UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of the ribosomal RNA gene cluster in Halobacterium cutirubrum Hui, Ivy Yuk Chee 1984

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1984_A1 H85.pdf [ 5.4MB ]
Metadata
JSON: 831-1.0096406.json
JSON-LD: 831-1.0096406-ld.json
RDF/XML (Pretty): 831-1.0096406-rdf.xml
RDF/JSON: 831-1.0096406-rdf.json
Turtle: 831-1.0096406-turtle.txt
N-Triples: 831-1.0096406-rdf-ntriples.txt
Original Record: 831-1.0096406-source.json
Full Text
831-1.0096406-fulltext.txt
Citation
831-1.0096406.ris

Full Text

CHARACTERIZATION  OF THE RIBOSOMAL  HALOBACTERIUM  RNA  GENE  CLUSTER  CUT I RUB RUM  by  IVY  A  YUK  CHEE  HUI  B.Sc., The University  of  British  Columbia, 1980  M.Sc., The University  of  British  Columbia, 1982  THESIS SUBMITTED THE  IN PARTIAL  REQUIREMENTS DOCTOR  FOR  OF  FULFILMENT  THE DEGREE  OF  OF  PHILOSOPHY in  THE F A C U L T Y OF G R A D U A T E STUDIES Department  We  of  Biochemistry  accept this thesis as conforming to the required standard  THE  UNIVERSITY  OF BRITISH  August  ©Ivy Yuk  COLUMBIA  1984  Chee Hui, 1984  .  In  presenting this  requirements of  British  it  freely  agree for  thesis  in partial  f u l f i l m e n t of  f o r an a d v a n c e d d e g r e e a t  Columbia, available  I  the  University  agree t h a t the L i b r a r y  for reference  and s t u d y .  that permission for extensive  copying of  understood that financial  copying or p u b l i c a t i o n of  I  make  further this  thesis  Department o f  BlOCHGMXST#)/  The U n i v e r s i t y o f B r i t i s h 1956 Main Mall V a n c o u v e r , Canada V6T 1Y3 @<I  this  It  is thesis  g a i n s h a l l n o t be a l l o w e d w i t h o u t my w r i t t e n  permission.  Date  shall  s c h o l a r l y p u r p o s e s may be g r a n t e d by t h e h e a d o f my  d e p a r t m e n t o r by h i s o r h e r r e p r e s e n t a t i v e s . for  the  /a,  Columbia  ii  ABSTRACT  A  detailed  ribosomal  RNA  cutirubrum  was  with the  eubacteria  could  The  cluster  rRNA  genes  which  are  transcript  from  is  found  and 5S  gene  distal  contains  two  bipartite  direct  rRNAs.  imperfect repeat  AAGTAA,  believed  promoter.  In  sequences  which  to  the  followed  3'  T  The  an  }  5S  the 5'  function upstream  in  by  contains  the  genomic  ribosomal  RNA  cutirubrum  genome.  Southern  genes  are  unique  single  cluster  gene to  was  that  inverted repeat of  flanking  three the  perfect  of  5S  experiments DNA  and  the  a  sequence  there  a  are  inverted G/C  cysteine  indicated  within  of  Halobacterium  gene,  from the  cluster  copies,  termination—an tRNA,  23S  primary  gene  the  rRNA  space  and  large  the  two  sequences  hexanucleotide  cysteine  copy  a  gene  contains  16S  of and  5.8S  intergenic  gene. The  transcription  hybridization  also  16S-23S  component  the  rRNA  eucaryotic  cluster  region followed by an A / T rich region downstream Finally,  identical  rRNA  sequence  from  cloned  gene  be  the  perfect  flanking  entire 23S  processing  important  a  Halobacterium  the  in the  followed  which  sequence  may by  in  to gene  gene the  species  the  to  of  occupying proximal, middle  RNA  long nearly  copies, unit  to  of of  equivalent  tRNA  utilized  mature  genes  ribosomal  are surrounded by  into  sequence  organization  No  organization  archaebacterial  middle  respectively.  presumably  and  the  16S, 23S  tRNA  the  DNA  genes, an alanine  a cysteine  structure  in  demonstrated. This tRNA  the  a region  gene  with the  be  repeat  of  undertaken. The  positions  putative and  gene  exception of  determined.  distal  analysis  that  rich tRNA. the  Halobacterium  iii  TABLE OF CONTENTS  ABSTRACT TABLE  ii  OF CONTENTS  iii  LIST OF FIGURES  vi  LIST OF T A B L E S  viit  ACKNOWLEDGEMENTS  ix  INTRODUCTION  1  Cellular evolution of Archaebacteria Diversity  and unique characteristics  1 of  archaebacteria  5  1.  The archaebacterial  cell envelopes  6  2.  Metabolisms and bioenergetics  7  3.  Transcription and translation machineries  9  4.  Antibiotic sensitivity  11  5.  Repeated  12  sequences  The organization of ribosomal RNA  genes  12  1.  Eubacterial  ribosomal RNA  gene clusters  12  2.  Eucaryotic  ribosomal RNA  gene clusters  14  3.  Chloroplast  and  mitochondrial ribosomal  RNA  gene  clusters 4. The  15  Archaebacterial ribosomal RNA  present  ribosomal  investigation—molecular  RNA  genes  in Halobacterium  gene clusters  characterization cutirubrum  15 of  the 17  ABBREVIATIONS  19  MATERIALS  20  AND METHODS  Chemicals  20  iv Bacterial  strains and growth conditions  Purification  of Halobacterium  Construction of X\055-H.  cutirubrum  21 chromosomal DNA  21  library  cutirubrum  23  Purification of ribosomal RNAs  24  Synthesis  24  of ribosomal cDNA  Screening of the library  for ribosomal RNA genes  25  Purification  of bacteriophage DNA  28  Preparation  of a nick-translated probe  29  Northern blot analysis  29  Southern blot analysis  30  M13 cloning and DNA sequencing  30  Nuclease  31  S1 mapping  Restriction enzyme digestion Agarose  gel electrophoresis  Polyacrylamide Recovery  32 . . .  gel electrophoresis  . .'.  33  of DNA from polyacrylamide gels  33~~  RESULTS Part  34 I:  Localization  of  rRNA  gene  cluster  in  genomic  X1059 library  34  Construction of X1059-/V. cutirubrum  Part  32  library  34  Screening for rRNA  genes in genomic library  35  Restriction  of XHc4 and XHc9  36  analysis  Southern blot analysis of XHc4 and XHc9 D N A s  38  Northern blot analysis  41  II:  Sequence  Subcloning  of  M13 vectors  of XHc4 and XHc9 DNAs  analysis of the rRNA the rRNA  gene  into  gene cluster  43  plasmid pBR322 and 43  V  Part  DNA  sequences of the rRNA  III:  Single  copy  rRNA  gene cluster  genes  DISCUSSION Direct  46 52 58  bipartite  repeat  sequence  58  Ribosomal RNA genes  60  Inverted repeat  63  sequences  Transfer RNA genes  67  Terminator  69  sequences  Unique copy REFERENCES  of ribosomal RNA genes  71 73  vi  LIST OF FIGURES  Figure  1:  Figure 2:  The three primary kingdoms Organization eubacteria,  of  3  ribosomal  eucaryote,  RNA  and  gene  in  clusters  the  in  organelles  chloroplast and mitochondria Figure 3:  Organization  of  13  ribosomal  RNA  genes  in  ten  different species of archaebacteria  16  Figure 4:  Plaque hybridization autoradiogram  27  Figure 5:  Restriction endonuclease maps of \ H c 4 and XHc9  37  Figure 6:  Southern  hybridization of  ribosomal cDNA to XHc4  and \Hc9 D N A s  39  Figure 7;  Cross Southern hybridization of X.Hc4 and XHc9  40  Figure 8:  Northern  hybridization  of XHc4  and XHc9  DNA  to  ribosomal RNAs  42  Figure 9:  Plasmid subclones of \Hc4 and XHc9  44  Figure  10:  Sequencing map of the ribosomal gene cluster  45  Figure  11:  The  5'  flanking  sequence  of  the  ribosomal  RNA  gene cluster  47 49  Figure  12:  The  16S ribosomal RNA gene sequence  Figure  13:  Nuclease  S1  mapping  of  the  5'  and  3'  end  of  mature 23S rRNA Figure  14:  The  intergenic  space  50 between  the  16S  and  23S  rRNA genes Figure  15:  The 3' flanking sequence of the 23S rRNA gene  51 ......  53  vii Figure  16:  Location  of  the  fragment  Southern  hybridization  used  with  for  respect  genomic  to  the  rRNA  gene cluster Figure  17;  Genomic  54  Southern  within the rRNA Figure  18:  Genomic  hybridization  with  probes  from  gene cluster  Southern  55  hybridization  probe  with  fragment containing a 5' flanking repeat Figure  19:  Direct the  Figure 20:  repeat  units  16S rRNA  Secondary  in the  57  5' flanking sequence  of  gene  59  structure  map  of  16S  rRNA  of  H.  61  cutirubrum Figure 21:  Figure 22:  Nucleotide  sequence  cutirubrum  and M.  Sequences 23S rRNA  Figure 23:  Cloverleaf cysteine  Figure 24:  homology between  vannielii  flanking  the  23S rRNA 16S  rRNA  E.  coli,  H.  genes  gene  and  64 the  gene  65  structure  of  putative  alanine  tRNAs  An inverted repeat  and 68  termination-like signal  70  viii LIST OF T A B L E S  Table  1  Genotypes  of E. coli  and phage X strains  22  ix  ACKNOWLEDGEMENTS I am very patience, spent  grateful  guidance  my  throughout  on the secondary I would  to  my  structural  like to thank  research supervisor, Dr. P.P. study  and  map of  16S rRNA  Dr. R.T.A. McGillivray  their  continuous enouragement  and valuable  also  like  technician  technical I  to  thank  our  especially  lab.  Dennis, for  for  of H.  the  time  his he  cutirubrum.  and Dr. J .  McPherson  for  suggestions. In addition, I would  Mrs.  D.  de  Jong  Wong  for  her  help. would  like  Medical Research  to  acknowledge  Council.  the  financial  support  of  the  Canadian  1 INTRODUCTION  Cellular evolution of Before  1977,  dichotomous (e.g.  cells  some  (80,  phylogenetic  these  of  phenotypic In  the  enormous known  15  evolutionary  invaded  symbiotic,  they  aboriginal  had  be  as  including  (e.g. cells  mainly  on  the  fundamentally  either  plants, animals  true  and  evolutionary  and  formed  bacteria).  structural  the  eucaryotic  lacking a well  and  neglected  it  has  between  the  This  functional origins  of  that  alone  exist  descent  of  to  between the  one  of  the  and  algae  most  of  current  not  a  and aerobic  status  cytoplasm  as  sufficient  procaryotes of  and  the  is  an  with  no  popular  chloroplasts  (79, 118, 126). After  their are  there  procaryotes  mitochondria  cells  that  and  theory,  blue green  host  associations  differences  of  free-living  evolve  apparent  eucaryotes  origin  to  become  symbiotic  protoeucaryotic  continued  line  and  (128). The  endosymbiotic  many  classified  cyanobacteria  based  gap  explaining  separately  the  procaryotic  years,  eucaryotes, suggested that  These  nucleus;  to  characteristics.  past  for  formed  was cell  believed  were  mycoplasma,  living  was  organisms  organisms) or  intermediates  theories  earth  a well  dichotomy the  on  127). A l l  including  aspects  life  containing  unicellular  nucleus;  Archaebacteria  in  bacteria becoming  organelles.  explanation eucaryotes;  eucaryotic  cell  of the is  ill-defined and remains unexplained.  Recent phenotypes  studies can  be  on  cellular  achieved  pathways—this  phenomenon  technique  following  for  evolution  in is  organisms  termed  evolution  have with  convergent  utilizes  indicated  that  different  evolutionary  evolution.  comparative  similar  amino  A  recent acid  or  2 nucleotide 166).  sequences  Using  these  evolutionary  macromolecules  molecular  distances  characteristics  of  characteristics. examples  of  of  and  forms are  (14-18S  rRNA) was  because  of  its  functional  constancy  distribution,  its  size  its  possible to and  much  found to  sequence more  rapid  living  ease  an entire to  small  simply  Using this technique Woese that  be the  and  also RNA best in of  of  to  the  living  molecular  to  small  phenotypic in  classifying  ribosomal  phylogenetic  organisms, (35,  143).  and his coworkers  T,  subunit  purposes  its  universal  Although  subunit ribosomal RNA, it is its  (34, 158) were  able  aboriginal  it  is  sufficient  oligonucleotide  into three, not two  (32,  estimate  the  useful  for  isolation  change to  infer  regard  choice all  of  possible  extremely  characterize  organisms can be divided  is  without  evolution. The  and  it  relationships,  techniques  convergent  chronometers  chronometers  ancestrial  These  as  catalog. to  show  lines  of  descent: 1.  The eubacteria—all  2.  The  typical  urcaryotes—the  bacteria;  nucleate  precursors  of  the  eucaryotic  cells;  halophilic  and  and 3.  The  archaebacteria—methanogenic,  thermoacidophilic The  fundamental  rather  extreme  procaryotes.  distinctions  in this  tripartite  division  than supramolecular or structural  (Figure  Woese  suggested  stemmed simpler  from entity  complexes between  et  were  al., a  (155,  157,  common,  than still  genotypes  a  universal  procaryote  evolving and  159)  and  trying  phenotypes.  semi-autonomous subcellular entities  The  1). to  life  are  molecular  1). that  ancestor—the (Figure  of  extant  life  has  progenote, which  In  the  establish complexes  that somehow  all  progenote stable are  group to  is  a  stage,  relationships visualized  give  as  ill-defined  3a.  Figure  1:  The three primary kingdoms.  Woese eubacteria progenote. contain  and  Eubacteria  and  methanogens They  photosynthetic to  (156)  and  that  arose  true  archaebacteria  bacteria;  the  from  membrane. Eubacteria  are  whereas  were bacteria  separately which  eucaryotes.  invaded  became  and  three a  kingdoms,  universal  procaryotes  contain  by  are  ancestor—the they  contain  nucleated  cyanobacteria  endosymbionts  mitochondria  and  urcaryotes,  do  not  cyanobacteria, photosynthetic  archaebacteria  and thermoacidophiles. Urcaryotes  organelles'—chloroplasts  become  proposed  archaebacteria,  a nuclear  bacteria,  cells.  et al.,  and  respectively,  halophiles,  protoeucaryotic and  gradually hence  purple evolved  urcaryotes  3  Fungi  Protozoa  Animals  Plants  Eucaryotes (chloroplasts)  Cyanobacteria  Halophiles Methanogens  (Mitochondria) I  Desulfurococcaceae  Spirocheates  Therraoproteales Sulfolobus A  Gram + Bacteria  Purple Photosynthetic Bacteria  Thermoplasma  Archaebacteria  Urcaryotes  Progenote  Green Photosynthetic Bacteria  Eubacteria  4 cellular  forms  Presumably,  with  as  a  ready  information  exchange  processing  and  flow  of  genetic  became  more  accurate,  exchange diminished, and the progenote stabilized to gave the  eubacteria, urcaryote  urcaryote  evolved  procaryotic  from  counterpart  Although resemblance  and  archaebacteria.  the  progenote  because  of  archaebacteria  whatsoever  to  at  It a  has  been  somewhat  the  level  of  rise separately  to  suggested that later  time  the presence of the nucleus bear  no  eucaryotic  properties that are characteristically  structural  cells,  they  or  have  eucaryotic. These  certain  The non-formylated  3.  The amino acid sequence of  4.  Introns in tRNA  5.  The  Thermoplasma 6.  The  ADP  factor 7.  The rather  8.  The  by  its  molecular  include:  2.  histone-like  than  supramolecular  The light-transducing bacteriorhodopsin in H. halobium  genes  the  (155).  1.  initiator  materials.  methionine tRNA  (7, 96);  (150);  ribosomal ' A ' protein  (81);  (53);  proteins, and  actin-  and  myosin-like  proteins  in  (120, 135);  ribosylation  of  the  archaebacterial  translation  elongation  tRNAs  eucaryotic  diphtheria toxin (60, 61);  preferential  charging  than eubacterial sensitivity  of  archaebacterial  aminoacyl tRNA  towards  anisomycin  synthetases  but  not  by (69);  chloramphenicol  (44,  99). Indeed, it has been suggested that archaebacterial-like the  precursor  invasion  of  (68, 145).  the  protoeucaryotes  prior  to  cells  evolved  endosymbiotic  to  give  eubacterial  5 Diversity  and unique characteristics  The (35,  155;  kingdom Figure  1)  archaebacteria  of  archaebacteria  has  according  the  to  been  divided  into  oligonucleotide  T  1  three  subgroups  catalog  of  their  rRNAs: 1.  The methanogens and extreme halophiles;  2.  The thermoacidophiles—e.g.  3.  The wall-less thermoacidophiles—Thermoplasma.  Collectively niches ago.  these  similar  to  as  to  methane  form  bottom  require along is  conditions  Methanogenic  1956 (5)  the  organisms  the  a  anaerobic  of  high  acidic  the  tailings  In  that  is  range  a  limiting  of  on earth  which that  found  or  were  hot  at  Great  2  to  survive;  Salt  Lake  grows (pH=2)  membrane  environmental  3500 million  described  by  and  at is  are in  Dead  in  hot  possesses  no  found  salty Sea.  in the  or  in  that  habitats Sulfolobus  (80°C)  sulfur cell  slug of  in  acetate  bacteria  temperatures  found  which is  grow  and the high  and  or  plants, in bogs  halophiles they  years  Barker  2  in sewage-treatment  salt  which  least  originally  springs. Extreme  of  unusual  metabolize H , C 0 , methanol  thermoacidophiles cell  and  in  springs; wall  hot  but  acidic  (20).  spite  the  prevalent  envirnoments  of  phylogenetic of  extreme  borders, the  thermoacidophiles  merely  their  gas, are  concentrations  Thermoplasma  inhabit  bacteria  oceans  ocean  extremely  coal  bacteria,  Sulfolobus;  true  the  small  diversity bacteria.  number and  This  of  known  phenotypic diversity  species  variety  has  been  biochemical and molecular techniques which  of  appear  archaebacteria, comparable  confirmed  by  a  to  wide  are discussed below.  6 1. The archaebacterial The  cell  envelopes  diaminopimelic  essential  component  (55).  Methanobacteriales,  In  structure,  of  and  eubacterial  alternating  (63).  of  ways. Unlike 1.  is  is  absent  replaced  Although  N-acetylated  hexosamines cross-linked by  acid-containing  cell wall,  murein  pseudomurein  possess  muramic  both  by  in all an  murein  hexosamines  short  peptidoglycan,  and  peptides, they  an  archaebacteria  unique and  analogous  pseudomurein  acid-derivatives  are  different  of  in a number  murein, pseudomurein contains:  D-glucosamine  and  D-galactosamine  instead  of  only  ' D-glucosamine; 2.  L-talosaminuronic  3.  0-1,3  linkage  4.  Only  L-amino  Other  acid  instead of D-muramic  instead of acids  gram-positive  linkage; and  0-1,4  instead of D-  archaebacteria  and L-amino  contain  galactosamine, glucose, mannose, glucuronic no  mureins  in  their  cell  envelopes  archaebacteria  contains  composed  glycoproteins  fibrillary cells  of  structures  (54,  55).  cytoplasmic  which  isoprenoid identical called  have  hydrocarbons  ether-linked  cell  arranged  heteropolysaccharides  or  55).  galacturonic The  wall.  in  acid)  gram-negative  Their  hexagonal  cell  contains  no  cell  but  have  group  envelopes  arrays  wall  (e.g.  and  (4,  51),  sometimes form a protein sheath encasing  lack  found  Instead they  (54,  acids.  rather  it  of are  or  in  several has  a  containing glycoproteins (162).  Archaebacteria  cells.  rigid  Thermoplasma  membrane  characteristically  no  acid;  the  in the  ester-linked  membranes  of  isoprenoid, isoprenyl  straight the  alkyl  diphytanylglycerol  chains diether  of  C -phytane 20  or  eubacterial  glycerol  (58, 71). The glycerolipids  chain  fatty and  acids  eucaryotic  ethers, and non-polar  of  archaebacteria  or  C -biphytane 40  dibiphytanyldiglycerol  contain and  are  tetraether  7 respectively the  (58, 59, 72, 73, 139). While diethers  halophiles, tetraethers  constitute  Thermoplasma  and Sulfolobus.  contain  1 to  from  biphytanyl  (70).  interaction  of  membrane and  is  found  The  analogous  the  and  eucaryotic  and  cells  are  characterized  hydrocarbons  (48,  141).  (C ),  pentaisoprenes  30  degree cell, with  skeletons  of  ratio  decreased  archaebacteria  of  and  assemble  74,  83,  to vary the fluidity  123).  in  the  and stability  C^-Cjo  decreases  the  diether  lipids  are of of  isoprenoid  derivatives e.g.  derivatives.  of  squalene  Variation state  of  in the  proportionately  these  of their  high  which  non-polar  Therefore,  in the  span  Neutral  and  also  membranes  physiological  hydrosqualene (140).  in  unsaturation,  unsaturated  differences  rates  of  lipids  of  through  (72). These  polar  are  degrees  bilayer  tetraethers  found  isoprenoid  to  can  extremely  lipid  the  phospholipids  their  squalene  aeration  to  at  "monolayer"  hydrocarbons  (C )  reflects  grow  normal  lipid  by  varying  glycolipid residues  thermoacidophiles  that a  (58,  with 2S  reduction  e.g. the  The  of  the  chains, whereas  used  archaebacteria  isoprenoid  strains form  are  glycolipids  of  glycerolipid in  (23, 24). Increased cyclization  an amphiphilic  components  to  bacterial  with  phytanyl  and resemble  tetraether  rings  diethers  opposing  all  tetraethers  4 cyclopentyl  group  temperature  The  nearly  are the sole  lipids  permit  membranes.  2. Metabolisms and bioenergetics Not  only  constructing have  cell  evolved  restricted acetate).  do  a  range Most  archaebacteria  envelopes distinct of  and  methanogenic  to  synthesizing  pathway  substrates  appear  for (H , 2  bacteria  plus C O i as sole source energy, C 0  2  the C0 , 2  are  use  lipids,  novel but  acquisition  the  of  and  in  methanogens  energy  trimethylamine,  autotrophic  pathways  from  methanol  can  being reduced to methane  grow  a and  on  (4, 134).  H  2  8  4H  + C0  2  Studies cofactor  CH  2  on the  involved  to  methane  in  is  of  ATP.  cofactors  are  involved  methane  acid  In  of  methanogenesis  methyl-transfer  an  synthesis  of  2  biochemistry  2-mercaptoethansulfonic M  + 2H 0  4  (84,  addition  nor  that  and  coenzyme  in methanogenesis  generation  reduction  process  to  of  a  new  coenzyme  M  or  reactions,  133). The  exergonic  have revealed  is  M,  of  methyl  coupled at  least  with  synthesis  has  the  net  six  other  the  mechanism  been  elucidated  (109, 146). Neither  ATP  coenzyme  new  completely. Besides  the  highly  specialized  methanogenic  bacterium  via  non-Calvin-type  a  novel  intermediate  of  synthesized  from  compound except  for  for  this  the  one-carbon  oxaloacetate,  detailed  studies  are  of  (7,  a  Bacteriorhodopsin  via  2  fixation  acetyl  pathway  coenzyme  one-carbon  of  carbon  required  the  Further  C0  coenzyme to  the  (36,  skeleton  A , and  provide  and  of  fixation  2  37).  A , which  units,  autotrophic  assimilates  thermoautotriphicum  bound  units.  archaebacteria, possess  cutirubrum,  bacteriorhodopsin  retinal  is  succinyl  halophilic  Halobacterium  transverses  C0  metabolism,  The  all  to  the  cell  proceeds  be  starting  compounds to  generate  c-ketoglutarate, etc.  additional  2  central  appears is  C0  information  More  on  this  pathway.  The  consists  via  2  synthesis  pyruvate,  metabolic  Methanobacterium  pathway  2C0  energy  the  a  base  Halobacterium purple like  bacteriorhodopsin,  single  membrane  a Schiff  a  131). Bacteriorhodopsin,  protein, is  e.g.  chain  seven  and  polypeptide times,' and  conformation  at  membrane the  of is  248  retinal amino  covalently  the £-amino  containing  eucaryotic a  and  halobium  group  rhodopsins, molecule. acids  linked of  which to  the  lysine-216  9 residue  (6, 62). This  translocation  of  transmembrane  protein  protons  and  ATP  and reducing  2S  + 2H 0  S In  is  this  SGv  b  near and  the  responsible  sulfur  to  in  a  in order  to  + 4H*  J  anion  electrical  potential  the  generating  sulfate  which  is  extruded by  potential enhances  transport  the  protons across the  chain, which  membrane  Thermoplasma  a  inside the active  its concentration gradient to maintain the  quinone,  for  membrane  + 6e-  +  sulfate  neutrality. The electron  transport of  + 8H  2  a positive  electrical  protons against cell  2SCV  acidophiIum,  positive  is  light-dependent  gradient..  2  2  bound ATPase, leaving  the  power.  + 4H 0  Thermoplasma  in  oxidize molecular  + 30  3  involved  consequently  electrochemical  The thermoacidophiles generate  is  is  membrane  cell  (19).  transport  internal  contains  It of  pH of  the  cytochrome  responsible  for  the  appear  to  membrane.  3. Transcription and translation machineries The contain  DNA-dependent  as  many  polymerases holoenzyme  as  appear and are  hand, archaebacterial complexity, its  RNA  9  to  much  polymerases 11  to  polymerase  resistance  to  different  more  resistant  from  archaebacteria  protein  complex  than  subunits the  (165).  These  eubacterial  o pfi'o2  rifampicin and streptolidigan. On the resembles  yeast  a-amanitin and  its  RNA  polymerase  stimulation  by  the  I  other in  its  alkaloid  silybin. The 23S,  5S)  archaebacterial are  similar  in  ribosome sizes  to  subunits  those  found  (30S, in  50S)  and  eubacteria  rRNAs (81).  (16S,  However,  10  recent  electron  archaebacteria the  40S  The  "micrographs  showed  subunit  of  value  proteins)  is and  ribosomes acidic,  70S  close less  (70-80  ranging  26).  The  appears the  to  this  the  in E. coli 'A'  not  number  in  in only  than  to  eubacterial  ribosomal protein present  protein  is L10, whereas  N-terminal protein  amino  archaebacterial  secondary  eucaryotic  by  the  found  of  E.  (115,  acid  equivalent.  in four  with  the  proteins  in  copies  another  analysis  E.  the  are  extreme  L12  coli  acidic protein)  sequence  homology  The  protein  'A'  is  to a  per ribosome, and binds  ribosomal  protein. In  and Sulfolobus is  (54  cytoplasmic  ribosomal >90%  116).  ribosome  coli  in  eubacteria.  proteins  eucaryotic  to  to  amino  in Halobacterium  sequence  to  5S  structure  counterparts  post-transcriptional uracil  acid  subunit 65  typical  those  from  related  to  this the  E.  coli  protein  by  coli  L11  E.  (81). The  unique  complex  in  (equivalent  eucaryotic  a 4;1  with  30S to  subunit  16% of the ribosomal proteins are  related  as  50  methanogens  closely  rRNA  the  archaebacterial  more  23S  in  ribosomal  common  found  found  protein  the  in  contains  Most  35-66%  ribosomal  but  that  proteins).  30S  features  be  multicopy to  to  from  the  ribosome  than  halophiles, whereas (8,  structural eucaryotes  archaebacterial  This  on  (33).  that  dihydrouracil  in  the  does  not  Archaebacteria  modifications  of  modification.  modification in the universal N-methyl  rRNA  large  ribosomal  resemble also  exhibit  tRNAs. Their tRNAs In  addition,  sequence TfCG  pseudouridine instead, to give ffCG  its  the  subunit  shows  eubacterial several  nor  unusual  do not  contain  the  normal  ribothymine  is modified to pseudouridine or or t fCG  (66, 156).  11 4. Antibiotic  sensitivity  The  sensitivity  examined  using  of  agar  Archaebacteria  archaebacteria  diffusion  were  insensitive  antibiotics. They were resistant the  cross-linking of  inhibits  protein  streptomycin eubacterial  70S  polymerase  of  II  and  III  cell  wall  which  to  the  and  wall  which  and  nisin  inhibit  the  membrane  on the archaebacterial  antibiotics  was  also  susceptible  to  permeability transferase  of  do it  not  remains  antibiotics  S,  membranes,  activity  antibiotics  observed.  protein  which  of  the  seem to  blocks  shown  and  spectinomycin, the  DNA-dependent  RNA  the RNA to:  the  The impermeability  2.  The inactivation  3.  The lack  of  of  anisomycin  which  with  whether  of the antibiotics target  were  found  which  which  to  be  increases  the  inhibits  peptidyl  contrast,  the  of  the  growth  insensitivity  to  some  membrane, or  by the cell, or antibiotic.  some to  in  for the  of  inhibits  ribosomes;  the cytoplasmic  a particular  bacitracin,  biosynthesis  is due to;  1.  polymerase  4  decapeptide  70S  which  monensin, a Na -ionophor,  chloramphenicol  interfere  inhibit  on  in  methanogens  cyclic  and  which  synthesis  sensitive  cycle  99).  eucaryotic  ribosome. Mixed sensitivity  eubacterial  to  be  a  the  are  lipid  The  been  (44,  and  ribosome;  inhibits  functions  protein synthesis  these  80S  +  gramicidin  assays  eubacterial  polymers, lasalocid, a K -ionophor, and with  have  in eubacteria; cycloheximide  Archaebacteria  which  dilution  inhibit  o-amanitin  eucaryotes.  interfere  However,  many  eucaryotic  erythromycin  eubacteria  tube  antibiotics  to: penicillin and D-cycloserine  murein cell on  and  ribosome; rifampicin which  of  gardimycin  the  synthesis  and  tests  towards  these  halophiles. or  all  of  12 5. Repeated  sequences  Molecular indicated that of  repeated  Most  of  cloning  the genomes  sequences  these  least  kb  in  by  five size  different  mutation  rates  due  per generation are  unstable  structural  of  fragments  the  Southern  contain  hybridizations  more than 50 families  on both chromosome and plasmid (112, 113). families  are  related  to spontaneous genomic  transposition, deletion elements  characterized  rearrangements to  and  halophiles  transposon-like  been  sequence-associated  of  sequence  means  have  DNA  located  repeat  rearrangements At  of  insertional  in  occur  H.  and perhaps functional  from  160).  frequencies  in the  range  events.  520 bp to  (100,  (101). These  the  variability  ranging  high  inactivation  and reversible, and provide  recombination  halobium  at  in the bacteriorhodopsin gene  or  and  of  Repeat  result  10-' to  insertion  3  in 10~  2  mutations  cell with an unusual degree  of  with its genome.  The organization of ribosomal RNA genes  1. Eubacterial  ribosomal RNA gene clusters  The typical RNA  genes  contains These by  further  genes  are  III  and alanine  RNA  generate by  a  modified  tRNA  operons, there  its  is either  tRNAs  genome  seven  (rrnA-G;  in  as  a  30S  rRNA  precursor  16S  and  set to  genes.  contains  genes  cotranscribed  to  are  contain  around  ribosomal  processed  nucleotides also  scattered  three  RNase  eubacterium, E. coli,  of  give In  a gene  mature  23S  glutamate  (15, 164). Similarly,  distal  3).  which  species  spacer tRNA to the  cluster  (Figure is  (39).  endonucleases These  ribosomal  Each  16S-23S-5S  molecule  rRNAs.  16S-23S  Ref.  order:  site-specific  the for  the  operons of  2).  cleaved  They  are  and  their  transcription  units  region  in  or genes  for  5S  gene  rRNA  all  rRNA  isoleucine in some  13a  Figure 2:  Organization of  ribosomal RNA gene clusters in eubacteria, eucaryote,  and in the organelles chloroplast and mitochondria. Ribosomal RNA genes are shown in open boxes and tRNA genes are shown in black boxes. Intervening sequences within rRNA and tRNA genes are indicated by shaded boxes. There are seven rRNA cistrons (16S-23S-5S) in E. coli (3, 90). In the rrnC operon, there is a glutamate tRNA gene in the 16S-23S spacer, and aspartate and tryptophan tRNA genes distal to the 5S rRNA gene. In the rrnD operon, there are isoleucine and alanine tRNA genes in the 16S-23S spacer and a threonine tRNA distal to the 5S rRNA gene. In eucaryotes, the nuclear rRNA genes are arranged in two transcription units. In human, the two rRNA transcription units (18S-5.8S-28S, 5S) are located on different chromosomes and are arranged as tandem repeats of hundreds of copies in the genome separated by non-transcribed spacers (30, 149). In Physarum polycephalum, the two rRNA transcription units (19S-5.8S-26S, 5S) are located on different chromosomes as hundreds of repeat copies separated by non-transcribed spacers with the large transcription units arranged as palindromic repeat units. The 26S rRNA gene has two intervening sequences (17). In Saccharomyces cerevisiae, the two rRNA transcription units (18S-5.8S-25S, 5S) are arranged close together as hundreds of alternating repeats in the genome (10, 144). In Zea mays chloroplast D N A , the two identical rRNA units (16S-23S-4.5S-5S) are arranged in an inverted orientation and separated by 18.5 kb of DNA. In the 16S-23S spacer, there are isoleucine and alanine tRNA genes with large intervening sequences (64). In Euglena gracilis chlo/oplast DNA, the three rRNA transcription units (23S-16S-5S) are arranged in tandem repeats with isoleucine and alanine tRNA genes in the 16S-23S spacer (97). In mitochondrial DNA, there is only a single copy of each rRNA gene. In human mitochondrial DNA, the arrangement of the ribosomal rRNA gene cluster is: tRNA(phenalanine)-12S-tRNA(valine)-16S-tRNA(leucine). There appear to be no noncoding sequences between the junctions of the tRNA and rRNA genes (2). In Zea mays mitochondria, the rRNAs are: 26S, 18S and 5S. The 5S and 18S rRNA genes are close together and separated from the 26S gene by 16 kb of DNA (129). In Saccharomyces cerevisiae mitochondria, the rRNAs are 21S and 15S, and their genes are separated by 25 kb of DNA (98). (Note; The non-transcribed spacer between each repeating unit is not drawn, to scale.)  EUBACTERIA E.coli(rrnC)  -I  E.coli(rrnD)  H  ifiH .  HHH  HH  EUCARYOTE Human  —I  I  Q  —fl P. polycephalum  H  -j  -j  1  1  1  f l  T  Ejl  H  I  o — KM  fej  I  [ " " H l l  o  —0 S- cerevisiae  1  hTH  HT—I  HU  HI  CHLOROPLAST Z.mays  H Z Z > ^ ^  E- gracilis  -I  Hti  MITOCHONDRIA Human  —I  I  I  HH tfV-H  HH  ^  fHH~ HI  1  h ^ ^ f ttti  HI  14 operons, there genes for tRNAs  is  either  aspartate  (90). Two  gene  for  threonine  and tryptophan tRNAs  tandem promoters which  200 and 300 bases are present  a  tRNA,  or  aspartate  tRNA  or  or glycine, threonine and tyrosine initiate  transcription approximately  upstream from the coding region of  the  16S rRNA  gene  in each of the seven transcription units (22, 163).  2. Eucaryotic ribosomal RNA gene clusters Eucaryotes organized  into  17-18S, 5.8S other  rRNA  for  Ih  hundred  144). In higher located units  at  (30,  yeast  repeat  149).  there  104, tRNA  precursor 106,  not  large  DNA. are  In  5S  mature  the  is  large  5.8S  the  two  fashion  in the  5S  types of  long and  polycephalum of  of  more  genome  rRNA  is 23S  repeating units  are  copies  rRNA  eubacterial  these  the  units  (10, are  repeating  stretches  of  various  strains  rDNA  within  the  as palindromic dimers (17, 152).  RNA  present  RNA  by unit  ribosomal RNA are  the  rRNA  than  transcribed  ribosomal  The  site  is transcribed by  sequences that rRNA.  repeating  present  molecules  precursor of  alternating  single  extrachromosomal  eucarytic of  a  Physarum  rRNA  The  at  an  positions  are  2).  eucaryotes, in  RNA  the  5' end of  18S-5.8S-28S  large  18S-5.8S-23S  intervening  in the  (rDNA)  gene  genes; some  contain  copies  rRNA  148).  lower  for  Figure  to the  clustered  repeating units  In eucaryotes, the the  other  the  ribosomal  in a 5' to 3' manner), and the  102;  equivalent  chromosomal  spacer  rRNA  (65,  found  Between  of  (transcribed  rRNA  and  are  different  Tetrahymena,  which the  5S  types  units: One codes  rRNAs  eucaryotes, the  non-transcribed of  the  units  different  transcription  and structurally  (147).  a  four  and 25S-28S  transcription than  two  codes  functionally  have  RNA does  genes  in the  polymerase  of  polymerase not lower  primary  III  and I  (13,  contain  any  eucaryotes  transcript  but  15 3. Chloroplast and mitochondrial ribosomal RNA gene clusters All In  the  chloroplasts and mitochondria code for their chloroplast  organized  in the  genomes,  there  are present  genome,  order are  as One  rRNA  genes  located  RNA  genes  are  exception  found in some  high  the  short genes  2).  is  very  found  genome  of  encoding  tRNAs  genes contain  100  separated.  have  each  ribosomal  16S-23S  and tRNA  ribosomal  two  chloroplast  and orientated  most  region  these  most  far  as  spacer  to  (64, 97). In  together  eucaryotes  addition  5S  close  higher  widely  genes  where  In  are  RNA  Euglena,  mitochondrial weight  of  rRNAs been  there  RNAs  200  In  there  tandem  gene;  these  from each other are  three  repeats  spacer  regions,  generally  appears  present two  in single  genes  are  bp, whereas  higher  there found  apart  RNA  are  (9;  copies  (105). and  of  Transfer  introns  are  be only  two  genes.  these  to  RNAs.  ribosomal  and  copies  ribosomal  the  in  in  23S rRNA  molecular  Figure  two  inverted repeats  2).  maize,  16S, 23S, 4.5S  only  Figure  In  e.g.  own  is  plant also  near  copies  closely  in  lower  small rRNA  5S  eucaryotes e.g.  rRNA  genes  (2, 43, 98;  linked with a  mitochondria,  a  the  to  and  the  maize,  (129). some  in  Genes rRNA  introns.  4. Archaebacterial ribosomal RNA gene clusters The  organization  archaebacteria be  in  most  of  species the  only  in  have  identified. The  tenax,  RNA  genes  in  at  have been determined (50, 93, 142; Figure  eubacteria been  ribosomal  Thermofi/um  order  three  types  16S-23S-5S; genome  pendens,  of  of no  rRNA  Halobacterium  5.8S  halobium,  mobi/is  ten  different  3). There appear to  genes, closely  eucaryotic-like  Desulfurococcus  least  and  linked  as  in  rRNA  genes  Thermoproteus  Desulfurococcus  1 6 a.  Figure 3:  Organization  of  ribosomal  RNA  genes  in  ten  different  species  of  archaebacteria (50, 93, 142). The  rRNA  which  genes  are  are  associated  Broken  lines  most  archaebacteria  celer  have  5S  rRNA  one  copy  an  extra  one  of  the  gene  four  also  acidophiIum, (sequence  copy  the  not  rRNA  linked  the  5S  gene. An  spacers a  rRNA  not known) closely  tRNA genes  in M. of are  in  the  by  alanine  have  unknown  gene  RNAs boxes.  clusters  only and  an  extra  of  the  rRNA gene  Sequences  sequences.  In  unlinked, and there  is  in  16S-23S-5S.  and  tRNA  vannielii.  black  order;  acidocaldarius  copies  transfer  Thermoproteus  mucosus  cluster  four  all  represented  pendens,  gene  has  vannielii  and  linked. The rRNA  Desulfurococcus  the  for  three  are  boxes  are  cluster. Sulfolobus  16S-23S  code  clusters  closely  and  of  of  open  Thermofi/um  gene  gene. Methanococcus  and  5S  genes  are  mobi/is  the  by  these  halobium,  Desulfurococcus of  with  indicated the  Halobacterium  copy  represented  tenax,  one  single  Thermococcus copy gene  was  of  the  cluster  found  distal  to  in the  Thermoplasma a tRNA  linked to one end of the 23S gene.  gene  16  H. halobium  M  —|  thermooulotrophicum  M . vannielii  f-  H  1  H  I—0  lfl  M  7^  //  [-[  1  H  I  TTl  plus two more clusters not yet mapped  S. acidocaldarius  —|  |  T. acidophilum  —{  |  T. celer  H  I  T. pendens  —T_  T. t e n a x  |—Tl—  1  j  H  H  I  —T_  D. mobilis  —|  |-  D. mucosus  -LZZI  1  H>  Tj  Q  7^  |  Q-  S/—f>  17 contain  mucosus Sulfolobus closely  only  single and  acidocaldarius linked  copies  16S,  23S  and  5S  thermoautotrophicum  Methanobacterium  vannielii  rRNA  found  gene.  are  data  is  spacer recent the  all  available regions  paper  has  16S-23S  to  contain  present  introns  level.  available, are  less  they than  underlying features  rRNA  gene  study.  from  genes  genes  in  rRNA  contain  any  specific  an alanine  introns  5S  gene; genes;  an  extra  archaebacteria (5S,  known  tRNA  16S  little  is and  sequence  whether  tRNA gene  have been  the  genes.  A  in one  (49).  vannielii  associated with rRNA  no  of  and  genes  yet  not  copies  rRNA  genome. Since  of  Some  genes  found  were  in  any  genes examined.  characterization  little  Although  is  some  known 5S  obtained from RNA  about rRNAs  of  the  ribosomal  RNA  mechanisms  protein  synthesis  the  responsible and  archaebacteria and  tRNAs  at  the  DNA  sequences  sequencing (29, 138); in total  10 genes with established DNA  their  of  not  however,  expression, a comprehensive  gene cluster this  very  were  sets  Methanococcus  of  single  is  of  genome  cutirubrum  molecular  of  (53);  investigation—molecular  present  sequence  of  the  unlinked  rRNA  the  per it  presence  genes apparently  genes in Halobacterium At  genes  spacers  the archaebacterial  The  rRNA  two  rRNA  once  an  of  in which  present  reported the  tRNA  of  archaebacteria,  these  rRNA  archaebacterial found  from  of  organization  and  and  sets  gene;  contain  celer  genes  four  acidophi/um,  unlinked  rRNA  contains  contains  unique  in Thermoplasma  23S)  of  A  each  Thermococcus  Methanobacterium  5S  of  the  sequence  organism Halobacterium  sequences. T o for  novel  the  analysis  of  cutirubrum  the was  there  understand  diverse  mechanism  are  and for  the  unusual  regulating  ribosomal carried  RNA  out  in  18 Only  a  few  archaebacteria  are  general  known.  It  has  linked on the Halobacterium the  number  the  of  copies  rRNA  sequence  sequence  from  H.  structure  of  H.  proposed for been  from  16S  vo/canii  shown  is  H.  have  the  ribosomal  that  rRNA  probably  and  halobium been  rRNA  one  in  a  16S-23S  genes  genes, are  published  conforms  spacer  region  closely  3' end of  the  complete  16S  (42,  52).  secondary  to  of  in  3', and that  (45, 92). The  the  small subunit rRNA. Finally, an alanine  identified  RNA  in the order 5' 16S-23S-5S  genome  vo/canii  of  been  genome  per  16S  features  universal  tRNA  the  The  structure  gene has  organism  gene  recently  Methanococcus  vannielii. The  results  Halobacterium 5' to the  presented  genome.  16S-23S-5S.  The  flanking  cluster  cluster,  there  are  two  located  in the  16S-23S  to the 5S  rRNA  genes  are  structural 16S  and  imperfect  23S  identified  two  transcription  repeat rich tRNA  followed  region gene.  in  followed  tRNA  RNA  is represented the  cluster  genes—an  secondary  is by  copies  found at an  and  tRNA  the  of  A/T  the rich  end  sequences  of  direct  the  gene located rRNA  unusual  of  5S is  containing  bipartite  gene  were  region  gene  processing and maturation  a precise  sequences  these  found  repeat  of two unit  cluster. In addition,  observed; rRNA  in  spacer  tRNA gene  in  in a  once  16S and 23S  structures;  promoter-like  5' flanking sequence  5  only  alanine  and a cysteine  utilized in the  termination-like T  organization  found in eubacteria, arranged cluster  space  Putative  perfect  in the  by  gene  have been sequenced. Within the rRNA  putative  probably  rRNAs.  were  rRNA  surrounding  intergenic  rich  are  and three  that  gene. The regions surrounding the  potentially features  gene  regions  the gene also  those  This  regions within  distal  confirm  resembles  cutirubrum  3' manner  here  genes after  an and the  inverted a  G/C  cysteine  19 ABBREVIATIONS  AMV  Avian  myeloblastosis  virus  ATP  Adenosine-5'-triphosphate  bp  base  (disodium  salt)  pair  kb  —  kilobase  pair  BPB  —  Bromophenol  blue  BSA  Bovine serum  dATP  2'-deoxy-adenosine-5'-triphosphate  dCTP  2'-deoxy-cytidine-5'-triphosphate  dGTP  2'-deoxy-guanosine-5'-triphosphate  (sodium  salt)  dTTP  2'-deoxy-thymidine-5'-triphosphate  (sodium  salt)  ddATP  2',3'-dideoxy-ATP  (disodium  ddCTP  2',3'-dideoxy-CTP  (sodium  salt)  ddGTP  2',3'-dideoxy-GTP  (sodium  salt)  ddTTP  2',3'-dideoxy-TTP  (sodium  salt)  DNA  Deoxyribonucleic  cDNA  Copy  ssDNA  Single-stranded  DNase  —  albumin  Deoxyribonuclease Ethylenediamine  MOPS  Morpholinopropane sulfonic  PEG  Polyethylene  PIPES  (Piperazine-N,N'-bis[2-ethane  tetracetic  acid disodium salt acid  glycol  Ribonucleic  sulfonic  acid])  acid  rRNA  Ribosomal  tRNA  Transfer  RNase  Ribonuclease  SDS  Sodium  TEMED  N, N, N'.N'-tetraethylethylene —  salt)  DNA  EDTA  Tris  salt)  DNA  Dithiothreitol  —  (sodium  salt)  acid  DTT  RNA  (disodium  RNA  RNA dodecyl  sulfate diamine  Tris(hydroxymethyl)aminomethane  XC  Xylene  cyanol  Xgal  5-bromo-4-chloro-3-indolyl-0-D-galactoside  20  MATERIALS  AND METHODS  Chemicals All reagent  chemicals  were  grade. Special  obtained  chemicals  from  were  commercial  obtained  sources  as f o l l o w s :  and were of agarose  II, medium EEO), ammonium persulfate, ampicillin, B S A , DNase 400,000), 6.1-7.5),  MOPS  pH  polyvinylpyrrolidone  tetracycline  and  (lyophozyme), fragment and  (pKa=7.2,  £coRI  of  Xgal  Tris  E. coli  from  (MW  from  from  ddGTP,  Research  New. England  M13  5'-d[CCCAGTCACGACGTT]-3'  acrylamide, from  Bio-Rad;  ([c- P]-dATP, 3J  from  New  Millipore;  Gene 3J  England  dATP  from  Western  circles  Scientific.  BamH\  fragment  point  (large  agarose, Smal HindW,  y  DNA polymerase  Hind\\\,  I and T4 DNA  Pharmacia  polynucleotide  32  nitrocellulose BA85  primers:  specific  P-L  Laboratories;  (15mer:  kinase  and  (HAHY,  radioisotopes  from  Ci/mmole)  0.45 / j m )  (0.45 yum, 82 mm) from  TEMED  20-50mesh)  activity =3000  sheets  and  Biochemicals;  (AG501-X8D,  A c A 5 4 (5,000-70,000) and PEG 8000 from  Terochem  A , SDS,  transcriptase,  Acc\, Bg/\\  bed resin  [r- P]-ATP;  Nuclear;  nitrocellulose  Schuell; ultrogel  T4  RNase  range  5'-d[GTAAAACGACGGCCAGT]-3'), from  and mixed  Screen,  K,  pH  d A T P , dCTP, dGTP, dTTP, d d A T P , ddCTP,  17mer;  [a- P]-dCTP,  low melting  Labortories;  oryzae)  bis-acrylamide  I),  I, Ficoll (MW  (pKa=6.8,  Klenow  single-stranded  (  (Aspergillus  reverse  formamide,  Taq\, E. coli  Biolab;  PIPES  proteinase  AMV  DNA polymerase  Bethesda  S1  360,000),  (lyophozyme),  ddTTP,  nuclease  6.5-7.9),  Sigma;  HpaW, Kpn\, Pst\, Sa/\, Sau3A\, ligase  range  (Type  Schleicher  Fisher  Eastman;  from &  Scientific; urea  from  21 Bacterial strains and g r o w t h The are  characteristics  listed  recipient  in for  37°C  in NY  0.01%  and  plasmids  The  in  the  strain  coli  course  of  the  acids  used  for  the  preparation  packaging  strains  MgS0  Q358  and  medium  (57).  JM103,  were  recombinant  Q359,  hosts  cultured  at  phage, in  for  M13  2%  medium  for  0.2%  et  phage  E.  medium the  were  cultured  at  at  0.2%  at  glucose  (130). and  and  E.  coli  X1059-M  37°C  in  NZYC  strains  JM101  and  the  screening  of  of  s s D N A , and  in  for  and  cultured  NS428  X1059  preparation  glucose  general  strains  1977  coli  a  0.2% glucose,  acids,  al.  cultured  the  YT  coli  casamino  were  in  was  extracts,  type  hosts,  with  E.  Sternberg wild  as  supplemented with (19).  employed  0.01%  vitamin  B1  for  (86).  Halobacterium low  by  37°C  2xYT  supplemented  at 4 ° C  with  respectively,  Bacteriophage  medium  in  described  recombinants  cutirubrum  storage  supplemented  as  4  of  used  investigation,  0.8% casamino  mM  medium  bacteriophages  MC1000,  and  medium  minimal  and  BI  M9  M9  E.  strains  vitamin  in  37°C  1.  bacterial  or  2  M9  Table  of  broth  NS433, 32°C  conditions  a  cutirubrum,  phosphate  complex  gift  from  medium  as  A.  Matheson,  described by  was  cultured  Nazar et al.  at  1978  (92).  Purification  H. at  of  cutirubrum  37°C  to  resuspended sodium 70  ml  Halobacterium  cells, grown  stationary in 20 ml  deoxycholate of  0.1  M  cutirubrum  Tris  of (30  phase, complex  chromosomal  in 500 ml were  medium  10 mM  phosphate  harvested  min., 4 ° C ) . The  pH 7.5,  low  and  DNA  complex  (7,000xg,  15  min.,  lyzed with 2 ml  viscous  lysate  was  E D T A , and extracted  medium  of  70  diluted  sucessively  4°C), mM using with  22  Table I;  Genotypes of E. coli  Strain  Genotype  MC1000  araD139,  and phage \ strains.  Origin  (araBCOIC  leu) 7697,  (lac/0PZY)X74,  galU, ga'/K, strA, thi  (19)  NS428  mOb(\Aamll  b2 red 3 clts857  (130)  NS433  H20S(\Eam4  Q358  hsdRk-, hsdMk\  supF\ 080  Q359  hsdRk-, hsdMk\  supF\  JM101  tlacpro, lacl Z q  JM103  *lacpro, lacl Z q  \1059  sRI4°  b2 red3 c/ts857 Sam7)  (130) (57)  080, P2  (57).  supE, thi, F'traD36, proAB, (86)  M5 supE,  thi, F'traD36,  M5, strA, end A,  h X.sbaml° clt857  Sam7)  b189  pACL29> nin5, Chi D  (86)  hsdR4  <int29 A  proAB,  [int-c//l]  ninL44 KH54 (57)  23 equal  volumes  of  phenol, chloroform/octanol (1:1, v/v),  DNA-containing aqueous pH  7.5, 1 mM  EDTA  layer  (16  was  dialyzed against  and chloroform. The  2 liters  of  10 mM  hrs., 4 ° C ) , and purified through a cesium  Tris  chloride  gradient (117).  Construction of \1059-/y. cutirubrum  library  Partial endonuclease digestion conditions were established for (10 >ug) of  fi.  were performed for amount of maximum mM  DNA  cutirubrum  for the  15 min. at 3 7 ° C  restriction  with 0.5, 1 and 2 times the  NaCl, 6 mM  of  Tris  15-25  kb  fragments  pH 7.5, 5 mM  MgCI ,  DNA  fragments  of  15-25  X1059, used as a vector restriction  were  fragments  Sau3A\ fragments (15-25 kb) of  fi.  mM  Tris  pH 7.8,  for  16 hrs. at  10 mM  2  ligated  DNA  digests  agarose  gel,  bacteriophage  (67), was  digested with  total  ligated  DNA  in 20 M\ of  DTT, 1 mM  was  50  The  of X1059 were  ligase  MgCI , 20 mM  1 2 ° C , and  library  cutirubrum  respectively) with 0.1 unit of T4 DNA  (67).  the  was  The  melting point  isolated  for constructing the  BamH\. The  enzyme  kb  used  100 >ug/ml BSA).  2  estimated  required to yield  (Sau3A\ buffer  were pooled and electrophoresed on a 0.6% low and  enzyme Sau3A\. Reactions  enzyme (0.7, 1.3 and 2.5 units respectively) proportion  aliquots  to  partial  (2 >ug and  1 >ug  ligation buffer  A T P , 50 >ug/ml  recovered  in  by  vitro  (50 BSA)  X. phage  packaging.  The (130) were  packaging a  extracts  gift  from  based  on  carried  out  library,  aliquots  of  made  Rashmi the  the  from  Kothary.  methods packaged  of  E. In  coli  strains  vitro  packaging  Hohn  mixture  1979  NS428  (46).  containing  and  reactions To  5x10  3  E.  ml  (10  min., 3 7 ° C ) ,  mixed  with  3  of  NZYC  the  recombinant  a fresh overnight  Q359  were  amplify  bacteriophage were preadsorbed with 0.2 ml of  coli  NS433  top  culture  of  agar  and  24 plated  on  five  overlaid  with  gelatin)  for  pooled were was  (25  100  5 ml 16  mm of  hrs.  removed  by  recovered  SM  at  ml), and  diameter  plates  buffer  4°C.  1 ml  The  of  (14  (10  mM  SM  buffer  chloroform  centrifugation  and stored over  hrs., 3 7 ° C ) .  Tris  pH 7.5, 0.1  containing  was  (6,000xg,  5  Each  chloroform at 4 ° C  M  was  NaCl, 0.02%  bacteriophage  added. Cell min.).  plate  The  debris  phage  was  and  agar  supernatant  (78).  Purification of ribosomal RNAs  H. medium and  cells, grown  cutirubrum at  lyzed  NaOAc  37°C, with  pH  were  1  phenol/chloroform aqueous  layer  ethanol 20  (1  mM (1:1,  SDS-lysis EDTA).  v/v),  buffer  The  and  were precipitated  (16S  Synthesis  and  23S)  were  precipitation  in  phase  in 20 ml  (7,000xg, 5 min., 4 ° C ) (1%  lysate  chloroform.  was  The  1.5 ml of  0.1  of  complex  in  a  SS-34  0.14  M  NaCl, 0.5  extracted  with  nucleic  acids  rotor,  by  M  phenol, in  the  pH 7.0 with 3 volumes  recovered  separated  SDS,  was  in 0.3 M N a O A c  hr., - 7 0 ° C ) . The pellet  preferential  of  centrifugation (10,000xg,  M NaOAc pH 5.0. Ribosomal  from  DNAs  and  small  RNAs  by  5 M LiCI (4 hrs., - 2 0 ° C ) .  of ribosomal cDNA  Oligonucleotides 16S  and  23S  DNA  cutirubrum mM  of  stationary  min., 4 ° C ) and redissolved in 1.5 ml of  RNAs  the  harvested  10 ml  5.1,  to  Tris  pH was  with  7.4,  for  priming  rRNAs  were  14 /jg  10 mM  inactivated  of  I  MgCI ). After 2  I  by  ethanol  precipitated, resuspended  synthesis  generated  DNase  DNase  E D T A , and autoclaved  the  in  by 0.2  500 >ul of  (10 min., 1 2 1 ° C ) .  ribosomal  digesting ml  incubation  phenol/chloroform into  of  of for  1  H.  I  buffer  (10  2 hrs. at  37°C,  the  DNase  mg  from of  extraction. 10 mM  cDNA  The  DNA  was  Tris pH 7.5, 1 mM  25  Conditions from  those  priming >jg  (107,  rRNA,  mM  (sp.  act.  37°C. hrs., pH  MgCI ,  was  10 / J M  incubated  The  ribosomal  chromatography equilibrated  in  0.8 / j g  2 0 yul  50  were  Actinomycin  units 15  of  min.  hydrolyzed  was  AMV at  with  neutralized  with  Tris  pH  mM  of  each  1  50 vuCi  and  [o-  8.3  3 2  then  for  of  1 M  volumes  of  2  dATP, P]-dCTP  M  The  hrs.  NaOH  3  2 50  ;  transcriptase.  volumes  0.1  containing:  mM  reverse  0.3  derived  oligonucleotide  volume  D,  15°C,  were  random  0-mercaptoethanol,  for  the  DNA  same  the  Screening  of  act.  the  by  Benton  agar,  (0.45 y u m ,  onto  the  filter  was  surface  were  Davis 82  removed,  from  the  on  the in  Cerenkov  radioactive  column  Tris  collected  by  at (16  NaOAC  pH  0.5  of  ml  counting.  purified  (AcA54;  7.5,  top  DNA  nucleotides  0.25  the  were  0.7cmx18cm)  mM  EDTA.  The  column, eluted  with  fractions. The  by  The  amount  radioactive pooled  of  fractions  and  ethanol  cpmAJg).  6  ribosomal  plaques  RNA  were  transferred  1977  mm), of  mM  layered  and  for  500  and  10  containing  3x10  library  and  filter  was  volume  (sp.  separated  NaCl,  measured  Approximately NZYC  M  buffer  was  was  acrylamide/agarose  mixture  excluded  precipitated  an  0.2  column  radioactivity  cDNA  on  with  radioactive  of  out  and  cDNA  4.8.  The  in  and  solution  ribosomal  oligo-dT  carried  mM  first  RNAs  in  of  o l i g o d e o x y n u c l e o t i d e s , 50  dCTP,  Ci/mmole),  Ribosomal 37°C).  used  were  20  2  dTTP,  synthesis  synthesis  H. cutirubrum  mM  3000  reaction  the  132). R e a c t i o n s  10  and  for  cDNA  2 Aig  KCI,  dGTP  of  used  (11)  genes  plated  onto  with  some  with  top  containing  transferred  onto  a  a  each  nitrocellulose  numbered agar  onto  100  filters  modification.  soft  pencil,  the  fresh  A  was  plaques  NZYC  mm  agar  as  dish  described  nitrocellulose  placed (1  petri  carefully  hr.,  4°C).  The  plate  with  the  26 plaque  side  faced  upward,  incubating  the  plate  for  immersing  the  filter,  plaque  min. The  filter  M  pH  Tris  was  7.5,  and  16  hrs. side  neutralized 1.5  M  NaCl  citrate  pH 7.0), was  (0.04% B S A , (2  were  in  20°C). bath  with  carried  1.5  M  1 M Tris  (20  air  performed  out  as  a probe  in 200 ml  (10  (16  (30  out  XRP-1  The  filter  in a sealed  X-ray  and  of  dried  film  in  0.5 was  solution  plastic  with  min., 2 0 ° C ) , in  were  an  labeled  cpm^ug). Washes  6  (5  and  bag  6xSSC, 2xDenhardt's  twice  washes  was  20  DNA  6xSSC, 2xDenhardt's  in 2xSSC  and  for  (0.3 M NaCl, 0.03 M sodium  in 3 ml  min., 6 8 ° C ) ,  agitation. The  using Kodak  dried.  hrs., 6 8 ° C ) using radioactively  prehybridization, hybrization constant  NaOH  by  80°C.  of  volumes: twice  SDS  M  by  lyzed  min.), rinsed  cpm/filter, sp. act. 3x10  6  amplified  were  NaCl, 0.5  and  filter, wetted in 2xSSC 3 ml  were  plaques  pH 7.4  min.),  prehybridized in  1xSSC, 0.5%  All  The  for 2 hrs. at  E D T A , 0.5% SDS  cDNA  carried  times  37°C.  0.04% Ficoll, 0.04% polyvinylpyrrolidone)  1 mM  ribosomal  at  (20  hrs., 6 8 ° C ) . Hybridization was  solution,  bacteriophages  up, in  in  immobilized by baking the filter The nitrocellulose  the  2xSSC  done  in  three  (5 a  min., water  autoradiography  intensifying  was  screen  (16  hrs., - 7 0 ° C ) .  The  bacteriophage  autoradiogram  (figure  4),  innoculated  into  0.5  was  and  purified  titred  probes  as  signals after  described  plaques,  ml  were of  until  screening.  SM  by  corresponding  picked buffer  successive  -90% of  the  using (2  a  to  sterile  hrs., 3 7 ° C ) .  positives pasteur The  rescreening  with  plaques  a  on  on  the  pipette  and  phage  solution  ribosomal  plate  gave  cDNA positive  27a  Figure 4:  Plaque hybridization autoradiogram.  Approximately diameter). with  The  NaOH.  Benton cDNAs  and  500 plaques  plaques  were  Hybridizations Davis  (11).  over the filter  transferred and  The  for ribosomal RNAs  were  washes probes  plated onto  onto  performed were  16S and 23S. Kodak  with an intensifying  screen for  plate  nitrocellulose  were used  each  (100  filter as  16hrs. at  X-ray -70°C.  32  in  lysed  described  radioactively  XRP-1  and  mm  by  P-labeled  film was  put  27  28 Purification of bacteriophage DNA A  purified  bacteriophage  solution containing of  SM  The  100 / J I  of  incubated  cells  at  were  37°C  hrs.). A  few  drops of  for  min.  Cellular  15  and  innoculated  into  a  of  Q359 and  100 yul  were  adsorb  as  described  above.  allowed 25 ml  vigorous  was  to  of  shaking  chloroform were debris  picked  culture  added to  with  was  a fresh overnight  buffer. Bacteriophages  infected  plaque  prewarmed  until  lysis  added and  removed  by  NZYC  medium, and  occurred  (about  incubation was  centrifugation  6-9  continued  (10,000xg, 10  min., 4 ° C ) .  Bacteriophages 0.3 volumes cooled  (1  of  50% PEG  7.0, 5 mM 50  of  4°C), The  RNase were  0.05 mM  supernatant DNA  ethanol  resuspended  was was  A  pellet  (Ihr., 3 7 ° C ) . The  of  buffer  (50  were  was  precipitated  in  with  5  of  0.1  recovered  by  centrifugation  of  ethanol/0.1  resuspended in 200 / J I  and stored at 4 ° C .  of  M  M  10 mM  NaCl  NaCl Tris  DNase I  inactivated  and  K and 50 .Ail of  centrifuged and  ml  ml  2.5  (10,000xg,  mM Tris pH  with 5 yug of  proteinase  mixture  and  mixed thoroughly and  Nucleases  100 /jg  5 M NaCl  extracted with phenol/chloroform (1:1, v/v),  washed was  adding  of  centrifugation  0.5 ml DNase  min., 3 7 ° C ) .  lyzed by  (2 hrs., - 2 0 ° C ) . DNA  was  into  by  2  (30  EDTA  recovered  CaCI ), and were treated  2  bacteriophages  Phage  particles,  MgCI , 0.05 mM  ug  10% SDS,  8000 (161). The solution was  hr., 4 ° C ) . Phage  10 min., 4 ° C ) , were  and  were precipitated with 0.15 volumes  with  the  and chloroform. 3 volumes  of  (10,000xg, 20 min., (2:1), and  air  dried.  pH 7.5, 1 mM  EDTA  29 Preparation  of a nick-translated probe  Nick  translation  with some  Tris  CaCI , 2yuM of [a- P]-dATP  pH 7.5, 5 mM  (0.05 /jg/ml) and for  0.5 M E D T A  10 units  1 hr. at  Rigby  10 mM  3  1977  et al.  (108)  50 yul containing: 0.5 yug  0-mercaptoethanol, 0.2  mM  E.  of  1 6 ° C . The  the  DNA  coli  reaction  addition  of  polymerase  was  5 yul of  I, the  stopped by  DNase  mixture  adding  was  1 yul  and extraction with phenol/chloroform. The nick-translated  purified  20-40x10  MgCI ,  (sp. act. 3000 Ci/mmole). After  3:  was  according to  each dCTP and dTTP, 8 yuM dGTP, 0.7 >iM d A T P , and 50 /iCi  2  incubated  performed  modifications. Each reaction volume was  DNA, 50 m M  I  was  by  column  chromatography  as  described  for  cDNA  of  DNA  (sp.  act.  cpmAJg).  6  Northern blot analysis Ribosomal  RNAs  agarose-formaldehyde formaldehyde NaOAc, 50%  and  1 mM  (40,  IxMOPS  EDTA  the  75).  The  gel  electrophoresis  pH 7.0). Samples  rRNAs, the  and neutralized in  25  transferred based was  gel  electrophoresed  were  formamide, 6% formaldehyde, 1XMOPS  hydrolyze  gel  were  on  air  in 0.1  M Tris  mM  sodium  onto  a  the  dried  gel  Gene  soaked  was  made  Screen  filter  instructions  (2 hrs., 8 0 ° C ) .  up  (20  mM  heated  for  15 min. at  before  loading  in 50 mM  pH" 6.5  a  buffer  NaOH  pH 7.0 (30 min., 2 0 ° C ) . After  phosphate  manufacturer's and baked  was  through  (20  using (New  min.,  the  England  Residual  rRNAs  in  6%  5  mM  MOPS,  60°C  onto the (30  min., 2 0 ° C )  rRNAs  phosphate  Nuclear). in the  were visualized by staining the gel in 30/ug/ml acridine orange  in  gel. To  equilibrating  20°C),  same  2%  were buffer  The agarose (85).  the  filter gel  30  The Gene 5xSSC, DNA  Screen  2xDenhardt's (16  hrs.,  DNA  (16  of  1 M  volumes of  2  M  cpmAjg)  NaOH  2 0 ° C ) , twice  agarose  The  solution  2XDenhardt's out  of  a  probe  out  as  (30  phage  of  sp.  in  min., 6 5 ° C )  and  twice  0.1  volumes  act.  2xSSC in  calf  with  with 0.125  twice  to  50%  denatured  cpm/filter;  6  thymus  ml  D N A , denatured  neutralized (10  calf  3  follows:  was (2  cDNA  based  baked  hrs.,  (45  min., 6 0 ° C )  or  and  subjected  hybridizations  in 2xSSC and  to  twice  (2  20x10 (5  6  min.,  O.lxSSC  (5  autoradiography.  DNA  neutralized the  described  by  and  hybridized  with  probe  cpm/filter)  EDTA  (16  (5 For  were carried  prehybridized  (10  6  a  times  in  Southern in  6xSSC,  radioactively in  6xSSC,  filter  stringency  out at 6 0 ° , 5 2 °  were  1xSSC, 0.5%  The  and  a  onto  hrs., 6 0 ° C ) . Washes  min., 2 0 ° C ) . reduced  on  transferred  80°C),  1 mM  2xSSC  and  method  (5 min., 2 0 ° C ) , three in  electrophoresed  hrs.,  nick-translated  autoradiography.  and washes  genomic  on  65°C),  solution, 0.5% S D S , twice  or  denatured,  0.45 / J m )  filter  ribosomal  carried  as  in  250 yug/ml  phage  and  50% formamide,  denatured out  SDS,  dried and subjected  were  (HAHY,  2xDenhardt's labeled  digests gel  nitrocellulose (124).  carried  of  analysis  Restriction  1975  min., 6 8 ° C )  in 2xSSC, 0.5% SDS  Southern blot  was  solution, 1%  carried  was  500 /jg/ml  Nick-translated  used  were  min., 2 0 ° C ) . The filter  0.6%  (10  was  Washes  SDS,  Hybridization  hrs., 4 2 ° C ) .  4  prehybridized in 3 ml  1%  IxDenhardt's  NaH P0 , 2  was  solution,  42°C).  formamide, 5xSSC, thymus  filter  of  was  SDS dried  annealing,  44°C.  M13 cloning and DNA sequencing All Messing  techniques (1983;  Ref.  concerning 86).  M13  Fragments  cloning to  be  were  carried  sequenced  were  out  based  digested  on with  31 restriction M13  enzymes  vectors  restriction DNA  (Sau3A\,  (mp8,  enzyme  from  each  mp9,  positive  chain-termination  clones  containing  end-labeled of  32  an  E.  coli  and  T4  e.g. The BamH\  or  rRNAs, and  the  for  S1  in  sequenced  in different different  method  for  (82).  I  kinase at  middle of  Sanger's  orientations  orientations  DNA  and were  sequencing was  Fragments  were  or  polymerase  out  phage  Messing (1983; Ref. 86).  fragments  carried  appropriate  using  DNA  rRNA  0.2  pellet  15  (27)  and  exchange  convenient  16S rRNA  either  gene  3'  Klenow  end-labeled  in phosphate  some  the  5'  also  with  reactions  restriction  sites,  and the Pst\  site  gene.  /ug  was  of  the  3  resuspended  85°C  hrs.  at  to  55°C  (300 or 600 units) was buffer  carrier by  radioactively  precipitated  pH 6.4, 0.4 M  min. at  for  ice-cold SI  terminated  sequences  3' end-labeled, was  incubated  20 /jg/ml  and  triphosphate  in the  (80% formamide, PIPES  ml  the  into  mapping  end-labeled  Nuclease  with  cloned  (86, 87). Single-stranded  Acc\)  isolated  polynucleotide  Approximately  then  were  [o- P]-deoxyribonucleoside  were  site  digested  32  at the end of the 5S  incubated  was  chemical  end-labeled  End-labelings  Nuclease S1  mpll)  and  and  HpaW)  method (111). Clones  Gilbert's  using  [r- P]-dATP (12).  clone  overlapping  and  on  fragment  or  HindW,  and  Taq\  " C - T e s t " as described by  Maxam performed  mp10  (BamHI,  dideoxy  identified by  HindW,  (0.28  into  NaCl,  denature  with  100 /ul 1 mM the  permitting  of  of  4.0 M  5 /jg  hybridization  RNA-DNA  DNA  hybrids  to  mixture together  30 min.. at mM  of  was and form.  with 0.3 ZnS0 , 4  37°C,  E D T A . The  5'  buffer  mixture  NaOAc pH 4.6, 4.5 mM  N H O A c , 0.1 4  with  double-stranded  ssDNA). The reaction, incubated for  adding 5 0 I  ethanol  fragment,  EDTA). The  added to the  M NaCl, 50 mM  labeled  was  solution  32 was of  extracted carrier  stop  with  tRNA.  (90%  phenol/chloroform  The  precipitate  formamide, 20  mM  was EDTA,  and  ethanol  precipitated  resuspended 0.03%  XC,  min., and electrophoresed on urea-polyacrylamide  into  5 ,vul  with  of  0.03% BPB),  20 >ug  formamide  boiled  sequencing gels  for  2  (31).  Restriction enzyme digestion Restriction according to samples  were  rstriction 37°C  and Sma\,  addition  0.01%  taken  Acc\,  of  digestion  manufacturer's  enzymes  with  Sau3A\ the  the  endonuclease  up  were  BamH\,  in  instructions  the  purified (New  appropriate  fcoRI, HindW,  Bg/W, 65°C  volumes  Ficoll  stop  carried  carried  and  out  aliquots  for  HpaW,  reactions  mix  was  buffer  H/nd\\\,  with Taq\. The  of  DNA  out  England Biolabs). The DNA  enzyme  added. Digestion was  and at 0.2  of  4-16  Kpn\,  of  hrs. at Sa/I,  Pst\,  were terminated  (20% Ficoll, 50 mM  by  EDTA,  BPB).  Agarose gel electrophoresis For (>500  Southern  blot  and  bp), electrophoresis  qualitative  was  agarose  (21cmx16cmx0.5cm). The  pH  20  8.0,  were  run  mM  at  approximately  NaOAc,  100 volts  10 until  carried  mM the  0.6%  analysis  out  on  agarose  EDTA,  of  horizontal gels  0.25 /ug/ml  bromophenol  restriction  blue  slab  gels  of  0.6%  40  mM  Tris  bromide  and  contained ethidium marker  dye  10cm. The DNA bands, visualized under ultra-violet  photographed with a Polaroid  camera.  fragments  had  moved  light, were  33 Polyacrylamide For  gel electrophoresis  qualitative  purification  of  analysis  restriction  of  small  fragments  molecular  cloning,  slab  (14cmx17cmx0.15cm) containing  gels  2.5  mM  of  time  E D T A . The and  electrophoresis  for  gels  stained  were  with  was  run  at  DNA  DNA  out  mM  250 volts  1 /jg/ml  (<500  sequencing, S1  carried 89  fragments  on  Tris, for  ethidium  5% 89  an  mapping, and polyacrylamide  mM  boric  appropriate  bromide.  bp),  DNA  acid,  amount  bands  were  visualized and photographed as described above.  Recovery  of DNA from polyacrylamide gels  DNA small from  bands  pieces  to  a  electroelution  was  for  from  hrs. at  a  which  bag).  carried  polyacrylamide  into  pipette  dialysis  was  4-16  out  transferred  a 10 ml plastic  attached  EDTA  and  cut  out  tube  plugged  had the top  With  the  tube  in 45 mM  2mA/tube. The  gels with  half  held  were  Tris, 45 mM DNA  glass  cut in  a  in  wool  away  acid,  the  into (made  and the  vertical  boric  collected  chopped  tip  position, 1.25  mM  dialysis  bag  recovered by ethanol precipitation. Other  fragments, isolation  molecular  cloning  transformation of  plasmid  Cloning Manual by  of  DNA  techniques, E.  were  Maniatis et al.  coli  such  with  carried  as;  plasmid out  1982 (77).  ligation DNA,  according  of  and to  restriction small  the  scale  Moleculer  34 RESULTS  Part I: Localization of rRNA gene cluster in genomic X.1059 library.  Construction of Al059-#. cutirubrum The  bacteriophage \1059 is a BamH\ substitution vector  three BamHI fragments-a 9.4 kb right functions  19.6 kb  arm (56). The two  required  for  \  phage  head  replaced by  replication  of  multiple  and  fragment  the  agarose.  were  inserts  unrelated  DNA  cutirubrum  properly,  DNA  The  arm, a  and  70% and  the  BamHI  ligated  sequences,  X1059  DNA  1 >ug of  fragment  15-25 kb  partial  and a  essential  lambdoid  phages  of  X1059  fill  can  be  6.3-24.4 kb. To avoid cloning  partial  cleaved  fragment  the wild type DNA to  of  H.  melting point agarose  gel  were  with  recovered  BamHI  and  fragments  Sau3A\  digests  Sau3A\  on a 0.5% low  was  composed of  contain all the  maturation. Since  in the size range of  corresponding to  with  17 kb central  108% of  central  were fractionated  sizes  religated  left  arms of the vector  require genomic sizes between the  library.  by  melting  2 >ug aliquots  (15-25  kb)  of  H.  cutirubrum. Recombinant Xred  and  phage  gamma  by  X1059 genes  plating  Nonrecombinant non-restrictive  spi  on  and E.  but  Q358), whereas recombinant in  vitro  reaction of  packaging, the was  phages  10 /ug H. 7  harboring  H.  are  they  are  they  can  because  be  lysogenic of  grow  phage grow  number  cutirubrum cutirubrum  of  DNA  of  separated  capable  cannot  spr  total  spr  strains  coli  phage  +  strain,  phages  from for  deletion the  on  Q359  spi  of +  the  vector  bacteriophage  propagating (a  on P2  P2.  Q358, lysogen  a of  on both Q358 and Q359. After  phage  generated  when plated  inserts  the  was  on  10 /ug 5  by  the  Q358;' the H.  cutirubrum  ligation number DNA  35 when  plated  on  Q359.  The  approximately  1000 fold  was  low  done  at  minimize library  the  independently  DNA  Q359  of  recombinant  and  (5,000  recovered  plaques  eliminating  per  phage's  as  a plate  100  particular  were  mm  amplified  lysate.  diameter  Plating  plate)  recombinant-phage  to  from  the  number  of  during amplification. According  given  on  density  risk  packaged  to  derived  single-copy insert  Clarke phage  and  Carbon,  recombinants  sequence  in a  library  1976  (library  (18),  the  size) required to  with a known  average  find  any  size of  the  is represented by the equation:  N  =  In (1  In  - p) /  (1 -  f)  where N  = number of  p  = probability the  f  = average  The genome average  insert  recombinant  recombinants contains a given unique sequence  fraction of total  size of  in each  phage  library  H.  cutirubrum  clone was  are  genome  required  in each  is 4.1x10  insert  base  6  fragment  pairs  (88)  20 kb; therefore, approximately to  represent  99%  of  the  H.  and  the  940 X1059 cutirubrum  genome.  Screening  f o r rRNA  H.  H.  radioactive  cDNA  LiCI small  prepared in  which  fraction  cutirubrum  by  and  by  were AMV  precipitation RNAs  messenger  library,  23S  DNAs  probes  small of  in genomic  16S  cutirubrum  fragmented  were  genes  and  from DNA  rRNAs  were  used as reverse total  used  primers  for  templates the  transcriptase. cellular  nucleic  soluble. Although  R N A s , greater  as  than 9 5 % of  and  synthesis  of  The  two  rRNAs  acid  with  2.5  M  by  a  contaminated the  precipitate  was  36 16S  and 23S rRNAs.  generated  by  DNase  heat-denatured  32  was used  hybridization  I  from  XHc4  of 8-12 nucleotides  of  H.  each  ribosomal  to screen  technique  endonucleases  treatment  P-labeled  independent positives DNA  primers  on that  were detected  (specific  library  of Benton  were  reaction.  activity  by means  of  3x10  6  of a plaque  and Davis,  1977 (11). Six  by screening 3,000 recombinants. Phage  was purified  BamHI, £coRI  and \Hc9, were  the genomic  based  positive  cDNA  in length  DNA (132) and were  cuti rubrum  (10 min, 121 ° C ) before each cDNA synthesis  Radioactively cpmAig)  Random  (16) and analyzed  and H/nd\\\. T w o different  identified. Four  of the positives  with  restriction  types  of  clones,  belonged to the XHc4  group and two belonged to the XHc9 group.  Restriction analysis of XHc4 and XHc9 Restriction phage  DNAs  with  maps of XHc4 and \Hc9 were various  combinations  H/nd\\\, and BamH\) followed These  three  recognition £coRI  then about  sequences  site  respectively either  enzymes  and  one  within  chosen the arms  Hinti\\\  site  of the two arms. Restriction accordingly.  The H.  of  of X1059  located  one regenerated  about  3.6  inserts  restriction  arm junction; see below). A l l other BamH\ sites  of  their  is only one  kb  and  4.4 kb  not cut within  in the H. cutirubrum  cuti rubrum  (£coRI,  gel (Figure 5).  sparsity  arm and BamH\ does  sites  a BamHI  the  DNA. There  17-20 kb in length. Of the four BamH\-Sau3A\  clones, only  endonucleases  on a 0.6% agarose  because  from the end of the right  mapped  of restriction  by analysis  were  constructed by digesting the  in each  inserts  were  clone  were  junctions from the two  site  (in A.Hc4 at the right  are within  the insert.  37a  Figure 5;  Restriction endonuclease maps of XHc4 and XHc9.  The XHc4 £coRI;  H,  and XHc9 DNAs B,  Hind\\\;  BamHI +H/nd\\I; electrophoresis  H/nd\\\ as molecular 4.3,  BamHI;  HBE, on a  weight  indicated  gel with  standards  (Note: maps  BE,  and  wild  The BamHI-£coRI  on the ethidium  digest  indicated genes,  inserts, by  open  approximately boxes.  18 kb in XHc4  The relative  16S and 23S, are indicated  respectively.  The XHc4  clone  whereas XHc9 contains partial  by  contains  stained  and lane  "b"  of XHc9  was  gel. The X1059 Halobacterium  and 17 kb in XHc9, are  locations  of  the  short  and long  both  16S  16S sequences.  by  on the restricted  arms, 9.4 and 19.6 kb in length, are indicated by black boxes; cutirubrum  BH,  X DNA cut with  XHc4  based  bromide  BamHI+£coRI;  sizes are 23.7, 9.6, 6.7,  DNA from  constructed were  enzymes (E,  fractionated  type  (the fragment  " a " represents  D N A from XHc9.  sizes  HE, HindW I +£coRI;  0.6% agarose  incomplete). The restriction fragment  digested with restriction  Hind\\ \ +BamHI +£coRI),  2.3 and 2.0 kb). Lane  represents  were  ribosomal RNA  horizontal  and 23S  rRNA  arrows genes  37  (JJ  a  b  a  b  a  b  a  b  a  b  a  b  a  b  l 1 1  0  2  4Kbp  E  B  H  B  HE  ^  EH  B  H  e  —  X  H  c  4  B  \Hc9  38  Southern blot analysis of XHc4 and XHc9 DNAs Phage cluster Hin6\\\  D N A s , \Hc4  were  digested  with  onto  gel  (approximately  nitrocellulose  ribosomal between  cDNA the  rRNA  In  2-3 /ug  most  weak  than  strong  cluster  the  was  rRNA  which bands  phage  on  the  hypothesis, digested  a  the  be  of  cpmAJg).  a  transferred 32  A  P-labeled  comparison  kb  fragment  /-///7dlll-£coRI  in the XHc4 clone (Figure 5 and within  the  10.9  the X1059 right arm are  result  lower  of  examination  in  limited  of  the  P-labeled the  might  restriction  XHc9 XHc9  as  phage  kb  Hind\\\  (Figure 5). Since  molecular  weights  homology  the  rRNA  or  two  gene  phage  identical  experiments  indicated DNA  were  was above.  (10  example;  6  The  poor  cluster  restriction  sequences. carried  To  out.  fractionated  DNA.  hybridized  The to  Phage  and  Hybridizations  all  shown  restriction  in  4.9  test  kb this  DNA  transferred  were  cpm/filter; sp. act. 20x10  results  Sau3A\  two  restricted fragments were probed with  (or XHc4) probe  contain  endonucleases  filters  nick-translated  genome. For  cuti rubrum  cross-hybridization  with  0.6%  autoradiograph indicated that  8.0  located  the  were  radioactively  the relative position of  closer  fragments  nitrocellulose with  H.  such that XHc4 (or \Hc9)  that  site  autoradiograms  could  DNAs  on  the cDNA probes.  clone,  from  Sa/7?HI-/y/'/?dlll  32  were  an  Hinti\\\,  t  fractionated  3x10'  gene  suggested that the clones might be carrying overlapping partial  fragments  out  on  5.0 kb belonged to  With the knowledge  onto  located  genes  bands, this  representation of  maps  act.  sequences beyond the £coRI  /\Hc9,  each  sp.  with  rRNA  cutirubrum  (£coRI, BamH\  The  ethidium bromide staining and the  fragment, of  on  probed  cpm/filter;  6  and  +EcoH\)  DNA/lane).  and  H.  endonucleases  Hind\\\  filters  (10  gene  plus some 6).  restriction  +BamH\, BamH\ +EcoR\,  agarose  the  and XHc9, containing the  6  carried cpm^ug)  radioactively  Figure  fragments  7  indicated in  ^Hc4.  39  a  Figure 6;  Southern  The enzymes  DNAs (E,  hybridization of ribosomal cDNA to \Hc4 and XHc9 DNAs. from XHc4  EcoRI;  B,  and \Hc9 were digested with various BamHI;  H,  BamHI +£coRI;  HE,  Hind\\\ +£coRI) and  0.6%  gel.  The  agarose  hybridized gel  and  to  the  to \Hc4 DNA  fragments  radioactive corresponding and  lane  32  Hind\\\;  HB,.  fractionated  by  were  P-labeled  transferred  cDNA.  autoradiogram  are  The  " b " corresponds to XHc9  HindW I +BamHI; electrophoresis  onto  ethidium  shown. DNA.  restriction  Lane  on  nitrocellulose bromide "a"  BE, a  and  stained  corresponds  39  co  X  CO  111  X  co  X  a b a b a b a b a b a b  CQ  III  LU  x X CQ X a b a b a b a b a b a b UJ  co  40 a.  Figure 7: The enzymes,  Cross Southern hybridization of XHc4 and XHc9. XHc4  as  nick-translated corresponding  DNAS  on  described  nick-translated  restricted  XHc9  electrophoresed  nitrocellulose with  and  XHc4  XHc9  in  DNA.  2.0 kb BamH\-EcoR\  of XHc4 fragment  0.6%  Figure  DNA;  autoradiogram  fragments  a  were  The are  digested  agarose 6. Panel  panel  B  A  DNA.  XHc9 DNA  and  various  XHc9  onto probed  DNA  probed  DNA  stained DNA  restriction  transferred  depicts XHc4  bromide  The  D N A , and XHc4 of XHc9  gels,  depicts  ethidium shown.  with  gel  and  hybridized  hybridized to  all  to but  with the all one  40  B  41 Similarly,  the  XHc4  probe  hybridized  BamHI-fcoRI) of XHc9. Some  of  faint  result  and  limited  this  might  homology.  indeed carried near  the  the  a  arm  of XHc4  BamHI  cutirubrum DNA  partial  site  of  in  which  Northern  hybridization  of  mixture  a  the  hybridized rRNA only  with  16S  contained rRNA  restriction this BamHI  detected  16S  and  23S  site site.  (Figure  and  the  5). 23S  rRNA The rRNA  very  the  fragment  results  imply  that  the  two  phages  site  located  the  BamHI  in  \Hc9  is  or  junction  X.1059-//. cutirubrum  arm  gene  were  from  the  H.  cluster.  present  carried  23S) onto DNA  with  gene  each  fractionated  "Gene  Screen"  ( A.Hc4 or X H c 9 ;  phage  clone,  RNAs  (5 /jg  on  the X H c 9  probe  whereas XHc9  rRNA was  gene located  had  Figure  as  indicating contained an  a  membrane,  when probed with \Hc4  genes 16S  on  out. Ribosomal  were  and 23S, were detected was  only  autoradiogram were  kb  of  were  phage  (2.0  DNAs  transferred  band  both  gene  gel,  and  nick-translated  bands, 16S the  16S  fragment  transfer  right  genes  experiments  of  formaldehyde-agarose  rRNA  one  poor  located within the rRNA  identify  on the  fact  Northern blot analysis of XHc4 and XHc9 To  but  Sau3A\ fragments. The  was  near  all  bands  Cross-hybridization  overlapping  right  whereas  be  the  to  1.0  and  8).  Two  DNA  and  that \,Hc4 the  internal  least  2%  kb  16S  BamHI from  42 cL  Figure 8;  Northern hybridization of AHc4 and XHc9 DNA to ribosomal RNAs.  Ribosomal RNAs, 16S and 23S, were electrophoresed on a 2% agarose gel  containing  Screen" Panel  6%  membranes  A  represents  represents  ribosomal  formaldehyde.  The  RNAs  were  and probed with nick-translated ribosomal RNAs  both  16S and 23S rRNA  rRNA  gene.  RNAs  probed  transferred "P-labeled  with XHc4  whereas  AHc9  "Gene  phage D N A s .  DNA and panel  probed with \Hc9 D N A . The XHc4 genes  to  DNA contains  B  DNA contains only  the 16S  23S  ^  43 Part II;  Sequence  analysis of the rRNA gene cluster  Subcloning of the rRNA gene into plasmid pBR322  Specific  DNA  from  cutirubrum analysis  (Figure  proximal  portion  of  pBR322  23S  9). The of  and 5S  the  complete the  no  were 5.0  the  recombinant  gene  genes, and the  cloned  site, a  utilized as  rRNA  the  into  p4S.  distal  p4L  the  and  which  into the  plasmid  fragment  for  portion  of  H.  further  contained  Similarly,  the the  sites  respectively.  the sites  7.5  16S  fragment, which  160 bp Kpn\~EcoB,\ restriction  a linker  of  A//'/?dlll-Ba/7?HI  BamHI-EcoRI  p4W  cluster  pBR322  fragment  cloned  vectors  gene  plasmid  7.5 kb Kpn\-Bgl\\  plasmids  restriction  into  was  contained  were  the  Hind\\\-BamH\  16S  recombinant  p701 (19) was  subcloned  the  cluster,  Kpn\  containing  kb  fragment, which  the  has  XHc4  giving  BamH\-Kpn\  giving  fragments  and M13  kb  gene,  contained of  pBR322  Since  pBR322  fragment  in the constructions  from  of  p4L and  to  subclone  p4W. Restriction  endonucleases  small  fragments  mp9,  mp10, mp11; Figure  transform by  clear  color.  E.  color  and  three, light  plaques  different  JM101  on  in some  The  Xgal  cases  number  of  blue  positive  plaques  clones  radioactive  10).  the  formation  small  bp) from the  strains  coli  However,  length)  the  (<500  (Sau3A\  of were  probe.  a  hybrid  first Clones  orientations  plasmid clones recombinant  or  JM103.  plates where  as the  nucleotides were  protein  identified  in  by  identified  into M13 vectors  M13  Positive  used  DNAs clones  by  were  the  inserts  small  the  were insert  was  was  partially  hybridization each  were  opposed to  observed. This was  which  overlapping  were  Taq\, HpaW) were  t  of  restriction "C-test"  wild  used  type  possibly  bp  due  functional. ssDNA  site  and In  blue  multiple  their  (86).  to  identified  (<100 a  (mp8,  of to  These with a  clones a  in  in  "C-test",  44 2L  Figure 9:  Plasmid subclones of XHc4 and XHc9.  The DNA  upper  segment  bar  which  represents contains  the  the  third bar represent H. cutirubrum As  indicated  the  rRNA  The  X  p4W,  by  gene  DNAs  are shown  and  Bgl\\-Kpn\ sites  of  plasmid  by  p4W  contain  fragment  a  Hind\\\\  subcloned lower  linker.  a  7.5  respectively  from  Restriction  K, Kpn\\  three  P, Pst\\  cluster. The second in >Hc9 and XHc4  experiments, XHc9 contains  into  chromosomal  cutirubrum  the  pBR322  and the  respectively.  contains  complete  part  gene  of  cluster.  plasmids, p4S, p4L and  bars. Plasmid  p4S contains  a 5.0 kb  cloned into Hindi I\-BamH\ sites of pBR322. Plasmids  pBR322. The Kpn\ p4L came  gene  DNA inserts  whereas XHc4  the  fragment  rRNA  hybridization  were  sites, a Kpn\-EcoR\  Kpn\ as  cluster  which  Hind\\\-BamH\ p4L  Northern  Halobacterium  site  one of  kb  BamH\-Kpn\  and  and they were cloned into the from  the  7.5 kb BamH\-Kpn\  the X1059 arms. Since  (160 bp in length) enzyme  fragment  sites  (B,  fragment BamH\\  pBR322 from  a  7.5  BamY\\-EcoR\ fragment  in  contains no  p701 was  Bg, BglW;  kb  E,  used  £coRI;  S a , Sa/I; S, Smal) are indicated by arrows.  H,  45  a  Figure  10; Sequencing map of the ribosomal gene cluster. The  boxes  organization  from  left  repeats  are  shaded  boxes.  to  of  rRNA  right  16S,  indicated by The  arrows  first  sequences preceding the the  gap  in  23S  direction and sequencing.  gene  length of  23S  nucleotide  are  prefixed  sequences this  H/nd\\  (H2)  HpaW  or  mp10,  mp11)  cut  with  and dideoxy  method  (82)  5S.  in  by  in  by  The  the  16S  D.  the  rRNA  gene  and cloned  gene  or  opposite  HindW.  also  fragments, e.g. at Pst\  (P)  employed and Sa/I  (Sa)  direct  indicated  by  numbered  +1;  and sequences  after  chemical are  indicate  the  or dideoxy  digested  with  vectors  (mp8, mp9,  Clones  contain  overlapping  purified  sites.  black  M13  orientations  with  in  flanking  underneath  were  method (111). The Maxam and Gilbert  was  bar  are is  cluster into  5'  tRNAs  values  Arrows  top  three  obtained from either  BarnVW, Acc\  clones  Sanger's  and  shown  16S gene have negative  from  Tag\,  is  ( >» ) and the two  Fragments  Sau3A\,  fragments  genes  3'  sequenced  chemical or  5'  using  sequenceing end-labeled  45  46 single-stranded  phage  hybridize.  Clones  identified  because  which  migrates  DNA  from  containing they  more  two  different  sequences  hybridize  slowly  in  and  than  clones  opposite  form  individual  a  are  allowed  to  could  be  orientations  figure-eight  like  non-hybridized  structure  circles  on  an  agarose gel.  DNA sequences of the rRNA gene cluster The middle  complete  rRNA  gene  cluster  the  rRNA  gene  was  of  sequencing obtained are  23S  methods  from  different  illustrated  cluster, was gene  was  in  numbered  M13 order  16S, 23S  +1, the  numbers  approximate  of  10. The  found to be  chemical  length  clones  or  of  genes,  the  from  and 5S. The first  5' sequence  and the  flanking  sequences  of  distal  sequences  purified  fragments  to  base  3'  within  in the  16S  rRNA  the  gap  to  dideoxy  DNA  5'  the  and  in the  16S  the rRNA  gene  was  in the  23S  gene were given a D prefix.  More  than  900  sequenced (Figure at  nucleotide  in  this  separated three  in  repeat  copy  repeat  These  the  and  Figure  units  adjacent are  -670  to  the  other  copy  11).  copies  of  contain  separated  at  segment. The  preceeding  -504, -418 to  units, there  located  segment  to  length  from  nucleotides  11). Three  -551  region.  nucleotides  (see  strands  for the -2600 bp gap  sequenced. Both  used. The  Figure  assigned negative rRNA  were  except  by  the  a bipartite -371, and two  16S  rRNA  direct  repeat  -285 to  repeat  Each  nucleotides.  85  nucleotides. Upstream  two  vestigial  copies  has  interruption  -646  located  spacing between  of  13  by  an at  -757  these  of  to  vestigial  the  750  unit  were located  -238, were  segments  one  gene  27  repeat  in has  remains  its  and unit  from  repeat  found 8 is  these  units. The long  only  the  is also  repeat short altered  47 a.  Figure  11: The 5' flanking sequence of the ribosomal RNA gene cluster. The  repeat  three  units  are  highly  conserved  highlighted  promoter  sequence  inverted  repeat  (  AAGTAA  sequence  is  immediately  ).  the  two  Within  indicated  surrounding  over-underlining. The sequence nucleotide  •  and  partially  each (  the  *  repeat ).  16S  conserved  The  unit 5'  gene  begins at -909 and ends at  preceding the  16S rRNA  gene.  the  portion  is -1  direct putative of  the  identified  by  which  is  the  The  5'  flanking  sequence  of  the  16S  rRNA  gene  -9I0  GGTACCACT  900  -890  -880  -870  -860  -850  -8-10  -830  -820  -8I0  800  -790  -780  -770  -760  -750  -7-10  -730  -720  700  -G90  -680  -G70  -660  -650  -640  -630  -620  -6 10  600  -590  -580  -570  -560  -550  -5-10  -530  -520  -5 10  500  -<i90  --180  --170  -460  -450  -440  -430  -420  -4 10  -390  -380  -370  -360  -350  -340  -330  -320  -310  300  -290  -280  -270  -260  -250  -240  -230  -220  -2 10  200  -190  -180  -170  -160  -150  -140  -130  - 120  - 1 10  CGGCCCGACCGAACGCACTCGCGCGGATGA'CCGGCCGACCTCCGCCTACGCAATACGCTGTGGCGTGTGTCCCTGGTGTGGGCCGCCATCACGAAGCGCT  GC T G G r T C G A C G G T G T T T T A T G T A C C C C A C C A C T C G G A T G A G A T G C G A A C G A C G T G A G G T G G C T C G G T G C A C C C G A C G C C A C T G A  CCCGTTCGGACGGAACCCGACTGGGTTCAGTCCGATGCCCTTAAGTACAACAGGGTACT  -7 10  f TGACGCCCCCTCGT  TCGGTGGAATGCGAACGACAATGGGGCCGCCCGGTTACACG  GGT G G C C G A C G O A T G A C T C C G C T G A T C G G T T C G G C G T T C G G C C G A A C T C G A T T C G A T G C C C T T A A G T A A T A A C G G G T G T T C C G A T G A G A T G C G A A C G A C A  A T G A G G C T A T C C G G C T T C G T C C G G G T G G C T G A T G C A T C T C T T C G A C G C T C T C C A T G G T G T C G G T C T C A C T C T C A G T G A G T G TGAT T C G A T G C C C T T A A G T  400  AA  TAACGGGCGTTACGAGGAATTGCGAACGACAATGTGGCTACCTGGTTCTCCCAGGTGGTTAACGCGTGTTCCTCGCCGCCCTGGTGGGCAAACGTCAC  GC T CGA TTCC. A G C G T G A T T C G A T G C C C T T A A G T A A T A A C G G G G C G T T C G G G G A A A T G C G A A C G T C G T C T T G G A C T G A T C G G A G T C C G A T G G G T T I A 1GAC  C TGTCGAAC  IOC)  rcTACGGTCTGGTCCGAAGGAATGAGGATTCCACACCTGCGGTCCGCCGTAAAGATGGAATCTGATGTTAGCCTTGATGGTTTGGTGACAT  -90  16S  -80  -70  -GO  -50  -40  -30  inverted -20  repeat .-.  -10  CCAACTGGCCACGACGATACGTCGTGTGCTAAGGGACACATTACGTGTCCCCGCCAAACCAAGACTTGATAGTCTTGGTCGCTGGGAACCATCCCAGCAA  48  The  16S  comparison  with  Halobacterium 16S rRNA shows pair  rRNA  gene  that  of  deletion  is  the two  8 8 % homology  rRNA  from  1472 nucleotides  a  by  comparison  illustrated  substitutions, including  327-328  and  an  23S  rRNA  sequence  related * organism  length. The  of Halobacterium  178 base  nucleotide  located  cutirubrum,  16S  species  with  between  H.  the  (42),  volcanii  between  of  in Figure  a  insertion  of  single  at  12  base  nucleotide  1078. The nuclease  mature  Si  5'  1969-2174),  [r- P]-dATP,  was  fragment  193±4  32  of  the  determine 23S  5' end  a  (nucleotide  1846-1939)  indicating  that  not  cleavage  extending  kb  Sa/I  in  the  to  the  5'  was  an  S1  rRNA  the These  was same  a  1982  (29,  the  and  by  by  5'  mature  if  of  there  a  the  is  1.0  middle  give  fragment  was  with  ones  the  14). To  5'  end  of was  fragment  Taq\  684-1969); not  23S any  a  kb  Sal\  of  the  5'  shown)  rRNA  are  nucleolytic  not  at  fragment 23S  gene  end-labeled  fragment  A  This  from the Taq\ site  experiment. The to  rRNA.  analysis  (results  downstream rRNA,  S1 a  end  and  digestion.  (nucleotide  rRNAs  mature  23S  1982 + 4 (Figure  fragment  rRNAs  corroborate  S1  fragments,  towards  3' end-labeled  from  147), nuclease  5.8S-like  by  205 bp in length  mature  putative  determine  protection  protected  results  the  protected  ribosome. To  the  nucleotide  BamH\-Sal\  was  nuclease  of  protected at  of  determined  polynucleotide . kinase  end  end-labeled  a  liberate  T4  preceeding  preceeding  nucleotide  fragment  shown).  with  were  fragment  Sal\-Taq\  the 5' portion of the 23S  2174  size, whereas not  in  the  gene  5'  and  sequences  from  used  other  radioactivity  within  nucleotide  was  two  preserved  rRNA  5.8S-like  on  no  map  sequence  performed  however,  to  23S  the  of  13). A  nucleotides  of  encodes  ends  5'-labeled  used  whether  rRNA  3'  mapping (Figure  (nucleotides  placed  and  1.0  of  similar  protected  (results  described  above  and  49 a  Figure  12: The  The 16S  sequence  rRNA  sequence  substitutions single  base  nucleotide  16S ribosomal  is  gene  numbered of  are  indicated  pair  deletion  1078.  RNA  the by  sequence.  from  1 to  related arrows  between  1472  organism, (  f  ). The  nucleotides  and  is  H.  vo/canii.  H.  compared  cutirubrum  327-328 and  an  The  to  the base  contains insertion  a at  49  The  t6S  rRNA  gene  of  H.  cutirubrum  10 20 30 JO SO GO 70 80 . 90 100 A T T C C G G T TGA TCC T G C C G G A G G C C A T T G C T A T C G G A G T C C G A T T T AGCCA TGCT AGT T G T G C G G G T T T A G A C C C G C A G C G G A A A G C T C A G T A A C A C G T G T  4 4  T  T G  44  4  C  A  4 4 4 tt  A  C  T  T  T  4  G  A  110 120 • 130 140 150 160 170 180 190 200 G C C A A G C T A C C C T G T G G A C G G G A A T A C T C TCGGGA A A C T G A G G C T AA T C C C C G A T A A C G C T T T G C T C C T G G A A G G G G C A A A G C C G G A A A C G C TCCGGCGC  4  m  Htt+  44  44444  44 444 44 4  4 444 444  4  4  A  ACA  GAACG  AC  AGTTC  CG  T CCG  C  A  GAG  CA  G  CTC  2 10 220 230 240 250 260 270 280 290 300 CACAGGATGCGGCTGCGGTCGATTAGGTAGACGGTGGGGTAACGGCCCACCGTGCCCATAATCGGTACGGGTTGTGAGAGCAAGAGCCCGGAGACGGAAT  444  4  4  4  TGT  T  C  G  310 320 330 340 350 360 370 380 390 400 CTGAGACAAGATTCCGGGCCCTACGGG-CGCAGCAGGCGCGAAACCTTTACACTGTACGAAAGTGCGATAAGGGGACTCCGAGTGTGAAGGCATAGAGCCT  +  4  G  C  4  4 4  C  4 + •  C  A  C  G  + +t T  T  C  4 10 420 430 440 450 460 470 480 490 500 TCACTTTTGTACACCGTAAGGTGGTGCACGAATAAGGACTGGGCAAGACCGGTGCCAGCCGCCGCGGTAATACCGGCAGTCCGAGTGATGGCCGATCTTA  +  I +4  I  H  4  H  Ht  G  C  C  CG  G  AG  CT  CG  A  t  t  A  A  510 520 530 540 550 560 570 580 590 600 TTGGGCCTAAAGCGTCCGTAGCTGGCTGAACAAGTCCGTTGGGAAATCTGTCCGCTTAACGGGCAGGCGTCCAGCGGAAACTGTTCAGCTTGGGACCGGA C  CACGA  G T A C  C C A  C  T  G  G T  A  CACGTG  610 620 630 640 650 660 670 680 690 700 AGACCTGAGGGGTACGTCTGGGGTAGGAGTGAAATCCTGTAATCCTGGACGGACCGCCGGTGGCGAAAGCGCCTCAGGAGAACGGATCCGACAGTGAGGG  t tt  +  4  G  C  C  TC  -4  A  4  4  44  44  4  A  A  GA  AG  G  7 10 720 730 740 7 50 760 770 780 790 800 ACGAAAGCTAGGGTCTCGAACCGGATTAGATACCCGGGTAGTCCTAGCTGTAAACGATGTCCGCTAGGTGTGGCGCAGGCTACGAGCCTGCGCTGTGCCG  44  4 4  44  CT  A  T  A  T  8 10 820 830 840 850 860 870 880 890 900 TAGGGAAGCCGAGAAGCGGACCGCCTGGGAAGTACGTCTGCAAGGATGAAACTTAAAGGAATTGGCGGGGGAGCACTACAACCGGAGGAGCCTGCGGTTT  44  4  AG  C  910 920 930 940 950 960 970 9B0 990 1000 AATTGGACTCAACGCCGGACATCTCACCAGCCCCGACAGTAGTAATGACGGTCAGGTTGATGACCTTACCCGGAGGCTACTGAGAGGAGGTGCATGGCCG T  TAC  G  A  T  AC  C  GTA  1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 CCGTCAGCTCGTACCGTGAGGCGTCCTGTTAAGTCAGGCAACGAGCGAGACCCGCACTCCTAATTGCCAGCAGTACCCTTTGGGTAGCTGGGTACATTAG  4  4 444  4 44 4  T  C  C  GT-  AC  G  1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 GTGGACTGCCGCTGCCAAAGCGGAGGAAGGAACGGGCAACGGTAGGTCAGTATGCCCCGAATGGGCTGGGCAACACGCGGGCTACAATGGTCGAGACAAT  44  4  AA  4  T  4  A  T  1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 GGGAAGCCACTCCGAGAGGAGGCGCT AATCTCCTAAACTCGATCGTAGTTCGGATTGAGGGCTGAAACTCGCCCTCATGAAGCTGGATTCGGTAGTAATC  44  4 444  4 4444  TT  T  A  TCT  AGAA  1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 GCGTGTCAGCAGCGCGCGGTGAATACGTCCCTGCTCCTTGCACACACCGCCCGTCAAATCACCCGAGTGGGGTTCGGATGAGGCCGGCATGCGCTGGTCA  4 4  44  4 4  4  4  A T  AT  A T  G  A  1410 1420 1430 1440 1450 1460 1470 AATCTGGCTCCGCAAGGGGGATTAAGTCGTAACAAGGTAGCCGTAGGGGAATCTGCGGCTGGATCACCTCCT  4  4  T  C  4  C  44 44 4 A  C  C  A  4  G  G  50a.  13: Nuclease S I mapping of the 5' and 3' end of  Figure  The bp  5'  5' end of  end-labeled  resistant  fragment  positions  the  end  mature  of  end-labeled was of the  5'  Taq\  mature Sal\-Taq\  was  end  the  rRNA  fragment  rRNA  (panel  fragment  estimated  of  23S  23S  to  23S  be  193±4 at  B)  (nucleotides  was  located  (nucleotides  gene  (panel  A)  mature 23S  was  located  S1  23S  gene  positions  fragments fragment nuclease.  of  respectively. and the  full  length  The  three  DNA lanes  protected fragment  and  in  B  and  a  76  are  the  S1  3' 3'  fragment  arrows  the  S1  which  bp  positions the  fragments A  length  resistant  at nucleotide D49±4. The upper and lower the  The  1982±4. The  using  estimated to be 4 9 ± 4 nucleotides in length which the  in  nucleotide  D1-D77). The  using a 205  1969-2174).  nucleotides  about  rRNA.  3' end indicate  resistant  full  digested with 300 or 600 units  length of  S1  3 3 OO — OO  to 00*0  B 3 3 OO O O cO ro  51 at  Figure 14; The intergenic space between the The and the  3' end of  5'  end  3' portion of portion of  the  the  The putative  of  the  the  16S  23S  rRNA  gene  inverted repeat  inverted repeat  alanine tRNA  gene  16S and 23S rRNA genes. (underlined)  (underlined)  is  surrounding the  at  is at  nucleotide  nucleotide  16S rRNA  1472.  1982±4. The  gene and the  5'  surrounding the 23S gene are over-underlined.  gene (nucleotides  1575-1651) is highlighted ( * ).  The  intergenlc  space  between  the  16S  and  23S  rRNA  genes  14)0 1420 1430 1440 1450 1460 1470 1480 1490 1500 AATCTGGCTCCGCAAGGGGGATTAAGTCGTAACAAGGTAGCCGTAGGGGAATCTGCGGCTGGATCACCTCCTAACGTCCGAGACTGGAGCGACGCTCCAG 3' e n d o f t h e 16S r R N A g e n e 1510 1520 1530 1540 1550 1560 1570 • 1580 1590 1600 CTCACCGAACGACGCCGTCGTGCCCAGTTGGGCACTTACAAACCATCAAGGCTAACATACCCTCCCAATCGGGAGGTGGGCCCATAGCTCAGTGGTAGAG 16S inverted repeat ** . . • . , . . . , > , . f  alanine  tRNA  gene  16 10 1620 1630 1640 1G50 1660 1670 1680 1690 1700 T G C C T C C T T TGCA AGGAGGA T G C C C T G G G T T C G A A T C C C A G T G G G T C C A T C C G T T C G G G G T T C A T C T T G G A T C G T G T C C C T TAAGTGGGAGACGGGGCAA  1710 1720 1730 1740 1750 1760 1770 1780 1790 1^800 CGATGA ATCGCGACGAAGACTGATGCACCACTCCGCGAAAGTGCGAGTGGGAAGGGTCGATGCACGCTCCCTGTTCACCT AGGGACGTGCGATGJ^GGCC 18 10  1820  1830  1_840  '  1850  1860  1870  1880  1890  1900  GTGTG TAAGTGCA A T C C A G G C G C T C A C T G G A C T C G A C C A C C G T G G T C G A G T A C C G A C T G T T A G J CACATCCGTGACT TAACAGCGCTCACCCA T TGTGTG 23S  inverted  repeat  1910 1920 1930 194Q 1950 1960 1970 1980 1990 2000 GTGAGCATTCATCGTCGTTGCTGTTTACAGCCAACATCTCGACACTTCGTGTGGTTGAGTACCATATTGTCGACAACCAACGTGGCTACTGTGCCACCTG 5'  end of  23S  rRNA  gene  2010 2020 2030 2040 2050 2060 2070 2080 2090 2 100 G T G G A T A G C T C G G C T C G G A T G C C G A C G A A G G A C G T G C C A A G C T G C G A T A A G C C T G A G G G A G C C G C A C G G A G G C T A A G A A C T C A G G A T C T C C T A A f GGGAA 2110 2120 2130 3210 T C C C T A TA AC AA T T G C C T T G C G C A A T G G G G A A C G G C C G G A A T  2 150 21G0 2170 TGAAGCATCTCAGTACGGCCAGGAAGAGAAA  TCGA  52 indicate  that the 5' end of  (nucleotide  1969). There  rise  5.8S-like  to  a  determined The  by  fragment  polymerase  I  protected, (Figure  was  placing  The  is  mature  experiment  3'  and  23S  is no nucleolytic  RNA.  an S1  mature  3'  with  [o- P]-dCTP.  A  n  mature  cleavage end  3'  the  of  the  Klenow of  23S  its  of  rRNA  49 + 4 at  give  was  also  76 bp in length.  fragment  rRNA  site  5' end to  23S  fragment  fragment  end  beyond the Sa/I  within  of  using a Taq\  end-labeled  the  located just  of  E.  coli  nucleotides nucleotide  was  D49±4  15). The  123  nucleotide  nucleotide  D162, about  rRNA. The  5S  DNA  long  5S  rRNA  112 nucleotides  sequence  agrees  gene  was  the  mature  from  with the  found  to  start  3' end of  published  5S  the  rRNA  at 23S  sequence  (33, 92).  Part  III:  Single copy  To H.  rRNA  genes  the  number  determine  genomic  cutirubrum,  Radioactively  32  P-labeled  the  cloned rRNA  H.  cutirubrum  gene  A  484 bp Sau3A\  bp EcoH\-Pst\ fragment  fragment  which  at  carried  60°C  in  at  each  restriction  (as  DNA  shown  in Figure a  £coRI, Hin6\\\,  Kpn\,  Pst\  from the  the  moderately and  are  high washes  at  used to  probe  of  restriction  16S  17. These  60°C  in  1.4 kb  Pst\  gene.  hybridizations  were  1xSSC.  probes  gene, a 340  gene and a  hybridizations  out. within  and Smal). The the  in  from  gene and the 5S  in Figure  stringency: were  23S  gene  carried  number  5' end of  middle of the  illustrated  were  16) were  with  from  RNA  fragments  digested  fragment  results  6xSSC,  ribosomal  nick-translated  contained the 3' end of the 23S  Hybridization were  of  hybridizations  endonucleases (BamHI, BglW, were:  copies  Southern  cluster  genomic  of  performed All  probes  53 a.  Figure  end  15; The 3' flanking sequence of the 23S  rRNA  The  D1 to  of  rRNA  sequences  the  gene  23S  inverted  the  putative *  ).  In  termination, region between  rRNA  (underlined)  the  (  extend  repeat  addition,  is between  tRNA two  inverted  (nucleotides nucleotides  nucleotide  (underlined)  surrounding  cysteine  an  gene  from  the  sequences  23S  nucleotide  gene  (nucleotides which  nucleotide  D608. The  D49 + 4. The  3' 5S  D162-D284. The 3' portion of  rRNA  (nucleotides  D544-D589) are D589-D608.  at  nucleotides  gene  repeat  is  gene.  may  is  over-underlined  D395-D469) be  related  D303-D332)  indicated. The  A/T  is  rich  and  and  highlighted  to a  region  transcript G/C is  rich found  The  3'  flanking  sequence  of  t h e 23S  rRNA  gene  0 10 020 D30 040 050 DG0 070 080 090 0100 TCGAGGCAACGAGACGTTTAGCCCGCGAGTACTAACAGGTCAATGCCACACACTCATGCACTCACCACATACGTGGTCGAGTCCAGGCGTTTACTGGATT 3' e n d o f t h e 2 3 S r R N A g e n e 23S i n v e r t e d repeat D1 10 D120 0130 0140 0 150 0160 D170 GCACT TACACACGGACGTCCGCCGACGTCGGCGTACAACGGTTCGATTCCGTTGGTCGGTATTAAGGCGGCCA 5S  rRNA  D180 0190 0200 TAGCGGTGGGGTTACTCCCGTACCCA  gene  0210 0220 D230 0240 0250 D2S0 0270 0280 CCCGA ACACGGAAGAT AAGCCCGCCTGCGTTCCGGTCAGTACTGGAGTGCGCGAGCCTCTGGGAAATCCGGTTCGCCGCCTACTA  0290 0300 T TCATACTCTCATTC  D 3 10 0320 0330 0340 0350 D3G0 D370 0380 0390 D400 A TGC T TCGA A C A G C A G C G G T G C T G T T C G G G G C T T J T T G C A G T TT T G A C T G G A G A C C G C T A C G T T T A T T G G C G G G A C A C C G G T ACGT A G T C G T G T G C C A A G inverted  repeat  0 4 10 0420 D430 0440 0<150 D4G0 0470 0480 0490 0500 GTGGCAGAGTTCGGCCTAACGCGGCGGCCTGCAGAGCCGCTCATCGCCGGTTCAAATCCGGCCCTTGGCT TTCAGCAGCGAGTGACGGTTCGAGTGGCAA cysteine  tRNA  gene  D 5 10 0520 D530 D540 D550 D560 0570 0580 D590 0600 CACAGTCGGCAGTGGTCGTGGAGCGGAGAATCGAGTGGCTATACCCGGGGTGTTCGGCCCGCGCGTGGGGTTGCTCGTTGTGGCCGCGGAAAGTAACGAT + + + + +++ + +++++ + + + ++-#- -»- + •*• + ++ ++ + ++ ++++ +* G/C  TATACGCA  regions  54 a.  Figure 16: Location  of  the  fragments  used  for  genomic  Southern  hybridization  with respect to the rRNA gene cluster. The putative  relative  tRNA  16S and the the  positions of  genes ( T ) are 23S rRNA  inverted  repeat  flanking region are bars  at  DNA  for  the  5S  gene  long nearly  and the  sequence. Identical  represent  a single  gene  rRNA  genes  and  two  distal  direct  perfect tRNA  repeat  inverted  the  repeats;  gene represents a  sequences  in  the  5'  indicated by a solid box with overhead arrows. The four  bottom  bp) from within 23S  the  and 5S  indicated. The solid boxes at the end of  restriction  fragments  related sequences. The fragments  bp) carrying  the  16S, 23S  genes represent  solid box between  short  the  the  and  23S gene, the entire  copy  of  the  direct  used to  are; Hind\\-Sau3A\ repeat  unit; Sau3A\  16S gene; an EcoR\-Pst\ fragment a Pst\ fragment 5S  (1.4  kb)  carrying  probe  genomic  fragment  (115  fragment  (480  (340 bp) from the  gene and a portion of the tRNA  distal gene.  end  within of  the  to  : LU  CO CN  -O CO  o o  CO  ' co CO (CO  B:•CN  55 a  Figure  17; Genomic  Southern  hybridization  with  probes  from  within  the  rRNA  a  variety  gene cluster. Genomic restriction  H.  endonucleases  (BgE,  BamHI; BH, BamHI +Hind\\\; transferred restriction 60°C.  onto  cluster  nitrocellulose  and  is  location depicted  with a mixture of indicate  Sa/;  the  fragments.  and 0.6 kb.  of in  two  of  and are  a  digested BE,  23S  with  and  and  E,  Bam + EcoR\\ by  were  probes  labeled  in  the  16S+23S  markers  between  (X. DNA  cut  fcoRI;  32  B,  P-labeled  carried  fragments; the double bands site  of  electrophoresis,  nick-translated  washes  5S  panel  restriction size  with  fractionated  Pst\),  probed  16. The  restriction  position  arrows  16S,  Figure  of  P,  hybridizations  the  presence  The  indicated by  Both  was  Bg/\\+EcoH\;  S,  fragments.  The  DNA  cutirubrum  the with  out  rRNA was  gene probed  in this two  at  panel  probing  Hind\\\)  are  from top to bottom: 23.7, 9.6, 6.7, 4.3, 2.3, 2.0,  55  d s CO  I I  H9 9 3  I  39  I  3 9 6  A  A  A  A A  A  d  S CO  H9  CO CN  9  I  3  I  39 3 9 6  23S  A  16S  +  d s  A  1  Ha  a 3  1  1  1  33  1A  I A  A A  A  d s H9 9  •  3  39 3 9 6  A  > 1 A  A A  1  1 A  • A  »  •  g6g  CO  A  A  A  AA  56 hybridized  to  only  Kpn\  and BglW  size  (results  and BglW that  single  not  shown).  are  genome. If  Genomic  the  Southern  the  restricted  genomic  from  of  the  the  16S  and  rRNA  respective  cluster single  genes  are  position  related  hybridizations were which  rRNA  sequences were  and washes  52°C  and  multicopy, they  also  contained  gene  present  were carried out  44°C.  (Figure  a  carried  direct  18). The  Although  elsewhere  on the  the  no  apparent  there  was  specific  hybridizations  probe sequence is probably single copy  cluster.  Kpn\  results of  must  imply  the be  for  kb in  the  out  with  H.  within  bipartite  location  of  the  115  repeat  unit  this  an  genome, hybridizations  increase X.DNA  were DNA  probe  16. To determine  at both high and reduced stringency  hybridization to H. cutirubrum DNA as well as marker),  of  components  with respect to the rRNA gene cluster is shown on Figure if  than 25  (Figure 9), these copy  DNA;  units greater than 50 kb in size.  fragment  Hindi\-Sau3A\  upstream  Because  unique  highly conserved repeat  bp  of  5' and 3' to the rRNA  genes  cutirubrum  fragment  the hybridizing genomic fragments are greater  sites  rRNA  a  (the  in  at 60°C,  non-specific  molecular  observed. This unique to the  weight  indicates  rRNA  gene  57 a.  Figure  18:  Genomic  Southern  hybridization probe  with  fragment  containing a  5'  flanking repeat. Genomic enzymes, as 32  the  rRNA  were  in  by  Figure  DNA  gene  cluster  out  17 are  at  was  electrophoresis 17. The  115 bp Hinti\\-Sau3A\  carried  in Figure  cuti rubrum  fractionated  described  P-labeled  H.  is  60°C,  filters fragment  indicated 52°C  indicated by  digested  and transferred were  probed  (location  in Figure  and 4 4 ° C .  arrows.  with  of  various onto with  restriction  nitrocellulose nick-translated  probe with repect  16). Hybridizations and The  size  markers  as  to  washes  described  58 DISCUSSION  Direct bipartite repeat The  5'  flanking  three  perfectly  -418  and  precise; spacer of  in  the  short  conserved  contain  repeat  in  genome  Halobacterium  large  of  the  halobium  has  between  28-42  at  the  three  direct  the  long  segment  genomic  DNA  two  believed (21).  frames  to  a  between  the  repeats  as  of and  of  the  six  units  160).  The  units  ATG  related present  the  is  89) and this  AT  in  from  in the  start  cluster.  rich  (66%  AT)  an  in all  segment In  relative  important  H.  codon.  AAGTAA,  long  the  positioned  the six positions  sequence,  the  flanking  translation  are  promoter  sequences  gene  be  units.  sequences  rRNA  may  within  sequences  AAGTTA,  to  these  homology  sequences  five of  positions, is  the three  A T ; Ref.  the  region  In  characterized  sequence,  least  preceeding  well  long  degree  the repeat  promoter  8 is  appears  sequences.  promoter  5'  the  spacer  sequences  transposable  from  in at  the  sequence  the  separate  upstream  within  repeat  the  and  and  a considerable  spacing between  hexanucleotide  122,  (34%  27  is  of  -551,  are  repeat  loss  contains  nucleotides  13 nucleotides  even  act  cluster  unit  consensus  gene  in two  28,  of  is  additional  in the  at  each  direct  Comparison  is conserved  repeat  three  eubacterial  (25,  five  unit  gene  units  spacing  both a partial  nucleotides  promoters  conserved  of  or  revealed  This hexanucleotide three  the  bacteriorhodopsin  open reading  The  (36-50%)  and a change  regions  repeat  85 nucleotides. There  from  eucaryotic  RNA  within  each  homology  been  segments  found  region  is  remains  has  ribosomal  direct  19).  within  units  vestigial  the  segments  (Figure  sequence  Typical not  two  region upstream the  of  bipartite  spacer  the  sequences, there the  The  length  between  (2). The  region  conserved  -285.  nucleotides  sequence  also of  addition, to the  component  593L  Figure  19: Direct  repeat  units  in  the  5'  flanking  sequence  of  the  16S  rRNA  of  sequences  within  and  surrounding  Homologous  bases  (  )  gene. A  homology  direct  repeat  highly  conserved  units  indicated. The nucleotides; decreased  to  comparison  line  within  is  presented.  segments  of  length within the  achieve  beginning and end of  two  each the  bipartite three  upstream  maximum  highly  imperfect  homology. The  each line are  indicated.  repeat  *  the  two  (over-underline)  are  conserved units  the  nucleotide  and  the  repeat line  was  133  length  was  numbers  at  the  THE  5'  FLANKING  SEQUENCE  OF THE 16S R-RNA GENE  -909  GGTACCACTCGGCCCGACCGAACGCACTCGCGCGGATGACCGGCCGACCTCCGCCTACGCAATACGCTGTGGCGTGTGTCCCTGG -825  -824  TGTGGGCCGCCATCACGAAGCGCTGCTGGTTCGACGGTGTTTTATGTACCCCACCACTCGGATGAGATGCGAACGACGTGAGGTGGCTCGGTGCACCCGACGCCACTGATTGACGCCCCCTCGTC -700 * * * * * * * * * * ** * + + *** * * * *********** ** * * **** * * * *  -699  CCGTTCGGACGGAACCCGACTGGGTTCAGTCC^ATGCCCTTAAGTACAACAGGGTACTTCGGTGGAATGCGAACGACAATGGGGCCGCCCGGTTACACGGGTGGCCGACGCATGACTCCGC -579 * * ++* *+ * * +* * * * * * * * * * * * * * * * * * **** * * * * * ****************** * * * * * * * * ***  -578  TGATCGGTTCGGCGTTCGGCCGAACTCGATTCGATGCCCTTAAGTAATAACGGGTGTTCCGATGAGATGCGA^CGACAATGAGGCTATCCGGCTTCGTCCGGGTGGCTGATGCATCTCTTCGACGCTCTCCAT -446  -445  GGTGTCGGTCTCACTCTCAGTGAGTGTGATTCGATGCCCTTAAGTAATAACGGGCGTTACGAGGAATTGCGAACGACAATGTGGCTACCTGGTTCTCCCAGGTGGTTAACGCGTGTTCCTCGCCGCCCTGGTG -313  -3 12  GGCAAACGTCACGCTCGATTCGAGCGTGATTCGATGCCCTTAAGTAATAACGGGGCGTTCGGGGAAATGCGAACGTCGTCTTGGACTGATCGGAGTCCGATGGGTTTATGACCTGTCGAACTCTACGGTCTGG -180 * ** * '* +* * * * * * * * * TCCGAAGGAATGAGGATTCCACACCTGCGGTCCGCCGTAAAGATGGAATCTGATGTTAGCCTTGATGGTTTGGTG -105  +  -179  **  +  +*  +  * * * * -if* .  + *•  +************++****+*****4*  ***  + +• + ****** + *** + *** + **.***********:((  * * * . * *  4'+** + * * * * * * + * *  * * * * *  * * * * * * * ******** *  +  ***  * *  *  *  +*  *+  *  *** * * * ***  * *  * * *  * ***  ***  **  * + * *  *  CD  60 in regulating transcription of In E. coli expression of copy  direct  result  of  the rRNA  and in eucaryotic  a gene results repeats  the  duplication  occurred. Instead,  presumably  with  this  interesting to  have  tandem  taken  place;  frequency  entire  it  may  genomic  gene  cluster  the  promoter are  many  the  promoters.  be related  It  to  in  H.  levels  unclear  known  to  been  of  the  this  place  in  gene and  expression. It  genes  in E.  coli  triplication  has  sequences  take  no  triplicated  gene  rRNA  how  the transposable  rearrangements  be  cutirubrum  has  including the is  also  selection has resulted  region  elevated  genes  might  multiple  the genes encoding rRNAs. In  cluster, whereas  triplication  multiple  rRNA  elevated  duplication (138). The  archaebacteria  gene  note that  culture, strong selection for  expression of  and some  of  is  the  selection for elevated  duplication  cell  in tandem gene  preceeding  eubacteria, eucaryotes  gene cluster.  and the  in  high  Halobacterium  (112).  Ribosomal RNA genes The the The  16S  universal  rRNA  sequence  secondary  nucleotides which  Halobacterium  strain, H.  substitution  differences  are  structure are  although  the  structural  features  vo/canii, occur  evolving  segments  clearly  apparent.  sequence, contain  the  base  the  in  small from  Figure  that  of  pairing  sequence  of  within  (94, 154).  distantly  RNA.  evolved  strongly  with  related  the  base  duplex structure  the  between  about  This  and  suggests  considerably,  preserved.  115-210 and  base  compatible  (42). About 7 5 % of  regions, representing overall  is  a rather  secondary  has  are  20  ribosome subunit RNA  indicated  nucleotides  two  35% of  are  molecule  between  These  for  in regions  nucleotide of  shown  different  compensatory, maintaining  that  as  Two  rapidly  525-590  10% of  substitutions. The  the  16S  are  rRNA  counterpart  of  61 a.  Figure 20; Secondary structure map of The  secondary  modifications Woese  5'  t  end  and H. of  substitutions additional volcanii  the  map  proposed  1983 (154). The  et al.  H. cuti rubrum the  upon  structure  the  in  base  16S  the  A  of  are  region  the  of  is  this  substitution  mutation  with  differences  between  the  ). An alternate  structure  for  which the  large  structure  minor of  The  in  based  map  nucleotides  region  is  secondary  mutational  illustrated.  cutirubrum.  rRNA  indicated (  between in  T6S  universal  sites  rRNA  interactions  structure.  652-671 allows  volcanii  16S rRNA of H.  number  110-200 are  not  loop  of  base  allows found  at  for in  H.  nucleotides  for a potential four base pair stem within this large  loop.  61  u  c  G  C  *  U-  G G .  4  „G U  A A U'C U*G  GC U C-G , -G-C c c c .AC"**,-G_ G. AC-G  G A , U-A G* A CA . U G * * ' ,, C UCCUCC GGGC GG„GGAUUA GUCAUGGG U-A A c A A »• CO •• . «:§c G % * CU G-C J G G  C 6  c  u  G  „  :A«  u  G-CG G G C U A . C G * *A C ** .G.-C*. * C C C G G-G C C-G C G  -  G  A  A  GA  U ' G 'G U G G-C C • -."" !:! G , . „, C-GG-C A C , y*  G  A  / 6 C  G-  c  C  C  G  C « G•u A UC *G G . U./Ar-,, G*G C U '„ . AC C-C.  C  UCcIcJ0G»' UGUUCAGC G G G U U GC C U * d » * i u C 6  c:S O'U G-C  u  G  C G  B. w . ^  V , » A A , . . C il C I '  C  **CGGCcifiG " U G C C UG U C U  r  G  c  c  c  G  ....  G  UC G  /  A  C  G  «  *°  C c  S . U  A G'U *  C  \o  il (Il  U  -„ c  ^*„-G-C» A.°, II, •  u  A  "  _ U .  C G  «-  U  U  £  ••••  //G0  A  "  J  !  C  C C  J  ;  ,  U ,V» - * U*G-" rc\A  C-G. G C-G C-G  . C  \  f.  A  C  *  »  G  C"GA  G-C A"*" A  G  G  ° /  C  C  A  C N \ \U \ >  S  CG  ' G^U  G  G ,  '°U GA  '  C  *  U-  A  U C C G G C . . l l j i t G . G  C  g  C  C  „'  *CGGG*AU* UCyCGG A - i i i * , . ! . ^ ^GGAGUC.A C  G  r  C C * O A *C*\  UG  G  G  UAGCCGyAGG G GUCGGCGUCU C  A  A  ,  G  C ,G ? .*  U .""  C  A A  A  C  .«".  C  U U  C  *  •' U .  U  G  G  G  *».«« V G  C  G  G  „  s  A-U - U-A -  G  C  =-ju» .VG' \  J  "  A  C*A G, C AGCCCGCAC* * -UUGGGCCUCGA GA/_ AU A A G U A *A G » G  A  C UAC A C  G'-G*"'G  C  u  G  A UUGGCGGGGGAGCA  C  C  C-G . . sC U C-G G-C C-G A * \ GC , . „ » „ C C  A  0  ""'c'-Vu,  c  C  C  U  G  u  C  A  C  * c \ \  CU  c  u.  =. c  r  G  G C A *A CuC * CtjC  wa^io.io,*  C-  G-C s  *'  - >*  C  c  G  6 e  C  ."{ififfi  s  G  U  c  C  C  C  A*GyGCG*I^AAGGG "ACAUGU AUUUC C ' C . C C G  G  Gc  :  •V  A  C  G  G  A=.? = A C-G U  C  C  C G G U  „..  Q  .'"°V C A  C  U  G  c  CAGCCGA CCGUGUCGCCUCCGA " ' ' . * „? A * G-C *. G G«U . 6G ... U-G A AU-0 „ A ' G „C A At AG G u 'UC* GC UG CU UC 'yc C U C A GU AGG * A  C C G A C  °v  U  TTT??fv*nv v hu;? TV c  C  G.  .A  **-UGUA  G  U  U  I  c  1  C  G '.,=  62 the  sequences  represent  between  the  nucleotides  binding  Surprisingly, E. coli  site  S8  for  protein  the  will  that  important  than its nucleotide sequence 16S  pyrimidine is  used  purine  rich in  rich  features  rRNA  in  sequence  initiation Shine  H.  of  of  and  the  at  its  initiation  functions sites  in  on  bacteriorhodopsin  mRNA  contains  only  initiation  codon.  between  Dalgarno  sequence,  AGGAGG,  nucleotides Within  the  elements, GGAG AUG  rich  open  and  16S rRNA  codon.  are  26-28  These  5'  terminus  mRNA at  136). this more  27-30  internal  purine  the  of  to  the  the  H.  purine  rich  respectively rich  However, pyrimidine  of  translation  sequence  the  AUG  6-9  and  the  the  AUG  cannot  occur.  codon  at  sequence.  transposable  downstream may  there  GGAGG  sequences, G G A  sequences  It  interactions  CCUCC  halobium  the  mRNAs.  synthesis, rRNA  of  that  preceeding  16S  6-9  this  eubacterial  beyond  a  sequence  (121).  that  16S  has  about  showed  nucleotides  also  and  during translation.  to  complementary  located  (28) most  and  this  a  on the  from  frames are  rRNA;  selection  report  complementary  reading  the  al.  mRNA  GGAG  ISH50, there  at ' nucleotides start  its  idea  bacteriorhodopsin  bacteriorhodopsin  27-31, which  ISH1  of  in  et  the  during  sequences,  long  at  16S  eubacteria  identify  the  mRNA. A  different  nucleotides  the  way  Dunn  is  (91,  probably  codons on mRNA  supporting  analogous  by  sequences  within  purine  evidence  Therefore,  leader  However, are  two  of  to  archaebacterial gene  that  synthesis  an  bacteriorhodopsin  are  protein  there  sequence  site  S8  3' end. In eubacteria  at  no  archaebacterial  like  upstream from A U G translation is  protein  believed  (137).  nucleotides present  is  coli  E.  binding  cutirubrum  CCUCCU  in  ribosomal  bind to  suggests  The  structural  525-590  from  interact  and the with  63 In  Figure  sequence and  are  21, the  compared  a sequence  rRNA  from  Several the  well  The and  112  have  available,  of  900  (45).  the  to  Fox  same  the  in  of  H.  and  1  very  16S  and  repeats  interruptions  to  22).  coli,  surrounding  the  ribosomal RNA loops III,  coli,  form  a 16S  the  homology 23S  for  (16, 94),  100 nucleotides  Methanococcus  rRNA  intergenic  lengths  showed  closely  of  23S (49).  vannielii  were  observed. With  shows  50% homology  spaces  are  are  much  the  very  closely  related  that  H.  cutirubrum  and  catalog  about 509  shorter  suggesting  than  the  species H.  that  related or are of the same  23S  5' and 3' ends. These  E.  bp  sequence  rRNA  vannielii.  oligonucleotide  x  mature  E.  sequence  23S  cutirubrum  rRNA  proximal  species,  These  (34)  inverted  precursor  the  H.  23S  coli  and 23S-5S  400  perfect  RNase  E.  the  H.  halobium  these  two  species.  sequences  Flanking the  large  of  cutirubrum  length.  et al.  16S  Inverted repeat  as  of  represent  16S-23S  bp  organisms are either  In  ends  and 68% homology with M.  nucleotides  halobium  that  regions  respective  estimates  3'  archaebacterial  defined  sequence  and  with  believed  another  with E. coli  5'  located  include  transcript (1,  duplex  long  and  23S  genes  nearly  form  23S  rRNAs  perfect  duplex structures  specific from  inverted  with the  16S  the  be  from the  duplex  duplex  repeats and 23S  in  extended after  brief  repeat  structure  in  are  which  transcript. By H.  rRNA  (Figure  sequences the  primary  sequences protruding  structures  ribonuclease  nearly their  flanking regions  mature  primary  long from  inverted  16S and 23S  of  141 nucleotides  can  perfect  14, 39, 94). These  sequences  23 and  residues  with the  are  structures  nearly  double-strand and  genes  between  additional  similar 16S  rRNA  cutirubrum  substrates  for  liberates  the  analogy  with  probably  also  sequences protruding as  64 2L  Figure 21: Nucleotide M.  The M. (  vannielii  5' and  vannielii  and  in  proximal and  3'  the  H.  of  23S  cuti rubrum  nuclease mapping.  H.  of  rRNA  bases). The gap  the  between  E.  coli,  H.  cutirubrum  and  23S rRNA genes.  100 nucleotides ends  homology  3' sequences  (bottom)  *, conserved  sequence  of  E.  genes  (top), H.  are  M.  cutirubrum  is  sequence  about  vannielii 23S  cuti rubrum  aligned for  in the E. coli  sequence the  coli  rRNA  2600  maximum homology is 2642 nucleotides  nucleotides.  sequence gene  (middle), and  are  were  Only  the  available. The 5' estimated  by  S1  comparison o f 5' and 3'  A  end of  23S rRNA gene among E. c o l i  ( t o p ) , H. cut i rubrum (middle) and M. v a n n i e l I 1 (bottom)  10 20 30 40 50 60 70 80 90 100 GGTTAAGCGACTAAGCGTACACGGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGATAAGCGTCGGTAAGGTGATATGAACCGTT •  **  *******  *  ***  +  *****************************  *  **  *  ***+ *  *  *****  + * * * ** + *  * *  *  CAACGTGGCTAC TGTGCCACCTGGTGGATAGCTCGGCTCGGAT-GCCGACGAAGGACGTGCCAAGCTGCGATAAGCCTGAGGGAGCCGCACGG-AGGCTA *.  *  •*t  f  *• * * * * * *  *  * •.  *+ *  **********  ****************  **  **  AAT TT T ATCTATT ACCCT ACCTGGGGAA TGGCTTGGCTTGAAACGCCGATGAAGGACGTGGTAAGCTGCGATAAGCCTAGGCGAGGCGCATAC-AGCCTT 110 120 130 140 150 160 170 180 190 200 ATAACCGGCGATTTCCGAATGGGGAAACCCAGTGTGTTTCGACACACTATCATTAACTGAATCCATAGGTTAATGA--GGCGAACCGG-GGGAACTGAAACAT **«* ***• + «••**»*•***** * * * * * * *. ** * * ** * * * * * **** *** * AGAACTCAGGATCTCCTAATGGG AATCCCTATAACAATTGCCTTGC GCAATGGGGAACGGCCGGAATTGAAGCATCTCAGTACGGCCAGGAAGAGAAATCG  C. A.  2850 2860 , 2870 2880 2890 2900 ...TAAGCGCAGCGATGCGTTGAGCTAACCGGTACTAATGAACCGTGAGCTTAACCTT * ****** ******* * ******* * * ...TCGAGGCAACGAGACGTTTAGCCCGCGAGTACTAACAGGTCAATGCCAC  CD  65 a.  Figure 22: Sequences flanking the 16S rRNA gene and the 23S rRNA gene. The rRNA  gene  helical the  sequences  duplex region  gene  mature  16S  potentially  rich  in  of  each  or are  at  23S 23S  rRNA  mature  base  inverted repeat  rRNA  within  structures. The  the  perfect  and  16S  sequences  the  (right) are  long nearly  rRNA  surrounding  gene. The are  an  23S  rRNA  gene  secondary of  these  (left)  structures flank  position  5'  loop  (  of );  the the  may  be  the  the  up to  23S  extended  results  from  both the  and  mature  protruding from  sequence  and  structure. The  sequences which  indicated  extended  rRNA  3'  ends  16S  and  top  of  four  16S of 23S these  nucleotides  longer than indicated on either or both of the 5' and 3' ends. The positions corresponding the Sal\  site  and therefore  to  the  5'  (nucleotide not part of  32  P-labeled  at  1973), which  the  Taq\  site  (nucleotide  were not protected in S1  mature rRNA, are  indicated by  •  .  1941) and experiments  65  c "u„ C A, ' br-  G U G U G G U U G A G U A C C A U A M I I I I I I I T " U A C A C C G A C A  fl  .|C  •"CU  A  u  G  CAG  c •-  u"  1  -  TVTT? C AC C G A  S  c c A  A  A A  3'  A-U  C-G «  *  U  C  A G U C U U G G U  G  C  ^_ A A A U U C C G G U U G  -  I I I I  i  * U  C  G U G U C C C  . U C C U C C  C C  A A  G  C  C  J  G  .  U C  G-C U-A G-C AC-G U  A — - «  ^ .,'  . C A C A G G G A A U C G U G U-A A G A  A-U G-C U-A G-C G-C U-A G-C U-A G'U  16 S  G U C A G A A C C A  C  G A G  A  C U G G A G C G  C U C C-A  G A C C U C G  A  C  C G U G A C U A A C A G C G C U C A C C A U U. C A C U G AU  U G U C A G  U A  U-A  G A G U G G U G . C C-G A-U  C AG-C C-G A-U  C-G U-A C-G  U-A C-G A-U A-U ' G-C ' A-U C-G C-G  G G—C A U-A U-A U-A G-C G-C U-A A-U G-C U-A U-A  C-G G-C U-A G-C A-U A-U U-A  C-G C-G  A-U U-A  U G G A A U C U G  G  A C C C U C C C  U A G G G A C G U G C G A U  A  C G C C G A C G  23S  66 large  loops;  RNase  III  RNase the  initial  E.  the  coli  repeat III  processing  the  inverted repeat secondary  large  ends  repeat  structures  end-labeled  duplex  reminiscent  out  to  these  component the  degraded in the  if  sequence  eucaryotic  during  is analogous S1  and  The  mature  5'  total  processing  (nucleotide  end  the Sa/I  site, and  The  flanking  5'  component  of the  of  rRNA  5.8S  the and  contrast,  well  removed  between contains  rRNA  the some  (147).  In  in sequence and  RNA  from  H.  if  it  is  utilizing  end of  preserved  as  indicated  that  neither  1939) or the Sal\  site  (nucleotide  it  rRNA  is  a  the 5.8S  5' nor  3'  1969)  is concluded that;  was  not  were  cutirubrum  mature  cut  structure  experiments  flanking the  or  result  23S  sequence  is no endonuclease  protection  5' sequence  ribosome. The  site  Taq\  within  ends. In are  an  rRNAs.  located  rRNAs  The  by  an endonuclease cut from the 5' end of  Nuclease  the  out  complementary)  ends of the 23S  protected by total RNAs, and therefore  2.  are  mature  cuti rubrum  structure.  rRNA  fragments  determine  like  labeling at  is  23S  rRNA.  restriction  rRNA  1.  gene  therefore  to  of  is derived by  5.8S  23S  was  H.  23S  carried  16S and 23S  ribosomal subunit RNA. In eubacteria, there  eucaryotic  carried  of  presumably  are  close  duplex and the mature  so that the 5' end of the to  the  (and  very  is  the precursor  of  structure  mature  eucaryotes, this RNA the  ends  occurs  inverted  event  liberates  mature  duplex  corresponding  from  processing  like enzyme which  In inverted  the  located  preserved  large ribosomal subunit.  downstream  as  a  5.8S  from  like  67  Transfer RNA  genes  Within which,  the  when  structure tRNA  transcribed,  containing  sequence,  (nucleotide alanine G-C,  tRNA  G-C  Unusual,  the  shares  and  isoleucine  with all  G-U of  tRNA  Bacillus  base any is  as  in all  and was  H.  to  archaebacteria in  the  sequenced.  features  nucleotide  hypothesis  first  sequence  is unusual  the  was  feature  contains not  tRNA  16S-23S  et  tRNA  of  all  sequence reported  cuti rubrum  the of  the  A  coli same in  different 1983  (41)  shows  84%  al.,  also  due  an  spacers  tRNA  thesis. Gu et al.  (125).  with  with  (49).  decoding properties  position  acceptor  in E.  intergenic  Gu  spacer  feature  spacers  gene  A  contiguous  associated  vannielii by  23).  the  this  leaf  cutirubrum  of  of  anticodon. That  in this  (Figure 16S-23S  positions  sequenced  in the  clover  to  suggested a  paucity  archaebacterial  tRNA  vannielii  and  the  thesis  make  this  5S  gene  anticodon. This  tRNA  in the dihydrouracil  stem  in  M. this  uncertain.  putative  (nucleotides  H.  alanine  Methanococcus  unusual  alanine  of  the  containing  sequenced  the  tRNAs  family  of  sequences  anticodon. This H.  tRNA  in one  anticodon  long  alanine  a CGC  have  tRNAs  is  152). A n  two  universal  gene  cuti rubrum  may  of  terminal  acid  a  are  tRNA  species,  DNA  However,  DNA  76,  contain  with the  the  there  forming  alanine  in  the  identified  from  shown  homology  A  of  509  amino  other  (64,  archaebacterial  with  been  tRNA  pairs  that  subti/is  related  alanine  the  other  other  a  U  cluster  conserved  within  has  of  gene  capable  highly  anticodon  that  are  located  however,  alanine  RNA  1575-1651), contains a UGC alanine  stem; no tRNA  and  ribosomal  tRNA  sequence  was  found  D395-D468) and contained a G C A in that  16 bases  ribonucleotide  in  it contains only the  dihydr&uracil  sequence has recently  two  located cysteine  base pairs  loop.  A  cysteine  distal  tRNA  to  the  with  been characterized from H.  a  similar  volcanii  but  68  a  Figure 23: Cloverleaf structure of putative alanine and cysteine tRNAs. The putative the  tRNA  16S-23S  sequence DNA  nucleotide  is  sequence intergenic located  sequences lack  the mature  sequence  tRNA.  are  universal  illustrated. The  space  distal  and  to  (nucleotides the  5S  rRNA  cloverleaf  alanine  structure  sequence  2152-2229) (nucleotides  and  is the  of  located  two in  cysteine  D395-D496). Both  the conserved C C A sequence at the 3' acceptor end of  68  < ^  o  <  ZD  ZD  3  u-o O  — O  O - O  <  o-o = o o-o  O 3  < o o o o< u 1 I I I I o o o o u o _ ^ 0  I I I I I I I o o o < <o o  o  =>  >s  U  o - o  < <  < o  ZD O  3  CJ  o O o o  <.  o  <  ZD ZD  3  U - O CJ—O  o-o <-=>  O  O - O 0  0  3  0  0  0  =3  °  <  3  o < o o 1 I I I I O O 3 o o  0  1 1 * 1 1 1 1 o o o o u o < o  < O  '  O 3 -  o< o 3  3  •o -< •o  o  o  o 3  <  69 its  coding  sequence  has  not  been  identified  (Woese  and  Gupta,  personal  communication). Neither the  3'  end  implies  tRNA of  that  maturation  gene  mature these  contains  tRNAs  the  above  nucleotides  universal the  are  7  CCA  base  added  trinucleotide  pair  by  a  found  acceptor  stem;  nucleotidyl  at this  transferase  system.  Terminator sequences There function  are  in  followed  two  potential  transcription by  T  position  rho-independent termination are of  13 base them  G-C  pairs  are  pairings  system  (in  of  expression of  second terminator-like  the  is  3'  flanking  first  is  the  bacteriorhodopsin  symmetry rich  overlapping  region;  stem  is not very to  transcription  tRNA  gene  gene  of  symmetry G/C  cutirubrum  H.  base  termination  but  contains  pairs,  occurs site  near  in  relative  a  very by the  Shimmin, unpublished results).  the  to  G/C an  of  a  A/T  to  almost  from  the by  the  rich  A/T  beginning  HL20 L12  E. coli  of  region the  T  the  rRNAs.  The  an A / T rich terminator of  dyad  an A / T  A  strong  ribosomal  protein  (21).  gene)  including 6  reduce  by  sequence, including  rich  are  region  region  the  all  gene. The  limited  rich  coli  E.  site would  tRNA  repeat  because only 7  G/C residues and followed  downstream  (equivalent  followed  occurs  consists  the  may  24). Although there  a G/C rich region followed  10 consecutive  termination  to  stable  at this  that  inverted  in which  E. coli  termination  mRNA  termination  short  analogus  region (D544-D604) located distal to the cysteine of  a  sequence  (47, 103, 110; Figure  cysteine  signal  The  contrast  pairings). Partial or complete  level  the  D302-D337,  in the stem, the  G-C  in  termination.  at  f  sites  sequence  lacks  dyad  9  consecutive  a  T  6  stretch;  pennis  and  70  a.  Figure 24; An inverted repeat termination-like signal. An  inverted  illustrated. This 4  nucleotides  resembles 110).  a  repeat  inverted and  typical  a  found repeat  13  base  eubacterial  at  18 nucleotides  (nucleotides pair  stem  beyond  the  D303-D332) contains followed  rho-independent  by  U .  termination  5  5S  gene  is  a  loop  of  This  structure  signal  ( 4 7 , 103,  70  G  5  A  U  G A C G A C A A G C U U C G  — — — — — — — — —  U G C U G U  u c G  •G •G  — —  G C U U U U U G C A ' 3  71  Unique copy of ribosomal RNA Genomic copy  of  Southern  each  of  rRNA unique  sequence  is  cutirubrum  grows  very  therefore,  a  single  promoters  is  probably  of  ribosomes  bacterial  cells  proteins  at  DNA  gene  5',  were  the  3'  flanking  3'.  distal  rRNA  the  alanine 16S  to  the  and  the  in  H.  and the region The  5S and  rRNA  sequences which rRNAs.  sequence  three  produce  a  at  one  37°C,  about  H.  six  hours;  tandem  repeat  sufficient  synthesis.  number  Indeed  these  synthesizes  ribosome (Dennis  sequence tRNA 23S  5S  and Chant,  rRNA  are  presumably  gene.  used for  a  bipartite  direct  5S  components rRNA  a  cysteine  gene  of  repeat of  signals  the  this  the  which  were  extensive  23S gene  are:  5'  sequences intergenic  (anticodon  sequences  by  the  in  tRNA  complete  genes  RNA-like  located  unique  of  of  rRNA  transfer  UGC)  surrounded  of  the  the  termination  sequence  flanking  intergenic  Putative  flanking  important  region  and  5'  be  the  of  the  achieved. The sequence  data, two  The  copies to  are  was  of  rRNAs, partial  (anticodon  rRNA  genes  characterization  arrangement  23S  believed  with  only  presumptive  medium of  protein  cuti rubrum  16S  perfect  for  molecular  processing, initiation, and  these  to  rich  is  the  time  genes  adequate  transcript and  doubling  rate for the E. coli  16S  From  between  located  a  In  there  Even  cutirubrum.  cluster.  demand  cluster  of  found—an  region  the  the  determined.  16S-23S-5S were  the than  investigation,  RNA  and  cluster  satisfy  H.  this  with  of  more  in  indicated  results).  sequence  rRNA,  to  have  appear to be rich in ribosomes and the ribosome  this  ribosomal  gene  slowly  copy  10-20% of  unpublished  In  to  hybridizations  the  promoter  genes  GCA)  resemble  detected. inverted  The  repeat  processing and maturation  the  gene  unit  cluster  which  contains  the Halobacterium  contains  an  contains  inverted  three  sequences  promoter. The repeat  of  3'  followed  by T  5  which resembles the rho-independent termination  signal in E.  coli.  73  REFERENCES  1.  Abelson, J. (1979) RNA processing and problem. Ann. Rev. Biochem. 48:1035-1069.  2.  Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H.L., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.M., Smith, A.J.H., Staden, R. and Young, I.G. (1981) Sequence and organization of the human mitochondrial genome. Nature 290:457-465.  3.  Bachmann, B.J. and Low, K.B. (1980) Linkage K-12, edition 6. Microbiol. Rev. 44:1-56.  4.  Batch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R. and Wolfe, R.S. (1979) Methanogens: Reevaluation of a unique biological group. Microbiol. Rev. 43:260-296.  5.  Barker, H.A. (1956) Bacterial Wiley and Sons, Inc.  6.  Bayley, H., Huang, K.S., Radhakrishnan, R., Ross, A.H., Takagaki, Y., and Khorana, H.G. (1981) Site of attachment of retinal in bacteriorhodopsin. Proc. Natl. A c a d . Sci. U S A 78:2225-2229.  7.  Bayley, S.T. and Morton,. R.A. (1978) Recent developments in the molecular biology of extremely halophilic bacteria. CRC Crit. Rev. Microbiol. 6:151-205.  8.  Bayley, S.T. (1966) Composition of ribosomes halophilic bacterium. J . M o l . Biol. J5-.420-427.  9.  Bedbrook, J.R., Kolodner, R. and Bogorad, L. (1977) Zea mays chloroplasts ribosomal RNA genes are part of a 22,000 base pair inverted repeat. Cell 11:739-749.  10.  Bell, G.I., Degennaro, L.J., Gelfand, D.H., Bishop, R.J., Valenzuela, P. and Rutter, W.J. (1977) Ribosomal RNA genes of Saccharomyces cerevisiae. I. Physical map of the repeating unit and location of the regions coding for 5S, 5.8S, 18S and 25S ribosomal RNAs. J. Biol. Chem. 252:8118-8125.  11.  Benton, W.D. and Davis, R.W. (1977) Screening of recombinant by hybridization to single plaques in situ. Science 196:180-182.  12.  Berkner, K.L. and Folk, W. R. (1977) reaction. J . Biol. Chem. 252:3175-3184.  13.  Blatti, S.P., Ingles, C.J., Lindell, T.H., Morris, P.W., Weaver, R.F., Weinberg, F. and Rutter, W.J., 1970. Structure and regulatory properties of eukaryotic RNA polymerase. Cold Spring Harbor Symp. Quant. Biol. 35:649-658.  fermentations,  the  intervening  map  of  Escherichia  pp.1-95. New  Polynucleotide  of  sequence  York,  an  kinase  coli  John  extremely  clones  exchange  74 14.  Bram, R.J., Young, R.A. and Steitz, J.A. (1980) The ribonuclease III flanking 23S sequences in the 30S ribosomal precursor RNA of E. Cell 19:393-401.  15.  Brosius, J., Dull, T.J., Sleeter, D.D. and Noller, organization and primary structure of a ribosomal Escherichia coli. J . Mol. Biol. 148:107-127.  16.  Brosius, J., Dull, T.J. and Noller, sequence of a 23S ribosomal RNA Natl. A c a d . Sci. U S A 77:201-204.  17.  Campbell, G.R., Littau, V.C., Melera, P.W., (1979) Unique sequence arrangement palindromic rRNA molecule of Physarum 6:1433-1447.  18.  Clarke, L. and Carbon, J . (1976) A El hybrid plasmids representative 9:91-99.  19.  Collins, J., Fiil, N.P., Jcfrgensen, P. and Friesen, J.D. (1976) In; Control of ribosome biosynthesis. (Kjeldgarrd, N.O. and Maaltfe, O., eds.), pp.356-367. Munksgaard, Copenhagen, Denmark. #  20.  Darland, G., Bock, T.D., S a m s o n o f f , W. and Conti, S.F. (1970) A thermophilic acidophilic mycoplasma isolated from a coal refuse pile. Science 170:1416-1418.  21.  DasSarma, S., RajBhandary, U.L. and Khorana, H.G. (1984) Bacterio-opsin mRNA in wild-type and bacterio-opsin-deficient Halobacterium halobium strains. Proc. Natl. A c a d . Sci. U S A 8J..-125-129.  22.  de Boer, promoter  H.F. gene  H.F. RNA  (1981) operon  (1980) Complete from Escherichia  site coli.  Gene from  nucleotide coli. Proc.  Alfrey, V.G. and Johnson, of ribosomal genes in polycephalum. Nucl. Acids  E.M. the Res.  colony bank containing synthetic Col of the entire E. coli genome. Cell  H.A., Gilbert, S.F. and Nomura, M. (1979) DNA sequence of regions for rRNA operons rrnE and rrnA in E. coli. Cell  12:201-209. 23.  de Rosa, M., Gambacorta, A., Nicolaus, B.,  Sodano, S.  and  Bu'lock,  (1980) Structural regularities in tetraether lipids of Caldariella and biosynthetic and phyletic implications. Phytochemistry 19:833-836.  J.D.  their  24.  de Rosa, M., de Rose, S., Gambacorta, A., Minale, L., and Bu'lock, J.D. (1977) Chemical structure of the ether lipids of thermophilic acidophilic bacteria of the Caldariel la group. Phytochemistry 16:1961-1965.  25.  Doolittle, W.F., Sapienza, C., Hofman, J.D., MacKay, R.M., Cohen, A . and Xu, W.L. (1983) In: Genetic Engineering. (Setlow, J.K. and Hollaender, A., eds.), Vol.5, Plenum New York.  26.  Douglas, C, Achatz, F. and Bock, A. (1980) Electrophoretic characterization of ribosomal proteins from Methanogenic bacteria. Zbl. Bakt. Hyg., I. Abt. Orig. CJ.:1-11.  27.  Drouin, J . (1980) Cloning of coli. S. M o l . Biol. 140:15-34.  human  mitochondrial  DNA  in  Escherichia  75 28.  Dunn, R., M c C o y , J., Simsek, M., Majumdar, A., Chang, S.H., RajBhandary, U.L. and Khorana, H.G. (1981) The bacteriorhodopsin gene. Proc. Natl. Acad. Sci. U S A 78:6744-6748.  29.  Erdmann, V.A., Huysmans, E., (1983) Collection of published Nucl. A c i d s Res. JJ.:r105-r133.  30.  Erickson, J.M., Rushford, C.L., Dorney, D.J., Wilson, G.N. and Schmickel, R.D. (1981) Structure and variation of human ribosomal D N A ; Molecular analysis of clones fragments. Gene 16:1-9.  31.  Favaloro, J., Treisman, R. and Kamen, R. (1980) Transcription maps polyoma virus-specific RNA: Analysis by two-dimensional nuclease gel mapping. Methods in Enzymol. 65:718-749.  32.  Fitch, W.M. and Margoliash, trees. Science 155:279-284.  33.  Fox, G.E., Luehrsen, K.R. and W o e s e , C.R. (1982) Archaebacterial ribosomal RNA. Zbl. Bakt. Hyg., I. Abt. Orig. C3:330-345.  34.  Fox, G.E., Stackebrandt, E., Hespell, R.B., Gibson, J., Maniloff, J., Dyer, T.A., Wolfe, R.S., Balch, W.E., Tanner, R.S., Magrum, L.J., Zablen, L.B., Blakemore, R., Gupta, R., Bonen, L., Lewis, B.J., Stahl, D.A., Luehrsen, K.R., Chen, K.N. and W o e s e , C.R. (1980) The phylogeny of prokaryotes. Science 209:457-463.  35.  Fox, G.E., Pechman, K.R. and Woese, C.R. (1977) Comparative cataloging of 16S rRNA: Molecular approach to prokaryotic systematics. Int. J . System. Bacteriol. 27:44-57.  36.  Fuch, S.G. and Stupperich, E. (1982) Autotrophic C 0 fixation pathwey in Methanobacterium thermoautotrophicum. Z b l . Bakt. Hyg., I. Abt. Orig. C3:277-288.  37.  Fuch, S.G. and Stupperich, E. (1980) Acetyl C o A , a central intermediate of autotrophic C 0 fixation in Methanobacterium thermoautotrophicum. Arch. Microbiol. 127:267-272.  Vandenberghe, A . and 5S and 5.8S ribosomal  G.  (1967)  Construction  de Wachter, R. RNA sequences.  of  of Si  phylogenetic 5S  2  2  38.  Gauss, D.H. and Sprizl, M. (1983) Acids Res. 1_1:r1-r103.  Compilation of  tRNA  39.  Gegenheimer, P. and Apirion, D. (1981) ribonucleic acid. Microbiol. Rev. 45:502-541.  40.  Goldberg, D.A. (1980) Isolation and partial characterization of Drosophila alcohol dehydrogenase gene. Proc. Natl. A c a d . Sci. 72:5794-5798.  41.  Gu, X.R., Nicoghosian, K., Cedergren, R.J. and Wong, J.T.F. (1983) Sequences of halobacterial tRNAs and the paucity of U in the first position in their anticodons. Nucl. A c i d s Res. 11:5433-5442.  Processing  sequences. Nucl. of  procaryotic the USA  76 42.  Gupta, R., Lanter, J.M. and Woese, C.R. (1983) Sequence of the 16S ribosomal RNA from Halobacterium vo/canii, an archaebacterium. Science 221:656-659.  43.  Hahn, U., Lazarus, C.M., Lunsdorf, H. and for mitochondrial 24S ribosomal RNA 17:191-200.  44.  Hilpert, R., Winter, J., Hammes, W. and Kandler, O. (1981) The sensitivity of archaebacteria to antibiotics. Zbl. Bakt. Hyg., I. Abt. Orig. £2:11-20.  45.  Hofman, J.D., Lau, R.H. and Doolittle, W.F. (1979) The number, physical organization and transcription of ribosomal RNA cistrons in an archaebacterium: Halobacterium halobium. Nucl. Acids Res. 7:1321-1333.  46.  Hohn, B. (1979) In vitro Enzymol. 68:299-309.  47.  Holmes, W.M., Piatt, T. and Rosenberg, transcription in E. coli. Cell 32:1029-1032.  48.  Holzer, G., Oro', J . and Tornabene, T.G. (1979) Gas chromatographic mass spectrometric analysis of neutral lipids from methanogenic and thermoacidophilic bacteria. J . Chromatogr. 186:795-809.  49.  Jarsch, M. and Bock, A . (1983) DNA sequence of the 16S rRNA/23S rRNA intercistronic spacer of two rDNA operons of the archaebacterium Methanococcus vannielii. Nucl. Acids Res. 11:7537-7545.  50.  Jarsch, M „ Altenbuchner, J . and Bock, A . (1983) Physical organization of the genes for ribosomal RNA in Methanococcus vannielii. M o l . Gen. Genet. 189:41-47.  51.  Jones, J.B., Bowers, B. and Stadtman, T.C. (1977) Methanococcus vannielii; Ultrastructure and sensitivity to detergents and antibiotics. J . Bacteriol. 130:1357-1363.  52.  Kagramanova, V.K., Mankin, A.S., Bratova, L A . and Bogdanov, A . A . (1982) The 3' terminal nucleotide sequence of the Halobacterium halobium 16S rRNA. FEBS Letters 144:177-180.  53.  Kaine, B.P., Gupta, R. and Woese, C.R. (1983) Putative introns in genes of prokaryotes. Proc. Natl. A c a d . Sci. USA 80:3309-3312.  54.  Kander, 0. (1982) Cell wall structures and their implications. Zbl. Bakt. Hyg., I. Abt. Orig. C3:149-160.  55.  Kandler, 0. and peptidoglycan-free 118:141-152.  56.  Karn, J., Brenner, S. and Barnett, L. (1983) New bacteriophage Lambda vectors with positive selection for cloned inserts. Methods in Enzymol. 101:3-19.  packaging  Kuntzel, H. (1979) Split of Neurospora crassa.  gene Cell  of X and cosmid DNA. Methods M.  (1983)  Termination  in of  tRNA  phylogenetic  Konig, H. (1978) Chemical composition of the cell wells of methanogenic bacteria. Arch. Microbiol.  77 57.  Karn, J., Brenner, S., Barnett, L. bacteriophage "X cloning vector. 7_7:5172-5176.  and Cesareni, G. (1980) Proc. Natl. Acad. Sci.  Novel USA  58.  Kates, M. (1978) The phytanyl ether-linked polar—iipids and isoprenoid neutral lipids of extremely halophilic bacteria. Progr. Chem. Fats Other Lipids 15:301-340.  59.  Kates, M., Yengoyan, L.S. and Sastry, P.S. (1965) phosphatidyl glycerophosphate in Halobacterium Biophys. Acta 98:252-268.  60.  Kessel, M. and Klink, F. (1982) Identification and comparison of eighteen archaebacteria by means of the diphtheria toxin reaction. Zbl. Bakt. Hyg., I. Abt. Orig. C3;140-148.  61.  Kessel, M. and Klink, F. (1980) Archaebacterial elongation ADP-ribosylated by diptheria toxin. Nature 287:250-251.  62.  Khorana, H.G., Gerber, G.E., Herlihy, W.C., Gray, C.P., Anderegg, R.J. Nihei, K. and Biemann, K. (1979) Amino acid sequence of bacteriorhodopsin. Proc. Natl. A c a d . Sci. U S A 76:5046-5050.  63.  Konig H., Kralik, R. and Kandler, O. (1982) Structure and of pseudomurein in Methanobacteriales. Zbl. Bakt. Hyg., C3:179-191.  64.  Kossel, H., Edwards, K., Loch, W., Langridge, P., Schiefermayr, E., Schwartz, Z., Strittmatter, G. and Zenke, G. (1982) Structural and functional analysis of an rRNA operon and its flanking tRNA genes from Zea mays chloroplasts. Nucl. Acids Res. symposium series U:117-121.  65.  Kramer, R.A., Philippsen, P. and Davis, R.W. (1978) Divergent transcription in the yeast ribosomal RNA coding region as shown by hybridization to separated strands and sequence analysis of cloned DNA. J . M o l . Biol. 123:405-416.  66.  Kuchino, Y., Ihara, M., Yabusaki, Y. and tRNAs from archaebacteria show characteristics. Nature 298:684-685.  67.  Kohn, S., Fritz H.J. and Starlinger, P. integration sites in the leader sequence Mol. Gen. Genet. 167:235-241.  68.  Kontzel, H. (1982) Phylogenetic trees derived from mitochondrial, nuclear, eubacterial and archaebacterial rRNA sequences: Implications on the origin of eukaryotes. Zbl. Bakt. Hyg., I. Abt. Orig. C3;31-39.  69.  Kwok, Y. and Wong, J.T.F. (1980) Evolutionary relationship Halobacterium cutirubrum and eukaryotes determined by aminoacyl-tRNA synthetases as phylogenetic probes. Can. J . 58:213-218.  A diether analog of cuti rubrum, Biochim.  factor  is  modifications I. Abt. Orig.  Nishimura, S. (1982) Initiator common unique sequence (1979) Close vicinity of the gal operon of  of IS1 E. coli.  between use of Biochem.  78  70.  Langworthy, T.A. (1982) Lipids of bacteria environments. Curr. T o p . Membr. Transp. 17:45-77.  living  in  extreme  71.  Langworthy, T.A., Tornabene, T.G. and Holzer, G. (1982) archaebacteria. Zbl. Bakt. Hyg., I. Abt. Orig. C3:228-244.  72.  Langworthy, Thermoplasma  73.  Langworthy, T.A., Mayberry, W.R. and diether and polyol dialkyl glycerol acidocaldarius. J . Bacteriol. 119:106-116.  74.  Langworthy, T.A., Smith, Thermoplasma acidophi Ium.  75.  Lehrach, H., Diamond, D., Wozney, J . M . and Boedtker, H. (1977) RNA molecular weight determinations by gel electrophoreis under denaturing conditions, a critical reexamination. Biochem. 16:4743-4751.  76.  Loughney, K., Lund, E. and Dahlberg, J.E. (1982) tRNA genes are found between the 16S and 23S rRNA genes in Bacillus subtilis. Nucl. A c i d s Res. 10:1607-1623.  77.  Maniatis, T., Fritsch, E.F. and Sambrook, J . (1982) In: Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.  78.  Maniatis, T., Hardison, R.C., Lacy, E., Lauer, J., O'Connell, C., Quon, D., S i m , G.K. and Efstratiadis, A . (1978) The isolation of structural genes from libraries of eucaryotic DNA. Cell 15:687-701.  79.  Margulis, L. (1981) Symbiosis San Francisco.  80.  Margulis, L. New Haven.  81.  Matheson, A.T. and Yaguchi, M. (1982) The evolution of archaebacterial ribosome. Zbl. Bakt. Hyg., I. Abt. Orig. C3_:192-199.  82.  Maxam, A . M . and Gilbert, W. (1977) Sequencing end-labeled DNA with base-specific chemical cleavages. Methods in Enzymol. 65:499-560.  83.  Mayberry-Carson, K.J., Langworthy, T.A., Mayberry, W.R. and Smith, P.F. (1974) A new class of lipopolysaccharide from Thermoplasma acidophi Ium. Biochim. Biophys. Acta 360:217-229.  84.  McBride, B.C. and W o l f e , R.S. (1971) A new transfer, coenzyme M. Biochem. 10:2317-2324.  85.  McMaster, G.K. and Carmichael, G.G. (1977) Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Natl. A c a d . Sci. USA 74:4835-4838.  Lipids  T.A. (1977) Long-chain diglycerol tetraethers acidophiIum. Biochim. Biophys. A c t a 487:37-50.  (1970)  Origin  of  from  Smith, P.F. (1974) Long chain triether lipids of Sulfolobus  P.F. and Mayberry, W.R. (1972) J . Bacteriol. 112:1193-1200.  in cell  of  evolution. Freeman  eukaryotic  cells.  Yale  Lipids  of  W.H. and Co.,  University  coenzyme  of  Press, the  methyl  79  86.  Messing, J . 101:20-78.  (1983)  New  M13  vectors  for  cloning. Methods  in Enzymol.  87.  Messing, J . and Vieira, J . (1982) A new pair selecting either DNA strand of double-digest Gene 19:269-276.  88.  Moore, R.L. and McCarthy, B.J. (1969) Base sequence renaturation studies of the deoxyribonucleic acid halophilic bacteria. J . Bacteriol. 99:255-262.  89.  Moore, R.L. and McCarthy, B.J. deoxyribonucleic acid of various Bacteriol. 99:248-254.  90.  Morgan, E.A., Ikemura, T., (1978) Some rRNA operons ends. Cell 13:335-344.  91.  Muller, R., Garrett, K.A. and Noller, H.F. RNA binding site of ribosomal proteins 254:3873-3878.  92.  Nazar, R.N., Matheson, A.T. and sequence of Halobacterium cutirubrum Biol. Chem. 253:5464-5469.  93.  Neumann, H., Gierl, A., Tu, J., Leibrock, J., Staiger, D. and Zillig, W. (1983) Organization of the genes for ribosomal RNA in archaebacteria. M o l . Gen. Genet. 192:66-72.  94.  Noller, H.F. and W o e s e , C.R. (1981) ribosomal RNA. Science 212:403-411.  95.  Noller, H.G., Kop, J., Wheaton, V., Brosius, J., Gutell, R.R., Kopylov, A.M., Dohme, F., Winship, H., Stahl, D.A., Gupta, R. and Woese, C.R. (1981) Secondary structure model for 23S ribosomal RNA. Nucl. A c i d s Res. 8:6167-6189.  96.  Oesterhelt, D. and Stoeckenius, W. (197). Functions of a photoreceptor membrane. Proc. Natl. A c a d . Sci. U S A 70:2853-2857.  97.  Orozco, E.M., Gray, P.W. and Hallick, R.B. (1980) Euglena gracilis chloroplast ribosomal RNA transcription units. I. The location of transfer RNA, 5S, 16S and 23S ribosomal RNA genes. J . Biol. Chem. 255:10991-10996.  98.  Osinga, K.A. and Tabak, H.F. (1982) Initiation of transcription of genes for mitochondrial ribosomal RNA in yeast: Comparison of the nucleotide sequence around the 5'-ends of both genes reveals a homologous stretch of 17 nucleotides. Nucl. Acids Res. 10:3617-3626.  of M13 vectors for restriction fragments. homology and of extremely  (1969) Characterization of the strains of halophilic bacteria. J.  Lindahl, L., Fallon, A . M . and Nomura, M. in E. coli have tRNA genes at their distal (1979) The structure of the S8 and S15. J . Biol. Chem.  Bellemare, ribosomal  G. 5S  Secondary  (1978) Nucleotide ribonucleic acid. J .  structure  of  16S  new  80 99.  Pecher, T. and Bock, A . (1981) In'vivo susceptability of halophilic and methanogenic organisms to protein synthesis inhibiters. FEMS Microbiol. Letters 10:295-297.  100. Pfeifer, F., Betlach, M., Martienssen, R., Friedman, J . and Boyer, (1983) Transposable elements of Halobacterium halobium. Mol. Genet. 191:182-188. 101. Pfeifer, F., Weidinger, G. and Goebel, W. (1981) Halobacterium halobium. J . Bacteriol. 145:375-381.  Genetic  102. Planta, R.J., Meyerink, J.H. and Klootwij, K.J. (1979) In: pp.401- 411. Pergamon Press, Oxford and New York. 103. Piatt, T. (1981) Termination of transcription tryptophan operon of E. coli. Cell 24:10-23.  and  its  H.W. Gen.  variability Gene  in  function,  regulation  in  the  104. Price, R. and Penman, S. (1972) A distinct RNA polymerase activity synthesizing 5.5S, 5S and 4S RNA in nuclei from adenovirus 2 infected HeLa cells. J . M o l . Biol. 70:435-450. 105. Rawson, J.R.Y., Kushner, S.R., Vapnek, D., A l t o n , N.K. (1978) Chloroplast ribosomal RNA genes in Euglena three clustered tandem repeats. Gene 3:191-209. 106. Reeder, R.H. and Roeder, R.G. (1972) isolated nuclei. J . Mol. Biol. 62:433-442.  Ribosomal  and Boerma, C.L. gracilis exist as RNA  synthesis  in  107. Retzel, E.F., Collet, M.S. and Faras, A.J. (1980) Enzymatic synthesis of deoxyribonucleic acid by the Avian retrovirus reverse transcriptase in vitro; Optimum conditions required for transcription of large ribonucleic acid templates. Biochem. 19:513-518. 108. Rigby, P.W.J., Dieckmann, M., Rhodes C. and Berg, P. (1977) Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J . M o l . Biol. 113:237-251. 109. Romesser, J.A. and Wolfe, R.S. (1982) CDR factor, a new coenzyme required for carbon dioxide reduction to methane by extracts of Methanobacterium thermoautotrophicum. Z b l . Bakt. Hyg., I. Abt. Orig. C3:27l-276. 110. Rosenberg, M. and the promotion and 13:319-353.  Court, D. (1979) Regulatory sequences involved in termination of RNA transcription. Ann. Rev. Genet.  111. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. A c a d . Sci. USA 74:5463-5467. 112. Sapienza, C , Rose, M.R. and Doolittle, W.F. (1982) High-frequency genomic rearrangements involving archaebacterial repeat sequence elements. Nature 299:182-185.  81 113. Sapienza, C. and Doolittle, W.F. (1982) Unusual the Halobacterium genome. Nature 295:384-389.  physical  organization of  114. Scheifer, K.H., Steber, J . and Mayer, H. (1982) Chemical composition and structure of the cell wall of Halococcus morrhuae. Zbl. Bakt. Hyg., I. Abt. Orig. C3:171-178. 115. Schmid, G. and Bock, A . (1982) The ribosomal protein composition of five methanogenic bacteria. Zbl. Bakt. Hyg., I. Abt. Orig. C3:347-353. 116. Schmid, G., Pecker, T.H. and Bock, A . (1982) Properties of the translational apparatus of archaebacteria. Zbl. Bakt. Hyg., I. Abt. Orig. C3:209-217. 117. Schnabel, H., Zillig, W., Pfaffle, H. (1982) Halobacerium halobium  M., Schnabel, R., Michel, H. and Delius, phage 0H. EMBO 1:87-92.  118. Schwartz, R.M. and Dayhoff, M.O. (1978) Origins of prokaryotes, eukaryotes, mitochondria, and chloroplasts. Science 199:395-403. 119. Searcy, D.G. and Whatley, F.R. membrane: Cytochrome b and Hyg., I. Abt. Orig. C3:245-257.  (1982) Thermoplasma acidophilum sulfate-stimulated ATPase. Zbl.  cell Bakt.  120. Searcy, D.G., Stern, D.B. and Green. G.R. (1978) Phylogenetic affinities between eukaryotic cells and a thermophilic mycoplasm. BioSystems 10:19-28. 121. Shine, J. and Dalgarno, L. (1974) The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: Complementarily to nonsense triplets and ribosome binding sites. Proc. Natl. A c a d . Sci. USA  21:1342-1346.  122. Simsek, M., DasSarma, S., RajBhandary, U.L. and Khorana, H.G. (1982) A transposable element from Halobacterium halobium which inactivates the bacteriorhodopsin gene. Proc. Natl. Acad. Sci. U S A 79:7268-7272. 123. Smith, P.F. (1980) Sequence and glycosidic bond arrangement of sugars in lipopolysaccharide from Thermoplasma acidophilum. Biochim. Biophys. Acta 619:367-373. 124. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J . M o l . Biol. 98:503-517. 125. Spinzl, M. and Gauss, D.H. (1982) Compilation of tRNA A c i d s Res. H); r1-r8l. 126. Stanier, R.Y. (1974) The origins of Soc. Gen. Microbiol. 24:219-242.  photosynthesis  sequences. Nucl.  in eukaryotes.  127. Stanier, R.Y. (1970) Organization and control in eukaryotic cells. Symp. Soc. Gen. Microbiol. 20:1-38.  prokaryotic  Symp. and  82 128. Stanier, R.Y. (1970) Some aspects of the biology of cells and their possible evolutionary significance. In; Organization and control in prokaryotic and eukaryotic cells. (Charles, H.P. and Knight, B.C.J.G., eds.), Cambridge University Press, Pergamon Press, Oxford. 129. Stern, D.B., Dyer, T.A. and Lonsdale, D.M. mitochondrial ribosomal RNA genes of 10:3333-3340.  (1982) Organization of the maize. Nucl. A c i d s Res.  130. Sternberg, N., Tiemeier, D. and Enquist, L. (1977) In vitro packaging of a \ Dam vector containing EcoRI DNA fragments of Escherichia coli and phage P1. Gene 1:255-280. 131. Stoeckenius, W. (1980) Purple membrane of Halobacteria; light-energy converter. A c c . Chem. Res. 13:337-344.  new  A  132. Taylor, J.M., lllmensee R. and Summers, J . (1976) Efficient transcription of RNA into DNA by Avian sarcoma virus polymerase. Biochim. Biophys. Acta 442:324-330. 133. Taylor, C.D. and Wolfe, R.S. (1974) Structure and methylation coenzyme M (HSCH CH S0 ), J . Biol. Chem. 249:4879-4885. 2  2  of  2  134. Thauer, R.K., Jungermann, K. and Decker, K. (1977) Energy conservation in chemotrophic anaerobic bacteria. Bacteriol. Rev. 41:100-180. 135. T h o m m , M., Stetter, K.O. and Zillig, W. (1982) Histone-like proteins Eu and Archaebacteria. Zbl. Bakt. Hyg., I. Abt. Orig. C3:128-139.  in  136. Thompson, J.F. and Hearst, J.E. coli 16S RNA. Cell 33:19-24.  E.  (1983) Structure-function  relations  in  137. Thurlow, D.L. and Zimmermann, R.A. (1982) Evolution of protein binding regions of archaebacterial, eubacterial and eukaryotic ribosomal RNAs. in; Archaebacteria. (Kandler, O., ed.), pp.347. Gustav Fischer, Verlag, Stuttgart. 138. Tisty, T.D., Albertini, A . M . and Miller, J.H. (1984) Gene the lac region of E. coli. Cell 37:217-224.  amplification  in  139. Tornabene, T.G. and Langworthy, T A . (1979) Diphytanyl and dibiphytanyl glycerol ether lipids of methanogenic archaebacteria. Science 203:51-53. 140. Tornabene, T.G. (1978) Non-aerated cultivation of cutirubrum and its effect on cellular squalenes. J . 11:253-257.  Halobacterium Mol. Evol.  141. Tornabene, T.G., Kates, M., Gelpi, E. and Oro', J . (1969) Occurrence of sequalene, d i - and tetra-hydrosqualenes and vitamin MK in an extremely halophilic bacterium Halobacterium cutirubrum. J . Lipid Res. 10:294-303. 8  83 142. Tu, J . and Zillig, W. the archaebacterium 10:7231-7245.  (1982) Organization of rRNA Thermoplasma acidophilum.  structural genes in Nucl. Acids Res.  143. Uchida, T., Bonen, L., Schaup, H.W., Lewis, B.J., Zablen, L.B. and Woese, C.R. (1974) The use of ribonuclease U in RNA sequence determination. J . M o l . Evol. 3:63-77. 2  144. Valenzuela, P., Bell, G.I., Venegas, A., Sewell, E.T., Masiarz, F.R., DeGennaro, L.J., Weiberg, F. and Rutter, W.J. (1977) Ribosomal RNA genes of Saccharomyces cerevisiae. II. Physical map and nucleotide sequence of the 5S ribosomal RNA gene and adjacent intergenic regions. J . Biol. Chem. 252:8126-8135. 145. Van Valen, L.M. and Maiorara, V.C. eukaryotic origins. Nature 287:248-250.  (1980)  The  archaebacteria  and  146. Vogels, G.D., Keltjens, J.T., Hutten, T.J. and Van der Drift, C. (1982) Coenzymes of methanogenic bacteria. Zbl. Bakt. Hyg., I. Abt. Orig. £3:258-264. 147. Walker, T.A. 33:320-322.  and  Norman,  R.P.  (1983)  5.8S  ribosomal  148. Weinmann, R. and Roeder, R.G. (1974) Role of DNA polymerase III in the transcription of the tRNA and Proc. Natl. A c a d . Sci. U S A 71:1790-1794.  RNA.  Cell  dependent RNA 5S RNA genes.  149. Wellauer, P.K. and Dawid, I.B. (1979) Isolation and sequence organization of human ribosomal DNA. J . M o l . Biol. 128:289-303. 150. White, B.N., and Bayley, S.T. (1972) Methionine transfer RNAs from the extreme halophile, Halobacterium cutirubrum. Biochim. Biophys. Acta 272:583-587. 151. Wieland F., Lechner, J. and Sumper, M. (1982) The cell wall glycoprotein of Halobacteria; Structural, functional and biosynthetic apects. Zbl. Bakt. Hyg., I. Abt. Orig. C3:161-170. 152. Wild, M.A. and Gall, J.G. (1979) A n intervening sequence in the coding for 25S ribosomal RNA of Tetrahymena pigmentosa. 16:565-573.  gene Cell  153. Williamson, D.E. and Doolittle, W.F. (1983) Genes for tRNA-ala and tRNA-ile in the spacer between the 16S and 23S rRNA genes of a blue-green alga: Strong homology to chloroplast tRNA genes and tRNA genes of the E. coli rrnD gene cluster. Nucl. A c i d Res. 11 -.225-235. 154. Woese, C.R., Gutell, R., Gupta, R. and Noller, analysis of the higher-order structure of 16S—like acids. Microbiol. Rev. 47:621-669.  H.F. (1983) Detailed ribosomal ribonucleic  84 155. Woese, C.R. (1982) Archaebacteria and Zbl. Bakt. Hyg., I. Abt. Orig. C3:1-17. 156. W o e s e ,  cellular  C.R. (1981) Archaebacteria. Scientific  157. W o e s e , C.R., Magrum, L.J. Evol. 11:245-252. 158. W o e s e , C.R. and Fox, prokaryotic domain; The 24:5088-5090.  and  An  overview.  American 244:98-122. J.  Mol.  G.E. (1977) Phylogenetic structure of primary kingdoms. Proc. Natl. A c a d . Sci.  the USA  159. W o e s e , C.R. and Fox, G.E. M o l . Evol. 10:1-6.  Fox, G.E.  origins:  (1977)  The  (1978)  concept  Archaebacteria.  of  cellular  evolution.  J.  160. X u , W.L. and Doolittle, W.F. (1983) Structure of the archaebacterial transposable element ISH50. Nucl. Acids Res. 11:4195-4199. 161. Yamamoto, K.R., Alberts, B.M., Benzinger, R., Lawhorne, L. and Treiber, G. (1970) Rapid bacteriophage sedimentation in the presence of polyethylene glycol and its application to large-scale virus purification. Virology 40:734-744. 162. Young, L. and Hough, A . (1979) Purification and partial characterization of a prokaryotic glycoprotein from the plasma membrane of Thermoplasma acidophilum. Biochim. Biophys. Acta 556:265-277. 163. Young, R.A. and Steitz, J.A. (1979) Tandem ribosomal RNA synthesis. Cell 12:225-234.  promoters  direct  E.  coli  164. Young, R.A., Macklis, R. and Steitz, JA. (1979) Sequence of the 16S-23S spacer region in two ribosomal RNA operons of Escherichia coli. J . Biol. Chem. 254:3264-3271. 165. Zillig, W., Stetter, K.O., Schnabel, R., Madon, J . and Gierl, A . (1982) Transcription in archaebacteria. Zbl. Bakt. Hyg., I. Abt. Orig. C3:218-227. 166. Zuckerkandl, E. and Pauling, L. (1963) Molecules evolutionary history. J . Theor. Biol. 8:357-366.  as  documents  of  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0096406/manifest

Comment

Related Items