UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on an inducible gene system : the heat shock response in trout cells Kothary, Rashmikant 1984

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1984_A1 K68.pdf [ 9.7MB ]
Metadata
JSON: 831-1.0096634.json
JSON-LD: 831-1.0096634-ld.json
RDF/XML (Pretty): 831-1.0096634-rdf.xml
RDF/JSON: 831-1.0096634-rdf.json
Turtle: 831-1.0096634-turtle.txt
N-Triples: 831-1.0096634-rdf-ntriples.txt
Original Record: 831-1.0096634-source.json
Full Text
831-1.0096634-fulltext.txt
Citation
831-1.0096634.ris

Full Text

STUDIES ON AN INDUCIBLE GENE SYSTEM: THE HEAT SHOCK RESPONSE IN TROUT CELLS by RASHMIKANT B.Sc,  The U n i v e r s i t y  KOTHARY  of B r i t i s h Columbia, 1 9 7 9  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE  REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in  THE  FACULTY OF GRADUATE STUDIES  Department of Biochemistry  We accept t h i s  t h e s i s as conforming  to the r e q u i r e d  THE  standard  UNIVERSITY OF BRITISH COLUMBIA June 1 9 8 4  ©  Rashmi K. Kothary, 19'84  In  presenting  requirements  this for  an  of  British  it  freely available  agree for  that  I  by  understood  that  his  that  or  be  her or  shall  of  June 19,  1984  the  University  and  study.  I  copying  granted  by  the  of  publication be  allowed  Columbia  of  make  further this  head  representatives.  not  the  shall  Biochemistry  The U n i v e r s i t y o f B r i t i s h 1956 Main M a l l Vancouver, Canada V6T 1Y3  at  of  Library  permission.  Department  fulfilment  the  extensive  may  copying  f i n a n c i a l gain  degree  reference  for  purposes  or  partial  agree  for  permission  scholarly  in  advanced  Columbia,  department  for  thesis  It  this  without  thesis  of  my  is  thesis my  written  Abstract  The heat shock phenomenon has been c h a r a c t e r i z e d f i b r o b l a s t s o f the rainbow t r o u t , Salmo g a i r d n e r i i . e l i c i t e d by one o f two methods: exposure.  i n cultured The response was  temperature e l e v a t i o n o r sodium a r s e n i t e  The s t r e s s s i t u a t i o n s r e s u l t e d i n the r a p i d e x p r e s s i o n o f a s e t  of n o v e l p o l y p e p t i d e s , i n trout c e l l s .  t h e heat shock p o l y p e p t i d e s ( h s p s ) , n o r m a l l y absent  At l e a s t s i x hsps have been i d e n t i f i e d and m o l e c u l a r  w e i g h t s a s s i g n e d ; these a r e r e f e r r e d t o as hsp30, hsp32, hsp42, hsp62, hsp70, and hsp87.  T r a n s l a t i o n a l c o n t r o l on p r e - e x i s t i n g mRNAs was  observed i n c e l l s under p r o l o n g e d a r s e n i t e exposure. response i s a r e v e r s i b l e p r o c e s s i n t r o u t  The heat shock  cells.  Two cDNAs, THS70.7 and THS70.14, encoding p a r t i a l i n f o r m a t i o n d i s t i n c t species  o f t r o u t hsp70 were i s o l a t e d and c h a r a c t e r i z e d .  sequences a r e i d e n t i c a l a t 73.3% o f the n u c l e o t i d e regions of overlap,  sequences show e x t e n s i v e Drosophila  and y e a s t .  The two d e r i v e d  These  positions i n their  and t h e i r degree o f sequence c o n s e r v a t i o n  p o l y p e p t i d e l e v e l i s 88.1%.  f o r two  a t the  t r o u t hsp70 p o l y p e p t i d e  homology w i t h amino a c i d sequences f o r hsp70 from  Southern b l o t a n a l y s i s o f t r o u t t e s t i s DNA  a s m a l l number o f bands h y b r i d i z i n g t o the hsp70 genes i n t h i s The t r o u t hsp70 cDNA sequences c r o s s - h y b r i d i z e  reveals  species.  w i t h r e s t r i c t i o n fragments  i n genomic DNA from HeLa c e l l s , b o v i n e l i v e r , nematodes, and  Drosophila.  N o r t h e r n b l o t a n a l y s i s o f RNA from a r s e n i t e - i n d u c e d trout c e l l l i n e ) , using  RTG-2 c e l l s ( t h e  t h e t r o u t hsp70 cDNAs as p r o b e s , r e v e a l s t h e  presence o f t h r e e hsp70 mRNA s p e c i e s . r e s u l t i n rapid synthesis  Both heat shock and sodium a r s e n i t e  o f t r o u t hsp70 mRNA.  o f hsp70 mRNA i s v e r y r a p i d , e s p e c i a l l y d u r i n g  S i m i l a r l y the r e p r e s s i o n r e c o v e r y from a temperature  stress.  An a r t i f a c t o f cDNA c l o n i n g was i d e n t i f i e d , T31) was i s o l a t e d and c h a r a c t e r i z e d library.  i . e . an IS-element  as o r g i n a t i n g  from a t r o u t cDNA  However, f u r t h e r a n a l y s i s proved T31 t o be a p r o k a r y o t i c  element t h a t had i n s e r t e d i t s e l f i n t o pBR322 d u r i n g cDNA l i b r a r y .  (named  the p r e p a r a t i o n  mobile of the  - iv-  TABLE OF CONTENTS  Abstract  i i  L i s t of Tables  ix  L i s t of Figures  x  Abbreviations  ••x i i  Acknowledgements  I.  •  INTRODUCTION  xiv  1  1.1  The Heat-Shock Response:  General C h a r a c t e r i s t i c s  1  1.2  H i s t o r i c a l Perspective  1  1.3  Mechanisms o f I n d u c t i o n  2  1.4  Heat-Shock P r o t e i n s  5  1.4.1  Heat-Shock P r o t e i n V a r i a n t s  6  1.4.2  I n t r a c e l l u l a r L o c a l i z a t i o n o f the hsps  7  1.4.3  F u n c t i o n o f t h e Heat-Shock P r o t e i n s  8  1.5  Heat-Shock mRNAs  1.6  O r g a n i z a t i o n o f t h e Heat-Shock Genes  9 10  1.6.1  The Heat-Shock Genes  10  1.6.2  The Heat-Shock Cognates  12  1.6.3  Chromatin S t r u c t u r e o f the Heat-Shock Genes  12  1.7  R e g u l a t i o n o f t h e Heat-Shock Response  1.7.1  Transcriptional Control  14 14  - v -  1.7.2  Translational Control  1.7.3  Developmental and T i s s u e S p e c i f i c E x p r e s s i o n  1.8  o f hsps...  Responses  19 20  1.8.1  P h y s i o l o g i c a l Responses  20  1.8.2  Other E f f e c t s o f Heat-Shock  20  1.9  II.  Heat-Shock R e l a t e d  17  The P r e s e n t I n v e s t i g a t i o n  22  EXPERIMENTAL PROCEDURES  24  2.1  24  C e l l Culture  2.1.1  C e l l L i n e and Growth C o n d i t i o n s  24  2.1.2  Induction of C e l l s  24  2.2  Protein Analysis  25  2.2.1  In vivo Labelling of Proteins  25  2.2.2  L o c a l i z a t i o n of Labelled Proteins  25  2.2.3  S D S - P o l y a c r y l a m i d e G e l E l e c t r o p h o r e s i s and Autoradiography  26  D e n s i t o m e t r y Scanning o f A u t o r a d i o g r a p h s  26  2.2.4 2.3  RNA A n a l y s i s  27  2.3.1  I s o l a t i o n o f T o t a l RNA  2.3.2  P u r i f i c a t i o n of Polyadenylated  2.3.3  Sucrose D e n s i t y  2.3.4  Cell-Free Protein Translation  30  2.3.5  Trout cDNA L i b r a r i e s  30  2.3.6  Screening  30  2.3.7  RNA N o r t h e r n and Dot B l o t A n a l y s i s  Gradient  27 RNA  C e n t r i f u g a t i o n o f RNA  o f the cDNA L i b r a r i e s  28 28  32  -vi-  2.3.8 2.4  C y t o p l a s m i c Quick B l o t s o f RNA  32  DNA A n a l y s i s  2.4.1.  33  I s o l a t i o n o f P l a s m i d DNA  33  2.4.2  I s o l a t i o n o f Genomic DNA  2.4.3  R e s t r i c t i o n Endonuclease  2.4.4  Agarose G e l E l e c t r o p h o r e s i s  35  2.4.5  DNA Southern B l o t A n a l y s i s  36  2.5  35 D i g e s t i o n o f DNA  35  Maxam and G i l b e r t DNA Sequencing  36  2.5.1  E n d - L a b e l l i n g o f DNA Fragments  36  2.5.2  P r e p a r a t i v e A c r y l a m i d e Gels  37  2.5.3  B a s e - S p e c i f i c R e a c t i o n s on E n d - L a b e l l e d DNA  37  2.5.4  Sequencing  37  2.6  Gels  M13-Dideoxy Sequencing  o f DNA  39  2.6.1  C l o n i n g o f DNA i n t o M13 Phage  39  2.6.2  P r e p a r a t i o n o f S i n g l e - S t r a n d e d Templates  40  2.6.3  'Dideoxy' Chain T e r m i n a t i o n R e a c t i o n s  40  2.7  Some G e n e r a l Methods o f DNA A n a l y s i s  42  2.7.1  Recovery  2.7.2  P u r i f i c a t i o n o f DNA on Mini-Chromatography  2.7.3  L a b e l l i n g DNA by N i c k - T r a n s l a t i o n  43  2.7.4  Hybridizations  43  2.8  o f DNA from Agarose and A c r y l a m i d e Gels Columns ....  C o n s t r u c t i o n and S c r e e n i n g o f Trout Genomic L i b r a r i e s  42 42  44  2.8.1  I s o l a t i o n o f B a c t e r i o p h a g e Lambda DNA  44  2.8.2  P r e p a r a t i o n o f Lambda 'Arms'  46  - vii -  III.  2.8.3  P r e p a r a t i o n o f 15-20 K i l o b a s e Fragments o f T r o u t DNA ..  46  2.8.4  P r e p a r a t i o n of i n v i t r o Packaging E x t r a c t s  50  2.8.5  L i g a t i o n and P a c k a g i n g R e a c t i o n s  51  2.8.6  A m p l i f i c a t i o n o f t h e Lambda L i b r a r i e s  51  2.8.7  S c r e e n i n g o f t h e Lambda L i b r a r i e s  51  2.8.8  S m a l l - S c a l e Growth o f B a c t e r i o p h a g e Lambda  52  RESULTS 3.1  53  C h a r a c t e r i z a t i o n o f t h e Trout Heat Shock Response a t the P r o t e i n L e v e l  53  3.1.1  The Heat Shock P r o t e i n s o f T r o u t RTG-2 C e l l s  53  3.1.2  Temperature P r o f i l e o f the Heat Shock Response  56  3.1.3  E f f e c t o f D u r a t i o n o f t h e Heat Shock  60  3.1.4  Recovery  60  3.1.5  Sodium A r s e n i t e C o n c e n t r a t i o n Study  60  3.1.6  Recovery from Sodium A r s e n i t e I n d u c t i o n  63  3.1.7  L o c a l i z a t i o n o f t h e hsps  65  3.2  from Heat Shock  T r a n s l a t i o n a l R e g u l a t i o n o f the Heat Shock Response  68  3.2.1  I n v i t r o t r a n s l a t i o n o f mRNA  68  3.2.2  Sucrose G r a d i e n t F r a c t i o n a t i o n o f RNA  70  3.3  I s o l a t i o n o f t h e T r o u t Hsp70 cDNA c l o n e s  70  3.3.1  S c r e e n i n g o f the Trout cDNA L i b r a r y  70  3.3.2  P r e l i m i n a r y E x a m i n a t i o n o f pTHS70.7 and pTHS70.14  70  3.4  F u r t h e r A n a l y s i s o f THS70.7 and THS70.14  3.4.1  N u c l e o t i d e Sequences f o r THS70.7 and THS70.14  72 72  - viii -  3.4.2 3.5  Comparison o f Hsp70 from T r o u t , D r o s o p h i l a , and Yeast  S y n t h e s i s and Turnover  o f Trout Hsp70 mRNA  79  3.5.1  RNA N o r t h e r n and Dot B l o t A n a l y s i s  79  3.5.2  I n d u c t i o n o f Hsp70 mRNA  79  3.5.3  R e p r e s s i o n o f Hsp70 mRNA S y n t h e s i s  84  3.6  DNA Southern B l o t A n a l y s i s  3.6.1 3.6.2  88  D e t e c t i o n o f M u l t i p l e Hsp70 Genes i n t h e Trout Genome  88  I d e n t i f i c a t i o n o f H s p 7 0 - l i k e Sequences i n Other Genomes  3.7  IV.  V. VI.  . 76  90  Trout Genomic DNA L i b r a r i e s  93  3.7.1  S c r e e n i n g o f the CH4A Lambda L i b r a r y  93  3.7.2  S c r e e n i n g o f t h e L47.1 Lambda L i b r a r i e s  93  DISCUSSION  97  4.1  The Heat Shock Response i n Trout C e l l s  97  4.2  R e g u l a t i o n o f the Heat Shock Response  100  4.3  The Conserved  104  4.4  Genomic O r g a n i z a t i o n o f Hsp70 Genes  108  4.5  C o n c l u s i o n s and F u t u r e P r o s p e c t s  109  Nature o f the Heat Shock Response  BIBLIOGRAPHY APPENDIX - I s T31 an IS-Element?  ;  112 122  - ix -  LIST OF TABLES  I.  Inducers o f the Heat-Shock Response  3  II.  O c c u r r e n c e o f the Heat-Shock Response  6  III.  DNA B a s e - M o d i f i c a t i o n R e a c t i o n s f o r M & G Sequencing  38  IV.  'Dideoxy' M i x C o m p o s i t i o n  41  V.  Summary o f the Heat Shock Response i n T r o u t C e l l s  110  VI.  Comparison o f T31 t o IS4  126  - x -  L i s t of Figures  1.  P u r i f i c a t i o n of Poly A  2.  P r e p a r a t i o n o f t h e 'arms' o f phage lambda DNA  47  3.  P r e p a r a t i o n o f 15-20 Kb Mbol fragments o f Trout DNA  49  4.  The h e a t - s h o c k p r o t e i n s o f T r o u t RTG-2 c e l l s  54  5.  D e n s i t o m e t r y scans o f t h e heat shock p r o t e i n s  55  6.  D e t e c t i o n o f hsps w i t h Coomassie b l u e s t a i n i n g  57  7.  Comparison o f T r o u t and D r o s o p h i l a hsps on an SDS g e l  58  8.  Temperature p r o f i l e o f the heat shock response  59  9.  Time s t u d y o f h e a t - s h o c k  61  10.  Recovery from h e a t - s h o c k  62  11.  Hsp s y n t h e s i s a t v a r y i n g sodium a r s e n i t e c o n c e n t r a t i o n s  64  12.  Recovery from sodium a r s e n i t e i n d u c t i o n  66  13.  S u b c e l l u l a r l o c a l i z a t i o n o f the hsps  67  14.  I n v i t r o t r a n s l a t i o n p r o d u c t s o f T r o u t mRNA  69  15.  Sucrose g r a d i e n t f r a c t i o n a t i o n o f RNA  71  16.  Southern b l o t a n a l y s i s o f Trout hsp70 cDNAs  73  17. P a r t i a l r e s t r i c t i o n map and sequencing s t r a t e g y f o r THS70.7 and THS70.14  74  +  RNA on an O l i g o [ d T ] - c o l u m n  18. N u c l e o t i d e sequences f o r THS70.7 and THS70.14 w i t h p r e d i c t e d amino a c i d sequences 19. Comparison o f amino a c i d sequence D r o s o p h i l a , and Y e a s t  29  their 75  f o r hsp70 from T r o u t ,  2 0. A m a t r i x summarizing t h e n u c l e o t i d e homology and t h e amino a c i d homology between t h e d i f f e r e n t hsp70 sequences  77  78  - xi-  21. N o r t h e r n b l o t a n a l y s i s o f Trout RTG-2 RNA  80  22. I n d u c t i o n o f hsp70 mRNA by heat-shock  82  23. I n d u c t i o n o f hsp70 mRNA w i t h sodium a r s e n i t e  83  24. I n d u c t i o n o f hsp70 mRNA under d i f f e r e n t sodium concentrations  arsenite 85  25. Hsp70 mRNA l e v e l s d u r i n g r e c o v e r y from h e a t - s h o c k  86  26. Hsp70 mRNA l e v e l s d u r i n g r e c o v e r y from a r s e n i t e  87  shock  27. Southern b l o t a n a l y s i s o f genomic DNA from t r o u t t e s t i s  89  28. E f f e c t o f washing s t r i n g e n c y Southern b l o t s  91  on s i g n a l d e t e c t i o n  from genomic  29. Southern b l o t a n a l y s i s o f genomic DNA from v a r i o u s s o u r c e s  92  30. Southern b l o t a n a l y s i s o f Trout genomic c l o n e s  94  31. Southern b l o t a n a l y s i s o f Mbol p a r t i a l fragments from Trout genomic DNA  96  32. Model f o r the r e g u l a t i o n o f the Heat Shock Response  105  33. P a r t i a l r e s t r i c t i o n map and sequencing s t r a t e g y f o r THS70.7 and T31 34. N u c l e o t i d e sequence f o r T31 w i t h i t s p r e d i c t e d amino a c i d  123  sequence  124  35. I n v e r t e d r e p e a t s o f T31  125  36. Southern b l o t a n a l y s i s o f E. c o l i genomic DNA  128  - xii-  Abbreviations  APS  ammonium persulphate  ATP  adenosine triphosphate  bisacrylamide  N,N'-methylene bisacrylamide  bp  base pairs  BSA  bovine serum albumin  CAA  cas-amino acids  cDNA  complementary DNA  CHC1  chloroform  cpm  counts per minute  DAP  diaminopimelic  ddNTP  dideoxyribonucleoside triphosphate  DE  diethylaminoethyl  DMS  dimethylsulphate  DMSO  dimethylsulphoxide  dNTP  deoxyribonucleoside  DNA  deoxyribonucleic acid  DTT  dithiothreitol  EDTA  ethylenediamine  Gu'HCl  guanadinium chloride  Hepes  N-2-hydroxyethylpiperazine-N -2-ethanesulfonic  HZ  hydrazine  3  IPTG  acid  triphosphate  tetraacetate, disodium s a l t  1  isopropylthiogalactoside  acid  - xiii  -  Kb  kilobases  Kd  kilodaltons  LB  Luria-Bertani  mA  milliamperes  mRNA  Messenger  NC  nitrocellulose  PEG  polyethylene g l y c o l  pfu  plaque f o r m i n g  RF  r e p l i c a t i v e form  RNA  ribonucleic  RPC  r e v e r s e phase chromatography  rpm  revolutions  SDS  sodium d o d e c y l  TEMED  N , N , N ' , N ' , - t e t r a m e t h y l e t h y l e n e diamine  Tris  tris  U UV  units  acid  per minute sulphate  (hydroxymethyl)  aminomethane  units ultraviolet  V  volts  W  watts  X-gal  RNA  5-bromo-4-chloro-3-indolyl-B-D-galactoside  - xiv -  Acknowledgements  F i r s t and foremost, I would l i k e to acknowledge the support of my supervisor, Dr. Peter Candido, whose patience and invaluable discussions were greatly appreciated.  Second, the assistance of many colleagues  played a c r u c i a l role i n the development of this thesis; my thanks to Jane Baker, Balwant Bhullar, J e f f Hewitt, Chris Kreis, Anne Rose, Colin Hay, Elizabeth Burgess, Roland Russnak, Rob Kay, and i n p a r t i c u l a r Don Jones (without his help, many parts of this thesis would not have been possible).  Third, I thank the members of the Biochemistry  Department for  creating an e x c i t i n g environment i n which to work and play. least, I thank Ms. Debbie Bunyak for typing this thesis.  Last but not  -  XV  -  DEDICATION  to my  parents  f o r w a i t i n g so  long  - 1 -  I.  1.1  The Heat Shock Response:  INTRODUCTION  General C h a r a c t e r i s t i c s  The heat shock response p r o v i d e s an e x c e l l e n t system f o r the study o f the  p r o c e s s e s w h i c h accompany r a p i d gene i n d u c t i o n i n e u k a r y o t i c  cells.  When organisms a r e s u b j e c t e d t o a h e a t - s h o c k , t r a n s c r i p t i o n o f most genes i s suppressed and the e x p r e s s i o n o f a n o v e l s e t o f p r o t e i n s i s enhanced ( r e v i e w e d i n 1-3). polypeptides (hsps).  These i n d u c e d p r o t e i n s a r e termed the h e a t - s h o c k A v a r i e t y of agents a l s o e l i c i t  the same r e s p o n s e ,  s u g g e s t i n g t h a t the heat shock response i s p r o b a b l y a r e a c t i o n t o m e t a b o l i c s t r e s s r a t h e r than t o temperature per se.  However, s i n c e the response o f  c e l l s t o d i f f e r e n t s t r e s s s t i m u l i i s so s i m i l a r , the term "heat shock r e s p o n s e " i s used t o d e s c r i b e the g e n e r a l phenomenon.  Similarly,  "heat-shock p o l y p e p t i d e s " i s used t o d e s c r i b e the p r o t e i n s induced by t h e s e d i f f e r e n t agents. In  a d d i t i o n t o the r a p i d i n d u c t i o n and t r a n s c r i p t i o n a l c o n t r o l , the  heat shock response i s c h a r a c t e r i z e d by the presence o f a t r a n s l a t i o n a l c o n t r o l mechanism.  F i n a l l y , the heat shock response i s c h a r a c t e r i z e d by  i t s h i g h l y conserved nature.  The phenomenon i s p r e s e n t i n a l l  organisms  s t u d i e d and homology a t the m o l e c u l a r l e v e l i s o b s e r v e d .  1.2  Historical  Perspective  The d i s c o v e r y o f the heat shock response dates back t o 1962, when F. R i t o s s a f i r s t observed the changes i n p u f f i n g p a t t e r n s o f the p o l y t e n e chromosomes o f D r o s o p h i l a b u s c k i i upon temperature e l e v a t i o n ( 4 ) .  This  - 2 -  d i s c o v e r y was  f o l l o w e d up by r e p o r t s c h a r a c t e r i z i n g the p u f f i n g a c t i v i t y  induced by heat-shock  (5-8).  Thus, f o r almost t e n y e a r s a f t e r i t s  d i s c o v e r y , most o f the d a t a on the heat shock response  came from  c y t o l o g i c a l s t u d i e s on the p o l y t e n e chromosomes o f D r o s o p h i l a s a l i v a r y glands.  Due  t o the l i m i t a t i o n s o f the a v a i l a b l e t e c h n i q u e s , s t u d i e s o f the  i n d u c t i o n mechanism or o f the f u n c t i o n o f the heat shock response were not attempted. In 1974,  T i s s i e r e s e_t a l . (9) r e p o r t e d the i n i t i a l r e s u l t s from  s t u d i e s on the m o l e c u l a r e f f e c t s o f the heat shock response.  Dramatic  changes i n p r o t e i n s y n t h e s i s were c o r r e l a t e d w i t h the p u f f i n g a c t i v i t y o f p o l y t e n e chromosomes from heat-shocked heat-shock  Drosophila.  These changes i n c l u d e d  induced s y n t h e s i s o f a n o v e l s e t of p o l y p e p t i d e s and  s y n t h e s i s o f the normal complement o f p r o t e i n s .  Soon a f t e r ,  repressed  heat-shock  induced p u f f s were shown t o be s i t e s o f a c t i v e genes r e s p o n s i b l e f o r the p r o d u c t i o n of hsp mRNA (10-13). was  The c l o n i n g o f DNA  soon t o f o l l o w and the f i r s t heat-shock  were the a B - r e p e t i t i v e u n i t s o f the 87C1  from these p u f f s i t e s  induced sequences t o be  l o c u s (14, 15).  o u t , the afcS u n i t s d i d not code f o r any o f the known hsps. f o r the hsps were soon c l o n e d and a n a l y z e d I t was  1978  heat shock response  As i t t u r n e d Genes c o d i n g  (16-19).  b e f o r e s t u d i e s on the heat-shock  o t h e r than D r o s o p h i l a began i n e a r n e s t .  cloned  phenomenon i n organisms  S i n c e t h e n , the o c c u r r e n c e o f the  i n a wide v a r i e t y o f organisms has been r e p o r t e d  (reviewed i n r e f . 1, a l s o see Table I I ) .  1.3  Mechanisms o f I n d u c t i o n  As the name i m p l i e s , the heat shock response  i s induced by exposure o f  - 3 -  c e l l s t o s l i g h t l y elevated temperatures.  However, t h e response i s n o t  l i m i t e d t o temperature e l e v a t i o n ; a growing l i s t o f a l t e r n a t i v e s t i m u l i a r e b e i n g d i s c o v e r e d (see Table I ) . Due t o t h e v a r i e t y o f i n d u c i n g agents and the  r a p i d response o f c e l l s t o these p e r t u r b a t i o n s , t h e e x i s t e n c e o f a  common c e l l u l a r t a r g e t i s l i k e l y . TABLE I.  I n d u c e r s o f t h e Heat Shock Response  Agent Adenylated n u c l e o t i d e s Amino a c i d a n a l o g s Antibiotics Cold C h e l a t i n g agents Deciliation Ecdysterone Ethanol Heat Heavy m e t a l s Pyrogens ( e . g . LSD) Recovery from a n o x i a Stress Sulfhydryl oxidants Uncouplers o f o x i d a t i v e phosphorylation Viral infection  Organism  Reference  S a l m o n e l l a typhimurium E. c o l i Mammalian c e l l s Drosophila Tetrahymena Rana c u l t u r e d c e l l s C h i c k embryo c e l l s Tetrahymena Drosophila Chinese hamster c e l l s Drosophila C h i c k embryo c e l l s Rabbit Drosophila Rat Drosophila C h i c k embryo c e l l s Drosophila  21 21 20 5 22 23 24-26 27 28 29 4 30 31 5 32 21 30 4, 30  Adenovirus/HeLa  33  cells  The p r o c e s s e s o f e l e c t r o n t r a n s p o r t and o x i d a t i v e p h o s p h o r y l a t i o n would seem t o be t a r g e t s f o r many o f t h e i n d u c i n g agents l i s t e d i n Table I.  Indeed, e a r l y r e p o r t s suggested t h a t m i t o c h o n d r i a were i n v o l v e d i n t h e  i n d u c t i o n mechanism (34, 3 5 ) .  However, t h e p r e c i s e r o l e o f m i t o c h o n d r i a l  f u n c t i o n s i n t h e heat shock response has y e t t o be d e t e r m i n e d . Attempts have a l s o been made t o i s o l a t e p r e - e x i s t i n g f a c t o r s c a p a b l e of i n d u c i n g h e a t - s h o c k genes.  These i n c l u d e t h e m i t o c h o n d r i a l f a c t o r s t h a t  i n d u c e t h e h e a t - s h o c k p u f f s i n D^ h y d i i (35) and a p r o t e a s e - s e n s i t i v e , heat  - 4 -  l a b i l e f a c t o r t h a t s p e c i f i c a l l y a c t i v a t e s D r o s o p h i l a heat-shock genes i n v i t r o (36, 3 7 ) .  These i n v i t r o s t u d i e s , where n u c l e i from normal c e l l s a r e  i n c u b a t e d w i t h c y t o p l a s m i c e x t r a c t s from heat-shocked c e l l s ,  strongly  support t h e p o s s i b i l i t y t h a t p r o t e i n f a c t o r s may i n d u c e heat-shock genes (36-39).  As t o how these p r e - e x i s t i n g f a c t o r s a r e m o d i f i e d upon heat-shock  remains t o be d e t e r m i n e d . The heat shock response i s such a complex phenomenon t h a t a s i m p l e one s t e p i n d u c t i o n mechanism has t o be r u l e d o u t . observed soon a f t e r a h e a t - s h o c k .  A number o f changes a r e  One o f these i s t h e t r a n s l o c a t i o n o f a  major p r e - e x i s t i n g c y t o p l a s m i c p r o t e i n t o t h e n u c l e u s i n heat-shocked D r o s o p h i l a Kc c e l l s ( 4 0 ) . o t h e r w i s e , i s unknown.  Three DNA b i n d i n g p r o t e i n s t h a t a r e sequence  s p e c i f i c f o r a 5'-noncoding i d e n t i f i e d (41).  What r o l e i t may have, s t r u c t u r a l l y o r  r e g i o n i n t h e D r o s o p h i l a hsp70 gene have been  However, s i n c e these p r o t e i n s a r e p r e s e n t i n b o t h normal  and h e a t - i n d u c e d c e l l s , t h e i r r o l e i n gene a c t i v a t i o n i s n o t c l e a r . a l t h o u g h t h e presence o f p r o t e i n f a c t o r s i n f l u e n c i n g t h e heat  Thus,  shock  response a r e b e i n g i d e n t i f i e d , t h e i r mode o f a c t i o n o r i n d e e d how they were a c t i v a t e d i n t h e f i r s t p l a c e remains o b s c u r e . Lee e_t a l . (21) have r e c e n t l y suggested t h a t t h e common f a c t o r among i n d u c e r s o f t h e heat shock response may be t h e development stress" i n cells.  o f an " o x i d a t i o n  D u r i n g t h e s t r e s s , a d e n y l a t e d n u c l e o t i d e s accumulate i n  the c e l l and may s e r v e t o t r i g g e r t h e heat shock response.  This i n t r i g u i n g  h y p o t h e s i s c o u l d e x p l a i n t h e widespread e x i s t e n c e o f hsps i n b o t h p r o k a r y o t i c and e u k a r y o t i c c e l l s , s i n c e t h e n e c e s s i t y f o r p r o t e c t i o n from the adverse p h y s i o l o g i c a l e f f e c t s o f excess i n t r a c e l l u l a r oxygen presumably dates from e a r l y e v o l u t i o n a r y t i m e s .  In a d d i t i o n t o t h e p r e - e x i s t i n g f a c t o r s , t h e r e i s e v i d e n c e t h a t t h e t r a n s c r i p t i o n a l and t r a n s l a t i o n a l c o n t r o l o f the h e a t - s h o c k genes i s autoregulatory,  i . e . the concentration  o f f u n c t i o n a l hsps determines t h e  a c t i v i t y o f t h e h e a t - s h o c k genes ( 4 2 ) .  The t h e o r y p u t forward i s t h a t i n a  normal c e l l a low amount o f hsps i s p r e s e n t , t h e i r f u n c t i o n b e i n g t o ensure t h a t the h e a t - s h o c k genes a r e n o t a c t i v a t e d . conditions  However, i f c e r t a i n  i n a c t i v a t e t h e hsps o r cause some c e l l u l a r t a r g e t s t o i n c r e a s e  the c o n c e n t r a t i o n  and/or a f f i n i t y o f hsp b i n d i n g  a r a p i d i n d u c t i o n o f t h e heat shock r e s p o n s e . are s y n t h e s i z e d  s i t e s , then t h e r e would be  Presumably, as enough hsps  t h e a c t i v i t y o f h e a t - s h o c k genes would d e c r e a s e .  v a r i a b l e s t h a t a f f e c t t h e i n d u c t i o n mechanism i n c l u d e duration,  and n a t u r e o f t h e s t r e s s  Other  the i n t e n s i t y ,  (42-44).  F i n a l l y , adding f u r t h e r c o m p l e x i t y , p r e - e x i s t i n g mRNAs a r e s u b j e c t t o t r a n s l a t i o n a l c o n t r o l during  i n d u c t i o n o f the heat shock r e s p o n s e .  Upon  exposure t o t h e s t r e s s , t h e p r e - e x i s t i n g mRNAs a r e n o t degraded b u t m a i n t a i n e d i n an i n a c t i v e s t a t e , e n a b l i n g r a p i d l y t r a n s l a t e d (13, 45-47).  t h e h e a t - s h o c k mRNAs t o be  Yeast c e l l s a r e an e x c e p t i o n i n t h a t  they  do n o t d i s p l a y t r a n s l a t i o n a l c o n t r o l o f p r e - e x i s t i n g mRNAs and seem t o degrade them ( 4 8 ) .  An i n t e r e s t i n g f e a t u r e o f t h e heat shock response i n  Xenopus o o c y t e s i s t h a t t h e appearance o f i t s hsps i s due n o t t o new t r a n s c r i p t i o n a l a c t i v i t y , but t o the a c t i v a t i o n of t r a n s l a t i o n of stored hsp mRNAs ( 4 7 ) .  Thus, i t i s e v i d e n t t h a t d i f f e r e n t c e l l s have a l t e r e d t h e  heat shock response t o s u i t t h e i r own needs.  1.4  Heat-Shock  The  Proteins  induction of protein synthesis  by heat-shock has been p r i m a r i l y  - 6 -  s t u d i e d i n the f r u i t  fly,  melanogaster.  However, t h i s phenomenon has  now been observed i n a wide v a r i e t y o f organisms  TABLE I I .  (see Table I I ) .  Occurrence o f the Heat Shock Response  Organism  Reference  Amoebae C. e l e g a n s C h i c k e n embryo fibroblasts Chinese hamster ovary c e l l s Chironomus Drosophila E. c o l i HeLa c e l l s S e v e r a l mammalian c e l l lines  49 50 20, 51 53 4 54 55 20  The major hsps of most organisms f a l l i n t o t h r e e c l a s s e s :  Kd) p o l y p e p t i d e s .  56 57 58 59 60, 61 61  Myogenic a v i a n c e l l s Salmon embryo c e l l s Sea u r c h i n embryos Slime mold Soybean Tobacco t i s s u e culture cells Tetrahymena S. c e r e v i s i a e Xenopus  52  (15 t o 30 K d ) , the h s p 7 0 - l i k e  Reference  Organism  62 63 47  the s m a l l hsps  (60 t o 70 K d ) , and the h s p 8 3 - l i k e  (80 t o 90  These t h r e e c l a s s e s o f hsps a r e s t r o n g l y c o n s e r v e d .  A n t i b o d i e s a g a i n s t the hsp70 and hsp89 from c h i c k e n embryo f i b r o b l a s t s cross-react with t h e i r counterparts and E.A.  from a wide v a r i e t y o f organisms  B u r g e s s , p e r s o n a l communication).  (64,  Similarly, cross-hybridization  o f hsp70 genes from d i f f e r e n t organisms has been observed (50, 57, The s m a l l hsps from b o t h T K _ melanogaster and C a e n o r h a b d i t i s  65-68).  elegans share  e x t e n s i v e amino a c i d sequence homology w i t h the mammalian a - c r y s t a l l i n s (69, 7 0 ) .  1.4.1  Heat-Shock P r o t e i n V a r i a n t s  The number o f hsps i n d u c e d d u r i n g s t r e s s has t u r n e d out to be g r e a t e r than o r i g i n a l l y s u g g e s t e d .  I n D r o s o p h i l a , when these p r o t e i n s were  - 7 -  examined by h i g h r e s o l u t i o n 2 - d i m e n s i o n a l g e l e l e c t r o p h o r e s i s , t h e a c t u a l number o f hsps t u r n e d out t o be c l o s e t o 50 o r more ( 7 1 ) .  S i m i l a r l y , more  than 20 hsp v a r i a n t s have been observed i n rainbow t r o u t t i s s u e c u l t u r e c e l l s ( E . A. B u r g e s s , p e r s o n a l  communication).  Most o f these v a r i a n t s  fall  i n t o one o f t h e t h r e e c l a s s e s mentioned above and may be a r e s u l t o f p o s t - t r a n s l a t i o n a l m o d i f i c a t i o n o f an i n i t i a l  polypeptide.  The  existence  o f m u l t i g e n e f a m i l i e s f o r p a r t i c u l a r hsps has been observed and thus a number o f t h e p r o t e i n v a r i a n t s c o u l d be p r o d u c t s o f the c l o s e l y r e l a t e d genes.  I n e i t h e r c a s e , the l a r g e number o f hsp v a r i a n t s shows the  c o m p l e x i t y o f t h e heat shock r e s p o n s e . Wang ejt a l . (72) have shown t h a t hsp83 and hsp68 o f a r s e n i t e c h i c k e n embryonic c e l l s a r e m e t h y l a t e d . methylation  this  o f hsps i s not due t o an a c t i v a t i o n o f p r e - e x i s t i n g p r o t e i n  methylases.  1.4.2  They a l s o suggest t h a t  treated  A n o t h e r a l t e r a t i o n o f hsps i s v i a p h o s p h o r y l a t i o n  (64, 73, 7 4 ) .  I n t r a c e l l u l a r L o c a l i z a t i o n o f the hsps  In order to understand the functions of the hsps, t h e i r i n t r a c e l l u l a r l o c a l i z a t i o n has been examined.  Studies  on t h i s a s p e c t have been done  u s i n g a v a r i e t y o f t e c h n i q u e s i n c l u d i n g s u b - c e l l u l a r f r a c t i o n a t i o n by c e n t r i f u g a t i o n ( 4 0 , 75-77), m i c r o d i s s e c t i o n autoradiographic (80-82).  of c e l l s (53, 78), d i r e c t  a n a l y s i s (75, 78, 7 9 ) , and immunofluorescence s t a i n i n g  In general,  the s m a l l hsps a r e found i n the n u c l e u s , t h e  hsp70-like  p r o t e i n s i n b o t h t h e c y t o p l a s m and the n u c l e u s , and t h e  hsp83-like  p r o t e i n s e x c l u s i v e l y i n the c y t o p l a s m .  nuclear  In Drosophila, the  hsps a r e h i g h l y r e s i s t a n t t o e x t r a c t i o n w i t h h i g h  concentrations  salt  and a r e a s s o c i a t e d w i t h c h r o m a t i n and n u c l e o l i  (40, 75, 7 6 ) . Upon r e t u r n o f t h e D r o s o p h i l a  preparations  c e l l s t o normal t e m p e r a t u r e s ,  - 8 -  the n u c l e a r hsps r e t u r n t o t h e c y t o p l a s m  (75).  Although  these e a r l y  r e s u l t s suggested an a s s o c i a t i o n o f the hsps w i t h the c h r o m a t i n , d a t a i m p l y a d i f f e r e n t n u c l e a r r o l e f o r some o f these p r o t e i n s .  recent For  i n s t a n c e , S i n i b a l d i and M o r r i s (77) have r e p o r t e d t h a t the b i n d i n g o f c e r t a i n hsps appeared t o be p r i m a r i l y t o the n u c l e a r s c a f f o l d r a t h e r than t o the c h r o m a t i n  o f heat-induced  D r o s o p h i l a Kc c e l l s .  In addition,  immunofluorescent s t a i n i n g o f c h i c k e n embryo f i b r o b l a s t s w i t h a n t i b o d i e s t o t h e i r hsps suggests t h a t c h i c k e n hsp89 i s s t r i c t l y c y t o p l a s m i c , whereas c h i c k e n hsp70 and hsp24 appear t o be p r e s e n t  throughout the c e l l i n  a s s o c i a t i o n w i t h i t s c y t o s k e l e t o n (80, 8 1 ) . I n d i r e c t immunofluorescence techniques  have shown t h e hsplOO o f c e r t a i n mammalian c e l l s t o be l o c a l i z e d  i n the G o l g i apparatus ( 8 2 ) .  The p o s s i b l e a s s o c i a t i o n o f the heat shock  response w i t h e l e c t r o n t r a n s p o r t was d i s c u s s e d e a r l i e r ; r e s u l t s w i t h t h i s i d e a came from a u t o r a d i o g r a p h i c o f hsp d i s t r i b u t i o n i n h e a t - i n d u c e d  conflicting  and e l e c t r o n m i c r o s c o p i c a n a l y s i s  Drosophila.  V e l a z q u e z et_ a l . (79)  showed t h a t i n s i g n i f i c a n t amounts o f the hsps a r e found i n a s s o c i a t i o n w i t h mitochondria.  1.4.3  F u n c t i o n o f the Heat-Shock P r o t e i n s  Thus f a r , hsp c h a r a c t e r i z a t i o n has n o t r e v e a l e d t h e t r u e n a t u r e o f t h e i r r o l e s ; however, s i n c e these p r o t e i n s occur i n such d i v e r s e o r g a n i s m s , t h e i r r o l e s a r e l i k e l y t o be o f a fundamental n a t u r e w i t h i n c e l l s . general homeostatic  A  f u n c t i o n was p o s t u l a t e d f o r t h e heat shock response  f a i r l y e a r l y i n i t s study  (83).  In the past three t o four years, s t u d i e s  on a v a r i e t y o f organisms have l e d t o t h e c o n c l u s i o n t h a t hsps c o n f e r thermotolerance  upon c e l l s ( 2 9 , 84-88).  I n d u c t i o n o f hsps by means o t h e r  than heat has a l s o been shown t o induce t r a n s i e n t t h e r m o t o l e r a n c e i n  -  Chinese hamster  f i b r o b l a s t s (29).  9  -  A d d i t i o n a l support f o r the p r o t e c t i v e  f u n c t i o n o f the hsps comes from s t u d i e s on D i c t y o s t e l i u m , where a mutant s t r a i n unable t o e x p r e s s hsps i s a l s o unable t o induce t h e r m o t o l e r a n c e (87).  An i n t e r e s t i n g h y p o t h e s i s was p u t f o r t h by M i n t o n ( 8 9 ) , who  suggested t h a t hsps might c o n t r i b u t e t o enhanced t h e r m o t o l e r a n c e i n c e l l s by n o n - s p e c i f i c a l l y s t a b i l i z i n g s t r e s s - s u s c e p t i b l e p r o t e i n s . Other f u n c t i o n s f o r hsps i n c l u d e a r e g u l a t o r y r o l e .  In Drosophila,  the absence o f f u n c t i o n a l hsps (and p a r t i c u l a r l y hsp70) p r e v e n t s c e l l s  from  a t t a i n i n g complete r e c o v e r y a f t e r h e a t - s h o c k ( 4 2 ) .  1.5  Heat-Shock mRNAs  D u r i n g the heat shock r e s p o n s e , t h e d r a m a t i c a l t e r a t i o n i n t h e p a t t e r n of p r o t e i n s y n t h e s i s i s accompanied  by a p a r a l l e l change i n t h e  d i s t r i b u t i o n o f ribosomes on polysomes  (10).  P r e - e x i s t i n g polysomes  r a p i d l y d i s s o c i a t e and t h e ribosomes then form new polysomes. these changes, p r e - e x i s t i n g mRNA i s s t i l l  Despite  found i n t h e c y t o p l a s m o f  heat-shocked c e l l s and can be t r a n s l a t e d i n v i t r o (13, 45-47).  Thus t h e  s e l e c t i v e t r a n s l a t i o n o f hsp mRNA i n h e a t - s h o c k e d c e l l s i m p l i e s a s p e c i f i c r e c o g n i t i o n o f hsp mRNA by t h e ribosomes. B a l l i n g e r and Pardue  (90) have shown p r e - e x i s t i n g mRNAs a r e p r e s e n t i n  heat-shocked D r o s o p h i l a c e l l s , a s s o c i a t e d w i t h ribosomes and RNP particles.  They suggest t h a t t h e t r a n s l a t i o n o f t h e 25°C mRNAs may be  r e p r e s s e d by a s e l e c t i v e i n h i b i t i o n o f t h e i r e l o n g a t i o n .  The same  c o n c l u s i o n was reached by Thomas and Matthews (91) from t h e i r s t u d i e s on heat-shock mRNAs o f HeLa c e l l s .  There i s one r e p o r t e d  structural  d i f f e r e n c e between 25°C mRNA i n c o n t r o l and induced D r o s o p h i l a c e l l s .  The  - 10 -  25°C mRNAs i n h e a t - s h o c k e d c e l l s l a c k t h e a b i l i t y t o b i n d t o o l i g o [ d T ] - c e l l u l o s e , s u g g e s t i n g an absence o f t h e n o r m a l l y p r e s e n t A  tail  (45).  poly  U n l i k e D r o s o p h i l a , when y e a s t c e l l s a r e induced by h e a t ,  the p r e - e x i s t i n g mRNAs a r e n o t s e q u e s t e r e d  on polysomes b u t a r e a l l o w e d t o  degrade a t t h e i r normal r a t e s ( 4 8 ) . A c h a r a c t e r i s t i c o f hsp mRNAs, a t l e a s t i n D r o s o p h i l a , i s t h e presence o f an u n u s u a l l y l o n g 5'-noncoding r e g i o n . to 253 bp i n l e n g t h (92-94).  T h i s r e g i o n v a r i e s from 111 bp  The l e a d e r sequences o f hsp70 and s m a l l hsp  mRNAs from D r o s o p h i l a have an u n u s u a l l y h i g h ( a p p r o x i m a t e l y content  l-  (94).  The l o n g l e a d e r sequences o f hsp mRNAs  p l a y a r o l e i n t h e s e l e c t i v e t r a n s l a t i o n o f these messages. Although  t h e e x p r e s s i o n o f a l l h e a t - s h o c k genes appears r e g u l a t e d i n a  s i m i l a r manner, t h e r e a r e e x c e p t i o n s . hsp83 p o l y p e p t i d e appears t o be p r e s e n t 71).  For instance, i n Drosophila, the i n n o r m a l l y growing c e l l s  (43, 45,  I n a d d i t i o n , t h e hsp83 gene i s t h e o n l y known D r o s o p h i l a h e a t - s h o c k  gene t o c o n t a i n an i n t e r v e n i n g sequence ( 1 7 ) .  The o n l y o t h e r known  h e a t - s h o c k gene t o c o n t a i n an i n t r o n i s the h s p l 6 gene o f Russnak, p e r s o n a l  1.6  adenosine  (92, 9 3 ) ; i n c o n t r a s t , t h e adenosine c o n t e n t o f t h e 5 n o n c o d i n g  r e g i o n o f hsp83 i s much lower may  50%)  e l e g a n s (R.  communication).  O r g a n i z a t i o n o f t h e Heat-Shock Genes  1.6.1  The Heat-Shock Genes  Although  t h e heat shock response has been s t u d i e d i n a number o f  organisms (see T a b l e I I ) , t h e o r g a n i z a t i o n o f t h e hsp genes has been primarily studied i n Drosophila.  A l l the major heat-shock genes i n D.  m e l a n o g a s t e r have been c l o n e d , mapped, and sequenced (16-19, 69, 92-102).  - 11 -  These genes f a l l  i n t o three c l a s s e s :  the hsp83 gene w h i c h i s p r e s e n t  ina  s i n g l e copy a t chromosomal l o c u s 63BC ( 1 7 ) , the hsp70 genes w h i c h a r e present and  i n f i v e c o p i e s , two a t l o c u s 87A and t h r e e a t l o c u s 87C (17, 9 8 ) ,  the s m a l l h e a t - s h o c k genes c o d i n g f o r hsp22, 23, 26, 27, a l l p r e s e n t a t  l o c u s 67B w i t h i n an 11 Kb r e g i o n (18, 19, 1 0 1 ) . I n a d d i t i o n , the hsp68 gene i s p r e s e n t  i n a s i n g l e copy a t l o c u s 95D ( 1 7 ) . Each o f the hsp70  genes i s o r g a n i z e d w i t h i n a 2.5 Kb conserved element c o n s i s t i n g o f a 2.1 Kb mRNA c o d i n g r e g i o n , and a 0.4 Kb 5' r e g i o n w h i c h i s n o t t r a n s c r i b e d (96, 97, 9 9 ) . The hsp70 genes a t l o c u s 87A a r e a p p r o x i m a t e l y  1.7 Kb a p a r t and  i n o p p o s i t e o r i e n t a t i o n (101, 1 0 3 ) . Two o f the hsp70 gene c o p i e s a t 87C are i n a tandem r e p e a t s e p a r a t e d  from t h e t h i r d gene by about 40 Kb o f DNA  t h a t c o n t a i n s the c»3-repetitive u n i t s ( 1 0 4 ) .  Due t o t h e s i m i l a r i t y o f  these f i v e hsp70 genes i n IK m e l a n o g a s t e r , i t has been suggested t h a t t h e genes a t 87A and 87C a r e not e v o l v i n g i n d e p e n d e n t l y  and t h a t gene  c o n v e r s i o n has o c c u r r e d b o t h w i t h i n and between hsp70 l o c i  (105).  As mentioned e a r l i e r , a l l f o u r s m a l l hsp genes i n D^ m e l a n o g a s t e r a r e present  i n s i n g l e c o p i e s w i t h i n an 11 Kb r e g i o n a t l o c u s 67B.  These f o u r  genes have p a r t i a l homology among themselves (69) and may thus be a r e s u l t o f d u p l i c a t i o n s o f an a n c e s t r a l gene. Very l i t t l e  sequence i n f o r m a t i o n about t h e hsp genes from o t h e r  organisms has been r e p o r t e d . briefly.  The a v a i l a b l e i n f o r m a t i o n can be summarized  The n u c l e o t i d e sequence o f an i n d u c i b l e hsp70 gene from y e a s t has  been r e p o r t e d  ( 6 5 ) . I t shows about 72% sequence homology t o D r o s o p h i l a  hsp70 a t t h e p r o t e i n l e v e l .  Very r e c e n t l y , B a r d w e l l and C r a i g (68)  r e p o r t e d t h e n u c l e o t i d e sequence o f the and showed i t t o be 48% i d e n t i c a l protein of Drosophila.  c o l i h e a t - i n d u c i b l e dnaK gene  a t t h e p o l y p e p t i d e l e v e l t o the hsp70  The o n l y o t h e r r e p o r t e d sequences f o r hsp genes i s  - 12 -  by Russnak ejt a l . (70) who from Cj_ e l e g a n s . from  p r e s e n t e d the cDNA sequences  coding f o r hspl6  I n t e r e s t i n g l y , the C\_ e l e g a n s h s p l 6 and the s m a l l hsps  m e l a n o g a s t e r both share e x t e n s i v e amino a c i d sequence homology w i t h  the mammalian a - c r y s t a l l i n s (68, 70). o f Cj_ e l e g a n s DNA  Study of the genomic o r g a n i z a t i o n  has r e v e a l e d the presence o f two (and p o s s i b l y more)  c l o s e l y l i n k e d s m a l l heat-shock genes (R. Russnak, p e r s o n a l communication).  1.6.2  The Heat-Shock Cognates  S e v e r a l r e p o r t s have d e s c r i b e d the presence o f heat-shock  related  genes t h a t a r e e x p r e s s e d c o n s t i t u t i v e l y a t some time d u r i n g normal development.  These genes are not n e c e s s a r i l y induced by heat-shock.  The  d e v e l o p m e n t a l l y r e g u l a t e d heat-shock genes w i l l be d e s c r i b e d i n a s e p a r a t e section. I n g o l i a and C r a i g (68, 102) have r e p o r t e d a number o f h s p 7 0 - l i k e genes from D r o s o p h i l a and Sj_ c e r e v i s i a e .  These cognate genes are not  h e a t - i n d u c i b l e and are n o r m a l l y e x p r e s s e d d u r i n g development.  Unlike  hsp70, some o f t h e s e cognate genes have been shown to have l a r g e (102).  The  introns  f u n c t i o n o f these cognate gene p r o d u c t s remains to be  determined.  1.6.3  Chromatin S t r u c t u r e of the Heat-Shock Genes  The changes i n c h r o m a t i n s t r u c t u r e accompanying gene a c t i v a t i o n have been e x p r e s s e d i n terms o f s e n s i t i v i t y t o c e r t a i n n u c l e a s e s ( r e v i e w e d i n 106).  There are t h r e e b r o a d l y d e f i n e d l e v e l s o f n u c l e a s e s e n s i t i v i t y :  low  l e v e l s e n s i t i v i t y o f b u l k c h r o m a t i n , moderate s e n s i t i v i t y o f r e g i o n s encoding gene sequences  e x t e n d i n g a few Kb i n e i t h e r d i r e c t i o n , and  finally  - 13 -  a h y p e r s e n s i t i v i t y i n v o l v i n g s m a l l domains u s u a l l y i n the 5' o r 3' f l a n k i n g r e g i o n s o f a t r a n s c r i p t i o n a l l y a c t i v e gene.  A v a r i e t y o f n u c l e a s e s have  been used t o measure the s e n s i t i v i t y o f c h r o m a t i n , the most u t i l i z e d ones b e i n g d e o x y r i b o n u c l e a s e I (DNAase I ) and m i c r o c o c c a l n u c l e a s e (MNase). The c h r o m a t i n s t r u c t u r e o f the major h e a t - s h o c k genes o f D r o s o p h i l a has been a n a l y z e d i n d e t a i l (summarized  i n 107).  U s i n g an i n d i r e c t end-  l a b e l l i n g t e c h n i q u e , Wu (108) has demonstrated the presence o f DNAase I h y p e r s e n s i t i v e s i t e s 5' t o the hsp70 and hsp83 genes i n D r o s o p h i l a embryos and t i s s u e c u l t u r e c e l l s .  These h y p e r s e n s i t i v e s i t e s a r e p r e s e n t i n b o t h  normal and heat-shocked c e l l s ; however, the DNAase I s e n s i t i v i t y o f the whole gene i s i n c r e a s e d upon i n d u c t i o n ( 1 9 8 ) .  S i m i l a r DNAase I  h y p e r s e n s i t i v e s i t e s have been demonstrated a t o r near the 5 o f the f o u r s m a l l h e a t - s h o c k genes i n D r o s o p h i l a ( 1 0 9 ) .  1  end o f each  Upon heat  i n d u c t i o n , the h e a t - s h o c k genes r a p i d l y adopt an open c h r o m a t i n s t r u c t u r e and t h e i r s e n s i t i v i t y t o n u c l e a s e s i s i n c r e a s e d ( 1 1 0 ) .  The a d o p t i o n o f the  open c o n f i g u r a t i o n may be a u t o - r e g u l a t e d by the presence o r absence o f f u n c t i o n a l hsps ( 4 2 ) .  t  As f a r as nucleosome s t r u c t u r e i s concerned, L e v i n g e r and V a r s h a v s k y (111) have r e p o r t e d t h a t the hsp70 genes o f D r o s o p h i l a c o n t a i n h e a v i l y u b i q u i t i n a t e d nucleosomes. o f nucleosomes.  T h i s i s i n c o n t r a s t t o the g e n e r a l p o p u l a t i o n  I t i s suggested t h a t the n u c l e o s o m a l p r o t e i n s from the  a c t i v a t e d chromosomal r e g i o n may be p r o t e o l y t i c a l l y removed and t h e r e b y cause the i n c r e a s e d n u c l e a s e s e n s i t i v i t y o f the DNA observed i n a c t i v e l y t r a n s c r i b i n g genes ( 1 1 1 ) . R e c e n t l y , Karpov ejt a l .  (112) have r e p o r t e d the s e l e c t i v e removal o f  h i s t o n e s from the c o d i n g r e g i o n o f induced hsp70 genes i n IK_ m e l a n o g a s t e r . T h i s , i n a d d i t i o n t o the l a c k o f h i s t o n e s a t the 5' h y p e r s e n s i t i v e  sites,  - 14 -  may be t h e cause o f t h e i n c r e a s e d a c c e s s i b i l i t y t o n u c l e a s e s o f t h e s e regions. Mace e_t a l . (113) have demonstrated  t h e presence o f an SI  n u c l e a s e - s e n s i t i v e s t r u c t u r e a s s o c i a t e d w i t h s h o r t d i r e c t r e p e a t s o f DNA found i n the 5' f l a n k i n g r e g i o n s o f c e r t a i n IK m e l a n o g a s t e r genes.  heat-shock  S i n c e t h i s s t u d y was done on i s o l a t e d p l a s m i d s c o n t a i n i n g the  c l o n e d genes, a p r e c i s e r o l e f o r these SI n u c l e a s e - s e n s i t i v e s t r u c t u r e s has not been d e t e r m i n e d .  1.7  R e g u l a t i o n o f t h e Heat Shock Response  1.7.1  Transcriptional  Control  In order t o i d e n t i f y the v a r i o u s s i g n a l s necessary f o r proper i n d u c t i o n and t r a n s c r i p t i o n o f D r o s o p h i l a h e a t - s h o c k genes, hsp70 were i n t r o d u c e d i n t o a v a r i e t y o f h e t e r o l o g o u s systems. mouse c e l l s ( 1 1 4 ) , r a t c e l l s ( 1 1 5 ) , monkey COS c e l l s o o c y t e s (118-120), and y e a s t c e l l s ( 1 2 1 ) .  sequences  These i n c l u d e d  (116, 1 1 7 ) , Xenopus  The e x p r e s s i o n o f these genes  was h e a t - i n d u c i b l e i n d i c a t i n g t h a t the i n d u c t i o n mechanisms and c o n t r o l s i g n a l s f o r t h e heat shock response a r e conserved between D r o s o p h i l a and the t e s t e d organism.  I n a d d i t i o n t o the TATA box, an upstream  element was d i s c o v e r e d .  promoter  From d e l e t i o n s t u d i e s , a 70 bp s t r e t c h o f sequence  i n t h e 5' f l a n k i n g r e g i o n o f the hsp70 gene was determined t o be n e c e s s a r y f o r h e a t - i n d u c i b i l i t y , t h e r e g i o n spanning -47 t o -66 b e i n g a b s o l u t e l y n e c e s s a r y (116, 1 1 7 ) . W i t h i n t h i s s h o r t s t r e t c h o f DNA l i e s an i m p e r f e c t inverted repeat (92). promoter  Pelham (117) searched f o r a s i m i l a r  upstream  i n o t h e r D r o s o p h i l a h e a t - s h o c k genes and d e r i v e d a consensus  sequence f o r t h i s  element:  - 15 -  5'  CT-GAA—TTC-AG  14-28  bp  TATA  3'  An i m p e r f e c t i n v e r t e d repeat i s e v i d e n t i n the sequence and c o u l d p l a y a role i n protein recognition.  D e l e t i o n s i n t h i s r e g i o n g r e a t l y decrease the  t r a n s c r i p t i o n o f the hsp70 gene d u r i n g h e a t - s h o c k ( 1 1 7 ) .  Pelham and  Bienz  (119) have c o n s t r u c t e d a s y n t h e t i c h e a t - s h o c k promoter element and used i t t o c o n f e r h e a t - i n d u c i b i l i t y on the herpes s i m p l e x v i r u s thymidine gene. 1.3  kinase  Corces et a l . (122) have c o n s t r u c t e d a f u s i o n gene h y b r i d c o n t a i n i n g  Kb o f the 5' sequence o f the D r o s o p h i l a hsp70 gene j o i n e d t o the e n t i r e  p r o t e i n - c o d i n g r e g i o n o f a human growth hormone gene. found t o be h e a t - i n d u c i b l e i n mouse c e l l s . promoters i n f u s i o n genes may  T h i s h y b r i d gene  was  The use o f such h e a t - s h o c k  be p a r t i c u l a r y advantageous i n the c o n t r o l l e d  e x p r e s s i o n o f c e r t a i n genes o f m e d i c a l o r commercial i n t e r e s t . R e c e n t l y , the d e s i g n and c o n s t r u c t i o n o f an i n - f r a m e the  c e r e v i s i a e hsp90 gene and the  (123).  When t h i s f u s i o n gene was  c o l i l a c Z gene has been r e p o r t e d  i n t r o d u c e d back i n t o y e a s t on a m u l t i c o p y  plasmid vector, i t s t i l l e x h i b i t e d h e a t - i n d u c i b i l i t y .  Moreover, the  p r o t e i n product had an a c t i v e 3 - g a l a c t o s i d a s e a c t i v i t y . D r o s o p h i l a hsp70 gene was  f u s i o n between  fused  Similarly, a  f u s e d t o the Jj^ c o l i 3 - g a l a c t o s i d a s e gene  (124)  and i n t r o d u c e d back i n t o the D r o s o p h i l a g e r m l i n e by the P-element m i c r o i n j e c t i o n method o f Rubin and S p r a d l i n g ( 1 2 5 ) . tS-galactosidase a c t i v i t y i n the t r a n s f o r m a n t s  As expected,  i s heat-inducible.  the These  l a t t e r r e s u l t s s h o u l d make i t e a s i e r to i n v e s t i g a t e the t r a n s c r i p t i o n a l t r a n s l a t i o n a l r e g u l a t i o n i n the heat shock response.  In a d d i t i o n ,  d e v e l o p m e n t a l and t i s s u e s p e c i f i c e x p r e s s i o n o f these genes can be more readily studied. A system t h a t seems t o have a t o t a l l y d i f f e r e n t  transcriptional  c o n t r o l mechanism f o r the heat shock response has been d e s c r i b e d f o r  and  - 16 -  Xenopus o o c y t e s ( 4 7 ) .  I n t h i s system, h e a t - s h o c k mRNA a r e p r e s e n t i n  normal c e l l s but a r e s t o r e d i n an i n a c t i v e s t a t e by a unique c o n t r o l mechanism.  Upon h e a t - s h o c k , t h e s e mRNAs a r e r a p i d l y a c t i v a t e d and the heat  shock response proceeds as u s u a l . adaptation  necessitated  T h i s form o f c o n t r o l i s presumably  an  by the v e r y l a r g e s i z e o f the o o c y t e , and the  r e s u l t i n g r e q u i r e m e n t f o r l a r g e amounts o f hsps w i t h i n a v e r y s h o r t  time  p e r i o d , w h i c h c o u l d not be s u p p l i e d by t r a n s c r i p t i o n . The mechanism o f i n d u c t i o n and the f u n c t i o n o f hsps can be more r e a d i l y through g e n e t i c a n a l y s i s . response i n  elucidated  For t h i s purpose, the heat shock  c o l i w i l l c e r t a i n l y a t t r a c t more a t t e n t i o n .  As mentioned  above, a response t o heat has been observed i n t h i s m i c r o o r g a n i s m ( 5 4 ) . Further  a n a l y s i s has r e v e a l e d  the presence o f a group o f  heat-inducible  p r o t e i n s w h i c h a r e a l l under the t r a n s c r i p t i o n a l c o n t r o l of a s i n g l e gene c a l l e d h i n o r htpR (126, 127).  M u t a t i o n s i n t h i s gene w i l l  prove  i n v a l u a b l e i n p i n - p o i n t i n g the mechanism o f i n d u c t i o n and the r o l e o f hsps.  Four o f the h e a t - i n d u c i b l e  identified:  proteins  from  c o l i have been  a l y s y l tRNA s y n t h e t a s e , and the groEL, groES, and dnaK gene  p r o d u c t s (127-129).  The l a s t t h r e e p r o t e i n s a r e e s s e n t i a l f o r growth o f  b a c t e r i o p h a g e lambda and m u t a t i o n s i n those genes r e n d e r the b a c t e r i a temperature s e n s i t i v e f o r growth a t 43°C (130-133).  Recently,  T i l l y et a l .  (134) showed t h a t the dnaK p r o t e i n may modulate the heat shock response o f E. c o l i .  They demonstrated t h a t one o f the r o l e s f o r the dnaK p r o t e i n  t o shut o f f the response i n E ^ c o l i . those o f DiDomenico ejt a l . (42) who the hsp70 o f D r o s o p h i l a .  These l a t t e r r e s u l t s f i t w e l l suggested an a u t o r e g u l a t o r y  with  role for  These r e s u l t s a r e even more s t r i k i n g i n l i g h t o f  the r e p o r t showing homology between the dnaK p r o t e i n o f E^ c o l i and the Drosophila  hsp70 ( 6 8 ) .  was  - 17 -  1.7.2  Translational  Control  One o f t h e c h a r a c t e r i s t i c s o f t h e heat shock response i s t h e r a p i d e x p r e s s i o n o f the h e a t - s h o c k mRNA.  Upon h e a t - s h o c k , p r e - e x i s t i n g  polysomes  r a p i d l y d i s a g g r e g a t e and new polysomes a r e s e l e c t i v e l y formed on heat-shock mRNA ( 1 0 ) . explain  Thus t h e p r e f e r e n t i a l t r a n s l a t i o n o f h e a t - s h o c k mRNAs may  t h e r a p i d appearance o f hsps i n t h e s t r e s s e d  of normal mRNA i n y e a s t c e l l s i s much s h o r t e r may  explain  cell.  than t h a t  The h a l f - l i f e  i n D r o s o p h i l a and  t h e absence o f t r a n s l a t i o n a l c o n t r o l o f p r e - e x i s t i n g mRNAs i n  yeast (48). In D r o s o p h i l a , t h e r e t u r n o f heat-shocked c e l l s t o t h e i r normal temperature causes r e l e a s e  o f t h e t r a n s l a t i o n a l c o n t r o l and p r e - e x i s t i n g  mRNAs a r e no l o n g e r s e l e c t i v e l y r e p r e s s e d ( 4 5 ) .  That t h e s e messages a r e  not degraded was a l s o demonstrated by in_ v i t r o t r a n s l a t i o n o f mRNA extracted  from h e a t - s h o c k e d D r o s o p h i l a c e l l s (13, 45, 4 6 ) .  However, i f  l y s a t e s a r e p r e p a r e d from heat-shocked D r o s o p h i l a c e l l s and used f o r t h e i n v i t r o t r a n s l a t i o n s t u d i e s , h e a t - s h o c k messages a r e p r e f e r e n t i a l l y translated  (45, 4 6 ) .  In contrast,  similar lysates  t r a n s l a t e b o t h normal and h e a t - s h o c k mRNA (45, 4 6 ) .  from c o n t r o l c e l l s The f a c t o r s  will  .  r e s p o n s i b l e f o r t h e p r e f e r e n t i a l t r a n s l a t i o n o f h e a t - s h o c k mRNA i n h e a t - s h o c k l y s a t e s have been l o c a l i z e d t o t h e r i b o s o m a l f r a c t i o n ( 1 3 4 ) . Addition  o f crude r i b o s o m a l f r a c t i o n s from c o n t r o l  heat-shock l y s a t e releases the repression (134).  lysates  to the  o f normal mRNA t r a n s l a t i o n  G l o v e r (135) and Sanders e t a l . (136) have demonstrated t h a t t h e  h e a t - i n d u c e d r a p i d d e p h o s p h o r y l a t i o n o f an S 6 - l i k e r i b o s o m a l p r o t e i n i n D r o s o p h i l a c l o s e l y p a r a l l e l s t h e h e a t - s h o c k i n d u c e d breakdown o f polysomes, suggesting a possible  r e l a t i o n s h i p between t h e p h o s p h o r y l a t i o n o f t h i s  p r o t e i n and t r a n s l a t i o n .  The r e s p o n s e , however, seems t o be h e a t - s p e c i f i c  - 18 -  s i n c e o t h e r c h e m i c a l i n d u c e r s do n o t cause t h e same d e p h o s p h o r y l a t i o n ( 1 8 7 ) . L i n d q u i s t (48) has shown t h a t p r e - e x i s t i n g mRNAs i n D r o s o p h i l a can be r e p e a t e d l y s e q u e s t e r e d and r e l e a s e d through a number o f h e a t - s h o c k / r e c o v e r y c y c l e s ; however, t h e s y n t h e s i s o f hsps g r a d u a l l y d e c r e a s e s i n t h e presence of a c t i n o m y c i n D.  Thus, a l t h o u g h normal messages a r e p r o t e c t e d d u r i n g  h e a t - s h o c k , t h e r e v e r s e i s n o t t r u e , i . e . h e a t - s h o c k mRNAs a r e degraded during recovery.  I t has a l s o been demonstrated  i n i t i a t i o n o f mRNA t r a n s l a t i o n a r e comparable heat-shock mRNAs (48, 137).  that the rates of  f o r b o t h normal and  However, B a l l i n g e r and Pardue  (90) have  r e c e n t l y r e p o r t e d t h a t t h e r a t e s o f b o t h e l o n g a t i o n and i n i t i a t i o n o f t r a n s l a t i o n a r e reduced 15- t o 30- f o l d on normal mRNAs compared t o heat-shock mRNAs. I t s h o u l d be noted t h a t t h e r e g u l a t i o n o f t r a n s c r i p t i o n and t r a n s l a t i o n d u r i n g t h e heat shock response do n o t o c c u r i n d e p e n d e n t l y o f each o t h e r b u t a r e i n f a c t c o o r d i n a t e d .  I t i s a l s o noteworthy t h a t t h i s  s t r e s s response i s n o t r e g u l a t e d i n an a l l o r none manner; t h e l e v e l o f hsp i n d u c t i o n i s dependent on t h e s e v e r i t y o f t h e s t r e s s .  F o r i n s t a n c e , i n D.  m e l a n o g a s t e r , t h e i n t e n s i t y o f t h e response v a r i e s w i t h t h e temperature o f h e a t - s h o c k and t h e time o f exposure t o the s t r e s s (42, 4 8 ) .  In addition,  the r a t e o f r e c o v e r y depends on t h e s t r e n g t h o f t h e i n i t i a l s t r e s s ( 4 4 ) . The h e a t - s h o c k and r e c o v e r y o f D r o s o p h i l a c e l l s have been shown t o be i n f l u e n c e d by t h e c o n c e n t r a t i o n o f f u n c t i o n a l hsps ( e s p e c i a l l y h s p 7 0 ) ; f o r i n s t a n c e , i f t h e p r o d u c t i o n o f hsps i s b l o c k e d , t r a n s c r i p t i o n o f heat-shock mRNAs c o n t i n u e s and t h e i r s t a b i l i t y i s i n c r e a s e d ( 4 2 ) .  However, as soon as  f u n c t i o n a l hsps a r e p r e s e n t , t r a n s c r i p t i o n o f heat-shock mRNAs i s reduced and t h e i r s t a b i l i t y d e c r e a s e s ( 4 4 ) . From the above d i s c u s s i o n i t s h o u l d be f a i r l y apparent t h a t t h e  - 19 -  r e g u l a t i o n o f the heat  shock response i s dependent on a v a r i e t y o f f a c t o r s ,  i n c l u d i n g the i n t e n s i t y , d u r a t i o n , and nature  o f the s t r e s s , and the  presence o f f u n c t i o n a l hsps f o r a u t o r e g u l a t i o n and r e c o v e r y . p r e - e x i s t i n g mRNAs a r e s u b j e c t t o t r a n s l a t i o n a l c o n t r o l . obvious  t h a t the r u l e s governing  there are exceptions, i n Xenopus oocytes  It i s also  t h i s r e g u l a t i o n a r e not r i g i d  and t h a t  e.g. s t o r a g e o f heat-shock mRNA d u r i n g normal growth  (47) and the absence o f t r a n s l a t i o n a l c o n t r o l on  p r e - e x i s t i n g mRNAs i n heat-shocked y e a s t c e l l s o f the heat  In a d d i t i o n ,  (48).  Thus the r e g u l a t i o n  shock response i s a complex process w i t h m a n i f e s t a t i o n s a t  s e v e r a l stages o f gene e x p r e s s i o n .  1.7.3  Developmental and T i s s u e S p e c i f i c E x p r e s s i o n o f hsps  U n t i l r e c e n t l y , i t was thought t h a t the heat i n a l l t i s s u e s and a t a l l stages o f development. developmental r e g u l a t i o n o f the hsps. preblastoderm  accumulation  occurred  There i s now evidence f o r  F o r example, D r o s o p h i l a  embryos have a low i n d u c i b i l i t y o f hsps (138, 139).  S i m i l a r l y , i n developing post-hatching  shock response  stages  sea u r c h i n s hsps a r e o n l y i n d u c i b l e i n  (140).  Recently,  Zimmerman e t a l . (141) r e p o r t e d the  o f mRNAs f o r D r o s o p h i l a hsps 83, 28, and 26 i n a d u l t o v a r i e s .  These messages were d e t e c t e d d u r i n g normal development and were abundant i n embryos u n t i l  the blastoderm  stage, s u g g e s t i n g  the presence of d i f f e r e n t i a l  c o n t r o l o f heat-shock gene e x p r e s s i o n d u r i n g development (141).  Another  such spontaneous e x p r e s s i o n o f hsps i s r e p o r t e d f o r mouse embryonal carcinoma c e l l s ,  and f o r ectoderms from day 8 mouse embryos  A l i n k between hsps and v i r a l  t r a n s f o r m a t i o n has a l s o been found. F o r  i n s t a n c e , mammalian hsp70 s y n t h e s i s i s induced adenovirus  (33) and by papovavirus  (142).  infection  by an e a r l y gene product o f  (143).  In a d d i t i o n the  - 20 -  c h i c k e n hsp89 has been shown t o b i n d t o t y r o s y l p r o t e i n k i n a s e s o f a v i a n sarcoma v i r u s e s ( 7 3 , 7 4 ) . hsps i n D r o s o p h i l a  The e c d y s t e r o n e induced s y n t h e s i s o f the s m a l l  (28) emphasizes the d i f f e r e n t i a l c o n t r o l o f the heat  shock response and thus adds t o the a l r e a d y complex n a t u r e  of i t s  regulation.  1.8  Heat-Shock R e l a t e d Responses  1.8.1  P h y s i o l o g i c a l Responses  Severe h e a t - s h o c k o f e a r l y D r o s o p h i l a embryos r e s u l t s i n d e v e l o p m e n t a l a b n o r m a l i t i e s c a l l e d phenocopies. disturbance  These a r e most l i k e l y caused by a  i n gene e x p r e s s i o n due t o the h e a t - s h o c k .  Studies of t h i s  phenomenon can be used t o i d e n t i f y c r i t i c a l steps i n the r e g u l a t i o n o f morphogenesis. Petersen  (144).  Attempts i n t h i s d i r e c t i o n have been made by M i t c h e l l and A m i l d heat p r e t r e a t m e n t o f D r o s o p h i l a  larvae protects  them from phenocopy i n d u c t i o n ( 8 4 ) . . Other p h y s i o l o g i c a l responses t o h e a t - s h o c k i n c l u d e the a d a p t a t i o n t r a n s i e n t r e s i s t a n c e to heat.  1.8.2  t o thermal  s t r e s s which l e a d s t o a  T h i s phenomenon has been d i s c u s s e d above.  Other E f f e c t s o f Heat-Shock  A v a r i e t y o f changes caused by the h e a t - s h o c k phenomenon have not y e t been d i s c u s s e d .  These i n c l u d e :  protein modifications,  metabolic  p e r t u r b a t i o n s , c e l l c y c l e s y n c h r o n i z a t i o n , and d i s r u p t i o n o f c y t o s k e l e t o n structure.  One o f the p r o t e i n m o d i f i c a t i o n s a l r e a d y mentioned i s the  heat-induced dephosphorylation Drosophila  (135, 136).  o f an S 6 ~ l i k e r i b o s o m a l  protein i n  T h i s change has been c o r r e l a t e d w i t h the i n i t i a l  breakdown o f p r e - e x i s t i n g polysomes i n h e a t - s h o c k e d c e l l s .  However, s i n c e  - 21  canavanine and  -  sodium a r s e n i t e do not cause d e p h o s p h o r y l a t i o n  of  the  S 6 - l i k e p r o t e i n (187), and y e t produce the same t r a n s l a t i o n a l r e g u l a t i o n as heat, heat.  t h i s p r o t e i n m o d i f i c a t i o n may  That p r o t e i n p h o s p h o r y l a t i o n may  gene e x p r e s s i o n i s supported who  showed t h a t r i b o s o m a l  ovary  be an e n t i r e l y separate  RNA  p l a y a r o l e i n the r e g u l a t i o n of  by the work of C a i z e r g u e s - F e r r e r et^ a l . s y n t h e s i s was  c e l l s r e c o v e r i n g from heat-shock.  c o r r e l a t e d w i t h the d e p h o s p h o r y l a t i o n The  induced  The  i n d u c t i o n of RNA  of two  i s decreased  synthesis i s increased while  (136,  145).  synthesis  i n heat-shocked D r o s o p h i l a c e l l s has a d d i t i o n , m e t h y l a t i o n of H2B  and H3  was  nuclear proteins. The  rate of  that of the o t h e r core h i s t o n e s  In Tetrahymena heat-shock or d e c i l i a t i o n  the p h o s p h o r y l a t i o n of h i s t o n e Hi (147).  (145)  i n Chinese hamster  e f f e c t o f heat-shock on h i s t o n e s i s q u i t e s p e c i f i c .  D r o s o p h i l a H2B  and  response to  The  induce  p h o s p h o r y l a t i o n of H2A  a l s o been r e p o r t e d  (135).  l a t t e r change appears to be a consequence of the heat  H4  In  i s a l t e r e d by heat-shock (148,  e x t e n s i v e d e a c e t y l a t i o n of core h i s t o n e s i s a l s o observed  and  149),  (149).  The  shock response r a t h e r  than a p a r t o f the i n d u c t i o n mechanism f o r hsps s i n c e h y p e r a c e t y l a t i o n of the h i s t o n e s i n t r o u t c e l l s does not prevent p e r s o n a l communication). m o d i f i c a t i o n s suggests transcriptional  production.  Burgess,  r a p i d i t y of heat-induced  t h e i r p o s s i b l e involvement  i n r e g u l a t i o n of  s i t u a t i o n s , c e l l s would be expected  histone the  to economize  and  t h e i r metabolism towards energy c o n s e r v a t i o n and/or  In support  of t h i s e x p e c t a t i o n , Wilhelm et a l . (150)  r e p o r t e d the accumulation D r o s o p h i l a and  s y n t h e s i s (E.A.  response.  Under s t r e s s f u l thus r e - d i r e c t  The v a r i e t y and  hsp  of glycogen  i n heat-shocked Tetrahymena.  have In  o t h e r mammalian c e l l s , heat-shock b l o c k s the assembly of  heterogeneous n u c l e a r RNA  (hnRNA) i n t o i t s normal n u c l e a r r i b o n u c l e o p r o t e i n  - 22 -  (RNP) form ( 1 5 1 ) .  T h i s b l o c k c o u l d be i n v o l v e d i n t h e s e l e c t i v e p r o c e s s i n g  of h e a t - s h o c k mRNAs. Other e f f e c t s o f h e a t - s h o c k i n c l u d e t h e i n h i b i t i o n o f t u b u l i n , s y n t h e s i s w h i c h may account f o r t h e i n d u c t i o n o f c e l l synchrony i n Tetrahymena ( 1 5 2 ) .  I n D r o s o p h i l a and baby hamster k i d n e y c e l l s , t h e  v i m e n t i n c y t o s k e l e t o n d i s i n t e g r a t e s a f t e r h e a t - s h o c k and aggregates a t t h e nucleus (153).  1.9  The P r e s e n t I n v e s t i g a t i o n  A t t h e time t h i s p r o j e c t was i n i t i a t e d  ( l a t e 1979), t h e heat shock  response had been w e l l c h a r a c t e r i z e d o n l y i n D r o s o p h i l a ( 2 ) .  I t had become  apparent t h a t t h i s phenomenon i n s t r e s s e d c e l l s was o f g r e a t importance f o r their survival.  Thus, i t s i n v e s t i g a t i o n i n o t h e r systems would be  i n v a l u a b l e i n d e t e r m i n i n g t h e i n d u c t i o n mechanism o f and f u n c t i o n a l r o l e for  t h e heat shock r e s p o n s e .  T h i s would a l l o w a comparison o f t h e  responses a t b o t h t h e t r a n s c r i p t i o n a l and t r a n s l a t i o n a l l e v e l s i n s p e c i e s from d i f f e r e n t p h y l o g e n e t i c backgrounds. Therefore,  an i n v e s t i g a t i o n o f t h e h e a t - s h o c k phenomenon i n c u l t u r e d  c e l l s o f rainbow t r o u t , Salmo g a i r d n e r i i , was u n d e r t a k e n .  This c e l l  line  was used because o f t h e ease w i t h w h i c h i t c o u l d be m a n i p u l a t e d , e s p e c i a l l y for k i n e t i c studies.  I n i t i a l l y , t h e o c c u r r e n c e o f t h e heat shock response  i n t r o u t c e l l s was. c h a r a c t e r i z e d .  The e x t e n t o f i t s s i m i l a r i t y t o t h e  D r o s o p h i l a response was s u b s e q u e n t l y a n a l y z e d a t s e v e r a l l e v e l s :  hsp  i n d u c t i o n and t u r n o v e r , hsp70 mRNA s y n t h e s i s and d e g r a d a t i o n , t r a n s l a t i o n a l c o n t r o l o f p r e - e x i s t i n g mRNAs, and hsp70 amino a c i d and n u c l e o t i d e homologies.  sequence  - 23 -  During the course of t h i s study, the presence o f a heat shock i n a wide range o f organisms was emerging  from these r e p o r t s  shock response. the  becoming e v i d e n t  i s the h i g h l y  In a d d i t i o n ,  ( l ) . The major theme  conserved n a t u r e o f the heat  the r a p i d k i n e t i c s o f i n d u c t i o n  suggests  chromatin o f heat-shock genes i s m a i n t a i n e d i n an " a l e r t " s t a t e  f o r immediate  response  that  ready  transcription.  The r e s u l t s p r e s e n t e d i n t h i s t h e s i s f u r t h e r emphasize the complex nature o f heat shock response r e g u l a t i o n , the hsp70 genes form a h i g h l y  conservative  and support the c o n c l u s i o n gene  family.  that  - 24 -  II.  2.1  Cell  2.1.1  EXPERIMENTAL PROCEDURES  Culture  C e l l L i n e and Growth C o n d i t i o n s  The f i b r o b l a s t - l i k e l i n e o f RTG-2 c e l l s was o r i g i n a l l y d e r i v e d from mixed gonadal t i s s u e o f male and female rainbow t r o u t , JS^ g a i r d n e r i i (154).  The c e l l s were grown i n E a g l e ' s minimum e s s e n t i a l medium c o n t a i n i n g  n o n - e s s e n t i a l amino a c i d s , E a r l e ' s b a s i c s a l t s , 100 U/mL o f p e n i c i l l i n - s t r e p t o m y c i n , and 10% f e t a l b o v i n e serum ( a l l from Gibco L t d . ) . The c u l t u r e s were m a i n t a i n e d i n d i s p o s a b l e p o l y s t y r e n e t i s s u e f l a s k s o f 25 cm  2  s u r f a c e a r e a , a t a temperature o f 22°C.  For l a r g e - s c a l e  growth o f c e l l s , r o l l e r b o t t l e s w i t h a s u r f a c e a r e a o f 300 cm  2.1.2  culture  2  were used.  Induction of Cells  C e l l s grown t o near c o n f l u e n c e were i n d u c e d by two methods.  In the  f i r s t method, c e l l s were s u b j e c t e d t o h i g h e r temperatures e i t h e r by p a r t i a l immersion o f t h e f l a s k i n a t e m p e r a t u r e - r e g u l a t e d w a t e r b a t h , o r by placement i n an a i r - i h c u b a t o r .  S i n c e the volume o f medium i n t h e f l a s k was  o n l y 5 mL, temperature e q u i l i b r a t i o n was r a p i d .  I n the second method, t h e  c e l l s were i n d u c e d a t 22°C by t h e a d d i t i o n o f sodium a r s e n i t e t o the medium.  C e l l s from a s i n g l e s u b - c u l t u r i n g were used f o r each s e t o f  experiments. results  D e t a i l s o f the c o n d i t i o n s o f i n d u c t i o n a r e d e s c r i b e d i n the  section.  - 25 -  2.2  Protein Analysis  2.2.1  In v i v o L a b e l l i n g of P r o t e i n s  F o l l o w i n g i n d u c t i o n the c e l l s were l a b e l l e d f o r 1 hour [ S]methionine 3 5  (1000 Ci/mmol, New  with  England N u c l e a r ) a t 22°C.  o f 20-30 pCi/mL o f [ S J m e t h i o n i n e was used per e x p e r i m e n t . 3 5  An  average  The l a b e l  was added t o 2 mL o f medium l a c k i n g m e t h i o n i n e ( S e l e c t a m i n e k i t from Gibco L t d . ) and t h i s was terminated  s u b s t i t u t e d f o r the complete medium.  Incorporation  by removing the l a b e l l i n g medium and washing the c e l l s  i c e - c o l d s a l i n e - E D T A s o l u t i o n (137 mM Na HP0^, 1.5 mM KI^PO^, 1.1 mM 2  NaCl, 0.5 mM  glucose).  was  with  EDTA, 2.7 mM KC1, 8.1  mM  The c e l l s were detached  from the f l a s k by a stream o f s a l i n e - E D T A from a P a s t e u r p i p e t and p e l l e t e d by g e n t l e c e n t r i f u g a t i o n . s a l i n e (0.15 M N a C l ) .  The p e l l e t was washed once i n i c e - c o l d i s o t o n i c  The c e l l s were then suspended  b u f f e r (0.05 M T r i s - H C l , pH 6.8,  1% SDS,  i n Laemmli sample  10 mM EDTA, 0.01%  bromophenol  b l u e , and 12% g l y c e r o l ) , and the p r o t e i n s s o l u b i l i z e d by b o i l i n g f o r 2 minutes.  2.2.2  L o c a l i z a t i o n of L a b e l l e d  Proteins  F o l l o w i n g i n d u c t i o n and l a b e l l i n g , c e l l s were s e p a r a t e d i n t o the cytoplasmic  and n u c l e a r  fractions.  T h i s was done e s s e n t i a l l y as  by Marushige and Bonner (155) w i t h a few m o d i f i c a t i o n s . suspended  i n 150 \iL of TMKS b u f f e r (50 mM  25 mM KC1, and 0.25  C e l l p e l l e t s were  T r i s - H C l , pH 7.5, 5 mM  M s u c r o s e ) and 0.5% NP40.  described  MgCl , 2  The s u s p e n s i o n was  freeze-thawed once on d r y i c e and homogenized i n a g l a s s - T e f l o n hand homogenizer.  The sample was c e n t r i f u g e d a t 3000 x g (10 m i n u t e s , 4°C)  the s u p e r n a t a n t saved as the c y t o p l a s m i c  fraction.  The p e l l e t  was  and  - 26 -  rehomogenized i n 500 uL o f TMK b u f f e r (same as TMKS w i t h o u t t h e s u c r o s e ) and 0.5% NP40.  The sample was c e n t r i f u g e d as above and t h e n u c l e a r p e l l e t  was washed i n 500 iiL o f 10 mM T r i s - H C l , pH 7.8, w i t h m e c h a n i c a l a g i t a t i o n (Vortex mixer). 4°C)  The s u s p e n s i o n was c e n t r i f u g e d a t 12,000 x g (15 m i n u t e s ,  t o o b t a i n a p e l l e t o f crude c h r o m a t i n .  Both t h e c y t o p l a s m i c and  n u c l e a r f r a c t i o n s were made IX i n Laemmli sample b u f f e r .  2.2.3  S D S - P o l y a c r y l a m i d e G e l E l e c t r o p h o r e s i s and A u t o r a d i o g r a p h y  The c e l l e x t r a c t s and f r a c t i o n a t e d p r o t e i n s were a n a l y z e d on 10 o r 12.5% p o l y a c r y l a m i d e - S D S s l a b g e l s w i t h a 4.5% s t a c k i n g g e l u s i n g t h e d i s c o n t i n u o u s b u f f e r system o f Laemmli (156).  The g e l s c o n t a i n e d an  a c r y l a m i d e : b i s a c r y l a m i d e r a t i o o f 30:0.8 (w/w), i n a d d i t i o n t o 375 mM T r i s - H C l , pH 8.8, 0.1% SDS, 0.03% TEMED, 0.05% APS f o r t h e s e p a r a t i n g g e l and 125 mM T r i s - H C l , pH 6.8, 0.1% SDS, 0.05% TEMED, 0.1% APS f o r t h e stacking g e l .  The g e l e l e c t r o p h o r e s i s b u f f e r c o n t a i n e d 25 mM T r i s (pH  about 8.3), 0.38 M g l y c i n e , and 0.1% SDS.  S l a b g e l s (0.08 x 7.5 x 10 cm)  were r u n a t 20 mA c o n s t a n t c u r r e n t f o r about 70 minutes and s t a i n e d w i t h 0.25%  Coomassie b l u e i n a m e t h a n o l : g l a c i a l a c e t i c a c i d : w a t e r (5:1:5 r a t i o ,  v/v) system.  The m i c r o s l a b apparatus was as d e s c r i b e d by M a t s u d a i r a and  Burgess ( 1 5 7 ) .  A f t e r d e s t a i n i n g , t h e g e l s were d r i e d and a u t o r a d i o g r a p h e d  u s i n g Kodak X-Omat AR f i l m f o r an average o f 40 h o u r s .  2.2.4  D e n s i t o m e t r y Scanning o f A u t o r a d i o g r a p h s  A f t e r a u t o r a d i o g r a p h y , t h e f i l m was i n s e r t e d i n t o t h e h o l d e r o f a Beckman DU-8 s p e c t r o p h o t o m e t e r and t h e p r o f i l e s o f [ S ] m e t h i o n i n e 3 s  l a b e l l e d p r o t e i n s were determined by measuring t h e percentage t r a n s m i t t a n c e of white l i g h t .  - 27 -  2.3  RNA A n a l y s i s  2.3.1  I s o l a t i o n o f T o t a l RNA  RTG-2 f i b r o b l a s t s , grown c l o s e t o c o n f l u e n c e , were induced w i t h 50 uM sodium a r s e n i t e f o r 24 h o u r s .  The c e l l s were s u b s e q u e n t l y  harvested  and t h e RNA was i s o l a t e d e s s e n t i a l l y as d e s c r i b e d by C h i r g w i n e_t a l . (158) w i t h a few m o d i f i c a t i o n s . B r i e f l y , t h e c e l l p e l l e t s were hand-homogenized on i c e u s i n g a Gu'HCl b u f f e r (6 M Gu'HCl, 20 mM sodium a c e t a t e , 0.1 M IJ-mercaptoethanol, pH 5.0).  The homogenates were then c a r r i e d through one  c y c l e o f f r e e z e - t h a w i n g , f o l l o w e d by c e n t r i f u g a t i o n a t 12,000 x g (10 minutes,  4°C). To t h e s u p e r n a t a n t was added 0.5 volume o f 95% e t h a n o l  (-20°C).  RNA was a l l o w e d t o p r e c i p i t a t e a t -20°C f o r a few hours and  subsequently  p e l l e t e d by c e n t r i f u g a t i o n a t 12,000 x g (15 m i n u t e s , 0°C).  The p e l l e t was d i s s o l v e d i n 7.5 M Gu'HCl, 25 mM sodium c i t r a t e , 50 mM 6-mercaptoethanol,  pH 7.0  and t h e RNA was r e p r e c i p i t a t e d by t h e a d d i t i o n  of 0.025 volume o f 1 M a c e t i c a c i d and 0.5 volume o f 95% e t h a n o l (-20°C). T h i s c y c l e o f r e p r e c i p i t a t i o n was c a r r i e d out two t o t h r e e t i m e s .  The  f i n a l RNA p e l l e t was washed once w i t h 95% e t h a n o l (-20°C), and then d r i e d under a stream o f n i t r o g e n .  The d r i e d p e l l e t was e x t r a c t e d t h r e e t o f o u r  times w i t h s t e r i l e w a t e r and the e x t r a c t s were p o o l e d .  The RNA was  p r e c i p i t a t e d once more w i t h 0.1 volume o f 2 M sodium a c e t a t e , pH 5-0, and 2 volumes o f 95% e t h a n o l (-20°C). minutes,  The RNA was c e n t r i f u g e d a t 12,000 x g (20  -10°C), d r i e d under n i t r o g e n and d i s s o l v e d i n s t e r i l e water a t a  f i n a l c o n c e n t r a t i o n o f 2 mg/ml (assuming  20 A^^Q u n i t s = 1 mg RNA).  T y p i c a l y i e l d s o f t o t a l c e l l u l a r RNA were about 1 mg p e r 5 r o l l e r of c e l l s .  A l l glassware  bottles  and s o l u t i o n s were t r e a t e d w i t h 0.1%  d i e t h y l p y r o c a r b o n a t e and baked o r a u t o c l a v e d , r e s p e c t i v e l y , b e f o r e use ( a  - 28 -  s t a n d a r d p r o c e d u r e f o r a l l RNA a n a l y s i s ) .  2.3.2  P u r i f i c a t i o n o f P o l y a d e n y l a t e d RNA  Poly A  +  RNA was s e p a r a t e d from the t o t a l RNA by two passages  through  an o l i g o [ d T ] - c e l l u l o s e column ( C o l l a b o r a t i v e Research I n c . ) u s i n g t h e procedure o f A v i v and Leder ( 1 5 9 ) .  T o t a l RNA was loaded onto the column i n  NETS b u f f e r (0.3 M N a C l , 1 mM EDTA, 10 mM T r i s - H C l , pH 7.5, and 0.5% SDS) and the s o l u t i o n r e c i r c u l a t e d s e v e r a l t i m e s . more NETS b u f f e r t o e l u t e o f f any unbound RNA.  The column was washed w i t h Poly A  RNA was e l u t e d  o f f the column w i t h a s m a l l volume o f ETS b u f f e r (1 mM EDTA, 10 mM T r i s - H C l , pH 7.5, and 0.05% SDS) o r s t e r i l e w a t e r .  The e l u t e d p o l y A  RNA was f u r t h e r p u r i f i e d by a second passage through t h e column. f i n a l e l u a n t , c o n t a i n i n g the p o l y A  +  +  To t h e  RNA, was added 0.1 v o l o f 2 M NaAc,  pH 5, and 2 v o l o f 95% e t h a n o l (-20°C).  The m i x t u r e was l e f t f o r a few  hours a t -20°C and then c e n t r i f u g e d a t 12,000 x g (30 m i n u t e s , -10°C).  The  p e l l e t was washed once i n 95% e t h a n o l (~20°C), d r i e d under n i t r o g e n , and d i s s o l v e d i n s t e r i l e water. The f a t e o f t h e RNA through t h e p u r i f i c a t i o n procedure was m o n i t o r e d w i t h an ISCO o p t i c a l u n i t s e t a t a wavelength o f 260 nm.  A typical  p u r i f i c a t i o n p r o f i l e i s shown i n F i g u r e 1.  2.3.3  Sucrose D e n s i t y G r a d i e n t C e n t r i f u g a t i o n o f RNA  Sucrose g r a d i e n t s o f 13 mL (15 t o 35%, w/v) were made w i t h t h e h e l p o f a Hoefer m u l t i p l e s u c r o s e g r a d i e n t maker.  The s u c r o s e s o l u t i o n s c o n t a i n e d  0.1 M N a C l , 1 mM EDTA, and 10 mM NaAc, pH 5.  The RNA a s heated t o 80°C w  f o r 5 minutes and then c h i l l e d on i c e . A t o t a l o f 200 pg o f RNA was loaded onto each g r a d i e n t and c e n t r i f u g e d a t 30,000 rpm (20 h o u r s , 4°C) i n  - 29 -  o  to CM  TIME  Figure 1.  P u r i f i c a t i o n of Poly A was separated  on an 01igo[dT]-column.  Poly A  The arrows indicate various treatments of  The fate of the RNA was followed by absorption at  260 nm (ubf = unbound f r a c t i o n , NETS = binding buffer, A p u r i f i e d poly A Note: run.  RNA  +  from t o t a l RNA by a f f i n i t y chromatography on  oligo[dT]-cellulose. the column.  +  +  +  =  RNA).  one cycle through the column took one hour i n a t y p i c a l  - 30 -  a Beckman SW41 r o t o r .  F r a c t i o n s o f 0.5 mL were c o l l e c t e d by upward  d i s p l a c e m e n t w i t h 50% s u c r o s e  (w/v).  RNA from each f r a c t i o n was  p r e c i p i t a t e d w i t h e t h a n o l and d r i e d i n vacuo f o r 5 m i n u t e s .  Individual  p e l l e t s were suspended i n 8 uL o f s t e r i l e water and s t o r e d a t -20°C.  2.3.4  Cell-Free Protein Translation  RNA was t r a n s l a t e d i n t h e r a b b i t r e t i c u l o c y t e system (NEN) as d e s c r i b e d by Pelham and J a c k s o n label.  ( 1 6 0 ) , w i t h [ S J m e t h i o n i n e as the 3 5  P o l y p e p t i d e s were f r a c t i o n a t e d and a n a l y z e d by  SDS-polyacrylamide  g e l e l e c t r o p h o r e s i s and a u t o r a d i o g r a p h y .  2.3.5  T r o u t cDNA L i b r a r i e s  The RTG-2 cDNA l i b r a r i e s were k i n d l y s u p p l i e d by Mr. Don Jones. A  +  Poly  RNA from a r s e n i t e induced c e l l s was used t o s y n t h e s i z e complementary  DNA by one o f two methods.  The f i r s t method i n v o l v e d the use o f  s e l f - p r i m i n g a t t h e 3' ends o f s i n g l e - s t r a n d e d cDNAs f o r s e c o n d - s t r a n d s y n t h e s i s (161).  These were c l o n e d i n t o the P s t I s i t e o f p l a s m i d pBR322  and y i e l d e d about 700 independent c l o n e s .  The second method i n v o l v e d  a d d i t i o n o f dC t a i l s t o t h e 3'-OH ends o f s i n g l e - s t r a n d e d cDNAs and the use o f o l i g o - [ d G ] as p r i m e r s f o r s e c o n d - s t r a n d  s y n t h e s i s (162).  These cDNAs  were a l s o c l o n e d i n t o the P s t I s i t e o f pBR322 and y i e l d e d about 2,000 and 5,000 independent c l o n e s i n two s e p a r a t e  2.3.6  attempts.  S c r e e n i n g o f t h e cDNA L i b r a r i e s  The cDNA l i b r a r i e s were screened e i t h e r by the c o l o n y h y b r i d i z a t i o n method o f G r u n s t e i n and Hogness (163) o r by the h i g h d e n s i t y p l a t i n g method o f Hanahan and M e s e l s o n ( 1 6 4 ) .  I n the former method, b a c t e r i a l c o l o n i e s  - 31 -  c o n t a i n i n g p l a s m i d s were i n d i v i d u a l l y t r a n s f e r r e d from a master p l a t e t o a NC f i l t e r (1%  ( S c h l e i c h e r and S c h u e l l ) and a l l o w e d  bactotryptone,  t o grow a t 37°C on LB p l a t e s  0-5% y e a s t e x t r a c t , 1% N a C l , and 1.4% a g a r ) c o n t a i n i n g  the a n t i b i o t i c s t e t r a c y c l i n e (15 ug/mL) and s t r e p t o m y c i n  (25 yg/mL).  When  the c o l o n i e s grew t o a s i z e o f 1 mm, t h e f i l t e r was t r a n s f e r r e d t o an LB p l a t e c o n t a i n i n g 170 ug/mL o f c h l o r a m p h e n i c o l , to amplify overnight  and the p l a s m i d s  allowed  a t 37°C.  I n t h e second method, b a c t e r i a l c o l o n i e s from a g l y c e r o l s t o c k o f t h e cDNA l i b r a r y were p l a t e d a t a d e n s i t y o f about 5,000 c o l o n i e s p e r p l a t e onto a NC f i l t e r .  These c o l o n i e s were a l s o grown under s e l e c t i o n o f  t e t r a c y c l i n e and s t r e p t o m y c i n .  The b a c t e r i a l c o l o n i e s were grown t o a  d i a m e t e r o f 0.1 mm and a r e p l i c a made onto a second NC f i l t e r . master and r e p l i c a were r e t u r n e d d i a m e t e r o f 1 mm. 4°C.  t o 37°C and the c o l o n i e s grown t o a  A t t h i s s t a g e t h e master p l a t e was removed and s t o r e d a t  The r e p l i c a f i l t e r was t r a n s f e r r e d t o a p l a t e  c h l o r a m p h e n i c o l and the p l a s m i d s a m p l i f i e d  containing  overnight.  F i l t e r s were then t r e a t e d t o o b t a i n c e l l l y s i s . colony  Both the  They were  placed  s i d e up on a Whatman 3 MM f i l t e r s a t u r a t e d w i t h 10% SDS (3 m i n ) .  T h i s was f o l l o w e d by s u c c e s s i v e washes i n : ( i ) 0.5 M NaOH, 1.5 M N a C l , ( i i ) 1.5 M N a C l , 0.5 M T r i s - H C l , pH 8, and ( i i i ) f i n a l l y  i n 2X SSPE ( I X SSPE i s  0.18 M N a C l , 10 mM sodium phosphate, pH 7.5, and 1 mM EDTA), a l l f o r 5 minutes. hours.  The f i l t e r s were a i r d r i e d and baked i n vacuo a t 80°C f o r 2 A f t e r h y b r i d i z a t i o n t o a l a b e l l e d DNA fragment, any p o s i t i v e  s i g n a l s were t r a c e d back t o t h e master p l a t e and a p p r o p r i a t e purified.  colonies  - 32 -  2.3.7  RNA N o r t h e r n and Dot B l o t  RNA  Analysis  was denatured i n 1 M g l y o x a l , 10 mM sodium phosphate, pH 7 a t 50°C  for  1 hour a c c o r d i n g  t o the procedure o f McMaster and C a r m i c h a e l  The  RNA samples were c o o l e d  t o room temperature and 0.2 v o l o f a 5X l o a d i n g  b u f f e r ( I X l o a d i n g b u f f e r i s 7% F i c o l l , 0.02%  bromophenol b l u e ) added.  h o r i z o n t a l agarose g e l . phosphate, pH 7.0, glyoxalated  10 mM sodium phosphate, pH 7, and  The denatured RNA was f r a c t i o n a t e d on a  The g e l s were poured and r u n i n 10 mM sodium  b u f f e r w h i c h was r e c i r c u l a t e d throughout the r u n .  RNA was t r a n s f e r r e d from the g e l t o a NC f i l t e r  after electrophoresis. Thomas (166).  (165).  The  immediately  The t r a n s f e r was through 20X SSPE as d e s c r i b e d by  For the d o t - b l o t s , t o t a l RNA was p l a c e d  a NC f i l t e r and a l l o w e d  t o dry.  The f i l t e r s  i n a s m a l l volume on  were s u b s e q u e n t l y baked i n  vacuo a t 80°C f o r 2 h o u r s .  2.3.8  C y t o p l a s m i c Quick B l o t s o f RNA  C y t o p l a s m i c e x t r a c t s c o n t a i n i n g mRNA were b l o t t e d t o n i t r o c e l l u l o s e filters  ( S c h l e i c h e r and S c h u e l l , Inc.) as d e s c r i b e d  (167), w i t h a few m o d i f i c a t i o n s .  by B r e s s e r  B r i e f l y , a f t e r appropriate  et a l .  treatments,  c e l l s from i n d i v i d u a l f l a s k s were h a r v e s t e d as q u i c k l y as p o s s i b l e avoid inadvertant solution.  (to  i n d u c t i o n o f h s p s ) i n 1.0 mL o f i c e - c o l d s a l i n e - E D T A  C e l l s were g e n t l y p e l l e t e d by a 5 minute c e n t r i f u g a t i o n i n a  desk top c e n t r i f u g e and resuspended i n 0.5 mL o f i c e - c o l d s a l i n e - E D T A s o l u t i o n made 0.5% i n SDS. a f i n a l concentration for  30 m i n u t e s .  Proteinase  K ( B o e h r i n g e r Mannheim) was added t o  o f 0.2 mg/mL and the s u s p e n s i o n was i n c u b a t e d a t 37°C  O n e - t w e n t i e t h volumes o f 10% B r i j - 3 5 and 10% sodium  d e o x y c h o l a t e were added t o the s u s p e n s i o n , which was then i n c u b a t e d on i c e for  5 minutes.  To s o l u b i l i z e c e l l u l a r c o n t e n t s ,  0.81 volume o f s u p e r -  - 33 -  s a t u r a t e d N a l (2.5 g N a l p e r mL o f h o t w a t e r ) , l i q u i f i e d a t 75°C, was added t o t h e s u s p e n s i o n w h i c h was l e f t a t room temperature f o r 10 m i n u t e s . D i l u t i o n s were made i n t o s a t u r a t e d N a l (0.81 volume o f s u p e r s a t u r a t e d N a l added t o s a l i n e - E D T A s o l u t i o n ) .  The s o l u b i l i z e d e x t r a c t and a p p r o p r i a t e  d i l u t i o n s were passed a t room temperature through a n i t r o c e l l u l o s e  filter  w i t h t h e a i d o f a Hybrid-Dot apparatus (Bethesda Research Lab, I n c . ) . N i t r o c e l l u l o s e f i l t e r s were p r e t r e a t e d by s o a k i n g i n w a t e r f o l l o w e d by a wash i n 6X SSC ( I X SSC i s 0.15 M N a C l , 0.015 M sodium c i t r a t e , pH 7.0). A f t e r f i l t r a t i o n , n i t r o c e l l u l o s e membranes were soaked s u c c e s s i v e l y i n w a t e r , 70% e t h a n o l , and f i n a l l y a c e t i c a n h y d r i d e s o l u t i o n (100 mL o f 0.1 M t r i e t h a n o l a m i n e p l u s 0.25 mL o f a c e t i c a n h y d r i d e p r e p a r e d j u s t p r i o r t o u s e ) , each f o r 10 minutes a t room t e m p e r a t u r e . a i r d r i e d and t r e a t e d f o r h y b r i d i z a t i o n .  F i l t e r s were s u b s e q u e n t l y  A l l s o l u t i o n s , except f o r ones  c o n t a i n i n g N a l o r p r o t e i n s , were t r e a t e d w i t h 0.1% d i e t h y l p y r o c a r b o n a t e and autoclaved before use.  2.4  DNA A n a l y s i s  2.4.1  I s o l a t i o n o f P l a s m i d DNA  P l a s m i d DNA was i s o l a t e d by t h e method o f B i r n b o i m and Doly ( 1 6 8 ) . For r a p i d s m a l l - s c a l e i s o l a t i o n o f p l a s m i d , 1.5 mL o f an o v e r n i g h t c u l t u r e was t r a n s f e r r e d t o an Eppendorf tube and t h e b a c t e r i a l c e l l s p e l l e t e d by c e n t r i f u g a t i o n i n a microfuge (Eppendorf).  The c e l l s were resuspended i n  0.1 mL o f l y s i s b u f f e r I (50 mM g l u c o s e , 25 mM T r i s - H C l , pH 8, 10 mM EDTA, and f r e s h l y added lysozyme a t 4 mg/mL). seconds  The s u s p e n s i o n was mixed f o r 30  ( V o r t e x ) and l e f t a t room t e m p e r a t u r e .  A f t e r 5 m i n u t e s , 0.2 mL o f  f r e s h l y made i c e - c o l d l y s i s b u f f e r I I (0.2 N NaOH, 1% SDS) was added.  To  - 34  the now  viscous  acetate,  s o l u t i o n was  pH 4.8.  The  added 0.15  tube was  l e f t on i c e f o r 5 m i n u t e s .  The  DNA  The  (room t e m p e r a t u r e , 2 m i n ) . (10 mM  DNA  and  were removed  l y s a t e , which c o n t a i n e d the p l a s m i d  1 v o l of p h e n o l i C H C l ^ ( 1 : 1 ) .  t r e a t e d w i t h NaAc and  i n 50 pL o f s t e r i l e TE  of i c e - c o l d 5 M p o t a s s i u m  b a c t e r i a l c e l l d e b r i s and  subjected to e x t r a c t i o n with  aqueous phase was  mL  i n v e r t e d , mixed f o r 10 seconds ( V o r t e x )  by a 5 minute c e n t r i f u g a t i o n . was  -  The  The  e t h a n o l to p r e c i p i t a t e the  f i n a l p e l l e t was  T r i s - H C l , pH  7.6,  d r i e d and  1 mM  DNA,  plasmid  resuspended  EDTA) p l u s  50  Mg/mL o f RNAase A (Sigma L t d . ) . For  the l a r g e s c a l e i s o l a t i o n of p l a s m i d DNA,  s c a l e d up.  U s u a l l y , 0.5  L c u l t u r e s of b a c t e r i a l c e l l s were used  p r o c e s s e d to the l y s a t e stage as above. the l y s a t e and DNA  was  added to  the m i x t u r e l e f t at room temperature f o r 15 m i n u t e s .  The  c o l l e c t e d by c e n t r i f u g a t i o n at 12,000 x g (20 m i n u t e s , 10°C)  and  dissolved  i n 4.5  added per mL  mL  s a l t and RNA was  of TE b u f f e r .  of s o l u t i o n .  mixture centrifuged  One  mg  DNA  was  d r i e d i n vacuo  and  gram of s o l i d cesium c h l o r i d e  of e t h i d i u m bromide was  a t 12,000 x g (10 m i n u t e s , 10°C) The  added and  to remove  was the  undissolved  cesium c h l o r i d e  solution  s u b j e c t e d t o e q u i l i b r i u m d e n s i t y c e n t r i f u g a t i o n at 50,000  c o l l e c t e d and  i n a Beckman VTi65 r o t o r .  s a l t i n g out,  The  DNA  band from the  w i t h water.  To p r e v e n t any  the aqueous phase was  a d d i t i o n of e t h a n o l (6 v o l ) . 12,000 x g (20 m i n u t e s , 0°C) d r i e d i n vacuo and  The  rpm  gradient  the e t h i d i u m bromide removed by s e v e r a l e x t r a c t i o n s  1-butanol s a t u r a t e d  p e l l e t was  One  The  complexed t o e t h i d i u m bromide.  (20 h o u r s , 15°C) was  and  I s o p r o p a n o l (0.6 v o l ) was  the p e l l e t s washed once i n 70% e t h a n o l .  o f DNA  a l l the s t e p s were  with  cesium c h l o r i d e from  d i l u t e d 3 - f o l d w i t h w a t e r p r i o r to DNA  was  p e l l e t e d by c e n t r i f u g a t i o n  and washed once i n 70% e t h a n o l . resuspended i n 0.5  mL  The  at  final  of s t e r i l e w a t e r .  - 35  2.4.2  I s o l a t i o n of Genomic  -  DNA  H i g h m o l e c u l a r w e i g h t genomic DNA  from t r o u t t e s t e s was  Dr. E.P.M. Candido f o l l o w i n g the method of B l i n and  prepared  S t a f f o r d (169).  i n v o l v e d g r i n d i n g of the t i s s u e i n l i q u i d n i t r o g e n f o l l o w e d by d i g e s t i o n s w i t h RNAase A and p r o t e i n a s e  K.  This  extensive  These d i g e s t i o n s were  i n t e r s p e r s e d w i t h phenol:CHC1^ (1:1) e x t r a c t i o n s and d i a l y s i s of  the  aqueous phase t o remove a l l t r a c e s of p h e n o l .  High molecular weight  was  ethanol.  wound out of the e x t r a c t a f t e r a d d i t i o n of Genomic DNA  samples from o t h e r s o u r c e s were k i n d l y p r o v i d e d  E l i z a b e t h B u r g e s s , C o l i n Hay,  by  J e f f Leung, Ross M a c G i l l i v r a y and  DNA  by Roland  Russnak.  2.4.3  R e s t r i c t i o n Endonuclease D i g e s t i o n of  D i g e s t i o n of DNA  w i t h r e s t r i c t i o n enzymes was  the d i r e c t i o n s o f the s u p p l i e r (BRL). NaCl), or high  (100 mM  ug/mL BSA  used.  except f o r TaqI (65°C), and  20% F i c o l l , 0.2%  The  (0 mM  N a C l ) , medium (50  Note t h a t 20 mM  KC1  was  was  added.  bromophenol b l u e , and  the  100  by i n c u b a t i o n at-68°C  t o room temperature and 50 mM  mM  A l l d i g e s t i o n s were a t 37°C,  the r e a c t i o n s t e r m i n a t e d  samples were c o o l e d  to  substituted for  For d i g e s t i o n s o f l o n g e r than 2 h o u r s ,  ( u l t r a p u r e g r a d e , BRL)  f o r 5 minutes.  Low  c a r r i e d out a c c o r d i n g  NaCl) s a l t b u f f e r s were used depending on  r e q u i r e m e n t of i n d i v i d u a l enzymes. NaCl when Smal was  DNA  0.2  v o l of  EDTA added p r i o r t o g e l  electrophoresis.  2.4.4  Agarose G e l  Electrophoresis  F r a c t i o n a t i o n of DNA gels.  was  by e l e c t r o p h o r e s i s through h o r i z o n t a l agarose  G e l s were poured and run i n IX TBE  (89 mM  T r i s - b o r a t e , pH 8.3,  and  2  - 36 -  mM EDTA) c o n t a i n i n g 0.1 mg/L o f e t h i d i u m bromide. d u r i n g the e l e c t r o p h o r e s i s (4 t o 5 V/cm).  Gels were submerged  The DNA bands were v i s u a l i z e d  under U V - l i g h t and photographs taken w i t h a P o l a r o i d camera.  2.4.5  DNA Southern B l o t A n a l y s i s  DNA from agarose g e l s was t r a n s f e r r e d t o NC f i l t e r s f o l l o w i n g t h e p r i n c i p l e s d e s c r i b e d by Southern ( 1 7 0 ) . t r a n s f e r as f o l l o w s :  The g e l was p r e t r e a t e d f o r  two 15 minute washes i n 1.5 M NaCl, 0.5 M NaOH  f o l l o w e d by a s h o r t r i n s e i n d i s t i l l e d w a t e r , then two 15 minute washes i n 0.5 M T r i s - H C l , pH 7.8, 1.5 M NaCl.  The NC f i l t e r was p r e t r e a t e d by b r i e f  washes i n d i s t i l l e d water and 20X SSPE. SSPE and t h e DNA i m m o b i l i z e d by b a k i n g  T r a n s f e r was o v e r n i g h t through 20X the f i l t e r i n vacuo a t 80°C f o r 2  hours.  2.5  Maxam and G i l b e r t DNA Sequencing  T h i s method i n v o l v e d t h e b a s e - s p e c i f i c m o d i f i c a t i o n and cleavage o f e n d - l a b e l l e d DNA (171, 1 7 2 ) . The c l e a v e d p r o d u c t s were o r d e r e d to  s i z e on an a c r y l a m i d e  2.5.1  according  g e l and t h e sequence read from an a u t o r a d i o g r a m .  E n d - L a b e l l i n g o f DNA Fragments  About 1 ng o f p u r i f i e d DNA w i t h unique 5' s t i c k y ends was e n d - l a b e l l e d w i t h the appropriate  [ a - p ] d N T P (40-50 u C i , 3,000 32  Ci/mmol, NEN) u s i n g t h e Klenow fragment o f E. , c o l i DNA polymerase I ( B o e h r i n g e r Mannheim).  A f t e r 20 minutes a t room temperature t h e r e a c t i o n  was t e r m i n a t e d by a d d i t i o n o f 0.2 v o l o f 20% F i c o l l , 0.2% bromophenol b l u e , and 50 mM EDTA.  - 37 -  2.5.2  Preparative Acrylamide  Gels  S i n g l e e n d - l a b e l l e d fragments o f DNA were p u r i f i e d on a 5 o r 8% polyacrylamide TBE,  (acrylamide:bisacrylamide  0.06% APS, and 0.1% TEMED.  i d e n t i f i e d by a u t o r a d i o g r a p h y , d i a l y s i s tubing.  r a t i o o f 29:1) g e l c o n t a i n i n g IX  The DNA fragments o f i n t e r e s t were  and e l e c t r o - e l u t e d from t h e g e l i n t o  The f i n a l DNA p e l l e t was Cerenkov counted  (approximately  30% e f f i c i e n t ) and suspended i n s t e r i l e water a t 1,000 - 2,000 Cerenkov cpm/uL.  2.5.3 The  B a s e - S p e c i f i c Reactions  on E n d - L a b e l l e d  DNA  p r o t o c o l used f o r t h e base m o d i f i c a t i o n r e a c t i o n s on t h e  e n d - l a b e l l e d DNA i s summarized i n T a b l e I I I . A f t e r t h e f i n a l l y o p h i l i z a t i o n , t h e DNA was Cerenkov counted and t a k e n up i n 90% formamide, 25 mM EDTA, 0.02% x y l e n e c y a n o l , and 0.02% bromophenol b l u e a t a c o n c e n t r a t i o n o f 2,000 Cerenkov cpm/uL ( f o r t h e G and C base r e a c t i o n s ) and 4,000 Cerenkov cpm/uL ( f o r t h e G+A and T+C base r e a c t i o n s ) .  The  samples were heated a t 95°C f o r 3 minutes and q u i c k - c h i l l e d on i c e p r i o r t o electrophoresis.  2.5.4 The  Sequencing  Gels  p r o d u c t s o f DNA sequencing r e a c t i o n s were a n a l y z e d  polyacrylamide  s l a b g e l s (0.035 x 15 x 35 cm).  acrylamide:bisacrylamide 0.06%  on 6 o r 8%  The g e l s c o n t a i n e d an  r a t i o o f 19:1 i n a d d i t i o n t o 8.3 M u r e a , IX TBE,  APS, and 0.03% TEMED.  E l e c t r o p h o r e s i s was i n IX TBE a t a c o n s t a n t  power o f 30 W ( a p p r o x i m a t e l y  1,600 V ) . The g e l s were d r i e d onto Whatman  f i l t e r paper and a u t o r a d i o g r a p h e d u s i n g Kodak X-Omat RP f i l m .  - 38 -  TABLE I I I . DNA B a s e - M o d i f i c a t i o n R e a c t i o n s f o r M & G Sequencing  T + C  G + A  3 2  C a r r i e r DNA (lmg/mL):  Mix & C h i l l Add  1 uL cacodylate b u f f e r , 300 yL DMS 2 uL  Incubate  3' , RT  Add  G-stop 50 uL  + 95% e t h a n o l ( - 7 0 ° O  Store Microfuge  10  10  [ P ] DNA (uL) :  1 mL  1 Pi dH 0 10 y l  1 UL dH 0 15 uL  1 UL 5 NaCl 20 uL  HZ 30 uL  HZ 30 uL  10', RT  15', RT  2  2  formic acid 3 uL 10', 37°C A-stop 300 uL  Py-stop 300 L  Py-stop 300 uL  1 mL  1 mL  1 mL  U  -70°C, 15 minutes 5 minutes  Reprecipitate Wash p e l l e t & d r y i n vacuo Resuspend i n Heat t o C o o l on i c e , add  2X i n 70% e t h a n o l 100 uL 1.0 M p i p e r i d i n e 90°C, 30 minutes 100 uL dH 0 2  Lyophilize Add L y o p h i l i z e & repeat  20 uL dH 0 2  - 39 -  2.6  M13-Dideoxy Sequencing o f  DNA  The second method o f DNA base sequence  determination u t i l i z e d  'dideoxy' c h a i n t e r m i n a t i o n procedure o f Sanger  the  (173, 174) as adapted to  t h e M13 phage system by Messing e_t _ a l . ( 1 7 5 ) .  2.6.1  C l o n i n g o f DNA  i n t o M13  Phage  M13mp8 and M13mp9 RF DNA were k i n d l y p r o v i d e d by Dr. E.P.M. Candido. About 100 ng o f i n s e r t DNA,  d i g e s t e d w i t h r e s t r i c t i o n enzymes, was  and l i g a t e d t o 50 ng o f v e c t o r DNA site. 7.6,  (M13 RF) r e s t r i c t e d a t the a p p r o p r i a t e  The l i g a t i o n r e a c t i o n was a t 15°C 5 mM M g C l , 2  T4 DNA  5 mM DTT,  and 1 mM ATP,  l i g a s e ( B o e h r i n g e r Mannheim).  h e a t i n g t o 68°C f o r 10 m i n u t e s .  annealed  f o r 4 hours i n 66 mM  Tris-HCl,  pH  i n a d d i t i o n t o 1 Weiss u n i t o f  The r e a c t i o n was  The l i g a t e d DNA was  t e r m i n a t e d by  transformed i n t o  o r JM103 c e l l s ( s t r a i n s o b t a i n e d from C r a i g Newton).  JM101  E s s e n t i a l l y , host  c e l l s were grown i n 20 mL YT medium (0.8% b a c t o t r y p t o n e , 0.5% y e a s t e x t r a c t , and 0.5% NaCl) t o a d e n s i t y o f 0.7 A-^^Q u n i t s and then c h i l l e d on i c e f o r 30 m i n u t e s . resuspended  The c e l l s were p e l l e t e d by g e n t l e c e n t r i f u g a t i o n and i n 10 mL of f r e s h i c e - c o l d 50 mM  CaCl^.  A f t e r s t o r i n g on i c e  f o r 30 minutes the c e l l s were p e l l e t e d (1,500 x g, 5 m i n u t e s , 4°C) c a r e f u l l y resuspended i n 2 mL o f i c e - c o l d 50 mM  CaC^.  and  Transformation  r e a c t i o n s c o n s i s t e d o f 0.3 mL o f competent c e l l s and 2 ng o f l i g a t e d t h e s e were i n c u b a t e d on i c e f o r 40 m i n u t e s .  DNA;  The m i x t u r e s were heat-shocked  a t 42°C f o r 2 m i n u t e s , and then l e f t a t room temperature f o r 5 m i n u t e s . Ten L o f 100 mM U  IPTG, 50 jiL X - g a l ( 2 % i n d i m e t h y l f o r m a m i d e ) , and 0.2 mL o f  a f r e s h c u l t u r e of c e l l s was added t o the t r a n s f o r m i n g m i x t u r e . was p l a t e d onto YT agar p l a t e s w i t h 3 mL o f s o f t agar.  The m i x t u r e  The p l a t e s were  - 40 -  i n c u b a t e d a t 37°C and c l e a r p l a q u e s i d e n t i f i e d as those c o n t a i n i n g recombinant phage.  2.6.2  P r e p a r a t i o n o f S i n g l e - S t r a n d e d Templates  C l e a r p l a q u e s ( c o n t a i n i n g recombinant phage) were t r a n s f e r r e d w i t h a s t e r i l e p a s t e u r p i p e t , from a p l a t e t o a tube c o n t a i n i n g 2 mL YT medium and 20 uL o f a f r e s h c u l t u r e o f JM101 o r JM103 c e l l s . a t 37°C w i t h s h a k i n g f o r 6 t o 7 h o u r s .  The tube was i n c u b a t e d  A 1.3 mL a l i q u o t was poured i n t o an  Eppendorf tube and t h e c e l l s p e l l e t e d (5 minutes i n a m i c r o f u g e ) . The s u p e r n a t a n t was c a r e f u l l y t r a n s f e r r e d t o a f r e s h tube c o n t a i n i n g 0.3 mL o f 20% PEG, and 2.5 M N a C l .  A f t e r m i x i n g , t h e tube was l e f t a t room temper-  a t u r e f o r 15 minutes f o l l o w e d by a 5 minute c e n t r i f u g a t i o n .  The s u p e r n a t a n t  was a s p i r a t e d o f f and the i n s i d e w a l l o f t h e tube was wiped w i t h paper t o ensure t h a t a l l t r a c e s o f PEG were removed.  tissue  The phage p e l l e t was  d i s s o l v e d i n 0.2 mL o f a low T r i s b u f f e r , LTB (20 mM T r i s - H C l , pH 7.5, 20 mM N a C l , 1 mM EDTA), and then s u b j e c t e d t o e x t r a c t i o n s w i t h p h e n o l , and phenol:CHCl2  (1:1).  The aqueous phase was t r a n s f e r r e d t o a c l e a n tube  and the s i n g l e - s t r a n d e d DNA p r e c i p i t a t e d by the a d d i t i o n o f 14 pL o f 4 M NaAc, pH 5, and 0.5 mL o f 95% e t h a n o l (-20°C).  The m i x t u r e was l e f t a t  -70°C f o r 15 minutes and then c e n t r i f u g e d f o r 5 m i n u t e s .  The b a r e l y  d e t e c t a b l e p e l l e t was washed i n 1 mL o f 95% e t h a n o l (-20°C), d r i e d i n vacuo f o r 5 m i n u t e s , and d i s s o l v e d i n 50 uL o f LTB.  2.6.3  'Dideoxy' C h a i n T e r m i n a t i o n R e a c t i o n s  S i n g l e - s t r a n d e d t e m p l a t e DNA (5 yL) from a recombinant M13 phage was mixed w i t h 0.75 ng o f M13-primer (17-mer, P-L B i o c h e m i c a l s ) i n 25 mM H C l , pH 7.5, 18 mM M g C l , and 150 mM NaCl i n a t o t a l volume o f 8 uL. ?  Tris-  - 41 -  The m i x t u r e was t r a n s f e r r e d t o a 50 pL g l a s s c a p i l l a r y which was then s e a l e d a t b o t h ends.  The h y b r i d i z a t i o n mix was p l a c e d a t 68°C f o r 10  minutes and t h e n g r a d u a l l y c o o l e d t o room temperature t o a l l o w p r o p e r a n n e a l i n g o f p r i m e r and t e m p l a t e DNA.  A f t e r 15 minutes t h e c a p i l l a r y  was  broken open and t h e c o n t e n t s t r a n s f e r r e d t o a tube c o n t a i n i n g 1 pL o f 15 pM dATP and 1.5 pL o f [c*- P]dATP (15 P C i o f a 3,000 Ci/mmol 32  s t o c k , NEN).  From the m i x t u r e , 2 pL a l i q u o t s were t r a n s f e r r e d t o 'A' and  'T' t u b e s , w h i l e 2.5 pL a l i q u o t s were t r a n s f e r r e d  'G' and 'C' t u b e s .  To  these tubes were a l s o added 1.5 pL o f t h e a p p r o p r i a t e dd/dNTP mix (see Table I V ) .  TABLE IV.  'Dideoxy' M i x C o m p o s i t i o n *  'G'  ddGTP ddATP ddTTP ddCTP dGTP dTTP dCTP  (pM) (pM) (pM) (pM) (pM) (pM) (pM)  89  *A'  1 Ji 1  -  116  -  547  -  7.9 158 158  Ill 111 111  158 7.9 158  547 158 158 10.5  -  -  -  e m p i r i c a l l y d e r i v e d by Dr. Joan McPherson  R e a c t i o n s were s t a r t e d by a d d i t i o n o f 0.2 u n i t s o f t h e Klenow fragment o f E. c o l i DNA polymerase I , and i n c u b a t i o n a t room temperature f o r 15 minutes.  One pL o f 0.5 mM dATP chase was added t o each tube and  i n c u b a t i o n c o n t i n u e d a t room temperature f o r an a d d i t i o n a l 15 m i n u t e s . R e a c t i o n s were t e r m i n a t e d by t h e a d d i t i o n o f 5 pL o f 98% d e i o n i z e d  - 42 -  formamide, 10 mM EDTA, 0.2% x y l e n e c y a n o l , and 0.2% bromophenol  blue.  The  samples were h e a t e d t o 95°C f o r 3 minutes and q u i c k - c h i l l e d on i c e p r i o r t o electrophoresis.  The sequencing g e l s were r u n as d e s c r i b e d under the  methods t o Maxam and G i l b e r t s e q u e n c i n g .  2.7  Some G e n e r a l Methods o f DNA A n a l y s i s  2.7.1  Recovery o f DNA from Agarose and A c r y l a m i d e G e l s  DNA was r e c o v e r e d from g e l s by e l e c t r o - e l u t i o n i n t o a d i a l y s i s t u b e . The DNA band o f i n t e r e s t was s l i c e d out o f the g e l and p l a c e d i n a d i a l y s i s tube c o n t a i n i n g a s m a l l volume o f 0.5X TBE.  The t u b i n g was clamped a t b o t h  ends, t a k i n g c a r e n o t t o t r a p any a i r b u b b l e s , and immersed  i n a shallow  l a y e r o f 0.5X TBE i n an e l e c t r o p h o r e s i s t a n k .  E l u t i o n o f the DNA was  g e n e r a l l y a c h i e v e d by 30-60 minutes a t 100 V.  The DNA a s d i s l o d g e d from w  the w a l l o f t h e d i a l y s i s tube by r e v e r s i n g the c u r r e n t f o r 30 seconds, and the b u f f e r i n the bag r e c o v e r e d .  The e l u t e d DNA was e i t h e r e t h a n o l  p r e c i p i t a t e d d i r e c t l y o r p u r i f i e d f u r t h e r by ion-exchange  2.7.2  chromatography.  P u r i f i c a t i o n o f DNA on Mini-Chromatography Columns  DNA e l u t e d from agarose g e l s was f u r t h e r p u r i f i e d by chromatography e i t h e r on DE-52 (Whatman L t d . ) o r on RPC-5 a n a l o g (BRL) packed i n 200 \iL Eppendorf p i p e t t i p s .  Both columns i n v o l v e d t h e i n i t i a l l o a d i n g o f DNA i n  low s a l t (< 0.1 M NaCl) and e v e n t u a l e l u t i o n i n h i g h s a l t (> 0.5 M NaCl).  The p u r i f i e d DNA was p r e c i p i t a t e d w i t h e t h a n o l and resuspended i n  s t e r i l e TE b u f f e r .  - 43 -  2.7.3  L a b e l l i n g DNA  by  Nick-Translation  High s p e c i f i c a c t i v i t y l a b e l l e d DNA DNA  a c c o r d i n g t o the procedure  m i x t u r e c o n t a i n e d 50 mM ug/mL BSA, 0.2  0.2 mM  was  o b t a i n e d by n i c k - t r a n s l a t i n g  o f Rigby e_t_ al^. ( 1 7 6 ) .  T r i s - H C l , pH 7.5,  The  25 uL  10 mM M g C l , 1 mM 2  DTT,  reaction 100  C a C l , 10 uM each o f dATP and dTTP, a p p r o x i m a t e l y 2  ug o f p u r i f i e d DNA,  and 15 u C i each o f [ a - P ] d G T P and 32  [ a - p ] d C T P (3,000 Ci/mmol, NEN).  The r e a c t i o n was  32  s t a r t e d by  the  a d d i t i o n o f 1 uL o f DNAase I ( d i l u t e d 1:40,000 from a 1 mg/mL s t o c k ) and 2 u n i t s o f E^ c o l i DNA  polymerase I .  The n i c k - t r a n s l a t i o n was  c a r r i e d out  a t 14-15°C f o r 1 hour and t e r m i n a t e d by the a d d i t i o n o f 125 uL o f s t o p buffer  (50 mM  EDTA, 100 ug/mL BSA).  was  separated  the u n i n c o r p o r a t e d dNTPs by c e n t r i f u g a t i o n through a 1 mL  column o f  Sephadex G-50.  T h i s spun-column was  beads i n t o a d i s p o s a b l e 1 mL  The  l a b e l l e d DNA  prepared by p a c k i n g Sephadex  syringe.  8  denatured  probe was  recovered.  G-50  In a s t a n d a r d n i c k - t r a n s l a t i o n  r e a c t i o n , 150 uL o f v e r y h i g h s p e c i f i c a c t i v i t y 10 cpm/ug DNA)  from  (approximately  An a l i q u o t of the probe  was  by h e a t i n g t o 100°C f o r 5 minutes and q u i c k - c h i l l i n g on i c e , and  used d i r e c t l y i n h y b r i d i z a t i o n m i x e s .  2.7.4  Hybridizations  A l l NC f i l t e r s prepared the same manner.  f o r h y b r i d i z a t i o n s were t r e a t e d i n e s s e n t i a l l y  F i l t e r s were h e a t - s e a l e d i n Seal-a-Meal  t o w h i c h were added p r e h y b r i d i z a t i o n mix 5X Denhardt's reagent denatured  ( 1 7 7 ) , 0.1%  c a l f thymus DNA)  P r e h y b r i d i z a t i o n was  SDS,  bags (Sears  Ltd.)  (5X SSPE, 50% d e i o n i z e d formamide,  and 100 to 200 yg/mL o f  a t 50 uL per cm  2  of  a t 42°C f o r 1 t o 4 h o u r s .  sheared,  filter. Hybridizations  were a l s o  c a r r i e d out a t 42°C i n the mix d e s c r i b e d above except t h a t IX Denhardt's  - 44 -  reagent  (0.02% each o f PVP, BSA, and F i c o l l ) ,  and a denatured  [ P ] l a b e l l e d DNA probe was used. 3 2  After hybridization  ( u s u a l l y o v e r n i g h t ) , the f i l t e r s were washed i n  two changes o f 2X SSPE, 0.1% SDS f o l l o w e d by one change o f 0.1X SSPE, 0.1% SDS a l l a t room temperature. 0.1X SSPE, 0.1% SDS.  One f i n a l wash was c a r r i e d out a t 50°C i n  The f i l t e r s were f l u o r o g r a p h e d a t -70°C u s i n g Kodak  X-Omat AR f i l m and a Dupont Cronex i n t e n s i f y i n g  2.8  C o n s t r u c t i o n and S c r e e n i n g o f Trout Genomic L i b r a r i e s  The by  screen.  v a r i e t y o f lambda v e c t o r s and b a c t e r i a l h o s t s were k i n d l y  the f o l l o w i n g :  T e r r y Snutch (XCH4A, E. c o l i  provided  DP50„_), Ross  br MacGillivray  ( E. c o l i Q358, E. c o l i  Q359), and M i c h a e l Sung (XL47.1, E.  c o l i K802).  2.8.1  I s o l a t i o n o f B a c t e r i o p h a g e Lambda  DNA  L a r g e - s c a l e growth o f phage lambda was based on the methods o f Yamamoto e t a l .  (178).  An o v e r n i g h t c u l t u r e o f the a p p r o p r i a t e  bacterial  h o s t was i n f e c t e d w i t h phage lambda a t a m u l t i p l i c i t y o f i n f e c t i o n o f 0.1 (i.e. The  f o r a t y p i c a l 0.5 L c u l t u r e ,  10  1 0  c e l l s were used w i t h 10 p f u ) . 9  phage was grown i n 0.5 L o f prewarmed (37°C) media i n a 2 L f l a s k .  NZYDT ( 1 % NZ-amine, 0.5% y e a s t e x t r a c t , 0.5% NaCl, 0.2% CAA, 10 mM M g C l , 2  100 ug/L DAP, and 40 ug/mL thymidine, pH 7) was used f o r growing phage i n the b a c t e r i a l  s t r a i n D P 5 0 „ , whereas NZYC ( 1 % NZ-amine, 0.1% y e a s t C  or e x t r a c t , 0.5% NaCl, 0.1% CAA, 10 mM M g C l , pH 7) was used i f the host 2  c e l l s were from the s t r a i n s K802, Q358, o r Q359. at  37°C w i t h a e r a t i o n f o r 6 to 10 h u n t i l  The f l a s k s were i n c u b a t e d  the b a c t e r i a l c e l l s  l y s e d to  - 45 -  release  the phage p a r t i c l e s .  f l a s k and i n c u b a t i o n cell  lysis.  Supernatants were c a r e f u l l y t r a n s f e r r e d  29.2 g o f NaCl ( f i n a l  concentration The  c o n t i n u e d f o r an a d d i t i o n a l 15 minutes t o complete t h e  B a c t e r i a l d e b r i s was removed by c e n t r i f u g a t i o n a t 9000 x g (15  minutes, 4 ° C ) . containing  Approximately 10 mL o f CHCl^ was added t o the  10%).  concentration  to a clean  flask  1 M) and 50 g o f PEG ( f i n a l  The contents were mixed and l e f t o v e r n i g h t a t 4°C.  PEG p r e c i p i t a t e was c o l l e c t e d by c e n t r i f u g a t i o n a t 9,000 x g (20  minutes, 4°C) buffer  (0.1  gelatin).  and the p e l l e t resuspended i n a t o t a l volume o f 6 mL SM  M NaCl, 10 mM T r i s - H C l , pH 7.5, To the  10 mM M g C l  2 >  and 0.02%  s u s p e n s i o n was added 50 uL o f 1 mg/mL DNAase I and 100  uL o f 5 mg/mL RNAase A and the m i x t u r e i n c u b a t e d a t 37°C f o r 30 minutes. An  e q u a l volume o f CHCl^ was added t o the phage s u s p e n s i o n and the  s e p a r a t e d by c e n t r i f u g a t i o n a t 1,500 l a y e r was t r a n s f e r r e d  x g (15 minutes, 4 ° C ) .  phases  The aqueous  t o a f r e s h tube.  To p u r i f y the b a c t e r i o p h a g e f u r t h e r , c e n t r i f u g a t i o n i n cesium c h l o r i d e .  For  i t was s u b j e c t e d  to equilibrium  every 1 mL o f phage, 0.75 mg o f  cesium c h l o r i d e was used.  Centrifugation  i n a Beckman VTi65 r o t o r .  The phage p a r t i c l e s formed a t i g h t b l u i s h band  i n the  gradient  was a t 45,000 rpm (15 hours, 4 ° C )  and were c o l l e c t e d i n a f a i r l y  s m a l l volume (1 t o 2 mL).  E x t r a c t i o n o f the DNA from phage lambda was performed as f o l l o w s :  0.1 v o l  o f 10X TE and 1 v o l o f d e i o n i z e d  chloride  s u s p e n s i o n o f phage p a r t i c l e s . for  cesium  The m i x t u r e was l e f t a t room temperature  1 t o 2 hours and then 1 v o l o f d i s t i l l e d water and 6 v o l o f 95% e t h a n o l  added. 30  formamide was added t o the  The DNA came out o f s o l u t i o n w i t h i n  second c e n t r i f u g a t i o n .  nitrogen, successive  The DNA was r i n s e d  and resuspended i n TE b u f f e r . extractions  5 minutes and was p e l l e t e d by a i n 70% e t h a n o l ,  Finally,  the  twice w i t h phenol:CHC1- (1:1),  d r i e d under  DNA was s u b j e c t e d t o and twice w i t h CHC1-.  - 46 -  The DNA was r e p r e c i p i t a t e d w i t h e t h a n o l and taken up i n TE b u f f e r .  2.8.2  P r e p a r a t i o n o f Lambda  'Arms'  Lambda DNA was d i g e s t e d w i t h the a p p r o p r i a t e r e s t r i c t i o n  endonuclease,  e.g. EcoRI f o r CH4A (179, 180) and BamHI f o r L47.1 (181), t o l i b e r a t e the insert  fragments.  A f t e r e x t r a c t i o n w i t h phenolrCHCl^  p r e c i p i t a t i o n w i t h e t h a n o l , the DNA was d i s s o l v e d  (1:1) and  i n TE b u f f e r supplemented  w i t h 10 mM MgCl^ and i n c u b a t e d a t 42°C f o r 1 hour t o a l l o w the c o h e s i v e ends o f lambda t o r e a n n e a l . and  l e f t arms annealed  fragments. methods. insert  This resulted  i n one l a r g e fragment ( t h e r i g h t  t o g e t h e r ) and one o r two much s m a l l e r i n s e r t  The p u r i f i c a t i o n o f lambda arms was done by one o f two In the case o f CH4A, the annealed  arms were s e p a r a t e d from the  fragments by f r a c t i o n a t i o n on a 0.35% agarose  gel.  In the second  method, L47.1 arms were p u r i f i e d by c e n t r i f u g a t i o n through gradients  (182).  Step g r a d i e n t s (40 mL) o f 10, 20, 30, and 40% (w/v)  sucrose i n 1 M NaCl, Annealed  L47.1 DNA  20 mM  T r i s - H C l , pH 7.7, and 5 mM  EDTA were poured.  (50 ng) was loaded onto each g r a d i e n t and s u b j e c t e d t o  c e n t r i f u g a t i o n a t 26,000 rpm (23 hours, Fractions  sucrose d e n s i t y  15°C) i n a Beckman SW27 r o t o r .  (1 t o 2 mL) were c o l l e c t e d by upward displacement  s u c r o s e and a l i q u o t s a n a l y z e d on a 0.5% agarose c o n t a i n i n g the annealed  w i t h 50% (w/v)  g e l (Figure 2). Fractions  arms were p o o l e d , d i l u t e d w i t h 3 v o l o f water and  the DNA p r e c i p i t a t e d w i t h e t h a n o l .  The d r i e d DNA p e l l e t was resuspended  TE b u f f e r and s t o r e d a t 4°C.  2.8.3  P r e p a r a t i o n o f 15-20 K i l o b a s e Fragments o f Trout  For the CH4A l i b r a r y ,  DNA  t r o u t t e s t e s DNA was d i g e s t e d w i t h EcoRI a t  in  -  47  -  4 7 10 13 16 19 22 25 27 29 31 33 35 M  M l  J  Figure  2.  Preparation gradient annealed,  o f the 'arms' o f phage lambda DNA by s u c r o s e  centrifugation. and c e n t r i f u g e d  XL47.1 DNA was d i g e s t e d w i t h BamHI, through a 10-40% sucrose  gradient.  F r a c t i o n s were c o l l e c t e d by upward displacement w i t h 50% sucrose and a l i q u o a t s were a n a l y z e d by e l e c t r o p h o r e s i s through a 0.5% aragose g e l .  S i z e markers (M) are from a Hind  w i l d type lambda DNA. Kb), and i n s e r t  I I I digest of  The l e f t arm (23.5 Kb, r i g h t arm (10.5  ( " s t u f f e r " ) fragments  F r a c t i o n s 22 to 29 c o n t a i n i n g  (6.6 Kb) were  the annealed  identified.  arms were p o o l e d .  - 48 -  v a r y i n g enzyme:DNA r a t i o s and f o r d i f f e r e n t d u r a t i o n s by Dr. E.P.M. Candido. 0.7%  The DNA  agarose g e l .  from v a r i o u s d i g e s t s was The 15-20  pooled and f r a c t i o n a t e d on a  Kb r e g i o n o f the DNA  e l e c t r o - e l u t e d onto a Whatman f i l t e r  paper backed d i a l y s i s membrane (183).  The f i l t e r was washed i n a s m a l l volume o f TNE mM  NaCl, and 1 mM  EDTA) p l u s 0.2%  on the g e l was  SDS.  tube and the f i l t e r washed as b e f o r e .  The  (10 mM  f l u i d was  The e l u t e d DNA  T r i s - H C l , pH 7.6,  10  removed to a f r e s h was  p r e c i p i t a t e d with  e t h a n o l , d r i e d under n i t r o g e n , and resuspended i n TE b u f f e r . I n s e r t DNA  f o r the L47.1  l i b r a r i e s was  prepared by  initially  e s t a b l i s h i n g c o n d i t i o n s f o r p a r t i a l d i g e s t i o n o f t r o u t DNA  w i t h Mbol.  D i g e s t i o n c o n d i t i o n s ranged from 0.00038 to 0.025 u n i t s o f Mbol/ug o f trout  DNA  i n c u b a t e d f o r 15 o r 60 minutes a t 37°C.  a n a l y z e d on a 0.5%  agarose g e l .  The optimum c o n d i t i o n o f d i g e s t i o n , to  a c h i e v e maximum r e p r e s e n t a t i o n i n the 15-20 0.025 u n i t s Mbol/pg DNA  These d i g e s t i o n s were  Kb range, was  i n c u b a t e d at 37°C f o r 60 minutes.  l a r g e - s c a l e p r e p a r a t i o n o f p a r t i a l l y d i g e s t e d t r o u t DNA, amount o f enzyme was  used.  An e q u a l a l i q u o t o f DNA  o p t i m a l amount o f enzyme, but o n l y f o r 15 minutes. d i g e s t i o n s was  determined to be  was  For the h a l f the optimum  d i g e s t e d w i t h the  The DNA  from both  p o o l e d , e x t r a c t e d twice w i t h phenol:CHCl-j (1:1), and  p r e c i p i t a t e d with ethanol.  The d r i e d p e l l e t was  P r i o r t o s u c r o s e g r a d i e n t c e n t r i f u g a t i o n , the DNA minutes and c o o l e d to room temperature.  Kb s i z e range was  was  i n TE b u f f e r .  heated to 68°C f o r 10  The c e n t r i f u g a t i o n was  d e s c r i b e d f o r the p r e p a r a t i o n o f v e c t o r DNA g r a d i e n t s were a n a l y z e d on a 0.5%  resuspended  arms.  as  F r a c t i o n s from the  agarose g e l ( F i g u r e 3 ) .  DNA  i n the  15-20  p o o l e d ( f r a c t i o n s 30-35), p r e c i p i t a t e d w i t h e t h a n o l , and  resuspended i n TE b u f f e r .  - 49  M  Figure  3.  4  9  -  14 18 21 23 25 27 29 31 33 35 37 40  Preparation  o f 15-20 Kb M b o l f r a g m e n t s  g e n o m i c DNA  was p a r t i a l l y  centrifugation  digested  T  M  o f t r o u t DNA.  w i t h M b o l and f r a c t i o n a t e d b y  through a sucrose d e n s i t y  gradient  (10-40%).  F r a c t i o n s were c o l l e c t e d by upward d i s p l a c e m e n t w i t h and a l i q u o t s o f s e l e c t e d through used  a 0.5% a g a r o s e  subsequently  f r a c t i o n s a n a l y z e d by  g e l . Fractions  to construct  Trout  sucrose  electrophoresis  30 t o 35 w e r e p o o l e d  a library  i n XL47.1.  m a r k e r s (M) w e r e  from a H i n d l l l d i g e s t o f w i l d type  T = Mbol p a r t i a l  digest  o f t r o u t DNA  50%  and  Size lambda  DNA.  p r i o r to f r a c t i o n a t i o n .  - 50 -  2.8.4  P r e p a r a t i o n o f i n v i t r o Packaging E x t r a c t s  The procedure employs the l y s o g e n i c s t r a i n s NS428 and NS433 (184) k i n d l y p r o v i d e d by T e r r y Snutch.  The two s t r a i n s p r o v i d e complementary  e x t r a c t s f o r e f f i c i e n t packaging o f lambda DNA. C o l o n i e s o f NS428 and NS433 b a c t e r i a were grown on M9 (0.6% N a H P 0 2  0.3%  4>  K H P 0 , 0.5% NaCl, 0.1% NH^Cl, 2 mM M g C l , 0.2% g l u c o s e , and 2  4  2  0.1 mM C a C l ) p l a t e s a t 30°C. 2  a t 30°C and 42°C.  S e v e r a l c o l o n i e s were checked f o r growth  Only c o l o n i e s growing a t 30°C, but not a t 42°C, were  used t o i n n o c u l a t e 50 mL o f M9 medium. s e p a r a t e f l a s k s a t 32°C w i t h s h a k i n g .  NS428 and NS433 were grown i n The c u l t u r e s were c e n t r i f u g e d a t  1,500 x g (5 minutes, 4°C) and resuspended  i n 5 mL o f M9 medium.  Two 0.5 L  c u l t u r e s o f NS433 and one o f NS428 were i n n o c u l a t e d t o an i n i t i a l A , ™ o f oUU  0.05 and i n c u b a t e d a t 32°C w i t h a e r a t i o n u n t i l an ^^QQ o f 0.3 was r e a c h e d . B a c t e r i o p h a g e growth was induced by t r a n s f e r r i n g the f l a s k s t o a 45°C b a t h f o r 20 minutes w i t h f r e q u e n t s w i r l i n g , and then t o a 37°C w i t h v i g o r o u s shaking f o r 2 h o u r s . and c h i l l e d  water  incubator  Contents from a l l 3 f l a s k s were pooled  i n i c e - w a t e r f o r 10 minutes.  From t h i s p o i n t e v e r y t h i n g was  kept on i c e t o a v o i d i n a d v e r t a n t l y s i s o f the c e l l s .  The c u l t u r e s were  s u b j e c t e d t o c e n t r i f u g a t i o n a t 2,500 x g (10 minutes, 4°C) and the p e l l e t s resuspended  i n a t o t a l o f 450 mL i c e - c o l d M9 medium.  The c e l l s were  r e c e n t r i f u g e d as above and the supernatant d r a i n e d c o m p l e t e l y . CH b u f f e r  (40 mM T r i s - H C l , pH 8, 10 mM s p e r m i d i n e - H C l , 10 mM  HC1, 0.1% 0-mercaptoethanol,  S i x mL o f  putrescine-  7% DMSO, and 1.5 mM ATP) was s t i r r e d  the p e l l e t s as q u i c k l y and g e n t l y as p o s s i b l e .  i n with  A l i q u o t s o f 100 pL were  t r a n s f e r r e d t o Eppendorf tubes and these were immediately plunged i n l i q u i d nitrogen.  The packaging e x t r a c t s were s t o r e d f r o z e n a t -70°C.  e f f i c i e n c i e s varied  from 1 0  7  Packaging  t o 10* p f u per ug o f u n d i g e s t e d lambda  DNA.  - 51  2.8.5  L i g a t i o n and  For  the  and  Packaging R e a c t i o n s  l i g a t i o n of lambda arms to i n s e r t DNA,  (arms:insert) L i g a t i o n was  was  used at a f i n a l DNA  c a r r i e d out  1 Weiss u n i t of T4 DNA  Murray (185).  f o r 3 minutes. M ATP,  and  An  mix  was  37°C.  uL of 1 M M g C l first  buffer  mL The  to the  Packaging was  thawed as above and 2  thawed on  1.5  uL of  0.1  e x t r a c t and c a r r i e d out  ice  mixed at  37°C  1 uL o f 1 mg/mL  added to i t . About 50 uL o f t h i s  of SM b u f f e r and d e b r i s was  i n a c l e a n tube at  incubation  c o n t i n u e d at  3 drops of CHC1  centrifuged  out  and  3  the  were packaged  4°C.  A m p l i f i c a t i o n o f the Lambda L i b r a r i e s  Both the  CH4A and  packaging mixes on 12 hours and at 4°C  ug/uL.  the method of Hohn  t o t a l DNA),  packaging r e a c t i o n and  added to the r e a c t i o n mix.  2.8.6  based on  added d i r e c t l y  glass c a p i l l a r y .  A f t e r 30 minutes, 0.9  stored  was  (with about 2 ug  A second e x t r a c t was  added to the  phage was  l i g a t e d DNA  of CH b u f f e r was  DNAase I w i t h 2.5  o f 0.2  a l i q u o t of f r o z e n packaging e x t r a c t was  i n w i t h a heat b l u n t e d f o r 1 hour.  concentration  2:1  ligase.  L i g a t i o n mix  20 ML  a molar r a t i o of  at 12°-14°C f o r 12 to 16 hours i n l i g a t i o n  In v i t r o packaging of the and  -  2.8.7 The  hours and  libraries  l i b r a r i e s were a m p l i f i e d by p l a t i n g out  f r e s h l y poured p l a t e s .  then o v e r l a y e d  f o r a few  amplified  L47.1  w i t h 5 mL the o v e r l a y  s t o r e d at 4°C  These were i n c u b a t e d at 37°C f o r  of c o l d SM b u f f e r . collected.  i n sealed  the  P l a t e s were  C h l o r o f o r m was  left  added  and  tubes or f l a s k s .  S c r e e n i n g o f the Lambda L i b r a r i e s phage lambda l i b r a r i e s were screened e s s e n t i a l l y as d e s c r i b e d  Benton and  Davis  (186).  Phage were p l a t e d out  by  at a p p r o x i m a t e l y 10-20,000  - 52 -  p f u per p l a t e and grown a t 37°C. the  surface  the  f i l t e r was  f i l t e r was  The  p e e l e d o f f and immersed DNA  f i l t e r was  [ P]labelled 3 2  M  to 1.5 M NaCL, 0.5 M T r i s - H C l , pH 7.6  (3  A f t e r h y b r i d i z a t i o n to a  probe, any p o s i t i v e s were t r a c e d back to the o r i g i n a l p u r i f i e d by a second and t h i r d  from phages i d e n t i f i e d as p o s i t i v e s was  culture i n exactly  preparation.  plate  screening.  bacterial debris. 5 M NaCl.  the c u l t u r e was  To the supernatant was  added  o f DNAase b u f f e r  C a C l ) and t r a n s f e r r e d  and 5 mM  (50 mM  Hepes, pH 7.5,  to an Eppendorf tube.  The m i x t u r e was made IX i n SET EDTA) and 100 ug o f p r o t e i n a s e  6 mL  3  Corex  o f 50% PEG and 3 mL  5 mM  of  and f i n a l l y w i t h CHC1  2  mM  A f t e r a d d i t i o n o f 5 ng i n c u b a t e d a t 37°C f o r 30  (0.5% SDS, K added.  3  resuspended i n  M g C l , and 0.5  10 mM  alone.  T r i s - H C l , pH  7.8,  The tube was i n c u b a t e d  at 68°C f o r 30 minutes and the c o n t e n t s then e x t r a c t e d w i t h phenol:CHC1  t o a 30 mL  The p e l l e t was  DNAase I and 50 pg RNAase A, the m i x t u r e was minutes.  large-scale  l e f t a t 4°C f o r s e v e r a l hours and then  12,000 x g (10 minutes, 4 ° C ) .  2  transferred  f o r the  a t 12,000 x g (10 minutes, 4°C) to remove the  The s u s p e n s i o n was  centrifuged  p r e p a r e d by growing a 20  the same manner as t h a t d e s c r i b e d  After lysis,  tube and c e n t r i f u g e d  a number o f times  The phage DNA  e t h a n o l p r e c i p i t a t e d and the d r i e d p e l l e t resuspended buffer.  A f t e r 2 minutes  S m a l l - S c a l e Growth o f B a c t e r i o p h a g e Lambda  DNA  0.3 mL  onto  s u b s e q u e n t l y r i n s e d twice i n 2X SSPE and a i r d r i e d  and the plaque o f i n t e r e s t was  mL  neatly  s i d e up i n 1.5 M NaCl, 0.5  p r i o r to b a k i n g ^ n vacuo at 80°C f o r 2 hours.  2.8.8  placed  o f the top-agarose and o r i e n t a t i o n marks made.  NaOH (3 m i n ) , then t r a n s f e r r e d min).  A d r y NC  was  i n 50 pL o f TE  - 53  III.  3.1  C h a r a c t e r i z a t i o n of the Trout  3.1.1  The  The  -  RESULTS  Heat Shock Response at the P r o t e i n  Heat Shock P r o t e i n s o f Trout  RTG-2 C e l l s  e f f e c t of temperature e l e v a t i o n or sodium a r s e n i t e on  fibroblasts  i s the p r o d u c t i o n  of a set o f new  r e f e r r e d to as the heat-shock p o l y p e p t i d e s  polypeptides.  (hsps).  been shown i n the autoradiogram of F i g u r e 4. w i t h sodium a r s e n i t e  s i x new  p r o t e i n s are  are 87 K,  70 K,  synthesized.  62 K,  r e s o l v e d as a doublet  42 K,  32 K,  used as the  inducer  These p r o t e i n s were induced  Kd was  c o u l d a l s o be  m o l e c u l a r weights of the 30 K.  The  The  synthesis  induced c e l l s  The  major hsp  level.  T h i s may  be  sufficient  (70 K) was be  i n SDS  sometimes  i n d i c a t i v e of  almost a l l of the  (Figure  prolonged  to cause i n d u c t i o n  no  of  sodium a r s e n i t e the patterns  5). c o u l d be  ( F i g u r e 4A,  reduced i f the  lane c ) ; i n t h i s  i n c o r p o r a t i o n of l a b e l i s i n t o the hsps.  i n t e r e s t i n g to note t h a t hsp42 was  the  sample b u f f e r , i . e . ~  Densitometry scanning of  of normal c e l l u l a r p r o t e i n s  i n d u c t i o n w i t h a r s e n i t e was  sometimes  not prominent i f temperature e l e v a t i o n  autoradiograms c l e a r l y showed the d i f f e r e n c e s i n p r o t e i n s y n t h e s i s between c o n t r o l and  least  proteins  band at 62 K was  sometimes observed by a hsp.  B).  (lane a or d) shows t h a t at  time of h a r v e s t i n g  even a s l i g h t degree of a n o x i a may  i n d u c t i o n and  hsps of t r o u t have  T h i s band c o n s i s t e n t l y appears a f t e r  at a low  c o n d i t i o n of the c e l l s at the  A band at 100  and  ( F i g u r e 4B).  seen i n c o n t r o l c e l l s , but  hsp70.  The  ( F i g u r e 11).  sodium a r s e n i t e i n d u c t i o n but was was  The  trout  These are  (panel A) or temperature e l e v a t i o n (panel  Comparison w i t h e x t r a c t s o f c o n t r o l c e l l s  Level  longer  case  It i s  induced under t h i s extended  - 54 -  obc SA  HS d e  hsp -  <  4  1  8 7  4  7 0  4 6 2  4 4 2  - 3 2  Figure  4.  4 32 « 3 0  * 3 0  —  The h e a t - s h o c k p r o t e i n s  o f t r o u t RTG-2 c e l l s .  i n d u c i b l e by Sodium A r s e n i t e  (SA):  Lane  50 pM a r s e n i t e f o r 3 h o u r s a n d r e c o v e r y MM a r s e n i t e f o r 24 h o u r s .  (B)  5 h o u r s and r e c o v e r y labelled  (a) c o n t r o l , lane (b) o f 1 hour, lane  Proteins  temperature e l e v a t i o n (HS): lane  [ S]methionine. 3 s  (100  ( e ) 27°C f o r  A l lcells  were  Proteins  were  s e p a r a t e d o n a 1 0 % S D S - p o l y a c r y l a m i d e g e l w h i c h was autoradiographed.  ( c ) 50  i n d u c i b l e by  (d) c o n t r o l , lane  a t 22°C f o r 1 h o u r .  f o r 1 hour w i t h  (A) P r o t e i n s  subsequently  The o p e n t r i a n g l e i n d i c a t e s a n o t h e r  K d ) t h a t may a l s o be i n d u c i b l e b y a r s e n i t e .  protein  -  55  -  30  70  62 87 32  Ac  100  42  50MM  A)  28°C  A  SA  HS  MN CONTROL  F i g u r e 5.  Densitometry scans o f a u t o r a d i o g r a p h s from SDS-acrylamide [ SJmethionine 35  l a b e l l e d proteins  were f r a c t i o n a t e d on a 10%  SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . subsequently scanned i n a Beckman DU-8  The X~ray f i l m was  spectrophotometer.  scans from t h r e e s e p a r a t e lanes a r e shown: arsenite  gels.  SA = 50 pM  The  sodium  exposure f o r 24 hours, HS = 28°C heat-shock f o r 1 hour,  and c o n t r o l c e l l s . (Ac) m i g r a t i o n .  Arrows i n d i c a t e p o s i t i o n s  o f hsp and a c t i n  - 56 -  p e r i o d o f s t r e s s ; hsp70 and hsp30 were the major  s p e c i e s induced.  l a t t e r p r o t e i n s were r e a d i l y v i s i b l e on g e l s w i t h Coomassie when the c e l l s were induced f o r 24 hours v i s i b l e under  (Figure 6).  The  blue s t a i n i n g  The hsp32 i s a l s o  these c o n d i t i o n s .  Samples o f JK_ melanogaster hsps  (a g i f t o f L. Moran) induced a t 37°C  were compared w i t h the t r o u t hsps induced w i t h 50 pM sodium a r s e n i t e f o r 24 h o u r s .  The samples were f r a c t i o n a t e d on a 10% SDS-polyacrylamide g e l  and a u t o r a d i o g r a p h e d ( F i g u r e 7 ) . the t r o u t hsps are i n lane c. t o g e t h e r ( l a n e b ) , i t was  The D r o s o p h i l a hsps are i n lane a, w h i l e  When samples  from both were mixed  and run  seen t h a t hsp70 from D r o s o p h i l a and t r o u t  i d e n t i c a l m o b i l i t i e s i n t h i s system.  had  The major hsp from the nematode, C.  e l e g a n s , has a l s o been found to co-migrate w i t h the t r o u t hsp70 (T. Snutch and R. Kothary, d a t a not shown).  3.1.2  Temperature  Our u s u a l growth  P r o f i l e o f the Heat Shock Response temperature f o r these c e l l s was  temperature by as l i t t l e  22°C.  I n c r e a s i n g the  as 5°C r e s u l t e d i n the i n d u c t i o n o f hsps.  The  e f f e c t o f a range o f temperatures on hsp s y n t h e s i s has been s t u d i e d and the r e s u l t s shown i n F i g u r e 8. temperature  The c e l l s were kept at the a p p r o p r i a t e  f o r 1 hour, then r e t u r n e d t o 22°C f o r another hour.  f o l l o w e d by a 1 hour l a b e l l i n g p e r i o d w i t h [ S ] m e t h i o n i n e . 3 5  the autoradiogram ( F i g u r e 8 ) , the response was up t o the l e t h a l temperature o f 34°C.  This  was  As shown i n  p r e s e n t i n a l l temperatures  Hsp70, hsp32, and hsp30 were p r e s e n t  a t a l l temperatures up to 34°C; hsp87 and hsp42 were p r e s e n t to 29°C. shocks a t h i g h e r temperatures, e.g. 37°C, w i l l  also e l i c i t  Heat  hsp s y n t h e s i s i f  the d u r a t i o n o f the i n d u c t i o n p e r i o d i s s h o r t , e.g. l e s s than 10 minutes (see F i g u r e 8 ) .  - 57  -  SA  Figure  6.  C  D e t e c t i o n o f hsps w i t h Cooraassie b l u e s t a i n i n g . exposed proteins  t o 50 uM from  SDS-acrylamide in  control  sodium  the c e l l gel.  arsenite extract  These  cells (C).  Cells  ( S A ) f o r 24 h o u r s  were  proteins  were  and t h e  s e p a r a t e d o n a 10% were  compared t o t h o s e  found  - 58 -  a bc Drosophila melanogaster hsp70  •  ^  Trout «  Figure  7.  Comparison o f Trout gel.  Lane  (a) heat-shock induced  melanogaster  (gift  sodium a r s e n i t e the  trout  and D r o s o p h i l a h s p s  and  o f D r . L.A.  induced  Drosophila  hsps.  on a n S D S - a c r y l a m i d e  (37°C) p r o t e i n s  Moran),  proteins  hsp70  lane  of trout,  of  D.  ( c ) 24 h o u r s 50 lane  pM  (b) a m i x t u r e of  -  Figure  8.  Temperature  profile  heat-shocked recovered [  3 5  S]methionine  h e a t - s h o c k was  The  arrows  bottom  -  o f the heat  at the temperatures  a t 22°C  fractionated  59  f o r 1 hour  f o r 1 hour  shock  response.  ( ° C ) shown  and f i n a l l y  a t 22°C.  f o r 5 minutes only.  The c e l l s  f o r 1 hour,  labelled  Note  that  The c e l l  were  then  with  t h e 37°C  extract  was  o n a 10% S D S - a c r y l a m i d e g e l a n d a u t o r a d i o g r a p h e d .  indcated  respectively.  hsps  87, 70, 42, 32, a n d 30 f r o m t o p t o  - 60 -  3.1.3  E f f e c t o f D u r a t i o n o f the Heat  To examine  Shock  the e f f e c t o f p r o l o n g e d temperature e l e v a t i o n , c e l l s were  incubated a t 28°C f o r v a r i o u s l e n g t h s o f time and then l a b e l l e d [ S]methionine  f o r 1 hour at 22°C.  3 5  with  As the i n d u c t i o n time at 28°C was  i n c r e a s e d from 1 hour t o 16 hours, the l e v e l o f i n c o r p o r a t i o n i n t o the hsps also increased and hsp30. f ) was  (Figure 9).  T h i s was  e s p e c i a l l y apparent f o r hsp70,  hsp32,  The i n c o r p o r a t i o n r a t e a t 16 hours o f i n d u c t i o n ( F i g u r e 9,  lane  comparable to t h a t a t 5 hours ( l a n e d) and 7.5 hours (lane e ) .  These r e s u l t s suggest t h a t the hsps are f u l l y induced by 5 hours at 28°C.  3.1.4  Recovery from Heat  To examine  Shock  the r e v e r s i b i l i t y of the heat shock response, c e l l s heat  shocked a t 27°C f o r 1 hour were allowed to r e c o v e r a t 22°C f o r v a r y i n g l e n g t h s o f time and then l a b e l l e d [ S]methionine. 3 5  f o r 1 hour a t 22°C w i t h  The r e s u l t s are presented i n F i g u r e 10.  A l t h o u g h the  amounts o f hsp87 and hsp30 were not a l t e r e d s i g n i f i c a n t l y i n the time span s t u d i e d , hsp70 and hsp42 l e v e l s dropped a f t e r 3 hours a t 22°C.  This  suggests e i t h e r t h a t the genes f o r hsp70 and hsp42 are more e f f i c i e n t l y turned o f f i n the absence o f the i n d u c i n g s t i m u l u s than a r e the hsp87 and hsp30 genes, or t h a t the mRNAs f o r hsp87 and hsp30 are more s t a b l e .  3.1.5  Sodium A r s e n i t e C o n c e n t r a t i o n Study  As shown above  ( F i g u r e 4A), sodium a r s e n i t e induced a spectrum of hsps  i n t r o u t c e l l s which were v e r y s i m i l a r to t h a t induced by temperature elevation.  The o n l y s i g n i f i c a n t d i f f e r e n c e was  d a l t o n s which was A study was  the e x t r a band a t 62K  induced by sodium a r s e n i t e but not by temperature s h i f t . performed to determine the optimum a r s e n i t e  concentration  - 61 -  a b c d e f  mm m  mm  Figure  9.  Time s t u d y o f h e a t - s h o c k . various with  [  3 5  lengths  control, hours  g e l and  heat-shock,  from  then  These  top  The  labelled  triangles  hours  at  were  autoradiographed.  ( e ) 7.5  to bottom  were h e a t - s h o c k e d  proteins  (b) 1 hour heat-shock,  heat-shock. 30  o f t i m e and  Sjmethionine.  SDS-acrylamide  Cells  22°C  at  for 1  separated Lanes  28°C f o r  are:  on  heat-shock,  heat-shock,  ( f ) 16  respectively.  the hsps  87,  a  10%  (a)  (c) 3 hours  indicate  hour  (d) 5  hours  70,  42,  32  and  - 62 -  F i g u r e 10. Recovery  from heat-shock.  C e l l s were heat-shocked  hour and a l l o w e d to r e c o v e r a t 22°C f o r d i f f e r e n t time.  lengths o f  They were then l a b e l l e d w i t h f S J m e t h i o n i n e  at 22°C.  35  The c e l l e x t r a c t s were r u n on a 12.5%  g e l and a u t o r a d i o g r a p h e d . l a n e s (a) 0 hours, and  a t 27°C f o r 1  cells.  SDS-acrylamide  The r e c o v e r y times were as f o l l o w s :  (b) 1.5 hours,  lane (e) c o n t r o l  f o r 1 hour  ( c ) 3 hours,  (d) 4.5 hours,  - 63  f o r hsp  induction.  pM ( F i g u r e 11,  600  the a p p r o p r i a t e  The  -  range of f i n a l c o n c e n t r a t i o n s  lanes b ~ l ) .  The  used was  from 1 to  c e l l s were induced f o r 3 hours w i t h  amount o f sodium a r s e n i t e .  T h i s was  followed  by  incubation  i n f r e s h medium f o r 2 hours, a f t e r which they were l a b e l l e d f o r an hour with  [ SJmethionine.  The  35  done a t 22°C.  and  l a b e l l i n g were a l l 11,  d i f f e r e n t hsps  v a r i e d i n t h e i r i n d u c i b i l i t y as a f u n c t i o n of the a r s e n i t e  concentration.  Hsp70 and i).  The  As  i n d u c t i o n , recovery,  shown i n the autoradiogram of F i g u r e  hsp87 induced v e r y doublet  at 62K  i n amount a f t e r 50 concentrations a r s e n i t e and hsp30. 15  up  pM.  r e a d i l y w i t h an optimum at about 50 pM  daltons  was  Hsp42 was  to 300  a l s o very  pM ( l a n e k ) .  Hsp32 i n c r e a s e d The  pM  from 5 to 50  most dramatic e f f e c t was  on  s p e c i f i c a l l y enhanced at a r s e n i t e c o n c e n t r a t i o n s  pM ( l a n e s g - j ) , w i t h a peak of 50 pM.  to 100  decreased  induced e q u a l l y w e l l at a l l the  then d i s a p p e a r e d a g a i n .  I t s l e v e l was  r e a d i l y induced but  (lane  were i n d u c i b l e at an a r s e n i t e c o n c e n t r a t i o n  o f 50  Since  a l l the hsps  pM,  t h i s l e v e l was  of  used  i n subsequent experiments.  3.1.6  Recovery from Sodium A r s e n i t e  Since  the e f f e c t o f sodium a r s e n i t e was  e l e v a t i o n i n the  temperature shock.  by  As  shown above ( F i g u r e 10),  the s y n t h e s i s  to normal c o n t r o l l e v e l s f o l l o w i n g r e c o v e r y  To study r e c o v e r y  from a r s e n i t e i n d u c t i o n , t r o u t  i n f r e s h medium f o r d i f f e r e n t l e n g t h s  a 1 hour p e r i o d of l a b e l l i n g w i t h  hsps were s t i l l  temperature  induced f o r 3 hours w i t h 50 pM sodium a r s e n i t e and  allowed to r e c o v e r followed  examined.  hsp42 r e t u r n e d  were i n i t i a l l y  s i m i l a r to t h a t of  i n d u c t i o n of the hsps, the s i m i l a r i t y of the r e v e r s a l of  the i n d u c t i o n was hsp70 and  Induction  present  3 5  2 hours a f t e r the a r s e n i t e had  from cells  then  o f time.  [ S]methionine.  of  This  was  A l l the  been removed  (Figure  - 64 -  Figure  11. Hsp s y n t h e s i s a t v a r y i n g were  induced  with  and  then  was  f o r 1 hour  separated  left  to recover  1,  (j)  100,  with  [  3 5  concentrations  SJmethionine.  ( c ) 2.5,  Cells  of a r s e n i t e f o r 3 hours  i n f r e s h medium  o n a 10% S D S - a c r y l a m i d e  Concentrations (b)  various  sodium a r s e n i t e c o n c e n t r a t i o n s .  f o r 2 hours.  Cell  g e l and  Labelling  e x t r a c t s were autoradiographed.  (pM) o f a r s e n i t e u s e d w e r e a s f o l l o w s : ( a ) 0, ( d ) 5,  ( k ) 300, a n d  ( e ) 7.5, ( 1 ) 600.  ( f ) 10,  ( g ) 15,  ( h ) 25,  ( i ) 50,  - 65 -  12, at  lane c ) .  T h i s suggests  a maximum a t t h i s  t h a t the t r a n s l a t a b l e heat  time.  shock mRNA l e v e l was  A g a i n the 100 Kd p r o t e i n was p r e s e n t w i t h the  o t h e r s and the 62Kd band was now c l e a r l y r e s o l v e d as a d o u b l e t . r e c o v e r y from temperature  shock, hsp42 was the f i r s t  As w i t h  t o d i s a p p e a r ; here i t s  s y n t h e s i s was terminated between 2 and 6 hours o f r e c o v e r y .  Production of  hsp70 and the d o u b l e t o f hsp62 was h a l t e d b e f o r e 10 hours o f r e c o v e r y . Hsp87 s y n t h e s i s was t e r m i n a t e d a f t e r about 15 hours o f r e c o v e r y .  Although  the l e v e l o f hsp30 dropped a f t e r 10 hours o f r e c o v e r y , i t was s t i l l d e t e c t a b l e even a f t e r 28 hours o f r e c o v e r y .  Thus, the m a j o r i t y o f the heat  shock mRNAs a r e e i t h e r n o t p r e s e n t o r present but n o t t r a n s l a t e d a f t e r 6 t o 10 hours from the end o f i n d u c t i o n . d i f f e r e n t r e c o v e r y times  As i n the case o f heat  shock, the  f o r hsps f o l l o w i n g a r s e n i t e i n d u c t i o n may be  a t t r i b u t e d t o d i f f e r e n c e s i n the r a t e s o f r e p r e s s i o n o f the hsp genes, t o v a r i a t i o n s i n the hsp mRNA s t a b i l i t i e s ,  3.1.7  o r both.  L o c a l i z a t i o n o f the hsps  RTG-2 c e l l s were induced a t 28°C f o r 1 hour, r e c o v e r e d a t 22°C f o r 2 hours, was  then l a b e l l e d w i t h  chased  usual.  a t 22°C f o r 1 hour.  F o r the c o n t r o l s i t u a t i o n , uninduced  3s  and  35  The l a b e l  f o r 0 o r 40 minutes i n f r e s h medium and the c e l l s h a r v e s t e d as  [ S]methionine chase.  [ Sjmethionine  c e l l s were l a b e l l e d  a t 22°C f o r 1 hour and h a r v e s t e d without  with  any p u l s e -  The c e l l s were s e p a r a t e d i n t o the c y t o p l a s m i c and n u c l e a r  subsequently  radiogram  a n a l y z e d on a 10% SDS-polyacrylamide  i s shown i n F i g u r e 13. The presence  gel.  The a u t o -  o f both hsp70 and hsp30 was  e a s i l y d e t e c t e d i n the n u c l e a r f r a c t i o n o f the induced c e l l s  ( F i g u r e 13,  l a n e s e, f ) . However, s u b s t a n t i a l amounts o f hsp70 and hsp30 were p r e s e n t i n the c y t o p l a s m i c f r a c t i o n .  fractions  still  An i n t e r e s t i n g t r e n d was the r e l a t i v e  -  66  -  abcde fgh  Figure  12.  Recovery with  from  50  yM  sodium a r s e n i t e  arsenite  f o r 3 hours  f r e s h medium f o r d i f f e r e n t recovery  period,  1 hour.  Cell  gel  and  hours,  cells  were  (c) 2 hours, ( h ) 24  the  control.  42,  32,  triangle  and  then  solid  from  indicates  top the  Cells left  lengths of time. labelled  The  with  ( i ) 28  [ a  F o l l o w i n g the 3 5  S]methionine  10%  ( e ) 10 h o u r s ,  hours,  to bottom  respectively.  protein.  for  SDS-acrylamide (b)  0  ( f ) 15 h o u r s ,  ( j ) 32 h o u r s ;  designate  Kd  induced  to recover i n  triangles  100  were  r e c o v e r y p e r i o d s were:  (d) 6 hours,  hours,  The 30  and  e x t r a c t s w e r e s e p a r a t e d on  autoradiographed.  20 h o u r s ,  induction.  the hsps The  lane 87, open  (g)  (a) i s 70,  62,  -  67  -  F i g u r e 13. S u b c e l l u l a r l o c a l i z a t i o n o f the hsps.  F o l l o w i n g i n d u c t i o n and  l a b e l l i n g , c e l l s were s e p a r a t e d i n t o the c y t o p l a s m i c and n u c l e a r f r a c t i o n s as d e s c r i b e d i n the the E x p e r i m e n t a l P r o c e d u r e s . C o n d i t i o n s used were as f o l l o w s :  28°C heat-shock  f o l l o w e d by a 2 hours r e c o v e r y p e r i o d a t 22°C. [ S]methionine 3s  was a t 22°C f o r 1 hour.  f r a c t i o n s were s u b j e c t e d to SDS-acrylamide autoradiography. nuclei,  Lanes:  f r a c t i o n , 0 minute minute  g e l e l e c t r o p h o r e s i s and  ( c ) heat-shocked cytoplasm, 0 minute  chase.  chase,  L a b e l l i n g with  C y t o p l a s m i c and n u c l e a r  (a) c o n t r o l cytoplasm,  shocked cytoplasm, 40 minute  f o r 1 hour  (b) c o n t r o l  chase,  (d) h e a t -  (e) heat-shocked n u c l e a r  chase, ( f ) heat-shocked n u c l e a r f r a c t i o n ,  40  - 67a-  d  e  f  « hsp 70  « hsp30  - 68 -  increase  i n hsp70 and hsp30 i n the n u c l e a r  p u l s e - c h a s e was done. fraction.  f r a c t i o n when a 40 minute  Hsp87 was found e x c l u s i v e l y i n the c y t o p l a s m i c  Though d e f i n i t e c o n c l u s i o n s  about the l o c a l i z a t i o n o f the t r o u t  hsps cannot be made, the r e s u l t s suggest an i n c r e a s e hsp30 i n n u c l e i w i t h time. w i t h the c y t o p l a s m i c i.e.  The l a r g e amount o f hsp70 and hsp30 a s s o c i a t e d  f r a c t i o n may be r e f l e c t i n g the c o n d i t i o n o f the c e l l ,  i n the r e c o v e r i n g  have a l r e a d y  i n l e v e l s o f hsp70 and  c e l l hsps may not be r e q u i r e d  i n the n u c l e i , and may  r e l o c a t e d i n the cytoplasm by the time the l a b e l l i n g was  completed a t 22°C.  3.2  T r a n s l a t i o n a l Regulation  3.2.1  In v i t r o  o f the Heat Shock Response  t r a n s l a t i o n o f mRNA  T o t a l RNA i s o l a t e d from c o n t r o l c e l l s o r from induced c e l l s  (50 jiM  sodium a r s e n i t e f o r 24 hours) was t r a n s l a t e d u s i n g a r e t i c u l o c y t e c e l l protein synthesis 10%  system.  The t r a n s l a t e d p r o d u c t s were f r a c t i o n a t e d on a  SDS-polyacrylamide g e l .  From the r e s u l t s ( F i g u r e 14), i t was c l e a r  t h a t the induced mRNA c o n t a i n e d  the messages f o r the hsp87, hsp70, hsp62,  hsp32, and hsp30, whereas the c o n t r o l mRNA d i d n o t .  This  i n d i c a t e d that  the i n d u c t i o n o f the hsps was c o n t r o l l e d a t the t r a n s c r i p t i o n a l r a t h e r the  translational level.  ( a f t e r 24 h r ,  the i n v i t r o l a b e l l e d p r o t e i n s  induced c e l l s ,  i n F i g u r e 4A (lane c ) w i t h  ( F i g u r e 14, lane c ) showed t h a t the normal  c e l l u l a r p r o t e i n s , which were not s y n t h e s i z e d in vitro.  than  Comparison o f the i n v i v o l a b e l l e d p r o t e i n s  50 pM sodium a r s e n i t e i n d u c t i o n )  are s y n t h e s i z e d  free  i n vivo, d u r i n g hsp i n d u c t i o n ,  Thus, a l t h o u g h normal mRNAs a r e present  their translation i sinhibited.  i n the  -  69 -  hsp  Figure  14. I n v i t r o in  t r a n s l a t i o n products  therabbit  label.  Lane  reticulocyte (a) water  mRNA ( 2 4 h o u r s , Note:  system,  control,  mRNA.  with  RNA was t r a n s l a t e d  [ SJmethionine 3 5  (b)control  mRNA,  (c)  50 uM a r s e n i t e ) .  Translation  SDS-acrylamide  of trout  products  were  fractionated  g e l and a u t o r a d i o g r a p h e d .  on a 10%  as t h e induced  - 70 -  3.2.2  Sucrose G r a d i e n t F r a c t i o n a t i o n o f RNA  T o t a l RNA from induced t r o u t c e l l s  (24 hours, 50 uM sodium a r s e n i t e )  was f r a c t i o n a t e d a c c o r d i n g t o s i z e on a 10-40% (w/v) sucrose g r a d i e n t .  The  r e s u l t i n g A gQ p r o f i l e o f the g r a d i e n t i s shown i n F i g u r e 15. RNA from 2  selected  f r a c t i o n s were t r a n s l a t e d i n v i t r o and the p r o d u c t s a n a l y z e d on a  12.5% SDS-polyacrylamide g e l .  The autoradiogram i s shown i n F i g u r e 15.  The m a j o r i t y o f the RNA was c o l l e c t e d  from f r a c t i o n s 5 t o 12. S e p a r a t i o n  o f the s m a l l hsp mRNA from the hsp70 mRNA was e v i d e n t and t h i s c o u l d be a u s e f u l s t e p i n the p u r i f i c a t i o n o f heat-shock messages.  I f need be, c e r t a i n  e n r i c h e d f r a c t i o n s c o u l d be used as RNA probes a g a i n s t a t o t a l cDNA l i b r a r y to narrow down the number o f c l o n e s t o be s c r e e n e d .  However, s i n c e a h e t e r -  ologous probe f o r hsp70 was o b t a i n e d , the RNA enrichment approach was n o t pursued.  3.3  I s o l a t i o n o f the T r o u t Hsp70 cDNA Clones  3.3.1  S c r e e n i n g o f the T r o u t cDNA L i b r a r y  A t r o u t cDNA l i b r a r y , made by the methods o f Wickens e_t a l . (161) was screened f o r the presence o f hsp70 sequences.  From a t o t a l o f about 700  independent c l o n e s , two t r o u t hsp70 cDNA sequences, pTHS70.7 and pTHS70.14, were i s o l a t e d .  The i d e n t i f i c a t i o n o f these two c l o n e s was based on t h e i r  homology t o a D r o s o p h i l a hsp70 gene from the c l o n e 132E3 ( p r o v i d e d by Dr. L.A. Moran, r e f 96).  3.3.2  P r e l i m i n a r y Examination o f pTHS70.7 and pTHS70.14  Plasmid DNA f o r the two t r o u t hsp70 c l o n e s was i s o l a t e d and subj e c t e d t o Southern b l o t a n a l y s i s a f t e r d i g e s t i o n w i t h s e v e r a l  different  -  71  -  o  <  Figure  15. S u c r o s e  gradient fractionation  RTG-2 c e l l s a  ( 5 0 pM  15-35% s u c r o s e  in  vitro.  was  T = total  with  precipitated  with  Total  24 h ) was  Fractions  50% s u c r o s e .  The t r a n s l a t i o n  SDS-acrylamide  o f RNA.  sodium a r s e n i t e ,  gradient.  upward d i s p l a c m e n t fractions  BOTTOM  FRACTION  TOP  RNA.  from  RNA  were  on  collected  by  in individual  e t h a n o l and a l i q u o t s  products  induced  fractionated  ( 0 . 5 mL) w e r e  g e l and a u t o r a d i o g r a p h e d .  induced  RNA  separated C = water  translated  o n a 10% control,  - 72 -  r e s t r i c t i o n enzymes.  H y b r i d i z a t i o n was t o a [ P ] l a b e l l e d 1.0 Kb P s t I 3 2  fragment o f the D r o s o p h i l a hsp70 gene.  The r e s u l t s a r e shown i n F i g u r e 16  and homology between the D r o s o p h i l a gene and both pTHS70.7 ( l a n e s a - d) and pTHS70.14 ( l a n e s e - h) i s e v i d e n t .  DNA from pBR322 was used as the  c o n t r o l and v e r y l i t t l e h y b r i d i z a t i o n t o the D r o s o p h i l a gene was (lanes i - k ) .  Upon f u r t h e r examination  observed  o f pTHS70.7, i t was d i s c o v e r e d  t h a t the r i g h t h a l f o f the cDNA was not homologous t o the D r o s o p h i l a gene, and d i d not code f o r an i n d u c i b l e mRNA i n t r o u t c e l l s . was a n a l y z e d  3.4  s e p a r a t e l y and the r e s u l t s p r e s e n t e d  hsp70  T h i s anomaly  i n the appendix.  F u r t h e r A n a l y s i s o f THS70.7 and THS70.14  3.4.1  N u c l e o t i d e Sequences f o r THS70.7 and THS70.14  THS70.7 and THS70.14 were f u r t h e r a n a l y z e d by n u c l e o t i d e P a r t i a l r e s t r i c t i o n maps and the sequencing F i g u r e 17.  sequencing.  s t r a t e g y a r e presented i n  The two cDNAs proved t o be incomplete  c o p i e s o f hsp70 messages,  and were from d i f f e r e n t r e g i o n s , w i t h an o v e r l a p o f about 250 n u c l e o t i d e s . The primary  n u c l e o t i d e sequences o f THS70.7 and THS70.14 are shown i n  F i g u r e 18.  The GC content  and  i n the c o d i n g r e g i o n s o f both THS70.7 (57.7%)  THS70.14 (50.3%) i s r e l a t i v e l y h i g h .  The o v e r a l l GC content  rainbow t r o u t genome has been r e p o r t e d t o be 43% (188). one long open r e a d i n g frame ( F i g u r e 18). i n f o r m a t i o n f o r a 278 amino a c i d  o f the  Both cDNAs have  The THS70.7 sequence c o n t a i n s  long r e g i o n o f hsp70.  T h i s corresponds  amino a c i d s 128 t o 406 o f the D r o s o p h i l a hsp70 ( 9 2 ) . A s e r y l r e s i d u e a t p o s i t i o n 213 o f the D r o s o p h i l a hsp70 i s d e l e t e d from THS70.7.  A similar  d e l e t i o n has been r e p o r t e d i n y e a s t hsp70 ( 6 5 ) . The THS70.14 sequence c o n t a i n s i n f o r m a t i o n f o r the f i r s t  213 amino a c i d s o f hsp70, assuming  to  - 73  Figure  -  16. Southern b l o t a n a l y s i s o f Trout hsp70 cDNA c l o n e s . pTHS70.7, pTHS70.14, and pBR322 was  NC paper.  on a 1.0% agarose g e l and DNA  and  transferred  3 2  from the D r o s o p h i l a hsp70 gene (a 1.0 Kb P s t I  (b),  with  The d i g e s t i o n p r o d u c t s  The b l o t was probed w i t h a [ P ] l a b e l l e d  132E3, r e f . 96).  from  i s o l a t e d and d i g e s t e d  s e v e r a l d i f f e r e n t r e s t r i c t i o n enzymes. were f r a c t i o n a t e d  DNA  D i g e s t s were as f o l l o w s :  to a  fragment  fragment  from  (a) and (e) P s t I ;  ( f ) , and ( j ) E c o R I / P s t I ; ( c ) , ( g ) , and (k) BamHl/Pstl; (d) (h) S a i l ;  preparation  ( i ) EcoRI. Note t h a t pTHS70.14 DNA  from t h i s  was r e s i s t a n t to d i g e s t i o n by r e s t r i c t i o n  enzymes,  however h y b r i d i z a t i o n to the hsp70 gene was not i n h i b i t e d . markers are from a H i n d l l l d i g e s t  of phage lambda  DNA.  Size  -  73a-  - 74  -  Figure 17. P a r t i a l r e s t r i c t i o n map and strategy used to determine the nucleotide sequences of THS70.7 (A) and THS70.14 (B) cDNAs. Arrows represent the d i r e c t i o n of sequencing  from  Klenow-labelled fragments, using either the chemical  cleavage  method (squares) or the dideoxy termination method (circles).. The lengths of the arrows represent the actual number of nucleotides sequenced from each s i t e .  The areas used as  hybridization probes have been indicated by a dashed l i n e , above the maps.  The boxed regions represent the cDNA sequences  whereas the thin lines represent pBR322 sequences.  The hatched  area within the boxes indicates the region of overlap between the two cDNAs.  This overlap region has a 73.3% homology at the  l e v e l of nucleotide sequence.  The r e s t r i c t i o n sites are:  A v a i l ; B, BamHI; Bg, B g l l ; D, Ddel; H, H a e l l l ; P, PstI; S, SauIIIA; T, Tag I.  A,  '////////////  100 bp,  - 75  -  Figure 18. Nucleotide sequences for THS70.7 (A) and THS70.14 (B) their predicted amino acid sequences.  The overlap  CDNAS  with  region  between the two cDNAs has been indicated by a l i n e above the respective amino acid sequences.  The  single l e t t e r amino acid  code i s A, alanine; C, cysteine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; H, h i s t i d i n e ; I, isoleucine; K, Lysine; L, Leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W,  tryptophan; Y,  tyrosine.  THS70.7  A  B  THS70.14  A E A Y L G Q K V S N A V CTGCAGGGGGGGGGGGGGGGTCGCTGAGGCTTACCTGGGCCAGAAGGTGTCCAATGCAGT 10 20 30 40 50 60  CTGCGGGGGGGGGCGCCATTGTTCAACTCCGATCAACATCAGCATCACCTTCGGTCAAAT 10 20 30 40 50 60  I T V P A Y F N D S Q R Q A T K D A G V CATCACAGTCCCTGCCTACTTCAACGATTCACAGAGACAGGCCACTAAGGACGCTGGAGT 70 80 90 100 110 120  M S K G P A V G I D L G T T Y AATTTATTCGGTAACATGTCTAAGGGACCAGCAGTCGGCATCGATCTCGGGACCACCTAC 70 80 90 100 110 120  I A G L N V L R I I N E P T A A S I A Y GATCGCTGGGCTGAATGTGCTGAGGATCATCAATGAGCCCACGGCGGCCAGCATCGCCTA 130 140 150 160 170 180  S C V G V F Q H G K V E I I A N D Q G N TCCTGCGTGGGTGTGTTCCAGCATGGCAAGGTTGAAATCATTGCCAACGACCAAGGCAAC 130 140 . 150 160 170 180  G M D K G M S R E R N V L I F D L G G G TGGCATGGACAAAGGCATGTCCAGGGAACGCAACGTCCTTATTTTTGACCTGGGTGGGGG 190 200 210 220 230 240  R T T P S Y V A F T D S E R L I G D A A AGGACCACTCCAAGCTACGTTGCCTTCACTGACTCTGAGAGGCTCATCGGTGATGCTGCC 190 200 210 220 230 240  T F D V S I L T I E D G I F E V K A T A CACCTTTGACGTGTCCATCCTGACCATCGAGGATGGGATCTTTGAGGTGAAGGCCACAGC 250 260 270 280 290 300  K N Q V A M N P C N T V F D A K R L I G AAGAATCAGGTTGCCATGAACCCCTGCAACACAGTATTCGATGCTAAGAGACTGATTGGC 250 260 270 280 290 300  G D T H L G G E D F D N R L V S H F V E TGGAGACACTCACCTGGGCGGGGAGGACTTTGACAACCGCCTGGTCAGTCACTTTGTGGA 310 320 330 340 350 360  R R F D D G V V Q S D M K H W P F E V I CGCAGGTTTGATGATGGAGTTGTTCAATCGGACATGAAGCATTGGCCCTTTGAAGTTATC 310 320 330 340 350 360  E F K R K H K K D I S Q N K R A L R R L GGAGTTCAAGAGGAAACACAAGAAGGACATCAGCCAGAACAAGCGGGCTCTGAGGAGGCT 370 380 390 400 410 420  N D S T R P K L Q V E Y K G E T K S F Y AATGATTCTACTCGGCCTAAGCTCCAAGTTGAATACAAAGGAGAGACTAAGTCCTTCTAC . 370 380 390 400 410 420  R T A C E R A K R T L S S S S Q A S I E GAGGACAGCCTGCGAGAGGGCCAAGAGAACACTGTCCTGCAGCTCCCAGGCCAGCATTGA 430 440 450 460 470 480  P E E I S S M V L V K M K E I A E A Y L CCAGAAGAAATTTCATCTATGGTTCTGGTCAAGATGAAGGAGATTGCTGAGGCCTACCTT 430 440 450 460 470 480  I D S L F E G I D F Y T S I T R A R F E GATTGACTCTCTTTTTGAGGGCATCGACTTCTACACCTCCATCACCAGGGCTCGTTTTGA 490 500 510 520 530 540  G K T V N N A V V T V P A Y F N D S Q R GGGAAAACTGTCAACAATGCTGTTGTTACCGTACCTGCCTACTTCAATGACTCCCAGCGC 490 500 510 520 530 540  E M C S D L F R G T L E P V E K A L G D GGAAATGTGTTCCGACCTCTTCAGGGGAACCCTGGAGGCTGTGGAGAAAGCCCTCGGGGA 550 560 570 580 590 600  Q A T K D A G T I S G L N V L R I I N E CAGGCAACCAAAGATGCTGGTACCATCTCGGGGCTGAATGTGCTGCGTATCATCAATGAG 550 560 570 580 590 600  A K M D K A Q I H D V V L V G G S T R I TGCCAAGATGGACAAGGCCCAAATTCACGACGTCGTCCTGGTCGGAGGCTCCACCCGGAT 610 620 630 640 650 660  P T A A A I R T G L D K K V G A E R N V CCAACTGCTGCTGCCATTCGTACGGGCCTGGACAAGAAGGTCGGTGCTGAAAGGAATGTC 610 620 630 640 650 660  P K V Q K L L Q D F F N G R E L N K S I CCCCAAGGTCCAGAAGCTCCTGCAGGACTTTTTCAACGGCCGAGAGCTAAACAAGAGCAT 670 680 690 700 710 720  L I F D L G G G T F D V S I L T I E CTTATCTTTGATCTGGGTGGCGGCACCTTTGACGTGTCCATCTTGACCATCGAGGCCCCC 670 680 690' 700 710 720  N P D E A V G Y G L A I Q A A I L S G D CAACCCAGACGAGGCGGTCGGCTACGGGCTCGCCATCCAGGCGGCCATCTTGTCTGGCGA 730 740 750 760 770 780  CCCCCCCCCTGCAG 730  K S E N V Q D L L L L D V A P L S L G I CAAGTCTGAGAACGTCCAGGATCTGGTGCTGCTGGATGTGGCTCCCCTGTCCCTGGGCAT 790 800 810 820 830 840 E T A G G CGAAACCGCCGGAGGGT 850 .  - 76 -  that i t s t a r t s a t the f i r s t m e t h i o n i n e . sequence f o r THS70.14 d i f f e r e d  The p r e d i c t e d amino t e r m i n a l  from t h a t o f the D r o s o p h i l a gene, i n t h a t i t  c o n t a i n e d an e x t r a three amino a c i d s .  3.4.2  Comparison o f Hsp70 from T r o u t , D r o s o p h i l a , and Yeast  The p r e d i c t e d amino a c i d sequence of a complete D r o s o p h i l a hsp70 gene and o f an i n d u c i b l e y e a s t hsp70 gene (YG100) have been p u b l i s h e d  (92, 65).  F i g u r e 19 compares a s e c t i o n o f these sequences to that o f THS70.7. a c i d s t h a t d i f f e r have been i n d i c a t e d . t h r e e hsp70 sequences i s e v i d e n t . hsp70 sequences occur  nature  o f the  Many o f the d i f f e r e n c e s i n the t h r e e  i n the same p o s i t i o n s .  changes account f o r approximately and  The h i g h l y conserved  Amino  Conservative  amino a c i d  55% o f the d i f f e r e n c e s between the t r o u t  D r o s o p h i l a sequences, and 48% o f those between t r o u t and y e a s t . The extent o f homology between THS70.7, THS70.14, D r o s o p h i l a hsp70  (92) and YG100 (65) i s summarized i n F i g u r e 20.  In a l l c a s e s , the  percentage homology was c a l c u l a t e d f o r the t o t a l sequence i n f o r m a t i o n a v a i l a b l e f o r the o v e r l a p r e g i o n s . divergence level.  a t the n u c l e o t i d e l e v e l  As expected,  the degree o f sequence  i s g r e a t e r than t h a t a t the amino a c i d  I n t e r e s t i n g l y enough, the n u c l e o t i d e sequences of THS70.7 and  THS70.14 a r e o n l y 73.3% homologous i n t h e i r o v e r l a p r e g i o n , y e t t h e i r homology a t the amino a c i d l e v e l  i s quite high  (88%).  Thus even w i t h i n  t r o u t , codon p r e f e r e n c e v a r i e s between the two genes i n the r e g i o n s analyzed.  Compared w i t h the D r o s o p h i l a hsp70 gene, YG100 has l e s s homology  to both THS70.7 and THS70.14 a t the n u c l e o t i d e l e v e l .  However, when the  amino a c i d sequences a r e compared, YG100 and the D r o s o p h i l a hsp70 show s i m i l a r degrees o f homology t o the t r o u t hsp70 (see a l s o F i g u r e 19).  - 77  -  F i g u r e 19. Comparison o f the p r e d i c t e d amino a c i d sequences o f THS70.7, a D r o s o p h i l a hsp70 gene (taken from I n g o l i a e_t a l . , r e f . 92), and yeast hsp70 gene YG100 (taken from I n g o l i a e t a l . , r e f . 6 5 ) . Regions compared are amino a c i d s number 128 to 406, based on the D r o s o p h i l a hsp70 numbering.  Mismatches i n the sequences have  been boxed i n . The s i n g l e dashes r e p r e s e n t d e l e t e d amino a c i d s r e l a t i v e to the compared sequence. sequence r e p r e s e n t s  The s o l i d  line  i n f o r m a t i o n not y e t a v a i l a b l e .  i n the y e a s t  - 77a-  [t, p  E-« O O O J P p  Cn  E-> E-" O C5 O O O O J J  (—1  P Q P (n  H-1  > > > 2 u  2  s  P  1.  si  in  P  2  O  CO  p  EH  Pi  CO  l-l  EH  CA in  CO  o u  o  X  p  p  p  PI  p  > p  p  t—1  p p  1-H  o  K p  p p  < < <:  Pu o> 2 2 2 Ul C O EH CO  CA  ^:  O  to  > Cn <  < < < n  EH  O  < P < p p < EH  < O < a < o> CA CA a CO  P  Cn  CO  p p p 2 2 2 >H  >H  < < Cn < OH CU  > > > EH EI H  H  >  > > >  < 2  CO  >  <,  P  E-< I—<  LO  O p to  \<  P  2  >  •r  l i s  rto P  > p  Cn  Cn  O  Cn  to to P P P X rr. EH  EH  EH  P P p o to o  < EH < EH < EH << < in a CO  > > p p Cn  1  Cn  P  CO  w Cn  HH  1  t? < 7o p P p p P p t—1  FH  p CO  ^  2i  O  p  O •— Q >-  1-H  P P P P P U  CO  gOo  Cn  P p oi Pi 2 2 2 P P P  p  < <  «  p P w P CO O i  CO  p P  N.. O O ^ i/> -r i/> JX k  Cn  1—1  3  CO  p P p P P iA *i »-H  t—i  P  EH  CA CA CA  2 2  CO  cu Cu  CO  EH  2  EH  > >  EH  > > >  to  P  .H P a a  a CK p p « a «  p :*i  Cn  HH  p  In d  EH  <  K a « P  i—i  >  P 2 P  < < a CO p. P w u < vl  i-i  l>  i CO CO  In  Cn  a. a, CU p p 2 2 2 t-n  CO CO  p ,k  EH  »—i  I—1  CO  Cn  < < < t-l co < < < < EH < < Ei—i  EH  CO CO  < <  P  •2 P n  12 J  o> p a  1—1  fn P P CO  > > > p P p ^ ° ^  o ^  «n i X ^  I—  D  o o t—  O  >-  DJ EH CO  to  o  > > > X  OI  o<  > >  ^ 7 t/ii  15. S  p PI a:  p  < <  p  K  2 p •<  p  P  p  p  Oi  Rl p  o  in  n  t2  > > > Cu Pu cu p  FH  P f-<  fH  IO P P P  P P 2  p P  o <«; < ; u ,y PI ip s p p p CO  p p  p  p  Cn  Cn  EH  CO  EH  « Cn Cn < < < CA HH  CO  EH >H  p p  >  EH  P  P  Cn  P  p  r-H  U  1-H  t—i  CO  EH  P  < < d  t-l  u  p CO  P  Q  > CO  EH  U  o e» p  CO  P  CO  p p p C U O i Cu  < < <  > >  S G I ? p p p p  J  >l  > 2  HH  3  Q p O O1 P  ^i  V  1 T 1 I  CO  p  oil p  O o CO  CO  1—1  1—1  p  p  < < < <  Oi O H  >l  d < < P O 5  > > < < t-H  t-H  CO  CO  *  PI  Z 2  P 2 Pi ?< , ^ to is  • -3 P  o  CO  X  i—  D  X  EH  1-H  p P p P Cu C U 2 z  to  p  EH  1-H  P  P  < P  CO  EH  J?  P 2  o  < < <  EH  >^ Cn Cn  to O p P Cn  »—l  CO  go o  o o  L.' O  >-  o  l/l X  ^ -r  t— Q  o O —"  O >-  - 78 -  THS70.7 THS70.14 Dr.HS70  THS70.7  \A B\  THS70.14  88.1  Dr.HS70  79.1  79.5  YGIOO  79.0  77.1  gure 20. A m a t r i x  73.3  72.0  66.2  71.3  67.5  64.1  72.0  summarizing the n u c l e o t i d e homology  a c i d homology and YG100.  YG100  (A) and the amino  (B) between THS70.7, THS70.14, D r o s o p h i l a  hsp70,  The homologies are g i v e n as percentages from the  t o t a l a v a i l a b l e sequence i n f o r m a t i o n i n the o v e r l a p  regions.  - 79 -  3.5  Synthesis  3.5.1  and Turnover o f Trout  RNA Northern and Dot B l o t  Hsp70 mRNA  Analysis  To ensure t h a t pTHS70.7 and pTHS70.14 were coding  f o r induced hsp70  s p e c i e s , RNA from c o n t r o l and sodium a r s e n i t e t r e a t e d RTG-2 c e l l s was subjected  t o Northern and RNA dot b l o t a n a l y s i s  ( F i g u r e 21).  The i n d u c t i o n  o f hsp70 mRNA (approximate s i z e 2.2 Kb) i n the a r s e n i t e - i n d u c e d evident.  Control c e l l s contained  very  A h e t e r o l o g o u s probe from D r o s o p h i l a  little  (Figure  ( i f any)  T h i s i s more obvious when the  compared.  21A)  and THS70.14 ( F i g u r e  two s e t s o f RNA dot b l o t s a r e  Here, equal amounts o f c o n t r o l and induced RNA were b l o t t e d on  both f i l t e r s .  The THS70.7 probe gave a much s t r o n g e r  even a t s h o r t e r exposure times. revealed  message f o r hsp70.  21C) r e s u l t e d i n a much weaker  h y b r i d i z a t i o n compared t o t h a t o f THS70.7 ( F i g u r e 21B).  cells i s  hybridization signal,  M u l t i p l e bands i n the induced mRNA were  by h y b r i d i z a t i o n t o l a b e l l e d THS70.7 ( F i g u r e 21A).  This  indicates  the e x i s t e n c e  o f e i t h e r an hsp70 m u l t i g e n e f a m i l y i n t r o u t o r o f s p l i c i n g  intermediates  from a s i n g l e t r a n s c r i p t .  p r e s e n t e d below, the former p o s s i b i l i t y  3.5.2 The  Induction  As w i l l be seen from evidence i s more  likely.  o f Hsp70 mRNA  major i n d u c i b l e heat shock p r o t e i n i n t r o u t RTG-2 c e l l s  70,000 d a l t o n s p e c i e s .  is a  The k i n e t i c s o f i n d u c t i o n o f t h i s hsp have been  shown t o depend t o the i n t e n s i t y o f s t r e s s .  Here, a study was undertaken  to determine whether s i m i l a r k i n e t i c s are observed a t the l e v e l o f transcription.  The c y t o p l a s m i c  q u i c k - b l o t s were h y b r i d i z e d  P s t I fragment from a t r o u t hsp70 cDNA, THS70.7.  This  amino a c i d s 128 t o 348 o f hsp70, based on the r e p o r t e d  t o a 0.7 Kb  fragment codes f o r Drosophila  hsp70  - 80  Figure  -  21. Northern b l o t a n a l y s i s o f t r o u t RTG-2 RNA from c o n t r o l sodium a r s e n i t e  induced ( i ) c e l l s .  0.2 pg (C) o f p o l y A electrophoresis transferred  +  ( c ) and  E i t h e r 2 pg (A and B) o r  RNA was g l y o x a l a t e d ,  s e p a r a t e d by  on a 1.4% (A and B) o r 1.2% (C) agarose g e l , and  to n i t r o c e l l u l o s e f i l t e r s .  The i n s e t s t o A and C  are dot b l o t s o f t o t a l RNA, 5 pg on each s p o t .  Hybridization  was t o [ P ] l a b e l l e d THS70.7 ( A ) , THS70.14 ( B ) , o r a 1.0 Kb 3 2  P s t I fragment formamide.  from a D r o s o p h i l a hsp70 gene (C) a t 42°C i n 50%  The s i z e was e s t i m a t e d by comparison t o g l y o x a l a t e d  H i n d l l l digested  DNA o f phage lambda.  exposure times r e q u i r e d  f o r the d i f f e r e n t h y b r i d i z a t i o n probes:  (A) and ( B ) , 1 hour, (C) 7 days. dot-blots  have been  Note the d i f f e r e n c e s i n  indicated.  The exposure times f o r the  -  2 hour  exp.  80 a  15 hour exp.  - 81 -  sequence  (92).  RTG-2 c e l l s , grown a t 22°C, a r e induced t o s y n t h e s i z e 27°-28°C.  When these c e l l s were p l a c e d  increased gradual  dramatically  autoregulation  occurs.  i s more l i k e l y .  Since  a r s e n i t e , the l e v e l  synthesis,  there  i s no decrease i n 9 ) , the  When 50 uM sodium a r s e n i t e was used  the r a t e o f i n c r e a s e  to t h a t seen w i t h temperature i n d u c t i o n .  slightly.  T h i s suggests that e i t h e r  no decrease i n hsp70 mRNA a t long exposure times was  observed ( F i g u r e 23);  rose  A f t e r 2 hours, a  i n these c e l l s a f t e r 16 hours a t 28°C (see F i g u r e  explanation  the i n d u c e r ,  o f hsp70 mRNA  o f f under these c o n d i t i o n s , o r t h a t some  o f mRNA s y n t h e s i s  protein synthesis  as  2 hours ( F i g u r e 22).  decrease i n hsp70 mRNA l e v e l s was seen.  the c e l l s b e g i n d y i n g  latter  f o r the f i r s t  a t 28°C, the l e v e l  hsps a t  i n hsp70 mRNA l e v e l s was s i m i l a r  A f t e r 24 hours o f exposure t o  o f hsp70 mRNA i n the c e l l s was m a i n t a i n e d , and even  T h i s agrees w i t h our p r e v i o u s  observations  i . e . maximal r a t e s o f hsp s y n t h e s i s  on r a t e s o f hsp  occur f o l l o w i n g  long  exposures (e.g. 24 hours) t o 50 pM sodium a r s e n i t e , where t r a n s l a t i o n o f p r e - e x i s t i n g mRNAs i s a l s o maximally i n h i b i t e d . The  i n d u c t i o n o f hsp70 by sodium a r s e n i t e i s r a p i d , o c c u r r i n g  minutes.  The l e v e l  antibody t o chicken t r o u t hsp70 (E.A. detectable due  o f hsp70 e x p r e s s i o n hsp70.  was f o l l o w e d  immunologically  This antibody c r o s s - r e a c t s  Burgess, p e r s o n a l  communication).  c o n s t i t u t i v e l y a t a low l e v e l .  using  s t r o n g l y w i t h the  Trout hsp70 was  a t low l e v e l s i n uninduced c e l l s by t h i s t e c h n i q u e .  t o the presence o f h s p 7 0 - l i k e  within  This may be  genes i n t r o u t that a r e expressed  Increased  l e v e l s o f hsp70 were d e t e c t e d as  e a r l y as 5 minutes a f t e r sodium a r s e n i t e i n d u c t i o n w i t h the l a r g e s t a c c u m u l a t i o n o c c u r r i n g a f t e r 1 hour o f i n d u c t i o n . As mentioned above, the i n t e n s i t y o f the response t o heat-shock  - 82 -  1  2  3  4  5  20  DURATION OF HEAT-SHOCK, hours Figure 22. Induction of hsp70 mRNA by heat-shock.  RTG-2 c e l l s were treated  with a 28°C heat-shock for various time periods. time was allowed.  No recovery  Cells were harvested and cytoplasmic  quick-blots of RNA were performed as described under Experimental Procedures.  The quick-blots were hybridized to a  [ P ] l a b e l l e d trout hsp70 cDNA, washed, and subsequently 32  fluorographed.  The inset shows the hybridization signals  obtained at the various time points.  To quantify the signals,  spots on the n i t r o c e l l u l o s e f i l t e r corresponding to bound RNA were cut out and the amount of r a d i o a c t i v i t y hybridized to each was determined.  The same procedure was used to obtain the  results i n Figures 23-26.  HS = heat-shock.  - 83 -  400  0  1  2  3  4  5  24  SODIUM ARSENITE INDUCTION,hours  F i g u r e 23. I n d u c t i o n o f hsp70 mRNA w i t h sodium a r s e n i t e .  RTG-2 c e l l s were  exposed t o 50 uM sodium a r s e n i t e f o r v a r i o u s t i m e s . r e c o v e r y was a l l o w e d .  The c e l l s were processed  manner as d e s c r i b e d i n t h e legend arsenite.  t o F i g u r e 22.  No  i n the same SA = sodium  - 84 -  r e f l e c t s the l e v e l o f s t r e s s a p p l i e d .  F o r i n s t a n c e , when t r o u t c e l l s were  induced by i n c r e a s i n g c o n c e n t r a t i o n s o f sodium a r s e n i t e , the l e v e l s o f hsp70 mRNA rose u n t i l a l e t h a l exposure l i m i t was reached decrease  ( F i g u r e 24). The  i n hsp70 mRNA, a f t e r a peak a t 50 pM sodium a r s e n i t e ,  corresponds  t o the g e n e r a l decrease  i n protein synthesis at higher arsenite  concentrations.  3.5.3  R e p r e s s i o n o f Hsp70 mRNA S y n t h e s i s  A f t e r an i n i t i a l  s t r e s s , c e l l s were allowed t o r e c o v e r under normal  growth c o n d i t i o n s and the l e v e l o f hsp70 mRNA was examined. a 1 hour heat  Recovery  from  shock (28°C) was v e r y r a p i d , w i t h hsp70 mRNA r e a c h i n g c o n t r o l  l e v e l s by 3 t o 4 hours ( F i g u r e 25). The e f f i c i e n t r e p r e s s i o n o f hsp70 mRNA s y n t h e s i s and i t s r a p i d d e g r a d a t i o n d u r i n g r e c o v e r y from heat  shock  i n d i c a t e t h a t both t r a n s c r i p t i o n and s t a b i l i t y o f these messages a r e subject to precise c o n t r o l .  This i s e s p e c i a l l y s t r i k i n g  s i n c e a f t e r 1 hour  a t 28°C the c e l l s were s t i l l  a c t i v e l y s y n t h e s i z i n g hsp70 mRNA (see F i g u r e  22). The  r e c o v e r y o f RTG-2 c e l l s  from a 2 hour, 50 pM sodium a r s e n i t e  exposure ( F i g u r e 26) was s l i g h t l y d i f f e r e n t shock.  than the r e c o v e r y from  heat  The l e v e l o f hsp70 mRNA c o n t i n u e d t o r i s e even a f t e r the a r s e n i t e  had been removed.  T h i s may be e x p l a i n e d by the p e r s i s t e n c e o f  i n t r a c e l l u l a r a r s e n i t e d u r i n g t h i s p e r i o d , o r i t may r e f l e c t i n a c t i v a t i o n o f the hsp70 gene.  a slower  In e i t h e r case, the decrease  l e v e l s f o l l o w i n g r e c o v e r y from a r s e n i t e treatment as r a p i d as i n the case o f r e c o v e r y from heat  i s apparent,  shock.  i n hsp70 mRNA although not  - 85 -  0  100  200  30(5  400  500  600  SODIUM ARSENITE (pM)  Figure 24. Induction of hsp70 mRNA under d i f f e r e n t sodium arsenite concentrations.  RTG-2 c e l l s were exposed to different  concentrations of arsenite for 3 hours followed by 2 hours of recovery.  The c e l l s were processed  i n the same manner as  described i n the legend to Figure 22.  SA = sodium arsenite.  - 86 -  0* 0  1  1  1  1  2  3  RECOVERY  FROM  i  4  1  i  5  6  HEAT-SHOCK,  hours  Figure 25. Hsp70 mRNA levels during recovery from heat-shock.  RTG-2 c e l l s  were heat-shocked at 28°C for 1 hour and then allowed to recover at 22°C for d i f f e r e n t lengths of time.  The c e l l s were processed  i n the same manner as described i n the legend to Figure 22. control c e l l s , no heat-shock.  C =  - 87 -  0  1  2  RECOVERY  3 FROM  4  5  A R S E N I T E , hours  Figure 26. Hsp70 mRNA levels during recovery from sodium arsenite shock. RTG-2 c e l l s were treated with 50 uM arsenite for 2 hours and then allowed to recover i n fresh medium for different lengths of time.  The c e l l s were processed i n the same manner as described  in the legend to Figure 22. shock.  C = control c e l l s , no arsenite  - 88  3.6  DNA  3.6.1  Southern B l o t  Detection  Genomic DNA by and  Analysis  of M u l t i p l e Hsp70 Genes i n the Trout  was  i s o l a t e d from t r o u t t e s t i s and  the Southern b l o t t e c h n i q u e . the DNA  was  nitrocellulose conditions  -  Several  Genome  subjected  to a n a l y s i s  r e s t r i c t i o n d i g e s t s were performed  f r a c t i o n a t e d on agarose g e l s .  A f t e r t r a n s f e r of the DNA  f i l t e r s , h y b r i d i z a t i o n s were c a r r i e d out under s t r i n g e n t  to hsp70 probes.  The  r e s u l t s i n Figure  27A  were o b t a i n e d  a n i c k - t r a n s l a t e d THS70.7 fragment which spans amino a c i d s 128 the hsp70, and two  bands was  27,  lane  contains detected  1), s u g g e s t i n g  a P s t I s i t e at the when P s t I was  3' end.  DNA  used to c l e a v e  fragment o f a p p r o x i m a t e l y 8 Kb.  ( F i g u r e 27,  The  existence  lane  However, the e x i s t e n c e  of two  smaller  (Figure  27,  lane 3) r e v e a l e d  i n t e n s i t i e s , p o s s i b l y due t r o u t DNA  was  2) r e v e a l e d hsp  THS70.7 fragment a Drosophila t o 312  ( F i g u r e 27,  The  w i t h both  l a r g e BamHI fragment  P s t I fragments ( F i g u r e 27,  lane  H y b r i d i z a t i o n to EcoRI c l e a v e d  to double d i g e s t s and lanes 4-6)  or to the  lanes  7 and  6). an  trout  hybridized 1.0  Kb  Genomic to  P s t I fragment from  Both probes produced  THS70.7 r e s u l t e d i n much b e t t e r s i g n a l s , as hsp70 sequences i n the  the  8) spanning amino a c i d s 1  i n a d d i t i o n to some 5' non-coding sequence.  d e t e c t i o n of two  this  a number of bands of d i f f e r e n t  hsp70 gene ( F i g u r e 27,  s i m i l a r r e s u l t s but  a larger  70 genes on  to incomplete d i g e s t i o n o f the DNA.  also subjected  (Figure  d i f f e r e n t BamHI fragments, each c o n t a i n i n g  hsp70 gene, i s a l s o a p o s s i b i l i t y . DNA  of  hsp70 genes.  of two  P s t I r e s u l t e d i n the disappearance of the  the appearance of the two  to 348  the genomic DNA  BamHI fragment i s p o s s i b l e , s i n c e the d i g e s t i o n of t r o u t DNA  and  using  Strong h y b r i d i z a t i o n to  the presence of at l e a s t two  H y b r i d i z a t i o n to BamHI c l e a v e d  BamHI and  to  expected.  t r o u t genome does not  rule  out  - 89 -  A  B  1  2  3  4  5  7  6  •1  8  | « 23.7—  23.7— *&—  IS— |.4  • 4—  4.2—  4.2—  m 2.3—  —  at  13—  1.»—  Figure  27. Southern b l o t a n a l y s i s o f genomic DNA i s o l a t e d testis. with PstI  Approximately 6 yg o f the genomic DNA was d i g e s t e d ( l a n e l ) , BamHI (lane 2 ) , EcoRI (lane 3 ) , P s t I and  EcoRI ( l a n e s 4 and 7 ) , BamHI and EcoRI (lanes and  from t r o u t  5 and 8 ) , o r P s t I  BamHI ( l a n e 6 ) , and separated by e l e c t r o p h o r e s i s on a 1.2%  (A) or 0.9% (B) agarose g e l . nitrocellulose f i l t e r s .  The DNA was then t r a n s f e r r e d to  H y b r i d i z a t i o n was t o [ P ] l a b e l l e d 3 2  THS70.7 ( A ) , o r a 1.0 Kb P s t I fragment from a D r o s o p h i l a hsp70 gene ( B ) , a t 42°C i n 50% formamide. H i n d l l l d i g e s t o f phage lambda DNA.  The s i z e markers a r e from a  - 90 -  the presence o f a d d i t i o n a l hsp70 genes.  Sequence d i v e r g e n c e , and the  incomplete n a t u r e o f the cDNA probes used, might a l l o w other sequences i n the genome t o go u n d e t e c t e d .  hsp70  I t i s worth n o t i n g ,  however,  t h a t washing f i l t e r s a t lower s t r i n g e n c y y i e l d e d s i m i l a r r e s u l t s  (Figure  28).  3.6.2 To  I n d e n t i f i c a t i o n o f H s p 7 0 - l i k e Sequences i n o t h e r  i n v e s t i g a t e i n t e r s p e c i e s hsp70 sequence homology, genomic DNA from  a v a r i e t y o f sources ( t r o u t t e s t i s ,  RTG-2 c e l l s , HeLa c e l l s ,  bovine l i v e r and IK_ m e l a n o g a s t e r ) was c l e a v e d Southern b l o t a n a l y s i s . lane  w i t h P s t I and s u b j e c t e d t o  above ( F i g u r e  be noted that the f i l t e r s c o n t a i n i n g  f i l m f o r a much s h o r t e r THS70.14 fragment  region) hybridized  time than the f i l t e r s c o n t a i n i n g  (spanning amino a c i d s  29, lanes 2-7).  t r o u t DNA were exposed t o the other  DNAs.  1 t o 210 and some 5' non-coding  t o the same two P s t I fragments i n t r o u t DNA as those  detected  by the THS70.7 probe.  evident,  r e v e a l i n g hsp70 sequences t h a t were not d e t e c t e d  probe.  C. e l e g a n s ,  H y b r i d i z a t i o n was t o e i t h e r THS70.14 ( F i g u r e 29,  1) o r t o the THS70.7 fragment d e s c r i b e d  I t should  The  Genomes  In a d d i t i o n , two l a r g e r P s t I fragments were by the THS70.7  C r o s s - h y b r i d i z a t i o n o f the t r o u t hsp70 sequences w i t h sequences i n  the genomes o f o t h e r  organisms was a l s o e v i d e n t  M u l t i p l e bands a r e e v i d e n t melanogaster DNA.  (Figure  29, lanes 4-7).  i n HeLa c e l l DNA, bovine l i v e r DNA, and D.  H y b r i d i z a t i o n t o the (K_ elegans DNA was very weak and  may be due t o the r e l a t i v e l y h i g h AT content  (64%) o f i t s genome (189).  - 91 -  Figure  28. E f f e c t o f washing s t r i n g e n c y Southern b l o t s .  on s i g n a l d e t e c t i o n from genomic  Approximately 6 ug o f t r o u t DNA was  w i t h e i t h e r P s t I (P) or BamHI ( B ) . The c l e a v e d f r a c t i o n a t e d by e l e c t r o p h o r e s i s t r a n s f e r r e d t o NC paper.  digested  DNA was  through a 1.0% agarose g e l , and  H y b r i d i z a t i o n was t o a [ P ] l a b e l l e d 3 2  0.7 Kb P s t I fragment from pTHS70.7 c o n d i t i o n s were as f o l l o w s :  (see F i g u r e  17).  The washing  ( l ) 2XSSPE/0.1% SDS, twice f o r 15  minute a t room temperature; (2) same as i n ( l ) p l u s a 15 minute room temperature wash i n 0.1XSSPE/0.1% SDS; (3) same as i n (2) p l u s a 15 minute  50°C wash i n 0.1XSSPE/0.1% SDS.  - 92 -  1  Figure  2  3  4  5  6  29. S o u t h e r n b l o t a n a l y s i s o f P s t I d i g e s t e d s o u r c e s : 6 ug t r o u t t e s t i s  DNA  DNA  (1 ane  3 ) , 6 ug HeLa c e l l  DNA  ( l a n e 5 ) , 8 ug b o v i n e DNA  m e l a n o g a s t e r DNA electrophoresis  (lane  7).  (lanes  DNA  t h r o u g h a 1.0%  DNA  filters.  THS70.14 ( l a n e  1) o r THS70.7 ( l a n e s  was  compared w i t h  8 days  bands.  were exposed  3 was  3 yg  to [  elegans  D.  cleaved,  f r a c t i o n a t e d by transferred 3 2  to  P]labelled  have been i n d i c a t e d  Note  that  f o r 2 days  f o r the other f i l t e r s .  f r o m a H i n d l l l d i g e s t o f phage lambda Note: - lane  various  2 t o 7 ) , a t 42°C i n 50%  The h s p 7 0 r e l a t e d s e q u e n c e s  t r o u t DNA  from  2 ) , 4 ug RTG-2  6 ) , and  H y b r i d i z a t i o n was  t r i a n g l e s next to appropriate containing  1 and  a g a r o s e g e l , and  nitrocellulose  formamide.  g e n o m i c DNA  ( L a n e 4 ) , 3 ug C.  (lane  The  7  the  filters  to X-ray  film,  S i z e markers  DNA.  from a d i f f e r e n t e l e c t r o p h o r e s i s  by  run.  were  - 93  3.7  Trout Genomic DNA  3.7.1  -  Libraries  S c r e e n i n g o f the CH4A Lambda L i b r a r y  To ensure 99% p r o b a b i l i t y t h a t the e n t i r e t r o u t genome 2.8  x 10  bp)  9  i s r e p r e s e n t e d , one would need to package and  approximately 0.25  x 10  6  10  s  p f u i_n v i t r o .  0.5  x 10  D r o s o p h i l a hsp70 gene.  out.  These were subsequently  probed w i t h  the  Four c l o n e s t h a t h y b r i d i z e d to the probe were  from t h r e e of these  d i g e s t e d w i t h EcoRI, and  (X2b,  XC2,  and  s u b j e c t e d to Southern  All  three clones contained  and  XC2  XC3)  were i s o l a t e d ,  b l o t a n a l y s i s ( F i g u r e 30).  i n s e r t s w i t h EcoRI r e s t r i c t i o n s i t e s ; w i t h  h a v i n g a common 4.6  D r o s o p h i l a hsp70 gene, and hybridized  carried  only  p f u from the a m p l i f i e d l i b r a r y were grown at a  s  d e n s i t y of 20,000 p f u / p l a t e .  DNA  obtain  t r o u t CH4A l i b r a r y c o n t a i n e d  i n d i v i d u a l c l o n e s ; d e s p i t e t h i s , a s c r e e n was  Approximately  purified.  The  (approximately  Kb EcoRI fragment t h a t h y b r i d i z e d to the XC3  c o n t a i n i n g a 5.5  Kb  fragment t h a t a l s o  to the hsp70 gene ( F i g u r e 30).  Although  the i n i t i a l  results  looked p r o m i s i n g ,  further analysis of  these c l o n e s showed no h y b r i d i z a t i o n to t r o u t mRNA from c o n t r o l or cells.  An  i n t e r e s t i n g p o i n t was  fragments from X2b  and  XC2.  fragments showed them to be  the s i m i l a r i t y of the 4.6  Kb  EcoRI  P a r t i a l n u c l e o t i d e sequencing  of  these  induced  i d e n t i c a l although no s i m i l a r i t y to the  D r o s o p h i l a hsp70 sequence was  evident  (data not  shown).  A second attempt at s c r e e n i n g the CH4A. l i b r a r y , u s i n g THS70.7 as probe, r e s u l t e d  3.7.2 The  X2b  i n no p o s i t i v e h y b r i d i z a t i o n s .  S c r e e n i n g of the L47.1 two  L47.1  Lambda L i b r a r i e s  l i b r a r i e s c o n t a i n e d 0.5  x 10  s  p f u and  3 x 10  6  pfu,  the  - 94 -  Figure  30. S o u t h e r n b l o t a n a l y s i s  of trout  X2b, AC2, and XC3 was d i g e s t e d a 0.7%  genomic c l o n e s . with  Drosophila  to a [  h s p 7 0 gene  have been i n d i c a t e d  3 2  P]labelled (clone  from  EcoRI, f r a c t i o n a t e d  a g a r o s e g e l and S o u t h e r n b l o t t e d  was h y b r i d i z e d  DNA  t o NC p a p e r .  2.0 Kb S a l I f r a g m e n t  56H8, r e f . 9 6 ) .  clones on  The  DNA  from a  Hybridizing  bands  and s i z e a s s i g n e d b y c o m p a r i s o n t o f r a g m e n t s  from a H i n d l l l d i g e s t  o f phage l a m b d a  DNA.  - 95 -  respectively.  However, the a m p l i f i e d v e r s i o n s o f these l i b r a r i e s may n o t  have been e n t i r e l y r e p r e s e n t a t i v e s i n c e the plaque  s i z e obtained  from  growth on Q359 was v e r y s m a l l (note t h a t Q359, a P2 l y s o g e n , was used s i n c e recombinants  i n AL47.1 a r e rendered  their ability the l i b r a r i e s ,  S p i " and thus may be s e l e c t e d by  t o grow i n P2 lysogens o f E. c o l i ) . the 15-20 Kb f r a c t i o n a t e d DNA  P r i o r to screening of  o f the Mbol p a r t i a l d i g e s t s  was r e s t r i c t e d w i t h BamHI and s u b j e c t e d t o Southern b l o t Hsp70-like  analysis.  sequences were d e t e c t e d i n both the t o t a l Mbol p a r t i a l s and the  15-20 Kb Mbol p a r t i a l s  (Figure 31).  However, a f t e r two s e p a r a t e  a t s c r e e n i n g the L47.1 l i b r a r i e s , no p o s i t i v e s were d e t e c t e d .  attempts  - 96 -  A  F i g u r e 31. Southern b l o t a n a l y s i s genomic DNA.  B  of Mbol p a r t i a l  Both 15-20  t o t a l Mbol p a r t i a l s  Kb f r a c t i o n a t e d Mbol p a r t i a l s  (B) o f t r o u t DNA  and f r a c t i o n a t e d on a 1.0% paper, the DNA was  fragments from  were d i g e s t e d  agarose g e l .  probed w i t h a [ P ] l a b e l l e d 0.7  from a H i n d l l l d i g e s t  3 2  o f phage lambda  (A) and  w i t h BamHI  A f t e r t r a n s f e r to NC  fragment from pTHS70.7 f o r h s p 7 0 - l i k e sequences. are  trout  DNA.  Kb Size  PstI markers  - 97 -  IV.  DISCUSSION  The r e s u l t s p r e s e n t e d i n t h i s t h e s i s , on the heat shock response i n t r o u t c e l l s , p r o v i d e a base f o r the study o f t h i s phenomenon i n a v e r t e b r a t e system. emphasize  The v a r i o u s experiments have h e l p e d to f u r t h e r  the complex n a t u r e o f the r e g u l a t i o n o f the heat shock response  w i t h c o n t r o l s a t s e v e r a l stages o f gene e x p r e s s i o n .  In a d d i t i o n ,  comparison o f hsp70 from t r o u t to those o f o t h e r organisms  the  supports the  c o n c l u s i o n t h a t hsp70 genes form a h i g h l y c o n s e r v a t i v e gene f a m i l y . The r e l e v a n c e o f the d a t a p r e s e n t e d i s d i s c u s s e d i n terms o f the importance of the response to the organism.  The maintenance  o f the heat  shock response i n both v e r t e b r a t e s and i n v e r t e b r a t e s suggests a fundamental role for i t .  In a d d i t i o n , the conserved n a t u r e o f t h i s phenomenon i m p l i e s  a s i m i l a r f u n c t i o n i n a l l organisms. has been d i s c u s s e d w i t h emphasis  4.1  Thus the heat shock response o f t r o u t  on the above mentioned a s p e c t s .  The Heat Shock Response i n Trout C e l l s  The response o f c u l t u r e d c e l l s o f rainbow t r o u t , S. g a i r d n e r i i , to e i t h e r temperature e l e v a t i o n or i n c u b a t i o n i n the presence o f a r s e n i t e i s very s i m i l a r to that of Drosophila ( 2 ) .  sodium  A novel set of  p o l y p e p t i d e s (the hsps) i s r a p i d l y induced and depending on the s e v e r i t y o f the s t r e s s a p p l i e d , normal p r o t e i n s y n t h e s i s can a l s o be d e c r e a s e d . instance, exposing c e l l s  to 50 uM sodium a r s e n i t e f o r 24 hours  For  resulted  i n a dramatic r e d u c t i o n o f normal p r o t e i n s y n t h e s i s w i t h o n l y the hsps b e i n g produced  (Figure 4).  I t has become f a i r l y obvious t h a t  heat-shock response i s a r e a c t i o n to s t r e s s i n g e n e r a l and not  the temperature  - 98 -  p e r t u r b a t i o n alone.  In support  of this,  the response o f t r o u t c e l l s t o  heat o r a r s e n i t e was observed t o be s i m i l a r i n most r e s p e c t s . d i f f e r e n c e s were observed however:  some hsps were induced  Some  by a r s e n i t e but  not heat, r e p r e s s i o n o f normal p r o t e i n s y n t h e s i s v a r i e d between the two i n d u c i n g agents, i n d u c t i o n and/or s t a b i l i t y o f hsp70 mRNA d i f f e r e d extended exposures t o a r s e n i t e o r heat, and d e g r a d a t i o n hsp70 mRNA a l s o d i f f e r e d upon r e t u r n o f c e l l s d i f f e r e n c e s w i l l be d i s c u s s e d Molecular proteins.  These  by comparison t o standard  They were determined t o be 87 Kd, 70 Kd, 62 Kd ( a r s e n i t e  t r o u t hsps f a l l  induced  An a d d i t i o n a l p r o t e i n o f 100 Kd ( a r s e n i t e  i n t o three c l a s s e s :  an hsp.  As w i t h most organisms, the  hsp83-like,  hsp70-like,  and s m a l l  polypeptides.  Optimum c o n d i t i o n s be  t o normal c o n d i t i o n s .  weights o f the hsps were assigned  o n l y ) may a l s o be c o n s i d e r e d  hsp-like  and s y n t h e s i s o f  separately.  o n l y ) , 42 Kd, 32 Kd, and 30 Kd. induced  during  f o r the  27°C t o 29°C (compared w i t h  i n d u c t i o n o f t r o u t hsps were determined t o the normal growth temperature o f 22°C) f o r  heat-shock o r 15 t o 100 uM f o r sodium a r s e n i t e exposure.  I t should be  noted t h a t t h e r e was no t r i g g e r p o i n t f o r the i n d u c t i o n o f the heat shock response; i n f a c t the r a t e o f hsp s y n t h e s i s was p r o p o r t i o n a l t o the severity of stress. increased  Consider  sodium a r s e n i t e :  the l e v e l s o f hsps a l s o i n c r e a s e d .  as i t s c o n c e n t r a t i o n was This pattern continued  until  a l e t h a l c o n c e n t r a t i o n was reached, a f t e r which the c e l l s began t o d i e off.  A s i m i l a r r e a c t i o n was observed w i t h  temperature shocks.  c e l l must be a b l e t o monitor the amount o f d i s c o m f o r t correspondingly.  The response o f t r o u t c e l l s  Thus the  and respond  t o sodium a r s e n i t e was v e r y  s i m i l a r t o t h a t found i n c h i c k embryo f i b r o b l a s t s (52), i . e . d i f f e r e n t become induced  at d i f f e r e n t arsenite concentrations.  hsps  F o r i n s t a n c e , hsp70  -  was  99  -  r e a d i l y induced a t a l l c o n c e n t r a t i o n s  between 1 and 300 pM whereas  hsp30 c o u l d o n l y be induced between 15 and 50 pM to any e x t e n t . a l t h o u g h the heat-shock genes are c o o r d i n a t e l y r e g u l a t e d ,  Thus,  they seem to be  d i f f e r e n t i a l l y expressed. One  o f the f e a t u r e s  induction.  The e n t i r e c e l l  towards an i n c r e a s e d shift cell  o f the heat shock response i s i t s r a p i d protein synthesis  production  i s so e f f i c i e n t  o f hsps d u r i n g  r e a d i l y v i s i b l e on Coomassie from c e l l s  a s t r e s s response.  t h a t s e v e r a l hsps become major c o n s t i t u e n t s  a f t e r a few hours o f i n d u c t i o n .  proteins  apparatus seems t o be geared  blue  This o f the  In t r o u t , hsp70 and hsp30 were  s t a i n e d SDS-polyacrylamide g e l s o f  induced f o r extended p e r i o d s .  Thus,  the presence o f  hsps i n such l a r g e numbers i m p l i e s an important f u n c t i o n f o r them, o t h e r w i s e one would not expect the c e l l times o f s t r e s s . trout. Since  As mentioned,  to expend  unnecessary energy i n  hsp70 i s one of the two major hsps o f  T h i s i s a l s o the case f o r most organisms  studied  to date ( 1 ) .  the heat shock response i s observed i n a l l organisms  and hsp70 i s the  major hsp o f these organisms, l o g i c d i c t a t e s t h a t some c o n s e r v a t i o n prote'n would be m a i n t a i n e d through the d i f f e r e n t s p e c i e s .  of t h i s  Several  experiments were done t o compare the t r o u t hsp70 w i t h t h a t o f D r o s o p h i l a i n v e s t i g a t e the above e x p e c t a t i o n . t r o u t and D r o s o p h i l a  One  o f these i n v o l v e d  the m o b i l i t y o f  hsps on an SDS-polyacrylamide g e l ( F i g u r e 7 ) .  o n l y hsp to have i d e n t i c a l m o b i l i t y i n the two systems was  the hsp70.  Other s i m i l a r i t i e s were determined at the s t r u c t u r a l l e v e l and w i l l discussed One  The  be  later. approach t h a t can h e l p  l o c a l i z e these p r o t e i n s  to determine the f u n c t i o n o f hsps i s to  to c e r t a i n p a r t s o f the c e l l .  however, the l o c a l i z a t i o n of t r o u t hsps was  In t h i s  not e x t e n s i v e l y  thesis  investigated.  to  - 100 -  The  l i m i t e d r e s u l t s o b t a i n e d from p u l s e - c h a s e experiments seemed t o suggest  t h a t both hsp70 and hsp30 were t r a n s l o c a t e d t o the n u c l e u s . b u l k o f the l a b e l l e d hsps was l o c a l i z e d  However, the  i n the c y t o p l a s m i c f r a c t i o n .  The  ambiguous r e s u l t s may have been due t o the c o n d i t i o n s o f the experiment. A l t h o u g h the i n d u c t i o n o f the t r o u t c e l l s was a t an e l e v a t e d the p u l s e and chase p o r t i o n s were done a t normal growth recovery period of 2 hours.  Velazquez and L i n d q u i s t  r e p o r t e d the s t r e s s dependent T h e i r use o f i n d i r e c t  temperature,  conditions after a  (190) have r e c e n t l y  t r a n s l o c a t i o n o f hsp70 i n D r o s o p h i l a c e l l s .  immunofluoresence  w i t h monoclonal a n t i b o d i e s t o hsp70  has h e l p e d t o l o c a l i z e the p r o t e i n predominantly i n the n u c l e i o f heat-shocked c e l l s .  D u r i n g r e c o v e r y , the hsp70 was seen t o m i g r a t e back  i n t o the cytoplasm.  Thus i n the case o f the p u l s e - c h a s e experiment  described i n this thesis reflecting  ( F i g u r e 13), the r e s u l t s may a c t u a l l y be  the s i t u a t i o n i n a r e c o v e r i n g c e l l .  need  t o be done t o c o n f i r m the above s u s p i c i o n .  4.2  R e g u l a t i o n o f the Heat  F u r t h e r experiments  would  Shock Response  The complex n a t u r e o f the r e g u l a t i o n o f the heat shock response has become apparent i n the l a s t  few y e a r s .  S e v e r a l l e v e l s o f c o n t r o l seem to  be c o o r d i n a t e d i n some manner t o produce a r a p i d response t o c e r t a i n s t r e s s f u l agents.  In some organisms, one type o f c o n t r o l occurs a t the  l e v e l o f normal p r o t e i n s y n t h e s i s .  I t has been known f o r some time t h a t  normal c e l l u l a r mRNAs a r e not degraded d u r i n g heat-shock, but r a t h e r a r e s e l e c t i v e l y r e p r e s s e d (13, 45-47).  Upon r e t u r n o f the c e l l s  c o n d i t i o n s , the p r e - e x i s t i n g mRNAs a r e r e l e a s e d from t h i s  t o normal  inhibition.  Yeast c e l l s do not e x h i b i t the same c o n t r o l on p r e - e x i s t i n g mRNAs but  - 101 -  rather allow them to be degraded at the normal rate (48).  In v i t r o  t r a n s l a t i o n of trout mRNA show that normal c e l l u l a r mRNAs are present but not translated during induction of the heat-shock genes.  Thus i t would be  reasonable to assume that t r a n s l a t i o n a l control occurs i n trout as i t does i n most other organisms.  The purpose for this t r a n s l a t i o n a l control may be  to allow selective t r a n s l a t i o n of heat-shock mRNAs and thus rapidly and e f f i c i e n t l y express the hsps.  This suggestion was supported by evidence  showing the rapid induction of hsps i n trout c e l l s .  For instance,  the two  major hsps of trout (hsp70 and hsp30) were readily detected in c e l l s induced for short periods at 37°C. incorporation was  The detection was based on the  of [ S]methionine into the proteins. 35  Since the l a b e l l i n g  carried out at 22°C for 1 hour, one cannot rule out the p o s s i b i l i t y  that the entire hour was necessary for hsp synthesis.  However, the rapid  appearance of trout hsp70 following induction has also been monitored by immunological methods (E.A Burgess, personal communication), and an increase  i n hsp70 was detected as early as 5 minutes a f t e r the addition of  arsenite to the c e l l s . The expression of heat-shock genes i s also regulated transcription.  As with most organisms studied,  trout c e l l s i s dependent on new t r a n s c r i p t i o n . analyzing  at the l e v e l of  the induction of hsps i n This was determined by  transcripts from both normal and induced c e l l s .  The levels of  hsp70 mRNA i n sodium arsenite induced RTG-2 c e l l s were much greater than i n control c e l l s (Figure 21).  The multiple bands for hsp70 mRNA observed on  Northern blots most probably represent d i f f e r e n t species of hsp70 message in trout.  To further study t r a n s c r i p t i o n a l control i n trout, the k i n e t i c s  of induction and recovery of c e l l s from heat-shock or sodium arsenite exposure were examined by measuring hsp70 mRNA l e v e l s .  There are at least  - 102 -  two  and p r o b a b l y more h s p 7 0 - l i k e  genes i n t r o u t and s i n c e o n l y one o f the  t r o u t hsp70 cDNAs (THS70.7) was used i n these s t u d i e s , d e f i n i t e c o n c l u s i o n s can o n l y be made c o n c e r n i n g species. parallel  the mRNA l e v e l s q u i t e c l o s e l y , the c o n c l u s i o n s t o i n c l u d e a l l i n d u c i b l e hsp70 mRNAs i n these  Induction  o f t r o u t hsp70 was r a p i d (of the o r d e r  when c e l l s were s u b j e c t e d  detected during  o f one hsp70 mRNA  However, s i n c e the l e v e l s o f t o t a l hsp70 p o l y p e p t i d e s  generalized  parallels  the i n d u c t i o n and r e c o v e r y  seem t o  can p r o b a b l y be cells.  o f a few minutes)  t o e i t h e r heat o r sodium a r s e n i t e s t r e s s .  the f i n d i n g s i n D r o s o p h i l a ,  This  where complete hsp70 mRNAs a r e  4 minutes a f t e r temperature e l e v a t i o n (43).  sodium a r s e n i t e i n d u c t i o n o f t r o u t c e l l s ,  As mentioned  earlier,  immunological d e t e c t i o n o f  hsp70 w i t h i n 5 minutes a f t e r s t a r t o f the i n d u c t i o n i s p o s s i b l e (E.A. Burgess, p e r s o n a l  communication).  This  i s i n contrast  to results  obtained  by hsp70 cDNA h y b r i d i z a t i o n t o mRNA from these c e l l s which do not show significant  l e v e l s o f hsp70 mRNA u n t i l  15 minutes a f t e r s t a r t o f  i n d u c t i o n . - The d i s p a r i t y between the appearance o f the p r o t e i n and the presence o f the t r a n s c r i p t may r e f l e c t techniques.  Since  whereas the other  one t e c h n i q u e r e l i e s on the d e t e c t i o n o f the p r o t e i n on d e t e c t i o n o f a t r a n s c r i p t , r e s u l t s from both cannot be  q u a n t i t a t i v e l y compared. and  was  More than one gene may code f o r the t r o u t hsp70  t r a n s c r i p t s from o t h e r  under c o n d i t i o n s detected  the s e n s i t i v i t y o f the two  o f high  genes may not h y b r i d i z e  stringency.  I t should  t o the hsp70 cDNA clone  be noted t h a t t r o u t hsp70  immunologically with antibody to chicken  c r o s s - r e a c t i o n o f the hsp70s from these two s p e c i e s h i g h l y conserved nature o f t h i s p r o t e i n .  hsp70.  The  f u r t h e r emphasizes the  The r a p i d r a t e o f i n d u c t i o n  suggests that the heat-shock genes, although i n a c t i v e i n uninduced  cells,  are m a i n t a i n e d i n an " a l e r t " s t a t e ready f o r immediate t r a n s c r i p t i o n . One  - 103 -  major d i f f e r e n c e was observed between the i n d u c t i o n p a t t e r n o b t a i n e d by heat-shock v e r s u s sodium a r s e n i t e . i n continued ( F i g u r e 23).  synthesis  Prolonged exposure t o a r s e n i t e r e s u l t e d  and/or maintenance o f t r o u t hsp70 mRNA l e v e l s  In c o n t r a s t , continuous heat-shock a t 28°C f o r longer  hours caused a decrease i n hsp70 mRNA l e v e l s ( F i g u r e s y n t h e s i s was s t i l l  occurring  22).  Since  than 2  protein  i n c e l l s heat-shocked f o r up t o 16 hours  ( F i g u r e 9), c e l l death i s n o t a l i k e l y cause o f the l a t t e r b e h a v i o u r . leaves  the p o s s i b i l i t y o f a u t o r e g u l a t i o n  c e l l u l a r adaptation  t o thermal shock.  and may a l s o r e f l e c t  This  a type o f  In a d d i t i o n t o t r a n s c r i p t i o n a l  c o n t r o l d i f f e r e n c e s , hsp70 mRNA s t a b i l i t y may be a f f e c t e d d i f f e r e n t l y by heat-shock and a r s e n i t e exposure. The  l e v e l o f heat-shock mRNA i n d u c t i o n seems t o r e f l e c t  of t h e i n d u c i n g concentration  stimulus.  The l e v e l s o f hsp70 mRNA v a r i e d w i t h the  o f sodium a r s e n i t e used  u n t i l a concentration  the i n t e n s i t y  ( F i g u r e 24); hsp70 mRNA l e v e l s rose  o f a p p r o x i m a t e l y 50 uM a r s e n i t e was reached, a f t e r  which the c e l l s began t o d i e .  T h i s behaviour was a l s o r e f l e c t e d a t the  l e v e l o f hsp s y n t h e s i s  11).  (Figure  T h i s r e l a t i o n s h i p between the  i n t e n s i t y o f the s t r e s s and the magnitude o f the response has a l s o been reported  i n Drosophila  Finally, trout c e l l s .  the c o n t r o l o f the r e c o v e r y  ( F i g u r e 25).  r a p i d , e s p e c i a l l y during  t o be s y n t h e s i z e d  of the i n d u c e r  (Figure  26).  from temperature  f o r a p p r o x i m a t e l y 30 minutes a f t e r removal  A f t e r the i n i t i a l  l e v e l s decreased, but more s l o w l y The s h o r t  recovery  Recovery from sodium a r s e n i t e d i f f e r e d i n t h a t hsp70  mRNA continued  stress.  from heat-shock was monitored i n  As was the case w i t h i n d u c t i o n , the r e p r e s s i o n o f the hsp70  mRNA s y n t h e s i s was very stress  (42, 4 3 ) .  than d u r i n g  l a g p e r i o d , hsp70 mRNA recovery  l a g may be due t o the p e r s i s t e n c e  from temperature  of i n t r a c e l l u l a r  - 104 -  a r s e n i t e o r may r e f l e c t synthesis.  a s e p a r a t e mechanism f o r r e p r e s s i n g hsp70 mRNA  Rapid r e c o v e r y o f c e l l s  from s t r e s s s i t u a t i o n s has a l s o been  observed i n D r o s o p h i l a (42, 44) and the a c t u a l k i n e t i c s o f r e c o v e r y v a r i e s w i t h the s e v e r i t y o f the i n i t i a l heat-shock  (44).  An i n t e r e s t i n g  feature  of t h i s complex p a t t e r n o f r e c o v e r y i s the requirement f o r f u n c t i o n a l hsps.  In D r o s o p h i l a , absence  o f f u n c t i o n a l hsps p r e v e n t s the c e l l s  a t t a i n i n g complete r e c o v e r y a f t e r a heat-shock  (42).  The r e g u l a t i o n o f t h e heat shock response i s dependent factors, including:  from  on a v a r i e t y o f  the i n t e n s i t y , d u r a t i o n and n a t u r e o f the s t r e s s , and  the presence o f f u n c t i o n a l hsps  f o r a u t o r e g u l a t i o n and r e c o v e r y .  In  a d d i t i o n , p r e - e x i s t i n g mRNAs a r e s u b j e c t t o t r a n s l a t i o n a l c o n t r o l (13, 45-47).  I t i s e v i d e n t t h a t r e g u l a t i o n o f the heat shock response i s a  complex p r o c e s s w i t h m a n i f e s t a t i o n s a t s e v e r a l stages o f gene e x p r e s s i o n (Figure 32).  4.3  The Conserved Nature o f the Heat  Shock Response  The presence o f the heat shock response has been observed i n a wide range o f organisms,  spanning a l l t h r e e primary kingdoms.  For t h i s  phenomenon t o be m a i n t a i n e d through e v o l u t i o n , i t must have been under considerable selective pressures. al.  (21) was t h a t t h e development  An i n t e r e s t i n g s u g g e s t i o n made by Lee e t o f an " o x d i a t i o n s t r e s s " i n c e l l s may be  a common f a c t o r among i n d u c e r s o f the heat shock response.  Since  p r o t e c t i o n from excess i n t r a c e l l u l a r oxygen would have been a n e c e s s i t y e a r l y i n the e v o l u t i o n a r y time s c a l e , one would have expected the c e l l t o have developed a s t r e s s response. was  I t may have f o l l o w e d t h a t t h i s  m a i n t a i n e d and m o d i f i e d t o i n c l u d e o t h e r s t r e s s  situations.  response  - 105  -  Figure 32. Model for the regulation of the Heat Shock Response.  The  diagram summarizes some of the steps involved i n the regulation of  the heat shock response.  B r i e f l y , the inducer ( l ) disrupts  pre-existing polysomes and sequesters the mRNA.  These are kept  under translational control and are only expressed when the c e l l i s returned to normal conditions.  The inducer could act  d i r e c t l y on the heat-shock genes but more l i k e l y through an intermediate (2).  The i d e n t i f i c a t i o n of this secondary  messenger has yet to be determined.  Rapid transcription of the  heat-shock messages occurs (3) followed by processing and transport to the cytoplasm (4).  Polysomes form on these newly  made messages (5) and selective translation (6) results i n the synthesis of hsps (hatched boxes).  These proteins could i n turn  affect the regulation of the response by c o n t r o l l i n g the rate of recovery of the c e l l (7), by binding to the cytoskeletal structure (8), by i n a c t i v a t i n g the secondary messenger (9), and by binding to heat-shock DNA (10) or RNA (11). = nucleus.  C = cytoplasm, N  -  io5 'a  - 106 -  Although the p r e c i s e r o l e f o r t h i s phenomenon has y e t to be determined, i t i s becoming e v i d e n t t h a t i t has an o v e r a l l function.  protective  T h i s i s supported by s t u d i e s showing t h a t a m i l d heat-shock  p r e c e d i n g a n o r m a l l y l e t h a l heat-shock c o n f e r s t h e r m o t o l e r a n c e on c e l l s (29, 85, 8 6 ) .  Such t h e r m o t o l e r a n c e can be c o n f e r r e d upon c e l l s by o t h e r  i n d u c e r s o f the response, such as sodium a r s e n i t e  (29).  The m i g r a t i o n o f  the major D r o s o p h i l a hsp to the n u c l e u s d u r i n g heat-shock, and i t s a s s o c i a t i o n w i t h decondensed chromatin would a l s o imply a p r o t e c t i v e f u n c t i o n (190). be s i m i l a r i n a l l  S i n c e f u n c t i o n a l p r o p e r t i e s o f hsps have been suggested to organisms, i t should f o l l o w t h a t s t r u c t u r a l p r o p e r t i e s o f  hsps a l s o be conserved.  One approach i n t h i s r e s p e c t has been to compare  the major hsp (hsp70) o f a l l  organisms.  Methods  such as p r o t e o l y t i c  c l e a v a g e , immunological c r o s s - r e a c t i v i t y , or c r o s s - h y b r i d i z a t i o n at the nucleic acid  l e v e l have been used.  However, the b e s t method  i s by d e t e r m i n i n g the sequence o f these p r o t e i n s .  o f comparison  Thus f a r , the o n l y  r e p o r t e d sequence i n f o r m a t i o n f o r a e u k a r y o t i c hsp70 i s f o r D r o s o p h i l a and y e a s t  (65).  They show 72% homology a t the n u c l e o t i d e l e v e l .  the sequence f o r the E. c o l i dnaK gene was  reported  (68).  (92)  Recently,  I t shows 57%  i d e n t i t y a t the n u c l e o t i d e l e v e l to the D r o s o p h i l a hsp70 gene.  Such  c o n s e r v a t i o n i s s t r i k i n g and a s i m i l a r homology w i t h t r o u t hsp70 would enhance these f i n d i n g s and h e l p to narrow down conserved domains which may reveal i t s functional  properties.  Two hsp70 cDNAs, THS70.7 and THS70.14 from rainbow t r o u t , g a i r d n e r i i have been i d e n t i f i e d and a n a l y z e d i n t h i s t h e s i s .  S. The p r e d i c t e d  amino a c i d sequences from these cDNAs are v e r y s i m i l a r t o those r e p o r t e d f o r the hsp70 genes of JK_ melanogaster (92) and  cerevisiae  (65).  The  presence o f a m u l t i g e n e f a m i l y o f hsp70 sequences i n the t r o u t genome has  - 107  -  been i n f e r r e d from the h y b r i d i z a t i o n o f genomic DNA cDNAs.  The  b l o t s to the hsp70  e x i s t e n c e of m u l t i p l e hsp70 genes i n t r o u t i s a l s o supported  the presence o f m u l t i p l e spots on two  dimensional  polyacrylamide  by  g e l s of  p r o t e i n samples from in v i t r o t r a n s l a t e d , h y b r i d - s e l e c t e d mRNA f o r t r o u t hsp70 (E.A. The  Burgess, p e r s o n a l  communication).  n u c l e o t i d e sequences of the two  cDNAs were determined and  to hsp70 sequences from D r o s o p h i l a and y e a s t  ( F i g u r e 20).  The  compared  extent  of  homology i s s t r i k i n g , e s p e c i a l l y at the amino a c i d sequence l e v e l .  The  amino a c i d sequences coded f o r i n the t r o u t cDNAs are approximately  79%  homologous w i t h both D r o s o p h i l a and y e a s t hsp70. c o l i dnaK p r o t e i n (68), the THS70.7 shows 55%  When compared to the  identity.  E.  For organisms  r e p r e s e n t i n g p h y l a that d i v e r g e d e a r l y i n the e v o l u t i o n a r y time s c a l e , t h i s degree o f sequence c o n s e r v a t i s m been observed conservatism  i n many o t h e r organisms, and can now  observations: studied  Hsp70-like  p r o t e i n s have  a h i g h degree o f sequence  be p r e d i c t e d on the b a s i s of the f o l l o w i n g  the s i m i l a r i t i e s of the i n d u c t i o n process  i n most organisms  ( l ) , the c r o s s - r e a c t i o n of a c h i c k e n hsp70 a n t i b o d y w i t h  proteins i n widely divergent genes from one 57,  i s remarkable.  65-67).  s p e c i e s (64), the c r o s s - h y b r i d i z a t i o n o f hsp70  organism to the genomic DNA  The  conservatism  o f the heat  and  RNA  of o t h e r organisms  shock response i s not  the h s p 7 0 - l i k e p r o t e i n s ; s i m i l a r i t i e s among d i f f e r e n t h s p 8 3 - l i k e (64) and presented  among the s m a l l hsps (69, 70) have been r e p o r t e d . here support  similar  The  (50,  limited  proteins results  the c o n c l u s i o n t h a t the hsp70 genes form a h i g h l y  c o n s e r v a t i v e gene f a m i l y .  to  - 108 -  4.4  Genomic O r g a n i z a t i o n  o f Hsp70 Genes  The o r g a n i z a t i o n o f hsp70 genes has been most e x t e n s i v e l y s t u d i e d i n Drosophila  ( 2 ) . These genes a r e present  i n m u l t i p l e copies  Drosophila  genome and are found c l u s t e r e d w i t h i n a few k i l o b a s e s .  S i m i l a r l y , an hsp70 m u l t i g e n e f a m i l y has been i d e n t i f i e d The o c c u r r e n c e of hsp70 m u l t i p l e gene c o p i e s supported by experiments presented a n a l y s i s of genomic DNA  i n the  i n yeast ( 6 5 ) .  i n the t r o u t genome has been  i n this thesis.  In a d d i t i o n , the  from d i f f e r e n t organisms has r e v e a l e d  the presence  o f m u l t i p l e bands on Southern b l o t s probed w i t h hsp70 sequences. i n s t a n c e , the presence o f at l e a s t in  t r o u t was observed.  gene?  Why  two and p o s s i b l y more h s p 7 0 ~ l i k e  does the c e l l  need e x t r a c o p i e s  T h i s q u e s t i o n has not r e a l l y been answered, however,  suggestions  have been made.  For genes  of the hsp70 several  The presence o f m u l t i p l e c o p i e s  of the hsp70  gene may h e l p produce the r a p i d response to s t r e s s i . e . a l o t more t r a n s c r i p t s can be made i n a s h o r t  time.  Another p o s s i b i l i t y  i s t h a t the  d i f f e r e n t hsp70 genes code f o r s l i g h t l y d i f f e r e n t hsp70s having  different  t a r g e t s i n the c e l l . A l t h o u g h the c o n s t r u c t i o n o f lambda l i b r a r i e s c o n t a i n i n g t r o u t genomic DNA was p a r t i a l l y s u c c e s s f u l , s c r e e n i n g t o i s o l a t e hsp70 genes.  For a genome the s i z e o f t r o u t (3 x 10  would need a p p r o x i m a t e l y 10 to r e p r e s e n t  o f these l i b r a r i e s ended i n f a i l u r e  6  clones with  the e n t i r e genome.  9  b p ) , one  i n s e r t s o f 15 to 20 Kb i n l e n g t h  We o b t a i n e d  more than 3 x 10  s  clones  from two attempts at c o n s t r u c t i n g a t r o u t genomic l i b r a r y i n L47.1 phage, y e t no p o s i t i v e s f o r hsp70 sequences were i d e n t i f i e d . Mbol p a r t i a l s used to c o n s t r u c t  the l i b r a r i e s c o n t a i n e d  ( F i g u r e 31), the o n l y e x p l a n a t i o n  Since  the 15-20 Kb  the hsp70 sequences  f o r the l a c k o f any p o s i t i v e s was the  - 109  p o s s i b i l i t y of under-representing amplification  stage.  representation 10 ) s  the genome a f t e r the l i b r a r y  In the case of the CH4A l i b r a r y ,  o f the genome may  have been due  of i n d i v i d u a l clones obtained.  i s o l a t e d from t h i s l i b r a r y , s e v e r a l that  showed some h y b r i d i z a t i o n  stringent  conditions  (Figure  been shown to c o n t a i n Southern  Although  incomplete  to the low number (2.5 no hsp70 genes were  c l o n e s were found  to c o n t a i n  inserts  to the D r o s o p h i l a hsp70 gene even under  30).  In a d d i t i o n ,  two  of these c l o n e s have  (Herb Chang, p e r s o n a l communication) and p a r t i a l  However, h y b r i d i z a t i o n  e x i s t s that  these sequences r e p r e s e n t pseudogenes or cognate genes f o r  causing h y b r i d i z a t i o n  presence  any bands.  sequences to t r o u t  b l o t s have f a i l e d  The  to r e v e a l  of these  on Northern  hsp70 i n t r o u t .  x  i d e n t i c a l sequences based on r e s t r i c t i o n mapping,  blot analysis  sequence a n a l y s i s .  -  Thus, the  RNA  possibility  of some r e p e t i t i v e sequence i n the c l o n e s  to the D r o s o p h i l a hsp70 gene cannot be r u l e d  out  either.  4.5  C o n c l u s i o n s and  The response  Future  r e s u l t s presented of trout  of t h i s response  Prospects  i n t h i s t h e s i s have shown the heat  to be v e r y s i m i l a r to o t h e r organisms. were a n a l y z e d  and  are summarized i n Table  shock  Different V.  aspects  - 110 -  TABLE V.  Summary o f the Heat Shock Response i n Trout C e l l s  Heat-inducible Sodium a r s e n i t e  hsps  87,  i n d u c i b l e hsps  100,  70, 42, 32, and 30 (Kd) 87, 70, 62, 42, 32, and 30 (Kd)  T r a n s l a t i o n a l c o n t r o l on p r e -  Yes  e x i s t i n g mRNAs Transcriptional  control  Yes  Response r e v e r s i b l e  Yes  hsp70 sequence  Yes  hsp70 m u l t i g e n e  The  conservation  Yes  family  c h a r a c t e r i z a t i o n o f the heat shock response i n t r o u t should p r o v i d e  a s u i t a b l e base from which t o i n v e s t i g a t e o t h e r a s p e c t s o f t h i s phenomenon.  Of immediate concern however, would be t o i s o l a t e genomic  c o p i e s o f the t r o u t hsp70 sequence. things,  T h i s would f a c i l i t a t e ,  the a n a l y s i s o f c o n t r o l r e g i o n s f l a n k i n g the gene.  among o t h e r Expression i n  h e t e r o l o g o u s systems would a l l o w f o r the study o f hsp70 r e g u l a t i o n controlled conditions.  How w e l l  the e x p r e s s i o n i s r e g u l a t e d  would a l l o w  one  t o b e t t e r understand the conserved nature o f the response.  one  can study the s t r u c t u r e  fairly  rigid  inducing  since  o r removing the  B e s i d e the use o f the heat shock response as an i d e a l  model system f o r the study o f gene r e g u l a t i o n , phenomenon can a l s o be i n v e s t i g a t e d . heat-inducible  Similarly,  o f a c t i v e l y t r a n s c r i b i n g hsp70 chromatin  c o n t r o l can be m a i n t a i n e d by i n t r o d u c i n g  agent.  under  o t h e r a s p e c t s o f the  For instance,  the l i n k i n g o f  promotors onto genes c o d i n g f o r m e d i c a l l y  o r commerically  - Ill -  important proteins would enable one to control the expression of these genes and thus make these proteins more accessible. Another area of the heat shock response that seems to be gaining more attention i s hsp function.  Although we can be f a i r l y sure that hsps serve  a protective function, the exact manner i n which they accomplish i t has yet to be determined. variants?  Why  does the c e l l need different types of hsps and hsp  Thus analysis of the structure of other trout hsps and i n  p a r t i c u l a r hsp30 may raised above.  prove invaluable i n answering some of the questions  It i s my f e e l i n g however, that since the heat shock response  i s so complex, answering one question w i l l probably raise ten others.  - 112 -  V.  BIBLIOGRAPHY  1. S c h l e s i n g e r , M.J., M. Ashburner, and A. T i s s i e r e s ( e d i t o r s ) . 1982. Heat Shock: From B a c t e r i a to Man. Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 2. Ashburner, M.,  and J . J . Bonner.  3. Tanguay, R.M.  1983.  1979.  Can J . Biochem.  Cell  1_7: 241-254.  Cell. Biol.  4. R i t o s s a , F.  1962.  E x p e r i e n t i a 18:  5. R i t o s s a , F.  1964.  Exp. C e l l Res. 35_: 601-607.  6. Berendes, H.D.,  and Th.K.H. H o l t .  61_: 387-394.  571-573.  Genen. Phaenen. 9:  1964.  7. Berendes, H.D., F.M.A. v a n B r e u g e l , and Th.K.H. H o l t . Chromosoma 1_6: 35-46. 8. Ashburner, M.  1970.  9. T i s s i e r e s , A., H.K. 84: 389-398.  Chromosoma 31_  :  1-7.  1965.  356-376. Tracy.  1974.  J . Mol.  10. McKenzie, S.L., S. H e n i k o f f , and M. Meselson. Acad. S c i . U.S.A. 7_2: 1117-1121.  1975.  Proc. N a t l .  11. S p r a d l i n g , A., 12. McKenzie,  S.L.,  M i t c h e l l , and V.M.  S. Penman, and M.L. and M. Meselson.  13. M i r a u l t , M.E., M. Tissieres. 1978.  Pardue. 1977.  1975.  Biol.  C e l l 4: 395-404.  J . Mol. B i o l .  117:  279-283.  Goldschmidt-Clermont, L. Moran, A.P. A r r i g o , and A. Cold S p r i n g Harbor Symp. Quant. B i o l . 42: 819-827.  14. L i s , J . , L. P r e s t i g e , and D.S.  Hogness.  15. L i s , J.T., D. Ish-Horowicz, and S.M. 9: 5297-5311.  1978.  Pinchin.  Cell  14: 901-911.  1981.  Nucl. Acids  Res.  16. L i v a k , K.F., R. Freund, M. Schweber, P.C. Wensink, and M. Meselson. 1978. P r o c . N a t l . Acad. S c i . U.S.A. _75: 5613-5617. 17. Holmgren, R., K. L i v a k , R. Morimoto, 1979. C e l l 18_: 1359-1370.  R. Freund, and M.  Meselson.  18. Corces, V., R. Holmgren, R. Freund, R. Morimoto, and M. Meselson. 1980. P r o c . N a t l . Acad. S c i . U.S.A. 77_: 5390-5393. 19. Wadsworth, S.C., E.A. C r a i g , and B.J. McCarthy. Acad. S c i . U.S.A. 77: 2134-2137.  1980.  Proc. N a t l .  - 113 -  20.  K e l l e y , P.M., and M.J. S c h l e s i n g e r .  21.  Lee, P.C., B.R. Bochner, and B.N. Ames. U.S.A. 80: 7496-7500.  22. F i n k , K., and E. Zeuthen. 23.  1980.  1978.  Cell  1983.  15_: 1277-1286. Proc. N a t l . Acad. S c i .  Exp. C e l l Res. 128: 23-30.  K e t o l a - P i r i e , C A . , and B.G. A t k i n s o n . B i o l . 61: 462-471.  1983.  24. L e v i n s o n , W., H. Oppermann, and J . Jackson. A c t a . 518: 401-412.  Can. J . Biochem. C e l l  1978.  Biochim. Biophys.  25.  L e v i n s o n , W., R. M i k e l e n s , H. Oppermann, Biochim. B i o p h y s . A c t a . 519: 65-75.  26.  L e v i n s o n , W., J . I d r i s s , and J . Jackson. Res. 1: 15-23.  1979.  27.  Guttman, S.D., C.V.C. G l o v e r , C D . A l l i s , C e l l 22: 299-307.  and M.A. Gorovsky.  28. I r e l a n d , R . C , and E.M. B e r g e r . 79: 855-859. 1982.  1982.  and J . J a c k s o n .  L i , C C , and Z.'Werb. 3218-3222.  30.  L e v i n s o n , W., H. Oppermann, and J . J a c k s o n . A c t a . 606: 170-178.  31.  Cosgrove, J.W., 80: 569-573.  33.  Nevins, J.R.  Cell  1980.  P r o c . N a t l . Acad. S c i . U.S.A. 79_:  and I.R. Brown.  1982.  Trace Elements  P r o c . N a t l . Acad. S c i . U.S.A.  29.  32. C u r r i e , R.W. , and F.P. White.  Biol.  1978.  1983.  1981.  1980.  Biochim. Biophys.  P r o c . N a t l . Acad. S c i . U.S.A.  Science  (Wash. D . C ) 214: 72-73.  29: 913-919.  34. Leenders, H.J., H.D. Berendes, P . J . Helmsing, J . Derksen, and J.F.J.G. Koninkx. 1974. S u b c e l l . Biochem. 3: 119-147. 35.  S i n , Y.T.  1975.  Nature 258: 159-160.  36.  C r a i n e , B.L., and T. Romberg.  1981.  37.  Bonner, J . J . 1982.  86: 409-418.  Dev. B i o l .  38. Compton, J.L., and J . J . Bonner. Quant. B i o l . 42: 835-838.  1977.  39.  Compton, J . L . , and B.J. McCarthy.  40.  Tanguay, R.M. , and M. V i n c e n t .  Cell  Cold S p r i n g Harbor Symp.  1978.  1982.  25_: 671-681.  Cell  14: 191-201.  Can. J . Biochem. 60_: 306-315.  - 114 -  41.  Jack, R.S., W.J. Gehring, and C. Brack.  42.  DiDomenico, B.J., G.E. Bugaisky, and S. L i n d q u i s t . 593-603.  43.  L i n d q u i s t , S.  44.  DiDomenico, B.J., G.E. Bugaisky, and S. L i n d q u i s t . Acad. S c i . U.S.A. _79: 6181-6185.  45.  S t o r t i , R.V., M.P. 825-834.  46.  Kruger, C ,  47.  B i e n z , M. , and J.B. Gurdon.  48.  L i n d q u i s t , S.L.  49.  Walsh, C.  50.  Snutch, T.P., and D.L. B a i l l i e . 61: 480-487.  51.  Bouche, G., F. A m a l r i c , M. C a i z e r g u e s - F e r r e r , and J.P. Z a l t a . N u c l . A c i d s Res. 7_: 1739-1747.  52.  Johnston, D., H. Oppermann, J . Jackson, , and W. L e v i n s o n . B i o l . Chem. 25_5: 6975-6980.  53.  V i n c e n t , M.,  54.  Lemaux, P.G., S.L. Herendeen, P.L. B l o c h , and F.C. N e i d h a r d t . C e l l 13: 427-434.  55.  S l a t t e r , A., A.C.B. Cato, G.M. S i l l a r , 1981. E u r . J . Biochem. 117: 341-346.  56.  A t k i n s o n , B.G.  57.  H e i k k i l a , J . J . , G.A. S c h u l t z , K. I a t r o u , and L. Gedamu. B i o l . Chem. 257: 12000-12005.  1982.  58.  G i u d i c e , G., M.C. R o c c h e r i , and M.G. I n t . Rep. 4: 69-74.  Cell  59.  F r a n c i s , D., and L. L i n . 1980.  60.  Key, J . L . , C.Y. L i n , and Y.M. U.S.A. _78_: 3526-3530.  61.  B a r n e t t , T., M. A l t s c h u l e r , C.N. MacDaniel, and J.P. Mascarenhas. 1980. Dev. Gen. 1: 331-340.  1980.  Dev. B i o l . JJ_:  Cell  1981.  1981.  1982.  24: 321-331. 1982.  C e l l 31:  1982.  Proc. Natl,  463-479.  S c o t t , A. R i c h , and M.L. Pardue.  and B . - J . Benecke.  1980.  1981.  1980.  C e l l ^ 3 : 595-603.  Cell  29_: 811-819.,  Chem.  255_: 2629-2632. 1983.  Can. J . Biochem. C e l l  1  1981.  22:  Nature (Lond.) 293: 311-314.  J. Biol.  and R.M.  Cell  Tanguay.  1979.  J. Cell Biol.  1979.  1980.  J.  Nature 281: 501-503. 1978.  J . K i o u s s i s , and R.H. Burdon.  89: 666-673.  DiBernardo.  Dev. B i o l .  Chen.  Biol.  1981.  1980.  J.  Biol.  79: 238-242. P r o c . N a t l . Acad. S c i .  - 115 -  62. Yuyama, S. , and A.M.  Zimmerman.  1972.  Exp. C e l l Res. 7_1_: 193-203.  63. M i l l e r , M.J., H.-H. Xuong, and E.P. Geiduschek. Acad. S c i . U.S.A. 76_: 5222-5225. 64. K e l l e y , P., and M. S c h l e s i n g e r . 65.  I n g o l i a , T.D., M.R. 2: 1388-1398.  66.  Lowe, D.G., 1540-1543.  W.D.  1982.  1979.  Proc.  Mol. C e l l . B i o l .  S l a t e r , and E.A. C r a i g .  F u l f o r d , and L.A. Moran.  1982.  1983.  2:  Natl.  267-274.  Mol. C e l l .  Biol.  Mol. C e l l . B i o l .  3:  67. Moran, L.A., M. Chauvin, M.E. Kennedy, M. K o r r i , D.G. Lowe, R.C. N i c h o l s o n , and M.D. P e r r y . 1983. Can. J . Biochem. C e l l . B i o l . 61: 488-499. 68. B a r d w e l l , J.C.A., and E.A. C r a i g . U.S.A. 81_: 848-852. 69.  I n g o l i a , T.D., and E.A. C r a i g . 79: 2360-2364.  1984.  1982.  Proc. N a t l . Acad. S c i .  Proc.  N a t l . Acad. S c i . U.S.A.  70. Russnak, R.H., D. Jones, and E.P.M. Candido. Res. 11_: 3187-3205. 71. Buzin,  C.H.,  and N.S. P e t e r s e n .  1982.  1981.  Brugge, J.S., E. E r i k s o n , and R.I. E r i k s o n .  74. Oppermann, H., W. L e v i n s o n , S c i . U.S.A. 78: 1067-1071.  77.  L., and A. Varshavsky.  S i n i b a l d i , R.M., 10735-10738.  78. M i t c h e l l , H.K., 79. Velazquez, J.M., 679-689. 80.  and P.W.  Morris.  and L.S. L i p p s .  1981. 1981.  1975.  Proc.  1981.  and J.M. Bishop.  75. A r r i g o , A.P., S. Fakan, and A. T i s s i e r e s . 86-103. 76. L e v i n g e r ,  Nucleic  J . Mol. B i o l .  72. Wang, C., R.H. Gomer, and E. L a z a r i d e s . U.S.A. 78: 3531-3535. 73.  1983.  1981.  1980.  Acids  158: 181-201. N a t l . Acad. S c i .  Cell  25: 363-372.  Proc.  N a t l . Acad.  Dev. B i o l .  78:  J . C e l l B i o l . jK): 793-796. J. Biol.  Chem. 256:  Biochem. Genet. _13: 585-602.  B.J. DiDomenico, and S. L i n d q u i s t .  1980.  Cell  20:  S c h l e s i n g e r , M.J., P.M. K e l l e y , G. A l i p e r t i , and C. M a l f e r . 1982. i n Heat Shock: From B a c t e r i a to Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 243-250, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y.  - 116 -  81. S c h l e s i n g e r , M.J., G. A l i p e r t i , and P.M. K e l l e y . Biochem. S c i . 7: 222-225.  1982.  Trends  82. L i n , J . J.-C., W.J. Welch, J . I . G a r r e l s , and J.R. Feramisco. 1982. i n Heat Shock: From B a c t e r i a t o Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 267-273, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 83. Lewis, M.J., P. Helmsing, and M. Ashburner. S c i . U.S.A. 72: 3604-3608.  1975.  P r o c . N a t l . Acad.  84. M i t c h e l l , H.K., G. M o l l e r , N.S. P e t e r s o n , and L. L i p p s - S a r m i e n t o . 1979. Dev. Genet. 1; 181-192. 85. M c A l i s t e r , L., and D.B. F i n k e l s t e i n . Commun. 93_: 819-824. 86. P e t e r s o n , N.S., and H.K. M i t c h e l l . U.S.A. 78: 1708-1711. 87. Loomis, W.F.,  and S.A. wheeler.  1980.  1981.  1982.  Biochem. Biophys. Res.  Proc. N a t l . Acad. S c i .  Dev. B i o l .  90:  412-418.  88. A l t s c h u l e r , M., and J.P. Mascarenhas. 1982. i n Heat Shock: From B a c t e r i a t o Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 321-327, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 89. Minton, K.W., P. Karmin, G.M. Hahn, and A.P. Minton. N a t l . Acad. S c i . U.S.A. 7_9: 7107-7111. 90. B a l l i n g e r , D.G., and M.L. Pardue.  1983.  1982.  Proc.  C e l l ^33: 103-114.  91. Thomas, G.P. and M.B. Matthews. 1982. i n Heat Shock: From B a c t e r i a to Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 207-213, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 92. I n g o l i a , T.D., E.A. C r a i g , and B.J. McCarthy. 93. I n g o l i a , T.D., and E.A. C r a i g . 94. Hackett, R.W.,  and J.T. L i s .  1981. 1983.  1980.  Cell  21:  669-679.  N u c l . A c i d s Res. £ : 1627-1642.  N u c l . A c i d s Res. U :  7011-7030.  95. S c h e d l , P., S. A r t a v a n i s - T s a k o n a s , R. Steward, W. Gehring, M.-E. M i r a u l t , M. Goldschmidt-Clermont, L. Moran, and A. T i s s i e r e s . 1978. C e l l 14: 921-929. 96. Moran, L.A., M.-E. M i r a u l t , A. T i s s i e r e s , J . L i s , P. S c h e d l , S. A r t a v a n i s - T s a k o n a s , and W.J. Gehring. 1979. C e l l 1_7: 1-8. 97. A r t a v a n i s - T s a k o n a s , S., P. S c h e d l , M.-E. M i r a u l t , L. Moran, and J . Lis. 1979. C e l l 1_7, 9-18.  - 117 -  98. C r a i g , E.A., B . J . McCarthy, and S.C. Wadsworth. 575-588.  1979.  C e l l 16:  99. Goldschmidt-Clermont, M.  1980.  N u c l . A c i d s Res. 8: 235-252.  100. Torok, I . , and F. Karch.  1980.  N u c l e i c A c i d s Res. 8: 3105-3123.  101. Voellmy, R., M. Goldschmidt-Clermont, R. Southgate, A. T i s s i e r e s , L e v i s , and W. G e h r i n g . 1981. C e l l 23_: 261-270. 102. I n g o l i a , T.D., and E.A. C r a i g . 79: 525-529.  1982.  R.  Proc. N a t l . Acad. S c i . U.S.A.  103. M i r a u l t , M.-E., M. Goldschmidt-Clermont, S. A r t a v a n i s - T s a k o n a s , and P. Schedl. 1979. P r o c . N a t l . Acad. S c i . U.S.A. 76: 5254-5258. 104. Ish-Horowicz, D. and S.M. P i n c h i n .  1980.  J . Mol. B i o l .  105. Brown, A.J.L. and D. Ish-Horowicz.  1981.  Nature 290: 677-682.  106. Weisbrod, S.  1982.  107. E l g i n , S.C.R. 1981. 108. Wu, C.  1980.  142: 231-245.  Nature 297: 289-295. Cell  27.:  413-415.  Nature 286: 854-860.  109. Keene, M.A., V. Corces, K. Lowenhaupt, and S.C.R. E l g i n . N a t l . Acad. S c i . U.S.A. 78: 143-146. 110. Levy, A. and M. N o l l .  1981.  1982.  C e l l ^8: 375-378.  112. Karpov, V.L., O.V. Preobrazhenskaya, and A.D. Mirzabekov. 36: 423-431. 113. Mace, H.A.F., H.R.B. Pelham, and A.A. T r a v e r s . 555-557.  1983.  114. C o r c e s , V., A. P e l l i c e r , R. A x e l , and M. Meselson. Acad. S c i . U.S.A. 78: 7038-7042. 115. Burke, J . F . and Ish-Horowicz, D. 3821-3830.  1982.  Cell  118. Voellmy, R. and D. Rungger. 1776-1780.  1984.  Cell  Nature 304:  1981.  Proc. N a t l .  N u c l . A c i d s Res. 10:  116. M i r a u l t , M.-E., R. Southgate, and E. Delwart. 1279-1285. 1982.  Proc.  Nature 289: 198-203.  111. L e v i n g e r , L. and A. Varshavsky.  117. Pelham, H.R.B.  1981.  1982.  EMBO J . _1:  30: 517-528. 1982.  P r o c . N a t l . Acad. S c i . U.S.A. 79:  - 118 -  119. Pelham, H.R.B. and M. B i e n z .  1982. EMBO J . I: 1473-1477.  120. B i e n z , M. and H.R.B. Pelham.  1982. EMBO J . _1: 1583-1588.  121. L i s , J . , N. Costlow, J de B a n z i e , D. K n i p p l e , D. O'Connor, and L. Sinclair. 1982. i n Heat Shock: From B a c t e r i a to Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 57-62, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 122. Corces, V., A. P e l l i c e r , R. A x e l , S.-Y. M e i , and M. Meselson. 1982. i n Heat Shock: From B a c t e r i a to Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 27-34, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 123. F i n k e l s t e i n , D.B. and S. S t r a u s b e r g . 1625-1633.  1983. M o l . C e l l . B i o l . 3:  124. L i s , J.T., J.A. Simon, and C A . S u t t o n . 125. Rubin, G.M. and A.C. S p r a d l i n g . 348-353.  1982. S c i e n c e (Wash. D.C.) 218:  126. N e i d h a r d t , F.C. and R.A. VanBogelen. Commun. 100: 894-900. 127. Yamamori, T. and T. Yura. 860-864.  1983. C e l l _35_: 403-410.  1981.  Biochem.  B i o p h y s . Res.  1982. P r o c . N a t l . Acad. S c i . U.S.A. 79:  128. Georgopoulos, C , K. T i l l y , B a c t e r i o l . 149: 1175-1177.  D. Drahos, and R. Hendrix.  1982. J .  129. N e i d h a r d t , F . C , R.A. VanBogelen, and E.T. Lau. 1982. i n Heat Shock: From B a c t e r i a to Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 139-145, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 130. Georgopolous, C P .  1977. M o l . Gen. Genet. 151: 35-39.  131. Itakawa, H., and J . Ryu.  1979. J . B a c t e r i o l . 138: 339-344.  132. T i l l y , K., H. M u r i a l d o , and C. Georgopoulos. S c i . U.S.A. 78_: 1629-1633. 133. Georgopolous, C P . and B. Hohn. 7_5: 131-135. 134. S c o t t , M.P., and M.L. Pardue. 78: 3353-3357. 135. G l o v e r , C.V.C.  1981. Proc. N a t l .  Acad.  1978. P r o c . N a t l . Acad. S c i . U.S.A.  1981. P r o c . N a t l . Acad. S c i . U.S.A.  1982. P r o c . N a t l . Acad. S c i . U.S.A. 7_9: 1781-1785.  - 119 -  136. Sanders, M.M., D. Feeney-Triemer., A.S. O l s e n , and J . F a r r e l l - T o w t . 1982. i n Heat Shock: From B a c t e r i a t o Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 235-242, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 137. L i n d q u i s t , S.L.  1980. J . Mol. B i o l .  137: 151-158.  138. G r a z i o s i , G., F. M i c a l i , F. M a r z a r i , F. d e C r i s t i n i , 1980. J . Exp. Z o o l . 214: 141-145. 139. Dura, J.-M.  1981. M o l . Gen. Genet. 184: 381-385.  140. R o c c h e r i , M.C., M.G. DiBernardo, and G. G i u d i c e . 83: 173-177. 141. Zimmerman, J.L., W. P e t r i ,  and M. Meselson.  142. Bensaude, 0., and M. Morange. 143. Khandjian,  and A. S a v o i n i .  E.W., and H. T l i r l e r .  1981. Dev. B i o l .  1983. C e l l  32: 1161-1170.  1983. EMBO J . 2: 173-177. 1983. M o l . C e l l . B i o l .  3: 1-8.  144. M i t c h e l l , H.K., and N.S. P e t e r s e n . 1982. i n Heat Shock: From B a c t e r i a t o Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 337-344, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y. 145. C a i z e r g u e s - F e r r e r , M., G. Bouche, and F. A m a l r i c . 116: 261-264. 146. Sanders, M.M.  1981. J . C e l l B i o l .  1980. FEBS L e t t .  9_1: 579-583.  147. G l o v e r , C.V*C., K.J. Vavra, S.D. Guttman, and M.A. Gorovsky. C e l l 23: 73-77 148. Camato, R., and R.M. Tanguay.  1981.  1982. EMBO J . 1: 1529-1532.  149. A r r i g o , A.-P. 1983. N u c l . A c i d s Res. 1_1: 1389-1404. 150. Wilhelm, J.M., P. Spear, and C. Sax. 1982. i n Heat Shock: From B a c t e r i a t o Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 309-314, Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, N.Y.. 151. Mayrand, S., and T. Pederson. 152. Ron, A. and E. Zeuthen.  1983. M o l . C e l l . B i o l . _3: 161-171.  1980. Exp. C e l l Res. 128_: 303-309.  153. Biessmann, H., F-G. F a l k n e r , H, Saumweber, and M.F. W a l t e r . 1982. i n Heat Shock: From B a c t e r i a t o Man ( S c h l e s i n g e r , M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 275-282, Cold S p r i n g Harbor L a b o r a t o r y , C o l d S p r i n g Harbor, N.Y. 154. Wolf, K., and M.C. Quimby.  1962. Science  (Wash. D.C.) 135: 1065-1066.  -  120  155.  Marushige, K. , and J . Bonner.  156.  Laemmli, U.K.  157.  Matsudaira, P.T., and D.R. Burgess.  1970.  -  1966.  Nature (Lond.)  J . Mol. B i o l . JZ27:  15.:  160-174.  680-685.  1978.  Anal. Biochem.  87_: 3 8 6 - 3 9 6 .  1 5 8 . Chirgwin, J.M., A.E. Pryzbyla, R.J. MacDonald, and W.J. Rutter. 1979.  Biochemistry  18: 5294-5299.  1 5 9 . Aviv, H., and P. Leder.  1 9 7 2 . Proc. Natl. Acad. S c i . U.S.A. 6 9 :  1408-1412.  1 6 0 . Pelham, H.R.B., and R.J. Jackson.  1 9 7 6 . Eur. J . Biochem. 6_7: 2 4 7 - 2 5 7 .  1 6 1 . Wickens, M.P., G.N. Buell, and R.T. Schimke. 253:  1 9 7 8 . J . B i o l . Chem.  2483-2495.  1 6 2 . Land, H., M. Grez, H. Hauser, W. Lindenmaier, and G. Schlitz. 1 9 8 1 . Nucl. Acids Res. 9 : 2 2 5 1 - 2 2 6 6 . 1 6 3 . Grunstein, M., and D. Hogness. 72.: 164.  1 9 7 5 . Proc. Natl. Acad. S c i . U.S.A.  3961-3965.  Hanahan, D., and M. Meselson.  1980.  Gene  10:  63-67.  1 6 5 . McMaster, G.K., and G.G. Carmichael. 1 9 7 7 . Proc. Natl. Acad. S c i . U.S.A. 7 4 : 4 8 3 5 - 4 8 3 8 . 166.  Thomas, P.  1981.  Proc. Natl. Acad. S c i . U.S.A. _7_Z  :  1 6 7 . Bresser, J . , H.R. Hubbell, and D. G i l l e s p i e . S c i . U.S.A. 80: 6 5 2 3 - 6 5 2 7 .  5201-5205.  1 9 8 3 . Proc. Natl. Acad.  168.  Birnboim, H.C., and J . Doly.  1979.  Nucl. Acids Res. 1_:  1513-1523.  169.  B l i n , N., and D.W. Stafford.  1976.  Nucl. Acids Res.  2303-2314.  170.  Southern, E.M.  1975.  J . Mol. B i o l .  1 7 1 . Maxam, A., and W. G i l b e r t .  98:  3:  503-517.  1 9 7 7 . Proc. Natl. Acad. S c i . U.S.A. 7 4 :  560-564. 172.  Maxam, A.M., and W. G i l b e r t .  1980.  Meth. i n Enzymol.  1 7 3 . Sanger, F., S. Nicklen, and A.R. Coulson. S c i . U.S.A. Ik: 5 4 6 3 - 5 4 6 7 . 174.  Sanger, F., and A.R. Coulson.  1978.  309-321.  499-560.  1 9 7 7 . Proc. Natl. Acad.  FEBS Lett.  1 7 5 . Messing, J . , R. Crea, and P.H. Seeburg.  65:  8_7:  107-110.  1 9 8 1 . Nucl. Acids Res. 9.:  - 121 -  176. Rigby, P.W.J., M. Dieckman, C. Rhodes, and P. Berg. B i o l . 113: 237-251. 177.  Denhardt, D.T.  1977. J . M o l .  1966. Biochem. Biophys. Res. Commun. 2^: 641-646.  178. Yamamoto, K.R., B.M. A l b e r t s , R. Benzinger, L. Lawhorne, and G. Treiber. 1970. V i r o l o g y 40: 734-744. 179.  B l a t t n e r , F.R., B.G. W i l l i a m s , A.E. B l e c h l , K. Denniston-Thompson, H.E. Faber, L. F u r l o n g , J.D. Grunwald, D.O. K i e f e r , D.D. Moore, J.W. Schumm, E.L. Sheldon, and 0. S m i t h i e s . 1977. Science (Wash. D.C.) 196: 161-169.  180. Williams, B.G., and F.R. Blattner. 181.  Loenen, W.A.M., and W.J. Brammar.  1979. J . V i r o l . 29: 555-575. 1980. Gene 20: 249-259-  182. Maniatis, T., R.L. Hardison, E. Lacy, J . Lauer, C. O'Connell, D. Quon, G.K. Sim, and A. E f s t r a t i a d i s . 1978. C e l l 1_5: 687-701. 183.  G i r v i t z , S.C., S. Bacchetti, A.J. Rainbow, and L. Graham. 1980. Anal. Bioc. 106: 492-496.  184. S t e r n b e r g , N., D. T i e m e i e r , and L. E n q u i s t . 185.  Hohn, B., and K. Murray. 3259-3263.  186. Benton, W.D., 180-182. 187.  1977. Gene I: 255-280.  1977. Proc. N a t l . Acad. S c i . U.S.A. 74:  and R.W. D a v i e s .  1977. S c i e n c e (Wash. D.C.) 196:  Olsen, A.S., D.F. Triemer, and M.M. Sanders. 3: 2017-2027.  1983. M o l . C e l l .  Biol.  188. S h a p i r o , H.S. 1972. In H.A. Sober ( e d . ) , Handbook o f B i o c h e m i s t r y pp. H-96, CRC P r e s s , C l e v e l a n d , Ohio. 189.  S u l s t o n , J.E., and S. Brenner.  1974. G e n e t i c s 7_7: 95-104.  190. V e l a z q u e z , J.M. , and S. L i n d q u i s t .  1984. C e l l  3_6: 655-662.  - 122 -  VI.  APPENDIX - Is T31 an IS-Element?  As mentioned e a r l i e r , when the insert to pTHS70.7 was analyzed, an unusual feature became evident.  sequenced and  The t o t a l insert of about  Kb length consisted of two separate and unrelated sequences.  2.2  One half of  the insert (850 bp) had p a r t i a l sequence information for a trout hsp70. The hsp70 cDNA came to an abrupt halt and the rest of the insert (1370 was  t o t a l l y unrelated to i t .  The hsp70 coding region was  bp)  further analyzed  and discussed e a r l i e r i n this thesis. Due  to the unusual nature of the insert i n pTHS70.7, two other trout  cDNA l i b r a r i e s were screened cDNAs.  for the presence of other such "fusion"  The probe used for this purpose consisted of 170 bp of hsp70  sequence and 690 bp of the unassigned sequence from pTHS70.7.  The two  new  cDNA l i b r a r i e s were made, from mRNA of arsenite-induced RTG-2 c e l l s , using the double t a i l i n g method. A high density screen of these l i b r a r i e s revealed the presence of a number of clones homologous to the probe.  A l l of these clones were analyzed  by r e s t r i c t i o n mapping which proved them to be i d e n t i c a l to the unassigned sequence from pTHS70.7. by nucleotide sequencing.  One of the new  clones, pT31, was  studied further  The p a r t i a l r e s t r i c t i o n maps and sequencing  strategies for the right half of THS70.7 and T31 are shown i n Figure 33. The s i m i l a r i t y of the two clones was sequences were compared.  There was  further enhanced when their nucleotide base for base sequence identity between  T31 and the right half of THS70.7, except that the ends of these sequences varied i n length by a few bases.  For this reason, only the t o t a l base  sequence for T31 i s presented here (Figure 34).  In addition, the 5  ends of the two sequences are compared i n Figure 35.  1  An interesting  and  3'  - 123  Figure 33. P a r t i a l r e s t r i c t i o n map  -  and strategy used to determine the  nucleotide sequences of THS70.7 and T31 cDNAs. the d i r e c t i o n of sequencing  Arrows represent  from Klenow-labelled  fragments,  using either the chemical cleavage method (squares) or the dideoxy termination method ( c i r c l e s ) .  The lengths of the arrows  represent the actual number of nucleotides sequenced from each site.  The boxed regions represent the cDNA sequences whereas  the thin lines represent pBR322 DNA.  The hatched  area  represents part of the hsp70 coding region from THS70.7. r e s t r i c t i o n s i t e s are: Sm,  Smal; T, TagI.  The  A, A v a i l ; B, BamHI; P, PstI; S, SauIIIA;  THS70.7  B  Sm  Sm  B  p  T31  200  bp  -  -  124  T31 M  N  V  C T G C A G G G G G G G G G G G C G G G G G G G C C C A T A A G C G C T A ACT T A AC.GGT T G T G G T A T T A C G C C T G A T A TGAT T T A A C G T G C C G A T G A A T T AC 15 S  H  D  N  W  30 S  A  1  L  A  15 H  I  G  K  P  60  E  E  L  D  T  S  75 A  R  N  A  G  90 A  L  T  R  TCTCACGATAACTGGTCAGCAATTCTGGCCCATATTGGTAAGCCCGAAGAACTGGATACTTCGGCACGTAATGCCGGGGCTCTAACCCGC 105 R  R  E  I  R  120 D  A  A  T  L  135  L  R  I  G  I  150  A  Y  G  P  G  G  165 M  S  L  R  E  180 V  T  A  W  CGCCGCGAAATTCGTGATGCTGCAACTCTGCTACGTCTGGGGCTGGCTTACGGCCCCGGGGGGATGTCATTACGTGAAGTCACTGCATGG 195  210  225  240  255  270  A O L H D V A T L S D V ' A L L K R L R N A A D W F G I L A A GCTCAGCTCCATGACGTTGCAACATTATCTGACGTGGCTCTCCTGAAGCGGCTGCGGAATGCCGCCGACTGGTTTGGCATACTTGCCGCA 285 300 3 15 330 3J5 360 Q  T  L  A  V  CAAACACTTGCTGT  R  A  A  V  375 G  G  T  A  E  T  G  C  T  S  G  K  R  L  R  L  V  D  G  T  A  I  S  G  P  G  ACGCGCCGCAGTTACGGGTTGT.ACAAGCGGAAAGAGATTGCGTCTTGTCGATGGAACAGCAATCAGTGGCCCCGGG 390 W  R  L  H  M  105 G  Y  D  P  H  120 T  C  O  F  T  D  ISO  135 F  E  L  T  D  S  R  D  A  GGCGGCACCGCTGAATGGCGACTACATATGGGATATGATCCTCATACCTGTCAGTTCACTGATTTTGAGCTAACCGACAGCAGAGACGCT 465  480  495  510  525  510  E R L O R F A ' O T A D E I . R I A O R G F G S R P E C I R S L GAACGGCTGGACCGATTTGCGCAAACGGCAGACGAGATACGCATTGCTGACCGGGGATTCGGTTCGCGTCCCGAATGTATCCGCTCACTT S55 570 585 600 615 G30 A F G E A D Y I V R V H W R G L R W L T A E G M R F D M M G GCTTTTGGAGAAGCTGATTATATCGTCCGGGTTCACTGGCGAGGATTGCGCTGGTTAACTGCAGAAGGAATGCGCTTTGACATGATGGGT 615 660 675 690 705 720 F L R G L D C G K N G E T T V M I G N S G N K K A G A P F P TTTCTGCG.CGGGCTGGATTGCGGTAAGAACGGTGAAACCACTGTAATGATAGGCAATTCAGGTAATAAAAAAGCCGGAGCTCCCTTTCCG 735 750 765 780 795 810 A R L I A V S L P P E K A L I S GCACGTCTCATTGCCGTATCACTTCCTCCCC.AAAAAGCATTAATCAGTAA 825 840 855  K T R L L S E N R R K G R V AACCCGACTGCTCAGCGAGAATCGTCGAAAAGGACGAGTA 870 885 900  V 0 A E T L E A A G H V L L L T S L P E D E Y 5 A E 0 V A D GTTCAGGCGGAAACGCTGGAAGCAGCGGGCCATGTGCTATTGCT AACATCA7TACCGGAAGATGAATATTCAGCAGAGCAAGTGGCTGAT 915 930 945 960 975 990 C Y R L R W O I E L A F K R L K S L L H L D A L R A K E P E T G T T A C C G T C T G C G A T GGCA A A T TGA A C T G G C T T T T A A G C G G C T C A A A A G T T T G C T G C A C C T G G A T G C T T T G C G T G C A A AGGA A C C T G A A 1005 1020 1035 1050 1065 1080 L A K A W I F A N L L A A F L I D D I I S H R W I 5 P P E V C T C G C G A A A G C G T G G A T ATT T G C T A A T C T AC T C G C C G C A TT TT T A A T TGA CG AC A T A A TC AGCC A TCGC T GGA T T T C C C C C C C A G A A G T G 1095 1110 1125 1140 1155 1170 R I R K E E L T R C G E * C G G A T C C G A A A A G A A G A A C T A A C T C G T T G T GG A G A A T A AC A A A A A T GGT C A T C T GGAGC T T AC AGGT GGCC A T T C G T G G G A C AGT A T C C C 1185  1200  1215  1230  1245  1260  TGACAGCCTACAAAACGCAATTGAAGAACGCGAGGCATCGTCTTAACGAGGCACCGAGGCGTCGCATTCTTCAGATGGTTCAACCCTTAA 1275  1290  1305  1320  1335  1350  GTTAGCGCTTATGGGGGGGGGCCCC 1360 1370  Figure 34. Nucleotide sequence for T31 with i t s predicted amino acid sequence.  The single l e t t e r amino acid code has been given i n  the legend to Figure 18.  - 125 -  ro  EH EH -  CJ CJ CJ  O CJ CJ O CJ O CJ  EH  EH  n  cj <  CJ  EH EH  u cj cj CJ u CJ o CJ < <  EH EH CJ  EH EH CJ  a <  < < EH EH CJ CJ U  EH EH CJ U CJ  cj cj £1 XI (71  (Tl  CM  CN)  a  CJ EH EH CJ CJ CJ  EH EH O O CJ  EH EH U  EH EH CJ  EH CJ CJ U CJ  CJ CJ CJ CJ  < < <  < 2 EH EH < CJ CJ CJ CJ CJ CJ CJ CJ CJ  Figure  35. The i n v e r t e d repeat at l e a s t 25-31 bp.  <  U  u CJ  o f T31.  The l e n g t h o f the p e r f e c t repeat i s  The unusual number o f GC p a i r s at both the  5' and 3' ends may e x p l a i n how t h i s element was r e a d i l y cloned i n t o the P s t I s i t e o f pBR322.  - 126  f i n d i n g was  -  the i n d e n t i f i c a t i o n o f a p e r f e c t i n v e r t e d r e p e a t  the T 3 1 - l i k e  sequences ( F i g u r e 35).  One  o f the c h a r a c t e r i s t i c s of mobile  elements i s the o c c u r r e n c e of an i n v e r t e d repeat DNA .  T h i s may  1  e x p l a i n how  the T 3 1 - l i k e  the hsp70 sequence of THS70.7. at  at the ends of a r e g i o n  sequence i n s e r t e d i t s e l f  promoter l i k e sequences were i d e n t i f i e d  long open r e a d i n g region contained polyadenylation stop codon.  frame was  present  both an ATG  start  s i t e and  not be  within  T h i s 375  a TAA  valid.  i n the T31  element,  amino a c i d  stop codon.  was  sent  to  A search was  conducted i n t h e i r p r o t e i n  hypothetical protein.  no  2538 sequences searched, the  homologies were found i n the  to the IS4 h y p o t h e t i c a l p r o t e i n I from E. c o l i . 2  IS-like qualities homology to the  TABLE VI.  (see Table VI) of T31 coli  IS4 was  Comparison of T31  not  to  a  would suggest that the  Length Major ORF I n v e r t e d Repeat  was  t r o u t DNA  subjected  and  RNA  best  The limited  IS4  E.coli  1347 365 31  bp aa bp  1428 442 18  to f u r t h e r a n a l y s i s by u s i n g  ( r e s u l t s not  Although  coincidence.  T31  T31  the  the  sequence database f o r homology to the T31  homology was  long  Research Foundation at the Georgetown U n i v e r s i t y  Center i n Washington, D.C.  extensive  one  No  i d e n t i f i e d on the 3' s i d e of  h y p o t h e t i c a l p r o t e i n sequence f o r T31  National Biomedical Medical  ( F i g u r e 34).  s i g n a l (AAUAAA) c o u l d be  The  of  However, s i n c e no d u p l i c a t i o n i s observed  the s i t e of i n t e g r a t i o n , the l a t t e r e x p l a n a t i o n may  A l t h o u g h no  at the ends o f  shown).  IS4  2  bp aa bp  i t as a probe a g a i n s t  H y b r i d i z a t i o n was  not d e t e c t e d  in  - 127  either case.  -  The most l i k e l y explanation  for these negative results i s  that the T31-element did not orginate i n the trout genome, but from the chromosome of the host s t r a i n (E. c o l i RR1) procedure.  during the  transformation  To further investigate this phenomenon, E. c o l i B genomic  (Sigma Ltd.) was  DNA  digested with several d i f f e r e n t r e s t r i c t i o n enzymes and  Southern blot analysis carried out.  When probed with the T31 sequence,  several d i s t i n c t bands were revealed indicating the presence of T31-like elements at several locations i n the E. c o l i genome (Figure 36). conclusion, the T31  In  sequence has been tentatively i d e n t i f i e d as a  prokaryotic  IS-element.  These results should also serve to warn other  researchers  about one of the several artefacts that can be encountered  during cloning procedures.  Shapiro, J.A. Press.  (editor).  1983.  Mobile Genetic Elements, Academic  Klaer, R. , S. Kuhn, E. Tillmann, H.-J. 1981. Mol. Gen. Genet. 181: 169-175.  F r i t z , and P. Starlinger.  - 128.. -  F i g u r e 36. Southern b l o t a n a l y s i s of E . c o l i genomic DNA. (lanes  1-5,  8, and 9) and pT31  DNA  (lanes 6 and 7) was  from E . c o l i digested with  a v a r i e t y o f r e s t r i c t i o n enzymes, f r a c t i o n a t e d on a 0.7% g e l , and t r a n s f e r r e d to NC paper.  The probe used  [ P ] l a b e l l e d P s t I fragments from T31. 3 2  agarose  was  The d i g e s t s i n (A)  were performed such t h a t fragments from w i t h i n T31 were liberated.  In c o n t r a s t ,  the d i g e s t s i n (B) were chosen t o  l i b e r a t e fragments c o n t a i n i n g whole c o p i e s  o f T31.  The  r e s t r i c t i o n enzymes (with expected i n t e r n a l fragment s i z e ) a r e as f o l l o w s :  (1) H i n f l ,  PstI/BamHI, 483 bp;  283 bp;  (2) P s t l / R s a l , 316 bp;  (4) D d e l , 599 bp;  (3)  (5) BamHI/Rsal, 800  bp.  Lanes  (6) BamHI/Rsal and (7) P s t I were c o n t r o l d i g e s t s o f pT31.  Lanes  (8) H i n d l l l and  copies  (9) P v u l i n d i c a t e t h a t T31 i s present  i n the E . c o l i genome.  d i g e s t o f phage lambda DNA. Jones).  in 3  S i z e markers are from a H i n d i I I (Southern b l o t c o u r t e s y  of D.  -  128 A  A  B 1  2  3  4  5  8  6 7  H  ~ II  2X7  JL3— w -  •I  •"> 06-  0.6—  9  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0096634/manifest

Comment

Related Items