Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and expression of Bacillus subtilis ribosomal RNA gene promoters in Escherichia coli Deneer, Henricus Gerardus 1986

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1986_A1 D46.pdf [ 8.98MB ]
Metadata
JSON: 831-1.0097132.json
JSON-LD: 831-1.0097132-ld.json
RDF/XML (Pretty): 831-1.0097132-rdf.xml
RDF/JSON: 831-1.0097132-rdf.json
Turtle: 831-1.0097132-turtle.txt
N-Triples: 831-1.0097132-rdf-ntriples.txt
Original Record: 831-1.0097132-source.json
Full Text
831-1.0097132-fulltext.txt
Citation
831-1.0097132.ris

Full Text

CLONING AND EXPRESSION OF BACILLUS SUBTILIS RIBOSOMAL RNA GENE PROMOTERS IN ESCHERICHIA COLI By HENRICUS GERARDUS DENEER B . S c , The U n i v e r s i t y o f Manitoba, 1975 M.Sc., The U n i v e r s i t y of Manitoba, 1981  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES Department o f M i c r o b i o l o g y  We a c c e p t t h i s t h e s i s as conforming to the r e q u i r e d  standard  THE UNIVERSITY OF BRITISH COLUMBIA August, 1986 ©  H e n r i c u s Gerardus Deneer, 1986  In p r e s e n t i n g  this thesis  r e q u i r e m e n t s f o r an of  British  it  freely available  agree t h a t for  Library  s h a l l make  for reference  and  study.  I  for extensive copying of  h i s or  be  her  g r a n t e d by  shall  not  be  Microbiology  The U n i v e r s i t y o f B r i t i s h 1956 Main Mall V a n c o u v e r , Canada V6T  Date  1Y3  0 c t  -  >  9  1 9 8 6  of  further this  Columbia  thesis  head o f  this  my  It is thesis  a l l o w e d w i t h o u t my  permission.  Department o f  the  representatives.  copying or p u b l i c a t i o n  f i n a n c i a l gain  University  the  s c h o l a r l y p u r p o s e s may  understood that  the  the  I agree that  permission by  f u l f i l m e n t of  advanced degree a t  Columbia,  department o r for  in partial  written  ii  Abstract  In  coli,  proportion known  which  rate  regulation. achieved  and t o e x t e n d  from  the B^ s u b t i l i s plasmid  acetytransferase Expression in  a growth  the  CAT mRNA  directly as  promoter  rate  coli  an  A-T r i c h  no  effect  rate  operon  was c l o n e d  the synthesis  that  manner.  rrnB  operon sequence  i n contrast,  upstream  on t h e o v e r a l l  indicated  regulation  that  were  level  onto  region  promoters.  activity  increased  o f CAT mRNA,  were  a l l measured  CAT s p e c i f i c  activity  t h e d o w n s t r e a m P2 pair  was s h o w n  t h e P1 p r o m o t e r t o growth  rate.  t o be  of the native Deletion of  P1 p r o m o t e r h a d  o f P1 o r P2 t r a n s c r i p t i o n . T h e s e mechanisms  between  E.  a transcription  subtilis  number  of using Only  with  chloramphenicol  o f t h e B_j_ s u b t i l i s  the general  conserved  studies  The s y n t h e s i s  P1-P2 t a n d e m  was r e s p o n s i v e  from  by t h e  copy  regions  form o f  the promoter  of  o f rRNA  regulation i s  CAT s p e c i f i c  function.  subtilis  regulated;  how t h i s  observations  and p l a s m i d  o f promoter  - 3 5 , -10  arranged  species,  showed  a phenomenon  The p r o m o t e r s  o f other  dependent  of the  E.  results  into  was d i r e c t e d  half-life,  squared,  characteristic  to e s t a b l i s h the v a l i d i t y  a measure  growth  that  (CAT)  rate  this  previous  rrnB  i n E_^ c o l i  rate  regulation.  insight  operons  such  i s synthesized i n  o f two t a n d e m l y  To p r o v i d e  t o t h e rRNA  fusion  growth  mediate  coli  (rRNA)  dependent  consist  120 bp a p a r t ,  about  RNA  to the c e l l u l a r  as growth  operons,  ribosomal  coli  conferring  growth  a n d B_^ s u b t i l i s ,  iii  although d i f f e r e n c e s and  P2  to develop  i n Ek_ 3 u b t i l i s  constructed carrying it  was  coli  a number  by f u s i n g  found  that  operon  of b i - f u n c t i o n a l  subtills  promoters  transcriptional  transfer  a similar  plasmids  overexpression of t h i s  and rRNA  bi-f unctional  fusion  shuttle  P1  t o an  to  possess  analogous functional promoters.  was  v e c t o r s were h i g h l y subtills.  that  promoters,  difference  coli gene. was  curtailed.  replicon However,  lethal unless  Furthermore,  u n s t a b l e i n E_;_ c o l i  t o E.  such  or a f t e r  N e v e r t h e l e s s , d a t a o b t a i n e d u s i n g one  the a n t i t e r m i n a t i o n coli  protein  system f o r v e c t o r s were  c o u l d n o t be m a i n t a i n e d  activity  of these v e c t o r s i n d i c a t e d not  o f the i n d i v i d u a l  a promoterless c a t e c h o l 2 , 3 dioxygenase  cell3  their  at the l e v e l  promoters.  In an a t t e m p t use  were n o t e d  B_;_ s u b t i l i s function  illustrating  between E_j_ c o l i  and  rRNA  promoters d i d  associated an  w i t h the  additional subtilis  rRNA  iv  TABLE OF CONTENTS  Abstract  i i  T a b l e o f contents  iv  L i s t of f i g u r e s  viii  L i s t of t a b l e s  x  Abbreviations  xi  Acknowledgements  x i i  L i t e r a t u r e review  1  1. G e n e r a l overview and p h y s i o l o g i c a l c o n s i d e r a t i o n s  1  2. L o c a t i o n , o r g a n i z a t i o n , and s t r u c t u r e o f rRNA genes i n E . c o l i .  3  3. R e g u l a t i o n  7  i.  of expression  o f rRNA genes.  upstream a c t i v a t i o n  ii.  9  antitermination  iii.  12  stringent control  13  4. Growth r a t e dependent r e g u l a t i o n o f rRNA operons i. ii.  DNA sequence requirements  17 17  Models f o r growth r a t e c o n t r o l o f rRNA operons  22  5. Ribosomal RNA operons i n B a c i l l u s s u b t i l i s  29  6. L o c a t i o n and s t r u c t u r e o f B . s u b t i l l s rRNA operons  29  7. Promoter r e g i o n s  32  8. R e g u l a t i o n 9. R a t i o n a l e  of B . s u b t i l i s rRNA operons  o f s t a b l e RNA s y n t h e s i s f o r present  studies  M a t e r i a l s and Methods  i n B.subtilis  , 33 37 39  1. B a c t e r i a l s t r a i n s and p l a s m i d s  39  2. P u r i f i c a t i o n o f DNA  39  V  i.  E . c o l i plasmid  ii.  DNA  E. c o l i plasmid  iii.  - small scale  DNA  B . s u b t i l i s plasmid  39  - large scale  39  DNA  41  i v . B . s u b t i l i s chromosomal DNA  42  v. Pseudomonas p u t i d a TOL  42  plasmid  3. T r a n s f o r m a t i o n recombinants  of E . c o l i and  4. T r a n s f o r m a t i o n  of B . s u b t i l i s  s e l e c t i o n of  5. C l o n i n g procedures i.  B l u n t i n g of 5' and  iii.  44 45  R e s t r i c t i o n endonuclease d i g e s t i o n of DNA  ii.  42  3' extended ends  D e p h o s p h o r y l a t i o n of DNA  45 46 46  i v . Ligation conditions  47  v. Exonuclease Bal-31 r e a c t i o n c o n d i t i o n s  47  6. A n a l y t i c a l and p r e p a r a t i v e g e l e l e c t r o p h o r e s i s i. ii.  Agarose g e l s  48  Polyacrylamide  7. I s o l a t i o n of DNA i. ii.  48  gels  fragments from g e l s  Agarose m i n i g e l s Polyacrylamide  48 50 50  gels  50  8. N u c l e i c a c i d sequencing  51  9. Autoradiography  51  10. Southern b l o t t i n g and h y b r i d i z a t i o n of DNA  52  11. C o n s t r u c t i o n  53  12. RNA i.  - DNA  of M13-CAT h y b r i d i z a t i o n probes  hybridization  i s o l a t i o n of H 3  - l a b e l l e d RNA  54 54  vi  ii.  p r e p a r a t i o n o f s i n g l e - s t r a n d e d DNA f i l t e r s  iii.  H-RNA - DNA h y b r i d i z a t i o n  56  3  13. D e t e r m i n a t i o n i.  55  o f mRNA h a l f - l i f e  56  Functional h a l f - l i f e  ii.  Chemical  56  half-life  57  14. P l a s m i d copy number d e t e r m i n a t i o n  58  15. Growth r a t e s t u d i e s and enzyme assays  59  i.  Media and growth c o n d i t i o n s  ii.  C a t e c h o l 2,3-dioxygenase assay  iii. Chapter  59  Chloramphenicol  1.  60  a c e t y l t r a n s f e r a s e assay  61  C l o n i n g and e x p r e s s i o n o f 15. s u b t i l i s rrnB promoters i n 15. c o l i .  63  1. I n t r o d u c t i o n  63  2. R e s u l t s  64  i.  Cloning of B . s u b t i l i s  ii.  rrnB promoters  S t a b i l i t y o f CAT-fusion  iii.  64  vectors  C h a r a c t e r i z a t i o n o f chloramphenicol transferase (CAT) assay  80 acetyl-  82  i v . E x p r e s s i o n o f E . c o l i r r n B promoters a t d i f f e r e n t growth r a t e s  84  v. E x p r e s s i o n o f B . s u b t i l i s in E.coli  88  rrnB promoters  v i . Measurement o f CAT mRNA, mRNA h a l f - l i f e , and p l a s m i d copy number 3. D i s c u s s i o n i. ii.  100  R e g u l a t i o n o f E . c o l i r r n B promoters Regulation of B . s u b t i l i s E.coli  88 ;  rrnB promoters i n  106 110  vii  Chapter 2.  C o n s t r u c t i o n of a l t e r n a t i v e promoterprobe c l o n i n g v e c t o r s  123  1. I n t r o d u c t i o n  123  2. R e s u l t s  125  i.  C o n s t r u c t i o n of pTLXT/pAS-3 v e c t o r s  ii.  C l o n i n g and  iii.  Expression  s t a b i l i t y of promoter fragments  126  of promoter-xylE f u s i o n s i n E . c o l i  131  i v . E f f e c t s of lambda t R l t e r m i n a t o r of B . s u b t i l l s rrnB promoters  on e x p r e s s i o n  3. D i s c u s s i o n i.  135  136  Lack of growth r a t e dependent e x p r e s s i o n of promoter-xyIE f u s i o n  Chapter 3.  125  Attempts to c o n s t r u c t b i - f u n c t i o n a l operon fusion vectors  140  145  1. I n t r o d u c t i o n  145  2. R e s u l t s  147  i.  Construction o f . b i - f u n c t i o n a l cointegrate plasmids  ii.  C o n s t r u c t i o n of i n t e g r a t i v e p l a s m i d pAS3C-168  3. D i s c u s s i o n Summary and References  concluding  147  156 159  remarks  165 172  viii  LIST OF FIGURES Figure  Page  1.  Structure  and o r i e n t a t i o n o f pHD1.8.  66  2.  Structure  o f pKK232-8.  69  3.  O r i g i n and sequence o f B . s u b t i l i s promoter fragments.  4.  Promoter i n s e r t s i n pKK232-8 and t h e i r electrophoretic mobility.  74  5.  Base sequence o f the E . c o l i rrnB promoter region.  77  6.  L i n e a r i t y o f chloramphenicol a c e t y l t r a n s f e r a s e assay.  83  CAT a c t i v i t y v s . growth r a t e : pKK-292Ec i n E . c o l i HB101.  85  8.  CAT a c t i v i t y v s . growth r a t e : pKK-351Ec, pKK-128Ec i n E . c o l i HB101.  86  9.  CAT a c t i v i t y v s . growth r a t e : pKK-Tet i n E . c o l i HB101.  87  10.  CAT a c t i v i t y v s . growth r a t e : pKK-i427B i n E . c o l i HB101.  89  11.  CAT a c t i v i t y v s . growth r a t e : pKK-285B i n E . c o l i HB101.  90  12.  CAT a c t i v i t y v s . growth r a t e : pKK-211B i n E . c o l i HB101.  91  13.  CAT a c t i v i t y v s . growth r a t e : pKK-282B, KK-220B i n E . c o l i HB101.  ?2  14.  C o n s t r u c t i o n and o r i e n t a t i o n o f M13-CAT h y b r i d i z a t i o n probes.  t, 94  15.  Amount o f CAT s p e c i f i c mRNA v s . growth r a t e .  ?5  16.  Measurement  96  . 7.  _  rRNA  71  P  o f t o t a l rRNA v s . growth r a t e .  D e t e r m i n a t i o n o f CAT mRNA f u n c t i o n a l l i f e - CAT p r o t e i n a n a l y s i s .  half-  Chemical h a l f - l i f e o f CAT mRNA v s . growth r a t e . Plasmid copy number d e t e r m i n a t i o n by dotblot hybridization analysis. Amount o f p l a s m i d DNA v s . growth Structure  rate.  o f pTLXT-ll/pAS-3.  C a t e c h o l 2,3-dioxygenase a c t i v i t y v s . growth rate. C a t e c h o l 2,3-dioxygenase a c t i v i t y v s . growth r a t e : pAS-351Ec. R e s t r i c t i o n endonuclease d i g e s t i o n of pAS3B. Structure  pattern  o f pCmTv-2/pASTV-l.  R e s t r i c t i o n endonuclease d i g e s t i o n p a t t e r n o f pAS3C-168 i n t e g r a t i v e p l a s m i d s .  X  LIST OF TABLES Table  Page  L i s t of b a c t e r i a l  2.  CAT gene f u s i o n s .  3.  S t a b i l i t y of Cm  4.  Ribosomal RNA promoter-xyIE operon f u s i o n s .  130  5.  Activities  135  6.  Frequency of t r a n s f o r m a t i o n w i t h b i functional vectors.  r  strains,  p l a s m i d s , phage.  40  1.  79 phenotype.  of B . s u b t i l i s  promoters i n E . c o l i .  81  149  xi  ABBREVIATIONS  Kb  Kilobase  bp  base p a i r  dNTP  deoxynucleoside  DNA  deoxyribonucleic  RNA  ribonucleic  rRNA  ribosomal r i b o n u c l e i c  tRNA  transfer  mRNA  messenger r i b o n u c l e i c  EDTA  ethylenediaminetetraacetic  EGTA  ethyleneglycol-bis-(B-aminoethyl tetraacetic acid  Cm  chloramphenicol  Ap  r  CAT  acid  acid  ribonucleic  ampicillin  liter  ml  milliliter  ul  microliter  gr  gram  acid acid  acetyltransferase  microgram r  Km  kanamycin  resistant  r Em  acid  resistance  milligram  ug  acid  resistance  chloramphenicol  1  mg  triphosphate  erythromycin  resistant  Tc  tetracycline  resistant  A  absorbance  r  ether)-N,N,N',N'-  xii  Acknowledgements  I am i n d e b t e d t o a great many p e o p l e f o r making t h i s p r o j e c t p o s s i b l e and making my stay a t U.B.C. so e n j o y a b l e and e x c i t i n g . I am e s p e c i a l l y g r a t e f u l to the members o f the Spiegelman l a b , both past and p r e s e n t , f o r t h e i r f r i e n d s h i p , warmth, and humour - n o t a b l y , Vera Webb, Kathy Dobinson, Fereydoun S a j j a d i , Dan Horvath, and Loverne Duncan.  I would a l s o l i k e to express my thanks and a p p r e c i a t i o n t o  my s u p e r v i s o r  George Spiegelman f o r h i s guidance, encouragement and  h i s eagerness t o work on the " i m p o s s i b l e "  projects.  F i n a l l y , t h i s p r o j e c t would not have been s t a r t e d , l e t alone completed, were i t n o t f o r the l o v e , s u p p o r t , and e s p e c i a l l y the p a t i e n c e o f my w i f e Jane.  By r i g h t s , t h i s t h e s i s i s p a r t i a l l y  hers.  1  Literature  1.  Review  General  It cell  O v e r v i e w and  has  long  suddenly  been a t e n e t  finds i t s e l f  environment  i t can  order  so  to do  synthesis. increased  accumulation i n the  However, the posed o f 53  synthesis  not  the only  the  as  the  are  key  machinery of  the  (see  Ref.  years  fraction  o f how  stable  the  cell. com-  RNA  mole-  1 for review),  whose  be  i t has  closely become  of ribosomes  synthesis but  In  an  organelles  standpoint,  i n recent RNA  these  complex  if a  protein  of  3 different  and  for  one  physiological conditions  also  apparent  is central  o f the  numerous  t o how  various  affect  the  accumulation  a whole.  recognition  stems from  rate  are  efficiency  question  and  of ribosomes  first  i s therefore  components i s c o o r d i n a t e d ,  nutritional  who  coli  proteins  an  that  advantageous  i t s capacity  of ribosomes s i n c e  r e g u l a t i o n o f the  ribosomal  The  response  Nevertheless,  to  increase  between 2 s u b u n i t s  must, f r o m  physiology  i n c r e a s i n g i t s growth r a t e .  protein synthesizing  different  regulated.  of b a c t e r i a l  by  ribosomes of  cules divided  that  respond  immediate  Considerations  in a nutritionally  i t must f i r s t  The  components  Physiological  of  the  pioneering  noted  of ribosome  that  importance  studies  a strict  accumulation  of ribosomal  o f Maaloe and  RNA  (rRNA)  co-workers  c o r r e l a t i o n e x i s t e d between and  the  cellular  growth  rate  (2) the  2  (herein  r e i e r r e d t o as "u", the r e c i p r o c a l o r the c e l l u l a r  doubling  time  expressed  macromolecular their DNA, of  composition  rate  and p r o t e i n  DNA  but In  growth  they  97$  or which  labile  Later per  cell  implying faster  activity.  o r RNA  RNA)  that  to protein  the actual  function  demand  was met  than  for  an i n c r e a s e  H o w e v e r , i t was n o t e d  cell  synthesis,  of  RNA,  the r a t i o  increased  dramatically.  per c e l l  (up t o  t o t h e more than the  obtained  number o f r i b o s o m e s  o f the growth protein  by an i n c r e a s e  synthesis  by  i n t h e number o f  that  the linear  proportionality  meant  the rate  that  by d i v i d i n g t h e p r o p o r t i o n  mass w h i c h was r i b o s o m e s  (3)i  rate  i n their translational  between u and t h e number o f r i b o s o m e s ribosome  of  macromolecules.  the increased  rather  the  essentially invariant,  was p r o p o r t i o n a l l y m u c h g r e a t e r  as a l i n e a r  cells  increased;  rRNA and tRNA a s o p p o s e d  f o r other  increased  proportion  i n t h e a m o u n t o f RNA  m e a s u r e m e n t s showed t h a t  growing  ribosomes  t o DNA  i s stable  seen  rate  By s t u d y i n g  as a f u n c t i o n  the r e l a t i v e  as t n e g r o w t h  the increase  messenger  increase  that  f o r example, remained  t h e r a t i o s o f RNA words,  per nour;.  of bacterial cells  found  changed  to protein  other  as d o u b l i n g s  by t h e c e l l  doubling  of  of the  time,  must  2 increase  as a f u n c t i o n  as  necessary  being  pass an  cells  .  In simple  i f one i m a g i n e d  on more r i b o s o m e s  increasing  of u  growth  to each daughter  rate.  had p r o g r e s s i v e l y  that  less  terms  could  f a s t e r growing cell  B u t , as growth time  this  i n order  i n order  rate  be  seen  cells  must  to  maintain  increased,  to synthesize  the  more  3  ribosomes unless  the  rate  of  this  growth r a t e  squared.  Thus, w h i l e  occupied  ribosomes  could  by  u=2.5, the fold  rate  in this  between the ribosomal  of  ribosome  RNA)  analogous to  synthesis feature  could  of  the  This  synthesis this  (5). of  term,  f o r other  Location,  rate  in a general  seemed  tied  than  to  presence  organisms  the  problem  have  RNA  being  "growth  sense,  been  and  the  mechanisms  of  of  rate  studied  have  s u b t i l i s as  structure  the  absence  growth  regulation  rate  is  p r i m a r i l y to or  (and  a  the  this  30-  proportionality  been most t h o r o u g h l y of  at  more t h a t  of  s u c h as  and  45$  of ribosome as  the  mass  r e g u l a t i o n " w h i c h had  ribosomal  organization  by  The  that  The  synthesis  cell  phenomenon known as  "metabolic  rather  vary  {H).  the  of  with  a t u=0.2 t o  been r e c o g n i z e d  although c e r t a i n f a c e t s  clarified  2.  has  to c o n t r o l s  nutrient  controlling coli  term  growth r a t e  dependent  E.  the  to r e f e r  particular  15$  synthesis  and  increased  fraction  from  c e l l u l a r growth r a t e  dependent r e g u l a t i o n " .  cellular  the  same r a n g e o f g r o w t h r a t e  characteristic  coined  vary  synthesis  in  been  well.  rRNA genes i n  E.  coli. As of  mentioned  three  previously,  the  different  RNA  species,  ribosomal  subunit,  and  the  subunit.  These t h r e e  cistronically  and  RNA  i n the  23S  the and  species order  E_^_ c o l i 16S 5S are  ribosome  rRNA f o u n d  rRNA f o u n d transcribed  16S-23S-5S, as  was  is  comprised  i n the  i n the  30S 50S  polyshown by  the  a  4  isolation  of  III  Formation of  (6).  involve  mutants  RNase -  with  hybridization  to  r e d u n d a n c y was n o t  growing  for  cells  questionable. E.  coli  there Five  (8)  between  p e r genome.  to meet  exactly  the  rRNA o p e r o n s  have  70 and 90 m i n . on t h e  o p e r o n s map n e a r genes f o r  5 and 57  a number o f  translation  apparatus  Southern  that  the  there  E_j_ c o l i  for  are  needed  chromosome that  of  the  the  increased  rRNA s y n t h e s i s  initiation  o f DNA r e p l i c a t i o n at  regulation  of  because  has  amounted  it to  rRNA s y n t h e s i s been  20$ as  seen growth  due  higher  cannot  that rate  to  this  rates  the u.  However,  gene dosage from  area  remaining the  0.9  of  to an  in the  in this  increase to 2.7  near  somewhat  because  increase  be e x p l a i n e d  varied  an  rRNA o p e r o n s  c h r o m o s o m a l r e p l i c a t i o n may c o n t r i b u t e  i n gene dosage  but  contains  o r i g i n of  increase  of  transcription-  of  h i g h growth  is  mutation.  (the  also  rapidly  a strain  the  effective  the  very  been mapped t o  The c l u s t e r i n g  at  seven  had been d e l e t e d this  E.  this  isolated  to  to  total  were  demands o f  due  components  (10).  of  may r e f l e c t  have  m i n . ) , an a r e a  other  digests  copies  rRNA o p e r o n s change  appeared  By u s i n g  seven  phenotypic  RNase  occurred  The r e a s o n  E l l w o o d and Nomura (9)  seven  enzyme  that  Multiple copies rRNA  whether  i n w h i c h one o f  these  (7).  established  clear.  was no o b v i o u s of  events  r e s t r i c t i o n enzyme  sufficient but  processing  i n d i v i d u a l RNA s p e c i e s  processing  analyze  o f rRNA o p e r o n s  necessity  i n the  transcription  DNA, K i s s e_t a l . .  copies  the  mediated  concomitantly  coli  defective  overall way only  doublings  5  per hour  (9 ) .  All  seven  rRNA o p e r o n s  analysis  first  indicated  fell  into  spacer  two g r o u p s  regions  within  the  that  found  the to  not  the  differing  between  Each o p e r o n was  were  structure  of  Heteroduplex different  p r i m a r i l y i n the  16S  and 23S  contain  16S-23S s p a c e r  identical.  RNA c o d i n g  either  regions  that  sequence  one  or  were  operons of  regions  two  the (11).  tRNA genes  co-transcribed  with  the  rRNA g e n e s . F o u r o f t h e o p e r o n s c a r r i e d t h e gene e n c o d i n g Glu He tRNA w h i l e the r e m a i n i n g t h r e e o p e r o n s had genes f o r tRNA Ala and tRNA carried  (12,  13).  In a d d i t i o n ,  co-transcribed  three  tRNA genes d i s t a l  of to  the the  operons  also  5S c o d i n g  region  (12).  All  seven  specialized have been  rRNA o p e r o n s  transducing  largely  information, vitro  E_^ c o l i  phage or p l a s m i d s ,  sequenced  combined w i t h  (for data  t r a n s c r i p t i o n products  revealed operons  an u n u s u a l examined.  feature  arrangement  from  downstream  promoter  of  identified including  the for  of of  review, generated cloned  the  with  the  o r P2 p r o m o t e r  tandem p a i r other  E_j. c o l i  a Pribnow box,  by  contained promoters  a -35  and s i x  see by  promoter  upstream  region,  isolated  the  analyzing (15,  seven Sequence  the  in  16),  has  region  of  all  a double,  or  tandem,  or P1 about the  of  on  4 and 1 4 ) .  rRNA genes  Each o p e r o n c o n t a i n e d  promoter the  have been  promoter 120  basic  (see and a  17  rRNA  separated  base p a i r s . elements for  review),  transcriptional  Each  6  start  or + 1 n  The  site.  n  availability  t o be made i n terms seven operons region site The  of sequence  data  o f the o v e r a l l  downstream P2  (16 o u t o f 27 well,  t h e P1  sequence  promoter  bp)  also  between P1  was  and  n o t s e e n i n t h e P2  P2  showed  promoter  region  expression  The rich  P1  below).  As w e l l , a l l o p e r o n s  was  f o r t h e rRNA  a 67  antitermination  Finally,  an RNase I I I p r o c e s s i n g  site  preceding  sequence  the  promoter.  in this  area As  an i d e n t i c a l  bp  The  no  15  box.  120  This  bp  region two  extensive  between +1  a r o l e i n rRNA  and  +10.  gene  ( 1 8 ) , an  o f amino a c i d s t a r v a t i o n ( s e e  had  required  point,  there  bp r e g i o n  transcriptional start  rRNA o p e r o n s i n a r e g i o n  was  as s e e n i n P1.  promoter.  suggested to p l a y  response to c o n d i t i o n s  this  bias  rich  o f a l l o p e r o n s d i d however,  adaptive  After  P1  the s o - c a l l e d s t r i n g e n t response  downstream o f t h e P2  +1  the Pribnow  "discriminator" region  has been during  an A-T  A-T  some a r e a s o f homology when any  conservation.  This  (where  o f the upstream  included  but o v e r a l l  a G-C  -62  o f a l l s i x o p e r o n s had  o p e r o n s were compared  contain  and  showed  (TCCCTATAATGCGCC) t h a t  comparisons  a highly  but n o t t o t h e same e x t e n t  promoter  conservation  contained  bp) between -35  of t r a n s c r i p t i o n i n i t i a t i o n )  some  homology among s i x o f t h e  ( 4 ) . A l l s i x operons  (22 o u t o f 27  allowed  site  system (7)  t h e 16S  immediately w h i c h may  be  (19, see b e l o w ) .  was RNA  identified coding  homology became e x t e n s i v e  ina l l  sequences. with  only  20  7  of  the  next  The  1541  a stem-loop  review).  was  the  terminator  was  about  3.  variety  rRNA a c c u m u l a t i o n (26)  found  (see  operon  the  the  5S  stop  at  the  21,  22).  residues Ref.  23  for  contained first  RNA  s i n c e i t has  o f rRNA  a  terminator  gene and  the  significance  of  been shown t h a t i n first has  terminator not  been  noted  genes.  clear  that ribosomal  operons yet  regulated at a v a r i e t y  overall  several U  rrnB  of  (20,  (25).  of e x p r e s s i o n  of d i f f e r e n t  probable  a tandem a r r a n g e m e n t  mechanisms.  with  the  identified,  the  point.  factor level By  RNA  with  of d i f f e r e n t  A key  r e g u l a t i o n i s at  o r a t some p o s t - t r a n s c r i p t i o n a l  Gausing  by  i n which  end  become i n c r e a s i n g l y  t o be  whether t h e  (21)  3'  of  terminators  E_;_ c o l i  a l l transcripts  a r e among t h e most complex potential  a number  were r e c o g n i z e d  i s unclear  rRNA o p e r o n s  has  o p e r o n s have a l s o been  n u c l e o t i d e s downstream. The  terminator  Regulation  the  t o the  In a d d i t i o n , such  It  and  arrangement  175  v i v o most i f n o t  other  rRNA  of rho-independent  Interestingly,  double  (24).  the  (1).  structure followed  located adjacent  second  in  ends o f  termination s i t e s  characteristic  double  heterologous  i n a number o f c a s e s  transcription had  being  far distal  examined  All  bp  the  p o i n t s by  i s the of  operons  a  question  of  transcription  comparing  the  rate  of  r a t e o f de_ novo rRNA s y n t h e s i s ,  t h a t at moderate  to f a s t  growth r a t e s the  two  8  were v i r t u a l l y degradation  was r e g u l a t e d  synthesis  initiation  constant  o f new  chains  (28) who  This  rRNA.  the r a t e  by m o d u l a t i n g  conclusion  was  t h e number  growth r a t e  At  the r a t e  Therefore,  different  the synthesis  elongation  (27), i t appeared  strengthened o f RNA  polymerase  t r a n s c r i b i n g rRNA  of synthesis  (below 0.3-0.4 d o u b l i n g s  p i c t u r e has emerged.  o f rRNA e x c e e d e d  Gausing  per  was r e g u l a t e d  rRNA c o u l d  dichotomy  Since control  slowly  play  became  Thus, i t appeared  at the l e v e l growing  This  cells  with the significant  that  rRNA  of t r a n s c r i p t i o n  intiation  where d e g r a d a t i o n  o f newly  a significant  role.  The r e a s o n f o r  i s p r e s e n t l y not c l e a r .  t h e p r o m o t e r s o f rRNA o p e r o n s a p p e a r  points  hour),  (26) has shown  the accumulation,  degraded.  rRNA was d e g r a d e d .  a l l but very  this  genes  o f rRNA as t h e  - 0.2 where up t o 70% o f t h e newly  synthesized  o f new  by t h e d a t a  a t g r o w t h r a t e s o f 0.1  in  of  of i n i t i a t i o n  being  synthesis  rRNA  the r a t e of  e x c e s s rRNA a p p a r e n t l y  synthesized  o r no  increased.  slow r a t e s o f growth  a slightly that  with  little  the frequency  ( i . e . the frequency  showed t h a t  in parallel  was  o f rRNA c h a i n  m o l e c u l e s p e r genome which were a c t i v e l y increased  there  a t a l l growth r a t e s  was r e g u l a t e d  rRNA t r a n s c r i p t s ) . o f Muto  that  p r i m a r i l y by m o d u l a t i n g  Furthermore, since  was e s s e n t i a l l y that  indicating  of excessively synthesized  accumulation synthesis.  identical,  t o be t h e p r i m a r y  i n t h e g r o w t h r a t e d e p e n d e n t r e g u l a t i o n o f rRNA  9  synthesis, the  some o f  the  t r a n s c r i p t i o n of  conditions  i) stable  can be  RNA p r o m o t e r s  newly  30,  than  have  is  due but  analysis  and T r a v e r s  (32)  i n promoter  subject  to  gene  upstream s t i m u l a t o r y by showing digestion upstream  that  the  that  influence  environmental  -35  of  this  noted  the  of  two  of  caused  a 10  these  studies  promoters  DNA  sequence a Lamond  wild-type to  12-fold  conclusions  were  a plasmid-borne Tyr  tRNA  to  the  topological  p r o m o t e r and c o u l d state  evidence  actually  of  that  functional  could protect  tRNATyr p r o m o t e r  transcription  the  to  of  gene p r o m o t e r ,  the  was  level  By p e r f o r m i n g  to  element  up  recent  functional  of  of  Although  chromosome,  Several  P1. Tyr  feature  transcriptionally  enhanced  However,  Nevertheless,  the  promoter.  removal  and - 9 8  activity  due  coli  tRNA  that  -40  are  on a s t i m u l a t o r y  region of  E_^ c o l i  they  (5).  presence  RNA p o l y m e r a s e  a region of  to  important  E_j_ c o l i  rRNA  activity.  chromosome.  the  dependent  fused  artifacts  the  average  the  position  by m e a s u r i n g  _in v i v o  RNA i s  the  first  decrease  versus  is  of  between  galactokinase  shown  under d i f f e r e n t  A potentially  0.4% o f  to  the  sequence  reached  the  only  upstream of  deletion  that  suggested  not  than o n e ,  located  is  synthesized  31)  expression rather  rRNA o p e r o n s  been  considered.  rRNA genes c o m p r i s e  (29,  which have  Upstream a c t i v a t i o n :  much more a c t i v e  40$ o f  factors  the  at  i n i t i a t i o n point  least (29).  plasmid  such  an  was  from DNase 75  be  obtained I  bp These  10  protection with  a  region  points to  and  such  from  studies  A  o f DNA  that  sites  primary s i t e  second  study  that  outside  suggested  secondary  the  indicated  of  RNA  the  binding  could  polymerase  normal  of  serve  the to  bears  on  -10  activate  the  interact  contact  polymerase  via protein-protein  which  -35,  could  molecule  transcription  interactions  question  of  (29).  upstream  a c t i v a t i o n r e g i o n s was p e r f o r m e d b y B o s s i a n d S m i t h (30) using His t h e tRNA gene o f S a l m o n e l l a t y p h i m u r i u m . T h e s e a u t h o r s showed that  a  3 bp  deletion  transcriptional the  wild-type  mobility  from  efficiency  promoter  474  bp  to  570  bp.  of  mobility.  electrophoretic  migration  Bossi  presence  and  Smith  conformation, somehow  the  RNA  contacts  This  (30)  to  have  could  be  3 bp Other  o f DNA or  an  result that  wild-type an  increased,  have  i n the that  an  number  helix  retarded  34).  DNA  bending  the  the  550  normal  (33,  region,  specific  about  correlated  of  thereby enhancing  interactions.  be  of  fragment  that  efficiency  of  in  addition,  of  the  aberrant  promoter  a  size  shown  could DNA  In  drop  electrophoretic  restored  fragments  through  2-fold  promoter  apparent  studies  normal  the  altered  fragment  kinks  in a  promoter.  transcriptional  such  polymerase-promoter  The  suggested  of the  the  polymerase would  bends  upstream  related  promoter.  of  showed  gels.  the  resulted His  tRNA  migrated with  electrophoretic  the  the  element  f o r example, Deletion  t o -72  of  i n polyacrylamide  of  with  -70  was the DNA  around  protein-DNA initial  11  Finally,  Gourse e_t ajL. (31)  promoter r e g i o n monitoring  of  this  to  found  i s not  (10).  region  could  s e e n by  of  bacterial  Bossi  and  that  classical  three  or  of  into,  associated region  at  the  the  with has  (30).  DNA  Again,  the  site  near  region  least  of  lambda normally  capacity  remains  t o be  stimulatory  to, a highly  c h a n g e s or seen.  that  15-fold  and  a  and  also that the  conformational  could  preceeding function  capacity.  A-T  rich  Interestingly,  region  promoters.  above  commonly  Whether  inducing  i n some o t h e r  the  in a  sequences mentioned  s i g n i f i c a n c e i n terms o f  conformational  of  r e s u l t s suggested  immediately  growth r a t e r e g u l a t e d  observed  the  question  deletion analysis  these  a stimulatory,  upstream  any  potential  p r o m o t e r between p o s i t i o n s -51  promoter element  least  or v e r y  open the  where rRNA o p e r o n s a r e  c e r t a i n s t r u c t u r a l or  procaryotic  regulatory,  any  e l e c t r o p h o r e t i c m o b i l i t y , s i m i l a r to  Smith  of  and  chromosome.  eliminated  leave  have shown by  rRNA P1  l a c Z gene  rrnB  copy number d i f f e r e n c e s f r o m  rRNA t r a n s c r i p t i o n a t  a retarded  characteristics  rich  the  increase  possibility  fell  i n t o the  i t does  i n a region  These a u t h o r s  upstream  displayed  all  situation,  E_j_ c o l i  after integration via a  e f f e c t s o f chromosome l o c a t i o n s i n c e  integration  -88  construct  t o p o l o g i c a l or  normal w i l d - t y p e the  production  chromosomal i n t e g r a t i o n p r e s u m a b l y  p r o b l e m s due  the  f u s i n g i t to a p r o m o t e r l e s s  B-galactosidase  lambda v e c t o r While  by  have s t u d i e d  the  the  regulatory  A-T  12  ii)  Antitermination.  For and  most b a c t e r i a l  translation  operons,  have been shown t o be  translating  ribosomes prevent  terminating  transcription  35  for details).  dependent  termination  factor  operons are  long,  suffer  from  e x p e r i m e n t s by that  RNA  termination  signals  The  involve  the  bacteriophage  termination (39).  without  be  read  terminators termination  between (35).  termination,  by  the  that  coli  so  for  insertion RNA as  has  the  be  but  Morgan  at  (see  Ribosomal  through r h o - f a c t o r  modified need  prematurely  o p e r o n s which would  initiating  suggested  that  of  polymerase to p r e v e n t  RNA  expected  early  (37)  showed  rRNA dependent transposons  or  initiating  at  premature  transcription-translation  (38).  coupling  The  polymerase  transcription  from  cryptic  B r e w s t e r and  introduced  This  such  interaction  RNA  and  efficiently  coupled  transcription  an  molecules  promoters might  termination  on  and  (36)  of  intragenic  non-translated  Morgan  processes  polymerase  s i g n i f i c a n t premature  n o n - c o d i n g DNA. these  "rho"  polymerase  promoters c o u l d  at  RNA  Such p r e m a t u r e  been shown t o be  to  the  an  system  as  lambda  i s known t o use  a r e g u l a t o r y mechanism d u r i n g  lambda N - a n t i t e r m i n a t i o n elaborate  (Nus  factors),  (nut  locus)  RNA  (40).  a transcription  interaction  and  been shown  between a s e t o f h o s t  p o l y m e r a s e , and Friedman  s y s t e m has  lytic  a site  Gottesman  on  the  (41)  growth to  proteins  phage genome  have  anti  proposed  13  three  consensus  and  of  C  which  essential  for  recognition that  a  Box  B  sufficient  the  play  expression their  the  such  a  to  unclear; is  simply  further  is  comparisons on  a  and  shown  just Box  been  (46).  in  B  that  shown  operon.  that  the  have  shown  fragment P2  this  sequence  further of  Boxes for  at  the  least  A  and  host  antitermination rRNA  gene  suggested  polymerase  Nevertheless,  underscores  protein  required  these  RNA  A  transcription  that  have  B,  is  bp  have  modulating  Boxes  Nus  rrnB  i s not  e_t a _ l . ( 3 1 )  ensure  67  consisting  Whether  role  to  a  A  et_ a l _ . (31)  system,  Gourse  Box  rho-dependent  as  i t has  and  rrnG  have  denoted  symmetry  located  E_^ c o l i  regions  untranslated  system  was  Gourse  regulatory  dyad  sequence  overcome  lambda  region,  while  experiments  although  any  is  an  the  i s necessary  function  through  of  of  (42)  sequence  critical  unlike  nut  region  (44 , 45 ) w h i l e  protein  signals  the  Recent  like  antitermination Nus  a  (43).  Deletion  pinpointed Thus  is  downstream  termination  C.  B  for  antitermination  B-A-C  promoters. was  Box  site  immediately  alone  sequences  the  that  elongates  existence  o v e r a l l complexity  of  of rRNA  operons.  iii) When  Stringent  bacterial cells  starvation adjusting chances  control  they their  for  respond  encounter  by  metabolism  s u r v i v a l and  conditions  halting  further  in  a  allow  such  quick  way  as  of  growth to  recovery  amino and  improve when  the  acid  rapidly their starvation  14  conditions  are  collectively (47)  and  termed  were s e e n  (reviewed observed lipids,  i n 48 to be  precursor  to  and  since  the  50,  was  at  the  the  energy d r a i n  rate  o f rRNA  initiation  of  molecule  intracellular  tetraphosphate  synthesis accumulate  of  membrane was his  r a p i d l y growing  t h e s e genes f e l l  be  was  stable  i s unclear.  involved  was  concentration  (ppGpp) i n c r e a s e d  cell  (54).  occurs  concurrent Relaxed  with  RNA The  only  RNA  genes,  is a (52).  Overall,  1-to-3  while  fold.  selective  (53)  possibility  from micromole  to s y n t h e s i z e  and  to  e f f e c t s on  decrease  many  10-to-20 f o l d  genes  E_j_ c o l i  of  of  was  the  although that  r a i s e d a f t e r i t was  the  rate  stable  of a n u c l e o t i d e ,  mutants o f  ppGpp c o n t i n u e d  lac  cells  the  through  the  inhibited,  and  was  carbohydrates,  e f f e c t due  by  shown t h a t  modulated  processes  transport  t r a n s c r i p t i o n of  d a t a has  can  of  well,  the  most p r o m i n e n t  t r a n s c r i p t i o n at  this  amounts per  As  as  Brenner  cellular  biosynthesis  cell  and  r e p l i c a t i o n o f DNA  b u l k mRNA t r a n s c r i p t i o n d r o p p e d  regulation  Stent  t r a n s l a t i o n a l apparatus  on  of  Most e x p e r i m e n t a l  the  The  by  the  increased,  the  level  of  the  effector  the  some o p e r o n s s u c h  transcription rate  how  example,  was  across  the  exactly  response  peptidoglycans.  51).  synthesis  of  For  and  c h a n g e s were  a wide r a n g e o f  p r o t e o l y s i s was  (49,  significant  involve  r e d u c e d , as  t r a n s c r i p t i o n of  stringency  stringent  49).  molecules  increased  These m e t a b o l i c  the  nucleotides,  intracellular  the  removed.  noted  guanosine to  which f a i l e d RNA  that 5',3'  millimole  in stable  stable  some  RNA to  during  amino  15  acid  starvation. A single genetic  t o encode a r i b o s o m e  associated  locus  ( r e l A ) was  thereby  f a c t o r which s y n t h e s i z e d  shown  ppGpp  (55).  There i s p r e s e n t l y ppGpp a c t s  to modulate  response.  Nene and  conflicting s t a b l e RNA  Glass  (56)  evidence  activity  as  during  have i s o l a t e d  or  the  RNA  even i f  stringent  polymerase  mutants w h i c h p r o d u c e d  a relaxed  the  made ppGpp a f t e r amino a c i d s t a r v a t i o n .  mutant  cells  Similarly, mutants  still  e_t a_l. (57)  Little  i n which  the  enzyme.  interaction  proposed in  the  by  Both r e p o r t s RNA  following  (58).  This  the  Significantly the used  stable  and  of at  E_;_ c o l i lower  to a l t e r  the  RNA  a functional  stable  and  can  RNA  regulation  be  be  discussed  o f rRNA and  that  ppGpp  tRNA i n v i v o  in  detail  specifically (59,  however, a number o f w o r k e r s have f a i l e d (61).  in vitro  More r e c e n t l y , K a j i t a n i  and  reaction  60). to  see  Ishihawa  (62)  s y s t e m whereby a number o f d i f f e r e n t ( i . e .  n o n - s t a b l e ) gene p r o m o t e r s were p l a c e d  transcription  though  section.  synthesis  same e f f e c t a mixed  induced  polymerase  Many i n v e s t i g a t o r s have r e p o r t e d inhibited  was  model w i l l  even  isolation  implicated  i n t o a model f o r g e n e r a l Travers  the  in vivo  t h e s e m u t a t i o n s were f o u n d  between ppGpp and  incorporated  reported  s t r i n g e n t response  ppGpp c o n c e n t r a t i o n s ; polymerase  phenotype  t o how  to show t h a t  low  levels  of  i n the ppGpp  same  16  significantly the  decreased  rRNA  t r a n s c r i p t i o n from o t h e r  favors  the involvement  regulation, polymerase. clear  f r o m 2 3 C t o MO  a large  accumulation  synthesis  increased  suggested  that  response  and  i t s observed  as w e l l .  but only  genes a r e c o n c e r n e d ,  the  t h e RNA  i s by no  that  this  means who  induced  DNA  Travers  a s y s t e m whereby t h e  g a l K gene, Lamond  stringency  be due t o i t s a b i l i t y  this  I t i s apparent  that  question.  sequences o f s t r i n g e n t l y c o n t r o l l e d and c o - w o r k e r s  rich  (64,  conserved  65)  have  features are  "discriminator" region  site;  t h e TTGA  an u p s t r e a m s t i m u l a t o r y  has  e f f e c t o r of the s t r i n g -  effector.  a t l e a s t two o f t h r e e  from  o f rRNA  results, Gallant  c o - i n c i d e n t a l l y during  to c l a r i f y  the t r a n s c r i p t i o n a l s t a r t  Using  RNA  et^ a_l. ( 6 3 )  on t h e s e  e f f e c t s may  n e c e s s a r y : i ) an 8-10 bp G-C  iii)  or through  of Gallant  Based  of the true  f a r as s p e c i f i c  slightly  of stable  this  C and f o u n d  increases  much more work i s needed  deviated  level  n o t be t h e t r u e  iji vitro  to mimic t h e a c t i o n s  that  aspect  evidence  o f ppGpp, b u t s u r p r i s i n g l y , t h e r a t e  ppGpp may  ent  not a f f e c t i n g  Thus, most  previously,  by t h e s t u d i e s o o  E_;_ c o l i  near  a t t h e DNA  However, as s t a t e d  shifted  suggested  promoters.  o f ppGpp i n t h i s  either directly  as e v i d e n c e d  As  t r a n s c r i p t i o n while  i i ) a -35  region  located  which  o f t h e c o n s e n s u s s e q u e n c e ; and  sequence coli  and T r a v e r s  as d i s c u s s e d Tyr  tRNA (65)  earlier.  p r o m o t e r was j o i n e d t o demonstrated  that  a 4 bp  mutation i n the d i s c r i m i n a t o r r e g i o n a b o l i s h e d the s t r i n g e n t r e g u l a t i o n o f tRNA T y r t r a n s c r i p t i o n in_ v i v o , i n d i c a t i n g t h a t f o r  17  this  gene a t  stringency. the  P1-P2  l e a s t , the In  G-C  rich  region  analogous s t u d i e s ,  was  Sarmientos  promoter r e g i o n s  of  the  a t r a n s c r i p t i o n terminator  on  a multicopy  most i n t e r n a l RNA vivo  and  Interestingly, subject  t r a n s c r i p t s on  they  promoters contained  was  not  +1  sufficient  necessary  i)  DNA  All  studies  RNA  to  mediated of  (26).  of  thus  confer the the  upstream  directly  assayed  P1  P1  promoter element  stringent  control  critical  promoter the  DNA  P1  was  and  P2  the  sequence  alone  A more d e t a i l e d appears  to  be  sequences.  rRNA  operons.  regulation  s y s t e m s whereby  the  the  promoter r e g i o n  control  was  been i m p l i e d  i n d i c a t i n g that necessary  has  of  a number o f d i f f e r e n t f o r m s  already  evidence  technology.  to  dependent  tRNA genes a r e  recombinant  of  f a r have i m p l i c a t e d  Direct  dependent  rich  control.  in  gels.  both  a G-C  to  eliminating  directly  Furthermore,  stringent  That growth r a t e  rRNA and  plasmid,  fused  requirements  being  growth r a t e  construct  the  i n d i c a t i n g that  t r a n s c r i p t i o n a l l y has  Gausing  regions  of  sequence  regulation.  only  dependent r e g u l a t i o n  genes as  operon  a d i s c r i m i n a t o r - l i k e sequence near  pinpoint  Growth r a t e  stable of  to  that  rrnA  and  to  e_t a_l. (66)  polyacrylamide  regulation.  site,  mutational analysis  4.  found  to s t r i n g e n t  transcriptional  E_j_ c o l l  s t r u c t u r a l elements,  iii vitro  critical  only  and  also  by  the  the  data  promoter  sufficient  come w i t h  the  advent  Most i n v e s t i g a t o r s have c h o s e n promoter r e g i o n  of  for  interest is  to  of  18  fused  to  a  marker  quantatatively The  fusion  either  on  is a  then  discussed termed gene  retains  site), of  a  as  hybrid  that  the  gene  such  In  and  case,  paralleled methods  used  insertions, Tyr  did  the  gene  tRNA  number  of  increase was  taken  their in by  could  galK  (see  and 67  appropriate  lysogenic  promoter expressed  Berman be  this  for  phage  organism  and  the  under  protein.  The  thesis  which  review).  host  monitored  fusions  of  are  various  fusions  properly  since  the  marker  (ribosome  result  in  binding  the  synthesis  not  the  a  did  e_t a _ l . ( 6 9 )  RNA  synthesis.  stable  showed  increased  growth  RNA.  precise  rate  levels  based  on  occurred.  exhibit  a A  subcloned  the  B-  the  phage of  Mu where  within  Interestingly,  growth more  of  to  which  Unfortunately,  localization  activity. who  coli  governed  fusions,  not  showed Tyr tRNA  subjected  i n s e r t i o n s had  fusions  the  first  was  stable  lacZ  permit  into  increasing  of  (68)  Beckwith  B-galactosidase  fusions  with  generate  of  which  the  and  inserted  B-galactosidase Ota  on  fusions  synthesis  synthesis  to  the  the  easily  (67).  activity  the  or  the  "gene"  mechanisms some  galactosidase  into  be  translational signals  approach,  the  regulatory this  to  gene  that  or  lacZ  "transcriptional"  protein  lacZ  as  throughout  i t s native  this  of  for  used  or  opposed  Using  the  activity  "operon"  can  plasmid  assaying  here  such  product  introduced  multicopy  by  whose  assayed,  transcriptional conditions  gene  rate  refined  a  dependent approach  promoter  region  19  plus  some 16S  RNA  coding  onto a lambda p g a l 8 that  expression  function  of  the  and  fused  was  required control  that  only  to p l a c e (31 , 70,  fragment to  the  sufficient  to p l a c e  by  galK  physically  to  the  separating  and  the  p r o m o t e r s t h e y were a b l e characteristic  galactosidase no  activity;  change i n e x p r e s s i o n  progressively  relative  to  sufficient region  of  the  P1  l a c Z c o n t r o l l e d by  and DNA  the  sequence  3*  increased.  (between -51  and  -20)  be  been  (P2) fusion in  Bshowed  By of  the  P1  and  -4  The  -35  were  response. to  has  promoter  s e q u e n c e s between -51  appeared  +5,  By  flanking regions  a growth r a t e dependent  to  integrated  PI-lacZ  P2  a  control.  increase  the  was  was  downstream  dependent  growth r a t e  -50  chromosomally  only  well.  shown t h a t  plasmid,  and  of  genes  residues  transcriptional initiation site  to c o n f e r P1  (P1)  growth r a t e  the  a  dependent  promoter r e g i o n s .  to show t h a t  that  as  RNA  have  critical  used  upstream  as  found  the  under g r o w t h r a t e  the  who  rrnB  d e l e t i n g b o t h 5*  promoter, they found  spanning  a multicopy  expression  rrnE  of s t a b l e  e_t_ a_l. (71)  promoter  Gourse e_t a_l.(31)  lacZ fusions  have a l l r e a c h e d  region  most d e t a i l e d a n a l y s i s o f  presented  gave the  studies  gene on  operon  i t was  increased  gene under g r o w t h r a t e  tRNA  galK  operon  rrnB  to s t r i n g e n t r e g u l a t i o n as  71 , 7 2 ) . Deuster Leu  o f the  coli  i n a manner c h a r a c t e r i s t i c  promoter  a fused  when f u s e d  The  other  the  Here a g a i n  galactose  subject  the  from  phage.  growth r a t e  t h e n a number o f  conclusion  DNA  transducing  cellular  rRNA s y n t h e s i s , Since  of  sequences  critical  20  because  s u b s t i t u t i o n s o f the w i l d - t y p e  sequence slight  from a non-regulated  i s somewhat u n d e f i n e d .  suggested growth  that  only  fragment  t o -20) s t i l l  be e x c l u d e d  and more s p e c i f i c  clarify  this  pointed  out, there  sequences  point.  appear  i n t h e P1 p r o m o t e r  operons, but t h i s Therefore,  does  t o be some  the p r e c i s e r o l e  smallest roughly  studies  the  conservation  bases  cannot to  (58) had p r e v i o u s l y  confined  of s p e c i f i c  15 bp o f  a r e needed  of the seven  homology i s l a r g e l y  have  Therefore,  as T r a v e r s  region  of the  o f t h e -35 r e g i o n  mutagenesis  Nevertheless,  their  contained  outside  a  o f P1 i s c r i t i c a l f o r  5' f l a n k i n g s e q u e n c e s .  importance o f sequences  a -10  the r o l e  e_t al_.(31)  r e g u l a t i o n ; however,  (-51  h i g h l y A-T r i c h  possible  Gourse  with  resulted i n only  Therefore,  t h e a c t u a l -35 r e g i o n  r a t e dependent  regulated the  ( l a c ) promoter  loss of regulatory capacity.  -10 r e g i o n  -10 r e g i o n  of  coli  rRNA  t o t h e -10 remains  region.  t o be  defined.  Support  f o r the o b s e r v a t i o n  promoters a r e i n d i v i d u a l l y come from e a r l i e r  than a t r a d i t i o n a l  above,  these  workers  sequences)  i n s u c h a way  transcript  was p r o d u c e d .  the rrnA  region that  regulated  and c o - w o r k e r s  operon-fusion  coupled  termination  t h e P1 and P2 rRNA  and d i f f e r e n t i a l l y  s t u d i e s by C a s h e l  Rather  transcription  that  system  has a l s o  (66, 73 , 7 4 ) .  as d i s c u s s e d  promoters  to the rrnB  (eliminating a l l internal  a small,  Expression  easily  visualized  o f the rrnA  in_ v i v o  promoters  could  21  be  monitored  by  extracting total  the  specific  rRNA  transcripts.  73)  observed  that  the  p r o m o t e r was only  the  P1  that neither  (ethidium  phase c e l l s ,  greater  nor  o f P2  characteristic  while  P1  only  activity  g r o w t h r a t e s and  was  weakly a c t i v e P2  whereby rRNA s y n t h e s i s from  must be  mentioned systems, be  as  non-translated ing  the  on  examined.  only  as  the  from  that  of  of  e_t a_l. ( 7 4 )  rapidly and  detection gels)  while  took  had the  Pl  some t i m e  These r e s u l t s  i n response  have  in  s t a t i o n a r y phase  predominated  promoter might  P1  a function  i n polyacrylamide  levels.  to  suggested  at moderate  to  fast  to growth r a t e ,  f u n c t i o n as  q u i c k l y resume i n c e l l s  out  t h a t most from  product,  the  of  the  study  multicopy  plasmids,  Since  given  any  a s i n g l e copy per  translation  of  p r o m o t e r and  method  high  above were d e r i v e d  critically  present  pointed  some c a r r i e d  P2  (66,  group  the  a means recovering  (74).  s t a t i o n a r y phase  It  their  a delay  could  Cashel's  Sarmientos  after  regulated  quantifying  t r a n s c r i p t s were o b s e r v e d  RNA  clearly  and  strength  the  transcripts increased  reach  their  way,  increase  Upon o u t g r o w t h  appeared  normally  P2  RNA  or  than  to  although  transcripts  that  activity  bromide s t a i n i n g o f  accumulation  this  Furthermore,  P1  sensitivity.  In  appeared  growth r a t e .  stationary  limited  3-fold  about  transcript  increasing reported  overall  cellular  there  product  of  conclusions of  operon-fusion  and  rRNA o p e r o n  chromosome and  e x i s t s the a gene  therefore  gives  possibility  fused  to  an  is  must  normally rise  that  to  a  measur-  rRNA-derived  22  regulatory could  region  mimic  artifacts and  a growth r a t e  low g r o w t h r a t e ;  changed.  Chapter 1.  Several  determining  the l e v e l  fusion-specific  ii)  The major  stability  o f mRNA a t  proportion  copy  further  discussed  of t r a n s l a t e d product  question  number  i n the  above simultaneously  and t h e l e v e l o f  changed.  c o n t r o l o f rRNA  genes.  now posed i s how t h e c o n c e n t r a t i o n o f  i s regulated  conditions  concentration  be d i s c u s s e d  o f t h e f u s i o n s y s t e m by  f o r growth r a t e  ribosomes per c e l l environmental  These w i l l  mRNA as g r o w t h r a t e  Models  potential  t r a n s l a t i o n o f mRNA a t h i g h  None o f t h e s t u d i e s  the v a l i d i t y  in  response.  b) d i f f e r e n t i a l  established  the  dependent  s i t u a t i o n which  growth r a t e s ; o r c ) f l u c t u a t i o n s i n p l a s m i d  growth r a t e  Results,  p r o d u c e an a r t i f i c i a l  i n c l u d e : a) d i f f e r e n t i a l  different as  could  i n r e s p o n s e t o changes i n  ( i . e . growth r a t e ) .  o f ribosomes  t o t h e growth  As s t a t e d  (and rRNA) i n c r e a s e s  before,  approximately  r a t e , u , and t h u s t h e r a t e o f  2 synthesis  increases  synthesis  rate  regulation the  with  o f ribosome b i o s y n t h e s i s .  be a b l e  environment inducing  I t has been  o f rRNA i s o f c o n s i d e r a b l e  mechanisms g o v e r n i n g  firstly  u .  growth  r a t e dependent  the appropriate  be a b l e  that the  importance i n the  In order  t o sense the n u t r i t i o n a l  and s e c o n d l y ,  shown  status  t o be e f f e c t i v e , r e g u l a t i o n must of a c e l l ' s  to respond to t h i s  amount o f rRNA  s t a t u s by  t r a n s c r i p t i o n f o r that  23  g r o w t h r a t e and In g e n e r a l ,  three  regulation  a)  Maaloe  (75)  cell  capacity.  ribosomal of  different  the  This  a passive  a limited  competition  metabolism  increasingly  repressed.  observations  are  Ikemura and  and  could  (76)  many o f  containing  r r n D or r r n B  expression  from each  subsequently  reduced  transcriptional While  and  with  mechanism would  not  seen  b) 80)  individual while  of  the  quality  of  become  model.  showed  For  example,  e_t a_l. (77)  increased  introducing  plasmids  that  the  level  chromosomal rRNA o p e r o n  there  were no  of other  apparent  competing  i n a concurrent  of was  changes i n  the  non-ribosomal  p r e d i c t that such  overall  for  experimental  genome by  Maaloe model would  cell  as  pathways  Jinks-Robertson  i n f l u e n c e the  gene i n t h e  the  this  o p e r o n s and  activities  the  the  compete  i n favor  because  However, c e r t a i n  the gene d o s e o f rRNA o p e r o n s p e r  every  switch  b i o s y n t h e s i s would  in conflict  Nomura  for  transcription  p r o m o t e r s must  genes as g r o w t h r a t e i n c r e a s e d  intermediary  ribosomes.  r e g u l a t o r y mechanism  capacity for  non-ribosomal  g r o w t h medium i m p r o v e d  genes.  c o r r e c t number o f  genes.  only  and  the  models have been p r o p o s e d  suggested  has  that ribosomal  this  produce  o f s t a b l e RNA  whereby t h e and  thereby  a  passive  p a t t e r n of e x p r e s s i o n manner, t h i s  is  of  clearly  iri v i v o .  Bremer and  have p r o p o s e d  co-workers  similar  (78,  79)  and  Travers  models whereby s t a b l e RNA  e_t a_l. genes  (58,  are  24  actively  regulated  effector  molecules.  nutritional polymerase  v i a the a c t i o n These  conditions  of p o s i t i v e  effectors  and t h e n i n t e r a c t  f r o m rRNA o p e r o n s .  was ppGpp b e c a u s e concentration  of the i n v e r s e  and rRNA  correlation  synthesis  during  i n the p r e v i o u s s e c t i o n .  presented  evidence that  fractionated  forms  promoters.  efficiently  t h e RNA  by c e n t r i f u g a t i o n  of d i f f e r e n t  One form  at stable  RNA  could  initiate  promoters  Therefore,  these workers  stable of the  ppGpp  rate  genes  control between  was p h e n o t y p i c a l l y affinity reduced  a mutant  RNA  f o r the c o n s t i t u t i v e affinity  a  transcription poorly at  have p r o p o s e d exist  cannot.  that  and  at l e a s t  that  can t r a n s c r i b e  At s a t u r a t i n g  the polymerase  mRNA t o s t a b l e  model i s s u p p o r t e d by t h e f i n d i n g  into  preferencesf o r  the form which  and t h e form w h i c h  prefers  be  s u c h as ppGpp o p e r a t e by  ( o r some o t h e r e f f e c t o r ) ,  form w h i c h  could  had t h e o p p o s i t e  conformations of polymerase  the e q u i l i b r i u m  RNA  form  as  have  gradients  but r e l a t i v e l y  preference.  o f growth  molecule  control,  holoenzyme  had d i f f e r e n t  a second  two d i f f e r e n t  rate of  between i t s  through g l y c e r o l  promoters;  changing  o r RNA  effector  stringent  polymerase  which  sense the  T r a v e r s e_t a_l. ( 8 0 )  constitutive  regulators  w i t h DNA  The f a v o r e d  discussed  various  presumably  o r b o t h so as t o i n d u c e t h e a p p r o p r i a t e  transcription  number  would  or n e g a t i v e  that  RNA  l a c promoter  f o r the rrnX promoter  promoters.  t h e E_;_ c o l i  polymerase  would  levels  be i n  This  altl  mutation  having a higher and c o n c u r r e n t l y , a  in. v i t r o  (81);  i n other  25  words, an  RNA  addition,  Muto  from any  RNA  polymerase (82)  that  several  polymerase. presently direct  by  fold  unclear.  that  the  the  balance  status  so  as  to  of  This  as  was  taken on  forms  operate  and  out  also  rRNA  synthesis  of  iji vivo  e a s y means f o r  a cell  evidence  rRNA  two  i n terms o f r e s p o n d i n g  fine-tune  distinct  stimulate  have p o i n t e d  have an  In  preferentially  between the  Nomura e_t al^. (14)  i t s actions,  ribosome supply  protein factors,  positive effectors truly  nutritional  r e s u l t s of  could  in. v i t r o .  e f f e c t o r model does n o t  assessing  crude  preference.  have a p o s i t i v e e f f e c t  shifting  Whether  a l t e r e d promoter  subunit,  c e r t a i n f a c t o r s could  transcription  the  reported  polymerase  rRNA s y n t h e s i s  with  that  is this  both  monitoring to  as  the  final  conditions  change.  c) proposed  For an  this  which  transcription be  conditions (4). al.  of an  stable  was  genes.  who  showed cell  derived that  did  not  Instead,  because  decreased.  The  autogenous r e g u l a t o r ,  rRNA s y n t h e s i s . unchanged  RNA  i n a manner p r e v i o u s l y  o p e r o n s per  co-workers  free, non-translating  T h i s model was (77)  Nomura and  (14,  77)  a l t e r n a t i v e model c o n s i s t i n g o f a f e e d b a c k  mechanism by  therefore  reason,  In  the  an  sensing  the  by by  i n the  overall from  words, a two  itself  may  environmental Lindahl  total  and  Zengel e_t  number o f  increase  rRNA s y n t h e s i s  in  rate  e a c h i n d i v i d u a l rRNA to  the  Jinks-Robertson  a corresponding  synthesis  other  ribosome  from s t u d i e s  cause  inhibition  ribosomes i n h i b i t  proposed  increase  have  rRNA total was  operon  three-fold increase  in  26  rRNA gene dosage accumulation the g l o b a l  resulted  o f tRNA  rate  importantly,  i n a two t o t h r e e - f o l d  and rRNA  of stable  this  effect  RNA  from  synthesis  was n o t seen  which were i n t r o d u c e d  were d e l e t e d  that  transcripts  full  latter  length  rRNA  case, the t o t a l  chrombsomally increased  encoded  individual  rate  operons  i f the e x t r a  could  rRNA  gene d o s a g e .  product  from  maintenance incomplete  of normal  rRNA  ribosomes, or complete  o f t h e amount a p p r o p r i a t e conditions, of s t a b l e  et  would  rRNA  Based mutants  f o r a given  presumably  apparently  are i n f a c t  surplus,  been  i n a number  was p r e f e r e n t i a l l y  that  some  f o r the Either  free  synthesized  rRNA,  i n excess  inhibit  the t r a n s c r i p t i o n  ribosome a s s e m b l y - d e f e c t i v e  o v e r p r o d u c e rRNA and tRNA,  that  the n e g a t i v e r e g u l a t o r y  non-translating of studies  developed a system  macromolecular  These  set of environmental  feedback  on t h e o b s e r v a t i o n  a l . (14) have p o s t u l a t e d  tested  rates.  ribosomes  this  operons.  o f E_^ c o l i  e t a_l. ( 8 3 )  was r e s p o n s i b l e  transcription  In  genes)  a l l o w e d J i n k s - R o b e r t s o n _e_t a_l. t o c o n c l u d e t h a t rRNA o p e r o n s  such  transcription ( i . e .  results  intact  operons  coding region  p l a s m i d encoded  i n accordance with the i n c r e a s i n g  that  More  n o t be p r o d u c e d .  operon  plus d e f e c t i v e ,  such  was u n c h a n g e d .  i n t h e rRNA  o f rRNA  decrease i n  inhibited  synthesis.  factors  r i b o s o m e s . T h i s model has  by Nomura's g r o u p .  i n which  the assembly  without i n h i b i t i n g  This  Nomura  Takebe  of ribosomes  overall  l e d to a d e f i c i e n c y  i n free  27  ribosomes  and a c o n c u r r e n t  synthesis.  stimulation  o f rRNA  Gourse ^_t a^L. ( 8 4 ; c o n s t r u c t e d  gene e x p r e s s i o n  system  by f u s i n g  and tRNA  a conditional  t h e lambda  P  rRNA  promoter/operator L  t o t h e E_j_ c o l i  rrnB  operon. seen  The r e s u l t a n t  and  f r e e ribosomes  was  and  tRNA s y n t h e s i s  f r o m chromosomal g e n e s .  however, has t h u s f a r been possible  promoters  that  some o t h e r  o f rRNA o p e r o n  control  inhibition with  again  synthesis,  implicate  b u t as p o i n t e d  be p o s s i b l e  that  a  by effector  that the  resulted  ppGpp  o u t by Gourse  on  i t i s i n t e r e s t i n g to note  i n a 2-fold correlated  concentration.  i n the c o n t r o l o f s t a b l e  the i n c r e a s e  test  I t remains  i s the t r u e  transcription also  in cellular ppGpp  (77).  act indirectly  e_t a_l. (84) showed  o f chromosomal rRNA  a 30-50$ i n c r e a s e  would  regard,  o f rRNA  i s , i t has n o t y e t been  i n turn  o f p l a s m i d rRNA w h i c h  repression  e f f e c t of ribosomes  f r e e ribosomes  In t h i s  o f rRNA  A definitive  in_ v i t r o  f a c t o r which  t h e s t u d y o f Gourse  overproduction  the  rRNA  possibility  regulating  that  from  a large  lacking - that  t o show a d i r e c t r e g u l a t o r y  transcription distinct  to produce  overproduction  This  RNA  e_t a_l. (84) i t c o u l d  also  i n ppGpp was t h e r e s u l t r a t h e r  than  cause o f the observed i n h i b i t i o n  o f chromosomal  rRNA  transcription.  Finally, ribosomes rRNA  this  model would  p r e d i c t a d i r e c t e f f e c t of free  ( o r some f a c t o r r e g u l a t e d  promoter  transcription.  region  by f r e e r i b o s o m e s ) on t h e  so as t o r e g u l a t e  Gourse  the o v e r a l l p a t t e r n  e_t a_l. (31) s t u d y i n g  deleted  rRNA  of  28  promoters i n a l a c f u s i o n system found  that  control  the  sequences c r i t i c a l  (between -51  sequences r e q u i r e d seen i f the  o f rRNA  but  an  to  the  overlooked  effects  of  of  the  be  work o f  suggests  level  is truly  points  effects  of  dependent  the  the are  these r e s u l t s ,  case  that  important  must be  rRNA synthesis  remains  not  f a c t o r to  r e l a t e the  Gallant  s u c h an  to  be  and  features.  cellular  important  (63)  intermediary there that  several  are  recognized  found as  i d e n t i f y i n g and  the  and  rRNA  indeed  features at  the  DNA  targets  Therefore  regulation  ppGpp  but  involving  f a c t o r may  are  mechanisms.  their  i n terms o f  The  the  incompatible  ppGpp c o n c e n t r a t i o n  them t o be  regulatory  Firstly,  entirely  e_t §_1.  genes, f e a t u r e s allow  made.  above a r e  u p s h i f t on  that  RNA  growth r a t e  these unique  also  regulation  f r e e ribosome p o o l .  rRNA p r o m o t e r r e g i o n s  could  this  important  temperature  to s t a b l e  sequence  From  have  dependent  inhibition  growth r a t e  Secondly, i t i s c l e a r that  unique  rate  promoter) are  feedback  f o r the  intermediary  largely  exist.  P1  feedback  negative  models d i s c u s s e d  require  synthesis  the  that  Whether  summary, two two  of  f o r growth  previously,  determined.  concentration  for  that  i s responsible  experimentally  latter  -20  discussed  rRNA gene dose i s i n c r e a s e d .  i n E_^ c o l i .  In  and  i n order  t h e y have p r o p o s e d promoters  as  i n other  the  study  organisms  characterizing  29  5.  R i b o s o m a l RNA  While  there  organization, coli,  operons  i s a wealth  structure  comparatively  species.  The  subtilis  has  number o f follows directed  little  the  reasons.  by  and  of  subject  o f most  of m o d i f i e d  the  B.  other  expression secretion to other  genes c o u l d  could of  system  well  facilitate  the  As  (87).  as  in this  operates  area  in this  organisms,  structure  the  of  ribosomal  large  precursor  RNA  RNA  rRNA  genes of  i n the has  order  genes  as  Secondly,  system  has  specific  B_;_ s u b t i l i s  transcriptional units  W h i l e no  of  An  RNA  for  the  protein  Finally,  B_;_ s u b t i l i s  a  mechanisms  efficient  g e n e t i c a l l y (86),  more d e t a i l e d s t u d y  (85).  stable  t o new  organism.  for  pathway  differentiation.  an  other  molecules  a potentially useful  characterized  and  of  E.  organism, i t  promoters  point  cellular  represent  i n E_j_ c o l i ,  organized  of  in  organism B a c i l l u s  polymerase  sets  therefore  and  Gram-positive  Location  RNA  h e t e r o l o g o u s genes s i n c e  relatively  6.  genes  situation in  studies  transcriptional regulation  to d e v e l o p m e n t  subtilis  the  RNA  the  is in effect a primitive differentiation  analysis  related  stable  i t is a sporulating  different, specific  as  of  concerning  endospore-forming  recognizing  well  information  i s known a b o u t  Because  a cascade  of  subtlli3  regulation  Gram-positive, been  what  in Bacillus  in  contrast  been  which  can  genes and  operons.  genes.  B_^ s u b t i l i s 16S,  23S,  been o b s e r v e d ,  are 5S  RNA  precursors  30  to  the i n d i v i d u a l  indicating required Oishi  that  rRNA's  some p o s t - t r a n s c r i p t i o n a l  (88).  Early  and Sueoka  density transfer  (89) and S m i t h  o f t h e DNA  that  replicated  very e a r l y ,  near  specifically  the o r i g i n  replicated second  c o u l d be d e t e c t e d  chromosomal l o c u s .  Chow and D a v i d s o n  that  (91) who after  used  to r e n a t u r e .  T h e i r data suggested  sequences.  More  the d i s t r i b u t i o n radiolabelled B. s u b t i l i s 93,  recently,  RNA,  that  and t h a t  each  La F a u c i e_t a_l. (96) were a b l e t o map  nine  (86).  A cluster  the  allowed copies  homologous  DNA t o examine  have f o u n d operons  plasmids  regions,  bringing  by  s e q u e n c e s homologous t o  these  of these operons,  of a  was  was  blotting  allowing  seven  20$  to study  spacer  as many as 10 rRNA  into  was  t h e r e were 7 t o 10  rDNA s e q u e n c e s o n t o  to i n t e g r a t e  RNA  80$  confirmed  DNA  a number o f a u t h o r s  possesses  By c l o n i n g  was  subtilis  o u t by  clustered  microscopy  by u s i n g S o u t h e r n  o f chromosomal DNA  ribosomal  was  were  about  The r e m a i n i n g  t h e o t h e r s by h e t e r o l o g o u s  probably  94, 9 5 ) .  DNA  clustering  denatured  o f r i b o s o m a l genes on t h e chromosome from  this  electron  formed  separated  that  s u g g e s t i n g the presence  heterduplexes  but  carried  with ribosomal  replication.  This tight  labelling,  p r o c e s s i n g events  e_t a_l. (90) showed  indicating  considerably later,  pulse  experiments  hybridized  o f chromosome  after  the homologous  that  (92,  and  chromosomal the l o c a t i o n  t h e number o f mapped  of  operons to  o f s i x o p e r o n s ( r r n 0, A, G, H, I , E) was o o mapped t o a r e g i o n between 0 and 15 , r r n D l a y between 60 and 75 o and t h e r e m a i n d e r i n a s e c o n d c l u s t e r between 200 and 275 .  31  Thus, the to  rRNA o p e r o n s o f B_j_ s u b t i l l s  a greater  By  extent  analyzing  than seen  cloned  o f homology, S t e w a r t  e_t a_l. (93)  l i n k a g e between d i s t i n c t  than 500  separated  bp.  In  ten  subtilis RNA  of  or  these  as  (92,  distal  largest  known c l u s t e r  to  construct detailed  100  very bp,  that  tight  and  others  to d i v i d e  only  could  be  the  - some were  i n the  by  the  of  Whereas a l l jS^ c o l i i n t e r g e n i c spacer,  less  rRNA  size  the  rRNA  only  two  of  to c o n t a i n i n t e r g e n i c tRNA lie Ala tRNA and tRNA  of  w o r k e r s have r e p o r t e d  the  94). the  located immediately  distal  Green and  for  B_^ s u b t i l i s in  coli  i s unclear, an  organisms.  Void  (97)  sequence of a c l u s t e r  s i g n i f i c a n c e of such  genes i n B a c i l l u s  positive  consisted  l a r g e groups  located  this  be  patterns  o p e r o n s were f o u n d  have r e c e n t l y r e p o r t e d  that  to  tRNA g e n e s between tandem rRNA gene s e t s  determinants  The  regions.  chromosomal  They f o u n d  were a b l e  I n t e r e s t i n g l y , other  clustering  as  tRNA genes i n t h i s  both of  sequences.  little  groups which d i f f e r e d  subtilis  genes and  as  16S-23S s p a c e r  operons c a r r i e d the  by  operons could  were c l u s t e r e d  operons.  were a b l e  operons.  a d d i t i o n , they  o p e r o n s i n t o two intergenic  f o r E_j_ c o l i  rDNA s e q u e n c e s and  p h y s i c a l maps f o r some o f the  apparently  apparently  rrnB  operon;  contains  tight  only  clustering  although  Void  the in  B.  to  the  5S  instance,  o f 21  tRNA  genes  in contrast,  the  7  (98).  tRNA genes  of s t a b l e  ( 9 9 ) has  evolutionary  feature  common t o  It i s clear,  however, t h a t  the  RNA  speculated Gramstable  RNA  32  genes  o f B_j_ 3 u b t i l i s  their in  coli  differ  counterparts.  the e x t r e m e l y t i g h t  relative sets,  7.  location  and  of  sequence been of  been  (103).  t h e B_^ s u b t i l i s  distinct  appeared  DNA  -10  I t was  region  compared  promoter fact  that  also  call  and  showed  operon, a single  tandem o p e r o n  one  rRNA  t h e 5'  on  flanking  100  a plasmid c a l l e d  promoter  was  the  operon  element  has region  a less  between  into  question  the o v e r a l l  i t s role  i n vivo,  especially was  bp.  14B1,  which  of the o t h e r  showed  operons t h e -35  and  t h a n o p t i m a l 18  bp,  f o r the o t h e r rRNA p r o m o t e r s .  arrangement.  subtilis  s e p a r a t e d by a b o u t  the s p a c i n g  i t s chromosomal l o c a t i o n  gene  the presence o f  promoter  promoter  the  t o rRNA  In a d d i t i o n ,  coli,  noted that  o f t h e 14B1  differences  tRNA g e n e s ,  of only  (102).  elements  is reflected  operons.  As w i t h  the second  to 17 bp  sequence  r r n B operon  to possess o n l y  rRNA  of a second  homology t o t h e downstream P2 (103).  this  from  operons.  region  tandem p r o m o t e r  Interestingly,  o f rRNA  determined  of the promoter  determined  o f rRNA and  subtilis  To d a t e , t h e c o m p l e t e has  above,  o f tRNA d e t e r m i n a n t s i n r e l a t i o n  regions  rRNA o p e r o n s  As o u t l i n e d  clustering  i n the gene dose  Promoter  fundamentally i n organization  These  efficiency i n view  of  this  of the  as t h e s e c o n d  set of a  33  Finally,  an i n s p e c t i o n  o f t h e DNA  tandem p r o m o t e r s o f t h e B a c i l l u s the  presence of a stem-loop  promoter a  rrnB  structure  operon  surrounding the  revealed  downstream o f t h e P2  transcription  initiation  site  and t h o u g h t t o be p a r t o f  post-transcriptional  processing  site  (103).  sequence to the  showing  be i n v o l v e d area  homology t o t h e d i s c r i m i n a t o r  i n the s t r i n g e n t  o f t h e +1  site  response i n  o f t h e B_^ s u b t i l i s  a l t h o u g h n o t f o r t h e P2 p r o m o t e r . upstream  o f t h e P1 p r o m o t e r  previously  8.  for  Regulation  in  i n general, B_j_ s u b t i l i s .  of stable  the  A direct  required  promoter,  rRNA o p e r o n s  synthesis  was  i n B_^ s u b t i l i s .  the s y n t h e s i s  o f rRNA o p e r o n s  of the a b i l i t y  As has been  of d i f f e r e n t  involves  be an  o f B_^ s u b t i l i s  factors  Sigma f a c t o r s  f o r the s p e c i f i c  the d i f f e r e n t i a l i s dependent  associated  i n general  recognition  to  i n the  shown by numerous a u t h o r s ,  whose t r a n s c r i p t i o n sigma  of stable  in particular,  d e v e l o p m e n t a l pathway c u l m i n a t i n g  a s u b s e t o f genes  (85).  was s e e n i n  P1  a n a l o g y t o E_;_ c o l i may  because  of endospores.  polymerase  coli  thought  F u r t h e r m o r e , the sequence  i s known a b o u t  process of sporulation  presence  sequence  rich  (37 o u t o f 44 b p ) , as n o t e d  and t h e r e g u l a t i o n  an a l t e r n a t e  formation  RNA  little  oversimplification follow  a G-C  c o l i rRNA o p e r o n s ( 4 ) .  Comparatively RNA  AI30,  rrnB  i n a l l B_;_ s u b t i l i s  s e e n t o be e x t r e m e l y A-T r i c h  of  sequences  have  expression on t h e  with the core been  of promoter  shown  sites  RNA  t o be  on DNA  by  34  RNA  polymerase  initiation  of  (105),  and  as  such are  transcription.  The  key  components  promoters  in  for stable  the RNA  have been shown t o have s e q u e n c e s p o t e n t i a l l y r e c o g n i z e d major sigma-43 c o n t a i n i n g (106). all  Since  stages  that  differential  tested  stable  and  RNA  regulation  sigma f a c t o r s  not  in fact  This  has  present  not  at  been  subject by  the  cells  g r o w t h , i t has  t r a n s c r i p t i o n caused  (99).  the  availability  transcriptional  studies  used  techniques  S1  mapping  promoters f u n c t i o n e d upstream  P1  although  the  mapping  relative  cloned  to  variations  been  in  experimentally  the  and  the  shown t h a t subtilis  fact  that  functional  be  isoaccepting  similarities  between  rrnB  evidence  that  S i m i l a r l y , Void  was  and  the  species, two  of  the  few  (103)  the pair,  were p o t e n t i a l l y Green  (107)  used  from a c l u s t e r  t h e s e g e n e s i n t o E_j_ c o l i .  a heterologous  transcribed  these  of  Bott  the  t r a n s c r i p t i o n products  this  and  l e s s a c t i v e promoter  mature tRNA's h a v i n g  tRNA's c o u l d  that  hybridization efficiencies  the  tRNA g e n e s ,  Stewart  provided  tRNA genes a f t e r i n t r o d u c t i o n  Despite  rRNA and  to d e m o n s t r a t e  i n vivo  f a c t o r s here.  to a n a l y z e  of  have been done.  p r o m o t e r was  complicating  o f 21  vegetative  i s known t o be  vegetative  genes a r e  of  of  by  however.  Despite  S1  polymerase  form of polymerase  of s p o r u l a t i o n  speculated  available  this  RNA  genes  primary and  thereby  organisms  system,  sequence  processed  of  into  emphasizing in this  it  the  regard.  was B.  35  However, s t u d i e s activity in  attempting  to r e l a t e t h e t r a n s c r i p t i o n a l  of  B_^ s u b t i l i s  stable  cellular  growth r a t e  have not  As  f a r as  the  For  similar there B'  have s u g g e s t e d  example,  the  RNA  in subunit  were s l i g h t  subunits  and,  sigma s u b u n i t s quantitating calculated subtilis roughly  that  cell the  structure  the  with  same e x t e n t  RNA  that  polymerase at  a l l growth r a t e s ,  seen i n  coli.  reflection  of  I t was  the  in Bacillus.  total  RNA  logarithmic rate  content  manner as  dependent  was  related  to  Finally, of  be  the  B  and  By e_t a_l. per  and  excess  of  t h i s could  be  these RNA  although greater  B.  to  Furthermore, an  (109)  the  than  that  a  in transcriptional control  the  presence  i t was  multiple  increased  increased. RNA  of  sigma  shown i n t h i s s t u d y  Bacillus cells  in total  coli.  although  molecules  E_^ c o l i ,  that  to  of  Leduc  significantly  growth r a t e  increase  did  suggested  found  growth r a t e  had  i n E_j_  (108).  cell,  polymerase  as  seen  of  number o f d i f f e r e n t  i n E_^ c o l i .  certain differences  mechanisms, p o s s i b l y factors  per  a number  polymerase  polymerase  B a c i l l u s apparently  lower growth r a t e s  that  RNA  increasing  seen  Bacillus  relative sizes  B subunit  with as  coli  the  variations  i s concerned,  above, i n t h e  number o f  increased  the  B a c i l l u s was  i n the  mentioned  amount o f  of  to  differences as  of  s i m i l a r to  polymerase  to  done.  machinery  authors noted  excess at  been  a pattern  associated  the  gene p r o m o t e r s  overall regulation  transciptional-translational studies  RNA  was  due  That  in  that  a  the  growth  predominantly  to  36  ribosomal measured  RNA the  A g a i n , as  followed  supporting similar the ed  the  that  that  two  B_^ s u b t i l l s RNA  polymerase  be  starvation of  (see  163  Ref.  acid  the It the  that  yet  no  must be  genes  or  origin  of  t o be  coli,  how  regulation  (110). this  rRNA  through  How  was  rRNA in  response, was measuring  cells  suggest-  RNA-  polymerase  dependent  B.  nucleotide  (162)  and  the  nucleotide  subtilis  used  such  related  for  a to  c o n t r o l of  has  ppGpp under  stimulus may  the  stable  been shown  conditions  required  be  the  same as  Despite  the  fact  t o s h u t down s t a b l e  RNA  that  that  of  amino  in  vivo  in  coli  relaxed  mutants  during  amino  have been i s o l a t e d i n B_^ s u b t i l i s  (163),  there  response  i n d i c a t i o n that  the  mechanistic  i s s i m i l a r i n B_j_ s u b t i l i l s  however, t h a t  t r a n s c r i p t i o n of involved  RNA  f o r the  to  synthesis  c l e a r cut  noted  the  who  unclear.  for review).  fail  stringent  thought  RNA  of  dependent  obtained  from  (110)  a cloned  synthesis  a stable, ribosomal  distinct  with  this  starvation)  as  Data  to  i n phage S P O 1 - i n f e c t e d  regulated  modified  synthesis  is  as  the  growth r a t e  mechanism f o r g r o w t h r a t e  the  Spiegelman  o v e r a l l growth r a t e  of n o n - s t a b l e  could  Finally,  (those  E_j_ c o l i ,  possessed  genes i n B a c i l l u s was  acid  Webb and  organisms.  polymerase  transcription  produce  with  o f rRNA s y n t h e s i s  specific  overall  shown by  a classical  idea  i n these  rate  later  h y b r i d i z a t i o n o f r a d i o l a b e l l e d RNA  gene p r o b e . Bacillus  was  the  GC  rich  and  sequences  d e t a i l s of coli. located  s t r i n g e n t l y c o n t r o l l e d genes  i n mediating  the  s t r i n g e n t response  at and (64),  37  are  homologous to  initiation promoter bearing  site  (see on  the  sequences  of  the  sequence  found  around  subtilis i n Ref.  rrnB  103).  stringent  regulation  for present  studies.  the P1  transcription  (but  Whether of  not  the  P2)  t h i s has  t h i s operon  any  remains  to  be  determined.  9.  Rationale  From the sense  the  subtilis  preceding  regulation  may  characterized necessary  provide proposed  an  Such an or  i n two  independent  to e x p l a i n  yielded  the  t e s t of  We  to genes whose e x p r e s s i o n quantitatively  monitored.  approach i s a v a l i d of  would  can As  means o f  of  possible  stable  models  follow the  an  RNA  will  be  assessing  to  possibly  currently rate  approach  easily  discussed  such  synthesis  expression  be  and  of  point  of  B a c i l l u s rRNA p r o m o t e r  subsequently  B.  and  regulation  mechanisms o f g r o w t h to  and  isolated  hopefully  the  broad  subtle  o r g a n i s m s and  concerning of  the  i n how  have c h o s e n  fusion  of  some o f  general  that  i t i s now  analysis  in a  coli  i s evidence  divergent  that  i n both  availability  differences  much i n f o r m a t i o n  rRNA g e n e s ; namely the  activity  the  analysis  widely  dependent r e g u l a t i o n . has  With  a detailed  similarities  controlled  there  B a c i l l u s rRNA o p e r o n s  to b e g i n  i t is clear  rRNA s y n t h e s i s  exist.  o p e r o n s jin v i v o •  is  of  i s s i m i l a r although  differences  further  discussion,  that coli  regions  and  below, s u c h  an  the t r a n s c r i p t i o n a l  i s o l a t e d p r o m o t e r s under a v a r i e t y o f  environmental  38  conditions carried the an  provided  out.  Our  coli  and  provide  an  indication the as  necessary  of to  monitor  the  of  well  as  were to  rRNA o p e r o n ,  are isolate  fuse  i t s expression  growth r a t e .  it in  to E.  The  B a c i l l u s rRNA genes i n E^_ c o l i evolutionary  divergence  transcription-translation  of growth r a t e  expression  of  of  experiments  therefore,  a B_;_ s u b t i l i s  a function  i f possible,  procaryotes  exist  as  control  objectives  s t r u c t u r a l gene and  component o f  details  from  B_^ s u b t i l i s  expression,  appropriate  primary  promoter r e g i o n assayable  the  provide  insights  dependent  system  into  control.  the  of  may  this  among mechanistic  Similarly,  the  t h e s e genes i n a homologous B a c i l l u s b a c k g r o u n d ascertain  whether s u b t l e  between t h i s o r g a n i s m  and  E_^  regulatory  coli.  differences  is  39  Materials  1.  and Methods  Bacterial strains  Strains other  than  Plasmids  2.  of b a c t e r i a  plasmlds  used  those constructed  constructed  described  and  i n the  throughout  here a r e l i s t e d  during  the course  coli  Plasmid  i n Table  o f t h i s work  plasmids  1.  will  be  Results.  DNA  plasmid was  DNA  - large  density  prepared  by t h e method o f C l e w e l l  Dobinson  lysates  was  108,000  with  gradient  x g.  a syringe  1 mM  determined  (112).  The s u p e r c o i l e d and 18G n e e d l e , overnight  EDTA, 10 mM by m e a s u r i n g  NaCl.  plasmid  against  lysis  IS^ c o l i  For  the r a p i d  plasmid  analysis  with  =50  f o r 36-40 h r . removed  H 0-saturated 2  n-  TRIS-C1  of plasmid  (pH DNA  ug/ml o f DNA).  260  - small  scale.  of recombinant  " m i n i p r e p " p r o c e d u r e was used  described  cleared  band was  The c o n c e n t r a t i o n  DNA  of  T i rotor DNA  lysates  (111) as  4 1 o f 10 mM  (1 A  cesium-  of cleared  70.1  extracted  the A  by  Centrifugation  260 ii)  HB101  and H e l i n s k i  o u t i n a Beckman  b u t a n o l and d i a l y z e d 7.5),  centrifugation  and S p i e g e l m a n carried  scale  i s o l a t e d from E_;_ c o l l  chloride  at  and  P u r i f i c a t i o n o f DNA i)  by  this thesis  clones,  which r o u t i n e l y  an a l k a l i n e yielded  2-3  was  Table 1  B a c t e r i a l S t r a i n s , Plasmids, Phage  Bacterial Strain  Genotype  Source  E . c o l i HB101  F pro l e u t h i lacY endA rps_L20 recA a r a i A galK2 xy!5 mcll supE44 hsdR hsdM  T.Beatty  E . c o l i C110  F~ str31 tsx33 sup37 supE44 proA2.his4 argE3 galK2 aral4 xy!5 m t l l t h r l leuC t h i l lacY  R.E.W.Hancock  E . c o l i JM101  supE t h i l A ( l a c proA,B)/F' traD36 proA,B lacI^Z M15  R.Miller  B . s u b t i l i s 168 Marburg  trpC2 thr5  C.Price  Plasmlds and Phage  Properties  PBR322  Ap , Tc  PBR328  Ap'  pKM-1  A p \ galK . r Ap , c a r r i e s E . c o l i rrnB T1,T2  PKK9-4  Tc  Cm  Host E.coli  R . M i l l e r , 144  E.coli  T.Warren, 121  E.coli  M.Rosenberg, 129  E.coli  J.Brosius, 131  pKKlO-2  Ap , c a r r i e s E.coli E . c o l i rrnB promoters  PKK232-8  Ap'  PGS227  r  Cm'  Source/Reference  J.Brosius,132  E.coli  J.Brosius, 131  Ap , c a r r i e s B . s u b t i l i s rrnB promoters  E.coli  K.Bott, 103  pTV-8  Cm , c a r r i e s Tn917  B.subtilis  P.Youngman, 153  PC194  Cm  B.subtilis  B a c i l l u s Genetic Stock Center  pBD9  Em , Km  B.subtilis  B a c i l l u s Genetic Stock Center  pWWO(TOL)  encodes toluene degradative enzymes  P.putida  G. Hegeman, 145  029  B . s u b t i l i s phage  B.subtilis  H. Whiteley, 161  M13mpl8  M13 cloning vector  E.coli  R . M i l l e r , 122  lambda i l v 5  lambda phage carrying E . c o l i rRNA operon  E.coli  P.Dennis, 137  r  41  ug  of plasmid  of  Maniatis  DNA  pure  enough f o r most p u r p o s e s .  ejb a_l. (113) was  modifications.  The c e l l s  followed  from  2.0  except  The  f o r minor  ml o f a s a t u r a t e d  overnight  culture  were l y s e d , p h e n o l e x t r a c t e d , and t h e p l a s m i d  ethanol  precipitated  as d e s c r i b e d  was d r i e d u n d e r vacuum,  then  procedure  (113).  resuspended  DNA  was  The p r e c i p i t a t e d i n 100 u l o f  pellet  sterile  HO. 5 u l o f D N a s e - f r e e p a n c r e a t i c RNase was t h e n added and t h e 2 o s o l u t i o n i n c u b a t e d a t 37 C f o r 15 m i n . Next, 31 u l o f 7.5 M ammonium a c e t a t e tubes p l a c e d precipitate. in  and 300 u l o f i s o p r o p a n o l  on i c e f o r 15 m i n . t o a l l o w The t u b e s were t h e n  spun  an E p p e n d o r f c e n t r i f u g e , t h e p e l l e t  required  volume o f s t e r i l e  were added  the plasmid  and t h e DNA  to  f o r 10 min. a t f u l l was  resuspended  H 0 (not exceeding 2  speed  i n the  50 u l ) and u s e d  as  needed.  iii)  B_j_ 3 u b t i l i s  Plasmids chloride lysed by  using  (114).  Overnight  aeration  antibiotics.  for 6 hr., after  the plasmid  DNA  ultracentrifugation  were p u r i f i e d  by  cesium-  the c e l l s  s u l f a t e / N a C l procedure  the c e l l s  for density  were  p l u s the o  C u l t u r e s were grown a t 37 which  were  as d e s c r i b e d  c u l t u r e s o f B_j_ s u b t i l i s  volumes o f L u r i a b r o t h  prepared (114).  DNA  centrifugation after  a sodium d o d e c y l  to i n o c u l a t e 1 l i t r e  appropriate  and  B_j_ s u b t i l i s  density gradient  Gryczan  used  from  plasmid  c  with  were h a r v e s t e d ,  lysed,  gradient  C e n t r i f u g a t i o n was  a t 108,000  x g  42  for  3 6 h r . i n a Beckman 70 T i r o t o r .  plasmid  DNA were removed and t r e a t e d  plasmid  DNA  purification.  iv)  B_^ s u b t i l i s  B. s u b t i l i s  Bands c o r r e s p o n d i n g as d e s c r i b e d  to  f o r E_^ c o l i  chromosomal DNA.  168 was grown i n 1 1 o f L u r i a b r o t h  f o r 8 hr.  o at  3 7 C.  and  Cells  were h a r v e s t e d ,  t h e chromosomal DNA s p o o l e d  R o d r i g u e z e_t a_l. ( 1 1 5 ) . buffer  (10 mM  concentration  v)  converted  to p r o t o p l a s t s , l y s e d ,  o u t as d e s c r i b e d by  Chromosomal DNA was r e s u s p e n d e d  TRIS-C1, pH 8.0; 1 mM EDTA) t o a  i n TE  final  o f 1 mg/ml.  Pseudomonas  Pseudomonas  putida  TOL  plasmid.  p u t i d a mt-2 c a r r y i n g pWWO (TOL) was grown o  with  a e r a t i o n a t 30 C f o r 12 h r . i n 1 1 o f L u r i a b r o t h .  were h a r v e s t e d deoxycholic Gunsalus cesium  acid/polyethylene  (11b).  glycol  lysed using  the S a r k o s y l -  method o f J o h n s t o n and  DNA was f r a c t i o n a t e d by e q u i l i b r i u m b a n d i n g i n  chloride-ethidium  described syringe  and 3 g a l i q u o t s were  Cells  (116).  b r o m i d e d e n s i t y g r a d i e n t s as  Supercoiled  and 18G n e e d l e ,  plasmid  extracted,  DNA was removed w i t h  a  and d i a l y z e d as d e s c r i b e d  above.  3.  Transformation  E.  coli  o f E_;_ c o l i  and s e l e c t i o n o f r e c o m b i n a n t s .  HB101 was made c o m p e t e n t f o r t r a n s f o r m a t i o n  by  43  the C a C l  method as d e s c r i b e d by M a n i a t i s e_t a l _ . (113) b u t w i t h 2 the f o l l o w i n g m o d i f i c a t i o n s . A s i n g l e c o l o n y was used t o inoculate  1.0 ml o f L u r i a  stationary Luria  T h i s was  b r o t h and grown  culture in  culture.  b r o t h and grown o v e r n i g h t as a then  diluted  t o 100 ml w i t h  fresh  t o an A  were h a r v e s t e d  o f 0.5. T w e n t y - f i v e ml o f t h i s 550 by c e n t r i f u g a t i o n a t 4000 x g f o r 5 m i n .  a S o r v a l SS-34 r o t o r .  The c e l l  pellet  was  resuspended  i n 12  ml o f c o l d  C a C l -TRIS-C1 s o l u t i o n (113) and i n c u b a t e d on i c e f o r 2 The c e l l s were a g a i n p e l l e t e d as above and g e n t l y  15 min.  resuspended  i n 1.5 ml o f c o l d  0.2 ml o f c e l l s tubes  and l e f t  competent purified  were p i p e t t e d on i c e f o r 6-18  cells  was  plasmid  Finally,  cells  DNA  carried  hrs.  Transformation  o u t by a d d i t i o n  of these  o f 0.1-0.5 ug o f  m i x t u r e , i n c u b a t i o n of the o on i c e f o r 30 min., f o l l o w e d by a 42 C h e a t shock f o r 2.5  cells min.  C a C l -TRIS-C1 s o l u t i o n . Finally, 2 i n t o s t e r i l e 1.8 ml E p p e n d o r f  or a l i g a t i o n  1.0 ml o f L u r i a  and t h e y were a l l o w e d  b r o t h was  added  to the transformed o  t o grow f o r 1 h r . a t 37 C b e f o r e  plating.  Transformed plates  supplemented  ampicillin  cells with  (0.1 ml) were p l a t e d  the a p p r o p r i a t e a n t i b i o t i c s  f o r pBR322 d e r i v a t i v e s ) and a l l o w e d  o at  then  agar  (50 ug/ml  t o grow o v e r n i g h t +  30 C.  formed  on L u r i a  When s e l e c t i o n  cells  sprayed  was  were p l a t e d , with  a 0.5  based  allowed  on t h e x y l E t o grow i n t o  M aqueous s o l u t i o n  phenotype,  trans-  c o l o n i e s (1-2  of c a t e c h o l using  mm.)  44  an a e r o s o l color  sprayer.  within  15  XylE  sec. of s p r a y i n g .  p i c k e d , grown i n 2.0 and  ml  turned a b r i g h t Single  recombinant  c l o n e s were  the a l k a l i n e  lysis  broth  method  above.  T r a n s f o r m a t i o n o f B.  B.  subtilis  168  subtilis.  was  made competent  a modification  o f t h e method  communication).  A loopful  fresh  yellow  of a n t i b i o t i c - s u p p l e m e n t e d L u r i a  a n a l y z e d f o r p l a s m i d c o n t e n t by  described  4.  colonies  TBAB a g a r  plate  o f Dubnau  and  (117,  o f B_^ s u b t i l i s  transformed using  C.  Price, personal  cells  (1$ B a c t o - T r y p t o n e ,  0.3$  was  spread  Beef  onto  Extract,  a  0.5$  N a C l , 0.5$ g l u c o s e , 1.5$ a g a r , pH 7.2) and grown o v e r n i g h t a t o 30 C. Three or f o u r c o l o n i e s from t h i s p l a t e were used t o inoculate  10 ml  o f pre-warmed  C-1  media  (0.6$  KH  PO , 2 4 glucose,  1.4$  K HP0 , 0.1$ Na C H 0 , 0.2$ (NH ) SO , 0.5$ 0.13$ 2 4 3 6 5 7 4 2 4 MgSO , 0.02$ Casamino a c i d s , 50 ug/ml t r y p t o p h a n ) i n a 125 ml 4 side-arm f l a s k . T h i s gave a s t a r t i n g o p t i c a l d e n s i t y o f a b o u t Klett  units  filter). and  (Klett-Summerson  The  was  growth f o l l o w e d by  time a t which growth was for  flask  exactly  cells  was  pelleted  and  taking  into  vigorously Klett  started  the f l a s k  1 h r . beyond  pipetted by  shaken  the c u l t u r e  noted  spectrophotometer,  this  was  centrifugation  at f u l l  37  green C water  r e a d i n g s e v e r y 30  to d e v i a t e from allowed  point.  a sterile  in a  #54 o  1.8  speed  The  logarithmic  to c o n t i n u e s h a k i n g  At t h i s ml  min.  bath  time,  Eppendorf  0.5  ml  of  tube,  f o r 2 min.,  and  then  5  45  resuspended that  i n 1.0  o f prewarmed  Casamino a c i d s were 0.01}  tenth  o f a ml  tubes,  transformation  cells. cells  cells then  by  cells by  plasmid  adding  shaken a t 37 g e n e s , 400  and  (as C-1,  tryptophan  were m a x i m a l l y  incubated  p l a t e d on  DNA,  1 u l of  A f t e r t h i s , 0.5 o  plasmid  media  was  except  5 ug/ml).  One-  were t r a n s f e r r e d to 13 x 100 mm. test o a t u b e r o l l e r a t 37 C, and shaken f o r 40 min.  on  the  enhanced  and  C-2  of c e l l s  placed  which time  was  ml  - 1.0  competent.  the  efficiency  of  100  mM  the  ug  C f o r another  EGTA to  of plasmid 30  min.  u l of L u r i a broth f o r 1 hr.  For  The  was  DNA  To  subsequent  transformation competent  was  allow  added  at  added  expression  to the  transformation  and  of  transformed  mixture  f r e s h TBAB a g a r p l a t e s c o n t a i n i n g the  the  was  required o  antibiotics  a t 5 ug/ml f i n a l  concentration  and  incubated  a t 37  C  overnight. 5.  Cloning  procedures.  The  recombinant  as d e s c r i b e d noted  by  Maniatis  DNA  techniques  e_t a_l. ( 1 1 3 ) .  used  h e r e were  Minor  essentially  variations will  be  here.  i)  Restriction  Restriction Biolabs  or P.L.  endonuclease  d i g e s t i o n of  e n d o n u c l e a s e s were o b t a i n e d  Biochemicals  and  were used  with  DNA.  from the  New  England  appropriate  46  buffers  as recommended  purified per  DNA,  generally  ug o f DNA  F o r DNA found  were n e c e s s a r y  to g i v e  and  ii)  was  t h a t more  enzyme  complete  extended  Blunting  DNA  ends were made f l u s h  miniprep  incubation  Therefore,  were used  p e r ug o f DNA  extended  ends.  (1-2 ug) w h i c h had 5*  extended  volume o f 30 u l . added, f o l l o w e d  O n e - t e n t h volume o f by 2 u n i t s o f t h e  DNA  The  f o r 20 m i n . a t room t e m p e r a t u r e , o  incubated  w h i c h t h e Klenow enzyme  was  polymerase  (2 mM  Klenow f r a g m e n t o f E_;_ c o l i r e a c t i o n was  times  i n these  by the a d d i t i o n o f 2 u l o f each dNTP  (113) was  used  t o 2.5-3.0 h r .  fragments  solution) i n a final  10X Klenow b u f f e r  enzyme  were  appropriate  and l o n g e r  digestion.  o f 5* and 3'  restriction  hr at the  gradient  enzyme  by t h e a l k a l i n e l y s i s  10-15 u n i t s o f r e s t r i c t i o n  incubation  stock  f o r 1.5  prepared  method, i t was  For density  5 units of r e s t r i c t i o n  and i n c u b a t e d  temperature.  cases,  by t h e s u p p l i e r .  (New  England  i n a c t i v a t e d by h e a t i n g  Blolabs). after  t o 65 C f o r 15  min.  Fragments  (1-2 ug) w i t h  by  a d d i t i o n o f T4 DNA  as  described  iii) In  by M a n i a t i s  e_t a_l.  Dephosphorylation  ligation  self-ligation  polymerase  reactions  be m i n i m i z e d ,  3'  extended  ends were made  and t h e a p p r o p r i a t e  dNTP  flush exactly  (113).  of  DNA.  where i t was  the t e r m i n a l  desired  that  vector  5' p h o s p h a t e s o f t h e  47  vector  m o l e c u l e s were removed w i t h c a l f  phosphatase.  G e n e r a l l y , 22 u n i t s  o f v e c t o r DNA. phosphatase  iv)  Ligation  Ligations  alkaline  were used  and i n a c t i v a t i o n  p e r ug  of  by M a n i a t i s e_t a l ^ . ( 1 1 3 ) .  conditions  were c a r r i e d  i n s e r t ) o f 0.5-0.7 ug o f DNA v e c t o r was  o f phosphatase  Reaction conditions  were as d e s c r i b e d  intestinal  o u t on a t o t a l  where  a p p r o x i m a t e l y 1:1.  the molar  The DNA  was  (vector ratio  plus  of insert  resuspended  to  i n 13 u l  of s t e r i l e added  H 0, t o w h i c h 1.5 u l o f 10x l i g a t i o n b u f f e r were 2 (1x was 50 mM TRIS-C1, pH 7.8; 10 mM MgCl ; 15 mM 2  dithiothreitol;  1 mM  serum a l b u m i n ) .  s p e r m i d i n e ; 0.5 mM  To t h i s ,  four  units  ATP; 50 ug/ml  o f T4 DNA  England  B i o l a b s ) were added and t h e r e a c t i o n s o o v e r n i g h t o r 16-18 C f o r 6 h r s . v)  Exonuclease  All  reactions  50 u l .  Nuclease  Bal-31  by t h e m a n u f a c t u r e r .  of cold  which  precipitated  with  1/10  B i o l a b s ) was u s e d  under  the b u f f e r  I n c u b a t i o n time  the r e a c t i o n s  EGTA t o a f i n a l  Samples were t h e n d i l u t e d  o i n c u b a t e d a t 12 C  conditions. o o u t a t 30 C i n a t o t a l  England  p l a s m i d DNA  s e c . and 3 min. a f t e r addition  (New  (New  reaction  were c a r r i e d  p e r ug o f l i n e a r i z e d specified  Bal-31  ligase  bovine  varied  c o n c e n t r a t i o n o f 0.02  volume o f 3 M sodium  at 1 unit  conditions  were s t o p p e d  3 times with s t e r i l e  volume o f  between 30 by t h e M.  H 0 and 2 a c e t a t e (pH 5.0) and  48  2 volumes o f 95$ e t h a n o l . exonuclease  and f u r t h e r  in  the R e s u l t s .  6.  Analytical i)  Specific  applications  characterization  o f DNA  o f Bal-31 will  be d i s c u s s e d  and p r e p a r a t i v e g e l e l e c t r o p h o r e s i s .  Agarose  Supercoiled  gels. or r e s t r i c t i o n  endonuclease  t r e a t e d plasmid  0.7$ or  was a n a l y z e d  on a g a r o s e  1.0$ a g a r o s e  ( B i o - R a d ) i n TBE b u f f e r (0.089 M TRIS Base;  M boric  acid;  0.001$.  in  0.002 M EDTA), w i t h  i n sample r u n n i n g  cyanole  bottom o f t h e g e l transilluminator  b r o m i d e added t o  DNA  Type 667  was v i s u a l i z e d  with  with  DNA  polyacrylamide  0.25$  by p l a c i n g  Products,  Inc.).  t r a n s m i t t e d UV l i g h t  a Vivitar  VMC  When d e s i r e d , u s i n g a Kodak  orange f i l t e r  and  gels  restriction  gels  acrylamide,  prepared  acrylamide:  0.8$  p a t t e r n s were a n a l y z e d  (180 x 140 x 1.5 mm.)  N,N,  using a stock  of either  solution  the  t h e g e l on a UV  film.  Polyacrylamide  Plasmid  with  t h e b r o m o p h e n o l b l u e dye r e a c h e d  (Ultra-Violet  camera e q u i p p e d  ii)  loaded  dye (2x TBE, 50$ g l y c e r o l ,  until  g e l s were p h o t o g r a p h e d  Polaroid  0.089  F F , 0.25$ b r o m o p h e n o l b l u e ) , and e l e c t r o p h o r e s e d  TBE b u f f e r a t 60 mA  MP-4  ethidium  of either  G e l s were c a s t on 5.0x7.5 cm. g l a s s s l i d e s ,  DNA mixed xylene  "minigels" consisting  DNA  on n a t i v e 4$ o r 8$  of acylamide  (30%  - m e t h y l e n e b i s a c r y l a m i d e ) i n TBE b u f f e r ,  49  0.05$  (w/v)  N,N,N  ,N - t e t r a m e t h y l e t h y l i n e d i a m i n e .  sample  running  stained a UV  ammonium p e r s u l f a t e ,  i n 0.1$  (as above) was  ethidium  polymerized DNA  with  0.1$  (w/v)  i n bromophenol  e l e c t r o p h o r e s e d a t 130  b r o m i d e f o r 15 min. b e f o r e  blue volts,  viewing  with  x 0.35  mm.  then  transilluminator.  DNA glass  sequencing  g e l s were c a s t between  p l a t e s as d e s c r i b e d above  solution  was  urea  added  was  contained EDTA. mM  dye  and  43.5$ a c r y l a m i d e :  0.05  Samples  to 7 M f i n a l M TRIS  were mixed  by b o i l i n g  1.5$  with  x 360  t h a t the stock 1  N,N  acrylamide  -methylene b i s a c r y l a m i d e ,  c o n c e n t r a t i o n , and  b a s e , 0.05  EDTA, 0.05$ x y l e n e  denatured  except  200  M boric  acid,  the TBE b u f f e r and 0.001  M  l o a d i n g b u f f e r (40$ f o r m a m i d e ,  25  c y a n o l F F , 0.05$ b r o m o p h e n o l b l u e ) , f o r 2 min.,  and  electrophoresed at  1200  volts.  Protein sulfate buffer or  samples were e l e c t r o p h o r e s e d on sodium  (SDS) - p o l y a c r y l a m i d e s y s t e m o f Laemmli  gel.  TRIS-C1,  pH 6.8;  Samples  0.25$ bromophenol at  (118).  e x p o n e n t i a l g r a d i e n t s from  stacking  acetic  Blue  acid  R,  Gels  12$  were mixed  2$ SDS;  0.2$  were e i t h e r  t o 20$ with  t h e c o n d i t i o n s and 18$  acrylamide  SDS  f o r 3 min.,  then  and 25$  de-stained with  ethanol  for 6 hr.  with  a 3$  a solution  glycerol;  electrophoresed  G e l s were s t a i n e d o v e r n i g h t w i t h then  acrylamide  l o a d i n g b u f f e r (0.005 M  B - m e r c a p t o e t h a n o l ; 20$  blue), boiled  100-120 v o l t s .  Brilliant  gels using  dodecyl  Coomassie  o f 25$  glacial  50  7.  Isolation i)  agarose  For  DNA  elution gel  1/10  used  in front  filled  i t while  source.  The  o f the  with  pelleted  than  TBE  b u f f e r and  following i t s progress recovered  DNA  was  resuspended  trough  the with  The  (pH  in a small  the  a  cut  DNA  the  and  band.  volume o f  the  The  light  a d d i t i o n of  the  was H  DV  2 volumes o f  min.  pellet  of  electrophoresed  by  5.0)  trough out  a hand-held  C f o r 30 DNA  was  DNA  precipitated  acetate o  centrifugation.  vacuum and  500-600 bp,  l e a d i n g edge o f  A f t e r i n c u b a t i o n a t -70 by  about  whereby a s m a l l  volumes o f 3 M sodium  ethanol.  from g e l s ,  minlgels  method was  was  fragments  fragments g r e a t e r  directly  trough into  o f DNA  DNA  95%  was  d r i e d under 0.  2 ii)  polyacrylamide  DNA  fragments  from p o l y a c r y l a m i d e scalpel  and  chopping  gels.  smaller  g e l s by the  gel slice  with  ammonium a c e t a t e ;  EDTA pH  bath  overnight.  small plug  The  of cotton  subsequently precipitation  about  e x c i s i n g the  f r a g m e n t s were c o v e r e d 1 mM  than  0.5  b u f f e r was  ml  into of  8.0) then  500  bp  appropriate fine  buffer  (0.5 o  i n a 65  and  from  as d e s c r i b e d  the  supernatant  above.  b u f f e r by  a  gel M  C water  passed  t o remove s m a l l g e l f r a g m e n t s .  recovered  band w i t h The  placed  removed  isolated  pieces.  elution  and  were  The  through DNA  ethanol  was  a  51  8.  Nucleic  The sequenced  acid  endpoints  [  except  that  and  deletions  with  o f DNA.  Products  (119). 32 [ P]dATP  u s i n g t h e Klenow s u b u n i t o f E_^ c o l i  Reaction conditions  were p e r f o r m e d  were  o f Maxam and G i l b e r t  were as d e s c r i b e d  10 u C l o r t h e a p p r o p r i a t e l a b e l l e d  Gilbert.  through  9.  I.  per microgram  reactions  generated  o r BamHI end was r a d i o l a b e l l e d  P]dGTP r e s p e c t i v e l y ,  DNA p o l y m e r a s e  used  o f Bal-31  by t h e c h e m i c a l method  E i t h e r an EcoRI 32 or  sequencing.  Chemical  under  nucleotide  modification  the c o n d i t i o n s  of the r e a c t i o n s  earlier were  and c l e a v a g e  described  by Maxam  were e l e c t r o p h o r e s e d  12$ o r 20$ p o l y a c r y l a m i d e - u r e a g e l s  as d e s c r i b e d  above.  DNA were p l a c e d on g l a s s  plates  Autoradiography.  Gels with r a d i o l a b e l l e d wrapped w i t h S a r a n Hi L i t e  X-ray  Wrap, t h e n o v e r l a i d  film.  the a p p r o p r i a t e t i m e manufacturer's gels, placed  G e l s were k e p t o f exposure  instructions.  an i n t e n s i f y i n g  on t o p o f t h e X - r a y  DNA s e q u e n c i n g paper  screen  u s i n g a Bio-Rad  gels  w i t h a s h e e t o f 3M o i n the dark a t 4 C f o r  then developed  To r e d u c e (Dupont  film  exposure  Cronex  and e x p o s e d  were d r i e d  Slab Gel Drier  onto  prior  according to the time  f o r some  L i g h t n i n g - P l u s ) was o a t -70 C.  Whatman 3 MM  filter  to autoradiography.  52  P r o t e i n g e l s were f i r s t soaking  t h e g e l i n an a u t o r a d i o g r a p h y  according then  subjected  to the m a n u f a c t u r e r ' s  d r i e d onto f i l t e r  paper  to f l u o r o g r a p h y 3  enhancer  instructions.  as d e s c r i b e d  by  (En Hance-Dupont) Enhanced g e l s  above  were  before  autoradiography.  10.  Southern b l o t t i n g DNA  and h y b r i d i z a t i o n o f DNA.  samples were r u n on a g a r o s e m i n i g e l s  above, p h o t o g r a p h e d , and p r e p a r e d paper  e_t a_l. ( 1 1 3 ) .  p r o c e d u r e was t h a t Transfer  to proceed  filter  Hybridization isolated  DNA  (113).  The o n l y d e v i a t i o n f r o m  the i n i t i a l  was a l l o w e d  nitrocellulose  al.  f o r t r a n s f e r to n i t r o c e l l u l o s e  ( S c h l e i c h e r and S c h u e l l , BA85) e s s e n t i a l l y  Maniatis  fragments  was baked  as d e s c r i b e d  acid  depurination  as o u t l i n e d by the p u b l i s h e d was  eliminated.  f o r 6-8 h r . , a f t e r w h i c h t h e o i n a 65 C oven o v e r n i g h t .  p r o b e s were p r e p a r e d or plasmids  by n i c k  as d e s c r i b e d  t r a n s l a t i o n of  by M a n i a t i s et^  Generally,  5 u n i t s of c o l i DNA p o l y m e r a s e (New 32 E n g l a n d B i o l a b s ) , 10 u C i o f [ P]dCTP and 10 uM o f e a c h r e m a i n i n g o dNTP were used p e r ug o f DNA. The r e a c t i o n was i n c u b a t e d a t 14 C o f o r 90 m i n . , then t e r m i n a t e d by h e a t i n g t o 65 C. Approximately 1 6 x 10 CPM o f p r o b e DNA were used p e r h y b r i d i z a t i o n r e a c t i o n .  Hybridization  of radiolabelled  p r o b e DNA t o  53  nitrocellulose-bound Prehybridization  (6  DNA  was  as  described  by  hr.)  and  hybridization  Southern  (18  hr.)  (120).  reactions  o were p e r f o r m e d consisting 200  of  in heat-sealable 200  ug/ml b o v i n e  x SSC  (1x  was  in  2 x SSC  briefly,  11.  serum a l b u m i n ,  10  ug/ml t h y m i d i n e ,  M N a C l , 0.0015 M Na  citrate,  nitrocellulose filters o  p l u s 0.5%  SDS  at  65  C and  with X-ray  four  film  and  pH  pyrrolidone, 0.25% 7.0).  were washed times  3  SDS, After  four  times  i n 2 x SSC,  autoradiographed  dried as  above.  Single  (CAT)  buffer  ug/ml p o l y v i n y l  the  Construction  cloning  C in a  200  then o v e r l a i n  described  65  ug/ml F i c o l l ,  0.15  hybridization,  bags a t  the  of  M13-CAT h y b r i d i z a t i o n  stranded  s t r u c t u r a l gene f o r  i n t o M13mpl8.  containing  the  A 773  entire  pBR328 (121)  and  as  described  by  to  the  CAT  Messing  ligation  had  been C a C l - t r e a t e d 2  the  773  p r o b e s were c o n s t r u c t e d  chloramphenicol  TagI  restriction  s t r u c t u r a l gene was  (122)  under  The  m i x t u r e was  CAT  bp  blunt-ended.  TaqI f r a g m e n t  bp  hybridization  probes.  the  used as  digested  reaction to  from  w i t h Smal and  conditions  transfect  described  gene were o b t a i n e d  E_j_ c o l l  above. in  t h i s way  and  the  "reverse" orientation  (i.e.  complementary  to  the  mRNA) was  blank  used  as  the  made  ligated  given  above.  JM101  which  Both o r i e n t a t i o n s  to  reactions.  fragment  isolated  corresponding  hybridization  acetyltransferase  M13mpl8 r e p l i c a t i v e form DNA, was  by  the  clone  nonin  subsequent  of  54  Large q u a n t i t i e s prepared Messing  of single-stranded  by s c a l i n g up t h e " m i n i p r e p " (122).  approximately  A 4 1 culture 2 mg  of i n f e c t e d  (1 A  were  procedure described  of single-stranded  spectrophotometrically  M13-CAT DNA  DNA  JM101  by  yielded  as d e t e r m i n e d  = 40 ug/ml s i n g l e - s t r a n d e d  DNA).  260 12.  RNA  - DNA  hybridizations.  3 i)  isolation  of [ H ] - l a b e l l e d  The  procedure  of Daniels  Plasmid-containing different aliquots  rates  derivatives  until  of c e l l s  RNA.  and B e r t r a n d  of  coli  a K l e t t value  (123) was  HB101  o f 20-25 was  followed.  were grown a t reached.  were l a b e l l e d f o r 1 m i n . by a d d i t i o n  Ten ml  o f 10 u C i  3 of  [5,6 -  H] u r i d i n e  Incorporation culture  into  was  p e r ml  stopped  a Corex  (45 Ci/mmol,  by r a p i d l y  tube c o n t a i n i n g  Amersham).  pouring  the e n t i r e  10 ml  an e q u a l volume o f c r u s h e d ,  f r o z e n s t o p s o l u t i o n (10$ w/v s u c r o s e ; 20 mM TRIS-C1, pH 7-3; 5 mM MgCl ; 20 mM NaN ; 400 ug c h l o r a m p h e n i c o l / m l ) . Labelled cells 2 3 were h a r v e s t e d solution I/ml  by c e n t r i f u g a t i o n ,  without  were added.  sucrose,  resuspended  i n 3 ml o f s t o p  and 200 ug l y s o z y m e / m l and 10 ug DNase  The c e l l s  were t h e n  subjected  to 4 c y c l e s  of  f r e e z i n g and t h a w i n g and l y s e d by t h e a d d i t i o n o f 35 u l o f 3 M sodium a c e t a t e (pH 5.0) and 0.15 ml o f 10$ (w/v) SDS. After o h e a t i n g t o 65 C f o r 5 min., t h e s a m p l e s were e x t r a c t e d w i t h 4 ml of b u f f e r - s a t u r a t e d phenol. RNA was p r e c i p i t a t e d w i t h 2 volumes  55  o f c o l d 95$ (pH in  5.0), 0.4  ethanol,  resuspended  p r e c i p i t a t e d again  ml  of b u f f e r  EDTA).  The  (1 A  =40  (10  mM  amount o f RNA  i n 1 ml  with  ethanol  TRIS-C1, pH was  o f 0.3 and  7.4;  quantitated  M sodium finally  300  mM  acetate  resuspended  KCI;  1  mM  spectrophotometrically  3 ug/ml RNA)  and  the  i n c o r p o r a t i o n of  [ H]  - uridine  260 was  determined  by  trichloroacetic filters  and  ii)  precipitating  acid, collecting  counting  by  i n 0.1  x SSC  nitrocellulose washing w i t h o at out  65  filtered, M13-CAT  ml  a cork  exactly  the  o f 0.1  with  c o l d 5%  the  of  SS  X SSC,  glass-fibre  M13  CAT  DNA  through  the  smaller  (SS)  DNA  was  a 115  filters.  diluted  S c h u e l l , BA85). filter  (6 mm.)  was  to  10  mm. After  a i r d r i e d , baked  f i l t e r s were  At  the  concentration  filter  was  c a l c u l a t e d to c o n t a i n  by  was  containing  same way  except  lambda that  ilv.5 the  a d d i t i o n o f NaOH (0.33  filtration.  o f DNA  punched  initially 4 ug  In b o t h c a s e s ,  assessed  by  the  monitoring  DNA  were p r e p a r e d  of  SS  diluted M  final  extent the  lambda DNA  was  concentration)  o f DNA  A  in  of  retention  the  initial  260  solution  (w/v)  scintillation.  filtered  then  borer.  RNA  p r e c i p i t a t e on  ( S c h l e i c h e r and  and  of  DNA.  denatured  filters  mg  slowly  e a c h 6 mm.  ug  of s i n g l e - s t r a n d e d  1.5  filter  50  Filters  to  and  C overnight  using  liquid  preparation  Approximately ml  5-10  and  comparing  this  to the  flow-through  filtrate.  prior to  56  3 L HJ RNA-DNA  iii)  hybridization.  Hybridizations  were c a r r i e d o u t i n 1.8 ml E p p e n d o r r t u b e s o v o l u m e ) a t 65 C f o r 18 h r . G e n e r a l l y , e a c h  (0.5 ml r e a c t i o n reaction  c o n t a i n e d 3 M13-CAT f i l t e r s ,  (non-complementary acid-precipitable  orientation), radioactivity  were washed, RNase t r e a t e d scintillation Levels  fluid  filters  bound  and c o u n t e d  as d e s c r i b e d  to blank  i)  Functional  E. c o l i under  different  rates  o f about  Filters  i n a toluene-based  by D a n i e l s and B e r t r a n d  (123).  by s u b t r a c t i n g t h e  filters  acid-precipitable  D e t e r m i n a t i o n o f mRNA  CPM o f t r i c h l o r o a c e t i c  i n 2xSSC p l u s 0.2$ SDS.  and e x p r e s s i n g t h e r e s u l t  trichloroacetic 13-  and 2x10  o f CAT mRNA were c a l c u l a t e d  radioactivity  1 " b l a n k " M13-CAT f i l t e r 4  from  that  bound  as a p e r c e n t a g e  t o M13-CAT  of input  radioactivity.  half-life.  half-life.  HB101 c a r r y i n g  t h e a p p r o p r i a t e p l a s m i d was grown  n u t r i t i o n a l c o n d i t i o n s so as t o a c h i e v e g r o w t h -1 0.5 h r . ( s e e s e c t i o n 15 ( i ) b e l o w ) . Ten ml o f  the  a p p r o p r i a t e media was i n o c u l a t e d from an o v e r n i g h t c u l t u r e , o shaken i n a 3 7 C water b a t h , and g r o w t h m o n i t o r e d w i t h a K l e t t Summerson s p e c t r o p h o t o m e t e r . 40  (Green  warmed and  At a K l e t t  f i l t e r ) , 0 . 3 ml o f t h e c u l t u r e  1.8 ml E p p e n d o r f  tube  value of approximately was added  to apre35 5 u C i of [ S]methionine  containing o i n c u b a t e d f o r 3 m i n . a t 37 C. A t t h e same t i m e ,  rifampicin  57  (200  ug/ml f i n a l  culture.  0.3  concentration)  was  added  n l a l i q u o t s were w i t h d r a w n  to the remainder  o f the  a t 20 s e c . i n t e r v a l s f o r  35 100 s e c , added  to 5 u C i o f [  f o r 3 min.  incubated  excess of u n l a b e l l e d was  added  After for  t o each  this,  At t h e end o f t h i s methionine  sonicated  pellet  (see above).  f o r 30 s e c . u s i n g  sonicator,  boiled  polyacrylamide de-staining,  was  f o r another  Chemical  on i c e ,  centrifuged  decay o f h y b r i d i z a b l e  essentially  initiation  as d e s c r i b e d  of plasmid-containing growth r a t e s  i n 30 u l o f SDS f o r 2 min.,  of a Fisher  model  t o an  SDS-  Electrophoresis,  were as d e s c r i b e d  300  staining,  earlier.  half-life.  Chemical h a l f - l i f e  transcription  an  f o r 1 min.  3 m i n . and a p p l i e d  g e l i n 20 u l a l i q u o t s .  period,  concentration)  Samples were b o i l e d the m i c r o t i p  and  continued  resuspended  and a u t o r a d i o g r a p h y  ii)  the  labelling  t h e t u b e s were r a p i d l y c h i l l e d  buffer  as b e f o r e  (60 ug/ml f i n a l  t u b e and i n c u b a t i o n  3 min., and t h e c e l l  loading  S]methionine  was  determined  directly  CAT mRNA f o l l o w i n g by r i f a m p i c i n . by D a n i e l s  E_^ c o l i  HB101  and when a K l e t t v a l u e  by m o n i t o r i n g  inhibition  of  The method used  and B e r t r a n d were grown  (123).  was Cultures  at d i f f e r e n t  o f 20-25 was  achieved, the  3 c u l t u r e s were l a b e l l e d f o r 1 m i n . w i t h  10 u C i o f [ H ] u r i d i n e  per  3 ml.  Further  addition ml.  incorporation  of [ H]uridine  into  o f 200 ug o f r i f a m p i c i n p e r ml and 0 . 8  RNA  was  stopped  by  ug o f u r i d i n e p e r  Ten ml samples o f t h e c u l t u r e were removed i m m e d i a t e l y  prior  58  to,  and 30, 60, and 90 s e c . a f t e r , r i f a m p i c i n  rapidly  pipetted  into  crushed,  frozen  stop  addition  solution  and  as  described  3 above.  [ H]RNA was  extracted  CAT mRNA were d e t e r m i n e d SS DNA 14.  as d e s c r i b e d  Plasmid  were d e t e r m i n e d Hatfield  by h y b r i d i z a t i o n  (124).  chloramphenicol  c o p y numbers  in cells  by t h e d o t - b l o t Portions  acetyltransferase  a Bio-Rad  equivalent  t o 10 ug o f t o t a l  individual  cell  denatured  first  l i n e a r i z e d with  Southern b l o t s , using  then  pKK232-8  was  As a s t a n d a r d ,  of n i t r o c e l l u l o s e f i l t e r .  Hyridization  dot b l o t  pKK232-8  DNA  method  (Schleicher apparatus. filtered  As a p r o b e ,  DNA.  excess  Filters  f o r Cerenkov r a d i a t i o n .  10 ug o f c e l l comparison  extract  protein  to a standard  was  A volume  f o r each  placed  translated  as  DNA  The amount then  as d e s c r i b e d  to X-ray  curve obtained  from  for  nick film,  o u t and  of plasmid  calculated  was  described  (2-3 u g / f i l t e r ) o f  were e x p o s e d  amounts  on t h e same  pKK232-8  t h e i n d i v i d u a l d o t s on t h e paper were punched  counted  and  d i f f e r e n t known  and washing were p e r f o r m e d a large  o f Adams and  used f o r  were a l s o  Smal, then n i c k  rates  ( s e e b e l o w ) were  paper  protein  piece  translated  M13-CAT  at d i f f e r e n t  extract  assays  BA 85) u s i n g  extract.  growing  o f the c e l l  Schuell,  before.  to f i l t e r - b o u n d  hybridization  onto n i t r o c e l l u l o s e f i l t e r  sonicated,  The l e v e l s o f  determination.  filtered  of  earlier.  above.  copy number  Plasmid  as d e s c r i b e d  DNA  per  after  t h e known  standard  59  DNA.  Absolute  number o f p l a s m i d  calculated,  but  plasmid  per microgram of t o t a l  DNA  instead, results  c o p i e s per  cell  were e x p r e s s e d protein  was  not  as nanograms  i n the  sonicated  of cell  extract.  15.  Growth r a t e s t u d i e s and  Plasmid-carrying under rate  a t 37  harvested encoded  and  At  enzymatic  of  coli  HB101  the a p p r o p r i a t e c u l t u r e e x t r a c t s prepared  activity  i)  M e d i a and  For  a l l experiments,  (125)  leucine,  50  either  depending  c o u l d be  were grown  cells  ug/ml f i n a l  differences 0.4$  Bacto-yeast  the  plasmid  a vitamin-amino  50  ug/ml;  a t 50  carried  i n growth r a t e , (final  that  were  plasmid-  assayed.  were grown i n AB  ug/ml; a r g i n i n e , 50  chloramphenicol on  i n order  minimal  acid  concentration; proline,  ug/ml; s e r i n e , 60  density, cells  growth c o n d i t i o n s .  supplemented with  tryptophan,  with:  C.  cell-free  ( t h i a m i n e , 20  and  strains  assays.  v a r i o u s n u t r i t i o n a l c o n d i t i o n s so as t o a c h i e v e a g r o w t h -1 o f 0.5 - 1.5 hr . I n c u b a t i o n temperature always remained o  constant  media  enzyme  this  t h r e o n i n e , 60  mixture 50  ug/ml; h i s t i d i n e ,  the  cells.  media was  concentration) glucose,  e x t r a c t f o r growth r a t e  (u)  also 1$  from  To  ug/ml;  ug/ml;  ug/ml o r a m p i c i l l i n by  salts  50  ug/ml)  a t 50  ug/ml  achieve  supplemented  Bacto-tryptone, 0.2$ -1 1.2-1.6 h r . ; 0.5$  60  glycerol, sodium  0.1$  succinate,  0.5$ sodium -1 hr .  o.4$  a c e t a t e , 0.1$  To e n s u r e t h e time  that  aliquots  p r o t o c o l was  -1 f o r u = 0.9-1.2 h r . ; 0.5$ -1 B a c t o - t r y p t o n e f o r u = 0.7 - 1.0 h r ;  Bacto-yeast extract  a l l cultures  flasks  broth culture  -  0.7  growth at  assays, the f o l l o w i n g  The a p p r o p r i a t e media was  250 ml s i d e - a r m  Meanwhile, a L u r i a  f o r u = 0.4  were i n l o g a r i t h m i c  were t a k e n f o r enzyme  adopted.  ml amounts i n t o  Bacto-yeast extract  and k e p t  of the s t r a i n  d i s p e n s e d i n 20 o at 4 C u n t i l use.  t o be t e s t e d  was  -7  serially  diluted  subsequent incubated less  cells  cultures  dilution  which  showed  i n t h e same m e d i a i n w h i c h  logarithmic  growth.  g r o w t h were used  containing  dense g r o w t h b u t t h o s e  presumably  showed o n l y f a i n t  flask  1x10  growth was d e s i r e d . These d i l u t i o n s were t h e n o a t 37 C f o r 14-18 h r . A f t e r t h i s t i m e , some o f t h e  diluted  higher  to at l e a s t  had s t a r t e d These  from  cells,  to i n o c u l a t e  c u l t u r e s of  o n l y a few  which  were s t i l l  t h e pre-warmed  t h e same media and grown w i t h v i g o r o u s  in  side-arm aeration  o at  37 C.  (Green  Growth was m o n i t o r e d  filter)  was  placed into  The  cells  Sorval  was  SS-34  ii) The  r e a c h e d , a t which  a 25 ml Corex  were then rotor  until  pelleted  tube  15 ml o f t h e c u l t u r e  by c e n t r i f u g a t i o n  and a s s a y e d  was  point  reading of 20-30  and r a p i d l y  f o r enzymatic  C a t e c h o l 2,3-dioxygenase enzyme  a Klett  assayed  chilled  on i c e .  a t 4000 x g i n a  activity.  assay.  essentially  as d e s c r i b e d  by  61  Zukowski e_t a l , . ( 1 2 7 ) . AP  buffer  The c e l l  pellets  with  , 0.16 M Na HPO , 10$ v / v a c e t o n e ) , t h e n 4 2 4 i n 4 ml o f AP b u f f e r and s o n i c a t e d f o r 1.5 m i n . ("65"  setting) using sonicator.  the intermediate  A cell-free  size  extract  d i o x y g e n a s e was a s s a y e d supernatant  by a d d i n g  Biosonic  by c e n t r i f u g a t i o n a t  SS-34 r o t o r .  Catechol,  2,3-  25-100 u l o f c e l l - f r e e  2.5 ml H 0, 0.3 ml AP b u f f e r , 2 100 u l o f a 0.1 M aqueous c a t e c h o l s o l u t i o n . Upon a d d i t i o n  and  t o a tube  t i p of a Bronwill  was p r e p a r e d  12,000 x g f o r 15 m i n . i n a S o r v a l  the s u p e r n a t a n t ,  path  length  containing:  the r e a c t i o n  cuvette  and p l a c e d  dual-beam s p e c t r o p h o t o m e t e r . nm due t o c o n v e r s i o n was  once  (0.04 M NaHPO  resuspended  of  were washed  followed.  content  i n a temperature The i n c r e a s e  of catechol  Enyzyme a c t i v i t y  of the supernatant,  mix was t r a n s f e r r e d  t o a 1 cm. o c o n t r o l l e d (37 C)  i n absorbance  to hydroxymuconic was n o r m a l i z e d  as measured  a t 375  semialdehyde  to the p r o t e i n  by a m o d i f i e d  Lowry  assay (127). One u n i t o f a c t i v i t y was d e f i n e d as a change o f 1 x -3 10 A u n i t s p e r minute per m i l l i g r a m o f t o t a l p r o t e i n . 375 iii) The washed  chloramphenicol method  once w i t h  dithiothreitol), as Cl,  described  acid;  assay.  Cell  pellets  were  (50 mM TRIS-C1, pH 7.8, 30 uM  resuspended  pH 7.8; 0.1 mM  nitrobenzoic  o f Shaw (128) was u s e d .  EB b u f f e r  above.  acetyltransferase  i n 5 ml o f EB b u f f e r  A reaction acetyl-CoA; and 0.1 mM  mix c o n s i s t i n g 0.4 mg/ml  and c e n t r i f u g e d  o f 100 mM  TRIS-  5,5'-dithiobis-2-  chloramphenicol  was made up and  62  used  as a b l a n k  reaction  mix  was  i n a dual-beam  spectrophotometer.  p l a c e d i n a second  One  cuvette, allowed  ml  to  of the  equil-  o ibrate and  t o 37 C, and  10-50  the c u v e t t e i n v e r t e d  Increase  in A  transferase supernatant  was 410 activity  u l of c e l l - f r e e several  f o l l o w e d and was  times  supernatant  t o mix  as d e s c r i b e d above. One -3 d e f i n e d as a change o f 1 x 10 A 410 milligram of t o t a l p r o t e i n .  to the p r o t e i n unit units  added  the c o n t e n t s .  chloramphenicol  normalized  was  The  acetylcontent  of a c t i v i t y  was  per minute  per  of the  63  C h a p t e r 1_  Cloning  and  expression  o f B.  s u b t i l i s rrnB promoters  i n E.  coli  Introduction This promoter E. c o l i designed  chapter describes  region  from  cloning  of the  t h e B_j_ s u b t i l i s r r n B o p e r o n  as w e l l  as  The  to d e t e r m i n e  were e x p r e s s i b l e was  and  rrnB operon.  growth  rate  initial  whether  i n E_^ coand dependent  shown f o r E_^_ c o l i  the i s o l a t i o n  in fact  by  in  and  for  Ej_ c o l l  (107)  to promoters  recognized  has n o t as y e t been  transcriptionally  active  be n o t e d however, t h a t workers  in cloning  presumptive  (103).  directly  have been  have shown t h a t  evidence that  (those expressed  the  promoter  in_ v i v o  region  is  structurally  by E_;_ c o l l  RNA  polymerase  shown t h a t  these promoters  the d i f f i c u l t i e s rRNA  been  73).  i n a heterologous  Bacillus  previously  i s active  t h e B_^ s u b t i l i s r r n B p r o m o t e r  similar  was  Green  promoters  expression  from B^ s u b t i l i s  polymerase)  a B_;_ s u b t i l i s tRNA gene c l u s t e r  While  it  and  (31 , 72,  genes  t h e sigma-43 RNA Void  this  i n a manner as had  rRNA p r o m o t e r s  work were  B_j_ s u b t i l i s rRNA  i f s o , whether  A number o f v e g e t a t i v e recognized  stages of t h i s  coli  i n E_^ c o l i .  host.  e n c o u n t e r e d by  fragments  the  (103), are I t must  some  on m u l t i c o p y p l a s m i d s  these promoters  are a c t i v e  i_n v i v o  64  Results Cloning The for  the  o f B_j_ s u b t i l i s  plasmid  pKM-1  c l o n i n g of unusually  of a p r o m o t e r l e s s  region into  inserted.  The  be  lambda-phage polylinker  by  tR1  and  cloning coli  strong promoters  activation  the galK  to read  Presumably,  o n l y about (129).  replication  because  was  due  transcripts  promoters c o u l d read-through containing venting and  v e c t o r s are  read-through  thereby  enhancing  Using  5-10$  EcoRI r e s t r i c t i o n  Previous  the  placed  can  be  polylinker the  between  the  upstream  attempts  multicopy plasmid  emanating the  transcription  fragments  into  o f the  from  from  as  at  plasmids  i n E.  instability  the  o r i region.  therefore necessary  pKM-1, S t e w a r t  upstream  to i n t e r f e r e n c e w i t h  into  plasmid  consists  gene. F i n a l l y ,  s t r o n g p r o m o t e r s on  this  vector  T h i s i s a weak, r h o - d e p e n d e n t  were u n s u c c e s s f u l b e c a u s e o f s e v e r e  (130).  an  It  fragments  t e r m i n a t o r was  gene.  through  rRNA or o t h e r  (129).  inserted  o f the g a l K  transcription  expression  ( g a l K ) gene and  of promoters  t e r m i n a t o r which a l l o w s transcripts  an  which p r o m o t e r - b e a r i n g  presence  detected  promoters.  c o n s t r u c t e d as  galactokinase  polylinker  can  was  rrnB  plasmid  cloned Terminator-  a means o f  high-activity  pre-  promoters  stability.  and  Bott  (103)  of approximately  cloned 1900  two and  contiguous 1100  bp  65  from t h e 5' end o f t h e B_^ s u b t i l i s  r r n B operon, to c r e a t e  By s e q u e n c i n g , t h e l a r g e r  was f o u n d  tandem p r o m o t e r s plasmid  isolated  pHD1.8  the s t a r t  BstE11  o f t h e 16S RNA c o d i n g  BstE11  the EcoRI insert  site  cloning  relative  digestion  t h e EcoRI  site  o f pKM-1  and P s t l  site  t h e tandem p r o m o t e r s  site  located  sequence,  site  about  This  located  would  123 bp beyond 1400 bp from t h e  754 bp u p s t r e a m o f  (129) were used  initiated  o f pKM-1 t o  asymmetrically  to o r i e n t the  Simultaneous  be e x p e c t e d t o p r o d u c e  f r a g m e n t s o f 2154 bp and 4046 bp i f t h e i n s e r t that  The  1900 bp f r a g m e n t had  t o t h e g a l K gene on pKM-1.  with BstEl1  o f them.  (103) and i t was found t o  (see F i g . 3 A ) .  and a P s t l  the rrnB  t h e 1900 bp p r o m o t e r  Most o f t h i s  restriction  5' end o f t h e f r a g m e n t located  with EcoRI,  by S t e w a r t and B o t t  a single  to contain  1200 bp u p s t r e a m  and s u b c l o n e d i n t o  (see F i g . 1A).  been s e q u e n c e d contain  as about  pGS227 was d i g e s t e d  fragment give  as w e l l  fragment  pGS227.  was o r i e n t e d  transcription  into  such  the galK  gene, and f r a g m e n t s o f 1320 bp and 4880 bp i f t h e r e v e r s e orientation  was c o r r e c t .  As s e e n i n F i g . 1B, two f r a g m e n t s o f  about 2000 bp and 4000 bp were p r o d u c e d , i n d i c a t i n g former o r i e n t a t i o n  Although  was  correct.  transcription  the rRNA p r o m o t e r s were a c t i v e expression transformed  proceeded iji v i v o ,  was o b s e r v e d i n E_j_ c o l l w i t h pHD1.8.  transformants  on e i t h e r  that the  into  t h e g a l K gene i f  no i n d i c a t i o n  strain  C110 ( g a l K  of galK )  T h i s was a s s e s s e d by growth o f McConkey-galactose  or EMB-galactose  F i g u r e 1. A.  S t r u c t u r e and o r i e n t a t i o n o f pHD1.8.  S t r u c t u r e o f pHD1.8. A 1900 bp EcoRI fragment from pGS227 (103) was cloned i n t o the EcoRI s i t e of pKM-1. The s t a r t o f the 16S RNA coding r e g i o n i s i n d i c a t e d . The lambda t R l t r a n s c r i p t i o n t e r m i n a t o r i s shown p r o x i m a l to the galK gene. Abbreviations: P, P s t l ; E, EcoRI; B, B s t E I I ; H, H i n d l l l .  B. O r i e n t a t i o n o f t h e 1900 bp i n s e r t . Lane A - pHD1.8 u n d i g e s t e d , Lane B - pHD1.8 d i g e s t e d w i t h EcoRI, Lane C - pGS227 d i g e s t e d w i t h EcoRI. D i g e s t e d DNA was e l e c t r o p h o r e s e s through a 1% agarose g e l . The p o s i t i o n o f the 1900 bp EcoRI rrnB fragment is indicated. Lane D - pHD1.8 d i g e s t e d w i t h P s t l and B s t E I I , Lane E - 029 d i g e s t e d w i t h H i n d l l l as m o l e c u l a r weight markers. Digested DNA was e l e c t r o p h o r e s e d through a 1.2% agarose g e l . S i z e o f the 029 fragments, i n base p a i r s , i s i n d i c a t e d on the r i g h t . The presence o f two fragments o f 2154 and 4046 bp i n Lane D was used to d e r i v e t h e o r i e n t a t i o n o f the 1900 bp i n s e r t ( s e e t e x t ) .  67  16 S  H  R1  .HD1.8  gal  B  B  C  D  -1900  E  K  68  indicator  media.  Therefore  p r o m o t e r s were not element, e i t h e r the  i t was  functional  i n the  lambda t e r m i n a t o r  16S  in this  RNA  of the  galactokinase protein.  further manipulations pHD1.8 i n s e r t  fragments c a r r y i n g only v e c t o r was  plasmid  pKK232-8  carried  a promoterless  gene and  to maintain efficient  plasmid  through  a t the  o f the from the  CAT  the CAT  3'  as  into  the u p s t r e a m inserting  DNA  from  from  the  CAT  vector  and  fragments.  the  The  CAT  CAT  chloramphenicol  Since  gene l a c k e d  by  an  the  i n that i t  rrnB  as  (CAT)  terminator  operon  from r e a d i n g polylinker  upstream  emanating  through placed  gene p r o v i d e d  into  between  a means o f  the  inactivated  enzyme the  reaction  p r o m o t e r but  read-  (Fig. 2).  transcripts  acetylation  had  to p r e v e n t  been p l a c e d  gene encoded  a functional  DNA  a set of h i g h l y  had  a c e t y l t r a n s f e r a s e which  antibiotic  v e c t o r was  o r i region  nascent  to  different  transcription  gene so  terminators  the  a  pKM-1  E_;_ c o l i  plasmid  to prevent  terminator  and  was  promoter  acetyltransferase  A multiple cloning site  chloramphenicol  this  of smaller  Instead,  the  pBR322 p o r t i o n o f gene.  a source  internal  of the  transcription  gene so  as  differed  derived  In o r d e r  rrnB  promoters,  or i n  gene,  Bacillus  chloramphenicol  end  structural  This expression  stability.  transcription  Furthermore,  which  insert  the  used  rRNA  r e q u i r e an  terminators  been p l a c e d  the  chosen.  (131)  i t d i d not  was  of  galK  cloned  before  facilitate  the  the  the  some downstream  placed  expression  expression  that either  s y s t e m , or  p o r t i o n of  preventing  elements, the  reasoned  (128).  retained  the  Pv  F i g u r e 2.  S t r u c t u r e o f pKK232-8.  S t i p p l e d areas denote sequences d e r i v e d from pBR322. 5S, T l , T2 r e f e r to the 5S RNA gene and the downstream T l and T2 t r a n s c r i p t i o n t e r m i n a t o r s d e r i v e d from the E . c o l i rrnB operon. The p r o m o t e r l e s s c h l o r a m p h e n i c o l a c e t y l t r a n s f e r a s e (CAT) gene i s shown as "Cam ". M u l t i p l e c l o n i n g s i t e s p r o x i m a l to the CAT gene are used f o r i n s e r t i o n o f promoter fragments to g i v e a c h l o r a m p h e n i c o l r e s i s t a n c e phenotype. Note the presence o f an a d d i t i o n a l t r a n s c r i p t i o n t e r m i n a t o r ( T l ) p r o x i m a l to the m u l t i p l e c l o n i n g s i t e s . Abbreviations: Ps, P s t l ; E, EcoRI; S, Smal; B, BamHI; Sa, S a i l , H, H i n d l l l ; Pv, P v u l . S  70  necessary  translational  fragments  resulted  manifested presence  from  restriction  t h e rRNA  sites  were s e l e c t e d  predicted into  on L u r i a  were s e l e c t e d  inserts  digesting  could  w i t h EcoRI  example F i g . 4 ) . clones  vector,  base  pairs,  from  E_j_ c o l i  was d e r i v e d (positions  This  a functional by t h i s  be v e r i f i e d and BamHI  isolated DNA  i s shown  the n o m e n c l a t u r e  t h e known DNA  promoter  protocol.  of t h i s  the i n s e r t  that  t h e pHD1.8 i n s e r t  427 bp f r a g m e n t  promoters  included  isolating  rrnB As  o f t h e B_j_ s u b t i l i s  throughout KK r e f e r s  this  work  t o a CAT-  of the i n s e r t i n was  The p l a s m i d  derived pKK-427B  w i t h D d e l and  Sau96l  a 427 bp f r a g m e n t  and c l o n i n g  218 bp o f DNA  (see f o r  i n F i g . 3A.  the i n s e r t  respectively.  700 t o 1127, F i g . 3 B ) ,  t h e tandem rRNA  whether  and  o f the v a r i o u s  corresponds to the s i z e  o r B^ s u b t i l l s by d i g e s t i n g  p l a s m i d DNA  region  o f p l a s m i d s i s as f o l l o w s :  and Ec o r B i n d i c a t e  recombinants  The p r e s e n c e o f  from pHD1.8 i s g i v e n  Note  and  (103).  i n the proper  by i s o l a t i n g  in Fig. 3 B .  t h e number  were  50 ug/ml c h l o r a m p h e n i c o l .  to l i b e r a t e  sequence  sequence  o f pKK232-8  A schematic r e p r e s e n t a t i o n  the r e l e v a n t  r r n B operon  from  agar c o n t a i n i n g  orientation  taining  t o grow i n t h e  o f pHD1.8 by making use o f  t h e Smal s i t e  containing  based  cells  was  p r o m o t e r - c o n t a i n i n g fragments  insert  Only c l o n e s  well,  o f t h e CAT gene w h i c h  of recombinant  of smaller  were c l o n e d  promoter  o f promoter  of chloramphenicol.  isolated  cloned  the i n s e r t i o n  i n expression  as t h e a b i l i t y  A number  These  signals,  this  into  upstream  con-  pKK232-8.  of the  71  F i g u r e 3.  O r i g i n and sequence of B . s u b t i l i s promoter fragments.  A - A schematic diagram o f the B . s u b t i l i s rrnB promoter fragments. The top l i n e r e p r e s e n t s the 2.9 Kb EcoRI fragments from the rrnB operon c l o n e d i n pKM-1 to g i v e pGS227 (see r e f . 103). The middle l i n e shows the 1.9 Kb EcoRI fragment subcloned i n pKM-1 to g i v e pHD1.8. The -35, -10 r e g i o n s o f the tandem promoters a r e i n d i c a t e d by s m a l l f i l l e d boxes. The s t a r t p o i n t and d i r e c t i o n o f t r a n s c r i p t i o n from PI and P2 a r e i n d i c a t e d by arrows. The double l i n e r e p r e s e n t s the 16S RNA c o d i n g r e g i o n . Numbering corresponds to that given by Stewart and Bott (103) where 1 i s the f i r s t base of the 5' EcoRI s i t e . The lower p a r t of the f i g u r e r e p r e s e n t s the v a r i o u s promoter fragments c l o n e d i n t o pKK232-8 as d e s c r i b e d i n the t e x t . B - Base sequence o f the B . s u b t i l i s rrnB promoter r e g i o n . Sequence as determined by Stewart and Bott (103). The -35 and -10 r e g i o n s o f PI and P2 a r e u n d e r l i n e d and the s t a r t p o i n t o f t r a n s c r i p t i o n i s i n d i c a t e d by arrows. The H i n d i s i t e a t p o s i t i o n 982 was used to i s o l a t e the s i n g l e PI promoter on pKK-282B and the endpoints o f the pKK-285B and pKK-220B d e l e t i o n fragments are i n d i c a t e d a t p o s i t i o n s 842 and 907 r e s p e c t i v e l y . The D r a l s i t e s a t p o s i t i o n s 879 and 1090 were used t o c o n s t r u c t pKK-211B w h i l e the Sau96I s i t e a t p o s i t i o n 1127 r e p r e s e n t s the 3' endpoint o f pKK-427B, pKK-220B, and pKK-285B. The sequence around PI marked " s t r i n g e n t " has homology to the r e g i o n which may be i n v o l v e d i n s t r i n g e n t c o n t r o l and the sequence marked "stem" i s p a r t o f a p o s t - t r a n s c r i p t i o n a l R N a s e l l l p r o c e s s i n g s i t e (see t e x t ) .  72  E c o R1  P1-P2  1  EcoRI  BstE11 |  EcoRI  i  23 S  16 S  PI Ddel  '—A  Oral  700  P2 Hindi  i  1  982 1090  842 907 879  BstEII  Sau96l  Oral  i  n27  -vA-J  1800  1313  pKK — 4 2 7 B  pKK - 282 B  pKK-220B  pKK — 211 B  pKK-285B  B "  CTTTAATGCTCCCCTTGTGGTCATCAGTATTTAGTTCCTTTCACATACAAGAAAACGAAAAAAA I  706  CAACAACATCACATGACTGATCTATATGTT'CTTTTAACAAACTTATATGATACACACCCTTTAC  A-285 i  Dra1  AAATCATOGCCAGGATTATAGTTTATTTCTTTTATACATTTTTTTTAAAAAACTATTGCAATAA  A-220  I 879  j->pi  ATAAATACAGGTGTTATATTATTAAACGTCGCTGATCCACAGCGCACACAACTACATGCTTCAA  907  Hindi  Stringent  L W  P  2  AACAACTTGAAAAAAGTTGTTCACAAAAAAGAAGCTGAATGTTATATTAGTAAAGCTGCTTCAT I  982 TCAGAAGTAACGAAATGATCTTTCAAAACTAAACAAGACAAAACGTACCTGTTAATTCAGTTTT  I Dral  STEM  1 Sau96l  TAAAAATCGCACTGCGATGTGCGTATCATCAAACAGGGCCTCCACGACGCACGTCACACAGGTG  1090  1127  TCGCCGCACGATGCGCTGAACTTAACCTGTGATCCATTTATCGGACAGTTTGATCTTGGCTCAG  I  m16S  •  1217  73  P1  transcription  initiation  start  site.  site  and 112 bp downstream o f t h e P2  Some o f t h e s e u p s t r e a m  by d i g e s t i n g  pKK-427B w i t h E c o R I ,  exonuclease,  and r e l e a s i n g  BamHI .  These  Smal s i t e  deleted  promoters  as w e l l  This  clone,  3A,B).  Finally,  tandem rRNA p r o m o t e r s 879  retained sequence  pKK-285B, t h e r e f o r e retained  fragments with  only  personal  t h e tandem P1-P2  immediately upstream  had t h e same 3'  t h e p l a s m i d pKK-211B a l s o  ( a s a 211 bp D r a l  fragment  1  o f P1 and 71 bp downstream o f P2 ( F i g . 3 B ) .  tandem P1-P2 p r o m o t e r s were a l s o cloned  onto pKK232-8,  expression  chloramphenicol  t e r m i n u s ended subcioned. only  as i n d i c a t e d  resistance.  PKK-427B was d i g e s t e d  contained  retained  i n t h e -35 r e g i o n The r e s u l t a n t  only  to the  45 bp  s e p a r a t e d and  by s e l e c t i n g f o r  by t h e a p p e a r a n c e o f  Initially,  with H i n d i  a functional  again  positions  and 3'  upstream  and  fragment  from  had been removed.  functional  This  both 5  c a r r i e d the  promoter  individually  sequences  76 bp o f DNA 5' t o t h e P1 p r o m o t e r  t o 1090, F i g . 3A,B) b u t h e r e s e q u e n c e s  The  i n t o the  various  (G.B. S p i e g e l m a n ,  as t h e A-T r i c h  deleted  and c l o n e d  By s e q u e n c i n g  one was f o u n d w h i c h  as pKK-427B b u t o n l y (Fig.  the s h o r t e n e d promoter  clones  were  w i t h Bal-31  f r a g m e n t s were i s o l a t e d  chloramphenicol-resistant  o f P1.  treating  o f pKK232-8 as b e f o r e .  communication)  sequences  t h e 427 bp i n s e r t  from  and a 282 bp f r a g m e n t whose o f t h e P2 p r o m o t e r  plasmid  3'  was i s o l a t e d  (pKK-282B, F i g . 3A,B)  P1 p r o m o t e r .  A derivative  containing  74  F i g u r e 4.  Top  Promoter i n s e r t s _ i n pKK232-8 and t h e i r e l e c t r o p h o r e t i c mobility.  - Lanes A and B, pKK427B d i g e s t e d w i t h EcoRI and BamHI; Lane C, pKK-220B d i g e s t e d w i t h EcoRI and BamHI; Lane D, pKK232-8 v e c t o r d i g e s t e d w i t h EcoRI and BamHI; Lane E, 029 d i g e s t e d w i t h H i n d l l l as m o l e c u l a r weight markers. S i z e s o f the marker fragments, i n base p a i r s , a r e shown a t r i g h t . D i g e s t s were run on 4% p o l y a c r y l a m i d e g e l s i n T r i s - b o r a t e - E D T A b u f f e r . Note the p r e s e n c e o f the 427 bp (Pl-P2).iand 220 bp (P2) promoter i n s e r t s i n pKK-427B and pKK-220B. The a c t u a l s i z e of these fragments i s 437 bp and 230 bp because c l o n i n g i n t o the Smal s i t e o f pKK232-8 and subsequent l i b e r a t i o n o f the fragment w i t h EcoRI and BamHI r e s u l t s i n the a d d i t i o n o f 10 e x t r a base p a i r s d e r i v e d from the m u l t i p l e c l o n i n g s i t e p o l y l i n k e r o f pKK232-8. The remaining two bands o f 300 bp and 180 bp i n Lanes A - D a r e d e r i v e d from t h e pKK232-8 v e c t o r .  Bottom - A s e m i l o g a r i t h m i c p l o t o f g e l m o b i l i t y v s . the fragment l e n g t h based on the above f i g u r e . The s o l i d dots a r e the m o l e c u l a r weight markers from 170 bp to 1091 bp. The cross r e p r e s e n t s the 427 bp promoter fragment (taken as 437 bp f o r measurement purposes) and the open square i s t h e 220 bp ( o r 230 bp) promoter fragment.  A  C  B  D  E  1272 1091 727 600 454  427  2 74  220  170  1  J  i  i  i  10  20  30  40  MIGRATION  50  DISTANCE  60 (mm.)  76  only  t h e P2 p r o m o t e r  generated  deletion  was  fragments  (pKK-220B, F i g . 3A,B) deleted,  o b t a i n e d by  as d e s c r i b e d  i n which  thereby i n a c t i v a t i n g  downstream  P2 p r o m o t e r  fragments  o f known s i z e  represented  above.  region  promoter  The  promoter  was  i n F i g . 4.  the -35 this  intact.  some o f t h e s e B_j_ s u b t i l i s  s e q u e n c i n g a s e t of Bal-31 One  o f P1  and  determined  been  leaving  only  As can be s e e n ,  the  mobility  relative  and  found  had  electrophoretic inserts  was  to  of  DNA  is graphically  the a c t u a l  size  of these  fragments,  as j u d g e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s ,  is  very  to t h a t  This  close  indicates  that  isolated  derived TaqI and  P1  cloned  the  68 bp  sequence.  an  anomolous  downstream o f P2  pKK-292Ec.  S e c o n d l y , the  as a 351  HinfI  restriction  of t h i s  fragment sites  t o compare  rRNA  t h e E_j_ c o l i  containing  fragment  Insertion  HinfI  E_j_ c o l i  rrnB operon.  sequence).  bp  from  able  The  (132), contained  coli  This  and  t o be  onto pKK232-8.  a 292bp f r a g m e n t  isolated. and  and  fragments  by B r o s i u s  from  do n o t d i s p l a y  was  o f B_^ s u b t i l i s  promoter  constructed  was  the o b j e c t i v e  activities  also  t h e known DNA  behaviour.  Because  analogous  from  these fragments  electrophoretic  vivo  calculated  contains  promoters,  rrnB operon  bp  t h e tandem  and  TaqI  into  coli  r r n B P1  were l o c a t e d  256  P1-P2  bp  DNA  with  promoters  upstream  of  Fig. 5 for pKK232-8  promoter  from pKK10-2 t o g i v e  of  digested  o f DNA  ( s e e r e f . 133 fragment  were  fragment  pKK10-2 was  bp  the  p l a s m i d pKK10-2,  a 1600  101  the i n  was  isolated  pKK-351Ec.  upstream  yielded  o f P1  The and  GATTC - 134bp i Hinfl  GTTACGGCTTCGAAACGCTCGAAAAACTGGCAGTTTTAGGCTGA i Taq 1  -35  PI  TTTGGTTGAATGTTGCGCGGTCAGAAAATTATTTTAAATTTCCTCTTGTCAGGCCGGAAT +1  r*"  -io  AACTCCCTATAATGCGCCACCACTGACACGGAACAACGGCAAACACGCCGCCGGGTCAGC i Hha1  -35  P2  GGGGTTCTCCTGACAACTCCGGCAGAGAAAGCAAAAATAAATGCTTGACTCTGTAGCGGG 1 |-* +  - 10  BOX B  i  i Hinf 1  BOX A  AAGGCGTATTATGCACACCCCGCGCCGCTGAGAAAAAGCGAAGCGGCACTGGTCTTTAAC i Hha1  BOX C AATTTATCAGACAATCTGTGTGGGCACTCGAAGA - lOObp - 16S RNA Taq 1  F i g u r e 5.  Base sequence of the E . c o l i rrnB promoter  region.  Sequence as determined by B r o s i u s e t a l . (21). The -35, -10 r e g i o n of PI and P2 a r e o v e r l i n e d and the s t a r t p o i n t s and d i r e c t i o n o f t r a n s c r i p t i o n a r e i n d i c a t e d by arrows. Box B, A, and C r e f e r t o sequences thought t o be r e q u i r e d f o r a n t i t e r m i n a t i o n o f rRNA t r a n s c r i p t s (see t e x t ) . R e s t r i c t i o n s i t e s i n d i c a t e d were used i n the i s o l a t i o n o f promoter fragments f o r c l o n i n g i n t o pKK232-8 as described i n the text.  78  within  the -35  promoter exactly promoter give  was  o f P2  functional  analogous was  (133); thus only  on pKK-351Ec and  t o pKK-282B d e s c r i b e d  cloned  pKK-128Ec.  immediately was  region  as a 128  The  5' end  bp  t h e E. c o l i  represented a above.  Hhal f r a g m e n t  of t h i s  downstream o f the -10  fragment  region  3 bp downstream o f the t r a n s c r i p t i o n  The  P1  construct  E_;_ c o l i  P2  f r o m pKK10-2 t o was  located  w h i l e the 3'  o f P1  initiation site  of  end P2  (133, F i g . 5 ) .  Finally, coli  was  fragment  also  used  fusions  carries  r e s i s t a n c e gene  pKK-Tet. i s given  a n o n - r i b o s o m a l promoter  i n these experiments.  f r o m pBR322 which  tetracycline yield  as a c o n t r o l ,  A list  The  377  the promoter  (134) was  cloned  2.  E.  EcoRI-BamHI  f o r the  into  of a l l plasmids c o n s t r u c t e d  i n Table  bp  from  pKK232-8 as CAT  to  gene  Table  2 - CAT  gene  fusions  Plasmid  Promoter  PKK-427B  P1-P2  PKK-285B  P1-P2,  5'  pKK-211B  P1-P2,  S'+S'  PKK-282B  P1  PKK-220B  P2  pKK-292Ec  P1-P2  pKK-351Ec  P1  "  pKK-128Ec  P2  "  pKK-Tet  tetracycline  Insert  Source  B.  subtilis  deletion deletion  Coli  r E.  coli  2.  Stability  The assess under were and  of CAT-fusion  stability  the extent  to which  chloramphenicol  was  2).  grown  then  HB101  18  then  1 i n 500  hr. plated  chloramphenicol  and  resistant  that  functional  promoter  on  growth  was  patterns  promoter with  of chloramphenicol  i n Table  were  promoters  with  pKK-292Ec ampicillin,  and  grown hr.  was  which  counted.  The  derivatives to ensure  of a of the  3).  lost  under  f o r the maintenance these  clones then  were  of a grown  a l l cells  indistinguishable,  i n polyacrylamide (data  number  as a p e r c e n t a g e  rapidly  was  for a  cultures  (due t o t h e p r e s e n c e  (Table  2  pKK232-8  or  26  lost  a m p i c i l l i n or  of chloramphenicol  fragment pKK  only  either  I f however,  promoter  be  on  pKK-427B  expressed  present  could  of inserted  t h e 8 h r . and  clones  phenotype  insert.  a functional  experiments  presence  clones r  i n the presence  cloned  either  d i d not d i r e c t l y select  electrophoretic  original  because  colonies  to  inserts  a m p i c i l l i n broth  both  tested  derivatives  supplemented  from  insert)  t h e Cm  conditions  retained  pKK  was  o f the b l a gene  carrying  resistant  ampicillin  continually  The  because  resistant  promoter  seen,  promoter  on m e d i a c o n t a i n i n g  chloramphenicol  c a n be  derivatives  resistant  in fresh  Samples  functional  As  cloned  f o r 8 hr. i n broth  diluted  further were  E. c o l i  pKK  conditions.  ampicillin resistant  (Fig.  of  of various  non-selective both  vectors.  gels,  from  based  the  not shown).  Thus, a l l  were  out i n the  carried  promoter  stability.  T a b l e 3.  S t a b i l i t y o f Cm  r  phenotype.  % Cm 0 hr.  phenotype 8 hr.  26 h r .  pKK-427B  100  61  0.12  pKK-292Ec  100  72  0.80  82  3.  Characteristics  of chloramphenicol  a c e t y l t r a n s f e r a s e (CAT)  assay.  free  The  assay  CoA  sulfhydryl  acetyl  group  Reaction acid  f o r CAT  takes  to c h l o r a m p h e n i c o l CoA  among o t h e r  products,  at  show t h a t the  (128).  r a n g e o f imput  To  (see M a t e r i a l s and  50  be  to d e v i a t e s l i g h t l y  transferase  activities  the M a t e r i a l s and  CAT  As  rather  than  different to d i s r u p t different  assay  was  to c e l l  media a r e cells  from  i t was  media b r o k e w i t h  b r e a k a g e methods  (136).  the  as u n i t s  5-  CAT  assay  assay high between  acetyl-  protein  grown i n  S o n i c a t i o n was  known t h a t c e l l s  different  of  using  to t o t a l  (135).  a  (as d e f i n e d i n  because c e l l s  size  over  only at very  Chloramphenicol  used  of d i f f e r e n t  free  standard  were p e r f o r m e d  Normalization  number was  volumes  t o the  linearity  were e x p r e s s e d  because  enzyme.  linear  shown i n F i g . 6,  extract.  Methods).  the  measured s p e c t r o p h o t o m e t r i c a l l y  e x t r a c t were added  Methods).  u l of c e l l - f r e e  CAT  of  a molar e q u i v a l e n t of  enzyme i n p u t s ; t h e r e f o r e a l l a s s a y s 5 and  the  enzyme c o n c e n t r a t i o n s , d i f f e r e n t  HB101/pKK-427B c e l l - f r e e  appeared  transfer  of a  with 5 , 5 ' - d i t h i o b i s - 2 - n i t r o b e n z o i c  w h i c h can  nm  the  c a t a l y z e d by  thio-2-nitrobenzoate 412  of the g e n e r a t i o n  group c o i n c i d e n t with  o f the r e d u c e d  yields,  advantage  efficiencies  grown i n using  other  used  20  40 V O L U M E  Fig.  6.  Linearity  60 E X T R A C T  80 { ul  100  }  of c h l o r a m p h e n i c o l a c e t y l t r a n s f e r a s e  assay.  Chloramphenicol a c e t y l t r a n s f e r a s e (CAT) a c t i v i t y was determined as d e s c r i b e d i n the M a t e r i a l s and Methods from d i f f e r e n t volumes of c e l l - f r e e e x t r a c t . E x t r a c t s were prepared from E. c o l i HB101 c a r r y i n g pKK-211B. CAT a c t i v i t y here i s shown as the i n c r e a s e in A ^ 2 P minute. To c o n v e r t t h i s to the u n i t s of CAT a c t i v i t y as d e f i n e d i n the M a t e r i a l s and Methods, the A 4 1 2 i n c r e a s e per minute was d i v i d e d by 13.6 (Ref. 128) and then expressed on a per m i l l i g r a m o f t o t a l p r o t e i n b a s i s . e r  84  4.  Expression  o f E_;_ c o l i  rrnB  promoters at d i f f e r e n t  growth  rates. The or  coli  HB101  pKK-128Ec was  range o f g r o w t h CAT  activity.  activity  due  host  grown i n d i f f e r e n t rates,  As  then  seen  to t r a n s c r i p t i o n  growth r a t e s . (26)  regulated  cells  T h i s was showing  the  expected,  the  upstream  P1  r a t e r e g u l a t e d whereas e x p r e s s i o n o f the overall rate. that  lower As  level  and  a control,  this  d i d not  the  non-ribosomal  results  overall  compared  promoters.  5.  to the  Expression The  in  the  to  13.  showed  rRNA  o f B_;_ s u b t i l i s  results  f o r the  heterologous The the  tandem r r n B P1-P2 steep  positive  P2  rrnB  HB101  assayed  for  specific tandem  rRNA  increasing  promoters  were  Furthermore, pair  was  p r o m o t e r was increasing ( F i g . 9)  show any  e x p r e s s i o n was  a  synthesis in  of t h i s  f o r pKK-Tet  Fig. 8 growth  at  an  growth  indicated  growth  much l o w e r  rate when  p r o m o t e r s i n E_^ c o l i .  EL_ s u b t i l i s  E_^ c o l i  these  i n c r e a s e with  p r o m o t e r d i d not  dependent c h a n g e s and  s l o p e at  manner.  promoter  and  P1-P2  o f rRNA  pKK-351Ec,  to a c h i e v e  o f CAT  E_^ c o l i  positive  i n a growth r a t e dependent  shows t h a t o n l y  level  characteristic  t h a t , as  pKK-292Ec,  media so as  the  from  a steep  either  were h a r v e s t e d  i n F i g . 7,  promoters i n c r e a s e d with  general  carrying  rrnB-CAT f u s i o n s , e x p r e s s e d  host,  promoters  slope with  are  shown i n F i g u r e s  (pKK-427B, F i g .  increasing  10  10)  growth r a t e  '  85  *  «  t  i  i  i  i  0.5 G R O W T H  F i g u r e 7.  i  i  i  i  1  i  1.0 R A T E  ( D O U B L I N G S / H R . }  CAT a c t i v i t y v s . growth r a t e : pKK-292Ec  i n E . c o l i HB101.  Chloramphenicol a c e t y l t r a n s f e r a s e s p e c i f i c a c t i v i t y was measured as a f u n c t i o n o f c e l l u l a r growth r a t e as d e s c r i b e d i n the M a t e r i a l s and Methods. The slope, of t h e . l i n e was determined by l i n e a r r e g r e s s i o n . pKK-292Ec r e p r e s e n t s the tandem P1-P2 E . c o l i rrnB promoter.  F i g u r e 8.  CAT a c t i v i t y v s . growth r a t e : pKK-351Ec, pKK-128Ec i n E . c o l i HB101.  c i r c l e s , E . c o l i rrnB s i n g l e upstream (PI) promoter on pKK-351Ec. t r i a n g l e s , E . c o l i rrnB downstream (P2) promoter on pKK-128Ec. Slopes were determined by l i n e a r r e g r e s s i o n .  0.5  G R O W T H  F i g u r e 9.  1.0  R A T E  ( D O U B L I N G S /  HR.)  CAT a c t i v i t y v s . growth r a t e : pKK-Tet i n E . c o l i HB101.  pKK-Tet r e p r e s e n t s the pBR322 t e t r a c y c l i n e r e s i s t a n c e promoter cloned i n pKK232-8. Slope was d e r i v e d by l i n e a r r e g r e s s i o n .  88  indicative  of a classical  same r e s p o n s e was s e e n  growth r a t e  f o r two o t h e r  pKK-427B i n t h e amount o f 5' and 3' 285B, pKK-211B; F i g . 11 and 12). at  l e a s t beyond  and  -83  relative  beyond +77 r e l a t i v e  growth r a t e  dependent  determined  for  pKK-427B o r pKK-285B.  for it  appeared  that  suggested  I t was n o t e d  The r e a s o n  for  control since  specific  increased  dramatically  rate  6.  range  (see  that but i s  below).  obtained Here  (pKK-220B) was  the l e v e l with  t h e P1 p r o m o t e r  much l e s s a c t i v e  than  i sunclear  P1-P2 p a i r .  dependent  In c o n t r a s t ,  site  the slope of  greater  this  t h e downstream P2 p r o m o t e r  transcriptionally  that  the r e s u l t s  under g r o w t h r a t e  growth r a t e .  sequences  to e l i c i t the  construction  promoters o f the rrnB  activity  that  i n translational efficiency  end o f t h i s  F i g . 13 i l l u s t r a t e s  the separated  f l a n k i n g DNA r e m a i n i n g (pKK-  This  n o t due t o a d i f f e r e n c e 3'  The  w h i c h d i f f e r e d from  f o r pKK-211B was s l i g h t l y  because o f t h e a l t e r e d  response.  t o t h e P1 t r a n s c r i p t i o n s t a r t  response.  line  Finally,  clones  t o P2 were n o t r e q u i r e d  the  probabaly  dependent  o f CAT  increasing  (pKK-282B) was  and c o n s t a n t  over  the growth  tested.  Measurement o f CAT mRNA, mRNA h a l f - l i f e ,  and p l a s m i d  copy  number.  As fusion  mentioned  previously  systems i n g e n e r a l  (see  L i t e r a t u r e Review),  c a n be s u b j e c t  operon  t o a number o f a r t i f a c t s  8  Figure  10.  CAT a c t i v i t y v s . growth r a t e : pKK-427B i n E . c o l i HB101.  Chloramphenicol a c e t y l t r a n s f e r a s e s p e c i f i c a c t i v i t y was measured as b e f o r e and s l o p e s were c a l c u l a t e d by l i n e a r r e g r e s s i o n . pKK-427B r e p r e s e n t s the tandem B . s u b t i l i s rrnB promoters cloned i n pKK232-8.  Figure  11. . C A T . a c t i v i t y v s . growth r a t e : pKK-285B i n E . c o l i HB101.  pKK-285B r e p r e s e n t s the P1-P2 tandem B . s u b t i l i s promoters w i t h 5' f l a n k i n g DNA d e l e t e d .  91  Figure  12.  CAT a c t i v i t y v s . growth r a t e : pKK-211B i n E . c o l i HB101.  pKK-211B r e p r e s e n t s the P1-P2 B . s u b t i l i s promoter w i t h 5' and 3' f l a n k i n g sequences d e l e t e d . •  8  >  4  i  i  i  i  i  0.5 GROWTH  F i g u r e 13.  i  J  I  L  J  I  1.0 RATE  ( D O U B LI N G S / H R.}  CAT a c t i v i t y v s . growth r a t e : i n E . c o l i HB101.  pKK-282B, pKK-220B  The c i r c l e s r e p r e s e n t pKK-220B ( s i n g l e B . s u b t i l i s P2 promoter); t r i a n g l e s r e p r e s e n t pKK-282B ( s i n g l e B . s u b t i l i s P l promoter).  93  which  could  Therefore, the  potentially result several  observed  activity  experiments  growth  rate  The  level  were  dependent  was a n a c c u r a t e  transcriptional  i n erroneous carried increase  reflection  activity  out to ensure i n CAT  that  specific  of the i n vivo  of the cloned  o f CAT m e s s e n g e r  conclusions.  Bacillus  rRNA  RNA was d i r e c t l y  promoters.  measured by  3 hybridization DNA  carrying  insert  were  carrying  o f [ H] u r i d i n e a CAT g e n e  obtained,  t o mRNA  was h y b r i d i z e d  total  that  RNA e x t r a c t e d The r e s u l t s  CAT-specific  dependent  manner  The  o f CAT mRNA  ratio  there  were  changing  and  t o CAT p r o t e i n  probably  activity for  i n excess  cells  grown  and pKK-427B  i n a growth  the growth  (Fig.  rate  a s shown  pKK-427B,  1 0 , 1 1 , a n d 12 t o F i g .  t o measuring  RNA s y n t h e s i s  itself  pKK d e r i v a t i v e s .  nitrocellulose  clone  above.  pKK-285B, and rate  range  15) i n d i c a t i n g  translation  effects  that  with  rate.  addition  hybridized  pKK-211B  over  no d i f f e r e n t i a l  T h e M13  pKK-containing  increased  a s d i d CAT s p e c i f i c  Figs.  growth  ribosomal carrying  mRNA  for  was e s s e n t i a l l y c o n s t a n t  (compare  In  from  M13  o f the cloned  CAT DNA c o m p l e m e n t a r y  different rates.  tested  orientations 14.  at  pKK-211B  Both i nFig.  labelled  show  insert.  RNA t o f i l t e r - b o u n d  a s shown  to  15)  labelled  lambda  This  the rate  was d i r e c t l y  Labelled  t o denatured filters.  CAT mRNA,  phage  of  measured  RNA was e x t r a c t e d ilv5  coli i n strains as b e f o r e  DNA b o u n d t o  carried  a single  copy  of a  94  F i g u r e 14.  C o n s t r u c t i o n and o r i e n t a t i o n o f M13-CAT h y b r i d i z a t i o n probes.  A - 0.7% agarose g e l w i t h 2 i n d i v i d u a l M13-CAT c l o n e s . Lanes 1 and 3, M13-CAT-4; Lanes 2 and 4, M13-CAT-5. Recombinant M13 DNA i s the heavy band near the top o f the g e l . T h i s g e l was b l o t t e d onto n i t r o c e l l u l o s e paper which was then c u t t o s e p a r a t e l a n e s 1 and 2 from l a n e s 3 and 4. B - a u t o r a d i o g r a p h o f Southern b l o t i n F i g . 14A a f t e r h y b r i d i z a t i o n w i t h probe DNA. Probe DNA was prepared by d i g e s t i n g pKK232-8 w i t h EcoRI, l a b e l l i n g t h e 3' r e c e s s e d end w i t h a32P-dATP, r e d i g e s t i n g w i t h H i n d l l l and i s o l a t i n g t h e l a r g e v e c t o r p o r t i o n away from t h e 300 bp E c o R l - H i n d l l l fragment (see F i g . 2 ) . The v e c t o r p o r t i o n and t h e 300 bp E c o R l - H i n d l l l fragment were thus each l a b e l l e d o n l y a t one end. Lanes 1 and 2 were probed w i t h the l a b e l l e d v e c t o r DNA w h i l e l a n e s 3 and 4 were probed w i t h t h e 300 bp fragment. The r e s u l t s i n d i c a t e t h a t M13-CAT-4 and -5 r e p r e s e n t c l o n e s c a r r y i n g the CAT gene i n two d i f f e r e n t o r i e n t a t i o n s w i t h M13-CAT-5 b e i n g i n t h e o r i e n t a t i o n complementary t o CAT mRNA.  F i g u r e 15. Amount o f CAT mRNA v s . growth r a t e . CAT mRNA was measured by f i l t e r h y b r i d i z a t i o n t o s i n g l e s t r a n d e d M13-CAT-5 DNA. The amount o f CAT mRNA i s expressed as a percentage of the t o t a l i n p u t r a d i o a c t i v i t y which bound t o CAT DNA f i l t e r s , a f t e r c o r r e c t i o n f o r background. The c i r c l e s r e p r e s e n t v a l u e s o b t a i n e d f o r pKK-427B and the squares a r e v a l u e s f o r pKK-21lB. The s l o p e o f the l i n e was o b t a i n e d by l i n e a r r e g r e s s i o n .  96  complete (Fig.  E. c o l i  16) i n d i c a t e s  increased these  rRNA  transcriptional unit  that,  as e x p e c t e d ,  w i t h growth r a t e  cells  of multicopy  p r o m o t e r s was n o t d i s r u p t i v e cellular  had a l s o  changed  (138).  increase  with  transcription appear  being  [  with  l e s s that  was o b t a i n e d  CAT mRNA f o l l o w i n g  by m o n i t o r i n g  The  results i nFig.  had  a chemical h a l f - l i f e  more l a b i l e  18 i n d i c a t e  an i n c r e a s e i n f o r the  and f u n c t i o n a l  total  rates. cellular  times a f t e r i n h i b i t i o n o f i n F i g . 17 t h e r e o f decay  d i d not  o f CAT mRNA  i n both  estimate  conditions  o f CAT mRNA  the decay o f h y b r i d i z a b l e  that  t h e CAT mRNA f r o m  of approximately  under  rate  o f t r a n s c r i p t i o n by r i f a m p i c i n .  and 30 s e c . i n f a s t e r g r o w i n g  slightly  growth  that  half-lives  A more a c c u r a t e  inhibition  regulation.  and low g r o w t h  i n the rate  with  or to the  o f some  by l a b e l l i n g  As s e e n  difference  2 min.  a t high  at various  rifampicin.  and low g r o w t h r a t e s ,  half-life  cells  dependent  was r e s p o n s i b l e  was a s s e s s e d  S]methionine  t o be a l a r g e  at high  synthesis  the p o s s i b i l i t y  o f CAT mRNA was measured  functional h a l f - l i f e 35  protein  i s o l a t e d rRNA  as c e l l u l a r  growth r a t e s  synthesis  the presence i n  i n CAT message seen a b o v e , t h e c h e m i c a l  half-life The  at high  The r e s u l t  o f rRNA  the h a l f - l i v e s  vary g r e a t l y  To e l i m i n a t e  mRNA s t a b i l i t y  carrying  growth r a t e  been shown t h a t  messenger RNA's c o u l d  that  t o o v e r a l l rRNA  mechanisms g o v e r n i n g  It  the r a t e  and s u g g e s t e d  plasmids  (137).  43 s e c . i n slow  cells.  f a s t e r growth  pKK-427B growing  Thus, CAT-mRNA was  conditions  suggesting  97  Figure  16.  Measurement  o f t o t a l r i b o s o m a l RNA v s . growth r a t e .  E . c o l i HBl01/pKK-427B was grown w i t h a growth r a t e of 1.1 d o u b l i n g s per h r . T o t a l r a d i o l a b e l l e d RNA was e x t r a c t e d and h y b r i d i z e d to f i l t e r bound lambda i l v 5 DNA under c o n d i t i o n s of DNA excess. The amount o f rRNA i s expressed as a percentage o f the t o t a l input r a d i o a c t i v i t y which bound to lambda i l v 5 f i l t e r s , a f t e r c o r r e c t i o n f o r background. The s l o p e o f the l i n e was determined by l i n e a r regression.  98  Figure  17.  Determination o f CAT mRNA f u n c t i o n a l CAT p r o t e i n a n a l y s i s .  half-life:  Top - T o t a l c e l l u l a r p r o t e i n e l e c t r o p h o r e s e d through a 12-20% SDS-polyacrylamide g r a d i e n t g e l and s t a i n e d w i t h Coomassie B r i l l i a n t Blue R. Lane 1, E . c o l i HB101/pKK-427B grown as a s t a t i o n a r y o v e r n i g h t c u l t u r e ; Lane 2, E . c o l i HB101/pKK-427B grown under a e r a t i o n and h a r v e s t e d when i n l o g a r i t h m i c growth ( A = 0.6); Lane 3, E . c o l i HB 10l/pKK232-8, s t a t i o n a r y o v e r n i g h t c u l t u r e ; Lane 4, E . c o l i HB101/pKK232-8, l o g a r i t h m i c c u l t u r e ; Lane 5, s t a n d a r d m o l e c u l a r weight markers. S i z e s are noted a t r i g h t , i n k i l o d a l t o n s . The p o s i t i o n o f t h e CAT p r o t e i n i n the s t r a i n s c a r r y i n g promoter-CAT f u s i o n s (Lanes 1 and 2) i s i n d i c a t e d by the l a r g e arrow. Note that s t r a i n s c a r r y i n g plasmids without a promoter i n s e r t (Lanes 3 and 4) do n o t show d e t e c t a b l e CAT p r o t e i n . 6  6  q  Bottom - Time course o f f u n c t i o n a l messenger RNA decay a f t e r a r r e s t of t r a n s c r i p t i o n . E . c o l i HB101 c a r r y i n g pKK-427B was grown a t two d i f f e r e n t r a t e s and t o t a l c e l l u l a r p r o t e i n s were r a d i o l a b e l l e d a t v a r i o u s times a f t e r t r a n s c r i p t i o n was i n h i b i t e d by r i f a m p i c i n (see M a t e r i a l s and Methods). P r o t e i n s were e l e c t r o p h o r e s e d through an 18% SDS-polyacrylamide g e l and a u t o r a d i o g r a p h e d . A, f a s t growth c o n d i t i o n s (1.1 d o u b l i n g s p e r h r . ) . Lane 1, E . c o l i HB101/pKK232-8 (negative c o n t r o l ) ; Lane 2, E . c o l i HB101/ pKK427B, 0 s e c . a f t e r r i f a m p i c i n a d d i t i o n ; Lanes 3 - 6 , 2,4,7, 10 min. a f t e r r i f a m p i c i n a d d i t i o n , r e s p e c t i v e l y . B, slow growth c o n d i t i o n s (0.50 d o u b l i n g s per h r . ) . Lane 1, E . c o l i HB101/pKK-427B, • 0 s e c . a f t e r r i f a m p i c i n a d d i t i o n ; Lanes 2 - 5, 2,4,7, and 10 min. a f t e r r i f a m p i c i n a d d i t i o n ; Lane 6, E . c o l i HBl01/pKK232-8 ( n e g a t i v e c o n t r o l ) . Note that under both f a s t and slow growth c o n d i t i o n s , v e r y l i t t l e CAT p r o t e i n i s s y n t h e s i z e d beyond 2 min. a f t e r i n h i b i t i o n o f mRNA t r a n s c r i p t i o n .  1  2 3  4  5  100  that  the  data  i n F i g . 10  rate  dependent response of  Finally, possibility varying was  extreme  growth r a t e  considered.  strengths plasmid  of  inserted  example o f s u c h the  (standard at  139).  per  unit  clones  a l l concentrations,  required  to  the  r e s u l t s f o r pKK-427B  while  was  a slight  plasmid  DNA  to account activity similar  as  increase  shown e a r l i e r . r e s u l t s (data  Discussion  increased,  not  protein  shown).  the was  hybridization  assay. 19A.  a known i n p u t  of  to  of  a l l available  this  indicate  i n the was  DNA  relationship  amount  ( F i g . 20)  s e e n i n CAT  Measurements  of  the  hybridization reaction  o v e r a l l increase  growth r a t e  f o r the  the  to h y b r i d i z e  The  and  i s shown i n F i g . from  with  response  affect  estimate  cellular  a dot-blot  bound DNA. there  dependent  an  the  copy number  gave a s t r a i g h t l i n e  added  (131),  growth c o n d i t i o n s  total  i n d i c a t i n g that  growth  promoters.  significantly  minute o b t a i n e d  p r o b e DNA that  of  the  plasmid  Therefore,  using  c u r v e - F i g . 19B)  excess of  that  a h y b r i d i z a t i o n assay  c o u n t s per  radiolabelled in  i s a multicopy  promoters could  DNA  rrnB  mimic a g r o w t h r a t e  (124,  for several  Plotting  B_j_ s u b t i l i s  O t h e r s have f o u n d  amount o f p l a s m i d  An  the  to u n d e r e s t i m a t e  f l u c t u a t i o n i n plasmid  could  copy number  obtained  tend  pKK232-8  since  that  may  amount  not  large  was  filterthat of enough  mRNA or  CAT  specific  for other  pKK  clones  gave  F i g u r e 18. Chemical h a l f - l i f e o f CAT mRNA v s . growth r a t e . The chemical h a l f - l i f e o f CAT mRNA was measured by h y b r i d i z a t i o n to f i l t e r bound M13-CAT-5 DNA as d e s c r i b e d i n t h e M a t e r i a l s and Methods. The r e s u l t s are expressed as the percentage o f t o t a l input r a d i o a c t i v i t y which bound t o CAT DNA f i l t e r s a t d i f f e r e n t times a f t e r i n h i b i t i o n o f t r a n s c r i p t i o n by r i f a m p i c i n . Values are f o r pKK-427B. The c l o s e d squares ( s o l i d l i n e ) r e p r e s e n t c e l l s grown a t f a s t r a t e s (0.97 d o u b l i n g s per h r . ) . The open squares (dashed l i n e ) r e p r e s e n t slower growing c e l l s (0.55 doublings per h r . ) . The c a l c u l a t e d mRNA h a l f - l i v e s a r e 30 s e c . and 43 s e c , r e s p e c t i v e l y .  102  Figure  19.  P l a s m i d copy number d e t e r m i n a t i o n by hybridization analysis.  dot-blot  A - Crude c e l l - f r e e e x t r a c t s o f E. c o l i HB101 c a r r y i n g v a r i o u s pKK d e r i v a t i v e s were b l o t t e d onto n i t r o c e l l u l o s e paper u s i n g a dot-blot apparatus. I n row A, a volume o f e x t r a c t e q u i v a l e n t to 10 ug o f t o t a l p r o t e i n was used i n each case. Each spot r e p r e s e n t s a d i f f e r e n t sample o f c e l l - f r e e e x t r a c t , d e r i v e d from c e l l s grown a t d i f f e r e n t r a t e s , and a r e shown f o r i l l u s t r a t i v e purposes o n l y . In row B, d i f f e r e n t amounts o f p u r i f i e d pKK232-8 DNA were b l o t t e d . Row B Lane 1, 0 ng; Lane 2, 0.1 ng; Lane 3, 0.2 ng; Lane 4, 0.4 ng; Lane 5, 0.6 ng; Lane 6, 0.8 ng; Lane 7, 1.0 ng; Lane 8, 1.2 ng; Lane 9, 1.4 ng; Lane 10, 0 ng. The f i l t e r was h y b r i d i z e d t o an excess of l a b e l l e d pKK232-8 DNA and autoradiographed. B - Standard p l a s m i d curve. I n d i v i d u a l dots c o r r e s p o n d i n g t o row B, Lanes 1 t o 9 were punched out and counted f o r Cherenkov r a d i a t i o n . Counts p e r minute a r e p l o t t e d v e r s u s the amount o f pKK232-8 DNA loaded per l a n e . The s t r a i g h t l i n e r e l a t i o n s h i p i n d i c a t e d t h a t the probe DNA was i n excess.  0 3  .10  .05  .01 J  1  1  I  0.5 G R O W T H  F i g u r e 20.  I  i  i 1  R A T E  i  i  i  i  0  ( D O U B L I N G S / H R . )  Amount o f plasmid DNA v s . growth  rate.  Values a r e f o r pKK-427B. The r e s u l t s were i n t e r p o l a t e d from the s t a n d a r d plasmid DNA curve shown i n F i g . 19B. R e s u l t s a r e expressed as the amount o f plasmid DNA per microgram o f t o t a l p r o t e i n i n the c e l l - f r e e e x t r a c t .  105  In for  this  the  initiate  section  3ubtllis  coli  rRNA p r o m o t e r s of r e g u l a t i o n discerned.  demonstrated  of a fused  host.  When compared  both d i f f e r e n c e s as a f u n c t i o n  of i n t e r e s t  directed  analysis  of a variety  were d i f f i c u l t In  assayed.  This  be d i r e c t l y  hybridization  but t h i s  measure o n l y g l o b a l from a g i v e n alternative part  approach  this  constructed.  this  system)  that the  of a fused,  i n the  t h e rRNA p r o d u c t  could  by RNA-DNA  be t i m e - c o n s u m i n g  rather  As w i l l  and would  than the e x p r e s s i o n be d i s c u s s e d rRNA  below, t h e  p r o m o t e r s as  i s b o t h a c o n v e n i e n t and v a l i d  problem.  work, two a n a l o g o u s In the f i r s t ,  as t h e i n d i v i d u a l  such  (see r e f . 6 7 f o r review).  ( i . e . the study o f cloned  fusion  means o f a d d r e s s i n g  would  operon.  c o u l d be  whose n a t i v e gene p r o d u c t s  i n Bacillus  rRNA s y n t h e s i s  individual  o f an o p e r o n  In  approach  rate  has proven v a l u a b l e  to assay  measured  i n the pattern  be e a s i l y and  approach  t h e c a s e o f r i b o s o m a l RNA o p e r o n s ,  potentially  systems  the t r a n s c r i p t i o n  or inconvenient  E_^ c o l i  taken here i n v o l v e d the  fusion  o f promoters  ina  to the n a t i v e  o f c h a n g i n g growth  p r o m o t e r l e s s gene whose p r o d u c t c o u l d quantitatively  can e f f i c i e n t l y  and s i m i l a r i t i e s  of t r a n s c r i p t i o n a l  the promoters  gene when p l a c e d  The e x p e r i m e n t a l a p p r o a c h  construction  that  r r n B r i b o s o m a l RNA o p e r o n  transcription  heterologous  promoter  i t has been  sets  t h e tandem  o f promoter  fusions  (P1-P2) p r o m o t e r s ,  s e p a r a t e d P1 and P2 p r o m o t e r s  from  the  were as w e l l coli  106  rrnB in  o p e r o n were c l o n e d  the second,  subtilis was  rrnB  chosen  the  into  P 1 - P 2 ,  and  P 1 ,  promoters  P2  o p e r o n were s i m i l a r l y  cloned.  f o r a number o f r e a s o n s .  constructed  to f a c i l i t a t e  v e c t o r pKK232-8, and  the e x p r e s s i o n  from t h e B.  The v e c t o r  I t was  specifically  the c l o n i n g o f unusually  strong  p r o m o t e r s by i n c o r p o r a t i n g e f f i c i e n t  transcription  signals  Thus, t h e s t a b i l i t y  3'  normally  to the fused  gene  a s s o c i a t e d with  be  overcome.  be  easily  attempts  Furthermore,  detected  acetyltransferase  (131).  the presence  by a c t i v a t i o n gene and t h i s  rRNA  enzyme c o u l d  all  to ensure maintenance of the cloned  pKK232-8  addition,  selective  t h e g r o w t h media w i t h  rrnB  insert  selective  stability  Regulation  o f E_;_ c o l i  When c e l l s  c a r r y i n g t h e E_^ c o l i  grown a t d i f f e r e n t  by t h e c o n s t i t u t i v e  promoter was e s s e n t i a l l y  could  could  be p l a c e d on  p r o m o t e r s i m p l y by Using  fragments d e r i v e d  from  cloned. In  were e l i m i n a t e d as l o n g  was  maintained.  promoters.  r a t e s , the l e v e l  growth r a t e dependent manner.  promoters  chloramphenicol.  pressure  rrnB  should  be q u a n t i t i v e l y  o p e r o n have been s u c c e s s f u l l y  problems with  as c h l o r a m p h e n i c o l  directed  pressure  t h e r e f o r e , a number o f p r o m o t e r  the B . s u b t i l i s  problems  of the chloramphenicol  Finally,  supplementing  termination  promoters  of cloned  assayed. cells  direct  to clone  pKK232-8  rrnB  - CAT f u s i o n s were  o f CAT enzyme i n c r e a s e d  Conversely,  CAT gene  tetracycline-resistance  constant  ina  expression gene  a t a l l growth r a t e s .  107  Furthermore, when the  the  tandem r r n B  promoter, was the  P1  fused  rRNA, as  the  the  f o r the  P2  rrnB  although  at  slow  f o r the  variance  with  that  the  was  at  higher  containing  fusion  reported  a low P1  that  of  fusion  alone  o f 0.5  fusion  at  the  the  P1  of  no  P2  synthesis  markedly  overall  that  during  of  7 3 ,7 4 ) .  (31,  remains  suggested  by  data  change  as  unclear, i t could  be  conditions  of  slope  shown h e r e a p p e a r  Gourse  than  e^  f o r the  o f the  P1-P2  alone.  activity  doublings  A comparison  activity  per  h r . was  same g r o w t h r a t e .  of  the  about At  high  They  of  a  therefore  construct In  the  to be  and  the  slope  not  as  presented  v s . growth r a t e p l o t than  the  slope  of F i g u r e s P1-P2  P2  construct  was  data  at  have  b o t h P1  activity  rate;  (pKK-292Ec) i s g r e a t e r  the  a_l. ( 3 1 ) .  containing  the  same g r o w t h  construct  (pKK-351Ec).  the  the  growth r a t e at  example, shows t h a t rate  role  of a c o n s t r u c t  v s . growth r a t e  here however, the P1-P2  exact  i n d i c a t e that  hand, showed with  P1  solely  iri vivo  o f rRNA s y n t h e s i s  some o f  activity  only  of a c t i v i t y  the  other  only  growth.  shown t h a t  as  The  t o be  a number o f w o r k e r s the  seen  s i n g l e upstream results  appears  a l l growth r a t e s  bulk  Interestingly,  steep  operon  These  e_t a_l. ( 7 4 ) have  Sarmientos  responsible  gene.  the  growth r a t e d e p e n d e n t  growth r a t e i n c r e a s e d .  very  CAT  p r o m o t e r on  expression  r e s p o n s e was  promoters or  shown p r e v i o u s l y by  downstream  reduced  P1-P2  to  promoter of  responsible  The  growth r a t e dependent  of  7 and  for  the  P1  8 for  f u s i o n at a growth  one-half  that  growth r a t e s  of  the  P1  however,  108  the  situation  less  activity  in  i . e . the a d d i t i o n  F i g . 8 gives a level  The Gourse  reason  expression  comparable  f o r t h e d i s c r e p a n c y between  In t h e i r  although  study,  that  used  were based  on m u l t i c o p y  it  copy  has been shown h e r e  significantly differences  validity report  between t h e s e  o f the data  mRNA h a l f - l i f e  at d i f f e r e n t system.  from  based  from  rrnE;  although  there  while  exist  i s no  the f u s i o n s  Gourse e_t a l .  on lambda phage.  Although  copy number d i d n o t v a r y  (see b e l o w ) t h e r e may be o t h e r  two s y s t e m s w h i c h  I t i sdifficult  influence  to f u l l y  did not  changes o r mRNA t r a n s l a t i o n a l their  how c l o n e d  assess the  o f Gourse et_ a_l. s i n c e t h e y  growth r a t e s from  t h e E_^ c o l i  Alternatively,  plasmids  plasmid  w i t h growth r a t e  genes a r e e x p r e s s e d .  i s so.  lysogens that  and t h a t o f  there are s e v e r a l  rRNA o p e r o n s i n E_;_ c o l i , this  data  subtle regulatory differences  to suggest  single  these  Gourse et_ §_1. compared t h e  precedent  constructed  t o be  f o r P1-P2 i n F i g .  seen  P1 and P2 p r o m o t e r s  t h e r e f o r e that  between t h e seven  here  at high  t o t h e P2 a c t i v i t y  o f t h e tandem P 1 - P 2 p r o m o t e r s  to that  i spossible  to that  slightly  rates.  o f the i s o l a t e d  r r n B operon  In f a c t ,  o f t h e P1 a c t i v i t y  e_t al. (31) i s n o t c l e a r  possibilities.  giving  o f P1 and P2 a p p e a r e d  the a c t i v i t i e s  7 a t high growth  it  t h e tandem P 1 - P 2 f u s i o n .  than  growth r a t e s , additive,  t h e P1 f u s i o n  was r e v e r s e d , w i t h  lambda-based  efficiencies  expression  109  The E.  coli  data  presented  P l promoter  here  imply  i s inhibited  p r e s e n c e o f t h e P2 p r o m o t e r  that  a t low g r o w t h r a t e s  i n t h e tandem  When t h e two p r o m o t e r s were s e p a r a t e d , released rates.  and e x p r e s s i o n At h i g h  this  From  very  P2 p r o m o t e r  inhibiting promoter the  little  t r a n s c r i p t i o n from  growth r a t e s expression (74) P2  that  conditions  maximal s y n t h e s i s  cells  regulation, since  rate  a t low  therefore  t o i t ) would  P2.  level  s i g n a l t h e need  i n a growth r a t e  o f P1 p l u s  a basal  o f P1 c o u l d  a c t by  regulated  o f rRNA  f o r more rRNA  be r e l e a s e d  dependent i s achieved  synthesis.  and rRNA  manner u n t i l  could  at high  by t h e combined  The f i n d i n g o f S a r m i e n t o s and C a s h e l  recovering  from  transcriptional activity  expression  i s required;  effects  a t t h e same time d i r e c t i n g t r a n s c r i p t i o n o f  the i n h i b i t i o n  synthesized  growth  inhibitory  the major growth  rRNA genes so as t o m a i n t a i n  When e n v i r o n m e n t a l  be  synthesis  o f P1 was  a t lower  o f g l o b a l rRNA  (or sequences i n p r o x i m i t y  (Pl) while  synthesis,  2-fold  seem t o be a d v a n t a g e o u s  rRNA  by t h e  the i n h i b i t i o n  about  the p e r s p e c t i v e  of the  P1-P2 a r r a n g e m e n t .  however, no s u c h  t y p e o f mechanism would  growth r a t e s the  increased  growth r a t e s  were o b s e r v e d .  the expression  s t a t i o n a r y phase show a b u r s t o f  followed  by a s l o w e r i n c r e a s e  does n o t n e c e s s a r i l y c o n t r a d i c t t h i s  i n P1  model s i n c e t h e  above d i s c u s s i o n i 3 based  on s l o w l y  cells,  o f a c u l t u r e i n s t a t i o n a r y phase i s a t  best for  and t h e p h y s i o l o g y  only  poorly  the cloned  understood.  B_j_ s u b t i l i s  growing, not s t a t i o n a r y  I n t e r e s t i n g l y , the r e s u l t s  rRNA p r o m o t e r s  showed  obtained  a similar  110  overall  trend  although  t o t h a t seen  the r e l a t i v e  f o r t h e E_^ c o l i  roles  rRNA  promoters,  o f P1 v s . P2 were r e v e r s e d ( s e e  below).  Regulation  o f B_;_ s u b t i l i s  rrnB  A 1 . 9 Kb f r a g m e n t d e r i v e d subtilis based as  rrnB  vector.  Although  transcription  phenotype c o u l d expression  from t h e 5 '  o p e r o n was i n i t i a l l y  expression  to d i r e c t  into  be d e t e c t e d .  i s not c l e a r ,  within  the p r e s e n c e  analogy, coli  rrnB  their  That fragment  16S rRNA  normal w i l d - t y p e  t h e B_;_ s u b t i l i s are s t i l l  who used  templates and  coding  terminators  shown by V. Webb 1986)  pKM-1, a g a l K -  gene, no o b v i o u s  galK  f o r the l a c k of galK  t h a t t h e B_^ s u b t i l i s i n this  transcription  sequence p r e s e n t  host,  i t could  termination  on t h i s  rrnB  sites  fragment.  By  L i e_t a_l. (44) have shown t h a t s e q u e n c e s w i t h i n t h e E .  transcription to  active  into  f r a g m e n t was o r i e n t e d so  the galK  b u t , assuming  of l a t e n t  t h e 16S RNA c o d i n g  this  coli.  end o f t h e B.  cloned  The r e a s o n  promoters a r e t r a n s c r i p t i o n a l l y reflect  promoters i n L  i f cloned  such  t h a t they  p r o m o t e r s on t h i s by B a c i l l u s  (Ph.D. t h e s i s ,  cloned  1 . 9 Kb  RNA p o l y m e r a s e  University of B r i t i s h  pHD1.8 as w e l l as t h e s e p a r a t e d  of this  are i n reverse  orientation.  recognized  f o r in v i t r o  transfer  r e g i o n can a c t as e f f i c i e n t  transcription  p o r t i o n o f t h e B^ s u b t i l i s  Columbia,  promoter  reactions.  Thus, rrnB  has been  c l o n e s as the c l o n i n g  operon t o  Ill  h a 3 probably  E. c o l i are  no  longer  Using  cloned these  the  P1  In two  other  was  clones by  promoter remained promoter c l o n e s  transcribed  that  the  consistent  pHD1.8 as  start  Bal-31  fragments  and  site  i n one  In  the  of  the  CAT  i t can  population  CAT  o f DNA  be  c a r r y a f u n c t i o n a l and  upstream  downstream the  three  of  of  P2.  5' f l a n k i n g  these  mRNA t r a n s c r i p t  stability here  of  not  i n the  intact  effect  should  be  influence Finally,  the as  subtilis presence  expression  here  have  the  t h o u g h , any  c o n t a i n i n g B_^  other  (only  the  gene e x p r e s s i o n  assumed  of  f l a n k i n g sequences  s t a b l e i n E_^ c o l i  reasonably  and  largest  constructions.  Unlike  DNA  a f u n c t i o n a l P2  r e g i o n o f an  f u s i o n plasmids  pressure.  selective  bp bp  o p e r o n f u s i o n s and  a direct  they  restriction  only  studies discussed  t o be  the  1  of  Alterations within  might have on  i n three  3,  The  114  been shown to i n f l u e n c e t h e  promoters appeared  129)  case  same 3  c o m p a r i s o n s drawn between v a r i o u s  (67,  and  Furthermore,  the  that  were i s o l a t e d  r e t a i n e d 220  d i g e s t i o n or by  (pKK-220B).  region  seen i n T a b l e  a source  v e c t o r , pKK232-8.  non-translated  (138). 3'  on  pKK-282B d i d n o t ) .  some c a s e s  such  subtilis.  promoter  maintained  but  promoters  (pKK-285B, pKK-211B), much o f  treatment  PKK-211B and  the  (pKK-U2?B) s t i l l  removed  message  rrnB  transcriptional  endonuclease  in  insert  expression  fragments  o f the  DNA  cloned  smaller  onto  altered  f u n c t i o n a l i n B_;_  the  fragments,  not  systems  that a l l c e l l s promoter  of  in  insert  as  112  long  as c h l o r a m p h e n i c o l  The into  fact  that  pKK232-8  s e l e c t i o n i s maintained.  B_^ s u b t i l i s  rRNA p r o m o t e r s c o u l d  by s e l e c t i n g f o r t h e  chloramphenicol-resistance  phenotype i n d i c a t e s  that  these  active  This  i s not unexpected  of  in  coli.  t h e DNA s e q u e n c e  strong (Fig.  homology t o t h e c o n s e n s u s  were t e s t e d steep  in  increase  classical  as a f u n c t i o n  i n CAT s p e c i f i c  growth r a t e  plasmid  fusion  performed increase in  system  such  since  was measured  vivo  RNA p r o d u c t .  t o ensure  that  i n CAT s p e c i f i c  reveals a  coli  promoters  (P1-P2) - CAT f u s i o n s  (Figs. 10, 11, 1 2 ) .  as used  here r e p r e s e n t s i n  the t r a n s l a t i o n product  whereas i n t h e n a t i v e  Therefore  the observed activity  transcriptional activity  regions  for  expression  system  an e x a m i n a t i o n  was s e e n , i n d i c a t i v e o f  rRNA o p e r o n e x i s t s as a s i n g l e copy  a non-translated  since  o f i n c r e a s i n g growth r a t e , a  activity  dependent  some ways an a r t i f i c i a l a multicopy  sequence  When t h e B. s u b t i l i s  coli  However, an o p e r o n  given  promoters a r e t r a n s c r i p t i o n a l l y  o f t h e P1 and P2 p r o m o t e r  3B, r e f . 1 7 ) .  be c l o n e d  from  s t a t e any  p e r genome and p r o d u c e s several  growth r a t e  was a t r u e  experiments dependent  reflection  o f the cloned  were  of the  B_^ s u b t i l i s  promoters.  Firstly, accurately  to ensure  that  t h e amount o f CAT enzyme  r e f l e c t e d the degree o f s y n t h e s i s  amount o f CAT mRNA was measured rates  directly  by h y b r i d i z a t i o n t o a C A T - s p e c i f i c  produced  o f CAT mRNA, t h e  a t d i f f e r e n t growth probe.  The r e s u l t s f o r  113  three  clones,  pKK-427B, pKK-285B, and pKK-211B, showed  CAT mRNA a p p r o x i m a t e l y as  a function  Fig.  15).  o f growth r a t e  differences  It  examples would  3'  was t h e r e f o r e  shown  indirect,  criptional  imply  means  i n cells  to l i m i t  synthesis  since  measured  16).  coll  This  i n general,  would  rRNA  i n d i c a t e that  to e l i c i t  titrated  o u t by t h e i n c r e a s e d  Secondly,  into  t h e growth r a t e  pKK232-8.  number  different half-lives  rates  The f u n c t i o n a l h a l f - l i f e  were a p p a r e n t  between  implying  the h a l f - l i f e  that  fast  cloned  dependent  of total  rRNA,  carrying a pattern ( F i g .  f a c t o r s that  may be  response a r e n o t  some mRNA's have  at different c e l l u l a r  growth  o f CAT mRNA was t h e r e f o r e  t h e amount o f C A T - p r o t e i n  pKK-427B a f t e r mRNA s y n t h e s i s  of a  o f rRNA p r o m o t e r s p e r c e l l .  i t h a s been shown t h a t  by e x a m i n i n g  copies  the expected  dependent  activity  the t r a n s -  the growth r a t e  any a n c i l l a r y  significantly (138).  p o s s i b l y be  fragment.  the synthesis  operon, followed  required  assessed  cloned  by h y b r i d i z a t i o n t o a lambda p r o b e  complete  were no g r e a t  which c o u l d  of multiple  rRNA p r o m o t e r does n o t a p p e a r o f rRNA  there  of assessing  o f promoters cloned  the presence  10, 11, and 12 t o  measurements o f CAT s p e c i f i c  i sa valid  activity  Furthermore,  as  that  end o f t h e pKK-211B that  i n CAT p r o t e i n  r a t i o s o f CAT p r o t e i n t o  i n translational efficiency  to the a l t e r e d  although  (compare F i g s .  The e s s e n t i a l l y c o n s t a n t  CAT mRNA i n t h e s e  due  p a r a l l e l e d the increase  that  synthesized  had been i n h i b i t e d .  and slow g r o w i n g  cells  from  No d i f f e r e n c e s (Fig.  o f CAT mRNA was s i m i l a r  17),  ( l e s s than 2  114  min.)  and t h a t  the t r a n s l a t i o n a l e f f i c i e n c y  mRNA was n o t a l t e r e d because o f d i f f e r e n c e s more a c c u r a t e obtained that  estimate  o f t h e pKK-427B CAT i n growth r a t e .  o f t h e CAT mRNA c h e m i c a l  by h y b r i d i z a t i o n a n a l y s i s  h a l f - l i f e was  ( F i g . 18) and i t was f o u n d  t h e CAT message from pKK-427B was i n f a c t  stable  a t higher  specific greater  activity at higher  growth r a t e  constructions  139).  The  itself  plasmid  copy number  grown a t d i f f e r e n t r a t e s  that  has been e s t i m a t e d  while  affect this  plasmid  and s t r e n g t h s o f parameter  copy number does  i s only  a slight  i s n o t enough t o a c c o u n t  o r CAT mRNA s e e n  since  (124,  change  increase at f o r the l a r g e  f o r t h e growth  rate  constructions. fact  that  pKK-427B was shown b o t h  and CAT mRNA t o be g r o w t h r a t e supports  synthesis  of the various  t h a t growth c o n d i t i o n s  the o v e r a l l trend  i n CAT p r o t e i n  regulated  accentuating  response.  g r o w t h r a t e s , which  protein  thereby  promoters can s i g n i f i c a n t l y  increase  t h e CAT  the apparent  the r e l a t i v e  with growth r a t e ,  that  growth r a t e ,  I t was f o u n d  higher  suggests  less  be even  w o r k e r s have f o u n d  inserted  This  slightly  as seen i n F i g . 10 may i n r e a l i t y  dependent  Finally,  other  growth r a t e s .  A  the suggestion  i n B a c i l l u s and  that  coli  by a s s a y  regulated  o f CAT  i n E_;_ c o l i i n  t h e o v e r a l l c o n t r o l o f rRNA  i s s i m i l a r (109),  since the  features  w h i c h g o v e r n growth r a t e d e p e n d e n c y , e i t h e r a t t h e DNA  sequence  level  o r any r e q u i r e d  ancillary  f a c t o r s , appear  t o be  115  compatible basic  i n both organisms.  regulatory  level  reason  (compare  for this  the DNA  coli  regions well,  P2  activity  It  promoter  P1  or P2  promoters  between t h e -10  and  reflect  -35  and  -35  i s clear  that  of expression  there  promoters  at  the least coli  7).  The  differences in  The  -35  region  of  i s more homologous t o  coli  analogous  rrnB operon.  As  seem t o have a more o p t i m a l regions.  Whether  a greater  promoters  are a l s o  clones  differences  overall  11,  pKK-211B r e a c h h i g h e r maximum l e v e l s  i n the  o f growth  carrying  ( F i g . 10,  these level  of  i s unknown.  (but not i n the t r e n d  a r e compared  highly  was  (17) t h a n a r e t h e  a l o n e a r e enough t o c o n f e r  upon the B_;_ s u b t i l i s  subtle  regions.  the  key  f o r the analogous  for instance,  from  of such  pKK-292Ec, F i g . 10 and  "consensus" sequence  d e p e n d e n c y ) when t h e t h r e e P1-P2  and  the  Interestingly,  rRNA p r o m o t e r s  seen  but may  o f t h e -10  of either  differences  level  pKK-427B and  t h e B_^ s u b t i l i s  spacing  than t h a t  that  apparatus are  standpoint.  the B a c i l l u s  i s unclear  sequence  the B_j_ s u b t i l i s the  from  i f not g r e a t e r  promoters  translational  from an e v o l u t i o n a r y  of a c t i v i t y  as h i g h ,  therefore  mechanisms g o v e r n i n g t h e s y n t h e s i s  components o f the c e l l u l a r conserved  It i s likely  overall  rate  t h e B_j_ s u b t i l i s 12).  Both  of a c t i v i t y  tandem  pKK-285B than  does  116  pKK-427B.  The pKK-211B c o n s t r u c t i o n was d e l e t e d  t o t h e tandem p r o m o t e r s ,  so t h e argument  alteration  o f the 3  1  efficiency  of t h i s  CAT mRNA s u c h  activities  are seen.  same 3'  end c o u l d  Here a g a i n ,  absolute  implying  that  deletion  that occurred  reason  exists found  rich  this  effect  for this  that  these  in  5  pKK-211B.  was  i s p r e s e n t l y unknown a l t h o u g h  the  to the  1  seen,  due t o t h e e x t e n s i v e  f a r upstream  5'  clones.  the p o s s i b i l i t y  sequences.  region  between -51 and -88 r e l a t i v e site  rRNA p r o m o t e r s , i t has been shown t h a t  c a n enhance t h e o v e r a l l  transcriptional  as 1 5 - f o l d  removed  coli  possess  o f some  t o t h e P1 level  transcription  of t r a n s c r i p t i o n  rrnB  s t a b l e RNA  genes  promoters,  this  ( i n pKK-211B) w i t h o u t  these  an A-T  (31). S i m i l a r upstream a c t i v a t i o n  f o r other  activity.  fragments c o n t a i n i n g  indicative  maintained  than  of a c t i v i t y  coli  be c o m p l e t e l y  from  level  was o n l y  t h e c a s e o f t h e Bk_ s u b t i l i s  DNA  deleted  enzyme  between pKK-427B and t h e o t h e r  s e q u e n c e s have been n o t e d  can  specific  l e s s e r extent  For  from P1 by as much  In  that higher  some, as y e t u n i d e n t i f i e d , r e g u l a t o r y r e g i o n s a r e  within  initiation  be made t h a t t h e  However, the pKK-285B c l o n e  to a s l i g h t l y  a higher  3'  5' and  p o s s i b l y change t h e t r a n s l a t i o n a l  sequence as pKK-427B and was o n l y  promoter, although  The  could  both  (30, 3 2 ) . region  any d e c r e a s e  O t h e r w o r k e r s have n o t e d upstream  that  a c t i v a t i o n elements  anomolous e l e c t r o p h o r e t i c m o b i l i t i e s  conformational  change i n t h e DNA  brought  about  117  by t h e DNA  sequence  B. s u b t i l i s upstream altered  but  r r n B DNA  mobilities  t o have  o f rRNA p r o m o t e r s  topological  region  normal  i n polyacrylamide  features  n o t i n B_^ s u b t i l i s  rich  (30, 3 1 ) .  a l o n e may  I t has been  fragments c a r r y i n g  o f P1 a p p e a r  activation certain  Itself  could  the analogous  or only gels  very  that  sequences  slightly  (Fig. 4).  therefore  o f t h e DNA  shown h e r e  Upstream  be a r e f l e c t i o n  which  of  are seen i n  coli  rRNA o p e r o n s , and t h e p r e s e n c e o f an A-T n o t be s u f f i c i e n t  t o enhance  downstream  transcription.  It  i s clear  expressed the  i n E_j_ c o l i  native  upstream  that  coli  t h e tandem B_^ s u b t i l i s show an o v e r a l l  activation  individual  feature.  here t h a t ,  s u b t l l i 3  upstream  was o n l y  weakly  this tains tor  DNA  in  P1 p r o m o t e r expressed.  -35  The B_^ s u b t i l i s  and growth  control  upstream  rate  rate  Therefore  downstream  used  and  P2 p r o -  promoter o f  here s t i l l r e -  examination o f the vecd i d not r e v e a l  the c r i t i c a l  r r n B o p e r o n would  between p o s i t i o n  regulated  regulated  fragment  I t was  p r o m o t e r s , t h e B.  o f t h e 220 bp i n s e r t  o f the B a c i l l u s  a 183 bp r e g i o n  coli  was n o t g r o w t h  o f t h e P1 p r o m o t e r ,  sequence.  an  differences  elements are examined.  to the  W h i l e t h e P2 p r o m o t e r  sequences  potential rate  i n contrast  t h e -10 r e g i o n  lacking  as do  become a p p a r e n t when t h e e x p r e s s i o n o f  was t h e more a c t i v e pair.  dependency  However, more i m p o r t a n t  P1 and P2 p r o m o t e r  observed  moter  rate  promoters  rRNA p r o m o t e r s w h i l e a p p a r e n t l y  between t h e s e two s y s t e m s the  growth  rrnB  region appear  907 and 1090  a  f o r growth to l i e  (see F i g . 3B).  118  The  level  o f e x p r e s s i o n o f the  almost  t w i c e as h i g h a t low  of  tandem P1-P2  the  PKK-220B and rates  equal  individual  and  seen  f o r the  responses tend  P1  o f P1  to imply  c o n s t r u c t i o n at the  to that  that  P2  but  response  two  promoters,  the r e l a t i v e  current  coli  i s reversed.  due  t o some  was  above, would  the again  artifact  models.  above have shown t h a t of a B a c i l l u s same as  response Clearly  i n E_;_ c o l i  the  some r e g u l a t o r y f e a t u r e  control  i s the  allow a d i s t i n c t i o n  the  of the this  although  while  rRNA  coli  individual  result  has  the data  regulation.  the  promoter  tandem P1  and  P2  important of growth  presented  t o be made between any  models f o r g r o w t h r a t e  Literature  as n o t e d  These r e s u l t s not  of  same t r e n d  i n terms o f the m e c h a n i s t i c d e t a i l s  control  was  operons.  to growth r a t e  into  not  rRNA  presented  introduced  do  was  could r e f l e c t  f o r growth r a t e  results  dependent  response  The  that,  were r e v e r s e d .  this  growth  i f the a c t i v i t i e s  except  system  implications  obtained  At h i g h  g r e a t e r and  promoters  between t h e s e  promoters  was  coli  shared  overall  (compare  were summed.  the  The  same g r o w t h r a t e  promoters  within  Implications  pair  was activity  P2  and  promoter t o the  doublings/hr.).  o f the P1-P2  approximately  P2  growth r a t e s compared  pKK-427B a t 0.5  the a c t i v i t y  isolated  of  rate  here  the  As d i s c u s s e d i n t h e  Review, t h r e e g e n e r a l models have been p r o p o s e d  for  119  the  regulation  model o f Maaloe is  in conflict  debate the  has  direct  of stable  with several  therefore effector  model o f Bremer feedback  mechanism a c t i n g  proposed  by  to  the l e v e l  or  some o t h e r s i g n a l  The  of f r e e  may  certain  introduction result per  cell  analogous which  failed  (78, 7 9 ) , and  to f a v o r  directly  on  Whether  molecule remains  favor  t o use  one  this  predictions  o f an r r n B - C A T  (14, 7 7 ) , i s feedback  the promoters may  o f rRNA  n o t be  this  the  t o be  compound  system  increase  plasmid into  rRNA o p e r o n s .  The  any  coli  by  would  promoters  (since  the  cloned  This i s  J i n k s - R o b e r t s o n e_t a_l. copies  a d e c r e a s e i n the t r a n s c r i p t i o n  on the o t h e r hand, r e s u l t e d  example,  rRNA s e q u e n c e s ) .  of extra deleted  introduction  For  i n t h e number o f rRNA  described  the i n t r o d u c t i o n  fusion  as a means o f  made by b o t h m o d e l s . fusion  i s ppGpp  model o v e r t h e o t h e r a l t h o u g h  fusion  do n o t c o n t a i n  t o the s y s t e m  to produce  free  seen.  but n o t i n t h e number o f rRNA o p e r o n s fragments  models,  T r a v e r s (58,  some t y p e o f  itself  but  Current  of the r e m a i n i n g  model o f Nomura  ribosomes.  i n an e f f e c t i v e  promoter  in  of i t s s i m p l i c i t y  d a t a o b t a i n e d h e r e w i t h t h e pKK232-8 o p e r o n  be p o s s i b l e  testing  regulation  Nomura but some o t h e r compound r e s p o n s i v e  system do n o t c u r r e n t l y it  passive  because  c e n t e r e d on w h i c h  (31) a l t h o u g h the e f f e c t o r  ribosomes  The  experimental observations.  Most e v i d e n c e a p p e a r s  inhibition operons  genes.  (79) i s a t t r a c t i v e  80) o r the r i b o s o m e correct.  RNA  of e x t r a  complete  i n a gene dosage  o f rRNA of  (77)  operons  chromosomal  rRNA  dependent  operons decrease  120  in  o v e r a l l rRNA t r a n s c r i p t i o n f r o m e a c h chromosomal o p e r o n .  would  be p r e d i c t e d  promoters changes  therefore,  that  (i.e.rrnB-CAT fusion  i n the l e v e l  introduction  p l a s m i d s ) would  the i n t r o d u c t i o n  fusion  into  does n o t a p p e a r  growth  rate  of a  activity  Additionally,  introduction  of extra  one  could  complete  a B_;_ s u b t i l i s  i n a reduction  rrnB-CAT  of the l e v e l  of  transcription  i f the ribosome  Interestingly  however, t h e s e q u e n c e s  (31) as b e i n g  critical  and of  B. s u b t i l i s described  rrnB  above  Conversely, ppGpp would promoters  correct. by  Gourse  rrnB  operon  (-51  region  o f the  therefore  be d i f f i c u l t  seen f o r the n a t i v e  using  e_t a l .  regulation to  -20  r e s u l t s of the experiments to  predict.  predict  t r a n s c r i p t i o n f r o m t h e B^ s u b t i l i s  tested  host  promoter  o f t h e E_i. c o l i  both are growth  be d i r e c t l y  a  dependent  to the e x t e n t  promoters s i n c e could  identified  t h e d i r e c t e f f e c t o r model would  inhibit  into  rRNA  f e e d b a c k model was  The  such  the  rate  promoter.  would  under  plasmid should  subtilis  a r e n o t homologous t o t h e e q u i v a l e n t  further  the  rRNA o p e r o n s fusion  can  rrnB-CAT  f o r both growth  feedback i n h i b i t i o n P1)  quantitate  envisage that  E. c o l i  any  As  although  o f chromosomal rRNA o p e r o n s  conditions.  carrying  to  the o v e r a l l  r e s p o n s e o f chromosomal rRNA o p e r o n s  transcriptional  result  subtilis  to d i m i n i s h  experiments are n e c e s s a r y to a c c u r a t e l y  already  not l e a d  rRNA  o f chromosomal rRNA t r a n s c r i p t i o n .  be seen i n F i g . 16, coli  of e x t r a  It  rate  E^ c o l i  regulated  the rrnB-CAT  that  rrnB  rRNA  i n E_s_ c o l i .  fusion  plasmids.  This In  121  this  way  identity  i t may  a l s o be  of  hypothetical  the  senses f r e e ribosome promoters, s i n c e may  into  immediately  shown h e r e  still  the  data  details  In f a c t ,  region  o f the the  although  immediately above, no region  preceding  o b v i o u s DNA  immediately  same r e g i o n 3B  there  and  5),  suggests  that  the  here,  can  A-T  model  has  long  -35  site  the  the  this  t o be  expression  including thought  bias  be  subtilis rrnB  with  rate  which i s region  i n the  region  As  mentioned  s e e n between  P1  -35  site  promoter  (compare  critical  of  (31).  f o r growth r a t e  P1  control  the and  i s apparently E_j_ c o l i  It no  this  P2  to  65).  growth  (P2)  ( F i g . 3B).  E_i_ c o l i  region  control points  been  control, lacks  taken  region  l a r g e l y deleted  sequence homology can  surrounding  rich  t r a n s c r i p t i o n (64, be  are  dependent  promoters,  tandem p r o m o t e r s  P2  surrounding  the  tRNA  i s a moderate A-T  growth r a t e r e g u l a t e d  rRNA  section  must be  of growth r a t e  pKK-220B c o n s t r u c t i o n  although  feedback  in this  example, t h e  promoter s t u d i e d  ability  ribosome  the which  i n t e r a c t s with  o f v i e w and  o f many rRNA and  this  to  e f f e c t o r molecule  presented  point  under growth r a t e d e p e n d e n t  entirely  the  the  as  correct.  when the  that  some c l u e s  subsequently  a r o l e i n m o d u l a t i n g downstream  regulated.  Fig.  to be  upstream  change i n the  the  and  e s t a b l i s h e d . For  B a c i l l u s P1  play  intermediary  from a m e c h a n i s t i c  are  to p r o v i d e  a l t e r n a t i v e to  earlier,  consideration  regulation  was  this  mentioned  significant  the  levels  u l t i m a t e l y prove  As  possible  for  This and  122  possibly conserved  feedback DNA  regulation  sequence  within  as w e l l  may  not l i e i n a p r e c i s e ,  the r r n promoters, but i n s t e a d a r e  more s u b t l e  and p r o b a b l y r e f l e c t  topological  c h a r a c t e r i s t i c s o f rRNA p r o m o t e r s  be  a c h i e v e d t h r o u g h a number  c e r t a i n c o n f o r m a t i o n a l or which  of d i f f e r e n t possible  i n t u r n can DNA  sequences.  123  Chapter 2  Construction  of a l t e r n a t i v e promoter-probe  cloning  vectors.  Introduction In  Chapter  3ubtilis was  now  growth vivo  rrnB  1,  promoters  desirable rate  on  P1  pKK232-8  positive  based  organism.  on  as w e l l .  has  on  not g i v e  relatively  was  the r e l a t i v e  seen  system  coli  operon  were n o t  p l a s m i d s used  efficiently  fusions  Since  ribosome  could  (141,  site  of s u f f i c i e n t  that  promoter-  subtilis,  organism. be  into  the  messenger  protein.  this translational  complementarity  of Gram-negative  While  transcribed  143),  not t r a n s l a t e d  have d e t e r m i n e d  t o the l a c k binding  organisms  Gram-  specific  i n t o B^  in this  not  i n B a c i l l u s have  Secondly, a  protein  subtilis  were g e n e r a l l y  e_t §_1. (142) due  i n B.  (140).  in  directly  a Gram-positive  i f introduced  Gram-negative  It  pBR322 r e p l i c o n , i t would  to i n c l u d e  t o the CAT  B.  were t r u e  f o r a number o f r e a s o n s .  an  of  e f f e c t s of  i n E_^ c o l i  Unfortunately,  In g e n e r a l ,  so as  rise  RNA's so formed McLaughlin  expression  been c h a r a c t e r i z e d .  whether  expression  pKK232-8, even  some genes from  block  coli  of r e p l i c a t i o n ( o r i ) region  fusion  would  dependent  t o r e p l i c a t e as an autonomous p l a s m i d i n any  been c o n s t r u c t e d origin  rate  expression  t o B_^ s u b t i l i s  was  be e x p e c t e d  the  v s . P2  on the pKK232-8  transferable  in  to determine  f o r B_j_ s u b t i l i s  based  CAT  the growth  between  t r a n s c r i p t s and  the  124  3*  end  of  the  negative because  their  was  RNA  of  ribosome such  achieved  However, a number  3 u b t l l ± 3 .  mRNA's have been f o u n d  been e x t e n d e d RNA  16S  binding  that  the  (126).  An  to be  sites  required ideal  homology  vector  be  replication  such  i t could  replicate  same t i m e ,  carried  subtilis  and,  at  the  gene which c o u l d required plasmid  be  fully  operon f u s i o n s manipulations  efficient, subtilis  followed  which c a r r i e d  expressed  could  be  by  where s p e c i f i c  regulatory  coli  a promoterless  in  coli and  and  B.  marker  organisms.  simpler  t r a n s f e r o f the  o r i g i n s of  i n both  constructed  16S  purposes o u t l i n e d  dual  i n both  were t e c h n i c a l l y  reasons,  t o B_j_ s u b t i l i s  f o r the  therefore  Gram-  Bacillus  have, f o r unknown  above would  that  one  translated in  of  Thus,  the  where  the  more  f u s i o n plasmid  characteristics  to  B.  could  be  tested.  Zukowski e_t a_l. (126) Pseudomonas p u t i d a and  i n E^ c o l i .  operon on in  the  through  the  gene i t s e l f the  This  TOL  catabolism the  was  expressed gene was  plasmid of  and found  as  B_^ s u b t i l i s  part  of  a  Pseudomonas p u t i d a and  catechol  to p y r u v a t e  to the  product.  which r e p l i c a t e d  gene  from  multi-gene  and p a r t i c i p a t e d  r e l a t e d aromatic  catechols  semialdehyde  xylE  translated in | L _ subtilis  gene, Z u k o w s k i e_t a_l. have c o n s t r u c t e d for  the  a c a t e c h o l 2,3-dioxygenase  colorless substrate  hydroxymuconic  of  toluene  corresponding encoded  have shown t h a t  hydrocarbons (145).  which  The  converted  yellow-colored  Using  the  and  2-  promoterless  a promoter-probe  in Bacillus  xylE  xylE  vector  i n E_^ c o l i ,  125  constitutively produced to  the  dioxygenase  x y l E gene.  constructing the  in  a dual  f a r only  have the  an  can  can  initial  E_;_ c o l i  used  be  as  the  step  basis  i n E_;_ c o l i  used  to be  toward  but,  system,  strong  for direct  use  which  Z u k o w s k i e_t  promoter-bearing  unusually  5'  of  fusion  u n l i k e the  only  placed  the g o a l  operon  but  f o r a set of vectors  to i d e n t i f y  modified  i n E_^ c o l i ,  i f a p r o m o t e r was  - B_j_ 3 u b t i l i s  stably maintain  potential  activity  subtili3  replicate  plasmids, E_;_ c o l i ,  dioxygenase  in  As  x y l E gene was  thus al.  produced  fragments  promoters, i n B_;_  and  subtilis.  Results  1.  Construction  A 2.0 was  Kb  isolated  BamHI and  spraying described  BamHI-Xhol f r a g m e n t from  Sail,  resistance.  and  i n the  TOL  used  an  case  was  clones  was  fragment  isolated  a yellow  E_j_ c o l i fragment  color.  ligated  (144). with  HB101  to  selecting  Expression  of  to t r a n s c r i p t i o n DNA  EcoRI  from one  and  (126) with  ampicillin  were i d e n t i f i e d  of c a t e c h o l  Methods and  p r e s u m a b l y due  digested  and  xylE  x y l E gene  to pBR322 c u t  aqueous s o l u t i o n  t e t p r o m o t e r o f pBR322  positive  ligated  to t r a n s f o r m  M a t e r i a l s and  turned  vectors.  c a r r y i n g the  plasmid,  c a r r y i n g the  c o l o n i e s with  gene i n t h i s the  the  Clones  c o l o n i e s which  at  o f pTLXT-11/pAS-3  Nrul  of  and  to EcoRI-Nrul d i g e s t e d  by  as  those the  xylE  initiating these the  xylE  pKK9-4  126  (131).  This  construction  transcription end  terminator  o f the x y l E g e n e .  r e s u l t e d i n the j o i n i n g o f the from  Finally,  by r e p l a c i n g the PstI-BamH1 PstI-BamH1 contained cloning  fragment  plasmid,  The  vector  fragment  pAS-3  rrnB  operon  the t e t promoter in this  (131).  The  the s t r u c t u r e  ( F i g . 21) was  t r a n s c r i p t i o n terminator  f r o m pKM-1, r e f . 129)  pTLXT-11.  This  terminator  between t h e p r o m o t e r  was  vector latter  t r a n s c r i p t i o n terminator  f o r i n s e r t i o n o f promoter  pTLXT-11, had  lambda tR1  coli  fragment  o f pKK232-8  an u p s t r e a m  sites  the  and  the  fragment multiple The r e s u l t i n g  shown i n F i g . 2 1 .  created  by i n t r o d u c i n g  (isolated  cloning  site  analogous  the  as a H i n d l l l - R s a l  i n t o the unique  in a fashion  3'  eliminated with  fragments.  Hpal s i t e  r e s u l t e d i n the p o s i t i o n i n g o f the  x y l E s t r u c t u r a l gene,  to the  and  of  lambda  the s t a r t  to that  of  o f the  pKM-1  (129).  2.  Cloning  and  Attempts promoter These  stability  o f promoter  fragments.  were made t o s u b c l o n e a l l t h e jB^ s u b t i l i s  fragments  shown i n F i g . 3A  f r a g m e n t s were i s o l a t e d from  (Chapter  1, F i g . 3 A ) , c l o n e d  vectors,  and  used  i n t o pTLXT-11 the v a r i o u s  i n t o t h e Smal s i t e  to transform  E^ c o l l  HB101  to  pKK  or  rrnB  pAS-3.  derivatives  of the  xylE  ampicillin  +  resistance.  Clones expressing  on the b a s i s o f t h e y e l l o w  the x y l E  c o l o r produced  phenotype  were  a f t e r spraying  selected colonies  127  F i g u r e 21.  S t r u c t u r e o f pTLXT-ll/pAS-3.  pTLXT-11 was c o n s t r u c t e d as d e s c r i b e d i n t h e t e x t . The t h i c k b a r , w i t h c i r c l e s , was d e r i v e d from t h e TOL p l a s m i d and c a r r i e s the x y l E gene. The s i n g l e l i n e denotes pBR322 sequences. A m u l t i p l e c l o n i n g s i t e l i n k e r , used f o r i n s e r t i o n of promoter fragments, i s p o s i t i o n e d p r o x i m a l to the x y l E gene and a s i n g l e T l t r a n s c r i p t i o n t e r m i n a t o r i s proximal t o t h i s . The p o s i t i o n o f t h e downstream t r a n s c r i p t i o n t e r m i n a t i o n s i g n a l s ( T l , T 2 ) , d e r i v e d from t h e E . c o l i rrnB operon, i s i n d i c a t e d . A 5S RNA gene was i n c l u d e d d u r i n g the c l o n i n g procedure. pAS-3 was c o n s t r u c t e d by i n s e r t i n g a 500 bp fragment c a r r y i n g the lambda t R l t r a n s c r i p t i o n t e r m i n a t o r (from pKM-1) i n t o the unique Hpal s i t e o f pTLXT-11. R e s t r i c t i o n s i t e s a r e : Ps, P s t l ; Pv, P v u l ; E, EcoRI; S, Smal; B, BamHI H, Hpal; K, Kpnl; Sa, S a i l ; A, A v a l . B r a c k e t t e d s i t e s have been destroyed d u r i n g c l o n i n g .  128  with  a catechol  initially  solution.  be c l o n e d  constructs  While a l l promoter  into either xylE  c a r r y i n g any tandem  vector,  fragments  i t was found  (P1-P2) p r o m o t e r  pTLXT-11 were h i g h l y u n s t a b l e .  could  fragment i n  I f a s i n g l e yellow  colony  subcultured  into ampicillin-supplemented  broth  saturation,  from  i n the r e s u l t a n t  population  8 5 $ to 9 0 $ of the c e l l s  were f o u n d  plasmid-mediated  ampicillin  1 0 0 $ of the c e l l s further  that  the x y l E  could  phenotype,  p l a s m i d s from x y l E  clones  although  present.  become x y l E  R e s t r i c t i o n endonuclease  was  and grown t o  r e s i s t a n c e was s t i l l  i n the p o p u l a t i o n  subculturing.  indicated  t o have l o s t  that  Up t o  upon  analysis  had l o s t  the e n t i r e  +  promoter i n s e r t . isolated colonies, of  Stable  xylE  clones  could  e v e n t u a l l y be  by c o n t i n u a l l y p i c k i n g and r e - g r o w i n g b u t p l a s m i d s from  the o r i g i n a l  these clones  promoter i n s e r t . t h e 3'  single  c a r r i e d deleted  In a l l cases,  involved  end o f t h e p r o m o t e r f r a g m e n t  not  Clones c a r r y i n g e i t h e r the s i n g l e rrnB  p r o m o t e r s i n pTLXT-11 were s t a b l e however.  i n d i c a t i n g that  termination strong  site  tandem  Similar  the p r e s e n c e  ( i n pAS-3)  (data  P1 o r P2  Likewise,  tandem o r s i n g l e p r o m o t e r f r a g m e n t s were c o m p l e t e l y pAS-3,  versions  the d e l e t i o n  specifically shown).  yellow  a l l the  stable i n  o f an i n t e r n a l t r a n s c r i p t i o n  was s u f f i c i e n t  to s t a b i l i z e the  promoters.  a t t e m p t s were made t o c l o n e  promoter fragments d e s c r i b e d  i n Chapter  the E ^ c o l i 1.  rrnB  Here a g a i n , t h e  129  tandem p r o m o t e r  f r a g m e n t s were h i g h l y  interestingly,  this  addition,  the i s o l a t e d  pTLXT-11.  only  instability  The u p s t r e a m  Finally, 253  plasmid  pC194 c a r r y i n g  acetyltransferase  P2 p r o m o t e r could  when c l o n e d  gene  level  of xylE  expression  itive  clones  could  into  In  was s t a b l e i n  be m a i n t a i n e d i n pAS-3 into  pTLXT-11.  was c l o n e d  into  pAS-3 f a i l e d ,  as w e l l .  pTLXT-11.  possibly  was l o w e r e d t o t h e e x t e n t  n o t be d e t e c t e d  the v a r i o u s operon  as w e l l .  A  f o r the c h l o r a m p h e n i c o l  (146) was c l o n e d  fragment  but  from the S t a p h l o c o c c u s aureus  the promoter  to c l o n e t h i s  izes  coli  a n o n - r i b o s o m a l RNA p r o m o t e r  bp M s p l - M n l l f r a g m e n t  i n pTLXT-11,  was n o t e d f o r pAS-3  P1 p r o m o t e r  but was found t o be u n s t a b l e  unstable  fusions  (see below).  constructed  Attempts  because the that  pos-  T a b l e 4 summar-  as o u t l i n e d  above.  130  Table  4  -  B.s. =  Ribosomal  RNA p r o m o t e r  - xylE  operon f u s i o n s  subtilis  E . c . = E. c o l i Plasmid  Promoter  Internal lambda t e r m i n a t o r  Stability  PAS-427B  B.s.  P1-P2  +  yes  pAS-211B  B.s.  P1-P2  +  yes  PTLXT-427B  B.s.  P1-P2  pTLXT-211B  B.s.  P1-P2  -  no no  PAS-282B  B.s. P1  +  yes  PTLXT-282B  B.s. P1  -  yes  PAS-220B  B.s.  P2  +  yes  PTLXT-220B  B.s.  P2  -  yes  pAS-292Ec  E.c.  P1-P2  +  no  pTLXT-292Ec  E.c.  P1-P2  -  no  +  yes  pAS-351Ec  E.c.  P1  pTLXT-3 51Ec  E.c.  P1  no  pTLXT-128Ec  E.c.  P2  yes  pTLXT-253  pC194 CAT  yes  131  3.  Expression  of promoter-xylE fusions  i n E_;_ c o l i .  Only t h o s e s t r a i n s c a r r y i n g p l a s m i d s w h i c h had been shown t o maintain Cells  a stable xylE  were grown as d e s c r i b e d  to a c h i e v e catechol  as can  activity  studied.  and Methods so as and a s s a y e d f o r  22 i l l u s t r a t e s t h e  as a f u n c t i o n  o f growth  rRNA p r o m o t e r s as w e l l  f o r pTLXT-253 c a r r y i n g t h e c o n s t i t u t i v e CAT gene p r o m o t e r . be s e e n , a l l c o n s t r u c t i o n s  carrying  Chapter  growth r a t e s .  in activity  was o b s e r v e d ,  rRNA p r o m o t e r s which had p r e v i o u s l y  1).  i n E_^ c o l i  was o b s e r v e d .  individual  respectively,  lower  As  levels of  No growth  rate  even f o r p l a s m i d s been shown t o be  ( i . e . 427 bp P1-P2, 220 bp P2 -  When t h e r e s p o n s e o f t h e c l o n e d  promoter as a f u n c t i o n trend  gave s l i g h t l y  at higher  growth r a t e r e g u l a t e d  E.coli  rrnB  o f g r o w t h r a t e was e x a m i n e d , a s i m i l a r  In t h i s  case,  i t was o n l y  p o s s i b l e to study  P1 and P2 p r o m o t e r s i n pAS-3 and pTLXT-11 since  pAS-351Ec, c a r r y i n g  not  specific  Figure  f o r a l l p l a s m i d s c a r r y i n g B_;_ s u b t i l i s  dependent i n c r e a s e  be  4) were f u r t h e r  i n the M a t e r i a l s  2,3-dioxygenase a c t i v i t y .  dioxygenase a c t i v i t y  the  (Table  a r a n g e o f growth r a t e s , h a r v e s t e d ,  changes i n d i o x y g e n a s e rate  phenotype  a l l other the rrnB  growth r a t e r e g u l a t e d  here  clones  were u n s t a b l e .  However,  P1 p r o m o t e r w h i c h had been shown t o (Chapter  produce a growth r a t e dependent  1) and e l s e w h e r e  increase  i n catechol  (31) d i d 2,3-  132  CO  £j  10000  < UJ  5(  CO  <  •z.  Ill  o >  X O  u .AA  o o UJ r<  o  1.0  Growth F i g u r e 22.  Catechol  1.1  1.S  1.6  Rate  2,3 dioxygenase a c t i v i t y v s . growth r a t e .  E x p r e s s i o n o f the x y l E gene from v a r i o u s B . s u b t i l i s rrnB promoter i n s e r t s was assessed by d e t e r m i n i n g the s p e c i f i c a c t i v i t y o f c a t e c h o l 2,3 dioxygenase as d e s c r i b e d i n the M a t e r i a l s and Methods. Growth r a t e was c a l c u l a t e d as the r e c i p r o c a l o f the c e l l u l a r d o u b l i n g time i n hours. The host f o r a l l plasmids i n these experiments was E . c o l i HB101. L i n e 1 (open c i r c l e s ) , pTLXT-220B; L i n e 2 ( c l o s e d c i r c l e s ) , pTLXT-282B; L i n e 3 ( s t a r s ) , pTLXT-253 (CAT gene promoter); L i n e 4 (open s q u a r e s ) , pAS-427B; L i n e 5 ( c l o s e d s q u a r e s ) , pAS-220B; L i n e 6 (open t r i a n g l e s ) , pAS-282B. See T a b l e 4 f o r a summary of the c h a r a c t e r i s t i c s o f the plasmids used here.  F i g u r e 23.  C a t e c h o l 2,3 dioxygenase a c t i v i t y v s . growth r a t e : pAS-351Ec.  E . c o l i HB101 c a r r y i n g pAS-351Ec ( E . c o l i rrnB PI promoter) was grown a t d i f f e r e n t r a t e s and c a t e c h o l 2,3 dioxygenase s p e c i f i c a c t i v i t y determined from c e l l - f r e e e x t r a c t s . The s l o p e o f the l i n e was determined by l i n e a r r e g r e s s i o n .  134  dioxygenase  activity  4.  of  Effects rrnB  An  lambda  tR1  examination as  internal  to  of  the  lambda  the  terminator  of  1.0  doubling/hr.,  3.4$  of  the  catechol  pTLXT-282B  (Table  number  and  cases,  this  P1  5).  implies  on  subtilis  before  P1  that  gave h i g h e r  P2  the  at  the  B_j_ s u b t i l i s  levels  of  for  P2  example,  noted  xylE  the  pTLXT-11  and  76$  that  growth  f o r P1  plasmid  transcripts  at  only on  copy  in  both  originating  tR1  site.  For  93$  of  transcripts  were  gene  5).  the  structural  relative the  pAS-3.  more a c t i v i t y  the  (Table  same t r e n d  At 50$  P2  activities  system.  r e s u l t e d i n approximately  pTLXT-11  seen  The  2,3-dioxygenase and  a  were e q u i v a l e n t the  followed  catechol  At  pAS-282B gave  activity  of  lambda  that  on  additional  termination  pAS-3.  assuming  96$  the  on  promoter  pKK232-8 e x p r e s s i o n  i n both  5).  carried P1  over  promoters  growth r a t e s  (Table  of  provides  transcription  efficiencies  reaching  i t was  and  using  i n the  the  of  pAS-220B, a p p r o x i m a t e l y  Finally,  P1  expression  i n F i g . 22  Therefore,  translational  terminated  earlier  on  2,3-dioxygenase  were t e r m i n a t e d  promoter  data  efficiency  rate  at  terminator  promoters.  information the  ( F i g . 23).  P2  as  of  the  observed  promoter  activity  at a l l  a growth r a t e  of  more a c t i v i t y  i n the  pAS-3  B.  vector  1.0  than  135  Table 5 - A c t i v i t i e s (u  Plasmid  =  of  subtilis  promoters  in  coli  1.0)  Promoter  I n t e r n a l lambda terminator  C a t e c h o l 2,3dioxygenase (units/mg)  pAS-427B  P1-P2  +  2,800  pAS-282B  P1  +  340  PTLXT-282B  P1  -  10,100  PAS-220B  P2  +  1,450  PTLXT-220B  P2  -  20,050  pTLXT-253  CAT  -  3,250  136  Discussion  This  chapter  probe v e c t o r s , cloning coli.  described  pTLXT-11  of s t r o n g  These v e c t o r s  quantitatively  x y l E gene i t s e l f without  and  used  the  could  and  promoters cloned selective  into  pressure  pTLXT-11 was  similar  constructed  however, pTLXT-11 constitutively  used  could  express  expected  to clone  such as the  was  and  those of  the  by  the  be  expressed  subtilis  Brosius  in  (131)  pTLXT-11 used  could  not  i n the  replicate  be  the  with  rRNA o p e r o n s .  xylE  placed  gene  Therefore, under  constant  pKK232-8 s y s t e m .  i n B.  been  pKK232-8,  was  although  gene.  Also,  promoter-probe  Unlike  pTG402 and  3 u b t i l i 3  x y l E gene i n E_^ c o l i  as  putida  F u n c t i o n a l l y , pTLXT-11  p r o m o t e r s had  that  E.  that  Z u k o w s k i e_t a_l. ( 1 2 6 ) . not  and  added a d v a n t a g e  a p r o m o t e r l e s s CAT  s t a b l y maintain the  Pseudomonas  t o pTG402, a n o t h e r x y l E based  upstream pBR322-derived  It  subtilis  the  the  they could  by  in  had  (126).  pTLXT-11  as  applicability  could  i n that  whereas pKK232-8 c o n t a i n e d  promoter-  2 , 3 - d i o x y g e n a s e enzyme which  potentially  they d i f f e r e d  two  p r o m o t e r s from  t o pKK232-8 d e s c r i b e d  structurally  of  their  promoterless  further modifications  identical  plasmid  RNA  a catechol assayed  construction  pAS-3, and  ribosomal  x y l E gene e n c o d i n g be  the  did  not  because a l l  eliminated.  pTLXT-11  could  a l l types of strong  be  promoters  I t was  found  however,  tandem rRNA p r o m o t e r s f r o m B_^ s u b t i l i s  could  be  cloned  that by  137  + selecting  for  the xyIE  rapidly  appeared  media.  Stable  preliminary  phenotype,  following +  xylE  deletions  This  suggested  that  fragments  transcription  from  replication  since  terminators  were  possible of  that  a hybrid  was  same  also  produces  translation protein  may  here  be t o x i c  expected  for  have  found were  that  have  instability  revealed  occurred. lost  t h e P2  o f tandem  the plasmid  a drain  stable mRNA  origin of  transcription gene.  I t  that  a n d tRNA  t h e same  assuming demand  here,  of certain  that 1)  on t h e  gene  levels  promoters. other  While  workers  plasmid-encoded  metabolism  these  equivalent  of the xylE  several  This  the results  a t the high a t rRNA  mRNA  protein  (Chapter  Instead  the product  effects  pools.  by t h e f i n d i n g  i s  this  on t h e c e l l u l a r  and which,  produced  to cellular  or that  i n pKK232-8  place  proven  overexpression  rRNA  i n E_;_ c o l i  of the c e l l .  when  directly  into  however,  must  to imply  detrimental  had  of the xylE  transcription initiating  has n o t been  but  inserts  ends  could  the ribosome  a hybrid  t o E_^ c o l i  this  teins  species  were  capacity  tend  be o b t a i n e d  was d u e t o t h e d e t r i m e n t a l  against  efficiencies,  synthetic  presented  downstream  namely  fragments  This  promoters  i t placed  i s argued  t h e 3'  setof efficient  mRNA  that  machinery,  promoter  which  a double located  ampicillin-supplemented  promoter  clones  segregants  n o t be due t o r e a d - t h r o u g h  t h e rRNA  rrnB-xylE  possibility  insert.  the i n s t a b i l i t y  so abundant  synthesis  of their  stable  should  i n  xylE  eventually  involving  these  o f the promoter  promoter  could  characterization  extensive  element  outgrowth  clones  that  but that  pro-  and t h e s t a b i l i t y  138  of recombinant  plasmids.  overexpression  o f the  to  plasmid  the  cell  of  level  the  to the  of  mRNA i t s e l f  the  cell.  the  the  not  due  protein  form of  the  xylE  function.  or  inhibitory  to a r e q u i r e d  This p o s s i b i l i t y  however, so  other  has  f a c t o r s could  observed  instability.  Bacillus  rRNA p r o m o t e r s c o u l d  vectors  simply  by  the  presence of  this  activity  93  the  terminator  still  and  Interestingly, from E_j_ c o l i c o u l d  i t was not  terminator-containing number o f s t u d i e s promoters could termination  that  be  be  found  tR1  catechol  p r e s u m a b l y would  found  high be  for  the  that  the  on  xylE  gene  the  bring  the  amount  I t had  even i n  of  promoters  the  been shown i n a  i n i t i a t i n g a t JL  a means o f o v e r c o m i n g  The  coli.  tandem r r n B  s t a b l y maintained  polymerase  (pAS-3).  2,3-dioxygenase  t o l e r a t e d by JL_  that  tandem  terminator  e f f i c i e n t l y read-through r h o - f a c t o r  s i g n a l s as  still  metabolic  important  i t was  pAS-3 v e c t o r . RNA  i n some way  xylE structural  d i o x y g e n a s e p r o t e i n down t o a l e v e l  of  since  s t a b l y maintained  reduced  to  inability  p r o t e i n was  cellular  p l a c e m e n t o f a lambda  p r o m o t e r s and  to 97$  be  due  led  been r i g o r o u s l y t e s t e d  Nevertheless,  between the  by  not  not  f u s i o n s , the  o f c a t e c h o l 2 , 3 - d i o x y g e n a s e enzyme may  detrimental  t o an  that  plasmid  effect  insulin  c a s e o f the  found  a multicopy  l y s i s ; an  and  non-secreted In  f o r example,  gene on  cellular  to e f f i c i e n t l y e x p o r t  overproduction lethal  rat insulin  i n s t a b i l i t y and  overproduction  (132)  Brosius  the  c o l i rRNA  dependent  transcriptional  139  polarity 44).  normally  This  antitermination  sequences l o c a t e d element cloned  associated  (31),  that  bp d i s t a l  It i s possible, to m a i n t a i n  these sequences which r e s u l t e d  properties  i n read-through  rho-dependent  the  427 bp tandem rRNA p r o m o t e r f r a g m e n t  stable in  i n pAS-3.  pAS-3  lambda tR1 t e r m i n a t o r  This  coli  functional dependent of  promoters, or e l s e  i n E_^ c o l i terminator  allow  (31,  44).  terminator  t h e B_;_ s u b t i l i s  on t h e p a r t i c u l a r r h o -  these  beyond  sequence between t h e B_^ s u b t i l l s  end  here do  possibilities.  o f t h e 16S RNA gene f a i l e d  S i m i l a r l y , no s u c h r e g i o n  t h e 3'  t o t h e B^ s u b t i l i s  Box B, A, C r e g i o n  i n the a n t i t e r m i n a t i o n  to that  b u t was i ) n o t  The d a t a p r e s e n t e d  homologous t o the s o - c a l l e d  which  completely  tR1  one was p r e s e n t  one t o d i s t i n g u i s h between  to t o be r e q u i r e d  3 u b t i l i s ,  percentage of read-  used h e r e o r , i i i ) l o c a t e d  P2 p r o m o t e r up t o t h e s t a r t  In c o n t r a s t ,  mechanism a n a l o g o u s  e x a m i n a t i o n o f t h e DNA s e q u e n c e d i s t a l  a region  f r o m B_;_  either  or, i i ) inoperable  t h e 427 bp p r o m o t e r f r a g m e n t .  not  that  p r o m o t e r s had no a n t i t e r m i n a t i o n  of the  on pAS-3.  a large  by  t r a n s c r i p t i o n of  t h e lambda  was f u n c t i o n a l i n p r e v e n t i n g  t h r o u g h t r a n s c r i p t i o n and i m p l i e d rrnB  that  promoter  conferred  t o t h e P2 e l e m e n t , was  suggested  fragment  t h e 292 bp r r n B  the  114 bp o f DNA d i s t a l  on t h e rRNA  although not r i g o r o u s l y  f r a g m e n t was due t o t h e a n t i t e r m i n a t i o n  included  t o t h e P2 p r o m o t e r  s e q u e n c e s which were p r e s e n t  the i n a b i l i t y  ( 3 7 , 38,  operons  mechanism was d e p e n d e n t on DNA  l e s s than 67  on pAS-292Ec.  proven,  with non-translated  An rrnB  to r e v e a l thought  mechanism i n E_j_ c o l i  appeared  i n the i n t e r v e n i n g  P1 and P2 p r o m o t e r s .  140  Unfortunately, and  transcription-translation coupling  understood.  While  has been r e p o r t e d of  the mechanisms o f t r a n s c r i p t i o n  the e x i s t e n c e  a protein  i n B a c i l l u s (147), a r i g o r o u s  s u p p r e s s p o l a r m u t a t i o n s ) has possible quire  that  B_^ s u b t i l i s  specific  elongation.  Lack  o f growth  may  functions  r a t e dependent  in  factor proof  able  It i s  to  therefore  rRNA t r a n s c r i p t  studies  the q u e s t i o n  poorly  not a c t u a l l y r e -  efficient  C l e a r l y , f u r t h e r ija v i v o  of a n t i t e r m i n a t i o n  rho  genetic  not yet appeared.  rRNA o p e r o n s  to address  are  ( i . e . as a m u t a t i o n  mechanisms t o e n s u r e  must be u n d e r t a k e n absence  i n B_j_ s u b t i l i s  s i m i l a r t o the E_;_ c o l i  of such a f a c t o r  termination  o f rRNA  expression  o f the presence  or  Bacillus.  r e g u l a t i o n of promoter-xylE  fusions. The subtilis  r e s u l t s presented i n Chapter and  coli  r a t e dependent transferase was  found  duplicated It  manner when f u s e d  gene and  that  rRNA p r o m o t e r s  were r e g u l a t e d  t h i s growth  rate  dependent  when t h e s e same p r o m o t e r s  here d i f f e r e d  expression  were f u s e d  from pKK232-8 used  originally  assumed  that  growth  o f 95$  the e f f i c i e n c y  could  to the x y l E used  (Table  5).  not  be  gene.  f o r most  i n Chapter  pAS-3 c a r r i e d an i n t e r n a l t r a n s c r i p t i o n t e r m i n a t o r o f x y l E by an a v e r a g e  in a  B.  Unexpectedly, i t  t h e pAS-3 v e c t o r  expression  that  to a c h l o r a m p h e n i c o l a c e t y l -  e x p r e s s e d i n JL_ c o l i .  must be n o t e d however, t h a t  experiments  1 demonstrated  1 i n that  which It  of t r a n s c r i p t i o n  reduced  was  141  termination thereby  a t tR1 v a r i e d as a f u n c t i o n o f g r o w t h r a t e and  masked any g r o w t h r a t e d e p e n d e n t  be o c c u r r i n g .  O t h e r s have n o t e d  which r e a d - t h r o u g h a g i v e n according  to the s t r e n g t h  transcription  (148).  transcription  termination  it  that  termination  occurred, observable  could  examined  as t h e r e l a t i v e  promoter i n c r e a s e d  nullifying  any growth  termination  n o t be t h e o n l y  growth r a t e d e p e n d e n t  obtained  This plasmid  at higher  here,  strength of growth  the  r a t e dependent  the i n t e r n a l  subtilis  changes.  response,  f o r t h e l a c k o f an as e v i d e n c e d  f o r t h e pTLXT-220B f u s i o n p l a s m i d  lacked  tR1 t e r m i n a t o r  by t h e  (Fig.  f u s i o n should  response.  P2 rRNA p r o m o t e r w h i c h p r e v i o u s l y had when f u s e d  t o t h e CAT  increasing  fusion  t o t h e p r e s e n c e o f t h e tR1 t e r m i n a t o r ,  have  shown a n o r m a l g r o w t h r a t e  As c a n be s e e n  p r o d u c e an i n c r e a s e  22).  o f pAS-3 and  I f the l a c k o f growth r a t e r e g u l a t i o n o f xylE-based  p l a s m i d s was due o n l y  a t tR1 ,  a t tR1 i f i n d e e d i t  explanation  been shown t o be g r o w t h r a t e r e g u l a t e d  this  vary  initiate  have n o t been d i r e c t l y  Growth r a t e d e p e n d e n t  gene.  s i g n a l could  so t o o d i d t h e d e g r e e o f t r a n s c r i p t i o n t e r m i n a t i o n  thus e f f e c t i v e l y  carried  might  W h i l e t h e e f f e c t s o f g r o w t h r a t e on  a growth r a t e r e g u l a t e d  results  which  t h e number o f t r a n s c r i p t s  o f the promoters which  i s n o t u n r e a s o n a b l e t o assume t h a t  rates,  expression  ( F i g . 2 2 ) , pKK-220B a l s o f a i l e d  i n c a t e c h o l 2,3-dioxygenase  growth r a t e .  dependent  The r e a s o n  for this  activity  to with  i s p r e s e n t l y not  then  142  clear. (data  Plasmid  copy number d e t e r m i n a t i o n s  n o t shown) f a i l e d  between h i g h  t o show any s i g n i f i c a n t  and low growth r a t e  t h e pKK232-8 v e c t o r s .  for  functional faster  half-life  rate  could  conditions,  I t was o b s e r v e d  as shown  however,  (G.B. S p i e g e l m a n , p e r s o n a l  account  f o r the l a c k  xylE vectors regulatory  have s e r i o u s  properties  presented  assessing  the s t r e n g t h  environmental in  still  The p r e c i s e  (Chapter  1 ) that  transcriptionally promoters cloned  t h e B_^ s u b t i l i s  i n pAS-3,  rrnB  the c l o n i n g  differential strengths  as  vector  termination  o f the cloned  other The  P2 p r o m o t e r was much  P2 was r o u g h l y  P1 p r o m o t e r .  more  For the  4 t i m e s more a c t i v e  over  f o r the  P1 by a f a c t o r o f 2.  o f P2 t o P1 a c t i v i t y was pAS-3 o r pTLXT-11  e f f e c t s dependent  data  observations  growth r a t e o f 1.0 d o u b l i n g / h r . ;  v a r i a t i o n i n the r a t i o  whether  b o t h pAS-  i n a l l cases.  the p r e v i o u s  p r o m o t e r s i n pTLXT-11, P2 p r e d o m i n a t e d This  Nevertheless,  a c t i v e than the upstream  than P1 a t a c e l l u l a r  to study the  p r o m o t e r s as l o n g  are equivalent  5 f o r example, c o n f i r m e d  Table  investigations  be u s e f u l as a means o f q u a n t a t i v e l y  of cloned  conditions  growth  p r o m o t e r s as a f u n c t i o n o f  c h a n g i n g p a r a m e t e r s s u c h as g r o w t h r a t e . 3 and pTLXT-11 may  reduced i n  above i t i s c l e a r t h a t t h e  l i m i t a t i o n s i f used  of cloned  that the  o f an a p p a r e n t  reasons are e s s e n t i a l l y i r r e l e v a n t to the present from the data  previously  communication).  d e p e n d e n t r e s p o n s e r e m a i n s t o be d e t e r m i n e d .  however, s i n c e  vectors  difference  o f x y l E mRNA was s i g n i f i c a n t l y  growing c e l l s  Whether t h i s  f o r the x y l E  according could  on t h e  p r o m o t e r s as d i s c u s s e d  be due t o  absolute  above.  to  143  In based  conclusion,  on  here.  the  conveniently  clones  done by  terminator product  utilizing  the  presence  as  be  toxic  for this  (126)  without  detectable  drawback  fusion  that  strong  the  systems  into  pTLXT-11  o f an  internal  over  effect  other  2,3  not  regard,  promoters  and  but  gene  (although  of c a t e c h o l  this  Selection  reaction.  amount o f x y l E  an  the  not  dioxy-  previous-  the  pAS-3  xylE-based  can  be  maintained  instability.  x y l E as  an  indicator  they  f u s i o n system  obscure c e r t a i n this  have  i s simply  been s u g g e s t e d  In  advantage  cannot  p r o p e r t i e s of cloned  from  conditions, noted  using  the  cells,  (126).  i n that very  however, i n t h a t  regulatory arising  t o E_^ c o l i  product  vectors  cloned  overproduction  a significant  Vectors  to reduce  Thus, i t has  g e n a s e may  has  a color-change  promoters r e q u i r e so  developed  but  fragments  be  fragment  vectors  i n B_^ s u b t i l i s .  may  proven) that  vector  i n JL_ c o l i  strength  synthesized.  noted  only  c a r r y i n g promoter  rigorously  ly  promoter-probe  x y l E gene have been  (with m o d i f i c a t i o n s )  Promoters of average strong  purpose  p r e s e n t l y useable  f o r use  of recombinant  very  general  Pseudomonas p u t i d a  Both a r e  potential  two  (126,  149)  and  be  used  itself  w h i c h may, phenomena.  a l s o extend the  to other  appropriate  serious  to study  promoters because  regulatory  drawback may  gene have a  of  the  artifacts  u n d e r some I t should  be  xylE-based  c o n t r o l s must  be  144  therefore vectors  considered.  have  subtilis  used  a n d E_^ c o l i  described rate  been  In s p i t e  of these  to clone  the promoter  rrnB 1.  i n Chapter  While  r e g u l a t i o n of these  nevertheless Bacillus  possible  promoters  promoters. concluded  promoters, those  to define  which  functions  from  rRNA  found they  other  terminators.  and  questions,  promoter  associated  in Bacillus  must  be  to gain  studies  undertaken.  i t was  either  of the  i t was lacked  E_;_ c o l i  the  rRNA  different  on  coli  rho-  more  insight  into  o f rRNA  that  E_j_ c o l i  vector,  with  to  to the growth  features  were s u f f i c i e n t l y  In order  parallel  analogous  the analogous  t h e pAS-3  these  o f t h e B.  n o t be d o n e ,  s o a s t o be n o n - f u c t i o n a l  dependent  systems  could  by u s i n g  regions  pertaining  certain  differed  or i f present,  o f E_^ c o l i  other  studies  t h e B_^ s u b t i l i s  antitermination  i n a manner  promoters  Specifically, that  operons  difficulties,  from  these  promoter-fusion  145  C h a p t e r 3_  Attempts  to c o n s t r u c t  b i f u n c t i o n a l operon  fu3ion  vectors .  2,  preferred  Introduction As next  stated  stage  i n the  in this  promoter-fusion vivo  directly  work would  system  experiments  expression  i n t r o d u c t i o n to  could  vector  used  involve  be  performed.  i n the  problems which c o u l d  different  expression initial  of a p r o m o t e r - f u s i o n gene s i n c e lated  systems  this  i n both  step  E\_ c o l l  be  and  t r a n s f e r of  i n order  as  to  two  this  based  on  goal  efficiently  use  hosts.  the  IL_ s u b t i l i s  the  vector  so  that  synthesized coli  the  alone. was  i n B_^  level  dependent on  chloramphenicol  of x y l E  the  Instead,  influenced  by  transcriptional the  level  other,  of  detailed in  the  construction  activity  catechol  poorly  was  would  gene on  not of  xylE  trans-  An a l t e r n a t i v e  ( 1 2 6 ) .  CAT  and  have been  the  shown however, t h a t  gene e x p r e s s i o n  be  two  a c e t y l t r a n s f e r a s e could I t was  s u b t i l i 3 .  the  in  any  of  transcribed  binding  of  parallel  Pseudomonas p u t i d a  alter  site  JL. c o l i  promoter  As  was  t e c h n i c a l l y more d i f f i c u l t ,  ribosome  that  eliminate  approach, although the  an  e x p e r i m e n t s would  a r i s e from  toward  vector  gene can  so  i n the  the  I d e a l l y , the  JL_ c o l i  potential  an  the  i n t o B_^ s u b t i l i s  t r a n s f e r r e d to B a c i l l u s ,  Chapter 2 ,  Chapter  pKK232-8  be in  E.  strictly  the  cloned  2,3-dioxygenase  characterized,  to  promoter activity  parameters  thus  146  making  the x y l E v e c t o r s u n s u i t a b l e f o r r e g u l a t o r y s t u d i e s i n E.  coli.  However, i t was  u n c l e a r whether s i m i l a r  xylE-based  system  would  Bacillus.  I t was  decided  and  pAS-3 i n an a t t e m p t  which would r e p l i c a t e activity should  i n both  occur  to u t i l i z e  and  E_;_ c o l i  in  t h e x y l E v e c t o r s pTLXT-11  B^ s u b t i l i s .  plasmids  If feasible,  this  t o be made o f t h e g e n e r a l u t i l i t y of cloned promoters i n t r o d u c e d  such  v e c t o r s m i g h t be u s e f u l  starting  point f o r other b i - f u n c t i o n a l  gene was  r e p l a c e d by  present  expressed  a  c a t e c h o l 2,3-dioxygenase  express and  x y l E v e c t o r s i n the s t u d y In a d d i t i o n ,  gene was  to c o n s t r u c t p r o m o t e r - p r o b e  a l l o w an a s s e s s m e n t  Bacillus.  i f this  problems with  another  plasmids  marker gene, one  the problems a s s o c i a t e d with  of  into  as  the  i n which  the  which would  xylE  not  t h e e x p r e s s i o n o f x y l E i n E.  coli.  While  t h e r e a r e no  replication  i n both  have c r e a t e d s u c h of  replicons  v e c t o r s was ligated isolated E. c o l i  E_^ c o l i  and  bi-functional  n a t i v e t o each pHV14 (150)  o c c u r r i n g plasmids  B^ s u b t i l i s , plasmids  organism.  i n which the  several  by  One  capable  the j j i v i t r o of the f i r s t  E^_ c o l i  plasmid  from  Staphlococcus  resulted  Transformation  i n the e x p r e s s i o n o f a m p i c i l l i n , chloramphenicol  only chloramphenicol then,  aureus.  resistance  (from  was  ligation such  pBR322  o f pHV14  into  tetracyline  i n B^  a l a r g e number o f o t h e r b i - f u n c t i o n a l  was  originally  pC194) r e s i s t a n c e  expressed  of  workers  t o pC194, a c h l o r a m p h e n i c o l - r e s i s t a n c e p l a s m i d  (from pBR322) and  Since  naturally  whereas  subtilis.  plasmids  have  147  been c r e a t e d ,  most based  Gram-positive  r e p l i c o n s such  Frequently these  on pBR322  a Ek_ s u b t i l i s deletion  host  (152).  component o f t h e p l a s m i d , replicon  replicon plus (151).  p r o b l e m s have been e n c o u n t e r e d especially  Usually,  of c e r t a i n regions  coli  as pBD9, pBD64, o r pUB110  however, s t a b i l i t y  b i - f u n c t i o n a l plasmids  as t h e  after  this  transformation  into  r e s u l t e d i n spontaneous  of e i t h e r the B a c i l l u s  b u t t h e end r e s u l t  which was c o n s i d e r a b l y  with  more s t a b l e  o r t h e E_j_ c o l l  was a s m a l l e r than i t s  parent.  V e r y r e c e n t l y some w o r k e r s have d e s c r i b e d  the c o n s t r u c t i o n o f  composite  the o r i r e g i o n  vectors  which  incorporated  G r a m - n e g a t i v e and G r a m - p o s i t i v e individual to  drug  (141).  size  o f such b i - f u n c t i o n a l v e c t o r s  and  the problem o f i n s t a b i l i t y  overcome.  This  section describes  Bacillus  a number vectors  from  various termination  reduced  seems t o have  based  on pTLXT-11/pAS-3  r e p l i c o n s , as w e l l as c o m p o s i t e  vectors  chromosome.  Results  Construction  i)  The f i r s t  of b i - f u n c t i o n a l cointegrate  attempt  been  of attempts at  w h i c h a r e i n t e g r a t a b l e i n t o t h e B_j_ s u b t i l i s  1.  sites  sequences,  was c o n s i d e r a b l y  i n e i t h e r host  b i - f u n c t i o n a l expression  various  plus  By e l i m i n a t i n g e x t r a n e o u s  the  and  plasmids  r e s i s t a n c e m a r k e r s and i n t e r n a l  ensure s t a b i l i t y  creating  only  plasmids.  at construction of a b i - f u n c t i o n a l  148  vector  was made u s i n g  subtilis  plasmid  shown t o c a r r y  pBD9  coli  (151).  plasmid  than only  (kanamycin  one, a f e a t u r e  i n the s e l e c t i o n of recombinant  monitoring  plasmid  unique  HB101  to erythromycin  fashion  Pstl  stability.  their  resulted  ampicillin  sites,  pAS3B, was f o u n d  l i g a t e d , and used  by r e s t r i c t i o n  resulted  i n 6 fragments  (3650 bp) c o n t a i n e d cointegrate expected  with  plasmid.  E_j_ c o l i  Ligation i n this  that  the recombinant  One o f t h e s e  clones,  t o have the s t r u c t u r e  Digestion  o f pBD9 w i t h  Hpall  (151, F i g . 2 4 ) , t h e l a r g e s t o f w h i c h  the P s t l  site  used  i n c o n s t r u c t i n g the  o f pAS3B w i t h  H p a l l would  i n t h e l o s s o f t h e 3650 bp f r a g m e n t  a p p e a r a n c e o f two new pBD9 and pAS-3.  analysis  pAS-3. D i g e s t i o n  to r e s u l t  to transform  i n a c t i v a t i o n of the  t h e pBD9 m a r k e r s .  of a cointegrate  prove  and a l s o i n  resistance.  i n the i n s e r t i o n a l  expected  erythromycin  Both pAS-3 and pBD9 were c u t a t  and kanamycin  expressed  and  i t has been  which c o u l d  clones  r e s i s t a n c e gene o f pAS-3 s u c h  plasmids only  pAS-3 and t h e B.  pBD9 was c h o s e n b e c a u s e  two s e l e c t a b l e m a r k e r s  resistance) rather useful  the  fragments both c o n t a i n i n g  and t h e  sequences  As s e e n i n F i g . 24, d i g e s t i o n o f pAS3B  be  from  with  H p a l l r e s u l t e d i n t h e a p p e a r a n c e o f two new f r a g m e n t s o f 1010 and 2660 bp, i n d i c a t i n g t h a t  this  plasmid  was a t r u e  cointegrate  between pAS-3 and pBD9.  Transformation  o f B^ s u b t i l i s  168 w i t h  pAS3B r e s u l t e d  appearance o f erythromycin-kanamycin  r e s i s t a n t colonies at  frequencies  i t was now e s t a b l i s h e d  shown i n T a b l e  6.  Since  i n the  that  149  Table  6.  Frequency  of transformation with  No. o f t r a n s f o r m a n t s  Vector  E. c o l i 4  pAS3B  1 .5  X  10  pCmTv-2  4.1  x  10  pASTV-1  5.2  X  10  PAS3C-E  2.4  X  10  pASUB-1  6.1  X  10  pCm-2/pAS3C  8.8  X  10  3 3 3  3 3 pTV8  0  bi-functional  p e r ug DNA i n :  B. s u b t i l i s 2 5.5 X 10 2 2.3 X 10 2 3.6 X 10 2 8.1 X 10 2 3.8 X 10 0  5.3  X  10  3  vectors  Figure  24. R e s t r i c t i o n  «  2 6 6 0  «  1 0 1 0  e n d o n u c l e a s e d i g e s t i o n p a t t e r n o f pAS3B.  P u r i f i e d DNA was d i g e s t e d and e l e c t r o p h o r e s e d t h r o u g h a 4% p o l y a c r y l a m i d e g e l as d e s c r i b e d i n t h e M a t e r i a l s and Methods. L a n e 1, 029 d i g e s t e d w i t h H i n d l l l a s m o l e c u l a r w e i g h t m a r k e r s . S i z e o f f r a g m e n t s c o r r e s p o n d s t o t h a t g i v e n i n F i g . I B a n d F i g . 4 . L a n e 2, pAS-3 d i g e s t e d w i t h H p a l l ; L a n e 3,pAS3B d i g e s t e d w i t h H p a l l ; L a n e 4, pBD9 d i g e s t e d w i t h H p a l l . A r r o w s d e n o t e t h e t w o new f r a g m e n t s o f 2660 and 1010 bp i n pAS3B c r e a t e d f r o m t h e 3 6 5 0 bp ( u p p e r m o s t ) f r a g m e n t o f pBD9 ( s e e t e x t f o r d e t a i l s ) .  151  could  pAS3B  subtilis  replicate  rrnB  3A,  Chapter  the  Sma s i t e  in  promoter  1), cloned  xylE  recombinant  clones  substantially vector  pAS3B  recombinant assess there  into  pAS3B  t h e Smal s i t e  c o l o n i e s with  smaller  a l l carried (by a b o u t  plasmids  (approximately  was some h e t e r o g e n e i t y .  authentic  indicating  o f about  a catechol plasmids  1 i n 20  colonies after  solution.  Of 10  but a l l plasmids  Restriction  were  the o r i g i n a l o f the to  o r whether  endonuclease  mapping  d i g e s t i o n of the x y l E  and BamHI, a f r a g m e n t  the cloned  Yellow  to  coli  14 Kb) i t was d i f f i c u l t  427 bp p r o m o t e r f r a g m e n t  that  to transform  t o t h e same e x t e n t  However, a f t e r EcoRI  (analogous  Because o f t h e l a r g e s i z e  whether a l l were d e l e t e d  recombinants with  of  r000-1500 bp) t h a n  ( d a t a n o t shown).  was n o t p e r f o r m e d .  the  from pKK-427B ( F i g .  kanamycin r e s i s t a n c e .  analyzed,  t h e 427 bp B.  f r a g m e n t was i s o l a t e d  ) were s e l e c t e d a t f r e q u e n c i e s  spraying  and E_^_ c o l i ,  o f pAS-3, F i g . 21) and used  HB101 t o e r y t h r o m y c i n , (xylE  subtilis  could  t h e same s i z e as be  p r o m o t e r was p r o b a b l y  liberated, unaltered.  When  +  plasmid  DNA  from  these  competent B_^ s u b t i l i s resistant occurred  during  recombinant  168 c e l l s ,  transformants  apparently  could  clones  no e r y t h r o m y c i n  be i s o l a t e d .  was added t o or kanamycin  The d e l e t i o n t h a t  t h e c l o n i n g o f t h e 427 bp p r o m o t e r  encompassed  t h a t were n e c e s s a r y  ii)  xylE  some r e g i o n s  for replication  In an a t t e m p t  therefore  o f t h e pBD9 p o r t i o n o f i n B_^  to reduce the s i z e  pAS3B  3 u b t l l i s .  o f the b i f u n c t i o n a l  152  vector,  a c o i n t e g r a t e between pAS-3  4.5 Kb p l a s m i d  This  aureus  was o r i g i n a l l y  linearized HB101.  with  i n this  host.  EcoRI , l i g a t e d ,  seen  to c a r r y  plasmids  plasmids.  the  of the upstream  loss this  Both  resistant  than  gave r i s e  on a g a r o s e  gels identical  t h a t pASUB-1 was i n d e e d  as w e l l ,  subtilis  t o kanamycin r e s i s t a n t  shown i n T a b l e  were  of the o r i g i n a l here  resulted i n  terminator present through  i n pAS-  transcription of  phenotype.  One o f t h e s e  EcoR1 and found i n size  t o g i v e two  to E c o R 1 - l i n e a r i z e d  ( d a t a n o t shown).  This  a c o i n t e g r a t e between t h e two  168 t r a n s f o r m e d c o l o n i e s with  6, b u t none o f t h e s e  suggesting  and pUB110 were  gene s i n c e a l l o f t h e a m p i c i l l i n - k a n a m y c i n  colonies displayed a xylE  parental plasmids.  and e x p r e s s  t o t r a n s f o r m E_;_ c o l i  either  to read  and E c o R I - l i n e a r i z e d pUB110  indicated  subtills  s t r a t e g y used  p l a s m i d s , pASUB-1, was d i g e s t e d w i t h fragments  Staphlococcus  c o l o n i e s which arose  transcription  a p p a r e n t l y d i d not lead  from  pAS-3  and used  larger  The c l o n i n g  the x y l E s t r u c t u r a l  pAS-3  in  Ampicillin-kanamycin r e s i s t a n t  parental  3;  isolated  (114, 151) b u t c o u l d r e p l i c a t e  kanamycin r e s i s t a n c e  all  and pUB110 was c o n s t r u c t e d .  with  DNA  the f r e q u e n c y  were r e s i s t a n t  t h a t t h e b l a gene o f pAS-3  pASUB-1  to a m p i c i l l i n  was n o t e x p r e s s e d  i n JB_^ s u b t i l i s .  The  427 bp  subtilis  rrnB promoter  fragment  was c l o n e d  +  into  t h e Smal s i t e  isolated. expected  o f pASUB-1 and x y l E  These r e c o m b i n a n t s size  E. c o l i  a l l carried  and a l l had p r o m o t e r i n s e r t s  transformants  plasmids  of the  of the c o r r e c t  size.  153  One  of these  subtilis  plasmids,  to k a n a m y c i n  pASUB-427B, was resistance.  used  to  transform  However, none o f  the  B. colonies  +  which a r o s e  displayed  the  plasmid  from 5 o f  these  clones  DNA  revealed  between 2 and this to  2.4  stable in  deletion  the  temperature  of  the  subtilis  of p l a s m i d s which  original  pASUB-427B.  b i - f u n c t i o n a l pASUB-427B v e c t o r but  t r a n s f e r to B_^ s u b t i l i s  x y l E s t r u c t u r a l gene, or  transposon  (153).  from S t r e p t o c o c c u s  by  integration  latter  host  B^  o f the  faecalls).  appeared  subtilis  o f Tn917 homology  a u t o n o m o u s l y i n E_j_ c o l i by  but  25  shows the  of  in  It  created  could  be  into  s t r u c t u r e o f one  as  pTV8  Tn917,  chromosome  be  well  resistance  result  (153).  i n t e g r a t i o n as a s i n g l e copy  Figure  the  f r o m pE194 as  C would  or  pTV8  Transformation  could  cloned  pTLXT-11  plasmid  carried  i n t o the  that b i - f u n c t i o n a l vectors  would r e p l i c a t e  on  c a r r y i n g a chromosomal copy o f o  region  In  resulted in  (a m a c r o l i d e - l i n c o s a m i d e  e n t i r e pTV8 v e c t o r  i n the  subtilis  functions  were  both.  based  plasmid  a t e m p e r a t u r e u p s h i f t to 42  recombination  chromosome.  This  Tn917 t r a n s p o s o n  a B_j_ s u b t i l i s  anticipated  from the  sensitive replication  complete  B^  presence  than the  fragments d e r i v e d  were c o n s t r u c t e d  followed  the  A number o f b i - f u n c t i o n a l v e c t o r s  pAS-3 and  into  Analysis  o f c e r t a i n pAS-3 r e l a t e d s e q u e n c e s i n v o l v i n g the  iii)  in  smaller  coli  promoter i n s e r t ,  the  kb  phenotype.  kanamycin r e s i s t a n t B_^  i n a l l cases,  case t h e r e f o r e , the  be  xylE  the by was  which  stabilized the  set of  these  154  F i g u r e 25. S t r u c t u r e of pCmTv-2/pASTV-l. pCmTv-2 was c r e a t e d from pTLXT-11 (see F i g . 21) by i n s e r t i o n o f a chloramphenicol a c e t y l t r a n s f e r a s e gene from pC194 i n t o t h e P s t l s i t e of pTLXT-11, f o l l o w e d by i n s e r t i o n o f a 6.8 Kb P s t l - Kpnl fragment from pTV-8 i n t o the P v u l s i t e o f pCmTv-2 (see t e x t f o r d e t a i l s ) . As i n d i c a t e d , t h i s fragment c o n t a i n s r o u g h l y t w o - t h i r d s o f the Tn917 transposon as w e l l as the t e m p e r a t u r e - s e n s i t i v e o r i g i n o f r e p l i c a t i o n from pE194 (denoted as " o r i " ) . A l l o t h e r sequences a r e as shown i n F i g . 21. pASTV-1 i s i d e n t i c a l to pCmTv-2 but w i t h the a d d i t i o n o f the lambda t R l t r a n s c r i p t i o n t e r m i n a t o r i n t o the Hpal s i t e as seen i n Fig.21. R e s t r i c t i o n s i t e s a r e : Ps, P s t l ; Pv, P v u l ; E, EcoRI; S, Smal; B, Bam HI; H, Hpal; K, Kpnl; Sa, S a i l ; A, A v a l .  155  p l a s m i d s , pCmTv-2 and pASTV-1. !1/pAS-3  was  inactivated  a 1032 bp M s p l - M b o l acetyltransferase pCm-2/pAS3C, potentially and  fragment  still  A 6.8  carrying  only  the unique  The r e s u l t i n g  replicate  Kb P s t l - K p n l  i n JL_ c o l i  The r e s u l t i n g of r e p l i c a t i o n  vectors, i n JL_ c o l i  fragment  and a b o u t  then i n s e r t e d  Pstl  site  the c h l o r a m p h e n i c o l  (146).  of r e p l i c a t i o n  Tn917 t r a n s p o s o n , was  capable  into  t h e b l a gene o f pTLXT-  express chloramphenicol r e s i s t a n c e  the o r i g i n  2/pAS3C  by i n s e r t i n g  gene o f pC194  could  B_j_ s u b t i l i s .  carrying  Initially,  into  plasmids,  but could  i n b o t h JL_ c o l i from  pTV8  (153)  t w o - t h i r d s of the  the Pvul  site  of  pCmTv-2/pASTV-1,  were  both  and i n B_^ s u b t i l i s  pCm-  (see Table  6).  In a d d i t i o n , into was  pAS3C. cloned  tained such  into  the P s t l  t h e new  recombinant  autonomously  integrate  into  lacking.  site  the pE194-derived  replicate  was  fragment  A 3400 bp EcoRI  only  that  a smaller  from  fragment  pASTV-1  This  (Table  inserted  ( s e e F i g . 25)  fragment  p l a s m i d , pAS3C-E was  since  also  of r e p l i c a t i o n  i n B_j_ s u b t i l i s  t h e chromosome  from  o f pAS3C. origin  pTV8 was  con-  from  pTV8  able to  6) b u t s h o u l d n o t  t h e Tn917 r e g i o n  o f homology  156  While p C m T v - 2 , E. c o l l  and  could  pASTV-1,  replicate  i n B^  a t t e m p t s were made t o i n s e r t activate be  the  isolated  x y l E gene. but  these  pAS3C-E a l l a p p e a r e d  and  the  subtilis. 427  bp  In a l l c a s e s ,  e i t h e r : a)  problems  rrnB  when  so  to  as  recombinants evidence  in  arose  promoter  xylE  showed no  stable  could  o f an  intact  +  promoter i n s e r t E. c o l i ) and they  could  be  r e t a i n i n g the used  were p h e n o t y p i c a l l y  427  bp  ing  only  inant and  (while  p r o m o t e r but the  to t r a n s f o r m  xylE  or b)  grew c o n s i d e r a b l y  parental  vector.  Thus, as  to t r a n s f o r m  B_;_  B_^  seen f o r p r e v i o u s  slower  smaller  Since vectors in  an  B_^ s u b t i l i s  of i n t e g r a t i v e plasmid  consistently failed,  attempt  Bacillus.  cells  contain-  latter  the  recomb-  original  problems  vector  rrnB  these  coincident  promoter.  pAS3C-l68.  to o b t a i n  a different  expression  of  the  a p p r o a c h was  rrnB-xylE  of r e p l i c a t i o n in this  host  i n IK_ s u b t i l i s by  c a r r y a segment o f DNA  may  nevertheless  i n t e g r a t i o n i n t o the having  homology t o JL_  taken  fusion in  O t h e r w o r k e r s have shown t h a t p l a s m i d s w h i c h  established they  intact  attempts at c o n s t r u c t i n g d u a l - o r i g i n b i - f u n c t i o n a l  had  incapable  where  bi-functional vectors,  the  Construction  in  subtilis.  with  2.  an  than  than  serious s t a b i l i t y  to i n s e r t  3 u b t i l i s  contained  plasmids a l s o d i s p l a y e d attempts  phenotype  In a d d i t i o n , t h e s e  p l a s m i d s were c o n s i d e r a b l y  were u n a b l e  xylE  are become  chromosome i f subtilis  157  chromosomal s e q u e n c e s  (96,  154).  replicated  coli  but  only  in  marker e x p r e s s i b l e i n both chromosomal DNA to p a r t i a l ligated HB101  was  to c h l o r a m p h e n i c o l  plasmid  DNA  analyzed  l a r g e r than  by  recombinant  plasmids  Pstl.  pAS3C-l68-4 contained  Pstl;  bp  whereas p A S 3 C - l 6 8 - 3 c o n t a i n e d bp.  subtilis  resistance 155  with  c o l o n i e s per  could  not  be  168  could  As  one  and  subjected  Two  then  clones  be  E_j_ c o l i  containing  were i d e n t i f i e d  s e e n i n F i g . 26, which c o u l d  be  liberated  of approximately  transformed  to  1100  of plasmid  detected  i n the  DNA  respectively.  transformants  could  after  xylE a c t i v i t y cloned  into  the  To  so see  bp  and  o f 420  Plasmid  i t was  and  DNA  assumed  i f these  i n t e g r a t i o n , the  Smal s i t e  1800  chloramphenicol-  e i t h e r -168-3 or -168-4 a t f r e q u e n c i e s ug  and  both  2 f r a g m e n t s o f about  occurred.  p r o m o t e r was  168  Total  to t r a n s f o r m  fragment  chromosomal i n t e g r a t i o n had express  used  inserts  by  1600  subtilis.  parental vector  contained  (above)  These f r a g m e n t s were  resistance.  d i g e s t i o n with  pAS3C  antibiotic-resistance  subtilis  pAS3C and  the  an  and  from  Pstl.  to P s t l - l i n e a r i z e d  plasmid  carried  E_;_ c o l i  isolated  d i g e s t i o n with  The  that  vectors  427  bp  rrnB  o f p A S 3 C - l 6 8 - 3 and  xylE  +  recombinants  isolated  were s t a b l e i n E ^ c o l i  from E^_ c o l i and  carried  HB101.  These x y l E  a promoter i n s e r t  clones of  correct size. When used to t r a n s f o r m B_j_ s u b t i l l s , c h l o r a m p h e n i c o l - r e s i s t a n t c l o n e s c o u l d be i s o l a t e d a t  the  frequencies +  similar  t o t h a t s e e n f o r the  phenotype was  only  p a r e n t a l v e c t o r , but  barely detectable  even a f t e r  the  the  xylE  plates  had  1  Figure 2 6 .  2  3  R e s t r i c t i o n endonuclease i n t e g r a t i v e plasmids.  d i g e s t i o n p a t t e r n of  pAS3C-168  Plasmid DNA was d i g e s t e d and e l e c t r o p h o r e s e d through a 4% p o l y a c r y l a m i d e g e l . Lane 1 , p A S 3 C - 1 6 8 - 4 d i g e s t e d w i t h P s t l ; Lane 2 , p A S 3 C - 1 6 8 - 3 d i g e s t e d w i t h P s t l ; Lane 3 , 0 2 9 d i g e s t e d w i t h H i n d l l l as m o l e c u l a r weight markers. Relevant s i z e s a r e noted a t the r i g h t , i n base p a i r s .  159  been  left  f o r several  substrate. could  Catechol  hours  described  than  50 u n i t s ) .  type  were  Thus  spraying  2,3-dioxygenase  n o t be a c c u r a t e l y  conditions  after  measured  with  activity  using  the  from  catechol  these  the standard  clones  assay  i n the M a t e r i a l s  and Methods  i t appeared  integrative vectors  not suitable  that  f o r the purposes  (activity  originally  less  of  this  outlined.  Discussion  The  goal  transferring  o f t h e above  a f u n c t i o n a l operon  subtilis.  In this  be  in parallel  studied  approaches  have  functional  plasmid  promoter-xylE constructed; that  entirely the  major  after  coli  i n these  taken.  integrate  either  which  JL_ c o l i  neither  i n JL_ c o l i  and c o u l d  frequencies.  pAS3B  transform  The o b s e r v e d  of cloned  E_j_ c o l i  promoters  To t h i s  be u s e d  could  vector  copy  was  into  of these  modified  t h e B_^  fragments.  and pASUB-1  differences  was vectors,  chimeric  t o B_^ s u b t i l i s ,  The b i - f u n c t i o n a l  were  B_j_ s u b t i l i s .  of the  such  s u b t i l i 3  approaches  transferred  a  has been  of the b i - f u n c t i o n a l  o r when  t o B.  e n d , two  to s h u t t l e  t o be t h e s t a b i l i t y  i n s e r t i o n o f promoter plasmids  from  and Jk_ s u b t i l i s  an J L _ c o l i  In the case  appeared  system  a means o f  a set of dual-originb i -  could  as a s i n g l e  Unfortunately,  to develop  two h o s t s .  Firstly,  between  was  fusion  the r e g u l a t i o n  vectors  fusion  problem  cointegrate E.  been  successful.  plasmids, or  way,  and s e c o n d l y ,  i t could  chromosome.  experiments  apparently  although  in  stable i n  a t low  transformation  160  frequency the  from  one  composition  differences plasmid  plasmid  o f the  to another  plasmids  per  may  s e , but  i n the degree o f m u l t i m e r i c  p r e p a r a t i o n to another.  that  efficient  only  achieved  not  multimers  are generated  different  plasmids  and  in  formations  Canosi  thus  lead  but  are  DNA.  to  shown  cells  was  Plasmid  could vary  to d i f f e r e n c e s  of  one  have  subtilis  this  due  from  e_t a l _ . (155)  forms o f p l a s m i d coli  a reflection  probably  t r a n s f o r m a t i o n o f competent using multimeric  be  for  in transformation  efficiency.  Both of  the  427  x y l E gene. deletion still  bp  B^  subtilis  In the  replicate  the  pASUB-1 were r e n d e r e d  case  in  unstable  r r n B p r o m o t e r and  of  pAS3B,  of v e c t o r sequences  subtilis. on  and  pAS3B  coli  such  but  Thus i t a p p e a r e d  this  by  activation  resulted  t h a t the  longer  c l o n e was  transform  Bacillus-specific  transform  but  subtilis  the  stable  i n E_j_ c o l i  resulting  the  plasmids  c h i m e r i c v e c t o r s were t a r g e t e d f o r d e l e t i o n .  a promoter-containing  of  in extensive  that,recombinant  c o u l d no  insertion  B_^ s u b t i l i s  B.  sequences  In  and  could  pASUB-1,  could recombinant  +  plasmids this  were d e l e t e d and  case  although  t h e r e f o r e , an this  A similar vectors  was  not  maintain  E_;_ c o l i - s p e c i f i c  directly  situation  i n t h a t they  d i d not  a xylE  phenotype.  s e q u e n c e may  be  deleted  verified.  occurred  were s t a b l e  with  the  i n E_^ c o l i  pASTV/CmTv s e t and  could  In  of  transform  161  B. s u b t i l i s . deletions E.  coli  However, when t h e r r n B  were g e n e r a t e d  p r o m o t e r was  either directly  a stable xylE  these  autonomously r e p l i c a t i n g v e c t o r s .  instability  i n the development  IL_ s u b t i l i s .  hybrid  p h e n o t y p e be m a i n t a i n e d  stable  i n JL_ c o l i  t h e E_;_ c o l i h i s G  but s u f f e r e d  introduced  into  B_;_ s u b t i l i s .  157)  that  B_^ s u b t i l i s  subsequently  re-introduced  deletions  B a c i l l u s host.  of cloned  U 3 i n g  of plasmid  documented  and a r e a  cloning  stable  deletions  i n both  that  system a  were  extents  when  i n JL_ c o l l and  v i a a bi-f unctional  involved  both vector  and  by t h e use o f an r ,m  i t s e l f , without  hosts.  appeared  i n s e r t s through  to v a r i o u s  i n t o B_^ s u b t i l i s  The v e c t o r  instability  Such h y b r i d s  DNA s e q u e n c e s c l o n e d  s e q u e n c e s and were n o t p r e v e n t e d  structural  subtili3  S i m i l a r l y , O s t r o f f and Pene (152,  insert  B.  severe  gene.  underwent  was u n i f o r m l y  I n no c a s e  pSA2100 and a pBR322  vector  recEM  B_j_  of  G r a n d i e_t a l . . (156) f o r example, c o n s t r u c t e d  carrying  noted  in  o f an e f f i c i e n t  between t h e B a c i l l u s p l a s m i d  derivative  host.  Instances  s i m i l a r t o t h e s e have been w e l l  major p r o b l e m for  after transformation  o r a f t e r r e - t r a n s f e r t o a B_^ s u b t i l i s  could  Inserted,  cloned  In a d d i t i o n ,  inserts,  the problem o f  t o be due s o l e l y t o t h e p a s s a g e  E_j_ c o l i p r i o r t o r e - i n t r o d u c t i o n  into  subtilis.  The other  reason  f o r the s t a b i l i t y  w o r k e r s , as w e l l  Ehrlich  as i n t h i s  problems report,  e_t a_l. (150) have p o s t u l a t e d  of a h i g h l y  efficient  recombination  observed  by t h e s e and  are not e n t i r e l y  the existence mechanism w h i c h  clear.  in Bacillus i s a c t i v e on  sequences with  only  l i m i t e d amounts o f homology.  between s e q u e n c e s w i t h i n vector  s e q u e n c e s would  which would this  a cloned  lead  hypothesis  Alternatively,  frequently,  DNA m o l e c u l e s w i t h i n O s t r o f f and Pene  the uptake o f plasmid transforming  functional  thus n e c e s s i t a t e significance relatively Pene  with  could  (158),  exceed  that  events  necessary Since the  trimers  which a r e  and s u b s e q u e n t l y  the large  s i z e o f most b i -  of processed  (157).  vectors  used  here  were  from  11 t o 15 Kb.  (157) have s u g g e s t e d  that  some as y e t u n i d e n t i f i e d  i n chimeric  I t must be n o t e d  Finally,  s y s t e m o f B_j_ s u b t i l i s .  sequences modified however, t h a t  DNA and  I t may be o f  l a r g e , ranging  instability  some  cells  weak h3dM,R s y s t e m t h u s f a r i d e n t i f i e d ,  coli.  (159).  transformation.  the l e n g t h  the h y b r i d  restriction-modification the  the c e l l  competent  some d e l e t i o n e v e n t s  then t h a t  plasmids  t h e y can e x i s t as  processing  DNA d u r i n g  variants Supporting  (157) have s u g g e s t e d  t h e DNA  a f t e r uptake  vectors  B_^ s u b t i l i s  DNA m o l e c u l e s a r e c h i m e r i c  upon c o n t a c t  recircularized  that  of deleted  population.  p o s s i b l y because  d e l e t i o n s may o c c u r d u r i n g  linearized  to the formation  i s the o b s e r v a t i o n  single-stranded  active  o r between i n s e r t and  soon p r e d o m i n a t e i n t h e c e l l  recombine very  for  insert  Recombination  O s t r o f f and  different  could  also  from  generate  by p a s s a g e t h r o u g h E.  stability  p r o b l e m s were n o t  a p p a r e n t when p l a s m i d s c a p a b l e o f i n t e g r a t i o n i n t o t h e B. subtills It  chromosome were used  i s possible  that  as e x p r e s s i o n  the multicopy  nature  vectors  (see below).  of the b i - f u n c t i o n a l  163  hybrid  vectors  instability hypothesis the  above i s a c o n t r i b u t i n g  i n Jk_ s u b t i l i s . put  f o r t h by  most r e a s o n a b l e .  instability functional for  used  the  or  the  Whatever  vectors  hybrid  studies  of  used  fusion  reason  here,  vectors  their that  of  the  pAS3C-l68-4.  suitably  a b o v e ) may  f o r the  be  structural  i t i s clear that b i -  of  namely as  large  this  Here i s was  region  of  vector  lead  i n t e g r a t i o n of  to  to  integratable  plasmid  this  type are  a means o f  goal  unsuitable  undertaking i n two  reasoned  the  not  previously  a number o f  different  genes  (96).  (154),  Both pAS3C-l68-3 and  chromosomal s e q u e n c e s and  subtilis  168 as  transformed  to c h l o r a m p h e n i c o l  the  into  I t must be  introduction  the  event.  i n the  onto  This  not  mapping  while  pointed  out  been d e m o n s t r a t e d  B. not  the  however t h a t  here,  RNA  apparently in  of  contain  transform  o f chromosomal i n t e g r a t i o n , v i a S o u t h e r n h y b r i d i z a t i o n example, has  approach  -168-4 were shown t o  resistance  a  would  including ribosomal  both could  of  Bacillus  genetic  autonomously r e p l i c a t i n g m o l e c u l e s cells.  pAS3C-l68-3  chromosomal DNA  useful  Bacillus  remaining  the  vectors  that  e n t i r e plasmid  genes  in  r e p l i c a t e i n B_;_ s u b t i l i s  been shown t o be  IL_ s u b t i l i s  taken  expression  subtilis  which c o u l d  was  chromosome v i a a homologous r e c o m b i n a t i o n  for  the  organisms.  construction  had  see  a p a r t i c u l a r gene s e q u e n c e  A d i f f e r e n t approach  and  the  to  seem t h e r e f o r e  E h r l i c h e_t a l _ . (150,  purposes intended,  parallel host  of  I t would  factor  although  proof analysis  the  a  164  circumstantial the  evidence  as d i s c u s s e d above p o i n t s t o t h i s  being  case.  Even t h i s  however was  not  a completely  suitable  fusion  +  system b e c a u s e a l t h o u g h B.  subtilis,  too low  the  t o be  efficiently  translated  in Bacillus  p r e s u m a b l y due  chromosome i n B_^ s u b t i l i s  t h e r e f o r e be  Bacillus, (160). tR1  based  t e r m i n a t o r has  reduce overall  fusion  of  had  had  low  level  o f two  reduced  was  other  o c c u r r e d , the  been r e d u c e d  i n c o n t r a s t t o the  copy  to  one  multicopy,  Overall  as much as  xylE 15-20  the pAS3C-l68 v e c t o r s c o n t a i n e d  RNA  proximal  p o l y m e r a s e complex (141),  same e x t e n t  so i t can  be  recognized i n an  the lambda t e r m i n a t o r  here.  in. v i v o as w e l l .  from  While  transcripts  activity fold  in  this  by  lambda This  a  B.  vitro that i t i s  T h i s would and  to l e v e l s  i t would be  pAS3C-l68,  in  assumed  c a t e c h o l 2,3-dioxygenase a c t i v i t y employed  the  to the x y l E gene.  been shown t o be  t h e number o f x y l E - s p e c i f i c  the a s s a y  the  to a combination  t o be  terminator  system  t o the  was  in  t h e known copy number o f pBR322 i n JL. c o l i  recently  sigma-55  transcription  by  on  transcription  operable  (126),  the x y l E mRNA  s t a t e i n JL_ c o l i .  expected  Additionally,  subtilis  Since  B e c a u s e chromosomal i n t e g r a t i o n  autonomously r e p l i c a t i n g may  expressed  of c a t e c h o l 2,3-dioxygenase a c t i v i t y  level  number o f the r r n B p r o m o t e r - x y l E per  p h e n o t y p e c o u l d be  a c c u r a t e l y measured.  e x p r e s s i o n was factors.  the x y l E  reduce  further the  unmeasurable  p o s s i b l e t o remove  would  have a s e r i o u s  165  drawback i n t h a t again the  be  the  unstable  plasmids  tandem r r n B  in  coli  much more  promoter-xylE  and  f u s i o n s would  make s u b s e q u e n t  manipulation  both  been d e v e l o p e d ,  but  coli this  i t has  expression B.  not  encountered fusion  into  of only  Summary and  The  the  can  be  and  major  of  the E_j_ c o l i  and  problem  i n t r o d u c t i o n of  promoter  O t h e r mechanisms, p o s s i b l y gene as  have to be  presented the  the  a portable  the  "cassette"  considered.  means o f a s s e s s i n g  above o u t l i n e a means whereby  B_^ s u b t i l l s i n E_^ c o l l .  promoter  such f u s i o n systems  A number o f o p e r o n  i n both  The  of  Because  compare  has  Remarks  expressed  through a f u s i o n of  valid  of  measurements  promoters.  intent.  promoter-xylE  chapters  promoter r e g i o n cloned  allow  promoters  to i n v o l v e the  B_^ s u b t i l i s .  Concluding  three  cloned  rrnB  original  phage, may  the  o f two  the  here appeared  onto a B a c i l l u s  these  B_^ s u b t i l i s  as was  vectors  transfer  of  cloned  (via pAS3C-l68-3)  B_^ s u b t i l i s  been p o s s i b l e t o e f f e c t i v e l y  o f the  subtilis,  and  approach d i d not  the d e g r e e o f e x p r e s s i o n this,  of  difficult.  In c o n c l u s i o n , a means o f s t a b l y i n t r o d u c i n g s t r o n g promoters i n t o  once  to an  tested, only  rrnB  T h i s has assayable one  promoter a c t i v i t y  fusion-type  ribosomal  was  been  RNA  operon  achieved  marker gene found  to be  jLn v i v o .  expression  vectors  were  but a  166  created  based  on  the  catechol  Pseudomonas p u t i d a . in  the  c l o n i n g and  promoters,  While  these  maintenance  t h e y were n o t  transcriptional  activity  of  under d i f f e r e n t  conditions,  i t appeared  obscured  to o t h e r , the  promoters.  true  only  be  valid  equivalent  or  negative  the  xylE  of  attempts such  vectors  previous  xylE  activity  system,  that  they  the  fusion  of  host  the  the  cells  Under  system  such  was  or  cloned of  p r o m o t e r s would of  useful  strong  a comparison  E_;_ c o l i  host  the  expression  and  the  therefore  cells  RNA  were  original  as  most o t h e r  could  be  led  E_j_ c o l l  stability any  such  to  and  xylE-  promoter-probe This  was  Gram-  efficiently to  the  b i - f u n c t i o n a l fusion vectors  i n both  of  the  B_j_ s u b t i l i s .  These a t t e m p t s  of  x y l E gene, s e r i o u s  serve  that, unlike  x y l E messenger  o f a number  could  However, once p r o m o t e r s were i n s e r t e d  prevented  very  p a r a m e t e r s w h i c h masked  conditions  i n both  were shown t o r e p l i c a t e  the  operon  were made to m o d i f y  i n B_^_ s u b t i l i s .  construction  of  weak and  generally  p r o m o t e r s when t h e  different  observations  genes, the  translated  the  growth  fusion vectors  on  be  physiological conditions.  transcriptional  i f the  may  of  i n a l l cases.  expression  based  cloned  that  activity  Furthermore, based  of both  ill-defined,  When u s i n g  transcriptional  vectors  ( x y l E ) gene  suitable for assessing  were p l a c e d  sensitive  2,3-dioxygenase  which  subtilis.  activate transcription  problems arose promoter-fusion  which system  in  167  B.  subtilis.  These s t a b i l i t y  if  the  f u s i o n was  operon  problems c o u l d  i n t e g r a t e d as  apparently  a single  copy  be  into  avoided the  B.  + subtilis  chromosome.  phenotype was reduced  very  poor under such  copy number and  transcription structural for  Unfortunately,  other  While  purposes  between these  cloned  sequences i n t o  fulfill in  the  original  the  intent  i t was  subtilis  rrnB  these  only  the r e g u l a t i o n o f t h e s e native  E_^ c o l i  account  In t h i s subclones  overly  system,  maintenance E\_ c o l i  specific  provided  the  the  (CAT)  of s t r o n g c o u l d be  activity.  useful  strong  integration  of  did  different  expression E_j_ c o l i  not the  hosts.  of  the  B.  background,  some s u b s t a n t i a l  p r o m o t e r s , and  insight  when compared  to  that present  r e g u l a t i o n of  into  the  models  to  rRNA  simplistic. B_j_ s u b t i l i s  t h e r e o f , were f u s e d  acetyltransferase  in  p r o m o t e r i n two  a xylE  o f p r o v i d i n g a means o f s t u d y i n g  rRNA p r o m o t e r s , s u g g e s t e d  be  the be  chromosome), t h e y  f o r the g r o w t h r a t e d e p e n d e n t  s y n t h e s i s may  the  and  of very  i n JL_ c o l i ;  i n a heterologous  studies nevertheless  of  undoubtedly  expression  p o s s i b l e to s t u d y  promoters  promoter  v e c t o r s would  B_^ s u b t i l i s  xylE  n e c e s s i t y of r e t a i n i n g  cloned  promoters  vivo r e g u l a t i o n of a given  Although  the  ( i . e . c l o n i n g and  homologous o r h e t e r o l o g o u s  o f the  c o n d i t i o n s because  because of the  terminator  gene.  expression  on  rrnB  t o the gene f o r  a multicopy  promoters.  indirectly  tandem p r o m o t e r s ,  The  chloramphenicol  plasmid  that permitted  ill v i v o promoter  determined  A number o f c o n t r o l  by  or  measuring  experiment  the  activity the  showed  CAT this  168  measurement was  to be  directly  entirely  valid  proportional  produced  by  the  subtills  rrnB  to  since  the  the  CAT  specific  amount o f  CAT  gene m e s s e n g e r  promoter f u s i o n .  I t was  p r o m o t e r s were e x p r e s s e d  manner i n E_^ c o l i ,  i n the  observed  that  activity  the  i n a growth r a t e  same f a s h i o n  as  the  native  RNA  B.  dependent  E_;_ c o l i  rrnB  promoters.  While  i t had  been known f o r some t i m e  subtills  genes c o u l d  E.  the  coli,  level  mechanisms, a t  i s c o n c e r n e d , may  between t h e s e conservation of  two  i s true  suggest  components o f negative out  and  the  shared that  by  very  B.  subtilis,  of  the  further  divergent  ribosomal  organisms.  but  the  the  Whether  conservation  and  E_j_ c o l i  conservation  not  extend  Jk_ s u b t i l l s . genes or  i n d i c a t i n g that  to  presented  among  of higher  a l l genes or  This  promoters  to  foreign  sequences  that  iii vivo  studies  o f B_^ s u b t i l i s  i t can  by  the  efficiently  regulate.  g e n e s and  point  operons  Bacillus i s less flexible  types of  Gram-  level  i s evidenced function  this  expression  results  organisms. I t i s important  possible  RNA  interchangeable  factors regulating  determined,  in  higher  t r a n s c r i p t i o n - t r a n s l a t i o n apparatus of  mechanisms may  few  f a r as  B.  efficiency  that  functionally  evolutionary  Gram-positive  E^ c o l i  reasonable  l e a s t as  f o r those  to be  a strong  however t h a t  regulatory  only  with  a number o f  here demonstrated  a l s o be  evolutionary  rRNA genes r e m a i n s  h e r e do  transcribed  f i n d i n g s presented  regulatory  synthesis  be  that  in  fact in  terms Clearly,  promoters  in  169  Bacillu3  are r e q u i r e d .  Furthermor,  i t i s clear  c a n t d i f f e r e n c e s do and  coli  downstream P2 Jk_  the  was  regulated  individually s u b t i l l 3  of sequences  promoter  resulted  expression  growth  upstream  dependent  were l a r g e l y  antitermination  Here  coli  effect  strong, that  however, i t was from t h e X  on downstream  read  emanating  P1  level  shown  subtilis  expression.  this  f r o m t h e E_j_ c o l i  t h r o u g h a downstream  terminator,  f u n c t i o n s were e i t h e r  rRNA p r o m o t e r s o r s i m p l y  the  of  showed  r e d u c t i o n i n the o v e r a l l  T r a n s c r i p t s from by  promoter  promoters  was  P2  the t e r m i n a t o r - c o n t a i n i n g x y l E f u s i o n  efficiently  blocked  the  o f t h e EL_ c o l i  transcripts  terminator.  shown t h a t  site  r e g i o n had  promoters c o u l d  and  o f t h e -35  r r n B promoter  that  P1  found  of the analogous sequences  indicated  closely.  have  that d e l e t i o n  vector  subtilis  others  promoter.  Furthermore, s t u d i e s with  o f B_^  rrnB  i n t h a t P1  in a significant  no  signifi-  rate regulated  t h e JL_ c o l i  Additionally,  o f t h e P1  that  c l o n i n g the upstream  pattern of expression  promoter.  more  p r o m o t e r s , i t was  Conversely,  deletion  of  study  when t h e e x p r e s s i o n  t h e more a c t i v e ,  tandem p a i r .  the r e v e r s e  this  rRNA p r o m o t e r s a r e examined  By s e p a r a t i n g and  promoter  exist  from  rho-  t h e B_^ s u b t i l i s indicating  not present  were n o t f u n c t i o n a l  rrnB  promoters  that  i n B_j_ s u b t i l i s  i n a heterologous  E.  host.  It  appears t h e r e f o r e t h a t a p r e c i s e analogy  t o JL_ c o l i  rRNA  170  p r o m o t e r s i s not rate  without  any  rich  For  since  this  located  promoters i n both  coll  enhancement o f  expression could  be  without it  may  any  the  change i n the  mechanisms p r o p o s e d  so  indeed  be  to  placement  of  upstream and  B^  of  i n B_;_  act  this  level  changes t h a t  from  i s not  of  response  expression.  as  pointed  highly  or  for in  this  the  region  promoters In  c o n t r o l of growth  i n E_^_ c o l i ,  the  required  since  of  promoter  o f a l l P1  expression  B_^ s u b t i l i s  the  strong,  subtilis  region  the  pattern  presented  ensure at  the  be  could DNA  -35  the  subtilis  overall  a  weaker, n o n - r e g u l a t e d reversed  can  increasing  to e x p l a i n  evidence  i n ways t h a t may  c h a n g e s i n the but  the  the  these  of  this the  out  regard  various  rate in  the  1).  mechanisms t h a t  Possibly  of  response  of  growth  promoters,  some f e a t u r e s  (Chapter  From the  rRNA do  example,  rrnB  to r e - e v a l u a t e  d e p e n d e n t gene e x p r e s s i o n  the  subtilis  their  could  deleted  necessary  Discussion  certain features  of a growth r a t e dependent  completely  be  the  a characteristic  l o s s of growth r a t e r e g u l a t i o n . S e c o n d l y ,  sequence  either  by  promoter upstream  unnecessary  that  elicited;  diminishing  growth r a t e .  regulated  A-T  illustrated  a l t e r e d without  cellular  is  i n order  d e p e n d e n t r e s p o n s e be  p r o m o t e r s , as be  necessary  the level  been c o n c l u d e d  o f rRNA than  operon  previously  brought  growth r a t e about  by  that  synthesis  promoters but  of  do  anticipated.  some s e q u e n c e - s p e c i f i c  surrounding be  i t has  growth r a t e dependent  more s u b t l e  involve  can  here  regulated  a number o f  conformational promoters, different  171  but  analogous sequences. between  "fine-tune  n  the  level  a given  set  of growth c o n d i t i o n s ,  Furthermore,  the  rRNA o p e r o n s on to  the  address and  further  the  and  P2  are  in vivo  here, such  but  there  may  as  to  the  and with  studies  the  they  which remain  iri v i t r o  studies  to  appropriate  i n Chapter  1.  individual  are  a l l regulated  unanswered. are  the  operon  fusion  may  now  possible.  be  serves  postulated  whether  an  extent  i n t e r a c t i o n s between  questions  be  promoters which  rRNA s y n t h e s i s  chromosome, or  these p o i n t s  tested  of  possible  same e x t e n t ,  Clearly,  P1  addition,  interaction  for  the  In  necessary  vectors  to  described  172  REFERENCES  1. Wittmann, H.G. 1982. Components of b a c t e r i a l Ann. Rev. Biochem. _5_1, 155-183.  ribosomes.  2. Schaechter, M., 0. Maaloe, N.O. K j e l d g a a r d . 1958. Dependency on medium and temperature of c e l l s i z e and chemical composition d u r i n g balanced growth of S a l m o n e l l a typhimurium. J . Gen. M i c r o b i o l . • 1_9, 592-606. 3. Maaloe, 0. and N.O. K j e l d g a a r d . 1966. " C o n t r o l of Macromolecular S y n t h e s i s " . Benjamin, New York. 4. L i n d a h l , L. and J . Zengel. 1982. E x p r e s s i o n of genes i n b a c t e r i a . Adv. G e n e t i c s . 2_1, 53-121. 5. Neidhardt, synthetase  ribosomal  F. 1975. F u n c t i o n and r e g u l a t i o n of amino-acyl tRNA i n p r o c a r y o t i c and e u c a r y o t i c c e l l s . Ann. Rev. Micro.29,215.  6. Dunn, J . and F. S t u d i e r , 1973. T7 e a r l y RNA's and E . c o l i ribosomal RNA's are cut from l a r g e p r e c u r s o r RNA's i n v i v o by r i b o n u c l e a s e I I I . Proc. N a t l . Acad. S c i . USA 70, 32963300. 7-. A p i r i o n , D. , B. Ghora, G. P l a u t z , T. M i s r a , P. Geggenheimer. 1980. P r o c e s s i n g o f ribosomal and t r a n s f e r RNA i n E . c o l i : c o o p e r a t i o n between p r o c e s s i n g enzymes. i n " T r a n s f e r RNA: B i o l o g i c a l Aspects. (J. Abelson, ed.) pp. 139-154. Cold Spring Harbor L a b o r a t o r i e s , Cold S p r i n g Harbor, New York. 8. K i s s , A., B. S a i n , P. V e n e t i a n e r . 1977. in E.coli. FEBS L e t t . 79, 77-79. 9. Ellwood, M. and M. operon i n E . c o l i . 10. Bachman B. 1983. Micro. Rev. 47,  Nomura. 1980. J. B a c t e r i o l .  Linkage map 180-230.  The number of rRNA genes  D e l e t i o n of a ribosomal 143, 1077-1080.  of E . c o l i K-12,  11. Ohtsubo, E...L. S o l i , R. Deonier, H. Lee, N. E l e c t r o n m i c r o s c o p i c heteroduplex s t u d i e s of among pl^smi_ds of E . c o l i . V I I . The s t r u c t u r e 08Od-ilv su 7, i n c l u d i n g the mapping o f rRNA 89, 63T 646.  Edition  RNA  7.  Davidson. 1974. sequence r e l a t i o n of b a c t e r i o p h a g e genes. J . Mol. B i o l .  :  12. Morgan, E., T. Ikemura, M. Nomura. 1977. I d e n t i f i c a t i o n of spacer tRNA genes i n i n d i v i d u a l rRNA t r a n s c r i p t i o n u n i t s of E . c o l i . Proc. N a t l . Acad. S c i . USA. 74, 2710-2714.  173  13. Nomura, M. and L. Post. 1980. O r g a n i z a t i o n of ribosome genes and r e g u l a t i o n of t h e i r e x p r e s s i o n i n E . c o l i . i n "Ribosomes: S t r u c t u r e , F u n c t i o n , and G e n e t i c s . (G.Chambliss, G.Craven, J.Davies, K.Davies, L.Kahan, M.Nomura, ed.) pp. 671-692. Univ. Park. P r e s s , B a l t i m o r e . 14. Nomura, M., R. Gourse, G. Baughman. 1984. R e g u l a t i o n of s y n t h e s i s °f ribosomes and r i b o s o m a l components. Ann. Rev. Biochem. 53, 75-117. 15. G l a s e r , G. and M. C a s h e l . 1979. In v i t r o t r a n s c r i p t s from the rrnB r i b o s o m a l c i s t r o n o r i g i n a t e from two tandem promoters. C e l l . 16, 111-121. 16. G i l b e r t , S. , H. deBoer, and M. Nomura. 1979 . I d e n t i f i c a t i o n of i n i t i a t i o n s i t e s f o r the i n v i t r o t r a n s c r i p t i o n of rRNA operons r r n E and r r n A i n E . c o l i . C e l l . 17, 211-224. 17. Rosenberg, M. and the promotion and _13, 319-353.  D. Court. 1979. R e g u l a t o r y sequences i n v o l v e d i n t e r m i n a t i o n of rRNA t r a n s c r i p t i o n . Ann. Rev. Genet.  18. T r a v e r s , A. 1980. Promoter sequence f o r s t r i n g e n t c o n t r o l o f b a c t e r i a l r i b o n u c l e i c a c i d s y n t h e s i s . J . B a c t e r i o l . 141, 973-976. 19. L i , S. , C.L. S q u i r e s , and C. S q u i r e s . 1984. A n t i t e r m i n a t i o n ••of E . c o l i rRNA t r a n s c r i p t i o n i s c a r r i e d out by a c o n t r o l r e g i o n segment c o n t a i n i n g lambda n u t - l i k e sequences. C e l l . 3_8, 851-860. 20.  Duester, G. and W. Holmes. 1 9 8 0 ^ The d i s t a l end of the rRNA operon rmD of E . c o l i c o n t a i n s a tRNA gene, two 5S rRNA genes and a t r a n s c r i p t i o n terminator. N u c l e i c A c i d s Res. 8_, 3793-3807.  21.  B r o s i u s , J . , T. D u l l , D. S l e e t e r , and H. N o l l e r . 1981. Gene o r g a n i z a t i o n and primary sequence of a r i b o s o m a l RNA operon from E.coli. J . Mol. B i o l . 148, 107-128.  22. Young, R., R. M a c k l i s , J . S t e i t z . 1979. Sequence of the 16S-23S spacer r e g i o n i n two r i b o s o m a l RNA operons of E . c o l i . . J . B i o l . Chem. 254, 3264-3271. 23. P i a t t , T. 1981. T e r m i n a t i o n of t r a n s c r i p t i o n and i t s r e g u l a t i o n i n the tryptophan operon of E . c o l i . C e l l . ^4. 10-23. 24.  Sarmientos, P., J . S y l v e s t e r , S. Contente, M. Cashel. 1983. D i f f e r e n t i a l s t r i n g e n t c o n t r o l of the tandem E . c o l i rRNA promoters from rrnB expressed i n v i v o i n m u l t i c o p y plasmids. C e l l . 32, 1337-1346.  25. Liebke, H. and G. H a t f u l l 1985. The sequence of the d i s t a l end of the E . c o l i r r n E operon i n d i c a t e s conserved f e a t u r e s shared by r r n operons. N u c l e i c A c i d s Res. _L3, 5515-5525.  174  26. Gausing, K. 1977. R e g u l a t i o n of ribosome p r o d u c t i o n i n E.coli: S y n t h e s i s and s t a b i l i t y o f rRNA and r i b o s o m a l p r o t e i n mRNA a t d i f f e r e n t growth r a t e s . J . Mol. B i o l . 115, 335-354. 27. M o l i n , S, 1976. Ribosomal c h a i n e l o n g a t i o n r a t e i n E . c o l i . i n " A l f r e d Benzon Symp. IX. C o n t r o l o f Ribosome S y n t h e s i s " (N.Kjeldgaard and O.Maaloe, ed.) pp. 333-339. Munksgaard, Copenhagen. 28. Muto, A. 1978. C o n t r o l o f rRNA s y n t h e s i s i n E . c o l i . IV. Frequency of t r a n s c r i p t i o n o f r i b o s o m a l RNA genes as a f u n c t i o n of growth r a t e . Mol. Gen. Genet. 164, 39-44. 29. T r a v e r s , A., A. Lamond, H. Mace, M. Berman. 1983. RNA polymerase i n t e r a c t i o n w i t h the upstream r e g i o n o f the E . c o l i t y r T promoter. C e l l . 25, 265-273. 30. B o s s i , L. and D. Smith. 1984. C o n f o r m a t i o n a l changes i n t h e DNA a s s o c i a t e d w i t h an unusual promoter m u t a t i o n i n a tRNA gene o f S a l m o n e l l a. Cell. 39, 643-652. 31. Gourse, R. , H. deBoer, M. Nomura. 1986- DNA d e t e r m i n a n t s o f rRNA s y n t h e s i s i n E . c o l i : growth r a t e dependent r e g u l a t i o n , feedback c o n t r o l , upstream a c t i v a t i o n , a n t i t e r m i n a t i o n . Cell. 4-4, 197-205. 32. Lamond, A. and A. T r a v e r s . 1983. Requirement f o r an upstream element f o r o p t i m a l t r a n s c r i p t i o n o f a b a c t e r i a l tRNA gene. Nature. 305, 248-250. 33. Wu, H. and D. C r o t h e r s . 1984. The l o c u s o f s e q u e n c e - d i r e c t e d and p r o t e i n - i n d u c e d bending. Nature. 308, 509-513. 34. Hagerman, P. 1984. Evidence f o r the e x i s t e n c e o f s t a b l e c u r v a t u r e of DNA i n s o l u t i o n . Proc. N a t l . Acad. S c i . USA. 81_, 4632-4636. 35. Adhya, S. and M. Gottesman. 1978. C o n t r o l o f t r a n s c r i p t i o n ination. Ann. Rev. Biochem. 4_7, 967-996.  term-  36..'Morgan, E. 1980. I n s e r t i o n s o f TnlO i n t o an E . c o l i r i b o s o m a l RNA operon a r e i n c o m p l e t e l y p o l a r . Cell. 2_1_, 257-265. 37. Brewster, J . and E. Morgan. 1981. Tn9 and IS1 i n s e r t s i n a r i b o s o m a l RNA operon of E . c o l i a r e i n c o m p l e t e l y p o l a r . J. Bacteriol. 148, 897-903. 3 8 . Holben, W. and E. Morgan. 1 9 8 4 . A n t i t e r m i n a t i o n o f t r a n s c r i p t i o n from an E . c o l i rRNA promoter. Proc. N a t l . Acad. S c i . USA. 8J., 6 7 8 9 - 6793. 39.  Friedman, D. and M. Gottesman. 1 9 8 3 . L y t i c mode o f lambda d e v e l o p ment, i n "Lambda I I " (R.Hendrix, ed.) Cold S p r i n g Harbor L a b o r a t o r y , pp. 2 1 - 5 1 .  175  40.  G r e e n b l a t t , J . and J . Li-. 1981. I n t e r a c t i o n of the sigma f a c t o r and the nusA gene p r o t e i n of E . c o l i w i t h RNA polymerase i n the i n i t i a t i o n - t e r m i n a t i o n c y c l e of t r a n s c r i p t i o n . C e l l . _24, 421-428.  41.  Friedman, D. and M. Gottesman. 1983. ment, i n "Lambda I I (R.Hendrix, ed.) pp. 21-51.  42.  Salstrom, J . and W. S z y b a l s k i . 1978. C o l i p h a g e lambda nutL : a unique c l a s s of mutants d e f e c t i v e i n the s i t e of gene N product u t i l i z a t i o n f o r a n t i t e r m i n a t i o n of l e f t w a r d t r a n s c r i p t i o n . J . Mol. B i o l . 124, 195-221.  43.  Friedman, D. and E. O l s o n . 1983. E v i d e n c e t h a t a unique sequence, "box A", i s i n v o l v e d i n the a c t i o n of the nusA p r o t e i n . Cell. 24, 143-149.  44.  L i , S. , C.L. S q u i r e s , C. S q u i r e s . 1984. A n t i t e r m i n a t i o n of E . c o l i rRNA t r a n s c r i p t i o n i s caused by a c o n t r o l r e g i o n segment c o n t a i n i n g lambda n u t - l i k e sequences. Cell. _38_, 851-860.  45.  Holben, W. , S. P r a s a d , E. Morgan. 1985. A n t i t e r m i n a t i o n by b o t h the promoter and l e a d e r r e g i o n s of an E . c o l i rRNA operon. Proc. N a t l . Acad. S c i . USA. 82_, 5073-5077.  46.  Sharrock, R., R. Gourse, M. Nomura. 1985. Defective antitermination of rRNA t r a n s c r i p t i o n and d e r e p r e s s i o n of rRNA and tRNA s y n t h e s i s i n the nusB5 mutant o f E . c o l i . Proc. N a t l . Acad. S c i . USA. 82, 5275-5279.  47.  S t e n t , G. and S. Brenner. 1961. of r i b o n u c l e i c a c i d synthesis. 47, 2005-2014.  48.  N i e r l i c h , D. 1978. protein synthesis.  49.  G a l l a n t , J . 1979. 2 3 , 393-415.  50.  Stephens, J . , S. A r t z , B. Ames. 1975. Guanosine-5 -diphosphate3 ' - d i p h o s p h a t e : P o s i t i v e e f f e c t o r f o r h i s t i d i n e operon t r a n s c r i p t i o n and g e n e r a l s i g n a l f o r amino-acid d e f i c i e n c y . P r o c . N a t l . Acad. S c i . USA. 72, 4389-4392.  51.  L i t t l e , R. and H. Bremer. 1984. T r a n s c r i p t i o n of r i b o s o m a l component genes and l a c i n a r e l A / relA p a i r of E . c o l i strains. J. Bacteriol. 159, 863-869.  52.  Sands, M. and R. R o b e r t s . 1952. The e f f e c t s of a t r y p t o p h a n h i s t i d i n e d e f i c i e n c y i n a mutant of E . c o l i . J . B a c t e r i o l . 63_,  L y t i c mode of lambda d e v e l o p Cold S p r i n g Harbor L a b o r a t o r y ,  A g e n e t i c l o c u s f o r the r e g u l a t i o n P r o c . N a t l . Acad. S c i . USA.  R e g u l a t i o n of b a c t e r i a l growth, RNA, Ann. Rev. M i c r o b i o l . 3_2, 393-432. Stringent  control in E.coli.  Ann.  and  Rev.  Genet.  1  505-511.  176  53. Lamond, A. and A. T r a v e r s . 1985. transcription. Cell. 41_, 6-8.  Stringent c o n t r o l of b a c t e r i a l  54. Cashel, M. and J . Gaillant. 1969. Two compounds i m p l i c a t e d i n the f u n c t i o n o f the RC gene of E . c o l i . Nature. 221, 838-841. 55. H a s e l t i n e , W. and R. B l o c k . 1973. S y n t h e s i s of guanosine t e t r a and p e n t a - phosphate r e q u i r e s the presence o f a c o d o n - s p e c i f i c uncharged t r a n s f e r r i b o n u c l e i c a c i d i n the a c c e p t o r s i t e o f ribosomes. P r o c . N a t l . Acad. S c i . USA. _7°_' 1564-1568. 56. Nene, V. and R. G l a s s . polymerase. FEBS L e t t .  1983. Relaxed mutants 153, 307-310.  of E . c o l i  RNA  57. L i t t l e , R., J . R y a l s , and H. Bremer. 1983. rpoB m u t a t i o n i n E . c o l i a l t e r s c o n t r o l of ribosome s y n t h e s i s by guanosine t e t r a phosphate. J. Bacteriol. 154, 787-792. 58. T r a v e r s , A., A. Lamond, and H. Mace. 1982. ppGpp r e g u l a t e s the b i n d i n g o f two RNA polymerase molecules to the t y r T promoter. N u c l e i c A c i d s Res. 10_, 5043-5057. 59. VanOoyen, A., H. deBoer, G. Ab, M. Gruber. 1975. Specific i n h i b i t i o n of rRNA s y n t h e s i s i n v i t r o by guanosine 3'-diphosphate 5'-diphosphate. Nature. 254, 530-531. 60. Debenham, P. and A. T r a v e r s . 1977. S e l e c t i v e i n h i b i t i o n o f tRNA t r a n s c r i p t i o n by ppGpp. Eur. J . Biochem. J72., 515-523.  y  61. Reiness, G., H. Yang, G. Zubay, M. C a s h e l . 1975. E f f e c t s o f guanosine tetraphosphate o f c e l l - f r e e s y n t h e s i s o f E . c o l i r i b o s o m a l RNA and other gene p r o d u c t s . Proc. N a t l . Acad. S c i . USA. T2, 2881-2885. 62. K a j i t a n i , M. and A. Ishihawa. 1984. Promoter s e l e c t i v i t y o f E . c o l i RNA polymerase: d i f f e r e n t i a l s t r i n g e n t c o n t r o l o f the m u l t i p l e promoters from rRNA and p r o t e i n operons. J . B i o l . Chem. 259, 1951-1957. 63. G a l l a n t , J . , L. Palmer, C. Poa. 1977. Anomalous s y n t h e s i s of ppGpp i n growing c e l l s . C e l l . _1_1, 181-185. 64. T r a v e r s , A. 1980. Promoter sequence f o r s t r i n g e n t c o n t r o l o f b a c t e r i a l RNA s y n t h e s i s . J. Bacteriol. 141, 973-976. 65. Lamond, A. and A. T r a v e r s . 1985. G e n e t i c a l l y s e p a r a b l e f u n c t i o n a l elements mediate the o p t i m a l e x p r e s s i o n and s t r i n g e n t r e g u l a t i o n of a b a c t e r i a l tRNA gene. Cell. 40, 319-326. 66. Sarmientos, P., J . S y l v e s t e r , S. Contente, M. C a s h e l . 1983. D i f f e r e n t i a l s t r i n g e n t c o n t r o l of the tandem E . c o l i rRNA promoters from rrnB e x p r e s s e d in v i v o i n m u l t i c o p y p l a s m i d s . Cell. 3_2, 1337-1346.  177  67. S i l h a v y , T. and J . Beckwith. 1985. Uses o f l a c f u s i o n s f o r the study of b i o l o g i c a l problems. M i c r o b i o l . Rev. 49_, 398-418. 68. Berman, M. and J . Beckwith. 1979. F u s i o n s o f the l a c operon to the t r a n s f e r RNA gene t y r T of E . c o l i . J . Mol. B i o l . 130, 285-301. 69. Ota, Y., A. K i k u c h i , M. C a s h e l . 1979. Gene e x p r e s s i o n o f an E . c o l i r i b o s o m a l RNA promoter.. fused to s t r u c t u r a l genes o f the g a l a c t o s e operon. Proc. N a t l . Acad. S c i . USA. 76., 5799-5803. 70. G l a s e r , G., S. Kobe, A. Oppenheim. 1980. r e g i o n of rRNA operon rrnB to l a c Z gene. 8, 4327-4335.  Fusions o f the promoter N u c l e i c A c i d s Res.  71. Dues£er, G., R. E l f o r d , W. Holmes. 1982. F u s i o n o f the E . c o l i tRNA promoter to the galK gene: a n a l y s i s of sequences necessary f o r growth-rate dependent r e g u l a t i o n . C e l l . J30, 855-864. 72. Miura, A., J . Krueger, S. I t o h , H. deBoer, M. Nomura. 1981. Growth r a t e dependent r e g u l a t i o n of ribosome s y n t h e s i s i n E . c o l i : e x p r e s s i o n of the l a c Z and galK genes f u s e d to r i b o s o m a l promoters. Cell. 25, 773-782. 73. Sarmientos, P. and M. Cashel. 1983. Carbon s t a r v a t i o n and growth r a t e dependent r e g u l a t i o n o f the E . c o l i r i b o s o m a l RNA promoters: d i f f e r e n t i a l c o n t r o l o f d u a l promoters. P r o c . N a t l . Acad. S c i . USA. 80, 7010-7013. 74. Sarmientos, P., S. Contente, G. C h i m a l i , M. C a s h e l . 1983. Ribosomal RNA operon promoters PI and P2 show d i f f e r e n t r e g u l a t o r y responses, i n "Gene E x p r e s s i o n " A l a n R. L i s s I n c . New York. pp. 65-74. 75. Maaloe, 0. 1969. Suppl. 3, 33-58.  An a n a l y s i s o f b a c t e r i a l growth.  Dev.  Biol.  76. Ikemura, T. and M. Nomura.. 1977. E x p r e s s i o n of spacer t r a n s f e r RNA genes i n rRNA t r a n s c r i p t i o n u n i t s c a r r i e d by h y b r i d C o l E l plasmids i n E . c o l i . C e l l . _1_1, 779-794. 77. J i n k s - R o b e r t s o n , S. , R. Gourse, M. Nomura. 1983. Expression of rRNA and tRNA genes i n E . c o l i : evidence f o r feedback r e g u l a t i o n by products of rRNA operons. Cell. 3_3, 865-876. 78. R y a l s , J . , R. L i t t l e , H. Bremer. 1982. C o n t r o l , of rRNA and tRNA s y n t h e s i s i n E . c o l i by guanosine t e t r a p h o s p h a t e . J. Bacteriol. 151, 1261-1268. 79. R y a l s , J . , R. L i t t l e , H. Bremer. 1982. C o n t r o l o f RNA s y n t h e s i s i n E . c o l i a f t e r a s h i f t to h i g h e r temperature. J. Bacteriol. 151, 1425-1432.  178  80.  T r a v e r s , A., R. Buckland, P. Debenham. 1980. geneity of E . c o l i RNA polymerase holoenzyme. 1656-1662.  Functional heteroBiochemistry. 19,  81. T r a v e r s , A., R. Buckland, M. Goman, S. L e G r i c e , J . S c a i f e . 1978. A mutation a f f e c t i n g the sigma s u b u n i t of RNA polymerase changes transcriptional specificity. Nature. 273, 354-358. 82. Muto. A. 1977. C o n t r o l of ribosomal RNA s y n t h e s i s i n E . c o l i . I I I . Cytoplasmic f a c t o r s f o r r i b o s o m a l RNA s y n t h e s i s . Mol. Gen. Genet. 152,'161-166. 83.  Takebe, Y., A. Miura, D. Bedwell, M. Tam, M. Nomura. 1985. Increased e x p r e s s i o n of r i b o s o m a l genes d u r i n g i n h i b i t i o n of ribosome assembly i n E . c o l i . J . Mol. B i o l . 184, 23-30.  84.  Gourse, R., Y. Takebe, R. Sharrock, M. Nomura. 1985. Feedback r e g u l a t i o n of rRNA s y n t h e s i s and accumulation of f r e e ribosomes a f t e r c o n d i t i o n a l e x p r e s s i o n of rRNA genes. Proc. N a t l . Acad. S c i . USA. 82, 1069-1073.  85.  Doi, R. 1982. M u l t i p l e RNA polymerase holoenzymes e x e r t t r a n s c r i p t i o n a l s p e c i f i c i t y i n B_. s u b t i l i s . Arch. Biochem. Biophys. 2_14, 772-781.  86. P i g g o t , P. and J . Hoch. 1985. B.subtilis. M i c r o b i o l . Rev.  R e v i s e d g e n e t i c l i n k a g e map 49, 158-179.  of  87. Z i n g a l e s , B. and W. C o l l i . 1977. Ribosomal RNA genes i n B . s u b t i l i s . Evidence f o r a c o t r a n s c r i p t i o n mechanism. Biochim. Biophys. A c t a . 474, 562-577. 88. Hecht, N. and C. Woese. 1968. S e p a r a t i o n of b a c t e r i a l r i b o s o m a l RNA from i t s macromolecular p r e c u r s o r s by p o l y a c r y l a m i d e g e l electrophoresis. J . B a c t e r i o l . 95_, 986-990. 89. O i s h i , M. and N. Sueoka. 1965. L o c a t i o n of g e n e t i c l o c i of ribosomal RNA on B . s u b t i l i s chromosome. P r o c . N a t l . Acad. S c i . 54, 483-491.  USA.  90.  Smith, I., D. Dubnau, P. M o r e l l , J , Marmur. 1968. Chromosomal l o c a t i o n of DNA base sequences complementary to t r a n s f e r RNA and to 5S, 16S, and 23S ribosomal RNA i n B . s u b t i l i s . J . Mol. B i o l . 33, 123-140.  91.  Chow, L. and N. Davidson. 1973. E l e c t r o n m i c r o s c o p i c mapping of the d i s t r i b u t i o n of ribosomal genes of the B . s u b t i l i s chromosome. J . Mol. B i o l . 75, 265-279.  .92.  Moran, C. and K. B o t t . 1979. R e s t r i c t i o n enzyme a n a l y s i s of B . s u b t i l i s r i b o s o m a l RNA genes. J. Bacteriol. 140, 99-105.  .  179  93.  Stewart, G. , F/ Wilson, K. B o t t . 1982. D e t a i l e d p h y s i c a l mapping o f the r i b o s o m a l RNA genes o f B . s u b t i l i s . Gene. 19_, 153-162.  94.  Wawrousek, E. and II. Hansen. 1983. S t r u c t u r e and o r g a n i z a t i o n o f a c l u s t e r o f s i x tRNA genes i n the space between tandem rRNA gene sets i n B . s u b t i l i s . J . B i o l . Chem. 258, 291-298.  95.  Loughney, K., E. Lund, J . Dahlberg. 1982. tRNA genes a r e found between the 16S and 23S rRNA genes i n B . s u b t i l i s . N u c l e i c Acids ' Res. _L0, 1607-1624. 1  96.  L a F a u c i , G., R. Widom, R. E i s n e r , E. J a r v i s , R. Rudner. 1986. Mapping o f rRNA genes w i t h i n t e g r a t a b l e plasmids i n B . s u b t i l i s . J . B a c t e r i o l . 165, 204-214.  97.  Green, C. and B. V o i d . 1983. Sequence a n a l y s i s o f a c l u s t e r o f twenty-one tRNA genes i n B . s u b t i l i s . N u c l e i c A c i d s Res. 11, 5763-5774.  98.  F o u r n i e r , M. and H. O z e k i . 1985. S t r u c t u r e and o r g a n i z a t i o n o f the t r a n s f e r RNA genes o f E . c o l i K-12. M i c r o b i o l . Rev. 49, 379-397.  99. V o i d , B. 1985. S t r u c t u r e and o r g a n i z a t i o n o f genes f o r t r a n s f e r RNA i n B . s u b t i l i s . M i c r o b i o l . Rev. 49_, 71-80. 100.  Moriya, S., N. Ogasawara, H. Yoshikawa. 1985. S t r u c t u r e and f u n c t i o n of the r e p l i c a t i o n o r i g i n o f B . s u b t i l i s chromosome. I I I . N u c l e o t i d e sequence o f some 10,000 bp i n the o r i g i n r e g i o n . N u c l e i c A c i d s Res. 1 3 , 2251-2265.  101.  Ogasawara, N., M. Seike, H. Yoshikawa. 1983. R e p l i c a t i o n o r i g i n r e g i o n o f B . s u b t i l i s c o n t a i n s two rRNA operons. J . B a c t e r i o l . 154, 50-57.  102.  Green, C , G. Stewart, M. H o l l i s , B. V o i d , K. B o t t . 1985. N u c l e o t i d e seqence o f the B . s u b t i l i s r i b o s o m a l RNA operon, Gene. 3_7, 261-266.  rrnB.  103.  Stewart, G. and K. B o t t . 1983. DNA sequence o f the tandem r i b o s o m a l RNA promoters o f B . s u b t i l i s operon r r n B . N u c l e i c A c i d s Res. 6289-6300.  104.  Loughney, K., E. Lund, J . Dahlberg. 1983. Ribosomal RNA p r e c u r s o r s of B . s u b t i l i s . N u c l e i c A c i d s Res. J _ l , 6710-6721.  105.  L o s i c k , R. and J . Pero. 1981. 25, 582-584.  106.  Lee, G., C. T a l k i n g t o n , J . Pero. 1980. N u c l e o t i d e sequence o f a promoter r e c o g n i z e d by B . s u b t i l i s RNA polymerase. Molec. Gen. Genet. 180, 57-65.  Cascades o f sigma f a c t o r s .  Cell.  180  107. V o i d , B. and C. Green. 1986. E x p r e s s i o n i n E . c o l i of B . s u b t i l i s tRNA genes from a promoter w i t h i n t h e tRNA gene r e g i o n . J . B a c t e r i o l . 166, 306-312. 108. D o i , R. 1977. Role o f RNA polymerase i n gene s e l e c t i o n i n procaryotes. B a c t e r i o l . Rev. 41_, 568-594. 109. Leduc, E., M. Hoekstr, G. Spiegelman. 1982. R e l a t i o n s h i p between s y n t h e s i s o f ribosomes and RNA polymerase i n B . s u b t i l i s . Can. J . M i c r o b i o l . 28, 1280-1288. 110. Webb, V. and G. Spiegelman. 1984. Ribosomal RNA s y n t h e s i s i n u n i n f e c t e d and SP01 am34 i n f e c t e d B . s u b t i l i s . Molec. Gen. Genet. 194, 98-104. 111. C l e w e l l , D. and D. H e l i n s k i . 1970. P r o p e r t i e s of a s u p e r c o i l e d DNA-protein r e l a x a t i o n complex and s t r a n d s p e c i f i c i t y o f t h e r e l a x a t i o n e v e n t . B i o c h e m i s t r y , j?, 4428-4440. 112. Dobinson, K. and G. Spiegelman. 1985. N u c l e o t i d e sequence and t r a n s c r i p t i o n o f a b a c t e r i o p h a g e 029 e a r l y promoter. J . B i o l . Chem. 260, 5950-5955. 113. M a n i a t i s , T., G. F r i t s c h , J . Sambrook. 1982. " M o l e c u l a r C l o n i n g : A L a b o r a t o r y Manual". Cold S p r i n g Harbor L a b o r a t o r i e s . New York. 114. Gryzcan, T., S. Contente, D. Dubnau. 1978. C h a r a c t e r i z a t i o n o f Staphylococcus aureus plasmids i n t r o d u c e d by t r a n s f o r m a t i o n i n t o B.subtilis. J . B a c t e r i o l . 134, 318-329. 115. Rodriquez, R., R. West, E. K l i n e . 1979. "Experiments i n Recombinant DNA Research" American S o c i e t y f o r M i c r o b i o l o g y , Washington, D.C. 116. Johnston, J . and I. Gunsalus. 1977. I s o l a t i o n o f m e t a b o l i c p l a s m i d DNA from Pseudomonas p u t i d a . Biochem. B i o p h y s . Res. Comm. 75_, 13-19. 117. Dubnau, D. and R. D a v i d o f f - A b e l s o n . 1971. F a t e of t r a n s f o r m i n g DNA f o l l o w i n g uptake by competent B . s u b t i l i s . I . Formation and p r o p e r t i e s o f the d o n o r - r e c i p i e n t complex. J . Mol. B i o l . 56, 209-221. 118. Laemmli, U. 1970. Cleavage o f s t r u c t u r a l p r o t e i n s d u r i n g the assembly o f the head o f b a c t e r i o p h a g e T4. Nature. 227, 680-685. 119. Maxam, A. and W. G i l b e r t . 1977. A new method f o r sequencing DNA. P r o c . N a t l . Acad. S c i . USA. _74_» 560-564. 120. Southern, E. 1975. D e t e c t i o n o f s p e c i f i c sequences among DNA fragments s e p a r a t e d by g e l e l e c t r o p h o r e s i s . J . M o l . B i o l . 98, 503-517.  181  121. Close, T. and R. Rodriquez. 1982. C o n s t r u c t i o n and c h a r a c t e r i z a t i o n of a c h l o r a m p h e n i c o l r e s i s t a n c e gene c a r t r i d g e : A new approach to the t r a n s c r i p t i o n a l mapping o f extrachromosomal elements. Gene. 20, 305-316. 122. Messing, J . 1983. New M13 v e c t o r s f o r c l o n i n g . 101, 20-52.  Meth. Enzymol.  123. D a n i e l s , D. and K. B e r t r a n d . 1985. Promoter mutations a f f e c t i n g d i v e r g e n t t r a n s c r i p t i o n i n the TnlO t e t r a c y c l i n e r e s i s t a n c e determinant. J . M o l . B i o l . 184, 599-610. 124. Adams, C. and G. H a t f i e l d . 1984. E f f e c t s o f promoter s t r e n g t h s and growth c o n d i t i o n s on copy number o f t r a n s c r i p t i o n - f u s i o n v e c t o r s . J . B i o l . Chem. 259, 7399-7403. 125. C l a r k , D. and 0. Maaloe. 1967. DNA r e p l i c a t i o n and t h e d i v i s i o n cycle i n E . c o l i . J . Mol. B i o l . 23, 99-112. 126. Zukowski, M. , D. G a f f n e y , D. Speck, M. Kauffman, A. F i n d e l i , A. Wisecup, J . Lecocq. 1983. Chromogenic i d e n t i f i c a t i o n o f g e n e t i c r e g u l a t o r y s i g n a l s i n B . s u b t i l i s based on e x p r e s s i o n o f a c l o n e d Pseudomonas gene. P r o c . N a t l . Acad. S c i . USA. 80, 1101-1105. 127. Sanderham, H. and J . Strominger. 1982. P u r i f i c a t i o n and p r o p e r t i e s of C,., i s o p r e n o i d a l c o h o l phosphokinase from S.aureus. J. Biol. Chem. 247, 5123-5131. 128. Shaw, W. 1975. Chloramphenicol a c e t y l t r a n s f e r a s e f o r c h l o r a m p h e n i c o l resistant bacteria. Meth. Enzymol. 43, 737-755. 129. McKenney, K., H. Shimatake, D. C o u r t , U. Schmeisser, C. Brady, M. Rosenberg. 1981. A system to study promoter and t e r m i n a t o r s i g n a l s r e c o g n i z e d by E.-.coli RNA polymerase, i n "Gene A m p l i f i c a t i o n and A n a l y s i s , V o l . 2. S t r u c t u r a l a n a l y s i s o f n u c l e i c a c i d s . E l s e v i e r , New York. pp. 383-415. 130. Boros, I . , A. K i s s , B. S a i n , G. Somlyai, P. V e n e t i a n e r . 1983. C l o n i n g o f the promoter o f an E . c o l i rRNA gene: New e x p e r i m e n t a l system to study the r e g u l a t i o n o f rRNA t r a n s c r i p t i o n . Gene. 22 191-201. 131. B r o s i u s , J . 1984. P l a s m i d v e c t o r s f o r s e l e c t i o n o f promoters. Gene. 27, 151-160. 132. B r o s i u s , J . 1984. T o x i c i t y o f an overproduced f o r e i g n gene product i n E . c o l i and i t s use i n p l a s m i d v e c t o r s f o r the s e l e c t i o n o f t r a n s c r i p t i o n t e r m i n a t o r s . Gene. 27_, 161-172. 133. B r o s i u s , J . , T. D u l l , D . S l e e t e r , H. N o l l e r . 1981. Gene o r g a n i z a t i o n and primary sequence o f a r i b o s o m a l RNA operon from E . c o l i . J . Mol. B i o l . 148, 107-128.  182  134.  S u t c l i f f e , J . 1979. Complete n u c l e o t i d e sequence of the E . c o l i plasmid pBR322. Cold Spring Harbor Symp. Quant. B i o l . 4_3, 77-90.  135.  S t a n i e r , R., M. Doudoroff, E. A d e l b e r g . 1970. "The World". P r e n t i c e - H a l l , New York. pp. 298-324.  136.  Wanner, B., R.Kodaira, F. Neidhardt. 1977. P h y s i o l o g i c a l regu l a t i o n of a d e c o n t r o l l e d l a c operon. J . B a c t e r i o l . 130, 212-222.  137.  Dennis, P. and D. Nordan. 1976. i z a t i o n between p u r i f i e d 16S and J. B a c t e r i o l . 128, 28-34.  138.  VonGabain, A., J . B e l a s c o , I. S c h a t t e l , A. Chang, S. Cohen. 1983. Decay of mRNA i n E . c o l i : I n v e s t i g a t i o n of the f a t e of s p e c i f i c segments of t r a n s c r i p t s . Proc. N a t l . Acad. S c i . USA. 80, 653-657.  139.  Stuber, D. and H. B u j a r d . 1982. T r a n s c r i p t i o n from e f f i c i e n t promoters can i n t e r f e r e w i t h plasmid r e p l i c a t i o n and d i m i n i s h e x p r e s s i o n of p l a s m i d s p e c i f i c genes. EMBO J . _1, 1399-1404.  140.  K r e f t , J . and C. Hughes. 1982. Cloning vectors derived and phage of B a c i l l u s . Curr. Top. M i c r o b i o l . Immunol.  141.  Osburne, M. and R. C r a i g . 1986. cloned i n t o B . s u b t i l i s . J . Gen.  142.  McLaughlin, J . C. Murray, J . Rabinowitz. 1981. Unique f e a t u r e s i n the ribosome b i n d i n g s i t e sequence of the G r a m - p o s i t i v e Staphylococcus aureus ^-lactamase gene. J . B i o l . Chem. 256, 11283-11291.  143.  Peschke U., V. Beuck, H. B u j a r d , R. Gentz, S. L e G r i c e . 1986. E f f i c i e n t u t i l i z a t i o n of E . c o l i t r a n s c r i p t i o n a l s i g n a l s i n B.subtilis. J . Mol. B i o l . JJ56, 547-555.  144.  B o l i v a r , F., P. Green, M. B e t l a c h , H. Heyneker, H. Boyer. 1977. C o n s t r u c t i o n and c h a r a c t e r i z a t i o n of new c l o n i n g v e h i c l e s . Gene. _2, 95-113.  145.  Kunz, D., D. Ribbons, P.Chapman. 1981. Metabolism of a l l y l g l y c i n e and c i s - c r o t y l g l y c i n e by P.putida ( a r v i l l a ) mt-2 h a r b o r i n g a TOL plasmid. J. Bacteriol. 148, 72-82.  146.  H o r i n o u c h i , S. and B. Weisblum. 1982. N u c l e o t i d e sequence and f u n c t i o n a l map of pC194, a plasmid t h a t s p e c i f i e s i n d u c i b l e chloramphenicol r e s i s t a n c e . J. Bacteriol. 150, 815-825.  147.  Hwang, J . and R. D o i . 1980. Transcription-termination from B . s u b t i l i s . Eur. J . Biochem. 104, 313-320.  Microbial  C h a r a c t e r i z a t i o n of the h y b r i d 23S rRNA and rDNA from E . c o l i .  A c t i v i t e s o f two Microbiol. 132,  from p l a s m i d s 9_6, 1-17.  s t r o n g promoters 565-568.  factor  Rho  183  148.  deBoer, H., L. Cornstock, M. V a s s e r . 1983. The tac promoter: A f u n c t i o n a l h y b r i d d e r i v e d from the t r p and l a c promoters. Proc. N a t l . Acad. S c i . USA. 80, 21-25.  149.  Ray, C., R. Hay, H. C a r t e r , C . Moran. 1985. Mutations t h a t u t i l i z a t i o n of a promoter i n s t a t i o n a r y - p h a s e B . s u b t i l i s . J. Bacteriol. 163, 610-614.  150.  E h r l i c h , S., B. Niaudet, B. M i c h e l . 1982. Use of plasmids from Staphylococcus aureus f o r c l o n i n g of DNA i n B . s u b t i l i s . Curr. Top. M i c r o b i o l . Immunol. 9_6, 19-29.  151.  Gryczan, T. and D. Dubnau. 1978. c h i m e r i c plasmids i n B . s u b t i l i s . 75, 1428-1432.  152.  O s t r o f f , G. and J . Pene. 1984. Molecular c l o n i n g with b i f u n c t i o n a l plasmid v e c t o r s i n B . s u b t i l i s : c o n s t r u c t i o n and a n a l y s i s of B . s u b t i l i s clone banks i n E . c o l i . Mol. Gen. Genet. 193, 299-305.  affect  C o n s t r u c t i o n and p r o p e r t i e s of P r o c . N a t l . Acad. S c i . USA.  153. Youngman, P., J . P e r k i n s , R. L o s i c k . 1986. C o n s t r u c t i o n of a c l o n i n g s i t e near one end of Tn917 i n t o which f o r e i g n DNA may be i n s e r t e d without a f f e c t i n g t r a n s p o s i t i o n i n B . s u b t i l i s or exp r e s s i o n of the transposon-borne erm gene. Plasmid, l _ l , i n p r e s s . 154.  Haldenwang, W"., C. Banner, J . O l l i n g t o n , R. L o s i c k , J . Hoch, M. O'Connor, A. Sonenshein. 1980. Mapping a c l o n e d gene under s p o r u l a t i o n c o n t r o l by i n s e r t i o n of a drug r e s i s t a n c e marker i n t o the B . s u b t i l i s chromosome. J . B a c t e r i o l . 142, 90-98.  155.  Canosi, U., G. M o r e l l i , T. T r a u t n e r . 1978. The r e l a t i o n s h i p between molecular s t r u c t u r e and t r a n s f o r m a t i o n frequency of some S.. aureus plasmids i s o l a t e d from B . s u b t i l i s . Mol. Gen. Genet. 166, 259-267.  156.  Grandi, G., M. Mottes, V. S g a r a m e l l i . 1981. S p e c i f i c p a t t e r n of i n s t a b i l i t y of E . c o l i h i s G gene c l o n e d i n B . s u b t i l i s v i a the S.aureus plasmid pCS194. Plasmid. j$, 99-111.  157.  O s t r o f f , G. and J . Pene. 1984. Molecular c l o n i n g with b i f u n c t i o n a l plasmid v e c t o r s i n B . s u b t i l i s . I I . T r a n s f e r of sequences propagated i n E . c o l i to B . s u b t i l i s . Mol. Gen. Genet. 193, 306-311.  158. M i c h e l , B., E. P a l l a , B. Niaudet, S. E h r l i c h . 1980. DNA c l o n i n g i n B . s u b t i l i s : I I I . E f f i c i e n c y of random-segment c l o n i n g and i n s e r t i o n a l i n a c t i v a t i o n v e c t o r s . Gene. 1_2, 147-154. 159.  R i e l e , H., B. M i c h e l , S. E h r l i c h . 1986. S i n g l e stranded plasmid DNA i n B . s u b t i l i s and S.aureus. P r o c . N a t l . Acad. S c i . USA. 83, 2541-2545.  184  160.  Twigg, A. and D. S h e r r a t t . 1980. number mutants of plasmid C o l E l .  Trans-complementable copy Nature. 283, 216-218.  161.  I t o , J . 1978. Bacteriophage 029 t e r m i n a l p r o t e i n : I t s a s s o c i a t i o n with the 5' terminus of the 029 genome. J . V i r o l . 28. > 895-904.  162.  G a l l a n t , J . and G. Margason. 1972. Amino a c i d c o n t r o l o f messenger RNA s y n t h e s i s i n B a c i l l u s s u b t i l i s . J . B i o l . Chem. 247, 2289-2294.  163.  Smith, I . 1982. The t r a n s l a t i o n a l apparatus o f B a c i l l u s s u b t i l i s . i n "The M o l e c u l a r B i o l o g y of the B a c i l l i " , V o l . 1, p. 111-145. D. Dubnau, ed. Academic P r e s s , New York.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0097132/manifest

Comment

Related Items