Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and characterization of the genes for polynucleotide phosphorylase and ribosomal protein S15… Evans, Sylvia 1984

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-UBC_1984_A1 E93.pdf [ 7.09MB ]
JSON: 831-1.0096403.json
JSON-LD: 831-1.0096403-ld.json
RDF/XML (Pretty): 831-1.0096403-rdf.xml
RDF/JSON: 831-1.0096403-rdf.json
Turtle: 831-1.0096403-turtle.txt
N-Triples: 831-1.0096403-rdf-ntriples.txt
Original Record: 831-1.0096403-source.json
Full Text

Full Text

C L O N I N G AND C H A R A C T E R I Z A T I O N OF THE GENES FOR POLYNUCLEOT IDE PHOSPHORYLASE AND R IBOSOMAL P R O T E I N S 1 5 I N E S C H E R I C H I A C O L I b y S y l v i a E v a n s B . A . , C a r l e t o n U n i v e r s i t y , 1 9 7 3 B . S c , ( H o n s ) U n i v e r s i t y o f A l b e r t a , 1 9 7 9 A T H E S I S SUBMITTED I N P A R T I A L F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PH I LOSOPHY i n THE F A C U L T Y OF GRADUATE S T U D I E S DEPARTMENT OF B I O C H E M I S T R Y We a c c e p t t h i s t h e s i s a s c o n f o r m i n g t o t h e r e q u i r e d s t a n d a r d THE U N I V E R S I T Y OF B R I T I S H COLUMBIA S e p t e m b e r , 1 9 8 4 c o p y r i g h t b y S y l v i a E v a n s , 1 9 8 4 In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f the requ i rements f o r an advanced degree a t the U n i v e r s i t y o f B r i t i s h Co lumb ia , I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and s tudy . I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e copy ing o f t h i s t h e s i s f o r s c h o l a r l y purposes may be g ran ted by the head o f my department o r by h i s o r her r e p r e s e n t a t i v e s . I t i s unders tood t h a t copy ing o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l ga in s h a l l no t be a l l owed w i thou t my w r i t t e n p e r m i s s i o n . Department o f ^ > oo+Ae M ) S T f e y The U n i v e r s i t y o f B r i t i s h Columbia 1956 Main Mall Vancouver , Canada V6T 1Y3 D a t e O ^ T o ' S S n e 11^  »E-6 (3/81) ABSTRACT I n o r d e r t o u n d e r s t a n d t h e r e g u l a t i o n o f p o l y n u c l e o t i d e p h o s p h o r y l a s e ( P N P a s e ) i n E s c h e r i c h i a c o l i a n d e l u c i d a t e i t s p h y s i o l o g i c a l r o l e , t h e g e n e f o r P N P a s e ( p n p ) w a s c l o n e d a n d c h a r a c t e r i z e d . T h e o r i e n t a t i o n o f t h e P N P a s e g e n e w a s d e t e r m i n e d t o b e a n t i c l o c k w i s e o n t h e E_. c o l i g e n e t i c map b y m e a n s o f m a p p i n g T n 5 i n s e r t i o n s w h i c h r e s u l t e d i n t r u n c a t e d p e p t i d e s . T h e P N P a s e c l o n e a l s o p r o d u c e d a < 1 2 , 0 0 0 MW p r o t e i n , now k n o w n t o b e r i b o s o m a l p r o t e i n S 1 5 e n c o d e d b y r p s O . T h e DNA s e q u e n c e c o v e r i n g t h e m a j o r 5 1 t r a n s c r i p t i o n t e r m i n i a n d c o n t r o l r e g i o n s f o r b o t h g e n e s , t h e e n t i r e c o d i n g s e q u e n c e o f S 1 5 , a n d p o s s i b l y t h e i n i t i a l c o d i n g s e q u e n c e o f P N P a s e h a s b e e n o b t a i n e d . T h e DNA s e q u e n c e o f S 1 5 a g r e e s w i t h t h e p u b l i s h e d p r o t e i n s e q u e n c e ( M o r i n a g a e t a l . , 1 9 7 6 ) w i t h t h e e x c e p t i o n o f a n a d d i t i o n a l h i s t i d i n e c o d o n c o r r e s p o n d i n g t o a m i n o a c i d 4 5 . T r a n s c r i p t i o n a l a n d t r a n s l a t i o n a l s t u d i e s o f t h e s e g e n e s h a v e b e e n c a r r i e d o u t b y m e a n s o f P - g a l a c t o s i d a s e a s s a y s a n d S I m a p p i n g o f r p s O - l a c Z a n d p n p - l a c Z f u s i o n p l a s m i d s . T h e p n p - l a c Z f u s i o n s h a v e a h i g h l e v e l o f 3 - g a l a c t o s i d a s e a c t i v i t y . L a c k o f s i g n i f i c a n t 3 - g a l a c t o s i d a s e a c t i v i t y i n a n r p s O - l a c Z f u s i o n s u g g e s t s t h a t S 1 5 , l i k e o t h e r c o r e r i b o s o m a l p r o t e i n s , may r e p r e s s i t s own t r a n s l a t i o n . T h i s i s s u p p o r t e d b y S I m a p p i n g r e s u l t s w h i c h i n d i c a t e t h a t t h e r p s O p r o m o t e r i s a c t i v e i n t h e r p s O - l a c Z f u s i o n . S e q u e n c e s o f t h e r p s O DNA s h o w some h o m o l o g y t o t h e r e g i o n o f 16S r R N A w h i c h b i n d s S 1 5 . M a p p i n g r e s u l t s w i t h n u c l e a s e S I i n d i c a t e t h a t t h e m a j o r t r a n s c r i p t i o n i n i t i a t i o n s i t e f o r S 1 5 i s a p p r o x i m a t e l y 1 0 0 bp u p s t r e a m o f i t s AUG s t a r t , w h i l e t h a t o f p n p i s a p p r o x i m a t e l y 1 4 0 bp u p s t r e a m o f i t s p u t a t i v e AUG s t a r t . T h e m a j o r t e r m i n a t i o n e v e n t o f r p s O t r a n s c r i p t i o n o c c u r s a p p r o x i m a t e l y 40 bp a f t e r t h e UAA s t o p c o d o n f o r S 1 5 . A s e c o n d a r y t e r m i n a t i o n e v e n t o c c u r s 93 bp d i s t a l t o t h i s . E v i d e n c e f r o m d e l e t i o n p l a s m i d s ( P o r t i e r , 1 9 8 2 ) a n d Tn_5 i n s e r t i o n s w h i c h r e s u l t i n t h e d i s a p p e a r a n c e o f P N P a s e p r o t e i n s u g g e s t t h a t t h e c o n t r o l r e g i o n s c h a r a c t e r i z e d a r e i n d e e d t h o s e f o r p n p . H o w e v e r , t h e p o s s i b i l i t y t h a t t h e p r o t e i n f u s i o n t h o u g h t t o b e p n p - l a c Z i s a c t u a l l y t h e f u s i o n o f a s m a l l p e p t i d e , i m m e d i a t e l y p r e c e d i n g p n p , t o l a c Z c a n n o t b e e x c l u d e d . i v LIST OF ABBREVIATIONS A abso rbance ADP a d e n o s i n e d i p h o s p h a t e ATP a d e n o s i n e t r i p h o s p h a t e Amp a m p i c i l l i n DTT d i t h i o t h r e i t o l EDTA e t h y l e n e d i am ine t e t r a c e t i c a c i d Kan kanamyc in Kb k i l o b a s e s MW m o l e c u l a r we igh t NDPs n u c l e o s i d e d i p h o s p h a t e s NMPs n u c l e o s i d e monophosphates ONPG o - n i t r o p h e n y l - f i - g a l a c t o p y r a n o s i d e p p r o t e i n p r o d u c t o f a gene (as i n pAmp) PNPase p o l y n u c l e o t i d e p h o s p h o r y l a s e R r e s i s t a n c e t o a n t i b i o t i c (as i n AmpR) S s e n s i t i v i t y t o a n t i b i o t i c (as i n AmpS) Te t t e t r a c y c l i n e UDP u r i d i n e d i p h o s p h a t e X - g a l 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - J 3 - D - g a l a c t o s i d a s e bp base p a i r dATP deoxyadenos ine t r i p h o s p h a t e dCTP d e o x y c y t i d i n e t r i p h o s p h a t e V dGTP d e o x y g u a n o s i n e t r i p h o s p h a t e dNTP d e o x y n u c l e o s i d e t r i p h o s p h a t e dTTP d e o x y t h y m i d i n e t r i p h o s p h a t e d d C T P d i d e o x y c y t i d i n e t r i p h o s p h a t e ddGTP d i d e o x y g u a n o s i n e t r i p h o s p h a t e d d N T P d i d e o x y n u c l e o s i d e t r i p h o s p h a t e r R N A r i b o s o m a l RNA TABLE OF CONTENTS v i INTRODUCTION A . P O L Y N U C L E O T I D E PHOSPHORYLASE 1 1 . T h e i n v i t r o R e a c t i o n s 1 2 . P h y s i o l o g i c a l R o l e • 2 3 . M u t a n t s o f P N P a s e 3 4 . E f f e c t o n P l a s m i d G e n e E x p r e s s i o n . 5 B . TURNOVER OF mRNA I N E . c o l i . 6 C . THE G E N E T I C R E G I O N SURROUNDING p n p 7 D. R IBOSOMAL P R O T E I N S15 10 MATERIALS AND METHODS A . B A C T E R I A L S T R A I N S 13 B . M E D I A AND CULTURE CONDIT IONS 13 C . TRANSDUCTION BY BACTER IOPHAGE P l 13 D . I N S E R T I O N MUTAGENES IS WITH TRANSPOSON T n 5 15 E . P O L Y N U C L E O T I D E PHOSPHORYLASE A S S A Y 15 F . R E S T R I C T I O N ENZYME D I G E S T I O N S 16 G . P A R T I A L R E S T R I C T I O N D I G E S T I O N S FOR CLONING 16 H . L I G A T I O N I 7 I . TRANSFORMATION 17 J . SMALL S C A L E P R E P A R A T I O N OF P L A S M I D DNA 17 K . L A R G E S C A L E P R E P A R A T I O N OF P L A S M I D DNA 18 L . DNA E L E C T R O P H O R E S I S l g v i i M . M A X I C E L L C S R 6 0 3 L A B E L L I N G 19 N . P R O T E I N E L E C T R O P H O R E S I S 19 0 . R E P A I R OF 3 ' - E N D S (KLENOW F I L L - I N ) 20 P . ORDERING OF P s t I FRAGMENTS BY END L A B E L L I N G AND P A R T I A L D I G E S T I O N . 20 Q . N I C K T R A N S L A T I O N 21 R. t i - GALACTOS IDASE 2 1 S . CONSTRUCTION OF CLONES FOR DNA SEQUENCING 22 T . BACTER IOPHAGE M13 SEQUENCING 23 1 . P h a g e G r o w t h , DNA E x t r a c t i o n , C l o n i n g 23 2 . S c r e e n i n g f o r P o s i t i v e C l o n e s 24 a . F i g u r e - o f - e i g h t s '. 24 b . D o t b l o t s 24 3 . S e q u e n c e R e a c t i o n s 25 U . CONSTRUCTION OF F U S I O N P L A S M I D S 26 1 . P l a s m i d s pMC412 a n d pMC416 26 2 . P l a s m i d p S H 1 2 2 27 a . S u b s t i t u t i o n o f t h e K a n a m y c i n C a s s e t t e i n t o p S H 1 2 2 28 3 . P l a s m i d s p U P l 7 a n d p M B l 29 4 . P l a s m i d pMS31 30 V . P R E P A R A T I O N OF RNA FOR S I M A P P I N G 3 1 W. T4 P O L Y N U C L E O T I D E K I N A S E EXCHANGE R E A C T I O N 32 X . T4 P O L Y N U C L E O T I D E K I N A S E L A B E L L I N G OF R E C E S S E D 5* T E R M I N I 32 Y . S I M A P P I N G 33 v i i i RESULTS A . C LONING THE GENE FOR POLYNUCLEOT IDE PHOSPHORYLASE 35 B . SUBCLONING FROM p S l 4 39 C . L O C A T I N G p n p ON p H E l 45 D . D I R E C T I O N OF T R A N S C R I P T I O N / T R A N S L A T I O N 45 E . L O C A T I O N OF PROMOTERS FOR p n p AND r p s O 51 F . THE DNA SEQUENCE OF P U T A T I V E PROMOTER REGIONS FOR r p s O AND p n p AND THE CODING SEQUENCE OF S15 61 G . CONSTRUCTION OF p n p - l a c Z AND r p s O - l a c Z F U S I O N P L A S M I D S 66 1 . T h e p n p - l a c Z f u s i o n p l a s m i d s 66 a . DNA s e q u e n c e o f p n p - l a c Z f u s i o n p l a s m i d s 75 2 . A n r p s O - l a c Z f u s i o n p l a s m i d . 75 H . t s -GALACTOS IDASE A S S A Y S OF F U S I O N P L A S M I D S 75 I . N U C L E A S E S I MAPP ING OF THE S 1 5 a n d P N P a s e T R A N S C R I P T S 78 1 . D e t e r m i n a t i o n o f t h e 5 ' T e r m i n i o f r p s O T r a n s c r i p t s 79 2 . D e t e r m i n a t i o n o f t h e 3 ' T e r m i n i o f r p s O T r a n s c r i p t s 79 3 . D e t e r m i n a t i o n o f t h e 5 ' T e r m i n i o f p n p T r a n s c r i p t s 84 DISCUSSION A . THE I N T A C T GENE FOR P N P a s e HAS B E E N CLONED 90 B . N A T I V E STRUCTURE OF P N P a s e 91 C . COMPARISON OF THE G E N E T I C MAP TO THE P H Y S I C A L M A P . . . 92 D. T R A N S C R I P T I O N A L / T R A N S L A T I O N A L I M P L I C A T I O N S OF l a c Z F U S I O N S 92 1 . I n d e p e n d e n t R e g u l a t i o n o f r p s O a n d p n p 92 E . T R A N S C R I P T I O N A L E X P R E S S S I O N OF r p s O AND p n p 97 1 . A M a j o r P r o m o t e r f o r r p s O , 98 i x 2 . T h e 3 ' T r a n s c r i p t i o n a l T e r m i n i o f r p s O 99 3 . A M a j o r P r o m o t e r f o r p n p 1 0 3 F . R I B 0 S 0 M E B I N D I N G S I T E S • • • • 1 0 5 G . CONCLUDING REMARKS 106 L I T E R A T U R E C I T E D 1 ° 8 X LIST OF TABLES Table 1. B a c t e r i a l s t r a i n s 14 Table 2. Cotransduction of Kanamycin r e s i s t a n c e w i t h argG and mtr 38 Table 3. P o l y n u c l e o t i d e phosphorylase a c t i v i t y of s t r a i n s c o n t a i n i n g the pS14 and pS17 S a i l plasmids (KanRpnp"1") and H i n d l l l - E c o R I subclones c o n t a i n i n g H i n d l l l - E c o R I from pSl4 . . .77T 40 Table 4. P o l y n u c l e o t i d e phosphorylase assays of pHEl and Tn5 d e r i v a t i v e s 46 Table 5. The B-galactosidase a c t i v i t y of s t r a i n s c o n t a i n i n g pMC1403 f u s i o n d e r i v a t i v e s 77 x i LIST OF FIGURES F i g u r e 1 . R e g i o n o f t h e E_. c o l i c h r o m o s o m e s u r r o u n d i n g t h e p n p l o c u s 8 - 9 F i g u r e 2 . T h e g e n e t i c map n e a r 68 m i n o n t h e b a c t e r i a l c h r o m o s o m e a n d i t s c o r r e s p o n d e n c e t o t h e r e s t r i c t i o n maps o f p S 1 7 a n d p S 1 4 3 6 - 3 7 F i g u r e 3 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p S 1 7 a n d p S l 4 b y a g a r o s e g e l e l e c t r o p h o r e s i s 4 1 - 4 2 F i g u r e 4 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p S 1 4 a n d AmpR T e t S s u b c l o n e s b y a g a r o s e g e l e l e c t r o p h o r e s i s 4 3 - 4 4 F i g u r e 5 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p S l 4 , p H E l , a n d p H E l T n 5 d e r i v a t i v e s b y a g a r o s e g e l e l e c t r o p h o r e s i s 4 7 - 4 8 F i g u r e 6 . T h e . s i t e s o f Tn5_ i n s e r t i o n i n p H E l 4 9 - 5 0 F i g u r e 7 . A u t o r a d i o g r a m o f p r o t e i n s f o r m e d i n p l a s m i d -c o n t a i n i n g m a x i c e l l s . . 5 2 - 5 3 F i g u r e 8 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p H E l o n a g a r o s e a n d a c r y l a m i d e g e l s 5 5 - 5 6 F i g u r e 9 . R e s t r i c t i o n map o f p H E l a n d d e r i v a t i v e fi-galactosidase f u s i o n p l a s m i d s 5 7 - 5 8 F i g u r e 1 0 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f T n 5 i n s e r t i o n s i n p H E l b y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . . . 5 9 - 6 0 F i g u r e 1 1 . , T h e DNA s e q u e n c i n g s t r a t e g y 6 2 - 6 3 F i g u r e 1 2 . T h e DNA s e q u e n c e o f r p s O a n d i n i t i a l p a r t o f p np 6 4 - 6 5 F i g u r e 1 3 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p H E l , p M C 4 1 2 , a n d pMC416 b y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . . . . 6 7 - 6 8 F i g u r e 1 4 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p H E l a n d d e r i v a t i v e L a c + B - g a l a c t o s i d a s e f u s i o n s b y a c r y l a m i d e g e l e l e c t r o p h o r e i s 6 9 - 7 0 F i g u r e 1 5 . S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f t h e S 1 5 - J 3 - g a l a c t o s i d a s e f u s i o n p l a s m i d , pMS31 b y a c r y l a m i d e g e l e l e c t r o p h o r e s i s 7 1 - 7 2 F i g u r e 1 6 . R e a d i n g f r a m e s i n t h e c o n s t r u c t i o n o f 6 - g a l a c t o s i d a s e f u s i o n s w i t h P N P a s e a n d S 1 5 7 3 - 7 4 x i i F i g u r e 1 7 . T h e S I m a p p i n g s t r a t e g y a n d r e s u l t s 8 0 - 8 1 F i g u r e 1 8 . A u t o r a d i o g r a m s o f S I m a p p i n g i n o r d e r t o d e t e r m i n e t h e 5 ' t e r m i n i o f t h e r p s O t r a n s c r i p t s 82 . -83 F i g u r e 1 9 . A u t o r a d i o g r a m s o f S I m a p p i n g i n o r d e r t o d e t e r m i n e t h e 3 ' t e r m i n i o f t h e r p s O t r a n s c r i p t s 8 5 - 8 6 F i g u r e 2 0 . A u t o r a d i o g r a m s o f S I m a p p i n g i n o r d e r t o d e t e r m i n e t h e 5 ' t e r m i n i o f t h e p n p t r a n s c r i p t s 8 7 - 8 8 F i g u r e 2 1 . N u c l e o t i d e s e q u e n c e h o m o l o g y o f 1 6 S r R N A a n d r p s O mRNA 9 5 - 9 6 F i g u r e 2 2 . H y p o t h e t i c a l s t e m l o o p s t r u c t u r e f o r t h e m a j o r t e r m i n a t o r o f r p s O , w i t h p o s s i b l e N u s A r e c o g n i t i o n s i g n a l s 1 0 1 - 1 0 2 x i i i ACKNOWLEDGEMENTS I w o u l d l i k e t o t h a n k my s u p e r v i s o r , P a t D e n n i s , a n d m e m b e r s o f my C o m m i t t e e , M i k e S m i t h a n d G o r d o n T e n e r . T h a n k y o u t o D e i d r e Wong f o r a l l h e r h e l p , a n d m e m b e r s o f o u r l a b a n d M . S m i t h ' s l a b f o r t h e i r a s s i s t a n c e a n d c o m m i s e r a t i o n . T h a n k s t o J o a n M c P h e r s o n . S p e c i a l t h a n k s t o C o l i n H a y . T h a n k s t o J u d i t h S m i t h a n d D e b b i e B u n y a k . T h a n k y o u , G r a i n g e r . 1 . INTRODUCTION A . POLYNUCLEOT IDE PHOSPHORYLASE 1 . T h e i n v i t r o R e a c t i o n s P o l y n u c l e o t i d e p h o s p h o r y l a s e ( P N P a s e ) h a s b e e n f o u n d i n l a r g e a m o u n t s i n a l l s p e c i e s o f b a c t e r i a e x a m i n e d a n d i n l e s s e r a m o u n t s i n y e a s t , c h l o r o p l a s t s o f b e a n s a n d c a b b a g e , r a t b r a i n a n d l i v e r , human s p e r m , a n d H e L a c e l l n u c l e i ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ) . T h e e n z y m e P N P a s e c a t a l y z e s t h r e e r e a c t i o n s _ i n v i t r o : p o l y m e r i s a t i o n o f n u c l e o s i d e d i p h o s p h a t e s , a n e x c h a n g e r e a c t i o n w i t h 3 2 P O a n d t h e 4 t s - p h o s p h a t e o f n u c l e o s i d e d i p h o s p h a t e s , a n d p h o s p h o r o l y s i s o f p o l y - o r o l i g o n u c l e o t i d e s i n t h e p r e s e n c e o f p h o s p h a t e t o y i e l d n u c l e o s i d e d i p h o s p h a t e s . U t i l i z a t i o n o r r e l e a s e o f n u c l e o s i d e d i p h o s p h a t e s i n t h e s e r e a c t i o n s i s s p e c i f i c t o p o l y n u c l e o t i d e p h o s p h o r y l a s e . T h e p h o s p h o r o l y t i c r e a c t i o n i s p r o c e s s i v e i n t h a t P N P a s e d e g r a d e s p o l y n u c l e o t i d e m o l e c u l e s o n e b y o n e e n t i r e l y f r o m t h e 3 ' t o 5 ' e n d ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ) . R i b o n u c l e o s i d e d i p h o s p h a t e s a r e p r e f e r r e d s u b s t r a t e s f o r a l l t h e r e a c t i o n s . P o l y a d e n y l i c a n d p o l y u r i d y l i c a c i d s a r e v e r y q u i c k l y p h o s p h o r o l y z e d . R i b o s o m a l RNA i s v e r y s l o w l y b u t c o m p l e t e l y a t t a c k e d w h e r e a s t R N A i s p a r t i a l l y a t t a c k e d ( G r u n b e r g - M a n a g o , 1 9 5 9 ) . T h e i n v i t r o s y n t h e t i c a n d d e g r a d a t i v e r e a c t i o n s h a v e b e e n u s e d t o p r o b e t h e s t r u c t u r e o f n a t u r a l RNAs ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ; S o r e g a n d W i t t a u e r , 1 9 7 7 ) , t o s y n t h e s i z e w e l l - d e f i n e d t e m p l a t e s f o r t h e e l u c i d a t i o n o f t h e g e n e t i c c o d e ( O c h o a , 1 9 6 3 ) a n d t o s y n t h e s i z e o l i g o n u c l e o t i d e s o f d e f i n e d s e q u e n c e f o r m o l e c u l a r p r o b i n g a n d i n v i t r o m u t a g e n e s i s ( G i l l a m a n d S m i t h , 1 9 7 4 ) a s w e l l a s f o r o t h e r a p p l i c a t i o n s 2. ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ) . T h e P N P a s e f r o m E_. c o l l h a s b e e n p u r i f i e d a n d s h o w n t o c o n s i s t o f o n e p o l y p e p t i d e c h a i n w i t h a MW o f 8 4 , 0 0 0 . T h e a c t i v e f o r m o f t h e e n z y m e i s t h o u g h t t o be a t r i m e r ( S o r e q a n d L i t t a u e r , 1 9 7 7 ) . 2 . P h y s i o l o g i c a l R o l e When f i r s t d i s c o v e r e d i n 1 9 5 5 b y O c h o a a n d G r u n b e r g - M a n a g o a s a n e n z y m e h a v i n g RNA p o l y m e r i s a t i o n c a p a b i l i t i e s , P N P a s e w a s c o n s i d e r e d a s a c a n d i d a t e f o r t h e p r o d u c t i o n o f m e s s e n g e r RNA ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ) . H o w e v e r , i t s t e m p l a t e i n d e p e n d e n c e a n d t h e s u b s e q u e n t d i s c o v e r y o f RNA p o l y m e r a s e l e d t o c o n s i d e r a t i o n o f o t h e r p o s s i b l e p h y s i o l o g i c a l r o l e s . C a l c u l a t i o n o f e q u i l i b r i u m c o n s t a n t s f o r t h e s y n t h e t i c a n d d e g r a d a t i v e r e a c t i o n s i n d i c a t e t h a t u n d e r p h y s i o l o g i c a l c o n d i t i o n s t h e l a t t e r r e a c t i o n i s t h e m o s t l i k e l y t o o c c u r ( L i e g e a n d G u y n n , 1 9 7 9 ) . G i v e n t h e h i g h p r e f e r e n c e f o r r i b o n u c l e o t i d e s , a l i k e l y r o l e f o r P N P a s e i n t h e c e l l i s i n v o l v e m e n t i n t h e t u r n o v e r o f R N A . I n v e s t i g a t i o n o f P N P a s e a c t i v i t y i n E .  c o l i h a s r e s u l t e d i n some h i n t s a s t o i t s p h y s i o l o g i c a l r o l e . I n b a c t e r i a , t h e b r e a k d o w n p r o d u c t s o f RNA a r e e f f i c i e n t l y a n d q u a n t i t a t i v e l y u t i l i z e d f o r t h e s y n t h e s i s o f RNA ( N i e r l i c h a n d V i e l m e t t e r , 1 9 6 8 ) . D e g r a d a t i o n o f RNA c a n o c c u r h y d r o l y t i c a l l y a n d p h o s p h o r o l y t i c a l l y , t h e l a t t e r b e i n g u n i q u e t o P N P a s e ( C h a n e y e t a l . , 1 9 7 2 ) . W i t h h y d r o l y t i c c l e a v a g e , i n t h e p r e s e n c e o f H 1 8 0 H m e d i a , a b u r s t o f 1 8 0 i n c o r p o r a t i o n i n t o RNA s h o u l d b e o b s e r v e d , f o l l o w e d b y a h i g h s t e a d y - s t a t e 1 8 0 c o n t e n t o f p h o s p h o d i e s t e r o x y g e n s i n RNA r e l a t i v e t o t h e 1 8 0 c o n t e n t o f p h o s p h o r y l A T P . W i t h p h o s p h o r o l y t i c c l e a v a g e , t h e r e w o u l d be no " b u r s t " , a n d a s p h o s p h o r o l y t i c t u r n o v e r h a s n o e f f e c t o n t h e a - b r a n c h o x y g e n s o f 3 . p h o s p h o r y l A T P . W i t h p h o s p h o r o l y t i c c l e a v a g e , t h e r e w o u l d b e n o " b u r s t " , a n d a s p h o s p h o r o l y t i c t u r n o v e r h a s n o e f f e c t o n t h e ct-branch o x y g e n s o f R N A , t h e i r s t e a d y - s t a t e l e v e l o f 1 8 0 w o u l d be c o m p a r a b l e t o t h a t o f t h e n u c l e o t i d e s s y n t h e s i z e d d e n o v o i n t h e H 1 8 0 H . R e s u l t s f r o m 1 8 0 l a b e l l i n g s u g g e s t e d t h a t t h e p r i n c i p a l mode o f u n s t a b l e RNA t u r n o v e r i n e x p o n e n t i a l l y g r o w i n g c e l l s wa s p h o s p h o r o l y t i c i n B a c i l l u s s u b t i l i s a n d h y d r o l y t i c i n E. c o l i . T h e " u n s t a b l e " d e s i g n a t i o n w o u l d a l s o i n c l u d e p r o c e s s i n g p r o d u c t s o f s t a b l e RNA s p e c i e s . A l t h o u g h t h e p r i n c i p a l m e c h a n i s m o f t h i s RNA d e g r a d a t i o n s e e m e d t o be h y d r o l y t i c i n E_. c o l i , i n v o l v e m e n t o f p h o s p h o r o l y s i s c a n n o t b e r u l e d o u t . 3 . M u t a n t s o f P N P a s e T h r e e m u t a n t s o f P N P a s e w e r e i s o l a t e d i n E_. c o l i b y n i t r o s o g u a n i d i n e m u t a g e n e s i s , f o l l o w e d b y P N P a s e a s s a y s o f i n d i v i d u a l c o l o n i e s ( R e i n e r , 1 9 6 9 ) . T h e s e m u t a n t s w e r e m a p p e d t o 68 m i n u t e s o n t h e 15. c o l i m a p , a l o c u s d e s i g n a t e d p n p , a n d a r e t h o u g h t t o e n c o d e t h e s t r u c t u r a l g e n e f o r P N P a s e . B e c a u s e o f t h e n i t r o s o g u a n i d i n e - m u t a g e n i z e d b a c k g r o u n d o f t h e o r i g i n a l i s o l a t e s , t h e p n p a l l e l e s w e r e t r a n s f e r r e d t o a n o t h e r s t r a i n b a c k g r o u n d r e s u l t i n g i n i s o g e n i c s t r a i n s , P R 1 0 0 ( w i l d t y p e p n p + ) , PR27 ( p n p 2 7 ) , P R 1 3 ( p n p ! 3 ) a n d PR7 ( p n p 7 ) ( R e i n e r , 1 9 6 9 ) . T h e s t r a i n s PR27 a n d PR13 h a d r e t a i n e d a s m a l l a m o u n t o f t h e p h o s p h o r o l y t i c a c t i v i t y o n l y , w h e r e a s PR7 h a d v e r y , l i t t l e , i f a n y , o f t h e t h r e e c h a r a c t e r i s t i c a l l y a s s a y e d f o r a c t i v i t i e s . R e i n e r g r e w t h e s e m u t a n t s i n v a r i o u s m e d i a a n d a t d i f f e r e n t t e m p e r a t u r e s b u t f o u n d l i t t l e o r n o p h y s i o l o g i c a l e f f e c t . A l t h o u g h s i n g l e m u t a n t s a l o n e a r e v i a b l e , d o u b l e m u t a n t s o f R N a s e l l , r n b 2 9 6 , a n d pnp7 c o u l d n o t b e c o n s t r u c t e d u n l e s s c o m p l e m e n t e d b y a p l a s m i d 4. b e a r i n g e i t h e r g e n e ( D o n o v a n a n d K u s h n e r , 1 9 8 3 ) . E x p e r i m e n t s w h i c h i m p l i c a t e d P N P a s e a n d R N a s e l l i n mRNA a n d rP.NA b r e a k d o w n ( N a t o r i a n d M i z u n o , 1 9 6 7 ; K a p l a n a n d A p i r i o n , 1 9 7 4 ) h a d i n d i c a t e d t h a t t h e t w o a c t i v i t i e s w e r e a d d i t i v e i n t h e p r e s e n c e o f b o t h p h o s p h a t e a n d p o t a s s i u m , s u g g e s t i n g t h a t t h e y a r e i n d e p e n d e n t . A p o l y n u c l e o t i d e p h o s p h o r y l a s e m u t a n t ( p n p 7 ) wa s u n a b l e t o be i n d u c e d f o r t r y p t o p h a n a s e a s d e t e r m i n e d b y e n z y m e a s s a y ( K r i s h n a a n d A p i r i o n , 1 9 7 3 ) . I n r e v e r t a n t s o f p n p 7 , l e v e l s o f P N P a s e c o r r e l a t e d c l o s e l y w i t h t h e a b i l i t y t o e x p r e s s t h e t r y p t o p h a n a s e g e n e , t n a . T h i s e f f e c t i s i n c o n s i s t e n t w i t h t h e i d e a t h a t P N P a s e i s r e s p o n s i b l e f o r t h e p r i m a r y d e g r a d a t i o n o f t r y p t o p h a n a s e m e s s a g e . Two a d d i t i o n a l o b s e r v a t i o n s may be r e l e v a n t t o t h e P N P a s e - t r y p t o p h a n a s e i n t e r a c t i o n . F i r s t , a d d i t i o n o f t r y p t o p h a n o r i t s a n a l o g u e 5 - m e t h y l t r y p t o p h a n t o a t r y p t o p h a n a u x o t r o p h c u l t u r e d i n t h e p r e s e n c e o f c h l o r a m p h e n i c o l s e l e c t i v e l y s t i m u l a t e s de n o v o s y n t h e s i s o f P N P a s e ( T h a n g e t a l . , 1 9 6 3 ) . S e c o n d , i m m e d i a t e l y a d j a c e n t t o t h e P N P a s e l o c u s o n t h e 15. c o l i c h r o m o s o m e i s m t r . T h i s l o c u s h a s b e e n d e f i n e d b y i t s a b i l i t y t o d e t e r m i n e r e s i s t a n c e t o 5 - m e t h y l t r y p t o p h a n . T h e f u n c t i o n o f t h e p r o t e i n i s u n k n o w n a l t h o u g h i t may be i n v o l v e d i n t h e t r a n s p o r t o f t r y p t o p h a n a n d 5 - m e t h y l t r y p t o p h a n i n t o t h e c e l l ( H i r a g a e t a l . , 1 9 6 8 ) . T h u s , t h e " t r y p t o p h a n c o n n e c t i o n " i s i n t r i g u i n g a n d r e q u i r e s f u r t h e r i n v e s t i g a t i o n . I n s u m m a r y , t h e a b i l i t y t o d e t e c t s p e c i f i c e f f e c t s o f t h e pnp7 a l l e l e s u g g e s t s t h a t R N a s e l l c a n n o t a l w a y s e f f i c i e n t l y s u b s t i t u t e f o r P N P a s e . H o w e v e r , t h e p r e s e n c e o f o n e o f t h e s e n u c l e a s e s a l l o w s c e l l v i a b i l i t y i n t h e a b s e n c e o f t h e o t h e r , s u g g e s t i n g t h a t t h e r e may b e some o v e r l a p o r a b i l i t y t o s u b s t i t u t e i n t h e i r p a t h w a y s o f a c t i o n . 5. 4 . E f f e c t o n P l a s m i d G e n e E x p r e s s i o n Two g e n e s f o r e u k a r y o t i c p r o t e i n s , c a t a b o l i c d e h y d r o q u i n a s e o f N . c r a s s a ( H a u t a l a e t a l . , 1 9 7 9 ) a n d t h e h i s 3 g e n e o f S . c e r e v i s i a e ( K a s u n i c a n d K u s h n e r , 1 9 8 0 ) w e r e c l o n e d i n t o p l a s m i d s t o be e x p r e s s e d i n E_. c o l i . T h e e x p r e s s i o n o f t h e s e g e n e s w a s s u b s t a n t i a l l y e n h a n c e d i n t h e p r e s e n c e o f t h e p n p 7 a l l e l e . T h i s e n h a n c e d e x p r e s s i o n a p p e a r e d t o be d u e t o a n i n c r e a s e d c o p y n u m b e r o f t h e p l a s m i d a n d s e l e c t i v e s t a b i l i z a t i o n o f t h e e u k a r y o t i c m e s s a g e . T h e c o p y n u m b e r o f p B R 3 2 2 a n d t h e p B R 3 2 2 r e c o m b i n a n t p l a s m i d s i n c r e a s e d 3 - 4 f o l d i n t h e p n p b a c k g r o u n d . T h e t r a n s c r i p t i o n o f RNA f r o m t h e o r i r e g i o n o f p l a s m i d s i s k n o w n t o i n f l u e n c e r e p l i c a t i o n a n d p l a s m i d c o p y n u m b e r . T h e r e l a t i o n s h i p b e t w e e n t h i s t r a n s c r i p t i o n a n d c o p y n u m b e r c o n t r o l a n d t h e d e f e c t i n P N P a s e a c t i v i t y r e m a i n s u n c l e a r . H a l f - l i v e s o f b o t h e u k a r y o t i c m e s s a g e s w e r e o b s e r v e d t o i n c r e a s e d 3 - 1 0 f o l d i n p n p 7 . M e s s a g e h a l f - l i v e s w e r e m e a s u r e d b y h y b r i d i z a t i o n o f p u l s e - l a b e l l e d RNA t o DNA . B o t h i n c r e a s e d c o p y n u m b e r a n d i n c r e a s e d mRNA s t a b i l i t y c o n t r i b u t e t o t h e l e v e l o f e u k a r y o t i c g e n e e x p r e s s i o n i n P N P a s e d e f i c i e n t s t r a i n s . U n p u b l i s h e d r e s u l t s f r o m o u r l a b o r a t o r y i n d i c a t e d t h a t a p B R 3 2 2 - d e r i v e d p l a s m i d b e a r i n g a l e u g e n e f r a g m e n t f r o m _S. c e r e v i s i a e , pCV9 ( P e t e s , 1 9 8 0 ) t r a n s f o r m e d t h e pnp7 s t r a i n S K 6 9 4 m u c h l e s s e f f i c i e n t l y t h a n t h e i s o g e n i c p n p + s t r a i n S K 6 9 2 . T h e p l a s m i d wa s s e l e c t e d f o r b y c o m p l e m e n t a t i o n o f a n _E. c o l i L e u p h e n o t y p e . T h e S K 6 9 4 t r a n s f o r m a n t s o b t a i n e d h a d l o n g e r g e n e r a t i o n t i m e s t h a n S K 6 9 2 t r a n s f o r m a n t s a t 3 0 ° C i n m i n i m a l m e d i u m . T h i s e f f e c t wa s n o t s e e n f o r pBR322 a l o n e . A l o n g e r c e l l d i v i s i o n t i m e c o u l d c o n t r i b u t e t o t h e a p p a r e n t i n c r e a s e i n p l a s m i d c o p y n u m b e r . T h e s e r e s u l t s i n d i c a t e t h a t a l a c k o f p o l y n u c l e o t i d e p h o s p h o r y l a s e 6 . c a n c r e a t e a n i m b a l a n c e b e t w e e n p l a s m i d r e p l i c a t i o n a n d h o s t c e l l p r o p a g a t i o n . B . TURNOVER OF mRNA I N E . C o l i F u n c t i o n a l d e c a y o f mRNA p r o b a b l y p r e c e d e s c h e m i c a l d e c a y . T h e r e i s c o n t r o v e r s y a b o u t a m e c h a n i s m o f mRNA d e c a y i n E_. c o l i b e c a u s e o f d i f f e r e n t m e t h o d o l o g i e s a n d a s s u m p t i o n s i n v o l v e d i n m o n i t o r i n g p r i m a r y e n d o n u c l e o l y t i c c l e a v a g e s d u r i n g m a s s d e c a y w i t h i n s h o r t t i m e p e r i o d s . F o r t h e l a r g e p o l y c i s t r o n i c m e s s a g e s o f t h e l a c t o s e , t r y p t o p h a n a n d g a l a c t o s e o p e r o n s , d e g r a d a t i o n o c c u r s b y m e a n s o f a s e r i e s o f p r i m a r y , i n d e p e n d e n t e n d o n u c l e o l y t i c c l e a v a g e s , p e r h a p s i n t h e i n t e r c i s t r o n i c j u n c t i o n s , f o l l o w e d b y a n e t 5 ' - 3 * l o s s ( M o r s e e t a l . , 1 9 6 9 ; B l u n d e l l e t a l . , 1 9 7 2 ; S c h n e i d e r e t a l . , 1 9 7 8 ; L i m a n d K e n n e l l , 1 9 8 0 ) . I n t e r n a l e n d o n u c l e o l y t i c c l e a v a g e i s i n v o l v e d i n mRNA d e c a y b e c a u s e d i s t a l m e s s a g e s o f a n o p e r o n c a n d e c a y f a s t e r t h a n p r o x i m a l o n e s ( B l u n d e l l a n d K e n n e l l , 1 9 7 4 ) . I f t h e s e p r i m a r y c l e a v a g e s d e p r i v e a m e s s a g e o f r i b o s o m e b i n d i n g s i t e s , t h e n f u n c t i o n a l i n a c t i v a t i o n h a s o c c u r r e d . A s s t a t e d e a r l i e r , t h e o v e r a l l n e t c h e m i c a l d e g r a d a t i o n o f t h e s e t r a n s c r i p t s i s 5 ' - 3 ' . H o w e v e r , a l l k nown e x o r i b o n u c l e a s e s o f E. c o l i , l i k e P N P a s e , d e g r a d e RNA i n t h e 3 ' - 5 ' d i r e c t i o n ( B o t h w e l l a n d A p i r i o n , 1 9 7 1 ) . T h e n e t 5 ' - 3 ' d e g r a d a t i o n o b s e r v e d s u g g e s t s a p r i m a r y e n d o n u c l e o l y t i c b r e a k d o w n f o l l o w e d b y p r o c e s s i v e 3 ' - 5 ' d e g r a d a t i o n o r t h e e x i s t e n c e o f a n u n d i s c o v e r e d 5 ' - 3 ' e x o r i b o n u c l e a s e . N e t 3 ' - 5 ' d e g r a d a t i o n o f mRNA o c c u r s f o r t h e ompA t r a n s c r i p t i n E_. c o l i ( G a b a i n e t a l . , 1 9 8 3 ) . T h e OmpA g e n e e n c o d e s a n o u t e r memb r ane p r o t e i n . B o t h ompA a n d fcs-lactamase t r a n s c r i p t s w e r e e x a m i n e d b y h y b r i d i z a t i o n t o i n v i v o [ 3 2 P ] - l a b e l l e d M13 s i n g l e - s t r a n d e d DNA c l o n e s c o n t a i n i n g 7 . d i f f e r e n t c o d i n g s e g m e n t s o f e a c h g e n e . H y b r i d s w e r e s u b j e c t e d t o S I n u c l e a s e , w h i c h s e l e c t i v e l y d e g r a d e s s i n g l e s t r a n d e d n u c l e i c a c i d s , r u n o n p o l y a c r y l a m i d e g e l s a n d a u t o r a d i o g r a p h e d . T h e l o n g - l i v e d ompA m e s s a g e , w i t h a h a l f - l i f e o f 15 m i n u t e s , d e c a y e d s e g m e n t a l l y , w i t h t h e 3 ' s e g m e n t s d i s a p p e a r i n g m o r e r a p i d l y t h a n t h e 5 ' s e g m e n t s . P r o c e s s i v e 3 ' - 5 ' d e g r a d a t i o n b y p o l y n u c l e o t i d e p h o s p h o r y l a s e o r R N a s e l l w o u l d g i v e t h i s r e s u l t . A r a p i d d e c a y r a t e p r e v e n t e d t h e o b s e r v a t i o n o f s u c h s e g m e n t a l i n t e r m e d i a t e s w i t h t h e fc-lactamase t r a n s c r i p t w h i c h h a d a h a l f - l i f e o f t h r e e m i n u t e s . C . THE G E N E T I C R E G I O N SURROUNDING pnp T h e P N P a s e l o c u s i s w i t h i n a n i n t e r e s t i n g g e n e t i c c o n t e x t . I m m e d i a t e l y a d j a c e n t t o p n p a r e m e t Y n u s A i n f B r p s O ( p n p ) m t r ( F i g u r e 1 ) ( P l u m b r i d g e a n d S p r i n g e r , 1 9 8 2 ; P o r t i e r , 1 9 8 2 ; I s h i i e t a l . , 1 9 8 4 ) . The M e t m e t Y g e n e c o d e s f o r t R N A ^ w h i c h i s a m i n o r f r a c t i o n o f i n i t i a t o r M e t t R N A m o l e c u l e s ( I k e m u r a e t a l . , 1 9 7 7 ) . T h e N u s A p r o t e i n i s a t r a n s c r i p t i o n a l t e r m i n a t i o n f a c t o r t h o u g h t t o i n t e r a c t w i t h RNA p o l y m e r a s e t o e n h a n c e t e r m i n a t i o n o r a n t i t e r m i n a t i o n ( F r i e d m a n a n d O l s e n , 1 9 8 3 ) . T h e g e n e i n f B c o d e s f o r t h e a a n d & p e p t i d e s o f I F 2 , a n i n i t i a t i o n f a c t o r i n v o l v e d i n t h e b i n d i n g o f i n i t i a t o r t R N A t o t h e s m a l l 3 0S r i b o s o m a l s u b u n i t i n t h e t r a n s l a t i o n i n i t i a t i o n c o m p l e x . T h e I F 2 b i n d i n g a l s o s t a b i l i z e s t h e c o m p l e x o f I F 3 a n d I F 1 w i t h t h e 30S s u b u n i t ( L e n g y e l , 1 9 7 4 ) . T h e r p s O l o c u s e n c o d e s r i b o s o m a l p r o t e i n S 1 5 , a p r o t e i n o f t h e 30S r i b o s o m a l s u b u n i t ( W i t t m a n , 1 9 7 4 ) a n d m t r e n c o d e s a g e n e d e t e r m i n i n g 5 - m e t h y l t r y p t o p h a n r e s i s t a n c e ( H i r a g a e t a l . , 1 9 6 8 ) . O t h e r r i b o s o m a l p r o t e i n o p e r o n s e n c o d e a d d i t i o n a l e l e m e n t s o f t h e 8. F I G U R E 1 R e g i o n o f t h e E . c o l i c h r o m o s o m e s u r r o u n d i n g t h e p_np_ l o c u s . T h e i n f o r m a t i o n s h o w n a b o v e i s t h e r e s u l t o f a n a l y s i s f r o m a s e r i e s o f c l o n i n g e x p e r i m e n t s ( P l u m b r i d g e a n d S p r i n g e r , 1 9 8 2 ; P o r t i e r , 1 9 8 2 ; K u r i h a r a a n d N a k a m u r a , 1 9 8 3 ; I s h i i e t a l . , 1 9 8 4 ) . G e n e d e s i g n a t i o n s a r e w r i t t e n a b o v e , a n d t h e i r p r o t e i n s o r p r o d u c t s b e l o w . R e s t r i c t i o n s i t e s a r e : E , E c o R I ; S , S a i l ; B , B g l l l ; H , H i n d l l l ; Sm, S m a l . T h e 15K p r o t e i n r e m a i n s u n i d e n t i f i e d a s t o f u n c t i o n ( I s h i i e t a l . , 1 9 8 4 ) . D e t e r m i n a t i o n s o f MW a r e f r o m m i g r a t i o n d i s t a n c e s o n SDS p o l y a c r y l a m i d e g e l s . P r e l i m i n a r y e v i d e n c e f o r t h e l o c a t i o n o f 5 - m t r h a s b e e n r e p o r t e d ( P l u m b r i d g e a n d M e t S p r i n g e r , 1 9 8 2 ) . DNA s e q u e n c e s h a v e b e e n o b t a i n e d f o r t R N A ^ g e n e , t h e 15 K p r o t e i n , a n d t h e b e g i n n i n g o f p N u s A ( I s h i i e t a l . , 1 9 8 4 ) , t h e S 1 5 g e n e ( P o r t i e r , 1 9 8 2 , a n d t h i s w o r k ) a n d t h e b e g i n n i n g o f P N P a s e ( t h i s w o r k ) . F o r f u r t h e r d i s c u s s i o n o f t h e s e g e n e s a n d t h e i r a c t i v i t i e s , r e f e r t o t h e I n t r o d u c t i o n . FIGURE 1 O l 1 0 . t r a n s l a t i o n a l , t r a n s c r i p t i o n a l , a n d r e p l i c a t i v e a p p a r a t u s , s u c h a s e l o n g a t i o n f a c t o r s T u a n d G , RNA p o l y m e r a s e s u b u n i t s 3 ' , &, a, a n d a , a n d DNA p r i m a s e ( N i e r l i c h , 1 9 7 8 ; B u r t o n e t a l . , 1 9 8 3 ) . Two o t h e r DNA r e p l i c a t i o n p r o t e i n s c o d e d f o r b y g e n e s d n a A a n d d n a N h a v e a p r o m o t e r o v e r l a p p i n g b u t o p p o s i t e l y - o r i e n t e d t o t h e p r o m o t e r f o r r i b o s o m a l p r o t e i n L 3 4 ( H a n s e n e t a l . , 1 9 8 2 ) . A p r o t e i n e x p o r t g e n e i s a l s o c o - t r a n s c r i b e d a s p a r t o f t h e s p c r i b o s o m a l p r o t e i n o p e r o n ( C e r r e t t i e t a l . , 1 9 8 3 ) . T h e g r o u p i n g o f t h e g e n e s f o r t h e s e m a j o r c e l l u l a r p r o c e s s e s i n v a r i o u s o p e r o n s may p l a y a r o l e i n t h e i r c o o r d i n a t e d e x p r e s s i o n . I n p a r t i c u l a r , t h e s i g m a o p e r o n c o n t a i n s p r o t e i n s i n v o l v e d i n i n i t i a t i o n o f t r a n s c r i p t i o n , t r a n s l a t i o n , a n d r e p l i c a t i o n ( B u r t o n , e t a l . , 1 9 8 3 ) . T h e p r o x i m i t y o f P N P a s e , w i t h t h e g e n e f o r t R N A ^ ^ . I F 2 a / 6 , n u s A p r o t e i n a n d S 1 5 may l i n k t h e p r o c e s s e s o f t r a n s c r i p t i o n t e r m i n a t i o n , t r a n s l a t i o n a l i n i t i a t i o n , a n d m e s s a g e i n a c t i v a t i o n a n d / o r d e g r a d a t i o n . T h e l i n k a g e w o u l d a l s o b e a p t i n t h e c a s e t h a t p r o c e s s i n g b y P N P a s e a l l o w s f o r g e n e e x p r e s s i o n . D . R IBOSOMAL P R O T E I N S 1 5 T h e p r i m a r y p r o t e i n s e q u e n c e o f S 1 5 w a s d e t e r m i n e d b y a c o m b i n a t i o n o f a u t o m a t i c a m i n o a c i d a n a l y s i s o f p e p t i d e s a n d Edman d e g r a d a t i o n o f p e p t i d e s ( M o r i n a g a e t a l . , 1 9 7 6 ) . T h e p r o t e i n (MW 1 0 , 0 0 0 ) c o n s i s t s o f 2 1 b a s i c a n d 10 a c i d i c a m i n o a c i d s , w i t h n o p r o l i n e , c y s t e i n e o r t r y p t o p h a n . R i b o s o m a l p r o t e i n S15 i s o n e o f s i x c o r e p r o t e i n s o f t h e 3 0 S s u b u n i t w h i c h b i n d t i g h t l y t o t h e 16S r i b o s o m a l RNA i n t h e i n i t i a l s t a g e s o f r i b o s o m e a s s e m b l y ( W b e s e e t a l . , 1 9 8 0 ; N o m u r a a n d H e l d , 1 9 7 4 ) . T h e s e q u e n c e a n d s e c o n d a r y s t r u c t u r e o f 16S r R N A h a v e b e e n d e t e r m i n e d ( B r o s i u s e t a l . , 1 1 . 1 9 7 8 ; W o e s e e t a l . , 1 9 8 0 ) a n d t h e b i n d i n g s i t e o f S 1 5 t o t h e 1 6 S r R N A h a s b e e n d e f i n e d b y R N a s e h y d r o l y s i s o f u n p r o t e c t e d f r a g m e n t s w h e n t h e p r o t e i n i s c o m p l e x e d w i t h t h e RNA ( Z i m m e r m a n , 1 9 7 4 ) . P r o t e i n S15 i n t e r a c t s w i t h t h e c e n t r a l n u c l e a t i o n s i t e I I , ( n u c l e o t i d e s 5 5 0 - 8 5 0 ) . M a n y o f t h e p r o t e i n s w h i c h b i n d t o r R N A i n t h e i n t a c t r i b o s o m e h a v e b e e n i m p l i c a t e d a s b e i n g r e p r e s s o r s o f t h e t r a n s l a t i o n o f t h e i r own o p e r o n mRNAs ( D e n n i s a n d F i l l , 1 9 7 9 ; N o m u r a e t a l . , 1 9 8 0 ) . S u c h r e p r e s s o r a c t i v i t y h a s b e e n d e m o n s t r a t e d f o r L I i n t h e L l l o p e r o n , S4 i n t h e a o p e r o n , S7 i n t h e s p c o p e r o n , S8 i n t h e s t r o p e r o n , L 4 i n t h e S 1 0 o p e r o n , a n d L 1 0 i n t h e fci o p e r o n ( N o m u r a e t a l . , 1 9 8 0 ; J o h n s e n e t a l . , 1 9 8 2 ; L i n d a h l e t a l . , 1 9 8 3 ) . T h e s e r e p r e s s o r p r o t e i n s a r e b e l i e v e d t o i n t e r a c t w i t h a s p e c i f i c s e q u e n c e i n t h e l e a d e r r e g i o n o f t h e i r own p o l y c i s t r o n i c mRNA; t h e s e l e a d e r s e q u e n c e s e x h i b i t p r i m a r y a n d s e c o n d a r y s t r u c t u r a l h o m o l o g y w i t h p r o t e i n b i n d i n g s i t e s o n mRNA. T h u s t h e r a t e o f t r a n s l a t i o n o f t h e r i b o s o m a l p r o t e i n mRNA i s b a l a n c e d t o t h e a v a i l a b i l i t y o f r R N A . T h e S 1 5 p r o t e i n a l s o a p p e a r s t o be a b l e t o r e g u l a t e i t s own s y n t h e s i s . T a k a t a e t a l . ( 1 9 8 2 ) d e m o n s t r a t e d t h a t a p l a s m i d c a r r y i n g r p s O a m p l i f i e s t h e c o p y n u m b e r b y 20 b u t r e s u l t s i n l e s s t h a n a 2 - f o l d i n c r e a s e i n S 1 5 s y n t h e s i s . T h e a c t i v i t y o f P N P a s e , t h e g e n e e n c o d e d b y t h e g e n e i m m e d i a t e l y a d j a c e n t t o r p s O h a s b e e n l o c a l i z e d t o t h e 30S s u b u n i t i n E_. c o l i , ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ) . T h i s r a i s e s t h e p o s s i b i l i t y t h a t t h e t w o g e n e s r p s O a n d p n p may be s u b j e c t t o c o o r d i n a t e r e g u l a t i o n a n d c o - t r a n s c r i p t i o n . I n o r d e r t o g a i n some i n s i g h t i n t o t h e in v i v o f u n c t i o n o f P N P a s e a n d t h e m e c h a n i s m r e g u l a t i n g i t s s y n t h e s i s , I h a v e c l o n e d t h e p n p g e n e a l o n g with the adjacent rpsO gene and have begun the char a c t e r i z a t i o n of t h e i r genetic organization and expression. 13. MATERIALS AND METHODS A . B A C T E R I A L S T R A I N S T h e b a c t e r i a l s t r a i n s u s e d a r e l i s t e d i n T a b l e 1 . B . MED IA AND CULTURE CONDIT IONS C o m p l e t e m e d i a w a s NY ( M i l l e r , 1 9 7 2 ) . M i n i m a l m e d i a wa s M9 s a l t s ( M i l l e r , 1 9 7 2 ) , 0 . 2% g l u c o s e , B^ ( 0 . 5 u g / m l ) a n d 0 .4% c a s a m i n o a c i d s . I n c a s e s w h e r e c a s a m i n o a c i d s w o u l d i n t e r f e r e , r e q u i r e d a m i n o a c i d s w e r e a d d e d i n d i v i d u a l l y ( 5 0 u g / m l ) . T r a n s d u c t a n t s t o a r g i n i n e i n d e p e n d e n c e w e r e s e l e c t e d o n m i n i m a l m e d i a l a c k i n g a r g i n i n e . I n o r d e r t o s c o r e f o r l a c t o s e p h e n o t y p e , c e l l s w e r e p l a t e d t o M c C o n k e y l a c t o s e i n d i c a t o r p l a t e s , o r NY p l a t e s c o n t a i n i n g 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - £ - D - g a l a c t o s i d a s e , c o m m o n l y k n o w n a s X - g a l ( 1 0 0 u g / m l ) . P l a t e s c o n t a i n i n g 5 - m e t h y l t r y p t o p h a n ( 2 0 u g / m l ) w e r e u s e d t o s c o r e m e t h y l t r y p t o p h a n r e s i s t a n c e ( m t r ) . A n t i b i o t i c c o n c e n t r a t i o n s w e r e : a m p i c i l l i n 1 0 0 u g / m l ; t e t r a c y c l i n e 10 u g / m l ; k a n a m y c i n 20 u g / m l ; s t r e p t o m y c i n 20 u g / m l . G r o w t h w a s a t 3 7 ° C u n l e s s o t h e r w i s e s t i p u l a t e d . C . TRANSDUCTION BY BACTER IOPHAGE P l B a c t e r i o p h a g e P l v ^ r w a s o b t a i n e d f r o m M . W h i t e w a y a n d l y s a t e s w e r e p r e p a r e d a c c o r d i n g t o M i l l e r ( M i l l e r , 1 9 7 2 ) . P h a g e w e r e a d s o r b e d t o f r e s h l o g p h a s e c e l l s a t a m u l t i p l i c i t y o f i n f e c t i o n o f 1 0 : 1 , p l a t e d i n NY s o f t a g a r c o n t a i n i n g 0 . 0 1 M C a C l j a n d i n c u b a t e d o v e r n i g h t a t 3 7 ° C . T h e p h a g e - c l e a r e d s o f t a g a r w a s s c r a p e d o f f i n t o C o r e x c e n t r i f u g e t u b e s , c h l o r o f o r m a d d e d , a n d l y s a t e s c l e a r e d i n t h e S S 3 4 r o t o r a t 7 , 0 0 0 r pm f o r 10 m i n . F o r t r a n s d u c t i o n s , l y s a t e s w e r e a d s o r b e d t o 1 0 - f o l d c o n c e n t r a t e d 1 4 . T A B L E 1 B a c t e r i a l s t r a i n s S t r a i n G e n o t y p e S o u r c e M C 1 0 0 0 P 9 0 A 5 C K Y 4 1 1 6 K Y 4 1 3 K 9 5 K 3 7 N 1 1 0 2 N 1 1 0 3 S C 1 0 1 S C 1 0 2 C S R 6 0 3 M C 1 0 2 2 J M 8 3 J M 1 0 3 C P 7 8 C P 7 9 a r a D 1 3 9 A ( a r a B C O T C - l e u ) A ( l a c I O P Z Y ) g a l U g a l K s t r A t h i r e c A a r g G l a c B^ H f r H m e t r p s L m t r - 1 6 H f r H me t r p s L g a l s t r A n u s A g a l s t r A r n a - 1 9 l a c t h r l e u p n p - 7  r n a - 1 9 l a c t h r l e u M C 1 0 0 0 : : T n 5 M C 1 0 0 0 : :Tn5_ p h r - 1 r e c A l t h r l e u p r o a r g h i s B^ a r a D 1 3 9 A ( a r a O l e u ) 7 697 A ( l a c Z ) M 1 5 g a l U g a l K S t r A a r a A( l a c - p r o ) s t r A t h i ip80d l a c Z AM15 l a c p r o T h i S t r A e n d A S b c B 1 5 h s c ! 5 4 s u p E f t r a D 3 6 p r o A B l a c 1 Q Z M13 t h r l e u a u g h i s t h i M . C a s a d a b a n J . H a r r i s S . H i r a g a S . H i r a g a D . F r i e d m a n D . F r i e d m a n R. K r i s h n a R . K r i s h n a T h i s p a p e r T h i s p a p e r A . S a n c a r t h r l e u a r g h i s t h i r e l A 2 J . M e s s i n g J . M e s s i n g C . P a o C . P a o 1 5 . c e l l s a t a m u l t i p l i c i t y o f i n f e c t i o n 1 0 0 : 1 , c e l l s w e r e w a s h e d , r e s u s p e n d e d i n 1 /4 v o l u m e s a l i n e a n d p l a t e d o n s e l e c t i v e m e d i a . D . I N S E R T I O N MUTAGENES IS WITH TRANSPOSON TnJ5 B a c t e r i o p h a g e A C I 8 5 7 , r e x : : T n 5 , ( ) 2 9 ( a m ) , £ 8 0 ( a m ) b 2 2 1 w a s o b t a i n e d f r o m N . F i l l . T h i s p h a g e c a r r i e s Tn_5 a n d i s u n a b l e t o i n t e g r a t e i n t o t h e h o s t c h r o m o s o m e o r t o r e p l i c a t e i n t h e a b s e n c e o f a h o s t s u p p r e s s o r ( B e r g , 1 9 7 7 ) . R e c i p i e n t b a c t e r i a w e r e g r o w n o v e r n i g h t i n 2 m l N Y , 0 . 0 1 M M g C l 2 ( a n d a n t i b i o t i c f o r p l a s m i d s t r a i n s ) , i n t h e a b s e n c e o f g l u c o s e , a n d i n f e c t e d w i t h X : : T n 5 a t a m u l t i p l i c i t y o f i n f e c t i o n o f 5 - 1 0 . A f t e r 3 h o u r s o f i n c u b a t i o n a t 3 7 ° , c e l l s w e r e s e d i m e n t e d , r e s u s p e n d e d i n 0 . 2 m l o f m e d i u m a n d p l a t e d o n t o NY c o n t a i n i n g k a n a m y c i n . C o l o n i e s r e s i s t a n t t o k a n a m y c i n w e r e p o o l e d i n 2 m l NY b r o t h c o n t a i n i n g k a n a m y c i n , a n d s t o r e d i n 20% g l y c e r o l a t - 8 0 ° C . F o r t h e c o n s t r u c t i o n o f s t r a i n s c a r r y i n g Tn_5 n e a r t h e p n p l o c u s , a l i q u o t s o f t h i s m i x t u r e w e r e s u b c u l t u r e d a n d u s e d t o g r o w P l l y s a t e s f o r t r a n s d u c t i o n o f P 9 0 A 5 C ( a r g ) . F o r I s o l a t i n g t r a n s p o s i t i o n s o f Tn_5 o n t o p l a s m i d p H E l i n s t r a i n M C 1 0 0 0 , p l a s m i d DNA w a s e x t r a c t e d f r o m t h e m i x t u r e a n d u s e d t o r e t r a n s f o r m M C 1 0 0 0 , s e l e c t i n g f o r AmpR K a n R . E . P O L Y N U C L E O T I D E PHOSPHORYLASE A S S A Y A c t i v i t y wa s a s s a y e d b y ADP p o l y m e r i s a t i o n i n t o l u e n i z e d e x t r a c t s . T h i s a p p r o a c h h a s b e e n s h o w n t o be a r e l i a b l e a n d s p e c i f i c a s s a y f o r P N P a s e ( L e v i n e t a l . , 1 9 6 3 ) . T o l u e n e ( 1 0 u l ) w a s a d d e d t o 0 . 5 m l o f o v e r n i g h t c u l t u r e g r o w n i n NY ( p l u s a n t i b i o t i c f o r p l a s m i d s t r a i n s ) , a n d s h a k e n g e n t l y a t 3 7 ° C , 10 m i n . A m e a s u r e d p o r t i o n ( 1 0 0 u l ) o f t h e e x t r a c t w a s a s s a y e d i n a r e a c t i o n m i x c o n t a i n i n g 2 5 0 mM T r i s - H C l ( p H 8 . 0 ) , 4 . 2 mM 14 [ C ] - A D P ( A m e r s h a m I n t e r n a t i o n a l , 56 m C i / m m o l ) , 4 . 2 mM M g C l » i n a 1 6 . f i n a l v o l u m e o f a p p r o x i m a t e l y 2 8 0 u l . R e a c t i o n s w e r e g e n t l y s h a k e n a t 3 7 ° C f o r 1 0 m i n . , a n d p r e c i p i t a t e d w i t h 1 m l 5% TCA a t 0 ° C . P r i o r t o I f i l t r a t i o n , n i t r o c e l l u l o s e f i l t e r s ( S c h l e i c h e r a n d S c h u l l , 24 mm d i a m e t e r , 0 . 4 5 m i c r o n p o r e s i z e ) w e r e r i n s e d i n 25 mM s o d i u m p h o s p h a t e i n 5% T C A . F o l l o w i n g f i l t r a t i o n o f t h e s a m p l e s e a c h f i l t e r wa s w a s h e d w i t h 5 m l 5% TCA a n d 5 m l 1% T C A , d r i e d , a n d c o u n t e d i n t o l u e n e s c i n t i l l a t i o n f l u i d c o n t a i n i n g 0 . 1 g / 1 POPOP a n d 4 . 0 g / 1 P O P . F . R E S T R I C T I O N ENZYME D I G E S T I O N S E n z y m e s u s e d w e r e : E c o R I a n d P s t I f r o m B o e h r i n g e r M a n n h e i m ; H i n d l l l BamHI a n d B g l l l f r o m B R L ; S a i l , H i n d i , P s t I , H p a l , H p a l l , X h o l , A c c I , S a u 3 A , a n d T a q I f r o m B i o l a b s ; B a m H I , E c o R I , S m a l l y p h o z y m e s w e r e u s e d f r o m B e t h e s d a R e s e a r c h L a b o r a t o r i e s . D i g e s t s w e r e c a r r i e d o u t a c c o r d i n g t o t h e i n s t r u c t i o n s o f t h e s u p p l i e r . G . P A R T I A L R E S T R I C T I O N D I G E S T I O N S FOR CLONING T o e s t a b l i s h t h e c o r r e c t d i g e s t i o n c o n d i t i o n s , s e r i a l d i l u t i o n s o f e n z y m e w e r e u s e d f o r e a c h r e a c t i o n c o n t a i n i n g 4 ug o f DNA i n a f i n a l v o l u m e o f 5 0 u l . R e a c t i o n s w e r e t e r m i n a t e d w i t h 10 u l o f s t o p m i x (20% F i c o l , 2 0 mM E D T A , 0 . 0 1 % b r o m o p h e n o l b l u e ) a n d 20 u l w e r e l o a d e d o n t o 0 .7% a g a r o s e g e l s . O n c e t h e c o r r e c t d i l u t i o n s o f e n z y m e h a d b e e n d e t e r m i n e d , p a r t i a l d i g e s t i o n s w e r e c a r r i e d o u t a c c o r d i n g l y , s t o p p e d b y t h e a d d i t i o n o f 4 u l 0 . 5 M E D T A , e x t r a c t e d w i t h b u f f e r - s a t u r a t e d p h e n o l , t w o t i m e s w i t h c h l o r o f o r m , a n d e t h a n o l p r e c i p i t a t e d . T h e p e l l e t w a s r e s u s p e n d e d i n TE b u f f e r ( 1 0 mM T r i s pH 7 . 5 , 1 mM EDTA ) a t 1 u g / u l , a n d u s e d f o r l i g a t i o n w i t h p B R 3 2 2 d i g e s t e d w i t h t h e same e n z y m e , e x t r a c t e d a n d p r e c i p i t a t e d i n t h e same m a n n e r . 1 7 . H . L I G A T I O N L i g a t i o n r e a c t i o n s w e r e c a r r i e d o u t i n l i g a t i o n b u f f e r ( 2 5 mM T r i s HC1 pH 7 . 4 , 1 0 mM M g C l 2 , 2 0 mM DTT a n d 1 mM A T P ) i n a f i n a l v o l u m e o f 20 u l a n d c o n t a i n i n g 1 ug o f v e c t o r p l a s m i d DNA a n d 1 - 3 f o l d m o l a r e x c e s s o f t h e DNA t o b e c l o n e d . I n c u b a t i o n w a s 4 - 6 h r a t 1 4 - 1 8 ° C u s i n g 0 . 2 u n i t s o f T 4 DNA l i g a s e ( B R L , s p e c . a c t . 2 u / u l ) . F o r b l u n t e n d l i g a t i o n s , 1 u n i t o f l i g a s e wa s u s e d a n d i n c u b a t i o n wa s a t r o o m t e m p e r a t u r e o v e r n i g h t . M13 l i g a t i o n s w e r e c a r r i e d o u t a c c o r d i n g t o M e s s i n g ( M e s s i n g , J . , 1 9 8 0 ) . I . TRANSFORMATION C o m p e t e n t c e l l s w e r e p r e p a r e d b y s e d i m e n t i n g 5 0 m l o f e a r l y l o g p h a s e c u l t u r e , r e s u s p e n d i n g i n 1 /2 v o l u m e 50 mM C a C ^ a t 0 ° C f o r 25 m i n , s e d i m e n t i n g , a n d r e s u s p e n d i n g I n 1 / 1 0 v o l u m e 5 0 mM C a C ^ a t 0 ° C . C o m p e t e n t c e l l s ( 0 . 1 m l ) w e r e m i x e d w i t h 0 . 1 - 2 . 0 ug DNA , l e f t o n i c e f o r 6 0 m i n . , a n d p l a t e d d i r e c t l y t o s e l e c t i v e m e d i a . I f s e l e c t i o n was f o r k a n a m y c i n o r t e t r a c y c l i n e r e s i s t a n c e , 0 . 1 m l NY b r o t h wa s a d d e d , a n d c e l l s w e r e i n c u b a t e d a t 3 7 ° C f o r 2 h r b e f o r e p l a t i n g . J . SMALL S C A L E P R E P A R A T I O N OF P L A S M I D DNA C u l t u r e s ( 1 5 m l ) o f t h e p l a s m i d c o n t a i n i n g s t r a i n w e r e g r o w n i n m i n i m a l m e d i u m p l u s a n t i b i o t i c a n d a m p l i f i e d w i t h c h l o r a m p h e n i c o l ( 1 5 0 u g / m l ) . C e l l s w e r e h a r v e s t e d , r e s u s p e n d e d i n 2 0 0 u l s o l u t i o n A ( 5 0 mM T r i s pH 8 . 0 , 25% s u c r o s e ) , 1 0 u l o f l y s o z y m e s o l u t i o n ( 4 m g / m l i n s o l u t i o n A ) , a n d l e f t o n i c e 10 m i n . A n a l i q u o t o f 2 5 0 u l s o l u t i o n B ( 5 0 mM T r i s pH 8 . 0 , 6 0 mM E D T A , 0 . 1 % S D S ) w a s a d d e d , v o r t e x e d , a n d l e f t o n i c e 5 - 1 0 m i n u n t i l l y s i s wa s c o m p l e t e . L y s a t e s w e r e c l e a r e d a t 1 7 , 0 0 0 r pm i n a S o r v a l l S M - 2 4 r o t o r . S u p e r n a t a n t s w e r e d e c a n t e d t o E p p e n d o r f t u b e s , a n d 1 8 . e x t r a c t e d w i t h 2 0 0 p l b u f f e r - s a t u r a t e d p h e n o l a n d 2 0 0 y l p h e n o l : c h l o r o f o r m ( 3 : 1 ) . P o t a s s i u m a c e t a t e wa s a d d e d t o 0 . 3 M a n d t u b e s w e r e p l a c e d o n i c e t o p r e c i p i t a t e t h e SDS a n d p r o t e i n s . T h e a q u e o u s p h a s e w a s f u r t h e r e x t r a c t e d w i t h p h e n o l : c h l o r o f o r m ( 1 : 1 ) , t w i c e w i t h c h l o r o f o r m , a n d t h e DNA p r e c i p i t a t e d t w i c e w i t h e t h a n o l . T h e p e l l e t wa s r e s u s p e n d e d i n 4 0 u l o f TE b u f f e r . A l i q u o t s w e r e u s e d f o r e i t h e r r e s t r i c t i o n a n a l y s i s ( 1 0 P l ) , o r f o r t r a n s f o r m a t i o n ( 1 u l ) . K . L ARGE S C A L E P R E P A R A T I O N OF P L A S M I D DNA S t r a i n s w e r e g r o w n a s d e s c r i b e d f o r t h e s m a l l s c a l e p r e p a r a t i o n , b u t i n a v o l u m e o f 5 0 0 m l . L y s o z y m e - S D S l y s a t e s w e r e c l e a r e d a t 1 6 , 0 0 0 r p m , 1 h r , i n t h e S S 3 4 r o t o r . T h e d e n s i t y wa s a d j u s t e d t o 1 . 5 8 w i t h C s C l a n d c e n t r i f u g e d i n a 5 0 T i r o t o r a t 3 6 , 0 0 0 r p m , f o r 72 h r . P l a s m i d b a n d s w e r e r e m o v e d , e x t r a c t e d w i t h i s o p r o p a n o l t o r e m o v e t h e e t h i d i u m b r o m i d e , a n d d i a l y z e d a g a i n s t TE b u f f e r . E t h a n o l p r e c i p i t a t e d DNA wa s r e s u s p e n d e d t o a c o n c e n t r a t i o n o f 1 m g / m l . L . DNA E L E C T R O P H O R E S I S A g a r o s e s l a b g e l s ( 0 . 7 % ) w e r e r u n i n AGB b u f f e r ( 4 0 mM T r i s pH 8 . 0 , 20 mM s o d i u m a c e t a t e , 1 mM E D T A , e t h i d i u m b r o m i d e 0 . 5 u g / m l ) a t 1 5 0 mA. F o r d e t e c t i o n o f s m a l l e r f r a g m e n t s , 1 . 5 mm 5% a c r y l a m i d e g e l s w e r e r u n i n TBE b u f f e r ( 9 0 mM T r i s pH 8 . 2 , 90 mM b o r i c a c i d , 2 . 5 . mM E D T A ) , a t 1 5 0 mA. G e l s w e r e s t a i n e d i n 0 . 5 u g / m l o f e t h i d i u m b r o m i d e . M o l e c u l a r s i z e s t a n d a r d s w e r e p J C 7 0 1 DNA c u t w i t h E c o R I f o r f r a g m e n t s r a n g i n g f r o m 1 - 6 K b , a n d p B R 3 2 2 DNA c u t w i t h H p a l l f o r f r a g m e n t s o f 6 0 - 6 0 0 bp ( s e e M a n i a t i s , 1 9 8 2 f o r M W s ) . E l e c t r o p h o r e s i s o f DNA f r a g m e n t s o n a p r e p a r a t i v e s c a l e w a s c a r r i e d o u t o n 3 . 0 mm t h i c k a c r y l a m i d e g e l s . E t h i d i u m b r o m i d e s t a i n e d 1 9 . b a n d s w e r e c u t o u t , p l a c e d i n d i a l y s i s t u b i n g a n d e l e c t r o e l u t e d i n a h o r i z o n t a l g e l a p p a r a t u s w i t h 0 . 5 X TBE a t 2 0 0 V f o r 1 h r . T h e e l u a t e wa s c o l l e c t e d , p h e n o l c h l o r o f o r m e x t r a c t e d , e t h a n o l p r e c i p i t a t e d a n d w a s h e d . M . M A X I C E L L C S R 6 0 3 L A B E L L I N G M a x i c e l l e x p e r i m e n t s w e r e p e r f o r m e d a s d e s c r i b e d ( S a n c a r e t a l . , 1 9 7 9 ) . T h e UV s e n s i t i v e s t r a i n C S R 6 0 3 wa s g r o w n i n m i n i m a l m e d i a p l u s r e q u i r e d a m i n o a c i d s , a n d a m p i c i l l i n f o r p l a s m i d s t r a i n s . A t A ^ n a p p r o x i m a t e l y 0 . 4 , a p p r o x i m a t e l y 10 m l c e l l s w e r e t r a n s f e r r e d t o a s t e r i l e p e t r i d i s h a n d UV i r r a d i a t e d f o r 15 s e c a t a d i s t a n c e o f 56 c m . A n a l i q u o t ( 0 . 2 m l ) wa s r e m o v e d a n d p l a t e d t o NY a g a r f o r s c o r i n g c e l l v i a b i l i t y . T h e r e m a i n d e r o f t h e i r r a d i a t e d c u l t u r e wa s t r a n s f e r r e d t o a s t e r i l e f l a s k a n d i n c u b a t e d o v e r n i g h t w i t h a e r a t i o n a t 3 7 ° C . I n t h e m o r n i n g , c e l l s w e r e s p u n d o w n a n d r e s u s p e n d e d i n 5 m l f r e s h m i n i m a l m e d i a a n d i n c u b a t e d a t 3 7 ° C f o r 3 0 m i n . A n a l i q u o t ( 0 . 2 m l ) o f t h i s c u l t u r e wa s p l a t e d t o c h e c k f o r c o n t a m i n a n t s . A t t h i s p o i n t , 5 . 0 u C i / m l o f [ 3 5 S " - m e t h i o n i n e ( A m e r s h a m , 1 2 . 7 5 m C i / u m o l / m l ) w a s a d d e d t o 2 m l o f c e l l s , a n d l a b e l l e d f o r o n e h r a t 3 7 ° C . A f t e r l a b e l l i n g , c e l l s w e r e h a r v e s t e d , r e s u s p e n d e d i n 0 . 2 5 m l l y s i s b u f f e r , a n d h e a t e d f o r 5 m i n a t 9 0 ° C b e f o r e l o a d i n g 2 5 - 1 0 0 p l o n t o e l e c t r o p h o r e s i s g e l s . N . P R O T E I N E L E C T R O P H O R E S I S R u n n i n g c o n d i t i o n f o r S D S - p o l y a c r y l a m i d e g e l s (3% s t a c k i n g a n d 1 2 . 5 % s e p a r a t i n g ) w e r e a s d e s c r i b e d b y L a e m m l i ( L a e m m l i , 1 9 7 0 ) . S a m p l e s w e r e r u n i n t o t h e g e l a t 2 0 mA, r u n a t 4 0 mA f o r s i x t o t e n h r , s t a i n e d o v e r n i g h t i n 50% T C A , 0 . 1 % C o o m a s s i e b l u e , a n d d e s t a i n e d s e v e r a l h o u r s i n 5% m e t h a n o l , 7% a c e t i c a c i d . K o d a k X R P 1 f i l m wa s p l a c e d o n t h e d r i e d g e l s , a n d 2 0 . e x p o s e d . A p a r t i a l l y p u r i f i e d p r e p a r a t i o n o f p o l y n u c l e o t i d e p h o s p h o r y l a s e f r o m E . c o l i w a s g e n e r o u s l y p r o v i d e d b y S . G i l l a m . M o l e c u l a r w e i g h t s t a n d a r d s o b t a i n e d f r o m P h a r m a c i a w e r e : p h o s p h o r y l a s e b 9 4 , 0 0 0 ; a l b u m i n 5 8 , 0 0 0 ; o v a l b u m i n 4 3 , 0 0 0 ; c a r b o n i c a n h y d r a s e 3 0 , 0 0 0 t r y p s i n i n h i b i t o r 2 0 , 0 0 0 ; t J - l a c t a l b u m i n 1 4 , 4 0 0 . 0 . R E P A I R OF 3 ' - E N D S (KLENOW F I L L - I N ) F i l l i n g r e c e s s e d 3 ' e n d s o f d o u b l e s t r a n d e d DNA b y t h e K l e n o w f r a g m e n t o f DNA p o l y m e r a s e I o f E_. c o l i w a s c a r r i e d o u t a s d e s c r i b e d b y M a n i a t i s ( M a n i a t i s , e t a l . , 1 9 8 2 ) . K l e n o w e n z y m e wa s o b t a i n e d f r o m B e t h e s d a R e s e a r c h L a b o r a t o r i e s . One u n i t o f e n z y m e w a s a d d e d t o 2 n m o l e s o f e a c h d N T P ( a s n e e d e d ) , 2 p m o l e s [ c x - 3 2 P ] d N T P ( A m e r s h a m o r New E n g l a n d N u c l e a r , s p . a c t . >400 C i / m m o l ) , 1 ug o f DNA , a n d 2 p l o f 1 0X n i c k t r a n s l a t i o n b u f f e r ( 0 . 5 M T r i s - C l pH 7 . 2 , 0 . 1 M M g S 0 4 , 1 mM d i t h i o t h r e i t o l , 5 0 0 Mg /m l B S A ) i n a f i n a l v o l u m e o f 25 u l . I n c u b a t i o n w a s a t RT f o r 3 0 m i n . R e a c t i o n s w e r e s t o p p e d b y a d d i n g 1 u l 0 . 5 M E D T A , e x t r a c t e d w i t h p h e n o l / c h l o r o f o r m ( 1 : 1 ) a n d w i t h p h e n o l / c h l o r o f o r m / i s o a m y l a l c o h o l ( 2 5 : 2 4 : 1 ) . T h e DNA w a s p r e c i p i t a t e d t w i c e w i t h e t h a n o l a n d w a s h e d w i t h 70% e t h a n o l . P . ORDERING OF P s t I FRAGMENTS BY END L A B E L L I N G AND P A R T I A L D I G E S T I O N T h i s m e t h o d w a s a d a p t e d f r o m t h a t o f S m i t h e t a l . , ( S m i t h e t a l . , 1 9 7 6 ) . P l a s m i d p H E l wa s d i g e s t e d w i t h E c o R I a n d 3 ' l a b e l l e d b y K l e n o w f i l l - i n . T h e DNA w a s e t h a n o l p r e c i p i t a t e d a n d w a s h e d , t h e n c u t w i t h H i n d l l l , r u n o n a 0 .7% p r e p a r a t i v e a g a r o s e g e l , a n d t h e l a b e l l e d 5 k b f r a g m e n t wa s e l e c t r o e l u t e d . T h i s DNA ( a p p r o x i m a t e l y 2 u g ) a n d c a r r i e r l a m b d a DNA ( a p p r o x i m a t e l y 3 u g ) w e r e d i g e s t e d w i t h 3 u o f P s t I i n a f i n a l v o l u m e o f 40 u l . S a m p l e s ( 1 0 u l ) w e r e r e m o v e d a t 1 m i n . i n t e r v a l s t o d r y i c e a n d e t h a n o l . L a m b d a DNA d i g e s t e d w i t h H i n d l l l w a s l a b e l l e d w i t h K l e n o w e n z y m e a n d u s e d a s a m o l e c u l a r w e i g h t s t a n d a r d . S a m p l e s w e r e r u n o n a 0 .7% a g a r o s e g e l w h i c h wa s t h e n b l o t t e d w i t h a s t a c k o f p a p e r t o w e l s o v e r n i g h t i n o r d e r t o d r y t h e g e l f o r a u t o r a d i o g r a p h y . Q . N I C K T R A N S L A T I O N N i c k t r a n s l a t i o n wa s p e r f o r m e d a c c o r d i n g t o M a n i a t i s ( M a n i a t i s e t a l . , 1 9 8 2 ) . One ug o f t h e DNA p r o b e wa s i n c u b a t e d w i t h 1 n m o l e o f e a c h o f t h e u n l a b e l l e d d N T P s , 1 7 0 p m o l e s o f [ c t 3 2 - P ] d A T P (New E n g l a n d N u c l e a r , 0 . 2 5 m C i / 8 7 p m o l e s / 0 . 0 2 5 m l ) , 5 u l 1 0X n i c k t r a n s l a t i o n b u f f e r ( 0 . 5 M T r i s - C l pH 7 . 2 , 0 . 1 M M g S 0 4 , 1 mM d i t h i o t h r e i t o l , 5 0 0 u g / m l B S A ) a n d 1 u l 1 0 mM C a C l ^ i n a f i n a l v o l u m e o f 37 u l . F i v e u l o f a 5 x 1 0 " 6 d i l u t i o n o f D N A s e I (New E n g l a n d N u c l e a r ) a n d 2 u l o f DNA p o l y m e r a s e I ( N e w E n g l a n d N u c l e a r ) w e r e a d d e d , a n d t h e r e a c t i o n wa s i n c u b a t e d a t 1 5 ° C f o r 2 h r . T h e r e a c t i o n wa s s t o p p e d b y t h e a d d i t i o n o f 1 u l o f 0 . 5 M EDTA a n d h e a t e d a t 6 8 ° C f o r 1 0 m i n . T h e DNA p r o b e wa s s e p a r a t e d f r o m u n i n c o r p o r a t e d n u c l e o t i d e s t h r o u g h a n A c A 5 4 c o l u m n ( U l t r a g e l , 5 , 0 0 0 - 7 0 , 0 0 0 , L K B ) . C o l u m n b u f f e r wa s 0 . 1 M N a C l , 1 0 mM T r i s pH 7 . 5 , a n d 1 mM EDTA pH 8 . 0 . T h e A c A 5 4 wa s e q u i l i b r a t e d t o r o o m t e m p e r a t u r e a n d d e g a s s e d b e f o r e p o u r i n g . T h e c o l u m n wa s w a s h e d w i t h a p p r o x i m a t e l y 1 0 0 m l o f b u f f e r a t a f l o w r a t e o f a b o u t 0 . 5 m l p e r m i n . One m l f r a c t i o n s w e r e c o l l e c t e d a n d a s s a y e d b y C e r e n k o v c o u n t i n g . R a d i o a c t i v e f r a c t i o n s f r o m t h e l e a d i n g p e a k w e r e p o o l e d a n d s t o r e d a t - 2 0 ° C . R . p - G A L A C T O S I D A S E A S S A Y A s s a y s f o r 3 - g a l a c t o s i d a s e w e r e p e r f o r m e d a c c o r d i n g t o M i l l e r ( M i l l e r , J . , 1 9 7 2 ) . S t r a i n s t o be a s s a y e d w e r e i n o c u l a t e d f r o m f r e s h o v e r n i g h t c u l t u r e s a n d g r o w n a t 3 7 ° C i n M9 g l u c o s e w i t h c a s a m i n o a c i d s a n d a m p i c i l l i n o r i n NY w i t h g l u c o s e a n d a m p i c i l l i n . Two m l s a m p l e s w e r e r e m o v e d a t t i m e d i n t e r v a l s b e t w e e n c e l l d e n s i t i e s o f A ^ n 0 . 2 - 0 . 8 a n d l e f t o n i c e 20 m i n . T h e a s s a y wa s p e r f o r m e d i n a f i n a l v o l u m e o f 2 . 8 m l . T r i p l i c a t e s a m p l e s 0 . 1 - 0 . 5 m l w e r e a d d e d t o 1 . 0 - 1 . 4 m l Z b u f f e r , 5 0 p l o f 0 . 1 % SDS a n d 1 0 0 M l o f C H C 1 3 a t 2 8 ° C . I n c u b a t i o n t i m e w a s s t a r t e d b y t h e a d d i t i o n o f 0 . 3 m l o f 4 m g / m l ONPG a n d s t o p p e d b y t h e a d d i t i o n o f 1 m l o f N a 2 C 0 g w h e n t h e y e l l o w c o l o r h a d d e v e l o p e d s u f f i c i e n t l y ( A ^ Q 0 . 6 - 0 . 9 ) . S a m p l e s w e r e t h e n d e c a n t e d i n t o 1 . 5 m l E p p e n d o r f t u b e s a n d c e n t r i f u g e d f o r 10 m i n . t o r e m o v e c e l l u l a r d e b r i s i n o r d e r t o e l i m i n a t e s c a t t e r f r o m t h e A ^ 2 Q r e a d i n g s . U n i t s w e r e c a l c u l a t e d a s lOOOx A ^ 2 o / t x v x ^ 4 6 0 ' w h e r e t i s t h e t i m e o f t h e r e a c t i o n i n m i n u t e s a n d v i s t h e v o l u m e o f c u l t u r e u s e d i n t h e a s s a y i n m l . S . CONSTRUCTION OF CLONES FOR DNA SEQUENCING T h e c l o n i n g s t r a t e g y f o r DNA s e q u e n c i n g i s d i a g r a m m e d i n F i g u r e 1 1 . P l a s m i d p H E l w a s d i g e s t e d w i t h H p a l a n d P s t I , a n d f r a g m e n t s H p a l ^ - P s t l ^ , a n d P s t l ^ - H p a l ^ ( F i g u r e 9 ) w e r e i s o l a t e d . T h e s e w e r e c l o n e d i n t o t h e c o m p l e m e n t a r y s e q u e n c i n g v e h i c l e s m p l O a n d m p l l c u t w i t h P s t I a n d S m a l . T h e P s t l - B a m H I f r a g m e n t c o n t a i n i n g t h e p o s s i b l e p n p p r o m o t e r f r o m p S H 1 2 2 wa s c l o n e d i n t o m p l l . T h i s f r a g m e n t c o n t a i n s t h e P s t I ^ t o H p a l ^ / S m a l f u s i o n ( F i g u r e 9 ) . A f t e r c l o n i n g i n t o m p l l , t h e DNA s e q u e n c e c a n be r e a d t h r o u g h t h e H p a l ^ / S m a l f u s i o n j u n c t i o n , t o w a r d t h e s t a r t o f t h e P N P a s e g e n e . T h e 6 0 0 b p E c o R I - B a m H I f r a g m e n t o f p M B l wa s c l o n e d i n t o 2 3 . m p l O c u t w i t h BamHI a n d E c o R I . A g a i n , t h i s o r i e n t a t i o n a l l o w s t h e s e q u e n c e t o b e r e a d t h r o u g h t h e f u s i o n j u n c t i o n i n p M B l t o w a r d t h e s t a r t o f t h e p n p g e n e . T h e P s t l ^ - B a m H I f r a g m e n t f r o m p S H 1 2 2 w a s d i g e s t e d w i t h S a u 3 A a n d d i r e c t l y l i g a t e d t o m p l O c u t w i t h B a m H I . T h e r e a r e t h r e e i n t e r n a l S a u 3 A f r a g m e n t s a n d o n e S a u 3 A - B a m H I f r a g m e n t t o b e o b t a i n e d i n t h i s r a n d o m c l o n i n g e x p e r i m e n t . F i v e p o s i t i v e c l o n e s w e r e s e q u e n c e d . T h r e e o f t h e s e h a d d i f f e r e n t S a u 3 A f r a g m e n t s . T h e s e s e q u e n c e s g a v e m o s t o f t h e P s t l ^ - H p a l ^ s e q u e n c e s i n b o t h o r i e n t a t i o n s , w i t h t h e e x c e p t i o n o f t h e r e g i o n b e t w e e n S a u 3 A ^ - S a u 3 A , , ( F i g u r e 9 ) . A c c o r d i n g l y , t h e s e q u e n c e d S a u 3 A ^ - S a u 3 A ^ c l o n e w a s u s e d a s a p r o b e f o r a c l o n e o f o p p o s i t e o r i e n t a t i o n , w h i c h w a s s u b s e q u e n t l y i s o l a t e d a n d s e q u e n c e d . T o s e q u e n c e t h r o u g h t h e l a c Z f u s i o n j u n c t i o n s , a n d t o e x t e n d t h r o u g h t h e S a u 3 A f r a g m e n t t h a t h a d n o t b e e n o b t a i n e d f r o m t h e r a n d o m c l o n i n g , t h e P s t l ^ - B a m H I f r a g m e n t f r o m p S H 1 2 2 w a s d i g e s t e d w i t h T a q I , a n d c l o n e d i n t o m p l O d o u b l e - d i g e s t e d w i t h A c c I a n d B a m H I . T h e l a r g e T a q l - B a m H I f r a g m e n t f r o m P s t l j - B a m H I c o v e r s t h e r e q u i s i t e a r e a s w h e n s e q u e n c e d i n t h e m p l O c o n t e x t ( F i g u r e 1 1 ) . T . BACTER IOPHAGE M13 SEQUENCING 1 . P h a g e G r o w t h , DNA E x t r a c t i o n , C l o n i n g C l o n i n g i n M13 a n d t h e d i d e o x y s e q u e n c i n g o f S a n g e r ( S a n g e r e t a l . , 1 9 7 6 ) w a s d o n e a s d e s c r i b e d b y M e s s i n g ( M e s s i n g , J . , 1 9 8 0 ) . T h e b e s t r e s u l t s w e r e o b t a i n e d w i t h f r e s h c u l t u r e s o f J M 1 0 3 a n d f r e s h p l a q u e s o f M 1 3 . T h e RF ( r e p l i c a t i v e f o r m ) o f a p a r t i c u l a r M13 v e c t o r wa s i s o l a t e d b y t h e l a r g e s c a l e p l a s m i d p r o c e d u r e . A s i n g l e p l a q u e w a s u s e d t o i n o c u l a t e 2 4 . e a r l y l o g p h a s e J M 1 0 3 a n d g r o w n f o r 5 t o 6 h o u r s . A n a l i q u o t ( 0 . 5 m l ) o f i n f e c t e d c u l t u r e wa s a d d e d t o 0 . 5 m l o f e a r l y l o g p h a s e J M 1 0 3 , u s e d t o i n o c u l a t e 5 0 0 m l o f NY b r o t h , a n d h a r v e s t e d a f t e r 12 h r a t 3 7 ° C . L o n g e r i n c u b a t i o n p e r i o d s d e c r e a s e d t h e y i e l d o f R F . T h e DNA f r a g m e n t s f o r c l o n i n g w e r e l i g a t e d t o t h e c o r r e s p o n d i n g l y d i g e s t e d RF a n d u s e d t o t r a n s f o r m C a C ^ c o m p e t e n t J M 1 0 3 . T h e t r a n s f o r m e d c e l l s w e r e m i x e d w i t h 0 . 3 m l o f e a r l y l o g p h a s e J M 1 0 3 , 10 u l o f 1 0 0 mM I P T G ( i s o p r o p y l t h i o tf-galactosidase) a n d 50 u l o f 2% X - g a l w e r e a d d e d a n d t h e m i x t u r e p l a t e d i n NY s o f t a g a r . T h e M13 v e c t o r s g i v e b l u e p l a q u e s ( L a c ) . R e c o m b i n a n t c l o n e s a p p e a r e d a s c l e a r p l a q u e s . T h e c l e a r p l a q u e b a c k g r o u n d v a r i e d f r o m 1 0 - 5 0 % d e p e n d i n g o n t h e r e s t r i c t i o n e n z y m e b e i n g u s e d . 2 . S c r e e n i n g f o r P o s i t i v e C l o n e s ( a ) F i g u r e - o f - e i g h t s P o t e n t i a l c l o n e s w e r e s c r e e n e d b y t h e f i g u r e - o f - e i g h t a n a l y s i s . A n a l i q u o t ( 1 0 u l ) o f p h a g e s u p e r n a t a n t f r o m a n o v e r n i g h t c u l t u r e i n o c u l a t e d w i t h a s i n g l e p l a q u e w a s m i x e d w i t h 1 0 u l o f t e s t e r p h a g e s u p e r n a t a n t , 1 M l o f 2% SDS a n d i n c u b a t e d a t 6 8 ° C f o r 1 h r . F i v e u l o f 20% F i c o l , 0 . 0 1 % b r o m o p h e n o l b l u e w e r e a d d e d a n d 20 u l w e r e l o a d e d o n t o 0 .7% a g a r o s e g e l s r u n a t 2 5 0 MA f o r a p p r o x i m a t e l y 1 h r . P o s i t i v e c l o n e s w h i c h h y b r i d i z e t o t h e t e s t e r DNA m i g r a t e m o r e s l o w l y t h a n t h e s i n g l e - s t r a n d e d DNA a l o n e . b . D o t B l o t s D o t b l o t a n a l y s i s w a s a l s o u s e d t o i d e n t i f y p o s i t i v e c l o n e s . P h a g e s u p e r n a t a n t s ( 2 u l ) w e r e d o t t e d o n t o c i r c u l a r 10 cm n i t r o c e l l u l o s e 2 5 . f i l t e r s ( S c h l e i c h e r a n d S c h u e l l ) , b a k e d a t 6 8 ° C f o r 2 h r , p r e h y b r i d i z e d i n 6 x S S C , 2 x D e n h a r d t ' s s o l u t i o n , t h e n h y b r i d i z e d t o t h e DNA p r o b e i n 6 x S S C , 2 x D e n h a r d t ' s s o l u t i o n ( 0 . 4 % B S A , 0 .4% F i c o l , 0 .4% p o l y v i n y l p y r r o l i d o n e ) , 1 mM EDTA a n d 0 .5% S D S , a s d e s c r i b e d b y M a n i a t i s ( M a n i a t i s , 1 9 8 2 ) . T h e DNA p r o b e s w e r e l a b e l l e d b y n i c k t r a n s l a t i o n u s i n g DNA p o l y m e r a s e I ( M a t e r i a l s a n d M e t h o d s ) . DNA p o l y m e r a s e I w a s o b t a i n e d f r o m New E n g l a n d B i o l a b s . 3 . S e q u e n c i n g R e a c t i o n s D i d e o x y - a n d d e o x y n u c l e o t i d e s w e r e o b t a i n e d f r o m P . L . B i o c h e m i c a l s I n c . S t o c k s o l u t i o n s w e r e i n 10 mM T r i s pH 8 , o r pH 2 f o r dCTP o r d d C T P . C h a i n t e r m i n a t o r m i x e s w e r e made w i t h 1 v o l u m e dNTP m i x : 1 v o l u m e ddNTP w o r k i n g s o l u t i o n . T h e dNTP m i x e s w e r e made f r o m 0 . 5 mM s t o c k s o l u t i o n s o f d T T P , dCTP a n d d G T P . A s p e c i f i c dNTP m i x w o u l d b e 2 0 u l s t o c k s o l u t i o n o f e a c h o f t h e o t h e r d N T P ' s , a n d 1 u l s t o c k s o l u t i o n o f t h e s p e c i f i c d N T P , w i t h 5 u l o f l O x M i x b u f f e r ( 5 0 mM T r i s - C l pH 7 . 5 , ImM E D T A ) . T h e d A T P m i x w a s made b y a d d i t i o n o f 20 u l o f e a c h o f t h e o t h e r dNTP s t o c k s o l u t i o n s , w i t h n o dATP a s [ c t - 3 2 P ] d A T P w a s u s e d a s l a b e l . T h e [ c t - 3 2 P ] d A T P wa s o b t a i n e d f r o m New E n g l a n d N u c l e a r , 0 . 2 5 m C i / 8 7 p m o l e s i n 0 . 0 2 5 m l . One u l w a s u s e d p e r r e a c t i o n . T h e ddNTP w o r k i n g s o l u t i o n s w e r e 1 . 0 mM d d T T P ; 0 . 1 mM d d C T P ; 0 . 6 - 0 . 8 mM d d G T P ; a n d 0 . 1 mM d d A T P . T h e " G " r e a c t i o n wa s i m p r o v e d b y u s i n g t h e l e s s e r c o n c e n t r a t i o n o f d d G T P . B e s t t e m p l a t e s w e r e o b t a i n e d u s i n g f r e s h p h a g e p l a q u e s t o i n o c u l a t e f r e s h l o g p h a s e c u l t u r e s o f J M 1 0 3 a n d h a r v e s t i n g t h e p h a g e s u p e r n a t a n t a f t e r 4 - 6 h o u r s o f g r o w t h a t 3 7 ° C w i t h g o o d a e r a t i o n . S e q u e n c i n g p r i m e r , e i t h e r 1 5 - m e r o r 1 7 - m e r , w a s o b t a i n e d f r o m P . L . B i o c h e m i c a l s I n c . T e m p l a t e , p r i m e r a n d a n n e a l i n g b u f f e r i n a f i n a l v o l u m e o f 10 u l w e r e h y b r i d i z e d a t 6 8 ° C f o r 10 m i n . A f t e r c o o l i n g , 1 u l o f 2 6 . l a b e l l e d dATP a n d 1 u l o f c o l d 1 2 . 5 uM dATP w e r e a d d e d a n d 2 u l o f t e m p l a t e m i x w a s a d d e d t o 2 P l o f e a c h o f t h e f o u r c h a i n t e r m i n a t o r m i x e s i n 1 . 5 m l E p p e n d o r f t u b e s . R e a c t i o n t u b e s w e r e t h e n i n c u b a t e d a t 3 0 ° C , a n d 0 . 5 u o f K l e n o w e n z y m e ( B e t h e s d a R e s e a r c h L a b o r a t o r i e s , 5 0 0 u / 1 1 2 p l d i l u t e d 1 : 2 0 i n 10% g l y c e r o l , 5 0 P g / m l b o v i n e s e r u m a l b u m i n , 10 mM T r i s - C l pH 8 . 0 , 1 mM d i t h i o t h r e i t o l ) w e r e a d d e d . A f t e r 15 m i n . , 2 p l o f 0 . 5 mM d A T P w e r e a d d e d a s a c h a s e . A f t e r 1 5 m i n . t h e r e a c t i o n s w e r e s t o p p e d b y t h e a d d i t i o n o f 4 p l f o r m a m i d e s t o p s o l u t i o n (90% d e i o n i z e d f o r m a m i d e , 2 0 mM E D T A , 0 . 0 3% x y l e n e c y a n o l , 0 . 0 3 % b r o m o p h e n o l b l u e ) . S a m p l e s w e r e b o i l e d f o r 2 - 3 m i n , p u t i m m e d i a t e l y o n i c e , a n d 2 . 5 p l l o a d e d t o 6% a n d 8% u r e a p o l y a c r y l a m i d e g e l s p r e p a r e d a s d e s c r i b e d ( M e s s i n g , 1 9 8 0 ) . G e l s w e r e r u n a t max 1 8 0 0 V , 40W, d r i e d a n d a u t o r a d i o g r a p h e d o v e r n i g h t . T h e f i l m u s e d w a s K o d a k X - O m a t RP R P X - 1 . A n a v e r a g e o f 2 5 0 bp o f s e q u e n c e w e r e r e a d p e r r e a c t i o n . U . CONSTRUCT ION OF F U S I O N P L A S M I D S 1 . P l a s m i d s pMC412 a n d p M C 4 l 6 T h e p l a s m i d pMC435 h a s a u n i q u e H p a l c l o n i n g s i t e w h i c h d i s r u p t s t h e amp p r o m o t e r c o n n e c t e d t o t h e a f r a g m e n t o f fci-galactosidase ( C a s a d a b a n a n d C o h e n , 1 9 8 0 ) . I n s e r t i o n o f a p r o m o t e r - b e a r i n g f r a g m e n t i n t h e p r o p e r o r i e n t a t i o n i n t o t h i s s i t e r e s u l t s i n L a c + e x p r e s s i o n , a s t h e a f r a g m e n t c a n c o m p l e m e n t t h e l a c Z ( a ) d e l e t i o n M15 i n t h e h o s t s t r a i n M C 1 0 2 2 . P l a s m i d p H E l w a s d i g e s t e d w i t h H p a l a n d t h r e e o f t h e f o u r H p a l f r a g m e n t s ( 1 9 0 b p , 6 5 0 bp a n d 8 5 0 b p ) w e r e i s o l a t e d . T h e s e w e r e l i g a t e d t o t h e v e c t o r pMC435 c u t w i t h H p a l . T h e MC1022 t r a n s f o r m a n t s w i t h pMC435 h a d d a r k p i n k c e n t r e s o n M c C o n k e y l a c t o s e p l a t e s , i n d i c a t i n g t h a t e x p r e s s i o n f r o m t h e amp p r o m o t e r r e s u l t e d i n a l o w l e v e l o f g - g a l a c t o s i d a s e a c t i v i t y . No d a r k e r c o l o n i e s w e r e o b s e r v e d among t h e a p p r o x i m a t e l y 1 2 5 t r a n s f o r m a n t s p e r l i g a t i o n . H o w e v e r , s e v e r a l l i g h t e r c o l o n i e s , r e l a t i v e l y L a c a p p e a r e d . T h r e e l i g h t e r c o l o n i e s w e r e s c r e e n e d f r o m t h e l i g a t i o n s w i t h t h e 8 5 0 bp H p a l f r a g m e n t a n d f i v e f r o m t h e l i g a t i o n w i t h t h e 6 5 0 bp H p a l f r a g m e n t . One o f t h e c l o n e s , p M C 4 l 2 , c o n t a i n e d t h e 8 5 0 bp f r a g m e n t . T h i s f r a g m e n t i s t h e H p a l ^ - H p a l ^ f r a g m e n t o f F i g u r e 9 . R e s t r i c t i o n a n a l y s i s o f pMC412 i n d i c a t e d t h a t t h e H p a l i n s e r t wa s i n t h e o r i e n t a t i o n o p p o s i t e t o t h a t o f t h e s u s p e c t e d p r o m o t e r ( F i g u r e 1 3 ) . T h r e e o u t o f f i v e c l o n e s h a d t h e 6 5 0 bp H p a l f r a g m e n t . T h i s f r a g m e n t i s t h e H p a l ^ - H p a l g f r a g m e n t o f F i g u r e 9 . One o f t h e s e , pMC416 w a s u s e d i n s u b s e q u e n t e x p e r i m e n t s ( F i g u r e 1 3 ) . 2 . P l a s m i d p S H 1 2 2 B e c a u s e o f t h e h i g h b a c k g r o u n d 3 - g a l a c t o s i d a s e a c t i v i t y o f p M C 4 3 5 , a n o t h e r l a c t r a n s c r i p t i o n / t r a n s l a t i o n e x p r e s s i o n v e c t o r , p M C 1 4 0 3 , w i t h n o d e t e c t a b l e b a c k g r o u n d 3 - g a l a c t o s i d a s e a c t i v i t y wa s o b t a i n e d ( C a s a d a b a n e t a l . , 1 9 8 0 ) . T h r e e s e p a r a t e l i g a t i o n s w e r e d o n e t o c l o n e t h e H p a l f r a g m e n t s i n t o p M C 1 4 0 3 . P l a s m i d pMC1403 c u t w i t h S m a l wa s l i g a t e d t o ( i ) p H E l c u t w i t h H p a l ; ( i i ) t o pMC412 c u t w i t h H p a l ; a n d ( i i i ) t o pMC416 c u t w i t h H p a l . T h e p h e n o t y p e s o f t h e p l a s m i d s a r e : p M C 1 4 0 3 , L a c AmpR; p M C 4 3 5 , L a c + ^ AmpS K a n R ; pMC412 a n d p M C 4 1 6 , L a c AmpS K a n R ; p H E l L a c AmpR. T h e d e s i r e d r e c o m b i n a n t s s h o u l d b e L a c + AmpR K a n S . T h e M C 1 0 0 0 t r a n s f o r m a n t s o f c o n t r o l pMC1403 c u t w i t h S m a l a n d s u b s e q u e n t l y l i g a t e d w e r e w h i t e o n M c C o n k e y l a c t o s e , a s w e r e t r a n s f o r m a n t s o f pMC1403 c u t w i t h S m a l a n d l i g a t e d t o pMC416 c u t w i t h H p a l . T h e o t h e r t w o l i g a t i o n s , h o w e v e r , g a v e .28. r e d c o l o n i e s ( L a c + ) , a l b e i t a t a l o w f r e q u e n c y . F i v e o u t o f 2 0 0 c o l o n i e s o f p M C l 4 0 3 c u t w i t h S m a l l i g a t e d t o p M C 4 l 2 c u t w i t h H p a l w e r e r e d , a n d 3 o u t o f 4 0 0 c o l o n i e s o f pMC1403 c u t w i t h S m a l l i g a t e d t o p H E l c u t w i t h H p a l w e r e r e d . T h e 8 5 0 b p H p a l f r a g m e n t wa s p r e s e n t i n e a c h o f t h e 8 L a c + c l o n e s . T h e l i g a t i o n o f pMC1403 c u t w i t h S m a l t o p H E l c u t w i t h H p a l w a s r e p e a t e d , u s i n g f r e s h DNA p r e p a r a t i o n s . C o n t r o l pMC1403 c u t w i t h S m a l w i t h n o l i g a s e g a v e n o t r a n s f o r m a n t s a n d w i t h l i g a s e g a v e 1 1 w h i t e a n d 1 r e d t r a n s f o r m a n t s . T h e e x p e r i m e n t a l l i g a t i o n g a v e 15 w h i t e a n d 2 r e d c o l o n i e s . T h e s e r e s u l t s s u g g e s t e d a n u c l e a s e a c t i v i t y i n t h e S m a l e n z y m e . T h e t w o e x p e r i m e n t a l L a c + c o l o n i e s w h e n s c r e e n e d e a c h h a d p l a s m i d s b e a r i n g t h e 8 5 0 bp H p a l f r a g m e n t . I t w a s u n l i k e l y t h a t a p r o m o t e r c o u l d h a v e b e e n c r e a t e d o n t h e 8 5 0 bp f r a g m e n t i n e a c h o f t h e i n d e p e n d e n t c l o n i n g e x p e r i m e n t s . T h e l e v e l o f 3 - g a l a c t o s i d a s e a c t i v i t y i n a l l t h e r e c o m b i n a n t s w a s h i g h , a s s h o w n b y t h e v e r y b r i g h t r e d c o l o r o n M c C o n k e y l a c t o s e p l a t e s . One o f t h e b r i g i n a l i s o l a t e s , p S H 1 2 2 , f r o m t h e e x p e r i m e n t w h e r e pMC1403 c u t w i t h S m a l wa s l i g a t e d t o p M C 4 l 2 c u t w i t h H p a l w a s u s e d f o r s u b s e q u e n t s t u d y ( F i g u r e 9 a n d F i g u r e 1 4 ) . S u b s e q u e n t DNA s e q u e n c i n g o f p S H 1 2 2 h a s i n d i c a t e d t h a t a f r a m e s h i f t d e l e t i o n o f a s i n g l e b a s e p a i r o c c u r r e d d u r i n g c l o n i n g , a l l o w i n g f o r L a c + e x p r e s s i o n . a . S u b s t i t u t i o n o f t h e K a n a m y c i n C a s s e t t e i n t o p S H 1 2 2 A 1 . 0 K b P s t I f r a g m e n t f r o m p S H 1 2 2 , i n c l u d i n g t h e H p a l g - P s t l j ^ ( F i g u r e 9 ) f r a g m e n t , wa s r e p l a c e d b y a 1 . 3 K b P s t I K a n R ( T n 9 0 3 ) c a s s e t t e f r o m pUC4K ( V i e i r a a n d M e s s i n g , 1 9 8 2 ) . T h e P s t I s i t e w i t h i n t h e pMC1403 v e c t o r c u t s w i t h i n t h e amp g e n e , t h e r e f o r e t h e e f f e c t o f t h i s DNA 2 9 . r e p l a c e m e n t w a s t o s u b s t i t u t e K a n R f o r AmpR , r e s u l t i n g i n A m p S . P l a s m i d p S H 1 2 2 wa s c u t w i t h P s t I , a n d l i g a t e d t o pUC4K c u t w i t h P s t I . A s a m p l e o f L a c + a n d L a c c l o n e s w e r e t e s t e d f o r a m p i c i l l i n s e n s i t i v i t y . One t r a n s f o r m a n t , p S H 2 1 w i t h t h e p h e n o t y p e L a c + K a n R AmpS , was d i g e s t e d w i t h P s t I . T h e r e s t r i c t i o n p a t t e r n i n d i c a t e d t h a t t h e d e s i r e d s u b s t i t u t i o n h a d b e e n e f f e c t e d ( r e s u l t s n o t s h o w n ) . I t w a s p o s s i b l e t h a t t h e L a c + a c t i v i t y i n t h i s c l o n e r e s u l t e d f r o m a p r o m o t e r o n t h e k a n a m y c i n c a s s e t t e . T o o b t a i n b o t h o r i e n t a t i o n s o f t h e K a n R i n s e r t , p S H 2 1 wa s d i g e s t e d w i t h P s t I a n d r e l i g a t e d . T h r e e t r a n s f o r m a n t s w e r e i s o l a t e d a n d t h e i r p l a s m i d s a n a l y z e d b y X h o l , B a m H I , a n d H i n d l l l , BamHI d o u b l e d i g e s t s . T h e e n z y m e s X h o l a n d H i n d l l l e a c h c u t a s y m m e t r i c a l l y w i t h i n T n 9 0 3 ( O k a e t a l . 1 9 8 1 ) . E a c h o r i e n t a t i o n o f t h e c a s s e t t e w a s o b t a i n e d , a n d b o t h w e r e L a c + . 3 . P l a s m i d s p U P 1 7 a n d p M B l T h e 6 0 0 bp P s t l - B a m H I f r a g m e n t o f p S H 1 2 2 w a s g e l p u r i f i e d a n d c l o n e d i n t o t h e P s t l - B a m H I s i t e o f p U C 1 3 , a n o t h e r 3 - g a l a c t o s i d a s e e x p r e s s i o n v e c t o r w h i c h h a s t h e BamHI s i t e i n t h e same r e a d i n g f r a m e a s t h a t o f pMC1403 ( V i e i r a a n d M e s s i n g 1 9 8 2 ) . T h e p l a s m i d v e c t o r pUC13 h a s a f a i r l y h i g h l e v e l o f 3 - g a l a c t o s i d a s e e x p r e s s i o n , a n d c l o n e s a r e u s u a l l y s e l e c t e d b y l o o k i n g f o r a L a c p h e n o t y p e . H o w e v e r , t h e v e r y h i g h l e v e l o f P - g a l a c t o s i d a s e p r o d u c e d i n p S H 1 2 2 b y t h e p o t e n t i a l p n p p r o m o t e r i n d i c a t e d t h a t t h e P s t l - B a m H I f r a g m e n t w h e n c l o n e d m i g h t g i v e h i g h e r a c t i v i t y t h a n n a t i v e p U C 1 3 . T r a n s f o r m a n t s o f J M 8 3 , t h e h o s t s t r a i n f o r c o m p l e m e n t a t i o n o f pUC p l a s m i d s ( V i e i r a a n d M e s s i n g , 1 9 8 2 ) w e r e p l a t e d t o NY p l a t e s c o n t a i n i n g X - g a l a n d a m p i c i l l i n . T h e i n d i c a t o r X - g a l i s m o r e s e n s i t i v e t h a n M c C o n k e y l a c t o s e . S e v e r a l o f t h e d e e p e r b l u e c o l o n i e s ( L a c + ) w e r e i s o l a t e d , a n d t h e i r p l a s m i d s d i g e s t e d w i t h BamHI a n d P s t I . 3 0 . One o f t h e s e h a d t h e 6 0 0 bp i n s e r t f r o m p S H 1 2 2 a n d wa s d e s i g n a t e d p U P 1 7 ( F i g u r e 9 a n d F i g u r e 1 4 ) . T h e i n - f r a m e f u s i o n s o b t a i n e d a r e s h o w n i n F i g u r e 1 6 . T o a l l o w f o r i s o g e n i c p l a s m i d c o m p a r i s o n s t o b e made w i t h p S H 1 2 2 , p l a s m i d p M B l wa s c o n s t r u c t e d . P l a s m i d p U P 1 7 w a s d i g e s t e d w i t h H i n d i I I , w h i c h c u t s i m m e d i a t e l y 5 ' o f t h e P s t I s i t e , t h e n t h e r e c e s s e d e n d wa s f i l l e d i n w i t h t h e K l e n o w f r a g m e n t o f DNA p o l y m e r a s e t o c r e a t e a b l u n t e n d ; t h e DNA w a s t h e n d i g e s t e d w i t h B a m H I . T h i s DNA w a s t h e n l i g a t e d t o p M C l 4 0 3 c u t w i t h S m a l a n d B a m H I . O f 1 36 t r a n s f o r m a n t s o b t a i n e d o n NY p l a t e s c o n t a i n i n g X - g a l a n d a m p i c i l l i n , 16 w e r e b l u e . T w e l v e o f t h e s e w e r e s c r e e n e d a n d h a d a 6 0 0 bp i n s e r t . One o f t h e s e w a s c a l l e d p M B l a n d wa s u s e d f o r f u r t h e r s t u d y ( F i g u r e 9 a n d F i g u r e 1 4 ) . 4 . P l a s m i d pMS31 To" o b t a i n a n i n - f r a m e f u s i o n f o r t h e S 1 5 g e n e a n u m b e r o f s t e p s w e r e r e q u i r e d . A 9 0 0 bp P s t l j - T a q I f r a g m e n t w a s i s o l a t e d f r o m t h e P s t l - ^ - H i n d l l l f r a g m e n t o f p H E l ( F i g u r e 9 ) , a n d c l o n e d i n t o t h e M13 v e c t o r mp7 ( M e s s i n g a n d V i e i r a , 1 9 8 2 ) c u t w i t h P s t I a n d p a r t i a l l y c u t w i t h A c c I ( T a q I f r a g m e n t g o e s i n t o t h e A c c I s i t e ) . R e s t r i c t i o n a n a l y s i s o f R F DNA, a n d d o t b l o t s w i t h t h e r a d i o a c t i v e l y l a b e l l e d P s t l - ^ - H i n d l l l f r a g m e n t o f p H E l , c o n f i r m e d t h e i d e n t i t y o f t h i s c l o n e , m p 7 P A T . T h e s y m m e t r i c a l r e s t r i c t i o n s i t e s o f mp7 g i v e t h e c l o n e d DNA e a s y m a n e u v e r a b i l i t y . A 9 0 0 bp BamHI f r a g m e n t f r o m mp7PAT ( c o n t a i n i n g t h e p H E l s u b c l o n e d f r a g m e n t ) wa s c l o n e d i n t o pUC13 c u t w i t h B a m H I . T h e L a c AmpR c l o n e s ( o u t - o f - f r a m e f u s i o n s ) w e r e s e l e c t e d a n d s c r e e n e d . Two w e r e i s o l a t e d w h i c h h a d t h e BamHI f r a g m e n t i n o p p o s i t e o r i e n t a t i o n s , pUB2 a n d p U B 3 . R e s t r i c t i o n o f pUB2 w i t h H p a l a n d S m a l g a v e a b l u n t e n d e d f r a g m e n t o f 2 5 0 b p ; t h e H p a l s i t e b e i n g H p a l g o f p H E l a n d t h e S m a l s i t e b e i n g f r o m pUC13 a n d l o c a t e d 3 ' o f t h e P s t l ^ s i t e ( F i g u r e 9 ) . L i g a t i o n o f t h i s H p a l ^ - S m a l f r a g m e n t i n t o t h e S m a l s i t e o f pMC1403 i n t h e a p p r o p r i a t e o r i e n t a t i o n g i v e s a n i n - f r a m e f u s i o n a s d i a g r a m m e d i n F i g u r e 1 6 . O f 1 0 0 t r a n s f o r m a n t s , 6 w e r e L a c + o n NY X - g a l Amp p l a t e s . P l a s m i d DNAs f r o m t h e L a c + c l o n e s w e r e e x t r a c t e d a n d d i g e s t e d w i t h BamHI a n d E c o R I . Two p l a s m i d s h a d i n s e r t s o f t h e e x p e c t e d 2 5 0 b p , pMS31 a n d p M S 3 4 . F u r t h e r r e s t r i c t i o n a n a l y s i s i n d i c a t e d t h a t p l a s m i d pMS34 w a s a d o u b l e i n s e r t i o n , w i t h e a c h 2 5 0 bp f r a g m e n t i n t h e same o r i e n t a t i o n a s t h e o n e i n p M S 3 1 . D i g e s t i o n w i t h a c o m b i n a t i o n o f r e s t r i c t i o n e n z y m e s i n d i c a t e d t h a t pMS31 h a d t h e e x p e c t e d s t r u c t u r e , w i t h a l l r e s t r i c t i o n s i t e s i n t a c t ( F i g u r e 1 5 ) . V . P R E P A R A T I O N OF RNA FOR S I M A P P I N G T h e RNA wa s p r e p a r e d f r o m 20 m l f r e s h l o g p h a s e M C 1 0 0 0 , M C l O O O / p M B l , M C 1 0 0 0 / p S H 1 2 2 , M C l O O O / p H E l a n d M C 1 0 0 0 / p M S 3 1 g r o w n i n m i n i m a l m e d i u m w i t h g l u c o s e , c a s a m i n o a c i d s , t r y p t o p h a n a n d , f o r p l a s m i d s t r a i n s , a m p i c i l l i n . C e l l s w e r e p o u r e d o v e r i c e a n d 0 . 2 m l 1 M s o d i u m a z i d e , c o o l e d i n a d r y i c e - e t h a n o l b a t h , c e n t r i f u g e d a t 9 0 0 0 r p m , 5 m i n . , a n d r e s u s p e n d e d i n 1 m l m e d i u m C ( 4 0 mM N H 4 C 1 , 4 0 mM NagHPO^, 20 mM K H 2 P 0 4 > 5 0 mM N a C l ) p l u s 10 mM s o d i u m a z i d e . T h i s w a s a d d e d t o 1 m l SDS l y s i s m i x t u r e ( SDS 0 . 1 M N a C l , 0 .5% S D S , 10 mM E D T A ) a t 1 0 0 ° C , 1 5 - 3 0 s e c . T h e l y s a t e w a s i m m e d i a t e l y e x t r a c t e d w i t h T E - s a t u r a t e d ( 5 mM T r i s - C l pH 8 , 1 mM EDTA pH 8 ) p h e n o l 3 x . T h e DNA w a s e x t r a c t e d w i t h c h l o r o f o r m a n d e t h a n o l p r e c i p i t a t e d 2 X . T h e A g g Q r e a d i n g s w e r e t a k e n o f 1 / 1 0 d i l u t i o n s , a n d t h e RNA s u s p e n d e d i n a f i n a l v o l u m e o f TE t o g i v e a p p r o x i m a t e l y 2 A 9 f i f ) / m l . 3 2 . W. T4 P O L Y N U C L E O T I D E K I N A S E EXCHANGE R E A C T I O N T h e DNA f r a g m e n t s f o r S I m a p p i n g w e r e 5 ' l a b e l l e d b y m e a n s o f t h e k i n a s e e x c h a n g e r e a c t i o n . T h e T4 p o l y n u c l e o t i d e k i n a s e w a s o b t a i n e d f r o m New E n g l a n d N u c l e a r . R e a c t i o n m i x t u r e s w e r e p r e p a r e d b y a d d i n g 5 u l 10X e x c h a n g e b u f f e r ( 0 . 5 M i m i d a z o l e c h l o r i d e pH 6 . 6 , 0 . 1 M M g C ^ , 50 mM d i t h i o t h r e i t o l , 1 mM s p e r m i d i n e , 1 mM. E D T A ) , 2 u l 8 mM A D P , 5 u l [ a - 3 2 p ] A T P ( N e w E n g l a n d N u c l e a r , 0 . 2 5 m C i / 8 6 p m o l e / 0 . 0 2 5 m l ) t o t h e DNA f r a g m e n t ( a p p r o x i m a t e l y 0 . 1 u g ) i n 3 5 u l ^ 0 . P o l y n u c l e o t i d e k i n a s e ( 2 0 u ) wa s a d d e d , r e a c t i o n s w e r e i n c u b a t e d a t 3 7 ° C f o r 3 0 m i n . , a n d s t o p p e d b y t h e a d d i t i o n o f 2 u l EDTA ( 0 . 5 M ) . T h e v o l u m e wa s made u p t o 1 0 0 u l b y t h e a d d i t i o n o f TE a n d p h e n o l / c h l o r o f o r m ( 1 : 1 ) , a n d p h e n o l / c h l o r o f o r m / i s o a m y l a l c o h o l ( 2 5 : 2 4 : 1 ) e x t r a c t i o n s w e r e p e r f o r m e d . T h e DNA wa s e t h a n o l p r e c i p i t a t e d t w i c e , a n d w a s h e d w i t h 95% e t h a n o l . S a m p l e s w e r e d r i e d a n d c o u n t e d b y C e r e n k o v c o u n t i n g i n a l i q u i d s c i n t i l l a t i o n c o u n t e r . L a b e l l e d f r a g m e n t s ( 1 0 5 - 1 0 6 c pm) w e r e t a k e n u p i n 5 0 u l T E , a n d 5 - 1 5 Ul u s e d p e r S I r e a c t i o n . X . T4 P O L Y N U C L E O T I D E K I N A S E L A B E L L I N G OF RECESSED 5 ' T E R M I N I T h e DNA ( 1 0 - 2 0 p m o l 5 ' t e r m i n i ) w a s i n c u b a t e d w i t h a p p r o x i m a t e l y 1 u n i t o f a l k a l i n e p h o s p h a t a s e f r o m c a l f i n t e s t i n e ( B o e h r i n g e r M a n n h e i m , 2 0 u n i t s / u l ) i n 5 0 mM T r i s , 0 . 1 mM E D T A , pH 8 , i n a f i n a l v o l u m e o f 30 u l a t 3 7 ° C f o r 30 m i n . T o s t o p t h e r e a c t i o n , 4 u l o f 10% S D S , 6 u l o f l O x STE ( 0 . 1 M T r i s , pH 8 , 1 M N a C l , 1 0 mM EDTA pH 8 ) a n d 20 u l H O w e r e a d d e d , t h e m i x t u r e h e a t e d t o 6 5 ° C f o r 5 m i n . , a n d e x t r a c t e d 2 x w i t h p h e n o l : c h l o r o f o r m ( 1 : 1 ) , 2 x w i t h c h l o r o f o r m . T h e d e p h o s p h o r y l a t e d DNA w a s e t h a n o l p r e c i p i t a t e d a f t e r t h e a d d i t i o n o f 6 u l 3M N a O A c , a n d w a s h e d w i t h 70% e t h a n o l . 3 3 . R e c e s s e d 5 ' t e r m i n i w e r e l a b e l l e d w i t h k i n a s e a c c o r d i n g t o M a n i a t i s ( M a n i a t i s , 1 9 8 2 ) . D e p h o s p h o r y l a t e d DNA ( 1 0 - 2 0 p m o l e s 5 ' e n d s ) wa s s u s p e n d e d i n 20 mM T r i s ' C l pH 9 . 5 , 1 mM s p e r m i d i n e , 0 . 1 mM EDTA i n a f i n a l v o l u m e o f 4 0 u l , h e a t e d t o 7 0 ° C , c h i l l e d i m m e d i a t e l y o n i c e , a n d 5 Ul o f l O x b l u n t e n d k i n a s e b u f f e r ( 0 . 5 M T r i s ' C l pH 9 . 5 , 0 . 1 M M g C l , 5 0 mM d i t h i o t h r e i t o l , 50% g l y c e r o l ) w e r e a d d e d . F i f t y p m o l e s o f [ a - 3 2 P ] A T P (New E n g l a n d N u c l e a r , 0 . 2 5 m C i / 8 6 p m o l e s / 0 . 0 2 5 m l ) a n d 2 0 u n i t s o f T4 p o l y n u c l e o t i d e k i n a s e (New E n g l a n d N u c l e a r ) w e r e a d d e d a n d t h e r e a c t i o n i n c u b a t e d a t 3 7 ° C f o r 15 m i n . a n d 5 6 ° C f o r 15 m i n . Two u l o f 0 . 5 M EDTA w e r e a d d e d , a p h e n o l / c h l o r o f o r m ( 1 : 1 ) e x t r a c t i o n p e r f o r m e d , t h e DNA wa s p r e c i p i t a t e d w i t h e t h a n o l 2 x , w a s h e d 2 x w i t h 70% e t h a n o l , r e s u s p e n d e d i n 3 0 0 u l T E , a n d 1 - 2 u l u s e d p e r S I s a m p l e ( a p p r o x i m a t e l y 1 0 s c p m / u l ) . Y . S I M A P P I N G T h e e n z y m e S I n u c l e a s e w a s o b t a i n e d f r o m P . L . B i o c h e m i c a l s . T h e DNA ( a p p r o x i m a t e l y 0 . 0 1 - 0 . 0 2 u g ) w a s a d d e d t o a p p r o x i m a t e l y 1 0 - 2 0 ug RNA , e t h a n o l p r e c i p i t a t e d , w a s h e d w i t h 95% e t h a n o l , d r i e d , a n d s u s p e n d e d i n 2 0 Ul h y b r i d i z a t i o n b u f f e r (80% d e i o n i z e d f o r m a m i d e , 4 0 mM P I P E S pH 6 . 4 , 4 0 0 mM N a C l , 1 mM E D T A ) . S a m p l e s w e r e h e a t e d t o 7 5 - 8 0 ° C f o r 15 m i n . t h e n t r a n s f e r r e d t o 5 1 - 5 2 ° C f o r 3 h r . I c e c o l d S I b u f f e r ( 2 8 0 mM N a C l , 3 0 mM NaOAc pH 4 , 4 , 4 . 5 mM Z n ( 0 A c ) 2 , 2 0 u g / m l M13 s i n g l e - s t r a n d e d DNA w i t h 2 0 0 u n i t s / m l o f S I n u c l e a s e a d d e d i m m e d i a t e l y b e f o r e u s e ) , 0 . 3 m l p e r s a m p l e , w a s a d d e d a n d t h e r e a c t i o n s i n c u b a t e d a t 3 2 - 3 7 ° C f o r 30 m i n . b e f o r e a d d i n g 75 u l o f t e r m i n a t i o n m i x ( 2 . 5 M NH^OAc , 50 mM E D T A ) . C a r r i e r t R N A ( 2 u l o f 1 0 m g / m l ) wa s a d d e d a n d t h e s a m p l e s i s o p r o p a n o l p r e c i p i t a t e d , w a s h e d w i t h 95% e t h a n o l , a n d v a c u u m d r i e d . F i v e u l 3 4 . f o r m a m i d e s t o p s o l u t i o n c o n t a i n i n g b r o m o p h e n o l b l u e a n d x y l e n e c y a n o l w e r e a d d e d a n d s a m p l e s w e r e b o i l e d 3 m i n . , t h e n i m m e d i a t e l y c h i l l e d i n i c e w a t e r b e f o r e l o a d i n g t o 8% p o l y a c r y l a m i d e u r e a g e l s p r e p a r e d a s f o r DNA s e q u e n c i n g . T h e MW s t a n d a r d wa s p B R 3 2 2 c u t w i t h H p a l I a n d l a b e l l e d b y K l e n o w f i l l - i n w i t h [ a - 3 2 P ] - d C T P a s d e s c r i b e d i n M a t e r i a l s a n d M e t h o d s . RESULTS A . C LONING THE GENE FOR P O L Y N U C L E O T I D E PHOSPHORYLASE C l o n i n g a g e n e i s f a c i l i t a t e d b y a n i n i t i a l s e l e c t i o n , w h i c h c a n b e e f f e c t e d m a k i n g u s e o f a n e i g h b o u r i n g m a r k e r . One s u c h m a r k e r n e a r t h e p n p l o c u s , i s a r g G ( F i g u r e 2 ) . A s e a r l i e r a t t e m p t s t o c l o n e a r g G h a d n o t me t w i t h s u c c e s s ( C l a r k e a n d C a r b o n , 1 9 7 6 ; K i t a k a w a e t a l . , 1 9 7 9 ) , o u r s t r a t e g y w a s t o o b t a i n s t r a i n s w i t h t h e t r a n s p o s o n T n 5 , w h i c h c o d e s f o r k a n a m y c i n r e s i s t a n c e ( B e r g e t a l . , 1 9 7 5 ) , i n s e r t e d n e a r t h e p n p l o c u s b y s c o r i n g f o r c o t r a n s d u c t i o n w i t h a r g G a n d m t r . C l o n e s o b t a i n e d f r o m t h e s e s t r a i n s a n d s e l e c t e d f o r K a n R m i g h t t h e n c a r r y p n p . T h e t r a n s p o s o n wa s i n t r o d u c e d i n t o s t r a i n M C 1 0 0 0 b y i n f e c t i n g w i t h A r e x ; : T n 5 a n d s e l e c t i n g f o r k a n a m y c i n r e s i s t a n c e a t 3 7 ° C . A m i x e d p o p u l a t i o n o f M C 1 0 0 0 K a n R b a c t e r i a was u s e d t o P l t r a n s d u c e s t r a i n P 9 0 A 5 C ( a r g G ) , s e l e c t i n g s i m u l t a n e o u s l y f o r A r g + , K a n R . F o r t y o f t h e s e t r a n s d u c t a n t s w e r e p u r i f i e d a n d a s s a y e d f o r P N P a s e a c t i v i t y . A l l h a d r e t a i n e d a c t i v i t y , s u g g e s t i n g t h a t T n 5 w a s n o t d i s r u p t i n g P N P a s e e x p r e s s i o n . L y s a t e s o f s t r a i n s w i t h P N P a s e a c t i v i t y l e v e l s s i m i l a r t o M C 1 0 0 0 w e r e made a n d u s e d t o t r a n s d u c e e i t h e r P 9 0 A 5 C t o a r g i n i n e i n d e p e n d e n c e , o r s t r a i n K Y 4 1 1 7 ( m t r ) t o k a n a m y c i n r e s i s t a n c e . T h e t r a n s d u c t a n t s w e r e s u b s e q u e n t l y s c o r e d f o r k a n a m y c i n r e s i s t a n c e o r m e t h y l t r y p t o p h a n s e n s i t i v i t y r e s p e c t i v e l y . F r o m t h e t r a n s d u c t i o n d a t a o b t a i n e d , i t w a s e v i d e n t t h a t t h e Tn_5 i n s e r t i o n s i n S C 1 0 1 a n d S C 1 0 2 w e r e a b l e t o be c o t r a n s d u c e d w i t h p n p b y b a c t e r i o p h a g e P l ( T a b l e 2 ) . I n o r d e r t o c l o n e f r o m t h e s e s t r a i n s , p a r t i a l d i g e s t s w e r e c a r r i e d o u t u s i n g e i t h e r E c o R I , B a m H I , S a i l , o r H i n d l l l t o g i v e a p p r o x i m a t e l y 2 0 - 30 K b s i z e d f r a g m e n t s . F r a g m e n t s f r o m t h e s e p a r t i a l d i g e s t s w e r e l i g a t e d i n t o t h e c o r r e s p o n d i n g s i t e o f p B R 3 2 2 , a n d t r a n s f o r m e d i n t o M C 1 0 0 0 , s e l e c t i n g 3 6 . F I G U R E 2 T h e g e n e t i c map n e a r 68 m i n o n t h e b a c t e r i a l c h r o m o s o m e a n d  i t s c o r r e s p o n d e n c e t o t h e r e s t r i c t i o n maps o f p S 1 7 a n d p S l 4 . T h e map p o s i t i o n s o f t h e g e n e s a r e a c c o r d i n g t o B a c h m a n n a n d L o w ( B a c h m a n n a n d L o w , 1 9 8 0 ) . R e s t r i c t i o n e n z y m e s i t e s a r e d e s i g n a t e d b y l e t t e r : S , S a i l ; B , B g l l l ; H , H i n d l l l ; E , E c o R I . T h e Tn_5 s e q u e n c e s c o d i n g f o r k a n a m y c i n r e s i s t a n c e o n p S 1 7 a n d p S l 4 a r e s h o w n b y t h e h e a v y b l a c k l i n e s . A r r o w s m a r k i n g t h e p B R 3 2 2 s e q u e n c e i n p S 1 4 a n d p S 1 7 i n d i c a t e t h e r e v e r s a l i n o r i e n t a t i o n o f t h e v e c t o r w i t h r e s p e c t t o t h e c l o n e d DNA . T h e d e l e t i o n i n p S 1 4 i s s h o w n b y t h e b l a n k b o x . I t i s u n c e r t a i n w h e t h e r t h e H i n d l l l s i t e a b u t t i n g t h e d e l e t i o n i s f r o m p B R 3 2 2 o r f r o m t h e c l o n e d f r a g m e n t . T h e s i t e o f t h e Tn5_ i n s e r t i o n i n t h e p a r e n t s t r a i n S C 1 0 1 wa s m a p p e d a t a b o u t 6 8 . 0 . W ZD o I—I kb map position 0 10 1 20 i 30 68.60 1 ( 68.01 1 dacB i 1 , argG i 1 rpsO i 1 mtr i 1 rplU pS17 ftsH nusA pnp E B E I I I HB S HE S —hy»»»»») EH P s i 4 I — \ LL J 1 1 U k < ( ( « « ( ( ^ 3 8 . T A B L E 2 C o t r a n s d u c t i o n o f k a n a m y c i n r e s i s t a n c e w i t h a r g G a n d m t r R e c i p i e n t s t r a i n S c o r e d m a r k e r S e l e c t e d m a r k e r S o u r c e o f P l l y s a t e 3 S C 1 0 1 S C 1 0 2 S C 1 0 3 S C 1 0 4 S C 1 0 5 K Y 4 1 1 6 m t r r m t r s 12 27 0 0 0 k a n r 19 32 7 2 1 6 P 9 0 A 5 C a r g k a n r 3 17 5 2 3 6 a r g + 50 5 0 5 0 4 0 5 0 P l t r a n s d u c t i o n wa s p e r f o r m e d a s d e s c r i b e d i n M a t e r i a l s a n d M e t h o d s . T h e c o t r a n s d u c t i o n f r e q u e n c y o f a p a i r o f m a r k e r s i s s h o w n a s t h e f r a c t i o n o f t r a n s d u c t a n t s f o r t h e s e l e c t e d m a r k e r w h i c h h a v e a l s o b e e n t r a n s d u c e d f o r t h e u n s e l e c t e d m a r k e r . T h u s , r e c i p i e n t K Y 4 1 1 6 w a s s e l e c t e d f o r k a n a m y c i n r e s i s t a n c e a n d s c o r e d f o r 5 - m e t h y l t r y p t o p h a n r e s i s t a n c e . F r o m t h e f r e q u e n c i e s o f c o t r a n s d u c t i o n s h o w n h e r e , a n e s t i m a t e o f t h e map p o s i t i o n o f Tn_5 i n S C 1 0 1 a n d S C 1 0 2 r e l a t i v e t o a r g G a n d m t r wa s c a l c u l a t e d b y m e a n s o f t h e f o r m u l a : d 3 f r e q u e n c y o f c o t r a n s d u c t i o n = 1 - — , w h e r e d i s t h e u n k n o w n d i s t a n c e Li b e t w e e n t w o m a r k e r s i n m i n u t e s a n d L i s t h e l e n g t h o f t h e t r a n s d u c i n g f r a g m e n t i n m i n u t e s ( a p p r o x i m a t e l y t w o m i n u t e s f o r b a c t e r i o p h a g e P l ) (Wu , 1 9 6 6 ) . I n S C 1 0 1 a n d S C 1 0 2 t h e Tn5_ i n s e r t i o n s a r e n e a r 6 7 . 7 + 0 . 3 m i n a n d 6 8 . 0 + 0 . 1 m i n r e s p e c t i v e l y . T h i s m e a n s t h a t t h e i n s e r t i o n s a r e 1 0 - 2 6 K b r e m o v e d f r o m p n p . f o r e i t h e r K a n R a n d AmpR o r K a n R a n d T e t R . P l a s m i d DNA w a s e x t r a c t e d f r o m t h e s e M C 1 0 0 0 t r a n s f o r m a n t s a n d u s e d t o t r a n s f o r m t h e P N P a s e d e f i c i e n t s t r a i n N 1 1 0 2 . T r a n s f o r m a n t s o f N 1 1 0 2 w e r e s u b s e q u e n t l y a s s a y e d f o r P N P a s e a c t i v i t y . T r a n s f o r m a t i o n d i r e c t l y i n t o N 1 1 0 2 wa s a v o i d e d s i n c e i n t e r a c t i o n b e t w e e n t h e p n p 7 a l l e l e a n d t h e r e c o m b i n a n t p l a s m i d s wa s u n p r e d i c t a b l e . Two p l a s m i d s o b t a i n e d b y S a i l d i g e s t i o n o f S C 1 0 1 , p S 1 4 a n d p S 1 7 , h a d g r e a t e r P N P a s e a c t i v i t y t h a n N 1 1 0 2 ( T a b l e 3 ) . N o n e o f t h e l i g a t i o n p r o d u c t s u s i n g t h e o t h e r e n z y m e s h a d i n c r e a s e d l e v e l s o f P N P a s e . A p p r o x i m a t e l y 1 5 . 6 K b a n d 2 4 . 1 K b o f c l o n e d DNA a r e p r e s e n t i n p S 1 4 a n d p S 1 7 , r e s p e c t i v e l y ( F i g u r e 2 ) . T h e r e s t r i c t i o n e n z y m e a n a l y s i s i n d i c a t e d t h a t b o t h c l o n e s i n i t i a l l y c o n t a i n e d t h e 2 4 . 1 K b S a i l f r a g m e n t i n s e r t e d i n o p p o s i t e o r i e n t a t i o n s i n t o p B R 3 2 2 . S u b s e q u e n t l y , t h e p S 1 4 c l o n e u n d e r w e n t a d e l e t i o n e v e n t w h i c h r e m o v e d a p p r o x i m a t e l y 8 K b o f DNA i n c l u d i n g o n e o f t h e S a i l s i t e s a t t h e e n d o f t h e i n s e r t e d f r a g m e n t a n d o n e o f t h e H i n d l l l s i t e s e i t h e r f r o m t h e p B R 3 2 2 v e c t o r o r f r o m t h e i n s e r t e d f r a g m e n t ( F i g u r e 3 ) . B . SUBCLONING FROM p S 1 4 P u b l i s h e d r e p o r t s s t a t e t h a t t h e monomer s i z e o f P N P a s e i s 8 4 , 0 0 0 ( S o r e q a n d L i t t a u e r , 1 9 7 7 ) ; t h i s w o u l d r e q u i r e a p p r o x i m a t e l y 2 . 3 K b o f c o d i n g DNA . F r a g m e n t s o f s i z e 6 . 4 a n d 4 . 8 K b p r o d u c e d b y H i n d l l l - E c o R I d i g e s t i o n o f p S 1 4 w e r e l i g a t e d b e t w e e n t h e H i n d l l l - E c o R I s i t e s o f p B R 3 2 2 . T r a n s f o r m a n t s o f M C 1 0 0 0 w h i c h w e r e AmpR a n d T e t S w e r e a s s a y e d f o r P N P a s e a c t i v i t y ( T a b l e 3 ) . A c t i v i t y wa s d e t e c t e d i n a l l s u b c l o n e s c o n t a i n i n g t h e 4 . 8 K b H i n d l l l - E c o R I f r a g m e n t f r o m p S 1 4 ( F i g u r e 4 ) , b u t n o a c t i v i t y w a s d e t e c t e d i n s u b c l o n e s c o n t a i n i n g t h e 6 . 4 K b f r a g m e n t . S u b c l o n e p H E l w a s s e l e c t e d f o r f u r t h e r s t u d y . 40. T A B L E 3 P o l y n u c l e o t i d e p h o s p h o r y l a s e a c t i v i t y o f s t r a i n s ' c o n t a i n i n g t h e p S 1 4 a n d p S 1 7 S a i l p l a s m i d s ( K a n R pnp" 1") a n d H i n d l l l - E c o R I s u b c l o n e s c o n t a i n i n g H i n d l l l - E c o R I f r o m p S 1 4 . S t r a i n P N P a s e a c t i v i t y 3 N 1 1 0 2 ( p n p ) ~ 0 . 4 3 N 1 1 0 3 ( p n p + ) 8 . 9 N 1 1 0 2 / p S l 4 3 0 . 9 N 1 1 0 2 / p S 1 7 1 0 . 4 M C 1 0 0 0 3 . 3 M C 1 0 0 0 / p H E l b 2 6 . 1 M C 1 0 0 0 / p H E 5 1 3 1 . 3 M C 1 0 0 0 / p H E 8 6 1 8 . 4 M C 1 0 0 0 / p H E 4 3 . 8 P o l y n u c l e o t i d e p h o s p h o r y l a s e a c t i v i t y i s e x p r e s s e d a s n m o l e s ADP p o l y m e r i s e d i n 10 m i n a t 3 7 ° C . T h e s p e c i f i c a c t i v i t y o f [ 1 1 , C ] - A D P i n t h e - 2 r e a c t i o n m i x w a s 1 . 4 X 1 0 n m o l e s p e r c p m . V a l u e s s h o w n h a v e b e e n c o r r e c t e d f o r b a c k g r o u n d . A s s a y s w e r e r e p e a t e d a m i n i m u m o f t h r e e t i m e s . D a t a s h o w n a r e f r o m o n e e x p e r i m e n t , b u t a r e r e p r e s e n t a t i v e o f t h e r e p e a t e d r e s u l t s . F o r t h e a s s a y p r o c e d u r e , r e f e r t o M a t e r i a l a n d M e t h o d s . ^The d e s i g n a t i o n HE r e p r e s e n t s t h e H i n d l l l - E c o R I f r a g m e n t s u s e d i n s u b c l o n i n g . T h e p l a s m i d s p H E l , 5 1 a n d 86 c o n t a i n t h e 4 . 8 K b f r a g m e n t f r o m p S 1 4 w h e r e a s t h e p l a s m i d pHE4 c o n t a i n s t h e 6 . 4 K b f r a g m e n t . 4 1 . F I G U R E 3 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p S 1 7 a n d p S l 4  b y a g a r o s e g e l e l e c t r o p h o r e s i s . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : B , B g l l l ; E , E c o R I ; S , S a i l ; P , P s t I . S a m p l e s o f d i g e s t e d DNA w e r e e l e c t r o p h o r e s e d t h r o u g h a 0 .7% a g a r o s e g e l . T h e s i z e s o f t h e 7 0 1 f r a g m e n t s a r e 6 . 4 , 2 . 8 , 2 . 2 , 1 . 3 , a n d 1 . 1 K b . T h e r e s t r i c t i o n map o b t a i n e d i s s h o w n i n F i g u r e 2 . CO LU h CO CL 4 3 . F I G U R E 4 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p S 1 4 a n d AmpR  T e t S s u b c l o n e s b y a g a r o s e g e l e l e c t r o p h o r e s i s . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : H , H i n d l l l ; E , E c o R I ; B , B g l l l . P l a s m i d s p H E l , p H E 5 1 , p H E 8 6 h a v e a 4 . 8 K b H i n d l l l - E c o R I f r a g m e n t w h i c h i s n o t c u t b y B g l l l a n d e x h i b i t P N P a s e a c t i v i t y ( T a b l e 3 ) . 44, F I G U R E 4 | pHE4|pHE69| pHE 1 | pHE 51 |pHE 86|pS1-4 I 701 H H B I H H B H H B IH H B H H B IH H B E B IE B E B IE B E B IE B E E E E E E 4 5 . C . L O C A T I N G p n p ON p H E l . I n o r d e r t o l o c a t e t h e p n p g e n e o n t h e s u b c l o n e d f r a g m e n t , a n d t o d e t e r m i n e i t s o r i e n t a t i o n , Tn5_ i n s e r t i o n s i n t o t h e p l a s m i d w e r e o b t a i n e d . A t o t a l o f 8 5 s e p a r a t e t r a n s p o s i t i o n s o n p H E l w e r e a n a l y z e d f o r P N P a s e a c t i v i t y i n M C 1 0 0 0 ; s e v e n o f t h e s e w e r e P N P a s e d e f i c i e n t i n d i c a t i n g t h a t t h e p l a s m i d g e n e w a s i n a c t i v a t e d b y t h e i n s e r t i o n a l e v e n t ( T a b l e 4 ) . R e s t r i c t i o n e n z y m e m a p p i n g wa s c a r r i e d o u t u s i n g H i n d l l l a n d H i n d l l l -E c o R I d i g e s t i o n s ( F i g u r e 5 ) . D i g e s t i o n w i t h H i n d l l l r e s u l t e d i n t h r e e f r a g m e n t s i n c l u d i n g a 3 . 2 K b f r a g m e n t f r o m t h e c e n t r a l r e g i o n s o f Tn5_; t h i s f r a g m e n t wa s common t o a l l i n s e r t i o n s . E s t i m a t i o n o f t h e s i z e o f t h e o t h e r H i n d l l l o r H i n d l l l - E c o R I f r a g m e n t s a l l o w s f o r t h e p o s i t i o n i n g o f t h e Tn_5 w i t h i n t h e c l o n e d f r a g m e n t ( F i g u r e 6 ) . W i t h i n t h e l i m i t a t i o n s o f r e s o l u t i o n , s e v e r a l o f t h e i n s e r t s a p p e a r e d t o map a t o r n e a r t h e same s i t e . T h e s e may r e f l e c t t h e same r a t h e r t h a n i n d e p e n d e n t e v e n t s . Two o f t h e i n s e r t i o n s , Tn5_-33 a n d Tn5_ -37 , w h i c h r e t a i n e d P N P a s e a c t i v i t y , d e l i m i t 2 . 2 K b o f t h e c l o n e d DNA r e q u i r e d f o r t h e e x p r e s s i o n o f P N P a s e a c t i v i t y . I n s e r t i o n s b e t w e e n t h e s e b o u n d a r i e s d e s t r o y P N P a s e a c t i v i t y . D . D I R E C T I O N OF T R A N S C R I P T I O N / T R A N S L A T I O N I n o r d e r t o d e t e r m i n e t h e p o l a r i t y o f t r a n s c r i p t i o n / t r a n s l a t i o n , p o l y p e p t i d e p r o d u c t s o f v a r i o u s T n 5 i n s e r t i o n s w e r e e x a m i n e d u s i n g t h e m a x i c e l l s t r a i n C S R 6 0 3 ( S a n c a r e t a l . , 1 9 7 7 ) . M a x i c e l l s w e r e t r a n s f o r m e d w i t h t h e p l a s m i d p B R 3 2 2 , p H E l a n d s e v e r a l Tn5_ d e r i v a t i v e s o f p H E l . T r a n s f o r m a n t s w e r e p u r i f i e d , a n d a s s a y e d f o r P N P a s e a c t i v i t y ( T a b l e 4 ) . T h e p l a s m i d DNA w a s e x t r a c t e d , a n d r e s t r i c t i o n a n a l y s i s p e r f o r m e d t o e n s u r e t h a t n o a l t e r a t i o n s h a d o c c u r r e d . A f t e r UV i r r a d i a t i o n , t h e o n l y p r o t e i n s w h i c h c o n t i n u e t o b e made i n s i g n i f i c a n t a m o u n t s a r e e n c o d e d b y t h e 4 6 . T A B L E 4 . P o l y n u c l e o t i d e p h o s p h o r y l a s e a s s a y s o f p H E l a n d Tn_5 d e r i v a t i v e s S t r a i n P N P a s e a c t i v i t y * M C l O O O / p H E l 5 7 . 7 M C 1 0 0 0 / p S C 1 7 8 4 . 3 M C 1 0 0 0 / p S C 2 0 6 3 . 1 M C 1 0 0 0 / p S C 2 1 5 . 4 M C 1 0 0 0 / p S C 2 6 4 . 6 M C 1 0 0 0 / p S C 3 3 4 5 . 2 M C 1 0 0 0 / p S C 3 5 4 . 9 M C 1 0 0 0 / p S C 3 7 5 1 . 4 M C 1 0 0 0 / p S C 5 2 7 . 0 M C 1 0 0 0 / p S C 5 5 4 . 1 M C 1 0 0 0 / p S C 6 2 5 2 . 7 M C 1 0 0 0 / p S C 7 3 6 8 . 0 M C 1 0 0 0 / p S C 7 5 8 . 0 C S R 6 0 3 5 . 3 C S R 6 0 3 / p B R 3 2 2 3 . 9 C S R 6 0 3 / p H E l 1 8 . 5 C S R 6 0 3 / p S C 3 3 1 7 . 5 C S R 6 0 3 / p S C 3 5 2 . 7 C S R 6 0 3 / p S C 5 2 5 . 4 C S R 6 0 3 / p S C 5 5 4 . 3 C S R 6 0 3 / p S C 6 2 4 5 . 3 C S R 6 0 3 / p S C 7 5 8 . 1 P o l y n u c l e o t i d e p h o s p h o r y l a s e a c t i v i t y i s e x p r e s s e d a s n m o l e s ADP p o l y m e r i s e d i n 1 0 m i n a t 3 7 ° C . T h e s p e c i f i c a c t i v i t y o f [ ' " C J - A D P i n t h e - 2 r e a c t i o n m i x w a s 1 .4 X 10 n m o l e s p e r c p m . V a l u e s s h o w n h a v e b e e n c o r r e c t e d f o r b a c k g r o u n d . A s s a y s w e r e r e p e a t e d a m i n i m u m o f t h r e e , t i m e s . D a t a s h o w n a r e f r o m o n e e x p e r i m e n t , b u t a r e r e p r e s e n t a t i v e o f t h e r e p e a t e d r e s u l t s . F o r t h e a s s a y p r o c e d u r e , r e f e r t o M a t e r i a l a n d M e t h o d s . 4 7 . F I G U R E 5 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p S ! 4 , P H E l ,  a n d p H E l T n 5 d e r i v a t i v e s b y a g a r o s e g e l e l e c t r o p h o r e s i s . E a c h DNA i s s h o w n d i g e s t e d w i t h H i n d l l l , a n d w i t h H i n d l l l a n d E c o R I r e s p e c t i v e l y . T h e s a m p l e s a r e : ( 1 ) p J C 7 0 1 s t a n d a r d ; ( 2 - 3 ) p S 1 4 ; ( 4 - 5 ) p H E l ; ( 6 - 7 ) p S C 2 0 ; ( 8 - 9 ) p S C 3 3 ; ( 1 0 - 1 1 ) p S C 7 5 ; ( 1 2 - 1 3 ) p S C 5 2 ; ( 1 4 - 1 5 ) p S C 3 5 ( 1 6 - 1 7 ) p S C 5 5 ; ( 1 8 - 1 9 ) P S C 3 7 ; ( 2 0 - 2 1 ) P S C 6 2 ; ( 2 2 ) P J C 7 0 1 s t a n d a r d . S a m p l e s w e r e e l e c t r o p h o r e s e d t h r o u g h a 0 .7% a g a r o s e g e l . T h e s i z e s o f t h e s t a n d a r d f r a g m e n t s a r e 6 . 4 , 2 . 8 , 2 . 2 , 1 . 3 a n d 1 . 1 K b . F I G U R E 5 48. 4 9 . F I G U R E 6 T h e s i t e s o f T n 5 i n s e r t i o n i n p H E l . A r r o w s i n d i c a t e t h e i n s e r t i o n s i t e s o f Tn_5 i n t o p l a s m i d p H E l . D i s t a n c e s w r i t t e n b e n e a t h e a c h s i t e a r e i n K b r e l a t i v e t o t h e E c o R I s i t e . T h e i n s e r t i o n s w h i c h d i s r u p t t h e p n p g e n e a r e t h o s e l o c a t e d b e t w e e n ( b u t n o t i n c l u d i n g ) p S C 6 7 ( 2 0 ) a n d p S C 3 7 ; T h i s d e l i n e a t e s a max imum o f a p p r o x i m a t e l y 2 . 6 K b o f DNA r e q u i r e d f o r p n p e x p r e s s i o n . T h e l o c a t i o n o f t h e p n p a n d amp g e n e s a r e i n d i c a t e d . T h e p l a s m i d s a r e T e t S , b e c a u s e t h e c l o n e d f r a g m e n t d i s r u p t s t h e t e t p r o m o t e r . FIGURE 6 5 1 . p l a s m i d . I n a d d i t i o n t o t h e a m p i c i l l i n p e p t i d e s o f p B R 3 2 2 , p l a s m i d p H E l p r o d u c e d a p e p t i d e o f 8 4 , 0 0 0 MW w h i c h c o - m i g r a t e d w i t h a p u r i f i e d p r e p a r a t i o n o f p o l y n u c l e o t i d e p h o s p h o r y l a s e f r o m E_. c o l i o n SDS g e l s . A s m a l l e r p r o t e i n o f < 1 2 , 0 0 0 MW w a s a l s o o b s e r v e d . T h e T n 5 i n s e r t i o n s i n t o p H E l w h i c h h a d l o s t P N P a s e a c t i v i t y h a d a l s o l o s t t h e 8 4 , 0 0 0 MW p r o t e i n . I n some o f t h e s t r a i n s , l o s s o f t h e P N P a s e b a n d w a s a c c o m p a n i e d b y t h e a p p e a r a n c e o f a s m a l l e r b a n d w h i c h r e p r e s e n t s a f u s i o n p r o d u c t o f t h e a b o r t i v e P N P a s e p o l y p e p t i d e a n d 0 t o 6 a m i n o a c i d s s p e c i f i e d b y t h e e n d o f Tn_5 ( R o t h s t e i n e t a l . , 1 9 8 0 ) , w h e r e a s i n o t h e r s t r a i n s , n o a d d i t i o n a l b a n d was e v i d e n t . A l t h o u g h p S C 3 3 h a d P N P a s e a c t i v i t y ( T a b l e 4 ) , t h e 8 4 , 0 0 0 MW p r o t e i n wa s r e p l a c e d b y a p r o t e i n o f a p p r o x i m a t e l y 7 0 , 0 0 0 MW, i n d i c a t i n g t h a t t h e i n s e r t i o n i n p S C 3 3 h a s d i s r u p t e d t h e g e n e . T h e i n s e r t i o n i n p S C 7 5 p r o d u c e d a s o m e w h a t s m a l l e r p e p t i d e o f a b o u t 6 4 , 0 0 0 MW w h i c h was p r e s e n t i n v e r y s m a l l a m o u n t s . T h i s f u s i o n p e p t i d e h a d l o s t P N P a s e a c t i v i t y . A n o t h e r P N P a s e d e f i c i e n t p l a s m i d , p S C 3 5 , p r o d u c e d a t r u n c a t e d p e p t i d e o f 3 4 , 0 0 0 MW ( F i g u r e 7 ) . T h e s e d a t a i n d i c a t e t h a t t h e 5 ' - e n d o f t h e g e n e i s a t t h e H i n d l l l e n d o f t h e c l o n e d DNA a n d t r a n s c r i p t i o n o n t h e E_. c o l i c h r o m o s o m e i s a n t i - c l o c k w i s e . T h e m o l e c u l a r w e i g h t o f t h e s e p a r t i a l p e p t i d e s m e a n s t h e p o s i t i o n o f t h e 5 ' - e n d o f t h e c o d i n g p o r t i o n i s c l o s e t o t h e s i t e o f i n s e r t i o n i n p S C - 5 5 , a n d t h e 3 ' l i m i t v e r y c l o s e t o t h e s i t e o f i n s e r t i o n p S C 2 0 . A s T n 5 - 3 7 d o e s n o t d i s r u p t P N P a s e a c t i v i t y a s e x p r e s s e d f r o m t h e p l a s m i d , i t i s r e a s o n a b l e t o c o n c l u d e t h a t t h e t r a n s c r i p t i o n a l c o n t r o l r e g i o n s o f t h e g e n e a r e b e t w e e n t h e i n s e r t i o n s i n p S C 5 5 a n d p S C 3 7 . E . L O C A T I O N OF PROMOTERS FOR p n p AND r p s O T o d e f i n e m o r e p r e c i s e l y t h e p u t a t i v e t r a n s c r i p t i o n a l c o n t r o l r e g i o n 5 2 . F I G U R E 7 A u t o r a d i o g r a m o f p r o t e i n s f o r m e d i n p l a s m i d - c o n t a i n i n g  m a x i c e l l s . C e l l e x t r a c t s w e r e e l e c t r o p h o r e s e d o n a n S D S - p o l y a c r y l a m i d e g e l . S a m p l e s f r o m f a r l e f t t o r i g h t a r e : ( 1 ) p B R 3 2 2 ; ( 2 ) p H E l ; ( 3 ) p S C 3 3 ; ( 4 ) P S C 7 5 ; ( 5 ) p S C 5 2 ; ( 6 ) p S C 3 5 ; ( 7 ) P S C 5 5 ; ( 8 ) P S C 6 2 ; ( 9 ) p H E l . T h e p o s i t i o n s o f p u r i f i e d p o l y n u c l e o t i d e p h o s p h o r y l a s e ( 8 4 , 0 0 0 MW) , t h e a m p i c i l l i n p e p t i d e o f p B R 3 2 2 ( 3 1 , 0 0 0 MW) a n d t h e k a n a m y c i n r e s i s t a n t T n 5 p e p t i d e ( 2 6 , 0 0 0 MW) a r e i n d i c a t e d . T h e f u s i o n p o l y p e p t i d e s r e s u l t i n g f r o m T n 5 i n s e r t i o n i n t o t h e p l a s m i d p n p g e n e a r e i n d i c a t e d b y a r r o w s . A s m a l l p e p t i d e o f < 1 2 , 0 0 0 MW e n c o d e d b y t h e 4 . 8 K b H i n d l l l - E c o R I f r a g m e n t i s a l s o a p p a r e n t . 53. F I G U R E 7 5 4 . o f t h e p n p g e n e , p H E l wa s m a p p e d w i t h t h e e n z y m e s H i n d i , H p a l a n d P s t I . T h e r e s t r i c t i o n d a t a a n d map o b t a i n e d a r e s h o w n i n F i g u r e 8 a n d a t t h e t o p o f F i g u r e 9 r e s p e c t i v e l y . O r d e r i n g o f t h e t h r e e s m a l l e s t P s t I f r a g m e n t s , t h e P s t l ^ - P s t l ^ ( 1 6 0 b p ) , t h e P s t l ^ P s t l ^ ( 3 2 5 b p ) , a n d t h e P s t l ^ - P s t l ^ . ( 8 5 b p ) w a s d o n e b y 3 ' l a b e l l i n g o f t h e E c o R I - H i n d l l l f r a g m e n t o f p H E l f o l l o w e d b y p a r t i a l d i g e s t i o n w i t h P s t I . T h e T n 5 i n s e r t i o n s w e r e t r i p l e - d i g e s t e d w i t h P s t I , H i n d l l l a n d E c o R I t o s e e w h i c h f r a g m e n t s h a d b e e n a l t e r e d b y e a c h i n s e r t i o n ( F i g u r e 1 0 ) . P l a s m i d p S C 2 0 a p p e a r e d t o h a v e t h e Tn5 i n s e r t e d i n t h e 85 bp P s t I f r a g m e n t a n d p S C 2 1 h a d Tn_5 i n t h e 3 2 5 bp P s t I f r a g m e n t . T h e e a r l i e r m a p p i n g o f t h e T n 5 i n s e r t i o n s made t h i s c o n s i s t e n t w i t h t h e o r d e r i n g o f P s t I f r a g m e n t s N o b t a i n e d b y t h e p a r t i a l r e s t r i c t i o n a n a l y s i s . T h e m a x i c e l l c e l l e x p e r i m e n t s i n d i c a t e d t h a t t w o p r o t e i n s w e r e b e i n g p r o d u c e d b y p H E l , P N P a s e a n d a s m a l l e r p r o t e i n . T h e l a t t e r w a s p r o b a b l y t h e p r o d u c t o f t h e r p s O g e n e , t h e r i b o s o m a l p r o t e i n S 1 5 . G e n e t i c m a p p i n g e x p e r i m e n t s h a d i n d i c a t e d t h a t t h e r p s O l o c u s maps t o t h e l e f t o f p n p ( F i g u r e 2 ) . B o t h p r o t e i n s w e r e p r o d u c e d b y p S C 6 2 . A P s t l - H i n d l l l - E c o R I r e s t r i c t i o n a n a l y s i s o f p S C 6 2 p l a c e d t h e i n s e r t i o n s i t e a p p r o x i m a t e l y 5 0 0 b p t o t h e l e f t o f t h e P s t ^ s i t e . M a p p i n g o f Tn_5 i n s e r t i o n s a n d P N P a s e a s s a y s i n d i c a t e d t h a t t h e t r a n s c r i p t i o n a l c o n t r o l r e g i o n f o r p n p w a s b e t w e e n t h e i n s e r t i o n s i n p S C 3 7 a n d p S C 5 5 . T h e s e i n s e r t i o n s a r e w i t h i n t h e P s t l j - H p a l ^ f r a g m e n t , t h e i n s e r t i o n i n p S C 3 7 m a p p i n g v e r y c l o s e t o t h e P s t l ^ s i t e , a n d p S C 5 5 a p p r o x i m a t e l y 3 5 0 bp t o t h e r i g h t o f t h e P s t l - ^ s i t e ( F i g u r e 9 ) . T h e i n s e r t i o n o n p l a s m i d p S C 3 7 c l e a r l y r e t a i n s P N P a s e a c t i v i t y b u t i s p r e s u m a b l y d e f e c t i v e i n t h e s y n t h e s i s o f r i b o s o m a l p r o t e i n S15 s i n c e t h e s i t e o f i n s e r t i o n maps w i t h i n t h e r p s O c o d i n g s e q u e n c e ( s e e b e l o w ) . T h e 5 5 . F I G U R E 8 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p H E l o n  a g a r o s e a n d a c r y l a m i d e g e l s . T h e 0 .7% a g a r o s e g e l i s s h o w n o n t h e l e f t , t h e 5% a c r y l a m i d e g e l o n t h e r i g h t . E n z y m e d e s i g n a t i o n s a r e : H e , H i n d i ; E , E c o R I ; H , H i n d l l l ; P , P s t I . T h e s i z e s o f p J C 7 0 1 d i g e s t e d w i t h E c o R I s t a n d a r d f r a g m e n t s a r e 6 . 4 , 2 . 8 , 2 . 2 , 1 . 3 , a n d 1 . 1 K b . T h e s i z e s o f p B R 3 2 2 d i g e s t e d w i t h H p a l I r a n g e f r o m 6 2 2 t o 67 b p . T h e r e s t r i c t i o n map o b t a i n e d i s s h o w n i n F i g u r e 9 . 5 7 . F I G U R E 9 R e s t r i c t i o n map o f p H E l a n d d e r i v a t i v e g - g a l a c t o s i d a s e  f u s i o n p l a s m i d s . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : H , H i n d l l l ; H p , H p a l ; P , P s t I ; H e , H i n d i ; E , E c o R I . E a c h H p a l s i t e i s a l s o a H i n d i s i t e . F o r r e s t r i c t i o n d i g e s t s s e e F i g u r e 1 2 . T h e ATG s t a r t a n d TAA s t o p c o d o n s f o r t h e S 1 5 s e q u e n c e a r e s h o w n . F o l l o w i n g t h e s e i s t h e p o s s i b l e ATG s t a r t c o d o n f o r P N P a s e . S i t e s o f T n 5 i n s e r t i o n i n p S C 6 2 a n d p S C 3 7 a r e s h o w n b y T n 6 2 a n d T n 3 7 r e s p e c t i v e l y . F r o m m a x i c e l l e x p e r i m e n t s , b o t h S 1 5 a n d P N P a s e a r e p r o d u c e d b y p S C 6 2 , a n d P N P a s e i s p r o d u c e d b y T n 3 7 . P h a g e mp7PAT a n d p l a s m i d pUB2 a r e L a c , a s t h e f u s i o n s a r e n o t i n f r a m e . F o r p l a s m i d a n d p h a g e c o n s t r u c t i o n s , r e f e r t o M a t e r i a l s a n d M e t h o d s . F r a g m e n t s c o m m o n l y r e f e r r e d t o i n t h e t e x t a r e : H p a l ^ - H p a l ^ ( 6 2 0 b p ) ; H p a l o - H p a l , ( 8 5 0 b p ) ; H p a l p - P s t l - . ( 2 5 0 b p ) ; P s t I . - H p a l , ( 6 0 0 b p ) . 58. FIGURE 9 M Hp, T zA-i J-H p 2 H p . A T G PJ H p , H p . A T G P. T A A A T G He J I ' 1 1 U L p 2 p J P f l P 5 - J 1 ' ' i Sm/Hp p Hp/Sm fl-qal p S H 1 2 2 L a c ' p S H 21 L o c iimiuiMiuimnnA wimiiiiiin:i-frnim PUPIT LOC 1 . S m / H K Hp/Sm I / 1 - g o I J - j ' p M B I L o c m p 7 P A T H l * / T H p H p P | S m / ! - g o l • a m / r i p r i /3 - cj0 ( -Lj p M S 3 I L Q C * 5 9 . F I G U R E 1 0 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f T n 5  i n s e r t i o n s i n p H E l b y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . E a c h ' DNA i s s h o w n d i g e s t e d w i t h P s t I , H i n d l l l , a n d E c o R I . T h e s a m p l e s a r e : ( 1 ) p B R 3 2 2 s t a n d a r d , ( 2 ) p H E l , ( 3 ) P S C 6 2 , ( 4 ) P S C 5 2 , ( 5 ) p S C 3 7 , ( 6 ) p S C 2 6 , ( 7 ) P S C 2 1 , ( 8 ) p S C 2 0 , ( 9 ) p S C 1 7 , ( 1 0 ) p S C 5 5 , ( 1 1 ) p S C 3 5 , ( 1 2 ) 7 0 1 s t a n d a r d . T h e s i z e s o f t h e p B R 3 2 2 d i g e s t e d w i t h H p a l I r a n g e f r o m 6 2 2 t o 67 b p . T h e s i z e s o f p J C 7 0 1 d i g e s t e d w i t h E c o R I a r e 6 . 4 , 2 . 8 , 2 . 2 , 1 . 3 , a n d 1 . 1 K b . FIGURE 10 1 2 3 4 5 6 789101112 i n s e r t i o n o n p l a s m i d p S C 5 5 i n a c t i v a t e s t h e e x p r e s s i o n o f p n p b u t n o t o f r p s O . T h e s e r e s u l t s s u g g e s t t h a t r p s O a n d p n p a r e i n s e p a r a t e t r a n s c r i p t i o n u n i t s a n d t h a t t h e p r o m o t e r f o r p np i s l o c a t e d w i t h i n t h e 3 5 0 n u c l e o t i d e s w h i c h s e p a r a t e t h e r e s p e c t i v e s i t e s o f i n s e r t i o n i n p S C 3 7 a n d p S C 5 5 . T h i s c o n c l u s i o n i s c o n s i s t e n t w i t h t h e o b s e r v a t i o n o f P o r t i e r ( 1 9 8 2 ) . B y d e l e t i o n m a p p i n g h e w a s a b l e t o s h o w t h a t t h e H p a l ^ - H p a l ^ f r a g m e n t ( F i g u r e 9 ) c o n t a i n s t h e p r o m o t e r ( s ) f o r r p s O a n d p n p , a l t h o u g h h e w a s u n a b l e t o d i s t i n g u i s h b e t w e e n s e p a r a t e a n d c o - t r a n s c r i p t i o n . F . THE DNA SEQUENCE OF P U T A T I V E PROMOTER REGIONS FOR r p s O AND pnp . AND  THE CODING SEQUENCE O F , S 1 5 T h e 8 5 0 b p H p a l f r a g m e n t o f p H E l w a s s e q u e n c e d . T h e DNA s e q u e n c i n g w a s c a r r i e d o u t b y t h e d i d e o x y m e t h o d o f S a n g e r a s d e s c r i b e d b y M e s s i n g ( M e s s i n g , 1 9 8 0 ) . T h e s e q u e n c i n g s t r a t e g y i s s h o w n i n F i g u r e 1 1 . T h e s e q u e n c e s a s s o c i a t e d w i t h t r a n s c r i p t i o n s t a r t s a n d s t o p s a r e d i s c u s s e d b e l o w . T h e DNA s e q u e n c e i s s h o w n i n F i g u r e 1 2 . T h e c o d i n g s e q u e n c e f o r t h e S 1 5 p r o t e i n a g r e e s w i t h t h e p u b l i s h e d a m i n o a c i d s e q u e n c e ( M o r i n a g a e t a l . , 1 9 7 6 ) e x c e p t f o r t h e i n s e r t i o n o f a n e x t r a h i s t i d i n e r e s i d u e a t p o s i t i o n 4 6 , a CAC c o d o n a t n u c l e o t i d e 2 8 2 . T h e i n i t i a t o r m e t h i o n i n e i s a p p a r e n t l y n o t f o u n d i n t h e m a t u r e p r o t e i n . T h e c o d o n u s a g e i n t h i s g e n e p a r a l l e l s t h a t f o u n d i n o t h e r r i b o s o m a l p r o t e i n g e n e s : 74 o u t o f 85 c o d o n s a r e t h o s e r e a d b y t h e m o s t a b u n d a n t t R N A s p e c i e s ( G o u y a n d G a u t i e r , 1 9 8 2 ; G r o s j e a n a n d F i e r s , 1 9 8 2 ) . T h e S h i n e a n d D a l g a r n o s e q u e n c e f o r r p s O i s GGCAG ( F i g u r e 1 2 ) . T h i s i s h o m o l o g o u s t o a s e q u e n c e i n t h e 1 6 s r R N A w h i c h i s k n o w n t o b i n d S 1 5 . T h e P s t I . s i t e ( n u c l e o t i d e 2 6 1 ) maps J u s t 5 ' t o t h e s i t e o f 6 2 . F I G U R E 11 T h e DNA s e q u e n c i n g s t r a t e g y . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : H p , H p a l ; P , P s t I ; S a u , S a u 3 A ; T , T a q I ; B , B a m H I . T h e ATG s t a r t a n d TAA s t o p c o d o n s o f S15 a n d t h e p r o b a b l e ATG s t a r t c o d o n o f P N P a s e a r e i n d i c a t e d . Hp^ a n d H p ^ , a r e H p a l ^ a n d H p a l 7 | o f F i g u r e 9 . T h e BamHI s i t e i s f r o m t h e f u s i o n v e c t o r p M C 1 4 0 3 . T h e l i n e s i n d i c a t e t h e s e q u e n c e d p o r t i o n s , w i t h a r r o w s i n d i c a t i n g t h e d i r e c t i o n i n w h i c h t h e y w e r e s e q u e n c e d . T h e DNA r e p r e s e n t e d b y l i n e s 5 a n d 6 wa s o b t a i n e d f r o m p M B l a n d p S H 1 2 2 . T h e s o u r c e f o r o t h e r DNA f r a g m e n t s w a s p H E l . E a c h f r a g m e n t w a s s e q u e n c e d a t l e a s t t w i c e . F o r c l o n i n g d e t a i l s , s e e M a t e r i a l a n d M e t h o d s . 63. FIGURE 11 — O to co « Oi ro > 64. F I G U R E 12 T h e DNA s e q u e n c e o f r p s O a n d i n i t i a l p a r t o f j m j j . T h e a m i n o a c i d s e q u e n c e f o r t h e S15 g e n e , a n d p o s s i b l e i n i t i a l a m i n o a c i d s f o r P N P a s e a r e i n d i c a t e d b y t h e t h r e e l e t t e r c o d e f o r a m i n o a c i d s . T h e DNA s e q u e n c e o f S 1 5 i n d i c a t e s t h a t t h e r e i s a n a d d i t i o n a l a m i n o a c i d v i s a v i s t h e p u b l i s h e d p r o t e i n s e q u e n c e ( M o r a n a g a e t a l . , 1 9 7 6 ) . T h i s e x t r a h i s t i d i n e c o d o n i s a t n u c l e o t i d e s 2 8 3 - 2 8 5 . T h e m a j o r - 3 5 a n d - 1 0 p r o m o t e r r e g i o n s f o r e a c h g e n e a r e u n d e r l i n e d a n d o v e r l i n e d . T h e H p a l 7 | s i t e o f p H E l ( F i g u r e 9 ) w h i c h i s t h e j u n c t i o n i n p n p - L a c Z f u s i o n s i s a t n u c l e o t i d e 8 4 2 . T h e p r i m a r y r p s O t e r m i n a t o r i s i n d i c a t e d b y a d o t a t n u c l e o t i d e 4 5 8 . T h e m a j o r 5 ' t r a n s c r i p t i o n a l t e r m i n i d e f i n e d b y S I m a p p i n g a r e i n d i c a t e d b y a r r o w h e a d s . R e s t r i c t i o n s i t e s u s e d f o r c l o n i n g a n d S I m a p p i n g a r e i n d i c a t e d . . 20 40 GO 80 100 HP A I >-GTT A ACCGTCT_TGCGATA ACAGGTCGCT ACGAGTAGATATGCCGCTT AACGTCGCGTAAATTGTTTAACACTTTGCGTAACGTACACTGGGATCGCTGAA 120 140 160 180 200 TTAGAGATCGGCGTCCTTTCATTCTATATACTTTGGCAGTTTTAAAATGTCTCTAAGTACTGAAGCAACAGCTAAAATCGTTTCTGAGTTTGGTCGTGAC S15: Me tSe rLeuSe rThrG luA1aThrA1aLys I1eVa1Se rG1uPheG1yArgAsp 220 240 260 280 300 HPAII PSTI GC AAACGACACCGGTTCTACCGAAGTTCAGGTAGCACTGCTGACTGCACAGATCAACCACCTGCAGGGCCACTTTGCAGAGCACA AA AA AGATCACCACA A ) aAsnAspThi-Gl y S e r T h r G l u V a 1 Gl nVAl A 1 aLeuLeuThrA 1 aG 1 n l 1 eAsnHi sLeuG 1 nG 1 yH i sPheA 1 aGl uHi s l y s L ysA s p H i sH i sS 320 340 3G0 380 400 GCCGTCGTGGTCTGCTGCGCATGGTTTCTCAGCGTCGTAAACTGCTCGACTACCTGAAACGTAAAGACGTAGCACGTTACACCCAGCTCA TCGAGCGCCT er ArcjArgG 1 yLe'.iLeuArgMe tVa 1 SerG 1 nArgArgLysLeuLeuAspTyr-LeuLysArgLysAspVa l A l a A r g T y r T h r G l n L o n I l e G l u A r g L e . 420 440 460 480 500 GGGTC T GCG TCGCTAA T TCTTGCGAGTTTCAGAAAAGGGGGCCTGAGTGGCCTTTTTTCAAGCTGACGGCAGCAATTCACTGGA AACTAATGTATTGTTG u G 1 y l e u A r g A r g * * * 520 540 • 560 580 600 CTATGAATGATC r TCCGTTGCAGAGGTTCGCGCGGCTAATGAGAGGCTTTACCCACATAGAGCTGGTTAGGCGTTGTCATTAGTCGCGAGGATGCGCAGA 620 640 660 680 700 AG A TCGGGT AT T A AC AC AGTGCCGT A AGGT ACTGTCT A AGA AAGAGA A AGGATATT AC AT TGCTTA ATCCGATCGTTCGT A A AT T CC AGT ACGGCC A AC A 720 740 760 780 800 HP A I I CACCGTGACTCTGGAAACCGGCATGATGGCTCGTCAGGCTACTGCCGCTGTTATGGTTAGCATGGATGACACCGCGGT ATTCGTT ACCGTTGTTGGCCAG PNP : MetMetA 1 a A r g G I n A l a T h r A l a A l a V a l M e t V a l S e r M e t A s p A s p T h r A 1aVa1PheVa1 rhrVa1Va1GlyG)n 820 840 HPAI AAA AAAGCCAAACCAGGTCAGGACTTCTTCCCACTGACCGTTAAC. LysLysA i-gLysProG I yd 1 nAspPhePheProLeuThr-Va 1 Asn . 66. i n s e r t i o n o f Tn5_-37 a n d i s w i t h i n t h e r p s O s e q u e n c e . F r o m t h e s i z e o f t r u n c a t e d p e p t i d e s p r o d u c e d b y v a r i o u s T n 5 i n s e r t i o n s i n t o t h e p n p g e n e ( F i g u r e 7 ) , i t c a n be e s t i m a t e d t h a t t h e c o d i n g r e g i o n o f p n p b e g i n s s o m e -w h e r e b e t w e e n n u c l e o t i d e s 6 5 0 a n d 8 0 0 . A p o s s i b l e r e a d i n g f r a m e b e g i n n i n g w i t h two c o n s e c u t i v e ATG m e t h i o n i n e c o d o n s a t n u c l e o t i d e 7 23 may r e p r e s e n t t h e p n p g e n e . T h i s i s s u p p o r t e d b y t h e o b s e r v a t i o n t h a t i n p h a s e f u s i o n s t o a 5 ' d e l e t e d l a c Z g e n e a t t h e H p a l s i t e ( n u c l e o t i d e 8 4 0 ) r e s u l t i n p r o d u c t i o n o f a h y b r i d p r o t e i n w i t h 3 - g a l a c t o s i d a s e a c t i v i t y . T h e p u r i n e s e q u e n c e GGAA p r e c e d e s t h e ATG i n i t i a t i o n c o d o n . T h e a s s i g n e d r e a d i n g f r a m e o f p n p c o n t a i n s 28 o u t o f 35 " w o b b l e " c o d o n s c h a r a c t e r i s t i c o f s t r o n g l y e x p r e s s e d p r o t e i n s ( G o u y a n d G a u t i e r , 1 9 8 2 ; G r o s j e a n a n d F i e r s , 1 9 8 2 ) . G . CONSTRUCTION OF p n p - l a c Z AND r p s Q - l a c Z F U S I O N P L A S M I D S T o f a c i l i t a t e r e g u l a t o r y s t u d i e s a n d t o d e t e c t t h e r e a d i n g f r a m e f o r p n p , a s e r i e s o f f u s i o n p l a s m i d s w e r e c o n s t r u c t e d ( M a t e r i a l s a n d M e t h o d s ) w i t h l a c Z e x p r e s s i o n v e c t o r s pMC435 ( C a s a d a b a n a n d C o h e n , 1 9 8 0 ) , pMC1403 ( C a s a d a b a n e t a l . , 1 9 8 0 ) , a n d p U C 1 3 ( V i e i r a a n d M e s s i n g , 1 9 8 2 ) . T h e s t r u c t u r e s o f t h e f u s i o n p l a s m i d s a l i g n e d w i t h p H E l a r e s h o w n i n F i g u r e 9 . R e s t r i c t i o n a n a l y s i s o f t h e f u s i o n p l a s m i d s i s s h o w n i n F i g u r e s 1 3 , 14 a n d 1 5 . T h e r e a d i n g f r a m e s r e l e v a n t t o t h e i r c o n s t r u c t i o n a r e d i a g r a m m e d i n F i g u r e 1 6 . 1 . T h e p n p - l a c Z F u s i o n P l a s m i d s T h e 8 5 0 bp H p a l - ^ - H p a l ^ f r a g m e n t ( F i g u r e 9 ) o f p H E l w h i c h a p p e a r l i k e l y t o c o n t a i n t h e p r o m o t e r ( s ) f o r r p s O a n d p n p w a s c l o n e d i n t o t h e S m a l s i t e o f p M C 1 4 0 3 . T h i s c l o n e wa s d e s i g n a t e d p S H 1 2 2 a n d was L a c + o n X - g a l i n d i c a t o r p l a t e s . T h e r e s t r i c t i o n s i t e P s t I . i s w i t h i n t h e 8 5 0 bp H p a l 6 7 . F I G U R E 1 3 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p H E l , pMC412  a n d pMC416 b y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : H , H i n d l l l ; H p , H p a l ; B , B a m H I ; P , P s t I . S a m p l e s w e r e r u n o n 5% a c r y l a m i d e g e l s . T h e s i z e s o f p J C 7 0 1 s t a n d a r d f r a g m e n t s a r e 6 . 4 , 2 . 8 , 2 . 2 , 1 . 3 a n d 1 . 1 K b . T h e s i z e s o f p B R 3 2 2 d i g e s t e d w i t h H p a l l r a n g e f r o m 6 2 2 t o 67 b p . N o t e t h a t p M C 4 l 2 c o n t a i n s t h e 8 5 0 bp H p a l f r a g m e n t o f p H E l w h i c h c o n t a i n s a P s t I s i t e , a n d p M C 4 l 6 c o n t a i n s t h e 6 5 0 bp H p a l f r a g m e n t o f p H E l . F I G U R E 13 CM CO M W H t B t H t Hp t S t d . P H P B P H H p Hp Hp Hp P I I I I I 6 9 . F I G U R E 14 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f p H E l a n d  d e r i v a t i v e L a c + g - g a l a c t o s i d a s e f u s i o n s b y a c r y l a m i d e g e l  e l e c t r o p h o r e s i s . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : H p , H p a l ; P , P s t I ; B , B a m H I ; E , E c o R I . S a m p l e s w e r e r u n o n 5% a c r y l a m i d e . T h e s i z e s t a n d a r d i s p B R 3 2 2 d i g e s t e d w i t h H p a l I . T h e f r a g m e n t s i z e s r a n g e f r o m 6 2 2 t o 67 b p . F o r d i a g r a m o f p l a s m i d s t r u c t u r e s , r e f e r t o F i g u r e 9 . c r-. 7 1 . F I G U R E 15 S e p a r a t i o n o f r e s t r i c t i o n e n z y m e f r a g m e n t s o f t h e  S 1 5 - p - g a l a c t o s i d a s e f u s i o n p l a s m i d , pMS31 b y a c r y l a m i d e g e l  e l e c t r o p h o r e s i s . R e s t r i c t i o n e n z y m e s a r e d e s i g n a t e d : S , S m a l ; E , E c o R I ; B , B a m H I ; P , P s t I ; H p , H p a l . T h e DNAs a r e : ( 1 ) p J C 7 0 1 a n d p B R 3 2 2 MW s t a n d a r d s ; ( 2 - 5 ) p M S 3 1 ; ( 6 ) p S H 1 2 2 ; ( 7 ) p H E l . I n o r d e r t o c o m p a r e t h e s e r e s u l t s w i t h t h e e x p e c t e d p l a s m i d s t r u c t u r e , r e f e r t o F i g u r e 9 . FIGUPE 15 1 2 3 4 5 6 7 8 MWSBPPBHp Std. EEE E P P 7 3 . F I G U R E 16 R e a d i n g f r a m e s i n t h e c o n s t r u c t i o n o f g - g a l a c t o s i d a s e  f u s i o n s w i t h P N P a s e a n d S 1 5 . R e s t r i c t i o n e n z y m e d e s i g n a t i o n s a r e : P , P s t I ; B , B a m H I ; S , S m a l ; H p , H p a l ; H p S , H p a l / S m a l f u s i o n . A r r o w s d e n o t e t h e r e s t r i c t i o n s i t e s u s e d i n p l a s m i d c o n s t r u c t i o n . F u s i o n j u n c t i o n s b e t w e e n t w o DNA s p e c i e s a r e s h o w n b y m e a n s o f s o l i d l i n e s . N o t e t h a t ( a ) i s t h e l o w e r p o r t i o n o f t h e f i g u r e , a n d ( b ) t h e u p p e r , ( a ) P N P a s e  f u s i o n s . T h e c l o n i n g s i t e s a n d r e a d i n g f r a m e o f t h e l a c e x p r e s s i o n v e c t o r p M C 1 4 0 3 a r e i n d i c a t e d . P l a s m i d p S H 1 2 2 i s L a c + a n d f u s e s t h e H p a l ^ s i t e f r o m p H E l ( F i g u r e 9 ) w i t h t h e S m a l s i t e o f p M C 1 4 0 3 . I n p U P 1 7 , w h i c h i s d e e p e r b l u e ( L a c + ) o n X - g a l i n d i c a t o r p l a t e s t h a n p a r e n t p U C 1 3 , t h e BamHI d o w n s t r e a m f r o m t h e H p a l / S m a l f u s i o n o f p S H 1 2 2 i s j o i n e d t o t h e BamHI s i t e o f pUC13 a n d r e s u l t s i n t h e same r e a d i n g f r a m e f o r b o t h . ( b ) S 1 5 f u s i o n s . T h e r e a d i n g f r a m e w i t h i n t h e S 1 5 g e n e a t t h e P s t l - ^ s i t e ( F i g u r e 9 ) i s s h o w n ( P o r t i e r , 1 9 8 2 ) . T h e M13 p h a g e c l o n e mp7PAT h a s t h i s P s t l j s i t e a d j a c e n t t o a BamHI s i t e . T h e r e a d i n g f r a m e s h o w n f o r mp7PAT i n t h i s f i g u r e i s n o t t h a t f o u n d i n t h e o r i g i n a l mp7 v e c t o r , b u t r a t h e r t h a t o f t h e S 1 5 g e n e . P l a s m i d pUB2 h a s t h e BamHI f r o m mp7 j o i n e d a t t h e BamHI s i t e o f p U C 1 3 . T h e r e a d i n g f r a m e s h o w n f o r pUB2 i s a g a i n n o t t h a t o f pUC13 b u t r a t h e r t h a t o f S 1 5 . R e s t r i c t i o n o f pUB2 a t t h e S m a l s i t e d o w n s t r e a m o f t h e BamHI s i t e a s s h o w n a l l o w s f o r a n i n - f r a m e f u s i o n b e t w e e n S 1 5 a n d ( s - g a l a c t o s i d a s e i n p M C 1 4 0 3 , a s s e e n b y t h e r e a d i n g f r a m e o f t h e l a t t e r s h o w n i n p a r t ( a ) . 74, FIGURE 16 p t C T C C A C C A C C T C t P P C T C C AIC CIA C CT C P p C T C CAJC CIAC C T C p C C C C A C C C C C T G C T C G A C C A C C T C C T C G A C C A G C T C B I C C A T C C C C T A C C t B B G|G A T C C C C T A clc B S C c'c C C A C C C C C T t (b) within S15 mp7 PAT pUB2 E t C A A T T C C T T A A C t E HpS N N G N N C T T C C C t s C A T C C C C C C C T A C C C C T A HpS C (C C B C T A C A C C A T C T C C A T C C C C (C C C C C B HpS N N C T T C C C C C C HpS C l C C B C C C t B (a) pMC-1403 pSH122 PUC13 pUP17 7 5 . f r a g m e n t a n d a l s o i n t e r r u p t s t h e S 1 5 c o d i n g s e q u e n c e . R e s u l t s w i t h t h e T n 5 i n s e r t i o n s i n p S C 3 7 a n d p S C 5 5 h a d i n d i c a t e d t h a t t h e p n p p r o m o t e r wa s w i t h i n t h e P s t I j - P s t I 2 f r a g m e n t ( F i g u r e 9 ) o f p H E l . A k a n a m y c i n r e s i s t a n c e c a s s e t t e ( V i e i r a a n d M e s s i n g , 1 9 8 2 ) wa s s u b s t i -t u t e d a t t h e P s t l - L s i t e o f p S H 1 2 2 t o g i v e p S F 2 1 ( F i g u r e 9 ) . B o t h o r i e n t a -t i o n s o f t h e c a s s e t t e r e s u l t e d i n a L a c + p h e n o t y p e , a f f i r m i n g t h a t t h e p n p p r o m o t e r i s i n d e e d l o c a t e d o n t h e P s t l ^ - H p a l , f r a g m e n t . T h i s f r a g m e n t was u s e d t o c o n s t r u c t a n i n - f r a m e f u s i o n i n p U C 1 3 , d e s i g n a t e d p U P l 7 a s d i a g r a m m e d i n F i g u r e 1 6 a . T h e same f r a g m e n t w a s a l s o p l a c e d i n a pMC1403 c o n t e x t t o g i v e p M B l ( F i g u r e 9 ) . E a c h o f t h e s e f u s i o n s g i v e s a s t r o n g L a c + p h e n o t y p e . a . DNA S e q u e n c e o f p n p - l a c Z F u s i o n s S e q u e n c i n g f r o m t h e f u s i o n j u n c t i o n s i n p S H 1 2 2 a n d p M B l i n d i c a t e d t h a t o n e b a s e p a i r h a d b e e n d e l e t e d f r o m t h e l a c Z e n d o f t h e f u s i o n j u n c t i o n d u r -i n g c l o n i n g ( F i g u r e 1 2 ) . T h i s d e l e t i o n w a s r e q u i r e d t o o b t a i n h i g h e x p r e s -s i o n o f l a c Z a n d t h u s c l e a r l y i d e n t i f i e s t h e r e a d i n g f r a m e o f t h e P N P a s e g e n e . A s i n d i c a t e d a b o v e , t h e r e i s a p u r i n e s e q u e n c e ( S h i n e a n d D a l g a r n o , 1 9 7 4 ; S t e i t z a n d J a k e s , 1 9 7 5 ) c o r r e c t l y p l a c e d i n f r o n t o f t w o c o n s e c u t i v e A T G c o d o n s a t n u c l e o t i d e 7 2 2 ( F i g u r e 1 2 ) . T h e S h i n e a n d D a l g a r n o s e q u e n c e s a r e t h o u g h t t o b e i m p o r t a n t i n t h e i n t e r a c t i o n o f mRNA w i t h t h e 3 ' e n d o f t h e 1 6 S r R N A t o e f f e c t r i b o s o m e b i n d i n g a n d i n i t i a t i o n o f t r a n s l a t i o n . 2 . A n r p s O - l a c Z F u s i o n P l a s m i d T h e DNA s e q u e n c e o f t h e S 1 5 c o d i n g r e g i o n made i t p o s s i b l e t o c o n s t r u c t a n i n - f r a m e f u s i o n o f • rpsO t o l a c Z . T h e 2 5 0 bp H p a l ^ - P s t l ^ f r a g m e n t f r o m p H E l w a s f i r s t f u s e d t o a s h o r t P s t l - S m a l l i n k e r f r a g m e n t a n d t h e n c l o n e d i n t o t h e S m a l s i t e o f pMC1403 t o g i v e t h e d e s i r e d i n - f r a m e 7 6 . f u s i o n ( F i g u r e 9 ) . P l a s m i d pMS31 wa s d i g e s t e d w i t h B a m H I - E c o R I a n d t h e 2 5 0 bp i n s e r t f r a g m e n t i s o l a t e d a n d c l o n e d i n t o m p l O a n d m p l l c u t w i t h B a m H I - E c o R I . O f e i g h t c l e a r p l a q u e s s c r e e n e d , t h r e e w e r e p o s i t i v e w h e n u s e d i n a f i g u r e - o f - e i g h t t e s t a g a i n s t a s e q u e n c e d H p a l ^ - P s t l ^ c l o n e . C o n t r o l f i g u r e - o f - e i g h t s w i t h n o t e s t e r p h a g e w e r e n e g a t i v e . T h e s e c l o n e s w e r e n o t s e q u e n c e d . H . B_-GALACTOSIDASE A S S A Y S OF F U S I O N P L A S M I D S T o q u a n t i t a t e t h e a m o u n t o f 3 - g a l a c t o s i d a s e p r o t e i n p r o d u c e d b y t h e f u s i o n p l a s m i d s , 3 - g a l a c t o s i d a s e a s s a y s w e r e p e r f o r m e d ( T a b l e 5 ) . T h e p l a s m i d s w e r e a s s a y e d i n t w o d i f f e r e n t s t r a i n b a c k g r o u n d s a n d g a v e s i m i l a r r e s u l t s i n e a c h . B o t h p S H 1 2 2 a n d p M B l ( p n p - l a c Z f u s i o n p l a s m i d s ) e x h i b i t e d h i g h l e v e l s o f B - g a l a c t o s i d a s e a c t i v i t y , t h e a c t i v i t y o f p S H 1 2 2 b e i n g a b o u t t w i c e t h a t o f p M B l . A g a i n , t h i s c o n f i r m s t h a t a m a j o r p r o m o t e r f o r p n p e x p r e s s i o n i s l o c a t e d o n t h e P s t I j - H p a l / f r a g m e n t p r e s e n t o n b o t h f u s i o n p l a s m i d s ( F i g u r e 9 ) . I n c o n t r a s t , t h e 3 - g a l a c t o s i d a s e a c t i v i t y o f p M S 3 1 i s r e l a t i v e l y l o w . I t i s h i g h l y i m p r o b a b l e t h a t t h i s f u s i o n i s o u t o f p h a s e s i n c e t h e r e a d i n g f r a m e s o f b o t h r p s O a n d l a c Z a r e k n o w n w i t h c e r t a i n t y a t t h e f u s i o n j u n c t i o n . P l a s m i d s p S H 1 2 2 a n d p M B l w e r e a s s a y e d i n g l u c o s e m i n i m a l m e d i u m w i t h c a s a m i n o a c i d s i n t h e p r e s e n c e a n d a b s e n c e o f t r y p t o p h a n . E . c o l i p o l y n u c l e o t i d e p h o s p h o r y l a s e a c t i v i t y i s s e l e c t i v e l y s t i m u l a t e d b y t h e a d d i t i o n o f t r y p t o p h a n t o t h e m e d i u m ( T h a n g e t a l . , 1 9 6 3 ) . B e c a u s e t h i s s t i m u l a t i o n wa s d u e t o d e n o v o e n z y m e s y n t h e s i s , a n e x p e r i m e n t wa s d o n e t o s e e i f t h i s e f f e c t c o u l d b e d e m o n s t r a t e d w i t h t h e f u s i o n p l a s m i d s ( T a b l e 5 ) . A d d i t i o n o f t r y p t o p h a n t o t h e m e d i u m d o e s i n c r e a s e t h e a m o u n t o f TABLE 5 The 3-galactosidase a c t i v i t y of s t r a i n s c o n t a i n i n g pMC1403 f u s i o n d e r i v a t i v e s S t r a i n U n i t s 3-galactosidase +trp a c t i v i t y 3 - t r p MC1000/pMC1403 <0.01 NT C MC1000/pSH122 1165 1053 MClOOO/pMBl 550 450 MC1000/pMS31 17b NTC CP78/pSH122 1012 846 CP78/pMBl 526 435 P-galactosidase s p e c i f i c a c t i v i t y was assayed and c a l c u l a t e d as described i n M a t e r i a l s and Methods. The s p e c i f i c a c t i v i t y r e f l e c t s the amount of ONPG hydrolyzed/min/A^Q at 28°C. Values shown are averaged from t r i p l i c a t e samples i n one experiment. Experiments were performed a minimum of three times f o r each s t r a i n , and the s p e c i f i c a c t i v i t i e s obtained were comparable to those shown. Growth ra t e s were s i m i l a r f o r a l l s t r a i n s . k The s p e c i f i c a c t i v i t y f o r MC1000/pMS31 was found to be s l i g h t l y h igher, ^40 u n i t s , i n NY plus glucose medium. Not t e s t e d . Two way r e g r e s s i o n a n a l y s i s of the data obtained w i t h and without tryptophan gave a standard e r r o r of 15 and an F c r i t i c a l > 0.05, i n d i c a t i n g that the d i f f e r e n c e i n 3-galactosidase a c t i v i t i e s w i t h and without tryptophan i s s i g n i f i c a n t . 7 8 . p r o t e i n p r o d u c e d b y t h e p o l y n u c l e o t i d e p h o s p h o r y l a s e - 3 - g a l a c t o s i d a s e f u s i o n s , i n b o t h p S H 1 2 2 a n d p M B l . T h e d a t a s u g g e s t t h a t t h e c o n t r o l r e g i o n l o c a t e d o n t h e P s t I j - H p a l ^ f r a g m e n t w h i c h i s i n b o t h p l a s m i d s may b e l a r g e l y r e s p o n s i b l e f o r t h e e f f e c t . I . N U C L E A S E S I M A P P I N G OF THE S 1 5 AND PNPASE T R A N S C R I P T S T h e r e s u l t s o f T n 5 i n s e r t i o n m u t a g e n e s i s e x p e r i m e n t s , DNA s e q u e n c e a n a l y s i s a n d e x p r e s s i o n o f f u s i o n p l a s m i d s s u g g e s t t h a t t h e r e g i o n s u r r o u n d i n g t h e S 1 5 g e n e a n d t h e s t a r t o f t h e P N P a s e g e n e c o n t a i n s e v e r a l t r a n s c r i p t i o n i n i t i a t i o n s i t e s . N u c l e a s e S I m a p p i n g o f P.NA t r a n s c r i p t s wa s d o n e t o l o c a t e p r e c i s e l y t h e s e t r a n s c r i p t i o n i n i t i a t i o n s i t e s a s w e l l a s RNA p r o c e s s i n g a n d t e r m i n a t i o n s i t e s . T h e RNA f o r t h e s e e x p e r i m e n t s wa s o b t a i n e d f r o m s e v e r a l d i f f e r e n t n o n - p l a s m i d a n d p l a s m i d s t r a i n s : M C 1 0 0 0 , M C l O O O / p H E l , M C 1 0 0 0 / p S H 1 2 2 , M C l O O O / p M B l a n d M C 1 0 0 0 / p M S 3 1 ( F i g u r e 9 ) . I n s t r a i n M C 1 0 0 0 , r p s O a n d p n p t r a n s c r i p t s a r e d e r i v e d o n l y f r o m t h e n o r m a l c h r o m o s o m a l g e n e s w h e r e a s i n t h e o t h e r s t r a i n s t r a n s c r i p t s a r e d e r i v e d b o t h f r o m t h e n o r m a l c h r o m o s o m a l g e n e a n d t h e h i g h c o p y n u m b e r p l a s m i d g e n e s . A l i q u o t s o f t h e v a r i o u s RNAs w e r e h y b r i d i z e d t o d i f f e r e n t 5 ' o r 3 ' e n d - l a b e l l e d f r a g m e n t s f r o m t h i s r e g i o n . H y b r i d i z a t i o n o f RNA t o 5 ' e n d - l a b e l l e d DNA f r a g m e n t s i d e n t i f i e s 5 ' t r a n s c r i p t e n d s w h e r e a s h y b r i d i z a t i o n t o 3 ' e n d - l a b e l l e d f r a g m e n t s i d e n t i f i e s 3* t r a n s c r i p t e n d s . T h e r e s u l t s o f t h e s e t r a n s c r i p t m a p p i n g e x p e r i m e n t s a r e s u m m a r i z e d i n F i g u r e 1 7 . T h e m a j o r s t a r t a n d s t o p s i t e s o f t h e r p s O t r a n s c r i p t s a r e a t a b o u t n u c l e o t i d e 4 5 a n d 4 5 8 r e s p e c t i v e l y a n d t h e m a j o r s t a r t s i t e f o r t h e p n p t r a n s c r i p t i s a t a b o u t n u c l e o t i d e 5 8 0 ( F i g u r e 1 2 ) . 7 9 . 1 . D e t e r m i n a t i o n o f t h e 5 ' T e r m i n i o f t h e r p s O T r a n s c r i p t s T o l o c a l i z e t h e 5 ' s t a r t s i t e o f S 1 5 t r a n s c r i p t s , a l i q u o t s o f t h e f i v e d i f f e r e n t RNAs w e r e h y b r i d i z e d t o t h e 5 ' e n d - l a b e l e d 9 0 0 bp B a m H I - P s t I f r a g m e n t d e r i v e d f r o m pUB2 ( F i g u r e 9 ) . T h e r e s u l t s a r e s h o w n i n F i g u r e 18 a n d s u m m a r i z e d i n F i g u r e 1 7 . T h e P s t I e n d o f t h i s f r a g m e n t l i e s w i t h i n t h e S 1 5 g e n e a n d t h e r e f o r e w i l l b e p r o t e c t e d b y t r a n s c r i p t s o f t h e S15 g e n e , w h e r e a s t h e BamHI e n d i s d e r i v e d f r o m t h e c l o n i n g v e c t o r a n d w i l l n o t b e p r o t e c t e d b y a n y o f t h e R N A s . T h e m a j o r f r a g m e n t p r o t e c t e d b y a l l f i v e RNAs wa s a b o u t 217 bp i n l e n g t h a n d r e p r e s e n t s a m a j o r t r a n s c r i p t i o n s t a r t s i t e a t a b o u t n u c l e o t i d e 4 5 , 1 0 0 b a s e s i n f r o n t o f t h e S 1 5 A T G t r a n s l a t i o n i n i t i a t i o n c o d o n . T h e b a c t e r i a l s t r a i n s w h i c h c o n t a i n p l a s m i d c l o n e s c a r r y i n g t h i s p r o m o t e r s e q u e n c e ( p H E l , p S H 1 2 2 a n d p M S 3 1 ) e x h i b i t a much m o r e i n t e n s e b a n d , i n d i c a t i n g t h a t t h e r p s O g e n e s o n t h e h i g h c o p y n u m b e r p l a s m i d s a s w e l l a s o n t h e c h r o m o s o m e a r e a c t i v e l y a n d f a i t h f u l l y t r a n s c r i b e d . A l o n g e r e x p o s u r e o f t h e a u t o r a d i o g r a m r e v e a l e d s e v e r a l a d d i t i o n a l m i n o r p r o t e c t e d f r a g m e n t s . T h e s h o r t e s t , a b o u t 1 1 0 b a s e s i n l e n g t h , c o r r e s p o n d s t o a 5 ' mRNA t e r m i n u s i m m e d i a t e l y t o t h e f r o n t o f t h e S 1 5 ATG t r a n s l a t i o n i n i t i a t i o n c o d o n . Two o t h e r p r o t e c t e d f r a g m e n t s a p p r o x i m a t e l y 3 1 5 a n d 8 5 0 b a s e s i n l e n g t h c o r r e s p o n d t o m i n o r s t a r t s i t e s 2 0 0 a n d 735 n u c l e o t i d e s i n f r o n t o f t h e ATG c o d o n . T h e s e l a s t t w o t r a n s c r i p t s a r e d e r i v e d f r o m m i n o r p r o m o t e r s i n f r o n t o f t h e c h r o m o s o m a l g e n e s o r t h e g e n e s o n p l a s m i d p H E l , a s t h e m i n o r p r o m o t e r s a r e n o t p r e s e n t i n t h e p l a s m i d s p S H 1 2 2 , p M B l o r p M S 3 1 . 2 . D e t e r m i n a t i o n o f t h e 3 ' T e r m i n i o f t h e r p s O T r a n s c r i p t s T o l o c a l i z e t h e 3 ' t e r m i n a t i o n s i t e o f t h e S 1 5 g e n e t r a n s c r i p t s , 8 0 . F I G U R E 17 T h e S I m a p p i n g s t r a t e g y a n d r e s u l t s . T h e RNA f o r h y b r i d i z a t i o n wa s e x t r a c t e d f r o m M C 1 0 0 0 a n d M C 1 0 0 0 c o n t a i n i n g v a r i o u s p l a s m i d s . A t t h e t o p o f t h e f i g u r e i s a r e p r e s e n t a t i o n o f c h r o m o s o m a l DNA , w i t h t h e c o d i n g s e q u e n c e s o f S 1 5 a n d P N P a s e i n d i c a t e d b y o p e n b o x e s . DNA p r o b e s w h i c h w e r e u s e d a r e s h o w n a s b l u n t e n d l i n e s , a n d t h e i r p e r t i n e n t l a b e l l e d s i t e s i n d i c a t e d b y m e a n s o f * . T r a n s c r i p t i o n a l s p e c i e s d e t e c t e d a f t e r S I n u c l e a s e t r e a t m e n t a r e s h o w n f o r e a c h p r o b e b y m e a n s o f a r r o w s . T h e h e a v i e r a r r o w s i n d i c a t e t h e m a j o r h y b r i d s d e t e c t e d ; t h e l i g h t e r a r r o w s r e p r e s e n t p o s s i b l e p r o c e s s e d t r a n s c r i p t s ; h y p h e n a t e d a r r o w s a r e m i n o r s p e c i e s d e t e c t e d b y S I m a p p i n g . T h e u p p e r B a m H I / T a q l - P s t I p r o b e wa s o b t a i n e d f r o m pUB2 ( F i g u r e 9 ) a n d e x t e n d s 6 5 0 b p u p s t r e a m o f t h e H p a l ^ s i t e w h i c h d e f i n e s t h e 5 ' t e r m i n u s o f t h e i n s e r t i n p S H 1 2 2 . T h e l o w e r P s t l - B a m H I p r o b e w a s o b t a i n e d f r o m p S H 1 2 2 , t h e l a b e l l e d BamHI s i t e b e i n g w i t h i n t h e v e c t o r s e q u e n c e s . T h e r e f o r e t h e t r a n s c r i p t s s h o w n f o r t h i s p r o b e a r e t h o s e s e e n w i t h p l a s m i d p S H 1 2 2 a n d p M B l RNAs ( F i g s . 2 0 c a n d 2 0 d ) . T h e r e s t o f t h e t r a n s c r i p t s i n d i c a t e d h e r e w e r e o b s e r v e d w i t h M C 1 0 0 0 R N A . F o r S I m a p p i n g p r o c e d u r e , s e e M a t e r i a l s a n d M e t h o d s . 8 1 . F I G U R E 17 X "O Ui ; CP -k1 x I T + 1 O X T) — T5 O l C O , s O I cr "a o O ca cr •o 0 s Oi o s O T T T T) CO T — z Q X CO y CD 8 2 . F I G U R E 1 8 A u t o r a d i o g r a m s o f S I m a p p i n g i n o r d e r t o d e t e r m i n e t h e 5 '  t e r m i n i o f t h e _rp_sO t r a n s c r i p t s . T h e 5 ' l a b e l l e d DNA p r o b e u s e d f o r h y b r i d i z a t i o n wa s t h e 9 0 0 bp B a m H I - P s t I f r a g m e n t 5 ' l a b e l l e d b y b l u n t - e n d k i n a s e r e a c t i o n : B P , B a m H I - P s t I . T h e RNAs u s e d f o r h y b r i d i z a t i o n a r e i n d i c a t e d a b o v e e a c h l a n e w h e r e P , DNA p r o b e a l o n e , n o S I n u c l e a s e ; r , r R N A c o n t r o l ; S , p S H 1 2 2 RNA; M , M C 1 0 0 0 RNA; MB , p M B l RNA; H , p H E l RNA; M S , pMS31 RNA ( F i g u r e 1 9 ) . T h e same a m o u n t o f RNA ( 1 0 0 p l ) o f a s t o c k w i t h a n Ag^Q = 2 w a s u s e d f o r e a c h h y b r i d i z a t i o n . F i g u r e ( b ) i s a l o n g e r e x p o s u r e o f F i g u r e ( a ) . F o r d e t a i l s o f h y b r i d i z a t i o n c o n d i t i o n s a n d S I n u c l e a s e t r e a t m e n t , r e f e r t o M a t e r i a l s a n d M e t h o d s . T h e s i z e s t a n d a r d wa s p B R 3 2 2 c u t w i t h H p a l l a n d l a b e l l e d b y K l e n o w f i l l - i n . T h e m o l e c u l a r s i z e s o f s t a n d a r d b a n d s a r e : 6 2 2 , 5 2 7 , 4 0 4 , 3 0 9 , 2 4 2 , 2 3 8 , 2 1 7 , 2 0 1 , 1 9 0 , 1 8 0 , 1 6 0 , 1 4 7 , 1 2 2 , 1 1 0 , 9 0 , 7 6 , 6 7 , 3 4 , 2 6 , 1 5 , a n d 9 . T h e l a r g e s t 622 bp b a n d i s i n d i c a t e d b y t h e o p e n a r r o w s . B l a c k a r r o w s i n d i c a t e p r o t e c t e d s p e c i e s d e s c r i b e d i n t h e t e x t ; t h e i r s i z e s i n b a s e s a r e i n d i c a t e d . F I G U R E 18 84. a l i q u o t s o f t h e v a r i o u s RNAs w e r e h y b r i d i z e d t o t h e 3 ' e n d - l a b e l e d 5 1 0 bp H p a l l f r a g m e n t w h i c h s p a n s t h e d i s t a l e n d o f t h e r p s O g e n e ( F i g u r e 17 a n d F i g u r e 1 9 ) . I n a l l c a s e s , t h e m a j o r p r o t e c t e d f r a g m e n t wa s a b o u t 2 4 5 b a s e s i n l e n g t h a n d c o r r e s p o n d s t o a s i t e a b o u t 4 0 n u c l e o t i d e s b e y o n d t h e TAA t e r m i n a t i o n c o d o n o f S15 a t n u c l e o t i d e 4 5 8 ( F i g u r e 1 2 ) . T h e s e q u e n c e i n t h i s r e g i o n a p p e a r s s i m i l a r t o k n o w n r h o - d e p e n d e n t t e r m i n a t o r s a n d N u s A r e c o g n i t i o n s e q u e n c e s ( s e e D i s c u s s i o n ) . T h e i n t e n s i t y o f t h e p r o t e c t e d f r a g m e n t i s e n h a n c e d i n t h e s a m p l e s o f RNA f r o m p l a s m i d s c a r r y i n g t h e i n t a c t S15 g e n e . A s e c o n d m i n o r p r o t e c t e d f r a g m e n t o f a b o u t 3 3 8 b a s e s i n l e n g t h c o r r e s p o n d s t o a 3 ' t r a n s c r i p t i o n t e r m i n u s 1 3 3 n u c l e o t i d e s d o w n s t r e a m f r o m t h e TAA t e r m i n a t i o n c o d o n . 3 . D e t e r m i n a t i o n o f t h e 5 ' T e r m i n i o f t h e p n p T r a n s c r i p t s T o l o c a l i z e t h e 5 ' t r a n s c r i p t i o n t e r m i n i o f P N P a s e g e n e t r a n s c r i p t s , M C 1 0 0 0 , p S H 1 2 2 a n d p M B l RNAs w e r e h y b r i d i z e d t o t w o 5 ' e n d - l a b e l l e d p r o b e s , a 5 1 0 b p H p a l l f r a g m e n t f r o m p H E l a n d a 6 0 0 bp P s t l - B a m H I f r a g m e n t f r o m p S H 1 2 2 , b o t h o f w h i c h s p a n t h e d i s t a l e n d o f r p s O a n d p r o x i m a l e n d o f p n p ( F i g u r e 17 .and F i g u r e 2 0 ) . T h e BamHI s i t e i s d e r i v e d f r o m v e c t o r pMC1403 s e q u e n c e s b e y o n d t h e f u s i o n j u n c t i o n a n d t h e r e f o r e s h o u l d b e p r o t e c t e d o n l y b y RNAs f r o m p S H 1 2 2 a n d p M B l p n p - l a c Z f u s i o n g e n e s ; T h e r e s u l t s w i t h e a c h o f t h e s e p r o b e s i n d i c a t e a m a j o r t r a n s c r i p t i o n s t a r t s i t e a t a b o u t n u c l e o t i d e 5 8 0 a p p r o x i m a t e l y 1 4 0 bp u p s t r e a m o f t h e p o s t u l a t e d A T G s t a r t o f p n p , a s r e p r e s e n t e d b y a p r o t e c t e d f r a g m e n t o f 1 4 0 b a s e s w i t h t h e H p a l l p r o b e , a n d 2 6 7 b a s e s w i t h t h e l o n g e r P s t l - B a m H I p r o b e . A d d i t i o n a l b u t m i n o r 5 ' t e r m i n i w e r e a l s o o b s e r v e d f o r e a c h o f t h e R N A s . One o f t h e s e maps 1 8 2 b p u p s t r e a m o f t h e p u t a t i v e ATG s t a r t o f p n p a t a b o u t n u c l e o t i d e 5 4 0 . T h e p r o t e c t e d s p e c i e s t h a t r e p r e s e n t t h i s 8 5 . F I G U R E 19 A u t o r a d i o g r a m s o f S I m a p p i n g i n o r d e r t o d e t e r m i n e t h e 3 '  t e r m i n i o f t h e r p s O t r a n s c r i p t s . T h e DNA p r o b e u s e d f o r h y b r i d i z a t i o n w a s t h e 5 1 0 bp H p a l l f r a g m e n t 3 ' l a b e l l e d b y K l e n o w f i l l - i n ( M a t e r i a l s a n d M e t h o d s ) . RNAs u s e d a r e s p e c i f i e d a b o v e e a c h l a n e : P , DNA p r o b e a l o n e , n o S I n u c l e a s e ; r , r R N A c o n t r o l ; M, M C 1 0 0 0 RNA; H , p H E l RNA ; M S , pMS31 RNA; S , p S H 1 2 2 RNA; MB , p M B l RNA ( r e f e r t o F i g u r e 1 9 ) . T h e n u m b e r s b e l o w t h e RNA d e s i g n a t i o n r e f e r t o t h e a m o u n t s o f RNA u s e d ( u l ) . A l l RNA s t o c k s o l u t i o n s h a d a n ^fro °^ ^' ^ o r h y b r i d i z a t i o n c o n d i t i o n s a n d S I n u c l e a s e t r e a t m e n t , s e e M a t e r i a l s a n d M e t h o d s . T h e s i z e s t a n d a r d was pBR.322 c u t w i t h H p a l l a n d l a b e l l e d b y K l e n o w f i l l - i n . T h e s i z e s o f s t a n d a r d b a n d s a r e l i s t e d i n t h e l e g e n d t o F i g u r e 1 8 . O p e n a r r o w s i n d i c a t e t h e l a r g e s t s t a n d a r d f r a g m e n t w h i c h i s 6 22 b p . B l a c k a r r o w s i n d i c a t e t h e p r o t e c t e d s p e c i e s d i s c u s s e d i n t h e t e x t ; t h e i r s i z e s i n b a s e s a r e i n d i c a t e d . 86. F I G U R E 19 C. 3 Hpn 510 bp P r M M P 100 5 0 1 0 0 Std. 338 245 *• 3 HpD 510 bp r M H MS 1 0 0 1 0 0 1 0 0 1 0 0 S t d 338 _ l 245 3 Hpn 510 bp P r M S MB 50 5 0 50 50 Std. 338 *" 245 8 7 . F I G U R E 20 A u t o r a d i o g r a m s o f S I m a p p i n g i n o r d e r t o d e t e r m i n e t h e 5 '  t e r m i n i o f t h e p n p t r a n s c r i p t s . T h e 5 ' k i n a s e l a b e l l e d DNA p r o b e s a n d t h e i r MWs a r e i n d i c a t e d a b o v e e a c h s e c t i o n o f t h e f i g u r e . H p I I , H p a l l ; P B , P s t I B a m H I . T h e RNAs u s e d f o r h y b r i d i z a t i o n a r e i n d i c a t e d a b o v e e a c h l a n e . P , DNA p r o b e a l o n e , n o S I ; r , r R N A c o n t r o l ; M , MC1000 RNA; S , p S H 1 2 2 RNA ; M B , p M B l RNA ( F i g u r e 1 9 ) . T h e n u m b e r s b e l o w t h e RNA d e s i g n a t i o n s r e f e r t o t h e a m o u n t o f RNA u s e d ( p l ) . A l l RNA s t o c k s o l u t i o n s h a d a n A>60 o f 2 . T h e DNA p r o b e s w e r e l a b e l l e d b y k i n a s e e x c h a n g e r e a c t i o n s . F i g u r e ( d ) i s a l o n g e r e x p o s u r e o f ( c ) . F o r d e t a i l s o f h y b r i z i a t i o n c o n d i t i o n s a n d S I n u c l e a s e t r e a t m e n t , s e e M a t e r i a l s a n d M e t h o d s . T h e s i z e s t a n d a r d i s p B R 3 2 2 d i g e s t e d w i t h H p a l l a n d l a b e l l e d b y K l e n o w f i l l - i n . T h e s i z e s o f s t a n d a r d b a n d s a r e l i s t e d i n t h e l e g e n d t o F i g u r e 1 8 . O p e n a r r o w s i n d i c a t e t h e l a r g e s t s t a n d a r d f r a g m e n t w h i c h i s 6 22 b p . B l a c k a r r o w s i n d i c a t e t h e p r o t e c t e d s p e c i e s d i s c u s s e d i n t h e t e x t ; t h e i r s i z e s i n b a s e s a r e i n d i c a t e d . 8 9 . t e r m i n u s m i g r a t e a t 182 b a s e s w i t h t h e H p a l l p r o b e a n d 3 1 0 b a s e s w i t h t h e P s t l - B a m H I p r o b e . T h e i n t e n s i t y o f t h i s s p e c i e s i s e n h a n c e d b y h y b r i d i z a t i o n w i t h RNA f r o m p S H 1 2 2 w h i c h c o n t a i n s t h e e n t i r e r p s O s e q u e n c e . O t h e r m i n o r t e r m i n i map a t 2 0 5 a n d 2 1 5 bp u p s t r e a m o f t h e p u t a t i v e p n p ATG s t a r t . 9 0 . DISCUSSION A . THE I N T A C T GENE FOR P N P A S E HAS BEEN CLONED T h e i n c r e a s e i n P N P a s e p o l y m e r i s a t i o n a c t i v i t y i n e x t r a c t s o f c e l l s c a r r y i n g r e c o m b i n a n t p l a s m i d s p S l 4 a n d p S 1 7 a n d t h e a p p e a r a n c e o f a n 8 4 , 0 0 0 MW p l a s m i d - s p e c i f i e d p r o t e i n t h a t c o - m i g r a t e s w i t h a p u r i f i e d p r e p a r a t i o n o f p o l y n u c l e o t i d e p h o s p h o r y l a s e f r o m E ^ c o l i i n d i c a t e t h a t t h e g e n e f o r P N P a s e o n a l a r g e S a i l f r a g m e n t h a s b e e n c l o n e d . L o s s o f t h e a c t i v i t y i n p o l a r Tn_5_ i n s e r t i o n m u t a n t s i s a c c o m p a n i e d b y l o s s o f t h e 8 4 , 0 0 0 MW p r o t e i n . T h e t e n - f o l d i n c r e a s e i n P N P a s e a c t i v i t y i n s t r a i n s b e a r i n g t h e c l o n e d g e n e a p p e a r s t o h a v e n o a d v e r s e e f f e c t s . T h i s i s n o t s u r p r i s i n g b e c a u s e w i l d t y p e b a c t e r i a a l r e a d y c o n t a i n l a r g e a m o u n t s o f P N P a s e ( G o d e f r o y - C o l b u r n a n d G r u n b e r g - M a n a g o , 1 9 7 2 ) . M u t a n t s o f p n p h a v e b e e n m a p p e d n e a r 6 8 m i n u t e s o n t h e E . c o l i c h r o m o s o m e . T h e c l o n i n g e x p e r i m e n t s r e p o r t e d h e r e a n d t h e w o r k o f o t h e r i n v e s t i g a t o r s ( P o r t i e r , 1 9 8 1 ) , c o n f i r m s t h i s a s t h e l o c a t i o n o f t h e s t r u c t u r a l g e n e f o r P N P a s e . T r a n s d u c t i o n d a t a o b t a i n e d f o r t h e p a r e n t s t r a i n S C 1 0 1 i n d i c a t e d t h a t t h e s i t e o f T n 5 i n s e r t i o n i n t h e b a c t e r i a l c h r o m o s o m e w a s a b o u t 15 K b r e m o v e d f r o m t h e p n p g e n e . T h e r e a r e n o S a i l s i t e s w i t h i n t h i s 15 K b i n t e r v e n i n g r e g i o n a n d t w o d i f f e r e n t S a i l c l o n e s o f t h e p n p g e n e , p S 1 4 a n d p S l 7 , w e r e o b t a i n e d . B o t h c l o n e s e x h i b i t i d e n t i c a l r e s t r i c t i o n maps i n t h e r e g i o n o f t h e p n p g e n e . T h e y d i f f e r o n l y b y a d e l e t i o n o f a b o u t 8 K b o f DNA f r o m t h e p S 1 4 ( F i g u r e 2 ) . A s u b c l o n e ( p H E l ) o f a 4 . 8 K b H i n d i I I - E c o R I f r a g m e n t p r e s e n t o n b o t h p S l 4 a n d pS17 r e t a i n e d t h e p n p g e n e . I n s e r t i o n s o f Tn_5 i n t o t h e 4 . 8 K b H i n d l l l - E c o R I p l a s m i d f r a g m e n t w e r e m a p p e d u s i n g r e s t r i c t i o n e n z y m e s a n d a s s a y e d f o r t h e i r a b i l i t y t o e l e v a t e 9 1 . t h e l e v e l o f P N P a s e a c t i v i t y i n t h e h o s t s t r a i n . T h e p e p t i d e s e n c o d e d b y t h e p l a s m i d s c a r r y i n g i n s e r t i o n m u t a t i o n s w h i c h a b o l i s h e d P N P a s e a c t i v i t y w e r e c h a r a c t e r i z e d b y SDS p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . T h i s p e r m i t t e d t h e p r e c i s e l o c a t i o n a n d i d e n t i f i c a t i o n o f t h e o r i e n t a t i o n o f t h e p n p g e n e . R e s u l t s f r o m Tn_5 i n s e r t i o n s w h i c h f l a n k e d t h e p n p g e n e a n d d i d n o t r e d u c e P N P a s e a c t i v i t y i n d i c a t e d t h a t t h e t r a n s c r i p t i o n a l c o n t r o l r e g i o n o f t h e g e n e o n p H E l wa s i n t a c t . T h e i n s e r t i o n i n p S C 3 7 t h a t o c c u r s a b o u t 3 5 0 b p 5 ' o f t h e t r a n s l a t i o n s t a r t s i t e w e l l w i t h i n t h e c l o n e d DNA d o e s n o t d i s r u p t t h e a c t i v i t y o f t h e g e n e ( T a b l e 4 ) . P l a s m i d p H E l p r o d u c e d b o t h P N P a s e a n d a s m a l l p r o t e i n w i t h a MW < 1 2 , 0 0 0 . T h i s was i n i t i a l l y b e l i e v e d t o b e t h e S 1 5 r i b o s o m a l p r o t e i n e n c o d e d b y r p s O w h i c h wa s s u b s e q u e n t l y c o n f i r m e d b y DNA s e q u e n c i n g a n a l y s i s . B . N A T I V E STRUCTURE OF PNPASE T h e r e h a s b e e n c o n t r o v e r s y a b o u t t h e s u b u n i t c o m p o s i t i o n o f P N P a s e ( P o r t i e r e t a l . , 1 9 7 3 ) . T h e p r e s e n t w o r k s u p p o r t s t h e i d e a t h a t t h e p o l y m e r i s a t i o n a c t i v i t y r e s i d e s i n o n e c h a i n , a s i t i s u n l i k e l y t h a t a n o t h e r p e p t i d e s u b u n i t w o u l d b e p r e s e n t i n s u f f i c i e n t e x c e s s t o c o m p l e m e n t t h e i n c r e a s e i n p r o d u c t i o n o f l a r g e c h a i n s f r o m t h e m u l t i c o p y p l a s m i d . T h e a c t i v i t y o f P N P a s e i s i n s e n s i t i v e t o i n i t i a l p r o t e a s e c l e a v a g e . A c t i v i t y c a n b e d e t e c t e d i n a p r o g r e s s i o n o f p r o t e o l y z e d s p e c i e s f r o m t h e i n t a c t s u b u n i t t o a f r a g m e n t h a v i n g a MW o f 6 8 , 0 0 0 . F u r t h e r d e g r a d a t i o n r e s u l t s i n l o s s o f e n z y m a t i c a c t i v i t y ( P o r t i e r e t a l . , 1 9 7 3 ) . T h i s e a r l y r e s u l t i s c o n s i s t e n t w i t h t h e o b s e r v a t i o n h e r e t h a t t h e Tn_5_ i n s e r t i o n i n p S C 3 3 p r o d u c e s a t r u n c a t e d p e p t i d e o f 7 0 , 0 0 0 MW a n d r e t a i n s p o l y m e r i s a t i o n a c t i v i t y , w h e r e a s s m a l l e r p o l y p e p t i d e f r a g m e n t s a r e d e v o i d o f e n z y m a t i c 9 2 . a c t i v i t y . C . COMPARISON OF THE G E N E T I C MAP TO THE P H Y S I C A L MAP T h e c l o n i n g a n d c h a r a c t e r i z a t i o n o f g e n e s f r o m t h e 6 8 . 5 - 6 8 . 0 m i n u t e r e g i o n o f t h e c h r o m o s o m e a l l o w s c o m p a r i s o n b e t w e e n t h e g e n e t i c a n d p h y s i c a l m a p . T h e p h y s i c a l map i s r e l a t i v e l y e x p a n d e d , i n c l u d i n g t h e i n f B g e n e ( c o m p a r e F i g u r e s 1 a n d 2 ) . T h e g e n e t i c m a p p i n g o f t h e T n 5 i n s e r t i o n s i n t h e S C 1 0 1 a n d S C 1 0 2 s t r a i n s a n d e a r l i e r g e n e t i c m a p p i n g d a t a ( B a c h m a n n a n d L o w , 1 9 8 0 ) i n d i c a t e d t h a t p S 1 7 c o n t a i n e d a r g G , n u s A , r p s O , p n p a n d m t r . A c o m p a r i s o n o f t h e r e s t r i c t i o n map o f p S l 7 a n d t h e r e s t r i c t i o n maps o f c l o n e s o b t a i n e d b y o t h e r i n v e s t i g a t o r s i n d i c a t e s t h a t t h e g e n e s a r g G , n u s A , r p s O a n d p n p a r e p r e s e n t , a n d i t i s l i k e l y t h a t m t r i s a l s o p r e s e n t ( F i g u r e 1 ) . T h e d e l e t i o n i n p l a s m i d p S 1 4 c o v e r s t h e a r g G a n d n u s A g e n e s a s h a d b e e n i n f e r r e d f r o m t h e r e s t r i c t i o n m a p p i n g l e a v i n g i n f B , r p s O , p n p a n d m t r . P l a s m i d p S 1 4 h a d h i g h e r l e v e l s o f P N P a s e a c t i v i t y t h a n p S 1 7 . T h i s m a y b e a r e s u l t o f e i t h e r a n i n c r e a s e i n p l a s m i d c o p y n u m b e r o r t h e d e l e t i o n o f g e n e s w h i c h a f f e c t P N P a s e e x p r e s s i o n . D . T R A N S C R I P T I O N A L / T R A N S L A T I O N A L I M P L I C A T I O N S OF l a c Z F U S I O N S 1 . I n d e p e n d e n t R e g u l a t i o n o f r p s O a n d p_np_  A c t i v i t i e s o f 3 - g a l a c t o s i d a s e i n s t r a i n s c a r r y i n g p n p - l a c Z f u s i o n p l a s m i d s p S H 1 2 2 a n d p M B l s u g g e s t e d t h e e x i s t e n c e o f s e p a r a t e t r a n s c r i p t i o n H p a l f r a g m e n t ( i n c l u d i n g t h e i n t a c t r p s O g e n e ) o f p H E l ( F i g u r e 9 ) w h e r e a s p M B l c o n t a i n s t h e d i s t a l p o r t i o n o f t h i s f r a g m e n t o r i g i n a t i n g f r o m t h e P s t I s i t e w i t h i n r p s O . T h e a c t i v i t y o f p S H 1 2 2 w a s a b o u t t w o - f o l d h i g h e r t h a n f o r p M B l ; t h e r e i s n o o b v i o u s e x p l a n a t i o n o f t h i s d i f f e r e n c e i n a c t i v i t y i n i t i a t i o n s i g n a l s f o r r p s O a n d p n p . P l a s m i d p S H 1 2 2 c o n t a i n s t h e 8 5 0 b p 9 3 . b e t w e e n t h e t w o f u s i o n c l o n e s s i n c e v i r t u a l l y a l l o f t h e p n p t r a n s c r i p t s o r i g i n a t e f r o m t h e m a j o r p r o m o t e r l o c a t e d i n t h e r p s Q - p n p i n t e r g e n i c r e g i o n . T h e m a j o r S 1 5 p r o m o t e r i s l o c a t e d a b o u t 1 0 0 n u c l e o t i d e s u p s t r e a m f r o m t h e t r a n s l a t i o n s t a r t s i g n a l ( a b o u t n u c l e o t i d e 4 5 i n F i g u r e 1 2 ) . T h e r e i s a h i g h l e v e l o f t r a n s c r i p t i o n i n i t i a t i o n a t t h i s p r o m o t e r w h i c h r e a d s i n t o t h e r p s O - l a c Z g e n e f u s i o n i n pMS31 ( F i g u r e 1 8 ) . T h e a m o u n t o f t h i s r p s O - l a c Z f u s i o n t r a n s c r i p t i s a t l e a s t a s g r e a t a s t h e a m o u n t o f r p s O t r a n s c r i p t i n p S H 1 2 2 o r p H E l ( F i g u r e 1 8 ) . T h e 3 - g a l a c t o s i d a s e a c t i v i t y o f t h e r p s O - l a c Z f u s i o n pMS31 w a s u n e x p e c t e d l y v e r y l o w . R e s t r i c t i o n a n a l y s i s o f pMS31 i n d i c a t e d t h a t t h e S m a l s i t e i s r e t a i n e d i n t h e f u s i o n . F u r t h e r r e s t r i c t i o n a n a l y s i s wa s c o n s i s t e n t w i t h t h e s t r u c t u r e e x p e c t e d f o r t h e i n - f r a m e f u s i o n o f r p s O - l a c Z ( F i g u r e 15 a n d F i g u r e 1 6 ) . T h e c l o n e d f r a g m e n t o f p M S 3 1 , w a s r e c l o n e d i n t o M13 v e c t o r s a n d f o u n d t o h y b r i d i z e t o a s e q u e n c e d c l o n e w h i c h c o n t a i n e d t h e p r o x i m a l H p a l ^ - P s t l - ^ p o r t i o n o f t h e 8 5 0 b p H p a l f r a g m e n t i n t h e o p p o s i t e o r i e n t a t i o n . T h e l o w l e v e l o f B - g a l a c t o s i d a s e a c t i v i t y o f pMS31 c a n n o t be e a s i l y e x p l a i n e d . T h e p o s s i b i l i t y r e m a i n s t h a t a f r a m e s h i f t o c c u r r e d d u r i n g t h e c o n s t r u c t i o n o f pMS31 s u c h t h a t t h e f u s i o n i s n o l o n g e r i n f r a m e . T h e DNA s e q u e n c e o f t h e f u s i o n j u n c t i o n w i l l h a v e t o b e d e t e r m i n e d . A l t e r n a t i v e l y , t h e l o w e n z y m e l e v e l may i n d i c a t e t h a t t h e f u s i o n p r o t e i n i s o n l y p a r t i a l l y a c t i v e a s 3 - g a l a c t o s i d a s e , o r i s h i g h l y u n s t a b l e . F i n a l l y , t h e l o w a c t i v i t y may b e d u e t o a t r a n s l a t i o n a l i n h i b i t i o n o f t h e p l a s m i d e n c o d e d f u s i o n mRNA b y f r e e S 1 5 o r b y t h e f u s i o n p r o t e i n . I n a n y e v e n t , t h e S I m a p p i n g e x p e r i m e n t s c l e a r l y i n d i c a t e t h a t t h e f u s i o n g e n e i s a c t i v e l y t r a n s c r i b e d o n p l a s m i d p M S 3 1 . T h e S 1 5 p r o t e i n i s a c o r e p r o t e i n a n d b i n d s d i r e c t l y t o 16S r R N A i n 9 4 . t h e r e g i o n b e t w e e n n u c l e o t i d e s 5 5 0 t o 6 8 5 ( Z i m m e r m a n e t a l . , 1 9 7 2 ) . L i k e o t h e r c o r e p r o t e i n s i t may a l s o b i n d t o i t s own mRNA a n d r e g u l a t e t r a n s l a t i o n . A 2 0 - f o l d i n c r e a s e i n c o p y n u m b e r o f r p s O r e s u l t s i n l e s s t h a n 2 - f o l d , i n c r e a s e i n t h e s y n t h e s i s r a t e o f S15 p r o t e i n ( T a k a t a e t a l . , 1 9 8 2 ) . T h e l o w l e v e l o f e x p r e s s i o n i n pMS31 s u g g e s t s t h a t t h e p l a s m i d c o p y o f r p s O may b e p r e f e r e n t i a l l y r e p r e s s e d o v e r t h e c h r o m o s o m a l c o p y . T h i s c i s e f f e c t h a s b e e n s e e n f o r o t h e r r i b o s o m a l p r o t e i n g e n e s ( F a l l o n e t a l . , 1 9 7 9 ) . Some r i b o s o m a l p r o t e i n s c a n a l s o a u t o g e n o u s l y r e p r e s s s y n t h e s i s a t t h e t r a n s c r i p t i o n a l l e v e l . A n e x c e s s o f p r o t e i n L 4 b i n d s t o t h e l e a d e r r e g i o n o f t h e S 1 0 o p e r o n mRNA a n d c a u s e s a t t e n u a t i o n j u s t b e f o r e t h e r i b o s o m e b i n d i n g s i t e o f r p s J , t h e f i r s t g e n e i n t h e o p e r o n . T h i s a t t e n t u a t i o n i s i n a d d i t i o n t o t h e t r a n s l a t i o n a l i n h i b i t i o n e x e r t e d o n f u l l - l e n g t h S 1 0 o p e r o n mRNA b y L 4 b i n d i n g t o t h e same l e a d e r s e q u e n c e s ( L i n d a h l e t a l . , 1 9 8 3 ) . I f t r a n s l a t i o n a l r e p r e s s i o n i s o c c u r r i n g i n t h e r p s O - l a c Z f u s i o n , t h e n t h e s i t e o f r e p r e s s i o n i s l i k e l y t o b e w i t h i n t h e H p a l ^ - P s t l ^ f r a g m e n t i n p M S 3 1 . B y a n a l o g y w i t h r e g u l a t o r y r e g i o n s o f o t h e r c o r e r i b o s o m a l p r o t e i n s ( N o m u r a e t a l . , 1 9 8 0 ) , t h e r e may b e some h o m o l o g y b e t w e e n t h e mRNA s e q u e n c e s r e c o g n i z e d b y t h e S 1 5 p r o t e i n a n d t h e c e n t r a l n u c l e a t i o n s i t e I I s e q u e n c e s o f t h e 1 6 S r R N A , w h e r e S 1 5 i s k n o w n t o b i n d ( Z i m m e r m a n , 1 9 7 4 ) . Some p r i m a r y s t r u c t u r a l h o m o l o g y c a n b e o b s e r v e d f r o m t h e DNA s e q u e n c e b e t w e e n t h e r e g i o n o f 16S r R N A k n o w n t o b i n d S 1 5 , a n d t h e mRNA a r o u n d t h e s t a r t o f t h e S 1 5 c o d i n g r e g i o n ( F i g u r e 2 1 ) . S i m i l a r l y p l a c e d h o m o l o g i e s t o 2 3 S r R N A a n d 16S r R N A , a t t h e r e g i o n s o f t h e s t a r t c o d o n , t h e S h i n e a n d D a l g a r n o s e q u e n c e , a n d a s l i g h t l y l o n g e r h o m o l o g y u p s t r e a m o f t h e s e s i t e s h a v e b e e n o b s e r v e d f o r o t h e r e f f e c t o r r i b o s o m a l p r o t e i n b i n d i n g s i t e s o n 9 5 . F I G U R E 2 1 N u c l e o t i d e s e q u e n c e h o m o l o g y o f 16S r R N A a n d rp_sp  mRNA. T h e u p p e r l i n e i s 1 6 S r R N A s e q u e n c e ( B r o s i u s e t a l . , 1 9 7 8 ) , w i t h r p s O mRNA b e n e a t h . T h e s e q u e n c e s w e r e a l i g n e d a t t h e S h i n e a n d D a l g a r n o s e q u e n c e o f t h e mRNA, w h i c h i s i n d i c a t e d b y d o t s . A n o t h e r t r a n s l a t i o n a l r e c o g n i t i o n s i g n a l , t h e AUG s t a r t c o d o n o f r p s O i s a l s o s h o w n b y d o t s . H o m o l o g i e s a r e i n d i c a t e d b y u n d e r l i n e d b o l d f a c e l e t t e r s . T h e n u c l e o t i d e s o f 16S r R N A w h i c h h a v e b e e n s h o w n t o b i n d S15 a r e w i t h i n c e n t r a l n u c l e a t i o n s i t e I I f r o m n u c l e o t i d e 5 5 0 t o 6 8 5 ( Z i m m e r m a n n e t a l . , 1 9 7 2 ) . T h e s e q u e n c e s h o w n h e r e i s f r o m n u c l e o t i d e 5 4 9 t o 7 0 0 a s i n d i c a t e d i n t h e f i g u r e . T h e mRNA s h o w n h e r e e x t e n d s f r o m n u c l e o t i d e 42 t o 1 9 4 , a s n u m b e r e d i n F i g u r e 1 2 . A s e c o n d a r y s t r u c t u r e f o r t h e s e 1 6 S r R N A s e q u e n c e s h a s b e e n p u b l i s h e d ( W o e s e e t a l . , 1 9 7 5 ) . T h e r p s O mRNA may a d o p t a s i m i l a r s t r u c t u r e w h i c h w o u l d b e r e c o g n i z e d b y p r o t e i n S 1 5 . FIGURE 21 96. c O O —• c o n O o o o c c c c > > > a CD c o c o c > > CD c > n c o > > o n > > o > CD n c > > > > c n O c c c n c O > o > o n c c O c n c o o c > O > o o o o o CD •C > CD > > c c n O > CD O c O c > O n O O c O > > > c O o o CD > c n O n c O > > c c > o > o > c o CD CD O O c o o c c c n > c c o c > "c > c > o c c c CD CD O > > > c o o > > J> c n n o o O o o o c o > > o o c o o o > > o c o o > c o c o > c > o c CD CD o > Ix c c r> > O > n c c n c O > O > > n > O c c c n > o n n c o O c o > o > o > CD c c c > <D > c > c o c n > O > O o > > n o O c n c > c 0 o o n o CD CD c O > c > c n c O O c c > c > > > n O c c t h e i r mRNAs ( N o m u r a e t a l . , 1 9 8 0 ; O l i n s a n d N o m u r a , 1 9 8 1 ) . C o m p a r i s o n o f p o s s i b l e s e c o n d a r y s t r u c t u r e s f o r t h e s e r e g i o n s o f r R N A a n d mRNA h a v e r e v e a l e d s t r i k i n g s t r u c t u r a l s i m i l a r i t y ( O l i n s a n d N o m u r a , 1 9 8 1 ) . T h e s e c o n d a r y s t r u c t u r e o f t h e 16S r R N A w h e r e i t b i n d s S15 p r o t e i n i s k n o w n ( W o e s e e t a l . , 1 9 8 0 ) . A s y e t , a s i m i l a r s e c o n d a r y s t r u c t u r e i n t h e S 1 5 mRNA h a s n o t b e e n r e c o g n i z e d . B i n d i n g o f c o r e r e g u l a t o r y r i b o s o m a l p r o t e i n s t o t h e i r own o p e r o n mRNA may p r e v e n t t r a n s l a t i o n o f c i s t r o n s d o w n s t r e a m o f t h e b i n d i n g s i t e w i t h i n a n o p e r o n ( Y a t e s a n d N o m u r a , 1 9 8 0 ) . A s r p s O a n d p n p a p p e a r t o h a v e s e p a r a t e t r a n s c r i p t s , t r a n s l a t i o n a l r e p r e s s i o n o f S15 w o u l d n o t b e e x p e c t e d t o a f f e c t t h e t r a n s l a t i o n o f P N P a s e . T h e h i g h l e v e l o f 3 - g a l a c t o s i d a s e a c t i v i t y i n t h e p n p - l a c Z f u s i o n p l a s m i d p S H 1 2 2 w h i c h c o n t a i n s r p s O i s c o n g r u e n t w i t h t h i s c o n c e p t . E . T R A N S C R I P T I O N A L E X P R E S S I O N OF r p s O AND p n p A c o m p i l a t i o n o f 1 6 8 p r o m o t e r r e g i o n s o f E_. c o l i r e s u l t e d i n t h e d e t e r m i n a t i o n o f c o n s e n s u s - 3 5 a n d - 1 0 p r o m o t e r s e q u e n c e s o f t c T T G A C a a n d t gnTA tAaT_ , ( c a p i t a l l e t t e r s d e n o t e t h e m o s t h i g h l y c o n s e r v e d n u c l e o t i d e s ; H a w l e y a n d M c C l u r e , 1 9 8 3 ) . T h e s p a c i n g b e t w e e n t h e s e t w o c o n s e n s u s s e q u e n c e s i s 15 t o 20 b a s e p a i r s , w i t h 1 7 + 1 b a s e p a i r s b e i n g o p t i m a l . T h e o p t i m a l s p a c i n g b e t w e e n t h e - 1 0 r e g i o n a n d t r a n s c r i p t i o n s t a r t s i t e v a r i e s f r o m 4 - 8 b a s e p a i r s b u t i s u s u a l l y 6 o r 7 b a s e p a i r s . T h e " i n v a r i a n t T_", t h e f i n a l T_ o f t h e - 1 0 r e g i o n , wa s p r e s e n t i n a l l b u t 4 o f t h e 1 6 8 p r o m o t e r s c o m p i l e d . T h e A a t - 1 2 i s p r e s e n t n e a r l y a s o f t e n . I n i t i a l s t u d i e s t o c h a r a c t e r i z e t r a n s c r i p t s o f t h e r p s O a n d pnp g e n e s h a v e b e e n p e r f o r m e d b y S I m a p p i n g . I n t h e s e t y p e s o f e x p e r i m e n t s t h e 5 ' o r 3* t e r m i n i o f RNA t r a n s c r i p t s c a n b e d e t e r m i n e d w i t h i n a r a n g e o f a b o u t +5 9 8 . n u c l e o t i d e s . T h e g e n e r a l p a t t e r n o f t r a n s c r i p t i o n o f t h e r p s O , p n p r e g i o n o f t h e b a c t e r i a l c h r o m o s o m e i s s u m m a r i z e d i n F i g u r e 1 7 . T h e RNA u s e d i n t h e a n a l y s i s wa s d e r i v e d f r o m t h e p a r e n t a l c o n t r o l s t r a i n M C 1 0 0 0 w h i c h c o n t a i n s o n l y t h e s i n g l e c o p y c h r o m o s o m a l g e n e s a n d v a r i o u s p l a s m i d ' d e r i v a t i v e s o f M C 1 0 0 0 w h i c h c o n t a i n b o t h t h e s i n g l e c o p y c h r o m o s o m a l g e n e s a n d t h e m u l t i c o p y p l a s m i d g e n e s . P l a s m i d p H E l c a r r i e s t h e i n t a c t w i l d t y p e r p s O a n d p n p g e n e s w h e r e a s p l a s m i d s p S H 1 2 2 , p M B l a n d pMS31 c a r r y t h e l a c Z f u s i o n g e n e s . A l l p l a s m i d s t r a i n s g i v e a n e n h a n c e d s i g n a l i n t h e S I m a p p i n g e x p e r i m e n t s b e c a u s e t h e a m p l i f i e d p l a s m i d g e n e s a r e a c t i v e l y t r a n s c r i b e d . I t s h o u l d b e r e m e m b e r e d t h a t i n a l l t h e s e p l a s m i d s t r a i n s t h e h i g h l e v e l o f p l a s m i d - d e r i v e d mRNA p r o d u c e d i s i n a d d i t i o n t o t h e b a s a l l e v e l o f c h r o m o s o m a l mRNA. 1 . A M a j o r P r o m o t e r f o r r g s O A m a j o r t r a n s c r i p t i o n a l s t a r t s i t e o c c u r s a p p r o x i m a t e l y 1 0 0 bp i n f r o n t o f t h e S 1 5 AUG s t a r t c o d o n a t n u c l e o t i d e 4 5 ( F i g u r e 1 2 ) , a s i n d i c a t e d b y a n i n t e n s e b a n d o f 217 n u c l e o t i d e s s e e n b y S I m a p p i n g ( F i g u r e 1 8 ) . A s e c o n d a r y s t a r t s i t e was o b s e r v e d a p p r o x i m a t e l y 5 n u c l e o t i d e s d o w n s t r e a m o f t h i s . T h i s s e c o n d a r y s t a r t may b e r e a l o r may b e d u e t o S I " c h e w i n g " a t t h e e n d o f t h e RNA -DNA h y b r i d . T h e DNA s e q u e n c e p r i o r t o t h i s mRNA s t a r t s i t e c o n t a i n s - 1 0 a n d - 3 5 p r o m o t e r c o n s e n s u s s e q u e n c e s . T h e - 3 5 a n d - 1 0 p r o m o t e r s e q u e n c e s a g r e e f a i r l y w e l l w i t h t h e c o n s e n s u s s e q u e n c e s , w i t h t h e e x c e p t i o n o f t h e " i n v a r i a n t T " , w h i c h a p p e a r s t o b e r e p l a c e d b y a n A a t n u c l e o t i d e 39 ( F i g u r e 1 2 ) . R i b o s o m a l p r o t e i n g e n e s a r e u n d e r s t r i n g e n t c o n t r o l ( D e n n i s a n d N o m u r a , 1 9 7 4 ) . D u r i n g c o n d i t i o n s o f a m i n o a c i d s t a r v a t i o n o f a r e l " 1 " s t r a i n o f _E. c o l i , g u a n i n e n u c l e o t i d e s a r e p r o d u c e d a n d t h e t r a n s c r i p t i o n o f r R N A a n d r i b o s o m a l p r o t e i n g e n e i s r e d u c e d . T h e c o n s e n s u s s e q u e n c e f o r p r o m o t e r s u n d e r s t r i n g e n t c o n t r o l , a t p o s i t i o n s - 5 t o +1 r e l a t i v e t o t h e c c s t a r t s i t e s e q u e n c e i s C CNCC ( T r a v e r s , 1 9 8 0 ) . A s t r i n g e n t c o n t r o l c o n -s e n s u s s e q u e n c e CCGC a l s o o c c u r s b e t w e e n t h e - 1 0 a n d s t a r t s i t e ( F i g u r e 1 2 ) . T h e r e may be a s m a l l a m o u n t o f r e a d t h r o u g h t r a n s c r i p t i o n t o r p s O f r o m a p r o m o t e r u p s t r e a m o f t h e T a q I s i t e w i t h i n t h e 9 0 0 b p B a m H I / T a q l - P s t I p r o b e a s i n d i c a t e d b y t h e p r o t e c t i o n o f t h e f u l l l e n g t h o f t h e p r o b e s e e n i n t h e c a s e o f p H E l RNA . P l a s m i d p H E l i s t h e o n l y o n e w h i c h c o n t a i n s t h e e n t i r e p r o b e s e q u e n c e s . T h i s p r o t e c t i o n i s s e e n t o a l e s s e r e x t e n t f o r t h e M C 1 0 0 0 R N A , a n d f o r t h e M C 1 0 0 0 b a c k g r o u n d s o f t h e o t h e r p l a s m i d s . I n a d d i t i o n , t h e r e s e e m s t o b e a n a d d i t i o n a l 5 ' m i n o r t e r m i n u s f o r r p s O t r a n s c r i p t i o n a p p r o x i m a t e l y 5 0 b p d o w n s t r e a m o f t h e T a q I s i t e , a s e v i d e n c e d b y t h e p r o t e c t i o n o f a b a n d o f a p p r o x i m a t e l y 8 5 0 b a s e s b y e a c h o f t h e e x p e r i m e n t a l R N A s . T h e s i g n i f i c a n c e o f t h e s e m i n o r s t a r t s i t e s r e m a i n s u n c l e a r . U p o n l o n g e r e x p o s u r e o f t h e S I m a p p i n g g e l , s e v e r a l a d d i t i o n a l m i n o r t r a n s c r i p t s w i t h v a r i a b l e 5 ' e n d s b e c a m e a p p a r e n t . A w e a k b a n d o f 1 1 0 n u c l e o t i d e s h a s a 5 ' e n d i m m e d i a t e l y i n f r o n t o f t h e AUG i n i t i a t i o n c o d o n . O t h e r b a n d s c o r r e s p o n d i n g t o t r a n s c r i p t l e n g t h s o f 2 5 0 n u c l e o t i d e s a n d 3 1 5 n u c l e o t i d e s w e r e a l s o a p p a r e n t . T h e s e b a n d s may r e p r e s e n t m i n o r t r a n s c r i p t i o n i n i t i a t i o n s i t e s , a r t i f a c t s o f S I d i g e s t i o n , o r p r o c e s s i n g a n d d e g r a d a t i o n i n t e r m e d i a t e s f r o m l a r g e r t r a n s c r i p t s . 2 . T h e 3 ' T r a n s c r i p t i o n a l T e r m i n i o f r p s O T h e m a j o r 3 ' t e r m i n u s o f r p s O wa s m a p p e d t o a s i t e a p p r o x i m a t e l y 40 b p a f t e r t h e UAA s t o p c o d o n o f S 1 5 ( F i g u r e 1 2 ) , w h e r e a G / C r i c h r e g i o n p r e c e e d s a r u n o f T r e s i d u e s e n d i n g a t n u c l e o t i d e 4 6 0 . T h i s s e q u e n c e c o u l d a d o p t t h e s t r u c t u r e s h o w n i n F i g u r e 2 2 . A s m a l l G / C s t e m l o o p s t r u c t u r e a n d 1 0 0 . s h o r t r u n o f U ' s s u g g e s t s a r e l a t i v e l y u n s t a b l e s e c o n d a r y s t r u c t u r e ; s u c h s t r u c t u r e s a r e c h a r a c t e r i s t i c o f r h o - d e p e n d e n t RNA t e r m i n a t i o n s i t e s ( A d h y a e t a l . , 1 9 7 9 ) . R h o p r o t e i n i s a t r a n s c r i p t i o n a l t e r m i n a t i o n f a c t o r w h i c h i s t h o u g h t t o i n t e r a c t w i t h t h e 3 s u b u n i t o f RNA p o l y m e r a s e ( D a s e t a l . , 1 9 7 8 ) . T h e s e q u e n c e i m m e d i a t e l y u p s t r e a m o f t h i s t e r m i n a t i o n s i t e i s s i m i l a r t o t h e c o n s e n s u s s e q u e n c e f o r r e c o g n i t i o n b y N u s A p r o t e i n ( O l s o n e t a l . , 1 9 8 2 ; F r i e d m a n a n d O l s o n , 1 9 8 3 ) . T h i s c o n s e n s u s " b o x A " r e g i o n i s C G C T C T ( T ) T A A ( o r i t s RNA a n a l o g u e ) a n d i s c l o s e l y f o l l o w e d b y a s h o r t r e g i o n o f G / C d y a d s y m m e t r y s u r r o u n d i n g a t r a n s l a t i o n s t o p s i g n a l ( TGA o r T A A ) . T h e N u s A p r o t e i n h a s b e e n s h o w n t o be i n v o l v e d i n t r a n s c r i p t i o n t e r m i n a t i o n a t t h e E . c o l i t r p t t e r m i n a t o r ( F a r n h a m e t a l . , 1 9 8 2 ) , a n d t h e s e q u e n c e CGCAGTTAA r e s e m b l i n g b o x A i s f o u n d 33 bp u p s t r e a m o f t h e t r p t t e r m i n a t o r . I n t h e c a s e o f t h e r p s O t e r m i n a t o r , t h e s e q u e n c e CGAGTTTCA i s f o u n d 28 b p u p s t r e a m , a n d a TGA c o d o n i s b e t w e e n t h e s h o r t r e g i o n o f G / C d y a d s y m m e t r y ( F i g u r e 2 1 ) . I n t h e c a s e o f t h e t r p t t e r m i n a t o r , N u s A p r o t e i n a c t s t o e n h a n c e t h e e f f i c i e n c y o f t e r m i n a t i o n in_ v i t r o w h i c h c a n b e f u r t h e r i m p r o v e d b y t h e a d d i t i o n o f r h o p r o t e i n ( F a r n h a m e t a l . , 1 9 8 2 ) . A n o t h e r 3 ' t e r m i n u s f o r r p s O t r a n s c r i p t i o n wa s o b s e r v e d a s a f r a g m e n t o f 3 3 8 n u c l e o t i d e s i n l e n g t h ( F i g u r e 1 9 ) w i t h a t e r m i n u s a t n u c l e o t i d e 5 5 3 . T h e r e i s n o i d e n t i f i a b l e t e r m i n a t o r s e q u e n c e i n t h i s r e g i o n . F o r t h e s e c o n d a r y t f p t e r m i n a t o r , t ' , a p p r o x i m a t e l y 2 5 0 bp d i s t a l t o t r p t , w h i c h h a s b e e n s h o w n t o a c t a s a s t r o n g r h o - d e p e n d e n t t e r m i n a t o r i n v i t r o , n o c h a r a c t e r i s t i c t e r m i n a t o r s t r u c t u r e i s o b s e r v e d . O b s e r v a t i o n s o n t h e d i f f e r i n g i n t e r a c t i o n o f t r p t a n d t r p t ' t e r m i n a t o r s i n v i t r o a n d i n v i v o h a v e l e f t a n o p e n q u e s t i o n a s t o w h e t h e r t r p t ' i s a t e r m i n a t i o n s i t e o r a n RNA p r o c e s s i n g s i t e ( P i a t t , 1 9 8 1 ) . T h e s e c o n d 3 ' t e r m i n u s o f t h e r p s O t r a n s c r i p t i s s i t u a t e d w i t h i n a r e g i o n o f i m p e r f e c t d y a d s y m m e t r y b e t w e e n 1 0 1 . F I G U R E 22 H y p o t h e t i c a l s t e m l o o p s t r u c t u r e f o r t h e m a j o r t e r m i n a t o r  o f X B s O , w i t h p o s s i b l e N u s A r e c o g n i t i o n s i g n a l s . N u c l e o t i d e n u m b e r s a r e f r o m F i g u r e 1 2 . T h e o v e r l i n e d UAA s t o p c o d o n i s t h a t o f t h e S 1 5 g e n e . T h e s u b s e q u e n t r u n o f T ' s i n t h e DNA s e q u e n c e c o i n c i d e s w i t h a t r a n s c r i p t i o n a l e n d p o i n t a s d e t e r m i n e d b y S I m a p p i n g . T h e h y p o t h e t i c a l s t e m l o o p s t r u c t u r e s h o w n h e r e c o u l d b e a r h o - d e p e n d e n t t e r m i n a t o r s e q u e n c e ( A d h y a e t a l . , 1 9 7 9 ) . A p o s s i b l e b o x A r e c o g n i t i o n s e q u e n c e f o r N u s A p r o t e i n ( O l s o n e t a l . , 1 9 8 2 ) o c c u r s 6 n u c l e o t i d e s a f t e r t h e U A A . B e n e a t h i t a r e t h e b o x A n u c l e o t i d e s o f t h e t r p t t e r m i n a t o r . H o m o l o g i e s b e t w e e n t h e t w o a r e i n d i c a t e d b y d o t s . T h e UGA c o d o n o v e r l i n e d w i t h i n t h e l o o p i s a l s o t h o u g h t t o be p a r t o f t h e r e c o g n i t i o n s i g n a l f o r N u s A p r o t e i n ( F r i e d m a n a n d O l s o n , 1 9 8 3 ) . FIGUF.E 22 102. A G G U U C - G C - G U A A U U C U U G C G A G U U U C A G A A A A G G G G - C U U U U U U 4 4 5 7 C G C A G U U A A 1 0 3 . n u c l e o t i d e s 5 2 7 - 5 9 2 ( F i g u r e 1 2 ) . I f t r a n s c r i b e d , t h i s s e q u e n c e c o u l d f o r m a s t e m l o o p s t r u c t u r e w h i c h i s c h a r a c t e r i s t i c o f k n o w n RNA p r o c e s s i n g s i t e s ( G e g e n h e i m e r a n d A p i r i o n , 1 9 8 1 ) . I f t h i s i s a p r o c e s s i n g s i t e , t h e n t r a n s c r i p t i o n i n i t i a t e d u p s t r e a m o f t h e r p s O g e n e may r e a d t h r o u g h i n t o p n p . 3 . A M a j o r P r o m o t e r f o r p n p T h e m a j o r a n d b y f a r t h e m o s t p r o m i n e n t 5 ' t e r m i n u s f o r p n p w a s m a p p e d b y m e a n s o f t w o d i f f e r e n t DNA p r o b e s t o a s i t e a p p r o x i m a t e l y 1 4 0 bp u p s t r e a m o f t h e p o s t u l a t e d A T G s t a r t s i g n a l a t n u c l e o t i d e 5 8 0 ( F i g u r e 1 2 ) . T h i s r e g i o n i s p r e c e d e d b y - 1 0 a n d - 3 5 p r o m o t e r c o n s e n s u s s i g n a l s a n d i s l o c a t e d w i t h i n a r e g i o n o f p o s s i b l e s e c o n d a r y s t r u c t u r e , w i t h p o s s i b l e i m p e r f e c t s y m m e t r y b e t w e e n n u c l e o t i d e s 5 2 7 - 5 9 2 ( F i g u r e 1 2 ) . T h e - 3 5 a n d - 1 0 s e q u e n c e s p r e c e d i n g t h e m a j o r 5 ' t e r m i n i o f t h e p n p t r a n s c r i p t a r e v e r y p o o r p r o m o t e r c o n s e n s u s s e q u e n c e s . T h e s p a c i n g s b e t w e e n t h e t r a n s c r i p t i o n s t a r t s i t e a n d t h e - 1 0 s e q u e n c e , a n d b e t w e e n t h e - 1 0 a n d - 3 5 s e q u e n c e s a r e l o n g e r t h a n i s u s u a l . T h e - 1 0 s e q u e n c e b e a r s l i t t l e r e s e m b l a n c e t o t h e c o n s e n s u s s e q u e n c e ( F i g u r e 1 2 ) . Why t h i s s h o u l d b e t h e c a s e i s n o t c l e a r . A f t e r l o n g e r e x p o s u r e o f t h e a u t o r a d i o g r a m , a d d i t i o n a l 5 ' t e r m i n i f o r t h e p n p g e n e w e r e o b s e r v e d i n M C 1 0 0 0 RNA a n d p M B l RNA m a p p i n g t o n u c l e o t i d e s 5 0 5 a n d 5 1 5 ( F i g u r e 1 2 ) . T h e r e a r e t w o d i s t i n c t - 1 0 a n d - 3 5 p r o m o t e r c o n s e n s u s s e q u e n c e s i n t h i s r e g i o n ( F i g u r e 1 2 ) a n d i t i s p o s s i b l e t h a t t h e s e a r e r e s p o n s i b l e f o r t h e s m a l l a m o u n t s o f t r a n s c r i p t s e e n . A n o t h e r w e a k p r o m o t e r c a n d i d a t e i s i n d i c a t e d b y a p r o t e c t e d s p e c i e s o f 1 6 5 b p s e e n b e s t w i t h p S H 1 2 2 RNA ( F i g u r e 2 0 d ) , w h i c h p l a c e s a 5 ' t e r m i n u s a p p r o x i m a t e l y 3 0 n u c l e o t i d e s u p s t r e a m o f t h e p o s t u l a t e d ATG s t a r t o f p n p a t n u c l e o t i d e 6 9 3 ( F i g u r e 1 2 ) . A g a i n , t h i s r e g i o n i s p r e c e d e d b y - 1 0 a n d - 3 5 p r o m o t e r s e q u e n c e s . 1 0 4 . T h e t r a n s c r i p t i o n a l s p e c i e s d e s c r i b e d i n t h e s e s t u d i e s r e f l e c t t h o s e s p e c i e s p r e s e n t i n a s t e a d y s t a t e u n d e r t h e g r o w t h c o n d i t i o n s u s e d w h e n i s o l a t i n g t h e RNA . S t r a i n s w e r e g r o w n a t 3 7 ° C w i t h g o o d a e r a t i o n i n m i n i m a l m e d i a a n d c a s a m i n o a c i d s p l u s t r y p t o p h a n . T h e v a r i e t y o f t r a n s c r i p t i o n a l t e r m i n i r e f l e c t many p o s s i b i l i t i e s f o r c o n t r o l a n d s u g g e s t t h a t p e r h a p s u n d e r d i f f e r e n t g r o w t h c o n d i t i o n s a d i f f e r e n t t r a n s c r i p t i o n a l p a t t e r n m i g h t b e o b s e r v e d , w h e t h e r q u a l i t a t i v e l y o r q u a n t i t a t i v e l y . I n s u m m a r y , t h e r e a p p e a r s t o b e o n e s t r o n g p r o m o t e r f o r r p s O w i t h i n t h e H p a l ^ - H p a l ^ ( F i g u r e 9 ) s e q u e n c e w h i c h i s a l m o s t c e r t a i n l y u n d e r s t r i n g e n t c o n t r o l . T h e r e a l s o a p p e a r s t o b e m i n o r p r o m o t e r a c t i v i t y f r o m a r e g i o n 6 0 0 b p o r m o r e u p s t r e a m ; i t i s n o t k n o w n w h e t h e r a n y g e n e s e x i s t i n t h i s r e g i o n ( b e t w e e n i n f B a n d r p s O ; F i g u r e 1 ) . S t u d y o f t h e r e g u l a t i o n o f t h e g e n e s i n t h i s r e g i o n o f t h e c h r o m o s o m e h a s j u s t b e g u n . T h e DNA s e q u e n c e h a s b e e n o b t a i n e d f o r m e t Y , t h e i n i t i a l p a r t o f t h e n u s A g e n e ( I s h i i e t a l . , 1 9 8 4 ) , 5 ' a n d c o d i n g s e q u e n c e s o f r p s O ( P o r t i e r , 1 9 8 2 a n d t h i s w o r k ) , a n d t h e i n i t i a l p a r t o f p n p ( t h i s w o r k ) . T h e d i r e c t i o n o f t r a n s c r i p t i o n f o r m e t Y , n u s A , i n f B , r p s O a n d p n p i s a n t i c l o c k w i s e o n t h e g e n e t i c map ( P o r t i e r , 1 9 8 2 ; P l u m b r i d g e a n d S p r i n g e r , 1 9 8 3 ; I s h i i e t a l . , 1 9 8 4 ; C r o f t o n a n d D e n n i s , 1 9 8 4 ) . T h e g e n e s f o r m e t Y , a n u n i d e n t i f i e d 1 5 K p r o t e i n , a n d n u s A a p p e a r t o b e i n a common t r a n s c r i p t i o n a l u n i t ( I s h i i , 1 9 8 4 ) . D e s p i t e e v i d e n c e f o r a w e a k i n d e p e n d e n t p r o m o t e r a c t i v i t y f o r i n f B , r e a d - t h r o u g h o f t h e n u s A g e n e i n t o i n f B s e e m s t o o c c u r o n a p l a s m i d b e a r i n g b o t h g e n e s ( P l u m b r i d g e a n d S p r i n g e r , 1 9 8 3 ) . T h i s p r o m o t e r a c t i v i t y c o u l d o r i g i n a t e f r o m t h e p l a s m i d o r w i t h i n t h e c l o n e d f r a g m e n t , t h a t i s , f r o m a n u s A p r o m o t e r . 1 0 5 . I t i s o f i n t e r e s t t o n o t e t h a t u p s t r e a m o f t h e n u s A g e n e j u s t p r e c e d i n g t h e 1 5 K p r o t e i n g e n e ( F i g u r e 1 ) a r e t w o p o s s i b l e t r a n s c r i p t i o n t e r m i n a t o r s e q u e n c e s w h i c h may i n t e r a c t w i t h n u s A t o e f f e c t a u t o g e n o u s r e g u l a t i o n o f i t s t r a n s c r i p t i o n ( I s h i i e t a l . , 1 9 8 4 ) . E a c h o f t h e d y a d s y m m e t r i e s o f t h e s e s e q u e n c e s b r a c k e t s a s t o p c o d o n ( T A A a n d T A G ) , a n d 33 b p u p s t r e a m o f t h e f i r s t t e r m i n a t o r i s t h e s e q u e n c e CAGTTA , h o m o l o g o u s t o t h e b o x A o f t r p t . A N u s A i n v o l v e m e n t i n t e r m i n a t i o n o f r p s O t r a n s c r i p t s o p e n s t h e p o s s i b i l i t y t h a t u n d e r some c o n d i t i o n s ( a n t i t e r m i n a t i o n ) t h e r p s O p r o m o t e r may d r i v e p n p t r a n s c r i p t i o n . R e a d t h r o u g h a t t h e b e g i n n i n g o f t h e r p s O t r a n s c r i p t i n t o p n p w o u l d s e e m t o b e s u p p o r t e d b y t h e S I m a p p i n g e x p e r i m e n t s w i t h t h e 5 ' l a b e l l e d 5 1 0 bp H p a l l a n d 6 0 0 bp P s t I - B a m H I p r o b e s . T h e f u l l l e n g t h o f e a c h p r o b e a p p e a r s t o b e p r o t e c t e d b y M C 1 0 0 0 , a n d p S H l 2 2 a n d p M B l RNAs r e s p e c t i v e l y ( F i g u r e 2 0 ) . T h i s may be a n a r t i f a c t o f t h e S I m a p p i n g t e c h n i q u e . H o w e v e r , t h e c o n t r o l s d o n o t s h o w t h i s p r o t e c t i o n ( F i g u r e 2 0 ) . F . R IBOSOME B I N D I N G S I T E S T h e e x p r e s s i o n o f a f u s i o n p r o t e i n w i t h 3 - g a l a c t o s i d a s e a c t i v i t y i n d i c a t e s t h a t f u n c t i o n a l t r a n s l a t i o n i n i t i a t i o n s i g n a l s a r e f o u n d w i t h i n t h i s DNA s e q u e n c e . T h e s e q u e n c e s o f t h e b e g i n n i n g s o f 1 24 g e n e s i n E_. c o l i h a v e b e e n e x a m i n e d a n d u s e d t o i d e n t i f y " r u l e s " f o r t r a n s l a t i o n i n i t i a t i o n s i t e s ( S t o r m o e t a l . , 1 9 8 2 ) . T h e s e q u e n c e i n f r o n t o f t h e p u t a t i v e ATG o f p n p a t n u c l e o t i d e s 7 1 5 - 7 1 7 ( F i g u r e 1 2 ) c o n f o r m s t o r u l e 2 , d e f i n e d a s A G G G G A 3 E 6 N A T G G A G 106. w h e r e N i s a n y b a s e , a n d E i s a n y b a s e o r n o b a s e . H o w e v e r , m o s t k n o w n g e n e s h a v e a 4 o r m o r e n u c l e o t i d e S h i n e a n d D a l g a r n o s e q u e n c e w h i c h i s t h o u g h t t o f a c i l i t a t e t h e b i n d i n g o f mRNA t o t h e 16S r R N A ( S h i n e a n d D a l g a r n o , 1 9 7 4 ) . O f t h e g e n e s e x a m i n e d b y S t o r m o e t a l . ( 1 9 8 2 ) , s e v e n h a d a t h r e e - n u c l e o t i d e S h i n e a n d D a l g a r n o s e q u e n c e . T h e S h i n e a n d D a l g a r n o s e q u e n c e i d e n t i f i e d f o r r p s O , GGCAG , i s a l s o u n u s u a l a s a r i b o s o m e b i n d i n g s i t e . T h i s s i t e , h o w e v e r , d o e s s h o w h o m o l o g y t o t h e r e g i o n o f 16S r R N A k n o w n t o b i n d S 1 5 ( F i g u r e 2 1 ) . G . CONCLUDING REMARKS R e s u l t s w i t h T n 5 i n s e r t i o n s i n t o a n r p s Q - p n p p l a s m i d c l o n e ( C r o f t o n a n d D e n n i s , 1 9 8 3 , a n d t h i s w o r k ) i n d i c a t e d t h a t t h e t r a n s c r i p t i o n a l c o n t r o l r e g i o n f o r p n p a n d r p s O c o u l d e x i s t o n t h e H p a l ^ - H p a l ^ f r a g m e n t o f p H E l ( F i g u r e 9 ) . D e l e t i o n o f t h e H p a l ^ - H p a l ^ f r a g m e n t , b u t n o t s e q u e n c e s u p s t r e a m , r e s u l t e d i n a d i s a p p e a r a n c e o f P N P a s e a n d S15 p r o t e i n s ( P o r t i e r , 1 9 8 2 ) . I n s e r t i o n o f Tn_5-37 i n t o a s i t e j u s t d i s t a l t o t h e P s t l ^ s i t e w i t h i n t h i s f r a g m e n t a n d w i t h i n t h e S15 c o d i n g s e q u e n c e d i d n o t d i s r u p t e x p r e s s i o n o f P N P a s e a c t i v i t y . T h e r e f o r e t h e t r a n s c r i p t i o n a l s p e c i e s w h o s e 5 ' t e r m i n i h a v e b e e n d e s c r i b e d a s m a p p i n g t o t h e r e g i o n w i t h i n t h e P s t l ^ - H p a l ^ r e g i o n a r e l i k e l y t o b e t h e t r a n s c r i p t s w h i c h r e s u l t i n t h e p r o d u c t i o n o f P N P a s e . T h e s i z e s o f t r u n c a t e d p e p t i d e s p r o d u c e d a s a r e s u l t o f T n 5 i n s e r t i o n s a s s e e n i n m a x i c e l l s i n d i c a t e t h a t t h e 5 ' c o d i n g t e r m i n u s o f P N P a s e i s a b o u t 1 5 0 n u c l e o t i d e s 5 ' t o t h e H p a l ^ s i t e . H o w e v e r , t h e p o s s i b i l i t y t h a t we h a v e f u s e d a s m a l l u n i d e n t i f i e d p e p t i d e r a t h e r t h a n P N P a s e t o t h e l a c Z g e n e c a n n o t b e r i g o r o u s l y d i s p r o v e d , a n d a w a i t s d e t e r m i n a t i o n o f t h e 107. a m i n o a c i d s e q u e n c e o f P N P a s e , o r p e r h a p s DNA s e q u e n c i n g o f pnp-Tn5 i n s e r t i o n s w h i c h d i s r u p t P N P a s e a c t i v i t y . 1 0 8 . LITERATURE CITED 1 . A b e l s o n , J . 1 9 7 9 . RNA p r o c e s s i n g a n d t h e i n t e r v e n i n g s e q u e n c e p r o b l e m . A n n . R e v . B i o c h e m . 48_: 1 0 3 5 - 1 0 6 9 . 2 . A d h y a , S . , P . S a r k a r , D . V a l e n z u e l a , a n d U . M a i t r a . 1 9 7 9 . T e r m i n a t i o n o f t r a n s c r i p t i o n b y E s c h e r i c h i a c o l i RNA p o l y m e r a s e : i n f l u e n c e o f s e c o n d a r y s t r u c t u r e o f RNA t r a n s c r i p t s o n r h o - i n d e p e n d e n t a n d r h o - d e p e n d e n t t e r m i n a t i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 7_6: 1 6 1 3 - 1 6 1 7 . 3 . A d h y a , S . , a n d M . G o t t e s m a n . 1 9 8 2 . P r o m o t e r o c c l u s i o n . T r a n s c r i p t i o n t h r o u g h a p r o m o t e r may i n h i b i t i t s a c t i v i t y . C e l l 2 9 : 9 3 9 - 9 4 4 . 4 . A i b a , H . 1 9 8 3 . A u t o r e g u l a t i o n o f t h e E s c h e r i c h i a c o l i c r p g e n e : CRP i s a t r a n s c r i p t i o n a l r e p r e s s o r f o r i t s own g e n e . C e l l 3 2 : 1 4 1 - 1 4 9 . 5 . A k s o y , S . , C . L . S q u i r e s , a n d C . S q u i r e s . 1 9 8 4 . T r a n s l a t i o n a l c o u p l i n g o f t h e t r p B a n d t r p A g e n e s i n t h e E s c h e r i c h i a c o l i t r y p t o p h a n o p e r o n . J . B a c t . 1 5 7 : 3 6 3 - 3 6 7 7 6 . A m e s , B . N . , T s a n g , T . H . , B u c k , M . , a n d C h r i s t m a n , M . F . 1 9 8 3 . T h e l e a d e r mRNA o f t h e h i s t i d i n e a t t e n u a t o r r e g i o n r e s e m b l e s t R N A ^ * s : p o s s i b l e g e n e r a l r e g u l a t o r y i m p l i c a t i o n s . P r o c . N a t l . A c a d . S c i . U . S . A . 8 0 : 5 2 4 0 - 5 2 4 2 . 7 . A n , G . , a n d J . D . F r i e s e n . 1 9 7 9 . P l a s m i d v e h i c l e s f o r d i r e c t c l o n i n g o f E s c h e r i c h i a c o l i p r o m o t e r s . J . B a c t . 1 4 0 : 4 0 0 - 4 0 7 . 8 . A o y a m a , T . , M . T a k a n a m i , E . O h t s u k a , Y . T a n i y a m a , R. M a r u m o t o , H . S a t o , a n d M o r i o I k e h a t a . 1 9 8 3 . E s s e n t i a l s t r u c t u r e o f E_. c o l i p r o m o t e r : e f f e c t o f s p a c e r l e n g t h b e t w e e n t h e t w o c o n s e n s u s s e q u e n c e s o n p r o m o t e r f u n c t i o n . N u c . A c i d s R e s . 11_: 5 8 5 5 - 5 8 6 4 . 9 . A p i r i o n , D . , a n d N . W a t s o n . 1 9 7 5 . M a p p i n g a n d c h a r a c t e r i z a t i o n o f a m u t a t i o n i n E s c h e r i c h i a c o l i t h a t r e d u c e s t h e l e v e l o f r i b o n u c l e a s e I I I s p e c i f i c f o r d o u b l e - s t r a n d e d r i b o n u c l e i c a c i d . J . B a c t . 1 2 4 : 3 1 7 - 3 2 4 . 1 0 . A p i r i o n , D . a n d N . W a t s o n . 1 9 7 8 . R i b o n u c l e a s e l l l i s i n v o l v e d i n m o t i l i t y o f E s c h e r i c h i a c o l i . J . B a c t . 1 3 3 : 1 5 4 3 - 1 5 4 5 . 1 1 . A p i r i o n , D . , a n d G i t e l m a n . 1 9 8 0 . D e c a y o f RNA i n RNA p r o c e s s i n g m u t a n t s o f E . c o l i . M o l e c . G e n . G e n e t . 1 7 7 : 1 3 9 - 1 5 4 . 1 2 . B a b i c h . A . , a n d J . R . N e v i n s . 1 9 8 1 . T h e s t a b i l i t y o f e a r l y a d e n o v i r u s mRNA i s c o n t r o l l e d b y t h e v i r a l 72 k d DNA b i n d i n g p r o t e i n . C e l l 2 6 : 3 7 1 - 3 7 9 . 1 3 . B a c h m a n n , B . J . , a n d K . B . L o w . 1 9 8 0 . L i n k a g e map o f E . c o l i K - 1 2 . M i c r o b i o l . R e v . 4 4 : 1 - 5 6 . 1 0 9 . 1 4 . B a c k e n d o r f , C . , J . A . B r a n d s m a , T . K a n t a s o v a , a n d P . v a n d e P u t t e . 1 9 8 3 . I n v i v o r e g u l a t i o n o f t h e u v r A g e n e : r o l e o f t h e " - 1 0 " a n d " - 3 5 " p r o m o t e r r e g i o n s . N u c . A c i d s R e s . 1 1 : 5 7 9 5 - 5 8 1 1 . 1 5 . B a r n s l e y , P . G . H . , a n d B . H . S e l l s . 1 9 7 7 . F u n c t i o n a l i n a c t i v a t i o n r a t e s o f t h e m e s s e n g e r RNA m o l e c u l e s c o d i n g f o r t h e i n d i v i d u a l r i b o s o m a l p r o t e i n s o f E s c h e r i c h i a c o l l . M o l e c . G e n . G e n e t . 1 5 3 : 1 2 1 - 1 2 7 . 1 6 . B a r r y , G . , C . S q u i r e s , a n d C . L . S q u i r e s . 1 9 8 0 . A t t e n u a t i o n a n d p r o c e s s i n g o f RNA f r o m t h e r p l J L - r p o B C t r a n s c r i p t i o n u n i t o f E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . _6: 3 3 3 1 - 3 3 3 5 . 1 7 . B a s s e t t , C . L . , a n d J . R . Y . R a w o n . 1 9 8 3 . I n v i t r o c o u p l e d t r a n s c r i p t i o n t r a n s l a t i o n o f l i n e a r DNA f r a g m e n t s i n a l y s a t e d e r i v e d f r o m a r e c B r n a p n p s t r a i n o f E s c h e r i c h i a c o l i . J . B a c t . 1 5 6 : 1 3 5 9 - 1 3 6 2 . 1 8 . B e r g , D . E . , J . D a v i e s , B . A l l e t , a n d J . R o c h a i x . 1 9 7 5 . T r a n s p o s i t i o n o f R f a c t o r g e n e s t o b a c t e r i o p h a g e X . P r o c . N a t . A c a d . S c i . U . S . A . 11} 3 6 2 8 - 3 6 3 2 . 1 9 . B e r g , D . E . 1 9 7 7 . I n s e r t i o n a n d e x c i s i o n o f t h e t r a n s p o s a b l e k a n a m y c i n r e s i s t a n c e d e t e r m i n a n t T n 5 . I n DNA I n s e r t i o n E l e m e n t s , P l a s m i d s a n d E p i s o m e s ( A . I . B u k h a r i , J . A . S h a p i r o a n d S . L . A d h y a , e d s . ) , C o l d S p r i n g H a r b o u r P r e s s , C o l d S p r i n g H a r b o u r , N . Y . , p . 2 0 5 - 2 1 2 . 2 0 . B e r k , A . J . , a n d P . A . S h a r p . 1 9 7 7 . S i z i n g a n d m a p p i n g o f e a r l y a d e n o v i r u s mRNAs b y g e l e l e c t r o p h o r e s i s o f S I e n d o n u c l e a s e - d i g e s t e d h y b r i d s . C e l l 12: 7 2 1 - 7 3 2 . 2 1 . B e r t r a n d , K . , L . J . K o r n , F . L e e a n d C . Y a n o f s k y . 1 9 7 7 . T h e a t t e n u a t o r o f t h e t r y p t o p h a n o p e r o n o f E s c h e r i c h i a c o l i . H e t e r o g e n e o u s 3 ' - 0 H t e r m i n i i n v i v o a n d d e l e t i o n m a p p i n g o f f u n c t i o n s . J . M o l e c . B i o l . 1 1 7 : 2 2 7 - 2 4 7 . 2 2 . B i r e n b a u m , M . , D . S c h l e s s i n g e r , Y . O h n i s h i . 1 9 8 0 . A l t e r e d b a c t e r i o p h a g e T4 r i b o n u c l e i c a c i d m e t a b o l i s m i n a R N a s e l l - d e f i c i e n t m u t a n t o f E s c h e r i c h i a c o l i . J . B a c t . 1 4 2 : 3 2 7 - 3 3 0 . 2 3 . B l u n d e l l , M . , E . C r a i g , a n d D . K e n n e l l . 1 9 7 2 . D e c a y r a t e s o f d i f f e r e n t mRNA i n _E. c o l i a n d m o d e l s o f d e c a y . N a t u r e New B i o l . 2 3 8 : 4 6 - 4 9 . 2 4 . B l u n d e l l , M . a n d D . K e n n e l l . 1 9 7 4 . E v i d e n c e f o r e n d o n u c l e o l y t i c a t t a c k i n d e c a y o f l a c m e s s e n g e r RNA i n E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 83: 1 4 3 - 1 6 1 . 2 5 . B o l i v a r , F . , R . L . R o d r i g u e z , P . J . G r e e n , M . C . B e t l a c h , H . L . H e y n e k e r , H .W . B o y e r , J . H . C r o s a , a n d S . F a l k o w . 1 9 7 7 . C o n s t r u c t i o n a n d c h a r a c t e r i s a t i o n o f new c l o n i n g v e h i c l e s . I I . A m u l t i - p u r p o s e c l o n i n g s y s t e m . G e n e t . 2 : 9 5 . 1 1 0 . 2 6 . B o t h w e l l , A . L . M . , a n d D . A p i r i o n . 1 9 7 1 . I s R N a s e V a m a n i f e s t a t i o n o f R N a s e l l ? B i o c h i m . B i o p h y s . R e s . Commun. 4 4 : 8 4 4 - 8 5 1 . 2 7 . B r a n l a n t , C , A . K r o l , A . M a c h a t t , a n d J . - P . E b e l . 1 9 8 1 . T h e s e c o n d a r y s t r u c t u r e o f t h e L l b i n d i n g r e g i o n o f r i b o s o m a l 23S R N A . H o m o l o g i e s w i t h p u t a t i v e s e c o n d a r y s t r u c t u r e s o f t h e L l l mRNA a n d o f a r e g i o n o f m i t o c h o n d r i a l 1 6S n R N A . N u c . A c i d s R e s . _9: 2 9 3 - 3 0 7 . 2 8 . B r e e d e n , L . , M . Y a r u s , a n d S . C l i v e . 1 9 8 0 . A c l o n e d s u p p r e s s o r t RNA g e n e r e l a x e s s t r i n g e n t c o n t r o l . M o l e c . G e n . G e n e t . 1 7 9 , 1 2 5 - 1 3 3 . 2 9 . B r e e d e n , L . a n d M . Y a r u s . 1 9 8 0 . M u t a t i o n s t h a t o v e r c o m e p l a s m i d - m e d i a t e d r e l a x a t i o n a f f e c t ( p ) p p G p p . M o l e c . G e n . G e n e t . 1 7 9 : 1 1 9 - 1 2 4 . 3 0 B r e w s t e r , J . M . , a n d E . A . M o r g a n . 1 9 8 1 . T n 9 a n d I S I i n s e r t s i n a r i b o s o m a l r i b o n u c l e i c a c i d o p e r o n o f E s c h e r i c h i a c o l i a r e i n c o m p l e t e l y p o l a r . J . B a c t . 1 4 8 : 8 9 7 - 9 0 3 . 3 1 . B r o c k , M . L . , a n d D . J . S h a p i r o . 1 9 8 3 . E s t r o g e n s t a b i l i z e s v i t e l l o g e n i n mRNA a g a i n s t c y t o p l a s m i c d e g r a d a t i o n . C e l l J 3 4 : 2 0 7 - 2 1 4 . 3 2 . B r o s i u s , J . , M . L . P a l m e r , P . J . K e n n e d y , a n d H . F . N o l l e r . 1 9 7 8 . C o m p l e t e n u c l e o t i d e s e q u e n c e o f a 16S r i b o s o m a l RNA g e n e f r o m E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 75_: 4 8 0 1 - 4 8 0 5 . 3 3 . B r o t , N . , P . C a l d w e l l , a n d H . W e i s s b a c h . 1 9 8 0 . A u t o g e n o u s c o n t r o l o f E s c h e r i c h i a c o l i r i b o s o m a l p r o t e i n L 1 0 s y n t h e s i s i n v i t r o . P r o c . N a t l . A c a d . S c i . U . S . A . 77.: 2 5 9 2 - 2 5 9 5 . 3 4 . B r o w n e , S . W . , a n d P . R o g e r s . 1 9 6 3 . A c c u m u l a t i o n o f r e p r e s s o r f o r o r n i t h i n e t r a n s c a r b a m y l a s e s y n t h e s i s i n E_. c o l i m e d i a t e d b y c h l o r a m p h e n i c o l . B i o c h i m . B i o p h y s . A c t a 7 6 : 6 0 0 - 6 1 3 . 3 5 . B u c k , M . , a n d B . N . A m e s . 1 9 8 4 . A m o d i f i e d n u c l e o t i d e i n t R N A a s a p o s s i b l e r e g u l a t o r o f a e r o b i o s i s : s y n t h e s i s o f c i s - 2 - M e t h y l - t h i o r i b o s y l z e a t i n i n t h e t R N A o f s a l m o n e l l a . C e l l 3 6 : 5 2 3 - 5 3 1 . 3 6 . B u l a w a , C . E . , B . R . G a n o n g , C . P . S p a r r o w , a n d C . R . H . R a e t z . 1 9 8 1 . E n z y m a t i c s o r t i n g o f b a c t e r i a l c o l o n i e s o n f i l t e r p a p e r r e p l i c a s : d e t e c t i o n o f l a b i l e a c t i v i t i e s . J . B a c t . 1 4 8 : 3 9 1 - 3 9 3 . 3 7 . B u r t o n , Z . F . , C . A . G r o s s , K . K . W a t a n a b e , R . R . B u r g e s s . 1 9 8 3 . T h e o p e r o n t h a t e n c o d e s t h e s i g m a s u b u n i t o f RNA p o l y m e r a s e a l s o e n c o d e s r i b o s o m a l p r o t e i n S 2 1 a n d DNA p r i m a s e i n E_. c o l i K 1 2 . C e l l 3 2 : 3 3 5 - 3 4 9 . 3 8 . B y e o n , W - H . , a n d B . W e i s b l u m . 1 9 8 4 . P o s t - t r a n s c r i p t i o n a l r e g u l a t i o n o f c h l o r a m p h e n i c o l a c e t y l t r a n s f e r a s e . J . B a c t . 1 5 8 : 5 4 3 - 5 5 0 . 1 1 1 . 3 9 . C a r l , P . L . , L . B l o o m , a n d R . J . C r o u c h . 1 9 8 0 . I s o l a t i o n a n d m a p p i n g o f a m u t a t i o n i n E s c h e r i c h i a c o l i w i t h a l t e r e d l e v e l s o f R N a s e H . J . B a c t . 1 4 4 : 2 8 - 3 5 . 4 0 . C a s a d a b a n , M . J . , J . C h o u , a n d S . N . C o h e n . 1 9 8 0 . I n v i t r o g e n e f u s i o n s t h a t j o i n a n e n z y m a t i c a l l y a c t i v e 3 - g a l a c t o s i d a s e s e g m e n t t o a m i n o - t e r m i n a l f r a g m e n t s o f e x o g e n o u s p r o t e i n : E s c h e r i c h i a c o l i p l a s m i d v e c t o r s f o r t h e d e t e c t i o n a n d c l o n i n g o f t r a n s l a t i o n a l i n i t i a t i o n s i g n a l s . J . B a c t . 1 4 3 : 9 7 1 - 9 8 0 . 4 1 . C a s a d a b a n , M . J . , a n d C o h e n S . N . . 1 9 8 0 . A n a l y s i s o f g e n e c o n t r o l s i g n a l s b y DNA f u s i o n a n d c l o n i n g i n E s c h e r i c h i a c o l i . J . M o l . B i o l . 1 3 8 : 1 7 9 - 2 0 7 . 4 2 . C a s k e y , C . T . , W . C . F o r r e s t e r , W. T a t e , a n d C . D . W a r d . 1 9 8 4 . C l o n i n g o f t h e E s c h e r i c h i a c o l i r e l e a s e f a c t o r 2 g e n e . J . B a c t . 1 5 8 : 3 6 5 - 3 6 8 . 4 3 . C a s t l e s , J . J . , a n d M . F . S i n g e r . 1 9 6 8 . Some p r o p e r t i e s o f t h e p n p a s e a n d R N a s e l l o f E . c o l i 1 1 1 3 B . B i o c h e m . B i o p h y s . R e s . Comm. 3 2 : 7 1 5 - 7 2 2 . ~~ 4 4 . C e c h , T . R . 1 9 8 3 . RNA s p l i c i n g : t h r e e t h e o r i e s w i t h v a r i a t i o n s . C e l l 34_: 7 1 3 - 7 1 6 . 4 5 . C e r r e t t i , D . P . , D . D e a n , G . R . D a i r s , D . M . B e d w e l l , a n d M . N o m u r a . 1 9 8 3 . T h e s p c r i b o s o m a l p r o t e i n o p e r o n o f E s c h e r i c h i a c o l i : s e q u e n c e a n d c o t r a n s c r i p t i o n o f t h e r i b o s o m a l p r o t e i n g e n e s a n d a p r o t e i n e x p o r t g e n e . N u c . A c i d s R e s . 11_: 2 5 9 9 - 6 8 3 9 . 4 6 . C h a n e y , S . G . , a n d P . D . B o y e r . 1 9 7 2 . I n c o r p o r a t i o n o f w a t e r o x y g e n s i n t o i n t r a c e l l u l a r n u c l e o t i d e s a n d RNA I I . P r e d o m i n a n t l y h y d r o l y t i c RNA t u r n o v e r i n E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 6 4 : 5 8 1 - 5 9 1 . 4 7 . C l a r k e , L . a n d J . C a r b o n . 1 9 7 5 . B i o c h e m i c a l c o n s t r u c t i o n a n d s e l e c t i o n o f h y b r i d p l a s m i d s c o n t a i n i n g s p e c i f i c s e g m e n t s o f t h e E . c o l i g e n o m e . P r o c . N a t l . A c a d . S c i . U . S . A . 72_: 4 3 6 1 - 4 3 6 5 . ~~ 4 8 . C l a r k e , L . , a n d J . C a r b o n . 1 9 7 6 . A c o l o n y b a n k c o n t a i n i n g s y n t h e t i c C o l E l h y b r i d p l a s m i d s r e p r e s e n t a t i v e o f t h e e n t i r e E_. c o l i g e n o m e . C e l l 9: 9 1 - 9 9 . 4 9 . C l o s e , T . J . , J . L . C h r i s t m a n n , a n d R . L . R o d r i g u e z . 1 9 8 3 . M13 b a c t e r i o p h a g e a n d pUC p l a s m i d s c o n t a i n i n g DNA i n s e r t s b u t s t i l l c a p a b l e o f 3 - g a l a c t o s i d a s e a - c o m p l e m e n t a t i o n . G e n e 2 3 : 1 3 1 - 1 3 6 . 5 0 . C o h e n , T . , A . S i l b e r s t e i n , J . K u h r , a n d M . T a l . 1 9 7 9 . R e l i e f o f p o l a r i t y i n E_. c o l i d e p l e t e d o f 30S r i b o s o m a l s u b u n i t s . M o l e c . G e n . G e n e t . 173: 1 2 7 - 1 3 4 . 5 1 . C o u r t , D . , B . d e C r o m b r u g g h e , S . A d h y a , a n d M . G o t t e s m a n . 1 9 8 0 . B a c t e r i o p h a g e l a m b d a H i n f u n c t i o n I I . E n c h a n c e d s t a b i l i t y o f l a m b d a m e s s e n g e r RNA . J . M o l e c . B i o l . 1 3 8 : 7 3 1 - 7 4 3 . 1 1 2 . 5 2 . C r o f t o n , S . , a n d P . P . D e n n i s . 1 9 8 3 . C l o n i n g a n d o r i e n t a t i o n o f t h e g e n e e n c o d i n g p o l y n u c l e o t i d e p h o s p h o r y l a s e i n E s c h e r i c h i a c o l i . 1 5 4 : 5 8 - 6 4 . 5 3 . D a s , A . , C . M e r r i l , a n d S . A d h y a . 1 9 7 8 . I n t e r a c t i o n o f RNA p o l y m e r a s e a n d r h o i n t r a n s c r i p t i o n : c o u p l e d A T P a s e . P r o c . N a t l . A c a d . S c i . U . S . A . 75_: 4 8 2 8 - 4 8 3 2 . 5 4 . D e a n , D . , a n d M . N o m u r a . 1 9 8 0 . F e e d b a c k r e g u l a t i o n o f r i b o s o m a l p r o t e i n g e n e e x p r e s s i o n i n E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 77_: 3 5 9 0 - 3 5 9 4 . 5 5 . D e a n , D . , J . L . Y a t e s , a n d M . N o m u r a . 1 9 8 1 . I d e n t i f i c a t i o n o f r i b o s o m a l p r o t e i n S7 a s a r e p r e s s o r o f t r a n s l a t i o n w i t h i n t h e s t r o p e r o n o f _E. c o l i . C e l l 24.: 4 1 3 - 4 1 9 . 5 6 . D e e l e y , M . C , a n d C . Y a n o f s k y . 1 9 8 1 . N u c l e o t i d e s e q u e n c e o f t h e s t r u c t u r a l g e n e f o r t r y p t o p h a n a s e o f E s c h e r i c h i a c o l i K - 1 2 . J . B a c t . 1 4 7 : 7 8 7 - 7 9 6 • 5 7 . D e e l e y , M . C . , a n d C . Y a n o f s k y . 1 9 8 2 . T r a n s c r i p t i o n I n i t i a t i o n a t t h e t r y p t o p h a n a s e p r o m o t e r o f E s c h e r i c h i a c o l i K - 1 2 . J . B a c t . 1 5 1 : 9 4 2 - 9 5 1 . 5 8 . D e n n i s , P . P . , a n d M . N o m u r a . 1 9 7 4 . S t r i n g e n t c o n t r o l o f r i b o s o m a l p r o t e i n g e n e e x p r e s s i o n i n E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . _71: 3 8 1 9 - 3 8 2 3 . 5 9 . D e n n i s , P . P . , a n d M . N o m u r a . 1 9 7 5 . R e g u l a t i o n o f t h e e x p r e s s i o n o f r i b o s o m a l p r o t e i n g e n e s i n E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 9 7 : 6 1 - 7 6 . 6 0 . D e n n i s , P . P . 1 9 7 7 . T r a n s c r i p t i o n p a t t e r n s o f a d j a c e n t s e g m e n t s o n t h e c h r o m o s o m e o f E s c h e r i c h i a c o l i c o n t a i n i n g g e n e s c o d i n g f o r f o u r 5 0 S r i b o s o m a l p r o t e i n s a n d t h e $ a n d 3 ' s u b u n i t s o f RNA p o l y m e r a s e . J . M o l e c . B i o l . 1 1 5 : 6 0 3 - 6 2 5 . 6 1 . D e n n i s , P . P . , a n d N . P . F i l l . 1 9 7 9 . T r a n s c r i p t i o n a l a n d p o s t - t r a n s c r i p t i o n a l c o n t r o l o f RNA p o l y m e r a s e a n d r i b o s o m a l p r o t e i n g e n e s c l o n e d o n c o m p o s i t e C o l E l p l a s m i d s i n t h e B a c t e r i u m E s c h e r i c h i a  c o l i . J . B i o l . C h e m . _254: 7 5 4 0 - 7 5 4 7 . 6 2 . D o n o v a n , W . P . , a n d K u s h n e r , S . R . 1 9 8 3 . A m p l i f i c a t i o n o f r i b o n u c l e a s e I I ( r n b ) a c t i v i t y i n E s c h e r i c h i a c o l i K - 1 2 . N u c . A c i d s R e s . 11_: 2 6 5 - 2 7 5 . 6 3 . D u e s t e r , G . , R . M . E l f o r d , a n d W . M . H o l m e s . 1 9 8 2 . F u s i o n o f t h e E s c h e r i c h i a c o l i tRNA-* - e u p r o m o t e r t o t h e g a l K g e n e : a n a l y s i s o f s e q u e n c e s n e c e s s a r y f o r g r o w t h - r a t e - d e p e n d e n t r e g u l a t i o n . C e l l 3 0 : 8 5 5 - 8 6 4 . 1 1 3 . 6 4 . D u f f y , J . J . , S . G . C h a n e y , a n d P . D . B o y e r . 1 9 7 2 . I n c o r p o r a t i o n o f w a t e r o x y g e n s i n t o i n t r a c e l l u l a r n u c l e o t i d e s a n d RNA I . p r e d o m i n a n t l y n o n - h y d r o l y t i c RNA t u r n o v e r i n B a c i l l u s s u b t i l i s . J . M o l e c . B i o l . j>4: 5 6 5 - 5 7 9 . 6 5 . D u n n , J . J . , a n d F . W . S t u d i e r . 1 9 7 5 . E f f e c t o f R N a s e l l l c l e a v a g e o n t r a n s l a t i o n o f b a c t e r i o p h a g e T 7 m e s s e n g e r R N A s . J . M o l e c . B i o l . 9 9 : 4 8 7 - 4 9 9 . 6 6 . E l l i o t t , T . a n d E . P . G e i d u s c h e k . 1 9 8 4 . D e f i n i n g a b a c t e r i o p h a g e T4 l a t e p r o m o t e r : a b s e n c e o f a " - 3 5 " r e g i o n . C e l l 3 6 : 2 1 1 - 2 1 9 . 6 7 . F a l l o n , A . M . , C . S . J i n c o , G . D . S t r y c h a r z , a n d M . N o m u r a . 1 9 7 9 . R e g u l a t i o n o f r i b o s o m a l p r o t e i n s y n t h e s i s i n E s c h e r i c h i a c o l i b y s e l e c t i v e mRNA i n a c t i v a t i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 7 6 : 3 4 1 1 - 3 4 1 5 . 6 8 . F a r n h a m , P . J . , a n d T . P i a t t . 1 9 8 0 . A m o d e l f o r t r a n s c r i p t i o n t e r m i n a t i o n s u g g e s t e d b y s t u d i e s o n t h e t r p a t t e n u a t o r i j i v i t r o u s i n g b a s e a n a l o g s . C e l l _20: 7 3 9 - 7 4 8 . 6 9 . F a r n h a m , P . J . , T . G r e e n b l a t t , a n d T . P i a t t . 1 9 8 2 . E f f e c t s o f N u s A p r o t e i n o n t r a n s c r i p t i o n t e r m i n a t i o n i n t h e t r y p t o p h a n o p e r o n o f E s c h e r i c h i a c o l i . C e l l 29_: 9 4 5 - 9 5 1 . 7 0 . F o l e y , D . , P . D e n n i s , a n d J . G a l l a n t . 1 9 8 1 . M e c h a n i s m o f t h e r e l d e f e c t i n g - g a l a c t o s i d a s e s y n t h e s i s . J . B a c t . 1 4 5 : 6 4 1 - 6 4 3 . 7 1 . F o r c h h a m m e r , J . , E . N . J a c k s o n , a n d C . Y a n o f s k y . 1 9 7 2 . D i f f e r e n t h a l f - l i v e s o f m e s s e n g e r RNA c o r r e s p o n d i n g t o d i f f e r e n t s e g m e n t s o f t h e t r y p t o p h a n o p e r o n o f E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 7 1 : 6 8 7 - 6 9 9 . 7 2 . F r i e d m a n , D . I . , A . T . S c h a u e r , M . R . B a u m a n n , L . S . B a r o n , a n d S . L . A d h y a . 1 9 8 1 . E v i d e n c e t h a t r i b o s o m a l p r o t e i n S 1 0 p a r t i c i p a t e s i n c o n t r o l o f t r a n s c r i p t i o n t e r m i n a t i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 78_: 1 1 1 5 - 1 1 1 8 . 7 3 . F r i e d m a n , D . I . , a n d E . R . O l s o n . 1 9 8 3 . E v i d e n c e t h a t a n u c l e o t i d e s e q u e n c e " b o x A " , i s i n v o l v e d i n t h e a c t i o n o f t h e N u s A p r o t e i n . C e l l _3J+: 1 ^ 3 - 1 4 9 . 7 4 . F u r d o n , P . J . , C . G u e r r i e r - T a k a d a , a n d S . A l t m a n . 1 9 8 3 . A G43 t o U43 m u t a t i o n i n E_. c o l i t R N A T y r SU3 w h i c h a f f e c t s p r o c e s s i n g b y R N a s e P . N u c . A c i d s R e s . 11_: 1 4 9 1 - 1 5 0 5 . 7 5 . F u r u i c h i , Y . , A . L a F i a n d s a , a n d A . J . S h a t k i n . 1 9 7 1 . 5 ' - t e r m i n a l s t r u c t u r e a n d mRNA s t a b i l i t y . N a t u r e 2 6 6 : 2 3 5 - 2 3 9 . 7 6 . F u t a i , M . , a n d D . M i z u n o . 1 9 6 6 . E f f e c t o f SRNA a n d r e l a t e d c o m p o u n d s o n t h e p h o s p h o r o l y s i s o f p o l y n u c l e o t i d e p h o s p h o r y l a s e i n t h e d e g r a d a t i o n o f m e s s e n g e r r i b o n u c l e i c a c i d s . J . B i o l . C h e m . 5 9 : 5 2 1 - 5 2 3 . 1 1 4 . 7 7 . G a r b e r , B r u c e B . , B . U . J o c h i n s e n , a n d J . S . G o t s . 1 9 8 0 . G l u t a m i n e a n d r e l a t e d a n a l o g s r e g u l a t e g u a n o s i n e m o n o p h o s p h a t e r e d u c t a s e i n S . t y p h i n u r i u m . J . B a c t . 1 4 3 : 1 0 5 - 5 1 1 1 . 7 8 . G a r n e t t , R. 1 9 8 3 . A n t i b i o t i c s a n d a c t i v e r i b o s o m a l RNA s i t e s . T r e n d s i n B i o c h e m . S c i . 8: 1 . 7 9 . G e g e n h e i m e r , P . , N . W a t s o n , a n d D . A p i r i o n . 1 9 7 7 . M u l t i p l e p a t h w a y s f o r p r i m a r y p r o c e s s i n g o f r i b o s o m a l RNA i n E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 2 5 2 : 3 0 6 4 - 3 0 7 3 . 8 0 . G i l l a m , S . , a n d M . S m i t h . 1 9 7 4 . E n z y m a t i c s y n t h e s i s o f d e o x y r i b o - o l i g o n u c l e o t i d e s o f d e f i n e d s e q u e n c e . P r o p e r t i e s o f t h e e n z y m e . N u c . A c i d s R e s . 1 2 : 1 6 3 1 - 1 6 4 8 . 8 1 . G o d e f r o y - C o l b u r n , T . , a n d M . G r u n b e r g - M a n a g o . 1 9 7 2 . P o l y n u c l e o t i d e P h o s p h o r y l a s e . I_n T h e E n z y m e s ( P . D . B o y e r , e d . ) , V o l V I I , A c a d e m i c P r e s s , New Y o r k , p . 5 3 3 - 5 7 5 . 8 2 . G o i t e i n , R . K . , a n d S . M . P a r s o n s . 1 9 8 0 . P o s s i b l e r e g u l a t i o n o f t h e S_. t y p h i m u r i u m h i s t i d i n e o p e r o n b y a d e n o s i n e t r i p h o s p h a t e p h o s p h o r i b o s y l t r a n s f e r a s e : l a r g e m e t a b o l i c e f f e c t s . J . B a c t . 1 4 4 : 3 3 7 - 3 4 5 . 8 3 . G o p a l a k r i s h n a , Y . , D . L a n g l e y , a n d N . S a n k a r . 1 9 8 1 . D e t e c t i o n o f h i g h l e v e l s o f p o l y a d e n y l a t e - c o n t a i n i n g RNA i n b a c t e r i a b y t h e u s e o f a s i n g l e - s t e p RNA i s o l a t i o n p r o c e d u r e . N u c . A c i d s R e s . _9: 3 5 4 5 - 3 5 5 4 . 8 4 . G o t t e s m a n , M . , A . O p p e n h e i m , a n d D . C o u r t . 1 9 8 2 . R e t r o r e g u l a t i o n : c o n t r o l o f g e n e e x p r e s s i o n f r o m s i t e s d i s t a l t o t h e G e n e . C e l l 2 9 : 7 2 7 - 7 2 8 . 8 5 . G o u r s e , R . L . , D . L . T h u r l o w , S . A . G e r b i , a n d R . A . Z i m m e r m a n . 1 9 8 1 . S p e c i f i c b i n d i n g o f a p r o k a r y o t i c r i b o s o m a l p r o t e i n t o a e u k a r y o t i c r i b o s o m a l R N A : i m p l i c a t i o n s f o r e v o l u t i o n a n d a u t o r e g u l a t i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 78_: 2 7 2 2 - 2 7 2 6 . 8 6 . G o u r s e , R . L . , M . J . R . S t a r k , a n d A . E . D a h l b e r g . 1 9 8 3 . R e g i o n s o f DNA i n v o l v e d i n t h e s t r i n g e n t c o n t r o l o f p l a s m i d - e n c o d e d r R N A i n v i v o . C e l l 3 2 : 1 3 4 7 - 1 3 5 4 . 8 7 . G o u y , M . , a n d C . G a u t i e r . 1 9 8 2 . C o d o n u s a g e i n b a c t e r i a : c o r r e l a t i o n w i t h g e n e e x p r e s s i v i t y . N u c . A c i d s R e s . 10_: 7 0 5 5 - 7 0 7 4 . 8 8 . G r a h a m , M . , M . T a l , a n d D . S c h l e s s i n g e r . 1 9 8 2 . l a c t r a n s c r i p t i o n i n E s c h e r i c h i a c o l i c e l l s t r e a t e d w i t h c h l o r a m p h e n i c o l . J . B a c t . 1 5 1 : 2 5 1 - 2 6 1 . 8 9 . G r e e n b l a t t , J . , a n d J . L i . 1 9 8 1 . I n t e r a c t i o n o f t h e s i g m a f a c t o r a n d t h e n u s A g e n e p r o t e i n o f E_. c o l i w i t h RNA p o l y m e r a s e i n t h e i n i t i a t i o n - t e r m i n a t i o n c y c l e o f t r a n s c r i p t i o n . C e l l 2 4 : 4 2 1 - 4 2 8 . 1 1 5 . 9 0 . G r e e r , C . L . , J a v o r , B . , J . A b e l s o n . 1 9 8 3 . RNA l i g a s e i n b a c t e r i a : f o r m a t i o n o f a 2 ' 5 ' l i n k a g e b y a n 1 5 . c o l i e x t r a c t . C e l l 33_: 8 9 9 - 9 0 6 . 9 1 . G r o s j e a n , H . , a n d W. F i e r s . 1 9 8 2 . P r e f e r e n t i a l c o d o n u s a g e i n p r o k a r y o t i c g e n e s : t h e o p t i m a l c o d o n - a n t i c o d o n i n t e r a c t i o n e n e r g y a n d t h e s e l e c t i v e c o d o n u s a g e i n e f f i c i e n t l y e x p r e s s e d g e n e s . G e n e 1 8 : 1 9 9 - 2 0 9 . 9 2 . G r u n b e r g - M a n a g o , M . 1 9 5 9 . J . M o l . B i o l . 1- 2 4 0 9 3 . G u a r e n t e , L . P . , D . H . M i t c h e l l , a n d J . B e c k w i t h . 1 9 7 7 . T r a n s c r i p t i o n t e r m i n a t i o n a t t h e e n d o f t h e t r y p t o p h a n o p e r o n o f E s c h e r i c h i a c o l i . , J . M o l e c . B i o l . 1 1 2 : 4 2 3 - 4 3 6 . 9 4 . G u a r e n t e , L . , a n d M . P t a s h n e . 1 9 8 1 . F u s i o n o f E s c h e r i c h i a c o l i l a c Z t o t h e c y t o c h r o m e c^  g e n e o f S a c c h a r o m y c e s c e r e v i s i a e . P r o c . N a t l . A c a d . S c i . U . S . A . _78: 2 1 9 9 - 2 2 0 3 . 9 5 . G u a r e n t e , L . , B . L a l o n d e , P . G i f f o r d , a n d E . A l a n i . 1 9 8 4 . D i s t i n c t l y r e g u l a t e d t a n d e m u p s t r e a m a c t i v a t i o n s i t e s m e d i a t e c a t a b o l i t e r e p r e s s i o n o f t h e C Y C 1 g e n e o f S . c e r e v i s i a e . C e l l 3 6 : 5 0 3 - 5 1 1 . ~ 9 6 . G u a r n e r o s , G . , C . M o n t a n e z , T . H e r n a n d e z , a n d D . C o u r t . 1 9 8 2 . P o s t t r a n s c r i p t i o n a l c o n t r o l o f b a c t e r i o p h a g e X i n t g e n e e x p r e s s i o n f r o m a s i t e d i s t a l t o t h e g e n e . P r o c . N a t l . A c a d . S c i . U . S . A . _79: 2 3 8 - 2 4 2 . 9 7 . G u e r r i e r - T a k a d a , C , K . G a r d i n e r , T . M a r s h , N . P a c e , a n d S . A l t m a n . 1 9 8 3 . T h e RNA m o i e t y o f r i b o n u c l e a s e P , t h e c a t a l y t i c s u b u n i t o f t h e e n z y m e . C e l l 35_: 8 4 9 - 4 5 7 . 9 8 . G u i d i - R o n t a n i , C , A . D a n c h i n , a n d A . U l l m a n . 1 9 8 0 . C a t a b o l i t e r e p r e s s i o n i n E_. c o l i m u t a n t s l a c k i n g c y c l i c AMP r e c e p t o r p r o t e i n . P r o c . N a t l . A c a d . S c i . U . S . A . 77.: 5 7 9 9 - 5 8 0 1 . 9 9 . G u p t a , R . S . , a n d D . S c h l e s s i n g e r . 1 9 7 5 . D i f f e r e n t i a l mode s o f c h e m i c a l d e c a y f o r e a r l y a n d l a t e l a m b d a m e s s e n g e r RNA . J . M o l e c . B i o l . 92_: 3 1 1 - 3 1 8 . 1 0 0 . G u p t a , R . S . , a n d D . S c h l e s s i n g e r . 1 9 7 6 . C o u p l i n g o f r a t e s o f t r a n s c r i p t i o n , t r a n s l a t i o n , a n d m e s s e n g e r r i b o n u c l e i c a c i d d e g r a d a t i o n i n s t r e p t o m y c i n - d e p e n d e n t m u t a n t s o f E s c h e r i c h i a c o l i . J . B a c t . 1 2 5 : 8 4 - 9 3 . 1 0 1 . G u r e v i t z , M . , S . K . J a i n , a n d D . A p i r i o n . 1 9 8 3 . I d e n t i f i c a t i o n o f a p r e c u r s o r m o l e c u l e f o r t h e RNA m o i e t y o f t h e p r o c e s s i n g e n z y m e R N a s e P . P r o c . N a t l . A c a d . S c i . U . S . A . 8 0 : 4 4 5 0 - 4 4 5 4 . 1 0 2 . H a n k e , P . D . , a n d J . A . F u c h s . 1 9 8 3 . C h a r a c t e r i z a t i o n o f t h e mRNA c o d i n g f o r r i b o n u c l e o s i d e d i p h o s p h a t e r e d u c t a s e i n E s c h e r i c h i a c o l i . J . B a c t . 1 5 6 : 1 1 9 2 - 1 1 9 7 . 1 1 6 . 1 0 3 . H a n s e n , E . B . , F . G . H a n s e n , a n d K . v o n M e y e n b u r g . 1 9 8 2 . T h e n u c l e o t i d e s e q u e n c e o f t h e d n a A g e n e a n d t h e f i r s t p a r t o f t h e d n a N g e n e o f E s c h e r i c h i a c o l i K - 1 2 . N u c . A c i d s R e s . 10_: 7 3 7 3 - 7 3 8 5 . 1 0 4 . H a r - e l , R . , A . S i l b e r s t e i n , J . K u h n , a n d M . T a l . 1 9 7 9 . S y n t h e s i s a n d d e g r a d a t i o n o f l a c mRNA i n E_. c o l i d e p l e t e d o f 30S r i b o s o m a l s u b u n i t s . M o l . G e n . G e n e t . 1 7 3 : 1 3 5 - 1 4 4 . 1 0 5 . H a r r i s , J . D . , J . S . H e i l i g , I . I . M a r t i n e z , R. C a l e n d a r , a n d L . A . I s a k s s o n . 1 9 7 8 . T e m p e r a t u r e - s e n s i t i v e E s c h e r i c h i a c o l i m u t a n t p r o d u c i n g a t e m p e r a t u r e - s e n s i t i v e a s u b u n i t o f D N A - d e p e n d e n t RNA p o l y m e r a s e . P r o c . N a t . A c a d . S c i . U . S . A . _75: 6 1 7 7 - 6 1 8 1 . 1 0 6 . H a u t a l a , J . A . , C L . B a s s e t t , N . H . G i l e s , a n d S . R . K u s h n e r . 1 9 7 9 . I n c r e a s e d e x p r e s s i o n o f a e u k a r y o t i c g e n e i n E . c o l i t h r o u g h s t a b i l i z a t i o n o f i t s m e s s e n g e r RNA . P r o c . N a t . A c a d . S c i . U . S . A . 7 6 : 5 7 7 4 - 5 7 7 8 . 1 0 7 . H a w l e y , D . K . , a n d W . R . M c C l u r e . 1 9 8 3 . C o m p i l a t i o n a n d a n a l y s i s o f E s c h e r i c h i a c o l i p r o m o t e r DNA s e q u e n c e s . N u c . A c i d s R e s . 1 1 : 2 2 3 7 - 2 2 5 5 . 1 0 8 . H e r c u l e s , K . , M . S c h w e i g e r , a n d W. S a u e r b i e r . 1 9 7 4 . C l e a v a g e b y R N a s e l l l c o n v e r t s T 3 a n d T 7 e a r l y p r e c u r s o r RNA i n t o t r a n s l a t a b l e m e s s a g e . P r o c . N a t l . A c a d . S c i . U . S . A . Tl: 8 4 0 - 8 4 4 . 1 0 9 . H i r a g a , S . , K . I t o , T . M a t s u y a m a , H . O z a k i , a n d T . Y u r a . 1 9 6 8 . 5 - M e t h y l t r y p t o p h a n - r e s i s t a n t m u t a t i o n s l i n k e d w i t h t h e a r g i n i n e G m a r k e r i n E_. c o l i . J . B a c t e r i o l . 96_: 1 8 8 0 - 1 8 8 1 . 1 1 0 . H i r a g a , S . 1 9 6 9 . O p e r a t o r m u t a n t s o f t h e t r y p t o p h a n o p e r o n i n E . c o l i . J . M o l e c . B i o l . 39_: 1 5 9 - 1 7 9 . 1 1 1 . H o c h , J . O . , C W . R o t h , I . P . C r a w f o r d , a n d E . W . N e s t e r . 1 9 7 1 . C o n t r o l o f t r y p t o p h a n b i o s y n t h e s i s b y t h e m e t h y l t r y p t o p h a n r e s i s t a n c e g e n e i n j i . s u b t i l i s . J . B a c t . 1 0 5 : 3 8 - 4 5 . 1 1 2 . H o l o w a c h u k , E . W . , a n d J . D . F r i e s e n . 1 9 8 2 . I s o l a t i o n o f a r e c o m b i n a n t l a m b d a p h a g e c a r r y i n g n u s A a n d s u r r o u n d i n g r e g i o n o f t h e E s c h e r i c h i a c o l i K - 1 2 c h r o m o s o m e . M o l e c . G e n . G e n e t . 1 8 7 : 2 4 8 - 2 5 3 . 1 1 3 . H o r o w i t z , H . , a n d T . P i a t t . 1 9 8 2 . A t e r m i n a t i o n s i t e f o r l a d t r a n s c r i p t i o n i s b e t w e e n t h e CAP s i t e a n d t h e l a c p r o m o t e r . J . B i o l . C h e m . 2 5 7 : 1 1 7 4 0 - 1 1 7 4 6 . 1 1 4 . H o r o w i t z , H . , G . E . C h r i s t i e , a n d T . P i a t t . 1 9 8 2 . N u c l e o t i d e s e q u e n c e o f t h e t r p D g e n e , e n c o d i n g a n t h r a n i l a t e s y n t h e t a s e c o m p o n e n t I I o f E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 1 5 6 : 2 4 5 - 2 5 6 . 1 1 5 . H o r o w i t z , H . , a n d T . P i a t t . 1 9 8 2 . I d e n t i f i c a t i o n o f t r p - p 2 , a n i n t e r n a l p r o m o t e r i n t h e t r y p t o p h a n o p e r o n o f E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 1 5 6 : 2 5 7 - 2 6 7 . 1 1 7 . 1 1 6 . I k e m u r a , T . , a n d H . O z e k i . 1 9 7 7 . G r o s s map l o c a t i o n o f E s c h e r i c h i a  c o l i t r a n s f e r RNA g e n e s . J . M o l e c . B i o l . 1 1 7 : 4 1 9 - 4 4 6 . 1 1 7 . I m a m o t o , F . 1 9 7 3 . D i v e r s i t y o f r e g u l a t i o n o f g e n e t r a n s c r i p t i o n . I . E f f e c t o f a n t i b i o t i c s w h i c h i n h i b i t t h e p r o c e s s o f t r a n s l a t i o n o n RNA m e t a b o l i s m i n E_. c o l i . J . M o l e c . B i o l . 7A_: 1 1 3 - 1 3 6 . 1 1 8 . I s h i i , S . , K . K u r o k i , a n d F . I m a m o t o . 1 9 8 4 . t R N A ^ f t g e n e i n t h e l e a d e r r e g i o n o f t h e n u s A o p e r o n i n E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 8 1 : 4 0 9 - 4 1 3 . 1 1 9 . I s h i k a m a , A . , a n d T . S a i t o h . 1 9 7 9 . S u b u n i t s o f RNA p o l y m e r a s e i n f u n c t i o n a n d s t r u c t u r e I X . R e g u l a t i o n o f RNA p o l y m e r a s e a c t i v i t y b y s t r i n g e n t s t a r v a t i o n p r o t e i n . J . M o l e c . B i o l . 1 2 9 : 5 1 7 6 - 5 3 0 . 1 2 0 . I z a r t , J . G . , a n d H . W e i n t r a u b . 1 9 8 4 . I n h i b i t i o n o f t h y m i d i n e k i n a s e g e n e e x p r e s s i o n b y a n t i - s e n s e R N A : a m o l e c u l a r a p p r o a c h t o g e n e t i c a n a l y s i s . C e l l _36: 1 0 0 7 - 1 0 1 5 . 1 2 1 . J a s k u n a s , S . R . , L . L i n d a h l , a n d M . N o m u r a . 1 9 7 5 . S p e c i a l i z e d t r a n s d u c i n g p h a g e s f o r r i b o s o m a l p r o t e i n g e n e s o f E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 72_: 6 - 1 0 . 1 2 2 . J i n k s - R o b e r t s o n , S . , a n d M . N o m u r a . 1 9 8 2 . R i b o s o m a l p r o t e i n S4 a c t s i n t r a n s a s a t r a n s l a t i o n a l r e p r e s s o r t o r e g u l a t e e x p r e s s i o n o f t h e a o p e r o n i n E s c h e r i c h i a c o l i . J . B a c t . 1 5 1 : 1 9 3 - 2 0 2 . 1 2 3 . J i n k s - R o b e r t s o n , S . , R . L . G o u r s e , M . N o m u r a . 1 9 8 3 . E x p r e s s i o n o f r R N A a n d t R N A g e n e s i n E s c h e r i c h i a c o l i : e v i d e n c e f o r f e e d b a c k r e g u l a t i o n b y p r o d u c t s o f r R N A o p e r o n s . C e l l _33: 8 6 5 - 8 7 6 . 1 2 4 . J o h n s e n , M . , T . C h r i s t e n s e n , P . P . D e n n i s , a n d N . P . F i l l . 1 9 8 2 . A u t o g e n o u s c o n t r o l : r i b o s o m a l p r o t e i n L 1 0 - L 1 2 c o m p l e x b i n d s t o t h e l e a d e r s e q u e n c e o f i t s mRNA. T h e EMBO J o u r n a l 1_: 9 9 9 - 1 0 0 4 . 1 2 5 . K a j i t a n i , M . , a n d A . I s h i h a n a . 1 9 8 3 . D e t e r m i n a t i o n o f t h e p r o m o t e r s t r e n g t h i n t h e m i x e d t r a n s c r i p t i o n s y s t e m I I . P r o m o t e r s o f r i b o s o m a l RNA , r i b o s o m a l p r o t e i n S I a n d r e c A p r o t e i n o p e r o n s f r o m E s c h e r i c h i a c o l i . N u c . A c i d s R e s . 11_: 3 8 6 3 - 3 8 8 8 . 1 2 6 . K a p l a n , R . , a n d D . A p i r i o n . 1 9 7 4 . T h e i n v o l v e m e n t o f r i b o n u c l e a s e I , r i b o n u c l e a s e I I a n d p o l y n u c l e o t i d e p h o s p h o r y l a s e i n t h e d e g r a d a t i o n o f s t a b l e r i b o n u c l e i c a c i d d u r i n g c a r b o n s t a r v a t i o n i n E_. c o l i . J . B i o l . C h e m . 2 4 9 : 1 4 9 - 1 5 1 . 1 2 7 . K a s t e l e i n , R . A . , B . B e r k h o u t , G . P . O v e r b e e k , a n d J . v a n D u i n . 1 9 8 3 . E f f e c t o f t h e r i b o s o m e - b i n d i n g s i t e o n t h e y i e l d o f p r o t e i n f r o m t h e c l o n e d g e n e f o r p h a g e MS2 c o a t p r o t e i n . G e n e J3_: 2 4 5 - 2 5 4 . 1 2 8 . K a s u n i c , D . A . , a n d S . R . K u s h n e r . 1 9 8 0 . E x p r e s s i o n o f t h e H I S 3 g e n e o f S a c c h a r o m y c e s c e r e v i s i a e i n p o l y n u c l e o t i d e p h o s p h o r y l a s e - d e f i c i e n t s t r a i n s o f E s c h e r i c h i a c o l i . G e n e 1 2 : 1 - 1 0 . 1 1 8 . 1 2 9 . K e n n e l l , D . , a n d H . R i e z m a n . 1 9 7 7 . T r a n s c r i p t i o n a n d t r a n s l a t i o n i n i t i a t i o n f r e q u e n c i e s o f t h e E s c h e r i c h i a c o l i l a c o p e r o n . J . M o l e c . B i o l . 1 1 4 : 1 - 2 1 . 1 3 0 . K i n g , T . C . , a n d D . S c h l e s s i n g e r . 1 9 8 3 . S I n u c l e a s e m a p p i n g a n a l y s i s o f r i b o s o m a l RNA p r o c e s s i n g i n w i l d t y p e a n d p r o c e s s i n g d e f i c i e n t E s c h e r i c h i a c o l i . J . B i o l . C h e m . _258: 1 2 0 3 4 - 1 2 0 4 2 . 1 3 1 . K i n g s t o n , R . E . , a n d M . J . C h a m b e r l i n . 1 9 8 1 . P a u s i n g a n d a t t e n u a t i o n ° f i £ v i t r o t r a n s c r i p t i o n i n t h e r r n B o p e r o n o f E_. c o l i . C e l l 2 7 : 5 2 3 - 5 3 1 . 1 3 2 . K i t a k a w a , M . , E . R . D a b b s , a n d K . I s o n o . 1 9 7 9 . G e n e s c o d i n g f o r r i b o s o m a l p r o t e i n s S 1 5 , L 2 1 a n d L 2 7 map n e a r a r g G i n E_. c o l i . J . B a c t . 1 3 8 : 8 3 2 - 8 3 8 . 1 3 3 . K l e e m a n , J . E . , a n d S . M . P a r s o n s . 1 9 7 7 . I n h i b i t i o n o f h i s t i d y l - t R N A - a d e n o s i n e t r i p h o s p h a t e p h o s p h o r i b o s y l t r a n s f e r a s e c o m p l e x f o r m a t i o n b y h i s t i d i n e a n d b y g u a n o s i n e t e t r a p h o s p h a t e . P r o c . N a t l . A c a d . S c i . U . S . A . 74_: 1 5 3 5 - 1 5 3 7 . 1 3 4 . K o l b , A . , A . S p a s s k y , C . C h a p o n , B . B l a z y , a n d H . B u c . 1 9 8 3 . On t h e d i f f e r e n t b i n d i n g a f f i n i t i e s o f CRP a t t h e l a c g a l a n d m a l T p r o m o t e r r e g i o n s . N u c . A c i d s R e s . j L l : 7 8 3 3 - 7 8 5 2 . 1 3 5 . K r i s h n a , R . V . , a n d D . A p i r i o n . 1 9 7 3 . P o l y n u c l e o t i d e p h o s p h o r y l a s e h a s a r o l e i n g r o w t h o f JE. c o l i . J . B a c t . 1 1 3 : 1 2 3 5 - 1 2 3 9 . 1 3 6 . K u r i h a r a , T . , a n d Y . N a k a m u r a . 1 9 8 3 . C l o n i n g o f t h e n u s A g e n e o f E s c h e r i c h i a c o l i . M o l e c . G e n . G e n e t . 1 9 0 : 1 8 9 - 1 9 5 . 1 3 7 . K u w a n o , M . , D . S c h l e s s i n g e r , a n d D . A p i r i o n . 1 9 7 0 . R i b o n u c l e a s e V o f E s c h e r i c h i a c o l i I V . E x o n u c l e o l y t i c c l e a v a g e i n t h e 5 ' t o 3 ' d i r e c t i o n w i t h p r o d u c t i o n o f 5 ' - n u c l e o t i d e m o n o p h o s p h a t e s . J . M o l e c . B i o l . _51 : 7 5 - 8 2 . 1 3 8 . L a e m m l i , U . K . . 1 9 7 0 . C l e a v a g e o f s t r u c t u r a l p r o t e i n s d u r i n g t h e a s s e m b l y o f t h e h e a d o f b a c t e r i o p h a g e T 4 . N a t u r e ( L o n d o n ) 2 2 7 : 6 8 0 - 6 8 5 . 1 3 9 . L e m a i r e , G . , L . G o l d , a n d M . Y a r u s . 1 9 7 8 . A u t o g e n o u s t r a n s l a t i o n a l r e p r e s s i o n o f b a c t e r i o p h a g e T4 g e n e 32 e x p r e s s i o n i n v i t r o . J . M o l e c . B i o l . 12JL : 7 3 - 9 0 . 1 4 0 . L e n g y e l , P . 1 9 7 4 . T h e P r o c e s s o f T r a n s l a t i o n : A B i r d ' s e y e v i e w . I n R i b o s o m e s ( N o m u r a , M . , T i s s i e r e s , A . , a n d L e n g y e l , P . , e d s . ) , C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N . Y . , p p 1 3 - 5 2 . 1 4 1 . L e v i n , D . H . , M . N . T h a n g , a n d M . G r u n b e r g - M a n a g o . 1 9 6 3 . S y n t h e s i s i n  v i v o o f p o l y n u c l e o t i d e p h o p h o r y l a s e i n E. c o l i . I . E f f e c t o f a m i n o a c i d s o n p o l y n u c l e o t i d e p h o s p h o r y l a s e a c t i v i t y i n a c h l o r a m p h e n i c o l - i n h i b i t e d s t a t e . B i o c h i m . B i o p h y s . A c t a . 7 6 : 5 5 8 - 5 7 1 . 1 1 9 . 1 4 2 . L i e g e l , J . , a n d R .W. G u y n n . 1 9 7 9 . E q u i l i b r i u m c o n s t a n t s u n d e r p h y s i o l o g i c a l c o n d i t i o n s f o r t h e r e a c t i o n s o f p o l y n u c l e o t i d e p h o s p h o r y l a s e a n d RNA p o l y m e r a s e . J . B i o l . C h e m . 2 5 4 : 1 9 9 2 - 1 9 9 7 . 1 4 3 . L i g h t , J . , a n d S . M o l i n . 1 9 8 3 . P o s t - t r a n s c r i p t i o n a l c o n t r o l o f e x p r e s s i o n o f t h e r e p A g e n e o f p l a s m i d R I m e d i a t e d b y a s m a l l RNA m o l e c u l e . EMBO J . 2: 9 3 - 9 8 . 1 4 4 . L i m , L . W . , a n d D . K e n n e l l . 1 9 8 0 . E v i d e n c e f o r r a n d o m e n d o n u c l e o l y t i c c l e a v a g e s b e t w e e n m e s s a g e s i n d e c a y o f E . c o l i t r p mRNA. J . M o l e c . B i o l . 1 4 1 : 2 2 7 - 2 3 3 . ~~ 1 4 5 . L i n d a h l , L . , R. A t c h e r , a n d J . M . Z e n g e l . 1 9 8 3 . T r a n s c r i p t i o n o f t h e S 1 0 r i b o s o m a l p r o t e i n o p e r o n i s r e g u l a t e d b y a n a t t e n u a t o r i n t h e l e a d e r . C e l l J33: 2 4 1 - 2 4 8 . 1 4 6 . M a k i , H . , T . H o r i u c h i , a n d M . S e k i g u c h i . 1 9 8 3 . S t r u c t u r e a n d e x p r e s s i o n o f t h e dnaQ m u t a t o r a n d t h e R N A s e H g e n e s o f E s c h e r i c h i a  c o l i : o v e r l a p o f t h e p r o m o t e r r e g i o n s . P r o c . N a t l . A c a d . S c i . U . S . A . 80_: 7 1 3 7 - 7 1 4 1 . 1 4 7 . M a n i a t i s , T . , E . F . F r i t s c h , a n d J . S a r n b r o o k . 1 9 8 2 . M o l e c u l a r c l o n i n g , a l a b o r a t o r y m a n u a l . C o l d S p r i n g H a r b o r L a b o r a t o r y , N . Y . , U . S . A . 1 4 8 . M a s u k a t a , H . , a n d J . T o m i z a w a . 1 9 8 4 . E f f e c t s o f p o i n t m u t a t i o n s o n f o r m a t i o n a n d s t r u c t u r e o f t h e RNA p r i m e r f o r C o l E I DNA r e p l i c a t i o n . C e l l J36: 5 1 3 - 5 2 2 . 1 4 9 . M a t t h e w s , C . K . , a n d N . S . S i n h a . 1 9 8 2 . A r e DNA p r e c u r s o r s c o n c e n t r a t e d a t r e p l i c a t i o n s i t e s ? P r o c . N a t l . A c a d . S c i . U . S . A . 7 9 : 3 0 2 - 3 0 6 . 1 5 0 . M a y a u x , J - F , F a y a t , G . , F r o m a n t , M . , S p r i n g e r , M . , G r u n b e r g - M a n a g o , M . , S . B l a n q u e t . 1 9 8 3 . S t r u c t u r a l a n d t r a n s c r i p t i o n a l e v i d e n c e f o r r e l a t e d t h r S a n d i n f C e x p r e s s i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 8 0 : 6 1 5 2 - 6 1 5 6 . 1 5 1 . M e s s i n g , J . 1 9 7 9 . A m u l t i - p u r p o s e c l o n i n g s y s t e m b a s e d o n s i n g l e - s t r a n d e d DNA b a c t e r i o p h a g e M 1 3 . R e c o m b i n a n t DNA T e c h n i c a l B u l l e t i n , N I H P u b l i c a t i o n N o . 9 9 - 9 9 , 2: 4 3 - 4 8 . 1 5 2 . M e s s i n g , J . 1 9 8 0 . A M a n u a l f o r t h e u s e o f Ml3mp2 a n d d e r i v a t i v e s . U n i v e r s i t y o f M i n n e s o t a , S t . P a u l , U . S . A . p p . 1 - 1 8 . 1 5 3 . M e s s i n g , J . 1 9 8 1 . M13mp2 a n d d e r i v a t i v e s : a m o l e c u l a r c l o n i n g s y s t e m f o r DNA s e q u e n c i n g , s t r a n d s p e c i f i c h y b r i d i z a t i o n a n d i n v i t r o m u t a g e n e s i s . I n P r o c e e d i n g s o f t h e T h i r d C l e v e l a n d S y m p o s i u m o n M a c r o m o l e c u l e s ( W a l t o n , A . G . , E d . ) , E l s e v i e r , A m s t e r d a m , p p . 1 4 3 - 1 5 3 . 1 5 4 . M i l l e r , J . H . 1 9 7 2 . E x p e r i m e n t s i n M o l e c u l a r G e n e t i c s . C o l d S p r i n g H a r b o r L a b o r a t o r y , New Y o r k . 1 2 0 . 1 5 5 . M i s r a , R . K . , a n d D . A p i r i o n . R N a s e E , a n RNA p r o c e s s i n g e n z y m e f r o m E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 2 5 4 : 1 1 1 5 4 - 1 1 1 5 9 . 1 5 6 . M i u r a , A . , J . H . K r u e g e r , S . I t o h , H . A . d e B o e r , a n d M . N o m u r a . 1 9 8 1 . G r o w t h - r a t e d e p e n d e n t r e g u l a t i o n o f r i b o s o m e s y n t h e s i s i n E_. c o l i : e x p r e s s i o n o f t h e l a c Z a n d g a l K g e n e s f u s e d t o r i b o s o m a l p r o m o t e r s . C e l l _2_5: 7 7 3 - 7 8 2 . 1 5 7 . M i z u n o , T . , M - Y . C h o u , a n d M . I n o u y e . 1 9 8 4 . A u n i q u e m e c h a n i s m r e g u l a t i n g g e n e e x p r e s s i o n : t r a n s l a t i o n a l i n h i b i t i o n b y a c o m p l e m e n t a r y RNA t r a n s c r i p t ( m i c R N A ) . P r o c . N a t l . A c a d . S c i . U . S . A . 81: 1 9 6 6 - 1 9 7 0 . 1 5 8 . M o r i n a g a , T . , F u n a t s u , G . , F u n a t s u , M . , a n d W i t t m a n , H . G . 1 9 7 6 . P r i m a r y s t r u c t u r e o f t h e 16S r R N A b i n d i n g p r o t e i n S 1 5 f r o m E s c h e r i c h i a c o l i r i b o s o m e s . F E B S L e t t . 6 4 : 3 0 7 - 3 0 9 . 1 5 9 . M o r s e , D . E . , R . D . M o s t e l l e r , a n d C . Y a n o f s k y . 1 9 6 9 . D y n a m i c s o f s y n t h e s i s , t r a n s l a t i o n , a n d d e g r a d a t i o n o f t r p o p e r o n m e s s e n g e r RNA i n E_. c o l i . C o l d S p r i n g H a r b o r S y m p . Q u a n t . B i o l . 34_: 7 2 5 - 7 4 0 . 1 6 0 . N a k a m u r a , K . , a n d M . I n o u y e . 1 9 7 9 . DNA s e q u e n c e o f t h e g e n e f o r t h e o u t e r m e m b r a n e l i p o p r o t e i n o f E_. c o l i : a n e x t r e m e l y A T - r i c h p r o m o t e r . C e l l 18: 1 1 0 9 - 1 1 1 7 . 1 6 1 . N a k a m u r a , Y . , a n d H . U c h i d a . 1 9 8 3 . I s o l a t i o n o f c o n d i t i o n a l l y l e t h a l a m b e r m u t a t i o n s a f f e c t i n g s y n t h e s i s o f t h e n u s A p r o t e i n o f E s c h e r i c h i a c o l i . M o l e c . G e n . G e n e t . 1 9 0 : 1 9 6 - 2 0 3 " 1 6 2 . N a t o r i , S . , Y . Y o g o , a n d D . M i z u n o . 1 9 6 7 . I n h i b i t i o n b y o l i g o n u c l e o t i d e s o f t h e a u t o d e g r a d a t i o n o f r i b o s o m a l a n d m e s s e n g e r RNA i n c e l l f r e e p r e p a r a t i o n s f r o m R N A s e l - l e s s b a c t e r i a . B i o c h i m . B i o p h y s . A c t a 1 4 5 : 6 2 1 - 6 2 8 . 1 6 3 . N a t o r i , S . , a n d D . M i z u n o . 1 9 6 7 . T u r n o v e r o f mRNA i n a R N a s e l - l e s s m u t a n t o f E_. c o l i Q 1 3 , w h i c h wa s f o u n d t o p o s s e s s P N P a s e . B i o c h i m . B i o p h y s . A c t a J A 5 : 3 2 8 - 3 3 6 . 1 6 4 . N a v r e , M . , a n d H . K . S c h a c h m a n . 1 9 8 3 . S y n t h e s i s o f a s p a r t a t e t r a n s c a r b a m o y l a s e i n E_. c o l i : t r a n s c r i p t i o n a l r e g u l a t i o n o f t h e p y r B - p y r l o p e r o n . P r o c . N a t l . A c a d . S c i . U . S . A . _80: 1 2 0 7 - 1 2 1 1 . 1 6 5 . N e f f , N . F . , a n d M . J . C h a m b e r l i n . 1 9 7 8 . T e r m i n a t i o n o f t r a n s c r i p t i o n b y E s c h e r i c h i a c o l i RNA p o l y m e r a s e i n v i t r o i s a f f e c t e d b y r i b o n u c l e o s i d e t r i p h o s p h a t e a n a l o g u e s . J . M o l e c . B i o l . 2 5 3 : 2 4 5 5 - 2 4 6 0 . 1 6 6 . N e i d h a r d t , F . C . , R . W i r t h , M.W. S m i t h , a n d R . v a n B o g e l e n . 1 9 8 0 . S e l e c t i v e s y n t h e s i s o f p l a s m i d - c o d e d p r o t e i n s b y E_. c o l i d u r i n g r e c o v e r y f r o m c h l o r a m p h e n i c o l t r e a t m e n t . J . B a c t . 1 4 3 : 5 3 5 - 5 3 7 . 1 2 1 . 1 6 7 . N e l s o n , D . E . , a n d D . R . Z u s m a n . 1 9 8 3 . E v i d e n c e f o r l o n g - l i v e d mRNA d u r i n g f r u i t i n g b o d y f o r m a t i o n i n m x o c o c c u s x a n t h u s . P r o c . N a t l . A c a d . S c i . U . S . A . 8 0 : 1 4 6 7 - 1 4 7 1 . 1 6 8 . N i e r l i c h , D . P . , a n d W. V i e l m e t t e r . 1 9 6 8 . K i n e t i c s t u d i e s o n t h e r e l a t i o n s h i p o f r i b o n u c l e o t i d e p r e c u r s o r p o o l s a n d r i b o n u c l e i c a c i d s y n t h e s i s . J . M o l e c . B i o l . 32: 1 3 5 - 1 4 7 . 1 6 9 . N i e r l i c h , D . P . 1 9 7 8 . R e g u l a t i o n o f b a c t e r i a l g r o w t h , RNA a n d p r o t e i n s y n t h e s i s . A n n . R e v . M i c r o b i o l . _32: 3 9 3 - 4 3 2 . 1 7 0 . N o m u r a , M . , a n d W . A . H e l d . 1 9 7 4 . R e c o n s t i t u t i o n o f R i b o s o m e s . I n " R i b o s o m e s " ( M . N o m u r a , A . T i s s i e r e s , P . L e n g y e l , e d s . ) , C o l d S p r i n g H a r b o r , New Y o r k , p p 1 9 3 - 2 2 4 . 1 7 1 . N o m u r a , M . , J . L . Y a t e s , D . D e a n , a n d L . E . P o s t . 1 9 8 0 . F e e d b a c k r e g u l a t i o n o f r i b o s o m a l p r o t e i n g e n e e x p r e s s i o n i n E s c h e r i c h i a c o l i : s t r u c t u r a l h o m o l o g y o f r i b o s o m a l RNA a n d r i b o s o m a l p r o t e i n mRNA. P r o c . N a t l . A c a d . S c i . U . S . A . 77_: 7 0 8 4 - 7 0 8 8 . 1 7 2 . N b t h l i n g , R . , a n d J . N . R e e v e . 1 9 8 0 . P r o t e i n s y n t h e s i s r e s u l t s i n g u a n o s i n e - 5 ' - d i p h o s p h a t e - 3 ' d i p h o s p h a t e s y n t h e s i s i n E s c h e r i c h i a c o l i m i w i c e l l s . J . B a c t . U3: 1 0 6 0 - 1 0 6 2 . 1 7 3 . N y , R . , a n d G . R . B j o r k . 1 9 8 0 . C l o n i n g a n d r e s t r i c t i o n m a p p i n g o f t h e t r m A g e n e c o d i n g f o r t r a n s f e r r i b o n u c l e i c a c i d ( - 5 - m e t h y l u r i d i n e ) - m e t h y l t r a n s f e r a s e i n E_. c o l i K - 1 2 . J . B a c t . 1 4 2 : 3 7 1 - 3 7 9 . 1 7 4 . O k a , A . , H . S u g i s a k i , a n d M . T a k a n a m i . 1 9 8 1 . N u c l e o t i d e s e q u e n c e o f t h e k a n a m y c i n r e s i s t a n c e t r a n s p o s o n T n 9 0 3 . J . M o l e c . B i o l . 1 4 7 : 2 1 7 - 2 2 6 . 1 7 5 . O l i n s , P . O . , a n d M . N o m u r a . 1 9 8 1 . R e g u l a t i o n o f t h e S 1 0 r i b o s o m a l p r o t e i n o p e r o n i n E . c o l i : n u c l e o t i d e s e q u e n c e a t t h e s t a r t o f t h e o p e r o n . C e l l 26_: 2 0 5 - 2 1 1 . 1 7 6 . O l i n s , P . O . , B . D . E r i c k s o n , a n d R. R. B u r g e s s . 1 9 8 3 . O v e r p r o d u c t i o n o f E s c h e r i c h i a c o l i N u s A p r o t e i n . G e n e 2_6_: 1 1 - 1 8 . 1 7 7 . O l i n s , P . O . , a n d M . N o m u r a . 1 9 8 1 . T r a n s l a t i o n a l r e g u l a t i o n b y r i b o s o m a l p r o t e i n S8 i n E s c h e r i c h i a c o l i : s t r u c t u r a l h o m o l o g y b e t w e e n r R N A b i n d i n g s i t e a n d f e e d b a c k t a r g e t o n mRNA. N u c . A c i d s R e s . j ) : 1 7 5 7 - 1 7 6 4 . 1 7 8 . O l s o n , E . R . , E . L . F l a m m , a n d D . I . F r i e d m a n . 1 9 8 2 . A n a l y s i s o f n u t R : a r e g i o n o f p h a g e l a m b d a r e q u i r e d f o r a n t i t e r m i n a t i o n o f t r a n s c r i p t i o n . C e l l _ 3 1 : 6 1 - 7 0 . 1 7 9 . O n o , M . , a n d M . K u w a n o . 1 9 7 9 . A c o n d i t i o n a l l e t h a l m u t a t i o n i n a n —• c ° l i s t r a i n w i t h a l o n g e r c h e m i c a l h a l f - l i v e o f mRNA. J . M o l e c . B i o l . 1 2 9 : 3 4 3 - 3 5 7 . 1 2 2 . 1 8 0 . O n o , M . , a n d M . K u w a n o . 1 9 8 0 . C h r o m o s o m a l l o c a t i o n o f a g e n e f o r c h e m i c a l l o n g e v i t y o f mRNA i n a t e m p e r a t u r e - s e n s i t i v e m u t a n t o f E_. c o l i . J . B a c t . 1 4 2 : 3 2 5 - 3 2 6 . 1 8 1 . P a l a t n i k , C . M . , C . W i l k i n s , a n d A . J a c o b s e n . 1 9 8 4 . T r a n s l a t i o n a l c o n t r o l d u r i n g e a r l y d i c t y o s t e l i u m d e v e l o p m e n t : p o s s i b l e i n v o l v e m e n t o f p o l y ( A ) s e q u e n c e s . C e l l _36: 1 0 1 7 - 1 0 2 5 . 1 8 2 . P a n g a n i b a n , A . T . , a n d H . R . W h i t e l e y . 1 9 8 3 . B a c i l l u s s u b t i l i s R N a s e l l l c l e a v a g e s i t e s i n p h a g e S P 0 2 e a r l y mRNA. C e l l _33_: 9 0 7 - 9 1 3 . 1 8 3 . P a o , C . C . , a n d J . G a l l a n t . 1 9 7 9 . A new n u c l e o t i d e i n v o l v e d i n t h e s t r i n g e n t r e s p o n s e i n E s c h e r i c h i a c o l i . J . B i o l . C h e m . 2 5 4 : 6 8 8 - 6 9 2 . 1 8 4 . P e s t k a , S i d n e y . 1 9 7 7 . I n h i b i t o r s o f p r o t e i n s y n t h e s i s . I n M o l e c u l a r M e c h a n i s m s o f P r o t e i n B i o s y n t h e s i s ( H e r b e r t W e i s s b a c h a n d S i d n e y P e s t k a , e d s . ) , A c a d e m i c P r e s s , I n c . , p p . 4 6 8 - 5 5 2 . 1 8 5 . P e t e s , T . D . 1 9 8 0 . U n e q u a l m e i o t i c r e c o m b i n a t i o n w i t h i n t a n d e m a r r a y s o f y e a s t r i b o s o m a l DNA g e n e s . C e l l 1 9 : 7 6 5 - 7 7 4 . 1 8 6 . P f e n n i g - Y e h , M . , H . P o n t a , M . H i r s c h K a u f f m a n n , H . R a h n s d o r f , P . H e i n l i c h , a n d M . S c h w e i g e r . 1 9 7 8 . E a r l y T7 g e n e e x p r e s s i o n . R a t e s o f RNA s y n t h e s i s a n d d e g r a d a t i o n , p r o t e i n k i n a s e d e p e n d e n t t e r m i n a t i o n o f t r a n s c r i p t i o n , a n d e f f i c i e n c y o f t r a n s l a t i o n . M o l e c . G e n . G e n e t . 1 6 6 : 1 2 7 - 1 4 0 . 1 8 7 . P i k i e l n y , C . W . , J . L . T e e m , a n d M . R o s b a c h . 1 9 8 3 . E v i d e n c e f o r t h e b i o c h e m i c a l r o l e o f a n i n t e r n a l s e q u e n c e i n t h e y e a s t n u c l e a r mRNA i n t r a n s : i m p l i c a t i o n s f o r U l RNA a n d m e t a z o a n mRNA s p l i c i n g . C e l l 34_: 3 9 5 - 4 0 3 . 1 8 8 . P l a s t e r k , R . H . A . , M . V o l l e r i n g , A . , B r i n k m a n , a n d P . V a n d e P u t t e . 1 9 8 4 . A n a l y s i s o f t h e m e t h y l a t i o n - r e g u l a t e d Mu mom t r a n s c r i p t . C e l l 3 6 : 1 8 9 - 1 9 6 . 1 8 9 . P i a t t , T . 1 9 8 1 . T e r m i n a t i o n o f t r a n s c r i p t i o n a n d i t s r e g u l a t i o n i n t h e t r y p t o p h a n o p e r o n o f E_. c o l i . C e l l 2 4 : 1 0 - 2 3 . 1 9 0 . P l a u t z , G . , a n d D . A p i r i o n . 1 9 8 1 . P r o c e s s i n g o f RNA i n E s c h e r i c h i a c o l i i s l i m i t e d i n t h e a b s e n c e o f r i b o n u c l e a s e I I I , r i b o n u c l e a s e E , a n d r i b o n u c l e a s e P . J . M o l e c . B i o l . 1 4 9 : 8 1 3 - 8 1 9 . 1 9 1 . P l u m b r i d g e , J . A . , J . G . H o w e , M . S p r i n g e r , D . T o u a t i - S c h w a r t z , J . W . B . H e r s h e y , a n d M . G r u n b e r g - M a n a g o . 1 9 8 2 . C l o n i n g a n d m a p p i n g o f a g e n e f o r t r a n s l a t i o n a l i n i t i a t i o n f a c t o r I F 2 i n E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 79: 5 0 3 3 - 5 0 3 7 . 1 9 2 . P l u m b r i d g e , J . A . , a n d M . S p r i n g e r . 1 9 8 3 . O r g a n i z a t i o n o f t h e E s c h e r i c h i a c o l i c h r o m o s o m e a r o u n d t h e g e n e s f o r t r a n s l a t i o n i n i t i a t i o n f a c t o r 1 F 2 ( i n f B ) a n d a t r a n s c r i p t i o n t e r m i n a t i o n f a c t o r ( n u s A ) . J . M o l e c . B i o l . 1 6 7 : 2 2 7 - 2 4 3 . 1 2 3 . 1 9 3 . P o l l o c k , T . J . , a n d I . T e s s m a n . 1 9 7 6 . U n i t s o f f u n c t i o n a l s t a b i l i t y i n b a c t e r i o p h a g e m e s s e n g e r R N A . J . M o l e c . B i o l . 1 0 8 : 6 5 1 - 6 6 4 . 1 9 4 . P o r t i e r , C , R. v a n R a p e n b u s c h , M . N . T h a n g , a n d M . G r u n b e r g - M a n a g o . 1 9 7 3 . Q u a t e r n a r y s t r u c t u r e o f p o l y n u c l e o t i d e p h o s p h o r y l a s e f r o m E . c o l i . E u r . J . B i o c h e m . 40_: 7 7 - 8 7 . — 1 9 5 . P o r t i e r , C . 1 9 8 0 . I s o l a t i o n o f a p o l y n u c l e o t i d e p h o s p h o r y l a s e m u t a n t u s i n g a k a n a m y c i n r e s i s t a n t d e t e r m i n a n t . M o l e c . G e n . G e n e t . 1 7 8 : 3 4 3 - 3 4 9 . 1 9 6 . P o r t i e r , C . , C . M i g o t , a n d M . G r u n b e r g - M a n a g o . 1 9 8 1 . C l o n i n g o f E . c o l i p n p g e n e f r o m a n e p i s o m e . M o l e c . G e n . G e n e t . 1 8 3 : 2 9 8 - 3 0 5 . 1 9 7 . P o r t i e r , C . 1 9 8 2 . P h y s i c a l l o c a l i s a t i o n a n d d i r e c t i o n o f t r a n s c r i p t i o n o f t h e s t r u c t u r a l g e n e o f E s c h e r i c h i a c o l i r i b o s o m a l p r o t e i n S 1 5 . G e n e _18: 2 6 1 - 2 6 6 . 1 9 8 . P o s t , L . E . , A . E . A r f s t e n , F . R e u s s e r , a n d M . N o m u r a . 1 9 7 8 . DNA s e q u e n c e s o f p r o m o t e r r e g i o n s f o r t h e s t r a n d s p c r i b o s o m a l p r o t e i n o p e r o n s i n E . c o l i . C e l l 15_: 2 1 5 - 2 2 9 . 1 9 9 . P o s t , L . E . , A . E . A r f s t e n , a n d M . N o m u r a . 1 9 7 8 . I s o l a t i o n a n d c h a r a c t e r i z a t i o n o f a p r o m o t e r m u t a n t i n t h e s t r r i b o s o m a l p r o t e i n o p e r o n i n JE. c o l i . C e l l L 5 : 2 3 1 - 2 3 6 . 2 0 0 . P o s t , L . E . , G . D . S t r y c h a r z , M . N o m u r a , H . L e w i s a n d P . D . D e n n i s . 1 9 7 9 . N u c l e o t i d e s e q u e n c e o f t h e r i b o s o m a l p r o t e i n g e n e c l u s t e r a d j a c e n t t o t h e g e n e f o r RNA p o l y m e r a s e s u b u n i t 6 i n E s c h e r i c h i a  c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . _7J>: 1 6 9 7 - 1 7 0 1 . 2 0 1 . P u r r e l l o , F . , D . B . B u r n h a m , a n d I . D . G o l d f i n e . 1 9 8 3 . I n s u l i n r e g u l a t i o n o f p r o t e i n p h o s p h o r y l a t i o n i n i s o l a t e d r a t l i v e r n u c l e a r e n v e l o p e s : p o t e n t i a l r e l a t i o n s h i p t o mRNA m e t a b o l i s m . P r o c . N a t l . A c a d . S c i . U . S . A . 8 0 : 1 1 8 9 - 1 1 9 3 . 2 0 2 . P r i m a k o f f , P . 1 9 8 1 . I n v i v o r o l e o f t h e r e l A + g e n e i n r e g u l a t i o n o f t h e l a c o p e r o n . J . B a c t . 1 4 5 : 4 1 0 - 4 1 6 . 2 0 3 . Q u e e n , C . , a n d M . R o s e n b e r g . 1 9 8 1 . D i f f e r e n t i a l t r a n s l a t i o n e f f i c i e n c y e x p l a i n s d i s c o o r d i n a t e e x p r e s s i o n o f t h e g a l a c t o s e o p e r o n . C e l l 25_: 2 4 1 - 2 4 9 . 2 0 4 . R a p a p o r t , E . , S . K . S v i h o v e c , a n d P . C . Z a m e c r i v e . 1 9 7 5 . R e l a t i o n s h i p o f t h e f i r s t s t e p i n p r o t e i n s y n t h e s i s t o p p G p p : f o r m a t i o n o f A ( 5 ' ) p p p ( 5 ' ) G p p . P r o c . N a t l . A c a d . S c i . U . S . A . 12\ 2 6 5 3 - 2 6 5 7 . 2 0 5 . R a y , A . , a n d D . A p i r i o n . 1 9 8 0 . C l o n i n g t h e g e n e f o r r i b o n u c l e a s e E , a n RNA p r o c e s s i n g e n z y m e . G e n e 1 2 : 8 7 - 9 4 . 124. 206. R e e d , R . E . , a n d A l t m a n , S . 1983. R e p e a t e d s e q u e n c e s a n d o p e n r e a d i n g f r a m e s i n t h e 3' f l a n k i n g r e g i o n o f t h e g e n e f o r t h e RNA s u b u n i t o f E s c h e r i c h i a c o l i r i b o n u c l e a s e P . P r o c . N a t l . A c a d . S c i . U . S . A . 80: 5359-5363. 207. R e i n e r , A . M . 1969. I s o l a t i o n a n d m a p p i n g o f p o l y n u c l e o t i d e p h o s p h o r y l a s e m u t a n t s o f E_. c o l i . J . B a c t . 97: 1431-1436. 208. R e i n e r , A . M . 1969. C h a r a c t e r i s a t i o n o f p o l y n u c l e o t i d e p h o s p h o r y l a s e m u t a n t s o f E . c o l i . J . B a c t . 97_: 1437-1443. 209. R i c h t e r , D . 1980. U n c h a r g e d t R N A i n h i b i t s g u a n o s i n e 3',5 ' - b i s ( d i p h o s p h a t e ) - 3 ' - p y r o p h o s p h o h y d r o l a s e [ p p G p p A s e ] , t h e s p o T g e n e p r o d u c t f r o m E s c h e r i c h i a c o l i . M o l e c . G e n . G e n e t . 178: 325-327. 210. R i t z e n t h a l e r , P . , a n d M . M a t a - G i l s i n g e r . 1982. U s e o f i n v i t r o g e n e f u s i o n s t o s t u d y t h e u x u R r e g u l a t o r y g e n e i n E s c h e r i c h i a c o l i K-12: d i r e c t i o n o f t r a n s c r i p t i o n a n d r e g u l a t i o n o f i t s e x p r e s s i o n . J . B a c t . 150: 1040-1047. 211. R o b e r t s o n , H . D . 1982. E s c h e r i c h i a c o l i r i b o n u c l e a s e I I I c l e a v a g e s i t e s . C e l l 30_: 669-672. 212. R o s e , K . M . , D . A . S t e t l e r , a n d S.T. J a c o b . 1981. P r o t e i n k i n a s e a c t i v i t y o f RNA p o l y m e r a s e I p u r i f i e d f r o m a r a t h e p a t o m a : p r o b a b l e f u n c t i o n o f M r 42,000 a n d 24,600 p o l y p e p t i d e s . P r o c . N a t l . A c a d . S c i . U . S . A . 7_8_: 2833-2837. 213. R o s e n b e r g , M . , a n d D . C o u r t . 1979. R e g u l a t o r y s e q u e n c e s i n v o l v e d i n t h e p r o m o t i o n a n d t e r m i n a t i o n o f RNA t r a n s c r i p t i o n . A n n . R e v . G e n e t . 13: 319-353. 214. R o s s , J . , a n d A . P i z a r r o . 1983. Human b e t a a n d d e l t a g l o b i n m e s s e n g e r RNAs t u r n o v e r a t d i f f e r e n t r a t e s . J . M o l e c . B i o l . 167: 607-617. 215. R o t h s t e i n , S . J . , R . A . J o r g e n s e n , K . P o s t l e , a n d W . S . R e z n i k o f f . 1980. T h e i n v e r t e d r e p e a t s o f Tn5 a r e f u n c t i o n a l l y d i f f e r e n t . C e l l 19: 795-805. 216. R o y , A . , C . H a z i z a , a n d A . D a n c h i n . 1983. R e g u l a t i o n o f a d e n y l a t e c y c l a s e s y n t h e s i s i n E s c h e r i c h i a c o l i n u c l e o t i d e s e q u e n c e o f t h e c o n t r o l r e g i o n . EMBO J . 2: 791-797. 217. R y a j i , M . , R. B o r l a n d , a n d A . K a j i . 1981. R e i n i t i a t i o n o f t r a n s l a t i o n f r o m t h e t r i p l e t n e x t t o t h e a m b e r t e r m i n a t i o n c o d o n i n t h e a b s e n c e o f r i b o s o m e - r e l e a s i n g f a c t o r . P r o c . N a t l . A c a d . S c i . U . S . A . J78: 5973-5977. 218. S a i t o , H . , a n d C . C . R i c h a r d s o n . 1981. P r o c e s s i n g o f mRNA b y r i b o n u c l e a s e I I I r e g u l a t e s e x p r e s s i o n o f g e n e 1.2 o f b a c t e r i o p h a g e T7. C e l l 27: 533-542. 1 2 5 . 2 1 9 . S a k a m o t o , H . , N . K i m u r a , F . N a g a w a , a n d Y . S h i m u r a . 1 9 8 3 . N u c l e o t i d e s e q u e n c e a n d s t a b i l i t y o f t h e RNA c o m p o n e n t o f R N a s e P f r o m a t e m p e r a t u r e s e n s i t i v e m u t a n t o f E . c o l i . N u c . A c i d s R e s . 1 1 : 8 2 3 7 - 8 2 5 1 . ~~ 2 2 0 . S a k a m o t o , H . , K i m u r a , N . a n d Y . S h i m u r a . 1 9 8 3 . P r o c e s s i n g o f t r a n s c r i p t i o n p r o d u c t s o f t h e g e n e e n c o d i n g t h e RNA c o m p o n e n t o f R N a s e P . P r o c . N a t l . A c a d . S c i . U . S . A . _80: 6 1 8 7 - 6 1 9 1 . 2 2 1 . S a n c a r , A . , A . M . H a c k , a n d W . D . R u p p . 1 9 7 9 . S i m p l e m e t h o d f o r i d e n t i f i c a t i o n o f p l a s m i d - c o d e d p r o t e i n s . J . B a c t . 1 3 7 : 6 9 2 - 6 9 3 . 2 2 2 . S a n g e r , F . , S . W i c k l e n , a n d A . R . C o u o l s o n . 1 9 7 7 . DNA s e q u e n c i n g w i t h c h a i n - t e r m i n a t i n g i n h i b i t o r s . P r o c . N a t l . A c a d . S c i . U . S . A . 7 4 : 5 4 6 3 - 5 4 6 7 . 2 2 3 . S a n z e y , B . 1 9 7 9 . M o d u l a t i o n o f g e n e e x p r e s s i o n b y d r u g s a f f e c t i n g d e o x y r i b o n u c l e i c a c i d g y r a s e . J . B a c t . 1 3 8 : 4 0 - 4 7 . 2 2 4 . S a r m i e n t o s , P . , a n d M . C a s h e l . 1 9 8 3 . C a r b o n s t a r v a t i o n a n d g r o w t h r a t e - d e p e n d e n t r e g u l a t i o n o f t h e E s c h e r i c h i a c o l i r i b o s o m a l RNA p r o m o t e r s : d i f f e r e n t i a l c o n t r o l o f d u a l p r o m o t e r s . P r o c . N a t l . A c a d . S c i . U . S . A . 80_: 7 0 1 0 - 7 0 1 3 . 2 2 5 . S a r m i e n t o s , P . , J . E . S y l v e s t e r , S . C o n t e n t e , a n d M . C a s h e l . 1 9 8 3 . D i f e r e n t i a l s t r i n g e n t c o n t r o l o f t h e t a n d e m E_. c o l i r i b o s o m a l RNA p r o m o t e r s f r o m t h e r r n A o p e r o n e x p r e s s e d i n v i v o i n m u l t i c o p y p l a s m i d s . C e l l 32^: 1 3 3 7 - 1 3 4 6 . 2 2 6 . S c h n e i d e r , E . , M . B l u n d e l l , a n d D . K e n n e l l . 1 9 7 8 . T r a n s l a t i o n a n d mRNA d e c a y . M o l e c . G e n . G e n e t . 1 6 0 : 1 2 1 - 1 2 9 . 2 2 7 . S c h n e i d e r , T . D . , G . D . S t o r m o , J . S . H a e m e r , a n d L . G o l d . 1 9 8 2 . A d e s i g n f o r c o m p u t e r n u c l e i c - a c i d - s e q u e n c e s t o r a g e , r e t r i e v a l , a n d m a n i p u l a t i o n . N u c . A c i d s R e s . J L0 : 3 0 1 3 - 3 0 2 5 . 2 2 8 . S c h n i e r , J . a n d K . I s o n o . 1 9 8 2 . T h e DNA s e q u e n c e o f t h e g e n e r p s A o f E s c h e r i c h i a c o l i c o d i n g f o r r i b o s o m a l p r o t e i n S I . N u c . A c i d s R e s . 1 0 : 1 8 5 7 - 1 8 6 5 . 2 2 9 . S c h l i m p e r l i , D . , K . M c K e n n e y , D . A . S o b i e s k i , a n d M . R o s e n b e r g . 1 9 8 2 . T r a n s l a t i o n a l c o u p l i n g a t a n i n t e r c i s t r o n i c b o u n d a r y o f t h e E s c h e r i c h i a c o l i g a l a c t o s e o p e r o n . C e l l J30 : 8 6 5 - 8 7 1 . 230, . S e i d m a n , J . G . , F . J . S c h m i d t , K . F o s s , a n d W . H . M c C l a i n . 1 9 7 5 . A m u t a n t o f E s c h e r i c h i a c o l i d e f e c t i v e i n r e m o v i n g 3 ' t e r m i n a l n u c l e o t i d e s f r o m some t r a n s f e r RNA p r e c u r s o r m o l e c u l e s . C e l l 5_: 3 8 9 - 4 0 0 , 2 3 1 . S e k i g u c h i , M . , a n d S . S . C o h e n . 1 9 6 3 . T h e s e l e c t i v e d e g r a d a t i o n o f p h a g e - i n d u c e d r i b o n u c l e i c a c i d b y P N P a s e . J . B i o l . C h e m . 2 3 8 : 3 4 9 - 3 5 6 . 1 2 6 . 2 3 2 . S e r d y u k , I . N . , S . C . A g a l a y o v , S . E . S e d e l n i k o v a , A . S . S p i r i n , a n d R . P . M a y . 1 9 8 3 . S h a p e a n d c o m p a c t n e s s o f t h e i s o l a t e d r i b o s o m a l 16S RNA a n d i t s c o m p l e x e s w i t h r i b o s o m a l p r o t e i n s . J . M o l e c . B i o l . 1 6 9 : 4 0 9 - 4 2 5 . 2 3 3 . S h e n , V . , F . I m a m o t o , a n d D . S c h l e s s i n g e r , 1 9 8 2 . R N a s e l l l c l e a v a g e o f E s c h e r i c h i a c o l i fci-galactosidase a n d t r y p t o p h a n o p e r o n mRNA. J . B a c t . 1 5 0 : 1 4 8 9 - 1 4 9 4 . 2 3 4 . S h i n e , J . , a n d L . D a l g a r n o . 1 9 7 4 . T h e 3 ' - t e r m i n a l s e q u e n c e o f E s c h e r i c h i a c o l i 1 6S r i b o s o m a l RNA : c o m p l e m e n t a r i t y t o n o n s e n s e t r i p l e t s a n d r i b o s o m e b i n d i n g s i t e s . P r o c . N a t l . A c a d . S c i . U . S . A . 71_: 1 3 4 2 - 1 3 4 6 . 2 3 5 . S i m o n s , R . W . , a n d N . K l e c k n e r . 1 9 8 3 . T r a n s l a t i o n a l c o n t r o l o f I S 1 0 t r a n s p o s i t i o n . C e l l 34_: 6 8 3 - 6 9 1 . 2 3 6 . S i m o n s , R . W . , H o o p e s , B . C . , M c C l u r e , W . R . , a n d N . K l e c k n e r . 1 9 8 3 . T h r e e p r o m o t e r s n e a r t h e t e r m i n i o f I S 1 0 : p l N , pOUT , a n d p i l l . C e l l 3 4 : 6 7 3 - 6 8 2 . 2 3 7 . S m i t h , H a m i l t o n 0 . , a n d M . L . B i r n s t i e l . 1 9 7 6 . A s i m p l e m e t h o d f o r DNA r e s t r i c t i o n s i t e m a p p i n g . N u c . A c i d s R e s . 4 : 2 3 8 7 - 2 3 9 8 . 2 3 8 . S o r e q , H . , a n d U . Z . L i t t a u e r . 1 9 7 7 . P u r i f i c a t i o n a n d c h a r a c t e r i s a t i o n o f p o l y n u c l e o t i d e p h o s p h o r y l a s e f r o m E_. c o l i . J . B i o l . C h e m . 2 5 2 : 6 8 8 5 - 6 8 8 8 . 2 3 9 . S p a h r , P . F . , a n d B . R . H o l l i n g w o r t h . 1 9 6 1 . P u r i f i c a t i o n a n d m e c h a n i s m o f a c t i o n o f r i b o n u c l e a s e f r o m E s c h e r i c h i a c o l i r i b o s o m e s . J . B i o l . C h e m . 2 3 6 : 8 2 3 - 8 3 1 . 2 4 0 . S p a h r , P . F . 1 9 6 4 . P u r i f i c a t i o n a n d p r o p e r t i e s o f r i b o n u c l e a s e I I f r o m E s c h e r i c h i a c o l i . J . B i o l . C h e m . 2 3 9 : 3 7 1 6 - 3 7 2 6 . 2 4 1 . S q u i r e s , C , A . K r a i n e r , G . B a r r y , W - F . S h e n , a n d C . L . S q u i r e s . 1 9 8 1 . N u c l e o t i d e s e q u e n c e a t t h e e n d o f t h e g e n e f o r t h e RNA p o l y m e r a s e £ ' s u b u n i t ( r p o C ) . N u c . A c i d s R e s . 9 : 6 8 2 7 - 6 8 4 0 . 2 4 2 . S t a h l , D . A . , T . A . W a l k e r , B . M e y h a c k , a n d N . R . P a c e . 1 9 7 9 . P r e c u r s o r - s p e c i f i c n u c l e o t i d e s e q u e n c e s c a n g o v e r n RNA f o l d i n g . C e l l 1 8 : 1 1 3 3 - 1 1 4 3 . 2 4 3 . S t e f a n o , J a m e s E . , a n d J . D . G r a l l a . 1 9 8 2 . S p a c e r m u t a t i o n s i n t h e l a c p s p r o m o t e r . P r o c . N a t l . A c a d . S c i . U . S . A . 7 9 : 1 0 6 9 - 1 0 7 2 . 2 4 4 . S t e i t z , J . A . , a n d K . J a k e s . 1 9 7 5 . How r i b o s o m e s s e l e c t i n i t i a t o r r e g i o n s i n mRNA: B a s e p a i r f o r m a t i o n b e t w e e n t h e 3 ' t e r m i n u s o f 1 6 s r R N A a n d t h e mRNA d u r i n g i n i t i a t i o n o f p r o t e i n s y n t h e s i s i n E s c h e r i c h i a c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 7 2 : 4 7 3 4 - 4 7 3 8 . 1 2 7 . 2 4 5 . S t o f f l e r , G . , a n d H . G . W i t t m a n . 1 9 7 7 . P r i m a r y S t r u c t u r e a n d T h r e e - D i m e n s i o n a l A r r a n g e m e n t o f P r o t e i n s W i t h i n t h e E s c h e r i c h i a c o l i r i b o s o m e . I n M o l e c u l a r M e c h a n i s m s o f P r o t e i n B i o s y n t h e s i s ( W e i s s b a c h , H . a n d P e s t k a , S . , e d s . ) , A c a d e m i c P r e s s , N . Y . , p p . 1 1 7 - 1 9 5 . 2 4 6 . S t o r m o , G . D . , T . D . S c h n e i d e r , a n d L . M . G o l d . 1 9 8 2 . C h a r a c t e r i z a t i o n o f t r a n s l a t i o n a l i n i t i a t i o n s i t e s i n E_. c o l i . N u c . A c i d s R e s . 1 0 : 2 9 7 1 - 2 9 9 5 . 2 4 7 . S t o r m o , G . D . , T . D . S c h n e i d e r , L . G o l d , a n d A . E h r e n f e u c h t . 1 9 8 2 . U s e o f t h e ' p e r c e p t r o n ' a l g o r i t h m t o d i s t i n g u i s h t r a n s l a t i o n a l i n i t i a t i o n s i t e s i n _E. c o l i . N u c . A c i d s R e s . 1 0 : 2 9 9 7 - 3 0 1 0 . 2 4 8 . S t r a g i e r , P . , F . B o r n e , F . R i c h a u d , C . R i c h a u d , a n d J . - C . P a t t e . 1 9 8 3 . R e g u l a t o r y p a t t e r n o f t h e E s c h e r i c h i a c o l i l y s A g e n e : e x p r e s s i o n o f c h r o m o s o m a l l y s A - l a c Z f u s i o n s . J . B a c t . 1 5 6 : 1 1 9 8 - 1 2 0 3 . 2 4 9 . S t u d i e r , F . W . 1 9 7 5 . G e n e t i c m a p p i n g o f a m u t a t i o n t h a t c a u s e s r i b o n u c l e a s e I I I d e f i c i e n c y i n E s c h e r i c h i a c o l i . J . B a c t . 1 2 4 : 3 0 7 - 3 1 6 . 2 5 0 . S y p h e r d , P . S . , a n d J . A . D e M o s s . 1 9 6 3 . T h e s t i m u l a t i o n b y c h l o r a m p h e n i c o l o f " r e p r e s s o r " f o r m a t i o n i n E_. c o l i . B i o c h i m . B i o p h y s . A c t a 7±- 5 8 9 - 5 9 9 . 2 5 1 . T a k a t a , R . , M . A o y a g i , a n d T . , M u k a i . 1 9 8 2 . C l o n i n g o f r p s O , t h e g e n e f o r r i b o s o m a l p r o t e i n S 1 5 o f E s c h e r i c h i a c o l i . M o l e c . G e n . G e n e t . 1 8 8 : 3 3 4 - 3 3 7 . 2 5 2 . T a l k a d , V . , D . A c h o r d , a n d D . K e n n e l l . 1 9 7 8 . A l t e r e d mRNA m e t a b o l i s m i n r i b o n u c l e a s e I l l - d e f i c i e n t s t r a i n s o f E s c h e r i c h i a  c o l i . J . B a c t . 1 3 5 : 5 2 8 - 5 4 1 . 2 5 3 . T a n i , S . , a n d F . I m a m o t o . 1 9 7 5 . F u s i o n s o f t h e t r p a n d N m e s s a g e s y n t h e s i z e d o r i g i n a t i n g a t t h e Pj^ p r o m o t e r i n l a m b d a t r p p h a g e . J . M o l e c . B i o l . 92_: 3 0 5 - 3 0 9 . 2 5 4 . T h a n g , M . N . , F . R . W i l l i a m s , a n d M . G r u n b e r g - M a n a g o . 1 9 6 3 . S y n t h e s e i n v i v o d e l a p n p a s e c h e z E . c o l i I I . S y n t h e s e d e n o v o d e l a p n p a s e e n p r e s e n c e d e c h l o r a m p h e n i c o l . B i o c h i m . B i o p h y s . A c t a _76: 5 7 2 - 5 8 8 . 2 5 5 . T h a n g , M . N . , D . C . T h a n g , a n d M . G r u n b e r g - M a n a g o . 1 9 6 7 . A n a l t e r e d p n p a s e i n E . c o l i m u t a n t Q 1 3 . B i o c h i m . B i o p h y s . R e s . Comm. 2 8 : 3 7 4 - 3 7 8 . 2 5 6 . T h a n g , M . N . , D . C . T h a n g , a n d M . G r u n b e r g - M a n a g o . 1 9 6 9 . S t r u c t u r e e t a c t i v i t e d e l a p o l y n u c l e o t i d e p h o s p h o r y l a s e d 'E_ . c o l i : u n e e s p e c e a f a i b l e p o i d s m o l e c u l a i r e . E . J . B i o c h e m . j 3 : 5 7 7 - 5 9 0 . 2 5 7 . T h a n g , M . N . , a n d F . M e y e r . 1 9 7 1 . A c t i v a t i o n o f p n p a s e b y 3 ' - 5 ' - c y c l i c A M P , A T P - d e p e n d e n t p r o t e i n k i n a s e . F E B S L e t t . 1 3 : 3 4 5 - 3 4 8 . 1 2 8 . 2 5 8 . T h o m a s , D . Y . , G . D u b u c . , a n d S . N a r a n g . 1 9 8 2 . E s c h e r i c h i a c o l i p l a s m i d v e c t o r s c o n t a i n i n g s y n t h e t i c t r a n s l a t i o n a l i n i t i a t i o n s e q u e n c e s a n d r i b o s o m e b i n d i n g s i t e s f u s e d w i t h t h e l a c Z g e n e . G e n e 1 9 : 2 1 1 - 2 1 9 . 2 5 9 . T h u r l o w , D . L . , a n d R . A . Z i m m e r m a n n . 1 9 8 3 . S t r u c t u r a l f e a t u r e s o f 16S r R N A r e q u i r e d f o r s p e c i f i c c o m p l e x f o r m a t i o n w i t h p r o t e i n s S8 a n d S 1 5 f r o m E s c h e r i c h i a c o l i . F e d . P r o c . _42: 2 1 8 5 . 2 6 0 . T o m i z a w a , J - I , T . I t o h , G . S e l z e r , a n d T . S o m . 1 9 8 1 . I n h i b i t i o n o f C o l E l RNA p r i m e r f o r m a t i o n b y a p l a s m i d - s p e c i f i e d s m a l l RNA . B i o c h e m i s t r y 7_8: 1 4 2 1 - 1 4 2 5 . 2 6 1 . T r a b o n i , C . , G . C i l i b e r t o , a n d R. C o r t e s e . 1 9 8 4 . M u t a t i o n s i n b o x b o f t h e p r o m o t e r o f a e u k a r y o t i c t R N A ^ r o g e n e a f f e c t r a t e o f t r a n s c r i p t i o n , p r o c e s s i n g , a n d s t a b i l i t y o f t h e t r a n s c r i p t s . C e l l 36_: 1 7 9 - 1 8 7 . 2 6 2 . T r a v e r s , A . A . 1 9 8 0 . Why p p G p p ? N a t u r e 283_ : 1 6 . 2 6 3 . T r a v e r s , A . A . 1 9 8 0 . P r o m o t e r S e q u e n c e f o r s t r i n g e n t c o n t r o l o f b a c t e r i a l r i b o n u c l e i c a c i d s e q u e n c e . J . B a c t . 1 4 1 : 9 7 3 - 9 7 6 . 2 6 4 . T r a v e r s , A . A . , A . I . L a m o n d , H . A . F . M a c e , a n d M . L . B e r m a n . 1 9 8 3 . RNA p o l y m e r a s e i n t e r a c t i o n s w i t h t h e u p s t r e a m r e g i o n o f t h e E. c o l i t y r T p r o m o t e r . C e l l 35_: 2 6 5 - 2 7 3 . 2 6 5 . V a p n e k , D . , J . A . H a u t a l a , J . W . J a c o b s o n , N . H . G i l e s , a n d S . R . K u s h n e r . 1 9 7 7 . E x p r e s s i o n i n E_. c o l i K - 1 2 o f t h e s t r u c t u r a l g e n e f o r c a t a b o l i c d e h y d r o q u i n a s e o f _N. c r a s s a . P r o c . N a t l . A c a d . S c i . U . S . A . 74_: 3 5 0 8 - 3 5 1 2 . 2 6 6 . V a r s h a v s k y , A . 1 9 8 3 . D i a d e n o s i n e 5 ' , 5* " - P 1 , P " - t e t r a p h o s p h a t e : a p l e i o t r o p i c a l l y a c t i n g a l a r m o n e ? C e l l ^ 4 : 7 1 1 - 7 1 2 . 2 6 7 . V i e i r a , J . , a n d J . M e s s i n g . 1 9 8 2 . T h e pUC p l a s m i d s , a n M 1 3 m p 7 - d e r i v e d s y s t e m f o r i n s e r t i o n m u t a g e n e s i s a n d s e q u e n c i n g w i t h s y n t h e t i c u n i v e r s a l p r i m e r s . G e n e 1 9 : 2 5 9 - 2 6 8 . 2 6 8 . v o n G a b a i n , A . , J . G . B e l a s c o , J . L . S c h o t t e l , A . C . Y . C h a n g , a n d S . N . C o h e n . 1 9 8 3 . D e c a y o f mRNA i n E s c h e r i c h i a c o l i . I n v e s t i g a t i o n o f t h e f a t e o f s p e c i f i c s e g m e n t s o f t r a n s c r i p t s . P r o c . N a t l . A c a d . S c i . U . S . A . 8 0 : 6 5 3 - 6 5 7 . 2 6 9 . W a t s o n , M . 1 9 8 3 . T h e r o l e o f t h e p r o t e c t o r i n a t t e n u a t i o n . T r e n d s i n B i o c h e m . S c i . 8^ : 1 - 2 . 2 7 0 . W e i s s , R . B . , J . P . M u r p h y , a n d J . A . G a l l a n t . 1 9 8 4 . G e n e t i c S c r e e n f o r c l o n e d r e l e a s e f a c t o r g e n e s . J . B a c t . 1 5 8 : 3 6 2 - 3 6 4 . 2 7 1 . W h i p p , M . J . , a n d P i t t a r d , A . J . 1 9 7 1 . R e g u l a t i o n o f a r o m a t i c a m i n o a c i d t r a n s p o r t s y s t e m s i n E . c o l i K - 1 2 . J . B a c t . 1 3 2 : 4 5 3 - 4 6 1 . 1 2 9 . 2 7 2 . W i c k s t r o m , E r i c . 1 9 8 3 . N u c l e a s e m a p p i n g o f t h e s e c o n d a r y s t r u c t u r e o f t h e 49 n u c l e o t i d e 3 ' t e r m i n a l c l o a c i n f r a g m e n t o f E s c h e r i c h i a c o l i 1 6S RNA a n d i t s i n t e r a c t i o n s w i t h i n i t i a t i o n f a c t o r 3 . N u c . A c i d s R e s . _11: 2 0 3 5 - 2 0 5 2 . 2 7 3 . W i l l i a m s , M . V . , J . J . K e r r , R . D . L emmon , a n d G . J . T r i t z . 1 9 8 0 . A z a s e r i n e r e s i s t a n c e i n E_. c o l i : c h r o m o s o m a l l o c a t i o n o f m u l t i p l e g e n e s . J . B a c t . 1 4 3 : 3 8 3 - 3 8 8 . 2 7 4 . W i t t m a n , H . G . 1 9 7 4 . P u r i f i c a t i o n a n d i d e n t i f i c a t i o n o f E_. c o l i r i b o s o m a l p r o t e i n s . In R i b o s o m e s ( M . N o m u r a , A . T i s s i e r e s , a n d P . L e n g y e l , e d s . ) , C o l d S p r i n g H a r b o u r P r e s s , C o l d S p r i n g H a r b o u r , N . Y . , p . 9 3 - 1 1 4 . 2 7 5 . W o e s e , C . R . , L . J . M a g r u m , R. G u p t a , R . B . S i e g e l , a n d D . A . S t a h l . 1 9 8 0 . S e c o n d a r y s t r u c t u r e m o d e l f o r b a c t e r i a l 1 6S r i b o s o m a l R N A : p h y l o g e n e t i c , e n z y m a t i c a n d c h e m i c a l e v i d e n c e . N u c . A c i d s R e s . 8 : 2 2 7 5 - 2 2 9 3 . ~~ 2 7 6 . W o e s e , C . R . , R . G u t e l l , R . G u p t a , a n d H . F . N o l l e r . 1 9 8 3 . D e t a i l e d a n a l y s i s o f t h e h i g h e r - o r d e r s t r u c t u r e o f 1 6 S - l i k e r i b o s o m a l r i b o n u c l e i c a c i d s . M i c r o . R e v . _47: 6 2 1 - 6 6 9 . 2 7 7 . W o l d , M . S . , a n d R . M c M a c k e n . 1 9 8 2 . R e g u l a t i o n o f e x p r e s s i o n o f t h e E s c h e r i c h i a c o l i d n a G g e n e a n d a m p l i f i c a t i o n o f t h e d naG p r i m a s e . P r o c . N a t l . A c a d . S c i . U . S . A . _79: 4 9 0 7 - 4 9 1 1 . 2 7 8 . W u , A . M . , a n d T . P i a t t . 1 9 7 8 . T r a n s c r i p t i o n t e r m i n a t i o n : n u c l e o t i d e s e q u e n c e a t 3 ' e n d o f t r y p t o p h a n o p e r o n i n E s c h e r i c h i a  c o l i . P r o c . N a t l . A c a d . S c i . U . S . A . 75: 5 4 4 2 - 5 4 4 6 . 2 7 9 . Wu , T . - H . , D . L . W o o d , P . L . S t e i n , a n d M . M . C o m e r . 1 9 8 4 . T r a n s c r i p t i o n o f a g e n e c l u s t e r c o d i n g f o r t w o a m i n o a c y l - t R N A s y n t h e t a s e s a n d a n i n i t i a t i o n f a c t o r i n E s c h e r i c h i a c o l i . J . M o l e c . B i o l . 1 7 3 : 1 7 7 - 2 0 9 . 2 8 0 . W u , T . T . 1 9 6 6 . A m o d e l f o r t h r e e - p o i n t a n a l y s i s o f r a n d o m g e n e r a l t r a n s d u c t i o n . G e n e t . 54_: 4 0 5 - 4 1 0 . 2 8 1 . W u l f f , D . L . , M . M a h o n e y , A . S h a t z m a n , a n d M . R o s e n b e r g . 1 9 8 4 . M u t a t i o n a l a n a l y s i s o f a r e g u l a t o r y r e g i o n i n b a c t e r i o p h a g e X t h a t h a s o v e r l a p p i n g s i g n a l s f o r t h e i n i t i a t i o n o f t r a n s c r i p t i o n a n d t r a n s l a t i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 81_: 5 5 5 - 5 5 9 . 2 8 2 . Y a m a m o t o , T . , a n d F . I m a m o t o . 1 9 7 5 . D i f f e r e n t i a l s t a b i l i t y o f t r p mRNA s y n t h e s i z e d o r i g i n a t i n g a t t h e t r p p r o m o t e r a n d PL p r o m o t e r o f l a m b d a t r p p h a g e . J . M o l e c . B i o l . 92_: 2 8 9 - 3 0 9 . 2 8 3 . Y a m a m o t o , M . , W . A . S t r y c h a r z , a n d M . N o m u r a . 1 9 7 6 . I d e n t i f i c a t i o n o f g e n e s f o r e l o n g a t i o n f a c t o r T s a n d r i b o s o m a l p r o t e i n S2 i n E_. c o l i . C e l l 1 8 : 1 2 9 - 1 3 8 . 1 3 0 . 2 8 4 . Y a n o f s k y , C , a n d V . H o r n . 1 9 8 1 . R i f a m p i n r e s i s t a n c e m u t a t i o n s t h a t a l t e r t h e e f f i c i e n c y o f t r a n s c r i p t i o n t e r m i n a t i o n a t t h e t r y p t o p h a n o p e r o n a t t e n u a t o r . J . B a c t . 1 4 5 : 1 3 3 4 - 1 3 4 1 . 2 8 5 . Y a n o f s k y , C , R . L . K e l l e y , a n d V . H o r n . 1 9 8 4 . R e p r e s s i o n i s r e l i e v e d b e f o r e a t t e n u a t i o n i n t h e t r p o p e r o n o f E s c h e r i c h i a c o l i a s t r y p t o p h a n s t a r v a t i o n b e c o m e s i n c r e a s i n g l y s e v e r e . J . B a c t . 1 5 8 : 1 0 1 8 - 1 0 2 4 . 2 8 6 . Y a t e s , J . L . , a n d M . N o m u r a . 1 9 8 0 . E . c o l i r i b o s o m a l p r o t e i n L 4 i s a f e e d b a c k r e g u l a t o r y p r o t e i n . C e l l 2 1 : 5 1 7 - 5 2 2 . 2 8 7 . Y a t e s , J . L . , A . E . A r f s t e n , a n d M . N o m u r a . 1 9 8 0 . I n v i t r o e x p r e s s i o n o f E s c h e r i c h i a c o l i r i b o s o m a l p r o t e i n g e n e s : a u t o g e n o u s i n h i b i t i o n o f t r a n s l a t i o n . P r o c . N a t l . A c a d . S c i . U . S . A . 77_: 1 8 3 7 - 1 8 4 1 . 2 8 8 . Y o k o t a , T . , H . S u g i s a k i , M . T a k a n a n i , a n d Y . K a z i r o . 1 9 8 0 . T h e n u c l e o t i d e s e q u e n c e o f t h e c l o n e d t u f A g e n e o f E s c h e r i c h i a c o l i . G e n e 12_: 2 5 - 3 1 . 2 8 9 . Y o o , S . H . , M . L . P r a t t , a n d W. S h i v e . 1 9 7 9 . E v i d e n c e f o r a d i r e c t r o l e o f t R N A i n a n a m i n o a c i d t r a n s p o r t s y s t e m . J . B i o l . C hem . 2 5 4 : 1 0 1 3 - 1 0 1 5 . 2 9 0 . Y o u d e r i a n , P . , S . B o u v i e r , a n d M . M . S u s s k i n d . 1 9 8 2 . S e q u e n c e d e t e r m i n a n t s o f p r o m o t e r a c t i v i t y . C e l l 3 0 : 8 4 3 - 8 5 3 . 2 9 1 . Z i m m e r m a n n , R . A . 1 9 7 4 . In R i b o s o m e s ( N o m u r a , M . , T i s s i e r e s , A . , a n d L e n g y e l , P . , e d s . ) , C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N . Y . , p p . 2 2 5 - 2 6 9 . 2 9 2 . Z i m m e r m a n n , R . A . , A . M u t o , P . F e l l n e r , C . E h r e s m a n n , a n d C . B r a n l a n t . 1 9 7 2 . L o c a t i o n o f r i b o s o m a l p r o t e i n b i n d i n g s i t e s o n 1 6 S r i b o s o m a l R N A . P r o c . N a t l . A c a d . S c i . U . S . A . _69: 1 2 8 2 - 1 2 8 6 . 2 9 3 . Z u b e r , P . , a n d R. L o s i c k . 1 9 8 3 . U s e o f a l a c Z f u s i o n t o s t u d y t h e r o l e o f t h e s poO g e n e s o f B a c i l l u s s u b t i l i s i n d e v e l o p m e n t a l r e g u l a t i o n . C e l l 3 5 : 2 7 5 - 2 8 3 . 


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items