r a n d e d templa te DNA was mixed w i t h a 10-100 f o l d molar excess o f the phosphory la ted o l i g o n u c l e o t i d e i n 10 / a l of b u f f e r c o n t a i n i n g 20 mM T r i s - H C l pH 7 . 5 , 10 mM MgCl2 , 50 mM N a C l , 1 mM DTT. The m ix tu re was heated t o 55° f o r 5 minutes and c o o l e d t o room tempera ture . An equal volume o f a m i x tu re c o n t a i n i n g 1 mM dCTP, dGTP, and dTTP, 0.1 mM cX[ 3 2 P]dATP (100 C i /mmo l ) , and 1 mM ATP i n 20 mM T r i s - C l pH 7 . 5 , 10 mM MgCl2, 10 mM DTT was added w i t h 1 u o f T4 DNA l i g a s e and 2 u o f DNA polymerase I (Klenow enzyme). A f t e r 2-5 minutes a t room tempera ture , dATP was added t o 1 mM, and i n c u b a t i o n was con t inued a t 15° f o r 12-16 hou rs . The r e a c t i o n m ix tu re was d i l u t e d t o 50 pi w i t h TE10:1 and an equa l volume o f 13% PEG i n 1.6 M NaCl was added. The m ix tu re was c h i l l e d on i c e f o r 15-40 m inu tes , and the DNA was p e l l e t e d by c e n t r i f u g a t i o n f o r 5 minutes a t 4° i n an Eppendorf c e n t r i f u g e . The p e l l e t was r i n s e d by add ing 100 pi o f i c e - c o l d 6.5% PEG i n 0.8 M NaCl - 1 5 5 -TABLE TV SUMMARY OF OLIGONUCLEOTIDE-DIRECTED MUTAGENESIS EXPERIMENTS Mutation Oligonucleotide Template Efficiency Name of (%) Mutant Clone GG462 C482 oASl oAS2 GT473 C474 OAS3 oAS4 mp9CYCl(2.5) mp8CYCl(2.5) mp8CYCl(GG462; mp9CYCl(2.5) 6 2 8 42 mpl1CYC1A K(-2 6/+4 49) 19 mp9CYCl(2.5) 58 mpl1CYC1A K(-2 6/+4 49) 3 mp9CYCl(GG462) mp8CYCl(C482) mp8CYCl(GG462/ C482) mp9CYCl(GT473) mpllCYClTl mp9CYCl(C474) mpllCYClT2 -156-and centrifuging for 5 minutes. As much of the supernatant as possible was removed using a capillary micropipet. The pellet was dissolved in TE10:1 (180/al), and 20 pi of 2M NaOH was added. The denatured DNA was loaded onto a 5 ml 5-20% sucrose gradient in 0.2 M NaOH, 1 M NaCl, and centrifuged at 37,000 rpm for 2 hours in a Beckman SW50.1 rotor. Fractions of about 0.2 ml were collected from the bottom of the gradient and the Cerenkov radiation emitted by each was measured in a liquid scintillation spectrometer. An example of the results is shown in Figure 12A. Fractions containing the lower (faster-sedimenting) of the two peaks of radioactivity were pooled, neutralized by adding an appropriate volume of 1 M Tris-citrate, pH 5 and dialyzed at 4° against 2 1.5 1 batches of TE10:1 and 1.5 1 of TE2:0.01 for at least 3 hours each. The dialysate was used to transfect competent cells of E. ooli JM101. Plaques obtained in the transfection were used to infect separate 1 ml cultures of JM101, and phage were precipitated from the supernatants of the infected cultures as described earlier. The phage were resuspended in 50 pi of TE10:1 and screened for the presence of oligonucleotide-directed mutations. Screening for Mutations Clones carrying oligonucleotide-induced mutations were identified by hybridization to the mutagenic oligonucleotide, as described by Wallace et al. (1979) and Zoller and Smith (1983). A grid was drawn lightly in pencil on the surface of a sheet of nitrocellulose and the sheet was then wet with water, soaked in 6XSSC for a few minutes, and air-dried. A 1-2 pi aliquot of each 50 ul phage suspension was spotted onto the nitrocellulose. An aliquot of the template used for mutagenesis was also spotted onto the filter as a "wild-type" control. -157-F i g u r e 12. O l i g o n u c l e o t i d e - D i r e c t e d Mutagenesis A . P r o f i l e o f a l k a l i n e suc rose g r a d i e n t , showing s e p a r a t i o n of c o v a l e n t l y c l o s e d c i r c u l a r DNA (cc) f rom open c i r c u l a r DNA ( o c ) . The g r a d i e n t was f r a c t i o n a t e d from bottom t o t o p , and each f r a c t i o n was assayed f o r r a d i o a c t i v i t y i n a l i q u i d s c i n t i l l a t i o n coun te r . B. I d e n t i f i c a t i o n of c l o n e s c a r r y i n g C474 mu ta t i on . (Top) Pr imary s c r e e n : 36 phage i s o l a t e s were bound t o n i t r o c e l l u l o s e , sub jec ted t o d e n a t u r a t i o n , h y b r i d i z e d t o 5 ' [ 3 2 ] P - o A S 4 , and washed a t the i n d i c a t e d tempera tu res . The rows marked "WT" c o n t a i n DNA from the p a r e n t a l phage, mp9CYCl (2 .5 ) . (Bottom) secondary s c r e e n : one o f the p o s i t i v e c l o n e s from the f i r s t sc reen was r e p l a t e d and phage prepared from 12 i s o l a t e d p laques were screened as b e f o r e . The rows marked "WT,m" c o n t a i n DNA from mp9CYCl(2.5) on the l e f t , and DNA from the presumpt ive mutant phage i d e n t i f i e d i n the f i r s t sc reen on the r i g h t . - 1 5 8 -A. 40 E Q. B. The f i l t e r was t h e n b a k e d i n v a c u o a t 80° f o r 1 - 2 h o u r s and p r e h y b r i d i z e d i n 6XSSC a n d 10X D e n h a r d t ' s s o l u t i o n (0.2% F i c o l l , 0 . 2 % p o l y v i n y l p y r o l l i d o n e , 0.2% BSA) a t 25° f o r 4 5 m i n u t e s . The m u t a g e n i c o l i g o n u c l e o t i d e was 5 ' e n d - l a b e l l e d f o r u s e a s a h y b r i d i z a t i o n p r o b e by i n c u b a t i n g 50 pmol o f o l i g o n u c l e o t i d e w i t h 1 -2 u o f T4 p o l y n u c l e o t i d e k i n a s e and 1 0 - 2 0 u C i tf[32P]ATP i n 10 / a l o f LK b u f f e r f o r 3 0 - 6 0 m i n u t e s a t 37°. The l a b e l l e d o l i g o n u c l e o t i d e was s e p a r a t e d f r o m u n i n c o r p o r a t e d ATP by g e l f i l t r a t i o n o v e r Sephadex G -25 i n 0 .1 M ammonium b i c a r b o n a t e , pH 7 . 8 , o r by b i n d i n g t o a 1 m l c o l u m n o f DE -52 i n 0 . 2 M N a C l i n T E 1 0 : 1 . The D E - 5 2 c o l u m n was washed i n t h e b i n d i n g b u f f e r t o e l u t e A T P , a n d t h e n t h e o l i g o n u c l e o t i d e was e l u t e d w i t h 1 M N a C l i n T E 1 0 : 1 . A p p r o x i m a t e l y 10^ cpm ( C e r e n k o v ) w e r e u s u a l l y i n c o r p o r a t e d i n t o 50 pmol o f o l i g o n u c l e o t i d e . The h y b r i d i z a t i o n m i x t u r e c o n t a i n e d 6XSSC, 10X D e n h a r d t ' s s o l u t i o n , and 1 - 5 X 1 0 ^ cpm o f l a b e l l e d o l i g o n u c l e o t i d e , i n a v o l u m e o f 3 m l f o r u s e w i t h a 50 c m 2 f i l t e r . The f i l t e r was i n c u b a t e d i n a s e a l e d bag w i t h t h e h y b r i d i z a t i o n m i x t u r e f o r 1 -4 h o u r s a t 15° o r room t e m p e r a t u r e . The f i l t e r was t h e n s u b j e c t e d t o f o u r 1 0 - m i n u t e washes i n 6XSSC a t room t e m p e r a t u r e and a u t o r a d i o g r a p h e d f o r 1 -4 h o u r s . A s e r i e s o f 1 0 - m i n u t e washes w e r e p e r f o r m e d , e a c h a t a t e m p e r a t u r e 5-7° h i g h e r t h a n t h e p r e v i o u s o n e . A f t e r e a c h w a s h , t h e f i l t e r was a u t o r a d i o g r a p h e d f o r 1 -16 h o u r s , l o n g e r e x p o s u r e s b e i n g n e c e s s a r y a f t e r t h e l a t e r washes i n t h e s e r i e s . Phage w h i c h g a v e a s t r o n g h y b r i d i z a t i o n s i g n a l a f t e r w a s h i n g a t a t e m p e r a t u r e s u f f i c i e n t t o remove t h e l a b e l l e d o l i g o n u c l e o t i d e f r o m t h e " w i l d - t y p e " DNA on t h e same f i l t e r were t e n t a t i v e l y c o n s i d e r e d t o c a r r y t h e o l i g o n u c l e o t i d e - i n d u c e d m u t a t i o n . - 1 6 0 -In the experiments described in this study, washing at a temperature of 25-37° was sufficient to remove the labelled oligonucleotide from "wild-type" phage DNA, while mutant phage gave a strong hybridization signal after a 37° wash (See Figure 12). The closed circular DNA purified from the alkaline sucrose gradient and used to transfect JM101 should have consisted of heteroduplexes with one mutant and one "wild-type" strand. Each plaque produced upon transfection might therefore have contained a mixture of mutant and "wild-type" phage. Phage suspensions identified as containing mutants in the first round of hybridization screening were replated on JM101 in order to obtain pure stocks of mutant phage. Well-isolated plaques were used to infect 1 ml cultures of JM101, and phage prepared from the supernatants of these cultures were subjected to a second round of hybridization screening. One of the mutant phage identified in the second screen was replated on JM101 and one of the plaques so obtained was used to infect a large culture of JM101 for the isolation of RF DNA using the procedures described earlier. Transfer of Oligonucleotide-Mutagenized CYCl Genes to Yeast Plasmids The RF DNAs of the phage mp9CYClGG462, mp8CYClC482, mp8CYC!GG462C482, mp9CYClGT473, and mp9CYClC474 (Table IV) were all digested with BamHI and Hindlll, and the 2.5 kb BamHI/Hindlll fragment of each was purified after electrophoresis through LMP agarose. The purified fragments were separately ligated to BamHI/Hindlll-digested, alkaline phophatase-treated YEpl3, and each ligation mix was used to transform E. coli RRl to ampicillin-resistance. Plasmids isolated from the transformants were screened for the presence of the 2.5 kb BamHI/Hindlll fragment carrying the CYCl gene. Plasmids carrying each -161-mutant CYCl region were referred to as YEpl3CYClGG462, YEpl3CYC1C482, YEpl3CYC1GG462C482, YEpl3CYClGT473, and YEpl3CYClC474, respectively. They were introduced into yeast strain GM-3C-2, selecting for LEU2+ transformants. Sequence Confirmation of Oligonucleotide-Directed Mutations in CYCl The plasmid YEpl3CYClGG462 was digested with Xhol and Hindlll and radioactively labelled by incubating with a[32P]dATP and DNA polymerase I (Klenow fragment). The 850 bp Xhol/Hindlll fragment carrying CYCl, specifically labelled at its Hindlll site, was purified by electroelution from a gel slice after electrophoresing the digest through a 5% acrylamide gel. Plasmids YEpl3CYClC482 and YEpl3CYClGG462C482 were digested with Kpnl and Hindlll, labelled with a[32P]dATP and DNA polymerase I (Klenow), and the 355 bp KpnI/Hindlll fragment of each was similarly purified by electroelution from acrylamide. The three purified fragments were subjected to the chemical cleavage reactions of Maxam and Gilbert (1977; 1980) and electrophoresed through 12% acrylamide/7M urea gels. After autoradiography, the sequence of a 100 bp region including the intended mutant site was read. Each fragment contained the desired mutation and no other differences from the "wild-type" sequence were noted in the region sequenced. The phage DNA of mp8CYClC482 was sequenced from M13FP1 by the chain termination method (Sanger et aL.,1977;1980). The C482 mutation was the only difference from the "wild-type" sequence in a region of about 200 bp. The GG462 mutation could not be sequenced from FPl in mp9CYClGG462, which was the phage produced by mutagenesis with oligonucleotide oASl (Table IV). The EamHI-Hindlll fragment of the RF -162-DNA of that phage was however cloned into mp8 to produce mp8CYClGG462. Sequencing of the DNA of this phage from M13FP1 confirmed the presence of the GG462 mutation and the absence of other changes in its vicinity. This phage was used as the template for mutagenesis with oAS2 to produce mp8CYC!GG462C482, as noted in Table IV. The purified BamHI/Hindlll fragments of the RFs of phage mp9CYClGT473 and mp9CYClC474 were ligated into BamHI-Hindlll-digested mplO, and E. coli JM101 was transfected with the ligation mixes. Phage DNA was prepared from a series of 1 ml cultures, each infected with a single plaque obtained upon transfection. The DNAs of two independent mplO clones of each Bam/Hindlll fragment were sequenced from M13FP1, and in each case the desired mutation was the only change from "wild-type" sequence evident in a region of about 250 nucleotides. The product of mutagenesis of npllCYClAK5 '-26/AK3 '+449 with oligonucleotide oAS4 was called mpllCYClT2 (Table IV). The RF DNA of the phage was used to produce deletions extending towards the CYCl 3' end signal from the Hindlll site downstream, as described above. The plasmids so produced were the pA4s. The sequence of the deletion endpoint region of each pA4 confirmed the presence of the C474 mutation. SEGMENT-DIRECTED MUTAGENESIS An outline of the procedure is shown in Figure 13. Annealing Ml3mpl0 RF DNA was digested with Smal and purified by phenol extraction and ethanol precipitation. The gapped heteroduplex which was to serve as template for misincorporation mutagenesis was produced by mixing the single-stranded DNA of mplOAl with a 5-fold weight excess -163-(Sm) (Sm) Sm Sm mpIO RF/ Smal MIX,DENATURE, ANNEAL GAPPED HETERODUPLEX KLENOW, 4 dNTPs, Mg 10°, 1-3' 2+ KLENOW, I dNTPfoS], Mn 25° 2+ KLENOW, 4 dNTPs , M g 2 + T4 LIGASE, ATP Figure 13. Outline of Segment-Directed Mutagenesis The inserted 3' end signal fragment in mplOAl is indicated by the thick line. Mismatched base pairs are indicated by carets. -164-of Sma l -cu t mplO RF i n H i n b u f f e r , h e a t i n g t o 100 f o r 3 minutes and h o l d i n g a t 65° f o r 15 minutes be fo re c o o l i n g t o room temperature . A t y p i c a l r e a c t i o n i n c l u d e d 0.5 pg o f s i n g l e - s t r a n d e d DNA and 2.5 pg o f RF i n a volume o f 10 pi. The p r o d u c t i o n o f gapped he te rodup lexes was e a s i l y mon i to red by agarose g e l e l e c t r o p h o r e s i s of samples o f s i n g l e - s t r a n d e d DNA, uncut and l i n e a r mplO R F , the annealed m i x t u r e , and the same m ix tu re a f t e r C l a l d i g e s t i o n . The templa te n u c l e o t i d e immedia te ly ad jacen t t o a p r imer terminus d e f i n e s the t a r g e t s i t e f o r mutagenesis by m i s i n c o r p o r a t i o n . In o rde r t o use m i s i n c o r p o r a t i o n t o generate muta t ions throughout a r e g i o n of i n t e r e s t , p r imer t e r m i n i must f i r s t be produced which cor respond t o each p o s i t i o n i n t h a t r e g i o n . The l i m i t e d , random e x t e n s i o n o f the 3 ' end of the incomple te s t r a n d o f a gapped he te rodup lex se rves t o produce such a s e t o f p r imer t e r m i n i . L i m i t e d Pr imer E x t e n s i o n on a Gapped Duplex Deoxynuc leos ide t r i p h o s p h a t e s were added t o the gapped dup lex formed between s s mplOAl and Sma l -cu t mplO i n 5 u l o f H in b u f f e r . ( F i n a l c o n c e n t r a t i o n s : dCTP,dGTP,dTTP, 33/iM e a c h ; cx [ 3 2 P]dATP, 800 C i / m o l , 1.8 / iM . ) The m ix tu re was c o o l e d t o 9 ° , and DNA polymerase I (Klenow f ragment : l u ) was then added. Samples were removed p e r i o d i c a l l y d u r i n g the subsequent i n c u b a t i o n a t 9 ° . In e a r l y exper iments des igned t o check the r a t e o f p r imer e x t e n s i o n , samples o f 3 pi were removed a t 30-second i n t e r v a l s and i m e d i a t e l y added t o separa te tubes c o n t a i n i n g 20 pi of i c e - c o l d 10 mM EDTA. The DNA was d e p r o t e i n i z e d , e t h a n o l - p r e c i p i t a t e d and then d i g e s t e d w i t h BamHI i n 5 pi o f H i n b u f f e r . Formamide-dye mix was added t o each d i g e s t , which was then heated t o 90° f o r 3 m inu tes , q u i c k - c h i l l e d and loaded on a - 1 6 5 -thin 8% acrylamide/7 M urea gel for electrophoresis. To prepare primer-templates for use in misincorporation, samples of 7.5 /al were removed from the primer extension reaction after 1 minute and 3 minutes and transferred directly to a single tube containing 50 pi of 10 mM EDTA. The DNA was deproteinized by phenol extraction and ethanol-precipitated three times from 2M ammonium acetate to free it of deoxynucleoside triphosphates. Ammonium acetate was added to the DNA solution from a 7.5 M stock, followed by 2 volumes of ethanol. The mixture was chilled in dry ice/ethanol for 15 minutes, then warmed to room temperature and centrifuged for 10 minutes in an Eppendorf centrifuge. The final precipitate was rinsed with 70% ethanol, dried, and dissolved in water. All of the radioactivity in samples of this solution was TCA-precipitable, suggesting that the repeated precipitations had effectively removed unincorporated nucleotides. Unfortunately, about 10 - 20% of the primer-template was also lost during the process, but the elimination of unincorporated nucleotides was seen as more important than quantitative recovery of the DNA, because free nucleotides would have interfered with misincorporation of nucleotide analogs in the next step in the procedure. Misincorporation The primer-template population was incubated for 16-24 hours at room temperature with 1 u of DNA polymerase I (Klenow fragment) in a volume of 50-75/al, containing 130 mM NaHepes pH 7.5, 0.2 mM MnCl2, 2 mM DTT, 0.1 mg/ml BSA, and either dGTP[«S] or dTTP[orS] at a concentration of 0.2 mM (Shortle et al.,1982). The DNA was deproteinized by phenol extraction and ethanol precipitated. -166-Gap Repair To complete the repair of the gap remaining in the primer:template after misincorporation, the DNA was incubated at room temperature for 16-24 hours with 1 u of DNA polymerase I (Klenow fragment) and 0.5-1 u of T4 DNA ligase in a volume of 20-40 pi containing 50 mM Tris-HCl pH 7.5, 1 mM MgCl2, 10 mM DTT, 2 mM MnCl2, 0.1 mg/ml BSA, 1 mM ATP, and dATP, dGTP, dCTP and dTTP at 0.1 mM each. The reaction mixture could be used directly for the transfection of JM101. Alternatively the DNA was deproteinized by phenol extraction, ethanol-precipitated and redissolved in 20 pi of 10 mM Tris-HCl pH 8, and an aliquot of this solution was used to transfect JM101. It was observed at this time that the addition of 1 or 2 pg of tRNA to a DNA sample prior to transfection of JM101 caused a 2-10-fold increase in the efficiency of transfection. In one experiment, an attempt was made to eliminate leftover mplOAl DNA in the hope of reducing the background of "wild-type" plaques. DNA recovered from the gap repair reaction was treated with 0.002 u of Si nuclease in 20 pi of Si buffer for 30 minutes at room temperature. Control experiments with mplOAl single-stranded DNA and circular mplO RF had shown that O.OOlu of Si nuclease in 20 yul effectively degraded 0.5 ug of mplOAl DNA in 30 minutes without detectably affecting either the electrophoretic mobility of RF DNA or the efficiency with which it transfected JM101. The Sl-treated DNA was purified by phenol extraction and ethanol precipitation before being introduced into JM101. The cells were plated in soft YT agar with XGAL and IPTG following transfection, and the colourless plaques which appeared on the plates were picked into 1 ml cultures of JM101 in 2YT. Phage DNA was prepared -167-as usual and subjected to "single-track" sequencing from M13FP1 with the dideoxynucleotide corresponding to the *-thiodeoxynucleotide used during the misincorporation reaction. Single-track sequences were displayed by autoradiography after electrophoresis in 6% acrylamide/7 M urea thin gels. Mutant clones were easily identified because most of the mutations produced by this procedure caused an extra band to appear in the single track sequence. Clones carrying mutations in the target region were used to construct the corresponding pAll plasmids. The complete sequence of the promoter/3' end signal region, including all promoter/3' end signal/lac fusion junctions was determined for each pAll so constructed. DNA SEQUENCING  Chain Terminator Method Most of-the DNA sequencing required over the course of this study was performed using chain-terminating inhibitors as originally described by Sanger et al.(1977a). This method was applied to the single-stranded DNA of recombinant Ml3 clones (Sanger et al.,1980; Messing, 1983), single-stranded pEMBL DNA (Dente et al.,1983) and to double-stranded plasmid DNA (Smith et al_. ,1979). The preparation of each type of template has already been described. Different procedures of annealing template to sequencing primer were applied to single- and double-stranded templates, as will be described below. Primer:Template Annealing Single-Stranded DNA Template The oligonucleotide M13FP1, prepared in this laboratory (Table I), was used as a sequencing primer on single-stranded Ml3 or pEMBL(+) templates. About 0.5/ag of template DNA was annealed to 6-10 pmol of -168-F P l i n a volume of 8-10 u l , c o n t a i n i n g 10 mM MgCl2 , 10 mM T r i s - H C l , pH 8 . 5 , by h e a t i n g t o 55° f o r 5 minutes and c o o l i n g t o room tempera ture . Doub le-St randed Template P l a s m i d DNA., prepared f o r sequenc ing as d e s c r i b e d e a r l i e r , was f i r s t d i g e s t e d w i t h s u i t a b l e r e s t r i c t i o n enzyme(s) f o r 1-2 hours i n a volume o f 10 / a l of e i t h e r low o r medium s a l t b u f f e r . About 6-10 pmol of o l i g o n u c l e o t i d e p r imer was added d i r e c t l y t o t he d i g e s t , and the m ix tu re was heated t o 100° f o r 5 minutes and q u i c k l y c h i l l e d i n i c e - w a t e r . Sequencing Reac t i ons The r e a c t i o n s were c a r r i e d out i n 0.5 ml Eppendorf t u b e s . 0t[32p]dATP ( 7 - 1 0 / i C i , i n 1 pi) and u n l a b e l l e d dATP (12 - 15 pmol , i n 1 pi) were added t o the p r imer : t emp la te s o l u t i o n , and 2 pi a l i q u o t s o f the r e s u l t i n g m ix tu re were t r a n s f e r r e d t o 4 t u b e s , marked C, T, A , G. The same volume of t he a p p r o p r i a t e ddNTP/dNTP " t e rm ina to r mix" was then added t o each tube . The compos i t ions o f the t e r m i n a t o r mixes a re l i s t e d i n Tab le V . The tubes were then t r a n s f e r r e d t o a 30° water b a t h , and the c h a i n ex tens ion r e a c t i o n was s t a r t e d by adding t o each tube 2 pi o f a f r e s h l y p repared d i l u t i o n o f DNA polymerase I (Klenow fragment) (0.25 u^u l i n 10% g l y c e r o l , 5 0 pg/ml BSA,10mM T r i s - H C l pH 7 .5 ,1 mM DTT). The r e a c t i o n was a l l o w e d t o proceed f o r 15 m inu tes , a t which t ime 2 pi o f a s o l u t i o n c o n t a i n i n g a l l 4 deoxynuc leos ide t r i p h o s p h a t e s a t a c o n c e n t r a t i o n of 0.5 mM each was added. F i f t e e n minutes l a t e r , the r e a c t i o n was s topped by add ing 4 pi of formamide dye mix (90% formamide/20mM EDTA/0.03% bromophenol b lue /0 .03% xy lene c y a n o l ) . The - 1 6 9 -TABLE V COMPOSITION OF ddNTP/dNTP TERMINATOR MIXES a Component Mixture (All concentrations are/oM) T dCTP 5.5 110 110 110 dTTP 110 5.5 110 110 dGTP 110 110 110 5.5 ddCTP 50 ddTTP - 500 ddATP 50 ddGTP - - - 300 a. All mixes also contained 2.5 mM Tris-HCl, pH 7.5, and 0.05 mM EDTA. -170-mixture was heated to 90; for 3 minutes, chilled in ice-water, and loaded immediately onto a 20 X 40cm X 0.3 mm thick 6% acrylamide/7M urea gel. Electrophoresis was carried out at 1,400 - 1,500 V for 1-3 hours. Each set of sequencing reactions was usually loaded on two gels, the first being run for 2-1/2 - 3 hours, and the second for 1-1/2 hours to allow different regions of the nucleotide sequence to be read. Sequencing by Base-Specific Chemical Cleavage  Purification of Fragments Prior to Sequencing End-labelled DNA fragments to be sequenced by the chemical cleavage method of Maxam and Gilbert (1977;1980) were purified after electrophoresis in acrylamide gels. The gel was autoradiographed to allow regions containing the DNA fragments of interest to be identified, and those regions were excised with a scalpel. Each gel piece was placed inside a dialysis bag containing 0.5 X TBE electrophoresis buffer. The bag was placed between and parallel to the electrodes of a horizontal electrophoresis apparatus and submerged in the same buffer. Electroelution of the DNA from the gel piece was carried out at 5 V/cm for 1-2 hours. The solution in the dialysis bag was transferred to a 1.5 ml tube. The gel piece was rinsed with the same buffer, and this rinse was added to the eluate. The eluate was phenol-extracted, and the DNA was then precipitated with ethanol, rinsed, dried, and dissolved in 30 pi of water. The DNA was divided into 4 aliquots, two of 5 /al each for the C and G sequencing reactions, and two of 10 pi each for the (C+T) and (A+G) reaction. Carrier DNA (1 pi of a 1 mg/ml solution of calf thymus DNA) was added to each tube. -171-Base-Modification Reactions  C Reaction Twenty microliters of 5M NaCl were added, and the C modification reaction was started by adding 30 ul of hydrazine. The reaction was allowed to proceed for 12 minutes at room temperature, at which point 300 /al of pyrimidine stop mix (0.3M NaOAc, pH 6.0; 0.1 mM EDTA; 50 /ag/ml tRNA) were added, followed by 1 ml of cold ethanol (-70°). (C+T) Reaction The reaction was exactly the same as the C reaction, except that 15 /al of water were added to the DNA instead of 5 M NaCl before starting the reaction. G Reaction The DNA was diluted with 300 ul of cacodylate buffer (50 mM Na-cacodylate; 10 mM MgCl2; 0.1 mM EDTA; pH 8.0) and the reaction commenced with the addition of 2 /al of dimethylsulfate. Five minutes later, base modification was stopped by adding 50 ul of G stop mix (2.5 M -^mercaptoethanol; 3 M NaOAc, pH6.0; 0.1 M Mg(OAc)2; 0.1 mM EDTA; 0.5 mg/ml tRNA) and 1 ml of cold ethanol. (A+G) Reaction The DNA was diluted with 10 /al of water, and depurination was initiated by adding 3 /al of 10% formic acid. The reaction continued for 10 minutes at 37°, at which time 300 /al of A stop mix (pyrimidine stop mix, with ATP added to 0.5 mM) were added, followed by 1 ml of cold ethanol. Purification and Hydrolysis of Modified DNA All samples were chilled in' a dry ice/ ethanol bath for 15 minutes, after which the DNA was pelleted by centrifugation for 5 minutes. -172-After drying, the pellet was resuspended in 0.25 ml of 0.3 M NaOAc, and the ethanol precipitation was repeated. The dried pellet was again resuspended, this time in 10/il of water, and precipitated for a third time. The pellet was rinsed in ethanol, dried, and dissolved in 20 /al of 1 M piperidine. Samples were heated at 90° for 30 minutes and then lyophilized. They were twice redissolved in 20 /al of water and lyophilized before being dissolved in formamide-dye mix. They were denatured at 90° for 3 minutes, chilled in ice-water and loaded on acrylamide/ 7 M urea thin gels. Electrophoresis was carried out at 30-40 V/cm until the marker dyes had migrated a suitable distance. The gels were subjected to autoradiography at -20° without pretreatment. TRANSFORMATION of YEAST The procedure used for yeast transformation was similar to those described by Hinnen et al. (1978), Beggs (1978), Sherman et al_. (1981), and Orr-Weaver et al.(1983). A single colony of the strain to be transformed was used to inoculate 5 ml of YPD, and the culture was incubated at 30° overnight. One ml of this saturated culture was used to inoculate 100 ml of fresh YPD, and the new culture was incubated at 30° until an OD500 of about 0.3, corresponding to a cell density of about 1.4 x 10^  cells/ml, was reached. The cells were harvested by centrifugation at 4,000 rpm for 5 minutes at 4° in a Sorvall SS-34 rotor. The pellets were resuspended in a total of about 30 ml of 1 M sorbitol, combined, and the cells were pelleted as before. The cells were resuspended in 10 ml of 1 M sorbitol, and 50 pi of 1M DTT and 100 /al of Glusulase were added. The suspension was incubated at 30° with gentle shaking, and 5-10 pi samples were removed periodically, diluted with 50 pi H2O and examined under a -173-phase-contrast microscope to determine the approximate proportion of non-refractile spheroplasts and "ghosts". If over 50% of the cells remained intact and refractile after 40 minutes, a second 100 pi aliquot of Glusulase was added. This was often necessary with strain GM-3C-2 but rarely with other strains. When 90% or more of the cells had been converted to spheroplasts, they were harvested by centrifugation at 2,000 rpm for 5 minutes at room temperature in an ICN benchtop centrifuge. The pellet was washed by gently resuspending in 10 ml of 1 M sorbitol and centrifuging in the benchtop centrifuge as before. A second wash with 10 ml of 1 M sorbitol and a third with 10 ml of STC (1M sorbitol,10 mM Tris-HCl pH 7.5,10 mM CaCl2) were carried out. The final pellet was resuspended in 0.5-1.0 ml of STC. Aliquots of 0.1 ml were transferred to sterile plastic tubes (Falcon) and 1-10 yug of plasmid DNA, in a volume not exceeding 10 /al was added. The spheroplast suspensions were kept at room temperature for 15-20 minutes, and 1 ml of PEG-T-C (40% PEG 3350, 10 mM Tris-HCl pH 7.5, 10 mM CaCl2) was added to each. After 15-20 minutes at room temperature, the suspensions were centrifuged at 2,000 rpm for 10 minutes in a Sorvall SS-34 rotor at room temperature. The viscous supernatant was carefully removed from each pellet with a sterile Pasteur pipet, and the pellet was gently resuspended in 0.5 ml of STC. An aliquot of 0.25 ml was removed and added to 10 ml of molten RC agar which lacked a growth factor X and which had been held at 55°. The missing growth factor, either tryptophan, leucine or uracil, was required by the parental yeast strain but not by cells which had acquired the plasmid used for transformation. Immediately after adding the spheroplast suspension, the molten agar was mixed briefly and -174-poured over a plate of SC-X agar. Transformants gave rise to colonies embedded within the regeneration agar, which were easily visible after 2-3 days of incubation at 30°. Transformants were streaked onto plates of SC-X, and single colonies from these plates were used to inoculate cultures for storage, RNA isolation, or 6-galactosidase assays. ISOLATION of YEAST RNA A single colony of yeast was used to inoculate 3-5 ml of an appropriate medium and the culture was incubated for 1-2 days at 30°). Selective media were used for all yeast strains carrying plasmids, but YPD was suitable for other strains. An aliquot of the small saturated culture was diluted into 100-200 ml of the same medium, which was then incubated at 30° until its A530 was between 0.6 (for cultures in selective medium) and 2 (for cultures in YPD). Cycloheximide was then added to the culture to a concentration of 0.1 mg/ml from a freshly-prepared 20 mg/ml stock in ethanol. Incubation was continued for 5 minutes, and the culture was then poured into two 250 ml centrifuge bottles, each half-full of crushed ice. Cells were harvested by centrifugation at 3,000 rpm for 1 minute at 4° in the Sorvall GSA rotor. The cell pellets were resuspended in ice-cold water containing cycloheximide (0.1 mg/ml), transferred to a chilled 30 ml Corex tube and pelleted by centrifugation at 5,000 rpm for 3 minutes at 4° in an SS-34 rotor. The pellets were immediately frozen in dry ice/ethanol. They could be kept frozen at -70° for at least several days without affecting the quality of the RNA extracted from them, but the extraction was usually done the day that the cells were harvested. Silanized, acid-washed glass beads were added to the frozen cell pellets (3 g beads/g wet weight cells) followed by 3 ml/g of ice-cold -175-RNA extraction buffer (0.15 M NaCl, 0.1 M Tris-HCl pH 7.5) and 50/al/g of vanadyl ribonucleoside complexes (VRC: 0.2 M). Cells were broken by vortexing hard for six 15-second intervals, each followed by 45 seconds of cooling on ice. Cell debris was pelleted by centrifugation at 9,000 rpm for 10 minutes at 4° in an SS-34 rotor. The supernatant was transferred to a clean tube and SDS and proteinase K were added to concentrations of 0.5% and 0.5 mg/ml, respectively. The mixture was incubated in a 37° water bath. The cell debris was extracted a second time by adding RNA extraction buffer and VRC and vortexing as before. After centrifugation, the second extract was added to the first, and the SDS concentration was adjusted to 0.5%. Incubation at 37° continued for 1 hour. The mixture was then extracted once with an equal volume of phenol/chloroform (1:1), and the phases were separated by centrifugation (9,000 rpm, 10 minutes, 4°, SS-34). The aqueous supernatant was transferred to a clean tube and nucleic acid was precipitated by adding sodium acetate to 0.3 M, 2.5 volumes of ethanol, and chilling at -20° for 1-16 hours. The precipitate was collected by centrifugation (9,000 rpm, 20 minutes, 4°, SS-34) rinsed in cold ethanol, dried and dissolved in 5 ml of 20 mM EDTA. An equal volume of 4M LiCl was added, and the mixture was chilled on ice overnight to precipitate high molecular weight RNA. The final precipitate was collected by centrifugation (9,000 rpm, 40 minutes, 4°, SS-34), rinsed in cold 2 M LiCl/10 mM EDTA and dissolved in water. A final ethanol precipitation from 0.3 M NaOAc, followed by rinsing with ethanol, served to desalt the RNA. The precipitate was dried, dissolved in water and stored frozen. The yield of RNA was estimated from its UV absorbance, assuming a solution of 40 /jg/ml RNA -176-to have an A 2 5 Q of 1.0. Up to 6 mg of RNA was obtained from 1 g (wet weight) of cells, which equals or exceeds the yields obtained by the author using procedures relying on repeated phenol extraction. The A260/280 r a t io of the RNA prepared by this method was at least 1.8, indicating that it was substantially free of protein. The LiCl precipitation was very effective in freeing high molecular weight RNA of smaller RNA species and DNA. RNA Minipreps The same RNA isolation procedure was adapted to the preparation of RNA from small cultures as follows: 2-3 ml of a suitable medium was inoculated with a single yeast colony and incubated until saturation was reached. An aliquot (approximately 2 ml) of this culture was diluted into 8 ml fresh medium and incubated at 30° until a cell density of about 2 x 10^ /ml was reached. The cultures were chilled in an ice-water bath and transferred to chilled 40 ml centrifuge bottles. Cells were harvested by brief centrifugation (5,000 rpm, 3 minutes, 4°, SS-34), resuspended in 1 ml of ice-cold water, transferred to a 1.5 ml Eppendorf tube, and pelleted by a 10-second spin in an Eppendorf centrifuge at 4°. The cell pellets were frozen in dry ice/ethanol. Ice-cold RNA extraction buffer (0.2 ml), VRC (10 ul), and glass beads (to meniscus) were added, and the tube was vortexed hard for six 15-second periods, each followed by 45 seconds on ice. After 15 seconds' centrifugation to pellet cell debris, the supernatant was transferred to a clean tube, and SDS (10 pi of 10%) and proteinase K (10/al of a fresh 10 mg/ml solution in RNA extraction buffer) were added. RNA extraction buffer (0.7 ml) and VRC (10 pi) were added to the pellet, and the vortexing and centrifugation were repeated. The -177-second supernatant was combined with the first and the SDS concentration was adjusted to 0.5%. The combined extract was incubated at 37° for 1 hour, after which an equal volume of 4 M LiCl was added. The tube was chilled on ice for 4-16 hours, and the precipitate was collected by centrifugation for 15 minutes in an Eppendorf centrifuge. The pellet was redissolved in 0.5 ml of water, and the LiCl precipitation was repeated. The second precipitate was rinsed with 2 M LiCl, 10 mM EDTA and redissolved in water (0.4 ml), and the UV spectrum of the resulting solution was measured. A final precipitation was carried out, this time using ethanol and 0.3 M NaOAc. After rinsing with ethanol, the final precipitate was dissolved in water to give an RNA concentration of about 10 pg/jol, based on the UV absorbance measured earlier. Yields from 10 ml cultures at 2 x 107 cells/ml were generally 200 - 400 jag. The ratio of A260/28O w a s approximately 2.0. Preparation of Glassware and Solutions for Handling RNA Glass beads used in the isolation of yeast RNA were washed with concentrated HCl, rinsed exhaustively with glass distilled water, silanized, and baked at 200° for at least 12 hours. All glassware used in the preparation, analysis and storage was similarly baked after washing and rinsing in glass distilled water. Plasticware, such as Eppendorf tubes and micropipet tips, was used without pretreatment from previously unopened packages. Solutions which were to come into contact with RNA were prepared with autoclaved glass distilled water in baked glassware. They were treated with 0.1% diethylpyrocarbonate (DEP) at 37° for 12-24 hours and autoclaved prior to use. (In the case of solutions containing Tris, the solution was made up without -178-T r i s and D E P - t r e a t e d , and the T r i s was added f rom an au toc laved s t o c k . The complete s o l u t i o n was then a u t o c l a v e d . ) P l a s t i c g l o v e s were worn whenever RNA samples , o r s o l u t i o n s t o be used w i t h RNA, were be ing hand led . GEL ELECTROPHORESIS of RNA RNA was ana l yzed by e l e c t r o p h o r e s i s i n agarose g e l s a f t e r d e n a t u r a t i o n by g l y o x a l and d i m e t h y l s u l f o x i d e (Carmichael and McMaster , 1980; Thomas, 1980) o r by e l e c t r o p h o r e s i s i n formaldehyde-agarose g e l s a f t e r d e n a t u r a t i o n w i t h formaldehyde and formamide (Lehrach e t al.,1977; M a n i a t i s e t a l . , 1982). E l e c t r o p h o r e s i s A f t e r Dena tu ra t i on w i t h G l y o x a l RNA samples o f up t o 15 pg were denatured i n a volume of 20 pi c o n t a i n i n g 1 M d e i o n i z e d g l y o x a l , 50% d i m e t h y l s u l f o x i d e , and 10 mM (NaH 2 P0 4 ' + N a 2 H P 0 4 ) , pH 7.0, by h e a t i n g a t 50° f o r 1 hour . Sample l o a d i n g b u f f e r {5pl) c o n t a i n i n g 50% g l y c e r o l , 10 mM (NaH 2P04 + Na 2HP04) pH 7.0, and 0.02% brcmophenol b l u e , was added b e f o r e l o a d i n g the samples on a 1-1.4% agarose g e l . The g e l was c a s t and run i n 10 mM phosphate b u f f e r , pH 7.0. The b u f f e r was r e c i r c u l a t e d d u r i n g e l e c t r o p h o r e s i s by means o f a p e r i s t a l t i c pump. E l e c t r o p h o r e s i s was c a r r i e d out a t about 2-4 V/cm f o r 6-12 hou rs . The g e l was not p r e t r e a t e d i n any way be fo re t r a n s f e r r i n g the RNA from the g e l t o n i t r o c e l l u l o s e . E l e c t r o p h o r e s i s A f t e r Dena tu ra t i on w i t h Formaldehyde As much as 20 pg o f RNA was denatured i n a volume of 20 pi c o n t a i n i n g 2.2 M formaldehyde, 50% formamide and 1/2X MOPS b u f f e r (IX MOPS b u f f e r con ta ined 40 mM NaMOPS, 10 mM sodium a c e t a t e , 1 mM EDTA, pH 7.0) by h e a t i n g a t 55° f o r 15 m inu tes . Sample l o a d i n g b u f f e r (2 -179-/al) was added, and the samples were loaded on a 1-1.4% agarose gel which had been cast in IX MOPS buffer containing 2.2M formaldehyde. The gel was run in IX MOPS buffer at 0.5-1 V/cm for 6-12 hours. After electrophoresis, the gel was rinsed for 5 minutes in distilled water and then soaked for 1 hour in 20X SSC (IX SSC is 0.15 M NaCl, 0.015 M Na citrate) prior to transferring the RNA to nitrocellulose as described in the next section. Transfer of RNA to Nitrocellulose The procedures of Thomas (1980) were used to transfer RNA from agarose gels to nitrocellulose and hybridize the immobilized RNA to radiolabelled probes. The gel was placed on top of two sheets of Whatman 3MM paper on a glass plate. The ends of the 3MM paper were submerged in a reservoir of 20X SSC. A sheet of nitrocellulose, slightly larger than the gel, was wet with distilled water, then soaked in 20X SSC for a few minutes before being placed on top of the gel. Two more pieces of 3MM were placed on top of the nitrocellulose, followed by a 6 cm stack of paper towels. Care was taken to ensure that neither the paper towels nor the 3MM paper beneath them touched either the gel or the 3MM wick at the base of the stack. A glass plate and a mass of a few hundred grams was placed on top of the assemblage, and transfer was allowed to proceed for about 16 hours. The nitrocellulose filter was then air-dried briefly and baked under vacuum at 80° for 2 hours. Prehybridization/Hybridization Nitrocellulose filters with bound RNA were prehybridized for 4-16 hours at 42° in sealed plastic bags containing 10 ml of a mixture of 50% formamide, 5X SSC, IX Denhardt's solution (0.02% Ficoll, 0.02% -180-polyvinylpyrrolidone, 0.02% BSA), 50 mM (NC1H2PO4 + Na2HPC>4) pH 7.0 and denatured, sheared salmon sperm DNA (250 pg/ml). The prehybridization mixture was then removed and replaced with a hybridization mixture containing a radioactively-labelled DNA probe. The hybridization mixture had a total volume of 6-10 ml and was composed of four parts of prehybridization mixture and one part of 50% dextran sulfate. The probe was denatured by heating in a boiling water bath for 5-10 minutes and chilling in ice-water before adding it to the hybridization mixture. Hybridization proceeded for 16-24 hours at 42°, after which the filter was washed at room temperature in four changes of 2X SSC, 0.1% SDS, for five minutes each. After being washed at 50° in two changes of 0.1X SSC, 0.1% SDS for 15 minutes each, the filter was subjected to autoradiography. Radioactive Labelling of a CYCl Hybridization Probe The hybridization probe used for analysis of CYCl transcripts was the 600 bp EcoRI-Hindlll fragment of pYeCYCl(2.5), which was purified from LMP agarose and end-labelled with DNA polymerase I (Klenow fragment). About 0.2 pg of DNA was incubated in 10 yul of Hin buffer with 1 u of Klenow fragment and 20-30 /iCi of a[32P]dATP for 30 minutes at room temperature. The mixture was then passed over a 1.5 ml column of Sephadex G-100 to remove unincorporated nucleotides. Radioactivity eluting in the void volume was collected and used as a hybridization probe after denaturation. QUANTITATIVE ASSAY of ft-GALACTOSIDASE in YEAST TRANSFORMANTS Assays of -^galactosidase activity were carried out as described by Ruby et a .^ (1983). Strains to be assayed were grown to saturation at 30° in 3 - 5 ml of appropriate selective media (SC-Trp for strains -181-bearing TRP1+ plasmids; SC-Uracil for strains bearing URA3+ plasmids; SC for untransformed strains). A 2 ml aliquot of each saturated culture was diluted with 8 ml of fresh medium, and the culture was incubated at 30° for 4-6 hours to allow the population to complete about two doublings. The culture was then chilled in ice water, and the cells from a sample of 4-8 ml were harvested by centrifugation (5,000 rpm, 5', 4°, SS-34). The supernatant was removed by aspiration, and the cell pellet was resuspended in 0.4 ml of 50 mM potassium phosphate, pH 7. An equal volume of Z buffer (60 mM Na2HP04, 40 mM NaH^ PO^ , 10 mM KC1, 1 mM MgS04, 40 mM -^mercaptoethanol) containing 0.025% SDS and 1 mM PMSF was then added. The tube was vortexed for 5 seconds and left at room temperature for 10 minutes, after which 2 drops of chloroform were added. The tube was vortexed hard for 5 seconds and incubated at 30° for 10 minutes, and the reaction was started by adding 0.2 ml of a solution of ONPG (4 mg/ml in 0.1 M potassium phosphate, pH 7), vortexing for 2 seconds, and continuing to incubate at 30°. The release of o-nitrophenol was linearly related to the time of incubation for at least two hours as long as the tube was agitated during the incubation, whether continually in a shaking water bath or by vortexing for 5 seconds at 10-minute intervals. The assay was stopped at a convenient time by adding 0.5 ml of 1 M Na2C03- Cell debris was pelleted by brief centrifugation (5,000 rpm, 5', SS-34 or SA600) and the absorbance at 420 nm of the supernatant or a suitably diluted aliquot was measured. Assays were always performed on 2-4 independent cultures of a given strain in an experiment. The levels of -^galactosidase measured in duplicate samples of a single culture were identical to within 5%, but -182-the levels measured in independent cultures of the same strain, or in samples removed at different times during the exponential growth of one culture, varied by up to 20%. ^ -galactosidase activity in a culture was calculated using the expression: ^ -gal Activity = 1,000 A420 units/ml, where Aeoo v r -A420 = absorbance at 420 nm of the assay supernatant; Aggo = absorbance at 600 nm of the yeast culture at the time it was sampled for assay; V = volume in ml of the sample, and t = time, in minutes, between the addition of ONPG and the addition of Na2CC>3 to the assay mix. The A^QQ was directly proportional to the cell number as determined by plating, up to an AgQO of 1.0. At higher values of AgQO' 6^00 underestimated cell number. The AgoO °f cultures used for 6-galactosidase assay was between 0.5 and 0.8. -183-RESULTS and DISCUSSION The CYCl 3- End Signal Resides Within 300 bp Downstream of the Coding  Sequence Yeast strain GM-3C-2, constructed by G. Faye, produces no functional cytochrome c whatsoever (Faye et al_. ,1981). It carries both the cycl-1 deletion, which completely removes the gene encoding iso-1-cytochrome c, (Sherman et al., 1975) and a nonsense mutation in CYC7, which leads to the production of an inactive fragment of iso-2-cytochrome c. As a result, the strain is able to grow only on media containing a fermentable carbon source. A second consequence of the cycl-1 deletion is that total RNA isolated from strain GM-3C-2 does not hybridize to a radioactively labelled fragment of the CYCl coding region when hybridization and washing are carried out as described in Materials and Methods. (See Figure 14.) The CYC1+ gene normally resides on a 2.5 kb BamHI/Hindlll fragment of yeast chromosome "x, as shown in Figure 15. This fragment may be cloned in an autonomously replicating plasmid such as YEpl3, to produce YEpl3CYCl(2.5), and introduced into strain GM-3C-2 by transformation. The transformants are capable of normal growth on glycerol or lactate, indicating that sequences on the recombinant plasmid complement the cytochrome c deficiency of the parental yeast strain. Figure 14 illustrates the hybridization of a radioactively labelled CYCl probe to RNA isolated from strain GM-3C-2, from a transformant of GM-3C-2 carrying the plasmid YEpl3CYCl(2.5), and from a strain carrying -184-I 2 3 I i Figure 14. Hybridization of a CYCl Probe to Total Yeast RNA. Total yeast RNA was denatured with glyoxal and DMSO as described in Chapter II and was then electrophoresed through a 1% agarose gel. After electrophoresis, the RNA was transferred to nitrocellulose and probed with a 32P-labelled 600 bp EcoRI/Hindlll fragment which included most of the CYCl coding sequence (see Figure 15). The probe was end-labelled with «[32p]cJATP using the Klenow fragment of DNA polymerase I, as described in Chapter II. Each lane contained 15 ;ug of RNA. The RNA in lane 1 was from D311-3A (CYC1+), that in lane 2 was from strain GM-3C-2 (cycl-1), and that in lane 3 was from a transformant of GM-3C-2 carrying plasmid YEpl3CYCl(2.5). (See Figure 15 for a map of the plasmid.) -185-Figure 15. A. Restriction Map of CYCl and Flanking Regions The map is from the sequence data of Smith et al_. (1979) and D.W. Leung and M. Smith (unpublished results). Recognition sites for restriction endonucleases are labelled as follows: B, BamHI; E, EcoRI; H, Hindlll; K, Kpnl; S, Sail; Sm, Smal; X, Xhol. The CYCl coding sequence is indicated by cross-hatching. The wavy line represents the CYCl transcript, with (A)n denoting the poly(A) tail. The transcript initiates heterogeneously, 10-150 nucleotides upstream of the coding sequence (McNeil and Smith, 1985). Its 3' end is located 172-175 nucleotides downstream of the coding sequence (Boss et al., 1981). B. Structure of YEpl3CYCl(2.5). The CYCl coding sequence is cross-hatched. Stippling is used to denote sequences from the yeast plasmid, 2/j circle. The single line represents pBR322, and the open box represents a region of yeast chromosome III carrying the LEU2+ gene. The filled circle indicates the normal 3' end site of CYCl transcripts, and the open circle represents the approximate position of the 3' end site of the transcripts of a 2ja circle gene called FLP [Broach et al_. (1979) ]. Restriction sites are labelled as in A, with the addition that P represents a PstI recognition site. -186--187-the "wild-type" chrcmoscmal CYCl gene. While no hybridization to the RNA of GM-3C-2 can be detected, both of the other strains produce an RNA of about 650 nucleotides which is detected by the CYCl probe. This species is polyadenylated, although the proportion which binds to oligo(dT)-cellulose in 0.1 M NaCl nay be as low as 50%, (not shown) presumably because of the short length of poly(A) sequences in yeast (Groner et al.,1974). The 650 nucleotide species must represent the CYCl mRNA. Other estimates of the length of the CYCl mRNA in wild-type yeast range from 630-700 nucleotides (Faye et al_. ,1981; Boss et al.,1980,1981; Zaret and Sherman, 1982). Faye et al. (1981) and McNeil and Smith (1985) have shown that the mRNAs transcribed from the CYCl gene on the plasmid YEpl3CYCl(2.5) have the same distribution of 5' ends as those produced from a single chromosomal copy of the gene. Since the plasmid and chromosome-derived CYCl transcripts, are indistinguishable in length, their 3' ends must also be generated at nearby, if not identical, sites. Boss et al.,(1981) have shown that CYCl mRNA in a "wild-type" yeast strain is polyadenylated at a site 172-175 nucleotides downstream of the coding sequence. Utilization of the same 3' end site in transcripts of the plasmid-borne CYCl gene indicates that the 2.5 kb BamHI/Hindlll fragment contains all of the sequences which are necessary for use of the normal CYCl mRNA 3' end site. These sequences are collectively referred to as the CYCl 3' end signal. A distinction is made in this work between the 3' end signal as a functional element determining where 3' end generation takes place, and the 3' end site as the position at which 3' end generation occurs. The nucleotide sequence at the 3' end site may or may not be an important component of the 3' end signal. -188-Deletion of the 3' End Signal Causes the Synthesis of Extended  Transcripts G. Faye provided two plasmids which were useful in preliminary experiments for designing the approach used in identifying the CYCl 3' end signal. The two plasmids, 2H26 and 4H40, differed from YEpl3CYCl(2.5) only in carrying deletions extending from the Hindlll site downstream of CYCl toward the gene for different distances. The exact deletion endpoint of each plasmid was determined by subjecting a fragment of each plasmid, end-labelled at the Hindlll site, to the chemical sequencing procedure of Maxam and Gilbert (1977; 1980). Plasmid 2H26 retained 179 bp of the normal CYCl 3' untranslated and flanking sequences, while 4H40 carried a deletion that extended 65 bp further upstream, to within 114 bp of the coding sequence. The two plasmids were used to transform GM-3C-2 to leucine prototrophy, and RNA isolated from the transformants was resolved by gel electrophoresis, transferred to nitrocellulose, and hybridized with a labelled CYCl probe. The result is shown in Figure 16. Transformants carrying plasmid 2H26 produced, in addition to the normal 650 nucleotide CYCl mRNA, low levels of an extended transcript, about 1,100 nucleotides long. Transformants bearing plasmid 4H40, in contrast, produced only extended transcripts of about 1,100 and 1,300 nucleotides. Transformants of both types were capable of growth on plates containing glycerol or lactate as principal carbon source, indicating that the extended transcripts were functional CYCl mRNAs. The extended transcripts might differ from the normal CYCl mRNA with respect to the positions of their 5' ends or 3' ends or both. However, Faye et al. (1981) and McNeil and Smith (1985) have shown that the -189-I 2 1 I 3 X 1175 _ 404 - 327 Figure 16. Hybridization of a CYCl Probe to RNA from Strains Bearing Deletions Distal to CYCl Total yeast RNA was denatured with glyoxal and DMSO and electrophoresed through a 1% agarose gel. The RNA was transferred from the gel to a nitrocellulose filter, which was then probed with a [32P]-labelled 600 bp EcoRI/Hindlll fragment including most of the CYCl coding sequence (see Figure 15). The probe was end-label led with cX[32P]dATP and the Klenow fragment of DNA polymerase I. The filter was washed and autoradiographed as described in Chapter II. Each lane contains 15 jag of RNA. Lane 1, RNA from GM-3C-2/YEpl3CYCl (2.5); lane 2, RNA from GM-3C-2/2H26; lane 3, RNA from GM-3C-2/4H40. Other lanes contained RNA from transformants of GM-3C-2 carrying plasmids with more extensive deletions of CYCl sequences than plasmid 4H40. They are not relevant to this study. Numbers in the right-hand margin indicate the sizes (in bp) and positions of fragments produced by TaqI digestion of X174 RF DNA. These fragments were end-labelled with cx[ 3 2p]dcTp using Klenow fragment. They were subsequently denatured in exactly the same way as the RNA samples and electrophoresed in the same gel. -190-positions of the normal 5' ends of CYCl mRNA depend on sequences located 20-150 bp upstream of the gene, and Guarente and co-workers have shown that a fusion of the CYCl promoter to lacZ or LEU2 coding and 5'-untranslated sequences have the same 5' end distribution as normal CYCl transcripts (Guarente and Mason, 1983; Guarente et al.,1984). Since the deletions in 4H40 and 2H26 remove only 3' untranslated and flanking sequences, it is unlikely that they would affect the 5' end distribution of the CYCl transcripts. Although the transcript ends were not mapped in this study, it is reasonable to conclude that the extended, 1,000 nucleotide transcript produced from 4H40 and 2H26 extends about 500 nucleotides beyond the 3' end site of the normal CYCl mRNA. The 3' end of the extended transcript therefore lies in the 2/& circle sequences of the plasmid, in a region known to correspond to the 3' end site of the FLP transcript of the intact 2/U circle. (Broach et al_. ,1979). The extended CYCl transcripts approach the FLP 3' end site from the same direction as the normal FLP transcript. It appeared from these results that disruption of the normal CYCl 3' end signal caused transcription to extend beyond the position corresponding to the normal 3' end site. Zaret and Sherman (1982) also noted the synthesis of 3'-extended CYCl transcripts from the cycl-512 allele, which carries a deletion of sequences normally found downstream of the gene. Most of the CYCl mRNA in 2H26 transformants of GM-3C-2 is of normal size, which suggest that the normal CYCl 3' end site was used quite efficiently in these cells and that the 3' end signal remained functional. The presence of low levels of extended transcripts suggested a slight reduction in the "strength" of the 3' end signal, -191-perhaps caused by the encroachment of the deletion in 2H26 into sequences at the downstream boundary of the signal. Since the CYCl-proximal deletion endpoint was within 5 bp of the CYCl 3' end site, it seemed at this stage that sequences at the 3' end site might form part of the 3' end signal. Mapping the Boundaries of the CYCl 3' End Signal An effort was made to localize the boundaries of the CYCl 3' end signal by means of an approach first used to systematically, define the boundaries of the promoter regions of the Xenopus 5S RNA genes (Sakonju et al. ,1980; Bogenhagen et al_. ,1980) and the Herpesvirus tk gene (McKnight et al.,1981). Two sets of nested deletions were introduced into the 2.5 kb CYCl BamHI/Hindlll fragment, and their effects on CYCl transcription were studied after introducing the modified fragments into yeast on high copy number plasmids. The two sets of deletions extended into the 3' untranslated region of the CYCl gene from opposite directions, all the members of one set sharing a common endpoint either upstream or downstream of the region of interest. Deletions in the CYC1AH5' series were used to identify the downstream boundary of the 3' end signal. They were like the deletions in plasmids 4H40 and 2H26 in that they extended toward the CYCl coding sequence for varying distances from the Hindlll site 275 bp downstream. Deletions in the CYC1AK3' series extended toward the Hindlll site for varying distances from the Kpnl site within the CYCl coding sequence. They served to identify the upstream boundary of the 3' end signal. Figure 17 illustrates the relationship of the two sets of deletions to each other and to the intact CYCl gene. The construction of both sets of deletion derivatives of the 2.5 kb CYCl fragment is described in detail in -192-D E L E T I O N A N A L Y S I S OF THE C Y C l 3' E N D SIGNAL AH5 ' SERIES 3 3 0 A K 3 ' S E R I E S 551 518 4 9 7 ' 4 6 4 4 6 0 4 5 8 4 4 3 2 4 9 3 3 0 35T 366 4 0 7 4 2 9 44"5~ 4 9 7 H =zl 6 0 6 F i g u r e 17. Endpo in ts of the CYC1AH5" and CYC1AK3' D e l e t i o n s The CYCl cod ing sequence i s s t i p p l e d . The endpoint of each d e l e t i o n i s i n d i c a t e d , t a k i n g the A o f t he CYCl i n i t i a t i o n codon as +1. The normal CYCl t r a n s c r i p t 3 ' end s i t e spans p o s i t i o n s +502-504, and i t i s i n d i c a t e d by t h e f i l l e d c i r c l e . - 1 9 3 -Chapter II. Selected derivatives in each set were transferred to YEpl3 as BamHI/Hindlll fragments, and the resulting YBpl3CYClAH5" and YEpl3CYClAK3' plasmids were used to transform GM-3C-2, selecting for LEU2+ transformants. The hybridization of a CYCl probe to RNA isolated from YEpl3CYClAH5' transformants of GM-3C-2 is illustrated in Figure 18. Deletions extending as far upstream as position +518 apparently do not interfere with the utilization of the normal CYCl 3' end site, since the only transcript detected by a CYCl probe in cells carrying such deletions in a plasmid-borne copy of CYCl is of normal size. The CYCl-proximal deletion endpoint in the YEpl3CYClAH5"(+497) plasmid is 21 bp further upstream, and in cells carrying this plasmid, an extended transcript about 500 nucleotides longer than the normal transcript is i i present at low levels, along with much higher levels of the normal CYCl transcript. This result is similar to that obtained with RNA from 2H26 . transformants (Figure 16). The difference is that the CYCl-proximal deletion endpoint is 12 bp further upstream in YEpl3CYClAH5'(+497) than in 2H26, with the result that the former plasmid lacks the sequence of the normal CYCl 3' end site (positions +502-505). The efficient production of a normal CYCl transcript from YEpl3CYClAH5"(+497) suggests that the 3' end signal remains functional in the absence of the normal 3' end site. The signal must cause 3' end generation at an approximately equivalent position in sequences flanking the CYC1AH5'(+497) deletion. The normal sequence of the CYCl 3' end site does not appear to be an important part of the 3' end signal, although the production of a low level of extended transcripts from both the CYC1AH5" (+497) and 2H26 templates suggests that sequences in the -194-*0 Qo O) O Xh \ Xfi Xh Xh Xh Xh Xh <0 <0 * * * * * * * * I I I I I I I I I Figure 18. Hybridization of a CYCl Probe to RNA from Transformants of GM-3C-2 Carrying CYC1AH5' Genes. Total yeast RNA was denatured with formaldehyde and electrophoresed through a 1% agarose gel. The RNA was transferred from the gel to nitrocellulose and was subsequently hybridized to a [32P]-labelled CYCl probe. The probe was made by copying the single-stranded DNA of mp8CYCl(2.5) using oligonucleotide FPl (Table I) as a primer, tx[32P]dATP, unlabelled dCTP, dGTP and dTTP, and the Klenow fragment of DNA polymerase I. Each marked lane contained 20 ug of RNA. The lane marked WT contained RNA from a transformant of GM-3C-2 carrying plasmid YEpl3CYCl(2.5). The other lanes contained RNA from transformants of GM-3C-2 carrying various YEpl3CYCl £H5' plasmids. The CYC14H5' deletion in each plasmid extended from the Hindlll site at position +605 to the position indicated at the top of the lane. -195-vicinity of the 3' end site nay play a minor role in making the 3' end signal maximally efficient. Figure 18 shows that a deletion extending from the Hindlll site to a position 35 bp or more upstream of position +497 completely abolishes the activity of the 3' end signal. The extended CYCl transcript is the only one detectable in cells carrying YEpl3CYClAH5" plasmids with CYCl-proximal deletion endpoints at position +464, or further upstream. From these results it may be concluded that one boundary of the functional CYCl 3' end signal lies between positions +464 and +497. Figure 19 illustrates the hybridization of a CYCl probe to RNA isolated from transformants of GM-3C-2 carrying various YEpl3CYC1AK3' plasmids. The deletions in these plasmids removed sequences which are normally part of the CYCl transcription unit. Those deletions which did not interfere with CYCl mRNA 3' end generation were therefore expected to cause the length of the mRNA to be reduced by an amount equal to the length of the deleted sequences. Those deletions which disrupted the 3' end signal were again expected to cause the extension of CYCl transcripts into 2/i circle sequences on the plasmid. Deletions extending downstream from the Kpnl site in CYCl as far as position +449 apparently have little effect on the CYCl 3' end signal because the predominant CYCl transcript detected in cells carrying CYC1AK3' derivatives with such deletions is slightly shorter than the normal CYCl mRNA. The length difference in each case is approximately equal to the extent of the deletion. Very low levels of an extended transcript are produced from CYC1AK3" templates with deletions extending as far as position +390. Deletions extending to positions +407 or +429 cause a slight increase in the level of the extended transcripts, which still account for only -196-I J J ^ ^ to O /V» O) O) ^ ^ /0 / ? Co P) o <V ^ \ Q) * * * * * * * * * i l I i i i I I i l . 9 \ I 6 > \ 1.3 0 . 9 8 0 . 8 3 0 . 5 6 r Figure 19. Hybridization of CYCl Probe to RNA from GM-3C-2 Transformants Carrying CYC1AK3' Genes. Total yeast RNA was denatured with glyoxal and DMSO and was then electrophoresed through a 1% agarose gel. The RNA was transferred from the gel to a nitrocellulose filter. The filter was incubated with a 32P-labelled CYCl probe, washed, and autoradiographed. The hybridization probe was the 600 base pair EcoRI-Hindlll fragment of CYCl, end-label led with 0([32p]aM>p and the Klenow fragment of DNA polymerase I. Each marked lane contained 15 pg of RNA. The lane marked WT contained RNA from a GM-3C-2 transformant carrying plasmid YEpl3CYCK2.5). The other lanes contained RNA from GM-3C-2 transformants carrying YEpl3CYCl AK3' plasmids. A given plasmid carried a deletion extending from the Kpnl site at position +247 in the CYCl coding sequence to the position indicated at the top of the lane. -197-a small fraction of the RNA detected by a CYCl probe. The CYC1AK3" (+449) derivative directs the production of a shortened CYCl transcript, but no extended transcript is observed. This may mean that the 3' end signal in the CYC1AK3" (+449) mutant is actually more efficient than in AK3' mutants with shorter deletions. A more plausible interpretation is that the extended transcript does not accumulate to detectable levels in the CYC1AK3'(+449) mutant because its stability is lower than that of the extended transcripts produced by mutants with shorter deletions. A gradual drop in the level of the shortened transcript with increasing deletion length is evident in cells carrying the CYClAK3'(+390), CYClAK3y(+407) and CYC1AK3'(+429) genes, with quite a marked drop in transformants bearing the CYC1&K3"(+449) gene. This observation may indicate that sequences upstream of position +449 influence the stability of CYCl transcripts. Other explanations, some of them trivial, cannot be excluded at present. For example, the probe used in this study may have detected shorter transcripts less efficiently than full-length transcripts, because the length of the region of complementarity between probe and transcript decreased with transcript length. The important point for the purposes of this study is that CYC1AK3' derivatives with deletion endpoints as far downstream as position +449 appeared to retain a functional CYCl 3' end signal. The synthesis of small quantities of extended CYCl transcripts from templates with shorter AK3' deletions was interpreted to mean that the context of the 3' end signal could influence its efficiency without preventing it from functioning altogether. -198-The extension of a AK3' deletion as far as position +474 prevents the utilization of the normal CYCl mRNA 3' end site. Only extended transcripts are evident in cells carrying the CYC1AK3'(+474) or CYC1AK3'(+497) genes. This suggests that the deletion of sequences between positions +449 and +474 inactivates the CYCl 3' end signal. Analysis of the CYCl transcripts produced from CYC1AH5' and CYC1AK3' templates (Figures 18,19) allows the functional boundaries of the CYCl 3' end signal to be mapped: one lies between positions +449 and +474, and another maps between positions +464 and +497. Sequences within these boundary regions are essential to CYCl 3' end signal function and are illustrated in Figure 20. Sequences flanking the boundaries appear to have minor effects on the efficiency of 3' end generation at the normal CYCl 3' end site. However, it would be premature to conclude that the 49 bp region within the boundaries constitutes or includes an autonomous functional element capable of causing 3' end generation in any context. Each of its boundaries was defined by deletions which removed only sequences flanking that boundary, while the other boundary and its flanking sequences remained intact. It is possible that some general feature of sequences on both sides of the 49 bp region or a sequence repeated on either side of this region is required for 3' end generation. This requirement might not become evident until the normal flanking sequences from both sides of the 49 bp region were replaced by other sequences. Point Mutations Within the 3' End Signal Region of the Intact CYCl Gene Definition of the boundaries of the CYCl 3' end signal allows the question of the specific sequence requirements of transcript 3' end - 1 9 9 -Figure 20. Sequence of the CYCi 3' End Signal and Flanking Regions A. The CYCl coding sequence and its immediate flanking regions are shown (Smith et al. ,1979). The 3' end signal region, as defined by the CYC1AH5" and CYC1AK3' deletions, is bracketed. The filled circle indicates the most 5' site of polyadenylation of CYCl transcripts as reported by Boss et al. (1981). Because there are three consecutive A/T base pairs at positions +503-505, polyadenylation at any of these positions would produce the same mature transcript. B. The 3' end signal region of CYCl is shown. Only the mRNA-parallel strand of the DNA sequence is presented. The sequence alterations introduced by the GG462, C482, GT473, and C474 mutations are indicated. -200-A. , S a w I j CCCGGGAGCAAGATCAAGATGTTTTCACCGATCTT TCCGGT C TCTT TGGCCGGGGT T T ACGGACGATGACCGAAGACCAAGCGCCAGCTCAT T TGGCGAGCGT TGGT 1 GGTGGA t CAAGC . , GGGCCCTCGTTCT ACT T C T ACAAAAGTGGCT AGAAAGGCCAGAGAAACCGGCCCCAAATGCCTGCT A C T G G C 1 TCTGGH CGCGGTCGAGTAAACCGCTCGCAACCAACCACC T A G 1 TCG ; - 3 8 0 - 3 6 0 - 3 4 0 - 3 2 0 - 3 0 0 - 2 8 0 t Xhol CCACGCGTAGGCAATCCTCGAGCAGATCCGCCAGGCGTGTATATAGCGTGGA tGGCCAGGCAACTTTAGTGCTGACACATACAGGCATATAT ATATGTGTGCGACGACACATGATCATAT , i GGTGCGCATCCGTTAGGAGCTCGTCTAGGCGGTCCGCACATATATCGCACCTACCGGTCCGTTGAAATCACGACTGTGTATGTCCGTArATATATACACACGCTGCTGTGTACTAGTATA , , - 2 G 0 - 2 4 0 - 2 2 0 - 2 0 0 - 1 8 0 - 1 6 0 G G C A T G C A T G T G C T C T G T A T G T A T A T A A A A C T C T T G T T T T C T T C T T T T C T C T A A A T A T T C T T T C C T T A T A C A T T A G G T C C T T T G T A G C A T A A A T T A C T A T A C T T C T A T A G A C A C G C A A A C -T C C G T A C G T A C A C G A G A C A T A C A T A T A T T T T G A G A A C A A A A G A A G A A A A G A G A T T T A T A A G A A A G G A A T A T G T A A T C C A G G A A A C A T C G T A T T T A A T G A T A T G A A G A T A T C T G T G C G T T TG - ' 4 0 - 1 2 0 - 1 0 0 - 8 0 - 6 0 - 4 0 ' M T E F K A G S A K K G A T L F K T R C L Q C H T V E K G G P H EcoRI A C A A A T A C A C A C A C T A A A T T A A T A A T G A C T G A A T T C A A G G C C G G T T C T G C T A A G A A A G G T G C T A C A C T T T T C A A G A C T A G A T G T C T A C A A T G C C A C A C C G T G G A A A A G G G T G G C C C A C A T | T G T T T A T G T G T G T G A T T T A A T T A T T A C T G A C T T A A G T T C C G G C C A A G A C G A T T C T T T C C A C G A T G T G A A A A G T T C T G A T C T A C A G A T G T T A C G G T G T G G C A C C T T T T C C C A C C G G G T G T A - 2 0 + 1 2 0 4 0 G O 8 0 ; K V G P N L H G I F G R H S G Q A E G V S V T D A N I K K N V L W D E N N M S E ' ' A A G G T T G G T C C A A A C T T G C A T G G T A T C T T T G G C A G A C A C T C T G G T C A A G C T G A A G G G T A T T C G T A C A C A G A T G C C A A T A T C A A G A A A A A C G T G T T G T G G G A C G A A A A T A A C A T G T C A G A G , T T C C A A C C A G G T T T G A A C G T A C C A T A G A A A C C G T C T G T G A G A C C A G T T C G A C T T C C C A T A A G C A T G T G T C T A C G G T T A T A G T T C T T T T T G C A C A A C A C C C T G C T T T T A T T G T A C A G T C T C 1 0 0 1 2 0 1 4 0 1 6 0 1 8 0 2 0 0 | Y L T N P K K V I P G T K M A F G G L K K E K D R N D L I T Y L K K A C E • I Kpnl | T A C T T G A C T A A C C C A A A G A A A T A T A T T C C T G G T A C C A A G A T G G C C T T T G G T G G G T T G A A G A A G G A A A A A G A C A G A A A C G A C T T A A T T A C C T A C T T G A A A A A A G C C T G T G A G T A A A C A G G C | A T G A A C T G A T T G G G T T T C T T T A T A T A A G G A C C A T G G T T C T A C C G G A A A C C A C C C A A C T T C T T C C T T T T T C T G T C T T T G C 1 G A A T T A A T G G A T G A A C T T T T T T C G G A C A C T C A T 1 1 Gl C C G 2 2 0 2 4 0 2 6 0 2 8 0 3 0 0 3 2 0 C C C T T T T C C T T T G T C G A T A T C A T G T A A T T A G T T A T G T C A C G C T T A C A T T C A C G C C C 1 C C C C C C A C A T C C G C T C T A A C C G A A A A G G A A G G A G T T A G A C A A C C T G A A G T C T AGGJT C C C T A T T G G G A A A A G G A A A C A G C T A T A G T A C A T T A A T C A A T A C A G T G C G A A T G T A A G T G C G G G A G G G G G G T G r A G G C G A G A T T G G C T T T T C C T T C C T C A A T C T G T T G G A C T T C A G A T C C B G G G A T A A , 3 1 0 3 6 0 3 8 0 4 0 0 4 2 0 4 4 0 T A T T T T T T T A T A G T T ^ ^ G _ T T A G T A T T A A G A A C G T T A T T T A T |AT T T C A A A T T T T T C T T T T T T T T C T G T A C A G A C G C G T G T A C G C A T G T A A C A T T A T A C T G A A A A C C T T G C T T G A G A A G G T T A T A A A A A A A T A T C A A T A C A A T C A T A A T T C T T G C A A T A A A T A J T A A A G T T T A A A A A G A A A A A A A A G A C A T G T C T G C G C A C A T G C G T A C A T T G T A A T A T G A C T T T T G G A A C G A A C T C T T C C A A 4 6 0 4 8 0 5 0 0 5 2 0 5 4 0 5 6 0 H1ndlI I T T G G G A C G C T C G A A G G C T T T A A T T T G C A A G C T T A A C C C T G C G A G C T T C C G A A A T T A A A C G T T C G A A 5 8 0 6 0 0 B - (GG462) (GT473) (C482) GG GT C M t t t 5 - T C C C T A T T T A T T T T T T T A T A G T T A T G T T A G T A T T A A G A A C G T T A T T T A T - 3 i C (C474) 450 4 6 0 470 480 4 9 0 -201-generation in yeast to be approached. As discussed earlier the sequence AATAAA had been shown to be required for polyadenylation in higher eucaryotes (Fitzgerald and Shenk, 1981, and references cited in Chapter I). It was therefore worth testing the importance of any analogous sequences in the CYCl 3' end signal. The closest such analog to be found is the sequence ATTAA, at positions +480 to +484. Accordingly, the C482 mutation, which altered this sequence to ATCAA, was introduced into the 3' end signal using a mutagenic oligonucleotide as described by Zoller and Smith (1982;1983). (The procedure is described in Chapter I, and the sequence of the oligonucleotide used, oAS2, is given in Table I.) A striking feature of the 3' end signal region and its neighbouring r sequences is its high content of adenine:thymine base pairs. A tract of seven consecutive T/A base pairs is present at positions +459 to +465, and in light of the importance of 3'-terminal uridylate tracts in transcript termination by bacterial RNA polymerase and by eucaryotic RNA polymerases I and III, it was reasonable to suspect that this tract of T/A base pairs might be involved in 3' end generation. The GG462 mutation was introduced by means of a mutagenic oligonucleotide, oASl (Table I), in order to disrupt the T/A tract. The mutation replaced the T/A base pairs at positions +462 and +463 with G/C base pairs. The 3' end signal sequences created by the GG462 and C482 mutations are noted in Figure 20. Both mutations were cloned into plasmid YEpl3 as part of the 2.5 kb BamHI-Hindlll fragment and introduced into yeast strain GM-3C-2, selecting for LEU2+ transformants. RNA isolated from both types of transformant was probed for CYCl sequences after electrophoresis and -202-transfer to nitrocellulose, and the result is shown in Figure 21. The C482 mutation had no detectable effect on 3' end generation in CYCl transcripts inasmuch as no transcript other than the normal 650 nucleotide species was evident.Small changes in the exact location of transcript 3' termini would not have been detected by this type of analysis. Transformants carrying the CYC1GG462 allele synthesized, in addition to the normal CYCl transcript, small amounts of an 1100 nucleotide transcript, indicating that the GG462 mutation reduced the efficiency of 3' end generation at the normal 3' end site. The extended transcript accumulated to less than one-tenth the level of the normal mRNA, which suggests that unless the stability of the two transcripts differed markedly, the altered 3' end signal remained more than 90% efficient. A derivative of YEpl3CYCl(2.5) was constructed in which the CYCl 3' end signal contained both the GG462 and C482 mutations, and RNA isolated from yeast transformants carrying this plasmid was also probed for CYCl sequences. The results, shown in Figure 21, suggest that the presence of both mutations may cause a modest increase in the relative level of the extended CYCl transcript. That a mutation such as C482, which by itself does not alter the efficiency of 3' end generation, can augment the effect of another mutation, such as GG462, suggests there might be some redundancy in the functionally important elements of the 3' end signal. If this is the case, then the mutational analysis of the 3' end signal might be simplified by restricting it to the smallest segment stil l capable of bringing about 3' end generation. The deletion analysis described earlier suggested that this segment would -203-G G 4 6 2 / W T G G 4 6 2 C 4 8 2 C 4 8 2 ^"^m a b c a b c a b c a b Figure 21. Hybridization of a CYCl probe to RNA from Yeast Strains with Point Mutations in the CYCl 3' End Signal. Yeast RNA was denatured with glyoxal and DMSO and electrophoresed through 1% agarose. The RNA was transferred from the gel to a nitrocellulose filter, which was subsequently incubated with a 32P-labelled CYCl hybridization probe, washed, and autoradiographed. The probe was the 600 base pair EcoRI-Hindlll CYCl fragment, end-labelled with e*[32P]dATP using the Klenow fragment of DNA polymerase I. Lanes marked "a" contained 15 yug of total yeast RNA. Those marked "b" contained RNA which bound to oligo(dT)-cellulose in 0.1 M NaCl, while those marked "c" contained RNA which failed to bind. The amount of RNA loaded in each lane "b" or "c" corresponded approximately to the amount of each fraction found in 15 yug of total RNA. Lanes marked WT contained RNA from GM-3C-2 transformants carrying plasmid YEpl3CYC1(2.5). Other lanes contained RNA from GM-3C-2 transformants carrying plasmid YEpl3CYClGG462, YEpl3CYClC482, or YEpl3CYClGG462C482, as indicated by the name of the mutation at the top of each group of lanes. -204-reside within the 49 bp region between positions +448 and +497. A Screening System for 3" End Signal Mutations The identification of the precise sequence requirements of the CYCl 3' end signal would be facilitated if there was a way of rapidly screening for mutants with defects in the 3' end signal. Such defects could not necessarily be expected to have any appreciable effect on CYCl expression, because it had already been shown that functional CYCl mRNA could be produced in the complete absence of the normal 3' end signal, at least if another 3' end signal was present some distance downstream. The fact that disruption of the normal 3' end signal caused the production of extended transcripts suggested that if some gene was placed downstream of the CYCl 3' end signal, its expression might be dependent upon the inactivation of the 3' end signal. The E. coll lacZ gene promised to be a suitable indicator for 3' end signal inactivation, because it can be expressed in yeast and its product, S-galactosidase, is easily assayed. S. cerevisiae produces no ^ -galactosidase of its own which might interfere with the assay for lacZ expression (Guarente and Ptashne,1981). If the expression of an indicator gene is to be an unambiguous measure of the efficiency of a transcriptional 3' end signal, the gene should be transcribed only as part of an extended mRNA from a promoter located upstream of the 3' end signal. Neither the efficiency of transcript initiation at the promoter, nor the efficiency of translation of the coding sequence of the indicator gene, should vary. The functional arrangement envisioned here, promoter-3' end signal-indicator gene, is of course analogous to that found in many bacterial biosynthetic operons (see Chapter I). It has been used quite -205-successfully to detect and study procaryotic terminators. Casadaban and Cohen (1980) demonstrated that transcription terminators in cloned bacterial DNA fragments could be detected by virtue of their ability to prevent lacZ expression when inserted between the gene and its promoter. A similar system using the tet gene instead of lacZ was described by Enger-Valk et al.(1981), and Rosenberg et a .^ (1983) were able to detect mutations interfering with transcript termination at a given terminator by selecting for increased expression of a galK gene located downstream of the terminator. More recently, Honigman et al. (1985) described a plasmid in which the lacZ or galK gene served as an indicator of terminator efficiency, while the cat gene provided an internal control for plasmid copy number. The success of this approach to studying prokaryotic terminators depends in part on the mechanism of translation initiation in procaryotes. Translation initiates at AUG triplets preceded by suitable ribosome binding sites, and the presence of other sequences upstream of these sites is not sufficient to prevent initiation. In yeast, as is usually true in other eucaryotes, translation of most mRNAs initiates at the AUG triplet closest to the 5' end of the message (Kozak, 1983a;1983b; Sherman and Stewart, 1981; Stiles et al.,1981). For this reason, mRNAs in eucaryotes, in contrast to those in procaryotes, are usually functionally monocistronic. [See Zitomer et al. (1984) for evidence of initiation at sites other than AUG triplets in yeast.] For lacZ, or any other gene, to serve as an indicator for the function of an upstream 3' end signal in yeast, it seemed likely to be important that no AUG triplets intervene between the 5' end of the extended lacZ message and the lacZ initiation codon. The type of -206-construct envisioned, and the consequences of inactivating the CYCl 3' end signal, are illustrated in Figure 22. The CYCl 3' end signal would be linked directly to the CYCl promoter upstream and to the lacZ coding sequence downstream. Inactivation of the 3' end signal would cause the production of an extended mRNA encoding ^ -galactosidase. The leader of the mRNA would include part of the normal CYCl leader sequence and the sequences of various defective 3' end signals. One AUG triplet is present in the 49 bp region within the functional boundaries of the 3' end signal, at positions +472 to +474 (see Figure 20). The scheme proposed in Figure 22 could only be useful if this AUG triplet could be eliminated without inactivating the 3' end signal. It seemed unlikely that any other feature of the 3' end signal, or any alteration which did not introduce an AUG triplet, would interfere with the translation of an extended lacZ mRNA. Comparisons of many eucaryotic mRNAs have revealed no other constraints on their leader sequences (Kozak, 1983b). Leaders ranging in length from 1-200 nucleotides are known, although very long leader sequences may reduce translation efficiency (Darveau et al., 1985). Zitomer et al. (1984) have recently shown that substantial alterations in the length and sequence of the 5" untranslated region of a CYCl:galK fusion have little or no effect on the levels of galactokinase produced in yeast, unless out-of-frame AUG triplets are introduced into the leader region by the alterations. Johansen et al_. (1984) made similar observations regarding the expression of galK in monkey and hamster cells. Because the leader sequence of a eucaryotic mRNA seems to have little influence on translation efficiency as long as it is free of AUG triplets, it was judged to be worthwhile to eliminate the single AUG triplet from the CYCl 3' end signal and, as long as this alteration did -207-P R O M O T E R 3 E N D S I G N A L l a c Z B . l a c Z " P R O M O T E R 3 E N D S I G N A L ( I N A C T I V E ) l a c Z Figure 22. Strategy for Screening for Mutations in the 3' End Signal of CYCl A. The CYCl 3' end signal is inserted between the CYCl promoter and the lacZ coding sequence. If the 3' end signal is functional, i t is expected to prevent expression of lacZ. B. Mutational inactivation of the 3' end signal is expected to allow lacZ expression. -208-not inactivate the 3' end signal, include the altered signal in the type of construct shown in Figure 22. Mutations could then be introduced into the 3' end signal at random and those which inactivated it detected through the consequent increase in lacZ expression. Mutagenesis of Positions +472 to +474 Within the CYCl 3' End Signal It was first necessary to test the effects of altering the 3' end signal sequence at positions +472 to +474. Oligonucleotides oAS3 and oAS4 (Table I) were used to produce two mutant 3" end signal regions, with the sequences AGT and ATC, respectively, at positions +472 to +474. The mutations are referred to as GT473 and C474, and they were created using the procedure of Zoller and Smith (1982; 1983) as described in Chapter II. Figure 20 shows the sequences of the mutant 3' end signal regions with the normal sequence of the region for comparison. Each mutation was introduced into the 2.5 kb BamHI-HindiII CYCl fragment, and the altered fragments were ligated separately into YEpl3 and introduced into yeast strain GM-3C-2, selecting LEU2+ transformants. Figure 23 illustrates the pattern of hybridization of a CYCl probe to RNA isolated from transformants carrying each type of plasmid. The transcripts of the CYC1GT473 and CYC1C474 alleles are identical in length to the transcript of the normal CYCl gene. This observation suggests that neither the GT473 nor the C474 mutation interferes with the function of the 3' end signal. It seemed feasible to use a 3' end signal carrying one of these mutations to construct a promoter 3' end signal:lacZ fusion plasmid which would provide a phenotypic indicator of 3' end signal function. Testing Various Promoter:3' End Signal:lacZ Fusion Plasmids The construction of promoter:3' end signal:lacZ fusion plasmids is -209-Figure 23. A. Sequence in the Vicinity of the GT473 and C474 Mutations, and the Corresponding Wild-Type Sequence. The wild-type CYCl 3' end signal region and its GT473 and C474 mutant derivatives were sequenced by the chain termination method of Sanger et al_. (1977a) after cloning in Ml3mp8 (Messing, 1983). From left to right, the sequencing channels in each case are C, T, A, G. The sequence displayed is that of the mRNA-antiparallel strand of the 3' end signal region, and consequently, the direction of reading (from bottom to top) is toward the CYCl coding sequence. The sequence at positions +474 to +472 is highlighted in each case for comparison. B. Hybridization of a CYCl Probe to RNA from GM-3C-2 Transformants Carrying the GT473 and C474 Mutations of the 3' End Signal. Total yeast RNA was denatured with formaldehyde and electrophoresed through a 1.4% agarose gel. The RNA was then blotted to nitrocellulose. The filter was incubated with a 32P-labelled CYCl probe, washed and autoradiographed, all as described in Chapter II. The probe was the 600 bp EcoRI-Hindlll fragment of CYCl, end-labelled with <X[32]dATP using the Klenow fragment of DNA polymerase I. Lanes M contained EcoRI-Hindlll fragments of * DNA which had been end-labelled with cX[32P]dATP using Klenow fragment, then denatured, electrophoresed and transferred in exactly the same way as the RNA samples. The positions to which these fragments migrated, and their sizes in kbp, are indicated at the right-hand side of the figure. The other lanes contained RNA from transformants of strain GM-3C-2 carrying plasmid YEpl3CYCl(2.5) (Lane ATG), plasmid YEpl3CYClGT473 (Lane AGT), or plasmid YEpl3CYClC474 (Lane ATC). -210-- 2 1 1 -described in detail in Chapter II and outlined in Figure 6. A CYCl promoter fragment completely lacking CYCl coding sequences was joined by means of a Kpnl linker to the upstream boundary of the CYCl 3' end signal at position +449. The C474 mutation was then introduced into the 3' end signal region using oligonucleotide oAS4. Sequences flanking the downstream boundary of the 3' end signal remained intact as far as the Hindlll site at this stage. Deletions extending from the Hindlll site toward the 3' end signal were produced, and to each deletion endpoint, a synthetic oligonucleotide duplex was ligated. The duplex consisted of oligonucleotides oAS5 and 0AS6 (Table I) and it had the following structure: oAS5 5' d(pTTAATAATGACTGG) 3' 0AS6 3' (AATTATTACTGACCTTAAp)d 5' The blunt end of the duplex was ligated to the resected 3' end signal fragments described above. The other end of the duplex could be ligated to fragment termini generated by EcoRI cleavage, which allowed the fused promoter:3' end signal:adapter fragments to be ligated into pEMBL9(+) as BamHI/EcoRI fragments. The deletion endpoints of several such fragments were determined by DNA sequencing. Figure 24 illustrates the deletion endpoints chosen for further study. The first set of promoter:3' end signal:lacZ fusion plasmids was constructed by joining the EcoRI termini of selected promoter:3' end signal:adapter fragments to the EcoRI terminus of a fragment of placZ. The fragment included all but the first 19 bp of the lacZ gene. The resulting plasmids also carried a fragment of yeast DNA including the TRPl gene and chromosomal replication origin, arsl, and they were referred to as the pA5s. (The map of a pA5 is shown in Figure 6.) -212-F i g u r e 24. D e l e t i o n Endpo in ts i n the pA4 P r o m o t e r : 3 ' End S i g n a l F u s i o n s , f o r use i n P r o m o t e r : 3 ' End S i g n a l : l a c 2 P l a s m i d s . The sequence shown extends from the Kpn l l i n k e r mark ing the p r o m o t e r : 3 ' end s i g n a l j u n c t i o n , th rough the 3 ' end s i g n a l r e g i o n t o t he ATG t r i p l e t o f the OAS5/6 adap te r . Sequences d e r i v e d f rom e i t h e r t he Kpn l l i n k e r o r the oAS5/6 adapter a r e u n d e r l i n e d . Sequences i d e n t i c a l t o t h a t of the w i l d - t y p e 3 ' end s i g n a l r e g i o n (except f o r t he C474 muta t ion) l i e between two v e r t i c a l l i n e s . - 2 1 3 -+ 4 5 0 +460 +470 +480 +490 +500 + 510 + 520 I I I I I I I 1 •12 C G G T A C ClG T C C C T A T T T A T T T T T T T A T A 6 T T A T C T T A G T A T T A A G A A C G T T A T T T A T A T T T C A A A T T T T T C T T T T T T T T C T l T T A A T A A T G . 20 C G G T A C ClG T C C C T A T T T A T T T T T T T A T A G T T A T C T T A G T A T T A A G A A C G T T A T T T A T A T T T C A A A T T T T T C T T T T T T T l A A T A A T G . . . •19 C G G T A C ClG T C C C T A T T T A T T T T T T T A T A G T T A T C T T A G T A T T A A G A A C G T T A T T T A T A T T T C A A A T TIA A T A A T G . . . 30 C G G T A C ClG T C C C T A T T T A T T T T T T T A T A G T T A T C T T A G T A T T A A G A A C G T T A T T T A T A T T T CIT T A A T A A T G . . . 7i c G G T A c CIG T C C C T A T T T A T T T T T T T A T A G T T A T C T T A G T A T T A A G A A C G T T A T T T AIA T A A T G... 50 C G G T A C ClG T C C C T A T T T A T T T T T T T A T A G T T A T C T T|T A A T A A T G... •II C G G T A C C I G T C C C T I T T A A T A A T G . . . •3 C G G T T A A T A A T G... Joining the promoter:3' end signal:adapter and lacZ fragments in this manner placed the ATG triplet in OAS5/6 (underlined in the structure given above) in the correct reading frame to serve as the initiation codon for translation of lacZ, should an extended lacZ mRNA be produced. Nucleotides adjacent to the ATG triplet of OAS5/6 matched those flanking the normal initiation codon of CYCl. It was hoped that for this reason, any extended mRNA produced from the pA5s would be translated about as readily as CYCl mRNA. Schweingruber et al_. (1981) demonstrated that mutational relocation of the AUG initiation codon of CYCl over a 37-nucleotide region had little effect on the expression of the gene. However, Kozak (1984a) has shown that nucleotides immediately flanking an AUG initiation codon can have some influence on the efficiency of initiation of translation at that oodon. The pA5 plasmids were used to transform yeast strain RP123 to tryptophan prototrophy. No -^galactosidase activity could be detected in any of the transformants after growth on XGAL plates for up to two weeks, or after quantitative assays of permeabilized cell suspensions. Transformants of the same strain carrying plasmid pLG669Z (Guarente and Ptashne, 1981) provided a positive control for the -^galactosidase assays: such transformants turned blue after overnight growth on XGAL plates, and quantitative assays detected 30 units of $-galactosidase per ml per O D g g o i n exponentially growing cultures. The complete absence of -^galactosidase from any of the pA5 transformants apparently had nothing to do with the presence of the CYCl 3' end signal. Plasmid pA5.3 lacked the 3' end signal completely, retaining only 2 bp of a Kpnl linker between the promoter and oAS5/6, and plasmid pA5.11 had only a 6 bp fragment of the 3' end signal. -215-Dur ing growth i n t he absence o f t r yp tophan , o n l y 1-20% o f the c e l l s i n a p o p u l a t i o n d e r i v e d from a pA5 t rans formant a c t u a l l y c a r r i e d the p l a s m i d . P lasmids w i t h chromosomal r e p l i c a t i o n o r i g i n s f r e q u e n t l y segregate w i t h the mother c e l l d u r i n g m i t o t i c growth (Murray and S z o s t a k , 1983) and as a r e s u l t they a re u s u a l l y found i n a r e l a t i v e l y low f r a c t i o n o f the c e l l s i n a p o p u l a t i o n , even d u r i n g growth under s e l e c t i v e c o n d i t i o n s . M a r t i n e z - A r i a s and Casadaban (1983) repo r ted t h a t LEU2 p romote r : l acZ f u s i o n s c a r r i e d on a r s p lasmids d i r e c t e d t h e s y n t h e s i s of o n l y ve ry low l e v e l s o f ft-galactosidase, but t h a t p lasmids c a r r y i n g 2 /u c i r c l e sequences produced h i g h e r l e v e l s o f ft-galactosidase, presumably because 2 /u p lasmids have h ighe r average copy number. I thought t h a t mod i f y ing the pA5s so as t o make them l e s s s u s c e p t i b l e to m i t o t i c s e g r e g a t i o n might r e s u l t i n t he p r o d u c t i o n of d e t e c t a b l e l e v e l s of ft-galactosidase, a t l e a s t i n t rans fo rmants c a r r y i n g those p lasmids w i t h i n a c t i v e 3 ' end s i g n a l s . A c c o r d i n g l y , I cons t ruc ted two s e r i e s o f m o d i f i e d p lasmids . P lasmids i n t he pA6 s e r i e s d i f f e r e d from the co r respond ing pA5s o n l y i n c a r r y i n g a 2 .2 kb fragment f rom the centromere of yeas t chromosomes I I I , CEN3. C i r c u l a r p lasmids c a r r y i n g CEN3 and an a r s sequence have p r e v i o u s l y been shown t o be much more s t a b l e , both m i t o t i c a l l y and m e i o t i c a l l y , than s i m i l a r p lasmids l a c k i n g CEN3 (C la rke and Carbon, 1980; F i t z g e r a l d - H a y e s e t a l . , 1 9 8 2 ; Murray and S z o s t a k , 1983) . P lasmids i n the pA7 s e r i e s d i f f e r e d from the pA5s i n c a r r y i n g a fragment o f the 2/a c i r c l e i n c l u d i n g i t s o r i g i n o f r e p l i c a t i o n and the REP3 r e g i o n , wh ich i s needed i n c i s f o r p lasmid maintenance a t h i g h copy number (Jayaram e t al_. , 1983) . P lasmids c a r r y i n g the 2yu o r i g i n and REP3 sequence a r e - 2 1 6 -substantially more stable than plasmids with only an ars sequence because they show no mother-daughter segregation bias and because they replicate to high copy number provided that the yeast strain has endogenous 2ya circles (Murray and Szostak, 1983; Jayaram et al.,1983). Plasmids pA6.3, pA6.11, pA7.3 and pA7.11 were all introduced into strain RP123, selecting for TRP1+ transformants. £ -galactosidase was not detectable in any of the transformants after plating them on XGAL medium. The lacZ gene of the pA5s, pA6s, and pA7s was from placZ (the construction of which was described in Chapter II), which was derived from pMCl403 by deleting lacYA. Plasmid placZ had initially been constructed to allow more convenient manipulation of the lacZ fragment and the fusion plasmids, but to test whether the deletion of lacYA had removed some sequence important for lacZ expression in yeast, I replaced the lacZ fragment of pA5.3 and pA5.11 with the lacZYA fragment of pMC1403. The resulting plasmids, pAl0.3 and pAlO.ll, did not direct the synthesis of detectable levels of -^galactosidase in yeast. The pAll Series of Plasmids It seemed possible that perhaps the pA5 plasmids and their derivatives encoded an inactive "^ -galactosidase" because of some peculiarity of the amino acid sequence encoded by the oAS5/6:lacZ junction. To test this idea, I replaced the lacZ fragment of the pA5s with a fragment from pLG669Z which carried 114 bp of the laci coding sequence fused to the lacZ coding sequence 64 bp downstream of the lacZ initiation codon: This fragment is known to encode an active £-galactosidase when fused to the first 4 bp of the CYCl coding sequence (Guarente and Ptashne, 1981). -217-Plasmids c a r r y i n g the l a c i ' Z f ragment a re r e f e r r e d t o as p A l l s , and t h e i r c o n s t r u c t i o n i s d e s c r i b e d i n Chapter I I . A map of a p A l l p lasmid i s shown i n F i g u r e 8 . They a l s o d i f f e r e d from the pA5s i n t h a t they c a r r i e d a fragment o f 2yj. c i r c l e i n c l u d i n g the o r i g i n o f r e p l i c a t i o n and REP3 sequence. In e x p o n e n t i a l l y growing c u l t u r e s o f p A l l t rans fo rmants of s t r a i n RP123, 75-80% o f the c e l l s c a r r i e d the p lasmid i n the absence o f t r yp tophan . Transformants o f yeas t s t r a i n RP123 c a r r y i n g t h e p A l l p lasmids were p l a t e d on XGAL medium t o t e s t f o r $ - g a l a c t o s i d a s e s y n t h e s i s , and q u a n t i t a t i v e assays o f $ - g a l a c t o s i d a s e i n suspens ions o f p e r m e a b i l i z e d c e l l s f rom e x p o n e n t i a l l y growing c u l t u r e s were c a r r i e d o u t . The r e s u l t s a re shown i n F i g u r e 25 . I t i s c l e a r t h a t the l e v e l o f e x p r e s s i o n o f l acZ on a p A l l p l asm id i n yeas t i s a f f e c t e d by the ex ten t of t he CYCl 3 ' end s i g n a l f ragment . P lasmids i n wh ich t h i s fragment extends a t l e a s t as f a r as p o s i t i o n +496 d i r e c t the s y n t h e s i s of ve ry l i t t l e $ - g a l a c t o s i d a s e i n y e a s t . P lasm id p A l l . 7 1 c a r r i e s a 3 ' end s i g n a l fragment ex tend ing from p o s i t i o n +449 t o +493, but the f i r s t 3 bp o f the OAS5/6 adapter a r e i d e n t i c a l t o sequences no rma l l y p resen t a t p o s i t i o n s +494 t o +496 of the CYCl 3 ' end s i g n a l . P lasm id p A l l . 5 0 c a r r i e s a 3 ' end s i g n a l fragment 20 bp s h o r t e r than t h a t o f p A l l . 7 1 , and i t d i r e c t s 1 3 - f o l d h ighe r l e v e l s o f £ - g a l a c t o s i d a s e s y n t h e s i s i n yeas t than does p A l l . 7 1 . Sequences wh ich prevent l acZ e x p r e s s i o n i n the p A l l s t h e r e f o r e e x h i b i t a f u n c t i o n a l boundary between p o s i t i o n s +476 and +496 of the CYCl 3 ' end s i g n a l f ragment . T h i s boundary cor responds ve ry c l o s e l y t o the boundary o f the 3 ' end s i g n a l as d e f i n e d by the a n a l y s i s o f t r a n s c r i p t s o f CYC1AH5' d e r i v a t i v e s , wh ich suggests t h a t t he f u n c t i o n a l element r e q u i r e d t o - 2 1 8 -f - G A L A C T O S I D A S E A C T I V I T Y I N Y E A S T C A R R Y I N G p A l l P L A S M I D S 0 - G A L K E P A l 1.12 Lv^WAVWA W ^ W i I 0 3 ( 0 . 1 ) - 2 4 A 4 4 8 521 K E p A l l P O - k w ^ w A V A w ^ i i I 0 . 1 ( 0 . 1 ) 518 K E p A l 1 .19 kss\sssssssv^»>vj I — ^ 0 . 1 ( 0 . 1 ) 5 0 7 K E p A l I 3 0 k w w ^ w ^ l — 0 . 2 ( 0 . 1 ) 5 0 2 p A 1 1 . 7 1 kssswsssssssssssss^ = 0 . 3 ( 0 . 2 ) 4 9 6 K E p A I 1 . 5 0 ksssssss, , , ! 4 . 2 ( 1 . 1 ) 4 7 6 K E p A l l . l l IssJ— 1 3 ( 2 . 6 ) 4 5 3 E p A I L 3 I— 1 1 ( 2 . 1 ) 4 4 9 Figure 25. Level of $-Galactosidase Produced by GM-3C-2 Transformants Carrying pAll Plasmids Units are defined in Chapter II. Each value given represents the mean of 6-10 independent measurements. The standard deviation from the mean is listed in parentheses. The 3' end signal region is cross-hatched, flanking sequences are shown as open boxes, and lacZ sequences are drawn as boxes with horizontal lines in them. The letters K and E denote recognition sites for restriction endonucleases Kpnl and EcoRI, respectively. -219-prevent lacZ expression in the pAll plasmids is the CYCl 3' end signal itself. A further 3-fold increase in -^galactosidase activity is seen in cells bearing plasmid pAll.ll, which retains only 6 bp of the 3' end signal. This may indicate that the 3' end signal fragment in pAll.50 remains partially active. Plasmid pAll.3 carries no 3' end signal sequences, and only a 2 bp remnant of a Kpnl linker separates the CYCl promoter from oAS5/6 sequences in this plasmid. It directs lacZ expression at the same level as pAll.ll in yeast. What Might lacZ Expression from pAll Plasmids Measure? Analysis of transcripts of deletion derivatives of the CYCl gene revealed two boundary regions of the CYCl 3' end signal. Sequences within these boundary regions bring about a 40-fold reduction in the expression of lacZ from the CYCl promoter when inserted between gene and promoter. These results are most easily explained by supposing that sequences within the boundary regions act autonomously as a 3' end signal, and when located upstream of lacZ, prevent the synthesis of lacZ transcripts. A second interpretation of the results presented in Figure 25 is that sequences within the 3' end signal region interfere with transcript initiation at the CYCl promoter when placed immediately adjacent to it. There is no evidence that an essential component of the CYCl promoter resides within the 5' untranslated region of the gene, and it therefore seems unlikely that replacing the normal 5' untranslated sequence with the 3' end signal sequence would of itself inactivate the promoter. The 3' end signal might interfere with the promoter as a consequence of its 3' end signal activity. For instance, -220-3' end signal activity might normally require the binding of particular proteins to the +449 to +496 region. Such binding might potentially interfere with transcript initiation at sites immediately upstream. In that case, although the observed reduction in lacZ expression would not result from 3' end generation, it would remain a valid indication of at least one aspect of 3' end signal function. Inactivation of the 3' end signal could occur through disruption of the protein binding site(s), which would at the same time relieve interference with transcript initiation. Brent and Ptashne (1984) have proposed that a similar mechanism might account for the inhibitory effect of two different 3' end signal regions on CYCl promoter activity when either of those regions is placed between the upstream activator site and transcriptional start sites. A third interpretation of the levels of ^ -galactosidase observed in pAll yeast transformants is that lacZ mRNA is produced from all of the pAll plasmids, but that the mRNAs produced from plasmids with longer CYCl 3' end signal fragments are less efficiently translated because of their necessarily longer leader sequences. This interpretation could also allow that certain sequences present in the CYCl 3' end signal region interfere with translation of the hybrid mRNAs. (The absence of certain sequences which are normally present in the 5' untranslated region could conceivably interfere with translation, but this effect could not contribute to differences in lacZ expression between transformants bearing different pAlls.) The coincidence of the downstream functional boundary of the CYCl 3' end signal with that of the sequences required to prevent lacZ expression in a pAll plasmid would be viewed as unfortunate but meaningless. Studies of translation -221-in eucaryotes argue against the idea that sequences in mRNA leaders dramatically influence translation efficiency. The leader regions of normal CYCl mRNAs vary in length from 25 to 100 nucleotides. Assuming that the same 5' end sites are used in transcripts initiated at the CYCl promoter of a pAll plasmid, plasmid pAll.ll would produce hybrid transcripts with leaders 6 nucleotides shorter than the corresponding CYC1+ transcripts, while the leader regions of transcripts from pAll.71 would be 34 nucleotides longer than CYC1+ transcripts. A 40-fold difference in lacZ expression accompanies this 40 nucleotide difference in mRNA leader length, a difference smaller than the range of leader lengths observed amongst CYC1+ mRNAs, and much smaller than the range observed amongst eukaryotic mRNAs in general (Kozak, 1983b; 1984b). The 5' untranslated regions in the CYCl:galK leader sequence fusions constructed by Zitomer et al. (1984) were 2-39 bp longer than those of the corresponding CYC1+ mRNAs. The maximum difference in galactokinase expression between yeast carrying different fusions was 2.6 fold. Pelletier and Sonenberg (1985) reported that regions of extensive secondary structure within the 5' untranslated sequences of a eukaryotic mRNA can severely inhibit its translation. The hybrid mRNAs encoded by the pAlls contain no notable regions of potential secondary structure, other than the Kpnl linker octanucleotide at the promoter:3' end signal junction and the EcoRI/BamHI/Smal linkers at the oAS5/6:laci junction. None of these could form a duplex of more than 4 bp. The Kpnl linker sequence clearly does not limit translation efficiency, since it is absent from pAll.3 and present in pAll.ll, yet both plasmids encode the same levels of -^galactosidase. The other linker sequences are present in all of the pAlls and should influence equally -222-the translation of mRNAs transcribed from any of them. The idea that effects on promoter activity or mRNA translation contribute to the differences in lacZ expression between different pAll transformants cannot be excluded without a direct demonstration of 3' end generation upstream of lacZ in pAll plasmids which do not produce detectable -^galactosidase. In an effort to examine the transcription of lacZ sequences in pAll plasmids directly, RNA isolated from various pAll transformants of strain RP123 was electrophoresed in agarose, transferred to nitrocellulose, and hybridized to a lacZ probe. No discrete RNA species hybridized to the lacZ probe. When hybridization was observed, it appeared as a diffuse pattern spanning a wide range of RNA sizes. The pattern was not due to general degradation of the RNA samples, because discrete bands of ribosomal RNA were visible upon staining samples which had been electrophoresed with those transferred to nitrocellulose. Discrete bands of hybridization to a TRPl probe were observed after transfer of RNA from a duplicate gel, run together with the first, to nitrocellulose. Saturation Mutagenesis of a CYCl 3' End Signal Fragment While I recognized that the phenotype conferred by any given pAll plasmid may have reflected effects on promoter activity or translation efficiency, it seemed that the process of 3' end generation could most simply and completely account for the dependence of $-galactosidase production on the extent of the CYCl 3' end signal fragment. Mutations were introduced into the 3' end signal fragment carried by plasmid pAll.71 with the idea that mutations which allowed increased lacZ expression might identify sequences important for 3' end generation. The plasmid pAll.71 was chosen because it carried the smallest 3' end -223-signal fragment which stil l maximally suppressed ft-galactosidase synthesis. The goal of this approach to studying the CYCl 3' end signal was to produce every possible point alteration of a functional 3' end signal fragment and identify those mutations which impaired 3' end generation. Screening a large number of mutants for increased ^ -galactosidase production is certainly feasible because of the ease and speed of the assay. The object of saturating the 3' end signal region with point mutations imposed several requirements on the mutagenic procedure: 1) i t should be reasonably efficient; 2) it should be targeted to the region of interest; 3) i t should produce mutations at random throughout that region; 4) it should produce any type of base substitution. A plethora of methods of in vitro mutagenesis, allowing the efficient production of mutations in target regions of varying size, have now been described. (The reader is directed to the excellent reviews of Shortle et al_. ,1981, Smith, 1985, and Botstein and Shortle, 1985). I should like to describe briefly the type of consideration that guided my choice of mutagenic method for the 3' end signal of CYCl. Linker-scanning mutagenesis provides a systematic approach to identifying functionally important sequence elements within a region of interest (McKnight and Kingsbury, 1982). This method, however, represents an intermediate step between defining the region of interest and defining important nucleotides within it, and I hoped that the simple screening device of elevated lacZ expression would allow such a step to be omitted. Bisulfite mutagenesis has been used to produce mutations throughout defined segments of DNA, but it causes only GC-AT -224-transitions (Shortle et al. ,1980; Ciampi et al_. ,1982; Weiher and Schaller, 1982; Folk and Hofstetter, 1983). It would be particularly unsuitable for the CYCl 3' end signal region, which has a GC content of only 20% (Figure 23). The mutagenic base analogue N -^hydroxylmethylcytosine did not meet the required criteria because it induces only transitions (Muller et al.,1978). Oligonucleotide-directed mutagenesis is capable of efficiently producing any desired base substitution at a target site specified by the sequence of the oligonucleotide (Smith and Gillam, 1981; Zoller and Smith, 1982;1983). The method has very recently proven adaptable to the aim of saturating a target region with point mutations. Kalderon et al_. (1984) showed that a mixture of homologous nucleotides could mutagenize a defined subset of the sites within a target region. McNeil and Smith (1985) and Wells et al. (1985) have devised an elegant extension of this method which allows the efficient production of any desired spectrum of point mutations within a target region of up to at least 50 bp. However, when I was designing my experiments on the 3' end signal of CYCl, I thought of oligonucleotides as strict site-specific mutagens and therefore turned to other approaches. The approach taken in this study was based on nucleotide misincorporation. Several groups had demonstrated that nucleotide misincorporation during in vitro copying of DNA could be used to produce almost all types of point mutations. Conditions which had been used in various procedures to increase the frequency of misincorporation included the use of Mn2+ rather than Mg2+ as an activator (Kunkel and Loeb, 1979), the use of non-proofreading DNA polymerases (Zakour and Loeb, 1982), the omission of one or more -225-nucleotides from the copying reaction (infinite pool bias), and the use of excision-resistant c(-thionucleotides (Kunkel et al_. ,1981; Short le et al.,1982). If a defined primer-template complex is incubated with a single nucleotide and DNA polymerase (an <X-thionucleotide if the enzyme has a proofreading exonuclease activity), then the site immediately downstream of the 3' end of the primer becomes a target for efficient mutagenesis (Shortle et al.,1982). Misincorporation of one nucleotide prevents misincorporation at the next site. Therefore, synthesis stops until the other nucleotides are added. It should be possible in principle to introduce any mutation at the site by carrying out four reactions, each with a different nucleotide. To subject a target region to misincorporation mutagenesis, it should simply be necessary first to produce a population of primers with 3' ends at every position in the region. The approach used in this study is illustrated in Figure 13 and described in detail in Chapter II. It was necessary to obtain the target region in single-stranded form for the in vitro copying reaction, and this was conveniently done by cloning a fragment including the target into Ml 3. The small Smal fragment of pAll.71, which included the CYCl 3' end signal and part of the CYCl promoter, was ligated into Ml3mpl0 such that the mRNA-isoparallel strand of the insert was linked to the + strand of Ml3. Single-stranded DNA of the recombinant phage, which was called mplOAl, was annealed with the complementary strand of Smal-linearized Ml3mpl0 replicative form DNA, to produce a gapped heteroduplex in which the target for mutagenesis (the 3' end signal region) lay at the 3' end of the single-stranded region. Figure 26 -226-illustrates the results of the annealing reaction. Conditions for limited primer extension which allowed the production of random primer termini over a region of up to 150 nucleotides had been described by Brown and Smith (1977). Similar conditions were used to extend the 3' end of the mplOAl:mplO/SmaI gapped heteroduplex into the single stranded region for 20-70 nucleotides, as illustrated in Figure 27. The product of this step was a population of gapped heteroduplexes with 3' ends opposite essentially every position of the CYCl 3' end signal. Figure 27 shows that the distribution of 3' ends was not entirely random, 3' ends at certain positions being considerably more abundant than at others. Every position of the 3' end signal appeared to be targeted for mutagenesis, but it was expected that mutations would be recovered more frequently at some positions than at others. A different approach to targeting misincorporation mutagenesis throughout a defined region was described while this work was in progress. Abarzua and Marians (1984) annealed circular, single-stranded DNA carrying the target region with a population of complementary linear fragments which collectively had 3' ends at all positions throughout the target. These fragments had been produced by exonucleolytic digestion of a fragment carrying the complete target region. The population of gapped heteroduplexes so produced was ' formally equivalent to the population produced by limited primer extension in this study. As observed in the present study, some primer termini occurred more frequently than others, but the authors were nevertheless able to recover mutants at over half of the positions in the target region. Another approach to targeting, which was originally applied to -227-Figure 26. Annealing of mplOAl and mplO/Smal A. Map showing the structure of the gapped heteroduplex formed by annealing mplOAl and Smal-cut mplORF. The positions of recognition sites for Clal are indicated by "C". The approximate sizes, in kbp, of the fragments expected from Clal digestion of the linear RF and of the gapped heteroduplex are indicated. B. Substrates and products of the annealing reaction. Two samples of each of the substrates and of the products of the annealing reaction were taken: One sample of each pair was digested with restriction endonuclease Clal. All samples were then electrophoresed through a 0.8% agarose gel. The gel was stained with ethidium bromide (1 /ag/ml in water) and photographed under UV illumination. In each pair of lanes, the right-hand lane shows the products of Clal digestion of the DNA in the left-hand lane. Lanes 1, mplOAl single-stranded DNA; Lanes 2, Smal-cut mplORF; Lanes 3, mplOAl and Smal-cut mplORF after mixing and annealing as described in Chapter II. Annealing is evidenced by (1) the appearance in lane 3 (left) of a band of lower mobility than the linear mplORF, and (2) the appearance of a new fragment in the Clal digest of the products of the aannealing reaction, lane 3 (right). The size of this fragment is about 4.8 kbp, as predicted in A. -228-- 2 2 9 -Figure 27. Limited Primer Extension on a Gapped Heteroduplex Lanes 1 and 2. Primer extension was carried out as described in Chapter II. An aliquot of the products was digested with BamHI prior to electrophoresis in a 7% acrylamide gel (lane 1). The remainder was used in a misincorporation reaction, after which a second aliquot was removed, digested with BamHI, and electrophoresed (lane 2). Lanes 3 and 4. As in lanes 1 and 2, respectively, except that dATP[o(S] was included in the primer extension reaction at a concentration of 15 /M. Lanes M. ddGTP chain terminator sequencing reaction of mplOAl ssDNA with oligonucleotide FPl as primer. Fragments produced in the sequencing reactions provided size markers. Fragment sizes in bp are indicated to the left of each panel. -230-bisulfite mutagenesis (Shortle et al.,1980), involves annealing the target region in a supercoiled duplex molecule to a complementary fragment to produce D-loops which can be randomly nicked by SI nuclease. Each nick can be extended into a short gap by exonucleolytic digestion to produce a population of randomly gapped heteroduplexes. The gapped heteroduplex population produced by limited primer extension was incubated with DNA pol I (Klenow fragment) and a single ot-thiodeoxynucleoside triphosphate. It was expected that during this incubation, theoc-thionucleoti.de would be randomly misincorporated onto the available primer termini. The fraction of primers terminated by a misincorporated nucleotide was expected to increase with time because ol-thionucleotides cannot be excised by the proofreading exonuclease of DNA poll (Kunkel et al.,1981). The fourth step in the procedure involved filling in the remainder of each gap with Klenow fragment and normal deoxynucleoside triphosphates and then ligating to produce closed duplex circular molecules. DNA purified from this reaction was introduced into E. coli JM101. The majority of the plaques obtained were colourless, suggesting that they were derived from repaired heteroduplexes or from mplOAl DNA "leftover" after the annealing reaction. (Leftover mplO RF DNA should have produced blue plaques after recircularization and introduction into cells.) To assess the efficiency of the mutagenic procedure, single-stranded DNA was prepared from several plaques and subjected to single-track sequencing using the dideoxynucleotide corresponding to the mutagenic (X-thionucleotide. Mutations were expected to be visible as extra bands in the single-track sequences as compared to that of the parent phage. An example of the results is -231-shown in Figure 28. Essentially all clones examined contained the pAll.71 fragment, confirming that they were derived from either heteroduplexes or mplOAl DNA. Of 100 clones screened in three experiments, 15 carried mutations, as summarized in Table VT. Twelve of the mutations recovered were within the target region. Those outside it were in adjacent vector or CYCl promoter sequences, as if some primer termini had been located in these regions. Comments on the Mutagenic Procedure  Targeting of Mutations Two problems limit the accuracy of targeting using the procedure described here: limited primer extension cannot produce primer termini which are precisely and completely confined to a target region within a larger single-stranded region, and redistribution of the primer termini by the proofreading exonuclease of DNA pol I would be expected to occur prior to misincorporation, producing some primer termini upstream of the target. Primer end redistribution did in fact occur during the misincorporation reaction, as shown in Figure 27. The first problem could be overcome by restricting the extent of the single-stranded region within the gapped heteroduplex to the target itself. All primer termini initially produced would necessarily be in the target region. Several ways of preventing primer redistribution suggest themselves. The method of including an cX-thionucleoti.de in the limited primer extension reaction seems fairly effective (Figure 27) but not ideal because it increases the chance of introducing mutations during limited primer extension and because it doesn't fix the positions of all primer termini, but rather provides a series of "stops" to block their exonucleolytic digestion. A more effective -232-MISINCORPORATION OF d T T P f e S ] T - T R A C K S (CLONES 2 5 - 3 6 ) 3' END p SIGNAL A D A P T E R _ — Figure 28. Single-Track (T) Sequences of 12 Clones Obtained in Experiment Tl (Table VI). Oligonucleotide FPl served as the primer for sequencing by the chain termination method of Sanger et al.(1977b). The sequence of the parental clone, mplOAl, is at the left. The extent of the 3' end signal region and the adapter region is indicated. T sequences of 12 clones occupy the remainder of the autoradiograph. Clones with differences from the parental sequence are numbered. -233-TABLE VI RESULTS OF MISINCORPORATION MUTAGENESIS EXPERIMENTS Experiment Clones Mutants Screened Name of Mutant Position of Mutation3 Mutationb Gl 24 5 G1.2 +473 T to C -70 T to Gd G1.5 M13C T to C G1.10 oAS5;5 T to C +478 G to T^  G1.13 +453 - +455 TAT to CCC G1.16 +487 A to C G3 36 3 G3.7 +496 A to C G3.13 +472 A to C G3.32 +487 A to C Tl 36 7 T1.17 -38 Ad T1.18 +495 T to A T1.26 -30 G to A T1.30 +473 T to A T1.34 +481 T to A T1.36 +465 T to A a Positions in CYCl sequences are numbered with respect to the sequence of the intact gene, taking the first base of.the coding sequence as +1. Positions upstream are denoted by a minus sign. Mutations in the OAS5/6 adapter are indicated by oAS5, followed by the position of the alteration, k Sequence changes are shown as they affect the mRNA-parallel strand of CYCl. The original base is shown on the left, the one inserted by mutation on the right. c The mutation was located in vector sequences upstream of the target. ^ These mutations could not have resulted from misincorporation of the CC-thionucleotide provided. -234-method might be to use a non-proofreading DNA polymerase. Shortle and Lin (1985) have found that primer terminus redistribution by DNA pol I can be prevented by including an excess of (X-thionucleotide over Mn2+ in the misincorporation reaction. The proofreading exonuclease is not active under these conditions because all available Mn +^ is chelated by the nucleotide, and none is available to activate the nuclease. Primer end redistribution, as well as reducing the accuracy of targeting, might create "hot spots" for misincorporation. Exonucleolytic digestion of any given primer would be expected to continue until the 3' terminal nucleotide of the resected primer was the same type as the thionucleotide used for misincorporation. Replacement of the 3' terminal nucleotide with the <X-thionucleotide could then occur readily and produce a stable primer terminus. Primers correctly terminated in the <x-thionucleotide would therefore accumulate over time, and positions immediately downstream of these abundant primers might become hotspots for misincorporation. A possible example of such a hotspot is evident from the data in Table VT. Two independent isolates of an A/T.G/C transversion at position +487 were recovered in experiments using dGTP[cxs] as the mutagenic nucleotide. (Three more isolates were recovered upon screening more clones from experiment G3; C. Beard, personal communication.) The position immediately upstream of +487 on the strand used for priming is position +488, and the nucleotide normally present on the bottom strand at that position is G. Stable primer termini at position +488 could have accumulated, leading to frequent misincorporation of G at position +487. Rendering all primer termini equally stable using one of the methods described above would prevent this type of hotspot from arising -235-(Shortle and Lin, 1985, also mention the contribution of primer end redistribution to mutagenic hotspots.) Accurate targeting of mutations by this procedure requires not only that limited primer extension produce primer termini confined to the target region, but also that the limited primer extension and the final, gap-repair steps proceed with high fidelity. Optimum fidelity during in vitro DNA synthesis with DNA pol I is achieved by using relatively low (approximately 20 JJM) equal concentrations of all four deoxynucleoside triphosphates (Shi and Fersht, 1984). The limited primer extension step was carried out with dCTP,dGTP,dTTP at a concentration of 35 /iM each and dATP at about 3 /iM. A 10-fold bias against dATP might be expected to reduce fidelity somewhat, but the concentrations of the other nucleotides were sufficiently low as to allow proofreading by the 3' exonuclease of DNA pol I. The inclusion of dATP[0(S] during the limited primer extension, as in Experiment G3, would prevent proofreading of misincorporated A residues, but the 10-fold excess of other nucleotides would not favour misincorporation of A in the first place. The gap repair step was carried out in the presence of 100 /JM of each deoxynucleoside triphosphate. It is possible that reducing this concentration would guard against misincorporation by allowing more effective proofreading. The gap repair reaction included Mn2+, as well as Mg2+, to improve the efficiency of extension of mispaired 3' ends. Its presence might lead to misincorporation during the gap repair reaction. Efficiency of Mutagenesis From the results presented in Table VI the efficiency of the mutagenic procedure is estimated to be about 15% (or about 0.2% per base pair over a region of about 80 base pairs). This is high enough -236-to make the identification of mutants by single-track sequencing feasible in the absence of any phenotypic screening device. A number of factors might limit the efficiency of mutagenesis. Transfection by leftover single-stranded DNA of mplOAl would have increased the "background" of unaltered mplOAl clones. It is unlikely that this had a serious effect on the efficiency of mutagenesis, since in one experiment (Tl; Table VT) the products of the gap repair reaction were treated with SI nuclease prior to being used in transfection. The conditions of SI treatment had previously been shown to allow complete degradation of single-stranded DNA, in the amount present in the annealing reaction, without allowing degradation of duplex DNA. Although the small sample sizes compared prevent accurate statistical comparisons, the number of mutants recovered in this experiment was not markedly different from that recovered in either of the other experiments. The efficiency of the misincorporation step itself may have limited the efficiency of mutagenesis, although Shortle et al. (1982) and Abarzua and Marians (1984) found that misincorporation could occur at frequencies higher than 40%. The presence of nucleotides other than one Ol-thionucleotide during the misincorporation step would reduce the efficiency of misincorporation. Such contaminants might be carried over from the limited primer extension step or introduced with the CX-thionucleotide. Misincorporation, followed by gap repair and ligation, would result in a heteroduplex containing a mismatched base pair. Mismatch repair following transfection of E. coli would reduce the efficiency of mutagenesis if the repair process was biased toward using the -237-"wild-type" strand of the heteroduplex as a template for correction of the "mutant" sequence. Abarzua and Marians guarded against the danger of mismatch repair by selectively replicating the "mutant" strand of each heteroduplex in vitro. One reservation which may be held about their procedure is that it is quite involved and requires at least one protein which is not readily available, the gene A protein of ^ X174. Perhaps the most elegant way of avoiding mismatch repair of mutant sequences is that described recently by Kunkel (1985). As applied to misincorporation mutagenesis of the 3' end signal fragment of mplOAl, the approach would involve preparing uridine-containing mplOAl single-stranded DNA from a dut~ung~ host. This DNA would be used in annealing, misincorporation and gap-repair reactions as described, and the products would be transfected into an ung"1" host. The presence of U in the wild-type strand of each heteroduplex would direct repair processes to that strand. Alternatively, the template strand could be degraded prior to transfection by treatment with dUTPase, followed by alkali (Kunkel, 1985). Types of Mutations Induced A disturbing feature of one experiment in which dGTP[(XS] was used for misincorporation was that three of five mutants contained multiple sequence changes. In each of two clones, Gl.2 and Gl.10, two mutations were present at nearby non-adjacent positions. Three of the four mutations in these clones were of the type expected from misincorporation of dGMP, while the fourth may have resulted from the misincorporation of dAMP. The continuation of DNA synthesis after one misincorporation event implies that nucleotides other than the one misincorporated were available. Other nucleotides may have been -238-present in the dGTP[«S], or they may have been carried over from the limited primer extension reaction. According to Botstein and Shortle (1985), error-prone DNA synthesis in the presence of more than one nucleoside triphosphate leads to a high frequency of clustered multiple mutations. The third multiple mutant recovered in the same experiment had the sequence CCCCCC instead of CCCTAT at positions +450-+455. It seems likely that the mutation resulted from some interaction involving the neighbouring sequence, but the nature of this interaction is obscure. No multiple mutants were observed in the other misincorporation experiments, but the apparent difference between experiments may be entirely due to the small numbers of mutants in each. The entire region subjected to the mutagenic procedure, or the portion of it subcloned for further analysis, should be sequenced to check for mutations outside the actual target region. In the pAlls reconstructed from mutants of mplOAl, about 250 bp of the CYCl promoter, between the Smal site at position -380 and the oAS7 priming site at -125, was not sequenced. As will be described, independent tests of the function of the mutant 3' end signals were later carried out using fragments which had been completely sequenced. Effects of Mutations in the 3' End Signal Fragment on lacZ Expression from pAll Plasmids Eight derivatives of plasmid pAll.71 carrying point mutations in the CYCl 3' end signal were produced from mutants of mplOAl as described in Chapter II. The CYCl 3' end signal and flanking regions of each plasmid were sequenced in order to confirm the identity of the point mutation(s) in the 3' end signal and the structure of the -239-CYCl:OA55/6:lacZ fusion junctions. An example of the results is shown in Figure 29. Plasmids carrying mutant derivatives of the CYCl 3' end signal fragment of pAll.71 were introduced into yeast strain RP123, and the -^galactosidase levels in the TRP1+ transformed strains were measured. The results are presented in Figure 30. The variability between independent assays of the same type of transformant was greater in several cases than had been observed in earlier experiments, and what this means is not clear. It is clear, however, that six of the eight plasmids tested directed $-galactosidase production at levels 4-15-fold higher than did the parent plasmid, pAll.71. The remaining two seemed to support even lower levels of lacZ expression than pAll.71. The results presented in Figure 30 suggest that all of the mutations tested except Tl.30 and Tl.34 impaired the activity of the CYCl 3' end signal and caused increased synthesis of functional lacZ transcripts. To argue against the involvement of 3' end generation in determining the level of lacZ expression from the pAll plasmids, i t would be necessary to suppose that six of eight mutations tested caused increased lacZ expression by quite dramatically improving the stability or translational efficiency of lacZ transcripts. Either interpretation would imply a strong dependence of the translational yield of an mRNA on the sequence of its leader region. As discussed previously, there is little support in the literature for the notion of such dependence, except with respect to AUG triplets and secondary structure. 3" End Signal Function in Truncated CYCl Genes In an attempt to confirm that increased lacZ expression from pAll plasmids is indicative of 3' end signal dysfunction, a fragment of -240-Figure 29. Sequences of 3' End Signal Regions of Various pAll Plasmids Plasmids in the pAll series were prepared for sequencing as described in Chapter II. They were digested with restriction endonucleases Xhol and SacI to release a 2.1 kbp fragment carrying part of the CYCl promoter, the 3' end signal region, OAS5/6 adapter, and part of laci '1. The digestion products were denatured and annealed to oligonucleotide oAS7 (Table I), which served as a primer for sequencing the mRNA-parailel strand of the 3' end signal region by the chain termination method of Sanger et al.(1977b). Products of the sequencing reactions were denatured and fractionated on 6% acrylamide/7M urea gels, which were then autoradiographed. The panel at the left illustrates the sequence of part of the 3' end signal region carried on plasmid pAll.71. The lanes in this and all other panels contain, from left to right, products of the C, T, A, and G sequencing reactions. Other panels illustrate the sequences of 3' end signal regions carrying the point mutations named at the bottom of each panel. Any base which differs from the pAll.71 sequence is labelled by a black dot to the left of the corresponding band in the autoradiograph. To the left or right of each panel, the sequence in the vicinity of the muatation is written out, with the site of the mutation again identified by a black dot to the left of the altered base. -241-- 2 4 2 -Figure 30. Levels of B-Galactosidase Activity in Yeast Transformants Carrying pAll Plasmids with 3' End Signal Mutations Transformants of strain RP123 carrying pAll plasmids were grown in 10 ml cultures of selective medium and assayed for -^galactosidase activity as described in Chapter II. The name of the plasmid carried by a given transformed strain is indicated in the left-hand column. The centre of the figure shows the sequence of the CYCl 3' end signal region in each plasmid. The complete sequence of the CYCl 3' end signal region of plasmid pAll.71 is written out. The vertical line marks the distal endpoint of sequences derived from the 3' end signal. Sequences to the right of this line were derived from the oASB/6 adapter. For each of the other plasmids, only those bases which differed from the sequence of the CYCl 3' end signal in pAll.71 are indicated. The horizontal lines indicate positions of sequence identity between pAll.71 and the other plasmids. The right-hand column lists the $-galactosidase activity in each transformed strain. Units are defined in Chapter II. Each number listed is the mean of measurements made on 4 independent cultures. -243-PLASMID SEQUENCE OF 3' END SIGNAL P - G A L A C T O S I O A S E A C T I V I T Y pAII-71 G T C C C T A T T T A T T T T T T T A T A G T T A T C T T A G T A T T A A G A A C G T T A T T T A|A T A A T G A C T 0.8 4 5 0 4 6 0 4 70 4 8 0 4 9 0 pAII-GI-2 C 3.9 pAII-GIIO 1 1 — T • C 11.5 pAI I -GI I6 • C 3.2 I N J £ pAII-TI 3 0 A 0.1 c i c. . M A A Q c pAI I -T I -34  0.2 pAI I -T I -36 - A 7.4 p A I I - 6 3 - 7 • C 3 .5 pAI I-G3-I3 C 3.8 pAll.71 was joined to the first half of the CYCl gene and the truncated CYCl gene so produced was assayed for the production of truncated CYCl transcripts. Truncated genes were also produced using the 3' end signal fragment of each mutant derivative of pAll.71. The structure of the truncated genes is diagrammed in Figure 11, and their construction is described in detail in Chapter II. The 355 bp KpnI/Hindlll fragment of the normal 2.5 kb BamHI/Hindlll CYC1+ fragment was replaced with a 70 bp fragment extending from the Kpnl site of mplOAl or one of its derivatives to the Hindlll site immediately downstream of the 3' end signal region. The truncated CYCl gene was transferred to YEpl3 on a 2 kb BamHI fragment, and the resulting plasmids, referred to as pAl2As or pAl2Bs, depending on the orientation of the insert, were introduced into yeast strain GM-3C-2. Total RNA was isolated from the transformants, electrophoresed through agarose, transferred to nitrocellulose, and tested for hybridization to a CYCl probe. Plasmids carrying a functional CYCl 3' end signal should produce an RNA of about 450 nucleotides which hybridizes to the probe. As shown in Figure 31, such a transcript is produced from plasmids carrying the "wild-type" 3' end signal or the Tl-30 or Tl-34 mutant 3' end signal. These are exactly the 3' end signal fragments which prevent lacZ expression in pAll plasmids. The position of the truncated transcript is indicated by the "C" in the margin of the figure. The level of the truncated transcript is greatly reduced in cells bearing plasmids with those mutant 3' end signals which allow elevated lacZ expression from pAll plasmids. Whether any transcript other than the truncated one is produced from the truncated CYCl genes depends upon the orientation of the 2 kb BamHI fragment (C. Beard, personal communication). If the fragment is -245-Figure 31. Hybridization of a CYCl Probe to RNA from Yeast Transformants Carrying pAl2A and pAl2B Plasmids A. Total RNA from transformants of strain GM-3C-2 carrying pAl2A or pAl2B plasmids was denatured with formaldehyde and electrophoresed through 1% agarose. The RNA was then transferred to a nitrocellulose filter, which was subsequently incubated with a 32P-labelled CYCl hybridization probe, washed and autoradiographed. The probe was generated by copying the ss DNA of mp8CYCl(2.5) using oligonucleotide FPl (Table I) as a primer, the Klenow fragment of DNA polymerase I, 0([32P]dATP, dCTP, dGTP, and dTTP. Each lane contained 20 joq of total RNA. The RNA was isolated from transformants carrying the plasmids indicated at the top of each lane. The transcripts produced by 3' end generation in the vicinity of the CYCl 3' end signal fragment are indicated by the line labelled C. Transcripts produced by 3' end generation further downstream in 2p circle sequences are indicated by the line labelled RT. Transcripts from the wild-type CYCl gene carried on plasmid YEpl3CYC1(2.5) and the deletion derivative carried on plasmid 4H40 (see Figure 16) provided size markers (of approximately 650 and 1100 nucleotides, respectively). The positions to which they migrated are indicated by the lines labelled WT and 4H40. B. Total RNA from transformants of strain GM-3C-2 carrying pAl2B plasmids was denatured with formaldehyde and electrophoresed through 1% agarose. The RNA was transferred to a nitrocellulose filter, which was then incubated with a 32p_labelled CYCl hybridization probe, washed and autoradiographed. The probe was prepared as described in A. Each lane contained 20 jug of RNA. The lane marked 71 contained RNA from a transformant of GM-3C-2 carrying pAl2B.71. Other lanes contained RNA from transformants carrying pAl2B plasmids with the mutations indicated at the top of each lane. Transcripts produced by 3' end generation in the vicinity of the 3' end signal fragment are marked by the arrow labelled C. Those produced by 3' end generation in 2/J circle sequences are marked by the arrow labelled RT. The lines labelled WT and 4H40 indicate the positions to which transcripts from the CYCl genes borne on plasmids YEpl3CYCl(2.5) and 4H40 migrated. -246-CD G I . I O T I . 3 0 T I . 3 4 7 1 T I . 3 6 G 3 . 7 G I . 2 G I . I 6 T I . I 8 P A I 2 B . G I . 2 p A I 2 A . G I . I O p A I 2 B . G I . l 6  p A I 2 B . T I . l 8 p A I 2 A . T I . 3 0 p A I 2 A . T I . 3 4 P A I 2 A . 7 I oriented so that transcription of the CYCl gene proceeds away from 2 /a circle sequences, as in the pAl2A series, then no discrete transcript other than the 400 nucleotide one is detected by the CYCl probe. If the truncated transcript could not be produced because of a defect in the CYCl 3' end signal, transcription would be expected to proceed into pBR322 sequences. The presence of another yeast 3' end signal in these sequences would be purely fortuitous, and in the absence of such a signal, 3' end generation could not occur. The extended transcript might therefore be unstable and escape detection. Several studies have suggested that disruption of the only 3' end signal downstream of a gene prevents the synthesis of a stable transcript of that gene (Higgs et al.,1983; Fitzgerald and Shenk, 1981; McDevitt et al.,1984). In pAl2B plasmids containing the 2 kb fragment in the opposite orientation, transcription would proceed from the CYCl gene through 375 bp of pBR322 and into 2/i circle sequences if the CYCl 3' end signal was defective. Termination or processing would be expected to occur about 500 bp distal to the junction with 2/i sequences to produce an extended transcript of about 1,300 nucleotides. Such a transcript is in fact observed in cells bearing any of the pAl2B plasmids. In cells bearing PA12B.71, pAl2B.Tl.30, or pAl2B.Tl.34, the truncated, 400 nucleotide transcript is also observed, in levels equalling or exceeding those of the extended transcript. The production of truncated transcripts from the truncated CYCl gene is indicative of 3' end signal function, and regardless of the orientation of the gene with respect to the vector, the synthesis of truncated transcripts correlates with the ability of the 3' end signal to prevent lacZ expression in pAll plasmids. This observation supports -248-the idea that increased lacZ expression in pAll transformants is indicative of 3' end signal dysfunction. The production of extended CYCl transcripts from all of the pAl2B plasmids implies that the 50 bp 3' end signal fragment, while retaining the ability to cause 3' end generation, is not completely autonomous. Some sequence outside this fragment is necessary to allow efficient 3' end generation. It has already been noted that sequences on either side of the boundary region have some influence on 3' end generation. The results obtained with the pAl2s suggest that simultaneous removal of the normal sequences flanking both boundaries causes a more dramatic drop in 3' end signal efficiency than the removal of sequences flanking only one boundary. Similar observations were made by Henikoff and Cohen (1984), who defined the functional boundaries of a yeast 3' end signal near a Drosophila gene segment but found that the 21 bp region within the boundaries could cause 3' end generation only when certain sequences were present downstream, and then only inefficiently. The question of what additional sequences must flank the 50 bp CYCl 3' end signal fragment in order for i t to function efficiently might be addressed using the plasmid pAl2B.71. Sequences to be tested could be inserted at either end of the 50 bp 3' end signal fragment, and those which allow more efficient 3' end generation would be expected to prevent the synthesis of the extended CYCl transcript in yeast. The production of extended transcripts from one series of pAl2s, but not the series in which the orientation of the truncated gene is reversed, may simply be due to a difference in the stability of the extended transcript produced in each instance. What is in some sense surprising is that although the extended transcripts from pAl2B -249-plasmids accumulate to the same level as the truncated transcripts, a high "background" of lacZ expression from pAll plasmids carrying functional 3' end signal fragments is not observed. Two explanations suggest themselves. One is that the context of the 3' end signal fragment in the pAlls allows it to function more efficiently than in the pAl2s. The other is that extended transcripts are in fact produced as a relatively low proportion of total transcripts pAl2B plasmids carrying the "wild-type" 3' end signal , but that the extended transcripts are more stable than the truncated transcripts and are therefore "enriched" in steady state mRNA. It would be necessary to suppose that a similar enrichment for the extended lacZ transcripts produced from pAll plasmids does not occur, but since no known yeast 3' end signal is present downstream of lacZ, such enrichment would not be expected. The utility of the pAll plasmids in screening for 3' end signal mutations should not be taken to imply that -^galactosidase levels in pAll-transformed cells provide a direct quantitative measure of the efficiency of a given 3' end signal fragment. The level of £-galactosidase in cells carrying a pAll plasmid such as pAll.71, with an intact 3' end signal, may be taken as a basal level. For reasons already discussed, it seems fair to say that inactivation of the CYCl 3' end signal is prerequisite to the synthesis of -^galactosidase in excess of the basal level. However, if two pAll plasmids express lacZ at different levels above the basal level, it should be remembered that other factors, such as differences in the translation efficiency or stability of the lacZ mRNAs might contribute to the difference in lacZ expression. -250-Sequence Requirements for CYCl Transcript 3' End Generation The apparent requirement for sequences outside the functional boundaries of the CYCl 3' end signal complicates the task of identifying those sequences within the boundaries which are important in 3' end generation. Mutations within the 3' end signal region of the intact CYC1+ gene would be expected to inactivate the signal if they alter a unique sequence which must be specifically recognized in some way during transcript 3' end generation. Mutations affecting a repeated recognition sequence, or altering nucleotides which contribute to some general property of the signal, might be expected to have more moderate effects on its activity. When the 3' end signal region is "trimmed down" to 50 bp, "general properties" of the region must be specified by fewer nucleotides, and extra copies of repeated recognition sequences may be lost in the trimming. The result is that the trimmed 3' end signal, located outside its normal context, may be more dramatically affected by certain mutations than it would be if it were in its usual position within the CYCl transcription unit. The data presented here do not allow the sequence requirements of the 3' end signal to be completely specified, but they do suggest certain of its features and they allow "terminator sequences" recognized on the basis of sequence homology to be assessed on the basis of functional importance. Zaret and Sherman (1982) noticed that the sequence TAG...TAGT...TTT, which occurs in the 38 bp region deleted from the cycl-512 allele, is also present in the sequences flanking the 3' ends of a number of other yeast genes. They proposed that this sequence might be a required component of at least some yeast transcription -251-terminators. At the same time they suggested that some other property of the 3' flanking region of a gene, such as high AT content or a disproportionate thymidine content in the mRNA-parallel strand, might be important to 3' end generation. A 3' end signal sequence should be present near sites at which 3' end generation is known to occur, but it is equally important that its essential features be absent from sites at which 3' end generation does not occur. The consensus sequence of Zaret and Sherman (1982) meets the first of these criteria in several cases, but it does not seem to meet the second. The same authors (Zaret and Sherman, 1984) reported the sequence of a region flanking two revertant alleles of the cycl-512 allele. Although they did not establish what segment of DNA was responsible for 3' end generation in each case, and they did not sequence the entire region in which transcript 3' ends were found, they did find a region of homology to the consensus sequence in which each of the three alleles had a different sequence. The regions homologous to the "core" of the tripartate consensus sequence [TAC...ATGT...TT] were, however, identical in the defective cycl-512 allele and the CYC1-512-E and CYC1-512-K alleles in which 3' end signal function had been restored. Differences between cycl-512 and the revertant alleles were confined to an AT-rich sequence between the last two elements of the consensus sequence. That such permutations of an AT-rich sequence should affect the efficiency of the 3' end signal implies that a particular AT-rich sequence, and not simply a high AT-content, is required for 3' end generation. The results of my study suggest that at least one element of the Zaret and Sherman consensus sequence is part of the 3' end signal, but -252-they also indicate that other specific sequence requirements exist. Evaluation of the importance of the first two elements of the Zaret and Sherman consensus sequence is complicated by the fact that they are related and repeated within the CYCl 3' end signal region. Table VTI compares the consensus sequence to corresponding regions of the CYCl 3' end signal and its mutant derivatives. It is clear that the sequence TATGT, which is one form of the second element of the consensus sequence, is not specifically required for 3' end generation. It can be altered to TAGTT or TATCT in the intact CYCl gene without affecting 3' end signal function. The latter mutation also does not inactivate the CYCl 3' end signal in plasmid pAll.71. Similarly, the Tl.30 mutation, which creates the sequence TAACT, does not impair 3' end signal function. Although some flexibility in the sequence at positions 471 to +475 is apparently compatible with 3' end signal function, certain sequences at these positions do seem to impair 3' end generation. The G1.2 and G3.13 mutations, which create the sequences TACCT and TCTCT, respectively, both interfere with 3' end generation to the extent that they cause a 4-fold increase in lacZ expression from pAll plasmids, as compared to pAll.71. Taken together, the results suggest that the sequence TATGT itself is not an essential feature of the 3' end signal, but that it might contribute to some general property which is important in 3' end generation. The tetranucleotide TAGT immediately follows the sequence TATGT in the intact CYCl 3' end signal and represents a second candidate for the second element of the Zaret and Sherman consensus sequence. The present study provides some indication that the tetranucleotide is required for 3' end generation. As shown in Table VII, the 3' end -253-TABLE VTI COMPARISON OF THE ZARET AND SHERMAN CONSENSUS SEQUENCE TO MUTANT 3'END SIGNALS Name Consensus CYC1+ GT473a C474 (pAll.71) pAll.50 G1.2 G3.13 TI.30 Gl.10b T1.18C Sequence TAG.TA(T)GT TTT TAGTTATGTTAGT...TTT TAGTTAGTTTAGT...TTT TAGTTATCTTAGT...TTT TAGTTATCTTT TAGTTACCTTAGT...TTT TAGTTCTCTTAGT...TTT TAGTTAACTTAGT...TTT TAGTTATCTTATT...TTT TAGTTATCTTAGT...TTA 3' End Signal Function + + + a Differences from the CYC1+ sequence are underlined. b Gl.10 includes a second point mutation, a T/A.C/G transition at position 5 of the OAS5/6 adapter c The effects of the Tl.18 mutation were assayed only in the pAl2A/B plasmids. -254-signal fragment in plasmid pAll.50 lacks this tetranucleotide, though it retains the other elements of the Zaret and Sherman terminator, and it is at best marginally functional. Unfortunately, the deletion which eliminated the TAGT tetranucleotide from plasmid pAll.50 also eliminated 17 bp of 3' end signal sequence from downstream of the tetranucleotide. It would be somewhat reckless to attribute the level of lacZ expression from pAll.50 entirely to the lack of the TAGT tetranucleotide. The plasmid pAll.Gl.10 is interesting because it supports lacZ expression at about the same level as pAll plasmids lacking the CYCl 3' end signal entirely. It carries two mutations as compared to plasmid pAll.71, the first being a G/C to T/A transversion at position +478 which alters the sequence TAGT to TATT. The second is a T/A to C/G transition at position 5 of the OAS5 /6 adapter. Although it will be important to obtain separate 3' end signal fragments carrying each of these mutations, it seems likely that both contribute to the phenotype of pAll.Gl.10 transformants. Four other mutations (G3.13, G1.2J G1.16, G3.7) which introduce C/G base pairs into the 3' end signal fragment of pAll.71 all cause about a 4-fold increase in lacZ expression. One of these, G3.7, affects position 4 of the OAS5 /6 adapter, immediately upstream of the position affected by the T/A to C/G transition in the Gl.10 mutant. It is likely that the dramatic enhancement of lacZ expression in pAll.Gl.10 transformants is at least partly due to the mutation at position +478, suggesting that the TAGT tetranucleotide is in fact required for 3' end generation. The trinucleotide TTT makes up the third element of the Zaret and Sherman consensus sequence. It occurs at positions +493 to +495 of the -255-intact 3' end signal and again at positions +499 to +501, although this copy as well as others further downstream can be eliminated without i l l effect. The Tl.18 mutation produces the sequence TTA at position +493 to +495. Plasmid pAl2A.Tl.18 does not produce a truncated CYCl transcript, suggesting that it lacks a functional 3' end signal. Henikoff and Cohen (1984) demonstrated that the sequence TTTTTATA is part of the 3' end signal for transcription of a fragment of the Drosophila GART gene in yeast. The sequence T7ATA lies within the functional boundaries of the CYCl 3' end signal, at positions +459 to +468, and it might therefore also form part of the CYCl 3' end signal. It is clearly not the only required component of the 3' end signal, because plasmid pAll.50 retains the sequence T 5 A T A and yet directs lacZ expression at levels 15-fold greater than pAll.71, which has an additional 20 bp from the 3' end signal region. Point mutations which alter the octanucleotide provide evidence that it is important to the function of the 3' end signal. The GG462 mutation creates the sequence TTTGGTTATA and causes a fraction of the transcripts of the intact CYCl gene to be extended beyond the normal 3' end site. The fact that the altered 3' end signal remains almost maximally active (90% efficient) suggests that perhaps a tract of thymidine residues in the mRNA-parallel strand is not a specifically required feature of the 3' end signal but contributes to some "general property" which is necessary for efficient 3' end generation. Another striking tract consisting mostly of thymidine residues occurs in the mRNA-parallel strand just outside the boundaries of the 3' end signal, at positions +506 to +519 [T^CHg]. T n i s tract, though clearly not essential to 3' end generation, may be involved in providing the proper -256-sequence context for the 3' end signal. The CYC1AH5'(+497) deletion removes this thymidine tract and although it does not prevent 3' end generation, it does cause the production of a small proportion of extended CYCl transcripts. The Tl.36 mutation is a T:A transversion at position +465 which creates the sequence TgAATA. A pAll plasmid carrying the Tl.36 mutation allows lacZ to be expressed at levels 10- to 25-fold higher than the corresponding plasmid carrying the "wild-type" 3' end signal, pAll.71. LacZ expression from pAll plasmids completely lacking the 3' end signal exceeds that from pAll.Tl.36 by less than a factor of two. Its dramatic effect on lacZ expression suggests that the Tl.36 mutation seriously interferes with the function of the 3' end signal. (As discussed earlier, it must be borne in mind that the difference in lacZ expression between pAll.Tl.36 and other pAll plasmids may not be due entirely to differences in the process of 3' end generation.) The sequence in the immediate vicinity of position +465 must therefore be considered as a candidate for an essential component of the 3' end signal. This possibility should be tested by attempting to identify other mutations in the region using the pAll screening system. Mutations which allow greatly increased lacZ expression from pAll plasmids could then be introduced into the flanking sequences of the intact CYCl gene and tested directly for their effect on CYCl transcription. A sequence which is noteworthy for its absence from the CYCl 3' end signal region is the AATAAA hexanucleotide, which is almost universally present in the 3' flanking regions of higher eukaryotic genes and is known to be an essential part of the 3' end signal in several of them. -257-The CYCl 3' end signal contains the sequence ATTAA, but it seems fairly certain that this sequence is not crucial to transcript 3' end generation. The C482 mutation changed this sequence to ATCAA and did not cause the production of an extended transcript from an otherwise unaltered CYCl transcription unit. The Tl.34 mutation produced the sequence AATAA, and not surprisingly, pAll.Tl.34 did not exhibit elevated lacZ expression compared to plasmid pAll.71. In fact, pAll.Tl.34 seemed to direct lower levels of -^galactosidase synthesis than pAll.71, but the level of lacZ expression from either plasmid was so low that it is doubtful that the difference is significant. Zaret and Sherman (1982) pointed out that sequences closely related to AATAAA do not occur in regions flanking many yeast genes and are therefore unlikely to be important in 3' end generation. Henikoff et al. (1983) found that although the sequence AATAAA occurred in the 3' untranslated sequences of the Drosophila ADE8 gene fragment, this sequence could be deleted without interfering with 3' end generation in yeast. The results of the present study, then, are consistent with those reported by other workers in suggesting that sequences related to AATAAA are not required for 3' end generation in yeast. The C474 mutation carried by pAll.71 and its derivatives apparently did not inactivate the CYCl 3' end signal fragment carried on these plasmids. However, five other mutations which introduced C/G base pairs into the 3' end signal fragment all impaired its activity. While each may have affected some specifically required sequence, it is more plausible that all exerted an effect on 3' end generation by altering some general property of the 3' end signal. One interpretation is that a high proportion of A/T base pairs is important to 3' end generation. -258-As noted by Zaret and Sherman (1982), putative 3' end signal regions in yeast tend to have high A/T contents. The 50 bp CYCl 3' end signal fragment, for example, contains 40 A/T or T/A base pairs. Alternatively, it might be supposed that C/G base pairs, with C in the mRNA-parallel strand, are particularly injurious to the 3' end signal