UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The nucleotide sequence of A cDNA for the rat Ia-A α chain Wallis, Anne Elizabeth 1983

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1983_A6_7 W35_3.pdf [ 4.87MB ]
Metadata
JSON: 831-1.0095772.json
JSON-LD: 831-1.0095772-ld.json
RDF/XML (Pretty): 831-1.0095772-rdf.xml
RDF/JSON: 831-1.0095772-rdf.json
Turtle: 831-1.0095772-turtle.txt
N-Triples: 831-1.0095772-rdf-ntriples.txt
Original Record: 831-1.0095772-source.json
Full Text
831-1.0095772-fulltext.txt
Citation
831-1.0095772.ris

Full Text

C . i THE NUCLEOTIDE SEQUENCE OF A cDNA FOR THE RAT I a - A a CHAIN By ANNE E L I Z A B E T H WALLIS B . S c . ( H o n s . ) M o l . B i o l . U n i v e r s i t y o f E d i n b u r g h , 1981 A T H E S I S SUBMITTED I N P A R T I A L F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE i n THE FACULTY OF GRADUATE STUDIES ( D e p a r t m e n t o f B i o c h e m i s t r y ) We a c c e p t t h i s t h e s i s a s c o n f o r m i n g t o t h e r e q u i r e d s t a n d a r d THE U N I V E R S I T Y OF B R I T I S H COLUMBIA J u l y 1983 @ Anne E l i z a b e t h W a l l i s , 1983 I n p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f t h e r e q u i r e m e n t s f o r an a d v a n c e d d e g r e e a t t h e U n i v e r s i t y o f B r i t i s h C o l u m b i a , I a g r e e t h a t t h e L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e a n d s t u d y . I f u r t h e r a g r e e t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g o f t h i s t h e s i s f o r s c h o l a r l y p u r p o s e s may be g r a n t e d by t h e h e a d o f my d e p a r t m e n t o r by h i s o r h e r r e p r e s e n t a t i v e s . I t i s u n d e r s t o o d t h a t c o p y i n g o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l n o t be a l l o w e d w i t h o u t my w r i t t e n p e r m i s s i o n . D e p a r t m e n t o f Uy The U n i v e r s i t y o f B r i t i s h C o l u m b i a 1956 Main M a l l V a n c o u v e r , C a n a d a V6T 1Y3 D a t e CAMP]' DE-6 (3/81) ABSTRACT The Ir genes of the Major H i s t o c o m p a t i b i l i t y Complex have been shown to p lay an important r o l e in the a b i l i t y of an i n d i v i d u a l to produce an immune response. The products of the Ir genes, the Ia ant igens , are h ighly homologous between spec ie s . To understand the s t ruc ture and funct ion of the Ia ant igens i t i s necessary to examine the Ia molecules and the Ir genes which code for them both with in and between s p e c i e s . The nuc leot ide sequence of a cDNA which corresponded to the 3' end of the Rat Ia-A a cha in was determined. Comparison of t h i s cDNA sequence with cDNA sequences from other species (mouse and human) showed that there was a much higher degree of sequence i d e n t i t y between the Ir gene products of equivalent l o c i between species than that observed between the Ir gene products of homologous l o c i wi th in a spec i e s . Th i s ind ica tes that the d u p l i c a t i o n which gave r i s e to the homologous Ir gene l o c i occurred before the divergence of rodents and mammals. (iii; TABLE OF CONTENTS Introduction 1 Cel l u l a r Immunology of the MHC 2 1. Discovery of the Immune Response (Ir) Genes 2 2. Linkage of the Ir Genes to the MHC 4 3. Function of the Ir Genes 5 (a) Role of the Ir Genes in T Helper Ce l l - Macrophage Interactions 6 (b) Role of the Ir Genes in T Helper Cell - B Cell Interactions 9 (c) The Ia Antigens 10 4. The Ia Antigens are the Ir Gene Products 12 Biochemistry and Molecular Genetics of the MHC 14 The Class I Molecules 14 The Ia Molecules 19 Materials and Methods 23 1 .Pla.smid pRIa.2 23 2.Plasmid DNA Preparation 24 3.Isolation of cDNA Inserts 26 4. Restriction Enzyme Mapping of cDNA Cloned Inserts 27 5. Nick Translation 29 6. Colony Hybridization 30 7. Maxam and Gilbert Sequencing 33 Results and Discussion 41 I DNA Sequence Analysis of the cDNA Insert of pRIa.2 41 II Predicted Amino Acid Sequence of the Carboxy Terminal End of Rat Ia-AaChain 48 III Search for the 5' End of the Rat Ia-A a Chain 70 IV Conclusions 76 Acknowledgement 77 References 78 LIST OF TABLES Table I Maxam and Gilbert Modification Reactions PAGE 37 Table II DNA Sequencing Gels 39 Table III Comparison of the Sequence Identity Between the a Chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1 53 Table IV Comparison of the Amino Acid Sequences of the Transmembrane Regions of the Ia a Chains of Different Species 58 Table V Percent Sequence Identity Between Ig-Like Domains of Different Immune System Molecules 67 (v) LIST OF FIGURES Figure 1 MHC Restriction of Cellular Interactions in the Immune System PAGE 1 1 Figure 2 —- The Restriction Map and Sequencing Strategy of the cDNA Insert of pRIa.2 42 Figure 3 The Nucleotide Sequence of the cDNA Insert o f pRIa.2 44 Figure 4 Comparison of the Nucleotide Sequences of the cDNA Encoding the a Chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1 47 Figure 5 Translation of the Coding Sequence of the cDNA Insert of pRIa.2 49 Figure 6 Comparison of the Amino Acid Sequences of the a Chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1 52 Figure 7 Diagram of an Region Domain Immunoglobulin Constant 62 Figure 8 Comparison of the Amino Acid Sequences of Ig-Like Domains Figure 9 Schematic Representations of Some Members of the Immunoglobulin Superfamily Figure 10 Alignment of the Partial Nucleotide Sequence of the cDNA Insert of pRIa.3 with the Sequence of the cDNA Insert of pRIa.2 (vii) ACKNOWLEDGEMENT I would like to gratefully acknowledge the support and advice I received from Rob McMaster, Sarah Eccles and Heather Wallis. 1 INTRODUCTION The Major Histocompatibility Complex During early studies on tumour transplantation and skin grafting i t became apparent that there was a genetic basis to transplantation or grafting. This phenomenon of tumour or graft rejection was found to be regulated by a number of independently segregating genes. Snell, in the 1940's, developed congenic mouse strains which differred only at regions of the genome which apparently regulated tumour or graft rejection. At the same time, Gorer, using antisera developed against these congenic strains defined a group of antigens which segregated with the genes responsible for the susceptibility and resistance to tumour transplantation. These transplantation or histocompatibility antigens correlated with the same area on the genome as the tumour susceptibility genes. The region of the mouse genome to which both the tumour susceptibility genes and the histocompatibility antigens mapped was called the H-2 complex. The H-2 complex was found to be the major region of the genome which determined the ab i l i t y of an animal to reject grafts or transplants and because of this i t was termed the Major Histocompatibility Complex (MHC). Regions homologous to the mouse H-2 complex have been identified in other species including Rats (RT-1), humans (HLA), chickens (B) and pigs (SLA) (Gotze, 1977). 2 CELLULAR IMMUNOLOGY OF THE MHC 1. Discovery of the Immune Response (Ir) Genes The existence of a genetically transmissible variable which resulted in unresponsivness to certain antigens in animals usually responsive to this antigen, was noted from the 1940's onward (Carlinfanti, 1948; Sang and Sobey, 1954; Ipsen, 1959; Sobey et a l . , 1966). Early studies to examine this genetically controlled immune responsiveness, were done in guinea pig strains using large foreign protein molecules as the challenging antigen. The use of these large multi-determinant proteins as antigen gave results that were indicative of a trend in immune responsiveness but which were often not clear cut. To demonstrate the strict genetic control of the immune responsiveness to limited or even single antigenic determinants, Levine et a l . (1963) studied the response of two inbred guinea pig strains (strain 2 and strain 13) to synthetic antigens composed of a specific hapten conjugated to the carrier poly-L-lysine (PLL). A carrier is defined as a molecule which can be recognized as immunogenic by the immune system. A hapten is defined as a molecule, usually a chemical group, which cannot provoke an immune response when injected by it s e l f but can act as an immunogen when linked to a carrier. By simplifying the antigen used, i t was hoped that a more clear cut set of data would result. In this study, the hapten-carrier conjugate 2,4-dinitrophenol (DNP) - PLL was used to immunize guinea pigs of either strain 2 or strain 13. Strain 2 guinea pigs showed a 3 response as measured by the presence of serum anti-DNP antibodies and by the occurrence of a delayed hypersensitivity response. Strain 13 guinea pigs, on the other hand, were non-responders exhibiting neither a delayed hypersensitivity response nor any production of anti-DNP antibodies. Breeding experiments were done with the two guinea pig strains. The f i r s t f i l i a l generation (F1) of strain 2 guinea pigs (responders) and strain 13 guinea pigs (non-responders) resulted in progeny which were a l l responders. Crossing two F1 guinea pigs resulted in a F2 generation which were 75% responders and 25% non-responders. This indicated that the gene controlling the immune response to DNP-PLL was a single dominant gene. Work by McDevitt and Sela (1965) using similar techniques in mice supported these observat ions. In a further study Benacerraf et a l . (1967) showed that different haptens conjugated to PLL showed a similar trend of response or non-response and that immune responsiveness to PLL. was linked to the strain of guinea pig used. The gene controlling this immune response was, therefore, named the PLL gene. By linking the DNP hapten to another carrier, such as bovine serum albumin (BSA) or ovalbumin (OVA), i t was shown that the non-responder strains could recognize and respond immunologically to the hapten DNP when i t was linked to BSA or OVA (Benacerraf et a l . , 1967). This demonstrated that the non-responder animals had the capability of producing antibodies to DNP i f i t was presented to the immune system on an immunogenic carrier. This observation also indicated that the c r i t i c a l recognition step was the recognition of carrier. The antibody 4 response which resulted, however, was not primarily directed against the carrier i t s e l f , but was primarily specific for the hapten conjugated to i t . This argued that although the PLL gene was responsible in some way for the process of antigen recognition, i t was not directly involved in identification of the specific determinants to which the antibody produced would recognize. The PLL gene and other genes shown to control the a b i l i t y of an animal to mount an immune response to a specific antigen were termed immune response or I r genes. 2. Linkage of the I r Genes to the MHC The availability of inbred mouse and guinea pig strains enabled experiments to be carried out to analyse the location of the I r genes on the genome. McDevitt and Chinitz (1969), showed that the Ir genes were linked to the H-2 complex. Linkage mapping studies in inbred mouse strains localized the site of one of the Ir genes, the Ir-1 gene, to the middle of the mouse H-2. The region of the MHC to which the Ir genes mapped was called the I region (McDevitt et al.,1972). Evidence from studies in guinea pigs also showed that the Ir genes were linked to the MHC (Ellman et al.,1970). Studies of the Ir genes in other species such as the rat (Amerding et al.,1974) and the rhesus monkey (Dorf et al.,1975) established that the Ir genes were linked to the MHC of these species as well. Subsequent studies indicated that different mouse Ir genes mapped to different areas of the I region, these were called the I-A and the I-E subregions (Klein,1981). Once i t had been shown that the loci for the Ir genes were linked to the 5 MHC many investigations were done searching for a correlation between the Ir genes and the histocompatibility antigens coded by the MHC. 3. Function of the Ir Genes The Ir genes were known to determine the ab i l i t y of an organism to respond to an antigen. The mechanism by which this regulation occurred, however, was unclear. In order to understand further the role of the Ir genes in the immune response, experiments were done to determine the pattern of expression of the Ir genes in cells of the immune system. At this time i t was known that for a humoral immune response to occur an antigen-specific interaction between T helper cells and B cells must occur. This went partway towards explaining the dichotomy of the hapten-carrier conjugate responses, in which the immune response was specific for the carrier, even though the antibody response that was stimulated was directed against the hapten. If the two lymphocyte, subpopulations involved recognized different parts of the same antigen this apparent contradiction would be explained. If i t was the T helper c e l l which was responsible for recognition of the carrier part of the antigen as immunogenic then i t was the T helper c e l l which regulated the B c e l l response or lack of response to hapten. The ab i l i t y of the T helper c e l l to recognize a carrier as immunogenic appeared to be determined by the Ir genes the animal possessed. Since i t appeared that i t was the T helper c e l l which regulated immune responsiveness, i t seemed probable that the 6 expression of Ir genes occurred at the T helper c e l l l e v e l and many experiments were done aimed at valid a t i n g t h i s supposition. (a) Role of the Ir Genes in T helper c e l l - Macrophage  Interactions Experiments had shown that the response of lymphocytes to antigen required the presence of macrophages. To c l a r i f y further the exact nature of the role of macrophages, Lipsky and Rosenthal (1973) used guinea pigs to investigate the interaction between macrophages and lymphocytes in the absence of antigen. They demonstrated that a physical c e l l - c e l l contact occurred and that there was a s p e c i f i c i t y for the c e l l types involved: macrophages bound only to thymocytes or lymphocytes and no other c e l l s of the body and thymocytes from mice did not bind to guinea pig macrophages. There appeared to be an unique c e l l u l a r recognition mechanism between thymocytes and macrophages. In the presence of antigen the interactions between macrophages and lymphocytes increased and i t seemed that a d i r e c t c e l l - c e l l contact was necessary for c e l l u l a r cooperation leading to antigen-specific lymphocyte stimulation. Further studies showed that for the antigen to be in an immunogenic form for T c e l l recognition, the macrophage was required to process the antigen in some way that involved the use of metabolic energy. The existence of mouse and guinea pig strains that were congenic at the I region of the MHC allowed the production of antisera directed against d i f f e r e n t I region s p e c i f i c i t i e s . This antisera was produced by cross immunization of these congenic strains with lymphoid tissue. Studies done by Shevach et a l . 7 (1972) looked at the relationship between Ir genes and the mechanism of immune responsiveness. Lymphocyte proliferation was used to assay T helper c e l l response. The effect of alloantibody directed against the I region of the two inbred guinea pig strains, 2 and 13, on T helper c e l l function was tested. The results of this study showed that the alloantibody specifically blocked the activation of T lymphocytes by antigens that were under Ir gene control. To see i f the addition of anti-I region alloantibody was simply blocking or inhibiting the antigen uptake by macrophages, Shevach et al.(l973) incubated antigen plus macrophages with and without alloantibody before assaying for Ir gene control by in  vitro T c e l l proliferation. This experiment showed that the alloantibody had no effect on the abi l i t y of macrophages to take up and process antigen for presentation to T helper c e l l s . The most acceptable explanation for such results was that the alloantibody inhibited antigen-induced proliferation of T helper cells by blocking recognition of antigen which has been bound to or processed by macrophages. It was also apparent that the Ir genes coded for a c e l l surface associated product and that this product was somehow involved in the mechanism of antigen recognition by T helper c e l l s . The immune response seemed to involve a multi-step pathway involving the two subsets of lymphocytes, the T and B ce l l s , macrophages and antigen. The general theme of proposals put forward to explain the pathway of an immune response went as follows: foreign antigen enters the body and reacts with B cells which express immunoglobulin specific for that antigen on their 8 c e l l surface. In order for B cells to proliferate and produce antigen-specific antibody a second signal is necessary. Antigen also binds to or is in some way processed by macrophages. Once antigen has been appropriately processed i t is presented to T ce l l s . Depending on the abil i t y of T cells to recognize the macrophage-processed antigen, or the ab i l i t y of macrophages to process antigen, T cells will proliferate and send a second signal to B cel l s leading to the induction of specific antibody synthesis. The evidence of Shevach and Rosenthal (1973) established that although the functional role of the Ir gene product is in the process or mechanism of antigen recognition by T lymphocytes, this function did not necessarily require the presence of the Ir gene product on the surface of the T c e l l . They offered the alternative explanation that the Ir genes might be expressed on the surface of a c e l l that controls T c e l l activation., for example the macrophage. To investigate this proposal Shevach and Rosenthal examined whether (1) macrophages from non-responder animals would stimulate T lymphocytes of (responder X non-responder) F1 animals and (2) whether anti-I region alloantibody inhibited by blocking macrophage-T c e l l interaction nonspecifically, by specifically blocking Ir gene products or by inhibiting both functions. The results of this study, showed that i t was necessary for T cells and macrophages to be compatible at some I region loci to enable macrophages and antigen to interact with immune T helper c e l l s . Further studies showed that T helper cells exhibited a dual specificity in that recognition of antigen on the macrophage 9 surface was specific for that antigen but only when the antigen was presented on the surface of macrophages which were I region compatible with the T helper cells (Sprent,1978a). The requirement that T helper ce l l s and macrophages could interact only when they shared MHC identity at the I region and that antigen could be responded to only in the context of this shared identity was termed MHC restriction. (b) Role of the Ir Genes in T Helper Cell - B Cell Interactions MHC restriction of the antigen-specific interaction between T helper cells and macrophages was also shown to apply to the interaction between T helper cells and B c e l l s . Experiments by Kindred and Shreffler (1972) and Katz et a l . (1973), demonstrated that histoincompatible T lymphocytes and B cells were unable to cooperate and produce an antibody response. Carrier-primed T helper cells could not produce the appropriate stimulus for induction of antibody synthesis in hapten-primed B cells unless the T and B cells were fully or semi-histocompatible. Therefore, there was a failure in antigen specific T cell-B c e l l cooperation across MHC barriers. Kappler and Marrack (1976,1978) and Sprent (l978a,b) confirmed these results using different experimental techniques. 10 (c) The Ia antigens Shreffler and David (1975) in mice and Schwartz et a l . (1976) in guinea pigs found that anti-I region antisera reacted with a group of c e l l surface glycoprotein molecules expressed on B lymphocytes and macrophages. Because of the unclear relationship of these alloantigens to the Ir genes these alloantigens were termed immune-associated or Ia antigens. The Ia antigens were shown to be highly polymorphic (Shreffler and David, 1975) and to consist of two non-covalently associated glycoprotein chains (Cullen et al.,1976). The Ia antigens will be discussed in detail in a further section. In Figure 1 the mechanism of MHC restriction in T helper cell-macrophage and T helper cell-B c e l l interactions are diagrammed. 11 Figure 1 MHC Restriction of Cellular Interactions in the Immune System (a) Induc t ion of helper T-cells (b) E l f ec to r phase of T c o o p e r a t i o n In this diagram the dual s p e c i f i c i t y of the T helper c e l l (Th) is depicted. In order for an immune response to occur antigen must be presented to the T helper c e l l in association with immune associated antigens (Ia) on the macrophage c e l l surface. A T helper c e l l which has • been able to interact with a histocompatible macrophage becomes stimulated and can then interact antigen-specifically with a B c e l l (B) which presents the antigen in association with the same histocompatible Ia antigen. The immune response to antigen is said to be MHC restricted because of the dual s p e c i f i c i t y of the T helper c e l l . 12 4, The Ia antigens are the Ir gene Products Dorf and Benacerraf (1975) showed, in mice, that the immune response to some antigens was under the control of two dominant genes. When two non-responders animals were bred the resulting progeny were responders. The non-responder alleles, therefore, appeared to complement one another resulting in offspring with a responder phenotype. One gene was shown to map to the I-A region of the H-2 complex (see section 2). It seemed that for an immune response to some antigens both alleles had to be present. Dorf and Benacerraf further showed that if the I region haplotype of an animal was known i t was possible to predict whether that animal would be a responder to a specific antigen. Using the same strains as Dorf and Benacerraf, Jones et a l . (1978) found evidence that the expression of one set of Ia antigens on the c e l l surface was under the control of two genes. There appeared to be a correlation between the Ir genes and two I region gene products which controlled Ia expression.. Jones et a l . found that one .component of the Ia antigen mapped to the I-A region and that a second locus which mapped to the I-E region appeared to control whether this I-A encoded molecule was expressed on the c e l l surface. They also showed that anti-I-E antisera coprecipitated a molecule which consisted of two non-covalently associated polypeptide chains in the F1 and that this Ia antigen was not present in either of the parental strains. Taken together these results indicated that the Ia I-E antigen in the mouse, was composed of two non-covalently associated polypeptide chains and that one subunit (0) was encoded by the I-A subregion and the other subunit (a) by the I-13 E subregion. Both the a and the 0 chain were required to produce a functional Ia antigen and concommitent with expression of a complete Ia I-E antigen the immune responsiveness to some antigens appeared. Additional evidence that the Ia antigens were the Ir gene products came from experiments in which monoclonal anti-la antibody was found to specifically block T helper c e l l macrophage interactions in vitro . The T c e l l response to antigens which were under the control of one Ir locus were inhibited only by antibody directed against that locus and this same antibody had no effect on the T c e l l response to antigen under the control of other Ir loci (Lerner et al.,1980; Baxevanis et al.,1980; Sredni et a l . 1981). MHC restriction of T helper c e l l interactions in the immune response results from the dual specificity of T helper c e l l s . This dual specificity requires that a specific antigen be recognized only in the context.of an Ia antigen. 1 4 BIOCHEMISTRY AND MOLECULAR GENETICS OF THE MHC Serological data had defined several types of molecules which were encoded by the MHC. Genetic studies, done by serologically analysing lymphocytes from mice strains where recombination events occurred within the MHC, divided the mouse MHC into five subregions: the K,I,S,G, and D regions. The D region was subsequently spl i t into the D and L regions based on serological findings by Hansen and Levy 1978 . The G region was shown to be identical to that of the S region which encoded the fourth component of the complement pathway (C4) (Huang and Klein, 1980; Ferriera et a l . , 1980). The K,D and L regions encode the Class I molecules of the MHC. The I region encodes the Ia antigens as previously discussed. THE CLASS I MOLECULES The earliest studies on the K and D region gene products were done by Shimada and Nathanson (1969). Specific antibodies were used to immunoprecipitate either H-2K or H-2D molecules after solublization by papain treatment of spleen cells to release the molecules from the c e l l surface. The proteins identified in this way were found to be of 37,000 molecular weight. Later studies (Schwartz et a l . , 1973) using radioactive labelling techniques to increase the sensitivity and overcome the problem of limited amounts of protein, showed that the K and D molecules consisted of two noncovalently linked chains. The heavy chain was a glycoprotein of 37,000 molecular weight when 15 papain treatment was used, and of 44,000 molecular weight when the membrane was solublized by detergent. The determinant recognized by anti-H-2K or anti-H-2D antibodies was found to reside within the larger 44,000 molecular weight polypeptide chain. The light chain associated with the K or D region encoded polypeptide ' was shown to be, /J 2 microglobulin (Natori et a l . , 1974). This polypeptide had a molecular weight of 12,000 and was not encoded by the MHC. The heavy chain was shown to contain two carbohydrate chains (Muramatsu and Nathenson, 1970). Studies to determine whether the location of the antigenic determinent(s) recognized by the antibodies were on the protein or carbohydrate moieties of the heavy chain, showed that the antibodies reacted with the polypeptide moiety (Nathenson and Cullen, 1974). The H-2K or D antigens are now called the Class I molecules of the MHC. The use of antibodies directed against K and D region haplotype differences showed that K and D loci were polymorphic. The number of different .alleles at. each of the K and D loci is now thought to be in the range of 30-60 . The Class I molecules are found on most tissues. The Class I molecules in humans are called HLA-A, HLA-B and HLA-C antigens. Orr et a l . (1979) reported the complete amino acid sequence of a papain solublized HLA-B7 molecule. This molecule was 271 residues in length, had a single carbohydrate moiety attached at amino acid 86 and had 2 disulphide loops. A search for internal homologies by computer analysis suggested homology between the amino terminal 90 amino acids and the region of the f i r s t disulphide loop (residues 91-180). Significant homology between the second disulphide loop 16 (residues 182-271) and immunoglobin (Ig) constant domains and ^microglobulin was also shown. - Coligan et al.(l98l) reported the f i r s t complete protein sequence of a Class I antigen. Using radiochemical techniques, the murine H-2Kb chain was completely sequenced. The protein was shown to be 346 amino acids in length. The H-2K antigen could be divided into 3 functional segments; the extracellular region, the transmembrane region and the cytoplasmic region. A transmembrane segment of 25 uncharged hydrophobic amino acids was identified starting at amino acid 282 and extending approximately to amino acid 307. This agreed with sequence data which had been derived from papain treated human Class I molecules (Martinko,1980) which were 281 amino acids in length. The region from amino acid 308 to the carboxy terminus at amino acid 346 represented a 38 amino acid long intracellular or cytoplasmic t a i l . The H-2K^ molecule contained two sites for carbohydrate attachment and had two intra-chain disulphide loops. By analogy with the human HLA-B7 molecule, which was approximately 70% homologous to H-2Kb, the extracellular segment could be divided into 3 domains; the amino-terminal domain a1, the f i r s t disulphide loop domain a.2 and the second disulphide loop domain a3 which was adjacent to the membrane. Studies on the Class I antigens suggested that the 3 external domains were organized into j3-pleated sheet structures (Uehara, 1980 a,b; Martinko, 1980). Lack of sufficient amounts of protein, however, limited the data which could be derived from these studies. Recombinant plasmids containing cDNA inserts corresponding to Class I antigen mRNAs were isolated for both human 1 7 transplantation antigens (Ploegh et a l . , 1980; Sood et a l . , 1981) and for mouse transplantation antigens (Kvist et a l . , 1981; Steinmetz et a l . , 1981a). Kvist et a l . isolated a recombinant plasmid containing an approximately 1000 base pair cDNA insert, which corresponded to the carboxy-terminal half of a murine Class I antigen. The cDNA isolated by Kvist et a l . was sequenced (Bregegere et a l . , 1981) and used as a probe to isolate other Class I specific clones (Jordan, 1981). Sood et al , (1981) using oligodeoxyribonucleotide primers isolated a cDNA clone for.an HLA-B Class I antigen. v Several genomic clones were isolated by the use of cDNA probes (Steinmetz et a l . , 1981b; Jordan et a l . , 1981; Singer et al.,1982). Because of the high degree of homology between Class I antigens of mice and humans, i t was found that cDNA clones for Class I antigens of one species could identify Class I antigens of other species (Singer et a l . , 1982). The f i r s t sequence of genomic DNA which was reported encoded what appeared to be a murine pseudogene homologous to the Class I antigens (Steinmetz et a l . , 198lb). This pseudogene consisted of 8 exons, 7 of which correlated with the domain structure of the protein. The amino acid sequence from exon 1 was thought to represent a leader sequence. Exons 2,3 and 4 correlated with the domain structures predicted from early protein and cDNA sequence data (Coligan et a l . , 1981; Bregegere et a l . , 1981). Exon 5 corresponded to the transmembrane region. The last 3 exons coded for the cytoplasmic portion of the protein and the 3' untranslated region. The need for the presence of 3 domains for the cytoplasmic region of the protein was unclear, as the cytoplasmic t a i l appeared to 18 comprise only one functional region. One interesting aspect of the sequences which have been elucidated is the similarity between products of homologous loci for the Class I antigens i.e. i t is possible to determine, from sequence alone, whether a sequence is from the human HLA or mouse H-2 complex. It is not possible to determine from which loci within a species a sequence is derived. Therefore, as well as a great deal of diversity at each Class I locus there appears to be a 'homogeneity' which renders each a l l e l i c product equally like or unlike another a l l e l i c or gene product. Steinmetz et a l . (1981a) carried out a Southern blot analysis of mouse DNA using a known Class I cDNA probe. Approximately fifteen bands were identified which hybridized to the probe DNA. This indicated that the Class I antigens comprised a multigene family. An elegant technique to identify a cloned H-2 Class I gene was used by Moore et al.(l982) and Goodenow et a l . (1983).. Moore et a l . used DNA-mediated gene transfer to transform a mouse c e l l line, haplotype H-2 , with, a genomic clone of 27.5kb which hybridized strongly to a Class I cDNA probe of haplotype d. The resulting positive transformants were detected by radioimmunoassay using anti-H-2 d monoclonal antibodies. The results indicated that the genomic clone contained a functional H-2L gene and that the H-2Ld molecule was expressed correctly on the recipient cell-surface. This method, therefore, not only allows unambiguous assignment of cloned genes but may provide a system to study the function of the Class I antigens. This technique was also used by Singer et a l . in 1982 to examine expression of a genomic clone for the 19 porcine Class I or SLA antigens, and by Mellor et a l . (1982) to look at expression of an H-2Kt Class I antigen. THE Ia MOLECULES The I region of the mouse H-2 was originally subdivided into five subregions: A,B,J,E,and C (Shreffler and David, 1975). At present however, i t appears that there may actually be only two I subregions: the A and E (Klein et al.,1981; Robertson,1982). The Ia antigens in mice are called the I-A and I-E and in rats the Ia-A and Ia-E antigens . These correspond respectively to the human HLA-DC1 (Bono and Strominger, 1982; Goyert et al.,1982) and HLA-DR (Allison et a l . , 1978) antigens. Similar techniques to those described for the Class I molecules were used to purify and characterize the molecules coded for by the I region. The Ia molecules were shown (Silver et al.,. 1977) to consist of two non-covalently linked polypeptide chains, both of which were glycosylated. The mouse Ia heavy chain (a) had a molecular weight of 33,000 and the light chain (0) a molecular weight of 26,000. The antigenic determinants recognized by antibodies were shown to be on the polypeptide portions of the molecules (Cullen et al.,1975). Immunoprecipitation studies also showed that a single Ia molecule expressed more than one determinant (Cullen et a l . , 1976). Due to the small amount of Ia protein available only limited protein sequencing could be done. Limited amino-terminal sequence data showed that in the mouse there were two distinct a 20 chains and two distinct 0 chains (Silver et al.,1975,1977). Antigenic specificites determined by I-A and I-E subregions were found on independent molecules (Jones et al.,1978). Thus, each subregion appeared to code for a distinct cell-surface molecule. Crossreaction using alloantibodies for the different subregions was noted (Murphy et a l . , 1975; Murphy and Shreffler, 1975). This indicated that a degree of homology between the different A region and E region molecules existed. In contrast to the Class I antigens, the Ia molecules had a restricted tissue distribution, they are found primarily on B c e l l s , macrophages, thymic epithelium and some T helper c e l l s . Larhammar et al. ( l 9 8 l ) , described the cloning of a cDNA clone of approximately 1000 base pairs corresponding to an HLA-DR j3-like chain of approximately 230 amino acids. The amino acid sequence which was predicted from this almost f u l l length cloned cDNA displayed sequence homology to the human Class I antigen heavy chains, /3 2 microglobulin and immunoglobin constant region domains. This was especially interesting because the original protein data from amino-terminal sequencing had revealed no homology to the molecules listed above. Isolation and sequencing of HLA-DR a and 0 chain DNA was reported by Lee et a l . (1982a) Wiman et a l . (1982), Korman et a l . (1982) and Larhammar et a l . (I982a,b). The mature HLA-DR-like 0 chain was shown to be 229 amino acids in length, containing two putative disulphide loops, a 21 amino acid transmembrane segment and a 10 amino acid cytoplasmic t a i l . There was a single putative site for carbohydrate attachment within the amino-terminal Ig-like region. This amino-terminal 21 domain exhibited homology to the corresponding regions of the HLA-A.B and C antigen heavy chains. The membrane proximal Ig-like region was shown to be homologous to 0 2 m i c r o 9 l ° b u H n , Ig constant region domains and the Ig-like domains of the Class I antigens (Larhammar, 1982a). The mature HLA-DR a chain was also shown to be 229 amino acids in length. The transmembrane region was 23 amino acids long and there was a 15 residue cytoplasmic t a i l . The remaining 191 amino acids were exposed on the c e l l surface. The HLA-DR a chain was shown to be composed of two extracellular domains; al the amino-terminal domain (residues 1-84) and a2, an Ig-like disulphide containing domain (residues 85-179). The connecting peptide, transmembrane region and cytoplasmic t a i l comprise another third domain. A cDNA corresponding to the HLA-DC1 a chain was described by Auffray et al.(l982). The cDNA for the HLA-DC1 a chain was isolated by. using, an HLA-DR a chain cDNA probe. The protein encoded by this isolated cDNA was shown to be 232 amino acids in length and to correspond to the HLA-DC1 a chain by comparison with the known amino-terminus protein sequence data for HLA-DC1 a chain. The HLA-DC1 a chain and the HLA-DR a chain exhibit approximately 60% homology. By analogy to the domain structure of the HLA-DR a chain protein the HLA-DC1 a chain protein was divided into two extracellular domains; a1(amino acids 1-87) and a2(amino acids 195-217) , a connecting peptide (amino acid 182-194) a tramsmembrane region (amino acids 195-217) and an intracytoplasmic region (amino acids 218-232). The HLA-DC1 a chain had two sites for carbohydrate attachment one in each of 22 the a1 and a2 domains. Like the HLA-DR a2 domain, the HLA-DC1 a2 domain contains the only disulphide loop and exhibits homology to the Ig constant region domains. Benoist et al.(-l983), described cDNA's corresponding to the murine I-A and I-E a chains. The highly polymorphic nature of the MHC encoded molecules is unique and it is of interest to try to understand the evolution of this polymorphism. One way in which this can be done is to compare the sequences of MHC molecules of other species such as the rat, to the equivalent sequences of mouse and human molecules. 23 MATERIALS AND METHODS 1. Plasmid pRIa.2 Plasmid pRIa.2 (supplied by Dr. W.R. McMaster) was constructed in the following manner. Total RNA was prepared from spleens of Wistar strain rats (haplotype RT1U ), using 7.5M guanidium-HCl and the procedures of Chirgwin et a l . (1979). Poly-adenylated RNA (Poly(A)-RNA) was purified by chromatography on oligo (dT)-cellulose (Aviv and Leder, 1972). Spleen poly(A)-RNA was fractionated by sucrose density gadient centrifugation. Fractions containing mRNA were translated in vitro in the presence of radioactive amino acids using a cell-free rabbit reticulocyte lysate system. The Ia polypeptides were immunoprecipitated with rabbit antibodies prepared against rat Ia-A a chain and analysed by SDS-PAGE electrophoresis. Fractions of. mRNA coding for rat Ia-A a chain were used to prepare double stranded cDNA as described by Land et al.(l981). cDNA was inserted into the Pst I site of the bacterial plasmid pBR322 (Bolivar and Backman, 1979) by G/C tailing (Land et a l . , 1981) and the resulting recombinant plasmids used to transform E.coli strain RR1 (Bolivar and Backman, 1979) . Specific cDNA clones containing sequence corresponding to Ia-A a chains were detected by using a positive mRNA selection assay (Parnes et al.,1981). The assay involved immobilising pools, of plasmid DNA onto nitrocellulose f i l t e r s and hybridising total mRNA to the immobilised DNA. mRNA which hybridised was eluted and the mRNA coding for Ia polypeptides was detected by cell-free translation 24 and immunoprecipitation as described above. Pools of plasmid DNA containing cDNA inserts which hybridised to mRNA for Ia polypeptides could then be screened individually. This strategy resulted in the identification of a recombinant plasmid, pRIa.1, which contained a cDNA insert of approximately 600 base pairs, coding for a rat Ia-A a chain. A cDNA library was prepared from total rat poly(A)-RNA as described above (R.McMaster, unpublished). This cDNA library was screened for the presence of cDNA inserts containing sequences which hybridised to the cDNA insert of plasmid pRIa.1. The plasmid pRIa.2, which contained a 800 base pair cDNA insert coding for a rat Ia I-A a chain was identified in this way. 2. Plasmid DNA Preparation (Bolivar and Backman, 1979) Media and Solutions: Luria-Bertani (LB) Medium (1 ,.0g Bacto dextrose, 5.0g Bacto yeast extract, 10.Og Bacto tryptone, 10.Og NaCl made up to 1 l i t r e with d i s t i l l e d water (dH20) and the pH adjusted to pH 7.2. A l l Bacto products were from Difco Laboratories, Detroit, Mich.) TEN-8 OOOmM NaCl, 1OmM Tris(hydroxymethyl)aminomethane-HCl (Tris-HCl) pH 8.0, 1mM disodiumethylenediaminetetra-acetic acid (EDTA). pH to 8.0 ) Lysis Solution (20% Sucrose, 50mM Tris-HCl pH 8.0) Agarose Gel Electrophoresis Buffer 40mM Tris-HCl, 20mM acetic acid, 2mM EDTA. pH to 8.0 ) 25 Method: One l i t r e of LB medium containing tetracycline (lOMg/ml) was inoculated with 10ml of fresh overnight cultures of E.coli strain RR1 cells containing plasmid pRIa.2 and grown at 37°C in a shaking water bath. At an absorbance at 600nm of 0.7 , 1.2ml of freshly made chloramphenicol (160mg/ml in 95% , ethanol) was added and the cells were shaken for 12 to 16 hours. Cells were centrifuged at 5000 rpm for 15 minutes in a GSA rotor in a Sorvall RC-5B centrifuge. Each pellet was resuspended in 25.0ml sterile TEN-8, transferred to 50ml polycarbonate tubes and centrifuged in a SS-34 rotor at 5000 rpm for 15 minutes. Each pellet was resuspended in 20.0ml of lysis solution and 1.0ml freshly dissolved lysozyme (1Omg/ml in 150mM Tris-HCl pH 8.0 ) and 1.0ml 0.25M EDTA pH 8.0 were added. The mixture was swirled and left on ice for 15 minutes. To each tube was added 1.0ml ribonuclease-A (Sigma type I-A, St. Louis, Mo., 2 mg/ml in dH20, previously heated to. 100°C for 5 minutes) and 10.0ml 10% v/v.Triton X-100 (BioRad, Richmond, Calif.) in dH20 . The mixture was swirled and left at room temperature for 5 minutes . The lysed cells were centrifuged at 15000 rpm for 30 minutes in a SS-34 rotor. The resulting supernatants were extracted with 1/2 volume phenol and 1/2 volume chloroform:isoamylalcohol (24:1 v/v). The DNA in the aqueous layer was precipitated by adding 1/10 volume 2M NaCl and one volume 100% isopropanol and being placed at -20°C for a minimum of 1 hour. Precipitated DNA was collected by centrifugation at 2700 rpm in a Beckman TJ-6 benchtop centrifuge for 30 minutes, air dried for 10 minutes and dissolved in 1.0ml TEN-8. Plasmid DNA was reprecipitated by the addition of 1/10 volume 2M NaCl and three volumes 95% ethanol 26 and storing at -20°C for 4 to 16 hours. The resulting precipitates were washed with 95% ethanol, dried under vacuum and dissolved in 1.0ml TEN-8. Plasmid DNA was then chromatographed on a Sephacryl-1000 (Pharmacia) column (100 cm X 1.6 cm) run in TEN-8 to separate tRNA from plasmid DNA. The absorbance at 260nm of each fraction (2ml) was recorded and aliquots from fractions containing plasmid DNA were analysed by electrophoresis on a horizontal 1% agarose gel (170X120x5mm) run at 150 volts for 40 minutes in agarose gel electrophoresis buffer. Fractions containing plasmid DNA were precipitated with ethanol as described above. The precipitate was dissolved in 1.0ml dH20 and the concentration of plasmid DNA calculated. At an absorbance of 260 nm, 20 OD units was equivalent to a concentration of 1mg/ml DNA. 3. Isolation of cDNA Inserts . . Plasmid DNA, 200/ig, was digested to completion with the restriction enzyme Pst I. Digested DNA was electrophoresed on a 1% agarose gel containing ]nq/ml ethidium bromide and run at 250 volts for 40 to 60 minutes (section 2). DNA bands corresponding to linearized pBR322 and inserted fragment DNA were visualized with long wave ultra violet (u.v.) light. To elute the inserted fragment DNA a thin slot, 3 to 5 mm in width, was cut with a razor blade directly in front of and parallel to the u.v. visible band representing the inserted fragment. The gel was electrophoresed such that the buffer touched the gel at either 27 end but did not submerge i t . The slot which had been cut out of the gel was f i l l e d with fresh electrophoresis buffer. Progress of the DNA into'the buffer f i l l e d slot was followed using the long wave u.v. light. The current was stopped before the DNA traversed to the other side of the slot and the buffer containing DNA was transferred to a sterile plastic tube. The slot was r e f i l l e d with fresh buffer and this process repeated 4 times to allow for maximal DNA recovery. DNA was ethanol precipitated at -20°C overnight as described in.section 2. The resulting DNA pellet was dissolved in dH20 to a concentration of 1mg/ml. 4. Restriction Enzyme Mapping of cDNA Cloned Inserts cDNA inserts were analysed by single and double restriction enzyme digests. . A 2ng. aliquot of purified-cDNA insert was incubated with 2 units of each restriction enzyme for 60 to 90 minutes at 37°C or 65°C depending on the enzyme used. Enzymes used were: Alu I, Ava I, Ava II, Bam HI, Bgl I, Dde I, Eco RI, Hae III, Hha I, Hin FI, Mbo II, Nei I, Pvu II, Sal I, Sau IIIA, Sau 961, Sma I, Sst I, Taq I, Tha I, Xba I, Xho I. Enzymes were from Bethesda Research Laboratories Inc.(BRL), Gaithersburg, MD. Enzyme digests were carried out under reaction conditions recomended by BRL. The digested DNA was analysed by electrophoresis on a 5% non-denaturing polyacrylamide gel (acrylamide:bis acrylamide 29:1(w/w); BioRad , Richmond, Calif.) size 180x160x1.5mm. The 28 gel was run in 1/2 X TBE (40mM Tris-HCl, 40mM boric acid, 1mM EDTA, pH 8.3) at 100 volts for 2 hours. Gels were stained with ethidium bromide (1Mg/ml in dH20) and photographed under u.v. light. To increase the sensitivity the cDNA insert was radioactively labelled . Fragments of the cDNA insert of pRIa.2 generated by restriction enzyme digestion were labelled by the extension of a recessed 3' end. The restriction enzymes used were Hpa II and Hin FI. Each of these enzymes recognizes a specific four base pair sequence and cleaves the DNA to give fragments with a 3' recessed end. The cDNA (2^g) was digested in the appropriate buffer in a final volume of 15M1 by incubation at 37°C for 90 minutes. To label the 3' recessed ends, the digested DNA (in 15MD was heated to 68°C for 5 minutes and allowed to cool to room temperature. To this 1 jul dithiothreitol (50mM), 1^ 1 DNA Polymerase I (Klenow Fragment) (2 units/jul, New England Nuclear, Boston, Mass.) and 15juCi • of a- 3 2P-deoxyribonucleotide triphosphate (a-32P-dNTP) (lOmCi/ml in 1OmM Tricine,2500 Ci/mmole; New England Nuclear, Boston, Mass.) were added and the reaction carried out at room temperature for 15 minutes. cDNA digested with Hpa II was labelled with a- 3 2P-deoxyribocytidine triphosphate (a-32P-dCTP) and the cDNA digested with Hin FI was labelled with a-32P-deoxyriboadenosine triphosphate (a-32P-dATP). After incubation the reaction mix was phenol extracted (as described in section 2 ) and chromatographed on a 9ml column of Sephadex-G50 Fine (Pharmacia) in TEN-8. Fractions of 400^1 were collected and those containing the radioactive DNA were pooled 29 and ethanol precipitated overnight at -20°C (as described in section 2) , The precipitated cDNA was washed once in 95% ethanol, dried under vacuum and dissolved in 25jul dH20. An aliquot of the labelled cDNA was subjected to digestion by a second restriction enzyme. Single and double digested DNA was run on a 5% non-denaturing polyacrylamide gel as described above. The gel was dried down under vacuum at 60°C for two to three hours and then exposed to X-ray film (Kodak X-Omat XAR-2) which was developed after 48 hours. 5. Nick Translation (Melgar and Goldwaith,1968; Maniatis et al.,1975; Rigby et a l . , 1977) Nick translation of cDNA fragments was carried out under the following conditions: (a) Deoxyribonuclease (DNase) Activation: DNase I (img/ml in dH20, Boehringer Mannheim, Indianapolis, Ind.) was diluted with DNase Activation Buffer (1OmM Tris pH 7.5, 5mM MgCl2, img/ml nuclease free bovine serum albumin (BSA) (Enzo Biochemicals Inc.,New York,NY.)) to give a final concentration of 100Mg DNase I/ml. The activated DNase I solution was l e f t on ice for between 5 and 120 minutes. Prior to addition to the nick translation reaction, the DNase I was further diluted by 2 serial dilutions of 1/100 and 1/10 into DNase Activation Buffer. This gave an activated DNase I solution of I00ng/ml. (b) Nick Translation Reaction: To a 1.5ml microfuge tube the following were added on ice : 5/xl 10 X Nick Translation Buffer 30 (500mM Tris-HCl pH7.5, 50mM MgCl2 ), 1yl dithiothreitol (50mM), 1 iul BSA (2mg/ml), 2yl deoxyriboguanosine triphosphate (dGTP) (500yM), 2yl deoxyribothymidine triphosphate (dTTP) (500yM), 2yl deoxyriboadenosine triphosphate (dATP) (35yM), 2yl deoxyribocytidine triphosphate (dCTP) (35yM), 4yl a-32P-dATP (l0mCi/m1, 2000 Ci/mmole, New England Nuclear, Boston, Mass.) 4yl a-32P-dCTP (lOmCi/ml, 2000 Ci/mmole, New England Nuclear, Boston, Mass.), 1yl CaCl 2 OOmM), 2yl cDNA fragment (250 yg/ml) I9.5yl dH20, 2.5yl Activated DNase I Solution (I00ng/ml), and 1yl DNA Polymerase I (8 units/yl,New England Nuclear, Boston, Mass.). The reaction mix was gently mixed, centrifuged in a microfuge and incubated at 15°C for 90 minutes. After incubation 3yl carrier tRNA (1Omg/ml,Sigma type X, St. Louis, MO.) was added. The mix was heated to 68°C for 5 minutes and chromatographed on a Sephadex G-50 Fine column (see section 4). Fractions containing radioactive DNA were pooled, ethanol precipitated overnight at -20°C as before and the precipitate dissolved in I00yl dH20. The average incorporation was 60 X 106 cpm/yg DNA. 6. Colony Hybridisation (Grunstein and Hogness, 1975) E.coli strain RR1 cells containing a cDNA library prepared from total rat spleen poly(A)-RNA (see section 1) were plated out on LB medium plus 1.5% agar containing tetracycline (I0yg/yl) to give approximately 300 to 400 colonies/plate and grown overnight at 37°C. Circular 82mm diameter nitrocellulose 31 f i l t e r s ( BA 85 0.45/Ltm, Schleicher and Schuell Inc., Keene, NH.) were autoclaved, numbered with soft lead pencil and then placed carefully, number side down, on top of the colonies. Filters were gently pushed onto plates and the number from the f i l t e r traced onto the bottom of the plate. After 5 minutes the f i l t e r s were gently peeled off and placed colony side up onto freshly made LB medium plus 1.5% agar containing chloramphenicol (lOOMg/yl). Filters were incubated on the plates overnight at 37°C to amplify the plasmid DNA contained in the colonies. The original plates from which the colonies had been removed were incubated to regrow the colonies that had been pulled off. (a) Immobilisation of DNA on nitrocellulose f i l t e r s The f i l t e r s were removed from the chloramphenicol plates and placed colonies up on Whatman 3MM paper which had been saturated with 0.5M NaOH, 1.5M NaCl. Filters were left for 20 minutes and then transferred to f i l t e r paper and air dried for 5 minutes. This step was then repeated. Filters were transferred to Whatman 3MM paper saturated with 1.0M Tris-HCl pH 7.5 for 20 minutes, air dried for 5 minutes and then placed on Whatman 3MM paper saturated with 0.5 M Tris-HCl (pH 7.5), 1.5 M NaCl. Fi l t e r s were air dried for 30 minutes and baked at 68°C for 3 hours. 32 (b) Hybridisation  Solutions 1 X SSC (0.15M NaCl, 0.015M Na Citrate, pH 7.0) 1 X Denhardt Solution (0.04% F i c o l l , 0.04% polyvinylpyrrolidone, 0.04% BSA a l l from Sigma, St. Louis, MO. (Denhardt,1966) Pre Hybridisation Solution (6 X SSC, 1 X Denhardt Solution) Hybridisation Solution (6 X SSC, 1 X Denhardt Solution, 0.5% sodium dodecylsulphate (SDS), 1mM EDTA, 0.5mg/ml carrier E.coli DNA (Sigma type VIII, St. Louis, MO.) ) Method . Fil t e r s were placed in 500ml prehybridisation solution at 68°C for a minimum of 2 hours in a pyrex dish (20X20cm). Just before use, the nick-translated probe DNA (section 5) was denatured. The following were incubated at 37°C for 30 minutes : 100M1 radioactive probe DNA (0. 2X1 06cpm/Ml) , 1 5/xl carrier pBR322 DNA (800Mg/mg) and 3*il NaOH (4M) to give a fi n a l volume of 120M1. The denaturation mixture was neutralized by addition of 1.5M NaH2PO„ to a final concentration of 0.15M. The denatured probe (approximately 10 scpm/filter) was added to preheated hybridisation solution (2ml/filter). Hybridisation solution containing the radioactive DNA was placed in a petri dish. Filters were then carefully placed in the solution (10 filters/plate maximum) such that there were no air bubbles in between the f i l t e r s . An exposed piece of X-ray film cut to the dimensions of a petri dish was placed on top of the f i l t e r s to ensure the f i l t e r s were kept immersed in the hybridisation solution and out of contact with a i r . The petri 33 dish was then placed in an air tight container and incubated at 68°C for a minimum of 6 hours. (c) Washing After hybridisation the f i l t e r s were rinsed twice in 2 X SSC to remove the majority of non-hybridised probe DNA. Filters .were then washed three times for 2 hours in 1 X SSC, 0.5% SDS at 68°C (500ml per wash), rinsed in 2 X SSC and air dried on f i l t e r paper (approximately 60 minutes). Filters were exposed to X-ray film (Kodak X-Omat XAR-2) for 2 days. Colonies which were identified as positives were isolated from the original regrown plates and the plasmid DNA they contained analysed for the presence of a cDNA insert. 7. Maxam and Gilbert Sequencing (Maxam and Gilbert, 1980, as modified by Dr. C. Astell, Dept. of Biochemistry, University of BC) (a) End Labelling Of Fragments With 3' Recessed Ends cDNA was labelled at the 3' end exactly as described in section 4. In addition to the restriction enzymes Hpa II and Hin FI, the enzymes Eco RI and Sau 3A were also used to digest cDNA fragments to be used for sequencing. The Eco RI and Sau 3A fragments were labelled with a-32P-dATP. To the reaction labelling the Eco RI fragments, 25juM unlabelled dATP was added and incubation was carried out for an additional minute. After the labelling reaction, the DNA was isopropanol precipitated at 34 -20°C for a minimum of 30 minutes as described in section 2. (b) Gel Electrophoresis And Isolation Of Labelled Fragments Precipitated DNA was washed in 95% ethanol, dried under vacuum for 10 minutes, dissolved in 5jul dye mix (1.5% ficoll,1X TBE,0.05% xylene cyanol,0.05% bromophenol blue ) and loaded onto a 5% nondenaturing polyacrylamide gel (see section 4) . The gel was run at 200 V for 60 to 90 minutes depending on the size of fragments and the separation required. The gel was then exposed to X-ray film (Kodak X Omat XAR-2) for 10 minutes and the film developed to visualize the locations of the DNA bands on the gel. Labelled fragments were cut out of the gel and placed in dialysis tubing with 400M1 elution buffer (1/2 X electrophoresis buffer). The DNA was electroeluted from the gel by placing the dialysis bags perpendicular to the current and applying a potential difference of 230 V for approximately 40 minutes. The elution' buffer containing radioactive DNA was transferred "to siliconized, sterile 1.5ml microfuge tubes and the tubing rinsed with a further 100M1 of elution buffer. The eluate was centrifuged in a microfuge for 5 minutes to pellet any polyacrylamide and the supernatant was transferred to a new tube. Labelled fragments were then ethanol precipitated at -20°C overnight as described in section 2. (c) Double Labelled Fragments Cleavage of the DNA with restriction enzymes which had more than one recognition site within the cloned cDNA fragment, 35 resulted in fragments which were labelled at both ends. In order to obtain a single labelled fragment necessary for DNA sequencing, double labelled fragments were either digested with an enzyme (as described in section 4) which cut within the labelled fragment or the fragment was strand separated (see below). Either method resulted in two single labelled fragments which were electrophoresed on a 5% non-denaturing polyacrylamide gel and isolated as described above. (d) Strand Separation To strand separate double-labelled fragments, precipitated DNA was dissolved in 40M1 of 'Strand Separation Solution (30% v/v dimethylsulphoxide (DMSO), 1mM EDTA, 0.05% w/v bromophenol blue) and heated to 90°C for 2 minutes. The DNA was quick-cooled in ice water and loaded immediately onto a prerun 5% non-denaturing polyacrylamide gel. The gel was run, with cooling, at 400 volts for 60 to 90 minutes depending on the size of the fragments being separated. It is important to note that when strand separated DNA is electrophoresed on polyacrylamide gels the double stranded DNA migrates faster than the single stranded species and the two single stranded DNAs usually migrate at different speeds thus allowing isolation of the two different strands as single labelled fragments. The DNA was electroeluted and precipitated as previously described in section 7(b). (e) End Labelling Of Fragments With 3' Extended Ends 36 To label fragments with 3' extended ends, such as those resulting from Pst I cleavage , a- 3 2P-cordycepin triphosphate and terminal deoxynucleotidyl transferase (TdT) were used. The cDNA fragment, 15/xl (600ng/;xl), was incubated at 37°C for 30 minutes with 10/ul 5X TdT buffer (700mM potasium cacodylate, l50mM Tris-HCl pH 7.0 ), 5yl CoCl 2 (1OmM ), 2yl dithiothreitol (2mM), 14M1 CL- 3 2P-cordycepin triphosphate (7mCi/ml in 10mM Tricine, 5700 Ci/mmole, New England Nuclear) and 2yl TdT (20 units/Ml, New England Nuclear, Boston, Mass.). After end labelling the DNA was phenol extracted and precipitated with ethanol as described in section 2. The DNA was then digested with Hpa II, which cut only once within the cDNA fragment, and the 2 single labelled fragments were isolated from a 5% non-denaturing polyacrylamide gel as previously described. (f) Maxam and Gilbert Modification Reactions SOLUTIONS:. Cacodylate Buffer (0.05M cacodylate, 0.1mM EDTA pH 8.0) G-Stop Mix (3M sodium acetate pH 6.0, 2.5M 2-mercaptoethanol, 500Mg/ml tRNA (Sigma type X, St. Louis, MO.)) Pyrimidine-Stop Mix (0.3M sodium acetate, 0.1mM EDTA, 83Mg/ml tRNA) A-Stop Mix (0.3M sodium acetate, 0.1 mM EDTA, 0. 5mM ATP, 83jtzg/ml tRNA). The single labelled DNA fragments were taken up in 32/zl dH20 and aliquoted for the 4 base-specific modification reactions. The modifications were carried out as in Table I. Table I Maxam and Gilbert Modification Reactions BASES MODIFIED C •»• T G T A + G REACTION CONDITIONS 20 ,Ul 5M NaCl 1jul E . c o l l DNA 5 u l P-DNA 300ul Cacody1 a t e l u l E . c o l l DNA 5ul P-DNA 15ul dH20 l u l E . c o l l DNA l O u l P-DNA lOul dH20 1ul E . c o H DNA l O u l P-ONA START REACTION AT — 0 min. 1 min. 2 min. 3 min. BASE MODIFYING SOLUTION 3 0 u l h y d r a z I n a 2ul OMS 30 u l h y d r a z 1 n a 3 u l 10% f o r m i c a c i d INCUBATE AT R . T . R . T . R . T . 37'C STOP REACTION ... AT 10 min. 4 min. 7 min. 13 min. STOP MIX 300ul Pyr-STOP I.Oml EtOH 50ul G-STOP 1.0ml EtOH 300ul Pyr-STOP 1.0ml EtOH 300ul A-STOP 1.0ml EtOH 38 After the addition of 1.0ml 95% ethanol (kept on dry ice), the tubes were placed immediately into a -70°C dry ice/ethanol bath to precipitate the DNA and to ensure the reactions were stopped. After fifteen minutes, the tubes were centrifuged in a microfuge for 10 minutes and the supernatant removed with a drawn-out Pasteur pipet. The DNA was dissolved in 250M1 0.3M sodium acetate (pH 6.3) and precipitated with 1.0ml 95% ethanol at -70°C. The DNA was then dissolved in l O j i l dH20 and precipitated with 1.0ml 95% ethanol as above, washed once with 1.0ml 95% ethanol and dried in a vacuum dessicator. (g) Piperidine Cleavage Reaction DNA pellets were dissolved in 100M1 of freshly diluted piperidine 1/10 (v/v) in dH20. Caps on the tubes were lined with teflon tape to provide a tight seal and prevent liquid from escaping or entering the tube. The DNA was heated to 90°C for 30 minutes, freeze dried under vacuum (approximately 2 to 3 hours), resuspended in 20M1 dH20 and freeze dried (approximately 1 hour), resuspended in a further 20M1 dH20 and freeze dried again to ensure that the piperidine was removed. (h) DNA Sequencing Gels Polyacrylamide gels were prepared as described in Table II. The gel size was 360 X 200 X 0.35 mm and a l l gels were run in 1/2 X TBE ( see section 4). 39 Table II DNA Sequencing Gels UREA 25a on 25o 25a lOx TBE 2.5ml 2.5ml 2 . 5ml 40% ACRYL-AMIDE ( 1 9 : 1 ) 9.5g ACRYL-AMIDE 0.5a BIS 10ml 7.5ml dH20 27.2ml 20m 1 21 .7ml Warm t o 42'C t o d i s s o l v e UREA Degas 10% A M P S ™ " ' 0r33ml 0~33mr~"1 0.33ml TEMED 15ul 15ul 1 15ul TOTAL VOL 50ML 50ML 50ML 40 (i) Gel Electrophoresis After the final freeze drying, the radioactivity of each tube was determined and the DNA dissolved in a volume of dye mix (80% formamide(deionized) , 0.1% xylene cyanol, 0.1% bromophenol blue, 1OmM NaOH, 1mM EDTA), such that there were twice as many counts/Ml in the C + T and A + G tubes as there were in the T and A tubes. The optimal volume of dye mix loaded into a gel slot was 4M1, therefore the DNA in the tube containing the least radioactivity was dissolved in 4/nl of dye mix per gel and the DNA in the other tubes was dissolved accordingly. DNA was heated to 90°C for 3 minutes, quick-cooled in ice-water, immediately loaded onto prerun gels (see above) and electrophoresed at 37 watts. The 20% gels were electrophoresed until the bromophenol blue had migrated 20cm from the loading point (approximately 75 minutes), the top plate of the gel was then removed and the gel was covered in Saran Wrap. 8% gels were electrophoresed for 90 and 180 minutes. The gels were then transferred to Whatman 3MM f i l t e r paper, covered with Saran Wrap and dried at 80°C under vacuum for 20 minutes. The dried gel was then exposed to X-ray film (Kodak X-OMAT RP) for one to three days depending on the number of counts loaded onto the gel. In some cases intensifying screens were used (Dupont Cronex Xtra Life,Wilmington,DE.). (j) DNA Sequence Analysis A computer program written by Dr. A. Delaney (1982) was used to store and analyse DNA sequence data. 41 RESULTS AND DISCUSSION I DNA SEQUENCE ANALYSIS OF THE cDNA INSERT OF pRIa.2 (a) Sequencing strategy In Figure 2 the strategy used to sequence the cDNA insert in pRIa.2 is shown. The sequencing was done by the methods of Maxam and Gilbert(1980), as described in Materials and Methods. The cDNA insert was digested with restriction enzymes which gave a staggered cut at a 4 base pair recognition sequence to give 3' recessed ends. The ends were then labelled with the appropriate a-32P-dNTP using DNA Polymerase I (Klenow fragment) and the fragments were then recut or strand separated. The 3' extended ends produced by Pst I cleavage were labelled with a- 3 2P-cordycepin triphosphate using terminal transferase. Both strands of the cDNA insert were sequenced using overlapping restriction enzyme fragments. 42 Figure 2 The Restriction Map and Sequencing Strategy of the cDNA Insert in pRIa.2 m ON <T co n o o r H r - CM O l cn •n NO M M M M M M M M M M fx* P i M *J 3 to 9 C O a 4J m a a. ifl -H V •H O P-. CO to 33 w « The restriction map shows the re s t r i c t i o n enzyme recognition sites used for sequencing the cDNA insert of pRIa2. The numbers indicate the 5' nucleotide of the recognition sequence.The numbering starts following the poly(G).tract at the 5' end of the insert. The horizontal arrows beneath the cDNA insert indicate the direction and extent of sequencing. . 43 (b) DNA Sequence of the cDNA Insert of pRIa.2 The nucleotide sequence of the cDNA insert of pRIa.2 (see Figure 3) was 779 base pairs in length. At one end of the insert there was a tract of 18 guanine (G) nucleotides and at the other end there was a tract of 17 cytosine (C) nucleotides. Immediately preceding the poly(C) tract was a tract of poly(A), 63 nucleotides in length. This poly(A) tract corresponded to the poly(A) t a i l of the mRNA and defined the 3' end of the cDNA insert. There was a putative polyadenylation signal, AATAAA, (Proudfoot and Brownlee,1976) 15 nucleotides 5' to the start of the poly(A) t a i l . Following the 5' poly(G) tract there was an open-reading frame of 388 nucleotides ending in the stop codon TGA. The open reading frame represented the coding region for the carboxy terminal 129 amino acids of the Ia a chain. The 290 nucleotides following the stop codon corresponded to a 3' untranslated region of the mRNA. 44 Figure 3 The Nucleotide Sequence of the cDNA Insert of pRIa.2 (G) TCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGATCAATA 18 1 16 TCACATGGTTGAGAAACAGCAAGCCAGTCACAGAAGGCGTTTATGAGACCAGCTTCCTTT 176 CCAACCCTGACCATTCCTTCCACAAGATGGCTTACCTCACCTTCATCCCTTCCAACGACG 236 ACATTTATGACTGCAAGGTGGAGCACTGGGGCCTGGACGAGCCGGTTCTAAAACACTGGG 296 AACCTGAGGTTCCAGCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTGTGCCCTGGGGT 356 TGTCTGTGGGCCTCGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCCTGCGAT 416 CAGATGGCCCCTCCAGACACCCAGGGCCCCTTTGAGTCACACCCTGGGAAAGAAGGTGCG 476 TGGCCCTCTACAGGCAAGATGTAGTGTGAGGGGTGACCTGGCACAGTGTGTTTTCTGCCC 536 CAATTCATCGTGTTCTTTCTCTTCTCCTGGTGTCTCCCATCTTGCTCTTCCCTTGGCCCC 596 CAGGCTGTCCACCTCATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATT 656 TTTGGCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTGATGCTCCACCA 681 AACCAATAAACCTCTCATAAGTTGG f A) (C) 63 17 The poly(G) and poly(C) tracts at either end of the insert are represented by a bracketed G/C with a subscript representing the number ofnucleotides. The poly(A) t a i l is similarly represented. The TGA stop codon at 389 is underlined as is the putative polyadenylation signal, AATAAA, at nucleotide 661. The numbers above each line represent the nucleotide number, starting at the f i r s t nucleotide following the 5' poly(G) tract and ending at the last nucleotide preceding the poly(A) t a i l at number 681. 45 (c) Comparison Of The DNA Sequence Of The cDNA Insert  Of pRIa.2 With The Equivalent Regions In cDNA  Coding For Mouse H-2 I-A And Human HLA-DC1 a Chains To gain a better understanding of the evolution of the Ia molecules encoded by the MHC, i t is useful to study the equivalent genes and their gene products in species which are closely related such as mice and rats, which diverged only 8 to 10 million years ago, and far apart such as rodents and humans, which diverged approximately 70 million years ago (Young,1950). In Figure 4 the nucleotide sequence of the cDNA insert of pRIa.2 is compared with the equivalent sequences of cDNA coding for mouse H-2 I-A and the human HLA-DC1 a chains. There is 91% DNA sequence identity between rat and mouse, and 85% DNA sequence identity between rat and human when coding sequences only are compared. When the 3' untranslated regions are compared, however, the rat and mouse sequences show 82% identity, whereas the rat and human sequences are only 27% identical. This difference in sequence identity between coding and noncoding regions is consistent with the proposal that noncoding regions are much more free from restraints and diverge from one another in evolution much more rapidly than coding regions (Crick,1981). Coding regions are maintained because of the evolutionary restraints or pressures which act on the gene products coded by the DNA. Non-coding regions are able to mutate and thus evolve at a much higher rate because the selection . 46 p r e s s u r e s o f e v o l u t i o n a r e a b l e t o a c t o n l y i n d i r e c t l y on t h e s e r e g i o n s . The f u n c t i o n o f n o n - c o d i n g o r u n t r a n s l a t e d r e g i o n s o f mRNA i s s t i l l unknown. I t i s t h o u g h t t h a t t h e p o l y ( A ) t a i l may a c t t o s t a b i l i z e mRNA ( W i l s o n e t a l . , 1 9 7 8 ; Z e e r i e t a l . , 1 9 8 1 ) . I f t h i s i s s o , p e r h a p s t h e 3' u n t r a n s l a t e d r e g i o n o f mRNA a l s o f u n c t i o n s t o s t a b i l i z e t h e messag e . I t i s i n t e r e s t i n g t o n o t e t h a t t h e human HLA-DC1 mRNA h a s o n l y a 123 n u c l e o t i d e 3' u n t r a n s l a t e d r e g i o n ( n o t i n c l u d i n g t h e p o l y ( A ) t a i l ) , w h i l e t h e r a t h a s a 290 n u c l e o t i d e 3' u n t r a n s l a t e d r e g i o n . The mouse 3' u n t r a n s l a t e d r e g i o n i s a t l e a s t 184 n u c l e o t i d e s i n l e n g t h b u t t h e f u l l e x t e n t o f t h e 3' e n d h a s n o t been r e p o r t e d . F i 9 u r ( J 4 Comparison of the Nucleotide Sequences of the cDNA encoding the a Chains H-2 I-A Rat Ia-A HLA-DC1 H-2 I-A Rat Ia-A HLA-DC1 H-2 I-A Rat Ia-A HLA-DC1 H-2 I-A Rat Ia-A HLA-DC1 H-2 I-A Rat Ia-A HLA-DC1 H-2 I-A" Rat Ia-A HLA-DC1 H-2 I-A Rat Ia-A HLA-DC1 10 20 30 40 50 TCAGCCCAACACCCTTATCTGCTTTGTGGACAACATCTTCCCTCCTGTGA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * TCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * TCAGCCCAACACCCTCATCTGTCTTGTGGACAACATCTTTCCTCCTGTGG 60 70 80 90 100 TCAACATCACATGGCTCAGAAATAGCAAGTCAGTCACAGACGGCGTTTAT * * * • * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * TCAATATCACATGGTTGAGAAACAGCAAGCCAGTCACAGAAGGCGTTTAT * * * * * * * * * * * * • * * * ** * * * * * * * * * * * * * * * * * * * * TCAACATCACCTGGCTGAGCAATGGGCACTCAGTCACAGAAGGTGTTTCT 110 120 130 140 150 GAAACCAGCTTCTTCGTCAACCGTGACTATTCCTTCCACAAGCTGTCTTA •• * * • • * • • * * * * * * * * * * * * * * * * * * * * * * * * * * •* * * • * GAGACCAGCTTCCTTTCCAACCCTGACCATTCCTTCCACAAGATGGCTTA * * * * * * * * * * * * * * * * ••• * * * * * * * * * * * * * * * * * * * * * GAGACCAGCTTCCTCTCCAAGAGTGATCATTCCTTCTTCAAGATCAGTTA 160 170 180 190 200 TCTCACCTTCATCCCTTCTGACGATGACATTTATGACTGCAAGGTGGAGC CCTCACCTTCATCCCTTCCAACGACGACATTTATGACTGCAAGGTGGAGC CCTCACCTTCCTCCCTTCTGCTGATGAGATTTATGACTGCAAGGTGGAGC 210 220 230 240 250 ACTGGGGCCTGGAGGAGCCGCTTCTGAAACACTGGGAACCTGAGATTCCA * * * • * • * * • • * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ACTGGGGCCTGGACGAGCCGGTTCTAAAACACTGGGAACCTGAGGTTCCA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ACTGGGGCCTGGATGAGCCTCTTCTGAAACACTGGGAGCCTGAGATTCCA 260 270 280 290 300 GCCCCCATGTCAGAGCTGACAGAGACTGTGGTGTGTGCCCTGGGGTTGTC • * • • • * * • * * * * * • • * • * * * * • * * • * * * * * • * * * * • • * • * * * * • • • • • • GCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTGTGCCCTGGGGTTGTC * •* * * * * * * * * * * * * * * • * * * • * • • * * * • • * * * * * * * * * * * * * * * ACACCTATGTCAGAGCTCACAGAGACTGTGGTCTGCGCCCTGGGGTTGTC 310 320 330 340 350 TGTGGGCCTTGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCC * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * TGTGGGCCTCGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCC * * • • * • * * * * • * * * * • * • * * * * * * * * * * * * * * * * * * * * * * * * * * TGTGGGCCTCGTGGGCATTGTGGTGGGGACCGTCTTGATCATCCGAGGCC H-2 I-A Rat Ia-A HLA -DC1 H-2 I-A Rat Ia-A HLA -DC1 H-2 I-A Rat Ia-A HLA -DC1 H-2 I-A Rat Ia-A HLA -OCI H-2 I-A Rat Ia-A Rat Ia-A Rat Ia-A 360 370 380 390 400 TGCGATCAGGTGGCACCTCCAGACACCCAGGGCCTTTATGAGTCACACCC * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * TGCGATCAGATGGCCCCTCCAGACACCCAGGGCCCCTTTGAGTCACACCC * • * • * • * • * * * * * * * * * * * * * * * * * * * * * • * * * *• ** *• TGCGTTCAGTTGGTGCTTCCAGACACCAAGGGCCCTTGTGAATCCCATCC 410 420 430 440 450 TGGAAAGGAAGGCGTGTGTCCCTCTTCATGGAAGAAGTGGTGTGCTGGGT *• * •* * * * * * * * * * * * * * * * * * * * * * * *• * * * * * * * * * TGGGAAAGAAGGTGCGTGGCCCTCTACAGGCAAGATGTAGTGTGAGGGGT * • • • • * * * • * * * • * • TGAAAAGGAAGGTGTTACCTACTAAGAGATGCCTGGGGTAAGCCGCCCAG 460 470 480 490 500 GACCTGGCACAGTGTGTTTTCTGGACCAATTTATGGTGTTCTTTTTCTTC • • • • * * • * * • * * * * * • • • * • * • * * • * • • * •* * * * • • • • * * * * * * * GACCTGGCACAGTGTGTTTTCTGCCCCAATTCATCGTGTTCTTTCTCTTC * * * * * * * * * * CTACCTAATTCCTCAGTAACATCGATCTAAAATCTCCATGGAAGCAATAA 510 520 530 540 550 TTCAAGTGACCCCCAACTTGCTTTTCCCTTGGCCCTGAGGCTGTCCCTCT TCCTGGTGTCTCCCATCTTGCTCTTCCCTTGGCCCCCAGGCTGTCCACCT • * * ATTCCCTTTAAGAGAAAA CACAGCTCACACACCCTTGGAATTC * * * • * * ••* • * • • • * • * • * * • CATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATTTTTG GCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTGATGCT CCACCAAACCAATAAACCTCTCATAAGTTG A s t e r i s k s show p o s i t i o n s of sequence i d e n t i t y . The stop codons are boxed. Data from Benoist et al.,1983 (H-2 I-A) and A u f f r a y et al.,1982 (HLA-DC1). 48 II_ PREDICTED AMINO ACID SEQUENCE OF THE CARBOXY  TERMINAL END OF RAT Ia-A a CHAIN (a) Translation of the cDNA Sequence The predicted amino acid sequence of the cDNA insert of pRIa.2 is shown in Figure 5. The translation starts at the second nucleotide after the G t a i l and corresponds to the carboxy terminal 129 amino acids. By analogy with the known domain organization of the HLA-DR a chain (Korman et al.,1982b), the predicted amino acid sequence of the cDNA insert of pRIa.2 can be divided into several different structural regions. The f i r s t 91 amino acids correspond to the majority of the f i r s t extracellular domain (a2). The next 13 amino acids define the connecting peptide, a region which joins the a.2 domain to the transmembrane region of the protein. The transmembrane region i t s e l f , consists of 23 mainly hydrophobic amino acids. The remaining 15 amino acids are thought to be located intracellularly and define the cytoplasmic region. \ 49 F i g u r e 5 T r a n s l a t i o n o f t h e C o d i n g S e q u e n c e o f t h e cDNA I n s e r t o f pRIa.2. CAG GLN CCC PRO AAC ASN ACC THR 1 6 CTC LEU ATC I L E X TGC CYS TTT PHE GTA VAL 3 1 GAC ASP AAC ASN ATC I L E TTT PHE CCT PRO 4 6 CCT PRO GTG VAL ATC I L E 0 AAT ASN ATC I L E 6 1 ACA THR • TGG TRP TTG LEU AGA ARG AAC ASN 7 6 AGC SER AAG LYS CCA PRO GTC VAL ACA THR 9 1 GAA GLU GGC GLY GTT VAL TAT TYR GAG GLU 1 0 6 ACC THR AGC SER TTC PHE CTT LEU TCC SER 1 2 1 AAC ASN CCT PRO GAC ASP CAT HIS TCC SER 1 3 6 TTC PHE CAC HIS AAG LYS ATG MET GCT ALA 1 5 1 TAC TYR CTC LEU ACC THR TTC PHE ATC ILE 1 6 6 CCT PRO TCC SER AAC ASN GAC ASP GAC ASP 1 8 1 ATT I L E TAT TYR GAC ASP X TGC CYS AAG LYS 1 9 6 GTG VAL GAG GLU CAC HIS TGG TRP GGC GLY 2 1 1 CTG LEU GAC ASP GAG GLU CCG PRO GTT VAL 2 2 6 CTA LEU AAA LYS CAC H I S TGG TRP GAA GLU 2 4 1 CCT PRO GAG GLU GTT VAL CCA PRO GCC ALA 2 5 6 CCC PRO ATG MET TCA SER GAG GLU CTG LEU 2 7 1 ACA THR GAG GLU ACT THR GTG VAL GTC VAL 2 8 6 TGT CYS GCC ALA CTG LEU GGG GLY TTG LEU 3 0 1 TCT SER GTG VAL GGC GLY CTC LEU GTG VAL 3 1 6 GGC GLY ATC I L E GTG VAL GTG VAL GGC GLY 3 3 1 ACC THR ATC I L E TTC PHE ATC ILE ATT ILE 3 4 6 CAA GLN GGC GLY CTG LEU CGA ARG TCA SER 3 6 1 GAT ASP GGC GLY CCC PRO TCC SER •> AGA ARG 3 7 6 CAC HIS CCA PRO GGG GLY CCC PRO CTT LEU 3 9 1 TGA The p r e d i c t e d amino a c i d s e q u e n c e o f t h e cDNA i n s e r t o f pRIa.2 i s shown. T r a n s l a t i o n s t a r t s a t t h e s e c o n d n u c l e o t i d e a f t e r t h e G t a i l . The numbers c o r r e s p o n d t o t h e n u c l e o t i d e n u m b e r i n g o f F i g u r e 4. C y s t e i n e r e s i d u e s w h i c h may be i n v o l v e d i n d i s u l p h i d e b o n d i n g a r e m a r k e d ( X ) . The p u t a t i v e g l y c o s y l a t i o n s i t e i s m a r k e d ( 0 ) . 50 (b) The Amino Acid Sequence Predicted From The  cDNA Insert Of pRIa.2 Compared With The Corresponding  Mouse H-2 I-A And Human HLA-DC1  a Chain Sequences A comparison of the amino acid sequences predicted from cDNA corresponding to the rat Ia-A, mouse H-2 I-A and human HLA-DC1 a chains is shown in Figure 6. The data from Figure 6 is summarised in Table III. The overall sequence identity for the regions of the a chains available for comparison is 90.7% when rat Ia-A and mouse H-2 I-A a chains are compared. The overall sequence identity drops to 81.4%, however, when rat Ia-A (or mouse H-2 I-A) are compared to the humayn HLA-DC 1 g chain. Not surprisingly, the rat and mouse proteins are more similar to one another then either is to the human protein. It is interesting that both rodent g chains differ to the same extent when compared to the human a chain, even though both rodent proteins have diverged from one another. 51 The amino acid sequences for the equivalent regions of the rat Ia-A a, mouse H-2 I-A a (Benoist et al.,1983) and human HLA-DC1 a (Auffray et al.,1982) are "compared. The Ig-like conserved residues are marked with a cross (+), and the MHC conserved residues by an open c i r c l e (O). The numbers below the lines refer to the numbering of the human HLA-DC1 a chain (Auffray et al.,1982). The amino acids defining the borders of the protein domains are also numbered. 52 Figure 6 Comparison of the Amino Acid Sequences of the a Chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1. • • • • H - 2 I - A : G L N P R O A S N T H R L E U I L E C Y S P H E V A L A S P A S N I L E P H E P R O P R O R A T I a - A ; G L N P R O A S N T H R L E U I L E C Y S P H E V A L A S P A S N I L E P H E P R O P R O • • • • • • a • • • • • • • H L A - D C 1 : G L N P R O A S N T H R L E U I L E C Y S L E U V A L A S P A S N I L E P H E P R O P R O 1 0 4 1 1 8 • H - 2 I - A V A L I L E A S N I L E T H R T R P L E U A R G A S N S E R L Y S S E R V A L T H R A S P R A T I a - A : V A L I L E A S N I L E T H R T R P L E U A R G A S N S E R L Y S P R O V A L T H R G L U • • • • • • • H L A - D C 1 : V A L V A L A S N I L E T H R T R P L E U S E R A S N G L Y H I S S E R V A L T H R G L U ' 1 3 3 • O H - 2 I - A : G L Y V A L T Y R G L U T H R S E R P H E P H E V A L A S N A R C A S P T Y R S E R P H E • • • • • • • • • • • R A T I a - A : G L Y V A L T Y R G L U T H R S E R P H E L E U S E R A S N P R O A S P H I S S E R P H E • • • • • • H L A - D C 1 : G L Y V A L S E R G L U T H R S E R P H E L E U S E R L Y S S E R A S P H I S S E R P H E 1 4 8 • 0 H - 2 I - A : H I S L Y S L E U S E R T Y R L E U T H R P H E I L E P R O S E R A S P A S P A S P I L E • • .. • • • • • • • • • • R A T I a - A : H I S L Y S M E T A L A T Y R L E U T H R P H E I L E P R O S E R A S N A S P A S P I L E • • • • • • • H L A - D C 1 : P H E L Y S I L E S E R T Y R L E U T H R P H E L E U P R O S E R A L A A S P G L U I L E 1 G 3 • • • . • . • . . • H - 2 I - A : T Y R A S P C Y S L Y S V A L G L U H I S T R P G L Y L E U G L U C L U P R O V A L L E U • • • • • • • • • • • • R A T I a - A : T Y R A S P C Y S L Y S V A L G L U H I S T R P G L Y L E U A S P C L U P R O V A L L E U H L A - D C 1 : T Y R A S P C Y S L Y S V A L G L U H I S T R P C L Y L E U A S P C L U P R O L E U L E U 178 O H - 2 I - A : L Y S H I S T R P G L U P R O G L U I L E P R O A L A P R O M E T S E R G L U L E U T H R R A T I a - A : L Y S H I S T R P G L U P R O G L U V A L P R O A L A P R O M E T S E R G L U L E U T H R • • • • • • • • • • • • • H L A - D C 1 t _ • L Y S H I S T R P G L U P R O G L U I L E P R O T H R P R O M E T S E R G L U L E U T H R 1 8 1 1 8 2 1 9 3 H - 2 I - A : G L U T H R V A L V A L C Y S A L A L E U G L Y L E U S E R V A L G L Y L E U V A L G L Y R A T I a - A : G L U T H R V A L V A L C Y S A L A L E U G L Y L E U S E R V A L G L Y L E U V A L G L Y H L A - D C 1 : G L U T H R V A L V A L C Y S A L A L E U G L Y L E U S E R V A L C L Y L E U V A L G L Y 1 9 4 1 9 5 2 0 8 H - 2 I - A : I L E V A L V A L G L Y T H R I L E P H E I L E I L E G L N G L Y L E U A R G S E R G L Y R A T I a - A : I L E V A L V A L G L Y T H R I L E P H E I L E I L E G L N C L Y L E U A R G S E R A S P • • • • • • • • • • > • H L A - D C 1 : I L E V A L V A L G L Y T H R V A L L E U I L E I L E A R G G L Y L E U A R G S E R V A L 2 1 7 2 1 8 2 2 3 H - 2 I - A : R A T I o - A : H L A - D C 1 53 Table III Comparison of the sequence identity between  the a chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1. RAT Ia-A /MOUSE H-2 I-A RAT Ia-A /HUMAN HLA-DC 1 MOUSE H-2/HUMAN I -A HLA-DC1 DOMAIN % SEOUENCE IDENTITY NUMBER OF AMINO ACIDS COMPARED % SEOUENCE IDENTITY NUMBER OF AMINO ACIDS COMPARED % SEOUENCE IDENTITY NUMBER OF AMINO ACIDS COMPARED 2 (104-181 88. 5% 69/78 79.5% 62/78 78.2% 61/78 CP • (182-194 92.3% 12/13 84.6% 11/13 92.3% 12/13 TM (195-217! 1O0% 23/23 91.3% 21/23 91.3% 21/23 CYT (218-232) 86.7% 13/15 73.3% 11/15 73.3% 11/15 OVERALL 90.7% 117/129 81.4% 105/129 81.4% 105/129 References are the same as for Figure 6. 54 Although the overall homology, in terms of sequence identity, between these proteins is high there are quite different levels of homology for the different domains. In Table III the sequence is divided into domains or regions of structural difference and the percent sequence identity of the rat a chain is compared to the mouse and human a chains. Although the homology between rat and mouse is higher than that between rat and human, those domains showing the least conservation between mouse and rat are the same domains with the least homology between human and rat. The different functional regions are discussed in detail below. The Cytoplasmic Tail The least conserved region is the cytoplasmic t a i l . The homology between mouse and rat is 86.7% for this region and between human and rat is 73.3%. The cytoplasmic t a i l is 15 amino acids in length and is approximately '50% hydrophilic in nature. This region is thought to be important in anchoring the protein in the membrane. There are 3 basic residues within the cytoplasmic t a i l . It is thought that the presence of such residues may act to stabilize the protein in the membrane. This may occur by interactions between negatively charged phosphate groups of the membrane phospholipids and the positively charged basic amino acids (Bretscher, 1975). Clusters of basic amino acids have been found in the cytoplasmic t a i l s of glycophorin (Tomita et.el., 1978), HLA-A2 and HLA-B7 (Robb et a l . , 1978) and membrane IgM (Rogers et a l . , 1980). The presence of proline residues also appears to be a characteristic of cytoplasmic regions of some proteins. In 55 glycophorin there are 5 proline residues in the 24 amino acid cytoplasmic t a i l (Tomita et a l . , 1978). In the rat Ia-A a chain cytoplasmic t a i l there are 3 prolines. Proline residues are, however, not characteristic of human HLA heavy chain cytoplasmic regions (Robb et a l . , 1978). There is some evidence that the Ia antigens may be phosphorylated at a serine residue within the cytoplasmic t a i l (Korman et al.,1982a ). There are two serine residues in the rat Ia-A a chain and both are adjacent to arginine residues. The cAMP-dependent protein kinase which may catalyse the phosphorylation reaction requires that the arginine be on the amino-terminal side of the serine (Kemp et a l . , 1977). Therefore, only the serine at amino acid 222 would be available for phosphorylation. It is thought that another function of the cytoplasmic t a i l is to provide a means of communicating information from outside the c e l l to the cytoplasm. The exact nature of the mechanism by which this communication occurs is not known but i t may be that the cytoplasmic t a i l interacts with molecules in the cytoplasm which then travel to the nucleus. If this was so then i t might be expected that the cytoplasmic regions would be highly conserved within and between species. It is surprising then, to find that the cytoplasmic region is the least conserved region of the molecules over the regions compared. The hydrophilic nature of this region is conserved and the presence of the adjacent arginine-serine residues is notable but there are marked differences. Perhaps this indicates that these Ia a chain molecules do not communicate by interaction with cytoplasmic molecules after a l l . Alternatively, the residues which are 56 important for these interactions are conserved and the only constraint on the other residues is that they retain their hydrophilic nature. It is interesting that comparison of the cytoplasmic regions of the murine, H-2 I-A a and H-2 I-E a chains shows only 47% sequence identity and the human, HLA-DC1 a and HLA-DR a chains show only 45% sequence identity. One interpretation of this is that i f the I-A and I-E (DC 1 and DR) a chains interact with molecules within the cytoplasm that they may interact with different molecules. It appears therfore, that the cytoplasmic t a i l s of Ia products of closely related loci within a species are less homologous than Ia products of equivalent loci in different species. The Transmembrane Region The transmembrane region of proteins which span the membrane is thought to be characterized by the presence of a mainly hydrophobic stretch of amino acids long enough to and capable of taking on an a-helical structure which will stretch across the membrane. The 23 amino acid transmembrane regions of the three a chains compared appear to have these characteristics. If this were the only function of a transmembrane region, however, i t may be expected that there would be a low degree of sequence conservation as long as the general hydrophobic nature of the region was maintained. Therefore i t is surprising to find that this region exhibits not the lowest but the highest degree of sequence identity of a l l the regions compared. Between rat and mouse there is 100% sequence identity and between rat and human a .91.3% sequence identity is observed. This unexpected degree of conservation seems to indicate that there must be a functional constraint 57 maintaining the sequence and selecting against any nucleotide changes which would result in an amino acid change in this region. When the transmembrane regions of two different murine Class I antigens of the same haplotype, H-2Kb and H-2Db, were compared they showed a protein sequence identity of 75% whereas overall the protein sequences showed a higher identity of 83% (Reyes et al.,1982). A comparison of Class I antigens from equivalent loci of different species, the murine H-2Kb and the human HLA-B7, showed an even more striking disparity between the protein identities of the extracellular domains, 70%, and the transmembrane regions, 30% (Coligan et al.,1981). The high degree of sequence identity between the transmembrane regions of the a chains described seems unusual and may suggest that these proteins are involved in a quaternary interaction with other membrane proteins (Korman et a l . ,1982b). It has been proposed (Benoist et.el., 1983) that the a and (1 chains interact within the membrane. This would explain the unexpected sequence constraint on this region and is further supported by data from the murine H-2 I-E a and human HLA-DR a chain sequences which also have similar transmembrane region sequences (Benoist et a l . , 1983, Auffray et a l . , 1982). In Table IV the transmembrane regions of Ia a chains of different species are compared. It is also of interest to note the presence of a cysteine residue within the transmembrane region of a l l three a chains. There is evidence to suggest that this may be a site for post-translational modification (Kaufman and Strominger, 1979 ); 58 Table IV Comparison of the Amino Acid Sequences of the  Transmembrane Regions of the Ia a Chains  of Different Species HLA -DR : ASN--VAL- VAL -CYS -ALA--LEU- GLY- LEU- THR- VAL- GLY- LEU HLA--DC1 : THR- VAL- VAL -CYS -ALA--LEU- GLY- LEU- SER- VAL- GLY- LEU H-2 I-E : ASN--VAL- VAL -CYS -ALA--LEU- GLY- LEU- PHE- VAL- GLY- LEU H-2 I-A : THR- -VAL- VAL -CYS -ALA-•LEU-GLY- LEU- SER- VAL- GLY- LEU Rat Ia-A : THR- -VAL- VAL -CYS -ALA-•LEU-GLY- LEU- SER- VAL- GLY- LEU HLA--DR : VAL- GLY- ILE -ILE -ILE-GLY- THR- ILE- PHE- ILE- ILE HLA--DC 1 : VAL- GLY- ILE -VAL -VAL- GLY- THR- VAL- LEU- ILE- ILE H-2 I-E : VAL- GLY- ILE--VAL--VAL- GLY- ILE- ILE-LEU- ILE-MET H-2 I-A : VAL- GLY- ILE--VAL--VAL- GLY- THR- ILE-PHE- ILE- ILE RAT Ia-A : VAL- GLY- ILE--VAL--VAL- GLY- THR- ILE-PHE- ILE- ILE Data from Lee et al.,1982a (HLA-DR), Auffray et al.,1982 (HLA-DC1) and Benoist et al.,1983 (H-2 I-A and I-E). 59 The Connecting Peptide The 13 amino acids between the a2 domain and the transmembrane region define the connecting peptide. The connecting peptide is less conserved than the transmembrane region and only slightly more conserved than the cytoplasmic region. There is 92.3% homology between rat and mouse and 84.6% homology between rat and human sequences. The high degree of homology between the transmembrane regions of the rat, mouse and human a chains is especially notable because of the much less conserved nature of the cytoplasmic t a i l and the connecting peptide. If the gene organization of the Ia-A a chain is the same as that of the human HLA-DR a chain gene then a l l three regions would be encoded by the same exon. It appears that only the transmembrane region is s t r i c t l y conserved and that the two regions surrounding i t are more free to diverge. One explanation is that the HLA-DR a chain gene organization is not the same as the gene organization of the HLA-DC1, mouse H-2 I-A and rat Ia-A a chain genes at least for the exon(s) coding for the connecting peptide, transmembrane and cytoplasmic regions. The extracellular domain (a2) The 91 amino acids of the a.2 domain are 88.5% homologous between rat Ia-A a and mouse H-2 I-A a and 79.5% homologous between rat Ia-A a and human HLA-DC1 a. The Ia molecules are glycoproteins and there is a potential glycosylation site at the asparagine residue at position 121, approximately 70 amino acids from the transmembrane portion of the protein. The sequence at this point asparagine-isoleucine-threonine (Asn-Ile-Thr) conforms to the consensus sequence for carbohydrate attachment, Asn-X-(Thr or Ser) (Spiro, 1974; Wagh 60 and Bahl, 1981). There are two cysteine residues which may form a disulphide loop within the a2 domain. Homology to Immunoglobulin (Ig) Domains Several immune system molecules such as /^microglobulin, and the Class I antigen heavy chains have been shown to contain amino acid sequences which are homologous to the amino acid sequences of the constant region domains of the immunoglobulin (Ig) molecules. Analysis of the amino acid sequence predicted from the cDNA insert of pRIa.2 shows that i t too exhibits homology to the sequences of the Ig constant region domains. The f i r s t studies on Ig molecules showed that they were four chain structures (two light chains and two heavy chains) (Porter, 1962). Characterization of immunoglobulin molecules by amino acid sequence analysis indicated that the immunoglobulin molecules could be divided into a series of globular domains (Edelman et.el., 1969,1970). This was further supported by X-ray crystallographic experiments (Poljak et a l . , 1973). There are several features which characterize immunoglobulin domains, notably a disulphide loop of approximately 55-65 amino acids and several typically conserved amino acids which are thought to be involved in maintenance of the three-dimensional structure of these domains. When the amino acid sequences of immunoglobulin domains are aligned, these Ig-conserved residues are found at the same positions. In Figure 6 the majority of the al domain sequences (amino acids 104-181) of rat Ia-A, mouse H-2 I-A, and human HLA-DC1 a chains are compared. There are 13 amino acids within each a2 61 domain which are characteristic of Ig-conserved residues. The two cysteine residues thought to form a disulphide loop are included in these Ig-conserved residues. There are a few Ig-conserved residues in the middle of the putative loop structure but the majority are clustered around the two cysteine residues. As well as the 13 Ig-conserved residues there are three residues which are found in the Ig-like domains of a l l MHC encoded molecules which have been compared. These MHC-conserved residues may play an important role in some MHC specific function of this domain. Despite differences in amino acid sequence between the constant region domains, X-ray crystallographic experiments indicated that the different constant regions a l l have a similar structure (Amzel and Poljak,1979). The similarity in amino acid sequence of these domains argued that they represented a similar pattern of tertiary folding (Beale and Feinstein, 1976). A typical constant region domain structure defined from X-ray crystallographic techniques is shown in Figure 7. 62 Figure 7 Diagram of an Immunoglobulin Constant Region Domain Diagram showing the basic immunoglobulin fold of an immunoglobulin constant region (Poljak et al.,1973). 63 The constant region domain consists of 2 faces , the x face (fx) and the y face (fy). There are stretches of (3-pleated sheet within each face and most of the amino acid homologies between constant region domains are within the /3-pleated sheets. Connecting the /3-pleated sheets are non-/3-pleated segments or bends; within the bends homology between constant region domains is lowest. The bends and /3-pleated segments are indicated in Figure 8. There is a characteristic pattern of alternating hydrophobic and hydrophilic amino acids around the cysteine residues of constant region domains. The side chains of these hydrophobic amino acids f i l l the internal spaces between the x and y faces of the constant region domains. The Ig-conserved residues which are clustered around the cysteines of the a2 domains of the Ia a chains conform to the pattern of alternating hydrophobic residues. For example in most constant region domains the sequence of Tyr (or Phe) -X-Cys-X-Val-X-His is highly, conserved in the second stretch of /3 pleated sheet of the y face (fy2) (Beale and Feinstein, 1976). This sequence is found in Ia molecules as. shown in Figure 8. 64 Figure 8 Comparison of the Amino Acid Sequences of Iq-Like Domains Rat Ia-A 0 P N T L I C F V D N I F P H-2 I-A : E A P 0 A - T V F P K S P V L L G 0 P N T L I C F V D N I F P H-2 I - E : V A P E V - T V L S R S P V N L G E P N I L I C F I D K F S P HLA -DC1 : V P P E V - T V L T N S P V E L R E D N I L I c F I D K F S P HLA -DR : E V P E V - T V F S K S P V T L G 0 P N V L I c F I D K F T P HLA -B7 : A D P P K - T H V T H H P I S D H E A T - L R c W A L G F Y P /J2M : R T P K I - 0 V Y S R H P A E N G K S N F L N c Y V S G F H P CH3 : R E P 0 V Y T L P P S R E E M T K N 0 V S L T c L V K G F Y P f x1 b1 f x2 Rat Ia-A P V I N I T w L R N S K P V T E G V Y E T S F L s N P D H H-2 I-A P V I N I T w L R N - S K S V T D G V Y E T S F F V N R - D Y H-2 I-E P V V N V T w L R N - G R P V T E G V S E T V F L p R D - D H HLA- -DC1 P V V N I T w L S N - G H S V T E G V S E T s F L s K S - D H HLA- -DR P V V N V T w L R N - G K P V T T G V S E T V F L p R E - D H HLA- B7 A E I T L T w 0 R - D G - E 0 0 T 0 D T E L V E T R P A G D R /32M S D I E V D L L K - D G - E R - I E K V E H s D L S F S K 0 W CH3 s D I A V E w E S N D G - E - - P E N Y K T T P P V L D S D G b2 f y l b3 f x 3 Rat Ia-A : S F H K M A Y L T F I P S N - D D I Y D C K V E H w G L D H-2 I-A S F H K L S Y L T F I, P S D - - D D - I Y D C L V E H W G L E H-2 I - E L F R K F H Y L T P L P s T - - D 0 - F Y D C E V D H w G L E HLA- DC 1 : S F F K I S Y L T F L P s A - - D E - I Y D C K V E H w G L D HLA- DR : L F R K F H Y L P F L P s T - - E D - V Y D C R V E H w G L D HLA- B7 T F E K W A A V V V - P s - G - E E 0 R Y T C H V 0 H E G L P /32M S F Y L L Y Y T E F T P T - - - E K D E Y A C R V N H V T L S CH3 S F F L Y S K L T V D K s R W 0 E G N V F S C S V M H E A t H f x 4 b5 f y 2 bG Rat Ia-A : - E P V L K H W H-2 I-A • - E P V L K H W H-2 I-E - E P L R K H w HLA- DC 1 E P L L K H w HLA- DR - E P L L K H w HLA- B7 - K P L T L R w (32M Q P K I V K w CH3 N H Y T 0 K S L f y 3 The /3 pleated sheet segments of the x face (fx) and the y face (fy) are numbered as are the bends (b). Positions where spaces have been l e f t to give maximal alignment are denoted by a (-). References as for Table IV plus data from Orr et al.,1979 (HLA-B7), Peterson et a l . , 1972 (^microglobulin) and Edelman et al.,1969 (Ig constant region domain, CH3) 65 /^microglobulin, the Class I antigen light chain, is 100 amino acids in length and contains a 57 residue disulphide loop (Peterson et al.,1972; Cunningham et al.,1973). When~the amino acid sequence of /^microglobulin was compared to Ig sequences a high degree of homology was found. The highest degree of sequence identity was observed when /^microglobulin was compared to the CH3 domain. Because of its homology to immunoglobulin constant region domains /^microglobulin was termed a "free" immunoglobulin domain.(Peterson et a l . , 1972). Sequence•analysis of the Class I antigen heavy chains, showed that two of the three extracellular domains contained disulphide loop structures of the same size as the characteristic Ig domain disulphide loop . Comparison of the heavy chain sequences of human Class I antigens (HLA-A and B) with immunoglobulin constant region domains and /^microglobulin showed that only the Class I antigen extracellular disulphide loop adjacent to the membrane exhibited homology to immunoglobulins and /^microglobulin (Tragardh et a l . , 1978; Orr et a l . , 1979b; Wiman et a l . , 1979). This so-called immunoglobulin-like (Ig-like) domain of the Class I antigens (a.3) was shown to be as homologous to 0 2microglobulin and constant immunoglobulin domains as /^microglobulin and immunoglobulin constant region domains were to one another. From this data the proposal was made that the immunoglobulins, /^microglobulin, and the Class I antigen heavy chains had a related evolution and that the Class I antigens may have arisen by a gene duplication involving the same ancestral gene as that which gave rise to immunoglobulin chains (Wiman et a l . , 1979). 66 The rat Thy-I glycoprotein is a major c e l l surface molecule which is found on thymocytes, neuronal and some other c e l l types. The amino acid sequence of Thy-I was determined by Campbell et al.(!98l). Thy-I was shown to be 111 amino acids in length and to contain 4 cysteine residues which defined a single disulphide loop. This disulphide loop was shown to be homologous to immunoglobulin domains but unlike the Class I antigen heavy chains and /^microglobulin, Thy-I was more homologous to the variable region domains (Cohen et al.,1981; Williams and Gagnon, 1982). Comparison of a human Ia antigen /3 chain sequence (Larhammar et al.,1981,1982a) with the other Ig-like domains previously identified showed that the /33 domain (the domain adjacent to the membrane) was also an Ig-like domain. The human HLA-DR a chain was also shown to contain an extracellular Ig-like domain adjacent to the membrane, the al domain (Larhammar et a l . , 1982b). The a.2 domains of both mouse H-2 I-A and human HLA-DC1 a chains were also shown to be homologous . to /^microglobulin, Class I a3 domains and immunoglobulin constant region domains. In Table V the Ig-like domains of several different immune system molecules are compared. 6 7 Table V Percent Sequence Identity Between Iq-Like  Domains of Di f f e r e n t Immune System Molecules RAT Ia-Aa MOUSE H-2 I-Aa MOUSE H-2 I-Ea HUMAN HLA-DC 1 a HUMAN HLA-DR a HUMAN 02MICRO-HLA-A, GLOBULIN "B,-C MOUSE H-2 I-Aa 89 -MOUSE H-2 I-Ea 67 60 -HUMAN HLA-DC1 a 80 67 70 -HUMAN"HLA-DR a 68 65 80 65 -HUMAN HLA-A,-B, -C 29 27 32 31 31 -/32MICROCLOBULIN 32 29 29 32 29 25 CH3 24 26 22 24 23 28 28 References as for Figure 8. 68 The finding that the Ia and Class I antigens, as well as /^microglobulin and Thy-1 are homologous to immunoglobulin domains led to the proposal of an immunoglobulin superfamily. Implicit in this proposal, is the hypothesis that a l l the molecules within the family originated from a single ancestral gene which would be equivalent to a single exon at the DNA level or a single domain at the protein level. The immunoglobulin constant domains to which the Class I antigen heavy chains, the Ia antigens and ^microglobulin had been likened, always occurred in pairwise combination. It was suggested, therefore, that the Class I heavy chain and ]3 2microglobulin and the Ia a and /J chains associate in a manner similar to that of the immunoglobulin constant region domains (Steinmetz et a l . , 1981b; Larhammar et a l . , 1982b). The proposed structures for the Class I and Ia antigens are diagrammed in Figure 9 along with the structure of a membrane immunoglobulin molecule. 69 Figure 9 Schematic Representations of Some Members of the Immunoglobulin Superfamily IgM MHC Antigens Class I V-domains C l « i » I( (la) fi OC * - t . A j j o / ^ " ^ N C - D O M A I N S Kr\M ki&* ^> ii j j ju i i j i i i i i i i i / 1 - -TTTT" 1 1 1 1 Membrane t o o - " » » » -Cytoplasm The immunoglobulin-related molecules Thy -1 , MHC Class I and Ia antigens are shown diagramatically along with a membrane IgM molecule. The drawings are approximately to scale. (Jensenius,J.C. and Williams,A.F.,1982). 70 III SEARCH FOR THE AMINO TERMINAL END OF THE RAT Ia~A a CHAIN In order to isolate a cDNA clone corresponding to the 5' end of mRNA encoding a rat Ia-A a chain, two cDNA libraries made from total spleen poly(A)-RNA (approximately 4000 independent transformants) were screened (see Materials and Methods). The cDNA insert of plasmid pRIa.2 was nick translated and used as a probe to screen for bacterial transformants containing rat Ia-A a chain sequences (see Materials and Methods). Fifteen clones which hybridized to the pRIa.2 cDNA insert were isolated. Restriction enzyme analysis indicated that there were only two independently arising clones. The clone with the larger insert (named pRIa.3) was amplified and plasmid DNA was prepared. The cDNA insert of the plasmid was approximately 800 base pairs in length and was bounded at either end by a PstI site. The restriction map of the cDNA insert of pRIa.3 indicated that i t might be the 5' end of a cDNA coding for the rat Ia-A a chain. The EcoR1 site, situated at position 570 of the cDNA insert in pRIa.2, was missing and since the inserts were approximately the same length this seemed to imply that the cDNA insert of pRIa.3 would extend at least another 200 nucleotides 5' to that of the cDNA insert of pRIa.2. This extra 200 nucleotides of coding region could code for another 70 amino acids and would, therefore, extend well into the a1 domain of the rat Ia-A a chain. The cDNA insert was isolated as described (see Materials and Methods) and the cDNA was partially sequenced 71 a c c o r d i n g t o t h e methods o f Maxam a n d G i l b e r t ( s e e M a t e r i a l s a n d M e t h o d s ) . The p a r t i a l s e q u e n c e o f t h e cDNA i n s e r t o f p R I a . 3 A p p r o x i m a t e l y one h a l f o f t h e s e q u e n c e o f t h e cDNA i n s e r t o f p R I a . 3 was d e t e r m i n e d a nd was c o m p a r e d t o t h e s e q u e n c e o f t h e p R I a . 2 cDNA i n s e r t t o i d e n t i f y a ny r e g i o n s o f h o m o l o g y . The c o m p a r i s o n i s shown i n F i g u r e 10. A l t h o u g h t h e p a r t i a l r e s t r i c t i o n map i n d i c a t e d t h a t t h e p R I a . 3 cDNA i n s e r t m i g h t c o n t a i n DNA s e q u e n c e s c o r r e s p o n d i n g t o t h e 5' e n d o f t h e p r o t e i n , c o m p a r i s o n o f t h e DNA s e q u e n c e s o f t h e cDNA i n s e r t s o f p R I a . 2 a n d p R I a . 3 showed t h a t t h i s was n o t t h e c a s e . I n s t e a d o f t h e e x p e c t e d 5' s e q u e n c e s , t h e cDNA i n s e r t o f p R I a . 3 a p p e a r e d t o c o n t a i n a d i f f e r e n t 3 ' u n t r a n s l a t e d r e g i o n , 600 n u c l e o t i d e s i n l e n g t h . The 5' end o f t h e cDNA i n s e r t o f p R I a . 3 was h o m o l o g o u s t o t h e open r e a d i n g f r a m e o f t h e cDNA i n s e r t o f p R I a . 2 . T h i s h o m o l o g y i n i t i a t e d a t n u c l e o t i d e 252 o f t h e p R I a . 2 i n s e r t s e q u e n c e a nd e x t e n d e d i n t o t h e 3' u n t r a n s l a t e d r e g i o n . The f i r s t 198 n u c l e o t i d e s o f t h e p R I a . 3 i n s e r t were n e a r l y i d e n t i c a l t o t h e s e q u e n c e o f t h e p R I a . 2 i n s e r t . A t n u c l e o t i d e 451 o f t h e p R I a . 2 i n s e r t s e q u e n c e , h o w e v e r , t h e s e q u e n c e s o f t h e two i n s e r t s became t o t a l l y d i f f e r e n t . The p R I a . 3 i n s e r t s e q u e n c e e x t e n d s a p p r o x i m a t e l y a n o t h e r 550 n u c l e o t i d e s f r o m t h i s p o i n t i n t h e p r e s u m e d 3' d i r e c t i o n a n d i s e n t i r e l y d i f f e r e n t i n s e q u e n c e f r o m t h e r e m a i n i n g 130 n u c l e o t i d e s o f t h e 3' u n t r a n s l a t e d r e g i o n o f p R I a . 2 . 72 Figure 10 Alignment of the Partial Nucleotide Sequence  of the cDNA insert of pRIa.3 with the Sequence  of the cDNA insert of pRIa.2 pRIa.2 (G)^TCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGATCAATA pRIa.2 TCACATGGTTGAGAAACAGCAAGCCAGTCACAGAAGGCGTTTATGAGACCAGCTTCCTTT pRIa.2 CCAACCCTGACCATTCCTTCCACAAGATGGCTTACCTCACCTTCATCCCTTCCAACGACG pRIa.2 ACATTTATGACTGCAAGGTGGAGCACTGGGGCCTGGACGAGCCGGTTCTAAAACACTGGG pRIa.2 AACCTGAGGTTCCAGCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTGTGCCCTGGGGT ******************** * ********************** pRIa.3 GGGGGGGGGGTTC--CCCCCATGTCAGAGCTGACAAAAACTGTGGTCTGTGCCCTGGGGT pRIa.2 TGTCTGTGGGCCTCGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCCTGCGAT * *.* ********************************** pRIa.3 TGTCTGTGGGCCTCGTGGGCATCGTGGTGGGCACCAT pRIa.2 CAGATGGCCCCTCCAGACACCCAGGGCCCCTTTGAGTCACACCCTGGGAAAGAAGGTGCG **************************************** pRIa.3 CCAGGGCCCCTTTGAGTCACACCCTGGGAAAGAAGGTGCG 4 pRIa.2 TGGCCCTCTACAGGCAAGATGTAGTGTGAGGGGTGACCTGGCACAGTGTGTTTTCTGCCC ************** ******************* pRIa.3 TGGCCCTCTACAGGGAAGATGTAGTGTGAGGGGTTAACACTGTCAGCAGTGCATTGTCAT pRIa.2 CAATTCATCGTGTTCTTTCTCTTCTCCTGGTGTCTCCCATCTTGCTCTTCCCTTGGCCCC pRIa.3 GTTCTCTGTAGTAGTTGTAAGAACAGGTATTTTAGGTAGGAGAGTTTTGGGGGGTTTTTT pRIa.2 CAGGCTGTCCACCTCATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATT pRIa.3 —AGCCATTAAGACTATCATACTCTA TCCTTCAT-ATTAAT-TTTCTAAC-ACT-p R I a . 2 TTTGGCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTGATGCTCCACCA p R I a . 3 -T-T—TTCAAAATGTAACTTTAAAGTGGAGTAACGAGACT--AAACAG-CGAACAAGAC p R I a . 2 AACCAATAAACCTCTCATAAGTTGG(A )_ (C) n n p R I a . 3 CAAAATTGAGTAAAAGGGACTCGAGA GATCTTTCATTGTACGTCTCGTCCGG The arrow indicates a possible splice site (see text). 73 The presumed 3' end of the cDNA insert of pRIa.3 has not been sequenced, but due to the method of synthesis of the cDNA there should be a poly(A) t a i l at the 3* end. If this is true and the cDNA insert of pRIa.3 represents a functional mRNA and not a cloning artifact, then the 3' untranslated region of this mRNA is approximately 600 nucleotides in length. The unusual properties of the cDNA insert of pRIa.3 are puzzling. If i t is assumed that this cDNA represents a functional mRNA which can be translated into the rat Ia-A a protein, then i t seems surprising that there should be two mRNA species differing only in their 3' untranslated regions which code for the same protein. There are many possible explanations for this finding but i t is not possible to determine which i f any are correct from the data available. One explanation is that the mRNA from which the cDNA insert of pRIA.3 was derived was not completely processed i.e. i t s t i l l contained nucleotide sequences which corresponds to intron DNA. This would have been spliced out of the mRNA from which the cDNA insert of pRIa.2 was derived. The last two nucleotides of shared sequence identity between the two cDNA inserts are GT. It is possible that this corresponds to the 5' end of the presumed intron sequence. Although this correlates with the consensus sequence for intron borders (GT at the 5' end and AG at the 3' end; Lewin, 1980) to explain why this dinucleotide is also found in the sequence of the cDNA insert of pRIa.2 i t must be proposed that the dinucleotide GT also occurs at the 5' end of the following exon. This explanation is acceptable but i t is unclear why there would be an intron within the region of the DNA 74 corresponding to the 3' untranslated region of the mRNA. There are, however, several findings which would indicate that the 3' ends of some MHC encoded proteins have unusual properties. The gene organization of the human HLA-DR a gene is known (Lee et a l . , 1982b, Korman et a l . , 1982). The 3' untranslated region is encoded by two exons. Exon three contains the connecting peptide, the transmembrane region, the cytoplasmic t a i l and extends 10 nucleotides downstream of the TGA stop codon. Exon four contains the remainder of the 3' untranslated region. Analysis of other genes has indicated that the stop codon and the 3'untranslated regions are usually found within the same exon (Korman et a l . , 1982). For the human HLA-DR a chain gene this is not the case. One isolated cDNA for the human HLA-DR a chain (Lee et al . , 1982a) had 2 polyadenylation signals within the 3'untranslated sequence; one was 28 nucleotides upstream of the poly(A) t a i l and the other was 130 nucleotides upstream of the poly(A) t a i l . It appeared that both polyadenylation signals may be used. If the f i r s t polyadenylation signal were recognized and signalled the end of transcription the mRNA would have an approximately 300 nucleotide untranslated region. If the second polyadenylation signal were used, as was the case for the cDNA which was isolated, then the mRNA would have an approximately 400 nucleotide untranslated region. If the presence of two polyadenlyation signals is a characteristic of Ia a chains then perhaps this indicates that there is some requirement for mRNA's with different lengths of 3' untranslated sequences. The mRNA species with different 3'untranslated regions may be synthesised 75 in response to different conditions or requirements in the c e l l . The most likely explanation of the cDNA insert of pRIa.3 is that i t represents an incompletely processed mRNA. To further investigate the insert of pRIa.3 experiments such as isolation of genomic DNA corresponding to rat Ia-A a genes and characterisation of this DNA by sequence analysis are needed. 76 IV CONCLUSIONS The sequence of a cDNA corresponding to a rat Ia-A a chain and the amino acid sequence predicted from this cDNA were presented. The rat Ia-A a chain sequence shows significant homology to Ig constant region domains and to Ig-like domains of other immune system molecules. The Ia-A a chain appears to belong to the proposed immunoglobulin superfamily and has probably evolved from the same ancestral gene from which the other molecules of this superfamily are derived. Comparison of the rat Ia-A a chain sequence to sequences from the equivalent loci of mouse and human shows that a high degree of sequence identity exists across the species barrier. The level of homology observed between the Ia a chain sequences from different loci within any single species is significantly lower. This indicates that the two Ia l o c i , Ia-A and Ia-E, duplicated prior to the speciation of rats, mice and humans. 77 ACKNOWLEDGEMENT I would like to gratefully acknowledge the support and advice I received from Rob McMaster, Sarah Eccles and Heather Wallis. 78 REFERENCES Allison,J.P., Walker,L.E., Russell,W.A., Pellegrino,M.A., Ferrone,S., Reisfeld,R.A., Frelinger,J.A. and Silver,J.(1978) Murine Ia and Human DR Antigens: Homology of Amino-Terminal Sequences. Proc .Natl .Acad.Sci . USA 7_5 ,3953-3956. Amerding,D., Katz,D.H. and Benacerraf,B.(1974) Immune Response Genes in Inbred Rats. II Segregation Studies of the GT and GA Genes and Their Linkage to the MH Locus. Immunogenet. j_ ,340-351. Amzel,L.M. and Poljak,R.J. (1979) Three-Dimensional Structure of Immunoglobulins. Ann.Rev.Biochem. 4J3 ,961- 997. Auffray,C, Korman,A.J., Roux-Dosseto ,M. , Bono,R. and Strominger,J.L.(1982) cDNA Clone for the Heavy Chain of the Human B Cell Alloantigen DC1: Strong Sequence Homology to the HLA-DR Heavy Chain. Proc.Nat1.Acad.Sci. USA 79 ,6337-6341. Aviv,H. And Leder,P.(1972) Purification of Biologically Active Globin Messenger RNA by Chromatography on Oligothymidylic Acid-Cellulose. Proc.Nat.Acad.Sci. USA 69 , 1408-1412. Bach,F.H. And van Rood,J.J.(1976) The Major Histocompatibility Complex - Genetics and Biology. New Eng.J.Med. 295 , 806-813. Baxevanis,C.N., Wernet,D., Nagy,Z.A., Maurer,P.H. and Klein,J.(1980) Genetic Control of T-Cell Proliferative Responses to Poly (Glu* 0Ala 6 0) and Poly (Glu 5 1 Lys 3"Tyr 1 5): Subregion-Specific Inhibition of the Responses with Monoclonal Ia Antibodies. Immunogenteics jj_ , 617-628. Beale,D. and Feinstein,A.(1976) Structure and Function of the Constant Regions of Immunoglobulins. Quart.Rev.Biophys. 9 , 135-180. Benacerraf,B., Green,I. and Paul,W.E.(1967) The Immune Response of Guinea Pigs to Hapten-poly-L-Lysine Conjugates as an Example of the Genetic Control of the Recognition of Antigenicity. Cold Spring Harb. Quant.Symp. 3_2 ,569-575. Benoist,C.O., Mathis,D.J., Kanter,M.R., Williams II,V.E., and McDevitt,H.O. (1983) The Murine Ia a Chains, Ea and ha, Show a Surprising Degree of Sequence Homology. Proc.Natl.Acad.Sci. USA 80 ,534-538. Bolivar, F. and Backman,K.(1979) Plasmids of Escherichia c o l i as Cloning Vectors. Methods Enzymol. 68 ,245-280. Bono,M.R. and Strominger,J.L.(1982) Direct Evidence of Homology Between Human DC-1 Antigen and Murine I-A Molecules. Nature 299 , 836-838. 79 Bregegere,F. , Abastado,J.P., Kvist,S., Rask,L., Lalanne,J.L., Garoff,h., Cami,B., Wiman,K., Larhammar,D., Peterson,P.A., Gachelin,G., Kourilsky,P. and Dobberstein,B. (1981) Structure of C-Terminal Half of Two H-2 Antigens from Cloned mRNA. Nature 292 ,78-81 . Bretscher,M.S.(1975) C-Terminal Region of the Major Erythrocyte Sialoglycoprotein is on the Cytoplasmic Side of the Membrane. J.Mol.Biol. 98 , 831-833. Campbell,D.G., Gagnon,J., Reid,K.B.M. and Williams,A.F.(1981) Rat Brain Thy-1 Glycoprotein. Biochemical J. 195 , 15-30. Carlinfanti,E.(1948). The Predisposition for Immunity. J.Imm. 59 , 1-7. Chirgwin,J.M., Przybyla,A.E., McDonald,R.J. and Rutter,W.J.(1979) Isolation of Biologically Active Ribonucleic Acid From Sources Enriched in Ribonuclease. Biochem. j_8 ,5294-5299. Cohen,F.E., Novotny,J., Sternberg,M.J.E., Campbell,D.G. and Williams,A.F.(1981) Analysis of the Structural Similarities Between Brain Thy-1 Antigen and Immunoglobulin Domains. Biochemical J. 195 , 31-40. Coligan,J.E., Kindt,J.J., Uehara,H., Martinko,J. and Nathenson,S.G.(1981) Primary Structure of a Murine Transplantation Antigen. Nature 291 , 35-39 . Crick,F.(1981) Split Genes and RNA Processing. Science 204 , 264-271. Cullen,S.E., Freed,J.H., Atkinson,P.H. and NathensonjS.G., (1975) Evidence That Protein Determines Ia Antigenic Specificity. Transplant.Proc. 7 , 237-239. Cullen,S.E., David,C.S., Cone,J.L. and Sachs,D.H.(1976) Evidence for More Than One Ia Antigenic Specificity on Molecules Determined by the I-A Subregion of the Mouse Major Histocompatibility Complex. J.Imm. 116 ,549-553. Cunningham,B.A., Wang,J.L., Berggard,I. and Peterson,P.A.(1973) The Complete Amino Acid Sequence of ^ microglobulin. Biochem. j_2 , 4 8 1 1 - 4 8 2 2 . David,C.S., Shreffler,D.C. and Frelhinger,J.A.(1973) New Lymphocyte Antigen System (Lna) Controlled by the Ir Region of the Mouse H-2 Complex. Proc .Natl .Acad.Sci. USA 7_0 , 2 5 0 9 - 2 5 1 4 . Delaney,A.D.(1982) A DNA Sequence Handling Program. Nuc .Acid.Res. J_0 , 6 1 - 6 7 . 80 Denhardt,D.T.(1966) A Membrane-Filter Technique for the Detection of Complementary DNA. Biochem.Biophys.Res.Comm. 23 ,641-646. Dorf,M.E., Balner,H. -and Benacerraf,B.(1975a) Mapping of the Immune Response Genes in the MHC of the Rhesus Monkey. J.Exp.Med. J_42 ,673-693. Dorf,M.E. and Benacerraf,B.(1975b) Complementation of H-2 Linked Ir Genes in the Mouse. Proc.Nat.Acad.Sci. USA 72 ,3671-3675. Edelman,G.M., Cunningham,B.A., Gall,W.E., Gottlieb,P.D., Rutishauser,U. and Waxdal,M.J.(1969) The Covalent Structure of an Entire 7 G Immunoglobulin Molucle. Proc .Natl .Acad.Sci . USA 6_3 , 78-85. Edelman,G.M.(1970) The Covalent Structure of a Human 7 G -Immunoglobulin. XI Functional Implications. Biochem. 9 , 3197-3205. Ellman,L., Green,I., Martin,W.J. and Benacerraf,B.(1970) Linkage Between the Poly-L-Lysine Gene and the Locus Controlling Major Histocompatibility Antigens in Strain 2 Guinea Pigs. Proc.Nat.Acad.Sci. USA 66 ,322-328. Erb,P..and Feldmann,M.(1975) The Role of Macrophages in the Generation of T-Helper Cells. II The Genetic Control of the Macrophage-T-Cell Interaction for Helper Cell Induction with Soluble Antigens. J.Exp.Med. 142 ,460- 472. Ferreira,A., David,CS. and Nussenzweig,V.(1980) The Murine H-2.7 Specificity is an Antigenic Determinant of C4d, a Fragment of the Fourth Component of the Complement System. J.Exp.Med. 151 , 1424-1435. Goodenow,R.S., Stroynowski,I., McMillan,M., Nicolson,M., Eakle,K., Sher,B.T., Davidson,N. and Hood,L.(1983) Expression of Complete Transplantation Antigens by Mammalian Cells Transformed with Truncated Class I Genes. Nature 301 , 388-394. Gotze,D. The Major Histocompatibility System in Man and Animals Berlin:Springer-Verlag,1977. Goyert,S.M., Shively,J.E. and Silver,J.(1982) Biochemical Characterization of a Second Family of Human Ia Molecules, HLA-DS, Equivalent to Murine I-A Subregion Molecules. J.Exp.Med. 156 , 550-566. Grunstein,M. and Hogness,D.S. (1975) Colony Hybridization: a method for the isolation of cloned DNAs that contain a specific gene. Proc.Natl.Acad.Sci. USA 72 ,3961-3965 . 81 Hansen,T.H. and Levy,R.B.(1978) Alloantigens Determined by a Second D Region Locus E l i c i t a Strong IN VITRO Cytotoxic Response. J.Imm. J_20 , 1 8 3 6 - 1840 . Hauptfeld,V., Klein,D. and Klein,J . ( 1 9 7 3 ) Serological Identification of an Ir-Region Product. Science 181 , 1 6 7 - 1 6 9 . Huang,C. and Klein,J.(1980) Murine Antigen H-2.7: Localization of Its Antigenic Determinant of the Ss(C4) Molecule. Immunogenetics jj_ , 605-615. Ipsen,J.(1959) Differences in Primary and Secondary Immunizability of Inbred Mice Strains. J.Imm. 8_3 , 448-457. Jensenius,J.C. and Williams,A.F. (1982) The T Lymphocyte Antigen Receptor - Paradigm Lost. Nature 300 , 583-588. Jones,P.P., Murphy,D.B. and McDevitt,H.O.(1978) Two-Gene Control of the Expression of a Murine Ia Antigen. J.Exp.Med. 148 , 925-939. Jordan,B.R., Bregegere,F. and Kourilsky,P.(1981) Human HLA Gene Segment Isolated by Hybridization with Mouse H-2 cDNA Probes. Nature 290 , 521-523. Kappler,J.W. and Marrack,P.C.(1976) Helper T Cells Recognise Antigen and Macrophage Surface Components Simultaneously. Nature 262 , 797-799. Kappler,J.W., and Marrack,P.(1978) The Role of H-2 Linked Genes in Helper T-Cell Function. IV Importance of T-Cell Genotype and Host Environment in I-Region and Ir Gene Expression. J.Exp.Med. 148 ,1510-1522. Katz,D.H., Hamaoka,T. and Benacerraf,B.(1973) Cell Interactions Between Histocompatible T and B Lymphocytes. II Faiure of Physiological Cooperative Interactions Between T and B Lymphocytes from Allogeneic Donor Strains in Humoral Response to -Hapten-Protein Conjugates. J.Exp.Med. 137 ,1405- 1418. Kaufman,J.F. and Strominger,J.L.(1979) Both Chains of HLA-DR Bind to the Membrane with a Penultimate Hydrophobic Region and the Heavy Chain is Phosphorylated at i t s Hydrophilic Carboxyl Terminus. Proc .Natl .Acad.Sci . USA 76. / 6304-6308. Kemp,B.E., Graves,D.J., Benjamini,E. and Krebs,E.G.(1977) Role of Multiple Basic Residues in Determining the Substrate Specificity of Cyclic AMP-Dependent Protein Kinase. J.Biol.Chem. 252 , 4888-4894. Kindred,B. and ShreffIer,D.C.(1972) H-2 Dependence of Cooperation Between T and B Cells in vivo . J.Imm. 109 ,940-943. Klein,J.(1979) The Major Histocompatibility Complex of the Mouse. Science 203 , 516-521. 82 Klein,J., Juretic,A., Baxevanis,C.N. and Nagy,Z.A.(1981) The Traditional and a New Version of the Mouse H-2 Complex. Nature 291 , 455-460. Korman,A.J., Knudsen,P.J., Kaufman,J.F. and Strominger,J.L.(1982) cDNA Clones for the Heavy Chain of HLA-DR Antigens Obtained After Immunopurification of Polysomes by Monoclonal Antibody. Proc.Natl.Acad.Sci. USA 79 , 1844-1848. Korman,A.J., Auffray,C, Schamboeck,A. and Strominger,J,L.(1982) The Amino Acid Sequence and Gene Organization of the Heavy Chain of the HLA-DR Antigen: Homology to Immunoglobulins. Proc.Natl.Acad.Sci. USA 79 , 6013-6017. Kvist,S., Bregegere,F., Nask,L., Cami,B., Gavoff,H., Danniel,F., Wiman,K., Larhammar,D., Abastudo,J.P., Gachelian,G., Peterson,P.A., Dobberstein,B. and Kourilsky,P.(1981) cDNA Clone Coding for Part of a Mouse H-2d Major Histocompatibility Antigen. Proc .Natl .Acad.Sci . USA 7_8 , 2722-2776. Land,H., Grez,M., Hauser,H., Lindenmaier,N. and Schutz,G.(1981) 5'-Terminal Sequences of Eukaryotic mRNA Can be Cloned with High Efficiency. Nuc.Acid.Res. 9 ,2251-2266. Larhammar,D., Wiman,K., Schenning,L., Claesson,L., Gustafsson,K., Peterson,P.A. and Rask,L.(1981) Evolutionary Relationship Between HLA-DR Antigen 0 Chains, HLA-A,B,C Antigen Subunits and Immunoglobulin Chains. Scand.J.Imm. J_4 , 617-622. Larhammar,D., Schenning,L., Gustafsson,K., Wiman,K., Claesson,L., Rask,L., Peterson,P.A.(1982a) Complete Amino Acid Sequence of an HLA-DR Antigen-Like /3 Chain as Predicted From the Nucleotide Sequence: Similarities with Immunoglobulins and HLA-A,-B, and -C Antigens. Proc;Natl.Acad.Sci. USA 7_9 , 3687- 3691. Larhammar,D., Gustafsson,K., Claesson,L., B i l l , P . , Wiman,K., Schenning,L., Sundelin,J., Widmark,E., Peterson,P.A. and Rask,L.(1982b) Alpha Chain of HLA-DR Transplantation Antigens is a Member of the Same Protein Superfamily as the Immunoglobulins. Cell 30 , 153-161. Lee,J.S., Trowsdale,J. and Bodmer,W.F.(1982a) vDNA Clones Coding for the Heavy Chain of Human HLA-DR Antigen. Proc.Natl.Acad.Sci. USA 79 , 545-549. Lee,J.S., Trowsdale,J., Travers,P.J., Carey,J., Grosveld,F., Jenkins,J. and Bodmer,W.F.(1982b) Sequence of an HLA-DR a Chain cDNA. Clone and Intron- Exon Organization of the Corresponding Gene. Nature 299 , 750-752. Lerner,E.A., Matis,L.A., Janeway,C.A., Jones,P.P., Schwartz,R.H. and Murphy,D.B.(1980) Monoclonal Antibody against an Ir Gene Product. J.Exp.Med. 152 ,1085-1101. 83 Levine,B.B., Ojeda,A.and Benacerraf,B.(1963) Studies on A r t i f i c i a l Antigens. I l l The Genetic Control of the Immune Response to Hapten-Poly-L-Lysine Conjugates in Guinea Pigs. J.Exp.Med. JJ_8 , 953-957. Lewin,B.(1980) Alternatives for Splicing: Recognizing the Ends of Introns. Cell 22 ,324-326. Lipsky,P.E. and Rosenthal,A.S.(1973a) Macrophage-Lymphocyte Interaction. I Characteristics of the Antigen-Independent Binding of Guinea Pig Thymocytes and Lymphocytes to Syngeneic Macrophages. J.Exp.Med. 138 , 900-924. McDevitt,H.O. and Sela,M.(1965) Genetic Control of the Antibody Response. I Demonstration of Determinant-Specific Differences in Response to Synthetic Polypeptide Antigens in Two Strains of Inbred Mice. J.Exp.Med. 122 , 517-531. McDevitt,H.O. and Chinitz,A.(1969) Genetic Control of the Antibody Response: Relationship Between Immune Response and Histocompatibility (H-2) Type. Science,, 163 , 1207-1208. McDevitt.H.O., Deak,B.D., Shreffler,D.C., Klein,J., Stimpfling,J.H. and Snell,D.G.(1972) Genetic Control of the Immune Response: Mapping of the Ir-1 Locus. J.Exp.Med. 135 ,1259-1278. Maniatis,T., Jeffrey,A. and Kleid,D.G.(1975) Nucleotide Sequence of the Rightward Operator of Phage Lambda. Proc.Nat.Acad.Sci. USA 72 , 1184-1188. Martinko,J.M., Uehara,H., Ewenstein,B.M., Kindt,J.J., Coligan,J.E. and Nathanson, S.G.(1980) Primary Structure of Murine Major Histocompatibility Complex Alloantigens: Completion of the Sequence of the Amino-Terminal 284 Residues of H-2K Molecule. Biochemistry J_9 , 6182-6188. Maxam,A.M. and Gilbert,W.(1980) Sequencing End-Labelled DNA with Base-Specific Chemical Cleavages. Methods Enzymol. 6_5 , 499-559. Melgar,E. and Goldwaith,D.A.(1968) Deoxyribonucleic Acid Nucleases. II The Effect of Metals on the Mechanism of Action of Deoxyribonuclease I. J.Biol.Chem. 243 ,4409-4416. Mellor,A.L., Golden,L., Weiss,E., Bullman,H., Hurst,J., Simpson,E., James,R.F.L., Townsend,A.R.M., Taylor,P.M., Schmidt,W., Ferluga,J., Leben,L., Santamaria,M., Atfield,G., Festenstein,H. and Flavell,R.A. (1982) Expression of Murine H-2K Histocompatibility Antigen in Cells Transformed with Cloned H-2 Genes. Nature 298 , 529-534. Merryman,C.F. and Maurer,P.H.(1976) Genetic Control of Immune Response Against Random Copolymers of Glutamic Acid and Alanine (GA) and Tyrosine (GT) in Inbred Mice. J.Imm. 116 , 739-742. 84 Moore,K.W., Shev,B.T., Sun,V.H., Eakle,K.A. and Hood,L.(1982) Identification of a BALB/c H-2L1 Gene by DNA-Mediated Gene Transfer. Science 215 , 677-682. Muramatsu,T. and Nathenson,S.G.(1970) Studies on the Carbohydrate Portion of Membrane-Located Mouse H-2 Alloantigens. Biochemistry 9 ,4875-4883. Murphy,D.B. and ShreffIer,D.C.(1975) Cross-Reactivity Between H-2K and H-2D Products. I Evidence for Extensive and Reciprocal Serological Cross-Reactivity. J.Exp.Med. 141 , 374-391. Murphy,D.B.(1975) Serological Cross-Reactivity Between the Products of Discrete Ia Genes. Fed.Proc. 34 , 1016. Nathenson,S.G. and Cullen,S.E.(1974) Biochemical Properties and Immunochemical-Genetic Relationships of Mouse H-2 Alloantigens. Biochem.Biophys.Acta. 344 ,1-25. Natori,T., Katagiri,M., Tanigaki,N. and Pressman,D.(1974) The 11,000-Dalton Component of Mouse H-2. Isolation and Identification. Transplantation J_8 , 550-555. Orr,H.T., Lopez de Castro,J.A., Lancet,D. and Strominger,J.L.(1979) Complete Amino Acid Sequence of a Papain-Solubilized Human Histocompatibility Antigen, HLA-B7.2. Sequence Determination and Search for Homologies. Biochemistry J_8 , 5711-5720. Orr,H.T., Lopez de Castro,J.A., Parham,P., Ploegh,H.L. and Strominger,J.L.(1979) Comparison of Amino Acid Sequences of Two Human Histocompatibility Antigens, HLA-A2 and HLA-B7: Location of.Putative Alloantigenic Sites. Proc.Natl.Acad.Sci. USA 76 ,4395-4399. Parnes,J., Velan,B., Felsenfeld,A., Ramanthan,L., Ferrini,U., Appella,E. and Seidman , J .G. ( 1 98 1 ) Mouse /^microglobulin cDNA Clones: A Screening Procedure for cDNA Corresponding to Rare mRNAs. Proc.Nat.Acad.Sci. USA 78 ,2253-2257. Peterson,P.A., Cunningham,B.A., Berggard,I. and Edelman,G,M.(1972) /^microglobulin - A Free Immunoglobulin Domain. Proc.Natl.Acad.Sci. USA 69 , 1697-1701. Ploegh,H.L., Orr,T.H. and Strominger,J.L.(1980) Molecular Cloning of a Human Histocompatibility Antigen cDNA Fragment. Proc.Natl.Acad.Sci. USA 77 , 6081- 6085. Poljak,R.J., Amzel,L.M., Avey,H.P., Chen,B.L., Phizackerley,R.P. and Saul, F.0973) Three-Dimensional Structure of the Fab' Fragment of a Human Immunoglobulin at 2.8-A Resolution. Proc.Natl.Acad.Sci. USA 70. , 3305-3310. 85 Porter,R.R.(1962) in 'Basic Problems of Neoplastic Disease' eds. Gellhorm,A. And Hirschberg,E. Columbia University Press, New York, pp 177-194. Proudfoot,N.J. and Brownlee,G.G.(1976) 3' Non-Coding Region Sequences in Eukaryotic Messenger RNA. Nature 263 ,211-214. Reyes,A.A., Schold,M. And Wallace,R.B.(1982) The Complete Sequence of the Murine Transplantation Antigen H-2D as Deduced by Molecular Cloning. Immunogenet. J_6 ,1-9. Rigby,P.W.J., Dieckmann,M., Rhodes,C, and Berg, P.(1977) Labelling Deoxyribonucleic Acid to High Specific Activity IN VITRO by Nick Translation with DNA Polymerase I..J.Mol.Biol. 113 ,237-251. Robb,R.J., Terhorst,C. and Strominger,J.L.(1978) Sequence of the COOH-Terminal Hydrophilic Region of Histocompatibility Antigens HLA-A2 and HLA-B7. J. Biol.Chem. 253 , 5319-5324. Robertson,M.(1982) The Evolutionary Past of the Major Histocompatibility Complex and the Future of Cellular Immunology. Nature 297 , 629-632. Rogers,J., Early,P., Carter,C, Calame,K., Bond,M., Hood,L. and Wall,R.(1980) Two RNA's With Different 3' Ends Encode Membrane-Bound and Secreted Forms of Immunoglobulin M Chain. Cell 20_ , 303-312. Sang,J.H. and Sobey,W.R.(1 954) The Genetic Control of Response to Antigenic Stimuli. J.Imm. 7_2 , 448-457. Schwartz,B.D., Kato,K., Cullen,S.E. and Nathenson,S.G.(1973) H-2 Histocompatibility Alloantigens. Some Biochemical Properties of the Molecules Solubilized by NP-40 Detergent. Biochemistry J_2 , 2157-2164 Schwartz,R.H., David,C.S., Sachs,D.H. and Paul,W.E.(1 976) T Lymphocyte-Enriched Murine Peritoneal Exudate Cells. I l l Inhibition of Antigen-Induced T Lymphocyte Proliferation with Anti-la Antisera. J.Imm. 117 , 531-540. Schwartz,R.H., David,C.S., Dorf,M.E. and Benacerraf,B.(1978) Inhibition of Dual Ir Gene-Controlled T-Lymphocyte Proliferative Response to Poly(Glu 5 6Lys 3 5 Phe9) with Anti-la Antisera Directed Against Products of Either I-A or I-C Subregion. Proc.Natl.Acad.Sci. USA 75 , 2387-2391. Shevach,E.M., Paul,W.E. and Green,I.(1972) Histocompatibility-Linked Immune Response Gene Functions in Guinea Pigs. J.Exp.Med. 136 , 1207-1221. 86 Shevach,E.M. and Rosenthal,A.S.(1973b) Function of Macrophages in Antigen Recognition by Guinea Pig T Lymphocytes. II. Role of the Macrophage in the Regulation of Genetic Control of the Immune Response. J.Exp.Med. 138 ,1213-1229. Shimada,A. and Nathenson,S.G.(1969) Murine Histocompatibility-2 (H-2) Alloantigens. Purification and Some Chemical Properties of Soluble Products from H-2b and H-2d Genotypes Released by Papain Digestion of Membrane Fractions. Biochemistry 8 , 4048-4062. Shreffler,D.C. and David,CS.(1975) The H-2 Major Histocompatibility Complex and the I Immune Response Region: Genetic Variation, Function, and Organization. Adv.Imm. 2_0 , 125-195. Silver,J., Cecka,J.M., McMillan,M. and Hood,L.(1975) Chemical Characterization of Products of the H-2 Complex. Cold Spring Harb.Symp. Quant.Biol. 4J_ , 369-377. Silver,J., Russell,W.A., Reis,B.L. and Frelinger,J.A.(1977) Chemical Characterization of Murine Ia Alloantigens Determined by the I-E/I-C Subregions of the H-2 Complex. Proc.Natl.Acad.Sci. USA 74 , 5131-5134. Singer,D.S., Camerini-Otero,R.D., Satz,M.L., Osborne,B., Sachs,D. and Rudikoff, S.(1982) Characterization of a Porcine Genomic Clone Encoding a Major Histocompatibility Antigen: Expression in Mouse L Cells. Proc.Natl.Acad.Sci. USA 79 , 1403-1407. Sobey,W.R., Magrath,J.M. and Reisner,A.H.(1966) Genetically Controlled Specific Immunological Unresponsiveness. Immunology n_ , 511-513. Sood,A.K., Pereira,D. and Weissman,S.M.(1981) Isolation and Partial Nucleotide Sequence of a cDNA Clone for Human Histocompatibility Antigen HLA-B by Use of an Oligodeoxynucleotide Primer. Proc .Natl .Acad. Sc i . USA 7_8 , 616-620. Spiro,R.G. (1 973) Glycoproteins. Adv.Prot .Chem. 2_7 , 349-467. Sprent,J.(1978a) Restricted Helper Function of F1 Hybrid T Cells Positively Selected to Heterologous Erythrocytes in Irradiated Parental Strain Mice. II Evidence for Restrictions Affecting Helper Cell Induction and T-B Collaboration, Both Mapping to the K-End of the H-2 Complex. J.Exp.Med. 147 , 1159-1174. Sprent,J.(1978b) Role of H-2 Gene Products in the Function of T Helper Cells from Normal and Chimeric Mice in vivo Immunol.Rev. 42 ,108-137. 87 t Steinmetz,M., Frelinger,J.G., Fisher,D., Hunkapiller,T., Pereira,D., Weissman, S.M., Uehara,H., Nathenson,S. and Hood,L.(198W Three cDNA Clones Encoding Mouse Transplantation Antigens: Homology to Immunoglobulin Genes. Cell 24 , 125-134. Steinmetz ,M. , Moore,K.W., Frelinger , J.G. , Shier,B.T., Shen,F., Boyse,E.A. And Hood,L.(1981fc) A Pseudogene Homologous to Mouse Transplantation Antigens: Transplantation Antigens are Encoded by Eight Exons that Correlate with Protein Domains. Cell 25 , 683-692. Sredni,B., Matis,L.A., Lerner,E.A., Paul,W.E. And Schwartz,R.H.(1981) Antigen Specific T Cell Clones Restricted to Unique F1 Major Histocompatibility Complex Determinants: Inhibition of Proliferation with Monoclonal Anti-la Antibody. J.Exp.Med. 153 ,677-693. Tomita,M., Furthmayr,H. and Marchesi,V.T.(1978) Primary-Structure of Human Erythrocyte Glycophorin A. Isolation and Characterization of Peptides and Complete Amino Acid Sequence. Biochemistry \1_ , 4756-4770. Tragardh,L., Wiman,K., Rask,L. and Peterson,P.A.(1978) Amino Acid Homology Between HLA-A,B,C Antigens, ^microglobulin and Immunoglobulins. Scand.J.Imm. 8 , 563-568. Uehara,H., Ewenstein,B.M., Martinko,J.M., Natherson,S.G., Coligan,J.E. and Kindt,T.J.(1980a) Primary Structure of Murine Major Histocompatibility Complex Alloantigens: Amino Acid Sequence of the Aminp-Terminal One Hundred and Seventy-Three Residues of the H-2K* Glycoprotein. Biochemistry j_9 , 306-315. Uehara,H., Ewenstein,B.M. , Martinko,J.M.., Nathenson,S.G. , Kindt,T.J. and Coligan,J.E.(1980b) Primary Structure of Murine Major Histocompatibility Alloantigens: Amino Acid Sequence of the Cyanogen Bromide Fragment Ia (Positons 139-228) from the H-2K Molecule. Biochemistry J_9 , 6182-6188. Wagh,P.V. and Bahl,O.P.(1981) Sugar Residues on- Proteins. Crit.Rev.Biochem. JHD , 307-377. Williams,A.F. and Gagnon,J.(1982) Neuronal Cell Thy-1 Glycoprotein: Homology with Immunoglobulin. Science 216 , 696-703. Wiman,K., Tragardh,L. and Peterson,P.A.(1979) Similarities Between Immunoglobulins and Transplantation Antigens in Amino-Acid Sequence and Disulfide-Bond Distribution. Eur.J.Biochem. 95 , 265-273. Wiman,K. et.al.(l982) Isolation and Identification of a cDNA Clone Corresponding to an HLA-DR Antigen 0 Chain. Proc.Natl.Acad.Sci. USA 79 , 1703-1707. 88 Young,J.Z.(1950) in The Life of Vertebrates. University Press, Oxford pp 619-626. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0095772/manifest

Comment

Related Items