UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transfer RNA genes in Drosophila melanogaster Newton, Craig Hunter 1984

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1984_A6_7 N49.pdf [ 5.42MB ]
Metadata
JSON: 831-1.0096129.json
JSON-LD: 831-1.0096129-ld.json
RDF/XML (Pretty): 831-1.0096129-rdf.xml
RDF/JSON: 831-1.0096129-rdf.json
Turtle: 831-1.0096129-turtle.txt
N-Triples: 831-1.0096129-rdf-ntriples.txt
Original Record: 831-1.0096129-source.json
Full Text
831-1.0096129-fulltext.txt
Citation
831-1.0096129.ris

Full Text

Transfer RNA Genes i n D r o s o p h i l a melanogaster by Craig Hunter Newton B.Sc. McGill University, 1980 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE i n THE FACULTY OF GRADUATE STUDIES Department of Biochemistry (Genetics Programme) We accept t h i s t h e s i s as conforming to t l ^ l r e q u i r e d standa/d THE UNIVERSITY OF BRITISH COLUMBIA May 1984 © C.H. Newton, 1984 In presenting t h i s thesis i n p a r t i a l f u l f i l m e n t of the requirements for an advanced degree at the University of B r i t i s h Columbia, I agree that the Library s h a l l make i t f r e e l y a v a i l a b l e for reference and study. I further agree that permission f o r extensive copying of t h i s t h e s i s f o r s c h o l a r l y purposes may be granted by the head, of my department or by his or her representatives. I t i s understood that copying or p u b l i c a t i o n of t h i s thesis for f i n a n c i a l gain s h a l l not be allowed without my written permission. Department of C.f+J=MIS TAY The University of B r i t i s h Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date 6/1 /H - i i -A b s t r a c t In D r o s o p h i l a melanogaster the 600-800 r e i t e r a t e d c o pies of genes encoding c y t o p l a s m i c tRNA are d i s p e r s e d a c r o s s the genome at a multitude o f chromosomal s i t e s . In many cases these s i t e s contain several copies of the same and d i f f e r e n t tRNA genes. Here we d e s c r i b e tRNA genes o b t a i n e d from two o f these s i t e s ; one, on the X chromosome a t 12E, i s the major s i t e o f i n s i t u h y b r i d i z a t i o n w i t h t R N A 7 S e r ( a n t i c o d o n IGA) o r tRNA^ S e r (CGA). The second i s one o f t h r e e minor h y b r i d i z a t i o n s i t e s and i s located on chromosome 2L a t 23E . DNA sequencing studies here show t h a t the plasmid d e r i v e d from 12E (pDt27R) c o n t a i n s two Ser i d e n t i c a l tRNA 4 genes and f o u r i d e n t i c a l genes encoding a minor arginine isoacceptor (UCG) . Previous studies with d i f f e r e n t p l a s m i d s had shown 12E a l s o c o n t a i n s two genes i d e n t i c a l to Se r tRNA 7 and two a d d i t i o n a l one and two b a s e p a i r v a r i a n t s thereof. Thus 12E co n t a i n s a t l e a s t ten genes encoding three, or perhaps f i v e , d i f f e r e n t i s o a c c e p t o r s . The o r g a n i z a t i o n of these genes w i t h i n 12E i s not known. In pDt27R a l l s i x genes occur within 2.3 kbp and are i n the same t r a n s c r i p t i o n a l o r i e n t a t i o n . The two serine genes are 317 bp a p a r t and are separated by 669 bp from the f o u r a d j a c e n t a r g i n i n e genes. While l i t t l e f l a n k i n g sequence homology o c c u r s around the s e r i n e genes, the flanking sequence of each arginine gene i s almost i d e n t i c a l . The extent of these homologies d i f f e r m a i n l y i n t h e amount o f shared 5' flanking sequence; two genes are contained on repeats with 455 bp - i i i -of common sequence while two o t h e r s are contained on repeats that share only 30 bp of 5 1 f l a n k i n g sequence. A l l four genes have the same 75 bp o f 3' f l a n k i n g sequence. The r e p e a t s are tandemly l i n k e d by j u n c t i o n sequences 5-27 bp i n l e n g t h . The f l a n k i n g sequence around one gene i s c o n s i d e r a b l y more d i v e r g e n t (18% versus 1-3%) from the o t h e r t h r e e . T h i s structure suggests that the gene quartet arose from a s i n g l e primordial gene by a s e r i e s o f d u p l i c a t i o n events t h a t i n c l u d e d i d e n t i c a l and d i f f e r e n t amounts o f f l a n k i n g s e q u e n c e . In one c a s e t h e d u p l i c a t i o n i n c l u d e d i d e n t i c a l amounts of f l a n k i n g sequence but a c t e d at times d i s t a n t enough for 18% divergence to accumulate. The plasmid b e a r i n g DNA from 23E on chromosome 2L (pDt5) Se r c o n t a i n s a s i n g l e gene i d e n t i c a l t o t h e tRNA^ genes previously described at 12E on the X chromosome. This gene occurs alone a p p r o x i m a t e l y i n t h e m i d d l e o f a 4.4 kbp fragment o f Drosophila DNA. The only s i m i l a r i t i e s i n flanking sequence with the two i d e n t i c a l genes a t 12E a r e s m a l l r e g i o n s t h a t o c cur w i t h i n 30 bp o f the 5' mature c o d i n g sequence. S i m i l a r l y , d i f f e r e n t sequences are conserved a t analogous p o s i t i o n s 5' to Se r the two tRNA genes a l s o a t 12E. - i v -Table o f Contents Page ABSTRACT i i TABLE OF CONTENTS i v LIST OF FIGURES v i ABBREVIATIONS v i i ACKNOWLEDGEMENTS v i i i DEDICATION ix INTRODUCTION ...1 EXPERIMENTAL PROCEDURES Materials 7 DNA P u r i f i c a t i o n 7 R e s t r i c t i o n Mapping 8 F i l t e r Hybridizations 9 DNA Sequencing 11 (1) Subcloning into M13 11 a) S p e c i f i c Fragments 11 b) Random Digests 12 c) Progessive 12 (2) Template P u r i f i c a t i o n 17 (3) Primer Annealing/Termination Reactions....17 (4) Rapid Template Characterization 19 (5) Electrophoresis 19 - V -RESULTS R e s t r i c t i o n mapping and Gene l o c a l i z a t i o n 21 0 a) pDt27R 21 b) pDt5 28 DNA Sequencing 28 (1) tRNA Genes 28 (2) Flanking Sequences 31 a) Random methods 31 b) Progessive methods 32 Serine tRNA Genes in pDt27R and pDt5 37 Serine tRNA Genes at 12E and 23E 43 Add i t i o n a l tRNA Genes i n pDt27R 51 Other Arginine tRNA Genes 56 DISCUSSION Gene organization 62 Gene conservation 66 Gene evolution 68 REFERENCES 71 APPENDIXES 77 - v i -L i s t o f F i g u r e s Page Figure 1. Progressive Sequencing Strategy 16 Figure 2. R e s t r i c t i o n maps of H i n d l l l fragments contained i n plasmids pDt27R and pDt5 23 Figure 3. Southern H y b r i d i z a t i o n a n a l y s i s of pDt27R with ( P) t R N A 4 S e r 25 Figure 4. Smith and B i r n s t i e l r e s t r i c t i o n mapping of 5.4 kbp EcoRI/Hindlll fragment i n pDt27R .27 32 Figure 5. Southern H y b r i d i z a t i o n a n a l y s i s of pDt5 with ( P) t R N A 4 S e r ...30 Figure 6. Recombinant M13 d e l e t i o n clones used i n DNA sequencing 36 Figure 7. Sequencing Strategies for pDt27R and pDt5 39 Figure 8. Nucleotide sequence determined i n pDt5 42 Figure 9. Nucleotide sequence determined i n pDt27R 45 Figure 10. Summary of serine accepting tRNA genes i s o l a t e d from D. melanogaster 50 Figure 11. Cloverleaf s t r u c t u r e o f t R N A A r g as predicted from nucleotide sequence of the genes 52 Figure 12. Structure of repeated DNA encoding four tRNA A r g genes found i n pDt27R 55 Figure 13. Southern h y b r i d i z a t i o n a n a l y s i s of Drosophila genomic DNA containing a d d i t i o n a l tRNA A r <3 genes 58 Figure 14. Chromosomal l o c a t i o n o f t R N A A r g genes on s a l i v a r y polytene chromsomes 61 - v i i -A b b r e v i a t i o n s bp: base p a i r BSA: Bovine serum albumin (Fraction V) cpm: counts per m i l l i o n ddNTP: Dideoxynucleoside triphosphate dNTP: Deoxynucleoside triphosphate DNA: Deoxyribonucleic acid DTT: D i t h i o t h r e i t o l EDTA: Ethylenediamine Tetraacetate (Disodium s a l t ) EtBr: Ethidium Bromide kbp: Kilobase p a i r s pCp: Cytidine 3',5 1-Diphosphate RF: R e p l i c a t i v e Form RNA: Ribonucleic acid SdNTP: Deoxynucleoside 5'-0-(l-thiotriphosphate) SDS: Sodium dodecyl sulphate SSC: 0.15 M NaCl, 0.015 M Na C i t r a t e pH 7.2 tRNA: Transfer r i b o n u c l e i c acid TEMED: N,N,N'jN'-Tetramethylethylenediamine T r i s : Tris(hydroxymethyl)aminoethane ug: microgram u l : m i c r o l i t r e uM: microMolar uCi: microCurie - v i i i -ACKNOWLEDGEMENTS This t h e s i s r e s t s s o l e l y upon the guidance and inestimable patience, support, and t o l e r a n c e o f Gordon Tener and members of h i s laboratory; i n p a r t i c u l a r , Ian G i l l a m , Shizu Hayashi, J e f f Leung and V i c k i D a r n e l l . I n t r o d u c t i o n to improved DNA sequencing technologies and computer programs f o r data management were the r e s u l t o f l e n g t h y d i s c u s s i o n s and d e m o n s t r a t i o n s with Ross MacG i l l i v r a y , Joan McPherson and Rob McMaster. I must also thank members o f the l a b o r a t o r i e s o f Peter Candido, Mike Smith, and C a r o l i n e A s t e l l f o r t h e i r m y r i a d h e l p f u l h i n t s and generous s u p p l i e s o f enzymes and r a d i o n u c l e o t i d e s ( t h a t I f o r g o t to order). L a s t l y , I would l i k e to thank T r a f f i c Control for t h e i r benevolent i n t e r e s t i n the w e l f a r e o f my parking f i n e s and to Ian Gillam f o r a f i n e r d e f i n i t i o n of the word ' s t u f f . - i x -DEDICATION TO ZOUAVE PETRANDA OUZO RAKI - 1 -I n t r o d u c t i o n In D r o s o p h i l a m e l a n o g a s t e r t h e r e a r e some 60 major and 30 minor chromatographically d i s t i n c t species of cytoplasmic tRNA (1). Solution h y b r i d i z a t i o n s t u d i e s w i t h n u c l e a r DNA indicates t h e i r genes have a k i n e t i c c o m p l e x i t y o f a b o u t 60 unique sequences whose combined copy number t o t a l s 600-800 genes (2). Each tRNA, t h e r e f o r e , i s encoded by 10-12 c o p i e s per h a p l o i d genome. In s i t u h y b r i d i z a t i o n w i t h t o t a l 4S RNA has shown that the genes have a t l e a s t 54 major and m i n o r s i t e s spread i n a seemingly random f a s h i o n around the genome (3) . The exceptions are the l a c k o f s i t e s on the s m a l l f o u r t h chromosome and the paucity of s i t e s on the X chromosome. More d e t a i l e d studies with p u r i f i e d tRNAs showed t h a t t h e m u l t i p l e gene c o p i e s a r e . d i s t r i b u t e d a t s e v e r a l d i s c r e e t s i t e s w i d e l y s e p a r a t e d i n the genome. Frequently these s i t e s a l s o c o n t a i n genes for d i f f e r e n t tRNAs and are a c t u a l l y gene c l u s t e r s composed of multiple copies of the same and d i f f e r e n t tRNA genes (4-6). The r e s o l u t i o n of i n  s i t u h y b r i d i z a t i o n i s l i m i t e d t o a p o l y t e n e band, which i n nucleotides may encompass a few to sev e r a l hundred kilobase p a i r s (7). The arrangement o f d i f f e r e n t genes wi-thin a c l u s t e r must t h e r e f o r e be determined by c l o n i n g r e g i o n s o f i n t e r e s t i n t o vectors f o r a m p l i f i c a t i o n i n b a c t e r i a l h o s t s whereupon they can be analysed i n d e t a i l by DNA sequencing. The most e x t e n s i v e l y s t u d i e d tRNA gene c l u s t e r i s located -2-within the 42A region of chromosome 2L (8). Analysis of almost 100 kbp of t h i s r e g i o n has shown t h a t a t l e a s t 18 tRNA genes are p r e s e n t . There are 8 i d e n t i c a l c o p i e s o f genes f o r t R N A 5 A s n , 5 f o r t R N A 2 L y s / 4 f o r t R N A 2 A r g , and one f o r t R N A I l e , a l l intermingled w i t h i n a 45 kbp r e g i o n . There are no further genes f o r 20 kbp f l a n k i n g e i t h e r s i d e o f t h i s c l u s t e r . The genes are arranged s i n g l y or i n s u b c l u s t e r s separated by l e s s than 100 bp to almost 10 kbp and are t r a n s c r i b e d from both strands with l i t t l e r e g u l a r i t y . The o n l y s i m i l a r i t i e s i n DNA sequence outside the coding regions are s m a l l conserved regions immediately 5" to some genes and o l i g o - t h y m i d y l a t e t r a c t s t h a t f o l l o w i n the 3 1 d i r e c t i o n . The l a t t e r a r e i n v o l v e d i n t r a n s c r i p t i o n termination by RNA polymerase I I I (9,10) and t h e f o r m e r may i n f l u e n c e t r a n s c r i p t i o n i n i t i a t i o n (11) . The s i z e o f the 42A region was estimated to contain 300-400 kbp thus even t h i s 95 kbp region may not represent the e n t i r e complement o f tRNA genes detected by i n s i t u h y b r i d i z a t i o n . O t h e r a n a l y s e s o f tRNA gene c l u s t e r s have been l e s s extensive. A 15 kbp portion o f the 50AB region contained 7 genes clustered w i t h i n 2.5 k b p m ( 1 2 ) . S i m i l a r to 42A, the 5 i d e n t i c a l genes f o r t R N A I l e and 2 genes f o r t R N A L e u a r e o r i e n t e d i n d i f f e r e n t d i r e c t i o n s and a r e a r r a n g e d i r r e g u l a r i l y between - T i e - ' u n r e l a t e d f l a n k i n g DNA. The tRNA genes are i d e n t i c a l i n coding sequence to the gene found at 42A. In ad d i t i o n , these two tRNA 1^ 1 1 genes c o n t a i n i n t e r v e n i n g sequences. T h i s appears to be a common o b s e r v a t i o n i n a s u b s e t o f tRNA genes i n many -3-eukaryotes and some archaebacteria (13,14). I d e n t i c a l gene c o p i e s are n o t always embedded i n unique f l a n k i n g sequence (15) . A 12 kbp p o r t i o n o f the 62A r e g i o n Glu contains 5 genes coding f o r tRNA . Three o f the genes share some 5' and 3' f l a n k i n g sequence s u g g e s t i n g t h a t they arose by unequal c r o s s i n g over o f an a n c e s t r a l gene p a i r . Some flanking sequence d i v e r g e n c e has accumulated s i n c e t h i s proposed event occurred. A l s o , one o f the f i v e genes has a s i n g l e base change w i t h i n t h e g e n e c o d i n g r e g i o n . T h i s i s an example o f microheterogeneity between otherwise i d e n t i c a l genes (see below). Other examples o f shared f l a n k i n g sequences are seen with two tRNA^^ genes d e r i v e d from p o l y t e n e r e g i o n 56EF(16). These are contained on two d i r e c t r e p e a t s 1.1-2.0 kbp i n length within a 22 kbp r e g i o n t h a t c o n t a i n s a d d i t i o n a l u n c h a r a c t e r i z e d tRNA genes. This arrangement suggests they arose by a DNA d u p l i c a t i o n . Met Another k i n d o f d u p l i c a t i o n i s s e e n f o r two tRNA. genes found i n recombinant phage c o n t a i n i n g unique i n s e r t s derived from p o l y t e n e band 61D (17). Here both genes are c o n t a i n e d w i t h i n approximately 1.1 kbp r e p e a t s s e p a r a t e d by at l e a s t 10-15 kbp of unique sequence. Again, the r e p e a t s are s i m i l a r but not i d e n t i c a l f o r a t l e a s t 415 bp and one c l o n e , a l l e l i c t o the o t h e r s , contained a gene w i t h a s i n g l e base change. Another clone that Met h y b r i d i z e d the tRNA^ probe c o n t a i n e d the p a r t i a l sequence Me t ( p o s i t i o n 7 t o 39) o f a t r u n c a t e d t R N A i gene. T h i s 'pseudogene' d i d n o t t r a n s c r i b e i n v i t r o and the f l a n k i n g sequences hybridized to a t l e a s t 30 d i f f e r e n t chromosomal s i t e s . -4-In t h i s example the d u p l i c a t e d f l a n k i n g sequences showed also varying degrees o f d i v e r g e n c e w h i l e the gene coding sequences remained i d e n t i c a l (with the exception of the a l l e l i c v a r i a n t ) . One i n t e r p r e t a t i o n of these shared f l a n k i n g sequences i s that they represent recent d u p l i c a t i o n s or transpositions that are slowly accumulating mutations through random d r i f t . In time they may d i v e r g e to the u n r e c o g n i z a b l e form common to the f l a n k i n g sequence around most tRNA g e n e s . I m p l i c i t i n t h i s view i s a mechanism t h a t m a i n t a i n s the coding sequences o f the d i f f e r e n t gene copies. I t a p p a r e n t l y o p e r a t e s i m p e r f e c t l y as demonstrated by the coding sequence microheterogeneities observed. More extreme examples o f sequence changes from known tRNA s t r u c t u r e s a r e t h e v a r i a n t g e n e s o f t R N A 4 V a l ( 1 8 , 1 9 ) , t R N A 3 b V a l ( 2 0 ) , and t R N A 5 L y s ( 2 1 ) . These d i f f e r from the tRNA sequence a t 3-4 p o s i t i o n s o u t s i d e the a n t i c o d o n and are transcibed e f f i c i e n t l y i n v i t r o to y i e l d mature s i z e products. The v a r i a n t g e n e s o f b o t h t R N A . V a l and tRNA.,, V a l were 4 3b ob t a i n e d from a common chromosomal s i t e a t 90BC i n m u l t i p l e c o p i e s t h a t r e p r e s e n t e i t h e r d i f f e r e n t a l l e l i c v e r s i o n s or d u p l i c a t e d r e g i o n s . An i d e n t i c a l tRNA^ 3"*" v a r i a n t gene was also derived from a chromosomal s i t e nearby a t 89C. Each of the copies of d i f f e r e n t v a r i a n t genes had i d e n t i c a l coding sequences which suggests they may be ma i n t a i n e d by s e l e c t i v e p r e s s u r e s l i n k e d to e x p r e s s i o n and may co r r e s p o n d to some o f the minor species that have not yet been c h a r a c t e r i z e d . The s i g n i f i c a n c e of these v a r i a n t i s o c o d i n g genes i s not c l e a r but does demomstrate - 5 -the need for comprehensive characterization of a l l members in an isoaccepting tRNA family. This thesis contributes to a study of serine accepting tRNAs and their genes in Drosophila. The individual isoacceptors can be resolved into at l e a s t seven major and minor species under standard chromatographic c o n d i t i o n s (1). Three of the major species have been p u r i f i e d and t h e i r n u c l e o t i d e sequences determined (22). t R N A 4 S e r and t R N A 7 S e r d i f f e r in sequence at only three positions (two outside the anticodon at nucleotide Se r 16 and 77) and are 96% homologous. t R N A ^ i s more distantly related with only 71-73 % similarity. The loc a t i o n of genes f o r these i s o a c c e p t o r s has been determined by i n s i t u h y b r i d i z a t i o n (5) . Because t R N A 4 S e r Se r and tRNA7 are so c l o s e l y r e l a t e d t h e i r genes cannot be distinguished and they h y b r i d i z e to i d e n t i c a l s i t e s on the polytene chromosomes. The strongest s i t e i s at polytene bands 12E on the X chromosome. This i s the only s i g n i f i c a n t tRNA gene containing region on the entire chromosome (ie. i f using a 4S RNA probe). Three additional minor s i t e s e x i s t on the autosomes at Ser polytene bands 23E, 56D, and 64D. Genes for tRNA^ have a unique distribution on chromosome 3R at 86A, 88A9-12, and 94A6-8. Ser Genes f o r t R N A ^ 7 have been f u r t h e r s t u d i e d on recombinant plasmids selected from a pBR322 l i b r a r y of Hindlll cleaved Drosophila DNA using either tRNA as the hydridization probe (23). DNA sequencing and i n s i t u h y bridization of the plasmid inserts resolves unambiguously the identity and location - 6 -of the tRNA genes contained within. Three of seven plasmids isolated (pDtl, pDt5, pDt81) contained the same inserts that derived from one of the minor sites at polytene band 23E. The remainder (pDtl6, pDtl7R, pDt27R, pDt73) contained different inserts a l l derived from the major site at 12E. The nucleotide sequence of the probe homologous regions of pDtl6, pDtl7R, and pDt73 have been determined (22) pDtl6 Se r contains a gene corresponding to tRNA^ and a second gene that is identical except at position 77 where a G to A transition occurred. S i m i l a r l y , the gene on pDt73 is i d e n t i c a l to tRNA 7 S e r but has two changes in the coding sequence. One is the same as the gene in pDtl6 at position 77 and the second is a C to T transition at positon 16. Both of these changes are exactly those which d i s t i n g u i s h t R N A 7 S e r from tRNA 4 S e r outside the anticodon. These variant genes thus resemble hybrid sequences of the two isoacceptors. The identity of the genes contained in the remaining plasmids derived from 12E (pDt27R) and 23E (pDt5) is the subject of this thesis. -7-M a t e r i a l s and Methods E. c o l i s t r a i n SF8 c o n t a i n i n g p l a s m i d s pDt27R and pDt5 were provided by R. C. M i l l e r J r . E. c o l i s t r a i n s JM101 and JM103 and DNA sequencing v e c t o r s M13mp9 (24) and M13mpll (25) were provided by R. T. A. M c G i l l i v r a y and J . Leung. Plasmid cloning v e c t o r pUC13 (26) was p r o v i d e d by D. M. I r w i n . P u r i f i e d t R N A 4 S e r and 4S RNA were p r o v i d e d by I. C. G i l l a m and G. M. Tener. P u r i f i e d pDt5 was a g i f t from D: St. Louis and Drosophila DNA (Ore R ) a g i f t , from P. C s e r j e s i . O l i g o n u c l e o t i d e s s p e c i f i c S e r f o r tRNA^ were s y n t h e s i s e d by T. A t k i n s e n i n t h e l a b o r a t o r y of M. Smith. M13 sequencing primer ( 17-mer ) was purchased from PL B i o c h e m i c a l s . A l l DNA and RNA modi f i c a t i o n enzymes were o b t a i n e d ' c o m m e r c i a l l y and t h e s u p p l i e r s are 32 i n d i c a t e d where t h e i r p r o d u c t s were used e x c l u s i v e l y . P r a d i o n u c l e o t i d e s and ex. p h o s p h o r o t h i o a t e dNTP analogues were purchased from New England Nuclear. DNA p u r i f i c a t i o n pDt27R DNA was i s o l a t e d as d e s c r i b e d (23) and p u r i f i e d by chromatography on Biogel A15 M (1.9 x 90 cm in 0.1 M a c e t i c a c i d pH 5 (NaOH)). M13 RF DNA was i s o l a t e d from 1 l i t r e infected E . c o l i JM101 c u l t u r e s (27) by the a l k a l i n e l y s i s method d e s c r i b e d by Maniatis et a l . (28) followed by two equilibrium c e n t r i f u g a t i o n s through C s C l - E t B r i n a VTi65 r o t o r (65000 rpm x 4 hours) and t h r i c e p r e c i p i t a t e d w i t h e t h a n o l i n t h e p r e s e n c e of 2.5 M -8-NH^QAc. Small s c a l e plasmid DNA or M13 RF DNA was i s o l a t e d from 2 ml cultures (27) by a s i m i l a r rapid a l k a l i n e l y s i s method (28). R e s t r i c t i o n Mapping Plasmid DNAs (2-3 ug) were d i g e s t e d s i n g l y or doubly with a v a r i e t y of r e s t r i c t i o n enzymes t h a t recognize 6 bp s i t e s (BamHI, EcoRI, PstI, C l a l , Smal, PvuII) i n standard r e s t r i c t i o n b uffers (10-50 mM T r i s pH 7.5 (HC1), 5 mM M g C l 2 , 1 mM DTT, 0.1 mg/ml BSA) at s a l t c o n c e n t r a t i o n s suggested by the s u p p l i e r s (0-100mM NaCl). Digestions were performed e i t h e r with two f o l d excess of enzyme or by incubating f o r twice or more the time suggested f o r completion by the s u p p l i e r . R e a c t i o n s were stopped by addition of 1/10 volume dye mix (20% F i c o l l , 10 mM EDTA, 0.1% bromophemol b l u e , 0.1% xylene c y a n o l ) and t h e p r o d u c t s f r a c t i o n a t e d by electrophoresis on 0.8%-1.2% agarose submarine gels i n 0.5x TBE (Ix = 90 mM Tris-borate pH 8.3, 2.5 mM EDTA ) containing 1 ug/ml EtBr f o r 8-16 hours at 4-5 V/cm. The d i f f e r e n t r e s t r i c t i o n s i t e s were ordered by comparing fragment s i z e s o f s i n g l e and double digests as descibed by Danna (29). More frequently o c c u r r i n g r e s t r i c t i o n s i t e s were mapped by the p a r t i a l d i g e s t i o n procedure of Smith and B i r n s t i e l (30). An example i s the 5.4 kbp H i n d l l l / E c o R I fragment of pDt27R shown i n Figure 4 . Plasmid DNA was d i g e s t e d with H i n d l l l and the 3' ends l a b e l l e d w i t h DNA p o l y m e r a s e 1 ( K l e n o w f r a g m e n t ) and ( 3 2 P ) d A T P ( 3 1 ) . The DNA was p h e n o l e x t r a c t e d , p u r i f i e d by e t h a n o l p r e c i p i t a t i o n and r e d i g e s t e d w i t h EcoRI to generate -9-s i n g l e end l a b e l l e d m o l e c u l e s . These were separ a t e d on 0.7% a g a r o s e g e l s and t h e a p p r o p r i a t e f r a g m e n t r e c o v e r e d by e l e c t r o e l u t i o n (28) from a g e l s l i c e i n t o d i a l y s i s t u b i n g . Conditions f o r d i g e s t i o n v a r i e d f o r each enzyme which i n t h i s example are H a e l l l and T a q l . S i n g l e end l a b e l l e d DNA (5 x 10^ cpm Cerenkov, <1 ug DNA) was made up to 65 u l i n a 6 mM NaCl r e s t r i c t i o n buffer (above) c o n t a i n i n g 5 ug unlabelled C a l f Thymus DNA and incubated a t 37 °C w i t h 2 u n i t s H a e l l l (New England Biolabs, 15 minute units) . Ten u l a l i q u o t s were removed a f t e r 0, 1, 2, 4, 10, and 30 minutes and stopped with 3 u l dye mix. The Taq I digestions were performed s i m i l a r l y except that more enzyme was used (12 u n i t s , Bethesda Research Laboratories, 1 hour units) and a l i q u o t s were w i t h d r a w n a f t e r 0, 2, 6, 15, 30, and 60, minutes i n c u b a t i o n a t 65°C. The r e a c t i o n s were loaded onto 40 cm h o r i z o n t a l 1.5 % a g a r o s e g e l s and f r a c t i o n a t e d by e l e c t r o p h o r e s i s a t 12-15 V/cm f o r 24 to 36 hours i n a Shandon high voltage apparatus (with c o o l i n g ) . The g e l s were drie d down on 3 MM paper (Whatman) and exposed to X-ray f i l m (Curex) for 24 to 48 hours with i n t e n s i f y i n g sceens (Dupont Lightening Plus ). F i l t e r H y b r i d i z a t i o n s Plasmid DNA fragments c o n t a i n i n g tRNA genes were i d e n t i f i e d by h y b r i d i z a t i o n w i t h 3 2 P - l a b e l l e d 4S RNA or t R N A 4 S e r . The 32 probes were prepared by 3' end l a b e l l i n g w i t h ( P)pCp and T j RNA Ligase as d e s c r i b e d by C r i b b s (22). R e s t r i c t i o n fragments r e s o l v e d i n agarose g e l s o r s m a l l e r fragments ( i e . Sau3a or -10-H a e l l l d i g e s t e d ) t h a t h a d b e e n s e p a r a t e d i n 5 % p o l y a c r y l a m i d e : b i s a c r y l a m i d e (30:1) were t r a n s f e r r e d t o G e n e s c r e e n (New E n g l a n d N u c l e a r ) as d e s c r i b e d by t h e manufacturers. The f i l t e r bound DNA was h y b r i d i z e d with 1-2 x 10 cpm/ml l a b e l l e d tRNA i n a s o l u t i o n c o n t a i n i n g 50 % formamide, 4xSSC, 50 mM NaH 2P0 4 pH 6.5, 60 ug/ml E . c o l i tRNA at 37-42°C f o r 48 to 64 hours. The f i l t e r s were washed 3x at room temperature i n 500 ml SSC c o n t a i n i n g 0.5% SDS and exposed at -70°C w i t h i n t e n s i f y i n g s c r e e n s f o r a few d a y s t o a week depending on the counts retained. D. melanogaster (Ore R) genomic DNA (10-15 ug) was digested overnight with 10 units r e s t r i c t i o n enzyme ( H i n d l l l , EcoRI, Xhol) and separated i n 0.7% agarose g e l s . A f t e r a c i d treatment (0.2 N HC1) the fragments were t r a n s f e r r e d to Genescreen as described. The f i l t e r was p r e h y b r i d i z e d o v e r n i g h t at 60°C i n 5x Denhardt's s o l u t i o n ( l x = 0.02% each p o l y v i n y l p y r r o l i d o n e (M.W. 40,000), F i c o l l (M.W. 40,000), and BSA) and 250 ug/ml denatured C a l f Thymus DNA. T h i s s o l u t i o n was r e p l a c e d with 0.3 M NaCl, 0.06 M T r i s pH 8.0 (HC1), 0.002 M EDTA, l x Denhardt's, 0.5% SDS, 100 ug/ml C a l f Thymus DNA and h y b r i d i z e d 24 hours w i t h 1-2 x 10^ 32 7 cpm/ml P n i c k t r a n s l a t e d (32) plasmid fragments (1-5 x 10 cpm/ug). The f i l t e r was washed i n 2x SSC a t 60°C with t h r e e changes and exposed as described above. M13 phage dot b l o t s and plaque l i f t f i l t e r h y b r i d i z a t i o n s were performed w i t h n i t r o c e l l u l o s e c i r c l e s ( S c h l e i c h e r & Schuell , BA85) using n i c k t r a n s l a t e d probes (above) e s s e n t i a l l y - l i -as described (27,28). DNA S e q u e n c i n g The m a j o r i t y o f n u c l e o t i d e s e quence presented here was determined us i n g the d i d e o x y n u c l e o t i d e t e r m i n a t i o n method o f Sanger et al.( 3 3 ) on s i n g l e stranded templates provided by the c o l i p h a g e M13 c l o n i n g v e c t o r s d e v e l o p e d by M e s s i n g e t a l . (24-26,34). In some cases the sequence was determined by the chemical degradation method o f Maxam and G i l b e r t (31) as modified by Dr.C. A s t e l l . . T h i s s h a l l n o t be d e s c r i b e d f u r t h e r but a summary of the reaction conditions are given i n Appendix 1. (I) Subcloning into M13 sequencing vectors a) S p e c i f i c Fragments: The tRNA gene codin g r e g i o n s are small (>100 bp) and can be sequenced on r e s t r i c t i o n fragments i d e n t i f i e d by f i l t e r h y b r i d i z a t i o n s (above). These fragments, 600 bp or l e s s , were p u r i f i e d from polyacrylamide gels by soaking the a p p r o p r i a t e g e l s l i c e i n 3-4 volumes o f 0.5 M NH 4OAc, 10 mM M g ( O A c ) 2 , 1 mM EDTA, 0 . 1 % SDS o v e r n i g h t a t 65°C and p r e c i p i t a t e d w i t h two volumes 95 % e t h a n o l . The ethanol washed p e l l e t was r e d i s s o l v e d i n 10-20 u l H 20 and the q u a n t i t y o f fragment recovered determined by e l e c t r o p h o r e s i s . The p u r i f i e d fragment was then l i g a t e d i n t o a p p r o p r i a t e l y digested r e p l i c a t i v e form (RF) M13mp9 or mpll and used to transform competent E. c o l i JM101 o r JM103 as d e t a i l e d by M e s s i n g ( 2 7 ) . When c l o n i n g fragments w i t h 5' o r 3 1 o v e r h a n g i n g ends t h e s e l e c t i o n o f recombinants was based s o l e l y on c o l o u r i n a c t i v a t i o n . C l e a r plaques a f t e r b l u n t end c l o n i n g , however, were not always recombinants. These were screened i n l a r g e r numbers e i t h e r by plaque l i f t and d o t b l o t f i l t e r h y b r i d i z a t i o n s (27) or by r e s t r i c t i o n analyses of RF DNA from several 2 ml cu l t u r e s (28). b) Random sub c l o n i n g : Rather than p u r i f y i n g and subcloning s e v e r a l s m a l l f r a g m e n t s , l a r g e r DNA r e g i o n s (1-2 kbp) were subcloned randomly..Appropriate r e s t r i c t i o n fragments(l-2 kbp) were p u r i f i e d from agarose g e l s by e l e c t r o e l u t i o n onto DE81 paper (Whatman) as descibed by Chambon (35) or into d i a l y s i s tubing with subsequent p u r i f i c a t i o n on DE52 (Whatman) as descibed by Maniatis e t a l . ( 2 8 ) . The recovered DNA (0.5-1.0 ug) was then d i g e s t e d s e p a r a t e l y with Sau3a, H a e l l l , and A l u l (as f o r r e s t r i c t i o n mapping), the enzymes h e a t i n a c t i v a t e d at 70°C, and the DNA p r e c i p i a t e d i n t h e p r e s e n c e o f 2.5 M NH 4OAc and e t h a n o l . Portions of the d i g e s t e d DNAs were then l i g a t e d separately into appropriately cleaved v e c t o r s and t r e a t e d as above. Template DNA (below) of 20-30 recombinants from each r e s t r i c t i o n digest were then screened by s i n g l e t e r m i n a t i o n r e a c t i o n s (see Rapid below) to obtain those recombinants wi t h unique i n s e r t s . These were then sequenced as described below. c) P r o g r e s s i v e S u b c l o n i n g : ( I ) . I n t h i s method t a r g e t DNA (1-3 kb) lacking i n t e r n a l r e s t r i c t i o n s i t e s f o r enzymes (A) and (B) (see F i g u r e 1) was c l o n e d i n t a c t i n t o a p p r o p r i a t e l y c u t M13mp9 or mpll. Ten to 20 ug o f recombinant RF DNA was l i n e a r i z e d by d i g e s t i o n with 10-20 u n i t s enzyme (A) i n the a p p r o p r i a t e r e s t r i c t i o n b u f f e r f o r 2-3 hours and the r e a c t i o n t e s t e d f o r -13 -completion by e l e c t r o p h o r e s i s on a mini-agarose g e l . The DNA was then p r e c i p i t a t e d w i t h e t h a n o l i n 2.5 M NH^OAc and resuspended i n 0.1-0.2 mis Exo b u f f e r (50 mM T r i s pH 8.0 (HC1) , 10 mM MgCl 2, 1 mM DTT, 0.1 mg/ml BSA). A f t e r a d d i t i o n o f 10-20 u n i t s Exonuclease III (Bethesda Research L a b o r a t o r i e s ) and incubating at 37°C, a l i q u o t s c o n t a i n i n g 2 ug DNA were removed at 3 minute i n t e r v a l s and the d i g e s t i o n s stopped by a d d i t i o n to an equal volume o f 2 x S 1 b u f f e r 1 (10x=2 M N a C l f 0.5 M NaOAc pH 4.5, 10 mM ZnSO^, .5 % g l y c e r o l ) . The s i n g l e s t r a n d s o f the RF molecules i n each exonuclease I I I a l i q u o t were trimmed with 3 u n i t s n u c l e a s e (PL B i o c h e m i c a l s ) f o r 3 m i n u t e s a t 37°C and the r e a c t i o n s s t o p p e d by e x t r a c t i o n w i t h an e q u a l volume o f phenol:chloroform (1:1). The DNA was c o l l e c t e d from the aqueous phase by p r e c i p i t a t i o n w i t h e t h a n o l and NH^OAc and p u r i f i e d by r e p r e c i p i t a t i o n . Any 5' overhanging ends remaining were made fl u s h by incubation w i t h 1-2 u n i t s DNA polymerase I (Klenow) i n 20 u l of r e s t r i c t i o n buffer c o n t a i n i n g 50 mM NaCl and 0.5 mM each dNTP f o r 30 minutes a t room temperature. These r e a c t i o n s were stopped with 1 u l 0.5 M EDTA, heated to 70°C f o r 15 minutes and p r e c i p i t a t e d w i t h e t h a n o l and NH4OAc. The recovered DNA was r e d i s s o l v e d i n 10-20 u l r e s t r i c t i o n buffer s u i t a b l e f o r enzyme (B) (see F i g u r e 1) and digested with 2-3 u n i t s of (B) for 1-2 hours. A f t e r heat i n a c t i v a t i o n (above) a p o r t i o n o f the mixture ( d e t e r m i n e d by e l e c t r o p h o r e s i s o f an a l i q u o t on a mini-agarose g e l ) of d e l e t e d vector and i n s e r t was l i g a t e d into f r e s h M13 v e c t o r prepared by d i g e s t i o n with Enzyme -14 -(B) and Sma I (blunt end) . The DNA ends created by d i g e s t i o n with (B) must be 5' o r 3' o v e r h a n g i n g t o e n s u r e t h e c o r r e c t o r i e n t a t i o n of the d e l e t e d i n s e r t i n the recovered recombinants. Six to 24 c l e a r plaques were p i c k e d from each exonuclease I I I a l i q u o t and grown i n two ml c u l t u r e s . The e x t e n t o f i n s e r t d e l e t i o n i n t h e s e r e c o m b i n a n t s was d e t e r m i n e d by s i z i n g a p p r o p r i a t e l y d i g e s t e d RF DNA or SDS l y s e d phage DNA (27) on 0.7%-1.5% agarose g e l s . Clones c o n t a i n i n g i n s e r t s that d i f f e r e d i n s i z e by 150-250 bp were choosen f o r DNA sequencing and t h e i r template DNAs prepared (below). ( I I ) . With the use o f <x p h o s p h o r o t h i o a t e dNTP analogues a s i n g l e end o f the r e c o m b i n a n t RF DNA c a n be p r o t e c t e d from d i g e s t i o n with exonuclease I I I (36,37). The DNA was l i n e a r i z e d w i t h r e s t r i c t i o n enzyme (A) as i n the pr e c e e d i n g s e c t i o n and p r e c i p i t a t e d with e t h a n o l (see F i g u r e . 1 ) . In t h i s case i t i s necessary that (A) l e a v e 5' overhanging ends. The l i n e a r i z e d RF DNA was r e d i s s o l v e d i n 50 u l r e s t r i c t i o n b u f f e r (above) containing 0-50 mM NaCl and 0.5 mM o f the appropriate SdNTP f o r f i l l i n g i n the overhanging 5' t e r m i n i c r e a t e d by cleavage with enzyme ( A ) . The r e a c t i o n was i n c u b a t e d one hour a t room temperature with 5-10 un i t s o f DNA polymerase I (Klenow), stopped by heat i n a c t i v a t i o n , a n d p r e c i p i t a t e d w i t h e t h a n o l and NH^OAc. The SdNTP l a b e l l e d DNA was then r e d i s s o l v e d i n 0.1 ml r e s t r i c t i o n buffer s u i t a b l e for enzyme (C) and d i g e s t e d with 20 units of (C) fo r 2-3 hours. The s i n g l e end l a b e l l e d RF molecules were then deleted with exonuclease I I I and r e p a i r e d w i t h DNA polymerase I -15 -F i g u r e 1. P r o g r e s s i v e s e q u e n c i n g s t r a t e g i e s u s i n g exonuclease I I I and n u c l e a s e . S o l i d l i n e s are M13 v e c t o r sequences, open boxes i n s e r t sequences, and s t i p l e d boxes the multiple cloning s i t e c o n t a i n i n g unique r e s t r i c t i o n s i t e s A, B, and C. The arrow i n d i c a t e s the priming s i t e used f o r sequencing with s i n g l e s t r a n d M13 t e m p l a t e s . The broken arrow (bottom) corresponds to DNA s equence o b t a i n e d from d e l e t i o n v a r i a n t templates. B r i e f l y , the RF DNA from M13 recombinants containing large (1-3 kb) i n s e r t s i s l i n e a r i z e d by d i g e s t i o n at r e s t r i c t i o n s i t e ( A ) . In method (I) t h e l i n e a r DNA i s d i g e s t e d w i t h e x o n u c l e a s e I I I t o i n c r e a s i n g e x t e n t s , trimmed w i t h S^ n u c l e a s e , and r e p a i r e d t o b l u n t ends w i t h DNA polymerase I (Klenow) i n the presence o f a l l f o u r dNTPs. The d e l e t e d i n s e r t portion of the molecules are r e l e a s e d by d i g e s t i o n with (B) and recloned into the compatible ends (B/Blunt) of fresh M13 vector. D e l e t e d v e c t o r s e q u e n c e s t e n d n o t t o r e d o n e due t o t h e p r e f e r e n c e M13 shows f o r s m a l l e r i n s e r t s . In method (II) the l i n e a r RF+insert i s l a b e l l e d w i t h SdNTP and DNA polymerase I (Klenow) at the 5' s t i c k y ends l e f t by d i g e s t i o n with (A). The i n s e r t end i s freed of the SdNMP l a b e l by d i g e s t i o n with (C) and the s i n g l e end l a b e l l e d (vector end) molecules then digested with e x o n u c l e a s e I I I and S^ n u c l e a s e as i n method ( I ) . A f t e r r e l i g a t i o n , the asymmetrically deleted molecules are competent for t r a n s f o r m a t i o n and subsequent phage p r o d u c t i o n . The extent of i n s e r t d e l e t i o n i n these phage i s determined by electrophoresis of phage supernatant i n 0.7% agarose g e l s . - 16 -- 17 -(Klenow) e x a c t l y as d e s c r i b e d a b o v e . Because the M13 v e c t o r sequences are p r o t e c t e d from d i g e s t i o n by exonuclease I I I , the DNA can be r e l i g a t e d and used f o r transformation without the need f o r r e c l o n i n g . A l s o n e i t h e r IPTG nor X-gal are r e q u i r e d f o r recombinant s e l e c t i o n . Those d e l e t i o n v a r i a n t s s u i t a b l e f or DNA sequencing were choosen as d e s c r i b e d above, i . e . electrophoresis of SDS lysed phage on 0.7% agarose g e l s (27). M13 Phage Template P r e p a r a t i o n S i n g l e s t r a n d e d phage t e m p l a t e s were prepared from 2 ml c u l t u r e s grown 4-8 hours a f t e r i n o c u l a t i o n into YT media (38) of a s i n g l e plaque and 20 u l o v e r n i g h t c u l t u r e o f E. c o l i JM101 or JM103 grown i n M9 media (38) . The i n f e c t e d cultures were cleared by s p i n n i n g 5 minutes i n a microfuge (Brinkman) and the phage p r e c i p i t a t e d from 1.3 ml of supernatant by ad d i t i o n of 0.3 ml 2.5 M NaCl and 20 % polyethylene g l y c o l (PEG 6000). After 15 minutes a t room temperature t h e phage were c o l l e c t e d by s p i n n i n g 5 minutes i n the microfuge. Care was taken here to remove a l l the supernatant w i t h a drawn out Pasteur p i p e t t e . The phage p e l l e t was r e d i s s o l v e d i n 0.2 ml LTS (10 mM NaCl, 10 mM T r i s pH 8.0 (HC1), 0.25 mM EDTA), e x t r a c t e d t h r e e times with an equal volume p h e n o l t c h l o r f o r m and p r e c i p i t a t e d t w i c e w i t h e t h a n o l and NH^OAc.The DNA p e l l e t s were washed w i t h 95 % e t h a n o l and redissolved i n 25-50 u l LTS. Primer Annealing and T e r m i n a t i o n Reactions -18 -H y b r i d i z a t i o n o f 1 u l sequencing primer (0.05-0.1 pmoles, 17-mer), 2 u l 10x b u f f e r (100 mM NaCl, 100 mM T r i s pH 7.5 (HC1), 70 mM MgCl 2) and 5 u l s i n g l e stranded template (0.2-0.5 pmoles; prepared above) was performed i n a s e a l e d c a p i l l a r y tube in a 65°C water bath f o r 10 minutes and brought to room temperature over 20-30 minutes. The c o n t e n t s o f the c a p i l l a r y was mixed with 1 u l 15 uM dATP and 1.5 u l ( 3 2 P ) d A T P ( 3 0 0 0 Ci/mmole) and d i s t r i b u t e d to 1.5 ml Eppendorf tubes f o r each G,(2.5 ul) ,A (2.0 u l ) , T ( 2 . 0 u l ) , C ( 2 . 5 u l ) t e r m i n a t i o n r e a c t i o n . Dideoxynucleotide/deoxynucleotide mixes (see Appendix II) were added (1.5 ul) and the r e a c t i o n s s t a r t e d by ad d i t i o n of 1 u l DNA polymerase T (Klenow) d i l u t e d to 400 units/ml in 1 mg/ml BSA, 50 mM K 2HP0 4 pH 7.5, 10 mM DTT. The r e a c t i o n s were incubated at room temperature for 15 minutes and then chased by addition of 1 u l 0.5 mM a l l four dNTPs and the i n c u b a t i o n c o n t i n u e d f o r 20 minutes. The r e a c t i o n s were s t o p p e d w i t h 5 u l dye mix ( 98% deionised formamide, 10 mM EDTA, 0.2% bromophenol blue and xylene cyanol). I f the r e a c t i o n s were not to be loaded onto sequencing g e l s immediately (below) they were s t o r e d a t -70°C and the dye mix added j u s t b e f o r e e l e c t r o p h o r e s i s . I f the template DNA was double stranded (such as w i t h M13 RF DNA f o r sequencing using a reverse primer (PL B i o c h e m i c a l s ) or f o r sequencing out of pUC plasmids) the DNA was p u r i f i e d by CsCl c e n t r i f u g a t i o n to remove any contaminating RNA and l i n e a r i z e d by d i g e s t i o n a t a unique r e s t r i c t i o n s i t e o u t s i d e o f the i n s e r t . The o n l y step d i f f e r e n t from above was i n the primer a n n e a l i n g where instead the sealed -19-c a p i l l a r y was heated to 100°C f o r 3 minutes and q u i c k c h i l l e d i n ice water b e f o r e proceeding with the t e r m i n a t i o n reactions. Best r e s u l t s were o b t a i n e d i f the r e a c t i o n s were kept on i c e u n t i l a d d i t i o n of DNA polymerase I (Klenow). Rapid C h a r a c t e r i z a t i o n of Random M13 Templates For 25 template samples, 1.2 u l primer mix (6 u l 17-mer p r i m e r , 10 u l 10x b u f f e r , 15 u l H 20) was mixed w i t h 1 u l template DNA i n s e a l e d c a p i l l a r i e s and h y b r i d i z e d as described above. The contents were expelled to 1.5 ml Eppendorf tubes, mixed with 1.5 u l n u c l e o t i d e mix (37 u l ddTTP/dNTP from Table I ,2 u l 15 uM dATP, 60-80 u C i ( 3 2 P ) d A T P (3000 Ci/mmole)) and the r e a c t i o n s s t a r t e d by a d d i t i o n o f 0.4 u n i t s DNA polymerase I (Klenow) as a b o v e . A l l s u b s e q u e n t s t e p s were performed as described in section above. Sequencing g e l s and E l e c t r o p h o r e s i s Sequencing g e l s were p o u r e d between s i l i c o n i z e d g l a s s p l a t e s ( 4 0 cm x 18 cm) with t h i n s p a c e r s (0.35cm) using a g e l m a t r i x c o m p o s e d o f 6% a n d 8 % d e i o n i s e d a c r y l a m i d e : b i s a c r y l a m i d e ( 2 0 : 1 ) , 0.5x TBE, 8.4 M u r e a , 0.06% ammonium p e r s u l f a t e and 20 u l TEMED i n a t o t a l volume of 50 ml. B e f o r e p o l y m e r i z a t i o n ( i . e . a d d i t i o n o f t h e l a t t e r two ingredients) the s o l u t i o n was e x t e n s i v e l y degassed. Af t e r s e t t i n g at l e a s t one hour the g e l s were pre-electrophoresed 30 minutes at 1500 V ( o p t i o n a l ) . I m m e d i a t e l y b e f o r e l o a d i n g the g e l s the -20-r e a c t i o n tubes were heated (caps open) f o r 3 minutes a t 95 C and 1-1.5 u l loaded into 0.5 cm s l o t s f r e s h l y flushed with buffer (0.5xTBE). E l e c t r o p h o r e s i s o f the 8% g e l was s t a r t e d at 1800 V (constant, g i v e s about 20-25 mA) and c o n t i n u e d f o r 60 minutes a f t e r which the v o l t a g e was decreased to 1500-1600 V (about 15 mA) and stopped when the bromophenol blue had j u s t l e f t the g e l ( t o t a l time = 90 m i u n t e s ) . E l e c t r o p h o r e s i s o f the 6% g e l was i d e n t i c a l except t h a t i t was c o n t i n u e d u n t i l 30 to 45 minutes a f t e r the xyl e n e c y a n o l had l e f t the g e l and was o f t e n turned down t o l o w e r v o l t a g e (1200-1400 V, 10-12 mA) to pr e v e n t overheating ( t o t a l time = 4 h o u r s ) . The g e l s were immediately transferred to 3MM paper (Whatman) , d r i e d down under vacuum at 80°C, and exposed to X - r a y f i l m (Curex) f o r 3 h r s to 3 days depending on the r a d i o l a b e l i n c o r p o r a t e d . T y p i c a l y i e l d s o f r e a d a b l e DNA s e q u e n c e from b o t h g e l s t o t a l l e d around 300 n u c l e o t i d e s . C o n d i t i o n s t h a t a d v e r s l y a f f e c t e d t h i s y i e l d included; e x c e s s i v e heat d u r i n g e l e c t r o p h o r e s i s , i n t e r r u p t i o n s during g e l drying, improperly d e i o n i s e d formamide, impurities i n the template, c h o i c e o f sequencing primer, batch v a r i a t i o n of radionucleotides, aging d i d e o x y and deoxynucleotides, sloppy or e x c e s s i v e sample l o a d i n g , and the source o f DNA polymerase I (Klenow) (Best r e s u l t s were o b t a i n e d w i t h the product from Boehringer Mannheim). - 2 1 -R e s u l t s R e s t r i c t i o n Mapping and tRNA gene l o c a l i z a t i o n (a) pDt27R- A r e s t r i c t i o n map of the 6.4 kbp H i n d l l l fragment c o n t a i n e d i n p D t 2 7 R i s shown i n . F i g u r e 2 a . S o u t h e r n h y b r i d i z a t i o n s w i t h ( 3 2 P ) t R N A 4 S e r showed t h a t the gene(s) are l o c a l i z e d to a 1 kbp r e g i o n on the. extreme r i g h t end of the i n s e r t . A s i n g l e 1.5 kbp BamHI fragment, i n c l u d i n g 346 bp of pBR322, h y b r i d i z e d w i t h t h e p r o b e ( F i g 3b l a n e e ) . A more d e t a i l e d map o f t h i s r e g i o n was o b t a i n e d from S m i t h / B i r n s t i e l p a r t i a l digestions of the 5.4 kbp Ec o R I / H i n d l l l fragment l a b e l l e d w i t h 3 2 P a t t h e H i n d l l l s i t e ( F i g u r e 4) The t R N A 4 S e r and Se r tRNA^ n u c l e o t i d e s e q u e n c e s (22) p r e d i c t p a t t e r n s o f r e s t r i c t i o n s i t e s i n t h e i r genes ( i . e . H a e l l l and TaqI) that are seen a t two l o c a t i o n s w i t h i n t h e p o r t i o n o f the i n s e r t t h a t hydridizes the probe. One p u t a t i v e gene has i t s 5' end very close (40 bp) to the H i n d l l l s i t e and the second i s 300 bp downstream i n the same o r i e n t a t i o n as judged by the order of the H a e l l l and TaqI s i t e s (5' t o 3')« When S o u t h e r n h y b r i d i z a t i o n s were performed w i t h plasmid DNA d i g e s t e d with Sau3a and H a e l l l the h y b r i d i z i n g fragments are o f the s i z e p r e d i c t e d from the f i n e mapping i . e . f o r Sau3a 250 bp and 530 bp and f o r H a e l l l 340 bp and 740 bp (data not shown) . Because two TaqI s i t e s are present Ser i n these r e g i o n s the genes p r o b a b l y code f o r tRNA 4 (22). The f i n e mapping a l s o r e v e a l e d a c l u s t e r i n g of r e s t r i c t i o n -22-F i g u r e 2. R e s t r i c t i o n maps o f t h e D r o s o p h i l a H i n d l l l fragments c o n t a i n e d i n (a) pDt27R and (b) pDt5. S o l i d l i n e s c orrespond to D r o s o p h i l a DNA and the broken l i n e s to pBR322. Se r Portions o f the i n s e r t t h a t h y b r i d i z e d the tRNA^ probe are i n d i c a t e d w i t h f i l l e d boxes below t h e r e s t r i c t i o n s i t e s i n question. EcoRI Hindl l l EcoRI PstI C l a l Xho l l (Ava l ) •a a cn Pvu II PstI C l a l •Pvu II • A v a I Xho l l (Ava l ) 'H ind l l l j - B a m H l PstI PstI PstI Bam HI C l a l Pvu II 4-PstI EcoRI Hindl l l Pvu II EcoRI B a m H l IBamHI BamHl B a m H l w O N> J3 l -H indl l l -r BamHl -24-Figure 3. Southern B l o t A n a l y s i s o f tRNA gene c o n t a i n i n g fragments from pDt27R. (A) Plasmid DNAs (2-3 ug) were digested with r e s t r i c t i o n enzymes and f r a c t i o n a t e d by electrophoresis i n 1% agarose g e l s c o n t a i n i n g 0.5x TBE and 1 ug/ml EtBr for 6 hours at 5 V/cm. Photograph shows bands i l l u m i n a t e d with low incidence UV i r r a d i a t i o n (254 nm) . (B) Gel bound r e s t r i c t i o n fragments i n (A) were transferred to Genescreen (NEN) and hybridized with 3-4 x 1 0 6 cpm ( 3 2 P ) p C p l a b e l l e d t R N A 4 S e r f o r 48 h o u r s a t 37°C as d e s c r i b e d i n Methods. The autoradiogram was exposed 48 hours at -70°C wit h an i n t e n s i f y i n g s c r e e n . Lane m c o n t a i n s lamda DNA digested w i t h H i n d l l l and pBR322 digested with H i n f l . The s i z e s o f t h e r e s u l t i n g f r a g m e n t s a r e i n d i c a t e d i n k i l o b a s e p a i r s on the s i d e . Lane a c o n t a i n s p D t l 6 DNA digested with PvuII. Lanes b-g are pDt27R d i g e s t e d with H i n d l l l (lane b), C l a l (lane c ) , Aval (lane d ) , BamHI (lane e ) , PvuII (lane f ) , and PstI (lane g ) . -is--26-Figure 4. Smith B i r n s t i e l mapping of the 5.4 kb EcoRI/Hindlll fragment from pDt27R. P a r t i a l d i g e s t i o n s with H a e l l l and TaqI of the H i n d l l l P - l a b e l l e d fragment and e l e c t r o p h o r e s i s o f the r e s u l t i n g fragments are d e s c r i b e d i n the Methods s e c t i o n . The s i z e markers (m) are the. same as i n Figure 3. The autoradiogram i s of a d r i e d 1.5 % agarose g e l f r a c t i o n a t e d at 15 cm/V f o r 36 hours and exposed 48 hours as i n F i g u r e 3. Lanes from l e f t to r i g h t c o n t a i n a l i q u o t s d i g e s t e d f o r i n c r e a s i n g l e n g t h s w i t h r e s t r i c t i o n enzyme (See methods) . On the f a r r i g h t i s a l i n e a r scale map of a p o r t i o n o f the i n t a c t 5.4 kbp fragment with the l a b e l l e d H i n d l l l s i t e a t t h e b o t t o m . The H a e l l l and Taq I r e s t r i c t i o n s i t e s associated with tRNA genes are indicated by the open and closed t r i a n g l e s , r e s p e c t i v e l y . The o r i e n t a t i o n of the serine tRNA genes are i n d i c a t e d by the arrows pointing 5* to 3'. The arrows marked (B) r e f e r to the l o c a t i o n of BamHI s i t e s within the tRNA A r g genes. These are a l l i n the same o r i e n t a t i o n as the serine genes (see text for d e t a i l s ) . - 2 7 --28-s i t e s (TaqI and H a e l l l i n F i g u r e 4 and H i n f l , Sau3a, Ddel, data not shown) around the BamHl s i t e s 670 bp downstream from the Ser 3? second tRNA^ gene. S o u t h e r n h y b r i d i z a t i o n s w i t h ( P)4S RNA gave very weak s i g n a l s f o r r e s t r i c t i o n fragments from t h i s r e g i o n compared to those r e g i o n s c o n t a i n i n g the s e r i n e tRNA genes (data not shown). This r e g i o n may therefore contain further tRNA genes (see below). No other strong bands were seen using t h i s probe. (b) pDt5- A r e s t r i c t i o n map o f the 4.4 kbp H i n d l l l fragment i n pDt5 i s shown in Figure 2b. A s i n g l e 850 bp A v a l / C l a l fragment Se r h y b r i d i z e d the tRNA^ probe on Southern f i l t e r s ( F i g u r e 5b lane c ) . The 650 bp PvuII/Clal subfragment was analysed i n d e t a i l by DNA sequencing d e s c r i b e d below. F o r both plasmids these r e l a t i v e l y d e t a i l e d r e s t r i c t i o n maps were v e r y u s e f u l i n subsequent subcloning into M13 sequencing vectors. DNA S e q u e n c i n g (I) tRNA Genes The s m a l l e s t fragments p r e d i c t e d t o c o n t a i n tRNA genes (above) were p u r i f i e d from g e l s and subcloned d i r e c t l y into the M13 sequencing v e c t o r s . The two Sau3a fragments of, pDt27R that hybridized the tRNA probe d i d not c l o n e r e a d i l y ; M13 subclones containing only one o r i e n t a t i o n (the coding strand) of the 250 bp fragment were o b t a i n e d . S e v e r a l a t t e m p t s d i d n o t produce recombinants of the l a r g e r 530 bp fragment. Both o r i e n t a t i o n s of -29-Figure 5. Southern B l o t A n a l y s i s o f r e s t r i c t i o n fragments Ser c o n t a i n i n g tRNA^y^ gene(s) i n pDt5. Plasmid DNA (2 ug) was digested with Pstl/HincII (lane a) , Aval (lane b),AvaI/ClaI (lane c ) , Aval/Xhol (lane d), A v a l / H i n c I I (lane e ) , and treated exactly as described i n (A) and (B) of F i g u r e 3. The autoradiogram was exposed 54 hours and the s i z e markers (same as F i g . 3) are i n kilobasepairs.a -30-B c d e m a b c d e . - 2 3 .-9.5 —6.5 -4.2 L 2 . 2 Ll.9 t -1.6 ^ 0 . 5 - 3 1 -the 200 and 600 bp BamHI f r a g m e n t s o f pDt27R and the 650 bp P v u I I / C l a l fragments o f pDt5 were r e c o v e r e d . Chain terminator r e a c t i o n s ( M a t e r i a l s and Methods) with these phage templates i d e n t i f i e d a l l the tRNA genes except t h a t on. the 530 bp Sau3a fragment of pDt27R. T h i s fragment was s u b s e q u e n t l y l a b e l l e d at the H i n d l l l s i t e and sequenced by chemical degradation. A l l gene sequences were l a t e r confirmed on both s t r a n d s u s i n g d i f f e r e n t M13 subcloning s t r a t e g i e s (below). (II) tRNA Gene F l a n k i n g Sequences a) Random S u b c l o n i n g - T h i s s t r a t e g y p r o d u c e d p a r t i a l sequence of the 2.0 kbp and 1.5 kbp BamHI fragments from pDt27R. Digestion of the target DNA with Sau3a, H a e l l l , and A l u l produced fragments that v a r i e d i n l e n g t h from 65-650 bp. The smallest of these tended to c l o n e more f r e q u e n t l y and were over-represented i n the sample of randomly choosen recombinants. This reduced the p r o b a b i l i t y of f i n d i n g more unique c l o n e s i n the l i m i t e d sample and l e f t gaps i n the t a r g e t sequence d e s i r e d . A n a l y s i s o f an impractical number of random subclones would have been necessary for determination o f the complete n u c l e o t i d e sequence of these r e g i o n s . Another f a c t o r i n f l u e n c i n g t h e r e c o v e r y o f random i n s e r t s i s t h e p o t e n t i a l b i a s t h e phage may show towards d i f f e r e n t i n s e r t sequences. Some i n s e r t s when s i n g l e stranded may form s e c o n d a r y s t r u c t u r e s t h a t r e d u c e phage v i a b i l i t y or s t a b i l i t y . This may be the case for i n s e r t s containing tRNA genes. None was recovered out o f 48 random clones from the 1.5 kbp BamHI fragment of pDt27R. As mentioned above, even l i g a t i o n reactions -32-with p u r i f i e d fragments f a i l e d to produce recombinants. b) Progressive Subcloning: S e v e r a l non-random DNA sequencing methods have been d e s c r i b e d f o r use w i t h M13 or o t h e r vectors that contain s i m i l a r polycloning regions and use universal primers (40-43). In these a f a m i l y o f o v e r l a p p i n g d e l e t i o n variants are constructed from a recombinant c o n t a i n i n g a l a r g e i n s e r t (1-3 kbp). The d e l e t i o n s extend from the i n s e r t end adjacent to the p r i m i n g s i t e and c o n t i n u e i n t o t h e i n s e r t by d i f f e r e n c e s o f 200-300 bp. In t h i s way o v e r l a p p i n g DNA sequence can be obtained a c r o s s the e n t i r e i n s e r t u s i n g t h e same pri m i n g s i t e . The drawback o f s u c h methods a r e t h e number and c o m p l e x i t y o f manipulations required i n making the d e l e t i o n s and recovering the d e s i r e d v a r i a n t s . The p r o c e d u r e d e s c r i b e d i n M a t e r i a l s and Methods, i n p a r t i c u l a r , Method I I (see F i g u r e 1) were used to circumvent some o f the v a g a r i e s i n h e r e n t i n the p u r i f i c a t i o n of intermediates and t h e i r subsequent r e c l o n i n g . Though e f f e c t i v e , there are some l i m i t a t i o n s i n the method described here. The range of s u i t a b l e t a r g e t DNA i s l i m i t e d by two f a c t o r s . F i r s t , two unique r e s t r i c t i o n s i t e s (A+B or A+C) are required i n the Ml3 p o l y c l o n i n g r e g i o n t h a t do not occur w i t h i n the target DNA. B e c a u s e t h e v e c t o r was d e s i g n e d f o r B - g a l a c t o s i d a s e complementation the v a r i e t y o f r e s t r i c t i o n s i t e s a v a i l a b l e i s l i m i t e d . The second l i m i t a t i o n concerns the s i z e and nature of i n s e r t s that w i l l s t a b l y c l o n e i n t o M13 s i n g l e stranded phage. This w i l l vary from i n s e r t to i n s e r t and can only be resolved by t r i a l and e r r o r . A more g e n e r a l l i m i t a t i o n i s t h a t s e v e r a l - 3 3 -enzymatic steps are required. The o v e r a l l outcome i s dependant on t h e i r q u a l i t y and judicious use. The 3' f l a n k i n g sequence o f the gene i n pDt5 was obtained using an M13mpll recombinant c o n t a i n i n g the 2.0 kbp C l a l fragment (see F i g u r e 2b) cloned i n t o the AccI s i t e o f the v e c t o r . This i n s e r t contained neither EcoRI nor BamHl s i t e s and therefore were used as r e s t r i c t i o n s i t e s (A) and ( C ) ,respectively, i n generating d e l e t i o n s w i t h SdATP as o u t l i n e d i n F i g u r e 1. The e n t i r e sequence was o b t a i n e d w i t h n i n e o v e r l a p p i n g d e l e t i o n v a r i a n t s taken from 3, 6, and 9 minute exonuclease I I I treatments. The phage DNA from these v a r i a n t s a r e shown i n Figure 6a. A wide s i z e range of i n s e r t d e l e t i o n s were recovered from each exonuclease III treatment. For example, phage DNA i n l a n e s c, f,• and j a l l r e s u l t from the same 3 minute exonuclease I I I treatment. This could r e s u l t from S 1 n u c l e a s e c u t t i n g a t n i c k s i n the DNA. The sequence shown i n Figure 8 i s t e n t a t i v e . No overlap e x i s t s at the leftmost C l a l s i t e i n F i g u r e 2b and a l l the sequence f o r the 2.0 kbp C l a l fragment i s from the same s t r a n d . Some G-C r i c h regions i n t h i s fragment were ambiguous on d i f f e r e n t d e l e t i o n clones and must be confirmed on the o t h e r s t r a n d . Only the tRNA gene i n the 650 bp P v u l / C l a l fragment was sequenced on both strands. The same strategy was used to c o n f i r m and make overlaps for the r i g h t h a l f of the i n s e r t i n pDt27R. P a r t i a l sequence had been determined using a combination o f random and s p e c i f i c subcloning s t r a t e g i e s (above). The 3.2 kbp P s t l / H i n d l l l fragment (Figure 2a) was cloned into the P s t I and H i n d l l l s i t e s of M13mp9. The i n s e r t -34-contains neither EcoRI nor S a i l s i t e s and were used as s i t e s (A) and (C) w i t h SdATP as d e s c r i b e d above. T h i s recombinant was unstable however. T r a n s f o r m a t i o n w i t h p u r i f i e d fragment l i g a t e d to v e c t o r produced recombinants t h a t had a p p a r e n t l y undergone various degrees o f d e l e t i o n (data not shown) Only 25-50% were i n t a c t as judged by r e s t r i c t i o n a nalyses a f t e r electrophoresis i n agarose g e l s . Once packaged, these i n t a c t recombinant phage could be grown i n large c u l t u r e s w i t h no f u r t h e r d e l e t i o n s occurring. The i n s t a b i l t y might be due to the s i x tRNA genes that are within t h i s i n s e r t (see below) The nine d e l e t i o n clones shown i n Figure 6b cover 75% of the, i n s e r t and c o n f i r m a l l t h e s e q u e n c e e x c e p t the BamHI s i t e c l o s e s t to the r i g h t H i n d l l l s i t e i n Figure 2a. No overlap e x i s t s here and the sequence i s assumed to be c o n t i g u o u s because t h i s r e s t r i c t i o n s i t e i s conserved i n t h r e e otherwise i d e n t i c a l tRNA gene coding sequences (see below). Larger numbers o f d e l e t i o n c l o n e s were s c r e e n e d i n o r d e r t o o b t a i n t h o s e used f o r sequencing. A p r o p o r t i o n (up to 75%) had d e l e t e d most or a l l of the i n s e r t . This may have been due t o the observed i n s t a b i l t y of the i n t a c t r e c o m b i n a n t o r t o e n d o n u c l e o l y t i c S^ n u c l e a s e cleavage. In both these examples the oc phosphorothioate dNTP l a b e l l e d ends e f f i c i e n t l y protected the M13 vector sequences from d i g e s t i o n with exonuclease III (36). In each the SdATP l a b e l l i n g occurred at the EcoRI s i t e and p l a c e s the b l o c k i n g n u c l e o t i d e two basepairs from the 3' end of the priming s i t e . Out of about t h i r t y templates -35-Figure 6. Recombinant M13 Phage template DNA o f d e l e t i o n c l o n e s g e n e r a t e d by s i n g l e end l a b e l l i n g w i t h SdNTP and exonuclease I I I / nuclease . The s i n g l e s t r a n d e d DNAs were sized by elect r o p h o r e s i s through 0.7% agarose gels at 4 V/cm for 16 hours. (A) shows d e l e t i o n c l o n e s generated from RF M13 mpll c o n t a i n i n g the 2.0 kb C l a l f r a g m e n t o f pDt5. Lanes a and 1 c o n t a i n w i l d t y p e M13mpll phage DNA and l a n e s b and k c o n t a i n phage DNA from the i n t a c t recombinant. The extent of d e l e t i o n i s 194 bp i n lane c, 436 bp i n la n e d, 714 bp i n lane e, 904 bp i n lane f , 1136 bp i n lane g, 1394 bp i n lane h, 1576 bp i n lane i , and 1796 bp i n lane j . (B) c o n t a i n s d e l e t i o n clones of the 3.2 kb P s t l / H i n d l l l fragment o f pDt27R i n M13mp9. Lanes a and m contain wildtype M13 mp9 phage DNA and l a n e s b and 1 i n t a c t 3.2 kb recombinant phage DNA. Clones i n lane c are deleted 496 bp, i n lane d 847 bp, i n la n e e 1096 bp, i n lane f 1532 bp, i n lane g 2227 bp, i n lane h 2626 bp, i n lane i 2870 bp, i n lane j 2990 bp and i n lane k 3123 bp. -37-attempted only one would not sequence and presumably was due to los s of t h i s s i t e . P o r t i o n s o f the 2.3 kbp r e g i o n a d j a c e n t to the 3.2 kbp P s t / H i n d l l l fragment were sequenced by the d e l e t i o n method I (Figure 1 ) . In one case the 1.9 kbp P s t l / H i n d l l l fragment i n M13mp9 was d e l e t e d u s i n g BamHI as enzyme (A) and H i n d l l l as enzyme (B). Five clones gave sequence out to the EcoRI s i t e (1.1 kbp). In another example the 1.1 kbp Pst I fragment cloned into pUC13 was deleted using H i n d l l l as (A) and EcoRI as (B). Deleted i n s e r t s were recloned i n t o M13 and sceened by plaque l i f t s using the p u r i f i e d fragment as a h y b r i d i z a t i o n probe to avoid those M13 recombinants c o n t a i n i n g pUC sequences. By combining wi t h the sequence obtained by random and s p e c i f i c s u b c l o n i n g the e n t i r e 2.3 kbp region was determined. A summary o f a l l t h e s e q u e n c i n g r e a c t i o n s used f o r compilation by the computer (using the Staden (44) programs BATIN and DBUTIL) are shown i n Figure 7. Serine tRNA Genes i n pDt5 and pDt27R a) p D t 5 - F i l t e r h y b r i d i z a t i o n s w i t h ( 3 2 P ) t R N A 4 S e r l i m i t e d regions c o n t a i n i n g homologous gene sequences to 650 bp between the PvuII and C l a l s i t e s i n the 4.4 kbp plasmid i n s e r t (above). The DNA s e q u e n c e i n t h i s r e g i o n c o n t a i n s a gene corresponding to t R N A y S e r ( F i g u r e 8) t h a t i s i d e n t i c a l to the two genes previously d e s c r i b e d a t 12E (22). It i s oriented 5' to -38-Figure 7. Sequencing Strategy for pDt27R and pDt5. S o l i d l i n e above the arrows corresponds to the l i n e a r r e s t r i c t i o n map taken from Figure 2. These are i n the o p p o s i t e o r i e n t a t i o n so that the tRNA genes are 5' to 3' from l e f t to r i g h t . The positi o n s of the genes are indicated by boxes. R e s t r i c t i o n s i t e s are indicated by l e t t e r s ; BamHI (B) , C l a l (C) , EcoRI (E) , Pst I (P), PvuII (Pv) , Smal (S ) , H i n d l l l (H). P o r t i o n (a) corresponds to the 3.2 kb P s t l / H i n d l l l fragment of pDt27R. A l l the sequencing gels used i n the computer c o m p l i l a t i o n are i n d i c a t e d by arrows (5' to 3' i n the d i r e c t i o n o f the arrow). A l l the sequence i s confirmed by o v e r l a p s e x c e p t a t t h e l e f t m o s t BamHI s i t e . P o r t i o n (b) corresponds to the adjacent h a l f of the pDt27R i n s e r t . Overlapping sequence extends for 2.3 kb towards the H i n d l l l s i t e . No sequence overlap e x i s t s at the P s t I s i t e j u n c t i o n o f region (a) and (b). P o r t i o n (c) o f F i g u r e 7 shows t h e g e l s used to compile the sequence of pD t 5 . A l l t h e se q u e n c e o v e r l a p s except a t the right-most C l a l s i t e . -39-X—1 UJ— O) < CQ-CQ-CQ-< in— D. 0 D_ — CL-0_-CQ — O — CO— a. o-> Q_ — o— a .a o o <0 > 4 -40-3' from r i g h t to l e f t i n F i g u r e 2b and has 1.3 kb and 3.0 kb of flanking sequence between the H i n d l l l s i t e s used i n cloning. The nucleotide sequence was determined f o r 397 bp 5' and 2999 bp 3' to the mature codi n g sequence o f the gene. No o t h e r tRNA genes are present within t h i s r e g i o n . L i k e a l l e u k a r y o t i c tRNA genes, i t does not encode the 3 1 CCA p r e s e n t i n the mature tRNA and has an. o l i g o - t h y m i d y l a t e sequence (dTg) beginning 14 bp downstream from the gene.The o n l y homologies wi t h f l a n k i n g sequence around i d e n t i c a l genes a t 12E are these dT t r a c k s and s h o r t conserved sequences l e s s than 30 bp 5* to the coding regions (see below). Although no o t h e r genes a r e p r e s e n t w i t h i n t h i s plasmid i n s e r t , i n s i t u h y b r i d i z a t i o n s u g g e s t s t h a t more genes are present at the 23E chromosomal s i t e . E l d e r e t a l . described 23E as a strong s i t e of h y b r i d i z a t i o n w i t h 4S RNA that contains four o r more tRNA g e n e s ( 3 ) . H y b r i d i z a t i o n w i t h p u r i f i e d t R N A 4 / , 7 S e r shows t h i s s i t e i s m i n o r compared to 12E but i s s t i l l s t r o n g e r t h a n t h e s i t e s a t 56D and 64D so t h e r e are Se r p r o b a b l y more t R N A ^ 7 genes p r e s e n t (5). b) pDt27R- The n u c l e o t i d e sequence ( F i g u r e 9) confirms the r e s u l t s o f Southern h y b r i d i z a t i o n s and d e t a i l e d r e s t r i c t i o n mapping p r e s e n t e d a b o v e . Two i d e n t i c a l q e n e s t h a t encode Ser tRNA^ are p r e s e n t w i t h i n the 1.2 kbp BamHI/Hindlll fragment on the extreme r i g h t of the 6.4 kbp i n s e r t as shown in Figure 2a. As predicted from the tRNA sequence, these genes d i f f e r from those encoding t R N A 7 S e r a t p o s i t i o n s 16, 34 (anticodon CGA), and 77 but are otherwise i d e n t i c a l . The sequence homology ends exactly - 4 1 -F i g u r e 8. The n u c l e o t i d e sequence o f pDt5. Shown i s the noncoding s t r a n d (5*-3' l e f t to r i g h t ) o f the 4.4 kbp H i n d l l l fragment contained i n t h i s p l a s m i d . The sequence begins near (<10 bp) the rightmost PvuII s i t e i n F i g u r e 2b and c o n t i n u e s w i t h overlaps to the l e f t m o s t C l a l s i t e . No sequence o v e r l a p e x i s t s with the adjacent 670 bp C l a l / H i n d l l l fragment but the sequence S e r i s shown c o n t i g u o u s n o n e t h e l e s s . The tRNA^ n o n c o d i n g sequence and r e s t r i c t i o n s i t e s i d e n t i f i e d i n mapping studies are boxed. Dashes indi c a t e ambiguous p o s i t i o n s that are not confirmed. -42-20 40 6 0 8 0 100 120 A G T A T 7 T G T A T A A T T T T A T G A G T T C G T T T G C A T T A C T T A T A T A A C T T A T T T T T C C A T G T G G A T T A G G T C T T C T T T C A T T T T C G T G G G G C A A G C A G A A A T G C G A G G G C A T G A A T T A C A A A M O 160 180 2 0 0 2 2 0 2 4 0 T G C G G C . \ T C A A T T G T T G C T G T C G T G A G T A T T G T C C T A A A C G G T T T T G T A A A T T T T A A T G C G G T C A A T A A A G G G T A T T A A A A A A A A T T A A A T C C C T T G T A T T C G A A T A A A A G G A A G C A A G T 2 6 0 2 8 0 3 0 0 3 2 0 3-10 3 6 0 A A A G G G V r T T G T G T G T C A C A T T C A A C T T G G C G C T C A A A T T C A A G T A A C A C A C A C A T G C A G T G T T G T C A A A T G A G C A A G G T T C C G A A A T G T G T G T T C A G T C T T G G A T T C T C C C A T G C A A T C 3 8 0 JQO 4 2 0 44Q 4 6 0 4 8 0 A AC AT T A3T TGCCA A T T T G C C G T G T C A T A T T A AC AfiC AGTCGTGGCCGAGCGGT T AAGGCGTCTGAC TAGA A A TCAGAT T C C C T C TGGGAGCG TAGGT T C G A A T C C T A C C G A C T GCG^GA 5 0 0 5 2 0 5 4 0 5 6 0 5 8 0 6 0 0 AGGTTT * " G G A T T T T T T T T A T T T T T C A A C A T T C T C T A T T C T A T T C T C T A T T T T T T C C T C T C A G A A A C T G G T T A A A T T A T T A T A A T A A T A A T A C A T A C A T G T G T G C T G T T T G T T T A C A A C T 6 2 0 6 4 0 6 6 0 6 8 0 7 0 0 7 2 0 CGATTA ? r T T T T C A C T C T C T A C G T A C A C A G A A C A C C C T A T T C C C C T T A C A T T G C A C T G T T G C G C G T G C A G T C G T A T G T C A T C G A T A A C C G A T T A C A A A A C A T T T G A T G T A T T T T T A T C G A 7 4 0 7 6 0 7 8 0 8 0 0 8 2 0 8 4 0 ; GGAAA t i A G G A C C T A T A T C T T A T T T T G A A A A T A A A A A T T T G T A G G A G A A A T G A G A G C G T A A G T A T G T G C T T T T G T A A A T G T G C G T G T C C T A A A G T C C C A T C T C G T C A T T T T A G C G C A C T 8 6 0 8 8 0 9 0 0 9 2 0 9 4 0 9 6 0 ( ' A A A G A C V G A T G C C G A G T C T G C C T T G G G G T C A G T G A A A A C G T G G T A A A C A T T T T C G A G G C A A A A C A A G A C C T G C T G G T - T T C A A T A G C A C A A G T G A T C T C T G A A T G C A C C G A C T G T G A C A T 9 8 0 . 1000 1020 1040 1060 1 0 8 0 TAAAGA 6 3 G G G A C G A T C T G T C G G A G T T A A T T T G T G C A T C C T G T T T G G A G G C C C A G A G A G C A T T C G A T A T C A T C A G A A A A T A C G A C G C G C A G T A C A T C A C C T T C T G T G A G G C A T A C G A 1100 1120 1140 1160 1180 1200 & G C G G 7 1 - T T G A A G A A G A G G A T T C C C T A G A C G G A G A G G 7 G T A C A C A A T A T C G G A C A G C G A G A G T G G G A C G T C G T C G C A C G A T A C C A A C G G A A A C C A A A A G T A C A T A A A T G C C G A T G A A A T 1220 1240 1260 1280 1300 1 3 2 0 : T A T G A ' . . A T A T C A G A A G A T G A A T G T G A T C A A A C C G T A G A T G C A A A A G G A G A A G A C T T C A A T A A T A G C G T C G A C G A T A G T G T T C A T T C G A A G A A T C A G C A A C A T G A T G A A A A G G A A C C C A A 1340 1360 1380 1400 1420 14 4 0 AGAA AG 3 G T A C A T T G G A C A A G G A T G T C C A G G A C G C C C C C C G A A A T G A A A G T G T T G C A C T T G A T C A A T C A G C A A G G T G A G A C T G A C A C C G A A A A A T T G G C T T T G G A C G G C A G T G A A T G T G 1460 1480 15O0 1520 1540 1560 1 T C G G A . i C G G T G C T C G G A T G G C C T A C A A G T - T C C C A C T G C A G T A A G T C C T T T C C A C A T C G A T C C A G G T T C G A G G A C A C A A C C G C G T C C A C A C G G G A G A C G A C C A T T C A A A T G C C C C A G C T 1580 1600 1620 1640 1660 1680 :.CCCGA r - 3 A C C T T C C G A C T G A A A T C C T T T C T T A A A A G G C A C A G C G C C C T G C A T T T G G A A G A A C G A C C T T A C C C G T G C G A C A T C T G T G C C A A G A - T T T T G C T G A C A A A A G T A A C C T G C G C C 1700 1720 1740 1760 1780 1800 rt A G C A A H A A G A C A C A C T C C G t C A T T C G A C C C T T C G A C T G C C C T T C C T G T C T G A G T T C C T T C C G A T T G A A A G C C A C C T G G A C C G C C A C A C C A T G A G T C A C A - - G G G C G A G C G G C C A T T T A A 1820 1840 1860 1880 1900 1920 G T G T G A V . : A C T G C G G T A A A G A C T T C A C G C T A C G C T G T A A C C T C G T C A A G C A T T T A A G G A C C C A C A C C A G G G A A C G T C C C T T C A A A T G C T C A A T A T G A A A A T C G G C C T T T A C G A A C T T A T C 1940 1960 1980 200O 2 0 2 0 2 0 4 0 G A G C C C v A T T G C A T G A A C C A T C G A A T G A A C T A C C T T T C C A G T G T G A T C G G T G C G A C A A - G G T T T G T G G A T A G G G T T C G T C C T G A C T G C C A G T C C C G T T T C T C G A C G T C A T C C G A C C T C C A 2 0 6 0 2 0 8 0 2 1 0 0 2 1 2 0 2 140 2 1 6 0 C C A G C C C G G A C T G G T A C A C A A G G C A A A A G C A A A G A T A C T A G A A T A A T T C T A G T G T C T T T G G A A A A A T G A C C T T T T A C G T G A A G T G T G A G G G T T G C G G T T T A G T C C T T A A G A A T A T G A T T C 2 1 8 0 2 2 0 0 2 2 2 0 2 2 4 0 2 2 6 0 2 2 8 0 I rCTTCG.t A G G C A T G C T A A G A A T T A C G G C A A G G C G T T A A A A A T G T A A T C T T A T C T CCAAATACGTACCAAAT A C G T A T T T A T T A T A A T T T T G T T A T T T T T C A T TCAAGAAACGT T T T 2 3 0 0 2 3 2 0 2 3 4 0 2 3 6 0 2 3 8 0 2 4 0 0 T C A A G C T O G A T A A C A G T T C G G T A A C G T A A C A T A C A A A T T C T T T T G C G C C T A A C A G C C C A C T G T T G T G G A A C A G G G T G A T C A T T C C A C T A G C A A A C T G A A T G G C T A T G C C A A A A T G G T A A A 2 4 2 0 2 4 4 0 2 4 6 0 2 4 8 0 2 5 0 0 2 5 2 0 C A A A C T A V T C C C T A T A A T A A A T A A A C C G T C T C A T T T A A T T T G A A A A T A T T T A A A A T A C C A C T A C A T A T T T A T T T G T A A T T A C C T T T G A T C G A T T T G T A T A G G C G G C C A A G G T T T A T T A A A 2 5 4 0 2 5 6 0 2 5 8 0 2GOO 2 6 2 0 2 6 4 0 AT A C A G G G T A A T G G A G A A C A A G T G T C G A G T T T G C C T G G C A A G C T C A A A A A A C A T G G T G A A C A T T T T C G A G G A A A G G C A G G A T C T T C C A G T T T C A A T A G C C C A T A T G A T A A T T G A A T G C A C 2GGO 2 6 8 0 2 7 0 0 2 7 2 0 2 7 4 0 27GO C G G C T T C . ' i A A G T T G A A A A A G G G G A C T C A T T A C C G C A C T C A A T A T G C C C A C C A T G T G T G A A G G A T G C C C A C A A T G C G T T T A C G A T C A T A A A A A C C T A C G A A C G C A G C T A C C A G G T C T T C T A 2 7 8 0 2 8 0 0 2 8 2 0 2 8 4 0 2 8 6 0 2 8 8 0 T G A A G T G ^ A G G A C A C G G T T C T C G A G G A A G A A C T C T C G G A G G A T G T A A T C A T C G A G C T A T C G A T G A A C A A G A G G A G A A A G T T C A T T T G A G T G A A A A C A A G G C A C C T A C G A A T G A A G T C A G C 2 9 0 0 . 2 9 2 0 2 9 4 0 2 9 6 0 2 9 8 0 30OO A C C C A G G A A G A A T C T A A A A C T G C T C A A T C C G A C A A T G T T T C C G A G G A T A A G G G T C A C A T C T G C A C A C A G T G T C A C A T G T C C T T T C G G A G A C C T G G T C T C C T A G A G C T A C A C A T C C T G C G A 3 0 2 0 3 0 4 0 3 0 6 0 3 0 8 0 3 1 0 0 3 1 2 0 C A C C A C A C A A C G G A C G G A C C C C G T C A A T G T C C T C C A C C A G C G A G C A C G C G T C A A A G A A G A G T T G A G G A C G A A A G A A A G A C A G C T T T C A A G G A A T T C T A C G C A C A C C T G C C G C C T T T G T A A 3 1 4 0 3 160 3 1 8 0 3 2 0 0 3 2 2 0 3 2 4 0 C A A G A C C T T C T G C A G C A A A G C A A G C T G T G T C C C A C A G G G G G A A A A A C C C T T G C C T G C G A A A T T T G C C A A A A G C C A T T T G C G G A T C T T G C T T C C G T C A A A A G A C A T C T A A G G A C T C A C A C G 3 2 G 0 3 2 8 0 3 3 0 0 3 3 2 0 3 3 4 0 3 3 6 0 G G A G A A A r . A C C A T T C A A G T G C C T T A C C T G C C A G T C G G C C T T C T C G G A T G G A T C T G C T C T A A G G C A G C A C A T T C G A A T T C A C A C A G G A G A A A G G C C G T A C A A G T G C G A T A T G T G C G A T A A G 3 3 8 0 3 4 0 0 3 4 2 0 3 4 4 0 3 4 6 0 3 4 8 0 T T C T T C C G G G A G C G G T C A G A T G C T C G G A A G C A C A T G A T G A G C C A C A C C G C A G A A A A G C G A T T C A A G T G T T C C C A A T G C G A G C C G G T T T C C G C C A A C C A A A A G G T C T G C G T A G G C A T G T A A AGCT -43-with the mature coding sequence. Beyond, the flanking sequences are completely unrelated except for the oligo-thymidylate residues 15-16 bp downstream from the 3' end of the coding sequences. Also, two small conserved 5' flanking sequences are found at positions analogous to those conserved between the tRNA 7 S e r genes (<30 bp). Neither of the genes encode the 3'CCA end of the mature tRNA nor are they interrupted by intervening sequences. The genes are separated by 317 bp and are in the same transcriptional orientation. The gene closest to the Hindlll site of pBR322 (i.e. the end of the insert) contains only 39 bp of 5' flanking sequence. Until additional clones are isolated that extend this 5' sequence (in progress; J. Leung personal communication) i t cannot be known whether this gene pair occurs alone or is part of a larger cluster. One feature of the of the sequence between these genes is the presence of small duplicated regions (underlined in Figure 9). A 54 bp segment begining 198 bp 5' to the second gene (-198) is repeated at position -127 and are 90% homologous except for a 19 bp insertion in the l a t t e r . Such repeats have not been observed between other tRNA gene pairs (i.e.pDtl6) and their significance is not clear. Serine tRNA Genes at 23E and 12E A comparison of coding and immediate flanking sequences of -44-Figure 9. The nucleotide sequence of pDt27R. Shown is the noncoding strand (5'-3' l e f t to right) extending from the rightmost Hindlll site (Figure 2a) to 309 bp beyond the unique EcoRI sit e . The gene sequences are boxed and occur in the following order; Ser4/1, Ser4/2, Arg/1, Arg/2, Arg/3, and Arg/4. The repeated sequences between the Ser4 genes and around the Arg genes (see Figure 12) are underlined. Also underlined are oligo dT, dA, and Purine/Pyrimidine tracts found 1.3 kbp 3' to the Arg gene cluster. 20 40 60 80 100 120 AAGCTTAAATAGTGTATTGGGCTTGCGTAGGAACAAGT^3CAGTCGTGGCCGAGTGGTTAAGGCGTCTGACTCGAAATCAGATTCCCTCTGGGAGCGTAGGTTCGAATCCTACCGGCTGC 140 1G0 180 200 220 240 T ^ A T G A G A A T G T A T A T T _ T T A T T T C A A A T G T T T T T A T T T T C T G A A A T T A A A T A A A A A C G T T C T G C A T A G C A A A A C A A A T G A G T G C T A G G T G T T T A A A A A T A C A T T A T T T T A T T G C C A T A C G 2G0 280 300 320 340 360 G A A T T A T C C T A T T T A A C G A T C A A T T T A T A T T T A T A A G G T A G A G A A T T A A C C T T T T T T T T A A T T G T C T T A T A G A A T T A T C C T A T T T A A C G A T C A A A C T A T A T T T A A A A G T A T A A A A A A A G T 380 400 420 440 460 4B0 AGGAAACGTAGGAAATTAACCTTTGGCCCTGTTATATGCATAAACTCCGGAAGATTGTTGGGATTTGATCCAAAATAA^CAGTCGTGGCCGAGTGGTTAAGGCGTCTGACTCGAAATCAG 500 520 540 560 580 600 A T T C C C T C T G G G A G C G T A G G T T C G A A T C C T A C C G G C T G C G C A A G G G T A T T C C T A T A T T T T T T A T G T T T T A A A A G G T G C A T T C T T A C A G T T T T G A A T A T G T T T A T T A T A T T A C A C A C T G T G 620 640 660 680 700 720 C C C T T T G T T T G G C A A T T A C T T T C T G T C T A A T G A A T T T C T T A A T T C A A T T A T A A T C C G C A T T T T G A T C A T A T T T C G T A T T C A A G G A A C C A C A T C T C T A A T T T T T T T A C C T T G C C T A T T T G T 740 760 780 800 820 840 CTCGCATTGTGTAGCCCAAACACAACAACACCACCCACCAGACACGCACAAAATTATTTACATTTGCTGCTGACGAGTTCGTTGAATCTTTGATAACCTTTTTGGTCTGCTCCTCGGCAA 860 880 900 920 940 960 T T T T A T T T C T C T A T A T A C T A A A T T T T T C G G C T G T C T T T C C T T T A C T T T C G T T T T G C T C T T C C G T C T G T G G G C G T A T A T C G C G T C C A C A A A A A G C C T C A A A A T G T C T T T G G T C C T T T T G C A 980 1000 1020 1040 1060 1080 T\ CCATTGACGTTGTTGTTTCCGCAGGTCCGAGCCCGCAGGAATCTTTGATAAAGATCTTTATATTATCAATGTCTAAGTATAGATAAAATGAATAAATAATTATGAAATAAGAATGTAAAT 1100 1120 1140 1160 1180 1 2 0 0 ACAATTTTCAATCAATCGTTTTAAGCAAGGTTCATTTGCAATATTATAAACTATGATAGACCGTTTTGTATCATTGATCTTGGGAATTTGGGACGCCGGTTGCGTAAC i r .ACCGTGTGGC 1220 1240 1260 1280 1300 1320 CCAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCGfcAGCTCAGGCTATATTTTTTTAAATTATATTTTGTTCGTCCTAGAATATATTAATATG 1340 1360 1380 1400 1420 1440 GGAGATTCCCTAGCCCAACCCAAACACACCAACACCACCCACCAGACACGTACAAAATTATTTACATTTGCTGCTGACGAGTTCGTTGAACCTTTGATAACCTTTTTGGTCTGCTCCTCG 1460 1480 " 1500 1520 1540 1560 G C A A T T T T A T T T C T C T A T A T A C T A A A T T T T T C G T C T T T C T T T C C T T T A C T T T C G T T T T G C T C T T T C G T C G T T G G G C G T A T A T C G C G T C C A C A A A A G C C T C A A A A T G T C T T T G G T C C T T T T 1580 1600 1620 1640 1660 1680 GCACCATTGACGTTGTTGTTTCCGCAGGTCAGAGCCCGCAGGAATCTTTGATAATGATCTTTCTATTATTAATGTCTAAGTATAGATAAAATGAATAAATAATTATGAAAAAAGAATGTA 1700 1720 1740 1760 1780 1800 AATACAATTTTCAATCAATCGTTTTAAGCAAGGTTCATTTGCAATATTATAAACTATAATAGACCGTTTTGTATCATTGATCTTGGGAATTTGGGACGCCGGTTGCGTAACTCACCGTGT ma ma ' sso 1 9 0 0 1 9 2 0 GGCCCAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCG|\AGCTCAGGCTACATTTTTTTTAAATTATATTTTGTTCGTCCTAGAATATATTAA 1940 1960 1980 2000 2020 2040 TATGGGAGATTCCCTAGCCCAACCCATTTGTGTAACCTGAGAAATTGGGAATTTGGGACGGCGGTTGCGTAACTpACCGTGTGGCCCAATGGATAAGGCGTCGGACTTCGGATCCGAAGA 2060 2080 2 100 2 1 2 0 2 140 2 160 TTGCAGGTTCGAGTCCTGTCACGGTCGUAGCTCAGGCTATATTTTTTTTAAATTATATTTTGTTCGTCCTAGAATATATTTATATGGGAGATTCCCTAGCCCAACCCATTTGTGTAACCT 2180 2200 2220 2240 ?7KQ 2280 GAGAAATTGGGAATTTGGGACGGGGGTTACGTAACCpACCGTGTGGCCCAATGGATAAGGCGTCGGACTTCGGATCCGAAGATTGCAGGTTCGAGTCCTGTCACGGTCG| rAGCTCAGTAT 2300 2320 2340 2360 2380 2400 TTA A T T T T T T TTGflACTTATTTTTCGTTCGTCCAATAATATATTAATATGGGAGATTCCCTAGCCCCACTCATTTGTGTAACCTGAGTGCGGTAAGCAGCAATCGTAACCAATTGGCATA 2420 2440 2460 2480 2500 2520 CCCAATTGAAAGATTTATTGGACTTTTACATGGGTCGTCCATGGACGAATCAACATGTGGCTGCCACCGCAAGAAGCCCAACTTTGTTCGTTGGCTCTTGCTGCCTGGGCTTGCACTGAA 2540 2560 2580 2600 2620 2640 ACAAATCTCTTTAACGTCAGCAAAAAATAAAAAGATATTTTTTCTAAAGTTTGTATTGTCGTACATTTGGTTTATAATTTTAATATTTAGCGTATCAATTAAATCAATGTGTCTATGTGT 2660 2680 2700 2720 2740 2760 CCGATACTTTCGTGTATTTTGTTATGTTTCTGTGTATCTGCTGGTGTCGTTGCTGCAATTGTTGCTAGCTTGAATAGCTATATATTTTTTATTCTCTTTTGTCAGCAAGCAGACTGAGGA 2780 2800 2820 2840 2860 2880 GCA AGTTTTA AGCAACAAGAACGACACGCGGAGGAACAAGCTGGTCTACAAAGTGGAGGACGAGGCTGCAATTTATGTGGAGGTCCGGCTGTCCACAGTCCGCGGTCCAAAAGAGATCCG 2900 2920 2940 2960 2980 3000 AGGGCCCACAGAGTCGGCTTAGCATAATAAACGTCAGAATTAATTGGATTTTAATTGTCTGTTAAGCGCTGAAATTAAGTGCAGCAAAACTAGATTGTCGGCCAGGCAGTGGCTGTGGCG 3020 3040 3060 3080 3100 3 120 GTGGGCGGTGTTTTGGCGGA AAATGTATTGCCAACTCGTAGCTGACTGCTTTATTCAGCCGACTTCAGCCATGAATGGTAGCCCCATTCCCCTTTAAGCCCCCCTTTTGGCCCGATACCG 3140 3160 3180 3200 3220 3240 ATCTTAACAATGCTCAACCAAGCGACACACAGTACACATATGAAGATTATTTGCATGTCTCCGTTCTGGTGGTCGTTTGTCCAACTCCAGCTCCATCTGGACTTAAAACCACAACTCCAA 3260 3280 3300 3320 3340 3360 CTCCAACTCCAGCTACGATCCCAATTTCGATGCCACAAAAAAAGAAAAAGGTACCTTGATGCCGCCAATTGCCCATCTTTGATTGGATGAAATGGTTCGGCATTCTTCATCACAAAACAG 3380 3400 3420 3440 3460 3480 ATCGCATATTAGTAGAAACTAAATAAATATTATACAAATAGAATGAACTTGCTGCAGTGCGAAATATTTTAAATATATATATTTTTGGTTCATTAAGTGTCATTTCAAAAATTTAAATTC 3500 3520 3540 3560 3580 3600 TTTCATTAGTAATTTTTTTACAATTAGCCTTTCTACCGCCTTAGTCCTTGTTTGTTGCCAGCAACATGTTGCTAAATTCCAGCTTGGGACGTCGAGACAAAAAAAAAAAAAAAAAAAAAA 3620 3640 3660 3680 3700 3720 AAATGAAACGAGGAGAATCAACAAAAACAGCAAGACCAAAGGCGACACACGAAAACGTTCAACGAACTTTGGTCGCAGGCTGAAAAAAGTGGACTGGGTGCACACCACTGCGTATACGCA 3740 3760 3780 3800 3820 3840 ATGTTCGGGATGTCAGGACATCAGCTGTTGGCGCTACAGGACTAAGGACCCCGGGTCTAAAGACTCAGGACTCGGCTCATTTTGATTTACGCCCAGTGGCAAAAGAAGCCGAGGAGCGAA 3860 3880 3900 3920 3940 3960 AGCCGAAGACGAGCGGCAAAAGGTTGAATGGAGTTCAATGCACTCCGATGACGTTAGGGATAATCCAGCAGGACGGCAGGCCTCCAGGACTTGTCTTGCTGTGTGTGCGTTAGTCAGTGT 3980 4000 4020 4040 4060 4080 GTATGGACACGCACACGTGCCTGTGCACAGAGAAAAATGAAATGTTACTTTGTGCAAAAGCATTGGCTTATCGATGCTTTAACCTAATAATGCAGAGTTTCATTGGTAATTCTAGAGTCC 4100 4120 4140 4160 4180 4200 A ACTAACTTAAACTTTTAACTTTCACTCGTTTAAGTAGTAGAAACAAAATTTTTTTATTCAAGTTCAACATTTTTGGTAAAGATTGTATTGTCGGAATGAAGTTCATTGTTATTTATTTG 4220 4240 4260 4280 4300 4320 AATAAATTATTATTTCATTCATTTCATTTTGTTCGACTTAGGTCAATGTTTTTTTTTTTTTTGCAGTGCAGGATCCCGGATCCTGGGCGCATCCTGCTGAGGGCCATTGGCTTTTTGGGC 4340 4360 4380 4400 4420 4440 TTCGCGGCGCGTCGGCAGTTTCGGCGTCTTCGTAGGGCTTCGGACTTTTCGGTCTGCCGGCTTTTATTTTATGCCATTCCATTTTCGGGAGTCAATGTCCTGCGTCCTGTGCTGGTATCT 4460 4480 4500 4520 4540 4560 GTGTGTGTGTGTGCGTGTTAGTGTGTGGCATGTGTCCTGCAGCGGAGAGCGAGCAAAAAAAAAAAAAAACTTACCAAACGAAAAGAAAAAGTCCTCTATTCGCGCTGGCTTCTGCGTTAC 4580 4600 4620 4640 4660 4680 GCTCGTCACATTTT ATTAGCCAGTTTGCAGGCTGCAGGACATTGAACGTCGTTCTCCCTGCGCGAGTCCTTTGTGTCGCAATAAATAACACACACATCAGTGTGTTAGTGTGTGTGTGTG 4700 4720 4740 4760 4780 4800 TTCGAGTGTTTGTGTGGGCCTTCCCTGCTTATTTTTGTTTTCTTCGGCTGCCTGTTATTTGTGTCCTTTTTGGGTTTAGATGTTGTGGGTGCATTGAACTGCAGGCCGCCTTCTTGACGC 4820 4840 4860 4880 4900 4920 TTTTTTGGGGGCA ATTTGTGTTTGAATTTGGCGGAACGTAGTTTTATATACCCTCTCCACGGCATGGTCATTAATTATATATTTTTTTACTGGCCACATTGTTTTCAAAATATTTAACGA 4940 4960 4980 5000 5020 5040 TTTTGAGGAGATTTCAAGTCAAAATCGAAGAATTATCATTTTTATTTTAAAAATTAAGGTTTAGTTACCCAAAGATAAAGAAAATTAAATGAAAATAAACTAAGATTATTTGAGCAGTGT 5060 5080 5100 5 120 5 140 5 160 TTGTTCATAGTTCTA ACCACTATTGCTTTGTTTGAATTTTGAAATCAGTATTATCGTTTTCTTATGACATAAGTTAGTTCCAGCGTTAAGGCTTTTATTTTCACAGGGTATGCCCAATTC 5 180 5200 5220 5240 5260 5280 GATTTTCGATCTGCGATGAACTGTCAAAGGTTTTTGTGTGCGCGGCAGTTTTCTTTTTTTTTTTTGCCAAACAATGGGTAGCGCCGAATATCCGCATATATATTCCGATGCACCGTTATC 5300 5320 5340 5360 5380 5400 CAGGACTTTTTGCGGATTAGGGCCTTGACAATTGCGAGGGCGAGCAATGTTAAGGGTTAAGGGATCAGGGTCGAAAGCAGCTGGCTTCCTCTAACGGGAACTCTTAACCCTAAGCATATT 5420 5440 5460 5480 5500 5520 TTCGGCGTTTCTTTTCTTTTGTGTGCGCTGAATTCTTTTTTCTTTTACACTTATTACGCTTTTTTGTGTGTGTATTTTATTTAA TTTTTTTTTTTTTTTTGGGATAGCGCTAATGATGAT 5540 5560 5580 5600 5620 5640 GA AGCGGCCAGGGGCGGGCGGAAAAAAGGGGTAGCGGGTGTTTTGGAACAACTGGCAACTGTCTCCTTGATGCGTCCTTCAGGAGCTCTCTGGCGCATGACTTTTGCCTTCTTCTGCTGC 5655 S670 5685 5700 5715 5730 CAACTTCTGTTGCAAGTCACAAAAATACAAAACAAAAAACGAGACAAAAATGTGCTGCGTTATTTTCTCCTTATTTTCTCCTTTTTTTTATTATTATTT -48-a l l serine genes found at 12E and 23E i s shown in Figure 10. The 5' flanking sequences are separated from the coding sequences by their number designations (i.e.777, 444) which correspond to the variant p o s i t i o r i s that d i s t i n g u i s h the various gene types (positions 16, 34, and 77). Patterns of sequence conservation are evident in the 5' flanking sequences of some of these genes. Each of the f i v e genes that have tRNA 7 S e r anticodons (777,774,474) are immediately preceded by a common pentanucleotide 51ATPyAA beginning at positions -5 to -7 from the f i r s t nucleotide of the mature tRNAs. This sequence i s included in the primary transcript as judged by in v i t r o t r a n s c r i p t i o n (D.St. Louis, personal communication) . The three 7-77 genes share an a d d i t i o n a l hexanucleotide 5* CAAPyTT beginning at positions -23. to -25. This sequence i s not present i n the variant 774 or 474 qenes. The two 444 genes in pDt27R have neither of these consensus sequences but share a different octanucleotide, 5' TTGGGNTT, at positions -21 to -23. They also share a s i m i l a r 5'AAPyAA pentanucleotide at positions -5 to -8. The consensus boxes around position -20 l i e outside the primary transcripts (ref. as above) and may play some role in the modulation of qene expression (see discussion). The coding regions of the d i f f e r e n t genes are shown in the central portion of Figure 10. The v e r t i c a l boxes highlight the1 distinguishing nucleotides between the different gene types. The changes in the variant genes (474,774) suggests something more than simple point mutations and emphasize the i r hybrid'nature (see discussion). The oligo-thymidylate residues 3' to the coding -49-Figure 10. Structure of serine tRNA genes isolated from 12E and 23E. The coding sequences of seven genes are shown in block letters starting 5' at position +1 and ending 3' at position +82. The top and bottom sequences are shown in f u l l and correspond, Ser Ser respectively, to genes encoding tRNA 7 and tRNA^ .The three positions that d i s t i n g u i s h these genes are in v e r t i c a l boxes that include the corresponding positions in the abbreviated sequences of the other genes. Solid l i n e s indicate homologous nucleotides. The l e t t e r designations of the various genes (ie. 777, 444) are based on the isoacceptor resemblance at these variant p o s i t i o n s . The immediate 5 1 and 3* flanking sequence around each gene are shown in small print with regions of interest highlighted in block l e t t e r s . Upstream, these include boxed sequences that are shared between the three different 777 genes at positions -5 to -7 and -23 to -25. The two 444 genes share different boxed sequences at analogous positions. Downstream the 3' oligothymidylate t r a c t s are underlined in a l l except the 474 gene (see Text for details) . The plasmids from which these genes were sequenced and the chromosomal s i t e s from which they are derived are shown on the right. -50-in - 51 -sequences are also shown. T h e i r absence i n the 474 gene i n pDt73 presumably r e s u l t s from the i n t e r v e n i n g H i n d l l l s i t e used i n c l o n i n g . A d d i t i o n a l tRNA Genes i n pDt27R Evidence that more tRNA genes might e x i s t i n pDt27R came from d e t a i l e d r e s t r i c t i o n mapping (see F i g u r e 4) and Southern h y b r i d i z a t i o n s w i t h 4S RNA (data not shown). T h i s showed that c l u s t e r s of r e s t r i c t i o n s i t e s o c c u r r e d around each of the BamHl s i t e s on t h e r i g h t hand s i d e o f t h e i n s e r t i n F i g u r e 2a. R e s t r i c t i o n fragments i n t h i s r e q i o n h y b r i d i z e d 4S RNA v e r y weakly. The n u c l e o t i d e s e q u e n c e shows t h a t these c l u s t e r e d r e s t r i c t i o n s i t e s are c o n t a i n e d w i t h i n four i d e n t i c a l 73 bp sequences t h a t can be f o l d e d i n t o tRNA c l o v e r l e a f s t r u c t u r e s (Figure 11). These have an a n t i c o d o n (5'UCG) t h a t decodes an a r g i n i n e codon (5'CGA). T h i s t R N A A r g i s 85% homologous to the o n l y m a j o r a r g i n i n e i s o a c c e p t o r t R N A 2 A r g (45) . A l l o t h e r a r g i n i n e i s o a c c e p t o r s (3-5) a r e m i n o r s p e c i e s as judged by chromatographic p r o f i l e s of amino a c i d acceptance (1). This f a c t might account for the weak h y b r i d i z a t i o n between the genes and 4S RNA. A l t h o u g h t h i s t R N A A r g i s 85% homologous to t R N A 2 A r g , there i s no cross h y b r i d i z a t i o n ; genes for the l a t t e r l o c a l i z e to 42A and 84F with no grains a ppearing over 12E, the s i t e of pDt27R and the genes f o r t R N A A r g (5). -52-5P G C A T C G C G G C T A G OH G C T G A T A A T T G T C C * C C C G G G C A G G T T C A A G G G G G C T A A G A T A C G G C G C A T * C A T G T C G 36 Figure 11. C l o v e r l e a f s t r u c t u r e o f the t R N A A r g predicted from a s i n g l e strand of the gene sequence. The t h i r d nucleotide of the anticodon at p o s i t i o n 36 corresponds to the f i r s t basepair of the BamHl recognition s i t e present i n each gene copy. - 5 3 -A novel feature o f these t R N A A r g genes i s the structure of t h e i r flanking DNA. They are arranged as tandem du p l i c a t i o n s of homologous f l a n k i n g sequence o f d i f f e r e n t u n i t l e n g t h (600 and 200 bp). The s i z e o f the d u p l i c a t e d segments v a r y o n l y i n the amount of 5' flanking sequence i n c l u d e d . The 5' sequence of genes 1 and 2 ( F i g u r e 12) are 97% i d e n t i c a l f o r 455 bp (A) whereas genes 3 and 4 share o n l y 30 bp (a) . A l l the genes have the same 70 bp of 3* f l a n k i n g sequence (B) . In a d d i t i o n to v a r i a t i o n i n repeat length, the d u p l i c a t i o n s v a r y i n t h e i r degree of homology. Genes 1, 2, and 3 have one or two mismatches between them over 102 bp of common sequence. Gene 4, however, contains at l e a s t 18 mismatches yet i s part of a d u p l i c a t i o n unit that i s of i d e n t i c a l s i z e to that containing gene 3. Each repeat i s f l a n k e d by j u n c t i o n sequences shown i n the lower portion of F i g u r e 12. The l e f t m o s t 600 bp repeat (gene 1) has eight bp repeats a t i t s t e r m i n i (5 * TAGCCCAA). Homology with the adjacent 600 bp repeat (gene 2) begins w i t h i n t h i s eight bp sequence and a p p e a r s t o d u p l i c a t e f i v e bp o f the sequence (5'CCCAA) at the 5' j u n c t i o n ( I I ) . The 3' end of t h i s second 600 bp re p e a t (III) c o n t a i n s an a d d i t i o n a l 22 bp t h a t are a l s o present around each of the 200 bp re p e a t s containing genes 3 and 4 ( j u n c t i o n s IV and V ) . The 5' homology between genes 3 and 4 ends p r e c i s e l y a t p o s i t i o n -30. The sequence a t t h i s p o s i t i o n (S'TTGGG) i s repeated twice and has dyad symmetry with the 8 bp repe a t s t h a t are common to the t e r m i n i o f a l l the d u p l i c a t e d segments. Dyad symmetries e x i s t a t f o u r out o f f i v e o f the -54-Figure 12. Structure o f the r e p e a t s containing four tRNA A r g genes in pDt27R. The genes are i n open boxes separated by flanking sequence represented as s o l i d l i n e s . N u c l e o t i d e p o s i t i o n s that mark the l i m i t s o f the r e p e a t s are i n d i c t e d i n the l e f t repeat (gene 1).' Genes are numbered l e f t t o r i g h t i n the 5' to 3' d i r e c t i o n o f the non-coding s t r a n d shown i n F i g u r e 9. Sequence homologies are i n d i c a t e d by shared l e t t e r s i . e . A=A, a=a, B=B. (97-99% i d e n t i c a l ) . The f l a n k i n g sequence of the l e s s homologous repeat (82% i d e n t i c a l ) i s i n d i c a t e d as a 1 and B 1 . Each of the junctions with unique sequence (U) and repeated sequence (A,a,B,) are indicated by roman numerals. The nucleotide sequence at these s i t e s (I - V) are shown below. Here the sequence from regions U, A, a, B, and U 1 are boxed to h i g h l i g h t the sequences located at the postulated j u n c t i o n s . Sequence not p r e s e n t at the 5 1 and 3' termini of the gene 1 repeat (1,11) are indicated with a broken u n d e r l i n e . Arrows i n d i c a t e r e g i o n s o f dyad symmetry found at junctions I, I I I , IV, and V. IV -30 -EQ- +70 E I B „ , u U - 4 5 5 A  I C T C G C A T T G T G l T A G C C C A A l A C A C A A C A A C A C C A C C C I cn cn I B +70 -455 G G G A G A T T C C C T A G C C C A A C C C A A A C A C A C C A A C A C C A C C C B - 3 0 a III & IV G G G A G A T T C C C l T A G C C C A A C C C A T T T G T G T A A C C T G A G A AAfT T G G G A A T T T G G G B U '  V G G G A G A T T C C C J T A G C C C C A C T C A T T T G T G T A A C C T G AG[TG C G G T A A G C A G C A A -56-junctions d e s c r i b e d here. The e x c e p t i o n (II) c o n t a i n s the f i v e basepair repeat of junction I (5'CCCAA). These symmetries involve d i f f e r e n t sequences around d i f f e r e n t repeats and are indicated i n Figure 12. The junction at (V) i s missing three terminal adenylate residues where i t j o i n s unique sequence (U). Otherwise, both the 200 bp and 600 bp r e p e a t s h a v e i d e n t i c a l e n d p o i n t s and demonstrate the s t r i k i n g p r e c i s i o n o f a d u p l i c a t i o n process that occurred at times separate enough to a l l o w at l e a s t 18% sequence divergence to accumulate (above). Other Genes f o r t R N A A r q Most D r o s o p h i l a tRNA genes have more than one chromosomal l o c a t i o n . The genes d e s c r i b e d above are derived from the c l u s t e r of serine tRNA genes at 12E . In order to te s t f o r the presence of a d d i t i o n a l tRNA A r g genes a genomic Southern was performed using a n i c k t r a n s l a t e d DNA probe c o n t a i n i n g gene coding sequences derived from pDt27R. The probe (200 bp BamHl fragment) c o n s i s t s of the 3* h a l f of one gene sep a r a t e d by 127 bp of flanking sequence from the 5' h a l f o f a second i d e n t i c a l gene. I f these flanking sequences are repeated elsewhere i n the genome then bands may r e s u l t on the a u t o r a d i o g r a m t h a t do not r e p r e s e n t fragments c o n t a i n i n g t R N A A r g g e n e s ( t h i s was n o t t e s t e d ) . F i g u r e 13 shows that each r e s t r i c t i o n d i g e s t produces 3-4 genomic fragments that hybridize the probe q u i t e s t r o n g l y and 1-2 others l e s s so. "-57-F i g u r e 13. Genomic f r a g m e n t s t h a t h y b r i d i z e a tRNA r g probe. D r o s o p h l i a (Ore R) genomic DNA (10-15 ug) was digested w i t h H i n d l l l (lane a ) , EcoRI ( l a n e b) and Xhol (lane c) and s e p a r t e d on a 0.8% a g a r o s e g e l . The DNA f r a g m e n t s were transferred to Genescreen and h y b r i d i z e d with a nick translated 0.2 kb BamHl fragment (2 x 10 cpm) from pDt27R for 24 hours at 65°C. The a u t o r a d i o g r a m was e x p o s e d f o r 24 h o u r s a t -70°C wit h an i n t e n s i f y i n g s c r e e n . S i z e markers are the same as i n Figure 3, 4, and 5. .54 -59-Th e weaker bands may r e s u l t from p a r t i a l homologies o r from polymorphisms i n the n o n - i s o g e n i c f l y p o p u l a t i o n from which the DNA was prepared. In the H i n d l l l d i g e s t (lane a) there are three stronger bands. The 6.4 kbp band i s the most intense and probably corresponds to the 6.4 kbp H i n d l l l fraqment cloned into pDt27R. The strong h y b r i d i z a t i o n i s expected from the f o u r genes (and flanking sequence) t h i s fragment c o n t a i n s . The second strongest band i s 5.5 kbp i n l e n g t h and as j u d q e d by h y b r i d i z a t i o n i n t e n s i t y might contain two to three genes. The t h i r d fragment i s 2.7 kbp and should c o n t a i n a s i n g l e gene according to the above. By t h i s count the genomic copy number o f genes f o r t R N A A r g i s 7-8. Using s i n g l e stranded M13 probes c o n t a i n i n g o n l y tRNA A r g coding sequences (J. Leung p e r s . comm.), the chromosomal l o c a t i o n of a d d i t i o n a l s i t e s has been determined by i n s i t u h y b r i d i z a t i o n (S. Hayashi p e r s . comm). In a d d i t i o n to the major s i t e at 12E there are two weaker s i t e s a t 85C on chromosome 3R and 19F on the base of the X chromosome (Fi g u r e 14). Preliminary experiments with recombinant plasmids t h a t h y b r i d i z e to these chromosomal regions (S.Hayashi, p e r s . comm.) i n d i c a t e t h a t 19F c o n t a i n s a si n g l e gene (2.7 kbp H i n d l l l fragment, F i g u r e 13) and 85C (5.5 kbp H i n d l l l fragment) a p a i r of genes (unpublished observations). -60-Figure 14. H y b r i d i z a t i o n o f I - l a b e l l e d s i n g l e stranded M13 t R N A A r g p r o b e (67 bp. H a e l l l / D ' d e l f r a g m e n t i n M13mpl0, courtesy of J.Leung) to p o l y t e n e chromosomes from t h i r d i n s t a r l a r v a e o f g t V / y s c I n ( l ) g t x 1 1 i n formamide b u f f e r a t 35°C (as d e s c r i b e d i n r e f . 5) f o r 90 hours. The probe was a t Q Q 2.9 x 10 moles N/1 and 3.9 x l 0 • dpm/ug. Autoradiographs were developed a f t e r 15-16 days exposure. G r a i n s appear over polytene regions 12E (upper), 19F ( m i d d l e ) , and 85C (lower). This f i g u r e i s courtesy of Dr. Shizu Hayashi. - 6 1 -62-D i s c u s s i o n tRNA Gene O r g a n i z a t i o n The recombinant plasmids d e s c r i b e d i n t h i s t h e s i s contain tRNA genes d e r i v e d from two d i f f e r e n t chromosomal s i t e s . One p l a s m i d , pDt5, c o n t a i n s a s i n g l e gene t h a t c o r r e s p o n d s to Ser tRNA^ and has been l o c a l i z e d by i n s i t u h y b r i d i z a t i o n to polytene r e g i o n 23E on chromosome 2L (45). T h i s i s one of the m i n o r s i t e s s e e n by i n s i t u h y b r i d i z a t i o n w i t h p u r i f i e d t R N A 4 ^ 7 S e r ( 5 ) . The second p l a s m i d , pDt27R, i s d e r i v e d from the major i n s i t u s i t e a t 12E oh t h e t h e X chromosome and c o n t a i n s two i d e n t i c a l tRNA^ genes and f o u r i d e n t i c a l tRNA A r g genes. Other s e r i n e tRNA genes have been d e s c r i b e d on d i f f e r e n t plasmids also d e r i v e d from 12E (22). These include two Se r g e n e s i d e n t i c a l t o t h e g e n e i n p D t 5 (tRNA 7 ) and two varia n t genes that are i d e n t i c a l except at one and two p o s i t i o n s , r e s p e c t i v e l y ( 774,474, Figure 10). These r e s u l t s show t h a t 12E i s a complex gene c l u s t e r that contains multiple c o p i e s of i d e n t i c a l and d i f f e r e n t tRNA genes. Id e n t i c a l copies of some genes at 12E are also found at d i f f e r e n t chromosomal s i t e s ( i . e . 2 3 E ) . In s i t u h y b r i d i z a t i o n with Se r tRNA 4 /, 7 p r e d i c t s t h a t f u r t h e r s i t e s f o r s e r i n e tRNA genes e x i s t at 56D and 64D but recombinant c l o n e s from these regions have not yet been o b t a i n e d ( 5 ) . A l s o , a d d i t i o n a l s i t e s f o r the t R N A A r g genes l i k e l y e x i s t a t 19AB and 85C. These r e s u l t s -63-further i l l u s t r a t e the d i s p e r s e d arrangement o f m u l t i p l e tRNA gene c o p i e s i n D r o s o p h i l a . It i s not known how these dispersed gene copies are expressed i n v i v o . S t u d i e s u s i n g i n v i t r o t r a n s c r i p t i o n systems show that each gene appears to be an independant t r a n s c r i p t i o n unit and gives r i s e to primary t r a n s c r i p t s t h a t are processed down to the mature RNA. These i n i t i a t e 2-10 bp 5' t o the mature codi n g sequence and terminate i n the s t r i n g of thymidylate residues that f o l l o w 3" to a l l e u k a r y o t i c tRNA genes ( 9 ) . I f t h i s l a t t e r sequence i s not present the RNA polymerase III w i l l continue u n t i l i t meets four or more dT r e s i d u e s and g i v e s r i s e to a properly processed tRNA and a d i s c r e e t run o f f t r a n s c r i p t (10). I t has been shown that t r a n s c r i p t i o n i n i t i a t i o n requires two sequence b l o c k s l o c a t e d w i t h i n t h e mature codi n g sequence. I n i t i a l observations suggested that 5' flanking sequences were not necessary f o r normal t r a n s c r i p t i o n (46) but t h i s view has been m o d i f i e d . A D r o s o p h i l a t R N A 2 A r g gene r e q u i r e s 33 bp o f upstream sequence f o r e f f i c i e n t t r a n s c r i p t i o n i n c e l l f r e e extracts (11). Negative modulating 5' sequences have also been d e s c r i b e d f o r a d i f f e r e n t t R N A 2 A r g g e n e (47) and a t R N A 2 L y s gene (48) . Both a r e l o c a t e d w i t h i n 30 bp of the mature c o d i n g s e q u e n c e . I f t r a n s c r i p t i o n m o d u l a t i o n by 5' sequences i s a general f e a t u r e o f D r o s o p h i l a tRNA genes i t might explain the conserved sequences shown i n F i g u r e 10. The three Se r tRNA 7 genes each are preceded by two s m a l l sequence boxes b e g i n n i n g a t p o s i t i o n s -5 to -7 (5'ATPyAA) and at -23 to -25 -64-(5'CAAPyTT) . I t s h o u l d be n o t e d t h a t one o f these genes i s l o c a t e d on a d i f f e r e n t chromosome (pDt5) . The two t R N A 4 S e r genes a l s o have c o n s e r v e d s e q u e n c e s a t p o s i t i o n s -5 to -8 (5'AAPyAA) and at -21 to -23 (5'TTGGGNTT). Conserved sequences are a l s o seen 5' to d i f f f e r e n t copies o f o t h e r tRNA gene f a m i l i e s ( 8 , 1 2 ) . However the a u t h o r s i n r e f . l l note t h a t the modulatory sequences i d e n t i f i e d i n v i t r o are not conserved between genes t h a t are known to t r a n s c r i b e e f f i c i e n t l y o r p o o r l y . T h e r e f o r e c o n s e r v a t i o n does n o t n e c e s s a r i l y imply a f u n c t i o n i n t r a n s c r i p t i o n modulation, at l e a s t as observed u s i n g i n v i t r o systems. A f e a t u r e o f tRNA genes t h a t may be r e l e v a n t to t h e i r e x p r e s s i o n i s t h e i r c l u s t e r i n g a t d i s c r e e t s i t e s around the genome. Each s i t e appears to c o n t a i n s e v e r a l copies of i d e n t i c a l and d i f f e r e n t genes (above) . T h i s i s not evident at the 23E s i t e because only 4.4 kbp have been analysed i n pDt5. The existance of a d d i t i o n a l genes at t h i s s i t e i s suggested by the i n t e n s i t y of h y b r i d i z a t i o n i n s i t u w i t h 4S RNA (3) o r p u r i f i e d t R N A 4 ^ 7 S e r ( 5 ) . The 12E s i t e c o n t a i n s 10 genes i n 20 kbp of c l o n e d sequences y e t t h i s i s p r o b a b l y o n l y a f r a c t i o n o f the t o t a l DNA i n t h i s r e g i o n ( 7 ) . However, tRNA genes w i t h i n a c l u s t e r are not d i s t r i b u t e d e v e n l y ( i . e . 42A ref.8) so the t o t a l complement need n o t be d r a m a t i c a l l y h i g h e r . T h e i r e x a c t arrangement can o n l y be d i s c e r n e d where more than one gene i s l o c a t e d on a plasmid i n s e r t ( p D t l 6 , pDt27R) and t h i s shows a r e l a t i v e l y t i g h t linkage (>400 bp). -65-Th i s c l u s t e r i n g i s dramatic when compared to the hundreds of kilobase p a i r s that are devoid o f tRNA genes. This i s e s p e c i a l l y evident on the X chromosome where the 12E s i t e i s the only major tRNA gene locus on the e n t i r e chromosome. In contrast each of the autosomes (except the fourth) contain 30-40 major and minor s i t e s . Whether each of these r e p r e s e n t s a c l u s t e r i s not yet known. The paucity of s i t e s on the X chromsome may be related to i t s s p e c i a l f u n c t i o n i n sex d i f f e r e n t i a t i o n and i n p a r t i c u l a r to the requirement f or dosage compensation i n males. The s i g n i f i c a n c e of t h i s d i s p e r s e d c l u s t e r e d arrangement of tRNA genes i n Drosophila i s not known. Some analogy might be drawn from r e s u l t s of a n a l y s i s o f RNA polymerase II genes. Here i t appears t h a t r e l a t e d genes i n c l u s t e r s are expressed together during development i . e . c h o r i o n genes (49), histone genes (50) , heat shock genes (51), 68C s a l i v a r y g l u e genes (52), c u t i c l e genes ( 5 3 ) , two y o l k p r o t e i n g e n e s ( 5 4 ) , HDL g e n e s (55). Conversely, r e l a t e d genes t h a t are d i s p e r s e d are expressed i n d i f f e r e n t t i s s u e s or developmental s t a g e s i . e . a c t i n genes (56), t u b u l i n genes (57) . In these examples the gene pro d u c t s from d i s p e r s e d l o c i are s l i g h t l y d i f f e r e n t and p o t e n t i a l l y have d i f f e r e n t f u n c t i o n s . T h i s c o n t r a s t s w i t h d i s p e r s e d tRNA genes where the mature pro d u c t s are i d e n t i c a l . What dist i n g u i s h e s the d i f f e r e n t c l u s t e r s are t h e number and v a r i e t y o f tRNA genes present within each. While a l l tRNA gene c l u s t e r s i n Drosophila are organized d i f f e r e n t l y no data e x i s t s to show that they are d i f f e r e n t i a l l y expressed e i t h e r i n a temporal or t i s s u e s p e c f i c -66-manner. What has been shown i s t h a t there i s no marked differ e n c e i n the tRNA comp o s i t i o n between f i r s t and t h i r d l a r v a l i n s t a r s and a d u l t s ( 1 ) . These s t u d i e s would not d e t e c t d i f f e r e n c e s i n . . . . A i n d i v i d u a l t i s s u e s during development as the tRNAs were extracted from whole organisms. A n a l y s i s o f tRNA during the development of Bombyx mori s i l k g l a n d s (58) and bovine l e n s (59) shows t h a t n o v e l i s o a c c e p t o r s do a p p e a r . T h u s i n D r o s o p h i l a , t h e r e l a t i o n s h i p b e t w e e n tRNA g e n e o r g a n i z a t i o n and t h e i r d i f f e r e n t i a l expression remains to be determined. Conservation o f tRNA Gene Coding Sequences Except for the 3'oligo dT t r a c t s and the 5* conserved boxes (see Figure 10) the f l a n k i n g sequences around each of the serine tRNA genes show no s i m i l a r i t i e s . The cod i n g sequences, however, are i d e n t i c a l between m u l t i p l e g e n e s c o p i e s a t the same or d i f f e r e n t chromosomal s i t e s . T h i s f a c t has prompted speculation that r e c t i f i c a t i o n mechanisms operate to homogenize the sequences o f m u l t i p l e gene c o p i e s . These mechanisms are thought to be n e c e s s a r y because gene r e d u n d a n c y may remove or l e s s e n the s e l e c t i v e p r e s s u r e s on i n d i v i d u a l genes. T h i s should r e s u l t i n more coding sequence microherterogenity than i s observed (60,61). The p a r t i c u l a r pathway by which t h i s homogeneity i s achieved may depend on the arrangement o f the gene family i n question. The 200 to 300 tandemly repeated rRNA genes i n yeast have been shown to undergo unequal exchanges wi t h s u f f i c i e n t frequency to account -67-f o r t h e i r homogeneity (62). T h i s cannot be the case for dispersed tRNA genes .with d i s s i m i l a r f l a n k i n g sequences. Instead, i t has been suggested they are maintained by gene c o n v e r s i o n (63-66). T h i s i s a process where p a r t i a l l y homologous DNA sequences l o c a t e d anywhere i n the genome can recombine and r e s u l t i n a non-reciprocal t r a n s f e r o f sequence information. This i s thought to occur v i a heteroduplex formation between a s i n g l e strand of one r e g i o n and the duplex o f a n o t h e r . These are r e s o l v e d and any mismatches r e p a i r e d by DNA s y n t h e s i s u s i n g e i t h e r s t r a n d , or perhaps o n l y t h e i n v a d i n g s t r a n d ( 6 7 , 6 8 ) , as the template (69,70). That t h i s p r o c e s s can be DNA s p e c i f i c and regulated i s i l l u s t r a t e d by mating type s w i t c h i n g i n yeast (71). Evidence for the trans f e r of sequence i n f o r m a t i o n between unlinked serine tRNA genes i n yeast was best explained by gene conversion events (72). Within these i n t e r c o n v e r t i n g l o c i e i g h t out o f a t l e a s t 20 bp were mismatched. I f h e t e r o d u p l e x f o r m a t i o n c a n o c c u r between sequences mismatched as much as 10 % (73) , and i f t h i s i s s u f f i c i e n t f o r gene conversion to proceed, then f a c t o r s must operate to prevent the interconversion o f c l o s e l y r e l a t e d i s o a c c e p t o r genes. These Se r may d i f f e r i n s e q u e n c e by l e s s t h a n 10% (i.e.tRNA^ and Ser tRNA^ ) y e t a p p a r e n t l y a r e m a i n t a i n e d as s e p a r a t e gene f a m i l i e s . I f i n t e r c o n v e r s i o n o c c u r s between these two gene f a m i l i e s , the rate and d i r e c t i o n must be balanced to prevent one f a m i l y f r o m c o n v e r t i n g members o f t h e o t h e r . The v a r i a n t p o s i t i o n s i n t h e t R N A _ S e r genes a t 12E (774,474) c o u l d be -68-e x p l a i n e d by incomplete i n t e r c o n v e r s i o n (D. C r i b b s p e r s o n a l communication) a l t h o u g h t h e y l a c k some c h a r a c t e r i s t i c 5' conserved sequences (above). A l s o p o s s i b l e i s that they represent minor i s o c o d i n g s p e c i e s whose tRNA p r o d u c t s have not been c h a r a c t e r i z e d . There are s e v e r a l examples o f c l o s e l y r e l a t e d i s o a c c e p t o r s t h a t d i f f e r by a s i n g l e n u c l e o t i d e and a r e maintained as separate gene f a m i l i e s (see Figure 31 i n ref 22 ). The maintenance o f s e p a r a t e , c l o s e l y r e l a t e d gene f a m i l i e s may r e f l e c t the observed decrease i n c o n v e r s i o n frequency when point mutation heterozygosity i s present (74). In t h i s case any aberrant i n t e r c o n v e r s i o n events might not be r e p a i r e d b e f o r e they are frozen during the cloning of genomic DNA. It i s evident from the d i v e r g e n t f l a n k i n g sequences that any gene conversion events a c t o n l y on the mature coding sequences. The presence o f conserved r e g i o n s embedded i n unique sequence Se r Ser f l a n k i n g t h e c o d i n g s e q u e n c e s o f tRNA^ and tRNA^ suggests t h a t a d d i t i o n a l maintenance p r e s s u r e s may e x i s t . This might imply t h a t i n d i v i d u a l tRNA gen e s a r e under the same s e l e c t i v e p r e s s u r e s as s i n g l e c o p y genes and r e t u r n s to the question of whether gene redundancy e x i s t s f o r i n c r e a s i n g gene product or for the d i f f e r e n t i a l use of product (60). Some evolutionary a s p e c t s o f tRNA gene arrangement. The dispersed r e i t e r a t e d nature o f tRNA genes i n Drosophila implies that both DNA d u p l i c a t i o n and t r a n s p o s i t i o n have occurred -69-during t h e i r evolution. The o r i g i n s o f d i f f e r e n t gene copies can o n l y be d i s c e r n e d where t h e s e e v e n t s i n c l u d e d some f l a n k i n g sequences and r e c e n t l y enough t h a t they r e t a i n some homology. Because non-homologous sequences f l a n k most tRNA genes i t can be concluded that any d u p l i c a t i o n and t r a n s p o s i t i o n events occurred long ago and have since been obscured by mutational d r i f t . Some e v i d e n c e o f t h e s e p r o c e s s e s have been observed G1 v however. The two tRNA y g e n e s a t 56F (16) appear to have resulted from a tandem d u p l i c a t i o n of a 1.1 to 2.0 kbp region (see Met i n t r o d u c t i o n ) . The r e p e a t s c o n t a i n i n g tRNA^ genes a t 61D (17) are separated by s e v e r a l k i l o b a s e p a i r s o f unique sequence and c o u l d r e s u l t from the t r a n s p o s i t i o n o f a gene c o n t a i n i n g region or by i n s e r t i o n s between an a n c e s t r a l tandem d u p l i c a t i o n . G l u The f l a n k i n g sequence homology around the t h r e e tRNA genes at 62A(15) i l l u s t r a t e the expansion o f a gene family by unequal exchanges between an o r i g i n a l gene p a i r . The homologous f l a n k i n g sequences around the four tRNA A r g genes i n pDt27R ( F i g u r e 12) s u g g e s t s t h e y arose by tandem d u p l i c a t i o n s o f some a n c e s t r a l gene. The mechanism apparently included d i f f e r e n t l e n g t h s o f f l a n k i n g sequence and r e s u l t s i n repeats 200 and 600 bp i n l e n g t h . A l t e r n a t i v e l y subsequent events ( i n s e r t i o n s or d e l e t i o n s ) have o c c u r r e d which r e s u l t i n the v a r i a t i o n i n repeat s i z e . Three o f the f o u r genes have s i m i l a r h o m o l o g i e s and a p p e a r t o h a v e a r i s e n f r o m more r e c e n t d u p l i c a t i o n ( s ) o f an o l d e r gene p a i r . A l s o t h e r e appear to be s p e c i f i c junctions sequences a t the t e r m i n i o f the repeats that -70-perhaps were invovled i n e i t h e r l i m i t i n g the amount of flanking sequence d u p l i c a t e d or i n t h e d u p l i c a t i o n mechanism i t s e l f (75,76). Portions o f these j u n c t i o n sequences flank each of the repeats and ra i s e the p o s s i b i l t y t h a t a tRNA gene transposed to 12E and s u b s e q u e n t l y d u p l i c a t e d between s p e c i f i c sequences (5*CCCAA see Ref.77) to y i e l d the gene quartet present today. I t w i l l be o f i n t e r e s t to see i f f l a n k i n g sequences around the t R N A A r g genes a t e i t h e r o f t h e two o t h e r chromosomal s i t e s (85C, 19AB) bear any homology to those present at 12E. - 7 1 -R e f e r e n c e s 1) White, B.N., Tener, G.M., Holden, J . , and Suzuki, D.T. (1973) Dev. B i o l . 33.: 185-195 2) Weber, L. and Berger* E. (1976) Biochemisitry 15:' 5511-5519 3) Elder, R.T., Uhlenbeck, O.C., and Szabo, P.(1980) . In " Transfer RNA: B i o l o g i c a l Aspects" (ed. D. S o l i , J.N. Abelson, and P.R. Schimmel) Cold Spring Harbour Laboratory pp 317-323 4) Tener, G.M., Hayashi, S., Dunn, R., Delaney, A., Gillam, I.C., G r i g l i a t t i , T.A., Kaufman, T.C., and Suzuki, D.T. (1980) In " Transfer RNA: B i o l o g i c a l Aspects" ( ed. D. S o l i , J.N. Abelson, and P.R. Schimmel) Cold Spring Harbour Laboratory pp 295-307 5) Hayashi, S., Gillam, I.C., Delaney, A., Dunn, R., Tener, G.M., G r i g l i a t t i , T.A., and Suzuki, D.T. (1980) Chromosoma (Berl.) 76: 65-84 6) Hayashi, S., Gillam, I.C., G r i g l i a t t i , T.A., and Tener, G.M. (1982) Chromosoma ( B e r l . ) 86: 279-292 7) Spierer, P., Spierer, A., Bender, W., and Hogness, D.S. (1980) J . Mol. B i o l 168: 35-50 8) Yen, P.H. and Davidson, N. (1980) C e l l 22: Part 1 137-148 9) Silverman, S., Schmidt, 0., S o l i , D. and Hoveman, B. (1979) J . B i o l . Chem. _2_57: 10290-10294 10) Adeniysi-Jones, S., Romeo, P \ H . , and Z a s l o f f , M. (1984) -72-Nucleic A c i d s Res. 12: 1101-1115 11) Schaack, J . , Sharp, S., Dingerman, T., Johnson Burke, D., and S o i l , D. (1984) J . B i o l . Chem. 259: 1461-1467 12) Robinson, R.R. and Davidson, N. (1981) C e l l 23: 251-259 13) Schmidt, 0., and S o i l * D. (1981) Bioscience 31: 34-39 14) Kaine, B.P., Gupta, R., and Woese, C.R. (1983) Proc. N a t l . Acad. S c i . (U.S.A.) 80: 3309-3312 15) Hosbach, H.A., Silberklang, M., and McCarthy, B.J. (1980) C e l l 21: 169-178 16) Hershey, N.D. and Davidson, N. (1980) Nucleic Acids Res. 8: 4899-4910 17) Sharp, S., DeFranco, D., Silberklang, M., Hosbach, H.A., Schmidt, T., K u b l i , E., Gergen, J.P., Wensink, P. and S o i l , D. (1981) N u c l e i c A c i d s Res. 9: 5867-5879 18) Addison, W.R., A s t e l l , C.R., Delaney, A., Gillam, I.C., Hayashi, S., M i l l e r J r , R.C., Rajput, B., Smith, M., Taylor, D.M., amd Tener, G.M. (1982) J . B i o l . Chem. 257: 670-677 19) Addison, W.R., Gillam, I.C. and Tener, G.M. (1982) J . B i o l . Chem. 257_: 674-677 20) Leung, J . e t a l . manuscript i n preparation 21) DeFranco, D., Burke, K.B., Hayashi, S., Tener, G.M., M i l l e r J r . , R.C., and S o i l , D. (1982) N u c l e i c Acids Res. 10: 5799-5807 22) Cribbs, D.L. (1982) Ph.D. Thesis, U n i v e r s i t y of B r i t i s h Columbia. 23) Dunn, R., Delaney, A., Gillam, I . C , Hayashi, S., Tener, -73-G . M . , ' G r i g l i a t t i , T.A., Misra, V., Spurr, M.G., Taylor, D.M., and M i l l e r J r . , R.C. (1979) Gene 7: 197-215 24) Messing, J . (1981) In "Proceedings of the Third Cleveland Symposium on Macromolecules" (ed. A.G. Walton) E l s e v i e r Amsterdam : p 143 25) Messing, J . and V i e r a , J . (1982) Gene 19: 269-276 26) V i e r a , J . and Messing, J . (1982) Gene 19: 259-268 27) Messing, J . (1983) Methods i n Enzymology 101: 20-78 28) Maniatis, T., F r i t s c h , E.F., and Sambrook, J . (1983) Molecular Cloning: A L a b o r a t o r y Manual Cold Sring Harbour Laboratory 29) Danna, K. (1980) Methods i n Enzymology 65: 449-467 30) Smith, H.O. and B i r n s t i e l , M.L. (1976) Nucleic Acids Res. 3: 2387-2398 31) Maxam, A.M. and G i l b e r t , W. (1980) Methods i n Enzymology 65: 499-560 32) Rigby, P.W.J., Dieckmann, M., Rhodes, C., and Berg, P. (1977) J . Mol. B i o l . 113: 237-251 33) Sanger, F., Nicklen, S., Coulson, A.R. (1977) Proc. N a t l . Acad. S c i . (U.S.A.) 74: 5463-5466 34) Gronenborn, B., Messing, J . (1978) Nature (Lond.) 272 375-377 35) Dretzen, G., B e l l a r d , M., Sassone-Corsi, P., and Chambon, P. (1981) A n a l . Biochem. 112: 295-301 36) Putney, S.D., Benkovic, S.J., and Schimmel, P.R. (1981) Proc. N a t l . Acad. S c i (U.S.A.) 78:7350-7354 -74-37) Guo, L-H. and Wu, R. (1982) Methods i n Enzymology 100: 60-96 38) M i l l e r , J.H. (1972) Experiments i n Molecular genetics Cold Spring Harbour Laboratory 39) Heidecker, G., Messing, J . , and Gronenborn, B. (1980) Gene JL0: 69-75 40) Ponz, M., Solowiejczyk, D., Ba l l a n t i n e , M., Schwartz, E., and Surrey, S. (1982) Proc. N a t l . Acad. S c i . (U.S.A.) 79 : 4298-4302 41) Hong, G.F. (1982) J . Mol. B i o l . 158: 539-549 42) Barnes, W.M., Bevan, M., and Son, P.H. Methods i n Enzymology 101: 98-122 43) Guo, L-H, Yang, R.C.A., and Wu, R. (1983) Nucleic Acids Res. 11: 5521-5540 44) Staden, R. (1980) N u c l e i c A c i d s Res. 8: 3673-3694 , 45) Rajput, B. (1980) M.Sc. Thesis, University of B r i t i s h Columbia 46) Sharp, S., DeFranco, D., Dingerman, T., F a r r e l l , P., and S o i l , D. (1981) Proc. N a t l . Acad. S c i . (U.S.A.) 78: 6657-6661 47) Dingerman, T., Burke, D.J., Sharp, S., Schaack, J . , and S o i l , D. (1982) J . B i o l . Chem. 257: 14738-14744 48) DeFranco, D., Sharp, S., and S o i l , D. (1981) J . B i o l . Chem. 256: 12424-12429 49) Spradling, A.C., Digan, M.E., Mahowald, A.P., Scott, M., and Craig, E.A. (1980) C e l l 19: 905-914 50) Goldberg, D.A. and Hogness, D.S. unpublished r e s u l t s . -75-51) Corces, V., Holmgren, R., Freund, R., Morimoto, R. and Meselson, M. (1980) Proc. N a t l . Acad. S c i . (U.S.A.) 77 5390-5393 52) Meyerowitz, E.M. and Hogness, D.S. (1982) C e l l 28: 165-176 53) Snyder, M., Hirsh, J . and Davidson, N. (1981) C e l l 25: 167-177 54) Barnett, T., Pachl, C , Gergen, J.P., and Wensink, P.C. (1980) C e l l 2_1: 729-738 55) Synder, M. and Davidson, N. (1983) J . Mol. B i o l . 166: 101-118 56) Fryberg, E.A., Mahaffey, J.W., Beverly, J . Bond, and Davidson, N. (1983) C e l l 33: 115-123 57) Kalfayan, L. and Wensink, P.C. (1982) C e l l 29: 91-98 58) Sprague, K.U., Hagenbuchle, 0., and Zuniga, M.C. (1977) C e l l 11: 561-570 59) L i n , F-K, Furr, T.D., Chang, S.H., Horwitz, J . , A g r i s , P.F. and Ortwerth, B.J. (1980) J . B i o l . Chem. 255: 6020-6023 60) Edelman, G.M. and G a i l y , J.A. (1970) In "Neurosciences: Second Study Program" (ed. F.O. Schmidt) Rockefeller U n i v e r s i t y Press New York, pp 962-972 61) Dover, G, (1982) Nature (Lond.) 299: 111-117 62) Szostak, J.W. and Wu, R. (1980) Nature (Lond.) 284: 426-430 63) Scherer, S. and Da v i s , R.W. (1980) Science 209: 1380-1384 64) Jackson, J.A. and F i n k , G. (1981) Nature (Lond.) 292: 306-307 -76-65) Nagylaki, T. and Pete s , T.D. (1982) Genetics 100;315-337 66) K l i e n , H.L. and Petes, T.D. (1981) Nature (Lond.) 289: 144-148 67) Markham, P. and Whitehouse, H.L.K. (1982) Nature (Lond.) 295: 421-423 68) Strathern, J.N., Klar, A.J.S., Hicks, J.B., Abraham, J.A., Ivy, J.M., Nasmyth, K.A., and M c G i l l , C. (1982) C e l l 31 : 183-192 69) Holiday, R. (1964) Genet. Res. 5: 282-304 70) Whitehouse, H.L.K. (1982) Genetic Recombination,  Understanding the Mechanisms J . Wiley and Sons, New York 71) Kostriken, R., Strathern, J.N., Klar, A.J.S., Hicks, J.B., and Heffron, F. (1983) C e l l 35: 167-174 72) Munz, P., Amstutz, H., K o h l i , J . , and Leupold, U. (1982) Nature (Lond.) _300: 225-231 73) Das Gupta, C. and Radding, CM. (1982) Proc. N a t l . Acad. S c i . (U.S.A.) 79: 762-766 74) N i c o l a s , A. and R o s s i g n o l , J-L. (1983) EMBO 2: 2265-2270 75) S t r i e s i n g e r , G., Okada, Y., Emrich, J . , Newton, J . , Tsugita, A., Terzaghi, E. and Inouye, M. (1966) Cold Spring Harbour Symp. Quant. B i o l . 31: 77-84 76) A l b e r t i n i , A., Hofer, H., Calos, M., and M i l l e r , J . (1982) C e l l 29: 319-328 77) Rogers, J . (1983) Nature (Lond.)305: 101-102 -77-Appendix I. Maxam G i l b e r t Sequencing Reactions. CJ_ G+A T+C C 3 2P-DNA a 5 u l 10 u l 10 u l 5 u l Cold DNAb 2 u l 2 u l 2 u l 2 u l 300 u l 10 u l H O 15 u l H,0 20 u l 5M G-buffer c z NaCl Modify 2 u l DMSd 3 u l 10% 30 HZ e 30 HZ Formic Acid Time(min) 3 10 10 15 Temp.(°C) 22 37 22 22 Stop 50 u l 300 u l 300 u l 300 u l G s t o p A s t o p g Py s t o p Py s t o p Ethanol 1 1 ml 1 ml 1 ml 1 ml -70°C a) Single end l a b e l l e d r e s t r i c t i o n fragment that was i s o l a t e d from polyacrylamide gels as described i n ref. ( 3 1 ) . Cerenkov measure of r a d i o a c t i v i t y at l e a s t 1000 cpm per m i c o l i t r e . b) Sonicated c a l f thymus DNA at 1 mg/ml. c) 50 mM Na cacodylate pH 8.0, 10 MgCl-, 0.1 mM EDTA. d) Dimethyl sulphate (Aldrich) e) Hydrazine (Kodak) f) 2.5 M 2-mercaptoethanol, 3 M NaOAc pH 6.0, 0.1 M Mg(OAc) 0.1 mM EDTA, 0.5 mg/ml tRNA. g) 0.3 M NaOAc pH 6.0, 0.1 mM EDTA, 50 ug/ml tRNA, 0.5 mM ATP h) 0.3 M NaOAc pH 6.0, 0.1 mM EDTA, 50 ug/ml tRNA. i) Ethanol p r e c i p i t a t i o n s , l y o p h i l i s a t i o n s , and p i p e r i d i n e cleavage c a r r i e d out as described i n ref.(31). Electrophoresis was as described i n the Methods except that lx TBE buffer and 20% polyacrylamide gels were used. ( A l l reaction conditions are courtesy of Dr. Caroline A s t e l l ) -78-Appendix I I . Components o f Dideoxy/deoxynucleotide Mixes G mix A mix T mix C mix ddGTP 89 ddATP - 116 ddTTP - - 547 ddCTP - - - 547 dGTP 7.9 111 158 158 dATP - -dTTP 158 U l 7.9 158 dCTP 158 U l 158 10.5 (a) a l l concentrations are i n micromoles per l i t r e and were obtained courtesy of Dr. Joan McPherson 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0096129/manifest

Comment

Related Items