Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and expression of Bacillus subtilis ribosomal RNA gene promoters in Escherichia coli Deneer, Henricus Gerardus 1986

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1986_A1 D46.pdf [ 8.98MB ]
Metadata
JSON: 831-1.0097132.json
JSON-LD: 831-1.0097132-ld.json
RDF/XML (Pretty): 831-1.0097132-rdf.xml
RDF/JSON: 831-1.0097132-rdf.json
Turtle: 831-1.0097132-turtle.txt
N-Triples: 831-1.0097132-rdf-ntriples.txt
Original Record: 831-1.0097132-source.json
Full Text
831-1.0097132-fulltext.txt
Citation
831-1.0097132.ris

Full Text

CLONING AND EXPRESSION OF BACILLUS SUBTILIS RIBOSOMAL RNA GENE PROMOTERS IN ESCHERICHIA COLI By HENRICUS GERARDUS DENEER B.Sc, The University of Manitoba, 1975 M.Sc., The University of Manitoba, 1981 A THESIS SUBMITTED IN THE REQUIREMENTS DOCTOR OF PARTIAL FULFILLMENT OF FOR THE DEGREE OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES Department of Microbiology We accept t h i s thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA August, 1986 © Henricus Gerardus Deneer, 1986 In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t of the requirements f o r an advanced degree a t the U n i v e r s i t y of B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and study. I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e copying o f t h i s t h e s i s f o r s c h o l a r l y purposes may be granted by the head of my department o r by h i s or her r e p r e s e n t a t i v e s . I t i s understood t h a t copying or p u b l i c a t i o n of t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l not be allowed without my w r i t t e n p e r m i s s i o n . Department of Microbiology The U n i v e r s i t y of B r i t i s h Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date 0 c t - 9> 1 9 8 6 i i A b s t r a c t In c o l i , r i b o s o m a l RNA (rRNA) i s s y n t h e s i z e d i n p r o p o r t i o n t o the c e l l u l a r g r o w t h r a t e s q u a r e d , a phenomenon known as growth r a t e d ependent r e g u l a t i o n . The p r o m o t e r s o f rRNA o p e r o n s , which c o n s i s t o f two t a n d e m l y a r r a n g e d - 3 5 , -10 r e g i o n s about 120 bp a p a r t , m e d i a t e t h i s c h a r a c t e r i s t i c form o f r e g u l a t i o n . To p r o v i d e i n s i g h t i n t o how t h i s r e g u l a t i o n i s a c h i e v e d and t o e x t e n d p r e v i o u s o b s e r v a t i o n s f r o m s t u d i e s w i t h E.  c o l i t o the rRNA o p e r o n s o f o t h e r s p e c i e s , the p r o m o t e r r e g i o n from the B^ s u b t i l i s r r n B o p e r o n was c l o n e d o n t o a t r a n s c r i p t i o n f u s i o n p l a s m i d s u c h t h a t t h e s y n t h e s i s o f c h l o r a m p h e n i c o l a c e t y t r a n s f e r a s e (CAT) was d i r e c t e d by the s u b t i l i s p r o m o t e r s . E x p r e s s i o n i n E_^ c o l i showed t h a t CAT s p e c i f i c a c t i v i t y i n c r e a s e d i n a growth r a t e d e p e n d e n t manner. The s y n t h e s i s o f CAT mRNA, the CAT mRNA h a l f - l i f e , and p l a s m i d copy number were a l l measured d i r e c t l y t o e s t a b l i s h t h e v a l i d i t y o f u s i n g CAT s p e c i f i c a c t i v i t y as a measure o f pr o m o t e r f u n c t i o n . O n l y the downstream P2 promoter o f t h e s u b t i l i s P1-P2 tandem p a i r was shown t o be growth r a t e r e g u l a t e d ; i n c o n t r a s t , t h e P1 p r o m o t e r o f t h e n a t i v e E. c o l i r r n B o p e r o n was r e s p o n s i v e t o growth r a t e . D e l e t i o n o f an A-T r i c h s e q u e n c e u p s t r e a m o f t h e B_j_ s u b t i l i s P1 p r o m o t e r had no e f f e c t on the o v e r a l l l e v e l o f P1 o r P2 t r a n s c r i p t i o n . These r e s u l t s i n d i c a t e d t h a t the g e n e r a l mechanisms c o n f e r r i n g g r o w t h r a t e r e g u l a t i o n were c o n s e r v e d between c o l i and B_^  s u b t i l i s , i i i although d i f f e r e n c e s were noted at the l e v e l of the i n d i v i d u a l P1 and P2 promoters. In an attempt to develop a s i m i l a r operon f u s i o n system f o r use i n Ek_ 3 u b t i l i s a number of b i - f u n c t i o n a l s h u t t l e v e c t o r s were constructed by f u s i n g s u b t i l l s plasmids to an c o l i r e p l i c o n c a r r y i n g a promoterless c a t e c h o l 2 , 3 dioxygenase gene. However, i t was found that o v e r e x p r e s s i o n of t h i s p r o t e i n was l e t h a l to E.  c o l i c e l l 3 and rRNA promoters could not be maintained u n l e s s t h e i r t r a n s c r i p t i o n a l a c t i v i t y was c u r t a i l e d . Furthermore, such b i - f u n c t i o n a l v e c t o r s were h i g h l y unstable i n E_;_ c o l i or a f t e r t r a n s f e r to s u b t i l l s . Nevertheless, data obtained using one of these v e c t o r s i n d i c a t e d that B_;_ s u b t i l i s rRNA promoters d i d not possess the a n t i t e r m i n a t i o n f u n c t i o n a s s o c i a t e d with the analogous c o l i promoters, i l l u s t r a t i n g an a d d i t i o n a l f u n c t i o n a l d i f f e r e n c e between E_j_ c o l i and s u b t i l i s rRNA promoters. i v TABLE OF CONTENTS Abstract i i Table of contents i v L i s t of figures v i i i L i s t of tables x Abbreviations x i Acknowledgements x i i Lit e r a t u r e review 1 1. General overview and p h y s i o l o g i c a l considerations 1 2. Location, organization, and structure of 3 rRNA genes i n E . c o l i . 3. Regulation of expression of rRNA genes. 7 i . upstream a c t i v a t i o n 9 i i . antitermination 12 i i i . s tringent control 13 4. Growth rate dependent regulation of rRNA operons 17 i . DNA sequence requirements 17 i i . Models f o r growth rate control of rRNA operons 22 5. Ribosomal RNA operons i n B a c i l l u s s u b t i l i s 29 6. Location and structure of B . s u b t i l l s rRNA operons 29 7. Promoter regions of B . s u b t i l i s rRNA operons 32 8. Regulation of stable RNA synthesis i n B . s u b t i l i s , 33 9. Rationale f o r present studies 37 Materials and Methods 39 1. B a c t e r i a l s t r a i n s and plasmids 39 2. P u r i f i c a t i o n of DNA 39 V i . E . c o l i plasmid DNA - small scale 39 i i . E. c o l i plasmid DNA - large scale 39 i i i . B . s u b t i l i s plasmid DNA 41 i v . B . s u b t i l i s chromosomal DNA 42 v. Pseudomonas putida TOL plasmid 42 3. Transformation of E . c o l i and s e l e c t i o n of 42 recombinants 4. Transformation of B . s u b t i l i s 44 5. Cloning procedures 45 i . R e s t r i c t i o n endonuclease digestion of DNA 45 i i . Blunting of 5' and 3' extended ends 46 i i i . Dephosphorylation of DNA 46 i v . L i g a t i o n conditions 47 v. Exonuclease Bal-31 reaction conditions 47 6. A n a l y t i c a l and preparative g e l electrophoresis 48 i . Agarose gels 48 i i . Polyacrylamide gels 48 7. I s o l a t i o n of DNA fragments from gels 50 i . Agarose minigels 50 i i . Polyacrylamide gels 50 8. Nucleic acid sequencing 51 9. Autoradiography 51 10. Southern b l o t t i n g and h y b r i d i z a t i o n of DNA 52 11. Construction of M13-CAT h y b r i d i z a t i o n probes 53 12. RNA - DNA h y b r i d i z a t i o n 54 i . i s o l a t i o n of 3H - l a b e l l e d RNA 54 v i i i . preparation of single-stranded DNA f i l t e r s 55 i i i . 3H-RNA - DNA hy b r i d i z a t i o n 56 13. Determination of mRNA h a l f - l i f e 56 i . Functional h a l f - l i f e 56 i i . Chemical h a l f - l i f e 57 14. Plasmid copy number determination 58 15. Growth rate studies and enzyme assays 59 i . Media and growth conditions 59 i i . Catechol 2,3-dioxygenase assay 60 i i i . Chloramphenicol acetyltransferase assay 61 Chapter 1. Cloning and expression of 15. s u b t i l i s rrnB 63 promoters i n 15. c o l i . 1. Introduction 63 2. Results 64 i . Cloning of B . s u b t i l i s rrnB promoters 64 i i . S t a b i l i t y of CAT-fusion vectors 80 i i i . Characterization of chloramphenicol a c e t y l - 82 transferase (CAT) assay i v . Expression of E . c o l i rrnB promoters at 84 di f f e r e n t growth rates v. Expression of B . s u b t i l i s rrnB promoters 88 i n E . c o l i v i . Measurement of CAT mRNA, mRNA h a l f - l i f e , and 88 plasmid copy number ; 3. Discussion 100 i . Regulation of E . c o l i rrnB promoters 106 i i . Regulation of B . s u b t i l i s rrnB promoters i n 110 E . c o l i v i i Chapter 2. Construction of a l t e r n a t i v e promoter- 123 probe cloning vectors 1. Introduction 123 2. Results 125 i . Construction of pTLXT/pAS-3 vectors 125 i i . Cloning and s t a b i l i t y of promoter fragments 126 i i i . Expression of promoter-xylE fusions i n E . c o l i 131 i v . E f f e c t s of lambda tRl terminator on expression 135 of B . s u b t i l l s rrnB promoters 3. Discussion 136 i . Lack of growth rate dependent expression 140 of promoter-xyIE fusion Chapter 3. Attempts to construct b i - f u n c t i o n a l operon 145 fusion vectors 1. Introduction 145 2. Results 147 i . Construction o f . b i - f u n c t i o n a l cointegrate 147 plasmids i i . Construction of i n t e g r a t i v e plasmid pAS3C-168 156 3. Discussion 159 Summary and concluding remarks 165 References 172 v i i i LIST OF FIGURES Figure Page 1. Structure and or i e n t a t i o n of pHD1.8. 66 2. Structure of pKK232-8. 69 3. Origin and sequence of B . s u b t i l i s rRNA 71 promoter fragments. 4. Promoter i n s e r t s i n pKK232-8 and t h e i r 74 electrophoretic mobility. 5. Base sequence of the E . c o l i rrnB promoter 77 region. 6. L i n e a r i t y of chloramphenicol ac e t y l t r a n s f e r a s e 83 assay. . 7. _ CAT a c t i v i t y vs. growth rate: pKK-292Ec i n 85 E . c o l i HB101. 8. CAT a c t i v i t y vs. growth rate: pKK-351Ec, 86 pKK-128Ec i n E . c o l i HB101. 9. CAT a c t i v i t y vs. growth rate: pKK-Tet i n 87 E . c o l i HB101. 10. CAT a c t i v i t y vs. growth rate: pKK-i427B i n 89 E . c o l i HB101. 11. CAT a c t i v i t y vs. growth rate: pKK-285B i n 90 E . c o l i HB101. 12. CAT a c t i v i t y vs. growth rate: pKK-211B i n 91 E . c o l i HB101. 13. CAT a c t i v i t y vs. growth rate: pKK-282B, ?2 PKK-220B i n E . c o l i HB101. 14. Construction and or i e n t a t i o n of M13-CAT t, 94 hy b r i d i z a t i o n probes. 15. Amount of CAT s p e c i f i c mRNA vs. growth rate. ?5 16. Measurement of t o t a l rRNA vs. growth rate. 96 Determination of CAT mRNA func t i o n a l h a l f -l i f e - CAT protein analysis. Chemical h a l f - l i f e of CAT mRNA vs. growth rate. Plasmid copy number determination by dot-blot h y b r i d i z a t i o n a n a l y s i s . Amount of plasmid DNA vs. growth rate. Structure of pTLXT-ll/pAS-3. Catechol 2,3-dioxygenase a c t i v i t y vs. growth rate. Catechol 2,3-dioxygenase a c t i v i t y vs. growth rate: pAS-351Ec. R e s t r i c t i o n endonuclease digestion pattern of pAS3B. Structure of pCmTv-2/pASTV-l. R e s t r i c t i o n endonuclease digestion pattern of pAS3C-168 i n t e g r a t i v e plasmids. X LIST OF TABLES Table Page 1. L i s t of b a c t e r i a l s t r a i n s , plasmids, phage. 40 2. CAT gene fusions. 79 3. S t a b i l i t y of Cmr phenotype. 81 4. Ribosomal RNA promoter-xyIE operon fusions. 130 5. A c t i v i t i e s of B . s u b t i l i s promoters i n E . c o l i . 135 6. Frequency of transformation with b i - 149 functional vectors. x i ABBREVIATIONS Kb Kilobase bp base pair dNTP deoxynucleoside triphosphate DNA deoxyribonucleic acid RNA ribonucleic acid rRNA ribosomal r i b o n u c l e i c a c i d tRNA transfer r i b o n u c l e i c acid mRNA messenger ribonucleic a c i d EDTA ethylenediaminetetraacetic acid EGTA ethyleneglycol-bis-(B-aminoethyl ether)-N,N,N',N'-t e t r a a c e t i c acid Cm chloramphenicol resistance Ap r a m p i c i l l i n resistance CAT chloramphenicol acetyltransferase 1 l i t e r ml m i l l i l i t e r u l m i c r o l i t e r gr gram mg milligram ug microgram r Km kanamycin r e s i s t a n t r Em erythromycin r e s i s t a n t r Tc t e t r a c y c l i n e r e s i s t a n t A absorbance x i i Acknowledgements I am indebted to a great many people for making t h i s project possible and making my stay at U.B.C. so enjoyable and e x c i t i n g . I am e s p e c i a l l y g r a t e f u l to the members of the Spiegelman lab, both past and present, f o r the i r friendship, warmth, and humour - notably, Vera Webb, Kathy Dobinson, Fereydoun S a j j a d i , Dan Horvath, and Loverne Duncan. I would also l i k e to express my thanks and appreciation to my supervisor George Spiegelman for his guidance, encouragement and his eagerness to work on the "impossible" projects. F i n a l l y , t h i s project would not have been started, l e t alone completed, were i t not for the love, support, and e s p e c i a l l y the patience of my wife Jane. By r i g h t s , t h i s thesis i s p a r t i a l l y hers. 1 L i t e r a t u r e Review 1. General Overview and P h y s i o l o g i c a l C o n s i d e r a t i o n s I t has long been a tenet of b a c t e r i a l physiology that i f a c e l l suddenly f i n d s i t s e l f i n a n u t r i t i o n a l l y advantageous environment i t can respond by i n c r e a s i n g i t s growth r a t e . In order to do so i t must f i r s t i n c r e a s e i t s c a p a c i t y f o r p r o t e i n s y n t h e s i s . The immediate response i s t h e r e f o r e one of an increased accumulation of ribosomes s i n c e these are key components i n the p r o t e i n s y n t h e s i z i n g machinery of the c e l l . However, the ribosomes of c o l i are complex o r g a n e l l e s com-posed of 53 d i f f e r e n t p r o t e i n s and 3 d i f f e r e n t s t a b l e RNA mole-c u l e s d i v i d e d between 2 subunits (see Ref. 1 f o r review), whose sy n t h e s i s must, from an e f f i c i e n c y s t a n d p o i n t , be c l o s e l y r e g u l a t e d . Nevertheless, i n recent years i t has become apparent that the r e g u l a t i o n of the RNA f r a c t i o n of ribosomes i s c e n t r a l not only to the q u e s t i o n of how the s y n t h e s i s of the numerous ribosomal components i s c o o r d i n a t e d , but a l s o to how v a r i o u s n u t r i t i o n a l and p h y s i o l o g i c a l c o n d i t i o n s a f f e c t the accumulation of ribosomes as a whole. The r e c o g n i t i o n of the importance of ribosomal RNA (rRNA) stems from the p i o n e e r i n g s t u d i e s of Maaloe and co-workers (2) who f i r s t noted that a s t r i c t c o r r e l a t i o n e x i s t e d between the r a t e of ribosome accumulation and the c e l l u l a r growth r a t e 2 ( h e r e i n r e i e r r e d t o as " u " , t h e r e c i p r o c a l o r t h e c e l l u l a r d o u b l i n g t i m e e x p r e s s e d as d o u b l i n g s p e r n o u r ; . By s t u d y i n g t h e m a c r o m o l e c u l a r c o m p o s i t i o n o f b a c t e r i a l c e l l s as a f u n c t i o n o f t h e i r g r o w t h r a t e t h e y f o u n d t h a t t h e r e l a t i v e p r o p o r t i o n o f RNA, DNA, and p r o t e i n c h a n g e d as t n e g r o w t h r a t e i n c r e a s e d ; t h e r a t i o o f DNA t o p r o t e i n f o r e x a m p l e , r e m a i n e d e s s e n t i a l l y i n v a r i a n t , b u t t h e r a t i o s o f RNA t o DNA o r RNA t o p r o t e i n i n c r e a s e d d r a m a t i c a l l y . I n o t h e r w o r d s , t h e i n c r e a s e i n t h e amount o f RNA p e r c e l l (up t o 97$ o r w h i c h i s s t a b l e rRNA and tRNA as o p p o s e d t o t h e more l a b i l e m e s s e n g e r RNA) was p r o p o r t i o n a l l y much g r e a t e r t h a n t h e i n c r e a s e s e e n f o r o t h e r m a c r o m o l e c u l e s . L a t e r m e a s u r e m e n t s showed t h a t t h e a c t u a l number o f r i b o s o m e s p e r c e l l i n c r e a s e d as a l i n e a r f u n c t i o n o f t h e g r o w t h r a t e (3 ) i i m p l y i n g t h a t t h e i n c r e a s e d demand f o r p r o t e i n s y n t h e s i s by f a s t e r g r o w i n g c e l l s was met by an i n c r e a s e i n t h e number o f r i b o s o m e s r a t h e r t h a n an i n c r e a s e i n t h e i r t r a n s l a t i o n a l a c t i v i t y . However, i t was n o t e d t h a t t h e l i n e a r p r o p o r t i o n a l i t y b e t w e e n u and t h e number o f r i b o s o m e s meant t h a t t h e r a t e o f r i b o s o m e s y n t h e s i s , o b t a i n e d by d i v i d i n g t h e p r o p o r t i o n o f t h e c e l l mass w h i c h was r i b o s o m e s by t h e c e l l d o u b l i n g t i m e , must 2 i n c r e a s e as a f u n c t i o n o f u . I n s i m p l e t e r m s t h i s c o u l d be s e e n as b e i n g n e c e s s a r y i f one i m a g i n e d t h a t f a s t e r g r o w i n g c e l l s must p a s s on more r i b o s o m e s t o e a c h d a u g h t e r c e l l i n o r d e r t o m a i n t a i n an i n c r e a s i n g g r o w t h r a t e . B u t , as g r o w t h r a t e i n c r e a s e d , t h e c e l l s had p r o g r e s s i v e l y l e s s t i m e i n o r d e r t o s y n t h e s i z e more 3 ribosomes unless the r a t e of t h i s s y n t h e s i s i n c r e a s e d with the growth r a t e squared. Thus, while the f r a c t i o n of c e l l mass occupied by ribosomes could vary from 15$ at u=0.2 to 45$ at u=2.5, the r a t e of ribosome s y n t h e s i s could vary by more that 30-f o l d i n t h i s same range of growth r a t e { H ) . The p r o p o r t i o n a l i t y between the c e l l u l a r growth r a t e and the r a t e of ribosome (and ribosomal RNA) s y n t h e s i s has been recognized as being a c h a r a c t e r i s t i c f e a t u r e of the phenomenon known as "growth r a t e dependent r e g u l a t i o n " . This term, i n a g e n e r a l sense, i s analogous to the term "metabolic r e g u l a t i o n " which had been coined to r e f e r to c o n t r o l s that seemed t i e d p r i m a r i l y to the c e l l u l a r growth r a t e r a t h e r than to the presence or absence of a p a r t i c u l a r n u t r i e n t ( 5 ) . The problem of the growth r a t e dependent s y n t h e s i s of ribosomal RNA and the mechanisms c o n t r o l l i n g t h i s s y n t h e s i s have been most thoroughly s t u d i e d i n E. c o l i although c e r t a i n f a c e t s of t h i s r e g u l a t i o n have been c l a r i f i e d f o r other organisms such as s u b t i l i s as w e l l . 2. L o c a t i o n , o r g a n i z a t i o n and s t r u c t u r e of rRNA genes i n E.  c o l i . As mentioned p r e v i o u s l y , the E_^_ c o l i ribosome i s comprised of three d i f f e r e n t RNA s p e c i e s , the 16S rRNA found i n the 30S ribosomal subunit, and the 23S and 5S rRNA found i n the 50S s u b u n i t . These three RNA s p e c i e s are t r a n s c r i b e d p o l y -c i s t r o n i c a l l y and i n the order 16S-23S-5S, as was shown by the 4 i s o l a t i o n o f mutants d e f e c t i v e i n the p r o c e s s i n g enzyme RNase I I I ( 6 ) . F o r m a t i o n o f the i n d i v i d u a l RNA s p e c i e s appeared to i n v o l v e RNase - m e d i a t e d p r o c e s s i n g e v e n t s t h a t o c c u r r e d c o n c o m i t a n t l y w i t h t r a n s c r i p t i o n ( 7 ) . By u s i n g S o u t h e r n h y b r i d i z a t i o n to a n a l y z e r e s t r i c t i o n enzyme d i g e s t s o f t o t a l E .  c o l i DNA, K i s s e_t a l . . (8) e s t a b l i s h e d t h a t t h e r e were seven c o p i e s o f rRNA operons per genome. The r e a s o n f o r t h i s redundancy was not c l e a r . M u l t i p l e c o p i e s may r e f l e c t the n e c e s s i t y f o r s u f f i c i e n t rRNA to meet the demands o f very r a p i d l y growing c e l l s but whether e x a c t l y seven c o p i e s are needed i s q u e s t i o n a b l e . E l l w o o d and Nomura (9) have i s o l a t e d a s t r a i n o f E . c o l i i n which one o f the rRNA operons had been d e l e t e d but t h e r e was no o b v i o u s p h e n o t y p i c change due to t h i s m u t a t i o n . F i v e o f these seven rRNA operons have been mapped to an a r e a between 70 and 90 m i n . on the E_j_ c o l i chromosome (the r e m a i n i n g operons map near 5 and 57 m i n . ) , an a r e a t h a t a l s o c o n t a i n s the genes f o r a number o f o t h e r components o f the t r a n s c r i p t i o n -t r a n s l a t i o n a p p a r a t u s ( 1 0 ) . The c l u s t e r i n g o f rRNA operons n e a r the o r i g i n o f chromosomal r e p l i c a t i o n may c o n t r i b u t e somewhat to the i n c r e a s e d rRNA s y n t h e s i s at h i g h growth r a t e s because o f an e f f e c t i v e i n c r e a s e i n gene dosage due to the i n c r e a s e i n i n i t i a t i o n o f DNA r e p l i c a t i o n at h i g h e r u . However, the o v e r a l l r e g u l a t i o n o f rRNA s y n t h e s i s cannot be e x p l a i n e d i n t h i s way because i t has been seen t h a t t h i s gene dosage i n c r e a s e o n l y amounted to 20$ as growth r a t e v a r i e d from 0.9 to 2.7 d o u b l i n g s 5 per hour (9 ) . A l l seven rRNA operons were not i d e n t i c a l . H e t e r o d u p l e x a n a l y s i s f i r s t i n d i c a t e d t h a t the s t r u c t u r e o f d i f f e r e n t operons f e l l i n t o two groups d i f f e r i n g p r i m a r i l y i n the sequence o f the s p a c e r r e g i o n s between the 16S and 23S RNA c o d i n g r e g i o n s ( 1 1 ) . Each operon was found to c o n t a i n e i t h e r one or two tRNA genes w i t h i n the 16S-23S s p a c e r r e g i o n s t h a t were c o - t r a n s c r i b e d w i t h the rRNA g e n e s . Four o f the operons c a r r i e d the gene e n c o d i n g G l u H e tRNA w h i l e the r e m a i n i n g t h r e e operons had genes f o r tRNA A l a and tRNA (12, 13) . In a d d i t i o n , t h r e e o f the operons a l s o c a r r i e d c o - t r a n s c r i b e d tRNA genes d i s t a l to the 5S c o d i n g r e g i o n ( 1 2 ) . A l l seven E_^ c o l i rRNA operons have been i s o l a t e d on s p e c i a l i z e d t r a n s d u c i n g phage or p l a s m i d s , and s i x o f the seven have been l a r g e l y sequenced ( f o r r e v i e w , see 4 and 1 4 ) . Sequence i n f o r m a t i o n , combined w i t h d a t a g e n e r a t e d by a n a l y z i n g the i n  v i t r o t r a n s c r i p t i o n p r o d u c t s o f c l o n e d rRNA genes (15, 1 6 ) , has r e v e a l e d an u n u s u a l f e a t u r e o f the promoter r e g i o n o f a l l rRNA operons examined. Each operon c o n t a i n e d a d o u b l e , or tandem, promoter arrangement w i t h the upstream or P1 promoter s e p a r a t e d from the downstream or P2 promoter by about 120 base p a i r s . Each promoter o f the tandem p a i r c o n t a i n e d the b a s i c elements i d e n t i f i e d f o r o t h e r E_j. c o l i p r o m o t e r s (see 17 f o r r e v i e w ) , i n c l u d i n g a Pribnow box, a -35 r e g i o n , and a t r a n s c r i p t i o n a l 6 s t a r t or n+1 n s i t e . The a v a i l a b i l i t y of sequence data allowed some comparisons to be made i n terms of the o v e r a l l homology among s i x of the seven operons ( 4 ) . A l l s i x operons contained a h i g h l y A-T r i c h r e g i o n (22 out of 27 bp) between -35 and -62 (where +1 was the s i t e of t r a n s c r i p t i o n i n i t i a t i o n ) of the upstream P1 promoter. The downstream P2 promoter a l s o showed an A-T b i a s i n t h i s area (16 out of 27 bp) but not to the same extent as seen i n P1. As w e l l , the P1 promoter of a l l s i x operons had an i d e n t i c a l 15 bp sequence (TCCCTATAATGCGCC) that i n c l u d e d the Pribnow box. This c o n s e r v a t i o n was not seen i n the P2 promoter. The 120 bp r e g i o n between P1 and P2 showed some areas of homology when any two operons were compared but o v e r a l l there was no ex t e n s i v e c o n s e r v a t i o n . The P1 promoter of a l l operons d i d however, cont a i n a G-C r i c h " d i s c r i m i n a t o r " r e g i o n between +1 and +10. This r e g i o n has been suggested to p l a y a r o l e i n rRNA gene expression during the s o - c a l l e d s t r i n g e n t response (18), an adaptive response to c o n d i t i o n s of amino a c i d s t a r v a t i o n (see below). As w e l l , a l l operons had a 67 bp r e g i o n immediately downstream of the P2 t r a n s c r i p t i o n a l s t a r t s i t e which may be r e q u i r e d f o r the rRNA a n t i t e r m i n a t i o n system (19, see below). F i n a l l y , an RNase I I I p r o c e s s i n g s i t e (7) was i d e n t i f i e d i n a l l rRNA operons i n a r e g i o n preceding the 16S RNA coding sequences. A f t e r t h i s p o i n t , sequence homology became ext e n s i v e with only 20 7 of the next 1541 bp being heterologous ( 1 ) . The f a r d i s t a l ends of the rRNA operons have a l s o been examined i n a number of cases and a number of probable t r a n s c r i p t i o n t e r m i n a t i o n s i t e s were re c o g n i z e d (20, 21, 22). A l l had a stem-loop s t r u c t u r e f o l l o w e d by s e v e r a l U r e s i d u e s c h a r a c t e r i s t i c of rho-independent t e r m i n a t o r s (see Ref. 23 f o r review). I n t e r e s t i n g l y , the E_;_ c o l i rrnB operon contained a double terminator arrangement (21) i n which the f i r s t t e r m i n a t o r was l o c a t e d adjacent to the 3' end of the 5S RNA gene and the second was about 175 n u c l e o t i d e s downstream. The s i g n i f i c a n c e of the double terminator i s u n c l e a r s i n c e i t has been shown that i n v i v o most i f not a l l t r a n s c r i p t s stop at the f i r s t t e r m i n a t o r (24). In a d d i t i o n , such a tandem arrangement has not been noted i n other rRNA operons (25). 3. Regulation of expression of rRNA genes. I t has become i n c r e a s i n g l y c l e a r t h a t ribosomal RNA operons are among the most complex operons yet i d e n t i f i e d , with the p o t e n t i a l to be r e g u l a t e d at a v a r i e t y of d i f f e r e n t p o i n t s by a v a r i e t y of d i f f e r e n t mechanisms. A key f a c t o r i s the q u e s t i o n of whether the o v e r a l l r e g u l a t i o n i s at the l e v e l of t r a n s c r i p t i o n or at some p o s t - t r a n s c r i p t i o n a l p o i n t . By comparing the r a t e of rRNA accumulation with the r a t e of de_ novo rRNA s y n t h e s i s , Gausing (26) found that at moderate to f a s t growth r a t e s the two 8 were v i r t u a l l y i d e n t i c a l , i n d i c a t i n g that there was l i t t l e or no degradation of e x c e s s i v e l y s y n t h e s i z e d rRNA. Therefore, rRNA accumulation was r e g u l a t e d p r i m a r i l y by modulating the r a t e of s y n t h e s i s . Furthermore, s i n c e the r a t e of rRNA chain e l o n g a t i o n was e s s e n t i a l l y constant at a l l growth r a t e s (27), i t appeared that s y n t h e s i s was r e g u l a t e d by modulating the frequency of i n i t i a t i o n of new chains ( i . e . the frequency of i n i t i a t i o n of new rRNA t r a n s c r i p t s ) . This c o n c l u s i o n was strengthened by the data of Muto (28) who showed that the number of RNA polymerase molecules per genome which were a c t i v e l y t r a n s c r i b i n g rRNA genes inc r e a s e d i n p a r a l l e l with the r a t e of s y n t h e s i s of rRNA as the growth r a t e i n c r e a s e d . At slow r a t e s of growth (below 0.3-0.4 doublings per hour), a s l i g h t l y d i f f e r e n t p i c t u r e has emerged. Gausing (26) has shown that the s y n t h e s i s of rRNA exceeded the accumulation, with the excess rRNA ap p a r e n t l y being degraded. This became s i g n i f i c a n t at growth r a t e s of 0.1 - 0.2 where up to 70% of the newly sy n t h e s i z e d rRNA was degraded. Thus, i t appeared that rRNA s y n t h e s i s was r e g u l a t e d at the l e v e l of t r a n s c r i p t i o n i n t i a t i o n i n a l l but very s l o w l y growing c e l l s where degradation of newly synt h e s i z e d rRNA could play a s i g n i f i c a n t r o l e . The reason f o r t h i s dichotomy i s p r e s e n t l y not c l e a r . Since the promoters of rRNA operons appear to be the primary c o n t r o l p o i n t s i n the growth r a t e dependent r e g u l a t i o n of rRNA 9 s y n t h e s i s , some o f the f a c t o r s which have been shown to i n f l u e n c e the t r a n s c r i p t i o n o f rRNA operons under d i f f e r e n t e n v i r o n m e n t a l c o n d i t i o n s can be c o n s i d e r e d . i ) Upstream a c t i v a t i o n : A p o t e n t i a l l y i m p o r t a n t f e a t u r e o f s t a b l e RNA promoters i s t h a t _in v i v o they are t r a n s c r i p t i o n a l l y much more a c t i v e than the average c o l i p r o m o t e r . A l t h o u g h rRNA genes c o m p r i s e o n l y 0.4% o f the E_j_ c o l i chromosome, up to 40$ o f newly s y n t h e s i z e d RNA i s rRNA ( 5 ) . S e v e r a l r e c e n t s t u d i e s (29, 3 0 , 31) have s u g g e s t e d t h a t t h i s enhanced l e v e l o f e x p r e s s i o n i s not due to the p r e s e n c e o f two f u n c t i o n a l p r o m o t e r s r a t h e r than one, but i s dependent on a s t i m u l a t o r y DNA sequence l o c a t e d upstream o f the -35 r e g i o n o f P1. By p e r f o r m i n g a Tyr d e l e t i o n a n a l y s i s o f the E_^  c o l i tRNA gene p r o m o t e r , Lamond and T r a v e r s (32) f i r s t noted t h a t removal o f the w i l d - t y p e sequence between p o s i t i o n - 4 0 and -98 caused a 10 to 1 2 - f o l d d e c r e a s e i n promoter a c t i v i t y . However, t h e s e c o n c l u s i o n s were r e a c h e d by m e a s u r i n g the a c t i v i t y o f a p l a s m i d - b o r n e Tyr g a l a c t o k i n a s e gene f u s e d to the tRNA promoter and c o u l d be s u b j e c t to a r t i f a c t s due to the t o p o l o g i c a l s t a t e o f the p l a s m i d v e r s u s the chromosome. N e v e r t h e l e s s , e v i d e n c e t h a t s u c h an upstream s t i m u l a t o r y element was a c t u a l l y f u n c t i o n a l was o b t a i n e d by showing t h a t RNA p o l y m e r a s e c o u l d p r o t e c t from DNase I d i g e s t i o n a r e g i o n o f the tRNATyr promoter at l e a s t 75 bp upstream o f the t r a n s c r i p t i o n i n i t i a t i o n p o i n t ( 2 9 ) . These 10 p r o t e c t i o n s t u d i e s i n d i c a t e d t h a t RNA p o l y m e r a s e c o u l d i n t e r a c t w i t h a r e g i o n o f DNA o u t s i d e o f the n o r m a l -35, -10 c o n t a c t p o i n t s and s u g g e s t e d t h a t b i n d i n g o f t h e p o l y m e r a s e m o l e c u l e t o s u c h s e c o n d a r y s i t e s c o u l d s e r v e t o a c t i v a t e t r a n s c r i p t i o n from t h e p r i m a r y s i t e v i a p r o t e i n - p r o t e i n i n t e r a c t i o n s (29). A s e c o n d s t u d y which b e a r s on t h e q u e s t i o n o f u p s t r e a m a c t i v a t i o n r e g i o n s was p e r f o r m e d by B o s s i and S m i t h (30) u s i n g H i s the tRNA gene o f S a l m o n e l l a t y p h i m u r i u m . These a u t h o r s showed t h a t a 3 bp d e l e t i o n from -70 t o -72 r e s u l t e d i n a 2 - f o l d d r o p i n H i s t r a n s c r i p t i o n a l e f f i c i e n c y o f t h e tRNA p r o m o t e r . I n a d d i t i o n , t h e w i l d - t y p e p r o m o t e r e l e m e n t showed an a l t e r e d e l e c t r o p h o r e t i c m o b i l i t y i n p o l y a c r y l a m i d e g e l s . The w i l d - t y p e p r o m o t e r f r a g m e n t o f 474 bp f o r example, m i g r a t e d w i t h an a p p a r e n t s i z e o f a b o u t 550 t o 570 bp. D e l e t i o n o f t h e 3 bp f r a g m e n t r e s t o r e d t h e n o r m a l e l e c t r o p h o r e t i c m o b i l i t y . O t h e r s t u d i e s have shown t h a t r e t a r d e d e l e c t r o p h o r e t i c m i g r a t i o n o f DNA f r a g m e n t s c o u l d be c o r r e l a t e d w i t h t h e p r e s e n c e o f bends o r k i n k s i n t h e DNA h e l i x (33, 34). B o s s i and S m i t h (30) have s u g g e s t e d t h a t an a b e r r a n t DNA c o n f o r m a t i o n , u p s t r e a m o f t h e n o r m a l p r o m o t e r r e g i o n , was somehow r e l a t e d t o t h e t r a n s c r i p t i o n a l e f f i c i e n c y o f t h e p r o m o t e r . T h i s c o u l d r e s u l t t h r o u g h a b e n d i n g o f t h e DNA a r o u n d th e RNA p o l y m e r a s e s u c h t h a t t h e number o f s p e c i f i c p r o t e i n - D N A c o n t a c t s would be i n c r e a s e d , t h e r e b y e n h a n c i n g t h e i n i t i a l p o l y m e r a s e - p r o m o t e r i n t e r a c t i o n s . 11 F i n a l l y , Gourse e_t ajL. (31) have s t u d i e d the E_j_ c o l i rrnB promoter region by f u s i n g i t to a promoterless la c Z gene and monitoring B - g a l a c t o s i d a s e p r o d u c t i o n a f t e r i n t e g r a t i o n v i a a lambda vect o r of t h i s c o n s t r u c t i n t o the b a c t e r i a l chromosome. While chromosomal i n t e g r a t i o n presumably e l i m i n a t e d any p o t e n t i a l problems due to t o p o l o g i c a l or copy number d i f f e r e n c e s from the normal wild-type s i t u a t i o n , i t does leave open the q u e s t i o n of the e f f e c t s of chromosome l o c a t i o n s i n c e the s i t e of lambda i n t e g r a t i o n i s not i n a r e g i o n where rRNA operons are normally found (10). These authors have shown by d e l e t i o n a n a l y s i s that a r e g i o n upstream of the rRNA P1 promoter between p o s i t i o n s -51 and -88 could i n c r e a s e rRNA t r a n s c r i p t i o n at l e a s t 15-fold and a l s o d i s p l a y e d a r e t a r d e d e l e c t r o p h o r e t i c m o b i l i t y , s i m i l a r to that seen by B o s s i and Smith (30). Again, these r e s u l t s suggested the p o s s i b i l i t y that c e r t a i n s t r u c t u r a l or conformational c h a r a c t e r i s t i c s of the DNA r e g i o n immediately preceeding the c l a s s i c a l p r o c a r y o t i c promoter element could f u n c t i o n i n a r e g u l a t o r y , or at l e a s t a s t i m u l a t o r y , c a p a c i t y . I n t e r e s t i n g l y , a l l three of the upstream s t i m u l a t o r y sequences mentioned above f e l l i n t o , or very near t o , a h i g h l y A-T r i c h r e g i o n commonly a s s o c i a t e d with growth r a t e r e g u l a t e d promoters. Whether the A-T r i c h r e g i o n has any s i g n i f i c a n c e i n terms of inducing the observed c o n f o r m a t i o n a l changes or i n some other r e g u l a t o r y c a p a c i t y remains to be seen. 12 i i ) A n t i t e r m i n a t i o n . For most b a c t e r i a l operons, the processes of t r a n s c r i p t i o n and t r a n s l a t i o n have been shown to be coupled such that t r a n s l a t i n g ribosomes prevent RNA polymerase from prematurely t e r m i n a t i n g t r a n s c r i p t i o n at i n t r a g e n i c c r y p t i c t e r m i n a t o r s (see 35 f o r d e t a i l s ) . Such premature t r a n s c r i p t i o n t e r m i n a t i o n has been shown to be dependent on an i n t e r a c t i o n between the t e r m i n a t i o n f a c t o r "rho" and RNA polymerase (35). Ribosomal RNA operons are l o n g , n o n - t r a n s l a t e d operons which would be expected to s u f f e r from s i g n i f i c a n t premature t e r m i n a t i o n , but e a r l y experiments by Morgan (36) and Brewster and Morgan (37) showed that RNA polymerase molecules i n i t i a t i n g at c o l i rRNA promoters could e f f i c i e n t l y read through r h o - f a c t o r dependent te r m i n a t i o n s i g n a l s i n t r o d u c e d by the i n s e r t i o n of transposons or non-coding DNA. T h i s suggested that RNA polymerase i n i t i a t i n g at these promoters might be modified so as to prevent premature t e r m i n a t i o n without the need f o r t r a n s c r i p t i o n - t r a n s l a t i o n c o u p l i n g (38). The bacteriophage lambda i s known to use a t r a n s c r i p t i o n a n t i t e r m i n a t i o n system as a r e g u l a t o r y mechanism during l y t i c growth (39). The lambda N - a n t i t e r m i n a t i o n system has been shown to i n v o l v e an e l a b o r a t e i n t e r a c t i o n between a set of host p r o t e i n s (Nus f a c t o r s ) , RNA polymerase, and a s i t e on the phage genome (nut l o c u s ) (40). Friedman and Gottesman (41) have proposed 1 3 t h r e e c o n s e n s u s s e q u e n c e s f o r t h e nut r e g i o n , d e n o t e d Boxes B, A and C o f w h i c h Box B i s a r e g i o n o f dyad symmetry and i s e s s e n t i a l f o r a n t i t e r m i n a t i o n (42) w h i l e Box A i s a Nus p r o t e i n r e c o g n i t i o n s i t e (43). R ecent s e q u e n c e c o m p a r i s o n s have shown t h a t a Box B-A-C l i k e s e q uence was l o c a t e d on a 67 bp f r a g m e n t i m m e d i a t e l y downstream o f t h e E_^ c o l i r r n G and r r n B P2 p r o m o t e r s . D e l e t i o n e x p e r i m e n t s have shown t h a t t h i s s e q u e n c e a l o n e was s u f f i c i e n t t o overcome r h o - d e p e n d e n t t r a n s c r i p t i o n t e r m i n a t i o n (44 , 45 ) w h i l e Gourse et_ a l _ . (31) have f u r t h e r p i n p o i n t e d t h e c r i t i c a l r e g i o n s as j u s t c o n s i s t i n g o f Boxes A and C. Thus u n l i k e t h e lambda s y s t e m , Box B i s n o t r e q u i r e d f o r a n t i t e r m i n a t i o n a l t h o u g h i t has been shown t h a t a t l e a s t t h e h o s t Nus B p r o t e i n i s n e c e s s a r y (46). Whether t h e s e a n t i t e r m i n a t i o n s i g n a l s p l a y any r e g u l a t o r y r o l e i n m o d u l a t i n g rRNA gene e x p r e s s i o n i s u n c l e a r ; Gourse e_t a_l. (31) have s u g g e s t e d t h a t t h e i r f u n c t i o n i s s i m p l y t o e n s u r e t h a t RNA p o l y m e r a s e e l o n g a t e s t h r o u g h an u n t r a n s l a t e d o p e r o n . N e v e r t h e l e s s , the e x i s t e n c e o f s u c h a s y s t e m f u r t h e r u n d e r s c o r e s t h e o v e r a l l c o m p l e x i t y o f rRNA o p e r o n s . i i i ) S t r i n g e n t c o n t r o l When b a c t e r i a l c e l l s e n c o u n t e r c o n d i t i o n s o f amino a c i d s t a r v a t i o n t h e y r e s p o n d by h a l t i n g f u r t h e r growth and r a p i d l y a d j u s t i n g t h e i r m e t a b o l i s m i n s u c h a way as t o i m prove t h e i r c h a n c e s f o r s u r v i v a l and a l l o w q u i c k r e c o v e r y when t h e s t a r v a t i o n 14 c o n d i t i o n s are removed. These metabolic changes were c o l l e c t i v e l y termed the s t r i n g e n t response by Stent and Brenner (47) and were seen to i n v o l v e a wide range of c e l l u l a r processes (reviewed i n 48 and 49). For example, the r e p l i c a t i o n of DNA was observed to be reduced, as was the b i o s y n t h e s i s of c arbohydrates, l i p i d s , n u c l e o t i d e s , and p e p t i d o g l y c a n s . As w e l l , the r a t e of i n t r a c e l l u l a r p r o t e o l y s i s was i n c r e a s e d , the t r a n s p o r t of many precursor molecules across the c e l l membrane was i n h i b i t e d , and the t r a n s c r i p t i o n of some operons such as h i s and l a c was increased (49, 50, 51). The most prominent e f f e c t due to s t r i n g e n c y was at the l e v e l of t r a n s c r i p t i o n of s t a b l e RNA genes, s i n c e the s y n t h e s i s of the t r a n s l a t i o n a l apparatus i s a s i g n i f i c a n t energy d r a i n on r a p i d l y growing c e l l s (52). O v e r a l l , the t r a n s c r i p t i o n r a t e of these genes f e l l by 10-to-20 f o l d while the r a t e of bulk mRNA t r a n s c r i p t i o n dropped only 1-to-3 f o l d . Most experimental data has shown that the s e l e c t i v e r e g u l a t i o n of rRNA can be modulated through e f f e c t s on the i n i t i a t i o n of t r a n s c r i p t i o n at s t a b l e RNA genes (53) although e x a c t l y how t h i s occurs i s u n c l e a r . The p o s s i b i l i t y that some e f f e c t o r molecule was i n v o l v e d was r a i s e d a f t e r i t was noted that the i n t r a c e l l u l a r c o n c e n t r a t i o n of a n u c l e o t i d e , guanosine 5',3' tetraphosphate (ppGpp) i n c r e a s e d from micromole to m i l l i m o l e amounts per c e l l concurrent with the decrease i n s t a b l e RNA s y n t h e s i s (54). Relaxed mutants of E_j_ c o l i which f a i l e d to accumulate ppGpp continued to s y n t h e s i z e s t a b l e RNA d u r i n g amino 15 a c i d s t a r v a t i o n . A s i n g l e g e n e t i c locus ( r e l A ) was thereby shown to encode a ribosome a s s o c i a t e d f a c t o r which s y n t h e s i z e d ppGpp (55). There i s p r e s e n t l y c o n f l i c t i n g evidence as to how or even i f ppGpp ac t s to modulate s t a b l e RNA a c t i v i t y during the s t r i n g e n t response. Nene and Glass (56) have i s o l a t e d RNA polymerase mutants which produced a r e l a x e d phenotype i n v i v o even though the mutant c e l l s s t i l l made ppGpp a f t e r amino a c i d s t a r v a t i o n . S i m i l a r l y , L i t t l e e_t a_l. (57) r e p o r t e d the i s o l a t i o n of E_;_ c o l i mutants i n which the s t r i n g e n t response was induced at lower ppGpp c o n c e n t r a t i o n s ; these mutations were found to a l t e r the RNA polymerase enzyme. Both r e p o r t s i m p l i c a t e d a f u n c t i o n a l i n t e r a c t i o n between ppGpp and RNA polymerase and can be i n c o r p o r a t e d i n t o a model f o r g e n e r a l s t a b l e RNA r e g u l a t i o n proposed by Travers (58). This model w i l l be d i s c u s s e d i n d e t a i l i n the f o l l o w i n g s e c t i o n . Many i n v e s t i g a t o r s have repo r t e d that ppGpp s p e c i f i c a l l y i n h i b i t e d the s y n t h e s i s of rRNA and tRNA i n v i v o (59, 60). S i g n i f i c a n t l y however, a number of workers have f a i l e d to see the same e f f e c t (61). More r e c e n t l y , K a j i t a n i and Ishihawa (62) used a mixed i n v i t r o system whereby a number of d i f f e r e n t ( i . e . s t a b l e and non-stable) gene promoters were placed i n the same t r a n s c r i p t i o n r e a c t i o n to show that low l e v e l s of ppGpp 16 s i g n i f i c a n t l y decreased rRNA t r a n s c r i p t i o n while not a f f e c t i n g the t r a n s c r i p t i o n from other promoters. Thus, most evidence favors the involvement of ppGpp i n t h i s aspect of s t a b l e RNA r e g u l a t i o n , e i t h e r d i r e c t l y at the DNA l e v e l or through the RNA polymerase. However, as s t a t e d p r e v i o u s l y , t h i s i s by no means c l e a r as evidenced by the s t u d i e s of G a l l a n t et^ a_l. ( 6 3 ) who o o s h i f t e d E_;_ c o l i from 23 C to MO C and found that t h i s induced a la r g e accumulation of ppGpp, but s u r p r i s i n g l y , the r a t e of rRNA sy n t h e s i s i n c r e a s e d as w e l l . Based on these r e s u l t s , G a l l a n t has suggested that ppGpp may not be the true e f f e c t o r of the s t r i n g -ent response but only i n c r e a s e s c o - i n c i d e n t a l l y during s t r i n g e n c y and i t s observed i j i v i t r o e f f e c t s may be due to i t s a b i l i t y to mimic the a c t i o n s of the true e f f e c t o r . I t i s apparent that much more work i s needed to c l a r i f y t h i s q u e s t i o n . As f a r as s p e c i f i c DNA sequences of s t r i n g e n t l y c o n t r o l l e d genes are concerned, Travers and co-workers (64, 65) have suggested that at l e a s t two of three conserved f e a t u r e s are necessary: i ) an 8-10 bp G-C r i c h " d i s c r i m i n a t o r " r e g i o n l o c a t e d near the t r a n s c r i p t i o n a l s t a r t s i t e ; i i ) a -35 r e g i o n which deviated s l i g h t l y from the TTGA of the consensus sequence; and i i i ) an upstream s t i m u l a t o r y sequence as d i s c u s s e d e a r l i e r . Tyr Using a system whereby the c o l i tRNA promoter was j o i n e d to the galK gene, Lamond and Travers (65) demonstrated that a 4 bp mutation i n the d i s c r i m i n a t o r r e g i o n a b o l i s h e d the s t r i n g e n t Tyr r e g u l a t i o n of tRNA t r a n s c r i p t i o n in_ v i v o , i n d i c a t i n g that f o r 17 t h i s gene at l e a s t , the G-C r i c h r e g i o n was c r i t i c a l to s t r i n g e n c y . In analogous s t u d i e s , Sarmientos e_t a_l. (66) fused the P1-P2 promoter r e g i o n s of the E_j_ c o l l rrnA operon d i r e c t l y to a t r a n s c r i p t i o n terminator on a multicopy plasmid, e l i m i n a t i n g most i n t e r n a l RNA s t r u c t u r a l elements, and d i r e c t l y assayed i n v i v o and i i i v i t r o t r a n s c r i p t s on p o l y a c r y l a m i d e g e l s . I n t e r e s t i n g l y , they found that only the upstream P1 promoter was s u b j e c t to s t r i n g e n t r e g u l a t i o n . Furthermore, both the P1 and P2 promoters contained a d i s c r i m i n a t o r - l i k e sequence near the t r a n s c r i p t i o n a l +1 s i t e , i n d i c a t i n g that a G-C r i c h sequence alone was not s u f f i c i e n t to confer s t r i n g e n t c o n t r o l . A more d e t a i l e d mutational a n a l y s i s of the P1 promoter element appears to be necessary to p i n p o i n t the s t r i n g e n t c o n t r o l sequences. 4. Growth r a t e dependent r e g u l a t i o n of rRNA operons. i ) DNA sequence requirements A l l s t u d i e s thus f a r have i m p l i c a t e d the promoter r e g i o n of s t a b l e RNA genes as being c r i t i c a l to a number of d i f f e r e n t forms of r e g u l a t i o n . That growth r a t e dependent c o n t r o l was a l s o mediated t r a n s c r i p t i o n a l l y has a l r e a d y been i m p l i e d by the data of Gausing (26). D i r e c t evidence i n d i c a t i n g that the promoter regions of rRNA and tRNA genes are necessary and s u f f i c i e n t f o r growth r a t e dependent r e g u l a t i o n has only come with the advent of recombinant DNA technology. Most i n v e s t i g a t o r s have chosen to c o n s t r u c t systems whereby the promoter r e g i o n of i n t e r e s t i s 18 f u s e d t o a marker gene whose p r o d u c t can be e a s i l y and q u a n t a t a t i v e l y a s s a y e d , s u c h as l a c Z or g a l K ( s e e 6 7 f o r r e v i e w ) . The f u s i o n i s t h e n i n t r o d u c e d i n t o t h e a p p r o p r i a t e h o s t o r g a n i s m e i t h e r on a m u l t i c o p y p l a s m i d o r on l y s o g e n i c phage and t h e t r a n s c r i p t i o n a l a c t i v i t y o f t h e p r o m o t e r m o n i t o r e d under v a r i o u s c o n d i t i o n s by a s s a y i n g f o r t h e e x p r e s s e d p r o t e i n . The f u s i o n s d i s c u s s e d h e r e and used t h r o u g h o u t t h i s t h e s i s a r e p r o p e r l y termed " o p e r o n " or " t r a n s c r i p t i o n a l " f u s i o n s s i n c e t h e marker gene r e t a i n s i t s n a t i v e t r a n s l a t i o n a l s i g n a l s ( r i b o s o m e b i n d i n g s i t e ) , as opposed t o "gene" f u s i o n s w h i c h r e s u l t i n t h e s y n t h e s i s o f a h y b r i d p r o t e i n ( 6 7 ) . U s i n g t h i s a p p r o a c h , Berman and B e c k w i t h ( 6 8 ) f i r s t showed T y r t h a t t h e l a c Z gene c o u l d be i n s e r t e d i n t o t h e c o l i tRNA gene s u c h t h a t the s y n t h e s i s o f B - g a l a c t o s i d a s e was s u b j e c t e d t o the r e g u l a t o r y mechanisms w h i c h g o v e r n e d s t a b l e RNA s y n t h e s i s . I n t h i s c a s e , some o f the f u s i o n s showed i n c r e a s e d l e v e l s o f B-g a l a c t o s i d a s e a c t i v i t y w i t h i n c r e a s i n g g r o w t h r a t e w h i c h p a r a l l e l e d t h e s y n t h e s i s o f s t a b l e RNA. U n f o r t u n a t e l y , t h e methods u s e d t o g e n e r a t e l a c Z f u s i o n s , based on phage Mu i n s e r t i o n s , d i d n o t p e r m i t a p r e c i s e l o c a l i z a t i o n o f where w i t h i n T y r t h e tRNA gene the i n s e r t i o n s had o c c u r r e d . I n t e r e s t i n g l y , a number o f t h e i r f u s i o n s d i d n o t e x h i b i t a g r o w t h r a t e d e p e n d e n t i n c r e a s e i n B - g a l a c t o s i d a s e a c t i v i t y . A more r e f i n e d a p p r o a c h was t a k e n by Ota e_t a_l. ( 6 9 ) who s u b c l o n e d the p r o m o t e r r e g i o n 19 plus some 16S RNA coding sequences from the c o l i rrnB operon onto a lambda pgal8 transducing phage. Here again i t was found that expression of the fused g a l a c t o s e operon i n c r e a s e d as a f u n c t i o n of c e l l u l a r growth r a t e i n a manner c h a r a c t e r i s t i c of rRNA s y n t h e s i s , and was s u b j e c t to s t r i n g e n t r e g u l a t i o n as w e l l . Since then a number of other s t u d i e s have a l l reached the c o n c l u s i o n that only the promoter r e g i o n of s t a b l e RNA genes was r e q u i r e d to place a fused gene under growth r a t e dependent c o n t r o l (31 , 70, 71 , 72). Deuster e_t_ a_l. (71) have shown that a Leu DNA fragment of the tRNA promoter spanning r e s i d u e s -50 to +5, when fused to the galK gene on a multicopy plasmid, was s u f f i c i e n t to place galK expression under growth r a t e c o n t r o l . The most d e t a i l e d a n a l y s i s of the c r i t i c a l sequence has been presented by Gourse e_t a_l.(31) who used chromosomally i n t e g r a t e d lacZ f u s i o n s to the r r n E and rrnB promoter r e g i o n s . By p h y s i c a l l y s e p a r a t i n g the upstream (P1) and downstream (P2) promoters they were able to show that only the P I - l a c Z f u s i o n gave the c h a r a c t e r i s t i c growth r a t e dependent i n c r e a s e i n B-g a l a c t o s i d a s e a c t i v i t y ; l a c Z c o n t r o l l e d by the P2 promoter showed no change i n e x p r e s s i o n as growth r a t e i n c r e a s e d . By p r o g r e s s i v e l y d e l e t i n g both 5* and 3* f l a n k i n g r e g i o n s of the P1 promoter, they found that the DNA sequences between -51 and -4 r e l a t i v e to the P1 t r a n s c r i p t i o n a l i n i t i a t i o n s i t e were s u f f i c i e n t to confer a growth r a t e dependent response. The -35 region of P1 (between -51 and -20) appeared to be c r i t i c a l 20 because s u b s t i t u t i o n s of the wild-type -10 r e g i o n with a -10 sequence from a non-regulated ( l a c ) promoter r e s u l t e d i n only a s l i g h t l o s s of r e g u l a t o r y c a p a c i t y . T h e r e f o r e , the r o l e of the -10 region i s somewhat undefined. Gourse e_t al_.(31) have suggested that only the a c t u a l -35 r e g i o n of P1 i s c r i t i c a l f o r growth r a t e dependent r e g u l a t i o n ; however, t h e i r s m a l l e s t r e g u l a t e d fragment (-51 to -20) s t i l l c ontained roughly 15 bp of the h i g h l y A-T r i c h 5' f l a n k i n g sequences. T h e r e f o r e , the p o s s i b l e importance of sequences o u t s i d e of the -35 r e g i o n cannot be excluded and more s p e c i f i c mutagenesis s t u d i e s are needed to c l a r i f y t h i s p o i n t . Nevertheless, as Travers (58) had p r e v i o u s l y pointed out, there does appear to be some c o n s e r v a t i o n of sequences i n the P1 promoter r e g i o n of the seven c o l i rRNA operons, but t h i s homology i s l a r g e l y c o n f i n e d to the -10 r e g i o n . Therefore, the p r e c i s e r o l e of s p e c i f i c bases remains to be d e f i n e d . Support f o r the ob s e r v a t i o n that the P1 and P2 rRNA promoters are i n d i v i d u a l l y and d i f f e r e n t i a l l y r e g u l a t e d has a l s o come from e a r l i e r s t u d i e s by Cashel and co-workers (66, 73 , 74). Rather than a t r a d i t i o n a l operon-fusion system as d i s c u s s e d above, these workers coupled the rrnA promoters to the rrnB t r a n s c r i p t i o n t e r m i n a t i o n r e g i o n ( e l i m i n a t i n g a l l i n t e r n a l sequences) i n such a way that a s m a l l , e a s i l y v i s u a l i z e d in_ v i v o t r a n s c r i p t was produced. Expression of the rrnA promoters could 21 be monitored by e x t r a c t i n g t o t a l c e l l u l a r RNA and q u a n t i f y i n g the s p e c i f i c rRNA t r a n s c r i p t s . In t h i s way, Cashel's group ( 6 6 , 7 3 ) observed that the o v e r a l l a c t i v i t y or s t r e n g t h of the P1 promoter was about 3 - f o l d g r e a t e r than the P2 promoter and that only the P1 t r a n s c r i p t appeared to i n c r e a s e as a f u n c t i o n of i n c r e a s i n g growth r a t e . Furthermore, Sarmientos e_t a_l. ( 7 4 ) have repor t e d that n e i t h e r P1 nor P2 t r a n s c r i p t s were observed i n s t a t i o n a r y phase c e l l s , although t h e i r method of d e t e c t i o n (ethidium bromide s t a i n i n g of RNA i n p o l y a c r y l a m i d e g e l s ) had l i m i t e d s e n s i t i v i t y . Upon outgrowth from s t a t i o n a r y phase the accumulation of P2 t r a n s c r i p t s i n c r e a s e d r a p i d l y while Pl t r a n s c r i p t s appeared only a f t e r a delay and took some time to reach t h e i r c h a r a c t e r i s t i c high l e v e l s . These r e s u l t s suggested that while P1 a c t i v i t y c l e a r l y predominated at moderate to f a s t growth r a t e s and was r e g u l a t e d i n response to growth r a t e , the normally weakly a c t i v e P2 promoter might f u n c t i o n as a means whereby rRNA s y n t h e s i s could q u i c k l y resume i n c e l l s r e c o v e r i n g from s t a t i o n a r y phase ( 7 4 ) . I t must be pointed out that most of the c o n c l u s i o n s mentioned above were d e r i v e d from the study of operon-fusion systems, some c a r r i e d on multicopy plasmids, and t h e r e f o r e must be c r i t i c a l l y examined. Since any g i v e n rRNA operon i s normally present as only a s i n g l e copy per chromosome and g i v e s r i s e to a n o n - t r a n s l a t e d product, there e x i s t s the p o s s i b i l i t y that measur-ing the t r a n s l a t i o n product of a gene fused to an rRNA-derived 22 r e g u l a t o r y r e g i o n could produce an a r t i f i c i a l s i t u a t i o n which could mimic a growth r a t e dependent response. S e v e r a l p o t e n t i a l a r t i f a c t s i n c l u d e : a) d i f f e r e n t i a l t r a n s l a t i o n of mRNA at high and low growth r a t e ; b) d i f f e r e n t i a l s t a b i l i t y of mRNA at d i f f e r e n t growth r a t e s ; or c) f l u c t u a t i o n s i n plasmid copy number as growth r a t e changed. These w i l l be d i s c u s s e d f u r t h e r i n the Re s u l t s , Chapter 1. None of the s t u d i e s d i s c u s s e d above e s t a b l i s h e d the v a l i d i t y of the f u s i o n system by si m u l t a n e o u s l y determining the l e v e l of t r a n s l a t e d product and the l e v e l of f u s i o n - s p e c i f i c mRNA as growth r a t e changed. i i ) Models f o r growth r a t e c o n t r o l of rRNA genes. The major question now posed i s how the c o n c e n t r a t i o n of ribosomes per c e l l i s r e g u l a t e d i n response to changes i n environmental c o n d i t i o n s ( i . e . growth r a t e ) . As s t a t e d b e f o r e , the c o n c e n t r a t i o n of ribosomes (and rRNA) i n c r e a s e s approximately i n p r o p o r t i o n to the growth r a t e , u, and thus the r a t e of 2 s y n t h e s i s i n c r e a s e s with u . I t has been shown that the sy n t h e s i s r a t e of rRNA i s of c o n s i d e r a b l e importance i n the r e g u l a t i o n of ribosome b i o s y n t h e s i s . In order to be e f f e c t i v e , the mechanisms governing growth rate dependent r e g u l a t i o n must f i r s t l y be able to sense the n u t r i t i o n a l s t a t u s of a c e l l ' s environment and secondly, be able to respond to t h i s s t a t u s by inducing the ap p r o p r i a t e amount of rRNA t r a n s c r i p t i o n f o r that 23 growth r a t e and thereby produce the c o r r e c t number of ribosomes. In g e n e r a l , three d i f f e r e n t models have been proposed f o r the r e g u l a t i o n of s t a b l e RNA genes. a) Maaloe (75) suggested a p a s s i v e r e g u l a t o r y mechanism whereby the c e l l has only a l i m i t e d c a p a c i t y f o r t r a n s c r i p t i o n and that ribosomal and non-ribosomal promoters must compete f o r t h i s c a p a c i t y . This competition could switch i n favor of ribosomal genes as growth r a t e i n c r e a s e d because as the q u a l i t y of the growth medium improved many of the pathways of i n t e r m e d i a r y metabolism and b i o s y n t h e s i s would become i n c r e a s i n g l y r e p r e s s e d . However, c e r t a i n experimental observations are i n c o n f l i c t with t h i s model. For example, Ikemura and Nomura (76) and Jinks-Robertson e_t a_l. (77) i n c r e a s e d the gene dose of rRNA operons per genome by i n t r o d u c i n g plasmids c o n t a i n i n g rrnD or rrnB operons and showed that the l e v e l of expression from each i n d i v i d u a l chromosomal rRNA operon was subsequently reduced while there were no apparent changes i n the t r a n s c r i p t i o n a l a c t i v i t i e s of other competing non-ribosomal genes. While the Maaloe model would p r e d i c t that such a passive mechanism would i n f l u e n c e the o v e r a l l p a t t e r n of e x p r e s s i o n of every gene i n the c e l l i n a concurrent manner, t h i s i s c l e a r l y not seen iri v i v o . b) Bremer and co-workers (78, 79) and Travers e_t a_l. (58, 80) have proposed s i m i l a r models whereby s t a b l e RNA genes are 24 a c t i v e l y r e g u l a t e d v i a the a c t i o n of p o s i t i v e or negative e f f e c t o r molecules. These e f f e c t o r s would presumably sense the n u t r i t i o n a l c o n d i t i o n s and then i n t e r a c t with DNA or RNA polymerase or both so as to induce the a p p r o p r i a t e r a t e of t r a n s c r i p t i o n from rRNA operons. The favored e f f e c t o r molecule was ppGpp because of the i n v e r s e c o r r e l a t i o n between i t s c o n c e n t r a t i o n and rRNA s y n t h e s i s d u r i n g s t r i n g e n t c o n t r o l , as di s c u s s e d i n the previous s e c t i o n . T r a v e r s e_t a_l. ( 8 0 ) have presented evidence that the RNA polymerase holoenzyme could be f r a c t i o n a t e d by c e n t r i f u g a t i o n through g l y c e r o l g r a d i e n t s i n t o a number of d i f f e r e n t forms which had d i f f e r e n t p r eferences f o r va r i o u s promoters. One form could i n i t i a t e t r a n s c r i p t i o n e f f i c i e n t l y at s t a b l e RNA promoters but r e l a t i v e l y p o o r l y at c o n s t i t u t i v e promoters; a second form had the opposite p r e f e r e n c e . Therefore, these workers have proposed that at l e a s t two d i f f e r e n t conformations of polymerase e x i s t and that r e g u l a t o r s of growth r a t e c o n t r o l such as ppGpp operate by changing the e q u i l i b r i u m between the form which can t r a n s c r i b e s t a b l e RNA genes and the form which cannot. At s a t u r a t i n g l e v e l s of ppGpp (or some other e f f e c t o r ) , the polymerase would be i n the form which p r e f e r s mRNA to s t a b l e RNA promoters. This model i s supported by the f i n d i n g t h a t the E_;_ c o l i a l t l mutation was p h e n o t y p i c a l l y a mutant RNA polymerase having a higher a f f i n i t y f o r the c o n s t i t u t i v e l a c promoter and c o n c u r r e n t l y , a reduced a f f i n i t y f o r the rrnX promoter in. v i t r o ( 8 1 ) ; i n other 25 words, an RNA polymerase with a l t e r e d promoter p r e f e r e n c e . In a d d i t i o n , Muto (82) r e p o r t e d that crude p r o t e i n f a c t o r s , d i s t i n c t from any RNA polymerase subunit, could p r e f e r e n t i a l l y s t i m u l a t e rRNA s y n t h e s i s s e v e r a l f o l d in. v i t r o . This was taken as evidence that c e r t a i n f a c t o r s could have a p o s i t i v e e f f e c t on rRNA t r a n s c r i p t i o n by s h i f t i n g the balance between the two forms of polymerase. Whether p o s i t i v e e f f e c t o r s t r u l y operate i j i v i v o i s p r e s e n t l y u n c l e a r . Nomura e_t al^. (14) have pointed out that t h i s d i r e c t e f f e c t o r model does not have an easy means f o r both as s e s s i n g the n u t r i t i o n a l s t a t u s of a c e l l and a l s o monitoring the r e s u l t s of i t s a c t i o n s , i n terms of responding to the f i n a l ribosome supply so as to f i n e - t u n e rRNA s y n t h e s i s as c o n d i t i o n s change. c) For t h i s reason, Nomura and co-workers (14, 77) have proposed an a l t e r n a t i v e model c o n s i s t i n g of a feedback i n h i b i t i o n mechanism by which f r e e , n o n - t r a n s l a t i n g ribosomes i n h i b i t the t r a n s c r i p t i o n of s t a b l e RNA genes. The ribosome i t s e l f may t h e r e f o r e be an autogenous r e g u l a t o r , sensing environmental c o n d i t i o n s i n a manner p r e v i o u s l y proposed by L i n d a h l and Zengel (4). This model was d e r i v e d from s t u d i e s by Jinks-Robertson e_t a l . (77) who showed t h a t an i n c r e a s e i n the t o t a l number of rRNA operons per c e l l d i d not cause a corresponding i n c r e a s e i n t o t a l rRNA s y n t h e s i s . Instead, the o v e r a l l rRNA s y n t h e s i s r a t e was unchanged because the s y n t h e s i s from each i n d i v i d u a l rRNA operon was decreased. In other words, a two to t h r e e - f o l d i n c r e a s e i n 26 rRNA gene dosage r e s u l t e d i n a two to t h r e e - f o l d decrease i n accumulation of tRNA and rRNA from i n d i v i d u a l operons such that the g l o b a l r a t e of s t a b l e RNA s y n t h e s i s was unchanged. More impo r t a n t l y , t h i s e f f e c t was not seen i f the e x t r a rRNA operons which were int r o d u c e d were d e l e t e d i n the rRNA coding r e g i o n such that f u l l l e n g t h rRNA t r a n s c r i p t s could not be produced. In t h i s l a t t e r case, the t o t a l r a t e of rRNA operon t r a n s c r i p t i o n ( i . e . chrombsomally encoded plus d e f e c t i v e , plasmid encoded genes) increased i n accordance with the i n c r e a s i n g gene dosage. These r e s u l t s allowed Jinks-Robertson _e_t a_l. to conclude that some product from i n t a c t rRNA operons was r e s p o n s i b l e f o r the maintenance of normal rRNA t r a n s c r i p t i o n r a t e s . E i t h e r f r e e rRNA, incomplete ribosomes, or complete ribosomes s y n t h e s i z e d i n excess of the amount a p p r o p r i a t e f o r a given set of environmental c o n d i t i o n s , would presumably feedback i n h i b i t the t r a n s c r i p t i o n of s t a b l e rRNA operons. Based on the o b s e r v a t i o n that ribosome assembly-defective mutants of E_^  c o l i a p p a r e n t l y overproduce rRNA and tRNA, Nomura et a l . (14) have p o s t u l a t e d that the negative r e g u l a t o r y f a c t o r s are i n f a c t s u r p l u s , n o n - t r a n s l a t i n g ribosomes. This model has been t e s t e d i n a number of s t u d i e s by Nomura's group. Takebe et a_l. (83) developed a system i n which the assembly of ribosomes was p r e f e r e n t i a l l y i n h i b i t e d without i n h i b i t i n g o v e r a l l macromolecular s y n t h e s i s . T h i s l e d to a d e f i c i e n c y i n f r e e 27 ribosomes and a concurrent s t i m u l a t i o n of rRNA and tRNA s y n t h e s i s . Gourse ^_t a^L. (84; co n s t r u c t e d a c o n d i t i o n a l rRNA gene expression system by f u s i n g the lambda P promoter/operator L to the E_j_ c o l i rrnB operon. The r e s u l t a n t overproduction of rRNA and f r e e ribosomes was seen to produce a l a r g e r e p r e s s i o n of rRNA and tRNA s y n t h e s i s from chromosomal genes. A d e f i n i t i v e t e s t however, has thus f a r been l a c k i n g - that i s , i t has not yet been p o s s i b l e to show a d i r e c t r e g u l a t o r y e f f e c t of ribosomes on t r a n s c r i p t i o n from rRNA promoters in_ v i t r o (77). I t remains a d i s t i n c t p o s s i b i l i t y that f r e e ribosomes act i n d i r e c t l y by r e g u l a t i n g some other f a c t o r which i n turn i s the true e f f e c t o r of rRNA operon c o n t r o l In t h i s regard, i t i s i n t e r e s t i n g to note that the study of Gourse e_t a_l. (84) showed that the overproduction of plasmid rRNA which r e s u l t e d i n a 2 - f o l d i n h i b i t i o n of chromosomal rRNA t r a n s c r i p t i o n a l s o c o r r e l a t e d with a 30-50$ i n c r e a s e i n c e l l u l a r ppGpp c o n c e n t r a t i o n . T h i s would again i m p l i c a t e ppGpp i n the c o n t r o l of s t a b l e RNA s y n t h e s i s , but as pointed out by Gourse e_t a_l. (84) i t could a l s o be p o s s i b l e that the i n c r e a s e i n ppGpp was the r e s u l t r a t h e r than the cause of the observed i n h i b i t i o n of chromosomal rRNA t r a n s c r i p t i o n . F i n a l l y , t h i s model would p r e d i c t a d i r e c t e f f e c t of f r e e ribosomes (or some f a c t o r r e g u l a t e d by f r e e ribosomes) on the rRNA promoter r e g i o n so as to r e g u l a t e the o v e r a l l p a t t e r n of t r a n s c r i p t i o n . Gourse e_t a_l. (31) stu d y i n g d e l e t e d rRNA 28 promoters i n a l a c f u s i o n system as d i s c u s s e d p r e v i o u s l y , have found that the sequences c r i t i c a l f o r growth r a t e dependent c o n t r o l (between -51 and -20 of the P1 promoter) are a l s o the sequences r e q u i r e d i n order that feedback i n h i b i t i o n e f f e c t s are seen i f the rRNA gene dose i s i n c r e a s e d . From these r e s u l t s , they have proposed that negative feedback r e g u l a t i o n of rRNA promoters i s r e s p o n s i b l e f o r the growth r a t e dependent s y n t h e s i s of rRNA i n E_^  c o l i . Whether t h i s i s t r u l y the case remains to be e x p e r i m e n t a l l y determined. In summary, two important p o i n t s must be made. F i r s t l y , the l a t t e r two models di s c u s s e d above are not e n t i r e l y i n c o m p a t i b l e but r e q u i r e an i n t e r m e d i a r y f a c t o r to r e l a t e the c e l l u l a r ppGpp c o n c e n t r a t i o n to the f r e e ribosome p o o l . The important but l a r g e l y overlooked work of G a l l a n t e_t §_1. (63) i n v o l v i n g the e f f e c t s of temperature u p s h i f t on ppGpp c o n c e n t r a t i o n and rRNA sy n t h e s i s suggests that such an i n t e r m e d i a r y f a c t o r may indeed e x i s t . Secondly, i t i s c l e a r that there are s e v e r a l f e a t u r e s unique to s t a b l e RNA genes, f e a t u r e s that are found at the DNA sequence l e v e l that allow them to be r e c o g n i z e d as t a r g e t s f o r the growth r a t e r e g u l a t o r y mechanisms. Therefore the study of rRNA promoter regions and t h e i r r e g u l a t i o n i n other organisms could be important i n terms of i d e n t i f y i n g and c h a r a c t e r i z i n g these unique f e a t u r e s . 29 5. Ribosomal RNA operons i n B a c i l l u s s u b t l l i 3 While there i s a wealth of i n f o r m a t i o n concerning the o r g a n i z a t i o n , s t r u c t u r e and r e g u l a t i o n of s t a b l e RNA genes i n E.  c o l i , comparatively l i t t l e i s known about the s i t u a t i o n i n other s p e c i e s . The Gram-positive, endospore-forming organism B a c i l l u s  s u b t i l i s has been the s u b j e c t of most s t u d i e s i n t h i s area f o r a number of reasons. Because i t i s a s p o r u l a t i n g organism, i t f o l l o w s what i s i n e f f e c t a p r i m i t i v e d i f f e r e n t i a t i o n pathway d i r e c t e d by a cascade of modified RNA polymerase molecules r e c o g n i z i n g d i f f e r e n t , s p e c i f i c s e t s of promoters (85). An a n a l y s i s of the t r a n s c r i p t i o n a l r e g u l a t i o n of s t a b l e RNA genes as w e l l as other genes could t h e r e f o r e p o i n t to new mechanisms r e l a t e d to development and c e l l u l a r d i f f e r e n t i a t i o n . Secondly, B. s u b t i l i s could r e p r e s e n t a p o t e n t i a l l y u s e f u l system f o r the expression of heterologous genes s i n c e an e f f i c i e n t p r o t e i n s e c r e t i o n system operates i n t h i s organism. F i n a l l y , i n c o n t r a s t to other Gram-positive organisms, B_;_ s u b t i l i s has been r e l a t i v e l y w e l l c h a r a c t e r i z e d g e n e t i c a l l y (86), which can f a c i l i t a t e the more d e t a i l e d study of s p e c i f i c genes and operons. 6. L o c a t i o n and s t r u c t u r e of B_;_ s u b t i l i s rRNA genes. As i n E_j_ c o l i , the ribosomal RNA genes of B_^  s u b t i l i s are organized as t r a n s c r i p t i o n a l u n i t s i n the order 16S, 23S, 5S RNA (87). While no l a r g e p r e c u r s o r RNA has been observed, p r e c u r s o r s 30 to the i n d i v i d u a l rRNA's could be detected a f t e r pulse l a b e l l i n g , i n d i c a t i n g that some p o s t - t r a n s c r i p t i o n a l p r o c e s s i n g events were r e q u i r e d (88). E a r l y d e n s i t y t r a n s f e r experiments c a r r i e d out by O i s h i and Sueoka (89) and Smith e_t a_l. (90) showed that about 80$ of the DNA that s p e c i f i c a l l y h y b r i d i z e d with ribosomal RNA was r e p l i c a t e d very e a r l y , i n d i c a t i n g that t h i s DNA was c l u s t e r e d near the o r i g i n of chromosome r e p l i c a t i o n . The remaining 20$ r e p l i c a t e d c o n s i d e r a b l y l a t e r , suggesting the presence of a second chromosomal l o c u s . T h i s t i g h t c l u s t e r i n g was confirmed by Chow and Davidson (91) who used e l e c t r o n microscopy to study the heterduplexes formed a f t e r denatured s u b t i l i s DNA was allowed to r e n a t u r e . T h e i r data suggested that there were 7 to 10 c o p i e s of ribosomal genes on the chromosome and that each was homologous but separated from the others by heterologous spacer DNA sequences. More r e c e n t l y , by using Southern b l o t t i n g to examine the d i s t r i b u t i o n of chromosomal DNA sequences homologous to r a d i o l a b e l l e d ribosomal RNA, a number of authors have found t h a t B. s u b t i l i s probably possesses as many as 10 rRNA operons (92, 93, 94, 95). By c l o n i n g rDNA sequences onto plasmids and a l l o w i n g these to i n t e g r a t e i n t o the homologous chromosomal r e g i o n s , La Fau c i e_t a_l. (96) were able to map the l o c a t i o n of seven of these operons, b r i n g i n g the number of mapped operons to nine (86). A c l u s t e r of s i x operons ( r r n 0, A, G, H, I, E) was o o mapped to a r e g i o n between 0 and 15 , rrnD l a y between 60 and 75 o and the remainder i n a second c l u s t e r between 200 and 275 . 31 Thus, the rRNA operons of B_j_ s u b t i l l s a p p a r e n t l y were c l u s t e r e d to a g r e a t e r extent than seen f o r E_j_ c o l i operons. By a n a l y z i n g cloned rDNA sequences and chromosomal p a t t e r n s of homology, Stewart e_t a_l. (93) were able to c o n s t r u c t d e t a i l e d p h y s i c a l maps f o r some of the operons. They found that the l i n k a g e between d i s t i n c t operons could be very t i g h t - some were apparently separated by as l i t t l e as 100 bp, and o t h e r s by l e s s than 500 bp. In a d d i t i o n , they were able to d i v i d e the rRNA operons i n t o two groups which d i f f e r e d only i n the s i z e of the i n t e r g e n i c 16S-23S spacer r e g i o n s . Whereas a l l jS^ c o l i rRNA operons c a r r i e d tRNA genes i n t h i s i n t e r g e n i c spacer, only two of the ten s u b t i l i s operons were found to c o n t a i n i n t e r g e n i c tRNA l i e A l a genes and both of these c o n s i s t e d of tRNA and tRNA sequences. I n t e r e s t i n g l y , other workers have r e p o r t e d the c l u s t e r i n g of tRNA genes between tandem rRNA gene s e t s i n B. s u b t i l i s or as l a r g e groups l o c a t e d immediately d i s t a l to the 5S RNA determinants (92, 94). Green and Void (97) f o r i n s t a n c e , have r e c e n t l y r e p o r t e d the sequence of a c l u s t e r of 21 tRNA genes lo c a t e d d i s t a l to the B_^  s u b t i l i s rrnB operon; i n c o n t r a s t , the l a r g e s t known c l u s t e r i n c o l i c o ntains only 7 tRNA genes (98). The s i g n i f i c a n c e of such t i g h t c l u s t e r i n g of s t a b l e RNA genes i n B a c i l l u s i s u n c l e a r , although Void ( 9 9 ) has s p e c u l a t e d that t h i s could be an e v o l u t i o n a r y f e a t u r e common to Gram-p o s i t i v e organisms. I t i s c l e a r , however, that the s t a b l e RNA 32 genes of B_j_ 3 u b t i l i s d i f f e r fundamentally i n o r g a n i z a t i o n from t h e i r c o l i c o u n t e r p a r t s . As o u t l i n e d above, t h i s i s r e f l e c t e d i n the extremely t i g h t c l u s t e r i n g of rRNA and tRNA genes, the r e l a t i v e l o c a t i o n of tRNA determinants i n r e l a t i o n to rRNA gene s e t s , and i n the gene dose of rRNA operons. 7. Promoter regions of s u b t i l i s rRNA operons. To date, the complete DNA sequence of only one s u b t i l i s rRNA operons has been determined (102). In a d d i t i o n , the sequence of the promoter r e g i o n of a second rRNA operon has been determined (103). As with c o l i , the 5' f l a n k i n g r e g i o n of the B_^  s u b t i l i s rrnB operon showed the presence of d i s t i n c t tandem promoter elements separated by about 100 bp. I n t e r e s t i n g l y , the second operon, on a plasmid c a l l e d 14B1, appeared to possess only a s i n g l e promoter element which showed homology to the downstream P2 promoter of the other operons (103). I t was a l s o noted that the spacing between the -35 and -10 region of the 14B1 promoter was a l e s s than optimal 18 bp, compared to 17 bp f o r the other rRNA promoters. These d i f f e r e n c e s c a l l i n t o question the o v e r a l l e f f i c i e n c y of t h i s promoter and i t s r o l e i n v i v o , e s p e c i a l l y i n view of the f a c t that i t s chromosomal l o c a t i o n was as the second set of a tandem operon arrangement. 33 F i n a l l y , an i n s p e c t i o n of the DNA sequences surrounding the tandem promoters of the B a c i l l u s rrnB operon r e v e a l e d the presence of a stem-loop s t r u c t u r e downstream of the P2 promoter t r a n s c r i p t i o n i n i t i a t i o n s i t e and thought to be p a r t of a p o s t - t r a n s c r i p t i o n a l p r o c e s s i n g s i t e (103). A I 3 0 , a G-C r i c h sequence showing homology to the d i s c r i m i n a t o r sequence thought to be i n v o l v e d i n the s t r i n g e n t response i n c o l i was seen i n the area of the +1 s i t e of the B_^  s u b t i l i s rrnB P1 promoter, although not f o r the P2 promoter. Furthermore, the sequence upstream of the P1 promoter i n a l l B_;_ s u b t i l i s rRNA operons was seen to be extremely A-T r i c h (37 out of 44 bp), as noted p r e v i o u s l y f o r c o l i rRNA operons ( 4 ) . 8. Regulation of s t a b l e RNA s y n t h e s i s i n B_^  s u b t i l i s . Comparatively l i t t l e i s known about the s y n t h e s i s of s t a b l e RNA i n g e n e r a l , and the r e g u l a t i o n of rRNA operons i n p a r t i c u l a r , i n B_j_ s u b t i l i s . A d i r e c t analogy to E_;_ c o l i may be an o v e r s i m p l i f i c a t i o n because of the a b i l i t y of B_^  s u b t i l i s to f o l l o w an a l t e r n a t e developmental pathway c u l m i n a t i n g i n the formation of endospores. As has been shown by numerous a u t h o r s , the process of s p o r u l a t i o n i n v o l v e s the d i f f e r e n t i a l e x p r e s s i o n of a subset of genes whose t r a n s c r i p t i o n i s dependent on the presence of d i f f e r e n t sigma f a c t o r s a s s o c i a t e d with the core RNA polymerase (85). Sigma f a c t o r s i n g e n e r a l have been shown to be re q u i r e d f o r the s p e c i f i c r e c o g n i t i o n of promoter s i t e s on DNA by 34 RNA polymerase (105), and as such are key components i n the i n i t i a t i o n of t r a n s c r i p t i o n . The promoters f o r s t a b l e RNA genes have been shown to have sequences p o t e n t i a l l y r e c o g n i z e d by the major sigma-43 c o n t a i n i n g RNA polymerase of v e g e t a t i v e c e l l s (106). Since t h i s form of polymerase i s known to be present at a l l stages of s p o r u l a t i o n and v e g e t a t i v e growth, i t has been speculated that s t a b l e RNA genes are not i n f a c t s u b j e c t to d i f f e r e n t i a l r e g u l a t i o n of t r a n s c r i p t i o n caused by v a r i a t i o n s i n a v a i l a b l e sigma f a c t o r s (99). This has not been e x p e r i m e n t a l l y t e s t e d however. Despite the a v a i l a b i l i t y of cloned rRNA and tRNA genes, few t r a n s c r i p t i o n a l s t u d i e s have been done. Stewart and Bott (103) used S1 mapping techniques to demonstrate that the rrnB promoters f u n c t i o n e d i n v i v o and provided evidence that the upstream P1 promoter was the l e s s a c t i v e promoter of the p a i r , although the r e l a t i v e h y b r i d i z a t i o n e f f i c i e n c i e s were p o t e n t i a l l y c o m p l i c a t i n g f a c t o r s here. S i m i l a r l y , Void and Green (107) used S1 mapping to analyze the t r a n s c r i p t i o n products from a c l u s t e r of 21 tRNA genes a f t e r i n t r o d u c t i o n of these genes i n t o E_j_ c o l i . Despite the f a c t that t h i s was a heterologous system, i t was shown that mature tRNA's having the primary sequence of B.  s u b t i l i s tRNA's could be t r a n s c r i b e d and processed i n t o f u n c t i o n a l i s o a c c e p t i n g s p e c i e s , thereby emphasizing the s i m i l a r i t i e s between these two organisms i n t h i s r e g a r d . 3 5 However, s t u d i e s attempting to r e l a t e the t r a n s c r i p t i o n a l a c t i v i t y of B_^  s u b t i l i s s t a b l e RNA gene promoters to v a r i a t i o n s i n c e l l u l a r growth r a t e have not been done. As f a r as the o v e r a l l r e g u l a t i o n of the B a c i l l u s t r a n s c i p t i o n a l - t r a n s l a t i o n a l machinery i s concerned, a number of s t u d i e s have suggested a p a t t e r n s i m i l a r to that seen i n E_j_ c o l i . For example, the RNA polymerase of B a c i l l u s was found to be s i m i l a r i n subunit s t r u c t u r e to c o l i RNA polymerase although there were s l i g h t d i f f e r e n c e s i n the r e l a t i v e s i z e s of the B and B' subunits and, as mentioned above, i n the number of d i f f e r e n t sigma subunits a s s o c i a t e d with the polymerase (108). By q u a n t i t a t i n g the amount of B subunit per c e l l , Leduc e_t a_l. (109) c a l c u l a t e d that the number of RNA polymerase molecules per B.  s u b t i l i s c e l l i n c r e a s e d with i n c r e a s i n g growth r a t e and to roughly the same extent as seen i n E_^  c o l i . Furthermore, these authors noted that B a c i l l u s a p p a r e n t l y had an excess of RNA polymerase at a l l growth r a t e s , as d i d E_^ c o l i , although the excess at lower growth r a t e s was s i g n i f i c a n t l y g r e a t e r than that seen i n c o l i . I t was suggested that t h i s could be a r e f l e c t i o n of c e r t a i n d i f f e r e n c e s i n t r a n s c r i p t i o n a l c o n t r o l mechanisms, p o s s i b l y r e l a t e d to the presence of m u l t i p l e sigma f a c t o r s i n B a c i l l u s . F i n a l l y , i t was shown i n t h i s study that the t o t a l RNA content of B a c i l l u s c e l l s i n c r e a s e d i n a l o g a r i t h m i c manner as growth r a t e i n c r e a s e d . That the growth ra t e dependent i n c r e a s e i n t o t a l RNA was due predominantly to 36 ribosomal RNA was l a t e r shown by Webb and Spiegelman (110) who measured the h y b r i d i z a t i o n of r a d i o l a b e l l e d RNA to a cloned rRNA gene probe. Again, as with E_j_ c o l i , the s y n t h e s i s of rRNA i n B a c i l l u s followed a c l a s s i c a l growth r a t e dependent response, supporting the idea that o v e r a l l growth r a t e r e g u l a t i o n was s i m i l a r i n these two organisms. Data obtained through measuring the r a t e of rRNA s y n t h e s i s i n phage SPO1-infected c e l l s suggest-ed that B_^  s u b t i l l s possessed a s t a b l e , ribosomal RNA-s p e c i f i c RNA polymerase d i s t i n c t from the polymerase used f o r t r a n s c r i p t i o n of non-stable RNA genes (110). How such a polymerase could be r e g u l a t e d or how t h i s was r e l a t e d to the o v e r a l l mechanism f o r growth r a t e dependent c o n t r o l of s t a b l e RNA genes i n B a c i l l u s was u n c l e a r . F i n a l l y , as with c o l i , B. s u b t i l i s has been shown to produce the modified n u c l e o t i d e ppGpp under c o n d i t i o n s of amino a c i d s t a r v a t i o n (162) and the stimulus r e q u i r e d f o r the i n v i v o s y n t h e s i s of t h i s n u c l e o t i d e may be the same as that i n c o l i (see Ref. 163 f o r r e v i e w ) . Despite the f a c t that r e l a x e d mutants (those that f a i l to shut down s t a b l e RNA s y n t h e s i s during amino a c i d s t a r v a t i o n ) have been i s o l a t e d i n B_^  s u b t i l i s (163), there i s as yet no c l e a r cut i n d i c a t i o n that the mechanistic d e t a i l s of the s t r i n g e n t response i s s i m i l a r i n B_j_ s u b t i l i l s and c o l i . I t must be noted however, that the GC r i c h sequences l o c a t e d at the o r i g i n of t r a n s c r i p t i o n of s t r i n g e n t l y c o n t r o l l e d genes and thought to be i n v o l v e d i n mediating the s t r i n g e n t response (64), 37 are homologous to sequences found around the t r a n s c r i p t i o n i n i t i a t i o n s i t e of the s u b t i l i s rrnB P1 (but not the P2) promoter (see sequence i n Ref. 103). Whether t h i s has any bearing on the s t r i n g e n t r e g u l a t i o n of t h i s operon remains to be determined. 9. R a t i o n a l e f o r present s t u d i e s . From the preceding d i s c u s s i o n , i t i s c l e a r that i n a broad sense the r e g u l a t i o n of rRNA s y n t h e s i s i n both c o l i and B.  s u b t i l i s i s s i m i l a r although there i s evidence that s u b t l e d i f f e r e n c e s may e x i s t . With the a v a i l a b i l i t y of i s o l a t e d and c h a r a c t e r i z e d B a c i l l u s rRNA operons i t i s now p o s s i b l e and necessary to begin a d e t a i l e d a n a l y s i s of the r e g u l a t i o n of such operons jin v i v o • Such an a n a l y s i s would h o p e f u l l y p o i n t to f u r t h e r s i m i l a r i t i e s or d i f f e r e n c e s i n how s t a b l e RNA s y n t h e s i s i s c o n t r o l l e d i n two widely d i v e r g e n t organisms and p o s s i b l y provide an independent t e s t of some of the models c u r r e n t l y proposed to e x p l a i n the g e n e r a l mechanisms of growth r a t e dependent r e g u l a t i o n . We have chosen to f o l l o w an approach t h a t has y i e l d e d much i n f o r m a t i o n concerning the e x p r e s s i o n of c o l i rRNA genes; namely the f u s i o n of B a c i l l u s rRNA promoter r e g i o n s to genes whose e x p r e s s i o n can subsequently be e a s i l y and q u a n t i t a t i v e l y monitored. As w i l l be d i s c u s s e d below, such an approach i s a v a l i d means of a s s e s s i n g the t r a n s c r i p t i o n a l a c t i v i t y of i s o l a t e d promoters under a v a r i e t y of environmental 3 8 c o n d i t i o n s provided the a p p r o p r i a t e c o n t r o l experiments are c a r r i e d out. Our primary o b j e c t i v e s t h e r e f o r e , were to i s o l a t e the promoter re g i o n from a B_;_ s u b t i l i s rRNA operon, fuse i t to an assayable s t r u c t u r a l gene and monitor i t s e x p r e s s i o n i n E.  c o l i and B_^  s u b t i l i s as a f u n c t i o n of growth r a t e . The e x pression, i f p o s s i b l e , of B a c i l l u s rRNA genes i n E^ _ c o l i may provide an i n d i c a t i o n of the e v o l u t i o n a r y divergence of t h i s component of the t r a n s c r i p t i o n - t r a n s l a t i o n system among procaryotes as w e l l as p rovide i n s i g h t s i n t o the m e chanistic d e t a i l s of growth r a t e dependent c o n t r o l . S i m i l a r l y , the expression of these genes i n a homologous B a c i l l u s background i s necessary to a s c e r t a i n whether s u b t l e r e g u l a t o r y d i f f e r e n c e s e x i s t between t h i s organism and E_^  c o l i . 39 M a t e r i a l s and Methods 1. B a c t e r i a l s t r a i n s and plasmlds S t r a i n s of b a c t e r i a used throughout t h i s t h e s i s and plasmids other than those c o n s t r u c t e d here are l i s t e d i n Table 1. Plasmids const r u c t e d during the course of t h i s work w i l l be d e s c r i b e d i n the R e s u l t s . 2. P u r i f i c a t i o n of DNA i ) c o l i plasmid DNA - l a r g e s c a l e Plasmid DNA was i s o l a t e d from E_;_ c o l l HB101 by cesium-c h l o r i d e d e n s i t y g r a d i e n t c e n t r i f u g a t i o n of c l e a r e d l y s a t e s prepared by the method of C l e w e l l and H e l i n s k i (111) as d e s c r i b e d by Dobinson and Spiegelman (112). C e n t r i f u g a t i o n of c l e a r e d l y s a t e s was c a r r i e d out i n a Beckman 70.1 T i r o t o r f o r 36-40 hr. at 108,000 x g. The s u p e r c o i l e d plasmid DNA band was removed with a s y r i n g e and 18G needle, e x t r a c t e d with H 0-saturated n-2 butanol and d i a l y z e d overnight a g a i n s t 4 1 of 10 mM TRIS-C1 (pH 7.5), 1 mM EDTA, 10 mM NaCl. The c o n c e n t r a t i o n of plasmid DNA was determined by measuring the A (1 A =50 ug/ml of DNA). 260 260 i i ) IS^ c o l i plasmid DNA - small s c a l e . For the r a p i d a n a l y s i s of recombinant c l o n e s , an a l k a l i n e l y s i s "miniprep" procedure was used which r o u t i n e l y y i e l d e d 2-3 Table 1 Bacterial Strains, Plasmids, Phage Bacterial Strain E.coli HB101 E.coli C110 E.coli JM101 B.subtilis 168 Marburg Genotype F pro leu thi lacY endA rps_L20 recA arai A galK2 xy!5  mcll supE44 hsdR hsdM F~ str31 tsx33 sup37 supE44 proA2.his4 argE3 galK2 aral4 xy!5 mtll t h r l leuC t h i l lacY supE t h i l A(lac proA,B)/F' traD36 proA,B lacI^Z M15 trpC2 thr5 Source T.Beatty R.E.W.Hancock R.Miller C.Price Plasmlds and Phage Properties Host Source/Reference PBR322 PBR328 pKM-1 PKK9-4 pKKlO-2 PKK232-8 PGS227 pTV-8 PC194 pBD9 pWWO(TOL) 0 2 9 M13mpl8 lambda ilv5 Ap , Tc Ap' Tc Cm E.co l i E . c o l i E.coli E.coli Ap\ galK . r Ap , carries E . c o l i rrnB T1,T2 Ap r, carries E . c o l i E . c o l i rrnB promoters Ap' Cm' Ap , carries B.subtilis rrnB promoters E.c o l i E.coli Cm , carries Tn917 B.subtilis Cmr B.subtilis Em , Km encodes toluene degradative enzymes B.subtilis phage M13 cloning vector lambda phage carrying E.coli rRNA operon B.subtilis P.putida B.subtilis E . c o l i E.coli R.Miller, 144 T.Warren, 121 M.Rosenberg, 129 J.Brosius, 131 J.Brosius,132 J.Brosius, 131 K.Bott, 103 P.Youngman, 153 Bacillus Genetic Stock Center Bacillus Genetic Stock Center G. Hegeman, 145 H. Whiteley, 161 R.Miller, 122 P.Dennis, 137 41 ug of plasmid DNA pure enough f o r most purposes. The procedure of M aniatis ejb a_l. (113) was fo l l o w e d except f o r minor m o d i f i c a t i o n s . The c e l l s from 2.0 ml of a s a t u r a t e d o v e r n i g h t c u l t u r e were l y s e d , phenol e x t r a c t e d , and the plasmid DNA was ethanol p r e c i p i t a t e d as d e s c r i b e d (113). The p r e c i p i t a t e d p e l l e t was d r i e d under vacuum, then resuspended i n 100 u l of s t e r i l e HO. 5 u l of DNase-free p a n c r e a t i c RNase was then added and the 2 o s o l u t i o n incubated at 37 C f o r 15 min. Next, 31 u l of 7.5 M ammonium acetate and 300 u l of i s o p r o p a n o l were added and the tubes placed on i c e f o r 15 min. to allow the plasmid DNA to p r e c i p i t a t e . The tubes were then spun f o r 10 min. at f u l l speed i n an Eppendorf c e n t r i f u g e , the p e l l e t was resuspended i n the r e q u i r e d volume of s t e r i l e H 0 (not exceeding 50 u l ) and used as 2 needed. i i i ) B_j_ 3 u b t i l i s plasmid DNA Plasmids from B_j_ s u b t i l i s were p u r i f i e d by cesium-c h l o r i d e d e n s i t y g r a d i e n t c e n t r i f u g a t i o n a f t e r the c e l l s were lysed using a sodium dodecyl s u l f a t e / N a C l procedure as d e s c r i b e d by Gryczan (114). Overnight c u l t u r e s of B_j_ s u b t i l i s were used to i n o c u l a t e 1 l i t r e volumes of L u r i a broth plus the o app r o p r i a t e a n t i b i o t i c s . C u l t u r e s were grown at 37 c with a e r a t i o n f o r 6 hr., a f t e r which the c e l l s were harvested, l y s e d , and the plasmid DNA prepared f o r d e n s i t y g r a d i e n t u l t r a c e n t r i f u g a t i o n (114). C e n t r i f u g a t i o n was at 108,000 x g 42 f o r 3 6 hr. i n a Beckman 70 T i r o t o r . Bands corresponding to plasmid DNA were removed and t r e a t e d as de s c r i b e d f o r E_^  c o l i plasmid DNA p u r i f i c a t i o n . i v ) B_^  s u b t i l i s chromosomal DNA. B. s u b t i l i s 168 was grown i n 1 1 of L u r i a broth f o r 8 hr. o at 37 C. C e l l s were harvested, converted to p r o t o p l a s t s , l y s e d , and the chromosomal DNA spooled out as de s c r i b e d by Rodriguez e_t a_l. (115). Chromosomal DNA was resuspended i n TE b u f f e r (10 mM TRIS-C1, pH 8.0; 1 mM EDTA) to a f i n a l c o n c e n t r a t i o n of 1 mg/ml. v) Pseudomonas p u t i d a TOL plasmid. Pseudomonas p u t i d a mt-2 c a r r y i n g pWWO (TOL) was grown o with a e r a t i o n at 30 C f o r 12 hr. i n 1 1 of L u r i a b r o t h . C e l l s were harvested and 3 g a l i q u o t s were l y s e d using the S a r k o s y l -deoxycholic a c i d / p o l y e t h y l e n e g l y c o l method of Johnston and Gunsalus (11b). DNA was f r a c t i o n a t e d by e q u i l i b r i u m banding i n cesium c h l o r i d e - e t h i d i u m bromide d e n s i t y g r a d i e n t s as de s c r i b e d (116). S u p e r c o i l e d plasmid DNA was removed with a syri n g e and 18G needle, e x t r a c t e d , and d i a l y z e d as d e s c r i b e d above. 3. Transformation of E_;_ c o l i and s e l e c t i o n of recombinants. E. c o l i HB101 was made competent f o r tr a n s f o r m a t i o n by 43 the CaCl method as d e s c r i b e d by M a n i a t i s e_t al_. (113) but with 2 the f o l l o w i n g m o d i f i c a t i o n s . A s i n g l e colony was used to i n o c u l a t e 1.0 ml of L u r i a broth and grown overnight as a s t a t i o n a r y c u l t u r e . T h i s was then d i l u t e d to 100 ml with f r e s h L u r i a broth and grown to an A of 0.5. Twenty-five ml of t h i s 550 c u l t u r e were harvested by c e n t r i f u g a t i o n at 4000 x g f o r 5 min. i n a S o r v a l SS-34 r o t o r . The c e l l p e l l e t was resuspended i n 12 ml of c o l d CaCl -TRIS-C1 s o l u t i o n (113) and incubated on i c e f o r 2 15 min. The c e l l s were again p e l l e t e d as above and g e n t l y resuspended i n 1.5 ml of c o l d CaCl -TRIS-C1 s o l u t i o n . F i n a l l y , 2 0.2 ml of c e l l s were p i p e t t e d i n t o s t e r i l e 1.8 ml Eppendorf tubes and l e f t on i c e f o r 6-18 h r s . Transformation of these competent c e l l s was c a r r i e d out by a d d i t i o n of 0.1-0.5 ug of p u r i f i e d plasmid DNA or a l i g a t i o n mixture, i n c u b a t i o n of the o c e l l s on i c e f o r 30 min., f o l l o w e d by a 42 C heat shock f o r 2.5 min. F i n a l l y , 1.0 ml of L u r i a broth was added to the transformed o c e l l s and they were allowed to grow f o r 1 hr. at 37 C before p l a t i n g . Transformed c e l l s (0.1 ml) were p l a t e d on L u r i a agar p l a t e s supplemented with the a p p r o p r i a t e a n t i b i o t i c s (50 ug/ml a m p i c i l l i n f o r pBR322 d e r i v a t i v e s ) and allowed to grow o v e r n i g h t o + at 30 C. When s e l e c t i o n was based on the x y l E phenotype, t r a n s -formed c e l l s were p l a t e d , allowed to grow i n t o c o l o n i e s (1-2 mm.) then sprayed with a 0.5 M aqueous s o l u t i o n of c a t e c h o l using 44 an a e r o s o l sprayer. XylE c o l o n i e s turned a b r i g h t yellow c o l o r w i t h i n 15 sec. of s p r a y i n g . S i n g l e recombinant clones were picked, grown i n 2.0 ml of a n t i b i o t i c - s u p p l e m e n t e d L u r i a b r o t h and analyzed f o r plasmid content by the a l k a l i n e l y s i s method desc r i b e d above. 4. Transformation of B. s u b t i l i s . B. s u b t i l i s 168 was made competent and transformed u s i n g a m o d i f i c a t i o n of the method of Dubnau (117, C. P r i c e , p e r s o n a l communication). A l o o p f u l of B_^  s u b t i l i s c e l l s was spread onto a f r e s h TBAB agar p l a t e (1$ Bacto-Tryptone, 0.3$ Beef E x t r a c t , 0.5$ NaCl, 0.5$ glucose, 1.5$ agar, pH 7.2) and grown ove r n i g h t at o 30 C. Three or four c o l o n i e s from t h i s p l a t e were used to i n o c u l a t e 10 ml of pre-warmed C-1 media (0.6$ KH PO , 1.4$ 2 4 K HP0 , 0.1$ Na C H 0 , 0.2$ (NH ) SO , 0.5$ g l u c o s e , 0.13$ 2 4 3 6 5 7 4 2 4 MgSO , 0.02$ Casamino a c i d s , 50 ug/ml tryptophan) i n a 125 ml 4 side-arm f l a s k . T h i s gave a s t a r t i n g o p t i c a l d e n s i t y of about 5 K l e t t u n i t s (Klett-Summerson spectrophotometer, #54 green o f i l t e r ) . The f l a s k was shaken v i g o r o u s l y i n a 37 C water bath and growth followed by t a k i n g K l e t t readings every 30 min. The time at which the c u l t u r e s t a r t e d to d e v i a t e from l o g a r i t h m i c growth was noted and the f l a s k was allowed to continue shaking f o r e x a c t l y 1 hr. beyond t h i s p o i n t . At t h i s time, 0.5 ml of c e l l s was p i p e t t e d i n t o a s t e r i l e 1.8 ml Eppendorf tube, p e l l e t e d by c e n t r i f u g a t i o n at f u l l speed f o r 2 min., and then 45 resuspended i n 1.0 ml of prewarmed C-2 media (as C-1, except that Casamino a c i d s were 0.01} and tryptophan was 5 ug/ml). One-tenth of a ml of c e l l s were t r a n s f e r r e d to 13 x 100 mm. t e s t o tubes, placed on a tube r o l l e r at 37 C, and shaken f o r 40 min. at which time the c e l l s were maximally competent. For subsequent tr a n s f o r m a t i o n by plasmid DNA, the e f f i c i e n c y of t r a n s f o r m a t i o n was enhanced by adding 1 u l of 100 mM EGTA to the competent c e l l s . A f t e r t h i s , 0.5 - 1.0 ug of plasmid DNA was added and the o c e l l s shaken at 37 C f o r another 30 min. To allow e x p r e s s i o n of plasmid genes, 400 u l of L u r i a broth was added to the transformed c e l l s and incubated f o r 1 hr. The t r a n s f o r m a t i o n mixture was then p l a t e d on f r e s h TBAB agar p l a t e s c o n t a i n i n g the r e q u i r e d o a n t i b i o t i c s at 5 ug/ml f i n a l c o n c e n t r a t i o n and incubated at 37 C o v e r n i g h t . 5. Cloning procedures. The recombinant DNA techniques used here were e s s e n t i a l l y as d e s c r i b e d by M a n i a t i s e_t a_l. (113). Minor v a r i a t i o n s w i l l be noted here. i ) R e s t r i c t i o n endonuclease d i g e s t i o n of DNA. R e s t r i c t i o n endonucleases were obtained from New England B i o l a b s or P.L. Biochemicals and were used with the a p p r o p r i a t e 46 b u f f e r s as recommended by the s u p p l i e r . For d e n s i t y g r a d i e n t p u r i f i e d DNA, g e n e r a l l y 5 u n i t s of r e s t r i c t i o n enzyme were used per ug of DNA and incubated f o r 1.5 hr at the a p p r o p r i a t e temperature. For DNA prepared by the a l k a l i n e l y s i s miniprep method, i t was found that more enzyme and longer i n c u b a t i o n times were necessary to g i v e complete d i g e s t i o n . Therefore, i n these cases, 10-15 u n i t s of r e s t r i c t i o n enzyme were used per ug of DNA and i n c u b a t i o n was extended to 2.5-3.0 hr. i i ) B l u n t i n g of 5* and 3' extended ends. DNA r e s t r i c t i o n fragments (1-2 ug) which had 5* extended ends were made f l u s h by the a d d i t i o n of 2 u l of each dNTP (2 mM stock s o l u t i o n ) i n a f i n a l volume of 30 u l . One-tenth volume of 10X Klenow b u f f e r (113) was added, f o l l o w e d by 2 u n i t s of the Klenow fragment of E_;_ c o l i DNA polymerase (New England B l o l a b s ) . The r e a c t i o n was incubated f o r 20 min. at room temperature, a f t e r o which the Klenow enzyme was i n a c t i v a t e d by heating to 65 C f o r 15 min. Fragments (1-2 ug) with 3' extended ends were made f l u s h by a d d i t i o n of T4 DNA polymerase and the a p p r o p r i a t e dNTP e x a c t l y as d e s c r i b e d by M a n i a t i s e_t a_l. (113). i i i ) Dephosphorylation of DNA. In l i g a t i o n r e a c t i o n s where i t was d e s i r e d that v e c t o r s e l f - l i g a t i o n be minimized, the t e r m i n a l 5' phosphates of the 47 vector molecules were removed with c a l f i n t e s t i n a l a l k a l i n e phosphatase. G e n e r a l l y , 22 u n i t s of phosphatase were used per ug of vector DNA. Reaction c o n d i t i o n s and i n a c t i v a t i o n of phosphatase were as d e s c r i b e d by M a n i a t i s e_t al^. (113). i v ) L i g a t i o n c o n d i t i o n s L i g a t i o n s were c a r r i e d out on a t o t a l ( v e c t o r plus i n s e r t ) of 0.5-0.7 ug of DNA where the molar r a t i o of i n s e r t to vector was approximately 1:1. The DNA was resuspended i n 13 u l of s t e r i l e H 0, to which 1.5 u l of 10x l i g a t i o n b u f f e r were 2 added (1x was 50 mM TRIS-C1, pH 7.8; 10 mM MgCl ; 15 mM 2 d i t h i o t h r e i t o l ; 1 mM spermidine; 0.5 mM ATP; 50 ug/ml bovine serum albumin). To t h i s , four u n i t s of T4 DNA l i g a s e (New o England B i o l a b s ) were added and the r e a c t i o n s incubated at 12 C o overnight or 16-18 C f o r 6 h r s . v) Exonuclease Bal-31 r e a c t i o n c o n d i t i o n s . o A l l r e a c t i o n s were c a r r i e d out at 30 C i n a t o t a l volume of 50 u l . Nuclease Bal-31 (New England B i o l a b s ) was used at 1 u n i t per ug of l i n e a r i z e d plasmid DNA under the b u f f e r c o n d i t i o n s s p e c i f i e d by the manufacturer. Incubation time v a r i e d between 30 sec. and 3 min. a f t e r which the r e a c t i o n s were stopped by the a d d i t i o n of c o l d EGTA to a f i n a l c o n c e n t r a t i o n of 0.02 M. Samples were then d i l u t e d 3 times with s t e r i l e H 0 and 2 p r e c i p i t a t e d with 1/10 volume of 3 M sodium acetate (pH 5.0) and 48 2 volumes of 95$ e t h a n o l . S p e c i f i c a p p l i c a t i o n s of Bal-31 exonuclease and f u r t h e r c h a r a c t e r i z a t i o n of DNA w i l l be d i s c u s s e d i n the R e s u l t s . 6. A n a l y t i c a l and p r e p a r a t i v e g e l e l e c t r o p h o r e s i s . i ) Agarose g e l s . S u p e r c o i l e d or r e s t r i c t i o n endonuclease t r e a t e d plasmid DNA was analyzed on agarose " m i n i g e l s " c o n s i s t i n g of e i t h e r 0 . 7$ or 1.0$ agarose (Bio-Rad) i n TBE b u f f e r (0.089 M TRIS Base; 0.089 M b o r i c a c i d ; 0.002 M EDTA), with ethidium bromide added to 0.001$. Gels were c a s t on 5.0x7.5 cm. g l a s s s l i d e s , loaded with DNA mixed i n sample running dye (2x TBE, 50$ g l y c e r o l , 0.25$ xylene cyanole FF, 0.25$ bromophenol b l u e ) , and e l e c t r o p h o r e s e d i n TBE b u f f e r at 60 mA u n t i l the bromophenol blue dye reached the bottom of the g e l DNA was v i s u a l i z e d by p l a c i n g the g e l on a UV t r a n s i l l u m i n a t o r ( U l t r a - V i o l e t Products, I n c . ) . When d e s i r e d , g e l s were photographed with t r a n s m i t t e d UV l i g h t u s ing a Kodak MP-4 camera equipped with a V i v i t a r VMC orange f i l t e r and P o l a r o i d Type 667 f i l m . i i ) P olyacrylamide g e l s Plasmid DNA r e s t r i c t i o n p a t t e r n s were analyzed on n a t i v e polyacrylamide g e l s (180 x 140 x 1.5 mm.) of e i t h e r 4$ or 8$ acrylamide, prepared using a stock s o l u t i o n of acylamide (30% acrylamide: 0.8$ N,N, -methylene b i s a c r y l a m i d e ) i n TBE b u f f e r , 4 9 0.05$ (w/v) ammonium p e r s u l f a t e , and polymerized with 0.1$ (w/v) N,N,N ,N - t e t r a m e t h y l e t h y l i n e diamine. DNA i n bromophenol blue sample running dye (as above) was e l e c t r o p h o r e s e d at 130 v o l t s , then s t a i n e d i n 0.1$ ethidium bromide f o r 15 min. before viewing with a UV t r a n s i l l u m i n a t o r . DNA sequencing g e l s were cast between 200 x 360 x 0.35 mm. g l a s s p l a t e s as d e s c r i b e d above except t h a t the stock acrylamide 1 s o l u t i o n was 43.5$ acrylamide: 1.5$ N,N -methylene b i s a c r y l a m i d e , urea was added to 7 M f i n a l c o n c e n t r a t i o n , and the TBE b u f f e r contained 0.05 M TRIS base, 0.05 M b o r i c a c i d , and 0.001 M EDTA. Samples were mixed with l o a d i n g b u f f e r (40$ formamide, 25 mM EDTA, 0.05$ xylene cyanol FF, 0.05$ bromophenol b l u e ) , denatured by b o i l i n g f o r 2 min., and e l e c t r o p h o r e s e d at 1200 v o l t s . P r o t e i n samples were e l e c t r o p h o r e s e d on sodium dodecyl s u l f a t e (SDS) - polyacrylamide g e l s u s i n g the c o n d i t i o n s and b u f f e r system of Laemmli (118). Gels were e i t h e r 18$ acrylamide or e x p o n e n t i a l g r a d i e n t s from 12$ to 20$ acrylamide with a 3$ s t a c k i n g g e l . Samples were mixed with SDS l o a d i n g b u f f e r (0.005 M TRIS-C1, pH 6.8; 2$ SDS; 0.2$ B-mercaptoethanol; 20$ g l y c e r o l ; 0.25$ bromophenol b l u e ) , b o i l e d f o r 3 min., then e l e c t r o p h o r e s e d at 100-120 v o l t s . Gels were s t a i n e d o v e r n i g h t with Coomassie B r i l l i a n t Blue R, then d e - s t a i n e d with a s o l u t i o n of 25$ g l a c i a l a c e t i c a c i d and 25$ ethanol f o r 6 hr. 50 7. I s o l a t i o n of DNA fragments from g e l s , i ) agarose m i n l g e l s For DNA fragments g r e a t e r than about 500-600 bp, a trough e l u t i o n method was used whereby a s m a l l trough was cut out of the g e l d i r e c t l y i n f r o n t of the l e a d i n g edge of the DNA band. The trough was f i l l e d with TBE b u f f e r and the DNA e l e c t r o p h o r e s e d i n t o i t while f o l l o w i n g i t s progress with a hand-held DV l i g h t source. The recovered DNA was p r e c i p i t a t e d by the a d d i t i o n of 1/10 volumes of 3 M sodium a c e t a t e (pH 5.0) and 2 volumes of 95% o e t h a n o l . A f t e r i n c u b a t i o n at -70 C f o r 30 min. the DNA was p e l l e t e d by c e n t r i f u g a t i o n . The DNA p e l l e t was d r i e d under vacuum and resuspended i n a s m a l l volume of H 0. 2 i i ) p o l y acrylamide g e l s . DNA fragments s m a l l e r than about 500 bp were i s o l a t e d from polyacrylamide g e l s by e x c i s i n g the a p p r o p r i a t e band with a s c a l p e l and chopping the g e l s l i c e i n t o f i n e p i e c e s . The g e l fragments were covered with 0.5 ml of e l u t i o n b u f f e r (0.5 M o ammonium a c e t a t e ; 1 mM EDTA pH 8.0) and placed i n a 65 C water bath o v e r n i g h t . The b u f f e r was then removed and passed through a small plug of c o t t o n to remove s m a l l g e l fragments. The DNA was subsequently recovered from the supernatant b u f f e r by ethanol p r e c i p i t a t i o n as d e s c r i b e d above. 5 1 8. Nu c l e i c a c i d sequencing. The endpoints of Bal-31 generated d e l e t i o n s were sequenced by the chemical method of Maxam and G i l b e r t (119). 32 E i t h e r an EcoRI or BamHI end was r a d i o l a b e l l e d with [ P]dATP 32 or [ P]dGTP r e s p e c t i v e l y , u s ing the Klenow subunit of E_^  c o l i DNA polymerase I. Reaction c o n d i t i o n s were as d e s c r i b e d e a r l i e r except that 10 uCl or the a p p r o p r i a t e l a b e l l e d n u c l e o t i d e were used per microgram of DNA. Chemical m o d i f i c a t i o n and cleavage r e a c t i o n s were performed under the c o n d i t i o n s d e s c r i b e d by Maxam and G i l b e r t . Products of the r e a c t i o n s were e l e c t r o p h o r e s e d through 12$ or 20$ po l y a c r y l a m i d e - u r e a g e l s as des c r i b e d above. 9. Autoradiography. Gels with r a d i o l a b e l l e d DNA were placed on g l a s s p l a t e s wrapped with Saran Wrap, then o v e r l a i d with a sheet of 3M o Hi L i t e X-ray f i l m . Gels were kept i n the dark at 4 C f o r the a p p r o p r i a t e time of exposure then developed according to the manufacturer's i n s t r u c t i o n s . To reduce exposure time f o r some g e l s , an i n t e n s i f y i n g screen (Dupont Cronex L i g h t n i n g - P l u s ) was o placed on top of the X-ray f i l m and exposed at -70 C. DNA sequencing g e l s were d r i e d onto Whatman 3 MM f i l t e r paper using a Bio-Rad Slab Gel D r i e r p r i o r to autoradiography. 52 P r o t e i n g e l s were f i r s t subjected to f l u o r o g r a p h y by 3 soaking the g e l i n an autoradiography enhancer (En Hance-Dupont) according to the manufacturer's i n s t r u c t i o n s . Enhanced g e l s were then d r i e d onto f i l t e r paper as d e s c r i b e d above before autoradiography. 10. Southern b l o t t i n g and h y b r i d i z a t i o n of DNA. DNA samples were run on agarose m i n i g e l s as d e s c r i b e d above, photographed, and prepared f o r t r a n s f e r to n i t r o c e l l u l o s e paper ( S c h l e i c h e r and S c h u e l l , BA85) e s s e n t i a l l y as o u t l i n e d by Maniatis e_t a_l. (113). The only d e v i a t i o n from the p u b l i s h e d procedure was that the i n i t i a l a c i d d e p u r i n a t i o n was e l i m i n a t e d . T r a n s f e r was allowed to proceed f o r 6-8 hr., a f t e r which the o n i t r o c e l l u l o s e f i l t e r was baked i n a 65 C oven o v e r n i g h t . H y b r i d i z a t i o n probes were prepared by n i c k t r a n s l a t i o n of i s o l a t e d DNA fragments or plasmids as d e s c r i b e d by M a n i a t i s et^ a l . (113). G e n e r a l l y , 5 u n i t s of c o l i DNA polymerase (New 32 England B i o l a b s ) , 10 uCi of [ P]dCTP and 10 uM of each remaining o dNTP were used per ug of DNA. The r e a c t i o n was incubated at 14 C o f o r 90 min., then terminated by hea t i n g to 65 C. Approximately 1 6 x 10 CPM of probe DNA were used per h y b r i d i z a t i o n r e a c t i o n . H y b r i d i z a t i o n of r a d i o l a b e l l e d probe DNA to 5 3 n i t r o c e l l u l o s e - b o u n d DNA was as d e s c r i b e d by Southern (120). P r e h y b r i d i z a t i o n (6 hr.) and h y b r i d i z a t i o n (18 hr.) r e a c t i o n s o were performed i n h e a t - s e a l a b l e bags at 65 C i n a b u f f e r c o n s i s t i n g of 200 ug/ml F i c o l l , 200 ug/ml p o l y v i n y l p y r r o l i d o n e , 200 ug/ml bovine serum albumin, 10 ug/ml thymidine, 0.25% SDS, 3 x SSC (1x was 0.15 M NaCl, 0.0015 M Na c i t r a t e , pH 7.0). A f t e r h y b r i d i z a t i o n , the n i t r o c e l l u l o s e f i l t e r s were washed four times o i n 2 x SSC plus 0.5% SDS at 65 C and four times i n 2 x SSC, d r i e d b r i e f l y , then o v e r l a i n with X-ray f i l m and autoradiographed as d e s c r i b e d above. 11. C o n s t r u c t i o n of M13-CAT h y b r i d i z a t i o n probes. S i n g l e stranded h y b r i d i z a t i o n probes were c o n s t r u c t e d by c l o n i n g the s t r u c t u r a l gene f o r chloramphenicol a c e t y l t r a n s f e r a s e (CAT) i n t o M13mpl8. A 773 bp TagI r e s t r i c t i o n fragment c o n t a i n i n g the e n t i r e CAT s t r u c t u r a l gene was i s o l a t e d from pBR328 (121) and blunt-ended. M13mpl8 r e p l i c a t i v e form DNA, made as de s c r i b e d by Messing (122) was d i g e s t e d with Smal and l i g a t e d to the TaqI fragment under the r e a c t i o n c o n d i t i o n s given above. The l i g a t i o n mixture was used to t r a n s f e c t E_j_ c o l l JM101 which had been CaCl - t r e a t e d as d e s c r i b e d above. Both o r i e n t a t i o n s of 2 the 773 bp CAT gene were obtained i n t h i s way and the clone corresponding to the " r e v e r s e " o r i e n t a t i o n ( i . e . non-complementary to the mRNA) was used as the blank i n subsequent h y b r i d i z a t i o n r e a c t i o n s . 54 Large q u a n t i t i e s of s i n g l e - s t r a n d e d M13-CAT DNA were prepared by s c a l i n g up the "miniprep" procedure d e s c r i b e d by Messing (122). A 4 1 c u l t u r e of i n f e c t e d JM101 y i e l d e d approximately 2 mg of s i n g l e - s t r a n d e d DNA as determined s p e c t r o p h o t o m e t r i c a l l y (1 A = 40 ug/ml s i n g l e - s t r a n d e d DNA). 260 12. RNA - DNA h y b r i d i z a t i o n s . 3 i ) i s o l a t i o n of [ H ] - l a b e l l e d RNA. The procedure of D a n i e l s and Bertrand (123) was f o l l o w e d . Plasmid-containing d e r i v a t i v e s of c o l i HB101 were grown at d i f f e r e n t r a t e s u n t i l a K l e t t value of 20-25 was reached. Ten ml a l i q u o t s of c e l l s were l a b e l l e d f o r 1 min. by a d d i t i o n of 10 uCi 3 of [ 5 , 6 - H] u r i d i n e per ml (45 Ci/mmol, Amersham). In c o r p o r a t i o n was stopped by r a p i d l y pouring the e n t i r e 10 ml c u l t u r e i n t o a Corex tube c o n t a i n i n g an equal volume of crushed, f r o z e n stop s o l u t i o n (10$ w/v sucrose; 20 mM TRIS-C1, pH 7-3; 5 mM MgCl ; 20 mM NaN ; 400 ug chloramphenicol/ml). L a b e l l e d c e l l s 2 3 were harvested by c e n t r i f u g a t i o n , resuspended i n 3 ml of stop s o l u t i o n without sucrose, and 200 ug lysozyme/ml and 10 ug DNase I/ml were added. The c e l l s were then subjected to 4 c y c l e s of f r e e z i n g and thawing and l y s e d by the a d d i t i o n of 35 u l of 3 M sodium acetate (pH 5.0) and 0.15 ml of 10$ (w/v) SDS. A f t e r o heating to 65 C f o r 5 min., the samples were e x t r a c t e d with 4 ml of b u f f e r - s a t u r a t e d phenol. RNA was p r e c i p i t a t e d with 2 volumes 55 of c o l d 95$ e t h a n o l , resuspended i n 1 ml of 0 .3 M sodium a c e t a t e (pH 5.0), p r e c i p i t a t e d again with e t h a n o l and f i n a l l y resuspended i n 0.4 ml of b u f f e r (10 mM TRIS-C1, pH 7.4; 300 mM KCI; 1 mM EDTA). The amount of RNA was q u a n t i t a t e d s p e c t r o p h o t o m e t r i c a l l y 3 (1 A =40 ug/ml RNA) and the i n c o r p o r a t i o n of [ H] - u r i d i n e 260 was determined by p r e c i p i t a t i n g 5-10 ug of RNA with c o l d 5% (w/v) t r i c h l o r o a c e t i c a c i d , c o l l e c t i n g the p r e c i p i t a t e on g l a s s - f i b r e f i l t e r s and counting by l i q u i d s c i n t i l l a t i o n . i i ) p r e p a r a t i o n of s i n g l e - s t r a n d e d (SS) DNA f i l t e r s . Approximately 1.5 mg of SS M13 CAT DNA was d i l u t e d to 10 ml i n 0.1 x SSC and s l o w l y f i l t e r e d through a 115 mm. n i t r o c e l l u l o s e f i l t e r ( S c h l e i c h e r and S c h u e l l , BA85). A f t e r washing with 50 ml of 0.1 X SSC, the f i l t e r was a i r d r i e d , baked o at 65 C overnight and then s m a l l e r (6 mm.) f i l t e r s were punched out using a cork borer. At the c o n c e n t r a t i o n of DNA i n i t i a l l y f i l t e r e d , each 6 mm. f i l t e r was c a l c u l a t e d to c o n t a i n 4 ug of SS M13-CAT DNA. F i l t e r s c o n t a i n i n g lambda ilv.5 DNA were prepared i n e x a c t l y the same way except that the d i l u t e d lambda DNA was denatured by a d d i t i o n of NaOH (0.33 M f i n a l c o n c e n t r a t i o n ) p r i o r to f i l t r a t i o n . In both cases, the extent of DNA r e t e n t i o n to f i l t e r s was assessed by monitoring the A of the i n i t i a l 2 6 0 s o l u t i o n and comparing t h i s to the flow-through f i l t r a t e . 56 3 i i i ) L HJ RNA-DNA h y b r i d i z a t i o n . H y b r i d i z a t i o n s were c a r r i e d out i n 1.8 ml Eppendorr tubes o (0.5 ml r e a c t i o n volume) at 65 C f o r 18 hr. G e n e r a l l y , each r e a c t i o n contained 3 M13-CAT f i l t e r s , 1 "blank" M13-CAT f i l t e r 4 (non-complementary o r i e n t a t i o n ) , and 2x10 CPM of t r i c h l o r o a c e t i c a c i d - p r e c i p i t a b l e r a d i o a c t i v i t y i n 2xSSC plus 0.2$ SDS. F i l t e r s were washed, RNase t r e a t e d and counted i n a toluene-based s c i n t i l l a t i o n f l u i d as desc r i b e d by D a n i e l s and Bertrand (123). Levels of CAT mRNA were c a l c u l a t e d by s u b t r a c t i n g the r a d i o a c t i v i t y bound to blank f i l t e r s from that bound to M13-CAT f i l t e r s and exp r e s s i n g the r e s u l t as a percentage of inp u t t r i c h l o r o a c e t i c a c i d - p r e c i p i t a b l e r a d i o a c t i v i t y . 1 3 - Determination of mRNA h a l f - l i f e . i ) F u n c t i o n a l h a l f - l i f e . E. c o l i HB101 c a r r y i n g the a p p r o p r i a t e plasmid was grown under d i f f e r e n t n u t r i t i o n a l c o n d i t i o n s so as to achieve growth -1 r a t e s of about 0.5 hr. (see s e c t i o n 15 ( i ) below). Ten ml of the a p p r o p r i a t e media was i n o c u l a t e d from an ov e r n i g h t c u l t u r e , o shaken i n a 37 C water bath, and growth monitored with a K l e t t -Summerson spectrophotometer. At a K l e t t value of approximately 40 (Green f i l t e r ) , 0 . 3 ml of the c u l t u r e was added to a pre-35 warmed 1.8 ml Eppendorf tube c o n t a i n i n g 5 uCi of [ S]methionine o and incubated f o r 3 min. at 37 C. At the same time, r i f a m p i c i n 57 (200 ug/ml f i n a l c o n c e n t r a t i o n ) was added to the remainder of the c u l t u r e . 0.3 n l a l i q u o t s were withdrawn at 20 sec. i n t e r v a l s f o r 35 100 s e c , added to 5 uCi of [ S]methionine as before and incubated f o r 3 min. At the end of t h i s l a b e l l i n g p e r i o d , an excess of u n l a b e l l e d methionine (60 ug/ml f i n a l c o n c e n t r a t i o n ) was added to each tube and i n c u b a t i o n was continued f o r 1 min. A f t e r t h i s , the tubes were r a p i d l y c h i l l e d on i c e , c e n t r i f u g e d f o r 3 min., and the c e l l p e l l e t resuspended i n 30 u l of SDS l o a d i n g b u f f e r (see above). Samples were b o i l e d f o r 2 min., son i c a t e d f o r 30 sec. using the m i c r o t i p of a F i s h e r model 300 s o n i c a t o r , b o i l e d f o r another 3 min. and a p p l i e d to an SDS-polyacrylamide g e l i n 20 u l a l i q u o t s . E l e c t r o p h o r e s i s , s t a i n i n g , d e - s t a i n i n g , and autoradiography were as d e s c r i b e d e a r l i e r . i i ) Chemical h a l f - l i f e . Chemical h a l f - l i f e was determined d i r e c t l y by monitoring the decay of h y b r i d i z a b l e CAT mRNA f o l l o w i n g i n h i b i t i o n of t r a n s c r i p t i o n i n i t i a t i o n by r i f a m p i c i n . The method used was e s s e n t i a l l y as d e s c r i b e d by D a n i e l s and Bertrand (123). C u l t u r e s of p l a s m i d - c o n t a i n i n g E_^  c o l i HB101 were grown at d i f f e r e n t growth r a t e s and when a K l e t t value of 20-25 was achieved, the 3 c u l t u r e s were l a b e l l e d f o r 1 min. with 10 uCi of [ H ] u r i d i n e per 3 ml. Further i n c o r p o r a t i o n of [ H ] u r i d i n e i n t o RNA was stopped by a d d i t i o n of 200 ug of r i f a m p i c i n per ml and 0 . 8 ug of u r i d i n e per ml. Ten ml samples of the c u l t u r e were removed immediately p r i o r 58 to, and 30, 60, and 90 sec. a f t e r , r i f a m p i c i n a d d i t i o n and r a p i d l y p i p e t t e d i n t o crushed, f r o z e n stop s o l u t i o n as d e s c r i b e d 3 above. [ H]RNA was e x t r a c t e d as d e s c r i b e d e a r l i e r . The l e v e l s of CAT mRNA were determined by h y b r i d i z a t i o n to f i l t e r - b o u n d M13-CAT SS DNA as d e s c r i b e d above. 14. Plasmid copy number det e r m i n a t i o n . Plasmid copy numbers i n c e l l s growing at d i f f e r e n t r a t e s were determined by the d o t - b l o t h y b r i d i z a t i o n method of Adams and H a t f i e l d (124). P o r t i o n s of the c e l l e x t r a c t used f o r chloramphenicol a c e t y l t r a n s f e r a s e assays (see below) were f i l t e r e d onto n i t r o c e l l u l o s e f i l t e r paper ( S c h l e i c h e r and S c h u e l l , BA 85) u s i n g a Bio-Rad dot b l o t apparatus. A volume equiva l e n t to 10 ug of t o t a l p r o t e i n was f i l t e r e d f o r each i n d i v i d u a l c e l l e x t r a c t . As a standard, d i f f e r e n t known amounts of s o n i c a t e d , denatured pKK232-8 DNA were a l s o placed on the same piece of n i t r o c e l l u l o s e f i l t e r . As a probe, pKK232-8 DNA was f i r s t l i n e a r i z e d with Smal, then nick t r a n s l a t e d as d e s c r i b e d b efore. H y r i d i z a t i o n and washing were performed as d e s c r i b e d f o r Southern b l o t s , u sing a l a r g e excess (2-3 u g / f i l t e r ) of nick t r a n s l a t e d pKK232-8 DNA. F i l t e r s were exposed to X-ray f i l m , then the i n d i v i d u a l dots on the paper were punched out and counted f o r Cerenkov r a d i a t i o n . The amount of plasmid DNA per 10 ug of c e l l e x t r a c t p r o t e i n was then c a l c u l a t e d a f t e r comparison to a standard curve obtained from the known standard 59 DNA. Absolute number of plasmid c o p i e s per c e l l was not c a l c u l a t e d , but i n s t e a d , r e s u l t s were expressed as nanograms of plasmid DNA per microgram of t o t a l p r o t e i n i n the s o n i c a t e d c e l l e x t r a c t . 15. Growth r a t e s t u d i e s and enzyme assays. P l a s m i d - c a r r y i n g s t r a i n s of c o l i HB101 were grown under v a r i o u s n u t r i t i o n a l c o n d i t i o n s so as to achieve a growth -1 r a t e of 0.5 - 1.5 hr . Incubation temperature always remained o constant at 37 C. At the a p p r o p r i a t e c u l t u r e d e n s i t y , c e l l s were harvested and c e l l - f r e e e x t r a c t s prepared i n order that plasmid-encoded enzymatic a c t i v i t y could be assayed. i ) Media and growth c o n d i t i o n s . For a l l experiments, c e l l s were grown i n AB minimal s a l t s media (125) supplemented with a vitamin-amino a c i d mixture (thiamine, 20 ug/ml f i n a l c o n c e n t r a t i o n ; p r o l i n e , 50 ug/ml; l e u c i n e , 50 ug/ml; s e r i n e , 50 ug/ml; t h r e o n i n e , 60 ug/ml; tryptophan, 60 ug/ml; a r g i n i n e , 50 ug/ml; h i s t i d i n e , 50 ug/ml) and e i t h e r chloramphenicol at 50 ug/ml or a m p i c i l l i n at 50 ug/ml depending on the plasmid c a r r i e d by the c e l l s . To achieve d i f f e r e n c e s i n growth r a t e , t h i s media was a l s o supplemented with: 0.4$ ( f i n a l c o n c e n t r a t i o n ) g l u c o s e , 1$ B a c t o - t r y p t o n e , 0.2$ -1 Bacto-yeast e x t r a c t f o r growth r a t e (u) from 1.2-1.6 hr. ; 0.5$ 60 -1 g l y c e r o l , 0.1$ Bacto-yeast e x t r a c t f o r u = 0.9-1.2 hr . ; 0.5$ -1 sodium s u c c i n a t e , o.4$ Bacto-tryptone f o r u = 0.7 - 1.0 hr ; 0.5$ sodium a c e t a t e , 0.1$ Bacto-yeast e x t r a c t f o r u = 0.4 - 0.7 -1 hr . To ensure that a l l c u l t u r e s were i n l o g a r i t h m i c growth at the time a l i q u o t s were taken f o r enzyme assays, the f o l l o w i n g p r o t o c o l was adopted. The a p p r o p r i a t e media was dispensed i n 20 o ml amounts i n t o 250 ml side-arm f l a s k s and kept at 4 C u n t i l use. Meanwhile, a L u r i a broth c u l t u r e of the s t r a i n to be t e s t e d was - 7 s e r i a l l y d i l u t e d to at l e a s t 1 x 1 0 i n the same media i n which subsequent growth was d e s i r e d . These d i l u t i o n s were then o incubated at 37 C f o r 14-18 hr. A f t e r t h i s time, some of the l e s s d i l u t e d c u l t u r e s showed dense growth but those c u l t u r e s of higher d i l u t i o n which presumably had s t a r t e d from only a few c e l l s showed only f a i n t growth. These c e l l s , which were s t i l l i n l o g a r i t h m i c growth were used to i n o c u l a t e the pre-warmed side-arm f l a s k c o n t a i n i n g the same media and grown with v i g o r o u s a e r a t i o n o at 37 C. Growth was monitored u n t i l a K l e t t r e a d i n g of 20 - 3 0 (Green f i l t e r ) was reached, at which p o i n t 15 ml of the c u l t u r e was placed i n t o a 25 ml Corex tube and r a p i d l y c h i l l e d on i c e . The c e l l s were then p e l l e t e d by c e n t r i f u g a t i o n at 4000 x g i n a So r v a l SS-34 r o t o r and assayed f o r enzymatic a c t i v i t y . i i ) Catechol 2,3-dioxygenase assay. The enzyme was assayed e s s e n t i a l l y as d e s c r i b e d by 61 Zukowski e_t al,. (127). The c e l l p e l l e t s were washed once with AP b u f f e r (0.04 M NaHPO , 0.16 M Na HPO , 10$ v/v acetone), then 4 2 4 resuspended i n 4 ml of AP b u f f e r and s o n i c a t e d f o r 1.5 min. ("65" s e t t i n g ) using the intermediate s i z e t i p of a B r o n w i l l B i o s o n i c s o n i c a t o r . A c e l l - f r e e e x t r a c t was prepared by c e n t r i f u g a t i o n at 12,000 x g f o r 15 min. i n a So r v a l SS-34 r o t o r . C a t e c h o l , 2,3-dioxygenase was assayed by adding 25-100 u l of c e l l - f r e e supernatant to a tube c o n t a i n i n g : 2.5 ml H 0, 0.3 ml AP b u f f e r , 2 and 100 u l of a 0.1 M aqueous c a t e c h o l s o l u t i o n . Upon a d d i t i o n of the supernatant, the r e a c t i o n mix was t r a n s f e r r e d to a 1 cm. o path length cuvette and placed i n a temperature c o n t r o l l e d (37 C) dual-beam spectrophotometer. The i n c r e a s e i n absorbance at 375 nm due to conversion of c a t e c h o l to hydroxymuconic semialdehyde was f o l l o w e d . Enyzyme a c t i v i t y was normalized to the p r o t e i n content of the supernatant, as measured by a modified Lowry assay (127). One u n i t of a c t i v i t y was d e f i n e d as a change of 1 x -3 10 A u n i t s per minute per m i l l i g r a m of t o t a l p r o t e i n . 375 i i i ) chloramphenicol a c e t y l t r a n s f e r a s e assay. The method of Shaw (128) was used. C e l l p e l l e t s were washed once with EB b u f f e r (50 mM TRIS-C1, pH 7.8, 30 uM d i t h i o t h r e i t o l ) , resuspended i n 5 ml of EB b u f f e r and c e n t r i f u g e d as described above. A r e a c t i o n mix c o n s i s t i n g of 100 mM TRIS-C l , pH 7.8; 0.1 mM acetyl-CoA; 0.4 mg/ml 5 , 5 ' - d i t h i o b i s - 2 -n i t r o b e n z o i c a c i d ; and 0.1 mM chloramphenicol was made up and 62 used as a blank i n a dual-beam spectrophotometer. One ml of the r e a c t i o n mix was placed i n a second c u v e t t e , allowed to e q u i l -o i b r a t e to 37 C, and 10-50 u l of c e l l - f r e e supernatant was added and the cuvette i n v e r t e d s e v e r a l times to mix the c o n t e n t s . The Increase i n A was followed and chloramphenicol a c e t y l -410 t r a n s f e r a s e a c t i v i t y was normalized to the p r o t e i n content of the supernatant as d e s c r i b e d above. One u n i t of a c t i v i t y was -3 def i n e d as a change of 1 x 10 A u n i t s per minute per 410 m i l l i g r a m of t o t a l p r o t e i n . 63 Chapter 1_ Cloning and exp r e s s i o n of B. s u b t i l i s rrnB promoters i n E. c o l i  I n t r o d u c t i o n This chapter d e s c r i b e s the i s o l a t i o n and c l o n i n g of the promoter r e g i o n from the B_j_ s u b t i l i s rrnB operon as w e l l as the E. c o l i rrnB operon. The i n i t i a l stages of t h i s work were designed to determine whether i n f a c t B_j_ s u b t i l i s rRNA promoters were e x p r e s s i b l e i n E_^  coand i f so, whether t h i s e x p r e s s i o n was growth r a t e dependent i n a manner as had p r e v i o u s l y been shown f o r E_^_ c o l i rRNA promoters (31 , 72, 73). A number of v e g e t a t i v e genes from B^ s u b t i l i s (those recognized by the sigma-43 RNA polymerase) have been expressed i n Ej_ c o l l and Void and Green (107) have shown that the promoter f o r a B_;_ s u b t i l i s tRNA gene c l u s t e r i s a c t i v e in_ v i v o i n E_^ c o l i . While the B_^  s u b t i l i s rrnB promoter r e g i o n i s s t r u c t u r a l l y s i m i l a r to promoters recognized by E_;_ c o l l RNA polymerase (103), i t has not as yet been d i r e c t l y shown that these promoters are t r a n s c r i p t i o n a l l y a c t i v e i n a heterologous c o l i h o st. I t must be noted however, that the d i f f i c u l t i e s encountered by some workers i n c l o n i n g B a c i l l u s rRNA fragments on multicopy plasmids was presumptive evidence that these promoters are a c t i v e i_n v i v o (103). 64 Results Cloning of B_j_ s u b t i l i s rrnB promoters. The plasmid pKM-1 was c o n s t r u c t e d as an e x p r e s s i o n v e c t o r f o r the c l o n i n g of u n u s u a l l y strong promoters (129). I t c o n s i s t s of a promoterless g a l a c t o k i n a s e (galK) gene and an upstream p o l y l i n k e r r e g i o n i n t o which promoter-bearing fragments can be i n s e r t e d . The presence of promoters i n s e r t e d i n t o the p o l y l i n k e r can be detected by a c t i v a t i o n of the galK gene. F i n a l l y , the lambda-phage tR1 t r a n s c r i p t i o n t e r minator was placed between the p o l y l i n k e r and the galK gene. This i s a weak, rho-dependent terminator which allows only about 5-10$ of the upstream t r a n s c r i p t s to read through (129). Previous attempts at c l o n i n g rRNA or other strong promoters on multicopy plasmids i n E.  c o l i were u n s u c c e s s f u l because of severe plasmid i n s t a b i l i t y (130). Presumably, t h i s was due to i n t e r f e r e n c e with plasmid r e p l i c a t i o n because t r a n s c r i p t s emanating from the cloned promoters could read-through i n t o the o r i r e g i o n . Terminator-c o n t a i n i n g v e c t o r s are t h e r e f o r e necessary as a means of pre-venting read-through t r a n s c r i p t i o n from h i g h - a c t i v i t y promoters and thereby enhancing plasmid s t a b i l i t y . Using pKM-1, Stewart and Bott (103) cloned two contiguous EcoRI r e s t r i c t i o n fragments of approximately 1900 and 1100 bp 65 from the 5' end of the B_^  s u b t i l i s rrnB operon, to create pGS227. By sequencing, the l a r g e r fragment was found to con t a i n the rrnB tandem promoters as w e l l as about 1200 bp upstream of them. The plasmid pGS227 was d i g e s t e d with EcoRI, the 1900 bp promoter fragment i s o l a t e d and subcloned i n t o the EcoRI s i t e of pKM-1 to give pHD1.8 (see F i g . 1A). Most of t h i s 1900 bp fragment had been sequenced by Stewart and Bott (103) and i t was found to contain a s i n g l e BstE11 r e s t r i c t i o n s i t e l o c a t e d 123 bp beyond the s t a r t of the 16S RNA coding sequence, about 1400 bp from the 5' end of the fragment (see F i g . 3 A ) . T h i s asymmetrically l o c a t e d BstE11 s i t e and a P s t l s i t e l o c a t e d 754 bp upstream of the EcoRI c l o n i n g s i t e of pKM-1 (129) were used to o r i e n t the i n s e r t r e l a t i v e to the galK gene on pKM-1. Simultaneous d i g e s t i o n with BstEl1 and P s t l would be expected to produce fragments of 2154 bp and 4046 bp i f the i n s e r t was o r i e n t e d such that the tandem promoters i n i t i a t e d t r a n s c r i p t i o n i n t o the galK gene, and fragments of 1320 bp and 4880 bp i f the reverse o r i e n t a t i o n was c o r r e c t . As seen i n F i g . 1B, two fragments of about 2000 bp and 4000 bp were produced, i n d i c a t i n g that the former o r i e n t a t i o n was c o r r e c t . Although t r a n s c r i p t i o n proceeded i n t o the galK gene i f the rRNA promoters were a c t i v e i j i v i v o , no i n d i c a t i o n of galK expression was observed i n E_j_ c o l l s t r a i n C110 (galK ) transformed with pHD1 .8. This was assessed by growth of transformants on e i t h e r McConkey-galactose or EMB-galactose Figure 1. Structure and ori e n t a t i o n of pHD1.8. A. Structure of pHD1.8. A 1900 bp EcoRI fragment from pGS227 (103) was cloned into the EcoRI s i t e of pKM-1. The s t a r t of the 16S RNA coding region i s indicated. The lambda t R l t r a n s c r i p t i o n terminator i s shown proximal to the galK gene. Abbreviations: P, P s t l ; E, EcoRI; B, BstEII; H, H i n d l l l . B. Orientation of the 1900 bp in s e r t . Lane A - pHD1.8 undigested, Lane B - pHD1.8 digested with EcoRI, Lane C - pGS227 digested with EcoRI. Digested DNA was electrophoreses through a 1% agarose gel. The p o s i t i o n of the 1900 bp EcoRI rrnB fragment i s indicated. Lane D - pHD1.8 digested with P s t l and BstEII, Lane E - 029 digested with H i n d l l l as molecular weight markers. Digested DNA was electrophoresed through a 1.2% agarose g e l . Size of the 029 fragments, i n base p a i r s , i s indicated on the r i g h t . The presence of two fragments of 2154 and 4046 bp i n Lane D was used to derive the or i e n t a t i o n of the 1900 bp i n s e r t (see t e x t ) . 67 16 S H R1 .HD1.8 gal K B B C D E -1900 68 i n d i c a t o r media. Therefore i t was reasoned that e i t h e r the promoters were not f u n c t i o n a l i n t h i s system, or some downstream element, e i t h e r i n the 16S RNA p o r t i o n of the cloned i n s e r t or i n the lambda terminator placed before the galK s t r u c t u r a l gene, was preventing expression of the g a l a c t o k i n a s e p r o t e i n . In order to f a c i l i t a t e f u r t h e r manipulations of the B a c i l l u s rrnB promoter elements, the pHD1.8 i n s e r t was used as a source of s m a l l e r DNA fragments c a r r y i n g only the rRNA promoters, and a d i f f e r e n t expression vector was chosen. This e x p r e s s i o n v e c t o r was the plasmid pKK232-8 (131) which d i f f e r e d from pKM-1 i n that i t c a r r i e d a promoterless chloramphenicol a c e t y l t r a n s f e r a s e (CAT) gene and i t d i d not r e q u i r e an i n t e r n a l t r a n s c r i p t i o n t e r m i n a t o r to maintain plasmid s t a b i l i t y . Instead, a set of h i g h l y e f f i c i e n t terminators d e r i v e d from the E_;_ c o l i rrnB operon had been placed at the 3' end of the CAT gene so as to prevent read-through t r a n s c r i p t i o n i n t o the plasmid o r i r e g i o n ( F i g . 2 ) . Furthermore, t r a n s c r i p t i o n t e r m i n a t o r s had been placed upstream of the CAT gene so as to prevent nascent t r a n s c r i p t s emanating from the pBR322 p o r t i o n of the v e c t o r from reading through i n t o the CAT gene. A m u l t i p l e c l o n i n g s i t e p o l y l i n k e r placed between the upstream terminator and the CAT gene provided a means of i n s e r t i n g DNA fragments. The CAT gene encoded the enzyme chloramphenicol a c e t y l t r a n s f e r a s e which i n a c t i v a t e d the a n t i b i o t i c chloramphenicol by an a c e t y l a t i o n r e a c t i o n (128). Since t h i s gene lacked a f u n c t i o n a l promoter but r e t a i n e d the Pv Figure 2. Structure of pKK232-8. Stippled areas denote sequences derived from pBR322. 5S, T l , T2 re f e r to the 5S RNA gene and the downstream T l and T2 t r a n s c r i p t i o n terminators derived from the E . c o l i rrnB operon. The promoterless chloramphenicol acetyltransferase (CAT) gene i s shown as "CamS". Multiple cloning s i t e s proximal to the CAT gene are used for i n s e r t i o n of promoter fragments to give a chloramphenicol resistance phenotype. Note the presence of an a d d i t i o n a l t r a n s c r i p t i o n terminator (Tl) proximal to the multiple cloning s i t e s . Abbreviations: Ps, P s t l ; E, EcoRI; S, Smal; B, BamHI; Sa, S a i l , H, H i n d l l l ; Pv, Pvul. 70 necessary t r a n s l a t i o n a l s i g n a l s , the i n s e r t i o n of promoter fragments r e s u l t e d i n expression of the CAT gene which was manifested as the a b i l i t y of recombinant c e l l s to grow i n the presence of chloramphenicol. A number of smaller promoter-containing fragments were i s o l a t e d from the rRNA i n s e r t of pHD1.8 by making use of r e s t r i c t i o n s i t e s p r e d i c t e d from the known DNA sequence (103). These were cloned i n t o the Smal s i t e of pKK232-8 and recombinants were s e l e c t e d on L u r i a agar c o n t a i n i n g 50 ug/ml ch l o r a m p h e n i c o l . Only clones c o n t a i n i n g a f u n c t i o n a l promoter i n the proper o r i e n t a t i o n were s e l e c t e d by t h i s p r o t o c o l . The presence of cloned i n s e r t s could be v e r i f i e d by i s o l a t i n g plasmid DNA and d i g e s t i n g with EcoRI and BamHI to l i b e r a t e the i n s e r t (see f o r example F i g . 4 ). A schematic r e p r e s e n t a t i o n of the v a r i o u s rrnB promoter clones i s o l a t e d from pHD1.8 i s gi v e n i n F i g . 3 A . As w e l l , the r e l e v a n t DNA sequence of t h i s r e g i o n of the B_j_ s u b t i l i s  rrnB operon i s shown i n F i g . 3 B . Note that throughout t h i s work the nomenclature of plasmids i s as f o l l o w s : KK r e f e r s to a CAT-based v e c t o r , the number corresponds to the s i z e of the i n s e r t i n base p a i r s , and Ec or B i n d i c a t e whether the i n s e r t was d e r i v e d from E_j_ c o l i or B^ s u b t i l l s r e s p e c t i v e l y . The plasmid pKK-427B was de r i v e d by d i g e s t i n g the pHD1.8 i n s e r t with Ddel and S a u 9 6 l ( p o s i t i o n s 700 to 1127, Fig.3B), i s o l a t i n g a 427 bp fragment con-t a i n i n g the tandem rRNA promoters and c l o n i n g t h i s i n t o pKK232-8. This 427 bp fragment i n c l u d e d 218 bp of DNA upstream of the 71 Figure 3. Origin and sequence of B . s u b t i l i s promoter fragments. A - A schematic diagram of the B . s u b t i l i s rrnB promoter fragments. The top l i n e represents the 2.9 Kb EcoRI fragments from the rrnB operon cloned i n pKM-1 to give pGS227 (see r e f . 103). The middle l i n e shows the 1.9 Kb EcoRI fragment subcloned i n pKM-1 to give pHD1.8. The -35, -10 regions of the tandem promoters are indicated by small f i l l e d boxes. The s t a r t p o i n t and d i r e c t i o n of t r a n s c r i p t i o n from PI and P2 are indicated by arrows. The double l i n e represents the 16S RNA coding region. Numbering corresponds to that given by Stewart and Bott (103) where 1 i s the f i r s t base of the 5' EcoRI s i t e . The lower part of the fig u r e represents the various promoter fragments cloned into pKK232-8 as described i n the text. B - Base sequence of the B . s u b t i l i s rrnB promoter region. Sequence as determined by Stewart and Bott (103). The -35 and -10 regions of PI and P2 are underlined and the s t a r t p o i n t of tr a n s c r i p t i o n i s indicated by arrows. The H i n d i s i t e at p o s i t i o n 982 was used to i s o l a t e the s i n g l e PI promoter on pKK-282B and the endpoints of the pKK-285B and pKK-220B de l e t i o n fragments are indicated at positions 842 and 907 respectively. The Dral s i t e s at positions 879 and 1090 were used to construct pKK-211B while the Sau96I s i t e at p o s i t i o n 1127 represents the 3' endpoint of pKK-427B, pKK-220B, and pKK-285B. The sequence around PI marked "stri n g e n t " has homology to the region which may be involved i n stringent control and the sequence marked "stem" i s part of a p o s t - t r a n s c r i p t i o n a l RNaselll processing s i t e (see t e x t ) . 72 Eco R1 1 BstE11 P1-P2 | EcoRI i 16 S EcoRI 23 S '—A Ddel B 700 Oral 842 907 879 PI P2 H i n d i i Oral 1 Sau96l 982 1090 n27 BstEII i 1313 pKK — 427 B pKK - 282 B p K K - 2 2 0 B pKK — 211 B p K K - 2 8 5 B -vA-J 1800 C T T T A A T G C T C C C C T T G T G G T C A T C A G T A T T T A G T T C C T T T C A C A T A C A A G A A A A C G A A A A A A A " I 706 C A A C A A C A T C A C A T G A C T G A T C T A T A T G T T ' C T T T T A A C A A A C T T A T A T G A T A C A C A C C C T T T A C A - 2 8 5 i Dra1 A A A T C A T O G C C A G G A T T A T A G T T T A T T T C T T T T A T A C A T T T T T T T T A A A A A A C T A T T G C A A T A A I A-220 j->pi 879 A T A A A T A C A G G T G T T A T A T T A T T A A A C G T C G C T G A T C C A C A G C G C A C A C A A C T A C A T G C T T C A A 907 Stringent L P 2 H i n d i W A A C A A C T T G A A A A A A G T T G T T C A C A A A A A A G A A G C T G A A T G T T A T A T T A G T A A A G C T G C T T C A T I 982 T C A G A A G T A A C G A A A T G A T C T T T C A A A A C T A A A C A A G A C A A A A C G T A C C T G T T A A T T C A G T T T T I STEM 1 Dral Sau96l T A A A A A T C G C A C T G C G A T G T G C G T A T C A T C A A A C A G G G C C T C C A C G A C G C A C G T C A C A C A G G T G 1090 1127 T C G C C G C A C G A T G C G C T G A A C T T A A C C T G T G A T C C A T T T A T C G G A C A G T T T G A T C T T G G C T C A G I m16S • 1217 73 P1 t r a n s c r i p t i o n s t a r t s i t e and 112 bp downstream of the P2 i n i t i a t i o n s i t e . Some of these upstream sequences were d e l e t e d by d i g e s t i n g pKK-427B with EcoRI, t r e a t i n g with Bal-31 exonuclease, and r e l e a s i n g the shortened promoter fragments with BamHI . These d e l e t e d fragments were i s o l a t e d and cloned i n t o the Smal s i t e of pKK232-8 as b e f o r e . By sequencing v a r i o u s c h l o r a m p h e n i c o l - r e s i s t a n t clones (G.B. Spiegelman, p e r s o n a l communication) one was found which r e t a i n e d only the tandem P1-P2 promoters as w e l l as the A-T r i c h sequence immediately upstream of P1. This clone, pKK-285B, t h e r e f o r e had the same 3' sequences as pKK-427B but only r e t a i n e d 76 bp of DNA 5' to the P1 promoter ( F i g . 3A,B). F i n a l l y , the plasmid pKK-211B a l s o c a r r i e d the tandem rRNA promoters (as a 211 bp D r a l fragment from p o s i t i o n s 879 to 1090, F i g . 3A,B) but here sequences both 5 1 and 3' to the promoter had been removed. This fragment r e t a i n e d only 45 bp upstream of P1 and 71 bp downstream of P2 ( F i g . 3 B ) . The tandem P1-P2 promoters were a l s o separated and i n d i v i d u a l l y cloned onto pKK232-8, again by s e l e c t i n g f o r f u n c t i o n a l e x p r e s s i o n as i n d i c a t e d by the appearance of chloramphenicol r e s i s t a n c e . I n i t i a l l y , the 427 bp i n s e r t from PKK-427B was di g e s t e d with H i n d i and a 282 bp fragment whose 3' terminus ended i n the -35 re g i o n of the P2 promoter was i s o l a t e d and subcioned. The r e s u l t a n t plasmid (pKK-282B, F i g . 3A,B) contained only a f u n c t i o n a l P1 promoter. A d e r i v a t i v e c o n t a i n i n g 74 Figure 4. Promoter i n s e r t s _ i n pKK232-8 and t h e i r e l e c t r o p h o r e t i c mobility. Top - Lanes A and B, pKK427B digested with EcoRI and BamHI; Lane C, pKK-220B digested with EcoRI and BamHI; Lane D, pKK232-8 vector digested with EcoRI and BamHI; Lane E, 029 digested with H i n d l l l as molecular weight markers. Sizes of the marker fragments, i n base p a i r s , are shown at r i g h t . Digests were run on 4% polyacrylamide gels i n Tris-borate-EDTA buffer. Note the presence of the 427 bp (Pl-P2).iand 220 bp (P2) promoter i n s e r t s i n pKK-427B and pKK-220B. The actual s i z e of these fragments i s 437 bp and 230 bp because cloning into the Smal s i t e of pKK232-8 and subsequent l i b e r a t i o n of the fragment with EcoRI and BamHI re s u l t s i n the addition of 10 extra base pa i r s derived from the multiple cloning s i t e p o l y l i n k e r of pKK232-8. The remaining two bands of 300 bp and 180 bp i n Lanes A - D are derived from the pKK232-8 vector. Bottom - A semilogarithmic p l o t of gel mobility vs. the fragment length based on the above fi g u r e . The s o l i d dots are the molecular weight markers from 170 bp to 1091 bp. The cross represents the 427 bp promoter fragment (taken as 437 bp for measurement purposes) and the open square i s the 220 bp (or 230 bp) promoter fragment. A B C D E 427 220 1272 1091 727 600 454 2 74 170 1 J i i i 10 20 30 40 50 60 M I G R A T I O N D I S T A N C E (mm.) 76 only the P2 promoter was obtained by sequencing a s e t of Bal-31 generated d e l e t i o n fragments as d e s c r i b e d above. One was found (pKK-220B, F i g . 3A,B) i n which the -35 r e g i o n of P1 had been d e l e t e d , thereby i n a c t i v a t i n g t h i s promoter and l e a v i n g only the downstream P2 promoter i n t a c t . The e l e c t r o p h o r e t i c m o b i l i t y of some of these B_j_ s u b t i l i s promoter i n s e r t s r e l a t i v e to DNA fragments of known s i z e was determined and i s g r a p h i c a l l y represented i n F i g . 4. As can be seen, the a c t u a l s i z e of these fragments, as judged by polyacrylamide g e l e l e c t r o p h o r e s i s , i s very c l o s e to that c a l c u l a t e d from the known DNA sequence. T h i s i n d i c a t e s that these fragments do not d i s p l a y an anomolous e l e c t r o p h o r e t i c behaviour. Because the o b j e c t i v e was to be able to compare the i n  v i v o a c t i v i t i e s of B_^  s u b t i l i s and E_j_ c o l i rRNA promoters, the analogous promoter fragments from the E_j_ c o l i rrnB operon were a l s o i s o l a t e d and cloned onto pKK232-8. The plasmid pKK10-2, con s t r u c t e d by B r o s i u s (132), contained a 1600 bp fragment of DNA de r i v e d from the c o l i rrnB operon. pKK10-2 was d i g e s t e d with TaqI and a 292bp fragment c o n t a i n i n g the tandem P1-P2 promoters was i s o l a t e d . This fragment c o n t a i n s 101 bp of DNA upstream of P1 and 68 bp downstream of P2 (see r e f . 133 and F i g . 5 f o r sequence). I n s e r t i o n of t h i s TaqI fragment i n t o pKK232-8 y i e l d e d pKK-292Ec. Secondly, the c o l i rrnB P1 promoter was i s o l a t e d as a 351 bp H i n f I fragment from pKK10-2 to g i v e pKK-351Ec. The H i n f I r e s t r i c t i o n s i t e s were l o c a t e d 256 bp upstream of P1 and GATTC - 134bp - GTTACGGCTTCGAAACGCTCGAAAAACTGGCAGTTTTAGGCTGA i i H i n f l Taq 1 - 3 5 PI TTTGGTTGAATGTTGCGCGGTCAGAAAATTATTTTAAATTTCCTCTTGTCAGGCCGGAAT +1 -io r*" AACTCCCTATAATGCGCCACCACTGACACGGAACAACGGCAAACACGCCGCCGGGTCAGC i Hha1 - 3 5 P2 GGGGTTCTCCTGACAACTCCGGCAGAGAAAGCAAAAATAAATGCTTGACTCTGTAGCGGG i + 1 Hinf 1 - 10 | - * i BOX B BOX A AAGGCGTATTATGCACACCCCGCGCCGCTGAGAAAAAGCGAAGCGGCACTGGTCTTTAAC i Hha1 BOX C AATTTATCAGACAATCTGTGTGGGCACTCGAAGA - lOObp - 16S RNA Taq 1 Figure 5. Base sequence of the E . c o l i rrnB promoter region. Sequence as determined by Brosius et a l . (21). The -35, -10 region of PI and P2 are overlined and the startpoints and d i r e c t i o n of tr a n s c r i p t i o n are indicated by arrows. Box B, A, and C r e f e r to sequences thought to be required for antitermination of rRNA transcripts (see t e x t ) . R e s t r i c t i o n s i t e s indicated were used i n the i s o l a t i o n of promoter fragments for cloning into pKK232-8 as described i n the text. 78 w i t h i n the -35 region of P2 (133); thus only the E. c o l i P1 promoter was f u n c t i o n a l on pKK-351Ec and represented a c o n s t r u c t e x a c t l y analogous to pKK-282B de s c r i b e d above. The E_;_ c o l i P2 promoter was cloned as a 128 bp Hhal fragment from pKK10-2 to g i v e pKK-128Ec. The 5' end of t h i s fragment was l o c a t e d immediately downstream of the -10 r e g i o n of P1 while the 3' end was 3 bp downstream of the t r a n s c r i p t i o n i n i t i a t i o n s i t e of P2 (133, F i g . 5 ) . F i n a l l y , as a c o n t r o l , a non-ribosomal promoter from E.  c o l i was a l s o used i n these experiments. The 377 bp EcoRI-BamHI fragment from pBR322 which c a r r i e s the promoter f o r the t e t r a c y c l i n e r e s i s t a n c e gene (134) was cloned i n t o pKK232-8 to y i e l d pKK-Tet. A l i s t of a l l plasmids c o n s t r u c t e d as CAT gene f u s i o n s i s given i n Table 2. T a b l e 2 - CAT gene f u s i o n s P l a s m i d P romoter I n s e r t S o u r c e PKK-427B PKK-285B pKK-211B PKK-282B PKK-220B P1-P2 P1-P2, 5' d e l e t i o n P1-P2, S'+S' d e l e t i o n P1 P2 B. s u b t i l i s pKK-292Ec P1-P2 C o l i pKK-351Ec P1 " pKK-128Ec P2 " pKK-Tet r t e t r a c y c l i n e E. c o l i 2. S t a b i l i t y o f C A T - f u s i o n v e c t o r s . The s t a b i l i t y o f v a r i o u s pKK d e r i v a t i v e s was t e s t e d t o a s s e s s the e x t e n t t o which c l o n e d p r o m o t e r i n s e r t s c o u l d be l o s t u n der n o n - s e l e c t i v e c o n d i t i o n s . The pKK d e r i v a t i v e s i n T a b l e 2 were b o t h c h l o r a m p h e n i c o l r e s i s t a n t b e c a u s e o f i n s e r t e d p r o m o t e r s and a m p i c i l l i n r e s i s t a n t b e c a u s e o f the b l a gene on pKK232-8 ( F i g . 2 ) . E. c o l i HB101 c a r r y i n g e i t h e r pKK-427B o r pKK-292Ec was grown f o r 8 h r . i n b r o t h s u p p l e m e n t e d o n l y w i t h a m p i c i l l i n , t h e n d i l u t e d 1 i n 500 i n f r e s h a m p i c i l l i n b r o t h and grown f o r a f u r t h e r 18 h r . Samples from b o t h the 8 h r . and 26 h r . c u l t u r e s were t h e n p l a t e d on media c o n t a i n i n g e i t h e r a m p i c i l l i n o r c h l o r a m p h e n i c o l and r e s i s t a n t c o l o n i e s were c o u n t e d . The number o f c h l o r a m p h e n i c o l r e s i s t a n t c l o n e s (due t o the p r e s e n c e o f a f u n c t i o n a l p r o m o t e r i n s e r t ) was e x p r e s s e d as a p e r c e n t a g e o f t h e a m p i c i l l i n r e s i s t a n t c l o n e s p r e s e n t ( T a b l e 3 ) . r As can be s e e n , the Cm phe n o t y p e was r a p i d l y l o s t u n d e r c o n d i t i o n s t h a t d i d n o t d i r e c t l y s e l e c t f o r t h e m a i n t e n a n c e o f a f u n c t i o n a l p r o m o t e r i n s e r t . I f however, t h e s e c l o n e s were grown c o n t i n u a l l y i n t h e p r e s e n c e o f c h l o r a m p h e n i c o l t h e n a l l c e l l s r e t a i n e d a f u n c t i o n a l p r o m o t e r which was i n d i s t i n g u i s h a b l e , b a s e d on e l e c t r o p h o r e t i c p a t t e r n s i n p o l y a c r y l a m i d e g e l s , f r o m t h e o r i g i n a l c l o n e d p r o m o t e r f r a g m e n t ( d a t a n ot shown). Thus, a l l growth e x p e r i m e n t s w i t h pKK d e r i v a t i v e s were c a r r i e d o u t i n t h e p r e s e n c e o f c h l o r a m p h e n i c o l t o e n s u r e p r o m o t e r s t a b i l i t y . Table 3. S t a b i l i t y of Cmr phenotype. % Cm phenotype 0 hr. 8 hr. 26 hr. pKK-427B 100 61 0.12 pKK-292Ec 100 72 0.80 82 3 . C h a r a c t e r i s t i c s of chloramphenicol a c e t y l t r a n s f e r a s e (CAT) assay. The assay f o r CAT takes advantage of the g e n e r a t i o n of a f r e e CoA s u l f h y d r y l group c o i n c i d e n t with the t r a n s f e r of the a c e t y l group to chloramphenicol c a t a l y z e d by the CAT enzyme. Reaction of the reduced CoA with 5 , 5 ' - d i t h i o b i s - 2 - n i t r o b e n z o i c a c i d y i e l d s , among other products, a molar e q u i v a l e n t of f r e e 5-t h i o - 2 - n i t r o b e n z o a t e which can be measured s p e c t r o p h o t o m e t r i c a l l y at 412 nm (128). To show that the CAT assay was l i n e a r over a range of imput enzyme c o n c e n t r a t i o n s , d i f f e r e n t volumes of HB101/pKK-427B c e l l - f r e e e x t r a c t were added to the standard assay (see M a t e r i a l s and Methods). As shown i n F i g . 6, the CAT assay appeared to deviate s l i g h t l y from l i n e a r i t y only at very high enzyme i n p u t s ; t h e r e f o r e a l l assays were performed using between 5 and 50 u l of c e l l - f r e e e x t r a c t . Chloramphenicol a c e t y l -t r a n s f e r a s e a c t i v i t i e s were expressed as u n i t s (as d e f i n e d i n the M a t e r i a l s and Methods). No r m a l i z a t i o n to t o t a l p r o t e i n r a t h e r than to c e l l number was used because c e l l s grown i n d i f f e r e n t media are of d i f f e r e n t s i z e (135). S o n i c a t i o n was used to d i s r u p t c e l l s because i t was known that c e l l s grown i n d i f f e r e n t media broke with d i f f e r e n t e f f i c i e n c i e s u s ing other breakage methods (136). 2 0 4 0 6 0 8 0 V O L U M E E X T R A C T { u l } 100 F i g . 6. L i n e a r i t y of chloramphenicol acetyltransferase assay. Chloramphenicol acetyltransferase (CAT) a c t i v i t y was determined as described i n the Materials and Methods from d i f f e r e n t volumes of c e l l - f r e e extract. Extracts were prepared from E. c o l i HB101 carrying pKK-211B. CAT a c t i v i t y here i s shown as the increase i n A ^ 2 P e r minute. To convert t h i s to the units of CAT a c t i v i t y as defined i n the Materials and Methods, the A 4 1 2 increase per minute was divided by 13.6 (Ref. 128) and then expressed on a per milligram of t o t a l protein basis. 84 4. Expression of E_;_ c o l i rrnB promoters at d i f f e r e n t growth r a t e s . The c o l i HB101 host c a r r y i n g e i t h e r pKK -292Ec, pKK-351Ec, or pKK-128Ec was grown i n d i f f e r e n t media so as to achieve a range of growth r a t e s , then c e l l s were harvested and assayed f o r CAT a c t i v i t y . As seen i n F i g . 7, the l e v e l of CAT s p e c i f i c a c t i v i t y due to t r a n s c r i p t i o n from the E_^  c o l i P1-P2 tandem rRNA promoters i n c r e a s e d with a steep p o s i t i v e slope at i n c r e a s i n g growth r a t e s . This was c h a r a c t e r i s t i c of rRNA s y n t h e s i s i n general (26) showing t h a t , as expected, these promoters were regulated i n a growth r a t e dependent manner. Furthermore, F i g . 8 shows that only the upstream P1 promoter of t h i s p a i r was growth rate r e g u l a t e d whereas expression of the P2 promoter was at an o v e r a l l lower l e v e l and did not i n c r e a s e with i n c r e a s i n g growth r a t e . As a c o n t r o l , the r e s u l t s f o r pKK-Tet ( F i g . 9) i n d i c a t e d that t h i s non-ribosomal promoter d i d not show any growth r a t e dependent changes and o v e r a l l e x p r e s s i o n was much lower when compared to the rRNA promoters. 5. Expression of B_;_ s u b t i l i s rrnB promoters i n E_^  c o l i . The r e s u l t s f o r the EL_ s u b t i l i s rrnB-CAT f u s i o n s , expressed i n the heterologous E_^ c o l i HB101 host, are shown i n F i g u r e s 10 to 13. The tandem rrnB P1-P2 promoters (pKK-427B, F i g . 10) showed the steep p o s i t i v e slope with i n c r e a s i n g growth r a t e ' 85 * « t i i i i i i i i 1 i 0 . 5 1.0 G R O W T H R A T E ( D O U B L I N G S / H R . } Figure 7. CAT a c t i v i t y vs. growth rate: pKK-292Ec i n E . c o l i HB101. Chloramphenicol acetyltransferase s p e c i f i c a c t i v i t y was measured as a function of c e l l u l a r growth rate as described i n the Materials and Methods. The slope, of t h e . l i n e was determined by l i n e a r regression. pKK-292Ec represents the tandem P1-P2 E . c o l i rrnB promoter. Figure 8. CAT a c t i v i t y vs. growth rate: pKK-351Ec, pKK-128Ec i n E . c o l i HB101. c i r c l e s , E . c o l i rrnB sin g l e upstream (PI) promoter on pKK-351Ec. tr i a n g l e s , E . c o l i rrnB downstream (P2) promoter on pKK-128Ec. Slopes were determined by l i n e a r regression. 0.5 1.0 G R O W T H R A T E ( D O U B L I N G S / H R . ) Figure 9. CAT a c t i v i t y vs. growth rate: pKK-Tet i n E . c o l i HB101. pKK-Tet represents the pBR322 t e t r a c y c l i n e resistance promoter cloned i n pKK232-8. Slope was derived by l i n e a r regression. 88 i n d i c a t i v e of a c l a s s i c a l growth r a t e dependent response. The same response was seen f o r two other clones which d i f f e r e d from pKK-427B i n the amount of 5' and 3' f l a n k i n g DNA remaining (pKK-285B, pKK-211B; F i g . 11 and 12). T h i s suggested that sequences at l e a s t beyond -83 r e l a t i v e to the P1 t r a n s c r i p t i o n s t a r t s i t e and beyond +77 r e l a t i v e to P2 were not r e q u i r e d to e l i c i t the growth rate dependent response. I t was noted that the slope of the l i n e determined f o r pKK-211B was s l i g h t l y g r e a t e r than that f o r pKK-427B or pKK-285B. The reason f o r t h i s i s un c l e a r but i s probabaly not due to a d i f f e r e n c e i n t r a n s l a t i o n a l e f f i c i e n c y because of the a l t e r e d 3' end of t h i s c o n s t r u c t i o n (see below). F i n a l l y , F i g . 13 i l l u s t r a t e s the r e s u l t s obtained f o r the separated promoters of the rrnB P1-P2 p a i r . Here i t appeared that the downstream P2 promoter (pKK-220B) was under growth r a t e dependent c o n t r o l s i n c e the l e v e l of CAT s p e c i f i c a c t i v i t y i n c r e a s e d d r a m a t i c a l l y with i n c r e a s i n g growth r a t e . In c o n t r a s t , the P1 promoter (pKK-282B) was t r a n s c r i p t i o n a l l y much l e s s a c t i v e and constant over the growth rate range t e s t e d . 6. Measurement of CAT mRNA, mRNA h a l f - l i f e , and plasmid copy number. As mentioned p r e v i o u s l y (see L i t e r a t u r e Review), operon f u s i o n systems i n gene r a l can be s u b j e c t to a number of a r t i f a c t s 8 Figure 10. CAT a c t i v i t y vs. growth rate: pKK-427B i n E . c o l i HB101. Chloramphenicol acetyltransferase s p e c i f i c a c t i v i t y was measured as before and slopes were calculated by l i n e a r regression. pKK-427B represents the tandem B . s u b t i l i s rrnB promoters cloned i n pKK232-8. Figure 11. .CAT.activity vs. growth r a t e : pKK-285B i n E . c o l i HB101. pKK-285B represents the P1-P2 tandem B . s u b t i l i s promoters with 5' flanking DNA deleted. 91 Figure 12. CAT a c t i v i t y vs. growth rate: pKK-211B i n E . c o l i HB101. pKK-211B represents the P1-P2 B . s u b t i l i s promoter with 5' and 3' flanking sequences deleted. • 8 > 4 i i i i i i J I L J I 0.5 1.0 GROWTH RATE (D O U B LI N G S / H R.} Figure 13. CAT a c t i v i t y vs. growth rate: pKK-282B, pKK-220B i n E . c o l i HB101. The c i r c l e s represent pKK-220B (single B . s u b t i l i s P2 promoter); triangles represent pKK-282B (single B . s u b t i l i s P l promoter). 93 which c o u l d p o t e n t i a l l y r e s u l t i n e r r o n e o u s c o n c l u s i o n s . T h e r e f o r e , s e v e r a l e x p e r i m e n t s were c a r r i e d o ut t o e n s u r e t h a t the o b s e r v e d g r o w t h r a t e d e pendent i n c r e a s e i n CAT s p e c i f i c a c t i v i t y was an a c c u r a t e r e f l e c t i o n o f the i n v i v o t r a n s c r i p t i o n a l a c t i v i t y o f t h e c l o n e d B a c i l l u s rRNA p r o m o t e r s . The l e v e l o f CAT messenger RNA was d i r e c t l y measured by 3 h y b r i d i z a t i o n o f [ H] u r i d i n e l a b e l l e d RNA t o f i l t e r - b o u n d M13 DNA c a r r y i n g a CAT gene i n s e r t . B o t h o r i e n t a t i o n s o f t h e c l o n e d i n s e r t were o b t a i n e d , as shown i n F i g . 14. The M13 c l o n e c a r r y i n g CAT DNA comp l e m e n t a r y t o mRNA was h y b r i d i z e d i n e x c e s s t o l a b e l l e d t o t a l RNA e x t r a c t e d f r o m p K K - c o n t a i n i n g c e l l s grown a t d i f f e r e n t r a t e s . The r e s u l t s f o r pKK-211B and pKK-427B ( F i g . 15) show t h a t C A T - s p e c i f i c mRNA i n c r e a s e d i n a growth r a t e dependent manner as d i d CAT s p e c i f i c a c t i v i t y as shown above. The r a t i o o f CAT mRNA t o CAT p r o t e i n f o r pKK-427B, pKK-285B, and pKK-211B was e s s e n t i a l l y c o n s t a n t o v e r the gr o w t h r a t e r a n g e t e s t e d (compare F i g s . 10, 11, and 12 t o F i g . 15) i n d i c a t i n g t h a t t h e r e were p r o b a b l y no d i f f e r e n t i a l t r a n s l a t i o n e f f e c t s w i t h c h a n g i n g growth r a t e . In a d d i t i o n t o m e a s u r i n g CAT mRNA, the r a t e o f c o l i r i b o s o m a l RNA s y n t h e s i s i t s e l f was d i r e c t l y measured i n s t r a i n s c a r r y i n g pKK d e r i v a t i v e s . L a b e l l e d RNA was e x t r a c t e d as b e f o r e and h y b r i d i z e d t o d e n a t u r e d lambda i l v 5 DNA bound t o n i t r o c e l l u l o s e f i l t e r s . T h i s phage c a r r i e d a s i n g l e copy o f a 9 4 Figure 14. Cons t r u c t i o n and o r i e n t a t i o n of M13-CAT h y b r i d i z a t i o n probes. A - 0.7% agarose g e l w i t h 2 i n d i v i d u a l M13-CAT clones. Lanes 1 and 3, M13-CAT-4; Lanes 2 and 4, M13-CAT-5. Recombinant M13 DNA i s the heavy band near the top of the g e l . This g e l was b l o t t e d onto n i t r o c e l l u l o s e paper which was then cut to separate lanes 1 and 2 from lanes 3 and 4. B - autoradiograph of Southern b l o t i n F i g . 14A a f t e r h y b r i d i z a t i o n w i t h probe DNA. Probe DNA was prepared by d i g e s t i n g pKK232-8 wi t h EcoRI, l a b e l l i n g the 3' recessed end w i t h a32P-dATP, r e d i g e s t i n g w i t h H i n d l l l and i s o l a t i n g the l a r g e v e c t o r p o r t i o n away from the 300 bp E c o R l - H i n d l l l fragment (see F i g . 2 ) . The vecto r p o r t i o n and the 300 bp E c o R l - H i n d l l l fragment were thus each l a b e l l e d only at one end. Lanes 1 and 2 were probed w i t h the l a b e l l e d v e c t o r DNA while lanes 3 and 4 were probed w i t h the 300 bp fragment. The r e s u l t s i n d i c a t e that M13-CAT-4 and -5 represent clones c a r r y i n g the CAT gene i n two d i f f e r e n t o r i e n t a t i o n s w i t h M13-CAT-5 being i n the o r i e n t a t i o n complementary to CAT mRNA. Figure 15. Amount of CAT mRNA vs. growth rate. CAT mRNA was measured by f i l t e r h y b r i d i z a t i o n to si n g l e stranded M13-CAT-5 DNA. The amount of CAT mRNA i s expressed as a percentage of the t o t a l input r a d i o a c t i v i t y which bound to CAT DNA f i l t e r s , a f t e r correction for background. The c i r c l e s represent values obtained f o r pKK-427B and the squares are values for pKK-21lB. The slope of the l i n e was obtained by l i n e a r regression. 96 complete E. c o l i rRNA t r a n s c r i p t i o n a l u n i t (137). The r e s u l t ( F i g . 16) i n d i c a t e s t h a t , as expected, the r a t e of rRNA s y n t h e s i s i n c r e a s e d with growth rate and suggested that the presence i n these c e l l s of multicopy plasmids c a r r y i n g i s o l a t e d rRNA promoters was not d i s r u p t i v e to o v e r a l l rRNA s y n t h e s i s or to the c e l l u l a r mechanisms governing growth r a t e dependent r e g u l a t i o n . I t had a l s o been shown that the h a l f - l i v e s of some messenger RNA's could vary g r e a t l y as c e l l u l a r growth r a t e changed (138). To e l i m i n a t e the p o s s i b i l i t y that an i n c r e a s e i n mRNA s t a b i l i t y at high growth r a t e s was r e s p o n s i b l e f o r the in c r e a s e i n CAT message seen above, the chemical and f u n c t i o n a l h a l f - l i f e of CAT mRNA was measured at high and low growth r a t e s . The f u n c t i o n a l h a l f - l i f e was assessed by l a b e l l i n g t o t a l c e l l u l a r 35 p r o t e i n with [ S]methionine at v a r i o u s times a f t e r i n h i b i t i o n of t r a n s c r i p t i o n with r i f a m p i c i n . As seen i n F i g . 17 there d i d not appear to be a la r g e d i f f e r e n c e i n the r a t e of decay of CAT mRNA at high and low growth r a t e s , with h a l f - l i v e s i n both c o n d i t i o n s being l e s s that 2 min. A more accurate estimate of CAT mRNA h a l f - l i f e was obtained by monitoring the decay of h y b r i d i z a b l e CAT mRNA f o l l o w i n g i n h i b i t i o n of t r a n s c r i p t i o n by r i f a m p i c i n . The r e s u l t s i n F i g . 18 i n d i c a t e that the CAT mRNA from pKK-427B had a chemical h a l f - l i f e of approximately 43 sec. i n slow growing c e l l s and 30 sec. i n f a s t e r growing c e l l s . Thus, CAT-mRNA was s l i g h t l y more l a b i l e under f a s t e r growth c o n d i t i o n s suggesting 97 Figure 16. Measurement of t o t a l ribosomal RNA vs. growth rate. E . c o l i HBl01/pKK-427B was grown with a growth rate of 1.1 doublings per hr. T o t a l r a d i o l a b e l l e d RNA was extracted and hybridized to f i l t e r bound lambda i l v 5 DNA under conditions of DNA excess. The amount of rRNA i s expressed as a percentage of the t o t a l input r a d i o a c t i v i t y which bound to lambda i l v 5 f i l t e r s , a f t e r correction for background. The slope of the l i n e was determined by l i n e a r regression. 98 Figure 17. Determination of CAT mRNA fun c t i o n a l h a l f - l i f e : CAT protein a n a l y s i s . Top - Total c e l l u l a r protein electrophoresed through a 12-20% SDS-polyacrylamide gradient gel and stained with Coomassie B r i l l i a n t Blue R. Lane 1, E . c o l i HB101/pKK-427B grown as a stationary overnight culture; Lane 2, E . c o l i HB101/pKK-427B grown under aeration and harvested when i n logarithmic growth ( A 6 6 q = 0.6); Lane 3, E . c o l i HB 10l/pKK232-8, stationary overnight culture; Lane 4, E . c o l i HB101/pKK232-8, logarithmic culture; Lane 5, standard molecular weight markers. Sizes are noted at r i g h t , i n k i l o d a l t o n s . The po s i t i o n of the CAT protein i n the str a i n s carrying promoter-CAT fusions (Lanes 1 and 2) i s indicated by the large arrow. Note that s t r a i n s carrying plasmids without a promoter i n s e r t (Lanes 3 and 4) do not show detectable CAT protein. Bottom - Time course of functional messenger RNA decay a f t e r a r r e s t of t r a n s c r i p t i o n . E . c o l i HB101 carrying pKK-427B was grown at two d i f f e r e n t rates and t o t a l c e l l u l a r proteins were r a d i o l a b e l l e d at various times a f t e r t r a n s c r i p t i o n was i n h i b i t e d by r i f a m p i c i n (see Materials and Methods). Proteins were electrophoresed through an 18% SDS-polyacrylamide gel and autoradiographed. A, fast growth conditions (1.1 doublings per h r . ) . Lane 1, E . c o l i HB101/pKK232-8 (negative c o n t r o l ) ; Lane 2, E . c o l i HB101/ pKK427B, 0 sec. a f t e r r i f a m p i c i n addition; Lanes 3 - 6 , 2,4,7, 10 min. a f t e r r i f a m p i c i n addition, r e s p e c t i v e l y . B, slow growth conditions (0.50 doublings per h r . ) . Lane 1, E . c o l i HB101/pKK-427B, • 0 sec. a f t e r r i f a m p i c i n addition; Lanes 2 - 5, 2,4,7, and 10 min. a f t e r r i f a m p i c i n addition; Lane 6, E . c o l i HBl01/pKK232-8 (negative c o n t r o l ) . Note that under both f a s t and slow growth conditions, very l i t t l e CAT protein i s synthesized beyond 2 min. a f t e r i n h i b i t i o n of mRNA t r a n s c r i p t i o n . 1 2 3 4 5 100 that the data i n F i g . 10 may tend to underestimate the growth r a t e dependent response of the B_j_ s u b t i l i s rrnB promoters. F i n a l l y , s i n c e p K K 2 3 2 - 8 i s a multicopy plasmid (131), the p o s s i b i l i t y that extreme f l u c t u a t i o n i n plasmid copy number with v a r y i n g growth r a t e could mimic a growth r a t e dependent response was c o n s i d e r e d . Others have found that growth c o n d i t i o n s and s t r e n g t h s of i n s e r t e d promoters could s i g n i f i c a n t l y a f f e c t the plasmid copy number (124, 139). T h e r e f o r e , an estimate of the amount of plasmid DNA per u n i t of t o t a l c e l l u l a r p r o t e i n was obtained f o r s e v e r a l clones using a d o t - b l o t h y b r i d i z a t i o n assay. An example of such a h y b r i d i z a t i o n assay i s shown i n F i g . 19A. P l o t t i n g the counts per minute obtained from a known input of DNA (standard curve - F i g . 19B) gave a s t r a i g h t l i n e r e l a t i o n s h i p at a l l c o n c e n t r a t i o n s , i n d i c a t i n g that the amount of r a d i o l a b e l l e d probe DNA added to the h y b r i d i z a t i o n r e a c t i o n was i n excess of that r e q u i r e d to h y b r i d i z e to a l l a v a i l a b l e f i l t e r -bound DNA. The r e s u l t s f o r pKK-427B ( F i g . 20) i n d i c a t e that while there was a s l i g h t o v e r a l l i n c r e a s e i n the amount of plasmid DNA as growth r a t e i n c r e a s e d , t h i s was not l a r g e enough to account f o r the i n c r e a s e seen i n CAT mRNA or CAT s p e c i f i c a c t i v i t y shown e a r l i e r . Measurements f o r other pKK clones gave s i m i l a r r e s u l t s (data not shown). D i s c u s s i o n Figure 18. Chemical h a l f - l i f e of CAT mRNA vs. growth rate. The chemical h a l f - l i f e of CAT mRNA was measured by h y b r i d i z a t i o n to f i l t e r bound M13-CAT-5 DNA as described i n the Materials and Methods. The r e s u l t s are expressed as the percentage of t o t a l input r a d i o a c t i v i t y which bound to CAT DNA f i l t e r s at d i f f e r e n t times a f t e r i n h i b i t i o n of t r a n s c r i p t i o n by ri f a m p i c i n . Values are for pKK-427B. The closed squares ( s o l i d l i n e ) represent c e l l s grown at f a s t rates (0.97 doublings per h r . ) . The open squares (dashed l i n e ) represent slower growing c e l l s (0.55 doublings per h r . ) . The calculated mRNA h a l f - l i v e s are 30 sec. and 43 s e c , res p e c t i v e l y . 102 Figure 19. Plasmid copy number determination by dot-blot h y b r i d i z a t i o n analysis. A - Crude c e l l - f r e e extracts of E. c o l i HB101 carrying various pKK derivatives were b l o t t e d onto n i t r o c e l l u l o s e paper using a dot-blot apparatus. In row A, a volume of extract equivalent to 10 ug of t o t a l protein was used i n each case. Each spot represents a d i f f e r e n t sample of c e l l - f r e e extract, derived from c e l l s grown at d i f f e r e n t rates, and are shown for i l l u s t r a t i v e purposes only. In row B, d i f f e r e n t amounts of p u r i f i e d pKK232-8 DNA were blotted. Row B Lane 1, 0 ng; Lane 2, 0.1 ng; Lane 3, 0.2 ng; Lane 4, 0.4 ng; Lane 5, 0.6 ng; Lane 6, 0.8 ng; Lane 7, 1.0 ng; Lane 8, 1.2 ng; Lane 9, 1.4 ng; Lane 10, 0 ng. The f i l t e r was hybridized to an excess of l a b e l l e d pKK232-8 DNA and autoradiographed. B - Standard plasmid curve. In d i v i d u a l dots corresponding to row B, Lanes 1 to 9 were punched out and counted f or Cherenkov r a d i a t i o n . Counts per minute are p l o t t e d versus the amount of pKK232-8 DNA loaded per lane. The s t r a i g h t l i n e r e l a t i o n s h i p indicated that the probe DNA was i n excess. 0 3 . 1 0 . 0 5 .01 J 1 1 I I i i i i i 0 . 5 1 i 0 G R O W T H R A T E ( D O U B L I N G S / H R . ) Figure 20. Amount of plasmid DNA vs. growth rate. Values are for pKK-427B. The r e s u l t s were interpolated from the standard plasmid DNA curve shown i n F i g . 19B. Results are expressed as the amount of plasmid DNA per microgram of t o t a l protein i n the c e l l - f r e e extract. 105 In t h i s s e c t i o n i t has been demonstrated that the promoters f o r the 3 u b t l l i s rrnB ribosomal RNA operon can e f f i c i e n t l y i n i t i a t e t r a n s c r i p t i o n of a fused gene when placed i n a heterologous c o l i host. When compared to the n a t i v e E_^  c o l i rRNA promoters both d i f f e r e n c e s and s i m i l a r i t i e s i n the p a t t e r n of r e g u l a t i o n as a f u n c t i o n of changing growth r a t e could be d i s c e r n e d . The experimental approach taken here i n v o l v e d the c o n s t r u c t i o n of t r a n s c r i p t i o n a l f u s i o n systems such that the promoter of i n t e r e s t d i r e c t e d the t r a n s c r i p t i o n of a fused, promoterless gene whose product could be e a s i l y and q u a n t i t a t i v e l y assayed. This approach has proven v a l u a b l e i n the a n a l y s i s of a v a r i e t y of promoters whose n a t i v e gene products were d i f f i c u l t or inconvenient to assay (see r e f . 6 7 f o r rev i e w ) . In the case of ribosomal RNA operons, the rRNA product could p o t e n t i a l l y be d i r e c t l y measured i n B a c i l l u s by RNA-DNA h y b r i d i z a t i o n but t h i s approach would be time-consuming and would measure only g l o b a l rRNA s y n t h e s i s r a t h e r than the exp r e s s i o n from a given i n d i v i d u a l operon. As w i l l be d i s c u s s e d below, the a l t e r n a t i v e approach ( i . e . the study of cloned rRNA promoters as part of an operon f u s i o n system) i s both a convenient and v a l i d means of addressing t h i s problem. In t h i s work, two analogous s e t s of promoter f u s i o n s were c o n s t r u c t e d . In the f i r s t , the tandem (P1-P2) promoters, as we l l as the i n d i v i d u a l separated P1 and P2 promoters from the c o l i 1 0 6 rrnB operon were cloned i n t o the ex p r e s s i o n v e c t o r pKK232-8, and i n the second, the P 1 - P 2 , P 1 , and P 2 promoters from the B.  s u b t i l i s rrnB operon were s i m i l a r l y c l o n e d . The ve c t o r pKK232-8 was chosen f o r a number of reasons. I t was s p e c i f i c a l l y c o nstructed to f a c i l i t a t e the c l o n i n g of unu s u a l l y strong promoters by i n c o r p o r a t i n g e f f i c i e n t t r a n s c r i p t i o n t e r m i n a t i o n s i g n a l s 3' to the fused gene ( 1 3 1 ) . Thus, the s t a b i l i t y problems normally a s s o c i a t e d with attempts to clone rRNA promoters should be overcome. Furthermore, the presence of cloned promoters could be e a s i l y detected by a c t i v a t i o n of the chloramphenicol a c e t y l t r a n s f e r a s e gene and t h i s enzyme could be q u a n t i t i v e l y assayed. F i n a l l y , d i r e c t s e l e c t i v e pressure could be placed on a l l c e l l s to ensure maintenance of the cloned promoter simply by supplementing the growth media with chloramphenicol. Using pKK232-8 t h e r e f o r e , a number of promoter fragments d e r i v e d from the B . s u b t i l i s rrnB operon have been s u c c e s s f u l l y cloned. In a d d i t i o n , problems with i n s e r t s t a b i l i t y were e l i m i n a t e d as long as chloramphenicol s e l e c t i v e pressure was maintained. Regulation of E_;_ c o l i rrnB promoters. When c e l l s c a r r y i n g the E_^  c o l i rrnB - CAT f u s i o n s were grown at d i f f e r e n t r a t e s , the l e v e l of CAT enzyme i n c r e a s e d i n a growth rate dependent manner. Conversely, CAT gene e x p r e s s i o n d i r e c t e d by the c o n s t i t u t i v e t e t r a c y c l i n e - r e s i s t a n c e gene promoter was e s s e n t i a l l y constant at a l l growth r a t e s . 1 0 7 Furthermore, the growth r a t e dependent response was seen only when the tandem rrnB P1-P2 promoters or the s i n g l e upstream P1 promoter, was fused to the CAT gene. These r e s u l t s i n d i c a t e that the P1 promoter of the rrnB operon appears to be s o l e l y r e s p o n s i b l e f o r the growth r a t e dependent iri v i v o s y n t h e s i s of rRNA, as shown p r e v i o u s l y by a number of workers (31, 7 3 , 7 4 ) . The downstream P2 promoter on the other hand, showed markedly reduced exp r e s s i o n at a l l growth r a t e s with no o v e r a l l change as growth r a t e i n c r e a s e d . The exact r o l e of P2 remains u n c l e a r , although Sarmientos e_t a_l. ( 7 4 ) have suggested that i t could be r e s p o n s i b l e f o r the bulk of rRNA s y n t h e s i s during c o n d i t i o n s of very slow growth. I n t e r e s t i n g l y , some of the data shown here appear to be at variance with that reported by Gourse e^ a_l. (31). They have shown that the a c t i v i t y of a c o n s t r u c t c o n t a i n i n g both P1 and P2 was higher at a low growth r a t e than the a c t i v i t y of a c o n s t r u c t c o n t a i n i n g only P1 at the same growth r a t e ; t h e r e f o r e the slope of a c t i v i t y vs. growth rate f o r the P1-P2 c o n s t r u c t was not as steep as that of the P1 c o n s t r u c t a l o n e . In the data presented here however, the slope of the a c t i v i t y vs. growth r a t e p l o t f o r the P1-P2 f u s i o n (pKK-292Ec) i s g r e a t e r than the slope of the P1 f u s i o n alone (pKK-351Ec). A comparison of F i g u r e s 7 and 8 f o r example, shows that the a c t i v i t y of the P1-P2 f u s i o n at a growth rate of 0.5 doublings per hr. was about one-half that of the P1 f u s i o n at the same growth r a t e . At high growth r a t e s however, 1 0 8 the s i t u a t i o n was reversed, with the P1 f u s i o n g i v i n g s l i g h t l y l e s s a c t i v i t y than the tandem P1-P2 f u s i o n . In f a c t , at high growth r a t e s , the a c t i v i t i e s of P1 and P2 appeared to be a d d i t i v e , i . e . the a d d i t i o n of the P1 a c t i v i t y to the P2 a c t i v i t y i n F i g . 8 g i v e s a l e v e l comparable to that seen f o r P1-P2 i n F i g . 7 at high growth r a t e s . The reason f o r the discrepancy between these data and that of Gourse e_t al. (31) i s not c l e a r although there are s e v e r a l p o s s i b i l i t i e s . In t h e i r study, Gourse et_ §_1. compared the expression of the i s o l a t e d P1 and P2 promoters from the E_^  c o l i  rrnB operon to that of the tandem P1-P2 promoters from r r n E ; i t i s p o s s i b l e t h e r e f o r e that s u b t l e r e g u l a t o r y d i f f e r e n c e s e x i s t between the seven rRNA operons i n E_;_ c o l i , although there i s no precedent to suggest that t h i s i s so. A l t e r n a t i v e l y , the f u s i o n s used here were based on multicopy plasmids while Gourse e_t a l . cons t r u c t e d s i n g l e copy lysogens based on lambda phage. Although i t has been shown here that plasmid copy number did not vary s i g n i f i c a n t l y with growth rate (see below) there may be other d i f f e r e n c e s between these two systems which i n f l u e n c e how cloned genes are expressed. I t i s d i f f i c u l t to f u l l y assess the v a l i d i t y of the data of Gourse et_ a_l. s i n c e they d i d not rep o r t mRNA h a l f - l i f e changes or mRNA t r a n s l a t i o n a l e f f i c i e n c i e s at d i f f e r e n t growth r a t e s from t h e i r lambda-based e x p r e s s i o n system. 109 The data presented here imply that the expre s s i o n of the E. c o l i Pl promoter i s i n h i b i t e d at low growth r a t e s by the presence of the P2 promoter i n the tandem P1-P2 arrangement. When the two promoters were separated, the i n h i b i t i o n of P1 was rele a s e d and expression i n c r e a s e d about 2 - f o l d at lower growth r a t e s . At high growth r a t e s however, no such i n h i b i t o r y e f f e c t s were observed. From the p e r s p e c t i v e of g l o b a l rRNA r e g u l a t i o n , t h i s type of mechanism would seem to be advantageous since at low growth ra t e s very l i t t l e rRNA s y n t h e s i s i s r e q u i r e d ; t h e r e f o r e the P2 promoter (or sequences i n p r o x i m i t y to i t ) would act by i n h i b i t i n g t r a n s c r i p t i o n from the major growth r a t e r e g u l a t e d promoter ( P l ) while at the same time d i r e c t i n g t r a n s c r i p t i o n of the rRNA genes so as to maintain a b a s a l l e v e l of rRNA s y n t h e s i s . When environmental c o n d i t i o n s s i g n a l the need f o r more rRNA s y n t h e s i s , the i n h i b i t i o n of P1 could be r e l e a s e d and rRNA could be synthesized i n a growth r a t e dependent manner u n t i l at high growth r a t e s maximal s y n t h e s i s i s achieved by the combined expre s s i o n of P1 plus P2. The f i n d i n g of Sarmientos and Cashel (74) that c e l l s r e c o v e r i n g from s t a t i o n a r y phase show a burst of P2 t r a n s c r i p t i o n a l a c t i v i t y followed by a slower i n c r e a s e i n P1 expression does not n e c e s s a r i l y c o n t r a d i c t t h i s model s i n c e the above d i s c u s s i o n i 3 based on slowly growing, not s t a t i o n a r y c e l l s , and the physi o l o g y of a c u l t u r e i n s t a t i o n a r y phase i s at best only poorly understood. I n t e r e s t i n g l y , the r e s u l t s obtained f o r the cloned B_j_ s u b t i l i s rRNA promoters showed a s i m i l a r 110 o v e r a l l trend to that seen f o r the E_^  c o l i rRNA promoters, although the r e l a t i v e r o l e s of P1 vs. P2 were reversed (see below). Regulation of B_;_ s u b t i l i s rrnB promoters i n L c o l i . A 1 .9 Kb fragment d e r i v e d from the 5 ' end of the B.  s u b t i l i s rrnB operon was i n i t i a l l y cloned i n t o pKM-1, a galK-based expression v e c t o r . Although t h i s fragment was o r i e n t e d so as to d i r e c t t r a n s c r i p t i o n i n t o the galK gene, no obvious galK phenotype could be de t e c t e d . The reason f o r the lack of galK expression i s not c l e a r , but, assuming that the B_^  s u b t i l i s rrnB promoters are t r a n s c r i p t i o n a l l y a c t i v e i n t h i s host, i t co u l d r e f l e c t the presence of l a t e n t t r a n s c r i p t i o n t e r m i n a t i o n s i t e s w i t h i n the 16S RNA coding sequence present on t h i s fragment. By analogy, L i e_t a_l. (44) have shown that sequences w i t h i n the E.  c o l i rrnB 16S rRNA coding r e g i o n can act as e f f i c i e n t t r a n s c r i p t i o n t erminators i f cloned such that they are i n r e v e r s e to t h e i r normal wild-type o r i e n t a t i o n . That the B_;_ s u b t i l i s promoters on t h i s cloned 1 .9 Kb fragment are s t i l l recognized by B a c i l l u s RNA polymerase has been shown by V. Webb (Ph.D. t h e s i s , U n i v e r s i t y of B r i t i s h Columbia, 1986) who used pHD1.8 as w e l l as the separated promoter c l o n e s as templates f o r in v i t r o t r a n s c r i p t i o n r e a c t i o n s . Thus, the c l o n i n g and t r a n s f e r of t h i s p o r t i o n of the B^ s u b t i l i s rrnB operon to I l l E. c o l i h a 3 probably not a l t e r e d the promoters such that they are no longer f u n c t i o n a l i n B_;_ s u b t i l i s . Using the cloned i n s e r t on pHD1.8 as a source of DNA fragments, sm a l l e r rrnB promoter fragments were i s o l a t e d and cloned onto the e x p r e s s i o n v e c t o r , pKK232-8. The l a r g e s t of these fragments (pKK-U2?B) s t i l l r e t a i n e d 220 bp of DNA upstream of the P1 t r a n s c r i p t i o n a l s t a r t s i t e and 114 bp downstream of P2. In two other clones (pKK-285B, pKK-211B), much of the 5' f l a n k i n g DNA was removed by Bal-31 d i g e s t i o n or by r e s t r i c t i o n endonuclease treatment and i n one case only a f u n c t i o n a l P2 promoter remained (pKK-220B). Furthermore, three of these promoter clones maintained the same 3 1 f l a n k i n g sequences (only PKK-211B and pKK-282B did n o t ) . A l t e r a t i o n s w i t h i n the t r a n s c r i b e d but n o n - t r a n s l a t e d r e g i o n of an mRNA t r a n s c r i p t have i n some cases been shown to i n f l u e n c e the s t a b i l i t y of the message (138). In the s t u d i e s d i s c u s s e d here though, any e f f e c t that the 3' region might have on CAT gene e x p r e s s i o n should be c o n s i s t e n t i n three of the operon f u s i o n s and not i n f l u e n c e the comparisons drawn between var i o u s c o n s t r u c t i o n s . F i n a l l y , as seen i n Table 3, CAT f u s i o n plasmids c o n t a i n i n g B_^  s u b t i l i s promoters appeared to be s t a b l e i n E_^  c o l i i n the presence of a d i r e c t s e l e c t i v e p ressure. Unlike other e x p r e s s i o n systems (67, 129) i t can reasonably be assumed here t h a t a l l c e l l s i n the p o p u l a t i o n c a r r y a f u n c t i o n a l and i n t a c t promoter i n s e r t as 112 long as chloramphenicol s e l e c t i o n i s maintained. The f a c t that B_^  s u b t i l i s rRNA promoters could be cloned i n t o p K K 2 3 2 - 8 by s e l e c t i n g f o r the c h l o r a m p h e n i c o l - r e s i s t a n c e phenotype i n d i c a t e s that these promoters are t r a n s c r i p t i o n a l l y a c t i v e i n c o l i . T h i s i s not unexpected s i n c e an examination of the DNA sequence of the P1 and P2 promoter regions r e v e a l s a strong homology to the consensus sequence f o r c o l i promoters ( F i g . 3B, r e f . 17). When the B. s u b t i l i s (P1-P2) - CAT f u s i o n s were tested i n c o l i as a f u n c t i o n of i n c r e a s i n g growth r a t e , a steep i n c r e a s e i n CAT s p e c i f i c a c t i v i t y was seen, i n d i c a t i v e of c l a s s i c a l growth r a t e dependent e x p r e s s i o n ( F i g s . 1 0 , 1 1 , 1 2 ) . However, an operon f u s i o n system such as used here r e p r e s e n t s i n some ways an a r t i f i c i a l system s i n c e the t r a n s l a t i o n product from a multicopy plasmid was measured whereas i n the n a t i v e s t a t e any given rRNA operon e x i s t s as a s i n g l e copy per genome and produces a non - t r a n s l a t e d RNA product. Therefore s e v e r a l experiments were performed to ensure that the observed growth r a t e dependent inc r e a s e i n CAT s p e c i f i c a c t i v i t y was a true r e f l e c t i o n of the i n vivo t r a n s c r i p t i o n a l a c t i v i t y of the cloned B_^  s u b t i l i s promoters. F i r s t l y , to ensure that the amount of CAT enzyme produced a c c u r a t e l y r e f l e c t e d the degree of s y n t h e s i s of CAT mRNA, the amount of CAT mRNA was measured d i r e c t l y at d i f f e r e n t growth r a t e s by h y b r i d i z a t i o n to a C A T - s p e c i f i c probe. The r e s u l t s f o r 1 1 3 three c l o n e s , pKK-427B, pKK-285B, and pKK-211B, showed that CAT mRNA approximately p a r a l l e l e d the in c r e a s e i n CAT p r o t e i n as a f u n c t i o n of growth r a t e (compare F i g s . 10, 11, and 12 to F i g . 15). The e s s e n t i a l l y constant r a t i o s of CAT p r o t e i n to CAT mRNA i n these examples would imply that there were no grea t d i f f e r e n c e s i n t r a n s l a t i o n a l e f f i c i e n c y which could p o s s i b l y be due to the a l t e r e d 3' end of the pKK-211B cloned fragment. I t was t h e r e f o r e shown that measurements of CAT s p e c i f i c a c t i v i t y although i n d i r e c t , i s a v a l i d means of a s s e s s i n g the t r a n s -c r i p t i o n a l a c t i v i t y of promoters cloned i n t o pKK232-8. Furthermore, the presence i n c e l l s of m u l t i p l e copies of a cloned rRNA promoter does not appear to l i m i t the growth r a t e dependent s y n t h e s i s of rRNA i n g e n e r a l , s i n c e the s y n t h e s i s of t o t a l rRNA, as measured by h y b r i d i z a t i o n to a lambda probe c a r r y i n g a complete c o l l rRNA operon, followed the expected p a t t e r n ( F i g . 16). This would i n d i c a t e that any a n c i l l a r y f a c t o r s that may be requ i r e d to e l i c i t the growth r a t e dependent response are not t i t r a t e d out by the i n c r e a s e d number of rRNA promoters per c e l l . Secondly, i t has been shown that some mRNA's have s i g n i f i c a n t l y d i f f e r e n t h a l f - l i v e s at d i f f e r e n t c e l l u l a r growth r a t e s (138). The f u n c t i o n a l h a l f - l i f e of CAT mRNA was t h e r e f o r e assessed by examining the amount of CAT-protein s y n t h e s i z e d from pKK-427B a f t e r mRNA s y n t h e s i s had been i n h i b i t e d . No d i f f e r e n c e s were apparent between f a s t and slow growing c e l l s ( F i g . 17), implying that the h a l f - l i f e of CAT mRNA was s i m i l a r ( l e s s than 2 114 min.) and that the t r a n s l a t i o n a l e f f i c i e n c y of the pKK-427B CAT mRNA was not a l t e r e d because of d i f f e r e n c e s i n growth r a t e . A more accurate estimate of the CAT mRNA chemical h a l f - l i f e was obtained by h y b r i d i z a t i o n a n a l y s i s ( F i g . 18) and i t was found that the CAT message from pKK-427B was i n f a c t s l i g h t l y l e s s s t a b l e at higher growth r a t e s . This suggests that the CAT s p e c i f i c a c t i v i t y as seen i n F i g . 10 may i n r e a l i t y be even g r e a t e r at higher growth r a t e , thereby a c c e n t u a t i n g the apparent growth r a t e dependent response. F i n a l l y , the r e l a t i v e plasmid copy number of the v a r i o u s c o n s t r u c t i o n s grown at d i f f e r e n t r a t e s has been estimated s i n c e other workers have found that growth c o n d i t i o n s and s t r e n g t h s of i n s e r t e d promoters can s i g n i f i c a n t l y a f f e c t t h i s parameter (124, 139). I t was found that while plasmid copy number does change with growth r a t e , the o v e r a l l trend i s only a s l i g h t i n c r e a s e at higher growth r a t e s , which i s not enough to account f o r the l a r g e i n c r e a s e i n CAT p r o t e i n or CAT mRNA seen f o r the growth r a t e r e g u l a t e d c o n s t r u c t i o n s . The f a c t that pKK-427B was shown both by assay of CAT p r o t e i n and CAT mRNA to be growth r a t e r e g u l a t e d i n E_;_ c o l i i n i t s e l f supports the suggestion that the o v e r a l l c o n t r o l of rRNA s y n t h e s i s i n B a c i l l u s and c o l i i s s i m i l a r (109), s i n c e the fe a t u r e s which govern growth r a t e dependency, e i t h e r at the DNA sequence l e v e l or any re q u i r e d a n c i l l a r y f a c t o r s , appear to be 115 compatible i n both organisms. I t i s l i k e l y t h e r e f o r e that the b a s i c r e g u l a t o r y mechanisms governing the s y n t h e s i s of such key components of the c e l l u l a r t r a n s l a t i o n a l apparatus are h i g h l y conserved from an e v o l u t i o n a r y s t a n d p o i n t . I n t e r e s t i n g l y , the l e v e l of a c t i v i t y from the B a c i l l u s rRNA promoters was at l e a s t as high, i f not g r e a t e r than that seen f o r the analogous c o l i promoters (compare pKK-427B and pKK-292Ec, F i g . 10 and 7) . The reason f o r t h i s i s unclear but may r e f l e c t s u b t l e d i f f e r e n c e s i n the DNA sequence of the -10 and -35 r e g i o n s . The -35 r e g i o n of the B_j_ s u b t i l i s P2 promoter f o r i n s t a n c e , i s more homologous to the c o l i "consensus" sequence (17) than are the analogous regions of e i t h e r P1 or P2 from the c o l i rrnB operon. As w e l l , the B_^  s u b t i l i s promoters seem to have a more optimal spacing between the -10 and -35 r e g i o n s . Whether these d i f f e r e n c e s alone are enough to confer a g r e a t e r o v e r a l l l e v e l of a c t i v i t y upon the B_;_ s u b t i l i s promoters i s unknown. I t i s c l e a r t h at there are a l s o d i f f e r e n c e s i n the o v e r a l l l e v e l of expression (but not i n the trend of growth r a t e dependency) when the three clones c a r r y i n g the B_j_ s u b t i l i s tandem P1-P2 promoters are compared ( F i g . 10, 11, 12). Both pKK-285B and pKK-211B reach higher maximum l e v e l s of a c t i v i t y than does 116 pKK-427B. The pKK-211B c o n s t r u c t i o n was d e l e t e d both 5' and 3' to the tandem promoters, so the argument could be made that the a l t e r a t i o n of the 3 1 end could p o s s i b l y change the t r a n s l a t i o n a l e f f i c i e n c y of t h i s CAT mRNA such that higher s p e c i f i c enzyme a c t i v i t i e s are seen. However, the pKK-285B clone maintained the same 3' sequence as pKK-427B and was only d e l e t e d 5 1 to the promoter, although to a s l i g h t l y l e s s e r extent than pKK-211B. Here again, a higher absolute l e v e l of a c t i v i t y was seen, implying that t h i s e f f e c t was only due to the ex t e n s i v e 5' d e l e t i o n that occurred between pKK-427B and the other c l o n e s . The reason f o r t h i s i s p r e s e n t l y unknown although the p o s s i b i l i t y e x i s t s that some, as yet u n i d e n t i f i e d , r e g u l a t o r y r e g i o n s are found w i t h i n these f a r upstream sequences. For c o l i rRNA promoters, i t has been shown that an A-T r i c h r e g ion between -51 and -88 r e l a t i v e to the P1 t r a n s c r i p t i o n i n i t i a t i o n s i t e can enhance the o v e r a l l l e v e l of t r a n s c r i p t i o n from P1 by as much as 15-fold (31). S i m i l a r upstream a c t i v a t i o n sequences have been noted f o r other s t a b l e RNA genes (30, 32). In the case of the Bk_ s u b t i l i s rrnB promoters, t h i s r e g i o n can be completely removed ( i n pKK-211B) without any decrease i n t r a n s c r i p t i o n a l a c t i v i t y . Other workers have noted that DNA fragments c o n t a i n i n g these upstream a c t i v a t i o n elements from c o l i possess anomolous e l e c t r o p h o r e t i c m o b i l i t i e s i n d i c a t i v e of some conformational change i n the DNA brought about 117 by the DNA sequence I t s e l f (30, 31). I t has been shown here that B. s u b t i l i s rrnB DNA fragments c a r r y i n g the analogous sequences upstream of P1 appear to have normal or only very s l i g h t l y a l t e r e d m o b i l i t i e s i n polyacrylamide g e l s ( F i g . 4 ) . Upstream a c t i v a t i o n of rRNA promoters could t h e r e f o r e be a r e f l e c t i o n of c e r t a i n t o p o l o g i c a l f e a t u r e s of the DNA which are seen i n c o l i but not i n B_^  s u b t i l i s rRNA operons, and the presence of an A-T r i c h r e g i o n alone may not be s u f f i c i e n t to enhance downstream t r a n s c r i p t i o n . I t i s c l e a r that the tandem B_^  s u b t i l i s rrnB promoters expressed i n E_j_ c o l i show an o v e r a l l growth r a t e dependency as do the n a t i v e c o l i rRNA promoters while a p p a r e n t l y l a c k i n g an upstream a c t i v a t i o n f e a t u r e . However, more important d i f f e r e n c e s between these two systems become apparent when the e x p r e s s i o n of the i n d i v i d u a l P1 and P2 promoter elements are examined. I t was observed here t h a t , i n c o n t r a s t to the c o l i promoters, the B.  s u b t l l i 3 upstream P1 promoter was not growth r a t e r e g u l a t e d and was only weakly expressed. The B_^  s u b t i l i s downstream P2 pro-moter was the more a c t i v e and growth r a t e r e g u l a t e d promoter of t h i s p a i r . While the P2 promoter fragment used here s t i l l r e -t a i n s the -10 r e g i o n of the P1 promoter, examination of the vec-tor DNA sequences upstream of the 220 bp i n s e r t d i d not r e v e a l a p o t e n t i a l -35 sequence. Therefore the c r i t i c a l r e g i o n f o r growth rate c o n t r o l of the B a c i l l u s rrnB operon would appear to l i e i n a 183 bp re g i o n between p o s i t i o n 907 and 1090 (see F i g . 3B). 118 The l e v e l of e x p r e s s i o n of the i s o l a t e d P2 promoter was almost twice as high at low growth r a t e s compared to the a c t i v i t y of the tandem P1-P2 c o n s t r u c t i o n at the same growth r a t e (compare PKK-220B and pKK-427B at 0.5 d o u b l i n g s / h r . ) . At high growth r a t e s the a c t i v i t y of the P1-P2 p a i r was g r e a t e r and was approximately equal to that obtained i f the a c t i v i t i e s of the i n d i v i d u a l P1 and P2 promoters were summed. The same trend was seen f o r the c o l i promoters except t h a t , as noted above, the responses of P1 and P2 were r e v e r s e d . These r e s u l t s would again tend to imply that t h i s response was not due to some a r t i f a c t w i t h i n the system but could r e f l e c t some r e g u l a t o r y f e a t u r e shared between these two rRNA operons. I m p l i c a t i o n s f o r growth r a t e c o n t r o l models. The r e s u l t s presented above have shown that while the o v e r a l l response to growth r a t e of a B a c i l l u s rRNA promoter in t r o d u c e d i n t o c o l i i s the same as the tandem c o l i promoters, the r e l a t i v e response of the i n d i v i d u a l P1 and P2 promoters i s r e v e r s e d . C l e a r l y t h i s r e s u l t has important i m p l i c a t i o n s i n terms of the mechanistic d e t a i l s of growth r a t e dependent c o n t r o l i n E_;_ c o l i although the data presented here do not allow a d i s t i n c t i o n to be made between any of the c u r r e n t models f o r growth r a t e r e g u l a t i o n . As d i s c u s s e d i n the L i t e r a t u r e Review, three g e n e r a l models have been proposed f o r 119 the r e g u l a t i o n of s t a b l e RNA genes. The p a s s i v e r e g u l a t i o n model of Maaloe (79) i s a t t r a c t i v e because of i t s s i m p l i c i t y but i s i n c o n f l i c t with s e v e r a l experimental o b s e r v a t i o n s . Current debate has t h e r e f o r e centered on which of the remaining models, the d i r e c t e f f e c t o r model of Bremer (78, 79), and Travers (58, 80) or the ribosome feedback model of Nomura (14, 77), i s c o r r e c t . Most evidence appears to fa v o r some type of feedback i n h i b i t i o n mechanism a c t i n g d i r e c t l y on the promoters of rRNA operons (31) although the e f f e c t o r i t s e l f may not be the f r e e ribosomes proposed by Nomura but some other compound r e s p o n s i v e to the l e v e l of f r e e ribosomes. Whether t h i s compound i s ppGpp or some other s i g n a l molecule remains to be seen. The data obtained here with the pKK232-8 operon f u s i o n system do not c u r r e n t l y favor one model over the other although i t may be p o s s i b l e to use t h i s f u s i o n system as a means of t e s t i n g c e r t a i n p r e d i c t i o n s made by both models. For example, i n t r o d u c t i o n of an rrnB-CAT f u s i o n plasmid i n t o c o l i would r e s u l t i n an e f f e c t i v e i n c r e a s e i n the number of rRNA promoters per c e l l but not i n the number of rRNA operons ( s i n c e the cloned promoter fragments do not c o n t a i n any rRNA sequences). This i s analogous to the system de s c r i b e d by Jinks-Robertson e_t a_l. (77) i n which the i n t r o d u c t i o n of e x t r a d e l e t e d copies of rRNA operons f a i l e d to produce a decrease i n the t r a n s c r i p t i o n of chromosomal rRNA operons. The i n t r o d u c t i o n of e x t r a complete rRNA operons on the other hand, r e s u l t e d i n a gene dosage dependent decrease 120 i n o v e r a l l rRNA t r a n s c r i p t i o n from each chromosomal operon. I t would be p r e d i c t e d t h e r e f o r e , that i n t r o d u c t i o n of e x t r a rRNA promoters (i.e.rrnB-CAT f u s i o n plasmids) would not lead to any changes i n the l e v e l of chromosomal rRNA t r a n s c r i p t i o n . As can be seen i n F i g . 16, the i n t r o d u c t i o n of a s u b t i l i s rrnB-CAT f u s i o n i n t o c o l i does not appear to d i m i n i s h the o v e r a l l growth r a t e response of chromosomal rRNA operons although f u r t h e r experiments are necessary to a c c u r a t e l y q u a n t i t a t e the t r a n s c r i p t i o n a l a c t i v i t y of chromosomal rRNA operons under such c o n d i t i o n s . A d d i t i o n a l l y , one could envisage that the i n t r o d u c t i o n of e x t r a complete E. c o l i rRNA operons i n t o a host already c a r r y i n g a B_;_ s u b t i l i s rrnB-CAT f u s i o n plasmid should r e s u l t i n a r e d u c t i o n of the l e v e l of s u b t i l i s rRNA promoter t r a n s c r i p t i o n i f the ribosome feedback model was c o r r e c t . I n t e r e s t i n g l y however, the sequences i d e n t i f i e d by Gourse e_t a l . (31) as being c r i t i c a l f o r both growth r a t e dependent r e g u l a t i o n and feedback i n h i b i t i o n of the E_i. c o l i rrnB operon (-51 to -20 of P1) are not homologous to the e q u i v a l e n t r e g i o n of the B. s u b t i l i s rrnB promoter. The r e s u l t s of the experiments de s c r i b e d above would t h e r e f o r e be d i f f i c u l t to p r e d i c t . Conversely, the d i r e c t e f f e c t o r model would p r e d i c t that ppGpp would i n h i b i t t r a n s c r i p t i o n from the B^ s u b t i l i s rrnB promoters to the extent seen f o r the n a t i v e E^ c o l i rRNA promoters s i n c e both are growth r a t e r e g u l a t e d i n E_s_ c o l i . T h i s could be d i r e c t l y t e s t e d u s i n g the rrnB-CAT f u s i o n plasmids. In 121 t h i s way i t may a l s o be p o s s i b l e to provide some c l u e s as to the i d e n t i t y of the h y p o t h e t i c a l i n t e r m e d i a r y e f f e c t o r molecule which senses f r e e ribosome l e v e l s and subsequently i n t e r a c t s with rRNA promoters, s i n c e t h i s a l t e r n a t i v e to the ribosome feedback model may u l t i m a t e l y prove to be c o r r e c t . As mentioned e a r l i e r , the data presented i n t h i s s e c t i o n are s i g n i f i c a n t from a mechanistic p o i n t of view and must be taken i n t o c o n s i d e r a t i o n when the d e t a i l s of growth r a t e dependent r e g u l a t i o n are e s t a b l i s h e d . For example, the A-T r i c h r e g i o n immediately upstream of many rRNA and tRNA promoters, i n c l u d i n g the B a c i l l u s P1 promoter s t u d i e d here, has long been thought to play a r o l e i n modulating downstream t r a n s c r i p t i o n (64, 65). I t was shown here that t h i s r e gion can be l a r g e l y d e l e t e d with no change i n the a b i l i t y of the tandem promoters to be growth r a t e r e g u l a t e d . In f a c t , the pKK-220B c o n s t r u c t i o n (P2) which i s s t i l l under growth r a t e dependent c o n t r o l , l a c k s t h i s r e g i o n e n t i r e l y although there i s a moderate A-T b i a s i n the r e g i o n immediately preceding the P2 -35 s i t e ( F i g . 3B). As mentioned above, no obvious DNA sequence homology can be seen between the r e g i o n immediately surrounding the s u b t i l i s P2 -35 s i t e and the same r e g i o n surrounding the E_i_ c o l i rrnB P1 promoter (compare F i g . 3B and 5) , although t h i s r e g i o n i s a p p a r e n t l y c r i t i c a l f o r the growth r a t e r e g u l a t e d expression of E_j_ c o l i P1 (31). T h i s suggests that the c o n t r o l p o i n t s f o r growth r a t e c o n t r o l and 122 p o s s i b l y feedback r e g u l a t i o n as w e l l may not l i e i n a p r e c i s e , conserved DNA sequence w i t h i n the r r n promoters, but i n s t e a d are more s u b t l e and probably r e f l e c t c e r t a i n c o n f o r m a t i o n a l or t o p o l o g i c a l c h a r a c t e r i s t i c s of rRNA promoters which i n turn can be achieved through a number of d i f f e r e n t p o s s i b l e DNA sequences. 123 Chapter 2 C o n s t r u c t i o n of a l t e r n a t i v e promoter-probe c l o n i n g v e c t o r s . I n t r o d u c t i o n In Chapter 1, the growth r a t e dependent e x p r e s s i o n of B.  3 u b t i l i s rrnB promoters i n c o l i has been c h a r a c t e r i z e d . I t was now d e s i r a b l e to determine whether the r e l a t i v e e f f e c t s of growth r a t e on P1 vs. P2 expression seen i n E_^ c o l i were true i n  vi v o f o r B_j_ s u b t i l i s as w e l l . U n f o r t u n a t e l y , operon f u s i o n s based on the pKK232-8 expression system were not d i r e c t l y t r a n s f e r a b l e to B_^  s u b t i l i s f o r a number of reasons. Since pKK232-8 was based on an c o l i pBR322 r e p l i c o n , i t would not be expected to r e p l i c a t e as an autonomous plasmid i n any Gram-p o s i t i v e organism. In g e n e r a l , plasmids used i n B a c i l l u s have been const r u c t e d so as to i n c l u d e a Gram-positive s p e c i f i c o r i g i n of r e p l i c a t i o n ( o r i ) r e g i o n (140). Secondly, a promoter-CAT f u s i o n on pKK232-8, even i f in t r o d u c e d i n t o B^ s u b t i l i s , would not g i v e r i s e to the CAT p r o t e i n i n t h i s organism. While some genes from Gram-negative organisms could be t r a n s c r i b e d r e l a t i v e l y e f f i c i e n t l y i n B. s u b t i l i s (141, 143), the messenger RNA's so formed were g e n e r a l l y not t r a n s l a t e d i n t o p r o t e i n . McLaughlin e_t §_1. (142) have determined that t h i s t r a n s l a t i o n a l block was due to the lac k of s u f f i c i e n t complementarity between the ribosome b i n d i n g s i t e of Gram-negative t r a n s c r i p t s and the 124 3* end of the 16S RNA of 3 u b t l l ± 3 . However, a number of Gram-negative mRNA's have been found to be t r a n s l a t e d i n B a c i l l u s because t h e i r ribosome bindi n g s i t e s have, f o r unknown reasons, been extended such that the r e q u i r e d homology to B_j_ s u b t i l i s 16S RNA was achieved (126). An i d e a l v e c t o r f o r the purposes o u t l i n e d above would t h e r e f o r e be one which c a r r i e d dual o r i g i n s of r e p l i c a t i o n such that i t could r e p l i c a t e i n both c o l i and B.  s u b t i l i s and, at the same time, c a r r i e d a promoterless marker gene which could be f u l l y expressed i n both organisms. Thus, the r e q u i r e d operon f u s i o n s could be c o n s t r u c t e d i n c o l i where the plasmid manipulations were t e c h n i c a l l y simpler and more e f f i c i e n t , followed by t r a n s f e r of the f u s i o n plasmid to B.  s u b t i l i s where s p e c i f i c r e g u l a t o r y c h a r a c t e r i s t i c s could be t e s t e d . Zukowski e_t a_l. (126) have shown that the x y l E gene from Pseudomonas pu t i d a was expressed and t r a n s l a t e d i n | L _ s u b t i l i s and i n E^ c o l i . T h i s gene was found as part of a multi-gene operon on the TOL plasmid of Pseudomonas p u t i d a and p a r t i c i p a t e d i n the catabolism of toluene and r e l a t e d aromatic hydrocarbons through the corresponding c a t e c h o l s to pyruvate (145). The x y l E gene i t s e l f encoded a c a t e c h o l 2,3-dioxygenase which converted the c o l o r l e s s s u b s t r a t e c a t e c h o l to the y e l l o w - c o l o r e d 2-hydroxymuconic semialdehyde product. Using the promoterless x y l E gene, Zukowski e_t a_l. have co n s t r u c t e d a promoter-probe v e c t o r f o r B_^  s u b t i l i s which r e p l i c a t e d i n B a c i l l u s and i n E_^ c o l i , 125 c o n s t i t u t i v e l y produced dioxygenase a c t i v i t y i n E_^  c o l i , but only produced dioxygenase i n s u b t i l i 3 i f a promoter was placed 5' to the x y l E gene. As an i n i t i a l step toward the g o a l of c o n s t r u c t i n g a dual E_;_ c o l i - B_j_ 3 u b t i l i s operon f u s i o n system, the x y l E gene was used as the b a s i s f o r a set of v e c t o r s which thus f a r only r e p l i c a t e i n E_;_ c o l i but, u n l i k e the Zukowski e_t a l . plasmids, can be used to i d e n t i f y promoter-bearing fragments i n E_;_ c o l i , can s t a b l y maintain u n u s u a l l y strong promoters, and have the p o t e n t i a l to be modified f o r d i r e c t use i n B_;_ s u b t i l i s . R esults 1. C o n s t r u c t i o n of pTLXT-11/pAS-3 v e c t o r s . A 2.0 Kb BamHI-Xhol fragment c a r r y i n g the x y l E gene (126) was i s o l a t e d from the TOL plasmid, l i g a t e d to pBR322 cut with BamHI and S a i l , and used to transform E_j_ c o l i HB101 to a m p i c i l l i n r e s i s t a n c e . Clones c a r r y i n g the x y l E fragment were i d e n t i f i e d by spraying c o l o n i e s with an aqueous s o l u t i o n of c a t e c h o l as d e s c r i b e d i n the M a t e r i a l s and Methods and s e l e c t i n g those c o l o n i e s which turned a yellow c o l o r . Expression of the x y l E gene i n t h i s case was presumably due to t r a n s c r i p t i o n i n i t i a t i n g at the t e t promoter of pBR322 (144). DNA from one of these p o s i t i v e clones was d i g e s t e d with EcoRI and Nrul and the x y l E fragment i s o l a t e d and l i g a t e d to EcoRI-Nrul d i g e s t e d pKK9-4 126 (131). This c o n s t r u c t i o n r e s u l t e d i n the j o i n i n g of the t r a n s c r i p t i o n terminator from the c o l i rrnB operon to the 3' end of the x y l E gene. F i n a l l y , the t e t promoter was e l i m i n a t e d by r e p l a c i n g the PstI-BamH1 fragment i n t h i s v e c t o r with the PstI-BamH1 fragment of pKK232-8 (131). The l a t t e r fragment contained an upstream t r a n s c r i p t i o n terminator and m u l t i p l e c l o n i n g s i t e s f o r i n s e r t i o n of promoter fragments. The r e s u l t i n g plasmid, pTLXT-11, had the s t r u c t u r e shown i n F i g . 21. The vec t o r pAS-3 ( F i g . 21) was cre a t e d by i n t r o d u c i n g the lambda tR1 t r a n s c r i p t i o n terminator ( i s o l a t e d as a H i n d l l l - R s a l fragment from pKM-1, r e f . 129) i n t o the unique Hpal s i t e of pTLXT-11. This r e s u l t e d i n the p o s i t i o n i n g of the lambda terminator between the promoter c l o n i n g s i t e and the s t a r t of the x y l E s t r u c t u r a l gene, i n a f a s h i o n analogous to that of pKM-1 (129). 2. Cloning and s t a b i l i t y of promoter fragments. Attempts were made to subclone a l l the jB^ s u b t i l i s rrnB promoter fragments shown i n F i g . 3A i n t o pTLXT-11 or pAS -3 . These fragments were i s o l a t e d from the v a r i o u s pKK d e r i v a t i v e s (Chapter 1, F i g . 3 A ) , cloned i n t o the Smal s i t e of the x y l E v e c t o r s , and used to transform E^ c o l l HB101 to a m p i c i l l i n + r e s i s t a n c e . Clones expressing the x y l E phenotype were s e l e c t e d on the b a s i s of the yellow c o l o r produced a f t e r s p r a y i n g c o l o n i e s 127 Figure 21. Structure of pTLXT-ll/pAS-3. pTLXT-11 was constructed as described i n the text. The thick bar, with c i r c l e s , was derived from the TOL plasmid and c a r r i e s the xylE gene. The single l i n e denotes pBR322 sequences. A multiple cloning s i t e l i n k e r , used for i n s e r t i o n of promoter fragments, i s positioned proximal to the xylE gene and a si n g l e T l t r a n s c r i p t i o n terminator i s proximal to t h i s . The position of the downstream t r a n s c r i p t i o n termination signals ( T l , T2), derived from the E . c o l i rrnB operon, i s indicated. A 5S RNA gene was included during the cloning procedure. pAS-3 was constructed by i n s e r t i n g a 500 bp fragment carrying the lambda tRl t r a n s c r i p t i o n terminator (from pKM-1) into the unique Hpal s i t e of pTLXT-11. R e s t r i c t i o n s i t e s are: Ps, P s t l ; Pv, Pvul; E, EcoRI; S, Smal; B, BamHI H, Hpal; K, Kpnl; Sa, S a i l ; A, Aval. Bracketted s i t e s have been destroyed during cloning. 128 with a c a t e c h o l s o l u t i o n . While a l l promoter fragments could i n i t i a l l y be cloned i n t o e i t h e r x y l E v e c t o r , i t was found that c o n s t r u c t s c a r r y i n g any tandem (P1-P2) promoter fragment i n pTLXT-11 were h i g h l y u n s t a b l e . I f a s i n g l e yellow colony was subcultured i n t o a m p i c i l l i n - s u p p l e m e n t e d broth and grown to s a t u r a t i o n , from 85$ to 90$ of the c e l l s i n the r e s u l t a n t p o p u l a t i o n were found to have l o s t the x y l E phenotype, although plasmid-mediated a m p i c i l l i n r e s i s t a n c e was s t i l l present. Up to 100 $ of the c e l l s i n the p o p u l a t i o n could become x y l E upon f u r t h e r s u b c u l t u r i n g . R e s t r i c t i o n endonuclease a n a l y s i s i n d i c a t e d that plasmids from x y l E clones had l o s t the e n t i r e + promoter i n s e r t . Stable x y l E clones could e v e n t u a l l y be i s o l a t e d by c o n t i n u a l l y p i c k i n g and re-growing s i n g l e yellow c o l o n i e s , but plasmids from these clones c a r r i e d d e l e t e d v e r s i o n s of the o r i g i n a l promoter i n s e r t . In a l l cases, the d e l e t i o n s p e c i f i c a l l y i n v o l v e d the 3' end of the promoter fragment (data not shown). Clones c a r r y i n g e i t h e r the s i n g l e rrnB P1 or P2 promoters i n pTLXT-11 were s t a b l e however. Likewise, a l l the tandem or s i n g l e promoter fragments were completely s t a b l e i n pAS -3 , i n d i c a t i n g that the presence of an i n t e r n a l t r a n s c r i p t i o n termination s i t e ( i n pAS-3) was s u f f i c i e n t to s t a b i l i z e the strong tandem promoters. S i m i l a r attempts were made to clone the E^ c o l i rrnB promoter fragments de s c r i b e d i n Chapter 1 . Here again, the 129 tandem promoter fragments were h i g h l y u nstable i n pTLXT-11, but i n t e r e s t i n g l y , t h i s i n s t a b i l i t y was noted f o r pAS-3 as w e l l . In a d d i t i o n , only the i s o l a t e d c o l i P2 promoter was s t a b l e i n pTLXT-11. The upstream P1 promoter could be maintained i n pAS-3 but was found to be unstable when cloned i n t o pTLXT-11. F i n a l l y , a non-ribosomal RNA promoter was cloned as w e l l . A 253 bp Mspl-Mnll fragment from the Staphlococcus aureus plasmid pC194 c a r r y i n g the promoter f o r the chloramphenicol a c e t y l t r a n s f e r a s e gene (146) was cloned i n t o pTLXT-11. Attempts to clone t h i s fragment i n t o pAS-3 f a i l e d , p o s s i b l y because the l e v e l of x y l E e x p r e s s i o n was lowered to the extent that pos-i t i v e clones could not be detected (see below). Table 4 summar-i z e s the v a r i o u s operon f u s i o n s c o n s t r u c t e d as o u t l i n e d above. 130 Table 4 - Ribosomal RNA promoter - x y l E operon f u s i o n s B.s. = s u b t i l i s E.c. = E. c o l i Plasmid Promoter I n t e r n a l lambda terminator S t a b i l i t y PAS-427B B.s. P1-P2 + yes pAS-211B B.s. P1-P2 + yes PTLXT-427B B.s. P1-P2 - no pTLXT-211B B.s. P1-P2 - no PAS-282B B.s. P1 + yes PTLXT-282B B.s. P1 - yes PAS-220B B.s. P2 + yes PTLXT-220B B.s. P2 - yes pAS-292Ec E.c. P1-P2 + no pTLXT-292Ec E.c. P1-P2 - no pAS-351Ec E.c. P1 + yes pTLXT-3 51Ec E.c. P1 no pTLXT-128Ec E.c. P2 yes pTLXT-253 pC194 CAT yes 131 3. Expression of promoter-xylE f u s i o n s i n E_;_ c o l i . Only those s t r a i n s c a r r y i n g plasmids which had been shown to maintain a s t a b l e x y l E phenotype (Table 4) were f u r t h e r s t u d i e d . C e l l s were grown as des c r i b e d i n the M a t e r i a l s and Methods so as to achieve a range of growth r a t e s , h a r v e s t e d , and assayed f o r ca t e c h o l 2,3-dioxygenase a c t i v i t y . F i g u r e 22 i l l u s t r a t e s the changes i n dioxygenase s p e c i f i c a c t i v i t y as a f u n c t i o n of growth rate f o r a l l plasmids c a r r y i n g B_;_ s u b t i l i s rRNA promoters as w e l l as f o r pTLXT-253 c a r r y i n g the c o n s t i t u t i v e CAT gene promoter. As can be seen, a l l c o n s t r u c t i o n s gave s l i g h t l y lower l e v e l s of dioxygenase a c t i v i t y at higher growth r a t e s . No growth r a t e dependent i n c r e a s e i n a c t i v i t y was observed, even f o r plasmids c a r r y i n g rRNA promoters which had p r e v i o u s l y been shown to be growth r a t e r e g u l a t e d i n E_^  c o l i ( i . e . 427 bp P1-P2, 220 bp P2 -Chapter 1). When the response of the cloned E . c o l i rrnB promoter as a f u n c t i o n of growth r a t e was examined, a s i m i l a r trend was observed. In t h i s case, i t was only p o s s i b l e to study the i n d i v i d u a l P1 and P2 promoters i n pAS-3 and pTLXT-11 r e s p e c t i v e l y , s i n c e a l l other clones were u n s t a b l e . However, pAS-351Ec, c a r r y i n g the rrnB P1 promoter which had been shown to be growth r a t e r e g u l a t e d here (Chapter 1) and elsewhere (31) d i d not produce a growth r a t e dependent i n c r e a s e i n c a t e c h o l 2 , 3 -132 CO £j 10000 < UJ 5( CO < •z. Ill o > X O u o o UJ r-< o . A A 1.0 1.1 1.S 1.6 Growth Rate Figure 22. Catechol 2,3 dioxygenase a c t i v i t y vs. growth rate. Expression of the xylE gene from various B . s u b t i l i s rrnB promoter i n s e r t s was assessed by determining the s p e c i f i c a c t i v i t y of catechol 2,3 dioxygenase as described i n the Materials and Methods. Growth rate was calculated as the r e c i p r o c a l of the c e l l u l a r doubling time i n hours. The host for a l l plasmids i n these experiments was E . c o l i HB101. Line 1 (open c i r c l e s ) , pTLXT-220B; Line 2 (closed c i r c l e s ) , pTLXT-282B; Line 3 ( s t a r s ) , pTLXT-253 (CAT gene promoter); Line 4 (open squares), pAS-427B; Line 5 (closed squares), pAS-220B; Line 6 (open t r i a n g l e s ) , pAS-282B. See Table 4 for a summary of the c h a r a c t e r i s t i c s of the plasmids used here. Figure 23. Catechol 2,3 dioxygenase a c t i v i t y vs. growth rate: pAS-351Ec. E . c o l i HB101 carrying pAS-351Ec ( E . c o l i rrnB PI promoter) was grown at d i f f e r e n t rates and catechol 2,3 dioxygenase s p e c i f i c a c t i v i t y determined from c e l l - f r e e extracts. The slope of the l i n e was determined by l i n e a r regression. 134 dioxygenase a c t i v i t y ( F i g . 23). 4. E f f e c t s of lambda tR1 terminator on expression of B_j_ s u b t i l i s  rrnB promoters. An examination of the data i n F i g . 22 provides a d d i t i o n a l i n f o r m a t i o n as to the e f f i c i e n c y of t r a n s c r i p t i o n t e r m i n a t i o n at the i n t e r n a l lambda terminator c a r r i e d on pAS-3. At a growth r a t e of 1.0 doubling/hr., the P1 promoter on pAS-282B gave only 3.4$ of the c a t e c h o l 2,3-dioxygenase a c t i v i t y seen f o r P1 on pTLXT-282B (Table 5). Therefore, assuming that plasmid copy number and t r a n s l a t i o n a l e f f i c i e n c i e s were e q u i v a l e n t i n both cases, t h i s i m p l i e s that over 96$ of the t r a n s c r i p t s o r i g i n a t i n g at P1 were terminated at the lambda tR1 s i t e . For the P2 promoter on pAS-220B, approximately 93$ of the t r a n s c r i p t s were terminated before reaching the x y l E s t r u c t u r a l gene (Table 5 ) . F i n a l l y , i t was noted that the r e l a t i v e a c t i v i t i e s of the B.  s u b t i l i s P1 and P2 promoters followed the same trend as observed e a r l i e r u s ing the pKK232-8 expr e s s i o n system. The P2 promoter gave higher l e v e l s of c a t e c h o l 2,3-dioxygenase a c t i v i t y at a l l growth r a t e s i n both pTLXT-11 and pAS-3. At a growth r a t e of 1.0 f o r example, P2 r e s u l t e d i n approximately 50$ more a c t i v i t y than P1 i n the pTLXT-11 and 76$ more a c t i v i t y i n the pAS-3 v e c t o r (Table 5). 135 Table 5 - A c t i v i t i e s of s u b t i l i s promoters i n c o l i (u = 1.0) Plasmid Promoter I n t e r n a l lambda Catechol 2,3-terminator dioxygenase (units/mg) pAS-427B P1-P2 + 2,800 pAS-282B P1 + 340 PTLXT-282B P1 - 10,100 PAS-220B P2 + 1,450 PTLXT-220B P2 - 20,050 pTLXT-253 CAT - 3,250 136 D i s c u s s i o n This chapter d e s c r i b e d the c o n s t r u c t i o n of two promoter-probe v e c t o r s , pTLXT-11 and pAS-3, and t h e i r a p p l i c a b i l i t y i n the c l o n i n g of strong ribosomal RNA promoters from s u b t i l i s and E.  c o l i . These v e c t o r s used the promoterless Pseudomonas p u t i d a  x y l E gene encoding a c a t e c h o l 2,3-dioxygenase enzyme which could be q u a n t i t a t i v e l y assayed and had the added advantage that the x y l E gene i t s e l f c ould p o t e n t i a l l y be expressed i n s u b t i l i s without f u r t h e r m o d i f i c a t i o n s (126). F u n c t i o n a l l y , pTLXT-11 was i d e n t i c a l to pKK232-8 d e s c r i b e d by B r o s i u s (131) although s t r u c t u r a l l y they d i f f e r e d i n that pTLXT-11 used the x y l E gene whereas pKK232-8 contained a promoterless CAT gene. Therefore, promoters cloned i n t o pTLXT-11 could not be placed under con s t a n t s e l e c t i v e pressure as they could i n the pKK232-8 system. A l s o , pTLXT-11 was s i m i l a r to pTG402, another x y l E based promoter-probe plasmid c o n s t r u c t e d by Zukowski e_t a_l. (126). Unlike pTG402 however, pTLXT-11 could not r e p l i c a t e i n B. 3 u b t i l i 3 and d i d not c o n s t i t u t i v e l y express the x y l E gene i n E_^  c o l i because a l l upstream pBR322-derived promoters had been e l i m i n a t e d . I t was expected that as with pKK232-8, pTLXT-11 could be used to clone and s t a b l y maintain a l l types of strong promoters such as those of the rRNA operons. I t was found however, t h a t the tandem rRNA promoters from B_^  s u b t i l i s could be cloned by 137 + s e l e c t i n g f o r t h e x y I E p h e n o t y p e , b u t t h a t x y l E s e g r e g a n t s r a p i d l y a p p e a r e d f o l l o w i n g o u t g r o w t h i n a m p i c i l l i n - s u p p l e m e n t e d + media. S t a b l e x y l E c l o n e s c o u l d e v e n t u a l l y be o b t a i n e d b u t p r e l i m i n a r y c h a r a c t e r i z a t i o n o f t h e i r p r o m o t e r i n s e r t s r e v e a l e d t h a t e x t e n s i v e d e l e t i o n s i n v o l v i n g t h e 3' ends had o c c u r r e d . T h i s s u g g e s t e d t h a t t h e s e s t a b l e c l o n e s c o u l d have l o s t t h e P2 element o f t h e p r o m o t e r i n s e r t . T h i s i n s t a b i l i t y o f tandem promoter f r a g m e n t s s h o u l d n o t be due t o r e a d - t h r o u g h t r a n s c r i p t i o n from t h e rRNA p r o m o t e r s i n t o the p l a s m i d o r i g i n o f r e p l i c a t i o n s i n c e a d o u b l e s e t o f e f f i c i e n t rRNA t r a n s c r i p t i o n t e r m i n a t o r s were l o c a t e d downstream o f t h e x y l E gene. I t i s p o s s i b l e t h a t the i n s t a b i l i t y was due t o t h e d e t r i m e n t a l e f f e c t s o f a h y b r i d r r n B - x y l E mRNA s p e c i e s i n E_;_ c o l i o r t h a t t h i s mRNA was so abundant t h a t i t p l a c e d a d r a i n on t h e c e l l u l a r p r o t e i n s y n t h e s i s m a c h i n e r y , namely t h e r i b o s o m e and tRNA p o o l s . T h i s p o s s i b i l i t y i s a r g u e d a g a i n s t however, by t h e f i n d i n g t h a t t h e s e same p r o m o t e r f r a g m e n t s were s t a b l e i n pKK232-8 ( C h a p t e r 1) which a l s o p r o d u c e s a h y b r i d mRNA and w h i c h , a s s u m i n g e q u i v a l e n t t r a n s l a t i o n e f f i c i e n c i e s , must p l a c e t h e same demand on t h e p r o t e i n s y n t h e t i c c a p a c i t y o f t h e c e l l . I n s t e a d t h e r e s u l t s p r e s e n t e d h e r e t e n d t o i m p l y t h a t t h e p r o d u c t o f t h e x y l E gene may be t o x i c t o E_^ c o l i when p r o d u c e d a t t h e h i g h l e v e l s e x p e c t e d f o r t r a n s c r i p t i o n i n i t i a t i n g a t rRNA p r o m o t e r s . W h i l e t h i s has n o t been d i r e c t l y p r o v e n h e r e , s e v e r a l o t h e r w o r k e r s have f o u n d t h a t o v e r e x p r e s s i o n o f c e r t a i n p l a s m i d - e n c o d e d p r o -t e i n s were d e t r i m e n t a l t o c e l l u l a r m e t a b o l i s m and t h e s t a b i l i t y 138 of recombinant plasmids. Brosius (132) f o r example, found that overexpression of the r a t i n s u l i n gene on a multicopy plasmid l e d to plasmid i n s t a b i l i t y and c e l l u l a r l y s i s ; an e f f e c t not due to overproduction of the mRNA i t s e l f and not due to an i n a b i l i t y of the c e l l to e f f i c i e n t l y export the i n s u l i n p r o t e i n s i n c e overproduction of the non-secreted form of the p r o t e i n was s t i l l l e t h a l to the c e l l . In the case of the x y l E f u s i o n s , the high l e v e l of c a t e c h o l 2 , 3-dioxygenase enzyme may i n some way be d e t r i m e n t a l or i n h i b i t o r y to a r e q u i r e d c e l l u l a r metabolic f u n c t i o n . This p o s s i b i l i t y has not been r i g o r o u s l y t e s t e d however, so other f a c t o r s could s t i l l be important f o r the observed i n s t a b i l i t y . Nevertheless, i t was found t h a t the tandem B a c i l l u s rRNA promoters could be s t a b l y maintained on x y l E vectors simply by the placement of a lambda tR1 terminator between the promoters and the x y l E s t r u c t u r a l gene (pAS - 3 ) . The presence of t h i s terminator reduced c a t e c h o l 2 , 3-dioxygenase a c t i v i t y by 93 to 97$ and presumably would b r i n g the amount of dioxygenase p r o t e i n down to a l e v e l t o l e r a t e d by JL_ c o l i . I n t e r e s t i n g l y , i t was found that the tandem rrnB promoters from E_j_ c o l i could not be s t a b l y maintained even i n the t e r m i n a t o r - c o n t a i n i n g pAS-3 v e c t o r . I t had been shown i n a number of s t u d i e s that RNA polymerase i n i t i a t i n g at JL c o l i rRNA promoters could e f f i c i e n t l y read-through r h o - f a c t o r dependent termination s i g n a l s as a means of overcoming the t r a n s c r i p t i o n a l 139 p o l a r i t y normally a s s o c i a t e d with n o n - t r a n s l a t e d operons (37, 38, 44). This a n t i t e r m i n a t i o n mechanism was dependent on DNA sequences l o c a t e d l e s s than 67 bp d i s t a l to the P2 promoter element (31), sequences which were present on the rRNA fragment cloned on pAS-292Ec. I t i s p o s s i b l e , although not r i g o r o u s l y proven, that the i n a b i l i t y to maintain the 292 bp rrnB promoter fragment was due to the a n t i t e r m i n a t i o n p r o p e r t i e s c o n f e r r e d by these sequences which r e s u l t e d i n read-through t r a n s c r i p t i o n of the rho-dependent lambda tR1 ter m i n a t o r on pAS-3. In c o n t r a s t , the 427 bp tandem rRNA promoter fragment from B_;_ 3 u b t i l i s , which in c l u d e d 114 bp of DNA d i s t a l to the P2 element, was completely s t a b l e i n pAS -3 . This suggested that the lambda tR1 terminator i n pAS-3 was f u n c t i o n a l i n p r e v e n t i n g a l a r g e percentage of read-through t r a n s c r i p t i o n and i m p l i e d that e i t h e r the B_;_ s u b t i l i s  rrnB promoters had no a n t i t e r m i n a t i o n mechanism analogous to that of the c o l i promoters, or e l s e one was present but was i ) not f u n c t i o n a l i n E_^  c o l i or, i i ) i n o p e r a b l e on the p a r t i c u l a r rho-dependent terminator used here or, i i i ) l o c a t e d beyond the 3' end of the 427 bp promoter fragment. The data presented here do not allow one to d i s t i n g u i s h between these p o s s i b i l i t i e s . An examination of the DNA sequence d i s t a l to the B^ s u b t i l i s rrnB P2 promoter up to the s t a r t of the 16S RNA gene f a i l e d to r e v e a l a region homologous to the s o - c a l l e d Box B, A, C region thought to to be r e q u i r e d i n the a n t i t e r m i n a t i o n mechanism i n E_j_ c o l i (31, 44). S i m i l a r l y , no such r e g i o n appeared i n the i n t e r v e n i n g sequence between the B_^  s u b t i l l s P1 and P2 promoters. 140 Unfortunately, the mechanisms of t r a n s c r i p t i o n t e r m i n a t i o n and t r a n s c r i p t i o n - t r a n s l a t i o n c o u p l i n g i n B_j_ s u b t i l i s are p o o r l y understood. While a p r o t e i n s i m i l a r to the E_;_ c o l i rho f a c t o r has been reported i n B a c i l l u s (147), a r i g o r o u s g e n e t i c proof of the ex i s t e n c e of such a f a c t o r ( i . e . as a mutation able to suppress p o l a r mutations) has not yet appeared. I t i s t h e r e f o r e p o s s i b l e that B_^  s u b t i l i s rRNA operons may not a c t u a l l y r e -quire s p e c i f i c mechanisms to ensure e f f i c i e n t rRNA t r a n s c r i p t e l o n g a t i o n . C l e a r l y , f u r t h e r ija v i v o s t u d i e s of rRNA e x p r e s s i o n must be undertaken to address the q u e s t i o n of the presence or absence of a n t i t e r m i n a t i o n f u n c t i o n s i n B a c i l l u s . Lack of growth r a t e dependent r e g u l a t i o n of promoter-xylE f u s i o n s . The r e s u l t s presented i n Chapter 1 demonstrated that B.  s u b t i l i s and c o l i rRNA promoters were r e g u l a t e d i n a growth r a t e dependent manner when fused to a chloramphenicol a c e t y l -t r a n s f e r a s e gene and expressed i n JL_ c o l i . Unexpectedly, i t was found that t h i s growth r a t e dependent expression could not be d u p l i c a t e d when these same promoters were fused to the x y l E gene. I t must be noted however, that the pAS-3 vector used f o r most experiments here d i f f e r e d from pKK232-8 used i n Chapter 1 i n t h a t pAS-3 c a r r i e d an i n t e r n a l t r a n s c r i p t i o n terminator which reduced expression of xylE by an average of 95$ (Table 5 ). I t was o r i g i n a l l y assumed that the e f f i c i e n c y of t r a n s c r i p t i o n 141 termination at tR1 v a r i e d as a f u n c t i o n of growth r a t e and thereby masked any growth r a t e dependent e x p r e s s i o n which might be o c c u r r i n g . Others have noted that the number of t r a n s c r i p t s which read-through a given t e r m i n a t i o n s i g n a l could vary according to the s t r e n g t h of the promoters which i n i t i a t e t r a n s c r i p t i o n (148). While the e f f e c t s of growth r a t e on t r a n s c r i p t i o n t e r m i n a t i o n have not been d i r e c t l y examined here, i t i s not unreasonable to assume that as the r e l a t i v e s t r e n g t h of a growth r a t e r e g u l a t e d promoter i n c r e a s e d at higher growth r a t e s , so too d i d the degree of t r a n s c r i p t i o n t e r m i n a t i o n at tR1 , thus e f f e c t i v e l y n u l l i f y i n g any growth r a t e dependent changes. Growth r a t e dependent t e r m i n a t i o n at tR1 i f indeed i t occurred, could not be the only e x p l a n a t i o n f o r the lack of an observable growth r a t e dependent response, as evidenced by the r e s u l t s obtained f o r the pTLXT-220B f u s i o n plasmid ( F i g . 22). This plasmid lacked the i n t e r n a l tR1 terminator of pAS-3 and c a r r i e d the s u b t i l i s P2 rRNA promoter which p r e v i o u s l y had been shown to be growth r a t e r e g u l a t e d when fused to the CAT gene. I f the lack of growth r a t e r e g u l a t i o n of xylE-based f u s i o n plasmids was due only to the presence of the tR1 t e r m i n a t o r , then t h i s f u s i o n should have shown a normal growth r a t e dependent response. As can be seen ( F i g . 22), pKK-220B a l s o f a i l e d to produce an i n c r e a s e i n c a t e c h o l 2,3-dioxygenase a c t i v i t y with i n c r e a s i n g growth r a t e . The reason f o r t h i s i s p r e s e n t l y not 142 c l e a r . Plasmid copy number determinations f o r the x y l E v e c t o r s (data not shown) f a i l e d to show any s i g n i f i c a n t d i f f e r e n c e between high and low growth r a t e c o n d i t i o n s , as shown p r e v i o u s l y f o r the pKK232-8 v e c t o r s . I t was observed however, that the f u n c t i o n a l h a l f - l i f e of x y l E mRNA was s i g n i f i c a n t l y reduced i n f a s t e r growing c e l l s (G.B. Spiegelman, p e r s o n a l communication). Whether t h i s could account f o r the l a c k of an apparent growth rate dependent response remains to be determined. The p r e c i s e reasons are e s s e n t i a l l y i r r e l e v a n t to the present i n v e s t i g a t i o n s however, s i n c e from the data presented above i t i s c l e a r t h a t the xy l E v e c t o r s have s e r i o u s l i m i t a t i o n s i f used to study the r e g u l a t o r y p r o p e r t i e s of cloned promoters as a f u n c t i o n of changing parameters such as growth r a t e . N e v e r t h e l e s s , both pAS-3 and pTLXT-11 may s t i l l be u s e f u l as a means of q u a n t a t i v e l y a s s e s s i n g the s t r e n g t h of cloned promoters as long as other environmental c o n d i t i o n s are e q u i v a l e n t i n a l l cases. The data i n Table 5 f o r example, confirmed the previous o b s e r v a t i o n s (Chapter 1 ) that the B_^  s u b t i l i s rrnB P2 promoter was much more t r a n s c r i p t i o n a l l y a c t i v e than the upstream P1 promoter. For the promoters cloned i n pAS -3 , P2 was roughly 4 times more a c t i v e than P1 at a c e l l u l a r growth r a t e of 1.0 d o u b l i n g / h r . ; f o r the promoters i n pTLXT-11, P2 predominated over P1 by a f a c t o r of 2. This v a r i a t i o n i n the r a t i o of P2 to P1 a c t i v i t y a c c o r d i n g to whether the c l o n i n g vector was pAS-3 or pTLXT-11 could be due to d i f f e r e n t i a l t e r m i n a t i o n e f f e c t s dependent on the absolute s t r e n g t h s of the cloned promoters as d i s c u s s e d above. 143 In c o n c l u s i o n , two general purpose promoter-probe v e c t o r s based on the Pseudomonas putida x y l E gene have been developed here. Both are p r e s e n t l y useable only i n JL_ c o l i but have the p o t e n t i a l f o r use (with m o d i f i c a t i o n s ) i n B_^  s u b t i l i s . S e l e c t i o n of recombinant clones c a r r y i n g promoter fragments i s simply and c o n v e n i e n t l y done by u t i l i z i n g a color-change r e a c t i o n . Promoters of average streng t h may be cloned i n t o pTLXT-11 but very strong promoters r e q u i r e the presence of an i n t e r n a l terminator fragment so as to reduce the amount of x y l E gene product s y n t h e s i z e d . Thus, i t has been suggested (although not r i g o r o u s l y proven) that overproduction of c a t e c h o l 2,3 dioxy-genase may be t o x i c to E_^  c o l i c e l l s , an e f f e c t not p r e v i o u s -l y noted f o r t h i s product (126). In t h i s r e g a r d , the pAS-3 vector has a s i g n i f i c a n t advantage over other xylE-based v e c t o r s (126) i n that very strong promoters can be maintained without d e t e c t a b l e i n s t a b i l i t y . Vectors using x y l E as an i n d i c a t o r gene have a s e r i o u s drawback however, i n that they cannot be used to study the r e g u l a t o r y p r o p e r t i e s of cloned promoters because of a r t i f a c t s a r i s i n g from the f u s i o n system i t s e l f which may, under some c o n d i t i o n s , obscure c e r t a i n r e g u l a t o r y phenomena. I t should be noted that t h i s drawback may a l s o extend to other xylE-based f u s i o n systems (126, 149) and the a p p r o p r i a t e c o n t r o l s must be 144 t h e r e f o r e c o n s i d e r e d . In s p i t e o f t h e s e d i f f i c u l t i e s , t h e s e v e c t o r s have been u s e d t o c l o n e the p r o m o t e r r e g i o n s o f t h e B.  s u b t i l i s and E_^ c o l i r r n B o p e r o n s i n a manner a n a l o g o u s t o t h a t d e s c r i b e d i n C h a p t e r 1. W h i l e s t u d i e s p e r t a i n i n g t o t h e g r o w t h r a t e r e g u l a t i o n o f t h e s e p r o m o t e r s c o u l d n o t be done, i t was n e v e r t h e l e s s p o s s i b l e t o d e f i n e c e r t a i n o t h e r f e a t u r e s o f t h e B a c i l l u s p r o m o t e r s w h i c h d i f f e r e d f r o m the a n a l o g o u s E_j_ c o l i p r o m o t e r s . S p e c i f i c a l l y , by u s i n g t h e pAS -3 v e c t o r , i t was c o n c l u d e d t h a t t h e B_^  s u b t i l i s rRNA p r o m o t e r e i t h e r l a c k e d t h e a n t i t e r m i n a t i o n f u n c t i o n s f o u n d a s s o c i a t e d w i t h E_;_ c o l i rRNA p r o m o t e r s , o r i f p r e s e n t , t h e y were s u f f i c i e n t l y d i f f e r e n t f r o m t h o s e o f E_^ c o l i so as t o be n o n - f u c t i o n a l on c o l i r h o -dep e n d e n t t e r m i n a t o r s . I n o r d e r t o g a i n more i n s i g h t i n t o t h e s e and o t h e r q u e s t i o n s , p a r a l l e l s t u d i e s o f rRNA p r o m o t e r - f u s i o n s y s t e m s i n B a c i l l u s must be u n d e r t a k e n . 145 Chapter 3_ Attempts to c o n s t r u c t b i f u n c t i o n a l operon f u 3 i o n v e c t o r s . I n t r o d u c t i o n As s t a t e d i n the i n t r o d u c t i o n to Chapter 2 , the p r e f e r r e d next stage i n t h i s work would i n v o l v e the t r a n s f e r of an JL. c o l i promoter-fusion system i n t o B_^  s u b t i l i s i n order that p a r a l l e l i n vivo experiments could be performed. I d e a l l y , the promoter expression v e c t o r used i n the JL_ c o l i experiments would be d i r e c t l y t r a n s f e r r e d to B a c i l l u s , so as to e l i m i n a t e any p o t e n t i a l problems which could a r i s e from the use of two d i f f e r e n t e x p r e s s i o n systems i n the two h o s t s . As d e t a i l e d i n Chapter 2 , an i n i t i a l step toward t h i s g o a l was the c o n s t r u c t i o n of a promoter-fusion v e c t o r based on the Pseudomonas p u t i d a x y l E gene s i n c e t h i s gene can be e f f i c i e n t l y t r a n s c r i b e d and t r a n s -l a t e d i n both E\_ c o l l and IL_ s u b t i l i s ( 1 2 6 ) . An a l t e r n a t i v e approach, although t e c h n i c a l l y more d i f f i c u l t , would have been to a l t e r the ribosome b i n d i n g s i t e of the CAT gene on the p K K 2 3 2 - 8 vector so that chloramphenicol a c e t y l t r a n s f e r a s e could be synthesized i n B_^  s u b t i l i 3 . I t was shown however, that i n E.  c o l i the l e v e l of x y l E gene expre s s i o n was not s t r i c t l y dependent on the t r a n s c r i p t i o n a l a c t i v i t y of the cloned promoter alone. Instead, the l e v e l of c a t e c h o l 2 , 3-dioxygenase a c t i v i t y was i n f l u e n c e d by other, p o o r l y c h a r a c t e r i z e d , parameters thus 146 making the x y l E v e c t o r s u n s u i t a b l e f o r r e g u l a t o r y s t u d i e s i n E.  c o l i . However, i t was unclear whether s i m i l a r problems with a xylE-based system would occur i f t h i s gene was expressed i n B a c i l l u s . I t was decided to u t i l i z e the x y l E v e c t o r s pTLXT-11 and pAS-3 i n an attempt to c o n s t r u c t promoter-probe plasmids which would r e p l i c a t e and express c a t e c h o l 2,3-dioxygenase a c t i v i t y i n both E_;_ c o l i and B^ s u b t i l i s . I f f e a s i b l e , t h i s should a l l o w an assessment to be made of the g e n e r a l u t i l i t y of x y l E v e c t o r s i n the study of cloned promoters i n t r o d u c e d i n t o B a c i l l u s . In a d d i t i o n , such v e c t o r s might be u s e f u l as the s t a r t i n g p o i n t f o r other b i - f u n c t i o n a l plasmids i n which the x y l E gene was r e p l a c e d by another marker gene, one which would not present the problems a s s o c i a t e d with the expression of x y l E i n E.  c o l i . While there are no n a t u r a l l y o c c u r r i n g plasmids capable of r e p l i c a t i o n i n both E_^  c o l i and B^ s u b t i l i s , s e v e r a l workers have c r e a t e d such b i - f u n c t i o n a l plasmids by the j j i v i t r o l i g a t i o n of r e p l i c o n s n a t i v e to each organism. One of the f i r s t such v e c t o r s was pHV14 (150) i n which the E^ _ c o l i plasmid pBR322 was l i g a t e d to pC194, a c h l o r a m p h e n i c o l - r e s i s t a n c e plasmid o r i g i n a l l y i s o l a t e d from Staphlococcus aureus. Transformation of pHV14 i n t o E. c o l i r e s u l t e d i n the expression of a m p i c i l l i n , t e t r a c y l i n e (from pBR322) and chloramphenicol (from pC194) r e s i s t a n c e whereas only chloramphenicol r e s i s t a n c e was expressed i n B^ s u b t i l i s . Since then, a l a r g e number of other b i - f u n c t i o n a l plasmids have 147 been c r e a t e d , most based on pBR322 as the c o l i r e p l i c o n p l u s Gram-positive r e p l i c o n s such as pBD9, pBD64, or pUB110 (151). Frequently however, s t a b i l i t y problems have been encountered with these b i - f u n c t i o n a l plasmids e s p e c i a l l y a f t e r t r a n s f o r m a t i o n i n t o a Ek_ s u b t i l i s host (152). U s u a l l y , t h i s r e s u l t e d i n spontaneous d e l e t i o n of c e r t a i n regions of e i t h e r the B a c i l l u s or the E_j_ c o l l component of the plasmid, but the end r e s u l t was a s m a l l e r r e p l i c o n which was c o n s i d e r a b l y more s t a b l e than i t s parent. Very r e c e n t l y some workers have d e s c r i b e d the c o n s t r u c t i o n of composite v e c t o r s which i n c o r p o r a t e d only the o r i r e g i o n from Gram-negative and Gram-positive plasmids plus v a r i o u s i n d i v i d u a l drug r e s i s t a n c e markers and i n t e r n a l t e r m i n a t i o n s i t e s to ensure s t a b i l i t y (141). By e l i m i n a t i n g extraneous sequences, the s i z e of such b i - f u n c t i o n a l v e c t o r s was c o n s i d e r a b l y reduced and the problem of i n s t a b i l i t y i n e i t h e r host seems to have been overcome. This s e c t i o n d e s c r i b e s a number of attempts at c r e a t i n g b i - f u n c t i o n a l e x p r e s s i o n v e c t o r s based on pTLXT-11/pAS-3 and v a r i o u s B a c i l l u s r e p l i c o n s , as w e l l as composite v e c t o r s which are i n t e g r a t a b l e i n t o the B_j_ s u b t i l i s chromosome. Resul t s 1. C o n s t r u c t i o n of b i - f u n c t i o n a l c o i n t e g r a t e plasmids. i ) The f i r s t attempt at c o n s t r u c t i o n of a b i - f u n c t i o n a l 148 vector was made using the c o l i plasmid pAS-3 and the B.  s u b t i l i s plasmid pBD9 (151). pBD9 was chosen because i t has been shown to c a r r y two s e l e c t a b l e markers (kanamycin and erythromycin r e s i s t a n c e ) r a t h e r than only one, a f e a t u r e which could prove u s e f u l i n the s e l e c t i o n of recombinant clones and a l s o i n monitoring plasmid s t a b i l i t y . Both pAS-3 and pBD9 were cut at t h e i r unique P s t l s i t e s , l i g a t e d , and used to transform E_j_ c o l i HB101 to erythromycin and kanamycin r e s i s t a n c e . L i g a t i o n i n t h i s f a s h i o n r e s u l t e d i n the i n s e r t i o n a l i n a c t i v a t i o n of the a m p i c i l l i n r e s i s t a n c e gene of pAS-3 such that the recombinant plasmids only expressed the pBD9 markers. One of these c l o n e s , pAS3B, was found by r e s t r i c t i o n a n a l y s i s to have the s t r u c t u r e expected of a c o i n t e g r a t e plasmid. D i g e s t i o n of pBD9 with H p a l l r e s u l t e d i n 6 fragments (151, F i g . 24), the l a r g e s t of which (3650 bp) contained the P s t l s i t e used i n c o n s t r u c t i n g the c o i n t e g r a t e with pAS-3. D i g e s t i o n of pAS3B with H p a l l would be expected to r e s u l t i n the l o s s of the 3650 bp fragment and the appearance of two new fragments both c o n t a i n i n g sequences from pBD9 and pAS-3. As seen i n F i g . 24, d i g e s t i o n of pAS3B with H p a l l r e s u l t e d i n the appearance of two new fragments of 1010 and 2660 bp, i n d i c a t i n g that t h i s plasmid was a true c o i n t e g r a t e between pAS-3 and pBD9. Transformation of B^ s u b t i l i s 168 with pAS3B r e s u l t e d i n the appearance of erythromycin-kanamycin r e s i s t a n t c o l o n i e s at fre q u e n c i e s shown i n Table 6. Since i t was now e s t a b l i s h e d that 149 Table 6. Frequency of t r a n s f o r m a t i o n with b i - f u n c t i o n a l v e c t o r s No. of transformants per ug DNA i n : Vector E. c o l i B. s u b t i l i s 4 2 pAS3B 1 .5 X 10 3 5.5 X 10 2 pCmTv-2 4.1 x 10 3 2 .3 X 10 2 pASTV-1 5.2 X 10 3 3.6 X 10 2 PAS3C-E 2.4 X 10 3 8.1 X 10 2 pASUB-1 6.1 X 10 3 3.8 X 10 pCm-2/pAS3C 8.8 X 10 0 3 pTV8 0 5 .3 X 10 « 2 6 6 0 « 1 0 1 0 F i g u r e 24. R e s t r i c t i o n e n donuclease d i g e s t i o n p a t t e r n o f pAS3B. P u r i f i e d DNA was d i g e s t e d and e l e c t r o p h o r e s e d t h r o u g h a 4% p o l y -a c r y l a m i d e g e l as d e s c r i b e d i n the M a t e r i a l s and Methods. Lane 1, 029 d i g e s t e d w i t h H i n d l l l as m o l e c u l a r w e i g h t m a r k e r s . S i z e o f f r a g m e n t s c o r r e s p o n d s t o t h a t g i v e n i n F i g . I B and F i g . 4 . Lane 2, pAS-3 d i g e s t e d w i t h H p a l l ; Lane 3,pAS3B d i g e s t e d w i t h H p a l l ; Lane 4, pBD9 d i g e s t e d w i t h H p a l l . Arrows denote t h e two new f r a g m e n t s of 2660 and 1010 bp i n pAS3B c r e a t e d from t h e 3650 bp (uppermost) fragment o f pBD9 (see t e x t f o r d e t a i l s ) . 151 p A S 3 B could r e p l i c a t e i n s u b t i l i s and E_^_ c o l i , the 427 bp B. s u b t i l i s rrnB promoter fragment was i s o l a t e d from pKK-427B ( F i g . 3 A , Chapter 1), cloned i n t o the Smal s i t e of p A S 3 B (analogous to the Sma s i t e of pAS-3, F i g . 21) and used to transform c o l i HB101 to erythromycin, kanamycin r e s i s t a n c e . Yellow c o l o n i e s (xylE ) were s e l e c t e d at fre q u e n c i e s of about 1 i n 20 a f t e r spraying recombinant c o l o n i e s with a c a t e c h o l s o l u t i o n . Of 10 xy l E clones analyzed, a l l c a r r i e d plasmids but a l l plasmids were s u b s t a n t i a l l y s m a l l e r (by about r000-1500 bp) than the o r i g i n a l p A S 3 B v e c t o r (data not shown). Because of the l a r g e s i z e of the recombinant plasmids (approximately 14 Kb) i t was d i f f i c u l t to assess whether a l l were delet e d to the same extent or whether there was some he t e r o g e n e i t y . R e s t r i c t i o n endonuclease mapping was not performed. However, a f t e r d i g e s t i o n of the x y l E recombinants with EcoRI and BamHI, a fragment the same s i z e as the a u t h e n t i c 427 bp promoter fragment could be l i b e r a t e d , i n d i c a t i n g t h a t the cloned promoter was probably u n a l t e r e d . When + plasmid DNA from these x y l E recombinant clones was added to competent B_^  s u b t i l i s 168 c e l l s , no erythromycin or kanamycin r e s i s t a n t transformants could be i s o l a t e d . The d e l e t i o n that occurred during the c l o n i n g of the 427 bp promoter t h e r e f o r e apparently encompassed some regions of the pBD9 p o r t i o n of p A S 3 B that were necessary f o r r e p l i c a t i o n i n B_^  3 u b t l l i s . i i ) In an attempt to reduce the s i z e of the b i f u n c t i o n a l 152 v e c t o r , a c o i n t e g r a t e between pAS-3 and pUB110 was c o n s t r u c t e d . This 4.5 Kb plasmid was o r i g i n a l l y i s o l a t e d from Staphlococcus  aureus (114, 151) but could r e p l i c a t e i n s u b t i l l s and express kanamycin r e s i s t a n c e i n t h i s host. Both pAS-3 and pUB110 were l i n e a r i z e d with EcoRI , l i g a t e d , and used to transform E_;_ c o l i HB101. Ampicillin-kanamycin r e s i s t a n t c o l o n i e s which arose were a l l seen to c a r r y plasmids l a r g e r than e i t h e r of the o r i g i n a l p a r e n t a l plasmids. The c l o n i n g s t r a t e g y used here r e s u l t e d i n the l o s s of the upstream t r a n s c r i p t i o n terminator present i n pAS-3; t h i s apparently d i d not lead to read through t r a n s c r i p t i o n of the x y l E s t r u c t u r a l gene s i n c e a l l of the a m p i c i l l i n - k a n a m y c i n r e s i s t a n t c o l o n i e s d i s p l a y e d a x y l E phenotype. One of these plasmids, pASUB-1, was d i g e s t e d with EcoR1 and found to g i v e two fragments on agarose g e l s i d e n t i c a l i n s i z e to E c o R 1 - l i n e a r i z e d pAS-3 and E c o R I - l i n e a r i z e d pUB110 (data not shown). This i n d i c a t e d that pASUB-1 was indeed a c o i n t e g r a t e between the two p a r e n t a l plasmids. s u b t i l i s 168 transformed with pASUB-1 DNA gave r i s e to kanamycin r e s i s t a n t c o l o n i e s with the frequency shown i n Table 6, but none of these were r e s i s t a n t to a m p i c i l l i n as w e l l , suggesting that the b l a gene of pAS-3 was not expressed i n JB_^  s u b t i l i s . The 427 bp s u b t i l i s rrnB promoter fragment was cloned + i n t o the Smal s i t e of pASUB-1 and x y l E E. c o l i transformants i s o l a t e d . These recombinants a l l c a r r i e d plasmids of the expected s i z e and a l l had promoter i n s e r t s of the c o r r e c t s i z e . 153 One of these plasmids, pASUB-427B, was used to transform B. s u b t i l i s to kanamycin r e s i s t a n c e . However, none of the c o l o n i e s + which arose d i s p l a y e d the x y l E phenotype. A n a l y s i s of the plasmid DNA from 5 of these kanamycin r e s i s t a n t B_^  s u b t i l i s clones r e v e a l e d i n a l l cases, the presence of plasmids which were between 2 and 2.4 kb s m a l l e r than the o r i g i n a l pASUB-427B. In t h i s case t h e r e f o r e , the b i - f u n c t i o n a l pASUB-427B v e c t o r appeared to be s t a b l e i n c o l i but t r a n s f e r to B_^  s u b t i l i s r e s u l t e d i n d e l e t i o n of c e r t a i n pAS-3 r e l a t e d sequences i n v o l v i n g the cloned promoter i n s e r t , the x y l E s t r u c t u r a l gene, or both. i i i ) A number of b i - f u n c t i o n a l v e c t o r s based on pTLXT-11 or pAS-3 and fragments d e r i v e d from the B^ s u b t i l i s plasmid pTV8 were co n s t r u c t e d (153). This l a t t e r plasmid c a r r i e d the temperature s e n s i t i v e r e p l i c a t i o n f u n c t i o n s from pE194 as w e l l as the complete Tn917 transposon (a m a c r o l i d e - l i n c o s a m i d e r e s i s t a n c e transposon from Streptococcus f a e c a l l s ) . Transformation of pTV8 i n t o a B_j_ s u b t i l i s host c a r r y i n g a chromosomal copy of Tn917, o followed by a temperature u p s h i f t to 42 C would r e s u l t i n the i n t e g r a t i o n of the e n t i r e pTV8 vector i n t o the chromosome by recombination i n the r e g i o n of Tn917 homology (153). I t was a n t i c i p a t e d that b i - f u n c t i o n a l v e c t o r s could be c r e a t e d which would r e p l i c a t e autonomously i n E_j_ c o l i but could be s t a b i l i z e d i n B^ s u b t i l i s by i n t e g r a t i o n as a s i n g l e copy i n t o the chromosome. F i g u r e 25 shows the s t r u c t u r e of one set of these 154 Figure 25. Structure of pCmTv-2/pASTV-l. pCmTv-2 was created from pTLXT-11 (see Fig. 21) by i n s e r t i o n of a chloramphenicol acetyltransferase gene from pC194 into the P s t l s i t e of pTLXT-11, followed by in s e r t i o n of a 6.8 Kb P s t l - Kpnl fragment from pTV-8 into the Pvul s i t e of pCmTv-2 (see text f o r d e t a i l s ) . As indicated, t h i s fragment contains roughly two-thirds of the Tn917 transposon as well as the temperature-sensitive o r i g i n of r e p l i c a t i o n from pE194 (denoted as " o r i " ) . A l l other sequences are as shown i n Fig. 21. pASTV-1 i s i d e n t i c a l to pCmTv-2 but with the addition of the lambda tRl tra n s c r i p t i o n terminator into the Hpal s i t e as seen i n Fig.21. R e s t r i c t i o n s i t e s are: Ps, P s t l ; Pv, Pvul; E, EcoRI; S, Smal; B, Bam HI; H, Hpal; K, Kpnl; Sa, S a i l ; A, Aval. 155 plasmids, pCmTv-2 and pASTV-1. I n i t i a l l y , the b l a gene of pTLXT-!1/pAS-3 was i n a c t i v a t e d by i n s e r t i n g i n t o the unique P s t l s i t e a 1032 bp Mspl-Mbol fragment c a r r y i n g the chloramphenicol a c e t y l t r a n s f e r a s e gene of pC194 (146). The r e s u l t i n g plasmids, pCm-2/pAS3C, could s t i l l only r e p l i c a t e i n JL_ c o l i but could p o t e n t i a l l y express chloramphenicol r e s i s t a n c e i n both JL_ c o l i and B_j_ s u b t i l i s . A 6.8 Kb P s t l - K p n l fragment from pTV8 (153) c a r r y i n g the o r i g i n of r e p l i c a t i o n and about two-thirds of the Tn917 transposon, was then i n s e r t e d i n t o the Pvul s i t e of pCm-2/pAS3C The r e s u l t i n g v e c t o r s , pCmTv-2/pASTV-1, were both capable of r e p l i c a t i o n i n JL_ c o l i and i n B_^  s u b t i l i s (see Table 6 ) . In a d d i t i o n , a s m a l l e r fragment from pTV8 was a l s o i n s e r t e d i n t o pAS3C. A 3400 bp EcoRI fragment from pASTV-1 (see F i g . 25) was cloned i n t o the P s t l s i t e of pAS3C. This fragment con-tai n e d only the pE194-derived o r i g i n of r e p l i c a t i o n from pTV8 such that the new recombinant plasmid, pAS3C-E was able to r e p l i c a t e autonomously i n B_j_ s u b t i l i s (Table 6) but should not i n t e g r a t e i n t o the chromosome s i n c e the Tn917 re g i o n of homology was l a c k i n g . 156 While pCmTv-2, pASTV - 1 , and pAS3C-E a l l appeared s t a b l e i n E. c o l l and could r e p l i c a t e i n B^ s u b t i l i s . problems arose when attempts were made to i n s e r t the 427 bp rrnB promoter so as to a c t i v a t e the x y l E gene. In a l l cases, x y l E recombinants c o u l d be i s o l a t e d but these e i t h e r : a) showed no evidence of an i n t a c t + promoter i n s e r t (while r e t a i n i n g the x y l E phenotype i n E. c o l i ) and could be used to transform B_;_ 3 u b t i l i s where they were p h e n o t y p i c a l l y x y l E or b) contained an i n t a c t 427 bp promoter but grew c o n s i d e r a b l y slower than c e l l s c o n t a i n -ing only the p a r e n t a l v e c t o r . In a d d i t i o n , these l a t t e r recomb-inant plasmids were c o n s i d e r a b l y s m a l l e r than the o r i g i n a l v e c t o r and were unable to transform B_^  s u b t i l i s . Thus, as seen f o r previous b i - f u n c t i o n a l v e c t o r s , these plasmids a l s o d i s p l a y e d s e r i o u s s t a b i l i t y problems c o i n c i d e n t with attempts to i n s e r t the B_^  s u b t i l i s rrnB promoter. 2 . C o n s t r u c t i o n of i n t e g r a t i v e plasmid p A S 3 C - l 6 8 . Since attempts at c o n s t r u c t i n g d u a l - o r i g i n b i - f u n c t i o n a l v e c t o r s had c o n s i s t e n t l y f a i l e d , a d i f f e r e n t approach was taken i n an attempt to o b t a i n expression of the r r n B - x y l E f u s i o n i n B a c i l l u s . Other workers have shown that plasmids which are incapable of r e p l i c a t i o n i n IK_ s u b t i l i s may n e v e r t h e l e s s become e s t a b l i s h e d i n t h i s host by i n t e g r a t i o n i n t o the chromosome i f they c a r r y a segment of DNA having homology to JL_ s u b t i l i s 157 chromosomal sequences ( 96 , 154). The plasmid pAS3C (above) r e p l i c a t e d only i n c o l i but c a r r i e d an a n t i b i o t i c - r e s i s t a n c e marker e x p r e s s i b l e i n both E_;_ c o l i and s u b t i l i s . T o t a l chromosomal DNA was i s o l a t e d from s u b t i l i s 168 and s u b j e c t e d to p a r t i a l d i g e s t i o n with P s t l . These fragments were then l i g a t e d to P s t l - l i n e a r i z e d pAS3C and used to transform E_j_ c o l i HB101 to chloramphenicol r e s i s t a n c e . Two clones c o n t a i n i n g plasmid DNA l a r g e r than the p a r e n t a l v e c t o r were i d e n t i f i e d and analyzed by d i g e s t i o n with P s t l . As seen i n F i g . 26, both recombinant plasmids contained i n s e r t s which could be l i b e r a t e d by P s t l ; pAS3C - l68-4 contained one fragment of approximately 1800 bp whereas pAS3C - l68-3 contained 2 fragments of about 1100 bp and 1600 bp. s u b t i l i s 168 could be transformed to chloramphenicol-r e s i s t a n c e with e i t h e r -168-3 or -168-4 at f r e q u e n c i e s of 420 and 155 c o l o n i e s per ug of plasmid DNA r e s p e c t i v e l y . Plasmid DNA could not be detected i n the transformants so i t was assumed that chromosomal i n t e g r a t i o n had o c c u r r e d . To see i f these v e c t o r s could express x y l E a c t i v i t y a f t e r i n t e g r a t i o n , the 427 bp rrnB promoter was cloned i n t o the Smal s i t e of pAS3C - l68-3 and x y l E + recombinants i s o l a t e d from E^ _ c o l i HB101. These x y l E clones were s t a b l e i n E^ c o l i and c a r r i e d a promoter i n s e r t of the c o r r e c t s i z e . When used to transform B_j_ s u b t i l l s , c h l o r a m p h e n i c o l - r e s i s t a n t clones could be i s o l a t e d at f r e q u e n c i e s + s i m i l a r to that seen f o r the p a r e n t a l v e c t o r , but the x y l E phenotype was only b a r e l y d e t e c t a b l e even a f t e r the p l a t e s had 1 2 3 Figure 2 6 . R e s t r i c t i o n endonuclease digestion pattern of p A S 3 C - 1 6 8 i n t e g r a t i v e plasmids. Plasmid DNA was digested and electrophoresed through a 4% poly-acrylamide gel. Lane 1 , p A S 3 C - 1 6 8 - 4 digested with P s t l ; Lane 2 , p A S 3 C - 1 6 8 - 3 digested with P s t l ; Lane 3 , 0 2 9 digested with H i n d l l l as molecular weight markers. Relevant sizes are noted at the r i g h t , i n base p a i r s . 159 been l e f t f o r s e v e r a l h o u r s a f t e r s p r a y i n g w i t h t h e c a t e c h o l s u b s t r a t e . C a t e c h o l 2 , 3 - d i o x y g e n a s e a c t i v i t y f r o m t h e s e c l o n e s c o u l d n o t be a c c u r a t e l y measured u s i n g t h e s t a n d a r d a s s a y c o n d i t i o n s d e s c r i b e d i n the M a t e r i a l s and Methods ( a c t i v i t y l e s s t h an 50 u n i t s ) . Thus i t a p p e a r e d t h a t i n t e g r a t i v e v e c t o r s o f t h i s t y p e were n o t s u i t a b l e f o r the p u r p o s e s o r i g i n a l l y o u t l i n e d . D i s c u s s i o n The g o a l o f t h e above e x p e r i m e n t s was t o d e v e l o p a means o f t r a n s f e r r i n g a f u n c t i o n a l o p e r o n f u s i o n s y s t e m f r o m E_j_ c o l i t o B.  s u b t i l i s . I n t h i s way, the r e g u l a t i o n o f c l o n e d p r o m o t e r s c o u l d be s t u d i e d i n p a r a l l e l i n t h e s e two h o s t s . To t h i s end, two a p p r o a c h e s have been t a k e n . F i r s t l y , a s e t o f d u a l - o r i g i n b i -f u n c t i o n a l p l a s m i d v e c t o r s w hich c o u l d be us e d t o s h u t t l e a p r o m o t e r - x y l E f u s i o n between J L _ c o l i and J k _ s u b t i l i s has been c o n s t r u c t e d ; and s e c o n d l y , an J L _ c o l i v e c t o r was m o d i f i e d s u c h t h a t i t c o u l d i n t e g r a t e as a s i n g l e c o p y i n t o t h e B_^  s u b t i l i 3 chromosome. U n f o r t u n a t e l y , n e i t h e r o f t h e s e a p p r o a c h e s was e n t i r e l y s u c c e s s f u l . I n t h e c a s e o f t h e b i - f u n c t i o n a l v e c t o r s , t h e major p r o b l e m a p p e a r e d t o be t h e s t a b i l i t y o f t h e c h i m e r i c p l a s m i d s , e i t h e r i n J L _ c o l i o r when t r a n s f e r r e d t o B_^  s u b t i l i s , or a f t e r i n s e r t i o n o f p r o m o t e r f r a g m e n t s . The b i - f u n c t i o n a l c o i n t e g r a t e p l a s m i d s p A S 3 B and pASUB-1 were a p p a r e n t l y s t a b l e i n E. c o l i and c o u l d t r a n s f o r m B_j_ s u b t i l i s . a l t h o u g h a t low f r e q u e n c i e s . The o b s e r v e d d i f f e r e n c e s i n t r a n s f o r m a t i o n 160 frequency from one plasmid to another may not be a r e f l e c t i o n of the composition of the plasmids per se, but probably are due to d i f f e r e n c e s i n the degree of multimeric formations from one plasmid p r e p a r a t i o n to another. Canosi e_t al_. (155) have shown that e f f i c i e n t t r a n s f o r m a t i o n of competent s u b t i l i s c e l l s was only achieved using multimeric forms of plasmid DNA. Plasmid multimers are generated i n c o l i but t h i s could vary f o r d i f f e r e n t plasmids and thus lead to d i f f e r e n c e s i n t r a n s f o r m a t i o n e f f i c i e n c y . Both p A S 3 B and pASUB-1 were rendered unstable by i n s e r t i o n of the 427 bp B^ s u b t i l i s rrnB promoter and a c t i v a t i o n of the x y l E gene. In the case of p A S 3 B , t h i s r e s u l t e d i n e x t e n s i v e d e l e t i o n of v e c t o r sequences such that,recombinant plasmids could s t i l l r e p l i c a t e i n c o l i but could no longer transform B. s u b t i l i s . Thus i t appeared that the B a c i l l u s - s p e c i f i c sequences on the chimeric v e c t o r s were targ e t e d f o r d e l e t i o n . In pASUB-1, a promoter-containing clone was s t a b l e i n E_j_ c o l i and could transform s u b t i l i s but the r e s u l t i n g B_^  s u b t i l i s recombinant + plasmids were d e l e t e d and d i d not maintain a x y l E phenotype. In t h i s case t h e r e f o r e , an E_;_ c o l i - s p e c i f i c sequence may be d e l e t e d although t h i s was not d i r e c t l y v e r i f i e d . A s i m i l a r s i t u a t i o n occurred with the pASTV/CmTv set of v e c t o r s i n that they were s t a b l e i n E_^  c o l i and could transform 161 B. s u b t i l i s . However, when the rrnB promoter was I n s e r t e d , d e l e t i o n s were generated e i t h e r d i r e c t l y a f t e r t r a n s f o r m a t i o n of E. c o l i or a f t e r r e - t r a n s f e r to a B_^  s u b t i l i s host. In no case could a s t a b l e x y l E phenotype be maintained i n B_j_ s u b t i l i 3 U 3 i n g these autonomously r e p l i c a t i n g v e c t o r s . Instances of plasmid i n s t a b i l i t y s i m i l a r to these have been w e l l documented and are a major problem i n the development of an e f f i c i e n t c l o n i n g system f o r IL_ s u b t i l i s . Grandi e_t al.. (156) f o r example, c o n s t r u c t e d a hybrid between the B a c i l l u s plasmid pSA2100 and a pBR322 d e r i v a t i v e c a r r y i n g the E_;_ c o l i hisG gene. Such hybrids were s t a b l e i n JL_ c o l i but s u f f e r e d d e l e t i o n s to v a r i o u s extents when introduced i n t o B_;_ s u b t i l i s . S i m i l a r l y , O s t r o f f and Pene (152, 157) noted that B_^  s u b t i l i s DNA sequences cloned i n JL_ c o l l and subsequently r e - i n t r o d u c e d i n t o B_^  s u b t i l i s v i a a b i - f u n c t i o n a l vector underwent severe d e l e t i o n s that i n v o l v e d both v e c t o r and i n s e r t sequences and were not prevented by the use of an r ,m recEM B a c i l l u s h o s t . The vector i t s e l f , without cloned i n s e r t s , was uniformly s t a b l e i n both hosts. In a d d i t i o n , the problem of s t r u c t u r a l i n s t a b i l i t y appeared to be due s o l e l y to the passage of cloned i n s e r t s through E_j_ c o l i p r i o r to r e - i n t r o d u c t i o n i n t o B. s u b t i l i s . The reason f o r the s t a b i l i t y problems observed by these and other workers, as w e l l as i n t h i s r e p o r t , are not e n t i r e l y c l e a r . E h r l i c h e_t a_l. (150) have p o s t u l a t e d the e x i s t e n c e i n B a c i l l u s of a h i g h l y e f f i c i e n t recombination mechanism which i s a c t i v e on sequences with only l i m i t e d amounts of homology. Recombination between sequences w i t h i n a cloned i n s e r t or between i n s e r t and vector sequences would lead to the formation of d e l e t e d v a r i a n t s which would soon predominate i n the c e l l p o p u l a t i o n . Supporting t h i s hypothesis i s the ob s e r v a t i o n that B_^  s u b t i l i s plasmids recombine very f r e q u e n t l y , p o s s i b l y because they can e x i s t as s i n g l e - s t r a n d e d DNA molecules w i t h i n the c e l l (159). A l t e r n a t i v e l y , O s t r o f f and Pene (157) have suggested that some d e l e t i o n s may occur during the DNA pr o c e s s i n g events necessary f o r the uptake of plasmid DNA during t r a n s f o r m a t i o n . Since the a c t i v e t r a n s f o r m i n g DNA molecules are chimeric t r i m e r s which are l i n e a r i z e d upon contact with competent c e l l s and subsequently r e c i r c u l a r i z e d a f t e r uptake (158), the l a r g e s i z e of most b i -f u n c t i o n a l v e c t o r s could exceed the len g t h of processed DNA and thus n e c e s s i t a t e some d e l e t i o n events (157). I t may be of s i g n i f i c a n c e then that the hybr i d v e c t o r s used here were r e l a t i v e l y l a r g e , ranging from 11 to 15 Kb. F i n a l l y , O s t r o f f and Pene (157) have suggested that some as yet u n i d e n t i f i e d r e s t r i c t i o n - m o d i f i c a t i o n system of B_j_ s u b t i l i s . d i f f e r e n t from the weak h3dM,R system thus f a r i d e n t i f i e d , could a l s o generate i n s t a b i l i t y i n chi m e r i c sequences modified by passage through E.  c o l i . I t must be noted however, that s t a b i l i t y problems were not apparent when plasmids capable of i n t e g r a t i o n i n t o the B.  s u b t i l l s chromosome were used as ex p r e s s i o n v e c t o r s (see below). I t i s p o s s i b l e that the multicopy nature of the b i - f u n c t i o n a l 163 hybrid v e c t o r s used above i s a c o n t r i b u t i n g f a c t o r to t h e i r i n s t a b i l i t y i n Jk_ s u b t i l i s . I t would seem t h e r e f o r e that the hypothesis put f o r t h by E h r l i c h e_t al_. (150, see above) may be the most reasonable. Whatever the reason f o r the s t r u c t u r a l i n s t a b i l i t y of the v e c t o r s used here, i t i s c l e a r that b i -f u n c t i o n a l or h y b r i d f u s i o n v e c t o r s of t h i s type are u n s u i t a b l e f o r the purposes intended, namely as a means of undertaking p a r a l l e l s t u d i e s of a p a r t i c u l a r gene sequence i n two d i f f e r e n t host organisms. A d i f f e r e n t approach to t h i s goal was taken i n the c o n s t r u c t i o n of the i n t e g r a t a b l e e x p r e s s i o n v e c t o r s pAS3C-l68 -3 and pAS3C-l68-4. Here i s was reasoned that the i n t r o d u c t i o n of a s u i t a b l y l a r g e r e g i o n of s u b t i l i s chromosomal DNA onto a plasmid v e c t o r which could not r e p l i c a t e i n B_;_ s u b t i l i s would lead to i n t e g r a t i o n of the e n t i r e plasmid i n t o the B a c i l l u s chromosome v i a a homologous recombination event. This approach had p r e v i o u s l y been shown to be u s e f u l i n the g e n e t i c mapping of a number of IL_ s u b t i l i s genes (154), i n c l u d i n g ribosomal RNA genes (96). Both pAS3C-l68-3 and -168-4 were shown to c o n t a i n B a c i l l u s chromosomal sequences and both could transform B.  s u b t i l i s 168 to chloramphenicol r e s i s t a n c e while a p p a r e n t l y not remaining as autonomously r e p l i c a t i n g molecules i n the transformed c e l l s . I t must be pointed out however that proof of chromosomal i n t e g r a t i o n , v i a Southern h y b r i d i z a t i o n a n a l y s i s f o r example, has not been demonstrated here, although the 164 c i r c u m s t a n t i a l evidence as d i s c u s s e d above p o i n t s to t h i s being the case. Even t h i s however was not a completely s u i t a b l e f u s i o n + system because although the x y l E phenotype could be expressed i n B. s u b t i l i s , the l e v e l of c a t e c h o l 2,3-dioxygenase a c t i v i t y was too low to be a c c u r a t e l y measured. Since the x y l E mRNA was e f f i c i e n t l y t r a n s l a t e d i n B a c i l l u s (126), the low l e v e l of expression was presumably due to a combination of two other f a c t o r s . Because chromosomal i n t e g r a t i o n had occurred, the copy number of the rrnB promoter-xylE f u s i o n had been reduced to one per chromosome i n B_^  s u b t i l i s i n c o n t r a s t to the multicopy, autonomously r e p l i c a t i n g s t a t e i n JL_ c o l i . O v e r a l l x y l E a c t i v i t y may t h e r e f o r e be expected to be reduced as much as 15-20 f o l d i n B a c i l l u s , based on the known copy number of pBR322 i n JL. c o l i (160). A d d i t i o n a l l y , the pAS3C-l68 v e c t o r s contained the lambda tR1 t r a n s c r i p t i o n terminator proximal to the x y l E gene. This terminator has r e c e n t l y been shown to be recognized by a B.  s u b t i l i s sigma-55 RNA polymerase complex i n an i n v i t r o t r a n s c r i p t i o n system (141), so i t can be assumed that i t i s operable to the same extent in. v i v o as w e l l . This would f u r t h e r reduce the number of x y l E - s p e c i f i c t r a n s c r i p t s and reduce the o v e r a l l c a t e c h o l 2,3-dioxygenase a c t i v i t y to l e v e l s unmeasurable by the assay employed here. While i t would be p o s s i b l e to remove the lambda terminator from pAS3C-l68, t h i s would have a s e r i o u s 165 drawback i n that the tandem rrnB promoter-xylE f u s i o n s would once again be unstable i n c o l i and make subsequent manipulation of the plasmids much more d i f f i c u l t . In c o n c l u s i o n , a means of s t a b l y i n t r o d u c i n g strong cloned promoters i n t o both c o l i and B_^  s u b t i l i s ( v i a p A S 3 C - l 6 8 - 3 ) has been developed, but t h i s approach d i d not allow measurements of the degree of e x p r e s s i o n of these cloned promoters. Because of t h i s , i t has not been p o s s i b l e to e f f e c t i v e l y compare the expression of the B_^  s u b t i l i s rrnB promoters i n both E_j_ c o l i and B. s u b t i l i s , as was the o r i g i n a l i n t e n t . The major problem encountered here appeared to i n v o l v e the i n t r o d u c t i o n of promoter f u s i o n v e c t o r s i n t o B_^  s u b t i l i s . Other mechanisms, p o s s i b l y the t r a n s f e r of only the promoter-xylE gene as a p o r t a b l e " c a s s e t t e " onto a B a c i l l u s phage, may have to be c o n s i d e r e d . Summary and Concluding Remarks The three chapters presented above o u t l i n e a means whereby the promoter r e g i o n of the B_^  s u b t i l l s rrnB ribosomal RNA operon can be cloned and expressed i n E_^  c o l l . T h i s has been achieved through a f u s i o n of the promoter to an assayable marker gene but of two such f u s i o n systems t e s t e d , only one was found to be a v a l i d means of a s s e s s i n g promoter a c t i v i t y jLn v i v o . A number of operon f u s i o n - t y p e e x p r e s s i o n v e c t o r s were 166 created based on the c a t e c h o l 2,3-dioxygenase (x y l E ) gene of Pseudomonas p u t i d a . While these v e c t o r s may be g e n e r a l l y u s e f u l i n the c l o n i n g and maintenance of both weak and very s t r o n g promoters, they were not s u i t a b l e f o r a s s e s s i n g the t r a n s c r i p t i o n a l a c t i v i t y of cloned promoters when the host c e l l s were placed under d i f f e r e n t p h y s i o l o g i c a l c o n d i t i o n s . Under such c o n d i t i o n s , i t appeared that the x y l E operon f u s i o n system was s e n s i t i v e to other, i l l - d e f i n e d , parameters which masked or obscured the true t r a n s c r i p t i o n a l a c t i v i t y of the cloned promoters. When us i n g the x y l E system, a comparison of the t r a n s c r i p t i o n a l a c t i v i t y of d i f f e r e n t promoters would t h e r e f o r e only be v a l i d i f the growth c o n d i t i o n s of the host c e l l s were equ i v a l e n t i n a l l cases. Furthermore, attempts were made to modify the o r i g i n a l x y l E -based f u s i o n v e c t o r s such that they could serve as promoter-probe or expression v e c t o r s i n both E_;_ c o l i and B_j_ s u b t i l i s . T h i s was based on previous o b s e r v a t i o n s t h a t , u n l i k e most other Gram-negative genes, the x y l E messenger RNA could be e f f i c i e n t l y t r a n s l a t e d i n B_^_ s u b t i l i s . These attempts led to the c o n s t r u c t i o n of a number of b i - f u n c t i o n a l f u s i o n v e c t o r s which were shown to r e p l i c a t e i n both E_j_ c o l l and s u b t i l i s . However, once promoters were i n s e r t e d to a c t i v a t e t r a n s c r i p t i o n of the x y l E gene, s e r i o u s s t a b i l i t y problems arose which prevented the e x p r e s s i o n of any such promoter-fusion system i n 167 B. s u b t i l i s . These s t a b i l i t y problems could a p p a r e n t l y be avoided i f the operon f u s i o n was i n t e g r a t e d as a s i n g l e copy i n t o the B. + s u b t i l i s chromosome. Un f o r t u n a t e l y , e x p r e s s i o n of the x y l E phenotype was very poor under such c o n d i t i o n s because of the reduced copy number and because of the n e c e s s i t y of r e t a i n i n g a t r a n s c r i p t i o n t e r minator between the cloned promoter and the x y l E s t r u c t u r a l gene. While these v e c t o r s would undoubtedly be u s e f u l f o r other purposes ( i . e . c l o n i n g and e x p r e s s i o n of very s t r o n g homologous or heterologous promoters i n JL_ c o l i ; i n t e g r a t i o n of cloned sequences i n t o the B_^  s u b t i l i s chromosome), they d i d not f u l f i l l the o r i g i n a l i n t e n t of p r o v i d i n g a means of s t u d y i n g the i n vivo r e g u l a t i o n of a given promoter i n two d i f f e r e n t h o s t s . Although i t was only p o s s i b l e to study the e x p r e s s i o n of the B.  s u b t i l i s rrnB promoters i n a heterologous E_j_ c o l i background, these s t u d i e s n e v e r t h e l e s s provided some s u b s t a n t i a l i n s i g h t i n t o the r e g u l a t i o n of these promoters, and when compared to the n a t i v e E_^  c o l i rRNA promoters, suggested that present models to account f o r the growth r a t e dependent r e g u l a t i o n of rRNA s y n t h e s i s may be o v e r l y s i m p l i s t i c . In t h i s system, the B_j_ s u b t i l i s rrnB tandem promoters, or subclones t h e r e o f , were fused to the gene f o r chloramphenicol a c e t y l t r a n s f e r a s e (CAT) on a multicopy plasmid that permitted the maintenance of s t r o n g promoters. The i l l v i v o promoter a c t i v i t y i n E\_ c o l i could be i n d i r e c t l y determined by measuring the CAT s p e c i f i c a c t i v i t y . A number of c o n t r o l experiment showed t h i s 168 measurement to be e n t i r e l y v a l i d s i n c e the CAT s p e c i f i c a c t i v i t y was d i r e c t l y p r o p o r t i o n a l to the amount of CAT gene messenger RNA produced by the promoter f u s i o n . I t was observed that the B.  s u b t i l l s rrnB promoters were expressed i n a growth r a t e dependent manner i n E_^  c o l i , i n the same f a s h i o n as the n a t i v e E_;_ c o l i rrnB promoters. While i t had been known f o r some time that a number of B.  s u b t i l l s genes could be t r a n s c r i b e d with reasonable e f f i c i e n c y i n E. c o l i , the f i n d i n g s presented here demonstrated that higher l e v e l r e g u l a t o r y mechanisms, at l e a s t as f a r as ribosomal RNA s y n t h e s i s i s concerned, may a l s o be f u n c t i o n a l l y i n t e r c h a n g e a b l e between these two e v o l u t i o n a r y d i v e r g e n t organisms. Whether t h i s c o n s e r v a t i o n i s true only f o r those f a c t o r s r e g u l a t i n g e x p r e s s i o n of rRNA genes remains to be determined, but the r e s u l t s presented here do suggest a strong e v o l u t i o n a r y c o n s e r v a t i o n among components of the t r a n s c r i p t i o n - t r a n s l a t i o n apparatus of Gram-negative and Gram-positive organisms. I t i s important to p o i n t out however that the p o s s i b l e c o n s e r v a t i o n of higher l e v e l r e g u l a t o r y mechanisms may not extend to a l l genes or operons shared by E^ c o l i and Jk_ s u b t i l l s . T h i s i s evidenced by the f a c t that very few E_j_ c o l i genes or promoters f u n c t i o n e f f i c i e n t l y i n B. s u b t i l i s , i n d i c a t i n g that B a c i l l u s i s l e s s f l e x i b l e i n terms of the types of f o r e i g n sequences that i t can r e g u l a t e . C l e a r l y , f u r t h e r i i i v i v o s t u d i e s of B_^  s u b t i l i s genes and promoters i n 169 B a c i l l u 3 are r e q u i r e d . Furthermor, i t i s c l e a r from t h i s study that s i g n i f i -cant d i f f e r e n c e s do e x i s t when the e x p r e s s i o n of B_^  s u b t i l i s and c o l i rRNA promoters are examined more c l o s e l y . By se p a r a t i n g and i n d i v i d u a l l y c l o n i n g the upstream P1 and downstream P2 Jk_ s u b t i l l 3 promoters, i t was shown that the P2 promoter was the more a c t i v e , growth r a t e r e g u l a t e d promoter of the tandem p a i r . Conversely, the JL_ c o l i rrnB promoters showed the reverse p a t t e r n of exp r e s s i o n i n that P1 was the s t r o n g , regulated promoter. A d d i t i o n a l l y , others have found that d e l e t i o n of sequences upstream of the -35 s i t e of the EL_ c o l i P1 promoter r e s u l t e d i n a s i g n i f i c a n t r e d u c t i o n i n the o v e r a l l l e v e l of expression of the P1 promoter. Here however, i t was shown that d e l e t i o n of the analogous sequences from t h e X s u b t i l i s  rrnB promoter r e g i o n had no e f f e c t on downstream e x p r e s s i o n . Furthermore, s t u d i e s with the t e r m i n a t o r - c o n t a i n i n g x y l E f u s i o n vector i n d i c a t e d t h at t r a n s c r i p t s emanating from the E_j_ c o l i rrnB promoters could e f f i c i e n t l y read through a downstream rho-dependent t e r m i n a t o r . T r a n s c r i p t s from the B_^  s u b t i l i s promoters were l a r g e l y blocked by t h i s t e r m i n a t o r , i n d i c a t i n g that a n t i t e r m i n a t i o n f u n c t i o n s were e i t h e r not present i n B_j_ s u b t i l i s rRNA promoters or simply were not f u n c t i o n a l i n a heterologous E.  c o l i host. I t appears t h e r e f o r e that a p r e c i s e analogy to JL_ c o l i rRNA 170 promoters i s not necessary i n order that a c h a r a c t e r i s t i c growth r a t e dependent response be e l i c i t e d ; c e r t a i n f e a t u r e s of these promoters, as i l l u s t r a t e d by the s u b t i l i s rrnB promoters, can be a l t e r e d without d i m i n i s h i n g t h e i r response to i n c r e a s i n g c e l l u l a r growth r a t e . For example, the placement of a s t r o n g , r e g u l a t e d promoter upstream of the weaker, non-regulated promoter i s unnecessary s i n c e t h i s could be r e v e r s e d i n B_;_ s u b t i l i s without any l o s s of growth r a t e r e g u l a t i o n . Secondly, the h i g h l y A-T r i c h sequence l o c a t e d upstream of the -35 r e g i o n of a l l P1 promoters i n both c o l l and B^ s u b t i l i s i s not r e q u i r e d f o r e i t h e r enhancement of the o v e r a l l l e v e l of e x p r e s s i o n or i n the expression of a growth r a t e dependent response s i n c e t h i s r e g i o n could be completely d e l e t e d from the B_^  s u b t i l i s promoters without any change i n the p a t t e r n of e x p r e s s i o n . In t h i s regard i t may be necessary to r e - e v a l u a t e some f e a t u r e s of the v a r i o u s mechanisms proposed to e x p l a i n the c o n t r o l of growth r a t e dependent gene expression i n E_^_ c o l i , as pointed out i n the D i s c u s s i o n (Chapter 1). From the evidence presented here i t has been concluded that the mechanisms that ensure the growth r a t e dependent s y n t h e s i s of rRNA do indeed act at the l e v e l of rRNA operon promoters but do so i n ways that may be more s u b t l e than p r e v i o u s l y a n t i c i p a t e d . P o s s i b l y t h i s could i n v o l v e some s e q u e n c e - s p e c i f i c c o n f o r m a t i o n a l changes i n the DNA surrounding growth r a t e r e g u l a t e d promoters, but changes that can be brought about by a number of d i f f e r e n t 171 but analogous sequences. In a d d i t i o n , there may be an i n t e r a c t i o n between the P1 and P2 promoters which serves to " f i n e - t u n e n the l e v e l of rRNA s y n t h e s i s to the extent a p p r o p r i a t e f o r a given set of growth c o n d i t i o n s , as p o s t u l a t e d i n Chapter 1. Furthermore, the p o s s i b l e i n t e r a c t i o n s between the i n d i v i d u a l rRNA operons on the chromosome, or whether they are a l l r e g u l a t e d to the same extent, are questions which remain unanswered. C l e a r l y , f u r t h e r i n v i v o and iri v i t r o s t u d i e s are necessary to address these p o i n t s but with the operon f u s i o n v e c t o r s d e s c r i b e d and t e s t e d here, such s t u d i e s may now be p o s s i b l e . 172 REFERENCES 1. Wittmann, H.G. 1982. Components of b a c t e r i a l ribosomes. Ann. Rev. Biochem. _5_1, 155-183. 2. Schaechter, M., 0. Maaloe, N.O. Kjeldgaard. 1958. Dependency on medium and temperature of c e l l s i z e and chemical composition during balanced growth of Salmonella typhimurium. J. Gen. M i c r o b i o l . • 1_9, 592-606. 3. Maaloe, 0. and N.O. Kjeldgaard. 1966. "Control of Macro-molecular Synthesis". Benjamin, New York. 4. Lindahl, L. and J. Zengel. 1982. Expression of ribosomal genes i n b a c t e r i a . Adv. Genetics. 2_1, 53-121. 5. Neidhardt, F. 1975. Function and regulation of amino-acyl tRNA synthetase i n procaryotic and eucaryotic c e l l s . Ann. Rev. Micro.29,215. 6. Dunn, J. and F. Studier, 1973. T7 early RNA's and E . c o l i ribosomal RNA's are cut from large precursor RNA's i n vivo by ribonuclease I I I . Proc. Natl. Acad. S c i . USA 70, 3296-3300. 7-. Apirion, D. , B. Ghora, G. Plautz, T. Misra, P. Geggenheimer. 1980. Processing of ribosomal and t r a n s f e r RNA i n E . c o l i : cooperation between processing enzymes. i n "Transfer RNA: B i o l o g i c a l Aspects. (J. Abelson, ed.) pp. 139-154. Cold Spring Harbor Laboratories, Cold Spring Harbor, New York. 8. Kiss, A., B. Sain, P. Venetianer. 1977. The number of rRNA genes i n E . c o l i . FEBS Lett. 79, 77-79. 9. Ellwood, M. and M. Nomura. 1980. Deletion of a ribosomal RNA operon i n E . c o l i . J. B a c t e r i o l . 143, 1077-1080. 10. Bachman B. 1983. Linkage map of E . c o l i K-12, Edi t i o n 7. Micro. Rev. 47, 180-230. 11. Ohtsubo, E...L. S o l i , R. Deonier, H. Lee, N. Davidson. 1974. Electron microscopic heteroduplex studies of sequence r e l a t i o n among pl^smi_ds of E . c o l i . VII. The structure of bacteriophage 08Od-ilv su 7, including the mapping of rRNA genes. J. Mol. B i o l . 89, 63T :646. 12. Morgan, E., T. Ikemura, M. Nomura. 1977. I d e n t i f i c a t i o n of spacer tRNA genes i n i n d i v i d u a l rRNA t r a n s c r i p t i o n units of E . c o l i . Proc. Natl. Acad. S c i . USA. 74, 2710-2714. 173 13. Nomura, M. and L. Post. 1980. Organization of ribosome genes and regulation of t h e i r expression i n E . c o l i . i n "Ribosomes: Structure, Function, and Genetics. (G.Chambliss, G.Craven, J.Davies, K.Davies, L.Kahan, M.Nomura, ed.) pp. 671-692. Univ. Park. Press, Baltimore. 14. Nomura, M., R. Gourse, G. Baughman. 1984. Regulation of synthesis °f ribosomes and ribosomal components. Ann. Rev. Biochem. 53, 75-117. 15. Glaser, G. and M. Cashel. 1979. In v i t r o t r a n s c r i p t s from the rrnB ribosomal c i s t r o n o r i g i n a t e from two tandem promoters. C e l l . 16, 111-121. 16. G i l b e r t , S. , H. deBoer, and M. Nomura. 1979 . I d e n t i f i c a t i o n of i n i t i a t i o n s i t e s f or the i n v i t r o t r a n s c r i p t i o n of rRNA operons rrnE and rrnA i n E . c o l i . C e l l . 17, 211-224. 17. Rosenberg, M. and D. Court. 1979. Regulatory sequences involved i n the promotion and termination of rRNA t r a n s c r i p t i o n . Ann. Rev. Genet. _13, 319-353. 18. Travers, A. 1980. Promoter sequence for stringent control of b a c t e r i a l r i b o n u c l e i c acid synthesis. J . B a c t e r i o l . 141, 973-976. 19. L i , S. , C.L. Squires, and C. Squires. 1984. Antitermination ••of E . c o l i rRNA t r a n s c r i p t i o n i s c a r r i e d out by a control region segment containing lambda n u t - l i k e sequences. C e l l . 3_8, 851-860. 20. Duester, G. and W. Holmes. 1980^ The d i s t a l end of the rRNA operon rmD of E . c o l i contains a tRNA gene, two 5S rRNA genes and a t r a n s c r i p t i o n terminator. Nucleic Acids Res. 8_, 3793-3807. 21. Brosius, J . , T. D u l l , D. Sleeter, and H. N o l l e r . 1981. Gene organization and primary sequence of a ribosomal RNA operon from E . c o l i . J. Mol. B i o l . 148, 107-128. 22. Young, R., R. Macklis, J . S t e i t z . 1979. Sequence of the 16S-23S spacer region i n two ribosomal RNA operons of E . c o l i . . J . B i o l . Chem. 254, 3264-3271. 23. P i a t t , T. 1981. Termination of t r a n s c r i p t i o n and i t s regulation i n the tryptophan operon of E . c o l i . C e l l . ^4. 10-23. 24. Sarmientos, P., J. Sylvest er, S. Contente, M. Cashel. 1983. D i f f e r e n t i a l stringent control of the tandem E . c o l i rRNA promoters from rrnB expressed i n vivo i n multicopy plasmids. C e l l . 32, 1337-1346. 25. Liebke, H. and G. H a t f u l l 1985. The sequence of the d i s t a l end of the E . c o l i rrnE operon indicates conserved features shared by rrn operons. Nucleic Acids Res. _L3, 5515-5525. 174 26. Gausing, K. 1977. Regulation of ribosome production i n E . c o l i : Synthesis and s t a b i l i t y of rRNA and ribosomal protein mRNA at di f f e r e n t growth rates. J . Mol. B i o l . 115, 335-354. 27. Molin, S, 1976. Ribosomal chain elongation rate i n E . c o l i . i n "Alfred Benzon Symp. IX. Control of Ribosome Synthesis" (N.Kjeldgaard and O.Maaloe, ed.) pp. 333-339. Munksgaard, Copenhagen. 28. Muto, A. 1978. Control of rRNA synthesis i n E . c o l i . IV. Frequency of t r a n s c r i p t i o n of ribosomal RNA genes as a function of growth rate. Mol. Gen. Genet. 164, 39-44. 29. Travers, A., A. Lamond, H. Mace, M. Berman. 1983. RNA polymerase i n t e r a c t i o n with the upstream region of the E . c o l i tyrT promoter. C e l l . 25, 265-273. 30. Bossi, L. and D. Smith. 1984. Conformational changes i n the DNA associated with an unusual promoter mutation i n a tRNA gene of Salmonella. C e l l . 39, 643-652. 31. Gourse, R. , H. deBoer, M. Nomura. 1986- DNA determinants of rRNA synthesis i n E . c o l i : growth rate dependent regulation, feedback control, upstream a c t i v a t i o n , antitermination. C e l l . 4-4, 197-205. 32. Lamond, A. and A. Travers. 1983. Requirement for an upstream element for optimal t r a n s c r i p t i o n of a b a c t e r i a l tRNA gene. Nature. 305, 248-250. 33. Wu, H. and D. Crothers. 1984. The locus of sequence-directed and protein-induced bending. Nature. 308, 509-513. 34. Hagerman, P. 1984. Evidence for the existence of stable curvature of DNA i n so l u t i o n . Proc. Natl. Acad. S c i . USA. 81_, 4632-4636. 35. Adhya, S. and M. Gottesman. 1978. Control of t r a n s c r i p t i o n term-in a t i o n . Ann. Rev. Biochem. 4_7, 967-996. 36..'Morgan, E. 1980. Insertions of TnlO into an E . c o l i ribosomal RNA operon are incompletely polar. C e l l . 2_1_, 257-265. 37. Brewster, J . and E. Morgan. 1981. Tn9 and IS1 in s e r t s i n a ribosomal RNA operon of E . c o l i are incompletely polar. J . B a c t e r i o l . 148, 897-903. 3 8 . Holben, W. and E. Morgan. 1984 . Antitermination of t r a n s c r i p t i o n from an E . c o l i rRNA promoter. Proc. N a t l . Acad. S c i . USA. 8J . , 6 7 8 9 - 6793 . 3 9 . Friedman, D. and M. Gottesman. 1 9 8 3 . L y t i c mode of lambda develop-ment, i n "Lambda I I " (R.Hendrix, ed.) Cold Spring Harbor Laboratory, pp. 2 1 - 5 1 . 175 40. Greenblatt, J. and J . Li-. 1981. Interaction of the sigma fa c t o r and the nusA gene protein of E . c o l i with RNA polymerase i n the i n i t i a t i o n - t e r m i n a t i o n cycle of t r a n s c r i p t i o n . C e l l . _24, 421-428. 41. Friedman, D. and M. Gottesman. 1983. L y t i c mode of lambda develop-ment, in "Lambda II (R.Hendrix, ed.) Cold Spring Harbor Laboratory, pp. 21-51. 42. Salstrom, J. and W. Szybalski. 1978. Coliphage lambda nutL : a unique class of mutants defective in the s i t e of gene N product u t i l i z a t i o n for antitermination of leftward t r a n s c r i p t i o n . J. Mol. B i o l . 124, 195-221. 43. Friedman, D. and E. Olson. 1983. Evidence that a unique sequence, "box A", i s involved i n the action of the nusA protein. C e l l . 24, 143-149. 44. L i , S. , C.L. Squires, C. Squires. 1984. Antitermination of E . c o l i rRNA t r a n s c r i p t i o n i s caused by a control region segment containing lambda n u t - l i k e sequences. C e l l . _38_, 851-860. 45. Holben, W. , S. Prasad, E. Morgan. 1985. Antitermination by both the promoter and leader regions of an E . c o l i rRNA operon. Proc. Natl. Acad. S c i . USA. 82_, 5073-5077. 46. Sharrock, R., R. Gourse, M. Nomura. 1985. Defective antitermination of rRNA t r a n s c r i p t i o n and derepression of rRNA and tRNA synthesis i n the nusB5 mutant of E . c o l i . Proc. N a t l . Acad. S c i . USA. 82, 5275-5279. 47. Stent, G. and S. Brenner. 1961. A genetic locus for the regulation of r i b o n u c l e i c acid synthesis. Proc. N a t l . Acad. S c i . USA. 47, 2005-2014. 48. N i e r l i c h , D. 1978. Regulation of b a c t e r i a l growth, RNA, and protein synthesis. Ann. Rev. M i c r o b i o l . 3_2, 393-432. 49. Gallant, J . 1979. Stringent control i n E . c o l i . Ann. Rev. Genet. 2 3 , 393-415. 50. Stephens, J . , S. Artz, B. Ames. 1975. Guanosine-5 1-diphosphate-3'-diphosphate: P o s i t i v e e f f e c t o r for h i s t i d i n e operon t r a n s c r i p t i o n and general s i g n a l for amino-acid d e f i c i e n c y . Proc. Natl. Acad. S c i . USA. 72, 4389-4392. 51. L i t t l e , R. and H. Bremer. 1984. Transcription of ribosomal component genes and l a c in a relA / r e l A p a i r of E . c o l i s t r a i n s . J . B a c t e r i o l . 159, 863-869. 52. Sands, M. and R. Roberts. 1952. The e f f e c t s of a tryptophan-h i s t i d i n e deficiency i n a mutant of E . c o l i . J . B a c t e r i o l . 63_, 505-511. 176 53. Lamond, A. and A. Travers. 1985. Stringent c o n t r o l of b a c t e r i a l t r a n s c r i p t i o n . C e l l . 41_, 6-8. 54. Cashel, M. and J. Gaillant. 1969. Two compounds implicated i n the function of the RC gene of E . c o l i . Nature. 221, 838-841. 55. Haseltine, W. and R. Block. 1973. Synthesis of guanosine t e t r a -and penta- phosphate requires the presence of a codon-specific uncharged transfer ribonucleic acid in the acceptor s i t e of ribosomes. Proc. Natl. Acad. S c i . USA. _7°_' 1564-1568. 56. Nene, V. and R. Glass. 1983. Relaxed mutants of E . c o l i RNA polymerase. FEBS L e t t . 153, 307-310. 57. L i t t l e , R., J . Ryals, and H. Bremer. 1983. rpoB mutation i n E . c o l i a l t e r s control of ribosome synthesis by guanosine t e t r a -phosphate. J . B a c t e r i o l . 154, 787-792. 58. Travers, A., A. Lamond, and H. Mace. 1982. ppGpp regulates the binding of two RNA polymerase molecules to the tyrT promoter. Nucleic Acids Res. 10_, 5043-5057. 59. VanOoyen, A., H. deBoer, G. Ab, M. Gruber. 1975. S p e c i f i c i n h i b i t i o n of rRNA synthesis i n v i t r o by guanosine 3'-diphosphate 5'-diphosphate. Nature. 254, 530-531. 60. Debenham, P. and A. Travers. 1977. Selective i n h i b i t i o n of tRNA y t r a n s c r i p t i o n by ppGpp. Eur. J . Biochem. J72., 515-523. 61. Reiness, G., H. Yang, G. Zubay, M. Cashel. 1975. E f f e c t s of guanosine tetraphosphate of c e l l - f r e e synthesis of E . c o l i ribosomal RNA and other gene products. Proc. Natl. Acad. S c i . USA. T2, 2881-2885. 62. K a j i t a n i , M. and A. Ishihawa. 1984. Promoter s e l e c t i v i t y of E . c o l i RNA polymerase: d i f f e r e n t i a l stringent control of the multiple promoters from rRNA and protein operons. J. B i o l . Chem. 259, 1951-1957. 63. Gallant, J . , L. Palmer, C. Poa. 1977. Anomalous synthesis of ppGpp in growing c e l l s . C e l l . _1_1, 181-185. 64. Travers, A. 1980. Promoter sequence for stringent c o n t r o l of b a c t e r i a l RNA synthesis. J. B a c t e r i o l . 141, 973-976. 65. Lamond, A. and A. Travers. 1985. Genetically separable f u n c t i o n a l elements mediate the optimal expression and stringent regulation of a b a c t e r i a l tRNA gene. C e l l . 40, 319-326. 66. Sarmientos, P., J. Sylvester, S. Contente, M. Cashel. 1983. D i f f e r e n t i a l stringent control of the tandem E . c o l i rRNA promoters from rrnB expressed in vivo i n multicopy plasmids. C e l l . 3_2, 1337-1346. 177 67. Silhavy, T. and J. Beckwith. 1985. Uses of lac fusions for the study of b i o l o g i c a l problems. Micr o b i o l . Rev. 49_, 398-418. 68. Berman, M. and J. Beckwith. 1979. Fusions of the lac operon to the transfer RNA gene tyrT of E . c o l i . J . Mol. B i o l . 130, 285-301. 69. Ota, Y., A. Kikuchi, M. Cashel. 1979. Gene expression of an E . c o l i ribosomal RNA promoter.. fused to s t r u c t u r a l genes of the galactose operon. Proc. Natl. Acad. S c i . USA. 76., 5799-5803. 70. Glaser, G., S. Kobe, A. Oppenheim. 1980. Fusions of the promoter region of rRNA operon rrnB to lacZ gene. Nucleic Acids Res. 8, 4327-4335. 71. Dues£er, G., R. E l f o r d , W. Holmes. 1982. Fusion of the E . c o l i tRNA promoter to the galK gene: analysis of sequences necessary for growth-rate dependent regulat i o n . C e l l . J30, 855-864. 72. Miura, A., J . Krueger, S. Itoh, H. deBoer, M. Nomura. 1981. Growth rate dependent regulation of ribosome synthesis i n E . c o l i : expression of the lacZ and galK genes fused to ribosomal promoters. C e l l . 25, 773-782. 73. Sarmientos, P. and M. Cashel. 1983. Carbon starvation and growth rate dependent regulation of the E . c o l i ribosomal RNA promoters: d i f f e r e n t i a l c o n t r o l of dual promoters. Proc. Natl. Acad. S c i . USA. 80, 7010-7013. 74. Sarmientos, P., S. Contente, G. Chimali, M. Cashel. 1983. Ribosomal RNA operon promoters PI and P2 show d i f f e r e n t regulatory responses, i n "Gene Expression" Alan R. L i s s Inc. New York. pp. 65-74. 75. Maaloe, 0. 1969. An analysis of b a c t e r i a l growth. Dev. B i o l . Suppl. 3, 33-58. 76. Ikemura, T. and M. Nomura.. 1977. Expression of spacer transfer RNA genes i n rRNA t r a n s c r i p t i o n units c a r r i e d by hybrid ColEl plasmids i n E . c o l i . C e l l . _1_1, 779-794. 77. Jinks-Robertson, S. , R. Gourse, M. Nomura. 1983. Expression of rRNA and tRNA genes i n E . c o l i : evidence for feedback regulation by products of rRNA operons. C e l l . 3_3, 865-876. 78. Ryals, J . , R. L i t t l e , H. Bremer. 1982. Control, of rRNA and tRNA synthesis i n E . c o l i by guanosine tetraphosphate. J. B a c t e r i o l . 151, 1261-1268. 79. Ryals, J., R. L i t t l e , H. Bremer. 1982. Control of RNA synthesis i n E . c o l i a f t e r a s h i f t to higher temperature. J . B a c t e r i o l . 151, 1425-1432. 178 80. Travers, A., R. Buckland, P. Debenham. 1980. Functional hetero-geneity of E . c o l i RNA polymerase holoenzyme. Biochemistry. 19, 1656-1662. 81. Travers, A., R. Buckland, M. Goman, S. LeGrice, J. Scaife. 1978. A mutation a f f e c t i n g the sigma subunit of RNA polymerase changes t r a n s c r i p t i o n a l s p e c i f i c i t y . Nature. 273, 354-358. 82. Muto. A. 1977. Control of ribosomal RNA synthesis i n E . c o l i . I I I . Cytoplasmic factors for ribosomal RNA synthesis. Mol. Gen. Genet. 152,'161-166. 83. Takebe, Y., A. Miura, D. Bedwell, M. Tam, M. Nomura. 1985. Increased expression of ribosomal genes during i n h i b i t i o n of ribosome assembly i n E . c o l i . J . Mol. B i o l . 184, 23-30. 84. Gourse, R., Y. Takebe, R. Sharrock, M. Nomura. 1985. Feedback regulation of rRNA synthesis and accumulation of free ribosomes a f t e r conditional expression of rRNA genes. Proc. Natl. Acad. S c i . USA. 82, 1069-1073. 85. Doi, R. 1982. M u l t i p l e RNA polymerase holoenzymes exert t r a n s c r i p t i o n a l s p e c i f i c i t y i n B_. s u b t i l i s . Arch. Biochem. Biophys. 2_14, 772-781. 86. Piggot, P. and J . Hoch. 1985. Revised genetic linkage map of B . s u b t i l i s . M i c r o b i o l . Rev. 49, 158-179. 87. Zingales, B. and W. C o l l i . 1977. Ribosomal RNA genes i n B . s u b t i l i s . Evidence for a c o t r a n s c r i p t i o n mechanism. Biochim. Biophys. Acta. 474, 562-577. 88. Hecht, N. and C. Woese. 1968. Separation of b a c t e r i a l ribosomal RNA from i t s macromolecular precursors by polyacrylamide gel electrophoresis. J . B a c t e r i o l . 95_, 986-990. 89. Oishi, M. and N. Sueoka. 1965. Location of genetic l o c i of ribosomal RNA on B . s u b t i l i s chromosome. Proc. N a t l . Acad. S c i . USA. 54, 483-491. 90. Smith, I., D. Dubnau, P. Morell, J, Marmur. 1968. Chromosomal loc a t i o n of DNA base sequences complementary to transfer RNA and to 5S, 16S, and 23S ribosomal RNA i n B . s u b t i l i s . J. Mol. B i o l . 33, 123-140. 91. Chow, L. and N. Davidson. 1973. Electron microscopic mapping of the d i s t r i b u t i o n of ribosomal genes of the B . s u b t i l i s chromosome. J . Mol. B i o l . 75, 265-279. .92. Moran, C. and K. Bott. 1979. R e s t r i c t i o n enzyme analysis of . B.subtilisribosomal RNA genes. J. B a c t e r i o l . 140, 99-105. 179 93. Stewart, G. , F/ Wilson, K. Bott. 1982. Detailed physical mapping of the ribosomal RNA genes of B . s u b t i l i s . Gene. 19_, 153-162. 94. Wawrousek, E. and II. Hansen. 1983. Structure and organization of a cluster of s i x tRNA genes i n the space between tandem rRNA gene sets i n B . s u b t i l i s . J. B i o l . Chem. 258, 291-298. 95. Loughney, K., E. Lund, J . Dahlberg. 1982. tRNA genes are found between the 16S and 23S rRNA genes i n B . s u b t i l i s . Nucleic Acids 1' Res. _L0, 1607-1624. 96. LaFauci, G., R. Widom, R. Eisner, E. J a r v i s , R. Rudner. 1986. Mapping of rRNA genes with integratable plasmids i n B . s u b t i l i s . J . B a c t e r i o l . 165, 204-214. 97. Green, C. and B. Void. 1983. Sequence analysis of a cl u s t e r of twenty-one tRNA genes i n B . s u b t i l i s . Nucleic Acids Res. 11, 5763-5774. 98. Fournier, M. and H. Ozeki. 1985. Structure and organization of the transfer RNA genes of E . c o l i K-12. M i c r o b i o l . Rev. 49, 379-397. 99. Void, B. 1985. Structure and organization of genes for transf e r RNA i n B . s u b t i l i s . M i c r o b i o l . Rev. 49_, 71-80. 100. Moriya, S., N. Ogasawara, H. Yoshikawa. 1985. Structure and function of the r e p l i c a t i o n o r i g i n of B . s u b t i l i s chromosome. I I I . Nucleotide sequence of some 10,000 bp i n the o r i g i n region. Nucleic Acids Res. 1 3 , 2251-2265. 101. Ogasawara, N., M. Seike, H. Yoshikawa. 1983. Replication o r i g i n region of B . s u b t i l i s contains two rRNA operons. J. B a c t e r i o l . 154, 50-57. 102. Green, C , G. Stewart, M. H o l l i s , B. Void, K. Bott. 1985. Nucleotide seqence of the B . s u b t i l i s ribosomal RNA operon, rrnB. Gene. 3_7, 261-266. 103. Stewart, G. and K. Bott. 1983. DNA sequence of the tandem ribosomal RNA promoters of B . s u b t i l i s operon rrnB. Nucleic Acids Res. 6289-6300. 104. Loughney, K., E. Lund, J. Dahlberg. 1983. Ribosomal RNA precursors of B . s u b t i l i s . Nucleic Acids Res. J _ l , 6710-6721. 105. Losick, R. and J. Pero. 1981. Cascades of sigma factors. C e l l . 25, 582-584. 106. Lee, G., C. Talkington, J . Pero. 1980. Nucleotide sequence of a promoter recognized by B . s u b t i l i s RNA polymerase. Molec. Gen. Genet. 180, 57-65. 180 107. Void, B. and C. Green. 1986. Expression i n E . c o l i of B . s u b t i l i s tRNA genes from a promoter within the tRNA gene region. J. B a c t e r i o l . 166, 306-312. 108. Doi, R. 1977. Role of RNA polymerase i n gene s e l e c t i o n i n procaryotes. B a c t e r i o l . Rev. 41_, 568-594. 109. Leduc, E., M. Hoekstr, G. Spiegelman. 1982. Relationship between synthesis of ribosomes and RNA polymerase i n B . s u b t i l i s . Can. J. Microbiol. 28, 1280-1288. 110. Webb, V. and G. Spiegelman. 1984. Ribosomal RNA synthesis i n uninfected and SP01 am34 infected B . s u b t i l i s . Molec. Gen. Genet. 194, 98-104. 111. Clewell, D. and D. H e l i n s k i . 1970. Properties of a supercoiled DNA-protein re l a x a t i o n complex and strand s p e c i f i c i t y of the relaxation event. Biochemistry, j?, 4428-4440. 112. Dobinson, K. and G. Spiegelman. 1985. Nucleotide sequence and tr a n s c r i p t i o n of a bacteriophage 029 e a r l y promoter. J . B i o l . Chem. 260, 5950-5955. 113. Maniatis, T., G. F r i t s c h , J. Sambrook. 1982. "Molecular Cloning: A Laboratory Manual". Cold Spring Harbor Laboratories. New York. 114. Gryzcan, T., S. Contente, D. Dubnau. 1978. Characterization of Staphylococcus aureus plasmids introduced by transformation into B . s u b t i l i s . J. B a c t e r i o l . 134, 318-329. 115. Rodriquez, R., R. West, E. Kline. 1979. "Experiments i n Recombinant DNA Research" American Society f o r Microbiology, Washington, D.C. 116. Johnston, J . and I. Gunsalus. 1977. I s o l a t i o n of metabolic plasmid DNA from Pseudomonas putida. Biochem. Biophys. Res. Comm. 75_, 13-19. 117. Dubnau, D. and R. Davidoff-Abelson. 1971. Fate of transforming DNA following uptake by competent B . s u b t i l i s . I. Formation and properties of the donor-recipient complex. J . Mol. B i o l . 56, 209-221. 118. Laemmli, U. 1970. Cleavage of s t r u c t u r a l proteins during the assembly of the head of bacteriophage T4. Nature. 227, 680-685. 119. Maxam, A. and W. G i l b e r t . 1977. A new method for sequencing DNA. Proc. Natl. Acad. S c i . USA. _74_» 560-564. 120. Southern, E. 1975. Detection of s p e c i f i c sequences among DNA fragments separated by gel elect r o p h o r e s i s . J . Mol. B i o l . 98, 503-517. 181 121. Close, T. and R. Rodriquez. 1982. Construction and ch a r a c t e r i z a t i o n of a chloramphenicol resistance gene c a r t r i d g e : A new approach to the t r a n s c r i p t i o n a l mapping of extrachromosomal elements. Gene. 20, 305-316. 122. Messing, J. 1983. New M13 vectors f o r cloning. Meth. Enzymol. 101, 20-52. 123. Daniels, D. and K. Bertrand. 1985. Promoter mutations a f f e c t i n g divergent t r a n s c r i p t i o n i n the TnlO t e t r a c y c l i n e resistance determinant. J . Mol. B i o l . 184, 599-610. 124. Adams, C. and G. H a t f i e l d . 1984. E f f e c t s of promoter strengths and growth conditions on copy number of t r a n s c r i p t i o n - f u s i o n vectors. J . B i o l . Chem. 259, 7399-7403. 125. Clark, D. and 0. Maaloe. 1967. DNA r e p l i c a t i o n and the d i v i s i o n cycle in E . c o l i . J. Mol. B i o l . 23, 99-112. 126. Zukowski, M. , D. Gaffney, D. Speck, M. Kauffman, A. F i n d e l i , A. Wisecup, J. Lecocq. 1983. Chromogenic i d e n t i f i c a t i o n of genetic regulatory signals i n B . s u b t i l i s based on expression of a cloned Pseudomonas gene. Proc. Natl. Acad. S c i . USA. 80, 1101-1105. 127. Sanderham, H. and J . Strominger. 1982. P u r i f i c a t i o n and properties of C,., isoprenoid alcohol phosphokinase from S.aureus. J . B i o l . Chem. 247, 5123-5131. 128. Shaw, W. 1975. Chloramphenicol acetyltransferase for chloramphenicol resistant b a c t e r i a . Meth. Enzymol. 43, 737-755. 129. McKenney, K., H. Shimatake, D. Court, U. Schmeisser, C. Brady, M. Rosenberg. 1981. A system to study promoter and terminator signals recognized by E.-.coli RNA polymerase, i n "Gene Amplification and Analysis, Vol. 2. Str u c t u r a l analysis of nucleic acids. E l s e v i e r , New York. pp. 383-415. 130. Boros, I., A. Kiss, B. Sain, G. Somlyai, P. Venetianer. 1983. Cloning of the promoter of an E . c o l i rRNA gene: New experimental system to study the regulation of rRNA t r a n s c r i p t i o n . Gene. 22 191-201. 131. Brosius, J. 1984. Plasmid vectors f o r s e l e c t i o n of promoters. Gene. 27, 151-160. 132. Brosius, J . 1984. T o x i c i t y of an overproduced foreign gene product i n E . c o l i and i t s use i n plasmid vectors for the se l e c t i o n of tra n s c r i p t i o n terminators. Gene. 27_, 161-172. 133. Brosius, J . , T. D u l l , D.Sleeter, H. No l l e r . 1981. Gene organization and primary sequence of a ribosomal RNA operon from E . c o l i . J. Mol. B i o l . 148, 107-128. 182 134. S u t c l i f f e , J. 1979. Complete nucleotide sequence of the E . c o l i plasmid pBR322. Cold Spring Harbor Symp. Quant. B i o l . 4_3, 77-90. 135. Stanier, R., M. Doudoroff, E. Adelberg. 1970. "The Microbial World". P r e n t i c e - H a l l , New York. pp. 298-324. 136. Wanner, B., R.Kodaira, F. Neidhardt. 1977. P h y s i o l o g i c a l reg-u l a t i o n of a decontrolled lac operon. J . B a c t e r i o l . 130, 212-222. 137. Dennis, P. and D. Nordan. 1976. Characterization of the hybrid-i z a t i o n between p u r i f i e d 16S and 23S rRNA and rDNA from E . c o l i . J. B a c t e r i o l . 128, 28-34. 138. VonGabain, A., J. Belasco, I. Schattel, A. Chang, S. Cohen. 1983. Decay of mRNA i n E . c o l i : Investigation of the fate of s p e c i f i c segments of t r a n s c r i p t s . Proc. Natl. Acad. S c i . USA. 80, 653-657. 139. Stuber, D. and H. Bujard. 1982. T r a n s c r i p t i o n from e f f i c i e n t promoters can i n t e r f e r e with plasmid r e p l i c a t i o n and diminish expression of plasmid s p e c i f i c genes. EMBO J. _1, 1399-1404. 140. Kreft, J . and C. Hughes. 1982. Cloning vectors derived from plasmids and phage of B a c i l l u s . Curr. Top. M i c r o b i o l . Immunol. 9_6, 1-17. 141. Osburne, M. and R. Craig. 1986. A c t i v i t e s of two strong promoters cloned into B . s u b t i l i s . J. Gen. M i c r o b i o l . 132, 565-568. 142. McLaughlin, J . C. Murray, J. Rabinowitz. 1981. Unique features i n the ribosome binding s i t e sequence of the Gram-positive Staphylococcus aureus ^-lactamase gene. J. B i o l . Chem. 256, 11283-11291. 143. Peschke U., V. Beuck, H. Bujard, R. Gentz, S. LeGrice. 1986. E f f i c i e n t u t i l i z a t i o n of E . c o l i t r a n s c r i p t i o n a l signals i n B . s u b t i l i s . J. Mol. B i o l . JJ56, 547-555. 144. Bolivar, F., P. Green, M. Betlach, H. Heyneker, H. Boyer. 1977. Construction and characterization of new cloning v e h i c l e s . Gene. _2, 95-113. 145. Kunz, D., D. Ribbons, P.Chapman. 1981. Metabolism of a l l y l g l y c i n e and c i s - c r o t y l g l y c i n e by P.putida ( a r v i l l a ) mt-2 harboring a TOL plasmid. J . B a c t e r i o l . 148, 72-82. 146. Horinouchi, S. and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that s p e c i f i e s inducible chloramphenicol resistance. J . B a c t e r i o l . 150, 815-825. 147. Hwang, J. and R. Doi. 1980. Transcription-termination factor Rho from B . s u b t i l i s . Eur. J. Biochem. 104, 313-320. 183 148. deBoer, H., L. Cornstock, M. Vasser. 1983. The tac promoter: A functional hybrid derived from the trp and lac promoters. Proc. Natl. Acad. S c i . USA. 80, 21-25. 149. Ray, C., R. Hay, H. Carter,C. Moran. 1985. Mutations that a f f e c t u t i l i z a t i o n of a promoter i n stationary-phase B . s u b t i l i s . J. B a c t e r i o l . 163, 610-614. 150. E h r l i c h , S., B. Niaudet, B. Michel. 1982. Use of plasmids from Staphylococcus aureus for cloning of DNA i n B . s u b t i l i s . Curr. Top. Microbiol. Immunol. 9_6, 19-29. 151. Gryczan, T. and D. Dubnau. 1978. Construction and properties of chimeric plasmids i n B . s u b t i l i s . Proc. N a t l . Acad. S c i . USA. 75, 1428-1432. 152. Ostroff, G. and J . Pene. 1984. Molecular cloning with b i f u n c t i o n a l plasmid vectors i n B . s u b t i l i s : construction and analysis of B . s u b t i l i s clone banks i n E . c o l i . Mol. Gen. Genet. 193, 299-305. 153. Youngman, P., J . Perkins, R. Losick. 1986. Construction of a cloning s i t e near one end of Tn917 into which foreign DNA may be inserted without a f f e c t i n g transposition i n B . s u b t i l i s or ex-pression of the transposon-borne erm gene. Plasmid, l _ l , i n press. 154. Haldenwang, W"., C. Banner, J . Ollington, R. Losick, J . Hoch, M. O'Connor, A. Sonenshein. 1980. Mapping a cloned gene under sporulation control by i n s e r t i o n of a drug resistance marker into the B . s u b t i l i s chromosome. J. B a c t e r i o l . 142, 90-98. 155. Canosi, U., G. M o r e l l i , T. Trautner. 1978. The r e l a t i o n s h i p between molecular structure and transformation frequency of some S.. aureus plasmids i s o l a t e d from B . s u b t i l i s . Mol. Gen. Genet. 166, 259-267. 156. Grandi, G., M. Mottes, V. Sgaramelli. 1981. S p e c i f i c pattern of i n s t a b i l i t y of E . c o l i hisG gene cloned i n B . s u b t i l i s v i a the S.aureus plasmid pCS194. Plasmid. j$, 99-111. 157. Ostroff, G. and J . Pene. 1984. Molecular cloning with b i f u n c t i o n a l plasmid vectors i n B . s u b t i l i s . II. Transfer of sequences propagated i n E . c o l i to B . s u b t i l i s . Mol. Gen. Genet. 193, 306-311. 158. Michel, B., E. P a l l a , B. Niaudet, S. E h r l i c h . 1980. DNA cloning i n B . s u b t i l i s : I I I . E f f i c i e n c y of random-segment cloning and i n s e r t i o n a l i n a c t i v a t i o n vectors. Gene. 1_2, 147-154. 159. Riele, H., B. Michel, S. E h r l i c h . 1986. Single stranded plasmid DNA in B . s u b t i l i s and S.aureus. Proc. Natl. Acad. S c i . USA. 83, 2541-2545. 184 160. Twigg, A. and D. Sherratt. 1980. Trans-complementable copy number mutants of plasmid C o l E l . Nature. 283, 216-218. 161. Ito, J . 1978. Bacteriophage 029 terminal pr o t e i n : Its ass o c i a t i o n with the 5' terminus of the 029 genome. J. V i r o l . 28. > 895-904. 162. Gallant, J . and G. Margason. 1972. Amino acid c o n t r o l of messenger RNA synthesis i n B a c i l l u s s u b t i l i s . J . B i o l . Chem. 247, 2289-2294. 163. Smith, I. 1982. The t r a n s l a t i o n a l apparatus of B a c i l l u s s u b t i l i s . i n "The Molecular Biology of the B a c i l l i " , V o l . 1, p. 111-145. D. Dubnau, ed. Academic Press, New York. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0097132/manifest

Comment

Related Items