UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transfer RNA genes in Drosophila melanogaster Newton, Craig Hunter 1984

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1984_A6_7 N49.pdf [ 5.42MB ]
Metadata
JSON: 831-1.0096129.json
JSON-LD: 831-1.0096129-ld.json
RDF/XML (Pretty): 831-1.0096129-rdf.xml
RDF/JSON: 831-1.0096129-rdf.json
Turtle: 831-1.0096129-turtle.txt
N-Triples: 831-1.0096129-rdf-ntriples.txt
Original Record: 831-1.0096129-source.json
Full Text
831-1.0096129-fulltext.txt
Citation
831-1.0096129.ris

Full Text

Transfer  RNA Genes i n D r o s o p h i l a  melanogaster  by C r a i g Hunter Newton B.Sc.  McGill University,  1980  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES Department o f B i o c h e m i s t r y (Genetics  Programme)  We a c c e p t t h i s t h e s i s a s conforming to t l ^ l r e q u i r e d  standa/d  THE UNIVERSITY OF BRITISH COLUMBIA  May 1984 ©  C.H. Newton, 1984  In p r e s e n t i n g  t h i s t h e s i s i n p a r t i a l f u l f i l m e n t of  requirements f o r an advanced degree at the  the  University  o f B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make it  f r e e l y a v a i l a b l e f o r reference  and  study.  I  further  agree t h a t p e r m i s s i o n f o r e x t e n s i v e copying o f t h i s t h e s i s f o r s c h o l a r l y purposes may  be  department o r by h i s or her  granted by  the head, o f  representatives.  my  It i s  understood t h a t copying or p u b l i c a t i o n of t h i s t h e s i s f o r f i n a n c i a l gain  s h a l l not be  allowed without my  permission.  Department o f  C.f+J=MIS  The U n i v e r s i t y of B r i t i s h 1956 Main Mall Vancouver, Canada V6T 1Y3 Date  6/1  /H  TAY  Columbia  written  -ii-  Abstract  In D r o s o p h i l a m e l a n o g a s t e r of genes encoding  t h e 600-800 r e i t e r a t e d  cytoplasmic  genome a t a m u l t i t u d e  tRNA  o f chromosomal  copies  are dispersed across the sites.  In many c a s e s  these  s i t e s c o n t a i n s e v e r a l c o p i e s o f t h e same and d i f f e r e n t tRNA genes. Here we d e s c r i b e tRNA g e n e s o b t a i n e d one,  o n t h e X chromosome  hybridization  with  (CGA). The second  from  two o f t h e s e  a t 12E, i s t h e m a j o r s i t e  tRNA  (anticodon  S e r 7  IGA)  sites;  of i n situ  o r tRNA^  S  e  r  i s one o f t h r e e m i n o r h y b r i d i z a t i o n s i t e s and  i s l o c a t e d on chromosome 2L a t 23E show t h a t t h e p l a s m i d  derived  . DNA  from  12E  sequencing  s t u d i e s here  (pDt27R) c o n t a i n s  two  Ser identical  tRNA  g e n e s and f o u r  4  identical  genes encoding  minor a r g i n i n e i s o a c c e p t o r (UCG) . P r e v i o u s s t u d i e s w i t h plasmids  had shown  12E a l s o  contains  two g e n e s  a  different  identical  to  Se r tRNA  7  and  two  additional  one  t h e r e o f . Thus 12E c o n t a i n s a t l e a s t perhaps f i v e , d i f f e r e n t genes w i t h i n  and  two  basepair  variants  t e n genes encoding  three, or  i s o a c c e p t o r s . The o r g a n i z a t i o n o f these  12E i s n o t known.  In pDt27R a l l s i x g e n e s  w i t h i n 2.3 kbp and a r e i n t h e same t r a n s c r i p t i o n a l The  occur  orientation.  two s e r i n e genes a r e 317 bp a p a r t and a r e s e p a r a t e d by 669 bp  from  the four adjacent  sequence homology o c c u r s  a r g i n i n e genes. While around  homologies d i f f e r  mainly  flanking  t h e s e r i n e g e n e s , the f l a n k i n g  sequence o f each a r g i n i n e gene i s a l m o s t these  little  i d e n t i c a l . The e x t e n t o f  i n t h e amount o f s h a r e d  5'  f l a n k i n g sequence; two genes a r e c o n t a i n e d on r e p e a t s w i t h 455 bp  -iii-  o f common sequence w h i l e two share o n l y 30 bp o f 5 same 75 linked  bp  of  by  3'  sequence a r o u n d  of  gene  from the  included  that  bp  other  three.  the  repeats  are  tandemly  in length.  The  flanking  i s considerably This  more d i v e r g e n t  (18%  s t r u c t u r e suggests that  a r o s e from a s i n g l e p r i m o r d i a l gene by a s e r i e s  d u p l i c a t i o n events that  amounts o f  on r e p e a t s  f l a n k i n g s e q u e n c e . A l l f o u r genes have  s e q u e n c e s 5-27  one  the gene q u a r t e t  are contained  f l a n k i n g s e q u e n c e . The  junction  v e r s u s 1-3%)  1  others  flanking  identical  included  sequence.  amounts o f  In  identical  one  case  flanking  and  the  different  duplication  sequence but  acted  at  times d i s t a n t enough f o r 18% d i v e r g e n c e t o accumulate. The  plasmid  bearing  DNA  from  23E  on  chromosome 2L  (pDt5)  Se r contains  a  single  gene  previously described  a t 12E  alone approximately Drosophila the  two  within  DNA.  The  identical 30  bp  of  in  only genes  the  5'  d i f f e r e n t sequences are  identical on  the  the  middle  12E  mature  are  two  tRNA  conserved  genes also  at  of in  a  4.4  tRNA^  genes  kbp  fragment  regions  that  occur  sequence. S i m i l a r l y ,  a t a n a l o g o u s p o s i t i o n s 5' 12E.  of  f l a n k i n g sequence w i t h  small  coding  Se r the  the  X chromosome. T h i s gene o c c u r s  similarities at  to  to  -iv-  Table o f  Contents  Page  ABSTRACT  i i  TABLE OF CONTENTS  iv  LIST OF FIGURES  vi  ABBREVIATIONS  v i i  ACKNOWLEDGEMENTS  vii i  DEDICATION  ix  INTRODUCTION  ...1  EXPERIMENTAL PROCEDURES Materials  7  DNA P u r i f i c a t i o n  7  Restriction  8  Mapping  F i l t e r Hybridizations  9  DNA Sequencing  11  (1) S u b c l o n i n g i n t o M13 a) S p e c i f i c  11  Fragments  11  b) Random D i g e s t s  12  c) P r o g e s s i v e  12  (2) Template P u r i f i c a t i o n (3) Primer A n n e a l i n g / T e r m i n a t i o n  17 Reactions....17  (4) Rapid Template C h a r a c t e r i z a t i o n  19  (5) E l e c t r o p h o r e s i s  19  -V-  RESULTS R e s t r i c t i o n mapping and Gene l o c a l i z a t i o n  21  0  a) pDt27R  21  b) pDt5  28  DNA Sequencing  28  (1) tRNA Genes  28  (2) F l a n k i n g Sequences  31  a) Random methods  31  b) P r o g e s s i v e methods  32  S e r i n e tRNA Genes i n pDt27R and pDt5  37  S e r i n e tRNA Genes a t 12E and 23E  43  A d d i t i o n a l tRNA Genes i n pDt27R  51  Other A r g i n i n e tRNA Genes  56  DISCUSSION Gene o r g a n i z a t i o n  62  Gene c o n s e r v a t i o n  66  Gene e v o l u t i o n  68  REFERENCES  71  APPENDIXES  77  -vi-  List  of  Figures Page  F i g u r e 1.  P r o g r e s s i v e Sequencing S t r a t e g y  16  F i g u r e 2.  R e s t r i c t i o n maps o f H i n d l l l fragments c o n t a i n e d i n p l a s m i d s pDt27R and pDt5  F i g u r e 3.  Southern H y b r i d i z a t i o n a n a l y s i s o f pDt27R w i t h tRNA  F i g u r e 4.  23 P)  25  S e r 4  Smith and B i r n s t i e l kbp  (  r e s t r i c t i o n mapping o f 5.4  E c o R I / H i n d l l l fragment i n pDt27R  .27 32  F i g u r e 5.  F i g u r e 6.  Southern H y b r i d i z a t i o n a n a l y s i s o f pDt5 w i t h  (  tRNA  ...30  S e r 4  P)  Recombinant M13 d e l e t i o n c l o n e s used i n DNA sequencing  36  F i g u r e 7.  Sequencing S t r a t e g i e s f o r pDt27R and pDt5  39  F i g u r e 8.  N u c l e o t i d e sequence determined i n pDt5  42  F i g u r e 9.  Nucleotide  45  sequence determined i n pDt27R  F i g u r e 10. Summary o f s e r i n e a c c e p t i n g tRNA genes i s o l a t e d  from  D. melanogaster  50  F i g u r e 11. C l o v e r l e a f s t r u c t u r e o f t R N A  A r g  as p r e d i c t e d from  n u c l e o t i d e sequence o f the genes F i g u r e 12. S t r u c t u r e o f r e p e a t e d  52  DNA e n c o d i n g f o u r t R N A  found i n pDt27R  A r g  genes 55  F i g u r e 13. Southern h y b r i d i z a t i o n a n a l y s i s o f D r o s o p h i l a genomic DNA c o n t a i n i n g a d d i t i o n a l t R N A F i g u r e 14. Chromosomal l o c a t i o n o f t R N A polytene  chromsomes  Ar<  A r g  3 genes  58  genes on s a l i v a r y 61  -vii-  Abbreviations  bp: base  pair  BSA: Bovine serum albumin  ( F r a c t i o n V)  cpm: c o u n t s p e r m i l l i o n ddNTP: D i d e o x y n u c l e o s i d e t r i p h o s p h a t e dNTP: Deoxynucleoside t r i p h o s p h a t e DNA: D e o x y r i b o n u c l e i c a c i d DTT: D i t h i o t h r e i t o l EDTA: E t h y l e n e d i a m i n e T e t r a a c e t a t e (Disodium s a l t ) E t B r : E t h i d i u m Bromide kbp:  Kilobase pairs  pCp: C y t i d i n e  3',5 -Diphosphate  RF: R e p l i c a t i v e RNA: R i b o n u c l e i c  1  Form acid  SdNTP: Deoxynucleoside  5'-0-(l-thiotriphosphate)  SDS: Sodium d o d e c y l s u l p h a t e SSC:  0.15 M N a C l , 0.015 M Na C i t r a t e pH 7.2  tRNA: T r a n s f e r r i b o n u c l e i c TEMED: Tris:  acid  N,N,N'jN'-Tetramethylethylenediamine Tris(hydroxymethyl)aminoethane  ug:  microgram  ul:  microlitre  uM: m i c r o M o l a r uCi: microCurie  -viii-  ACKNOWLEDGEMENTS T h i s t h e s i s r e s t s s o l e l y upon t h e g u i d a n c e and i n e s t i m a b l e patience,  s u p p o r t , and t o l e r a n c e  his laboratory;  i n p a r t i c u l a r , Ian G i l l a m  Leung and V i c k i D a r n e l l . technologies result  o f G o r d o n T e n e r and members o f  Introduction  , Shizu  Hayashi, J e f f  t o improved DNA sequencing  and c o m p u t e r p r o g r a m s f o r d a t a management were t h e  o f lengthy  discussions  and demonstrations with  Ross  M a c G i l l i v r a y , Joan M c P h e r s o n and Rob McMaster. I must a l s o thank members o f t h e l a b o r a t o r i e s o f P e t e r Caroline  Astell  f o rtheir myriad  supplies  o f enzymes  C a n d i d o , M i k e S m i t h , and  helpful hints  and r a d i o n u c l e o t i d e s  order). L a s t l y , I would  like  (that  t o thank T r a f f i c  I forgot to  Control  b e n e v o l e n t i n t e r e s t i n t h e w e l f a r e o f my p a r k i n g G i l l a m f o r a f i n e r d e f i n i t i o n o f t h e word  and g e n e r o u s  'stuff.  for their  f i n e s and t o Ian  -ix-  DEDICATION TO  ZOUAVE PETRANDA OUZO RAKI  -1-  Introduction  In D r o s o p h i l a  melanogaster there  30 minor c h r o m a t o g r a p h i c a l l y  distinct  a r e some 60 m a j o r  species o f cytoplasmic  (1). S o l u t i o n h y b r i d i z a t i o n s t u d i e s w i t h their  genes  have  a  kinetic  sequences whose c o m b i n e d E a c h tRNA, t h e r e f o r e ,  nuclear  complexity  of  c o p y number t o t a l s  i s e n c o d e d by  10-12  DNA  about  and tRNA  indicates 60  unique  600-800 genes ( 2 ) . copies  per  haploid  genome. In s i t u h y b r i d i z a t i o n w i t h genes have  at  least  seemingly random are  54  total  major  4S RNA  and  minor  f a s h i o n a r o u n d t h e genome  the lack of s i t e s  on t h e s m a l l  h a s shown t h a t the sites  spread  (3) . The  in a  exceptions  f o u r t h chromosome and t h e  p a u c i t y o f s i t e s on the X chromosome. More d e t a i l e d s t u d i e s  with  purified  are.  tRNAs  distributed  showed  that  at several discreet sites  genome. F r e q u e n t l y  these  sites  tRNAs and a r e a c t u a l l y g e n e o f the same and d i f f e r e n t situ  n u c l e o t i d e s may encompass  widely  also contain  tRNA g e n e s  separated  i n the  genes f o r d i f f e r e n t of multiple  polytene  copies  band, which i n  a few t o s e v e r a l hundred k i l o b a s e p a i r s  be d e t e r m i n e d b y  g e n e s wi-thin a c l u s t e r must  cloning  regions  vectors f o r a m p l i f i c a t i o n i n b a c t e r i a l be a n a l y s e d  copies  ( 4 - 6 ) . The r e s o l u t i o n o f i n  to a  arrangement o f d i f f e r e n t  therefore  gene  c l u s t e r s composed  hybridization i s limited  ( 7 ) . The  the multiple  i n d e t a i l by DNA  hosts  of interest into whereupon  they can  sequencing.  The most e x t e n s i v e l y s t u d i e d  tRNA gene  c l u s t e r i s located  -2-  w i t h i n the 42A r e g i o n o f chromosome 2L ( 8 ) . A n a l y s i s o f almost 100 kbp o f t h i s present.  r e g i o n h a s shown t h a t  There a r e 8 i d e n t i c a l  5 for tRNA all  L  y  4  s  2  /  intermingled  copies  for tRNA  within  at least  A  r  2  g  18 tRNA g e n e s a r e  o f genes f o r t R N A  ,  and  A s n  ,  I l e  ,  5  one f o r t R N A  a 45 kbp r e g i o n . T h e r e a r e no f u r t h e r  genes f o r 20 kbp f l a n k i n g e i t h e r s i d e o f t h i s c l u s t e r . The genes a r e arranged  s i n g l y or i n s u b c l u s t e r s separated  bp t o almost  10 kbp and a r e t r a n s c r i b e d f r o m b o t h s t r a n d s  little  r e g u l a r i t y . The o n l y  the c o d i n g  similarities  regions are s m a l l  conserved  some g e n e s and o l i g o - t h y m i d y l a t e d i r e c t i o n . The l a t t e r by RNA p o l y m e r a s e transcription estimated  I I I (9,10)  initiation  with  i n DNA sequence o u t s i d e  regions  tracts  are involved  by l e s s than 100  that  immediately 5" t o f o l l o w i n the 3  i n transcription  and t h e former  (11) . The s i z e  may  1  termination influence  o f t h e 42A r e g i o n  was  t o c o n t a i n 300-400 kbp t h u s even t h i s 95 kbp r e g i o n may  not r e p r e s e n t t h e e n t i r e complement  o f tRNA genes d e t e c t e d by i n  situ hybridization. Other  analyses  o f tRNA  gene  e x t e n s i v e . A 15 kbp p o r t i o n o f t h e clustered w i t h i n genes f o r t R N A different  2.5 k b p ( 1 2 ) . m  I l e  c l u s t e r s have  been  50AB r e g i o n c o n t a i n e d  less  7 genes  S i m i l a r t o 42A, t h e 5 i d e n t i c a l  and 2 genes  for tRNA  d i r e c t i o n s and a r e a r r a n g e d  L e u  are oriented i n  irregularily  between  -Tie-'  unrelated coding tRNA ^ 1  f l a n k i n g DNA.  The tRNA  sequence t o t h e g e n e 11  genes c o n t a i n  be a common  found  genes are i d e n t i c a l i n  a t 42A. In a d d i t i o n , these two  i n t e r v e n i n g sequences. This  observation  i n a subset  o f tRNA  appears to  genes  i n many  -3-  e u k a r y o t e s and  some a r c h a e b a c t e r i a  Identical flanking  gene c o p i e s  sequence  are  (15) . A  (13,14). not  12  a l w a y s embedded  kbp  portion  of  the  i n unique 62A  region  Glu contains  5 genes coding  some 5' and  3'  f o r tRNA  f l a n k i n g sequence s u g g e s t i n g  unequal c r o s s i n g o v e r o f sequence d i v e r g e n c e  has  o c c u r r e d . A l s o , one within  the  of  gene  microheterogeneity  an  accumulated the  are contained a 22 kbp  on two  region  five  region.  shared  kind  repeats  contains  approximately  61D 1.1  (17). kbp  unique sequence. A g a i n , for  at  least  contained  415  bp  the and  is  Some f l a n k i n g  proposed  an  region  example  repeats  of  seen w i t h  5 6 E F ( 1 6 ) . These i n length within tRNA  arose by a DNA d u p l i c a t i o n . Met for  two  tRNA.  genes  unique i n s e r t s d e r i v e d  separated  one  event  additional uncharacterized  Here b o t h g e n e s a r e  repeats  by  a s i n g l e base change  1.1-2.0 kbp  of d u p l i c a t i o n i s seen  band  share  t h e y arose  f l a n k i n g sequences are  found i n recombinant phage c o n t a i n i n g polytene  this  genes  i d e n t i c a l genes (see below).  genes. T h i s arrangement s u g g e s t s t h e y  Another  that  This  from p o l y t e n e  direct  that  since  genes has  between o t h e r w i s e  tRNA^^ genes d e r i v e d  the  a n c e s t r a l gene p a i r .  coding  Other examples o f two  . Three o f  contained  clone,  within  by a t l e a s t 10-15  a r e s i m i l a r but not allelic  to  the  from  kbp  of  identical others,  a gene w i t h  hybridized  the  (position  7  'pseudogene'  a s i n g l e base change. Another clone that Met tRNA^ probe c o n t a i n e d the p a r t i a l sequence Me t  to did  39) not  of  a  truncated  transcribe  sequences h y b r i d i z e d t o a t  least  30  tRNA  in vitro  i  and  gene. the  This  flanking  d i f f e r e n t chromosomal  sites.  -4-  In t h i s  example t h e d u p l i c a t e d f l a n k i n g  varying degrees o f divergence remained i d e n t i c a l One  while  s e q u e n c e s showed a l s o  t h e gene c o d i n g  (with t h e e x c e p t i o n o f t h e a l l e l i c  interpretation  o f these  shared  flanking  sequences  variant). sequences i s  that they represent recent d u p l i c a t i o n s o r t r a n s p o s i t i o n s t h a t a r e s l o w l y accumulating may d i v e r g e  mutations  through  to the unrecognizable  s e q u e n c e a r o u n d most tRNA mechanism t h a t m a i n t a i n s  random d r i f t .  genes.  Implicit  the coding  in this  (20),  V a l 3 b  and t R N A  L y s 5  observed.  genes  f r o m known tRNA  of tRNA  (21).  These  (18,19),  V a l 4  differ  from the  tRNA s e q u e n c e a t 3-4 p o s i t i o n s o u t s i d e t h e a n t i c o d o n transcibed e f f i c i e n t l y The  variant genes  obtained  in vitro  o f both  to y i e l d tRNA. 4  f r o m a common c h r o m o s o m a l  copies that duplicated  represent r e g i o n s . An  either  mature s i z e and  V a l  site  a l s o d e r i v e d from a c h r o m o s o m a l  site  allelic  V  linked  a  l  were  i n multiple versions or  tRNA^ "*" v a r i a n t gene was 3  n e a r b y a t 89C. Each o f t h e  copies o f d i f f e r e n t v a r i a n t genes had i d e n t i c a l coding which suggests  and a r e products.  tRNA.,, 3b  a t 90BC  different  identical  i sa  i m p e r f e c t l y as demonstrated  More extreme e x a m p l e s o f s e q u e n c e c h a n g e s  tRNA  view  sequences o f the d i f f e r e n t  by t h e c o d i n g sequence m i c r o h e t e r o g e n e i t i e s  are the v a r i a n t  they  f o r m common t o t h e f l a n k i n g  gene c o p i e s . I t a p p a r e n t l y o p e r a t e s  structures  In time  t h e y may be m a i n t a i n e d  by s e l e c t i v e  t o e x p r e s s i o n and may c o r r e s p o n d  sequences pressures  t o some o f t h e m i n o r  s p e c i e s t h a t have n o t y e t been c h a r a c t e r i z e d . The s i g n i f i c a n c e o f these v a r i a n t i s o c o d i n g g e n e s  i s not clear  b u t does demomstrate  -5-  the need f o r comprehensive c h a r a c t e r i z a t i o n of a l l members i n an isoaccepting tRNA family. This thesis contributes to a study of serine accepting tRNAs and t h e i r genes i n Drosophila. The i n d i v i d u a l isoacceptors can be resolved  into at l e a s t  s e v e n m a j o r and minor s p e c i e s under  standard  chromatographic c o n d i t i o n s  s p e c i e s have been p u r i f i e d determined  (22). t R N A  at only three positions  S e r 4  ( 1 ) . Three of the major  and t h e i r and  tRNA  n u c l e o t i d e sequences S e r  7  differ  i n sequence  (two o u t s i d e the anticodon at nucleotide Se r  16 and 77)  and  a r e 96%  homologous.  tRNA^  i s more  d i s t a n t l y related with only 71-73 % s i m i l a r i t y . The l o c a t i o n o f g e n e s f o r t h e s e determined by i n s i t u  i s o a c c e p t o r s has been  h y b r i d i z a t i o n (5) . Because  tRNA  S e r 4  Se r and  tRNA  7  a r e so c l o s e l y  related their  genes cannot be  d i s t i n g u i s h e d and t h e y h y b r i d i z e t o i d e n t i c a l  s i t e s on the  polytene chromosomes. The s t r o n g e s t s i t e i s at polytene bands 12E on the X chromosome. T h i s  i s t h e o n l y s i g n i f i c a n t tRNA gene  containing region on the e n t i r e chromosome ( i e . i f using a 4S RNA probe). Three a d d i t i o n a l minor s i t e s e x i s t on the autosomes at Ser  p o l y t e n e bands 23E, 56D, and 64D. Genes f o r t R N A ^ have a unique d i s t r i b u t i o n on chromosome 3R at 86A, 88A9-12, and 94A6-8. Ser Genes  for tRNA^  7  have  been  f u r t h e r studied  on  recombinant plasmids s e l e c t e d from a pBR322 l i b r a r y of H i n d l l l cleaved D r o s o p h i l a DNA probe  using e i t h e r tRNA as the h y d r i d i z a t i o n  (23). DNA sequencing  and  i n s i t u h y b r i d i z a t i o n o f the  plasmid i n s e r t s resolves unambiguously the i d e n t i t y and l o c a t i o n  -6-  of the tRNA genes contained within. Three of seven plasmids i s o l a t e d  ( p D t l , pDt5, pDt81)  contained the same inserts that derived from one of the minor sites at polytene band 23E. The remainder (pDtl6, pDtl7R, pDt27R, pDt73) contained different inserts a l l derived from the major site at 12E. The nucleotide sequence of the probe homologous regions of pDtl6, pDtl7R, and pDt73 have been determined (22)  pDtl6  Se r  contains a gene corresponding to tRNA^  and a second gene  that i s identical except at position 77 where a G to A transition o c c u r r e d . S i m i l a r l y , the gene on pDt73 i s i d e n t i c a l to tRNA  Ser 7  but has two changes  i n the coding sequence. One i s  the same as the gene in pDtl6 at position 77 and the second i s a C to T t r a n s i t i o n at p o s i t o n 16. Both of these changes are e x a c t l y those which d i s t i n g u i s h  tRNA  S e r 7  from  tRNA  S e r 4  outside the anticodon. These variant genes thus resemble hybrid sequences of the two isoacceptors. The i d e n t i t y of the genes contained  i n the remaining  plasmids derived from 12E (pDt27R) and 23E (pDt5) i s the of this thesis.  subject  -7-  Materials  E.  coli  and M e t h o d s  strain  SF8 c o n t a i n i n g  were p r o v i d e d by R. C. M i l l e r and  DNA  sequencing  J r . E. c o l i  v e c t o r s M13mp9  p r o v i d e d by R. T. A. M c G i l l i v r a y vector tRNA  pUC13  S e r 4  ( 2 6 ) was  and 4S RNA  s t r a i n s JM101 and JM103  (24) and M13mpll  by  provided  (25) were  D.  M.  Irwin.  Purified  b y I . C. G i l l a m and G.  Tener. P u r i f i e d pDt5 was  a gift  DNA  P. C s e r j e s i .  (Ore R ) a g i f t , f r o m  pDt27R and p D t 5  and J . L e u n g . Plasmid c l o n i n g  provided  were  plasmids  M.  f r o m D: S t . L o u i s and D r o s o p h i l a Oligonucleotides specific  Ser for  tRNA^  laboratory  were o f M.  synthesised  S m i t h . M13  by  sequencing  T.  Atkinsen  primer  i n the  ( 17-mer ) was  purchased f r o m PL B i o c h e m i c a l s . A l l DNA and RNA modification enzymes were o b t a i n e d ' c o m m e r c i a l l y and t h e s u p p l i e r s a r e 32 indicated  where  their  products  were  used  r a d i o n u c l e o t i d e s and ex. p h o s p h o r o t h i o a t e purchased from New England DNA  exclusively.  dNTP a n a l o g u e s  were  Nuclear.  purification  pDt27R DNA  was  isolated  chromatography on B i o g e l A15 M  as d e s c r i b e d  (23) and p u r i f i e d by  (1.9 x 90 cm i n 0.1 M a c e t i c  pH 5 (NaOH)). M13 RF DNA was i s o l a t e d from 1 l i t r e JM101 c u l t u r e s Maniatis e t a l .  (27) by t h e a l k a l i n e  infected  acid  E.coli  l y s i s method d e s c r i b e d by  (28) f o l l o w e d b y two e q u i l i b r i u m c e n t r i f u g a t i o n s  through CsCl-EtBr thrice  P  i n a VTi65  precipitated  with  rotor  ethanol  (65000 rpm x 4 h o u r s ) and i n the presence  o f 2.5 M  -8-  NH^QAc. Small s c a l e 2 ml c u l t u r e s  plasmid  DNA  o r M13  RF DNA  was i s o l a t e d  from  (27) by a s i m i l a r r a p i d a l k a l i n e l y s i s method (28).  Restriction  Mapping  Plasmid DNAs (2-3 ug) were d i g e s t e d s i n g l y o r doubly w i t h a v a r i e t y o f r e s t r i c t i o n enzymes t h a t EcoRI,  PstI, C l a l ,  (10-50 mM  Tris  Smal, PvuII)  pH 7.5  (HC1),  r e c o g n i z e 6 bp s i t e s  i n standard 5 mM  MgCl , 2  BSA) a t s a l t c o n c e n t r a t i o n s s u g g e s t e d N a C l ) . D i g e s t i o n s were p e r f o r m e d  restriction 1 mM  DTT,  with  buffers  0.1 mg/ml  by t h e s u p p l i e r s  either  (BamHI,  (0-100mM  two f o l d excess o f  enzyme o r by i n c u b a t i n g f o r t w i c e o r more the time suggested f o r c o m p l e t i o n by the s u p p l i e r . R e a c t i o n s were stopped by a d d i t i o n o f 1/10 v o l u m e d y e mix blue,  0.1% x y l e n e  (20% F i c o l l ,  cyanol)  and  e l e c t r o p h o r e s i s on 0.8%-1.2% (Ix = 90 mM T r i s - b o r a t e  agarose  pH 8.3,  by comparing  EDTA, 0.1%  the products  fractionated  by  0.5x TBE  EDTA ) c o n t a i n i n g 1 ug/ml  The d i f f e r e n t  fragment  bromophemol  submarine g e l s i n  2.5 mM  EtBr f o r 8-16 hours a t 4-5 V/cm. were o r d e r e d  10 mM  restriction  sizes of single  and  sites double  d i g e s t s as d e s c i b e d by Danna (29). More f r e q u e n t l y o c c u r r i n g r e s t r i c t i o n the p a r t i a l d i g e s t i o n  procedure  o f Smith  sites  and B i r n s t i e l  example i s t h e 5.4 kbp H i n d l l l / E c o R I f r a g m e n t F i g u r e 4 . Plasmid DNA labelled (  3 2  P)dATP  ethanol  with  was d i g e s t e d w i t h  DNA  ( 3 1 ) . The  precipitation  polymerase  DNA and  was  phenol  1  were mapped by (30). An  o f pDt27R shown i n  H i n d l l l and the 3' ends (Klenow  fragment)  extracted, purified  r e d i g e s t e d with  EcoRI t o  and by  generate  -9-  single  end l a b e l l e d m o l e c u l e s . T h e s e  agarose  gels  and  electroelution Conditions  the a p p r o p r i a t e  (28) f r o m  cpm C e r e n k o v ,  and T a q l .  <1 ug DNA)  Single  on  enzyme  which  end l a b e l l e d DNA  DNA  a t 37 ° C w i t h  by  tubing. i n this (5 x 10^  was made up t o 65 u l i n a 6 mM  (above) c o n t a i n i n g  0.7%  recovered  into dialysis  f o r each  r e s t r i c t i o n buffer and i n c u b a t e d  fragment  a gel slice  for digestion varied  example a r e H a e l l l  were s e p a r a t e d  NaCl  5 ug u n l a b e l l e d C a l f Thymus  2 units Haelll  (New  England  B i o l a b s , 15 minute u n i t s ) . T e n u l a l i q u o t s were removed a f t e r 0, 1, 2, 4, 10, and 30 m i n u t e s  and s t o p p e d w i t h 3 u l dye mix. The  Taq I d i g e s t i o n s were p e r f o r m e d was used and  cm  (12 u n i t s , Bethesda R e s e a r c h L a b o r a t o r i e s ,  a l i q u o t s were w i t h d r a w n  minutes  s i m i l a r l y e x c e p t t h a t more enzyme  incubation  horizontal  electrophoresis high voltage  a t 65°C.  1.5  %  agarose  (Whatman)  (with  gels  2,  and  units)  6, 15, 30, and 60, onto 40  fractionated  f o r 24 t o 36 h o u r s  by  i n a Shandon  c o o l i n g ) . The g e l s were d r i e d down  and e x p o s e d  to 48 hours w i t h i n t e n s i f y i n g sceens  Filter  0,  The r e a c t i o n s were l o a d e d  a t 12-15 V/cm  apparatus  on 3 MM paper  after  1 hour  to X-ray f i l m  (Curex) f o r 24  (Dupont L i g h t e n i n g  Plus ).  Hybridizations  Plasmid DNA fragments c o n t a i n i n g by h y b r i d i z a t i o n w i t h  3 2  P-labelled  tRNA genes were 4S  RNA  or t R N A  identified S e r 4  .  The  32 probes were p r e p a r e d b y 3' end l a b e l l i n g RNA L i g a s e resolved  as d e s c r i b e d  by C r i b b s  i n agarose g e l s  with  (  P)pCp  and T j  ( 2 2 ) . R e s t r i c t i o n fragments  or smaller  fragments  ( i e . Sau3a o r  -10-  H a e l l l  digested)  that  had  been  polyacrylamide:bisacrylamide Genescreen  (New  England  m a n u f a c t u r e r s . The 10  cpm/ml  filter  labelled  4xSSC, 50 mM  at  f o r 48  37-42°C  bound  with  DNA  in  NaH P0 2  a  intensifying  were  4  as  was  pH  described  hybridized  6.5,  screens  5  by  for a  to  w i t h 1-2 50  60 ug/ml E . c o l i were washed  0.5%  %  the  containing  filters  containing  in  transferred  solution  t o 64 h o u r s . The  room temperature i n 500 ml SSC -70°C  (30:1)  Nuclear)  tRNA  formamide,  separated  x %  tRNA 3x a t  SDS and exposed a t  few  days  to  a week  depending on the counts r e t a i n e d . D. melanogaster  (Ore R)  g e n o m i c DNA  o v e r n i g h t w i t h 10 u n i t s r e s t r i c t i o n and s e p a r a t e d i n 0.7% HC1)  agarose g e l s .  solution Ficoll  was p r e h y b r i d i z e d ( l x = 0.02%  (M.W.  Thymus DNA. T r i s pH  cpm/ml  40,000), This  8.0  ug/ml C a l f 32  each  solution  (HC1),  cpm/ug). The  BSA) was  and  were p e r f o r m e d  was  dot b l o t s with  S c h u e l l , BA85) u s i n g  a t 60°C  and  250  replaced  hybridized  translated  filter  phage  treatment (0.2 N  t o Genescreen as d e s c r i b e d .  overnight  i n 5x  washed  and  i n 2x  40,000),  ug/ml d e n a t u r e d  w i t h 0.3  M NaCl, 0.06 0.5%  SDS,  24 h o u r s w i t h 1-2  SSC  Calf  a t 60°C  x  100 10^  (1-5 x 10 with  M  7  three  above.  plaque l i f t  nitrocellulose nick  Denhardt's  (M.W.  (32) p l a s m i d f r a g m e n t s  changes and exposed as d e s c r i b e d M13  acid  0.002 M EDTA, l x D e n h a r d t ' s ,  Thymus DNA  P nick  After  polyvinylpyrrolidone  and  digested  enzyme ( H i n d l l l , EcoRI, Xhol)  t h e fragments were t r a n s f e r r e d  The f i l t e r  (10-15 ug) was  translated  filter  circles  probes  hybridizations (Schleicher  (above)  &  essentially  -li-  as d e s c r i b e d  DNA  (27,28).  Sequencing  The  majority of nucleotide  determined  using  the dideoxynucleotide  Sanger e t a l . ( 3 3 ) coliphage  M13  sequence  on s i n g l e  cloning  stranded  vectors  a l . (24-26,34). In some c a s e s  presented  t e r m i n a t i o n method o f  templates  developed  Dr.C. A s t e l l . . T h i s  p r o v i d e d by t h e by Messing e t  t h e s e q u e n c e was determined by t h e  c h e m i c a l d e g r a d a t i o n method o f Maxam and G i l b e r t by  h e r e was  shall  n o t be d e s c r i b e d  (31) as m o d i f i e d further but a  summary o f t h e r e a c t i o n c o n d i t i o n s a r e g i v e n i n Appendix 1. (I) S u b c l o n i n g a) small  Specific  i n t o M13 sequencing  vectors  F r a g m e n t s : T h e tRNA gene c o d i n g  (>100 bp) and c a n be s e q u e n c e d  regions are  on r e s t r i c t i o n  fragments  i d e n t i f i e d by f i l t e r h y b r i d i z a t i o n s (above). These fragments, 600 bp o r l e s s , were p u r i f i e d appropriate g e l s l i c e Mg(OAc) , 2  precipitated pellet  1 mM  from p o l y a c r y l a m i d e  i n 3-4 v o l u m e s o f 0.5 M NH OAc, 10 mM 4  EDTA,  with  0 . 1 %  was r e d i s s o l v e d  2  determined  (RF) M13mp9 o r m p l l  fragments w i t h  overnight  i n 10-20 u l H 0  fragment was then l i g a t e d  JM101 o r J M 1 0 3  SDS  two v o l u m e s 95 % e t h a n o l .  fragment r e c o v e r e d  form  g e l s by soaking t h e  into  5' o r 3  r e c o m b i n a n t s was b a s e d  1  The e t h a n o l washed  and the q u a n t i t y o f  b y e l e c t r o p h o r e s i s . The p u r i f i e d a p p r o p r i a t e l y digested  and u s e d  as d e t a i l e d  a t 65°C and  t o t r a n s f o r m competent E . c o l i  by Messing  overhanging  solely  replicative  ( 2 7 ) . When  ends  on c o l o u r  cloning  the selection of  inactivation.  Clear  plaques  after  blunt  end  c l o n i n g , h o w e v e r , were not always  r e c o m b i n a n t s . T h e s e were s c r e e n e d  i n l a r g e r numbers  plaque  h y b r i d i z a t i o n s (27) o r b y  lift  and d o t b l o t  filter  e i t h e r by  r e s t r i c t i o n a n a l y s e s o f RF DNA from s e v e r a l 2 ml c u l t u r e s ( 2 8 ) . b) Random s u b c l o n i n g : R a t h e r several  small  subcloned  fragments,  than  larger  randomly..Appropriate  purifying  and s u b c l o n i n g  regions  (1-2 kbp) were  DNA  restriction  fragments(l-2  kbp)  were p u r i f i e d from agarose g e l s b y e l e c t r o e l u t i o n onto DE81 paper (Whatman) as d e s c i b e d by Chambon (35) o r i n t o d i a l y s i s t u b i n g subsequent p u r i f i c a t i o n on DE52 e t a l . ( 2 8 ) . The r e c o v e r e d separately with  precipiated  (Whatman) as d e s c i b e d by M a n i a t i s  DNA  (0.5-1.0 ug) was  Sau3a, H a e l l l ,  m a p p i n g ) , t h e enzymes h e a t  and  Alul  then  digested  (as f o r r e s t r i c t i o n  i n a c t i v a t e d a t 7 0 ° C , and t h e  i n the presence  P o r t i o n s o f the d i g e s t e d  of  2.5  M  DNAs were t h e n  NH OAc 4  ligated  and  then screened  by s i n g l e  to o b t a i n those  from each  termination  recombinants w i t h  DNA  ethanol.  separately into  a p p r o p r i a t e l y c l e a v e d v e c t o r s and t r e a t e d as above. Template (below) o f 20-30 r e c o m b i n a n t s  with  DNA  r e s t r i c t i o n d i g e s t were  reactions  (see Rapid below)  u n i q u e i n s e r t s . These were  then  sequenced as d e s c r i b e d below. c)  Progressive  Subcloning:  (1-3 kb) l a c k i n g i n t e r n a l (B)  (see F i g u r e  1) was  (I).In  restriction  cloned  intact  t h i s method  sites into  f o r enzymes  d i g e s t i o n with  restriction  10-20  units  enzyme  DNA  (A) and  appropriately cut  M13mp9 o r m p l l . Ten t o 20 ug o f r e c o m b i n a n t RF DNA was by  target  linearized  (A) i n t h e a p p r o p r i a t e  b u f f e r f o r 2-3 h o u r s and t h e r e a c t i o n t e s t e d f o r  -13-  c o m p l e t i o n by e l e c t r o p h o r e s i s on then p r e c i p i t a t e d i n 0.1-0.2 mis Exo 1  mM  DTT,  0.1  a m i n i - a g a r o s e g e l . The DNA  w i t h e t h a n o l i n 2.5 b u f f e r (50 mM  mg/ml  BSA).  Tris  a t 37°C, a l i q u o t s c o n t a i n i n g intervals  and  volume o f  2 x S  each  exonuclease  reactions  DNA  stopped  single  III aliquot  Biochemicals)  stopped  phenol:chloroform  by  phase by p r e c i p i t a t i o n reprecipitation.  Any  f l u s h by i n c u b a t i o n w i t h  with  was  units  dNTP f o r 30 m i n u t e s  The  M  3  10  units  37°C  equal  and  the  volume  of  from the aqueous  polymerase 50 mM  purified  by  I (Klenow) i n  NaCl and 0.5 mM These  each  r e a c t i o n s were  t o 7 0 ° C f o r 15 minutes  and  4  was  (B) f o r 1-2  redissolved (B)  i n 10-20  ( s e e F i g u r e 1)  of the mixture  i n t o f r e s h M13  ul  restriction  and d i g e s t e d w i t h  h o u r s . A f t e r heat i n a c t i v a t i o n (determined  (above)  by e l e c t r o p h o r e s i s  a l i q u o t on a m i n i - a g a r o s e g e l ) o f d e l e t e d ligated  4.5,  w i t h e t h a n o l and NH OAc.  b u f f e r s u i t a b l e f o r enzyme  portion  equal  e n d s r e m a i n i n g were made  DNA  EDTA, h e a t e d  r e c o v e r e d DNA  2-3 u n i t s o f  an  at  NH^OAc and  a t room t e m p e r a t u r e .  stopped w i t h 1 u l 0.5  minute  t o an  with  collected  overhanging 1-2  units  incubating  M NaOAc pH  were trimmed  20 u l o f r e s t r i c t i o n b u f f e r c o n t a i n i n g  precipitated  0.5  f  w i t h e t h a n o l and 5'  10-20  by a d d i t i o n  f o r 3 minutes  DNA  2  s t r a n d s o f the RF m o l e c u l e s  extraction  ( 1 : 1 ) . The  of  MgCl ,  were removed a t 3  b u f f e r (10x=2 M N a C l  in  (HC1) , 10 mM  addition  1  1  ZnSO^, .5 % g l y c e r o l ) . The  (PL  8.0  resuspended  L a b o r a t o r i e s ) and  2 ug  the d i g e s t i o n s  mM  nuclease  pH  After  Exonuclease I I I ( B e t h e s d a R e s e a r c h  M NH^OAc and  was  v e c t o r and  of  insert  a an  was  v e c t o r p r e p a r e d by d i g e s t i o n w i t h Enzyme  -14-  (B) and Sma I (blunt end) . The DNA (B)  must  be  5'  or  3'  overhanging  o r i e n t a t i o n o f the d e l e t e d S i x t o 24 c l e a r aliquot  insert  i n two  i n these  ml  cultures.  0.7%-1.5% agarose g e l s .  RF DNA  was  o r SDS  single  restriction  DNA  was  enzyme  lysed  insert  by  phage DNA  sizing (27) on  inserts that d i f f e r e d  f o r DNA  enzyme  RF  DNA  s e q u e n c i n g and t h e i r  redissolved  (see F i g u r e . 1 ) .  i n 50  NaCl  was  from  linearized  was  temperature w i t h 5-10 u n i t s o f DNA by heat i n a c t i v a t i o n , a n d  ends.  i ti s  The l i n e a r i z e d buffer  created  RF  (above)  by cleavage with  i n c u b a t e d one polymerase  precipitated  The SdNTP l a b e l l e d DNA was t h e n  case  and  o f t h e a p p r o p r i a t e SdNTP f o r  5' t e r m i n i  reaction  In t h i s  ul restriction  and 0.5 mM  i n the overhanging ( A ) . The  c a n be p r o t e c t e d  (A) a s i n t h e p r e c e e d i n g s e c t i o n  (A) l e a v e 5' o v e r h a n g i n g  c o n t a i n i n g 0-50 mM filling  determined  I I I ( 3 6 , 3 7 ) . The DNA  with ethanol  necessary that  exonuclease I I I  t h e use o f <x p h o s p h o r o t h i o a t e dNTP a n a l o g u e s a  end o f t h e r e c o m b i n a n t  precipitated  recombinants.  (below).  digestion with exonuclease with  correct  The e x t e n t o f  Clones containing  i n s i z e by 150-250 bp were c h o o s e n template DNAs prepared  the  i n t h e recovered  recombinants  appropriately digested  ( I I ) . With  to ensure  p l a q u e s were p i c k e d f r o m e a c h  and grown  deletion  ends c r e a t e d by d i g e s t i o n w i t h  hour  at  room  I (Klenow), stopped  w i t h e t h a n o l and NH^OAc.  redissolved  i n 0.1 ml  restriction  b u f f e r s u i t a b l e f o r enzyme  (C) and d i g e s t e d w i t h 20 u n i t s o f (C)  f o r 2-3 h o u r s .  end l a b e l l e d  The s i n g l e  deleted with exonuclease  RF m o l e c u l e s were t h e n  I I I and r e p a i r e d  w i t h DNA polymerase  I  -15-  Figure  1.  exonuclease sequences,  Progressive  I I I and  nuclease.  open boxes  multiple cloning s i t e  insert  single  s t r a n d M13  corresponds  t o DNA  templates. B r i e f l y ,  t h e RF  (1-3 kb)  inserts  site  (A).  method  exonuclease  III to  n u c l e a s e , and  and  The  from  i s linearized (I)  the  to  used  from  Deleted  tend  DNA  (Klenow) a t t h e i n s e r t end  5'  i s labelled sticky  i s freed of the  ends  with  DNA  not  to  with  polymerase  ends l e f t  ( v e c t o r end)  exonuclease  S^  nuclease  I  DNA  (B)  and  vector.  due  In method  to  the  (II) the  polymerase  by d i g e s t i o n  SdNMP l a b e l  S^  deleted insert  redone  SdNTP and  with  with  ( B / B l u n t ) o f f r e s h M13  the s i n g l e end l a b e l l e d I I I and  variant  is digested , trimmed  shows f o r s m a l l e r i n s e r t s .  RF+insert  (bottom)  r e l e a s e d by d i g e s t i o n w i t h ends  linear  arrow  digestion at r e s t r i c t i o n  are  p r e f e r e n c e M13  f o r sequencing  by  p o r t i o n o f the m o l e c u l e s  r e c l o n e d i n t o the c o m p a t i b l e  B,  recombinants c o n t a i n i n g  o f a l l f o u r d N T P s . The  sequences  boxes the  deletion  (Klenow) i n t h e p r e s e n c e  vector  vector  M13  extents  blunt  stipled  broken  linear  increasing  repaired  site  obtained  DNA  a r e M13  using  r e s t r i c t i o n s i t e s A,  the priming  templates.  strategies  lines  sequences,  sequence  large  In  Solid  c o n t a i n i n g unique  and C. The arrow i n d i c a t e s with  sequencing  with  by d i g e s t i o n w i t h  I  ( A ) . The (C) and  m o l e c u l e s then d i g e s t e d w i t h as  i n method  (I). After  r e l i g a t i o n , the a s y m m e t r i c a l l y d e l e t e d m o l e c u l e s a r e competent f o r transformation  and  subsequent  i n s e r t d e l e t i o n i n t h e s e phage o f phage s u p e r n a t a n t i n 0.7%  phage p r o d u c t i o n . The i s determined  agarose  gels.  by  extent of  electrophoresis  -16-  -17-  (Klenow) e x a c t l y  as d e s c r i b e d  a b o v e . B e c a u s e t h e M13  sequences a r e p r o t e c t e d f r o m  digestion  DNA  f o r t r a n s f o r m a t i o n w i t h o u t the need  for  can be r e l i g a t e d and used  r e c l o n i n g . A l s o n e i t h e r IPTG  recombinant  selection.  by  vector  nor  Those d e l e t i o n  exonuclease  X-gal  are  I I I , the  required for  v a r i a n t s suitable for  DNA  sequencing were choosen a s d e s c r i b e d a b o v e , i . e . e l e c t r o p h o r e s i s o f SDS  l y s e d phage on 0.7%  M13  agarose g e l s (27).  Phage T e m p l a t e P r e p a r a t i o n  Single  stranded  phage t e m p l a t e s  were p r e p a r e d  from  2  ml  c u l t u r e s grown 4-8  hours a f t e r i n o c u l a t i o n i n t o YT media  (38) o f a  single  20  JM101  plaque  and  ul overnight culture  JM103 grown i n M9 media by s p i n n i n g 5 m i n u t e s  (38) . The  infected  i n a microfuge  of  E. c o l i  c u l t u r e s were c l e a r e d  ( B r i n k m a n ) and  t h e phage  p r e c i p i t a t e d from 1.3 ml o f s u p e r n a t a n t by a d d i t i o n o f 0.3 ml M NaCl and at  20 % p o l y e t h y l e n e g l y c o l  room t e m p e r a t u r e  the  minutes i n the m i c r o f u g e .  phage Care  s u p e r n a t a n t w i t h a drawn o u t was  redissolved  (HC1),  0.25  mM  i n 0.2  redissolved  were  was  LTS  6000). A f t e r 15 minutes  collected  taken  Pasteur  here  NaCl,  by  spinning 5  to remove a l l the  pipette.  (10 mM  2.5  The  10 mM  phage p e l l e t Tris  pH  8.0  EDTA), e x t r a c t e d t h r e e t i m e s w i t h an e q u a l volume  phenoltchlorform NH^OAc.The  ml  (PEG  or  DNA  and  precipitated  pellets  i n 25-50 u l  Primer A n n e a l i n g  were  washed  twice with  with 95  LTS.  and  T e r m i n a t i o n Reactions  ethanol  and  % ethanol  and  -18-  Hybridization of  1 u l sequencing  17-mer), 2 u l 10x b u f f e r 70 mM  M g C l ) and  5 ul single  2  prepared  (100 mM  a b o v e ) was  65°C water b a t h  NaCl,  stranded  performed  primer 100 mM  (0.05-0.1 pmoles, T r i s pH 7.5  template  (0.2-0.5 pmoles;  in a sealed c a p i l l a r y  f o r 10 m i n u t e s  and  brought  (HC1),  t o room  tube  in a  temperature  over 20-30 minutes. The  c o n t e n t s o f t h e c a p i l l a r y was mixed w i t h  1  1.5  ul  15  uM  distributed ul),T  dATP  and  t o 1.5 ml  (2.0  ul),C  ul  (  Eppendorf (2.5  3 2  P ) d A T P ( 3 0 0 0 Ci/mmole)  tubes  ul)  and  f o r each G,(2.5 u l ) ,A  termination  (2.0  reaction.  Dideoxynucleotide/deoxynucleotide mixes  ( s e e A p p e n d i x II) were  added  by a d d i t i o n o f 1 u l  (1.5 u l ) and the r e a c t i o n s s t a r t e d  polymerase mM  K HP0 2  4  T (Klenow) d i l u t e d pH  7.5,  room temperature ul  0.5  mM  minutes.  10 mM  t o 400  DTT.  f o r 15 m i n u t e s  a l l f o u r dNTPs and The  The  d e i o n i s e d formamide, 10 mM  gels mix  immediately added j u s t  incubation continued  EDTA, 0.2%  l o a d e d onto  (below) t h e y were s t o r e d  ( s u c h a s w i t h M13  reverse primer  (PL B i o c h e m i c a l s ) o r was  any c o n t a m i n a t i n g RNA  purified and  by  RF  i n the primer  mix  20  ( 98%  DNA  sequencing  a t -70°C and the dye  I f the  t e m p l a t e DNA  was  f o r sequencing u s i n g a  f o r sequencing  out of  pUC  C s C l c e n t r i f u g a t i o n t o remove  linearized  r e s t r i c t i o n s i t e o u t s i d e o f the  5 u l dye  for  bromophenol b l u e and x y l e n e  t o be  double s t r a n d e d  from above was  with  before electrophoresis.  plasmids) the DNA  50  t h e n chased by a d d i t i o n o f 1  stopped  c y a n o l ) . I f the r e a c t i o n s were n o t  i n 1 mg/ml BSA,  r e a c t i o n s were i n c u b a t e d a t  and the  r e a c t i o n s were  units/ml  DNA  by d i g e s t i o n  insert.  The  a n n e a l i n g where  at a  unique  only step d i f f e r e n t i n s t e a d the s e a l e d  -19-  capillary  was  heated  i n i c e water b e f o r e Best  to  1 0 0 ° C f o r 3 m i n u t e s and  proceeding  r e s u l t s were o b t a i n e d  u n t i l a d d i t i o n o f DNA  with  i f the  polymerase I  the  25  template  primer,  10  ul  template  DNA  10x  samples, buffer,  r e a c t i o n s were k e p t  on  ice  (Klenow).  1.2  15  chilled  termination reactions.  Rapid C h a r a c t e r i z a t i o n o f Random M13 For  quick  Templates  u l primer  ul  in sealed c a p i l l a r i e s  H 0)  was  2  and  mix  (6 u l 17-mer  mixed  with  1 ul  h y b r i d i z e d as d e s c r i b e d  above. The c o n t e n t s were e x p e l l e d t o 1.5 ml Eppendorf t u b e s , mixed w i t h 1.5 15  uM  u l n u c l e o t i d e mix  dATP,  reactions  started  (Klenow) a s described  60-80  (  3 2  P)dATP  addition  of  (3000 0.4  A l l subsequent  units  steps  DNA  and  the  polymerase  were  performed  I as  cm  g e l s and E l e c t r o p h o r e s i s gels  x 18  were  cm)  poured  with  c o m p o s e d  thin  o f  6%  between spacers  ammonium p e r s u l f a t e  and  20  polymerization  glass  (0.35cm) u s i n g  a gel  8%  TBE,  u l TEMED i n a  d e i o n i s e d  8.4  M urea,  0.06%  t o t a l volume o f 50  ( i . e . addition  i n g r e d i e n t s ) the s o l u t i o n was  siliconized  and  a c r y l a m i d e : b i s a c r y l a m i d e ( 2 0 : 1 ) , 0.5x  Before  Ci/mmole))  i n s e c t i o n above.  Sequencing  m a t r i x  by  above.  Sequencing  plates(40  uCi  (37 u l ddTTP/dNTP from T a b l e I ,2 u l  of  the  latter  e x t e n s i v e l y degassed. A f t e r  ml. two  setting  a t l e a s t one hour the g e l s were p r e - e l e c t r o p h o r e s e d 30 minutes a t 1500  V  (optional).  Immediately  before  l o a d i n g the g e l s  the  -20-  reaction  tubes  were h e a t e d  and 1-1.5 u l loaded  ( c a p s open) f o r 3 m i n u t e s a t 95 C  i n t o 0.5 cm s l o t s  f r e s h l y flushed with buffer  (0.5xTBE). E l e c t r o p h o r e s i s o f t h e 8% g e l was s t a r t e d a t 1800 V (constant, g i v e s about  20-25 mA)  and c o n t i n u e d  a f t e r which t h e v o l t a g e was d e c r e a s e d mA)  and stopped when t h e b r o m o p h e n o l  (total  time  identical after  = 90 m i u n t e s ) .  except  the xylene  down t o l o w e r overheating transferred  (total  readable  t o 3MM  nucleotides.  until  30 t o 45 minutes  t h e g e l and was o f t e n 10-12  mA)  to  = 4 h o u r s ) . The g e l s were  paper  (Whatman) , d r i e d  to X-ray  film  on t h e r a d i o l a b e l DNA  b l u e had j u s t l e f t t h e g e l  ( 1 2 0 0 - 1 4 0 0 V,  time  sequence  included; e x c e s s i v e heat  both  that  f o r 3 h r s to 3 days  during  totalled  adversly  prevent  down u n d e r vacuum a t  (Curex)  gels  turned  immediately  incorporated. Typical  from  Conditions  (about 15  E l e c t r o p h o r e s i s o f t h e 6% g e l was  c y a n o l had l e f t  8 0 ° C , and e x p o s e d depending  t o 1500-1600 V  t h a t i t was c o n t i n u e d  voltage  f o r 60 minutes  yields of around  affected  this  300  yield  e l e c t r o p h o r e s i s , interruptions  d u r i n g g e l d r y i n g , i m p r o p e r l y d e i o n i s e d formamide, i m p u r i t i e s i n the t e m p l a t e ,  choice o f sequencing  radionucleotides, aging excessive (Klenow)  sample  dideoxy  primer,  B o e h r i n g e r Mannheim).  were  variation of  and d e o x y n u c l e o t i d e s , s l o p p y o r  l o a d i n g , and t h e s o u r c e  (Best r e s u l t s  batch  obtained  o f DNA  with  polymerase  the product  I  from  -21-  Results  R e s t r i c t i o n M a p p i n g and tRNA g e n e  localization  (a) pDt27R- A r e s t r i c t i o n map o f t h e 6.4 kbp H i n d l l l contained  i n pDt27R  hybridizations  with  i s shown  ( P)  tRNA  3 2  are l o c a l i z e d t o a 1 k b p r e g i o n insert.  A single  S e r 4  showed  with  map o f t h i s  the probe  region  2a. that  Southern  the gene(s)  o n the. e x t r e m e r i g h t end o f t h e  1.5 k b p BamHI f r a g m e n t ,  pBR322, h y b r i d i z e d detailed  in. Figure  fragment  including  (Fig  3b l a n e  was o b t a i n e d  from  346 bp o f e ) . A more  Smith/Birnstiel  p a r t i a l d i g e s t i o n s o f t h e 5.4 k b p E c o R I / H i n d l l l fragment l a b e l l e d with  3  2  P  at the H i n d l l l  site  (Figure  4) T h e t R N A  and  S e r 4  Se r tRNA^  nucleotide  sequences  restriction sites i n their  genes  s e e n a t two l o c a t i o n s w i t h i n  site  the portion  ( 5 ' t o 3 ' ) « When  performed w i t h hybridizing  plasmid  of  that close  i s 300 bp downstream  b y t h e o r d e r o f t h e H a e l l l and  Southern  DNA d i g e s t e d  with  hybridizations  were  Sau3a and H a e l l l t h e  fragments a r e o f the s i z e p r e d i c t e d  mapping i . e . f o r Sau3a and  o f the insert  gene has i t s 5' end v e r y  and t h e second  i n t h e same o r i e n t a t i o n a s j u d g e d TaqI s i t e s  patterns  ( i . e . H a e l l l and TaqI) t h a t a r e  h y d r i d i z e s t h e probe. One p u t a t i v e (40 bp) t o t h e H i n d l l l  (22) p r e d i c t  from  the fine  250 b p and 530 bp and f o r H a e l l l 340 bp  740 bp (data n o t shown) . B e c a u s e  two T a q I s i t e s a r e p r e s e n t Ser i n these r e g i o n s t h e genes p r o b a b l y code f o r tRNA (22). The f i n e mapping a l s o r e v e a l e d a c l u s t e r i n g o f r e s t r i c t i o n 4  -22-  Figure  2.  Restriction  fragments contained correspond  maps  of the Drosophila  i n (a) p D t 2 7 R and  to Drosophila  DNA  Hindlll  (b) p D t 5 . S o l i d  and the broken l i n e s  lines  t o pBR322.  Se r Portions o f the i n s e r t  that hybridized  indicated  boxes  question.  with  filled  below  t h e tRNA^  probe are  the restriction  sites in  EcoRI Hindlll EcoRI PstI  EcoRI Hindlll  •a  a cn  O N>  J3  Clal Xholl(Aval) Pvu II EcoRI  PstI Pvu II PstI  PstI PstI Bam HI Clal Pvu II  Clal  4-PstI •Pvu II • Ava I  BamHl  Xho ll(Aval) 'Hindlll  w  I  BamHI BamHl  j-BamHl  BamHl  l-Hindlll  -r B a m H l  -24-  Figure  3. S o u t h e r n B l o t A n a l y s i s o f tRNA gene  fragments f r o m pDt27R. with  (A) P l a s m i d  DNAs  containing  (2-3 ug) were d i g e s t e d  r e s t r i c t i o n enzymes and f r a c t i o n a t e d b y e l e c t r o p h o r e s i s i n  1% agarose g e l s c o n t a i n i n g  0.5x TBE and 1 ug/ml EtBr f o r 6 h o u r s  at  5 V/cm. Photograph shows b a n d s i l l u m i n a t e d w i t h  UV  irradiation  (254 nm) .  (B) G e l bound  restriction  low i n c i d e n c e fragments i n  (A) were t r a n s f e r r e d t o G e n e s c r e e n  (NEN) and h y b r i d i z e d w i t h  x  tRNA  10  6  cpm  (  3 2  P)pCp  37°C a s d e s c r i b e d  The  sizes  S  e  an i n t e n s i f y i n g s c r e e n .  with  Hindlll  of the resulting  fragments  w i t h P v u I I . Lanes b-g a r e pDt27R d i g e s t e d (lane c ) , A v a l  PstI  (lane g ) .  Lane m  contains  and pBR322 d i g e s t e d w i t h  k i l o b a s e p a i r s on t h e s i d e . Lane a c o n t a i n s  Clal  f o r 48 h o u r s a t  r  4  i n M e t h o d s . The a u t o r a d i o g r a m was exposed 48  hours a t -70°C with lamda DNA d i g e s t e d  labelled  3-4  (lane d ) , BamHI  Hinfl.  are indicated in pDtl6  DNA  with H i n d l l l  (lane e ) , PvuII  digested (lane b ) ,  (lane f ) , and  -is-  -26-  Figure  4. Smith B i r n s t i e l mapping o f t h e 5.4  fragment from pDt27R. P a r t i a l the  Hindlll  resulting  P-labelled  fragments  digestions  fragment  are described  and  of  1.5  right  48 h o u r s a s  aliquots  r e s t r i c t i o n enzyme  of a p o r t i o n  labelled  Hindlll  of the  site  at  r e s t r i c t i o n s i t e s associated  A r g  s e r i n e genes  bottom.  triangles, respectively.  The arrows marked  Lanes  kbp The  f o r 36  from l e f t to lengths with  the f a r r i g h t 5.4  The  i s a linear  fragment w i t h t h e H a e l l l and  Taq  I  w i t h tRNA genes a r e i n d i c a t e d by the  s e r i n e tRNA genes a r e i n d i c a t e d  the t R N A  intact  the  3.  a t 15 cm/V  f o r increasing  (See methods) . On  s c a l e map  open and c l o s e d  i n Figure  digested  of the  3. The autoradiogram i s  % agarose g e l f r a c t i o n a t e d  exposed  contain  w i t h H a e l l l and TaqI o f  i n t h e Methods s e c t i o n .  (m) a r e the. same as i n F i g u r e  hours and  EcoRI/Hindlll  electrophoresis  s i z e markers a dried  kb  The  o r i e n t a t i o n o f the  by t h e arrows p o i n t i n g  5* t o 3'.  (B) r e f e r t o t h e l o c a t i o n o f BamHI s i t e s w i t h i n  genes. These  a r e a l l i n t h e same o r i e n t a t i o n as t h e  (see t e x t f o r d e t a i l s ) .  - 2 7 -  -28-  sites not  (TaqI and H a e l l l  shown) a r o u n d  second RNA  tRNA^  Ser  i n Figure  t h e BamHl s i t e s  gene.  Southern  gave v e r y weak s i g n a l s  region  compared  4  and  H i n f l , Sau3a, D d e l , d a t a  670  bp d o w n s t r e a m  hybridizations  for restriction  r e g i o n may  with  (  3?  the P)4S  f r a g m e n t s from t h i s  to those r e g i o n s c o n t a i n i n g  genes (data n o t shown). T h i s  from  the s e r i n e  therefore contain  tRNA  further  tRNA genes (see b e l o w ) . No o t h e r s t r o n g bands were seen u s i n g  this  probe. (b) pDt5- A r e s t r i c t i o n map  o f t h e 4.4  kbp H i n d l l l  fragment  i n pDt5 i s shown i n F i g u r e 2b. A s i n g l e 850 bp A v a l / C l a l  fragment  Se r hybridized  t h e tRNA^  probe  l a n e c ) . The 650 bp P v u I I / C l a l by DNA  detailed  below.  restriction  subsequent s u b c l o n i n g i n t o M13  DNA  Sequencing  (I)  tRNA  The  smallest  For  5b  analysed i n d e t a i l  both plasmids these  maps w e r e  predicted  f r o m g e l s and The  h y b r i d i z e d the tRNA p r o b e  two  very  useful  in  tRNA g e n e s  s u b c l o n e d d i r e c t l y i n t o the  Sau3a f r a g m e n t s  of, pDt27R t h a t  530  subclones  ( t h e c o d i n g s t r a n d ) o f the 250  obtained. Several  recombinants o f the l a r g e r  to contain  d i d n o t c l o n e r e a d i l y ; M13  c o n t a i n i n g o n l y one o r i e n t a t i o n were  was  (Figure  sequencing v e c t o r s .  fragments  sequencing v e c t o r s .  fragment  filters  Genes  (above) were p u r i f i e d M13  Southern  subfragment  sequencing d e s c r i b e d  relatively  on  bp  attempts  d i d not  bp  produce  f r a g m e n t . Both o r i e n t a t i o n s o f  -29-  Figure  5.  Southern B l o t A n a l y s i s  of  restriction  fragments  Ser containing  tRNA^y^  gene(s)  i n pDt5. Plasmid  digested with  P s t l / H i n c I I ( l a n e a) , A v a l  c ) , Aval/Xhol  (lane d ) , A v a l / H i n c I I  as d e s c r i b e d exposed  54  in  (A)  h o u r s and  kilobasepairs.a  and the  (B)  of  s i z e markers  (2 ug)  (lane b ) , A v a I / C l a I  (lane e ) , and  Figure  DNA  3.  The  was (lane  treated exactly  autoradiogram  (same as  F i g . 3)  was  are i n  -30-  B  c  d e  m  a  b  c  d  e .-23 .-9.5 —6.5 -4.2  L2.2  Ll.9 t -  1.6  ^0.5  -31-  the  200  and  600  bp BamHI  fragments  o f pDt27R and  t h e 650  bp  PvuII/Clal  f r a g m e n t s o f p D t 5 were r e c o v e r e d . C h a i n t e r m i n a t o r  reactions  ( M a t e r i a l s and  identified  a l l t h e tRNA g e n e s  M e t h o d s ) w i t h t h e s e phage t e m p l a t e s  fragment o f pDt27R. T h i s  fragment  the H i n d l l l s i t e and s e q u e n c e d sequences were l a t e r M13  except that was  530  bp  Sau3a  subsequently labelled at  by c h e m i c a l d e g r a d a t i o n . A l l gene  c o n f i r m e d on b o t h s t r a n d s u s i n g  different  s u b c l o n i n g s t r a t e g i e s (below). (II) tRNA Gene F l a n k i n g a)  Random  Sequences  Subcloning- This  sequence o f the 2.0 kbp and  1.5  D i g e s t i o n o f the t a r g e t DNA fragments t h a t v a r i e d  strategy  kbp  probability of f i n d i n g left  gaps  partial  w i t h Sau3a, H a e l l l , and A l u l produced  in length  i n the sample o f randomly  produced  BamHI fragments from pDt27R.  from  65-650 b p . The s m a l l e s t o f  these tended t o c l o n e more f r e q u e n t l y  and  on. t h e  choosen  and  were o v e r - r e p r e s e n t e d  r e c o m b i n a n t s . T h i s reduced the  more u n i q u e c l o n e s  i n the t a r g e t  sequence  i n the l i m i t e d  sample  desired. Analysis of  an  i m p r a c t i c a l number o f random s u b c l o n e s would have been n e c e s s a r y for determination o f the complete r e g i o n s . Another inserts different  i s the  factor  influencing  potential  bias  the  the  sequence o f these  recovery of  phage  may  show  random towards  i n s e r t sequences. Some i n s e r t s when s i n g l e s t r a n d e d may  form s e c o n d a r y  structures  s t a b i l i t y . T h i s may None was  nucleotide  that  reduce  phage  viability  or  be t h e c a s e f o r i n s e r t s c o n t a i n i n g tRNA genes.  r e c o v e r e d o u t o f 48  random c l o n e s from the 1.5 kbp BamHI  fragment o f pDt27R. As m e n t i o n e d  above,  even  ligation  reactions  -32-  with p u r i f i e d  fragments f a i l e d to produce recombinants.  b) P r o g r e s s i v e S u b c l o n i n g : methods h a v e b e e n d e s c r i b e d  Several f o r use  non-random DNA  with  M13  t h a t c o n t a i n s i m i l a r p o l y c l o n i n g r e g i o n s and (40-43). In these constructed kbp). The priming  d e l e t i o n s extend site  and  continue  into  200-300 bp.  In t h i s way  across  entire  insert  such  methods  the  drawback o f manipulations desired  the  overlapping using  the the  required i n making  the  v a r i a n t s . The  procedure  Methods, i n p a r t i c u l a r , circumvent some o f i n t e r m e d i a t e s and  the their  Method  vagaries  end  insert  DNA  are  a large  insert  the  same  priming  of  recovering  the  in Materials  and  1)  the Ml3 DNA.  unique r e s t r i c t i o n  polycloning  Because  the  complementation l i m i t e d . The  vector  the  second  inserts that w i l l  region  s t a b l y clone  and  error. A  more  to  not  designed  limitation  to  i n the p u r i f i c a t i o n of  here.  o r A+C)  are r e q u i r e d i n  occur  w i t h i n the t a r g e t  for  B-galactosidase  restriction  sites  concerns the  size  i n t o M13  insert  general  were used  i s l i m i t e d by two f a c t o r s . (A+B  t h a t do  v a r i e t y of  T h i s w i l l v a r y from i n s e r t trial  sites  was  site  r e c l o n i n g . Though e f f e c t i v e ,  range o f s u i t a b l e t a r g e t DNA  F i r s t , two  obtained  complexity  t h e r e a r e some l i m i t a t i o n s i n the method d e s c r i b e d The  the  The  Figure  inherent  to  .  and  described  (1-3  differences of  d e l e t i o n s and  subsequent  insert  sequence can be  (see  primers  adjacent  by  number  II  vectors  d e l e t i o n v a r i a n t s are  containing  from  other  use u n i v e r s a l  a family of overlapping  from a recombinant  or  sequencing  and  available is and  nature  s i n g l e stranded  phage.  can o n l y be r e s o l v e d  limitation  i s that  of  by  several  -33-  enzymatic s t e p s a r e r e q u i r e d . The t h e i r q u a l i t y and The  o v e r a l l outcome i s dependant on  j u d i c i o u s use.  3' f l a n k i n g s e q u e n c e o f  the gene  i n p D t 5 was  obtained  u s i n g an M13mpll recombinant c o n t a i n i n g the 2.0  kbp C l a l  (see F i g u r e  the  2b)  cloned  into  the  AccI  i n s e r t c o n t a i n e d n e i t h e r EcoRI n o r used as r e s t r i c t i o n s i t e s deletions  with  sequence was taken  from  phage DNA  SdATP  obtained  3,  6,  (A)  as  and  and  nine  in  Figure  overlapping  9 minute exonuclease  result  from the  could r e s u l t  e x a m p l e , p h a g e DNA  S  1  nuclease  1.  The  entire  d e l e t i o n variants  I I I treatments.  from each  i n lanes c,  same 3 m i n u t e e x o n u c l e a s e  from  t h e r e f o r e were  The  shown i n F i g u r e 6a. A wide s i z e  range o f i n s e r t d e l e t i o n s were r e c o v e r e d For  v e c t o r . This  (C),respectively, i n generating  from these v a r i a n t s a r e  III treatment.  of  BamHl s i t e s and  outlined  with  site  fragment  exonuclease f,• and  j all  III treatment.  c u t t i n g at nicks  This  i n t h e DNA.  The  sequence shown i n F i g u r e 8 i s t e n t a t i v e . No o v e r l a p e x i s t s a t the leftmost C l a l s i t e  in Figure  2b  kbp C l a l fragment i s f r o m t h e  and  same s t r a n d . Some G-C  i n t h i s fragment were a m b i g u o u s on must be confirmed 650  on t h e  other  bp P v u l / C l a l fragment was The  same s t r a t e g y was  (above). The  was  i n t o the P s t I and  cloned  3.2  and  s t r a n d . O n l y the tRNA gene i n t h e  to confirm  of  kbp  2.0  regions  strands.  and make o v e r l a p s f o r  i n pDt27R. P a r t i a l sequence had  determined u s i n g a c o m b i n a t i o n strategies  rich  d i f f e r e n t d e l e t i o n clones  sequenced on both  used  the r i g h t h a l f o f the i n s e r t  a l l t h e sequence f o r the  random and  specific  P s t l / H i n d l l l fragment  Hindlll  been  subcloning (Figure  s i t e s o f M13mp9. The  2a)  insert  -34-  c o n t a i n s n e i t h e r EcoRI n o r and  (C)  with  Sail sites  SdATP a s d e s c r i b e d  and  were used as s i t e s  above. This  u n s t a b l e however. T r a n s f o r m a t i o n  with  to v e c t o r  t h a t had  produced  recombinants  various degrees of d e l e t i o n  (data  purified  not  be grown i n l a r g e c u l t u r e s w i t h The  i n s t a b i l t y might be due  this insert The  to  no  the  and  closest  t o the r i g h t H i n d l l l s i t e  confirm  the  a l l the  sequence  undergone  25-50% were  after electrophoresis in  f u r t h e r deletions occurring. s i x tRNA genes t h a t a r e w i t h i n  sequences  were  (see  screened  sequencing. A p r o p o r t i o n the  i n s e r t . T h i s may  the  intact  in  t o be  i n three  below). order  (up  to  or  to  except  the  75% o f the, BamHI s i t e  i n F i g u r e 2a. No o v e r l a p contiguous otherwise  Larger to  75%)  have b e e n due  recombinant  i n F i g u r e 6b cover  sequence  i s assumed  restriction site i s conserved  clones  ligated  (see below)  insert  gene c o d i n g  apparently  was  i n t a c t recombinant phage c o u l d  n i n e d e l e t i o n c l o n e s shown  here and  fragment  shown) O n l y  i n t a c t as judged by r e s t r i c t i o n a n a l y s e s agarose g e l s . Once packaged, t h e s e  recombinant  (A)  to the  because t h i s i d e n t i c a l tRNA  numbers o f d e l e t i o n  obtain had  exists  those  used  for  d e l e t e d most o r a l l o f observed i n s t a b i l t y o f  endonucleolytic  S^  nuclease  cleavage. In both these examples t h e oc p h o s p h o r o t h i o a t e ends e f f i c i e n t l y p r o t e c t e d the M13  dNTP l a b e l l e d  v e c t o r sequences from d i g e s t i o n  w i t h e x o n u c l e a s e I I I (36). In each the SdATP l a b e l l i n g o c c u r r e d the EcoRI s i t e and  places  the  from the 3' end o f the p r i m i n g  blocking  n u c l e o t i d e two  at  basepairs  s i t e . Out o f about t h i r t y templates  -35-  Figure clones  6. R e c o m b i n a n t M13 Phage t e m p l a t e  generated  exonuclease  by s i n g l e  III/  nuclease  s i z e d by e l e c t r o p h o r e s i s 16 h o u r s .  contain  t h e 2.0 k b C l a l  wildtype  with  stranded  SdNTP a n d DNAs were  0.7% a g a r o s e g e l s a t 4 V/cm f o r  clones generated fragment  f r o m RF M13 m p l l  o f pDt5.  L a n e s a and 1  M13mpll phage DNA and l a n e s b and k c o n t a i n  phage DNA from t h e i n t a c t 194  . The s i n g l e  through  (A) shows d e l e t i o n  containing  end l a b e l l i n g  DNA o f d e l e t i o n  r e c o m b i n a n t . The e x t e n t o f d e l e t i o n i s  bp i n l a n e c , 436 bp i n l a n e  d , 714 bp i n l a n e e, 904 bp i n  l a n e f , 1136 bp i n l a n e g , 1394 bp i n l a n e h , 1576 bp i n l a n e i , and kb  1796 bp i n l a n e Pstl/Hindlll  j . (B) c o n t a i n s d e l e t i o n  fragment  o f pDt27R  i n M13mp9.  c o n t a i n w i l d t y p e M13 mp9 phage DNA a n d l a n e s kb recombinant phage DNA. C l o n e s l a n e d 847 b p , i n l a n e  i n l a n e k 3123 bp.  L a n e s a and m  b and 1 i n t a c t 3.2  i n l a n e c a r e d e l e t e d 496 bp, i n  e 1096 b p , i n l a n e  2227 bp, i n l a n e h 2626 b p , i n l a n e and  c l o n e s o f t h e 3.2  f 1532 b p , i n l a n e g  i 2870 bp, i n l a n e j 2990 bp  -37-  attempted o n l y one loss of t h i s  would n o t  p r e s u m a b l y was  due  to  site.  Portions  of  the  Pst/Hindlll  fragment  (Figure  In one  1).  M13mp9 was  s e q u e n c e and  2.3  kbp  were s e q u e n c e d  case  deleted  region  the  using  1.9  by  kbp  BamHI a s  adjacent the  to  3.2  kbp  d e l e t i o n method  Pstl/Hindlll enzyme  the  (A)  I  fragment  in  Hindlll  as  and  enzyme ( B ) . F i v e c l o n e s g a v e s e q u e n c e o u t  t o the EcoRI s i t e  (1.1  kbp).  I fragment c l o n e d  into  In another example  pUC13 was  deleted using  i n s e r t s were r e c l o n e d the p u r i f i e d  the  Hindlll  into  M13  by  2.3  determined.  (A)  r e g i o n was summary  of  a l l the  pDt5-  (above).  specific  (using the  (B). Deleted  The  DNA  Clal  using  S e r  subcloning  reactions  with the  the  used  for  (44) programs BATIN  7.  sites  pDt27R  in  i n the this  ( F i g u r e 8)  genes p r e v i o u s l y d e s c r i b e d  M13  entire  with  ( P) 3 2  tRNA  h o m o l o g o u s gene s e q u e n c e s to 650  sequence  to t R N A y  combining  Staden  hybridizations  containing  P v u I I and  corresponding two  Filter  regions  between the  EcoRI as  s c e e n e d by plaque l i f t s  S e r i n e tRNA G e n e s i n p D t 5 and  limited  and  sequencing  DBUTIL) are shown i n F i g u r e  a)  Pst  s e q u e n c e s . By  random and  c o m p i l a t i o n by the computer and  as and  pUC  sequence o b t a i n e d  A  kbp  fragment as a h y b r i d i z a t i o n probe to a v o i d those  recombinants c o n t a i n i n g  kbp  1.1  at  12E  4.4  kbp  region that  plasmid  contains  is identical  S e r 4  bp  insert a gene to  ( 2 2 ) . I t i s o r i e n t e d 5'  the to  -38-  F i g u r e 7. Sequencing  S t r a t e g y f o r pDt27R and pDt5. S o l i d  above t h e arrows c o r r e s p o n d s  to the linear  line  r e s t r i c t i o n map taken  from F i g u r e 2. These a r e i n t h e o p p o s i t e o r i e n t a t i o n so t h a t t h e tRNA genes a r e 5' t o 3' f r o m genes a r e i n d i c a t e d by b o x e s . l e t t e r s ; BamHI (B) , C l a l Smal  (S), H i n d l l l  (C) , E c o R I  s i t e s a r e i n d i c a t e d by  (E) , P s t I (P), PvuII  (a) c o r r e s p o n d s  are indicated  t o t h e 3.2 kb  by arrows  o f the arrow). A l l t h e sequence  except  (Pv) ,  o f pDt27R. A l l t h e sequencing g e l s used i n  the computer c o m p l i l a t i o n  overlaps  t o r i g h t . The p o s i t i o n s o f t h e  Restriction  (H). P o r t i o n  P s t l / H i n d l l l fragment  the d i r e c t i o n  left  at the leftmost  BamHI  ( 5 ' t o 3' i n  i s c o n f i r m e d by  site.  Portion  (b)  c o r r e s p o n d s t o t h e a d j a c e n t h a l f o f t h e pDt27R i n s e r t . O v e r l a p p i n g sequence extends f o r 2.3 kb t o w a r d s t h e H i n d l l l s i t e . No sequence overlap exists at the P s t I Portion  (c) o f F i g u r e  sequence o f p D t 5 . right-most C l a l  site  7 shows  junction the gels  A l l the sequence  site.  o f r e g i o n (a) and used  overlaps  (b).  to compile the except  at the  -39-  X—1  UJ—  o-  CQ-  CQ-  a .a  in—  o o  D. O)  <  <0  CQ-  >  Q_ — D_ —  <  CL-  0_-  CQ —  O —  o—  CO—  a.  0  >  4  -40-  3' from r i g h t t o l e f t  i n F i g u r e 2b  and h a s 1.3 kb and 3.0 kb o f  f l a n k i n g sequence between t h e H i n d l l l n u c l e o t i d e sequence was d e t e r m i n e d to t h e mature c o d i n g  s i t e s used  f o r 397 bp 5' and 2999 bp 3'  s e q u e n c e o f t h e g e n e . No o t h e r tRNA genes  are present w i t h i n t h i s i t does n o t encode t h e 3  r e g i o n . L i k e a l l e u k a r y o t i c tRNA genes, CCA p r e s e n t  1  an. o l i g o - t h y m i d y l a t e s e q u e n c e  i n t h e mature tRNA and has  (dTg) b e g i n n i n g  from t h e gene.The o n l y h o m o l o g i e s w i t h i d e n t i c a l g e n e s a t 12E a r e t h e s e sequences l e s s Although insert,  no o t h e r g e n e s a r e p r e s e n t w i t h i n t h i s hybridization  suggests  as a s t r o n g s i t e o f h y b r i d i z a t i o n  tRNA still  4 /  ,  tRNA S e r  7  f l a n k i n g sequence around  than 30 bp 5* t o t h e c o d i n g r e g i o n s (see below).  in situ  more  14 bp downstream  d T t r a c k s and s h o r t conserved  p r e s e n t a t t h e 23E c h r o m o s o m a l s i t e .  or  i n c l o n i n g . The  genes  shows t h i s  stronger  than  t h a t more g e n e s a r e  E l d e r e t a l . d e s c r i b e d 23E  with  4S RNA t h a t c o n t a i n s f o u r  (3). H y b r i d i z a t i o n with site  i s minor  the s i t e s  plasmid  compared  a t 56D  and  purified  t o 12E b u t i s  64D  so t h e r e a r e  Se r p r o b a b l y more t R N A ^  7  genes p r e s e n t ( 5 ) .  b) pDt27R- The n u c l e o t i d e s e q u e n c e r e s u l t s o f Southern mapping  presented  hybridizations above.  Two  ( F i g u r e 9) c o n f i r m s the  and d e t a i l e d  identical  qenes  restriction that  encode  Ser tRNA^  are p r e s e n t  w i t h i n t h e 1.2 k b p B a m H I / H i n d l l l  on t h e extreme r i g h t o f t h e 6.4  kbp i n s e r t as shown i n F i g u r e 2a.  As p r e d i c t e d from the tRNA sequence, t h e s e genes d i f f e r encoding  tRNA  S e r 7  but are otherwise  at positions identical.  fragment  16, 34  from  those  ( a n t i c o d o n CGA), and 77  The s e q u e n c e homology ends e x a c t l y  -41-  Figure noncoding  8.  The  strand  n u c l e o t i d e s e q u e n c e o f p D t 5 . Shown i s t h e  (5*-3'  left  to  right)  fragment c o n t a i n e d i n t h i s p l a s m i d . bp)  the  rightmost  o v e r l a p s to the  PvuII  site  leftmost Clal  w i t h the a d j a c e n t  670  bp  The  of  4.4  kbp  Hindlll  sequence b e g i n s near  i n Figure s i t e . No  Clal/Hindlll  the  2b  and  continues  (<10 with  sequence o v e r l a p e x i s t s f r a g m e n t but the sequence Ser  is  shown  contiguous  sequence and  restriction  nonetheless. sites  The  identified  tRNA^  noncoding  i n mapping s t u d i e s a r e  boxed. Dashes i n d i c a t e ambiguous p o s i t i o n s t h a t a r e not  confirmed.  -42-  20 40 60 80 100 120 AGTAT7TGTATAATTTTATGAGTTCGTTTGCATTACTTATATAACTTATTTTTCCATGTGGATTAGGTCTTCTTTCATTTTCGTGGGGCAAGCAGAAATGCGAGGGCATGAATTACAAA MO 160 180 200 220 240 TGCGGC.\TCAATTGTTGCTGTCGTGAGTAT TGTCCTAAACGGTTTTGTAAATTTT AATGCGGTCAATAAAGGGTATTAAAAAAAATTAAATCCCTTGTATTCGAATAAAAGGAAGCAAGT 260  280  300  320  3-10  360  A A A G G G V rTTGTGTGTCACATTCAACTTGGCGCTCAAATTCAAGTAACACACACATGCAGTGTTGTCAAATGAGCAAGGTTCCGAAATGTGTGTTCAGTCTTGGATTCTCCCATGCAATC 380 JQO 420 44Q 460 480 A AC A T T A 3 T T G C C A A T T T G C C G T G T C A T A T T A AC AfiC A G T C G T G G C C G A G C G G T T A A G G C G T C T G A C T A G A A A T C A G A T T C C C T C T G G G A G C G T A G G T T C G A A T C C T A C C G A C T G C G ^ G A 500 520 540 560 580 600 AGGTTT * " G G A T T T T T T T T A T T T T T C A A C A T T C T C T A T T C T A T T C T C T A T T TTTTCCTCTCAGAAACTGGTTAAATTATTATAATAATAATACATACATGTGTGCTGTTTGTTTACAACT 620 640 660 680 700 720 CGATTA ? rTTTTCACTCTCTACGTACACAGAACACCCTATTCCCCTTACATTGCACTGTTGCGCGTGCAGTCGTATGTCATCGATAACCGATTACAAAACATTTGATGTATTTTTATCGA 740  760  780  800  820  840  ; GGAAA t i A G G A C C T A T A T C T T A T T T T G A A A A T A A A A A T T T G T A G G A G A A A T G A G A G C G T A A G T A T G T G C T T T T G T A A A T G T G C G T G T C C T A A A G T C C C A T C T C G T C A T T T T A G C G C A C T 860  880  900  920  940  960  ('AAAGACVGATGCCGAGTCTGCCTTGGGGTCAGTGAAAACGTGGTAAACATTTTCGAGGCAAAACAAGACCTGCTGGT-TTCAATAGCACAAGTGATCTCTGAATGCACCGACTGTGACAT 980. 1000 TAAAGA 6 3 G G G A C G A T C T G T C G G A G T T A A T T T G T G C A T C C T G T T T G G A G G 1100  1020 1040 1060 1080 CCCAGAGAGCATTCGATATCATCAGAAAATACGACGCGCAGTACATCACCTTCTGTGAGGCATACGA  1120  1140  1160  1180  1200  &GCGG71-TTGAAGAAGAGGATTCCCTAGACGGAGAGG7GTACACAATATCGGACAGCGAGAGTGGGACGTCGTCGCACGATACCAACGGAAACCAAAAGTACATAAATGCCGATGAAAT 1220  1240  1260  1280  1300  1320  :TATGA'..ATATCAGAAGATGAATGTGATCAAACCGTAGATGCAAAAGGAGAAGACTTCAATAATAGCGTCGACGATAGTGTTCATTCGAAGAATCAGCAACATGATGAAAAGGAACCCAA 1340 AGAA AG  1460 1  1360  1380  1400  1420  14 4 0  3GTACATTGGACAAGGATGTCCAGGACGCCCCCCGAAATGAAAGTGTTGCACTTGATCAATCAGCAAGGTGAGACTGACACCGAAAAATTGGCTTTGGACGGCAGTGAATGTG 1480  15O0  1520  1540  1560  TCGGA.iCGGTGCTCGGATGGCCTACAAGT-TCCCACTGCAGTAAGTCCTTTCCACATCGATCCAGGTTCGAGGACACAACCGCGTCCACACGGGAGACGACCATTCAAATGCCCCAGCT 1580  :.CCCGA  1600  1620  1640  1660  1680  r-3ACCTTCCGACTGAAATCCTTTCTTAAAAGGCACAGCGCCCTGCATTTGGAAGAACGACCTTACCCGTGCGACATCTGTGCCAAGA-TTTTGCTGACAAAAGTAACCTGCGCC  1700 1720 1740 1760 1780 rt A G C A A H A A G A C A C A C T C C G t C A T T C G A C C C T T C G A C T G C C C T T C C T G T C T G A G T T C C T T C C G A T T G A A A G C C A C C T G G A C C G C C A C A C C A T G A G T C A C A 1820  1840  1860  1880  1900  1800 --GGGCGAGCGGCCATTTAA 1920  GTGTGAV.:ACTGCGGTAAAGACTTCACGCTACGCTGTAACCTCGTCAAGCATTTAAGGACCCACACCAGGGAACGTCCCTTCAAATGCTCAATATGAAAATCGGCCTTTACGAACTTATC 1940  1960  1980  200O  2020  2040  GAGCCCvATTGCATGAACCATCGAATGAACTACCTTTCCAGTGTGATCGGTGCGACAA-GGTTTGTGGATAGGGTTCGTCCTGACTGCCAGTCCCGTTTCTCGACGTCATCCGACCTCCA 2060  2080  2100  2120  2 140  2160  CCAGCCCGGACTGGTACACAAGGCAAAAGCAAAGATACTAGAATAATTCTAGTGTCTTTGGAAAAATGACCTTTTACGTGAAGTGTGAGGGTTGCGGTTTAGTCCTTAAGAATATGATTC 2180 2200 I rCTTCG.t AGGCATGCTAAGAATTACGGCAAGGCGTTAAAAATGTAATCTTATCT  2220 2240 2260 2280 CCAAATACGTACCAAAT A C G T A T T T A T T A T A A T T T T G T T ATTTTTCAT TCAAGAAACGT TTT  2300 2320 2340 2360 2380 2400 TCAAGCTOGATAACAGTTCGGTAACGTAACATACAAATTCTTTTGCGCCTAACAGCCCACTGTTGTGGAACAGGGTGATCATTCCACTAGCAAACTGAATGGCTATGCCAAAATGGTAAA 2420 2440 2460 2480 2500 2520 CAAACTAVTCCCTATAATAAATAAACCGTCTCATTTAATTTGAAAATATTTAAAATACCACTACATATTTATTTGTAATTACCTTTGATCGATTTGTATAGGCGGCCAAGGTTTATTAAA  AT  2540 2560 2580 2GOO 2620 2640 ACAGGGTAATGGAGAACAAGTGTCGAGTTTGCCTGGCAAGCTCAAAAAACATGGTGAACATTTTCGAGGAAAGGCAGGATCTTCCAGTTTCAATAGCCCATATGATAATTGAATGCAC  2GGO 2680 2700 2720 2740 27GO CGGCTTC.'iAAGTTGAAAAAGGGGACTCATTACCGCACTCAATATGCCCACCATGTGTGAAGGATGCCCACAATGCGTTTACGATCATAAAAACCTACGAACGCAGCTACCAGGTCTTCTA 2780 2800 2820 2840 2860 2880 TGAAGTG^AGGACACGGTTCTCGAGGAAGAACTCTCGGAGGATGTAATCATCGAGCTATCGATGAACAAGAGGAGAAAGTTCATTTGAGTGAAAACAAGGCACCTACGAATGAAGTCAGC 2900 .2920 2940 2960 2980 30OO ACCCAGGAAGAATCTAAAACTGCTCAATCCGACAATGTTTCCGAGGATAAGGGTCACATCTGCACACAGTGTCACATGTCCTTTCGGAGACCTGGTCTCCTAGAGCTACACATCCTGCGA 3020 3040 3060 3080 3100 3120 CACCACACAACGGACGGACCCCGTCAATGTCCTCCACCAGCGAGCACGCGTCAAAGAAGAGTTGAGGACGAAAGAAAGACAGCTTTCAAGGAATTCTACGCACACCTGCCGCCTTTGTAA 3140 3 160 3180 3200 3220 3240 CAAGACCTTCTGCAGCAAAGCAAGCTGTGTCCCACAGGGGGAAAAACCCTTGCCTGCGAAATTTGCCAAAAGCCATTTGCGGATCTTGCTTCCGTCAAAAGACATCTAAGGACTCACACG 32G0 3280 3300 3320 3340 3360 GGAGAAAr.ACCATTCAAGTGCCTTACCTGCCAGTCGGCCTTCTCGGATGGATCTGCTCTAAGGCAGCACATTCGAATTCACACAGGAGAAAGGCCGTACAAGTGCGATATGTGCGATAAG 3380 3400 3420 3440 3460 3480 TTCTTCCGGGAGCGGTCAGATGCTCGGAAGCACATGATGAGCCACACCGCAGAAAAGCGATTCAAGTGTTCCCAATGCGAGCCGGTTTCCGCCAACCAAAAGGTCTGCGTAGGCATGTAA  AGCT  -43-  with the mature coding sequence. Beyond, the flanking sequences are completely unrelated except for the oligo-thymidylate residues 15-16  bp downstream from the 3' end of the coding sequences.  Also, two small conserved  5' flanking sequences are found at  positions analogous to those  conserved between the t R N A  S e r 7  genes (<30 bp). Neither of the genes encode the 3'CCA end of the mature tRNA nor are they interrupted by intervening sequences. The genes are separated by 317  bp and  are in the same  transcriptional orientation. The gene closest to the Hindlll site of pBR322 (i.e. the end of the insert) contains only 39 bp of 5' flanking sequence. Until additional clones are isolated that extend  t h i s 5' sequence  ( i n progress; J . Leung personal  communication) i t cannot be known whether t h i s gene pair occurs alone or i s part of a larger cluster. One feature of the of the sequence between these genes i s the presence of small duplicated regions (underlined in Figure 9). A 54 bp segment begining 198 bp 5' to the second gene (-198) is repeated at position -127 and are 90% homologous except for a 19 bp i n s e r t i o n i n the l a t t e r . Such repeats have not been observed between other tRNA gene pairs (i.e.pDtl6) and their significance i s not clear.  Serine tRNA Genes at 23E and 12E  A comparison of coding and  immediate flanking sequences of  -44-  Figure 9. The nucleotide sequence of pDt27R. Shown i s the noncoding strand  (5'-3' l e f t  rightmost H i n d l l l s i t e  to r i g h t ) extending from the  (Figure 2a) to 309 bp beyond the unique  EcoRI s i t e . The gene sequences are boxed and occur in the following order; Ser4/1, Ser4/2, Arg/1, Arg/2, Arg/3, and Arg/4. The repeated sequences between the Ser4 genes and around the Arg genes (see Figure 12) are underlined. Also underlined are oligo dT, dA, and Purine/Pyrimidine tracts found 1.3 kbp 3' to the Arg gene cluster.  20  40  60  80  100  120  AAGCTTAAATAGTGTATTGGGCTTGCGTAGGAACAAGT^3CAGTCGTGGCCGAGTGGTTAAGGCGTCTGACTCGAAATCAGATTCCCTCTGGGAGCGTAGGTTCGAATCCTACCGGCTGC  140 1G0 180 200 220 240 T^ATGAGAATGTATATT_TTATTTCAAATGTTTTTATTTTCTGAAATTAAATAAAAACGTTCTGCATAGCAAAACAAATGAGTGCTAGGTGTTTAAAAATACATTATTTTATTGCCATACG 2G0  280  300  320  340  360  GAATTATCCTATTTAACGATCAATTTATATTTATAAGGTAGAGAATTAACCTTTTTTTTAATTGTCTTATAGAATTATCCTATTTAACGATCAAACTATATTTAAAAGTATAAAAAAAGT  380  400  420  440  460  4B0  AGGAAACGTAGGAAATTAACCTTTGGCCCTGTTATATGCATAAACTCCGGAAGATTGTTGGGATTTGATCCAAAATAA^CAGTCGTGGCCGAGTGGTTAAGGCGTCTGACTCGAAATCAG  500  520  540  560  580  600  ATTCCCTCTGGGAGCGTAGGTTCGAATCCTACCGGCTGCGCAAGGGTATTCCTATATTTTTTATGTTTTAAAAGGTGCATTCTTACAGTTTTGAATATGTTTATTATATTACACACTGTG  620  640  660  680  700  720  CCCTTTGTTTGGCAATTACTTTCTGTCTAATGAATTTCTTAATTCAATTATAATCCGCATTTTGATCATATTTCGTATTCAAGGAACCACATCTCTAATTTTTTTACCTTGCCTATTTGT  740  760  780  800  820  840  CTCGCATTGTGTAGCCCAAACACAACAACACCACCCACCAGACACGCACAAAATTATTTACATTTGCTGCTGACGAGTTCGTTGAATCTTTGATAACCTTTTTGGTCTGCTCCTCGGCAA  860  880  900  920  940  960  TTTTATTTCTCTATATACTAAATTTTTCGGCTGTCTTTCCTTTACTTTCGTTTTGCTCTTCCGTCTGTGGGCGTATATCGCGTCCACAAAAAGCCTCAAAATGTCTTTGGTCCTTTTGCA  980 T\  1000  1020  1040  1060  1080  CCATTGACGTTGTTGTTTCCGCAGGTCCGAGCCCGCAGGAATCTTTGATAAAGATCTTTATATTATCAATGTCTAAGTATAGATAAAATGAATAAATAATTATGAAATAAGAATGTAAAT  1100 1120 1140 1160 1180 1200 ACAATTTTCAATCAATCGTTTTAAGCAAGGTTCATTTGCAATATTATAAACTATGATAGACCGTTTTGTATCATTGATCTTGGGAATTTGGGACGCCGGTTGCGTAACir.ACCGTGTGGC 1220  1240  1260  1280  1300  1320  CCAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCGfcAGCTCAGGCTATATTTTTTTAAATTATATTTTGTTCGTCCTAGAATATATTAATATG  1340  1360  1380  1400  1420  1440  GGAGATTCCCTAGCCCAACCCAAACACACCAACACCACCCACCAGACACGTACAAAATTATTTACATTTGCTGCTGACGAGTTCGTTGAACCTTTGATAACCTTTTTGGTCTGCTCCTCG  1460  1480 "  1500  1520  1540  1560  1580  1600  1620  1640  1660  1680  1700  1720  1740  1760  1780  1800  ma  ma  'sso  1900  1920  GCAATTTTATTTCTCTATATACTAAATTTTTCGTCTTTCTTTCCTTTACTTTCGTTTTGCTCTTTCGTCGTTGGGCGTATATCGCGTCCACAAAAGCCTCAAAATGTCTTTGGTCCTTTT  GCACCATTGACGTTGTTGTTTCCGCAGGTCAGAGCCCGCAGGAATCTTTGATAATGATCTTTCTATTATTAATGTCTAAGTATAGATAAAATGAATAAATAATTATGAAAAAAGAATGTA  AATACAATTTTCAATCAATCGTTTTAAGCAAGGTTCATTTGCAATATTATAAACTATAATAGACCGTTTTGTATCATTGATCTTGGGAATTTGGGACGCCGGTTGCGTAACTCACCGTGT  GGCCCAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCG|\AGCTCAGGCTACATTTTTTTTAAATTATATTTTGTTCGTCCTAGAATATATTAA  1940  1960  1980  2000  2020  2040  TATGGGAGATTCCCTAGCCCAACCCATTTGTGTAACCTGAGAAATTGGGAATTTGGGACGGCGGTTGCGTAACTpACCGTGTGGCCCAATGGATAAGGCGTCGGACTTCGGATCCGAAGA  2060 2080 2 100 2 120 2 140 2 160 TTGCAGGTTCGAGTCCTGTCACGGTCGUAGCTCAGGCTATATTTTTTTTAAATTATATTTTGTTCGTCCTAGAATATATTTATATGGGAGATTCCCTAGCCCAACCCATTTGTGTAACCT 2180  2200  2220  2240  ?7KQ  2280  GAGAAATTGGGAATTTGGGACGGGGGTTACGTAACCpACCGTGTGGCCCAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCG|rAGCTCAGTAT  2300 2320 2340 2360 2380 2400 TTGflACTTATTTTTCGTTCGTCCAATAATATATTAATATGGGAGATTCCCTAGCCCCACTCATTTGTGTAACCTGAGTGCGGTAAGCAGCAATCGTAACCAATTGGCATA  TTAATTTTTT  2420 2440 2460 2480 2500 CCCAATTGAAAGATTTATTGGACTTTTACATGGGTCGTCCATGGACGAATCAACATGTGGCTGCCACCGCAAGAAGCCCAACTTTGTTCGTTGGCTCTTGCTGCCTGGGCTTGCACTGAA  2520  2540 2560 2580 2600 2620 2640 ACAAATCTCTTTAACGTCAGCAAAAAATAAAAAGATATTTTTTCTAAAGTTTGTATTGTCGTACATTTGGTTTATAATTTTAATATTTAGCGTATCAATTAAATCAATGTGTCTATGTGT 2660 2680 2700 2720 2740 2760 CCGATACTTTCGTGTATTTTGTTATGTTTCTGTGTATCTGCTGGTGTCGTTGCTGCAATTGTTGCTAGCTTGAATAGCTATATATTTTTTATTCTCTTTTGTCAGCAAGCAGACTGAGGA  GCA A G T T T T A  2780 2800 2820 2840 2860 2880 AGCAACAAGAACGACACGCGGAGGAACAAGCTGGTCTACAAAGTGGAGGACGAGGCTGCAATTTATGTGGAGGTCCGGCTGTCCACAGTCCGCGGTCCAAAAGAGATCCG  2900 2920 2940 2960 2980 3000 AGGGCCCACAGAGTCGGCTTAGCATAATAAACGTCAGAATTAATTGGATTTTAATTGTCTGTTAAGCGCTGAAATTAAGTGCAGCAAAACTAGATTGTCGGCCAGGCAGTGGCTGTGGCG 3020 GTGGGCGGTGTTTTGGCGGA  3040 3060 3080 3100 3 120 AAATGTATTGCCAACTCGTAGCTGACTGCTTTATTCAGCCGACTTCAGCCATGAATGGTAGCCCCATTCCCCTTTAAGCCCCCCTTTTGGCCCGATACCG  3140 3160 3180 3200 3220 ATCTTAACAATGCTCAACCAAGCGACACACAGTACACATATGAAGATTATTTGCATGTCTCCGTTCTGGTGGTCGTTTGTCCAACTCCAGCTCCATCTGGACTTAAAACCACAACTCCAA  3240  3260 3280 3300 3320 3340 CTCCAACTCCAGCTACGATCCCAATTTCGATGCCACAAAAAAAGAAAAAGGTACCTTGATGCCGCCAATTGCCCATCTTTGATTGGATGAAATGGTTCGGCATTCTTCATCACAAAACAG  3360  3380 3400 3420 3440 3460 ATCGCATATTAGTAGAAACTAAATAAATATTATACAAATAGAATGAACTTGCTGCAGTGCGAAATATTTTAAATATATATATTTTTGGTTCATTAAGTGTCATTTCAAAAATTTAAATTC  3480  3500 3520 3540 3560 3580 TTTCATTAGTAATTTTTTTACAATTAGCCTTTCTACCGCCTTAGTCCTTGTTTGTTGCCAGCAACATGTTGCTAAATTCCAGCTTGGGACGTCGAGACAAAAAAAAAAAAAAAAAAAAAA  3600  3620 3640 3660 3680 3700 3720 AAATGAAACGAGGAGAATCAACAAAAACAGCAAGACCAAAGGCGACACACGAAAACGTTCAACGAACTTTGGTCGCAGGCTGAAAAAAGTGGACTGGGTGCACACCACTGCGTATACGCA 3740 3760 3780 3800 3820 3840 ATGTTCGGGATGTCAGGACATCAGCTGTTGGCGCTACAGGACTAAGGACCCCGGGTCTAAAGACTCAGGACTCGGCTCATTTTGATTTACGCCCAGTGGCAAAAGAAGCCGAGGAGCGAA 3860 3880 3900 3920 3940 3960 AGCCGAAGACGAGCGGCAAAAGGTTGAATGGAGTTCAATGCACTCCGATGACGTTAGGGATAATCCAGCAGGACGGCAGGCCTCCAGGACTTGTCTTGCTGTGTGTGCGTTAGTCAGTGT 3980 4000 4020 4040 4060 GTATGGACACGCACACGTGCCTGTGCACAGAGAAAAATGAAATGTTACTTTGTGCAAAAGCATTGGCTTATCGATGCTTTAACCTAATAATGCAGAGTTTCATTGGTAATTCTAGAGTCC  A  4080  4100 4120 4140 4160 4180 4200 ACTAACTTAAACTTTTAACTTTCACTCGTTTAAGTAGTAGAAACAAAATTTTTTTATTCAAGTTCAACATTTTTGGTAAAGATTGTATTGTCGGAATGAAGTTCATTGTTATTTATTTG  4220 4240 4260 4280 4300 4320 AATAAATTATTATTTCATTCATTTCATTTTGTTCGACTTAGGTCAATGTTTTTTTTTTTTTTGCAGTGCAGGATCCCGGATCCTGGGCGCATCCTGCTGAGGGCCATTGGCTTTTTGGGC 4340 4360 4380 4400 4420 TTCGCGGCGCGTCGGCAGTTTCGGCGTCTTCGTAGGGCTTCGGACTTTTCGGTCTGCCGGCTTTTATTTTATGCCATTCCATTTTCGGGAGTCAATGTCCTGCGTCCTGTGCTGGTATCT  4440  4460 4480 4500 4520 4540 4560 GTGTGTGTGTGTGCGTGTTAGTGTGTGGCATGTGTCCTGCAGCGGAGAGCGAGCAAAAAAAAAAAAAAACTTACCAAACGAAAAGAAAAAGTCCTCTATTCGCGCTGGCTTCTGCGTTAC  GCTCGTCACATTTT  4580 4600 4620 4640 4660 4680 ATTAGCCAGTTTGCAGGCTGCAGGACATTGAACGTCGTTCTCCCTGCGCGAGTCCTTTGTGTCGCAATAAATAACACACACATCAGTGTGTTAGTGTGTGTGTGTG  4700 4720 4740 4760 4780 4800 TTCGAGTGTTTGTGTGGGCCTTCCCTGCTTATTTTTGTTTTCTTCGGCTGCCTGTTATTTGTGTCCTTTTTGGGTTTAGATGTTGTGGGTGCATTGAACTGCAGGCCGCCTTCTTGACGC  TTTTTTGGGGGCA  4820 4840 4860 4880 4900 4920 ATTTGTGTTTGAATTTGGCGGAACGTAGTTTTATATACCCTCTCCACGGCATGGTCATTAATTATATATTTTTTTACTGGCCACATTGTTTTCAAAATATTTAACGA  4940 4960 4980 5000 5020 5040 TTTTGAGGAGATTTCAAGTCAAAATCGAAGAATTATCATTTTTATTTTAAAAATTAAGGTTTAGTTACCCAAAGATAAAGAAAATTAAATGAAAATAAACTAAGATTATTTGAGCAGTGT  TTGTTCATAGTTCTA  5060 5080 5100 5 120 5 140 5 160 ACCACTATTGCTTTGTTTGAATTTTGAAATCAGTATTATCGTTTTCTTATGACATAAGTTAGTTCCAGCGTTAAGGCTTTTATTTTCACAGGGTATGCCCAATTC  5 180 5200 5220 5240 5260 5280 GATTTTCGATCTGCGATGAACTGTCAAAGGTTTTTGTGTGCGCGGCAGTTTTCTTTTTTTTTTTTGCCAAACAATGGGTAGCGCCGAATATCCGCATATATATTCCGATGCACCGTTATC 5300 5320 5340 5360 5380 5400 CAGGACTTTTTGCGGATTAGGGCCTTGACAATTGCGAGGGCGAGCAATGTTAAGGGTTAAGGGATCAGGGTCGAAAGCAGCTGGCTTCCTCTAACGGGAACTCTTAACCCTAAGCATATT 5420 5440 5460 5480 5500 5520 TTCGGCGTTTCTTTTCTTTTGTGTGCGCTGAATTCTTTTTTCTTTTACACTTATTACGCTTTTTTGTGTGTGTATTTTATTTAATTTTTTTTTTTTTTTTGGGATAGCGCTAATGATGAT  GA  5540 5560 5580 5600 5620 5640 AGCGGCCAGGGGCGGGCGGAAAAAAGGGGTAGCGGGTGTTTTGGAACAACTGGCAACTGTCTCCTTGATGCGTCCTTCAGGAGCTCTCTGGCGCATGACTTTTGCCTTCTTCTGCTGC  5655 S670 5685 5700 5715 5730 CAACTTCTGTTGCAAGTCACAAAAATACAAAACAAAAAACGAGACAAAAATGTGCTGCGTTATTTTCTCCTTATTTTCTCCTTTTTTTTATTATTATTT  -48-  a l l serine genes found at 12E and 23E i s shown i n Figure 10. The 5' flanking sequences are separated from the coding sequences by their number designations (i.e.777, 444) which correspond to the v a r i a n t p o s i t i o r i s t h a t d i s t i n g u i s h the v a r i o u s gene types (positions 16, 34, and 77). Patterns of sequence conservation are evident in the 5' flanking sequences of some of these genes. Each of the f i v e genes that have t R N A  S e r 7  anticodons  (777,774,474)  are immediately preceded by a common pentanucleotide 5 ATPyAA 1  beginning at positions -5 to -7 from the f i r s t nucleotide of the mature tRNAs. This sequence i s included i n the primary transcript as judged by i n v i t r o t r a n s c r i p t i o n communication) . The  (D.St. Louis, personal  t h r e e 7-77 genes share an  additional  hexanucleotide 5* CAAPyTT beginning at positions -23. to -25. This sequence i s not present i n the v a r i a n t 774 or 474 qenes. The two 444 genes i n pDt27R have neither of these consensus sequences but share a different octanucleotide, 5' TTGGGNTT, at positions -21 to -23. They a l s o share a s i m i l a r 5'AAPyAA pentanucleotide at positions -5 to -8. The consensus boxes around position -20 l i e outside the primary transcripts ( r e f . as above) and may play some role i n the modulation of qene expression (see discussion). The coding regions of the d i f f e r e n t genes are shown i n the central portion of Figure 10. The v e r t i c a l boxes highlight the distinguishing nucleotides between the d i f f e r e n t gene types. The changes in the v a r i a n t genes (474,774) suggests something more than simple point mutations and emphasize t h e i r hybrid'nature (see discussion). The oligo-thymidylate residues 3' to the coding  1  -49-  Figure 10. Structure o f s e r i n e tRNA genes isolated from 12E and 23E. The coding  sequences o f seven genes are shown i n block  l e t t e r s s t a r t i n g 5' at p o s i t i o n +1 and ending 3' at position +82. The  top and bottom sequences are shown i n f u l l and correspond,  r e s p e c t i v e l y , to g e n e s  encoding tRNA  Ser 7  and tRNA^  Ser  .The  three p o s i t i o n s t h a t d i s t i n g u i s h these genes are i n v e r t i c a l boxes that include the corresponding positions i n the abbreviated sequences o f the o t h e r genes. S o l i d  lines indicate  homologous  nucleotides. The l e t t e r d e s i g n a t i o n s o f the v a r i o u s genes ( i e . 777, 444) are based on t h e i s o a c c e p t o r resemblance a t these v a r i a n t p o s i t i o n s . The immediate 5  1  and 3*  flanking  sequence  around each gene are shown i n small p r i n t with regions of interest highlighted  i n block l e t t e r s .  Upstream, these i n c l u d e boxed  sequences that are shared between  the t h r e e d i f f e r e n t 777 genes  at p o s i t i o n s -5 to -7 and -23 to -25. The two 444 genes share d i f f e r e n t boxed sequences a t analogous p o s i t i o n s . Downstream the 3' oligothymidylate t r a c t s are u n d e r l i n e d i n a l l except the 474 gene (see Text for d e t a i l s ) . The plasmids from which these genes were sequenced and the chromosomal derived are shown on the r i g h t .  s i t e s from which they are  -50-  in  -51-  sequences are a l s o shown. T h e i r presumably r e s u l t s from the  absence  i n the 474  intervening  Hindlll  gene i n pDt73 site  used  in  cloning.  Additional  tRNA G e n e s i n pDt27R  Evidence t h a t more tRNA genes might e x i s t i n pDt27R came from detailed  restriction  hybridizations with  mapping  4S  RNA  clusters of r e s t r i c t i o n sites  on  the  right  Restriction  fragments  w e a k l y . The  nucleotide  restriction  sites  sequences t h a t (Figure  11).  arginine  arginine  can  in  side this  folded an  (5'CGA). T h i s  arginine  of  (3-5)  around  the  reqion  and  Southern  showed  insert  in  hybridized  Figure 4S  these  within  four  identical  tRNA c l o v e r l e a f  anticodon tRNA  A r g  are  (5'UCG) t h a t i s 85%  tRNA minor  A r g 2  2a.  RNA  that  into  that  each o f the BamHl  shows  isoacceptor  isoacceptors  4)  shown). T h i s  occurred  contained  be  Figure  not  sequence  These have  codon  only major  are  (data  sites  hand  (see  very  clustered 73  bp  structures decodes  homologous to (45) . A l l  species  chromatographic p r o f i l e s o f amino a c i d acceptance  as  the  other  judged  (1). This  Although  there  this  tRNA  ,  i s no c r o s s h y b r i d i z a t i o n ; g e n e s f o r the l a t t e r l o c a l i z e  to  42A  and  84F w i t h no g r a i n s a p p e a r i n g  and  the  genes f o r t R N A  A r g  (5).  homologous  over 12E,  to  tRNA  4S  2  A r g  i s 85%  by  fact  might account f o r the weak h y b r i d i z a t i o n between the genes and RNA.  an  A r g  the s i t e o f pDt27R  -52-  5  T  A A  P  T  G  C  G  C C G  G OH C T G G C A C TGT  G A C C G T G  G  G  GGC A  A  C T  C  A  G  G  T  G  T  A  *  T  C  T A  G  A  CC  T C G G  A G C C  A  T  AG  * A G  T  C  G 36  Figure  11.  Cloverleaf  structure  of  the  from a s i n g l e s t r a n d o f the gene sequence. The the a n t i c o d o n a t p o s i t i o n 36  tRNA  A r g  predicted  third nucleotide  c o r r e s p o n d s t o the  f i r s t basepair  the BamHl r e c o g n i t i o n s i t e p r e s e n t i n each gene copy.  of of  -53-  A novel  feature o f these  tRNA  genes  A r g  t h e i r f l a n k i n g DNA. T h e y a r e a r r a n g e d homologous  flanking  i s the structure of  a s tandem d u p l i c a t i o n s o f  sequence o f d i f f e r e n t u n i t l e n g t h  200 b p ) . The s i z e o f t h e d u p l i c a t e d  segments  vary  (600 and  only  i n the  amount o f 5' f l a n k i n g sequence i n c l u d e d . The 5' sequence o f genes 1 and 2 ( F i g u r e  12) a r e 97% i d e n t i c a l  genes 3 and 4 s h a r e o n l y  30 bp (a) . A l l t h e g e n e s have t h e same  70 bp o f 3* f l a n k i n g s e q u e n c e repeat  f o r 455 b p (A) w h e r e a s  (B) . I n a d d i t i o n  length, the d u p l i c a t i o n s v a r y  to variation in  i n t h e i r degree o f homology.  Genes 1, 2, and 3 h a v e o n e o r two m i s m a t c h e s between them over 102 bp o f common s e q u e n c e . Gene 4, h o w e v e r , c o n t a i n s a t l e a s t 18 mismatches y e t i s p a r t o f a d u p l i c a t i o n u n i t t h a t i s o f i d e n t i c a l s i z e t o t h a t c o n t a i n i n g gene 3. Each r e p e a t  i s flanked  lower p o r t i o n o f F i g u r e has e i g h t bp r e p e a t s the a d j a c e n t  by j u n c t i o n  12. The l e f t m o s t  a t i t s termini  600 bp r e p e a t  (5'CCCAA) a t t h e 5' j u n c t i o n repeat  present  (III) c o n t a i n s  five  bp o f t h e sequence  ( I I ) . The 3' end o f t h i s second 600 an a d d i t i o n a l  I V and V ) . The 5' h o m o l o g y  22 bp t h a t  repeats  that  between  segments.  t w i c e and h a s d y a d symmetry  a r e common t o t h e t e r m i n i  Dyad  symmetries  exist  are also  c o n t a i n i n g genes 3 and genes  ends p r e c i s e l y a t p o s i t i o n - 3 0 . The s e q u e n c e a t t h i s (S'TTGGG) i s r e p e a t e d  (gene 1)  (gene 2) b e g i n s w i t h i n t h i s e i g h t bp  around each o f t h e 200 bp r e p e a t s  4 (junctions  600 bp r e p e a t  (5 * TAGCCCAA). Homology w i t h  s e q u e n c e and a p p e a r s t o d u p l i c a t e  bp  s e q u e n c e s shown i n t h e  3 and 4 position  w i t h t h e 8 bp  o f a l l the duplicated  at four  out of five  of the  -54-  F i g u r e 12. S t r u c t u r e o f t h e r e p e a t s  c o n t a i n i n g four  tRNA  A r g  genes i n pDt27R. The genes a r e i n open boxes s e p a r a t e d by f l a n k i n g sequence r e p r e s e n t e d mark the l i m i t s  as s o l i d  lines.  of the repeats  Nucleotide  are indicted  (gene 1).' Genes a r e n u m b e r e d  left  to  p o s i t i o n s that  i n the l e f t  right  i n t h e 5' t o  d i r e c t i o n o f t h e n o n - c o d i n g s t r a n d shown i n F i g u r e 9. homologies a r e i n d i c a t e d  by s h a r e d  (97-99% i d e n t i c a l ) . The f l a n k i n g repeat  (82% i d e n t i c a l )  letters  i s indicated  j u n c t i o n s w i t h unique sequence  i . e . A=A,  sequence o f the as a  1  and  (U) and repeated  repeat  less B . 1  3'  Sequence a=a,  B=B.  homologous  E a c h o f the  sequence  (A,a,B,)  a r e i n d i c a t e d by roman n u m e r a l s . The n u c l e o t i d e sequence a t these sites  (I - V) a r e shown below.  A, a, B, and U  1  a r e boxed  Here  to h i g h l i g h t  the p o s t u l a t e d j u n c t i o n s . S e q u e n c e termini o f the  gene 1 r e p e a t  u n d e r l i n e . Arrows  t h e sequence from  indicate  j u n c t i o n s I , I I I , IV, and V.  t h e sequences l o c a t e d a t  not present  (1,11)  r e g i o n s U,  a t the 5  1  and 3'  a r e i n d i c a t e d w i t h a broken  r e g i o n s o f dyad  symmetry  found  at  IV -30  -455  U I  B  B & IV  EI  +70  B  „, u  I cn cn I  A  -455 CCCAACCCAAACACACCAACACCACCC  -30  a  G G G A G A T T C C C l T A G C C C A A C C C A T T T G T G T A A C C T G A G A AAfT T G G G A A T T T G G G  B V  +70  CTCGCATTGTGlTAGCCCAAlACACAACAACACCACCC  GGGAG A T T C C C T AG  III  -EQ-  U'  G G G A G A T T C C C J T A G C C C C A C T C A T T T G T G T A A C C T G AG[TG C G G T A A G C A G C A A  -56-  junctions d e s c r i b e d  h e r e . The  basepair repeat o f junction I  exception (5'CCCAA).  d i f f e r e n t sequences around d i f f e r e n t  ( I I ) c o n t a i n s the f i v e These symmetries  involve  r e p e a t s and a r e i n d i c a t e d i n  F i g u r e 12. The j u n c t i o n a t (V) i s m i s s i n g t h r e e t e r m i n a l a d e n y l a t e r e s i d u e s where i t j o i n s u n i q u e  sequence  200  have  bp  and  600  bp  repeats  demonstrate the s t r i k i n g  precision  ( U ) . Otherwise, b o t h t h e  identical  endpoints  o f a d u p l i c a t i o n process that  o c c u r r e d a t times s e p a r a t e enough t o a l l o w a t l e a s t 18% d i v e r g e n c e t o accumulate  Other  Genes  tRNA  o f s e r i n e tRNA genes a t 12E genes  A r g  A r q  tRNA g e n e s  l o c a t i o n . The genes d e s c r i b e d  additional tRNA  DNA  h a v e more t h a n one  a b o v e a r e d e r i v e d from t h e c l u s t e r  a genomic  translated  derived  from pDt27R. The probe  probe  S o u t h e r n was  containing  result  on  containing  o f a second  the a u t o r a d i o g r a m A r g  genes  that (this  shows t h a t each r e s t r i c t i o n d i g e s t t h a t h y b r i d i z e the probe  127  identical  are repeated elsewhere  tRNA  performed  gene c o d i n g  using  sequences  (200 bp BamHl fragment) c o n s i s t s o f  the 3* h a l f o f one gene s e p a r a t e d by  sequences  chromosomal  . In o r d e r t o t e s t f o r the presence o f  a nick  from the 5' h a l f  sequence  (above).  for  Most D r o s o p h i l a  and  quite  bp o f f l a n k i n g gene.  sequence  I f these flanking  i n t h e genome t h e n b a n d s do  not represent  was  not  tested).  may  fragments Figure  13  p r o d u c e s 3-4 genomic fragments  strongly  and  1-2  others l e s s so.  "-57-  Figure  13. G e n o m i c  probe. D r o s o p h l i a with  Hindlll  separted  on  (Ore R)  (lane a  fragments genomic  a ) , EcoRI  0.8%  agarose  t r a n s f e r r e d t o G e n e s c r e e n and 0.2 kb BamHl f r a g m e n t 6 5 ° C . The with  an  Figure  (2 x 10  a u t o r a d i o g r a m was  intensifying  3, 4, and  5.  screen.  that  DNA  (lane  (10-15 b)  and  g e l . The hybridized cpm)  hybridize ug)  Xhol  DNA  a tRNA  was  r  g  digested  (lane  c)  fragments  and were  w i t h a nick translated  f r o m pDt27R f o r 24 hours a t  exposed  f o r 24  S i z e markers  hours at  -70°C  a r e t h e same a s i n  .54  -59-  Th e  weaker b a n d s may r e s u l t  from  polymorphisms i n t h e n o n - i s o g e n i c DNA was p r e p a r e d .  In t h e H i n d l l l  s t r o n g e r bands. The 6.4 kbp band corresponds The  partial  f l y p o p u l a t i o n from which t h e digest  fraqment cloned  strong h y b r i d i z a t i o n i s expected  band  i s 5.5  this  ( l a n e a) t h e r e a r e t h r e e  i s t h e most i n t e n s e and p r o b a b l y  t o t h e 6.4 k b p H i n d l l l  f l a n k i n g sequence)  homologies o r from  from  i n t o pDt27R.  t h e f o u r g e n e s (and  f r a g m e n t c o n t a i n s . The second s t r o n g e s t  kbp i n l e n g t h  and a s j u d q e d  by h y b r i d i z a t i o n  i n t e n s i t y might c o n t a i n two t o t h r e e genes. The t h i r d  fragment i s  2.7 kbp and s h o u l d c o n t a i n a s i n g l e gene a c c o r d i n g t o t h e above. By t h i s c o u n t  t h e g e n o m i c c o p y number o f g e n e s f o r t R N A  A r g  is  7-8. Using coding  single  sequences  stranded  M13 p r o b e s  pers.  the base o f t h e X chromosome  regions  plasmids  (S.Hayashi,  pers.  s i n g l e gene (2.7 kbp H i n d l l l kbp  A r g  by i n s i t u h y b r i d i z a t i o n  comm). I n a d d i t i o n t o t h e m a j o r  t h e r e a r e two w e a k e r s i t e s  with recombinant  tRNA  ( J . Leung p e r s . comm.), t h e chromosomal l o c a t i o n  o f a d d i t i o n a l s i t e s has b e e n d e t e r m i n e d (S. H a y a s h i  containing only  site  a t 12E  a t 85C o n chromosome 3R and  19F on  ( F i g u r e 1 4 ) . P r e l i m i n a r y experiments that h y b r i d i z e to these comm.) i n d i c a t e t h a t  19F c o n t a i n s a  f r a g m e n t , F i g u r e 13)  H i n d l l l fragment) a p a i r o f genes (unpublished  chromosomal  and  85C (5.5  observations).  -60-  F i g u r e 14. M13  tRNA  A r g  H y b r i d i z a t i o n of  probe  (67  I-labelled  bp. H a e l l l / D ' d e l f r a g m e n t  courtesy of J.Leung) to p o l y t e n e larvae 35°C  gtV/y  of  (as d e s c r i b e d  sc  i n r e f . 5)  x 10  developed  stranded  i n M13mpl0,  chromosomes f r o m t h i r d  I n ( l ) g t  Q 2.9  single  x  1  1  f o r 90  in  formamide  hours.  The  instar  buffer  at  p r o b e was  at  Q  m o l e s N/1 a f t e r 15-16  r e g i o n s 12E  (upper),  and  3.9  x l 0 • dpm/ug. A u t o r a d i o g r a p h s  d a y s e x p o s u r e . G r a i n s appear over 19F  i s c o u r t e s y o f Dr. S h i z u  ( m i d d l e ) , and Hayashi.  85C  were  polytene  (lower). This figure  -61  -62-  Discussion  tRNA Gene  Organization  The r e c o m b i n a n t p l a s m i d s d e s c r i b e d tRNA g e n e s d e r i v e d plasmid,  pDt5,  f r o m two d i f f e r e n t  contains  a  in this  t h e s i s contain  chromosomal  s i n g l e gene  that  sites.  One  corresponds to  Ser tRNA^  and h a s b e e n l o c a l i z e d  polytene  region  minor  sites  tRNA ^ 4  the  major  contains tRNA  23E on chromosome  seen  by  ( 5 ) . The  S e r 7  in situ two  in situ  in situ  2L  site  at  identical  h y b r i d i z a t i o n to  (45). This  i s one o f t h e  h y b r i d i z a t i o n with  second p l a s m i d , 12E  oh  tRNA^  genes. Other s e r i n e  A r g  by  purified  pDt27R, i s d e r i v e d  the  from  t h e X chromosome and  genes  and  four  identical  tRNA g e n e s h a v e b e e n d e s c r i b e d  d i f f e r e n t plasmids a l s o d e r i v e d  f r o m 12E  on  (22). These i n c l u d e two Se r  genes  identical  to  the  gene  v a r i a n t genes t h a t a r e i d e n t i c a l respectively  i n pDt5  (tRNA  ) and  7  two  e x c e p t a t one and two p o s i t i o n s ,  ( 774,474, F i g u r e 1 0 ) .  These r e s u l t s show t h a t contains multiple c o p i e s  12E  i s a complex  of i d e n t i c a l  gene c l u s t e r t h a t  and d i f f e r e n t tRNA genes.  I d e n t i c a l c o p i e s o f some genes a t 12E a r e a l s o found a t d i f f e r e n t chromosomal  sites  (i.e.  23E).  In s i t u  hybridization  with  Se r tRNA , 4/  7  predicts that  e x i s t a t 56D and  64D  A r g  genes  for serine  but recombinant clones  have n o t y e t b e e n o b t a i n e d tRNA  further sites  likely  (5). Also,  exist  at  19AB  tRNA  from these  genes regions  a d d i t i o n a l s i t e s f o r the and  85C.  These r e s u l t s  -63-  further  illustrate  gene c o p i e s  the d i s p e r s e d  arrangement  o f m u l t i p l e tRNA  i n Drosophila.  I t i s n o t known how these d i s p e r s e d gene c o p i e s a r e in  vivo. Studies  using  in vitro  transcription  expressed  s y s t e m s show  t h a t each gene appears t o be an independant t r a n s c r i p t i o n u n i t and g i v e s r i s e t o primary mature  RNA.  These  transcripts  initiate  sequence and t e r m i n a t e follow  3"  2-10  bp  i n the s t r i n g  to a l l e u k a r y o t i c  sequence i s not p r e s e n t t h e RNA i t meets f o u r o r more dT processed  t h a t a r e processed 5'  t o the mature  o f thymidylate  tRNA  down t o the  genes  coding  residues that  (9). If this  latter  polymerase I I I w i l l c o n t i n u e  r e s i d u e s and g i v e s  rise  until  to a properly  tRNA and a d i s c r e e t run o f f t r a n s c r i p t (10).  I t has been shown t h a t t r a n s c r i p t i o n i n i t i a t i o n r e q u i r e s two sequence  blocks  located  within  I n i t i a l o b s e r v a t i o n s suggested necessary  f o r normal  modified.  A  extracts  described tRNA  L y s 2  mature  for  gene  coding  a  tRNA  A 2  for efficient  (11). Negative  modulating  d i f f e r e n t  (48) . B o t h sequence.  sequences i s a g e n e r a l explain the conserved  coding  sequence.  t h a t 5' f l a n k i n g sequences were n o t  transcription  Drosophila  upstream sequence  the mature  are  (46) b u t t h i s r  g  gene  v i e w has been  requires  transcription  33  bp  in cell  of  free  5' s e q u e n c e s h a v e a l s o been  t R N A  A  r  g  2  located  gene  within  If transcription  (47) 30  bp  and  a  of the  m o d u l a t i o n by  5'  f e a t u r e o f D r o s o p h i l a tRNA genes i t might s e q u e n c e s shown i n F i g u r e  10. The  three  Se r tRNA  7  beginning  genes  e a c h a r e p r e c e d e d by two  a t p o s i t i o n s -5  t o -7  small  (5'ATPyAA) and  sequence a t -23  boxes to  -25  -64-  (5'CAAPyTT) . I t s h o u l d  be  located  chromosome  on  a different  genes a l s o have (5'AAPyAA) and  of  other  ref.ll are  or  poorly.  imply  a l s o seen (8,12).  Therefore  genes  that  clustering  in  tRNA ^  7  cloned  sequences yet DNA  ( 5 ) . The  in this  site  s i t u 12E  need  arrangement can located  on  to  5'  to d i f f f e r e n t  copies  -8  authors  identified  in  in vitro  known t o t r a n s c r i b e  this  region  not  only  a plasmid  be be  does  r e l e v a n t to  discreet sites  not at  i n pDt5. The  genes  only  purified  i n 20  kbp  a fraction  of  of the  tRNA g e n e s w i t h i n  ( i . e . 42A  r e f . 8 ) so the  where more t h a n  ( p D t l 6 , pDt27R) and  (>400 b p ) .  site  intensity of  or  dramatically higher. discerned  identical  existance of  the  (3)  10  ( 7 ) . However, evenly  by  RNA  contains  the  e v i d e n t a t the 23E  i s suggested 4S  their  around  s e v e r a l copies of  i s probably  insert  r e l a t i v e l y tight linkage  be  i s not  with  site  c l u s t e r a r e not d i s t r i b u t e d complement  p o s i t i o n s -5  conservation  kbp have been a n a l y s e d  additional genes at t h i s  total  S e r 4  at  However t h e  may  at  and d i f f e r e n t genes (above) . T h i s  S e r  tRNA  systems.  genome. Each s i t e a p p e a r s t o c o n t a i n  hybridization  two  (5'TTGGGNTT).  in vitro  tRNA  is their  because o n l y 4.4  genes i s  a f u n c t i o n i n t r a n s c r i p t i o n modulation, using  feature of  4  of these  ( p D t 5 ) . The  between g e n e s t h a t a r e  l e a s t as o b s e r v e d  expression  one  t h a t the modulatory sequences  efficiently  A  t o -23  sequences are  conserved  necessarily  that  sequences  tRNA gene f a m i l i e s  note  not  conserved  a t -21  Conserved  noted  Their  a  total exact  one  gene i s  this  shows a  -65-  Th i s c l u s t e r i n g  i s d r a m a t i c when compared  kilobase pairs that are devoid  t o the hundreds o f  o f tRNA g e n e s . T h i s i s e s p e c i a l l y  e v i d e n t on t h e X chromosome where t h e 12E s i t e i s the o n l y major tRNA gene l o c u s on the e n t i r e autosomes  chromosome. In c o n t r a s t each o f the  (except t h e f o u r t h ) c o n t a i n 30-40 major and minor s i t e s .  Whether each o f these r e p r e s e n t s a c l u s t e r  i s not y e t known. The  p a u c i t y o f s i t e s on t h e X chromsome may be r e l a t e d t o i t s s p e c i a l function  i n sex  differentiation  and  in particular  to the  requirement f o r dosage compensation i n males. The s i g n i f i c a n c e o f t h i s  dispersed  c l u s t e r e d arrangement o f  tRNA genes i n D r o s o p h i l a i s n o t known. Some a n a l o g y might be drawn from  results  o f a n a l y s i s o f RNA  appears t h a t  related  genes  d u r i n g development i . e . heat genes  shock genes ( 5 3 ) , two  Conversely,  related  in clusters  c h o r i o n genes  ( 5 1 ) , 68C yolk  p o l y m e r a s e I I g e n e s . Here i t  salivary  protein  genes t h a t  are expressed  together  ( 4 9 ) , h i s t o n e genes g l u e genes  genes  ( 5 4 ) , HDL  are dispersed  (50) ,  (52), c u t i c l e genes  (55).  a r e expressed i n  d i f f e r e n t t i s s u e s o r d e v e l o p m e n t a l s t a g e s i . e . a c t i n genes (56), tubulin genes dispersed different  (57)  loci  . In t h e s e examples  are s l i g h t l y  functions.  t h e gene  different  clusters  a r e t h e number  differently  d i f f e r e n t i a l l y expressed  no d a t a either  exists  have  tRNA genes  What d i s t i n g u i s h e s the  and v a r i e t y  p r e s e n t w i t h i n e a c h . W h i l e a l l tRNA gene are organized  and p o t e n t i a l l y  This contrasts with dispersed  where t h e mature p r o d u c t s a r e i d e n t i c a l . different  p r o d u c t s from  o f tRNA g e n e s  c l u s t e r s i n Drosophila t o show t h a t t h e y a r e  i n a temporal or tissue  specfic  -66-  manner. What has been shown i s t h a t i n the tRNA c o m p o s i t i o n and a d u l t s  ( 1 ) . These  . . .  between  t h e r e i s no marked  first  s t u d i e s would  and  third  not detect  .  difference  larval  instars  differences in  A  i n d i v i d u a l t i s s u e s d u r i n g d e v e l o p m e n t as the tRNAs were e x t r a c t e d from whole organisms. A n a l y s i s o f tRNA d u r i n g the development o f Bombyx m o r i s i l k novel  glands  isoacceptors  relationship  (58) a n d  do  between  d i f f e r e n t i a l expression  bovine lens  appear. tRNA  Thus  gene  (59) shows  that  i n Drosophil a ,  the  organization  and  their  remains t o be d e t e r m i n e d .  C o n s e r v a t i o n o f tRNA Gene C o d i n g Sequences  Except f o r the 3 ' o l i g o d T t r a c t s (see F i g u r e 10) the f l a n k i n g tRNA genes show no are  identical  d i f f e r e n t chromosomal  multiple  sites.  t h e 5* c o n s e r v e d boxes  s e q u e n c e s around each o f the s e r i n e  similarities.  between  and  This  The  coding  genes fact  s e q u e n c e s , however,  copies  a t t h e same o r  h a s prompted  speculation  t h a t r e c t i f i c a t i o n mechanisms o p e r a t e t o homogenize the sequences of multiple necessary  gene  copies.  because gene  s e l e c t i v e p r e s s u r e s on  These  m e c h a n i s m s a r e t h o u g h t t o be  redundancy individual  may  remove o r l e s s e n  genes. This  should  the  result i n  more c o d i n g sequence m i c r o h e r t e r o g e n i t y than i s observed (60,61). The p a r t i c u l a r pathway by w h i c h t h i s homogeneity i s a c h i e v e d may depend on the arrangement o f t h e gene f a m i l y i n q u e s t i o n . The 200 t o 300 tandemly r e p e a t e d  rRNA g e n e s  to undergo unequal exchanges w i t h  i n y e a s t have been shown  s u f f i c i e n t f r e q u e n c y t o account  -67-  f o r t h e i r homogeneity  (62). T h i s c a n n o t be the case f o r d i s p e r s e d  tRNA genes .with d i s s i m i l a r been s u g g e s t e d This  they are maintained  i s a process  located  flanking  anywhere  where  sequences.  I n s t e a d , i t has  by g e n e c o n v e r s i o n  partially  homologous  i n t h e genome c a n  non-reciprocal transfer o f sequence  DNA  r e c o m b i n e and  (63-66).  sequences  result  in a  i n f o r m a t i o n . T h i s i s thought  t o o c c u r v i a h e t e r o d u p l e x f o r m a t i o n between a s i n g l e s t r a n d o f  one  region  any  and  the duplex  mismatches r e p a i r e d perhaps  only  the  of another.  by DNA  i l l u s t r a t e d by mating  type  r e s o l v e d and  synthesis using either  invading  (69,70). That t h i s p r o c e s s  These are  strand  can  be  (67,68),  DNA  as  specific  s w i t c h i n g i n yeast  strand, or  the  and  template  regulated i s  (71). Evidence f o r  the t r a n s f e r o f sequence i n f o r m a t i o n between u n l i n k e d s e r i n e tRNA genes i n y e a s t was Within these  b e s t e x p l a i n e d by gene c o n v e r s i o n events  interconverting  loci  eight  out  of at least  (72). 20  bp  were mismatched. If  heteroduplex  mismatched a s much as gene  formation 10  %  conversion to proceed,  (73) , and then  the i n t e r c o n v e r s i o n o f c l o s e l y may  differ Ser  tRNA^  i n sequence  ) yet  families.  by  apparently  can  occur i f this  less  than  10%  maintained  If interconversion occurs  from  positions  c o n v e r t i n g members  i n the  tRNA_  S e r  i s sufficient for  i s o a c c e p t o r genes. These  genes  of at  (i.e.tRNA^  as  between  f a m i l i e s , the r a t e and d i r e c t i o n must be family  sequences  f a c t o r s must o p e r a t e t o p r e v e n t  related  are  between  Se r  separate these  two  and  gene gene  balanced to prevent  the 12E  other.  The  one  variant  (774,474) c o u l d  be  -68-  explained  by  incomplete  communication)  interconversion  although  they  conserved sequences (above). minor  isocoding  characterized. isoacceptors maintained  species There are  that  The m a i n t e n a n c e o f  Also  tRNA  by  a  single  separate,  closely  flanking  the  coding  frequency  repaired before  as  any  mature coding  embedded of  tRNA  single  sequences.  i n unique  tRNA^  Se r  copy  genes  are  g e n e s and  question o f whether gene redundancy e x i s t s f o r product  o r f o r the d i f f e r e n t i a l use o f product  Some e v o l u t i o n a r y a s p e c t s  The  dispersed  reiterated  i m p l i e s t h a t both DNA  of  aberrant  f l a n k i n g sequences t h a t  and  sequence tRNA^  under  pressures  may  are  might  selective  ).  they  the  sequences  individual  are  when p o i n t  may  that  and  F i g u r e 31 i n r e f 22  suggests t h a t a d d i t i o n a l m a i n t e n a n c e p r e s s u r e s imply  related  DNA.  e v e n t s a c t o n l y on regions  been  r e l a t e d gene f a m i l i e s  be  I t i s e v i d e n t from the d i v e r g e n t  conserved  have not  (74). In t h i s c a s e any  f r o z e n d u r i n g the c l o n i n g o f genomic  5'  represent  nucleotide  i n conversion  i n t e r c o n v e r s i o n events might not  presence of  characteristic  products  g e n e f a m i l i e s (see  mutation h e t e r o z y g o s i t y i s present  The  personal  s e v e r a l examples o f c l o s e l y  r e f l e c t the observed d e c r e a s e  gene c o n v e r s i o n  some  Cribbs  p o s s i b l e i s t h a t they  whose  differ  as s e p a r a t e  lack  (D.  exist. the  returns  to  Ser  This same the  i n c r e a s i n g gene  (60).  tRNA gene arrangement.  nature  d u p l i c a t i o n and  of  tRNA genes i n D r o s o p h i l a  t r a n s p o s i t i o n have o c c u r r e d  -69-  during only  t h e i r e v o l u t i o n . The  be  discerned  sequences and  where  o r i g i n s o f d i f f e r e n t gene c o p i e s  these  events  r e c e n t l y enough t h a t  Because non-homologous s e q u e n c e s  and  they  some f l a n k i n g  r e t a i n some homology.  f l a n k most tRNA genes i t can  concluded t h a t any d u p l i c a t i o n and long ago  included  t r a n s p o s i t i o n events  have s i n c e been obscured by m u t a t i o n a l  Some e v i d e n c e  of  these  two  tRNA  processes  have  be  occurred  drift. been  observed  v  G1 h o w e v e r . The  can  genes  y  at  56F  (16)  r e s u l t e d from a tandem d u p l i c a t i o n o f a 1.1  appear  to 2.0  kbp  to  have  region  (see  Met i n t r o d u c t i o n ) . The (17) and  are s e p a r a t e d could  by  containing  several  r e s u l t from  r e g i o n o r by  The  repeats  the  kilobase  61D  a gene  containing  a n c e s t r a l tandem d u p l i c a t i o n . Gl u  f l a n k i n g sequence homology around the  genes a t  p a i r s o f unique sequence  t r a n s p o s i t i o n of  i n s e r t i o n s b e t w e e n an  a t 62A(15) i l l u s t r a t e  tRNA^  expansion of  the  three  a gene  tRNA  genes  f a m i l y by  unequal  the  tRNA  exchanges between an o r i g i n a l gene p a i r . The genes  homologous f l a n k i n g  i n pDt27R  duplications of  (Figure  12)  200  and  ( i n s e r t i o n s or  600  and  duplication(s)  bp  of  size.  appear of  s p e c i f i c junctions  an  flanking  in length.  deletions)  variation in repeat homologies  suggests  some a n c e s t r a l g e n e . The  included d i f f e r e n t l e n g t h s repeats  sequences around  have  they  tandem  apparently  s e q u e n c e and  results in  A l t e r n a t i v e l y subsequent e v e n t s occurred the  to  arisen  have  the  which r e s u l t i n  four  gene p a i r . A l s o  sequences at  a r o s e by  A r g  mechanism  Three o f  older  four  termini  the  g e n e s have s i m i l a r from there of  more  recent  a p p e a r to  the r e p e a t s  be  that  -70-  perhaps were i n v o v l e d sequence d u p l i c a t e d (75,76). P o r t i o n s  in either  l i m i t i n g t h e amount o f f l a n k i n g  or i n the d u p l i c a t i o n  o f these  junction  (5*CCCAA see Ref.77) will tRNA (85C,  duplicated to y i e l d  be o f i n t e r e s t t o s e e A r g  genes a t e i t h e r  itself  s e q u e n c e s f l a n k each o f the  r e p e a t s and r a i s e t h e p o s s i b i l t y t h a t 12E and s u b s e q u e n t l y  mechanism  a tRNA gene t r a n s p o s e d to  between  s p e c i f i c sequences  t h e gene q u a r t e t i f flanking  o f t h e two  p r e s e n t today. I t  sequences around  other  chromosomal  19AB) bear any homology t o those p r e s e n t a t 12E.  the  sites  -71-  References  1) White, B.N., Dev.  Biol.  Tener, G.M., 33.:  2) Weber, L. and  Holden, J . , and  S u z u k i , D.T.  (1973)  185-195 Berger*  E.  (1976) B i o c h e m i s i t r y  15:' 5 5 1 1 - 5 5 1 9 3) E l d e r , R.T.,  Uhlenbeck, O.C.,  . In " T r a n s f e r RNA: A b e l s o n , and P.R.  and  Szabo, P.(1980)  B i o l o g i c a l Aspects"  (ed. D. S o l i ,  Schimmel) C o l d S p r i n g Harbour  J.N.  Laboratory  pp 317-323 4) Tener, G.M., Grigliatti,  Hayashi, S., T.A.,  " T r a n s f e r RNA: A b e l s o n , and  Dunn, R.,  Kaufman, T.C.,  Delaney, A.,  and S u z u k i , D.T.  B i o l o g i c a l Aspects"  P.R.  Gillam,  (1980) In  ( ed. D. S o l i ,  Schimmel) C o l d S p r i n g Harbour  I.C.,  J.N.  Laboratory  pp 295-307 5) H a y a s h i , S., G i l l a m , I.C., Grigliatti, 76:  T.A.,  and  S u z u k i , D.T.  Dunn, R.,  Tener,  G.M.,  (1980) Chromosoma ( B e r l . )  65-84  6) Hayashi, S.,  G i l l a m , I.C., G r i g l i a t t i ,  (1982) Chromosoma 7) S p i e r e r , P., J.  Delaney, A.,  Mol.  8) Yen,  P.H.  S p i e r e r , A.,  Biol  168:  and Tener,  279-292  Bender, W.,  and Hogness, D.S.  N.  (1980) C e l l  Schmidt, 0.,  S o l i , D. and  (1980)  22: P a r t 1 137-148 Hoveman, B.  (1979)  Chem. _2_57: 10290-10294  10) A d e n i y s i - J o n e s , S.,  G.M.  35-50  and D a v i d s o n ,  9) S i l v e r m a n , S., J. Biol.  ( B e r l . ) 86:  T.A.,  Romeo, P \ H . , and  Z a s l o f f , M.  (1984)  -72-  Nucleic Acids  R e s . 12: 1101-1115  11) Schaack, J . , Sharp, S., Dingerman, T., Johnson Burke, D., and S o i l , D. (1984) J . B i o l .  Chem. 259: 1461-1467  12) Robinson, R.R. and D a v i d s o n , N. 13) Schmidt, 0., and S o i l *  D.  (1981) C e l l  (1981) B i o s c i e n c e  23: 251-259 31: 34-39  14) K a i n e , B.P., Gupta, R., and Woese, C.R. (1983) P r o c . N a t l . Acad. S c i . (U.S.A.) 8 0 : 3309-3312 15) Hosbach, Cell  H.A., S i l b e r k l a n g , M., and McCarthy, B . J . (1980)  2 1 : 169-178  16) Hershey, N.D. and Davidson, N. (1980) N u c l e i c A c i d s Res. 8:  4899-4910  17) Sharp, S., DeFranco, D., S i l b e r k l a n g , M., Hosbach,  H.A.,  Schmidt, T., K u b l i , E., Gergen, J.P., Wensink, P. and S o i l , D. (1981) N u c l e i c 18) A d d i s o n , W.R.,  Acids  A s t e l l , C.R., Delaney, A., G i l l a m , I.C.,  H a y a s h i , S., M i l l e r  J r , R.C., R a j p u t , B., Smith, M., T a y l o r ,  D.M., amd Tener, G.M. 19) A d d i s o n , W.R.,  R e s . 9: 5867-5879  (1982) J . B i o l .  Chem. 257: 670-677  G i l l a m , I.C. and Tener, G.M.  (1982)  J . Biol.  Chem. 257_: 674-677 20) Leung, J . e t a l . m a n u s c r i p t i n p r e p a r a t i o n 21) DeFranco, D., Burke, K.B., H a y a s h i , S., Tener, G.M., J r . , R.C., and S o i l , D.  (1982) N u c l e i c  Miller  A c i d s Res. 10:  5799-5807 22) C r i b b s , D.L. (1982) Ph.D. T h e s i s , U n i v e r s i t y o f B r i t i s h Columbia. 23) Dunn, R., Delaney, A., G i l l a m , I . C , H a y a s h i , S., Tener,  -73-  G . M . , ' G r i g l i a t t i , T.A., M i s r a , V., S p u r r , M.G., T a y l o r , D.M., and M i l l e r  J r . , R.C. (1979) Gene 7: 197-215  24) M e s s i n g , J . (1981) In "Proceedings o f t h e T h i r d  Cleveland  Symposium  on Macromolecules" (ed. A.G. Walton) E l s e v i e r  Amsterdam  : p 143  25) M e s s i n g , J . and V i e r a , J . (1982) Gene 19: 269-276 26) V i e r a , J . and M e s s i n g , J . (1982) Gene 19: 259-268 27) M e s s i n g , J . (1983)  Methods  i n Enzymology 101: 20-78  28) M a n i a t i s , T., F r i t s c h , E.F., and Sambrook, J . (1983) M o l e c u l a r C l o n i n g : A L a b o r a t o r y M a n u a l C o l d S r i n g Harbour Laboratory 29) Danna, K. (1980) M e t h o d s  i n Enzymology 65: 449-467  30) Smith, H.O. and B i r n s t i e l , M.L. (1976) N u c l e i c A c i d s Res. 3:  2387-2398  31) Maxam, A.M. and G i l b e r t , W. (1980) Methods i n Enzymology 65: 499-560 32) Rigby, P.W.J., Dieckmann, M., Rhodes, C., and Berg, P. (1977) J . M o l . B i o l .  113: 237-251  33) Sanger, F., N i c k l e n , S., C o u l s o n , A.R. (1977) P r o c . N a t l . Acad. S c i . (U.S.A.)  74: 5463-5466  34) Gronenborn, B., M e s s i n g , J . (1978) Nature (Lond.) 272 375-377 35) D r e t z e n , G., B e l l a r d , M., S a s s o n e - C o r s i , P., and Chambon, P. (1981) A n a l . B i o c h e m .  112: 295-301  36) Putney, S.D., Benkovic, S.J., and Schimmel, P.R. (1981) P r o c . N a t l . A c a d . S c i (U.S.A.)  78:7350-7354  -74-  37) Guo, L-H. and Wu, R.  (1982) M e t h o d s  i n Enzymology 100:  60-96 38) M i l l e r , J.H. (1972) E x p e r i m e n t s i n M o l e c u l a r g e n e t i c s C o l d S p r i n g Harbour L a b o r a t o r y 39) H e i d e c k e r , G., M e s s i n g , J . , and Gronenborn, B. (1980) Gene JL0:  69-75  40) Ponz, M., S o l o w i e j c z y k , D., B a l l a n t i n e , M., Schwartz, E., and  S u r r e y , S. (1982) P r o c . N a t l . A c a d . S c i . (U.S.A.) 79  : 4298-4302 41) Hong, G.F. (1982) J . M o l . B i o l . 42) Barnes, W.M., 101:  158: 539-549  Bevan, M., and Son, P.H. Methods i n Enzymology  98-122  43) Guo, L-H, Yang, R.C.A., and Wu, R. (1983) N u c l e i c A c i d s Res. 11:  5521-5540  44) Staden, R. (1980) N u c l e i c  A c i d s Res. 8: 3673-3694  ,  45) Rajput, B. (1980) M.Sc. T h e s i s , U n i v e r s i t y o f B r i t i s h Columbia 46) Sharp, S., DeFranco, D., Dingerman, T., F a r r e l l , P., and S o i l , D. (1981) P r o c . N a t l . A c a d . S c i . (U.S.A.)  78: 6657-6661  47) Dingerman, T., Burke, D.J., Sharp, S., Schaack, J . , and S o i l , D. (1982) J . B i o l .  Chem. 257: 14738-14744  48) DeFranco, D., Sharp, S., and S o i l , D. (1981) J . B i o l . Chem. 256:  12424-12429  49) S p r a d l i n g , A.C., Digan, M.E., Mahowald, A.P., S c o t t , M., and C r a i g , E.A. (1980) C e l l  19: 905-914  50) G o l d b e r g , D.A. and Hogness, D.S. u n p u b l i s h e d  results.  -75-  51) C o r c e s , V., Holmgren, R., Freund, R., Morimoto, R. and Meselson, M.  (1980) P r o c . N a t l . A c a d . S c i . (U.S.A.)  77  5390-5393 52) Meyerowitz, E.M. 53) Snyder, M.,  and H o g n e s s , D.S.  (1982) C e l l  H i r s h , J . and D a v i d s o n , N.  28: 165-176  (1981) C e l l  25:  167-177 54) B a r n e t t , T., P a c h l , C , Cell  2_1:  Gergen, J.P., and Wensink, P.C.  (1980)  729-738  55) Synder, M. and D a v i d s o n , N.  (1983) J . M o l . B i o l .  166:  101-118 56) F r y b e r g , E.A., Mahaffey, J.W., N.  (1983) C e l l  33:  115-123  57) K a l f a y a n , L. and W e n s i n k , 58) Sprague, K.U., 11:  P.C.  (1982) C e l l  29: 91-98  Hagenbuchle, 0., and Zuniga, M.C.  (1977) C e l l  561-570  59) L i n , F-K, F u r r , T.D., and  B e v e r l y , J . Bond, and Davidson,  Chang, S.H.,  Ortwerth, B . J . (1980) J . B i o l .  60) Edelman, G.M. Study Program"  and G a i l y , J.A.  Horwitz, J . , A g r i s ,  P.F.  Chem. 255: 6020-6023  (1970) In " N e u r o s c i e n c e s : Second  (ed. F.O. Schmidt) R o c k e f e l l e r U n i v e r s i t y P r e s s  New York, pp 962-972 61) Dover, G,  (1982) N a t u r e  62) S z o s t a k , J.W.  and Wu,  R.  (Lond.) 299: 111-117 (1980) N a t u r e (Lond.) 284:  426-430 63) S c h e r e r , S. and D a v i s ,  R.W.  64) J a c k s o n , J.A. and F i n k , G. 306-307  (1980) S c i e n c e 209: 1380-1384 (1981) Nature (Lond.) 292:  -76-  65) N a g y l a k i , T. and P e t e s , T.D. 66) K l i e n , H.L. and P e t e s ,  T.D.  (1982) G e n e t i c s 100;315-337 (1981) Nature (Lond.) 289:  144-148 67) Markham, P. and Whitehouse, H.L.K. (1982) Nature (Lond.) 295:  421-423  68) S t r a t h e r n , J.N., K l a r , A.J.S., H i c k s , J.B., Abraham, J.A., Ivy,  J.M.,  Nasmyth, K.A.,  and M c G i l l ,  C.  (1982) C e l l  31  : 183-192 69) H o l i d a y , R.  (1964) G e n e t . R e s . 5: 282-304  70) Whitehouse, H.L.K. (1982) G e n e t i c Recombination, Understanding t h e Mechanisms 71) K o s t r i k e n , R.,  J . W i l e y and Sons, New  S t r a t h e r n , J.N., K l a r , A.J.S., H i c k s , J.B.,  and H e f f r o n , F.  (1983) C e l l  35: 167-174  72) Munz, P., Amstutz, H., K o h l i , J . , and Leupold, U. Nature  (Lond.) _300:  (1982) P r o c . N a t l . Acad. S c i .  762-766  74) N i c o l a s , A. and R o s s i g n o l , 75) S t r i e s i n g e r , G.,  J-L.  (1983) EMBO 2: 2265-2270  Okada, Y., Emrich, J . , Newton, J . , T s u g i t a ,  A., T e r z a g h i , E. and Inouye, M. Symp. Q u a n t .  Biol.  31:  (1966) C o l d S p r i n g Harbour  77-84  76) A l b e r t i n i , A., H o f e r , H., C a l o s , M., Cell  29:  (1982)  225-231  73) Das Gupta, C. and Radding, C M . (U.S.A.) 79:  York  and M i l l e r , J . (1982)  319-328  77) Rogers, J . (1983) N a t u r e  ( L o n d . ) 3 0 5 : 101-102  -77-  Appendix I . Maxam G i l b e r t Sequencing  CJ_ 32  P-DNA  a  C o l d DNA  b  G+A  5 ul  10 u l  2 ul  2 ul  300 u l G-buffer  10 u l H O  Reactions.  T+C  C  10 u l  5 ul  2 ul  2 ul  15 u l H,0  c  Modify  2 u l DMS  z  d  3 u l 10%  30 H Z  e  20 u l 5M NaCl 30 HZ  Formic A c i d Time(min)  3  10  10  15  Temp.(°C)  22  37  22  22  Stop  Ethanol -70°C  1  50 u l G stop  300 u l A stop  1 ml  1 ml  g  300 u l Py s t o p 1 ml  300 u l Py s t o p 1 ml  a) S i n g l e end l a b e l l e d r e s t r i c t i o n fragment t h a t was i s o l a t e d from p o l y a c r y l a m i d e g e l s as d e s c r i b e d i n r e f . ( 3 1 ) . Cerenkov measure o f r a d i o a c t i v i t y a t l e a s t 1000 cpm p e r m i c o l i t r e . b) S o n i c a t e d c a l f thymus DNA a t 1 mg/ml. c) 50 mM Na c a c o d y l a t e pH 8.0, 10 MgCl-, 0.1 mM EDTA. d) Dimethyl s u l p h a t e ( A l d r i c h ) e) Hydrazine (Kodak) f ) 2.5 M 2 - m e r c a p t o e t h a n o l , 3 M NaOAc pH 6.0, 0.1 M Mg(OAc) 0.1 mM EDTA, 0.5 mg/ml tRNA. g) 0.3 M NaOAc pH 6.0, 0.1 mM EDTA, 50 ug/ml tRNA, 0.5 mM ATP h) 0.3 M NaOAc pH 6.0, 0.1 mM EDTA, 50 ug/ml tRNA. i ) E t h a n o l p r e c i p i t a t i o n s , l y o p h i l i s a t i o n s , and p i p e r i d i n e c l e a v a g e c a r r i e d o u t as d e s c r i b e d i n r e f . ( 3 1 ) . E l e c t r o p h o r e s i s was as d e s c r i b e d i n t h e Methods except t h a t l x TBE b u f f e r and 20% p o l y a c r y l a m i d e g e l s were used. ( A l l r e a c t i o n c o n d i t i o n s a r e c o u r t e s y o f Dr. C a r o l i n e A s t e l l )  -78-  Appendix I I . Components o f D i d e o x y / d e o x y n u c l e o t i d e Mixes  G mix  A mix  T mix  C mix  ddGTP  89  ddATP  -  116  ddTTP  -  -  547  ddCTP  -  -  -  547  dGTP  7.9  111  158  158  dATP  -  -  dTTP  158  U l  7.9  158  dCTP  158  U l  158  10.5  (a) a l l c o n c e n t r a t i o n s a r e i n micromoles p e r l i t r e and were o b t a i n e d c o u r t e s y o f Dr. Joan McPherson  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0096129/manifest

Comment

Related Items