UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Pyridine nucleotide transhydrogenase of Escherichia coli: nucleotide sequence of the pnt gene and characterization.. Clarke, David Morgan 1986

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
UBC_1986_A1 C62.pdf [ 10.31MB ]
Metadata
JSON: 1.0097196.json
JSON-LD: 1.0097196+ld.json
RDF/XML (Pretty): 1.0097196.xml
RDF/JSON: 1.0097196+rdf.json
Turtle: 1.0097196+rdf-turtle.txt
N-Triples: 1.0097196+rdf-ntriples.txt
Original Record: 1.0097196 +original-record.json
Full Text
1.0097196.txt
Citation
1.0097196.ris

Full Text

PYRIDINE NUCLEOTIDE TRANSHYDROGENASE OF E s c h e r i c h i a NUCLEOTIDE SEQUENCE OF THE pnt_ GENE AND CHARACTERIZATION OF THE ENZYME COMPLEX  by DAVID MORGAN CLARKE M.Sc,  McMaster U n i v e r s i t y , 1980  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE  REQUIREMENTS FOR THE DEGREE OF DOCTORATE OF PHILOSOPHY  in THE  FACULTY OF GRADUATE STUDIES  DEPARTMENT OF BIOCHEMISTRY  We a c c e p t t h i s t h e s i s as conforming t o the r e q u i r e d  THE  standard.  UNIVERSITY OF BRITISH COLUMBIA F e b r u a r y 1986  copyright  by David C l a r k e , 1986  8  In  presenting  requirements  this thesis  British  it  freely available  for  Columbia,  I agree that f o r reference  permission  scholarly  f u l f i l m e n t of the  f o r an a d v a n c e d d e g r e e a t t h e U n i v e r s i t y  of  agree t h a t  in partial  the Library  shall  and s t u d y .  I  f o r extensive  for  that  copying or p u b l i c a t i o n  f i n a n c i a l gain  shall  Department  of  jSsfypLe.Mt&'tr f-  The U n i v e r s i t y o f B r i t i s h 2075 Wesbrook P l a c e Vancouver, Canada V6T 1W5  Date  79)  of this  I ti s thesis  n o t be a l l o w e d w i t h o u t my  permission.  Columbia  thesis  by t h e h e a d o f my  d e p a r t m e n t o r by h i s o r h e r r e p r e s e n t a t i v e s . understood  further  copying of t h i s  p u r p o s e s may be g r a n t e d  make  written  ABSTRACT  Based on the r a t i o n a l e t h a t E s c h e r i c h i a c o l i  c e l l s harboring plasmids  c o n t a i n i n g the pnt gene would c o n t a i n e l e v a t e d l e v e l s o f enzyme, t h r e e c l o n e s were i s o l a t e d b e a r i n g the transhydrogenase gene from the C l a r k e and Carbon c o l o n y bank.  The t h r e e plasmids were s u b j e c t e d t o r e s t r i c t i o n  endonuclease a n a l y s i s .  A 10.4-kilobase r e s t r i c t i o n  fragment  o v e r l a p p e d a l l t h r e e plasmids was c l o n e d i n t o pUC13.  which  Examination o f  s e v e r a l d e l e t i o n d e r i v a t i v e s o f the r e s u l t i n g p l a s m i d s and subsequent treatment w i t h exonuclease BAL31 r e v e a l e d that enhanced  transhydrogenase  e x p r e s s i o n was l o c a l i z e d w i t h i n a 3.05-kilobase segment. l o c a t e d a t 35.4 min i n the E_. c o l i genome.  T h i s segment was  Plasmid pDC21 c o n f e r r e d on i t s  h o s t 7 0 - f o l d o v e r p r o d u c t i o n o f transhydrogenase.  The p r o t e i n p r o d u c t s o f  plasmids c a r r y i n g the pnt gene were examined by sodium d o d e c y l s u l f a t e - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f membranes  from  cells  c o n t a i n i n g the plasmids and by i n v i t r o t r a n s c r i p t i o n / t r a n s l a t i o n o f pDC21.  Two p o l y p e p t i d e s o f m o l e c u l a r weights 52,000 and 48,000 were coded  by the 3 . 0 5 - k i l o b a s e fragment for  o f pDC21.  e x p r e s s i o n o f transhydrogenase  Both p o l y p e p t i d e s were r e q u i r e d  activity.  The transhydrogenase was p u r i f i e d  from c y t o p l a s m i c membranes o f E_.  c o l i by p r e - e x t r a c t i o n o f the membranes w i t h sodium c h o l a t e and T r i t o n X-100, s o l u b i l i z a t i o n o f the enzyme w i t h sodium d e o x y c h o l a t e i n the presence o f 1 M potassium c h l o r i d e , and c e n t r i f u g a t i o n through a 1.1 M sucrose s o l u t i o n .  The p u r i f i e d enzyme c o n s i s t s o f two s u b u n i t s , cx and  6, o f m o l e c u l a r weights  52,000 and 48,000.  D u r i n g t r a n s h y d r o g e n a t i o n between NADPH and 3 - a c e t y l p y r i d i n e d i n u c l e o t i d e by both the p u r i f i e d enzyme r e c o n s t i t u t e d  adenine  i n t o liposomes and  the membrane-bound  enzyme, a pH g r a d i e n t i s e s t a b l i s h e d a c r o s s t h e  membrane as i n d i c a t e d by t h e quenching o f f l u o r e s c e n c e o f 9-aminoacridine.  I t was concluded  t h a t E_. c o l i  transhydrogenase  a c t s as a  p r o t o n pump which i s r e g u l a t e d p r i m a r i l y by a pH g r a d i e n t r a t h e r than a membrane p o t e n t i a l . Treatment o f transhydrogenase  with  N,N'-dicyclohexylcarbodiimide  r e s u l t s i n an i n h i b i t i o n o f p r o t o n pump a c t i v i t y and t r a n s h y d r o g e n a t i o n , suggesting  that proton  obligatorily  linked.  t r a n s l o c a t i o n and c a t a l y t i c a c t i v i t i e s a r e [ "*C]Dicyclohexylcarbodiimide 1  preferentially  l a b e l l e d the a s u b u n i t . The  transhydrogenase-catalyzed  r e d u c t i o n o f 3 - a c e t y l p y r i d i n e adenine  d i n u c l e o t i d e by NADPH was s t i m u l a t e d over t h r e e - f o l d by NADH. concluded  t h a t NADH binds  I t was  t o an a l l o s t e r i c b i n d i n g s i t e on the enzyme.  The n u c l e o t i d e sequences o f the pntA and pntB genes, c o d i n g f o r t h e transhydrogenase  a and 6 s u b u n i t s r e s p e c t i v e l y , were e s t a b l i s h e d . The  m o l e c u l a r masses o f 53,906 (a) and 48,667 (B) and the N - t e r m i n a l sequences o f the p r e d i c t e d p o l y p e p t i d e s agree w e l l w i t h the d a t a by a n a l y s i s o f the p u r i f i e d  subunits.  S e v e r a l hydrophobic  enough t o span the c y t o p l a s m i c membrane were observed  obtained  regions large  f o r each s u b u n i t .  -iv-  TABLE OF CONTENTS  TITLE PAGE  i  ABSTRACT  i i  TABLE OF CONTENTS  iv  LIST OF TABLES  viii  LIST OF FIGURES  ix  ABBREVIATIONS  x i i  ACKNOWLEDGEMENTS  xiii  INTRODUCTION Linkage w i t h the O x i d a t i v e P h o s p h o r y l a t i o n System Purification  o f Transhydrogenase  R e c o n s t i t u t i o n o f Transhydrogenase  3 •  5 9  Transhydrogenase as a P r o t o n Pump  11  E f f e c t o f E l e c t r o c h e m i c a l P o t e n t i a l on R e c o n s t i t u t e d Transhydrogenase  12  Chemical M o d i f i c a t i o n w i t h DCCD  13  R e a c t i o n Mechanism o f Transhydrogenase  14  P h y s i o l o g i c a l Role o f Transhydrogenase  19  O b j e c t i v e o f t h i s Study  20  MATERIALS AMD METHODS Chemicals and I s o t o p e s  21  S t r a i n s and B a c t e r i a l Growth  21  P r e p a r a t i o n o f Membranes  23  Solubilization  23  Purification  o f Membrane V e s i c l e s w i t h Detergents  o f Transhydrogenase from S t r a i n W6  23  -v-  S c r e e n i n g o f C l a r k e and Carbon C o l l e c t i o n f o r Plasmids C a r r y i n g the pnt Gene  25  Preparation of C o l i c i n E l  25  P r e p a r a t i o n o f Plasmid DNA  27  Preparation of Nucleic Acids  29  Digestion with Restriction  30  Enzymes  L i g a t i o n s w i t h T4-DNA L i g a s e  30  Transformations  30  E l e c t r o p h o r e s i s o f DNA  31  D e p h o s p h o r y l a t i o n o f DNA  32  Nuclease BAL31 D i g e s t i o n  33  Purification  33  o f Transhydrogenase from JM83 pDC21  P e p t i d e Mapping  34  Polyacrylamide Gel E l e c t r o p h o r e s i s  35  R e c o n s t i t u t i o n o f Transhydrogenase  35  In v i t r o P r o t e i n S y n t h e s i s  36  DNA Sequence D e t e r m i n a t i o n  37  Isolation  o f M13 Phage  38  Sequence R e a c t i o n  38  Isolation  o f Transhydrogenase c* and IB Subunits  Isolation  o f Transhydrogenase Subunits  40  u s i n g the Prep-Gel Apparatus  40  P r o t e i n Assay  •  Assay o f Energy-Independent Assay o f Energy-Dependent  Transhydrogenase A c t i v i t y  Transhydrogenase A c t i v i t y  41 41 42  F l u o r e s c e n c e Assays  43  P r e p a r a t i o n o f RNase t h a t i s Free o f DNase A c t i v i t y  44  -vi-  Glutamate Dehydrogenase Assay  43  PI T r a n s d u c t i o n  44  Labelling  o f Membrane V e s i c l e s  w i t h [ C]DCCD  45  ll,  Crossed Immunoelectrophoresis  45  R e a c t i o n o f E. c o l i Transhydrogenase w i t h Mitochondrial Anti-Transhydrogenase  46  RESULTS I. II.  III.  Physiological  Role o f Transhydrogenase  P u r i f i c a t i o n o f Transhydrogenase from S t r a i n W6  51  Selection  o f Detergent  55  P u r i f i c a t i o n o f Transhydrogenase  58  C l o n i n g o f the pnt Gene  Restriction  64  o f the pnt Plasmids  64  Endonuclease A n a l y s i s o f the pnt Plasmids  66  S u b c l o n i n g o f the pnt Gene i n t o pUCl3  66  Localization  68  o f the pnt Gene i n pDC3  I d e n t i f i c a t i o n o f the pnt Gene Products  71  Complementation  76  o f Transhydrogenase A c t i v i t y  Morphological Effects  V.  51  Growth o f C e l l s  Identification  IV.  48  o f pnt O v e r p r o d u c t i o n  P u r i f i c a t i o n o f Transhydrogenase from S t r a i n P r o p e r t i e s o f Transhydrogenase Kinetic  Parameters  Inactivation  by T r y p s i n . . . . .  JM83 pDC21  77 81 90 90 90  -vii-  VI.  Transhydrogenase as a P r o t o n Pump  90  Proteoliposome E n e r g i z a t i o n  90  I n t e r a c t i o n o f Transhydrogenase w i t h a pH G r a d i e n t o r Membrane P o t e n t i a l  VII.  I n h i b i t i o n by DCCD  101  I s o l a t i o n o f Transhydrogenase Subunits by E x c i s i o n from P o l y a c r y l a m i d e Gels  114  I s o l a t i o n o f the Transhydrogenase Subunits f o r Amino A c i d Sequence A n a l y s i s  VIII.  95  110  P u r i f i c a t i o n o f Subunits Using P o l y a c r y l a m i d e Slab G e l s . . . .  110  I s o l a t i o n o f the Transhydrogenase Subunits U s i n g a Commercial P r e p a r a t i v e G e l E l e c t r o p h o r e s i s System  110  N u c l e o t i d e Sequencing o f t h e pnt Gene  116  DISCUSSION P h y s i o l o g i c a l Role  124  C l o n i n g and E x p r e s s i o n o f Transhydrogenase  125  P u r i f i c a t i o n and C h a r a c t e r i z a t i o n o f Transhydrogenase  129  N u c l e o t i d e Sequence o f the pnt Gene  135  REFERENCES  141  -viii-  LIST OF TABLES Table 1.  Bacterial  2.  E f f e c t o f transhydrogenase a c t i v i t y on a e r o b i c growth r a t e s . . . .  49  3.  Role o f transhydrogenase i n the a s s i m i l a t i o n  53  4.  E f f e c t o f transhydrogenase mutation on the growth r a t e o f glutamate synthase mutants  54  P a r t i a l p u r i f i c a t i o n o f transhydrogenase from E_. c o l i s t r a i n W6  59  5.  6.  7.  Strains  22  o f ammonia  Transhydrogenase a c t i v i t y i n membranes o f s e l e c t e d from the C l a r k e - C a r b o n c o l o n y bank Complementation  strains  o f chromosomal pnt::Tn5 by  v a r i o u s pnt a l l e l e s on p l a s m i d s  78  8.  Growth c h a r a c t e r i s t i c s  9.  P u r i f i c a t i o n o f transhydrogenase E. c o l i s t r a i n JM83pDC21  10.  Treatment E. c o l i  65  o f JM83 c a r r y i n g  o f membrane v e s i c l e s  various plasmids  82  from  prepared  86 from  JM83pDC21 w i t h v a r i o u s l e v e l s o f T P C K - t r y p s i n o f E . c o l i W6 pDC21 membranes w i t h EDC  92  11.  Treatment  106  12.  E f f e c t o f s u b s t r a t e s on the i n h i b i t i o n o f transhydrogenase a c t i v i t y by DCCD  108  13.  Amino a c i d compositions o f the transhydrogenase s u b u n i t s  123  14.  Codon usage i n the E . c o l i pnt genes  137  -ix-  LIST OF FIGURES  Figure 1.  Proposed p r o t o n pump mechanisms f o r m i t o c h o n d r i a l transhydrogenase  18  2.  Pathways o f n i t r o g e n a s s i m i l a t i o n i n E . c o l i  50  3.  E f f e c t o f exogenous NH^Cl on glutamate dehydrogenase and transhydrogenase a c t i v i t i e s i n E. c o l i W6  52  S o l u b i l i z a t i o n o f membrane-bound transhydrogenase with various detergents  57  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f f r a c t i o n s at v a r i o u s s t a g e s o f the transhydrogenase p u r i f i c a t i o n from E. c o l i s t r a i n W6  60  S e p a r a t i o n o f transhydrogenase by ion-exchange chromatography  61  7.  P u r i f i c a t i o n o f transhydrogenase by a f f i n i t y chromatography..  63  8.  Comparison o f r e s t r i c t i o n endonuclease maps o f C o l E l p l a s m i d i n s e r t s w i t h a r e g i o n o f the E. c o l i genome  67  S u b c l o n i n g o f DNA c a r r y i n g the pnt gene  69  R e s t r i c t i o n endonuclease maps o f plasmids c o n t a i n i n g the pnt gene and transhydrogenase a c t i v i t i e s o f membranes p r e p a r e d from c e l l s h a r b o r i n g each o f the p l a s m i d s  70  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f membranes of JM83 c o n t a i n i n g e i t h e r pUC13 o r p D C l l  73  A u t o r a d i o g r a p h o f SDS-polyacrylamide e l e c t r o p h o r e s i s g e l o f [ S j m e t h i o n i n e - l a b e l e d in v i v o t r a n s c r i p t i o n / t r a n s l a t i o n products  74  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f membrane of JM83 c a r r y i n g h y b r i d plasmids  75  4.  5.  6.  9. 10.  11.  12.  3 s  13.  14.  15.  16.  fractions  Agarose g e l e l e c t r o p h o r e s i s o f plasmids p r e p a r e d from E. c o l i AB1450 c o n t a i n i n g transhydrogenase s u b u n i t s on s e p a r a t e r e p l i c o n s  79  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f membranes prepared from E. c o l i AB1450 pnt::Tn5 and AB1450 pnt: :Tn5 pDC9, pDC50  80  Microphotographs o f E . c o l i  83  JM83 c e l l s c o n t a i n i n g p l a s m i d s . . .  -x-  17.  T h i n s e c t i o n e l e c t r o n micrographs o f JM83 pDC21 c e l l s  84  18.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f v a r i o u s f r a c t i o n s o b t a i n e d d u r i n g the p u r i f i c a t i o n o f transhydrogenase from E . c o l i s t r a i n JM83 pDC21  88  19.  P a r t i a l p r o t e o l y s i s o f the 100,000-molecular-weight  protein  and the c* and 6 s u b u n i t s o f the transhydrogenase  89  20.  K i n e t i c parameters  91  21.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f membrane v e s i c l e s prepared from E . c o l i JM83 pDC21 t r e a t e d w i t h t r y p s i n  93  I n a c t i v a t i o n o f membrane-bound transhydrogenase by T P C K - t r y p s i n i n the presence o f various levels of nucleotides  94  23.  E f f e c t o f FCCP on r e v e r s e and forward t r a n s h y d r o g e n a t i o n  96  24.  Quenching o f the f l u o r e s c e n c e o f 9 - a m i n o a c r i d i n e d u r i n g the r e d u c t i o n o f AcNAD by NADPH c a t a l y z e d by e i t h e r membrane-bound o r r e c o n s t i t u t e d transhydrogenase  97  I n f l u e n c e o f a transmembrane pH g r a d i e n t on t r a n s h y d r o g e n a t i o n  99  22.  25.  o f transhydrogenase  26.  I n f l u e n c e o f a membrane p o t e n t i a l on t r a n s h y d r o g e n a t i o n  100  27.  E f f e c t o f ionophores on the r e d u c t i o n o f AcNAD by NADPH by membrane-bound transhydrogenase i n the presence of a membrane p o t e n t i a l  102  K i n e t i c s o f i n h i b i t i o n o f membrane-bound and p u r i f i e d transhydrogenase by DCCD  103  E f f e c t o f DCCD on p r o t o n t r a n s l o c a t i o n and c a t a l y t i c a c t i v i t i e s o f membrane-bound transhydrogenase  105  30.  [ C]DCCD l a b e l l i n g o f membrane-bound t r a n s h y d r o g e n a s e . . . . . . .  107  31.  E f f e c t o f NADH and AcNADH on the r e d u c t i o n o f AcNAD by NADPH c a t a l y z e d by p u r i f i e d transhydrogenase  109  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f samples from f r a c t i o n s o b t a i n e d d u r i n g the s e p a r a t i o n o f transhydrogenase s u b u n i t s u s i n g the p r e p a r a t i v e g e l e l e c t r o p h o r e s i s system  112  28.  29.  32.  ll,  -xi-  33.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f samples from f r a c t i o n s o b t a i n e d d u r i n g the s e p a r a t i o n o f transhydrogenase s u b u n i t s u s i n g the p r e p a r a t i v e g e l e l e c t r o p h o r e s i s system  113  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f transhydrogenase s u b u n i t s p u r i f i e d by e x c i s i o n of the p r o t e i n bands from a g e l  115  35.  Amino a c i d sequences  117  36.  Nucleotide  37.  S t r u c t u r e o f the M13  38.  Summary o f the c l o n e s used to e s t a b l i s h the n u c l e o t i d e sequence  122  Proposed mechanism o f transhydrogenase i n i n t a c t E. c o l i c e l l s  134  34.  39.  o f transhydrogenase a and 8 s u b u n i t s . . . .  sequence o f the pnt gene r e g i o n mpl8 and mpl9 c l o n i n g r e g i o n s  118 120  40.  Hydropathy  p l o t o f the transhydrogenase a s u b u n i t  139  41.  Hydropathy  p l o t o f the transhydrogenase 8 s u b u n i t  140  - x i i -  ABBREVIATIONS  Ac NAD  3-Acetylpyridine adenine dinucleotide  AG-NAD  NAD coupled to agarose resin.  Brij 35  Polyoxyethylene(23) lauryl ether  DCCD  N,N'-dicyclohexylcarbodiimide  DNase  Deoxyribonuclease  DTT  Dithiothreitol  EDTA  (Ethylenedinitrilo)-tetraacetic acid  EDC  l-Ethyl-3(3-dimethyl-amino-propyl)carbodiimide  EGTA  [Ethylenebis(oxyethylenenitrilo]-tetraacetic  HEPES  N-2-hydroxyethylpiperazine N -2-ethanesulphonic ac  MES  2-(N-morpholino)ethanesulphonic  MOPS  3-(N-morpholino)propanesulphonic  PEG  Polyethyleneglycol  RNase  Ribonuclease  SDS  Sodium dodecyl sulphate  TEMED  N,N,N',N'-tetramethylethylenediamine  acid  1  acid acid  TPCK-trypsin  Trypsin treated with L-(tosylamido 2-phenyl)ethyl chloromethyl ketone  Tris  Tris (hydroxymethyl)-aminoethane  Triton X-100  Polyoxyethyleneglycol(9-10)p-t-octylphenol  Triton X-114  Polyoxyethyleneglyco1(7-8)p-t-octylpheno1  U  Unit  aw  Membrane potential  ApH  Difference in pH across the membrane  ACKNOWLEDGEMENTS  To my supervisor and teacher, Dr. P.D. Bragg, I am deeply obliged. His  scientific and organizing ability and his never failing interest in  this work have made a deep impression on me. His continuous support during these years has been invaluable. I am especially grateful to my friend Tip Loo.  His assistance with  nearly a l l aspects of this work greatly contributed to i t s success. His positive attitude to l i f e and science has meant much to me during these studies. To Helga Stan-Lotter, I want to express my warmest thanks for the excellent assistance.  Her knowledge and technical s k i l l has made i t a  pleasure to work together with her. I am particulary grateful to Dr. Shirley Gillam for the use of her f a c i l i t i e s to do the nucleotide sequencing studies. My sincere thanks to my collaborators, Dr. Ross MacGillivray for his patience to teach me the basics in molecular biology and gifts of plasmid and enzymes, Dr. Pat Dennis for his help in techniques of molecular biology and performing the Sl-mapping studies, Dr. Bob Molday for doing the electron microscopy studies and Keith Withers for his help with computer analysis.  I thank Dr. J. Weiner of the University of Alberta fo  the gift of the Clarke and Carbon colony bank. I wish to thank Dr. Pat Dennis and Dr. Peter Candido for their constructive criticism of this thesis. My sincere thanks are also due to Masako Williams for her untiring help of typing the manuscripts. Finally I wish to thank Dr. Ted Sedgwick and Cynthia Hou for their assistance.  -xiv-  Financial  support  Council Studentship,  f o r t h i s work was  p r o v i d e d by a M e d i c a l  f o r which I express my  gratitude.  Research  1.  INTRODUCTION  P y r i d i n e n u c l e o t i d e transhydrogenases  (EC 1.6.1.1) c a t a l y z e t h e  d i r e c t and r e v e r s i b l e t r a n s f e r o f a h y d r i d e i o n e q u i v a l e n t between NAD and NADP a c c o r d i n g t o t h e e q u a t i o n : NADH + NADP ±~ NAD + NADPH An enzyme p o s s e s s i n g transhydrogenase a c t i v i t y was f i r s t d i s c o v e r e d by Colowick e t a l . (1) i n e x t r a c t s from Pseudomonas f l u o r e s c e n s .  Soon  a f t e r t h e d i s c o v e r y o f the Pseudomonas enzyme, Kaplan and co-workers (2) r e p o r t e d t h a t transhydrogenase a c t i v i t y was found i n bovine h e a r t preparations.  I t became apparent t h a t t h e r e were s i g n i f i c a n t  between the Pseudomonas and bovine h e a r t t r a n s h y d r o g e n a s e s .  differences Today these  enzymes a r e known t o be r e p r e s e n t a t i v e s o f two d i s t i n c t c l a s s e s o f transhydrogenases.  Both c l a s s e s o f transhydrogenases have been r e c e n t l y  reviewed ( 3 , 4 , 5 ) . The  first  c l a s s , termed B B - s p e c i f i c t r a n s h y d r o g e n a s e s , and  r e p r e s e n t e d by the Pseudomonas enzyme, c a t a l y z e the t r a n s f e r o f a h y d r i d e ion  e q u i v a l e n t between t h e 4B l o c u s o f both NADH and NADPH.  The  B B - s p e c i f i c transhydrogenases a r e s o l u b l e , F A D - c o n t a i n i n g enzymes which are  under a l l o s t e r i c r e g u l a t i o n by n u c l e o t i d e s such as 2'-AMP.  They a r e  found i n some h e t e r o t r o p h i c b a c t e r i a such as Pseudomonas f l u o r e s c e n s ( 1 ) , Pseudomonas a e r u g i n o s a ( 6 ) , A z o t o b a c t e r v i n e l a n d i i chroococcum, and A z o t o b a c t e r a g i l e  ( 7 ) , Azotobacter  ( 8 ) . The transhydrogenase enzymes o f  Pseudomonas a e r u g i n o s a (9) and A z o t o b a c t e r v i n e l a n d i i p u r i f i e d t o homogeneity.  (10,11) have been  The p u r i f i e d enzymes were i s o l a t e d as l a r g e  f i l a m e n t o u s aggregates w i t h m o l e c u l a r weights o f s e v e r a l m i l l i o n .  In the  presence o f 2'-AMP o r NADP the Pseudomonas enzyme d i s s o c i a t e d i n t o s m a l l e r  2. fragments of molecular weight 900,000, composed of 20 polypeptides of molecular weight 40,000 to 45,000 (12). The Azotobacter transhydrogenase also disaggregated in the presence of NADP into fragments of molecular weight 58,000 (10). FAD was found as a prosthetic group in both enzymes (9,10). The second class, termed AB-specific transhydrogenases, and represented by the bovine heart mitochondrial enzyme, catalyze the transfer of a hydride ion equivalent between the 4B locus of NADPH and the 4A locus of NADH. These enzymes are found in the cytoplasmic membrane of certain bacteria and i n the inner membrane of mitochondria. They are not allosterically  regulated by 2'-AMP nor do they require FAD insofar as i s  known. The AB-specific transhydrogenases are an interesting class of enzymes because upon membrane energization by respiration or ATP hydrolysis the rate of reduction of NADP by NADH i s increased up to ten-fold (3). This energy-linked transhydrogenase is widespread; i t i s found in the mitochondria of heart, kidney, liver, arterial and muscle tissue, in heterotrophic bacteria such as Escherichia c o l i (13), Micrococcus denitrificans (14), Bacillus megaterium (15), Salmonella typhimurium (16) and Benekea natriegens (17), and in photosynthesizing bacteria including Rhodospirilium rubrum (18), Rhodopseudomonas spheroides (19),  Rhodopseudomonas palustris and Rhodospirilium molischianum (18). This thesis focused on the study of the energy-linked  transhydrogenase of E. c o l i .  The E. coli enzyme, along with the  transhydrogenases of bovine heart mitochondria and R. rubrum are the most studied AB-specific transhydrogenases.  The following will focus on  advancements that have contributed to an understanding of the structure, function and properties of the aforementioned transhydrogenases.  3. Linkage with the Oxidative Phosphorylation System AB-specific transhydrogenases are integral membrane proteins found i n the inner mitochondrial membrane (20-22), the cytoplasmic membrane of E. coli (23), and R. rubrum chromatophore membranes (13,24).  Energy-linked  transhydrogenases are functionally linked to the energy-transfer the membrane in which they are located (4).  system of  The energy required may be  generated through any of the coupling sites of the respiratory chain in mitochondria or respiring bacteria.  In E. c o l i , the transhydrogenase may  be driven by ATP hydrolysis or respiration (25-27). Energy to drive the mitochondrial enzyme may be furnished by hydrolysis of ATP or by oxidation of NADH, succinate or reduced cytochrome c (21,22). With  photosynthetic  bacteria such as R. rubrum, energy can be generated either by light-induced electron transport or by the hydrolysis of pyrophosphate, ATP or GTP (18,24).  The presence of an energy source results in an energy  dependent increase in both the rate (5) and the extent (28,29) of reduction of NADP by NADH.  In mitochondria, the apparent equilibrium  constant for the reaction is increased from unity to about 500 and the rate of reduction of NADP by NADH is stimulated about 10-fold in the presence of an energy source such as ATP. The effect of ATP is mediated by the energy-transducing ATPase (3).  In mutants of E. c o l i lacking  ATPase, ATP does not drive the transhydrogenase reaction (30), although respiration is s t i l l effective (31).  An antibody to purified ATPase  inhibits the stimulation by ATP of transhydrogenase activity as well as inhibiting ATPase activity (32).  In addition, ATPase can be extracted  from the membrane with loss of the ATP stimulation and reconstituted to restore the effect (27,33).  Energy-linked  transhydrogenation driven by  any of the energy sources is inhibited by oxidative  phosphorylation  uncouplers  (28,34).  The ATP-dependent r e a c t i o n i s s p e c i f i c a l l y  inhibited  by the p h o s p h o r y l a t i o n i n h i b i t o r s , o l i g o m y c i n and d i c y c l o c a r b o d i i m i d e (3,18,35).  The a v a i l a b l e  transhydrogenase utilize  i n f o r m a t i o n suggests  t h a t the e n e r g y - l i n k e d  r e a c t i o n and e l e c t r o n t r a n s p o r t - l i n k e d  a common energy  pool.  A consequence o f t h i s assumption  t h a t a r e v e r s a l o f the transhydrogenase transhydrogenation)  phosphorylation  should r e s u l t  reaction  (i.e.,  NADPH+NAD  i n the c o n s e r v a t i o n o f f r e e  Dontsov and co-workers (36) showed t h a t e n e r g y - l i n k e d  would be  energy.  transhydrogenation  i s r e v e r s i b l e i n s t u d i e s on the d i s t r i b u t i o n o f the l i p o p h i l i c phenyl dicarbaundecarborane  (PCB ), a c r o s s s u b m i t o c h o n d r i a l p a r t i c l e and  R. rubrum chromatophore membranes. l i n k e d t o PCB  anion  NADPH+NAD t r a n s h y d r o g e n a t i o n was  uptake which i s i n d i c a t i v e o f the f o r m a t i o n o f a membrane  p o t e n t i a l , p o s i t i v e on the i n s i d e o f the v e s i c l e s NABH+NADP t r a n s h y d r o g e n a t i o n caused  (3).  an e f f l u x o f PCB .  r e s u l t s were o b t a i n e d u s i n g E_. c o l i v e s i c l e s  (37).  On the o t h e r hand, Similar  By u s i n g  t i g h t l y - c o u p l e d s u b m i t o c h o n d r i a l p a r t i c l e s , Van de S t a d t e t a l . (38) were a b l e t o couple ATP s y n t h e s i s to NADPH^NAD t r a n s h y d r o g e n a t i o n . these o b s e r v a t i o n s i t was proposed a r e v e r s i b l e p r o t o n pump (39-42), hypothesis  (43,44).  transhydrogenases  t h a t the transhydrogenase  f u n c t i o n s as  c o n s i s t e n t w i t h the chemiosmotic  One o f the major g o a l s o f r e s e a r c h on A B - s p e c i f i c  i s t o determine  the mechanism o f the transhydrogenase  r e a c t i o n and how the r e a c t i o n i s coupled to the energy system.  Based on  conservation  These s t u d i e s r e q u i r e a p u r i f i e d enzyme which can be  reconstituted into a r t i f i c i a l  membranes.  5.  P u r i f i c a t i o n of  Transhydrogenase  Transhydrogenase  i s an i n t e g r a l membrane p r o t e i n which must be  r e l e a s e d from the membranes f o r p u r i f i c a t i o n purposes. of  transhydrogenase from the membrane i s c o m p l i c a t e d by the f a c t  delipidation inactivates acetone and b i l e s a l t s Rydstrom is  However, r e l e a s e  the enzyme.  that  L i p i d - r e m o v i n g agents such as  i n a c t i v a t e m i t o c h o n d r i a l transhydrogenase ( 2 ) .  has demonstrated  that bovine h e a r t m i t o c h o n d r i a l transhydrogenase  i n a c t i v a t e d by ammonium s u l f a t e p r e c i p i t a t i o n i n the presence o f sodium  c h o l a t e ( 4 5 ) . A d d i t i o n o f p h o s p h o l i p i d s such as p h o s p h a t i d y l c h o l i n e , phosphatidylethanolamine or lysophosphatidylcholine to t h i s p r e p a r a t i o n restored a c t i v i t y .  Treatment  ammonium s u l p h a t e a l s o caused  o f E. c o l i transhydrogenase w i t h c h o l a t e and i n a c t i v a t i o n o f the enzyme  ( 4 6 ) . The  p r e p a r a t i o n was r e a c t i v a t e d by v a r i o u s p h o s p h o l i p i d s , p a r t i c u l a r l y b a c t e r i a l c a r d i o l i p i n and p h o s p h a t i d y l g l y c e r o l . of  Therefore, s o l u b i l i z a t i o n  transhydrogenase r e q u i r e s a d e t e r g e n t that e i t h e r s o l u b i l i z e s w i t h o u t  s t r i p p i n g away e s s e n t i a l  l i p i d s o r can e f f e c t i v e l y  substitute  for native  lipids. Transhydrogenase the  was f i r s t  l a b o r a t o r i e s o f Rydstrom  e x t r a c t e d transhydrogenase u s i n g sodium of  purified  from b e e f h e a r t m i t o c h o n d r i a i n  (47) and F i s h e r  (48). Rydstrom s 1  group  from beef h e a r t s u b m i t o c h o n d r i a l p a r t i c l e s  c h o l a t e i n the presence of ammonium s u l p h a t e .  such an e x t r a c t by chromatography  Purification  on DEAE-Sepharose and h y d r o x y a p a t i t e  y i e l d e d a homogeneous p r e p a r a t i o n o f transhydrogenase h a v i n g a m o l e c u l a r weight o f 97,000. purified  No p r o s t h e t i c group was d e t e c t e d .  transhydrogenase  a s i x - s t e p procedure.  Fisher's  group  from beef h e a r t s u b m i t o c h o n d r i a l p a r t i c l e s u s i n g  S u b m i t o c h o n d r i a l p a r t i c l e s were f i r s t  extracted  with sodium p e r c h l o r a t e t o remove p e r i p h e r a l p r o t e i n s and then  transhydrogenase was s o l u b i l i z e d  using l y s o l e c i t h i n .  then a c h i e v e d by f r a c t i o n a t i o n o f the s o l u b i l i z e d c a l c i u m phosphate purified 110,000.  g e l , and by chromatography  P u r i f i c a t i o n was  enzyme on alumina g e l ,  on NAD a f f i n i t y columns.  The  transhydrogenase was r e p o r t e d t o have a m o l e c u l a r weight o f The enzyme was f r e e o f f l a v i n ,  NADPH-dichlorophenolindophenol  r e d u c t a s e , NADPH-ferricyanide  NADH+NAD transhydrogenase a c t i v i t i e s . t r a n s f e r by p u r i f i e d  cytochromes, r e d u c t a s e and  The s t e r e o c h e m i s t r y o f hydrogen  transhydrogenase was shown t o be i d e n t i c a l  t o the  s u b m i t o c h o n d r i a l enzyme w i t h no exchange o f protons w i t h medium water (3).  Both o f the above procedures were l a b o r i o u s and y i e l d e d s m a l l  amounts o f transhydrogenase.  A much s i m p l e r p u r i f i c a t i o n  procedure f o r  m i t o c h o n d r i a l transhydrogenase was developed by Wu e t a l . ( 4 9 ) . heart s u b m i t o c h o n d r i a l p a r t i c l e s peripheral proteins.  Bovine  were washed w i t h 2 M NaCl t o remove  T h i s was f o l l o w e d by e x t r a c t i o n o f the membranes  w i t h 1.5% T r i t o n X-100.  The e x t r a c t was then a p p l i e d t o an a f f i n i t y  column o f NAD i m m o b i l i z e d on agarose and the enzyme e l u t e d w i t h NADH. The enzyme p r e p a r a t i o n was judged t o be homogeneous by a n a l y s i s u s i n g dodecyl sulphate polyacrylamide g e l e l e c t r o p h o r e s i s . resulted  i n a h i g h y i e l d o f enzyme (47.4%).  procedure i s not r e p r o d u c i b l e .  This  However, t h i s  sodium  procedure purification  Persson e t a l . ( 5 0 ) , d e s p i t e repeated  attempts, c o u l d not o b t a i n y i e l d s o f transhydrogenase g r e a t e r than 5% when u s i n g methods employing  i m m o b i l i z e d NAD.  In a d d i t i o n , the s p e c i f i c  a c t i v i t y o f t h e i r p r e p a r a t i o n s was o n l y about 15-20 umol/min/mg o f p r o t e i n , which was much l e s s than the s p e c i f i c a c t i v i t y o f 62.3 umol/min/mg o f p r o t e i n r e p o r t e d by Wu e t a l . purified  Persson e t a l .  (50)  the m i t o c h o n d r i a l transhydrogenase by cholate-ammonium s u l p h a t e  fractionation  f o l l o w e d by DEAE-Sepharose chromatography  and f a s t  protein  7.  liquid  chromatography.  The advantages of t h i s p r e p a r a t i o n , as compared t o  o t h e r p r e p a r a t i o n s , i s i t s s u p e r i o r p u r i t y , the r e p r o d u c i b i l i t y o f the method, and  the a b i l i t y  t o o b t a i n l a r g e amounts o f p u r i f i e d  transhydrogenase. P r e p a r a t i o n s o f the p u r i f i e d m i t o c h o n d r i a l transhydrogenase shown that the minimal m o l e c u l a r weight 115,000.  o f the enzyme i s 97,000 t o  The amino a c i d c o m p o s i t i o n of the m i t o c h o n d r i a l  has been determined  (49,50).  The  transhydrogenase  p o l a r i t y index (percentage o f Asx,  Ser, Thr, H i s , Lys and Arg r e s i d u e s ) i s about 40% more nonpolar  (49).  s t r u c t u r e o f p u r i f i e d bovine h e a r t transhydrogenase  transhydrogenase  (52).  was  Glx,  T h i s i s somewhat  than the t y p i c a l w a t e r - s o l u b l e p r o t e i n ( 5 1 ) .  c r o s s - l i n k i n g reagents  have  The  subunit  investigated using  Reaction of p u r i f i e d bovine heart  w i t h the b i f u n c t i o n a l c r o s s - l i n k i n g r e a g e n t s  a d i p i m i d a t e , d i m e t h y l p i m e l i m i d a t e , d i m e t h y l s u b e r i m i d a t e and  dimethyl dithiobis  ( s u c c i n i m i d y 1 p r o p i o n a t e ) r e s u l t s i n the appearance o f a dimer band on sodium d o d e c y l s u l p h a t e p o l y a c r y l a m i d e g e l s w i t h no h i g h e r o l i g o m e r s formed.  Treatment  transhydrogenase  being  o f the enzyme w i t h 6 M urea l e d t o i n a c t i v a t i o n o f  and p r e v e n t e d c r o s s - l i n k i n g .  membrane-bound m i t o c h o n d r i a l transhydrogenase c r o s s - l i n k i n g reagents  (53).  I t was  concluded  The was  subunit structure of also investigated using  that  transhydrogenase  e x i s t s i n the n a t i v e membrane p r i m a r i l y as a d i m e r i c s p e c i e s . Attempts  have been made by s e v e r a l l a b o r a t o r i e s t o i s o l a t e o r  i d e n t i f y the p o l y p e p t i d e c o m p o s i t i o n of the E. c o l i enzyme (46,54,55,56). L i a n g and Houghton (55) p a r t i a l l y p u r i f i e d  the E. c o l i  transhydrogenase  d e o x y c h o l a t e e x t r a c t i o n o f membranes f o l l o w e d by ion-exchange filtration  chromatography.  and g e l  Sodium dodecyl s u l f a t e p o l y a c r y l a m i d e g e l  e l e c t r o p h o r e s i s o f the p r e p a r a t i o n showed two major p r o t e i n bands o f  by  8.  molecular coli  w e i g h t s 94,000 and  cells  acids,  the  50,000, and  s e v e r a l minor bands.  When E.  a r e grown on complex media c o n t a i n i n g h i g h  l e v e l s o f amino  s y n t h e s i s of transhydrogenase i s repressed  (57).  o b s e r v a t i o n , L i a n g and  Houghton (55)  attempted  Using  this  to d e t e r m i n e which  p o l y p e p t i d e s were components o f t r a n s h y d r o g e n a s e by i n c o r p o r a t i n g 3  H-labelled  Casamino a c i d s i n the  nonrepressive dodecyl  l e v e l s of  sulphate  polypeptides the two  of molecular  o f the  the  C / H r a t i o corresponded  to  llf  3  known.  The  A third  degradation  and  represent  with  the  relationship  p o l y p e p t i d e may  This i s consistent with  possibility  The  50,000-molecular weight  transhydrogenase i s a s i n g l e polypeptide 120,000.  50,000.  largest  s m a l l e r component may  l a r g e r component.  Sodium  i n d i c a t e d that  w e i g h t s 94,000 and  i s not  enzyme to p r o t e o l y t i c  i n d u c t i o n phase.  and  g e l s o f the p r e p a r a t i o n  s t a b l e dimer o f the  Alternatively,  r e p r e s s i v e growth phase  i n the  1  the h i g h e s t  polypeptides  an u n u s u a l l y  [ ^C]leucine  polyacrylamide  p r o t e i n bands w i t h  initial  fact  polypeptide. fragment  sensitivity  t h a t the  of m o l e c u l a r  of  represent  a proteolytic the  the  of  the  mitochondrial  w e i g h t 97,000 t o  i s t h a t the enzyme i s composed o f  two  components. Chromatophores p r e p a r e d complex which i s r e a d i l y  from R.  separable  soluble p r o t e i n f a c t o r having membrane-bound component  2000-fold sulphate  purification precipitation  o f the  chromatophores and  Neither  and  transhydrogenase  centrifugation into  weight o f about the  70,000 and  s o l u b l e f a c t o r nor  e x h i b i t s transhydrogenase a c t i v i t y s o l u b l e f a c t o r was  f o l l o w e d by  The membrane component was  dilution  a molecular  (58,59).  membrane-bound component a l o n e  by  rubrum c o n t a i n a  obtained  from b o t h R.  s o l u b l e f a c t o r - d e p l e t e d membranes u s i n g  a  the (60).  u s i n g ammonium  chromatography on DEAE-Sephadex  successfully extracted  a  (61).  rubrum  A  9.  lysophosphatidylcholine  (62).  Transhydrogenase  a c t i v i t y can be  r e c o n s t i t u t e d by m i x i n g the membrane component w i t h p a r t i a l l y soluble factor  purified  (62,63) i n the presence o f low c o n c e n t r a t i o n s o f NADP o r  NADPH.  Reconstitution of  Transhydrogenase  In o r d e r t o t e s t the h y p o t h e s i s t h a t transhydrogenase c o u p l e s the t r a n s f e r o f protons a c r o s s membranes to the t r a n s f e r o f a h y d r i d e i o n e q u i v a l e n t between the s u b s t r a t e s , the p u r i f i e d enzyme must be reconstituted first  i n t o liposomes.  reconstituted  Rydstrom ( 4 7 ) .  P u r i f i e d bovine h e a r t transhydrogenase  i n t o p h o s p h a t i d y l c h o l i n e v e s i c l e s by Hojeberg  R e d u c t i o n o f NAD  by NADPH c a t a l y z e d by  and  reconstituted  transhydrogenase g e n e r a t e d an u n c o u p l e r - s e n s i t i v e uptake o f  lipophilic  a n i o n i n d i c a t i v e o f the f o r m a t i o n o f a membrane p o t e n t i a l , p o s i t i v e the v e s i c l e .  The r a t e o f r e d u c t i o n o f NAD  1 0 - f o l d by u n c o u p l e r s .  by NADPH was  was  inside  enhanced over  Other work showed t h a t p u r i f i e d m i t o c h o n d r i a l  transhydrogenase c o u l d be r e c o n s t i t u t e d by d i a l y s i s o f m i x t u r e s o f transhydrogenase, sodium c h o l a t e and p h o s p h a t i d y l c h o l i n e t o form s m a l l u n i l a m e l l a r p r o t e o l i p o s o m e s (64-66). transhydrogenase demonstrated  Experiments w i t h r e c o n s t i t u t e d  t h a t NADPH+NAD transhydrogenase  to the a c i d i f i c a t i o n o f the v e s i c l e i n t e r n a l space and transhydrogenation i s stimulated s e v e r a l - f o l d a d d i t i o n o f u n c o u p l e r (64-66).  The  i s coupled  that  i n b o t h d i r e c t i o n s upon  i n h i b i t i o n of transhydrogenation i n  both d i r e c t i o n s upon r e c o n s t i t u t i o n r e s u l t s from the r a p i d e s t a b l i s h m e n t o f a pH g r a d i e n t a c r o s s the membrane ( 3 ) .  Uncouplers a l l o w the c y c l i n g o f  protons a c r o s s the membrane and r e l i e v e the i n h i b i t i o n o f transhydrogenation.  10.  The  respiratory control  r a t i o i s the  a c t i v i t y i n the presence to t h a t respiratory  control  r e c o n s t i t u t i o n of t r a n s h y d r o g e n a s e .  latent  or  cannot c r o s s  treated  to the e x t e r n a l  observed when  The  functional  lysophosphatidylcholine  with detergents.  the membranes, the  v e s i c l e s must be o r i e n t e d  indicator of  R e s p i r a t o r y c o n t r o l was  transhydrogenase a c t i v i t y was  transhydrogenase was  transhydrogenase  i n the absence o f u n c o u p l e r (65).  r a t i o serves as an  d e t e r g e n t s such as T r i t o n X-100  r a t i o of  abolished  (65,66).  by No  reconstituted  Since p y r i d i n e  enzyme molecules i n the  nucleotides  reconstituted  asymmetrically with t h e i r a c t i v e  s i t e s exposed  medium.  Pennington and  Fisher  (67)  demonstrated that  reconstituted  m i t o c h o n d r i a l transhydrogenase i s a transmembrane p r o t e i n . bovine h e a r t m i t o c h o n d r i a l transhydrogenase was i n t o p h o s p h a t i d y l c h o l i n e liposomes by  Purified  asymmetrically  cholate-dialysis  inserted  procedure.  N - ( 4 - A z i d o - 2 - n i t r o p h e n y l ) - 2 - a m i n o e t h y 1 s u l f o n a t e , a membrane-impermeant photoprobe, when e n c a p s u l a t e d i n the v e s i c l e s , c o v a l e n t l y  modified  enzyme and  (3-acetylpyridine  i n h i b i t e d transhydrogenation.  analog of NAD)  increased  NADPH, NADP and  the  NADH were w i t h o u t e f f e c t .  l a b e l l e d photoprobe was  by  not  membranes.  R.  by NADPH.  enzyme by  a l t e r s the  These r e s u l t s  c o n f o r m a t i o n of the enzyme.  rubrum enzyme have been p u r i f i e d and  the  NADP, decreased indicate  m i t o c h o n d r i a l transhydrogenase spans the membrane  that substrate binding £. c o l i nor  L a b e l l i n g o f the  enhanced by AcNAD and  s i g n i f i c a n t l y affected  that r e c o n s t i t u t e d  AcNAD  r a t e o f i n a c t i v a t i o n s e v e r a l - f o l d , whereas  isotopically NADH, and  External  the  and  Neither  reconstituted  into  the  11.  Transhydrogenase  as a P r o t o n Pump  Several l i n e s of evidence transhydrogenase  i n d i c a t e that  f u n c t i o n s as a p r o t o n pump.  reconstituted D i r e c t evidence f o r proton  t r a n s l o c a t i o n coupled t o t r a n s h y d r o g e n a t i o n has been p r o v i d e d by the use o f pH probes  such as 9-aminoacridine  9-amino-6-chloro-2-methoxyacridine  (50,64,65) and  (66).  A decrease  i n i n t r a v e s i c u l a r pH  causes  the uptake o f the probes w i t h a r e s u l t a n t quenching  of fluorescence  (68).  During NADPH*NAD t r a n s h y d r o g e n a t i o n by the r e c o n s t i t u t e d  the f l u o r e s c e n c e o f these probes was s u b s t a n t i a l l y quenched, uptake  o f the probe i n response  to a decrease  enzyme,  indicating  i n i n t r a v e s i c u l a r pH.  S i m i l a r r e s u l t s were o b t a i n e d u s i n g the nonpermeant pH i n d i c a t o r , f l u o r e s c e i n i s o t h i o c y a n a t e - d e x t r a n trapped w i t h i n t h e v e s i c l e d i r e c t demonstration  A  o f p r o t o n t r a n s l o c a t i o n coupled t o t r a n s h y d r o g e n a t i o n  i n r e c o n s t i t u t e d v e s i c l e s was c a r r i e d out by E a r l e and F i s h e r Transhydrogenase  (65).  was r e c o n s t i t u t e d  i n t o potassium  (3,69).  loaded  p h o s p h a t i d y l c h o l i n e v e s i c l e s and the v e s i c l e s were suspended i n potassium-free b u f f e r .  The r a t e o f NADPth-NAD t r a n s h y d r o g e n a t i o n was  measured u s i n g t h e NAD analogue u s i n g a pH e l e c t r o d e .  AcNAD.  P r o t o n t r a n s l o c a t i o n was measured  When NADPH*AcNAD t r a n s h y d r o g e n a t i o n was c a r r i e d  out i n the presence o f v a l i n o m y c i n a concomitant the medium was demonstrated was  uptake  by e l e c t r o d e measurements.  o f protons  from  About one p r o t o n  t r a n s l o c a t e d f o r each h y d r i d e i o n e q u i v a l e n t t r a n s f e r r e d between the  substrates. result  A d d i t i o n o f v a l i n o m y c i n i n the absence o f s u b s t r a t e s d i d n o t  i n the uptake  a c t as a proton  pore.  o f protons  i n d i c a t i n g t h a t transhydrogenase  does n o t  12.  E f f e c t o f an E l e c t r o c h e m i c a l P o t e n t i a l on R e c o n s t i t u t e d  Transhydrogenase  Rydstrom (66) found that both pH g r a d i e n t s and membrane p o t e n t i a l s i n f l u e n c e the transhydrogenase r e a c t i o n .  When the r e d u c t i o n o f AcNAD by  NADPH was c a t a l y z e d by transhydrogenase v e s i c l e s w i t h  an i n t e r n a l pH o f 8  i n a medium o f pH 6, a t r a n s i e n t phase o f h i g h i n i t i a l a c t i v i t y was observed which r a p i d l y d e c l i n e d t o a lower a c t i v i t y . the a r t i f i c i a l l y  This implied  imposed pH g r a d i e n t promoted NADPH*AcNAD  transhydrogenation.  I n t e r a c t i o n s between transhydrogenase and imposed  membrane p o t e n t i a l s were i n v e s t i g a t e d with potassium g r a d i e n t s presence o f v a l i n o m y c i n . chloride  that  i n the  A h i g h e x t e r n a l c o n c e n t r a t i o n o f potassium  (150 mM), g e n e r a t i n g  a minimal membrane p o t e n t i a l o f 100 mV,  p o s i t i v e i n s i d e the v e s i c l e s , caused an i n h i b i t i o n o f the r e d u c t i o n o f AcNAD by NADPH.  The r e d u c t i o n o f AcNAD by NADPH was s t i m u l a t e d when a  membrane p o t e n t i a l o f the same s i z e but n e g a t i v e  i n s i d e the v e s i c l e s was  generated by the presence o f v a l i n o m y c i n  and the same c o n c e n t r a t i o n o f  potassium c h l o r i d e i n s i d e the v e s i c l e s .  Thus, these r e s u l t s i n d i c a t e t h a t  both a pH g r a d i e n t and a membrane p o t e n t i a l r e g u l a t e the transhydrogenase reaction i n vesicles.  E a r l e and F i s h e r (65) s t u d i e d the i n f l u e n c e o f pH  g r a d i e n t s and membrane p o t e n t i a l s on r e c o n s t i t u t e d transhydrogenase valinomycin  and n i g e r i c i n .  either acidic proteoliposomes  They found that c r e a t i o n o f pH g r a d i e n t s ,  i n s i d e the v e s i c l e s , by a d d i t i o n o f n i g e r i c i n t o prepared  w i t h a p p r o p r i a t e potassium g r a d i e n t s , had l i t t l e  e f f e c t on the transhydrogenase r a t e i n e i t h e r d i r e c t i o n .  However,  valinomycin-dependent movement o f potassium i o n s , i n a d i r e c t i o n to  using  opposite  proposed t r a n s h y d r o g e n a s e - c o u p l e d proton movements, s t i m u l a t e d the r a t e  of t r a n s h y d r o g e n a t i o n  markedly.  These r e s u l t s i n d i c a t e t h a t r e c o n s t i t u t e d  transhydrogenase i s i n f l u e n c e d p r i m a r i l y by membrane p o t e n t i a l s w i t h a l i m i t e d c o n t r i b u t i o n by the pH g r a d i e n t .  only  13.  Chemical M o d i f i c a t i o n w i t h D i c y c l o h e x y l c a r b o d i i m i d e NjN'-Dicyclohexylcarbodiimide  (DCCD) has been known as a potent  c o v a l e n t l y i n t e r a c t i n g i n h i b i t o r o f a number o f enzymes i n v o l v e d i n p r o t o n t r a n s l o c a t i o n a c r o s s b i o l o g i c a l membranes. ATP  DCCD i n h i b i t s  proton-linked  synthase (70), u b i q u i n o l - c y t o c h r o m e c r e d u c t a s e from mammalian and  y e a s t m i t o c h o n d r i a (71,72), and cytochrome o x i d a s e ( 7 3 ) .  In these systems  DCCD i n h i b i t s p r o t o n t r a n s l o c a t i o n p r i m a r i l y r a t h e r than t h e h y d r o l y t i c or redox r e a c t i o n s c a t a l y z e d by these enzymes.  Since transhydrogenase  acts  as a p r o t o n pump, i t i s a n t i c i p a t e d that DCCD may modify the p r o t o n - b i n d i n g domain i n an analogous way. Treatment  o f bovine h e a r t s u b m i t o c h o n d r i a l p a r t i c l e s w i t h DCCD does  cause i n a c t i v a t i o n o f transhydrogenase  (74-76).  The k i n e t i c s o f  i n a c t i v a t i o n suggest t h a t the r e a c t i o n o f 1 mol o f DCCD p e r a c t i v e enzyme complex r e s u l t s i n complete  inactivation.  Pennington and F i s h e r (74)  found that NADPH and NADP s t i m u l a t e d i n a c t i v a t i o n o f transhydrogenase by DCCD, whereas AcNAD and NADH a f f o r d e d no p r o t e c t i o n .  They c o n c l u d e d t h a t  DCCD-modified the transhydrogenase o u t s i d e t h e a c t i v e s i t e , p o s s i b l y i n a p r o t o n - b i n d i n g domain t h a t membrane.  f u n c t i o n s t o t r a n s l o c a t e p r o t o n s a c r o s s the  However, Phelps and H a t e f i  (75,76) r e p o r t e d t h a t AcNAD and NADH  p r o t e c t e d the enzyme from i n a c t i v a t i o n and came t o t h e c o n c l u s i o n DCCD b i n d s a t , o r near, the NAD(H)-binding  that  s i t e on t r a n s h y d r o g e n a s e .  Both  p u r i f i e d and s u b m i t o c h o n d r i a l transhydrogenases were l a b e l e l e d w i t h [ ' C]DCCD i n a manner which p a r a l l e l e d the e x t e n t o f i n h i b i t i o n ( 7 4 ) . i  ,  By c o n t r a s t Persson e t a l . (50) found that treatment o f r e c o n s t i t u t e d transhydrogenase w i t h DCCD r e s u l t e d  i n an i n h i b i t i o n o f p r o t o n pump  a c t i v i t y w i t h o u t an e f f e c t on uncoupled c a t a l y t i c a c t i v i t y , s u g g e s t i n g that p r o t o n t r a n s l o c a t i o n and c a t a l y t i c a c t i v i t i e s a r e n o t o b l i g a t o r i l y  14.  l i n k e d o r t h a t t h i s agent activity. (74).  s e p a r a t e s p r o t o n pumping from the c a t a l y t i c  S i m i l a r r e s u l t s had been observed  In experiments  w i t h transhydrogenase  reconstituted  p h o s p h a t i d y l c h o l i n e v e s i c l e s , DCCD i n h i b i t e d i n t o the liposomes  These r e s u l t s support  and F i s h e r potassium-loaded  the r a t e o f p r o t o n uptake  to a s i g n i f i c a n t l y greater extent  transhydrogenation. modify  by Pennington  than  the h y p o t h e s i s t h a t DCCD may  the p r o t o n - b i n d i n g domain o f transhydrogenase.  R e a c t i o n Mechanism o f Transhydrogenase The mechanism by which t r a n s h y d r o g e n a t i o n i s c o u p l e d t o t h e e n e r g i z e d s t a t e o f the membrane i s unknown.  M i t c h e l l has proposed  f o r the m i t o c h o n d r i a l transhydrogenase enzyme i s reduced  (44).  a loop mechanism  In t h i s mechanism, t h e  by a h y d r i d e i o n e q u i v a l e n t donated  by NADPH and a  p r o t o n from t h e m a t r i x s i d e o f the membrane t o form a reduced-enzyme intermediate. and  T h i s i s f o l l o w e d by the t r a n s f e r o f a h y d r i d e i o n t o NAD  the r e l e a s e o f t h e p r o t o n t o the c y t o s o l i c s i d e o f the membrane. Skulachev  (85) suggested  an a l t e r n a t i v e t o M i t c h e l l ' s scheme based on  l i g a n d - i n d u c e d c o n f o r m a t i o n a l changes. transhydrogenase subunits.  was proposed  t o have c a t a l y t i c and p r o t o n  translocating  A p o s i t i v e charge on the p r o t o n t r a n s l o c a t i n g s u b u n i t was  e n v i s i o n e d t o be near The  In the Skulachev model, t h e  the NADPH b i n d i n g s i t e o f the c a t a l y t i c  subunit.  p r o t o n b i n d i n g s i t e would r e o r i e n t from one s i d e o f t h e membrane t o  the o t h e r when NADP, formed by the o x i d a t i o n o f bound NADPH by NAD, o c c u p i e d the NADPH b i n d i n g s i t e . Ligand-induced  c o n f o r m a t i o n a l changes i n t h e transhydrogenase  have  been d e t e c t e d i n p r o t e o l y t i c , t h e r m o s t a b i l i t y and c h e m i c a l m o d i f i c a t i o n studies.  Both the bovine h e a r t (86) and r a t l i v e r  (87) m i t o c h o n d r i a l  transhydrogenases were p r o t e c t e d became more t h e r m a l l y  labile  from thermal i n a c t i v a t i o n by NADPH, and  i n the presence o f NADP.  NAD a f f e c t e d t h e r m o s t a b i l i t y .  N e i t h e r NADH n o r  The r a t e o f i n a c t i v a t i o n o f m i t o c h o n d r i a l  transhydrogenase by t r y p s i n i s a f f e c t e d by the p r e s e n c e o f l i g a n d s . Bovine heart  transhydrogenase was p r o t e c t e d by low c o n c e n t r a t i o n s  or NADH (86), whereas these of the l i v e r enzyme.  substrates d i d not a f f e c t t r y p s i n i n a c t i v a t i o n  The t r y p s i n i n a c t i v a t i o n o f both enzymes was  s t i m u l a t e d i n t h e presence o f NADPH. of i n a c t i v a t i o n . mitochondrial  NADP had l i t t l e  transhydrogenase have been d e t e c t e d :  2,3-butanedione i n b o r a t e  b u f f e r i n h i b i t E. c o l i  NADP, NAD and h i g h c o n c e n t r a t i o n s  unliganded  P h e n y l g l y o x a l and transhydrogenase  activity  Low c o n c e n t r a t i n s o f NADPH  NADH i n c r e a s e d the r a t e o f i n h i b i t i o n by 2,3-butanedione.  e f f e c t s were observed f o r the i n a c t i v a t i o n o f E_. c o l i t r y p t i c d i g e s t i o n i n t h e presence o f these coenzymes. t h a t t h e r e were a t l e a s t  enzyme, t h e  o f NADPH and NADH p r o t e c t e d t h e  enzyme a g a i n s t i n h i b i t i o n by 2,3-butanedione. and  e f f e c t on t h e r a t e  Hence, a t l e a s t three d i f f e r e n t c o n f o r m a t i o n s o f the  NADPH-enzyme complex and t h e NADP-enzyme complex.  (88).  o f NAD  Similar  transhydrogenase by I t was  concluded  two conformations o f the a c t i v e s i t e o f E . c o l i  transhydrogenase. Separate b i n d i n g s i t e s  f o r the NAD(H) and NADP(H) s u b s t r a t e s a t t h e  a c t i v e s i t e a r e i n d i c a t e d by k i n e t i c  s t u d i e s (54,88,89,90), the e x i s t e n c e  oi i n h i b i t o r s s p e c i f i c a l l y c o m p e t i t i v e (91,92), and by d i r e c t h y d r i d e and  the 4B l o c u s o f NADPH.  f o r b i n d i n g w i t h e i t h e r NAD o r NADP  i o n t r a n s f e r between the 4A l o c u s o f NADH  Kozlov  e t a l . (96) p r e s e n t e d  evidence  that  there i s a s h o r t d i s t a n c e between the NADP(H) and NAD(H) b i n d i n g s i t e s o f mitochondrial  transhydrogenase.  They found t h a t t h e  7-nitrobenzofurazan-4-y1 d e r i v a t i v e o f dephospho-CoA i s a c o m p e t i t i v e  16.  i n h i b i t o r w i t h r e g a r d t o both b i n d i n g s i t e s .  The k i n e t i c s o f the  i n h i b i t i o n i n d i c a t e d t h a t one m o l e c u l e o f t h e i n h i b i t o r simultaneously The  t o both  binds  the NADP(H) and NAD(H) b i n d i n g s i t e s o f the enzyme.  presence o f s e p a r a t e  binding s i t e s indicated that  partial  transhydrogenase r e a c t i o n s c o u l d take p l a c e a t the NAD(H) and NADP(H) binding s i t e s .  Bovine h e a r t m i t o c h o n d r i a l transhydrogenase was shown to  c a t a l y z e an exchange r e a c t i o n between NADH and NAD, but o n l y i n t h e presence o t NADPH (93).  The s t e r e o c h e m i s t r y  was the t r a n s f e r o f h y d r i d e  o f the NADH*NAD r e a c t i o n  i o n equivalent d i r e c t l y  NADH to the 4A l o c u s o f the NADH product.  The s t e r e o c h e m i s t r y  i o n t r a n s f e r between NADH and NAD p r o v i d e d evidence to the NADP s i t e .  from the 4A l o c u s o f  Because t r a n s h y d r o g e n a t i o n  a g a i n s t NADH b i n d i n g  i n v o l v e s o n l y the 4B l o c u s  of NADPH, b i n d i n g o f NADH t o the NADP s i t e would r e s u l t removal o f the 4B hydrogen o f NADH.  o f hydride  i n the s p e c i f i c  I t was proposed t h a t NADH+NAD  transhydrogenation  r e p r e s e n t s a p a r t i a l r e a c t i o n o f NADPH+NAD  transhydrogenation  which i n v o l v e s the p a r t i c i p a t i o n o f a reduced  enzyme  intermediate. Bovine h e a r t transhydrogenase was a l s o shown t o c a t a l y z e NADPH+NADP transhydrogenation  (94,95).  Wu and F i s h e r (95) demonstrated t h a t d u r i n g  NADPH+NADP t r a n s h y d r o g e n a t i o n  the NADP was reduced  locus and that o x i d a t i o n o f NADPH was predominantly and  e x c l u s i v e l y a t t h e 4B a t t h e 4B l o c u s .  F i s h e r (95) proposed t h a t NADPH+NADP t r a n s h y d r o g e n a t i o n  p a r t i a l r e a c t i o n o f NADH+NADP t r a n s h y d r o g e n a t i o n p a r t i c i p a t i o n o f a reduced  enzyme  Wu  represents a  which a l s o i n v o l v e s the  intermediate.  More r e c e n t r e s u l t s o b t a i n e d by Enander and Rydstrom (97) do n o t support  these c o n c l u s i o n s .  NADPH by bovine  They r e p o r t e d that the r e d u c t i o n o f NADP by  h e a r t m i t o c h o n d r i a l transhydrogenase r e q u i r e s  catalytic  amounts o f NADH. intermediate.  T h i s argues a g a i n s t the involvement  Other e v i d e n c e  enzyme i n t e r m e d i a t e  o f a reduced  a g a i n s t the p a r t i c i p a t i o n o f a  reduced  i s the l a c k o f exchange between s u b s t r a t e hydrogen and  water hydrogen (93,97,98) and the l a c k o f r e d u c i b l e groups The  (47,48).  k i n e t i c mechanism o f the transhydrogenase from E_. c o l i  and bovine  heart mitochondria  (97) have been determined.  double r e c i p r o c a l p l o t s o f i n i t i a l v e l o c i t i e s NADPH v e r s u s  enzyme  (54,88)  In both  cases  f o r the r e d u c t i o n o f NAD by  s u b s t r a t e c o n c e n t r a t i o n s were convergent and i n t e r s e c t i n g  i n d i c a t i n g a t e r n a r y complex mechanism.  The e f f e c t o f s i t e - s p e c i f i c  i n h i b i t o r s i n d i c a t e d t h a t the o r d e r o f a d d i t i o n o f the s u b s t r a t e s t o the enzyme was random. Enander and Rydstrom (97) used the knowledge t h a t m i t o c h o n d r i a l transhydrogenase was a dimer and a proton pump t o propose a model f o r transhydrogenation  shown i n F i g . l a .  The model i s based on t h e p r o p o s a l  that o l i g o m e r i c p r o t e i n s i n g e n e r a l may e x e r t the s o - c a l l e d h a l f o f the sites reactivity,  i . e . , o n l y h a l f o f the s u b u n i t s a r e c a t a l y t i c a l l y a c t i v e  at a g i v e n time (99,100). exchange o f t h e products and  binding o f a proton  the v e s i c l e s .  In A ( F i g . l a ) , subunit  NADH and NADP f o r t h e s u b s t r a t e s NAD and NADPH, from the s i d e o f the enzyme f a c i n g the e x t e r i o r o f  Simultaneously,  from the p r o t o n - b i n d i n g  I i s involved i n  subunit  I I i s a c t i v e i n pumping one p r o t o n  s i t e t o the i n t e r i o r o f the v e s i c l e s , d r i v e n by  the r e d u c t i o n o f NAD by NADPH. A s i m i l a r mechanism had been proposed by Pennington and F i s h e r ( 7 4 ) . As  shown i n F i g . l b , they proposed that the transhydrogenase dimer forms a  p r o t o n channel which spans the i n n e r m i t o c h o n d r i a l membrane. unliganded  n a t i v e transhydrogenase conformation  domain on each s u b u n i t  In the  ( C Q ) , the p r o t o n  i s i n a c c e s s i b l e t o protons  binding  on e i t h e r s i d e o f the  18.  F i g . 1.  Proposed proton pump mechanisms f o r  mitochondrial  transhydrogenase as o u t l i n e d by Enander and and  Pennington and  Fisher  (74)(b).  A  B  NADP* NADPH\ N A D H ^  NADPH-> NADP*  NADV  NAD**NADH  H*  •*H  3>C -+H*  NAD*-NADH NAOPH-NADP*  II  Rydstrom  H*  NAD*Vi  NADH ' NADPH NADP*  5>C  !I  17  +  (97)(a)  19.  membrane.  The b i n d i n g o f NADPH and NAD t o e i t h e r a c t i v e s i t e induces the  formation of conformation  , forming and exposing the p r o t o n  hydrophobic b i n d i n g domain t o t h e m a t r i x s i d e o f the membrane.  Subsequent  to p r o t o n a t i o n , h y d r i d e i o n t r a n s f e r generates a second t e r n a r y  complex  having c o n f o r m a t i o n  , i n which the p r o t o n b i n d i n g domain i s exposed t o  the c y t o s o l i c s i d e o f the membrane.  Products and p r o t o n s a r e r e l e a s e d and  the enzyme r e t u r n s t o c o n f o r m a t i o n CQ.  T h i s mechanism r e f l e c t s the  s t o i c h i o m e t r y o f protons t r a n s l o c a t e d f o r each t u r n o v e r o f the enzyme (H /H  = 1 ) as determined w i t h homogenous transhydrogenase  reconstituted into phospholipid vesicles  (69).  P h y s i o l o g i c a l Role o f Transhydrogenase The p h y s i o l o g i c a l  f u n c t i o n o f transhydrogenase i s u n c l e a r .  Several  p h y s i o l o g i c a l r o l e s f o r the enzyme i n m i t o c h o n d r i a have been suggested such as s u p p l y i n g NADPH f o r b i o s y n t h e s i s and h y d r o x y l a t i o n r e a c t i o n s ( 5 ) or p a r t i c i p a t i n g i n a pathway which i n a c t i v a t e s h y d r o p e r o x i d e s In E. c o l i ,  (77,78).  e n e r g y - l i n k e d transhydrogenase has been a s s o c i a t e d w i t h  the supply o f NADPH f o r the b i o s y n t h e s i s o f amino a c i d s s i n c e the presence of the l a t t e r the c e l l s  i n the growth medium r e p r e s s e d the l e v e l o f the enzyme i n  (57).  I f the c e l l s a r e i n i t i a l l y  cultured  i n a medium  c o n t a i n i n g h i g h l e v e l s o f amino a c i d s and then washed and p l a c e d i n a medium c o n t a i n i n g activity will  low l e v e l s o f amino a c i d s , the l e v e l o f transhydrogenase  increase.  I n c o r p o r a t i o n o f chloramphenicol i n the i n d u c t i o n  medium i n h i b i t s the i n c r e a s e i n transhydrogenase a c t i v i t y  indicating  that  de novo p r o t e i n s y n t h e s i s i s r e q u i r e d f o r t h e i n d u c t i o n o f transhydrogenase  (79).  G e r o l i m a t o s and Hanson ( 8 0 ) p r e s e n t e d e v i d e n c e  that the transhydrogenase o f IS. c o l i may p l a y a r o l e i n b r a n c h e d - c h a i n  20. amino a c i d t r a n s p o r t as they found t h a t r e g u l a t o r o f the enzyme.  leucyl-tRNA f u n c t i o n s as a  However, t h e i r h y p o t h e s i s c o u l d n o t e x p l a i n the  r e p r e s s i v e e f f e c t s o f the o t h e r amino a c i d s on i t s f o r m a t i o n . The E. c o l i  transnydrogenase may f u n c t i o n as a component o f the  ammonia a s s i m i l a t i o n pathway.  When E. c o l i was grown on g l u c o s e and  v a r i o u s c o n c e n t r a t i o n s o f NH^Cl, a s i m i l a r i t y transhydrogenase and glutamate dehydrogenase  i n the r e g u l a t i o n o f was observed ( 8 1 ) .  In the  range of 0.5 to 20 mM NH^Cl both transhydrogenase and glutamate denydrogenase  activities  i n c r e a s e d two- t o t h r e e f o l d .  c o n c e n t r a t i o n s o f 20 to 60 mM r e s u l t e d a c t i v i t i e s f o r both enzymes. d e c l i n e i n both a c t i v i t i e s . glutamate dehydrogenase  NH^Cl  i n r e l a t i v e l y constant  Higher exogenous NH^Cl, however, l e d to a The c o r e g u l a t i o n o f transhydrogenase and  a c t i v i t i e s may i n d i c a t e t h a t transhydrogenase may  a c t as a d i r e c t source o f NADPH i n the ammonia a s s i m i l a t i o n Mutants isolated  o f E_. c o l i  (82-84).  system.  l a c k i n g transhydrogenase a c t i v i t y have been  Such mutants grow normally under growth c o n d i t i o n s so  t a r t e s t e d l e a d i n g t o the c o n c l u s i o n that under normal an a c t i v e transhydrogenase  Objective of this  specific  i s not e s s e n t i a l to c e l l  growth c o n d i t i o n s  viability.  Study  Comparatively l i t t l e work has been done on the transhydrogenase £. c o l i d e s p i t e advantages offer.  from  that g e n e t i c m a n i p u l a t i o n o f t h i s system can  One o f the major g o a l s o f the work d e s c r i b e d i n t h i s t h e s i s was t o  p u r i f y t h i s enzyme, determine  i t s s u b u n i t c o m p o s i t i o n , and examine i t s  p o s s i b l e r o l e as a p r o t o n pump.  MATERIALS AND METHODS  Chemicals and Isotopes The chemicals and column materials used in this work were the highest grade obtainable from commercial suppliers.  Radioactive materials were  purchased from Amersham International Corp.  Restriction endonucleases  were from Amersham International Corp., Boehringer Mannheim Biochemicals or Pharmacia P-L Biochemicals.  Exonuclease BAL31, T4-DNA ligase, calf  intestinal phosphatase and DNA polymerase I (Klenow fragment) were obtained from Boehringer Mannheim Biochemicals.  Strains and Bacterial Growth Table 1 l i s t s the strains of bacteria used in this study. strains were stored at -50° to -70°C in 25% glycerol.  These  Strains were  prepared for storage by adding an equal amount of 50% glycerol to exponentially growing bacterial cultures. Cells used i n this study were grown on one of three types of medium. LB medium: 1% Bacto-tryptone, 1% NaCl and 0.5% yeast extract; YT medium: 0.8% Bacto-tryptone, 0.5% NaCl and 0.5% yeast extract; M9 medium: 0.7% Na HP0 , 0.3% KH P0 , 0.1% NH C1, 0.05% NaCl, 0.4% glucose, 100 ug/ml 2  4  2  4  4  thiamine and supplemented with 40 ug/ml of the appropriate amino acids. Cells were grown with shaking (at 250 rpm) at 37°C to an absorbance of 1.2 at 600 nm.  Larger batches of 4.5 1 were grown at 37°C with  vigorous aeration (at 25 1/min) in a Lab-Line/S.M.S. Hi-Density Fermentor.  The cells were harvested, washed with TED buffer (50 mM  Tris-HCl, pH 7.8, 1 mM dithiothreitol, 1 mM EDTA) or 0.9% NaCl and either used immediately or stored at -70°C.  22.  Table  1.  STRAIN  Bacterial  Strains  CHARACTERISTICS  RH-5  F* pnt::Tn5 argE3 l a c Y l  galK2 mtl-1 rpsL700 A." supE44  AB1450  JT t h i - 1 i l v D - 1 6 a r g H l metBl h i s G l  l a c Y l or lacZ4  mtl-2 x y l - 7 ara-13 g a l - 6 s t r A 8 A9 o r Al_7 tonA2  malAl  t s x - 7 _X"  supE44 g l t B 1 3 W6  pro  MV-12  F  JM83  a r a a l a c pro s t r A t h i I 8 0 d  JM103  F A l a c pro supE t h i s t r A endA sbcB15 traD36 proAB l a c I J l ZAM15  X1197  F" t h r l e u a r g l a c Y g a l minA minB t h i T6 r e c A l s t r  A  1  9  +  trpA t h r , l e u recA l a c Z AM15  1  hsdR4  M l . " a - 1 9 h i s - 9 5 r e l A l metBl s p o T l r  W1485  F  GMS343  F" argE3 l a c Y l galK2 mtl-1 rpsL700 A_* supE44  +  supE l i p  S t r a i n s were s u p p l i e d by B. Bachmann ( E . c o l i G e n e t i c Stock  Centre).  23.  P r e p a r a t i o n o f Membranes All buffer  s t e p s were performed  (50 mM  a t 0-4°C.  The c e l l s were suspended i n TED  T r i s - H C l , pH 7.8, 1 mM d i t h i o t h r e i t o l ,  1 mM  EDTA) and  MgSO^ and DNasel were added t o 5 mM and 1 uM, r e s p e c t i v e l y .  The c e l l s  were l y s e d by passage through an i c e - c o l d F r e n c h p r e s s u r e c e l l a t 1400 kg/cm*.  Unbroken c e l l s were removed by c e n t r i f u g a t i o n a t 12,000 x g f o r  10 min.  The supernatant was c e n t r i f u g e d  a t 180,000 x g f o r 2 h.  The  supernatant o b t a i n e d i s r e f e r r e d to as the c y t o p l a s m i c f r a c t i o n .  The  membranes were suspended i n TED b u f f e r .  S o l u b i l i z a t i o n o f Membrane V e s i c l e s w i t h The  Detergents  s o l u b i l i z a t i o n c h a r a c t e r i s t i c s o f v a r i o u s d e t e r g e n t s were  determined  as f o l l o w s .  described previously  Membranes  o f E . c o l i ML308-225 were prepared as  and suspended i n TED b u f f e r a t a p r o t e i n  c o n c e n t r a t i o n o f 5 mg/ml.  The suspension was d i v i d e d  a l i q u o t s and to each was added dropwise,  into  several  d i f f e r e n t amounts o f d e t e r g e n t s  from e i t h e r a 10% (w/v) o r 20% (w/v) s t o c k s o l u t i o n i n TED b u f f e r , o r i n some i n s t a n c e s added w i t h o u t d i l u t i o n . 0°C,  they were c e n t r i f u g e d  and p r o t e i n  a t 200,000 x g f o r 2 h and the  l e v e l s determined  s t e p s were performed  starting material.  transhydrogenase  i n the supernatant and p e l l e t f r a c t i o n s .  P u r i f i c a t i o n o f Transhydrogenase All  A f t e r i n c u b a t i o n f o r 30 min a t  from S t r a i n W6  a t 0-4°C w i t h 10-15 g o f W6 c e l l s as  The c e l l s were suspended i n 40 ml o f TED b u f f e r and  l y s e d by passage through a French p r e s s u r e c e l l a t 1400  kg/cm . 2  Unbroken c e l l s were removed by c e n t r i f u g a t i o n a t 12,000 x g f o r 10 min. The  supernatant was a d j u s t e d t o f i n a l volume o f 200 ml w i t h TED b u f f e r and  24.  was centrifuged at 180,000 x g for 2 h.  The resulting pellet was  suspended in 20 ml of TED buffer and 5 ml of 8 M urea was added to the membrane suspension.  After incubation at 0°C for 10 min, the membrane  suspension was diluted to 100 ml with TED buffer and centrifuged at 180,000 x g for 2 h.  The resulting pellet was washed by resuspension and  recentrifugation at 18,000 x g for 1 h twice with 1 mM Tris-HCl, pH 7.8, 0.2 mM dithiothreitol, 0.2 mM EDTA. The washed membranes were suspended in 20 ml of TED buffer and KCI and sodium deoxycholate (0.25 M stock) were added to final concentrations of 1 M and 15 mM, respectively. The membrane suspension was stirred for 10 min at 0°C and then centrifuged at 180,000 x g for 1 h.  The amber supernatant was adsorbed batchwise onto a  minimal amount of phenyl-Sepharose  (Pharmacia).  The resin was washed with  TED buffer containing (1 mg/ml) Brij 35 to remove KCI.  The resin was  transferred to a column and the protein eluted with 20 mg/ml Triton X-100 in the same buffer.  The eluted material was adsorbed onto a 32 ml (1.5 x  18 cm) DEAE-Bio-Gel A (Bio-Rad) column equilibrated with TED buffer containing 10% (v/v) glycerol and 1 mg/ml Brij 35. Proteins were eluted with a 0-200 mM NaCl gradient (200 ml) in the same buffer used to equilibrate the column.  Fractions containing transhydrogenase activity  were pooled and concentrated by ultrafiltration under ]S to a volume of 1 ml using an Amicon XM-50 membrane. The buffer in which the enzyme was dissolved was exchanged to 10 mM sodium phosphate pH 7.4, 1 mM EDTA, 1 mM dithiothreitol, 0.5 mg/ml Brij 35 by gel filtration chromatography on Sephadex G-50.  The enzyme was then adsorbed onto a 1 x 3 cm  agarose/hexane/nicotinamide the same buffer.  adenine dinucleotide column equilibrated with  The column was washed sequentially with 10 ml of  equilibration buffer, 10 ml of buffer containing 20 mM NaCl, 10 ml of  25. buffer, 5 ml of buffer containing 5 mM NADH, 5 ml of buffer, and the enzyme eluted by addition of 4 ml of buffer containing 10 mM NADH. This was followed by more buffer until a l l of the enzyme had been eluted.  NADH  was removed by desalting on a column of Sephadex G-50 equilibrated with sodium phosphate, pH 7.0, 1 mM dithiothreitol and 0.5 mg/ml Brij 35.  Screening of the Clarke and Carbon Collection for Plasmids Carrying the pnt Gene Each of the 2,112 clones from the Clarke and Carbon collection was grown at 37°C for 48 h in 12.5 ml of M9 medium supplemented with 20 Mg each of leucine, threonine, and tryptophan, 1 ug of thiamine, and 1 U of colicin El per ml.  Cells were harvested by centrifugation at 12,000 x g  for 5 min at 4°C.  The supernatant was discarded and the cells suspended  in 2.5 ml of 0.1 M sodium phosphate buffer (pH 7.0) containing 0.2 mM dithiothreitol and 0.2 mM EDTA. The cells were broken by passage through an ice-cold French pressure cell at 1,400 kg/cm . 2  Samples of 450 ul  were used to measure transhydrogenase activity.  Preparation of Colicin El Colicin El was prepared from strain W3110 pColEl (101).  An overnight  culture of W3110 pColEl was streaked onto an LB plate and grown overnight at 37°C. Several of the colonies were then replica plated onto two LB plates. 37°C.  One plate was used as a master plate and grown overnight at The remaining plate was incubated at 37°C for 2 h and then the  colonies irradiated for 10 sec with a Mineralight short-wave lamp held 1 cm above the agar surface.  The plate was incubated at 37°C for 1 h, then  overlayed with a mixture of 0.5 ml of X1197  cells in 2.5 ml of top agar  26.  (LB media w i t h 0.8%  a g a r ) , and  incubated a t 37°C o v e r n i g h t .  c l e a r i n g i n d i c a t e d t h a t the c o l o n y c o n t a i n e d the C o l E l A 50 ml c u l t u r e o f W3110  p C o l E l (LB media) was  v i g o r o u s s h a k i n g t o an absorbance  o f 0.5  f l a s k s c o n t a i n i n g 500 ml o f LB media was c u l t u r e and  Zones o f  plasmid.  grown a t 37°C w i t h  a t 600 nm.  To each o f e i g h t 2 1  added 5 ml o f the W3110  pColEl  the f l a s k s were i n c u b a t e d a t 37° w i t h s h a k i n g (250 rpm)  the absorbance  had reached 0.5  a t 600 nm.  Mitomycin  C was  until  then added t o  g i v e a f i n a l c o n c e n t r a t i o n o f 1 ug/ml and the f l a s k s were shaken f o r 14 h a t 37°C. min and  The c e l l s were h a r v e s t e d by c e n t r i f u g a t i o n a t 4,500 x g f o r 15  resuspended  c o n t a i n i n g 1 M NaCl.  i n 60 ml o f 0.1  M potassium phosphate b u f f e r , pH  C e l l s were broken by passage t h r e e times through  i c e - c o l d French p r e s s u r e c e l l a t 1,400  kg/cm . 2  The broken  (40 ml) was  then s t i r r e d f o r 30 min  added dropwise  i n an i c e b a t h .  an  c e l l s were  c e n t r i f u g e d a t 18,000 x g f o r 90 min and the p e l l e t d i s c a r d e d . ammonium s u l f a t e  7.0,  Saturated  to the s u p e r n a t a n t which  The p r e c i p i t a t e was  was  removed by  c e n t r i f u g a t i o n a t 12,000 x g f o r 10 min and the p e l l e t was d i s c a r d e d . S a t u r a t e d ammonium s u l f a t e supernatant was  stirred  (35 ml) was  f o r 30 min  added t o the s u p e r n a t a n t and  i n an i c e b a t h .  The p r e c i p i t a t e  c o l l e c t e d by c e n t r i f u g a t i o n a t 12,000 x g f o r 10 min was  discarded.  The p e l l e t was  phosphate b u f f e r , pH 7.5, buffer.  The volume was  and the  suspended i n 5 ml o f 0.1  M  now  10 ml.  supernatant  potassium  10 ml o f 20%  (v/v) g l y c e r o l was  added  s t o r e d a t -20°C.  T i t r a t i o n o f the c o l i c i n was  performed  u s i n g s t r a i n X1197.  c u l t u r e s o f XI197 grown i n LB media were added to top agar t o 2.5 ml o f LB c o n t a i n i n g 0.8%  plates.  was  and d i a l y z e d f o r 4 h a g a i n s t 6 1 o f the same  and the crude c o l i c i n E l was  cells  the  (w/v)  agar) and  A drop o f s e r i a l l y d i l u t e d c o l i c i n E l was  Overnight  (0.5 ml o f  l a y e r e d on  LB  p l a c e d on the p l a t e  which was then i n c u b a t e d o v e r n i g h t a t 37°C.  The number o f u n i t s o f  c o l i c i n was c a l c u l a t e d as the r e c i p r i c a l o f t h e most d i l u t e s o l u t i o n which caused  l y s i s o f the c e l l s on the p l a t e .  n o r m a l l y gave t i t r a t i o n s o f 1 x 10" t o 1 x 1 0  1 1  colicin  The p r e p a r a t i o n s  u n i t s o f c o l i c i n per  ml.  P r e p a r a t i o n o f P l a s m i d DNA For l a r g e - s c a l e p r e p a r a t i o n s , plasmid DNA was a m p l i f i e d by t r e a t i n g the c e l l s w i t h c h l o r a m p h e n i c o l as d e s c r i b e d by M a n i a t i s e t a l . (102). C e l l s were grown i n LB media t o an absorbance  o f 0.6 and c h l o r a m p h e n i c o l  was added t o a f i n a l c o n c e n t r a t i o n o f 50 ug/ml. f u r t h e r 12-18 h . lysates  P l a s m i d DNA was e x t r a c t e d from l y s o z y m e - T r i t o n X-100  (103,104) o r by a l k a l i n e  l y s i s method was used. bacterial pellet  C e l l s were shaken a  lysis  (102).  T h i s was performed  Normally,  the a l k a l i n e  as d e s c r i b e d below.  from a 500 ml c u l t u r e was resuspended  The  i n 10 ml o f 50 mM  g l u c o s e , 25 mM T r i s - H C l , pH 8.0, and 10 mM EDTA c o n t a i n i n g 5 mg/ml lysozyme.  A f t e r 5 min a t room temperature,  20 ml o f 0.2 N NaOH/1% SDS was  added and the tubes were l e f t on i c e f o r 10 min.  15 ml o f an i c e - c o l d  s o l u t i o n o f 5 M potassium a c e t a t e , pH 4.8, was added.  T h i s s o l u t i o n was  prepared from 60 ml o f 5 M potassium a c e t a t e , 11.5 ml o f g l a c i a l a c i d and 28.5 ml o f E^O.  acetic  The tubes were i n v e r t e d s e v e r a l times and l e f t  s t a n d i n g i n i c e f o r 10 m i n .  The c e l l DNA and b a c t e r i a l d e b r i s were  removed by c e n t r i f u g a t i o n a t 40,000 x g f o r 30 min a t 4°C. The supernatant was t r a n s f e r r e d t o a f r e s h tube and 0.6 volumes o f i s o p r o p a n o l was added t o each tube.  The c o n t e n t s were mixed and l e f t  temperature  The plasmid DNA was r e c o v e r e d by c e n t r i f u g a t i o n  f o r 15 m i n .  at 12,000 x g f o r 30 min a t room temperature.  t o stand a t room  The s u p e r n a t a n t was  28.  discarded  and the p e l l e t o f n u c l e i c a c i d d r i e d b r i e f l y  desiccator. 8.0,  The p e l l e t s were d i s s o l v e d  i n 9 ml o f TE (10 mM T r i s - H C l pH  1 mM EDTA) and 9 g o f cesium c h l o r i d e was added.  s o l u t i o n was t r a n s f e r r e d  i n a vacuum  t o a 16 x 76 mm s e a l a b l e  The cesium  tube and the tube was  f i l l e d w i t h a s o l u t i o n o f e t h i d i u m bromide (10 mg/ml i n H 2 O ) . was  sealed  and c e n t r i f u g e d  DNA were n o r m a l l y v i s i b l e  a t 250,000 x g f o r 36 h a t 15°C. i n ordinary  l i n e a r b a c t e r i a l DNA and n i c k e d consisted  of closed  c o l l e c t e d using  light.  chloride  The tube Two bands o f  The upper band c o n s i s t e d o f  c i r c u l a r p l a s m i d DNA; the lower band  c i r c u l a r plasmid DNA.  The lower band o f DNA was  an 18G needle and the DNA t r a n s f e r r e d  t o a tube.  Ethidium  bromide was removed by adding an equal volume o f i s o a m y l a l c o h o l  saturated  w i t h water and m i x i n g the two phases.  The phases were s e p a r a t e d by  c e n t r i f u g a t i o n a t 1,500 x g f o r 3 min a t room temperature. phase was d i s c a r d e d .  The e x t r a c t i o n was r e p e a t e d s e v e r a l  p i n k c o l o r had d i s a p p e a r e d .  The upper times u n t i l t h e  The aqueous phase was d i a l y z e d  against  s e v e r a l changes o f TE b u f f e r . For  small-scale  i s o l a t i o n s , plasmid DNA was p r e p a r e d from  overnight c u l t u r e s , using ml  the a l k a l i n e l y s i s method (102).  T y p i c a l l y , 1.5  o f the c u l t u r e was poured i n t o a 1.5 ml tube and c e n t r i f u g e d  in a Micro-Centrifuge.  f o r 1 min  The medium was removed by a s p i r a t i o n and t h e  p e l l e t resuspended i n 100 u l o f l y s i s b u f f e r T r i s - H C l , pH 8.0 and 10 mM EDTA c o n t a i n i n g min  unamplified  (50 mM g l u c o s e , 25 mM  4 mg/ml o f lysozyme).  After 5  a t room temperature, 200 y l o f an i c e - c o l d s o l u t i o n o f 0.2 N NaOH i n  1% SDS was added and the c o n t e n t s mixed by i n v e r t i n g t h e tube two o r t h r e e times.  The tube was kept on i c e f o r 5 min.  Then, 150 u l o f an i c e - c o l d  s o l u t i o n o f potassium a c e t a t e pH 4.8, made up as d e s c r i b e d l a r g e - s c a l e plasmid i s o l a t i o n , was added.  f o r the  A f t e r 5 min a t 0°C the s o l u t i o n  29.  was  c e n t r i f u g e d i n a M i c r o - C e n t r i f u g e f o r 7 min.  The  supernatant  was  added t o a f r e s h tube and e x t r a c t e d w i t h an equal volume o f phenol/chloroform.  A f t e r c e n t r i f u g i n g f o r 2 min  the supernatant was  t r a n s f e r r e d to a f r e s h tube.  were added.  A f t e r s t a n d i n g a t room temperature  c e n t r i f u g e d a t room temperature supernatant was desiccator.  removed and  f o r 5 min  in a Micro-Centrifuge, Two  f o r 2 min,  the p e l l e t d r i e d b r i e f l y  added and the mixture  The p r e p a r a t i o n o f p l a s m i d DNA  was  the tubes were  in a Micro-Centrifuge.  50 u l o f TE b u f f e r c o n t a i n i n g 50 ug/ml  p a n c r e a t i c RNase was  volumes o f e t h a n o l  The  i n a vacuum DNase-free  i n c u b a t e d a t 37°C f o r 5  s t o r e d a t -20°  min.  centrifugation.  P u r i f i c a t i o n of Nucleic Acids DNA  was  p u r i f i e d by e x t r a c t i o n w i t h p h e n o l / c h l o r o f o r m  p r e c i p i t a t i o n with ethanol. s e v e r a l times w i t h b u f f e r M T r i s - H C l pH 8.0 phase was  7.6  C h l o r o f o r m as used and iso-amyl The DNA  The  volume o f 0.3 of ethanol.  extracting  f o l l o w e d by  0.1  the pH o f the aqueous  then added t o a to as  final  phenol.  i s a 24:1 m i x t u r e o f c h l o r o f o r m  alcohol. was  mixed w i t h an equal volume o f phenol o r p h e n o l / c h l o r o f o r m The  c o n t e n t s were mixed u n t i l an  emulsion  two phases were s e p a r a t e d by c e n t r i f u g a t i o n i n a  M i c r o - C e n t r i f u g e f o r 1 min. f r e s h tube.  was  until  This preparation i s referred  i n these experiments  i n a p o l y p r o p y l e n e tube. formed.  13-mercaptoethanol),  8-Hydroxyquinoline  c o n c e n t r a t i o n o f 0.1%.  prepared by  ( u s u a l l y 1.0 M T r i s - H C l pH 8.0,  and 0.2%  (102).  L i q u i f i e d phenol was  and  The  The upper aqueous phase was  s t e p s were r e p e a t e d u s i n g c h l o r o f o r m a l o n e .  M sodium a c e t a t e , pH 5.5, was The  t r a n s f e r r e d to a One-tenth  added a l o n g w i t h two  tubes were s t o r e d a t -20°C f o r a t l e a s t  1 h.  volumes  The  DNA  was  30.  recovered by c e n t r i f u g a t i o n f o r 10 min i n a M i c r o - C e n t r i f u g e .  The  supernatant was d i s c a r d e d and the p e l l e t d r i e d i n a vacuum d e s i c c a t o r . The DNA p e l l e t was suspended i n TE b u f f e r .  Digestion with R e s t r i c t i o n  Enzymes  R e s t r i c t i o n endonuclease manufacturer's  instructions.  d i g e s t i o n s were done a c c o r d i n g t o the C o n d i t i o n s f o r p a r t i a l d i g e s t i o n o f plasmid  DNA were e s t a b l i s h e d by adding s e r i a l d i l u t i o n s o f enzymes t o the p l a s m i d DNA and i n c u b a t i n g a t 37°C f o r 1 h.  Reactions were t e r m i n a t e d by the  a d d i t i o n o f o n e - s i x t h volume o f c o n c e n t r a t e d " l o a d i n g " b u f f e r (0.25% bromophenol b l u e , 40% s u c r o s e , 75 mM EDTA) and a sample was agarose  gel for electrophoresis.  been determined,  loaded onto an  Once the c o r r e c t d i l u t i o n o f enzyme had  p a r t i a l d i g e s t i o n o f plasmid DNA was c a r r i e d out  a c c o r d i n g l y and the r e a c t i o n s were stopped by the a d d i t i o n o f 0.5 M EDTA to a f i n a l c o n c e n t r a t i o n o f 12  mM.  L i g a t i o n s w i t h T4-DNA L i g a s e 200 ng o f l i n e a r i z e d plasmid DNA and a t h r e e f o l d molar excess o f the fragment to be subcloned were mixed i n a t o t a l volume o f 8 Ml.  1 pl  o f 1 0 - f o l d c o n c e n t r a t e d l i g a t i o n b u f f e r (0.66 M T r i s - H C l pH 7.5, 50 mM M g C l , 50 mM 2  d i t h i o t h r e i t o l and 10 mM ATP) and 1 u l o f 0.9 U/ul  T4-DNA l i g a s e were added. l e f t a t room temperature  The c o n t e n t s were mixed w i t h a v o r t e x mixer and  f o r 1 to 12 h.  Transformations B a c t e r i a were transformed w i t h plasmid DNA by the c a l c i u m c h l o r i d e procedure  (102).  About 40 ml o f LB medium i n a 250 f l a s k was  incubated  with 0.1  ml o f an o v e r n i g h t c u l t u r e o f the c e l l s  t o be t r a n s f o r m e d .  c e l l s were grown a t 37°C w i t h v i g o r o u s s h a k i n g to an absorbance 0.6  a t 600 nm.  The  f l a s k was  p l a c e d on i c e f o r 10 min  and the  c o l l e c t e d by c e n t r i f u g a t i o n a t 3000 x g f o r 5 min a t 2°C. i n 20 ml o f 10 mM  CaCl .  The  was  l e f t on i c e f o r 25 min and then c e n t r i f u g e d as b e f o r e .  10 mM  50 mM  2  50 mM  CaCl  2  and kept on i c e .  pellet tube  The  d i s c a r d e d and the c e l l s were g e n t l y suspended  T r i s - H C l pH 8.0,  to  cells cell  suspended  supernatant was  T r i s - H C l , pH 8.0,  o f 0.2  The  was  The  i n 4 ml  of  For each  t r a n s f o r m a t i o n , 200 u l o f the competent c e l l s were p l a c e d i n i c e - c o l d tubes and about ice  50 ng o f p l a s m i d DNA  was  added.  The  tubes were l e f t  f o r 40 min and then p l a c e d i n a 42°C bath f o r 2 min.  The  on  c e l l s were  r e v i v e d by a d d i n g 800 u l o f LB media to each tube and i n c u b a t i n g the c e l l s a t 37° f o r 1 h.  Up  to 100 u l o f the transformed c e l l s were  s t r e a k e d onto p l a t e s c o n t a i n i n g the d e s i r e d medium and case o f pUC  plasmids 50 u l o f  1.5%  agar.  In the  5-bromo-4-chloro-3-indolyl-S-D-  g a l a c t o p y r a n o s i d e (2% i n N,N'-dimethylformamide) was c a r r y i n g an i n s e r t w i t h i n the p l a s m i d were i d e n t i f i e d  also present. as white  Clones  colonies,  whereas c l o n e s w i t h o u t i n s e r t s gave b l u e c o l o n i e s .  Electrophoresis of Agarose  s l a b g e l s (0.4 to 1.2%)  run i n TBE b u f f e r 2 h.  DNA  (0.09 M T r i s ,  (Bio-Rad, M i n i - G e l ) and  M boric acid,  2 mM  EDTA) a t 60 V f o r  G e l s were s t a i n e d i n e t h i d i u m bromide (0.5 ug/ml o f H 0)  DNA-containing  2  bands were observed under UV  u s i n g a P o l a r o i d MP-4 film.  0.09  were prepared  light.  Photographs  and were taken  camera f i t t e d w i t h a red f i l t e r and u s i n g Type  667  E x t r a c t i o n o f i n d i v i d u a l DNA p o i n t agarose was p i e c e of agarose t h a t the f i n a l  performed  bands f o r l i g a t i o n  c o n t a i n i n g the DNA  was  The  put i n a volume o f TE b u f f e r so  c o n c e n t r a t i o n o f agarose would be 0.1%. and  The  then c o o l e d .  agarose  The  DNA  was  i n the  then l i g a t e d as d e s c r i b e d p r e v i o u s l y .  Dephosphorylation The  low-melting  as d e s c r i b e d by Burns and Beacham (105).  melted by i n c u b a t i o n a t 65°C f o r 5 min s o l u t i o n was  from  of  DNA  t e r m i n a l 5' phosphates were removed from DNA  c a l f i n t e s t i n a l a l k a l i n e phosphatase ( C I P ) ( 1 0 2 ) .  The  by treatment DNA  was  with  digested  w i t h the r e s t r i c t i o n enzyme o f c h o i c e , e x t r a c t e d once w i t h phenol/chloroform,  and  the DNA  p r e c i p i t a t e d with ethanol.  d i s s o l v e d i n a minimum volume o f 10 mM  T r i s - H C l , pH 8.0.  of t e n - f o l d c o n c e n t r a t e d b u f f e r (0.5 M T r i s - H C l pH 9.0, mM  ZnC^,  ul.  10 mM  0.01  the i n c u b a t i o n was  10 mM  MgCl  5 ul 1  2 >  50 from  p r o t r u d i n g 5' t e r m i n i , the p r e p a r a t i o n was  p r e p a r a t i o n was  DNA  a l i q u o t o f CIP was  10 u l o f STE  The  added and  CIP was  (100 mM  and  min.  i n c u b a t e d f o r 15 min a t 37°C f o l l o w e d by  both temperatures.  added  w i t h b l u n t ends o r r e c e s s e d 5' t e r m i n i ,  a l i q u o t o f CIP was  u l of 10% SDS,  then a second  c o n t i n u e d f o r a f u r t h e r 30  To dephosphorylate  2  Water and  added t o remove the t e r m i n a l phosphates  i n c u b a t e d a t 37°C f o r 30 min,  H 0,  was  DNA.  To d e p h o s p h o r y l a t e  A second  DNA  s p e r m i d i n e ) were added t o b r i n g the t o t a l volume to  u n i t s o f C1P was  1 pmole o f  The  15 min  the  a t 56°C.  the i n c u b a t i o n s were r e p e a t e d a t  then i n a c t i v a t e d by adding 40 u l o f  T r i s - H C l pH 8.0,  1 M NaCl,  10 mM  and h e a t i n g the sample at 68°C f o r 15 min.  EDTA), 5 The  DNA  was  e x t r a c t e d t w i c e w i t h p h e n o l / c h l o r o f o r m and p r e c i p i t a t e d w i t h e t h a n o l .  33.  Nuclease BAL31 D i g e s t i o n An  equal volume o f 2 - f o l d c o n c e n t r a t e d  M g C l , 0.4 2  M NaCl, 40 mM  sample of DNA.  The  T r i s - H C l pH 8.0,  b.0)  placed  on  was  added to a f i n a l  ice.  The  2 mM  samples were incubated  pre-determined amount of BAL31 was M pH  b u f f e r (24 mM EDTA) was  added.  At a p p r o p r i a t e  concentration  of 20 mM  p r e c i p i t a t e d with  24  added to  at 37°C f o r 3 min  samples of BAL31-digested DNA  p h e n o l / c h l o r o f o r m and  CaC^,  and  and  mM  the then a  times EGTA the  (0.2  samples were  were e x t r a c t e d  with  ethanol.  P u r i f i c a t i o n of Transhydrogenase from JM83 pDC21 All  steps  were performed at 0-4°C with 3-5  starting material. 5 mM an  MgSO^ and  The  a small  cells,  suspended i n 40 ml  c e l l at 1,400  removed by c e n t r i f u g a t i o n o f the adjusted  of 1%  of TED  (v/v).  The  The  T r i t o n X-100  After stirring  of TED  b u f f e r , and  concentration  at 0°C  suspension was was  sodium c h o l a t e  o f 50 mM. again  o f 1 M.  of TED  t o r 10 min  added to a f i n a l  at 0°C,  the  and  (0.5  p e l l e t s were suspended i n  M) was  at 0°C  KCI  concentration  the membrane s u s p e n s i o n  added to a  f o r 5 min,  was  Sodium deoxycholate (0.25  (0.5 to) were then added to f i n a l stirring  was  The  b u f f e r and  buffer  membrane p e l l e t s were suspended  f o r 5 min,  After stirring  ml w i t h TED  concentrations  added to a M)  and  of 15 mM  i n s o l u b l e m a t e r i a l was  was 50  final  the membrane  c e n t r i f u g e d at 210,000 x g f o r 90 min.  suspended i n 15 ml  concentration  passage through  l y s a t e at 12,000 x g f o r 10 min.  2  to a f i n a l volume of 100  b u f f e r and  containing  were  c e n t r i f u g e d at 210,000 x g f o r 90 min. ml  kg/cm .  buffer  as  Unbroken c e l l s  c e n t r i f u g e d at 210,000 x g f o r 2 h. i n 50 ml  of TED  amount o f DNase I, were l y s e d by  i c e - c o l d French p r e s s u r e  supernatant was  g o f JM83 pDC21 c e l l s  The  pellet  final  sodium  cholate  each.  After  removed  by  34.  c e n t r i f u g a t i o n at 210,000 x g f o r 4 5 min. l a y e r e d onto a c u s h i o n sodium c h o l a t e , and punctured and  of 1.1  M sucrose i n TED  centrifuged  ten 1.4  ml  buffer containing  mM  The  2.3  tube  Fractions  was  containing  s t o r e d at 0-4°C.  Mapping  Cleveland  et a l . (106).  composed o f 10% Laemmli ( 7 ) .  The  c a r r i e d out u s i n g  first  polyacrylamide  60  g e l s were s t a i n e d  10%  (v/v) a c e t i c a c i d f o r 30 min,  soaiced f o r 30 min SDS),  and  i n 0.1%  The  (0.25  e l e c t r o p h o r e s i s was  (v/v) a c e t i c a c i d and  (v/v)  (w/v)  destained  f o r 60 min  were e x c i s e d 6.8,  stacking g e l .  performed at 100 The  continued  power was  by  mA/slab.  in  10%  from the g e l ,  1 mM  To  EDTA,  0.1%  x 14 x  0.15  each w e l l  was  10%  mA/slab u n t i l  the  then shut o f f .  as b e f o r e .  Coomassie B l u e , 25% i n 10%  was  isopropanol,  mg/ml) i n b u f f e r B c o n t a i n i n g  the s t a c k i n g g e l .  i n 0.1%  at 100  i n t o the w e l l s of a s l a b g e l (15  E l e c t r o p h o r e s i s was  entered  stained overnight  then d e s t a i n e d  a c r y l a m i d e w i t h a 4%  added 10 u l of chymotrypsin  A f t e r 30 min,  Coomassie B l u e , 25% and  by  transhydrogenase i n  c a r r i e d out  i n b u f f e r B (0.125 M T r i s - H C l pH  composed of 15%  p r o t e i n s had  (15 x 14 x 0.075 cm)  ug of p u r i f i e d  desired polypeptides  then loaded  (v/v) g l y c e r o l .  (w/v)  the method d e s c r i b e d  s t a c k i n g g e l as d e s c r i b e d  E l e c t r o p h o r e s i s was  The  (v/v) a c e t i c a c i d .  slab gel  w i t h a 4%  Each w e l l r e c e i v e d  Laemmli sample b u f f e r .  cm)  was  f r a c t i o n s were c o l l e c t e d .  P r o t e o l y t i c d i g e s t i o n was  (w/v)  r e s u l t i n g supernatant  at 260,000 x g f o r 16 h.  transhydrogenase a c t i v i t y were pooled and  Peptide  The  The  (v/v)  (v/v) a c e t i c a c i d .  g e l s were  isopropanol,  10%  35. P o l y a c r y l a m i d e Gel E l e c t r o p h o r e s i s P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s was Laemmli (107). 0.1%  bDS  and  acrylamide and  acrylamide  0.8%  (w/v)  10%  N,N -methylenebisacrylamide  15 x 14 x 0.075 or 0.15 t e r t i a r y b u t a n o l was butanol was (w/v)  SDS  removed.  cm g e l was  allowed to p o l y m e r i z e  prepared.  P o l y m e r i z a t i o n was  ft-mercaptoethanol).  The  mA/slab.  g e l s were s t a i n e d w i t h F a i r b a n k ' s s t a i n  acid.  The  10%  E l e c t r o p h o r e s i s was  4%  c a r r i e d out a t  an  (w/v)  10%  (v/v) a c e t i c  SDS, onto  mM  100  (108) o f 0.1%  (v/v) i s o p r o p a n o l and  g e l s were d e s t a i n e d w i t h 10%  by  (w/v)  T r i s base, 192  (w/v)  25%  initiated  samples were loaded  g l y c i n e , 0.1%  blue R,  0.1%  Samples were prepared by adding  immersed i n running b u f f e r (25 mM  Coomassie b r i l l i a n t  tertiary  l a y e r e d over the s e p a r a t i n g g e l  10%  The  A of  M T r i s - H C l , pH 6.8,  20%  SDS).  ml  1 h, the  sample b u f f e r (0.125 M T r i s - H C l , pH 6.8,  the g e l which was  0.5  15 u l of f r e s h l y prepared  g e l mixture was f o r 1 h.  After  e q u a l volume o f SDS (v/v) g l y c e r o l ,  For each  15 Ml o f TEMED.  and a p p r o x i m a t e l y  A s t a c k i n g g e l of 0.125  the a d d i t i o n of 10 u l of TEMED and  and  poured  l a y e r e d on the g e l s u r f a c e .  The  (w/v)  e f f e c t e d by the a d d i t i o n of 75 y l of  ammonium p e r s u l f a t e and  and 4% a c r y l a m i d e was  ammonium p e r s u l f a t e .  i n water).  1  (w/v)  8.8,  (prepared from a s t o c k s o l u t i o n o f 30%  15 ml of g e l , p o l y a c r y l a m i d e was f r e s h l y prepared  as d e s c r i b e d by  s e p a r a t i n g g e l contained 0.375 M T r i s - H C l , pH  The  7-15%  performed  (w/v)  (v/v) a c e t i c  acid.  R e c o n s t i t u t i o n of Transhydrogenase Purified  transhydrogenase  was  r e c o n s t i t u t e d w i t h egg  p h o s p h a t i d y l c h o l i n e by the c h o l a t e d i l u t i o n method ( 6 5 ) . transhydrogenase Sephadex G-50  (0.5 mg/ml, 26.4  U/mg  of p r o t e i n ) was  column to exchange the b u f f e r to 10 mM  yolk Purified  passed  through  Hepes-KOH, pH  a  7.5,  36.  300 mM  KCI, 0.1  mM  dithiothreitol,  1.5%  egg p h o s p h a t i d y l c h o l ine (10 mg/ml) was r e s i d u e was was  clarified  twice. lipid  In  suspended  (w/v)  sodium  The  transhydrogenase was  s u s p e n s i o n and d i l u t e d  ml o f  the  suspension  a t 1,400  kg/cm  then added to 0.2  2  ml o f  i n t o the a p p r o p r i a t e assay medium.  v i t r o Protein Synthesis In  v i t r o p r o t e i n s y n t h e s i s was  DNA-directed  the  c a r r i e d out w i t h a p r o c a r y o t i c  t r a n s l a t i o n k i t o b t a i n e d from Amersham I n t e r n a t i o n a l  P r o t e i n s were t r a n s l a t e d  1s  A premix  u l o f supplement  f o r each r e a c t i o n was  1 s  R e a c t i o n m i x t u r e s were prepared adding 12.5 u l o f the premix.  min,  cell  extract.  15.8  u l o f DNA  Ci/ml).  (3-5 ug) i n  The r e a c t i o n m i x t u r e  p l a c e d i n a 37°C water bath and the r e a c t i o n was the S-30  prepared  s o l u t i o n , 3 u l o f amino a c i d  mixture and 2 Ul of [ S ] m e t h i o n i n e (1460 Ci/nmole,  d i l u t i o n b u f f e r t o 12.5  Corp.  i n the presence o f [ S J m e t h i o n i n e a c c o r d i n g to  i n s t r u c t i o n s o f the s u p p l i e r .  by mixing t o g e t h e r 7.5  of  lipid  through a French p r e s s u r e c e l l  Ten ug o f p u r i f i e d  One  d r i e d under n i t r o g e n and  i n 5 ml o f the same b u f f e r .  by passage  cholate.  was  s t a r t e d by adding 5 u l  A f t e r i n c u b a t i n g the r e a c t i o n at 37°C f o r 60  5 u l o f methionine chase s o l u t i o n was  c o n t i n u e d f o r a f u r t h e r 5 min.  added and  incubation  An equal amount o f SDS  was  sample b u f f e r  was  added and the p r o t e i n s were separated by SDS/polyacrylamide g e l electrophoresis. d e s t a i n e a w i t h 10%  The g e l was  stained with Fairbank's s t a i n  f o r 30  min,  (v/v) a c e t i c a c i d , t r e a t e d w i t h A m p l i f y (Amersham) f o r  15 min, and then d r i e d .  A u t o r a d i o g r a p h y was  performed o v e r n i g h t u s i n g  Kodak XAR-5 f i l m . In A19  some cases an S-30  as f o l l o w s (109).  e x t r a c t was  used t h a t was  The growth medium was  p r e p a r e d from  composed o f 2.6%  (w/v)  strain  37.  K H P 0 , 0.5% 2  glucose, was  (w/v)  4  13.5  K H P 0 , 0.9% 2  ul/ml  grown o v e r n i g h t  shaking.  One  ml  (w/v)  4  thiamine and i n 200  were h a r v e s t e d  nm  c u l t u r e was ml  with shaking  (250  5 min.  c e l l s were resuspended i n 40 ml  recentrifuged.  The  d i t h i o t h r e i t o l ) and  y i e l d o f c e l l s was  suspended i n 10 ml o f b u f f e r S and kg/cm .  for  30 min,  of 1 mM.  (0.2  20 mM  7.8,  pH  7.0,  pyruvate k i n a s e ,  0.5  g.  The  e x t r a c t was  5 ml;  0.14  0.2  ml;  mg)  b u f f e r once.  200  The  cells  They were  8.2,  0.014  at 8,000 x g f o r and  i c e - c o l d French  pressure  final  t w i c e at 30,000 x g  u l ) and  mix  2 ml was  added to 8 ml  15  2 ml;  o f the  i n the dark, the e x t r a c t  volumes of b u f f e r S f o r 14 h at 4 ° , changing  e x t r a c t was  (1 M  1 M dithiothreitol,  sodium phosphoenolphosphate, 6  were mixed and  M  Equal p a r t s o f mix  ml;  an  washed c e l l s were  centrifuged  MgOAc, 1.0  75 mM  The  then added to g i v e a  A f t e r i n c u b a t i o n a t 37°C f o r 90 min  dialyzed against  DNA  The  2.5  of b u f f e r S  amino a c i d s m i x t u r e l a c k i n g methionine, 25  h ATP,  extract.  at 30°C.  centrifuged  keeping the supernatant each time.  T r i s - a c e t a t e pH ul;  rpm)  broken i n an  D i t h i o t h r e i t o l was  2  A19  c e l l s were grown to  M T r i s - a c e t a t e , pH  M KOAc, 1 mM  concentration  The  by c e n t r i f u g a t i o n at 4,500 x g f o r 15 min.  MgOAc, 0.06  c e l l a t 5b0  Strain  used to i n o c u l a t e each o f  of medium.  suspended i n i c e - c o l d b u f f e r S (0.01  The  (w/v)  ml o f medium i n a 1 1 f l a s k at 37°C w i t h  twelve 2 1 f l a s k s c o n t a i n i n g 400 at 600  e x t r a c t , 1%  50 ug/ml of m e t h i o n i n e .  o f the o v e r n i g h t  absorbance of 0.3  yeast  d i v i d e d i n t o a l i q u o t s and  cell was  the  s t o r e d at -70°C.  Sequence D e t e r m i n a t i o n DNA  sequence d e t e r m i n a t i o n  procedure (110,111). single-stranded  The  phage and  M13mpl9 were used.  was  performed u s i n g  procedure c o n s i s t s of two DNA  the c h a i n  termination  parts; preparation  sequence d e t e r m i n a t i o n .  of  Phages M13mpl8 and  38.  I s o l a t i o n of M13 0.1  ml  Phage  of an o v e r n i g h t c u l t u r e of JM103 c e l l s grown i n M9 media  added to 5 ml of YT medium and shaking.  T h i s c u l t u r e was  distributed  the c u l t u r e i n c u b a t e d a t 37°C f o r 2 h w i t h  added t o 45 ml of YT medium and  to s e p a r a t e c u l t u r e tubes.  i n t o the medium i n a c u l t u r e tube.  ml c e n t r i f u g e tube and  The  (w/v)  temperature  cored from a  the agar p l u g was  blown  tubes were i n c u b a t e d a t 37°C f o r 5  contents of each tube were poured  The  supernatant  (0.8 ml) was  PEG-6000/2.5 M NaCl, mixed, and  f o r 15 min.  The  M i c r o - C e n t r i f u g e f o r 5 min. p e l l e t was  The  was  into a  1.5  the c e l l s p e l l e t e d by c e n t r i f u g a t i o n i n a  M i c r o - C e n t r i f u g e f o r 1 min. Ul of 20%  2 ml  Each phage plaque was  p l a t e w i t h a 50 u l d i s p o s a b l e m i c r o p i p e t and  h with v i g o r o u s s h a k i n g .  was  added to  200  l e t stand a t room  phage were c o l l e c t e d by c e n t r i f u g a t i o n i n a The  supernatant was  suspended i n 100 y l o f TE b u f f e r .  removed and  The  the phage  phage p e l l e t  was  e x t r a c t e d w i t h 50 Ml of phenol by v o r t e x i n g f o r 10 sec f o l l o w e d by c e n t r i f u g i n g i n the M i c r o - C e n r i f u g e f o r 1 min.  The aqueous l a y e r was  then  e x t r a c t e d t h r e e times w i t h 500 u l of w a t e r - s a t u r a t e d d i e t h y l e t h e r . s i n g l e - s t r a n d e d DNA a c e t a t e , pH 5.5, overnight.  and  The DNA  was  p r e c i p i t a t e d by adding  300 was  the DNA  10 u l o f 3 M sodium  y l o f e t h a n o l and c h i l l i n g  the tube a t -20°C  c o l l e c t e d by c e n t r i f u g a t i o n i n the  M i c r o - C e n t r i f u g e f o r 5 min d e s i c c a t o r and  The  at 0-4°C.  resuspended  The  p e l l e t was  i n 50 y l of TE  dried  i n a vacuum  buffer.  Sequence R e a c t i o n The  first  the template.  s t e p o f the sequencing  r e a c t i o n was  To 5 y l o f s i n g l e - s t r a n d e d M13  base d e o x y n u c l e o t i d e  primer  (2.4 yg/ml) and  DNA  to anneal was  the primer  added 1 y l of  1 y l of 10-fold  17  to  39.  concentrated 1 u l of The  a n n e a l i n g b u f f e r (0.1 M T r i s - H C l , pH 8.5,  ti^O.  The  tube was  h e a t i n g b l o c k was  dATP and  0.1  to c o o l to about 40°C and  1 u l of deoxyadenosine 5 ' -[<*- *P J t r i p h o s p h a t e 3  mixed and  2 y l was  2  p l a c e d i n 70°C water i n a h e a t i n g  allowed  Ci/mmole, 10 mCi/ml) was  M M g C l ) and  added to the DNA.  distributed  The  contents  block.  1 u l o f 12 (3000  of the tube were  to each of the f o u r n u c l e o t i d e r e a c t i o n  tubes each of which c o n t a i n e d 2 u l of the a p p r o p r i a t e t e r m i n a t o r The  t e r m i n a t o r mixes of the  7.5,  1 mM  EDTA: A, 0.5  d&lP; B, 50 uM C, 0.5  mM  ddTTP, 5.4  b u f f e r (10 mM  mh  (90%  uM  The  uM  dGTP; 50  r e a c t i o n was  uM started  polymerase i n 2 u l o f  1 mM  i n c u b a t i o n was  r e a c t i o n s were stopped  (v/v) formamide, 20 mM  dithiothreitol,  by adding  EDTA, 0.03%  (w/v)  and  continued  4 u l o f formamide s t o p xylene cyanol,  then c o o l e d on i c e .  of  ml of 38%  (w/v)  acrylamide/2%  10-fold concentrated  EDTA), 0.5 The  g e l s were prepared  g e l was  TEMED.  The  ml o f 10%  (w/v)  degased and g e l was  TBE  by f i r s t mixing (w/v)  b u f f e r (1.78  mix  0.03%  p l a c e d i n a b o i l i n g water bath f o r 3 min  and  0.5  for a further  The  7.5  50  then 2 u l o f  bromophenol b l u e ) to each r e a c t i o n m i x t u r e .  Polyacrylamide  pH  (v/v) g l y c e r o l ) to each of the r e a c t i o n  added to each tube and  The  uM  mix.  Tris-HCl,  dCTP, 109  uM dGTP; D,  tubes were i n c u b a t e d a t 37°C f o r 15 min  dATP was  15 min.  dGTP.  T r i s - H C l pH 8.0,  10%  i n 50 mM  dCTP, 109,  uM dCTP, 5.4  dCTP, 77 UM  ug/ml of n u c l e a s e - f r e e BSA, The  uM  u n i t s o f the Klenow fragment of DNA  Klenow d i l u t i o n  tubes.  uM dTTP, 109  dTTP, 5.4  uM dTTP, 109  dTTP, 77 UM  by adding 0.5  f o l l o w i n g compositions  ddCTP, 109 uM  ddGTP, 109  ddATP, 77 UM  mM  uM  r e a c t i o n tubes were  t o g e t h e r 25 g o f u r e a ,  N,N'-methylenebisacrylamide, 5 ml M Tris,  1.78  M b o r i c a c i d , 20  ammonium p e r s u l f a t e i n a t o t a l volume of 50  p o l y m e r i z a t i o n was  i n i t i a t e d by adding  poured to form a 17 x 30 x 0.05  cm g e l .  mM ml.  20 u l o f  A f t e r the g e l  40.  had  polymerized,  pre-run  i t was a t t a c h e d  a t 28 amps/gel f o r 10 min u s i n g TBE b u f f e r .  s e q u e n c i n g r e a c t i o n was loaded mA/gel f o r e i t h e r 2 o r 5 h . paper, covered 80°C.  t o the e l e c t r o p h o r e s i s apparatus and  with  About 2 u l o f each  i n each w e l l and the g e l s were run at 28  The g e l s were then p l a c e d  on 0.3 mm Whatman  Saran Wrap and d r i e d f o r one hour on a g e l - d r y e r a t  A u t o r a d i o g r a p h y was performed o v e r n i g h t  The  f i l m was t r e a t e d f o r 5 min w i t h  and  then t r e a t e d f o r 5 min w i t h Kodak f i x e r .  u s i n g Kodak XRP-1 f i l m .  Kodak GBX d e v e l o p e r  and r e p l e n i s h e r  The developed f i l m was  r i n s e d w i t h water f o r 30 min and d r i e d .  I s o l a t i o n o f Transhydrogenase ot and 13 S u b u n i t s A 15 x 14 x 0.15 cm 10% p o l y a c r y l a m i d e prepared  as d e s c r i b e d  g e l with  f o r Laemmli g e l s except t h a t the TEMED and ammonium  persulfate concentrations  were reduced by o n e - h a l f .  s t o c k i n g g e l was 12 cm wide.  Purified  out  a t 100 mA p e r s l a b u n t i l  end  o f the g e l .  (112).  E l e c t r o p h o r e s i s was c a r r i e d  the bromophenol blue dye f r o n t reached the  The g e l was p l a c e d on i c e .  i n a g l a s s d i s h , washed t h r e e  times  I c e - c o l d 0.2 M KC1 was added to the g e l  The p r o t e i n bands were e x c i s e d  very  s m a l l p i e c e s and then p l a c e d  0.1%  (w/v) SDS.  room temperature. filtered  The c o n t e n t s  from the g e l , c u t i n t o  i n a screw-cap tube w i t h 4-5 volumes o f  The tube was i n c u b a t e d  with  shaking  f o r f o u r hours a t  o f the tube were p l a c e d  through a 45 um A c r o d i s c  a c i d was added t o the f i l t r a t e After  i n the  A f t e r 5 min the w h i t e p r o t e i n bands c o u l d e a s i l y be seen a g a i n s t a  b l a c k background.  and  The s l o t  t r a n s h y d r o g e n a s e (450 ug) i n  SDS-sample b u f f e r was l a y e r e d onto the g e l .  w i t h water and c o o l e d  a 4% s t a c k i n g g e l was  filter.  to give a f i n a l  Cold  i n a 10 ml s y r i n g e  100% t r i c h l o r o a c e t i c  c o n c e n t r a t i o n o f 12%.  i n c u b a t i o n on i c e f o r 2 h, the p r e c i p i t a t e was c o l l e c t e d by  c e n t r i f u g a t i o n f o r 15 min  i n a M i c r o - C e n t r i f u g e at 0-4°C.  The  protein  p e l l e t was washed t h r e e times w i t h i c e - c o l d 10% t r i c h l o r o a c e t i c a c i d three times w i t h i c e - c o l d acetone. vacuum d e s i c c a t o r .  The sample was  f o r p r o t e i n sequencing.  s t a i n i n g when a sample was  in a  then sent to the U n i v e r s i t y o f V i c t o r i a  100 ug on the b a s i s o f the i n t e n s i t y o f  run on a Laemmli g e l .  I s o l a t i o n o f Transhydrogenase  instructions.  dried  The amount o f each s u b u n i t r e c o v e r e d was  e s t i m a t e d to be between 50 and  The BRL  The p r o t e i n p e l l e t was  and  Subunits u s i n g the Prep-Gel  Prep-Gel apparatus was  Apparatus  used a c c o r d i n g to the manufacturer's  A 6 cm 10% Laemmli g e l w i t h a 1 cm 4% s t o c k i n g g e l was  i n the a p p a r a t u s .  Laemmli r u n n i n g b u f f e r c o n t a i n i n g 0.1 mM  m e r c a p t o a c e t a t e was  used.  flow r a t e o f 10 ml/h e l u t e d a f t e r 5-6  sodium  A sample c o n t a i n i n g 50-200 ug o f p u r i f i e d  transhydrogenase i n SDS-sample b u f f e r was E l e c t r o p h o r e s i s was  cast  l a y e r e d on the g e l .  c a r r i e d out a t 150 V, c o l l e c t i n g a t room temperature.  The  10 min  f r a c t i o n s at a  transhydrogenase s u b u n i t s  h.  P r o t e i n Assay P r o t e i n c o n c e n t r a t i o n was  determined a c c o r d i n g t o the method o f Lowry  et a l . (114) w i t h the e x c e p t i o n that 1% (w/v)  SDS was  i n c u b a t e d i n the  assays.  Assay o f Energy-Independent  Transhydrogenase  Activity  The assay o f transhydrogenase a c t i v i t y was Kaplan (113). phosphate  The r e a c t i o n was  b u f f e r , pH 7.0,  based on the method o f  c a r r i e d out a t 25°C i n 50 mM  c o n t a i n i n g 1 mM  KCN,  1 mM  sodium  d i t h i o t h r e i t o l , 0.5  mM  EDTA, 1 mM AcNAD and 0.5 mM NADPH i n a f i n a l volume o f 1 m l . The r e d u c t i o n o f AcNAD by NADPH was measured as an i n c r e a s e i n the absorbance at 375 nm u s i n g a Coleman 124 spectrophotometer recorder. One  a t t a c h e d to a c h a r t  The e x t i n c t i o n c o e f f i c i e n t was taken as 5.1 1/mmol/cm (113).  u n i t o f enzyme a c t i v i t y r e p r e s e n t s the c o n v e r s i o n o f 1 umol o f AcNAD  to AcNADH p e r min. transhydrogenase  The assay was m o d i f i e d when a s s a y i n g s o l u b l e  by i n c l u d i n g 0.025% (w/v) B r i j 35 i n the assay medium.  Assay o f Energy-Dependent Transhydrogenase  Activity  T h i s was measured by a m o d i f i c a t i o n o f the method o f F i s h e r and Sanadi  (25).  Membrane-bound transhydrogenase  was i n c u b a t e d i n an assay  medium o f 50 mM T r i s - H C l , pH 7.8, 10 mM MgSO^, 1 mM d i t h i o t h r e i t o l and 0.16  M sucrose.  The c u v e t t e was then t r a n s f e r r e d t o a Perkin-Elmer model  124 spectrophotometer, bath.  A f t e r 5 min,  m a i n t a i n e d a t 37°C by means o f a c i r c u l a t i n g water  10 y l o f e t h a n o l , 50 u l o f y e a s t a l c o h o l  dehydrogenase (4 mg/ml) and 25 u l o f 2.7 mM NAD were added.  The  absorbance  After  o f the r e a c t i o n mixture a t 340 nm was monitored.  1 min,  50 u l o f 15.7 mM NADP was added and the r e d u c t i o n NADP measured (aerobic-driven transhydrogenase). exhausted,  When t h e oxygen i n the c u v e t t e was  the f o r m a t i o n o f NADPH was now due t o the energy-independent  transhydrogenase.  10 u l o f 65 mM ATP, pH 7.8, was added and the new  r a t e o f NADP r e d u c t i o n was measured (ATP-driven t r a n s h y d r o g e n a s e ) . r a t e o f the energy d r i v e n transhydrogenase the r a t e o f energy-independent coefficient  was 6.22 1/mmol/cm.  The  was c o r r e c t e d by s u b t r a c t i n g  transhydrogenation.  The e x t i n c t i o n  One u n i t o f enzyme a c t i v i t y r e p r e s e n t s  the c o n v e r s i o n o f 1 umole o f NADP t o NADPH.  43.  Fluorescence  Assays  I n t r a v e s i c u l a r pH changes were f o l l o w e d f l u o r o m e t r i c a l l y w i t h 9-aminoacridine w i t h a Turner S p e c t r o f l u o r o m e t e r (model 420) u s i n g the i n d i c a t e d wavelength were conducted 5 mM  pair  i n 10 mM  h g C l , 0.5-5 2  ( e x c i t a t i o n , 420 nm;  e m i s s i o n , 500 nm).  Hepes-KOH b u f f e r , pH 7.5,  Assays  c o n t a i n i n g 300 mM  tiM 9-aminoacridine, 250 uM NADPH and  KCI,  reactions  by a d d i t i o n o f 500 \xM AcNAD.  were i n i t i a t e d  P r e p a r a t i o n of RNase that i s Free of DNase A c t i v i t y P a n c r e a t i c RNase (RNase A) was mM  d i s s o l v e d i n 10 mM  NaCl a t a c o n c e n t r a t i o n o f 10 mg/ml.  T r i s - H C l pH 7.5/15  The enzyme p r e p a r a t i o n was  f o r 15 min and then a l l o w e d to c o o l s l o w l y to room temperature. was  boiled  The  RNase  d i s p e n s e d i n t o a l i q u o t s and s t o r e d a t -20°C.  Glutamate  Dehydrogenase Assay  Glutamate  dehydrogenase was  Sakamoto e t a l . (115). quartz cuvette: containing  1 mM  0.5  f o l l o w i n g s o l u t i o n s were added to a 1 ml  ml o f 0.1  EDTA, 0.05  ammonium c h l o r i d e , 0.01 The absorbance  The  assayed u s i n g the method d e s c r i b e d by  M potassium phosphate  ml o f 0.2  ml o f 10 mM  b u f f e r , pH  M 2 - o x o g l u t a r a t e , 0.05 NADPH, 0.39  of the r e a c t i o n mixture was  8.0,  ml o f 0.4  ml o f water and  M  sample.  f o l l o w e d a t 340 nm u s i n g a  P e r k i n - E l m e r model 124 spectrophotometer m a i n t a i n e d a t 30°C by means o f a c i r c u l a t i n g water bath. sample.  The r e a c t i o n was  The same assay was  glutamine was  s t a r t e d by a d d i t i o n o f the  used f o r glutamate  synthase except t h a t 40  i n c l u d e d i n the assay i n s t e a d o f NH.Cl.  mM  44.  Pl  Transduction Bacteriophage  department.  P l v i r was o b t a i n e d from Dr. P. Dennis o f t h i s  The p r e p a r a t i o n o f l y s a t e s and t r a n s d u c t i o n s were c a r r i e d o u t  as d e s c r i b e d by M i l l e r  (116).  The l y s a t e was prepared  as f o l l o w s .  An  o v e r n i g h t b a c t e r i a l c u l t u r e from which the l y s a t e was to be prepared was used t o i n o c u l a t e (100 y l ) 10 ml o f LB media c o n t a i n i n g 0.1% (w/v) g l u c o s e and 5 mM CaCl^ i n a 50 ml f l a s k .  T h i s c u l t u r e was i n c u b a t e d  w i t h s h a k i n g u n t i l an absorbance r e a d i n g o f 0.2 a t 600 nm was o b t a i n e d . One  ml o f t h i s c u l t u r e was p l a c e d i n a t e s t  10  phage and l e f t  6  R-top agar  f o r 20 min a t 37°C.  ( 1 % (.w/v) B a c t o - t r y p t o n e ,  NaCl, 0.1% (w/v) g l u c o s e , 2 mM C a C l  tube c o n t a i n i n g about 1 x  To each tube was added 2.5 ml o f  0.1% (w/v) y e a s t e x t r a c t , 0.8% (w/v)  2 >  0.8% (w/v) agar) and the e n t i r e  contents were poured onto p l a t e s c o n t a i n i n g R-medium ( 1 % (w/v) Bacto-tryptone,  0.1% (w/v) y e a s t e x t r a c t , 0.8% (w/v) NaCl, 0.1% (w/v)  g l u c o s e , 2 mM C a C ^ , 1.2% (w/v) a g a r ) . 37°C f o r 5-6 h.  The p l a t e s were i n c u b a t e d a t  The top agar was scrapped  o f f and p l a c e d i n a screw-top  tube w i t h 4 ml o f LB media, 50 u l o f 1 M sodium c i t r a t e and 10 drops o f chloroform.  The c o n t e n t s o f the tube were mixed v i g o r o u s l y on a v o r t e x  mixer f o r 1 min and the tube was l e f t  a t 0-4°C o v e r n i g h t .  The agar was  removed by c e n t r i f u g a t i o n a t t h e maximum speed i n an I n t e r n a t i o n a l desk-top  c e n t r i f u g e f o r 30 min.  screw-top tubes bacteriophage repeated  i n the presence  The supernatant  was removed and s t o r e d i n  o f a few drops o f c h l o r o f o r m .  were t i t r a t e d u s i n g s t r a i n W1485.  The  The above procedures  f o r the t i t r a t i o n u s i n g d i f f e r e n t d i l u t i o n s o f t h e phage.  p l a t e s were i n c u b a t e d o v e r n i g h t a t 37°C and the number o f c l e a r were counted.  T i t e r s ranged from 1 x 1 0 - l x 10 s  l 1  phage/ml.  were  The  plaques  45.  T r a n s d u c t i o n s were c a r r i e d out as f o l l o w s .  O v e r n i g h t c u l t u r e s of the  d e s i r e d s t r a i n o f b a c t e r i a i n LB medium c o n t a i n i n g 10 mM added lil.  CaC^  were  to d i f f e r e n t d i l u t i o n s o f the phage s t o c k i n a t o t a l volume o f The tubes were i n c u b a t e d a t 37°C f o r 20 min.  sodium c i t r a t e was  added  400  An e q u a l volume of IM  to the c e l l s and 100 u l o f samples  o f the  t r a n s d u c t i o n mix were s t r e a k e d out onto the s e l e c t i o n media.  The  plates  were i n c u b a t e d o v e r n i g h t a t 37°C.  L a b e l l i n g o f Membrane V e s i c l e s w i t h [ C]DCCD l,t  ['"CJDCCD (50 mCi/mMole) was The e t h e r was  purchased i n e t h e r i n a s e a l e d  evaporated a t room temperature under n i t r o g e n and the d r i e d  c o n t e n t s were taken up i n a b s o l u t e e t h a n o l (5 mM Membranes were prepared and suspended c o n t a i n i n g 0.25  M s u c r o s e , 5 mM  added  10 u l o f 5 mM  [ *C]DCCD). ll  i n 10 mM  MgSO^ and 0.2 mM  p r o t e i n c o n c e n t r a t i o n o f 5 mg/ml. was  vial.  T r i s - H C l , pH  7.8,  d i t h i o t h r e i t o l at a  To 0.5 ml o f the membrane s u s p e n s i o n  [ C]DCCD i n a b s o l u t e e t h a n o l and the 1<,  s u s p e n s i o n s t i r r e d a t 4°C f o r 12 h.  The  l a b e l l e d membranes were washed  f i v e times i n b u f f e r by r e s u s p e n s i o n and c e n t r i f u g a t i o n at 250,000 x g f o r 1 h.  Crossed  Immunoelectrophoresis  T h i s was  based on the methods o f Nowotny (117), Bjerrum and Lundhal  (118) and Mayer and Walker b u f f e r , pH 8.8, X-100  c o n t a i n i n g 100 mM  a t 55°C was  p l a s t i c mold.  (119).  2.4 ml of 1% (w/v) agarose i n Bjerrum g l y c i n e , 38 mM  poured onto a 50 x 50 mm  The agarose was  T r i s and 1% (w/v)  Triton  g l a s s p l a t e surrounded by a  a l l o w e d to c o o l to 20 °C and the mold  c a r e f u l l y removed such that a 40 x 40 x 1.5 mm  g e l was  obtained.  Agarose  46.  in  the same b u f f e r was  l a y e r e d around the p e r i p h e r y  edges o f the p l a t e (agarose b r i d g e s ) the c u r r e n t .  A row  of four wells  of the c a s t g e l to  to g i v e a more u n i f o r m c o n d u c t i o n o f  (3 mm  diameter),  about 1 cm  c u t ouc w i t h a Bio-Rad g e l - p u n c h e r .  The  l e v e l s of antigen  i n a Pharmacia f l a t - b e d  and  the g e l p l a c e d  e l e c t r o p h o r e s i s u n i t at 4°C. placed  The  d e t e r g e n t , and  4°C  V.  100  e l e c t r o p h o r e s i s was  width) such t h a t each c o n t a i n e d  1%  (w/v)  placed  mm  g e l as above.  around the g e l .  of the  The  ml)  8.8,  f o r 1.5-2  into strips  end.  and  The  various  were mixed at 55°C and  A s t r i p of the g e l from the  end  o f the g e l and  e l e c t r o d e b u f f e r was  E l e c t r o p h o r e s i s was  first  cut  a sample w e l l at one  agarose i n Bjerrum b u f f e r pH 8.8  a t the c a t h o d i c  dimension.  c a r r i e d out  overlap  h at (5  mm  individual  immediately or run i n the second dimension.  a n t i s e r u m ( f i n a l volume, 2.4 40 x 1.5  was  various  i n such a manner that they d i d not  A f t e r e l e c t r o p h o r e s i s , the g e l was  s t r i p s were s t a i n e d  with  chambers were f i l l e d w i t h Bjerrum b u f f e r , pH  without any and  w e l l s were f i l l e d  apart,  Wicks, 4 cm wide ( U l t r a w i c k s , Bio-Rad) were  onto the agarose b r i d g e s  onto the w e l l s .  the  l e v e l s of  c a s t onto a 40 first-dimension  agarose b r i d g e s  c a r r i e d out p e r p e n d i c u l a r 4°C.  was  constructed  the same as i n the  dimension f o r 16 to 18 h at 10 V and  x  first  to the d i r e c t i o n  The  p r o t e i n s were  s t a i n e d w i t h F a i r b a n k ' s s t a i n (108).  Reaction  of E. c o l i Transhydrogenase w i t h  Mitochondrial  Anti-Transhydrogenase Membranes were prepared from 3 g each o f JM83 pUC13 and Tne  proteins  gel  w i t h a 4%  Tris,  192 mM  (70  ug) were separated  stacking g e l . g l y c i n e and  20%  The  on a 0.15  g e l was  cm  10%  JM83 p D C l l .  SDS/polyacrylamide  e q u i l i b r a t e d i n 500  (v/v) methanol f o r 30 min.  The  ml gel  o f 25 was  mM  p l a c e d i n a t r a n s f e r apparatus  (Bio-Rad) next to wetted n i t r o c e l l u l o s e i n  e q u i l i b r a t i o n b u f f e r and the p r o t e i n s were t r a n s f e r r e d t o the n i t r o c e l l u l o s e a t 100 V f o r 12 h. tap water-  The apparatus was c o o l e d by c i r c u l a t i n g  S t a i n i n g o f the g e l i n d i c a t e d t h a t the two transhydrogenase  s u b u n i t s had been t r a n s f e r r e d  t o the n i t r o c e l l u l o s e .  The membrane was  washed t w i c e f o r 30 min i n TBS (20 mM T r i s - H C l pH 7.5, 500 mM NaCl, 3% (w/v)  BSA) and p l a c e d i n a s e a l e d bag w i t h 1:25 d i l u t e d a n t i b o d y  (gift  from R.R. F i s h e r ) and i n c u b a t e d o v e r n i g h t a t room temperature.  Excess  a n t i b o d y was removed by washing the membrane twice w i t h 100 ml o f TBS c o n t a i n i n g 0.05% (w/v) Tween 20.  [  l 2 s  I ] P r o t e i n A was added and the  membrane i n c u b a t e d f o r 1 h i n a s e a l e d p l a s t i c bag.  The excess p r o t e i n A  was washed three times w i t h TBS c o n t a i n i n g 0.05% (w/v) Tween 20. n i t r o c e l l u l o s e was a i r d r i e d and developed by a u t o r a d i o g r a p h y . were o b s e r v e d .  The  No bands  48.  RESULTS  I.  P h y s i o l o g i c a l Role o f Transhydrogenase The  p h y s i o l o g i c a l f u n c t i o n s o f the p y r i d i n e  t r a n s h y d r o g e n a s e o f E_. c o l i  nucleotide  have n o t been e s t a b l i s h e d .  To g a i n i n s i g h t  i n t o t h e r o l e o f t h i s enzyme, mutants which l a c k t r a n s h y d r o g e n a s e were i s o l a t e d by Hanson's group (82,84).  As shown i n T a b l e  activity  2, one o f  these mutants, RH-5, has normal growth r a t e s when grown a e r o b i c a l l y on LB, or on a s y n t h e t i c medium w i t h  glucose,  g l y c e r o l o r f r u c t o s e as carbon  s o u r c e when compared t o the growth r a t e s o f the p a r e n t a l d i f f e r e n c e was o b s e r v e d between a n a e r o b i c parent  on s y n t h e t i c media w i t h  source. and  These r e s u l t s c o n f i r m  support  his conclusion  glucose  postulated  the observations  fumarate as carbon  o f Hanson's group  the e n e r g y - l i n k e d  viability.  t r a n s h y d r o g e n a s e has o f t e n been  t o a c t as a s o u r c e o f NADPH f o r the b i o s y n t h e s i s o f amino a c i d s  o f the enzyme i n the c e l l s  i n the growth medium r e p r e s s e s  (57,120).  a s s i m i l a t i o n of nitrogen.  for  the l e v e l  An i n t e r r e l a t i o n s h i p between amino  a c i d b i o s y n t h e s i s and t r a n s h y d r o g e n a s e a c t i v i t y may o c c u r  (81).  Recent work on t h e E_. c o l i  d u r i n g the  t r a n s h y d r o g e n a s e has  t h i s enzyme as a source o f NADPH f o r glutamate dehydrogenase  As shown i n F i g . 2, glutamate dehydrogenase i s one o f the pathways  a s s i m i l a t i o n o f ammonia i n E.  coli.  Liang  and Houghton (81) r e p o r t e d  t h a t glutamate dehydrogenase and t r a n s h y d r o g e n a s e a r e c o r e g u l a t e d nitrogen was  (82,84)  t h a t under normal growth c o n d i t i o n s an a c t i v e  s i n c e the presence o f the l a t t e r  implicated  No  growth r a t e s o f the mutant and  or g l y c e r o l plus  transhydrogenase i s not e s s e n t i a l to c e l l In E . c o l i ,  strain.  limitation.  grown on g l u c o s e  S i m i l a r r e s u l t s were o b t a i n e d at various  concentrations  when E.  coli  during s t r a i n W6  o f NH.Cl ( F i g . 3 ) . In  T a b l e 2.  E f f e c t o f t r a n s h y d r o g e n a s e a c t i v i t y on a e r o b i c growth  D o u b l i n g Time  Strain  Glucose  Glycerol  rates.  (min)  Fructose  LB  GMS  343  (pnt )  58  139  97  36  RH5  (pnt::Tn5)  64  131  95  38  +  C e l l s were grown i n 200 ml of M9 medium c o n t a i n i n g 0.2% indicated shaking  RH-5  was  C e l l growth was  a t 600  o f the  s o u r c e s o r i n LB medium i n 2 1 f l a s k s a t 37°C w i t h  (250 rpm).  kanamycin. culture  carbon  (w/v)  nm.  grown i n the presence o f 25 ug/ml measured from the absorbance  o f the  50.  Fig. 2  Pathways o f n i t r o g e n a s s i m i l a t i o n  i n E_. c o l i .  a-oxoglutarate HOOC-CO-CH -CHi-COOH 2  CH-CH-COOH 3'  J_  NH1  valine  (a)  CH-CO-COOH H O O C - C H - C H - C H -COOH 2  a-oxoisovalerate  2  NHi glutamate  NH  3  + ATP  glutamate  glutamate  NADP glutamine synthetase  [ glutamate synthase - NADPH?  ADP + P|  glutamine  a-oxoglutarate  v  (b)  the  range o f 0.5  dehydrogenase  t o 20 mM  NH^Cl the a c t i v i t i e s o f both glutamate  and transhydrogenase i n c r e a s e d two- t o t h r e e f o l d .  Higher  exogenous NH^Cl c o n c e n t r a t i o n s l e d to a d e c l i n e i n the s p e c i f i c a c t i v i t i e s o f both enzymes.  C o o r d i n a t e changes  transhydrogenase and glutamate dehydrogenase  i n the l e v e l s o f  c o u l d i n d i c a t e t h a t the  enzyme i s i n v o l v e d i n the s u p p l y o f NADPH, s p e c i f i c a l l y dehydrogenase  f o r glutamate  when i t f u n c t i o n s i n the s y n t h e s i s o f glutamate.  This  h y p o t h e s i s was  t e s t e d by i n a c t i v a t i n g the o t h e r pathway f o r n i t r o g e n  assimilation.  T h i s pathway i n c l u d e s glutamate s y n t h a s e .  The  strain  AB1450 ( g l t B 1 3 ) , l a c k i n g glutamate synthase a c t i v i t y ,  i s dependent  glutamate dehydrogenase  The  a c t i v i t y o f AB1450 was s t r a i n RH-5.  f o r a s s i m i l a t i o n o f ammonia.  transhydrogenase  i n a c t i v a t e d by P l t r a n s d u c t i o n from the pnt  The g l t B 1 3 pnt mutant o b t a i n e d d i d not r e q u i r e glutamate f o r  growth on a minimal s a l t s medium. of  on  the p a r e n t (Table 3,4).  I t s growth r a t e was  identical  to that  These r e s u l t s i n d i c a t e t h a t transhydrogenase  i s not the s o l e source o f NADPH f o r n i t r o g e n a s s i m i l a t i o n by glutamate dehydrogenase  II.  i n E. c o l i .  P u r i f i c a t i o n o f transhydrogenase from S t r a i n  W6  Growth o f C e l l s E. c o l i  s t r a i n W6 was  used as a source o f enzyme.  The  transhydrogenase a c t i v i t y o f t h i s s t r a i n i s c o n s i s t e n t l y h i g h e r than t h a t of  s t r a i n K-12  (81).  Transhydrogenase a c t i v i t y i s r e p r e s s e d when E .  i s grown on complex media c o n t a i n i n g h i g h l e v e l s o f amino a c i d s T r a n s f e r r i n g o f such c e l l s to  coli  (81,120).  i n t o a g l u c o s e minimal medium r e s u l t s i n a 5-  1 0 - f o l d i n c r e a s e i n transhydrogenase a c t i v i t y  (55).  Therefore, i n  Fig.  3.  E f f e c t of exogenous NH^Cl on glutamate dehydrogenase  transhydrogenase a c t i v i t i e s  i n E. c o l i W6.  c o n t a i n i n g v a r i o u s c o n c e n t r a t i o n s o f NH^Cl. l a t e - e x p o n e n t i a l phase nm)  the  C e l l s were grown on M9 medium The c e l l s were h a r v e s t e d i n  (as determined by the absorbance of c u l t u r e s at  and washed twice w i t h TED b u f f e r (50 mM  dithiothreitol).  and  T r i s - H C l , pH 7.8,  1 mM  Membrane and c y t o p l a s m i c f r a c t i o n s were prepared from  c e l l s , and the glutamate dehydrogenase  (PNT) a c t i v i t i e s measured as d e s c r i b e d Measurements were o b t a i n e d a t l e a s t  (GDH)  and  transhydrogenase  i n M a t e r i a l s and Methods.  from two s e p a r a t e experiments.  600  53.  Table 3.  Role o f transhydrogenase i n the a s s i m i l a t i o n o f ammonia.  Enzyme A c t i v i t i e s D o u b l i n g time (min)  Strain  GMS  343  [umoles min" (mg 1  Transhydrogenase  protein)" ]  Glutamate dehydrogenase  1  Glutamate synthase  68  0.36  0.28  0.38  RH-5(pnt::Tn5)  65  0  0.24  0.38  AB1450(gltB13)  78  0.18  0.42  0  AB1450(pnt::Tn5,gltB13)  80  0  0.37  0  C e l l s were grown i n 200 ml o f M9  media ( c o n t a i n i n g 25 ug/ml o f  transhydrogenase mutants) i n 2 1 f l a s k s at  37°C w i t h  c e l l s was measured  600  u s i n g the absorbance at  nm.  l a t e - e x p o n e n t i a l phase and washed w i t h TED b u f f e r .  shaking. The  kanamycin f o r The growth o f  c e l l s were harves ted  the in  Enzyme assays and the  p r e p a r a t i o n o f membrane and c y t o p l a s m i c f r a c t i o n s are d e s c r i b e d i n M a t e r i a l s and Methods.  54.  T a b l e 4.  E f f e c t o f transhydrogenase synthase mutants.  mutation  on the growth of  D o u b l i n g Time  Strain  Glucose  Fructose  glutamate  (min)  Glycerol  LB  AB  1450  (gltB13)  78  106  146  31  AB  1450  ( g l t B 1 3 , pnt::Tn5)  80  98  144  35  C e l l s were grown i n 200 ml o f M9 medium c o n t a i n i n g 0.2%  (w/v)  o f the  i n d i c a t e d carbon source or i n LB medium i n 2 1 f l a s k s a t 37°C w i t h (250 rpm).  AB  1450  25 ul/ml kanamycin. nm.  ( g l t B 1 3 , pnt::Tn5) was C e l l growth was  grown i n the presence  measured from the absorbance  shaking  of at  600  order to maximize the e x p r e s s i o n o f transhydrogenase, a g l u c o s e minimal medium. membranes prepared  c e l l s were grown i n  The s p e c i f i c a c t i v i t y o f transhydrogenase  in  from c e l l s grown under these c o n d i t i o n s ranged from 0.9  t o 1.3 pmoles/min per mg o f p r o t e i n .  S e l e c t i o n o f Detergent Transhydrogenase i s an i n t e g r a l component o f the c y t o p l a s m i c membrane.  In c o n t r a s t to w a t e r - s o l u b l e p r o t e i n s , membrane-bound p r o t e i n s  must be r e l e a s e d from the membranes p r i o r to p u r i f i c a t i o n . detergent  should s a t i s f y c e r t a i n c o n d i t i o n s .  be a b l e t o r e l e a s e a s i g n i f i c a n t percentage membrane.  First,  An e f f e c t i v e  the d e t e r g e n t  should  o f the enzyme from the  Second, i t should not i n a c t i v a t e the enzyme under  study.  T h i r d , i t would g r e a t l y a i d the p u r i f i c a t i o n scheme i f the d e t e r g e n t s e l e c t i v e l y s o l u b i l i z e a s i g n i f i c a n t amount o f the enzyme s o l u b i l i z i n g o t h e r membrane-bound p r o t e i n s .  without  On the b a s i s o f these  c r i t e r i a a number o f d e t e r g e n t s were t e s t e d to s e l e c t a s u i t a b l e f o r the e x t r a c t i o n o f the transhydrogenase  could  detergent  from the c y t o p l a s m i c membrane.  S t r a i n ML 308-225 was used as s t a r t i n g m a t e r i a l f o r these p r e l i m i n a r y experiments. Membrane v e s i c l e s were prepared detergents. if The  and t r e a t e d w i t h v a r i o u s l e v e l s o f  Transhydrogenase a c t i v i t y was c o n s i d e r e d as being  solubilized  i t was n o t sedimented f o l l o w i n g c e n t r i f u g a t i o n a t 200,000 x g f o r 2 h. f o l l o w i n g detergents  transhydrogenase  solubilized  l e s s than 25% o f the membrane-bound  and were c o n s i d e r e d i n e f f e c t i v e : c h o l a t e ,  taurodeoxycholate,  deoxycholate,  T r i t o n X-100, B r i j 35, B r i j  96, L u b r o l  WX, Aminoxide WS 35 and n - o c t y l - f i - D - g l u c o s i d e when used a t c o n c e n t r a t i o n s up t o 2%.  The r e s u l t s  o f the treatment w i t h v a r i o u s d e t e r g e n t s which  s o l u b i l i z e d more than 25% o f the a c t i v i t y a r e shown i n F i g . 4.  Optimal  s o l u b i l i z a t i o n o f the transhydrogenase a c t i v i t y was o b t a i n e d w i t h the d e t e r g e n t sodium d e o x y c h o l a t e i n the presence o f 1 M KCI.  At a d e t e r g e n t  to p r o t e i n r a t i o o f 0.8, 100% o f the a c t i v i t y was s o l u b i l i z e d .  Some  s t i m u l a t i o n o f transhydrogenase o c c u r s i n the presence o f d e o x y c h o l a t e as 12% o f the o r i g i n a l  a c t i v i t y was d e t e c t e d i n the p e l l e t  fraction.  Deoxycholate e x h i b i t e d some s e l e c t i v i t y , i n t h a t o n l y 34% o f the membrane p r o t e i n was s o l u b i l i z e d  a t a d e t e r g e n t t o p r o t e i n r a t i o o f 0.8.  Taurodexoycholate i n the presence o f 1 M KCI a l s o significant  amounts o f transhydrogenase a c t i v i t y .  p r o t e i n r a t i o o f 0.4, t a u r o d e o x y c h o l a t e s o l u b i l i z e d but o n l y 37% o f the membrane Dodecyl-6-D-maltoside  solubilized  At a d e t e r g e n t t o 73% o f the a c t i v i t y  protein.  and N - l a u r o y l s a r c o s i n e s o l u b i l i z e d  the  transhydrogenase a c t i v i t y but w i t h l e s s  the  results  over 50% o f  s e l e c t i v i t y when compared t o  o b t a i n e d w i t h d e o x y c h o l a t e and t a u r o d e o x y c h o l a t e .  At a  d e t e r g e n t t o p r o t e i n r a t i o o f 1, dodecyl-IJ-D-maltoside s o l u b i l i z e d the  transhydrogenase a c t i v i t y and 49% o f the membrane p r o t e i n .  s a r c o s i n e e x h i b i t e d the l e a s t  N-lauroyl  s e l e c t i v i t y o f the d e t e r g e n t s t e s t e d .  r a t i o o f 0.6, 65% o f the membrane p r o t e i n was s o l u b i l i z e d ,  64% o f  At a  but o n l y 50% o f  the  transhydrogenase was d e t e c t e d i n the s u p e r n a t a n t .  the  a c t i v i t y was found i n the p e l l e t , 45% o f the a c t i v i t y was i n a c t i v a t e d . It i s c l e a r  the KCI.  Since o n l y 5% o f  from these s t u d i e s that the most s u i t a b l e d e t e r g e n t f o r  s o l u b i l i z a t i o n o f transhydrogenase i s d e o x y c h o l a t e i n the presence o f  F i g . 4.  S o l u b i l i z a t i o n o f membrane-bound  detergents.  Membrane v e s i c l e s  transhydrogenase w i t h v a r i o u s  i n TED b u f f e r a t a p r o t e i n c o n c e n t r a t i o n o f  5 mg/ml were t r e a t e d w i t h v a r i o u s l e v e l s o f d e t e r g e n t as d e s c r i b e d i n M a t e r i a l s and Methods.  N-lauroyl sarcosine  (•-•); sodium deoxycholate i n  the presence o f 1 M KC1 ( o - o ) ; t a u r o d e o x y c h o l a t e i n the presence o f IM KC1 (u-u); dodecyl-S-D-maltoside (•-«).  Transhydrogenase Activity  Detergent-mg Protein-mg  Protein  58.  P u r i f i c a t i o n o f Transhydrogenase The p u r i f i c a t i o n procedure o u t l i n e d under r e p r e s e n t e d i n T a b l e 5.  'Methods and M a t e r i a l s ' i s  The p u r i t y o f the transhydrogenase a t v a r i o u s  stages was a s s e s s e d by SDS-polyacrylamide g e l e l e c t r o p h o r e s i s  (Fig. 5).  To remove p e r i p h e r a l p r o t e i n s l i k e l y t o contaminate the s o l u b i l i z e d transhydrogenase, membrane v e s i c l e s were e x t r a c t e d s e q u e n t i a l l y w i t h 2 M urea and low s a l t b u f f e r .  Over 90% o f the transhydrogenase a c t i v i t y was  r e t a i n e d i n the membrane v e s i c l e s a f t e r these washing  procedures.  The e x t r a c t e d membrane v e s i c l e s were i n c u b a t e d w i t h 0.6% d e o x y c h o l a t e i n the presence o f 1 M KCI. from forming a g e l .  C h o l a t e was added t o p r e v e n t the d e o x y c h o l a t e  A f t e r c l a r i f i c a t i o n by c e n t r i f u g a t i o n ,  24% o f the  t o t a l membrane p r o t e i n and 75% o f the transhydrogenase a c t i v i t y in  remained  solution. The h i g h c o n c e n t r a t i o n o f s a l t had t o be removed p r i o r t o  ion-exchange chromatography.  A r a p i d d e s a l t i n g procedure was developed  u s i n g hydrophobic chromatography.  The s o l u b i l i z e d  transhydrogenase was  adsorbed onto a minimal amount o f phenyl-Sepharose. washing  KCI was removed by  the r e s i n w i t h a column volume o f b u f f e r and the transhydrogenase  then e l u t e d w i t h T r i t o n X-100.  A l t h o u g h ion-exchange  chromatography  was  performed i n the presence o f the d e t e r g e n t B r i j 35, t h i s d e t e r g e n t was found t o be i n e f f e c t i v e i n e l u t i n g the bound transhydrogenase from phenyl-Sepharose.  R e c o v e r i e s o f about 90% were o b t a i n e d d u r i n g t h i s s t e p  when T r i t o n X-100 was used. The m a t e r i a l from phenyl-Sepharose was adsorbed onto a DEAE-Bio G e l A column and then e l u t e d u s i n g a 0-200 mM NaCl l i n e a r g r a d i e n t 0.05%  (w/v) B r i j 35.  containing  As shown i n F i g . 6, c o n s i d e r a b l e amount o f the  a p p l i e d p r o t e i n d i d not b i n d t o the ion-exchange r e s i n .  Transhydrogenase  T a b l e 5.  P a r t i a l p u r i f i c a t i o n o f transhydrogenase from E. c o l i  strain  W6.  Transhydrogenase Activity  Fraction  Total  Protein  %  Specific  U/mg  protein  311  100  1.3  E x t r a c t e d Enzyme  74  75  4.1  A f t e r phenyl-Sepharose chromatography  52  63  4.9  Membranes  Combined f r a c t i o n s a f t e r chromatography on DEAE-Bio-Gel A  7.8  Combined f r a c t i o n s a f t e r chromatography on NAD-Agarose  1.4  13  25  22  3.9  Membranes were p r e p a r e d from 12.1 g o f c e l l s .  After  t r e a t i n g the  membranes w i t h 2 M u r e a , the transhydrogenase was s o l u b i l i z e d d e t e r g e n t d e o x y c h o l a t e i n the presence o f KC1.  After  by the  d e s a l t i n g the  e x t r a c t u s i n g phenyl-Sepharose, the enzyme was p a r t i a l l y p u r i f i e d ion-exchange and a f f i n i t y chromatography.  Experimental d e t a i l s  p u r i f i c a t i o n a r e d e s c r i b e d i n M a t e r i a l s and Methods.  using  o f the  60.  F i g . 5.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f f r a c t i o n s  stages o f the transhydrogenase p u r i f i c a t i o n sample was  from E. c o l i  removed a t each o f the v a r i o u s stages o f the  at various  s t r a i n W6. purification  scheme o u t l i n e d i n T a b l e 5 and a n a l y z e d by SDS/polyacrylamide g e l e l e c t r o p h o r e s i s as d e s c r i b e d i n M a t e r i a l s and Methods. + NAD  -agarose.  AG-NAD ; +  A  F i g . 6.  Separation  Solubilized  o f transhydrogenase by ion-exchange  transhydrogenase  by hydrophobic chromatography,  (50 mg was  chromatography.  o f p r o t e i n ) , which had been d e s a l t e d subjected  18 cm DEAE B i o G e l A column as d e s c r i b e d  to chromatography  on a 1.5  i n M a t e r i a l s and Methods.  F r a c t i o n s o f 4.2 ml were c o l l e c t e d and assayed f o r transhydrogenase activity  («-a).  P r o t e i n was  (u-u) and NaCl c o n c e n t r a t i o n  detected  from the absorbance  by c o n d u c t i v i t y  32 were saved.  Fraction  Number  (o-o).  at 280  nm  F r a c t i o n s 28 to  x  a c t i v i t y was d e t e c t e d i n f r a c t i o n s 24-35 w i t h the peak f r a c t i o n s a t 100 mM N a C l .  eluting  Most o f t h e a p p l i e d p r o t e i n was e l u t e d o f f t h e column  p r i o r t o the appearance  o f transhydrogenase a c t i v i t y i n the e l u a n t .  F r a c t i o n s 28-32 were p o o l e d and the b u f f e r was exchanged t o 10 mM phosphate  sodium  pH 7.4, 1 mM EDTA, 1 mM DTT and 0.05 mg/ml B r i j 35 u s i n g a  Sephadex G-25 column. The d e s a l t e d transhydrogenase a p p l i e d t o a column o f NAD agarose.  from the i o n exchange column was The column was washed s u c c e s s i v e l y  w i t h e q u i l i b r a t i o n b u f f e r , b u f f e r c o n t a i n i n g 20 mM NaCl, b u f f e r 5 mM NADH, and b u f f e r w i t h 10 mM NADH.  containing  As shown i n F i g . 7, most o f the  transhydrogenase a c t i v i t y was e l u t e d w i t h 10 mM NADH, a l t h o u g h s i g n i f i c a n t amounts were e l u t e d by the 20 mM NaCl wash.  The t o t a l number o f u n i t s o f  transhydrogenase r e c o v e r e d a f t e r t h i s s t e p r e p r e s e n t e d 1-4% o f the starting material.  A n a l y s i s o f t h e p u r i f i e d transhydrogenase u s i n g  SDS-PAGE showed t h e presence o f t h r e e major p r o t e i n bands o f m o l e c u l a r weights  100,000, 52,000 and 47,000, as w e l l as s e v e r a l minor p r o t e i n bands.  The p u r i f i c a t i o n procedure d i s c u s s e d above was n o t e n t i r e l y satisfactory.  Y i e l d s o f transhydrogenase were low and the p u r i t y o f t h e  m a t e r i a l v a r i e d g r e a t l y from p u r i f i c a t i o n t o p u r i f i c a t i o n . v a r i a b i l i t y o c c u r r e d d u r i n g the ion-exchange steps.  D u r i n g ion-exchange  chromatography,  when the transhydrogenase e l u t e d protein.  or a f f i n i t y  The g r e a t e s t chromatography  the b e s t p u r i f i c a t i o n o c c u r r e d  l a t e r than the b u l k o f t h e a p p l i e d  U n f o r t u n a t e l y , i n many cases the two peaks would o v e r l a p  s l i g h t l y r e s u l t i n g i n a l e s s pure transhydrogenase p r e p a r a t i o n . and p u r i t y o f the transhydrogenase f o l l o w i n g a f f i n i t y v a r i e d from r u n t o r u n . was  The y i e l d  chromatography  Another problem w i t h the p u r i f i c a t i o n  procedure  t h a t the transhydrogenase p r e p a r a t i o n was contaminated w i t h s e v e r a l  other  proteins.  F i g . 7.  P u r i f i c a t i o n o f transhydrogenase by a f f i n i t y  Partially purified chromatography described  transhydrogenase  (fractions  buffer containing  and Methods.  The column was washed  1-3), b u f f e r c o n t a i n i n g  20 mM NaCl  successively (fraction 4),  5 mM NADH ( f r a c t i o n 8 ) , and transhydrogenase e l u t e d w i t h  10 mM NADH ( f r a c t i o n 11). activity  (7.8 mg) was s u b j e c t e d to  on a 1 x 3 cm AG-NAD Type I column (P-L B i o c h e m i c a l s ) as  i n Materials  with buffer  chromatography.  Each f r a c t i o n was assayed f o r transhydrogenase  (•-•).  Fraction Number  64.  Transhydrogenase i s found c e l l membrane. difficulty  was  i n r e l a t i v e l y minor amounts i n the E_. c o l i  T h i s i n c r e a s e s the d i f f i c u l t y overcome by  i n c r e a s i n g the e x p r e s s i o n  by c l o n i n g the pnt gene onto a m u l t i - c o p y  III.  of  This  transhydrogenase  plasmid.  C l o n i n g o f the pnt Gene  I d e n t i f i c a t i o n o f the pnt  plasmids  Mutants d e f e c t i v e i n the e x p r e s s i o n exhibit  a r e a d i l y d e t e c t a b l e phenotype.  t h a t E_. c o l i and  of p u r i f i c a t i o n .  o f t r a n s h y d r o g e n a s e do Hanson and  Rose (84)  not  reported  s t r a i n s d e f e c t i v e i n both g l u c o s e - 6 - p h o s p h a t e dehydrogenase  t r a n s h y d r o g e n a s e produced much s m a l l e r c o l o n i e s when grown  a n a e r o b i c a l l y on minimal media p l a t e s when compared to the parent was  d e f e c t i v e i n g l u c o s e - 6 - p h o s p h a t e dehydrogenase a l o n e .  found  the d i f f e r e n c e i n c o l o n y  s i z e between the two  which  However, I  s t r a i n s to be  negligible. T h i s p r o p e r t y r u l e d out  any  s c r e e n i n g o f an E. c o l i  based on a r e c o g n i z a b l e p h e n o t y p i c Therefore, rationale  the C l a r k e and t h a t E_. c o l i  change when s e e k i n g  10-19, pLC  based on  c e l l s harboring multicopy  plasmids  containing  pLC  27-35 c o n t a i n e d  8-  t r a n s h y d r o g e n a s e a c t i v i t y when compared w i t h (Table 6).  Over 90%  membranes o f these  locus.  screened  2,200 c l o n e s o f the C l a r k e and  26-24, and  the pnt  bank  Carbon c o l o n y bank was  pnt gene would c o n t a i n e l e v a t e d l e v e l s o f the enzyme. approximately  plasmid  Expression  the  Among the  Carbon c o l l e c t i o n ,  clones  pLC  to 1 0 - f o l d more the o t h e r c l o n e s o f the bank  of the enzyme a c t i v i t y was  cells.  the  o f E_. c o l i  associated with  the  transhydrogenase  i s maximal when c e l l s are grown i n minimal media f r e e o f h i g h  activity  levels  of  65.  Table 6.  Transhydrogenase a c t i v i t y i n membranes o f s e l e c t e d s t r a i n s C l a r k e - C a r b o n c o l o n y bank  Transhydrogenase A c t i v i t y  from the  (umoles/min/mg p r o t e i n )  Strain LB medium  MV12(pLC  a  14-12)  M9 medium  0.04  0.18  MV12(pLC 10-19)  0.32  1.33  MV12(pLC 26-24)  0.38  1.52  MV12(pLC 27-35)  0.42  1.80  a  T h e l e v e l o f transhydrogenase a c t i v i t y i n t h i s s t r a i n i s t y p i c a l o f those s t r a i n s not c a r r y i n g the pnt gene on a C o l E I p l a s m i d .  amino a c i d s  (57).  Increased l e v e l s o f transhydrogenase were observed when  each o f the pnt b e a r i n g c l o n e s was  grown i n minimal M9 medium.  Membranes  prepared from c e l l s grown i n minimal medium e x h i b i t e d a f o u r f o l d  increase  i n transhydrogenase a c t i v i t y as compared w i t h the transhydrogenase a c t i v i t y o f membranes prepared from c e l l s grown i n LB medium (Table 6 ) .  R e s t r i c t i o n Endonuclease A n a l y s i s o f the pnt Plasmids R e s t r i c t i o n endonuclease a n a l y s i s was  performed on the t h r e e  recombinant plasmids from the C l a r k e and Carbon c o l o n y bank to i d e n t i f y the r e g i o n s o f DNA  c o n t a i n i n g the pnt gene.  An 8 . 7 - k i l o b a s e r e g i o n  was  found t o be common to the i n s e r t s o f a l l t h r e e plasmids ( F i g . 8 ) . The r e g i o n o f the E_. c o l i genome b e a r i n g the transhydrogenase gene has been p h y s i c a l l y mapped by Bouche  1  (121).  Comparison  o f the r e s t r i c t i o n  endonuclease maps o f the plasmids w i t h t h a t o f the genome r e v e a l e d the p l a s m i d i n s e r t s o v e r l a p a r e g i o n o f the genome between 35.2 min  ( F i g . 8).  that  and  35.7  The o v e r l a p r e g i o n common to a l l t h r e e plasmids i n c l u d e d  the 35.4 min r e g i o n which i s the p o s i t i o n mapped by Hanson and Rose  (84)  f o r the pnt gene.  S u b c l o n i n g o f the pnt Gene i n t o pUC13 P l a s m i d pLC 26-24 was f o u r fragments  (10.4, 5.9,  d i g e s t e d by r e s t r i c t i o n n u c l e a s e P s t l t o g i v e 1.2  and 0.1 k i l o b a s e s ) .  The  fragments were  s e p a r a t e d by g e l e l e c t r o p h o r e s i s i n l o w - m e l t i n g - p o i n t agarose, and the 10.4  k i l o b a s e fragment was  e x c i s e d from the g e l .  P s t l - d i g e s t e d pUC13,  which had been d e p h o s p h o r y l a t e d w i t h c a l f i n t e s t i n a l phosphatase, l i g a t e d w i t h the 1 0 . 4 - k i l o b a s e fragment, and the l i g a t e d DNA t r a n s f o r m s t r a i n JM83.  White a m p i c i l l i n - r e s i s t a n t  was  was used t o  t r a n s f o r m a n t s were  67.  F i g . 8.  Comparison o f r e s t r i c t i o n  endonuclease  i n s e r t s w i t h a r e g i o n o f the E . c o l i genome. E. c o l i genome was determined  —1  -,  ,  ,  by Bouche  II  ? T  The r e s t r i c t i o n map o f the  (121).  i  pLC 10-19  T  1  II T T—L  pLC 26-24  1  II T T  pLC 27-35  1  u—1—1—i  1  i  T Genome 35 7  35.2 min Eco Rl _L  Hind III 1 Pst I -r  maps o f C o l E I plasmid  H 1kb  m  i  n  68.  s e l e c t e d and screened f o r o v e r p r o d u c t i o n o f transhydrogenase. pDCl, c o n t a i n i n g t h e 1 0 . 4 - k i l o b a s e P s t l amplified  i n s e r t e d i n t o pUC13,  transhydrogenase a c t i v i t y 2 0 - f o l d i n JM83.  A 4.8-kilobase H i n d l l l Hindlll  fragment  Plasmid  fragment  o f pDCl was subcloned i n t o the  s i t e o f pUC13 as shown i n F i g . 9 t o y i e l d plasmid pDC3.  Transhydrogenase  a c t i v i t y o f JM83 c a r r y i n g pDC3 was 5 0 - f o l d g r e a t e r when  compared w i t h JM83 h a r b o r i n g pUC13.  L o c a l i z a t i o n o f the pnt Gene i n pDC3 Plasmid pDC3 was s u b j e c t e d t o r e s t r i c t i o n endonuclease  analysis,  u s i n g the r e s t r i c t i o n endonucleases Hpal, B s t E I I , X h o l , Smal, and S a i l . A f t e r the l o c a t i o n s o f the r e s t r i c t i o n endonuclease  s i t e s had been  e s t a b l i s h e d , v a r i o u s segments o f the 4 . 8 - k i l o b a s e H i n d l l l i n s e r t s o f pDC3 o r pDC4 were removed.  Plasmids pDC3 and pDC4 d i f f e r o n l y i n the  o r i e n t a t i o n o f the i n s e r t i n the pUC13 v e c t o r . s i n g l e EcoRI s i t e .  Plasmid pUC13 c o n t a i n s a  Plasmids i n F i g . 10 a r e drawn so t h a t t h i s s i t e i s  c l o s e s t t o one end o f the i n s e r t .  The c o n s t r u c t e d plasmids were used t o  t r a n s f o r m JM83.  The c e l l s were grown and t h e i r transhydrogenase  were determined  ( F i g . 10). D e l e t i o n o f a 0 . 5 5 - k i l o b a s e Hpal-Smal  from pDC3 o r a 1 . 6 - k i l o b a s e Hpal-Smal fragment pDC8 and pDC9, r e s p e c t i v e l y , r e s u l t e d transhydrogenase a c t i v i t y .  levels fragment  from pDC4 t o g i v e plasmids  i n l o s s o f enhanced e x p r e s s i o n o f  These r e s u l t s demonstrated  t h a t a t l e a s t the  2 . 6 5 - k i l o b a s e fragment bounded by the Hpal r e s t r i c t i o n s i t e s was e s s e n t i a l f o r the e x p r e s s i o n o f enzyme a c t i v i t y .  D u r i n g the c o n s t r u c t i o n o f pDC9  from pDC4, one c l o n e was i s o l a t e d which c o n t a i n e d p l a s m i d p D C l l .  This  p l a s m i d was m i s s i n g 0 . 7 5 - k i l o b a s e s o f DNA between the Hpal and H i n d l l l sites  ( F i g . 10). There was no Hpal s i t e a t t h i s p o i n t i n pDC4 so the  69.  F i g . 9.  S u b c l o n i n g o f DNA c a r r y i n g  p o s i t i o n s o f the r e s t r i c t i o n  Pstl  sites  the pnt gene.  The plasmids and  a r e drawn a p p r o x i m a t e l y to s c a l e .  relative  70.  Fig.  10.  R e s t r i c t i o n endonuclease maps o f plasmids c o n t a i n i n g the pnt  gene and transhydrogenase a c t i v i t i e s h a r b o r i n g each o f the p l a s m i d s . i n t o JM83.  cells  Plasmids were c o n s t r u c t e d and transformed  Membranes were prepared from t r a n s f o r m a n t s grown i n LB medium  and assayed f o r transhydrogenase activity  o f membranes prepared from  (PNT) a c t i v i t y .  The transhydrogenase  o f membranes prepared from JM83 pUC 13 was 0.035 U/mg  protein.  Symbols: P, Pat I; H, Hind I I I ; B, B s t E I I ; Hp, Hp_a I; E, E c £ R l ; S, S a l I ; X, Xho I ; T, S s t I ; M, Sma I ; s o l i d  P  L  A  S  M  „nr  1  P°C  1  n  I  l i n e s are inserted  DNA.  PNT ACTIViTYfUmg)  D  P  H  Hp  1  LI  '  nr  T  ?  H  P  H  ES  ES  E  Hp  H  P  i,  LZ  1  i  Hp 1  H 1  E  J,  0.702  1.82  EMP - n r .  H  Hp  P  i  i—  D t  -  4  ES  E  ijJ—1|  X PDC  11  ^  H  E  T  8  S  E  E ~  R  PDC  pDC  H  Q  23  H  d.  H  p  ?  E  H P  kb  H  1  -  p U C 13  1.73  1  T  2  3  9  E H  ES  E  X  B  S  E S  1  P  - H  0.032  B T  o  T  p  0.042  E H P  T ME  o  0.038  E  B E  „ „  i,  H  X P D C 21  r  PME  B  —ij  E  i i J  Hp  E  X Hp  i  9  HST  iZ  B  X PDC  Hp  2.41  H  P  cleavage may have been made by another enzyme c o n t a i n e d i n the Hpal preparation.  This plasmid conferred to 70-fold a m p l i f i c a t i o n o f  transhydrogenase  a c t i v i t y i n the membranes o f JM83 ( F i g . 10).  was f u r t h e r l o c a l i z e d by treatment w i t h the exonuclease  The gene  BAL31•  Plasmid  p D C l l c o n t a i n s a s i n g l e H i n d l l l s i t e a t one j u n c t i o n o f the pUC13 and i n s e r t DNA  ( F i g . 10) and a s i n g l e S s t I s i t e w i t h i n v e c t o r pUC13 a t the  other j u n c t i o n .  The plasmid was f i r s t  w i t h BAL31 f o r d i f f e r e n t  c l e a v e d w i t h S s t I and then  l e n g t h s o f time.  The BAL31-treated  treated  i n s e r t s were  c l e a v e d w i t h H i n d l l l t o r e l e a s e the fragments and then l i g a t e d i n t o the H i n d l l l and H i n d i s i t e s o f pUC13.  The r e s u l t i n g plasmids were used t o  t r a n s f o r m JM83.  The s m a l l e s t plasmid pDC15 s t i l l  r e t a i n i n g the  transhydrogenase  gene was then i s o l a t e d , and the process d e s c r i b e d above  was r e p e a t e d f o r the o t h e r end o f the i n s e r t i n t h i s plasmid by  first  c l e a v i n g w i t h H i n d l l l f o l l o w e d by d i g e s t i o n f o r v a r i o u s l e n g t h s o f time w i t h BAL31.  The d i g e s t e d i n s e r t s ware r e l e a s e d from the plasmid by  cleavage w i t h S s t I and then l i g a t e d pUC13. insert. of  i n t o the S s t I and H i n d i s i t e s o f  One o f the r e s u l t i n g p l a s m i d s , pDC21, c o n t a i n e d a 3.05-kilobase I n s e r t s 50 t o 100 base p a i r s s m a l l e r a t e i t h e r end o f the i n s e r t  pDC21 d i d not e x h i b i t transhydrogenase  activity.  c o n f e r r e d a 7 0 - f o l d a m p l i f i c a t i o n o f transhydrogenase  Plasmid  pDC21  a c t i v i t y i n the  membranes o f JM83 ( F i g . 1 0 ) .  I d e n t i f i c a t i o n o f the pnt Gene Products D u r i n g the course o f t h i s study, we found t h a t the pnt gene p r o d u c t s i r r e v e r s i b l y aggregated when s o l u b i l i z e d  i n SDS g e l e l e c t r o p h o r e s i s  b u f f e r a t 100°C and d i d not e n t e r SDS-polyacrylamide electrophoresis.  sample  gels during  However, two p r o t e i n p r o d u c t s o f m o l e c u l a r weight 52,000  72.  and 48,000 were observed  i n the g e l s o f membranes from JM83 ( p D C l l ) , but  not i n t h e g e l s o f membranes from JM83 (pUC13), when s o l u b i l i z a t i o n i n SDS sample b u f f e r was c a r r i e d out a t 37°C ( F i g . 1 1 ) . To e s t a b l i s h t h a t the two p r o t e i n p r o d u c t s o f m o l e c u l a r  weights  52,000 and 48,000 were p l a s m i d encoded, an i n v i t r o t r a n s c r i p t i o n / t r a n s l a t i o n system was used w i t h p l a s m i d p D C l l as template. The p r o t e i n s , l a b e l l e d w i t h SDS-polyacrylamide  [ SJmethionine, 35  were s e p a r a t e d by  g e l e l e c t r o p h o r e s i s and v i s u a l i z e d by a u t o r a d i o g r a p h y  o f the d r i e d g e l s .  Two r a d i o a c t i v e p o l y p e p t i d e s o f m o l e c u l a r  52,000 and 48,000 were observed  t o be p r o d u c t s o f the in v i t r o  weights translation  o f p D C l l but not o f pUC13 ( F i g . 12). These two p r o d u c t s correspond two  p o l y p e p t i d e s a m p l i f i e d i n membranes o f JM83 ( p D C l l ) .  lower-molecular-weight  t o the  The  r a d i o a c t i v e p o l y p e p t i d e s seen on the g e l a r e  p r o d u c t s o f the pUC13 v e c t o r DNA. Two p o l y p e p t i d e s o f a combined m o l e c u l a r weight r e q u i r e the c o d i n g c a p a c i t y o f about  2.7 k i l o b a s e s o f DNA.  w i t h the o b s e r v a t i o n t h a t a t l e a s t a 3 . 0 5 - k i l o b a s e the e x p r e s s i o n o f enzyme a c t i v i t y .  T h i s agrees  insert i s required for  To e s t a b l i s h whether o r not both  p o l y p e p t i d e s were needed f o r transhydrogenase the v a r i o u s plasmids  o f 100,000 would  a c t i v i t y , the p r o d u c t s o f  ( F i g . 10) were examined by SDS-polyacrylamide g e l  e l e c t r o p h o r e s i s ( F i g . 1 3 ) . The e x p r e s s i o n o f both p o l y p e p t i d e s was observed  i n JM83 membranes c o n t a i n i n g e i t h e r p D C l l o r pDC21, and  a m p l i f i c a t i o n o f transhydrogenase  a c t i v i t y o c c u r r e d i n both c a s e s .  S i m i l a r r e s u l t s were o b t a i n e d w i t h plasmids pDCl, pDC3, and pDC4 (data not shown).  N e i t h e r o f the two p o l y p e p t i d e s was observed  c e l l s c o n t a i n i n g pUCl3 o r pDC8.  i n the membranes o f  Only one membrane-bound p r o t e i n was  observed as a product o f p l a s m i d pDC9.  No i n c r e a s e i n transhydrogenase  73  Fig.  11. SDS p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f membranes o f JM83  c o n t a i n i n g e i t h e r pUC 13 o r pDC 11.  Membranes were s o l u b i l i z e d  i n SDS  sample b u f f e r a t e i t h e r 37°C f o r 10 min o r a t 100°C f o r 3 min p r i o r t o electrophoresis.  Lane 1, m o l e c u l a r weight markers; lane 2, JM83 (pUC 13)  membranes s o l u b i l i z e d solubilized  a t 100°C; lane 3, JM83 (pDC 11) membranes  a t 100°C; lane 4, JM83 (pUC 13) membranes s o l u b i l i z e d  lane 5, JM83 (pDC 11) membranes s o l u b i l i z e d  2  94K« 67K<  43K<  3 4  5  a t 37°C.  a t 37°C  74.  F i g . 12.  Autoradiograph  [ Sjmethionine-labeled 3 s  (lane 4) as templates Plasmid DNA  was  o f SDS  polyacrylamide e l e c t r o p h o r e s i s g e l of  products u s i n g plasmids  pUC  i n c u b a t e d a t 37°C f o r 40 min.  terminated by c o o l i n g to 0°C.  The  pg DNA  pDC  11  system.  per m l .  The  The r e a c t i o n was  Samples o f the r e a c t i o n m i x t u r e were mixed w i t h  an equal volume o f e l e c t r o p h o r e s i s sample b u f f e r and electrophoresis.  ( l a n e 3) and  i n an i n v i t r o t r a n s c r i p t i o n / t r a n s l a t i o n  added to f i n a l c o n c e n t r a t i o n of 100  r e a c t i o n m i x t u r e was  13  10 u l was  used f o r  p o l y p e p t i d e s o f lane 1 ( m o l e c u l a r weight markers) and  lane 2 (membrane p o l y p e p t i d e s o f JM83 pDC  12  94K  3  11) were s t a i n e d w i t h Coomassie b l u e .  4  —  67K  43K  mm  30K*»  ii  75.  F i g 13.  SDS p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f membrane f r a c t i o n s o f JM83  carrying hybrid plasmids.  Lanes 1,9, m o l e c u l a r weight markers; l a n e s 2,8,  JM83 (pUC 1 3 ) ; lane 3, JM83 (pDC 9 ) ; lane 4, JM83 (pDC 23); lane 5, JM83 (pDC 21); lane 6, JM83 (pDC 8 ) ; lane 7, JM83 ( p D C l l ) .  1 234  5 6 7 8 9  94K —  — 94K  67K«»  ••67K  43K mm  • 43K  30K'  - *»  30K  a c t i v i t y was d e t e c t e d i n these membranes, i n d i c a t i n g t h a t the 52,OOO-molecular-weight p o l y p e p t i d e a l o n e i s n o t c a p a b l e o f transhydrogenation. The  p o s s i b i l i t y t h a t the 48,OOO-molecular-weight p o l y p e p t i d e alone i s  r e s p o n s i b l e f o r transhydrogenase p l a s m i d pDC23 from p D C l l .  a c t i v i t y was examined by c o n s t r u c t i n g  P l a s m i d p D C l l was d i g e s t e d w i t h S a i l and  B s t E I I , and the r e c e s s e d 3' ends o f the DNA were f i l l e d l i g a t i o n , u s i n g the Klenow fragment  i n before  o f E. c o l i DNA polymerase.  r e s u l t i n g p l a s m i d , pDC23, was used t o t r a n s f o r m s t r a i n JM83.  The Membranes  prepared from the transformed s t r a i n c o n t a i n e d the 48,OOO-molecular-weight p o l y p e p t i d e and a p o l y p e p t i d e o f m o l e c u l a r weight  42,000 ( F i g . 1 3 ) .  The  l a t t e r may be a t r a n s l a t i o n product o f the r e s i d u a l DNA r e s u l t i n g from the 0.45-kilobase d e l e t i o n .  No i n c r e a s e i n transhydrogenase  d e t e c t e d i n these membranes  a c t i v i t y was  ( F i g . 13), i n d i c a t i n g t h a t the  48,OOO-molecular-weight p o l y p e p t i d e a l o n e i s not capable o f transhydrogenation.  Complementation o f Transhydrogenase  Activity  F u r t h e r e v i d e n c e t h a t the 52,000- and 48,OOO-molecular-weight p o l y p e p t i d e s compose the transhydrogenase  enzyme and were not merely  s t i m u l a t i n g e x p r e s s i o n o f the chromosomally encoded transhydrogenase comes from complementation  t e s t s w i t h s t r a i n RH-5.  In t h i s  gene  strain,  t r a n s p o s o n Tn5 i s i n s e r t e d i n the pnt l o c u s w i t h the r e s u l t t h a t t h e r e i s complete  l o s s o f transhydrogenase  activity  (84).  Since RH-5  transformed  p o o r l y , the d e f e c t i v e pnt l o c u s was transduced i n t o AB1450, u s i n g b a c t e r i o p h a g e P l and s e l e c t i n g  f o r kanamycin r e s i s t a n c e .  T h i s s t r a i n was  then transformed w i t h plasmids pUC13, pDC9, pDC23, and pDC21.  Transhydrogenase a c t i v i t y was r e s t o r e d t o the r e c i p i e n t by pDC21 o n l y ( T a b l e 7 ) , i n d i c a t i n g t h a t both p o l y p e p t i d e s a r e p a r t o f the enzyme. Transhydrogenase a c t i v i t y c o u l d a l s o be r e s t o r e d by having  replicons  c o n t a i n i n g t h e pDC9 and pDC23 i n s e r t s transformed i n t o t h e same  cells.  Plasmid pDC23 was c l e a v e d w i t h H i n d l l l and BamHI and l i g a t e d i n t o pACYC184 which had been c l e a v e d w i t h H i n d l l l and BamHI t o g i v e p l a s m i d pDC50. Plasmids pDC9 and pDC50 were transformed Transformants selected.  i n t o AB1450  (pnt::Tn5).  r e s i s t a n t t o both a m p i c i l l i n and c h l o r a m p h e n i c o l were  As shown i n F i g . 14, these t r a n s f o r m a n t s c o n t a i n e d both pDC9  and pDC50.  Plasmid pDC50 i s a low-copy-number p l a s m i d and was found i n  l e s s e r amounts than the high-copy  number p l a s m i d pDC9.  Membranes  prepared  from c l o n e s c o n t a i n i n g both plasmids had an enhanced l e v e l o f transhydrogenase  activity  (0.33 U/mg p r o t e i n ) .  No  transhydrogenase  a c t i v i t y was found i n the supernatant prepared from AB1450 ( p n t ; : T n 5 ) . Membranes prepared from AB1450 had a s p e c i f i c transhydrogenase 0.04 U/mg p r o t e i n .  activity of  Both t h e 52,000 and 48,000 p r o t e i n s were found i n  membranes o f the c e l l s c o n t a i n i n g both plasmids  i n amounts c o r r e s p o n d i n g  to the plasmid copy number from which they were encoded ( F i g . 1 5 ) . These r e s u l t s c o n f i r m t h a t the transhydrogenase m o l e c u l a r weights  52,000 and 48,000.  c o n s i s t o f two s u b u n i t s o f  These w i l l be r e f e r r e d t o as the a  and IE s u b u n i t s , r e s p e c t i v e l y .  M o r p h o l o g i c a l E f f e c t s o f pnt O v e r p r o d u c t i o n The  t h r e e p l a s m i d s , pDC9, pDC23 and pDC21, c a r r y i n g i n t a c t a, 13 and  u/ft s u b u n i t s o f transhydrogenase,  and pUC13 were t r a n s f e r r e d i n t o t h e  transhydrogenase  i n a c t i v a t e d s t r a i n AB1450 pnt::Tn5.  High  l e v e l s o f the  transhydrogenase  s u b u n i t s were found i n the membranes ( F i g . 13) from  cells  78.  Table 7.  Complementation o f chromosomal on p l a s m i d s .  Strain  pnt::Tn5 by v a r i o u s pnt a l l e l e s  transhydrogenase a c t i v i t y i n membrane (umoles/min/mg p r o t e i n )  AB 1450  0.044  AB 1450 pnt::Tn5  0  AB 1450 pnt: :Tn5 pUC13  0  AB 1450 pnt: :Tn5 pDC9  0  AB 1450 pnt: :Tn5 pDC23  0  AB 1450 pnt: :Tn5 pDC21  0.94  E. c o l i s t r a i n AB 1450 pnt::Tn5 was transformed w i t h plasmids pUC13, pDC9, pDC23 and pDC21 and then grown i n LB media supplemented w i t h 25 ug/ml kanamycin and 50 ug/ml a m p i c i l l i n .  Membranes were prepared and assayed  f o r transhydrogenase a c t i v i t y as d e s c r i b e d i n M a t e r i a l s and Methods.  79.  Fig.  14.  Agarose g e l e l e c t r o p h o r e s i s o f plasmids prepared  AB 1450 c o n t a i n i n g transhydrogenase Plasmids were prepared  s u b u n i t s on s e p a r a t e  from E . c o l i  replicons.  from AB 1450 pDC50 ( l a n e 2 ) , AB 1450 pDC50 and pDC9  (lane 3) and AB 1450 pDC9 ( l a n e 4) c e l l s grown i n LB supplemented w i t h 30 ug/ml c h l o r a m p h e n i c o l  (pDC50) and/or 50 ug/ml a m p i c i l l i n  i n M a t e r i a l s and Methods.  The plasmids were d i g e s t e d w i t h  Xhol and BamHI and the fragments agarose g e l .  Lane 1:  ADNA  as d e s c r i b e d  s e p a r a t e d by e l e c t r o p h o r e s i s i n an 0.8%  c l e a v e d w i t h H i n d l l l and EcoRI.  Size (bp)  endonucleases  12  3 4  80.  F i g . 15.  SDS-polyacrylamide  g e l e l e c t r o p h o r e s i s o f membranes  prepared  from E. c o l i AB 1450 pnt::Tn5 and AB 1450 pnt::Tn5 pDC9, pDC50.  Cells  were grown i n LB media supplemented w i t h 30 ug/ml o f kanamycin. Ampicillin  (50 Ug/ml) and c h l o r a m p h e n i c o l  (30 ug/ml) were i n c l u d e d i n  the medium f o r the p l a s m i d - c o n t a i n i n g s t r a i n . e l e c t r o p h o r e s e d i n a 10% SDS/polyacrylamide and Methods.  Membranes were prepared and  g e l as d e s c r i b e d i n M a t e r i a l s  Lane 1: m o l e c u l a r weight markers; lane 2, p u r i f i e d  transhydrogenase;  l a n e 3, AB 1450 pnt::Tn5 pDC9 and pDC50 membranes;  lane 4, AB 1450 pnt::Tn5 membranes.  M  r  x10  94 67 ?  mm  43  -3  81.  c a r r y i n g pDC21.  There was an almost 8 0 - f o l d g r e a t e r e x p r e s s i o n o f  transhydrogenase a c t i v i t y when compared t o the transhydrogenase l e v e l s o f AB1450.  No growth was observed when c e l l s c o n t a i n i n g the plasmids pDC9,  pDC23 o r pDC21 were i n o c u l a t e d i n t o M9 medium and shaken a t 37°C f o r 18 h.  C e l l s c o n t a i n i n g pUC13 grew n o r m a l l y .  The presence o f the p l a s m i d s  c o n t a i n i n g transhydrogenase s u b u n i t s a l s o i n h i b i t e d growth i n LB medium and decreased the y i e l d o f c e l l s pronounced  ( T a b l e 8 ) . The i n h i b i t i o n was most  i n c e l l s c o n t a i n i n g p l a s m i d pDC21.  The y i e l d o f c e l l s was  reduced by almost 50% when compared t o the y i e l d o f c e l l s which c o n t a i n e d the p l a s m i d pUC13. O b s e r v a t i o n o f the c e l l s u s i n g phase c o n t r a s t microscopy  revealed  t h a t the s t r a i n s w i t h a h i g h l e v e l o f transhydrogenase s u b u n i t s had a heterogeneous The c e l l s  s i z e d i s t r i b u t i o n ( F i g . 16). i n t h i n s e c t i o n p r e p a r a t i o n r e v e a l e d the presence o f  t u b u l a r - l i k e s t r u c t u r e s t h a t were sometimes observed i n c e l l s o v e r p r o d u c i n g the transhydrogenase s u b u n i t s but not observed i n c e l l s c o n t a i n i n g the p l a s m i d pUC13 ( F i g . 1 7 ) . These t u b u l a r - l i k e  structures  were n o r m a l l y observed near the p o l e s o f the c e l l s . Another i n t e r e s t i n g e f f e c t o f o v e r p r o d u c t i o n o f transhydrogenase was the l o s s o f a e r o b i c - d r i v e n t r a n s h y d r o g e n a t i o n . JM83, energy-independent,  In membranes p r e p a r e d  aerobic-dependent and ATP-dependent  are 0.009, 0.036 and 0.064 U/mg p r o t e i n r e s p e c t i v e l y .  from  activities  The c o r r e s p o n d i n g  v a l u e s were 0.14, 0, and 0.44 U/mg p r o t e i n f o r JM83 pDC21.  IV.  P u r i f i c a t i o n o f Transhydrogenase  from S t r a i n JM83 pDC21  C l o n i n g o f the pnt gene t o form the m u l t i c o p y p l a s m i d pDC21 r e s u l t e d  82.  T a b l e 8.  Plasmid  Growth c h a r a c t e r i s t i c  Specific A c t i v i t y of transhydrogenase U/mg p r o t e i n  o f JM83 c a r r y i n g v a r i o u s p l a s m i d s .  R e l a t i v e Growth of Single Colonies  Growth Rate  Growth Yield  (%)  (%)  pUC13  0  1.0  100  100  pDC21  3.4  0.6  78  52  pDC9  0  0.6  80  64  pDC22  0  0.7  86  81  none  0  1.0  100  100  C e l l s were grown i n LB medium supplemented w i t h 100 ug/ml o f a m p i c i l l i n when the c e l l s c o n t a i n e d p l a s m i d s . after  The s i z e s o f c o l o n i e s were measured  growth on p l a t e s c o n t a i n i n g LB medium c o n t a i n i n g 100 ug/ml o f  a m p i c i l l i n a t 37°C o v e r n i g h t . absorbance a t 600 nm.  Growth r a t e was measured from the  The growth y i e l d was measured by adding an e q u a l  amount o f c e l l s t o 200 ml o f LB media and growing the c e l l s f o r 14 h a t 37° w i t h shaking  (250 rpm).  83.  Fig.  16.  Microphotographs  c e l l s containing 1000X.  (phase c o n t r a s t , 40X o b j e c t i v e ) o f E . c o l i  the p l a s m i d s pUC13 (A) o r pDC21 ( B ) . M a g n i f i c a t i o n  JM83 -  84.  F i g . 17.  T h i n s e c t i o n micrographs o f JM83 pDC21 c e l l s .  t o s t a t i o n a r y phase i n LB medium.  C e l l s were grown  The c e l l s were c o l l e c t e d by  c e n t r i f u g a t i o n , washed w i t h 0.2 M sodium phosphate (pH 7.0), and f i x e d w i t h 2% g l u t a r a l d e h y d e .  The c e l l s were washed w i t h  sucrose, p o s t f i x e d i n 2% OsO^, dehydrated Epon 812.  phosphate-buffered  i n e t h a n o l and embedded i n  S e c t i o n s were s t a i n e d w i t h l e a d c i t r a t e and s a t u r a t e d u r a n y l  a c e t a t e , and mounted on g r i d s f o r e l e c t r o n m i c r o s c o p y .  85.  i n g r e a t e r than 7 0 - f o l d o v e r p r o d u c t i o n o f transhydrogenase  in cells  h a r b o r i n g the p l a s m i d .  starting  These c e l l s s e r v e d as an e x c e l l e n t  m a t e r i a l f o r the p u r i f i c a t i o n o f transhydrogenase (M^ 52,000) and fi (M  as the two s u b u n i t s , a  48,000), were the two major p r o t e i n s i n the  r  c y t o p l a s m i c membrane. E x t r a c t i o n o f membrane v e s i c l e s o f E . c o l i s t r a i n JM83 pDC21 s e q u e n t i a l l y w i t h 1% T r i t o n X-100 and 2% sodium c h o l a t e r e s u l t e d i n s o l u b i l i z a t i o n o f 80% o f the membrane p r o t e i n , w h i l e a p p r o x i m a t e l y 55% o f the transhydrogenase  remained  i n the p a r t i c u l a t e m a t e r i a l a f t e r  c e n t r i f u g a t i o n ( T a b l e 9 ) . Some s e l e c t i v i t y was observed e x t r a c t e d by the d e t e r g e n t s .  S e v e r a l o f the p r o t e i n s remaining  T r i t o n X-100 e x t r a c t i o n were e f f i c i e n t l y s o l u b i l i z e d by treatment w i t h c h o l a t e .  i n the p r o t e i n s after  subsequent  However, o n l y T r i t o n X-100 was e f f e c t i v e i n  s o l u b i l i z i n g some f l a v o p r o t e i n s and b-type cytochromes,  as w e l l as a  number o f o t h e r p r o t e i n s . The  transhydrogenase  c o u l d be s o l u b i l i z e d  by 0.5% sodium deoxycholate  from the e x t r a c t e d v e s i c l e s  i n the presence o f 1 M KC1.  Although c h o l a t e  (0.5%) alone was i n e f f e c t i v e i n s o l u b i l i z i n g the transhydrogenase,  i t was  n e c e s s a r y t o i n c l u d e t h i s d e t e r g e n t i n o r d e r t o prevent the s o l u b i l i z e d m a t e r i a l from forming a g e l when s t o r e d f o r any l e n g t h o f time. The d e o x y c h o l a t e e x t r a c t was loaded over a 20% sucrose s o l u t i o n and c e n t r i f u g e d o v e r n i g h t a t 260,000 x g. found i n the sucrose  The transhydrogenase  solution.  Pooled f r a c t i o n s c o n t a i n i n g transhydrogenase of 29.9 limol.min" .mg" 1  original activity.  a c t i v i t y was  1  had a s p e c i f i c  activity  o f p r o t e i n and r e p r e s e n t e d 16% o f the  R e c o v e r i e s o f a c t i v i t y ranged  from 10-18%.  The  p u r i f i e d enzyme r e t a i n e d over 90% o f i t s a c t i v i t y when s t o r e d f o r a week  86.  Table 9.  P u r i f i c a t i o n o f transhydrogenase  from E_. c o l i s t r a i n JM83 pDC21.  Transhydrogenase Activity  Protein  Fraction  Membranes  Total  Specific  mg  %  188  100  5.2  U/mg  protein  After  T r i t o n X-100 treatment  61  77  12.1  After  cholate  33  55  16.2  15  38  24.4  5  16  29.9  treatment  E x t r a c t e d enzyme Combined f r a c t i o n s centrifugation  after  Membranes were prepared from 4.7 g o f c e l l s ; sequentially  a f t e r t r e a t i n g the membranes  w i t h the d e t e r g e n t s T r i t o n X-100 and sodium c h o l a t e , the  transhydrogenase was s o l u b i l i z e d by the d e t e r g e n t sodium d e o x y c h o l a t e i n the  presence o f KCI.  centrifugation  The enzyme was p u r i f i e d from the e x t r a c t  through a s u c r o s e s o l u t i o n .  by  E x p e r i m e n t a l d e t a i l s o f the  p u r i f i c a t i o n a r e d e s c r i b e d i n M a t e r i a l s and Methods.  87.  a t 4°C.  A h i g h degree o f p u r i f i c a t i o n was a c h i e v e d as shown by  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f the p u r i f i e d m a t e r i a l ( F i g . 18).  Two bands, a and 8, o f apparent m o l e c u l a r weights 52,000 and  48,000 were o b s e r v e d .  The a b s o r p t i o n spectrum o f the p u r i f i e d enzyme  i n d i c a t e d t h a t the p r e p a r a t i o n was d e v o i d o f f l a v i n . Both L i a n g and Houghton (55) and Voordouw e t a l . (122) have suggested that the 100,000-molecular-weight transhydrogenase.  p r o t e i n i s a component o f the E_. c o l i  A 100,000-molecular-weight  transhydrogenase was p u r i f i e d 100,000-molecular-weight  from W6  p r o t e i n was observed when  ( F i g . 1 8 ) . A minor  p r o t e i n was observed as a d i f f u s e band i n  SDS-polyacrylamide g e l s o f the enzyme p r e p a r a t i o n p u r i f i e d pDC21.  from JM83  T h i s p o l y p e p t i d e became more prominent i n the g e l s when the  samples were s t o r e d f o r s e v e r a l days a t 4°C o r when t h i o l r e d u c i n g agents were o m i t t e d from the b u f f e r s .  In o r d e r to determine i f the  100,000-molecular weight p r o t e i n r e p r e s e n t e d an aggregate o f the transhydrogenase a. and 6 s u b u n i t s , the s t a i n e d bands o f the p o l y p e p t i d e s were e x c i s e d from the g e l s and p a r t i a l l y d i g e s t e d w i t h chymotrypsin u s i n g the t e c h n i q u e d e s c r i b e d by C l e v e l a n d e t a l . (106). c h y m o t r y p t i c fragments a r e shown i n F i g . 19.  The p a t t e r n s o f  The p a t t e r n o f c h y m o t r y p t i c  fragments f o r the 100,000 m o l e c u l a r - w e i g h t p r o t e i n c l o s e l y resembled the p a t t e r n o f fragments o b t a i n e d from the a and 8 s u b u n i t s o f the transhydrogenase.  T h i s i n d i c a t e s t h a t the 100,000-molecular-weight  p r o t e i n was an aggregate o f the a and IE s u b u n i t s .  88.  F i g . 18.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f v a r i o u s  fractions  o b t a i n e d d u r i n g the p u r i f i c a t i o n o f transhydrogenase from E . c o l i JM83 pDC 21 ( l a n e s 1-5) and W6  (lane 6 ) .  strains  P u r i f i c a t i o n o f the enzyme, g e l  e l e c t r o p h o r e s i s , and s t a i n i n g were c a r r i e d out as d e s c r i b e d i n M a t e r i a l s and Methods.  Lane 1, membranes, 36 ug; lane 2, T r i t o n X-100 e x t r a c t e d  membranes, 16 ug; l a n e 3, c h o l a t e - e x t r a c t e d membranes, 12 Ug; lane 4, deoxycholate ug;  e x t r a c t , 8 ug; lane 5, pooled  lane 6, a f f i n i t y column e l u e n t , 10 ug.  of the m o l e c u l a r  weight standards  r  9467-  The p o s i t i o n s o f m i g r a t i o n  are i n d i c a t e d .  -3  M X 10  sucrose g r a d i e n t f r a c t i o n s , 6  1 2 3 4 5  M x10 r  9467-  43433020.1 14.4  3020.114.4-  6  89.  F i g . 19.  P a r t i a l p r o t e o l y s i s o f the 97,000-molecular-weight  the u and fi s u b u n i t s o f the transhydrogenase. p r o t e i n and  The  protein,  100,000-molecular-weight  the a and 13 s u b u n i t s o f the transhydrogenase were s u b j e c t e d  to C l e v e l a n d d i g e s t i o n u s i n g chymotrypsin as d e s c r i b e d i n M a t e r i a l s Methods.  and  Lane 1, chymotrypsin a l o n e ; lane 2,  and  100,000-molecular-weight  p r o t e i n ; lane 3, mixed a and 6 transhydrogenase s u b u n i t s ; l a n e 4, transhydrogenase 6 s u b u n i t ; lane 5, transhydrogenase a s u b u n i t . p o s i t i o n s o f m i g r a t i o n o f the m o l e c u l a r mass standards are  The  indicated.  90.  V.  P r o p e r t i e s o f Transhydrogenase  Kinetic The  Parameters steady s t a t e k i n e t i c s  determined  f o r r e d u c t i o n o f AcNAD by NADPH were  ( F i g . 2 0 ) . The apparent M i c h a e l i s c o n s t a n t s , Km, f o r NADPH and  AcNAD were 23 uM and 33 uM, r e s p e c t i v e l y , The  f o r the p u r i f i e d  enzyme.  c o r r e s p o n d i n g v a l u e s f o r the membrane-bound enzyme were 29 uM and 41  uM, r e s p e c t i v e l y .  I n a c t i v a t i o n by T r y p s i n S t u d i e s o f the p r o t e o l y t i c t r a n s h y d r o g e n a s e by t r y p s i n  inactivation of mitochondrial  p r o v i d e d e v i d e n c e t h a t c o n f o r m a t i o n a l changes  i n the t r a n s h y d r o g e n a s e m o l e c u l e a r e induced by the b i n d i n g o f NADPH (123).  As shown i n T a b l e 10, E . c o l i  i n a c t i v a t e d by t r y p s i n . subunit  t r a n s h y d r o g e n a s e was a l s o  P r o t e o l y t i c c l e a v a g e took p l a c e w i t h i n  the a  ( F i g . 2 1 ) . NADPH i n c r e a s e d the degree o f i n a c t i v a t i o n by t r y p s i n  whereas NADP, NADH and NAD d i d n o t have any s i g n i f i c a n t proteolysis  ( F i g . 2 2 ) . These f i n d i n g s a r e s i m i l a r  e f f e c t on  t o those r e p o r t e d f o r  the m i t o c h o n d r i a l t r a n s h y d r o g e n a s e .  VI.  Transhydrogenase  Proteoliposome  Energization  D u r i n g the e a r l y still  as a P r o t o n Pump  stage o f p u r i f i c a t i o n when the t r a n s h y d r o g e n a s e was  membrane-bound, maximum a c t i v i t y was observed  uncoupler.  i n the presence o f an  A d d i t i o n o f the u n c o u p l e r FCCP t o n o n e n e r g i z e d , e v e r t e d  membrane v e s i c l e s enhanced the r e d u c t i o n o f AcNAD by NADPH and the r e d u c t i o n o f NADP by NADH by 3 . 4 - f o l d and 3 . 6 - f o l d , r e s p e c t i v e l y  F i g . 20. purified  Kinetic  parameters o f transhydrogenase.  (A and B) and membrane-bound  assayed i n the presence o f a f i x e d D) o r 0.99 mM  transhydrogenases  c o n c e n t r a t i o n o f 1.98 mM AcNAD (B and  i n M a t e r i a l s and Methods.  out i n the presence o f 1 uM FCCP.  The assays were  V i s expressed i n umoles min"  - I  ®  (C and D) were  NADPH (A and C) and v a r y i n g the c o n c e n t r a t i o n o f the other  n u c l e o t i d e as d e s c r i b e d  mg  The a c t i v i t i e s o f  ®  1  carried  Table 10.  Treatment o f membrane v e s i c l e s prepared with various l e v e l s of TPCK-trypsin.  T r y p s i n added (ng)  % Control A c t i v i t y  0 50 100 200 400  100 86.3 65.3 25.6 1.4  Membranes i n TED  a t a p r o t e i n c o n c e n t r a t i o n o f 2.3 mg/ml were t r e a t e d w i t h  v a r i o u s amounts o f t r y p s i n f o r 5 min a t 37°C. the a d d i t i o n o f 10 ug o f t r y p s i n i n h i b i t o r . was  from E. c o l i JM83 pDC21  R e a c t i o n s were stopped  Transhydrogenase  then measured as d e s c r i b e d i n M a t e r i a l s and  Methods.  activity  by  93.  F i g . 21.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f membrane v e s i c l e s  prepared from E. c o l i JM83 pDC21 and t r e a t e d w i t h 0 ng ( l a n e 3 ) , 50 ng (lane 4 ) , 100 ng ( l a n e 5 ) , 200 ng ( l a n e 6) o r 400 ng ( l a n e 7) o f T P C K - t r y p s i n as d e s c r i b e d 10%  i n Table 10.  SDS-polyacrylamide g e l as d e s c r i b e d  The p r o t e i n s were s e p a r a t e d i n M a t e r i a l s and Methods.  Lane 1: m o l e c u l a r weight markers; lane 2: p u r i f i e d  1 2 345 67  transhydrogenase.  on a  94. F i g . 22.  I n a c t i v a t i o n o f membrane-bound transhydrogenase by T P C K - t r y p s i n  i n the presence o f v a r i o u s l e v e l s o f n u c l e o t i d e s . prepared and suspended mg/ml.  Membrane v e s i c l e s were  i n TED b u f f e r a t a p r o t e i n c o n c e n t r a t i o n o f 2.3  The membrane v e s i c l e s  (0.5 ml) were t r e a t e d w i t h 75 mg o f  T P C K - t r y p s i n f o r 5 min a t 37°C i n the presence o f v a r i o u s amounts o f NADPH (•-•), NADP ( o - o ) , NADH (•-•) o r NAD (•-•). stopped by the a d d i t i o n o f 10 Ug o f soybean tubes p l a c e d on i c e .  The r e a c t i o n s were t r y p s i n i n h i b i t o r and the  The transhydrogenase a c t i v i t y was measured as  d e s c r i b e d i n M a t e r i a l s and Methods.  I t i s expressed as a percentage o f  the transhydrogenase a c t i v i t y remaining i n a c o n t r o l w i t h no added nucleotide.  Treatment  at 37°C r e s u l t e d  o f the c o n t r o l w i t h 75 ng o f T P C K - t r y p s i n f o r 5 min  i n a 34% decrease i n transhydrogenase  activity.  o 50 C  o O  c  CD O d> a.  100 [Pyridine Dinucleotide] pM  200  ( F i g . 2 3 ) . Uncoupler d i d n o t a f f e c t purified  transhydrogenase.  the a c t i v i t i e s o f s o l u b i l i z e d o r  These d a t a suggest t h a t t h e i n h i b i t i o n o f  t r a n s h y d r o g e n a t i o n i n both d i r e c t i o n s d e r i v e s from the e s t a b l i s h m e n t o f a pH g r a d i e n t a c r o s s the membrane.  Uncouplers would c o l l a p s e the pH  g r a d i e n t e i t h e r by p r o v i d i n g a c o n t i n u a l supply o f protons t o the v e s i c l e i n t e r i o r t o be pumped out d u r i n g t h e r e d u c t i o n o f NADP by NADH o r by r e l i e v i n g the b u i l d up o f protons i n the v e s i c l e i n t e r i o r d u r i n g the r e d u c t i o n o f AcNAD by NADPH. V a r i o u s pH probes, such as 9 - a m i n o a c r i d i n e , pyramine o r n e u t r a l r e d may  be used t o monitor the i n t e r n a l pH o f the v e s i c l e s  (124-126).  Proton  t r a n s l o c a t i o n d u r i n g the r e d u c t i o n o f AcNAD by NADPH was f o l l o w e d by measuring  the f l u o r e s c e n c e o f 9-aminoacridine ( F i g . 24).  Following the  a d d i t i o n o f both s u b s t r a t e s , the f l u o r e s c e n c e was s u b s t a n t i a l l y quenched i n d i c a t i n g an uptake o f protons i n t o the v e s i c l e s d u r i n g the r e a c t i o n . Quenching was s u b s e q u e n t l y r e l i e v e d by the a d d i t i o n o f FCCP. Measurement o f t h e e l e c t r o g e n i c a c t i v i t y o f p u r i f i e d may  transhydrogenase  be c a r r i e d out by r e c o n s t i t u t i n g the enzyme i n t o s y n t h e t i c l i p o s o m e s .  When p u r i f i e d  transhydrogenase was r e c o n s t i t u t e d i n t o egg  p h o s p h a t i d y l c h o l i n e v e s i c l e s , t h e r a t e o f r e d u c t i o n o f AcNAD by NADPH was i n c r e a s e d t h r e e f o l d by the a d d i t i o n o f the u n c o u p l e r FCCP.  P r o t o n pumping  a c t i v i t y was a l s o observed d u r i n g t h e r e d u c t i o n o f AcNAD by NADPH c a t a l y z e d by the r e c o n s t i t u t e d transhydrogenase as i n d i c a t e d by t h e quenching o f t h e f l u o r e s c e n c e o f 9-aminoacridine ( F i g . 2 4 ) .  I n t e r a c t i o n o f Transhydrogenase  w i t h a pH G r a d i e n t o r Membrane P o t e n t i a l  Uncouplers s t i m u l a t e transhydrogenase i n both d i r e c t i o n s s u g g e s t i n g t h a t r e s p i r a t o r y c o n t r o l seen i n transhydrogenase  ( F i g . 23) containing  F i g . 23.  Effect  activities.  o f FCCP on r e v e r s e  transhydrogenase a c t i v i t i e s  i n M a t e r i a l s and Methods.  c a t a l y z e d by e i t h e r (a) s o l u b i l i z e d  NADP r e d u c t i o n  o f the s o l u b l e  were assayed as d e s c r i b e d  Experiment A compares the r a t e s o f AcNAD  (b) membrane-bound t r a n s h y d r o g e n a s e .  transhydrogenase o r  Experiment  B compares the r a t e o f  c a t a l y z e d by e i t h e r (a) s o l u b i l i z e d  (b) membrane-bound t r a n s h y d r o g e n a s e . indicated.  transhydrogenase  The i n f l u e n c e o f u n c o u p l e r on the a c t i v i t i e s  and membrane-bound  reduction  and forward  transhydrogenase or  FCCP (1 yM) was added where  F i g . 24.  Quenching of the f l u o r e s c e n c e o f 9-aminoacridine d u r i n g  the  r e d u c t i o n o f AcNAD by NADPH c a t a l y z e d by e i t h e r membrane-bound or reconstituted  transhydrogenase.  monitored d u r i n g wavelength was were prepared Methods with The  420  nm  and  emission  MgCl  (2.1 ml)  15.8  yg of washed membranes and  Reactions 1.3  250  uM  NADPH.  ug of p u r i f i e d egg  uM FCCP was  MgSO^ was  nm.  in Materials  contained  10 mM  Hepes, 300  In a d d i t i o n , experiment A  8.7  uM  Membranes and  included i n a l l steps.  9-aminoacridine.  mM  contained  Experiment B  transhydrogenase r e c o n s t i t u t e d i n t o  y o l k p h o s p h a t i d y l c h o l i n e , and  were s t a r t e d by  experiment  determined at 500  at pH 7.5  5 mM  2  and  t h a t 5 mm  KCI,  v e s i c l e s with  was  was  The e x c i t a t i o n  from E_. c o l i s t r a i n JM83 pDC21 as d e s c r i b e d the e x c e p t i o n  2.4  f l u o r e s c e n c e o f 9-aminoacridine  the r e d u c t i o n of AcNAD by NADPH.  r e a c t i o n mixtures  contained  The  the a d d i t i o n of 500  added i n experiment A and  0.3  1.1  uM  FCCP was  ® AcNAD  Quenching  1 min  FCCP  9-aminoacridine.  UM AcNAD.  B.  AcNAD  uM  Where i n d i c a t e d added i n  98. v e s i c l e s could r e s u l t  from a b a l a n c i n g  o f the s u b s t r a t e  oxidation-reduction p o t e n t i a l against  the e l e c t r o c h e m i c a l hydrogen i o n  gradient  The r a t e o f r e d u c t i o n o f NADP by  formed a c r o s s  t h e membrane.  NADH would decrease because o f a d e p l e t i o n o f i n t e r n a l protons whereas the r a t e o f r e d u c t i o n o f NAD by NADPH would be i n h i b i t e d because o f an i n c r e a s e i n i n t e r n a l protons i n e v e r t e d membrane v e s i c l e s . A l t e r n a t i v e l y , transhydrogenation  An  might be c o n t r o l l e d p r i m a r i l y by the membrane p o t e n t i a l  artificially  imposed pH g r a d i e n t was generated i n membrane  v e s i c l e s by c a r r y i n g out the r e d u c t i o n o f AcNAD by NADPH i n a b u f f e r a t pH 6.0 u s i n g v e s i c l e s which had been e q u i l i b r a t e d w i t h b u f f e r t o g i v e an i n t e r n a l pH o f 8.0.  As shown i n F i g . 25A, t h e r e was a t r a n s i e n t phase o f  h i g h i n i t i a l a c t i v i t y which g r a d u a l l y d e c l i n e d . caused the expected enhancement o f a c t i v i t y .  A d d i t i o n o f uncoupler  No decrease i n a c t i v i t y was  observed when the r e a c t i o n was c a r r i e d out a t an e x t e r n a l pH o f 7.4 ( F i g . 25B). I n t e r a c t i o n s between transhydrogenase and imposed membrane p o t e n t i a l s were i n v e s t i g a t e d w i t h valinomycin.  potassium g r a d i e n t s  i n the presence o f  A h i g h e x t e r n a l c o n c e n t r a t i o n o f KC1 (150 mM) and a low  internal concentration  o f KC1 ( 5 mM) would generate a minimal membrane  p o t e n t i a l o f 100 mV p o s i t i v e i n s i d e t h e v e s i c l e s . a p p r o x i m a t e l y the same s i z e but n e g a t i v e by  the presence o f v a l i n o m y c i n  the v e s i c l e s .  A membrane p o t e n t i a l o f  i n s i d e the v e s i c l e s was generated  and the same c o n c e n t r a t i o n  o f KCl inside  No s i g n i f i c a n t e f f e c t was observed on the r a t e o f  transhydrogenation  under e i t h e r o f these c o n d i t i o n s  ( F i g . 2 6 ) . The same  r e s u l t s were observed when e v e r t e d v e s i c l e s were prepared i n 0.1 M potassium phosphate o r sodium phosphate and assayed i n 0.1 M sodium phosphate o r potassium phosphate, r e s p e c t i v e l y .  Fig.  25.  Influence  o f a transmembrane  pH g r a d i e n t  on the r a t e o f  r e d u c t i o n o f AcNAD by NADPH c a t a l y z e d by membrane v e s i c l e s . v e s i c l e s were prepared  from E. c o l i  Membrane  JM83 pDC21 i n 0.1 M T r i c i n e b u f f e r ,  pH 8.0 c o n t a i n i n g 5 mM MgCl^, 0.2 mM d i t h i o t h r e i t o l .  The r e d u c t i o n o f  AcNAD by NADPH a t 375 nm was measured i n 0.1 M MES b u f f e r , pH 6.0, c o n t a i n i n g 5 mM MgCl^  and 0.2 mM transhydrogenase (A) o r i n 0.1 M  T r i c i n e , pH 7.4 c o n t a i n i n g 5 mM, MgCl^ and 0.2 mM 35 ug of p r o t e i n was added to each assay m i x t u r e . f i n a l concentration  dithiothreitol. FCCP was added to a  o f 1.3 uM.  2 min  100. F i g . 26.  Influence  o f a membrane p o t e n t i a l p o s i t i v e i n s i d e (A) or o u t s i d e  (B; on the r a t e o f r e d u c t i o n o f AcNAD by NADPH c a t a l y z e d by membrane vesicles.  Membrane v e s i c l e s o f JM83 pDC21 were prepared i n 0.1 M T r i c i n e  pH 7.4 c o n t a i n i n g 5 mM MgCl^ and 0.2 mM d i t h i o t h r e i t o l and assayed f o r transhydrogenase a c t i v i t y  i n the same b u f f e r c o n t a i n i n g 150 mM KC1  (A).or  membrane v e s i c l e s were prepared i n b u f f e r w i t h KC1 and assayed i n the absence o f e x t e r n a l KC1 ( B ) . A volume o f 2 u l membrane v e s i c l e s containing  12 ug o f p r o t e i n was used i n the a s s a y .  added to a f i n a l  concentration  o f 1 uM and FCCP to 1.5 uM.  transhydrogenase assay procedure i s d e s c r i b e d  A  B  A c N A D F  C  C  V a l i n o m y c i n was  P  2 min *  The  i n M a t e r i a l s and Methods.  101. N i g e r i c i n promotes the e l e c t r o n e u t r a l exchange o f K a c r o s s membranes.  Thus, i t w i l l  a l t e r i n g the av (127).  f o r protons  change the i n t r a v e s i c u l a r pH w i t h o u t  As shown i n F i g . 27, n i g e r i c i n s t i m u l a t e d the  r e d u c t i o n o f AcNAD r e g a r d l e s s o f the o r i e n t a t i o n o f the p o t e n t i a l i n the e v e r t e d membrane v e s i c l e s .  membrane  When the e x t e r n a l l e v e l o f  KC1 i s h i g h , n i g e r i c i n , which c o u p l e s the e f f l u x o f protons t o the uptake o f potassium, would be expected  t o s t i m u l a t e the r e d u c t i o n o f AcNAD i f the  r e a c t i o n were i n f l u e n c e d by apH.  In the experiment  with  potassium  loaded v e s i c l e s , n i g e r i c i n a g a i n s t i m u l a t e d the r e a c t i o n by c o u p l i n g the e f f l u x o f protons t o the uptake movement o f potassium  o f potassium even though t h i s r e q u i r e d the  i o n s a g a i n s t a potassium  ion gradient.  Thus, these  r e s u l t s i n d i c a t e that the r e d u c t i o n o f AcNAD by NADPH i s a s s o c i a t e d w i t h an inward  t r a n s p o r t o f protons and the r e a c t i o n i s c o n t r o l l e d p r i m a r i l y by  a pH g r a d i e n t i n e v e r t e d membrane  vesicles.  I n h i b i t i o n by DCCD P r e v i o u s s t u d i e s have shown t h a t the a c t i v i t i e s o f the m i t o c h o n d r i a l transhydrogenase  a r e a f f e c t e d by DCCD (74,128).  T h i s compound  inhibited  p r o t o n pump a c t i v i t y without a f f e c t i n g t r a n s h y d r o g e n a t i o n ( 5 0 ) . a d d i t i o n t o the m i t o c h o n d r i a l transhydrogenase, p r o t o n - l i n k e d ATP synthase  DCCD a l s o  In  inhibits  (129), u b i q u i n o l - c y t o c h r o m e c r e d u c t a s e  mammalian and y e a s t m i t o c h o n d r i a (130,131) and cytochrome oxidase  from (132).  In these systems DCCD i n h i b i t s p r o t o n t r a n s l o c a t i o n p r i m a r i l y r a t h e r than h y d r o l y t i c o r redox r e a c t i o n s c a t a l y z e d by these enzymes. Treatment  o f both p u r i f i e d and membrane-bound transhydrogenases  c o l i w i t h DCCD i n a c t i v a t e d  the enzyme.  F i g . 28 shows the k i n e t i c s o f  i n a c t i v a t i o n o f both p u r i f i e d and membrane-bound transhydrogenases  by  o f E.  102, F i g . 27.  E f f e c t o f ionophores on the r e d u c t i o n  catalyzed  by membrane-bound  transhydrogenase i n the presence o f a  transmembrane p o t e n t i a l p o s i t i v e i n s i d e Experimental d e t a i l s are o u t l i n e d included  i n the e x t e r n a l  o f AcNAD by NADPH  (A) o r p o s i t i v e o u t s i d e ( B ) .  i n F i g . 26 except t h a t  assay medium i n B.  10 mM KCI was  N i g e r i c i n , v a l i n o m y c i n and  FCCP were added t o g i v e f i n a l c o n c e n t r a t i o n s o f 0.1 uM, 1 uM and 1.5 mM,  respectively.  103. Fig.  28.  Kinetics of i n h i b i t i o n  transhydrogenase by DCCD. 22°C w i t h c o n s t a n t  o f membrane-bound  and p u r i f i e d  Washed membranes (380 ug) were incubated a t  s t i r r i n g i n a 1 ml r e a c t i o n m i x t u r e c o n t a i n i n g 40 uM  T r i s - H C l , pH 7.8, 0.8 mM d i t h i o t h r e i t o l ,  2% (v/v) e t h a n o l , and 25 uM  (•), 50 UM ( o ) , 75 UM ( a ) , 100 UM ("), o r 150 UM ( A ) DCCD (experiment B ) . P u r i f i e d  transhydrogenase (76 ug) was incubated  a t 22°C  i n a 1 ml r e a c t i o n m i x t u r e c o n t a i n i n g 40 mM T r i s - H C l , pH 7.8, 0.8 mM dithiothreitol, 10 M U  2% (v/v) e t h a n o l , 0.02% (w/v) B r i j  35 detergent and  (•), 20 uM ( o ) , 30 uM (•), 40 uM (u), o r 50 uM U)  DCCD (experiment A ) .  Samples were removed a t the times i n d i c a t e d and  assayed f o r the r e d u c t i o n o f AcNAD by NADPH. transhydrogenase a c t i v i t y  In both cases t h e  o f t h e c o n t r o l remained c o n s t a n t .  the l o g o f the s l o p e o f the l i n e o b t a i n e d  by p l o t t i n g  In the i n s e t s  log control a c t i v i t y  (%) a g a i n s t time i s p l o t t e d a g a i n s t the l o g o f t h e c o n c e n t r a t i o n o f DCCD during  preincubation.  T i m e (min)  104.  DCCD.  P l o t s o f the l o g a r i t h m o f the a c t i v i t y , expressed  as a  percentage  o f the c o n t r o l v a l u e v e r s u s time, were l i n e a r , i n d i c a t i n g t h a t the m o d i f i c a t i o n o f the enzyme was p s e u d o - f i r s t o r d e r .  The i n s e t s show p l o t s  o f the l o g a r i t h m o f the p s e u d o - f i r s t - o r d e r r a t e c o n s t a n t s v e r s u s the l o g a r i t h m o f the c o r r e s p o n d i n g c o n c e n t r a t i o n s o f DCCD. lines,  1.16 f o r membrane-bound transhydrogenase,  transhydrogenase, approximately  The s l o p e s o f the  1.03 f o r p u r i f i e d  i n d i c a t e t h a t i n h i b i t i o n r e s u l t s from the i n t e r a c t i o n o f  one molecule  o f DCCD p e r r e a c t i v e enzyme complex.  As shown  i n F i g . 29, both the c a t a l y t i c and proton-pumping a c t i v i t i e s o f transhydrogenase  were i n h i b i t e d a t the same r a t e w i t h 250 uM DCCD.  m o d i f i c a t i o n o f transhydrogenase  The  by DCCD e x h i b i t e d some s p e c i f i c i t y as  t r a n s h y d r o g e n a t i o n was not a f f e c t e d a f t e r treatment w i t h the w a t e r - s o l u b l e c a r b o d i i m i d e EDC ( T a b l e 1 1 ) . S i n c e the enzyme c o n s i s t s o f two s u b u n i t s i t was o f i n t e r e s t t o see whether i n h i b i t i o n o f transhydrogenase  a c t i v i t y by DCCD i n v o l v e d c o v a l e n t  m o d i f i c a t i o n by the i n h i b i t o r o f o n l y one o f the s u b u n i t s . JM83 pDC21 were i n c u b a t e d w i t h  Membranes  from  [ *C]DCCD, washed s e v e r a l times t o remove ll  excess r e a g e n t , and then the p o l y p e p t i d e s s e p a r a t e d by e l e c t r o p h o r e s i s on an SDS-polyacrylamide  gel.  p r e f e r e n t i a l l y modified.  As can be seen i n F i g . 30, the o s u b u n i t was  No l a b e l l i n g o f the 6 s u b u n i t was observed  when the g e l was a u t o r a d i o g r a p h e d  even  f o r a much l o n g e r p e r i o d o f time.  As shown i n Table 12, NADH p r o t e c t e d the enzyme a g a i n s t i n h i b i t i o n by DCCD, w h i l e NADP, and t o a l e s s e r e x t e n t NADPH, i n c r e a s e d the r a t e o f inhibition.  NAD, AcNAD and AcNADH had l i t t l e e f f e c t on the r a t e o f  i n h i b i t i o n by DCCD.  Although  both NADH and AcNADH can a c t as s u b s t r a t e s  f o r the enzyme, o n l y NADH a f f e c t e d the r a t e o f i n h i b i t i o n by DCCD. f u r t h e r d i f f e r e n c e between NADH and AcNADH i s shown i n F i g . 31.  A  NADH  105. F i g . 29.  E f f e c t o f DCCD on p r o t o n t r a n s l o c a t i o n and c a t a l y t i c  of membrane-bound  transhydrogenase.  activities  Washed membranes were prepared  from  E. c o l i s t r a i n JM83 pDC21 as d e s c r i b e d i n M a t e r i a l s and Methods w i t h the e x c e p t i o n t h a t 5 mM MgSO^ was i n c l u d e d i n a l l s t e p s .  The membranes  (1.26 mg) were i n c u b a t e d a t 22°C w i t h c o n s t a n t s t i r r i n g mixture c o n t a i n i n g 7.5 mM Hepes/KOH  (pH 7.5), 1 mM  i n a 1 ml r e a c t i o n  KCN, 0.15  mM  d i t h i o t h r e i t o l , 4 mM M g C l , 225 mM KC1 and 2% ( v / v ) e t h a n o l . 3  was c a r r i e d out w i t h 250 pM U ,  Treatment  a) o r z e r o ( n , Q ) DCCD and  samples were removed a t the times i n d i c a t e d  to assay the r e a c t i o n o f AcNAD  by NADPH (O, A ) i n the presence o f 1 uM FCCP o r to measure the quenching of f l u o r e s c e n c e o f 9-aminoacridine r e d u c t i o n o f AcNAD by NADPH.  (•, a) d u r i n g the  C o n t r o l v a l u e s a t zero time were 30%  quenching o f 9 - a m i n o a c r i d i n e and 6 umol o f AcNAD reduced x min" ot p r o t e i n " . 1  Time(min)  1  x mg  106. T a b l e 11.  Treatment o f E . c o l i W6 pDC21 membrane w i t h EDC tl-ethyl-3(3-dimethyl-amino-propyl)carbodiimide].  Concentration o f EDC (uM)  Transhydrogenase A c t i v i t y (U/mg o f p r o t e i n )  0  4.32  10  4.26  50  4.26  100  4.34  200  4.27  500  4.23  1000  4.26  Membranes (5 mg/ml o f p r o t e i n ) p r e p a r e d from E_. c o l i W6 pDC21 were t r e a t e d w i t h v a r i o u s l e v e l s o f EDC f o r 60 min. measured as d e s c r i b e d  Transhydrogenase a c t i v i t y was  i n M a t e r i a l s and Methods.  107. F i g . 30.  [ "C]DCCD l a b e l l i n g o f membrane-bound l  transhydrogenase.  Washed membranes from E . c o l i s t r a i n JM83 pDC21 (5 mg p r o t e i n / m l ) were incubated f o r 10 h a t 4°C i n the presence  o f 40 mM T r i s - H C l (pH 7.8), 0.2  mM d i t h i o t h r e i t o l and 160 uM DCCD (5 u C i ) .  The membranes were then  sedimented by c e n t r i f u g a t i o n a t 175,000 x g f o r 1 h, and resuspended i n b u f f e r without was removed.  DCCD.  T h i s s t e p was repeated u n t i l a l l o f the f r e e  Samples were submitted  t o e l e c t r o p h o r e s i s , s t a i n e d and  f l u o r o g r a p h e d as d e s c r i b e d i n M a t e r i a l s and Methods. mass s t a n d a r d s ;  label  Lane 1, m o l e c u l a r  lane 2, [ '*C]DCCD l a b e l l e d membranes s t a i n e d w i t h 1  Coomassie b l u e ; lane 3, f l u o r o g r a p h o f ['''CjDCCD l a b e l l e d membranes.  108. Table  12.  E f f e c t o f s u b s t r a t e s on the i n h i b i t i o n o f transhydrogenase a c t i v i t y by DCCD.  Nucleotide  k  added  min" None NADH AcNADH AcNAD NAD NADP NADPH  Preincubation  1  0.071 0.019 0.068 0.064 0.066 0.26 0.15  and assay c o n d i t i o n s were the same as i n F i g . 26, experiment  B, except t h a t the p u r i f i e d of 75 uM DCCD.  transhydrogenase was incubated  The n u c l e o t i d e s  i n d i c a t e d were added t o the  p r e i n c u b a t i o n m i x t u r e immediately b e f o r e  the a d d i t i o n o f DCCD.  were p l o t t e d as i n F i g . 26 and i n h i b i t i o n r a t e constants from the s l o p e s o f the p s e u d o - f i r s t - o r d e r p l o t s , pseudo-first-order  i n the presence  i n h i b i t i o n rate  constant.  A l l data  were c a l c u l a t e d  k i s the  109. F i g . 31.  Effect  o f NADH and AcNADH on the r e d u c t i o n o f AcNAD by NADPH  c a t a l y z e d by p u r i f i e d t r a n s h y d r o g e n a s e . c a t a l y z e d by p u r i f i e d different  The r e d u c t i o n o f AcNAD by NADPH  transhydrogenase was assayed i n the presence o f  c o n c e n t r a t i o n s o f NADH (•) or AcNADH ( • ) .  30r  [Nucleotide] ( m M )  110. s t i m u l a t e d the enzyme-catalyzed c o n c e n t r a t i o n s up t o 0.75 mM. NADH.  r e d u c t i o n o f AcNAD by NADPH a t Maximum s t i m u l a t i o n o c c u r r e d a t 0.1-0.2 mM  At c o n c e n t r a t i o n s h i g h e r than 0.75 mM,  NADH i n h i b i t e d  by a c t i n g as a c o m p e t i t i v e i n h i b i t o r a t the NAD s i t e . c o n c e n t r a t i o n s o f AcNADH d i d n o t a f f e c t  reaction  In c o n t r a s t , low  the r e a c t i o n r a t e , but a t  c o n c e n t r a t i o n s h i g h e r than 25 uM, i n h i b i t e d  V I I . I s o l a t i o n o f Transhydrogenase  this  the r e a c t i o n .  Subunits f o r Amino A c i d  Sequence  Analysis  P u r i f i c a t i o n o f Subunits U s i n g P o l y a c r y l a m i d e Slab Gels An important body o f i n f o r m a t i o n that i s needed t o understand the mechanism and s t r u c t u r e o f transhydrogenase i s the amino a c i d sequence o f the transhydrogenase s u b u n i t s .  The amino a c i d sequence  o f the  transhydrogenase s u b u n i t s was e l u c i d a t e d by sequencing the DNA o f the pnt gene ( d i s c u s s e d l a t e r ) .  The amino a c i d sequence  o f the amino-terminal  ends o f the transhydrogenase a and B s u b u n i t s was determined  to a i d i n  the i d e n t i f i c a t i o n o f t h e i r r e s p e c t i v e DNA c o d i n g r e g i o n s . The a and 6 s u b u n i t s o f transhydrogenase must be i n d i v i d u a l l y i s o l a t e d f o r amino a c i d sequence  analysis.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s .  T h i s was a c h i e v e d by  Two methods o f g e l  e l e c t r o p h o r e s i s were used.  I s o l a t i o n o f the Transhydrogenase  Subunits U s i n g a Commercial P r e p a r a t i v e  G e l E l e c t r o p h o r e s i s System The BRL p r e p a r a t i v e g e l e l e c t r o p h o r e s i s system was used t o s e p a r a t e the transhydrogenase s u b u n i t s .  In t h i s system,  the p r o t e i n s a r e s e p a r a t e d  111. by e l e c t r o p h o r e s i s i n a tube g e l and the components c o l l e c t e d by continuous The  sampling  from the base o f the g e l .  system was used a c c o r d i n g t o the manufacturer's  instructions. ' A  6 cm 10% p o l y a c r y l a m i d e g e l w i t h a 1 cm 4% s t a c k i n g g e l was poured and allowed  t o stand o v e r n i g h t a t room temperature.  A sample o f 200 u l  c o n t a i n i n g 50 t o 400 ug o f p u r i f i e d transhydrogenase  i n sample b u f f e r  was l a y e r e d on top o f the g e l and e l e c t r o p h o r e s i s was c a r r i e d out a t 150 V.  F r a c t i o n s were c o l l e c t e d every  Sodium mercaptoacetate  10 min a t a flow r a t e o f 10 ml/h.  (0.1 mM) was i n c l u d e d i n the cathode b u f f e r  r e s e r v o i r t o minimize the d e s t r u c t i o n o f tryptophan, methionine matrix  h i s t i d i n e and  s i d e c h a i n s by f r e e r a d i c a l s o r o x i d a n t s trapped  (133).  The mercaptoacetate  i n the g e l  t r a v e l s a t the dye f r o n t  during  e l e c t r o p h o r e s i s and scavenges the d e s t r u c t i v e s p e c i e s i n the g e l b e f o r e the p r o t e i n s r e a c h them.  A l l o f the b u f f e r s and the apparatus  t h o r o u g h l y de-gassed t o prevent  accumulation  f r i t which would cause a poor s e p a r a t i o n .  o f bubbles  were  under the e l u t i o n  A p o r t i o n o f each f r a c t i o n was  l y o p h i l i z e d , suspended i n SDS sample b u f f e r and a p p l i e d t o a polyacrylamide slab g e l . transhydrogenase The  As shown i n F i g . 32, some s e p a r a t i o n o f the  s u b u n i t s was o b t a i n e d but there was s t i l l  some o v e r l a p .  s e p a r a t i o n o f the s u b u n i t s was much worse when l a r g e r amounts o f  p r o t e i n were a p p l i e d t o the system ( F i g . 3 3 ) . T h e r e f o r e o n l y s m a l l amounts o f the transhydrogenase be r e c o v e r e d to i s o l a t e  i n a purified  subunits  « 1 0 ug o f each s u b u n i t ) c o u l d  form u s i n g the a p p a r a t u s .  l a r g e r amounts o f each s u b u n i t by p o o l i n g the p a r t i a l l y  p u r i f i e d s u b u n i t s and r e - r u n n i n g them through Again  Attempts were made  the e l e c t r o p h o r e t i c system.  the y i e l d s o f r e c o v e r e d p u r i f i e d s u b u n i t s were low and d e g r a d a t i o n  was observed.  T h e r e f o r e i t was concluded  t h a t the system c o u l d n o t be  used t o r e s o l v e the two s u b u n i t s i n q u a n t i t i e s s u f f i c i e n t  f o r sequencing.  112. F i g . 32. obtained  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f samples from during  preparative  the s e p a r a t i o n  g e l e l e c t r o p h o r e s i s system (BRL).  transhydrogenase was s t a c k i n g g e l and M a t e r i a l s and and  o f transhydrogenase s u b u n i t s  a p p l i e d to a 6 cm  e l e c t r o p h o r e s i s was  Methods.  200  10%  the r e s i d u e suspended i n sample b u f f e r .  fractions  30-45 were a p p l i e d to a 10%  r e s p e c t i v e l y ) along with i n t a c t  ug of  ml  out a t 150  polyacrylamide  1).  in  lyophilized portions  gel (lanes  9 10 11 12 13 14 15 16 17  5%  V as d e s c r i b e d  lyophilized  transhydrogenase ( l a n e  1 2 3 4 5 6 7 8  gel with a  f r a c t i o n was The  the  purified  polyacrylamide  carried  u l o f each 1.6  160  using  fractions  2-17,  of  F i g . 33.  SDS-polyacrylamide g e l e l e c t r o p h o r e s i s o f samples  obtained during preparative  the s e p a r a t i o n o f transhydrogenase s u b u n i t s u s i n g  g e l e l e c t r o p h o r e s i s system  (BRL).  The c o n d i t i o n s  as o u t l i n e d i n F i g . 32 except t h a t 400 ug o f p u r i f i e d was  of fractions  a p p l i e d t o the g e l .  Lanes  1-18  c o n t a i n samples  the  are the same  transhydrogenase  from f r a c t i o n s 30-49.  A 1 2 3 4 5 6 7 8 9 1011 12 1314  114. I s o l a t i o n o f Transhydrogenase  Subunits by E x c i s i o n from P o l y a c r y l a m i d e Gels  A b e t t e r method o f s e p a r a t i n g the two  s u b u n i t s was  the e x c i s i o n o f  the p r o t e i n bands from the g e l .  The two  first  The p r o t e i n bands were too c l o s e l y  to  to be l o c a t e d i n the g e l .  transhydrogenase  use s t a i n e d s t r i p s o f g e l as a g u i d e .  Brilliant  Furthermore  s u b u n i t s had  the use o f Coomassie  Blue t o v i s u a l i z e the p r o t e i n i s time-consuming  and some  p r o t e i n s , p a r t i c u l a r l y those c o n t a i n i n g Asp-Pro bands, can be fragmented  by b r i e f exposure  t o low pH.  The p r o t e i n bands can  v i s u a l i z e d w i t h o u t s t a i n i n g u s i n g the f o r m a t i o n o f protein-SDS w i t h potassium 4M and  partially be complexes  (134,135) or by p r e c i p i t a t i o n o f non-protein-bound  sodium a c e t a t e (136).  spaced  SDS  by  A s t r i p o f g e l c o n t a i n i n g the p r o t e i n i s c u t out  the p r o t e i n e x t r a c t e d from i t . A p p r o x i m a t e l y 450  a 15 x 14 x 0.15  ug o f p u r i f i e d transhydrogenase was  cm 10% p o l y a c r y l a m i d e g e l .  v i s u a l i z e d by t r e a t i n g the g e l w i t h c o l d 0.1 bands were v i s i b l e a f t e r 5 min when viewed  s e p a r a t e d on  The p r o t e i n bands were M KC1.  The opaque p r o t e i n  against a black  background.  The s t r i p s o f g e l c o n t a i n i n g the p r o t e i n s were c u t out, d i c e d i n t o s m a l l p i e c e s w i t h a sharp r a z o r b l a d e and p l a c e d i n a s e a l a b l e tube w i t h volumes o f 0.1%  SDS/1  mM  dithiothreitol.  The  tube c o n t a i n i n g the g e l  i n c u b a t e d a t room temperature w i t h g e n t l e s h a k i n g f o r 4 h. were removed by f i l t r a t i o n  through a 0.45  four was  The g e l p i e c e s  pM pore f i l t e r .  The  proteins  were p r e c i p i t a t e d by adding t r i c h l o r o a c e t i c a c i d t o a f i n a l c o n c e n t r a t i o n of was  12% and a l l o w i n g the samples t o stand on i c e f o r 1 h. c o l l e c t e d by c e n t r i f u g a t i o n and the p r o t e i n p e l l e t was  times w i t h c o l d acetone. Fig.  The  precipitate  washed t h r e e  10% t r i c h l o r o a c e t i c a c i d and t h r e e times w i t h c o l d  The samples were l y o p h i l i z e d f o r sequencing.  As shown i n  34 the two s u b u n i t s were i s o l a t e d i n a h i g h l y p u r i f i e d  form u s i n g  115. F i g . 34.  SDS-polyacrylamide  gel electrophoresis of  transhydrogenase  s u b u n i t s p u r i f i e d by e x c i s i o n o f the p r o t e i n band from a g e l . 450 ug o f p u r i f i e d transhydrogenase  was a p p l i e d t o a 10% p o l y a c r y l a m i d e g e l t o  p u r i f y the s u b u n i t s as d e s c r i b e d i n M a t e r i a l s and Methods.  Samples  r e p r e s e n t i n g 5% o r 2.5% o f the i s o l a t e d a and S s u b u n i t s , r e s p e c t i v e l y , were s u b j e c t e d to e l e c t r o p h o r e s i s i n a 10% p o l y a c r y l a m i d e g e l . A, u s u b u n i t ; lane B, fi s u b u n i t .  1  2  Lane  116. this  technique.  a s u b u n i t d i d undergo some d e g r a d a t i o n but  The  the  m u l t i p l e bands p r o b a b l y r e p r e s e n t d i f f e r e n t o x i d i z e d forms o f the enzyme. The r e s u l t s o f the p r o t e i n sequencing o f each o f the s u b u n i t s are shown i n F i g . 35. a c i d r e s i d u e s was identified  The  i d e n t i t y o f 26 o f the f i r s t 28 amino  o b t a i n e d f o r the a s u b u n i t and 8 r e s i d u e s were  f o r the 6 s u b u n i t .  I t was  r e p o r t e d t h a t the B s u b u n i t was  s u s c e p t i b l e to the a c i d i c c o n d i t i o n s used to suspend sequencing.  VIII.  T h i s caused the p r o t e i n to  sequence  fragment.  d e s c r i b e d i n F i g . 36 were determined by the dideoxy  c h a i n t e r m i n a t i o n procedure  of  the p r o t e i n f o r  N u c l e o t i d e Sequencing o f the pnt Gene  The DNA  M13  transhydrogenase  (137).  The phage M13  (110) c o u p l e d w i t h c l o n i n g i n t o b a c t e r i o p h a g e  has been g e n e t i c a l l y e n g i n e e r e d to c o n t a i n p a r t  the E. c o l i gene f o r 8 - g a l a c t o s i d a s e and expresses t h i s gene when grown  on l a c " E. c o l i .  T h i s l a c r e g i o n s e r v e s as a marker system f o r  d i s t i n g u i s h i n g v e c t o r phage ( b l u e p l a q u e - f o r m e r s ) and recombinant (white plaque formers) on p l a t e s c o n t a i n i n g X-Gal.  The phages used f o r  sequencing the transhydrogenase gene were M13mpl8 and M13mpl9.  These  c o n t a i n an i n s e r t o f 57 bases w i t h an a r r a y o f r e s t r i c t i o n s i t e s the  l a c gene as shown i n F i g . 37.  r e g i o n and recombinant  s i n g l e - s t r a n d e d DNA sequenced Two to  within  Fragments can be i n s e r t e d i n t o  phages d i s t i n g u i s h e d as white p l a q u e s .  were grown i n s m a l l c u l t u r e s  phage  (2 m l ) , the phage i s o l a t e d , and  uncoated u s i n g p h e n o l .  The  this  The  plaques  the  fragments were then  using a s y n t h e t i c primer. d i f f e r e n t s t r a t e g i e s were a p p l i e d a t v a r i o u s stages o f t h i s work  sequence  the transhydrogenase gene.  I n i t i a l l y , various r e s t r i c t i o n  Subunit  Residue Number  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  -  -  LYS  ALA or a  MET ARG ILE GLY ILE PRO ARG GLU ARG LEU THR ASN GLU THR ARG VAL ALA VAL THR PRO LYS THR GLY GLU GLN  13  MET SER GLY THR LEU VAL THR ALA  F i g . 35.  Amino a c i d sequence o f the transhydrogenase a and 13 s u b u n i t s .  as d e s c r i b e d  i n M a t e r i a l s and Methods and sequenced  on a gas-phase  The transhydrogenase s u b u n i t s were i s o l a t e d  sequenator a t the U n i v e r s i t y o f V i c t o r i a .  118. F i g . 36.  Nucleotide  sequence o f the pnt gene r e g i o n .  Each gene i s marked  above the proposed p o i n t s f o r i n i t i a t i o n o f t r a n s l a t i o n . ribosome-binding  s i t e s are underlined.  Proposed  Promoter sequences a r e boxed and  l a b e l l e d -10 and -35.  15 3 0 4 5 6 0 GATGTCTCGTTTATGCGGCGTTCTAAGGTGTTTATCCCACTATCACGGCTGAATCGT^ 1 6 2 132 T35_- 1 4 7 10 TTCAGTACGTTATAGGGCGTjrrG^JjCTAATTTATTTTAACGGAGJT^  1  "  249 2 6 4 2 7 9 2 9 4 M R I G I P R E R L T N E T R V A A GAAGGGAATATCATGC^AATTGGCATACCAAGAGAACGGTTAACCAATCAAACCCGTGTTGC^  7 5  9 0  1 9 2  2 0 7  2 2 2  L  G  3 3 9 F T  V  A  V  366 3 8 1 3 9 6 4 1 1 4 2 6 4 4 1 E S G A V N W Q V L T I K R L C S G R E 1 V E G N S V W Q S E 1 1 GAGAGCGGCGCGGTCAACTGGCAAGTTTTGACGATAAAGCGTTTGTGCAGCGGGCGTGAAATTGTAGAAGGGAATAGCGTCTGGCAGTCAGAGATCA  L  4 5 6 K V  N  A  P  483 4 9 8 5 1 3 5 2 8 5 4 3 5 5 8 L D D E I A L L N P G T T L V S F I W P A Q n P E L M Q K L A E TTAGATGATGAAATTGCGTTACTGAATCCTGGGACAACGCTGGTGAGTTTTATCTGGCCTGCGCAGAATCCGGAATTAATGCAAAAACTTG  N  5 7 3 V T  V  M  A  R  F  F  T  P  3 0 9 K T V  1 0 5  E  Q  L  3 2 4 L K  R  600 6 1 5 6 3 0 6 4 5 6 6 0 6 7 5 6 9 0 M D S V P R 1 S R A Q S L D A L S S M A N I A G Y R A I V E A A H E F G ATGGACTCTGTGCCGCGTATCTCACGCGCACAATCGCTGGACGCACTAAGCTCGATGGCGAACATCGCCGGTTATCGCGCCATTGTTGAAGCGGCACATGAA  717 7 3 2 7 4 7 7 6 2 7 7 7 7 9 2 8 0 7 T G Q I T A A G K V P P A K V M V I G A G V A G L A A 1 G A A N S L G A 1 V R ACCGGGCAAATTACTGCGGCCGGGAAAGTGCCACCGGCAAAAGTGATGGTGATTGGTGCGGGTGTTGCAGGTCTGGCCGCCATTGGCGCAGCAAACAGTCTCGGCGCGATTG 834 8 4 9 8 6 4 8 7 9 8 9 4 9 0 9 9 2 4 A F D T R P E V K E Q V Q S M G A E F L E L D F K E E A G S G D G Y A K GCATTCGAC^CCCGCCCGGAAGTGAAAGAACAAGTTCAAAGTATGGGCGCGGAATTCCTCGAGCTGGATrTTAAAGAGGAAGCTGGCAGCGGCGATGGCTATGC  V  M  S  951 9 6 6 9 8 1 9 9 6 1 0 1 1 1 0 2 6 1 0 4 1 D A F I K A E M E L F A A Q A K E V D I 1 V T T A L I P G K P A P K L I T R E GACGCGTTCATCAAAGCGGAAATGGAACTCTTTGCCGCCCAGGCAAAAGAGGTCGATATCATTGTCACCACCGCGCTTATTCCAGGCAAACCAGCGCCGAAGCTAATTACCCGTGAA 1068 1 0 8 3 1 0 9 8 1 1 1 3 1 1 2 8 1 1 4 3 1 1 5 8 M V D S M K A G S V 1 V D L A A Q N G G N C E Y T V P G E I F T T E N G ATGGTTGACTCCATGAAGGCGGGCAGTGTGATTGTCGACCTGGCAGCCCAAAACGGCGGCAACTGTGAATACACCGTGCCGGGTGAAATCTTCACTACGGA  V  K  V  1185 1 2 0 0 1 2 1 5 1 2 3 0 I G Y T D L P G R L P T Q S S Q L Y G R N L V ATTGGTTATACCGATCTTCCGGGCCGTCTCCCGACGCAATCCTCACAGCTTTACGGCAGAAACCTO  N  1 2 4 5 L L K L  L  1 2 6 0 1 2 7 5 C K E K D G N  I  T  V  1302 1 3 1 7 1 3 3 2 1 3 4 7 D F D D V V I R G V T V I R A G E I T W P A P GATTTTGATGATGTGGTGATTCGCGGCGTGACCGTGATCCGTGCGGGCGAAATTACCTGGCCGGC^  P  1 3 6 2 I Q V S  A  1 3 7 7 1 3 9 2 Q P Q A A Q K  A  A  P  1419 1 4 3 4 1 4 4 9 1 4 6 4 1 4 7 9 E V K T E E K C T C S P W R K Y A L M A L A I I L F G W M GAAGTGAAAACTGAGGAAAAATGTACCTGCTCACCGTGGCGTAAATACGCGTTGATGGCGCTGGCAATCATTCTTTTTGGCTC  1 4 9 4 1 5 0 9 A S V A P K E  F  L  G  1536 1 5 5 1 1 5 6 6 1 5 8 1 H F T V F A L A C V V G Y Y V V W N V S H A L CACTTCACCGTTTTCGCGCTGGCCTGCGTTGTCGGTTArTACGTGGTGTGGAATGTATCGCACGCG  H  1 5 9 6 T P L M  S  1 6 1 1 1 6 2 6 V T N A I S G  I  1  V  1653 1 6 6 8 1 6 8 3 V G A L L Q 1 G Q G G W V S F L S F GTCGGAGCACTGTTGCAGATTGGCCAGGGCGGCTGGGTTAGCTTCCTTAGT  A  1 7 1 3 S 1 N 1  F  1 7 2 8 1 7 4 3 G G F T V T Q  R  M  1  1 6 9 8 A V L I  1770  1785  1800 M S G G L V T A A AAATGTTCCGCAAAAATTAAGGGGTAACATATGTCTCGAGGATTAGTTACAGCTC  pntB  1815 Y I  V  A  1830 1 L F  A  1845 F S  1  L  A  1860 L S  G  K  H  E  1977 V I  G  G  T  »»  1887 1902 1917 1932 S R Q G N N F G I A G M A I A L I A T I F TCTCGCCAGGGTAACAACTTCGGTATCGCCGGGATGGCGATTGCGTTAATCCCAACCA  G  P  1947 T G  D  N  V  1962 W I  G  L  L  A  M  2004 2019 2034 2049 2064 2079 2094 A 1 G 1 R L A K K V E M T E M P E L V A I L H S F V G L A A V L V G F N S Y L GCAATTGGTATCCGTCTGGCGAAGAAAGTTGAAATGACCGAAATGCCAGAACTGGTGGCGATCCTGCATAGCTTCGTGGGTCTGGCGGCAGTGCTGGTTGGCTTTAACAGCTATCTG 2121 2136 2151 2166 2181 2196 2211 H H D A G M A P 1 L V N 1 H L T E V F L G . I F I G A V T F T G S V V A F G K L CATCATGACGCGGGAATGGCACCGATTCTGGTCAATATTCACCTGACGGAAGTGTTCCTCGGTATCTTCATCGGGGCGGTAACGTTCACGGGTTCGGTGGTGGCGTTCGGCAAACTG 2238 2253 2268 2283 2298 2313 C G K I S S K P L M L P N R H K M N L A A L V V S F L L L I V F V TGTGGCAAGATTTCGTCTAAACCATTGATGCTGCCAAACCGTCACAAAATGAACCTGGCGGCTCTGGTCGTTTCCTTCCTGCTGCTGATTGTAT^  R  2328 D S  T  V  G  2355 2370 2385 2400 2415 2430 2445 L Q V L A L L I M T A I A L V F G W H L V A S I G G A D M P V V V S M A CTGCAAGTCCTGGCATTGCTGATAATGACCGCAATTGCGCTGGTATTCGGCTGGCATTTAGTCGCCTCCATCGGTGGTGCAGATATGCCAGTGGTGGTGTCGA  E  L  V  2472 2487 2502 L R L G G C G C G L Y A Q Q . R P V CTCCCGCTGGGCGGCTGCGGCTGCGGGCTTTATGCTCAGCAACGACCTGTC  2547 1 L  S  Y  I  2562 M C  K  A  M  2664 E 1  T  A  E  2679 E T  A  E  L  2706 2721 2736 2751 2766 2781 L K N S H S V I I T P G Y G M A V A Q A Q Y P V A E I T E K L R A CTGAAAAACTCCCATTCAGTGATCATTACTCCGGGGTACGGCATGGCAGTCGCGCAGGCGCAATATCCTGTCGCTGAAATTACTGAGAAATTGCGCG  R  G  2796 1  N  V  R  2823 2838 2853 2868 F G 1 H P V A G R L P G H M N V L L A E A TTCGGTATCCACCCGGTCGCGGGGCGTTTGCCTGGACATATGAACGTATTGCTGGCTGAA  K  V  P  2883 Y D  I  V  L  2898 E M  D  E  I  N  2913 D  D  F  A  2940 2955 2970 D T D T V L V I G A N D T V N P A A GATACCGATACCGTACTGGTCATTGGTGCTAACGATACGGTTAACCCGGCGG  P  K  S  3000 P I  A  G  M  3015 P V  L  E  V  W  3030 K  A  Q  N  K  A  S  3147 V  D  A  I  I  V  2517 T G  A  L  V  2532 G S  2589 2604 2619 2634 2649 N R S F I S V I A G G F G T D G S S T G D D Q E V G AACCGTTCCTTTATCAGCGTTATTGCGGGTGGTTTCGGCACCGACGGCTCTTCTACTGGCGATGATCAGGAAGTC  3057 3072 3087 V I V F K R S M N T G Y A G V O . GTGATTGTCTrrAAACGTTCGATGAACACTGGCTATGCTGGTGTGCAA  N  2985 D D  Q  P  L  3102 F F  K  E  N  3117 T H  S  E  G  H  M  3169 3179 3189 3199 3209 3219 3229 3239 L K A L CTGAAAGCTCTGTAACCCTCGACTCTGCTGAGGCCGTCACTCTTTATTGAGATCGCTTAACAGAACGGCGATGCGACTCTA  A  R  L  F  3132 G D  A  Co  0  T3 [ 1  REVERSE SEQUENCING PRIMER C  A  O  O  A  A  A  C  A  Q  C  I  A  I  S  A  I—' CO (U  (+| STRAND SYNTHESIS  C---  15-BASE SEQUENCING PRlMEfl i i a c A O c * c r « * c c c  |-> STRAND SYNTHESIS  lllllllllllllllll e i « < ) A A A C i o c i i f « 4 C C A i e * i t «  11 I M I I I I 11 I I I I I II I I I M I I I I ,1 I I 111 I I I 11 I I I I I  i i t i i i i i t i u t II  ccAATiccACcrccctAcccccGCAicciciAaAGiccACCiGCAGGCAiQCAACcnctiC*  I  IcoM  I  I  , Stll  J  Atwtll  I M  L  i  »Mint  II  I  X0<l  I  SWI Met i  I  **Mi  I  ton I  I  MaMH  I  c i a o c c o i c a i  III III I I I M I I I  i i  i A c i i c o i c a i a * c i « o a  9  a-  11111111111 11111 l i l l l l l l l l i ,11111 111111111 IIIIIIIIIIIIIUII  B xi  17-BASE SEQUENCING PRIMER  o a  Ml3mplfi  HYBRIDIZATION PROBE PRIMER  H-  3  OP C A O O A A A C A Q C I A f a A C C A i a A I I A  CCCCAAGCIlGCAIGCCIGCAGGICGACICIAGAGGAICCCCGCCTACCGAGCICGAAnCA  ( Htnau  ,  sp«i  | _  tut  !  s*ti ACS I f*m •  I  ««t  I JAAIIIII  MI3mpl9  J U l SAM  I I I  I  ) « M i sui  I  tsotn  C I O O C C O I C O I l l l A C A A C a l c A | i A 6 f « a «  I  1 (D OQ H* O 3 ca  o  121.  fragments for  (mostly E c o R I / H i n c I I fragments) o f pDC21 were c l o n e d i n t o  sequencing.  However, i t proved d i f f i c u l t  to cover the whole gene.  to i s o l a t e s u f f i c i e n t  M13 clones  T h e r e f o r e , the m a j o r i t y o f the c l o n e s f o r  sequencing were generated u s i n g exonuclease BAL31. fragments were generated u s i n g BAL31.  The f i r s t  Three s e t s o f  s e t o f fragments  were  generated by c l e a v i n g the unique Smal s i t e o f pDC21, t r e a t i n g the l i n e a r i z e d p l a s m i d DNA w i t h BAL31 f o r v a r i o u s l e n g t h s o f time and then r e l e a s i n g the shortened pnt fragment w i t h P s t l and H i n d l l l . fragments were c l o n e d i n t o P s t l / S m a l c l e a v e d M13mpl9. fragments were generated by c l e a v i n g the unique P s t l  The BAL31  The second s e t o f s i t e o f pDC21,  t r e a t i n g the l i n e a r i z e d p l a s m i d w i t h BAL31 f o r v a r i o u s l e n g t h s o f time and then r e l e a s i n g the shortened fragments by c l e a v a g e w i t h BamHI. fragments were c l o n e d i n t o the BamHI/SmaI s i t e o f M13mpl9.  The  Clones  c o n t a i n i n g fragments o f the o p p o s i t e s t r a n d o f pDC21 were generated by c l e a v i n g pDC21 w i t h B s t E I I , t r e a t i n g w i t h BAL31 f o r v a r i o u s l e n g t h s o f time and then r e l e a s i n g two fragments c o n t a i n i n g o p p o s i t e ends o f the pnt gene by c l e a v i n g w i t h H i n d l l l and BamHI.  These fragments were c l o n e d i n t o  e i t h e r BamHI/HincII-treated M13mpl8 o r H i n d l l l / H i n c I I - t r e a t e d Ml3mpl9. The M13 phage c o n t a i n i n g the fragments were transformed i n t o JM103 and the sequencing p r o t o c o l s c a r r i e d out as d e s c r i b e d i n M a t e r i a l s and Methods. Thus, the sequence was b u i l t up i n an o r d e r l y and r a p i d manner i n both o r i e n t a t i o n s , as summarized i n F i g . 38. The p r e d i c t e d amino a c i d sequences  f o r the a and 6 transhydrogenase  s u b u n i t s are shown i n F i g . 36.  The amino a c i d c o m p o s i t i o n o f the two  s u b u n i t s i s shown i n Table 13.  The p r e d i c t e d m o l e c u l a r weight  and S s u b u n i t s a r e 53,906 and 48,667 r e s p e c t i v e l y .  f o r the a  122  F i g . 38.  Summary o f c l o n e s used t o e s t a b l i s h the n u c l e o t i d e sequence.  H o r i z o n t a l arrows r e p r e s e n t e x t e n t o f sequences determined and t h e i r orientations.  Symbols: H i , H i n d l l l ; Ps, P s t l ; H, Hpal; P, P v u l l ;  He, H i n d i ; E, EcoRI; X, X h o l ; Sa, S a i l ; Bs, B s t E I I ; B, BamHI; Sm, Smal; S, S s t I .  Boxed  l i n e s a r e i n s e r t e d DNA and d o t t e d  l i n e s are pUC13 v e c t o r  DNA.  Hi  pnt AHPHc  ""r  K  n—  E X HcSa  S E  • pntB E Bs P _i i i_  Sm BSE  Ps  0.5 kb  pDC 11 pDC 21  T a b l e 13.  Amino a c i d c o m p o s i t i o n o f the transhydrogenase  No.  GLY ALA LEU ILE VAL PRO GLU GLN ASP ASN THR SER MET CYS ARG LYS HIS TYR PHE TRP  of residues/subunit a 13  41 59 42 38 51 24 31 20 16 18 30 27 15 6 20 24 4 8 20 8 502  48 55 47 38 48 17 19 10 18 18 22 25 19 4 13 17 12 8 21 3 462  Content a  8.17 11.75 8.37 7.57 10.16 4.78 6.18 3.98 3.19 3.59 5.98 5.38 2.99 1.20 3.98 4.78 0.80 1.59 3.98 1.59  subunits.  (mole  %) 13  10.39 11.90 10.17 8.22 10.39 3.68 4.11 2.16 3.90 3.90 4.76 5.41 4.11 0.87 2.81 3.68 2.60 1.73 4.55 0.65  124.  DISCUSSION  Physiological Mutants (82,84).  Role have been i s o l a t e d which  One o f the mutants,  l a c k transhydrogenase  RH-5, had normal  activity  growth r a t e s when grown  a e r o b i c a l l y on a s y n t h e t i c medium w i t h g l u c o s e , g l y c e r o l o r f r u c t o s e as carbon s o u r c e , when compared t o the growth r a t e s o f the p a r e n t a l  strain.  The mutant a l s o grew n o r m a l l y under a n a e r o b i c c o n d i t i o n s on s y n t h e t i c media w i t h g l u c o s e o r g l y c e r o l and fumarate as carbon source ( T a b l e 2 ) . These r e s u l t s agree w i t h those o f Hanson (82,84).  Thus,  transhydrogenase  i s not an e s s e n t i a l source o f NADPH f o r the c e l l . In  agreement w i t h the f i n d i n g s o f L i a n g and Houghton (85) glutamate  dehydrogenase  and transhydrogenase a c t i v i t i e s were found t o be c o r e g u l a t e d  during nitrogen l i m i t a t i o n .  C o o r d i n a t e changes i n the l e v e l s o f  transhydrogenase and glutamate dehydrogenase may  suggest t h a t  transhydrogenase  be a d i r e c t source o f NADPH f o r t h e glutamate dehydrogenase  T h i s h y p o t h e s i s was t e s t e d by i n a c t i v a t i n g transhydrogenase E. c o l i dependent  s o l e l y on t h e glutamate dehydrogenase  a s s i m i l a t i o n o f ammonia. growth.  reaction.  i n a strain of  pathway f o r  The mutant d i d n o t r e q u i r e glutamate f o r  T h i s r u l e s out the h y p o t h e s i s t h a t transhydrogenase i s the s o l e  source o f NADPH f o r ammonia a s s i m i l a t i o n by glutamate dehydrogenase  i n E.  coli. These r e s u l t s suggest t h a t the transhydrogenase o f E . c o l i may n o t f u n c t i o n as a component i n a s p e c i f i c pathway. coli  i s almost e n t i r e l y NAD-linked,  S i n c e the c a t a b o l i s m o f E_.  t h e f u n c t i o n o f the e n e r g y - l i n k e d  transhydrogenase may be t o channel r e d u c t i o n e q u i v a l e n t s from the NADH p o o l t o the NADPH p o o l under  thermodynamically u n f a v o u r a b l e c o n d i t i o n s .  A  125.  number o f o t h e r enzymes i n c l u d i n g g l u c o s e 6-phosphate dehydrogenase and N A D P - s p e c i f i c m a l i c enzyme a l s o c o n t r i b u t e t o the NADPH p o o l . it  Therefore,  i s n o t s u r p r i s i n g t h a t transhydrogenase mutants grow n o r m a l l y .  It i s  i n t e r e s t i n g t o note t h a t mutants d e f e c t i v e i n both g l u c o s e 6-phosphate dehydrogenase  and transhydrogenase grow much slower than mutants d e f e c t i v e  i n o n l y one o f t h e enzymes ( 8 4 ) .  C l o n i n g and E x p r e s s i o n o f Transhydrogenase A g r e a t d e a l o f time and e f f o r t was devoted t o t h e p u r i f i c a t i o n o f transhydrogenase from E . c o l i s t r a i n W6 d u r i n g the i n i t i a l s t a g e o f t h i s project.  The transhydrogenase was p u r i f i e d  combination o f hydrophobic, ion-exchange A n a l y s i s o f the p u r i f i e d  t o near homogeneity by a  and a f f i n i t y  chromatography.  transhydrogenase u s i n g SDS-PAGE showed t h e  presence o f t h r e e major p r o t e i n bands o f m o l e c u l a r weights 100,000, 52,000 and 47,000 as w e l l as s e v e r a l minor p r o t e i n bands. c l o s e l y resembled  The SDS-PAGE p r o f i l e  the r e s u l t s r e p o r t e d by L i a n g and Houghton (55) a l t h o u g h  t h e i r g e l s showed o n l y one p r o t e i n band i n the m o l e c u l a r weight  50,000  region. The p u r i f i c a t i o n procedure from s t r a i n W6 was n o t e n t i r e l y satisfactory.  The r e p r o d u c i b i l i t y o f the procedure was poor.  v a r i a b i l i t y o c c u r r e d d u r i n g t h e a f f i n i t y chromatography al.  step.  Much o f t h e Persson e t  (50) a l s o r e p o r t e d t h a t y i e l d s and p u r i t y o f m i t o c h o n d r i a l  transhydrogenase v a r i e d g r e a t l y when p u r i f i e d u s i n g a f f i n i t y chromatography  w i t h AG-NAD r e s i n s .  Another problem w i t h the p u r i f i c a t i o n  procedure was t h a t t h e transhydrogenase p r e p a r a t i o n was contaminated w i t h several other p r o t e i n s .  T h e r e f o r e i t was d e c i d e d t o a m p l i f y the l e v e l s o f  transhydrogenase i n t h e c e l l s by c l o n i n g t h e pnt gene onto a m u l t i - c o p y plasmid.  126.  Based on the r a t i o n a l e that E. c o l i  c e l l s harbouring  plasmids  c o n t a i n i n g the pnt gene would c o n t a i n e l e v a t e d l e v e l s o f enzyme, t h r e e c l o n e s were i s o l a t e d from the C l a r k e and contained was  the transhydrogenase gene.  Carbon colony bank which  That the pnt gene had been c l o n e d  shown by the f o l l o w i n g .  (i)  An  8.7-kilobase  fragment common to a l l t h r e e plasmids  was  included  i n the 35.5-min r e g i o n o f the E. c o l i genome p r e v i o u s l y mapped as the l o c u s f o r the pnt gene ( F i g . 8 ) . (ii)  Transhydrogenase a c t i v i t y was  r e p r e s s e d when the  plasmid-bearing  c e l l s were grown i n a r i c h medium (Table 6 ) . (iii)  A n a l y s i s o f membranes o f the p l a s m i d - b e a r i n g a m p l i f i e d e x p r e s s i o n o f the two  s t r a i n s showed  polypeptides of molecular  52,000 and 48,000 ( F i g . 11) which were observed  i n the  5).  strain  W6  S i m i l a r p o l y p e p t i d e s were formed d u r i n g i n v i t r o  t r a n s c r i p t i o n / t r a n s l a t i o n o f p D C l l DNA (iv)  weights  partially  p u r i f i e d p r e p a r a t i o n o f the transhydrogenase o f E. c o l i (Fig.  the  Transhydrogenase a c t i v i t y was transhydrogenase-defective  ( F i g . 12).  r e s t o r e d to a  mutant when transformed  with  plasmid  pDC21 (Table 7 ) . Subcloning  o f the pnt gene i n t o pUC13 r e s u l t e d i n up  a m p l i f i c a t i o n of transhydrogenase a c t i v i t y . the p r o t e i n products presence o f SDS  Initial  to 7 0 - f o l d  attempts to  identify  by SDS-PAGE f a i l e d because h e a t i n g a t 100°C i n the  g e l e l e c t r o p h o r e s i s sample b u f f e r caused a g g r e g a t i o n  the p r o t e i n s so t h a t they d i d not e n t e r the g e l ( F i g . 11). Houghton demonstrated t h a t the r a t i o o f 100K a l t e r e d upon a l k y l a t i o n .  Therefore,  an u n u s u a l l y s t a b l e dimer o f one  the 100K  to 50K  Liang  protein could  p r o t e i n probably  o r both o f the lower m o l e c u l a r  of  and be  represents weight  127.  components.  The rodA gene product (138), l a c t o s e permease (139), and  g l y c e r o l phosphate boiled  i n SDS.  permease (140) are o t h e r p r o t e i n s which aggregate when  A l l f o u r p r o t e i n s which behave i n t h i s manner are  c y t o p l a s m i c membrane p r o t e i n s . Both p o l y p e p t i d e s are needed f o r the e x p r e s s i o n o f transhydrogenase activity.  D e l e t i o n o f a 1 . 6 - k i l o b a s e H p a l - H i n d l l l fragment  g i v e pDC9 r e s u l t e d i n the l o s s o f the 48,000-molecular from the membranes o f p l a s m i d - b e a r i n g c e l l s 0 . 5 5 - k i l o b a s e H p a l - H i n d l l l fragment of  pDC3 to g i v e pDC8 r e s u l t e d  52,000-molecular  D e l e t i o n o f the  i n the l o s s o f both p o l y p e p t i d e s .  deleted  transhydrogenase a c t i v i t y was  weight p o l y p e p t i d e  from the 4 . 8 - k i l o b a s e H i n d l l l  weight p o l y p e p t i d e was  S a l l - B s t E I I fragment was  ( F i g . 12).  from pDC4 t o  insert The  l o s t when a 0.45-kilobase  from p D C l l ( F i g . 12).  No  a s s o c i a t e d w i t h any o f these p l a s m i d s .  These r e s u l t s suggest t h a t a l l o r p a r t o f the promoter  r e g i o n i s found i n  the  0 . 6 0 - k i l o b a s e H p a l - H i n d l l l r e g i o n f o l l o w e d by the r e g i o n s c o d i n g f o r  the  52,000 and 48,000-molecular  weight  polypeptides, respectively.  Compatible plasmids which would express e i t h e r the 50,000 o r 48,000-molecular-weight t o g e t h e r i n t o J.. activity.  p o l y p e p t i d e s were c o n s t r u c t e d and transformed  c o l i AB1450 (pnt::Tn5)  lacking  transhydrogenase  In such c e l l s , a c t i v e transhydrogenase was  formed  indicating  t h a t the transhydrogenase o f E. c o l i i s composed o f two d i f f e r e n t s u b u n i t s of m o l e c u l a r weights  52,000 and 48,000 ( F i g . 15).  The two s u b u n i t s o f  m o l e c u l a r weights 52,000 and 48,000 were d e s i g n a t e d as the a and ft s u b u n i t s r e s p e c t i v e l y o f transhydrogenase. E x p r e s s i o n o f the pnt gene o f the m u l t i c o p y p l a s m i d pDC21 r e s u l t e d i n g r e a t e r than 7 0 - f o l d o v e r p r o d u c t i o n o f transhydrogenase i n c e l l s h a r b o u r i n g the p l a s m i d s .  The a and B s u b u n i t s were the two most  128.  abundant p o l y p e p t i d e s i n the c y t o p l a s m i c membranes o f these  cells.  B i o s y n t h e s i s o f transhydrogenase t o amounts g r e a t e r than those o f w i l d - t y p e s t r a i n s had e f f e c t s on morphology, growth r a t e , growth y i e l d c e l l d i v i s i o n o f these c e l l s  ( T a b l e 8, F i g . 16).  Deletion of portions of  the genes c o d i n g f o r the a or fi s u b u n i t s so t h a t o n l y one was  s y n t h e s i z e d i n the c e l l s  i n t a c t subunit  i n l a r g e amounts a l s o caused the  p h y s i o l o g i c a l and m o r p h o l o g i c a l e f f e c t s  (Table 8 ) .  abnormal  T h e r e f o r e , the changes  a r e not the r e s u l t o f a p y r i d i n e n u c l e o t i d e imbalance which may produced by excess l e v e l s o f transhydrogenase.  and  be  The p h y s i o l o g i c a l  and  m o r p h o l o g i c a l phenomena observed i n the E. c o l i s t r a i n s , which s y n t h e s i z e h i g h l e v e l s o f transhydrogenase, are thus t o be regarded as a s o l e consequence membrane.  o f the abnormally h i g h amount o f p r o t e i n b e i n g i n s e r t e d T u b u l a r - l i k e s t r u c t u r e s were observed i n the c e l l s  excess l e v e l s o f the transhydrogenase s u b u n i t s ( F i g . 17).  i n the  containing  Lemire e t a l .  (141) found unusual t u b u l a r v e s i c l e s i n t h e i r membrane p r e p a r a t i o n s o f an E. c o l i s t r a i n o v e r p r o d u c i n g the membrane-bound fumarate r e d u c t a s e . same group d i d a thorough study on the m o r p h o l o g i c a l changes caused  The by  o v e r p r o d u c t i o n o f fumarate r e d u c t a s e under growth c o n d i t i o n s where the enzyme accounted f o r more than 50% o f the inner-membrane p r o t e i n  (142).  They found t h a t the membrane accommodated t h i s excess fumarate r e d u c t a s e w i t h o u t r e d u c i n g the l e v e l s o f o t h e r membrane-associated same time, the amount o f membrane l i p i d l i p i d / p r o t e i n r a t i o remained membrane had doubled.  c o n s t a n t , i n d i c a t i n g t h a t the t o t a l amount o f localized  i n tubular  from the c y t o p l a s m i c membrane and were composed  o f an aggregate o f fumarate r e d u c t a s e and appeared  At the  i n c r e a s e d such t h a t the  The excess membrane was  s t r u c t u r e s which branched  enzymes.  lipid.  The t u b u l e s o n l y  a f t e r the c y t o p l a s m i c membrane became h i g h l y e n r i c h e d i n fumarate  129.  reductase.  Changes i n l i p i d  c o m p o s i t i o n were a l s o observed.  change i n p h o s p h o l i p i d c o m p o s i t i o n upon a m p l i f i c a t i o n o f r e d u c t a s e was  fumarate  the disappearance o f the a c y l p h o s p h a t i d y l g l y c e r o l and  appearance o f c a r d i o l i p i n . observed  The major  S i m i l a r t u b u l a r - l i k e s t r u c t u r e s c o u l d be  i n some o f the c e l l s c o n t a i n i n g excess  However, no transhydrogenase  a c t i v i t y was  transhydrogenase.  d e t e c t e d i n the  f r a c t i o n a f t e r c e n t r i f u g a t i o n a t 50,000 x g f o r 90 min o f prepared by French p r e s s l y s i s .  supernatant envelopes  Under these c o n d i t i o n s , Weiner e t a l .  (141) r e p o r t e d t h a t s m a l l fragments t u b u l e s remained  the  i n the supernatant  o f the fumarate r e d u c t a s e - e n r i c h e d fraction.  Abnormal p h y s i o l o g i c a l and m o r p h o l o g i c a l e f f e c t s were a l s o r e p o r t e d by von Meyenburg e t a l . (143) on o v e r p r o d u c t i o n o f membrane-bound synthase  i n E. c o l i .  They observed  ATP  t h a t 10- to 1 2 - f o l d o v e r p r o d u c t i o n o f  ATP  synthase r e s u l t e d i n pronounced i n h i b i t i o n o f c e l l d i v i s i o n and  and  i n f o r m a t i o n o f membrane c i s t e r n ( s ) and v e s i c l e s w i t h i n the  I n c l u s i o n b o d i e s , p r o b a b l y r e p r e s e n t i n g d e p o s i t s o f excess ATP were a l s o observed  i n these  growth  cells. synthase,  cells.  P u r i f i c a t i o n and C h a r a c t e r i z a t i o n o f  Transhydrogenase  C l o n i n g o f the pnt gene to form the m u l t i c o p y p l a s m i d pDC21 r e s u l t e d i n g r e a t e r than 7 0 - f o l d o v e r p r o d u c t i o n o f transhydrogenase h a r b o u r i n g the p l a s m i d .  in cells  These c e l l s s e r v e d as e x c e l l e n t s t a r t i n g m a t e r i a l  f o r the p u r i f i c a t i o n o f transhydrogenase  as the a and & s u b u n i t s were  the two major p r o t e i n s i n the c y t o p l a s m i c membrane ( F i g . 11). transhydrogenase  was  procedure employing  purified  The  from the a m p l i f i e d membranes by a simple  d i f f e r e n t i a l s o l u b i l i z a t i o n o f p r o t e i n s by d e t e r g e n t s  f o l l o w e d by c e n t r i f u g a t i o n through a 1.1  M sucrose s o l u t i o n  ( F i g . 18).  130.  The presence o f the two  s u b u n i t s (a and IS) i n the p u r i f i e d enzyme  confirmed t h a t both gene p r o d u c t s o f the pnt gene are needed f o r a f u n c t i o n a l transhydrogenase. amounts.  The  two s u b u n i t s are p r e s e n t i n equimolar  In s o l u b i l i z e d p r e p a r a t i o n s these two s u b u n i t s i r r e v e r s i b l y  aggregate over a p e r i o d o f time to form a s p e c i e s o f m o l e c u l a r weight 95,000-100,000. are  solubilized  The e x t e n t o f a g g r e g a t i o n i s i n c r e a s e d when the s u b u n i t s i n the absence o f d i s u l p h i d e - r e d u c i n g agents.  The s t r u c t u r e o f the E. c o l i the  transhydrogenase d i f f e r s markedly  from  w e l l - s t u d i e d transhydrogenase o f the bovine h e a r t m i t o c h o n d r i o n and o f  R. rubrum.  The bovine h e a r t m i t o c h o n d r i a l transhydrogenase has been  p u r i f i e d t o homogeneity and c o n s i s t s o f a s i n g l e p o l y p e p t i d e c h a i n o f m o l e c u l a r weight 97,000-120,000 (47-50).  In c o n t r a s t ,  the  transhydrogenase o f R. rubrum c o n s i s t s o f a s o l u b l e p e r i p h e r a l  protein  f a c t o r h a v i n g a m o l e c u l a r weight o f 70,000 and an i n t e g r a l membrane-bound component o f unknown m o l e c u l a r weight e x h i b i t s transhydrogenase a c t i v i t y .  (59,60). The E_. c o l i  N e i t h e r component a l o n e transhydrogenase  differs  from the R. rubrum enzyme i n t h a t both s u b u n i t s are t i g h t l y bound to the c y t o p l a s m i c membrane and a r e not r e l e a s e d even i n the presence o f M 6 urea.  The two components can be r e l e a s e d o n l y by d e t e r g e n t s such as  d e o x y c h o l a t e i n the presence o f h i g h c o n c e n t r a t i o n s o f s a l t s . Reconstitution of p u r i f i e d  transhydrogenase i n t o  egg  p h o s p h a t i d y l c h o l i n e v e i s c l e s r e s u l t e d i n a 70-80% decrease i n enzymatic activity.  A d d i t i o n o f the u n c o u p l e r , FCCP, enhanced enzymatic  activity.  S i m i l a r r e s u l t s were o b t a i n e d w i t h membrane-bound transhydrogenase, c a t a l y z i n g the r e a c t i o n i n e i t h e r d i r e c t i o n  ( F i g . 23).  These d a t a suggest  t h a t the i n h i b i t i o n o f transhydrogenase i n both d i r e c t i o n s d e r i v e s from a r a p i d e s t a l i s h m e n t o f a pH g r a d i e n t a c r o s s the membrane.  Translocation of  protons can a l s o be measured d i r e c t l y u s i n g p H - s e n s i t i v e f l u o r e s c e n t probes such as 9-aminoacridine (124-126).  D u r i n g the r e d u c t i o n o f AcNAD  by NADPH by transhydrogenase r e c o n s t i t u t e d i n t o v e s i c l e s ,  9-aminoacridine  f l u o r e s c e n c e was s u b s t a n t i a l l y quenched, i n d i c a t i n g t h a t protons were taken i n t o t h e v e s i c l e s  ( F i g . 24).  A d d i t i o n a l support f o r a  p r o t o n - t r a n s l o c a t i n g f u n c t i o n o f transhydrogenase was p r o v i d e d by the ATP-dependent s t i m u l a t i o n o f the r e d u c t i o n o f NADP by NADH, c a t a l y z e d by membrane v e s i c l e s c o n t a i n i n g both p r o t o n - t r a n s l o c a t i n g ATPase and transhydrogenase. The a v a i l a b l e i n f o r m a t i o n thus seems t o f a v o u r a chemiosmotic c o u p l i n g mechanisms f o r e n e r g y - l i n k e d t r a n s h y d r o g e n a t i o n .  type o f  However,  c a u t i o n i s warranted  i n i n t e r p r e t i n g the p r e s e n t d a t a w i t h r e g a r d t o a  c o u p l i n g mechanism.  Transmembrane p r o t o n t r a n s l o c a t i o n c a t a l y z e d by  transhydrogenase remains probe used here c l e a r l y  t o be shown d i r e c t l y , a l t h o u g h the f l u o r e s c e n t i n d i c a t e s an NAD p l u s NADPH-dependent  a c i d i f i c a t i o n o f the v e s i c l e s .  F l u o r e s c e n t probes may n o t probe the  i n t e r n a l pH o f the v e s i c l e s e x c l u s i v e l y , but a l s o i n t e r a c t w i t h the s u r f a c e o r the i n t e r i o r o f t h e membrane (144).  Nevertheless,  9-aminoacridine has been r e p o r t e d t o behave as an i d e a l monoamine which d i s t r i b u t e s a c r o s s the l i p o s o m a l membrane i n response t o a transmembrane pH g r a d i e n t  (145,146).  Experiments w i t h n i g e r i c i n and v a l i n o m y c i n suggest a p r e f e r e n t i a l r e g u l a t i o n o f the enzyme by a p r o t o n g r a d i e n t r a t h e r than a membrane potential  ( F i g . 25-27).  P e r s s o n e t a l . (50) r e p o r t e d t h a t the  m i t o c h o n d r i a l transhydrogenase from bovine h e a r t was p r e f e r e n t i a l l y r e g u l a t e d by a p r o t o n g r a d i e n t r a t h e r than a membrane p o t e n t i a l .  132.  Both t r a n s h y d r o g e n a t i o n  and proton  pump a c t i v i t y o f the enzyme were  i n h i b i t e d by c o v a l e n t m o d i f i c a t i o n o f one a c t i v e enzyme u n i t by one molecule o f DCCD ( F i g . 29).  L a b e l l i n g o f the transhydrogenase  [ C ] D C C D i n d i c a t e d t h a t t h e a s u b u n i t was p r e f e r e n t i a l l y lH  (.Fig. 30). 128).  with  modified  M i t o c h o n d r i a l transhydrogenase i s a l s o i n h i b i t e d by DCCD (74,  Pennington and F i s h e r (74) p o s t u l a t e d t h a t DCCD may modify the  mitochondrial  transhydrogenase i n a p u t a t i v e p r o t o n b i n d i n g domain o u t s i d e  the a c t i v e s i t e .  By c o n t r a s t Phelps and H a t e f i (128)  have suggested  DCCD r e a c t s near the NAD(H) b i n d i n g s i t e o f beef h e a r t transhydrogenase.  mitochondrial  Persson e t a l . (50) observed an i n h i b i t i o n o f p r o t o n  pump a c t i v i t y without proton  an e f f e c t on  t r a n s l o c a t i o n and h y d r i d e  hydride  t r a n s f e r suggesting  t r a n s l o c a t i o n and c a t a l y t i c a c t i v i t i e s a r e t i g h t l y coupled T h i s does n o t imply  t h a t DCCD r e a c t s w i t h  t h a t t h i s reagent  that  t r a n s f e r are not o b l i g a t o r i l y l i n k e d .  However, my r e s u l t s w i t h E . c o l i transhydrogenase suggest t h a t  evident  that  the p r o t o n pump.  i s not a s p e c i f i c  proton  ( F i g . 29). I t has become  i n h i b i t o r o f p r o t o n pumps  (147). Homyk and Bragg (88) concluded allosteric  t h a t NADH may a l s o b i n d t o an  s i t e by s t u d y i n g the k i n e t i c s o f m o d i f i c a t i o n by  2,3-butanedione o f a r g i n y l r e s i d u e s o f the membrane-bound E . c o l i transhydrogenase. ( F i g . 31).  The present  r e s u l t s are consistent with  this  conclusion  Furthermore, the NADH analogue AcNADH appears n o t t o b i n d to  t h i s s i t e s i n c e i t does n o t s t i m u l a t e the enzyme-catalyzed r e d u c t i o n o f AcNAD by NADPH o r p r o t e c t the enzyme from m o d i f i c a t i o n by DCCD ( T a b l e 12).  The p r o t e c t i o n by NADH might mean t h a t DCCD binds  t o the enzyme a t  o r near the a l l o s t e r i c NADH-binding s i t e t h a t s t i m u l a t e s the r e d u c t i o n o f AcNAD by NADPH.  An a l t e r n a t i v e e x p l a n a t i o n  i s that the b i n d i n g o f NADH t o  133.  the enzyme induces residues induce  a conformational  less accessible.  a conformational  change t h a t makes the DCCD-binding  By c o n t r a s t , the b i n d i n g o f NADP appears t o  change which causes t h e DCCD-binding r e s i d u e t o  become more a c c e s s i b l e t o t h i s reagent Substrate-induced an important  (Table 12).  conformers o f transhydrogenase a r e l i k e l y  r o l e i n the f u n c t i o n o f t h e enzyme.  b i n d i n g o f low c o n c e n t r a t i o n s  to play  F u r t h e r evidence  that  o f s u b s t r a t e s cause a c o n f o r m a t i o n a l  change  i s seen from the i n a c t i v a t i o n o f t h e enzyme by t r y p s i n ( T a b l e 10).  NADPH  i n c r e a s e d the degree o f i n a c t i v a t i o n by t r y p s i n whereas NADP, NADH and NAD did  n o t have any s i g n i f i c a n t e f f e c t on p r o t e o l y s i s ( F i g . 20).  i n t e r e s t i n g t o note t h a t s i m i l a r r e s u l t s were o b t a i n e d mitochondrial  transhydrogenase ( 8 7 ) .  This hypothesis  i s supported  f o r the r a t  liver  These r e s u l t s suggest t h a t t h e  NADP-enzyme complex has a d i f f e r e n t conformation complex.  It i s  from the NADPH-enzyme  by the f i n d i n g t h a t s u l f h y d r y l  group m o d i f i c a t i o n by N - e t h y l maleimide w i t h e i t h e r the m i t o c h o n d r i a l enzyme o r the enzyme from E . c o l i was enhanced by NADPH, whereas NADP a f f o r d e d p r o t e c t i o n a g a i n s t m o d i f i c a t i o n (46,86). A working h y p o t h e s i s  f o r a mechanism o f t h e E . c o l i  transhydrogenase  can be based on the f i n d i n g s t h a t transhydrogenase a c t s as a p r o t o n pump and  c a n e x i s t i n t h r e e d i f f e r e n t c o n f o r m a t i o n s as shown i n F i g . 39. The  r e s t i n g conformation conformation  (E^) i s transformed  to  by b i n d i n g NADP.  o f the enzyme changes t o E ^ upon h y d r i d e  the same time a p r o t o n  i s t r a n s l o c a t e d from the o u t e r  membrane t o t h e i n n e r s u r f a c e .  i o n t r a n s f e r . At surface o f the  The d i r e c t i o n o f t r a n s h y d r o g e n a t i o n  be determined by the r a t i o o f s u b s t r a t e s and p r o d u c t s , gradient.  The  would  and a l s o by the pH  134.  F i g . 39.  Proposed mechanism o f transhydrogenase i n i n t a c t E_. c o l i  , E^ and E^ a r e d i f f e r e n t  c o n f o r m a t i o n s o f t h e enzyme.  the model a r e found i n the D i s c u s s i o n .  NADH.. nH  out  + NADP + NADH + E, ^ 1  N  A  D  p  E -nH 2 out  ^  H N  nH.  + NAD + NADPH  A  D  \  NADPH^  E -nH. 3  i  n  transfer  cells.  Details of  135.  Nucleotide  Sequence of the pnt Gene  In o r d e r °f J[«  coli  plasmid and  to p r e d i c t the amino a c i d sequence of the a and  determined  ( F i g . 36).  Two  open r e a d i n g  sequences o f the u and 1386  B subunits  n u c l e o t i d e open r e a d i n g  subunits  respectively.  the a s u b u n i t  and  i n s e r t o f plasmid  the N-terminal  ( F i g . 35).  I t was  The  1406  predicted  amino a c i d  found t h a t the  frames corresponded to the a and  1406  B  However, o n l y 45 n u c l e o t i d e s remained upstream o f  69 n u c l e o t i d e s downstream o f the B s u b u n i t pDC21.  Therefore,  promoter and  to be found i n the v e c t o r DNA  i n the  transcription  t e r m i n a t i o n s i g n a l s f o r pnt gene t r a n s c r i p t i o n i n plasmid likely  of  frames of  n u c l e o t i d e s were found i n the n u c l e o t i d e sequence.  amino a c i d sequences were compared w i t h  and  subunits  transhydrogenase, the n u c l e o t i d e sequence o f the i n s e r t  pDC21 was  1386  6  pDC21 were  as e x p r e s s i o n o f transhydrogenase  v e r y h i g h i n c e l l s c o n t a i n i n g plasmid  pDC21.  The m i s s i n g  nucleotide  sequences of the pnt gene promoter r e g i o n were d e r i v e d from plasmid Promoter sequence elements, d e t e r m i n i n g t r a n s c r i p t i o n a l i n i t i a t i o n i n E_. c o l i , DNA  sequence l o c a t e d at about 10 and  transcription start site  (the  '-10'  246-base p a i r n u c l e o t i d e sequence 5' a  '-10'  (TATAAT) and  promoter-like  sequences [ 1 4 8 ] ) .  to the a ATG  codon was  1  sequence was  and  The  for  A  n u c l e o t i d e sequence between the  the i n i t i a t i o n codon o f the  i s too s h o r t (30 n u c l e o t i d e s ) to c o n t a i n a promoter. B subunits  The  found at p o s i t i o n s 138-143 (TTGTTA) and  t e r m i n a t i o n codon o f the a s u b u n i t  the a and  the  searched  a -35'(TTGACA) consensus sequence (149).  p o s i t i o n s 163-168 (TAACAT)(Fig. 36).  subunit  r e g i o n s o f conserved  35 n u c l e o t i d e s upstream from '-35'  pDCll.  the p o s i t i o n o f  c o n t a i n two  and  was  are probably  transcribed  together.  B  Therefore,  136.  F o u r - n u c l e o t i d e sequences a t p o s i t i o n s 238-241 (AGGG) and p o s i t i o n s 1775-1778 (AGGG) show some homology  t o the ribosome b i n d i n g s i t e consensus  sequence (AGGAGGT)(150) and a r e l o c a t e d a t the c o r r e c t d i s t a n c e from the a  and (3 i n i t i a t i o n  points of translation respectively  (Fig.  36).  No  o b v i o u s t e r m i n a t i o n - l i k e s t r u c t u r e was o b s e r v e d i n the sequence o f the i n s e r t e d DNA f o l l o w i n g  the c o d i n g  region.  The non-random usage o f codons i n the pnt gene c o d i n g r e g i o n s s u p p o r t s the assignment o f the open r e a d i n g frames. AGA and AGG a r e r a r e l y used i n E. sparingly  coli  (151).  The codons CTA, ATA,  The codons a r e used  i n the pntA and B genes ( F i g . 3 6 ) . G r o j e a n and F i e r s  a n a l y z e d codon usage i n JS. in-phase t r a n s l a t i o n  c o l i genes.  is facilitated  further  (151) have  They found t h a t an e f f i c i e n t  by p r o p e r c h o i c e o f d e g e n e r a t e  codewords e n d i n g w i t h a T o r C promoting a c o d o n - a n t i c o d o n i n t e r a c t i o n with intermediate strength  ( o p t i m a l energy) over those w i t h v e r y s t r o n g o r  v e r y weak i n t e r a c t i o n e n e r g y .  Generally, e f f i c i e n t l y  a c l e a r p r e f e r e n c e f o r a C i n the t h i r d  base p o s i t i o n o f codons h a v i n g A  and/or T and a p r e f e r e n c e f o r a T i n the t h i r d h a v i n g C and/or G. as  e x p r e s s e d genes show  base p o s i t i o n o f codons  C o n v e r s e l y , codon usage i n weakly e x p r e s s e d genes such  r e p r e s s o r genes f o l l o w s e x a c t l y  the o p p o s i t e r u l e s .  both the a and 13 s u b u n i t genes does not c l e a r l y  Codon usage i n  resemble codon usage i n  e i t h e r weakly o r s t r o n g l y e x p r e s s e d genes ( T a b l e 1 4 ) . The codon usage reflects normal E.  a moderately e f f i c i e n t coli cells,  t r a n s l a t i o n o f t r a n s h y d r o g e n a s e mRNA.  t r a n s h y d r o g e n a s e o n l y r e p r e s e n t s between 0.1% t o  0.5% o f the c y t o p l a s m i c membrane p r o t e i n .  T h i s i s much more e x p r e s s i o n  than weakly e x p r e s s e d genes such as r e p r e s s o r p r o t e i n s but much l e s s efficiently  In  e x p r e s s e d genes such as RNA polymerase and r i b o s o m a l  than  proteins.  T a b l e 14.  Codon usage i n the E. c o l i pnt genes.  a  B  a_  6  2 4 0 8  2 2 0 3  R R R R  10 6  7 4 1 1 1 1  5 8 2 0  2 5 0 0  a  B  4 4 0 0  5 3 0 0  TGT C TGC C TGA TGG W  7 5 4 6  CGT CGC CGA CGG  TTT TTC TTA TTG  F F L L  9 11 4 6  8 13 3 6  TCT TCC TCA TCG  S S S S  1 2 6 5  7 4 1 6  TAT Y TAC Y TAA TAG  CTT CTC CTA CTG  L L L L  8 4 2 18  3 3 0 34  CCT CCC CCA CCG  P P P P  2 0 5 17  4 0 4 9  CAT CAC CAA CAG  Q Q  2 2 9 11  ATT ATC ATA ATG  I I I M  24 11 3 15  19 18 1 19  ACT ACC ACA ACG  T T T T  5 17 3 5  4 9 2 7  ATT AAC AAA AAG  N N K K  10 8 20 4  4 14 12 5  AGT S AGC S AGA R AGG R  GTT GTC GTA GTG  V V V V  13 11 4 23  9 10 7 22  GCT GCC GCA GCG  A A A A  2 11 18 28  13 6 12 22  GAT GAC GAA GAG  D D E E  9 7 24 7  11 7 15 4  GGT GGC GGA GGG  H H  G G G G  10 22  22 14 1 5 8 7  138.  The  amino a c i d sequences o f the transhydrogenase o and fl s u b u n i t s  were p r e d i c t e d hydrophobic.  from t h e n u c l e o t i d e  sequences.  Both s u b u n i t s  are rather  A n a l y s i s o f the amino a c i d sequence o f both s u b u n i t s f o r  l o c a l hydropathy and p r e d i c t e d  secondary s t r u c t u r e suggests t h a t  of a t l e a s t f i v e transmembrane segments i n the a subunit transmembrane segments i n theflsubunit  ( F i g . 40,41).  presence  and seven The r e l i a b i l i t y o f  such p r e d i c t i o n s a r e unknown because o f an absence o f a database o f membrane p r o t e i n s o f known s t r u c t u r e . The and  a subunit  of E. c o l i  c o v a l e n t l y w i t h DCCD.  transhydrogenase r e a c t s q u i t e  specifically  Other p r o t e i n - t r a n s l o c a t i n g enzymes r e a c t w i t h  DCCD and the s i t e o f i n t e r a c t i o n w i t h DCCD has been i d e n t i f i e d cases (152).  They e x h i b i t s t r i k i n g s i m i l a r i t y : i n a l l cases DCCD r e a c t s  with a carboxyl  residue  l o c a t e d i n an o t h e r w i s e hydrophobic and h i g h l y  conserved r e g i o n o f these p o l y p e p t i d e s . proton-translocation.  supports the s u p p o s i t i o n  o f p r o t o n pumps (147).  T h i s r e s i d u e may be important t o  However, no homologous sequence was found i n t h e  amino a c i d sequence o f e i t h e r s u b u n i t observation  i n some  o f E. c o l i  transhydrogenase.  t h a t DCCD i s not a s p e c i f i c  This  inhibitor  139.  Fig.  40.  Hydropathy p l o t o f the transhydrogenase  procedure (A),  o f Kyte and D o o l i t t l e  (153).  a s u b u n i t based  The p o s i t i o n s o f b a s i c r e s i d u e s  a c i d i c r e s i d u e s ( A ) and r e g i o n s of p r e d i c t e d a l p h a h e l i x  beta sheet (I-V).  (niltl) a r e i n d i c a t e d .  on the  (-) and  P o s s i b l e transmembrane segments are shown  Secondary s t r u c t u r e was determined  by the method o f G a m i e r e t a l .  (154).  -3\  AA  AA  A  A A A  \  ^  i  A  um-  x:  A  A  i f |  i  II I  o  I  A  A A /, A  I  AAAA-L -  _l 100  _l_  50  as  Ct A A  A ^A  tS.±A  - | |  l_  A  A A,-^  -i_  T3 >.  ~  A A  II -I  200  150  X.  A  i  250 V? 1  r  IV  . 'i  A  -3  £.  A  a  A  A  L  250  i  300  i  IIIIII  in  in  _i_  i  —IIIIIHIU-  350 Residue number  400  450  500  L40.  F i g . 41.  Hydropathy p l o t o f the transhydrogenase 13 s u b u n i t based on the  procedure of Kyte and D o o l i t t l e (*), a c i d i c beta sheet  residues  (153).  (A) and r e g i o n s o f p r e d i c t e d a l p h a h e l i x  (inn) are i n d i c a t e d .  shown ( I - V T I ) .  The p o s i t i o n s o f b a s i c r e s i d u e s (-) and  P o s s i b l e transmembrane segments a r e  Secondary s t r u c t u r e was determined by the method o f  G a r n i e r e t a l . (154).  I  i — ~ — i  i  II  3  -3  III  1 i — = — i  IV  i  '—i  i  V  1  i  VI  i  —  VII  :  —  L  A£* A  A  II  * \ &  A A  A  I  A  A A  llll  A  A  A  I I II I I  II  -  A  A  A  I tl SI ||  x: a. O -a  0  50  A  -3  L  250  A  »—«i  A ^ A A  100  «^A A  i it »i  A ^AA  i  300  A  i  150  A  M  350  AA  i  A  AA^AAAA  A  200  /£A  A A  i i III*  ill - I -  v 400 Residue number  A^  A^  II  AA  ii  450  250  A  141.  REFERENCES 1.  Colowick, S.P., N.O. Kaplan, E.F. N e u f e l d and M.M. C i o t t i J . B i o l . Chem. 195, 95-105.  (1952)  2.  Kaplan, N.O., S.P. Colowick and E.F. N e u f e l d (1953) J . B i o l . Chem. 205, 1-15.  3.  F i s h e r , R.R. and S.R. E a r l e (1982) i n The p y r i d i n e n u c l e o t i d e coenyzmes ( J . E v e r s e , B. Anderson and K.-S. You, e d s . ) pp.279-324, Academic P r e s s , New York.  4.  Rydstrom, J . (1977) Biochim. B i o p h y s . A c t a 463, 155-184.  5.  Rydstrom, J . , J.B. Hoek and L. E r n s t e r (1976) i n The enzymes (P.D. Boyer, ed.) V o l . 13, pp. 51-88, Academic P r e s s , New York.  6.  L o u i e , D.D. and N.O. Kaplan (1970) J . B i o l . Chem. 245, 5691-5698.  7.  Chung, A.E. (1970) J . B a c t e r i o l . 102, 437-438.  8.  Kaplan, N.O., S.P. Colowick, E.F. N e u f e l d and M.M. C i o t t i J . B i o l . Chem. 205, 17-29.  9.  Cohen, P.T. and N.O. Kaplan (1970) J . B i o l . Chem. ^45, 2825-2836.  (1953)  10.  van den Brock, H.W.J., J.S. Santema, J.H. Wassink and C. Veeger (1971) E u r . J . Biochem. 24, 31-45.  11.  M i d d l e d i t c h , L.E., R.W. A t c h i s o n and A.E. Chung (1972) J . B i o l . Chem. 247, 6802-6809.  12.  L o u i e , D.D., N.O. Kaplan and J.D. Lean 70, 651-664.  13.  Murthy, P.S. and A.E. B r o d i e (1964) J . B i o l . Chem. 239,  14.  Asano, A, K. Imai and R. Sato (1967) B i o c h i m . B i o p h y s . A c t a 143, 477-486.  15.  Downs, A . J . and C.W. Jones  16.  Kay, W.W.  17.  C o l l i n s , P.J. and C . J . Knowles (1977) Biochim. B i o p h y s . A c t a 480, 77-82.  18.  K e i s t e r , D.L. and N.J. Y i k e (1967) B i o c h e m i s t r y 6_, 3847-3857.  19.  Orlando, J.A., D. Sabo and C. Curnym 41, 937-945.  and P.D. Bragg  (1972) J . M o l . B i o l .  4292-4297.  (1975) A r c h . M i c r o b i o l . 105, 159-167.  (1975) Biochem. J . 150, 21-29.  (1966) P l a n t  Physiol.  142.  20.  Kaplan, N.O. , M.N. Swartz, M.E. Freeh and M.M. C i o t t i N a t l . Acad. S c i . kl, 481-487.  (1956) P r o c .  21.  D a n i e l s o n , L. and L. E r n s t e r (1963) Biochem. B i o p h y s . Res. Commun. 10, 91-96.  22.  D a n i e l s o n , L. and L. E r n s t e r  23.  Houghton, R.L., R.J. F i s h e r and D.R. Sanadi (1975) Biochim. B i o p h y s . A c t a 396, 17-23.  24.  K e i s t e r , D.L. and N.J. Y i k e (1966) Biochem. Biophys. Res. Commun. 24, 519-525.  25.  F i s h e r , R.J. and D.R. Sanadi (1971) Biochim. B i o p h y s . A c t a 245, 34-41.  26.  Bragg, P.D. and C. Hou (1968) Can. J . Biochem. 46_, 631-641.  27.  Bragg, P.D. and C. Hou (1972) FEBS L e t t . 28, 309-312.  28.  Lee, C.P. and L. E r n s t e r (1964) Biochim. B i o p h y s . A c t a 81, 187-190.  29.  Rydstrom, J . , A. T e i x e i r a da Cruz and L. E r n s t e r (1970) Eur. J . Biochem. 17_, 56-62.  30.  Cox, G.B., N.A. Newton, J.D. B u t l i n and F. Gibson (1971) Biochem. J 125, 489-493.  31.  Kanner, B . J . and D.C. G u t n i c k (1972) FEBS L e t t . _22, 197-199.  32.  Hanson, R.L. and E.P. Kennedy (1973) J . B a c t e r i o l . 114, 772-781.  33.  Cox, G.B., F. Gibson, L.M. McCann, J.D. B u t l i n and F.L. Crane (1973) Biochem. J . 132, 689-695.  34.  M o n t a l , M., B. Chance, C.P. Lee and A. A z z i Res. Commun. 34, 104-110.  35.  Kawasaki, T., K. Satoh and N.O. Kaplan (1964) Biochem. B i o p h y s . Res. Commun. 17, 648-654.  36.  Dontsov, A.E., L.L. G r i n i u s , A.A. J a s a i t i s , I . I . S e v e r i n a and V.P. Skulachev (1972) B i o e n e r g e t i c s 3_» 277-303.  37.  C h e t k a u s s t a i t e , A.V. and L.L. G r i n i u s  38.  Van de S t a d t , R.J., F.J.R.M. Nieuwenhuis and K. Van Dam (1971) Biochim. B i o p h y s . A c t a 234, 173-176.  39.  M i t c h e l l , P. and J . Moyle (1965) Nature 208, 1205-1206.  40.  Skulachev, V.P. (1970) FEBS L e t t . 11, 301-308.  (1963) Biochem. Z. 338, 188-205.  (1969) Biochem. B i o p h y s .  (1979) B i o k h i m i y a 44, 1101-1110.  143.  41.  M i t c h e l l , P. (1972) B i o e n e r g e t i c s  42.  Skulachev, V.P. (1974) Ann. N.Y. Acad. S c i . 227, 188-202.  43.  M i t c h e l l , P. (1966) B i o l . Rev. 41_, 445-502.  44.  M i t c h e l l , P. (1977) Ann. Rev. Biochem. 46, 996-1005.  45.  Rydstrom, J . , J.B. Hoek, B.G. E r i c s o n , and T. Hundal (1976) B i o c h i m . B i o p h y s . A c t a 430, 419-425.  46.  Houghton, R.L., R.J. F i s h e r and D.R. Sanadi (1976) Biochem. B i o p h y s . Res. Commun. 73, 751-757.  47.  Hojeberg, B. and J . Rydstrom (1977) Biochem. B i o p h y s . Res. Commun. 78_, 1183-1190.  48.  Anderson, W.M. 187, 180-190.  49.  Wu, L.N.Y., R.M. Pennington, J.D. E v e r e t t J . B i o l . Chem. 257, 4052-4055.  50.  P e r s s o n , B. K. Enander, H.L. Tong and J . Rydstrom (1984) J . B i o l . Chem. 259, 8626-8632.  51.  C a p a l d i , R.A. and G. Vanderkooi (1972) P r o c . N a t l . Acad. S c i . 69_, 930-932.  52.  Anderson, W.M. 635, 194-199.  53.  Wu, L.N.Y. and R.R. F i s h e r  54.  Hanson, R.L. (1979) J . B i o l . Chem. 254, 888-893.  55.  Liang,  56.  Homyk, M. (1981) Ph.D. t h e s i s , U n i v e r s i t y o f B r i t i s h Columbia, Vancouver.  57.  Bragg, P.D., P.L. Davies and C. Hou (1972) Biochem. Biophys. Res. Commun. 4_7, 1248-1255.  58.  F i s h e r , R.R. and R.J. G u i l l o r y (1969) J . B i o l . Chem. 244, 1078-1079.  59.  F i s h e r , R.R. and R.J. G u i l l o r y (1969) FEBS L e t t . 3, 27-30.  60.  F i s h e r , R.R. and R.J. G u i l l o r y (1971) J . B i o l . Chem. 246, 4687-4693.  61.  Konings, A.W.T. and R.J. G u i l l o r y (1973) J . B i o l . Chem. 248, 1045-1050.  and R.R. F i s h e r  and R.R. F i s h e r  3_, 5-24.  (1978) A r c h . Biochem. B i o p h y s .  and R.R. F i s h e r  (1982)  (1981) Biochim. Biophys. A c t a  (1983) J . B i o l . Chem. 258, 7847-7851.  A. and R.L. Houghton (1980) FEBS L e t t . K)9, 185-188.  144.  62.  Jacobs, E., K. H e r i o t and R.R. F i s h e r 115, 151-156.  (1977) A r c h . M i c r o b i o l .  63.  F i s h e r , R.R. and R.J. G u i l l o r y  64.  E a r l e , S.R., W.M. 9J,, 21-24.  65.  E a r l e , S.R. and R.R. F i s h e r ,  66.  Rydstrom, J . (1979) J . B i o l . Chem. 254, 8611-8619.  67.  Pennington, R.M. and R.R. F i s h e r  68.  Deamer, D.W., R.C. P r i n c e and A.R. C r a f t s A c t a 274, 323-335.  69.  E a r l e , S.R. and R.R. F i s h e r  70.  S e n i o r , A.E. and J.G. Wise (1983) J . Membr. B i o l .  71.  C l e j a n , L. and D.S. B e a t t i e  72.  E s p o s t i , M.D., E.M.M. M e i e r , J . Timoneda and G. Lenaz (1983) B i o c h i m . B i o p h y s . A c t a 725, 349-360.  73.  Casey, R.P., M. T h e l e n and A. A z z i (1980) J . B i o l . Chem. 255, 3994-4000.  74.  Pennington, R.M. and R.R. F i s h e r  75.  P h e l p s , D.C. and Y. H a t e f i  (1984) B i o c h e m i s t r y 23_, 4475-4480.  76.  P h e l p s , D.C. and Y. H a t e f i  (1984) B i o c h e m i s t r y 23, 6340-6344.  77.  J o c e l y n , P.C. and J . D i c k s o n (1980) Biochim. Biophys. A c t a 590, 1-12.  78.  Bellamo, G., A. M a r t i n o , P. R i c h e l m i , G.A. Moore, S.A. J e w e l l and S. O r r e n i u s (1984) E u r . J . Biochem. 140, 1-6.  79.  Houghton, R.L., R.J. F i s h e r and D.R. Sanadi (1976) A r c h . Biochem. B i o p h y s . 176, 747-752.  80.  G e r o l i m a t o s , B. and R.L. Hanson (1978) J . B a c t e r i o l . 134, 394-400.  81.  L i a n g , A. and R.L. Houghton (1981) J . B a c t e r i o l . 146, 997-1002.  82.  Z a h l , K.J., C. Rose and R.L. Hanson (1978) A r c h . Biochem. B i o p h y s . 190, 598-602.  83.  Hanson, R.L. and C. Rose (1979) J . B a c t e r i o l . L38, 783-787.  84.  Hanson, R.L. and C. Rose (1980) J . B a c t e r i o l . 141, 401-404.  (1971) J . B i o l . Chem. 2A6, 4679-4686.  Anderson and R.R. F i s h e r (1978) FEBS L e t t .  (1980) B i o c h e m i s t r y l j ) , 561-569.  (1983) FEBS L e t t . J J 4 , 345-349. (1972) Biochim.  Biophys.  (1980) J . B i o l . Chem. 155, 827-830. 73_, 105-124.  (1983) J . B i o l . Chem. 258, 14271-14275.  (1981) J . B i o l . Chem. ^56, 8963-8969.  145.  85.  Skulachev,  V.P. (1974) Ann. N.Y. Acad. S c i 227, 188-202.  86.  O'Neal, S.G. and R.R. F i s h e r (1977) J . B i o l . Chem. _252, 4552-4556.  87.  B l a z y k , J . F . , D. Zam and R.R. F i s h e r (1976) B i o c h e m i s t r y _15, 2843-2848.  88.  Homyk, M. and P.D. Bragg (1979) Biochim. Biophys. A c t a _571, 201-217.  89.  T e i x e i r a da Cruz, A., J . Rydstrom and L. E r n s t e r (1971) E u r . J . Biochem. 23, 203-211.  90.  T e i x e i r a da Cruz, A., J . Rydstrom and L. E r n s t e r (1971) E u r . J . Biochem. 23_, 212-219.  91.  Rydstrom, J . (1972) E u r . J . Biochem. _31, 496-504.  92.  Chen, S. and R.J. G u i l l o r y  93.  Wu, L.N.W., S.R. E a r l e and R.R. F i s h e r (1981) J . B i o l . Chem. 256, 7401-7408.  94.  H a t e f i , Y., D.C. Phelps and Y.M. Galante 255, 9526-9529.  95.  Wu, L.N.Y. and R.R. F i s h e r (1982) J . B i o l .  96.  K o z l o v , I.A., Y.M. Milgrom, L.A. Saburova and A.Y. Sobolev Eur. J . Biochem. JA5, 413-416.  97.  Enander, K. and J . Rydstrom (1982) J . B i o l . Chem. 2^6, 14760-14766.  98.  Lee, C P . , N. Simard-Duquesne, L. E r n s t e r and H.D. Hoberman (1965) Biochim. B i o p h y s . A c t a 105, 397-409.  99.  L a z d u n s k i , M. (1972) C u r r . Top. B i o e n e r g . 6, 267-310.  (1984) J . B i o l . Chem. 259, 5945-5953.  (1980) J . B i o l . Chem.  Chem. 257, 11680-11683. (1984)  100.  K l i n g e n b e r g , M. (1981) Nature 290, 449-454.  101.  Swartz, S.A. and D.R. H e l i n s k i  102.  M a n i a t i s , J . , E.F. F r i t s c h and J . Sambrook (1982) M o l e c u l a r cloning. A l a b o r a t o r y manual. C o l d S p r i n g Harbor L a b o r a t o r y , s p r i n g Harbor, N.Y.  (1971) J . B i o l . Chem. 246, 6318-6327.  103.  K a t z , L., O.T. Kingsbury 114, 577-591.  and D.R. H e l i n s k i  (1973) J . B a c t e r i o l .  104.  K a t z , L. P.H. W i l l i a m s , S. Sato, R.W. L e a v i t t and D.R. H e l i n s k i (1977) B i o c h e m i s t r y 16_, 1677-1683.  105.  Burns, D.M. and I.R. Beacham  (1983) A n a l . Biochem. 135, 48-51.  Cold  146.  106.  C l e v e l a n d , D.W., S.G. F i s c h e r , M.W. J . B i o l . Chem. _252, 1102-1106.  107.  Laemmli, U.K.  108.  F a i r b a n k s , G. T.L. Steck and D.F.H. Wallach 10, 2606-2617.  109.  B r u s i l o w , W.S.A., R.P. Gunsalus Enzymol. 9_7, 189-195.  and R.D.  110.  Sanger, F., S. N i c k l e n and A.R. S c i . 74, 5463-5467.  Coulson (1977) P r o c . N a t l . Acad.  (1970) Nature  111.. Sanger, F.and A.R.  K i r s c h e r and U.K.  Laemmli (1977)  227, 680-685. (1971) B i o c h e m i s t r y  Simoni  (1983) Methods  Coulson (1978) FEBS L e t t . 87,  107-110.  112.  Oker-Blom, C. (1984) Ph.D.  t h e s i s , Univ. o f H e l s i n k i ,  Helsinki.  113.  Kaplan, N.O.  114.  Lowry, O.H., N.J. Rosebrough, A.L. F a r r and A . J . R a n d a l l (1951) J . B i o l . Chem. 193, 265-275.  115.  Sakamoto, N., A.M. 775-783.  116.  M i l l e r J.H. (1972) Experiments Harbor L a b o r a t o r y , New York.  117.  Nowotny, A. (1979) B a s i c E x e r c i s e s i n Immunochemistry. S p r i n g e r - V e r l a g , New York.  118.  Bjerrum, O.J. and P. Lundhal 69-80.  119.  Mayer, R.J. and J.H. Walker (1980) Immunochemical Methods i n B i o l o g i c a l S c i e n c e s : Enzymes and P r o t e i n s , Academic P r e s s , I n c . , New York.  120.  Houghton, R.L., R.J. F i s h e r and D.R. Biophys. 176, 747-752.  121.  Bouchg, J.P. (1982) J . M o l . B i o l . _154,  122.  Voordouw, G., S.M. van der V i e s and A.P.N. Themmen (1983) E u r . J . Biochem. 131, 527-533.  123.  B l a z y k , J . F . and R.R.  124.  Deamer, D.W., R.C. P r i n c e and A.R. A c t a 274, 323-335.  125.  Rottenberg, H. and C P .  126.  C a s a d i o , R. and M e l a n d r i , B.A. 9, 17-29.  (1967) Methods Enzymol. 10, 317-322.  K o t r e and M.A.  Fisher  Savageau (1975) J . B a c t e r i o l .  i n molecular g e n e t i c s .  124,  Cold Spring  (1974) Biochim. Biophys. A c t a 342,  Sanadi (1976) A r c h . Biochem.  1-20.  (1975) FEBS L e t t . 50, 227-230. Crafts  (1972) Biochim.  Lee (1975) B i o c h e m i s t r y 14,  Biophys.  2675-2680.  (1977) J . B i o e n e r g e t . Biomembr.  147.  127.  Pressman, B.C. (1976) Annu. Rev. Biochem. 4_5, 501-530.  128.  P h e l p s , D.C. and Y. H a t e f i  129.  S e n i o r , A.E. and J.G. Wise (1983) J . Membr. B i o l .  130.  C l e j a n , L. and D.S. B e a t t i e  131.  E s p o s t i , M.D., E.M.M. M e i e r , J . Timoneda and G. Lenaz (1983) Biochim. B i o p h y s . A c t a 725, 349-360.  132.  Casey, R.P., M. T h e l e n and A. A z z i 255, 3994-4000.  133.  H u n k a p i l l e r , M.W., E . L u j a n , F. Ostrander and L.E. Hood Enzymol. 91_, 227-236.  134.  N e l l e s , L.P. and J.R. Bambury (1976) A n a l . Biochem 7_3, 522-531.  135.  Hager, D.A. and R. Burgess  136.  H i g g i n s , R.C. and M.E. Dahmus (1979) A n a l . Biochem. 9J3, 257-260.  137.  Messing, J . and J . V i e i r a  138.  S t o c k e r , N.G., J.M. P r a t t and B.G. S p r a t t 155, 854-859.  139.  T e a t h e r , R.M., B. M u l l e r - H i l l , U. A b r u t s c h , G. A i c h e l e and P. Overath (1978) M o l . Gen. Genet. 159, 239-248.  140.  L a r s o n , T . J . , G. Schumaker and W. Boos (1983) J . B a c t e r i o l . 152, 1008-1021.  141.  Lemire, B.D., J . J . Robinson, R.D. B r a d l e y , D.G. Scraba and J.H. Weiner (1983) J . B a c t e r i o l . 155, 391-397.  142.  Weiner, J.H.., B.D. Lemire, M.L. Elmes, R.D. B r a d l e y and D.G. Scraba (1984) J . B a c t e r i o l . 158, 590-596.  143.  von Meyenburg, K., B.B. Jorgensen and B. v a n Deurs (1984) EMBO J . 3, 1791-1797.  144.  F i o l e t , J.W.T., E.P. Bakker and K. van Dam (1974) Biochim. A c t a 368, 432-445.  145.  Lee, H.C. and J.G. F o r t e (1978) Biochim. Biophys. A c t a 508, 339-356.  146.  Rogan, C . I . and W.R. Widger (1975) Biochem. B i o p h y s . Res. Commun. 62, 744-749.  147.  A z z i , A., R.P. Casey and M.J. Nalecy (1984) Biochim. B i o p h y s . A c t a 768, 209-226.  (1981) J . B i o l . Chem. ^56, 8217-8221. 73,, 105-124.  (1983) J . B i o l . Chem. 258, 14271-14275.  (1980) J . B i o l . Chem.  (1983) Meth.  (1980) A n a l . Biochem. 97_, 76-86.  (1982) Gene 19_, 269-276. (1983) J . B a c t e r i o l .  Biophys.  148.  148.  Rosenberg, M. and D. Court  149.  Hawley, D.K.  150.  Gold, L., D. Pribnow, T. S c h n e i d e r , S. S h i n e d l i n g , B.S. S i n g e r and G. Stormo (1981) Annu. Rev. M i c r o b i o l . 35, 365-403.  151.  G r o s j e a n , H. and W. F i e r s  (1982) Gene 18_, 199-209.  152.  S o l i o z , M. (1984) TIBS 9,  309-312.  153.  Kyte, J . and R.F. D o o l i t t l e (1982) J . Mol. B i o l .  154.  G a m i e r , J . , D.J. Osguthorpe and B. Robson (1978) J . Mol. B i o l . 120, 97-120.  and W.R.  (1979) Annu. Rev. Genet. 13., 319-353.  McClure (1983) N u c l e i c A c i d s Res. 8,  157,  2237-2255.  105-132.  

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 12 1
Japan 7 0
China 5 28
France 1 0
Canada 1 0
Singapore 1 0
City Views Downloads
Tokyo 7 0
Ashburn 5 0
Beijing 5 0
Unknown 4 1
Salem 2 0
Singapore 1 0
Mont-Saint-Aignan 1 0
Mountain View 1 1
Pasadena 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097196/manifest

Comment

Related Items