UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on an inducible gene system : the heat shock response in trout cells Kothary, Rashmikant 1984

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1984_A1 K68.pdf [ 9.7MB ]
Metadata
JSON: 831-1.0096634.json
JSON-LD: 831-1.0096634-ld.json
RDF/XML (Pretty): 831-1.0096634-rdf.xml
RDF/JSON: 831-1.0096634-rdf.json
Turtle: 831-1.0096634-turtle.txt
N-Triples: 831-1.0096634-rdf-ntriples.txt
Original Record: 831-1.0096634-source.json
Full Text
831-1.0096634-fulltext.txt
Citation
831-1.0096634.ris

Full Text

STUDIES ON AN INDUCIBLE GENE SYSTEM: THE HEAT SHOCK RESPONSE IN TROUT CELLS by RASHMIKANT KOTHARY B.Sc, The University of B r i t i s h Columbia, 1 9 7 9 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES Department of Biochemistry We accept t h i s thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA June 1 984 © Rashmi K. Kothary, 19'84 I n p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f t h e r e q u i r e m e n t s f o r an a d v a n c e d d e g r e e a t t h e U n i v e r s i t y o f B r i t i s h C o l u m b i a , I a g r e e t h a t t h e L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and s t u d y . I f u r t h e r a g r e e t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g o f t h i s t h e s i s f o r s c h o l a r l y p u r p o s e s may be g r a n t e d by t h e h e a d o f my d e p a r t m e n t o r by h i s o r h e r r e p r e s e n t a t i v e s . I t i s u n d e r s t o o d t h a t c o p y i n g o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l n o t be a l l o w e d w i t h o u t my w r i t t e n p e r m i s s i o n . D e p a r t m e n t o f Biochemistry  The U n i v e r s i t y o f B r i t i s h C o l u m b i a 1956 Main Ma l l V a n c o u v e r , Canada V6T 1Y3 June 19, 1984 A b s t r a c t The heat shock phenomenon has been c h a r a c t e r i z e d i n c u l t u r e d f i b r o b l a s t s of the rainbow t r o u t , Salmo g a i r d n e r i i . The response was e l i c i t e d by one of two methods: temperature e l e v a t i o n or sodium a r s e n i t e exposure. The s t r e s s s i t u a t i o n s r e s u l t e d i n the r a p i d expression of a set of novel polypeptides, the heat shock polypeptides (hsps), normally absent i n t r o u t c e l l s . At l e a s t s i x hsps have been i d e n t i f i e d and molecular weights assigned; these are r e f e r r e d to as hsp30, hsp32, hsp42, hsp62, hsp70, and hsp87. T r a n s l a t i o n a l c o n t r o l on p r e - e x i s t i n g mRNAs was observed i n c e l l s under prolonged a r s e n i t e exposure. The heat shock response i s a r e v e r s i b l e process i n t r o u t c e l l s . Two cDNAs, THS70.7 and THS70.14, encoding p a r t i a l i n f o r m a t i o n f o r two d i s t i n c t species of t r o u t hsp70 were i s o l a t e d and c h a r a c t e r i z e d . These sequences are i d e n t i c a l at 73.3% of the n u c l e o t i d e p o s i t i o n s i n t h e i r regions of overlap, and t h e i r degree of sequence conservation at the polypeptide l e v e l i s 88.1%. The two derived t r o u t hsp70 polypeptide sequences show extensive homology w i t h amino a c i d sequences f o r hsp70 from Drosophila and yeast. Southern b l o t a n a l y s i s of t r o u t t e s t i s DNA re v e a l s a small number of bands h y b r i d i z i n g to the hsp70 genes i n t h i s s p e c i e s . The t r o u t hsp70 cDNA sequences c r o s s - h y b r i d i z e w i t h r e s t r i c t i o n fragments i n genomic DNA from HeLa c e l l s , bovine l i v e r , nematodes, and Drosophila. Northern b l o t a n a l y s i s of RNA from arsenite-induced RTG-2 c e l l s (the t r o u t c e l l l i n e ) , using the t r o u t hsp70 cDNAs as probes, re v e a l s the presence of three hsp70 mRNA species. Both heat shock and sodium a r s e n i t e r e s u l t i n r a p i d synthesis of t r o u t hsp70 mRNA. S i m i l a r l y the r e p r e s s i o n of hsp70 mRNA i s very r a p i d , e s p e c i a l l y during recovery from a temperature s t r e s s . An a r t i f a c t of cDNA c l o n i n g was i d e n t i f i e d , i . e . an IS-element (named T31) was i s o l a t e d and c h a r a c t e r i z e d as o r g i n a t i n g from a t r o u t cDNA l i b r a r y . However, f u r t h e r a n a l y s i s proved T31 to be a p r o k a r y o t i c mobile element that had i n s e r t e d i t s e l f i n t o pBR322 during the pre p a r a t i o n of the cDNA l i b r a r y . - i v -TABLE OF CONTENTS Abst r a c t i i L i s t of Tables i x L i s t of Figures x Abbreviations • • x i i Acknowledgements • x i v I . INTRODUCTION 1 1.1 The Heat-Shock Response: General C h a r a c t e r i s t i c s 1 1.2 H i s t o r i c a l P erspective 1 1.3 Mechanisms of Induction 2 1.4 Heat-Shock P r o t e i n s 5 1.4.1 Heat-Shock P r o t e i n V a r i a n t s 6 1.4.2 I n t r a c e l l u l a r L o c a l i z a t i o n of the hsps 7 1.4.3 Function of the Heat-Shock P r o t e i n s 8 1.5 Heat-Shock mRNAs 9 1.6 Organization of the Heat-Shock Genes 10 1.6.1 The Heat-Shock Genes 10 1.6.2 The Heat-Shock Cognates 12 1.6.3 Chromatin S t r u c t u r e of the Heat-Shock Genes 12 1.7 Regulation of the Heat-Shock Response 14 1.7.1 T r a n s c r i p t i o n a l C o n t r o l 14 - v -1.7.2 T r a n s l a t i o n a l Control 17 1.7.3 Developmental and Tissue S p e c i f i c Expression of hsps... 19 1.8 Heat-Shock Related Responses 20 1.8.1 P h y s i o l o g i c a l Responses 20 1.8.2 Other E f f e c t s of Heat-Shock 20 1.9 The Present I n v e s t i g a t i o n 22 I I . EXPERIMENTAL PROCEDURES 24 2.1 C e l l Culture 24 2.1.1 C e l l Line and Growth Conditions 24 2.1.2 Induction of C e l l s 24 2.2 P r o t e i n A n a l y s i s 25 2.2.1 In v i v o L a b e l l i n g of Pr o t e i n s 25 2.2.2 L o c a l i z a t i o n of L a b e l l e d P r o t e i n s 25 2.2.3 SDS-Polyacrylamide Gel E l e c t r o p h o r e s i s and Autoradiography 26 2.2.4 Densitometry Scanning of Autoradiographs 26 2.3 RNA A n a l y s i s 27 2.3.1 I s o l a t i o n of T o t a l RNA 27 2.3.2 P u r i f i c a t i o n of Polyadenylated RNA 28 2.3.3 Sucrose Density Gradient C e n t r i f u g a t i o n of RNA 28 2.3.4 C e l l - F r e e P r o t e i n T r a n s l a t i o n 30 2.3.5 Trout cDNA L i b r a r i e s 30 2.3.6 Screening of the cDNA L i b r a r i e s 30 2.3.7 RNA Northern and Dot B l o t A n a l y s i s 32 - v i -2.3.8 Cytoplasmic Quick B l o t s of RNA 32 2.4 DNA A n a l y s i s 33 2.4.1. I s o l a t i o n of Plasmid DNA 33 2.4.2 I s o l a t i o n of Genomic DNA 35 2.4.3 R e s t r i c t i o n Endonuclease D i g e s t i o n of DNA 35 2.4.4 Agarose Gel E l e c t r o p h o r e s i s 35 2.4.5 DNA Southern B l o t A n a l y s i s 36 2.5 Maxam and G i l b e r t DNA Sequencing 36 2.5.1 End-Labelling of DNA Fragments 36 2.5.2 P r e p a r a t i v e Acrylamide Gels 37 2.5.3 B a s e - S p e c i f i c Reactions on End-Labelled DNA 37 2.5.4 Sequencing Gels 37 2.6 M13-Dideoxy Sequencing of DNA 39 2.6.1 Cloning of DNA i n t o M13 Phage 39 2.6.2 Pre p a r a t i o n of Single-Stranded Templates 40 2.6.3 'Dideoxy' Chain Termination Reactions 40 2.7 Some General Methods of DNA A n a l y s i s 42 2.7.1 Recovery of DNA from Agarose and Acrylamide Gels 42 2.7.2 P u r i f i c a t i o n of DNA on Mini-Chromatography Columns .... 42 2.7.3 L a b e l l i n g DNA by N i c k - T r a n s l a t i o n 43 2.7.4 H y b r i d i z a t i o n s 43 2.8 C o n s t r u c t i o n and Screening of Trout Genomic L i b r a r i e s 44 2.8.1 I s o l a t i o n of Bacteriophage Lambda DNA 44 2.8.2 P r e p a r a t i o n of Lambda 'Arms' 46 - v i i -2.8.3 P r e p a r a t i o n of 15-20 Kil o b a s e Fragments of Trout DNA .. 46 2.8.4 Pre p a r a t i o n of i n v i t r o Packaging E x t r a c t s 50 2.8.5 L i g a t i o n and Packaging Reactions 51 2.8.6 A m p l i f i c a t i o n of the Lambda L i b r a r i e s 51 2.8.7 Screening of the Lambda L i b r a r i e s 51 2.8.8 Small-Scale Growth of Bacteriophage Lambda 52 I I I . RESULTS 53 3.1 C h a r a c t e r i z a t i o n of the Trout Heat Shock Response at the P r o t e i n Level 53 3.1.1 The Heat Shock Pr o t e i n s of Trout RTG-2 C e l l s 53 3.1.2 Temperature P r o f i l e of the Heat Shock Response 56 3.1.3 E f f e c t of Duration of the Heat Shock 60 3.1.4 Recovery from Heat Shock 60 3.1.5 Sodium A r s e n i t e Concentration Study 60 3.1.6 Recovery from Sodium A r s e n i t e Induction 63 3.1.7 L o c a l i z a t i o n of the hsps 65 3.2 T r a n s l a t i o n a l Regulation of the Heat Shock Response 68 3.2.1 In v i t r o t r a n s l a t i o n of mRNA 68 3.2.2 Sucrose Gradient F r a c t i o n a t i o n of RNA 70 3.3 I s o l a t i o n of the Trout Hsp70 cDNA clones 70 3.3.1 Screening of the Trout cDNA L i b r a r y 70 3.3.2 P r e l i m i n a r y Examination of pTHS70.7 and pTHS70.14 70 3.4 Further A n a l y s i s of THS70.7 and THS70.14 72 3.4.1 Nucleotide Sequences f o r THS70.7 and THS70.14 72 - v i i i -3.4.2 Comparison of Hsp70 from Trout, Drosophila, and Yeast . 76 3.5 Synthesis and Turnover of Trout Hsp70 mRNA 79 3.5.1 RNA Northern and Dot B l o t A n a l y s i s 79 3.5.2 Induction of Hsp70 mRNA 79 3.5.3 Repression of Hsp70 mRNA Synthesis 84 3.6 DNA Southern B l o t A n a l y s i s 88 3.6.1 Detection of M u l t i p l e Hsp70 Genes i n the Trout Genome 88 3.6.2 I d e n t i f i c a t i o n of Hsp70-like Sequences i n Other Genomes 90 3.7 Trout Genomic DNA L i b r a r i e s 93 3.7.1 Screening of the CH4A Lambda L i b r a r y 93 3.7.2 Screening of the L47.1 Lambda L i b r a r i e s 93 IV. DISCUSSION 97 4.1 The Heat Shock Response i n Trout C e l l s 97 4.2 Regulation of the Heat Shock Response 100 4.3 The Conserved Nature of the Heat Shock Response 104 4.4 Genomic Organization of Hsp70 Genes 108 4.5 Conclusions and Future Prospects 109 V. BIBLIOGRAPHY ; 112 VI. APPENDIX - Is T31 an IS-Element? 122 - i x -LIST OF TABLES I. Inducers of the Heat-Shock Response 3 I I . Occurrence of the Heat-Shock Response 6 I I I . DNA B a s e - M o d i f i c a t i o n Reactions f o r M & G Sequencing 38 IV. 'Dideoxy' Mix Composition 41 V. Summary of the Heat Shock Response i n Trout C e l l s 110 VI. Comparison of T31 to IS4 126 - x -L i s t of Figures 1. P u r i f i c a t i o n of Poly A + RNA on an Oligo[dT]-column 29 2. Pre p a r a t i o n of the 'arms' of phage lambda DNA 47 3. Pre p a r a t i o n of 15-20 Kb Mbol fragments of Trout DNA 49 4. The heat-shock p r o t e i n s of Trout RTG-2 c e l l s 54 5. Densitometry scans of the heat shock p r o t e i n s 55 6. Detection of hsps w i t h Coomassie blue s t a i n i n g 57 7. Comparison of Trout and Drosophila hsps on an SDS g e l 58 8. Temperature p r o f i l e of the heat shock response 59 9. Time study of heat-shock 61 10. Recovery from heat-shock 6 2 11. Hsp synth e s i s at v a r y i n g sodium a r s e n i t e concentrations 64 12. Recovery from sodium a r s e n i t e i n d u c t i o n 66 13. S u b c e l l u l a r l o c a l i z a t i o n of the hsps 67 14. In v i t r o t r a n s l a t i o n products of Trout mRNA 69 15. Sucrose gradient f r a c t i o n a t i o n of RNA 71 16. Southern b l o t a n a l y s i s of Trout hsp70 cDNAs 73 17. P a r t i a l r e s t r i c t i o n map and sequencing s t r a t e g y f o r THS70.7 and THS70.14 74 18. Nucleotide sequences f o r THS70.7 and THS70.14 w i t h t h e i r p r e d i c t e d amino a c i d sequences 7 5 19. Comparison of amino a c i d sequence f o r hsp70 from Trout, Drosophila, and Yeast 7 7 2 0. A m a t r i x summarizing the n u c l e o t i d e homology and the amino a c i d homology between the d i f f e r e n t hsp70 sequences 78 - x i -21. Northern b l o t a n a l y s i s of Trout RTG-2 RNA 80 22. Induction of hsp70 mRNA by heat-shock 82 23. Induction of hsp70 mRNA wi t h sodium a r s e n i t e 83 24. Induction of hsp70 mRNA under d i f f e r e n t sodium a r s e n i t e concentrations 85 25. Hsp70 mRNA l e v e l s during recovery from heat-shock 86 26. Hsp70 mRNA l e v e l s during recovery from a r s e n i t e shock 87 27. Southern b l o t a n a l y s i s of genomic DNA from t r o u t t e s t i s 89 28. E f f e c t of washing stringency on s i g n a l d e t e c t i o n from genomic Southern b l o t s 91 29. Southern b l o t a n a l y s i s of genomic DNA from v a r i o u s sources 92 30. Southern b l o t a n a l y s i s of Trout genomic clones 94 31. Southern b l o t a n a l y s i s of Mbol p a r t i a l fragments from Trout genomic DNA 96 32. Model f o r the r e g u l a t i o n of the Heat Shock Response 105 33. P a r t i a l r e s t r i c t i o n map and sequencing s t r a t e g y f o r THS70.7 and T31 123 34. Nucleotide sequence f o r T31 wi t h i t s p r e d i c t e d amino a c i d sequence 124 35. Inverted repeats of T31 125 36. Southern b l o t a n a l y s i s of E. c o l i genomic DNA 128 - x i i -Abbreviations APS ammonium persulphate ATP adenosine triphosphate bisacrylamide N,N'-methylene bisacrylamide bp base pairs BSA bovine serum albumin CAA cas-amino acids cDNA complementary DNA CHC13 chloroform cpm counts per minute DAP diaminopimelic acid ddNTP dideoxyribonucleoside triphosphate DE diethylaminoethyl DMS dimethylsulphate DMSO dimethylsulphoxide dNTP deoxyribonucleoside triphosphate DNA deoxyribonucleic acid DTT dithiothreitol EDTA ethylenediamine tetraacetate, disodium salt Gu'HCl guanadinium chloride Hepes N-2-hydroxyethylpiperazine-N1-2-ethanesulfonic acid HZ hydrazine IPTG isopropylthiogalactoside - x i i i -Kb k i l o b a s e s Kd k i l o d a l t o n s LB L u r i a - B e r t a n i mA milliamperes mRNA Messenger RNA NC n i t r o c e l l u l o s e PEG polyethylene g l y c o l pfu plaque forming u n i t s RF r e p l i c a t i v e form RNA r i b o n u c l e i c a c i d RPC reverse phase chromatography rpm r e v o l u t i o n s per minute SDS sodium dodecyl sulphate TEMED N,N,N',N',-tetramethylethylene diamine T r i s t r i s (hydroxymethyl) aminomethane U u n i t s UV u l t r a v i o l e t V v o l t s W watts X-gal 5-bromo-4-chloro-3-indolyl-B-D-galactoside - xiv -Acknowledgements First and foremost, I would like to acknowledge the support of my supervisor, Dr. Peter Candido, whose patience and invaluable discussions were greatly appreciated. Second, the assistance of many colleagues played a crucial role in the development of this thesis; my thanks to Jane Baker, Balwant Bhullar, Jeff Hewitt, Chris Kreis, Anne Rose, Colin Hay, Elizabeth Burgess, Roland Russnak, Rob Kay, and in particular Don Jones (without his help, many parts of this thesis would not have been possible). Third, I thank the members of the Biochemistry Department for creating an exciting environment in which to work and play. Last but not least, I thank Ms. Debbie Bunyak for typing this thesis. - X V -DEDICATION to my parents f o r w a i t i n g so long - 1 -I. INTRODUCTION 1.1 The Heat Shock Response: General C h a r a c t e r i s t i c s The heat shock response provides an e x c e l l e n t system f o r the study of the processes which accompany r a p i d gene i n d u c t i o n i n e u k a r y o t i c c e l l s . When organisms are subjected to a heat-shock, t r a n s c r i p t i o n of most genes i s suppressed and the expression of a novel set of p r o t e i n s i s enhanced (reviewed i n 1-3). These induced p r o t e i n s are termed the heat-shock polypeptides (hsps). A v a r i e t y of agents a l s o e l i c i t the same response, suggesting that the heat shock response i s probably a r e a c t i o n to metabolic s t r e s s r a t h e r than to temperature per se. However, si n c e the response of c e l l s to d i f f e r e n t s t r e s s s t i m u l i i s so s i m i l a r , the term "heat shock response" i s used to describe the general phenomenon. S i m i l a r l y , "heat-shock p o l y p e p t i d e s " i s used to describe the p r o t e i n s induced by these d i f f e r e n t agents. In a d d i t i o n to the r a p i d i n d u c t i o n and t r a n s c r i p t i o n a l c o n t r o l , the heat shock response i s c h a r a c t e r i z e d by the presence of a t r a n s l a t i o n a l c o n t r o l mechanism. F i n a l l y , the heat shock response i s c h a r a c t e r i z e d by i t s h i g h l y conserved nature. The phenomenon i s present i n a l l organisms stud i e d and homology at the molecular l e v e l i s observed. 1.2 H i s t o r i c a l P e r s p e c t i v e The discovery of the heat shock response dates back to 1962, when F. R i t o s s a f i r s t observed the changes i n p u f f i n g patterns of the polytene chromosomes of Drosophila b u s c k i i upon temperature e l e v a t i o n ( 4 ) . This - 2 -discovery was followed up by reports c h a r a c t e r i z i n g the p u f f i n g a c t i v i t y induced by heat-shock (5-8). Thus, f o r almost ten years a f t e r i t s d i s c o v e r y , most of the data on the heat shock response came from c y t o l o g i c a l s t u d i e s on the polytene chromosomes of Drosophila s a l i v a r y glands. Due to the l i m i t a t i o n s of the a v a i l a b l e techniques, s t u d i e s of the i n d u c t i o n mechanism or of the f u n c t i o n of the heat shock response were not attempted. In 1974, T i s s i e r e s e_t a l . (9) reported the i n i t i a l r e s u l t s from studies on the molecular e f f e c t s of the heat shock response. Dramatic changes i n p r o t e i n synthesis were c o r r e l a t e d w i t h the p u f f i n g a c t i v i t y of polytene chromosomes from heat-shocked D r o s o p h i l a . These changes included heat-shock induced synthesis of a novel set of polypeptides and repressed synthesis of the normal complement of p r o t e i n s . Soon a f t e r , heat-shock induced p u f f s were shown to be s i t e s of a c t i v e genes r e s p o n s i b l e f o r the production of hsp mRNA (10-13). The c l o n i n g of DNA from these puff s i t e s was soon to f o l l o w and the f i r s t heat-shock induced sequences to be cloned were the a B - r e p e t i t i v e u n i t s of the 87C1 locus (14, 15). As i t turned out, the afcS u n i t s d i d not code f o r any of the known hsps. Genes coding f o r the hsps were soon cloned and analyzed (16-19). I t was 1978 before studies on the heat-shock phenomenon i n organisms other than Drosophila began i n earnest. Since then, the occurrence of the heat shock response i n a wide v a r i e t y of organisms has been reported (reviewed i n r e f . 1, a l s o see Table I I ) . 1.3 Mechanisms of Induction As the name i m p l i e s , the heat shock response i s induced by exposure of - 3 -c e l l s to s l i g h t l y elevated temperatures. However, the response i s not l i m i t e d to temperature e l e v a t i o n ; a growing l i s t of a l t e r n a t i v e s t i m u l i are being discovered (see Table I ) . Due to the v a r i e t y of inducing agents and the r a p i d response of c e l l s to these p e r t u r b a t i o n s , the existence of a common c e l l u l a r t a r g e t i s l i k e l y . TABLE I. Inducers of the Heat Shock Response Agent Organism Reference Adenylated n u c l e o t i d e s Salmonella typhimurium 21 E. c o l i 21 Amino a c i d analogs Mammalian c e l l s 20 A n t i b i o t i c s Drosophila 5 Cold Tetrahymena 22 Rana c u l t u r e d c e l l s 23 Che l a t i n g agents Chick embryo c e l l s 24-26 D e c i l i a t i o n Tetrahymena 27 Ecdysterone Drosophila 28 Ethanol Chinese hamster c e l l s 29 Heat Drosophila 4 Heavy metals Chick embryo c e l l s 30 Pyrogens (e.g. LSD) Rabbit 31 Recovery from anoxia Drosophila 5 Stress Rat 32 S u l f h y d r y l oxidants Drosophila 21 Chick embryo c e l l s 30 Uncouplers of o x i d a t i v e Drosophila 4, 30 phosphorylation V i r a l i n f e c t i o n Adenovirus/HeLa c e l l s 33 The processes of e l e c t r o n t r a n s p o r t and o x i d a t i v e phosphorylation would seem to be ta r g e t s f o r many of the inducing agents l i s t e d i n Table I. Indeed, e a r l y r e p orts suggested that mitochondria were inv o l v e d i n the i n d u c t i o n mechanism (34, 35). However, the p r e c i s e r o l e of mi t o c h o n d r i a l fu n c t i o n s i n the heat shock response has yet to be determined. Attempts have a l s o been made to i s o l a t e p r e - e x i s t i n g f a c t o r s capable of inducing heat-shock genes. These include the m i t o c h o n d r i a l f a c t o r s that induce the heat-shock p u f f s i n D^ h y d i i (35) and a p r o t e a s e - s e n s i t i v e , heat - 4 -l a b i l e f a c t o r that s p e c i f i c a l l y a c t i v a t e s Drosophila heat-shock genes i n v i t r o (36, 37). These i n v i t r o s t u d i e s , where n u c l e i from normal c e l l s are incubated w i t h cytoplasmic e x t r a c t s from heat-shocked c e l l s , s t r o n g l y support the p o s s i b i l i t y that p r o t e i n f a c t o r s may induce heat-shock genes (36-39). As to how these p r e - e x i s t i n g f a c t o r s are modified upon heat-shock remains to be determined. The heat shock response i s such a complex phenomenon that a simple one step i n d u c t i o n mechanism has to be r u l e d out. A number of changes are observed soon a f t e r a heat-shock. One of these i s the t r a n s l o c a t i o n of a major p r e - e x i s t i n g cytoplasmic p r o t e i n to the nucleus i n heat-shocked Drosophila Kc c e l l s (40). What r o l e i t may have, s t r u c t u r a l l y or oth e r w i s e , i s unknown. Three DNA bindin g p r o t e i n s that are sequence s p e c i f i c f o r a 5'-noncoding region i n the Drosophila hsp70 gene have been i d e n t i f i e d (41). However, since these p r o t e i n s are present i n both normal and heat-induced c e l l s , t h e i r r o l e i n gene a c t i v a t i o n i s not c l e a r . Thus, although the presence of p r o t e i n f a c t o r s i n f l u e n c i n g the heat shock response are being i d e n t i f i e d , t h e i r mode of a c t i o n or indeed how they were a c t i v a t e d i n the f i r s t place remains obscure. Lee e_t a l . (21) have r e c e n t l y suggested that the common f a c t o r among inducers of the heat shock response may be the development of an " o x i d a t i o n s t r e s s " i n c e l l s . During the s t r e s s , adenylated n u c l e o t i d e s accumulate i n the c e l l and may serve to t r i g g e r the heat shock response. This i n t r i g u i n g hypothesis could e x p l a i n the widespread existence of hsps i n both p r o k a r y o t i c and eu k a r y o t i c c e l l s , s ince the n e c e s s i t y f o r p r o t e c t i o n from the adverse p h y s i o l o g i c a l e f f e c t s of excess i n t r a c e l l u l a r oxygen presumably dates from e a r l y e v o l u t i o n a r y times. In a d d i t i o n to the p r e - e x i s t i n g f a c t o r s , there i s evidence that the t r a n s c r i p t i o n a l and t r a n s l a t i o n a l c o n t r o l of the heat-shock genes i s autoregul a t o r y , i . e . the conce n t r a t i o n of f u n c t i o n a l hsps determines the a c t i v i t y of the heat-shock genes (42). The theory put forward i s that i n a normal c e l l a low amount of hsps i s present, t h e i r f u n c t i o n being to ensure that the heat-shock genes are not a c t i v a t e d . However, i f c e r t a i n c o n d i t i o n s i n a c t i v a t e the hsps or cause some c e l l u l a r t a r g e t s to increase the concentration and/or a f f i n i t y of hsp binding s i t e s , then there would be a r a p i d i n d u c t i o n of the heat shock response. Presumably, as enough hsps are synthesized the a c t i v i t y of heat-shock genes would decrease. Other v a r i a b l e s that a f f e c t the i n d u c t i o n mechanism in c l u d e the i n t e n s i t y , d u r a t i o n , and nature of the s t r e s s (42-44). F i n a l l y , adding f u r t h e r complexity, p r e - e x i s t i n g mRNAs are subject to t r a n s l a t i o n a l c o n t r o l during i n d u c t i o n of the heat shock response. Upon exposure to the s t r e s s , the p r e - e x i s t i n g mRNAs are not degraded but maintained i n an i n a c t i v e s t a t e , enabling the heat-shock mRNAs to be r a p i d l y t r a n s l a t e d (13, 45-47). Yeast c e l l s are an exception i n that they do not d i s p l a y t r a n s l a t i o n a l c o n t r o l of p r e - e x i s t i n g mRNAs and seem to degrade them (48). An i n t e r e s t i n g feature of the heat shock response i n Xenopus oocytes i s that the appearance of i t s hsps i s due not to new t r a n s c r i p t i o n a l a c t i v i t y , but to the a c t i v a t i o n of t r a n s l a t i o n of stored hsp mRNAs (47). Thus, i t i s evident that d i f f e r e n t c e l l s have a l t e r e d the heat shock response to s u i t t h e i r own needs. 1.4 Heat-Shock P r o t e i n s The i n d u c t i o n of p r o t e i n synthesis by heat-shock has been p r i m a r i l y - 6 -studied i n the f r u i t f l y , melanogaster. However, t h i s phenomenon has now been observed i n a wide v a r i e t y of organisms (see Table I I ) . TABLE I I . Occurrence of the Heat Shock Response Organism Reference Organism Reference Amoebae 49 Myogenic avian c e l l s 56 C. elegans 50 Salmon embryo c e l l s 57 Chicken embryo 20, 52 Sea u r c h i n embryos 58 f i b r o b l a s t s Slime mold 59 Chinese hamster 51 Soybean 60, 61 ovary c e l l s Tobacco t i s s u e 61 Chironomus 53 c u l t u r e c e l l s Drosophila 4 Tetrahymena 62 E. c o l i 54 S. c e r e v i s i a e 63 HeLa c e l l s 55 Xenopus 47 Several mammalian 20 c e l l l i n e s The major hsps of most organisms f a l l i n t o three c l a s s e s : the small hsps (15 to 30 Kd), the hsp70-like (60 to 70 Kd), and the hsp83-like (80 to 90 Kd) polypeptides. These three c l a s s e s of hsps are s t r o n g l y conserved. Antibodies against the hsp70 and hsp89 from chicken embryo f i b r o b l a s t s c r o s s - r e a c t w i t h t h e i r counterparts from a wide v a r i e t y of organisms (64, and E.A. Burgess, personal communication). S i m i l a r l y , c r o s s - h y b r i d i z a t i o n of hsp70 genes from d i f f e r e n t organisms has been observed (50, 57, 65-68). The small hsps from both T K _ melanogaster and Caenorhabditis elegans share extensive amino a c i d sequence homology w i t h the mammalian a - c r y s t a l l i n s (69, 70). 1.4.1 Heat-Shock P r o t e i n V a r i a n t s The number of hsps induced during s t r e s s has turned out to be greater than o r i g i n a l l y suggested. In Drosophila, when these p r o t e i n s were - 7 -examined by high r e s o l u t i o n 2-dimensional g e l e l e c t r o p h o r e s i s , the a c t u a l number of hsps turned out to be clos e to 50 or more (71). S i m i l a r l y , more than 20 hsp v a r i a n t s have been observed i n rainbow t r o u t t i s s u e c u l t u r e c e l l s (E. A. Burgess, personal communication). Most of these v a r i a n t s f a l l i n t o one of the three c l a s s e s mentioned above and may be a r e s u l t of p o s t - t r a n s l a t i o n a l m o d i f i c a t i o n of an i n i t i a l p olypeptide. The existence of multigene f a m i l i e s f o r p a r t i c u l a r hsps has been observed and thus a number of the p r o t e i n v a r i a n t s could be products of the c l o s e l y r e l a t e d genes. In e i t h e r case, the large number of hsp v a r i a n t s shows the complexity of the heat shock response. Wang ejt a l . (72) have shown that hsp83 and hsp68 of a r s e n i t e t r e a t e d chicken embryonic c e l l s are methylated. They a l s o suggest that t h i s methylation of hsps i s not due to an a c t i v a t i o n of p r e - e x i s t i n g p r o t e i n methylases. Another a l t e r a t i o n of hsps i s v i a phosphorylation (64, 73, 74). 1.4.2 I n t r a c e l l u l a r L o c a l i z a t i o n of the hsps In order to understand the funct i o n s of the hsps, t h e i r i n t r a c e l l u l a r l o c a l i z a t i o n has been examined. Studies on t h i s aspect have been done using a v a r i e t y of techniques i n c l u d i n g s u b - c e l l u l a r f r a c t i o n a t i o n by c e n t r i f u g a t i o n (40, 75-77), m i c r o d i s s e c t i o n of c e l l s (53, 78), d i r e c t autoradiographic a n a l y s i s (75, 78, 79), and immunofluorescence s t a i n i n g (80-82). In gene r a l , the small hsps are found i n the nucleus, the hsp7 0 - l i k e p r o t e i n s i n both the cytoplasm and the nucleus, and the hsp83-like p r o t e i n s e x c l u s i v e l y i n the cytoplasm. In Drosophila, the nuclear hsps are h i g h l y r e s i s t a n t to e x t r a c t i o n w i t h high s a l t concentrations and are ass o c i a t e d w i t h chromatin and n u c l e o l i preparations (40, 75, 76). Upon r e t u r n of the Drosophila c e l l s to normal temperatures, - 8 -the nuclear hsps r e t u r n to the cytoplasm (75). Although these e a r l y r e s u l t s suggested an a s s o c i a t i o n of the hsps w i t h the chromatin, recent data imply a d i f f e r e n t nuclear r o l e f o r some of these p r o t e i n s . For instance, S i n i b a l d i and Mor r i s (77) have reported that the bi n d i n g of c e r t a i n hsps appeared to be p r i m a r i l y to the nuclear s c a f f o l d r a t h e r than to the chromatin of heat-induced Drosophila Kc c e l l s . In a d d i t i o n , immunofluorescent s t a i n i n g of chicken embryo f i b r o b l a s t s w i t h a n t i b o d i e s to t h e i r hsps suggests that chicken hsp89 i s s t r i c t l y cytoplasmic, whereas chicken hsp70 and hsp24 appear to be present throughout the c e l l i n a s s o c i a t i o n w i t h i t s c y t o s k e l e t o n (80, 81). I n d i r e c t immunofluorescence techniques have shown the hsplOO of c e r t a i n mammalian c e l l s to be l o c a l i z e d i n the G o l g i apparatus (82). The p o s s i b l e a s s o c i a t i o n of the heat shock response w i t h e l e c t r o n t r a n s p o r t was discussed e a r l i e r ; r e s u l t s c o n f l i c t i n g w i t h t h i s idea came from autoradiographic and e l e c t r o n microscopic a n a l y s i s of hsp d i s t r i b u t i o n i n heat-induced Drosophila. Velazquez et_ a l . (79) showed that i n s i g n i f i c a n t amounts of the hsps are found i n a s s o c i a t i o n w i t h mitochondria. 1.4.3 Function of the Heat-Shock P r o t e i n s Thus f a r , hsp c h a r a c t e r i z a t i o n has not revealed the true nature of t h e i r r o l e s ; however, since these p r o t e i n s occur i n such diverse organisms, t h e i r r o l e s are l i k e l y to be of a fundamental nature w i t h i n c e l l s . A general homeostatic f u n c t i o n was po s t u l a t e d f o r the heat shock response f a i r l y e a r l y i n i t s study (83). In the past three to four years, s t u d i e s on a v a r i e t y of organisms have l e d to the conc l u s i o n that hsps confer thermotolerance upon c e l l s (29, 84-88). Induction of hsps by means other than heat has a l s o been shown to induce t r a n s i e n t thermotolerance i n - 9 -Chinese hamster f i b r o b l a s t s (29). A d d i t i o n a l support f o r the p r o t e c t i v e f u n c t i o n of the hsps comes from s t u d i e s on D i c t y o s t e l i u m , where a mutant s t r a i n unable to express hsps i s a l s o unable to induce thermotolerance (87). An i n t e r e s t i n g hypothesis was put f o r t h by Minton (89), who suggested that hsps might c o n t r i b u t e to enhanced thermotolerance i n c e l l s by n o n - s p e c i f i c a l l y s t a b i l i z i n g s t r e s s - s u s c e p t i b l e p r o t e i n s . Other func t i o n s f o r hsps i n c l u d e a r e g u l a t o r y r o l e . In Drosophila, the absence of f u n c t i o n a l hsps (and p a r t i c u l a r l y hsp70) prevents c e l l s from a t t a i n i n g complete recovery a f t e r heat-shock (42). 1.5 Heat-Shock mRNAs During the heat shock response, the dramatic a l t e r a t i o n i n the p a t t e r n of p r o t e i n synthesis i s accompanied by a p a r a l l e l change i n the d i s t r i b u t i o n of ribosomes on polysomes (10). P r e - e x i s t i n g polysomes r a p i d l y d i s s o c i a t e and the ribosomes then form new polysomes. Despite these changes, p r e - e x i s t i n g mRNA i s s t i l l found i n the cytoplasm of heat-shocked c e l l s and can be t r a n s l a t e d i n v i t r o (13, 45-47). Thus the s e l e c t i v e t r a n s l a t i o n of hsp mRNA i n heat-shocked c e l l s i m p l i e s a s p e c i f i c r e c o g n i t i o n of hsp mRNA by the ribosomes. B a l l i n g e r and Pardue (90) have shown p r e - e x i s t i n g mRNAs are present i n heat-shocked Drosophila c e l l s , a s s o c i a t e d w i t h ribosomes and RNP p a r t i c l e s . They suggest that the t r a n s l a t i o n of the 25°C mRNAs may be repressed by a s e l e c t i v e i n h i b i t i o n of t h e i r e l o n g a t i o n . The same co n c l u s i o n was reached by Thomas and Matthews (91) from t h e i r s tudies on heat-shock mRNAs of HeLa c e l l s . There i s one reported s t r u c t u r a l d i f f e r e n c e between 25°C mRNA i n c o n t r o l and induced Drosophila c e l l s . The - 10 -25°C mRNAs i n heat-shocked c e l l s l a c k the a b i l i t y to bind to o l i g o [ d T ] - c e l l u l o s e , suggesting an absence of the normally present poly A t a i l (45). U n l i k e Drosophila, when yeast c e l l s are induced by heat, the p r e - e x i s t i n g mRNAs are not sequestered on polysomes but are allowed to degrade at t h e i r normal rates (48). A c h a r a c t e r i s t i c of hsp mRNAs, at l e a s t i n Drosophila, i s the presence of an unusually long 5'-noncoding r e g i o n . This region v a r i e s from 111 bp to 253 bp i n length (92-94). The leader sequences of hsp70 and small hsp mRNAs from Drosophila have an unusually high (approximately 50%) adenosine content (92, 93); i n c o n t r a s t , the adenosine content of the 5 l -noncoding region of hsp83 i s much lower (94). The long leader sequences of hsp mRNAs may play a r o l e i n the s e l e c t i v e t r a n s l a t i o n of these messages. Although the expression of a l l heat-shock genes appears regulated i n a s i m i l a r manner, there are exceptions. For ins t a n c e , i n Drosophila, the hsp83 polypeptide appears to be present i n normally growing c e l l s (43, 45, 71). In a d d i t i o n , the hsp83 gene i s the only known Drosophila heat-shock gene to c o n t a i n an i n t e r v e n i n g sequence (17). The only other known heat-shock gene to co n t a i n an i n t r o n i s the hspl6 gene of elegans (R. Russnak, personal communication). 1.6 Organization of the Heat-Shock Genes 1.6.1 The Heat-Shock Genes Although the heat shock response has been studied i n a number of organisms (see Table I I ) , the o r g a n i z a t i o n of the hsp genes has been p r i m a r i l y s t u d i e d i n Drosophila. A l l the major heat-shock genes i n D.  melanogaster have been cloned, mapped, and sequenced (16-19, 69, 92-102). - 11 -These genes f a l l i n t o three c l a s s e s : the hsp83 gene which i s present i n a s i n g l e copy at chromosomal locus 63BC (17), the hsp70 genes which are present i n f i v e c o pies, two at locus 87A and three at locus 87C (17, 98), and the small heat-shock genes coding f o r hsp22, 23, 26, 27, a l l present at locus 67B w i t h i n an 11 Kb region (18, 19, 101). In a d d i t i o n , the hsp68 gene i s present i n a s i n g l e copy at locus 95D (17). Each of the hsp70 genes i s organized w i t h i n a 2.5 Kb conserved element c o n s i s t i n g of a 2.1 Kb mRNA coding r e g i o n , and a 0.4 Kb 5' region which i s not t r a n s c r i b e d (96, 97, 99). The hsp70 genes at locus 87A are approximately 1.7 Kb apart and i n opposite o r i e n t a t i o n (101, 103). Two of the hsp70 gene copies at 87C are i n a tandem repeat separated from the t h i r d gene by about 40 Kb of DNA that contains the c»3-repetitive u n i t s (104). Due to the s i m i l a r i t y of these f i v e hsp70 genes i n IK melanogaster, i t has been suggested that the genes at 87A and 87C are not e v o l v i n g independently and that gene conversion has occurred both w i t h i n and between hsp70 l o c i (105). As mentioned e a r l i e r , a l l four small hsp genes i n D^ melanogaster are present i n s i n g l e copies w i t h i n an 11 Kb re g i o n at locus 67B. These four genes have p a r t i a l homology among themselves (69) and may thus be a r e s u l t of d u p l i c a t i o n s of an a n c e s t r a l gene. Very l i t t l e sequence informa t i o n about the hsp genes from other organisms has been reported. The a v a i l a b l e i n f o r m a t i o n can be summarized b r i e f l y . The n u c l e o t i d e sequence of an i n d u c i b l e hsp70 gene from yeast has been reported (65). I t shows about 72% sequence homology to Drosophila hsp70 at the p r o t e i n l e v e l . Very r e c e n t l y , Bardwell and Cra i g (68) reported the n u c l e o t i d e sequence of the c o l i h e a t - i n d u c i b l e dnaK gene and showed i t to be 48% i d e n t i c a l at the polypeptide l e v e l to the hsp70 p r o t e i n of Drosophila. The only other reported sequences f o r hsp genes i s - 12 -by Russnak ejt a l . (70) who presented the cDNA sequences coding f o r hspl6 from Cj_ elegans. I n t e r e s t i n g l y , the C\_ elegans hspl6 and the small hsps from melanogaster both share extensive amino a c i d sequence homology w i t h the mammalian a - c r y s t a l l i n s (68, 70). Study of the genomic o r g a n i z a t i o n of Cj_ elegans DNA has revealed the presence of two (and p o s s i b l y more) c l o s e l y l i n k e d small heat-shock genes (R. Russnak, personal communication). 1.6.2 The Heat-Shock Cognates Several r e p orts have described the presence of heat-shock r e l a t e d genes that are expressed c o n s t i t u t i v e l y at some time during normal development. These genes are not n e c e s s a r i l y induced by heat-shock. The developmentally regulated heat-shock genes w i l l be described i n a separate s e c t i o n . I n g o l i a and C r a i g (68, 102) have reported a number of hsp70-like genes from Drosophila and Sj_ c e r e v i s i a e . These cognate genes are not h e a t - i n d u c i b l e and are normally expressed during development. U n l i k e hsp70, some of these cognate genes have been shown to have large i n t r o n s (102). The f u n c t i o n of these cognate gene products remains to be determined. 1.6.3 Chromatin S t r u c t u r e of the Heat-Shock Genes The changes i n chromatin s t r u c t u r e accompanying gene a c t i v a t i o n have been expressed i n terms of s e n s i t i v i t y to c e r t a i n nucleases (reviewed i n 106). There are three broadly defined l e v e l s of nuclease s e n s i t i v i t y : low l e v e l s e n s i t i v i t y of bulk chromatin, moderate s e n s i t i v i t y of regions encoding gene sequences extending a few Kb i n e i t h e r d i r e c t i o n , and f i n a l l y - 13 -a h y p e r s e n s i t i v i t y i n v o l v i n g small domains u s u a l l y i n the 5' or 3' f l a n k i n g regions of a t r a n s c r i p t i o n a l l y a c t i v e gene. A v a r i e t y of nucleases have been used to measure the s e n s i t i v i t y of chromatin, the most u t i l i z e d ones being deoxyribonuclease I (DNAase I) and micrococcal nuclease (MNase). The chromatin s t r u c t u r e of the major heat-shock genes of Drosophila has been analyzed i n d e t a i l (summarized i n 107). Using an i n d i r e c t end-l a b e l l i n g technique, Wu (108) has demonstrated the presence of DNAase I h y p e r s e n s i t i v e s i t e s 5' to the hsp70 and hsp83 genes i n Drosophila embryos and t i s s u e c u l t u r e c e l l s . These h y p e r s e n s i t i v e s i t e s are present i n both normal and heat-shocked c e l l s ; however, the DNAase I s e n s i t i v i t y of the whole gene i s increased upon i n d u c t i o n (198). S i m i l a r DNAase I h y p e r s e n s i t i v e s i t e s have been demonstrated at or near the 5 1 end of each of the four small heat-shock genes i n Drosophila (109). Upon heat i n d u c t i o n , the heat-shock genes r a p i d l y adopt an open chromatin s t r u c t u r e and t h e i r s e n s i t i v i t y to nucleases i s increased (110). The adoption of the open c o n f i g u r a t i o n may be auto-regulated by the presence or absence of f u n c t i o n a l hsps (42). t As f a r as nucleosome s t r u c t u r e i s concerned, Levinger and Varshavsky (111) have reported that the hsp70 genes of Drosophila co n t a i n h e a v i l y u b i q u i t i n a t e d nucleosomes. This i s i n c o n t r a s t to the general po p u l a t i o n of nucleosomes. I t i s suggested that the nucleosomal p r o t e i n s from the a c t i v a t e d chromosomal region may be p r o t e o l y t i c a l l y removed and thereby cause the increased nuclease s e n s i t i v i t y of the DNA observed i n a c t i v e l y t r a n s c r i b i n g genes (111). Recently, Karpov ejt a l . (112) have reported the s e l e c t i v e removal of histones from the coding region of induced hsp70 genes i n IK_ melanogaster. T h i s , i n a d d i t i o n to the l a c k of histones at the 5' h y p e r s e n s i t i v e s i t e s , - 14 -may be the cause of the increased a c c e s s i b i l i t y to nucleases of these reg i o n s . Mace e_t a l . (113) have demonstrated the presence of an SI n u c l e a s e - s e n s i t i v e s t r u c t u r e a s s o c i a t e d w i t h short d i r e c t repeats of DNA found i n the 5' f l a n k i n g regions of c e r t a i n IK melanogaster heat-shock genes. Since t h i s study was done on i s o l a t e d plasmids c o n t a i n i n g the cloned genes, a p r e c i s e r o l e f o r these SI n u c l e a s e - s e n s i t i v e s t r u c t u r e s has not been determined. 1.7 Regulation of the Heat Shock Response 1.7.1 T r a n s c r i p t i o n a l Control In order to i d e n t i f y the various s i g n a l s necessary f o r proper i n d u c t i o n and t r a n s c r i p t i o n of Drosophila heat-shock genes, hsp70 sequences were introduced i n t o a v a r i e t y of heterologous systems. These included mouse c e l l s (114), r a t c e l l s (115), monkey COS c e l l s (116, 117), Xenopus oocytes (118-120), and yeast c e l l s (121). The expression of these genes was h e a t - i n d u c i b l e i n d i c a t i n g that the i n d u c t i o n mechanisms and c o n t r o l s i g n a l s f o r the heat shock response are conserved between Drosophila and the t e s t e d organism. In a d d i t i o n to the TATA box, an upstream promoter element was discovered. From d e l e t i o n s t u d i e s , a 70 bp s t r e t c h of sequence i n the 5' f l a n k i n g r e gion of the hsp70 gene was determined to be necessary f o r h e a t - i n d u c i b i l i t y , the region spanning -47 to -66 being a b s o l u t e l y necessary (116, 117). Within t h i s short s t r e t c h of DNA l i e s an imperfect i n v e r t e d repeat (92). Pelham (117) searched f o r a s i m i l a r upstream promoter i n other Drosophila heat-shock genes and derived a consensus sequence f o r t h i s element: - 15 -5' CT-GAA—TTC-AG 14-28 bp TATA 3' An imperfect i n v e r t e d repeat i s evident i n the sequence and could play a r o l e i n p r o t e i n r e c o g n i t i o n . Deletions i n t h i s r e gion g r e a t l y decrease the t r a n s c r i p t i o n of the hsp70 gene during heat-shock (117). Pelham and Bienz (119) have constructed a s y n t h e t i c heat-shock promoter element and used i t to confer h e a t - i n d u c i b i l i t y on the herpes simplex v i r u s thymidine kinase gene. Corces et a l . (122) have constructed a f u s i o n gene hy b r i d c o n t a i n i n g 1.3 Kb of the 5' sequence of the Drosophila hsp70 gene j o i n e d to the e n t i r e p r o t e i n - c o d i n g region of a human growth hormone gene. This h y b r i d gene was found to be h e a t - i n d u c i b l e i n mouse c e l l s . The use of such heat-shock promoters i n f u s i o n genes may be p a r t i c u l a r y advantageous i n the c o n t r o l l e d expression of c e r t a i n genes of medical or commercial i n t e r e s t . Recently, the design and c o n s t r u c t i o n of an in-frame f u s i o n between the c e r e v i s i a e hsp90 gene and the c o l i lacZ gene has been reported (123). When t h i s f u s i o n gene was introduced back i n t o yeast on a multicopy plasmid v e c t o r , i t s t i l l e x h i b i t e d h e a t - i n d u c i b i l i t y . Moreover, the fused p r o t e i n product had an a c t i v e 3-galactosidase a c t i v i t y . S i m i l a r l y , a Drosophila hsp70 gene was fused to the Jj^ c o l i 3-galactosidase gene (124) and introduced back i n t o the Drosophila germline by the P-element m i c r o i n j e c t i o n method of Rubin and S p r a d l i n g (125). As expected, the tS-galactosidase a c t i v i t y i n the transformants i s h e a t - i n d u c i b l e . These l a t t e r r e s u l t s should make i t e a s i e r to i n v e s t i g a t e the t r a n s c r i p t i o n a l and t r a n s l a t i o n a l r e g u l a t i o n i n the heat shock response. In a d d i t i o n , developmental and t i s s u e s p e c i f i c expression of these genes can be more r e a d i l y s t u d i e d . A system that seems to have a t o t a l l y d i f f e r e n t t r a n s c r i p t i o n a l c o n t r o l mechanism f o r the heat shock response has been described f o r - 16 -Xenopus oocytes (47). In t h i s system, heat-shock mRNA are present i n normal c e l l s but are stored i n an i n a c t i v e s t a t e by a unique c o n t r o l mechanism. Upon heat-shock, these mRNAs are r a p i d l y a c t i v a t e d and the heat shock response proceeds as u s u a l . This form of c o n t r o l i s presumably an adaptation n e c e s s i t a t e d by the very large s i z e of the oocyte, and the r e s u l t i n g requirement f o r large amounts of hsps w i t h i n a very short time p e r i o d , which could not be s u p p l i e d by t r a n s c r i p t i o n . The mechanism of i n d u c t i o n and the f u n c t i o n of hsps can be e l u c i d a t e d more r e a d i l y through genetic a n a l y s i s . For t h i s purpose, the heat shock response i n c o l i w i l l c e r t a i n l y a t t r a c t more a t t e n t i o n . As mentioned above, a response to heat has been observed i n t h i s microorganism (54). Further a n a l y s i s has revealed the presence of a group of h e a t - i n d u c i b l e p r o t e i n s which are a l l under the t r a n s c r i p t i o n a l c o n t r o l of a s i n g l e gene c a l l e d h i n or htpR (126, 127). Mutations i n t h i s gene w i l l prove i n v a l u a b l e i n p i n - p o i n t i n g the mechanism of i n d u c t i o n and the r o l e of hsps. Four of the h e a t - i n d u c i b l e p r o t e i n s from c o l i have been i d e n t i f i e d : a l y s y l tRNA synthetase, and the groEL, groES, and dnaK gene products (127-129). The l a s t three p r o t e i n s are e s s e n t i a l f o r growth of bacteriophage lambda and mutations i n those genes render the b a c t e r i a temperature s e n s i t i v e f o r growth at 43°C (130-133). Recently, T i l l y et a l . (134) showed that the dnaK p r o t e i n may modulate the heat shock response of E. c o l i . They demonstrated that one of the r o l e s f o r the dnaK p r o t e i n was to shut o f f the response i n E^ c o l i . These l a t t e r r e s u l t s f i t w e l l w i t h those of DiDomenico ejt a l . (42) who suggested an autoregulatory r o l e f o r the hsp70 of Drosophila. These r e s u l t s are even more s t r i k i n g i n l i g h t of the report showing homology between the dnaK p r o t e i n of E^ c o l i and the Drosophila hsp70 (68). - 17 -1.7.2 T r a n s l a t i o n a l C o n t r o l One of the c h a r a c t e r i s t i c s of the heat shock response i s the r a p i d expression of the heat-shock mRNA. Upon heat-shock, p r e - e x i s t i n g polysomes r a p i d l y disaggregate and new polysomes are s e l e c t i v e l y formed on heat-shock mRNA (10). Thus the p r e f e r e n t i a l t r a n s l a t i o n of heat-shock mRNAs may e x p l a i n the r a p i d appearance of hsps i n the stre s s e d c e l l . The h a l f - l i f e of normal mRNA i n yeast c e l l s i s much shor t e r than that i n Drosophila and may e x p l a i n the absence of t r a n s l a t i o n a l c o n t r o l of p r e - e x i s t i n g mRNAs i n yeast (48). In Drosophila, the r e t u r n of heat-shocked c e l l s to t h e i r normal temperature causes r e l e a s e of the t r a n s l a t i o n a l c o n t r o l and p r e - e x i s t i n g mRNAs are no longer s e l e c t i v e l y repressed (45). That these messages are not degraded was a l s o demonstrated by in_ v i t r o t r a n s l a t i o n of mRNA ext r a c t e d from heat-shocked Drosophila c e l l s (13, 45, 46). However, i f ly s a t e s are prepared from heat-shocked Drosophila c e l l s and used f o r the i n  v i t r o t r a n s l a t i o n s t u d i e s , heat-shock messages are p r e f e r e n t i a l l y t r a n s l a t e d (45, 46). In c o n t r a s t , s i m i l a r l y s a t e s from c o n t r o l c e l l s w i l l t r a n s l a t e both normal and heat-shock mRNA (45, 46). The f a c t o r s . res p o n s i b l e f o r the p r e f e r e n t i a l t r a n s l a t i o n of heat-shock mRNA i n heat-shock l y s a t e s have been l o c a l i z e d to the ribosomal f r a c t i o n (134). A d d i t i o n of crude ribosomal f r a c t i o n s from c o n t r o l l y s a t e s to the heat-shock l y s a t e r e l e ases the re p r e s s i o n of normal mRNA t r a n s l a t i o n (134). Glover (135) and Sanders et a l . (136) have demonstrated that the heat-induced r a p i d dephosphorylation of an S 6 - l i k e ribosomal p r o t e i n i n Drosophila c l o s e l y p a r a l l e l s the heat-shock induced breakdown of polysomes, suggesting a p o s s i b l e r e l a t i o n s h i p between the phosphorylation of t h i s p r o t e i n and t r a n s l a t i o n . The response, however, seems to be h e a t - s p e c i f i c - 18 -since other chemical inducers do not cause the same dephosphorylation (187). L i n d q u i s t (48) has shown that p r e - e x i s t i n g mRNAs i n Drosophila can be repeatedly sequestered and released through a number of heat-shock/recovery c y c l e s ; however, the synthesis of hsps g r a d u a l l y decreases i n the presence of actinomycin D. Thus, although normal messages are protected during heat-shock, the reverse i s not t r u e , i . e . heat-shock mRNAs are degraded during recovery. I t has a l s o been demonstrated that the rat e s of i n i t i a t i o n of mRNA t r a n s l a t i o n are comparable f o r both normal and heat-shock mRNAs (48, 137). However, B a l l i n g e r and Pardue (90) have r e c e n t l y reported that the rat e s of both e l o n g a t i o n and i n i t i a t i o n of t r a n s l a t i o n are reduced 15- to 30- f o l d on normal mRNAs compared to heat-shock mRNAs. I t should be noted that the r e g u l a t i o n of t r a n s c r i p t i o n and t r a n s l a t i o n during the heat shock response do not occur independently of each other but are i n f a c t coordinated. I t i s a l s o noteworthy that t h i s s t r e s s response i s not regulated i n an a l l or none manner; the l e v e l of hsp i n d u c t i o n i s dependent on the s e v e r i t y of the s t r e s s . For ins t a n c e , i n D.  melanogaster, the i n t e n s i t y of the response v a r i e s w i t h the temperature of heat-shock and the time of exposure to the s t r e s s (42, 48). In a d d i t i o n , the r a t e of recovery depends on the strength of the i n i t i a l s t r e s s (44). The heat-shock and recovery of Drosophila c e l l s have been shown to be inf l u e n c e d by the con c e n t r a t i o n of f u n c t i o n a l hsps ( e s p e c i a l l y hsp70); f o r ins t a n c e , i f the production of hsps i s blocked, t r a n s c r i p t i o n of heat-shock mRNAs continues and t h e i r s t a b i l i t y i s increased (42). However, as soon as f u n c t i o n a l hsps are present, t r a n s c r i p t i o n of heat-shock mRNAs i s reduced and t h e i r s t a b i l i t y decreases (44). From the above d i s c u s s i o n i t should be f a i r l y apparent that the - 19 -regul a t i o n of the heat shock response i s dependent on a v a r i e t y of factors, including the i n t e n s i t y , duration, and nature of the stress, and the presence of functional hsps for autoregulation and recovery. In addition, pre-existing mRNAs are subject to t r a n s l a t i o n a l c o n t r o l . It i s also obvious that the rules governing t h i s regulation are not r i g i d and that there are exceptions, e.g. storage of heat-shock mRNA during normal growth i n Xenopus oocytes (47) and the absence of t r a n s l a t i o n a l control on pre-existing mRNAs i n heat-shocked yeast c e l l s (48). Thus the regulation of the heat shock response i s a complex process with manifestations at several stages of gene expression. 1.7.3 Developmental and Tissue S p e c i f i c Expression of hsps U n t i l recently, i t was thought that the heat shock response occurred i n a l l tissues and at a l l stages of development. There i s now evidence f o r developmental regulation of the hsps. For example, Drosophila preblastoderm embryos have a low i n d u c i b i l i t y of hsps (138, 139). Si m i l a r l y , i n developing sea urchins hsps are only inducible i n post-hatching stages (140). Recently, Zimmerman et a l . (141) reported the accumulation of mRNAs for Drosophila hsps 83, 28, and 26 i n adult ovaries. These messages were detected during normal development and were abundant i n embryos u n t i l the blastoderm stage, suggesting the presence of d i f f e r e n t i a l c ontrol of heat-shock gene expression during development (141). Another such spontaneous expression of hsps i s reported for mouse embryonal carcinoma c e l l s , and for ectoderms from day 8 mouse embryos (142). A l i n k between hsps and v i r a l transformation has also been found. For instance, mammalian hsp70 synthesis i s induced by an early gene product of adenovirus (33) and by papovavirus i n f e c t i o n (143). In addition the - 20 -chicken hsp89 has been shown to bind to t y r o s y l p r o t e i n kinases of avian sarcoma v i r u s e s (73, 74). The ecdysterone induced synthesis of the small hsps i n Drosophila (28) emphasizes the d i f f e r e n t i a l c o n t r o l of the heat shock response and thus adds to the already complex nature of i t s r e g u l a t i o n . 1.8 Heat-Shock Related Responses 1.8.1 P h y s i o l o g i c a l Responses Severe heat-shock of e a r l y Drosophila embryos r e s u l t s i n developmental abn o r m a l i t i e s c a l l e d phenocopies. These are most l i k e l y caused by a disturbance i n gene expression due to the heat-shock. Studies of t h i s phenomenon can be used to i d e n t i f y c r i t i c a l steps i n the r e g u l a t i o n of morphogenesis. Attempts i n t h i s d i r e c t i o n have been made by M i t c h e l l and Petersen (144). A m i l d heat pretreatment of Drosophila larvae p r o t e c t s them from phenocopy i n d u c t i o n (84).. Other p h y s i o l o g i c a l responses to heat-shock i n c l u d e the adaptation to thermal s t r e s s which leads to a t r a n s i e n t r e s i s t a n c e to heat. This phenomenon has been discussed above. 1.8.2 Other E f f e c t s of Heat-Shock A v a r i e t y of changes caused by the heat-shock phenomenon have not yet been discussed. These i n c l u d e : p r o t e i n m o d i f i c a t i o n s , metabolic p e r t u r b a t i o n s , c e l l c y c l e s y n c h r o n i z a t i o n , and d i s r u p t i o n of cy t o s k e l e t o n s t r u c t u r e . One of the p r o t e i n m o d i f i c a t i o n s already mentioned i s the heat-induced dephosphorylation of an S 6 ~ l i k e ribosomal p r o t e i n i n Drosophila (135, 136). This change has been c o r r e l a t e d w i t h the i n i t i a l breakdown of p r e - e x i s t i n g polysomes i n heat-shocked c e l l s . However, si n c e - 21 -canavanine and sodium arsenite do not cause dephosphorylation of the S6-like protein (187), and yet produce the same t r a n s l a t i o n a l regulation as heat, t h i s p rotein modification may be an e n t i r e l y separate response to heat. That protein phosphorylation may play a r o l e i n the regulation of gene expression i s supported by the work of Caizergues-Ferrer et^ a l . (145) who showed that ribosomal RNA synthesis was induced i n Chinese hamster ovary c e l l s recovering from heat-shock. The induction of RNA synthesis was correlated with the dephosphorylation of two nuclear proteins. The e f f e c t of heat-shock on histones i s quite s p e c i f i c . The rate of Drosophila H2B synthesis i s increased while that of the other core histones i s decreased (136, 145). In Tetrahymena heat-shock or d e c i l i a t i o n induce the phosphorylation of histone Hi (147). The phosphorylation of H2A and H4 i n heat-shocked Drosophila c e l l s has also been reported (135). In addition, methylation of H2B and H3 i s altered by heat-shock (148, 149), and extensive deacetylation of core histones i s also observed (149). The l a t t e r change appears to be a consequence of the heat shock response rather than a part of the induction mechanism for hsps since hyperacetylation of the histones i n trout c e l l s does not prevent hsp synthesis (E.A. Burgess, personal communication). The v a r i e t y and r a p i d i t y of heat-induced histone modifications suggests t h e i r possible involvement i n regulation of the t r a n s c r i p t i o n a l response. Under s t r e s s f u l s i t u a t i o n s , c e l l s would be expected to economize and thus r e - d i r e c t t h e i r metabolism towards energy conservation and/or production. In support of t h i s expectation, Wilhelm et a l . (150) have reported the accumulation of glycogen i n heat-shocked Tetrahymena. In Drosophila and other mammalian c e l l s , heat-shock blocks the assembly of heterogeneous nuclear RNA (hnRNA) into i t s normal nuclear ribonucleoprotein - 22 -(RNP) form (151). This block could be in v o l v e d i n the s e l e c t i v e processing of heat-shock mRNAs. Other e f f e c t s of heat-shock includ e the i n h i b i t i o n of t u b u l i n , synthesis which may account f o r the i n d u c t i o n of c e l l synchrony i n Tetrahymena (152). In Drosophila and baby hamster kidney c e l l s , the vimentin c y t o s k e l e t o n d i s i n t e g r a t e s a f t e r heat-shock and aggregates at the nucleus (153). 1.9 The Present I n v e s t i g a t i o n At the time t h i s p r o j e c t was i n i t i a t e d ( l a t e 1979), the heat shock response had been w e l l c h a r a c t e r i z e d only i n Drosophila (2). I t had become apparent that t h i s phenomenon i n stre s s e d c e l l s was of great importance f o r t h e i r s u r v i v a l . Thus, i t s i n v e s t i g a t i o n i n other systems would be i n v a l u a b l e i n determining the i n d u c t i o n mechanism of and f u n c t i o n a l r o l e f o r the heat shock response. This would a l l o w a comparison of the responses at both the t r a n s c r i p t i o n a l and t r a n s l a t i o n a l l e v e l s i n species from d i f f e r e n t phylogenetic backgrounds. Therefore, an i n v e s t i g a t i o n of the heat-shock phenomenon i n c u l t u r e d c e l l s of rainbow t r o u t , Salmo g a i r d n e r i i , was undertaken. This c e l l l i n e was used because of the ease with which i t could be manipulated, e s p e c i a l l y f o r k i n e t i c s t u d i e s . I n i t i a l l y , the occurrence of the heat shock response i n t r o u t c e l l s was. c h a r a c t e r i z e d . The extent of i t s s i m i l a r i t y to the Drosophila response was subsequently analyzed at s e v e r a l l e v e l s : hsp i n d u c t i o n and turnover, hsp70 mRNA synthesis and degradation, t r a n s l a t i o n a l c o n t r o l of p r e - e x i s t i n g mRNAs, and hsp70 amino a c i d and n u c l e o t i d e sequence homologies. - 23 -During the course of t h i s study, the presence of a heat shock response i n a wide range of organisms was becoming evident ( l ) . The major theme emerging from these reports i s the highly conserved nature of the heat shock response. In addition, the rapid k i n e t i c s of induction suggests that the chromatin of heat-shock genes i s maintained i n an " a l e r t " state ready for immediate t r a n s c r i p t i o n . The r e s u l t s presented i n t h i s thesis further emphasize the complex nature of heat shock response regulation, and support the conclusion that the hsp70 genes form a highly conservative gene family. - 24 -I I . EXPERIMENTAL PROCEDURES 2.1 C e l l C u l t u r e 2.1.1 C e l l Line and Growth Conditions The f i b r o b l a s t - l i k e l i n e of RTG-2 c e l l s was o r i g i n a l l y d erived from mixed gonadal t i s s u e of male and female rainbow t r o u t , JS^ g a i r d n e r i i (154). The c e l l s were grown i n Eagle's minimum e s s e n t i a l medium c o n t a i n i n g n o n - e s s e n t i a l amino a c i d s , E a r l e ' s b a s i c s a l t s , 100 U/mL of p e n i c i l l i n - s t r e p t o m y c i n , and 10% f e t a l bovine serum ( a l l from Gibco L t d . ) . The c u l t u r e s were maintained i n disposable polystyrene t i s s u e c u l t u r e f l a s k s of 25 cm 2 surface area, at a temperature of 22°C. For l a r g e - s c a l e growth of c e l l s , r o l l e r b o t t l e s w i t h a surface area of 300 cm 2 were used. 2.1.2 Induction of C e l l s C e l l s grown to near confluence were induced by two methods. In the f i r s t method, c e l l s were subjected to higher temperatures e i t h e r by p a r t i a l immersion of the f l a s k i n a temperature-regulated water bath, or by placement i n an a i r - i h c u b a t o r . Since the volume of medium i n the f l a s k was only 5 mL, temperature e q u i l i b r a t i o n was r a p i d . In the second method, the c e l l s were induced at 22°C by the a d d i t i o n of sodium a r s e n i t e to the medium. C e l l s from a s i n g l e s u b - c u l t u r i n g were used f o r each set of experiments. D e t a i l s of the co n d i t i o n s of i n d u c t i o n are described i n the r e s u l t s s e c t i o n . - 25 -2.2 P r o t e i n A n a l y s i s 2.2.1 In v i v o L a b e l l i n g of P r o t e i n s Following i n d u c t i o n the c e l l s were l a b e l l e d f o r 1 hour w i t h [ 3 5S]methionine (1000 Ci/mmol, New England Nuclear) at 22°C. An average of 20-30 pCi/mL of [ 3 5SJmethionine was used per experiment. The l a b e l was added to 2 mL of medium l a c k i n g methionine (Selectamine k i t from Gibco Ltd.) and t h i s was s u b s t i t u t e d f o r the complete medium. In c o r p o r a t i o n was terminated by removing the l a b e l l i n g medium and washing the c e l l s w i t h i c e - c o l d saline-EDTA s o l u t i o n (137 mM NaCl, 0.5 mM EDTA, 2.7 mM KC1, 8.1 mM Na 2HP0^, 1.5 mM KI^PO^, 1.1 mM glucose). The c e l l s were detached from the f l a s k by a stream of saline-EDTA from a Pasteur p i p e t and p e l l e t e d by gentle c e n t r i f u g a t i o n . The p e l l e t was washed once i n i c e - c o l d i s o t o n i c s a l i n e (0.15 M NaCl). The c e l l s were then suspended i n Laemmli sample b u f f e r (0.05 M T r i s - H C l , pH 6.8, 1% SDS, 10 mM EDTA, 0.01% bromophenol bl u e , and 12% g l y c e r o l ) , and the p r o t e i n s s o l u b i l i z e d by b o i l i n g f o r 2 minutes. 2.2.2 L o c a l i z a t i o n of L a b e l l e d P r o t e i n s F o l l o w i n g i n d u c t i o n and l a b e l l i n g , c e l l s were separated i n t o the cytoplasmic and nuclear f r a c t i o n s . This was done e s s e n t i a l l y as described by Marushige and Bonner (155) w i t h a few m o d i f i c a t i o n s . C e l l p e l l e t s were suspended i n 150 \iL of TMKS b u f f e r (50 mM T r i s - H C l , pH 7.5, 5 mM MgCl 2, 25 mM KC1, and 0.25 M sucrose) and 0.5% NP40. The suspension was freeze-thawed once on dry i c e and homogenized i n a g l a s s - T e f l o n hand homogenizer. The sample was c e n t r i f u g e d at 3000 x g (10 minutes, 4°C) and the supernatant saved as the cytoplasmic f r a c t i o n . The p e l l e t was - 26 -rehomogenized i n 500 uL of TMK b u f f e r (same as TMKS without the sucrose) and 0.5% NP40. The sample was c e n t r i f u g e d as above and the nuclear p e l l e t was washed i n 500 iiL of 10 mM T r i s - H C l , pH 7.8, w i t h mechanical a g i t a t i o n (Vortex m i x e r ) . The suspension was c e n t r i f u g e d at 12,000 x g (15 minutes, 4°C) to ob t a i n a p e l l e t of crude chromatin. Both the cytoplasmic and nuclear f r a c t i o n s were made IX i n Laemmli sample b u f f e r . 2.2.3 SDS-Polyacrylamide Gel E l e c t r o p h o r e s i s and Autoradiography The c e l l e x t r a c t s and f r a c t i o n a t e d p r o t e i n s were analyzed on 10 or 12.5% polyacrylamide-SDS slab gels w i t h a 4.5% s t a c k i n g g e l using the discontinuous b u f f e r system of Laemmli (156). The gels contained an acrylamide:bisacrylamide r a t i o of 30:0.8 (w/w), i n a d d i t i o n to 375 mM T r i s - H C l , pH 8.8, 0.1% SDS, 0.03% TEMED, 0.05% APS f o r the separating g e l and 125 mM T r i s - H C l , pH 6.8, 0.1% SDS, 0.05% TEMED, 0.1% APS f o r the st a c k i n g g e l . The g e l e l e c t r o p h o r e s i s b u f f e r contained 25 mM T r i s (pH about 8.3), 0.38 M g l y c i n e , and 0.1% SDS. Slab gels (0.08 x 7.5 x 10 cm) were run at 20 mA constant current f o r about 70 minutes and sta i n e d w i t h 0.25% Coomassie blue i n a m e t h a n o l : g l a c i a l a c e t i c acid:water (5:1:5 r a t i o , v/v) system. The microslab apparatus was as described by Matsudaira and Burgess (157). A f t e r d e s t a i n i n g , the gels were d r i e d and autoradiographed u s i n g Kodak X-Omat AR f i l m f o r an average of 40 hours. 2.2.4 Densitometry Scanning of Autoradiographs A f t e r autoradiography, the f i l m was i n s e r t e d i n t o the holder of a Beckman DU-8 spectrophotometer and the p r o f i l e s of [ 3 sS]methionine l a b e l l e d p r o t e i n s were determined by measuring the percentage transmittance of white l i g h t . - 27 -2.3 RNA A n a l y s i s 2.3.1 I s o l a t i o n of T o t a l RNA RTG-2 f i b r o b l a s t s , grown c l o s e to confluence, were induced w i t h 50 uM sodium a r s e n i t e f o r 24 hours. The c e l l s were subsequently harvested and the RNA was i s o l a t e d e s s e n t i a l l y as described by Chirgwin e_t a l . (158) wi t h a few m o d i f i c a t i o n s . B r i e f l y , the c e l l p e l l e t s were hand-homogenized on i c e using a Gu'HCl b u f f e r (6 M Gu'HCl, 20 mM sodium acetate, 0.1 M IJ-mercaptoethanol, pH 5.0). The homogenates were then c a r r i e d through one c y c l e of freeze-thawing, followed by c e n t r i f u g a t i o n at 12,000 x g (10 minutes, 4°C). To the supernatant was added 0.5 volume of 95% ethanol (-20°C). RNA was allowed to p r e c i p i t a t e at -20°C f o r a few hours and subsequently p e l l e t e d by c e n t r i f u g a t i o n at 12,000 x g (15 minutes, 0°C). The p e l l e t was d i s s o l v e d i n 7.5 M Gu'HCl, 25 mM sodium c i t r a t e , 50 mM 6-mercaptoethanol, pH 7.0 and the RNA was r e p r e c i p i t a t e d by the a d d i t i o n of 0.025 volume of 1 M a c e t i c a c i d and 0.5 volume of 95% ethanol (-20°C). This c y c l e of r e p r e c i p i t a t i o n was c a r r i e d out two to three times. The f i n a l RNA p e l l e t was washed once w i t h 95% ethanol (-20°C), and then d r i e d under a stream of n i t r o g e n . The d r i e d p e l l e t was ext r a c t e d three to four times w i t h s t e r i l e water and the e x t r a c t s were pooled. The RNA was p r e c i p i t a t e d once more w i t h 0.1 volume of 2 M sodium acetate, pH 5-0, and 2 volumes of 95% ethanol (-20°C). The RNA was c e n t r i f u g e d at 12,000 x g (20 minutes, -10°C), d r i e d under n i t r o g e n and d i s s o l v e d i n s t e r i l e water at a f i n a l c o n c e n t r a t i o n of 2 mg/ml (assuming 20 A^^Q u n i t s = 1 mg RNA). T y p i c a l y i e l d s of t o t a l c e l l u l a r RNA were about 1 mg per 5 r o l l e r b o t t l e s of c e l l s . A l l glassware and s o l u t i o n s were t r e a t e d w i t h 0.1% diethylpyrocarbonate and baked or autoclaved, r e s p e c t i v e l y , before use (a - 28 -standard procedure f o r a l l RNA a n a l y s i s ) . 2.3.2 P u r i f i c a t i o n of Polyadenylated RNA Poly A + RNA was separated from the t o t a l RNA by two passages through an o l i g o [ d T ] - c e l l u l o s e column ( C o l l a b o r a t i v e Research Inc.) using the procedure of Aviv and Leder (159). T o t a l RNA was loaded onto the column i n NETS b u f f e r (0.3 M NaCl, 1 mM EDTA, 10 mM T r i s - H C l , pH 7.5, and 0.5% SDS) and the s o l u t i o n r e c i r c u l a t e d s e v e r a l times. The column was washed w i t h more NETS b u f f e r to e l u t e o f f any unbound RNA. Poly A RNA was e l u t e d o f f the column w i t h a small volume of ETS b u f f e r (1 mM EDTA, 10 mM T r i s - H C l , pH 7.5, and 0.05% SDS) or s t e r i l e water. The el u t e d poly A + RNA was f u r t h e r p u r i f i e d by a second passage through the column. To the f i n a l e l u a n t , c o n t a i n i n g the poly A + RNA, was added 0.1 v o l of 2 M NaAc, pH 5, and 2 v o l of 95% ethanol (-20°C). The mixture was l e f t f o r a few hours at -20°C and then c e n t r i f u g e d at 12,000 x g (30 minutes, -10°C). The p e l l e t was washed once i n 95% ethanol (~20°C), d r i e d under n i t r o g e n , and d i s s o l v e d i n s t e r i l e water. The f a t e of the RNA through the p u r i f i c a t i o n procedure was monitored w i t h an ISCO o p t i c a l u n i t set at a wavelength of 260 nm. A t y p i c a l p u r i f i c a t i o n p r o f i l e i s shown i n Figure 1. 2.3.3 Sucrose Density Gradient C e n t r i f u g a t i o n of RNA Sucrose gradients of 13 mL (15 to 35%, w/v) were made with the help of a Hoefer m u l t i p l e sucrose gradient maker. The sucrose s o l u t i o n s contained 0.1 M NaCl, 1 mM EDTA, and 10 mM NaAc, pH 5. The RNA w a s heated to 80°C f o r 5 minutes and then c h i l l e d on i c e . A t o t a l of 200 pg of RNA was loaded onto each gradient and c e n t r i f u g e d at 30,000 rpm (20 hours, 4°C) i n - 29 -o to C M TIME Figure 1. Purification of Poly A + on an 01igo[dT]-column. Poly A + RNA was separated from total RNA by aff i n i t y chromatography on oligo[dT]-cellulose. The arrows indicate various treatments of the column. The fate of the RNA was followed by absorption at 260 nm (ubf = unbound fraction, NETS = binding buffer, A + = purified poly A + RNA). Note: one cycle through the column took one hour in a typical run. - 30 -a Beckman SW41 r o t o r . F r a c t i o n s of 0.5 mL were c o l l e c t e d by upward displacement w i t h 50% sucrose (w/v). RNA from each f r a c t i o n was p r e c i p i t a t e d w i t h ethanol and d r i e d i n vacuo f o r 5 minutes. I n d i v i d u a l p e l l e t s were suspended i n 8 uL of s t e r i l e water and stored at -20°C. 2.3.4 C e l l - F r e e P r o t e i n T r a n s l a t i o n RNA was t r a n s l a t e d i n the r a b b i t r e t i c u l o c y t e system (NEN) as described by Pelham and Jackson (160), w i t h [ 3 5SJmethionine as the l a b e l . Polypeptides were f r a c t i o n a t e d and analyzed by SDS-polyacrylamide g e l e l e c t r o p h o r e s i s and autoradiography. 2.3.5 Trout cDNA L i b r a r i e s The RTG-2 cDNA l i b r a r i e s were k i n d l y s u p p l i e d by Mr. Don Jones. Poly A + RNA from a r s e n i t e induced c e l l s was used to synthesize complementary DNA by one of two methods. The f i r s t method involved the use of s e l f - p r i m i n g at the 3' ends of si n g l e - s t r a n d e d cDNAs f o r second-strand synthesis (161). These were cloned i n t o the P s t I s i t e of plasmid pBR322 and y i e l d e d about 700 independent clones. The second method i n v o l v e d a d d i t i o n of dC t a i l s to the 3'-OH ends of si n g l e - s t r a n d e d cDNAs and the use of oligo-[dG] as primers f o r second-strand synthesis (162). These cDNAs were a l s o cloned i n t o the P s t I s i t e of pBR322 and y i e l d e d about 2,000 and 5,000 independent clones i n two separate attempts. 2.3.6 Screening of the cDNA L i b r a r i e s The cDNA l i b r a r i e s were screened e i t h e r by the colony h y b r i d i z a t i o n method of Grunstein and Hogness (163) or by the high d e n s i t y p l a t i n g method of Hanahan and Meselson (164). In the former method, b a c t e r i a l c o l o n i e s - 31 -co n t a i n i n g plasmids were i n d i v i d u a l l y t r a n s f e r r e d from a master p l a t e to a NC f i l t e r ( S c h l e i c h e r and Sc h u e l l ) and allowed to grow at 37°C on LB p l a t e s (1 % bactotryptone, 0-5% yeast e x t r a c t , 1% NaCl, and 1.4% agar) c o n t a i n i n g the a n t i b i o t i c s t e t r a c y c l i n e (15 ug/mL) and streptomycin (25 yg/mL). When the c o l o n i e s grew to a s i z e of 1 mm, the f i l t e r was t r a n s f e r r e d to an LB p l a t e c o n t a i n i n g 170 ug/mL of chloramphenicol, and the plasmids allowed to amplify overnight at 37°C. In the second method, b a c t e r i a l c o l o n i e s from a g l y c e r o l stock of the cDNA l i b r a r y were p l a t e d at a den s i t y of about 5,000 c o l o n i e s per p l a t e onto a NC f i l t e r . These c o l o n i e s were a l s o grown under s e l e c t i o n of t e t r a c y c l i n e and streptomycin. The b a c t e r i a l c o l o n i e s were grown to a diameter of 0.1 mm and a r e p l i c a made onto a second NC f i l t e r . Both the master and r e p l i c a were returned to 37°C and the c o l o n i e s grown to a diameter of 1 mm. At t h i s stage the master p l a t e was removed and stored at 4°C. The r e p l i c a f i l t e r was t r a n s f e r r e d to a p l a t e c o n t a i n i n g chloramphenicol and the plasmids a m p l i f i e d overnight. F i l t e r s were then t r e a t e d to o b t a i n c e l l l y s i s . They were placed colony side up on a Whatman 3 MM f i l t e r saturated w i t h 10% SDS (3 min). This was followed by successive washes i n : ( i ) 0.5 M NaOH, 1.5 M NaCl, ( i i ) 1.5 M NaCl, 0.5 M T r i s - H C l , pH 8, and ( i i i ) f i n a l l y i n 2X SSPE (IX SSPE i s 0.18 M NaCl, 10 mM sodium phosphate, pH 7.5, and 1 mM EDTA), a l l f o r 5 minutes. The f i l t e r s were a i r d r i e d and baked i n vacuo at 80°C f o r 2 hours. A f t e r h y b r i d i z a t i o n to a l a b e l l e d DNA fragment, any p o s i t i v e s i g n a l s were traced back to the master p l a t e and appropriate c o l o n i e s p u r i f i e d . - 32 -2.3.7 RNA Northern and Dot B l o t A n a l y s i s RNA was denatured i n 1 M g l y o x a l , 10 mM sodium phosphate, pH 7 at 50°C fo r 1 hour according to the procedure of McMaster and Carmichael (165). The RNA samples were cooled to room temperature and 0.2 v o l of a 5X loading b u f f e r (IX loading b u f f e r i s 7% F i c o l l , 10 mM sodium phosphate, pH 7, and 0.02% bromophenol blue) added. The denatured RNA was f r a c t i o n a t e d on a h o r i z o n t a l agarose g e l . The gels were poured and run i n 10 mM sodium phosphate, pH 7.0, b u f f e r which was r e c i r c u l a t e d throughout the run. The gly o x a l a t e d RNA was t r a n s f e r r e d from the g e l to a NC f i l t e r immediately a f t e r e l e c t r o p h o r e s i s . The t r a n s f e r was through 20X SSPE as described by Thomas (166). For the d o t - b l o t s , t o t a l RNA was placed i n a small volume on a NC f i l t e r and allowed to dry. The f i l t e r s were subsequently baked i n vacuo at 80°C f o r 2 hours. 2.3.8 Cytoplasmic Quick B l o t s of RNA Cytoplasmic e x t r a c t s c o n t a i n i n g mRNA were b l o t t e d to n i t r o c e l l u l o s e f i l t e r s ( S c h l e i c h e r and S c h u e l l , Inc.) as described by Bresser et a l . (167), w i t h a few m o d i f i c a t i o n s . B r i e f l y , a f t e r appropriate treatments, c e l l s from i n d i v i d u a l f l a s k s were harvested as q u i c k l y as p o s s i b l e (to avoid inadvertant i n d u c t i o n of hsps) i n 1.0 mL of i c e - c o l d saline-EDTA s o l u t i o n . C e l l s were ge n t l y p e l l e t e d by a 5 minute c e n t r i f u g a t i o n i n a desk top c e n t r i f u g e and resuspended i n 0.5 mL of i c e - c o l d saline-EDTA s o l u t i o n made 0.5% i n SDS. Proteinase K (Boehringer Mannheim) was added to a f i n a l c o n c e n t r a t i o n of 0.2 mg/mL and the suspension was incubated at 37°C f o r 30 minutes. One-twentieth volumes of 10% B r i j - 3 5 and 10% sodium deoxycholate were added to the suspension, which was then incubated on i c e f o r 5 minutes. To s o l u b i l i z e c e l l u l a r contents, 0.81 volume of super-- 33 -saturated Nal (2.5 g Nal per mL of hot water), l i q u i f i e d at 75°C, was added to the suspension which was l e f t at room temperature f o r 10 minutes. D i l u t i o n s were made i n t o saturated Nal (0.81 volume of supersaturated Nal added to saline-EDTA s o l u t i o n ) . The s o l u b i l i z e d e x t r a c t and appropriate d i l u t i o n s were passed at room temperature through a n i t r o c e l l u l o s e f i l t e r w i t h the a i d of a Hybrid-Dot apparatus (Bethesda Research Lab, I n c . ) . N i t r o c e l l u l o s e f i l t e r s were pre t r e a t e d by soaking i n water followed by a wash i n 6X SSC (IX SSC i s 0.15 M NaCl, 0.015 M sodium c i t r a t e , pH 7.0). A f t e r f i l t r a t i o n , n i t r o c e l l u l o s e membranes were soaked s u c c e s s i v e l y i n water, 70% et h a n o l , and f i n a l l y a c e t i c anhydride s o l u t i o n (100 mL of 0.1 M triethanolamine plus 0.25 mL of a c e t i c anhydride prepared j u s t p r i o r to use), each f o r 10 minutes at room temperature. F i l t e r s were subsequently a i r d r i e d and t r e a t e d f o r h y b r i d i z a t i o n . A l l s o l u t i o n s , except f o r ones co n t a i n i n g Nal or p r o t e i n s , were t r e a t e d w i t h 0.1% diethylpyrocarbonate and autoclaved before use. 2.4 DNA A n a l y s i s 2.4.1 I s o l a t i o n of Plasmid DNA Plasmid DNA was i s o l a t e d by the method of Birnboim and Doly (168). For r a p i d s m a l l - s c a l e i s o l a t i o n of plasmid, 1.5 mL of an overnight c u l t u r e was t r a n s f e r r e d to an Eppendorf tube and the b a c t e r i a l c e l l s p e l l e t e d by c e n t r i f u g a t i o n i n a microfuge (Eppendorf). The c e l l s were resuspended i n 0.1 mL of l y s i s b u f f e r I (50 mM glucose, 25 mM T r i s - H C l , pH 8, 10 mM EDTA, and f r e s h l y added lysozyme at 4 mg/mL). The suspension was mixed f o r 30 seconds (Vortex) and l e f t at room temperature. A f t e r 5 minutes, 0.2 mL of f r e s h l y made i c e - c o l d l y s i s b u f f e r I I (0.2 N NaOH, 1% SDS) was added. To - 34 -the now viscous s o l u t i o n was added 0.15 mL of i c e - c o l d 5 M potassium ace t a t e , pH 4.8. The tube was i n v e r t e d , mixed f o r 10 seconds (Vortex) and l e f t on i c e f o r 5 minutes. The b a c t e r i a l c e l l d ebris and DNA were removed by a 5 minute c e n t r i f u g a t i o n . The l y s a t e , which contained the plasmid DNA, was subjected to e x t r a c t i o n w i t h 1 v o l of phenoliCHCl^ (1:1). The aqueous phase was t r e a t e d w i t h NaAc and ethanol to p r e c i p i t a t e the plasmid DNA (room temperature, 2 min). The f i n a l p e l l e t was d r i e d and resuspended i n 50 pL of s t e r i l e TE (10 mM T r i s - H C l , pH 7.6, 1 mM EDTA) plus 50 Mg/mL of RNAase A (Sigma L t d . ) . For the large s c a l e i s o l a t i o n of plasmid DNA, a l l the steps were scaled up. U s u a l l y , 0.5 L c u l t u r e s of b a c t e r i a l c e l l s were used and processed to the l y s a t e stage as above. Isopropanol (0.6 v o l ) was added to the l y s a t e and the mixture l e f t at room temperature f o r 15 minutes. The DNA was c o l l e c t e d by c e n t r i f u g a t i o n at 12,000 x g (20 minutes, 10°C) and the p e l l e t s washed once i n 70% ethanol. The DNA was d r i e d i n vacuo and d i s s o l v e d i n 4.5 mL of TE b u f f e r . One gram of s o l i d cesium c h l o r i d e was added per mL of s o l u t i o n . One mg of ethidium bromide was added and the mixture c e n t r i f u g e d at 12,000 x g (10 minutes, 10°C) to remove undissolved s a l t and RNA complexed to ethidium bromide. The cesium c h l o r i d e s o l u t i o n of DNA was subjected to e q u i l i b r i u m d e n s i t y c e n t r i f u g a t i o n at 50,000 rpm (20 hours, 15°C) i n a Beckman VTi65 r o t o r . The DNA band from the gradient was c o l l e c t e d and the ethidium bromide removed by s e v e r a l e x t r a c t i o n s w i t h 1-butanol saturated w i t h water. To prevent any cesium c h l o r i d e from s a l t i n g out, the aqueous phase was d i l u t e d 3 - f o l d w i t h water p r i o r to a d d i t i o n of ethanol (6 v o l ) . The DNA was p e l l e t e d by c e n t r i f u g a t i o n at 12,000 x g (20 minutes, 0°C) and washed once i n 70% ethanol. The f i n a l p e l l e t was d r i e d i n vacuo and resuspended i n 0.5 mL of s t e r i l e water. - 35 -2.4.2 I s o l a t i o n of Genomic DNA High molecular weight genomic DNA from t r o u t t e s t e s was prepared by Dr. E.P.M. Candido f o l l o w i n g the method of B l i n and S t a f f o r d (169). This i n v o l v e d g r i n d i n g of the t i s s u e i n l i q u i d n i t r o g e n followed by extensive d i g e s t i o n s w i t h RNAase A and proteinase K. These d i g e s t i o n s were i n t e r s p e r s e d w i t h phenol:CHC1^ (1:1) e x t r a c t i o n s and d i a l y s i s of the aqueous phase to remove a l l traces of phenol. High molecular weight DNA was wound out of the e x t r a c t a f t e r a d d i t i o n of ethanol. Genomic DNA samples from other sources were k i n d l y provided by E l i z a b e t h Burgess, C o l i n Hay, J e f f Leung, Ross M a c G i l l i v r a y and Roland Russnak. 2.4.3 R e s t r i c t i o n Endonuclease D i g e s t i o n of DNA D i g e s t i o n of DNA w i t h r e s t r i c t i o n enzymes was c a r r i e d out according to the d i r e c t i o n s of the s u p p l i e r (BRL). Low (0 mM NaCl), medium (50 mM NaCl), or high (100 mM NaCl) s a l t b u f f e r s were used depending on the requirement of i n d i v i d u a l enzymes. Note that 20 mM KC1 was s u b s t i t u t e d f o r NaCl when Smal was used. For d i g e s t i o n s of longer than 2 hours, 100 ug/mL BSA ( u l t r a p u r e grade, BRL) was added. A l l d i g e s t i o n s were at 37°C, except f o r TaqI (65°C), and the r e a c t i o n s terminated by i n c u b a t i o n at-68°C f o r 5 minutes. The samples were cooled to room temperature and 0.2 v o l of 20% F i c o l l , 0.2% bromophenol blue, and 50 mM EDTA added p r i o r to g e l e l e c t r o p h o r e s i s . 2.4.4 Agarose Gel E l e c t r o p h o r e s i s F r a c t i o n a t i o n of DNA was by e l e c t r o p h o r e s i s through h o r i z o n t a l agarose g e l s . Gels were poured and run i n IX TBE (89 mM T r i s - b o r a t e , pH 8.3, and 2 - 36 -mM EDTA) c o n t a i n i n g 0.1 mg/L of ethidium bromide. Gels were submerged during the e l e c t r o p h o r e s i s (4 to 5 V/cm). The DNA bands were v i s u a l i z e d under UV-light and photographs taken w i t h a P o l a r o i d camera. 2.4.5 DNA Southern B l o t A n a l y s i s DNA from agarose gels was t r a n s f e r r e d to NC f i l t e r s f o l l o w i n g the p r i n c i p l e s described by Southern (170). The g e l was pret r e a t e d f o r t r a n s f e r as f o l l o w s : two 15 minute washes i n 1.5 M NaCl, 0.5 M NaOH followed by a short r i n s e i n d i s t i l l e d water, then two 15 minute washes i n 0.5 M T r i s - H C l , pH 7.8, 1.5 M NaCl. The NC f i l t e r was pret r e a t e d by b r i e f washes i n d i s t i l l e d water and 20X SSPE. Transfer was overnight through 20X SSPE and the DNA immobilized by baking the f i l t e r i n vacuo at 80°C f o r 2 hours. 2.5 Maxam and G i l b e r t DNA Sequencing This method i n v o l v e d the b a s e - s p e c i f i c m o d i f i c a t i o n and cleavage of e n d - l a b e l l e d DNA (171, 172). The cleaved products were ordered according to s i z e on an acrylamide g e l and the sequence read from an autoradiogram. 2.5.1 End-Labelling of DNA Fragments About 1 ng of p u r i f i e d DNA w i t h unique 5' s t i c k y ends was en d - l a b e l l e d w i t h the appropriate [a- 3 2p]dNTP (40-50 uCi, 3,000 Ci/mmol, NEN) using the Klenow fragment of E. , c o l i DNA polymerase I (Boehringer Mannheim). A f t e r 20 minutes at room temperature the r e a c t i o n was terminated by a d d i t i o n of 0.2 v o l of 20% F i c o l l , 0.2% bromophenol blue, and 50 mM EDTA. - 37 -2.5.2 Pr e p a r a t i v e Acrylamide Gels S i n g l e e n d - l a b e l l e d fragments of DNA were p u r i f i e d on a 5 or 8% polyacrylamide (acrylamide:bisacrylamide r a t i o of 29:1) g e l c o n t a i n i n g IX TBE, 0.06% APS, and 0.1% TEMED. The DNA fragments of i n t e r e s t were i d e n t i f i e d by autoradiography, and e l e c t r o - e l u t e d from the g e l i n t o d i a l y s i s tubing. The f i n a l DNA p e l l e t was Cerenkov counted (approximately 30% e f f i c i e n t ) and suspended i n s t e r i l e water at 1,000 - 2,000 Cerenkov cpm/uL. 2.5.3 B a s e - S p e c i f i c Reactions on End-Labelled DNA The p r o t o c o l used f o r the base m o d i f i c a t i o n r e a c t i o n s on the en d - l a b e l l e d DNA i s summarized i n Table I I I . A f t e r the f i n a l l y o p h i l i z a t i o n , the DNA was Cerenkov counted and taken up i n 90% formamide, 25 mM EDTA, 0.02% xylene cyanol, and 0.02% bromophenol blue at a con c e n t r a t i o n of 2,000 Cerenkov cpm/uL ( f o r the G and C base r e a c t i o n s ) and 4,000 Cerenkov cpm/uL ( f o r the G+A and T+C base r e a c t i o n s ) . The samples were heated at 95°C f o r 3 minutes and q u i c k - c h i l l e d on i c e p r i o r to e l e c t r o p h o r e s i s . 2.5.4 Sequencing Gels The products of DNA sequencing r e a c t i o n s were analyzed on 6 or 8% polyacrylamide s l a b gels (0.035 x 15 x 35 cm). The gels contained an acrylamide:bisacrylamide r a t i o of 19:1 i n a d d i t i o n to 8.3 M urea, IX TBE, 0.06% APS, and 0.03% TEMED. E l e c t r o p h o r e s i s was i n IX TBE at a constant power of 30 W (approximately 1,600 V). The gels were d r i e d onto Whatman f i l t e r paper and autoradiographed using Kodak X-Omat RP f i l m . - 38 -TABLE I I I . DNA Ba s e - M o d i f i c a t i o n Reactions f o r M & G Sequencing G + A T + C [ 3 2 P ] DNA (uL) : C a r r i e r DNA (lmg/mL): Mix & C h i l l Add Incubate Add Store Microfuge R e p r e c i p i t a t e Wash p e l l e t & dry i n vacuo Resuspend i n Heat to Cool on i c e , add L y o p h i l i z e Add L y o p h i l i z e & repeat 1 uL cacodylate b u f f e r , 300 yL DMS 2 uL 3' , RT G-stop 50 uL + 95% ethanol (-70°O 1 mL 10 1 Pi dH 20 10 y l formic a c i d 3 uL 10', 37°C A-stop 300 uL 1 mL 10 1 UL dH 20 15 uL HZ 30 uL 10', RT Py-stop 300 U L 1 mL -70°C, 15 minutes 5 minutes 2X i n 70% ethanol 100 uL 1.0 M p i p e r i d i n e 90°C, 30 minutes 100 uL dH 20 20 uL dH 20 1 UL 5 NaCl 20 uL HZ 30 uL 15', RT Py-stop 300 uL 1 mL - 39 -2.6 M13-Dideoxy Sequencing of DNA The second method of DNA base sequence determination u t i l i z e d the 'dideoxy' chain t e r m i n a t i o n procedure of Sanger (173, 174) as adapted to the M13 phage system by Messing e_t _ a l . (175). 2.6.1 Cloning of DNA i n t o M13 Phage M13mp8 and M13mp9 RF DNA were k i n d l y provided by Dr. E.P.M. Candido. About 100 ng of i n s e r t DNA, digested w i t h r e s t r i c t i o n enzymes, was annealed and l i g a t e d to 50 ng of v e c t o r DNA (M13 RF) r e s t r i c t e d at the appropriate s i t e . The l i g a t i o n r e a c t i o n was at 15°C f o r 4 hours i n 66 mM T r i s - H C l , pH 7.6, 5 mM MgCl 2, 5 mM DTT, and 1 mM ATP, i n a d d i t i o n to 1 Weiss u n i t of T4 DNA l i g a s e (Boehringer Mannheim). The r e a c t i o n was terminated by heating to 68°C f o r 10 minutes. The l i g a t e d DNA was transformed i n t o JM101 or JM103 c e l l s ( s t r a i n s obtained from C r a i g Newton). E s s e n t i a l l y , host c e l l s were grown i n 20 mL YT medium (0.8% bactotryptone, 0.5% yeast e x t r a c t , and 0.5% NaCl) to a d e n s i t y of 0.7 A-^^Q u n i t s and then c h i l l e d on i c e f o r 30 minutes. The c e l l s were p e l l e t e d by gentle c e n t r i f u g a t i o n and resuspended i n 10 mL of f r e s h i c e - c o l d 50 mM CaCl^. A f t e r s t o r i n g on i c e f o r 30 minutes the c e l l s were p e l l e t e d (1,500 x g, 5 minutes, 4°C) and c a r e f u l l y resuspended i n 2 mL of i c e - c o l d 50 mM CaC^. Transformation r e a c t i o n s c o n s i s t e d of 0.3 mL of competent c e l l s and 2 ng of l i g a t e d DNA; these were incubated on i c e f o r 40 minutes. The mixtures were heat-shocked at 42°C f o r 2 minutes, and then l e f t at room temperature f o r 5 minutes. Ten U L of 100 mM IPTG, 50 jiL X-gal (2% i n dimethylformamide), and 0.2 mL of a f r e s h c u l t u r e of c e l l s was added to the transforming mixture. The mixture was p l a t e d onto YT agar p l a t e s w i t h 3 mL of s o f t agar. The p l a t e s were - 40 -incubated at 37°C and c l e a r plaques i d e n t i f i e d as those c o n t a i n i n g recombinant phage. 2.6.2 Pr e p a r a t i o n of Single-Stranded Templates Clear plaques ( c o n t a i n i n g recombinant phage) were t r a n s f e r r e d w i t h a s t e r i l e pasteur p i p e t , from a p l a t e to a tube c o n t a i n i n g 2 mL YT medium and 20 uL of a f r e s h c u l t u r e of JM101 or JM103 c e l l s . The tube was incubated at 37°C w i t h shaking f o r 6 to 7 hours. A 1.3 mL a l i q u o t was poured i n t o an Eppendorf tube and the c e l l s p e l l e t e d (5 minutes i n a microfuge). The supernatant was c a r e f u l l y t r a n s f e r r e d to a f r e s h tube c o n t a i n i n g 0.3 mL of 20% PEG, and 2.5 M NaCl. A f t e r mixing, the tube was l e f t at room temper-ature f o r 15 minutes followed by a 5 minute c e n t r i f u g a t i o n . The supernatant was a s p i r a t e d o f f and the i n s i d e w a l l of the tube was wiped w i t h t i s s u e paper to ensure that a l l traces of PEG were removed. The phage p e l l e t was d i s s o l v e d i n 0.2 mL of a low T r i s b u f f e r , LTB (20 mM T r i s - H C l , pH 7.5, 20 mM NaCl, 1 mM EDTA), and then subjected to e x t r a c t i o n s w i t h phenol, and phenol:CHCl2 (1:1). The aqueous phase was t r a n s f e r r e d to a clean tube and the si n g l e - s t r a n d e d DNA p r e c i p i t a t e d by the a d d i t i o n of 14 pL of 4 M NaAc, pH 5, and 0.5 mL of 95% ethanol (-20°C). The mixture was l e f t at -70°C f o r 15 minutes and then c e n t r i f u g e d f o r 5 minutes. The b a r e l y d e t e c t a b l e p e l l e t was washed i n 1 mL of 95% ethanol (-20°C), d r i e d i n vacuo f o r 5 minutes, and d i s s o l v e d i n 50 uL of LTB. 2.6.3 'Dideoxy' Chain Termination Reactions Single-stranded template DNA (5 yL) from a recombinant M13 phage was mixed w i t h 0.75 ng of M13-primer (17-mer, P-L Biochemicals) i n 25 mM T r i s -HCl, pH 7.5, 18 mM MgCl ?, and 150 mM NaCl i n a t o t a l volume of 8 uL. - 41 -The mixture was t r a n s f e r r e d to a 50 pL glass c a p i l l a r y which was then sealed at both ends. The h y b r i d i z a t i o n mix was placed at 68°C f o r 10 minutes and then g r a d u a l l y cooled to room temperature to al l o w proper annealing of primer and template DNA. A f t e r 15 minutes the c a p i l l a r y was broken open and the contents t r a n s f e r r e d to a tube c o n t a i n i n g 1 pL of 15 pM dATP and 1.5 pL of [c*- 3 2P]dATP (15 PCi of a 3,000 Ci/mmol stock, NEN). From the mixture, 2 pL a l i q u o t s were t r a n s f e r r e d to 'A' and 'T' tubes, w h i l e 2.5 pL a l i q u o t s were t r a n s f e r r e d 'G' and 'C' tubes. To these tubes were a l s o added 1.5 pL of the appropriate dd/dNTP mix (see Table I V ). TABLE IV. 'Dideoxy' Mix Composition* 'G' *A' 1 J i 1 ddGTP (pM) 89 ddATP (pM) - 116 - -ddTTP (pM) - - 547 -ddCTP (pM) - - - 547 dGTP (pM) 7.9 I l l 158 158 dTTP (pM) 158 111 7.9 158 dCTP (pM) 158 111 158 10.5 e m p i r i c a l l y derived by Dr. Joan McPherson Reactions were s t a r t e d by a d d i t i o n of 0.2 u n i t s of the Klenow fragment of E. c o l i DNA polymerase I , and i n c u b a t i o n at room temperature f o r 15 minutes. One pL of 0.5 mM dATP chase was added to each tube and in c u b a t i o n continued at room temperature f o r an a d d i t i o n a l 15 minutes. Reactions were terminated by the a d d i t i o n of 5 pL of 98% deionized - 42 -formamide, 10 mM EDTA, 0.2% xylene cyanol, and 0.2% bromophenol blue. The samples were heated to 95°C f o r 3 minutes and q u i c k - c h i l l e d on i c e p r i o r to e l e c t r o p h o r e s i s . The sequencing gels were run as described under the methods to Maxam and G i l b e r t sequencing. 2.7 Some General Methods of DNA A n a l y s i s 2.7.1 Recovery of DNA from Agarose and Acrylamide Gels DNA was recovered from gels by e l e c t r o - e l u t i o n i n t o a d i a l y s i s tube. The DNA band of i n t e r e s t was s l i c e d out of the g el and placed i n a d i a l y s i s tube c o n t a i n i n g a small volume of 0.5X TBE. The tubing was clamped at both ends, t a k i n g care not to trap any a i r bubbles, and immersed i n a shallow l a y e r of 0.5X TBE i n an e l e c t r o p h o r e s i s tank. E l u t i o n of the DNA was g e n e r a l l y achieved by 30-60 minutes at 100 V. The DNA w a s dislodged from the w a l l of the d i a l y s i s tube by r e v e r s i n g the current f o r 30 seconds, and the b u f f e r i n the bag recovered. The e l u t e d DNA was e i t h e r ethanol p r e c i p i t a t e d d i r e c t l y or p u r i f i e d f u r t h e r by ion-exchange chromatography. 2.7.2 P u r i f i c a t i o n of DNA on Mini-Chromatography Columns DNA e l u t e d from agarose gels was f u r t h e r p u r i f i e d by chromatography e i t h e r on DE-52 (Whatman Ltd.) or on RPC-5 analog (BRL) packed i n 200 \iL Eppendorf p i p e t t i p s . Both columns in v o l v e d the i n i t i a l l o ading of DNA i n low s a l t (< 0.1 M NaCl) and eventual e l u t i o n i n high s a l t (> 0.5 M NaCl). The p u r i f i e d DNA was p r e c i p i t a t e d w i t h ethanol and resuspended i n s t e r i l e TE b u f f e r . - 43 -2.7.3 L a b e l l i n g DNA by N i c k - T r a n s l a t i o n High s p e c i f i c a c t i v i t y l a b e l l e d DNA was obtained by n i c k - t r a n s l a t i n g DNA according to the procedure of Rigby e_t_ al^. (176). The 25 uL r e a c t i o n mixture contained 50 mM T r i s - H C l , pH 7.5, 10 mM MgCl 2, 1 mM DTT, 100 ug/mL BSA, 0.2 mM C a C l 2 , 10 uM each of dATP and dTTP, approximately 0.2 ug of p u r i f i e d DNA, and 15 uCi each of [a- 3 2P]dGTP and [a- 3 2p]dCTP (3,000 Ci/mmol, NEN). The r e a c t i o n was s t a r t e d by the a d d i t i o n of 1 uL of DNAase I ( d i l u t e d 1:40,000 from a 1 mg/mL stock) and 2 u n i t s of E^ c o l i DNA polymerase I . The n i c k - t r a n s l a t i o n was c a r r i e d out at 14-15°C f o r 1 hour and terminated by the a d d i t i o n of 125 uL of stop b u f f e r (50 mM EDTA, 100 ug/mL BSA). The l a b e l l e d DNA was separated from the unincorporated dNTPs by c e n t r i f u g a t i o n through a 1 mL column of Sephadex G-50. This spun-column was prepared by packing Sephadex G-50 beads i n t o a disposable 1 mL s y r i n g e . In a standard n i c k - t r a n s l a t i o n r e a c t i o n , 150 uL of very high s p e c i f i c a c t i v i t y (approximately 108cpm/ug DNA) probe was recovered. An a l i q u o t of the probe was denatured by heating to 100°C f o r 5 minutes and q u i c k - c h i l l i n g on i c e , and used d i r e c t l y i n h y b r i d i z a t i o n mixes. 2.7.4 H y b r i d i z a t i o n s A l l NC f i l t e r s prepared f o r h y b r i d i z a t i o n s were t r e a t e d i n e s s e n t i a l l y the same manner. F i l t e r s were heat-sealed i n Seal-a-Meal bags (Sears Ltd.) to which were added p r e h y b r i d i z a t i o n mix (5X SSPE, 50% deionized formamide, 5X Denhardt's reagent (177), 0.1% SDS, and 100 to 200 yg/mL of sheared, denatured c a l f thymus DNA) at 50 uL per cm2 of f i l t e r . P r e h y b r i d i z a t i o n was at 42°C f o r 1 to 4 hours. H y b r i d i z a t i o n s were a l s o c a r r i e d out at 42°C i n the mix described above except that IX Denhardt's - 44 -reagent (0.02% each of PVP, BSA, and F i c o l l ) , and a denatured [ 3 2 P ] l a b e l l e d DNA probe was used. A f t e r h y b r i d i z a t i o n (usually overnight), the f i l t e r s were washed i n two changes of 2X SSPE, 0.1% SDS followed by one change of 0.1X SSPE, 0.1% SDS a l l at room temperature. One f i n a l wash was c a r r i e d out at 50°C i n 0.1X SSPE, 0.1% SDS. The f i l t e r s were fluorographed at -70°C using Kodak X-Omat AR f i l m and a Dupont Cronex i n t e n s i f y i n g screen. 2.8 Construction and Screening of Trout Genomic L i b r a r i e s The v a r i e t y of lambda vectors and b a c t e r i a l hosts were kindly provided by the following: Terry Snutch (XCH4A, E. c o l i DP50„_), Ross br MacGillivray ( E. c o l i Q358, E. c o l i Q359), and Michael Sung (XL47.1, E.  c o l i K802). 2.8.1 I s o l a t i o n of Bacteriophage Lambda DNA Large-scale growth of phage lambda was based on the methods of Yamamoto et a l . (178). An overnight culture of the appropriate b a c t e r i a l host was infected with phage lambda at a m u l t i p l i c i t y of i n f e c t i o n of 0.1 ( i . e . for a t y p i c a l 0.5 L culture, 10 1 0 c e l l s were used with 10 9 pfu). The phage was grown i n 0.5 L of prewarmed (37°C) media i n a 2 L f l a s k . NZYDT (1% NZ-amine, 0.5% yeast extract, 0.5% NaCl, 0.2% CAA, 10 mM MgCl 2, 100 ug/L DAP, and 40 ug/mL thymidine, pH 7) was used for growing phage i n the b a c t e r i a l s t r a i n DP50 C„, whereas NZYC (1% NZ-amine, 0.1% yeast or extract, 0.5% NaCl, 0.1% CAA, 10 mM MgCl 2, pH 7) was used i f the host c e l l s were from the s t r a i n s K802, Q358, or Q359. The flasks were incubated at 37°C with aeration for 6 to 10 h u n t i l the b a c t e r i a l c e l l s lysed to - 45 -release the phage p a r t i c l e s . Approximately 10 mL of CHCl^ was added to the fl a s k and incubation continued for an add i t i o n a l 15 minutes to complete the c e l l l y s i s . B a c t e r i a l debris was removed by cen t r i f u g a t i o n at 9000 x g (15 minutes, 4°C). Supernatants were c a r e f u l l y transferred to a clean f l a s k containing 29.2 g of NaCl ( f i n a l concentration 1 M) and 50 g of PEG ( f i n a l concentration 10%). The contents were mixed and l e f t overnight at 4°C. The PEG p r e c i p i t a t e was c o l l e c t e d by ce n t r i f u g a t i o n at 9,000 x g (20 minutes, 4°C) and the p e l l e t resuspended i n a t o t a l volume of 6 mL SM buffe r (0.1 M NaCl, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 > and 0.02% g e l a t i n ) . To the suspension was added 50 uL of 1 mg/mL DNAase I and 100 uL of 5 mg/mL RNAase A and the mixture incubated at 37°C for 30 minutes. An equal volume of CHCl^ was added to the phage suspension and the phases separated by cen t r i f u g a t i o n at 1,500 x g (15 minutes, 4°C). The aqueous layer was transferred to a fresh tube. To p u r i f y the bacteriophage further, i t was subjected to equilibrium c e n t r i f u g a t i o n i n cesium c h l o r i d e . For every 1 mL of phage, 0.75 mg of cesium chloride was used. Centrifugation was at 45,000 rpm (15 hours, 4°C) in a Beckman VTi65 r o t o r . The phage p a r t i c l e s formed a ti g h t b l u i s h band i n the gradient and were c o l l e c t e d i n a f a i r l y small volume (1 to 2 mL). Extraction of the DNA from phage lambda was performed as follows: 0.1 vol of 10X TE and 1 vo l of deionized formamide was added to the cesium chloride suspension of phage p a r t i c l e s . The mixture was l e f t at room temperature fo r 1 to 2 hours and then 1 v o l of d i s t i l l e d water and 6 vo l of 95% ethanol added. The DNA came out of sol u t i o n within 5 minutes and was pel l e t e d by a 30 second c e n t r i f u g a t i o n . The DNA was rinsed i n 70% ethanol, dried under nitrogen, and resuspended i n TE buffer. F i n a l l y , the DNA was subjected to successive extractions twice with phenol:CHC1- (1:1), and twice with CHC1-. - 46 -The DNA was r e p r e c i p i t a t e d with ethanol and taken up i n TE buffer. 2.8.2 Preparation of Lambda 'Arms' Lambda DNA was digested with the appropriate r e s t r i c t i o n endonuclease, e.g. EcoRI for CH4A (179, 180) and BamHI for L47.1 (181), to l i b e r a t e the in s e r t fragments. A f t e r extraction with phenolrCHCl^ (1:1) and p r e c i p i t a t i o n with ethanol, the DNA was dissolved i n TE buffer supplemented with 10 mM MgCl^ and incubated at 42°C for 1 hour to allow the cohesive ends of lambda to reanneal. This resulted i n one large fragment (the r i g h t and l e f t arms annealed together) and one or two much smaller i n s e r t fragments. The p u r i f i c a t i o n of lambda arms was done by one of two methods. In the case of CH4A, the annealed arms were separated from the i n s e r t fragments by f r a c t i o n a t i o n on a 0.35% agarose g e l . In the second method, L47.1 arms were p u r i f i e d by ce n t r i f u g a t i o n through sucrose density gradients (182). Step gradients (40 mL) of 10, 20, 30, and 40% (w/v) sucrose i n 1 M NaCl, 20 mM Tris-HCl, pH 7.7, and 5 mM EDTA were poured. Annealed L47.1 DNA (50 ng) was loaded onto each gradient and subjected to ce n t r i f u g a t i o n at 26,000 rpm (23 hours, 15°C) i n a Beckman SW27 rotor. Fractions (1 to 2 mL) were c o l l e c t e d by upward displacement with 50% (w/v) sucrose and aliquots analyzed on a 0.5% agarose gel (Figure 2). Fractions containing the annealed arms were pooled, d i l u t e d with 3 v o l of water and the DNA p r e c i p i t a t e d with ethanol. The dried DNA p e l l e t was resuspended i n TE buffer and stored at 4°C. 2.8.3 Preparation of 15-20 Kilobase Fragments of Trout DNA For the CH4A l i b r a r y , trout testes DNA was digested with EcoRI at - 4 7 -M l 4 7 10 13 16 19 22 25 27 29 31 33 35 M J Figure 2. Preparation of the 'arms' of phage lambda DNA by sucrose gradient c e n t r i f u g a t i o n . XL47.1 DNA was digested with BamHI, annealed, and centrifuged through a 10-40% sucrose gradient. Fractions were c o l l e c t e d by upward displacement with 50% sucrose and aliquoats were analyzed by electrophoresis through a 0.5% aragose g e l . Size markers (M) are from a Hind III digest of wild type lambda DNA. The l e f t arm (23.5 Kb, r i g h t arm (10.5 Kb), and i n s e r t ("stuffer") fragments (6.6 Kb) were i d e n t i f i e d . Fractions 22 to 29 containing the annealed arms were pooled. - 48 -varying enzyme:DNA r a t i o s and for d i f f e r e n t durations by Dr. E.P.M. Candido. The DNA from various digests was pooled and fractionated on a 0.7% agarose g e l . The 15-20 Kb region of the DNA on the gel was el e c t r o - e l u t e d onto a Whatman f i l t e r paper backed d i a l y s i s membrane (183). The f i l t e r was washed i n a small volume of TNE (10 mM Tris-HCl, pH 7.6, 10 mM NaCl, and 1 mM EDTA) plus 0.2% SDS. The f l u i d was removed to a fresh tube and the f i l t e r washed as before. The eluted DNA was p r e c i p i t a t e d with ethanol, dried under nitrogen, and resuspended i n TE buffer. Insert DNA for the L47.1 l i b r a r i e s was prepared by i n i t i a l l y e s t a b l i s h i n g conditions for p a r t i a l digestion of trout DNA with Mbol. Digestion conditions ranged from 0.00038 to 0.025 units of Mbol/ug of trout DNA incubated for 15 or 60 minutes at 37°C. These digestions were analyzed on a 0.5% agarose g e l . The optimum condition of digestion, to achieve maximum representation i n the 15-20 Kb range, was determined to be 0.025 units Mbol/pg DNA incubated at 37°C for 60 minutes. For the large-scale preparation of p a r t i a l l y digested trout DNA, h a l f the optimum amount of enzyme was used. An equal aliquot of DNA was digested with the optimal amount of enzyme, but only for 15 minutes. The DNA from both digestions was pooled, extracted twice with phenol:CHCl-j (1:1), and p r e c i p i t a t e d with ethanol. The dried p e l l e t was resuspended i n TE b u f f e r . P r i o r to sucrose gradient c e n t r i f u g a t i o n , the DNA was heated to 68°C for 10 minutes and cooled to room temperature. The c e n t r i f u g a t i o n was as described for the preparation of vector DNA arms. Fractions from the gradients were analyzed on a 0.5% agarose gel (Figure 3). DNA i n the 15-20 Kb siz e range was pooled ( f r a c t i o n s 30-35), p r e c i p i t a t e d with ethanol, and resuspended i n TE buffer. - 49 -M 4 9 14 18 21 23 25 27 29 31 33 35 37 40 T M F i g u r e 3. P r e p a r a t i o n o f 15-20 Kb Mbol fr a g m e n t s o f t r o u t DNA. T r o u t genomic DNA was p a r t i a l l y d i g e s t e d w i t h Mbol and f r a c t i o n a t e d by c e n t r i f u g a t i o n t h r o u g h a s u c r o s e d e n s i t y g r a d i e n t ( 1 0 - 4 0 % ) . F r a c t i o n s were c o l l e c t e d by upward d i s p l a c e m e n t w i t h 50% s u c r o s e and a l i q u o t s o f s e l e c t e d f r a c t i o n s a n a l y z e d by e l e c t r o p h o r e s i s t h r o u g h a 0.5% a g a r o s e g e l . F r a c t i o n s 30 t o 35 were p o o l e d and used s u b s e q u e n t l y t o c o n s t r u c t a l i b r a r y i n XL47.1. S i z e m arkers (M) were from a H i n d l l l d i g e s t o f w i l d t y p e lambda DNA. T = Mbol p a r t i a l d i g e s t o f t r o u t DNA p r i o r t o f r a c t i o n a t i o n . - 50 -2.8.4 Preparation of i n v i t r o Packaging Extracts The procedure employs the lysogenic s t r a i n s NS428 and NS433 (184) kindly provided by Terry Snutch. The two stra i n s provide complementary extracts for e f f i c i e n t packaging of lambda DNA. Colonies of NS428 and NS433 bac t e r i a were grown on M9 (0.6% Na 2HP0 4 > 0.3% KH 2P0 4, 0.5% NaCl, 0.1% NH^Cl, 2 mM MgCl 2, 0.2% glucose, and 0.1 mM CaCl 2) plates at 30°C. Several colonies were checked f o r growth at 30°C and 42°C. Only colonies growing at 30°C, but not at 42°C, were used to innoculate 50 mL of M9 medium. NS428 and NS433 were grown i n separate flasks at 32°C with shaking. The cultures were centrifuged at 1,500 x g (5 minutes, 4°C) and resuspended i n 5 mL of M9 medium. Two 0.5 L cultures of NS433 and one of NS428 were innoculated to an i n i t i a l A , ™ of o U U 0.05 and incubated at 32°C with aeration u n t i l an ^^QQ of 0.3 was reached. Bacteriophage growth was induced by t r a n s f e r r i n g the flasks to a 45°C water bath for 20 minutes with frequent s w i r l i n g , and then to a 37°C incubator with vigorous shaking for 2 hours. Contents from a l l 3 flasks were pooled and c h i l l e d i n ice-water for 10 minutes. From t h i s point everything was kept on i c e to avoid inadvertant l y s i s of the c e l l s . The cultures were subjected to ce n t r i f u g a t i o n at 2,500 x g (10 minutes, 4°C) and the p e l l e t s resuspended i n a t o t a l of 450 mL i c e - c o l d M9 medium. The c e l l s were recentrifuged as above and the supernatant drained completely. Six mL of CH buffer (40 mM Tris-HCl, pH 8, 10 mM spermidine-HCl, 10 mM putrescine-HC1, 0.1% 0-mercaptoethanol, 7% DMSO, and 1.5 mM ATP) was s t i r r e d i n with the p e l l e t s as quickly and gently as possible. Aliquots of 100 pL were transferred to Eppendorf tubes and these were immediately plunged i n l i q u i d nitrogen. The packaging extracts were stored frozen at -70°C. Packaging e f f i c i e n c i e s varied from 10 7 to 10* pfu per ug of undigested lambda DNA. - 51 -2.8.5 L i g a t i o n and Packaging Reactions For the l i g a t i o n of lambda arms to insert DNA, a molar r a t i o of 2:1 (arms:insert) was used at a f i n a l DNA concentration of 0.2 ug/uL. Lig a t i o n was c a r r i e d out at 12°-14°C for 12 to 16 hours i n l i g a t i o n buffer and 1 Weiss unit of T4 DNA l i g a s e . In v i t r o packaging of the l i g a t e d DNA was based on the method of Hohn and Murray (185). An a l i q u o t of frozen packaging extract was thawed on ice f o r 3 minutes. L i g a t i o n mix (with about 2 ug t o t a l DNA), 1.5 uL of 0.1 M ATP, and 20 ML of CH buffer was added d i r e c t l y to the extract and mixed i n with a heat blunted glass c a p i l l a r y . Packaging was c a r r i e d out at 37°C fo r 1 hour. A second extract was thawed as above and 1 uL of 1 mg/mL DNAase I with 2.5 uL of 1 M MgCl 2 added to i t . About 50 uL of t h i s mix was added to the f i r s t packaging reaction and incubation continued at 37°C. Af t e r 30 minutes, 0.9 mL of SM buffer and 3 drops of CHC1 3 were added to the r e a c t i o n mix. The debris was centrifuged out and the packaged phage was stored i n a clean tube at 4°C. 2.8.6 A m p l i f i c a t i o n of the Lambda L i b r a r i e s Both the CH4A and L47.1 l i b r a r i e s were amplified by p l a t i n g out the packaging mixes on f r e s h l y poured pla t e s . These were incubated at 37°C for 12 hours and then overlayed with 5 mL of cold SM buffer. Plates were l e f t at 4°C for a few hours and the overlay c o l l e c t e d . Chloroform was added and amplified l i b r a r i e s stored at 4°C i n sealed tubes or f l a s k s . 2.8.7 Screening of the Lambda L i b r a r i e s The phage lambda l i b r a r i e s were screened e s s e n t i a l l y as described by Benton and Davis (186). Phage were plated out at approximately 10-20,000 - 52 -pfu per plate and grown at 37°C. A dry NC f i l t e r was placed neatly onto the surface of the top-agarose and o r i e n t a t i o n marks made. Afte r 2 minutes the f i l t e r was peeled o f f and immersed DNA side up i n 1.5 M NaCl, 0.5 M NaOH (3 min), then transferred to 1.5 M NaCL, 0.5 M Tr i s - H C l , pH 7.6 (3 min). The f i l t e r was subsequently rinsed twice i n 2X SSPE and a i r dried p r i o r to baking ^n vacuo at 80°C for 2 hours. A f t e r h y b r i d i z a t i o n to a [ 3 2 P ] l a b e l l e d probe, any p o s i t i v e s were traced back to the o r i g i n a l plate and the plaque of i n t e r e s t was p u r i f i e d by a second and t h i r d screening. 2.8.8 Small-Scale Growth of Bacteriophage Lambda DNA from phages i d e n t i f i e d as p o s i t i v e s was prepared by growing a 20 mL culture i n exactly the same manner as that described for the large-scale preparation. A f t e r l y s i s , the culture was transferred to a 30 mL Corex tube and centrifuged at 12,000 x g (10 minutes, 4°C) to remove the b a c t e r i a l debris. To the supernatant was added 6 mL of 50% PEG and 3 mL of 5 M NaCl. The suspension was l e f t at 4°C for several hours and then centrifuged 12,000 x g (10 minutes, 4°C). The p e l l e t was resuspended i n 0.3 mL of DNAase buffer (50 mM Hepes, pH 7.5, 5 mM MgCl 2, and 0.5 mM CaCl 2) and transferred to an Eppendorf tube. Af t e r addition of 5 ng DNAase I and 50 pg RNAase A, the mixture was incubated at 37°C for 30 minutes. The mixture was made IX i n SET (0.5% SDS, 10 mM Tris-HCl, pH 7.8, and 5 mM EDTA) and 100 ug of proteinase K added. The tube was incubated at 68°C for 30 minutes and the contents then extracted a number of times with phenol:CHC1 3 and f i n a l l y with CHC13 alone. The phage DNA was ethanol p r e c i p i t a t e d and the dried p e l l e t resuspended i n 50 pL of TE buffer. - 53 -I I I . RESULTS 3.1 Characterization of the Trout Heat Shock Response at the Protein Level 3.1.1 The Heat Shock Proteins of Trout RTG-2 C e l l s The e f f e c t of temperature elevation or sodium arsenite on trout f i b r o b l a s t s i s the production of a set of new polypeptides. These are r e f e r r e d to as the heat-shock polypeptides (hsps). The hsps of trout have been shown i n the autoradiogram of Figure 4. These proteins were induced with sodium arsenite (panel A) or temperature elevation (panel B). Comparison with extracts of control c e l l s (lane a or d) shows that at least s i x new proteins are synthesized. The molecular weights of the proteins are 87 K, 70 K, 62 K, 42 K, 32 K, and 30 K. The band at 62 K was sometimes resolved as a doublet (Figure 11). This band c o n s i s t e n t l y appears a f t e r sodium arsenite induction but was not prominent i f temperature elevation was used as the inducer (Figure 4B). The major hsp (70 K) was sometimes seen i n control c e l l s , but at a low l e v e l . This may be i n d i c a t i v e of the condition of the c e l l s at the time of harvesting i n SDS sample buffer, i . e . ~ even a s l i g h t degree of anoxia may be s u f f i c i e n t to cause induction of hsp70. A band at 100 Kd was sometimes observed by sodium arsenite induction and could also be a hsp. Densitometry scanning of the autoradiograms c l e a r l y showed the differences i n protein synthesis patterns between control and induced c e l l s (Figure 5). The synthesis of normal c e l l u l a r proteins could be reduced i f the induction with arsenite was prolonged (Figure 4A, lane c ) ; i n this case almost a l l of the incorporation of l a b e l i s into the hsps. It i s i n t e r e s t i n g to note that hsp42 was no longer induced under t h i s extended - 54 -SA o b c HS d e h s p - < 4 8 7 1 4 7 0 4 6 2 4 4 2 - 3 2 — * 3 0 4 3 2 « 3 0 F i g u r e 4. The h e a t - s h o c k p r o t e i n s o f t r o u t RTG-2 c e l l s . (A) P r o t e i n s i n d u c i b l e by Sodium A r s e n i t e ( S A ) : Lane ( a ) c o n t r o l , l a n e (b) 50 pM a r s e n i t e f o r 3 hours and r e c o v e r y o f 1 h o u r , l a n e ( c ) 50 MM a r s e n i t e f o r 24 h o u r s . (B) P r o t e i n s i n d u c i b l e by t e m p e r a t u r e e l e v a t i o n (HS): l a n e ( d) c o n t r o l , l a n e ( e ) 27°C f o r 5 hours and r e c o v e r y a t 22°C f o r 1 h o u r . A l l c e l l s were l a b e l l e d f o r 1 hour w i t h [ 3 s S ] m e t h i o n i n e . P r o t e i n s were s e p a r a t e d on a 10% S D S - p o l y a c r y l a m i d e g e l w h i c h was s u b s e q u e n t l y a u t o r a d i o g r a p h e d . The open t r i a n g l e i n d i c a t e s a n o t h e r p r o t e i n (100 Kd) t h a t may a l s o be i n d u c i b l e by a r s e n i t e . - 55 -70 30 62 87 100 A c 42 A MN 32 A) 5 0 M M S A 2 8 ° C HS C O N T R O L Figure 5. Densitometry scans of autoradiographs from SDS-acrylamide gels. [ 3 5SJmethionine l a b e l l e d proteins were fractionated on a 10% SDS-acrylamide gel and autoradiographed. The X~ray f i l m was subsequently scanned i n a Beckman DU-8 spectrophotometer. The scans from three separate lanes are shown: SA = 50 pM sodium arsenite exposure f o r 24 hours, HS = 28°C heat-shock for 1 hour, and control c e l l s . Arrows indicate positions of hsp and a c t i n (Ac) migration. - 56 -period of s t r e s s ; hsp70 and hsp30 were the major species induced. The l a t t e r proteins were r e a d i l y v i s i b l e on gels with Coomassie blue s t a i n i n g when the c e l l s were induced for 24 hours (Figure 6). The hsp32 i s also v i s i b l e under these conditions. Samples of JK_ melanogaster hsps (a g i f t of L. Moran) induced at 37°C were compared with the trout hsps induced with 50 pM sodium arsenite for 24 hours. The samples were fractionated on a 10% SDS-polyacrylamide gel and autoradiographed (Figure 7). The Drosophila hsps are i n lane a, while the trout hsps are i n lane c. When samples from both were mixed and run together (lane b), i t was seen that hsp70 from Drosophila and trout had i d e n t i c a l m o b i l i t i e s i n t h i s system. The major hsp from the nematode, C.  elegans, has also been found to co-migrate with the trout hsp70 (T. Snutch and R. Kothary, data not shown). 3.1.2 Temperature P r o f i l e of the Heat Shock Response Our usual growth temperature for these c e l l s was 22°C. Increasing the temperature by as l i t t l e as 5°C resulted i n the induction of hsps. The e f f e c t of a range of temperatures on hsp synthesis has been studied and the r e s u l t s shown i n Figure 8. The c e l l s were kept at the appropriate temperature for 1 hour, then returned to 22°C for another hour. This was followed by a 1 hour l a b e l l i n g period with [ 3 5S]methionine. As shown i n the autoradiogram (Figure 8), the response was present i n a l l temperatures up to the l e t h a l temperature of 34°C. Hsp70, hsp32, and hsp30 were present at a l l temperatures up to 34°C; hsp87 and hsp42 were present to 29°C. Heat shocks at higher temperatures, e.g. 37°C, w i l l also e l i c i t hsp synthesis i f the duration of the induction period i s short, e.g. less than 10 minutes (see Figure 8). - 57 -S A C F i g u r e 6. D e t e c t i o n o f hsps w i t h Cooraassie b l u e s t a i n i n g . C e l l s were exposed t o 50 uM sodium a r s e n i t e (SA) f o r 24 hours and the p r o t e i n s from the c e l l e x t r a c t were s e p a r a t e d on a 10% SDS-acrylamide g e l . These p r o t e i n s were compared t o those found i n c o n t r o l c e l l s ( C ) . - 58 -a b c Drosophila melanogaster h s p 7 0 • ^ Trout « h s p 7 0 F i g u r e 7. Comparison o f T r o u t and D r o s o p h i l a hsps on an SDS-acrylamide g e l . Lane (a) h e a t - s h o c k induced (37°C) p r o t e i n s o f D.  m e l a n o g a s t e r ( g i f t o f Dr. L.A. Moran), l a n e ( c ) 24 hours 50 pM sodium a r s e n i t e induced p r o t e i n s o f t r o u t , l a n e (b) a m i x t u r e of the t r o u t and D r o s o p h i l a hsps. - 59 -F i g u r e 8. Temperature p r o f i l e o f the heat shock response. The c e l l s were heat-shocked a t the temperatures (°C) shown f o r 1 hour, then r e c o v e r e d a t 22°C f o r 1 hour and f i n a l l y l a b e l l e d w i t h [ 3 5 S ] m e t h i o n i n e f o r 1 hour a t 22°C. Note t h a t the 37°C hea t - s h o c k was f o r 5 minutes o n l y . The c e l l e x t r a c t was f r a c t i o n a t e d on a 10% SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . The arrows i n d c a t e d hsps 87, 70, 42, 32, and 30 from top to bottom r e s p e c t i v e l y . - 60 -3.1.3 E f f e c t of Duration of the Heat Shock To examine the e f f e c t of prolonged temperature elevation, c e l l s were incubated at 28°C for various lengths of time and then l a b e l l e d with [ 3 5S]methionine for 1 hour at 22°C. As the induction time at 28°C was increased from 1 hour to 16 hours, the l e v e l of incorporation into the hsps also increased (Figure 9). This was e s p e c i a l l y apparent for hsp70, hsp32, and hsp30. The incorporation rate at 16 hours of induction (Figure 9, lane f ) was comparable to that at 5 hours (lane d) and 7.5 hours (lane e ) . These r e s u l t s suggest that the hsps are f u l l y induced by 5 hours at 28°C. 3.1.4 Recovery from Heat Shock To examine the r e v e r s i b i l i t y of the heat shock response, c e l l s heat shocked at 27°C for 1 hour were allowed to recover at 22°C for varying lengths of time and then l a b e l l e d for 1 hour at 22°C with [ 3 5S]methionine. The r e s u l t s are presented i n Figure 10. Although the amounts of hsp87 and hsp30 were not altered s i g n i f i c a n t l y i n the time span studied, hsp70 and hsp42 l e v e l s dropped a f t e r 3 hours at 22°C. This suggests e i t h e r that the genes for hsp70 and hsp42 are more e f f i c i e n t l y turned o f f i n the absence of the inducing stimulus than are the hsp87 and hsp30 genes, or that the mRNAs for hsp87 and hsp30 are more stable. 3.1.5 Sodium Arsenite Concentration Study As shown above (Figure 4A), sodium arsenite induced a spectrum of hsps i n trout c e l l s which were very s i m i l a r to that induced by temperature el e v a t i o n . The only s i g n i f i c a n t difference was the extra band at 62K daltons which was induced by sodium arsenite but not by temperature s h i f t . A study was performed to determine the optimum arsenite concentration - 61 -a b c d e f mm mm m F i g u r e 9. Time s t u d y o f h e a t - s h o c k . C e l l s were heat-shocked a t 28°C f o r v a r i o u s l e n g t h s o f time and then l a b e l l e d a t 22°C f o r 1 hour w i t h [ 3 5 S j m e t h i o n i n e . These p r o t e i n s were s e p a r a t e d on a 10% SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . Lanes a r e : (a) c o n t r o l , (b) 1 hour heat-shock, ( c ) 3 hours heat-shock, (d) 5 hours heat-shock, (e) 7.5 hours heat-shock, ( f ) 16 hours h e a t - s h o c k . The t r i a n g l e s i n d i c a t e the hsps 87, 70, 42, 32 and 30 from top to bottom r e s p e c t i v e l y . - 62 -Figure 10. Recovery from heat-shock. C e l l s were heat-shocked at 27°C for 1 hour and allowed to recover at 22°C for d i f f e r e n t lengths of time. They were then l a b e l l e d with f 3 5SJmethionine for 1 hour at 22°C. The c e l l extracts were run on a 12.5% SDS-acrylamide gel and autoradiographed. The recovery times were as follows: lanes (a) 0 hours, (b) 1.5 hours, (c) 3 hours, (d) 4.5 hours, and lane (e) control c e l l s . - 63 -for hsp induction. The range of f i n a l concentrations used was from 1 to 600 pM (Figure 11, lanes b ~ l ) . The c e l l s were induced for 3 hours with the appropriate amount of sodium arsenite. This was followed by incubation i n fresh medium for 2 hours, a f t e r which they were l a b e l l e d for an hour with [ 3 5SJmethionine. The induction, recovery, and l a b e l l i n g were a l l done at 22°C. As shown i n the autoradiogram of Figure 11, d i f f e r e n t hsps varied i n t h e i r i n d u c i b i l i t y as a function of the arsenite concentration. Hsp70 and hsp87 induced very r e a d i l y with an optimum at about 50 pM (lane i ) . The doublet at 62K daltons was also very r e a d i l y induced but decreased i n amount a f t e r 50 pM. Hsp42 was induced equally well at a l l the concentrations up to 300 pM (lane k). Hsp32 increased from 5 to 50 pM arsenite and then disappeared again. The most dramatic e f f e c t was on hsp30. Its l e v e l was s p e c i f i c a l l y enhanced at arsenite concentrations of 15 to 100 pM (lanes g - j ) , with a peak of 50 pM. Since a l l the hsps were inducible at an arsenite concentration of 50 pM, t h i s l e v e l was used i n subsequent experiments. 3.1.6 Recovery from Sodium Arsenite Induction Since the e f f e c t of sodium arsenite was s i m i l a r to that of temperature el e v a t i o n i n the induction of the hsps, the s i m i l a r i t y of the reversal of the induction was examined. As shown above (Figure 10), the synthesis of hsp70 and hsp42 returned to normal control l e v e l s following recovery from temperature shock. To study recovery from arsenite induction, trout c e l l s were i n i t i a l l y induced for 3 hours with 50 pM sodium arsenite and then allowed to recover i n fresh medium for d i f f e r e n t lengths of time. This was followed by a 1 hour period of l a b e l l i n g with [ 3 5S]methionine. A l l the hsps were s t i l l present 2 hours a f t e r the arsenite had been removed (Figure - 64 -F i g u r e 11. Hsp s y n t h e s i s a t v a r y i n g sodium a r s e n i t e c o n c e n t r a t i o n s . C e l l s were induced w i t h v a r i o u s c o n c e n t r a t i o n s o f a r s e n i t e f o r 3 hours and then l e f t t o r e c o v e r i n f r e s h medium f o r 2 h o u r s . L a b e l l i n g was f o r 1 hour w i t h [ 3 5 S J m e t h i o n i n e . C e l l e x t r a c t s were s e p a r a t e d on a 10% SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . C o n c e n t r a t i o n s (pM) of a r s e n i t e used were as f o l l o w s : (a) 0, (b) 1, (c) 2.5, (d) 5, (e) 7.5, ( f ) 10, (g) 15, (h) 25, ( i ) 50, ( j ) 100, (k) 300, and (1) 600. - 65 -12, lane c ) . This suggests that the translatable heat shock mRNA l e v e l was at a maximum at th i s time. Again the 100 Kd protein was present with the others and the 62Kd band was now c l e a r l y resolved as a doublet. As with recovery from temperature shock, hsp42 was the f i r s t to disappear; here i t s synthesis was terminated between 2 and 6 hours of recovery. Production of hsp70 and the doublet of hsp62 was halted before 10 hours of recovery. Hsp87 synthesis was terminated a f t e r about 15 hours of recovery. Although the l e v e l of hsp30 dropped a f t e r 10 hours of recovery, i t was s t i l l detectable even a f t e r 28 hours of recovery. Thus, the majority of the heat shock mRNAs are ei t h e r not present or present but not translated a f t e r 6 to 10 hours from the end of induction. As i n the case of heat shock, the d i f f e r e n t recovery times for hsps following arsenite induction may be attr i b u t e d to differences i n the rates of repression of the hsp genes, to var i a t i o n s i n the hsp mRNA s t a b i l i t i e s , or both. 3.1.7 L o c a l i z a t i o n of the hsps RTG-2 c e l l s were induced at 28°C for 1 hour, recovered at 22°C for 2 hours, then l a b e l l e d with [ 3 5Sjmethionine at 22°C for 1 hour. The la b e l was chased for 0 or 40 minutes i n fresh medium and the c e l l s harvested as usual. For the control s i t u a t i o n , uninduced c e l l s were l a b e l l e d with [ 3 sS]methionine at 22°C for 1 hour and harvested without any pulse-chase. The c e l l s were separated into the cytoplasmic and nuclear fract i o n s and subsequently analyzed on a 10% SDS-polyacrylamide g e l . The auto-radiogram i s shown i n Figure 13. The presence of both hsp70 and hsp30 was e a s i l y detected i n the nuclear f r a c t i o n of the induced c e l l s (Figure 13, lanes e, f ) . However, substantial amounts of hsp70 and hsp30 were s t i l l present i n the cytoplasmic f r a c t i o n . An i n t e r e s t i n g trend was the r e l a t i v e - 66 -a b c d e f g h i j F i g u r e 12. Recovery from sodium a r s e n i t e i n d u c t i o n . C e l l s were induced w i t h 50 yM a r s e n i t e f o r 3 hours and then l e f t t o r e c o v e r i n f r e s h medium f o r d i f f e r e n t l e n g t h s o f time. F o l l o w i n g the r e c o v e r y p e r i o d , c e l l s were l a b e l l e d w i t h [ 3 5 S ] m e t h i o n i n e f o r 1 hour. C e l l e x t r a c t s were s e p a r a t e d on a 10% SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . The r e c o v e r y p e r i o d s were: (b) 0 h o u r s , ( c ) 2 h o u r s , (d) 6 hours, (e) 10 h o u r s , ( f ) 15 h o u r s , (g) 20 h o u r s , (h) 24 hours, ( i ) 28 hours, ( j ) 32 h o u r s ; l a n e (a) i s t h e c o n t r o l . The s o l i d t r i a n g l e s d e s i g n a t e the hsps 87, 70, 62, 42, 32, and 30 from top to bottom r e s p e c t i v e l y . The open t r i a n g l e i n d i c a t e s the 100 Kd p r o t e i n . - 67 -Figure 13. Subcellular l o c a l i z a t i o n of the hsps. Following induction and l a b e l l i n g , c e l l s were separated into the cytoplasmic and nuclear fr a c t i o n s as described i n the the Experimental Procedures. Conditions used were as follows: 28°C heat-shock for 1 hour followed by a 2 hours recovery period at 22°C. L a b e l l i n g with [ 3 sS]methionine was at 22°C for 1 hour. Cytoplasmic and nuclear fr a c t i o n s were subjected to SDS-acrylamide gel electrophoresis and autoradiography. Lanes: (a) control cytoplasm, (b) control n u c l e i , (c) heat-shocked cytoplasm, 0 minute chase, (d) heat-shocked cytoplasm, 40 minute chase, (e) heat-shocked nuclear f r a c t i o n , 0 minute chase, ( f ) heat-shocked nuclear f r a c t i o n , 40 minute chase. - 67a-d e f « hsp 70 « hsp30 - 68 -increase i n hsp70 and hsp30 i n the nuclear f r a c t i o n when a 40 minute pulse-chase was done. Hsp87 was found e x c l u s i v e l y i n the cytoplasmic f r a c t i o n . Though d e f i n i t e conclusions about the l o c a l i z a t i o n of the trout hsps cannot be made, the r e s u l t s suggest an increase i n le v e l s of hsp70 and hsp30 i n n u c l e i with time. The large amount of hsp70 and hsp30 associated with the cytoplasmic f r a c t i o n may be r e f l e c t i n g the condition of the c e l l , i . e . i n the recovering c e l l hsps may not be required i n the n u c l e i , and may have already relocated i n the cytoplasm by the time the l a b e l l i n g was completed at 22°C. 3.2 Tr a n s l a t i o n a l Regulation of the Heat Shock Response 3.2.1 In v i t r o t r a n s l a t i o n of mRNA Total RNA i s o l a t e d from control c e l l s or from induced c e l l s (50 jiM sodium arsenite for 24 hours) was translated using a r e t i c u l o c y t e c e l l free protein synthesis system. The translated products were fractionated on a 10% SDS-polyacrylamide g e l . From the r e s u l t s (Figure 14), i t was clear that the induced mRNA contained the messages for the hsp87, hsp70, hsp62, hsp32, and hsp30, whereas the control mRNA did not. This indicated that the induction of the hsps was co n t r o l l e d at the t r a n s c r i p t i o n a l rather than the t r a n s l a t i o n a l l e v e l . Comparison of the i n vivo l a b e l l e d proteins ( a f t e r 24 hr, 50 pM sodium arsenite induction) i n Figure 4A (lane c) with the i n v i t r o l a b e l l e d proteins (Figure 14, lane c) showed that the normal c e l l u l a r proteins, which were not synthesized i n vivo, during hsp induction, are synthesized i n v i t r o . Thus, although normal mRNAs are present i n the induced c e l l s , t h e i r t r a n s l a t i o n i s i n h i b i t e d . - 6 9 -hsp F i g u r e 14. In v i t r o t r a n s l a t i o n p r o d u c t s o f t r o u t mRNA. RNA was t r a n s l a t e d i n the r a b b i t r e t i c u l o c y t e system, w i t h [ 3 5 S J m e t h i o n i n e as the l a b e l . Lane (a) water c o n t r o l , (b) c o n t r o l mRNA, ( c ) induced mRNA (24 hou r s , 50 uM a r s e n i t e ) . Note: T r a n s l a t i o n p r o d u c t s were f r a c t i o n a t e d on a 10% SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . - 70 -3.2.2 Sucrose Gradient Fr a c t i o n a t i o n of RNA Total RNA from induced trout c e l l s (24 hours, 50 uM sodium arsenite) was fractionated according to size on a 10-40% (w/v) sucrose gradient. The r e s u l t i n g A 2gQ p r o f i l e of the gradient i s shown i n Figure 15. RNA from selected f r a c t i o n s were translated i n v i t r o and the products analyzed on a 12.5% SDS-polyacrylamide g e l . The autoradiogram i s shown i n Figure 15. The majority of the RNA was c o l l e c t e d from fract i o n s 5 to 12. Separation of the small hsp mRNA from the hsp70 mRNA was evident and th i s could be a useful step i n the p u r i f i c a t i o n of heat-shock messages. If need be, c e r t a i n enriched f r a c t i o n s could be used as RNA probes against a t o t a l cDNA l i b r a r y to narrow down the number of clones to be screened. However, since a heter-ologous probe for hsp70 was obtained, the RNA enrichment approach was not pursued. 3.3 I s o l a t i o n of the Trout Hsp70 cDNA Clones 3.3.1 Screening of the Trout cDNA Library A trout cDNA l i b r a r y , made by the methods of Wickens e_t a l . (161) was screened for the presence of hsp70 sequences. From a t o t a l of about 700 independent clones, two trout hsp70 cDNA sequences, pTHS70.7 and pTHS70.14, were i s o l a t e d . The i d e n t i f i c a t i o n of these two clones was based on t h e i r homology to a Drosophila hsp70 gene from the clone 132E3 (provided by Dr. L.A. Moran, r e f 96). 3.3.2 Preliminary Examination of pTHS70.7 and pTHS70.14 Plasmid DNA for the two trout hsp70 clones was i s o l a t e d and sub-jected to Southern bl o t analysis a f t e r digestion with several d i f f e r e n t - 71 -o < TOP FRACTION BOTTOM F i g u r e 15. Sucrose g r a d i e n t f r a c t i o n a t i o n o f RNA. T o t a l RNA from i n d u c e d RTG-2 c e l l s (50 pM sodium a r s e n i t e , 24 h) was f r a c t i o n a t e d on a 15-35% s u c r o s e g r a d i e n t . F r a c t i o n s (0.5 mL) were c o l l e c t e d by upward d i s p l a c m e n t w i t h 50% s u c r o s e . RNA i n i n d i v i d u a l f r a c t i o n s was p r e c i p i t a t e d w i t h e t h a n o l and a l i q u o t s t r a n s l a t e d i n v i t r o . The t r a n s l a t i o n p r o d u c t s were s e p a r a t e d on a 10% SDS-acrylamide g e l and a u t o r a d i o g r a p h e d . C = water c o n t r o l , T = t o t a l i nduced RNA. - 72 -r e s t r i c t i o n enzymes. Hybridization was to a [ 3 2 P ] l a b e l l e d 1.0 Kb PstI fragment of the Drosophila hsp70 gene. The r e s u l t s are shown i n Figure 16 and homology between the Drosophila gene and both pTHS70.7 (lanes a - d) and pTHS70.14 (lanes e - h) i s evident. DNA from pBR322 was used as the control and very l i t t l e h y b r i d i z a t i o n to the Drosophila gene was observed (lanes i - k ) . Upon further examination of pTHS70.7, i t was discovered that the r i g h t h a l f of the cDNA was not homologous to the Drosophila hsp70 gene, and did not code for an inducible mRNA i n trout c e l l s . This anomaly was analyzed separately and the r e s u l t s presented i n the appendix. 3.4 Further Analysis of THS70.7 and THS70.14 3.4.1 Nucleotide Sequences for THS70.7 and THS70.14 THS70.7 and THS70.14 were further analyzed by nucleotide sequencing. P a r t i a l r e s t r i c t i o n maps and the sequencing strategy are presented i n Figure 17. The two cDNAs proved to be incomplete copies of hsp70 messages, and were from d i f f e r e n t regions, with an overlap of about 250 nucleotides. The primary nucleotide sequences of THS70.7 and THS70.14 are shown i n Figure 18. The GC content i n the coding regions of both THS70.7 (57.7%) and THS70.14 (50.3%) i s r e l a t i v e l y high. The o v e r a l l GC content of the rainbow trout genome has been reported to be 43% (188). Both cDNAs have one long open reading frame (Figure 18). The THS70.7 sequence contains information for a 278 amino acid long region of hsp70. This corresponds to amino acids 128 to 406 of the Drosophila hsp70 (92). A s e r y l residue at p o s i t i o n 213 of the Drosophila hsp70 i s deleted from THS70.7. A s i m i l a r d e l e t i o n has been reported i n yeast hsp70 (65). The THS70.14 sequence contains information for the f i r s t 213 amino acids of hsp70, assuming - 73 -Figure 16. Southern bl o t analysis of Trout hsp70 cDNA clones. DNA from pTHS70.7, pTHS70.14, and pBR322 was i s o l a t e d and digested with several d i f f e r e n t r e s t r i c t i o n enzymes. The di g e s t i o n products were fractionated on a 1.0% agarose gel and DNA transferred to a NC paper. The blot was probed with a [ 3 2 P ] l a b e l l e d fragment from the Drosophila hsp70 gene (a 1.0 Kb PstI fragment from 132E3, r e f . 96). Digests were as follows: (a) and (e) PstI; (b), ( f ) , and ( j ) EcoRI/PstI; ( c ) , (g), and (k) BamHl/Pstl; (d) and (h) S a i l ; ( i ) EcoRI. Note that pTHS70.14 DNA from t h i s preparation was r e s i s t a n t to digestion by r e s t r i c t i o n enzymes, however h y b r i d i z a t i o n to the hsp70 gene was not i n h i b i t e d . Size markers are from a H i n d l l l digest of phage lambda DNA. - 7 3 a -- 74 -Figure 17. Partial restriction map and strategy used to determine the nucleotide sequences of THS70.7 (A) and THS70.14 (B) cDNAs. Arrows represent the direction of sequencing from Klenow-labelled fragments, using either the chemical cleavage method (squares) or the dideoxy termination method (circles).. The lengths of the arrows represent the actual number of nucleotides sequenced from each site. The areas used as hybridization probes have been indicated by a dashed line, above the maps. The boxed regions represent the cDNA sequences whereas the thin lines represent pBR322 sequences. The hatched area within the boxes indicates the region of overlap between the two cDNAs. This overlap region has a 73.3% homology at the level of nucleotide sequence. The restriction sites are: A, Avail; B, BamHI; Bg, Bgll; D, Ddel; H, Haelll; P, PstI; S, SauIIIA; T, Tag I. '//////////// 100 bp, - 75 -Figure 18. Nucleotide sequences for THS70.7 (A) and THS70.14 (B) CDNAS with their predicted amino acid sequences. The overlap region between the two cDNAs has been indicated by a line above the respective amino acid sequences. The single letter amino acid code is A, alanine; C, cysteine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; H, histidine; I, isoleucine; K, Lysine; L, Leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine. A THS70.7 A E A Y L G Q K V S N A V CTGCAGGGGGGGGGGGGGGGTCGCTGAGGCTTACCTGGGCCAGAAGGTGTCCAATGCAGT 10 20 30 40 50 60 I T V P A Y F N D S Q R Q A T K D A G V CATCACAGTCCCTGCCTACTTCAACGATTCACAGAGACAGGCCACTAAGGACGCTGGAGT 70 80 90 100 110 120 I A G L N V L R I I N E P T A A S I A Y GATCGCTGGGCTGAATGTGCTGAGGATCATCAATGAGCCCACGGCGGCCAGCATCGCCTA 130 140 150 160 170 180 G M D K G M S R E R N V L I F D L G G G TGGCATGGACAAAGGCATGTCCAGGGAACGCAACGTCCTTATTTTTGACCTGGGTGGGGG 190 200 210 220 230 240 T F D V S I L T I E D G I F E V K A T A CACCTTTGACGTGTCCATCCTGACCATCGAGGATGGGATCTTTGAGGTGAAGGCCACAGC 250 260 270 280 290 300 G D T H L G G E D F D N R L V S H F V E TGGAGACACTCACCTGGGCGGGGAGGACTTTGACAACCGCCTGGTCAGTCACTTTGTGGA 310 320 330 340 350 360 E F K R K H K K D I S Q N K R A L R R L GGAGTTCAAGAGGAAACACAAGAAGGACATCAGCCAGAACAAGCGGGCTCTGAGGAGGCT 370 380 390 400 410 420 R T A C E R A K R T L S S S S Q A S I E GAGGACAGCCTGCGAGAGGGCCAAGAGAACACTGTCCTGCAGCTCCCAGGCCAGCATTGA 430 440 450 460 470 480 I D S L F E G I D F Y T S I T R A R F E GATTGACTCTCTTTTTGAGGGCATCGACTTCTACACCTCCATCACCAGGGCTCGTTTTGA 490 500 510 520 530 540 E M C S D L F R G T L E P V E K A L G D GGAAATGTGTTCCGACCTCTTCAGGGGAACCCTGGAGGCTGTGGAGAAAGCCCTCGGGGA 550 560 570 580 590 600 A K M D K A Q I H D V V L V G G S T R I TGCCAAGATGGACAAGGCCCAAATTCACGACGTCGTCCTGGTCGGAGGCTCCACCCGGAT 610 620 630 640 650 660 P K V Q K L L Q D F F N G R E L N K S I CCCCAAGGTCCAGAAGCTCCTGCAGGACTTTTTCAACGGCCGAGAGCTAAACAAGAGCAT 670 680 690 700 710 720 N P D E A V G Y G L A I Q A A I L S G D CAACCCAGACGAGGCGGTCGGCTACGGGCTCGCCATCCAGGCGGCCATCTTGTCTGGCGA 730 740 750 760 770 780 K S E N V Q D L L L L D V A P L S L G I CAAGTCTGAGAACGTCCAGGATCTGGTGCTGCTGGATGTGGCTCCCCTGTCCCTGGGCAT 790 800 810 820 830 840 E T A G G CGAAACCGCCGGAGGGT 850 . B THS70.14 CTGCGGGGGGGGGCGCCATTGTTCAACTCCGATCAACATCAGCATCACCTTCGGTCAAAT 10 20 30 40 50 60 M S K G P A V G I D L G T T Y AATTTATTCGGTAACATGTCTAAGGGACCAGCAGTCGGCATCGATCTCGGGACCACCTAC 70 80 90 100 110 120 S C V G V F Q H G K V E I I A N D Q G N TCCTGCGTGGGTGTGTTCCAGCATGGCAAGGTTGAAATCATTGCCAACGACCAAGGCAAC 130 140 . 150 160 170 180 R T T P S Y V A F T D S E R L I G D A A AGGACCACTCCAAGCTACGTTGCCTTCACTGACTCTGAGAGGCTCATCGGTGATGCTGCC 190 200 210 220 230 240 K N Q V A M N P C N T V F D A K R L I G AAGAATCAGGTTGCCATGAACCCCTGCAACACAGTATTCGATGCTAAGAGACTGATTGGC 250 260 270 280 290 300 R R F D D G V V Q S D M K H W P F E V I CGCAGGTTTGATGATGGAGTTGTTCAATCGGACATGAAGCATTGGCCCTTTGAAGTTATC 310 320 330 340 350 360 N D S T R P K L Q V E Y K G E T K S F Y AATGATTCTACTCGGCCTAAGCTCCAAGTTGAATACAAAGGAGAGACTAAGTCCTTCTAC . 370 380 390 400 410 420 P E E I S S M V L V K M K E I A E A Y L -CCAGAAGAAATTTCATCTATGGTTCTGGTCAAGATGAAGGAGATTGCTGAGGCCTACCTT 430 440 450 460 470 480 G K T V N N A V V T V P A Y F N D S Q R GGGAAAACTGTCAACAATGCTGTTGTTACCGTACCTGCCTACTTCAATGACTCCCAGCGC 490 500 510 520 530 540 Q A T K D A G T I S G L N V L R I I N E CAGGCAACCAAAGATGCTGGTACCATCTCGGGGCTGAATGTGCTGCGTATCATCAATGAG 550 560 570 580 590 600 P T A A A I R T G L D K K V G A E R N V CCAACTGCTGCTGCCATTCGTACGGGCCTGGACAAGAAGGTCGGTGCTGAAAGGAATGTC 610 620 630 640 650 660 L I F D L G G G T F D V S I L T I E CTTATCTTTGATCTGGGTGGCGGCACCTTTGACGTGTCCATCTTGACCATCGAGGCCCCC 670 680 690' 700 710 720 CCCCCCCCCTGCAG 730 - 76 -that i t s t a r t s at the f i r s t methionine. The predicted amino terminal sequence for THS70.14 d i f f e r e d from that of the Drosophila gene, i n that i t contained an extra three amino acids. 3.4.2 Comparison of Hsp70 from Trout, Drosophila, and Yeast The predicted amino acid sequence of a complete Drosophila hsp70 gene and of an inducible yeast hsp70 gene (YG100) have been published (92, 65). Figure 19 compares a section of these sequences to that of THS70.7. Amino acids that d i f f e r have been indicated. The highly conserved nature of the three hsp70 sequences i s evident. Many of the differences i n the three hsp70 sequences occur i n the same po s i t i o n s . Conservative amino acid changes account f or approximately 55% of the differences between the trout and Drosophila sequences, and 48% of those between trout and yeast. The extent of homology between THS70.7, THS70.14, Drosophila hsp70 (92) and YG100 (65) i s summarized i n Figure 20. In a l l cases, the percentage homology was calculated f o r the t o t a l sequence information a v a i l a b l e for the overlap regions. As expected, the degree of sequence divergence at the nucleotide l e v e l i s greater than that at the amino acid l e v e l . I n t e r e s t i n g l y enough, the nucleotide sequences of THS70.7 and THS70.14 are only 73.3% homologous i n t h e i r overlap region, yet t h e i r homology at the amino acid l e v e l i s quite high (88%). Thus even within trout, codon preference varies between the two genes i n the regions analyzed. Compared with the Drosophila hsp70 gene, YG100 has less homology to both THS70.7 and THS70.14 at the nucleotide l e v e l . However, when the amino acid sequences are compared, YG100 and the Drosophila hsp70 show s i m i l a r degrees of homology to the trout hsp70 (see also Figure 19). - 77 -Figure 19. Comparison of the predicted amino acid sequences of THS70.7, a Drosophila hsp70 gene (taken from Ingolia e_t a l . , r e f . 92), and yeast hsp70 gene YG100 (taken from Ingolia et a l . , r e f . 65). Regions compared are amino acids number 128 to 406, based on the Drosophila hsp70 numbering. Mismatches i n the sequences have been boxed i n . The sin g l e dashes represent deleted amino acids r e l a t i v e to the compared sequence. The s o l i d l i n e i n the yeast sequence represents information not yet a v a i l a b l e . - 77a-[t, p Cn E-« E-> E-" O O C5 O O O O O O J J J P P Q p P (n (—1 H-1 > > > 2 1. 2 s s i u P P p in :*i P o 2 •2 X P n 12 J P I O < < < »—i t - l co < < < < < < EH E-a. a, CU p p 2 2 2 i—i I—1 t—i t-n i - i K a « P > > > 2 2 2 P O to < < < i—i H H n l> EH to O < < < p p P EH EH < < < o> O a CA CA a CO CO CO p p p 2 2 2 P Cn >H >H < < < OH Cn CU > > > E- EH I H H > > > > < <, 2 P P CO E-< 2 > I—< > L O O p to 3 p \< CO p P < < N.. O O ^ o •r i/> g -r O i/> J- ^ X k O •— Q >-o> p a CO EH CO CO i CO CO CO CO CO CO p l - l > EH EH P Pi CA 2 in P < < a CO p. P w u < v l < < < EH EH EH K a CK p p p « a « CA CA CA p p p < < <: Pu o> 2 2 2 Ul CO EH CO CA CO »-H p P p P P iA *i « :^ Cn Cn Cn p P w P CO O i > < 1-H Cn l i s rto P 2 i > p P p oi Pi 2 2 2 P P P Cn Cn Cn P P P P P U O O to to P P P X rr. EH EH EH P P p o to o < < < EH EH EH << CO < in a > > p p w Cn Cn Cn P HH 1 CO 1 t? <7 o p P p p P p 1—1 t—1 FH fn p p P 1—1 P CO CO CO > > > p P p ^ o ° o ^ ^ o «n i t— X ^ O I— D >-p In ,k In d p P .H P a a > > cu Cu Cn Cn DJ EH EH EH CO CO CO o to u o o > > > p p p > > p p p X p t—1 1-H > OI o< 7^ t/ii p 15. S PI a: < < p n o 2 p p p K •< in t2 P p p > > > Cu Pu cu Oi Rl p P p FH f-< f H IO P P p P P P P 2 o CO <; <«; ,y u i s p PI p p p p p p p Cn Cn « Cn Cn < < < CA EH CO EH H H > »—l CO CO EH EH EH > H >^  p Cn Cn p P P to O p P P Cn Cn 2 P P CO < to p P Q p r-H P U 1-H t—i > CO EH CO < < EH o d o C O X o X L.' O i— D >-g o o o < < < EH EH EH P P U 1-H 1-H t - l u o e» p p P CO CO CO p p p CU Oi Cu < < < > > S G I ? 3 p p p p J > l Q p O O1 > H H 2 i^ P V 1 1 CO T I oil p p O o CO CO p p 1—1 1—1 < < < < Oi O H > l < <d P 5 O J? > > < < p P p P Cu CU 2 z t-H t-H CO CO * PI Z 2 •-3 P P 2 Pi ?< , ^ to is o ^ o -r O l/l —" X O t— Q >-- 78 -THS70.7 THS70.14 Dr.HS70 YG100 THS70.7 \ A B\ 73.3 72.0 66.2 THS70.14 88.1 71.3 67.5 Dr.HS70 79.1 79.5 64.1 YGIOO 79.0 77.1 72.0 gure 20. A matrix summarizing the nucleotide homology (A) and the amino acid homology (B) between THS70.7, THS70.14, Drosophila hsp70, and YG100. The homologies are given as percentages from the t o t a l a v a i l a b l e sequence information i n the overlap regions. - 79 -3.5 Synthesis and Turnover of Trout Hsp70 mRNA 3.5.1 RNA Northern and Dot Blot Analysis To ensure that pTHS70.7 and pTHS70.14 were coding for induced hsp70 species, RNA from control and sodium arsenite treated RTG-2 c e l l s was subjected to Northern and RNA dot b l o t analysis (Figure 21). The induction of hsp70 mRNA (approximate size 2.2 Kb) i n the arsenite-induced c e l l s i s evident. Control c e l l s contained very l i t t l e ( i f any) message for hsp70. A heterologous probe from Drosophila (Figure 21C) resulted i n a much weaker h y b r i d i z a t i o n compared to that of THS70.7 (Figure 21A) and THS70.14 (Figure 21B). This i s more obvious when the two sets of RNA dot bl o t s are compared. Here, equal amounts of control and induced RNA were blotted on both f i l t e r s . The THS70.7 probe gave a much stronger h y b r i d i z a t i o n s i g n a l , even at shorter exposure times. Multiple bands i n the induced mRNA were revealed by hy b r i d i z a t i o n to l a b e l l e d THS70.7 (Figure 21A). This indicates the existence of eit h e r an hsp70 multigene family i n trout or of s p l i c i n g intermediates from a sing l e t r a n s c r i p t . As w i l l be seen from evidence presented below, the former p o s s i b i l i t y i s more l i k e l y . 3.5.2 Induction of Hsp70 mRNA The major inducible heat shock protein i n trout RTG-2 c e l l s i s a 70,000 dalton species. The k i n e t i c s of induction of th i s hsp have been shown to depend to the i n t e n s i t y of st r e s s . Here, a study was undertaken to determine whether s i m i l a r k i n e t i c s are observed at the l e v e l of t r a n s c r i p t i o n . The cytoplasmic quick-blots were hybridized to a 0.7 Kb PstI fragment from a trout hsp70 cDNA, THS70.7. This fragment codes for amino acids 128 to 348 of hsp70, based on the reported Drosophila hsp70 - 80 -Figure 21. Northern bl o t analysis of trout RTG-2 RNA from control (c) and sodium arsenite induced ( i ) c e l l s . Either 2 pg (A and B) or 0.2 pg (C) of poly A + RNA was glyoxalated, separated by electrophoresis on a 1.4% (A and B) or 1.2% (C) agarose g e l , and transferred to n i t r o c e l l u l o s e f i l t e r s . The insets to A and C are dot blots of t o t a l RNA, 5 pg on each spot. Hybridization was to [ 3 2 P ] l a b e l l e d THS70.7 (A), THS70.14 (B), or a 1.0 Kb PstI fragment from a Drosophila hsp70 gene (C) at 42°C i n 50% formamide. The siz e was estimated by comparison to glyoxalated H i n d l l l digested DNA of phage lambda. Note the differences i n exposure times required for the d i f f e r e n t h y b r i d i z a t i o n probes: (A) and (B), 1 hour, (C) 7 days. The exposure times f o r the dot-blots have been indicated. - 8 0 a -2 hour exp. 15 hour exp. - 81 -sequence (92). RTG-2 c e l l s , grown at 22°C, are induced to synthesize hsps at 27°-28°C. When these c e l l s were placed at 28°C, the l e v e l of hsp70 mRNA increased dramatically for the f i r s t 2 hours (Figure 22). A f t e r 2 hours, a gradual decrease i n hsp70 mRNA le v e l s was seen. This suggests that either the c e l l s begin dying o f f under these conditions, or that some autoregulation of mRNA synthesis occurs. Since there i s no decrease i n protein synthesis i n these c e l l s a f t e r 16 hours at 28°C (see Figure 9), the l a t t e r explanation i s more l i k e l y . When 50 uM sodium arsenite was used as the inducer, no decrease i n hsp70 mRNA at long exposure times was observed (Figure 23); the rate of increase i n hsp70 mRNA le v e l s was s i m i l a r to that seen with temperature induction. After 24 hours of exposure to arsenite, the l e v e l of hsp70 mRNA i n the c e l l s was maintained, and even rose s l i g h t l y . This agrees with our previous observations on rates of hsp synthesis, i . e . maximal rates of hsp synthesis occur following long exposures (e.g. 24 hours) to 50 pM sodium arsenite, where t r a n s l a t i o n of pre-existing mRNAs i s also maximally i n h i b i t e d . The induction of hsp70 by sodium arsenite i s rapid, occurring within minutes. The l e v e l of hsp70 expression was followed immunologically using antibody to chicken hsp70. This antibody cross-reacts strongly with the trout hsp70 (E.A. Burgess, personal communication). Trout hsp70 was detectable at low le v e l s i n uninduced c e l l s by th i s technique. This may be due to the presence of hsp70-like genes i n trout that are expressed c o n s t i t u t i v e l y at a low l e v e l . Increased l e v e l s of hsp70 were detected as ea r l y as 5 minutes a f t e r sodium arsenite induction with the largest accumulation occurring a f t e r 1 hour of induction. As mentioned above, the i n t e n s i t y of the response to heat-shock - 82 -1 2 3 4 5 DURATION OF HEAT-SHOCK, hours 20 Figure 22. Induction of hsp70 mRNA by heat-shock. RTG-2 cells were treated with a 28°C heat-shock for various time periods. No recovery time was allowed. Cells were harvested and cytoplasmic quick-blots of RNA were performed as described under Experimental Procedures. The quick-blots were hybridized to a [ 3 2P]labelled trout hsp70 cDNA, washed, and subsequently fluorographed. The inset shows the hybridization signals obtained at the various time points. To quantify the signals, spots on the nitrocellulose f i l t e r corresponding to bound RNA were cut out and the amount of radioactivity hybridized to each was determined. The same procedure was used to obtain the results in Figures 23-26. HS = heat-shock. - 83 -400 0 1 2 3 4 5 24 SODIUM ARSENITE INDUCTION,hours Figure 23. Induction of hsp70 mRNA wi t h sodium a r s e n i t e . RTG-2 c e l l s were exposed to 50 uM sodium a r s e n i t e f o r various times. No recovery was allowed. The c e l l s were processed i n the same manner as described i n the legend to Figure 22. SA = sodium a r s e n i t e . - 84 -r e f l e c t s the l e v e l of stress applied. For instance, when trout c e l l s were induced by increasing concentrations of sodium arsenite, the le v e l s of hsp70 mRNA rose u n t i l a l e t h a l exposure l i m i t was reached (Figure 24). The decrease i n hsp70 mRNA, a f t e r a peak at 50 pM sodium arsenite, corresponds to the general decrease i n protein synthesis at higher arsenite concentrations. 3.5.3 Repression of Hsp70 mRNA Synthesis Af t e r an i n i t i a l s t r e s s , c e l l s were allowed to recover under normal growth conditions and the l e v e l of hsp70 mRNA was examined. Recovery from a 1 hour heat shock (28°C) was very rapid, with hsp70 mRNA reaching control l e v e l s by 3 to 4 hours (Figure 25). The e f f i c i e n t repression of hsp70 mRNA synthesis and i t s rapid degradation during recovery from heat shock in d i c a t e that both t r a n s c r i p t i o n and s t a b i l i t y of these messages are subject to precise c o n t r o l . This i s e s p e c i a l l y s t r i k i n g since a f t e r 1 hour at 28°C the c e l l s were s t i l l a c t i v e l y synthesizing hsp70 mRNA (see Figure 22). The recovery of RTG-2 c e l l s from a 2 hour, 50 pM sodium arsenite exposure (Figure 26) was s l i g h t l y d i f f e r e n t than the recovery from heat shock. The l e v e l of hsp70 mRNA continued to r i s e even a f t e r the arsenite had been removed. This may be explained by the persistence of i n t r a c e l l u l a r arsenite during t h i s period, or i t may r e f l e c t a slower i n a c t i v a t i o n of the hsp70 gene. In ei t h e r case, the decrease i n hsp70 mRNA lev e l s following recovery from arsenite treatment i s apparent, although not as rapid as i n the case of recovery from heat shock. - 85 -0 100 200 30(5 400 500 600 SODIUM ARSENITE (pM) Figure 24. Induction of hsp70 mRNA under different sodium arsenite concentrations. RTG-2 cells were exposed to different concentrations of arsenite for 3 hours followed by 2 hours of recovery. The cells were processed in the same manner as described in the legend to Figure 22. SA = sodium arsenite. - 86 -0* 1 1 1 i 1 i 0 1 2 3 4 5 6 RECOVERY F R O M HEAT-SHOCK, hours Figure 25. Hsp70 mRNA levels during recovery from heat-shock. RTG-2 cells were heat-shocked at 28°C for 1 hour and then allowed to recover at 22°C for different lengths of time. The cells were processed in the same manner as described in the legend to Figure 22. C = control c e l l s , no heat-shock. - 87 -0 1 2 3 4 5 RECOVERY F R O M ARSENITE , hours Figure 26. Hsp70 mRNA levels during recovery from sodium arsenite shock. RTG-2 cells were treated with 50 uM arsenite for 2 hours and then allowed to recover in fresh medium for different lengths of time. The cells were processed in the same manner as described in the legend to Figure 22. C = control c e l l s , no arsenite shock. - 88 -3.6 DNA Southern Blot Analysis 3.6.1 Detection of Multiple Hsp70 Genes i n the Trout Genome Genomic DNA was i s o l a t e d from trout t e s t i s and subjected to analysis by the Southern bl o t technique. Several r e s t r i c t i o n digests were performed and the DNA was fractionated on agarose gels. A f t e r transfer of the DNA to n i t r o c e l l u l o s e f i l t e r s , h ybridizations were c a r r i e d out under stringent conditions to hsp70 probes. The r e s u l t s i n Figure 27A were obtained using a nick-translated THS70.7 fragment which spans amino acids 128 to 348 of the hsp70, and contains a PstI s i t e at the 3' end. Strong h y b r i d i z a t i o n to two bands was detected when PstI was used to cleave the genomic DNA (Figure 27, lane 1), suggesting the presence of at least two hsp70 genes. Hybridization to BamHI cleaved DNA (Figure 27, lane 2) revealed a larger fragment of approximately 8 Kb. The existence of two hsp 70 genes on this BamHI fragment i s possible, since the digestion of trout DNA with both BamHI and PstI resulted i n the disappearance of the large BamHI fragment and the appearance of the two smaller PstI fragments (Figure 27, lane 6). However, the existence of two d i f f e r e n t BamHI fragments, each containing an hsp70 gene, i s also a p o s s i b i l i t y . Hybridization to EcoRI cleaved trout DNA (Figure 27, lane 3) revealed a number of bands of d i f f e r e n t i n t e n s i t i e s , possibly due to incomplete digestion of the DNA. Genomic trout DNA was also subjected to double digests and hybridized to the THS70.7 fragment (Figure 27, lanes 4-6) or to the 1.0 Kb PstI fragment from a Drosophila hsp70 gene (Figure 27, lanes 7 and 8) spanning amino acids 1 to 312 i n addition to some 5' non-coding sequence. Both probes produced s i m i l a r r e s u l t s but THS70.7 resulted i n much better s i g n a l s , as expected. The detection of two hsp70 sequences i n the trout genome does not rule out - 89 -A B 1 2 3 4 5 6 7 8 | « •1 23.7— 23.7— *&— I S — |.4 • 4 — 4.2— 4.2— m 2.3— — a t 13— 1.»— Figure 27. Southern blot analysis of genomic DNA i s o l a t e d from trout t e s t i s . Approximately 6 yg of the genomic DNA was digested with PstI (lane l ) , BamHI (lane 2), EcoRI (lane 3), PstI and EcoRI (lanes 4 and 7), BamHI and EcoRI (lanes 5 and 8), or PstI and BamHI (lane 6), and separated by electrophoresis on a 1.2% (A) or 0.9% (B) agarose g e l . The DNA was then transferred to n i t r o c e l l u l o s e f i l t e r s . Hybridization was to [ 3 2 P ] l a b e l l e d THS70.7 (A), or a 1.0 Kb PstI fragment from a Drosophila hsp70 gene (B), at 42°C i n 50% formamide. The size markers are from a H i n d l l l digest of phage lambda DNA. - 90 -the presence of a d d i t i o n a l hsp70 genes. Sequence divergence, and the incomplete nature of the cDNA probes used, might allow other hsp70 sequences i n the genome to go undetected. It i s worth noting, however, that washing f i l t e r s at lower stringency yielded s i m i l a r r e s u l t s (Figure 28). 3.6.2 I n d e n t i f i c a t i o n of Hsp70-like Sequences i n other Genomes To investigate interspecies hsp70 sequence homology, genomic DNA from a v a r i e t y of sources (trout t e s t i s , RTG-2 c e l l s , HeLa c e l l s , C. elegans, bovine l i v e r and IK_ melanogaster) was cleaved with PstI and subjected to Southern bl o t a n a l y s i s . Hybridization was to eit h e r THS70.14 (Figure 29, lane 1) or to the THS70.7 fragment described above (Figure 29, lanes 2-7). It should be noted that the f i l t e r s containing trout DNA were exposed to f i l m for a much shorter time than the f i l t e r s containing the other DNAs. The THS70.14 fragment (spanning amino acids 1 to 210 and some 5' non-coding region) hybridized to the same two PstI fragments i n trout DNA as those detected by the THS70.7 probe. In addition, two larger PstI fragments were evident, revealing hsp70 sequences that were not detected by the THS70.7 probe. Cross-hybridization of the trout hsp70 sequences with sequences i n the genomes of other organisms was also evident (Figure 29, lanes 4-7). Multi p l e bands are evident i n HeLa c e l l DNA, bovine l i v e r DNA, and D.  melanogaster DNA. Hybridization to the (K_ elegans DNA was very weak and may be due to the r e l a t i v e l y high AT content (64%) of i t s genome (189). - 91 -Figure 28. Ef f e c t of washing stringency on signal detection from genomic Southern b l o t s . Approximately 6 ug of trout DNA was digested with e i t h e r PstI (P) or BamHI (B). The cleaved DNA was fractionated by electrophoresis through a 1.0% agarose gel, and transferred to NC paper. Hybridization was to a [ 3 2 P ] l a b e l l e d 0.7 Kb PstI fragment from pTHS70.7 (see Figure 17). The washing conditions were as follows: ( l ) 2XSSPE/0.1% SDS, twice for 15 minute at room temperature; (2) same as i n ( l ) plus a 15 minute room temperature wash i n 0.1XSSPE/0.1% SDS; (3) same as i n (2) plus a 15 minute 50°C wash i n 0.1XSSPE/0.1% SDS. - 92 -1 2 3 4 5 6 7 F i g u r e 29. S o u t h e r n b l o t a n a l y s i s o f P s t I d i g e s t e d genomic DNA from v a r i o u s s o u r c e s : 6 ug t r o u t t e s t i s DNA ( l a n e s 1 and 2 ) , 4 ug RTG-2 DNA (1 ane 3 ) , 6 ug HeLa c e l l DNA (Lane 4 ) , 3 ug C. e l e g a n s DNA ( l a n e 5 ) , 8 ug b o v i n e DNA ( l a n e 6 ) , and 3 yg D. m e l a n o g a s t e r DNA ( l a n e 7 ) . The DNA was c l e a v e d , f r a c t i o n a t e d by e l e c t r o p h o r e s i s t h r o u g h a 1.0% a g a r o s e g e l , and t r a n s f e r r e d t o n i t r o c e l l u l o s e f i l t e r s . H y b r i d i z a t i o n was t o [ 3 2 P ] l a b e l l e d THS70.14 ( l a n e 1) o r THS70.7 ( l a n e s 2 t o 7 ) , a t 42°C i n 50% formamide. The hsp70 r e l a t e d sequences have been i n d i c a t e d by t r i a n g l e s n e x t t o a p p r o p r i a t e bands. Note t h a t the f i l t e r s c o n t a i n i n g t r o u t DNA were exposed f o r 2 days t o X-ray f i l m , compared w i t h 8 days f o r t h e o t h e r f i l t e r s . S i z e markers were from a H i n d l l l d i g e s t o f phage lambda DNA. Note: - l a n e 3 was from a d i f f e r e n t e l e c t r o p h o r e s i s r u n . - 93 -3.7 Trout Genomic DNA L i b r a r i e s 3.7.1 Screening of the CH4A Lambda Library To ensure 99% p r o b a b i l i t y that the e n t i r e trout genome (approximately 2.8 x 10 9 bp) i s represented, one would need to package and obtain approximately 10 s pfu i_n v i t r o . The trout CH4A l i b r a r y contained only 0.25 x 10 6 i n d i v i d u a l clones; despite t h i s , a screen was c a r r i e d out. Approximately 0.5 x 10 s pfu from the amplified l i b r a r y were grown at a density of 20,000 pfu/plate. These were subsequently probed with the Drosophila hsp70 gene. Four clones that hybridized to the probe were p u r i f i e d . DNA from three of these (X2b, XC2, and XC3) were i s o l a t e d , digested with EcoRI, and subjected to Southern b l o t analysis (Figure 30). A l l three clones contained i n s e r t s with EcoRI r e s t r i c t i o n s i t e s ; with X2b and XC2 having a common 4.6 Kb EcoRI fragment that hybridized to the Drosophila hsp70 gene, and XC3 containing a 5.5 Kb fragment that also hybridized to the hsp70 gene (Figure 30). Although the i n i t i a l r e s u l t s looked promising, further analysis of these clones showed no h y b r i d i z a t i o n to trout mRNA from control or induced c e l l s . An i n t e r e s t i n g point was the s i m i l a r i t y of the 4.6 Kb EcoRI fragments from X2b and XC2. P a r t i a l nucleotide sequencing of these fragments showed them to be i d e n t i c a l although no s i m i l a r i t y to the Drosophila hsp70 sequence was evident (data not shown). A second attempt at screening the CH4A. l i b r a r y , using THS70.7 as the probe, resulted i n no p o s i t i v e h y b r i d i z a t i o n s . 3.7.2 Screening of the L47.1 Lambda L i b r a r i e s The two L47.1 l i b r a r i e s contained 0.5 x 10 s pfu and 3 x 10 6 pfu, - 94 -F i g u r e 30. S o u t h e r n b l o t a n a l y s i s o f t r o u t genomic c l o n e s . DNA from c l o n e s X2b, AC2, and XC3 was d i g e s t e d w i t h E c o R I , f r a c t i o n a t e d on a 0.7% a g a r o s e g e l and S o u t h e r n b l o t t e d t o NC p a p e r . The DNA was h y b r i d i z e d t o a [ 3 2 P ] l a b e l l e d 2.0 Kb S a l I fragment from a D r o s o p h i l a hsp70 gene ( c l o n e 56H8, r e f . 9 6 ) . H y b r i d i z i n g bands have been i n d i c a t e d and s i z e a s s i g n e d by c o m p a r i s o n t o fragments from a H i n d l l l d i g e s t o f phage lambda DNA. - 95 -res p e c t i v e l y . However, the amplified versions of these l i b r a r i e s may not have been e n t i r e l y representative since the plaque si z e obtained from growth on Q359 was very small (note that Q359, a P2 lysogen, was used since recombinants i n AL47.1 are rendered Spi" and thus may be selected by t h e i r a b i l i t y to grow i n P2 lysogens of E. c o l i ) . P r i o r to screening of the l i b r a r i e s , the 15-20 Kb fractionated DNA of the Mbol p a r t i a l digests was r e s t r i c t e d with BamHI and subjected to Southern b l o t a n a l y s i s . Hsp70-like sequences were detected i n both the t o t a l Mbol p a r t i a l s and the 15-20 Kb Mbol p a r t i a l s (Figure 31). However, a f t e r two separate attempts at screening the L47.1 l i b r a r i e s , no po s i t i v e s were detected. - 96 -A B Figure 31. Southern blot analysis of Mbol p a r t i a l fragments from trout genomic DNA. Both 15-20 Kb fractionated Mbol p a r t i a l s (A) and t o t a l Mbol p a r t i a l s (B) of trout DNA were digested with BamHI and fractionated on a 1.0% agarose g e l . Af t e r transfer to NC paper, the DNA was probed with a [ 3 2 P ] l a b e l l e d 0.7 Kb PstI fragment from pTHS70.7 for hsp70-like sequences. Size markers are from a H i n d l l l digest of phage lambda DNA. - 97 -IV. DISCUSSION The r e s u l t s presented i n t h i s t h e s i s , on the heat shock response i n trout c e l l s , provide a base for the study of t h i s phenomenon i n a vertebrate system. The various experiments have helped to further emphasize the complex nature of the regulation of the heat shock response with controls at several stages of gene expression. In addition, the comparison of hsp70 from trout to those of other organisms supports the conclusion that hsp70 genes form a highly conservative gene family. The relevance of the data presented i s discussed i n terms of the importance of the response to the organism. The maintenance of the heat shock response i n both vertebrates and invertebrates suggests a fundamental r o l e f o r i t . In addition, the conserved nature of t h i s phenomenon implies a s i m i l a r function i n a l l organisms. Thus the heat shock response of trout has been discussed with emphasis on the above mentioned aspects. 4.1 The Heat Shock Response i n Trout C e l l s The response of cultured c e l l s of rainbow trout, S. g a i r d n e r i i , to e i t h e r temperature elevation or incubation i n the presence of sodium arsenite i s very s i m i l a r to that of Drosophila (2). A novel set of polypeptides (the hsps) i s r a p i d l y induced and depending on the severity of the stress applied, normal protein synthesis can also be decreased. For instance, exposing c e l l s to 50 uM sodium arsenite for 24 hours resulted i n a dramatic reduction of normal protein synthesis with only the hsps being produced (Figure 4). It has become f a i r l y obvious that the heat-shock response i s a reaction to stress i n general and not temperature - 98 -perturbation alone. In support of t h i s , the response of trout c e l l s to heat or arsenite was observed to be s i m i l a r i n most respects. Some differences were observed however: some hsps were induced by arsenite but not heat, repression of normal protein synthesis varied between the two inducing agents, induction and/or s t a b i l i t y of hsp70 mRNA d i f f e r e d during extended exposures to arsenite or heat, and degradation and synthesis of hsp70 mRNA also d i f f e r e d upon return of c e l l s to normal conditions. These differences w i l l be discussed separately. Molecular weights of the hsps were assigned by comparison to standard proteins. They were determined to be 87 Kd, 70 Kd, 62 Kd (arsenite induced only), 42 Kd, 32 Kd, and 30 Kd. An add i t i o n a l protein of 100 Kd (arsenite induced only) may also be considered an hsp. As with most organisms, the trout hsps f a l l into three classes: hsp83-like, hsp70-like, and small hsp-like polypeptides. Optimum conditions for the induction of trout hsps were determined to be 27°C to 29°C (compared with the normal growth temperature of 22°C) for heat-shock or 15 to 100 uM for sodium arsenite exposure. It should be noted that there was no tr i g g e r point for the induction of the heat shock response; i n fact the rate of hsp synthesis was proportional to the sever i t y of str e s s . Consider sodium arsenite: as i t s concentration was increased the le v e l s of hsps also increased. This pattern continued u n t i l a l e t h a l concentration was reached, a f t e r which the c e l l s began to die o f f . A s i m i l a r reaction was observed with temperature shocks. Thus the c e l l must be able to monitor the amount of discomfort and respond correspondingly. The response of trout c e l l s to sodium arsenite was very s i m i l a r to that found i n chick embryo f i b r o b l a s t s (52), i . e . d i f f e r e n t hsps become induced at d i f f e r e n t arsenite concentrations. For instance, hsp70 - 99 -was r e a d i l y induced at a l l concentrations between 1 and 300 pM whereas hsp30 could only be induced between 15 and 50 pM to any extent. Thus, although the heat-shock genes are coordinately regulated, they seem to be d i f f e r e n t i a l l y expressed. One of the features of the heat shock response i s i t s rapid induction. The e n t i r e c e l l protein synthesis apparatus seems to be geared towards an increased production of hsps during a stress response. This s h i f t i s so e f f i c i e n t that several hsps become major constituents of the c e l l a f t e r a few hours of induction. In trout, hsp70 and hsp30 were r e a d i l y v i s i b l e on Coomassie blue stained SDS-polyacrylamide gels of proteins from c e l l s induced for extended periods. Thus, the presence of hsps i n such large numbers implies an important function for them, otherwise one would not expect the c e l l to expend unnecessary energy i n times of s t r e s s . As mentioned, hsp70 i s one of the two major hsps of trout. This i s also the case for most organisms studied to date (1). Since the heat shock response i s observed i n a l l organisms and hsp70 i s the major hsp of these organisms, l o g i c dictates that some conservation of t h i s prote'n would be maintained through the d i f f e r e n t species. Several experiments were done to compare the trout hsp70 with that of Drosophila to investigate the above expectation. One of these involved the mobility of trout and Drosophila hsps on an SDS-polyacrylamide gel (Figure 7). The only hsp to have i d e n t i c a l m o b i l i t y i n the two systems was the hsp70. Other s i m i l a r i t i e s were determined at the s t r u c t u r a l l e v e l and w i l l be discussed l a t e r . One approach that can help to determine the function of hsps i s to l o c a l i z e these proteins to c e r t a i n parts of the c e l l . In this thesis however, the l o c a l i z a t i o n of trout hsps was not extensively investigated. - 100 -The limited r e s u l t s obtained from pulse-chase experiments seemed to suggest that both hsp70 and hsp30 were translocated to the nucleus. However, the bulk of the l a b e l l e d hsps was l o c a l i z e d i n the cytoplasmic f r a c t i o n . The ambiguous r e s u l t s may have been due to the conditions of the experiment. Although the induction of the trout c e l l s was at an elevated temperature, the pulse and chase portions were done at normal growth conditions a f t e r a recovery period of 2 hours. Velazquez and Lindquist (190) have recently reported the stress dependent tr a n s l o c a t i o n of hsp70 i n Drosophila c e l l s . Their use of i n d i r e c t immunofluoresence with monoclonal antibodies to hsp70 has helped to l o c a l i z e the protein predominantly i n the nu c l e i of heat-shocked c e l l s . During recovery, the hsp70 was seen to migrate back into the cytoplasm. Thus i n the case of the pulse-chase experiment described i n th i s thesis (Figure 13), the re s u l t s may a c t u a l l y be r e f l e c t i n g the s i t u a t i o n i n a recovering c e l l . Further experiments would need to be done to confirm the above suspicion. 4.2 Regulation of the Heat Shock Response The complex nature of the regulation of the heat shock response has become apparent i n the l a s t few years. Several l e v e l s of control seem to be coordinated i n some manner to produce a rapid response to c e r t a i n s t r e s s f u l agents. In some organisms, one type of control occurs at the l e v e l of normal protein synthesis. It has been known for some time that normal c e l l u l a r mRNAs are not degraded during heat-shock, but rather are s e l e c t i v e l y repressed (13, 45-47). Upon return of the c e l l s to normal conditions, the pre-e x i s t i n g mRNAs are released from t h i s i n h i b i t i o n . Yeast c e l l s do not exhibit the same control on pre-existing mRNAs but - 101 -rather allow them to be degraded at the normal rate (48). In vitro translation of trout mRNA show that normal cellular mRNAs are present but not translated during induction of the heat-shock genes. Thus i t would be reasonable to assume that translational control occurs in trout as i t does in most other organisms. The purpose for this translational control may be to allow selective translation of heat-shock mRNAs and thus rapidly and efficie n t l y express the hsps. This suggestion was supported by evidence showing the rapid induction of hsps in trout c e l l s . For instance, the two major hsps of trout (hsp70 and hsp30) were readily detected in cells induced for short periods at 37°C. The detection was based on the incorporation of [ 3 5S]methionine into the proteins. Since the labelling was carried out at 22°C for 1 hour, one cannot rule out the possibility that the entire hour was necessary for hsp synthesis. However, the rapid appearance of trout hsp70 following induction has also been monitored by immunological methods (E.A Burgess, personal communication), and an increase in hsp70 was detected as early as 5 minutes after the addition of arsenite to the c e l l s . The expression of heat-shock genes is also regulated at the level of transcription. As with most organisms studied, the induction of hsps in trout cells is dependent on new transcription. This was determined by analyzing transcripts from both normal and induced c e l l s . The levels of hsp70 mRNA in sodium arsenite induced RTG-2 cells were much greater than in control cells (Figure 21). The multiple bands for hsp70 mRNA observed on Northern blots most probably represent different species of hsp70 message in trout. To further study transcriptional control in trout, the kinetics of induction and recovery of cells from heat-shock or sodium arsenite exposure were examined by measuring hsp70 mRNA levels. There are at least - 102 -two and probably more hsp70-like genes i n trout and since only one of the trout hsp70 cDNAs (THS70.7) was used i n these studies, d e f i n i t e conclusions can only be made concerning the induction and recovery of one hsp70 mRNA species. However, since the le v e l s of t o t a l hsp70 polypeptides seem to p a r a l l e l the mRNA le v e l s quite c l o s e l y , the conclusions can probably be generalized to include a l l inducible hsp70 mRNAs i n these c e l l s . Induction of trout hsp70 was rapid (of the order of a few minutes) when c e l l s were subjected to eit h e r heat or sodium arsenite s t r e s s . This p a r a l l e l s the findings i n Drosophila, where complete hsp70 mRNAs are detected 4 minutes a f t e r temperature elevation (43). As mentioned e a r l i e r , during sodium arsenite induction of trout c e l l s , immunological detection of hsp70 within 5 minutes a f t e r s t a r t of the induction i s possible (E.A. Burgess, personal communication). This i s i n contrast to r e s u l t s obtained by hsp70 cDNA h y b r i d i z a t i o n to mRNA from these c e l l s which do not show s i g n i f i c a n t l e v e l s of hsp70 mRNA u n t i l 15 minutes a f t e r s t a r t of induction. - The d i s p a r i t y between the appearance of the protein and the presence of the t r a n s c r i p t may r e f l e c t the s e n s i t i v i t y of the two techniques. Since one technique r e l i e s on the detection of the protein whereas the other on detection of a t r a n s c r i p t , r e s u l t s from both cannot be qu a n t i t a t i v e l y compared. More than one gene may code for the trout hsp70 and t r a n s c r i p t s from other genes may not hybridize to the hsp70 cDNA clone under conditions of high stringency. It should be noted that trout hsp70 was detected immunologically with antibody to chicken hsp70. The cross-reaction of the hsp70s from these two species further emphasizes the highly conserved nature of th i s protein. The rapid rate of induction suggests that the heat-shock genes, although i n a c t i v e i n uninduced c e l l s , are maintained i n an " a l e r t " state ready for immediate t r a n s c r i p t i o n . One - 103 -major difference was observed between the induction pattern obtained by heat-shock versus sodium arsenite. Prolonged exposure to arsenite resulted i n continued synthesis and/or maintenance of trout hsp70 mRNA le v e l s (Figure 23). In contrast, continuous heat-shock at 28°C for longer than 2 hours caused a decrease i n hsp70 mRNA le v e l s (Figure 22). Since protein synthesis was s t i l l occurring i n c e l l s heat-shocked for up to 16 hours (Figure 9), c e l l death i s not a l i k e l y cause of the l a t t e r behaviour. This leaves the p o s s i b i l i t y of autoregulation and may also r e f l e c t a type of c e l l u l a r adaptation to thermal shock. In addition to t r a n s c r i p t i o n a l c o n t r o l differences, hsp70 mRNA s t a b i l i t y may be affected d i f f e r e n t l y by heat-shock and arsenite exposure. The l e v e l of heat-shock mRNA induction seems to r e f l e c t the i n t e n s i t y of the inducing stimulus. The le v e l s of hsp70 mRNA varied with the concentration of sodium arsenite used (Figure 24); hsp70 mRNA le v e l s rose u n t i l a concentration of approximately 50 uM arsenite was reached, a f t e r which the c e l l s began to die . This behaviour was also r e f l e c t e d at the l e v e l of hsp synthesis (Figure 11). This r e l a t i o n s h i p between the in t e n s i t y of the stress and the magnitude of the response has also been reported i n Drosophila (42, 43). F i n a l l y , the control of the recovery from heat-shock was monitored i n trout c e l l s . As was the case with induction, the repression of the hsp70 mRNA synthesis was very rapid, e s p e c i a l l y during recovery from temperature stress (Figure 25). Recovery from sodium arsenite d i f f e r e d i n that hsp70 mRNA continued to be synthesized for approximately 30 minutes a f t e r removal of the inducer (Figure 26). A f t e r the i n i t i a l lag period, hsp70 mRNA le v e l s decreased, but more slowly than during recovery from temperature s t r e s s . The short lag may be due to the persistence of i n t r a c e l l u l a r - 104 -arsenite or may r e f l e c t a separate mechanism for repressing hsp70 mRNA synthesis. Rapid recovery of c e l l s from stress s i t u a t i o n s has also been observed i n Drosophila (42, 44) and the actual k i n e t i c s of recovery varies with the severity of the i n i t i a l heat-shock (44). An i n t e r e s t i n g feature of t h i s complex pattern of recovery i s the requirement for functional hsps. In Drosophila, absence of functional hsps prevents the c e l l s from a t t a i n i n g complete recovery a f t e r a heat-shock (42). The regulation of the heat shock response i s dependent on a v a r i e t y of fac t o r s , including: the i n t e n s i t y , duration and nature of the str e s s , and the presence of functional hsps for autoregulation and recovery. In addition, p r e - e x i s t i n g mRNAs are subject to t r a n s l a t i o n a l control (13, 45-47). It i s evident that regulation of the heat shock response i s a complex process with manifestations at several stages of gene expression (Figure 32). 4.3 The Conserved Nature of the Heat Shock Response The presence of the heat shock response has been observed i n a wide range of organisms, spanning a l l three primary kingdoms. For th i s phenomenon to be maintained through evolution, i t must have been under considerable s e l e c t i v e pressures. An i n t e r e s t i n g suggestion made by Lee et a l . (21) was that the development of an "oxdiation s t r e s s " i n c e l l s may be a common fac t o r among inducers of the heat shock response. Since protection from excess i n t r a c e l l u l a r oxygen would have been a necessity e a r l y i n the evolutionary time scale, one would have expected the c e l l to have developed a stress response. It may have followed that this response was maintained and modified to include other stress s i t u a t i o n s . - 105 -Figure 32. Model for the regulation of the Heat Shock Response. The diagram summarizes some of the steps involved in the regulation of the heat shock response. Briefly, the inducer (l) disrupts pre-existing polysomes and sequesters the mRNA. These are kept under translational control and are only expressed when the c e l l is returned to normal conditions. The inducer could act directly on the heat-shock genes but more likely through an intermediate (2). The identification of this secondary messenger has yet to be determined. Rapid transcription of the heat-shock messages occurs (3) followed by processing and transport to the cytoplasm (4). Polysomes form on these newly made messages (5) and selective translation (6) results in the synthesis of hsps (hatched boxes). These proteins could in turn affect the regulation of the response by controlling the rate of recovery of the c e l l (7), by binding to the cytoskeletal structure (8), by inactivating the secondary messenger (9), and by binding to heat-shock DNA (10) or RNA (11). C = cytoplasm, N = nucleus. - i o 5 a ' -- 106 -Although the precise r o l e f o r t h i s phenomenon has yet to be determined, i t i s becoming evident that i t has an o v e r a l l protective function. This i s supported by studies showing that a mild heat-shock preceding a normally l e t h a l heat-shock confers thermotolerance on c e l l s (29, 85, 86). Such thermotolerance can be conferred upon c e l l s by other inducers of the response, such as sodium arsenite (29). The migration of the major Drosophila hsp to the nucleus during heat-shock, and i t s as s o c i a t i o n with decondensed chromatin would also imply a protective function (190). Since functional properties of hsps have been suggested to be s i m i l a r i n a l l organisms, i t should follow that s t r u c t u r a l properties of hsps also be conserved. One approach i n t h i s respect has been to compare the major hsp (hsp70) of a l l organisms. Methods such as p r o t e o l y t i c cleavage, immunological c r o s s - r e a c t i v i t y , or cro s s - h y b r i d i z a t i o n at the n u c l e i c acid l e v e l have been used. However, the best method of comparison i s by determining the sequence of these proteins. Thus f a r , the only reported sequence information for a eukaryotic hsp70 i s for Drosophila (92) and yeast (65). They show 72% homology at the nucleotide l e v e l . Recently, the sequence for the E. c o l i dnaK gene was reported (68). It shows 57% i d e n t i t y at the nucleotide l e v e l to the Drosophila hsp70 gene. Such conservation i s s t r i k i n g and a s i m i l a r homology with trout hsp70 would enhance these findings and help to narrow down conserved domains which may reveal i t s functional properties. Two hsp70 cDNAs, THS70.7 and THS70.14 from rainbow trout, S. g a i r d n e r i i have been i d e n t i f i e d and analyzed i n t h i s t h e s i s . The predicted amino acid sequences from these cDNAs are very s i m i l a r to those reported f o r the hsp70 genes of JK_ melanogaster (92) and ce r e v i s i a e (65). The presence of a multigene family of hsp70 sequences i n the trout genome has - 107 -been i n f e r r e d from the h y b r i d i z a t i o n of genomic DNA blots to the hsp70 cDNAs. The existence of multiple hsp70 genes i n trout i s also supported by the presence of multiple spots on two dimensional polyacrylamide gels of p r o t e i n samples from in v i t r o translated, hybrid-selected mRNA for trout hsp70 (E.A. Burgess, personal communication). The nucleotide sequences of the two cDNAs were determined and compared to hsp70 sequences from Drosophila and yeast (Figure 20). The extent of homology i s s t r i k i n g , e s p e c i a l l y at the amino acid sequence l e v e l . The amino acid sequences coded for i n the trout cDNAs are approximately 79% homologous with both Drosophila and yeast hsp70. When compared to the E.  c o l i dnaK protein (68), the THS70.7 shows 55% i d e n t i t y . For organisms representing phyla that diverged early i n the evolutionary time scale, t h i s degree of sequence conservatism i s remarkable. Hsp70-like proteins have been observed i n many other organisms, and a high degree of sequence conservatism can now be predicted on the basis of the following observations: the s i m i l a r i t i e s of the induction process i n most organisms studied ( l ) , the cross-reaction of a chicken hsp70 antibody with s i m i l a r proteins i n widely divergent species (64), the c r o s s - h y b r i d i z a t i o n of hsp70 genes from one organism to the genomic DNA and RNA of other organisms (50, 57, 65-67). The conservatism of the heat shock response i s not l i m i t e d to the hsp70-like proteins; s i m i l a r i t i e s among d i f f e r e n t hsp83-like proteins (64) and among the small hsps (69, 70) have been reported. The r e s u l t s presented here support the conclusion that the hsp70 genes form a highly conservative gene family. - 108 -4.4 Genomic Organization of Hsp70 Genes The organization of hsp70 genes has been most extensively studied i n Drosophila (2). These genes are present i n multiple copies i n the Drosophila genome and are found clustered within a few kilobases. S i m i l a r l y , an hsp70 multigene family has been i d e n t i f i e d i n yeast (65). The occurrence of hsp70 multiple gene copies i n the trout genome has been supported by experiments presented i n t h i s t h e s i s . In addition, the analysis of genomic DNA from d i f f e r e n t organisms has revealed the presence of multiple bands on Southern blo t s probed with hsp70 sequences. For instance, the presence of at least two and possibly more hsp70~like genes i n trout was observed. Why does the c e l l need extra copies of the hsp70 gene? This question has not r e a l l y been answered, however, several suggestions have been made. The presence of multiple copies of the hsp70 gene may help produce the rapid response to stress i . e . a l o t more tr a n s c r i p t s can be made i n a short time. Another p o s s i b i l i t y i s that the d i f f e r e n t hsp70 genes code for s l i g h t l y d i f f e r e n t hsp70s having d i f f e r e n t targets i n the c e l l . Although the construction of lambda l i b r a r i e s containing trout genomic DNA was p a r t i a l l y successful, screening of these l i b r a r i e s ended i n f a i l u r e to i s o l a t e hsp70 genes. For a genome the siz e of trout (3 x 10 9 bp), one would need approximately 10 6 clones with inserts of 15 to 20 Kb i n length to represent the e n t i r e genome. We obtained more than 3 x 10 s clones from two attempts at constructing a trout genomic l i b r a r y i n L47.1 phage, yet no p o s i t i v e s for hsp70 sequences were i d e n t i f i e d . Since the 15-20 Kb Mbol p a r t i a l s used to construct the l i b r a r i e s contained the hsp70 sequences (Figure 31), the only explanation for the lack of any p o s i t i v e s was the - 109 -p o s s i b i l i t y of under-representing the genome a f t e r the l i b r a r y a m p l i f i c a t i o n stage. In the case of the CH4A l i b r a r y , incomplete representation of the genome may have been due to the low number (2.5 x 10 s) of i n d i v i d u a l clones obtained. Although no hsp70 genes were i s o l a t e d from t h i s l i b r a r y , several clones were found to contain inserts that showed some h y b r i d i z a t i o n to the Drosophila hsp70 gene even under stringent conditions (Figure 30). In addition, two of these clones have been shown to contain i d e n t i c a l sequences based on r e s t r i c t i o n mapping, Southern blot analysis (Herb Chang, personal communication) and p a r t i a l sequence an a l y s i s . However, h y b r i d i z a t i o n of these sequences to trout RNA on Northern blots have f a i l e d to reveal any bands. Thus, the p o s s i b i l i t y e x i s t s that these sequences represent pseudogenes or cognate genes for hsp70 i n trout. The presence of some r e p e t i t i v e sequence i n the clones causing h y b r i d i z a t i o n to the Drosophila hsp70 gene cannot be ruled out e i t h e r . 4.5 Conclusions and Future Prospects The r e s u l t s presented i n t h i s thesis have shown the heat shock response of trout to be very s i m i l a r to other organisms. D i f f e r e n t aspects of t h i s response were analyzed and are summarized i n Table V. - 110 -TABLE V. Summary of the Heat Shock Response i n Trout C e l l s Heat-inducible hsps Sodium arsenite inducible hsps Tra n s l a t i o n a l control on pre-e x i s t i n g mRNAs Tra n s c r i p t i o n a l control Response r e v e r s i b l e hsp70 sequence conservation hsp70 multigene family 87, 70, 42, 32, and 30 (Kd) 100, 87, 70, 62, 42, 32, and 30 (Kd) Yes Yes Yes Yes Yes The c h a r a c t e r i z a t i o n of the heat shock response i n trout should provide a s u i t a b l e base from which to investigate other aspects of th i s phenomenon. Of immediate concern however, would be to i s o l a t e genomic copies of the trout hsp70 sequence. This would f a c i l i t a t e , among other things, the analysis of control regions flanking the gene. Expression i n heterologous systems would allow f o r the study of hsp70 regulation under c o n t r o l l e d conditions. How well the expression i s regulated would allow one to better understand the conserved nature of the response. S i m i l a r l y , one can study the structure of a c t i v e l y t r a n s c r i b i n g hsp70 chromatin since f a i r l y r i g i d control can be maintained by introducing or removing the inducing agent. Beside the use of the heat shock response as an i d e a l model system f o r the study of gene regulation, other aspects of the phenomenon can also be investigated. For instance, the l i n k i n g of heat-inducible promotors onto genes coding for medically or commerically - I l l -important proteins would enable one to control the expression of these genes and thus make these proteins more accessible. Another area of the heat shock response that seems to be gaining more attention is hsp function. Although we can be f a i r l y sure that hsps serve a protective function, the exact manner in which they accomplish i t has yet to be determined. Why does the c e l l need different types of hsps and hsp variants? Thus analysis of the structure of other trout hsps and in particular hsp30 may prove invaluable in answering some of the questions raised above. It is my feeling however, that since the heat shock response is so complex, answering one question w i l l probably raise ten others. - 112 -V. BIBLIOGRAPHY 1. Schlesinger, M.J., M. Ashburner, and A. T i s s i e r e s ( e d i t o r s ) . 1982. Heat Shock: From Bacteria to Man. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 2. Ashburner, M., and J . J . Bonner. 1979. C e l l 1_7: 241-254. 3. Tanguay, R.M. 1983. Can J. Biochem. C e l l . B i o l . 61_: 387-394. 4. Ritossa, F. 1962. Experientia 18: 571-573. 5. Ritossa, F. 1964. Exp. C e l l Res. 35_: 601-607. 6. Berendes, H.D., and Th.K.H. Holt. 1964. Genen. Phaenen. 9: 1-7. 7. Berendes, H.D., F.M.A. vanBreugel, and Th.K.H. Holt. 1965. Chromosoma 1_6: 35-46. 8. Ashburner, M. 1970. Chromosoma 31_: 356-376. 9. T i s s i e r e s , A., H.K. M i t c h e l l , and V.M. Tracy. 1974. J . Mol. B i o l . 84: 389-398. 10. McKenzie, S.L., S. Henikoff, and M. Meselson. 1975. Proc. Natl. Acad. S c i . U.S.A. 7_2: 1117-1121. 11. Spradling, A., S. Penman, and M.L. Pardue. 1975. C e l l 4: 395-404. 12. McKenzie, S.L., and M. Meselson. 1977. J. Mol. B i o l . 117: 279-283. 13. Mi r a u l t , M.E., M. Goldschmidt-Clermont, L. Moran, A.P. Arrigo, and A. T i s s i e r e s . 1978. Cold Spring Harbor Symp. Quant. B i o l . 42: 819-827. 14. L i s , J., L. Prestige, and D.S. Hogness. 1978. C e l l 14: 901-911. 15. L i s , J.T., D. Ish-Horowicz, and S.M. Pinchin. 1981. Nucl. Acids Res. 9: 5297-5311. 16. Livak, K.F., R. Freund, M. Schweber, P.C. Wensink, and M. Meselson. 1978. Proc. Natl. Acad. S c i . U.S.A. _75: 5613-5617. 17. Holmgren, R., K. Livak, R. Morimoto, R. Freund, and M. Meselson. 1979. C e l l 18_: 1359-1370. 18. Corces, V., R. Holmgren, R. Freund, R. Morimoto, and M. Meselson. 1980. Proc. Natl. Acad. S c i . U.S.A. 77_: 5390-5393. 19. Wadsworth, S.C., E.A. Craig, and B.J. McCarthy. 1980. Proc. Natl. Acad. S c i . U.S.A. 77: 2134-2137. - 113 -20. Kelley, P.M., and M.J. Schlesinger. 1978. C e l l 15_: 1277-1286. 21. Lee, P.C., B.R. Bochner, and B.N. Ames. 1983. Proc. Natl. Acad. S c i . U.S.A. 80: 7496-7500. 22. Fink, K., and E. Zeuthen. 1980. Exp. C e l l Res. 128: 23-30. 23. K e t o l a - P i r i e , CA., and B.G. Atkinson. 1983. Can. J . Biochem. C e l l B i o l . 61: 462-471. 24. Levinson, W., H. Oppermann, and J . Jackson. 1978. Biochim. Biophys. Acta. 518: 401-412. 25. Levinson, W., R. Mikelens, H. Oppermann, and J . Jackson. 1978. Biochim. Biophys. Acta. 519: 65-75. 26. Levinson, W., J . I d r i s s , and J . Jackson. 1979. B i o l . Trace Elements Res. 1: 15-23. 27. Guttman, S.D., C.V.C. Glover, CD. A l l i s , and M.A. Gorovsky. 1980. C e l l 22: 299-307. 28. Ireland, R.C, and E.M. Berger. 1982. Proc. Natl. Acad. S c i . U.S.A. 79: 855-859. 29. L i , C C , and Z.'Werb. 1982. Proc. Natl. Acad. S c i . U.S.A. 79_: 3218-3222. 30. Levinson, W., H. Oppermann, and J . Jackson. 1980. Biochim. Biophys. Acta. 606: 170-178. 31. Cosgrove, J.W., and I.R. Brown. 1983. Proc. Natl. Acad. S c i . U.S.A. 80: 569-573. 32. Currie, R.W. , and F.P. White. 1981. Science (Wash. D.C) 214: 72-73. 33. Nevins, J.R. 1982. C e l l 29: 913-919. 34. Leenders, H.J., H.D. Berendes, P.J. Helmsing, J . Derksen, and J.F.J.G. Koninkx. 1974. Subcell. Biochem. 3: 119-147. 35. Sin, Y.T. 1975. Nature 258: 159-160. 36. Craine, B.L., and T. Romberg. 1981. C e l l 25_: 671-681. 37. Bonner, J . J . 1982. Dev. B i o l . 86: 409-418. 38. Compton, J.L., and J . J . Bonner. 1977. Cold Spring Harbor Symp. Quant. B i o l . 42: 835-838. 39. Compton, J.L., and B.J. McCarthy. 1978. C e l l 14: 191-201. 40. Tanguay, R.M. , and M. Vincent. 1982. Can. J . Biochem. 60_: 306-315. - 114 -41. Jack, R.S., W.J. Gehring, and C. Brack. 1981. C e l l 24: 321-331. 42. DiDomenico, B.J., G.E. Bugaisky, and S. Lindquist. 1982. C e l l 31: 593-603. 43. Lindquist, S. 1980. Dev. B i o l . JJ_: 463-479. 44. DiDomenico, B.J., G.E. Bugaisky, and S. Lindquist. 1982. Proc. Natl, Acad. S c i . U.S.A. _79: 6181-6185. 45. S t o r t i , R.V., M.P. Scott, A. Rich, and M.L. Pardue. 1980. C e l l 22: 825-834. 46. Kruger, C , and B.-J. Benecke. 1981. C e l l ^3: 595-603. 47. Bienz, M. , and J.B. Gurdon. 1982. C e l l 29_: 811-819., 48. Lindquist, S.L. 1981. Nature (Lond.) 293: 311-314. 49. Walsh, C. 1980. J . B i o l . Chem. 255_: 2629-2632. 50. Snutch, T.P., and D.L. B a i l l i e . 1983. Can. J . Biochem. C e l l B i o l . 61: 480-487. 51. Bouche, G., F. Amalric, M. Caizergues-Ferrer, and J.P. Za l t a . 1979. Nucl. Acids Res. 7_: 1739-1747. 52. Johnston, D., H. Oppermann, J . Jackson,1, and W. Levinson. 1980. J . B i o l . Chem. 25_5: 6975-6980. 53. Vincent, M., and R.M. Tanguay. 1979. Nature 281: 501-503. 54. Lemaux, P.G., S.L. Herendeen, P.L. Bloch, and F.C. Neidhardt. 1978. C e l l 13: 427-434. 55. S l a t t e r , A., A.C.B. Cato, G.M. S i l l a r , J . Kioussis, and R.H. Burdon. 1981. Eur. J . Biochem. 117: 341-346. 56. Atkinson, B.G. 1981. J . C e l l B i o l . 89: 666-673. 57. H e i k k i l a , J . J . , G.A. Schultz, K. Iatrou, and L. Gedamu. 1982. J . B i o l . Chem. 257: 12000-12005. 58. Giudice, G., M.C. Roccheri, and M.G. DiBernardo. 1980. C e l l B i o l . Int. Rep. 4: 69-74. 59. Francis, D., and L. L i n . 1980. Dev. B i o l . 79: 238-242. 60. Key, J.L., C.Y. L i n , and Y.M. Chen. 1981. Proc. Natl. Acad. S c i . U.S.A. _78_: 3526-3530. 61. Barnett, T., M. Alt s c h u l e r , C.N. MacDaniel, and J.P. Mascarenhas. 1980. Dev. Gen. 1: 331-340. - 115 -62. Yuyama, S. , and A.M. Zimmerman. 1972. Exp. C e l l Res. 7_1_: 193-203. 63. M i l l e r , M.J., H.-H. Xuong, and E.P. Geiduschek. 1979. Proc. Natl. Acad. S c i . U.S.A. 76_: 5222-5225. 64. Kelley, P., and M. Schlesinger. 1982. Mol. C e l l . B i o l . 2: 267-274. 65. Ingolia, T.D., M.R. Slater, and E.A. Craig. 1982. Mol. C e l l . B i o l . 2: 1388-1398. 66. Lowe, D.G., W.D. Fulford, and L.A. Moran. 1983. Mol. C e l l . B i o l . 3: 1540-1543. 67. Moran, L.A., M. Chauvin, M.E. Kennedy, M. K o r r i , D.G. Lowe, R.C. Nicholson, and M.D. Perry. 1983. Can. J . Biochem. C e l l . B i o l . 61: 488-499. 68. Bardwell, J.C.A., and E.A. Craig. 1984. Proc. N a t l . Acad. S c i . U.S.A. 81_: 848-852. 69. Ingolia, T.D., and E.A. Craig. 1982. Proc. Natl. Acad. S c i . U.S.A. 79: 2360-2364. 70. Russnak, R.H., D. Jones, and E.P.M. Candido. 1983. Nucleic Acids Res. 11_: 3187-3205. 71. Buzin, C.H., and N.S. Petersen. 1982. J. Mol. B i o l . 158: 181-201. 72. Wang, C., R.H. Gomer, and E. Lazarides. 1981. Proc. Natl. Acad. S c i . U.S.A. 78: 3531-3535. 73. Brugge, J.S., E. Erikson, and R.I. Erikson. 1981. C e l l 25: 363-372. 74. Oppermann, H., W. Levinson, and J.M. Bishop. 1981. Proc. Natl. Acad. S c i . U.S.A. 78: 1067-1071. 75. Arrigo, A.P., S. Fakan, and A. T i s s i e r e s . 1980. Dev. B i o l . 78: 86-103. 76. Levinger, L., and A. Varshavsky. 1981. J. C e l l B i o l . jK): 793-796. 77. S i n i b a l d i , R.M., and P.W. Morris. 1981. J . B i o l . Chem. 256: 10735-10738. 78. M i t c h e l l , H.K., and L.S. Lipps. 1975. Biochem. Genet. _13: 585-602. 79. Velazquez, J.M., B.J. DiDomenico, and S. Lindquist. 1980. C e l l 20: 679-689. 80. Schlesinger, M.J., P.M. Kelley, G. A l i p e r t i , and C. Malfer. 1982. i n Heat Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 243-250, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. - 116 -81. Schlesinger, M.J., G. A l i p e r t i , and P.M. Kelley. 1982. Trends Biochem. S c i . 7: 222-225. 82. L i n , J. J.-C., W.J. Welch, J . I . Garrels, and J.R. Feramisco. 1982. in Heat Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 267-273, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 83. Lewis, M.J., P. Helmsing, and M. Ashburner. 1975. Proc. Natl. Acad. S c i . U.S.A. 72: 3604-3608. 84. M i t c h e l l , H.K., G. Moller, N.S. Peterson, and L. Lipps-Sarmiento. 1979. Dev. Genet. 1; 181-192. 85. McAlister, L., and D.B. F i n k e l s t e i n . 1980. Biochem. Biophys. Res. Commun. 93_: 819-824. 86. Peterson, N.S., and H.K. M i t c h e l l . 1981. Proc. Natl. Acad. S c i . U.S.A. 78: 1708-1711. 87. Loomis, W.F., and S.A. wheeler. 1982. Dev. B i o l . 90: 412-418. 88. A l t s c h u l e r , M., and J.P. Mascarenhas. 1982. i n Heat Shock: From  Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 321-327, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 89. Minton, K.W., P. Karmin, G.M. Hahn, and A.P. Minton. 1982. Proc. Natl. Acad. S c i . U.S.A. 7_9: 7107-7111. 90. B a l l i n g e r , D.G., and M.L. Pardue. 1983. C e l l 3^3: 103-114. 91. Thomas, G.P. and M.B. Matthews. 1982. i n Heat Shock: From Bacteria  to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 207-213, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 92. Ingolia, T.D., E.A. Craig, and B.J. McCarthy. 1980. C e l l 21: 669-679. 93. Ingolia, T.D., and E.A. Craig. 1981. Nucl. Acids Res. £: 1627-1642. 94. Hackett, R.W., and J.T. L i s . 1983. Nucl. Acids Res. U : 7011-7030. 95. Schedl, P., S. Artavanis-Tsakonas, R. Steward, W. Gehring, M.-E. Mirault, M. Goldschmidt-Clermont, L. Moran, and A. T i s s i e r e s . 1978. C e l l 14: 921-929. 96. Moran, L.A., M.-E. Mirault, A. T i s s i e r e s , J . L i s , P. Schedl, S. Artavanis-Tsakonas, and W.J. Gehring. 1979. C e l l 1_7: 1-8. 97. Artavanis-Tsakonas, S., P. Schedl, M.-E. Mirault, L. Moran, and J . L i s . 1979. C e l l 1_7, 9-18. - 117 -98. Craig, E.A., B.J. McCarthy, and S.C. Wadsworth. 1979. C e l l 16: 575-588. 99. Goldschmidt-Clermont, M. 1980. Nucl. Acids Res. 8: 235-252. 100. Torok, I., and F. Karch. 1980. Nucleic Acids Res. 8: 3105-3123. 101. Voellmy, R., M. Goldschmidt-Clermont, R. Southgate, A. T i s s i e r e s , R. Levis, and W. Gehring. 1981. C e l l 23_: 261-270. 102. Ingolia, T.D., and E.A. Craig. 1982. Proc. Natl. Acad. S c i . U.S.A. 79: 525-529. 103. Mirault, M.-E., M. Goldschmidt-Clermont, S. Artavanis-Tsakonas, and P. Schedl. 1979. Proc. Natl. Acad. S c i . U.S.A. 76: 5254-5258. 104. Ish-Horowicz, D. and S.M. Pinchin. 1980. J . Mol. B i o l . 142: 231-245. 105. Brown, A.J.L. and D. Ish-Horowicz. 1981. Nature 290: 677-682. 106. Weisbrod, S. 1982. Nature 297: 289-295. 107. E l g i n , S.C.R. 1981. C e l l 27.: 413-415. 108. Wu, C. 1980. Nature 286: 854-860. 109. Keene, M.A., V. Corces, K. Lowenhaupt, and S.C.R. E l g i n . 1981. Proc. Natl. Acad. S c i . U.S.A. 78: 143-146. 110. Levy, A. and M. N o l l . 1981. Nature 289: 198-203. 111. Levinger, L. and A. Varshavsky. 1982. C e l l ^8: 375-378. 112. Karpov, V.L., O.V. Preobrazhenskaya, and A.D. Mirzabekov. 1984. C e l l 36: 423-431. 113. Mace, H.A.F., H.R.B. Pelham, and A.A. Travers. 1983. Nature 304: 555-557. 114. Corces, V., A. P e l l i c e r , R. Axel, and M. Meselson. 1981. Proc. Natl. Acad. S c i . U.S.A. 78: 7038-7042. 115. Burke, J.F. and Ish-Horowicz, D. 1982. Nucl. Acids Res. 10: 3821-3830. 116. Mirault, M.-E., R. Southgate, and E. Delwart. 1982. EMBO J . _1: 1279-1285. 117. Pelham, H.R.B. 1982. C e l l 30: 517-528. 118. Voellmy, R. and D. Rungger. 1982. Proc. Natl. Acad. S c i . U.S.A. 79: 1776-1780. - 118 -119. Pelham, H.R.B. and M. Bienz. 1982. EMBO J . I: 1473-1477. 120. Bienz, M. and H.R.B. Pelham. 1982. EMBO J . _1: 1583-1588. 121. L i s , J . , N. Costlow, J de Banzie, D. Knipple, D. O'Connor, and L. S i n c l a i r . 1982. i n Heat Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 57-62, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 122. Corces, V., A. P e l l i c e r , R. Axel, S.-Y. Mei, and M. Meselson. 1982. i n Heat Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 27-34, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 123. F i n k e l s t e i n , D.B. and S. Strausberg. 1983. Mol. C e l l . B i o l . 3: 1625-1633. 124. L i s , J.T., J.A. Simon, and CA. Sutton. 1983. C e l l _35_: 403-410. 125. Rubin, G.M. and A.C. Spradling. 1982. Science (Wash. D.C.) 218: 348-353. 126. Neidhardt, F.C. and R.A. VanBogelen. 1981. Biochem. Biophys. Res. Commun. 100: 894-900. 127. Yamamori, T. and T. Yura. 1982. Proc. Natl. Acad. S c i . U.S.A. 79: 860-864. 128. Georgopoulos, C , K. T i l l y , D. Drahos, and R. Hendrix. 1982. J . B a c t e r i o l . 149: 1175-1177. 129. Neidhardt, F . C , R.A. VanBogelen, and E.T. Lau. 1982. i n Heat  Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 139-145, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 130. Georgopolous, C P . 1977. Mol. Gen. Genet. 151: 35-39. 131. Itakawa, H., and J. Ryu. 1979. J . B a c t e r i o l . 138: 339-344. 132. T i l l y , K., H. Murialdo, and C. Georgopoulos. 1981. Proc. Natl. Acad. S c i . U.S.A. 78_: 1629-1633. 133. Georgopolous, C P . and B. Hohn. 1978. Proc. Natl. Acad. S c i . U.S.A. 7_5: 131-135. 134. Scott, M.P., and M.L. Pardue. 1981. Proc. Natl. Acad. S c i . U.S.A. 78: 3353-3357. 135. Glover, C.V.C. 1982. Proc. Natl. Acad. S c i . U.S.A. 7_9: 1781-1785. - 119 -136. Sanders, M.M., D. Feeney-Triemer., A.S. Olsen, and J. Farrell-Towt. 1982. i n Heat Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 235-242, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 137. Lindquist, S.L. 1980. J . Mol. B i o l . 137: 151-158. 138. G r a z i o s i , G., F. M i c a l i , F. Marzari, F. d e C r i s t i n i , and A. Savoini. 1980. J . Exp. Zool. 214: 141-145. 139. Dura, J.-M. 1981. Mol. Gen. Genet. 184: 381-385. 140. Roccheri, M.C., M.G. DiBernardo, and G. Giudice. 1981. Dev. B i o l . 83: 173-177. 141. Zimmerman, J.L., W. P e t r i , and M. Meselson. 1983. C e l l 32: 1161-1170. 142. Bensaude, 0., and M. Morange. 1983. EMBO J. 2: 173-177. 143. Khandjian, E.W., and H. T l i r l e r . 1983. Mol. C e l l . B i o l . 3: 1-8. 144. M i t c h e l l , H.K., and N.S. Petersen. 1982. i n Heat Shock: From  Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 337-344, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 145. Caizergues-Ferrer, M., G. Bouche, and F. Amalric. 1980. FEBS Le t t . 116: 261-264. 146. Sanders, M.M. 1981. J . C e l l B i o l . 9_1: 579-583. 147. Glover, C.V*C., K.J. Vavra, S.D. Guttman, and M.A. Gorovsky. 1981. C e l l 23: 73-77 148. Camato, R., and R.M. Tanguay. 1982. EMBO J. 1: 1529-1532. 149. Arrigo, A.-P. 1983. Nucl. Acids Res. 1_1: 1389-1404. 150. Wilhelm, J.M., P. Spear, and C. Sax. 1982. i n Heat Shock: From  Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 309-314, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.. 151. Mayrand, S., and T. Pederson. 1983. Mol. C e l l . B i o l . _3: 161-171. 152. Ron, A. and E. Zeuthen. 1980. Exp. C e l l Res. 128_: 303-309. 153. Biessmann, H., F-G. Falkner, H, Saumweber, and M.F. Walter. 1982. i n Heat Shock: From Bacteria to Man (Schlesinger, M., M. Ashburner, and A. T i s s i e r e s . , eds.) pp. 275-282, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 154. Wolf, K., and M.C. Quimby. 1962. Science (Wash. D.C.) 135: 1065-1066. - 1 2 0 -1 5 5 . Marushige, K. , and J. Bonner. 1 9 6 6 . J. Mol. Biol. 15.: 1 6 0 - 1 7 4 . 1 5 6 . Laemmli, U.K. 1 9 7 0 . Nature (Lond.) JZ27: 6 8 0 - 6 8 5 . 1 5 7 . Matsudaira, P.T., and D.R. Burgess. 1 9 7 8 . Anal. Biochem. 87_: 3 8 6 - 3 9 6 . 1 5 8 . Chirgwin, J.M., A.E. Pryzbyla, R.J. MacDonald, and W.J. Rutter. 1 9 7 9 . Biochemistry 1 8 : 5 2 9 4 - 5 2 9 9 . 1 5 9 . Aviv, H., and P. Leder. 1 9 7 2 . Proc. Natl. Acad. Sci. U.S.A. 6 9 : 1 4 0 8 - 1 4 1 2 . 1 6 0 . Pelham, H.R.B., and R.J. Jackson. 1 9 7 6 . Eur. J. Biochem. 6_7: 2 4 7 - 2 5 7 . 1 6 1 . Wickens, M.P., G.N. Buell, and R.T. Schimke. 1 9 7 8 . J. Biol. Chem. 2 5 3 : 2 4 8 3 - 2 4 9 5 . 1 6 2 . Land, H., M. Grez, H. Hauser, W. Lindenmaier, and G. Schlitz. 1 9 8 1 . Nucl. Acids Res. 9 : 2 2 5 1 - 2 2 6 6 . 1 6 3 . Grunstein, M., and D. Hogness. 1 9 7 5 . Proc. Natl. Acad. Sci. U.S.A. 72.: 3 9 6 1 - 3 9 6 5 . 1 6 4 . Hanahan, D., and M. Meselson. 1 9 8 0 . Gene 1 0 : 6 3 - 6 7 . 1 6 5 . McMaster, G.K., and G.G. Carmichael. 1 9 7 7 . Proc. Natl. Acad. Sci. U.S.A. 7 4 : 4 8 3 5 - 4 8 3 8 . 1 6 6 . Thomas, P. 1 9 8 1 . Proc. Natl. Acad. Sci. U.S.A. _7_Z: 5 2 0 1 - 5 2 0 5 . 1 6 7 . Bresser, J., H.R. Hubbell, and D. Gillespie. 1 9 8 3 . Proc. Natl. Acad. Sci. U.S.A. 80: 6 5 2 3 - 6 5 2 7 . 1 6 8 . Birnboim, H.C., and J. Doly. 1 9 7 9 . Nucl. Acids Res. 1_: 1 5 1 3 - 1 5 2 3 . 1 6 9 . Blin, N., and D.W. Stafford. 1 9 7 6 . Nucl. Acids Res. 3 : 2 3 0 3 - 2 3 1 4 . 1 7 0 . Southern, E.M. 1 9 7 5 . J. Mol. Biol. 9 8 : 5 0 3 - 5 1 7 . 1 7 1 . Maxam, A., and W. Gilbert. 1 9 7 7 . Proc. Natl. Acad. Sci. U.S.A. 7 4 : 5 6 0 - 5 6 4 . 1 7 2 . Maxam, A.M., and W. Gilbert. 1 9 8 0 . Meth. in Enzymol. 6 5 : 4 9 9 - 5 6 0 . 1 7 3 . Sanger, F., S. Nicklen, and A.R. Coulson. 1 9 7 7 . Proc. Natl. Acad. Sci. U.S.A. Ik: 5 4 6 3 - 5 4 6 7 . 1 7 4 . Sanger, F., and A.R. Coulson. 1 9 7 8 . FEBS Lett. 8_7: 1 0 7 - 1 1 0 . 1 7 5 . Messing, J., R. Crea, and P.H. Seeburg. 1 9 8 1 . Nucl. Acids Res. 9.: 3 0 9 - 3 2 1 . - 121 -176. Rigby, P.W.J., M. Dieckman, C. Rhodes, and P. Berg. 1977. J . Mol. B i o l . 113: 237-251. 177. Denhardt, D.T. 1966. Biochem. Biophys. Res. Commun. 2^: 641-646. 178. Yamamoto, K.R., B.M. Alberts, R. Benzinger, L. Lawhorne, and G. Treiber. 1970. Virology 40: 734-744. 179. Blattner, F.R., B.G. Williams, A.E. B l e c h l , K. Denniston-Thompson, H.E. Faber, L. Furlong, J.D. Grunwald, D.O. Ki e f e r , D.D. Moore, J.W. Schumm, E.L. Sheldon, and 0. Smithies. 1977. Science (Wash. D.C.) 196: 161-169. 180. Williams, B.G., and F.R. Blattner. 1979. J . Vir o l . 29: 555-575. 181. Loenen, W.A.M., and W.J. Brammar. 1980. Gene 20: 249-259-182. Maniatis, T., R.L. Hardison, E. Lacy, J . Lauer, C. O'Connell, D. Quon, G.K. Sim, and A. Efstratiadis. 1978. Cell 1_5: 687-701. 183. Girvitz, S.C., S. Bacchetti, A.J. Rainbow, and L. Graham. 1980. Anal. Bioc. 106: 492-496. 184. Sternberg, N., D. Tiemeier, and L. Enquist. 1977. Gene I: 255-280. 185. Hohn, B., and K. Murray. 1977. Proc. Natl. Acad. S c i . U.S.A. 74: 3259-3263. 186. Benton, W.D., and R.W. Davies. 1977. Science (Wash. D.C.) 196: 180-182. 187. Olsen, A.S., D.F. Triemer, and M.M. Sanders. 1983. Mol. C e l l . B i o l . 3: 2017-2027. 188. Shapiro, H.S. 1972. In H.A. Sober (ed.), Handbook of Biochemistry pp. H-96, CRC Press, Cleveland, Ohio. 189. Sulston, J.E., and S. Brenner. 1974. Genetics 7_7: 95-104. 190. Velazquez, J.M. , and S. Lindquist. 1984. C e l l 3_6: 655-662. - 122 -VI. APPENDIX - Is T31 an IS-Element? As mentioned earlier, when the insert to pTHS70.7 was sequenced and analyzed, an unusual feature became evident. The total insert of about 2.2 Kb length consisted of two separate and unrelated sequences. One half of the insert (850 bp) had partial sequence information for a trout hsp70. The hsp70 cDNA came to an abrupt halt and the rest of the insert (1370 bp) was totally unrelated to i t . The hsp70 coding region was further analyzed and discussed earlier in this thesis. Due to the unusual nature of the insert in pTHS70.7, two other trout cDNA libraries were screened for the presence of other such "fusion" cDNAs. The probe used for this purpose consisted of 170 bp of hsp70 sequence and 690 bp of the unassigned sequence from pTHS70.7. The two new cDNA libraries were made, from mRNA of arsenite-induced RTG-2 cells , using the double tai l i n g method. A high density screen of these libraries revealed the presence of a number of clones homologous to the probe. A l l of these clones were analyzed by restriction mapping which proved them to be identical to the unassigned sequence from pTHS70.7. One of the new clones, pT31, was studied further by nucleotide sequencing. The partial restriction maps and sequencing strategies for the right half of THS70.7 and T31 are shown in Figure 33. The similarity of the two clones was further enhanced when their nucleotide sequences were compared. There was base for base sequence identity between T31 and the right half of THS70.7, except that the ends of these sequences varied in length by a few bases. For this reason, only the total base sequence for T31 is presented here (Figure 34). In addition, the 51 and 3' ends of the two sequences are compared in Figure 35. An interesting - 123 -Figure 33. Partial restriction map and strategy used to determine the nucleotide sequences of THS70.7 and T31 cDNAs. Arrows represent the direction of sequencing from Klenow-labelled fragments, using either the chemical cleavage method (squares) or the dideoxy termination method (circles). The lengths of the arrows represent the actual number of nucleotides sequenced from each site. The boxed regions represent the cDNA sequences whereas the thin lines represent pBR322 DNA. The hatched area represents part of the hsp70 coding region from THS70.7. The restriction sites are: A, Avail; B, BamHI; P, PstI; S, SauIIIA; Sm, Smal; T, TagI. Sm Sm B THS70.7 B p T31 2 0 0 bp - 124 -T31 M N V CTGCAGGGGGGGGGGGCGGGGGGGCCCATAAGCGCT A ACT T A AC.GGT TGTGGT A T T ACGCCTGA T A TGAT T T A ACGTGCCGATGAA T T AC 15 30 15 60 75 90 S H D N W S A 1 L A H I G K P E E L D T S A R N A G A L T R T C T C A C G A T A A C T G G T C A G C A A T T C T G G C C C A T A T T G G T A A G C C C G A A G A A C T G G A T A C T T C G G C A C G T A A T G C C G G G G C T C T A A C C C G C 105 120 135 150 165 180 R R E I R D A A T L L R I G I A Y G P G G M S L R E V T A W C G C C G C G A A A T T C G T G A T G C T G C A A C T C T G C T A C G T C T G G G G C T G G C T T A C G G C C C C G G G G G G A T G T C A T T A C G T G A A G T C A C T G C A T G G 195 210 225 240 255 270 A O L H D V A T L S D V ' A L L K R L R N A A D W F G I L A A G C T C A G C T C C A T G A C G T T G C A A C A T T A T C T G A C G T G G C T C T C C T G A A G C G G C T G C G G A A T G C C G C C G A C T G G T T T G G C A T A C T T G C C G C A 285 300 3 15 330 3J5 360 Q T L A V R A A V T G C T S G K R L R L V D G T A I S G P G C A A A C A C T T G C T G T ACGCGCCGCAGTTACGGGTTGT .ACAAGCGGAAAGAGATTGCGTCTTGTCGATGGAACAGCAATCAGTGGCCCCGGG 375 390 105 120 135 I S O G G T A E W R L H M G Y D P H T C O F T D F E L T D S R D A G G C G G C A C C G C T G A A T G G C G A C T A C A T A T G G G A T A T G A T C C T C A T A C C T G T C A G T T C A C T G A T T T T G A G C T A A C C G A C A G C A G A G A C G C T 465 480 495 510 525 5 1 0 E R L O R F A ' O T A D E I . R I A O R G F G S R P E C I R S L G A A C G G C T G G A C C G A T T T G C G C A A A C G G C A G A C G A G A T A C G C A T T G C T G A C C G G G G A T T C G G T T C G C G T C C C G A A T G T A T C C G C T C A C T T S 5 5 5 7 0 585 6 0 0 615 G 3 0 A F G E A D Y I V R V H W R G L R W L T A E G M R F D M M G G C T T T T G G A G A A G C T G A T T A T A T C G T C C G G G T T C A C T G G C G A G G A T T G C G C T G G T T A A C T G C A G A A G G A A T G C G C T T T G A C A T G A T G G G T 6 1 5 6 6 0 6 7 5 6 9 0 705 7 2 0 F L R G L D C G K N G E T T V M I G N S G N K K A G A P F P T T T C T G C G . C G G G C T G G A T T G C G G T A A G A A C G G T G A A A C C A C T G T A A T G A T A G G C A A T T C A G G T A A T A A A A A A G C C G G A G C T C C C T T T C C G 735 7 5 0 765 780 795 8 1 0 A R L I A V S L P P E K A L I S K T R L L S E N R R K G R V G C A C G T C T C A T T G C C G T A T C A C T T C C T C C C C . A A A A A G C A T T A A T C A G T A A AACCCGACTGCTCAGCGAGAATCGTCGAAAAGGACGAGTA 8 2 5 8 4 0 8 5 5 8 7 0 885 9 0 0 V 0 A E T L E A A G H V L L L T S L P E D E Y 5 A E 0 V A D G T T C A G G C G G A A A C G C T G G A A G C A G C G G G C C A T G T G C T A T T G C T A A C A T C A 7 T A C C G G A A G A T G A A T A T T C A G C A G A G C A A G T G G C T G A T 9 1 5 9 3 0 945 9 6 0 975 9 9 0 C Y R L R W O I E L A F K R L K S L L H L D A L R A K E P E T G T T A C C G T C T G C G A T GGCA A A T TGA ACTGGCT T T T A A G C G G C T C A A A A G T T TGCTGCACCT GGATGCT T TGCGTGCAA AGGA ACCTGA A 1005 1020 1035 1050 1065 1080 L A K A W I F A N L L A A F L I D D I I S H R W I 5 P P E V CTCGCGA A AGCGTGGAT ATT TGCT A A TCT AC TCGCCGCA TT TT T A A T TGA CG AC A T A A TC AGCC A TCGC T GGA T TTCCCCCCCAGA AGTG 1095 1110 1125 1140 1155 1170 R I R K E E L T R C G E * C G G A T C C G A A A A G A A G A A C T A A C T C G T T G T GG A G A A T A AC A A A A A T GGT C A T C T GGAGC T T AC AGGT GGCC A T TCGTGGGAC AGT A TCCC 1185 1200 1215 1230 1245 1260 T G A C A G C C T A C A A A A C G C A A T T G A A G A A C G C G A G G C A T C G T C T T A A C G A G G C A C C G A G G C G T C G C A T T C T T C A G A T G G T T C A A C C C T T A A 1275 1290 1305 1320 1335 1350 G T T A G C G C T T A T G G G G G G G G G C C C C 1360 1370 Figure 34. Nucleotide sequence for T31 with i t s predicted amino acid sequence. The single letter amino acid code has been given in the legend to Figure 18. - 125 -EH r o EH - O n CJ CJ O CJ CJ CJ O CJ CJ cj CJ EH EH < EH EH u cj cj CJ u CJ o CJ < < EH EH EH EH CJ CJ a < < < EH EH EH EH CJ CJ CJ U U CJ cj cj £1 XI (71 (Tl CM CN) CJ a EH EH EH EH CJ O CJ O CJ CJ EH EH EH EH U CJ < < < EH CJ CJ CJ CJ U CJ CJ CJ < 2 EH EH < < CJ U CJ u CJ CJ CJ CJ CJ CJ CJ CJ Figure 35. The inverted repeat of T31. The length of the perfect repeat i s at least 25-31 bp. The unusual number of GC pairs at both the 5' and 3' ends may explain how th i s element was r e a d i l y cloned into the PstI s i t e of pBR322. - 126 -f i n d i n g was the i n d e n t i f i c a t i o n of a perfect inverted repeat at the ends of the T31-like sequences (Figure 35). One of the c h a r a c t e r i s t i c s of mobile elements i s the occurrence of an inverted repeat at the ends of a region of DNA1. This may explain how the T31-like sequence inserted i t s e l f within the hsp70 sequence of THS70.7. However, since no d u p l i c a t i o n i s observed at the s i t e of i n t e g r a t i o n , the l a t t e r explanation may not be v a l i d . Although no promoter l i k e sequences were i d e n t i f i e d i n the T31 element, one long open reading frame was present (Figure 34). This 375 amino acid long region contained both an ATG s t a r t s i t e and a TAA stop codon. No polyadenylation s i g n a l (AAUAAA) could be i d e n t i f i e d on the 3' side of the stop codon. The hypothetical protein sequence for T31 was sent to the National Biomedical Research Foundation at the Georgetown University Medical Center i n Washington, D.C. A search was conducted i n t h e i r protein sequence database for homology to the T31 hypothetical protein. Although no extensive homologies were found i n the 2538 sequences searched, the best homology was to the IS4 hypothetical protein I from E. c o l i 2 . The I S - l i k e q u a l i t i e s (see Table VI) of T31 would suggest that the l i m i t e d homology to the c o l i IS4 was not a coincidence. TABLE VI. Comparison of T31 to IS4 T31 E . c o l i IS4 2 Length Major ORF Inverted Repeat 1347 bp 365 aa 31 bp 1428 bp 442 aa 18 bp T31 was subjected to further analysis by using i t as a probe against trout DNA and RNA ( r e s u l t s not shown). Hybridization was not detected i n - 127 -either case. The most likely explanation for these negative results is that the T31-element did not orginate in the trout genome, but from the chromosome of the host strain (E. c o l i RR1) during the transformation procedure. To further investigate this phenomenon, E. c o l i B genomic DNA (Sigma Ltd.) was digested with several different restriction enzymes and Southern blot analysis carried out. When probed with the T31 sequence, several distinct bands were revealed indicating the presence of T31-like elements at several locations in the E. c o l i genome (Figure 36). In conclusion, the T31 sequence has been tentatively identified as a prokaryotic IS-element. These results should also serve to warn other researchers about one of the several artefacts that can be encountered during cloning procedures. Shapiro, J.A. (editor). 1983. Mobile Genetic Elements, Academic Press. Klaer, R. , S. Kuhn, E. Tillmann, H.-J. Fr i t z , and P. Starlinger. 1981. Mol. Gen. Genet. 181: 169-175. - 128.. -Figure 36. Southern bl o t analysis of E . c o l i genomic DNA. DNA from E . c o l i (lanes 1-5, 8, and 9) and pT31 (lanes 6 and 7) was digested with a v a r i e t y of r e s t r i c t i o n enzymes, fractionated on a 0.7% agarose g e l , and transferred to NC paper. The probe used was [ 3 2 P ] l a b e l l e d PstI fragments from T31. The digests i n (A) were performed such that fragments from within T31 were l i b e r a t e d . In contrast, the digests i n (B) were chosen to l i b e r a t e fragments containing whole copies of T31. The r e s t r i c t i o n enzymes (with expected i n t e r n a l fragment size) are as follows: (1) H i n f l , 283 bp; (2) P s t l / R s a l , 316 bp; (3) PstI/BamHI, 483 bp; (4) Ddel, 599 bp; (5) BamHI/Rsal, 800 bp. Lanes (6) BamHI/Rsal and (7) PstI were control digests of pT31. Lanes (8) H i n d l l l and (9) Pvul indicate that T31 i s present i n 3 copies i n the E . c o l i genome. Size markers are from a HindiII digest of phage lambda DNA. (Southern b l o t courtesy of D. Jones). - 1 2 8 A -A 1 2 3 4 5 6 7 2X7 ~ II B 8 9 H JL3— • I w -•"> 0 6 -0.6— 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0096634/manifest

Comment

Related Items