UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The nucleotide sequence of A cDNA for the rat Ia-A α chain Wallis, Anne Elizabeth 1983

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1983_A6_7 W35_3.pdf [ 4.87MB ]
Metadata
JSON: 831-1.0095772.json
JSON-LD: 831-1.0095772-ld.json
RDF/XML (Pretty): 831-1.0095772-rdf.xml
RDF/JSON: 831-1.0095772-rdf.json
Turtle: 831-1.0095772-turtle.txt
N-Triples: 831-1.0095772-rdf-ntriples.txt
Original Record: 831-1.0095772-source.json
Full Text
831-1.0095772-fulltext.txt
Citation
831-1.0095772.ris

Full Text

C .i  THE  NUCLEOTIDE FOR  THE  S E Q U E N C E OF  RAT  Ia-A a  A  cDNA  CHAIN  By ANNE E L I Z A B E T H B.Sc.(Hons.) M o l . B i o l .  A T H E S I S SUBMITTED THE  WALLIS  University  of Edinburgh,  IN PARTIAL FULFILLMENT  R E Q U I R E M E N T S FOR M A S T E R OF  THE  DEGREE  OF  SCIENCE  in THE  We  FACULTY  GRADUATE  (Department  of  accept  thesis  to  THE  OF  this  Biochemistry)  the required  U N I V E R S I T Y OF July @ Anne  STUDIES  as  conforming  standard  BRITISH  COLUMBIA  1983  Elizabeth  Wallis,  1983  OF  1981  In  presenting  requirements of  British  it  freely  agree for  this  thesis  i n partial  f o r an advanced  degree  Columbia, I agree that available  that  f o rreference  permission  scholarly  f o rextensive  at the University  the Library  shall  and study.  I  p u r p o s e s may b e g r a n t e d  by t h e head  o r by h i s o r h e r r e p r e s e n t a t i v e s .  understood  that  financial  copying or publication  gain  shall  of  Uy  The U n i v e r s i t y o f B r i t i s h 1956 Main M a l l Vancouver, Canada V6T 1Y3  D  a  (3/81)  t  e  CAMP]'  Columbia  thesis  o f my  I ti s thesis  n o t b e a l l o w e d w i t h o u t my  permission.  Department  of this  make  further  copying of this  department for  DE-6  fulfilment of the  written  ABSTRACT  The I r genes of been  shown  to  the Major H i s t o c o m p a t i b i l i t y  play  an  important  role  individual  to produce an immune r e s p o n s e .  genes,  Ia a n t i g e n s ,  To is  the  understand  the  code  for  them  The p r o d u c t s of  are h i g h l y homologous  the  a  c h a i n was d e t e r m i n e d .  I r genes  it  which  nucleotide the  Rat  t h i s cDNA sequence  (mouse and human)  showed  was a much h i g h e r degree of  sequence i d e n t i t y  between  there  the  Ir  that  observed  gene  products  the of  of e q u i v a l e n t  between the  within a species.  divergence  Ia a n t i g e n s  The  Ir  species.  3' end of  Comparison of  the  species  that  to  the  both w i t h i n and between s p e c i e s .  w i t h cDNA sequences from other  rise  between  Ia m o l e c u l e s and the  sequence of a cDNA which corresponded to the Ia-A  have  i n the a b i l i t y of an  s t r u c t u r e and f u n c t i o n of  n e c e s s a r y to examine  Complex  This  rodents  I r gene p r o d u c t s  indicates  homologous  loci  Ir  that  gene  and mammals.  the loci  between s p e c i e s  than  of  loci  homologous  d u p l i c a t i o n which gave occurred  before  the  (iii; TABLE OF CONTENTS Introduction C e l l u l a r Immunology of the MHC 1. Discovery of the Immune Response ( I r ) Genes 2. Linkage of the Ir Genes to the MHC 3. Function of the Ir Genes (a) Role of the Ir Genes in T Helper C e l l - Macrophage Interactions (b) Role of the Ir Genes in T Helper C e l l - B C e l l Interactions (c) The Ia Antigens 4. The Ia Antigens are the Ir Gene Products Biochemistry and Molecular Genetics of the MHC The C l a s s I Molecules The Ia Molecules  1 2  M a t e r i a l s and Methods 1 .Pla.smid pRIa.2 2.Plasmid DNA Preparation 3 . I s o l a t i o n of cDNA Inserts 4. R e s t r i c t i o n Enzyme Mapping of cDNA Cloned Inserts 5. Nick T r a n s l a t i o n 6. Colony H y b r i d i z a t i o n 7. Maxam and G i l b e r t Sequencing  23 23 24 26  Results and D i s c u s s i o n I DNA Sequence Analysis of the cDNA Insert of pRIa.2 II P r e d i c t e d Amino Acid Sequence of the Carboxy Terminal End of Rat I a - A a C h a i n III Search f o r the 5' End of the Rat Ia-A a Chain IV Conclusions Acknowledgement References  2 4 5 6 9 10 12 14 14 19  27 29 30 33 41 41 48 70 76 77 78  LIST OF TABLES  PAGE Table I  Maxam and G i l b e r t Modification Reactions  37  Table II  DNA Sequencing  Table III  Comparison of the Sequence Identity  Gels  Between the a  Chains of Rat Ia-A,  Mouse H-2 I-A and Human HLA-DC1  Table IV  39  53  Comparison of the Amino Acid Sequences of the Transmembrane Regions of the Ia a Chains of D i f f e r e n t Species  Table V  58  Percent Sequence Identity Between Ig-Like Domains of D i f f e r e n t Immune System Molecules  67  (v)  LIST OF FIGURES  PAGE Figure 1  MHC R e s t r i c t i o n of C e l l u l a r Interactions in the Immune System  Figure 2  1 1  — - The R e s t r i c t i o n Map and Sequencing Strategy of the cDNA Insert of pRIa.2  Figure 3  The Nucleotide Sequence of the cDNA Insert o f pRIa.2  Figure 4  42  Comparison  of the Nucleotide  44  Sequences  of the cDNA Encoding the a Chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1  Figure 5  T r a n s l a t i o n of the Coding Sequence of the cDNA Insert of pRIa.2  Figure 6  47  Comparison  of the Amino Acid  49  Sequences  of the a Chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1  Figure 7  Diagram of an Immunoglobulin Region Domain  52  Constant 62  Figure 8  Comparison of the Amino Acid Sequences of Ig-Like Domains  Figure 9  Schematic Representations  of Some  Members of the Immunoglobulin Superfamily  Figure 10  Alignment of the P a r t i a l  Nucleotide  Sequence of the cDNA Insert of pRIa.3 with the Sequence of the cDNA Insert of pRIa.2  (vii)  ACKNOWLEDGEMENT  I would l i k e to g r a t e f u l l y advice Wallis.  I  received  acknowledge  the support  and  from Rob McMaster, Sarah Eccles and Heather  1  INTRODUCTION  The Major Histocompatibility Complex During early studies on grafting  i t became  tumour  transplantation  and  skin  apparent that there was a genetic basis to  transplantation or g r a f t i n g . This phenomenon of tumour or graft rejection was found to be regulated by a number of segregating  genes.  Snell,  in the  mouse strains which d i f f e r r e d only which  apparently  same  time,  congenic  regulated  Gorer,  strains  using defined  1940's, developed congenic  at  tumour antisera  independently  regions  of  the genome  or graft r e j e c t i o n . At the developed  against  these  a group of antigens which segregated  with the genes responsible for the s u s c e p t i b i l i t y and resistance to  tumour  transplantation.  These  transplantation  or  histocompatibility antigens correlated with the same area on the genome  as  the  tumour  s u s c e p t i b i l i t y genes. The region of the  mouse genome to which both the tumour s u s c e p t i b i l i t y the  histocompatibility  antigens  mapped  was  called  genes  and  the  H-2  complex. The H-2 complex was found to be the major region of the genome which determined the a b i l i t y grafts  or  transplants  and  of  because  an  animal  to  reject  of t h i s i t was termed the  Major Histocompatibility Complex (MHC). Regions homologous to  the mouse  H-2  complex  have  been  i d e n t i f i e d i n other species including Rats (RT-1), humans (HLA), chickens  (B) and pigs (SLA) (Gotze, 1977).  2  CELLULAR IMMUNOLOGY OF THE MHC  1. Discovery  of the Immune Response (Ir) Genes  The existence of a genetically transmissible variable which resulted  in unresponsivness  usually responsive onward  to certain  antigens  to this antigen, was noted  (Carlinfanti,  from  immune  the  1940's  1948; Sang and Sobey, 1954; Ipsen, 1959;  Sobey et a l . , 1966). Early studies to examine controlled  in animals  responsiveness,  were  this  done  genetically  in guinea pig  strains using large foreign protein molecules as the challenging antigen. The use of these large antigen  gave  multi-determinant  proteins  as  results that were indicative of a trend in immune  responsiveness but which were often not clear cut. To demonstrate the s t r i c t genetic  control  of  the  immune  responsiveness to limited or even single antigenic determinants, Levine pig  et  a l . (1963) studied the response of two inbred guinea  strains (strain 2  composed  and  strain  13)  to  synthetic  of a s p e c i f i c hapten conjugated to the c a r r i e r  lysine (PLL). A c a r r i e r i s defined as a molecule recognized  as  immunogenic  by  the  an  can be  group,  which  cannot  immune response when injected by i t s e l f but can act  as an immunogen when linked to a antigen  which  poly-L-  immune system. A hapten i s  defined as a molecule, usually a chemical provoke  antigens  used,  carrier.  By  simplifying the  i t was  hoped that a more clear cut set of data  study,  the  would r e s u l t . In  this  dinitrophenol  (DNP)  -  hapten-carrier  conjugate  2,4-  PLL was used to immunize guinea pigs of  either strain 2 or strain 13. Strain  2  guinea  pigs  showed  a  3  response  as  measured  by  the presence  antibodies and by the occurrence of a response.  Strain  responders response  13  delayed  serum  anti-DNP  hypersensitivity  guinea pigs, on the other hand, were non-  exhibiting nor any  of  neither  production  a  delayed  hypersensitivity  of anti-DNP antibodies. Breeding  experiments were done with the two guinea pig strains. The f i r s t f i l i a l generation (F1) of strain 2 guinea pigs (responders) and s t r a i n 13 guinea pigs (non-responders) resulted in progeny which were  a l l responders. Crossing two F1 guinea pigs resulted in a  F2 generation which were 75% responders and 25% This  non-responders.  indicated that the gene c o n t r o l l i n g the immune response to  DNP-PLL was a single dominant gene. Work by (1965)  using  similar  techniques  McDevitt  in mice  and  supported  Sela these  observat ions. In a further study Benacerraf et different  haptens  conjugated  response or non-response was  linked  to  a l . (1967)  showed  to PLL showed a similar trend of  and that immune responsiveness  the strain  of  guinea  pig used.  By  linking  the DNP  (BSA) or ovalbumin  the  strains  immunologically  to  gene  the PLL  hapten to another c a r r i e r , such as  bovine serum albumin non-responder  to PLL.  The  c o n t r o l l i n g this immune response was, therefore, named gene.  that  could  (OVA), i t was shown that recognize  and  respond  the hapten DNP when i t was linked to BSA or  OVA (Benacerraf et a l . , 1967). This demonstrated that the nonresponder  animals had the c a p a b i l i t y of producing antibodies to  DNP i f i t was presented to the immune system on carrier.  This  observation  also  indicated  recognition step was the recognition of  an  that  carrier.  immunogenic the c r i t i c a l  The  antibody  4  response  which  resulted,  however,  against the c a r r i e r i t s e l f hapten was  was not primarily directed  , but was primarily s p e c i f i c for  the  conjugated to i t . This argued that although the PLL gene  responsible  recognition,  in  some  way  for  the  process  antigen  i t was not d i r e c t l y involved in i d e n t i f i c a t i o n of  the s p e c i f i c determinants to which the antibody recognize.  of  The  PLL  gene  produced  would  and other genes shown to control the  a b i l i t y of an animal to mount an immune response to  a  specific  antigen were termed immune response or I r genes.  2. Linkage of the I r Genes to the MHC The  availability  of  inbred  mouse and guinea pig strains  enabled experiments to be c a r r i e d out to analyse the location of the I r genes on the genome. McDevitt and Chinitz (1969), showed that the Ir genes linked  to  the  H-2  were  complex. Linkage mapping studies in inbred  mouse strains l o c a l i z e d the s i t e of one of the Ir genes, the I r 1 gene, to the middle of the mouse H-2. The region of the MHC  to  which the Ir genes mapped was c a l l e d the I region  et  (McDevitt  al.,1972). Evidence from studies in guinea pigs also showed that the  Ir  genes  were  Studies of the Ir (Amerding  linked  genes  in  to  the  other  MHC  (Ellman et al.,1970).  species  such  the  rat  et al.,1974) and the rhesus monkey (Dorf et al.,1975)  established that the Ir genes were linked to the species  as  as  well.  Subsequent  MHC  of  these  studies indicated that different  mouse Ir genes mapped to d i f f e r e n t areas of the I region,  these  were c a l l e d the I-A and the I-E subregions (Klein,1981). Once i t had been shown that the l o c i for the Ir genes were linked to the  5 MHC  many  investigations  were done searching for a correlation  between the Ir genes and the histocompatibility antigens  coded  by the MHC.  3. Function of the Ir Genes The  Ir genes  were  known  to determine the a b i l i t y of an  organism to respond to an antigen. The mechanism by regulation  occurred,  however,  understand further the role response,  experiments  of  were  was  unclear.  the Ir genes  done  which  In  this  order  to  in the immune  to determine the pattern of  expression of the Ir genes in c e l l s of the immune system. At t h i s time response  i t was  to occur  an  known  that  for a  antigen-specific  responses, carrier, was  the  dichotomy  of  even  directed  subpopulations  though the antibody against  the hapten.  involved  was  towards conjugate  specific  for the  response that was stimulated If the  two  lymphocyte,  recognized different parts of the same  antigen t h i s apparent contradiction would be was  partway  the hapten-carrier  in which the immune response  immune  interaction between T  helper c e l l s and B c e l l s must occur. This went explaining  humoral  explained.  If i t  the T helper c e l l which was responsible for recognition of  the c a r r i e r part of the antigen as immunogenic then i t was the T helper c e l l which regulated the B response  to hapten.  The  ability  cell of  response the T  or  lack of  helper  c e l l to  recognize a c a r r i e r as immunogenic appeared to be determined  by  the Ir genes the animal possessed. Since  i t appeared  that  regulated immune responsiveness,  i t was  the T helper c e l l which  i t seemed  probable  that the  6  expression  of  I r genes occurred at the T h e l p e r c e l l  level  and  many experiments were done aimed at v a l i d a t i n g t h i s s u p p o s i t i o n .  (a) Role of the I r Genes i n T h e l p e r c e l l - Macrophage Interactions Experiments had  shown that the response of  lymphocytes  to  a n t i g e n r e q u i r e d the presence of macrophages. To c l a r i f y f u r t h e r the  exact  nature  Rosenthal  of  the  role  (1973) used guinea  between macrophages and  of  macrophages,  Lipsky  p i g s to i n v e s t i g a t e the  lymphocytes i n the absence  and  interaction of  antigen.  They demonstrated that a p h y s i c a l c e l l - c e l l  c o n t a c t occurred  that  cell  there  was  a  specificity  for  the  types i n v o l v e d :  macrophages bound only to thymocytes or lymphocytes and no c e l l s of the body and guinea  thymocytes  from  mice  and  did  not  other  bind  to  p i g macrophages. There appeared to be an unique c e l l u l a r  r e c o g n i t i o n mechanism between thymocytes and macrophages. In the presence of a n t i g e n the lymphocytes contact  increased  was  necessary  antigen-specific  interactions and for  in some way The congenic  seemed  cellular  that a d i r e c t cooperation  i n an immunogenic  the macrophage was  form  r e q u i r e d to process  t h a t i n v o l v e d the use of metabolic  e x i s t e n c e of mouse and guinea at  the  I r e g i o n of the MHC  antisera d i r e c t e d against d i f f e r e n t a n t i s e r a was strains  macrophages  with  and  cell-cell  leading  to  lymphocyte s t i m u l a t i o n . Further s t u d i e s showed  that f o r the antigen to be recognition,  it  between  pig  tissue.  the  T  antigen  that  were  the p r o d u c t i o n of  I region s p e c i f i c i t i e s . of  cell  energy.  strains  allowed  produced by c r o s s immunization lymphoid  for  these  This  congenic  S t u d i e s done by Shevach et a l .  7  (1972) looked at the relationship  between  Ir genes  and the  mechanism of immune responsiveness.  Lymphocyte p r o l i f e r a t i o n was  used to assay T helper c e l l response. The effect of alloantibody directed  against  the I  region  of  strains, 2 and 13, on T helper c e l l results  the two inbred guinea pig  function  was  tested.  of t h i s study showed that the alloantibody  blocked  the activation of T lymphocytes by  The  specifically  antigens  that  were  under Ir gene c o n t r o l . To  see  i f the addition of anti-I region alloantibody was  simply blocking or i n h i b i t i n g the antigen uptake by macrophages, Shevach et al.(l973) incubated  antigen plus macrophages with and  without alloantibody before assaying vitro  T  cell  proliferation.  This  for Ir gene control  by in  experiment showed that the  alloantibody had no effect on the a b i l i t y of macrophages to take up and process antigen for presentation most  acceptable  explanation  for such  to T helper results  cells. was  The  that the  alloantibody inhibited antigen-induced p r o l i f e r a t i o n of T helper c e l l s by blocking recognition of antigen which has been bound to or processed by macrophages. It was also apparent genes  that  the Ir  coded for a c e l l surface associated product and that this  product  was  somehow  recognition by T helper The  involved  i n the mechanism  of  antigen  cells.  immune response seemed to involve a multi-step pathway  involving the two subsets of lymphocytes, the T macrophages  and  antigen.  The  general  forward to explain the pathway of an  and  B  cells,  theme of proposals put  immune  response  went  as  follows: foreign antigen enters the body and reacts with B c e l l s which  express immunoglobulin s p e c i f i c for that antigen on their  8  c e l l surface. In order antigen-specific  for B c e l l s to p r o l i f e r a t e and  antibody a second signal i s necessary. Antigen  also binds to or i s in some way processed by antigen  has  been  macrophages.  Once  appropriately processed i t i s presented to T  c e l l s . Depending on the a b i l i t y of macrophage-processed  antigen,  T  cells  to  recognize  the  or the a b i l i t y of macrophages to  process antigen, T c e l l s w i l l signal  produce  p r o l i f e r a t e and  send  a  second  to B c e l l s leading to the induction of s p e c i f i c antibody  synthesis. The evidence of Shevach and that the  although process  (1973)  mechanism  this  of  function  antigen  recognition  d i d not necessarily  presence of the Ir gene product on the surface of They offered the alternative explanation be  expressed  on  the surface  activation., for example proposal  of  by  T  require the the T  cell.  that the Ir genes might  a c e l l that controls T c e l l  the macrophage.  To  investigate  this  Shevach and Rosenthal examined whether (1) macrophages  from non-responder animals (responder  X  interaction  would  non-responder)  region alloantibody  inhibited  nonspecifically,  stimulate  T  lymphocytes  of  F1 animals and (2) whether anti-I by by  blocking  macrophage-T  cell  s p e c i f i c a l l y blocking Ir gene  products or by i n h i b i t i n g both functions. The study,  established  the functional role of the Ir gene product i s in or  lymphocytes,  Rosenthal  results  of  this  showed that i t was necessary for T c e l l s and macrophages  to be compatible at some I region l o c i to enable macrophages and antigen to interact with immune T helper  cells.  Further studies showed that T helper c e l l s exhibited a dual s p e c i f i c i t y in that recognition of  antigen  on  the macrophage  9  surface  was specific  was presented compatible  for that antigen but only when the antigen  on the surface of macrophages which were I with  the  T  helper  cells  (Sprent,1978a).  requirement that T helper c e l l s and macrophages only  when  they  shared  MHC  region  could  interact  identity at the I region and that  antigen could be responded to only in the context of this identity was termed MHC  The  shared  restriction.  (b) Role of the Ir Genes in T Helper C e l l - B C e l l Interactions MHC r e s t r i c t i o n  of the antigen-specific interaction between  T helper c e l l s and macrophages was also shown to interaction Kindred  between  and  demonstrated  to the  T helper c e l l s and B c e l l s . Experiments by  Shreffler that  apply  (1972)  and  Katz  histoincompatible and  et  al.  (1973),  T lymphocytes and B c e l l s  were unable to  cooperate  produce  an  antibody  response.  Carrier-primed  T helper c e l l s could not produce the appropriate  stimulus for induction of antibody  synthesis in hapten-primed  cells  cells  unless  the  T  histocompatible. Therefore, specific  T cell-B  and  B  failure  semi-  c e l l cooperation across MHC b a r r i e r s .  Kappler  results using d i f f e r e n t experimental  a  or  antigen  Sprent  was  fully  in  and Marrack (1976,1978) and  there  were  B  (l978a,b) techniques.  confirmed  these  10  (c) The Ia antigens Shreffler  and  David  (1975)  in  mice and Schwartz et a l .  (1976) in guinea pigs found that anti-I region antisera  reacted  with a group of c e l l surface glycoprotein molecules expressed on B  lymphocytes  and  relationship  of  alloantigens  were  macrophages.  these  alloantigens  Because  of  the  to  Ir  genes  the  1975)  and  these  termed immune-associated or Ia antigens. The  Ia antigens were shown to be highly polymorphic David,  unclear  to  (Shreffler  and  consist of two non-covalently associated  glycoprotein chains (Cullen et al.,1976). The Ia  antigens  will  be discussed in d e t a i l in a further section. In  Figure  cell-macrophage diagrammed.  1 and  the mechanism of MHC T  helper  cell-B  r e s t r i c t i o n in T helper cell  interactions  are  11  Figure 1 MHC R e s t r i c t i o n of C e l l u l a r Interactions in the Immune System  (a) I n d u c t i o n o f helper T-cells  (b) E l f e c t o r phase o f T c o o p e r a t i o n  In t h i s diagram the dual s p e c i f i c i t y of the T helper is  depicted.  In  must be presented immune A T  (Th)  order for an immune response to occur antigen to the T  helper  cell  in association  with  associated antigens (Ia) on the macrophage c e l l surface.  helper  cell  histocompatible  which  has • been  macrophage  becomes  able  antigen  i n association  antigen. The immune response  with  to  interact  stimulated  i n t e r a c t a n t i g e n - s p e c i f i c a l l y with a B c e l l the  cell  with  and can  (B) which  a  then  presents  the same histocompatible Ia  to antigen  i s said  to be  MHC  r e s t r i c t e d because of the dual s p e c i f i c i t y of the T helper c e l l .  12  4, The Ia antigens are the Ir gene Products Dorf and Benacerraf response genes.  (1975) showed, in mice, that the immune  to some antigens was under the control of two When  dominant  two non-responders animals were bred the resulting  progeny were responders. The non-responder  alleles,  therefore,  appeared to complement one another resulting in offspring with a responder of  phenotype. One gene was shown to map  the H-2  response  complex (see section 2). It seemed that for an immune to  some antigens both a l l e l e s had to be present. Dorf  and Benacerraf an  to the I-A region  animal  further showed that i f the I region haplotype  was  known  it  animal would be a responder  of  was possible to predict whether that to a specific antigen.  Using the same strains as Dorf and Benacerraf, Jones et a l . (1978) found evidence that the  expression  of  one  set  of  Ia  antigens on the c e l l surface was under the control of two genes. There  appeared to be a correlation between the Ir genes and  two  I region gene products which controlled Ia expression.. Jones  et  a l . found that one .component of the Ia antigen mapped to the I-A region  and  that  appeared to expressed  a second locus which mapped to the I-E region  control on  the  whether  this  I-A  encoded  molecule  was  c e l l surface. They also showed that anti-I-E  antisera coprecipitated a molecule which consisted of  two  non-  covalently associated polypeptide chains in the F1 and that t h i s Ia antigen was not present in either of the parental strains. Taken antigen  in  associated  together the  these  mouse,  polypeptide  results  was chains  indicated  composed and  of  that  two one  that the Ia I-E non-covalently subunit (0) was  encoded by the I-A subregion and the other subunit (a) by the I-  13  E subregion. Both the a and the 0 chain were required to produce a functional Ia antigen and concommitent with complete  Ia  I-E antigen  the  immune  expression  responsiveness  of a to some  antigens appeared. Additional evidence that the Ia antigens were the Ir gene products  came  antibody was macrophage  from found  experiments to  interactions  in which  specifically in v i t r o  block  . The  antigens which were under the control inhibited  T T  of  helper  cell  one  cell  response to  Ir  locus  were  only by antibody directed against that locus and this  same antibody had no effect on the T c e l l under  monoclonal a n t i - l a  the control  of  other  response  Ir l o c i  (Lerner  to et  antigen  al.,1980;  Baxevanis et al.,1980; Sredni et a l . 1981). MHC r e s t r i c t i o n of T helper c e l l interactions in the immune response results from the dual s p e c i f i c i t y of This  dual  specificity  requires  that  a  T  helper  specific  recognized only in the context.of an Ia antigen.  cells.  antigen be  14  BIOCHEMISTRY AND  MOLECULAR GENETICS OF THE  Serological data had defined which  were  encoded  by  the  s e r o l o g i c a l l y analysing recombination MHC  was  MHC.  types  Genetic  lymphocytes  from  the K,I,S,G,  subsequently s p l i t  mice  molecules  and  done  strains  by  where  divided the mouse D  regions.  The  D  into the D and L regions based on  serological findings by Hansen and Levy 1978 shown  of  studies,  events occurred within the MHC,  into five subregions:  region  several  MHC  . The G region  was  to be i d e n t i c a l to that of the S region which encoded the  fourth component of Klein,  1980;  the  Ferriera  complement et  pathway  a l . , 1980).  encode the Class I molecules of the MHC.  (C4)  The The  K,D I  (Huang  and  and L regions  region  encodes  the Ia antigens as previously discussed.  THE CLASS I MOLECULES The  earliest  studies  on the K and D region gene products  were done by Shimada and Nathanson (1969). were  used  to  immunoprecipitate  after s o l u b l i z a t i o n by release  the  molecules  i d e n t i f i e d in this way weight.  papain from  either H-2K  treatment the  were found  Specific  cell to  be  of  Later studies (Schwartz et a l . , 1973)  l a b e l l i n g techniques  to increase the  or H-2D  molecules  spleen  cells  surface. of  antibodies  The  37,000  to  proteins molecular  using radioactive  sensitivity  and  overcome  the problem of limited amounts of protein, showed that the K and D  molecules  consisted  of two noncovalently  linked chains.  heavy chain was a glycoprotein of 37,000 molecular  weight  The when  15  papain the  treatment  membrane  recognized  was  was  by  used, and of 44,000 molecular  solublized  anti-H-2K  reside within the larger chain. The  or  by  detergent.  The  weight when determinant  anti-H-2D antibodies was  44,000  molecular  weight  found to  polypeptide  l i g h t chain associated with the K or D region encoded  polypeptide  ' was  shown  to  be, / J i c r o g l o b u l i n  al.,  1974). This polypeptide had a molecular  and  was  not  encoded  by the MHC.  contain two carbohydrate chains Studies to determine determinent(s)  whether  weight  of  et  12,000  The heavy chain was  shown to  (Muramatsu and Nathenson, 1970). the  location  of  the  antigenic  recognized by the antibodies were on the protein  or carbohydrate moieties of the heavy antibodies  (Natori  m  2  reacted  with  Cullen, 1974). The H-2K molecules of the MHC.  chain,  showed  that  the  the polypeptide moiety (Nathenson and  or D antigens are now  c a l l e d the Class I  The use of antibodies directed  against  K  and D region haplotype differences showed that K and D l o c i were polymorphic.  The  and D l o c i i s now  number  of d i f f e r e n t .alleles at. each of the K  thought to be in the  range  of  30-60  .  The  Class I molecules are found on most tissues. The Class I molecules in humans are c a l l e d HLA-A, HLA-B and HLA-C  antigens.  acid sequence of molecule  was  271  Orr a  et a l . (1979) reported the complete amino papain  solublized  HLA-B7  molecule.  residues in length, had a single carbohydrate  moiety attached at amino acid 86 and had 2 disulphide search  for  internal  of  Significant  the  first  homology  loops.  A  homologies by computer analysis suggested  homology between the amino region  This  terminal disulphide  between  the  90  amino  loop second  acids  (residues  and  the  91-180).  disulphide  loop  16  (residues  182-271)  and  immunoglobin (Ig) constant domains and  ^ m i c r o g l o b u l i n was also shown. - Coligan et a l . ( l 9 8 l ) reported the sequence  of  first  complete  a Class I antigen. Using radiochemical  the murine H-2K chain was completely  protein  techniques,  sequenced. The protein was  b  shown to be 346 amino acids in length. The H-2K antigen could be divided into 3 functional segments; the  transmembrane  region  and  the e x t r a c e l l u l a r the cytoplasmic  transmembrane segment of 25 uncharged  hydrophobic  was  acid  identified  starting  at  amino  282  region,  region. amino  and  acids  extending  approximately to amino acid 307. This agreed with sequence which  had  been  derived  from  papain  treated  human  molecules (Martinko,1980) which were 281 amino acids in The  A  data  Class I length.  region from amino acid 308 to the carboxy terminus at amino  acid 346 represented a cytoplasmic  tail.  carbohydrate loops.  By  38  The  H-2K^  attachment analogy  amino  and  with  acid  long  intracellular  or  molecule contained two s i t e s for had  two  intra-chain  disulphide  the human HLA-B7 molecule, which was  approximately 70% homologous to H-2K , the e x t r a c e l l u l a r segment b  could be divided into 3 domains; the amino-terminal the  first  disulphide  a1,  loop domain a.2 and the second disulphide  loop domain a3 which was adjacent the  domain  to the membrane.  Studies  on  Class I antigens suggested that the 3 external domains were  organized  into j3-pleated sheet  structures  (Uehara,  1980 a,b;  Martinko, 1980). Lack of s u f f i c i e n t amounts of protein, however, limited the data which could be derived from these studies. Recombinant to  Class  I  plasmids containing cDNA inserts corresponding  antigen  mRNAs  were  isolated  for  both  human  1  transplantation  antigens  1981)  and for mouse  1981;  Steinmetz  (Ploegh  et  transplantation et  al.,  1981a).  al.,  1980; Sood et a l . ,  antigens Kvist  (Kvist  et  recombinant plasmid containing an approximately cDNA  7  et  al.,  a l . isolated 1000  base  a  pair  insert, which corresponded to the carboxy-terminal  half of  a murine Class I antigen. The cDNA isolated by Kvist et  a l . was  sequenced  (Bregegere  et  a l . , 1981) and  used  isolate other Class I s p e c i f i c clones (Jordan, al,  (1981)  using  oligodeoxyribonucleotide  as  a probe to  1981).  Sood  primers isolated a v  cDNA clone for.an HLA-B Class I antigen. Several genomic clones were isolated by probes  (Steinmetz  et  the use  of  cDNA  et a l . , 1981b; Jordan et a l . , 1981; Singer et  al.,1982). Because of the high degree of homology between  Class  I antigens of mice and humans, i t was found that cDNA clones for Class  I antigens of one species could identify Class I antigens  of other species (Singer et a l . , 1982). The genomic  DNA  which  was  first  sequence  of  reported encoded what appeared to be a  murine pseudogene homologous to the Class I antigens  (Steinmetz  et a l . , 198lb). This pseudogene consisted of 8 exons, 7 of which correlated  with  the domain structure of the protein. The amino  acid sequence from exon 1 was sequence.  thought  to  represent  a  leader  Exons 2,3 and 4 correlated with the domain structures  predicted from early protein and cDNA sequence data (Coligan et al.,  1981;  Bregegere et a l . , 1981). Exon 5 corresponded to the  transmembrane region. The last 3 exons coded for the cytoplasmic portion of the protein and the 3' untranslated region. The for  the presence of 3 domains for the cytoplasmic  protein  was  unclear,  as  the cytoplasmic  tail  need  region of the appeared  to  18  comprise only one functional region. One  interesting  aspect  of  the sequences which have been  elucidated i s the s i m i l a r i t y between products of homologous l o c i for  the Class I antigens i . e . i t i s possible to determine,  sequence  alone,  whether  a  sequence  i s from the human HLA or  mouse H-2 complex. It i s not possible to loci  from  determine  from  which  within a species a sequence i s derived. Therefore, as well  as a great deal of d i v e r s i t y at each Class I locus there appears to be a 'homogeneity' which renders each a l l e l i c product  equally  l i k e or unlike another a l l e l i c or gene product. Steinmetz et analysis  of  a l . (1981a)  mouse  DNA  carried  using  a  out  known  a  Southern  Class  I  blot  cDNA probe.  Approximately f i f t e e n bands were i d e n t i f i e d which hybridized the  probe  DNA.  This  indicated  that  the Class  comprised a multigene family. An elegant technique cloned H-2 Class I gene was Goodenow  et a l . (1983)..  used  Moore  by et  Moore  et  clone  al.(l982)  detected  antibodies. contained  was expressed method,  by  The a  a l . used DNA-mediated gene  d. The resulting p o s i t i v e  radioimmunoassay  H-2 , with, a  results  functional correctly  therefore,  not  indicated H-2L on  that  d  monoclonal  the genomic  gene and that the H-2L  d  the  only  transformants  using anti-H-2  recipient  clone molecule  cell-surface.  This  allows unambiguous assignment of  cloned genes but may provide a system to study the the  and  of 27.5kb which hybridized strongly to a Class I  cDNA probe of haplotype were  antigens  to identify a  transfer to transform a mouse c e l l l i n e , haplotype genomic  I  to  function of  Class I antigens. This technique was also used by Singer et  a l . in 1982 to examine expression of a  genomic  clone  for the  19  porcine  Class I or SLA antigens, and by Mellor et a l . (1982) to  look at expression of an H-2K Class I antigen. t  THE  Ia MOLECULES  The I region of the mouse  H-2  was  originally  subdivided  into five subregions: A,B,J,E,and C (Shreffler and David, 1975). At two  present I  however, i t appears that there may  subregions:  Robertson,1982).  the  A  and  E  (Klein  et  to  the  .  These  Similar techniques to were  used  those  to  described  for  et  1977)  al.,.  to  1978)  consist  of  two  the  Ia  heavy  chain  (a)  had  recognized  polypeptide portions of Immunoprecipitation  I  molecules (Silver  non-covalently  linked  The  mouse  a molecular weight of 33,000 and the  light chain (0) a molecular determinants  Class  shown  polypeptide chains, both of which were glycosylated.  1982;  antigens.  purify and characterize the  coded for by the I region. The Ia molecules were  and  correspond  human HLA-DC1 (Bono and Strominger,  Goyert et al.,1982) and HLA-DR (Allison et a l . ,  molecules  al.,1981;  The Ia antigens in mice are c a l l e d the I-A  I-E and in rats the Ia-A and Ia-E antigens respectively  actually be only  weight  by the  studies  of  26,000.  The  antigenic  antibodies were shown to be on the molecules also  molecule expressed more than one  (Cullen  showed  determinant  that  et a  (Cullen  al.,1975). single  Ia  et a l . ,  1976). Due  to  the  small  limited protein sequencing  amount  of  Ia  protein available only  could be done. Limited  amino-terminal  sequence data showed that in the mouse there were two d i s t i n c t a  20  chains and two d i s t i n c t  0  chains  (Silver  et  al.,1975,1977).  Antigenic s p e c i f i c i t e s determined by I-A and I-E subregions were found  on  independent molecules (Jones et al.,1978). Thus, each  subregion appeared to code for a d i s t i n c t c e l l - s u r f a c e molecule. Crossreaction using alloantibodies for the d i f f e r e n t was  noted  (Murphy  et  subregions  a l . , 1975; Murphy and S h r e f f l e r ,  1975).  This indicated that a degree of homology between the different A region and E region molecules existed. In contrast to the I  antigens,  the  Ia  molecules  had  a  restricted  d i s t r i b u t i o n , they are found primarily on B c e l l s ,  Class tissue  macrophages,  thymic epithelium and some T helper c e l l s . Larhammar  et  al.(l98l),  described  the cloning of a cDNA  clone of approximately 1000 base pairs corresponding to an  HLA-  DR j3-like chain of approximately 230 amino acids. The amino acid sequence which was predicted from t h i s almost f u l l length cloned cDNA  displayed  sequence  homology to the human Class I antigen  heavy chains, /3 icroglobulin and immunoglobin  constant  m  2  domains.  This  was  protein data from  region  especially interesting because the o r i g i n a l amino-terminal  sequencing  had  revealed  no  homology to the molecules l i s t e d above. Isolation  and  sequencing  of HLA-DR a and 0 chain DNA  reported by Lee et a l . (1982a) Wiman et a l . al.  (1982)  and  l i k e 0 chain containing  was two  was  a  Korman  et  Larhammar et a l . (I982a,b). The mature HLA-DRshown  to  putative  transmembrane segment and a There  (1982),  was  single  be  229  disulphide 10  amino  amino loops, acid  acids a  21  in  length,  amino acid  cytoplasmic  tail.  putative s i t e for carbohydrate attachment  within the amino-terminal Ig-like  region.  This  amino-terminal  21  domain  exhibited  homology  to the corresponding  HLA-A.B and C antigen heavy chains. The like  region  was  regions of the  membrane  shown to be homologous to 0 2 i m  proximal c r o  Ig-  9 l ° b H , Ig u  n  constant  region domains and the Ig-like domains of the Class  antigens  (Larhammar, 1982a).  The  mature  HLA-DR  a chain was also shown to be 229 amino  acids in length. The transmembrane region long  I  was  23  amino  acids  and there was a 15 residue cytoplasmic t a i l . The remaining  191 amino acids were exposed on the c e l l surface. The chain  HLA-DR  a  was shown to be composed of two e x t r a c e l l u l a r domains; al  the amino-terminal domain (residues 1-84) disulphide  containing  peptide, transmembrane  and  a2,  an  Ig-like  domain (residues 85-179). The connecting region  and  cytoplasmic  tail  comprise  another t h i r d domain. A  cDNA  corresponding  to the HLA-DC1 a chain was described  by Auffray et al.(l982). The cDNA for the HLA-DC1 isolated  by. using,  an  HLA-DR  a  chain  was  a chain cDNA probe. The protein  encoded by this isolated cDNA was shown to be 232 amino acids in length and to correspond with  to the HLA-DC1 a  chain  by  comparison  the known amino-terminus protein sequence data for HLA-DC1  a chain. The HLA-DC1 a chain and approximately  60%  the HLA-DR  a  chain  exhibit  homology. By analogy to the domain structure  of the HLA-DR a chain protein the HLA-DC1 a  chain  protein  was  divided into two e x t r a c e l l u l a r domains; a1(amino acids 1-87) and a2(amino 194)  a  acids 195-217) , a connecting peptide tramsmembrane  intracytoplasmic  region  region (amino  (amino acids  chain had two sites for carbohydrate  acids  (amino acid 182195-217)  and an  218-232). The HLA-DC1 a  attachment one in each of  22  the a1 and a2 domains. Like the HLA-DR a2 domain, the HLA-DC1 a2 domain to  contains  the  Ig  described  the only disulphide loop and exhibits homology  constant  cDNA's  region  domains.  corresponding  to  Benoist  the murine  et  al.(-l983),  I-A and I-E a  chains. The highly polymorphic nature of the MHC encoded is  unique  and  i t i s of  interest  to  t r y to understand the  evolution of this polymorphism. One way in which done  i s to  compare  the  sequences  molecules.  this  can be  of MHC molecules of other  species such as the r a t , to the equivalent and human  molecules  sequences  of mouse  23  MATERIALS AND METHODS  1. Plasmid pRIa.2 Plasmid  pRIa.2  (supplied  by Dr. W.R.  McMaster)  was  constructed in the following manner. Total RNA was prepared from spleens  of Wistar  strain  guanidium-HCl and the  rats  (haplotype  procedures  RT1 ), using 7.5M U  of Chirgwin  et a l . (1979).  Poly-adenylated RNA (Poly(A)-RNA) was p u r i f i e d by chromatography on  oligo (dT)-cellulose (Aviv and Leder,  1972). Spleen poly(A)-  RNA was fractionated by sucrose density gadient Fractions  containing  mRNA  were  translated  in v i t r o  using  cell-free  presence of radioactive amino acids reticulocyte  lysate  immunoprecipitated  system.  centrifugation.  The  Ia  a  in  rabbit  polypeptides  with rabbit antibodies prepared  the  were  against rat  Ia-A a chain and analysed by SDS-PAGE electrophoresis. Fractions of. mRNA coding for rat Ia-A a chain were used to prepare stranded cDNA as described inserted  into  by Land  et al.(l981).  double  cDNA was  the Pst I s i t e of the b a c t e r i a l plasmid pBR322  (Bolivar and Backman, 1979) by G/C t a i l i n g (Land et a l . , and  1981)  the resulting recombinant plasmids used to transform E . c o l i  strain RR1 (Bolivar and Backman, 1979) . Specific  cDNA  clones  containing sequence corresponding to Ia-A a chains were detected by  using  The assay  a positive mRNA selection assay (Parnes et al.,1981). involved  nitrocellulose  immobilising  filters  pools, of plasmid  and hybridising  total  DNA  mRNA  onto  to the  immobilised DNA. mRNA which hybridised was eluted and the mRNA coding for Ia polypeptides was detected by c e l l - f r e e translation  24  and immunoprecipitation containing  cDNA  as described above. Pools of plasmid DNA  inserts  which  hybridised  to mRNA  polypeptides could then be screened i n d i v i d u a l l y . This  for  Ia  strategy  resulted in the i d e n t i f i c a t i o n of a recombinant plasmid, pRIa.1, which  contained  a cDNA insert of approximately  600 base pairs,  coding for a rat Ia-A a chain. A cDNA l i b r a r y was prepared from t o t a l rat poly(A)-RNA  as  described above (R.McMaster, unpublished). This cDNA l i b r a r y was screened  for the presence of cDNA inserts containing sequences  which hybridised to the cDNA plasmid  pRIa.2,  which  insert  contained  a  of plasmid  pRIa.1. The  800 base pair cDNA insert  coding for a rat Ia I-A a chain was i d e n t i f i e d in this way.  2. Plasmid DNA Preparation (Bolivar and Backman, 1979) Media and Solutions: Luria-Bertani (LB) Medium (1 ,.0g Bacto dextrose, 5.0g Bacto extract,  10.Og Bacto  tryptone,  yeast  10.Og NaCl made up to 1 l i t r e  with d i s t i l l e d water (dH 0) and the pH adjusted to pH 2  7.2.  All  Bacto products were from Difco Laboratories, Detroit, Mich.) TEN-8  OOOmM  NaCl,  1OmM  Tris(hydroxymethyl)aminomethane-HCl  (Tris-HCl) pH 8.0, 1mM disodiumethylenediaminetetra-acetic  acid  (EDTA). pH to 8.0 ) Lysis Solution (20% Sucrose, 50mM Tris-HCl pH 8.0) Agarose Gel Electrophoresis Buffer acid, 2mM EDTA. pH to 8.0 )  40mM  Tris-HCl,  20mM acetic  25  Method: One l i t r e  of  LB  medium  (lOMg/ml)  was  of E . c o l i  strain RR1 c e l l s containing  at  37°C  in  containing  tetracycline  inoculated with 10ml of fresh overnight cultures plasmid pRIa.2 and  grown  a shaking water bath. At an absorbance at 600nm of  0.7 , 1.2ml of freshly made  chloramphenicol  (160mg/ml  in  95%  , ethanol) was added and the c e l l s were shaken for 12 to 16 hours. Cells  were centrifuged at 5000 rpm for 15 minutes in a GSA  rotor in a Sorvall RC-5B centrifuge. Each p e l l e t was resuspended in 25.0ml s t e r i l e TEN-8, transferred to 50ml polycarbonate tubes and centrifuged  in a SS-34 rotor at 5000 rpm for 15 minutes.  Each p e l l e t was resuspended in 20.0ml of l y s i s solution and 1.0ml freshly dissolved lysozyme (1Omg/ml in 150mM 8.0  )  and  Tris-HCl  pH  1.0ml 0.25M EDTA pH 8.0 were added. The mixture was  swirled and l e f t on ice for 15 minutes. To each tube  was  1.0ml ribonuclease-A (Sigma type I-A, St. Louis, Mo.,  2 mg/ml in  dH 0,  previously  2  v/v.Triton X-100  added  heated to. 100°C for 5 minutes) and 10.0ml 10% (BioRad,  Richmond,  Calif.)  in  dH 0  .  2  The  mixture was swirled and l e f t at room temperature for 5 minutes . The  lysed c e l l s were centrifuged at 15000 rpm for 30 minutes in  a SS-34 rotor. The resulting supernatants were  extracted  with  1/2 volume phenol and 1/2 volume chloroform:isoamylalcohol (24:1 v/v).  The  DNA  in the aqueous layer was precipitated by adding  1/10 volume 2M NaCl and one volume 100% placed  at  -20°C  isopropanol  and  being  for a minimum of 1 hour. Precipitated DNA  c o l l e c t e d by centrifugation  at  2700  rpm  in  a  Beckman  was TJ-6  benchtop centrifuge for 30 minutes, a i r dried for 10 minutes and dissolved  in 1.0ml TEN-8. Plasmid DNA was reprecipitated by the  addition of 1/10 volume 2M NaCl and three  volumes  95%  ethanol  26  and  storing  at  -20°C  for  4  to  16  hours.  precipitates were washed with 95% ethanol, and  dissolved  in  1.0ml  TEN-8.  chromatographed on a Sephacryl-1000 1.6 cm)  run in TEN-8 to separate  absorbance  at  260nm  of  dried  Plasmid  resulting  under DNA  vacuum  was  then  (Pharmacia) column (100 cm X  tRNA  each  The  from  plasmid  f r a c t i o n (2ml) was  aliquots from fractions containing plasmid DNA  DNA.  The  recorded and  were analysed  by  electrophoresis on a horizontal 1% agarose gel (170X120x5mm) run at  150  volts  for  40  minutes  in agarose gel electrophoresis  buffer. Fractions containing plasmid DNA ethanol 1.0ml an  as  described  above.  were precipitated  The precipitate was dissolved in  dH 0 and the concentration of plasmid DNA 2  absorbance  of  260  nm,  with  20  OD  units  calculated.  At  was equivalent to a  concentration of 1mg/ml DNA.  3. Isolation of cDNA Inserts .  Plasmid DNA, restriction  .  200/ig, was digested  enzyme Pst I. Digested DNA  to  completion  with  the  was electrophoresed on a  1% agarose gel containing ]nq/ml ethidium bromide and run at 250 v o l t s for 40 to 60 minutes (section 2). DNA to  linearized  bands  pBR322 and inserted fragment DNA  corresponding were visualized  with long wave u l t r a v i o l e t (u.v.) l i g h t . To elute the fragment  DNA  a  thin  s l o t , 3 to 5 mm  razor blade d i r e c t l y in front visible  band  representing  of the  and  inserted  in width, was cut with a parallel  to  the  u.v.  inserted fragment. The gel was  electrophoresed such that the buffer touched the gel  at  either  27  end  but did not submerge i t . The  the gel was of  the  slot which had been cut out of  f i l l e d with fresh electrophoresis  DNA  into'the buffer f i l l e d slot was  long wave u.v.  l i g h t . The current was  traversed  to  the  containing DNA  was  slot  was  buffer.  other  side  of  followed using the  stopped the  slot  transferred to a s t e r i l e  Progress  before and  the  the  plastic  DNA  buffer  tube.  The  r e f i l l e d with fresh buffer and this process repeated 4  times to  allow  for  maximal  precipitated  at  resulting DNA  p e l l e t was  DNA  -20°C overnight  recovery. as described  DNA  was  ethanol  in.section 2.  dissolved in dH 0 to a concentration 2  The of  1mg/ml.  4. R e s t r i c t i o n Enzyme Mapping of cDNA Cloned Inserts  cDNA  inserts  restriction insert was  were  enzyme  analysed  digests. . A  by  single  2ng. aliquot  incubated with 2 units of each r e s t r i c t i o n enzyme for  used  were: Alu I, Ava  Eco RI, Hae  I I I , Hha  Sau  Sau  IIIA,  from  Gaithersburg,  MD.  Sma  non-denaturing 29:1(w/w);  HI, Bgl I, Dde  II, Nei I, Pvu  Research  used.  II,  Laboratories  Sal I, Xho  I, I, I.  Inc.(BRL),  Enzyme digests were carried out under reaction  DNA  BRL. was  polyacrylamide  BioRad  enzyme  I, Sst I, Taq I, Tha I, Xba  Bethesda  conditions recomended by digested  I, Ava II, Bam  I, Hin FI, Mbo  961,  Enzymes were  The  double  of purified-cDNA  60 to 90 minutes at 37°C or 65°C depending on the Enzymes  and  ,  analysed gel  by electrophoresis on a 5% (acrylamide:bis  acrylamide  Richmond, C a l i f . ) size 180x160x1.5mm. The  28  gel was run in 1/2 X TBE (40mM Tris-HCl, 40mM EDTA,  pH  acid,  bromide  (1Mg/ml  in dH 0)  and  the  sensitivity  2  photographed  under  light. To  increase  the  cDNA  insert  radioactively labelled . Fragments of the cDNA insert of generated  by  Hpa  II  was  pRIa.2  r e s t r i c t i o n enzyme digestion were l a b e l l e d by the  extension of a recessed 3' end. were  1mM  8.3) at 100 v o l t s for 2 hours. Gels were stained with  ethidium u.v.  boric  and  Hin  The  restriction  enzymes  used  FI. Each of these enzymes recognizes a  s p e c i f i c four base pair sequence and cleaves  the  DNA  to  give  fragments with a 3' recessed end. The cDNA (2^g) was digested in the  appropriate  buffer in a f i n a l volume of 15M1 by incubation  at 37°C for 90 minutes. To digested  DNA  label  (in 15MD was  the  3'  recessed  ends,  the  heated to 68°C for 5 minutes and  allowed to cool to room temperature. To this 1 jul  dithiothreitol  (50mM),  1^1 DNA Polymerase I (Klenow Fragment) (2 units/jul, New  England  Nuclear,  Boston,  deoxyribonucleotide  Mass.)  and  15juCi • of  and  minutes.  the  32  deoxyribocytidine  triphosphate  was  labelled  (a- P-dCTP)  digested with Hin FI was labelled with  After  were  reaction carried out at room temperature for 15  cDNA digested with Hpa II  triphosphate  32  triphosphate (a- P-dNTP) (lOmCi/ml in 1OmM  Tricine,2500 Ci/mmole; New England Nuclear, Boston, Mass.) added  a- P-  32  with and  a- P32  the cDNA  a- P-deoxyriboadenosine 32  (a- P-dATP). 32  incubation the reaction mix was phenol extracted (as  described in section 2 ) and chromatographed on a 9ml column of Sephadex-G50  Fine (Pharmacia) in TEN-8. Fractions of 400^1 were  c o l l e c t e d and those containing the radioactive DNA  were  pooled  29  and  ethanol  precipitated  section 2) , The ethanol,  dried  overnight  precipitated under  cDNA  vacuum  and  aliquot of the l a b e l l e d cDNA was second  restriction  run on a above.  5% The  enzyme.  non-denaturing gel  was  at -20°C (as described was  washed  dissolved  subjected  once  in 2  digestion  by  Single and double digested DNA gel  as  a was  described  dried down under vacuum at 60°C for two  three hours and then exposed to X-ray f i l m (Kodak X-Omat which was  95%  in 25jul dH 0. An  to  polyacrylamide  in  to  XAR-2)  developed after 48 hours.  5. Nick Translation (Melgar and Goldwaith,1968; Maniatis et al.,1975; Rigby et a l . , 1977) Nick  translation  the following  of  cDNA fragments was  conditions:  (a) Deoxyribonuclease (DNase) Activation: dH 0,  Boehringer Mannheim, Indianapolis,  2  carried out under  DNase Activation Buffer  (1OmM  nuclease  serum  free  bovine  T r i s pH  DNase Ind.)  7.5,  albumin  (BSA)  was  5mM  The activated DNase I solution was  5 and  120 minutes. Prior to addition  reaction, of 1/100  the DNase I was and  1/10  to  (img/ml  in  diluted with  MgCl , 2  img/ml  (Enzo Biochemicals  Inc.,New York,NY.)) to give a f i n a l concentration I/ml.  I  of 100Mg DNase  l e f t on ice for between the  nick  translation  further d i l u t e d by 2 s e r i a l d i l u t i o n s  into DNase Activation  Buffer.  This  gave  an  activated DNase I solution of I00ng/ml. (b) Nick Translation Reaction:  To  a  1.5ml  following were added on ice : 5/xl 10 X Nick  microfuge tube the Translation  Buffer  30  (500mM  Tris-HCl pH7.5, 50mM MgCl  1 iul BSA (2mg/ml),  ), 1yl d i t h i o t h r e i t o l (50mM),  2  2yl deoxyriboguanosine  triphosphate  (dGTP)  (500yM), 2yl deoxyribothymidine triphosphate (dTTP) (500yM), 2yl deoxyriboadenosine  triphosphate  deoxyribocytidine triphosphate (l0mCi/m1,  2000  Ci/mmole,  (dATP)  (dCTP)  (35yM),  32  Mass.), 1yl C a C l  Polymerase  32  New  England  Solution  2  DNA  4yl a- P-dATP  OOmM), 2yl cDNA fragment  2  I9.5yl dH 0, 2.5yl Activated DNase I 1yl  2yl  New England Nuclear, Boston, Mass.)  4yl a- P-dCTP (lOmCi/ml, 2000 Ci/mmole, Boston,  (35yM),  Nuclear,  (250 yg/ml)  (I00ng/ml), and  I (8 units/yl,New England Nuclear, Boston,  Mass.). The reaction mix was  gently  mixed,  centrifuged  in a  microfuge and incubated at 15°C for 90 minutes. After  incubation  3yl c a r r i e r tRNA (1Omg/ml,Sigma type X,  St. Louis, MO.) was added. The mix was heated minutes  and chromatographed  precipitated  for 5  on a Sephadex G-50 Fine column (see  section 4). Fractions containing radioactive ethanol  to 68°C  overnight  at -20°C  DNA  were  as before  p r e c i p i t a t e dissolved in I00yl dH 0. The average 2  pooled, and the  incorporation  was 60 X 10 cpm/yg DNA. 6  6. Colony Hybridisation (Grunstein and Hogness, 1975) E.coli from out  total  strain RR1 c e l l s containing a cDNA l i b r a r y prepared r a t spleen poly(A)-RNA  on LB medium  (I0yg/yl)  to give  plus  (see section 1) were plated  1.5% agar  containing  tetracycline  approximately 300 to 400 colonies/plate and  grown overnight at 37°C. Circular 82mm  diameter  nitrocellulose  31  filters were  ( BA 85 0.45/Ltm, Schleicher and Schuell Inc., Keene, NH.)  autoclaved,  numbered with soft lead pencil and then placed  c a r e f u l l y , number side down, on top were  gently  pushed  of  the  colonies.  Filters  onto plates and the number from the f i l t e r  traced onto the bottom of the plate. After 5 minutes the f i l t e r s were gently peeled off and placed colony side made  LB  medium  plus  1.5%  agar  (lOOMg/yl). F i l t e r s were incubated 37°C  to  containing on the  amplify the plasmid DNA contained  filters  of DNA on n i t r o c e l l u l o s e were  chloramphenicol overnight  at  in the colonies. The been  removed  were  with  0.5M  filters  removed from the chloramphenicol plates  and placed colonies up on saturated  freshly  to regrow the colonies that had been pulled o f f .  (a) Immobilisation The  onto  plates  o r i g i n a l plates from which the colonies had incubated  up  Whatman  3MM  paper  which  had  been  NaOH, 1.5M NaCl. F i l t e r s were l e f t for 20  minutes and then transferred to f i l t e r paper and a i r dried for 5 minutes. This step was then repeated. F i l t e r s to  were  transferred  Whatman 3MM paper saturated with 1.0M Tris-HCl pH 7.5 for 20  minutes, a i r dried for 5 minutes and then placed on Whatman paper  saturated  with  0.5  M  Tris-HCl  (pH  7.5), 1.5 M NaCl.  F i l t e r s were a i r dried for 30 minutes and baked at hours.  3MM  68°C  for 3  32  (b) Hybridisation Solutions 1 X SSC (0.15M NaCl, 0.015M Na C i t r a t e , pH 7.0) 1 X Denhardt Solution 0.04%  (0.04% F i c o l l , 0.04% polyvinylpyrrolidone,  BSA a l l from Sigma, St. Louis, MO. (Denhardt,1966)  Pre Hybridisation Solution Hybridisation Solution  (6 X SSC, 1 X Denhardt  (6  X  SSC,  Solution)  1 X Denhardt Solution, 0.5%  sodium dodecylsulphate (SDS), 1mM EDTA, 0.5mg/ml c a r r i e r  E.coli  DNA (Sigma type VIII, St. Louis, MO.) ) Method . F i l t e r s  were  placed  solution at 68°C for a minimum  of  in 500ml 2  hours  prehybridisation in a  pyrex  dish  (20X20cm). Just  before use, the nick-translated probe DNA (section 5)  was denatured. The following minutes  :  were  100M1 radioactive  incubated  probe  at  37°C  for 30  DNA (0. 2X1 0 cpm/Ml) , 1 5/xl 6  c a r r i e r pBR322 DNA (800Mg/mg) and 3*il NaOH (4M) to give a volume  of  120M1.  The  final  denaturation mixture was neutralized by  addition of 1.5M NaH PO„ to a f i n a l concentration  of 0.15M. The  denatured  was  2  probe  (approximately  preheated hybridisation solution  10 cpm/filter) s  in a  to  DNA  was  (2ml/filter).  Hybridisation solution containing placed  added  the radioactive  p e t r i dish. F i l t e r s were then c a r e f u l l y placed in  the solution (10 f i l t e r s / p l a t e maximum) such that there were air  bubbles  no  in between the f i l t e r s . An exposed piece of X-ray  film cut to the dimensions of a p e t r i dish was placed on top of the  filters  to  ensure  the  f i l t e r s were kept immersed in the  hybridisation solution and out of contact  with  a i r . The  petri  33  dish  was then placed in an a i r tight container and incubated at  68°C for a minimum of 6 hours.  (c) Washing After hybridisation the f i l t e r s were rinsed twice SSC  in 2 X  to remove the majority of non-hybridised probe DNA. F i l t e r s  .were then washed three times for 2 hours in 1 X SSC, 0.5% SDS at 68°C (500ml per wash), rinsed in 2 X SSC and a i r dried on f i l t e r paper (approximately 60 minutes). F i l t e r s were exposed to X-ray film  (Kodak  X-Omat  XAR-2)  for 2  days.  Colonies which were  i d e n t i f i e d as positives were isolated from the o r i g i n a l plates  and  the plasmid  DNA  they  regrown  contained analysed for the  presence of a cDNA insert.  7. Maxam and Gilbert Sequencing (Maxam and G i l b e r t , 1980, as modified by Dr. C. A s t e l l , Dept. of Biochemistry, University of BC)  (a) End Labelling Of Fragments With 3' Recessed Ends cDNA was l a b e l l e d at the 3' end exactly  as  described  in  section 4. In addition to the r e s t r i c t i o n enzymes Hpa II and Hin FI,  the enzymes Eco RI and Sau 3A were also used to digest cDNA  fragments to be used for sequencing. fragments  were  labelled  with  The  Eco RI  a- P-dATP. 32  To  and the  l a b e l l i n g the Eco RI fragments, 25juM unlabelled dATP and  incubation  Sau 3A reaction  was  added  was carried out for an additional minute. After  the l a b e l l i n g reaction, the DNA was isopropanol precipitated at  34  -20°C for a minimum of 30 minutes as described  (b) Gel Electrophoresis And Precipitated  DNA  in section  Isolation Of Labelled Fragments  was  washed  in 95% ethanol, dried under  vacuum for 10 minutes, dissolved in 5jul dye mix  (1.5%  TBE,0.05% xylene cyanol,0.05% bromophenol blue ) and a  2.  ficoll,1X loaded onto  5% nondenaturing polyacrylamide gel (see section 4) . The  was  run at 200 V for 60 to 90 minutes depending on the  fragments  and the separation  required. The gel was  to  visualize  the  locations of the DNA  gel. Labelled fragments were cut out of the gel  size  of  then exposed  to X-ray f i l m (Kodak X Omat XAR-2) for 10 minutes and developed  gel  the  film  bands on  the  placed  in  and  d i a l y s i s tubing with 400M1 elution buffer (1/2 X electrophoresis buffer).  The  DNA  d i a l y s i s bags potential  was  electroeluted from the gel by placing the  perpendicular  radioactive  s i l i c o n i z e d , s t e r i l e 1.5ml a  the  current  and  applying  a  difference of 230 V for approximately 40 minutes. The  elution' buffer containing  with  to  further  centrifuged  in  polyacrylamide  100M1 a  and  was  transferred  microfuge tubes and the tubing of  elution  microfuge the  DNA  for  5  supernatant  buffer.  The  minutes  to  was  "to  rinsed  eluate pellet  transferred to a  was any new  tube. Labelled fragments were then ethanol precipitated at -20°C overnight  as described  in section  2.  (c) Double Labelled Fragments Cleavage of the DNA than one  recognition  with r e s t r i c t i o n enzymes which had more  site  within  the  cloned  cDNA  fragment,  35  resulted in fragments which were labelled at both ends. In order to  obtain  a  single  labelled  fragment  necessary  for  sequencing, double labelled fragments were either digested an  enzyme  (as  described  labelled fragment or the below).  in  section  fragment  DNA with  4) which cut within the  was  strand  separated  (see  Either method resulted in two single labelled fragments  which were electrophoresed on a 5% non-denaturing  polyacrylamide  gel and isolated as described above.  (d) Strand Separation To strand separate double-labelled fragments, DNA  was dissolved in 40M1 of 'Strand Separation Solution (30% v/v  dimethylsulphoxide (DMSO), 1mM and  precipitated  heated  to  EDTA, 0.05%  w/v  90°C for 2 minutes. The DNA  ice water and loaded immediately  bromophenol blue)  was quick-cooled in  onto a prerun 5%  non-denaturing  polyacrylamide g e l . The gel was run, with cooling, at 400 for  60  to  90  minutes  being separated. It separated  depending on the size of the fragments important  to  note  is  electrophoresed  on  double stranded DNA  migrates faster  than  species  DNA  is  and  the  two  single  strands as single labelled DNA  was  that  when  strand  polyacrylamide gels the the  single  stranded  stranded DNAs usually migrate at  d i f f e r e n t speeds thus allowing i s o l a t i o n of  The  volts  the  two  different  fragments.  electroeluted and precipitated as previously  described in section 7(b).  (e) End Labelling Of Fragments With 3' Extended Ends  36  To label fragments with 3' extended resulting  from  Pst  I cleavage  ends,  such  , a- P-cordycepin  fragment,  15/xl  minutes with 10/ul 5X l50mM  Tris-HCl  (2mM), 14M1 CLTricine,  5700  units/Ml, New  (600ng/;xl), TdT  pH 7.0 32  was  buffer  P-cordycepin  Ci/mmole,  potasium  (1OmM  2  The  cacodylate,  ), 2yl d i t h i o t h r e i t o l  triphosphate  New  used.  incubated at 37°C for 30  (700mM  ), 5yl CoCl  those  triphosphate  32  and terminal deoxynucleotidyl transferase (TdT) were cDNA  as  (7mCi/ml  in  10mM  England Nuclear) and 2yl TdT  (20  England Nuclear, Boston, Mass.).  After end  extracted  and  precipitated with ethanol as described in section 2. The DNA  was  then  digested  labelling  with Hpa  the  DNA  was  phenol  I I , which cut only once within the cDNA  fragment, and the 2 single labelled fragments were isolated from a 5% non-denaturing  polyacrylamide gel as previously described.  (f) Maxam and Gilbert Modification Reactions  SOLUTIONS:. Cacodylate Buffer (0.05M cacodylate, 0.1mM G-Stop Mix  (3M sodium acetate pH  6.0,  500Mg/ml tRNA (Sigma type X, St. Louis, Pyrimidine-Stop Mix  (0.3M  sodium  EDTA pH  2.5M  8.0)  2-mercaptoethanol,  MO.))  acetate, 0.1mM  EDTA, 83Mg/ml  tRNA) A-Stop Mix  (0.3M  sodium acetate, 0.1 mM EDTA, 0. 5mM  ATP,  83jtzg/ml  tRNA). The dH 0 2  and  single  labelled  aliquoted  for  DNA the  fragments were taken up in 32/zl 4  base-specific  modification  reactions. The modifications were carried out as in Table I.  Table I  Maxam and Gilbert Modification Reactions  BASES  MODIFIED  REACTION CONDITIONS  C •»• T  2 0 ,Ul 5M N a C l 1jul E . c o l l DNA 5ul P-DNA  START  AT  REACTION  —  BASE MODIFYING SOLUTION  AT  STOP  REACTION  MIX  min.  30ul hydrazIna  I N C U B A T E AT  STOP  0  R.T. ...  10 m i n .  300ul Pyr-STOP I.Oml  EtOH  G  300ul Cacody1 a t e lul E.coll DNA 5ul P-DNA  1 min.  T  A  15ul dH20  lOul dH20  lul E.coll DNA lOul P-DNA  2 min.  2ul OMS  30ul hydraz1na  R.T.  R.T.  4 min.  50ul G-STOP 1.0ml  EtOH  + G  7 min.  1ul E . c o H DNA lOul P-ONA  3 min.  3ul 10% f o r m i c acid  37'C  13 m i n .  300ul Pyr-STOP  300ul A-STOP  1.0ml  1.0ml  EtOH  EtOH  38  After  the addition of 1.0ml 95% ethanol (kept on dry i c e ) ,  the tubes were placed immediately bath  to precipitate  into a -70°C  dry ice/ethanol  the DNA and to ensure the reactions were  stopped. After f i f t e e n minutes, the tubes were centrifuged in a microfuge  for 10  minutes  and  the supernatant removed with a  drawn-out Pasteur pipet. The DNA was sodium at  in 250M1  0.3M  acetate (pH 6.3) and precipitated with 1.0ml 95% ethanol  -70°C.  The  precipitated 1.0ml  dissolved  DNA  with  was  then  dissolved  in  lOjil  dH 0 2  and  1.0ml 95% ethanol as above, washed once with  95% ethanol and dried in a vacuum dessicator.  (g) Piperidine Cleavage Reaction DNA p e l l e t s were dissolved  in  100M1 of  freshly  diluted  piperidine 1/10 (v/v) in dH 0. Caps on the tubes were lined with 2  teflon  tape  to provide  a  tight seal and prevent l i q u i d from  escaping or entering the tube. The DNA was heated to 90°C for 30 minutes,  freeze dried under vacuum (approximately 2 to 3 hours),  resuspended  in 20M1 dH 0 2  hour), resuspended  and  freeze  dried  (approximately  1  in a further 20M1 dH 0 and freeze dried again 2  to ensure that the piperidine was removed.  (h) DNA Sequencing  Gels  Polyacrylamide gels were prepared as described in Table I I . The  g e l size  was 360 X 200 X 0.35 mm and a l l gels were run in  1/2 X TBE ( see section 4).  39  Table II  DNA Sequencing Gels  on UREA lOx 40%  TBE  ACRYL-  25a 2.5ml 9.5g  AMIDE (19:1) dH20  ACRYL-  AMPS™"' TEMED  TOTAL  VOL  25a  2.5ml  2 . 5ml  10ml  7.5ml  20m 1  21 .7ml  AMIDE 0.5a  BIS  27.2ml  Warm t o 4 2 ' C t o d i s s o l v e Degas  10%  25o  0r33ml  UREA  0~33mr~"1  15ul  15ul  50ML  50ML  1  0.33ml 15ul  50ML  40  (i) Gel Electrophoresis After the f i n a l freeze drying, the  radioactivity  of  each  tube was determined and the DNA dissolved in a volume of dye mix (80% formamide(deionized) , 0.1% xylene cyanol, 0.1% bromophenol blue,  1OmM  NaOH, 1mM EDTA), such that there were twice as many  counts/Ml in the C + T and A + G tubes as there were and  A  tubes.  The  the  T  optimal volume of dye mix loaded into a gel  slot was 4M1, therefore the DNA  in the tube containing the least  r a d i o a c t i v i t y was dissolved in 4/nl of dye mix per DNA  in  gel  and  the  in the other tubes was dissolved accordingly. DNA  was heated to 90°C for 3 minutes, quick-cooled in i c e -  water, immediately loaded electrophoresed  at  onto  prerun  gels  above)  and  37 watts. The 20% gels were electrophoresed  u n t i l the bromophenol blue had migrated 20cm point  (see  (approximately  from  the  loading  75 minutes), the top plate of the gel was  then removed and the gel was covered in Saran Wrap. 8% gels were electrophoresed for 90 and transferred to Whatman 3MM  180  minutes.  The  gels  were  then  f i l t e r paper, covered with Saran Wrap  and dried at 80°C under vacuum for 20 minutes. The dried gel was then  exposed  to  X-ray film (Kodak X-OMAT RP) for one to three  days depending on the number of counts loaded onto the some  cases  intensifying  g e l . In  screens were used (Dupont Cronex Xtra  Life,Wilmington,DE.).  (j) DNA  Sequence Analysis  A computer program written by Dr. used to store and analyse DNA  A.  Delaney  sequence data.  (1982)  was  41  RESULTS AND DISCUSSION  I  DNA SEQUENCE ANALYSIS OF THE cDNA INSERT OF pRIa.2  (a) Sequencing strategy In Figure 2 the strategy used to sequence the in  pRIa.2  i s shown. The sequencing  cDNA  insert  was done by the methods of  Maxam and Gilbert(1980), as described in Materials and  Methods.  The cDNA insert was digested with r e s t r i c t i o n enzymes which gave a staggered cut at a 4 base pair recognition sequence to give 3' recessed  ends. The ends were then l a b e l l e d with the appropriate  a- P-dNTP  using DNA Polymerase  fragments  were  32  ends produced by  I  (Klenow  fragment)  and  the  then recut or strand separated. The 3' extended Pst  I  cleavage  were  labelled  with  a- P32  cordycepin triphosphate using terminal transferase. Both strands of  the cDNA insert were sequenced using overlapping r e s t r i c t i o n  enzyme fragments.  42  Figure 2  The R e s t r i c t i o n Map and Sequencing Strategy of the cDNA Insert in pRIa.2 m  ON  <T  M  *J m  P-.  The  co  M M  M M  M M  to  3  9  a.  a  CO  restriction  recognition  n  rH Ol  o cn  o r•n  M fx*  M Pi  C  O  ifl -H to 33  map  shows  V  w  CM  NO M  a  •H  «  the  sequence.The  numbering  5'  the  of  4J  O  restriction  enzyme  s i t e s used for sequencing the cDNA i n s e r t of pRIa2.  The numbers i n d i c a t e the 5' nucleotide of  end  M  the recognition  s t a r t s following the p o l y ( G ) . t r a c t at the  i n s e r t . The horizontal arrows beneath the cDNA  insert i n d i c a t e the d i r e c t i o n and extent of sequencing. .  43  (b) DNA Sequence of the cDNA Insert of pRIa.2 The nucleotide sequence of the cDNA insert of pRIa.2 (see Figure 3) was 779 base pairs in length. At one end of the insert there was a tract of 18 guanine (G) nucleotides and at the other end  there  was a  Immediately preceding  tract  of 17 cytosine  (C) nucleotides.  the poly(C) tract was a tract of poly(A),  63 nucleotides in length. This poly(A) tract corresponded to the poly(A)  tail  of the mRNA  insert. There was a (Proudfoot  putative  and defined the 3' end of the cDNA polyadenylation  frame  there  was an  of 388 nucleotides ending in the stop codon  TGA. The open reading frame represented the  AATAAA,  and Brownlee,1976) 15 nucleotides 5' to the start of  the poly(A) t a i l . Following the 5' poly(G) tract open-reading  signal,  the coding  region for  carboxy terminal 129 amino acids of the Ia a chain. The 290  nucleotides following  the stop  untranslated region of the mRNA.  codon  corresponded  to a 3'  44  Figure 3 The Nucleotide Sequence of the cDNA Insert of pRIa.2  (G)  18  TCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGATCAATA  1 16  TCACATGGTTGAGAAACAGCAAGCCAGTCACAGAAGGCGTTTATGAGACCAGCTTCCTTT  176 CCAACCCTGACCATTCCTTCCACAAGATGGCTTACCTCACCTTCATCCCTTCCAACGACG 236 ACATTTATGACTGCAAGGTGGAGCACTGGGGCCTGGACGAGCCGGTTCTAAAACACTGGG 296 AACCTGAGGTTCCAGCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTGTGCCCTGGGGT  356 TGTCTGTGGGCCTCGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCCTGCGAT  416 CAGATGGCCCCTCCAGACACCCAGGGCCCCTTTGAGTCACACCCTGGGAAAGAAGGTGCG  476 TGGCCCTCTACAGGCAAGATGTAGTGTGAGGGGTGACCTGGCACAGTGTGTTTTCTGCCC  536 CAATTCATCGTGTTCTTTCTCTTCTCCTGGTGTCTCCCATCTTGCTCTTCCCTTGGCCCC  596 CAGGCTGTCCACCTCATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATT  656 TTTGGCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTGATGCTCCACCA  681 AACCAATAAACCTCTCATAAGTTGG f A) ( C )  63  17  The poly(G) and poly(C) t r a c t s at either represented  TGA  insert  are  by a bracketed G/C with a s u b s c r i p t representing the  number o f n u c l e o t i d e s . The poly(A) t a i l The  end of the  stop  codon  at  389  i s similarly  represented.  i s underlined as i s the putative  polyadenylation s i g n a l , AATAAA, at nucleotide 661.  The  numbers  above each l i n e represent the nucleotide number, s t a r t i n g at the first  nucleotide  following  the l a s t nucleotide preceding  the 5' poly(G) t r a c t and ending at the poly(A) t a i l at number 681.  45  (c) Comparison Of The DNA Sequence Of The cDNA Insert Of pRIa.2 With The Equivalent Regions In cDNA Coding For Mouse H-2 I-A And Human HLA-DC1 a Chains  To gain a better understanding molecules  encoded  by  of the evolution of  the MHC,  i t i s useful  equivalent genes and their gene products closely  to  in species  the Ia  study the which are  related such as mice and rats, which diverged only 8 to  10 m i l l i o n years ago, and far apart such as rodents and humans, which diverged approximately In  Figure  70 m i l l i o n years ago (Young,1950).  4 the nucleotide sequence of the cDNA insert of  pRIa.2 i s compared with the equivalent sequences of cDNA for  mouse  H-2 I-A and the human HLA-DC1 a chains. There i s 91%  DNA sequence sequence only  coding  identity  identity  between  are compared.  compared,  between  however,  When  rat and  mouse,  and  85% DNA  rat and human when coding sequences the 3'  untranslated  the rat and  identity, whereas the rat and  mouse  human  regions  sequences  sequences  are  show 82%  are only  27%  identical. This  difference  in sequence  identity between coding and  noncoding regions i s consistent with the proposal that noncoding regions are much more free from r e s t r a i n t s and diverge from another  in evolution  (Crick,1981). Coding evolutionary  much regions  restraints  or  more  rapidly  than coding regions  are maintained pressures  one  which  because  of the  act on the gene  products coded by the DNA. Non-coding regions are able to mutate and thus evolve at a much  higher  rate  because  the  selection  . 46  pressures regions. mRNA  of evolution  i s still to stabilize  If  this  unknown. mRNA  to stabilize  the  human  HLA-DC1  rat  290 n u c l e o t i d e  the  full  region  extent  et al.,1978;  t h e message.  region  untranslated  that  Zeeri  mRNA  I t i s  has  (not including  only  i sa t l e a s t  a  o f t h e 3' e n d h a s n o t b e e n  tail  may  o f mRNA to  also note  123 n u c l e o t i d e tail),  region.  184 n u c l e o t i d e s  of  al.,1981).  interesting  thepoly(A)  3' u n t r a n s l a t e d  et  region  on t h e s e  regions  thepoly(A)  t h e 3' u n t r a n s l a t e d  untranslated a  indirectly  or untranslated  I t i sthought  (Wilson  i s s o , perhaps  functions  has  t o a c t only  The f u n c t i o n o f non-coding  act  that  a r eable  i n  reported.  while  3'  the  T h e m o u s e 3' length  but  F i  H-2  I-A  Rat  Ia-A  HLA-DC1 H-2  I-A  Rat  Ia-A  HLA-DC1  9  u r ( J  4  Comparison  o f t h e N u c l e o t i d e Sequences o f t h e cDNA e n c o d i n g t h e a C h a i n s  10 20 30 40 50 TCAGCCCAACACCCTTATCTGCTTTGTGGACAACATCTTCCCTCCTGTGA *************** *********** *********** ********** TCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGA ********************* **** ********************* TCAGCCCAACACCCTCATCTGTCTTGTGGACAACATCTTTCCTCCTGTGG 60 70 80 90 100 TCAACATCACATGGCTCAGAAATAGCAAGTCAGTCACAGACGGCGTTTAT ***• ********* * ***** ****** ********** ********* TCAATATCACATGGTTGAGAAACAGCAAGCCAGTCACAGAAGGCGTTTAT * * * * * * * * * * * * •*** ** * * ************* **** * TCAACATCACCTGGCTGAGCAATGGGCACTCAGTCACAGAAGGTGTTTCT  H-2 I-A Rat Ia-A HLA -DC1 H-2 I-A Rat Ia-A HLA -DC1  360 370 380 390 400 TGCGATCAGGTGGCACCTCCAGACACCCAGGGCCTTTATGAGTCACACCC ********* **** ******************* * ************ TGCGATCAGATGGCCCCTCCAGACACCCAGGGCCCCTTTGAGTCACACCC *•*• *•*• *** * * * * * * * * * * * * * * * * * * • * * * *• ** *• TGCGTTCAGTTGGTGCTTCCAGACACCAAGGGCCCTTGTGAATCCCATCC 410 420 430 440 450 TGGAAAGGAAGGCGTGTGTCCCTCTTCATGGAAGAAGTGGTGTGCTGGGT * • * •* * * * * * * * * * * * * * * * * * * * * * * * • * * * * * **** TGGGAAAGAAGGTGCGTGGCCCTCTACAGGCAAGATGTAGTGTGAGGGGT *• •••***•** *• * • TGAAAAGGAAGGTGTTACCTACTAAGAGATGCCTGGGGTAAGCCGCCCAG  HLA-DC1  110 120 130 140 150 GAAACCAGCTTCTTCGTCAACCGTGACTATTCCTTCCACAAGCTGTCTTA •• * * • • * • • * * * * * * * * * * * * * * * * * * * * * * * * * * •* * * • * GAGACCAGCTTCCTTTCCAACCCTGACCATTCCTTCCACAAGATGGCTTA * * * * * * * * * * * * * * **••• *** * * * * * * * * * ****** *** GAGACCAGCTTCCTCTCCAAGAGTGATCATTCCTTCTTCAAGATCAGTTA  HLA -DC1  460 470 480 490 500 GACCTGGCACAGTGTGTTTTCTGGACCAATTTATGGTGTTCTTTTTCTTC ••••**•**•*****•••*•*•* * • * • • * •* * * * • • • • * * * * * * * GACCTGGCACAGTGTGTTTTCTGCCCCAATTCATCGTGTTCTTTCTCTTC * * * * * * * * * * CTACCTAATTCCTCAGTAACATCGATCTAAAATCTCCATGGAAGCAATAA  H-2  I-A  160 170 180 190 200 TCTCACCTTCATCCCTTCTGACGATGACATTTATGACTGCAAGGTGGAGC  H-2 I-A  510 520 530 540 550 TTCAAGTGACCCCCAACTTGCTTTTCCCTTGGCCCTGAGGCTGTCCCTCT  Rat  Ia-A  CCTCACCTTCATCCCTTCCAACGACGACATTTATGACTGCAAGGTGGAGC  Rat Ia-A  CCTCACCTTCCTCCCTTCTGCTGATGAGATTTATGACTGCAAGGTGGAGC  HLA -OCI  H-2  I-A  Rat  Ia-A  HLA-DC1 H-2  I-A  Rat  Ia-A  HLA-DC1 H-2  I-A"  Rat  Ia-A  210 220 230 240 250 ACTGGGGCCTGGAGGAGCCGCTTCTGAAACACTGGGAACCTGAGATTCCA ***•*•**••*** ****** **** ****************** ***** ACTGGGGCCTGGACGAGCCGGTTCTAAAACACTGGGAACCTGAGGTTCCA ************* ***** **** *********** ****** ***** ACTGGGGCCTGGATGAGCCTCTTCTGAAACACTGGGAGCCTGAGATTCCA 260 270 280 290 300 GCCCCCATGTCAGAGCTGACAGAGACTGTGGTGTGTGCCCTGGGGTTGTC •*•••**•*****••*•****•**•*****•* ***••*•****•••••• GCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTGTGCCCTGGGGTTGTC * •* * * * * * * * * * * * * * * • * * * • * • • * * * • • * **************  HLA-DC1  ACACCTATGTCAGAGCTCACAGAGACTGTGGTCTGCGCCCTGGGGTTGTC  H-2  I-A  310 320 330 340 350 TGTGGGCCTTGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCC ********* ****************************************  Rat  Ia-A  HLA-DC1  TGTGGGCCTCGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCC **••*•****•****•*• ******** *** **** ***** * ***** TGTGGGCCTCGTGGGCATTGTGGTGGGGACCGTCTTGATCATCCGAGGCC  H-2 I-A Rat Ia-A  H-2 I-A Rat Ia-A Rat Ia-A Rat Ia-A  Asterisks  TCCTGGTGTCTCCCATCTTGCTCTTCCCTTGGCCCCCAGGCTGTCCACCT • * * ATTCCCTTTAAGAGAAAA CACAGCTCACACACCCTTGGAATTC ** *•** ••* •*•••*•*•**• CATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATTTTTG GCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTGATGCT CCACCAAACCAATAAACCTCTCATAAGTTG  show p o s i t i o n s o f sequence  identity.  The s t o p codons a r e boxed. Data from B e n o i s t et a l . , 1 9 8 3 (H-2 I-A) and A u f f r a y e t a l . , 1 9 8 2 (HLA-DC1).  48  II_  PREDICTED AMINO ACID SEQUENCE OF THE CARBOXY TERMINAL END OF RAT Ia-A a CHAIN  (a) Translation of the cDNA Sequence The  predicted  amino  acid  pRIa.2 i s shown in Figure  5.  second  the G  nucleotide  after  sequence of the cDNA insert of  The  carboxy terminal 129 amino acids.  translation tail By  and analogy  starts  at the  corresponds to the with  the known  domain organization of the HLA-DR a chain (Korman et al.,1982b), the  predicted  amino acid sequence of the cDNA insert of pRIa.2  can be divided into several d i f f e r e n t first  91  amino  acids  structural  peptide,  a  remaining  consists 15  of  amino  acids  define  the  region which joins the a.2 domain to the  transmembrane region of the protein. itself,  The  correspond to the majority of the f i r s t  e x t r a c e l l u l a r domain (a2). The next 13 amino connecting  regions.  23  mainly  acids  are  The  transmembrane  hydrophobic thought  i n t r a c e l l u l a r l y and define the cytoplasmic  region  amino acids. The to  region.  be  located  49  \  5  Figure  Translation  of  cDNA  16  ACC THR  CTC LEU  AAT ASN  ATC ILE  ACA THR  ACC THR  CAG GLN  CCC PRO  AAC ASN  GTG VAL  ATC ILE  0  the Coding Sequence Insert  X  of  GTA VAL  GAC ASP  TGG TRP  TTG LEU  AGA ARG  AAC ASN  AGC SER  AGC SER  TTC PHE  CTT LEU  TCC SER  AAC ASN  CTC LEU  ACC THR  TTC PHE  ATC ILE  CCT PRO  GAG GLU  CAC HIS  TGG TRP  GGC GLY  CTG LEU  GAG GLU  GTT VAL  CCA PRO  GCC ALA  GCC ALA  CTG LEU  GGG GLY  TTG LEU  TCT SER  ATC ILE  TTC PHE  ATC ILE  ATT ILE  CAA GLN  CCA PRO  GGG GLY  CCC PRO  CTT LEU  TGA  sequence  of  •  GGC GLY  GTT VAL  TAT TYR  CAC HIS  AAG LYS  ATG MET  GCT ALA  TAC TYR  TAT TYR  GAC ASP  TGC CYS  AAG LYS  GTG VAL  AAA LYS  CAC HIS  TGG TRP  GAA GLU  CCT PRO  GAG GLU  ACT THR  GTG VAL  GTC VAL  ATC ILE  GTG VAL  GTG VAL  GGC GLY  CCC PRO  TCC SER  AGA ARG  The  predicted  is  shown.  G  tail.  The  amino  Figure  4.  Cysteine  bonding  a r e marked  marked  (0).  GTC VAL  ACA THR  GAA GLU  CCT PRO  GAC ASP  CAT HIS  TCC SER  TTC PHE  TCC SER  AAC ASN  GAC ASP  GAC ASP  ATT ILE  GAC ASP  GAG GLU  CCG PRO  GTT VAL  CTA LEU  ATG MET  TCA SER  GAG GLU  CTG LEU  ACA THR  GTG VAL  GGC GLY  CTC LEU  GTG VAL  GGC GLY  GGC GLY  CTG LEU  CGA ARG  TCA SER  GAT ASP  91  136  181  226  271  316  361  346  391  acid  Translation numbers  CCA PRO  301  376  CAC HIS  AAG LYS  CCC PRO  331  GGC GLY  CCT PRO  256  286  •>  CCT PRO  211  241  ACC THR  TTT PHE  166  196  TGT CYS  ATC ILE  121  151  X  AAC ASN  76  106  GAG GLU  46  31  TTT PHE  61  the  pRIa.2.  TGC CYS  ATC ILE  of  starts at  correspond residues (X).  The  the  to  which  t h e cDNA  insert  second nucleotide  the may  putative  of  pRIa.2  after  the  nucleotide  numbering  of  be  in  involved  glycosylation  disulphide site  is  50  (b) The Amino Acid Sequence Predicted From The cDNA Insert Of pRIa.2 Compared With The Corresponding Mouse H-2 I-A And Human HLA-DC1 a Chain Sequences  A comparison of the amino  acid  sequences  predicted  from  cDNA corresponding to the rat Ia-A, mouse H-2 I-A and human HLADC1  a  chains  i s shown in Figure 6. The data from Figure 6 i s  summarised in Table I I I . The overall sequence identity regions  of  the a chains available for comparison  i s 90.7% when  rat Ia-A and mouse H-2 I-A a chains are compared. sequence  identity  drops  to  for the  The  overall  81.4%, however, when rat Ia-A (or  mouse H-2 I-A) are compared to the human HLA-DC 1 y  g  chain. Not  s u r p r i s i n g l y , the rat and mouse proteins are more similar to one another  then  either i s to the human protein. It i s interesting  that both rodent compared  g  chains  differ  to  the same  extent  when  to the human a chain, even though both rodent proteins  have diverged from one another.  51  The amino a c i d sequences f o r the equivalent regions of Ia-A  a, mouse H-2 I-A a (Benoist et al.,1983) and human HLA-DC1  a (Auffray et al.,1982) residues  are marked  are "compared.  with  residues by an open c i r c l e refer  the r a t  a  The  Ig-like  conserved  cross (+), and the MHC conserved  (O). The  numbers  below  the  lines  to the numbering of the human HLA-DC1 a chain (Auffray et  al.,1982).  The amino acids d e f i n i n g the borders of  domains are a l s o numbered.  the p r o t e i n  52 F i g u r e 6 Comparison of the Amino A c i d Sequences  of the  a C h a i n s of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1. • H-2  I - A  RAT  I a - A ;  :  HLA-DC1  •  G L N PRO A S N THR L E U  :  G L N PRO A S N THR L E U I L E C Y S • • • • • • a G L N P R O A S N 104  •  •  I L E C Y S P H EV A LA S PA S N I L E P H E P R O  P R O  P H EV A LA S PA S N I L E P H E P R O P R O • • • • • • •  T H R L E U I L E C Y S L E UV A L A S P A S N I L E P H E P R O P R O 1 1 8 •  H-2  I - A  V A L I L E A S N I L E T H R T R P L E U ARG A S N S E R L Y S S E R V A LT H R  A S P  RAT  I a - A :  V A L I L E A S N I L E THR T R P L E U A R G A S N S E R L Y S P R O V A LT H R  G L U  •  • • • • •  •  HLA-DC1  :  V A LV A LA S NI L E T H R T R P L E US E RA S N G L YH I S S E R V A LT H R G L U ' 1 3 3  H-2  I - A  :  G L Y V A L T Y RG L U T H R S E R P H EP H E V A L A S N A R C A S P T Y R S E R  RAT  I a - A :  •  • • • • • • •  •  G L Y V A L T Y RG L U THR S E R P H EL E U S E RA S N P R O  O  •  P H E  ••  A S P H I S S E R  • •  P H E  • • • •  H L A - D C 1  :  G L YV A L S E R G L UT H R S E R P H E L E US E R L Y S S E R A S P H I S S E R  H-2  I - A  :  H I S L Y S  RAT  I a - A :  •  0  P H E 148  L E U S E R T Y RL E U T H R P H E I L E P R O S E RA S P A S PA S P  • • ..  • • • • • • •  I L E  • ••  H L A - D C 1  :  H I S L Y S M E TA L A T Y RL E U T H R P H E I L E P R O S E RA S N A S P A S P • • • • • • P H E L Y S I L E S E R T Y R L E UT H R P H E L E UP R O S E R A L A A S P G L U  H-2  :  T Y RA S P C Y S L Y S V A LG L U H I S T R PG L Y L E U G L U C L U P R O V A L  L E U  T Y RA S PC Y S L Y S V A L G L U H I S T R PG L Y L E U A S P C L U P R O V A L T Y R A S P C Y S L Y SV A L G L UH I S T R P C L Y L E UA S P C L UP R O L E U  L E U L E U  • I - A  RAT I a - A : H L A - D C 1 :  •  •  •  .  •  .  •.  • • • • • • • •  I L E • I L E 1G3  . •  • •• 178  O H-2  H L A - D C 1  L Y S H I S L Y S H I S • • t _ • L Y S H I S  H - 2  I - A  :  RAT  I a - A :  RAT  I - A : I a - A :  T R PG L U P R O G L U I L E P R OA L A P R OMET S E R G L U L T R P G L U P R O G L U V A L P R OA L A P R OMET S E R G L U L • • • • • • • • • T R P G L U P R O G L U I L E P R O T H R P R O M E T S E R G L UL  E U T H R E U T H R • • E U T H R  181 1 8 2 1 9 3 G L U T H R V A LV A L C Y S A L AL E U G L Y L E U S E R V A LG L YL E U V A L G L Y G L U T H R V A LV A LC Y S A L AL E U G L Y L E U S E R V A LG L Y L E U V A L  G L Y  H L A - D C 1  :  G L UT H R V A L V A L C Y S A L A L E UG L Y L E US E R V A L C L Y L E UV A L G L Y 194 1 9 5 2 0 8  H-2  I - A  :  I L E V A LV A L G L Y THR I L E P H E I L E I L E G L N G L Y L E U A R GS E R  RAT  I a - A :  H L A - D C 1  :  I L E V A LV A LG L Y • • • • •  THR I L E P H E I L E I L E G L N C L Y L E U A R GS E R • • • • • > •  I L E V A LV A LG L YT H R V A L L E U I L E I L E A R GG L YL E UA R GS E R 217  H-2 RAT  I - A  :  I o - A :  H L A - D C 1  2 1 8  G L Y A S P V A L  2 2 3  53  Table III Comparison of the sequence i d e n t i t y between the a chains of Rat Ia-A, Mouse H-2 I-A and Human HLA-DC1.  RAT DOMAIN  Ia-A  % SEOUENCE IDENTITY  /MOUSE H-2  I-A  NUMBER OF AMINO ACIDS COMPARED  RAT  I a - A /HUMAN HLADC 1  % SEOUENCE IDENTITY  NUMBER OF AMINO ACIDS COMPARED  MOUSE H-2/HUMAN I-A HLA-DC1 %  SEOUENCE IDENTITY  NUMBER OF AMINO ACIDS COMPARED  2 (104-181  88. 5%  69/78  79.5%  62/78  78.2%  61/78  CP • (182-194  92.3%  12/13  84.6%  11/13  92.3%  12/13  TM (195-217!  1O0%  23/23  91.3%  21/23  91.3%  21/23  CYT (218-232)  86.7%  13/15  73.3%  11/15  73.3%  11/15  OVERALL  90.7%  117/129  81.4%  105/129  81.4%  105/129  References are the same as for Figure 6.  54  Although identity,  the overall  between  these  homology,  proteins  in terms  i s high  of  there  sequence  are quite  d i f f e r e n t levels of homology for the different domains. In Table III  the  sequence  i s divided  into  domains  or  regions  structural difference and the percent sequence identity rat  a  chain  i s compared  to  the mouse  of the  and human a chains.  Although the homology between rat and mouse i s higher than between  rat  and  human,  those  of  domains  showing  that  the  least  conservation between mouse and rat are the same domains with the least homology between human and r a t . The different functional regions are discussed  in d e t a i l  below. The Cytoplasmic cytoplasmic for  this  The  least  conserved  t a i l . The homology between mouse and region  cytoplasmic  tail  approximately  and  between  i s 15  human  amino  and  acids  region  i s the  rat i s 86.7%  rat i s 73.3%. The  in  length  and  is  '50% hydrophilic in nature. This region i s thought  to be important are  Tail  in anchoring  the protein in the membrane.  There  3 basic residues within the cytoplasmic t a i l . It i s thought  that the presence of such residues protein  may  act to  stabilize  the  in the membrane. This may occur by interactions between  negatively phospholipids  charged  phosphate  and  the p o s i t i v e l y  groups  of  charged  the  basic  membrane amino acids  (Bretscher, 1975). Clusters of basic amino acids have been found in the cytoplasmic t a i l s of glycophorin HLA-A2  and  (Tomita  e t . e l . , 1978),  HLA-B7 (Robb et a l . , 1978) and membrane IgM (Rogers  et a l . , 1980). The presence of proline residues also appears be  a c h a r a c t e r i s t i c of cytoplasmic  to  regions of some proteins. In  55  glycophorin there are 5 proline residues in the cytoplasmic  tail  (Tomita et a l . ,  cytoplasmic t a i l there are 3  24  amino  acid  1978). In the rat Ia-A a chain  prolines.  Proline  residues are,  however, not c h a r a c t e r i s t i c of human HLA heavy chain cytoplasmic regions  (Robb et a l . ,  1978). There i s some evidence that the Ia  antigens may be phosphorylated at a serine cytoplasmic  tail  (Korman  residues in the rat Ia-A arginine  residues.  et al.,1982a a  chain  and  residue  within  the  ). There are two serine both  are adjacent  to  The cAMP-dependent protein kinase which may  catalyse the phosphorylation reaction requires that the arginine be on the amino-terminal 1977).  Therefore,  side  only  the  of  the  serine  (Kemp  et  al.,  serine at amino acid 222 would be  available for phosphorylation. It  i s thought that another  function of the cytoplasmic  is to provide a means of communicating information from the  outside  c e l l to the cytoplasm. The exact nature of the mechanism by  which t h i s communication occurs i s not known but i t may be the  cytoplasmic  tail  interacts with molecules  be  expected  that  the cytoplasmic  regions  would  i t might be  highly  conserved within and between species. It i s surprising then, find  that  of  to  the cytoplasmic region i s the least conserved region  the molecules over  nature  that  in the cytoplasm  which then travel to the nucleus. If t h i s was so then  of  tail  this  the  region  adjacent arginine-serine  regions  compared.  i s conserved residues  The hydrophilic  and the presence of the  i s notable  but  there  are  marked differences. Perhaps this indicates that these Ia a chain molecules  do  molecules after  not  communicate  by interaction with cytoplasmic  a l l . Alternatively,  the  residues  which are  56  important  for these  interactions  constraint on the other hydrophilic  nature.  residues  It  are conserved and the only i s that  they  retain  their  i s interesting that comparison of the  cytoplasmic regions of the murine, H-2  a  I-A  and  I-E a  H-2  chains shows only 47% sequence identity and the human, HLA-DC1 a and  HLA-DR  a  chains  show  only  45%  sequence  i d e n t i t y . One  interpretation of this i s that i f the I-A and I-E (DC 1 and DR) a chains interact with molecules within the cytoplasm  that  they  may interact with different molecules. It appears therfore, that the  cytoplasmic  within a  tails  species  of  Ia products of closely related l o c i  are less  homologous  than  Ia  products  of  equivalent l o c i in different species. The Transmembrane Region  The  transmembrane  region of  proteins which span the membrane i s thought to be characterized by  the presence of a mainly hydrophobic  stretch of amino acids  long enough to and capable of taking on an which  will  stretch  across  a-helical  the membrane.  The  structure  23 amino acid  transmembrane regions of the three a chains compared have  appear  to  these c h a r a c t e r i s t i c s . If t h i s were the only function of a  transmembrane region, however, i t may would  be  general  a  be  expected  that  there  low degree of sequence conservation as long as the  hydrophobic  nature  of  the region  was  maintained.  Therefore i t i s surprising to find that this region exhibits not the  lowest  but  the highest degree of sequence identity of a l l  the regions compared. sequence  identity  Between  and  between  identity i s observed. This seems  to  indicate  that  rat and mouse  there  i s 100%  rat and human a .91.3% sequence  unexpected  degree  of  conservation  there must be a functional constraint  57  maintaining changes  the sequence and selecting  which  would  result  in  against  an  any  nucleotide  amino acid change in this  region. When the transmembrane Class  I  antigens  regions  of  two  of the same haplotype,  different  murine  H-2K and H-2D , were b  b  compared they showed a protein sequence identity of 75% overall  the  protein  sequences showed a higher identity of 83%  (Reyes et al.,1982). A equivalent  loci  whereas  comparison  of  Class  I  antigens  from  of different species, the murine H-2K and b  the  human HLA-B7, showed an even more s t r i k i n g d i s p a r i t y between the protein i d e n t i t i e s of the extracellular domains, transmembrane  regions,  30%  (Coligan  et  70%,  and  the  al.,1981).  The  high  degree of sequence identity between the transmembrane regions of the a chains described seems unusual and may proteins  are  involved  in  suggest that  a quaternary interaction with other  membrane proteins (Korman et a l . ,1982b). It has (Benoist the  e t . e l . , 1983)  membrane.  constraint  al.,  have 1983,  been  proposed  that the a and (1 chains interact within  would  explain  the  unexpected  sequence  on t h i s region and i s further supported by data from  the murine H-2 also  This  these  I-E a and human HLA-DR a  similar  transmembrane  chain  sequences  which  region sequences (Benoist et  Auffray et a l . , 1982). In Table IV the  transmembrane  regions of Ia a chains of different species are compared. It  is  also of interest to note the presence of a cysteine  residue within the transmembrane region of a l l three There  is  evidence to suggest that t h i s may  a  chains.  be a s i t e for post-  t r a n s l a t i o n a l modification (Kaufman and Strominger, 1979  );  58  Table IV Comparison of the Amino Acid Sequences of the Transmembrane Regions of the Ia a Chains of Different Species  HLA -DR  :  ASN- -VAL- VAL -CYS -ALA- -LEU- GLY- LEU- THR- VAL- GLY- LEU  HLA--DC1  :  THR- VAL- VAL -CYS -ALA- -LEU- GLY- LEU- SER- VAL- GLY- LEU  H-2  I-E  :  ASN- -VAL- VAL -CYS -ALA- -LEU- GLY- LEU- PHE- VAL- GLY- LEU  H-2  I-A  :  THR- -VAL- VAL -CYS -ALA- •LEU-GLY- LEU- SER- VAL- GLY- LEU  Rat Ia-A :  THR- -VAL- VAL -CYS -ALA- •LEU-GLY- LEU- SER- VAL- GLY- LEU  HLA- -DR  :  VAL- GLY- ILE -ILE -ILE- GLY- THR- ILE- PHE- ILE- ILE  HLA- -DC 1  :  VAL- GLY- ILE -VAL -VAL- GLY- THR- VAL- LEU- ILE- ILE  H-2  I-E  :  VAL- GLY- ILE--VAL--VAL- GLY- ILE- ILE- LEU- ILE- MET  H-2  I-A  :  VAL- GLY- ILE--VAL--VAL- GLY- THR- ILE- PHE- ILE- ILE  RAT Ia-A :  VAL- GLY- ILE--VAL--VAL- GLY- THR- ILE- PHE- ILE- ILE  Data from Lee et al.,1982a (HLA-DR), Auffray et al.,1982 (HLA-DC1) and Benoist et al.,1983 (H-2 I-A and I-E).  59  The Connecting Peptide domain  and  the  transmembrane  peptide. The connecting transmembrane cytoplasmic  The 13 amino acids between the a2  region  region  peptide  define  i s less  the  connecting  conserved  than  the  and only s l i g h t l y more conserved than the  region. There i s 92.3% homology  between  rat and  mouse and 84.6% homology between rat and human sequences. The  high  degree  of  regions of the rat, mouse notable  because  cytoplasmic  of  tail  organization  of  homology and  the much  and  human less  a  gene  a  the transmembrane  chains  i s especially  conserved  the connecting  the Ia-A  human HLA-DR a chain  between  nature  peptide.  If  of the  the gene  chain i s the same as that of the  then  a l l three  regions  would  be  encoded by the same exon. It appears that only the transmembrane region  is  surrounding  strictly  conserved  and  that  the  two  regions  i t are more free to diverge. One explanation i s that  the HLA-DR a chain gene organization i s not the same as the gene organization of the HLA-DC1, mouse H-2 I-A and rat Ia-A a genes  at  least  for the exon(s) coding  peptide, transmembrane and cytoplasmic  chain  for the connecting  regions.  The e x t r a c e l l u l a r domain (a2) The 91 amino acids of the  a.2  domain are 88.5% homologous between rat Ia-A a and mouse H-2 I-A a  and  79.5% homologous between rat Ia-A a and human HLA-DC1 a.  The Ia molecules are glycoproteins glycosylation approximately the  protein.  threonine  site  at  and  the asparagine  there  is a  residue at position 121,  70 amino acids from the transmembrane  portion  of  The sequence at this point asparagine-isoleucine-  (Asn-Ile-Thr) conforms to the consensus  carbohydrate  potential  sequence for  attachment, Asn-X-(Thr or Ser) (Spiro, 1974; Wagh  60  and Bahl,  1981). There are two cysteine residues which may  form  a disulphide loop within the a2 domain.  Homology to Immunoglobulin Several  immune  (Ig) Domains  system  molecules such as /^microglobulin,  and the Class I antigen heavy chains have been shown to amino  acid  sequences  which  sequences of the constant (Ig)  molecules.  of  homologous to the amino acid  region domains of  Analysis  from the cDNA insert  are  first  pRIa.2  studies  shows  that  on  could  (Edelman e t . e l . ,  be  divided  region  exhibits  domains.  two  heavy  chains)  the  immunoglobulin  into a series of globular domains  1969,1970). This was further supported by X-ray  crystallographic experiments (Poljak et several  i t too  1962). Characterization of immunoglobulin molecules by  amino acid sequence analysis indicated that molecules  immunoglobulin  Ig molecules showed that they were  four chain structures (two l i g h t chains and (Porter,  the  of the amino acid sequence predicted  homology to the sequences of the Ig constant The  contain  features  which  characterize  a l . , 1973).  There  immunoglobulin  are  domains,  notably a disulphide loop of approximately 55-65 amino acids and several t y p i c a l l y conserved amino acids which are thought to involved  in  maintenance  of the three-dimensional  these domains. When the amino acid sequences domains  are  aligned,  of  be  structure of immunoglobulin  these Ig-conserved residues are found at  the same positions. In Figure 6 the majority of the al domain sequences acids  104-181)  (amino  of rat Ia-A, mouse H-2 I-A, and human HLA-DC1 a  chains are compared. There are 13 amino  acids  within  each  a2  61  domain  which  are  c h a r a c t e r i s t i c of Ig-conserved  two cysteine residues thought to included  in  these  form  Ig-conserved  a  residues. The  disulphide  loop  are  residues. There are a few Ig-  conserved residues in the middle of the putative loop  structure  but the majority are clustered around the two cysteine residues. As well as the 13 Ig-conserved which  are  found  in  the  residues there are three residues  Ig-like  domains  of a l l MHC  encoded  molecules which have been compared. These MHC-conserved residues may  play an important  role in some MHC  s p e c i f i c function of t h i s  domain. Despite differences in constant  region  domains,  amino X-ray  acid  sequence  crystallographic  indicated that the d i f f e r e n t constant structure (Amzel and Poljak,1979).  between  the  experiments  regions a l l have a similar  The s i m i l a r i t y in amino  acid  sequence of these domains argued that they represented a similar pattern  of  tertiary  t y p i c a l constant  region  folding domain  crystallographic techniques  (Beale  and  structure  Feinstein, 1976). A defined  i s shown in Figure 7.  from  X-ray  62  Figure 7  Diagram of an  Immunoglobulin  Constant Region Domain  Diagram  showing  the  basic  immunoglobulin  fold  immunoglobulin constant region (Poljak et al.,1973).  of  an  63  The constant region domain consists of 2 faces , the x face (fx) and the y face ( f y ) . There are stretches of (3-pleated sheet within each face and most of the amino acid constant  region  domains  are  within  Connecting the /3-pleated sheets are  homologies  between  /3-pleated  sheets.  the  non-/3-pleated  segments  or  bends; within the bends homology between constant region domains is  lowest.  The  Figure 8. There hydrophobic  bends is a  and  and /3-pleated segments are indicated in characteristic  hydrophilic  amino  pattern acids  around the cysteine  residues of constant region domains. The side hydrophobic  amino  which  chains  of  these  acids f i l l the internal spaces between the x  and y faces of the constant residues  of alternating  are  region  clustered  domains.  around  The  Ig-conserved  the cysteines of the a2  domains of the Ia a chains conform to the pattern of alternating hydrophobic  residues.  For  example  in most  constant  region  domains the sequence of Tyr (or Phe) -X-Cys-X-Val-X-His i s highly, conserved in the second stretch of /3 pleated sheet of the y face (fy2)  (Beale and Feinstein, 1976). This sequence i s found in Ia  molecules as. shown in Figure 8.  64  Figure 8  Comparison of the Amino Acid Sequences of Iq-Like Domains  Rat Ia-A H-2 I-A H-2 I - E HLA -DC1 HLA -DR HLA -B7  /J M CH3 2  : E  : :  V V  : E : : :  Rat Ia-A H-2 I-A H-2 I - E HLA- -DC1 HLA- -DR HLA- B7  A R R  P P P P P A S  /3 M CH3 2  s  A A P V D T  E  P P P P P P P  -  0 A E V E V E V P K K I 0 V Y f x1  V I N V I N V V N V V N V V N E I T D I E D I A  b2  Rat H-2 H-2 HLAHLAHLA-  Ia-A I-A  I-E  DC 1 DR B7  /3 M CH3 2  Rat H-2 H-2 HLAHLAHLA-  (3 M 2  CH3  Ia-A I-A I-E DC 1 DR B7  : S S L : S : L T S S  F F F F F F F F  H H R F R E Y F  K K K K K K L L  E - E E - E E K - Q N H  P P P P P P P Y  V V L L L L K T  : •  -  I I V I V L V V fyl  M L F I F W L Y fx4  T T T T T 0 T  V V V V H V L  F L L F V Y P  P S T S T S P  K R N K H R S  S S S S H H R  P P P P P P E  T w L R N T L R N T L R N T L S N T L R N T 0 R D D L L K D E w E S N D  S S G G G G G G  K K R H K  w w w w w  A S H S H A Y S  L K L K R K L K L K T L I V 0 K fy3  Y Y Y Y Y A Y K  -  -  L L L L L V T L  T T T T P V  -  V V V V I A  L L N L E L T L S D E N T  M  E b1  P S P S P  V V V V V E 0 E R E  -  b3  T T T T T 0  -  F I P S N -  F P F F V E F T V  s s s s - - -  P S D P T P A P T P - G T P T D K R W 0 b5 I, L L L  -  s  P P P D P E A K S N 0  T L I C F V D N T L I C F V D N I L I C F I D K N I L I c F I D K N V L I c F I D K T L R c W A L G N F L N c Y V S G V S L T c L V K G f x2  E D E E T T I P  G G G G G 0 E  Y Y S S S T V Y  D D D D E E E E  D I D I F 0 E I V D E 0 R K D E G N V  G G R G H G K  0 0 E E 0  E  V V V V V D K N  --  F F S S T Y H Y  P P P P P P P P  D D D D E D A D S K 0 D S D  H Y H H H R W G  K V E H w G L L V E H W G L E V D H G L K V E H G L R V E H G L H V 0 H E G L R V N H V T L S V H E A t fy2 bG  D  N  N N  -  T T E T E T E T E L E H K T  S F L S F F V F L F L V F L V E T D L T P P fx3  Y Y Y Y Y Y Y F  C C C C C C C C  E  E  D D D D D T A S  s  s  s  N V N p R K p R R P S F V L  s  P R D S  are  -G  w w w  M  E E  D D P S H  H W H W H H H R K S L  w w w w w  The /3 pleated sheet segments of the x face (fx) and the (fy)  I I F F F F F F  y  face  numbered as are the bends (b). P o s i t i o n s where spaces  have been l e f t to give maximal alignment are denoted by References as for Table IV plus data from Orr et al.,1979 (HLA-B7), Peterson  et a l . , 1972  (^microglobulin)  and Edelman et al.,1969 (Ig constant  region domain, CH3)  a  (-).  65  /^microglobulin,  the  Class  I antigen light chain, i s 100  amino acids in length and contains a 57 residue disulphide (Peterson  et  loop  al.,1972; Cunningham et al.,1973). When~the amino  acid sequence of /^microglobulin was compared to Ig sequences high  degree  of  homology  was  found.  The  highest  a  degree of  sequence identity was observed when /^microglobulin was compared to the CH3 domain. Because of constant  region  domains  i t s homology  /^microglobulin  to  immunoglobulin  was  termed a "free"  immunoglobulin domain.(Peterson et a l . , 1972). Sequence•analysis of the showed  that  disulphide  two  of  loop Ig  I  antigen  heavy  domain  of  the  same  disulphide  size  the  (HLA-A  and  B)  immunoglobulin constant region domains and /^microglobulin  showed that only the Class I loop  as  loop . Comparison of the  heavy chain sequences of human Class I antigens with  chains,  the three e x t r a c e l l u l a r domains contained  structures  characteristic  Class  adjacent  to  the  antigen  extracellular  membrane  exhibited  disulphide homology  to  immunoglobulins and /^microglobulin (Tragardh et a l . ,  1978; Orr  et  so-called  a l . , 1979b;  Wiman  immunoglobulin-like (a.3) was shown constant  to  et  (Ig-like) be  as  immunoglobulin  a l . , 1979).  This  domain  of  the Class I antigens  homologous  to  0 microglobulin  domains  as  2  /^microglobulin  and and  immunoglobulin constant region domains were to one another. From this data  the  /^microglobulin,  proposal and  the  was  made  Class  that I  the  immunoglobulins,  antigen heavy chains had a  related evolution and that the Class I antigens may have by  arisen  a gene duplication involving the same ancestral gene as that  which gave r i s e to immunoglobulin chains (Wiman et a l . , 1979).  66  The rat Thy-I glycoprotein i s a major c e l l surface molecule which i s found on types.  The  thymocytes,  amino  acid  neuronal  sequence  of  and  some  Thy-I  other  cell  was determined by  Campbell et a l . ( ! 9 8 l ) . Thy-I was shown to be 111 amino acids  in  length and to contain 4 cysteine residues which defined a single disulphide loop. This disulphide loop was shown to be homologous to  immunoglobulin  domains but unlike the Class I antigen heavy  chains and /^microglobulin, Thy-I was  more  homologous  to the  variable region domains (Cohen et al.,1981; Williams and Gagnon, 1982). Comparison  of  a  human  (Larhammar et al.,1981,1982a) with previously adjacent HLA-DR  identified  a  chain  a l . , 1982b).  HLA-DC1  the other  that  chain  sequence  Ig-like  domains  the /33 domain (the domain  to the membrane) was also an Ig-like domain. The  a  chains  /^microglobulin,  human  was also shown to contain an e x t r a c e l l u l a r Ig-  l i k e domain adjacent et  showed  /3  Ia antigen  to the membrane, the al  domain  (Larhammar  The a.2 domains of both mouse H-2 I-A and human were  also  shown  to  be  homologous . to  Class I a3 domains and immunoglobulin  constant  region domains. In Table V the Ig-like domains of several d i f f e r e n t system molecules are compared.  immune  67  Table V  Percent  Sequence I d e n t i t y  Domains of D i f f e r e n t  RAT Ia-Aa  Between I q - L i k e  Immune System  Molecules  MOUSE MOUSE HUMAN HUMAN H-2 H-2 HLAHLADC 1 a I-Aa I-Ea DR a  HUMAN 0 MICROHLA-A, GLOBULIN "B,-C 2  MOUSE H-2 I - A a  89  -  MOUSE H-2 I - E a  67  60  -  HUMAN HLA-DC1 a  80  67  70  -  HUMAN"HLA-DR a  68  65  80  65  -  HUMAN  29  27  32  31  31  -  32  29  29  32  29  25  24  26  22  24  23  28  HLA-A,-B, -C  /3 MICROCLOBULIN 2  CH3  References  as f o r F i g u r e 8 .  28  68  The  finding  /^microglobulin domains  led  and  to  the Ia and Class I antigens, as well as  Thy-1  are  homologous  to  immunoglobulin  the proposal of an immunoglobulin  Implicit in t h i s molecules  that  proposal,  within  is  the  hypothesis  superfamily.  that  all  the family originated from a single ancestral  gene which would be equivalent to a single exon at the DNA or a single domain at constant Ia  the  protein  level.  The  level  immunoglobulin  domains to which the Class I antigen heavy chains, the  antigens  occurred  and  in  ^microglobulin  had  pairwise combination.  been  It was  likened,  2  /J chains  associate  in  a  manner  always  suggested, therefore,  that the Class I heavy chain and ]3 microglobulin and and  the  the  Ia  a  similar to that of the  immunoglobulin constant region domains (Steinmetz et a l . , 1981b; Larhammar et a l . , 1982b). The proposed structures for the I  and  Ia  antigens  are  Class  diagrammed in Figure 9 along with the  structure of a membrane immunoglobulin molecule.  69  Figure 9  Schematic  Representations of Some Members  of the Immunoglobulin Superfamily  IgM  V-domains  M H C Antigens Class I  C l « i » I( (la)  fi O C *-t.  A j j o  \  Kr M  /^"^N  ki&*  C  -  D O M A I N S  ^> TTTT"  ii j j j u i i j i i i i i i i i / - 1  1  1  1  1  Membrane  »»»-  too-"  Cytoplasm  The immunoglobulin-related molecules T h y - 1 , antigens molecule.  are The  shown  diagramatically  drawings  are  MHC Class I  and Ia  along with a membrane IgM  approximately  (Jensenius,J.C. and Williams,A.F.,1982).  to  scale.  70  III  SEARCH FOR THE AMINO TERMINAL END OF THE RAT Ia~A a CHAIN  In  order  to  isolate a cDNA clone corresponding  to the 5'  end of mRNA encoding a rat Ia-A a chain, two cDNA l i b r a r i e s made from t o t a l spleen poly(A)-RNA transformants)  were  (approximately  screened  4000  independent  (see Materials and Methods). The  cDNA insert of plasmid pRIa.2 was nick translated and used as a probe  to screen for b a c t e r i a l transformants  containing rat Ia-A  a chain sequences (see Materials and Methods). Fifteen clones which hybridized to the pRIa.2 were  cDNA  insert  i s o l a t e d . Restriction enzyme analysis indicated that there  were only two independently larger  insert  a r i s i n g clones. The clone  pairs  the  (named pRIa.3) was amplified and plasmid DNA was  prepared. The cDNA insert of the plasmid was base  with  in length  approximately  800  and was bounded at either end by a PstI  s i t e . The r e s t r i c t i o n map of the cDNA insert of pRIa.3 indicated that i t might be the 5' end of a cDNA coding for the rat Ia-A a chain.  The  EcoR1  insert in pRIa.2,  site, was  situated missing  at position 570 of the cDNA  and  since  the  inserts  were  approximately the same length t h i s seemed to imply that the cDNA insert  of  5' to that nucleotides  pRIa.3 would extend at least another 200 nucleotides of of  the cDNA coding  insert region  of  pRIa.2.  This  200  could code for another 70 amino  acids and would, therefore, extend well into the a1 the  extra  domain  of  rat Ia-A a chain. The cDNA insert was isolated as described  (see Materials and Methods) and the cDNA was p a r t i a l l y sequenced  71  according  t o t h e m e t h o d s o f Maxam a n d G i l b e r t  (see M a t e r i a l s and  Methods).  The  p a r t i a l sequence Approximately  of  pRIa.3  pRIa.2  comparison  insert  i s shown  Although  the  cDNA  cDNA  the  case.  600  insert  Instead  identify  i n Figure  might contain  pRIa.2  The f i r s t  nearly  identical  nucleotide  451 o f  sequences  of  pRIa.3  entirely  The  DNA  map  indicated  that  the  sequences corresponding  and pRIa.3  DNA  to  sequences  showed t h a t  of  insert  a different  length.  The  t o t h e open homology  3'untranslated  5' e n d o f t h e cDNA reading  frame  initiated  198 n u c l e o t i d e s to  the  the  extends  point  in  the of  insert  inserts  sequence  from t h i s  sequence  pRIa.2  two  of  o f t h e 3' u n t r a n s l a t e d  totally  approximately  region  the  cDNA  were  insert.  At  however,  the  different.  The  another  550  3' d i r e c t i o n  the  of  252 o f  insert  pRIa.2  sequence,  from  insert  untranslated  pRIa.3  i n t h e presumed  sequence  t h e 3'  the  became  of  region,  at nucleotide  sequence and extended i n t o  different  nucleotides  of homology.  o f t h e e x p e c t e d 5' s e q u e n c e s , t h e cDNA  the  insert  nucleotides  any r e g i o n s  of the  was n o t  pRIa.2. This  region.  insert  this  in  insert  cDNA  t o the sequence  comparison of the  of pRIa.2  was h o m o l o g o u s of  of the  10.  appeared to contain  nucleotides  insert  of pRIa.3  of t h e sequence  the p a r t i a l r e s t r i c t i o n  inserts  pRIa.3  pRIa.3  the  to  5' e n d o f t h e p r o t e i n ,  the  of  one h a l f  insert  w a s d e t e r m i n e d a n d was c o m p a r e d  cDNA  pRIa.3  o f t h e cDNA  remaining  of pRIa.2.  and i s 130  72  Figure 10 Alignment of the P a r t i a l Nucleotide Sequence of the cDNA insert of pRIa.3 with the Sequence of the cDNA insert of pRIa.2  pRIa.2  (G)^TCAGCCCAACACCCTCATCTGCTTTGTAGACAACATCTTTCCTCCTGTGATCAATA  pRIa.2  TCACATGGTTGAGAAACAGCAAGCCAGTCACAGAAGGCGTTTATGAGACCAGCTTCCTTT  p R I a . 2 CCAACCCTGACCATTCCTTCCACAAGATGGCTTACCTCACCTTCATCCCTTCCAACGACG pRIa.2  ACATTTATGACTGCAAGGTGGAGCACTGGGGCCTGGACGAGCCGGTTCTAAAACACTGGG  pRIa.2  AACCTGAGGTTCCAGCCCCCATGTCAGAGCTGACAGAGACTGTGGTCTGTGCCCTGGGGT  pRIa.3  GGGGGGGGGGTTC--CCCCCATGTCAGAGCTGACAAAAACTGTGGTCTGTGCCCTGGGGT  pRIa.2  TGTCTGTGGGCCTCGTGGGCATCGTGGTGGGCACCATCTTCATCATTCAAGGCCTGCGAT * *.* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *  ********************  pRIa.3  * **********************  TGTCTGTGGGCCTCGTGGGCATCGTGGTGGGCACCAT  pRIa.2  CAGATGGCCCCTCCAGACACCCAGGGCCCCTTTGAGTCACACCCTGGGAAAGAAGGTGCG ****************************************  pRIa.3  CCAGGGCCCCTTTGAGTCACACCCTGGGAAAGAAGGTGCG  pRIa.2  TGGCCCTCTACAGGCAAGATGTAGTGTGAGGGGTGACCTGGCACAGTGTGTTTTCTGCCC ************** *******************  pRIa.3  TGGCCCTCTACAGGGAAGATGTAGTGTGAGGGGTTAACACTGTCAGCAGTGCATTGTCAT  pRIa.2  CAATTCATCGTGTTCTTTCTCTTCTCCTGGTGTCTCCCATCTTGCTCTTCCCTTGGCCCC  pRIa.3  GTTCTCTGTAGTAGTTGTAAGAACAGGTATTTTAGGTAGGAGAGTTTTGGGGGGTTTTTT  4  p R I a . 2 CAGGCTGTCCACCTCATGGCTCTCACGCCCTTGGAATTCTCCCCTGACCTGAGTTTCATT pRIa.3  —AGCCATTAAGACTATCATACTCTA  TCCTTCAT-ATTAAT-TTTCTAAC-ACT-  p R I a . 2 TTTGGCATCTTCCAAGTCGAATCTACTATAGATTCCGAGACCCTGATTGATGCTCCACCA pRIa.3  -T-T—TTCAAAATGTAACTTTAAAGTGGAGTAACGAGACT--AAACAG-CGAACAAGAC  p R I a . 2 A A C C A A T A A A C C T C T C A T A A G T T G G ( A )_ ( C )  n pRIa.3  CAAAATTGAGTAAAAGGGACTCGAGA  The arrow indicates  n GATCTTTCATTGTACGTCTCGTCCGG  a possible s p l i c e s i t e (see t e x t ) .  73  The  presumed  3' end of the cDNA insert of pRIa.3 has not  been sequenced, but due to the method of synthesis of the cDNA there  should  be a poly(A) t a i l at the 3* end. If t h i s i s true  and the cDNA insert of pRIa.3 represents a functional not  a cloning a r t i f a c t , then the 3' untranslated region of this  mRNA i s approximately  600 nucleotides in length.  The unusual properties of the cDNA puzzling.  If i t i s assumed  that  insert this  functional mRNA which can be translated protein,  of pRIa.3 are  cDNA  into  represents  a  the rat Ia-A a  then i t seems surprising that there should be two mRNA  species d i f f e r i n g only in their 3' untranslated code  mRNA and  regions  which  for the same protein. There are many possible explanations  for t h i s finding but i t i s not possible to determine  which i f  any are correct from the data a v a i l a b l e . One explanation i s that the mRNA from which the cDNA insert of pRIA.3 was derived was not completely contained  processed  i.e. i t s t i l l  nucleotide sequences which corresponds to intron DNA.  This would have been spliced out of the mRNA from which the cDNA insert of pRIa.2 was derived. The last two nucleotides of shared sequence identity between the two cDNA inserts possible  that  this  corresponds  intron sequence. Although t h i s sequence  for intron borders  are GT. It i s  to the 5' end of the presumed  correlates  with  the consensus  (GT at the 5' end and AG at the 3'  end; Lewin, 1980) to explain why t h i s dinucleotide i s also found in the sequence of the cDNA insert of pRIa.2 i t must be proposed that the dinucleotide GT also  occurs  at the 5' end of the  following exon. This explanation i s acceptable but i t i s unclear why  there  would  be an  intron  within  the region of the DNA  74  corresponding are,  to the 3' untranslated region of the mRNA.  There  however, several findings which would indicate that the 3'  ends of some MHC encoded proteins have unusual properties. The gene organization of the human HLA-DR a gene (Lee  et a l . , 1982b,  region  i s encoded  connecting  Korman et a l . , 1982). The 3' untranslated  by two exons.  peptide,  Exon  three  contains the  downstream  of the TGA  stop  four contains the remainder of the 3' untranslated  region. Analysis of other genes codon  Exon  the transmembrane region, the cytoplasmic  t a i l and extends 10 nucleotides codon.  i s known  and the 3'untranslated  has indicated  that  the stop  regions are usually found within  the same exon (Korman et a l . , 1982).  For the human  HLA-DR  a  chain gene t h i s i s not the case. One al.,  isolated  1982a)  had  3'untranslated  cDNA 2  for the human HLA-DR a chain (Lee et polyadenylation  signals  within  sequence; one was 28 nucleotides upstream of the  poly(A) t a i l and the other was 130 nucleotides upstream poly(A)  the  of the  t a i l . It appeared that both polyadenylation signals may  be used. If the f i r s t  polyadenylation signal were recognized and  signalled the end of transcription approximately  the mRNA  would  have an  300 nucleotide untranslated region. If the second  polyadenylation signal were used, as was the case for the cDNA which  was  isolated,  then the mRNA would have an approximately  400 nucleotide untranslated polyadenlyation  region.  If the presence  of two  signals i s a c h a r a c t e r i s t i c of Ia a chains then  perhaps this indicates that there i s some requirement for mRNA's with different lengths of 3' untranslated species with different 3'untranslated  sequences.  The mRNA  regions may be synthesised  75  in response to different conditions or requirements  in the c e l l .  The most l i k e l y explanation of the cDNA insert of pRIa.3 i s that  it  represents  an incompletely processed mRNA. To further  investigate the insert of pRIa.3 experiments such  as  of  a  genomic  DNA  corresponding  characterisation of this DNA  to  rat  Ia-A  isolation genes  by sequence analysis are needed.  and  76  IV CONCLUSIONS  The sequence of a cDNA corresponding and  the  amino  acid  presented. The rat  sequence  Ia-A  a  to a rat Ia-A a  predicted  chain  from  sequence  chain  this cDNA were  shows  significant  homology to Ig constant region domains and to Ig-like domains of other  immune  belong  to  probably  system  molecules.  the  proposed  evolved  from  other molecules  The  immunoglobulin the  the  superfamily  and  has  of this superfamily are derived.  equivalent  sequence  to  sequences  l o c i of mouse and human shows that a high  degree of sequence identity exists across the The  a chain appears to  same ancestral gene from which the  Comparison of the rat Ia-A a chain from  Ia-A  species  barrier.  level of homology observed between the Ia a chain sequences  from d i f f e r e n t l o c i within any single species lower.  This  indicates  that  the  two  is  significantly  Ia l o c i , Ia-A and  Ia-E,  duplicated prior to the speciation of rats, mice and humans.  77  ACKNOWLEDGEMENT  I would l i k e to g r a t e f u l l y advice Wallis.  I  received  acknowledge  the support and  from Rob McMaster, Sarah Eccles and Heather  78  REFERENCES Allison,J.P., Walker,L.E., Russell,W.A., Pellegrino,M.A., Ferrone,S., Reisfeld,R.A., Frelinger,J.A. and Silver,J.(1978) Murine Ia and Human DR Antigens: Homology of Amino-Terminal Sequences. Proc .Natl .Acad.Sci . USA 7_5 ,3953-3956. Amerding,D., Katz,D.H. and Benacerraf,B.(1974) Immune Response Genes in Inbred Rats. II Segregation Studies of the GT and GA Genes and Their Linkage to the MH Locus. Immunogenet. j_ ,340351. Amzel,L.M. and Poljak,R.J. (1979) Three-Dimensional Structure of Immunoglobulins. Ann.Rev.Biochem. 4J3 ,961- 997. Auffray,C, Korman,A.J., Roux-Dosseto ,M. , Bono,R. and Strominger,J.L.(1982) cDNA Clone for the Heavy Chain of the Human B C e l l Alloantigen DC1: Strong Sequence Homology to the HLA-DR Heavy Chain. Proc.Nat1.Acad.Sci. USA 79 ,6337-6341. Aviv,H. And Leder,P.(1972) P u r i f i c a t i o n of B i o l o g i c a l l y Active Globin Messenger RNA by Chromatography on Oligothymidylic AcidCellulose. Proc.Nat.Acad.Sci. USA 69 , 1408-1412. Bach,F.H. And van Rood,J.J.(1976) The Major Histocompatibility Complex - Genetics and Biology. New Eng.J.Med. 295 , 806-813. Baxevanis,C.N., Wernet,D., Nagy,Z.A., Maurer,P.H. and Klein,J.(1980) Genetic Control of T-Cell P r o l i f e r a t i v e Responses to Poly ( G l u * A l a ) and Poly ( G l u L y s " T y r ) : SubregionSpecific Inhibition of the Responses with Monoclonal Ia Antibodies. Immunogenteics jj_ , 617-628. 0  60  51  3  1 5  Beale,D. and Feinstein,A.(1976) Structure and Function of the Constant Regions of Immunoglobulins. Quart.Rev.Biophys. 9 , 135180. Benacerraf,B., Green,I. and Paul,W.E.(1967) The Immune Response of Guinea Pigs to Hapten-poly-L-Lysine Conjugates as an Example of the Genetic Control of the Recognition of Antigenicity. Cold Spring Harb. Quant.Symp. 3_2 ,569-575. Benoist,C.O., Mathis,D.J., Kanter,M.R., Williams II,V.E., and McDevitt,H.O. (1983) The Murine Ia a Chains, Ea and ha, Show a Surprising Degree of Sequence Homology. Proc.Natl.Acad.Sci. USA 80 ,534-538. Bolivar, F. and Backman,K.(1979) Plasmids of Escherichia c o l i as Cloning Vectors. Methods Enzymol. 68 ,245-280. Bono,M.R. and Strominger,J.L.(1982) Direct Evidence of Homology Between Human DC-1 Antigen and Murine I-A Molecules. Nature 299 , 836-838.  79  Bregegere,F. , Abastado,J.P., Kvist,S., Rask,L., Lalanne,J.L., Garoff,h., Cami,B., Wiman,K., Larhammar,D., Peterson,P.A., Gachelin,G., Kourilsky,P. and Dobberstein,B. (1981) Structure of C-Terminal Half of Two H-2 Antigens from Cloned mRNA. Nature 292 ,78-81 . Bretscher,M.S.(1975) C-Terminal Region of the Major Erythrocyte Sialoglycoprotein i s on the Cytoplasmic Side of the Membrane. J.Mol.Biol. 98 , 831-833. Campbell,D.G., Gagnon,J., Reid,K.B.M. and Williams,A.F.(1981) Rat Brain Thy-1 Glycoprotein. Biochemical J . 195 , 15-30. Carlinfanti,E.(1948). The Predisposition for Immunity. J.Imm. 59 , 1-7. Chirgwin,J.M., Przybyla,A.E., McDonald,R.J. and Rutter,W.J.(1979) Isolation of B i o l o g i c a l l y Active Ribonucleic Acid From Sources Enriched in Ribonuclease. Biochem. j_8 ,52945299. Cohen,F.E., Novotny,J., Sternberg,M.J.E., Campbell,D.G. and Williams,A.F.(1981) Analysis of the Structural Similarities Between Brain Thy-1 Antigen and Immunoglobulin Domains. Biochemical J . 195 , 31-40. Coligan,J.E., Kindt,J.J., Uehara,H., Martinko,J. and Nathenson,S.G.(1981) Primary Structure of a Murine Transplantation Antigen. Nature 291 , 35-39 . Crick,F.(1981) S p l i t Genes and RNA 264-271.  Processing.  Cullen,S.E., Freed,J.H., Atkinson,P.H. and (1975) Evidence That Protein Determines S p e c i f i c i t y . Transplant.Proc. 7 , 237-239.  Science  204 ,  NathensonjS.G., Ia Antigenic  Cullen,S.E., David,C.S., Cone,J.L. and Sachs,D.H.(1976) Evidence for More Than One Ia Antigenic S p e c i f i c i t y on Molecules Determined by the I-A Subregion of the Mouse Major Histocompatibility Complex. J.Imm. 116 ,549-553. Cunningham,B.A., Wang,J.L., Berggard,I. and Peterson,P.A.(1973) The Complete Amino Acid Sequence of ^ m i c r o g l o b u l i n . Biochem. j_2 ,  4811-4822.  David,C.S., Shreffler,D.C. and Frelhinger,J.A.(1973) New Lymphocyte Antigen System (Lna) Controlled by the Ir Region of the Mouse H-2 Complex. Proc .Natl .Acad.Sci. USA 7_0 , 2 5 0 9 - 2 5 1 4 . Delaney,A.D.(1982) A Nuc .Acid.Res. J_0 , 6 1 - 6 7 .  DNA  Sequence  Handling  Program.  80  Denhardt,D.T.(1966) A Membrane-Filter Technique for the Detection of Complementary DNA. Biochem.Biophys.Res.Comm. 23 ,641-646. Dorf,M.E., Balner,H. -and Benacerraf,B.(1975a) Mapping Immune Response Genes in the MHC of the Rhesus J.Exp.Med. J_42 ,673-693.  of the Monkey.  Dorf,M.E. and Benacerraf,B.(1975b) Complementation of H-2 Linked Ir Genes in the Mouse. Proc.Nat.Acad.Sci. USA 72 ,3671-3675. Edelman,G.M., Cunningham,B.A., Gall,W.E., Gottlieb,P.D., Rutishauser,U. and Waxdal,M.J.(1969) The Covalent Structure of an Entire 7 G Immunoglobulin Molucle. Proc .Natl .Acad.Sci . USA 6_3 , 78-85. Edelman,G.M.(1970) The Covalent Structure of a Human 7 G Immunoglobulin. XI Functional Implications. Biochem. 9 , 31973205. Ellman,L., Green,I., Martin,W.J. and Benacerraf,B.(1970) Linkage Between the Poly-L-Lysine Gene and the Locus Controlling Major Histocompatibility Antigens in Strain 2 Guinea Pigs. Proc.Nat.Acad.Sci. USA 66 ,322-328. Erb,P..and Feldmann,M.(1975) The Role of Macrophages in the Generation of T-Helper C e l l s . II The Genetic Control of the Macrophage-T-Cell Interaction for Helper C e l l Induction with Soluble Antigens. J.Exp.Med. 142 ,460- 472. Ferreira,A., David,CS. and Nussenzweig,V.(1980) The Murine H2.7 S p e c i f i c i t y i s an Antigenic Determinant of C4d, a Fragment of the Fourth Component of the Complement System. J.Exp.Med. 151 , 1424-1435. Goodenow,R.S., Stroynowski,I., Eakle,K., Sher,B.T., Davidson,N. and Complete Transplantation Antigens by with Truncated Class I Genes. Nature  McMillan,M., Nicolson,M., Hood,L.(1983) Expression of Mammalian C e l l s Transformed 301 , 388-394.  Gotze,D. The Major Histocompatibility System in Man and Animals Berlin:Springer-Verlag,1977. Goyert,S.M., Shively,J.E. and Silver,J.(1982) Biochemical Characterization of a Second Family of Human Ia Molecules, HLADS, Equivalent to Murine I-A Subregion Molecules. J.Exp.Med. 156 , 550-566. Grunstein,M. and Hogness,D.S. (1975) Colony Hybridization: a method for the i s o l a t i o n of cloned DNAs that contain a s p e c i f i c gene. Proc.Natl.Acad.Sci. USA 72 ,3961-3965 .  81  Hansen,T.H. and Levy,R.B.(1978) Alloantigens Determined by a Second D Region Locus E l i c i t a Strong IN VITRO Cytotoxic Response. J.Imm. J_20 , 1 8 3 6 - 1 8 4 0 . Hauptfeld,V., Klein,D. and Klein,J.(1973) I d e n t i f i c a t i o n of an Ir-Region Product. Science 181  ,  Serological 167-169.  Huang,C. and Klein,J.(1980) Murine Antigen H-2.7: Localization of Its Antigenic Determinant of the Ss(C4) Molecule. Immunogenetics jj_ , 605-615. Ipsen,J.(1959) Differences in Primary and Secondary Immunizability of Inbred Mice Strains. J.Imm. 8_3 , 448-457. Jensenius,J.C. and Williams,A.F. (1982) The T Lymphocyte Antigen Receptor - Paradigm Lost. Nature 300 , 583-588. Jones,P.P., Murphy,D.B. and McDevitt,H.O.(1978) Two-Gene Control of the Expression of a Murine Ia Antigen. J.Exp.Med. 148 , 925939. Jordan,B.R., Bregegere,F. and Kourilsky,P.(1981) Human HLA Gene Segment Isolated by Hybridization with Mouse H-2 cDNA Probes. Nature 290 , 521-523. Kappler,J.W. and Marrack,P.C.(1976) Helper T C e l l s Recognise Antigen and Macrophage Surface Components Simultaneously. Nature 262 , 797-799. Kappler,J.W., and Marrack,P.(1978) The Role of H-2 Linked Genes in Helper T-Cell Function. IV Importance of T-Cell Genotype and Host Environment in I-Region and Ir Gene Expression. J.Exp.Med. 148 ,1510-1522. Katz,D.H., Hamaoka,T. and Benacerraf,B.(1973) C e l l Interactions Between Histocompatible T and B Lymphocytes. II Faiure of Physiological Cooperative Interactions Between T and B Lymphocytes from Allogeneic Donor Strains in Humoral Response to -Hapten-Protein Conjugates. J.Exp.Med. 137 ,1405- 1418. Kaufman,J.F. and Strominger,J.L.(1979) Both Chains of HLA-DR Bind to the Membrane with a Penultimate Hydrophobic Region and the Heavy Chain i s Phosphorylated at i t s Hydrophilic Carboxyl Terminus. Proc .Natl .Acad.Sci . USA 76. / 6304-6308. Kemp,B.E., Graves,D.J., Benjamini,E. and Krebs,E.G.(1977) Role of Multiple Basic Residues i n Determining the Substrate S p e c i f i c i t y of Cyclic AMP-Dependent Protein Kinase. J.Biol.Chem. 252 , 4888-4894. Kindred,B. and ShreffIer,D.C.(1972) H-2 Dependence of Cooperation Between T and B C e l l s in vivo . J.Imm. 109 ,940-943. Klein,J.(1979) The Major Histocompatibility Mouse. Science 203 , 516-521.  Complex  of the  82  K l e i n , J . , Juretic,A., Baxevanis,C.N. and Nagy,Z.A.(1981) The T r a d i t i o n a l and a New Version of the Mouse H-2 Complex. Nature 291 , 455-460. Korman,A.J., Knudsen,P.J., Kaufman,J.F. and Strominger,J.L.(1982) cDNA Clones for the Heavy Chain of HLA-DR Antigens Obtained After Immunopurification of Polysomes by Monoclonal Antibody. Proc.Natl.Acad.Sci. USA 79 , 1844-1848. Korman,A.J., A u f f r a y , C , Schamboeck,A. and Strominger,J,L.(1982) The Amino Acid Sequence and Gene Organization of the Heavy Chain of the HLA-DR Antigen: Homology to Immunoglobulins. Proc.Natl.Acad.Sci. USA 79 , 6013-6017. Kvist,S., Bregegere,F., Nask,L., Cami,B., Gavoff,H., Danniel,F., Wiman,K., Larhammar,D., Abastudo,J.P., Gachelian,G., Peterson,P.A., Dobberstein,B. and Kourilsky,P.(1981) cDNA Clone Coding for Part of a Mouse H-2 Major Histocompatibility Antigen. Proc .Natl .Acad.Sci . USA 7_8 , 2722-2776. d  Land,H., Grez,M., Hauser,H., Lindenmaier,N. and Schutz,G.(1981) 5'-Terminal Sequences of Eukaryotic mRNA Can be Cloned with High E f f i c i e n c y . Nuc.Acid.Res. 9 ,2251-2266. Larhammar,D., Wiman,K., Schenning,L., Claesson,L., Gustafsson,K., Peterson,P.A. and Rask,L.(1981) Evolutionary Relationship Between HLA-DR Antigen 0 Chains, HLA-A,B,C Antigen Subunits and Immunoglobulin Chains. Scand.J.Imm. J_4 , 617-622. Larhammar,D., Schenning,L., Gustafsson,K., Wiman,K., Claesson,L., Rask,L., Peterson,P.A.(1982a) Complete Amino Acid Sequence of an HLA-DR Antigen-Like /3 Chain as Predicted From the Nucleotide Sequence: S i m i l a r i t i e s with Immunoglobulins and HLAA,-B, and -C Antigens. Proc;Natl.Acad.Sci. USA 7_9 , 3687- 3691. Larhammar,D., Gustafsson,K., Claesson,L., B i l l , P . , Wiman,K., Schenning,L., Sundelin,J., Widmark,E., Peterson,P.A. and Rask,L.(1982b) Alpha Chain of HLA-DR Transplantation Antigens i s a Member of the Same Protein Superfamily as the Immunoglobulins. C e l l 30 , 153-161. Lee,J.S., Trowsdale,J. and Bodmer,W.F.(1982a) vDNA Clones Coding for the Heavy Chain of Human HLA-DR Antigen. Proc.Natl.Acad.Sci. USA 79 , 545-549. Lee,J.S., Trowsdale,J., Travers,P.J., Carey,J., Grosveld,F., Jenkins,J. and Bodmer,W.F.(1982b) Sequence of an HLA-DR a Chain cDNA. Clone and Intron- Exon Organization of the Corresponding Gene. Nature 299 , 750-752. Lerner,E.A., Matis,L.A., Janeway,C.A., Jones,P.P., Schwartz,R.H. and Murphy,D.B.(1980) Monoclonal Antibody against an Ir Gene Product. J.Exp.Med. 152 ,1085-1101.  83  Levine,B.B., Ojeda,A.and Benacerraf,B.(1963) Studies on A r t i f i c i a l Antigens. I l l The Genetic Control of the Immune Response to Hapten-Poly-L-Lysine Conjugates in Guinea Pigs. J.Exp.Med. JJ_8 , 953-957. Lewin,B.(1980) Alternatives for S p l i c i n g : Recognizing the Ends of Introns. C e l l 22 ,324-326. Lipsky,P.E. and Rosenthal,A.S.(1973a) Macrophage-Lymphocyte Interaction. I Characteristics of the Antigen-Independent Binding of Guinea Pig Thymocytes and Lymphocytes to Syngeneic Macrophages. J.Exp.Med. 138 , 900-924. McDevitt,H.O. and Sela,M.(1965) Genetic Control of the Antibody Response. I Demonstration of Determinant-Specific Differences in Response to Synthetic Polypeptide Antigens in Two Strains of Inbred Mice. J.Exp.Med. 122 , 517-531. McDevitt,H.O. and Chinitz,A.(1969) Genetic Control of the Antibody Response: Relationship Between Immune Response and Histocompatibility (H-2) Type. Science,, 163 , 1207-1208. McDevitt.H.O., Deak,B.D., Shreffler,D.C., Klein,J., Stimpfling,J.H. and Snell,D.G.(1972) Genetic Control of the Immune Response: Mapping of the Ir-1 Locus. J.Exp.Med. 135 ,1259-1278. Maniatis,T., Jeffrey,A. and Kleid,D.G.(1975) Nucleotide Sequence of the Rightward Operator of Phage Lambda. Proc.Nat.Acad.Sci. USA 72 , 1184-1188. Martinko,J.M., Uehara,H., Ewenstein,B.M., Kindt,J.J., Coligan,J.E. and Nathanson, S.G.(1980) Primary Structure of Murine Major Histocompatibility Complex Alloantigens: Completion of the Sequence of the Amino-Terminal 284 Residues of H-2K Molecule. Biochemistry J_9 , 6182-6188. Maxam,A.M. and Gilbert,W.(1980) Sequencing End-Labelled DNA with Base-Specific Chemical Cleavages. Methods Enzymol. 6_5 , 499-559. Melgar,E. and Goldwaith,D.A.(1968) Deoxyribonucleic Acid Nucleases. II The Effect of Metals on the Mechanism of Action of Deoxyribonuclease I. J.Biol.Chem. 243 ,4409-4416. Mellor,A.L., Golden,L., Weiss,E., Bullman,H., Hurst,J., Simpson,E., James,R.F.L., Townsend,A.R.M., Taylor,P.M., Schmidt,W., Ferluga,J., Leben,L., Santamaria,M., Atfield,G., Festenstein,H. and Flavell,R.A. (1982) Expression of Murine H2K Histocompatibility Antigen in C e l l s Transformed with Cloned H-2 Genes. Nature 298 , 529-534. Merryman,C.F. and Maurer,P.H.(1976) Genetic Control of Immune Response Against Random Copolymers of Glutamic Acid and Alanine (GA) and Tyrosine (GT) in Inbred Mice. J.Imm. 116 , 739-742.  84  Moore,K.W., Shev,B.T., Sun,V.H., Eakle,K.A. and Hood,L.(1982) I d e n t i f i c a t i o n of a BALB/c H-2L Gene by DNA-Mediated Gene Transfer. Science 215 , 677-682. 1  Muramatsu,T. and Nathenson,S.G.(1970) Studies on the Carbohydrate Portion of Membrane-Located Mouse H-2 Alloantigens. Biochemistry 9 ,4875-4883. Murphy,D.B. and ShreffIer,D.C.(1975) Cross-Reactivity Between H2K and H-2D Products. I Evidence for Extensive and Reciprocal Serological Cross-Reactivity. J.Exp.Med. 141 , 374-391. Murphy,D.B.(1975) Serological Cross-Reactivity Between Products of Discrete Ia Genes. Fed.Proc. 34 , 1016.  the  Nathenson,S.G. and Cullen,S.E.(1974) Biochemical Properties and Immunochemical-Genetic Relationships of Mouse H-2 Alloantigens. Biochem.Biophys.Acta. 344 ,1-25. Natori,T., Katagiri,M., Tanigaki,N. and Pressman,D.(1974) The 11,000-Dalton Component of Mouse H-2. Isolation and I d e n t i f i c a t i o n . Transplantation J_8 , 550-555. Orr,H.T., Lopez de Castro,J.A., Lancet,D. and Strominger,J.L.(1979) Complete Amino Acid Sequence of a PapainS o l u b i l i z e d Human Histocompatibility Antigen, HLA-B7.2. Sequence Determination and Search for Homologies. Biochemistry J_8 , 57115720. Orr,H.T., Lopez de Castro,J.A., Parham,P., Ploegh,H.L. and Strominger,J.L.(1979) Comparison of Amino Acid Sequences of Two Human Histocompatibility Antigens, HLA-A2 and HLA-B7: Location of.Putative Alloantigenic Sites. Proc.Natl.Acad.Sci. USA 76 ,4395-4399. Parnes,J., Velan,B., Felsenfeld,A., Ramanthan,L., Ferrini,U., Appella,E. and Seidman , J .G. ( 1 98 1 ) Mouse /^microglobulin cDNA Clones: A Screening Procedure for cDNA Corresponding to Rare mRNAs. Proc.Nat.Acad.Sci. USA 78 ,2253-2257. Peterson,P.A., Cunningham,B.A., Berggard,I. and Edelman,G,M.(1972) /^microglobulin - A Free Immunoglobulin Domain. Proc.Natl.Acad.Sci. USA 69 , 1697-1701. Ploegh,H.L., Orr,T.H. and Strominger,J.L.(1980) Molecular Cloning of a Human Histocompatibility Antigen cDNA Fragment. Proc.Natl.Acad.Sci. USA 77 , 6081- 6085. Poljak,R.J., Amzel,L.M., Avey,H.P., Chen,B.L., Phizackerley,R.P. and Saul, F.0973) Three-Dimensional Structure of the Fab' Fragment of a Human Immunoglobulin at 2.8-A Resolution. Proc.Natl.Acad.Sci. USA 70. , 3305-3310.  85  Porter,R.R.(1962) in 'Basic Problems of Neoplastic Disease' eds. Gellhorm,A. And Hirschberg,E. Columbia University Press, New York, pp 177-194. Proudfoot,N.J. and Brownlee,G.G.(1976) 3' Non-Coding Region Sequences in Eukaryotic Messenger RNA. Nature 263 ,211-214. Reyes,A.A., Schold,M. And Wallace,R.B.(1982) The Complete Sequence of the Murine Transplantation Antigen H-2D as Deduced by Molecular Cloning. Immunogenet. J_6 ,1-9. Rigby,P.W.J., Dieckmann,M., Rhodes,C, and Berg, P.(1977) Labelling Deoxyribonucleic Acid to High Specific A c t i v i t y IN VITRO by Nick Translation with DNA Polymerase I..J.Mol.Biol. 113 ,237-251. Robb,R.J., Terhorst,C. and Strominger,J.L.(1978) Sequence of the COOH-Terminal Hydrophilic Region of Histocompatibility Antigens HLA-A2 and HLA-B7. J . Biol.Chem. 253 , 5319-5324. Robertson,M.(1982) The Evolutionary Histocompatibility Complex and the Immunology. Nature 297 , 629-632.  Past of the Major Future of Cellular  Rogers,J., Early,P., C a r t e r , C , Calame,K., Bond,M., Hood,L. and Wall,R.(1980) Two RNA's With Different 3' Ends Encode MembraneBound and Secreted Forms of Immunoglobulin M Chain. C e l l 20_ , 303-312. Sang,J.H. and Sobey,W.R.(1 954) The Genetic Control to Antigenic Stimuli. J.Imm. 7_2 , 448-457.  of  Response  Schwartz,B.D., Kato,K., Cullen,S.E. and Nathenson,S.G.(1973) H-2 Histocompatibility Alloantigens. Some Biochemical Properties of the Molecules Solubilized by NP-40 Detergent. Biochemistry J_2 , 2157-2164 Schwartz,R.H., David,C.S., Sachs,D.H. and Paul,W.E.(1 976) T Lymphocyte-Enriched Murine Peritoneal Exudate Cells. I l l Inhibition of Antigen-Induced T Lymphocyte P r o l i f e r a t i o n with A n t i - l a Antisera. J.Imm. 117 , 531-540. Schwartz,R.H., David,C.S., Dorf,M.E. and Benacerraf,B.(1978) Inhibition of Dual Ir Gene-Controlled T-Lymphocyte P r o l i f e r a t i v e Response to Poly(Glu Lys Phe ) with A n t i - l a Antisera Directed Against Products of Either I-A or I-C Subregion. Proc.Natl.Acad.Sci. USA 75 , 2387-2391. 5 6  3 5  9  Shevach,E.M., Paul,W.E. and Green,I.(1972) HistocompatibilityLinked Immune Response Gene Functions in Guinea Pigs. J.Exp.Med. 136 , 1207-1221.  86  Shevach,E.M. and Rosenthal,A.S.(1973b) Function of Macrophages in Antigen Recognition by Guinea Pig T Lymphocytes. I I . Role of the Macrophage in the Regulation of Genetic Control of the Immune Response. J.Exp.Med. 138 ,1213-1229. Shimada,A. and Nathenson,S.G.(1969) Murine Histocompatibility-2 (H-2) Alloantigens. P u r i f i c a t i o n and Some Chemical Properties of Soluble Products from H-2 and H-2 Genotypes Released by Papain Digestion of Membrane Fractions. Biochemistry 8 , 4048-4062. b  d  Shreffler,D.C. and David,CS.(1975) The H-2 Major Histocompatibility Complex and the I Immune Response Region: Genetic Variation, Function, and Organization. Adv.Imm. 2_0 , 125-195. S i l v e r , J . , Cecka,J.M., McMillan,M. and Characterization of Products of the H-2 Harb.Symp. Quant.Biol. 4J_ , 369-377.  Hood,L.(1975) Chemical Complex. Cold Spring  Silver,J., Russell,W.A., Reis,B.L. and Frelinger,J.A.(1977) Chemical Characterization of Murine Ia Alloantigens Determined by the I-E/I-C Subregions of the H-2 Complex. Proc.Natl.Acad.Sci. USA 74 , 5131-5134. Singer,D.S., Camerini-Otero,R.D., Satz,M.L., Osborne,B., Sachs,D. and Rudikoff, S.(1982) Characterization of a Porcine Genomic Clone Encoding a Major Histocompatibility Antigen: Expression in Mouse L C e l l s . Proc.Natl.Acad.Sci. USA 79 , 14031407. Sobey,W.R., Magrath,J.M. and Reisner,A.H.(1966) Genetically Controlled Specific Immunological Unresponsiveness. Immunology n_ , 511-513. Sood,A.K., Pereira,D. and Weissman,S.M.(1981) Isolation and Partial Nucleotide Sequence of a cDNA Clone for Human Histocompatibility Antigen HLA-B by Use of an Oligodeoxynucleotide Primer. Proc .Natl .Acad. Sc i . USA 7_8 , 616620. Spiro,R.G. (1 973) Glycoproteins. Adv.Prot .Chem. 2_7 , 349-467. Sprent,J.(1978a) Restricted Helper Function of F1 Hybrid T C e l l s P o s i t i v e l y Selected to Heterologous Erythrocytes in Irradiated Parental Strain Mice. II Evidence for Restrictions Affecting Helper C e l l Induction and T-B Collaboration, Both Mapping to the K-End of the H-2 Complex. J.Exp.Med. 147 , 1159-1174. Sprent,J.(1978b) Role of H-2 Gene Products in the Function of Helper Cells from Normal and Chimeric Mice in vivo Immunol.Rev. 42 ,108-137.  T  87  t Steinmetz,M., Frelinger,J.G., Fisher,D., Hunkapiller,T., Pereira,D., Weissman, S.M., Uehara,H., Nathenson,S. and Hood,L.(198W Three cDNA Clones Encoding Mouse Transplantation Antigens: Homology to Immunoglobulin Genes. C e l l 24 , 125-134. Steinmetz ,M. , Moore,K.W., Frelinger , J.G. , Shier,B.T., Shen,F., Boyse,E.A. And Hood,L.(1981 ) A Pseudogene Homologous to Mouse Transplantation Antigens: Transplantation Antigens are Encoded by Eight Exons that Correlate with Protein Domains. C e l l 25 , 683-692. fc  Sredni,B., Matis,L.A., Lerner,E.A., Paul,W.E. And Schwartz,R.H.(1981) Antigen Specific T C e l l Clones Restricted to Unique F1 Major Histocompatibility Complex Determinants: Inhibition of P r o l i f e r a t i o n with Monoclonal A n t i - l a Antibody. J.Exp.Med. 153 ,677-693. Tomita,M., Furthmayr,H. and Marchesi,V.T.(1978) PrimaryStructure of Human Erythrocyte Glycophorin A. Isolation and Characterization of Peptides and Complete Amino Acid Sequence. Biochemistry \1_ , 4756-4770. Tragardh,L., Wiman,K., Rask,L. and Peterson,P.A.(1978) Amino Acid Homology Between HLA-A,B,C Antigens, ^ m i c r o g l o b u l i n and Immunoglobulins. Scand.J.Imm. 8 , 563-568. Uehara,H., Ewenstein,B.M., Martinko,J.M., Natherson,S.G., Coligan,J.E. and Kindt,T.J.(1980a) Primary Structure of Murine Major Histocompatibility Complex Alloantigens: Amino Acid Sequence of the Aminp-Terminal One Hundred and Seventy-Three Residues of the H-2K* Glycoprotein. Biochemistry j_9 , 306-315. Uehara,H., Ewenstein,B.M. , Martinko,J.M.., Nathenson,S.G. , Kindt,T.J. and Coligan,J.E.(1980b) Primary Structure of Murine Major Histocompatibility Alloantigens: Amino Acid Sequence of the Cyanogen Bromide Fragment Ia (Positons 139-228) from the H2K Molecule. Biochemistry J_9 , 6182-6188. Wagh,P.V. and Bahl,O.P.(1981) Crit.Rev.Biochem. JHD , 307-377.  Sugar  Residues  on- Proteins.  Williams,A.F. and Gagnon,J.(1982) Neuronal Cell Thy-1 Glycoprotein: Homology with Immunoglobulin. Science 216 , 696703. Wiman,K., Tragardh,L. and Peterson,P.A.(1979) Similarities Between Immunoglobulins and Transplantation Antigens in AminoAcid Sequence and Disulfide-Bond D i s t r i b u t i o n . Eur.J.Biochem. 95 , 265-273. Wiman,K. et.al.(l982) Isolation and I d e n t i f i c a t i o n Clone Corresponding to an HLA-DR Antigen Proc.Natl.Acad.Sci. USA 79 , 1703-1707.  of a cDNA 0 Chain.  88 Young,J.Z.(1950) in The L i f e of Vertebrates. Oxford pp 619-626.  University  Press,  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0095772/manifest

Comment

Related Items