UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression of C. elegans heat shock genes in mouse cells Kay, Robert James 1986

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1986_A1 K39.pdf [ 11.47MB ]
Metadata
JSON: 831-1.0097290.json
JSON-LD: 831-1.0097290-ld.json
RDF/XML (Pretty): 831-1.0097290-rdf.xml
RDF/JSON: 831-1.0097290-rdf.json
Turtle: 831-1.0097290-turtle.txt
N-Triples: 831-1.0097290-rdf-ntriples.txt
Original Record: 831-1.0097290-source.json
Full Text
831-1.0097290-fulltext.txt
Citation
831-1.0097290.ris

Full Text

EXPRESSION OF C. eleqans HEAT SHOCK GENES IN MOUSE CELLS By ROBERT JAMES KAY B . S c , The U n i v e r s i t y of B r i t i s h Columbia, 1980 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF BIOCHEMISTRY We accept t h i s t h e s i s as conforming to the r e q u i r e d standard THE UNIVERSITY OF^iBlfiTISH COLUMBIA November 1986 © Robert James Kay In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f the requirements f o r an advanced degree a t the U n i v e r s i t y o f B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and study. I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e copying o f t h i s t h e s i s f o r s c h o l a r l y purposes may be granted by the head o f my department o r by h i s or her r e p r e s e n t a t i v e s . I t i s understood t h a t copying or p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l not be allowed without my w r i t t e n p e r m i s s i o n . Department of /B/og/e^/y^y  The U n i v e r s i t y of B r i t i s h Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date S^f£. /2^< /?3<f i i A b s t r a c t The t r a n s c r i p t i o n a l c o n t r o l elements of a p a i r of d i v e r g e n t l y t r a n s c r i b e d C. eleqans heat s h o c k - i n d u e i b l e hspl6 genes were examined by e x p r e s s i n g the genes i n mouse c e l l s . For t h i s purpose, t r a n s f e c t i o n v e c t o r s c o n t a i n i n g elements necessary f o r bovine p a p i l l o m a v i r u s - m e d i a t e d extrachromosomal r e p l i c a t i o n were c o n s t r u c t e d . Genes i n s e r t e d i n t o these v e c t o r s c o u l d be e f f i c i e n t l y t r a n s c r i b e d upon i n t r o d u c t i o n i n t o mouse f i b r o b l a s t s . E l e v a t e d copy numbers of these v e c t o r s i n t r a n s f e c t e d c e l l s were dependent on e x p r e s s i o n of BPV gene products i n the same c e l l s , but were not dependent on the presence of c i s - a c t i n q bovine p a p i l l o m a v i r u s r e p l i c a t i o n sequences w i t h i n the v e c t o r . The w i l d - t y p e C. eleqans hspl6 genes were very e f f i c i e n t l y t r a n s c r i b e d i n t r a n s f e c t e d mouse c e l l s f o l l o w i n g i n d u c t i o n of the heat shock response by high temperature or a r s e n i t e treatment. The hspl6 promoter regions c o n t a i n sequences that c l o s e l y resemble the r e g u l a t o r y promoter elements of D r o s o p h i l a heat shock genes. The number and p o s i t i o n of these sequence elements was a l t e r e d i_n v i t r o and the m o d i f i e d hspl 6 genes were t e s t e d f o r t r a n s c r i p t i o n a l competence i n mouse c e l l s . A s i n g l e r e g u l a t o r y element c o u l d induce b i d i r e c t i o n a l t r a n s c r i p t i o n of the hspl6 gene p a i r . M u l t i p l e r e g u l a t o r y elements were r e q u i r e d f o r maximal t r a n s c r i p t i o n r a t e s . The o r i e n t a t i o n and c o n f i g u r a t i o n of the elements a l s o a f f e c t e d t r a n s c r i p t i o n . A mutation i n an a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequence t h a t i s found between the two hspl6 genes had no s i g n i f i c a n t e f f e c t on t r a n s c r i p t i o n . S p l i c i n g of the hspl6 t r a n s c r i p t s i n t r a n s f e c t e d mouse c e l l s was e i t h e r incomplete or o c c u r r e d at 3' s i t e s t h a t were l o c a t e d 20 to 60 base p a i r s downstream from the 3' s p l i c e s i t e that was used i n C. eleqans. The use of downstream 3' s p l i c e s i t e s was p o s s i b l y due to the u n u s u a l l y s h o r t l e n g t h of the hspl 6 gene i n t r o n s . The 3' p r o c e s s i n g of the hspl6 t r a n s c r i p t s was a l s o p a r t i a l l y d e f e c t i v e . Some t r a n s c r i p t s were c l e a v e d and ap p a r e n t l y p o l y a d e n y l a t e d i n mouse c e l l s at the same s i t e s that were used f o r 3' p r o c e s s i n g i n C. eleqans, while the remainder of the hspl6 t r a n s c r i p t s c o n t i n u e d through the normal p r o c e s s i n g s i t e i n t o downstream sequences. TABLE OF CONTENTS A b s t r a c t i i L i s t of Tables v i i i L i s t of F i g u r e s i x A b b r e v i a t i o n s x i i Acknowledgements x i v I. INTRODUCTION 1 1.1 The Heat Shock Response 1 1.2 The Heat Shock P r o t e i n s and Genes of D r o s o p h i l a 2 1.3 E x p r e s s i o n of D r o s o p h i l a Heat Shock Genes i n the Absence of S t r e s s 5 1.4 Common 5' Sequences of the D r o s o p h i l a Heat Shock Genes 6 1.5 E x p r e s s i o n of D r o s o p h i l a Hsp70 i n T r a n s f e c t e d Rodent C e l l s 7 1.6 Use of SV40 V e c t o r s f o r E x p r e s s i n g Genes i n Monkey C e l l s 9 1.7 I d e n t i f i c a t i o n of a H e a t - i n d u e i b l e Promoter Element .10 1.8 E x p r e s s i o n of Recombinant D r o s o p h i l a Heat Shock Genes i n D r o s o p h i l a C e l l s 12 1.9 C o n t r a s t s i n the E x p r e s s i o n of D r o s o p h i l a Heat Shock Genes i n Heterologous and Homologous C e l l s 15 1.10 P r o t e i n F a c t o r s Required f o r T r a n s c r i p t i o n of D r o s o p h i l a Heat Shock Genes .16 1.11 A Model f o r R e g u l a t i o n of T r a n s c r i p t i o n d u r i n g Heat Shock 19 1.12 P r o t e i n F a c t o r s Involved i n T r a n s c r i p t i o n of the D r o s o p h i l a A l c o h o l Dehydrogenase Gene 20 1.13 P r o t e i n F a c t o r s Involved i n T r a n s c r i p t i o n of Mammalian Genes 21 1.14 Heat Shock Genes of Organisms other than D r o s o p h i l a .23 1.15 Heat Shock Genes of C. elegans 26 1.16 E x p r e s s i o n of C. elegans Hspl6 Genes in Heterologous C e l l s 32 1.17 Bovine P a p i l l o m a v i r u s V e c t o r s 34 1.18 Use of PMS V e c t o r s f o r E x p r e s s i n g C. elegans Hspl6 Genes in Mouse C e l l s 37 I I . METHODS 39 2.1 General Methods for C l o n i n g and M a n i p u l a t i n g DNA ....39 2.2 Vector C o n s t r u c t i o n 40 2.3 Assembly of the Hspl 6 Gene P a i r i n pPN1 42 2.4 C o n s t r u c t i o n of pPNIDX, pPNIIX, and pPNIMX 45 2.5 C o n s t r u c t i o n of pPN2NF 47 2.6 C o n s t r u c t i o n of pPN2RM 47 2.7 Sequencing of Mutated Hspl6 Promoter Regions 50 2.8 C e l l C u l t u r e 50 2.9 T r a n s f e c t i o n 51 2.10 I n d u c t i o n of the Heat Shock Response .52 2.11 I s o l a t i o n of N u c l e i c A c i d s 52 2.12 Q u a n t i f y i n g N u c l e i c A c i d s 52 2.13 E l e c t r o p h o r e s i s of N u c l e i c A c i d s and T r a n s f e r to F i l t e r s 53 v i 2.14 P r e p a r a t i o n of L a b e l l e d DNA f o r H y b r i d i z a t i o n 54 2.15 F i l t e r H y b r i d i z a t i o n 55 2.16 P r e p a r a t i o n of L a b e l l e d S i n g l e - s t r a n d e d DNA f o r T r a n s c r i p t Mapping 56 2.17 T r a n s c r i p t Mapping by Nuclease S1 P r o t e c t i o n of S i n g l e - s t r a n d e d Probes 57 2.18 Q u a n t i f y i n g Genes and T r a n s c r i p t s 58 I I I . R e s u l t s 62 3.1 S t r u c t u r e of the Hsp16 Gene P a i r 62 3.2 Mutation and Rearrangement of the Hsp16 Gene P a i r ...62 3.3 Vector C o n s t r u c t i o n 64 3 . 4( Transf e c t i o n 67 3.5 S t r u c t u r e of T r a n s f e c t e d DNA 67 3.6 I n d u c t i o n of Mouse Heat Shock Genes 78 3.7 T r a n s c r i p t i o n of Genes on PN, ON, and CGBPV V e c t o r s .81 3.8 S e l e c t i o n of C e l l L i n e s f o r Comparative A n a l y s i s of T r a n s c r i p t i o n of the Hsp16 and NPT II Genes 89 3.9 S t r u c t u r e of the Hspl6 and NPT II Genes i n the C e l l L i n e s used f o r Comparative T r a n s c r i p t i o n a l A n a l y s i s 91 3.10 T r a n s c r i p t i o n of the Wild-type Hsp16 Gene P a i r 93 3.11 T r a n s c r i p t i o n of Mutated Hsp16 Gene P a i r s 99 3.12 S p l i c i n g of Hsp16 T r a n s c r i p t s 102 3.13 3' P r o c e s s i n g of Hsp16 t r a n s c r i p t s 102 v i i IV. DISCUSSION 114 4.1 S t r u c t u r e of Vector DNA i n T r a n s f e c t e d C e l l s 114 4.2 T r a n s c r i p t i o n a l Competence of T r a n s f e c t e d Genes ....117 4.3 Promoter Elements of the C. eleqans Hspl6 Genes that are A c t i v e i n Mouse C e l l s 119 4.4 E f f e c t of HSE M u l t i p l i c i t y on Promoter S t r e n g t h ....122 4.5 E f f e c t s of HSE C o n f i g u r a t i o n and O r i e n t a t i o n 126 4.6 Remote HSEs 128 4.7 Common Mechanism of Heat Shock Gene I n d u c t i o n by Heat and A r s e n i t e 129 4.8 Summary of HSE F u n c t i o n and Prospects f o r F u r t h e r Experimentation 129 4.9 S p l i c i n g of Hspl6 T r a n s c r i p t s 130 4.10 P r o c e s s i n g of the 3' Ends of Hspl6 T r a n s c r i p t s 134 4.11 U t i l i t y of CGBPV and PN V e c t o r s f o r I n t r o d u c i n g Genes i n t o Mammalian C e l l s 136 V. REFERENCES 139 v i i i L i s t of Tables I. Contents of PN-derived t r a n s f e c t i o n v e c t o r s 79 I I . Copy numbers and t r a n s c r i p t abundances of the hspl6 and NPT II genes i n t r a n s f e c t e d c e l l l i n e s 86 I I I . Abundances of hspl6 and NPT II t r a n s c r i p t s in c e l l l i n e s t r a n s f e c t e d with v a r i o u s hspl6 gene p a i r c o n s t r u c t s 97 IV. R a t i o s of hspl6 and NPT II t r a n s c r i p t s i n c e l l l i n e s t r a n s f e c t e d with v a r i o u s hspl6 gene p a i r c o n s t r u c t s 97 ix L i s t of F i g u r e s 1. S t r u c t u r e of the C. eleqans hspl6-1 + hspl6-48 lo c u s ..28 2. Sequence of the hspl 6 gene p a i r 29 3. Sequence of the DNA between the t r a n s c r i p t i o n i n i t i a t i o n s i t e s of hspl6-1 and hspl6-48 31 4. C o n s t r u c t i o n of t r a n s f e c t i o n v e c t o r s 41 5. C o n s t r u c t i o n of the t r a n s f e c t i o n v e c t o r pPQ1 43 6. Assembly of the hspl 6 gene p a i r i n pPN1 44 7. C o n s t r u c t i o n of pPNIDX, pPNIIX, and pPNIMX 46 8. C o n s t r u c t i o n of pPN2NF 48 9. C o n s t r u c t i o n of pPN2RM 49 10. The HSEs, TATA elements, and a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequences of the w i l d - t y p e and mutated hspl 6 gene p a i r s 63 11. S t r u c t u r e of the t r a n s f e c t i o n v e c t o r pCGBPV9 65 12. S t r u c t u r e of the t r a n s f e c t i o n v e c t o r pPN1 66 13. S t r u c t u r e of pPN2NF i n t r a n s f e c t e d c e l l s 69 14. S t r u c t u r e of l i n e a r i z e d BPV DNA i n t r a n s f e c t e d c e l l s ..70 15. S t r u c t u r e of i n t a c t BPV DNA i n t r a n s f e c t e d c e l l s 71 16. S t r u c t u r e of the non-BPV DNA w i t h i n CGBPV v e c t o r s i n t r a n s f e c t e d c e l l s 72 17. S t r u c t u r e of i n t a c t CGBPV v e c t o r s i n t r a n s f e c t e d c e l l s . 7 3 18. E f f e c t s of BPV genes and PMSs on v e c t o r copy number in t r a n s f e c t e d c e l l s 75 19. S t r u c t u r e of pONIWT i n the presence or absence of c o - t r a n s f e c t e d BPV DNA 76 X 20. S t r u c t u r e of s u p e r - t r a n s f e c t e d v e c t o r s i n BP V - t r a n s f e c t e d c e l l s 77 21. S t r u c t u r e s of v a r i o u s PN ve c t o r d e r i v a t i v e s i n t r a n s f e c t e d c e l l s 80 22. Endogenous hsp70-homologous t r a n s c r i p t s i n C127 c e l l s 82 23. S t r u c t u r e of the hspl6 gene p a i r and the probes used f o r t r a n s c r i p t i n i t i a t i o n s i t e mapping 84 . 24. Hspl6-1 and NPT II gene t r a n s c r i p t s i n pPN2NF-transfected c e l l s 85 25. Hspl6-1 and NPT II gene t r a n s c r i p t s i n c e l l s t r a n s f e c t e d with pONIWT or pCGBPV9WT 88 26. S t r u c t u r e s and copy numbers of the hspl6 gene p a i r s and NPT II genes i n the t r a n s f e c t e d c e l l l i n e s used f o r comparative t r a n s c r i p t i o n a l a n a l y s i s 92 27. Q u a n t i f i c a t i o n and i n i t i a t i o n s i t e mapping of hspl6-1 t r a n s c r i p t s 94 28. Q u a n t i f i c a t i o n and i n i t i a t i o n s i t e mapping of hspl6-48 t r a n s c r i p t s 95 29. Q u a n t i f i c a t i o n of hspl6-1 t r a n s c r i p t s i n t r a n s f e c t e d c e l l s a f t e r v a r i o u s c o n d i t i o n s of heat shock 98 30. NPT II gene t r a n s c r i p t s i n t r a n s f e c t e d c e l l s 100 31. The t r a n s c r i p t s of the hspl6 genes and the probes used to d e f i n e t h e i r s t r u c t u r e 103 32. S p l i c e s i t e s of hspl6-1 t r a n s c r i p t s 104 33. S p l i c e s i t e s of hspl6-48 t r a n s c r i p t s 105 x i 34. Sequences around the hspl6 s p l i c e s i t e s 106 35. 3' t e r m i n i of hspl6 t r a n s c r i p t s 108 36. Sequences around the 3' t e r m i n i of hspl6 t r a n s c r i p t s .109 37. S i z e s of hspl6-1 and hspl6-48 t r a n s c r i p t s 110 38. S i z e s of hspl 6 and NPT II t r a n s c r i p t s 111 39. T r a n s c r i p t s of hspl6-48 and the NPT II gene 112 x i i A b b r e v i a t ions A adenine b bases bp base p a i r s BPV bovine p a p i l l o m a v i r u s C c y t o s i n e cpm counts per minute DME/FBS Dulbecco's m o d i f i e d Eagle's medium c o n t a i n i n g 10% f e t a l bovine serum DNA d e o x y r i b o n u c l e i c a c i d dATP deoxyadenosine-5'-triphosphate dCTP d e o x y c y t i d i n e - 5 ' - t r i p h o s p h a t e dGTP deoxyguanosine-5'-triphosphate dTTP deoxythymidine-5'-triphosphate DNA d e o x y r i b o n u c l e i c a c i d EBV E p s t e i n - B a r r v i r u s EDTA ethylenediamine t e t r a a c e t i c a c i d G guanine-HEPES N - 2 - h y d r o x y e t h y l p i p e r a z i n e - N ' - 2 - e t h a n e s u l f o n i c a c i d HSE heat shock promoter element HSP heat shock p o l y p e p t i d e hsp heat shock p o l y p e p t i d e gene HSTF D r o s o p h i l a heat shock t r a n s c r i p t i o n f a c t o r HSV herpes simplex v i r u s mRNA messenger r i b o n u c l e i c a c i d N any base, e.g. A, C, G, or T NPT II neomycin phosphotransferase type II PMS plasmid maintenance sequence x i i i polyA p o l y a d e n y l i c a c i d RNA r i b o n u c l e i c a c i d RNase r i b o n u c l e a s e rRNA ribosomal r i b o n u c l e i c a c i d SDS sodium dodecyl s u l f a t e SV40 simian v i r u s 40 T thymine TBE 90 mM T r i s - b o r a t e pH 8.1, 1 mM Na 2EDTA tk thymidine kinase T r i s tris(hydroxymethyl)aminomethane tRNA t r a n s f e r r i b o n u c l e i c a c i d U urac i 1 Y pyr imidine x i v ACKNOWLEDGEMENTS Everyone i n Peter Candido's l a b has c o n t r i b u t e d to t h i s t h e s i s . Peter i n i t i a t e d the p r o j e c t and p r o v i d e d the time, space, ideas, and encouragement that were needed to complete i t . Robert B o i s s y and Roland Russnak were d i r e c t l y i n v o l v e d i n the assembly and a n a l y s i s of the heat shock genes. The methods used i n t h i s study were developed and r e f i n e d by our c o l l e c t i v e e f f o r t s , and the t e x t of the t h e s i s i s a d i s t i l l a t i o n of many hours of d i s c u s s i o n s among a l l of us. Of equal importance was the camaraderie and enthusiasm of my f r i e n d s , which made i t a l l worthwhile. 1 I. INTRODUCTION - Heat shock genes provide e x c e l l e n t models f o r s t u d y i n g the mechanisms i n v o l v e d i n r e g u l a t i n g gene e x p r e s s i o n . T h i s work d e s c r i b e s the t r a n s f e r of heat shock genes from the nematode C a e n o r h a b d i t i s elegans to c u l t u r e d mouse c e l l s and the behaviour of these genes in t h e i r new c e l l u l a r environment. 1.1 The Heat Shock Response When i s o l a t e d c e l l s or whole organisms are s u b j e c t e d to e x c e s s i v e l y h i g h temperatures they s y n t h e s i z e a s p e c i f i c set of p r o t e i n s , c a l l e d heat shock p o l y p e p t i d e s (HSPs), and c o n c u r r e n t l y c u r t a i l the s y n t h e s i s of most other p r o t e i n s (reviewed i n r e f s . 1-4). S y n t h e s i s of the same or a s i m i l a r set of p r o t e i n s i s a l s o induced by many other agents which have d i v e r s e d e l e t e r i o u s e f f e c t s on c e l l growth and metabolism (compiled and reviewed i n r e f s . 1 a n d 4 2 ) . The new p a t t e r n of p r o t e i n s y n t h e s i s i n s t r e s s e d c e l l s i s the r e s u l t of a r a d i c a l r e s t r u c t u r i n g of gene e x p r e s s i o n . T h i s phenomenom i s r e f e r r e d to as the heat shock response, i r r e s p e c t i v e of the agent which induces i t . The HSPs may be i n v o l v e d i n p r o t e c t i n g v a r i o u s components of c e l l s from the d e s t r u c t i v e e f f e c t s of heat and other hazardous treatments (reviewed i n r e f . 4), but the modes of a c t i o n of HSPs i n such p r o t e c t i v e r o l e s have not been determined. The heat shock response was f i r s t observed i n D r o s o p h i l a 2 melanoqaster. In some t i s s u e s of t h i s small f l y , the changes i n gene e x p r e s s i o n that are induced by heat and other s t r e s s agents can be d e t e c t e d with the l i g h t microscope by the appearance of l a r g e d i s t e n s i o n s , c a l l e d p u f f s , a t the s i t e s of a c t i v e l y t r a n s c r i b e d genes i n po l y t e n e chromosomes (reviewed i n r e f . 1). The i n i t i a l c h a r a c t e r i z a t i o n of the p u f f i n g p a t t e r n s a s s o c i a t e d with the heat shock response was f o l l o w e d by thorough s t u d i e s of HSP s y n t h e s i s , and of the s t r u c t u r e and t r a n s c r i p t i o n of the genes which encode the HSPs. C u r r e n t l y , much more i s known about the molecular g e n e t i c s of the heat shock response i n D r o s o p h i l a than i n any other eukaryote. The e x p r e s s i o n of D r o s o p h i l a heat shock genes w i l l be d i s c u s s e d i n d e t a i l , and then compared to the e x p r e s s i o n of the heat shock genes of other eukaryotes, p a r t i c u l a r l y those of C. elegans. 1.2 The Heat Shock P r o t e i n s and Genes of D r o s o p h i l a D r o s o p h i l a are normally grown i n the l a b o r a t o r y at temperatures ranging from 20 to 25°C. When the temperature i s r a i s e d to 37°C, s y n t h e s i s of almost a l l of the p r o t e i n s which were present p r i o r to the heat shock i s suppressed, and at the same time the r a t e s of s y n t h e s i s of seven major p r o t e i n types are g r e a t l y i n c r e a s e d (5-7). These major D r o s o p h i l a HSPs are named HSP83, HSP70, HSP68, HSP28, HSP26, HSP23, and HSP22, with the numbers r e f e r r i n g to the o r i g i n a l e s t i m a t e s of t h e i r masses in k i l o d a l t o n s . The l a t t e r four p r o t e i n s are c o l l e c t i v e l y r e f e r r e d to as the small HSPs. The genes which encode the major D r o s o p h i l a HSPs have been 3 c l o n e d and sequenced. The gene encoding HSP83, which i s d e s i g n a t e d hsp83, i s present i n a s i n g l e copy per h a p l o i d genome (8-10). I t i s i n a chromosomal p o s i t i o n that i s i s o l a t e d from a l l other heat shock genes. Hsp68 i s a l s o an i s o l a t e d s i n g l e copy gene (8) . There are f i v e hsp70 genes; two of these are found w i t h i n 9000 base p a i r s (bp) at one l o c u s and the remaining three are c l u s t e r e d w i t h i n 50,000 bp at a separate but c y t o l o g i c a l l y adjacent l o c u s (8,11,12). The p r o t e i n s encoded by the hsp70 genes are about 96% homologous to each o t h e r , and about 75% homologous to the p r e d i c t e d p r o t e i n product of hsp68 (8,9,13-15). The small heat shock genes are c l u s t e r e d w i t h i n 12,000 bp (16-18). They encode p r o t e i n s which are homologous i n an 83 amino a c i d - l o n g domain at t h e i r C - t e r m i n a l ends (19)'. Three a d d i t i o n a l genes which encode minor h e a t - i n d u e i b l e p r o t e i n s are found w i t h i n the same g e n e t i c l o c u s as the small heat shock genes (19-21). S y n t h e s i s of HSPs i n response to heat shock i s dependent on induced t r a n s c r i p t i o n of t h e i r genes. T h i s was i m p l i e d by the o b s e r v a t i o n that mRNA from heat shocked c e l l s s p e c i f i c a l l y h y b r i d i z e s to the chromosomal p u f f s at the s i t e s of heat shock genes (22-24), and was more d i r e c t l y demonstrated by b l o c k i n g HSP s y n t h e s i s i n heat shocked D r o s o p h i l a s a l i v a r y glands or c u l t u r e d c e l l s with actinomycin D, which i n h i b i t s new t r a n s c r i p t i o n without a f f e c t i n g t r a n s l a t i o n of p r e - e x i s t i n g t r a n s c r i p t s (6,7). Subsequently, gene fragments have been used as h y b r i d i z a t i o n probes to show that most heat shock gene t r a n s c r i p t s are e i t h e r absent or present i n low amounts i n 4 uninduced c e l l s and r a p i d l y accumulate to high l e v e l s i n heat shocked c e l l s (7,13,14,25-28). During prolonged heat shock, t r a n s c r i p t i o n of heat shock genes i s p r o g r e s s i v e l y i n h i b i t e d ; t h i s i s dependent on s y n t h e s i s of f u n c t i o n a l p r o t e i n s d u r i n g heat shock, s u g g e s t i n g that t r a n s c r i p t i o n of heat shock genes i s s e l f - r e g u l a t e d through r e p r e s s i o n by one or more of the products of these genes (29). T r a n s c r i p t i o n of most non-heat shock genes i s r e p r e s s e d by heat shock (5,22-24,26,30), although the l e v e l s of t h e i r t r a n s c r i p t s are not s i g n i f i c a n t l y d e p l e t e d by d e g r a d a t i o n d u r i n g a s h o r t p e r i o d of heat shock (31,32). The r a p i d d e c l i n e i n the r a t e of s y n t h e s i s of normal c e l l u l a r p r o t e i n s d u r i n g heat shock i s p r i m a r i l y a r e s u l t of changes i n the t r a n s c r i p t s p e c i f i c i t y of the t r a n s l a t i o n a l apparatus. L y s a t e s of uninduced c u l t u r e d D r o s o p h i l a c e l l s can support e f f i c i e n t t r a n s l a t i o n of a l l t r a n s c r i p t s , i n c l u d i n g those of heat shock genes; i n c o n t r a s t , l y s a t e s of heat shocked c e l l s w i l l e f f i c i e n t l y t r a n s l a t e heat shock gene t r a n s c r i p t s but the r a t e s of t r a n s l a t i o n a l i n i t i a t i o n and e l o n g a t i o n of p e p t i d e s encoded by non-heat shock t r a n s c r i p t s are g r e a t l y reduced (31,33-36). The same form of t r a n s l a t i o n a l c o n t r o l of gene e x p r e s s i o n i s observed i n i n t a c t c e l l s ; heat shock gene t r a n s c r i p t s are s e l e c t i v e l y t r a n s l a t e d at 37°C, and a l l types of t r a n s c r i p t s can be e f f i c i e n t l y t r a n s l a t e d at 25°C, both p r i o r to and d u r i n g recovery from heat shock (29,32). General t r a n s l a t i o n a l competence can be c o n f e r r e d on l y s a t e s of heat shocked c e l l s by supplementing them with t r a n s l a t i o n f a c t o r s from l y s a t e s of uninduced c e l l s (33,36). S e l e c t i v e 5 t r a n s l a t i o n of heat shock gene t r a n s c r i p t s d u r i n g heat shock i s dependent on s p e c i f i c sequences at t h e i r 5' ends, as demonstrated by e x p r e s s i o n of J j i v i t r o - m u t a t e d hsp70 and hsp22 genes i n t r a n s f e c t e d c u l t u r e d c e l l s and transformed f l i e s , r e s p e c t i v e l y (37,38). When c u l t u r e d D r o s o p h i l a c e l l s or f l i e s are re t u r n e d to t h e i r normal growth temperature a f t e r a p e r i o d of heat shock, t r a n s c r i p t i o n of normally expressed genes resumes and t r a n s c r i p t i o n of heat shock genes i s r e p r e s s e d (26,29,39). Both the newly s y n t h e s i z e d and p r e - e x i s t i n g t r a n s c r i p t s of non-heat shock genes are e f f i c i e n t l y t r a n s l a t e d (29,31), while the heat shock gene t r a n s c r i p t s produced d u r i n g the heat shock p e r i o d are now s e l e c t i v e l y degraded (28,29). Thus, the r e s t r u c t u r i n g of gene e x p r e s s i o n that i s induced by heat shock i s r e v e r s e d when normal c o n d i t i o n s are r e s t o r e d . 1.3 E x p r e s s i o n of D r o s o p h i l a Heat Shock Genes i n the Absence of S t r e s s Some HSPs are s y n t h e s i z e d by D r o s o p h i l a i n the absence of heat shock or any other harmful c o n d i t i o n . T r a n s c r i p t s of hsp83 are abundantly t r a n s c r i b e d and t r a n s l a t e d i n c u l t u r e d c e l l s under normal growth c o n d i t i o n s (7,25). HSP83 i s a l s o s y n t h e s i z e d at high l e v e l s d u r i n g l a t e r stages of embryogenesis (40). Hsp83, hsp28, and hsp26 are t r a n s c r i p t i o n a l l y a c t i v e i n o v a r i a n nurse c e l l s ; the t r a n s c r i p t s are t r a n s p o r t e d to eggs where they are s t o r e d and t r a n s l a t e d d u r i n g egg maturation and i n p r e -blastoderm embryos (41). A l l four of the small heat shock genes 6 are induced i n imaginal d i s k s or c u l t u r e d c e l l s by treatment with the developmental hormone ecdysterone (28,42-44). HSP23 i s s y n t h e s i z e d i n l a r g e amounts j u s t p r i o r to pupation, when d i f f e r e n t i a t i o n i s being induced by an i n c r e a s e i n the l e v e l of endogenous ecdysterone (21,44). S y n t h e s i s of HSP22 and HSP23 i s induced by drugs that d i s r u p t d i f f e r e n t i a t i o n of embryonic n e u r a l and muscle c e l l s i n c u l t u r e (45). E x p r e s s i o n of hsp83 and the small heat shock genes, t h e r e f o r e , i s developmentally r e g u l a t e d by the a c t i o n of hormones and other endogenous f a c t o r s in a d d i t i o n to being induced by heat and other s t r e s s agents. Hsp68 and the f i v e hsp70 genes are t r a n s c r i b e d at very low l e v e l s i n the absence of s t r e s s i n both d e v e l o p i n g embryos and a d u l t f l i e s (13,14,26,27,41,43). However, three other genes, which encode p r o t e i n s with 75% homology to HSP70, are c o n s t i t u t i v e l y t r a n s c r i b e d (46,47). U n l i k e the hsp68 and hsp70 genes, they are u n a f f e c t e d by heat shock and are d i f f e r e n t i a l l y expressed d u r i n g development. These genes are d e s i g n a t e d heat shock cognate genes. 1.4 Common 5' Sequences of the D r o s o p h i l a Heat Shock Genes The c o o r d i n a t e r e g u l a t i o n of the D r o s o p h i l a heat shock genes i n response to heat and other s t r e s s agents suggests that they are induced by a common mechanism. The p u t a t i v e promoter r e g i o n s of these genes have been searched f o r common sequences that c o u l d be r e q u i r e d f o r heat-induced t r a n s c r i p t i o n . The hsp70 genes are h i g h l y homologous throughout a region which extends more than one hundred bp upstream from the s i t e of i n i t i a t i o n of 7 t r a n s c r i p t i o n (13-15). However, the c o n s e r v a t i o n of t h i s r e g i o n c o u l d r e s u l t from gene c o n v e r s i o n among hsp70 genes r a t h e r than p r e s e r v a t i o n of promoter f u n c t i o n (48). The r e g i o n s upstream from the i n i t i a t i o n s i t e s of the other heat shock genes are not h i g h l y homologous, i n d i c a t i n g t h at an e x t e n s i v e and s p e c i f i c 5' sequence i s not e s s e n t i a l f o r h e a t - i n d u c i b i l i t y . A l l of the D r o s o p h i l a heat shock genes have a v a r i a t i o n of the sequence TATAAA, r e f e r r e d to as a TATA element, l o c a t e d 20 to 30 bp upstream from the t r a n s c r i p t i o n i n i t i a t i o n s i t e (8,9,13-15,19,49). TATA elements are found i n the same p o s i t i o n i n almost a l l e u k a r y o t i c genes; t h i s promoter element i s r e q u i r e d f o r a c c u r a t e and e f f i c i e n t i n i t i a t i o n of t r a n s c r i p t i o n (reviewed in r e f . 50). Short and imperfect i n v e r t e d repeats are found upstream from the TATA elements of some of the D r o s o p h i l a heat shock genes (9,49), but i n v e r t e d repeats per se presumably would not be s u f f i c i e n t to c o n f e r h e a t - i n d u c i b i l i t y on a gene. A l l four of the sma l l heat shock genes have the heptamer ACTTTCA l o c a t e d about 190 bp upstream from the i n i t i a t i o n s i t e (49), but t h i s sequence i s not found i n the 5' r e g i o n s of the other heat shock genes. 1.5 E x p r e s s i o n of D r o s o p h i l a Hsp70 i n T r a n s f e c t e d Rodent C e l l s The t r a n s c r i p t i o n a l c o n t r o l sequences of D r o s o p h i l a heat shock genes were i d e n t i f i e d by examining the e x p r e s s i o n of i n y_itro-mutated genes i n g e n e t i c a l l y transformed c e l l s . The i n i t i a l s t u d i e s on the promoters of D r o s o p h i l a hsp70 genes used mammalian c e l l s as the s i t e of e x p r e s s i o n . 8 Some c u l t u r e d c e l l types w i l l take up DNA i n the c u l t u r e medium by e n d o c y t o s i s , when the DNA i s complexed with a c a r r i e r such as DEAE-dextran or a c a l c i u m phosphate p r e c i p i t a t e (51-55). In a small p r o p o r t i o n of the c e l l s , one or more of the i n c o r p o r a t e d DNA molecules become s t a b l y i n t e g r a t e d i n t o the chromosomes. If the genes i n the t r a n s f e c t e d DNA are t r a n s c r i p t i o n a l l y a c t i v e and encode a product that i s e s s e n t i a l f o r c e l l growth, such as a metabolic enzyme or an i n h i b i t o r of an a n t i b i o t i c , t r a n s f e c t e d c e l l l i n e s can be s e l e c t i v e l y i s o l a t e d from the c e l l c u l t u r e . A complete D r o s o p h i l a hsp70 gene, i n c l u d i n g more than 1000 bp of DNA upstream from the t r a n s c r i p t i o n i n i t i a t i o n s i t e , was i n t r o d u c e d i n t o mouse or r a t f i b r o b l a s t s by c o - t r a n s f e c t i o n with a s e l e c t a b l e gene (56,57). In some c e l l l i n e s , the t r a n s f e c t e d hsp70 genes were t r a n s c r i p t i o n a l l y a c t i v e when the rodent c e l l s were heat shocked at 45°C, and were i n a c t i v e at 37°C. The t r a n s f e c t e d heat shock genes, t h e r e f o r e , were r e g u l a t e d i n response to heat shock c o n d i t i o n s that were a p p r o p r i a t e to the host c e l l . The h i g h e s t l e v e l s of D r o s o p h i l a hsp70 t r a n s c r i p t s o b t a i n e d i n rodent c e l l s were more than t e n - f o l d lower than the hsp70 t r a n s c r i p t s i n heat shocked D r o s o p h i l a c e l l s , and most of the t r a n s f e c t e d c e l l l i n e s had much lower or u n d e t e c t a b l e l e v e l s of hsp70 t r a n s c r i p t s . T r a n s f e c t e d genes are o f t e n expressed with low and v a r i a b l e e f f i c i e n c i e s a f t e r i n t e g r a t i o n i n t o the host c e l l chromosomes (52,53), due i n p a r t to undefined f a c t o r s which vary with the s i t e of i n t e g r a t i o n . S i t e - s p e c i f i c i n t e g r a t i o n e f f e c t s probably c o n t r i b u t e d to the low e f f i c i e n c y of 9 t r a n s c r i p t i o n of the t r a n s f e c t e d hsp70 genes i n rodent c e l l s , although i n a d d i t i o n to the r e p r e s s i v e e f f e c t s of i n t e g r a t i o n , D r o s o p h i l a heat shock promoters may be i n h e r e n t l y i n e f f i c i e n t in h eterologous c e l l s . However, D r o s o p h i l a hsp70 genes that are i n t e g r a t e d i n t o the chromosomes of c u l t u r e d D r o s o p h i l a c e l l s a f t e r t r a n s f e c t i o n are a l s o i n e f f i c i e n t l y expressed, r e l a t i v e to the endogenous hsp70 genes in the same c e l l s (37). 1.6 Use of SV40 V e c t o r s f o r E x p r e s s i n g D r o s o p h i l a Heat Shock Genes i n Monkey C e l l s Subsequent s t u d i e s on the e x p r e s s i o n of D r o s o p h i l a heat shock genes in mammalian c e l l s have used a t r a n s i e n t t r a n s f e c t i o n system based on the r e p l i c a t i v e p r o p e r t i e s of simian v i r u s 40 (SV40). The DNA of SV40 i s c o n t i n u a l l y r e p l i c a t e d as extrachromosomal episomes i n i n f e c t e d monkey c e l l s (reviewed i n r e f . 58). R e p l i c a t i o n i s dependent on a SV40-s p e c i f i c o r i g i n of r e p l i c a t i o n i n the episomal DNA and on the presence of T a n t i g e n , which i s a product of e a r l y SV40 gene e x p r e s s i o n . C u l t u r e d monkey c e l l l i n e s which c o n s t i t u t i v e l y express T a n t i g e n (COS c e l l s ) have been e s t a b l i s h e d (59). When v e c t o r s that c o n t a i n the SV40 o r i g i n of r e p l i c a t i o n are i n t r o d u c e d i n t o COS c e l l s by t r a n s f e c t i o n , the v e c t o r DNA i s r e p l i c a t e d i n the same manner as SV40, r e s u l t i n g i n the accumulation of many tens of thousands of extrachromosomal c o p i e s of v e c t o r DNA w i t h i n two days a f t e r t r a n s f e c t i o n (60). During t h i s p e r i o d , the t r a n s c r i p t i o n a l a c t i v i t y of a gene c a r r i e d on the v e c t o r can be assayed. Because the t r a n s f e c t e d 10 genes are not a f f e c t e d by i n t e g r a t i o n and t h e i r l a r g e numbers obscure the consequences of v a r i a t i o n i n t r a n s c r i p t i o n a l a c t i v i t y between i n d i v i d u a l genes, the e x p r e s s i o n of genes on r e p l i c a t i n g SV40 v e c t o r s i s g e n e r a l l y c o n s i s t e n t . As a r e s u l t , these v e c t o r s can be used to compare the t r a n s c r i p t i o n a l competence of d i f f e r e n t genes. 1.7 I d e n t i f i c a t i o n of a H e a t - i n d u e i b l e Promoter Element by E x p r e s s i o n of Mutated D r o s o p h i l a Heat Shock Genes i n Heterologous C e l l s The SV40 vector/COS c e l l system has been used to d e f i n e the b a s i c heat i n d u c i b l e promoter element of the D r o s o p h i l a hsp70 genes. As observed i n t r a n s f e c t e d rodent c e l l s , D r o s o p h i l a hsp70 genes that had been i n t r o d u c e d i n t o COS c e l l s on SV40 v e c t o r s were induced by temperatures that e l i c i t the heat shock response of the host c e l l (61,62). Strong h e a t - i n d u c i b i l i t y was r e t a i n e d i n hsp70 genes which were t r u n c a t e d 66 bp upstream from the i n i t i a t i o n s i t e , but i n d u c i b i l i t y was l o s t when an a d d i t i o n a l 13 bp was removed from the 5' end (61,62). The TATA element was not a f f e c t e d by the d e l e t i o n s that e l i m i n a t e d h e a t - i n d u c i b i l i t y . The e s s e n t i a l r e g i o n of the hsp70 promoter that was d e f i n e d by these experiments i n c l u d e s the sequence CTCGAATGTTCGCG. V a r i a n t s of t h i s 14 bp sequence are a l s o found upstream from the TATA elements and i n i t i a t i o n s i t e s of the other heat shock genes of D r o s o p h i l a (62-64). The consensus sequence of t h i s promoter element, r e f e r r e d to as a heat shock element or HSE, i s CNNGAANNTTCNNG (63). The d i r e c t r o l e of the HSE i n c o n f e r r i n g 11 h e a t - i n d u c i b i l i t y on a promoter was demonstrated by r e p l a c i n g the upstream promoter elements of the herpes simplex v i r u s thymidine kinase gene (HSV tk) with s y n t h e t i c o l i g o n u c l e o t i d e s . Only the HSV tk genes which c o n t a i n e d i n s e r t e d o l i g o n u c l e o t i d e s that matched the HSE consensus sequence i n at l e a s t s i x of the e i g h t s p e c i f i e d bases were h e a t - i n d u e i b l e i n t r a n s f e c t e d COS c e l l s (65). In a d d i t i o n to the HSE c e n t r e d 56 bp upstream from the i n i t i a t i o n s i t e , the D r o s o p h i l a hsp70 gene has three a d d i t i o n a l HSEs c e n t r e d at p o s i t i o n s -247, -177, and -78. P o s i t i o n s are d e s i g n a t e d by t h e i r d i s t a n c e from the s i t e of i n i t i a t i o n of t r a n s c r i p t i o n , with sequences that are upstream from the i n i t i a t i o n s i t e having negative numbers and downstream sequences having p o s i t i v e numbers. D e l e t i o n of the three upstream HSEs had no n o t i c e a b l e e f f e c t on the e f f i c i e n c y of t r a n s c r i p t i o n of the hsp70 gene i n t r a n s f e c t e d COS c e l l s (61,62) . E x p r e s s i o n of the D r o s o p h i l a hsp70 gene was a l s o p r o p e r l y r e g u l a t e d a f t e r i n j e c t i o n of the gene i n t o Xenopus oocytes (66,67). As observed i n COS c e l l s , h e a t - i n d u c i b i l i t y i n the oocytes was dependent on the HSE proximal to the TATA element of the hsp70 gene (67), and a s i n g l e s y n t h e t i c HSE c o n f e r r e d heat-i n d u c i b i l i t y on the HSV tk gene (65). The small heat shock genes of D r o s o p h i l a have a l s o been expressed i n COS c e l l s by the use of SV40 v e c t o r s . Both hsp22 and hsp26 were i n a c t i v e i n COS c e l l s under normal growth c o n d i t i o n s and were s t r o n g l y induced by heat shock (68). Hsp22 has three o v e r l a p p i n g HSEs c e n t r e d at p o s i t i o n -80, while hsp26 1 2 has two o v e r l a p p i n g HSEs c e n t r e d at p o s i t i o n -60 and four a d d i t i o n a l HSEs that are d i s p e r s e d between p o s i t i o n s -360 and -180 (19,49,69). The other two small heat shock genes were not r e g u l a t e d by heat i n COS c e l l s . HSP28 was not t r a n s c r i b e d under any c o n d i t i o n s i n t r a n s f e c t e d COS c e l l s (68). The four HSEs of t h i s gene are d i s p e r s e d between p o s i t i o n s -350 and -210,(64). Hsp23 was c o n s t i t u t i v e l y t r a n s c r i b e d i n t r a n s f e c t e d COS c e l l s and was not induced by heat shock (68). T h i s gene has three HSEs c e n t r e d at p o s i t i o n s -172, -140, and -130 (19,70). In c o n t r a s t to i t s behavior i n COS c e l l s , hsp23 was heat i n d u c i b l e i n Xenopus oocytes, and i n d u c t i o n was dependent on a re g i o n that i n c l u d e s the HSE at p o s i t i o n -140 (70). 1.8 E x p r e s s i o n of Recombinant D r o s o p h i l a Heat Shock Genes i n D r o s o p h i l a C e l l s Methods f o r i n t r o d u c i n g genes i n t o D r o s o p h i l a c e l l s have been developed r e c e n t l y , and are being used to d e f i n e the promoter elements that are r e q u i r e d f o r the n a t u r a l f u n c t i o n of the D r o s o p h i l a heat shock genes. Under the r i g h t c o n d i t i o n s , c u l t u r e d D r o s o p h i l a c e l l s can be d i r e c t l y t r a n s f e c t e d with DNA (71,72). E x p r e s s i o n of the in t r o d u c e d genes can be assayed soon a f t e r t r a n s f e c t i o n , when the t r a n s f e c t e d DNA i s t r a n s i e n t l y maintained as n o n - r e p l i c a t i n g extrachromosomal episomes. Genes can be s t a b l y i n s e r t e d i n t o the chromosomes of D r o s o p h i l a by P element-mediated t r a n s f o r m a t i o n . P elements are 13 g e n e t i c elements which are m o b i l i z e d i n s p e c i f i c s t r a i n s of D r o s o p h i l a , r e s u l t i n g i n t h e i r t r a n s p o s i t i o n to new chromosomal l o c a t i o n s (73). When v e c t o r s c o n t a i n i n g P element DNA are i n j e c t e d i n t o e a r l y embryos of the a p p r o p r i a t e s t r a i n of D r o s o p h i l a , the P element DNA and any gene p l a c e d w i t h i n i t becomes i n t e g r a t e d i n t o a s m a l l number of randomly p l a c e d s i t e s i n the chromosomes of the embryonic c e l l s (74,75). E x p r e s s i o n of the i n t e g r a t e d genes can then be examined i n s p e c i f i c t i s s u e s of embryos, l a r v a e , and a d u l t f l i e s . D r o s o p h i l a hsp70 genes were h e a t - i n d u e i b l e a f t e r being i n t r o d u c e d i n t o D r o s o p h i l a c e l l s by e i t h e r P element-mediated t r a n s f o r m a t i o n of embryos (76-79) or t r a n s f e c t i o n of c u l t u r e d c e l l s (71,72). T r a n s f o r m a t i o n of embryos with hsp70 genes that were t r u n c a t e d at t h e i r 5' ends, and subsequent a n a l y s i s of the e x p r e s s i o n of the i n t r o d u c e d genes i n the r e s u l t i n g l a r v a e and a d u l t f l i e s , demonstrated that both of the HSEs proximal to the TATA element ( i . e . those at p o s i t i o n s -56 and -78) are r e q u i r e d f o r h e a t - i n d u c i b i l i t y (77-79). The same r e s u l t was obtained with c u l t u r e d c e l l s t h a t were t r a n s i e n t l y t r a n s f e c t e d with t r u n c a t e d hsp70 genes (72). An HSV tk gene with a s i n g l e s y n t h e t i c HSE upstream from the TATA element, which was h e a t - i n d u c i b l e i n COS c e l l s and Xenopus oocyt e s , was not i n d u c i b l e i n t r a n s i e n t l y t r a n s f e c t e d D r o s o p h i l a c e l l s (80). A l l four of the s m a l l heat shock genes were induced by heat shock or ecdysterone a f t e r being i n t r o d u c e d i n t o c u l t u r e d D r o s o p h i l a c e l l s by t r a n s i e n t t r a n s f e c t i o n (80). D e l e t i o n of the sequences l y i n g 120 bp or more upstream from the i n i t i a t i o n s i t e 1 4 of hsp23 e l i m i n a t e d both heat- and e c d y s t e r o n e - i n d u c i b i l i t y (80). T h i s d e l e t i o n removes the HSE at p o s i t i o n -140 which i s r e q u i r e d f o r h e a t - i n d u c i b i l i t y i n Xenopus oocytes. Hsp26 and hsp28 genes which i n c l u d e d e x t e n s i v e upstream sequences were both h e a t - i n d u c i b l e and a p p r o p r i a t e l y expressed d u r i n g development in transformed f l i e s (64,69,81). The d i s t i n c t r e g u l a t o r y elements in the upstream sequences of these genes have been i d e n t i f i e d by examining the e f f e c t s of d e l e t i o n s on the e x p r e s s i o n of the two genes i n transformed f l i e s . A r e g i o n of the hsp26 promoter between p o s i t i o n s -340 and -240, which c o n t a i n s three HSEs, was e s s e n t i a l f o r e f f i c i e n t t r a n s c r i p t i o n d u r i n g heat shock (69). The three other HSEs that are found betwen p o s i t i o n -240 and the TATA element c o u l d support o n l y a low l e v e l of h e a t - i n d u c i b l e t r a n s c r i p t i o n i n the absence of the HSEs f u r t h e r upstream. The r e g i o n between p o s i t i o n s -520 and -350 was e s s e n t i a l f o r e x p r e s s i o n of hsp26 in the o v a r i a n nurse c e l l s ; t h i s upstream r e g i o n had no e f f e c t on t r a n s c r i p t i o n of hsp26 d u r i n g heat shock (69). An HSE l o c a t e d 210 bp upstream from the i n i t i a t i o n s i t e of hsp28 was r e q u i r e d f o r h e a t - i n d u c i b l e t r a n s c r i p t i o n of t h i s gene in transformed f l i e s (64). The presence of three a d d i t i o n a l HSEs d i s p e r s e d between p o s i t i o n s -350 and -270 r e s u l t e d i n t w o - f o l d higher r a t e s of t r a n s c r i p t i o n d u r i n g heat shock (64). However, maximal h e a t - i n d u c i b i l i t y of the hsp28 gene was a c h i e v e d o n l y when sequences between p o s i t i o n s -2100 and -1100 were a l s o present (64). T h i s far-upstream r e g i o n does not c o n t a i n any r e c o g n i z a b l e HSEs, and so the mechanism by which i t i n f l u e n c e s 1 5 h e a t - i n d u c i b l e t r a n s c r i p t i o n i s u n c l e a r at t h i s time. The promoter elements t h a t are r e q u i r e d f o r a p p r o p r i a t e e x p r e s s i o n of hsp28 d u r i n g development are d i s t i n c t from the h e a t - i n d u c i b l e promoter elements, and are d i s p e r s e d over the region between p o s i t i o n -2100 and the TATA element (64). 1.9 C o n t r a s t s i n the E x p r e s s i o n of D r o s o p h i l a Heat Shock Genes in Heterologous and Homologous C e l l s Two major d i s t i n c t i o n s are apparent between the sequence requirements of h e a t - i n d u c i b l e promoters i n COS c e l l s and Xenopus oocytes versus t r a n s f e c t e d D r o s o p h i l a c e l l s or transformed f l i e s . F i r s t l y , the hsp70 promoter r e q u i r e s both of the HSEs immediately upstream from the TATA element f o r e f f i c i e n t h e a t - i n d u c i b l e t r a n s c r i p t i o n i n D r o s o p h i l a , but only the most proximal HSE or a s i n g l e s y n t h e t i c HSE i s r e q u i r e d f o r maximal t r a n s c r i p t i o n i n COS c e l l s or Xenopus oocytes. Secondly, heat shock promoters with HSEs that are separated by more than 100 bp from the TATA element (hsp23 and hsp28) are f u n c t i o n a l i n D r o s o p h i l a but are not i n d u c i b l e i n COS c e l l s . I t remains u n c e r t a i n whether the d i f f e r e n t sequence requirements of heat-i n d u c i b l e t r a n s c r i p t i o n i n h e t e r o l o g o u s versus homologous c e l l s r e s u l t from d i s t i n c t i o n s i n the mechanism of i n d u c t i o n of heat shock genes i n d i f f e r e n t organisms or whether the reduced requirement f o r HSEs i n COS c e l l s or oocytes i s a r t i f i c i a l l y imposed by the abnormal s t a t e of the i n t r o d u c e d heat shock genes in these c e l l s . 1 6 1.10 P r o t e i n F a c t o r s Required f o r T r a n s c r i p t i o n of D r o s o p h i l a Heat Shock Genes The i n t e r a c t i o n s between the promoter elements of the D r o s o p h i l a hsp70 gene and c e l l u l a r t r a n s c r i p t i o n f a c t o r s have been s t u d i e d by the use of i_n v i t r o t r a n s c r i p t i o n systems. DNA fragments that c o n t a i n promoter elements of D r o s o p h i l a genes are a c c u r a t e l y t r a n s c r i b e d when they are added to an e x t r a c t of n u c l e i prepared from c u l t u r e d D r o s o p h i l a c e l l s (82). Some of the t r a n s c r i p t i o n f a c t o r s w i t h i n the nu c l e a r e x t r a c t have been p a r t i a l l y p u r i f i e d by standard p r o t e i n s e p a r a t i o n methods, u s i n g i n v i t r o assays f o r t r a n s c r i p t i o n a l a c t i v a t i o n . A combination of two separate f r a c t i o n s of the nucl e a r e x t r a c t , i n c o n j u n c t i o n with added RNA polymerase I I , i s s u f f i c i e n t to a c t i v a t e t r a n s c r i p t i o n of a D r o s o p h i l a a c t i n gene and h i s t o n e H3 and H4 genes (82). The a c t i v e components of these two f r a c t i o n s have been desi g n a t e d A f a c t o r and B f a c t o r . The l a t t e r f a c t o r s p e c i f i c a l l y binds to the regions of the promoters that i n c l u d e the TATA element and i n i t i a t i o n s i t e (82). No b i n d i n g s i t e f o r A f a c t o r has been i d e n t i f i e d . In v i t r o t r a n s c r i p t i o n of the D r o s o p h i l a hsp70 gene i s dependent on an a d d i t i o n a l f a c t o r , d e s i g n a t e d heat shock t r a n s c r i p t i o n f a c t o r or HSTF (83). T h i s f a c t o r s p e c i f i c a l l y binds to the four HSEs i n the hsp70 promoter that are c e n t r e d at p o s i t i o n s -247, -177, -78, and -56 (84). B i n d i n g to the -78 s i t e i s s t r o n g l y dependent on pr e v i o u s o c c u p a t i o n of the -56 s i t e by HSTF, which i s i n d i c a t i v e of c o o p e r a t i v e and ordered b i n d i n g at these two s i t e s . 17 In v i t r o t r a n s c r i p t i o n of hsp70 i s reduced t w o - f o l d when the two upstream HSTF b i n d i n g s i t e s are d e l e t e d (84). A f u r t h e r d e l e t i o n that removes the -78 b i n d i n g s i t e r e s u l t s i n an a d d i t i o n a l s i x - f o l d r e d u c t i o n i n t r a n s c r i p t i o n . Subsequent d e l e t i o n of the remaining HSTF b i n d i n g s i t e at p o s i t i o n -56 does not a f f e c t the r e s i d u a l l e v e l of t r a n s c r i p t i o n u n l e s s the d e l e t i o n extends i n t o the TATA element. These r e s u l t s mimic the e f f e c t s of d e l e t i o n s on ir\ v i v o t r a n s c r i p t i o n of hsp70, although no s i g n i f i c a n t e f f e c t of the two upstream HSEs on t r a n s c r i p t i o n a l e f f i c i e n c y was observed in_ v i v o (72,77). HSTF a c t i v i t y i s present i n a s i x - f o l d higher c o n c e n t r a t i o n i n e x t r a c t s of n u c l e i from heat shocked c e l l s versus uninduced c e l l s (83). However, both types of e x t r a c t can support in v i t r o t r a n s c r i p t i o n of hsp70 with comparable e f f i c i e n c i e s (83). The r e g u l a t e d t r a n s c r i p t i o n of hsp70, t h e r e f o r e , i s not reproduced i n v i t r o . In c o n t r a s t , rn v i t r o t r a n s c r i p t i o n of a D r o s o p h i l a a c t i n gene i s dependent on the o r i g i n of the n u c l e a r e x t r a c t ; t r a n s c r i p t i o n a l e f f i c i e n c y of t h i s gene i s much lower i n e x t r a c t s from heat shocked c e l l s than i t i s i n e x t r a c t s from uninduced c e l l s (83). The in. v i v o t r a n s c r i p t i o n a l a c t i v i t y of the same a c t i n gene i n i t s n a t u r a l chromosomal p o s i t i o n i s r e p r e s s e d t e n - f o l d by heat shock (26). In v i t r o t r a n s c r i p t i o n of the a c t i n gene i s completely dependent on B f a c t o r (82,83), and the c o n c e n t r a t i o n of the a c t i v e form of t h i s f a c t o r i s reduced at l e a s t f i v e - f o l d i n heat shock e x t r a c t s r e l a t i v e to normal e x t r a c t s (83). I_n v i t r o t r a n s c r i p t i o n of hsp70 a l s o appears to be dependent on B f a c t o r 18 although i t i s not a f f e c t e d by the d e p l e t i o n of a c t i n gene-a c t i v a t i n g B f a c t o r that r e s u l t s from heat shock (83). A s i m i l a r p a t t e r n of protein-DNA i n t e r a c t i o n s has been observed f o r hsp70 and hsp83 in i s o l a t e d n u c l e i of c u l t u r e d D r o s o p h i l a c e l l s . The region between p o s i t i o n s -40 and -12 of hsp70, which i n c l u d e s the TATA element, i s p r o t e c t e d from d i g e s t i o n with exonuclease I I I i n n u c l e i o b t a i n e d from uninduced c e l l s (85). The p r o t e c t e d r e g i o n i s extended to p o s i t i o n -108 i n n u c l e i from heat shocked c e l l s . The a d d i t i o n a l area of p r o t e c t i o n i n c l u d e s the HSEs at p o s i t i o n s -78 and -56. P r o t e c t i o n of the two HSEs that are f u r t h e r upstream would not have been d e t e c t e d by the methods used i n these experiments. As seen f o r hsp70, the TATA element of hsp83 i s i n a region that i s p r o t e c t e d from exonuclease I I I i n n u c l e i from uninduced c e l l s , while the p r o t e c t e d region encompasses both the TATA element and three adjacent HSEs i n n u c l e i from heat shocked c e l l s (85,86). A d d i t i o n of a p r o t e i n e x t r a c t of heat shock n u c l e i to the n u c l e i i s o l a t e d from uninduced c e l l s r e s u l t s i n p r o t e c t i o n of the HSEs of hsp83 from d i g e s t i o n both by exonuclease I I I and by the r e s t r i c t i o n enzyme Xbal, which has two r e c o g n i t i o n s i t e s w i t h i n the HSE c l u s t e r (86). The c o n c e n t r a t i o n of the HSE b i n d i n g f a c t o r i s estimated to be t w e n t y - f o l d lower i n n u c l e a r e x t r a c t s of uninduced c e l l s than i t i s i n n u c l e a r e x t r a c t s of heat shocked c e l l s (86). The f a c t o r s that are r e s p o n s i b l e f o r p r o t e c t i n g the promoter elements of hsp70 and hsp83 from enzymatic d i g e s t i o n i n n u c l e i may be i d e n t i c a l to HSTF and B f a c t o r , although t h i s remains to be proven. 1 9 1.11 A Model f o r R e g u l a t i o n of T r a n s c r i p t i o n d u r i n g Heat Shock A model f o r the mechanism of i n d u c t i o n of heat shock genes can be d e r i v e d from what i s now known about the behaviour of the D r o s o p h i l a t r a n s c r i p t i o n f a c t o r s and the heat shock gene promoter elements.. Features of t h i s model have been proposed by v a r i o u s r e s e a r c h e r s (63,83-85,87). With the onset of the heat shock response, the amount of a c t i v e HSTF i n c r e a s e s , through mechanisms t h a t remain m y s t e r i o u s . The a c t i v a t e d HSTF binds to the HSEs of heat shock genes and a c t i v a t e s t r a n s c r i p t i o n by RNA polymerase II v i a i n t e r a c t i o n s with B f a c t o r t hat was a l r e a d y bound to the TATA element and with A f a c t o r , which may not b i n d d i r e c t l y to s p e c i f i c DNA sequences. P r o d u c t i v e b i n d i n g of HSTF may be enhanced by the presence of m u l t i p l e HSEs. Heat shock-induced b i n d i n g of HSTF may a l s o be dependent on the removal of f a c t o r s t h a t are absent from the .in v i t r o t r a n s c r i p t i o n system but are p r e s e n t i n i s o l a t e d n u c l e i and i n t a c t c e l l s , thus e x p l a i n i n g both the f a i l u r e to observe heat shock dependent t r a n s c r i p t i o n ir\ v i t r o and the absence of p r o t e c t i o n of the hsp70 and hsp83 HSEs i n n u c l e i from uninduced c e l l s , d e s p i t e the presence of low amounts of a c t i v e HSTF i n these c e l l s . T r a n s c r i p t i o n of the genes that are expressed under normal growth c o n d i t i o n s may be i n h i b i t e d d u r i n g heat shock by p a r t i a l i n a c t i v a t i o n of B f a c t o r . The HSTF that i s bound to the HSEs adja c e n t to the TATA element of heat shock genes may i n c r e a s e the a f f i n i t y of those TATA elements f o r the low amounts of B f a c t o r t hat are present d u r i n g heat shock. A l t e r n a t i v e l y , the s p e c i f i c i t y of B f a c t o r may be m o d i f i e d d u r i n g heat shock, such 20 that i t i s only a c t i v e i n the presence of bound HSTF. The heat shock response c o u l d be re v e r s e d by i n a c t i v a t i o n of HSTF and r e -a c t i v a t i o n of B f a c t o r . 1.12 P r o t e i n F a c t o r s Involved i n T r a n s c r i p t i o n of the D r o s o p h i l a A l c o h o l Dehydrogenase Gene L i k e the heat shock genes, the D r o s o p h i l a a l c o h o l dehydrogenase gene i s a c t i v a t e d by t r a n s c r i p t i o n f a c t o r s that bind to e s s e n t i a l promoter elements. T h i s gene has two promoters that are separated by 700 bp and are u t i l i z e d at d i f f e r e n t times du r i n g development (88). Both promoters are a c t i v e i n the presence of a n u c l e a r e x t r a c t prepared from c u l t u r e d D r o s o p h i l a c e l l s (89). Two separate t r a n s c r i p t i o n f a c t o r s are r e q u i r e d f o r in v i t r o t r a n s c r i p t i o n from the d i s t a l promoter (89). One of these f a c t o r s s p e c i f i c a l l y binds to an upstream promoter element. The second f a c t o r does not have any i d e n t i f i a b l e b i n d i n g s i t e on the promoter DNA, and i s a l s o r e q u i r e d f o r i n  v i t r o t r a n s c r i p t i o n from the proximal promoter; i t may correspond to the p r e v i o u s l y d e s c r i b e d A f a c t o r . The t r a n s c r i p t i o n f a c t o r s that a c t i v a t e the a l c o h o l dehydrogenase gene are not s o l e l y r e s p o n s i b l e f o r r e g u l a t e d e x p r e s s i o n of t h i s gene because the c e l l s from which the f a c t o r s were i s o l a t e d do not express t h e i r endogenous a l c o h o l dehydrogenase genes (90). T h i s s i t u a t i o n i s r e m i n i s c e n t of t h a t of the heat shock genes, which are a c t i v a t e d by t r a n s c r i p t i o n f a c t o r s that can be i s o l a t e d from uninduced c e l l s . 21 1.13 P r o t e i n F a c t o r s Involved i n T r a n s c r i p t i o n of Mammalian Genes In v i v o and ir\ v i t r o t r a n s c r i p t i o n from the adenovirus major l a t e promoter i s dependent on a promoter element that i s c e n t r e d at p o s i t i o n -55 (91-93). I_n v i t r o t r a n s c r i p t i o n from t h i s promoter i s a l s o dependent on the presence of two s p e c i f i c f a c t o r s that .are found i n a whole c e l l e x t r a c t (94-96); one of these f a c t o r s binds to a region that i n c l u d e s the -55 promoter element (95,96), while the other f a c t o r binds to the TATA element (96). B i n d i n g of these two f a c t o r s to the adenovirus major l a t e promoter occurs i n a c o o p e r a t i v e f a s h i o n (96), i n d i c a t i n g that they may d i r e c t l y i n t e r a c t with each o t h e r . C u l t u r e d human c e l l s c o n t a i n a f a c t o r , d e s i g n a t e d Sp2, that i s e s s e n t i a l f o r ir\ v i t r o t r a n s c r i p t i o n of a l a r g e number of mammalian c e l l u l a r and v i r a l genes (97). Sp2 can f u n c t i o n a l l y s u b s t i t u t e f o r the D r o s o p h i l a f a c t o r that i s r e q u i r e d f o r t r a n s c r i p t i o n from both of the a l c o h o l dehydrogenase gene promoters (89). L i k e t h i s D r o s o p h i l a t r a n s c r i p t i o n f a c t o r , Sp2 does not have an i d e n t i f i a b l e b i n d i n g s i t e w i t h i n the promoters that i t a c t i v a t e s . Another f a c t o r , or group of s i m i l a r f a c t o r s , forms s t a b l e complexes with fragments from the promoter region of the chi c k e n conalbumin gene and the adenovirus major l a t e promoter which c o n t a i n i n t a c t TATA elements (98). N e i t h e r the exact s i t e and mode of b i n d i n g nor the r o l e of these f a c t o r s i n t r a n s c r i p t i o n have been i n v e s t i g a t e d . The most thoroughly c h a r a c t e r i z e d t r a n s c r i p t i o n f a c t o r of 22 e u k a r y o t i c p r o t e i n - c o d i n g genes i s Sp1, which has been i s o l a t e d from e x t r a c t s of human c e l l s (97). T h i s f a c t o r , i n c o n j u n c t i o n with Sp2, i s r e q u i r e d f o r e f f i c i e n t jin v i t r o t r a n s c r i p t i o n of SV40 e a r l y and l a t e promoters (97,99), an u n i d e n t i f i e d monkey gene (100), the HSV tk (101) and immediate e a r l y genes (102), and the mouse d i h y d r o f o l a t e reductase gene (103). Sp1 s p e c i f i c a l l y binds to sequences t h a t c o n t a i n the hexanucleotide GGGCGG (99-104), which i s found i n m u l t i p l e c o p i e s i n the promoter r e g i o n s of a l l of the genes that are a c t i v a t e d by Sp1. The GGGCGG sequences have been demonstrated to be e s s e n t i a l f o r t r a n s c r i p t i o n from the SV40 promoter (105-108) and the HSV tk promoter (109-114), both i_n v i v o and ir\ v i t r o . The p o s i t i o n s of the Sp1 b i n d i n g s i t e s r e l a t i v e to each other and to the TATA element are important determinants of the e f f i c i e n c i e s of the SV40 and HSV tk promoters (99,112,115,116). GGGCGG sequences have been found i n the presumptive promoter r e g i o n s of many other mammalian genes, i n c l u d i n g those that encode h y d r o x y m e t h y l g l u t a r y l CoA reductase (117), adenine and hypoxanthine p h o s p h o r i b o s y l t r a n s f e r a s e s (118,119), adenosine deaminase (120), p r o c o l l a g e n (121), m e t a l l o t h i o n e i n (122), and urokinase-plasminogen a c t i v a t o r (123). The v a r i o u s genes which c o n t a i n GGGCGG promoter elements are expressed i n many d i f f e r e n t t i s s u e s and under d i v e r s e c o n d i t i o n s , s u g g e s t i n g that Sp1 i s not i n v o l v e d i n r e g u l a t i n g the e x p r e s s i o n of s p e c i f i c genes. Maximal r a t e s of ir\ v i t r o t r a n s c r i p t i o n of the HSV tk gene are achieved only when a f a c t o r a d d i t i o n a l to Sp1 and Sp2 i s present (101). T h i s t r a n s c r i p t i o n f a c t o r binds to a promoter 23 element of the tk gene that c o n t a i n s the sequence CCAAT. The same sequence or a s i m i l a r sequence i s found i n the promoter r e g i o n s of many other mammalian genes (124,125), and c o n s t i t u t e s an.important promoter element of g l o b i n genes (126-128). The r e s u l t s o b tained with ir\ v i t r o t r a n s c r i p t i o n systems are compatible with a general model f o r t r a n s c r i p t i o n a l a c t i v a t i o n i n which t r a n s c r i p t i o n f a c t o r s bind to s p e c i f i c promoter elements and subsequently i n t e r a c t with a d d i t i o n a l t r a n s c r i p t i o n f a c t o r s (such as Sp2 and A f a c t o r ) and RNA polymerase to i n i t i a t e t r a n s c r i p t i o n . R e g u l a t i o n of gene e x p r e s s i o n may be determined by the a v a i l a b i l i t y of gene-s p e c i f i c t r a n s c r i p t i o n f a c t o r s . In a d d i t i o n , and perhaps more i m p o r t a n t l y , gene e x p r e s s i o n may be modulated by f a c t o r s t hat do not operate d i r e c t l y on promoter elements, such as changes i n l o c a l or r e g i o n a l chromatin s t r u c t u r e (see r e f s . 129 and 130 f o r reviews on t h i s s u b j e c t ) . 1.14 Heat Shock Genes of Organisms other than D r o s o p h i l a The HSPs t h a t are s y n t h e s i z e d by other eukaryotes i n response to heat and other s t r e s s agents are s i m i l a r to those of D r o s o p h i l a (reviewed i n r e f s . 2-4). Induced t r a n s c r i p t i o n of heat shock genes i s i n v o l v e d i n the heat shock response of a l l eukaryotes t h a t have been s t u d i e d to date (2-4); the only e x c e p t i o n s to t h i s r u l e are observed i n oocytes and e a r l y embryos, which e i t h e r do not s y n t h e s i z e HSPs or t r a n s l a t e them from s t o r e d r e s e r v e s of m a t e r n a l l y d e r i v e d t r a n s c r i p t s (131-136). HSPs or heat shock cognate p r o t e i n s are s y n t h e s i z e d i n the 24 absence of s t r e s s i n yeast (137,138), D i c t y o s t e l i u m (139,140), and mouse (141,142), and some HSPs are expressed at s p e c i f i c times i n embryonic development i n sea u r c h i n (131) and mouse (132-134). Human HSP70 s y n t h e s i s i s induced by serum s t i m u l a t i o n of c u l t u r e d c e l l s (143). Thus, many eukaryotes share with D r o s o p h i l a a mixed p a t t e r n of c o o r d i n a t e e x p r e s s i o n of HSPs d u r i n g the heat shock response and non-coordinate e x p r e s s i o n of HSPs d u r i n g development and i n u n s t r e s s e d a d u l t t i s s u e s . The o b s e r v a t i o n that D r o s o p h i l a heat shock genes can be induced by heat i n the c e l l s of other organisms, i n c l u d i n g tobacco p l a n t s (144) as w e l l as Xenopus, r a t s , mice, and monkeys, suggests that a l l eukaryotes may share a common mechanism f o r i n d u c i n g heat shock genes which i s h i g h l y conserved at the l e v e l of promoter sequences. The accumulated i n f o r m a t i o n on the sequences of heat shock genes of eukaryotes other than D r o s o p h i l a has supported t h i s n o t i o n . To date, heat shock gene sequences have been o b t a i n e d from yeast (137,145), D i c t y o s t e l i u m (140,146), C. elegans (147), Xenopus (148), humans (149,150), and soybeans (151,152). HSEs have been found upstream from the i n i t i a t i o n s i t e s of a l l of these genes, although the presumptive HSE of the yeast hsp90 gene matches the consensus sequence i n only f i v e of the e i g h t s p e c i f i e d bases (145). As seen i n the D r o s o p h i l a heat shock genes, the HSEs are o f t e n found i n m u l t i p l e and o v e r l a p p i n g c o p i e s (140,146-149,151,152). One human hsp70 gene has four GGGCGG sequences l o c a t e d immediately upstream from i t s HSEs and TATA element (149). A second human hsp70 gene has a s i n g l e upstream GGGCGG sequence 25 ( 150) . Heat shock genes of yeast (138,153,154), Xenopus (148), and humans (150,155) are p r o p e r l y r e g u l a t e d a f t e r being i n t r o d u c e d i n t o c e l l s of the same s p e c i e s . The extreme c o n s e r v a t i o n of the mechanism of heat shock gene i n d u c t i o n has been confirmed by the r e g u l a t e d e x p r e s s i o n of a D i c t y o s t e l i u m heat shock promoter i n yeast (146), a human hsp70 gene i n COS c e l l s and Xenopus oocytes (149), and soybean small heat shock genes i n transformed sunflower p l a n t s (156,157). H e a t - i n d u c i b l e t r a n s c r i p t i o n of one of the l a t t e r genes i s e l i m i n a t e d by removal of the HSEs i n the promoter r e g i o n (157). A s i n g l e HSE c e n t r e d at p o s i t i o n -100 i s r e q u i r e d f o r heat-i n d u c i b l e t r a n s c r i p t i o n of a human hsp70 gene i n human embryonic kidney c e l l s (150). A p u r i n e - r i c h sequence between the HSE and the TATA element i s r e q u i r e d f o r serum-stimulated t r a n s c r i p t i o n of t h i s gene. Removal of a re g i o n that i n c l u d e s the s i n g l e upstream GGGCGG sequence of the gene r e s u l t s i n a r e d u c t i o n i n both heat-induced and serum-stimulated t r a n s c r i p t i o n . Both forms of t r a n s c r i p t i o n are more s e v e r e l y reduced by the l o s s of a CCAAT sequence that i s l o c a t e d between the GGGCGG sequence and the HSE. T h e r e f o r e , heat-induced or serum-stimulated t r a n s c r i p t i o n of t h i s human hsp70 gene i s determined by s p e c i f i c promoter elements, but a d d i t i o n a l n o n - r e g u l a t o r y elements are r e q u i r e d f o r e f f i c i e n t u t i l i z a t i o n of the promoter i n e i t h e r of i t s two r e g u l a t o r y modes. The i n t e r m i n g l i n g of d i f f e r e n t promoter elements i n the human hsp70 gene i s s i m i l a r to that seen i n other promoters, 26 such as the HSV tk promoter and the d i s p e r s e d promoter of the D r o s o p h i l a hsp26 gene. Judging from the f u n c t i o n of the D r o s o p h i l a heat shock promoters and the human hsp70 promoter, a l l e u k a r y o t i c heat shock genes are probably r e g u l a t e d by i n t e r a c t i o n s with heat s h o c k - s p e c i f i c t r a n s c r i p t i o n f a c t o r s such as HSTF, a c t i n g i n c o n j u n c t i o n with more gen e r a l t r a n s c r i p t i o n f a c t o r s that determine the e f f i c i e n c y and p r e c i s i o n of t r a n s c r i p t i o n . 1.15 Heat Shock Genes of C. elegans C a e n o r h a b d i t i s elegans i s a s m a l l s o i l - d w e l l i n g nematode which has been used e x t e n s i v e l y to study the development of m u l t i c e l l u l a r organisms at both the c e l l u l a r and g e n e t i c l e v e l (see r e f s . 158-160 f o r r e v i e w s ) . C. elegans can be c u l t i v a t e d i n the l a b o r a t o r y on agar p l a t e s or i n l i q u i d medium that c o n t a i n s b a c t e r i a as a food source. The normal growth temperature i s 20-25°C. When the temperature i s r a i s e d to 29-35°C, the s y n t h e s i s of p r o t e i n s with estimated masses of 81,000 Da, 70,000 Da, 41,000 Da, 38,000 Da, 29,000 Da, 19,000 Da, 18,000 Da, and 16,000 Da i s i n c r e a s e d , while the s y n t h e s i s of a l l other C. elegans p r o t e i n s i s r e p r e s s e d (161,162). T r a n s c r i p t s t h a t encode the C. elegans HSPs are s y n t h e s i z e d i n response to heat shock, as demonstrated by i d e n t i f i c a t i o n of the products of i_n v i t r o t r a n s l a t i o n of mRNA from heat shocked and uninduced worms (161,162) . Fragments of C. elegans genomic DNA that i n c l u d e hsp70 genes have been c l o n e d (163), but the sequences of these genes 27 have not yet been p u b l i s h e d . Part of a t r a n s c r i p t that encodes one form of the 16,000 Da HSP of C. elegans, d e s i g n a t e d HSP16-48, has been c l o n e d and sequenced (162), and subsequently used to i s o l a t e a fragment of genomic DNA that c o n t a i n s the genes f o r HSP16-48 and a c l o s e l y r e l a t e d p r o t e i n , HSP16-1 (147). The o r g a n i z a t i o n of t h i s hspl6 l o c u s of C. eleqans i s remarkable. I t c o n t a i n s four genes in t o t a l , with a d i v e r g e n t l y t r a n s c r i b e d p a i r of hspl6-1 and h s p l 6 - 48 genes being found w i t h i n each arm of a 3800 bp p e r f e c t i n v e r t e d repeat ( F i g u r e 1). The sequence of one hspl6 gene p a i r i s shown i n F i g u r e 2. The coding regions of the hspl6 genes have been deduced from the open reading frames in the genomic sequence (147) and from the sequence of the fragment of the processed hspl6-48 t r a n s c r i p t (162). The coding regions of hspl6-1 and hspl6-48 are d i v i d e d by s i n g l e i n t r o n s of 52 bp and 55 bp, r e s p e c t i v e l y . The sequences at the intron-exon j u n c t i o n s are very s i m i l a r to the s p l i c e j u n c t i o n consensus sequences that have been d e r i v e d from other e u k a r y o t i c genes (164,165). The p r o t e i n s t h a t are encoded by the two hspl6 genes are q u i t e d i f f e r e n t i n t h e i r 5' exons but are 60% homologous i n t h e i r 3' exons (147). The conserved 3' exon i s a l s o homologous to the C - t e r m i n a l domains of the small HSPs of D r o s o p h i l a and soybean (19,151). A s i n g l e copy of the sequence AATAAA occurs 40 bp downstream from the end of the coding r e g i o n of hspl6-48, and two c o p i e s of the same sequence are found 70 bp and 120 bp downstream from the end of the coding r e g i o n of h s p l 6 - 1 . The IR IR B a m H I E c o R I B e l l h s p ! 6 - l hsp !6-48 hsp !6-48 h s p l 6 - l F i g u r e 1. S t r u c t u r e of the C. elegans hspl6-1 + hspl6-48 gene l o c u s . The coding r e g i o n s are rep r e s e n t e d by s o l i d boxes. P o s i t i o n and d i r e c t i o n of t r a n s c r i p t i o n i s shown by the wavy arrows. The s t r a i g h t arrows ( l a b e l l e d IR) i n d i c a t e the p o s i t i o n and o r i e n t a t i o n of the sequences that are d u p l i c a t e d w i t h i n the l o c u s . T r i a n g l e s i n d i c a t e the boundaries of the fragment t h a t was i n t r o d u c e d i n t o mouse C127 c e l l s . 29 50 . . . GGATCCCGCCTTCATGATCGCGAGATAACCCCCAGCCAGGTAAGTTTAAGAAGTGGCGGTAAGAGAGGGTAAGGGTGTTGTATAGCATGA BamHI 100 . . 1 5 0 CATCTGGCGGGTTCCGCGGACGAATGCAGAATGTGTTAGGATGGGAGGGGCTGTGCAATACCCAAAAATAGGCATTATGCAAGAAGTACA 200 . . . . 250 TTGCCGGCATTTACATAXTTATTACTAACTTTCAAAAAATATCACAAATTCATATTATTTTTAAATTTTATTGAAACAGAATACTGGAAT polyA 3 ' M — polyA 300 . . 340 350 ._ TTATAGTAATTACATGCATAGTTCAAAAAAATCATAAAATTACAATAATTATTCAGAAGTTTTTTGTTCAACGGGCGCTTGCTGAATTGG NslI ••<-•• : . . 400 . . 430 . 450 AATAGATCTTCCTTGAATCGCTTCCTTCTTTGGTGCTTCAATTGAAAGTTTTCCATCTTCTGAAAGATTTGAAGCAACTGCACCAACATC B g l l l : : , , 5 f i2 , §22 , . AACATCTTCGGGTAGAAGAATAACACGAGAAAATGATTTCTTTGAATATCCATGTTCAGTCTTTAATTCTTGTTCTCCTTGAATTGATAA 550 , . . . 600 . TGTATGTCCATCCAAATTAATTTTCAAATCTTCTGGCTTGAACTGCGAGACATTGAGATTTATGGCAAACTTTTGATCATTGTTAACAAf B e l l Hpal 650 . 700 . . . .. CTGAAAGAAATCTTTTTTATACAAACTCTTGAAAAAAAAATGTGTTACTTACCTCAGAAGATTCAGATGGAGAGCCTCTGCAAACTGGAG 1 3' s p l i c e s i t e 16-1 i n t r o n 5' s p l i c e s i t e 1 . . 750| . . . . 800 . TAAATTGACGTTCCATCTGAGCCATATCTCTCATGAGATCACCAAAAACAGAACGTTGAGCTGGACGGAAATAGTGGTAAAGTGACATGA Sau3AI 850 . . . . 900 TTGTAGTTTGAAGATTTCACAATTAGAGTGAATGTTGTTTGGTTCGGTTTTGTCACTGTATTTATACTCATTTCCACCTTTTT^TAGAAC 15' 16-1 TATA Xbal 950 • • ATTCGAGCTGCTTCtrTGCAAAAGGAGGGCGACTCACATTCAGAACgtTCgGAAATAGTGTGCGTACTGAAGAAACCCAGATACTTTT^CA Rsal 1000 1050 .. A"yCTGCGTCTCTTTGCACCTATGGGGTGTATTTTGAAATGAATGCAT^TXGGACCTTCTAGAACATTCTAA](\CGGCTGCAGGATACGGGT N s i l Xbal 1100 . 1150 ._ ATATAAGCCAATCGTGTTCAGAGGAAACCAATACACTTTGTTCAAGTGCTTACTGTTCAT'TlCTCTAAACTTCAAGiAATGCTCATGCTCCG 16-48 TATA 5'I »- DS HSE . , 1200 . , , 1250 u TTCTCCATTTTCTGATTCAAATGTTCTCGATCATTTCTTGGATGAAATCACTGGATCTGTTCAATTTCCATATTGGAGAAATGCTGATCA Sau3AI . s . 1300 . . . . 1350 CAACTCATTCAATTTTTCCGACAATATTGGAGAGGTAAGAAAATAATCTCTTTTTCAATTGTTTATTTGTCAAATGTTTTATTTTTCAGA Sspl * 5 ' s p l i c e s i t e 18-48 Intron 3' s p l i c e s i t e * . , , , 1400 , , , t TTGTAAATGACGAATCTAAATTCTCTGTTCAACTCGATGTTTCTCATTTCAAACCAGAAGATCTTAAAATTGAATTGGATGGAAGAGAAC B g l l l 14S0 , , . . 1500 , , _ TAAAAATTGAAGGAATTCAAGAAAAAAAATCAGAGCATGGATACTCGAAACGATCATTTTCAAAAATGATTCTTCTACCAGAAGATGTTG EcoRI Sau3AI . 1550 . . . . 1600 . ._ ATTTAACTTCTGTCAAATCTGCAATTTCGAATGAAGGAAAACTTCAAATTGAGGCTCCAAAGAAGACTAACTCATCTCGTTCTATTCCCA 1650 . . . . 1700 TTAATTTTGTTGCAAAACATTAATCTTTTATTGTATTCCAAATATTCTTAATTTCAATAAAGTCATTAATTTAATTTATTCATGTTCTCT Sspl polyA H 3 ' 1750 . . . . 1800 AGCATAACAAAAACATCAAATCCGACTTTCCAATTCAAATATTTCAAAACAACATAACGGCTCAACTTTACAGCATACTCATGCTACGTT 1850 . . . . TTACCAACCGTTAAACGTTTAGCTATAAAAATTCCTGCATCGTTTCAAACGACTTTTGCAACTTTTTCAAAATTCAGTTTTTCAGCTTAA 1900 TTTCGCTCACAACTGTGTTGATCCGTCGACGGATCC S a i l BamHI F i g u r e 2. Sequence of the DNA fragment c o n t a i n i n g hspl6 gene p a i r t h a t was i n t r o d u c e d i n t o mouse C127 c e l l s . The sequence of the hspl6-1 t r a n s c r i p t i s complementary to the sequence shown i n t h i s f i g u r e . The coding r e g i o n s are o v e r l i n e d . The TATA elements and p o l y a d e n y l a t i o n s i g n a l sequences are u n d e r l i n e d . The HSEs are w i t h i n boxes. DS HSE i s the HSE found immediately upstream from the codi n g r e g i o n of hspl6-48. Dashed boxes enclose the TCAAT sequences upstream from each gene. The arrows mark the p o s i t i o n s of the 5' and 3' ends of the t r a n s c r i p t s i n C. eleg a n s . 30 e q u i v a l e n t sequence AAUAAA, or a v a r i a n t t h e r e o f , i s found upstream from and w i t h i n ten to t h i r t y bases of the s i t e of 3' cleavage and p o l y a d e n y l a t i o n of the t r a n s c r i p t s of almost a l l p r o t e i n - c o d i n g genes of higher eukaryotes (reviewed i n r e f s . 166 and 167). Both of the hs p l 6 genes are i n a c t i v e i n uninduced worms and are t r a n s c r i b e d at high l e v e l s i n response to heat shock (147,162). The s i t e s of i n i t i a t i o n of t r a n s c r i p t i o n have been mapped f o r both genes; they are l o c a t e d 40 bp and 50 bp upstream from the N-terminal ATG codon of hspl6-1 and hspl6-48, r e s p e c t i v e l y (147). TATA elements are found about 20 bp upstream from the t r a n s c r i p t i o n i n i t i a t i o n s i t e s , and a p a i r of o v e r l a p p i n g HSEs are found 25 bp f u r t h e r upstream i n each gene (F i g u r e 3). The HSEs match the consensus sequence i n at l e a s t seven of the ei g h t s p e c i f i e d bases, with the e x c e p t i o n of the d i s t a l HSE of hspl6-1, which has two mismatches. TCAAT sequences, which resemble the p r e v i o u s l y d i s c u s s e d CCAAT promoter element, are found at p o s i t i o n -70 with res p e c t to hspl6-1 and at p o s i t i o n -90 with respect to hspl6-48. A 10 bp sequence of a l t e r n a t i n g p u r i n e s and p y r i m i d i n e s i s found i n the r e g i o n between the two hspl6 genes. A l t e r n a t i n g p u r i n e / p y r i m i d i n e sequences are a l s o found i n the promoter r e g i o n s of the D r o s o p h i l a hsp68, hsp28, and hsp23 genes (9,49), a soybean s m a l l heat shock gene (151), and i n non-heat i n d u c i b l e promoters, e.g. those of r a t and human somatostatin genes (168), a human m e t a l l o t h i o n e i n gene (169), a yeast cytochrome c gene 31 h s p ! 6 - 1 C A A T T A G A G T G A A T G T T G T T T G G T T C G G T T T T G T C A C T G t r A T T T A T A J r r C A T T T C C A C C T T T T X b a l T C T A G A A C A T T C G A G C T G C T T C T T G C A A A A G G A G G G C G A C T C A C A T T C A G A A C A T T G A G A A A T A G T G T G C G T A C T G A A G A A C A T T C T A A A C G G C T G C A G G A T A C G G G t r A T A T ^ A T G C C A A T C G T G T T C A G A G G A A A C C A A T A C A C T T T G T T C A A G T G C F i g u r e 3. Sequence of the DNA between the t r a n s c r i p t i o n i n i t i a t i o n s i t e s of hspl6-1 and hspl6-48. Wavy arrows represent t r a n s c r i p t s , with a dot over the i n i t i a t i n g base. TATA elements are w i t h i n boxes. HSEs are u n d e r l i n e d , w i t h dots under the bases that do not match the consensus sequence. The a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequence has a z i g - z a g g i n g u n d e r l i n e . hsp 1 6 - 4 8 32 (170), and i n many v i r a l promoters (reviewed i n 171). DNA c o n t a i n i n g such sequences can form l e f t - h a n d e d h e l i c e s i n s o l u t i o n (reviewed i n r e f . 172) and p o s s i b l y w i t h i n c e l l s (171). 1.16 E x p r e s s i o n of C. eleqans Hspl6 Genes i n Heterologous C e l l s In order to d e f i n e and c h a r a c t e r i z e the promoter elements of the C. elegans hspl6 genes, the presumptive promoter sequences must be mutated u i v i t r o , and then the e f f e c t s of the mutations must be t e s t e d . I_n v i t r o t r a n s c r i p t i o n systems d e r i v e d from C. elegans are not a v a i l a b l e , and the methods that have been developed f o r g e n e t i c a l l y t r a n s f o r m i n g C. elegans by i n j e c t i n g DNA i n t o d e v e l o p i n g eggs (173) are not s u f f i c i e n t l y e f f i c i e n t or r e l i a b l e to be used f o r comparing the f u n c t i o n of d i f f e r e n t promoters. T h e r e f o r e , the r e g u l a t o r y elements of the C. eleqans hspl6 genes must be d e f i n e d by e x p r e s s i n g them i n heterologous c e l l s . The s t r o n g resemblance of the HSEs of the h s p l 6 genes to the HSEs that can mediate h e a t - i n d u c i b l e t r a n s c r i p t i o n i n other organisms, and the numerous examples of r e g u l a t e d t r a n s c r i p t i o n of heat shock genes i n heterologous c e l l s , lends c o n f i d e n c e to the e x p e c t a t i o n that the promoter elements which determine the h e a t - i n d u c i b i l i t y of the C. eleqans hspl6 genes w i l l f u n c t i o n i n the c e l l s of another s p e c i e s . However, the use of heterologous c e l l s as the s i t e of e x p r e s s i o n p r e c l u d e s any examination of the f a c t o r s i n v o l v e d i n t i s s u e - s p e c i f i c or developmental r e g u l a t i o n of the hspl6 genes. Furthermore, any hspl6 promoter elements that might modulate t r a n s c r i p t i o n i n C. eleqans through 33 mechanisms that are not p r e c i s e l y conserved i n the heterologous host c e l l s cannot be d e f i n e d . In these circumstances, two v a l i d q u e s t i o n s can be asked about the hspl6 genes: 1) what C. elegans promoter elements and t r a n s c r i p t p r o c e s s i n g s i g n a l s are f u n c t i o n a l i n the host c e l l , and 2) how does the arrangement of conserved promoter elements (e.g. HSEs) a f f e c t promoter s t r e n g t h and r e g u l a t i o n i n the host c e l l s ? A l l of the methods that have p r e v i o u s l y been used to express heat shock genes i n heterologous c e l l s have demonstrated or p o t e n t i a l d isadvantages. S t a b l e t r a n s f e c t i o n of c e l l s by i n t e g r a t i o n of i n t r o d u c e d heat shock genes r e s u l t s i n a low average e f f i c i e n c y and a h i g h v a r i a b i l i t y i n the t r a n s c r i p t i o n of the i n t r o d u c e d genes (37,56,57). I t i s very d i f f i c u l t to c o n t r o l f o r these e f f e c t s when a comparison of the t r a n s c r i p t i o n a l competence of d i f f e r e n t genes i s r e q u i r e d . T r a n s i e n t e x p r e s s i o n of u n i n t e g r a t e d heat shock genes which have been i n t r o d u c e d i n t o c u l t u r e d c e l l s by e n d o c y t o s i s (71,72) or i n t o Xenopus oocytes by i n j e c t i o n (65-67,70) i s a l s o i n e f f i c i e n t and i n c o n s i s t e n t . Furthermore, thousands of c o p i e s of the i n t r o d u c e d genes are present; the f u n c t i o n of t r a n s c r i p t i o n c o n t r o l elements t h a t r e l y on a l i m i t e d supply of host c e l l t r a n s c r i p t i o n f a c t o r s can be a f f e c t e d under these c o n d i t i o n s (174,175). The copy numbers of genes that have been i n t r o d u c e d i n t o COS c e l l s on r e p l i c a t i n g SV40 v e c t o r s are a l s o extremely h i g h . The net t r a n s c r i p t i o n of D r o s o p h i l a hsp70 genes in COS c e l l s i n c r e a s e d t e n - f o l d d u r i n g a p e r i o d when the copy number of the 34 SV40 v e c t o r that c a r r i e d them i n c r e a s e d from an estimated 1000 to 20,000, but hsp70 t r a n s c r i p t i o n d i d not i n c r e a s e any f u r t h e r when the copy number rose to 120,000 (61). These r e s u l t s i n d i c a t e that the c a p a c i t y of the c e l l s to support heat shock gene t r a n s c r i p t i o n was s a t u r a t e d at 20,000 c o p i e s . The t r a n s c r i p t i o n a l a c t i v i t y of both the D r o s o p h i l a heat shock genes and the HSV tk genes i s very low on a per gene b a s i s i n COS c e l l s t r a n s f e c t e d with SV40 v e c t o r s (61,62,65,68). Most of the t r a n s f e c t e d genes may be t r a n s c r i p t i o n a l l y i n a c t i v e , p o s s i b l y due to t h e i r c o n t i n u a l l y h i g h r a t e of r e p l i c a t i o n . T h e r e f o r e , the c a p a c i t y to support heat shock gene t r a n s c r i p t i o n may be s a t u r a t e d when f a r fewer than 20,000 a c t i v e heat shock genes are p r e s e n t . 1.17 Bovine P a p i l l o m a v i r u s V e c t o r s Both extremely high copy numbers and i n t e g r a t i o n s i t e -dependent r e p r e s s i o n of t r a n s c r i p t i o n can be avoided by the use of t r a n s f e c t i o n v e c t o r s that are d e r i v e d from bovine p a p i l l o m a v i r u s (BPV). BPV i s a DNA v i r u s with a 7945 bp double stranded c i r c u l a r genome (176). The v i r u s i n f e c t s and transforms the cutaneous f i b r o b l a s t s of cows (177). P u r i f i e d BPV DNA can be i n t r o d u c e d i n t o c u l t u r e d mouse C127 f i b r o b l a s t s by t r a n s f e c t i o n (178). The t r a n s f e c t e d c e l l s are m o r p h o l o g i c a l l y transformed by the products of two of the genes of the BPV e a r l y t r a n s c r i p t i o n u n i t (179-182). The BPV DNA i s r e p l i c a t e d w i t h i n the t r a n s f e c t e d c e l l s as c i r c u l a r episomes with s t a b l e copy numbers of f i v e to one hundred (178). In some of the i n f e c t e d bovine f i b r o b l a s t s 35 the BPV DNA i s packaged i n t o i n f e c t i o u s v i r a l p a r t i c l e s , but the BPV l a t e t r a n s c r i p t i o n u n i t which encodes the c a p s i d p r o t e i n s i s i n a c t i v e i n C127 c e l l s and so no c e l l damage or propagation of i n f e c t i o n occurs i n these c e l l s . Extrachromosomal r e p l i c a t i o n of BPV DNA i s dependent on c i s - a c t i n g sequences w i t h i n the BPV DNA, which are c a l l e d p lasmid maintenance sequences or PMSs (183). Extrachromosomal r e p l i c a t i o n a l s o r e q u i r e s the products of two genes of the BPV e a r l y t r a n s c r i p t i o n u n i t that are d i s t i n c t from the t r a n s f o r m i n g genes (184). T r a n s f e c t i o n v e c t o r s that c o n t a i n the e a r l y t r a n s c r i p t i o n u n i t of BPV are extrachromosomally r e p l i c a t e d a f t e r being i n t r o d u c e d i n t o C127 c e l l s (185-189). C e l l s that c a r r y f u n c t i o n a l c o p i e s of the BPV vecto r can be i d e n t i f i e d by t h e i r transformed morphology, and can then be p h y s i c a l l y separated from non-transformed c e l l s and expanded i n t o s t a b l e c e l l l i n e s . C e l l s t h a t are t r a n s f e c t e d with BPV v e c t o r s can be s e l e c t e d by i n c l u d i n g composite genes that encode the enzyme neomycin phosp h o t r a n s f e r a s e w i t h i n the ve c t o r (188-190). T h i s enzyme i n a c t i v a t e s the a n t i b i o t i c G418, which i s l e t h a l to many d i f f e r e n t types of e u k a r y o t i c c e l l s (191). The genes that have been s u c c e s s f u l l y i n t r o d u c e d i n t o C127 c e l l s on BPV v e c t o r s i n c l u d e an i n f l u e n z a v i r u s hemagglutinin gene (192), a human T - c e l l leukemia v i r u s small envelope p r o t e i n (193), a human HLA heavy c h a i n gene (194), a r a t i n s u l i n gene (195), a human (3-globin gene (186), and a human U1 small n u c l e a r RNA gene (196). M e t a l l o t h i o n e i n genes have been i n t r o d u c e d i n t o 36 C127 c e l l s on BPV v e c t o r s , and t r a n s f e c t e d c e l l s were s e l e c t e d by t h e i r r e s i s t a n c e to cadmium, which r e s u l t e d from e x p r e s s i o n of the i n t r o d u c e d m e t a l l o t h i o n e i n genes (197,198). A mouse mammary tumor v i r u s promoter and a human j 3 - i n t e r f e r o n promoter were a p p r o p r i a t e l y r e g u l a t e d by g l u c o c o r t i c o i d s and double-stranded RNA, r e s p e c t i v e l y , when i n t r o d u c e d i n t o C127 c e l l s on BPV v e c t o r s (199,200-202). I n d u c t i o n of the BPV-linked j3-i n t e r f e r o n gene was dependent on promoter elements upstream from the TATA element (201), but the same promoter elements were non-f u n c t i o n a l when the 0 - i n t e r f e r o n gene was i n t r o d u c e d i n t o COS c e l l s on a r e p l i c a t i n g SV40 v e c t o r (203). Some of the genes that have been i n t r o d u c e d i n t o C127 c e l l s on BPV v e c t o r s were expressed at very high l e v e l s (186,192,194,198,199), while other genes were i n e f f i c i e n t l y or i n c o n s i s t e n t l y expressed (193,195,196). In most c a s e s , the t r a n s f e c t e d v e c t o r DNA was i n the form of monomeric episomes (185,186,188,189,192,195,199), but BPV v e c t o r DNA has a l s o been found i n complex episomes (178,186,192,198) or i n t e g r a t e d i n t o the host c e l l chromosomes (192,194,196). E f f i c i e n t e x p r e s s i o n of the genes on BPV v e c t o r s i s not n e c e s s a r i l y dependent on the v e c t o r s being i n an episomal s t a t e . There are some p o t e n t i a l disadvantages to u s i n g v e c t o r s that c o n t a i n the complete e a r l y t r a n s c r i p t i o n u n i t of BPV. I n s e r t i o n of a d d i t i o n a l DNA i n t o some BPV v e c t o r s r e s u l t e d i n rearrangements of the v e c t o r DNA i n t r a n s f e c t e d c e l l s (188,196,199,201), p o s s i b l y due to s e l e c t i v e p r o p a g a t i o n of episomes which had l o s t sequences w i t h i n the i n s e r t e d DNA that 37 were incom p a t i b l e with the t r a n s f o r m i n g and r e p l i c a t i v e f u n c t i o n s of the BPV DNA. T r a n s f e c t i o n v e c t o r s that c o n t a i n the e a r l y t r a n s c r i p t i o n u n i t of BPV can be present i n hundreds of c o p i e s i n each t r a n s f e c t e d c e l l , which may a f f e c t the f u n c t i o n of vector-borne promoters. The BPV e a r l y t r a n s c r i p t i o n u n i t i s f l a n k e d at each end by t r a n s c r i p t i o n a l enhancers (195,204,205). L i k e other e u k a r y o t i c enhancers (reviewed i n r e f s . 206 and 207), they can i n c r e a s e the r a t e of t r a n s c r i p t i o n , and p o s s i b l y a l t e r the s p e c i f i c i t y , of promoters at remote s i t e s on the same v e c t o r . The s p e c i f i c i t y and e f f i c i e n c y of e x p r e s s i o n of genes that are i n s e r t e d i n t o BPV v e c t o r s may a l s o be a f f e c t e d by t r a n s c r i p t i o n a l read-through from BPV promoters (186,199,200) or r e g i o n a l changes i n chromatin s t r u c t u r e that o r i g i n a t e i n BPV sequences (208) . 1.18 Use of PMS V e c t o r s f o r E x p r e s s i n g C. eleqans Hspl6 Genes i n Mouse, C e l l s In an attempt to circumvent some of the p o t e n t i a l problems with BPV v e c t o r s that are d i s c u s s e d above, the present study u t i l i z e d v e c t o r s that c o n t a i n o n l y the PMSs of BPV. PMS-c o n t a i n i n g v e c t o r s are extrachromosomally r e p l i c a t e d i n t r a n s f e c t e d C127 c e l l s when the r e q u i r e d r e p l i c a t i o n f a c t o r s are produced by the e x p r e s s i o n of u n l i n k e d BPV genes that are a l r e a d y e s t a b l i s h e d i n the c e l l s (183,184). The copy numbers of PMS v e c t o r s a r e , on average, much lower than those of v e c t o r s that c o n t a i n the complete BPV e a r l y t r a n s c r i p t i o n u n i t . The BPV enhancers can be e i t h e r i n c l u d e d i n or omitted from PMS v e c t o r s , 38 a l l o w i n g d e t e r m i n a t i o n of the e f f e c t of the enhancers on e x p r e s s i o n of t r a n s f e c t e d genes. The small s i z e of PMS v e c t o r s , and the absence of most BPV sequences, c o u l d reduce the p o t e n t i a l f o r rearrangement f o l l o w i n g t r a n s f e c t i o n . For t h i s study, PMS v e c t o r s were c o n s t r u c t e d that i n c l u d e d a neomycin phos p h o t r a n s f e r a s e type II gene (NPT II) with a e u k a r y o t i c promoter. Hspl6 genes with v a r i o u s mutations in t h e i r promoter r e g i o n s were i n s e r t e d i n t o the PMS v e c t o r s . C127 c e l l s were c o - t r a n s f e c t e d with both the PMS v e c t o r s and separate BPV DNA, and then s e l e c t e d on the b a s i s of both G418 r e s i s t a n c e and m o r p h o l o g i c a l t r a n s f o r m a t i o n . The t r a n s c r i p t i o n a l c a p a b i l i t i e s of the v a r i o u s mutated hspl6 genes were then compared, using t r a n s c r i p t i o n of the NPT II gene as an i n t e r n a l c o n t r o l . The e f f i c i e n c y and accuracy of p r o c e s s i n g of the hspl6 t r a n s c r i p t s was a l s o examined. 39 11. METHODS 2.1 General Methods f o r M a n i p u l a t i n g and C l o n i n g DNA E. c o l i s t r a i n s RR1, HB101, and JM101 were c u l t u r e d and transformed with plasmid DNA or l i g a t i o n s as d e s c r i b e d (209). Plasmid DNA from 2 to 100 ml of b a c t e r i a l c u l t u r e was prepared by the a l k a l i n e l y s i s method of Birnboim and Doly (210), with m o d i f i c a t i o n s as d e s c r i b e d (209). A f t e r the RNase d i g e s t i o n step, plasmid DNA was f u r t h e r p u r i f i e d f o r t r a n s f e c t i o n s by banding on C s C l d e n s i t y g r a d i e n t s c o n t a i n i n g e t h i d i u m bromide as d e s c r i b e d (209). A f t e r removal of the band of s u p e r c o i l e d DNA from the g r a d i e n t with a s y r i n g e and e x t r a c t i o n of the et h i d i u m bromide with b u t a n o l , the p u r i f i e d plasmid DNA was d i l u t e d with 2 volumes of water, p r e c i p i t a t e d by the a d d i t i o n of 2 volumes of et h a n o l , recovered by c e n t r i f u g a t i o n at 15,000 g f o r 15 min, and d i s s o l v e d i n 2 mM Na 2EDTA. A l t e r n a t i v e l y , a f t e r the RNase d i g e s t i o n s t e p the plasmid p r e p a r a t i o n was d i g e s t e d with p r o t e i n a s e K (Boehringer Mannheim) at 0.1 mg/ml f o r 20 min at 55°C, e x t r a c t e d twice with phenol, and p r e c i p i t a t e d by the a d d i t i o n of 0.1 volumes of sodium a c e t a t e , pH 5.0 and 2 volumes of e t h a n o l , and then c e n t r i f u g e d and r e d i s s o l v e d as d e s c r i b e d above. R e s t r i c t i o n enzymes, T4 DNA l i g a s e , and polymerases were purchased from Bethesda Research L a b o r a t o r i e s , New England B i o l a b s , Boehringer Mannheim, and Pharmacia. C o n d i t i o n s f o r the use of enzymes were those recommended by the s u p p l i e r s , u n l e s s s t a t e d o t h erwise. DNA fragments were p u r i f i e d by e l e c t r o p h o r e s i s 40 through agarose g e l s c o n t a i n i n g 90 mM T r i s - b o r a t e pH 8.1, 1 mM Na 2EDTA (TBE) as d e s c r i b e d (209). Gel s l i c e s c o n t a i n i n g separated DNA fragments were p l a c e d i n d i a l y s i s tubing and the DNA was e l e c t r o - e l u t e d as d e s c r i b e d (209), except that 0.1% SDS was i n c l u d e d i n the 0.5X TBE e l e c t r o - e l u t i o n b u f f e r . The e l e c t r o - e l u t e d DNA was e x t r a c t e d once with phenol and once with b u t a n o l , and p r e c i p i t a t e d by the a d d i t i o n of 0.1 volumes of 3 M sodium a c e t a t e pH 5.5 c o n t a i n i n g 0.25% po l y a c r y l a m i d e c a r r i e r , and two volumes of e t h a n o l . The p r e c i p i t a t e was recoved by c e n t r i f u g a t i o n at 15,000 g f o r 15 min and d i s s o l v e d i n 5 mM T r i s - C l pH 8.0, 0.5 mM Na 2EDTA. 2.2 Vector C o n s t r u c t i o n The c o n s t r u c t i o n of the b a s i c t r a n s f e c t i o n v e c t o r s used i n t h i s study i s i l l u s t r a t e d i n F i g u r e 4. The t r a n s f e c t i o n v e c t o r pCGBPV9 (189) was ob t a i n e d from P a t r i c k M a t t h i a s of the German Cancer Research I n s t i t u t e , H e i d e l b e r g . pPN1 was made by e x c i s i n g the 7 300 bp of BPV DNA i n pCGBPV9 (176) between the C l a l s i t e s at p o s i t i o n s 6834 and 7476 i n the BPV genomic sequence (161). pPN2 was made by i n s e r t i n g the 365 bp H a e l l l fragment, which l i e s between p o s i t i o n s 1440 to 1805 i n the BPV genomic sequence and c o n t a i n s PMS-2, i n t o the EcoRV s i t e of pPN1. pPN3 was d e r i v e d from pPN2 and pON1 was d e r i v e d from pPN1 by e x c i s i n g the 640 bp H i n d i I I fragment that c o n t a i n s PMS-1. pPN5 was made by p u r i f y i n g t h i s H i n d i 11 fragment and i n s e r t i n g i t i n t o pON1 i n a rev e r s e d o r i e n t a t i o n i n comparison to pPN1. pPQ1 was made by r e p l a c i n g the Dral-BamHI fragment of 41 F i g u r e 4. C o n s t r u c t i o n of t r a n s f e c t i o n v e c t o r s . The e a r l y t r a n s c r i p t i o n u n i t of BPV i s represented by the smooth arrow. The NPT II t r a n s c r i p t i o n u n i t i s represented by the wavy arrow. The open c i r c l e r e p r e s e n t s the b a c t e r i a l o r i g i n of r e p l i c a t i o n . The numbered boxes i n d i c a t e the p o s i t i o n s of PMS-1 and PMS-2. C, C l a l s i t e ; H, H i n d i 11 s i t e ; EV, EcoRV s i t e . 42 pPN1 that i n c l u d e s the b a c t e r i a l o r i g i n of r e p l i c a t i o n with the Dral-BamHI fragment of pUC13HM that i n c l u d e s the o r i g i n of r e p l i c a t i o n (Figure 5). pUC13HM i s a d e r i v a t i v e of pUC13 (211) i n which the Hindi 11 s i t e has been converted to an Nhel s i t e . pOQ1 was made from pPQ1 by e x c i s i n g the 640 bp H i n d i 11 fragment that c o n t a i n s PMS-1. C i r c u l a r i z e d BPV DNA was made by p u r i f y i n g the 7945 bp Hindi11 fragment of pCGBPV9 that c o n t a i n s the complete BPV genome and j o i n i n g together the ends of t h i s fragment with T4 DNA l i g a s e ( F i g u r e 4 ). 2.3 Assembly of the Hspl6 Gene P a i r i n the T r a n s f e c t i o n Vector pPN1 The steps i n v o l v e d i n the t r a n s f e r of DNA fragments b e a r i n g Hspl6 genes i n t o pPN1 are i l l u s t r a t e d i n F i g u r e 6. The EcoRI fragments of C. elegans genomic DNA had been c l o n e d by i n s e r t i o n i n t o the phage X v e c t o r Charon 4A by T e r r y Snutch of Simon F r a s e r U n i v e r s i t y , Vancouver, Canada, and the c l o n e d i n s e r t s t h a t i n c l u d e d the sequences of the hspl6-1 + hspl6-48 l o c u s were i d e n t i f i e d and sequenced by Roland Russnak of the U n i v e r s i t y of B r i t i s h Columbia, Vancouver, Canada, as d e s c r i b e d i n r e f . 147. The 460 bp EcoRI- B e l l fragment of one arm of the C. elegans hspl6-1 + hspl6-48 l o c u s i n v e r t e d repeat ( F i g u r e 1), which c o n t a i n s the 3' end of one hspl6-48 gene, was e x c i s e d from the L-1.0 genomic cl o n e and i n s e r t e d between the EcoRI and BamHI s i t e s of M13 mp8 (212), c r e a t i n g mp8-48. Both the B e l l and BamHI s i t e s were l o s t i n the course of t h i s c o n s t r u c t i o n . The S a i l s i t e i n the mp8-48 p o l y l i n k e r was made blu n t ended with the 43 F i g u r e 5. C o n s t r u c t i o n of the t r a n s f e c t i o n v e c t o r pPQ1. Heavy l i n e s represent sequences d e r i v e d from BPV. Double l i n e s r e p r e s e n t sequences that are found i n pUC13HM. O r i , b a c t e r i a l o r i g i n of r e p l i c a t i o n ; Cos, phage X cos s i t e ; Amp, ^-lactamase gene. 44 F i g u r e 6. Assembly of the hspl6 gene p a i r i n the t r a n s f e c t i o n v e c t o r pPN1. Sequences d e r i v e d from C. elegans genomic DNA are d e s i g n a t e d by heavy l i n e s . The wavy arrows are beneath the t r a n s c r i b e d sequences of the hspl6-1 and hspl6-48 genes, which are l a b e l l e d 1 and 48, r e s p e c t i v e l y . PMS-1 i s re p r e s e n t e d by the open box. The b a c t e r i a l o r i g i n of r e p l i c a t i o n of pPN1 i s rep r e s e n t e d by the open c i r c l e . The X Charon 4A v e c t o r s c a r r y i n g the 3300 bp or 1000 bp EcoRI fragments from the hspl6 l o c u s are l a b e l l e d L-3.3L and L-1.0, r e s p e c t i v e l y . E, EcoRI s i t e ; S, S a i l s i t e ; B, BamHI s i t e . 45 Klenow fragment of DNA Polymerase I and a BamHI l i n k e r was i n s e r t e d , c r e a t i n g mp8-48B. The EcoRI-BamHI fragment of mp8-48B was then p u r i f i e d . The 1450 bp BamHI- EcoRI fragment of genomic c l o n e L-3.3L, which c o n t a i n s a complete hspl6-1 gene and the 5' h a l f of the adj a c e n t hspl6-48 gene, was a l s o p u r i f i e d , and these two fragments were l i g a t e d i n the presence of BamHI-cut pPN1. The r e s u l t i n g v e c t o r (pPNIWT) c o n t a i n s a reassembled hspl6 gene p a i r i n the form of a 1920 bp i n s e r t at the BamHI s i t e of pPN1. The BamHI fragment c o n t a i n i n g the hspl6 gene p a i r was subsequently i n s e r t e d i n t o the BamHI s i t e s of pPN2, pPN3, pON1, and pCGBPV9. 2.4 Mutagenesis of pPNIWT to Create the DX, IX, and MX Hspl6 Gene P a i r s The steps i n v o l v e d i n c o n s t r u c t i n g pPNIDX, pPNIIX, and pPNIMX are i l l u s t r a t e d i n F i g u r e 7. The exact l o c a t i o n s of r e s t r i c t i o n enzyme s i t e s are shown i n F i g u r e s 2 and 3. The sequences at the s i t e s of mutations and rearrangements are shown in F i g u r e 10. pPNIDX was made by e x c i s i n g the 157 bp i n t e r g e n i c Xbal fragment of the hspl6 gene p a i r i n pPNIWT. pPNIIX was made by i n s e r t i n g the p u r i f i e d i n t e r g e n i c Xbal fragment i n t o the Xbal s i t e of pPNIDX, such that the o r i e n t a t i o n of the Xbal fragment was rev e r s e d r e l a t i v e to i t s p o s i t i o n i n pPN1WT. pPNIMX was made by d i g e s t i n g pPNIDX with Xbal, adding 5 volumes of 70 mM sodium a c e t a t e pH 4.5, 300 mM NaCl, 2.5 mM 46 F i g u r e 7. C o n s t r u c t i o n of pPNIDX, pPNIIX, and pPNIMX. Wavy l i n e s are beneath the t r a n s c r i b e d sequences of the hspl6-1 (1), h s p l 6 - 48 (48), and NPT II genes. PMS-1 i s i n d i c a t e d by the open box. The b a c t e r i a l o r i g i n of r e p l i c a t i o n i s i n d i c a t e d by the open c i r c l e . X, Xbal s i t e ; N, N s i l s i t e . 47 ZnSO a, and 100 u n i t s of nuclease S1 (Boehringer Mannheim) and i n c u b a t i n g the mixture at 37°C f o r 15 min. The d i g e s t e d v e c t o r DNA was e x t r a c t e d with phenol and then p r e c i p i t a t e d by the a d d i t i o n of 0.1 volumes of 3 M sodium a c e t a t e pH 5.0 c o n t a i n i n g 0.25% p o l y a c r y l a m i d e c a r r i e r , and 2 volumes of e t h a n o l . The ragged ends at the nuclease S1 d i g e s t e d Xbal s i t e of the v e c t o r were f i l l e d i n with d e o x y r i b o n u c l e o t i d e s u s i n g the Klenow fragment of DNA polymerase I as d e s c r i b e d (209) and then l i g a t e d t o g e t h e r . 2.5 C o n s t r u c t i o n of pPN2NF The assembly of the NF hspl6 gene p a i r i n pPN2 i s i l l u s t r a t e d i n F i g u r e 8. The f o l l o w i n g three fragments were p u r i f i e d and then l i g a t e d t o g e t h e r : 1)the Hpal- N s i I fragment of pPNIIX c o n t a i n i n g the 5' end of the IX hspl6-1 gene, 2) the N s i I - S a i l fragment of pPNIWT c o n t a i n i n g the complete WT h s p l 6 - 48 gene, and 3) the S a i l - Hpal fragment of pPN2WT c o n t a i n i n g a l l of the t r a n s f e c t i o n v e c t o r sequences and the 3' end of the WT hspl6-1 gene. 2.6 C o n s t r u c t i o n of pPN2RM The assembly of the RM hspl6 gene p a i r i n pPN2 i s i l l u s t r a t e d i n F i g u r e 9. pPN2WT was cut with R s a l , e x o n u c l e o l y t i c a l l y degraded with Klenow fragment i n the presence of dATP, dCTP, and dGTP, and d i g e s t e d with 5 u n i t s of nuclease S1 as d e s c r i b e d above. A f t e r e x t r a c t i n g and p r e c i p i t a t i n g the 48 F i g u r e 8. C o n s t r u c t i o n of pPN2NF. Wavy l i n e s are beneath the t r a n s c r i b e d sequences of the hspl6-1 (1), hspl6-48 (48), and NPT II genes. PMSs are i n d i c a t e d by the open boxes and the b a c t e r i a l o r i g i n of r e p l i c a t i o n i s i n d i c a t e d by the open c i r c l e . H, Hpal s i t e ; X, Xbal s i t e , S, S a i l s i t e , N, N s i l s i t e . 49 R N (R) N ^ (R) 1 (R) F i g u r e 9. C o n s t r u c t i o n of pPN2RM. Wavy l i n e s are beneath the t r a n s c r i b e d sequences of the hspl6-1 ( 1 ) , hspl6-48 (48), and NPT II genes. PMSs are i n d i c a t e d by the open boxes and the b a c t e r i a l o r i g i n of r e p l i c a t i o n i s i n d i c a t e d by the open c i r c l e . N, Nsi I s i t e ; S, S a i l s i t e ; R, Rsal s i t e . (R) i n d i c a t e s a mutated Rsal s i t e . 50 DNA as above and d i g e s t i n g with N s i l , the N s i l - ( R s a l ) fragment c o n t a i n i n g hspl6-1 was p u r i f i e d . The brackets d e s i g n a t e a mutated Rsal s i t e . A complete h s p l 6 gene p a i r b e a r i n g the nuclease S1-generated d e l e t i o n at the i n t e r g e n i c Rsal s i t e was reassembled i n pPN2 by l i g a t i n g the p u r i f i e d N s i I - ( R s a l ) fragment to both the R s a l - S a i l fragment of pPN2WT that i n c l u d e s hspl6-48 and the S a l l - N s i l fragment of pPN2WT that i n c l u d e s a l l of the pPN2 v e c t o r sequences and the 3' end of h s p l 6 - 1 . 2.7 Sequencing of Mutated Hspl6 Promoter Regions The Sau3AI fragment of each c o n s t r u c t that i n c l u d e s the hspl6 promoter r e g i o n s was i n s e r t e d i n t o the BamHI s i t e of M13 mp8. A f t e r t r a n s f o r m a t i o n of JM101, s i n g l e - s t r a n d e d template DNA was p u r i f i e d as d e s c r i b e d (212). The sequence of the i n s e r t was determined by the c h a i n t e r m i n a t i o n method of Sanger (213), u s i n g m o d i f i c a t i o n s as d e s c r i b e d (214) to anneal primer (17-mer sequencing primer, Pharmacia) to the template and then extend the primer with Klenow fragment of DNA polymerase i n the presence of both dideoxy- and d e o x y r i b o n u c l e o t i d e s and [ a - 3 2 P ] dATP (Amersham). 2.8 C e l l C u l t u r e C127 mouse f i b r o b l a s t c e l l s were obtained from the American Type C u l t u r e C o l l e c t i o n , R o c k v i l l e , Maryland. These c e l l s were grown i n Dulbecco's m o d i f i e d ' E a g l e ' s medium (215) c o n t a i n i n g 10% f e t a l bovine serum (DME/FBS) i n 37°C c u l t u r e chambers with an 51 atmosphere of 10% C0 2. C127 c e l l s were passaged by r i n s i n g the monolayers with 10 mM Na 2HP0 4 pH 7.4, 150 mM NaCl, 3 mM KC1, 1 mM Na 2EDTA, d e t a c h i n g the c e l l s i n the same s o l u t i o n c o n t a i n i n g 0.05% t r y p s i n ( G i b c o ) , and then t r a n s f e r r i n g one-twentieth of the c e l l s to a new c u l t u r e f l a s k c o n t a i n i n g DME/FBS. M o r p h o l o g i c a l l y transformed c e l l s were passaged i n the same manner but, because these c e l l s are e f f i c i e n t l y detached from f l a s k s by the a c t i o n of EDTA alone, t r y p s i n was not used. 2.9 T r a n s f e c t i o n 500 ng of a PN or ON v e c t o r with or without 250 ng of BPV DNA, or 250 ng of CGBPV v e c t o r a l o n e , was used f o r each t r a n s f e c t i o n . 250 til of 250 mM C a C l 2 c o n t a i n i n g t h i s DNA was e x t r a c t e d with c h l o r o f o r m and c h i l l e d on i c e . An equal volume of c o l d 2X HBS (IX HBS=20 mM HEPES pH 7.1, 1.4 mM Na 2HPO„, 140 mM NaCl, 5 mM KC1, 6 mM glucose) was added while v i g o u r o u s l y bubbling a i r through the C a C l 2 s o l u t i o n . The r e s u l t i n g suspension of a f i n e c a l c i u m phosphate p r e c i p i t a t e was t r a n s f e r r e d to a 25 cm 2 c e l l c u l t u r e f l a s k c o n t a i n i n g 10 5 C127 c e l l s i n 3 ml of DME/FBS. A f t e r 12 h at 37°C the medium was removed and the c e l l s were shocked by r i n s i n g them i n HBS/10% g l y c e r o l f o r 2.5 min. The c e l l s were then r i n s e d i n DME/FBS and subsequently grown i n DME/FBS at 37°C. The a n t i b i o t i c G418 (Gibco) was added to a c o n c e n t r a t i o n of 0.6 mg/ml 48 h a f t e r the g l y c e r o l shock. Primary t r a n s f e c t e d c e l l c u l t u r e s were fed with f r e s h DME/FBS c o n t a i n i n g 0.6 mg/ml of G418 at 5 day i n t e r v a l s . R e s i s t a n t c o l o n i e s were p i c k e d 12 to 15 days a f t e r t r a n s f e c t i o n 52 and grown up under G418 s e l e c t i o n . 2.10 I n d u c t i o n of the Heat Shock Response Adu l t C. elegans were heat shocked and t h e i r RNA was p u r i f i e d as d e s c r i b e d (162). The heat shock response was u s u a l l y induced i n sub-confluent C127 c e l l c u l t u r e s by t r a n s f e r r i n g f l a s k s to a water bath at 42.5°C for 60 min f o l l o w e d by 30 min of r ecovery i n an i n c u b a t o r at 37°C, or by adding sodium a r s e n i t e at 100 MM i n DME/FBS f o r 90 min f o l l o w e d by recovery i n f r e s h DME/FBS without a r s e n i t e f o r 60 min. Any changes i n these i n d u c t i o n c o n d i t i o n s are d e s c r i b e d i n R e s u l t s . 2.11 I s o l a t i o n of N u c l e i c A c i d s C e l l s were r i n s e d with 25 mM Na 2EDTA pH 7.5, 75 mM NaCl and then l y s e d i n the same s o l u t i o n c o n t a i n i n g 0.5% SDS and 100 Mg/ml P r o t e i n a s e K (Boehringer Mannheim) for 40 min at 37°C. The l y s a t e was e x t r a c t e d once with phenol and twice with p h e n o l : c h l o r o f o r m (1:1) and t o t a l n u c l e i c a c i d s were p r e c i p i t a t e d by the a d d i t i o n of 0.1 volumes of 3.5 M sodium a c e t a t e and 2 volumes of e t h a n o l . A f t e r 12 h at -20°C, the p r e c i p i t a t e was p e l l e t e d by c e n t r i f u g a t i o n at 15,000 g f o r 10 min and then d i s s o l v e d i n 5 mM T r i s - C l pH 7.4, 0.5 mM Na2EDTA.. 2.12 Q u a n t i f y i n g N u c l e i c A c i d s P u r i f i e d M13 mp8 templates and phage X DNA (Bethesda Research L a b o r a t o r i e s ) , and C127 c e l l RNA that had been p u r i f i e d 53 by c e n t r i f u g a t i o n through C s C l as d e s c r i b e d (216) were q u a n t i f i e d by spectrophotometry, assuming that 1 A 2 g 0 u n i t = 40 nq of RNA or 50 /ug of DNA. Spectrophotometry was not r e l i a b l e f o r q u a n t i f y i n g the C127 c e l l n u c l e i c a c i d samples that had been prepared by e x t r a c t i o n with phenol and c h l o r o f o r m and p r e c i p i t a t e d with e t h a n o l as d e s c r i b e d above. The n u c l e i c a c i d components i n these samples were q u a n t i f i e d by l e s s a c c u r a t e but more r e l i a b l e v i s u a l methods. T o t a l n u c l e i c a c i d was separated by e l e c t r o p h o r e s i s through 1% agarose g e l s c o n t a i n i n g TBE and 0.1% SDS. A f t e r soaking the g e l i n 0.2 nq/ml of e t h i d i u m bromide and i l l u m i n a t i n g i t with UV l i g h t , t hree major bands of f l u o r e s c i n g n u c l e i c a c i d were v i s i b l e . The band with the lowest m o b i l i t y i s high molecular weight DNA and the other two bands are 28S and 18S rRNA. The q u a n t i t y of DNA was e s t i m a t e d by comparing i t s i n t e n s i t y of f l u o r e s c e n c e to that of a known q u a n t i t y of phage X DNA that had been d i g e s t e d with H i n d l l l and separated on the same g e l . RNA was q u a n t i f i e d i n the same way, but adjustments were made f o r the d i f f e r e n c e i n e t h i d i u m b i n d i n g of rRNA versus DNA and f o r the p r o p o r t i o n of rRNA i n t o t a l RNA by determining the amount of phage X DNA t h a t produced the same f l u o r e s c e n c e as the rRNA i n 1 jig of C s C l - p u r i f i e d t o t a l c e l l u l a r RNA. Degradation of RNA was d e t e c t e d by smearing of the rRNA bands, which are normally very d i s c r e t e . 2.13 E l e c t r o p h o r e s i s of N u c l e i c A c i d s and T r a n s f e r to F i l t e r s For s i z i n g and i d e n t i f y i n g DNA fragments, t o t a l c e l l u l a r n u c l e i c a c i d was d i g e s t e d with RNase A and r e s t r i c t i o n enzymes, 54 s e p a r a t e d by e l e c t r o p h o r e s i s through agarose g e l s c o n t a i n i n g TBE, and p a r t i a l l y d e p u r i n a t e d with HC1 as d e s c r i b e d (209). The DNA w i t h i n the g e l was then denatured with NaOH, n e u t r a l i z e d with T r i s , and t r a n s f e r r e d to n i t r o c e l l u l o s e f i l t e r s as d e s c r i b e d (209), u s i n g 1 M ammonium a c e t a t e as the t r a n s f e r r i n g s o l u t i o n . A l t e r n a t i v e l y , DNA was t r a n s f e r r e d to Zetaprobe (Biorad) nylon f i l t e r s i n 0.4 M NaOH immediately a f t e r d e p u r i n a t i o n as d e s c r i b e d (217). For s i z i n g and i d e n t i f y i n g RNA, t o t a l c e l l u l a r n u c l e i c a c i d and r e s t r i c t i o n enzyme-generated fragments of c l o n e d DNA were denatured with formaldehyde, separated by e l e c t r o p h o r e s i s through agarose g e l s c o n t a i n i n g formaldehyde, and t r a n s f e r r e d to n i t r o c e l l u l o s e as d e s c r i b e d (209). 2.14 P r e p a r a t i o n of L a b e l l e d DNA f o r H y b r i d i z a t i o n DNA fragments were l a b e l l e d by n i c k - t r a n s l a t i o n as d e s c r i b e d (218). Short lengths of l a b e l l e d DNA complementary to i n s e r t s i n M13 mp c l o n i n g v e c t o r s were s y n t h e s i z e d by the f o l l o w i n g procedure. 500 ng of s i n g l e - s t r a n d e d template DNA was annealed with 0.5 pmoles of 17-mer sequencing primer (Pharmacia) by i n c u b a t i o n i n 10 M1 of 50 mM T r i s - C l pH 7.6, 20 mM MgCl 2, 50 mM NaCl, 2 mM d i t h i o t h r e i t o l at 58°C f o r 60 min. 10 ul of 200 MM dCTP, 200 MM dGTP, 200 MM dTTP and 0.6 juM [a- 3 2 P ] d A T P (>3000 Ci/mmol, Amersham), and 1 u n i t of Klenow fragment of DNA Polymerase I were added and the mixture was incubated at 37°C f o r 5 min. Under these c o n d i t i o n s , the s y n t h e s i z e d DNA c o n t a i n i n g l a b e l l e d dATP extends f o r 400 to 1000 bases. 55 U n l a b e l l e d dATP was then added to a f i n a l c o n c e n t r a t i o n of 50 MM i n order to f u r t h e r extend the r e g i o n of double-stranded DNA. The d e s i r e d probe fragment was then e x c i s e d i n double-stranded form by the a d d i t i o n of an a p p r o p r i a t e amount of NaCl and r e s t r i c t i o n enzymes with f l a n k i n g r e c o g n i t i o n s i t e s ( t y p i c a l l y H a e l l l and EcoRI f o r e x c i s i o n of probes from M13 mp8). N i c k - t r a n s l a t i o n or primer e x t e n s i o n l a b e l l i n g r e a c t i o n s were terminated by the a d d i t i o n of 4 volumes of 10 mM T r i s - C l pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.1% SDS. U n i n c o r p o r a t e d n u c l e o t i d e s were removed from the l a b e l l e d DNA by a b s o r p t i o n i n t o Sephadex G-50 (Pharmacia) spun columns prepared as d e s c r i b e d (209), except that 0.1% SDS was i n c l u d e d i n a l l s o l u t i o n s . Immediately p r i o r to use as h y b r i d i z a t i o n probes, l a b e l l e d DNA fragments were denatured by immersion i n a b o i l i n g water bath f o r 4 min and then r a p i d l y c o o l e d by immersion i n a dry i c e / e t h a n o l bath. 2.15 F i l t e r H y b r i d i z a t i o n F i l t e r s with s u r f a c e areas of about 100 cm 2 were p r e h y b r i d i z e d i n 10 ml of 50% formamide, 5X SSPE (1X SSPE=10 mM sodium phosphate pH 7.4, 150 mM NaCl, 1 mM Na 2EDTA), 0.5% SDS, 200 Mg/ml he p a r i n (219) f o r 30 min at 37°C and then h y b r i d i z e d i n 5 ml of the same s o l u t i o n c o n t a i n i n g about 5 x 10 6 cpm of denatured probe DNA at 42°C f o r 12 h. H y b r i d i z e d f i l t e r s were washed s e q u e n t i a l l y f o r 20 min at 23°C i n 5X SSPE 0.1% SDS, 2X SSPE 0.1% SDS, 0.5X SSPE 0.1% SDS, 0.1X SSPE 1% SDS, and then washed f o r 20 min at 50°C i n 0.1X SSPE 1% SDS. An a d d i t i o n a l 30 56 min wash at 50°C i n 5X SSPE 0.3% SDS was used f o r nylon membranes. F i l t e r s were then autoradiographed with the use of i n t e n s i f y i n g screens. 2.16 P r e p a r a t i o n of L a b e l l e d S i n g l e - s t r a n d e d DNA f o r T r a n s c r i p t Mapping and Q u a n t i f i c a t i o n 0.5 pmol of 17-mer sequencing primer (Pharmacia) and 200-500 ng of M13 mp8 s i n g l e - s t r a n d e d template c a r r y i n g the a p p r o p r i a t e i n s e r t were annealed i n 10 ml of 50 mM T r i s - C l pH 7.6, 20 mM MgCl 2, 10 mM NaCl, 2 mM d i t h i o t h r e i t o l at 58°C f o r 60 min. The annealed primer was extended with Klenow fragment of DNA Polymerase I i n the presence of 50 u.M each of dCTP, dGTP, and dTTP and 0.3 MM [ a - 3 2 P ] dATP (>3000 Ci/mmol, Amersham) f o r 1 min at 23°C. Under these c o n d i t i o n s , the primer i s extended f o r 60 to 120 bases. Unlabeled dATP was then added to 50 MM and the r e a c t i o n was co n t i n u e d f o r an a d d i t i o n a l 5 min. Probes with l a b e l l e d n u c l e o t i d e s i n c o r p o r a t e d throughout t h e i r l e n g t h , which were used f o r mapping 3' t e r m i n i and s p l i c e j u n c t i o n s , were made by i n c l u d i n g 2 MM u n l a b e l l e d dATP i n the i n i t i a l e x t e n s i o n r e a c t i o n , which was continued at 37°C f o r 15 min. A s i n g l e c ut i n the double-stranded DNA was made by adding a r e s t r i c t i o n enzyme and an a p p r o p r i a t e amount of NaCl, and i n c u b a t i n g the mixture at 37°C f o r 20 min. The l a b e l l e d probe fragment, which extends from the primer to the r e s t r i c t i o n enzyme s i t e , was p u r i f i e d i n s i n g l e - s t r a n d e d form by e l e c t r o p h o r e s i s through a 4% TBE/urea p o l y a c r y l a m i d e g e l (209). A f t e r l o c a l i z a t i o n by autoradiography and e x c i s i o n , the probe fragment was e l e c t r o -57 e l u t e d i n 0.5X TBE 0.05% SDS, and p r e c i p i t a t e d by the a d d i t i o n of 0.1 volumes of 3.5 M sodium a c e t a t e c o n t a i n i n g 0.25% p o l y a c r y l a m i d e c a r r i e r , and 2 volumes of e t h a n o l . The p r e c i p i t a t e was recovered by c e n t r i f u g a t i o n at 15,000 g f o r 15 min and d i s s o l v e d i n water. 2.17 T r a n s c r i p t Mapping and Q u a n t i f i c a t i o n by Nuclease S1 P r o t e c t i o n of S i n g l e - s t r a n d e d Probes 100,000 cpm of s i n g l e - s t r a n d e d probe were mixed with 1 jug of t o t a l n u c l e i c a c i d i n a f i n a l volume of 30 M1 of 50% formamide, 10 mM PIPES pH 6.9, 400 mM NaCl, 1 mM EDTA. The mixture was heated to 70°C f o r 15 min, and then h y b r i d i z e d at 42°C for 12 h. 170 jul of 70 mM sodium a c e t a t e , pH 4.5, 600 mM NaCl, 2.5 mM ZnSO a c o n t a i n i n g 150 u n i t s of nuclease S1 (Pharmacia) was then added and a f t e r d i g e s t i o n f o r 1 h at 37°C the undegraded probe was p r e c i p i t a t e d by the a d d i t i o n of 30 nl of 100 mM Na 2EDTA pH 8.0, 4 M ammonium a c e t a t e , 100 uq/ml tRNA, and 230 nl of i s o p r o p a n o l . A f t e r 20 min at -70°C, the samples were c e n t r i f u g e d at 15,000 g f o r 10 min, and the p e l l e t s were r i n s e d with 70% e t h a n o l and then a i r - d r i e d f o r 15 min. The dry p e l l e t s were d i s s o l v e d i n 99% formamide, 5 mM Na 2EDTA pH 8.0. To make DNA s i z e markers, pBR322 DNA was d i g e s t e d with H p a l l i n 20 mM T r i s - C l pH 7.8, 10 mM NaCl, 10 mM MgCl 2 and the r e s u l t i n g DNA fragments were e n d - l a b e l l e d by adding dATP, dGTP, and dTTP to c o n c e n t r a t i o n s of 100 *xM, [ a - 3 2 P ] d C T P (>3000 Ci/mmol, Amersham) to a c o n c e n t r a t i o n of 0.2 ULM, and Klenow fragment of DNA Polymerase I to a c o n c e n t r a t i o n of 0.05 58 u n i t s / M l . A f t e r 10 min at 37°C, the l a b e l l i n g r e a c t i o n was t e r m i n a t e d by the a d d i t i o n of 1 volume of 50 mM Na 2EDTA pH 8.0. 1 jul of t h i s s o l u t i o n was added to 100 nl of 99% formamide, 5 mM Na 2EDTA pH 8.0 The nuclease S1 d i g e s t e d samples and e n d - l a b e l l e d DNA s i z e markers i n formamide/EDTA were p l a c e d i n a b o i l i n g water bath f o r 4 min, r a p i d l y c h i l l e d i n an i s o p r o p a n o l bath c o n t a i n i n g dry i c e , immediately separated by e l e c t r o p h o r e s i s through 6% p o l y a c r y l a m i d e g e l s c o n t a i n i n g TBE and 7 M urea as d e s c r i b e d (209), and v i s u a l i z e d by autoradiography with the use of i n t e n s i f y i n g screens. 2.18 Q u a n t i f y i n g Genes and T r a n s c r i p t s S p e c i f i c DNAs and RNAs w i t h i n samples of c e l l u l a r n u c l e i c a c i d were q u a n t i f i e d by i n s p e c t i o n of autoradiograms of f i l t e r h y b r i d i z a t i o n s or nuclease S1 p r o t e c t i o n experiments, r e s p e c t i v e l y . Known amounts of s p e c i f i c p u r i f i e d DNA or RNA that h y b r i d i z e d to the probes were t r e a t e d i n p a r a l l e l with samples of c e l l u l a r n u c l e i c a c i d . The amount of a s p e c i f i c DNA or RNA w i t h i n the c e l l u l a r n u c l e i c a c i d was then e s t i m a t e d by d e t e r m i n i n g how much of the pure DNA or RNA would h y b r i d i z e with the same amount of the probe as does the c e l l u l a r n u c l e i c a c i d sample. a) C a l c u l a t i n g gene copy number: copy # = pg of h y b r i d i z i n g DNA x l e n g t h of t o t a l DNA pg of t o t a l DNA l e n g t h of h y b r i d i z i n g DNA The hspl6 fragment of the WT c e l l l i n e ( F i g u r e 22) w i l l be used as an example. 1) By i n s p e c t i o n , the amount of hsp16 DNA i n 1/Jq of WT DNA i s e q u i v a l e n t to the amount of hspl6 DNA i n 16 pg of pPNIWT, which has a l e n g t h of 6300 bp. 2) A d i p l o i d mouse c e l l c o n t a i n s 4.6 x 10 bp of DNA (220). hsp16 copy # = 16 pg x 4.6 x 10 b p / c e l l = 11.7 c o p i e s / c e l l 10* pg 6300 bp/copy b) C a l c u l a t i n g t r a n s c r i p t abundance: T r a n s c r i p t abundance = pg of t r a n s c r i p t x 100% pg of mRNA The hsp16-48 t r a n s c r i p t i n heat shocked WT c e l l s ( F i g u r e 24) w i l l be used as an example. 1) By i n s p e c t i o n , the WT HS band was estimated to be about f i v e times as i n t e n s e as the band p r o t e c t e d by 1.1 pg of s i n g l e - s t r a n d e d DNA complementary to the probe. T h i s estimate was a s s i s t e d by r e f e r e n c e to other experiments that used a narrow range of increments i n the amount of s i n g l e - s t r a n d e d probe. 60 2) The p r o t e c t e d probe i s covered by 95 b of t r a n s c r i p t . The f u l l l e n g t h of the hsp16-48 t r a n s c r i p t , i n c l u d i n g the presumptive polyA t a i l , i s estimated to be 900 b. the amount of hsp16-48 t r a n s c r i p t i n 1 fq of WT c e l l n u c l e i c a c i d = 5.5 pg x 900 b = 50 pg 95 b 3) 75% of mouse c e l l n u c l e i c a c i d i s RNA, of which 3% i s mRNA (221) 1 jjq of c e l l u l a r n u c l e i c a c i d c o n t a i n s 22,000 pg of mRNA hsp16-48 t r a n s c r i p t abundance = 50 pg x 100% 22,UU0 pg = 0.22% of mRNA c) C a l c u l a t i n g the number of t r a n s c r i p t s per c e l l : t r / c e l l = bases of mRNA/cell x amount of t r a n s c r i p t bases of RNA/tr amount of mRNA 1) There i s three times as much RNA as DNA i n a mouse c e l l . 3 x 9.2 x 10 ? b of DNA/cell = 2.8 x to'* b of RNA/cell = 8.4 x 10 b of mRNA/cell # of hsp16-48 t r a n s c r i p t s / c e l l = 8.4 x 10 b x 0.0022 900 b 2000 t r a n s c r i p t s / c e l l Measurements of n u c l e i c a c i d c o n c e n t r a t i o n s and amounts of h y b r i d i z i n g probes are based on v i s u a l comparisons t h a t probably have an u n c e r t a i n t y i n the range of 10 to 40%. Any r a t i o of two t r a n s c r i p t abundances w i l l have a compounded u n c e r t a i n t y . E s t i m a t e s of ab s o l u t e amounts of t r a n s c r i p t s or gene copy numbers are f u r t h e r a f f e c t e d by e r r o r s i n the c o n c e n t r a t i o n of the pure n u c l e i c a c i d s that are used as standards. These r a t h e r 61 a l a r m ing u n c e r t a i n t i e s can be reduced by r e p e a t i n g measurements, p a r t i c u l a r l y by examining d i f f e r e n t c e l l l i n e s t h a t c a r r y the same t r a n s f e c t e d genes. 62 I I I . RESULTS 3.1 S t r u c t u r e of the Hspl6 Gene P a i r 1900 bp of DNA from the C. elegans hspl6-1 + hspl6-48 lo c u s ( F i g u r e 1) was t r a n s f e r r e d to t r a n s f e c t i o n v e c t o r s f o r e x p r e s s i o n i n C127 c e l l s . T h i s fragment c o n t a i n s s i n g l e c o p i e s of the hspl6-1 and hspl6-48 genes i n a d i v e r g e n t l y t r a n s c r i b e d p a i r , separated by 340 bp of i n t e r g e n i c DNA. The e n t i r e sequence of the hspl6 gene p a i r i s shown i n F i g u r e 2. The 1900 bp fragment i n c l u d e s p o l y a d e n y l a t i o n s i g n a l sequences and an a d d i t i o n a l 250 bp of DNA downstream from each gene. 3.2 Mutation and Rearrangement of the Hspl6 Gene P a i r S e v e r a l rearrangements i n the i n t e r g e n i c r e g i o n of t h i s w i l d - t y p e (WT) hspl6 gene p a i r were made ( F i g u r e 10): 1) IX = I n v e r s i o n of Xbal fragment: The i n t e r g e n i c Xbal fragment of WT was i n v e r t e d . The r e s u l t i n g hspl6-1 gene has only one HSE adjacent to i t s TATA element while the hspl6-48 gene has t h r e e o v e r l a p p i n g HSEs. 2) DX = D e l e t i o n of Xbal fragment: The 154 bp of DNA between the i n t e r g e n i c Xbal s i t e s was d e l e t e d , l e a v i n g a s i n g l e HSE p o s i t i o n e d between the two TATA elements. 3) MX = Mutation of Xbal s i t e : The s i n g l e HSE i n DX was de s t r o y e d by a 13 bp d e l e t i o n , l e a v i n g the two f l a n k i n g TATA elements i n t a c t . 4) NF = N s i l s i t e F u s i o n : The two HSEs of the hspl6-48 gene i n 63 W T T T T A T A - / 1 7 / - C T A G A A C A T T C G A G C T G C T T C T T G - / 1 2 0 / - C T A G G A C C T T C T A G A A C A T T C T A A - / 1 8 / - T A T A T A T i , — | 1 P ID 48D 4 8 P IX. T T T A T A - / 1 7 / - C T A G A A G G T C C T A G - / 1 2 0 / - C A A G A A G C A G C T C G A A T G T T C T A G A A C A T T C T A A - / 1 8 / - T A T A T A r — • I •* — i — I — • " 8 ° . 1D I P 4 8 P DX T T T A T A - / 1 7 / - C T A G A A C A T T C T A A - / 1 8 / - TAT AT A | • 4 8 P M X T T T A T A - / 1 4 / - T T C T A A - / 1 8 / - T A T A T A N F T T T A T A - / 1 7 / - C T A G A A G G T C C T A G A T G C A T C T A G G A C C T T C T A G A A C A T T C T A A - / 1 8 / - T A T A T A I " I ~m 1 • 48D NEW 48D 4 8 P i i f T AWi/WVWWVWA W I TGAGAAATAGTGTGCGTACTGAAGAAAC V N . . AVWWVWA K M TGAGAAATAGTGTGCGACTGAAGAAAC F i g u r e 10. The HSEs, TATA elements, and a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequences of the w i l d - t y p e and mutated hspl6 gene p a i r s . HSEs are u n d e r l i n e d , with dots at mismatches to the consensus sequence. The HSEs are d e s i g n a t e d by t h e i r p o s i t i o n i n the WT gene p a i r , e.g. 48P i s the hspl6-48 HSE proximal to the TATA element, 48D i s the d i s t a l HSE, e t c . 'New' r e f e r s to the HSE that i s c r e a t e d in the c o n s t r u c t i o n of NF. The bases of the Xbal s i t e s i n WT, IX, and DX, and the bases of the N s i l s i t e of NF are o v e r l i n e d . The a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequences have z i g - z a g g i n g o v e r l i n e s . The base t h a t i s d e l e t e d i n RM i s i n d i c a t e d by the t r i a n g l e . 64 WT were d i r e c t l y fused to the s i n g l e HSE of hspl6-1 i n IX by l i g a t i n g together the upstream N s i l s i t e s . T h i s c r e a t e s a c l u s t e r of four o v e r l a p p i n g HSEs p o s i t i o n e d between the TATA elements of the two genes; one of these HSEs, with two mismatches to the consensus sequence, i s c r e a t e d around the new N s i l s i t e . The NF gene p a i r i s i d e n t i c a l to the DX gene p a i r except f o r the i n s e r t i o n of three a d d i t i o n a l HSEs. 5) RM = Rsal s i t e M utation: A run of a l t e r n a t i n g p u r i n e s and p y r i m i d i n e s i n the i n t e r g e n i c region of WT was reduced i n l e n g t h from 10 bp to 7 bp by d e l e t i o n of a s i n g l e base p a i r . 3.3 Vector C o n s t r u c t i o n M a t t h i a s et a l . (189) have c o n s t r u c t e d a BPV t r a n s f e c t i o n v e c t o r c a l l e d pCGBPV9 ( F i g u r e 11). I t i s 11,700 bp i n s i z e and c o n t a i n s the complete BPV genome, a b a c t e r i a l o r i g i n of r e p l i c a t i o n , a phage X cos s i t e , and the TN5 neomycin phosphotransferase type II gene (NPT I I ) . The NPT II gene i n pCGBPV9 has both a b a c t e r i a l pBR322 P1 promoter and a e u k a r y o t i c HSV tk promoter to allow s e l e c t i o n f o r kanamycin r e s i s t a n c e i n E. c o l i and G418 r e s i s t a n c e i n t r a n s f e c t e d mouse c e l l s (191). T h i s v e c t o r was m o d i f i e d by removing the 7300 bp of BPV DNA between the C l a l s i t e s . The r e s u l t i n g v e c t o r , pPN1, i s 4400 bp i n s i z e and has r e t a i n e d 640 bp of BPV DNA, i n c l u d i n g PMS-1 ( F i g u r e 12). Vector pPN2 i s a m o d i f i c a t i o n of pPN1 that a l s o c o n t a i n s PMS-2 as a 365 bp Hael11 fragment i n s e r t e d at the EcoRV s i t e immediately upstream from the NPT II promoters ( F i g u r e 12). The r e l a t i v e o r i e n t a t i o n s of the two PMSs i s the same i n both 65 BamHI F i g u r e 11. S t r u c t u r e of the t r a n s f e c t i o n v e c t o r pCGBPV9. Heavy l i n e s r e p r e s e n t BPV sequences. Hatched boxes, PMSs; O r i , ColE1-d e r i v e d o r i g i n of r e p l i c a t i o n ; Cos, phage X cos s i t e ; P1 , P1 promoter of pBR322; tk, HSV tk promoter. Wavy arrows represent t r a n s c r i p t s . Open c i r c l e s r e p r e s e n t p o l y a d e n y l a t i o n s i g n a l sequences. 66 P M S - 2 Hind IIJ F i g u r e 12. S t r u c t u r e of the t r a n s f e c t i o n v e c t o r pPN1. Heavy l i n e s represent BPV sequences. Hatched boxes, PMSs; O r i , ColE1-d e r i v e d o r i g i n of r e p l i c a t i o n ; Cos, phage X cos s i t e ; P1, PI promoter of pBR322; tk, HSV tk promoter. The wavy arrow re p r e s e n t s the NPT II t r a n s c r i p t . The open c i r c l e r e p r e s e n t s the p o l y a d e n y l a t i o n s i g n a l sequence. The PMS-2-containing i n s e r t of pPN2 i s shown above the EcoRV s i t e . 67 pPN2 and BPV. C. elegans hspl6 gene p a i r s were i n s e r t e d i n t o the BamHI s i t e of the PN v e c t o r s , with hspl6~48 adjacent to and t r a n s c r i b e d i n the same d i r e c t i o n as the NPT II gene. The WT, NF, and RM gene p a i r s were i n s e r t e d i n t o pPN2 and the DX, MX, and IX gene p a i r s were i n s e r t e d i n t o pPN1. 3.4 T r a n s f e c t i o n C127 c e l l s were t r a n s f e c t e d with e i t h e r a mixture of s u p e r c o i l e d PN v e c t o r DNA and f u l l l e n g t h c i r c u l a r i z e d BPV DNA, or s u p e r c o i l e d CGBPV v e c t o r DNA alone, u s i n g the c a l c i u m phosphate c o - p r e c i p i t a t i o n method (51,52), and then put under s e l e c t i o n f o r G418 r e s i s t a n c e . A f t e r 10 to 15 days of s e l e c t i o n , a l l n o n - t r a n s f e c t e d c e l l s had d i e d and i n d i v i d u a l c o l o n i e s c o n t a i n i n g 100 to 1000 c e l l s were p r e s e n t . C o l o n i e s t h a t were both r e s i s t a n t to the drug and m o r p h o l o g i c a l l y transformed, and t h e r e f o r e harboured both f u n c t i o n a l NPT II genes and BPV tran s f o r m i n g genes, were p i c k e d and grown up as i n d i v i d u a l c e l l l i n e s . Ten to t h i r t y of these c o l o n i e s , and about four times as many r e s i s t a n t but non-transformed c o l o n i e s , were o b t a i n e d f o r each c o - t r a n s f e c t i o n with PN v e c t o r and BPV DNA. About h a l f of the G 4 1 8 - r e s i s t a n t c o l o n i e s r e s u l t i n g from t r a n s f e c t i o n s with CGBPV v e c t o r s were m o r p h o l o g i c a l l y transformed. 3.5 S t r u c t u r e of T r a n s f e c t e d DNA The s t r u c t u r e s of v e c t o r DNA i n i n d i v i d u a l c e l l l i n e s co-68 t r a n s f e c t e d with BPV and pPN2NF are shown i n F i g u r e 13. Copy numbers of pPN2NF were estimated to range from 4 to 60. The c a l c u l a t i o n s f o r determining gene copy numbers are d e s c r i b e d i n Methods. Most of the c o p i e s were converted to f u l l l e n g t h l i n e a r molecules by d i g e s t i o n with Xbal, which has two very c l o s e l y spaced s i t e s w i t h i n the NF hspl6 gene p a i r ( F i g u r e 2), but a v a r i a b l e p r o p o r t i o n of the c o p i e s had s u f f e r e d rearrangements or d e l e t i o n s r e s u l t i n g i n l a r g e r or s m a l l e r fragment s i z e s . The v e c t o r DNA i n c e l l l i n e NF-5 was dominated by c o p i e s that had a l l d e l e t e d an estimated 600 bp of DNA. No monomeric episomes of pPN2NF DNA c o u l d be d e t e c t e d when the c e l l u l a r DNA was s e l e c t i v e l y fragmented with S s t I , which does not cut w i t h i n e i t h e r the BPV or v e c t o r sequences ( F i g u r e 13). The s t a t e of the BPV DNA i n c e l l l i n e s that had been co-t r a n s f e c t e d with BPV DNA and v a r i o u s PN v e c t o r s i s shown i n F i g u r e s 14 and 15. The c o - t r a n s f e c t e d BPV DNA was present i n 5 to 50 c o p i e s that were predominantly unrearranged ( F i g u r e 14). Some monomeric and d i m e r i c episomes were present i n the co-t r a n s f e c t e d c e l l s , i n a d d i t i o n to l a r g e r amounts of BPV DNA that was i n a more complex, high molecular weight form ( F i g u r e 15). F i g u r e s 16 and 17 show the s t a t e of t r a n s f e c t e d pCGBPV9 and pCGBPV9WT v e c t o r DNA. The probe that was used i n the h y b r i d i z a t i o n shown i n F i g u r e 16 was only complementary to the H i n d i 11 fragment that i n c l u d e s the b a c t e r i a l o r i g i n of r e p l i c a t i o n , the NPT II gene, and the hspl6 gene p a i r . These p a r t s of the CGBPV v e c t o r s were predominantly unrearranged i n t r a n s f e c t e d c e l l s . The copy numbers of the CGBPV9 v e c t o r s were 69 x b q ' ™t Sstl cut C o p y # 30 ? 4 45 60 10 7 5 8 6 F i g u r e 13. S t r u c t u r e of pPN2NF i n t r a n s f e c t e d c e l l s . Approximately 1 uq of c e l l u l a r DNA was d i g e s t e d with e i t h e r Xbal or S s t l , separated by e l e c t r o p h o r e s i s through a 0.5% agarose g e l , t r a n s f e r r e d to a nylon membrane, and h y b r i d i z e d with n i c k -t r a n s l a t e d pONIWT DNA. Lanes 1-10, DNA from c e l l l i n e s NF-1 to 10, which were t r a n s f e c t e d with pPN2NF + BPV; Lanes P, 10 pg of pPN2NF DNA. L, p o s i t i o n of l i n e a r i z e d pPN2NF; S1 and R1, p o s i t i o n s of s u p e r c o i l e d and re l a x e d pPN2NF, r e s p e c t i v e l y . The DNA of c e l l l i n e NF-2 was not completely d i g e s t e d by e i t h e r of the r e s t r i c t i o n enzymes. 70 A 1 2 3 4 5 6 7 copy* 60 10 5 25 30 30 40 F i g u r e 14. S t r u c t u r e of l i n e a r i z e d BPV DNA i n t r a n s f e c t e d c e l l s . C127 c e l l s were c o - t r a n s f e c t e d with BPV DNA and v a r i o u s PN v e c t o r s . Approximately 1 jug of c e l l u l a r DNA was d i g e s t e d with Kpnl, which has a s i n g l e s i t e w i t h i n BPV DNA. The d i g e s t e d DNA was separated by e l e c t r o p h o r e s i s through a 0.8% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d to the nick t r a n s l a t e d BPV Kpnl-Xbal fragment. Lane A, 30 pg of pCGBPV9 d i g e s t e d with H i n d i 11; Lanes 1 to 7, DNA from i n d i v i d u a l t r a n s f e c t e d c e l l l i n e s ; L, p o s i t i o n of l i n e a r BPV DNA. 7 1 4 ^ 5 6 4 H M W «R2 F i g u r e 15. S t r u c t u r e of i n t a c t BPV DNA i n t r a n s f e c t e d c e l l s . 1 nq of DNA from c e l l l i n e s NF-4, NF-5, and NF-6 (l a n e s 4, 5, and 6 r e s p e c t i v e l y ) was d i g e s t e d with SstI , separated by e l e c t r o p h o r e s i s through a 0.4% agarose g e l , t r a n s f e r r e d to a nylon f i l t e r , and h y b r i d i z e d to the n i c k t r a n s l a t e d BPV Kpnl-Xbal fragment. HMW, p o s i t i o n of high molecular weight DNA i n the ethidi u m bromide-stained g e l ; S1 and S2, expected p o s i t i o n of monomeric and d i m e r i c s u p e r c o i l e d BPV DNA, r e s p e c t i v e l y ; R1 and R2, expected p o s i t i o n of monomeric and d i m e r i c r e l a x e d BPV DNA, r e s p e c t i v e l y . 72 CGB BH A 1 2 3 4 5 B 1 2 3 4 5 C c o p y 2 5 90 10 SO 40 100 350 20 5 250 F i g u r e 16. S t r u c t u r e of the non-BPV DNA w i t h i n CGBPV v e c t o r s i n t r a n s f e c t e d c e l l s . Plasmid DNA or 0.2 to 3 uq of c e l l u l a r DNA was d i g e s t e d with H i n d l l l , separated by e l e c t r o p h o r e s i s through a 0.6% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d to ni c k t r a n s l a t e d pONIWT. CGB, c e l l l i n e s t r a n s f e c t e d with pCGBPV9; BH, c e l l l i n e s t r a n s f e c t e d with pCGBPV9WT; Lane A, 20 pg of pCGBPV9; Lanes B and C, 10 pg and 40 pg of pCGBPV9WT, r e s p e c t i v e l y . 73 C 6 B «R2 R1.S2 4 SI F i g u r e 17. S t r u c t u r e of i n t a c t CGBPV v e c t o r s i n t r a n s f e c t e d c e l l s . 0.5 to 3 nq of c e l l u l a r DNA was d i g e s t e d with S s t I , separated by e l e c t r o p h o r e s i s through a 0.4% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d to n i c k t r a n s l a t e d pONIWT. CGB, c e l l l i n e s t r a n s f e c t e d with pCGBPV9; BH, c e l l l i n e s t r a n s f e c t e d with pCGBPV9WT; Lane A, 20 pg of d i m e r i c pCGBPV9; Lane B, 200 pg of pCGBPV9WT; SI and S2, p o s i t i o n of monomeric and d i m e r i c s u p e r c o i l e d pCGBPV9WT, r e s p e c t i v e l y ; R1 and R2, p o s i t i o n of monomeric and dim e r i c r e l a x e d pCGBPV9WT, r e s p e c t i v e l y . 74 about f i v e - f o l d h i g h e r , on average, than the copy numbers of pPN2NF or BPV, although the ranges of copy numbers o v e r l a p to some ex t e n t . No monomeric episomes of e i t h e r pCGBPV9 or pCGBPV9WT c o u l d be d e t e c t e d f o l l o w i n g s e l e c t i v e d i g e s t i o n of the host c e l l DNA with S s t l ( F i g u r e 17). When the BPV DNA was omitted from the t r a n s f e c t i o n , the PN ve c t o r copy numbers were i n v a r i a b l y low i n the t r a n s f e c t e d c e l l s ( F i g u r e 18, pPN2WT-BPV), being reduced f i f t e e n - f o l d on average in comparison to c e l l s that had been c o - t r a n s f e c t e d with both PN v e c t o r and BPV DNA. Unexpectedly, h i g h copy numbers c o u l d be o b t a i n e d with pONIWT, a d e r i v a t i v e of pPNIWT th a t has no PMSs, when t h i s v e c t o r was c o - t r a n s f e c t e d with BPV DNA ( F i g u r e 18, pON1WT+BPV). As observed f o r pPN2WT, pONIWT copy numbers were reduced ten- to t w e n t y - f o l d when BPV DNA was omitted from the t r a n s f e c t i o n ( F i g u r e 19). To a v o i d c o - t r a n s f e c t i o n of PN or ON v e c t o r DNA with BPV DNA, a c e l l l i n e t h a t was m o r p h o l o g i c a l l y transformed by t r a n s f e c t i o n with BPV DNA was e s t a b l i s h e d . T h i s c e l l l i n e was then s u p e r - t r a n s f e c t e d with e i t h e r pPNIWT or pONIWT. Both of these v e c t o r s had average copy numbers of about 40 i n the r e s u l t i n g G 4 1 8 - r e s i s t a n t c e l l s ( F i g u r e 20), demonstrating that BPV-derived sequences do not have to be present i n the t r a n s f e c t e d DNA i n order to o b t a i n high copy numbers of e i t h e r PN or ON v e c t o r s . A s e r i e s of PN v e c t o r d e r i v a t i v e s were c o n s t r u c t e d to determine the sequence requirements f o r e l e v a t e d v e c t o r copy 75 P N 2 W T - B P V 0 N 1 W T + B P V 1 2 3 4 5 A B C 1 2 3 4 5 6 7 copy* 2 2 0 2 0.5 0 2 4 0 8 7 6 20 F i g u r e 18. E f f e c t of BPV and PMSs on v e c t o r copy number i n t r a n s f e c t e d c e l l s . Approximately 1 jug of DNA from c e l l l i n e s t r a n s f e c t e d with pPN2NF or pONIWT + BPV were d i g e s t e d with S a i l , which l i n e a r i z e s the t r a n s f e c t i n g v e c t o r s . The DNA was sepa r a t e d by e l e c t r o p h o r e s i s through a 0.8% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d to nick t r a n s l a t e d pONIWT. Lanes A and B, 500 pg and 5 pg of l i n e a r i z e d pPN2NF r e s p e c t i v e l y ; Lane C, 50 pg of l i n e a r i z e d pONIWT. 76 F i g u r e 19. S t r u c t u r e of pONIWT in the presence or absence of co-t r a n s f e c t e d BPV DNA. C127 c e l l s were t r a n s f e c t e d with pONIWT alone (-) or c o - t r a n s f e c t e d with pONIWT and BPV DNA (+). A l l r e s i s t a n t c o l o n i e s from each t r a n s f e c t i o n were pooled t o g e t h e r . 1 nq of c e l l u l a r DNA was d i g e s t e d with BamHI, separated by e l e c t r o p h o r e s i s through a 0.8% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d to n i c k - t r a n s l a t e d pONIWT, L, p o s i t i o n of l i n e a r pONIWT. 77 F i g u r e 20. S t r u c t u r e of s u p e r - t r a n s f e c t e d v e c t o r s i n BPV-t r a n s f e c t e d c e l l s . C127 c e l l s that had been p r e v i o u s l y t r a n s f e c t e d with BPV DNA were s u p e r t r a n s f e c t e d with pPNIWT (lane 1) or pONIWT (lane 2 ) . A l l r e s i s t a n t c e l l s from a s i n g l e t r a n s f e c t i o n were pooled, and 1 nq of the c e l l u l a r DNA was d i g e s t e d with S a i l , which l i n e a r i z e s both v e c t o r s . The DNA was then separated by e l e c t r o p h o r e s i s through a 0.6% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d with n i c k t r a n s l a t e d pONIWT. Lane A, 10 pg of pONIWT l i n e a r i z e d with H i n d l l l . 78 number i n t r a n s f e c t e d c e l l s . The c o n s t r u c t i o n of pPQ1, i n which the sequences encompassing the b a c t e r i a l o r i g i n of r e p l i c a t i o n i n pPNI are r e p l a c e d by an o r i g i n - c o n t a i n i n g fragment of DNA from pUC13, i s i l l u s t r a t e d i n F i g u r e 5. The a c t u a l o r i g i n of r e p l i c a t i o n i s the same i n both pPN1 and pPQ1, but the sequences f l a n k i n g the o r i g i n are d i f f e r e n t i n the two v e c t o r s . The s t r u c t u r e s of a l l the PN v e c t o r d e r i v a t i v e s are summarized i n Table I. C127 c e l l s were c o - t r a n s f e c t e d with one of these PN v e c t o r d e r i v a t i v e s i n combination with separate BPV DNA, and a l l of the G 4 1 8 - r e s i s t a n t c o l o n i e s from a s i n g l e t r a n s f e c t i o n were combined p r i o r to i s o l a t i o n of n u c l e i c a c i d . The amount of v e c t o r DNA i n the t r a n s f e c t e d c e l l s i s shown i n F i g u r e 21. The h y b r i d i z i n g h i g h molecular weight DNA was due to incomplete r e s t r i c t i o n enzyme d i g e s t i o n . High copy numbers c o u l d be ob t a i n e d without e i t h e r a PMS (PN1 and PN5 versus 0N1, PQ1 versus OQ1) or the hspl6 gene p a i r (ON 1WT versus ONI) or with d i f f e r e n t sequences f l a n k i n g the b a c t e r i a l o r i g i n of r e p l i c a t i o n (0N1 versus OQ1). . Apparent l y , BPV factor-dependent r e p l i c a t i o n of the t r a n s f e c t i o n v e c t o r s o c c u r r e d as intended i n the t r a n s f e c t e d c e l l s but, c o n t r a r y to e x p e c t a t i o n s , through a mechanism t h a t d i d not r e q u i r e the presence of BPV-derived PMSs w i t h i n the v e c t o r s . 3.6 I n d u c t i o n of Mouse Heat Shock Genes To ensure t h a t the c o n d i t i o n s p r e v i o u s l y r e p o r t e d to induce the heat shock response i n rodent f i b r o b l a s t s (222) were 79 PMS-1 Source of Vec t o r PMS-1 Or i e n t a t ion PMS-2 O r i Sequences pPN1 Present A Absent PCGBPV9 pPN2 Present A Present PCGBPV9 pPN3 Absent - Present pCGBPV9 pON1 Absent - Absent pCGBPV9 pPN5 Present B Absent pCGBPV9 pPQ1 Present A Absent pUC13HM P0Q1 Absent - Absent pUC13HM Table I. S t r u c t u r e s of PN v e c t o r d e r i v a t i v e s . O r i e n t a t i o n A of PMS-1 r e l a t i v e to the NPT II gene i s that shown i n F i g u r e 12. O r i e n t a t i o n B i s the o p p o s i t e o r i e n t a t i o n . 'Source of O r i Sequences' r e f e r s to the v e c t o r from which the Dral-BamHI fragment that i n c l u d e s the b a c t e r i a l o r i g i n of r e p l i c a t i o n was ob t a i n e d . 80 F i g u r e 21. S t r u c t u r e of v a r i o u s PN v e c t o r d e r i v a t i v e s i n t r a n s f e c t e d c e l l s . C127 c e l l s were t r a n s f e c t e d w i t h BPV DNA and a p a r t i c u l a r PN v e c t o r . A l l r e s i s t a n t and m o r p h o l o g i c a l l y transformed c o l o n i e s from a s i n g l e t r a n s f e c t i o n were pooled to g e t h e r . Approximately 1 jug of c e l l u l a r DNA was d i g e s t e d with EcoRV, separated by e l e c t r o p h o r e s i s through a 0.6% agarose g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r , and h y b r i d i z e d to n i c k t r a n s l a t e d pONIWT. C e l l pools are de s i g n a t e d by the name of the PN v e c t o r with which they were t r a n s f e c t e d . PN i s a s i n g l e c e l l l i n e t r a n s f e c t e d with pPN1 and BPV DNA. Lane A, 50 pg of pPN1 d i g e s t e d with EcoRV. 81 e f f e c t i v e with C127 c e l l s , the amounts of hsp70-homologous t r a n s c r i p t s i n uninduced or heat shocked C127 c e l l s were determined by RNA b l o t h y b r i d i z a t i o n ( F i g u r e 22). The probe DNA i n c l u d e d the 5' coding r e g i o n of an hsp70 gene that was c l o n e d by R i c h a r d Morimoto (Northwestern U n i v e r s i t y , Evanston, I l l i n o i s ) from a mouse genomic l i b r a r y ( u n p u b l i s h e d ) . A s i n g l e s i z e c l a s s of t r a n s c r i p t s t h a t h y b r i d i z e d to the mouse hsp70 probe was present i n uninduced c e l l s . The same t r a n s c r i p t s were a l s o present i n c e l l s t h a t had been heat shocked at 42.5°C f o r 60 min, but a d d i t i o n a l and more abundant hsp70-homologous t r a n s c r i p t s were present o n l y i n the heat shocked c e l l s , demonstrating that t r a n s c r i p t i o n of endogenous mouse hsp7Q-like genes was induced by these c o n d i t i o n s . The hsp70 gene from which the probe was d e r i v e d proved to be t r a n s c r i p t i o n a l l y i n a c t i v e under a l l c o n d i t i o n s , as determined by nuclease S1 p r o t e c t i o n experiments. As a r e s u l t , the c l o n e d DNA of t h i s gene c o u l d not be used f o r comparing the r e g u l a t i o n or t r a n s c r i p t i o n a l e f f i c i e n c i e s of the t r a n s f e c t e d C. elegans hspl6 genes with those of a s p e c i f i c endogenous mouse heat shock gene. 3.7 T r a n s c r i p t i o n of Genes on PN, ON, and CGBPV Vec t o r s A s e l e c t i o n of c e l l l i n e s from each t r a n s f e c t i o n were heat shocked and screened f o r t r a n s c r i p t i o n a l a c t i v i t y of the hspl6-1 and NPT II genes. T r a n s c r i p t s were i d e n t i f i e d and q u a n t i f i e d by nuclease S1 p r o t e c t i o n of s i n g l e - s t r a n d e d probes complementary to the 5' ends of the genes. The probes used and the regions 82 c H F i g u r e 22. Endogenous hsp70 t r a n s c r i p t s i n C127 c e l l s . Approximately 1 uq of n u c l e i c a c i d from pCGBPV9-transfected c e l l s that were uninduced (C) or heat shocked at 42.5°C f o r 60 min (H) was denatured with formaldehyde, s e p a r a t e d by e l e c t r o p h o r e s i s through a 1% agarose g e l c o n t a i n i n g formaldehyde, and t r a n s f e r r e d to n i t r o c e l l u l o s e . The f i l t e r was h y b r i d i z e d with a n i c k - t r a n s l a t e d DNA fragment c o n t a i n i n g 1500 bp of the 5' coding region of a mouse hsp70 gene, c, c o n s t i t u t i v e l y expressed t r a n s c r i p t ; i , heat i n d u c i b l e t r a n s c r i p t . The s i z e markers are e n d - l a b e l l e d fragments of H i n d l l l d i g e s t e d phage X DNA. 83 expected to be p r o t e c t e d by the t r a n s c r i p t s are shown i n F i g u r e 23. T r a n s c r i p t s were roughly q u a n t i f i e d by comparing the i n t e n s i t i e s of probe bands p r o t e c t e d by the sample n u c l e i c a c i d to those p r o t e c t e d by a known amount of M13 mp8 template DNA c o n t a i n i n g i n s e r t s complementary to segments of the probe. T r a n s c r i p t abundance was then c a l c u l a t e d as d e s c r i b e d i n Methods. Hspl6-1 and NPT II t r a n s c r i p t s i n the set of c e l l l i n e s o b t ained from a s i n g l e t r a n s f e c t i o n with pPN2NF and BPV DNA are shown i n F i g u r e 24, and the q u a n t i t i e s , of the t r a n s c r i p t s i n each c e l l l i n e are summarized i n Table I I . The s t r u c t u r e of the t r a n s f e c t e d v e c t o r DNA i n these c e l l l i n e s i s shown i n F i g u r e 13. A f t e r heat shock, both the hspl6-1 and the NPT II genes were t r a n s c r i p t i o n a l l y a c t i v e i n a l l c e l l l i n e s , although the t r a n s c r i p t l e v e l s of the t r a n s f e c t e d genes v a r i e d c o n s i d e r a b l y between d i f f e r e n t c e l l l i n e s . T h i s v a r i a t i o n was not s t r i c t l y a f u n c t i o n of the d i f f e r e n c e s i n gene copy number among the NF c e l l l i n e s because the e f f i c i e n c i e s of t r a n s c r i p t i o n ( t r a n s c r i p t s / g e n e ) of the t r a n s f e c t e d genes were e q u a l l y v a r i a b l e (Table I I ) . The r a t i o of hspl6-1 to NPT II gene t r a n s c r i p t s was a l s o not the same among a l l NF c e l l l i n e s ; h a l f of the c e l l l i n e s had a h i g h and mutually s i m i l a r r a t i o of about 100 ( l i n e s 1, 4, 6, 9, and 10) while the remainder had a t h r e e - to f i f t e e n - f o l d lower r a t i o ( l i n e s 2, 3, 5, 7, and 8 ) . There was no obvious s t r u c t u r a l c h a r a c t e r i s t i c of the t r a n s f e c t e d v e c t o r DNA that was g e n e r a l l y c o r r e l a t e d with e i t h e r low t r a n s c r i p t i o n a l e f f i c i e n c y 84 F i g u r e 23. S t r u c t u r e of the hspl6 gene p a i r and the probes used fo r t r a n s c r i p t i n i t i a t i o n s i t e mapping. a) The 1.9 Kbp BamHI fragment c o n t a i n i n g the hspl6 gene p a i r . Open boxes, promoters; Heavy l i n e s , coding r e g i o n s ; Open c i r c l e s , 3' AATAAA sequences; B, BamHI s i t e ; N, N s i l s i t e ; X, Xbal s i t e ; R, Rsal s i t e ; S a l , S a i l s i t e ; H, Hpal s i t e ; S, Sau3AI s i t e s f l a n k i n g the fragment used f o r t r a n s c r i p t i n i t i a t i o n s i t e mapping probes. b) D e t a i l s of hspl6 gene and NPT II gene promoter regions ( r e f s . 147 and 223) and s t r u c t u r e of the probes used f o r t r a n s c r i p t i n i t i a t i o n s i t e mapping. R/Y, a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequence. Wavy l i n e s r epresent t r a n s c r i p t s . Broken l i n e s r e p r e s e n t probes. S o l i d l i n e s i n d i c a t e the l e n g t h of probe expected to be p r o t e c t e d by a co r r e s p o n d i n g t r a n s c r i p t . 85 NF 1 2 3 4 5 6 7 8 9 10 h» - 404 -311 -244 N P T ^ - 2 1 9 -182 -149 -124 -78 F i g u r e 24. Hspl6-1 and NPT II t r a n s c r i p t s i n pPN2NF-transfected c e l l l i n e s . 1 jug of n u c l e i c a c i d from c e l l l i n e s t h a t had been heat shocked f o r 1 h at 42.5°C was h y b r i d i z e d to the WT 16-1 and NPT II s i n g l e - s t r a n d e d probes shown i n F i g u r e 23, d i g e s t e d with nuclease S1, sep a r a t e d by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. NPT, NPT II t r a n s c r i p t s . HS, hspl6-1 t r a n s c r i p t s ; h, f u l l l e n g t h 16-1 probe; n, f u l l l e n g t h NPT II probe; RI, t r a n s c r i p t s t h a t read i n t o hspl6-1 from upstream i n i t i a t i o n s i t e s . The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR322 DNA. 86 c e l l gene 1 6-1 NPT 1 6-1 NPT 16-1/NPT l i n e copy # t r / c e l l t r / c e l l tr/gene tr/gene t r / t r NF 1 30 2100 20 70 0.7 100 2 5 450 1 5 90 3 30 3 4 300 30 80 8 10 4 45 2700 30 60 0.7 90 5 60 1700 1 20 30 2 1 5 6 1 0 3300 30 330 3 1 1 0 7 7 550 25 80 3 25 8 5 150 25 30 5 6 9 8 2700 30 330 4 90 10 6 3800 40 650 7 90 WT 12 1 2 3000 80 250 7 40 OH 3 40 4000 1 10 100 3 35 4 8 1 700 40 240 5 45 6 6 8000 190 1 300 30 45 7 20 1000 25 50 1 .2 40 BH 1 100 27000 500 270 5 55 2 350 17000 500 50 1 .4 35 3 20 5000 1 00 250 5 50 4 5 700 1 5 1 40 3 45 5 250 5000 100 20 0.4 50 Table I I . Copy numbers and t r a n s c r i p t abundances of the hspl6-1 and NPT II genes i n c e l l l i n e s t r a n s f e c t e d with v a r i o u s v e c t o r s . NF c e l l l i n e s were t r a n s f e c t e d with pPN2NF and BPV DNA, OH c e l l l i n e s were t r a n s f e c t e d with pONIWT and BPV DNA, and BH c e l l l i n e s were t r a n s f e c t e d with pCGBPV9WT. WT-12 i s the pPN2WT + BPV DNA-transfected ce-ll l i n e t h a t was used f o r comparative t r a n s c r i p t i o n a l a n a l y s i s of the w i l d - t y p e and mutated hspl6 gene p a i r s . Vector copy numbers are es t i m a t e d from F i g u r e s 13, 16, 18, and 26, as d e s c r i b e d i n Methods. T r a n s c r i p t abundances are estimated from F i g u r e s 24, 25, 27, and 30, as d e s c r i b e d i n Methods. The e r r o r s i n these e s t i m a t e s are d i s c u s s e d i n Methods, t r = t r a n s c r i p t . 87 or abnormal r a t i o s of hspl6-1 to NPT II gene t r a n s c r i p t s , but the NF-5 c e l l l i n e , i n which most of the v e c t o r c o p i e s had s u f f e r e d a 600 bp d e l e t i o n ( F i g u r e 13), had a low hspl6-1 to NPT II t r a n s c r i p t r a t i o and was f u r t h e r d i s t i n g u i s h e d by the presence of many t r a n s c r i p t s that p r o t e c t e d a l a r g e r than normal l e n g t h of the hspl6-1 probe ( l a b e l l e d RI i n F i g u r e 24). The probe used i n t h i s experiment was d e r i v e d from the WT hspl6 gene p a i r , and the abnormally l a r g e RI fragments were p r o t e c t e d from nuclease S1 d i g e s t i o n up to the p o i n t where the homology of the WT probe to the NF hspl6 gene p a i r i s d i s r u p t e d , i . e . about 45 bp upstream from the normal s i t e of i n i t i a t i o n of hspl6-1 t r a n s c r i p t s . T h e r e f o r e , the RI t r a n s c r i p t s were i n i t i a t e d at an undefined s i t e upstream from the NF hspl6-1 gene. No f u r t h e r work was done towards e s t a b l i s h i n g a c a u s a t i v e l i n k between the a b n o r m a l i t i e s i n the s t r u c t u r e and t r a n s c r i p t i o n of the t r a n s f e c t e d genes i n the NF-5 c e l l l i n e . The h i g h e s t t r a n s c r i p t l e v e l s f o r both the hspl6-1 gene and the NPT II gene were o b t a i n e d with c e l l l i n e s that were t r a n s f e c t e d with pCGBPV9WT (Fi g u r e 25 and Table I I , BH l i n e s ) . As observed i n the NF c e l l l i n e s , the t r a n s c r i p t i o n a l e f f i c i e n c i e s of the t r a n s f e c t e d genes v a r i e d up to t e n - f o l d among the BH c e l l l i n e s . The t r a n s c r i p t i o n a l e f f i c i e n c i e s of the hspl6-1 and NPT II genes i n the c e l l l i n e s that had been t r a n s f e c t e d with pONIWT and BPV DNA ( F i g u r e 25 and Table I I , OH l i n e s ) were comparable to those observed i n c e l l l i n e s t r a n s f e c t e d with e i t h e r pPN2WT ( l i n e WT i n Table I I ) or pCGBPV9WT (BH l i n e s ) , and by f a r the 88 BH O H WT 1 2 3 4 5 3 4 6 7 1 w-4 - 4 0 4 - ? 4 4 NPTM"» • - 2 1 9 -182 I ^ N P T H S * 124 92 -78 F i g u r e 25. Hspl6-1 and NPT II t r a n s c r i p t s i n c e l l l i n e s t r a n s f e c t e d with pONIWT or pCGBPV9WT. 1 nq of n u c l e i c a c i d was h y b r i d i z e d to the hsp16-1 and NPT II s i n g l e - s t r a n d e d probes shown i n F i g u r e 23, d i g e s t e d with nuclease S1, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. OH, c e l l l i n e s t r a n s f e c t e d with pONIWT and BPV DNA; WT, the c e l l l i n e t r a n s f e c t e d with pPN2WT and BPV DNA; BH, c e l l l i n e s t r a n s f e c t e d with pCGBPV9WT; HS, p o s i t i o n of hspl6-1 t r a n s c r i p t ; NPT, p o s i t i o n of the NPT II t r a n s c r i p t . The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR322 DNA. 89 h i g h e s t t r a n s c r i p t i o n a l e f f i c i e n c i e s were o b t a i n e d i n a c e l l l i n e t r a n s f e c t e d with pONIWT ( l i n e OH-6). The 5' enhancer element of BPV, which i s l o c a t e d w i t h i n the PMS-1-containing p o r t i o n of the PN v e c t o r s (176) and i s absent from pONIWT, i s e v i d e n t l y not r e q u i r e d f o r e f f i c i e n t t r a n s c r i p t i o n of e i t h e r the hspl6-1 or NPT II genes i n C127 c e l l s . The c e l l l i n e s that were t r a n s f e c t e d with pONIWT had the same v a r i a t i o n i n t r a n s c r i p t i o n a l e f f i c i e n c i e s of the t r a n s f e c t e d genes that was observed i n c e l l l i n e s t r a n s f e c t e d with pPN2NF or pCGBPV9WT (Table I I ) . T h i s v a r i a t i o n , t h e r e f o r e , i s a g e n e r a l p r o p e r t y of a l l of the t r a n s f e c t i o n v e c t o r s that were used i n t h i s study. The h i g h e s t t r a n s c r i p t i o n a l e f f i c i e n c i e s tended to be found i n c e l l l i n e s with r e l a t i v e l y low v e c t o r copy numbers ( l i n e s NF-6, NF-9, NF-10, WT-12, OH-4, OH-6, and BH-3) but l i n e BH-1, which c o n t a i n s 100 c o p i e s of pCGBPV9WT per c e l l i s an ex c e p t i o n to t h i s r u l e . The r a t i o s of hspl6-1 to NPT II gene t r a n s c r i p t s were about 45 i n a l l of the OH and BH c e l l l i n e s t h a t were examined (Table I I ) . The absence i n these c e l l l i n e s of the v a r i a b i l i t y i n the t r a n s c r i p t r a t i o that was observed among the NF c e l l l i n e s may have been f o r t u i t o u s . 3.8 S e l e c t i o n of C e l l L i n e s f o r Comparative A n a l y s i s of the T r a n s c r i p t i o n a l Competence of T r a n s f e c t e d Hspl6 and NPT II Genes The v a r i a t i o n i n the l e v e l s of hspl6 gene t r a n s c r i p t s that was observed among c e l l l i n e s t r a n s f e c t e d with the same hspl6 gene p a i r c o n s t r u c t n e c e s s i t a t e d the use of a method to c o n t r o l 90 fo r t h i s i n h e r e n t v a r i a b i l i t y i f the t r a n s c r i p t i o n a l competences of d i f f e r e n t h spl6 gene p a i r c o n s t r u c t s were to be compared i n a meaningful way. The t r a n s c r i p t l e v e l s of the NPT II genes were used f o r t h i s purpose. Sets of c e l l l i n e s that had been t r a n s f e c t e d with a p a r t i c u l a r h spl6 gene p a i r c o n s t r u c t were screened f o r t r a n s c r i p t l e v e l s of the hspl6-1 and NPT II genes as d e s c r i b e d above f o r the c e l l l i n e s bearing the NF gene p a i r , and one of the s e v e r a l c e l l l i n e s which had optimal t r a n s c r i p t l e v e l s of both of these t r a n s f e c t e d genes was s e l e c t e d f o r f u r t h e r a n a l y s i s , e.g. c e l l l i n e s NF-1, NF-4, NF-6, NF-9, and NF-10 were found to have o p t i m a l t r a n s c r i p t l e v e l s of both the hspl6-1 and NPT II genes and l i n e NF-9 was s e l e c t e d f o r d e f i n i n g the t r a n s c r i p t i o n a l competence of the NF gene p a i r . I t was assumed that a l l of the t r a n s f e c t e d genes i n the s e l e c t e d c e l l l i n e s were u n a f f e c t e d , or at l e a s t minimally and e q u i v a l e n t l y a f f e c t e d , by the u n i d e n t i f i e d f a c t o r s that v a r i a b l y i n f l u e n c e d the t r a n s c r i p t i o n a l e f f i c i e n c i e s of the t r a n s f e c t e d genes. Thus, any d i f f e r e n c e s i n - t h e r a t i o s of hspl6 to NPT II gene t r a n s c r i p t s among the s e l e c t e d c e l l l i n e s should be due s o l e l y to the a l t e r a t i o n s that were d e l i b e r a t e l y made i n the promoter re g i o n s of the hspl6 gene p a i r . The r e s u l t s shown i n Table II demonstrate that the hspl6-1 to NPT II gene t r a n s c r i p t r a t i o was the same among o p t i m a l l y a c t i v e c e l l l i n e s c a r r y i n g the WT hspl6 gene p a i r (WT, BH, and OH l i n e s ) and c o u l d be d i s t i n c t l y and c o n s i s t e n t l y d i f f e r e n t among o p t i m a l l y a c t i v e c e l l l i n e s c a r r y i n g a d i f f e r e n t hspl6 gene p a i r c o n s t r u c t , i . e . the NF c e l l l i n e s . 91 The optimal t r a n s c r i p t l e v e l s were n e c e s s a r i l y determined by the examination of a l i m i t e d number of c e l l l i n e s . I t i s always p o s s i b l e that every c e l l l i n e from a p a r t i c u l a r t r a n s f e c t i o n harboured d e f e c t i v e hspl6 and/or NPT II genes, r e s u l t i n g i n a f a l s e i d e n t i f i c a t i o n of an o p t i m a l l y a c t i v e c e l l l i n e . The p r o b a b i l i t y of t h i s o c c u r r i n g i s reduced i n p r o p o r t i o n to the number of independently d e r i v e d c e l l l i n e s that are examined. Most hspl6 gene p a i r c o n s t r u c t s were t e s t e d f o r t r a n s c r i p t i o n a l competence e i t h e r i n a l a r g e number of c e l l l i n e s from a s i n g l e t r a n s f e c t i o n (NF) or i n a l a r g e accumulated number of c e l l l i n e s d e r i v e d from d i f f e r e n t t r a n s f e c t i o n s (WT, DX, MX, and IX ) . The ex c e p t i o n was the RM gene p a i r ; only three RM c e l l l i n e s , a l l d e r i v e d from the same t r a n s f e c t i o n , were examined f o r t r a n s c r i p t i o n a l competence. 3.9 S t r u c t u r e of the hspl6 Gene P a i r s and the NPT II Gene i n the C e l l L i n e s used f o r Comparative T r a n s c r i p t i o n a l A n a l y s i s For each hspl6 gene p a i r c o n s t r u c t , a s i n g l e c e l l l i n e was s e l e c t e d f o r d e t a i l e d t r a n s c r i p t i o n a l a n a l y s i s by the c r i t e r i a d e s c r i b e d above. The s e l e c t e d c e l l l i n e s w i l l be r e f e r r e d to by the name of the hspl6 gene p a i r c o n s t r u c t which they c a r r y . Thus, the NF-9 c e l l l i n e which was chosen f o r d e t a i l e d t r a n s c r i p t i o n a l a n a l y s i s i s h e n c e f o r t h simply r e f e r r e d to as the NF c e l l l i n e . The copy numbers and s t r u c t u r e s of the i n t a c t hspl6 gene p a i r s and NPT II genes i n the chosen c e l l l i n e s were r e v e a l e d by d i s s e c t i n g out the gene fragments of the v e c t o r s with BamHI and 92 F i g u r e 26. S t r u c t u r e s and copy numbers of the hspl6 gene p a i r s and the NPT II genes i n the t r a n s f e c t e d c e l l l i n e s used f o r comparative t r a n s c r i p t i o n a l a n a l y s i s . Approximately 1 jug of c e l l u l a r DNA was d i g e s t e d with BamHI and Nc o l , separated by e l e c t r o p h o r e s i s through a 0.8% agarose g e l , t r a n s f e r r e d t o a nylon membrane, and h y b r i d i z e d with the n i c k - t r a n s l a t e d h s p l 6 gene p a i r BamHI fragment and the nick t a n s l a t e d NPT II EcoRV-S s t l l fragment. C e l l l i n e s are designated by the name of the hspl6 gene p a i r c o n s t r u c t which they c a r r y . HT i s the c e l l l i n e t r a n s f e c t e d with pPN3WT. Lane P2, 10 pg of BamHI + Ncol d i g e s t e d pPN2WT DNA; Lanes 1-4, 256 pg, 64 pg, 16 pg, and 4 pg of BamHI + Ncol d i g e s t e d pPNIWT, r e s p e c t i v e l y . HS and NPT mark the p o s i t i o n s of the hspl6 BamHI fragment and the NPT II BamHI-Ncol fragments of pPNIWT, r e s p e c t i v e l y . 93 Ncol ( F i g u r e 26). The WT, NF, and RM l i n e s had a sm a l l e r NPT II fragment because the pPN2 v e c t o r has a BamHI s i t e that i s c r e a t e d at the H a e l l l - E c o R V j u n c t i o n of the PMS-2 i n s e r t p roximal to the NPT II promoters (Figure 12). V a r i a t i o n i n the l e n g t h of the hspl6 fragment was due to the d i f f e r e n c e s i n s t r u c t u r e between the c o n s t r u c t s . In some of the c e l l l i n e s , the copy number of the hspl6 gene p a i r was lower than that of the NPT II gene, due to a higher frequency of rearrangements a f f e c t i n g the hspl6 genes. 3.10 T r a n s c r i p t i o n of the Wild-type Hspl6 Gene P a i r Hspl6 t r a n s c r i p t l e v e l s i n uninduced, heat shocked, and a r s e n i t e t r e a t e d c e l l l i n e s and i n heat shocked C. elegans are shown i n F i g u r e s 27 and 28. In heat shocked C. elegans, both hspl6 genes had a s i n g l e t r a n s c r i p t that i n i t i a t e d about 20 bp downstream from the TATA element. In mouse c e l l s , the WT hspl6 genes were t r a n s c r i p t i o n a l l y i n a c t i v e under normal growth c o n d i t i o n s , except f o r a minor t r a n s c r i p t i n i t i a t i n g about 175 bp upstream from the hspl6-48 TATA element. The d i f f u s e bands that were a l s o p r o t e c t e d by n u c l e i c a c i d from c e l l s t r a n s f e c t e d with pPN1 alone must have been a r t i f a c t s of the nuclease S1 d i g e s t i o n r a t h e r than being i n d i c a t i v e of hspl6 t r a n s c r i p t s . No t r a n s c r i p t s i n i t i a t i n g 3' to the TATA elements of the hspl6 genes c o u l d be d e t e c t e d i n uninduced c e l l s even a f t e r a t e n - f o l d longer p e r i o d of autoradiography than i s shown. When the WT c e l l s were heat shocked at 42.5°C f o r 60 min or t r e a t e d with 100 MM sodium a r s e n i t e for the same p e r i o d of time, 94 1 6 - 1 C. elegans I WT_ _DX_ M X . _NF_ J X _ _ R M PN H C H A C H A C H A C H A C H A C H A C H A -311 - 2 4 4 - 1 8 2 -149 -124 HS - 9 2 - 7 8 F i g u r e 27. Q u a n t i f i c a t i o n and i n i t i a t i o n s i t e mapping of hspl6-1 t r a n s c r i p t s . 1 nq of n u c l e i c a c i d (0.3 uq from heat shocked NF) from uninduced (C), heat shocked (H; 1 h at 42.5°C), or a r s e n i t e t r e a t e d (A) c e l l l i n e s , or heat shocked C. elegans was h y b r i d i z e d to the hspl6-1 s i n g l e - s t r a n d e d probe a p p r o p r i a t e to the t r a n s f e c t e d c o n s t r u c t ( F i g u r e 23), d i g e s t e d with nuclease S1, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. C e l l l i n e s are d e s i g n a t e d by the name of the hspl6 gene p a i r with which they were t r a n s f e c t e d . PN i s a c e l l l i n e t r a n s f e c t e d with pPN1 and BPV DNA. HS marks the major i n d u c i b l e t r a n s c r i p t s i n i t i a t i n g downstream from the hspl6-1 TATA elements. The s i z e markers are e n d - l a b e l l e d fragments of Hpa l l d i g e s t e d pBR322 DNA. 95 C.elegans ^ I WT D X M X NF IX R M P N 1 H C H A C H A C H A C H A C H a C H A C H A 2 c « • - 4 0 4 -311 -244 .182 |<M -149 -124 ">•§« «•»» - 9 2 - 7 8 F i g u r e 28. Q u a n t i f i c a t i o n and i n i t i a t i o n s i t e mapping of hspl6-48 t r a n s c r i p t s . 1 nq of n u c l e i c a c i d (0.3 nq from heat shocked NF) from uninduced (C), heat shocked (H; 1 h at 42.5°C), or a r s e n i t e t r e a t e d (A) c e l l l i n e s , or heat shocked C. elegans was h y b r i d i z e d to the hspl6-48 s i n g l e - s t r a n d e d probe a p p r o p r i a t e to the t r a n s f e c t e d c o n s t r u c t TFigure 23), d i g e s t e d with nuclease S1, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. HS marks the major i n d u c i b l e t r a n s c r i p t s i n i t i a t i n g downstream from the hspl6-48 TATA element, with the approximate l e n g t h of the p r o t e c t e d probe i n d i c a t e d ; M, bands due to p r o t e c t i o n of the WT 16-48 probe by 1.1 pg (lane 1) and 22 pg (lane 2) of complementary s i n g l e stranded DNA from templates c a r r y i n g NF DNA i n s e r t s ; c, c o n s t i t u t i v e l y expressed t r a n s c r i p t i n i t i a t i n g 175 bp upstream from the hspl6-48 TATA element; i , i n d u c i b l e t r a n s c r i p t i n i t i a t i n g 225 bp upstream from the hspl6-48 TATA element. The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR322 DNA. 96 t r a n s c r i p t i o n of both hspl6 genes was s t r o n g l y induced ( F i g u r e s 27 and 28). I n i t i a t i o n o c c u r r e d at the same p o s i t i o n i n mouse c e l l s and C. elegans. A minor t r a n s c r i p t t h at i n i t i a t e d 225 bp upstream from the hspl6-48 TATA element was a l s o induced by heat or a r s e n i t e ( F i g u r e 28). By comparison to the amount of probe p r o t e c t e d by a known amount of complementary s i n g l e - s t r a n d e d DNA, i t was estimated that about 5 pg of 16-48 probe was p r o t e c t e d by 1 ixq of n u c l e i c a c i d from heat shocked WT c e l l s ( F i g u r e 28). A f t e r compensating for the f u l l l e n g t h of the t r a n s c r i p t , the abundance of hspl6-48 t r a n s c r i p t s was estimated to be about 0.2% of the mRNA (see Methods f o r d e t a i l s of the c a l c u l a t i o n s ) . T h i s i s e q u i v a l e n t to about 2000 t r a n s c r i p t s per c e l l . The hspl6-1 t r a n s c r i p t s were roughly estimated to comprise 0.3% of the mRNA i n WT c e l l s , which i s e q u i v a l e n t to about 3000 t r a n s c r i p t s per c e l l (Table I I I ) . The t r a n s c r i p t l e v e l s c o u l d be r a i s e d approximately f o u r - f o l d by extending the 42.5°C heat shock p e r i o d to 120 min ( F i g u r e 29). The hspl6-1 t r a n s c r i p t l e v e l s were c o n s i d e r a b l y reduced by r a i s i n g the heat shock temperature by 1°C (F i g u r e 29). The hspl6-1 t r a n s c r i p t s comprised about 0.3% of the mRNA i n heat shocked C. elegans (Table I I I ) . The hspl6-48 t r a n s c r i p t s were about one h a l f as abundant as the hspl6-1 t r a n s c r i p t s i n WT c e l l s , but more than twice as abundant as the hspl6-1 t r a n s c r i p t s i n C. eleqans (Table I V ) . T h i s c o u l d be due to d i f f e r e n c e s i n e i t h e r the promoter s t r e n g t h s or the t r a n s c r i p t s t a b i l i t i e s of the two hspl6 genes 97 hspl6-1 hsp16-48 NPT II hsp16 gene # %mRNA t r / c e l l %mRNA t r / c e l l gene # %mRNA t r / c e l l Ce WT DX MX NF IX RM 4 1 2 30 3 10 1 5 25 0.3 0.3 3000 300 0 2500 300 3000 0 0 2000 400 0 1 500 800 1 600 1 2 50 8 10 25 20 0.012 80 1 30 40 30 80 60 Table I I I . Abundances of hsp l 6 and NPT II t r a n s c r i p t s i n c e l l l i n e s t r a n s f e c t e d with v a r i o u s hspl6 gene p a i r c o n s t r u c t s . C e l l l i n e s are d e s i g n a t e d by the name of the hspl6 gene p a i r which they c a r r y . Ce i s C. ele g a n s . Vector copy numbers are estimated from F i g u r e 26, as d e s c r i b e d i n Methods. T r a n s c r i p t abundances are estimated from F i g u r e s 27, 28, and 30, as d e s c r i b e d i n Methods. The u n c e r t a i n t y i n these estimates i s d i s c u s s e d i n Methods, t r = t r a n s c r i p t 16-1/16-48 16-1/NPT 16-48/NPT Ce 0.4 WT 1.5 40 25 DX 0.8 2.5 3 MX - 0 0 NF 1.7 90 50 IX 0.4 4 10 RM 1.9 50 27 Table IV. R a t i o s of hspl6 and NPT II t r a n s c r i p t s i n c e l l l i n e s t r a n s f e c t e d with v a r i o u s hspl6 gene p a i r c o n s t r u c t s . The r a t i o s are d e r i v e d from the t r a n s c r i p t abundances i n Table I I I . 98 1 2 3 4 F i g u r e 29. Q u a n t i f i c a t i o n of hspl6-1 t r a n s c r i p t s i n t r a n s f e c t e d c e l l s a f t e r v a r i o u s heat shock c o n d i t i o n s . C e l l s t r a n s f e c t e d with pPN3WT and BPV DNA ( l i n e HT i n F i g u r e 26) were heat shocked for 60 min at 42.5°C (lane 1), f o r 120 min at 42.5°C (lane 2), for 60 min at 43.5°C (lane 3), or f o r 60 min at 44°C (lane 4). 1 uq of n u c l e i c a c i d was h y b r i d i z e d to the hsp16-1 WT probe ( F i g u r e 23), d i g e s t e d with nuclease S1, s e p a r a t e d by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. HS marks the p o s i t i o n of the major hspl6-1 t r a n s c r i p t . 99 in mouse versus C. eleqans c e l l s . There were an estimated 80 NPT II t r a n s c r i p t s i n each WT c e l l grown at 37°C ( F i g u r e 30, Table I I I ) . NPT II gene t r a n s c r i p t i o n was i n i t i a t e d at a s i n g l e s i t e downstream from the TATA element that i s c l o s e to or i d e n t i c a l with the t r a n s c r i p t i o n i n i t i a t i o n s i t e observed i n the n a t u r a l HSV thymidine kinase gene (223). Uninduced c e l l s were used to measure NPT II t r a n s c r i p t l e v e l s to a v o i d any e f f e c t s of t r a n s c r i p t i o n a l l y a c t i v e upstream hspl6 genes that might vary with the s t r e n g t h of the hspl6 promoters. 3.11 T r a n s c r i p t i o n of Mutated Hspl6 Gene P a i r s In the DX gene p a i r , both hspl6 genes were s t i l l i n d u c i b l e by heat shock or a r s e n i t e ( F i g u r e s 27 and 28), demonstrating that a s i n g l e HSE and downstream sequences, i n c l u d i n g the TATA element, can c o n s t i t u t e a r e g u l a t e d heat shock promoter. The s i n g l e HSE can a l s o f u n c t i o n b i d i r e c t i o n a l l y . But the hspl6 t r a n s c r i p t l e v e l s were s i g n i f i c a n t l y lower i n DX than i n WT, a b s o l u t e l y (Table I I I ) and i n p r o p o r t i o n to the NPT II t r a n s c r i p t s (Table I V ) . The r a t i o of hspl6-1 to hspl6-48 t r a n s c r i p t s was more than two-fold lower i n DX than i n WT (Table IV). The d e l e t i o n i n the DX hspl6 gene p a i r that d e s t r o y e d the HSE i n a c t i v a t e d the two hspl6 genes ( F i g u r e s 27 and 28, MX l i n e ) . The NPT II gene was s t i l l f u l l y f u n c t i o n a l i n the MX c e l l l i n e ( F i g u r e 30). There was no hspl6 gene t r a n s c r i p t i o n i n uninduced MX c e l l s . T h e r e f o r e , the HSE i s r e q u i r e d f o r 1 00 D X N F R M 311" 4 P r o b e 244-219- — — 1 -4 N P T 182-F i g u r e 30. NPT II gene t r a n s c r i p t s i n t r a n s f e c t e d c e l l s . 1 nq of n u c l e i c a c i d from t r a n s f e c t e d c e l l s was h y b r i d i z e d with the s i n g l e - s t r a n d e d NPT II probe shown in F i g u r e 23, d i g e s t e d with nuclease S1, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. C e l l l i n e s are d e s i g n a t e d by the name of the hspl6 gene p a i r w i t h which they were t r a n s f e c t e d . NPT, t r a n s c r i p t s i n i t i a t i n g downstream from the tk promoter TATA element; Probe, f u l l l e n g t h NPT II probe. The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR322 DNA. 101 i n d u c t i o n , and the TATA elements, which are p r e s e r v e d i n the MX hspl6 gene p a i r , cannot independently promote t r a n s c r i p t i o n . The NF hspl6 gene p a i r , with four o v e r l a p p i n g HSEs between the two TATA elements, was more e f f i c i e n t l y t r a n s c r i b e d than the WT h spl6 gene p a i r , when the t r a n s c r i p t l e v e l s were normalized to the l e v e l s of NPT II t r a n s c r i p t s (Table I V ) . (Note that only 0.3 jug of n u c l e i c a c i d was used i n the NF heat shock samples in F i g u r e s 27 and 28). The r e l a t i v e p r o p o r t i o n s of the two hspl6 genes were at WT l e v e l s . A c l u s t e r of m u l t i p l e HSEs, t h e r e f o r e , can f u n c t i o n a l l y s u b s t i t u t e f o r a l l of the sequences that are found between the i n t e r g e n i c Xbal s i t e s i n the WT h spl6 gene p a i r . I n v e r t i n g the i n t e r g e n i c Xbal fragment (IX) r e s u l t e d i n a t e n - f o l d r e d u c t i o n i n hspl6-1 t r a n s c r i p t i o n and a t w o - f o l d r e d u c t i o n i n hspl6-48 t r a n s c r i p t i o n , r e l a t i v e to the NPT II gene (Table I V ) . The l a r g e decrease i n hspl6-1 t r a n s c r i p t i o n was a s s o c i a t e d with a decrease i n the number of adjacent HSEs from two to one, while the decrease i n hspl6-48 t r a n s c r i p t i o n , a l b e i t somewhat l e s s than f o r hspl6-1, was a s s o c i a t e d with an i n c r e a s e in the number of adjacent HSEs from two to t h r e e . The s i n g l e base d e l e t i o n w i t h i n the a l t e r n a t i n g p u r i n e / p y r i m i d i n e sequence i n the i n t e r g e n i c r e g i o n of the RM gene p a i r had no s i g n i f i c a n t e f f e c t on the t r a n s c r i p t i o n a l a c t i v i t y of e i t h e r hspl6 gene ( F i g u r e s 27 and 28, and Tables III and I V ) . A l l mutations i n the hspl6 gene p a i r had e q u i v a l e n t e f f e c t s on both heat shock and a r s e n i t e induced t r a n s c r i p t i o n ( F i g u r e s 1 02 27 and 28), sugges t i n g that the two s t i m u l i a ct on the hspl6 promoters through e x a c t l y the same sequence elements. 3.12 S p l i c i n g of Hspl6 T r a n s c r i p t s The l o c a t i o n s of the s p l i c e s i t e s and 3' t e r m i n i of the hspl6-1 and hspl6-48 t r a n s c r i p t s were determined by nuclease S1 p r o t e c t i o n of the s i n g l e - s t r a n d e d probes that are shown i n F i g u r e 31. While a l l of the hspl6 t r a n s c r i p t s were completely s p l i c e d at the c o r r e c t s i t e s i n C. eleqans, many of the t r a n s c r i p t s were u n s p l i c e d i n the mouse c e l l s ( F i g u r e s 32 and 33). The t r a n s c r i p t s that were s p l i c e d i n mouse c e l l s were a l l c l e a v e d at the c o r r e c t 5' s i t e , but i n the s p l i c e d hspl6-48 t r a n s c r i p t s the 3' s i t e was l o c a t e d about 60 bp downstream from the c o r r e c t s i t e ( F i g u r e 33), and i n the s p l i c e d hspl6-1 t r a n s c r i p t s two d i f f e r e n t 3' j u n c t i o n s were found about 20 bp and 35 bp downstream from the c o r r e c t s i t e ( F i g u r e 32). AG d i n u c l e o t i d e s , which are found at a l l known 3' s p l i c e j u n c t i o n s (165), are found at the estimated l o c a t i o n s of the ab e r r a n t hspl6 3' j u n c t i o n s that were used i n mouse c e l l s ( F i g u r e 34). 3.13 3' P r o c e s s i n g of Hspl6 T r a n s c r i p t s The hspl6 t r a n s c r i p t s i n C. elegans had 3' t e r m i n i l o c a t e d about 20 bp downstream from the f i r s t p o l y a d e n y l a t i o n s i g n a l sequence ( F i g u r e s 35 and 36). The s h o r t e r fragments of the hspl6-48 probe i n the C. eleqans sample c o u l d have been due to p r o t e c t i o n by t r a n s c r i p t s of the hspl6-41 gene, which i s 1 03 16-1 M o u s e -C. e l e g a n s 7 X b a l . „ S a u 3 A I I n i t " . 1 N B e l l I I I I I I II l l l l II II B g l l l S p l i c e 5 ' * 3 ' -O O-T e r m " B a m H I M o u s e C . e l e I n i t " 1 6 - 4 8 S p l i c e 5 -r-p-S s p l S p l i c e 3 T e r m " B a m H I F i g u r e 31. The t r a n s c r i p t s of the hspl6 genes, and the probes that were used to d e f i n e t h e i r s t r u c t u r e s . The genes are re p r e s e n t e d by the c e n t r a l continuous l i n e s . Open boxes, promoters; s o l i d boxes, c o d i n g r e g i o n s ; open c i r c l e s , p o l y a d e n y l a t i o n s i t e s . The p o s i t i o n s of AG d i n u c l e o t i d e s w i t h i n the second exons are i n d i c a t e d by v e r t i c a l b a r s. The t r a n s c r i p t s are r e p r e s e n t e d by the arrows above the genes. S p l i c e d sequences are r e p r e s e n t e d by the kinks i n the arrows. The broken arrows represent t r a n s c r i p t s that read through the p o l y a d e n y l a t i o n s i t e s . The s i n g l e - s t r a n d e d probes that were used to map the t r a n s c r i p t s are shown below the genes, and are l a b e l l e d as f o l l o w s : Term'n, probes used to map the 3' t e r m i n i ; S p l i c e 5', probes used to map the 5' s p l i c e s i t e s ; S p l i c e 3', probes used to map the 3' s p l i c e s i t e s ; I n i t ' n , probes used to map the i n i t i a t i o n s i t e s ; N, probes used f o r f i l t e r h y b r i d i z a t i o n . 1 04 16-1 M W 1 8 2 -• <«5'S 1 6 2 -1 4 9 -F i g u r e 32. S p l i c e s i t e s i n the hspl6-1 t r a n s c r i p t s . RNA from C. eleqans (W) or n u c l e i c a c i d from c e l l s t r a n s f e c t e d with pPN3WT (M) was h y b r i d i z e d to the hspl6-1 s p l i c e s i t e mapping probe extending from the B q l l I s i t e to the Xbal s i t e ( F i g u r e 31). The h y b r i d i z e d n u c l e i c a c i d was d i g e s t e d with nuclease SI, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. H and C i n d i c a t e the use of n u c l e i c a c i d from heat shocked and uninduced c e l l s , r e s p e c t i v e l y . US, u n s p l i c e d t r a n s c r i p t s ; 5'S, 5' s p l i c e d fragments; 3'S, 3' s p l i c e d fragments. Brackets i n d i c a t e fragments r e s u l t i n g from s p l i c i n g at the aberrant 3' s i t e s i n t r a n s f e c t e d c e l l s . The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR322 DNA. 105 16-48 1 6 _ 4 8  Mu W W M H C H C H H 404 311 2 4 4 -* M 624 -4 0 4 -«(3'S) 3 1 1 " . . U S 1 8 2 - 2 4 4 -2 0 3 -1 8 2 - * • " S ' S 124 -124-F i g u r e 33. S p l i c e s i t e s i n the hspl6-48 t r a n s c r i p t s . RNA from C. elegans (W) or n u c l e i c a c i d from c e l l s t r a n s f e c t e d with pPN3WT (M) was h y b r i d i z e d to the hspl6-48 s p l i c e s i t e mapping probes shown i n F i g u r e 31, d i g e s t e d with nuclease S1, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. H and C i n d i c a t e the use of n u c l e i c a c i d from heat shocked and uninduced c e l l s , r e s p e c t i v e l y . US, u n s p l i c e d t r a n s c r i p t s ; 5'S, 5' s p l i c e d fragments; 3'S, 3' s p l i c e d fragments. B r a c k e t s i n d i c a t e fragments r e s u l t i n g from s p l i c i n g at the aberrant 3' s i t e s i n t r a n s f e c t e d c e l l s . Panel a) 3' s p l i c e s i t e probe extending between the Sspl s i t e s in hspl6-48. Panel b) 5^ s p l i c e s i t e probe extending from the B q l l I s i t e i n hspl6-48 to the Hpal s i t e i n hspl6-1. The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR32 2 DNA. 106 h S p 16"I T C T T C T G A r j G T A A G T A A C A C A l I I I I I I I I C A A G A G T T T G T A T A A A A A A G ^ C T T T C A ^ T T G T T A A C A A T G A T C A A A A g T ^ h s p l 6 ~ 4 8 . A T T G G A G A & T A A G A A A A T A A T c r r C T T T T T C A A T T G T T T A T T T G T C A A A T GTTTTAi I I I I ^^t^TTGTAAATGACGAATCTAAATTCTrCTGTTCAACTCGATGTTTCTCATTTCAAACCAGAAGAT F i g u r e 34. Sequences around the hspl6 t r a n s c r i p t s p l i c e s i t e s . P o s i t i o n s of the 5' and 3' s p l i c e s i t e s u t i l i z e d i n C. elegans are i n d i c a t e d by r i g h t and l e f t b r a c k e t s , r e s p e c t i v e l y . AG d i n u c l e o t i d e s at or downstream from the c o r r e c t 3' s p l i c e s i t e are i n d i c a t e d by underbars. V e r t i c a l arrowheads i n d i c a t e the proposed p o s i t i o n s of the 3' s p l i c e s i t e s i n t r a n s f e c t e d C127 c e l l s . Sequences with homology to the l a r i a t s i t e consensus sequence are u n d e r l i n e d , with dots below the bases that do not match the consensus sequence. 1 07 p a r t i a l l y homologous to the hspl6-48 gene (162). Some of the hspl6 t r a n s c r i p t s were terminated at the same 3' s i t e s in mouse c e l l s , but a smal l p r o p o r t i o n of hspl6-1 t r a n s c r i p t s and about h a l f of the hspl6-48 t r a n s c r i p t s were not p r o p e r l y processed at these s i t e s , and c o n t i n u e d on i n t o downstream sequences. A few of the hspl6-1 t r a n s c r i p t s i n mouse c e l l s ended 20 bp downstream from the second AATAAA sequence, which was not used as a f i n a l 3' p r o c e s s i n g s i t e i n C. elegans ( F i g u r e 35). These read-through t r a n s c r i p t s were a l s o e v i d e n t when the s i z e s of the t r a n s c r i p t s i n t r a n s f e c t e d C127 c e l l s that h y b r i d i z e d to hspl6 and NPT II probes were examined. There were two prominent RNA s p e c i e s t h a t h y b r i d i z e d to the hspl6-48 probe ( F i g u r e 37). Only the l a r g e r t r a n s c r i p t a l s o h y b r i d i z e d to the NPT II probe ( F i g u r e 38). The s h o r t e r hspl6-48 t r a n s c r i p t was esti m a t e d to be about 950 b long , which i s 350 b longer than the d i s t a n c e between the 5' and 3' t e r m i n i observed i n nuclease S1 p r o t e c t i o n experiments. The excess l e n g t h was presumably a r e s u l t of p o l y a d e n y l a t i o n of the t r a n s c r i p t . The l a r g e r hspl6-48 t r a n s c r i p t was estimated to be 2500 b to 3000 b long; i t probably c o n t i n u e d through the downstream NPT II gene and terminated i n the v i c i n i t y of the NPT II p o l y a d e n y l a t i o n s i t e ( F i g u r e 39). Most of the RNA that h y b r i d i z e d to the hspl6-1 probe was of a s i z e (about 800 b) expected f o r c o r r e c t l y processed and p o l y a d e n y l a t e d t r a n s c r i p t s , but some l a r g e r read-through t r a n s c r i p t s were v i s i b l e ( F i g u r e 37). The NPT II probe h y b r i d i z e d to a s i n g l e d i s c r e t e s i z e of 108 F i g u r e 35. 3' t e r m i n i of hspl6 t r a n s c r i p t s . RNA from heat shocked C. elegans (W), or n u c l e i c a c i d from heat shocked C127 c e l l s t r a n s f e c t e d with pCGBPV9WT (M), were h y b r i d i z e d to the 3' terminus mapping probes shown i n F i g u r e 31. The h y b r i d i z e d mixture was d i g e s t e d with nuclease S1, separated by e l e c t r o p h o r e s i s through a 6% p o l y a c r y l a m i d e g e l , and autoradiographed. pA1a, t r a n s c r i p t s c l e a v e d downstream from the f i r s t p o l y a d e n y l a t i o n s i g n a l sequence of hspl6-1; pA1b, t r a n s c r i p t s c l e a v e d downstream from the second p o l y a d e n y l a t i o n s i g n a l sequence of hspl6-1; pA48, t r a n s c r i p t s t h at are c l e a v e d downstream from the s i n g l e p o l y a d e n y l a t i o n s i g n a l sequence of hspl6-48; RT, t r a n s c r i p t s that are not c l e a v e d w i t h i n the sequences covered by the probe. Panel a) Hspl6-1 probe extending from the BamHI s i t e to the B g l l I s i t e . Panel b) hspl6-48 probe extending from the BamHI s i t e to the Sau3AI s i t e . The s i z e markers are e n d - l a b e l l e d fragments of HpalI d i g e s t e d pBR322 DNA. 109 hsP16-l — — m A T G T A A T T A C T A T A A A T T C C A G T A T T C T G T T T C i A A T Aa fltATTTAAAAATAATATGA A T T T G T G A T A T T T T T T G A A A G H TTAGTtAATAA AfrATGTAAATGCCGGCAATGTACTTCTTGCATAATGCCTATTTTTGGGTATTGCACAGCCCCTcec: h s o 1 6 - 4 8 ^ T T T T A T T G T A T T C C A A A T A T T C T T A A T T T C i A A T A A J f e T C A T T A A T T T A A T T T A T T C A T G T T C T C T A G C A T A A C A A A A A C A T C A A A T C C G A C T T T C C A A T T C A A A T A T T T C A A A A C A A C A T A A C G G C T C A A C T T T A C A G C A T A C T C A T G C T A C G F i g u r e 36. Sequences surrounding the 3' t e r m i n i of hspl6 t r a n s c r i p t s . The t r a n s c r i p t s are represented by the arrows, with bars over the bases that are estimated to be at the s i t e of p o l y a d e n y l a t i o n . The dashed arrow r e p r e s e n t s the t r a n s c r i p t s t h a t c o n t i n u e through the proximal p o l y a d e n y l a t i o n s i t e of hspl6-1 and are ter m i n a t e d at the d i s t a l s i t e . AATAAA sequences upstream from the p o l y a d e n y l a t i o n s i t e s are shown i n boxes. Sequences resembling the YGTGTTYY 3' p r o c e s s i n g s i t e consensus sequence are u n d e r l i n e d , with dots under mismatches. 1 10 1 48 F i g u r e 37. S i z e s of hspl6-1 and hspl6-48 t r a n s c r i p t s i n t r a n s f e c t e d c e l l s . N u c l e i c a c i d from heat shocked c e l l s t h a t were t r a n s f e c t e d with pCGBPV9WT was denatured with formaldehyde, separated by e l e c t r o p h o r e s i s through a 1.4% agarose g e l c o n t a i n i n g formaldehyde, and t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r . Halves of the f i l t e r were h y b r i d i z e d with the hspl6-1 s p e c i f i c Bgll I-Sau3AI probe (1) or the hspl6-48 s p e c i f i c B g l l I -Sau3AI probe (48) , both of which are shown i n F i g u r e 31. The probes were s y n t h e s i z e d and l a b e l l e d by e x t e n s i o n of primers annealed to M13 mp8 templates. 1H, hspl6-1 t r a n s c r i p t s t h at are cle a v e d at the hspl6-1 p o l y a d e n y l a t i o n s i t e ; 48H, hspl6-48 t r a n s c r i p t s t h at are c l e a v e d at the hspl6-48 p o l y a d e n y l a t i o n s i t e ; RT, hspl6-48 t r a n s c r i p t s that are c l e a v e d i n the v i c i n i t y of the NPT II p o l y a d e n y l a t i o n s i t e . The s i z e markers are fragments of DNA that h y b r i d i z e to the probes. S p e c i f i c a l l y , they are the hspl6 BamHI fragment (1920 b) or i t s subfragments that were d i g e s t e d with H i n d i ! (1300 b ) , Bg_lII (1040 b ) , Rsal (780 b), or Rsal and B q l l T T 6 0 0 b ) . 1+48 NPT 6 0 0 -F i g u r e 38. S i z e of hspl6 and NPT II gene t r a n s c r i p t s i n t r a n s f e c t e d c e l l s . N u c l e i c a c i d from c e l l s t r a n s f e c t e d with pCGBPV9WT was denatured with formaldehyde, separated by e l e c t r o p h o r e s i s through a 1% agarose g e l c o n t a i n i n g formaldehyde, and t r a n s f e r r e d to a n i t r o c e l l u l o s e f i l t e r . Halves of the f i l t e r were h y b r i d i z e d with e i t h e r the n i c k - t r a n s l a t e d hspl6 gene p a i r BamHI fragment (1+48) or the n i c k - t r a n s l a t e d NPT II EcoRI- S s t l l fragment. H and C i n d i c a t e the use of n u c l e i c a c i d from heat shocked and uninduced c e l l s , r e s p e c t i v e l y . 1+48H, o v e r l a p p i n g mixture of hspl6-1 and hspl6-48 t r a n s c r i p t s t h a t are cl e a v e d at t h e i r a p p r o p r i a t e p o l y a d e n y l a t i o n s i t e s ; RT, hspl6-48 t r a n s c r i p t that i s c l e a v e d i n the v i c i n i t y of the NPT II p o l y a d e n y l a t i o n s i t e ; NPT, NPT II gene t r a n s c r i p t that i s cl e a v e d i n the v i c i n i t y of the NPT II p o l y a d e n y l a t i o n s i t e . The s i z e markers are fragments of DNA that h y b r i d i z e to the probes. S p e c i f i c a l l y , they are the hspl6 BamHI fragment (1920 b) or i t s subfragments that were d i g e s t e d with H i n d i I (1300 b) , B g l l I (1040 b ) , Rsal (780 b) , or Rsal and BgJ.II (600 b) . 1 12 F i g u r e 39. T r a n s c r i p t s of hspl6-48 and the NPT II gene. Open boxes, promoters; s o l i d boxes, c o d i n g r e g i o n s ; Open c i r c l e s , p o l y a d e n y l a t i o n s i t e s . Wavy arrows r e p r e s e n t t r a n s c r i p t s . 48H, hspl6-48 t r a n s c r i p t c l e a v e d at the hspl6-48 p o l y a d e n y l a t i o n s i t e ; NPT, NPT II t r a n s c r i p t c l e a v e d i n the v i c i n i t y of the NPT II p o l y a d e n y l a t i o n s i t e ; RT, hspl6-48 t r a n s c r i p t t h a t i s c l e a v e d i n the v i c i n i t y of the NPT II p o l y a d e n y l a t i o n s i t e . 1 1 3 t r a n s c r i p t i n uninduced c e l l s that was approximately 1500 b long, which i s the s i z e expected of a t r a n s c r i p t that i n i t i a t e s at the HSV tk promoter, t r a v e r s e s the NPT II coding r e g i o n , and i s c l e a v e d and p o l y a d e n y l a t e d at the HSV tk p o l y a d e n y l a t i o n s i t e ( F i g u r e s 38 and 39). The absence i n uninduced c e l l s of NPT II gene t r a n s c r i p t s l a r g e r than 1500 b i n d i c a t e s t h a t p r o c e s s i n g at the HSV-derived p o l y a d e n y l a t i o n s i t e downstream from t h i s gene i s very e f f i c i e n t . 1 1 4 IV. DISCUSSION 4.1 S t r u c t u r e of Vector DNA i n T r a n s f e c t e d C e l l s The PN v e c t o r s were designed to r e p l i c a t e as monomeric episomes i n t r a n s f e c t e d c e l l s , through the mediation of ex-a c t i n g PMSs and t r a n s - a c t i n g BPV r e p l i c a t i o n f a c t o r s . However, these v e c t o r s d i d not perform e x a c t l y as intended; they were s t a b l y maintained i n t r a n s f e c t e d c e l l s with average copy numbers of about twenty, but none of the v e c t o r DNA was i n the form of monomeric episomes. Monomeric episomes of CGBPV9 v e c t o r s were a l s o u n d e t e c t a b l e i n t r a n s f e c t e d c e l l s , i n c o n t r a s t to the r e s u l t s presented by M a t t h i a s et a l . (189). A minor p a r t of the BPV DNA that was c o - t r a n s f e c t e d with PN v e c t o r DNA was i n the form of monomeric episomes i n the t r a n s f e c t e d c e l l s . T h i s o b s e r v a t i o n demonstrates that the BPV DNA used f o r v e c t o r c o n s t r u c t i o n and t r a n s f e c t i o n was competent to r e p l i c a t e extrachromosomally, and that monomeric episomes c o u l d be d e t e c t e d when they e x i s t e d . BPV DNA with the s i z e of d i m e r i c episomes was i s o l a t e d from t r a n s f e c t e d c e l l s , a long with monomeric episomes and high molecular weight forms of BPV DNA. Catenated and o l i g o m e r i c forms of BPV v e c t o r episomes have been found by others i n t r a n s f e c t e d c e l l s (178,192). The t r a n s f e c t e d PN and CGBPV ve c t o r DNA may have been i n such complex episomal s t r u c t u r e s , which would not be d i s t i n g u i s h e d from chromosomal DNA by the methods that were used i n t h i s study. The i n d i v i d u a l c o p i e s of v e c t o r DNA were not a l l d i s p e r s e d 1 1 5 among separate i n t e g r a t i o n s i t e s because the l i n e a r arrangement of v e c t o r sequences was unperturbed i n most ca s e s . The observed s t r u c t u r e s are compatible with i n t e g r a t i o n of o l i g o m e r i c , head-t o - t a i l a r r a y s of f u l l l e n g t h v e c t o r DNA at a l i m i t e d number of chromosomal s i t e s . Such tandem a r r a y s are f r e q u e n t l y formed in t r a n s f e c t e d DNA p r i o r to i n t e g r a t i o n (224). The v e c t o r DNA that had aberrant lengths and was present i n a s i n g l e copy per c e l l c o u l d be p a r t of the unique r e s t r i c t i o n fragments that are c r e a t e d at the j u n c t i o n s between i n t e g r a t e d v e c t o r DNA and host c e l l chromosomal DNA. The copy numbers of PN v e c t o r s were i n c r e a s e d t e n - to t w e n t y - f o l d when BPV DNA was i n c l u d e d i n the t r a n s f e c t i o n , i m p l y i n g that BPV f a c t o r - m e d i a t e d extrachromosomal r e p l i c a t i o n of PN v e c t o r DNA happened at some stage i n the t r a n s f e c t e d c e l l s , although r e s u l t i n g tandem a r r a y s of v e c t o r DNA c o u l d have been i n t e g r a t e d subsequent to r e p l i c a t i o n . Removal of a l l PMSs from the PN v e c t o r s had no s i g n i f i c a n t e f f e c t on t h e i r s t r u c t u r e , copy number, or t r a n s c r i p t i o n a l competence i n t r a n s f e c t e d c e l l s . pONIWT DNA had a low frequency of rearrangement in t r a n s f e c t e d c e l l s and the c e l l l i n e with the h i g h e s t t r a n s c r i p t i o n a l e f f i c i e n c y ( t r a n s c r i p t s / g e n e ) of both the hspl6-1 and NPT II genes was t r a n s f e c t e d with t h i s v e c t o r . How c o u l d the presence of BPV DNA a f f e c t the copy number of v e c t o r s that do not c o n t a i n a PMS? One p o s s i b i l i t y i s that the ON v e c t o r DNA became d i r e c t l y l i n k e d to a fragment of co-t r a n s f e c t e d BPV DNA that c o n t a i n e d a PMS at an e a r l y stage of the t r a n s f e c t i o n , when the i n t r o d u c e d DNA i s known to be h i g h l y 1 16 recombinogenic (224). In order to e x p l a i n the predominance of unrearranged pONIWT DNA, the PMS-bearing DNA would have to be i n s e r t e d at a s i n g l e s i t e w i t h i n a l a r g e tandem a r r a y of vecto r DNA. High copy numbers of both pPNIWT and pONIWT were obt a i n e d when these v e c t o r s were used to s u p e r t r a n s f e c t C127 c e l l s i n which BPV DNA was a l r e a d y e s t a b l i s h e d . In t h i s case, the pre-e s t a b l i s h e d BPV DNA would not be expected to be h i g h l y recombinogenic with non-homologous t r a n s f e c t e d DNA, such as pON1WT. As an a l t e r n a t i v e to the PMS i n s e r t i o n theory, i t can be p o s t u l a t e d that the pONIWT v e c t o r c o n t a i n s sequences that can f u n c t i o n a l l y s u b s t i t u t e f o r a BPV PMS. These p u t a t i v e pseudo-PMSs c o u l d not be c o n f i n e d to the hspl6 gene p a i r or to the DNA f l a n k i n g the b a c t e r i a l o r i g i n of r e p l i c a t i o n i n the PN or ON v e c t o r s , because pOQ1 can a l s o have hi g h copy numbers i n t r a n s f e c t e d c e l l s . The v e c t o r s t h a t were used by Lusky and Botchan to demonstrate the e s s e n t i a l r o l e of the BPV-derived PMSs i n BPV fa c t o r - m e d i a t e d extrachromosomal r e p l i c a t i o n i n c l u d e d the same b a c t e r i a l o r i g i n of r e p l i c a t i o n , P1 promoter r e g i o n , and NPT II coding sequences that are found i n pOQ1 (183,184). The only remaining sequences that c o u l d c o n t a i n pseudo-PMSs e s s e n t i a l f o r extrachromosomal r e p l i c a t i o n of the ON and OQ v e c t o r s are i n the HSV-derived tk promoter and 3' non-coding r e g i o n s . HSV d i f f e r s from BPV i n that i t has a t w e n t y - f o l d l a r g e r genome that i s e x p o n e n t i a l l y r e p l i c a t e d i n p r o d u c t i v e l y i n f e c t e d c e l l s (reviewed i n r e f . 225). E p s t e i n - B a r r v i r u s (EBV), which i s 1 1 7 r e l a t e d to HSV and has a s i m i l a r l y l a r g e genome (225), i s s t a b l y r e p l i c a t e d as a low copy number episome i n i n f e c t e d lymphocytes (225,226). Episomal r e p l i c a t i o n of EBV i s dependent on a c i s -a c t i n g plasmid maintenance sequence and t r a n s - a c t i n g EBV r e p l i c a t i o n f a c t o r s (227), and so i s analogous to the r e p l i c a t i o n of BPV. I t i s not known whether the EBV PMSs can s u b s t i t u t e f o r the BPV PMSs, or whether HSV c o n t a i n s sequences t h a t are e q u i v a l e n t to the EBV PMSs. If a pseudo-PMS i s present i n the PN and CGBPV v e c t o r s i t may cause e i t h e r the formation of complex episomes or delayed i n t e g r a t i o n by i n t e r f e r i n g with the normal p r o c e s s e s of BPV-mediated r e p l i c a t i o n . 4.2 T r a n s c r i p t i o n a l Competence of T r a n s f e c t e d Genes A l l c e l l l i n e s t h a t were t r a n s f e c t e d with PN or ON v e c t o r DNA and BPV DNA, or with CGBPV v e c t o r DNA a l o n e , had t r a n s c r i p t i o n a l l y a c t i v e v e c t o r genes. The average l e v e l of NPT II gene t r a n s c r i p t i o n was w e l l above the minimum l e v e l that was observed i n G 4 1 8 - r e s i s t a n t c e l l l i n e s ; t h e r e f o r e , e f f i c i e n t e x p r e s s i o n of the NPT II gene was not n e c e s s i t a t e d by the s e l e c t i o n p r o c e s s . N e i t h e r the r e l a t i v e l e v e l s of hspl6 to NPT II gene t r a n s c r i p t s nor the number of t r a n s c r i p t s per gene copy was c o n s i s t e n t i n a l l the c e l l l i n e s d e r i v e d from the same t r a n s f e c t i o n . There was a p a r t i c u l a r l y high p r o p o r t i o n of c e l l l i n e s with reduced hspl6 t r a n s c r i p t l e v e l s . Repression of the hspl6 genes c o u l d r e s u l t from m u t a t i o n a l 1 18 i n a c t i v a t i o n of these u n s e l e c t e d genes a f t e r t r a n s f e c t i o n , a lthough the observed frequency of r e p r e s s i o n of hspl6 t r a n s c r i p t i o n r e l a t i v e to NPT II gene t r a n s c r i p t i o n was much higher than the frequency of mutation that has been observed with other BPV t r a n s f e c t i o n v e c t o r s (228). Some of the hspl6 genes may have been repr e s s e d as a r e s u l t of t h e i r chromatin s t r u c t u r e . The assembly of genes i n t o a c t i v e or i n a c t i v e chromatin s t r u c t u r e s may be a f o r t u i t o u s event o c c u r r i n g soon a f t e r t r a n s f e c t i o n (229). Once e s t a b l i s h e d , these s t r u c t u r e s can be s t a b l y propagated (229). The NPT II gene may p r e f e r e n t i a l l y a v o i d r e p r e s s i o n i f i t c o n t a i n s sequences that i n i t i a t e assembly of a c t i v e chromatin. The HSV tk promoter c o n t a i n s an e n h a n c e r - l i k e sequence that c o u l d be p o s t u l a t e d to perform t h i s r o l e (223), although, u n l i k e c l a s s i c a l l y d e f i n e d enhancers, t h i s element of the HSV tk promoter cannot a c t i v a t e d i s t a n t promoters (111). D i f f e r e n t numbers of v e c t o r c o p i e s may have been completely i n a c t i v e i n d i f f e r e n t c e l l l i n e s , r e s u l t i n g i n v a r i a t i o n i n the number of t r a n s c r i p t s per gene f o r a l l vector-borne genes without n e c e s s a r i l y a f f e c t i n g the hspl6 to NPT II t r a n s c r i p t r a t i o s . A s i n g l e c e l l l i n e t h a t was t r a n s f e c t e d with pONIWT and BPV DNA (OH-6, Table II) had f i v e times as many t r a n s c r i p t s per gene as any other c e l l l i n e c a r r y i n g the WT hspl6 gene p a i r ; t h i s c e l l l i n e may have been the only one that had a l l of i t s t r a n s f e c t e d genes i n a f u l l y f u n c t i o n a l s t a t e . V a r i a b i l i t y i n the t r a n s c r i p t i o n a l competence of the hspl6 and NPT II genes c o u l d be c o n t r o l l e d f o r by i d e n t i f y i n g the c e l l 1 19 l i n e s that had h i g h and mutually c o n s i s t e n t l e v e l s of t r a n s c r i p t i o n of a l l the t r a n s f e c t e d genes. Once the c o n s i s t e n c y of t r a n s c r i p t i o n i n these c e l l l i n e s had been e s t a b l i s h e d , the NPT II gene c o u l d be used as an i n t e r n a l c o n t r o l f o r comparing t r a n s c r i p t i o n of the other genes. The presence of an i n t e r n a l c o n t r o l gene was e s s e n t i a l because the l e v e l s of hspl6 t r a n s c r i p t s i n d i f f e r e n t c e l l l i n e s c o u l d not be c o n s i s t e n t l y normalized to the gene copy number. 4.3 Promoter Elements of the C. elegans Hspl6 genes t h a t are A c t i v e i n Mouse C e l l s . The 5' f l a n k i n g sequences of the C. elegans hspl6 genes have the f e a t u r e s of an a r c h e t y p i c a l heat i n d u c i b l e promoter. Each gene has a 5' TATA element and a p a i r of upstream HSEs that c l o s e l y match the HSE consensus sequence. The HSEs i n each p a i r o v e r l a p by 4 bp, which i s common to almost a l l o v e r l a p p i n g HSE c l u s t e r s (e.g. D r o s o p h i l a hsp83, hsp68, hsp23 and hsp22, human hsp70, D i c t y o s t e l i u m DIRS-1 heat i n d u c i b l e promoter, soy bean small HSP genes, and a human hsp70 gene; r e f s . 9,49,146,149,151). The s t r i c t c o n s e r v a t i o n of the HSE between very d i s t a n t l y r e l a t e d organisms (e.g. soy beans and humans) i s presumably due to h i g h sequence s p e c i f i c i t i e s of the t r a n s c r i p t i o n f a c t o r s that i n t e r a c t with i t and a low p r o b a b i l i t y of compatible mutations o c c u r r i n g i n those f a c t o r s and i n a l l of the e s s e n t i a l HSEs i n a genome. Whatever the cause, r e s t r i c t e d e v o l u t i o n a r y divergence i n heat shock gene promoter sequences enables e f f i c i e n t and t i g h t l y r e g u l a t e d 120 t r a n s c r i p t i o n of the C. elegans hspl6 genes i n mouse f i b r o b l a s t s . Both of the t r a n s f e c t e d hspl6 genes were s t r o n g l y induced by. a 42.5°C heat shock or by a r s e n i t e , which are s t i m u l i that induce the heat shock response i n c u l t u r e d Chinese hamster ovary f i b r o b l a s t s (222). The same heat shock c o n d i t i o n s a l s o induced t r a n s c r i p t i o n of hsp70-homologous genes i n C127 c e l l s . The hspl6 genes used the same t r a n s c r i p t i o n i n i t i a t i o n s i t e i n C. elegans and mouse c e l l s . Under optimal heat shock c o n d i t i o n s (2 h at 42.5°C), the hspl6-1 t r a n s c r i p t s accumulated to an estimated 1.2% of mRNA, or 12,000 t r a n s c r i p t s per c e l l , i n a mouse c e l l l i n e t h a t had twelve c o p i e s of the gene. T h i s i s comparable to the hspl6-1 t r a n s c r i p t abundance of 0.3% of mRNA i n heat shocked C. elegans, which has four hspl6-1 genes per d i p l o i d c e l l (147). The fragment of BPV DNA i n the PN v e c t o r s that c o n t a i n s PMS-1 a l s o c o n t a i n s a str o n g enhancer (205). E f f i c i e n t t r a n s c r i p t i o n of the hspl6 genes was n e i t h e r dependent on nor n o t i c e a b l y a f f e c t e d by the presence of t h i s enhancer. The s t r e n g t h of the hspl6 promoters appeared to be an autonomous p r o p e r t y of the C. elegans DNA. P r i o r to t h i s study, the t r a n s c r i p t i o n a l e f f i c i e n c i e s of exogenous heat shock genes that had been i n t r o d u c e d i n t o mammalian c e l l s were u n c e r t a i n , due to l i m i t a t i o n s i n the t r a n s f e c t i o n methods that were employed. An indeterminate but l a r g e p r o p o r t i o n of the D r o s o p h i l a heat shock genes i n t r o d u c e d i n t o monkey COS c e l l s on SV40 v e c t o r s (61,62,68) or s t a b l y i n t e g r a t e d i n t o mouse or r a t c e l l chromosomes (56,57) were 121 t r a n s c r i p t i o n a l l y r e p ressed, and so the number of t r a n s c r i p t s per gene i n these c e l l s would not be an a c c u r a t e measure of optimal promoter s t r e n g t h . The h i g h l e v e l s of C. elegans hspl6 gene t r a n s c r i p t s observed i n mouse c e l l s t r a n s f e c t e d with PN v e c t o r s demonstrates that the e f f i c i e n c y as w e l l as the i n d u c i b i l i t y of heat shock gene promoters can be f a i t h f u l l y reproduced i n d i s t a n t l y r e l a t e d host c e l l s . What promoter elements of the C. elegans hspl6 genes are f u n c t i o n i n g i n mouse c e l l s ? The 120 bp of DNA between the HSEs of hspl6-1 and hspl6-48 are 78% conserved i n the s t r u c t u r a l l y s i m i l a r hspl6-2 + hspl6-41 gene p a i r (D. Jones and E.P.M. Candido, manuscript submitted). W i t h i n t h i s r e g i o n , both gene p a i r s have a segment of a l t e r n a t i n g p u r i n e s and p y r i m i d i n e s . A s i n g l e base d e l e t i o n i n the p u r i n e / p y r i m i d i n e sequence i n the i n t e r g e n i c r e g i o n of the hspl6-1 + hspl6-48 gene p a i r , which reduced the l e n g t h of the a l t e r n a t i n g sequence from 10 bp to 7 bp, d i d not s i g n i f i c a n t l y a f f e c t the f u n c t i o n of e i t h e r of the hspl6 promoters i n mouse c e l l s . T h e r e f o r e , the l e n g t h of t h i s sequence, and thus i t s t h e o r e t i c a l p o t e n t i a l f o r forming l e f t -handed h e l i c a l s t r u c t u r e s (172), i s not a s i g n i f i c a n t determinant of h e a t - i n d u c i b l e promoter s t r e n g t h under the c o n d i t i o n s used i n t h i s study. Removing three of the four HSEs and a l l of the encompassed upstream sequences from the WT gene p a i r reduced the t r a n s c r i p t i o n a l a c t i v i t y of both hspl6 genes i n t r a n s f e c t e d mouse c e l l s , but the l o s s of these sequences c o u l d be more than compensated f o r by i n s e r t i n g three more HSEs between the TATA 1 22 elements of the two genes. The sequences of the w i l d - t y p e hspl6 gene p a i r a d d i t i o n a l to the HSEs that are d e l e t e d i n the DX gene p a i r , such as the TCAAT sequences, are not proven to be non-f u n c t i o n a l by t h i s r e s u l t . They may be r e s p o n s i v e to ind u c e r s other than h i g h temperature or a r s e n i t e . They may enhance promoter a c t i v i t y i n the WT gene p a i r , with t h e i r absence i n the NF gene p a i r being o f f s e t by the presence of an e x c e p t i o n a l l y s t r o n g promoter element r e s u l t i n g from the o v e r l a p of four HSEs. F i n a l l y , and more probably, they may r e g u l a t e hspl6 gene t r a n s c r i p t i o n i n C. elegans, but through sequences and t r a n s c r i p t i o n f a c t o r s that are not present or s u f f i c i e n t l y conserved i n the mouse. Some elements of the hspl6 genes must be f u n c t i o n i n g abnormally i n mouse c e l l s because the p r o p o r t i o n of hspl6-48 to hspl6-1 t r a n s c r i p t s i s f i v e - f o l d lower i n mouse c e l l s than i t i s i n C. elegans. While t h i s may be due to d i f f e r e n c e s i n promoter s t r e n g t h s , i t i s e q u a l l y p o s s i b l e that the t r a n s c r i p t s have d i s p r o p o r t i o n a t e s t a b i l i t i e s i n the two organisms. 4.4 E f f e c t of HSE M u l t i p l i c i t y on Promoter S t r e n g t h In a d d i t i o n to d e f i n i n g the elements of the C. elegans  hspl 6 genes that are f u n c t i o n a l i n a d i s t a n t l y r e l a t e d host, the WT and mutated h s p l 6 gene p a i r s were used to examine the r o l e of HSEs i n c o n t r o l l i n g t r a n s c r i p t i o n i n mouse c e l l s . In the MX gene p a i r , where the two TATA elements are p r e s e r v e d but a l l HSEs are d e l e t e d , n e i t h e r gene i s t r a n s c r i b e d i n induced or uninduced c e l l s . P l a c i n g a s i n g l e HSE between the 1 23 TATA elements (DX) r e s u l t s i n heat i n d u c i b l e t r a n s c r i p t i o n of the two genes from the c o r r e c t i n i t i a t i o n s i t e s , although t r a n s c r i p t l e v e l s are s i g n i f i c a n t l y lower than those obtained with the WT gene p a i r , i n which there are two HSEs adjacent to the TATA elements of each gene. Because the t r a n s c r i p t s of the DX and WT gene p a i r s are i d e n t i c a l , the d i f f e r e n c e i n t r a n s c r i p t l e v e l s i s presumably a f u n c t i o n of a d i f f e r e n c e i n promoter s t r e n g t h s between the two gene p a i r s . Expanding the s i n g l e HSE i n t o a c l u s t e r of four o v e r l a p p i n g HSEs (NF) i n c r e a s e s t r a n s c r i p t i o n of both genes to approximately twice that of the WT gene p a i r . T h e r e f o r e , while a s i n g l e HSE upstream from the TATA element i s necessary and s u f f i c i e n t f o r heat or a r s e n i t e i n d u c t i o n i n mouse c e l l s , r a t e s of induced t r a n s c r i p t i o n are h i g h l y dependent on the number of HSEs that are adjacent to the TATA element. E f f i c i e n t t r a n s c r i p t i o n of the D r o s o p h i l a hsp70 gene r e q u i r e s both of the HSEs that are adjacent to the TATA element (72,77,78,84). D e l e t e d v e r s i o n s of t h i s gene that r e t a i n only the s i n g l e HSE that i s c l o s e s t to the TATA element are only weakly induced (77,78) or n o n - i n d u e i b l e (72) i n transformed f l i e s or i n c u l t u r e d D r o s o p h i l a c e l l s , and are a l s o i n e f f i c i e n t l y t r a n s c r i b e d iri v i t r o i n the presence of e x t r a c t s from heat shocked D r o s o p h i l a c e l l s (84). S i m i l a r l y , genes with a s i n g l e s y n t h e t i c HSE i n t h e i r promoters are not heat i n d u c i b l e i n transformed f l i e s (80). The dependence of heat shock genes in both D r o s o p h i l a and mouse c e l l s on m u l t i p l e HSEs f o r e f f i c i e n t t r a n s c r i p t i o n 1 24 suggests t h a t the mechanism by which t r a n s c r i p t i o n f a c t o r s a c t i v a t e h e a t - i n d u c i b l e promoters i s probably s i m i l a r i n the two organisms. In p a r t i c u l a r , c o o p e r a t i v e b i n d i n g of heat shock t r a n s c r i p t i o n f a c t o r s to adjacent or o v e r l a p p i n g HSEs may be a common mechanism f o r magnifying the e f f i c i e n c y of t r a n s c r i p t i o n . The i n i t i a l experiments that d e f i n e d the e s s e n t i a l promoter elements of HSP genes suggested that m u l t i p l e HSEs were not important f o r promoter s t r e n g t h i n mammalian c e l l s . D r o s o p h i l a  hsp70 promoters c o n t a i n i n g only a s i n g l e upstream HSE were t r a n s c r i b e d j u s t as e f f i c i e n t l y i n monkey COS c e l l s as promoters that i n c l u d e d the three a d d i t i o n a l upstream HSEs (61,62). These promoters were on r e p l i c a t i n g SV40 v e c t o r s that would be p r e s e n t i n g r e a t e r than 10,000 c o p i e s per c e l l (60,61). I t now seems probable t h a t a l i m i t e d supply of HSE-binding t r a n s c r i p t i o n f a c t o r s i n these c e l l s was d i s t r i b u t e d among a l a r g e excess of HSEs, with most of the genes being without any f a c t o r and t h e r e f o r e i n a c t i v e , and the remaining genes having only a s i n g l e bound HSE c o n f e r r i n g weak i n d u c i b i l i t y . The hspl6-1 t r a n s c r i p t i o n a l e f f i c i e n c i e s and hspl6-1 to NPT II gene t r a n s c r i p t r a t i o s were s i m i l a r l y high i n t r a n s f e c t e d c e l l l i n e s with v e c t o r copy numbers ranging from 8 to 100 (see T able I I , l i n e s WT, OH-4, BH-1, and BH-3). In t h i s copy number range, t h e r e f o r e , there i s no evidence for severe e f f e c t s on hps 16-1 gene t r a n s c r i p t i o n due to s a t u r a t i o n of the p o o l s of an - e s s e n t i a l host c e l l t r a n s c r i p t i o n f a c t o r . The BH-2 c e l l l i n e , w ith 350 v e c t o r c o p i e s , had a f i v e - f o l d lower e f f i c i e n c y of t r a n s c r i p t i o n of hspl6-1 in comparison to the c e l l l i n e s 1 25 mentioned above. However, t h i s r e d u c t i o n can probably be a t t r i b u t e d to the g e n e r a l v a r i a t i o n i n t r a n s c r i p t i o n a l e f f i c i e n c i e s between some c e l l l i n e s r a t h e r than to i n h i b i t i o n by- a dramatic d e p l e t i o n i n the a v a i l a b i l i t y of f r e e t r a n s c r i p t i o n f a c t o r s when the number of a c t i v e heat shock genes i n a c e l l i n c r e a s e s from 200 to 700. S i m i l a r l y , the very h i g h t r a n s c r i p t i o n a l e f f i c i e n c y of hspl6-1 i n c e l l l i n e OH-6 r e l a t i v e to c e l l l i n e OH-4 i s presumably not a r e s u l t of the s l i g h t l y lower v e c t o r copy number i n the former c e l l l i n e . The D r o s o p h i l a hsp83 gene i s s t r o n g l y induced by heat shock but i s a l s o t r a n s c r i p t i o n a l l y a c t i v e under normal growth c o n d i t i o n s (7,25). The s u g g e s t i o n has been made that the three o v e r l a p p i n g HSEs i n i t s promoter may have a very high a f f i n i t y f o r HSTF, r e s u l t i n g i n p r e f e r e n t i a l e x p r e s s i o n of t h i s gene when c o n c e n t r a t i o n s of a c t i v e HSTF are low (63,79,86), as they a p p a r e n t l y are i n u n s t r e s s e d D r o s o p h i l a c e l l s (83). The NF gene p a i r has a c l u s t e r of o v e r l a p p i n g HSEs t h a t i s s i m i l a r to and more e x t e n s i v e than t h a t of hsp83. The NF hspl6 genes are s t r o n g l y induced by heat shock i n mouse c e l l s but, u n l i k e the hsp83 gene, these genes are completely i n a c t i v e under normal growth c o n d i t i o n s . There may not be any a c t i v e heat shock t r a n s c r i p t i o n f a c t o r s i n u n s t r e s s e d mouse c e l l s , i n which case the heat shock genes t h a t are c o n s t i t u t i v e l y expressed i n mouse c e l l s (141,142) must be induced by a d i f f e r e n t mechanism than t h a t proposed f o r the D r o s o p h i l a hsp83 gene. 1 26 4.5 E f f e c t s of HSE C o n f i g u r a t i o n and O r i e n t a t i o n The number of upstream HSEs does not r i g o u r o u s l y determine the promoter s t r e n g t h of heat shock genes i n mouse c e l l s . In the c o n s t r u c t i o n of the IX gene p a i r , the hspl6-1 gene l o s t one of i t s two HSEs and i t s t r a n s c r i p t l e v e l s were reduced t e n - f o l d r e l a t i v e to the WT gene p a i r . However, the hspl6-48 gene exchanged i t s d i s t a l HSE f o r both the proximal and d i s t a l HSEs of hspl6-1, l e a v i n g i t with three o v e r l a p p i n g HSEs i n the IX gene p a i r , but the hspl6-48 t r a n s c r i p t l e v e l s were a l s o reduced, i n t h i s case two-fold r e l a t i v e to the WT gene p a i r . The two new HSEs of the IX hspl6~48 gene should be f u n c t i o n a l and p r o p e r l y o r i e n t e d because they were a b l e to a c t i v a t e e f f i c i e n t t r a n s c r i p t i o n of hspl6-1 i n the WT gene p a i r . The low e f f i c i e n c y of the IX hspl6-48 promoter may be due to some form of HSE i n c o m p a t i b i l i t y , such as a non-productive order of c o o p e r a t i v e b i n d i n g of t r a n s c r i p t i o n f a c t o r s to the three HSEs. For example, i t may be necessary to have the HSE with the h i g h e s t a f f i n i t y f o r a heat shock t r a n s c r i p t i o n f a c t o r adjacent to the TATA element, as i n the D r o s o p h i l a hsp70 gene (84). The middle HSE of IX hspl6-48 has the c l o s e s t resemblance to the HSE consensus sequence (8/8, versus 7/8 f o r the proximal HSE and 6/8 f o r the d i s t a l HSE), and so might be expected to have the h i g h e s t a f f i n i t y . A s i n g l e HSE (DX) or an HSE c l u s t e r (NF) can a c t i v a t e b i d i r e c t i o n a l t r a n s c r i p t i o n of the hspl6 gene p a i r when p l a c e d c l o s e l y between the two TATA elements and i n i t i a t i o n s i t e s . The DX and NF gene p a i r s have d i f f e r e n t r a t i o s of hspl6-1 to 1 27 hspl6-48 t r a n s c r i p t s and t h e r e f o r e i n at l e a s t one case the HSEs must have a d i r e c t i o n a l b i a s independent of downstream sequences. The HSE consensus sequence i s the same on both DNA s t r a n d s , so an HSE would be expected to f u n c t i o n i n e i t h e r o r i e n t a t i o n . But the sequences of a c t u a l HSEs are not u s u a l l y the same on both DNA s t r a n d s , so t h e i r o r i e n t a t i o n c o u l d a f f e c t promoter s t r e n g t h . HSTF may a l s o make c o n t a c t s with bases f l a n k i n g the HSE that can be d i f f e r e n t on the two strands (84). If the presumed t r a n s c r i p t i o n f a c t o r s are asymmetric, t h e i r probable o r i e n t a t i o n and consequent e f f e c t on t r a n s c r i p t i o n c o u l d be dependent on the b i n d i n g s t r e n g t h s of the two a l t e r n a t i v e p o s i t i o n s on an HSE. The o r i e n t a t i o n s of the HSEs of the w i l d - t y p e hspl6 gene p a i r may be o p t i m i z e d f o r t r a n s c r i p t i o n a l e f f i c i e n c y ; hspl6-48 i s more s t r o n g l y induced than hspl6-1 i n the DX gene p a i r , i n which the s i n g l e HSE i s i n the n a t u r a l o r i e n t a t i o n r e l a t i v e to hspl6-48 but i s i n a r e v e r s e d o r i e n t a t i o n r e l a t i v e to h s p l 6 - 1 . An example of d i r e c t i o n a l b i a s i n f a c t o r - b i n d i n g promoter elements i s found i n SV40. One DNA s t r a n d of the b i d i r e c t i o n a l promoter of the v i r u s c o n t a i n s s i x c o p i e s of the sequence GGGCGG, which binds the Sp1 t r a n s c r i p t i o n f a c t o r (104). I_n v i t r o t r a n s c r i p t i o n of mutated promoters showed that some of the Sp1 b i n d i n g elements are r e q u i r e d f o r e a r l y gene t r a n s c r i p t i o n while a d i f f e r e n t set of the elements i s r e q u i r e d f o r l a t e gene t r a n s c r i p t i o n (99,115). In t h i s case, f l a n k i n g sequences or the r e l a t i v e p o s i t i o n s of the b i n d i n g s i t e s must determine the d i r e c t i o n of t r a n s c r i p t i o n , because the GGGCGG sequences 1 28 themselves are a l l i d e n t i c a l and have the same o r i e n t a t i o n . While the HSEs were capable of f u n c t i o n i n g i n e i t h e r o r i e n t a t i o n , no s i g n i f i c a n t amounts of t r a n s c r i p t i n i t i a t i o n o c c u r r e d on the upstream s i d e of the WT HSEs. T h e r e f o r e , sequences a d d i t i o n a l to HSEs are r e q u i r e d to i n i t i a t e t r a n s c r i p t i o n . These sequences do not have to i n c l u d e a TATA element because t h i s promoter element i s absent i n a f u n c t i o n a l human hsp70 promoter (149). 4.6 Remote HSEs The rearrangements that were made i n the C. elegans hspl6 gene p a i r d i d not address the q u e s t i o n of whether the HSEs adja c e n t to the hspl6-1 gene c o u l d modulate the promoter s t r e n g t h of the hspl6-48 gene. In the D r o s o p h i l a hsp70 gene, t r a n s c r i p t i o n i s dependent on a p a i r of HSEs that are c e n t r e d at p o s i t i o n s -56 and -78, but HSEs f u r t h e r upstream at p o s i t i o n s -177 and -247 can bi n d HSTF and i n c r e a s e promoter s t r e n g t h i n  v i t r o (84). In the case of the D r o s o p h i l a hsp28 and hsp26 genes, HSEs l o c a t e d hundreds of base p a i r s upstream from the s i t e of t r a n s c r i p t i o n i n i t i a t i o n are e s s e n t i a l f o r h i g h l e v e l s of t r a n s c r i p t i o n (64,69). HSEs can a l s o be found downstream from the i n i t i a t i o n s i t e ; the D r o s o p h i l a hsp83 gene has two HSEs i n an i n t r o n (10) and the C. elegans hspl6-48 gene has a 7/8 match (CTCTAAACTTCAAG) to the HSE consensus sequence downstream from the TATA element and immediately i n f r o n t of the co d i n g r e g i o n ( F i g u r e 2 ). The MX gene p a i r r e t a i n s t h i s HSE as w e l l as the two TATA elements, but both of i t s hspl6 genes are i n a c t i v e . 1 29 T h e r e f o r e , the downstream HSE of hspl6-48 cannot a c t i v a t e t r a n s c r i p t i o n i n mouse c e l l s i n the absence of the upstream HSEs of the hspl6 gene p a i r . HSEs t h a t are remote from the i n i t i a t i o n s i t e may i n d i r e c t l y i n c r e a s e promoter s t r e n g t h by l o c a l i z i n g t r a n s c r i p t i o n f a c t o r s i n the v i c i n i t y of the HSEs that are d i r e c t l y i n v o l v e d i n i n i t i a t i n g t r a n s c r i p t i o n . 4.7 Common Mechanism of Heat Shock Gene Induction by Heat and A r s e n i t e . A l l of the mutations that were made in the promoter r e g i o n of the hspl6 gene p a i r had e q u i v a l e n t e f f e c t s on the i n d u c i b i l i t y of the genes by both heat shock and a r s e n i t e . Thus, i t seems probable that a common mechanism f o r a c t i v a t i n g heat shock gene t r a n s c r i p t i o n i s invoked by these two agents, at l e a s t at the stage that d i r e c t l y i n v o l v e s the promoter sequences of the genes. I t i s p o s s i b l e t h a t heat and a r s e n i t e a c t i v a t e two d i s t i n c t t r a n s c r i p t i o n f a c t o r s that u t i l i z e e x a c t l y the same promoter elements, e.g. the HSEs. The a l t e r n a t i v e i s that the heat shock response a c t i v a t i o n pathways would i n i t i a l l y vary with d i f f e r e n t i n d u c i n g agents, but subsequent events l e a d i n g to i n d u c t i o n of heat shock gene t r a n s c r i p t i o n would be i d e n t i c a l f o r a l l pathways and independent of the induc i n g agent. 4.8 Summary of HSE F u n c t i o n and Prospects f o r F u r t h e r E x p e r i m e n t a t i o n The experiments d e s c r i b e d i n t h i s study have demonstrated 1 30 that the HSEs are e s s e n t i a l f o r h e a t - i n d u c i b l e t r a n s c r i p t i o n of the hspl6 genes. The HSEs a c t i v a t e t r a n s c r i p t i o n i n a b i d i r e c t i o n a l manner with r a t e s of t r a n s c r i p t i o n being determined by the number of HSEs. These r e s u l t s suggest that the HSEs are b i n d i n g s i t e s of t r a n s c r i p t i o n f a c t o r s analogous to the D r o s o p h i l a HSTF. Two p o s s i b l e l i n e s of i n v e s t i g a t i o n c o u l d be pursued to i n c r e a s e our understanding of how the hspl6 genes are r e g u l a t e d . The PN vector/C127 c e l l e x p r e s s i o n system c o u l d be used to study the f u n c t i o n of HSEs p o s i t i o n e d at v a r i a b l e d i s t a n c e s upstream or downstream from the TATA element. With the development of an in v i t r o t r a n s c r i p t i o n system d e r i v e d from C. elegans c e l l s , the r o l e of promoter elements other than HSEs i n determining t r a n s c r i p t i o n r a t e s and r e g u l a t i o n c o u l d be examined and the p r o t e i n s that i n t e r a c t with those promoter elements c o u l d be i d e n t i f i e d and p u r i f i e d . 4.9 S p l i c i n g of Hspl6 T r a n s c r i p t s Both the 5' and 3' i n t r o n j u n c t i o n sequences of the C. elegans hspl6 genes c l o s e l y match the consensus sequences of mammalian i n t r o n j u n c t i o n s (165), but none of t h e i r t r a n s c r i p t s were a c c u r a t e l y s p l i c e d i n mouse c e l l s . Some hspl6 t r a n s c r i p t s were completely u n s p l i c e d ; the remainder were cut at the c o r r e c t 5' s p l i c e s i t e s but the 3' s p l i c e s i t e s i n these t r a n s c r i p t s were downstream from the s i t e s t h a t are u t i l i z e d i n the p r o c e s s i n g of hspl6 t r a n s c r i p t s i n C. elegans . Introns are removed from pre-mRNAs by a two step process (reviewed i n r e f . 232). A f t e r cleavage at the 5' s p l i c e s i t e , 131 the f r e e 5' end of the i n t r o n becomes j o i n e d to a s i t e w i t h i n the i n t r o n through a 5'-2' phosphodiester bond, thus forming a l a r i a t shaped i n t e r m e d i a t e . The 5' and 3' exon sequences are then s p l i c e d t o g e t h e r , and the i n t r o n sequences are r e l e a s e d . The s i t e where the 5'-2' bond i s formed, r e f e r r e d to as the l a r i a t s i t e , i s g e n e r a l l y found twenty to f o r t y bases upstream from the 3' s p l i c e s i t e (230-232). A consensus sequence f o r the l a r i a t s i t e has been d e r i v e d from a l i m i t e d number of cases (YNYTRAY; 233), but i t i s not very s p e c i f i c or w e l l conserved, and i n t r o n s l a c k i n g t h e i r normal l a r i a t s i t e can s t i l l be a c c u r a t e l y s p l i c e d , a lthough e f f i c i e n c y of s p l i c i n g may be reduced (234,235). Sequences s i m i l a r to the l a r i a t s i t e consensus sequence can be found w i t h i n the hspl6-48 i n t r o n and upstream from a l l of the hspl6 aberrant 3' s p l i c e s i t e s ( F i g u r e 34). These sequences may not be s u f f i c i e n t f o r e f f i c i e n t s p l i c i n g i n mouse c e l l s , e i t h e r at the c o r r e c t 3' s i t e of the hspl6-48 t r a n s c r i p t or at the aberrant 3' s i t e s of both hspl6 t r a n s c r i p t s , thus a c c o u n t i n g f o r the abundance of completely u n s p l i c e d hspl6 t r a n s c r i p t s . The hspl6 5' s p l i c e s i t e s may be f u l l y f u n c t i o n a l i n mouse c e l l s d e s p i t e incomplete c u t t i n g at these s i t e s because i n i t i a t i o n of the s p l i c i n g r e a c t i o n by 5' cleavage i s dependent on the presence of f u n c t i o n a l l a r i a t s i t e s and 3' s p l i c e s i t e s w i t h i n the same t r a n s c r i p t (236,237). A l l of the hspl6 t r a n s c r i p t s p l i c e s i t e sequences may be i n d i v i d u a l l y f u n c t i o n a l i n mouse c e l l s , with aberrant and i n e f f i c i e n t s p l i c i n g r e s u l t i n g from the c o r r e c t 5' and 3' s p l i c e s i t e s being too c l o s e to each other. Mammalian i n t r o n s appear to 1 32 have a minimum s p l i c e a b l e i n t r o n l e n g t h of about 80 bp (238,239). The c o r r e c t 5' and 3' s i t e s are 52 bp or 55 bp apart in the unprocessed hspl6 t r a n s c r i p t s , and cannot be s p l i c e d together i n mouse c e l l s . The s h o r t e s t i n t r o n that c o u l d be s p l i c e d out of the < hspl6-1 t r a n s c r i p t s was estimated to be 73 bp long, and the s p l i c e d hspl6-1 t r a n s c r i p t that used the 3' s i t e 27 bp f u r t h e r downstream was four times as abundant. The s p l i c e d hspl6-48 t r a n s c r i p t s l o s t an i n t r o n t h a t was estimated to be 113 bp long. Apart from i n c l u d i n g AG d i n u c l e o t i d e s , the aberrant 3' s p l i c e s i t e s of the hspl6 gene t r a n s c r i p t s that are used i n mouse c e l l s do not c l o s e l y match the 3' s p l i c e s i t e consensus sequence (165). In p a r t i c u l a r , they l a c k the s t r e t c h of s i x or more p y r i m i d i n e s that i s commonly found upstream from the AG d i n u c l e o t i d e . The mammalian s p l i c i n g apparatus normally has a very high s p e c i f i c i t y f o r s p l i c e s i t e s , o f t e n i g n o r i n g many ap p a r e n t l y a c c e p t a b l e 3' s p l i c e s i t e sequences l y i n g between the c o r r e c t 5' and 3' s p l i c e s i t e s (50). C o n s i d e r i n g t h i s h i g h n a t u r a l s e l e c t i v i t y i n the c h o i c e of s p l i c e s i t e s , why are the f o r t u i t o u s l y p l a c e d AG d i n u c l e o t i d e s w i t h i n the 3' exons of the hspl6 genes u t i l i z e d as 3' s p l i c e s i t e s i n mouse c e l l s ? The hspl6 i n t r o n sequences may be s u f f i c i e n t to i n i t i a t e the s p l i c i n g p rocess i n mouse c e l l s , s t a r t i n g with cleavage at the 5' s i t e , but s i z e c o n s t r a i n t s or sequence requirements d i f f e r e n t from those i n C. elegans may r e s u l t i n l a r i a t formation downstream from the l a r i a t s i t e t h a t i s used i n C. el e g a n s . T h i s would prevent l i g a t i o n of the 5' s i t e to the c o r r e c t 3' s i t e and 1 33 f o r c e AG d i n u c l e o t i d e s f u r t h e r downstream to react with the l a r i a t i n t e r m e d i a t e . Removal of a normal 3' s p l i c e s i t e with r e t e n t i o n of the normal l a r i a t s i t e t y p i c a l l y r e s u l t s i n u t i l i z a t i o n of the next downstream AG d i n u c l e o t i d e as the new 3' s p l i c e s i t e (232). In a d d i t i o n to s u f f e r i n g from the e f f e c t s of i n c o m p a t i b i l i t y between e i t h e r s p e c i f i c C. elegans s p l i c e s i t e sequences or e x c e s s i v e l y short i n t r o n l e n g t h s and the s p l i c i n g apparatus of mouse c e l l s , the e f f i c i e n c y of s p l i c i n g of the t r a n s c r i p t s of t r a n s f e c t e d hspl6 genes may be impaired by the c o n d i t i o n s that e l i c i t the heat shock response. When the D r o s o p h i l a hsp70 promoter was fused to the coding r e g i o n of the D r o s o p h i l a white gene, which c o n t a i n s an i n t r o n of 3000 bases, and the f u s i o n gene was in t r o d u c e d i n t o D r o s o p h i l a by P element-mediated t r a n s f o r m a t i o n , the f u s i o n gene t r a n s c r i p t s were i n e f f i c i e n t l y s p l i c e d d u r i n g heat shock but were completely s p l i c e d a f t e r normal growth c o n d i t i o n s were r e s t o r e d (240). T h i s o b s e r v a t i o n p r o v i d e s s t r o n g evidence that s p l i c i n g i s i n h i b i t e d by heat shock i n D r o s o p h i l a . Almost a l l heat shock genes are de v o i d of i n t r o n s , the onl y exceptions being the D r o s o p h i l a  hsp83 gene (10) and the C. elegans hspl6 genes (147). Thus, most heat shock genes would be immune to the consequences of d e f e c t s i n the s p l i c i n g machinery r e s u l t i n g from c o n d i t i o n s that induce t h e i r t r a n s c r i p t i o n . The absence of i n t r o n s i n almost a l l e u k a r y o t i c heat shock genes suggests that i n h i b i t i o n of s p l i c i n g by heat shock may be a u n i v e r s a l phenomenom. If t h i s i s t r u e , then the q u e s t i o n of how D r o s o p h i l a hsp83 (10,25) and C. eleqans 134 hspl6 genes can be completely s p l i c e d d u r i n g heat shock remains unanswered. I f the C. eleqans hspl6 genes have s p l i c e s i t e sequences that permit s p l i c i n g even under the adverse c o n d i t i o n s of heat shock, then these sequences may not be a b l e to perform the same r o l e i n heat shocked mouse c e l l s . I t i s a l s o p o s s i b l e that heat shock does not a f f e c t s p l i c i n g i n C. eleqans, i n which case there would not be any s e l e c t i v e pressure a g a i n s t the presence of i n t r o n s i n the heat shock genes of t h i s organism. 4.10 P r o c e s s i n g of the 3' Ends of Hsp16 T r a n s c r i p t s L i k e the 5' s p l i c e s i t e s , the p o l y a d e n y l a t i o n s i g n a l sequences of the elegans h s p l 6 genes were a c c u r a t e l y but i n e f f i c i e n t l y u t i l i z e d i n mouse c e l l s . Some hspl6 t r a n s c r i p t s were c l e a v e d about 20 bp downstream from the f i r s t AATAAA sequence but many of the t r a n s c r i p t s were not processed at these s i t e s and c o n t i n u e d on i n t o downstream vect o r sequences. The HSV-derived p o l y a d e n y l a t i o n s i g n a l sequences appeared to f u n c t i o n much more e f f i c i e n t l y f o r p r o c e s s i n g both the t r a n s c r i p t s i n i t i a t e d by the HSV tk promoter and the hspl6-48 read-through t r a n s c r i p t s . In a d d i t i o n to the AATAAA sequence i t s e l f (241,242), sequences l y i n g f u r t h e r downstream are r e q u i r e d f o r proper 3' p r o c e s s i n g of t r a n s c r i p t s i n mammalian c e l l s (243-249). In some cases, the regions that are r e q u i r e d f o r p r o c e s s i n g i n c l u d e sequences that resemble the consensus sequence YGTGTTYY (243,245,246,249). Such sequences are found twenty to t h i r t y base p a i r s downstream from the 3' AATAAA of most mammalian genes 1 35 (reviewed i n r e f . 249), and are a l s o found downstream from the AATAAA sequences that d e f i n e the 3' t e r m i n i of the hspl6 gene t r a n s c r i p t s i n C. elegans (Figure 36). However, sequences l y i n g beyond the YGTGTTYY sequences are a l s o r e q u i r e d f o r maximum e f f i c i e n c i e s of 3' p r o c e s s i n g (246,249). These sequences are not h i g h l y conserved among d i f f e r e n t mammalian genes and t h e r e f o r e the e q u i v a l e n t sequences of the C. elegans hspl6 t r a n s c r i p t s may not be able to p r o d u c t i v e l y i n t e r a c t with the t r a n s c r i p t p r o c e s s i n g f a c t o r s of mouse c e l l s . The hspl6 t r a n s c r i p t s that were c l e a v e d at t h e i r 3' p r o c e s s i n g s i t e s a l s o appeared to be p o l y a d e n y l a t e d , judging from the l e n g t h of the t r a n s c r i p t s . Cleavage and p o l y a d e n y l a t i o n at the 3' ends of t r a n s c r i p t s are c l o s e l y coupled processes i n mammalian c e l l s (250), so the absence of c l e a v e d but non-p o l y a d e n y l a t e d hspl6 t r a n s c r i p t s i s not s u r p r i s i n g . 1 36 4.11 U t i l i t y of CGBPV and PN V e c t o r s f o r I n t r o d u c i n g Genes i n t o Mammalian C e l l s The most commonly used methods f o r s t u d y i n g f o r e i g n genes i n c u l t u r e d c e l l s r e s u l t i n t r a n s i e n t e x p r e s s i o n of thousands of gene c o p i e s , f o l l o w e d by e i t h e r l o s s of the i n t r o d u c e d genes by a combination of d e g r a d a t i o n and absence of r e p l i c a t i o n , or d e s t r u c t i o n of the t r a n s f e c t e d c e l l s . In the COS c e l l system, the v e c t o r copy number reaches 10,000 to 100,000 a f t e r two days, at which p o i n t t r a n s c r i p t i o n of the v e c t o r genes i s maximal, although extremely i n e f f i c i e n t i n terms of t r a n s c r i p t s per gene (60). R e p l i c a t i o n of v e c t o r DNA c o n t i n u e s unabated beyond t h i s p o i n t , r e s u l t i n g i n c e l l l y s i s . With many c e l l types, t r a n s f e c t i o n with any type of DNA r e s u l t s i n thousands of c o p i e s being taken up by a small p r o p o r t i o n of the c e l l s (53). These c o p i e s are not extrachromosomally r e p l i c a t e d , but at l e a s t some of them are t r a n s c r i p t i o n a l l y a c t i v e f o r a p e r i o d of s e v e r a l days (54). There are s e v e r a l advantages to u s i n g the PN v e c t o r t r a n s f e c t i o n method i n p l a c e of these t r a n s i e n t t r a n s f e c t i o n methods. PN v e c t o r s are s t a b l y maintained i n C127 c e l l s , r e s u l t i n g i n c e l l l i n e s t h a t can be analyzed r e p e a t e d l y and can express genes at a constant r a t e f o r long p e r i o d s . Genes on PN v e c t o r s can have c l o s e to n a t u r a l copy numbers and t r a n s c r i p t l e v e l s , and v a r i a n t s f o r these q u a l i t i e s can be found by s c r e e n i n g d i f f e r e n t c e l l l i n e s . The hspl6 and NPT II genes used t h e i r n a t u r a l t r a n s c r i p t i o n i n i t i a t i o n s i t e s when int r o d u c e d i n t o mouse c e l l s on PN v e c t o r s , and the hspl6 genes were t i g h t l y 1 37 r e g u l a t e d . When in t r o d u c e d i n t o monkey COS c e l l s on r e p l i c a t i n g SV40 v e c t o r s , the HSV thymidine kinase promoter i n i t i a t e d t r a n s c r i p t i o n at m u l t i p l e upstream s i t e s as w e l l as the n a t u r a l s i t e (62,65), and the D r o s o p h i l a heat shock gene promoters were p a r t i a l l y a c t i v e i n u n s t r e s s e d c e l l s (61,62,68). The observed l o s s of s p e c i f i c i t y in r e g u l a t i o n and i n i t i a t i o n may r e s u l t from the abnormal r e p l i c a t i o n r a t e s or copy numbers of the genes on SV40 v e c t o r s . The disadvantage of PN v e c t o r s r e l a t i v e to t r a n s i e n t t r a n s f e c t i o n methods l i e s i n the time and e f f o r t i n v o l v e d i n growing and s c r e e n i n g many c e l l l i n e s . T h i s process takes about 25 days, compared to the 3 days r e q u i r e d to get r e s u l t s by t r a n s i e n t e x p r e s s i o n . Some c o p i e s of t r a n s f e c t e d DNA w i l l i n t e g r a t e i n t o the c e l l ' s chromosomes, and c e l l l i n e s c a r r y i n g a c t i v e c o p i e s of s e l e c t a b l e genes can be o b t a i n e d (53). These c e l l l i n e s take at l e a s t as long to o b t a i n as c e l l l i n e s s t a b l y t r a n s f e c t e d with PN v e c t o r s . T r a n s c r i p t i o n a l e f f i c i e n c i e s of the i n t e g r a t e d genes are t y p i c a l l y much lower than n a t u r a l genes and n o n - s e l e c t a b l e genes are f r e q u e n t l y completely i n a c t i v e (53,56,57). The advantage of i n t e g r a t i v e t r a n s f e c t i o n i s that i t can be used with any c e l l type that i s competent f o r DNA uptake. The l i m i t e d host range of BPV-derived v e c t o r s c o u l d be expanded by r e p l a c i n g BPV promoters and other r e g u l a t o r y elements with e q u i v a l e n t elements t h a t can f u n c t i o n i n d i v e r s e c e l l types. T r a n s f e c t i o n with PN and CGBPV v e c t o r s r e s u l t e d i n about the same number of c e l l l i n e s with e f f i c i e n t l y t r a n s c r i b e d 1 38 vector-borne genes. CGBPV v e c t o r s produced the most t r a n s c r i p t s , due to t h e i r higher copy numbers. T h e r e f o r e , CGBPV v e c t o r s are w e l l suited- f o r s t u d i e s i n which l a r g e amounts of the products of t r a n s c r i p t i o n (RNA or p r o t e i n s ) must be analysed or produced. PN v e c t o r s are more s u i t a b l e f o r s t u d i e s on the a c t u a l processes of t r a n s c r i p t i o n , which c o u l d be a f f e c t e d by high copy number or l i n k a g e to v i r a l t r a n s c r i p t i o n c o n t r o l sequences. 1 39 V. REFERENCES 1. Ashburner, M. , and J . J . Bonner. 1979. C e l l _T7_: 241-254. 2. Nover, L. 1984. Heat Shock Response of E u k a r y o t i c C e l l s . S p r i n g e r V e r l a g . New York. 3. A t k i n s o n , B. G., and D. B. Walden. 1985. Changes i n  E u k a r y o t i c Gene E x p r e s s i o n i n Response to Environmental  S t r e s s . Academic P r e s s . Orlando. 4. C r a i g , E. A. 1985. C r i t . Rev. Biochem. J_8: 239-280. 5. T i s s i e r e s , A., H. K. M i t c h e l l , and V. M. T r a c y . 1974. J . Mol. B i o l . 84j_ 389-398. 6. Lewis, M., P. J . Helmsing, and M. Ashburner. 1975. Proc. N a t l . Acad. S c i . U.S.A. 72j_ 3604-3608. 7. L i n d q u i s t , S. 1980. Dev. B i o l . 77: 463-479. 8. Holmgren, R., K. L i v a k , R. Morimoto, R. Freund, and M. Meselson. 1979. C e l l 18: 1359-1370. 9. Holmgren, R., V. Corces, R. Morimoto, R. Blackman, and M. Meselson. 1981. Proc. N a t l . Acad. S c i . U.S.A. 78: 3775-3778. 10. Hackett, R. W., and J . T. L i s . 1983. N u c l e i c A c i d s Res. 11: 7011-7030. 11. Ish-Horowicz, D., S. M. Pinchen, P. Sch e d l , S. A r t a v a n i s -Tsakonas, and M.-E. M i r a u l t . 1979. C e l l 18: 1351-1358. 12. Goldschmidt-Clermont, M. 1980. N u c l e i c A c i d s Res. 8j_ 235-252. 13. I n g o l i a , T. D., E. A. C r a i g , and B. J . McCarthy. 1980. C e l l 21: 669-679. 14. Torok, I., and F. Karch. 1980. N u c l e i c A c i d s Res. 8j_ 3105-31 23. 15. Karch, F., I. Torok, and A. T i s s i e r e s . 1981. J . Mol. B i o l . 148: 219-230. 16. C r a i g , E. A., and B. J . McCarthy. 1980. N u c l e i c A c i d s Res. 8j_ 4441-4457. 17. Corces, V., R. Holmgren, R. Freund, R. Morimoto, and M. Meselson. 1980. Proc. N a t l . Acad. S c i . U.S.A. 77: 5390-5393. 1 40 18. Voellmy, R., M. Goldschmidt-Clermont, R. Southgate, A. T i s s i e r e s , R. L e v i s , and W. J . Gehring. 1981. C e l l 23: 261-270. 19. Southgate, R., A. Ayme, and R. Voellmy. 1983. J . Mol. B i o l . 165: 35-57. 20. Ayme, A., and A. T i s s i e r e s . 1985. EMBO J . 4j_ 2949-2954. 21. S i r o t k i n , K., and N. Davidson. 1982. Dev. B i o l . 89: 196-210. 22. McKenzie, S. L., S. H e n i k o f f , and M. Meselson. 1975. Proc. N a t l . Acad. S c i . U.S.A. 72: 1117-1121. 23. S p r a d l i n g , A., S. Penman, and M. L. Pardue. 1975. C e l l 4: 395-407. 24. S p r a d l i n g , A., M. L. Pardue, and S. Penman. 1977. J . Mol. B i o l . 109: 559-587. 25. O'Connor, D., and J . T. L i s . 1981. N u c l e i c A c i d s Res. 9: 5075-5092. 26. F i n d l y , R. C , and T. Pederson. 1981. J . C e l l B i o l . 88: 323-328. 27. L i n d q u i s t , S. 1980. J . Mol. B i o l . 137: 151-158. 28. V i t e k , M. P., and E. M. Berger. 1984. J . Mol. B i o l . 178: 173-189. 29. DiDomenico, B. J . , G. E. Bugaisky, and S. L i n d q u i s t . 1982. C e l l 31: 593-603. 30. McKenzie, S. L., and M. Meselson. 1977. J . Mol. B i o l . 117: 279-283. 31. S t o r t i , R. V., M. P. S c o t t , A. Ric h , and M. L. Pardue. 1980. C e l l 22: 825-834. 32. L i n d q u i s t , S. 1981. Nature 293: 311-314. 33. S c o t t , M. P., and M. L. Pardue. 1981. Proc. N a t l . Acad. S c i . U.S.A. 78: 3353-3357. 34. Kruger, C , and B.-J. Benecke. 1981. C e l l 23j_ 595-603. 141 35. B a l l i n g e r , D. G., and M. L. Pardue. 1983. C e l l 33: 103-114. 36. Sanders, M. M., D. F. Treimer, and A. S. O l s e n . 1986. J . B i o l . Chem. 261: 2189-2196. 37. McGarry, T. S., and S. L i n d q u i s t . 1985. C e l l 42j_ 903-911. 38. Hultmark, D., R. Klemenz, and W. J . Gehring. 1986. C e l l 44: 429-438. 39. DiDomenico, B. J . , G. E. Bugaisky, and S. L i n d q u i s t . 1982. Proc. N a t l . Acad. S c i . U.S.A. 79j_ 6181-6185. 40. Chomyn, E. M., G. M o l l e r , and H. K. M i t c h e l l . 1979. Dev. Genet. U_ 77-95. 41. Zimmerman, J . L., W. P e t r i , and M. Meselson. 1983. C e l l 32: 1161-1170. 42. I r e l a n d , R. C , E. Berger, K. S i r o t k i n , M. A. Yund, D. Osterbur, and J . F r i s t o n . 1982. Dev. B i o l . 93: 498-507. 43. I r e l a n d , R. C , and E. M. Berger. 1982. Proc. N a t l . Acad. S c i . U.S.A. 79_L 855-859. 44. Cheney, C. M., and A. Shearn. 1983. Dev. B i o l . 95: 325-330. 45. Buzin, C. H., and N. B o u r n i a s - V a r d i a b a s i s . 1982. p 387-394, in Heat Shock from B a c t e r i a to Man. M. J . S c h l e s i n g e r , M. Ashburner, and A. T i s s i e r e s ( e d s ) . C o l d S p r i n g Harbor L a b o r a t o r i e s . C o l d S p r i n g Harbor. New York. 46. I n g o l i a , T. D., and E. A. C r a i g . 1982. Proc. N a t l . Acad. S c i . U.S.A. 79_1 525-529. 47. C r a i g , E. A., T. D. I n g o l i a , and L. J . Manseau. 1983. Dev. B i o l . 99j_ 418-426. 48. Leigh-Brown, A. J . , and D. Ish-Horowicz. 1981. Nature 290: 677-682. 49. I n g o l i a , T. D., and E. A. C r a i g . 1981. N u c l e i c A c i d s Res. 9j_ 1627-1642. 50. Breathnach, R., and P. Chambon. 1981. Ann. Rev. Biochem. 50: 349-383. 51. Graham, F. L., and A. J . van der Eb. 1973. V i r o l o g y 52: 456-467. 1 42 52. W i g l e r , M., A. P e l l i c e r , S. S i l v e r s t e i n , and R. A x e l . 1978. C e l l 14: 725-731. 53. P e l l i c e r , A., D. Robins, B. Wold, R. Sweet, J . Jackson, I. Lowy, J . M. Roberts, G. K. Sim, S. S i l v e r s t e i n , and R. A x e l . 1980. Science 209: 1414-1422. 54. Gorman, C. M., L. F. Mo f f a t , and B. H. Howard. 1982. Mol. C e l l . B i o l . 2j_ 1044-1051 . 55. Lopata, M. A., D. W. C l e v e l a n d , and B. Sollner-Webb. 1984. N u c l e i c A c i d s Res. 12: 5707-5717. 56. Corces, V., A. P e l l i c e r , R. A x e l , and M. Meselson. 1981. Proc. N a t l . Acad. S c i . U.S.A. 78: 7038-7042. 57. Burke, J . F., and D. Ish-Horowicz. 1982. N u c l e i c A c i d s Res. 10: 3821-3830. 58. Gluzman, Y. 1982. E u k a r y o t i c V i r a l V e c t o r s . C o l d S p r i n g Harbor L a b o r a t o r y . C o l d S p r i n g Harbor. New York. 59. Gluzman, Y. 1981. C e l l 23j_ 175-182. 60. M e l l o n , P., V. Parker, Y. Gluzman, and T. M a n i a t i s . 1981. C e l l 27: 279-288. 61. M i r a u l t , M.-E., R. Southgate, and E. Delward. 1982. EMBO J . U_ 1279-1285. 62. Pelham, H. R. B. 1982. C e l l 30: 517-528. 63. Bienz, M. 1985. Trends B i o l . S c i . 10: 157-161. 64. Hoffman, E., and V. Corces. 1986. Mol. C e l l . B i o l . 6j_ 663-673. 65. Pelham, H. R. B., and M. Bienz. 1982. EMBO J . Jj_ 1473-1477. 66. Voellmy, R., and D. Rungger. 1982. Proc. N a t l . Acad. S c i . U.S.A. 79: 1776-1780. 67. Bienz, M., and H. R. B. Pelham. 1982. EMBO J . U_ 1583-1588. 68. Ayme, A., R. Southgate, and A. T i s s i e r e s . 1985. J . Mol. B i o l . 182: 469-475. 143 69. Cohen, R. S., and M. Meselson. 1985. C e l l 43: 737-746. 70. M e s t r i l , R., D. Rungger, P. S c h i l l e r , and R. Voellmy. 1985. EMBO J . _4_l 2971-2976. 71. Di Nocera, P. P., and I. B. Dawid. 1983. Proc. N a t l . Acad. S c i . U.S.A. 80: 7095-7098. 72. Amin, J . , R. M e s t r i l , R. Lawson, H. Klapper, and R. Voellmy. 1985. Mol. C e l l . B i o l . 5± 197-203. 73. Engels, W. R. 1983. Ann. Rev. Genet. V7j_ 315-344. 74. Rubin, G. M., and A. C. S p r a d l i n g . 1982. Science 218: 348-353. 75. Rubin, G. M., and A. C. S p r a d l i n g . 1983. N u c l e i c A c i d s Res. 11: 6341-6351. 76. L i s , J . T., J . A. Simon, and C. A. Sutton. 1983. C e l l 35: 403-410. 77. Cohen, R. S., and M. Meselson. 1984. Proc. N a t l . Acad. S c i . U.S.A. 81: 5509-5513. 78. Dudler, R., and A. T r a v e r s . 1984. C e l l 38: 391-398. 79. Simon, J . A., C. A. Sutton, R. B. L o b e l l , R. L. G l a z e r , and J . T. L i s . 1985. C e l l 40: 805-817. 80. M o r g a n e l l i , C. M., E. M. Berger, and H. R. B. Pelham. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82: 5865-5869. 81. Hoffman, E. P., and V. Corces. 1984. Mol. C e l l . B i o l . 4: 2883-2889. 82. Parker, C. S., and J . T o p o l . 1984. C e l l 36: 357-369. 83. Parker, C. S., and J . T o p o l . 1984. C e l l 37: 273-283. 84. Topol, J . , D. M. Ruden, and C. S. Parker. 1985. C e l l 42: 527-537. 85. Wu, C. 1984. Nature 309: 229-234. 1 44 86. Wu, C. 1984. Nature 311; 81-84. 87. Pelham, H. 1985. Trends Genet. U_ 31-35. 88. B e n y a j a t i , C , N. S p o e r e l , H. Haymerle, and M. Ashburner. 1983. C e l l 33: 125-133. 89. H e b e r l e i n , U., B. England, and R. T j i a n . 1985. C e l l 41 :, 965-977. 90. B e n y a j a t i , C , and J . F. Dray. 1984. Proc. N a t l . Acad. S c i . U.S.A. 81: 1701-1705. 91. Hen, R., P. Sa s s o n e - C o r s i , J . Corden, M. P. Gaub, and P. Chambon. 1982. Proc. N a t l . Acad. S c i . U.S.A. 79: 7132-7136. 92. Jove, R., and J . L. Manley. 1984. J . B i o l . Chem. 259: 8513-8521 . 93. Yu, Y.-T., and J . L. Manley. 1984. N u c l e i c A c i d s Res. 12: 9309-9321 . 94. Miyamoto, N. G., V. M o n c o l l i n , M. W i n t z e r i t h , J . M. E g l y , and P. Chambon. 1984. N u c l e i c A c i d s Res. 12: 8779-8799. 95. Carthew, R. W., L. A. Chodosh, and P. A. Sharp. 1985. C e l l 43: 439-448. 96. Sawadogo, M., and R. G. Roeder. 1986. C e l l 43: 165-175. 97. Dynan, W. S., and R. T j i a n . 1983. C e l l 32: 669-680. 98. Davison, B. L., J . M. E g l y , E. R. M u l v i h i l l , and P. Chambon. 1983. Nature 301: 680-686. 99. G i d o n i , D., J . T. Kadonaga, H. Ba r r e r a - S a l d a n a , K. Takahashi, P. Chambon, and R. T j i a n . 1985. Science 230: 511-517. 100. Dynan, W. S., J . D. S a f f e r , W. S. Lee, and R. T j i a n . 1985. Proc. N a t l . Acad. S c i . U.S.A. 82: 4915-4919. 101. Jones, K. A., K. R. Yamamoto, and R. T j i a n . 1985. C e l l 42: 559-572. 102. Jones, K. A., and R. T j i a n . 1985. Nature 317: 179-182. 1 45 103. Dynan, W. S., S. Sazer, R. T j i a n , and R. T. Schimke. 1986. Nature 319: 246-248. 104. G i d o n i , D., W. S. Dynan, and R. T j i a n . 1984. Nature 312: 409-418. 105. Myers, R. M., D. C. Rio, A. K. Robbins, and R. T j i a n . 1981. C e l l 25: 373-384. 106. B e n o i s t , C , and P. Chambon. 1981. Nature 290: 304-310. 107. Lebowitz, P., and P. K. Ghosh. 1982. J . V i r o l . 41: 449-461. 108. Fromm, M., and P. Berg. 1982. J . Mol. Appl. Genet. U_ 452-481 . 109. McKnight, S. L., E. R. G r a v i s , R. Kingsbury, and R. A x e l . 1981. C e l l 25: 385-398. 110. McKnight, S. L. 1982. C e l l 3Jj_ 355-365. 111. McKnight, S. L., and R. Kingsbury. 1982. Science 217: 316-324. 112. McKnight, S. L., R. C. Kingsbury, A. Spence, and M. Smith. 1984. C e l l 37: 253-262. 113. E i s e n b e r g , S. P., D. M. Coen, and S. L. McKnight. 1985. Mol. C e l l . B i o l . 5j_ 1940-1947. 114. E l Karch, A., A. J . M. Murphy, T. F i c h t e r , A. E f s t r a t i a d i s , and S. S i l v e r s t e i n . 1985. Proc. N a t l . Acad. S c i . U.S.A. 82: 1002-1006. 115. Barr e r a - S a l d a n a , H., K. Takahashi, M. Vigneron, A. Wildeman, I. Davidson, and P. Chambon. 1985. EMBO J . 4: 3839-3849. 116. Takahashi, K., M. Vigneron, H. Matthes, A. Wildeman, M. Zenke, and P. Chambon. 1986. Nature 319: 121-126. 117. Osbourne, T. F., J . L. G o l d s t e i n , and M. S. Brown. 1985. C e l l 42: 203-212. 118. Dush, M. K., J . M. S i k e l a , S. A. Khan, J . A. T i s c h f i e l d , and P. J . Stambrook. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82: 2731-2735. 119. Melton D. W., D. S. Konecki, J . Brennand, and C. T. Caskey. 1984. Proc. N a t l . Acad. S c i . U.S.A. 81: 2147-2151. 1 46 120. V a l e r i o , D., M. G. C. Duyvesteyn, B. M. M. Dekker, G. Weeda, T. M. Berkvens, L. van der Voorn, H. van Ormondt, and A. J . van der Eb. 1985. EMBO J . 4j_ 437-443. 121. Khono, K., M. S u l l i v a n , and Y. Yamada. 1985. J . B i o l . Chem. 260: 4441-4447. 122. Ri c h a r d s , R. I., A. Hegvy, and M. K a r i n . 1984. C e l l 37: 263-272. 123. R i c c i o , A., G. G r i m a l d i , P. V e r d i , G. S e b a s t i o , S. Boast, and F. B l a s i . 1985. N u c l e i c A c i d s Res. 13: 2759-2771. 124. E f s t r a t i a d i s , A., J . W. Posakony, T. M a n i a t i s , R. M. Lawn, C. O'Connell, R. A. S p r i t z , J . K. d e R i e l , B. G. For g e t , S. W. Weissman, J . L. Slightom, A. E. B l e c h l , 0. Sm i t h i e s , F. E. B a r a l l e , C. C. Shoulders, and N. J . Proudfoot. 1980. C e l l 21: 653-658. 125. B e n o i s t , C , K. O'Hare, R. Breathnach, and P. Chambon. 1980. N u c l e i c A c i d s Res. 8j_ 127-142. 126. G r o s v e l d , G. C , E. de Boer, C. K. Shewmaker, and R. A. F l a v e l l . 1982. Nature 295: 120-126. 127. D i e r k s , P., A. van Ooyen, M. D. Cochran, J . R e i s e r , and C. Weissman. 1983. C e l l 32: 695-706. 128. Charnay, P., P. Mellon, and T. M a n i a t i s . 1985. Mol. C e l l . B i o l . 5j_ 1 498-1 51 1 . 129. Reeves, R. 1984. Biochim. Biophys. A c t a . 782: 343-393. 130. E i s s e n b e r g , J . C , I. L. C a r t w r i g h t , G. H. Thomas, and S. C. R. E l g i n . 1985. Ann. Rev. Genet. 19: 485-536. 131. R o c c h e r i , M. C , M. G. diBernardo, and G. G i u d i c e . 1981. Dev. B i o l . 83: 173-177. 132. Bensaude, O., and M. Morange. 1983. EMBO J . 2j_ 173-177. 133. Bensaude, 0., C. Babnel, M. Morange, and F. Jacob. 1983. Nature 305: 331-332. 134. W i t t i g , S., S. Hensse, C. K e i t e l , C. E i s n e r , and B. W i t t i g . 1983. Dev. B i o l . 96: 507-514. 135. Bienz, M., and J . B. Gurdon. 1982. C e l l 29: 811-819. 136. Bienz, M. 1984. Proc. N a t l . Acad. S c i . U.S.A. 8U_ 3138-31 42. 147 137. I n g o l i a , T. D., M. J . S l a t e r , and E. A. C r a i g . 1982. Mol. C e l l . B i o l . 2j_ 1388-1398. 138. Ellwood, M. S., and E. A. C r a i g . 1984. Mol. C e l l . B i o l . 4j_ 1454-1459. 139. Loomis, W. F., and S. A. Wheeler. 1980. Dev. B i o l . 79: 399-408. 140. Zuker, C , J . C a p p e l l o , R. L. Chisholm, and H. F. L o d i s h . 1983. C e l l 3_4_i 997-1005. 141. Lowe, D. G., and L. A. Moran. 1984. Proc. N a t l . Acad. S c i . U.S.A. 8_l2 231 7-2321 . 142. Lowe, D. G., and L. A. Moran. 1986. J . B i o l . Chem. 261: 2102-2112. 143. Wu, B. J . , and R. I. Morimoto. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82j_ 6070-6077. 144. Spena, A., R. Hain, U. Z i e r v o g e l , H. S a e d l e r , and J . S c h e l l . 1985. EMBO J . 4^ 2739-2743. 145. F a r r e l l y , F. W., and D. B. F i n k e l s t e i n . 1984. J . B i o l . Chem. 259; 25745-25751. 146. C a p p e l l o , J . , C. Zuker, and H. L o d i s h . 1984. Mol. C e l l . B i o l . 4j_ 591-598. 147. Russnak, R. H., and E. P. M. Candido. 1985. Mol. C e l l . B i o l . 5_£ 1268-1278. 148. Bienz, M. 1984. EMBO J . 3j_ 2477-2483. 149. Voellmy, R., A. Ahmed, P. S c h i l l e r , P. Bromley, and D. Rungger. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82j_ 4949-4953. 150. Wu, B. J . , R. E. King s t o n , and R. I. Morimoto. 1986. Proc. N a t l . Acad. S c i . U.S.A. 83; 629-633. 151. S c h o f f l , F., E. Raschke, and R. T. Nagao. 1984. EMBO J . 3; 2491-2497. 152. Czarnecka, E., W. B. Gurle y , R. T. Nagao, L. Mosquera, and J . L. Key. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82; 3726-3730. 153. F i n k e l s t e i n , D. B., and S. St r a u s b e r g . 1983. Mol. C e l l . B i o l . 3: 1625-1633. 1 48 154. F i n k e l s t e i n , D. B., and S. St r a u s b e r g . 1983. J . B i o l . Chem. 258: 1908-1913. 155. Wu, B., C. Hunt, and R. Morimoto. 1985. Mol. C e l l . B i o l . 5: 330-341. 156. S c h o f f l , F., and G. Baumann. 1985. EMBO J . 4^ 1119-1124. 157. G u r l e y , W. B., E. Czarnecka, R. T. Nagao, and J . L. Key. 1986. Mol. C e l l . B i o l . 6j_ 559-565. 158. S t e r n b e r g , P. W., and H. R. H o r v i t z . 1984. Ann. Rev. Genet. 18: 489-524. 159. Marx, J . L. 1984. Science 225: 40-42. 160. Lewin, R. 1984. Science 224: 1327-1329. 161. Snutch, T. P., and D. L. B a i l l i e . 1983. Can. J . Biochem. C e l l B i o l . 61: 480-487. 162. Russnak, R. H., D. Jones, and E. P. M. Candido. 1983. N u c l e i c A c i d s Res. 11: 3187-3205. 163. Snutch, T. P., and D. L. B a i l l i e . 1984. Mol. Gen. Genet. 195: 329-335. 164. Breathnach, R., C. Ben o i s t , K. O'Hare, F. Gannon, and P. Chambon. 1978. Proc. N a t l . Acad. S c i . U.S.A. 75: 4853-4857. 165. Mount, S. M. 1982. N u c l e i c A c i d s Res. 10: 459-472. 166. Proudfoot, N. J . , and G. G. Brownlee. 1976. Nature 263: 211-214. 167. B i r n s t i e l , M. L., M. B u s s l i n g e r , and K. Stru b . 1985. C e l l 41: 349-359. 168. Hayes, T. E., and J . E. Dixon.1985. J . B i o l . Chem. 260: 8145-8162. 169. K a r i n , M., A. H a s l i n g e r , H. H o l t g r e v e , R. I. R i c h a r d s , P. Krautner, H. M. Westphal, and M. Beato. 1984. Nature 308: 513-519. 170. Smith, M., D. W. Leung, S. G i l l a m , C. R. A s t e l l , D. L. Montgomery, and B. D. H a l l . 1979. C e l l 16: 753-761. 1 49 171. Nordheim, A., and A. R i c h . 1983. Nature 303: 674-679. 172. R i c h , A., A. Nordheim, and A. H.-J. Wang. Ann. Rev. Biochem. 53: 791-846. 173. Stinchcomb, D. T. 1985. Mol. C e l l . B i o l . 5j_ 3484-3496. 174. S c h o l e r , H. R., and P. Gruss. 1984. C e l l 36: 403-411. 175. S a s s o n e - C o r s i , P., A. Wildeman, and P. Chambon. 1985. Nature 313: 458-463. 176. Chen, E. Y., P. M. Howley, A. D. Levinson, and P. H. Seeburg. 1983. Nature 293: 529-534. 177. L a n c a s t e r , W. D., and C. Olson. 1978. V i r o l o g y 89: 372-379. 178. Law, M.-F., D. R. Lowy, I. Dvoretzky, and P. M. Howley. 1981. Proc. N a t l . Acad. S c i . U.S.A. 78: 2727-2731. • 179. Sarver, N., M. S. Rabson, Y.-C. Yang, J . C. Byrne, and P. M. Howley. 1984. J . V i r o l . 52j_ 377-388. 180. Yang, Y.-C, H. Okayama, and P. M. Howley. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82: 1030-1034. 181. DiMiao, D. 1986. J . V i r o l . 57: 475-480. 182. S c h i l l e r , J . T., W. C. Vass, K. H. Vousden, and D. R. Lowy. 1986. J . V i r o l . 57: 1-6. 183. Lusky, M. , and M. R. Botchan. 1984. C e l l 36j_ 391-401. 184. Lusky, M. , and M. R. Botchan. 1985. J . V i r o l . 53j_ 955-965. 185. Sa r v e r , N., J . C. Byrne, and P. M. Howley. 1982. Proc. N a t l . Acad. S c i . U.S.A. 79: 7147-7151. 186. DiMiao, D., R. Treisman, and T. M a n i a t i s . 1982. Proc. N a t l . Acad. S c i . U.S.A. 79: 4030-4034. 187. Howley, P. M., N. Sarver, and M.-F. Law. 1983. Methods Enzymol. 101: 387-402. 1 50 188. Law, M.-F., J . C. Byrne, and P. M. Howley. 1983. Mol. C e l l . B i o l . 3j_ 21 10-21 15. 189. M a t t h i a s , P. D., H. U. Bernard, A. S c o t t , G. Brady, T. Hashimoto-Gotoh, and G. Schutz. 1983. EMBO J . 2j_ 1487-1492. 190. S e k i g u c h i , T., T. Nishimoto, R. K a i , and M. S e k i g u c h i . 1983. Gene 21: 267-272. 191. C o l b e r e - G a r a p i n , F., F. Horodniceanu, P. K o u r i l s k y , and A.-C. Garapin. 1981. J . Mol. B i o l . 150: 1-14. 192. Sambrook, J . , L. Rodgers, J . White, and M. J . Gething. 1985. EMBO J . 4j_ 91-103. 193. Ei d e n , M., M. Newman, A. G. F i s h e r , D. L. Mann, P. M. Howley, and M. S. R e i t z . 1985. Mol. C e l l . B i o l . 5j_ 3320-3324. 194. DiMiao, D., V. C o r b i n , E. S i b l i n g , and T. M a n i a t i s . 1984. Mol. C e l l . B i o l . 4j_ 340-350. 195. Sarver, N., R. Muschel, J . C. Byrne, G. Khoury, and P. M. Howley. 1985. Mol. C e l l . B i o l . 5j_ 3507-3516. 196. Schenborn, E. T., E. L i n d , J . L. Mitchen, and J . E. Dahlberg. 1985. Mol. C e l l . B i o l . 5j_ 1318-1326. 197. P a v l a k i s , G. N., and D. H. Hamer. 1983. Proc. N a t l . Acad. S c i . U.S.A. 80: 397-401 . 198. K a r i n , M., G. C a t h a l a , and M. C. Nguyen-Huu. 1983. Proc. N a t l . Acad. S c i . U.S.A. 80: 4040-4044. 199. Ostrowski, M.. C , H. Richard-Foy, R. G. Wolford, D. S. Berard, and G. L. Hager. 1983. Mol. C e l l . B i o l . 3j_ 2045-2057. 200. Mitrani-Rosenbaum, S., L. Maroteaux, Y. Mory, M. Revel, and P. M. Howley. 1983. Mol. C e l l . B i o l . 3j_ 233-240. 201. Zinn, K., D. DiMiao, and T. M a n i a t i s . 1983. C e l l 34: 865-879. 202. Goodbourn, S., K. Zinn, and T. M a n i a t i s . 1985. C e l l 41 : 509-520. 203. Maroteaux, L., C. Kahana, Y. Mory, Y. Groner, and M. Revel. 1983. EMBO J . 2j_ 325-332. 204. Lusky, M., L. Berg, H. Weiher, and M. R. Botchan. 1983. Mol. C e l l . B i o l . 3: 1108-1122. 151 205. S p a l h o l z , B. A., Y.-C. Yang, and P. M. Howley. 1985. C e l l 42: 183-191. 206. Khoury, G., and P. Gruss. 1983. C e l l 33j_ 313-314. 207. S e r f l i n g , E., M. J a s i n , and W. S c h a f f n e r . 1985. Trends Genet. j j _ 224-230. 208. R o s l , F., W. Waldeck, and G. Sauer. 1983. J . V i r o l . 46: 567-574. 209. M a n i a t i s , T., E. F. F r i t s c h , and J . Sambrook. 1982. M o l e c u l a r C l o n i n g . C o l d S p r i n g Harbor L a b o r a t o r y . C o l d S p r i n g Harbor, New York. 210. Birnboim, H. C , and J . Doly. 1979. N u c l e i c A c i d s Res. 7: 1513-1523 211. V i e i r a , J . , and J . Messing. 1982. Gene 19: 259-268 212. Messing, J . 1983. Meth. Enzymol. 101: 20-78 213. Sanger, F., S. N i c k l e n , and A. R. Coulson. 1977. Proc. N a t l . Acad. S c i . U.S.A. 74: 5463-5467 214. B i g g i n , M. D., T. J . Gibson, and G. F. Hong. 1983. Proc. N a t l . Acad. S c i . U.S.A. 80: 3963-3965. 215. Dulbecco, R., and G. Freeman. 1959. V i r o l o g y 8: 396-412 216. A n t o n u c c i , T. K. 1985. Recombinant DNA Techniques. 6: 22-24 217. Reed, K. C , and D. A. Mann. 1985. Proc. N a t l . Acad. S c i . U.S.A. J_3: 7207-7221 218. Rigby, P. W. J . , M. Dieckmann, C. Rhodes, and P. Berg. 1977. J . Mol. B i o l . 113: 237-251 219. Singh, L., and K. W. Jones. 1984. N u c l e i c A c i d s Res. 12: 5627-5637. 220. Lewin, B. 1974. Gene E x p r e s s i o n . John Wiley and Sons. London. 221. Brandhorst, B. P., and E. H. McConkey. 1974. J . Mol. B i o l . 85: 451-563 1 52 222. L i , G. C , D. C. Sh r i e v e , and Z. Webb. 1982. p 395-404, i n Heat Shock from B a c t e r i a to Man. M. J . S c h l e s i n g e r , M. Ashburner, and A. T i s s i e r e s ( e d s . ) . C o l d S p r i n g Harbor Laborat o r y . Cold S p r i n g Harbor. New York. 223. McKnight, S. L. 1980. N u c l e i c A c i d s Res. 8: 5949-5964. 224. F o l g e r , K. R., E. A. Wong, G. Wahl, and M. R. Capecchi. 1982. Mol. C e l l . B i o l . 2: 1372-1387. 225. Zur Hausen, H. 1981. p 747-795, i n DNA Tumor V i r u s e s . J . Tooze (e d . ) . C o l d S p r i n g Harbor L a b o r a t o r y . C o l d S p r i n g Harbor. New York. 226. Sudgen, B. 1982. Rev. I n f e c t . D i s . 4: 1048-1060. 227. Sudgen, B., K. Marsh, and J . Yates. 1985. Mol. C e l l . B i o l . 5: 410-413. 228. Ashman, C. R., and R. L. Davidson. 1985. Somatic C e l l and Mol. G e n e t i c s . JM: 499-504. 229. Reeves, R., C. M. Gorman, and B. Howard. 1985. N u c l e i c A c i d s Res. J_3: 3599-3615. 230. Z e i t l i n , S., and A. E f s t r a t i a d i s . 1984. C e l l 39: 589-602. 231. Konarska, M. M., P. J . Grabowski, R. A. Padgett, and P. A. Sharp. 1985. Nature 313: 552-557. 232. K e l l e r , W. 1984. C e l l 39: 423-425. 233. Ruskin, B., A. R. Kraimer, T. M a n i a t i s , and M. R. Green. 1984. C e l l 38: 317-331. 234. Ruskin, B., J . M. Greene, and M. R. Green. 1985. C e l l 41 : 833-844. 235. Padgett, R. A., M. M. Konarska, M. A e b i , H. Hornig, C. Weissman, and P. A. Sharp. 1985. Proc. N a t l . Acad. S c i . U.S.A. 82: 8349-8353. 236. O r k i n , S. H., H. H. K a z a r i n , S. E. A n t o n a r a k i s , H. O s t r e r , S. C. Gott, and J . Sexton. Nature 300: 768-769. 237. Mount, S. M., I. P e t t e r s s o n , M. H i n t e r b e r g e r , A. Karmas, and J . A. S t e i t z . 1983. C e l l 33: 509-518. 1 53 238. Weiringa, B., E. Hofer, and C. Weissman. 1984. C e l l 37: 915-925. 239. U l f e n d a h l , P. J . , U. P e t t e r s s o n , and G. A k u s j a r v i . 1985. N u c l e i c A c i d s Res. J_3: 6299-6315. 240. S t e l l e r , H., and V. P i r r o t t a . 1985. EMBO J . 4: 3765-3772. 241. F i t z g e r a l d , M., and T. Shenk. 1981. C e l l 2A: 251-260. 242. M o n t e l l , C , E. F. F i s h e r , M. H. Caruthers, and A. J . Berk. 1983. Nature 305: 600-605. 243. G i l , A., and N. J . Proudfoot. 1984. Nature 312: 473-474. 244. Sadofsky, M., and J . C. Alwine. 1984. Mol. C e l l . B i o l . 4: 1460-1468. 245. Woychik, R. P., R. H. Lyons, L. Post, and T. Rottman. 1984. Proc. N a t l . Acad. S c i . U.S.A. 8J_: 3944-3948. 246. McDevitt, M. A., M. J . Imperiale, H. A l i , and J . R. Nevins. 1984. C e l l 37: 993-999. 247. C o l e , N., and T. P. Stacy. 1985. Mol. C e l l . B i o l . 5: 2104-2113. 248. Hart, R. P., M. A. McDevitt, and J . R. Nevins. 1985. C e l l 43: 677-683. 249. McLauchlan, J . , D. G a f f r e y , J . L. Whitton, and J . B. Clements. 1985. N u c l e i c A c i d s Res. J_3: 1347-1368. 250. Nevins, J . R., and J . E. D a r n e l l . 1978. C e l l 15: 1477-1493. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0097290/manifest

Comment

Related Items