UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The structure and transcription of a rat RT1 B alpha class II gene Barran, Paul Arthur 1987

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1987_A1 B37.pdf [ 9.03MB ]
Metadata
JSON: 831-1.0097104.json
JSON-LD: 831-1.0097104-ld.json
RDF/XML (Pretty): 831-1.0097104-rdf.xml
RDF/JSON: 831-1.0097104-rdf.json
Turtle: 831-1.0097104-turtle.txt
N-Triples: 831-1.0097104-rdf-ntriples.txt
Original Record: 831-1.0097104-source.json
Full Text
831-1.0097104-fulltext.txt
Citation
831-1.0097104.ris

Full Text

THE STRUCTURE AND TRANSCRIPTION OF A RAT  RT1 Ba CLASS II GENE BY PAUL ARTHUR BARRAN .Sc. Honours Science, University of Waterloo, 1980. M.Sc. Biology, University of Waterloo, 1982. A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Medical Genetics) (Genetics Programme) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA March 1987 © P a u l Arthur Barran, 1987. In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of G e n e t i c s The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date 14 July 1987 DE-firvft-n ABSTRACT The major histocompatibil i ty complex of the rat (RT1 complex) encodes two sets of class II molecules referred to as RT1 B and RT1 D. The RT1 B Q gene was isolated from a Sprague-Dawley (RTl^) rat genomic l ibrary using a rat RT1 B Q chain cDNA as a hybridization probe. The coding and the majority of the intron DNA sequence was determined. The structure of the RT1 B Q gene is equivalent to that of H-2 and HLA a chain genes. Comparison of the nucleotide and predicted amino acid sequences of the RT1 B a gene to those of the H-2 and HLA genes revealed a high degree of overal l sequence conservation. However, two regions of the f i r s t external domain (a l ) , residues 19-23 and 45-78, exhibit marked sequence var iat ion . Two blocks of conserved nucleotide sequence were ident i f ied in the 5' promoter region of the RT1 B Q gene that have been described in a l l MHC class II genes sequenced to date. These conserved sequences may be involved in the co-ordinate regulation of expression of class II genes. The cloned RT1 B Q gene was e f f i c i en t ly transcribed when transfected into mouse L ce l l s . i i i TABLE OF CONTENTS Page Abstract i i L i s t of Tables ix L i s t of Figures x L i s t of Abbreviations x i i Acknowledgements xiv CHAPTER 1: INTRODUCTION The Major Histocompatibil ity Complex 1 A. Detection and History of the MHC - 1 1. The Class I Antigens 1 a) Graft Rejection 1 b) Genetics and Serology 3 2. The Class II Antigens 4 a) Immune Response Genes 4 b) Immune Associated Antigens 5 c) Mixed Lymphocyte Responses 5 d) Class II Antigens are Encoded by Class II Genes 7 B. Structure of MHC Products 8 1. The Class I Molecules 8 a) Structure of the Rat Class I Molecules 8 b) Comparison to the Mouse 10 2. The Class II Molecules 11 a) Structure of the Rat Class II Molecules 11 b) Comparison to the Mouse and Human 13 3. The Class III Molecules 14 iv Page C. Genetic Organization of the MHC 15 1. Structure of the Rat RT1 Complex 15 a) A H i s t o r i c a l Perspective 15 b) Structure of the RT1 Complex 17 2. The Structure of the Mouse H-2 Complex 18 3. The Structure of the Human HLA Complex 18 D. The Structure of the Class I and Class II Genes 20 1. Class I 20 2. Class II 20 E . Functions of the MHC 22 1. Functions Assigned to the Class I Antigens 22 a) Graft Rejection 22 b) Restr ict ion of Cytotoxic T-lymphocyte Ac t iv i ty 23 c) A l l e l i c Polymorphism and Function 24 2. Functions Assigned to the Class II Antigens 26 a) Activation of T-lymphocytes 26 b) Restr ict ion of Helper T-lymphocyte Ac t iv i ty 27 c) A l l e l i c Polymorphism 28 d) T - c e l l Dif ferent iat ion 32 e) Non Response 33 f) Evolutionary Function 34 3. MHC Functions Not Assigned to the Class I or Class II Antigens 35 F. Objectives and Rationale for Studying the RT1 Class II Genes 36 V Page CHAPTER 2: MATERIALS AND METHODS A. Materials 38 1. Enzymes 38 2. Electrophoresis Chemicals 38 3. Bacteria l Culture Media 38 4. Tissue Culture Products 39 B. Bacteria l Strains, Vectors, and Media 39 1. Vectors 39 2. Bacteria l Strains 39 3. Media 40 C. Basic Techniques of Molecular Biology 40 1. Restrict ion Endonuclease Digestion of DNA 40 2. Agarose Gel Electrophoresis 40 a) Qualitat ive Agarose Gel Electrophoresis 40 b) Preparative Agarose Gel Electrophoresis 41 i ) Electroelut ion into Dialys is Bags 41 i i ) Low Melting Point Agarose Gels 41 3. Polyacrylamide Gel Electrophoresis 42 D. Isolation and Puri f icat ion of Nucleic Acids 43 1. Large Scale Preparation of Plasmid DNA 43 2. Large Scale Isolation of Phage DNA 45 3. Isolation of High Molecular Weight Eukaryotic DNA 46 E. Isolation of High Molecular Weight RNA 46 F. Labell ing of Probe DNA by Nick Translation 47 G. Screening the Rat Genomic Library 48 1. Plating the Library 48 v i Page 2. Amplification ' 48 3. Plaque Hybridization 49 4. Second and Third Screens 50 H. Analysis of Recombinant Clones 50 1. Restrict ion Mapping 50 2. Southern Blot Analysis 51 I. Sub-cloning of DNA Fragments into pUC Plasmids 52 1. Isolation of Specif ic DNA Fragments 52 2. Ligation 52 3. Transformation of DNA into Bacteria 52 a) Preparation of Competent Cel ls 52 b) Transformation 53 J . DNA Sequence Analysis 54 1. Preparation of DNA for Shotgun Cloning into M13 Vectors 54 a) Digestion with Restrict ion Enzymes 54 b) Sonication 54 2. Subcloning DNA into M13 Vectors 55 a) Ligation 55 b) Transformation of M13 RF into Bacteria 55 3. Isolation and Growth of Recombinant M13 Phage 56 4. Preparation of Template DNA 56 5. Screening Recombinant M13 Phage DNA 56 6. Dideoxy DNA Sequencing 58 a) Reactions 58 b) Gels 58 v i i P a g e K. Transfection of Mouse L - c e l l s with RT1 Class I I Genes 58 1. Growth and Maintenance of L - c e l l s i n Tissue Culture 58 2. Transfection by Calcium Phosphate Co-precipitation 59 a) Preparation of the P r e c i p i t a t e 59 b) Transfection 59 3. Analysis of Transformed C e l l s 60 a) C e l l Surface Expression of RT1 Class I I Molecules 60 b) Hybridization Analyses 61 i ) Southern Blots ~ 61 i i ) Northern Blots 62 CHAPTER 3: ISOLATION AND CHARACTERIZATION OF GENOMIC CLONES A.Results 63 1. The Plasmid pRIa.2 63 2. I s o l a t i o n of Genomic Clones 63 3. Genomic Southern Blot Hybridizations 68 B. Discussion 73 CHAPTER 4: ANALYSIS OF THE DNA AND PREDICTED AMINO ACID SEQUENCE OF THE RT1 B a GENE A. Results 74 1. The Nucleotide Sequence 74 2. Analysis of the Predicted Protein Sequence 79 3. The Promoter 82 4. A l l e l i c and Interspecies V a r i a t i o n i n RT1 B a Genes 84 5. Molecular Evolution 88 v i i i P a g e B. Discussion 92 1. The Structure of the RT1 B a Gene 92 2. The Promoter Region 96 3. Polymorphism 98 CHAPTER 5: STUDIES ON THE TRANSCRIPTION OF THE RT1 Ba GENE A. Results 104 1. Transcription of the Cloned RT1 B a Gene 104 B. Discussion 111 CHAPTER 6: GENERAL DISCUSSION 116 REFERENCES 127 APPENDIX 1 162 ix LIST OF TABLES Table Page 1 Protein Sequence Identity between Class II a Chains of Rat, Mouse and Human. 80 2 Sequence Divergence of Class II a Chain Genes. 89 3 Sequence Divergence of Class II a Chain Genes by Exon. 90 A Expression of Class II Genes on Transfected Ltk+ Ce l l s . 107 X LIST OF FIGURES Figure Page 1 The structure of the MHC encoded Class I and Class II proteins. 9 2 Organization of the MHC in rat , mouse, and man. 16 3 Structure of Class II genes. 21 4 Restr ict ion map of the RT1 cDNA insert of plasmid pRIa.2 64 5 Southern Blot of Lambda 7 and Lambda 8 DNA. 66 6 Restrict ion map of the RT1 B Q gene containing phages Lambda 7 and Lambda 8. 67 7A Southern blot of plasmid pRTlB.4 and pRTlB.5 DNA. 69 7B Southern blot of plasmid pRTlB.4 and pRTlB.5 DNA. 70 8 Restr ict ion map of Lambda 7, pRTlB.4, and pRTlB.5. 71 9 Genomic Southern Blot of Wistar Rat Liver DNA. 72 10 The nucleotide and predicted amino acid sequence of the RT1 Ba gene. 77 11 Structure of the RT1 B a Class II gene. 78 12 Alignment of the promoter regions of Class II a and 3 genes. 83 13 Alignment of the RT1 B Q gene (RTl b ) with the a l l e l i c RT1 B a (RT1U) cDNA pRIa.2. 85 14 Comparison of the predicted amino acid sequences of the RT1 B Q and H-2 A Q molecules. 87 15 Plot of the percentage corrected divergence of MHC Class II a molecules versus evolutionary time. 91 x i Figure _ Page 16 FACS prof i les of L -ce l l s transfected with RT1.B genes. 106 17 Southern blot analysis of high molecular weight DNA isolated from transfected L - c e l l clones. 109 18 Northern blot analysis of RT1 Ba chain RNA. 110 19 Postulated evolution of Class II MHC genes. 117 20 A model for the regulation of Class II gene expression. 124 x i i LIST OF ABBREVIATIONS ATP 2 1-Adenosine 5'-triphosphate BIS N ,N' , methylene-bis-acrylamide BSA Bovine Serum Albumin cDNA Copy Deoxyribonucleic acid CTL Cytotoxic T-lymphocyte CTP 2'-Cytosine 5 1 -triphosphate DEP Diethyl Pyrocarbonate DMEM Dulbecco's Modified Eagle Medium DNA Deoxyribonucleic Acid DNase I Deoxyribonuclease I DTT Di th io thre i to l E . c o l i Escherichia c o l i EDTA Ethylenediaminetetraacetic acid F^ F i r s t f i l i a l generation FACS Fluorescence Activated C e l l Sorter FITC Fluorescine Isothiocyanate GLcp polymer of L-glutamic ac id , L- lys ine , and L-phenylalanine GTP 2'-Guanosine 5 1 -triphosphate H-2 Histocompatibil ity 2 Complex of the mouse HEPES N-2-hydroxyethylpiperazine-N'-2-ethylsulfonic Acid HLA Human Leukocyte Associated I Immune response region la Immune Associated IPTG Isopropylthiogalactoside Ir Immune Response x i i i L L i t r e LB L u r i a - B e r t a n i LMP Low Melting Point Ltk +/- L - c e l l + or - the Thymidine Kinase Gene MHC Major H i s t o c o m p a t i b i l i t y Complex MLR Mixed Lymphocyte Response mRNA Messenger Ribonucleic A c i d PAGE Polyacrylamide Gel E l e c t r o p h o r e s i s PBS Phosphate Buffered S a l i n e RNA Ribonucleic A c i d RNase Ribonuclease SDS Sodium Dodecylsulphate SSC Standard S a l i n e C i t r a t e TAE T r i s - H C l Acetate Buffer TBE T r i s - H C l Borate Buffer TE T r i s - H C l EDTA Buffer TEMED N,N,N',N'-tetramethylethylenediamine TK Thymidine Kinase Gene T r i s - H C l T r i s (hydroxymethyl) aminomethane tRNA Transfer Ribonucleic Acid TTP 2'-Thymidine 5 1-triphosphate UV U l t r a v i o l e t l i g h t V V o l t s X-gal 5-bromo-A-chloro-3-indoyl-B-D-galactoside xgpt E . c o l i xanthine guanosine phosphoribosyl transferase xiv ACKNOWLEDGEMENTS I would l i k e to thank Drs. L. Jagodzinski and J . Bonner f o r the g i f t of the Rat genomic l i b r a r y ; and Drs. D. Mathis and C. Benoist f o r the mouse H-2 A a cDNA pACD3. I would l i k e to thank my supervisor Dr. W.R. McMaster f o r h i s constant guidance and encouragement throughout these s t u d i e s . To the members of my supervisory committee go my thanks f o r h e l p f u l discussions i n the preparation of t h i s t h e s i s . To my parents and Judy Bus go my h e a r t f e l t thanks f o r t h e i r c o n t i n u a l support and encouragement without which t h i s t h e s i s would not have been p o s s i b l e . 1 CHAPTER 1  INTRODUCTION  The Major Histocompatibil ity Complex The Major Histocompatibil ity Complex (MHC) is a set of linked genes specifying at least three families of gene products known as the Class I , I I , and III molecules. The Class I and II molecules are c e l l surface glycoproteins whereas the Class III molecules are serum proteins. The MHC encoded molecules are involved in a number of b io logica l phenomena mostly immunological in nature (Kaufman et al . ,1984). A l l vertebrate species studied possess an MHC (Gotze,1977) and some invertebrates exhibit functions characterist ic of the MHC (Hildeman et al. ,1979; Scofield et al . ,1982). A. Detection and History of the MHC Although a l l mammalian species are now known to contain MHC regions in their genomes, the MHC's of mouse and human are by far the most well characterized. In fact these two species have been used almost exclusively in the h i s t o r i c a l def in i t ion of this genetic system. 1. The Class I Molecules a) Graft Rejection In 1903 Jensen began experiments on the transplantation of l ive tumours from one mouse to another. He observed that the more closely related the two strains of mouse were, the greater the success of the transplant. A number of studies over the next 10 years suggested that the success or fa i lure of tumour grafts was under the control of several dominant genes ( L i t t l e and Tyzzer,1916). In order to simplify analysis of these transplantation genes inbred strains of mice were developed. 2 Experimental transplantation of tumours between inbred strains of mice c lear ly showed that the donor and recipient mice must be of the same inbred s tra in in order for the graft to be accepted (Gorer, 1936). Crosses between donor and recipient mouse strains demonstrated that several independently segregating genes were responsible for graft reject ion (Gorer, 1937), and Snel l (1948) cal led these genes histocompatibil i ty genes. The development of congenic strains of mice d i f fer ing only at the genetic l o c i control l ing graft rejection allowed further genetic mapping of the histocompatibil i ty genes. These genes have been assigned to linkage group IX (Gorer et al.,1948) and later to chromosome 17 (Allen et al . ,1955). Further comparison of the suscept ib i l i ty to a given tumour amongst many congenic strains of mice has ident i f ied cross-over events which separate the histocompatibil i ty genes into two l o c i (Snell,1953). In humans the practice of skin grafting to treat superf ic ia l injury dates from the mid 1800's (Barnstable et al . ,1979). By 1927 Bauer established that the acceptance or rejection of a skin graft was also under genetic control by observing that of a l l grafts , only autografts and homografts between ident ica l twins survived permanently. Gibson and Medawar (1943) noted that rejection was an immunological phenomenon by correct ly associating the rapid rejection of a graft in a patient sensitized by the previous rejection of a homograft from the same donor with a secondary type immune response. Further work in rabbits demonstrated that the sensit iz ing antigens were also carried on leukocytes (Medawar,1946). 3 b) Genetics and Serology The linkage of the histocompatibil i ty genes to serological ly detectable c e l l surface antigens resulted from a series of experiments by Peter Gorer in 1936. He immunized rabbits with ce l l s from strain A mice rais ing an antiserum which could detect c e l l surface proteins (antigens) on s tra in A mouse ce l l s but not on C57BL strain or CBA strain mouse ce l l s (Gorer,1936). Ant i - s t ra in A serum was also raised in C57BL strain mice and found to have ident ica l spec i f i c i ty to the serum raised in rabbit . When tumours derived in s train A mice were transplanted into A, C57BL, CBA, and various hybrids bred amongst these three s trains , the a b i l i t y to accept the graft segregated absolutely with the a b i l i t y to react with anti-A serum. These data were interpreted to show that tumour graft rejection was under the control of as few as two genes, one of which encoded the s tra in A antigen (Gorer, 1937) which was cal led antigen II . In concurrent studies Snel l observed that the histocompatibil i ty gene associated with antigen II was remarkable in i t s a b i l i t y to e l i c i t graft reject ion, and led to the designation of the mouse MHC as the H-2 complex (Counce et al . ,1956). Further genetic and serological analyses ident i f ied recombination events which separated the H-2 region into two l o c i designated H-2K and H-2D (Gorer,1956,1959; Amos,1955; Allen,1955; and Snell,1953,1971). Each of these l o c i was shown to have serological ly defined a l le les and encode c e l l surface glycoproteins now cal led Class I antigens. A similar genetic and serological approach has ident i f ied a homologous genetic region in rats , now cal led the RT1 complex (Bogden,1960). 4 The human MHC (HLA Complex) has been defined almost ent ire ly through serological analysis . The f i r s t antigens ident i f ied were those thought to be involved in graft reject ion, and are the products of the HLA-A, HLA-B, and HLA-C l o c i . They were f i r s t detected using antisera derived from individuals who had undergone multiple blood transfusions (Dausset, 1958), and antisera from women who had been sensitized to human lymphocyte antigens by f e ta l maternal stimulation (Van Rood et a l . , 1958; Payne and Rolf , 1958). The separation of the HLA complex into l o c i depended on population genetics and s t a t i s t i c a l analysis of many antisera assayed on several different target c e l l s . Each locus has been shown to be extremely polymorphic with up to 50 a l le les ident i f ied at a single locus. A l l e l e s o r i g i n a l l y assigned by s t a t i s t i c a l methods have now been confirmed through family studies (reviewed in McMaster, 1981; Barnstable et al . ,1979). The antigens encoded by the HLA-A, HLA-B, and HLA-C l o c i are also cal led Class I molecules. 2. The Class II Antigens a) Immune Response Genes Although a genetic factor regulating immune responses was described as early as 1938 i t was not u n t i l well defined synthetic antigens became available in the early 1960's that detailed analyses were attempted (Barnstable et al,1979). Levine and colleagues challenged two strains of guinea pig with a simple polypeptide antigen, po ly-L- lys ine , one s train could respond by producing antibody whereas the other could not (Levine et al . ,1963). Further studies in guinea pig (Levine et al.,1963) and in mouse (McDevitt and Sela,1965) involving genetic crosses between responder and non-responder animals showed that the a b i l i t y to respond to the antigen challenge was under the control of a single dominant 5 gene. This gene and later genes were cal led the immune response genes. Inbred strains of rat (Amerding et al.,1974) and mouse (McDevitt and Chinitz,1969) were used in linkage experiments to assign the immune response genes to a region (cal led the I or immune response gene region) within the previously defined MHC. b) Immune Associated Antigens In an attempt to serological ly identify the products of the immune response genes congenic mice and guinea pigs were developed. These animal strains d i f f er only in the immune response (or I) region of the MHC, and were used to raise ant i - I region sera of exquisite spec i f i c i ty . Studies in mouse and in guinea pig showed that ant i - I region sera reacted with highly polymorphic c e l l surface glycoproteins expressed only on B-lymphocytes and macrophages (Shreffler and David,1975; Schwartz et al . ,1976; and Sachs et a l . , 1977). The antigens described in this manner were termed immune associated or l a , and are now cal led Class II antigens. The a v a i l a b i l i t y of ant i - I region sera allowed the further sub-divis ion of this region through the detection of cross-over events between l o c i . Specif ic sera have ident i f ied the A, E , and/or C sub-regions or l o c i in mice (Shreffler et al . ,1976). c) Mixed Lymphocyte Responses The mixed lymphocyte response (MLR) involves the mixing of lymphocytes from different individuals in an in v i tro culture. If the ce l l s are cultured in the presence of -^H-thymidine, c e l l pro l i ferat ion can be measured by the incorporation of radioact iv i ty (Bain et al . ,1964). In an early study 0% of monozygotic twins and 50% of dizygotic twins showed stimulation of lymphocyte pro l i ferat ion in this 6 type of assay, c lear ly suggesting a genetic basis (Bain et al . ,1964). The MLR response was linked to the MHC by demonstrating that lymphocytes from sibl ings who were ident ica l at HLA Class I l o c i did not react with each other whereas lymphocytes from unrelated but HLA Class I ident ical individuals did react in 90% of cases (Bach and Amos,1967). These results suggested that the genes which regulate mixed lymphocyte responses were linked to but separate from the HLA Class I genes (Yunis and Amos,1971). The development of standardized assays for typing ce l l s allowed a s imilar type of analysis as that used to study the genetics of the HLA Class I antigens, to be applied to the genes that induce a mixed lymphocyte response. Using the analyt ica l techniques of population genetics and s ta t i s t i c s a large number of mixed lymphocyte response types have been defined. Family studies have shown that MLR types behave as a l l e l es at a single locus, now cal led the D or Class II locus (Barnstable et al . ,1979). During analysis of the immune associated or Class II antigens in mice, i t was found that ce l l s bearing Class II antigens could cause the al loreact ive pro l i ferat ion of unprimed T-lymphocytes in a response ident ica l to the mixed lymphocyte response observed in humans (Frei l inger et al . ,1974). Furthermore, anti-Class II antiserum could block the mixed lymphocyte response stimulated by Class II bearing ce l l s (Frei l inger et al . ,1974). These findings c lear ly associated the Class II antigens to the genes control l ing the mixed lymphocyte response. Cepe l l in i and colleagues (1969) observed that HLA typing sera could also inhibi t mixed lymphocyte responses using human c e l l s . These sera were not reactive with the Class I antigens encoded by the HLA-A, HLA-B, 7 or HLA-C l o c i , and yet reac t iv i ty segregated with the HLA complex in families (van Leeuwen,1973). d) Class II Antigens are encoded by Class II Genes The evidence that the Class II antigens are the products of the Class II genes is threefold. F i r s t the Class II antigens and the Class II genes have been mapped to the same sub-region of the MHC. Secondly anti-Class II antisera block mixed lymphocyte responses which are known to be under Class II gene control . F i n a l l y a number of studies d irec t ly l ink Class II antigen structure to an immune response. When two non-responder mice were crossed the F^ progeny were unexpectedly found to respond to the same antigen. This suggested that the response to this antigen L-glutamic ac id , L- lys ine , L-phenylalanine (GLcp) was under the control of a recessive gene (Dorf and Benacerraf,1975). Later i t was shown that two genes were involved, one of which was mapped to the I-A subregion of the H-2 complex (Dorf and Benacerraf,1975), and the other to the I-E subregion (Jones et al . ,1978). Cook et a l . (1979) later showed that the E Q chain was I-E encoded whereas the Ep chain was I-A encoded. Furthermore, these two chains must associate in order to form a functional Class II molecule. Antisera raised against GL(p responder mouse ce l l s were also found to block the immune response to GLcp. The a b i l i t y of a n t i - l a sera and monoclonal antibodies to block immune responses established the close functional relationship between Immune response genes and Immune associated antigens (Schwartz et al. ,1976; Baxevanis et al . ,1980). Further confirmation came with the advent of cDNA cloning and gene transfer technologies. Mice of the H-2*5 haplotype are non-responders to GLcp due to a fa i lure of ce l l s of this haplotype to express Class II E Q 8 chain molecules. The creation of transgenic mice in which functional H-2 E molecules were reconstituted by the introduction of a cloned gene into mice which produce no endogenous E Q molecules proved conclusively that the Class II antigens are the products and effectors of the Class II genes (LeMeur et al . ,1985; Yamamura et al . ,1985). B. The Structure of MHC Products The use of antisera developed against the products of the genes encoded by the MHC has led to the ident i f icat ion of three families or classes of molecules designated I , I I , and III . The genetic l o c i encoding each class of MHC product has been ident i f ied in mouse and human whereas only l o c i encoding the Class I and II molecules have been ident i f ied in the rat . 1. The Class I Molecules The Class I molecules are highly polymorphic transmembrane glycoproteins normally expressed on a l l nucleated c e l l s . These proteins are approximately 350 amino acids in length, have a molecular weight of 45,000 , and can be sub-divided into three extramembrane domains (Klein et al . ,1981). Class I molecules are normally found associated with the non-MHC encoded glycoprotein 32-microglobulin (Figure 1) and function in regulating the recognition of antigen by cytotoxic T-lymphocytes (CTL) (Klein et al . ,1983; Kaufman et al. ,1984; Sporer et al . ,1979). a) Structure of the Rat Class I Molecules The rat Class I molecules have not been characterized to the same degree as the murine Class I molecules. Most of the information available on the rat concerns the ident i f icat ion and preliminary characterization of the products of the Class I l o c i . 9 Class I Class II Figure 1: The s t r u c t u r e of the MHC encoded Class I and Class II pr o t e i n s . The domain s t r u c t u r e of the proteins are i l l u s t r a t e d , a l , a2, a3, 31, and 32 denote the e x t r a c e l l u l a r domains, C denotes the cytoplasmic t a i l , and the transmembrane domain, designated TM, i s shown spanning the plasma membrane. 3M i s beta-2-microglobulin, and S-S denotes intra-domain d i s u l p h i d e bonds. 10 The predominant species of transplantation antigen immunoprecipitated from rat c e l l membranes was shown to have a molecular weight of 45,000 (Sporer et al . ,1979). These molecules were found to be associated with a 12,000 molecular weight protein, presumed to be 32-microglobulin, on the membranes of a l l nucleated c e l l s . Through sequential immunoprecipitation studies i t was demonstrated that there were more than one species of rat class I molecule (Sporer et al. ,1979; Natori et al . ,1979). N-terminal amino acid sequence data confirmed a second Class I species of molecular weight 42,000 (Blankenhorn et al.,1978) which was later genetically mapped to the RT1.C locus (Kohoutova, 1980). This 42,000 molecular weight Class I protein showed a res tr ic ted tissue d is tr ibut ion compared to the RT1.A encoded proteins in that i t could not be demonstrated on erythrocyte or hepatocyte membranes (Haustein,1982). The lower molecular weight and the res tr ic ted tissue d is tr ibut ion led Haustein (1982) to propose that the RT1.C locus was the rat homolog of the murine Qa/Tla complex. Class I proteins highly s imilar in size and d is tr ibut ion to those from the RT1.A locus have now been identi f ied and mapped to the RT1.E (Kunz et al.,1982) and to the RT1.F (Misra et al.,1982) l o c i . Hybridization studies using rat Class I probes have ident i f ied at least 20 different DNA bands which hybridize to the probes. This finding when compared to s imilar studies in mouse suggest the rat genome contains about 20 Class I genes (Gunther et al . ,1985). b) Comparison to the Mouse Extensive studies on the Class I proteins from the mouse have revealed detailed information on the structure of these molecules. The proteins have a molecular weight of 45,000, are transmembrane proteins, 11 and are found associated with 32-microglobulin on the surface of a l l nucleated ce l l s (Goding,1981; Michaelson,1981; and Robinson et al . ,1981). Amino acid sequence data derived from several different mouse haplotypes showed that the protein was composed of 5 domains; 3 extramembrane, a transmembrane region, and a cytoplasmic domain (Coligan et al.,1981) (see Figure 1). Each of the three extramembrane domains was about 90 residues in length. Characterist ic di-sulphide bridges were found in the a2 and a3 domains as well as up to three potential glycosylation sites in each of these domains (Maloy et al . ,1982). Furthermore the 32-microglobulin protein was found to associate with the a3 domain (Yokoyama and Nathenson,1983). 2. The Class II Molecules The Class II molecules are composed of two non-covalently associated transmembrane glycoproteins cal led the a and 3 chains with molecular weights of 29,000 to 34,000 and 24,000 to 28,000 respectively (Figure 1). Class II molecules show a restr ic ted tissue d is tr ibut ion and are found on B-lymphocytes, antigen presenting ce l l s such as macrophages and dendrit ic c e l l s , and some activated T-lymphocytes. Class II molecules are also highly polymorphic and function in regulation of antigen recognition by T-lymphocytes (Kaufman et al. ,1984: Klein et al. ,1983: McMaster and Williams,1979). a) The Structure of the Rat Class II Molecules The structure of the rat Class II gene products were f i r s t examined by radiochemical labe l l ing and immunoprecipitation (Sachs et al.,1977) of proteins from thymic ep i the l i a l re t i cu lar c e l l s . Similar procedures were used to isolate proteins from mouse thymic ep i the l ia l re t icu lar ce l l s (Cullen et al.,1976) and human B-lymphocytes (Springer et 12 et al . ,1977). These antigens were shown to be composed of two non-covalently bonded glycoprotein chains of molecular weight 25,000 to 30,000 and 32,000 to 36,000 respectively. Further characterization of rat Class II antigens was achieved using monoclonal antibodies. Rat Class II protein molecules were isolated from detergent so lubi l ized rat thymocyte membranes by l e n t i l l ec t in a f f i n i t y chromatography, size fractionated, and used to produce mouse monoclonal antibodies specif ic for rat Class II proteins. One monoclonal MRC 0X3 was shown to detect Class II determinants on rat B-lymphocytes, some thymocytes, spleen ce l l s from various strains of rat , and several human lymphoblastoid c e l l l ines as determined by binding assay or flow cytometry. Furthermore, binding studies on inbred strains of mouse with known recombinational events within the Class II region of the MHC showed that MRC 0X3 identi f ied proteins which mapped to the mouse Class II A region. This monoclonal antibody was used in antibody a f f i n i t y chromatography of so lubi l ized rat spleen membranes to purify an RT1.B molecule. RT1.D molecules were puri f ied in a s imilar fashion using the monoclonal antibody MRC 0X17. Rat Class II molecules isolated in this manner were shown to consist of two non-covalently linked glycoprotein chains of apparent molecular weight 29,000 and 24,000 designated the a and 3 chains respectively (reviewed in McMaster and Williams,1979). Further studies have shown that Class II molecules are expressed on B-lymphocytes, spleen c e l l s , some thymocytes, a small percentage of bone marrow c e l l s , and kidney tissue (McMaster and Williams,1979; Mason and Gallico,1978). Class II molecules in human have been described as being expressed on bone marrow derived ce l l s such as B-lymphocytes, 13 macrophages, and dendrit ic ce l l s ; non-bone marrow derived ce l l s such as thymus, in te s t ina l , and kidney epithelium; and some tissues after stimulation such as mammary glands during lactat ion, or contact sensitized epidermal ce l l s (Daar et al,1984). Serological studies have shown the rat Class II molecules to be highly polymorphic. More recently two dimensional denaturing polyacrylamide gel electrophoresis (PAGE) (Sawicki and Wettstein,1984) has also been used to identify polymorphism in Class II molecules. Studies on the i so lat ion of Class II membrane proteins as well as hybridization studies searching for Class II genes have been unable to demonstrate more than one a chain and two 3 chains at each of the B and D l o c i (Diamond et al,1985; Gunther,1985). b) Comparison to Mouse and Human The murine and human Class II molecules have provided most of the structural information known about these molecules. Limited proteolysis of intact dimeric molecules and separated chains, as well as structure deduced from cloned Class II genes or cDNAs has given r i se to the structure shown in Figure 1 (Kaufman et al. ,1984; Hood et al. ,1983; Mengle-Gaw and McDevitt,1985). As described above Class II molecules are composed of two non-covalently linked polypeptide chains, designated a and 3- The observed difference in the molecular weights of the a and 3 chains is due to an additional N-linked carbohydrate side chain on the a molecule (Germain and Malissen,1986). Both chains are transmembrane glycoproteins consisting of two large external domains, a hydrophobic transmembrane region, and a short hydrophilic cytoplasmic t a i l (Mengle-Gaw and McDevitt,1985). The external domains of both chains are about 90 amino acids in length, and the 32, and a2 domains contain disulphide 14 bridges highly characterist ic of immunoglobulin constant region domains, MHC Class I membrane proximal (a3) domains, and 32-microglobulin (Larhammar et al . ,1982). The 31 domain also contains a disulphide bridge whereas the a l domain does not (Shackelford and Strominger,1983). There are two potential glycosylation sites in the a chain; one in the a l domain at residue 78, and a second in the a2 domain at residue 118 (Shackelford and Strominger,1983; Kaufman and Strominger,1982; Kaufman et al. ,1984; and Mengle-Gaw and McDevitt,1985). The a2 and 32 domains are believed to form characterist ic t er t iary structure of the immunoglobulin fo ld . Biochemical data and DNA sequence identity to immunoglobulin constant region domains suggests that the a2 and 32 domains associate to form a 3"pleated structure creating an immunoglobulin-like three dimensional configuration (Kaufman and Strominger,1982: Larhammar et al . ,1982). It has been suggested that the a l and 31 domains also form interacting 3~pleated sheets (Mengle-Gaw et al,1984), and that the transmembrane regions form a helices (Travers et al . ,1984). Data derived from the nucleotide sequence of RT1 B a (Wallis and McMaster,1984), RT1 Dp (Robertson and McMaster,1985), and RT1 D Q (Holowachuk,1985) Class II cDNAs as well as the RT1 Bp gene (Eccles and McMaster,1985) have shown that rat Class II molecules are highly homologous to those of human and mouse. 3. The Class III Molecules The Class III molecules are components of the complement system, C2, C4, 21-hydroxylase and factor B (Klein et al . ,1981). While these molecules are encoded by the MHC and have immunological function they bear no s tructural or functional resemblance to the Class I or II 15 molecules. In fact the fa i lure to find any evidence of functional or evolutionary t ies between the Class III molecules and the rest of the MHC has led Klein (1983) to argue for their exclusion from discussions of the MHC. The Class III molecules w i l l not be discussed further. C. Genetic Organization of the MHC The use of serological reagents in the analysis of recombinational events between animals of different haplotypes has been used to construct genetic maps for the rat (RT1), mouse (H-2), and human (HLA) major histocompatibil i ty complexes. A comparison of the organization of the MHC's of rat , mouse, and human is presented in Figure 2. 1. Structure of the Rat RT1 Complex a) H i s t o r i c a l Perspective The MHC of the rat is known as the RT1 complex. H i s t o r i c a l l y the rat MHC has been referred to as the Ag-B or H- l complex (Howard,1983), although these designations are no longer in use. The RT1 complex has not been assigned to a part icular chromosome, nor has the orientation of the RT1 complex been determined with reference to the centromere (Howard,1983). The l o c i of the RT1 complex were defined by analysis of genetic crosses between rats of different serological haplotypes. Recombination events occurring between regions encoding defined MHC phenotypes allowed the d iv i s ion of the RT1 region into specif ic l o c i . The f i r s t two loc i defined in this manner were those encoding the Class I and Class II MHC functions and were cal led the A and B l o c i respectively (Stark et al. ,1977: Butcher and Howard,1977: Gunther et al . ,1978). Further studies ident i f ied and mapped other Class I l o c i which were cal led the RT1.C (Kohoutova et al . ,1978), RT1.E (Kunz et al . ,1982), and another proposed 16 RT-1 A B B 2 -o-Ba D 6 2 D6 Da -6 o • - • -E -o : l a s s I I I I I I I I I I I I -o-I H-2 O A B Act E B E 8 2 - o -E a C4 L D Q a / T l a -•-o-m-c l a s s I I I I I I I I I I I I I I I HLA O DP • • • • cm • • • • DZ B a (J. DQ a 2 B i a ! DR B i B 2 B 3 a C2 C4 Bf 3 A c l a s s I I 11 I I I Figure 2: Organization of the MHC i n r a t , mouse, and man. Class I and Class II l o c i are shown. The MHC has been assigned to chromosome 17 i n the mouse and chromosome 6 i n human. No chromosomal assignment has been made f o r the r a t RT1 complex. The large open c i r c l e s i n d i c a t e the l o c a t i o n of the centromere with respect to the MHC where known. Shaded c i r c l e s denote genes which are known to be expressed, whereas open c i r c l e s denote genes which are not expressed or f o r which e x p r e s s i b i l i t y has not been determined. 17 locus RT1.F (Misra et al . ,1985). In addition a second Class II locus was ident i f ied and cal led the RT1.D locus (Lobel and Cramer,1981). There have been no Class III l o c i ident i f ied in the rat to date, b) Structure of the RT1 Complex The orientation of the known l o c i of the RT1 complex is shown in Figure 2. It has been proposed that the RT1.A locus encodes the c la s s i ca l Class I transplantation antigens, which are expressed on a l l nucleated c e l l s . Data from studies using monoclonal antibodies (Misra et al.,1985) and re s t r i c t i on fragment length polymorphisms (RFLP) (Gunther et al,1985) have shown these Class I l o c i to be highly polymorphic, identifying up to 19 different a l l e l e s . The RT1.C and RT1.E l o c i have been shown to contain Class I l ike genes by hybridization with rat Class I gene probes (Gunther et al . ,1985), however the products of these l o c i do not exhibit typica l Class I histocompatibil i ty behaviour (Stark and Gunther,1982). The molecules encoded by the RT1.C and RT1.E show a more restr ic ted tissue dis tr ibut ion and lower levels of expression when compared to RT1.A encoded molecules (Diamond et al . ,1985). Furthermore, the location of the RT1.C locus in re lat ion to the other RT1 l o c i (Figure 2) resembles that of the H-2 Qa/Tla l o c i , which coupled with the non-classical Class I behaviour has led several researchers to c a l l the RT1.C locus the homolog of the Qa/Tla region of the mouse (Misra et al. ,1985: Gunther et al . ,1985). More than 80% of the rat Class I gene clones which have been mapped are local ized in the RT1.C region. In the mouse the majority of Class I genes have been local ized to the Qa\Tla region. The RT1.B and RT1.D regions have been shown to encode Class II molecules highly homologous to the A and E l o c i of the mouse H-2 complex 18 (Fukomoto et al . ,1982). Each locus contains one a chain gene and probably two 3 chain genes ordered as shown in Figure 2 (Blankenhorn and Cramer,1985; Diamond et al . ,1985; and Blankenhorn et al . ,1983). 2. The Structure of the Mouse H-2 Complex The a v a i l a b i l i t y of many inbred, congenic, and recombinant congenic strains of mice and highly specif ic a l loant isera has allowed the H-2 complex to be characterized in great de ta i l (Hood et al,1983). Figure 2 shows the structure of the H-2 complex and i t s orientation on chromosome 17. Comparison of the overal l structure of the H-2 complex to that of the rat RT1 complex shows s tr ik ing s imi lar i t i e s in the number and orientation of l o c i , ref lect ing their closeness in evolutionary time. The H-2 complex encodes about 30 Class I genes in 4 regions as follows: 2 K genes, 2 D/L genes, at least 10 Qa 2,3 genes, and at least 13 Tla genes (Weiss et a l . , 1984). The K and D/L l o c i are extremely polymorphic with at least 50 different a l l e l es having been ident i f ied in both wild and inbred populations of mice (Hood et al. ,1983; Weiss et al . ,1984). The Qa/Tla l o c i appear to be less polymorphic, but as described above encode a greater number of Class I genes (Klein et al . ,1983). The Class II region (or I region) contains 7 genes encoding an A Q , Ap3, Ajj2 pseudogene, Apj , E a , Epi_, and Ep2 genes oriented as shown in Figure 2 (Steinmetz,1982; 1985). With the exception of the E Q gene (Mathis et a l . , 1983) each of these genes shows considerable polymorphism (Steinmetz,1985). 3. The Structure of the Human HLA Complex I n i t i a l l y serological reagents were used to define the number and organization of HLA encoded genes in humans. More recent studies using 19 cosmid mapping and gene counting experiments have supported much of the early data. A comparison of the HLA complex to rat and mouse is shown in Figure 2. The HLA-A, B, and C l o c i are the human Class I regions, and are homologous to the Class I regions of mouse and rat . The human Class II genes are encoded in the D region of the HLA complex. Comparison of the orientation of the MHC complex between these three species reveals a s tr ik ing difference. In rat and mouse the Class II region is surrounded by two Class I encoding regions whereas in humans the Class I and Class II regions are adjacent. G i l l and colleagues (1982) have suggested that during evolution the ancestral Class I and Class II genes duplicated to form multiple l o c i adjacent to each other. Following the divergence of man and rodents an inversion event occurred in rodents placing the Class II region between two Class I regions. Further duplication events would give r i s e to the genetic map seen today. The human Class I molecules have been shown to be highly polymorphic with 10 to 50 a l le les ident i f ied serological ly at each of the HLA-A ,B , and C l o c i (Bodmer, 1984). Serological and biochemical studies have shown evidence for human homologs to the murine Qa/Tla region, however no genes have been ident i f ied or mapped to the HLA region (Steinmetz and Hood,1983). The human Class II region has been shown to contain at least three l o c i cal led HLA-DR, HLA-DQ, and HLA-DP. The HLA-DQ and HLA-DR l o c i are homologous to the H-2 A, H-2 E , and RT1 B, RT1 D l o c i respectively, however there is no rodent homolog for the HLA-DP locus. In addition the human HLA-DP locus is the only known Class II locus encoding two a chain genes (Auffray et al. ,1984; Servenius et al . ,1984). The HLA-D l o c i also 20 exhibit marked polymorphism with 16 HLA-DR, 3 HLA-DQ, and 6 HLA-DP a l l e l es ident i f ied to date (Kle in , 1986; Bodmer,1984). D. The Structure of the Class I and Class II Genes 1. Class I The DNA encoding the 340-350 amino acids of Class I proteins is separated into eight exons which correspond precisely to the domain structure of the protein (Hood et al . ,1983). Exon 1 encodes the leader peptide, and exons 2, 3, and 4 encode the three external domains of the protein ( a l , a2, and a3 respectively) . The transmembrane region is encoded in exon 5. The cytoplasmic domain is encoded in exons 6, 7, and 8. In addition exon 8 also encodes the 3' untranslated region. The Class I genes of mouse and rat (Hood et al. ,1983) are highly s imilar in structure, however the human Class I genes show a variat ion in that the cytoplasmic domain is encoded in two rather than three exons (Malissen et al . ,1982). In general the Class I genes possess the characterist ics common to a l l eukaryotic genes. Intron/exon boundaries conform to the GT\AG rule (Breathnach and Chambon,1981), the 5' flanking sequences contain the CAAT and TATA promoter elements upstream from the i n i t i a t i o n codon, and a polyadenylation signal can be found 400 nucleotides 3' to the termination codon (Hood et al . ,1983). 2. Class II The structure of the Class II genes corresponds closely to the domain structure of the protein in rat , mouse, and human (Figure 3 ). Class II 3 genes of mouse (Larhammar et al.,1983) and rat (Eccles and McMaster,1985) are encoded in six exons whereas the human HLA-DCp gene has only 5 exons (Schenning et a l . , 1984). Exon 1 codes for the leader 21 SUT1 <x1 <x2 TMjC 3UT - a • ! WM JM—Wk CK 5'UTL m fl2 TM C C,3'l)T - a m—am—i—i—wzz— {] Figure 3: Structure of Class II genes. The H-2 E a chain gene (Mathis et a l . , 1983) and RTl Bp chain gene (Eccles and McMaster, 1985) are shown as examples of Class I I a and B chain gene s t r u c t u r e s . Shaded boxes denote coding sequence and cross-hatching denotes untranslated sequences. L denotes the leader peptide, a l , a2, 31 > and 32 denote the exons encoding the ex t e r n a l domains of the prote i n s ; TM denotes the transmembrane region: C denotes the cytoplasmic region of the p r o t e i n ; and 3'UT denotes the untranslated region found i n the 3' fl a n k i n g region. 22 peptide and the f i r s t four amino acid residues of the - f i r s t external domain. Exons 2 and 3 each encode the f i r s t and second external domains respectively. Exon 4 contains the sequence for the transmembrane region, and exon 5 the cytoplasmic region. Interestingly human Class H p genes do not have a separate exon for the cytoplasmic region but instead encode the 3" untranslated sequence in a single exon (Schenning et a l . , 1984). The sixth exon in rodents contains 8 residues of the cytoplasmic domain and the 3' untranslated sequence. The Class II a genes of mouse (Benoist et al.,1983) and human (Mathis et al.,1983) are encoded in f ive exons. Exon 1 encodes the leader peptide and 3 to 4. residues of the a l domain. Exons 2 and 3 encode the a l and a2 domains respectively. In contrast to one exon per domain, the transmembrane region, cytoplasmic t a i l , and several residues of 3' untranslated region are a l l encoded in exon 4. Exon 5 contains the remainder of the 3' untranslated sequence, which is unusual in that the 3' untranslated sequences are normally not s p l i t between exons. E. Functions of the MHC 1. Functions Assigned to the Class I Antigens a) Graft Rejection The primordial function of the MHC may have been in se l f non-self recognition. Although tissue transplantation is only encountered surgical ly or in animal experiments today, there are examples of MHC regulation of natural transplantation in the invertebrates. The tunicate Botryllus primigenus l ives in colonies sharing a common vascular system and encased in a common gelatinous tunic. Parental organisms sexually reproduce to form tadpole l ike larva which undergo metamorphosis to form oozooids which in turn form colonies by budding. Parental individuals 23 are reabsorbed by fusion with newly formed buds. The fusion process appears to be under the control of genes encoded by an ancestral MHC l ike gene complex (Scofield et al . ,1982). Although tissue transplantation cannot be the function for which the Class I genes have evolved, they nonetheless present a formidable obstacle to the surgical transplantation of tissue in medicine. The strong allogeneic response e l i c i t e d in the recipient by donor Class I and Class II antigens ultimately causes the rejection of the graft . The careful matching of donor and recipient for shared Class I and other histocompatibil ity antigens has improved the success of organ transplants, however with the exception of ident ica l twins - matches are d i f f i c u l t to achieve without the aid of immunosuppressive drugs, b) Restrict ion of Cytotoxic T-lymphocyte (CTL) Act iv i ty The Class I molecules have been shown to play an important role in the recognition of virus infected ce l l s by syngeneic Cytotoxic T-lymphocytes (CTL). Zinkernagel and Doherty (1974) showed that T-lymphocytes isolated from an H-2 type K^D^ animal infected with Lymphocytic choriomeningitis virus (LCMV) would k i l l Lymphocytic choriomeningitis virus infected target ce l l s of H-2 type K^D^, but neither Lymphocytic choriomeningitis virus infected ce l l s of H-2 type K^D^, nor uninfected ce l l s of H-2 type K^D^ were k i l l e d . Similar studies in mouse (reviewed by Ploegh et al.,1981) and human (McMichael et al.,1977) have confirmed this phenomenon known as MHC r e s t r i c t i o n . Cytotoxic T-lymphocytes function in the surveil lance of the immune system, constantly searching for and destroying ce l l s which display altered se l f Class I antigens on their c e l l surfaces (Hood et al . ,1983). Some highly oncogenic viruses such as human adenovirus appear to escape 24 the immune system by a l ter ing the expression of Class I molecules on the surface of ce l l s they infect (Schrier et al . ,1983). Reintroduction of functional Class I genes into Adenovirus 12 transformed ce l l s results in loss of oncogenicity by the virus (Tanaka et al . ,1985). Furthermore, introduction of Class I genes and de novo synthesis of product in fibrosarcoma ce l l s reduced their tumourigenicity and metastatic potential (Wallach et al . ,1985). This suggests that lack of expression of Class I molecules can result in evasion of the immune system by tumour c e l l s . However, induction of Class I antigens in other tumours increases tumour growth (Brickwell et al . ,1985). Nonetheless Class I proteins are instrumental in determining the targets of cytotoxic immune a c t i v i t y . c) A l l e l i c Polymorphism and Function One of the most outstanding features of the Class I antigens is the extreme polymorphism in the primary structure of these proteins. Serological studies using al loant isera and monoclonal antibodies developed in MHC congenic mice have defined over 50 different a l l e l i c determinants at each Class I locus (Klein et al . ,1981). S imi lar ly , many Class I a l l e l e s have been demonstrated in wild rats (Wagener,1979). The conservation of Class I antigen polymorphism through the evolution of mammals suggests that i t plays a role in the function of these molecules. Studies directed towards the understanding of structure-function relationships have employed the spontaneous Class I mutants natural ly occurring in mice (Nathenson et al . ,1986). Tryptic peptide mapping, amino acid sequencing, and most recently DNA sequencing (Nairn et al . ,1980; Pease et al. ,1983; and Weiss et al.,1983) have been used in the detailed structural analysis of the H-2 25 family of spontaneous in vivo mutant Class I molecules and their parent molecules. Comparison of s tructural data to functional studies using anti-K^ antisera and al loreact ive Cytotoxic T-lymphocytes (CTL) allowed the ident i f icat ion of regions of functional importance within the Class I molecule. These studies have ident i f ied one region in each of the a l (residue 70 to 90) and the a2 (residue 150 to 180) domains to which anti-Class I antisera were directed. Furthermore, disruptions in these sequences, even of a small nature, grossly altered the react iv i ty of these Class I molecules with specif ic T - c e l l s , apparently by a l ter ing the conformational determinants formed by the interaction of the a l and a2 domains (reviewed in Nathenson et al . ,1986). Clearly primary sequence polymorphism is involved in the regulation of the functional interaction of Class I bearing ce l l s and lymphocytes. A study of the Cheetah Acinonyx jubatus showed that this species exhibited considerably less genetic variat ion than other mammals. The MHC, normally the most polymorphic genetic region, shows l i t t l e or no genetic variat ion as demonstrated by skin grafting experiments. In 14 out of 14 cases skin grafts were accepted without complications between unrelated animals. The apparent monomorphism of the cheetah has been attributed to a population bottleneck. Perhaps the worst consequence of this monomorphism is the suscept ib i l i ty of the cheetah to the Coronavirus and the fa ta l disease Feline Infectious Per i toni t i s i t causes. The Cheetah population apparently lacks any individuals carrying the appropriate MHC a l l e l e to mount a effective immune response to the Coronavirus, and as a result entire populations have been decimated 26 (O'Brien et al . ,1985). This example may show the importance of MHC polymorphism in the protection of populations from infectious diseases. 2. Functions Assigned to the Class II Antigens a) Activation of T-lymphocytes Activation of T-lymphocytes in an immune response requires the recognition of Class II molecules and antigen by the T - c e l l ' s antigen receptor. This phenomenon was f i r s t cal led the mixed lymphocyte response in which the act ivation of T-lymphocytes is by Class II antigens presented by allogeneic lymphocytes. Physiological ly , presentation of antigen to T-ce l l s is the function of macrophages and dendrit ic c e l l s , the so cal led "antigen presenting ce l l s" . Lipsky and Rosenthal (1973) demonstrated that antigen must be processed by the antigen presenting c e l l , and presented to the T - c e l l associated with Class II molecules in order to be immunogenic. Later work showed that isolated membranes containing Class II molecules could also activate T-lymphocytes provided that the antigen had been "pre-processed" by proteolyt ic digestion (Watts et al . ,1984). B - c e l l lymphomas (Ben-Nun et al . ,1984), and L-ce l l s (Norcross et al. ,1984) have been transfected with cloned Class II genes and both express functional transfected Class II molecules on their c e l l surfaces. B - c e l l lymphomas are known to be capable of antigen processing (Shimonkevitz et a l . , 1982), however the finding that the L - c e l l f ibroblastoid c e l l l ine also processes antigen was unexpected (Shastri et al . ,1985). Furthermore, i t suggests that the physiological pathways involved in antigen processing are not confined to the lymphoreticular system (Germain and Malissen, 1986). It is clear that recognition of processed antigen in the context of Class II proteins by T-lymphocytes activates these ce l l s for part ic ipat ion in immune responses to antigen. 27 b) Restrict ion of Helper T-lymphocyte A c t i v i t y The Class II molecules are also involved in the regulation of antibody responses by B-lymphocytes. B-cel ls respond to antigen by producing antibody only when activated by helper T-lymphocytes. T - c e l l act ivation of B-cel l s requires the recognition of Class II molecules on the c e l l surface of the B-lymphocyte. Several investigators have demonstrated that the B - c e l l must share the same MHC haplotype as the activating T - c e l l in order to respond and synthesize antibody (Katz,1973; Kappler and Marrack,1978). More recently Lanzavechia (1985) has proposed a mechanism for B - c e l l act ivation by T - c e l l s . Antigen molecules can be bound by immunoglobulin receptors on the B-lymphocyte c e l l surface and absorbed by endocytosis. The antigen can then be processed by the B - c e l l and presented along with Class II molecules on i t s c e l l surface. Recognition of processed antigen and Class II molecules by helper T-ce l l s results in the induction of antibody production by the B - c e l l . Class II molecules are also involved in the regulation of c e l l mediated immunity. Von Boehmer (1978) immunized female mice with ce l l s from male mice of the same s tra in , where male antigens are recognized as foreign by the female recipient in a Class I mediated cytotoxic T-lymphocyte response. He noted that reconstitution of chimeric mice which were high responders to male antigen with ce l l s from two different mice which were low responders to male antigen gave different results . In one case the chimeric mice remained high responders while the other became low responders. The lack of immune response in the one case was found to be due to histoincompatibi l i ty between the helper T - c e l l and the responding cytotoxic T-lymphocyte at the Class II locus. 28 c) A l l e l i c Polymorphism The majority of the nucleotide and protein sequence variat ion between Class II a l l e l e s is clustered in several regions of the N-terminal domains of both a and 3 chains (Benoist et al . ,1983). Furthermore, comparison of Class II protein sequences between different species such as ra t , mouse, and man (Eccles and McMaster,1985; Robertson and McMaster,1985; and Wallis and McMaster,1984) shows that interspecies variat ion in Class II proteins is also clustered in regions of the a l and 01 domains. The non random nature of the polymorphism in the a l and 01 domains suggests that these regions function as the s i te of recognition for antigen and /or the T - c e l l receptor (Mengle-Gaw and McDevitt,1985). Several investigators have examined the relationship between structural variat ion in Class II molecules and their function. Wakeland and colleagues (1985) studied two mouse a l l e l es H-2 A k v l , and H-2 A k v 2 which can be differentiated serological ly using monoclonal antibodies and functionally using H-2 A k restr icted al loreact ive T-lymphocytes. Tryptic digest and amino acid sequence mapping local ized the regions responsible for the observed differences to residues 43-71 of the a chain, 26-29 of the 3 chain, and 95-106 of the 3 chain. Site directed mutagenesis has been used to introduce amino acid changes in specif ic regions of the 31 domain of murine H-2 A*3 molecules (Cohn et al . ,1986). Analysis of the serological and functional changes caused by the H-2 Ap chain mutations ident i f ied two sites (residues 9-13, and 65-67) responsible for the re s t r i c t i on of Class II ac t i v i ty . It was clear that changes in the primary structure of Class II molecules in the so cal led regions of a l l e l i c hypervariabi l i ty resulted in changes in the 29 functional recognition of these molecules by antibodies and a l lores tr i c ted T-lymphocytes. A recent study (Landais et al.,1986) examined the relationship between the regions of a l l e l i c v a r i a b i l i t y of the H-2 A a molecule and the immunogenicity of the molecule. Chimeric A Q molecules were constructed from the cDNA clones encoding the a chain of H-2 A^ and H-2 Ap mice. The chimeric A Q chains were introduced into mouse L-ce l l s by DNA mediated gene transfer techniques along with a cDNA encoding a complete H-2 Ap molecule. The Class II molecules expressed on the c e l l surface were then characterized using monoclonal antibodies specif ic for determinants on the A a chain, and which dist inguish the A^ and A*3 a l l e l e s . The residues which defined k a l l e l e and b a l l e l e were local ized to positions 69-76 and 53-59 of the a l domain respectively. The authors noted that despite the extensive polymorphism in a l , at residues 11-15, 53-59, and 69-76 in both the A^ and A b molecules, the monoclonal antibodies tested recognized only one hypervariable region in di f ferent iat ing the two a l l e l e s . This apparent l imited spectrum of react iv i ty exhibited by the ant i -A Q reagents could be caused by the inaccess ib i l i ty of polymorphic regions due to protein conformation. Alternatively the a l l e l i c amino acid substitutions may not a l ter the protein structure enough to be immunogenic. Evidence suggests that amino acid substitutions between the A^ and A b a chains such as arginine to threonine at posit ion 56 suf f ic ient ly changes the loca l charge to s igni f icant ly a l ter the local structure (Landais et al . ,1985). Similarly hydrophi l ic i ty plots predict that a l l three of the hypervariable regions are exposed on the surface of the A Q molecule (Landais et al . ,1986). It appears that mice simply cannot respond, by 30 producing antibody, to a l l the available polymorphism in the Class II molecules. This may explain the observation that serological ly the H-2 A Q chains appear less polymorphic (Klein and Figueroa,1981) than would be predicted from the comparison of a l l e l i c nucleotide sequences (Benoist et al . ,1983). Determination of the three dimensional crysta l structure of Class II molecules may allow the fine de ta i l of Class II antibody interaction to be examined. Despite the extensive work done on the effects of s tructural variat ion in Class II molecules on recognition by antibody i t is not known i f the T - c e l l receptor recognizes Class II molecules in a s imilar manner. Preliminary results from a number of laboratories suggest that Class II molecules may be recognized in a different manner than antibody. Two murine c e l l l ines JE50 and JE67 express mutant AJ£ chains which are indistinguishable by a n t i - A Q monoclonal antibodies, but are distinguishable using T - c e l l hybridomas specif ic for hen egg ovalbumin and restr ic ted by H-2 A^ (Allen et al . ,1985). Allogeneic T-ce l l s have been found which c lear ly respond to a l domain determinants local ized to re s i dues 53-59 and 69-76 of H-2 A£ cha ins whereas monoclonal antibodies were a l l directed against residues 69-76 (Landais et al . ,1986). These data are consistent with reports that A Q Ap chain association and the result ing t er t iary structure are responsible for the res tr i c t ion properties of Class II molecule T - c e l l receptor interaction (Cohn et al. ,1986; Lechler et al . ,1986). The molecular role of polymorphism in the interaction of Class II molecules, antigen, and T - c e l l receptors is unclear. Helper T-lymphocytes recognize antigen displayed on the surface of antigen 31 presenting ce l l s through a single T - c e l l receptor molecule (Hood et al . ,1985). In addition the T - c e l l receptor must also recognize self Class II molecules before the T - c e l l can respond to the antigen. The molecular mechanism of co-recognition of antigen and Class II molecule through a single T - c e l l receptor molecule is a highly controversial subject (reviewed, Schwartz,1985). One model suggests that Class II molecules interact physical ly with antigen either before or during binding of the T - c e l l receptor. The T - c e l l receptor could recognize the Class II-antigen complex, or some "altered self" epitope result ing from a conformational change in the Class II protein mediated by antigen binding. Al ternat ive ly , the T - c e l l receptor may bind antigen and Class II protein molecules independently accounting for the observed dual spec i f i c i ty without requiring Class II-antigen interact ion. Watts, Gaub, and McConnell (1986) created a r t i f i c i a l planar membranes containing Class II proteins, which were capable of stimulating antigen specif ic Class II res tr ic ted T-lymphocytes to prol i ferate in the presence of antigen. Fluorescent dyes were coupled to both the Class II molecules and to the antigen. Using the property that excited fluorochromes can transfer energy to other fluorescent dye molecules in close proximity (less than AO °A) these authors demonstrated that during T - c e l l recognition of antigen, Class II molecules, T - c e l l receptor molecules, and antigen are closely associated in a complex. S imi lar ly , Ashwell and Schwartz (1986) examined the dose response of a single specif ic T - c e l l clone to antigen presented in the context of two different Class II molecules. Although the T - c e l l can recognize the antigen in the context of both Class II molecules ( E p k E a k or Ep^E a k ) the response was s igni f icant ly reduced using the E p k E a k Class 32 II molecule. These authors attribute the difference in dose response to a difference in the a f f i n i t y of the antigen to the two MHC molecules, suggesting a physical interaction between antigen and Class II molecule. The molecular role of the polymorphic regions of Class II molecules has not been resolved. Analysis of a number of T - c e l l receptor 0 chain sequences has ident i f ied as many as seven s igni f i cant ly hypervariable regions (Patten et al . ,1984) . Three hypervariable segments are located at positions s imilar to those found in immunoglobulin molecules, and are believed to interact with the hypervariable segments in T - c e l l receptor a chains to form an antigen binding s i te (Davis, 1985; Patten et al . ,1984). Four hypervariable regions appear to be -located on the outside of the T - c e l l receptor molecule and may be involved in interactions with polymorphic determinants on Class II molecules (Davis, 1985). The available data do not exclude the "altered self" hypothesis where the T - c e l l receptor recognizes a novel epitope which results from an antigen induced conformational change in the Class II molecule (Schwartz, 1985; Ashwell and Schwartz, 1986). d) T - c e l l Dif ferent iat ion The development of a se l f MHC restr ic ted antigen specif ic repertoire of T - c e l l receptor molecules which is not spontaneously autoreactive has been an unresolved issue in immunology for some time (Kronenberg et al . ,1986). Studies using chimeric mice in which the reconstituting ce l l s are of a different MHC haplotype have supported the model that developing T-ce l l s are "educated" in the thymus. According to this model only those T-ce l l s with receptors capable of interacting with se l f MHC and antigen are allowed to emigrate from the thymus and populate the peripheral lymphoid organs. T-ce l l s which recognize antigen 33 alone or non-self MHC molecules do not leave the thymus and are believed to die in the thymus (Zinkernagel et al. ,1978; Schwartz, 1984). An alternative hypothesis suggests that only se l f restr icted T-ce l l s are activated in peripheral c i rcu la t ion . Recent evidence has shown that the thymus is the f i r s t s i te where the T - c e l l receptor is expressed, and therefore "education" or induction of tolerance is unl ikely to occur before the entry of the T-ce l l s into the thymus. Furthermore, the large number of non-productive rearrangements observed in T - c e l l receptor genes may account for some of the c e l l death believed to occur in the thymus (Kronenberg at al. ,1986; Cohn and Epstein,1978). These data favour the thymic education theory, however they are by no means conclusive. Nonetheless MHC antigens are key in the development of T-c e l l antigen receptor repertoire, e) Non-Response Attempts to explain the phenomenon of immunological non-responsiveness have led to much controversy amongst immunologists. Non-response to antigen has been examined by a number of investigators and five models have been proposed. 1) Non-response is due to the absence of functional MHC molecules. Jones et a l . (1981) showed that mice of MHC haplotypes b ,s ,or f, which have deletions in the promoter of the E Q gene, are incapable of expressing E Class II molecules on their c e l l surface. As a result these animals are non responders to any antigen which associates with E Class II molecules. 2) the repertoire of variable regions of the T - c e l l receptor genes is incomplete, result ing in no appropriate receptor for some antigens. 3) Schwartz (1978) in describing a theory for development of se l f tolerance suggested that some T - c e l l clones are selected against, ef fect ively deleting them from 34 the repertoire. Deletion of T-ce l l s which cross react with se l f determinants would make these animals non-responders to antigens requiring the deleted T - c e l l to mount a response. 4) Rosenthal (1978) proposed a "determinant selection" hypothesis in which antigen, MHC molecule, and T - c e l l receptor a l l interact . If some of these interactions were of low a f f i n i t y they may not be strong enough to e l i c i t an immune response, result ing in the non-responder phenotype. 5) Non-response is due to regulatory ce l l s such as T-suppressor ce l l s which block the immune response, f) Evolutionary Function The role of Class II proteins in the presentation of antigen to the immune system has led many investigators to propose that polymorphism across a species ensures that at least one individual w i l l have a Class II a l l e l e appropriate for mounting an immune response against any new pathogen (reviewed Klein and Figueroa,1981). It would therefore be an advantage for an individual to express as many different MHC molecules as possible, as this would provide the maximum protection against infectious diseases. In agreement with this idea is the finding that Class II l o c i (RT1.B and RT1.D) are expressed co-dominantly (Klein and Figueroa,1981), providing two different sets of Class II molecules for potential antigen interact ion. Heterozygous individuals should also be at a selective advantage, due to hybrid Class II molecules formed by the independent assortment of a l l e l i c a and B chain molecules. Consistent with this is the finding that 85% of a l l wild mice in a random bred population, and 90% of humans are heterozygous at their Class II l o c i (Klein and Figueroa,1981). Heterozygote advantage has also been demonstrated by Palm (1969,1970) in crosses between homozygous inbred 35 rats which are non-responders to a given antigen. He found that the heterozygous offspring could respond to the antigen, and therefore had a selective advantage over their parents. 3. MHC Functions Not Assigned to the Class I or Class II Molecules Meruelo and Edidan (1980) have postulated that MHC encoded molecules function as general receptors binding antigen, ligands, or other receptors. The polymorphism of MHC molecules as well as the m u l t i p l i c i t y of l o c i would enable the MHC to be involved in the modulation of a wide variety of processes. The MHC has been associated with functions as diverse as variat ion in the response of a tissue to androgen in animals of different MHC haplotype, to the expression of different MHC l o c i at different stages of development. It has been noted that individuals carrying certain a l l e l es at some MHC l o c i have a higher incidence of specif ic diseases. The association of MHC a l l e l es and disease may be due to a direct physical relationship in which the MHC locus contributes to the disease phenotype, or the MHC marker may simply show linkage disequil ibrium with an undefined disease locus. The most s tr ik ing disease associations are found in humans where individuals carrying the HLA-B27 a l l e l e have an 85 times higher chance of developing the autoimmune disease Ankylosing Spondylitis (Bodmer and Bodmer,1978). A s imilar relationship is seen in rats where Insulin Dependent Diabetes Mell i tus is strongly associated with the RT1U haplotype of BB s tra in rats (Colle et al,1981; Jackson et al,198A). To date very l i t t l e is known about the mechanism of association between an MHC a l l e l e and a disease. 36 F. Objectives and Rationale for Studying the RTl Class II Genes Recent advances in molecular genetics have greatly increased our knowledge of the structure of individual MHC genes and their products. Many of the human and murine Class II genes have now been well characterized, however the structure of the rat RTl Class II genes remains largely unknown. The study of the rat RTl Class II genes is important in that i t allows the structure of the rat genes to be compared to the equivalent genes in mouse and human. Comparisons of closely related species such as rat and mouse which diverged about 8 mi l l ion years ago, and more distant ly related species such as rodent and human which diverged about 80 mi l l ion years ago w i l l lead to a better understanding of the relationship between the structure of the rat Class II genes and their evolution, polymorphism, and expression. This thesis describes the i so lat ion and characterization of a rat RTl B a Class II gene. The structure of this gene w i l l be compared to the equivalent human HLA-DQQ gene (Okada et al.,1985) and to the mouse H-2 A a cDNA sequence (Mathis et al . ,1983). This approach w i l l identify genetic regions which have been conserved throughout evolution and are therefore l i k e l y to be of functional importance. Furthermore, the evolutionary relationships between the three gene sequences w i l l be ident i f ied and discussed. The RTl B Q gene is the f i r s t rodent "A" Class II gene for which the complete sequence and gene structure has been described. The MHC shows the highest degree of polymorphism of any known mammalian genetic system. This polymorphism has been selected for during evolution and is related to the function of MHC molecules. Comparison of the gene encoding the RTl B„ molecule to the equivalent gene sequences 37 from mouse and human, as w e l l as an a l l e l i c r a t RT1 B Q cDNA (Wal l i s and McMaster,1984) may r e v e a l mechanisms f o r the generation and maintenance of polymorphism. F i n a l l y , s t r u c t u r a l comparisons between the RT1 B Q and other Class I I genes may i d e n t i f y conserved s t r u c t u r a l sequence elements important i n the r e g u l a t i o n of the t r a n s c r i p t i o n of these genes, and therefore t h e i r expression. 38 Chapter 2  MATERIALS AND METHODS A. Materials 1. Enzymes Restr ict ion endonucleases were from Pharmacia Molecular Biology Div i s ion , Montreal, Quebec; New England Biolabs, Beverly, Maryland,USA; or Bethesda Research Laboratories (BRL), Bethesda, Maryland, USA. TA DNA Ligase, DNA Polymerase I , DNA Polymerase (Klenow Fragment), and Mung Bean Nuclease were from Pharmacia, New England Biolabs, or BRL. Deoxyribonuclease I (DNase I) was from Pharmacia or Boehringer Mannheim GmbH, and Ribonuclease A was from Sigma Chemical Co . , St. Louis, Missouri , USA. Proteinase K was from Bethesda Research Labs. 2. Electrophoresis Chemicals Agarose was supplied by BRL and Sigma Chemical Co . , Acrylamide by Bio-Rad Laboratories, Richmond, C a l i f o r n i a , USA, and B r i t i s h Drug House (BDH), Toronto, Ontario. Ammonium Persulphate, N,N'-Methylenebis-acrylamide, and N ,N ,N' ,N ' -Tetramethyl-ethylenediamine (TEMED) were supplied by Bio-Rad Laboratories, BDH, and Sigma Chemicals. A l l other chemicals were supplied by Sigma Chemicals. 3. Bacter ia l Culture Media A l l Bacto products (Tryptone, Yeast Extract, and Agar) were from Difco Laboratories, Detroit , Michigan, USA. Pre-mixed Luria-Bertani (LB) broth mix was supplied by Gibco Laboratories, Maddison, Wisconsin, USA. Antibiot ics were from Sigma Chemicals. 39 4. Tissue Culture Products Dulbecco's Modified Eagle Medium (DMEM) and Tissue culture dishes were from Gibco Laboratories, while ant ibiot ics were from Sigma Chemicals. 5. General Chemicals and Supplies General laboratory chemicals and reagents were purchased from Sigma Chemicals, B r i t i s h Drug Houses, Toronto, Ontario, and J . T . Baker Co. , Phi l l ipsburg , New Jersey, USA. Laboratory supplies were from Canlab, and Western S c i e n t i f i c , both of Vancouver, B r i t i s h Columbia. B.Bacteria l Strains , Vectors, and Media 1. Vectors The rat l i v e r genomic l ibrary was supplied in the lambda vector Charon 4A (Jagodzinski, unpublished). Charon 4A ^ ^ 3 2 , B a m ^ , lac 5, bio 256, KH 54, BW 2, nin 5, and QSR 80) (Blattner et. al. ,1977) phage part ic les contained rat DNA fragments 15,000 to 20,000 nucleotides in length generated by p a r t i a l digestion with the re s t r i c t i on endonuclease Hae III and cloned into the Eco Rl s i t e . The plasmid pUC9 (Vie ira and Messing, 1982) was used for the subcloning and maintenance of DNA fragments isolated from the Charon 4A l i b r a r y . Small DNA fragments for sequencing were sub-cloned into the M13 phage vectors mp9 (Messing and V i e i r a , 1982), mpl8, and mpl9 (Yanisch-Perron et al . ,1985). 2. Bacteria l Strains The host c e l l used for growth of the Charon 4A phage was Escherichia c o l i s tra in LE392 [F~, hsd R514(rj c~.m^ -), supE44, supF58, (lac IZY)6, gal K2, gal T22, met B l , trp R55%, and lambda"] (Leder et a l . , 1977; Murray et a l . , 1977). 40 Plasmid pUC9 was maintained in E. c o l i K-12 s tra in JM83 ce l l s (ara, lac-pro, strA, t h i , cp80dlacZM15) (Messing, 1979). The M13 phage were grown in E . c o l i K-12 s tra in JM101 ce l l s [supE, t h i , ( lac-proAB),(F-traD36, proAB, lacIqZ,M15)] (Messing et a l . , 1981). 3. Media Luria-Bertani (LB) media: lOg Bacto-tryptone, 5g Bacto Yeast Extract, and lOg NaCl per l i t e r of dh^O. (for plates add 1.5% Bacto-agar) 2xYT media: 16g Bacto-tryptone, lOg Bacto Yeast Extract, and 5g NaCl per l i t e r of dH 2 0.( for plates add 1.5% Bacto-agar) M9 Salt media: 6g Na 2 HP0 4 , 3g KH 2 PO A , 0.5g NaCl, and lg NH4C1 per l i t e r of dH 20. S t e r i l i z e , and when cool add : 2.0ml 1M MgS04, 10ml 20% glucose, and 0.1ml 1M CaCl2 per l i t e r . Top (T) agar: lOg Bacto-tryptone, 5g NaCl, and7.5g Bacto-agar per l i t e r . C.Basic Techniques of Molecular Biology 1. Restrict ion Endonuclease Digestion of DNA Each res tr i c t ion enzyme has i t s own optimal reaction conditions, which are supplied by the manufacturer. Typical ly 2 to 10pg of DNA was suspended in 20pl of a solution of lOmM Tr i s -HCl pH 7.5, ImM DTT, and 0 to lOOmM NaCl depending on the enzyme. Two to ten units of the appropriate endonuclease were then added and digestion allowed to proceed for 1 to 2 hours at the recommended temperature. 2. Agarose Gel Electrophoresis a) Qualitative Agarose Gel Electrophoresis Agarose gel electrophoresis of DNA samples was carried out using 0.7% to 1.0% agarose, containing lpg/ml EtBr, and Tr i s Borate buffer 41 (TBE) (90mM T r i s - H C l , pH 8.3, 90mM Boric ac id , and 25mM EDTA) or Tris Acetate buffer (TAE) (40mM T r i s - H C l , pH 8.0, 20mM NaOAc, and 2mM EDTA) (Maniatis et al . ,1982). Glycerol-dye solution (20% glycerol , 0.1% brom-phenol blue) was added to samples in a 1 to 1 (dye:DNA sample) rat io prior to loading the gel . DNA fragments were subjected to electrophoresis at 12 to 20 Volts/cm for 15 to 30 minutes. DNA bands were visual ized under short wave u l t rav io le t (UV) l ight (254nm). b) Preparative Agarose Gel Electrophoresis In order to recover specif ic DNA fragments from agarose gels DNA was electrophoresed and bands visual ized as described above. The desired DNA band(s) were located and the segment of the gel~ containing the fragment excised from the gel with a razor blade. The DNA was then isolated from the gel s l i c e by one of two methods, i ) Electroelut ion in Dialys is Bags The gel s l i c e was placed in a d ia lys i s bag containing buffer at one half the concentration of the running buffer, the bag was then sealed and placed p a r t i a l l y submerged in a gel box such that the gel fragment is perpendicular to the current. Current was passed through the bag (100V for 30 to 60 minutes) u n t i l a l l the DNA has migrated out of the gel s l i c e and onto the wall of the d ia lys i s bag. The polar i ty of the current was reversed for 90 seconds to release the DNA from the wall of the d ia lys i s bag. The DNA solution was then removed from the bag and the DNA recovered by precipi tat ion with ethanol (McDonell et al . ,1977). i i ) Low Melting Point (LMP) Agarose Gels A number of grades of agarose are available which melt at 65°C, which is well below the melting point of DNA, and remain molten at 37°C. Gel s l ices cut from LMP agarose gels were melted at 65°C and diluted in 42 65°C TE buffer containing 0.2M NaCl. The solution was loaded on a Bethesda Research Laboratories (BRL) NACS PREPAC™ column equil ibrated in the same buffer. The DNA fragments were se lect ively bound to the resin in the column while the agarose was not. The column was washed with 5ml TE buffer containing 0.2M NaCl to remove a l l of the agarose. The DNA fragments were then se lect ive ly eluted using a small volume (600ul) of TE buffer containing 1.0M NaCl. The eluted DNA was recovered by ethanol prec ip i ta t ion . Alternat ive ly LMP agarose gel s l ices were melted at 65°C, di luted with TE buffer, and the agarose removed by repeated extraction with phenol. Again the DNA was recovered from solution by ethanol prec ipi tat ion (Weislander,1979). 3. Polyacrylamide Gel Electrophoresis Polyacrylamide gels (Maniatis et al.,1982) containing 6% to 8% acrylamide, and 7.5M Urea were routinely used for DNA sequencing. Glass plates (36x20cm) were scrubbed well with detergent and treated with 2% dimethyl-dichlorosilane to s i l i con ize the plates. The glass plates were then taped together using 0.35mm plas t ic spacers. Forty m i l l i l i t e r s of gel solution (8%) was prepared as follows: 25g Urea, 10ml 40% acrylamide solution [91.2g acrylamide, 4.8g BIS (N,N*-methylenebisacrylamide), and d i s t i l l e d water to 240ml; deionized with Amber l i t e^ MB-3 res in] , 2.5ml lOx TBE (0.9M T r i s - H C l pH 8.3, 0.9M Boric ac id , and 0.25M EDTA), and 20ml dH20. The gel solution was warmed to dissolve the urea and de-aerated under vacuum. The gel was polymerized by the addition of 330^ x1 10% Ammonium Persulphate, and 20ul TEMED (N,N,N' ,N' -tetramethylethylenediamine), quickly poured between the glass plates, 43 and allowed to set. Sequencing gels were electrophoresed in lx TBE buffer at 35 watts per gel . D. Isolation and Puri f icat ion of Nucleic Acids 1) Large Scale Preparation of Plasmid DNA The procedure used was that of Bimboim and Doly (1979) as modified by Maniatis (1982). A culture of the bacter ia l s tra in containing the plasmid was prepared by inoculating 40ml of Luria-Bertani (LB) media containing ant ib io t ic (50ug/ml for ampic i l l in ; lOug/ml for tetracycline) with a single bacter ia l colony, and incubating the culture overnight at 37°C, with shaking. Four l i t e r s (L) of M9 media containing ant ibiot ics were inoculated with 10ml of the overnight culture prepared above. The 4L of culture was shaken vigorously at 37°C u n t i l the opt ica l density of the culture reached an O.D.ggg of 0.7. Chloramphenicol was added to a f i n a l concentration of 250pg/ml and incubation continued at 37°C overnight. The bacter ia l ce l l s were collected by centrifugation at 4000 x g for 10 minutes at 4°C, and resuspended in 80ml of a Solution 1 [25% sucrose; 50mM Tris(hydroxymethyl)aminomethane-HCl(Tris-HCl), pH 8.0; ImM Disodiumethylenediaminetetracetic acid (EDTA); and lysozyme 4mg/ml (added fresh)] . The suspension was incubated at 22°C for 5 minutes, followed by addition of 80ml of ice cold Solution 2 [0.2N NaOH; 1.0% Sodium Dodecylsulphate (SDS)], gentle mixing and incubation on ice for 10 minutes. The c e l l lysate was cleared by addition of 120ml of cold Solution 3 (60ml 5M Potassium Acetate; 11.5ml g l a c i a l acetic acid; and 28.5ml dh^O), incubation on ice for 10 minutes, and centrifugation at 16,000 x g for 30 minutes at 4°C. 44 The supernatant was transferred to clean tubes and the DNA precipitated by the addition of 0.6 volumes of cold isopropanol. After 1 to 2 hours of incubation on ice the precipitated DNA was collected by centrifugation for 30 minutes at 4°C, and 16,000 x g. The supernatant was discarded and the pel lets dried under vacuum for 5 minutes. The pel le ts were resuspended in TE buffer (lOmM T r i s - H C l , pH 8.0; ImM EDTA) The DNA solution was extracted three times with an equal volume of phenol/chloroform ( l : l , v : v ) to remove proteins. The DNA was then precipitated from solution by the addition of 3M NaOAC (l /10th volume) and 95% Ethanol (2 volumes) and stored at -20°C for 2 to 18 hours. The precipitated DNA was col lected by centrifugation at 27,000 x g for 20 minutes at 4°C. DNA pel lets were dried and resuspended in TE buffer. Further pur i f i cat ion involved the use of Cesium Chloride (CsCl) equilibrium gradients to separate bacter ia l chromosomal DNA from plasmid DNA. Essent ia l ly (for 4L of i n i t i a l culture) 80g of CsCl was dissolved in 70ml of TE buffer containing the DNA. Two ml of Ethidium Bromide (EtBr) (lOmg/ml) was added and the f i n a l CsCl concentration adjusted to 35% brix using an Atago refractometer. The gradients were divide into 8 Beckman "quick seal" tubes (12ml) and sealed. Ultracentrifugation was at 60,000rpm for 20 hours at 15°C in a Beckman T i 70.1 rotor (331,000 x g). The DNA bands were visual ized under UV l ight (254nm) to locate the plasmid DNA band. The gradient was fractionated by puncturing the tube with an 18 gauge needle and aspirating the band with a syringe. The CsCl-DNA solution was di luted with TE buffer, butanol extracted to remove the EtBr and the DNA precipitated with ethanol as described above. 45 2. Large Scale Isolation of Phage (Charon 4A) DNA The procedure used was a scaled up version of the plate lysate protocol described by Maniatis et al . , (1982). Br ie f ly (for 20 plates) 6ml of an overnight culture of Escherichia c o l i (E. co l i ) s train LE392 (Leder et al. ,1977) was infected with 2x10^ plaque forming units (pfu) of bacteriophage by incubation together at 37°C for 20 minutes. Following infection 80 to 100ml of Top (T) agar . supplemented with thymidine (50ug/ml) and magnesium (lOmM) was added and the mixture plated onto 20 LB agar plates (also supplemented with magnesium and thymidine). The plates were incubated at 37°C overnight to allow growth. After overnight growth the plaques on each plate should have reached confluence. Each plate was then overlaid with 5ml of SM buffer (lOOmM NaCl, lOmM T r i s - H C l pH 7.5, and lOmM MgS04) and allowed to stand at 4°C for 2 hours. The buffer containing the phage part ic les was collected and centrifuged at 27,000 x g for 10 minutes to remove debris. The phage part ic les were precipitated by the addition of 0.15 volumes 5M NaCl and 0.3 volumes of a 50% solution of Polyethylene Glycol (PEG 6000) and incubation on ice for 120 minutes. The phage part ic les were collected by centrifugation at 27,000 x g for 5 minutes at 4°C. The phage pel let was resuspended in 10ml Deoxyribonuclease Activation buffer (lOmM Tr i s -HCl pH 7.5, 5mM MgCl 2 , and 100ug/ml Bovine Serum Albumin). In order to remove bacter ia l nucleic acids lOOug of Deoxyribonuclease I (DNase I) and l.Omg Ribonuclease a (RNase) were added and digestion allowed to proceed at 37°C for 30 minutes. Debris was removed by centrifugation at 1500 x g for 10 minutes. The supernatant was transferred to clean tubes and SDS and EDTA were added to concentrations of 0.05% and 25mM respectively. Proteinase 46 K (lmg) was added and allowed to digest the phage coat for 60 minutes at 68°C. Digested protein was removed by repeated phenol and chloroform extractions as described above. The phage DNA was ethanol precipitated and used d irec t ly or was further puri f ied by CsCl equilibrium gradient centrifugation as described above. 3. Isolation of High Molecular Weight Eukaryotic DNA Eukaryotic ce l l s (10^ - 10 7) may be collected from tissue culture or from whole t issue. Cel ls were washed twice with cold Phosphate Buffered Saline (PBS) and collected by centrifugation at 500 x g for 10 minutes at 4°C. The PBS was careful ly removed at the ce l l s resuspended in a solution of 150mM NaCl, 50mM EDTA, and 50mM T r i s - H C l , pH 8.0. Sarcosine was added to a f i n a l concentration of 2.5mg/ml. Proteinase K (20ug) was added to the solution and digestion allowed to proceed at 50°C for 3 to 8 hours. Following digestion protein was removed by repeated phenol and chloroform extractions. DNA was precipitated using ethanol, and col lected by centrifugation. The f i n a l pe l le t was resuspended in 200ul TE buffer, and typ ica l yields were 700ug. E. Isolation of High Molecular Weight RNA from Eukaryotic Cel ls Cel ls harvested from tissue culture or homogenized tissue (5xl0 7 ce l l s ) were washed twice in 10 ml of a solution of 150mM NaCl and 0.1% Diethylpyrocarbonate (DEP). Cel ls were collected by centrifugation at 500 x g for 10 minutes at 0°C. The ce l l s were lysed by resuspension of the pel le t in 3ml of 7.5M Guanidine Hydrochloride (GuHCl), 0.5% sarcosine, and lOmM Di th io thre i to l (DTT). The viscos i ty of the solution was reduced by t r i tura t ion of the solution through an 18 gauge needle. The lysate was careful ly layered on a 3ml cushion of 5.7M CsCl and 25mM sodium c i trate in a 5ml Beckman Cellulose Nitrate centrifuge tube. 47 The gradient was ultracentrifuged for 21 hours at 20°C and 36,000rpm in a Beckman SW50.1 rotor. The supernatant was careful ly removed leaving the transparent, gelatinous RNA pel le t in the tube. The pel let was resuspended in 200ul of TE buffer containing 0.1% SDS and extracted twice with phenol/chloroform ( l : l , v : v ) . The RNA was ethanol precipitated as described above for DNA (Gl i s in et a l . . , 1974: U l l r i c h et al . ,1977). F. Labell ing of Probe DNA by Nick Translation DNA fragments to be used as probes in hybridization reactions were radioactively label led by nick translat ion (Rigby et al . ,1977). A typ ica l nick translat ion reaction contained 200 to 500ng of probe DNA, 5ul lOx nick translat ion buffer (500uM T r i s - H C l , pH 7.5, 50mM MgCl 2 ) , l . O u l 50mM DTT, 2ul Bovine Serum Albumin (BSA)(2mg/ml), 2ul each of dGTP and dTTP (500uM), 1.5ul each of dATP and dCTP (35uM), l u l CaCl2(10mM), 2.5ul DNase I (200pg/ul; freshly d i luted) , 17.5ul dH 20, 2.5ul each of [ a 3 2 P]dATP and [a 3 2P]dCTP ( lOuCi /u l ) , and 2 units DNA Polymerase I. The reactions were incubated at 16°C for 60 minutes. Reactions were stopped by heating to 68°C for 10 minutes. Unincorporated nucleotides were removed by gel f i l t r a t i o n chromatography using Sephadex G-50 gel matrix (Pharmacia) in a 25 x 1cm column. Elution was with TE buffer, and 400ul fractions were col lected. The labelled probe DNA eluted in the void volume (fractions 7-9) and was concentrated by ethanol prec ip i tat ion . Typical nick translat ion reactions yielded 3.0xl0 7 counts per minute (cpm) at 5x10^ cpm/ug of DNA. Probe DNA was denatured by incubation at 100°C for 10 minutes followed by quick cooling in an ice water bath immediately prior to use in hybridization reactions. 48 G. Screening the Rat Genomic Library A H a e l l l rat l i v e r l ibrary was provided by Drs. L . Jagodzinski and J . Bonner (unpublished). The l ibrary was constructed by the p a r t i a l digestion of Sprague-Dawley (RTl*3) rat l i ver DNA to give fragments 15,000 to 20,000 nucleotides in length. These fragments were cloned into the EcoRl s i te of the lambda vector Charon 4A using EcoRl l inkers . The l ibrary was screened essential ly as described by Woo (1979) using the radioact ively labelled cDNA insert from the plasmid pRIa.2 (Wallis and McMaster,1984) as the probe. 1. Plating the Library The l ibrary stock ( t i tered at 2.0x10^ pfu/ml) was diluted with SM buffer to give a plating density of 2.0x10^ plaques per plate. To this was added 300ul per plate of a fresh overnight culture of E. c o l i LE392, and the suspension incubated at 37°C for 10 minutes to allow infect ion. Following infection 4ml per plate of Top agar (lOg Bacto-tryptone, 5g NaCl, MgS04 to lOmM, Thymidine to 0.05mg/ml, 7.5g Bacto-agar, and IL dH^O) was added and the mixture plated on LB agar plates supplemented with MgS04 (lOmM) and Thymidine (0.05mg/ml). Once the Top agar had set the plates were inverted and incubated at 37°C overnight. In order to locate a single copy gene in a rat DNA l ibrary (genome complexity 3.0x10^ nucleotides) 3.0x10^ recombinant phage each containing 2.0x10^ nucleotides of rat DNA must be screened. Therefore to screen the rat l ibrary for the RTlB a gene 2.0x10^ plaques were examined ( ie . 100 plates at 2.0x10^ plaques per plate) . 2. Amplification Nitrocel lulose f i l t e r s ( s t er i l e M i l l i p o r e ^ HA) were soaked in an overnight culture of E. c o l i LE392 ce l l s and allowed to a i r dry for 60 49 minutes. The f i l t e r s were then placed careful ly on the agar surface of the 100 plates containing the phage plaques. The plates were allowed to stand 10 minutes. After marking the plates and the f i l t e r s to allow orientation at a later time, the f i l t e r s were careful ly peeled off the plates and placed on fresh LB agar plates supplemented with MgSO^ and Thymidine. The plates were then incubated at 37°C overnight. 3. Plaque Hybridization The n i troce l lu lose f i l t e r s were l i f t e d off the agar plates and placed on Whatman 3MM f i l t e r s soaked in a solution of 0.5N NaOH, and 1.5M NaCl for 15 minutes. This procedure denatures the phage part ic les and fixes the DNA to the n i troce l lu lose f i l t e r . The f i l t e r s were neutralized by transferring the f i l t e r s to Whatman 3MM paper soaked in 0.5M T r i s - H C l , pH 7.4, and 1.5M NaCl for 15 minutes. The f i l t e r s were then a i r dried, baked at 68°C for 2 hours to f ix the DNA, and pre-hybridized at 68°C overnight in 6xSSC (lxSSC 0.15M NaCl, 0.015M Sodium Citrate) and lx Denhardt's (0.04% polyvinylpyrrolidone, 0.04% f i c o l l , and 0.04% BSA). The f i l t e r s were hybridized in a solution of 6xSSC, 0.5% SDS, and lx Denhardt's containing denatured 3 2 P labelled DNA probe. Hybridization was carried out at 68°C overnight with at least 1x10° cpm per f i l t e r , the f i l t e r s were washed three times for 60 minutes each in lxSSC, 0.5% SDS at 60°C. After a i r drying the f i l t e r s were autoradiographed at -20°C using Kodak XAR-2 x-ray f i lm and intensifying screens. The or ig ina l plaque containing plates, f i l t e r s , and films were aligned and plaques with posit ive hybridization signals ident i f ied . Positive plaques were excised from the plate using the t ip of a s t e r i l e pasteur pipet, and suspended in 2ml of SM buffer. Following addition of 50 a single drop of chloroform these phage stocks - were stable at 4°C indef in i te ly . 4. Second and Third Screens In order to insure that plaques hybridizing with the probe were indeed posit ive a second and th ird screen were performed. Essent ial ly phage stocks from plaques selected in the f i r s t screen were t i tered to determine the number of phage present. Each stock was then plated at a density of 500 plaques per plate as described above. A dry s t e r i l e n i troce l lu lose f i l t e r was placed on each plate for 10 minutes and then denatured d i rec t l y , omitting the amplification step. Plaque hybridization was carried out exactly as described.- Plaques identi f ied as posit ive in the second screen were isolated, plated, and screened a th ird time. Three independent recombinant phage clones posit ive for the RTl B Q gene after 3 screens were chosen for further -analysis . They were designated Lambda 7, 8, and 16. DNA stocks from each of these phage were prepared as described in Section A. H. Analysis of Recombinant Clones I. Restrict ion Mapping Ten microgram (ng) amounts of DNA were digested in 20LI1 volumes with a number of different re s t r i c t ion enzymes. Enzymes were used singly or in pairs . Digested DNA samples were electrophoresed on qual i tat ive agarose gels with DNA standards of known molecular s ize . The DNA fragments were v isual ized under UV l ight (254nm) and photographed to create a permanent record. From the sizes of the DNA fragments the re lat ive locations of . the re s t r i c t i on enzyme cleavage sites were deduced. 51 2. Southern Blot Analysis DNA fragments which had been separated electrophoretical ly in agarose were denatured by soaking the gel in 0.5M NaOH, 1.5M NaCl for 30 minutes. Following neutral izat ion of the gel by soaking for 30 minutes in a solution of 0.5M T r i s - H C l , pH 7.6, 1.5M NaCl the DNA was transferred unid irect ional ly to GeneScreen™ Transfer membrane (New England Nuclear) according to the method of Southern (1975). The DNA was then immobilized on the membrane by baking at 80-100°C for 2-4 hours. Prehybridization conditions were routinely 2.5x Denhardt's (0.1% polyvinyl-pyrrol idone, 0.1% f i c o l l , and 0.1% BSA), and sheared Herring Testis DNA (100pg/ml) as carr i er . Membranes were sealed in p las t ic bags and incubated at 60°C for 4 to 20 hours. Hybridizations were routinely carried out in the following solution: 0.3M NaCl, 0.06M Tris-HCl(pH 8.0), 0.002M EDTA, 0.5x Denhardt's (0.02% polyvinyl-pyrrol idone, 0.02% F i c o l l , and 0.02% BSA), 1.0% SDS, and carr ier DNA (>100ug/ml). Denatured probe DNA (5.0xl0^cpm at > 5.OxlO^cpm/pg) was added and the entire mixture sealed in a p las t i c bag with the membrane. Hybridizations were carried out at 60°C for 12-24 hours. Membranes were washed twice in 100ml of 0.3M NaCl, 0.06M T r i s -HCl (pH 8.0), and 0.002M EDTA at room temperature for 5 minutes. The stringency was then increased and the membranes washed for 30 minutes at 60°C in 100ml the above solution with SDS added to 1.0%. This wash was repeated a second time, the membrane a i r dried, and exposed to Kodak XRP-1 f i lm at -20°C with intensifying screens. Comparison of the films and the or ig ina l photograph of the gel allowed ident i f icat ion of DNA bands containing sequences homologous to the probe DNA. 52 I. Sub-cloning of DNA Fragments Into the pUC Plasmids 1. Isolation of specif ic DNA fragments Lambda 7 was shown to contain the RT1 B a gene on two EcoRl fragments 7,800 and 8,100 nucleotides in length by res tr i c t ion mapping and Southern analysis . Phage DNA (20ug) was digested with EcoRl and subjected to electrophoresis on a preparative agarose gel . The desired bands were excised from the gel , and the DNA fragments isolated as described in Section C. DNA fragments were resuspended in dH20 to a f i n a l concentration of 50-lOOng/ul. 2. Ligation The pUC family of plasmid vectors (Vie ira and Messing, 1982) have been used to maintain subcloned fragments of DNA. The plasmid vector pUC9 was digested with EcoRl to completion, phenol/chloroform extracted, and ethanol precipitated. Vector DNA was resuspended in dH20 at a concentration of 10 to 20 ng/ul . Ligation conditions were as follows: 10-20ng vector DNA (EcoRl cut pUC9), 20-100ng of the DNA fragment to be subcloned ( isolated above), 2ul lOx l igat ion buffer (0.5M T r i s - H C l , pH 7.8, and 0.1M MgCl 2 ) , 2ul lOmM ATP, 2ul 50mM DTT, 1-2 units T4 DNA l igase, and dH 20 to 20ul. The reaction was incubated at 16°C overnight. 3. Transformation of DNA into Bacteria Introduction of recombinant pUC plasmids into the bacter ia l host E. c o l i s tra in JM83 (Vie ira and Messing, 1982) allows propagation of the plasmid. a) Preparation of Competent Cel ls In order to be able to take up the recombinant plasmid DNA bacterial ce l l s must be made "competent" by treatment with C a C l 2 (Morrison, 1979; Maniatis et al. ,1982; Messing et al . ,1981). JM83 ce l l s 53 were grown in 50ml of 2xYT medium at 37°C with vigorous shaking u n t i l the O-D.QgQnjjj reached 0.6. The ce l l s were collected by centrifugation at 1500 x g for 10 minutes at 4°C. The c e l l pel let was gently resuspended using a Pasteur pipet in 16ml cold lOOmM CaCl2, and allowed to stand on ice for 30 minutes. The ce l l s were again collected by centrifugation at 1500 x g for 10 minutes at 4°C. The pel lets were gently resuspended in 5ml of a lOOmM CaCl2 solution, and transformed immediately, b) Transformation A small portion of the l igat ion reaction (3-5pl) was added to 45pl of TEN 7.5 buffer (lOmM Tris-HCL, pH 7.5, ImM EDTA, and lOOmM NaCl), and 200pl of freshly made competent JM83 c e l l s . The suspension was incubated on ice for 30-40 minutes, followed by heat shock at 42°C for 2 minutes. LB broth (1ml) was added and the mixture incubated at 37°C for 60 minutes. A small volume (lOOpl) was then used to inoculate LB agar plates containing ampic i l l in (50pg/ml), Isopropylthiogalactoside (IPTG) (160 Mg/ml), and 5-bromo-4-chloro-3-indoyl-p-D-galactoside (X-gal) (40pg/ml) u t i l i z i n g the spread plate technique. The plates were incubated at 37°C overnight. Colonies containing recombinant plasmid ( ident i f ied by their white colour) were picked and cultured in 5ml of LB broth containing 50pg/ml ampic i l l in at 37°C overnight. S ter i l e glycerol was then added to a f i n a l concentration of 15% and the culture frozen at - 7 0 ° C . Frozen stock cultures of pRTlB.4 and pRTlB.5 were stored at -70°C, and were thawed as required for i so lat ion of plasmid DNA. 54 J . DNA Sequence Analysis 1. Preparation of DNA for Shotgun Cloning into M13 Vectors One approach to sequencing a gene was to generate random DNA fragments 200 to 500 nucleotides in length, and sub-clone them into M13 vectors. Random fragments were generated by two methods: a) Digestion with Restr ict ion Enzymes Restrict ion enzymes which have four nucleotide recognition sites w i l l cut DNA on average once in every 256 nucleotides. Plasmid DNA (pRTlB.4 and pRTlB.5) were digested with the enzymes A l u l , Rsal , and Hae l l l which result in blunt ended fragments, or Sau3A which results in cohesive ends. Fragments were phenol/chloroform extracted and precipitated with ethanol pr ior to l i ga t ion , b) Sonication Random DNA fragments were also generated using the sonication procedure of Deininger (1983). Whole plasmid DNA (20ug) was resuspended in a solution of 0.5M NaCl, 0.1M T r i s - H C l (pH 7.4), and 0.01M EDTA. The DNA solution was cooled on ice and subjected to f ive 5 second bursts on a Biosonik H A Sonicator set at 60, with mixing between each burst. Sonicated DNA fragments were collected by ethanol prec ip i tat ion , and fractionated on a preparative LMP agarose gel . The region of the gel containing DNA 200 to 500 nucleotides in length was excised, and the DNA recovered using a NACS PREPAC™ column as described above. The ends of sonicated DNA fragments were repaired for blunt end l igat ion by treatment with the enzyme Mung Bean Nuclease (Kowalski et al . ,1976). The reaction was carried out as follows: 2ul lOx SI buffer (0.3M NaOAc pH 4.5, 0.5M NaCl, and 0.01M ZnS0 4 .7H 2 0), and lOunits Mung Bean Nuclease were added to lOug of DNA in 90ul of TE buffer, and 55 incubated at 37°C for 10 minutes. The reaction was stopped by extraction with phenol/chloroform, and the DNA recovered by precipi tat ion with ethanol. 2.Subcloning DNA into M13 Vectors a) Ligation Random DNA fragments with blunt ends were l igated into M13 mp9 or mpl8 (Messing and V i e i r a , 1982; Yanisch-Perron et a l . , 1985) Replicative Form (RF) cut with Smal. Fragments with cohesive ends were l igated into M13 mp9, mpl8, or mpl9 RF cut with an enzyme generating a compatible cohesive end. Ligations were carried out under the following general conditions: 2ul vector DNA (10-20ng/ul), 2pl lOx l igat ion buffer (0.5M T r i s - H C l pH 7.8, and 0.1M MgCl 2 ) , 2pl lOmM ATP, 2M1 50mM DTT, l-2units T4 DNA Ligase, 20-100ng of DNA to be cloned, and dH 20 to 20ul. Reactions were incubated at 16°C overnight. b) Transformation of MI3 RF into Bacteria The bacter ia l host for the Ml3 phage vectors was JM101 (Vie ira and Messing,1982). JM101 ce l l s were made competent prior to transformation as described for JM83 in Section G. The transformation reaction incubated 3ul of the l igat ion mix with 45pl TEN 7.5 buffer, and 200M1 fresh competent JM101 ce l l s together on ice for 30-40 minutes. The ce l l s were then heat shocked at 42°C for 2 minutes followed by the immediate addition of 3.0ml 2xYT media with 0.75% agar (autoclaved and cooled to 4 2 ° C ) , 20ul lOOmM IPTG, and 40pl 2% X-gal . The mixture was then poured onto LB agar plates and allowed to set. Plates were incubated at 37°C overnight. Recombinant plaques appeared as clear colourless plaques. 56 3. Isolation and Growth of Recombinant M13 Phage Clear plaques were isolated from agar plates using the t ip of a s t e r i l e Pasteur pipet. The piece of agar containing the plaque was physical ly excised from the plate and placed in 2ml s t e r i l e 2xYT medium. Plaques were stored for up to several weeks at 4°C in this form. Recombinant M13 phage were grown by adding 20pl of an overnight culture of JMlOl ce l l s to the agar plug in 2xYT medium, and incubating overnight at 37°C with aeration. 4. Preparation of Template DNA The overnight M13 phage cultures were transferred to s t e r i l e (1.5ml) microfuge tubes (Eppendorf) and centrifuged for 5 minutes (15,000 xg) to pe l le t the c e l l s . One ml of supernatant was transferred to a clean microfuge tube, and 250ul of a solution of 20% PEG, 2.5M NaCl added. The tubes were mixed and allowed to stand at room temperature for 30 minutes. The phage part ic les were collected by centrifugation at 15,000 x g in a microfuge. The PEG supernatant was removed with a pipet, and the pel le t resuspended in lOOpl TE buffer. The phage coats were removed by three phenol/chloroform extractions, and the DNA recovered by ethanol prec ip i tat ion . Phage DNA pel lets were routinely resuspended in 20ul dH 20. 5. Screening Recombinant M13 Phage DNA Recombinant phage containing DNA encoding the RTl B Q gene were ident i f ied by hybridization with the cDNAs pRIa.2 (Wallis and McMaster, 1984) and pACD3 (Benoist et al . ,1983). Template DNA (2pl) was spotted on ni trocel lu lose membranes (Mil l ipore HA) and allowed to a i r dry. The DNA was denatured by soaking the f i l t e r in a solution of 0.5N NaOH and 1.5M NaCl for 15 minutes, followed by neutralization in a solution of 0.5M 57 T r i s - H C l pH 7.6 and 1.5M NaCl for 15 minutes. Template DNA was immobilized on the membrane by baking the f i l t e r at 68°C for 4 hours. Membranes were prehybridized in 5ml of a solution of 5x Denhardt's (0.2% PVP, 0.2% F i c o l l , and 0.2% BSA), 5x SSC (0.75M NaCl, and 0.075M Sodium Ci tra te ) , 50% formamide (deionized), 50mM phosphate buffer pH 6.8, 0.1% SDS, and 250ug/ml sheared Herring test is DNA. Membranes were sealed in p las t ic bags and incubated at 42°C for 2 to 18 hours. The prehybridization buffer was replaced with hybridization buffer, the bag re-sealed, and incubated at 42°C overnight. Hybridization buffer contained lx Denhardt's (0.15% PVP, 0.15% F i c o l l , and 0.15% BSA), 5x SSC, 50% formamide, 20mM phosphate pH 6.8, 0.1% SDS, 100ug/ml carr ier DNA, and denatured radioactive probe (2x10^ cpm per f i l t e r ; 5xl0 7 cpm/ug). The membranes were washed three times in 2x SSCP (0.3M NaCl, 0.03M NaOCit, l.OmM EDTA, 0.02M phosphate, and 0.1% SDS) at 20°C for 15 minutes per wash. Four additional washes were carried out in 0.2x SSCP at 50°C and 15 minutes per wash. Membranes were a i r dried and autoradiographed using Kodak XRP-1 f i lm at -20°C with intensifying screens (Dupont Lightning Plus). Templates which hybridized to the probe were sequenced. 6.Di-deoxy DNA Sequencing M13 DNA templates were sequenced using the di-deoxynucleotide chain termination protocol of Sanger (Sanger et al . ,1977). a) Reactions In a microfuge tube (eppendorf) mix 2ul lOx Hinf buffer (lOOmM Tris -HCl pH 8.0, 70mM MgCl 2 ) , lul(0.2 pmoles) M13 primer (17 base universal sequencing primer), and 5ul template DNA (l .Oug). The tube was 58 heated to 75°C and allowed to slowly cool to room temperature over 45 minutes. Next l p l 15uM dATP, and 1.5pl [a 3 2P]dATP ( lOpCi/pl) were added, and the tubes mixed. The reaction mixes were dispensed into 4 microfuge tubes at 2pl to the A and T tubes and 2.5ul to the G and C tubes. To the tubes 1.5ul of the appropriate termination mix (see Appendix 1 for the preparation of termination mixes) was added. 0.6units of Klenow DNA Polymerase was added to each tube and incubated at room temperature for exactly 15 minutes. One microl i ter of 0.5mM ATP was added and incubation at room temperature continued for a further 15 minutes. The reactions were stopped by addition of 5pl dye mix (98% formamide, lOmM EDTA, 0.2% bromphenol blue, and 0.2% xylene cyanol) and heating to 100°C for 5 minutes, b) Gels Reactions were loaded d irec t ly on acrylamide gels prepared as described above, and electrophoresed for approximately 1.5 to 3 hours. Gels were dried and exposed to Kodak XRP-1 f i lm overnight at - 2 0 ° C . DNA sequence data was analyzed by the computer programs of Staden (1980), and Delaney (1982). K. Transfection of Mouse L Cel ls with RTl Class II Genes 1. Growth and Maintenance of L ce l l s in Tissue Culture The thymidine kinase-deficient mouse L - c e l l l ine Ltk~A~ (provided by C. Stammers) was maintained in monolayer cultures in Dulbecco's modified Eagle medium (DMEM) supplemented with heated 10% feta l cal f serum (FCS), 100 IU/ml P e n i c i l l i n G, lOOpg/ml Streptomycin Sulphate, and 50pg/ml Amphotericin B (Fungizone). Cel ls were grown in 100x20mm tissue culture dishes at 37°C, in an atmosphere containing 5% CO2. 59 2. Transfection by Calcium Phosphate Co-precipitation Transfections were carried out essential ly as described by Graham and Van der Erb (1973). a) Preparation of the Precipitate Approximately 5-10ug of cosmid or phage DNA and lOOng of plasmid pOPF (containing the Tk gene) were mixed together and di luted to a f i n a l volume of 450ul with dH 20. To this was added 50ul of 2.5M C a C l 2 and the solution mixed thoroughly. This C a C l 2 DNA mixture was added one drop at a time to 500ul of 2x HEBES buffer pH 7.1 (200mM NaCl, 50mM Hepes pH 7.1, and 1.5mM Na2HPO^) in a s t e r i l e 5ml p las t ic tube with mixing between drops. The precipitate was allowed to form at room temperature for 30 minutes prior to addition to the c e l l s . b) Transfection L-ce l l s were plated at a density of 8x10-* ce l l s per 20x100mm tissue culture dish and grown at 37°C overnight as described above. The following morning 5ml of fresh DME medium was added to each culture and ce l l s incubated at 37°C for 1-2 hours. The DNA precipitate was added such that the DNA was spread over the entire surface of the plate and the plates incubated at 37°C for 4 to 6 hours. The media was removed from the dish and the ce l l s were washed with 5ml PBS buffer. The ce l l s were glycerol shocked by addition of 5ml PBS buffer containing 15% glycerol . After 1 minute the PBS glycerol solution was removed and the ce l l s washed with 5ml of PBS buffer. Cel ls were then grown in 10ml DMEM, containing 10% FCS, for 48 hours to allow expression of the Tk gene. Tk + ce l l s were selected by growing the transfected ce l l s in HAT medium for 2-3 weeks. Transformed T k + c e l l colonies were harvested as mixed 60 populations of ce l l s (pools) or individual ly as clonal populations and maintained in monolayer culture as described above. 3. Analysis of Transformed Cel ls a) C e l l Surface Expression of RTl Class II Molecules Transformed T k + L -ce l l s transfected with rat Class II B genes were analyzed for c e l l surface expression of RTl B molecules using the mouse monoclonal antibody MRC 0X6 (McMaster and Williams, 1979) which detects a non-polymorphic determinant found on a l l rat Class II molecules. B r i e f l y , ce l l s (1x10^) growing in monolayer culture were washed with PBS buffer (containing no M g 2 + or C a 2 + ions) and loosened from the bottom of the tissue culture dish by incubation of the culture in l-2ml 0.6mM EDTA in PBS buffer for 5 minutes. The ce l l s were collected by washing the plate with several m i l l i l i t e r s of PBS buffer containing 10% fe ta l cal f serum. Cel ls were collected by centrifugation at 500 x g for 5 minutes at 4°C. The c e l l pel let was resuspended in 50pl of a solution of MRC 0X6 antibody (20pg/ml), and incubated on ice for 45 minutes to allow binding. Unbound antibody was removed by washing the ce l l s twice with lml PBS buffer containing 0.1% bovine serum albumin (BSA). Again ce l l s were collected by centrifugation as described above. The amount of MRC 0X6 bound to the c e l l surface was quantified using a second antibody (rabbit anti-mouse IgG) labelled with -^^Iodine Q r Fluorescein Isothiocyanate (FITC) followed by analysis using a Gamma counter or by Flow Cytometry (FACS IV) respectively. Again the ce l l s were incubated for 45 minutes on ice in lml of the second antibody. Unbound antibody was removed by washing the ce l l s twice in 5ml PBS buffer containing 0.1% BSA. The ce l l s were collected and suspended in lml PBS (+ 0.1% BSA) 61 buffer and analyzed on the FACS IV or Gamma counter. Cel ls which show high levels of bound fluorescence or radioact iv i ty were expressing RT1 B molecules on their c e l l surfaces, b) Hybridization Analysis In order to investigate the in trace l lu lar expression of rat Class II genes high molecular weight DNA and RNA were isolated from T k + L -ce l l s (transfected with RT1 B genes), and hybridized with the RT1 B Q probe pRIa.2. i ) Southern Blot Analysis Genomic DNA (2ug) was digested with the appropriate res tr i c t ion endonuclease to completion and run on a 0.5% agarose gel (7x10 cm) in lx TBE buffer. The gel was denatured by soaking in a solution of 0.5N NaOH, 1.5M NaCl for 60 minutes, followed by neutral ization in 0.5M Tr i s -HCl pH 7.A, 1.5M NaCl for 60 minutes. DNA was transferred to ni trocel lulose using the cap i l lary blot procedure of Southern (1975), and 20x SSC as the transfer buffer. Following overnight transfer the membrane was baked at 80°C for 2 hours. The membrane was prehybridized in a solution of 50% formamide, 3x SSC, ImM EDTA, 0.1% SDS, lOmM Tr i s -HCl pH 7.5, lOx Denhardt's solution, 0.05% Na pyrrophosphate, 100 ug/ul sheared Herring Testes DNA, and 50ug/Ml tRNA at 37°C for 18 hours. The prehybridization solution was removed and replaced with hybridization solution containing 3 2 P - l a b e l l e d RT1 B Q probe (pRIa.2), and incubated at 37°C for 18-24 hours (hybridization solution and prehybridization solution are the same). Following hybridization the membrane was washed for 60 minutes at 22°C in 2x SSC; twice for 90 minutes at 50°C in O.lx SSC, 0.1% SDS; and rinsed four times in O.lx SSC. Membranes were a i r dried and exposed for 2 to 5 days. 62 i i ) Northern Blot Analysis RNA suspended in H^O was mixed with 3 volumes glyoxal premix (67ul DMSO, 23ul 6M deionized glyoxal , lOul 0.25M phosphate buffer pH 6.6) and incubated at 50°C for 60 minutes. The sample was then cooled to room temperature and sample buffer added (50%. g lycerol , lOmM phosphate buffer, and 0.4% bromphenol blue). The sample was run on a 1.5% agarose gel using lOmM phosphate buffer pH 6.5 at 3-4 volts/cm for 2 hours. The RNA was transferred to GeneScreen by cap i l lary blot procedure with 25mM phosphate buffer. Following overnight transfer the membrane was baked for 2 hours at 80°C. Hybridizations were carried out as described in Section H above. 63 Chapter 3 ISOLATION AND CHARACTERIZATION OF RTl Ba GENOMIC CLONES  A. RESULTS 1. The Plasmid pRIa.2 Wallis and McMaster (1984) have isolated and determined the nucleotide sequence of an RTl BjJ cDNA contained in the recombinant plasmid pRIa.2. The cDNA encodes the carboxy-terminal 129 amino acids of the RTl BjJ chain and 239 nucleotides of 3' untranslated sequence. The cDNA has been used extensively as a DNA probe in the studies on the structure and transcript ion of the RTl B a gene described in this thesis. Figure 4 shows a r e s t r i c t i o n map of the cDNA insert of pRIa.2. The 218 nucleotide Ps t l /Hpa l l fragment was used as a probe for the 5' portion of the RTl B Q gene whereas the remaining Hpal l /Ps t l fragment (nucleotide 218-733) was used as a probe for the 3' end of the RTl B Q gene. 2. Isolation of RTl B a Genomic Clones A Sprague-Dawley (RTl' 3) rat l i ver DNA genomic l ibrary constructed in the Lambda vector Charon 4A was screened with radioactively labelled cDNA pRIa.2 (Wallis and McMaster,1984) and from a screen of 1x10^ recombinant phage, two strongly hybridizing clones were ident i f ied . Southern blot analysis of these recombinant phage, designated Lambda 7 and Lambda 8, is shown in Figure 5. Lambda 7 and 8 overlap and together span 30,000 nucleotides of rat DNA. Two EcoRl fragments of approximately 8,000 nucleotides in length hybridized to the RTl B a cDNA probe in Lambda 7 whereas a single 9,000 nucleotide 1 fragment in Lambda 8 hybridized to the probe. A 4,000 nucleotide BamHl fragment hybridized to the RTl B Q cDNA probe in Lambda 7 whereas a 16,000 nucleotide fragment 64 4-1 (A cu -3-3 CO CO CO iH CN CO a cn c~i O m < ^ M M M t—I ft, 3 C CO -H to ac o o a w CN C a: CO 5' probe 3' probe Figure 4: R e s t r i c t i o n map of the RTl B Q cDNA i n s e r t (haplotype RT1 U) of plasmid pRIa.2 (from W a l l i s and McMaster,1984). This cDNA was used ex t e n s i v e l y as an RTl B Q probe. The 218 nucleotide P s t l / H p a l l fragment was used as a probe f o r the 5' p o r t i o n of the RTl B Q gene, while the remainder of the cDNA was used as a probe f o r the 3' por t i o n of the RTl B a gene. 65 hybridized in Lambda 8. Furthermore hybridizations of EcoRl/BamHl double digested Lambda 7 and 8 DNA detected bands of 1,900 and 1,100 nucleotides in length for Lambda 7 and 1,900 nucleotides in length for Lambda 8. The re s t r i c t i on map i l lu s t ra ted in Figure 6 shows the orientation of the RT1 B Q gene encoded by Lambda 7 and 8. From these data i t appears that the EcoRl s i te of Lambda 7 which separates the two fragments detected by the pRIa.2 cDNA probe coincides with the EcoRl s i te at position 570 of the pRIa.2 cDNA (Figure A). One clone, Lambda 7, therefore should contain the entire RT1 B a gene (as the fragments which hybridized to the RT1 B Q cDNA were flanked by 7,000 nucleotides of DNA in each direction) and was chosen for further study. Lambda 8 was not studied further. The two EcoRl fragments of Lambda 7 with homology to the RT1 B a cDNA were isolated from agarose gels and subcloned into the EcoRl s i te of the plasmid vector pUC9. The recombinant plasmids were designated pRTlB.A and pRTlB.5 (Figure 8A). Southern blot analysis of isolated plasmid DNA hybridized with cDNA probes for the 5' and 3' regions of the gene (see section 1) is shown in Figures 7A and 7B. Figure 7A shows a blot of pRTlB.A and pRTlB.5 DNA hybridized with the 218 nucleotide Ps t l /Hpal l fragment of the pRIa.2 cDNA. It is clear that the 5' region of the RT1 B a gene maps to plasmid pRTlB.A as the probe for the 5' end of the gene does not hybridize to pRTlB.5. The 530 nucleotide Hpal l /Ps t l fragment of the pRIa.2 cDNA hybridizes to both plasmids (Figure 7B). Comparison of the hybridization patterns of pRTlB.A DNA with the 5' and 3' probes shows that the fragments detected are ident ica l . This suggests that the carboxy-terminal 129 amino acids of the RT1 B Q chain are encoded in a 2,000 nucleotide BamHl/Smal fragment located near the 3' 1 2 3 4 5 6 7 8 9 10 11 12 Figure 5: Southern Blot of Lambda 7 and Lambda 8 DNA. Phage DNA was hybridized with the cDNA insert of pRIa.2. Lane 1: EcoRl digested Lambda 7 DNA; Lane 2: EcoRl digested Lambda 8 DNA; Lane 3: BamHl digested Lambda 7 DNA; Lane 4: BamHl digested Lambda 8 DNA; Lane 5: EcoRl/BamHl digested Lambda 7 DNA; Lane 6: EcoRl/BamHl digested Lambda 8 DNA; Lane 7: Alu l digested Lambda 7 DNA; Lane 8: A l u l digested Lambda 8 DNA; Lane 9: Hpall digested Lambda 7 DNA; Lane 10: Hpall digested Lambda 8 DNA; Lane 11: EcoRl digested Lambda DNA standards; and Lane 12: EcoRl/BamHl digested Lambda DNA standards. The RTl B Q gene encoded in Lambda 7 appears to be contained in two EcoRl fragments of approximately 8,000 nucleotides in length, whereas the gene is encoded in a single 10,000 nucleotide EcoRl fragment in Lambda 8. Each lane contains approximately 2pg of digested DNA. 67 Lambda 7 E E E E R ~T— B n i ' i i i ' •' B B B B B B B B Lambda 8 R E E E h— n — i i II i B B B B B B E —r-B — pRIa.2 — 5 kb Figure 6: Restrict ion map of the RTl B a gene containing phages Lambda 7 and Lambda 8. The two recombinant phages are aligned to show the RTl B Q gene in 5' to 3' orientation. The heavy lines indicate DNA fragments inserted into the EcoRl s i te of Charon 4A during the construction of the l ibrary . EcoRl sites are indicated with an "E" and BamHl sites are indicated with a "B". The bar labelled "pRIa.2" denotes the fragments which hybridize to the pRIa.2 cDNA probe. 68 end of the insert of pRTlB.A. The data from these blots as well as DNA sequence data (presented in Chapter A) were used to generate the re s tr i c t ion maps shown in Figures 8B and 8C. 3. Genomic Southern Blot Hybridizations In order to determine i f Lambda 7 contained a s tructural ly intact RT1 B Q gene the hybridization patterns of rat genomic DNA and Lambda 7 DNA using the RT1 B a,cDNA probe were compared. When predicting the expected size of genomic fragments from recombinant phage the method of construction of the l ibrary from which the phage was isolated must be considered. The l ibrary which Lambda 7 and 8 were isolated was constructed from p a r t i a l l y Hae l l l digested rat DNA cloned into the EcoRl s i te of Charon AA using EcoRl l inkers . Therefore the terminal EcoRl s ites on fragments cloned into Charon AA (heavy l ines in Figure 6) may not be present in genomic DNA. Comparison of the re s t r i c t i on maps of Lambda 7 and Lambda 8 predicts genomic DNA fragment sizes of 9,000 and 7,800 nucleotides for EcoRl digested DNA; and 3,000 nucleotides for BamHl digested DNA. Figure 9 shows a Southern blot of high molecular weight Wistar s tra in rat l i ver DNA, digested with a number of re s t r i c t ion enzymes, and hybridized with the cDNA insert of pRIa.2. Figure 9 shows that EcoRl fragments of 9,000 and 7,800 nucleotides in length and a BamHl fragment of 3,000 nucleotides in length were detected exactly as predicted. Furthermore, the fragment sizes detected in Figure 9 with the enzymes B g l H and Smal are as predicted from the nucleotide sequence of the RT1 B a gene contained in Lambda 7 and discussed in Chapter A. 69 1 2 3 A 5 6 7 8 9 10 111213 Figure 7A: Southern blot of plasmid pRTlB.4 and pRTlB.5 DNA. Plasmids were digested with various enzymes and hybridized with fragments of pRIa.2. Lanes 1 to 6 contain pRTlB.4 DNA and Lanes 7 to 12 contain pRTlB.5 DNA; Lane 13 contains EcoRl/BamHl digested Lambda DNA standards. The res tr i c t ion enzymes used are Lanes 1 and 7: EcoRl; Lanes 2 and 8: BamHl; Lanes 3 and 9: Smal; Lanes 4 and 10: EcoRl/BamHl; Lanes 5 and 11: EcoRl/Smal; and Lanes 6 and 12: BamHl/Smal. Each lane contains approximately 2ug of digested DNA. Blot (A) was hybridized with the 218 nucleotide Pst l /Hpal l fragment (1-218) of the cDNA insert of plasmid pRIa.2 (see Figure 4). No hybridization was seen to pRTlB.5 DNA using this probe. 70 1 2 3 4 5 6 7 8 9 1011 1213 Figure 7B: Southern blot of plasmid pRTlB.4 and pRTlB.5 DNA. Plasmids were digested with various enzymes and hybridized with fragments of pRIa.2. Lanes 1 to 6 contain pRTlB.4 DNA and Lanes 7 to 12 contain pRTlB.5 DNA; Lane 13 contains EcoRl/BamHl digested Lambda DNA standards. The res tr i c t ion enzymes used are Lanes 1 and 7: EcoRl; Lanes 2 and 8: BamHl; Lanes 3 and 9: Smal; Lanes 4 and 10: EcoRl/BamHl; Lanes 5 and 11: EcoRl/Smal; and Lanes 6 and 12: BamHl/Smal. Each lane contains approximately 2ug of digested DNA. Blot (B) was hybridized with the 561 nucleotide Hpal l /Pst l fragment (218-733) of the cDNA insert of plasmid pRIa.2 (see Figure 4). 71 OC O O Ui cc o o UJ • 111 p R T B . 4 cr o o UJ o o p R T B . 5 1 kb o « o £ U i CO n II D E CD CO CD CO (0 E co X E w co to oc o o UJ cc o o UJ X E (0 CO X E 10 m x E m oc o u UJ 1 kb Figure 8: (A) Restr ict ion map of lambda 7. Shaded boxes indicate the exons of the RTl Ba gene. (B) Restrict ion map of pRTlB.A. Arrows below the map indicate the fragments used to sequence the RTl B a coding regions contained in this plasmid. (C) Restrict ion map and the fragments used to sequence the RTl B a coding regions contained in the plasmid pRTlB.5. 72 Figure 9: Genomic Southern Blot of Wistar Rat Liver DNA. Approximately 2ng of high molecular weight Wistar rat DNA was digested with the enzymes EcoRl (Lane A) , BamHl (Lane B), and Smal (Lane C) as well as combinations of these enzymes (EcoRl/BamHl Lane D; EcoRl/Smal Lane E) . DNA transferred to a Genescreen membrane were hybridized with the cDNA insert of plasmid pRIa.2. Lane F contains EcoRl/BamHl digested Lambda DNA as molecular weight standards. 73 B. DISCUSSION The RTl B a cDNA insert of plasmid pRIa.2 was used to screen a Sprague-Dawley (RTl*3) rat genomic l i b r a r y . From 1x10^ recombinant phage two overlapping clones designated Lambda 7 and Lambda 8 were isolated (Figure 6). Hybridization studies showed that the entire RTl B Q was potential ly encoded in two Lambda 7 EcoRl fragments of approximately 8,000 nucleotides in length. In order to f a c i l i t a t e the characterization and subsequent sequence analysis of the RTl B Q gene the two EcoRl fragments of Lambda 7 were isolated and subcloned into the pUC9 plasmid vector. The RTl B a recombinant plasmids were cal led pRTlB.4 and RT1B.5 (Figure 8A, 8B, and 8C). Restrict ion mapping and hybridization studies local ized the RTl B Q gene to several fragments of these two plasmids. Comparison of the re s t r i c t ion fragments detected by hybridization with the RTl B a gene probe (pRIa.2 cDNA) in Lambda 7 DNA and in rat genomic DNA has been used to determine i f the gene encoded by Lambda 7 is intact . Figure 9 shows that EcoRl fragments of 9,000 and 7,800 nucleotides in length and a 3,000 nucleotide BamHl fragment were detected in Wistar genomic DNA and that these fragments corresponded exactly to the fragment sizes predicted from the res tr i c t ion map of Lambda 7. The RTl B a gene encoded by Lambda 7 appears to be intact and ident ica l to that detected by the RTl B a gene probe. o 74 Chapter 4 ANALYSIS OF THE DNA AND PREDICTED AMINO ACID SEQUENCE  OF THE RT1 Ba GENE A. RESULTS 1. The Nucleotide Sequence The approach used to sequence the RT1 B a gene was to cleave the entire gene into random fragments, identify fragments containing coding sequence, by hybridization with an RT1 B Q cDNA, and determine the sequence of those clones only. This strategy was chosen as i t is very e f f ic ient in that the structure and organization of a gene can be determined by sequencing only a small portion of the entire DNA contained in a gene (ie coding sequence including intron/exon boundaries as well as 5' and 3' flanking sequence). The plasmids pRTlB.4 and pRTlB.5 were cleaved into random fragments of 200 to 400 nucleotides in length by two methods. Whole plasmid was sonicated to generate random fragments of varying s ize . These fragments were size fractionated and isolated using preparative agarose gels. Fragments were rendered blunt ended using Mung Bean nuclease (Kowalski and Kroeker,1976) and blunt end l igated into Smal cut M13 mp9 or mpl8 (Messing,1983). Random fragments were also generated by digestion of whole plasmid with the re s tr i c t ion endonucleases A l u l , Rsal , and Hae l l l which generate blunt ended fragments. These endonucleases have tetranucleotide recognition sequences and therefore generate fragments which are on average 300 nucleotides in length. Fragments generated by res tr i c t ion endonuclease were also l igated into Smal cut M13 mp9 or mpl8. Clones containing coding sequence were ident i f ied by hybridization with the plasmid pRIa.2 (RT1 B Q cDNA; Wallis and McMaster,1984). As 75 plasmid pRIa.2 does not contain the 5' end of the RTl B Q gene the cDNA pACD3 which contains the coding region of the entire mouse H-2 A Q gene was used as a hybridization probe for the 5' end of the RTl B a gene (Benoist et al . ,1983). Positive clones were sequenced using the di-deoxy nucleotide chain termination method of Sanger et a l . (1977). Sequences obtained from random fragments were overlapped by cloning specif ic fragments into the M13 vectors mp9, mpl8, and mpl9 (Messing,1983; Norrander et al . ,1983). Figures 8B and 8C i l l u s t r a t e the fragments used to determine the coding sequence of the RTl B Q gene. The complete nucleotide sequence of the coding regions, most of the intron sequences as well as the predicted amino acid sequence are shown in Figure 10. The intron and exon junctions of the RTl B a gene were mapped by comparison of the genomic DNA sequence to the cDNA sequence of pRIa.2 and pACD3 and by searching the genomic DNA sequence for the consensus sequence for nuclear mRNA spl ice junctions (Breathnach and Chambon, 1981). Furthermore, the 3' end of each predicted intron in the RTl B Q sequence was preceded by variations of the consensus sequence 5'-CTGAC-3' that is found 20 to 50 nucleotides upstream from the 3' spl ice junction of most rat introns (Kel ler and Noon, 1984). The organization of the RTl B a gene closely resembles the structures of the H-2 and HLA class II a genes in that the gene is divided into 5 exons (Figure 11) which corresponds to the domain structure of the protein (Mathis et a l . 1983; Okada et a l . 1985; Das et a l . 1983). Exon 1 encodes the leader peptide of 23 amino acids as well as the f i r s t 5 amino acids of the f i r s t external domain (a l ) . Exon 2 encodes the remaining 83 amino acids of the a l domain and exon 3 encodes the complete a2 domain consisting of 94 amino acids. In contrast to one exon per domain, exon 4 encodes the 76 Figure 10: The nucleotide and predicted amino acid sequence of the RT1 Ba gene. The numbers correspond to the amino acid positions i n the mature protein. Sequences underlined i n the 5' flanking sequences are (5 1 to 3'): the putative CAAT box, two highly conserved putative regulatory sequence elements, the TATA box, and the s i t e of t r a n s c r i p t i n i t i a t i o n . The t r a n s l a t i o n termination codon i s indicated by ***.. The underlined sequences 3' to the coding region are the 3' untranslated region of the gene. ....indicates sequences conserved i n a l l Class I I genes (Okada et a l . 1985). 77 CTCCAGGGAGTTCTCCTATCCTCTTCCAGGCCTCTCAATACAAAGTCTGCAGTrAGCAACTGTGACGTCATCACAGGGAAATTTTCfGAT TGGTCTGTCCGGTTTGGTTTGAGTGTAAGATCTCCTGGGCTGGATCCTCACAATCTCTTGAAGACTCAGGAGAGCAGCTACAGAGACCAC -23 - 1 1 MetProLeuSerArgAlaLeuIleLeuGlyValLeuAlaLeuThrThrMetLeuSerProCysGlyGlyGlnAspAs CTAGAGAACAGAGATGCCGCTCAGCAGAGCTCTGATTTTGGGGGTCCTCGCCCTGACCACCATGCTCAGCCCCTGTGGAGGTCAAGACGA 5 p I l e G l u A CATTGAGGGTGAGTTGTGCAGCTGAGGGATGCCTGGAGCCGGGAAATGGAAAATCTACAGAAGAGGGAGATACAAATTGGCTAAGATATA AATCCTCAATATTAGACAATCTAACAACTGTGTGAGCCCTTCTTCGGGAGTCTCTCGTTGCCGACCACAG... Intron. 1. . 2. 0. KB.. GATCTATTAGACACAAAACCTMCCAGAGMGGAAATATGCGGACCTGMCCTTTGCAGACAAAGC'n'CCTCCCTCTGCTCAGTTGTAAG CTACTTGGTCTGAGCCGTCTGTGTACCAAAGAGTGGACAAGGCAGTCAGGATAGCAGAAATCAAACACATGGCATCCCACCATTGTGCGG CGCGTGTCACAGAGGGAAAGACAGGAGTGTAACCCACACTGAGAGTGGTAGGGAGACGCGGGTGGTGGAAATGCATCAAAAACAATGATG T T C A C G G T A C T C G T C A G A G C A T T T T C T A C C C G m G T T T T A A M C A T T C T T T T C C T C T T C C T G T T T T 7 laAspHisValGlySerTyrGlylleThrValTyrGlnTyrHisGluSerLysGlyGlnTyrThrHisGluPheAspGlyA ATTCCTCAGCCGACCACGTAGGCTCCTATGGTATAACTGTGTATCAGTATCATGAATCCAAAGGCCAGTACACACATGAATTTGATGGTG spGluArRPheTyrValAspLeuAspLysLysGluThrlleTrpArglleProGluPheGlyGlnLeuIleSerPheAspProGlnGlvA ACGAGAGATTCTATGTGGACTTGGATAAGMGGAGAtCATCTGGAGGATCCCCGAGTTTGGACAACTGATMGCTTTGACCCCCAAGGTG 88 laLeuArgAsnlleAlallelleLysHisAsnLeuGluIleLeuMetLysArgSerAsnSerThrProAlaValAsnG CACTTCGAMTATAGCTATMTAAAACACMTTTGGAMTCTTGATGAAGAGGTCAAATTCAACCCCAGCTGTCAACGGTACGTGCTCAC CACCCTGCTCCCCCCTCCCTTCCCTGGGGGGTTAGGGGATGTGATCACGACATTAATGGTCCAATAAAATCCTCTCCTTTCCAAGGAGAC CCCGGATCTCTTCATCACTGGAGACTCATCCCCTCTCTTCTTGTTTTTAMGATTTATTTATTTATTATATCT^ CTTCGGACACACCAGAGAGAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCT GGAAGAGCAGTCAGTGCTCTTMCCACTGAGCCATCTCTCCGGCCCATCCCTTCTCTTCTTAAAAATCACACATTTCATGTAATATACAG CTCACTATTCCACAATGCTCTCCTCGAATCTTTTGGAAAAGCCCCGACAGACATCCTACCTGAACTCCCTAGACGAGAGGGGCACAGGGA TCAAGTGGAGGGCACATTAGCTCCAAGCAGAGGAATCGGGCTCTTTGACTTTCATATGTGTAAGACTTGTCAAGAAGGCTCTCTCACTAG 90 luValProGluAlaThrValPheS ACAGTGCAGGGCTTCAGGGAGAGAAGCTCCCATCAGCCTCTGACATCCAGACCATTrCCTTTGCAGAGGTTCCTGAGGCGACCGTGTTTT erLysSerProValLeuLeuGlyGlnProAsnThrLeuIleCysPheValAspAsnllePheProProVallleAsnlleThrTrpLeuA CCAAGTCCCCTGTCCTGCTGGGTCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGATCAATATCACATGGTTGA rgAsnSerLysProLeuThrGluGlyValTyrGluThrSerPheLeuIleAsnSerAspTyrSerPheHisLysMetAlaTyrLeuThrP GAAACAGCAAGCCACTCACAGAAGGCGTTTATGAGACCAGCTTCCTTATCAACAGTGACTATTCCTTCCACAAGATGGCTTACCTCACCT 182 helleProSerAsnAspAspIleTyrAspCysLysValGluHisTrpSerLeuAspGluProValLeuArgHisTrpG T C A T C C C T T C C A A C G A C G A C A T T T A T G A C T G C A A G G T G G A G C A C T G G A G C C T G G A C G A G C C G G T T C T A A G A C A C T G G G G T G T G T A T G A G C T C T G C C A C T T C T G G C A C T T T C T C G T T C A C T G T C A C T T C T G G A A C A G C A T G G C T T C T G G C T T C A A G T G A C C A A A A C T C A C T T T C C A C T C T T A M G T T T C T M G G C T A G A G T T C G T G T C A T C C C A T T A G C C C A G C C T C A G A G A C C A G T A G G T T A A C T C C T C C T C A C C T G G T C C T G T C T T A C A 184 luProGluIleProAlaProMetSerGluLeuThrGluThrValValCy CATACATGAGTCCCTTCTGACTCAAAGCTTCTCTCTCTCAGAACCTGAGATTCCAGCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTG sAlaLeuGlyLeuSerValGlyLeuValGlylleValValGlyThrllePhellelleGlnGlyLeuArgSerValAlaProSerArgHi TGCCCTGGGGTTGTCTGTGGGTCTCGTGGGCATCCTGGTGGGCACCATCTTCATCATTCAAGGCCTGCGATCAGTGGCTCCCTCCAGACA 233 sProGlyProLeu*** CCCAGGGCCGTTGTGAGTCACACCCTGGGAMGMGGTAAGGGTTTGTGTTTGTGGGAAACAAAGGCACGCATGGGGAGGGGAAGGAAGG GGAGACATGAAAGTTrGTTGTTGGAACTTTGCTGGAGCCTCTGAACCCATCTTrCCTGTGTGTTTTGTTGTAGGTGCGTGGCCCTCTACA  GGGAAGATGTAGTGTGTGGGGGTGACCTGGCACAGTGTGTTTTCTGGCCCAATTCATCGTGTTCTCTCTCTTCTCCTGGTGTCTCCCATC  TTGCTCTTCCCTTGGCCCCCAGGCTGTCCACCTCATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATTTTTGGCATCTT CCMGTCCAATCTACTATAGATTCCGAGACCCTGATTAATGCTCCACCALAACCAATAAACCTC T C T C C C A T T T T G G A G C T T A C T G G A G C C A G G C C C A T G T A A T C C T G T G T C C A G T G T C A C A G G A A T A A C C A A T G C A G C C C A G A A T G G T T T G G T A T C T T A G C C M G G T T G A C T T T C A A A T T T T T T T G T T C A G C T G A C A T C T C A C C 78 SUT,L — S h -od oc2 TM.C 3UT A Figure 11: Structure of RT1-B a Class II gene. The gene i s d i v i d e d into 5 exons: Shaded boxes denote coding sequence and cross-hatching denotes untranslated sequences. L denotes the leader peptide, a l , and al, denote the exons encoding the e x t e r n a l domains of the pro t e i n s ; TM denotes the transmembrane region: C denotes the cytoplasmic region of the p r o t e i n ; and 3'UT denotes the untranslated region found in the 3' f l a n k i n g region. 79 connecting peptide (or membrane proximal region) of 13 amino acids, the transmembrane region of 23 amino acids, the cytoplasmic region of 15 amino acids and 23 nucleotides of the 3' untranslated region. The remainder of the 3' untranslated region is encoded separately in exon 5. An intron in the 3' untranslated region is unusual and is d i s t inct ive to MHC class II a genes. With most genes, including the MHC class II 3 and class I genes, the cytoplasmic domain of the protein and 3' untranslated region are encoded by a single exon (Eccles and McMaster, 1985; Larhammar et a l . 1983; and Larhammar et a l . 1982). The organization of the HLA DQ a gene (Auffray et a l . , 1984) is s imilar to that of the RTl B a gene except that exon 1 encodes a leader peptide of 23 amino acids and only 4 amino acids of the a l domain (which is one amino acid shorter). Thus the RTl B Q and HLA DQQ genes are s tructural ly more related to each other than to the H-2 E Q and HLA DRQ genes. 2. Analysis of the Predicted Protein Sequence Comparison of the predicted amino acid sequence of the RTl B Q gene to that of the H-2 A Q and the HLA DQ a genes (Table 1) shows that the amino acid sequence of these three molecules is highly conserved. The addition of the predicted amino acid sequence from the RTl B Q gene provides values for the leve l of sequence conservation in the leader peptide and a l domains. Within the a l domain of the RTl B, H-2 A and HLA DQ molecules there are conserved amino acids at 39 of 88 positions (44%). Even higher levels of conservation are found in the remaining a chain domains (Wallis and McMaster 1984). This level of conservation is s imilar to that found in the comparison of RTl Dp ,H-2 Ep and HLA DRp chain sequences (Robertson and McMaster 1985). A comparison of 26 MHC 80 Table 1: Protein Sequence Identity between Class II a Chains of Rat, Mouse, and Human Domain Percent Sequence Identity RT1 B a : H-2 A a RT1 B a : HLA-DQa leader peptide 91 74 a l 80 59 a2 84 79 connecting peptide 92 84 transmembrane region 100 91 cytoplasmic t a i l 86 73 overal l 85 73 81 class II a chain sequences has recently been reported which shows in de ta i l the d is tr ibut ion of species specif ic and .alTe'le- specif ic ' differences found in MHC class II genes of rat , mouse, rabbi t and human (Figueroa and Klein, 1986). ' W-T Conserved amino acid residues are observed at residue 82 and 122 where the sequence Asn-Ser-Thr, 'a <• potential s i te of N-linked glycosylation, is observed. ' Other residues conserved across species are Cysteine residues at position- 1-11 and' 167, Phenylalanine at position 117, Tryptophan, at positions -1*25 and"il82, and Aspartate at posit ion 146 a l l of which are "character i s t ic of immunoglobulin constant region domains (Travers ,et al . ,1984). Class II molecules are a member of the immunoglobulihfgene superfamily (Hood et a l . 1985). In addition the RT1 B a , '" H-2; ; JA a, -and HLA-DQa molecules a l l have the following conserved residues:^ Phenylalanine 149, Proline 159, and Tryptophan 182 which are characterist ic of MHC antigen membrane proximal domains (Travers et a l . ,1984) / :•>• The structure of the coding sequence of Class II genes can be comparedvbetween "species. The RT1 B a , and H-2 A Q genes contain 23 amino acids of the leader peptide and 5 residues of the a l domain in exon 1, 83 residues of the a l domain in exon 2, 94 residues of the a2 domain in exon 3, and the remaining 51 residues of the protein plus 23 nucleotides of 3' untranslated sequence in exon 4 (see Figure 4).- The HLA DQQ gene is highly s imilar in structure except that exon 1 is shorter and encodes 23 residues o f t leader peptide and only 4 residues of the a l domain (which is one amino acid shorter in human than in rodent). In contrast the H-2 E a and HLA DRa genes contain 25'residues of leader peptide and 2 residues of the a l domain in exon 1, 82 residues of the a l domain in 82 exon 2, 94 residues of the cc2 domain in exon 3, and the remaining 51 residues of the protein plus 11 nucleotides of 3' untranslated sequence in exon 4. The H-2 A a , RT1 B a , and HLA DQa molecules are s tructural ly more related to each other than to the E Q homologs H-2 E a or HLA DR a , and s imi lar ly for the H-2 E Q and HLA DRa molecules. These findings suggest that the two Class II l o c i represented by the H-2 A Q and E a molecules diverged by gene duplication prior to the speciation of mammals. 3. The Promoter The 5' untranslated region of the RT1 B a gene contains several blocks of conserved nucleotide sequence that are thought to be involved in the regulation of class II gene expression. The cap s i t e , which has been proposed to represent the s i te of i n i t i a t i o n of RNA transcript ion and conforms to the consensus sequence 51-PyNNNPyAPyPyPyPyPy-3'; where Py represents Pyrimidine nucleotides and N can be any nucleotide (Breathnach and Chambon, 1981), is located at -50 with respect to the i n i t i a t o r methionine codon at posit ion +1 (underlined in figures 10 and 12). S imi lar ly , the Hogness or TATA box plays an important role in determining the s i te of i n i t i a t i o n of transcript ion and is usually found 25 nucleotides upstream from the i n i t i a t i o n s i te (Breathnach and Chambon, 1981). An A-T r i c h region 25 nucleotides upstream from the putative cap s i te (underlined in Figures 10 and 12) may serve as a TATA box in the RT1 B Q gene. Analysis of the 5' flanking sequence of the RT1 B Q gene reveals two segments of highly conserved DNA sequence found in a l l MHC class II sequences published to date (Saito et a l . 1983, Okada et a l . 1985). Figure 12 shows a consensus sequence of the conserved 5' region of MHC 83 -90 - 8 0 - 7 0 . - 6 0 - 5 0 - 4 0 - 3 0 - 2 0 - 1 0 -1 RT i IV. A A t ^ T C T C C A G T T A G C A A C T G T G A C G T C A T C A C A G G G A A A T T T T C T G A T T G G T C T G T C C G G T T T G G T T T G A G T G T A A G A T C T C C T G G G C T G G A T C C T C A C A A T C T C T Hl .A G C T A G T A A C T G A G A T G T C A C C A T G G G G G A T T T T T C T A A T T G G C C A A A A II-: In C C T A G C A A C A G A T G T G T C A G T C T G A A A G A T T T T T C T G A T T G G T T A A A A G T T G A G T G C T T T G G A T T T T A A T C C C T T T T A G T T C T T G T T A A T T C T G C C T H L A V?.a C C T T C C C C T A G C A A C A G A T G G G T C A T C T C A A M T A T T T T T C T G A T T G G C C A A A G A G T A A T T G A T T T G C A T T T T A A T G G T G A G A C T C T A T T A C A C C C C A C A T T C C O N S E N S U S N Y T A G Y A A C N C N N R Y G T C A N Y N T i ' R R R K N A N T T T T C T R A T T G G Y Y N R N R H - 2 A B A T G T C T A C C C A G A G A C A G A T G A C A G A C T T C A G C T C C A A T G C T G A T T G G T T C C T C A C T T G G G A C C A A C C C T G A C A C T C T G G G A T T T C A G A T C A C T C T A G G C T A C A H L A DOS A T G T C T G C C T A G A G A C A G A T T A G G T C C T T C A G C T C C A G T G C T G A T T G G T T C C T T T C C A A A G G A C C A T C C A A T C C T G C C A C G C A G G G A A A C A T C C A C A G G T T T T T H - 2 F.3 A T C T C T A A C T A G C A A C T G A T G A T G C T G G A C T C C T T T G A T G C T G A T T G G C T C C C A G C A C T G G C C T T A C C C A A T C C A G T G C C A A A G C A G T G A A T G T G C T G T C T C T T H L A HHP A T C T C T G A C C A G C A A C T G A T G A T G C T A T T G A A C T C A G A C G C T G A T T C A T T C T C C A A C A C T A G A T T A C C C A A T C C A G G A G C A A G G A A A T C A G T A A C T T C C T C G C T B C O N S E N S U S N C Y A G N R A C N G A T G A N R N N N N N N N N C T Y N R R Y G C T G A T T N N Y T C Y Y Y Figure 12: Alignment of the promoter regions of Class II a and B genes. [HLA DQ a (Okada et a l . 1985), H-2 E Q (Mathis et a l . 1983), HLA DRQ (Das et a l . 1983), H-2 Ap (Larhammar et a l . , 1983), HLA DQp (Schenning et a l . 1984), H-2 Ep (S a i t o et al.1983), and HLA DRp (Larhammar et a l . 1985)] Underlined sequences i d e n t i f y the promoter element (-90 to -50), the TATA box (-28), and the cap s i t e (-1). 84 class II a and B genes incorporating the sequence data from the RT1 B Q gene. This alignment shows that the overal l structure of these two short highly conserved regions are separated by 20 nucleotides in a genes and 19 nucleotides in B genes and have been maintained throughout the evolution of class II genes. The a and 0 consensus sequences do, however, d i f fer in the regions flanking the 3' underlined sequence. It is l i k e l y , therefore, that these regions may be important in the regulation of expression of class II genes. Many eukaryotic promoter regions have a conserved sequence 5'-GGPyCAATC-31 70 to 80 nucleotides upstream from the cap s i te of unknown function cal led the CAAT box (Breathnach and Chambon, 1981). Class II B genes that have been sequenced have CAAT boxes located between the conserved regulatory region and the TATA box (Larhammar et a l . 1985; G i l l i e s et a l . 1984), whereas many a genes do not appear to have CAAT boxes (Das et a l . 1983; Larhammar et a l . 1983). Analysis of the RT1 B Q 5' flanking region reveals an atypical CAAT box at position -103. This location is unusual in that in those Class II genes which have CAAT boxes the CAAT box is found between the TATA box and the conserved regulatory element not 51 to i t . 4. A l l e l i c and Interspecies Variation in RT1 Ba Genes Figure 13 compares the nucleotide and predicted amino acid sequence of the RT1 B a gene (haplotype R T l b ) and the RT1 B Q cDNA, pRIa.2, (haplotype RT1U) (Wallis and McMaster, 1984). The cDNA insert of pRIa.2 encodes the carboxy terminal 129 amino acids of the mature RT1 B Q protein which includes the a2 domain, connecting peptide, transmembrane region and cytoplasmic domains. Figure 13 shows that 85 124 Gin Pro Asn Thr Leu l i e Cys Phe Val Asp Asn H e Phe Pro Pro Val H e Asn H e Thr B b : CAG CCC AAC ACC CTC ATC TGC TTT GTA GAC AAC ATC TTT CCT CCT GTG ATC AAT ATC ACA B u : 144 Trp Leu Are Asn Ser Lys Pro Leu Thr Glu Gly V a l Tyr Glu Thr Ser Phe Leu H e Asn B b : TGG TTG AGA AAC AGC AAG CCA CTC ACA GAA GGC GTT TAT GAG ACC AGC TTC CTT ATC AAC B u : G TC Val Ser 164 Ser Asp Tvr Ser Phe His Lys Met Ala Tvr Leu Thr Phe H e Pro Ser Asn Asp Asp H e B b : AGT GAC TAT TCC TTC CAC AAG ATG GCT TAC CTC ACC TTC ATC CCT TCC AAC GAC GAC ATT B u : CC C Pro His 184 Tvr Asp Cys Lys V a l Glu His Trp Ser Leu Asp Glu Pro V a l Leu Are His Trp Glu Pro B b : TAT GAC TGC AAG GTG GAG CAC TGG AGC CTG GAC GAG CCG GTT CTA AGA CAC TGG GAA CCT B u : G A Gly Lys 204 Glu H e Pro A l a Pro Met Ser Glu Leu Thr Glu Thr Val V a l Cvs A l a Leu Gly Leu Ser B b : GAG ATT CCA GCC CCC ATG TCA GAG CTG ACA GAG ACT GTG GTC TGT GCC CTG GGG TTG TCT B u : G Val 224 Val Gly Leu V a l Gly H e Val Val Gly Thr H e Phe H e H e Gin Gly Leu Are Ser Val B b : GTG GGT CTC GTG GGC ATC GTG GTG GGC ACC ATC TTC ATC ATT CAA GGC CTG CGA TCA GTG B u : C AT Asp 233 Ala Pro Ser Arg His Pro Gly Pro Leu B b : GCT CCC TCC AGA CAC CCA GGG CCG TTG TGAGTCACACCCTGGGAAAGAAGGTGCGTGGCCCTCTACAGGG B u : GC C T C B b : AAGATGTAGTGTGTGGGGGTGACCTGGCACAGTGTGTTTTCTGGCCCAATTCATCGTGTTCTCTCTCTTCTCCTGGTGT : A C T B b : CTCCCATCTTGCTCTTCCCTTGGCCCCCAGGCTGTCCACCTCATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGA B u : B b : GTTTCATTTTTGGCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTAATGCTCCACCAAACCAATAAA B u : G Figure 13: Alignment of the RTl B Q gene (RTl b ) with the a l l e l i c RTl B Q (RT1U) cDNA pRIa.2 (Wallis and McMaster, 1984). Nucleotide and amino acid substitutions are shown. 86 between the RTl B b and RTl^ a l le les there are 16 nucleotide changes result ing in 8 amino acid substitutions of which 50% are conservative. Comparison of the 3' untranslated sequences between RTl B Q a l le les shows that these sequences are 98% conserved. In the mouse comparison of the 3' untranslated sequences between the six H-2 A a a l l e les (Benoist et al.,1983) showed that the average conservation of nucleotide sequence in this region was 97%. The same comparison between RTl and H-2 genes shows 95% conservation of nucleotide sequence, however the 3' untranslated sequence is only 80% conserved between the HLA-DRQ and H-2 E a genes (Mathis et al.,1983) The high leve l of conservation between the RTl B a and H-2 A a genes and a l l e l es in the 3' untranslated region suggests that these sequences may play a role in the functional expression of class II molecules. Comparison of the nucleotide and protein sequence of the coding sequence of the RTl B a gene to that of H-2 A Q a l l e les (Benoist, 1983, Figueroa and K l e i n , 1986) (Figure 14) reveals several s tr ik ing features. Over the entire a chain protein, 11 of the 20 inter-species amino acid differences occur at positions ident i f ied as a l l e l i c a l l y variable in the H-2 molecule. The inter-species nucleotide and amino acid changes are clustered primarily in two regions of the RTl B al domain at amino acid positions 19 to 23 and 45 to 78. The regions which have been designated as a l l e l i c a l l y variable in H-2 A Q occur at amino acid positions 8 to 16 and 45 to 78. The close association of regions of inter-species and a l l e l i c v a r i a b i l i t y suggests that a l l e l i c v a r i a b i l i t y may occur at the same locations in the RTl B a l domain. 87 I RTl B—.Gln Asp Asp He Glu Ala Asp His Val Gly Ser Tyr Gly He Thr Val Tyr Gin Tyr His 20 * * * * * * * * * * * * * * * * * H-2 A Q:Glu Asp Asp He Glu Ala Asp His Val Gly Ser Tyr Gly H e Thr Val Tyr Gin Ser Pro RTl B :Glu Ser Lys Gly Gin Tyr Thr His Glu Phe Asp Gly Asp Glu Arg Phe Tyr Val Asp Leu 40 * * * * * * * * * * * * * * * H-2 A Q:Gly Asp H e Gly Gin Tyr Thr Phe Glu Phe Asp Gly Asp Glu Leu Phe Tyr Val Asp Leu RTl B„:Asp Lys Lys Glu Thr He Trp Arg He Pro Glu Phe Gly Gin Leu He Ser Phe Asp Pro 60 * * * * * * * * * * * * * H-2 A a:Asp Lys Lys Glu Thr Val Trp Met Leu Pro Glu Phe Ala Gin Leu ArR Arg Phe Glu Pro RTl B_:Gln Glv Ala Leu Arg Asn He Ala He He Lys His Asn Leu Glu He Leu Met Lys Arg 30 * * " * * * * * * * * * * * * * H-2 A,,:Gin Gly Gly Leu Gin Asn H e Ala Thr Gly Lys His Asn Leu Glu H e Leu Thr Lys Arg RTl B :Ser Asn Ser Thr Pro Ala Val Asn Glu Val Pro Glu Ala Thr Val Phe Ser Lys Ser Pro 100 * * * * * * * * * * * * * * * * H-2 A Q:Ser Asn Ser Thr Pro Ala Thr Asn Glu Ala Pro Gin Ala Thr Val Phe Pro Lys Ser Pro RTl B„:Val Leu Leu Gly Gin Pro Asn Thr Leu H e Cys Phe Val Asp Asn He Phe Pro Pro Val 120 * * * * * * * * * * * * * * * * * * * * H-2 A a:Val Leu Leu Gly Gin Pro Asn Thr Leu H e Cys Phe Val Asp Asn He Phe Pro Pro Val RTl B _ : l i e Asn H e Thr Trp Leu Arg Asn Ser Lys Pro Leu Thr Glu Gly Val Tyr Glu Thr Ser 140 * * * * * * * * * * * * * * * * * H-2 A a : I l e Asn H e Thr Trp Leu Arg Asn Ser Lys Ser Val Thr Asp Gly Val Tyr Glu Thr Ser RTl B„:Phe Leu H e Asn Ser Asp Tyr Ser Phe His Lys Met Ala Tyr Leu Thr Phe He Pro Ser 160 * * * * * * * * * * * * * * * H-2 A a:Phe Phe Val Asn Arg Asp Tyr Ser Phe His Lys Leu Ser Tyr Leu Thr Phe He Pro Ser RTl B„:Asn Asp Asp H e Tyr Asp Cys Lys Val Glu His Trp Ser Leu Asp Glu Pro Val Leu Arg 180 * * * * * * * * * * * * * * * * H-2 A Q:Asp Asp Asp He Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro Val Leu Lys RTl B :His Trp Glu Pro Glu He Pro Ala Pro. Met Ser Glu Leu Thr Glu Thr Val Val Cys Ala 200 * * * * * * * * * * * * * * * * * * * * H-2 A Q:His Trp Glu Pro Glu He Pro Ala Pro Met Ser Glu Leu Thr Glu Thr Val Val Cys Ala RTl B :Leu Gly Leu Ser Val Gly Leu Val Gly He Val Val Gly Thr He Phe He H e Gin Gly 220 * * * * * * * * * * * * * * * * * * * * H-2 A a:Leu Gly Leu Ser Val Gly Leu Val Gly H e Val Val Gly Thr He Phe He He Gin Gly" RTl B a:Leu Arg Ser Val Ala Pro Ser Arg His Pro Gly Pro Leu 233 * * * * * * * * * * H-2 A a:Leu Arg Ser Gly Gly Thr Ser Arg His Pro Gly Pro Leu Figure 14: Comparison of the predicted amino acid sequences of the RTl B Q and H-2 A Q molecules. Amino acids highlighted in boldface are positions showing a l l e l i c variat ion in the mouse (Benoist et al . ,1983). Underlined sequences indicate regions of nucleotide sequence hypervariabi l i ty in the mouse (Benoist et a l . , 1983; Landais et a l . 1985; and Landais et a l . 1986). Asterisks denote amino acid sequence identity between rat and mouse. 88 5. Molecular Evolution The rates of nucleotide divergence among DNA encoding RT1, H-2, and HLA Class II a genes was calculated using the method of Perler (Perler et a l . 1980). Comparison of the coding sequences codon by codon allows the number of s i lent (those substitutions which do not result in an amino acid change) and replacement substitutions (nucleotide substitutions which result in an amino acid change) to be evaluated (Perler et a l . 1980). The number of potential s i lent and replacement substitutions are also determined. From these numbers the rates of divergence are calculated (Perler et al.,1980) and these rates are expressed as the percentage of the number of observed substitutions versus the number of potential substitutions and were corrected for multiple mutation events (Perler et a l . 1980). Comparison of the percentage s i lent and replacement substitutions between l o c i such as the RT1 B and D, or H-2 A ans E l o c i (Table 2) shows a large accumulation of mutations of both types. Furthermore, there is very l i t t l e difference between species in the values ref lect ing inter-locus mutation. These data support the view that the ancestral Class II gene duplicated into two l o c i ( ie RT1 B and D homologs) prior to the speciation of mammals. Comparison of the percentage s i lent substitutions for each domain (Table 3) among species is approximately 45 with two exceptions. The values for exon 2 (27.7%) and exon 4 (19.6%) in the comparison of RT1 to H-2 probably ref lects the low number of observed s i lent substitutions. The value for exon 2 (119.1%) in the RT1 to HLA comparison is l i k e l y due to multiple mutations at the same nucleotide position which would have accumulated over the 80 mi l l ion years since rodent and human diverged. When the RT1 B a or H-2 A a chain sequence is compared to that of the HLA 89 Table 2: Sequence Divergence of Class II a Chain Genes Percentage Corrected Divergence'" Si lent Sites Replacement Sites RTl Ba: H-2 Aa 29.6 9.8 RTl Ba: HLA-DQa 59.A 16.2 H-2 Aa: HLA-DQa 49.8 _ 17.4 RTl Ba: H-2 Ea 123.4 44.4 RTl Ba: HLA-DRa 109.8 39.1 H-2 Ea: HLA-DRa 70.1 15.7 RTl Ba: RTl Da 107.9 34.9 H-2 Aa: H-2 Ea 121.3 45.4 HLA-DQa: HLA-DRa 101.0 38.0 * The percentage corrected divergence of each pair of sequences was calculated as described by Perler et. a l . (1980) except that a l l three categories of substitutions were used for each weighted average. 90 Table 3: Sequence Divergence of Class II a Chain Genes by Exon Si lent Substitutions Replacement Substitutions Observed Potential Percent" Observed Potential Percent" RTlBa:H-2Aa exon 2 (al) 9 54 27.7 25 209 14. 3 exon 3 (a2) 10 61 46.4 15 220 7. 8 exon 4 (TM) 9 43 19.8 3 110 3. 2 overal l 26 159 29.6 43 539 9. 0 RTlBa:HLADQa exon 2 (al) 22 53 119.1 39 209 29. 6 exon 3 (a2) 16 61 44.1 28 220 14. 6 exon 4 (TM) 10 41 48.2 5 110 5. 3 overal l 47 157 59.4 72 539 17. 4 Percent" Percent corrected diverg calculated as described (Perler et ence for each a l . 1980). pair of sequences was 91 Figure 15: Plot of the percentage corrected divergence of MHC Class II a molecules versus evolutionary time. Values are taken from Table 1. S i l e n t s u b s t i t u t i o n s ( H ) , replacement s u b s t i t u t i o n s ( A ) . 92 DQQ i t is apparent that the accumulation of both replacement and s i lent substitutions is not l inear with evolutionary time and reaches a plateau (Figure 15). For example, after 8 mi l l ion years of evolutionary time, represented by a comparison of RT1 and H-2 sequences, there is an overal l rate of 9% for replacement substitutions and 29.6% for s i lent substitutions. After 80 mi l l ion years of evolutionary time, represented by a comparison of RT1 and HLA sequences, replacement substitutions have increased to only 17 percent and s i lent substitutions have increased to 59.4%. This strongly suggests that replacement substitutions can only be tolerated to a certain leve l before they are selected against. Alternat ive ly , i t has been proposed that rodents may be evolving more rapidly than humans perhaps due to increased opportunity for selection to act as a result of the shorter generation times of rodents (Wu and L i , 1985). A similar observation has been made in the analysis of the DNA sequence of the 3 chains encoded by the RT1 D, H-2 E , and HLA DR genes (Robertson and McMaster, 1985). B. DISCUSSION 1. Structure of the RT1 B Q Gene The organization of the RT1 B Q gene was determined by comparison of the genomic sequence to the cDNA sequence of pRIa.2 and pACD3. The gene is organized into 5 exons separated by 4 introns and encompassing about 5,000 nucleotides of DNA. The intron/exon structure of the RT1 B Q gene closely resembles that of a l l Class II a genes and is v i r t u a l l y ident ical to the H-2 E Q and HLA-DQa genes. Structural ly the Class II a genes vary primarily in the length and composition of each exon. A l l variations f a l l into one of two groups corresponding to the two Class II l o c i (RT1.B and RT1.D in ra t ) . For example the RT1 B Q and HLA-DQa genes 93 encode 23 residues of leader peptide and 5 amino acids of the a l domain in exon 1, whereas the H-2 E a and HLA-DRa genes encode a leader peptide of 25 amino acids and 2 residues of the a l domain (Mathis et al . ,1983). Thus the RT1 B Q and HLA-DQa genes are s tructural ly more related to each other than to the H-2 E Q or HLA-DRa genes, suggesting that the two Class II l o c i represented by the RT1 B Q and RT1 D a molecules diverged by gene duplication prior to the speciation of mammals. Further evidence for this duplication and i t s timing come from comparisons of the nucleotide sequences of the coding regions of the RT1, H-2, and HLA Class II a genes. Nucleotide substitutions, both s i lent and replacement, can be expressed as a rate of sequence divergence (observed substitutions/ potential substitutions) and ref lect the mutation rate between the two sequences (Perler, 1980). Table 2 summarizes the rates of divergence of DNA encoding Class II a genes. The largest number of both s i lent and replacement substitutions occurs between sequences encoded by different l o c i irrespective of species. For example, the rates of divergence for s i lent substitutions between H-2 A a :H-2 E a , HLA-DQ a:HLA-DR a, and RT1 B a : R T l D Q are 121.3%, 101.0%, and 107.9% respectively. The lowest rates are observed in comparisons of closely related species at the same locus (for example RT1 BQ:H-2 A Q ) . This data supports the view that the duplication event which created the two main Class II l o c i occurred before the speciation of mammals. Comparison of the predicted amino acid sequence of the RT1 B Q gene to that of the" H-2 A a and HLA-DQa genes (Table 1) shows a high degree of overal l sequence conservation. The RT1 B Q molecule shows protein sequence identity with the H-2 A a molecule at 85% of i t s residues, and with the HLA-DQa molecule at 73% of i t s residues. These values are 94 similar to those reported for comparisons of the Class II Ap and Ep proteins (Eccles and McMaster,1985; Robertson and McMaster,1985) and ref lect the evolutionary distance between rat , mouse, and man. There are differences in the levels of conservation of protein sequence when individual domains of Class II a molecules are compared. The amino acid sequence of the a l domain (residues 1-88) is the least conserved when the RTl B a molecule is compared to mouse and human (59%-80%). The concentration of the protein sequence variat ion in the a l domain suggests that this domain may be involved in antigen recognition by T-lymphocytes (see Class II Polymorphism below). The a2 domain (residues 89-182) shows a much higher level of sequence conservation (79%-84%) than the al domain (Table 1). This domain is as conserved between rodent and human (79% RTl B a :HLA-DQ a ) as between rat and mouse (84%) suggesting a functional constraint has prevented the divergence of this domain during the evolution of Class II a genes. The RTl B a chain has a number of highly conserved residues such as cysteines at positions 111 and 167 (which form a characterist ic disulphide loop), phenylalanine 117, tryptophan 125, aspartate 146, and tryptophan 182 which are a l l characterist ic of immunoglobulin constant region domains (Travers et al . ,1984). In addition there are a number of residues such as phenylalanine 149 and proline 159 which are conserved in MHC membrane proximal domains but are not found in immunoglobulin constant region domains (Lee et al. ,1982; Travers et al . ,1984). These highly conserved residues are l ike ly to be involved in maintaining the structure of the RTl B a molecule, and the immunoglobulin-like structure of the RTl B Q Class II molecule is consistent with the view that immunoglobulin and MHC proteins evolved from a common ancestral gene. 95 The transmembrane region of the RT1 B Q protein is the most conserved of a l l domains. Comparison of transmembrane sequences between rat and mouse shows 100% conservation of protein sequence. The transmembrane domain is also highly conserved between rat and human (90%). Similar levels of sequence conservation have been seen in comparisons of rodent and human Class II Ap (Eccles and McMaster,1985) and Ep (Robertson and McMaster,1985) molecules. The high degree of sequence conservation observed between RT1 B a , H-2 A a , and HLA-DQa transmembrane regions is unusual, and not seen in other membrane glycoproteins. Murine Class I H-2 K b and H-2 D b share identity at only 75% of transmembrane res i dues (Reyes et al.,1982) while H-2 K b and HLA-B7 have only 30% shared amino acid sequence in the transmembrane region (Coligan et al . ,1981). The transmembrane region is composed of a series of hydrophobic residues believed to form an ct-hel ical configuration which spans the l i p i d membrane (Travers et al . ,1984). The conserved nature of Class II a and Class II 3 chain transmembrane regions suggests that this region may mediate interactions between a and 3 chains within the membrane insuring that interactions such as RT1 B a and Dp do not occur. The lack of protein sequence conservation between RT1 B Q and D a molecules (69%) (Holowachuck,1985) and RT1 B Q and Dp (17%) supports this view. The cytoplasmic regions of the RT1 B Q molecule are also highly conserved when compared to the H-2 A Q and HLA-DQa molecules, showing 86% and 73% sequence identity respectively. The conservation of sequence in this region suggests functional importance for this domain, most l ike ly in interactions with cytoplasmic proteins. 96 Comparison of nucleotide sequences encoding e v o l u t i o n a r i l y r e l a t e d proteins can be used to c a l c u l a t e the rate of divergence between the sequences. Table 3 summarizes the rate of divergence of DNA encoding Class II a chains from r a t , mouse, and human, expressed as the percentage of s i l e n t and replacement s u b s t i t u t i o n s . The low number of replacement s u b s t i t u t i o n s observed i n a l l domains except the a l r e f l e c t s the high degree of sequence conservation discussed above. When the number of replacement s u b s t i t u t i o n s i s p l o t t e d against evolutionary time ( f i g u r e 15) i t i s apparent that replacement s u b s t i t u t i o n s do not accumulate l i n e a r l y . This s t r o n g l y suggests that replacement s u b s t i t u t i o n s have been s e l e c t e d against during ev o l u t i o n , and can only be t o l e r a t e d to a c e r t a i n l e v e l before they a f f e c t the function of the p r o t e i n . In contrast there are 2 to 3 times more replacement s u b s t i t u t i o n s i n the a l domain as in the r e s t of the molecule i n both the rat/mouse and rat/human comparisons. S e l e c t i o n appears to have favoured replacement s u b s t i t u t i o n s i n the a l domain. 2. The Promoter Region Examination of the 5' f l a n k i n g sequence of the RTl B Q gene (Figures 10 and 12) shows that t h i s gene contains a number of conserved nucleotide sequences c h a r a c t e r i s t i c of a l l eukaryotic promoters. Conserved sequences i d e n t i f y i n g the TATA box, and "cap" s i t e of i n i t i a t i o n of mRNA synthesis have been found i n a l l Class II genes examined (Mathis et al.,1983; Saito et al.,1983; Larhammar et al.,1983; Okada et al.,1985; Das et al.,1983; and Larhammar et al.,1985) and are known to be involved i n the r e g u l a t i o n of the i n i t i a t i o n of t r a n s c r i p t i o n (Breathnach and Chambon,1981). 97 Upstream from the TATA box are two blocks of sequence found to be conserved in the RTl B a gene and in a l l Class II genes examined (Saito et al . ,1983; Okada et al . ,1985). It is l i k e l y that these regions may be important in the regulation of transcript ion of Class II genes. The marked s imi lar i ty between these conserved regions in both a and 3 chain genes suggests that these sequences may be involved in the coordinate regulation of Class II gene expression (Coll ins et al . ,1984). The differences in the putative regulatory region between a and 3 genes appear to flank the 3' underlined element in Figure 12, and may account for the d i f f eren t ia l levels of a and 3 transcript production that have been reported (Germain et al . ,1985). The nucleotide spacing between the two elements of the putative regulatory region (underlined in Figure 12) of 19 or 20 nucleotides is reminiscent of the recombination signals of immunoglobulin genes (Early et al . ,1980). The spacing between the two elements is such that they would be separated by two turns of the DNA helix (10.4 nucleotides per turn) and therefore would be located on the same side of the DNA molecule available to interact with regulatory factors. In recent studies i t has been demonstrated that the expression of MHC Class II a and 3 genes involves a trans-acting factor or factors (de Preval et al. ,1985; Salter et al. ,1985; and Guardiola et al.,1986) which may possibly interact with the two sequence elements of the putative regulatory region. The putative CAAT box found at position -103 is atypical in both structure and location. In Class II 3 genes which have been sequenced the CAAT box is located between the TATA box and the conserved regulatory region (Larhammar et al. ,1985; G i l l i e s et al.,1984) whereas 98 many a genes do not have CAAT boxes (Das et al. ,1983; Larhammar et al . ,1983). Furthermore there is marked v a r i a b i l i t y in the distance between the cap s i te and the conserved regulatory region (-78 to -48 in the RT1 B Q gene) amongst a and f3 genes. A deletion may have occurred during the evolution of Class II a and B genes result ing in the deletion of the CAAT box in some a genes. Alternatively the CAAT box at -103 is not necessary for Class II a gene expression. 3. Polymorphism The study of polymorphism is important in understanding how i t has been generated and maintained throughout evolution, as well as i ts role in the control of protective immunological responses. The association of disease with various MHC a l l e l es makes the genetic polymorphism of the MHC useful in the diagnosis of disease suscept ib i l i ty , and may lead to a better understanding of the mechanisms of pathogenesis. Comparison of a l l e l i c Class II sequences local izes the polymorphic regions of the protein. Figure 13 shows a comparison of the RT1 B Q gene (haplotype R T l b ) and the RT1 B Q cDNA pRIa.2 (haplotype RT1 U ) . The al domains could not be compared as the cDNA pRIa.2 is incomplete (Wallis and McMaster,1984). The amino acid changes are few, and randomly distributed over the a2, transmembrane, and cytoplasmic domains of the protein. It is interesting that only one of the positions of a l l e l i c v a r i a b i l i t y in Figure 13 occurs at a position which shows a l l e l i c v a r i a b i l i t y in the mouse H-2 A a molecule (Benoist et al . ,1983). Class II a chain polymorphism has been local ized to the a l domain in mouse (Benoist et al. ,1983; Landais et al.,1986) and human (Gorski and Mach,1986). The close relationship between the RT1 B Q , H-2 A a , and HLA-99 DQQ molecules suggests that a l l e l i c polymorphism in the RT1 B a molecules would also be local ized in the a l domain. The 3' untranslated sequences of the RT1 B b and RT1 B£ a l le les are also highly conserved, showing identity at 98% of nucleotides. A similar value of 96% sequence identity is seen when the 3' untranslated sequences are compared between mouse H-2 A Q a l l e les (Benoist et al . ,1983). Comparison of 3' untranslated sequences between species shows that the RT1 B Q and H-2 A a genes are 95% homologous whereas the RT1 B Q and HLA-DQa genes are quite divergent (30% homology). The high level of 3' untranslated sequence conservation in rodents reflects the close evolutionary distance between rat and mouse. Conservation of non-coding DNA in Class I and Class II genes has been implicated in gene conversion and other non-reciprocal recombination events (Weiss et al. ,1983: Kourilsky et al . ,1983). The comparison of the nucleotide and predicted amino acid sequences of the RT1 B Q gene and H-2 A Q a l l e les (Benoist et al.,1983) in Figure 14 shows that over 50% of the interspecies amino acid differences occur at residues which show a l l e l i c v a r i a b i l i t y in the mouse H-2 A a molecule. Furthermore, the interspecies changes are clustered in two regions, residues 19-23 and 45-78. The regions of a l l e l i c v a r i a b i l i t y in the mouse A Q chain are residues 11-15 and 45-78 (Benoist et al . ,1983). Although Landais et a l . (1986) designate residues 11-15, 53-59, and 69-78 as a l l e l i c variables , examination of the highlighted residues in Figure 14 suggests that most of the a l l e l i c variat ion is spread over residues 45-78. The close association of regions of interspecies variation between the RT1 B Q and H-2 A Q antigens and regions of a l l e l i c variation in the mouse H-2 A Q antigen suggests that a l l e l i c polymorphism 100 in the RTl B Q molecule would also be local ized to residues 45 to 78 of the a l domain. Recent studies have shown that one region of the class II protein which allows phenotypic di f ferent iat ion of a l l e les by antibody comprises residues 43 to 71 (Wakeland et a l . 1985). Furthermore, this is the same region which is functionally recognized by T-lymphocytes (Germain et a l . 1985). It is clear that the region at position's 45 to 78 is of prime importance to the function of class II molecules. Many investigators have t r i ed to elucidate the molecular mechanisms which generate Class II polymorphisms. It has become apparent that no single mechanism is responsible, and in fact several mechanisms may act concomitantly. Comparison of the nucleotide sequences reported for a number of a l l e l i c Class II genes from human and mouse to the RTl B Q gene, described in this study, allowed the number of s i lent and replacement substitutions (substitutions which result in amino acid changes) to be evaluated. The results showed that despite the observed clustering of amino acid changes in the al and 31 domains of the protein, there was no evidence for a higher mutation rate in these parts of the molecules. Replacement substitutions appeared to be subject to negative selection pressures eliminating these substitutions from the second external domain, the transmembrane region, and the cytoplasmic region. In contrast the f i r s t external domain behaves as i f replacement substitutions were se lect ively neutral or perhaps even undergoing positive select ion. The authors conclude that Class II polymorphism could arise from random point mutations. Selective pressures would eliminate mutations causing replacement substitutions over the majority 101 of the molecule while allowing replacements to accumulate in the a l and 31 domains (Gustafsson et al . ,1984). Gene conversion has been demonstrated to generate polymorphism in MHC Class I and Class II molecules. Several authors have shown that the H-2 K b m l a l l e l e has been derived from a conversion event involving the Qa 2.3 gene locus as the donor sequence, and the H-2 Kp gene as the recipient (Mellor et al . ,1983; Weiss et al . ,1983). Similarly one a l l e l i c murine Class II 3 chain gene may have been derived by a gene conversion event. Comparison of the nucleotide sequences of the H-2 and H-2 revealed that the a l l e l i c variant H-2 AJ§m-'-2 resulted from a gene conversion in which the E^ gene was the donor and the Ap1 gene the recipient (Widera and Flavell ,1984; Mengle-Gaw et al . ,1984). This recombination event transferred 14 nucleotides from exon 2 of the Ep gene to exon 2 of the Ap gene (Widera and Flavell ,1984; Mengle-Gaw et al . ,1984). Recently gene conversion between two HLA-DRp l o c i has been shown to have resulted in a new HLA-DR spec i f i c i ty (Gorski and Mach,1986). These authors demonstrated that the HLA-DR3/Dw3 haplotype was the result of a conversion event between a segment of the 3 I H locus and the 31 locus, as donor and recipient respectively, of the HLA-DRw6/Dwl8 haplotype. The region of the protein involved in both l o c i was the 31 domain. It has been postulated that gene conversion can cause both the increase in sequence divers i ty and also the decrease in sequence divers i ty in affected genes (Klein and Petes,1981). Gene conversion can generate polymorphism between genes whose spontaneous mutation rate is higher than the conversion rate, whereas when the conversion rate is higher than that of spontaneous mutations, between the two genes, 102 sequence homogenization occurs (Klein and Petes,1981; Ernst et al . ,1981). For example the Bl domains of murine Class II 0 chain genes show a high degree of sequence variat ion indicating that selection is maintaining a high mutation rate. Therefore in this case gene conversion would be predicted to lead to the generation of further polymorphism. As described above gene conversion has c lear ly been shown to be responsible for Class II B chain polymorphism. Conversely, several authors have suggested that gene conversion is responsible for the lack of polymorphism seen in globin (Liebhaber et al.,1981) and immunoglobulin (Schrier et al. ,1981) genes. Interestingly there is no evidence for gene conversion as a source of polymorphism in Class II a genes. Gene conversion events between l o c i such as the RT1 B Q and D Q , or two a l l e l i c RT1 B a genes in a heterozygous wild animal could potential ly have made a l imited contribution to polymorphism, however no such conversions have been detected (Benoist et al . ,1983). The low leve l of polymorphism amongst H-2 E Q or RT1 D a al le les when compared to H-2 A Q or RT1 B Q a l l e les (Mathis et al. ,1983; Palmer,1985) led to the proposal that an i n t r i n s i c structural difference exists between these duplicated l o c i . This difference would allow s i te specif ic or region specif ic mutagenic events to occur. For example changes in chromatin structure may alter the access ib i l i ty of repair enzymes result ing in a higher apparent mutation rate in that region. Furthermore, selection could eliminate undesirable mutations or f ix others (Benoist et al . ,1983). Al len and colleagues have raised a series of monoclonal antibodies and T-lymphocyte clones reactive with one antigen associated with one Class II molecule. They were able to demonstrate that this protocol 103 generated a family of T - c e l l clones and monoclonal antibodies each reactive with a different determinant on the same molecular structure. It is clear that Class II molecules and antigen interact to produce a number of different determinants thereby increasing divers i ty (Allen et al . ,1985). Recombinational hot spots have also been ident i f ied in the I-A region of the murine MHC of wild mice. The unusually high number of crossover events occurring in the region between the A Q and E a l o c i suggests that this may be a mechanism of shuffling of sequences bearing different haplotypes in heterozygous animals (Steinmetz et al . ,1986). It is clear that there is no single mechanism for the generation of polymorphism in Class II genes. Random mutation is l i k e l y the main source of sequence d ivers i ty . Phenotypic selection w i l l conserve s tructural ly important residues, while allowing others to mutate freely. Gene conversion in some Class II genes, such as H-2 Ap (Mengle-Gaw et a l . , 1984), leads to further divers i ty by dispersing mutations through i n t e r a l l e l i c transfer of sequences. It is clear from the above discussion that the majority of the inter-species variat ion between the Class II a molecules of rat , mouse, and human resides in the a l domain. The high degree of overal l conservation of Class II genes structure and sequence and the demonstrated sequence v a r i a b i l i t y in certain regions of the a l domain is consistent with the view that conservative selection is acting on s tructural ly important residues while functionally important regions are undergoing posit ive selection for replacements generating polymorphism. 104 Chapter 5 STUDIES ON THE TRANSCRIPTION OF THE RTl Ba GENE A. RESULTS 1. Transcription of the Cloned RTl Ba Gene DNA mediated gene transfer has been used to study the structure, function, and regulation of expression of cloned Class II genes (Eccles et al.,1986;Germain and Malissen,1986). In order to eliminate problems with the serological d i f ferent iat ion of introduced and endogenous Class II molecules, as well as technical d i f f i c u l t i e s , c e l l l ines that do not express Class II molecules, such as the mouse f ibroblastoid L - c e l l l ine , have been used as recipients for cloned Class II genes. L -ce l l s have been successfully transfected with a number of mouse (Malissen et al.,1984) and rat (Diamond et al. ,1985; Eccles et al.,1986) Class II genes, and expression of Class II molecules detected on the c e l l surface. DNA mediated gene transfer experiments were carried out in order to determine whether the cloned RTl B Q gene contained in Lambda 7 could be transcribed. Lambda 7 DNA was transfected into thymidine kinase (TK) deficient mouse L-ce l l s by co-transfection with cosmid 21.3 DNA containing an RTl B | gene (Diamond et al.,1985) and plasmid DNA containing the Herpes Simplex Virus thymidine kinase gene using the Calcium phosphate procedure as described by Graham and Van der Erb (1973). L -ce l l s were also transfected with cosmid 13.1 DNA which contains both the RTl Bg and B | genes (Diamond et al. ,1985; Eccles et al . ,1986). Stable transfectants were selected for thymidine kinase expression in HAT medium, and L t k + colonies pooled and maintained in 105 culture. For each experiment a fraction of the L t k + pool was plated at a density such that well separated colonies resulted. Individual colonies were then trypsinized and transferred to microtitre tissue culture dishes. Several colonies from each experiment were isolated in this way clonal populations of each were grown and maintained in culture. C e l l surface expression of transfected RT1 B genes was analyzed using the monoclonal antibody MRC 0X6 directed against non-polymorphic determinants on a l l rat RT1 Class II Bp molecules (McMaster and Williams,1979). The level of rat Class II c e l l surface expression was evaluated by indirect binding assay. L - c e l l pools or clones were incubated with saturating levels of MRC 0X6, washed, and incubated with saturating levels of o r YITC (Fluorescein iso-thiocyanate) labelled second antibody reagent. The amount of antibody bound was then determined by Gamma counting or fluorescence activated c e l l analysis . Table 4 shows the results of a typ ica l transfection experiment. Pooled and clonal populations of ce l l s were labelled with MRC 0X6 and iodinated second antibody. The results show that the pooled populations of L-ce l l s transfected with cosmid 13.1 DNA express c e l l surface RT1 B Q molecules on at least some of the ce l l s in the population. Furthermore, these ce l l s express RT1 B Q molecules at high levels . In L-ce l l s transfected with Lambda 7 and cosmid 21.3 DNA no c e l l surface expression of RT1 B Q molecules could be detected. Figure 16 shows the analysis of another transfection experiment using a Fluorescence Activated C e l l Sorter (FACS IV). Pooled populations of transfectants selected for thymidine kinase expression were labelled with antibody as described above and analyzed on the FACS IV c e l l 106 o E QJ o cn o A F luo rescence Intensi ty A B C Figure 16: FACS p r o f i l e s of I l -e a l Is t r a n s f e c t e d with RTl.B genes. A: Untransfected L-c e l l s l a b e l l e d with the rat s p e c i f i c monoclonal antibody W3/13 (McMaster and Williams, 1979) as a negative c o n t r o l . B: L - c e l l s t r a n s f e c t e d with cosmid 13.1 DNA (RTl B|) l a b e l l e d with the r a t c l a s s II s p e c i f i c monoclonal antibody MRC 0X6. A s i g n i f i c a n t number of these c e l l s show increased fluorescence i n d i c a t i n g c e l l surface Class II gene expression. C: L - c e l l s t r a n s f e c t e d with lambda 7 DNA (RTl B£) and cosmid 21.3 DNA (RTl Bg) l a b e l l e d with MRC 0X6. No s i g n i f i c a n t increase i n fluorescence i s seen i n d i c a t i n g the absence of c l a s s II molecules on the surface of these c e l l s . 107 Table 4: Expression of Class II Genes on Transfected Ltk Cells Cel ls Antibody a Gene 3 Gene Counts(cpm) Ltk" none - 3,016 Ltk" aH-2 k - 30,824 pool A MRC 0X6 cos 13. 1 cos 13. 1 10,112 clone A- 1 MRC 0X6 cos 13. 1 cos 13. 1 36,172 clone A-•2 MRC 0X6 cos 13. 1 cos 13. 1 22,374 clone A-•3 MRC 0X6 cos 13. 1 cos 13. 1 3,314 pool B MRC 0X6 Lambda 7 cos 21. 3 7,960 clone B-•1 MRC 0X6 Lambda 7 COS 21. 3 1,114 clone B- 2 MRC 0X6 Lambda 7 COS 21. 3 5,488 clone B-•3 MRC 0X6 Lambda 7 cos 21. 3 2,530 clone A-•1 W3/13 cos 13. 1 COS 13. 1 7,760 clone B- 1 W3/13 Lambda 7 COS 21. 3 3,314 F i r s t antibodies used: cxH-2K, mouse anti-mouse MHC Class I antibody which detects molecules expressed on the surface of a l l mouse ce l l s (used as a posit ive control); MRC 0X6, detects rat Class II genes expressed on the c e l l surface; and W3/13 (Williams et al . ,1979), which detects non-Class II molecules found on rat T-lymphocytes but not on rat B-lymphocytes (used as a negative control) . The second antibody was Rabbit anti-mouse IgG antibody labelled with radioactive iodine (^^I) . 108 sorter. Populations of ce l l s transfected with cosmid 13.1 DNA contain ce l l s which express high levels of RT1 B a molecules, and these ce l l s account for about 50% of the to ta l TK+. population. In populations of ce l l s transfected with Lambda7 and cosmid 21.3 DNA no sub-population of ce l l s expressing RT1 B molecules could be detected. Figure 17 shows a Southern blot of high molecular weight DNA isolated from transfected L - c e l l s , and hybridized with radioactively labelled RT1 B Q probe (pRIa.2 cDNA). The probe detects the single endogenous copy of the homologous H-2 A Q gene in the untransfected L-c e l l genome (the 8,000 nucleotide band in Lane A). DNA isolated from Clone 1 ce l l s transfected with cosmid 13.1 DNA shows strong hybridization with the RT1 B a probe (lane C). Comparison of the intensity of these bands to those in Lanes D, E , and F (digests of isolated cosmid 13.1 DNA) suggests that Clone 1 ce l l s have many copies of the RT1 B a gene integrated into i t s genome. In contrast L-ce l l s transfected with Lambda 7 and cosmid 21.3 DNA show two bands of approximately 8,000 nucleotides corresponding to the Lambda 7 encoded RT1 B Q gene. Furthermore, the intensity of these bands is s imilar to that of the endogenous RT1 B Q gene of L - c e l l s , suggesting that ce l l s transfected with Lambda 7 DNA have one or two copies only integrated into their genomes. Northern blot analysis (Figure 18) using a RT1 B a probe (pRIa.2 cDNA) of RNA isolated from the two clones of L-ce l l s transfected with Lambda 7 and cosmid 21.3 DNA showed a single band of 1,100 nucleotides. The a chain transcript of the Lambda 7 RT1 B b gene from these two 109 A B C DEF Figure 17: Southern b l o t a n a l y s i s of high molecular weight DNA i s o l a t e d from transfected L - c e l l clones. Approximately 2.0pg of DNA was digested with the r e s t r i c t i o n enzyme EcoRl, electrophoresed on a 1% agarose g e l , t r a n s f e r r e d to Genescreen and hybridized with an RT1 B a gene probe (pRIa.2 cDNA). Lane A: Untransfected L - c e l l DNA, Lane B: DNA from L-c e l l s t r a n s f e c t e d with Lambda 7 and cosmid 21.3 DNA, Lane C: Clone 1 DNA ( L - c e l l s t r a n s f e c t e d with cosmid 13.1 DNA), Lane D: Cosmid 13.1 DNA digested with EcoRl (5ug), Lane E: Cosmid 13.1 DNA digested with EcoRl ( l O i i g ) , and Lane F: Cosmid 13.1 DNA digested with EcoRl (15ug)- Lanes A and B are 5 day exposures, whereas Lanes C,D,E, and F are 8 hour exposures. 110 1/lkb Figure 18: Northern blot analysis of RT1 Ba chain RNA. Total RNA (20 Mg) was hybridized with the RT1 B" cDNA insert of pRIa.2. RNA from: (a) L c e l l s ; (b) rat spleen; (c) L c e l l s transfected with cosmid 13.1 (RT1 B^Bg); (d) L c e l l s transfected with lambda 7 (RT1 B b) and cosmid 21.3 (RT1 B^) clone a ; (e) same as d except clone b. I l l clones (Lanes D and E) was indistinguishable from that of the RT1 gene of cosmid 13.1 (Lane C) and of rat spleen to ta l RNA (Lane B). Thus the RT1 B b gene of Lambda 7 is e f f i c i ent ly transcribed when transferred to L - c e l l s . B. DISCUSSION DNA mediated gene transfer is a powerful tool in the study of the regulation of gene transcript ion. Cloned DNA can be introduced into a variety of different c e l l l ines to examine the effects of c e l l type and stage of d i f ferent iat ion on transcript ion. Manipulations of the cloned DNA, such as deletion or mutation of specif ic residues, allows the analysis of promoters, enhancers, and transcript processing when the altered genes are introduced into a c e l l l ine which does not endogenously transcribe the gene. Class II genes from rat (Eccles et al. ,1986; Diamond et al.,1985) and mouse (Malissen et al.,1984) have been introduced into the mouse L-c e l l f ibroblastoid c e l l l ine which does not transcribe endogenous Class II genes. Expression of Class II antigens on the c e l l surface has been shown to be d irec t ly proportional to the amount of Class II transcript within the c e l l , suggesting that the primary level of control of Class II gene expression is transcript ion (Germain and Malissen,1986). Thus c e l l surface expression of Class II antigens can be used to evaluate transcript ional ac t i v i ty in addition to Northern blot analysis. DNA mediated gene transfer was used to introduce Lambda 7 DNA encoding an RT1 B b gene into mouse L - c e l l s . A number of studies have demonstrated a requirement for a/S dimers in the c e l l surface expression of Class II molecules (Malissen et al. ,1983; Murphy et al . ,1980). Therefore Lambda 7 DNA was co-transfected with cosmid 21.3 DNA which 112 encodes an RTl Bg molecule (Diamond et al . ,1985). As a control , L -ce l l s were also transfected with cosmid 13.1 DNA which encodes RTl B^ B | molecules, and has been successfully introduced into L-ce l l s previously (Eccles et al . ,1986). As described above, one approach to evaluating the transcr ipt ional ac t iv i ty of Class II genes introduced into Class II" c e l l l ines is to analyze c e l l surface expression. L -ce l l s transfected with RTl B genes were analyzed using a monoclonal antibody directed against determinants on the RTl Bp chain. Table 4 and Figure 16 show the results of typica l transfection experiments. L - c e l l s transfected with Lambda 7 and cosmid 21.3 DNA have no detectable RTl B Q antigen on their c e l l surface, whereas L-ce l l s transfected with cosmid 13.1 DNA clear ly have detectable RTl B a molecules expressed on their c e l l surface. L - c e l l s transfected with RTl B a genes were analyzed by Southern Blot hybridization with an RTl B a gene probe. Cel ls transfected with cosmid 13.1 or Lambda 7 DNA were shown to contain copies of the RTl B Q gene, however ce l l s transfected with cosmid 13.1 DNA appear to have many copies of the RTl B a gene integrated into their genome whereas ce l l s transfected with Lambda 7 DNA contain only one or two copies. Northern blot analysis of L -ce l l s transfected with RTl B Q genes is shown in Figure 18. The RTl B Q genes contained in Lambda 7 and cosmid 13.1 are c lear ly transcribed when introduced into L - c e l l s , and the transcript is indistinguishable from the RTl B a gene of rat spleen ce l l s . The primary form of regulation at the protein level appears to be the requirement for the correct association of a and 0 chains in the cytoplasm before they can be expressed on the c e l l surface. Studies 113 involving the introduction of cloned Class II genes into ce l l s which are Class I I + or Class II" c learly show the requirement for both chains in order to get c e l l surface expression. Cloned H-2 genes were transfected into a murine lymphoblastoid c e l l l ine which expresses H-2^ Class II molecules. Immunoprecipitation of c e l l surface proteins using an ant i -H-2 k monoclonal antibody showed that A^ molecules were only expressed in association with A^ molecules (Germain et al. ,1983; Ben-Nun et al . ,1984). Transfection of cloned murine (Malissen et al. ,1984; Norcross et al.,1984) and human (Rabourdin-Combe and Mach,1983) into mouse L - c e l l s , which express no endogenous Class II molecules, showed that c e l l surface expression only occurred when suitable a and 3 chains were avai lable . That is to say in no case were a or 3 chain molecules detected alone on the membranes of transfected ce l l s . The fa i lure of L -ce l l s transfected with the RTl B Q gene encoded by Lambda 7 to express RTl B a molecules on their c e l l surface despite the e f f ic ient transcript ion of the gene could be due to a number of reasons. The most obvious reason for the absence of c e l l surface RTl B molecules is the absence of a functional 3 chain. Although Lambda 7 was always co-transfected with the cosmid 21.3 which contains an RTl Bg gene (Diamond et al. ,1985) the cosmid may not have been integrated into the L - c e l l genome, or a mutation may have occurred preventing e f f ic ient transcript ion. As this .study was primarily concerned with the transcript ional ac t iv i ty of the RTl B b gene cosmid 21.3 was not investigated further. Immunoprecipitation of in t ra -ce l lu lar a or 3 chains using monoclonal antibodies co-precipitates a third glycoprotein termed the invariant chain ( l i)(Jones et al . ,1979). This non-polymorphic, non-MHC 114 encoded protein has not been detected on the c e l l surface (Sung and Jones,1981) and has been shown to be induced by interferon (Koch et al . ,1984). These data suggested that the invariant chain plays a role in the assembly of Class II molecules. Recent studies using functional murine (Germain and Malissen,1986) and rat (Eccles et al.,1986) Class II a and 0 genes and c e l l l ines which express no endogenous invariant chain genes showed that transfected c e l l l ines were capable of expressing Class II genes in the absence of I i molecules. The invariant chain does not appear to be required for Class II expression, however i t may aid in the cytoplasmic assembly of Class II molecules. In this study L-ce l l s transfected with cosmid 13.1 DNA have multiple copies of exogenous RTl B a genes integrated into their genome. It is possible that excess copies of Class II genes can overcome the normal regulatory mechanisms which function on single copy genes. The absence of invariant chains cannot be ruled out as a mechanism for the lack of expression of RTl B Q molecules on the c e l l surface of Lambda 7 transfected L - c e l l s . The in trace l lu lar levels of a and 0 chain molecules, as reflected by transcript levels , also play a role in expression of Class II molecules. Germain and colleagues (1985) have transfected murine Class II a and 0 genes into L-ce l l s and examined c e l l surface expression. Haplotype matched genes pairs (A kA^) resulted in high levels of expression in primary transfectants whereas haplotype mismatched gene pairs (A^A^) did not. Further analysis showed that higher levels of transcript (part icu lar ly A a transcript) were required to achieve expression of haplotype mismatched gene pairs . Recombinant Class II molecules containing the A01 domain of one a l l e l e and the remainder of the molecule from a second a l l e l i c 0 chain were used in similar studies 115 to map the region of the Class II molecule control l ing inter-chain assembly to the 31 domain. The transfection experiment involving Lambda 7 (RT1 Bb) and cosmid 21.3 (RT1 Bp1) is c lear ly a haplotype mismatched s i tuat ion. Figure 18, however shows that L -ce l l s transfected with Lambda 7 DNA have RT1 Bg transcript levels equivalent or s l i gh t ly lower than those found in L-ce l l s transfected with cosmid 13.1 DNA, which is a haplotype matched s i tuat ion. Thus RT1 B b transcript levels may be insuff ic ient for c e l l surface expression of RT1 B b molecules in this haplotype mismatched s i tuat ion. Germain and Q u i l l (1986) have also examined the control of isotype selection in the assembly of Class II molecules. Cloned murine Class II genes were transfected into mouse L-ce l l s in mixed isotype gene pairs ( eg. AaEp) and c e l l surface expression examined. Unexpectedly these authors found that Ap^ could not pair with E^/k molecules whereas A$ and E°[/k could pair . Since the N-terminal domain of the Ap molecule contains the bulk of the i n t e r - a l l e l i c variat ion the function of isotype pairing was assigned to this region. Clearly the polymorphic a l and 31 domains of Class II molecules regulate the association of a and 3 chains thereby also regulating the c e l l surface expression of Class II molecules. 116 Chapter 6  GENERAL DISCUSSION Serological studies have assigned Class II molecules an essential role in immune function, and there is a considerable amount of information concerning the molecular mechanisms by which Class II molecules control immune responses. Recombinant DNA technology has made i t possible to examine the genetic structure and organization of Class II genes and i t s relationship to the evolution, polymorphism, and expression of these genes. Determination of the structure of the Class II genes and the glycoproteins they encode has revealed a number of highly conserved amino acid residues. A l l Class II genes contain conserved regions centering on two cysteine residues (residues 111 and 167 in the RTl B b molecule) in the membrane proximal domain which are thought to form an intrachain disulphide loop characterist ic of immunoglobulin constant region domains (Travers et al . ,1984). MHC Class I molecules, Thy-1 antigen molecules, and 32-microglobulin molecules also contain these characterist ic conserved residues (Travers et al. ,1984) suggesting that these molecules evolved from a common ancestral gene (Hood et al . ,1983). Kaufman and colleagues (Kaufman et al.,1984) have proposed that the members of the so cal led immunoglobulin supergene family evolved from an ancestral gene which closely resembles the contemporary Class II 0 chain genes. Figueroa and Klein have proposed an evolutionary scheme for the Class II genes of mouse and human (Figueroa and Klein,1986). The determination of the nucleotide sequence of the RTl B a , RTl Bp (Eccles and McMaster,1985), RTl Dp (Robertson and McMaster,1985) and RTl D Q Human Mouse Rat DP DZ DQ DR ftl al ft) a l ft a fl'l a ! ft\ a l /il (11 f:i a A' X A E /?1 ftl ft] a ft\ ftl Q ft a ft \ a ft a ft\a ft \ a ft lift a ft a ft a ft | a Ef B D / J ? « ft] ftl a fl a ft a Figure 19: Postulated evolution of Class II MHC genes. Each rectangle represents one gene. Crossed rectangles i n d i c a t e deleted genes. Arrows show the d i r e c t i o n of t r a n s c r i p t i o n 5' to 3'. (adapted from Figueroa and Klein,1986). 118 (Holowachuck,1985) genes, has allowed the rat to be added to the evolutionary scheme as shown in Figure 19. The ancestral gene duplicated early in evolution to form the elements from which the a and 3 genes have evolved. The duplication event may have occurred twice, once giving r i se to the ancestors of the H L A -DP locus through an inversion duplicat ion, and once giving r i se to the ancestral a and 3 genes of the main evolutionary lineage through a tandem duplication. The ancestors of the three contemporary Class II l o c i were formed by further duplications of the 3"Ct unit prior to the speciation of mammals. Class II evolution continued through further duplication of the 3~a unit followed by mutation and deletion of some genes. Although multiple a and 3 genes have been demonstrated for each Class II locus only the a l and 31 genes at each locus are known to be functional in ra t , mouse, and human (Figueroa and Klein,1986). Clearly the evolutionary relationships between the RT1 B a gene and i t s murine and human homologs determined in this study contribute s ign i f i cant ly to the overal l understanding of Class II gene evolution. The extreme serological and functional polymorphism of Class II antigens depends on v a r i a b i l i t y in the primary structure of the protein (Kaufman et al . ,1984). Comparison of nucleotide and predicted amino acid sequences of a number of H-2 A Q chain molecules showed that s tructural polymorphism is confined to two subregions (residues 11-15 and 45-78) of the a l domain (Benoist et al . ,1983; and Landais et al . ,1986). A similar comparison of the a l l e l i c rat RT1 B b gene and the RT1 B£ C D N A pRIa.2 (which encodes the a2, transmembrane, cytoplasmic, and 3' untranslated domains; Wallis and McMaster,1984) showed that the protein sequences of i i y these a l le les are highly conserved (Figure 13). This suggests that any s ignif icant polymorphism must reside in the a l domain. When the structure of the RT1 B a and H-2 A a genes are compared (Figure 14) i t was apparent that these molecules were highly homologous. The RT1 B Q and H-2 A Q molecules share sequence identity at 85% of residues, whereas H-2 A Q a l l e les share identity at 89% of residues (Benoist et al . ,1983). There are two regions of interspecies sequence v a r i a b i l i t y (residues 19-23 and 45-78) one of which corresponds exactly to a region of a l l e l i c v a r i a b i l i t y (residues 45-78) in the mouse H-2 A Q molecule. The close association of regions of interspecies and a l l e l i c v a r i a b i l i t y at residues 45 to 78 suggests a role for polymorphism in this region in the function of Class II a molecules. Furthermore amino acid changes introduced into this region profoundly a l ter the serological properties of the molecule identifying residues 45 to 78 as functionally important (Wakeland et al . ,1985). Despite the extreme polymorphism of Class II a chain molecules, s tructural comparisons across species reveal that these molecules are highly conserved. A plot of amino acid changes (replacement substitutions) against evolutionary time (the sequence divergence between rat and mouse represents 8 mi l l ion years of evolution whereas the divergence between rodent and man represents 80 mi l l ion years) shows that replacement substitutions do not increase l inear ly with evolutionary time but reach a plateau (Figure 15). This strongly suggests that conservative selection is acting to maintain the structure of Class II a chains. In contrast Table 3 shows that the amino acid sequence of the a l domain is not nearly as conserved as in the rest of the molecule. This data suggest that conservative selection acts on 120 residues (Gustafsson et al.,1984) and posit ive selection for replacement substitutions acts on others. In this way polymorphism can be maintained throughout evolution while conserving the overal l structure of. the molecule. Class II gene expression has been shown to be d irec t ly proportional to the Class II mRNA content of the c e l l , suggesting that transcript ion is the primary level of control for Class II genes (Germain and Malissen,1986). Dissection of the structure of Class II molecules also provides insight into the control of expression of the genes encoding these molecules. Class II genes, l ike most eukaryotic genes, contain a number of highly conserved sequences important for the correct i n i t i a t i o n of transcript ion. The conserved sequences identifying the CAAT box, TATA box, and "cap" s i te have been found in the RT1 B Q gene and several other Class II a and 0 genes from rat (Eccles and McMaster,1985), mouse (Mathis et al . ,1983; Saito et al. ,1983; Larhammar et al . ,1983), and human (Okada et al . ,1985; Das et al. ,1983; Larhammar et al . ,1985). Furthermore, these sequences are known to be involved in the regulation of i n i t i a t i o n of transcript ion (Breathnach and Chambon, 1981). Comparison of the rat RT1 B Q gene to a number of Class II genes revealed a highly conserved element found in the 5' flanking sequences of a l l a and 0 chain genes (Saito et al . ,1983). This element is located 70 to 140 nucleotides 5' to the s i te of transcript i n i t i a t i o n , and consists of 10 and 14 nucleotide sequences separated by 19 or 20 nucleotides. Features of these elements allow those from a and 0 chain genes to be dif ferent iated, although the element is highly homologous in both genes (Okada et al . ,1985). The duplication of the primordial Class 121 II gene into a and 3 genes is thought to be the f i r s t step in the evolution of Class II genes (Klein , 1986). Therefore the conservation of this structure between the evolutionari ly distant a and 3 genes has been suggested to be involved in the coordinate regulation of a and 3 gene transcription (Saito et al . ,1983). Mice of the H-2 E b or E§ haplotypes do not express Class II E molecules on their c e l l surfaces. Northern blot analysis determined that non-expression was due to the absence of E Q gene transcript . Further characterization revealed a 600 nucleotide deletion encompassing most of the f i r s t exon and at least 200 nucleotides of the promoter region. The correlation of lack of transcript ion with the absence of the promoter element, CAAT box , and TATA box c lear ly suggests these sequences are important in the regulation of transcript ion (Mathis et al . ,1983). Studies involving the construction of recombinant plasmids containing 2.7kb of 5' flanking sequence from the H-2 E^ mouse gene linked to a selectable marker (xgpt; expression of this gene allows growth in the presence of mycophenolic acid) have allowed the ident i f icat ion of tissue specif ic enhancer elements in Class II genes. These constructs were transfected into B - c e l l lymphoma c e l l s , myeloma c e l l s , or L-ce l l s and the drug resistant colonies counted. More colonies, ref lect ing a higher level of xgpt gene transcript ion, were seen in the Class 11+ B lymphoma c e l l s , suggesting the presence of a tissue specif ic enhancer element or elements in the 5' sequences of Class II genes. Further analysis has local ized the element or elements to the -600 to -2,000 region of the E$ gene ( G i l l i e s et al . ,1984). Introduction of the H-2 E | gene complete with 2,000 nucleotides of 5', and 1,400 nucleotides of 3' flanking sequence into 122 (C57Bl/6xSJL)Fl mice has also demonstrated enhancer elements in E Q genes. These F l mice do not transcribe their endogenous E Q genes due to deletions in the E Q promoter regions. Introduction of an E^ gene by DNA mediated gene transfer restored the c e l l surface expression of the H-2 E molecules to levels comparable to the H-2 A molecules (Lemeur et al. ,1985; Yamamura et al . ,1985). The P388D1 mouse macrophage c e l l l ine expresses no detectable Class II molecules on i t s c e l l surface. Addition of y interferon to the growth media induces the expression o f H-2 A d and E d Class II molecules after several days. Furthermore, introduction of a cloned H-2 E^ gene by gene transfer techniques, followed by -y interferon treatment led to the expression of A d A ^ , E d E ^ , and EDEJ§ molecules. Clearly interferon stimulation results in the coordinate regulation of transcript ion of Class II genes (Folsom et al . ,1984). Other compounds such as prostaglandins (Snyder et al . ,1982), glucocorticosteroids (Aberer et al . ,1984), and lipopolysaccharide bacterial toxins (Steeg et al.,1982) have been shown to suppress Class II gene transcript ion, and therefore expression on macrophages. Tissue specif ic trans-acting factors have also been implicated in the regulation of Class II gene expression. Early studies on the human B-lymphoid c e l l l ine (B-LCL) showed that these ce l l s had untranscribed but s tructural ly intact a l l e l i c HLA-DR1 and HLA-DR3 Class II genes. Fusion of these Class II defective ce l l s with another B-lymphoid c e l l l ine which expresses HLA-DR2 antigens on i t s c e l l surface restored the expression of the HLA-DR1 and DR3 molecules on the surface of the fusion products. The authors concluded that the defect in the B-LCL c e l l l ine must be in some trans-acting transcription factor contained in the 123 second c e l l l ine (Gladstone and Pious, 1980). One form of congenital severe combined immunodeficiency (SCID) is also characterized by the absence of Class II gene products expressed on the surface of patient lymphocytes. Southern and Northern hybridization studies showed that the HLA-DR, DQ, DP, a, and 3 genes were a l l s tructural ly intact but none were transcribed in these patients. Interferon y» a known inducer of Class II gene expression, did not a l lev iate the global block in Class II transcript ion. Family studies showed that this condition was inherited as an autosomal recessive t r a i t , however the t r a i t did not segregate with the HLA. In one family with two children with ident ical MHC haplotypes one ch i ld has SCID while the other "does not. In a second family two affected s ibl ings have different MHC haplotypes (de Preval et a l . , 1985). The authors conclude that these patients are defective in a trans-acting factor which controls the expression of a l l Class II genes. This factor is unlinked to the MHC, and the factor controls a function or product essential for the action of y interferon on Class II genes. Recent studies have provided more direct evidence for the role of trans-acting factors in the control of Class II gene expression. Guardiola and colleagues (1986) have studied the Raji human B-lymphoma c e l l l ine which expresses high levels of Class II gene products. Mutagenesis and immunoselection resulted in a variant c e l l l ine which did not express HLA-DR, HLA-DQ, or HLA-DP molecules due to a block at the level of transcript ion. Fusion of these ce l l s with Class II posit ive mouse B-lymphoma ce l l s restored the expression of the human Class II genes and their products. Analysis of the fusion products by hybridization with probes for various mouse chromosomal markers suggested that the gene encoding the trans-acting factor was located on 124 Figure 20: Model f o r the re g u l a t i o n of Class II gene expression. Non-MHC encoded genes produce t r a n s - a c t i n g f a c t o r ( s ) which coord i n a t e l y regulates the t r a n s c r i p t i o n of both Class II a and B genes by binding to the conserved elements i n the 5' f l a n k i n g sequences of both genes. Class II t r a n s c r i p t s are t r a n s l a t e d and in s e r t e d into the c e l l membrane to form f u n c t i o n a l c l a s s II molecules expressed on the surface of the c e l l . Factors such as prostaglandins and # i n t e r f e r o n may act on the trans-a c t i n g f a c t o r ( s ) or the gene(s) encoding them to mediate Class II gene expression. 777X • gamma Interferon Trans-acting f a c t o r gene Class II gene Conserved elements i n the 5 ' f l a n k i n g sequence mRNA t r a n s c r i p t Trans-acting f a c t o r 125 mouse chromosome 16. In Class II" Raji ce l l s have been transfected with genomic DNA isolated from I a + murine B-lymphoma c e l l s . Transfectants with restored human Class II gene expression have been shown to contain stably integrated mouse DNA. These data strongly suggest that trans-acting factors are required for Class II gene expression, and that the specif ic gene or genes w i l l soon be ident i f ied . Figure 20 i l lus tra tes a model for the control of Class II gene expression. The highly conserved elements in the 5' flanking sequence ident i f ied in the RTl B a gene and in a l l Class II genes are l i k e l y targets for trans-acting factor(s) . The control of transcript ional ac t iv i ty by a trans-acting factor(s) regulates the expression of Class II molecules on the c e l l surface. Although some regulation of Class II expression can occur at the protein level (discussed in Chapter 5) the primary level of control appears to be at the level of transcript ion. Other factors such as y interferon and prostaglandins which are known to induce Class II gene transcript ion may act in a synergistic manner with a trans-acting factor(s) or possibly in the regulation of trans-acting factor gene expression. In summary, the addition of the RTl B Q nucleotide sequence to the l i s t of known Class II gene sequences has provided evidence supporting Figueroa and Kle in 's model for the evolution of Class II genes. In addition comparison of the structure and sequence of the RTl B Q gene to other Class II a genes has local ized interspecies variat ion to the a l domain. Furthermore these regions coincide with the known functionally polymorphic residues ident i f ied in a l l e l i c mouse sequences, and posit ive selection appears to favour replacement substitutions in this region. In 126 contrast s t r u c t u r a l l y important residues have been hi g h l y conserved during the e v o l u t i o n of Class II a genes. F i n a l l y , sequence a n a l y s i s has i d e n t i f i e d a promoter element i n the 5' f l a n k i n g sequence of the RTl B a and a l l Class II genes which may be the target f o r f a c t o r s involved i n the r e g u l a t i o n of Class II gene expression. 127 REFERENCES Aberer, W., S t ing l , L . , Pogantsch, S. , and St ing l , G . : Effects of glucocorticosteroids on epidermal cell- induced immune responses. J.Immunol. 133:792-803, 1984. Al l en , P . M . , McKean, D . J . , Beck, B . , Sheff ie ld, J . , and Glimcher, L . H . : Direct evidence that a class II molecule and a simple globular protein generate multiple determinants. J.Exp.Med. 162:1264-1274, 1985. Al l en , S . L . : Linkage re lat ion of the genes histocompatibil ity-2 and fused t a i l , brachyury and kinky t a i l in the mouse as determined by tumour transplantation. Genetics 40:627-650, 1955. Amerding, D . , Katz, D . H . , and Benacerraf, B . : Immune response genes in inbred r a t s . I . Analysis of responder status to synthetic polypeptides and low doses of Bovine Serum Albumin. Immunogenetics _1: 329-339, 1974. Ashwell, J . D . , and Schwartz, R . H . : T - c e l l recognition of antigen and the l a molecule as a ternary complex. Nature 320:176-179, 1986. Amos, D . B . , Gorer, P . A . , and Mikulska, Z . B . : An analysis of an antigenic system in the mouse. Proc.R.Soc.Lond.Ser B 144:369-371, 1955. 128 Auffray, C , L i l l i e , J .W. , Arnot~i D . , Grossberger, D . , Kappes, D . , and Strominger, J . L . : Isotypic and a l lo typic variat ion of human class II histocompatibil ity antigen a chain genes. Nature 308:327-329, 1984. Bach, F . H . , and Amos, D . B . : HU-1: Major histocompatibil i ty locus in man. Science 156:1506-1508, 1967. Bain, B . , and Lowenstein, L . : Genetic studies on mixed lymphocyte reactions. Science 145:1315-1316, 1964. Barnstable, C . J . , Jones, E . A . , and Bodmer, W.F.: Genetic structure of Major Histocompatibil ity regions. Intl.Rev.Biochem. 22:151-225, 1979. Baxevanis, C . N . , Wernet, D . , Nagy, Z . , Mauer, P . H . , and K l e i n , J . : Genetic control of T pro l i ferat ive responses to poly(GluAla) and poly(GluLysTyr): Subregion-specific inhib i t ion of the responses with monoclonal la antibodies. Immunogenetics 1_1:617-620, 1980. Benacerraf, B . , and McDevitt, H .O. : Histocompatibility linked immune response genes. Science 175:273-276, 1972. Benoist, C . , Mathis, D.y Kanter, M . , Williams, V. and McDevitt, H. : Regions of a l l e l i c hypervariabi l i ty in the murine Aa immune response gene , C e l l 34:169-177, 1983. 129 Ben-Nun, A . , Glimcher, L . H . , Weiss, J . , and Seidman, J . G . : Functional expression of a cloned I~Apk gene in B-lymphoma ce l l s . Science 223:825-828, 1984. Birnboim, H . C . , and Doly, J . : A rapid alkal ine extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7.: 1513-1516, 1979. Blankenhorn, E . P . , and Cramer, D . V . : Orientation of the l o c i encoding RT1 B polypeptides in the MHC of the rat . Immunogenetics 21:135-142, 1985. Blankenhorn, E . , Symington, F. and Cramer, D. : Biochemical characterization of l a antigens encoded by the RT1.B and RT1.D l o c i in the rat . Immunogenetics L7:475-484, 1983. Blankenhorn, E . P . , Cecka, J . M . , Gotze, D . , and Hood, L . : Par t ia l N-terminal amino acid sequence of rat transplantation antigens. Nature 274:90-92, 1978. Blattner, F . R . , Williams, W.G., Blechl , A . E . , Denniston-Thompson, K . , Faber, H . E . , Furlong, L A . , Grunwald, D . J . , Keifer , D . O . , Moore, D .D. , Schumm, J .W. , Sheldon, E . L . , and Smithies, 0.: Charon Phages: Safer derivatives of bacteriophage lambda for DNA cloning. Science 196:161-169, 1977. 130 B r i c k e l l , P.M., Latchman, D.S., Murphy, D., W i l l i s o n , K., and Rigby, P.W.J.: The c l a s s I major h i s t o c o m p a t i b i l i t y antigen gene a c t i v a t e d i n a l i n e of SV -A0-transformed mouse c e l l s i s H-2 D^, not Qa/Tla. Nature 316:162-163, 1985. Bodmer, W.F., and Bodmer, J.G.: Ev o l u t i o n and function of the HLA system. Brit.Med.Bull. 3A:309-316, 1978. Bodmer, J. and Bodmer, W.: H i s t o c o m p a t i b i l i t y 198A., Immunology Today 5:251-25A, 198A. Bogden, A. and Aptekman, P.A.: The R-l f a c t o r , a h i s t o c o m p a t i b i l i t y antigen i n the r a t . Cancer Research 20:1372-1382, 1960. Breathnach, R. and Chambon, P.: Organization and expression of eukaryotic s p l i t genes coding f o r pr o t e i n s . Ann.Rev.Biochem.50:3A9-383, 1981. Butcher, G.W., and Howard, J.C.: A recombinant i n the major h i s t o c o m p a t i b i l i t y of the r a t . Nature 266:362-36A, 1977. C e p p e l l i n i , R., B i g l i a r i , S., Curtoni, E.S., and Leigheb, G.: A l l o t r a n s p l a n t a t i o n i n man I I : , The r o l e of A l , A2, and B antigens. Transpl.Proc. 1:390-391, 1969. 131 Cohn, M. , and Epstein, R.: T - c e l l inhibi t ion of humoral responsiveness. II . Theory on the role of re s t r i c t ive recognition in immune regulation. Cel lu lar Immunology 39:125-153, 1978. Coligan, J . E . , Kindt, T . J . , Uehara, H . , Martinko, J . , and Nathenson, S . G . : Primary structure of a murine transplantation antigen. Nature 291:35-39, 1981. Col le , E . , Guttmann, R . D . , and Seemayer, T . : Spontaneous diabetes mellitus syndrome in the rat . I . Association with the major histocompatibil i ty complex. J.Exp.Med. 154:1237-1242, 1981. C o l l i n s , T . , Korman, K. , Wake, C , Boss, J . , Kappas, D. , Fre i s , W. , Aul t , J . , Grimbone, M . , Strominger, J . and Poler, J . : Immune interferon activates multiple Class II MHC genes and the associated invariant chain gene in human endothelial ce l l s and dermal f ibroblasts . Proc.Natl.Acad.Sci.81:4917-4921, 1984. Cook, R . G . , Capra, J . D . , Bednarczyk, J . L . , Uhr, J .W. , and Vi t te ta , E . S . : Structural studies on the murine la alloantigens. IV. Evidence that both sub-units of the I-A alloantigen are encoded by the I-A subregion. J.Immunol. 123:2799-2802, 1979. Counce, S. , Smith, P . , Barth, R. , and Sne l l , G.D.: Strong and weak histocompatibil ity differences in mice and their role in rejection of homografts of skin and tumours. Ann.Surg. 144:1989-1991, 1956. 132 Cullen, S . E . , Freed, J . H . , and Nathenson, S . G . : Structural and serological properties of murine la alloantigens. Transpl.Rev. 30:326-329, 1976. Daar, A . S . , Fuggle, S . V . , Fabre, J .W. , Ting, A . , and Morris, P . J . : The detailed d is tr ibut ion of MHC class II antigens in normal human organs. Transplantation 38:293-298, 1984. Das, H . , Lawrance, S. and Weisman, S.: Structure and nucleotide sequence of the heavy chain gene of HLA-DR. Proc.Natl.Acad.Sci.80:3543-3547, 1983. Dausset, J . : Iso-leuco anticorps. Acta Haematologica 20:156-166, 1958. Davis, M. : Molecular genetics of the T - c e l l receptor Beta chain. Ann.Rev.Immunol. 3:537-560, 1985. Deininger, P . : Random subcloning of sonicated DNA: application to shotgun DNA sequence analysis . Anal.Biochem.129:216-220, 1983. Delaney, A . : A DNA sequence handling program. Nucleic Acids Res.10:61-67, 1982. de Preval, C , Lisowska-Grospierre, B . , Loche, M. , G r i s c e l l i , C. and Mach, B . : A trans-acting class II regulatory gene unlinked to the MHC controls expression of HLA class II genes. Nature 318:291-293, 1985. 133 Diamond, A . G . , Windle, J . M . , Butcher, G.W., Winoto, A . , and Hood, L . : Identif icat ion and expression of genes encoding rat class I and II MHC molecules from two genomic and cosmid l i b r a r i e s . Transpl.Proc. 17:1808-1811, 1985. Dorf, M . E . , and Benacerraf, B . : Complementation of H-2 linked Ir genes in the mouse. Proc.Nat l .Acad.Sci . 72:3671-3675, 1975. Early , P . , Huang, H . , Davis, M. and Hood, L . : An immunoglobulin heavy chain variable region gene is generated from three segments of DNA: V J J , D and J H . C e l l 19:981-992, 1980. Eccles, S . J . , Teh, H-S . , Diamond, A . G . , and McMaster, W.R.: Di f ferent ia l expression of RTl Class II genes in f ibroblast c e l l l ines: Recognition by allogeneic and xenogeneic T lymphocytes. Immunology 59:29-35, 1986. Eccles, S. and McMaster, W.: DNA sequence analysis of a rat RTl Class II-Ap gene. Immunogenetics 22:653-663, 1985. Ernst, J . F . , Stewart, J .W. , and Sherman, F . : The cycl-11 mutation in yeast reverts by recombination with a non-a l l e l i c gene: composite genes determining the iso-cytochrome c. Proc.Natl .Acad.Sci . 78:6334-6337, 1981. Figueroa, F. and Kle in , J . : The evolution of MHC Class II genes. Immunology Today 7:78-81, 1986. 134 Flaherty, L . : Tla-region antigens. In The role of the MHC in immunobiology. (M. Dorf, editor) Garland Publishing, New York, 1981. Folsom, V . , Gold, D . P . , expression in a DR-negative B c e l l variant. Somatic C e l l Genetics 6:285-298, 1980. Fre i l inger , J . A . , Neiderhuber, J . E . , David, C . S . , and Shreff ler , D . C . : Evidence for the expression of l a (H-2 associated) antigens on tymus derived lymphocytes. J.Exp.Med. 140:1273-1284, 1874. Fukomoto, T . , McMaster, W. and Williams, A . : Mouse monoclonal antibodies against rat major histocompatibil i ty antigens: Two la antigens and expression of l a and class I antigens in rat thymus. Eur.J.Immunol.12:237-242, 1982. Germain, R . N . , and Malissen, B . : Analysis of the expression and function of Class II major histocompatibil i ty complex-encoded molecules by DNA-mediated gene transfer. Ann.Rev.Immunol. 4:281-315, 1986. Germain, R . N . , and Q u i l l , H . : Unexpected expression of a unique mixed-isotype class II MHC molecule by transfected L - c e l l s . Nature 320:72-75, 1986. Germain, R . , Bentley, D. and Q u i l l , H . : Influence of a l l e l i c polymorphism on the assembly and surface expression of Class II MHC (la) molecules. C e l l 43:233-242, 1985. 135 Germain, R . N . , Norcross, M.A. , and Margulies, D . H . : Functional expression of a transfected murine Class II MHC gene. Nature 306:190-193, 1983. Gibson, T . , and Medawar, P . B . : J.Anat. 77:99-103, 1943. G i l l , T . J . I l l , Kunz, H.W., Schaid, D . J . , Van de Berg, J . L . , and Stole, V . : Orientation of l o c i in the major histocompatibil ity complex of the rat and i t s comparison to man and the mouse. J . Immunogenetics 9_: 281-293, 1982. G i l l i e s , S. , Folsom, V. and Tonegawa, S.: C e l l type specif ic enhancer element associated with a mouse MHC gene Ep. Nature 310:594-597, 1984. Gladstone, P . , and Pious, D . : Identif icat ion of a trans-acting function regulating HLA-DR expression in a DR-negative B c e l l variant. Somatic C e l l Genetics 6:285-298, 1980. G l i s i n , V . R . , Cerkvenjakov, R . , and Byus, C . : Ribonucleic acid isolated by cesium chloride centrifugation. Biochem. 1^3:2633-2636, 1974. Goding, J .W. , and Harr is , A.W.: Sub-unit structure of c e l l surface proteins: Disulphide binding in antigen receptors, Ly-2/3 antigens and transferrin receptors of murine T and B lymphocytes. Proc.Natl .Acad.Sci . 78:4530-4534, 1981. 136 Gorer, P . A . , and Mikulska, Z . B . : Some further data on the H-2 system of antigens. Proc.R.Soc.Lond. 151:57-69, 1959. Gorer, P . A . , and O'Gorman, P . : The cytotoxic ac t iv i ty of antibodies in mice. Transp l .Bul l . 3:142-143, 1956. Gorer, P . A . , Lyman, S. , and Sne l l , G.D. : Studies on the genetic and antigenic basis of tumour transplantation. Linkage between a histocompatibil i ty gene and "fused" in mice. Proc.R.Soc.Lond.Ser.B. 135:449-451, 1948. Gorer, P . A . : The detection of antigenic differences in mouse erythrocytes by employment of immune sera. Br .J .Exp.Path. 17:42-45, 1936. Gorski, J . , and Mach, B . : Polymorphism of human l a antigens: Gene conversion between two DRp l o c i results in a new HLA-D/DR spec i f i c i ty . Nature 322:67-70, 1986. Gotze, D. ed. The Major Histocompatibil ity System in Man and Animals. Springer, Ber l in , 1977. Graham, F . L . , and Van der Erb, A . : A new technique for the assay of in fec t iv i ty of Adenovirus 5 DNA. Virology 52:456-458, 1973. Guardiola, J . , Scarpellino L . , Carra, G. and Accol la , R .S . : Stable integration of mouse DNA into la-negative human B-lymphoma ce l l s causes 137 reexpression of the ' human la-pos i t ive phenotype. Proc.Natl .Acad.Sci .(USA). 83:7415-7418, 1986. Gunther, E . , Wurst, W., Wonigeit, K . , and Epplen, J . T . : Analysis of the rat major histocompatibil i ty complex system by Southern hybridization. J.Immunol. 134:1257-1261, 1985. Gunther, E . , Stark, 0 . , and Koch, determined antigens of the rat Eur.J.Immunol. 8:206-212, 1978. C . : Genetic def ini t ion of I region major histocompatibil ity complex. Gustofsson, K . , Wiman, K . , Emmoth, E . , Larhammar, D . , Bohme, J . , Hyldig-Nielsen, J . , Ronne, H . , Peterson, P. and Rask, L . : Mutations and selection in the generation of class II histocompatibil ity antigen polymorphism. EMBO J.3:1655-1660, 1984. Haustein, D . , Stock, W., and Gunther, E . : Rat major histocompatibil ity RT1.C antigens of restr icted tissue d is tr ibut ion consist of two polypeptide chains with molecular weights of about 42,000 and 12,500. Immunogenetics L5:271-277, 1982. Hildeman, W.H., Johnson, I . S . , and Jok ie l , P . L . : Immunocompetence in the lowest metazoan phylum: Transplantation immunity in sponges. Science 204:420-422, 1979. 138 Holowachuck, E . : Isolation and characterization of a cDNA clone for the MHC class II chain R T l . D a u of the diabetic BB rat . Immunogenetics 22:665-671, 1985. Hood, L . , Kronenberg, M. and Hunkapiller, T . : T - c e l l antigen receptors and the immunoglobulin supergene family. C e l l 40:225-229, 1985. Hood, L . , Steinmetz, M . , and Malissen, B . : Genes of the major histocompatibil ity complex of the mouse. Ann.Rev.Immunol. 1:529-568, 1983. Howard, J . C . : The major histocompatibil ity complex of the rat: A p a r t i a l review. Metabolism 32(l):41-50, 1983. Jackson, R . A . , Buse, J . B . , R i f a i , R . , Pe l l e t i er , D . , Mi l ford , E . L . , Carpenter, C . B . , Eisenbarth, G . S . , and Williams, R .M.: Two genes required for diabetes in BB rats: evidence from c y c l i c a l intercrosses and backcrosses. J.Exp.Med. L59:1629-1636, 1984. Jensen, C O . : Zentrabl. Bakteriol . I .Abt.Ref. 34:28-30, 1903. Jones, P . P . , Murphy, D . B . , and McDevitt, H.O. : Two gene control of the expression of a murine l a antigen. J.Exp.Med. 148:925-939, 1978. Jones, P . P . , Murphy, D . B . , Hewgill, D . , and McDevitt, H.O. : Detection of a'common polypeptide chain in I-A and I-E subregion immunoprecipitates. Mol.Immunol. 16:51-54, 1979. 139 Jones, P.P., Murphy, D., and McDevitt, H.O.: Variable synthesis and expression of E Q and A e(Ep) l a polypeptide chains i n mice of d i f f e r e n t H-2 haplotypes. Immunogenetics 1^2:321-325, 1981. Kappler, J.W., and Marrack, P.: The r o l e of H-2 linked genes i n helper T - c e l l function. IV. Importance of T - c e l l genotype and host c e l l environment i n I region and I r gene expression. J.Exp.Med. 148:1510-1522, 1978. Katz, D.H., Hamaoka, T., and Benacerraf, B.: C e l l interactions between histocompatible T and B lymphocytes. I I . F a i l u r e of physiologic cooperative interactions between T and B lymphocytes from allogenic donor str a i n s i n humoral response to hapten-protein conjugates. J.Exp.Med. 137:1405-1418, 1973. Kaufman, J.F., Auffray, C , Korman, A.J., Shackelford, D.A., and Strominger, J . : The Class I I molecules of the human and murine major hi s t o c o m p a t i b i l i t y complex. C e l l 3_6:1-13, 1984. Kaufman, J.F., and Strominger, J.L.: HLA-DR l i g h t chain has a polymorphic N-terminal region and a conserved Ig l i k e C-terminal region. Nature 297:694-696, 1982. K e l l e r , E. and Noon, W.: Intron s p l i c i n g : a conserved i n t e r n a l signal i n introns of animal pre-mRNAs. Proc.Natl.Acad.Sci.81:7417-7420, 1984. 140 Kle in , J . : The major histocompatibil i ty complex. In Medical Microbiology S. Baron (ed), Addison Wesley L t d . , Don M i l l s , Canada. 1986, ppl6-23. Kle in , J . , Figueroa, F. and Nagy, Z . : Genetics of the major histocompatibil ity complex: the f i n a l act. Ann.Rev.Immunol.1:119-142, 1983. Kle in , J . , Juret i c , A . , Baxevanis, C . N . , and Nagy, Z . A . : The trad i t iona l and a new view of the mouse H-2 complex. Nature 291:455-460, 1981. Kle in , J . , and Petes, T . D . : Intrachromosomal gene conversion in yeast. Nature 289:144-146, 1981. K l e i n , J . , and Figueroa, F . : Polymorphism of the mouse H-2 l o c i . Immunol.Rev. 60:23-57, 1981. Kle in , J . , and Hauptfeld, V . : Ia antigens: their serology, molecular relat ionships, and their role in a l lograft reactions. Transpl.Rev. 30:83-90, 1976. Koch, N . , Wong, G.H.,and Schrader, J . H . : Ia antigens and associated invariant chain are induced simultaneously in l ines of T-dependent mast ce l l s by recombinant interferon-x. J . Immunol. 132:1361, 1984. Kohoutova, M . , Gunther, E . , and Stark, 0.: Genetic def in i t ion of a further gene region and ident i f icat ion of at least three different 141 histocompatibil i ty genes in the rat histocompatibil ity system. Immunogenetics 11:483-490, 1980. Kohoutova, M . , Gunther, E . , Stark, 0. , and Vojcik, L . : Further two recombinants at the MHC of the rat . F o l i a B i o l . 24:406-407, 1978. Kourilsky, P . : Genetic exchanges between p a r t i a l l y homologous nucleotide sequences.: possible implications for multi-gene families . Biochimie. 65:85-93, 1983. Kowalski, D..Kroeker, W.D., and Laskowski, M . , S r . : Mung Bean Nuclease I. Physical , Chemical, and Catalyt ic Properties. Biochem.15:4457-4463, 1976. Kronenbrg, M . , S iu , G . , Hood, L . and Shastr i , N. : The molecular genetics of .the T - c e l l antigen receptor and T - c e l l antigen recognition. Ann.Rev.Immunol. 4:529-591, 1986. Kunz, H.W., G i l l , T . J . I l l , Liebert , M . , and Katz, S .M.: Gene order in the major histocompatibil i ty complex of the rat . Immunogenetics 13:371-379, 1981. Kunz, H.W., G i l l , T . J . I l l , and Misra, D .N. : The ident i f icat ion and mapping of a second class I locus in the MHC of the rat . J.Immunol. 128:402-408, 1982. 142 Landais, D . , Waltzinger, C , North-Beck, B . , Staub, A . , McKean, D . J . , Benoist, C , and Mathis, D . : Functional sites on Ia molecules. A molecular dissection of A a immunogenicity. C e l l 47:173-181, 1986. Landais, D. , Matthes, H. , Benoist, C , and Mathis, D. : A molecular basis for the Ia.2 and Ia.19 antigenic determinants. Proc.Natl .Acad.Sci . 82:2930-2934, 1985. Lanzavecchia, A . : Antigen specif ic interaction between T and B ce l l s . Nature 314:537-539, 1985. Larhammar, D . , Servenius, B . , Rask, L . and Peterson, P . : Characterization of an HLA DRp pseudogene. Proc.Natl.Acad.Sci.82:1475-1479, 1985. Larhammar, D . , Hamerling, U . , Denaro, M . , Lund, T . , F l a v e l l , R. , Rask, L . and Peterson. P.: Structure of the murine immune response I-Ap locus: Sequence of the I-Ap gene and an adjacent 0 chain second domain exon. C e l l 34:179-188, 1983. Larhammar, D . , Schenning, L . , Gustofsson, K . , Winman, K . , Claesson, L . , Rask, L . and Peterson, P . : Complete amino acid sequence of an HLA-DR antigen-like 0 chain as predicted from the nucleotide sequence: S imi lar i t i e s with immunoglobulins and HLA-A,B and C. Proc.Natl.Acad.Sci.79:3687-3691, 1982. 143 Leder, P . , Tiemeier, D . , and Enquist, L . : Derivatives of bacteriophage lambda useful in cloning DNA from higher organisms: The AgtWES system. Science 196:175-177, 1977. Lee, J . S . , Trowsdale, J . , Travers, P . J . , Carey, J . , Grosveld, F . , Jenkins, J . , and Bodmer, W.F.: Sequence of an HLA-DR a chain cDNA clone and intron-exon organization of the corresponding gene. Nature 299:750-752, 1982. LeMeur, M . , Garlinger, P . , Benoist, C , and Mathis, D. : Correcting an immune response deficiency by creating E Q gene transgenic mice. Nature 316:38-43, 1985. Levine, B . B . , Ojeda, A . , and Benacerraf, B . : Studies on a r t i f i c i a l antigens. I l l Genetic control of the immune response to hapten Poly-L-Lysine conjugates in guinea pigs. J.Exp.Med. 118:953-957, 1963. Liebhaber, S . A . , Goossens, M . , and Kan, Y.W.:Homology and concerted evolution at the a l and a2 l o c i of human a-globin. Nature 290:26-28, 1981. Lipsky, P . E . , and Rosenthal, A . S . : Macrophage lymphocyte interaction. I. Demonstration of determinant specif ic differences in response to synthetic polypeptide antigens in two strains of inbred mice. J.Exp.Med. 139:900-924, 1973. 144 L i t t l e , C C , and Tyzzer, E . E . : Further studies on inheritance of suscept ib i l i ty to a transplantable tumour in Japanese Waltzing mice. J.Med.Res. 33:395-425, 1916. Lobel, S . A . , and Cramer, D .V . : Demonstration of a new genetic locus in the MHC of the rat . Immunogenetics 13:465-473, 1981. Malissen, B . , Steinmetz, M . , McMillan, M . , Pierres, M . , and Hood, L . : Expression of I - A k molecules in mouse L-ce l l s after DNA mediated gene transfer. Nature 305:440-442, 1983. Malissen, B . , Peele-Price, M . , Goverman, J . M . , McMillan, M . , White, J . , Kappler, J . , Marrack, P . , Pierres, F . , Pierres, M . , and Hood, L . : Gene transfer of H2 Class II genes: Antigen presentation by mouse f ibroblast and hamster B c e l l l ines . C e l l 36:319-327, 1984. Maloy, W.L. , and Coligan, J . E . : Primary structure of the H-2 D b alloantigen: Additional amino, acid sequence information, loca l izat ion of a th ird s i te of glycosylation and evidence for K and D region specif ic sequences. Immunogenetics 1_6:11 -22, 1982. Maniatis, T . , F r i t s c h , E . F . , and Sambrook, J . : Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory, 1982. Mason, D.W., and G a l l i c o , G . G . : Tissue d is tr ibut ion and quantitation of l a - l i k e antigens in the rat . Eur.J.Immunol. 8:741-748, 1978. 145 Mathis, D. , Benoist, C , Williams, V . , Kanter, M. and McDevitt, H. : The murine E Q immune response gene. C e l l 32:745-754, 1983. McDevitt, H .O. , and Sela, M . : Genetic control of the antibody response. I Demonstration of determinant-specific differences in response to synthetic polypeptide antigens in two strains of inbred mice. J.Exp.Med. 122:517-539, 1965. McDevitt, H . O . , and Chin i tz , A . : Genetic control of the immune response: Relationship between immune response and histocompatibil ity (H-2) type. Science 163:1207-1208, 1969. McDonell, M.W., Simon, M.N. , and Studier, F.W.: Analysis of re s tr i c t ion fragments of T7 DNA and determination of molecular weights by electrophoresis in neutral and alkal ine gels. J . M o l . B i o l . 110:119-123, 1977. McMaster, W.R.: Puri f icat ion and molecular cloning of rat Ia antigens. Methods in Enzymology 108:558-570, 1984. McMaster, W.R.: C e l l Surface Antigens. In Biochemistry of Cel lu lar  Regulation Vol IV. The c e l l Surface. M.J . Clemens editor, CRC Press, Boca Raton, F lor ida , USA., pp 50-77, 1981. McMaster, W.R., and Williams, A . F . : Identif ication of Ia glycoproteins in rat thymus and puri f icat ion from rat spleen. Eur.J.Immunol. 9:426-433, 1979. 146 McMichael, A . J . , Ting, A - , Zweerink, H . , and Askonas, B . A . : HLA res tr i c t ion of c e l l mediated lys i s of influenza virus infected human c e l l s . Nature 270:524-525, 1977. Medawar, P . B . : Immunity to homologous grafted sk in . I . The suppression of c e l l d iv is ion in grafts transplanted to immunized animals.II. The relationship between the antigens of blood and skin. Br.J.Exp.Path.27:9-15,1946. Mellor, A . L . , Weiss, E . H . , Ramachandran, K . , and F l a v e l l , R . A . : A potential donor gene for the bml gene conversion event in the C57BL mouse. Nature 306:792-795, 1983. Mengle-Gaw, L . , and McDevitt, H .O. : Genetics and expression of mouse la antigens. Ann.Rev. Immunol. 3_:367-396, 1985. Mengle-Gaw, L . , Connor, S. , McDevitt, H . O . , and Fathman, C . G . : Gene conversion between murine class II MHC l o c i : Functional and molecular evidence from the bml2 mutant. J.Exp.Med. 160:1184-1189, 1984. Mengle-Gaw, L . , and McDevitt, H . O . : A l l e l i c variat ion in mouse Ia3 chain genes. UCLA Sympossia 18 1984. Meruelo, H . , and Edidan, T . : The bio logical function of the MHC; hypotheses. In: Contemporary topics in immunobiology (Marchalonis and Cohen, editors) 9:231-253, 1980, Plenum Press, New York. 147 Messing, J . : New vectors for M13 cloning. Methods in Enzymology 101:20-78, 1983. Messing, J . , and V i e i r a , J . : A new pair of M13 vectors for selecting either strand of double digest re s t r i c t ion fragments. Gene 19:269-276, 1982. Messing, J . , Crea, R . , and Seeberg, P . H . : A system for shotgun DNA sequencing. Nucl.Acids Res. 9:309, 1981. Messing, J . : A multi purpose cloning system based on single stranded DNA bacteriophage M13. Recombinant DNA Technical Bu l l e t in . NIH 79-99.2, No.2:43-48, 1979. Michaelson, J . : Genetic polymorphism of 32 microglobulin maps to the H-3 region of chromosome 2. Immunogenetics 1_3:167-171, 1981. Misra, D .N . , Kunz, H.W., Cortesse-Hassett, A . , and G i l l , T . J . I l l : Monoclonal antibodies against specif ic rat class I major histocompatibil ity complex antigens. Transpl. Proc . 1_7:1815-1817 , 1985. Misra, D . N . , Noeman, S . A . , Kunz, H.W., and G i l l , T . J . : Identif ication of two Class I antigens coded by the MHC of the rat using monoclonal antibodies. J.Immunol. 128:1651-1658, 1982. 148 Morrison, D .A . : Transformation and preservation of competent bacterial ce l l s by freezing. Methods in Enzymology 68:326-331, 1979. Murphy, D . B . , Jones, P . P . , Lohen, M.R., and McDevitt, H .O. : Interaction between I region l o c i influences the expression of a c e l l surface la antigen. Proc.Natl .Acad.Sci .USA. 77:5404-5408, 1980. Murray, K . : Applications of bacteriophage Lambda in recombinant RNA research. In. Molecular cloning of DNA., S. Werner editor, Academic Press, New York, Vol 13:133, 1977. Nairn, R . , Yamaga, K . , Nathenson, S . G . : Biochemistry of the gene products from murine MHC mutants. Ann. Rev. Genet. l_4:241-256, 1980. Nathenson, S . G . , Geliebter, J . , Pfaffenbach, G . M . , and Zeff, R . A . : Murine major histocompatibil i ty complex Class I mutants: Molecular analysis and structure-function implications. Ann. Rev. Immunol.4:471-502, 1986. Natori , T . , Ohasi, T . , Kotani, T . , Katag ir i , M . , and Aizawa, M.: The molecular ident i f icat ion of two serological ly defined gene products of the rat major histocompatibil i ty complex. J.Immunol. 122:1911-1915, 1979. 149 Norcross, M.A. , Bentley, D .M. , Margulies, D . H . , and Germain, R . N . : Membrane Ia expression and antigen presenting accessory c e l l function of L -ce l l s transfected with Class II MHC genes. J.Exp.Med. 160:1316-1320, 1984. Norrander, J . , Kempe, T . , and Messing, J . : Improved Ml3 vectors using oligonucleotide directed mutagenesis. Gene 26:101-106, 1983. O'Brien, S . J . , Roelke, M . E . , Marker, L . , Newman, A . , Winkler, C . A . , Meltzer, D . , Col ly , L . , Everman, J . F . , Bush, M . , and Wildt, D . E . : Genetic basis for species vulnerabi l i ty in the cheetah.- Science 227:1428-1434, 1985. Okada, K. , Boss, J . , Prentice, H. , Speis, T . , Mengler, R. , Auffray, C , L i l l i e , J . , Grossberger, D. and Strominger, J . : Gene organization of DC and DX subregions of the human MHC. Proc.Natl.Acad.Sci.82:3410-3414, 1985. Palm, J . : Association of maternal genotype and excess heterozygousity for Ag-B histocompatibil i ty antigens among male rats . Transpl.Proc. 1:82-84, 1969. Palm, J . : Maternal-fetal interactions and histocompatibil ity antigen polymorphisms. Transpl.Proc. 2:162-173, 1970. Palmer, M . J . , Buck, D . A . , Fre i l inger , J . A . , and Wettstein, P . J . : Polymorphic class II sequences linked to the rat major 150 histocompatibil ity complex (RTl) homologous to human DR and DQ sequences. J.Immunol. 135:1450-1455, 1985. Patten, P . , Yokata, T . , Rothbard, J . , A r a i , K . , and Davis, M.M.: Structure, expression and divergence of T - c e l l receptor B chain variable regions. Nature 312:40-42, 1984. Payne, R. , and Rolfs , M.R.: Fetomaternal leukocyte incompatibi l i ty. Journal of C l i n i c a l Investigation 37:1756-1763, 1958. Perler, F . , Efstratiadus, A . , Lomedico, P . , Gi lber t , W., Kolodner, R. and Dodgson, J . : The evolution of genes: the chicken pre-pro- insul in gene. C e l l 20:555-560, 1980. Ploegh, H . L . , Orr, H . T . , and Strominger, J . L . : Biosynthesis and c e l l surface loca l izat ion of nonglycosylated human histocompatibil ity antigens. J.Immunol. 126:270-272, 1981. Pol la , B . S . , Poliak, A . , Geier, S . G . , Nathenson, S . G . , Ohara, J . , Paul, W.E . , and Glimcher, L . H . : Three d i s t inc t signals can induce class II gene expression in a murine pre-B-ce l l l ine . Proc.Natl.Acad.Sci.83:4878-4882, 1986. Rabourdin-Combe, C . , and Mach, B . : Expression of HLA-DR antigens at the surface of mouse L-ce l l s cotransfected with cloned human genes. Nature 303:670-672, 1983. 151 Reyes, A . A . , and Wallace, R . B . : A comparison of the coding and 3' non-coding DNA sequences of several murine transplantation antigens. Immunogenetics 16:265-268, 1982. Rigby, P . , Dieckmann, M . , Rhodes, C. and Berg, P . : Labell ing deoxyribonucleic acids to high specif ic ac t iv i ty in v i tro by nick translation with DNA Polymerase I . J . M o l . B i o l . 113:237-251, 1977. Robertson, K. and McMaster, W.R.: Complete structure of a rat RTl Ep chain: Extensive conservation of MHC Class II B chains. J.Immunol.135:4095-4099, 1985. Robinson, P . J . , Lundin, L . , Sege, K . , Graf, L . , Wigzel l , H . , and Peterson, P.: Immunogenetics l_4:449-452, 1981. Rosenberg, L . T . , Cooperman, D . , and Payne, R.: HLA and mate selection. Immunogenetics 17:89-93, 1983. Rosenthal, A . S . : Determinant selection and macrophage function in genetic control of the immune response. Immunol.Rev. 40:136-140, 1978. Sachs, D . H . , Humphrey, G.W., and Lunney, J . K . : Sharing of l a antigens between species .I . Detection of l a spec i f i c i t i e s shared by rats and mice. J.Exp.Med.146:381-384, 1977. 152 Saito, H . , Maki, R . , Clayton, L . and Tonegawa, S.: Complete primary structures of the chain and gene of the mouse MHC. Proc.Natl .Acad.Sci . 80:5520=5524, 1983. Salter , R . D . , Alexander, J . , Levine, F . , Pious, D. and Cresswell, P.:Evidence for two trans-acting genes regulating HLA class II antigen expression. J.Immunol. 135:4235-4238, 1985. Sanger, F . , Nicklen, S. and Coulson. A . : DNA sequencing with chain terminating inhib i tors . Proc.Natl.Acad.Sci.74:5463-5467, 1977. Sassone-Corsi, P . , and B o r r e l l i , E . : Transcriptional regulation by trans-acting factors. TIGS 20:215-219, 1986. Sawicki, J . A . , and Wettstein, P . J . : Evidence for extensive polymorphism of RT1 class II molecules in the rat . J.Immunol. 132:310-315, 1984. Schenning, L . , Larhammar, D . , B i l l , P . , Wiman, K . , Jonsson, A . , Rask, L. and Peterson, P . : Both a and 3 chains of HLA-DC Class II histocompatibil ity antigens display extensive polymorphism in their amino terminal domains. EMBO J . 3:447-452, 1984. Schrier, P . I . , Bernards, R. , Vaessen, R . T . M . J . , Houweling, A . , and vander Eb, A . J . : Expression of class I MHC antigens switched off by highly oncogenic adenovirus 12 in transformed rat c e l l s . Nature 305:771-775, 1983. 153 Schrier, P . H . , Bothwell, A . L . M . , M u e l l e r - H i l l , B . , and Baltimore, D. : Multiple differences between the nucleic acid sequences of the IgG2aa and IgG2ab a l l e l e s of the mouse. Proc.Natl .Acad.Sci . 78:4495-4500, 1981. Schwartz, R . H . : The role of gene products of the major histocompatibil ity complex in T - c e l l activation and ce l lu lar interactions. IN: Fundamental Immunology (M. Dorf, edi tor) , Raven Press, New York, 1984 (pp379-438) Schwartz, R . H . : T-lymphocyte recognition of antigen in association with gene products of the MHC. Ann. Rev. Immunol. 3_:237-261, 1985. Schwartz, R . H . , David, C . S . , Dorf, M . , Benacerraf, B . , and Paul, W.E.: Inhibit ion of dual Ir gene controlled T-lymphocyte pro l i ferat ive response to poly(GluLysPhe) n with a n t i - l a antisera directed against products of either I-A or I-C subregions. Proc.Natl .Acad.Sci . 75:2387-2393, 1978. Schwartz, R . H . , David, C . S . , Sachs, D . , and Paul, W.E. : T-lymphocyte enriched murine peritoneal exudate c e l l s . III . Inhibit ion of antigen induced T-lymphocyte pro l i ferat ion with a n t i - l a antisera. J.Immunol. 117:531-536, 1976. Scof ie ld, V . L . , Schlumpberger, J . M . , West, L . A . , and Weissman, I . L . : Protochordate al lorecognit ion is controlled by an MHC-like gene system. Nature 295:499-502, 1982. 154 Servenius, B . , Gustafsson, K . , Widmark, E . , Emmoth, E . , Anderson, G . , Larhammar, D . , Rask, L . , and Peterson, P . : Molecular map of the human HLA-SB (DP) region and sequence of an SBQ (DP a) pseudogene. EMBO.J. 3:3209-3212, 1984. Shackelford, D . A . , and Strominger, J . L . : Analysis of the oligosaccharides, on the HLA-DR and DC1 B-ce l l antigens. J.Immunol.130:274-282,1983. Shackelford, D . A . , Kaufman, J . F . , Korman, A . J . , and Strominger, J . L . : HLA-DR antigens: Structure, separation of sub-populations, gene cloning and function. Imm.Rev. 6:133-187, 1982. Shastr i , N . , Malissen, B, and Hood, L . : Ia transfected L - c e l l f ibroblasts present a lysozyme peptide, but not native protein to lysozyme-specific T - c e l l s . Proc.Natl .Acad.Sci . 82:5885-5890, 1985. Shastr i , N . , Oki , A . , M i l l e r , A . , and Sercarz, E . : Dist inct recognition phenotypes exist for T - c e l l clones specif ic for small peptide regions of proteins. Implications for the mechanism underlying MHC restr icted antigen recognition and clonal deletion models of immune response gene defects. J.Exp.Med. .162:332-345, 1985. Shimonkevitz, R . , Kappler, J . , Marrack, P . , and Grey, H . : Antigen recognition by H-2 restr icted T - c e l l s . I. Ce l l - f ree antigen processing. J.Exp.Med. 158:303-306, 1983. 155 Shreff ler , D . C . , Meo, T . , and David, C . S . : In Role of products of the  Histocompatibil ity gene complex in immune responses. Katz, D . H . , and Benacerraf, B. (eds) Academic Press, New York, 1976, pp 3-5. Shreff ler , D . C . , and David, C . S . : The H-2 MHC and the I immune response region. Genetic var iat ion , function, and organization. Adv.Immunol.20:125-195,1975. Sne l l , G . D . , Graff, R . J . , and Cherry, M. : Histocompatibility genes of mice. XI. Evidence establishing a new histocompatibil i ty locus H-12 and a new H-2 a l l e l e H - 2 b . T r a n s p l . U : 525-530, 1971. Sne l l , G.D. : A cytosieve permitting s t e r i l e preparation of suspensions of tumour ce l l s for transplantation. J.Natl.Cancer Inst.13:1511-1513,1953. Sne l l , G.D. : Methods for the study of histocompatibil ity genes. J.Genetics 49:87-103, 1948. Snyder, D . S . , Be l l er , D . L . , and Unanue, E . R . : Prostaglandins modulate macrophage la expression. Nature 299:163-165,1982. Southern, E. : Detection of specif ic sequences among DNA fragments separated by gel electrophoresis. J.Mol.Biol.9_8:503-517, 1975. 156 Springer, T . A . , Kaufman, J . F . , Terhorst, C , and Strominger, J . L . : Puri f icat ion and structural characterization of human HLA linked B - c e l l antigens. Nature 268:213-215, 1977. Sporer, R . , Gotze, D . , and Manson, the MHC of the r a t . I I . Biochemical 1979. L . A . : An immunogenetic analysis of data. Transpl.Proc. 11:1342-1345, Staden, R.: A new computer method for the storage and manipulation of DNA gel reading data. Nucl.Acids Res.8:3673-3694, 1980. Stark, 0 . , and Gunther, E . : Serological and ce l lu lar characterization of products of a new major histocompatibil ity region RT1.C of the rat: possible homology to the mouse H-2 Qa. J.Immunol. 128:1923-1928, 1982. Stark, 0 . , Gunther, E . , Kohoutova, M . , and Vojcik, L . : Genetic recombination in the major histocompatibil ity complex of the rat . Immunogenetics 5:183-187, 1977. Steeg, P . S . , Johnson, H . M . , and Oppenheim, J . J . : Regulation of murine macrophage Ia antigen expression by an immune interferon-l ike lymphokine: Inhibitory effect of endotoxin. J.Immunol. 129:2402-2410, 1982. Steinmetz, M . , Stephan, and Lindah, K . : Gene organization and recombinational hotspots in the murine MHC. C e l l 44:895-904, 1986. 157 Steinmetz, M.: S t r u c t u r a l and f u n c t i o n a l studies of mouse c l a s s II genes. In: Human Class II h i s t o c o m p a t i b i l i t y antigens (S. Ferrone, e d i t o r ) Springer-Verlag, B e r l i n , 1985. Steinmetz, M., Minard, K., Horvath, S., McNicholas, J . , and F r e i l i n g e r , J . : A molecular map of the immune response region from the MHC of the mouse. Nature 300:35-37, 1982. Strominger, J.L., Engelhard, V.H., Fuks, A., Guil d , B.C., H y a f i l , F., Kaufman, J.F., Korman, A.J., Kostyk, T.G., Krangel, M.S., Lancet, D., Lopez de Castro, J.A., Mann, D.L., Orr, H.T., Parham, P.T., Parker, K.C., Ploegh, H.L., Pober, J.S., Robb, R.J., and Shackelford, D.A.: Biochemical a n a l y s i s of products of the MHC, In The r o l e of the Major H i s t o c o m p a t i b i l i t y Complex i n immunobiology. M.E. Dorf e d i t o r . Garland Press, New York, 1981, ppll5-172. Sung, E., and Jones, P.P.: The in v a r i a n t chain of murine l a antigens: i t s g l y c o s y l a t i o n , abundance, and s u b - c e l l u l a r l o c a l i z a t i o n . Mol.Immunol. 18:899-903, 1981. Tanaka, K., Isselbacher, K.J., Khoury, G., and Jay, G.: Reversal of oncogenesis by expression of a major h i s t o c o m p a t i b i l i t y complex Class I gene. Science 228:26-30, 1985. Travers, P., B l u n d e l l , T.L., Sternberg, M.J., and Bodmer, W.F.: St r u c t u r a l and evolutionary a n a l y s i s of HLA D region products. Nature 310:235-237, 1984. 158 U l l r i c h , A . , Shine, J . , Chirgwin, J . , Pictet , R . , Tischer, E . , Rutter, W . J . , and Goodman, H.M. : Rat insul in genes: Construction of plasmids containing coding sequence. Science 196:1313, 1977. Van Leeuwen, A . , Schuit, R . , and VanRood, J . J . : Typing for MLC (LD) II . The selection of non-stimulator ce l l s by MLC inhibi t ion test using SD ident ical stimulator ce l l s and fluorescent antibody studies. Transpl.Proc.5:1539-1542, 1973. van Rood, J . J . , Eernisse, J . G . , and van Leeuwen, A . r Leukocyte antibodies in sera from pregnant women. Nature 181:1735-1736, 1958. V i e i r a , J . , and Messing, J . : The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268, 1982. Von Boehmer, H . , Haas, W., and Jerne, N .K. : Major histocompatibil ity complex linked immune responsiveness is acquired by lymphocytes of low responder mice di f ferent iat ing in thymus of high responder mice. Proc.Nat l .Acad.Sci . 75:2439-2442, 1978. Wagener, D . K . , Cramer, D . V . , Shonnard, J .W. , and Davis, B . K . : Linkage disequil ibrium between two genetic l o c i of the major histocompatibil ity complex in rats . Immunogenetics 9:157-164, 1979. 159 Wakeland, E . K . , Darby, B. and Coligan J . E . : Local izat ion of structural variations distinguishing I-A^-related molecules to the al and 01 domains. J . Immunol. 135:391-398, 1985. Wallach, R . , Bulbuc, N . , Hammerling, G . J . , Katzav, S. , Segal, S. , and Feldman, M . : Abrogation of metastatic properties of tumour ce l l s by de novo expression of H-2K antigens following H-2 gene transfection. Nature 315:301-305, 1985. Wal l i s , A. and McMaster, W.R.: Sequence of a cDNA coding for a rat Class II A Q chain: Extensive DNA and protein sequence identity to H-2 A Q and HLA-DC a . Immunogenetics 19:53-62, 1984. Watts, T . H . , Gaub, H . E . , and McConnell, H.M.: T - c e l l mediated association of peptide antigen and MHC protein detected by energy transfer in an evanescent wave f i e l d . Nature 320:176-179, 1986. Watts, T . H . , Brian, A . B . , Kappler, J .W. , Marrack, P . , and McConnell, H.M.: Antigen presentation by supported planar membranes containing a f f in i ty puri f ied I - A d . Proc.Natl .Acad.Sci . 81:7564-7568, 1984. Weislander, L . : A simple method to recover intact high molecular weight RNA and DNA after electrophoretic separation in low gel l ing temperature agarose gels. Anal.Biochem. 98:305-307, 1979. Weiss, E . H . , Golden, L . , Fahrner, K . , Mellor, A . L . , Devlin, J . J . , Bullman, H . , Tiddens, H . , Bud, H . , and F l a v e l l , R . A . : Organization and 160 evolution of the Class I gene family in the major histocompatibil ity complex of the C57BL/10 mouse. Nature 310:650-655, 1984. Weiss, E . H . , Mellor, A . , Golden, L . , Fahner, K . , Simpson, E . , Hurst, J . , and F l a v e l l , R . A . : The structure of a mutant H-2 gene suggests that the generation of polymorphism in H-2 genes may occur by gene conversion l ike events. Nature 301:671-674, 1983. Widera, G . , and F l a v e l l , R . A . : Nucleotide sequence of the murine I - E p b immune response gene: evidence for gene conversion events in class II genes of the major histocompatibil i ty complex. EMBO J . 3:1221-1226, 1984. Woo, S .L . : A sensitive and rapid method for recombinant phage screening. Methods in Enzymology 68:389-395, 1979. Wu, C-I . and L I , W-H.: Evidence for higher rates of nucleotide substitution in rodents than in man. Proc. Natl . Acad. Sci.82:1741-1745, 1985. Yamaguchi, M . , Yamazaki, K.,Beauchamp, G . K . , Bard, J . , Thomas, L . , and Boyse, E . A . : Dist inct ive urinary odors governed by the major histocompatibil i ty complex of the mouse. Proc.Natl .Acad.Sci . 78:5817-5820, 1981. 161 Yamamura, K . , Kikutani , H . , Folsom, V . , Clayton, L . K . , Kimoto, M . , Akira , S. , Kashiwamura, S . , Tonegawa, S . , and Kishimoto, T. : Functional expression of a microinjected E a d gene in C57/BL/6 transgenic mice. Nature 316:67-69, 1985. Yanisch-Perron, C , V i e i r a , J . , and Messing, J . : Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8:pUC19 vectors. Gene 33:103-119, 1985. Yokoyama, K . , Nathenson, S . C . : Intramolecular organization of class I MHC antigens: Local izat ion of the alloantigenic determinants, and the 3 2M binding s i te to different regions of the H-2K b glycoprotein. J.Immunol. 126:1312-1315, 1983. Yunis, F . J . , and Amos, D . B . : Three closely linked genetic systems relevant to transplantation. Proc.Natl.Acad.Sci.(USA)68:3031-3035, 1971. Zinkernagel, R . M . , Callahan, G . N . , Althage, A . , Cooper, S. , K le in , P . A . , and Kle in , J . : On the thymus in the di f ferent iat ion of " H-2 self-recognition" by T - c e l l s : Evidence for dual recognition? J . Exp. Medicine 147:882-896, 1978. Zinkernagel, R . M . , and Doherty, P . C . : Restrict ion of on v i tro T - c e l l mediated cytotoxici ty in lymphocytic choriomeningitis within a syngeneic or semi-allogeneic system. Nature 248:701-702, 1974. 162 APPENDIX 1 Preparation of Termination Mixes for M13 Dideoxynucleotide Sequencing (from G. Winter, unpublished) 1. Dilute Deoxyribonucleotide Triphosphate (dNTP) stock solutions to a f i n a l concentration of 0.5mM with d i s t i l l e d water (dR^O). 2. Prepare dNTP mixes as follows: stock dTTP dCTP dGTP dATP 0.5mM dTTP 4 n l 80pl 80LI1 80pl 0.5mM dCTP 80pl 4 M1 80pl 80ul 0.5mM dGTP 80pl 80(jl 4 p l 80pl dH 20 20pl 20pl 20pl 20pl 184pl 184pl 184pl 260pl 3. Prepare Dideoxynucleotide Triphosphate (ddNTP) mixes from lOmM stocks to give the following f i n a l concentrations: ddATP 0.2mM ddCTP 0.2mM ddTTP 2.OmM ddGTP 1.6mM 4. Ti trate the ddNTP mixes to prepare the termination mixes. 163 For example to prepare the "A" termination mix dATP mix and ddATP are mixed in several rat ios; 5pl dATP mix 5pl dATP mix 5pl dATP mix 5pl 0.2mM ddATP 5pl O.lmM ddATP 5pl 0.05mM ddATP 10pl lOpl 10pl Repeat this procedure for the other three nucleotides, and use the 3 sets of termination mixes to sequence a wild type M13 phage template. 5. Determine the optimum rat io for each termination mix from the sequencing results , and make 2-5ml of each. Aliquot in lOOpl amounts and store at -20°G. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0097104/manifest

Comment

Related Items