UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Serine tRNAs and their genes in Drosophila melanogaster Cribbs, David Lamar 1982

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1982_A1 C75.pdf [ 13.99MB ]
Metadata
JSON: 831-1.0094971.json
JSON-LD: 831-1.0094971-ld.json
RDF/XML (Pretty): 831-1.0094971-rdf.xml
RDF/JSON: 831-1.0094971-rdf.json
Turtle: 831-1.0094971-turtle.txt
N-Triples: 831-1.0094971-rdf-ntriples.txt
Original Record: 831-1.0094971-source.json
Full Text
831-1.0094971-fulltext.txt
Citation
831-1.0094971.ris

Full Text

S E R I N E TRNAS AND T H E I R G E N E S I N D R O S O P H I L A M E L A N O G A S T E R by DAVID LAMAR CRIBBS B.A., The U n i v e r s i t y o f C o l o r a d o , 1975 M . S c , The U n i v e r s i t y o f B r i t i s h C o l u m b i a , 1979 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY i n The F a c u l t y o f G r a d u a t e S t u d i e s D epartment.of B i o c h e m i s t r y F a c u l t y o f M e d i c i n e We a c c e p t t h i s t h e s i s as c o n f o r m i n g to the r e q u i r e d s t a n d a r d The U n i v e r s i t y o f B r i t i s h Columbia J a n u a r y 1982 © D a v i d Lamar C r i b b s , 1982 In presenting t h i s thesis i n p a r t i a l f u l f i l m e n t of the requirements for an advanced degree at the University of B r i t i s h Columbia, I agree that the Library s h a l l make i t f r e e l y a v a i l a b l e for reference and study. I further agree that permission for extensive copying of t h i s thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It i s understood that copying or pu b l i c a t i o n of t h i s thesis for f i n a n c i a l gain s h a l l not be allowed without my written permission. Department of Biochemistry  The University of B r i t i s h Columbia 2075 Wesbrook Place Vancouver, Canada V6T 1W5 Date Feb. 11, 1982 \T-< c / I / in \ i i SUMMARY S e r i n e tRNAs and t h e i r genes i n D r o s o p h i l a m e l a n o g a s t e r were c h a r a c t e r i z e d . The n u c l e o t i d e sequences o f tRNA^ (codon UCG), tRNA 7 (UCA, UCC, UCU), and t R N A ^ r (AGC, AGU) were d e t e r m i n e d . A l s o , t h e n u c l e o t i d e sequences o f f o u r tRNA genes from t h e X chromosome i s o l a t e d i n recom-b i n a n t p l a s m i d s were d e t e r m i n e d . SGP SP.Y* T r a n s f e r RNA^ and tRNA y d i f f e r a t o n l y t h r e e o u t o f 85 p o s i t i o n s , i n c l u d i n g the "wobble" n u c l e o t i d e o f t h e a n t i c o d o n . However, tRNA2^ i s o n l y 72% homologous w i t h tRNA^ (62 o u t o f 85 p o s i t i o n s , n o t c o u n t i n g d i f f e r e n c e s i n m o d i f i c a t i o n ) . M a j o r r e g i o n s o f sequence homology (> 5 c o n s e c u t i v e p o s i t i o n s ) a r e found o n l y i n t h e D arm (21 c o n s e c u t i v e p o s i t i o n s ) and i n the T(JJC arm (11 c o n s e c u t i v e p o s i t i o n s ) . T r a n s f e r RNA^ e r and t R N A ^ e r a r e i n d i s t i n g u i s h a b l e by RNA-DNA h y b r i d i z a t i o n . Both h y b r i d i z e t o the same s i t e s on p o l y t e n e chromosomes i n s i t u , i n c l u d i n g t h e major s i t e a t 12DE on the X chromosome, and 23E on chromosome 2 ( H a y a s h i e t al_. (1980). Chromosoma 76, 65-84.) No o t h e r p u r i f i e d tRNA than tRNAs^ 7 has been shown t o h y b r i d i z e t o t h e X chromosome i n D r o s o p h i l a . T h e r e f o r e , s e v e r a l X - d e r i v e d r e c o m b i n a n t p l a s m i d s h y b r i d i z i n g t R N A ^ (pDt 16, pDt 17R, pDt 27R, and pDt 73; Dunn e t al _ . ( 1 9 7 9 ) . Gene ]_, 197-215.) were a n a l y z e d . Based on t h e r e s u l t s o f S o u t h e r n b l o t t i n g e x p e r i -ments, t h e r e a ppear t o be e i g h t tRNA genes on the f o u r p l a s m i d s (one each on pDt 17R and pDt 73; two on pDt 16; and f o u r on pDt 27R). Thus, th e 12DE r e g i o n c o n t a i n s a t l e a s t e i g h t tRNA e r genes. i i i R e s t r i c t i o n mapping and DNA sequence a n a l y s i s were per f o r m e d w i t h pDt 16, pDt 17R, and pDt 73. Based on the tRNA sequ e n c e s , which d i f f e r a t Sor Ssv* t h r e e p o s i t i o n s , t he p r e s u m p t i v e DNA sequences e n c o d i n g tRNA^ and tRNA^ can be r e p r e s e n t e d as 444 o r 777 genes. DNA sequence a n a l y s i s gave s u r p r i s i n g S e r r e s u l t s i n t h i s r e s p e c t . A n a l y s i s o f f o u r tRNA genes on the t h r e e p l a s m i d s S i d e n t i f i e d two 777 genes matching tRNA^ p l u s " h y b r i d " 774 and 474 sequences. F u r t h e r , pDt 16 c o n t a i n s both a 777 and a 774 gene as a d i r e c t r e p e a t 400 Se r base p a i r s a p a r t . S i n c e a 444 gene c o r r e s p o n d i n g t o tRNA^ must e x i s t , t h e r e a r e a t l e a s t f o u r d i f f e r e n t t y p e s o f c l o s e l y r e l a t e d s e r i n e tRNA genes i n the D. m e l a n o g a s t e r genome. T h i s o b s e r v a t i o n may have i m p l i c a t i o n s c o n c e r n i n g t h e e v o l u t i o n and maintenance o f r e i t e r a t e d tRNA genes i n e u k a r y o t e s . In a d d i t i o n t o s t u d i e s on s e r i n e tRNAs and t h e i r genes, t h e n u c l e o -t i d e sequences o f D r o s o p h i l a t R N A ^ s and o f a tRNA^ r^ were d e t e r m i n e d . i v TABLE OF CONTENTS Paoe Summary i i L i s t o f T a b l e s i x L i s t o f F i g u r e s x Acknowledgements x i i i D e d i c a t i o n x i v A b b r e v i a t i o n s x v Ch a p t e r I INTRODUCTION 1 I.A. P r e f a c e 1 I.B. S t r u c t u r e o f T r a n s f e r RNAs 2 I.B.I. S t r u c t u r e o f tRNA: The " C l o v e r l e a f " 3 I.B.2. M o d i f i e d n u c l e o s i d e s o f tRNA 6 I.B.2.a; M o d i f i e d n u c l e o s i d e s i n the f i r s t p o s i t i o n o f t h e a n t i c o d o n 7 I.B.2.b,..Modified n u c l e o s i d e s l o c a t e d a d j a c e n t t o t h e a n t i c o d o n 8 I.B.2.c. M o d i f i e d n u c l e o s i d e s i n o t h e r p o s i t i o n s o f the tRNA m o l e c u l e . ........ 9 I.B.3. T h r e e - d i m e n s i o n a l c o n f i g u r a t i o n o f tRNA. 10 I.B.4. P u r i f i c a t i o n o f tRNAs 11 I.B.5. Sequence a n a l y s i s o f tRNA... 14 I.C. T r a n s f e r RNA genes.. 17 V Page I.D. T r a n s f e r RNA and tRNA genes i n D r o s o p h i l a m e l a n o g a s t e r 21 I.D.I. T r a n s f e r RNAs i n D r o s o p h i l a . 21 I.D.I.a. T r a n s f e r RNA p o p u l a t i o n 21 I.D.I.b. N u c l e o t i d e sequences o f D r o s o p h i l a tRNAs 23 I.D.2. O r g a n i z a t i o n and s t r u c t u r e o f tRNA genes i n D r o s o p h i l a 23 I.D.2.a H y b r i d i z a t i o n o f tRNAs and genes t o p o l y t e n e chromosomes j_n s i t u 23 I.D.2.b. A n a l y s i s o f r e c o m b i n a n t p l a s m i d s c a r r y i n g D r o s o p h i l a tRNA genes 25 I . D . 2 . b . i . Genes i n the 42A r e g i o n : t he s t r u c t u r e o f a tRNA gene c l u s t e r 25 I . D . 2 . b . i i . O t h e r tRNA gene c l u s t e r s 26 I.D.2.C A r e re d u n d a n t tRNA genes i d e n t i c a l ? : 26 I.D.3. E x p r e s s i o n o f D r o s o p h i l a tRNA genes 27 Val I.D.3.a. E x p r e s s i o n o f tRNA genes i n mutant f l i e s 27 I.D.3.b. T r a n s c r i p t i o n o f D r o s o p h i l a tRNA genes 28 11 MATERIALS AND METHODS 30 II . A . RNA Sequence A n a l y s i s 30 I I . A . 1 . N u c l e o t i d e c o n t e n t a n a l y s i s 31 II. A . 2 . S y n t h e s i s o f [ 5 ' - 3 2 P ] c y t i d i n e 5', 3'-b i s p h o s p h a t e (*pCp) 31 I I . A . 3 . S y n t h e s i s o f [ 3 ' - 3 2 P ] t R N A by RNA l i g a s e -c a t a l y z e d a d d i t i o n o f *pCp 32 II.A . 4 . D e - p h o s p h o r y l a t i o n o f tRNA 32 I I . A . 5 . P o l y n u c l e o t i d e k i n a s e - c a t a l y z e d s y n t h e s i s o f [ 5 ' - 3 2 P ] t R N A o r o l i g o n u c l e o t i d e s 33 v i Page II.A. 6 . P u r i f i c a t i o n o f [ 5 ' - 3 2 P ] R N A 33 3? I I . A . 7 . Gel " r e a d - o f f " sequence a n a l y s i s o f [ 5 ' - P] o r [ 3 ' - 3 2 P ] R N A s 33 11.A.8. Sequence a n a l y s i s o f tRNA by t h e method o f S t a n l e y and V a s s i l e n k o 34 I I . A . 8 . a . P u r i f i c a t i o n o f tRNA by p o l y a c r y l a m i d e gel e l e c t r o p h o r e s i s 34 I I.A.8.b. P a r t i a l h y d r o l y s i s o f t h e tRNA 35 32 II.A.8.C. L a b e l l i n g h y d r o l y s i s p r o d u c t s w i t h P by p o l y n u c l e o t i d e k i n a s e 36 I I . A . 8 . d . S e p a r a t i o n o f [ 5 ' - 3 2 P ] t R N A fragments by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s 37 I I . A . 8 . e . A n a l y s i s o f 5 ' - t e r m i n i as *pNp's 37 I I . A . 8 . f . A n a l y s i s o f 5 ' - t e r m i n i as *pN's 39 I I . A . 8 . g . C h a r a c t e r i z a t i o n o f *pN's by t h i n l a y e r chromatography 40 11.A.8.h. C h a r a c t e r i z a t i o n o f s u l f u r - c o n t a i n i n g n u c l e o t i d e s . . . 40 I I . A . 9 . Two-dimensional RNA s e q u e n c i n g : a v a r i a t i o n on S t a n l e y / V a s s i l e n k o 41 II.A.10. "Wandering s p o t " a n a l y s i s o f [ 5 ' - 3 2 P ] o r 32 [ 3 ' - PjtRNA: t w o - d i m e n s i o n a l e l e c t r o p h o r e s i s / homochromatography 43 I I . B . DNA Sequence A n a l y s i s 44 I I . B . 1 . P r e p a r a t i o n o f p l a s m i d DNA. 45 I I . B . 2 . A g a r o s e gel e l e c t r o p h o r e s i s 45 I I . B . 3 . P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f d o u b l e -s t r a n d e d DNA fragments 46 I I . B . 4 . D i g e s t i o n o f DNA w i t h r e s t r i c t i o n enzymes 47 11. B.5. E l e c t r o e l u t i o n o f DNA f ragments from g e l s 48 I I . B . 6 . - 3 ' - e n d " l a b e l l i n g o f r e s t r i c t i o n fragments 49 v i i Page I I . B . 7 . S i z e d e t e r m i n a t i o n s f o r DNA fragments 51 I I . B . 8 . R e s t r i c t i o n enzyme mapping o f r e c o m b i n a n t p l a s m i d s 51 I I . B . 9 . I d e n t i f i c a t i o n o f DNA fragments c o n t a i n i n g S e r tRNA seq u e n c e s : S o u t h e r n b l o t t i n g e x p e r i m e n t s . . . 52 I I . B . 9 . a . P r e p a r a t i o n o f [ 3 1 - 3 2 P ] t R N A 7 e r as a h y b r i d i z a t i o n probe. 52 II.B.9.b. S o u t h e r n b l o t s from a g a r o s e g e l s v53 II.B.9.C. S o u t h e r n b l o t s from p o l y a c r y l a m i d e g e l s 54 I I . B . 10. Mapping o f s i n g l e - e n d l a b e l l e d DNA f r a g m e n t s by p a r t i a l d i g e s t i o n w i t h r e s t r i c t i o n enzymes -S m i t h / B i r n s t i e l mapping 55 I I . B . 11. Sequence a n a l y s i s by t h e method o f Maxam. and G i l b e r t 56 I I I SEQUENCE ANALYSIS OF SERINE tRNAs IN DROSOPHILA 60 I I I . A . I n t r o d u c t i o n 60 I I I . B . R e s u l t s 64 I I I . B . l . Sequence a n a l y s i s o f D. m e l a n o g a s t e r tRNA-^ 65 I I I . B . 2 . Sequence a n a l y s i s o f tRNA^ e r 91 I I I . B . 3 . Sequence a n a l y s i s o f t R N A ^ r 93 I I I .C. D i s c u s s i o n .... 104 11 I . C . I . Sequences o f i n d i v i d u a l s e r i n e tRNAs from D. m e l a n o g a s t e r 104 S p r I I I . C . 2 . R e c o g n i t i o n o f D r o s o p h i l a tRNAs by s e r y l - t R N A s y n t h e t a s e 104 I I I . C . 3 . Homologies among e u k a r y o t i c s e r i n e tRNAs; t R N A S e r gene e v o l u t i o n 106 IV. STRUCTURE AND ORGANIZATION OF SERINE tRNA GENES IN DROSOPHILA 114 IV.A. R e s u l t s .... 114 v i i i Page IV.A.1. R e s u l t s o f S o u t h e r n b l o t a n a l y s i s o f recom-b i n a n t p l a s m i d s u s i n g t e t r a m e r - r e c o g n i z i n g r e s t r i c t i o n enzymes 114 IV. A.2. S t r a t e g y f o r DNA sequence a n a l y s i s o f recom-b i n a n t p l a s m i d s 120 IV.A.3. Sequence a n a l y s i s o f pDt 73 120 IV.A.4. Sequence a n a l y s i s o f pDt 17R 127 IV.A.5. Sequence a n a l y s i s o f pDt 16 131 IV. A.6. Summary o f r e s u l t s f r o m DNA sequence a n a l y s i s o f pDt 16, pDt 17R, and p D t 7 3 149 IV.A.7. Comparison o f g e n e - f l a n k i n g sequences 152 IV.A.7.a. 3 ' - f l a n k i n g sequences 152 IV.A.7.b. 5 ' - f l a n k i n g sequences 154 IV.B. D i s c u s s i o n 155 V. SEQUENCE ANALYSIS OF t R N A ^ FROM DROSOPHILA. 167 V. A. I n t r o d u c t i o n 167 V.B. R e s u l t s 168 V. C. D i s c u s s i o n 191 BIBLIOGRAPHY 194 i x LIST OF TABLES T a b l e Page 1 N u c l e o t i d e c o n t e n t o f D r o s o p h i l a s e r i n e tRNAs 68 2 C h r o m a t o g r a p h i c m o b i l i t e s o f *pNp's 102 X LIST OF FIGURES F i g u r e Page Phe 1 C l o v e r l e a f s t r u c t u r e o f y e a s t tRNA 4 2 G e n e r a l i z e d c l o v e r l e a f s t r u c t u r e o f tRNA 5 Phe 3 T h r e e - d i m e n s i o n a l s t r u c t u r e o f y e a s t tRNA 12 4 N u c l e o t i d e a n a l y s i s o f D r o s o p h i l a s e r i n e tRNAs 67 Ser 5 S t a n l e y / V a s s i l e n k o sequence a n a l y s i s o f tRNA, Q p p 4 . and tRNAy 71 6 Gel " r e a d - o f f " a n a l y s i s o f t R N A ^ e r and t R N A 7 e r 78 7 "Wandering s p o t " a n a l y s i s o f the 5 ' - t e r m i n i o f t R N A ^ e r and t R N A ^ 83 8 C l o v e r l e a f s t r u c t u r e o f t R N A ^ e r and tRNA^ 1" 90 9 Gel " r e a d - o f f " a n a l y s i s o f t R N A ^ r 96 S 10 S t a n l e y / V a s s i l e n k o sequence a n a l y s i s o f tRNAg^ 97 11 Two-dimensional " r e a d - o f f " sequence a n a l y s i s o f Ser t R N A ^ ; a v a r i a t i o n on S t a n l e y / V a s s i l e n k o 101 12 C l o v e r l e a f s t r u c t u r e o f t R N A ^ r 103 CO 13 Sequence homologies between e u k a r y o t i c s e r i n e tRNAs 107 14 Sequences o f e u k a r y o t i c s e r i n e tRNAs 109 15 Comparison o f p o s i t i o n s d i f f e r i n g between s e r i n e tRNAs w i t h a n t i c o d o n s IGA and GCU i n D r o s o p h i l a and r a t l i v e r 112 16 S o u t h e r n b l o t a n a l y s i s o f rec o m b i n a n t p l a s m i d s h y b r i d i z i n g D r o s o p h i l a . s e r i n e tRNAs 116 17 R e s t r i c t i o n maps e x p e c t e d , f o r t R N A ^ e r and t R N A ^ e r genes 118 x i F i g u r e Page 18 N u c l e o t i d e sequence o f the g e n e - c o n t a i n i n g r e g i o n i n pDt 73 123 19 M a x a m / G i l b e r t sequence a n a l y s i s o f t h e s e r i n e tRNA gene i n pDt 73 125 20 R e s t r i c t i o n mapping o f pDt 17R by a g a r o s e gel e l e c t r o -p h o r e s i s o f r e s t r i c t i o n f ragments and S o u t h e r n b l o t a n a l y s i s 129 ; 21 R e s t r i c t i o n map o f t h e D r o s o p h i l a i n s e r t i n pDt 17R 130 22 S m i t h / B i r n s t i e l r e s t r i c t i o n mapping o f t h e gene-c o n t a i n i n g r e g i o n i n pDt 17R 133 23 N u c l e o t i d e sequence o f t h e g e n e - c o n t a i n i n g r e g i o n i n pDt 17R 135 24 M a x a m / G i l b e r t sequence a n a l y s i s o f t h e s e r i n e tRNA gene i n pDt 17R 137 25 M a x a m / G i l b e r t sequence a n a l y s i s . o f t h e s e r i n e tRNA genes i n pDt 16 140 26 R e s t r i c t i o n mapping o f pDt 16 by a g a r o s e g e l e l e c t r o -p h o r e s i s o f r e s t r i c t i o n fragments and S o u t h e r n b l o t a n a l y s i s 142 27 R e s t r i c t i o n map o f t h e D r o s o p h i l a i n s e r t i n pDt 16 145 28 S m i t h / B i r n s t i e l r e s t r i c t i o n mapping o f the gene-c o n t a i n i n g r e g i o n i n pDt 16 147 29 N u c l e o t i d e sequence o f the g e n e - c o n t a i n i n g r e g i o n i n pDt 16 151 30 Comparison o f s e r i n e tRNA g e n e - f l a n k i n g sequences from pDt 73, pDt 17R, and pDt 16 153 31 C l o s e l y r e l a t e d but n o n - i d e n t i c a l tRNAs 157 32 N u c l e o t i d e a n a l y s i s o f D r o s o p h i l a t R N A ^ y s 170 33 S t a n l e y / V a s s i l e n k o sequence a n a l y s i s o f tRNAJ: y s 172 34 Chromatography o f a t h i o n u c l e o t i d e a f t e r t r e a t m e n t w i t h CNBr 175 x i i F i g u r e Page 35 Gel " r e a d - o f f " a n a l y s i s o f [ 5 ' - 3 2 P ] t R N A | : y S and l a r g e o l i g o n u c l e o t i d e s 177 36 Gel " r e a d - o f f " a n a l y s i s o f [ 3 ' - 3 2 P ] t R N A J : y s 179 37 "Wandering s p o t " a n a l y s i s o f the 3'-terminus o f tRNA|: y s 181 38 C l o v e r l e a f s t r u c t u r e o f t R N A g y s 182 3 39 Gel " r e a d - o f f " a n a l y s i s o f [ 5 ' - 3 2 P ] t R N A ^ | 184 40 Gel " r e a d - o f f " a n a l y s i s o f [ 3 1 - 3 2 P ] t R N A ^ 186 x i i i ACKNOWLEDGEMENTS I w i s h t o thank Gordon Tener f o r h i s h e l p , encouragement, and c o n s i d e r a t i o n as my gr a d u a t e s u p e r v i s o r . I a l s o wish t o thank Ian G i l l a m f o r h i s many c o n t r i b u t i o n s t o my r e s e a r c h . F i n a l l y , I am i n the d e b t o f a l a r g e number o f p e o p l e i n our l a b o r a t o r y and i n the s e v e r a l groups c o l l a b o r a t i n g w i t h us f o r d i s c u s s i o n s , a d v i c e , g i f t s o f m a t e r i a l s , and e n t h u s i a s m . xi v DEDICATION This thesis is dedicated to the memory of my father, and to my mother. XV ABBREVIATIONS A number o f a b b r e v i a t i o n s a r e used r o u t i n e l y t h r o u g h o u t t h e t e x t . F or c o n v e n i e n c e , t h e s e a r e c o m p i l e d h e r e . N u c l e o s i d e s and n u c l e o t i d e s : N n u c l e o s i d e (A,G,C,U, o r m o d i f i e d n u c l e o s i d e s ) dN d e o x y n u c l e o s i d e (dA,dG,dC,dT) NMP n u c l e o s i d e 5'-phosphate dNMP d e o x y n u c l e o s i d e 5'-phosphate NDP n u c l e o s i d e 5 ' - d i p h o s p h a t e dNDP d e o x y n u c l e o s i d e 5 1 - d i p h o s p h a t e NTP n u c l e o s i d e 5 ' - t r i p h o s p h a t e dNTP d e o x y n u c l e o s i d e 5 ' - t r i p h o s p h a t e A a d e n o s i n e G g u a n o s i n e C c y t i d i n e U u r i d i n e dA d e o x y a d e n o s i n e dG de o x y g u a n o s i n e dC d e o x y c y t i d i n e dT d e o x y t h y m i d i n e ( t h y m i d i n e ) M o d i f i e d n u c l e o s i d e s a r e a b b r e v i a t e d as recommended i n r e f . 12. p p h o s p h o r y l group *p ^ P - l a b e l l e d p h o s p h o r y l group pN n u c l e o s i d e 5'-phosphate Np n u c l e o s i d e 3'-phosphate Np (2') n u c l e o s i d e 2'-phosphate pNp n u c l e o s i d e 5', 3 ' - b i s p h o s p h a t e *pN n u c l e o s i d e [5'-32p] phosphate Np* n u c l e o s i d e [ 3 ' - ^ P ] phosphate *pNp n u c l e o s i d e 5', 3 ' - b i s [ 5 ' - 3 2 P ] phosphate x v i O t h e r : XC x y l e n e c y a n o l FF BB bromophenol b l u e TEMED N , N , N ' , N 1 - t e t r a m e t h y l e t h y l e n e d i a m i n e SSC 0.15 M N a C l , 0.015 M sodium c i t r a t e , pH 7 2 x SSC 0.30M N a C l , 0.030 M Sodium c i t r a t e , pH 7 NH^OAc ammonium a c e t a t e b.p. base p a i r s kb k i l o b a s e p a i r s - 1 -C h a p t e r I INTRODUCTION A. P r e f a c e T h i s t h e s i s d e a l s w i t h a s t u d y on s e r i n e tRNAs and s e r i n e tRNA genes i n D r o s o p h i l a m e l a n o g a s t e r . I t p r e s e n t s d a t a on the n u c l e o t i d e sequences o f s e v e r a l D r o s o p h i l a tRNAs, i n c l u d i n g t R N A s ^ e r r e a d i n g the s i x s e r i n e c o d o n s / and -on t h e s t r u c t u r e and o r g a n i z a t i o n o f t R N A ^ e r genes. The t h e s i s i s d i v i d e d i n t o f i v e c h a p t e r s . They a r e p r e s e n t e d i n t h e f o l l o w i n g way. ( i ) The i n t r o d u c t o r y c h a p t e r ( C h a p t e r I) i s i n t e n d e d t o p r o v i d e the r e a d e r w i t h an o v e r v i e w o f t h e c h a r a c t e r i s t i c s o f tRNA and o f tRNA genes. The l a s t s e c t i o n o f the i n t r o d u c t i o n d e a l s s p e c i f i c a l l y w i t h D r o s o p h i l a tRNAs and tRNA genes. In i t I emphasize advances o f the l a s t s e v e r a l y e a r s , l a r g e l y made p o s s i b l e by r e c o m b i n a n t DNA t e c h n i q u e s . ( i i ) C h a p t e r II c o n t a i n s a d e s c r i p t i o n o f methods used i n the p r e s e n t work. ( i i i ) N u c l e o t i d e sequence a n a l y s e s o f t h r e e s e r i n e i s o a c c e p t o r tRNAs from D r o s o p h i l a a r e p r e s e n t e d i n C h a p t e r I I I . ( i v ) The f o u r t h c h a p t e r d e a l s w i t h the s t r u c t u r e and o r g a n i z a t i o n o f s e r i n e tRNA genes i n D r o s o p h i l a . The a n a l y s i s combines d a t a from i n s i t u h y b r i d i z a t i o n e x p e r i m e n t s by o t h e r w o rkers i n t h i s l a b o r a t o r y w i t h r e s t r i c t i o n enzyme mapping and n u c l e o t i d e sequence a n a l y s i s o f r e c o m b i n a n t p l a s m i d s h y b r i d i z i n g t R N A s S e r . In p a r t i c u l a r , s t r u c t u r e and o r g a n i z a t i o n o f t R N A S e r genes o b t a i n e d from t h e 12DE r e g i o n on - 2 -the X chromosome a r e c o n s i d e r e d , (v) Under some c o n d i t i o n s , t R N A ^ h y b r i d i z e s t o the 12DE r e g i o n o f p o l y t e n e X-'chromosomes i n s i t u . As p a r t o f a com-p r e h e n s i v e c h a r a c t e r i z a t i o n o f t h i s r e g i o n a t t h e m o l e c u l a r l e v e l , t h e n u c l e o t i d e sequence o f t R N A g y s was d e t e r m i n e d . A p a r t i a l sequence o f a tRNA^ r9 c o n t a m i n a t i n g the t R N A ^ s p r e p a r a t i o n i s a l s o p r e s e n t e d . An i n t r o d u c t i o n r e l e v a n t to e u k a r y o t i c s e r i n e tRNAs and t h e i r genes i s p r e s e n t e d i n C h a p t e r I I I , but a p p l i e s a l s o t o C h a p t e r IV. A s e p a r a t e i n t r o d u c t i o n c o n c e r n i n g D r o s o p h i l a l y s i n e tRNAs and t h e i r genes i s found i n C h a p t e r V. C h a p t e r s I I I , IV, and V each p r e s e n t r e s u l t s and d i s c u s s i o n p e r t a i n i n g t o the r e s e a r c h problem o f that, c h a p t e r . D i s c u s s i o n o f the major r e s u l t s o f t h e t h e s i s r e s e a r c h i s found i n C h a p t e r IV, " S t r u c t u r e and O r g a n i z a t i o n o f S e r i n e tRNA Genes i n D r o s o p h i l a . " B. S t r u c t u r e o f T r a n s f e r RNAs T r a n s f e r RNA (tRNA) i s a c l a s s o f m o l e c u l e s f u n c t i o n i n g as c a r r i e r s o f a c t i v a t e d amino a c i d s i n p r o t e i n b i o s y n t h e s i s , a fundamental p r o c e s s i n any l i v i n g c e l l . I t i s an a n c i e n t c l a s s o f m o l e c u l e s , p r o b a b l y h a v i n g ..: e x i s t e d i n some form s i n c e the f i r s t l i v i n g c e l l ( 1 ) . T r a n s f e r RNA m o l e c u l e s a r e r e m a r k a b l e f o r the l a r g e number o f c e l l components w i t h which they i n t e r a c t . These i n c l u d e p r o c e s s i n g and m o d i f y i n g enzymes., n u c l e o t i d y l t r a n s f e r a s e , aminoacyl-tRNA s y n t h e t a s e s , i n i t i a t i o n f a c t o r s , e l o n g a t i o n f a c t o r s , and r i b o s o m e s . T r a n s f e r RNAs have a v e r y c e n t r a l r o l e i n c e l l u l a r m e t a b o l i s m . They f u n c t i o n t o i n s e r t amino a c i d s i n t o n a s c e n t p o l y p e p t i d e c h a i n s i n r e s p o n s e t o DNA-coded mRNA. Thus, tRNAs a r e r e s p o n s i b l e f o r t r a n s f o r m i n g - 3 -the l i n e a r , sequence-encoded i n f o r m a t i o n o f DNA i n t o p r o t e i n s t r u c t u r e s r e s p o n s i b l e f o r dynamic e x p r e s s i o n o f t h e g e n e t i c i n f o r m a t i o n s t o r e d i n the genome. For t h e s e r e a s o n s , tRNA s t r u c t u r e and f u n c t i o n have been the s u b j e c t s o f e x t e n s i v e i n v e s t i g a t i o n . B.1. S t r u c t u r e o f tRNA: The " C l o v e r l e a f " The e x i s t e n c e o f t r a n s f e r RNA, p r e d i c t e d e a r l i e r on t h e o r e t i c a l grounds by C r i c k , was d e m o n s t r a t e d by Hoaglund and Zamecnik i n 1957 ( 2 ) . The f i r s t n u c l e o t i d e sequence o f a p u r i f i e d tRNA was com p l e t e d by H o l l e y and h i s co-workers i n 1965 ( 3 ) . T h i s sequence, o f y e a s t a l a n i n e tRNA, can be drawn i n s e v e r a l p o s s i b l e s e c o n d a r y s t r u c t u r e s . One o f t h e s e , t h e " c l o v e r l e a f " s t r u c t u r e , was a l s o a p o s s i b l e form f o r s e v e r a l tRNAs whose sequences were c o m p l e t e d s h o r t l y a f t e r ( 4 , 5 , 6 ) . The n u c l e o t i d e sequence o f y e a s t p h e n y l a l a n i n e tRNA i s shown i n i t s " c l o v e r l e a f " s t r u c t u r e i n F i g u r e 1. The sequences o f many. tRNAs a r e now known ( 7 ) . A l l c y t o p l a s m i c tRNAs can be r e p r e s e n t e d by a s t a n d a r d " c l o v e r l e a f " , w i t h i n v a r i a n t o r s e m i - i n v a r i a n t n u c l e o t i d e s i n c h a r a c t e r i s t i c p o s i t i o n s ( F i g u r e 2 ) . Reviews on t h i s s u b j e c t a r e a v a i l a b l e ( 8 , 9 ) . T r a n s f e r RNAs g e n e r a l l y c o n t a i n 75-90 n u c l e o t i d e s ( 7 ) . The s t a n d a r d s t r u c t u r e c o n s i s t s o f an a c c e p t o r arm, t h e d i h y d r o u r i d i n e (D) arm c o n t a i n i n g t h e D l o o p (Loop I ) , t h e a n t i c o d o n arm c o n t a i n i n g t h e a n t i c o d o n l o o p (Loop I I ) , ' t h e e x t r a o r v a r i a b l e arm (Loop I I I ) , and t h e TIJJC arm and l o o p (Loop I V ) . The a c c e p t o r arm c o n s i s t s o f a stem c o n t a i n i n g seven base p a i r s ( u s u a l l y W a t s o n - C r i c k base p a i r s , G-C o r A-U) and a s i n g l e - s t r a n d e d t a i l a t the 3•'-terminus w i t h sequence NCCA. A pG C C G G C G U A U U A U A D G A D C U C n?G • • • • G G A G C G G A Cm U C U G A C A C rr^CU G U G C U m7G A C . G c G A U G m5C A 4» A Y m:A Gm F i g u r e 1 - C l o v e r l e a f s t r u c t u r e o f y e a s t tRNA - 5 -D L O O P -R-15 o-o -Y-o—o— R-o; 'o—o—o-o-c ANTICODON LOOP ACCEPTOR S T E M T ¥ C LOOP /" T 60 o—o-o-G, 55 VARIABLE LOOP ANTICODON F i g u r e 2 - G e n e r a l i z e d c l o v e r l e a f s t r u c t u r e o f tRNA. - 6 -(An i m p o r t a n t e x c e p t i o n i s the c l a s s o f p r o k a r y o t i c i n i t i a t o r m e t h i o n i n e tRNAs, i n which t he 5 ' - t e r m i n a l base and the base o p p o s i t e i t do n o t p a i r . T h i s f e a t u r e i s a p p a r e n t l y n e c e s s a r y f o r c o r r e c t r e c o g n i t i o n by s p e c i f i c i n i t i a t i o n f a c t o r s . A l s o , h i s t i d i n e tRNAs from both p r o k a r y o t e s and e u k a r y o t e s have an e x t r a n u c l e o t i d e a t t h e 5'-terminus., which may o r may n o t base p a i r w i t h t h e o p p o s i t e n u c l e o t i d e . ) A m i n o a c y l a t i o n o f t h e tRNA o c c u r s a t the 3 ' - t e r m i n a l a d e n o s i n e r e s i d u e . The D arm c o n t a i n s a stem o f t h r e e o r f o u r base p a i r s and a l o o p . The D l o o p i s o f v a r i a b l e l e n g t h , u s u a l l y 8 to 10 n u c l e o t i d e s , w i t h v a r i a b l e a and 3 r e g i o n s f l a n k i n g t h e s t a n d a r d GG sequence a t p o s i t i o n s 17 and 18. The D l o o p n o r m a l l y c o n t a i n s a t l e a s t one d i h y -d r o u r i d i n e r e s i d u e . The a n t i c o d o n arm c o m p r i s e s a stem o f f i v e base p a i r s and a l o o p o f seven n u c l e o t i d e s c o n t a i n i n g t h e t r i p l e t a n t i c o d o n . The e x t r a o r v a r i a b l e arm i s f o u r o r f i v e n u c l e o t i d e s l o n g i n abo u t 80% o f c y t o p l a s m i c tRNA s e q u e n c e s , b u t 13-21 n u c l e o t i d e s l o n g i n t h e r e m a i n i n g 20%. (The e x t r a arm and t h e a and 6 r e g i o n s o f t h e D l o o p a r e the o n l y sequences o f v a r i a b l e l e n g t h i n t h e s t a n d a r d " c l o v e r l e a f " . ) The T^C arm i s made up o f a f i v e b a s e - p a i r stem and a seven n u c l e o t i d e l o o p . The f i r s t ( 5 1 ) n u c l e o t i d e o f t h e l o o p i s u s u a l l y r i b o t h y m i d i n e ( T ) . B.2. M o d i f i e d n u c l e o s i d e s o f tRNA T r a n s f e r RNAs c o n t a i n many d i f f e r e n t t y p e s o f m o d i f i e d n u c l e o s i d e s . These have been d i s c u s s e d i n a number o f r e v i e w s (10,11,12,13,14). Up t o 25% o f the n u c l e o s i d e s i n a tRNA may be m o d i f i e d ( 7 ) . Each m o d i f i c a t i o n , i n t r o d u c e d p o s t - t r a n s c r i p t i o n a l l y by s p e c i f i c t RNA-modifying enzymes ( 1 5 ) , o c c u r s i n one o r a few c h a r a c t e r i s t i c p o s i t i o n s i n the tRNA " c l o v e r l e a f " - 7 -( 7 ) . The m o d i f i e d n u c l e o s i d e s o f tRNA have been d i v i d e d i n t o t h r e e c l a s s e s : ( i ) t h o s e found i n t h e f i r s t ( 5 1 ) o r "wobble" p o s i t i o n o f t h e a n t i c o d o n ; ( i i ) t h o s e found a d j a c e n t t o the 3 1 end o f the a n t i c o d o n ; and ( c ) t h o s e found e l s e w h e r e (12,13,14). B. 2.a. M o d i f i e d n u c l e o s i d e s i n t h e f i r s t p o s i t i o n o f the a n t i c o d o n The g e n e t i c code c o n s i s t s o f 64 t r i p l e t codons, grouped i n f o u r s as XYN ( e . g . CGN, where X - C, Y .=; G, and N = A,G,C, o r U). Of the 64 codons, 61 code f o r an amino a c i d ("sense" c o d o n s ) ; the o t h e r t h r e e s i g n a l t e r m i n a -t i o n o f t r a n s l a t i o n ("nonsense" c o d o n s ) . In a number o f codon g r o u p s , a l l f o u r s p e c i f y the same amino a c i d . C r i c k ' s "wobble" h y p o t h e s i s s e t s o u t r u l e s f o r p a i r i n g between the a n t i c o d o n s o f tRNAs and codons i n mRNA ( 1 6 ) . I t a l l o w s n o n - s t a n d a r d b a s e - p a i r s between t h e f i r s t n u c l e o s i d e o f t h e a n t i -codon and the t h i r d n u c l e o s i d e o f the codon, t o g e t h e r w i t h s t a n d a r d A-U o r G-C b a s e - p a i r s between tRNA and t h e f i r s t two codon l e t t e r s . By a l l o w i n g n o n - s t a n d a r d b a s e - p a i r s , the d e g e n e r a t e s e t o f 61 sense codons can be r e a d by c o n s i d e r a b l y l e s s than 61 tRNAs. F o r example, C r i c k s u g g e s t e d t h a t tRNAs w i t h G i n t h e "wobble" p o s i t i o n would r e a d codons e n d i n g i n C and 4J; t h a t tRNAs w i t h i n o s i n e ( I ) t h e r e would r e a d codons e n d i n g i n A, C, o r U; and t h a t tRNAs w i t h U i n t h i s p o s i t i o n would r e a d t h o s e e n d i n g i n A and G. The f i r s t and second c a s e s a r e c e r t a i n l y t r u e . I n o s i n e - c o n t a i n i n g tRNAs r e s p o n d t o codons e n d i n g i n A, C, o r U i n ribosome b i n d i n g a s s a y s . S i m i l a r l y , tRNAs w i t h G i n the f i r s t a n t i c o d o n p o s i t i o n r e a d codons e n d i n g i n U o r C, ( 1 6 , 1 7 ) . On the o t h e r hand, v i r t u a l l y no c y t o p l a s m i c tRNAs have been found w i t h an u n m o d i f i e d U i n the "wobble" p o s i t i o n ( 7 , 1 4 ) . M i t o c h o n d r i a l tRNAs from Neurospora c r a s s a c o n t a i n U i n t h i s p o s i t i o n , however, and p r e -sumably p a i r as p r e d i c t e d ( 1 8 ) . - 8 -A number o f m o d i f i e d n u c l e o s i d e s a r e found o n l y i n t h e f i r s t p o s i t i o n o f the a n t i c o d o n . These i n c l u d e s u r i d i n e - 5 - o x y a c e t i c a c i d (V 5 2 b a s e ) , 5 - m e t h o x y c a r b o n y l m e t h y l - 2 - t h i o u r i d i n e (mem s U), 5-methylaminomethyl-2 - t h i o u r i d i n e (mam.s U), and 7 - ( 4 , 5 - c i s d i h y d r o x y - ! - c y c l o p e n t e n - 3 - y l a m i n o -m e t h y l ) - 7 - d e a z a g u a n o s i n e (Q b a s e ) . M o d i f i c a t i o n s o f t h e "wobble" p o s i t i o n a l t e r codon s p e c i f i c i t y o f the tRNAs. Whether s p e c i f i c i t y i s i n c r e a s e d o r d e c r e a s e d depends on the p a r t i c u l a r m o d i f i c a t i o n . C o n v e r s i o n o f u r i d i n e t o V base a l l o w s d e c o d i n g o f codons e n d i n g i n U as w e l l as A and G. C o n v e r s i o n o f a d e n o s i n e t o i n o s i n e r e s u l t s i n a b i l i t y t o r e a d codons e n d i n g i n A, C, and 11(12,13,14). These two m o d i f i c a t i o n s thus r e s u l t i n d e c r e a s e d codon 5 2 s p e c i f i c i t y . However, mem s U and Q base seem t o f u n c t i o n t o i n c r e a s e codon s p e c i f i c i t y . T r a n s f e r RNAs c o n t a i n i n g Q base (a d e r i v a t i v e o f guanine) r e s p o n d p r e f e r e n t i a l l y t o codons NAU o v e r NAC ( 1 4 ) , w h i l e r a b b i t l i v e r tRNA*" y s c o n t a i n i n g mcm^s^U res p o n d s t o AAA i n p r e f e r e n c e to AAG ( 1 9 ) . Y e a s t tRNAg 1", which c o n t a i n s mcm 5s 2U, responds o n l y t o GAA, n o t GAG ( 2 0 ) . Presumably such a l t e r a t i o n o f codon s p e c i f i c i t y enhances t h e f u n c t i o n a l e f f i c i e n c y o f the tRNA p o p u l a t i o n i n p r o t e i n s y n t h e s i s . B.2.b. M o d i f i e d n u c l e o s i d e s l o c a t e d a d j a c e n t t o t h e a n t i c o d o n A number o f m o d i f i e d p u r i n e n u c l e o s i d e s a r e found a d j a c e n t ( 3 1 ) t o t he a n t i c o d o n . M o d i f i c a t i o n s range from s i m p l e m e t h y l a t i o n t o r a t h e r e x o t i c h y p e r m o d i f i c a t i o n s . The ty p e o f m o d i f i c a t i o n c o r r e l a t e s w e l l w i t h codon s p e c i f i c i t y ( 1 3 ) . The h y p e r m o d i f i e d bases f a l l i n t o two g e n e r a l c l a s s e s . (1) T r a n s f e r RNAs r e a d i n g codons t h a t b e g i n w i t h U have a m o d i f i e d 2 base w i t h a b u l k y h y d r o p h o b i c s u b s t i t u e n t . U s u a l l y t h i s base i s N-6-(A -- 9 -i s o p e n t e n y l ) - a d e n o s i n e ( i D A ) o r i t s 2 - m e t h y l t h i o d e r i v a t i v e , ms'~i uA. The f o r m e r i s found i n e u k a r y o t e s , t h e l a t t e r i n p r o k a r y o t e s . One o u t s t a n d i n g Phe e x c e p t i o n t o t h i s g e n e r a l i z a t i o n i s y e a s t tRNA , which c o n t a i n s t h e h y d r o p h o b i c Y base (12,13,14). (2) The s e t o f tRNAs r e a d i n g codons t h a t b e g i n w i t h A c o n t a i n a base w i t h a b u l k y h y d r o p h i l i c s u b s t i t u e n t . T h i s base i s g e n e r a l l y N - [ 9 - ( B - D - r i b o f u r a n o s y l ) p u r i n - 6 - y l c a r b a m o y l ] t h r e o n i n e 6 6 r • 2 6 ( t A) o r one o f i t s d e r i v a t i v e s such as mt A , o r ms t A (12 , 1 4 ) . These h y p e r m o d i f i e d n u c l e o s i d e s a r e t h o u g h t t o i n c r e a s e t r a n s l a -t i o n a l a c c u r a c y f o r codons b e g i n n i n g w i t h A o r U. T r a n s f e r RNAs might be e x p e c t e d t o i n t e r a c t r e l a t i v e l y weakly w i t h codons ANN o r UNN, s i n c e s t a n d a r d A-U base p a i r s can form o n l y two hydrogen bonds compared w i t h t h r e e f o r G-C p a i r s . How the h y p e r m o d i f i e d bases f u n c t i o n i s not known. I t has been s u g g e s t e d t h a t t h e s e bases may e x t e n d codon b i n d i n g t o f o u r bases so f a r as tRNA i s c o n c e r n e d ( 1 2 ) . An a t t r a c t i v e a l t e r n a t i v e p r o p o s a l i s t h a t t h e s e bases p r e v e n t d i s t o r t i o n o f the a n t i c o d o n and m a i n t a i n c o r r e c t base s t a c k i n g , p a r t i c u l a r l y a t the t h i r d a n t i c o d o n base, t h e r e b y h e l p i n g t o m a i n t a i n h i g h t r a n s l a t i o n a l a c c u r a c y a t UNN o r ANN codons ( 2 1 ) . N u c l e o s i d e s found a d j a c e n t t o t h e a n t i c o d o n i n tRNAs r e a d i n g CNN o r GNN codons i n c l u d e 1 - m e t h y l g u a n o s i n e , 2 - m e t h y l a d e n o s i n e , 6 - m e t h y l a d e n o s i n e , and 1 - m e t h y l i n o s i n e ( 7 ) . B.2.c. M o d i f i e d n u c l e o s i d e s i n o t h e r p o s i t i o n s o f the tRNA m o l e c u l e M o d i f i e d n u c l e o s i d e s l o c a t e d i n o t h e r p o s i t i o n s o f t h e tRNA m o l e c u l e than t he "wobble" p o s i t i o n o r a d j a c e n t to t h e a n t i c o d o n may f u n c -t i o n i n b i n d i n g o f tRNA t o r i b o s o m e s , s t a b i l i z a t i o n o f t h e tRNA c o n f o r m a t i o n , - 10 -enhancement o f n u c l e a s e r e s i s t a n c e o r o f s p e c i f i c r e c o g n i t i o n by a m i n o a c y l -tRNA s y n t h e t a s e ( 1 2 ) . W h i l e mutant s t r a i n s o f m i c r o o r g a n i s m s l a c k i n g some m o d i f y i n g enzymes may a ppear to grow n o r m a l l y , t h e s e m o d i f i c a t i o n s may enhance tRNA f u n c t i o n s u f f i c i e n t l y t o c o n f e r a s e l e c t i v e a d v a n t a g e . For example, b a c t e r i a l a c k i n g the enzyme t h a t s y n t h e s i z e s r i b o t h y m i d i n e from u r i d i n e i n tRNA a r e q u i c k l y s u b v e r t e d by w i l d t y p e s t r a i n s i n mixed c u l t u r e s ( 2 2 ) . M o d i f i e d n u c l e o s i d e s found i n tRNA a t p o s i t i o n s o u t s i d e the a n t i -codon l o o p i n c l u d e d i - h y d r o u r i d i n e i n the D l o o p o f most tRNAs, Tip i n p o s i -t i o n s 54 and 55 o f most tRNAs, 1 - m e t h y l a d e n o s i n e i n p o s i t i o n 58 o f many e u k a r y o t i c tRNAs, and 7 - m e t h y l g u a n o s i n e and 5 - m e t h y l c y t o s i n e i n the e x t r a arm o f many tRNAs ( 7 ) . B.3. T h r e e - d i m e n s i o n a l , c o n f i g u r a t i o n o f tRNA The d e t e r m i n a t i o n t o 0.25 nm r e s o l u t i o n o f a t h r e e - d i m e n s i o n a l Phe s t r u c t u r e f o r y e a s t tRNA by X-ray c r y s t a l l o g r a p h y was r e p o r t e d by two i n d e p e n d e n t groups i n 1973-74 (23,24). Because the t h r e e - d i m e n s i o n a l s t r u c -Phe t u r e i s known, tRNA has been the s u b j e c t o f many s t u d i e s on s t r u c t u r e / f u n c t i o n r e l a t i o n s h i p s . Of p a r t i c u l a r s i g n i f i c a n c e , r e s u l t s o f c h e m i c a l m o d i f i c a t i o n s t u d i e s on t h i s tRNA i n aqueous s o l u t i o n g i v e r e s u l t s c o n s i s t e n t Php w i t h the t h r e e d i m e n s i o n a l s t r u c t u r e o f c r y s t a l l i n e tRNA ( 2 5 ) . The c r y s t a l s t r u c t u r e deduced i s t h e r e f o r e r e l e v a n t t o the s t r u c t u r e o f t h e m o l e c u l e i n aqueous s o l u t i o n and t o i t s b i o l o g i c a l f u n c t i o n . Many s t u d i e s c o n s i s t e n t w i t h t h i s a s s e r t i o n have been c a r r i e d o u t ( r e v i e w e d i n 8,26). However, a d e t a i l e d d i s c u s s i o n o f t h e s e i s not n e c e s s a r y f o r o u r p u r p o s e s h e r e . - 11 -A diag r a m m a t i c t h r e e d i m e n s i o n a l s t r u c t u r e f o r y e a s t tRNA i s p r e s e n t e d i n F i g u r e 3. The m o l e c u l e has a compact L-shape, w i t h t he a n t i c o d o n l o o p a c c e s s i b l e t o r e a d mRNA a t one end and the NCCA o f the a c c e p t o r arm e x t e n d e d a t the o t h e r end t o donate an amino a c i d i n t o a p o l y p e p t i d e i n r e s p o n s e t o t h e c o r r e c t codon. The s t r u c t u r e o f v a r i o u s tRNAs must be s i m i l a r , s i n c e a l l tRNAs a c t i v e i n p r o t e i n b i o s y n t h e s i s must i n t e r a c t w i t h t he r i b o s o m e s . However, tRNAs must be d i f f e r e n t enough t o a l l o w h i g h l y s p e c i f i c a m i n o a c y l a t i o n by c o g n a t e s y n t h e t a s e s , and f o r r e c o g n i t i o n o f m e t h i o n i n e i n i t i a t o r tRNA by s p e c i f i c i n i t i a t i o n f a c t o r s . The e x i s t e n c e o f such s i m i l a r i t y i s s u p p o r t e d by t h e f a c t t h a t homogeneous c r y s t a l s can be p r e p a r e d c o n t a i n i n g a m i x t u r e o f tRNAs ( 2 7 ) . With r e s p e c t t o d i f f e r e n c e s , t h r e e d i m e n s i o n a l s t r u c t u r e s Met d e t e r m i n e d by X - r a y c r y s t a l l o g r a p h y f o r y e a s t i n i t i a t o r tRNA (28) and f o r a m i x t u r e o f y e a s t t R N A ^ y s p e c i e s ( 2 7 ) , w h i l e g e n e r a l l y s i m i l a r t o t h a t Phe f o r y e a s t tRNA ' a r e n o n e t h e l e s s d i s t i n c t i v e . The v a r i o u s m o d i f i e d n u c l e o s i d e s may f u n c t i o n by a l t e r i n g t h e s u r f a c e o f the f o l d e d tRNA i n s p e c i f i c ways t o enhance p a r t i c u l a r tRNA f u n c -t i o n s . The s u b s t i t u e n t s o f m o d i f i e d n u c l e o s i d e s may i n c r e a s e t he s u r f a c e a r e a o f a tRNA s u b s t a n t i a l l y . By p l a c i n g - d i s t i n c t i v e m o d i f i c a t i o n s i n p o s i t i o n s not i n v o l v e d i n g e n e r a l tRNA r e c o g n i t i o n f o r p r o t e i n s y n t h e s i s , s p e c i f i c r e c o g n i t i o n o f g e n e r a l l y s i m i l a r tRNA m o l e c u l e s might be a c h i e v e d . B.4. P u r i f i c a t i o n o f tRNAs A number o f d i f f e r e n t column c h r o m a t o g r a p h i c systems a r e used i n t h e p u r i f i c a t i o n o f tRNAs ( d i s c u s s e d i n 8,29). These i n c l u d e chromatography - 12 -- 13 -on B D - c e l l u l o s e ( 3 0 , 3 1 ) , DEAE-Sephadex ( 3 2 ) , Sepharose 6B i n a c i d i c ammonium s u l f a t e s o l u t i o n ( 3 3 ) , " r e v e r s e d phase" chromatography on RPC-5 columns (34) u t i l i z i n g a c o m b i n a t i o n o f i o n i c and h y d r o p h o b i c i n t e r a c t i o n s t o e f f e c t a s e p a r a t i o n o f tRNAs, o r the s i m i l a r system employing the a n i o n exchange p o l y s t y r e n e r e s i n Aminex-A28. ( 3 5 ) . S e v e r a l a f f i n i t y chromatography systems have been r e p o r t e d . F a m i l i e s o f i s o a c c e p t i n g tRNAs can be e n r i c h e d c o n -s i d e r a b l y by a m i n o a c y l a t i o n w i t h t he s p e c i f i c amino a c i d , d e r i v a t i z a t i o n w i t h an a r o m a t i c a c i d f u n c t i o n added t o the a-NH^ group o f the am i n o a c y l e s t e r , and chromatography on B D - c e l l u l o s e ( 3 1 ) . E x t e n s i v e l y p u r i f i e d tRNA can be o b t a i n e d by a f f i n i t y chromatography on a column c o n t a i n i n g a bound, p u r i f i e d tRNA w i t h an a n t i c o d o n complementary t o t h a t o f the d e s i r e d tRNA s p e c i e s . F o r example, E . c o l i t R N A ^ u ( a n t i c o d o n s^UUC) i s 1 9 - f o l d e n r i c h e d by passage Phe t h r o u g h a column c o n t a i n i n g c o v a l e n t l y bound y e a s t tRNA ' ( a n t i c o d o n G mAA) ( 3 6 ) . Columns c o n t a i n i n g bound a n t i b o d y r a i s e d a g a i n s t n u c l e o s i d e Y Phe o r d e r i v a t i v e s have been used i n p u r i f y i n g tRNA (37, 3 8 ) . S e p h a r o s e -bound l e c t i n s have been used i n p u r i f y i n g tRNAs w i t h a m a n n o s e - s u b s t i t u t e d Q base ( 3 9 ) . A l s o , t he h i g h r e s o l v i n g power o f p o l y a c r y l a m i d e g e l e l e c t r o -p h o r e s i s has been u t i l i z e d i n one, two, o r t h r e e d i m e n s i o n a l systems to a c h i e v e p u r i f i c a t i o n o f some tRNA s p e c i e s ( 4 0 , 4 1 ) . The s t r a t e g y employed i n our l a b o r a t o r y i n v o l v e s a m u l t i - s t e p e n r i c h m e n t by chromatography i n B D - c e l l u l o s e , S epharose 6B i h a c i d i c ammonium s u l f a t e r e v e r s e g r a d i e n t s , then r e p e a t e d RPC-5 chromatography i n s e v e r a l b u f f e r s u n t i l a s i n g l e , s y m m e t r i c a l peak i s o b t a i n e d . - 14 -B.5. Sequence a n a l y s i s o f tRNA The l a s t s e v e r a l y e a r s have seen major advances i n methods f o r sequence a n a l y s i s o f tRNAs t h a t c a n n o t be i s o l a t e d i n l a r g e q u a n t i t i e s , o r c o n v e n i e n t l y r a d i o l a b e l 1 ed i n t e r n a l l y d u r i n g c e l l growth. These " p o s t -l a b e l l i n g " methods a l l o w t he c o m p l e t e sequence o f a tRNA t o be e s t a b l i s h e d u s i n g as l i t t l e as 2-3 yg o f p u r i f i e d m a t e r i a l . An e x c e l l e n t d i s c u s s i o n o f many o f t h e s e methods by S i l b e r k l a n g , G i l l u m , and RajBhandary i s found i n r e f e r e n c e 42. A l s o , I have d i s c u s s e d tRNA s e q u e n c i n g methods i n C h a p t e r I o f my M.Sc. t h e s i s ( 4 3 ) . N e v e r t h e l e s s , a comprehensive d i s c u s s i o n o f tRNA s e q u e n c i n g methods i s r e l e v a n t t o the s u b j e c t o f t h i s t h e s i s . The f i r s t c o mplete tRNA sequence was completed by H o l l e y and h i s group i n 1965 ( 3 ) . D u r i n g t h i s work, H o l l e y worked o u t a g e n e r a l t w o - p a r t s t r a t e g y f o r sequence a n a l y s i s o f s m a l l RNAs. ( i ) The p u r i f i e d RNA i s h y d r o l y z e d t o c o m p l e t i o n by n u c l e a s e s w i t h d i f f e r e n t s p e c i f i c i t i e s t o g e n e r a t e d i s t i n c t s e t s o f f r a g m e n t s , which a r e then i d e n t i f i e d . Because o f the d i f f e r e n t s p e c i f i c i t i e s o f t h e enzymes used, some fragments can u s u a l l y be a l i g n e d a t t h i s s t a g e , s i n c e t h e y t w i l l c o n t a i n u n i q u e , o v e r l a p p i n g s e quences, ( i i ) The RNA i s p a r t i a l l y d i g e s t e d w i t h t he same enzymes t o make l a r g e r fragments which a r e a l s o s e p a r a t e d and c h a r a c t e r i z e d . These a r e used t o o r d e r t he o l i g o n u c l e o t i d e s o b t a i n e d from complete d i g e s t s . T h i s g e n e r a l s t r a t e g y , d e v i s e d f o r sequence a n a l y s i s o f p u r i f i e d , n o n - r a d i o -a c t i v e R N A s , i s d i s c u s s e d i n a r e v i e w by H o l l e y ( 4 4 ) . A major l i m i t a t i o n o f methods used i n H o l l e y ' s work i s the need f o r l a r g e amounts o f p u r i f i e d RNA. Thus, sequence a n a l y s i s c o u l d o n l y be c a r r i e d o u t on tRNAs t h a t c o u l d be p u r i f i e d i n b u l k , f o r i n s t a n c e from y e a s t , wheat germ, o r mammalian l i v e r . The i n t r o d u c t i o n by Sanger o f methods 32 f o r s e q u e n c i n g P - l a b e l l e d RNAs ( 4 5 ) , a d a p t i n g H o l l e y ' s s t r a t e g y , made - 15 -p o s s i b l e a n a l y s i s o f s m a l l amounts o f tRNAs from c e l l s t h a t c o u l d be c u l -32 t u r e d c o n v e n i e n t l y i n media c o n t a i n i n g P - i n o r g a n i c phosphate a t h i g h s p e c i f i c r a d i o a c t i v i t y . The major advances i n s e q u e n c i n g methodology i n the p a s t few y e a r s r e s u l t e d from development o f methods f o r e n z y m a t i c l a b e l l i n g o f non-r a d i o a c t i v e RNAs o r o l i g o n u c l e o t i d e s . A p a r t i c u l a r l y u s e f u l enzyme i n RNA sequence a n a l y s i s i s T 4 - i n d u c e d p o l y n u c l e o t i d e k i n a s e . K i n a s e - l a b e l l i n g o f tRNA fra g m e n t s g e n e r a t e d by r i b o n u c l e a s e T-j, o r r i b o n u c l e a s e A, s e p a r a -t i o n , and i d e n t i f i c a t i o n o f the [5 - P ] o l i g o n u c l e o t i d e s i s c e n t r a l t o the s t r a t e g y d e v i s e d by RajBhandary and h i s c o l l e a g u e s f o r sequence a n a l y s i s o f s m a l l amounts o f n o n - r a d i o a c t i v e tRNA ( 4 2 ) . C o n c e p t u a l l y s i m i l a r methods f o r a n a l y z i n g o l i g o n u c l e o t i d e s l a b e l l e d a t the 3'-end w i t h t r i t i u m have been d e v e l o p e d by Randerath and c o-workers ( 4 6 ) . These methods, w h i l e r e l a t i v e l y s e n s i t i v e compared to the c l a s s i c a l methods f o r a n a l y s i s o f n o n - r a d i o a c t i v e RNAs, r e q u i r e much more p u r i f i e d RNA than methods e m p l o y i n g phosphorus-32. 32 32 Sequence a n a l y s i s o f [ 5 ' - P] o r [3' - P] RNAs o r o l i g o n u c l e o -t i d e s has been r e p o r t e d . T h i s can be a c c o m p l i s h e d by t w o - d i m e n s i o n a l e l e c t r o p h o r e s i s / h o m o c h r o m a t o g r a p h y ( 4 7 ) , o r t w o - d i m e n s i o n a l g e l e l e c t r o -p h o r e s i s o f p a r t i a l e n z y m a t i c d i g e s t s ( 4 8 ) . A l t e r n a t i v e l y , methods have been d e v e l o p e d f o r a n a l y s i s o f e n d - l a b e l l e d RNAs by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f s e v e r a l p a r t i a l , b a s e - s p e c i f i c e n z y m a t i c h y d r o l y s a t e s ( 4 9 , 5 0 ) . RNA l a b e l l e d a t the 3'-end may be s u b j e c t e d t o p a r t i a l , b ase-s p e c i f i c c h e m i c a l m o d i f i c a t i o n , s t r a n d - s c i s s i o n a t m o d i f i e d r e s i d u e s , and gel e l e c t r o p h o r e s i s o f t h e p a r t i a l h y d r o l y s a t e s ( 5 1 ) . These gel s e q u e n c i n g methods a r e e s p e c i a l l y u s e f u l i n o r d e r i n g fragments from l i m i t r i b o n u c l e a s e d i g e s t s . - 16 -The v a r i o u s methods mentioned above f o r sequence a n a l y s i s o f 32 [ P] tRNA o r o l i g o n u c l e o t i d e s have a common weakness. M o d i f i e d n u c l e o t i d e s a r e f r e q u e n t l y l o c a t e d i n such a way t h a t t h e y c a n n o t be i d e n t i f i e d d i r e c t l y 32 as the [ P] n u c l e o t i d e . R a t h e r , t h e i r i d e n t i t i e s must be i n f e r r e d based on changes i n e l e c t r o p h o r e t i c b e h a v i o r on a d d i t i o n o r l o s s o f t h e m o d i f i e d s p e c i e s i n a n e s t e d s e t o f homologous f r a g m e n t s , and on n u c l e a s e s p e c i f i c i t i e s . Thus, the method o f S t a n l e y and V a s s i l e n k o ( 5 2 ) , and r e l a t e d p r o c e d u r e s s i n c e d e v e l o p e d i n Randerath's (53) and Brownlee's (54) l a b o r a t o r i e s , has been an i m p o r t a n t advance. The p r i n c i p l e o f the method i s s i m p l e . I f an i n t a c t , n o n - r a d i o -a c t i v e tRNA m o l e c u l e i s c l e a v e d once i n h o t formamide, the r e s u l t i n g f r a g -ment c o n t a i n i n g the 5'-end o f the m o l e c u l e has a 5'-phosphate and 3 ' - c y c l i c phosphate w h i l e t h e o t h e r has a 5 ' - h y d r o x y l group and 3 ' - t e r m i n a l CCA. The fragment w i t h a 5 ' - h y d r o x y l group i s a s u b s t r a t e f o r p o l y n u c l e o t i d e 32 k i n a s e , and can be r a d i o l a b e l e d w i t h a [ 5 ' - P] p h o s p h o r y l group donated by [Y-32P]ATP. ; I f a l i m i t e d random h y d r o l y s i s o f a p u r i f i e d tRNA i s . p e r f o r m e d under c o n d i t i o n s a l l o w i n g z e r o o r one c l e a v a g e per m o l e c u l e , the s e t o f 32 [ P] o l i g o n u c l e o t i d e s o b t a i n e d by p o l y n u c l e o t i d e k i n a s e l a b e l l i n g i s a 32 n e s t e d s e t . These [ 5 1 - P] o l i g o n u c l e o t i d e s , a l l c o n t a i n i n g t h e 3 ' - t e r m i n a l CCA but v a r y i n g a t the 5'end, a r e s e p a r a t e d a c c o r d i n g t o s i z e by p o l y a c r y l a -3? mide gel e l e c t r o p h o r e s i s . I d e n t i f i c a t i o n o f 5 ' - t e r m i n a l ( P - l a b e l l e d ) n u c l e o t i d e s from t h e o r d e r e d s e t o f o l i g o n u c l e o t i d e s a l l o w s the n u c l e o t i d e sequence, i n c l u d i n g m d i f i n u c l e o t i d e s , t o be " r e a d " d i r e c l y . T h i s p r o c d u r e w i l l i n p r i n c p l  a l l o w i d e n t i f i c a t i o n , as [ 3 2 P ] - n u c l e o t i d , o f a l l i n the tRNA x c e p t h s e a  the 5' and 3 ' - t e r m i n i , and t h s e - 17 -i m m e d i a t e l y 3' t o a 2 ' - 0 - m e t h y l n u c l e o t i d e . F u r t h e r m o r e , s i n c e v e r y l i t t l e m a t e r i a l i s r e q u i r e d (as l i t t l e as 0.5-1 y g ) , t h e method i s a p p l i c a b l e t o tRNAs which can o n l y be o b t a i n e d i n v e r y s m a l l q u a n t i t i e s . The S t a n l e y and V a s s i l e n k o method i s a p o w e r f u l e x p e r i m e n t a l a p p roach t o tRNA sequence a n a l y s i s . The r e l a t e d methods o f Gupta and Randerath (53) and Tanaka, Dyer, and Brownlee (54) a r e f a s t , a c c u r a t e , and r e q u i r e l i t t l e m a t e r i a l . T h e i r w i d e s p r e a d use i n sequence a n a l y s i s o f tRNAs i n the f u t u r e seems a s s u r e d . C o m b i n a t i o n s o f the above p o s t ^ l a b e l l i n g methods f o r sequence a n a l y s i s have been a p p l i e d t o tRNAs from m i t o c h o n d r i a ( 1 8 , 5 5 ) , c h l o r o p l a s t s ( 5 6 ) , n e o p l a s t i c c e l l l i n e s ( 4 1 ) , and t o minor c y t o p l a s m i c tRNAs p r e s e n t i n s m a l l q u a n t i t i e s such as s u p p r e s s o r tRNAs ( 5 7 ) . Thus, s y s t e m a t i c s t u d i e s o f s e t s o f r e l a t e d tRNAs which may d i f f e r w i d e l y i n amount a r e p o s s i b l e . P u r i t y o f m a t e r i a l r a t h e r than q u a n t i t y a v a i l a b l e i s now t h e p r i m a r y e x p e r i -mental o b s t a c l e i n s y s t e m a t i c s t u d i e s o f tRNA seq u e n c e s . C. T r a n s f e r RNA genes T r a n s f e r RNA genes a r e an a t t r a c t i v e model system f o r s t u d i e s o f gene e x p r e s s i o n . T r a n s f e r RNAs a r e i n v o l v e d i n numerous c e l l u l a r p r o -c e s s e s . C o r r e c t r e g u l a t i o n o f tRNA genes i s t h e r e f o r e i m p o r t a n t t o the c e l l . Because the gene p r o d u c t i s s m a l l , s t a b l e , and r e a d i l y c h a r a c t e r i z e d i n v e r y s m a l l amounts, the e x p r e s s i o n o f t h e s e genes can be s t u d i e d r e l a t i v e l y e a s i l y a t the m o l e c u l a r l e v e l . Mutant tRNA genes f o r i n f o r m a t i o n a l sup-p r e s s o r s have been i d e n t i f i e d i n some o r g a n i s m s . S u p p r e s s o r - c a r r y i n g s t r a i n s can be q u i t e v a l u a b l e i n s t u d i e s o f c e l l u l a r p h y s i o l o g y . - 18 -Numerous s t u d i e s on s t r u c t u r e and o r g a n i z a t i o n o f tRNA genes have been r e p o r t e d i n the l a s t few y e a r s . Some o f t h e s e s t u d i e s used g e n e t i c , e l e c t r o n m i c r o s c o p i c , and RNA-DNA h y b r i d i z a t i o n t e c h n i q u e s . Q u i t e r e c e n t l y , advances i n t h i s f i e l d have been a i d e d t r e m e n d o u s l y by the b u r g e o n i n g r e -combinant DNA t e c h n o l o g y . B a c t e r i o p h a g e c a r r i e s genes f o r e i g h t tRNAs. These genes a r e l o c a t e d i n two c l u s t e r s w i t h i n a s i n g l e t r a n s c r i p t i o n u n i t . T^ tRNA p r e -c u r s o r s have been e x t e n s i v e l y used t o s t u d y tRNA b i o s y n t h e s i s ( 5 8 , 5 9 ) . In E . c o l i t h e r e a r e a p p r o x i m a t e l y 60 tRNA genes ( 5 8 ) . Most o f t h e s e genes a r e l o c a t e d i n c l u s t e r s a t s e v e r a l l o c a t i o n s on t h e chromosome, though genes f o r s e v e r a l tRNAs a r e found i n the s p a c e r r e g i o n between 16S and 23S rRNA genes and a r e c o - t r a n s c r i b e d w i t h t h e rRNAs (6 0 , 6 1 ) . P r o b a b l y t h e b e s t - s t u d i e d tRNA genes i n E. c o l i a r e t h o s e f o r t R N A T y r . T h e r e a r e t h r e e genes c o d i n g f o r two n e a r l y i d e n t i c a l t R N A p ^ d i f f e r i n g o n l y i n the v a r i a b l e l o o p . Two i d e n t i c a l genes f o r t R N A j y r a r e l o c a t e d a t a d i f f e r e n t * X V K * s i t e from t h e s i n g l e gene f o r tRNAg ( 6 2 ) . Sequence d e t e r m i n a t i o n o f the tRNA-| p r e c u r s o r by Altman and Smith (63) l e d t o the s y n t h e s i s o f a sup-Xy x* p r e s s o r tRNA-j gene by Khorana and h i s group ( 6 4 ) . In e u k a r y o t e s , genes f o r a p a r t i c u l a r tRNA a r e g e n e r a l l y r e d u n d a n t , e x i s t i n g i n m u l t i p l e c o p i e s . O r g a n i z a t i o n and e x t e n t o f d u p l i c a t i o n o f tRNA genes v a r i e s c o n s i d e r a b l y among e u k a r y o t i c s p e c i e s . Y e a s t c o n t a i n about 320-440 tRNA gene c o p i e s . T y r o s i n e and s e r i n e tRNA genes have been w i d e l y s t u d i e d i n the y e a s t S. c e r e v i s i a e s i n c e t h e y can be c o n v e r t e d t o nonsense s u p p r e s s o r s . T h e r e a r e e i g h t g e n e t i c a l l y u n l i n k e d t R N A T y r genes w i t h i d e n t i c a l tRNA c o d i n g sequences (65 and r e f s . - 19 -. t h e r e i n ) . These have been i s o l a t e d i n r e c o m b i n a n t phage ( 6 6 ) . The S. S e r c e r e v i s i a e h a p l o i d genome c o n t a i n s a t l e a s t e l e v e n genes f o r tRNAr, ; however, o n l y a s i n g l e gene f o r t R N A ^ g i s p r e s e n t ( 6 5 , 6 7 ) . The o r g a n i z a -t i o n o f tRNA genes i s n o t r e a l l y known. I t i s c l e a r , however, t h a t t h e r e i s c o n s i d e r a b l e v a r i a t i o n i n the number o f genes f o r d i f f e r e n t i s o a c c e p t o r tRNAs i n y e a s t . A d i f f e r e n t o r g a n i z a t i o n o f tRNA genes i s found i n t h e clawed t o a d Xenopus l a e v i s , which c o n t a i n s about 8000 gene c o p i e s . These a r e e s t i m a t e d by h y b r i d i z a t i o n k i n e t i c s t o c o n s i s t o f 43 tRNA sequences each r e i t e r a t e d about 200 t i m e s . T h e r e i s e x t e n s i v e c l u s t e r i n g o f genes. Most o f the tRNA genes a r e grouped t o g e t h e r w i t h s p a c e r DNA as tandem r e p e a t u n i t s e x t e n d i n g up t o 10 base p a i r s o r more ( 6 8 , 6 9 ) . R e s t r i c t i o n mapping and DNA sequence a n a l y s i s o f - a c l o n e d 3.18 kb r e p e a t u n i t r e v e a l s t h e p r e s e n c e o f e i g h t genes c o d i n g f o r tRNAs a c c e p t i n g p h e n y l a l a n i n e , t y r o s i n e , m e t h i o n i n e ( i n i t i a t o r tRNA; two c o p i e s ) , a s p a r a g i n e , a l a n i n e , l e u c i n e , and l y s i n e ( 7 0 , 7 1 ) . O n l y 70 base p a i r s s e p a r a t e the t R N A T y r and t R N A P h e genes ( 7 1 ) . T h e r e i s no e v i d e n c e , however, f o r c o - t r a n s c r i p t i o n o f more than one tRNA gene as i s seen w i t h b a c t e r i o p h a g e T^. The human genome c o n t a i n s o v e r 1000 tRNA genes, about 10-20 c o p i e s each o f r o u g h l y 60 d i f f e r e n t genes ( 7 2 ) . C o n s i s t e n t w i t h t h i s , Santos and Met Z a s l o f f (73) f i n d e v i d e n c e f o r about 12 tRNA.. genes s c a t t e r e d on the human genome i n S o u t h e r n h y b r i d i z a t i o n e x p e r i m e n t s . These workers sequenced Met two tRNA^ genes i s o l a t e d i n r e c o m b i n a n t phage. I n t e r e s t i n g l y , one o f the two genes c o n t a i n s t h e sequence GATC_3, c o r r e s p o n d i n g t o t h e sequence Met GAUCG found i n the TXJJC arm o f a l l v e r t e b r a t e tRNA^ sequences examined. - 20 -The o t h e r gene c o n t a i n s t h e sequence GATCT; however, no c y t o p l a s m i c tRNA o f any s o r t has been found w i t h a n u c l e o t i d e o t h e r than G o r A i n t h i s p o s i t i o n . The s i g n i f i c a n c e o f t h i s o b s e r v a t i o n i s not known. M i t o c h o n d r i a l and c h l o r o p l a s t chromosomes encode o r g a n e l l a r s e t s o f tRNA^s d i s t i n c t from t h o s e i n the c e l l c y t o p l a s m . The s t r u c t u r e s o f m i t o c h o n d r i a l tRNAs, based on RNA sequences o r i n f e r r e d from DNA s e q u e n c e s , a r e q u i t e d i f f e r e n t from t h o s e o f c y t o p l a s m i c tRNAs i n s e v e r a l r e s p e c t s . The A+T r i c h n e s s o f the m i t o c h o n d r i a l genome ext e n d s t o tRNA genes, i n c o n t r a s t to G+C r i c h c y t o p l a s m i c tRNA genes. Some m i t o c h o n d r i a l tRNAs l a c k s t a n d a r d f e a t u r e s o f c y t o p l a s m i c tRNAs, such as the GG i n the D l o o p ; o r have l o o p s o f u n u s u a l l y s m a l l s i z e . A t r u n c a t e d m i t o c h o n d r i a l s e r i n e tRNA and i t s gene l a c k t h e D arm a l t o g e t h e r ( 7 4 , 7 5 ) . Sequence a n a l y s e s o f m i t o c h o n d r i a l DNA, tRNAs, and p r o t e i n s d e m o n s t r a t e t h a t d i f f e r e n t g e n e t i c codes a r e used i n c y t o p l a s m and m i t o c h o n d r i a (76,77,18). The mammalian m i t o c h o n d r i a l genome i s v e r y compact ( 7 8 ) . T r a n s f e r RNA genes a p p e a r t o be c o - t r a n s c r i b e d w i t h rRNA and p r o t e i n s t r u c t u r a l genes. They may f u n c t i o n as s i g n a l s f o r p r o c e s s i n g the s i n g l e l a r g e p o l y c i s t r o n i c t r a n s c r i p t from t h e c i r c u l a r genome i n t o mRNA, rRNA, and tRNA ( 7 9 ) . A major r e s u l t from the.sequence a n a l y s i s o f e u k a r y o t i c DNA has been the f i n d i n g t h a t DNA and RNA sequences a r e not always c o - l i n e a r . By t h e p r o c e s s o f " s p l i c i n g " , i n t e r n a l RNA sequences can be removed from t r a n s c r i p t s . In a d d i t i o n t o p r o t e i n s t r u c t u r a l genes ( e . g . 80,81) and rRNA genes ( 8 2 , 8 3 ) , tRNA genes from s e v e r a l e u k a r y o t e s c o n t a i n i n t e r v e n i n g sequences l o c a t e d i n the a n t i c o d o n l o o p . Such s p l i t tRNA genes have been found i n the genomic DNA o f y e a s t (84-86,67), D r o s o p h i l a m e l a n o g a s t e r - 21 -( 8 7 ) , c h i c k e n ( 8 8 ) , Xenopus l a e v i s ( 7 1 ) , and Zea mays ( c o r n ) c h l o r o p l a s t s ( 8 9 ) . In most c a s e s , the i n t e r v e n i n g sequences a r e s m a l l ( a b o u t 8-40 n u c l e o t i d e s ) . The p r e s u m p t i v e s p l i t tRNA genes i d e n t i f i e d by sequence a n a l y s i s o f Zea mays c h l o r o p l a s t DNA a r e p a r t i c u l a r l y u n u s u a l . The i n t e r -v e n i n g sequences i n t h e s e tRNA genes a r e v e r y l a r g e ( o v e r 800 base p a i r s ) . In a d d i t i o n , c h l o r o p l a s t tRNA genes a r e unusual because t h e y a r e l o c a t e d i n s p a c e r sequences w i t h i n a r i b o s o m a l RNA t r a n s c r i p t i o n u n i t . T h i s o r g a n i z a t i o n i s s i m i l a r t o t h a t o f rRNA operons o f E. c o l i ( 6 1 , 9 0 ) . D. T r a n s f e r RNA and tRNA genes i n D r o s o p h i l a m e l a n o g a s t e r D.1. T r a n s f e r RNAs i n D r o s o p h i l a D . l . a . T r a n s f e r RNA p o p u l a t i o n I s o a c c e p t o r tRNA p o p u l a t i o n s from d i f f e r e n t d e v e l o p m e n t a l s t a g e s o f D r o s o p h i l a m e l a n o g a s t e r were c h a r a c t e r i z e d by RPC-5 chromatography o f aminoacyl-tRNA ( 9 1 ) . The s e n s i t i v e r e v e r s e d phase c h r o m a t o g r a p h i c system a l l o w e d White e t a l _ . ^ . t o i d e n t i f y 63 major and 36 minor i s o a c c e p t i n g tRNAs. Of t h e s e 99 tRNA peaks, a p p r o x i m a t e l y o n e - t h i r d undergo some q u a n t i t a t i v e change, r e l a t i v e t o o t h e r i s o a c c e p t o r s , d u r i n g development from f i r s t T h r i n s t a r l a r v a e t o a d u l t s . Changes i n peak s i z e s f o r major s p e c i e s tRNA^ , Met Met tRNA2 o r tRNA^ were o b s e r v e d . R e l a t i v e l y few changes i n v o l v e a p p e a r a n c e o r l o s s o f a peak. Those t h a t do c o n c e r n a minor peak. The e l u t i o n p r o f i l e s o f a s p a r a g i n y l , a s p a r t y l , h i s t i d y l , and t y r o s y l - t R N A s from d i f f e r e n t d e v e l o p m e n t a l s t a g e s were examined i n d e t a i l ( 9 2 ) . The r e l a t i v e p r o p o r t i o n s o f c e r t a i n c h r o m a t o g r a p h i c a l l y d i s t i n c t - 2 2 -forms o f t h e s e tRNAs change i n s i m i l a r f a s h i o n d u r i n g the l i f e c y c l e o f w i l d - t y p e f l i e s . The 6 and y c h r o m a t o g r a p h i c forms were shown t o d i f f e r o n l y by the p r e s e n c e o r a b s e n c e , r e s p e c t i v e l y , o f a Q base d e r i v a t i v e . The Q base presumably o c c u p i e s , the u s u a l "wobble" p o s i t i o n o f the a n t i c o d o n , s i n c e t R N A ^ s c o n t a i n s G t h e r e ( 9 3 ) . Wosnick and White (94) found t h a t t h e r e l a t i v e amounts o f 6 and y forms o f t R N A ^ y r change markedly dependent on growth c o n d i t i o n s . The t o t a l amount o f t R N A ^ y r i n a d u l t f l i e s i s c o n s t a n t , however. Changes i n t h e r e l a t i v e amounts o f 6 and y forms a r e a p p a r e n t l y a consequence o f g e n e r a l m e t a b o l i s m r a t h e r than o f genotype. T h i s l a s t p o i n t i s r e l e v a n t t o r e p o r t s by J a c o b s e n (95) and T w a r d z i c e t aJL (96) t h a t t R N A J y r i n h i b i t s t r y p t o p h a n p y r r o l a s e , an i n h i b i t i o n r e l i e v e d i n f l i e s c a r r y i n g the s u p p r e s s o r o f s a b l e m u t a t i o n . T h e i r r e s u l t s have not p r o v e d t o be r e p r o d u c i b l e , and a p p a r e n t t R N A ^ y r i n v o l v e m e n t i n s u p p r e s s i o n o f v e r m i l i o n eye c o l o r m u t a t i o n s i s p r o b a b l y a r t i f a c t u a l ( 9 4 , 9 7 ) . The v a l i n e and s e r i n e tRNAs a r e the most e x t e n s i v e l y c h a r a c -t e r i z e d i s o a c c e p t o r f a m i l i e s from D r o s o p h i l a . The f o u r v a l i n e codons GUN a r e r e a d by t h r e e major s p e c i e s , tRNAg* 1 (GUA), t R N A ^ 1 (GUG), and tRNA^ a l (GUA, GUC, GUU). The c o d i n g s p e c i f i c i t y o f t R N A ^ a l i s a consequence o f i n o s i n e , shown to be p r e s e n t by m o d i f i e d n u c l e o t i d e a n a l y s i s o f the v a l i n e tRNAs ( 9 8 ) . The e x t e n t o f s i m i l a r i t y o f the t h r e e tRNAs was a l s o examined by " f i n g e r p r i n t " a n a l y s i s o f c omplete r i b o n u c l e a s e d i g e s t s ( 9 9 ) . Q u i t e r e c e n t l y , t h e n u c l e o t i d e sequences o f t R N A ^ 1 (100) and tRNA^ a 1 (101) have been d e t e r m i n e d . The s i x s e r i n e codons AGC, AGU, and UCN a r e r e a d by major s p e c i e s t R N A ^ and t R N A g e r (AGC, AGU), t R N A ^ e r (UCG), t R N A ^ e r (UCU, and t o a - 23 -l e s s e r e x t e n t UCA and UCC), and t R N A g e r ( s p e c i f i c i t y has not been d e t e r -S p r S p r mined) ( 1 0 2 ) . M o d i f i e d n u c l e o t i d e a n a l y s i s showed t h a t tRNA^ and tRNAg (A6C,AGU) a r e s i m i l a r , and d i s t i n c t from t R N A ^ e r and t R N A ^ e r (UCN). The n u c l e o -t i d e c o n t e n t o f t R N A g e r i s v e r y s i m i l a r t o t h a t o f t R N A ^ e r and t R N A ^ e r , suggest-i n g t h a t i t a l s o reads UCN c o d o n ( s ) . S e r i n e tRNAs r e s p o n d i n g t o UCN codons i n t h e ribosome b i n d i n g a s s a y c o n t a i n the c y t o k i n i n i s o p e n t e n y l a d e n o s i n e whereas t h o s e r e s p o n d i n g t o AGC and AGU do n o t , c o n s i s t e n t . w i t h s e r i n e tRNAs i n o t h e r o r g a n i s m s ( 1 0 2 ) . A d e t a i l e d d i s c u s s i o n o f s e r i n e tRNAs 'is fou n d i n C h a p t e r I I I below. D.l.b.- N u c l e o t i d e sequences o f D r o s o p h i l a tRNAs The n u c l e o t i d e sequences o f a number o f c y t o p l a s m i c tRNAs from D r o s o p h i l a m e l a n o g a s t e r have been d e t e r m i n e d . These i n c l u d e t R N A ^ ( 1 0 0 ) , tRNAj| a l ( 1 0 1 ) , t R N A ^ l u ( 1 0 3 ) , t R N A ^ S ( 9 3 ) , t R N A ^ ( 1 0 4 ) , t R N A M e t ( 1 0 5 ) , and t R N A P h e ( 1 0 6 ) . These tRNAs a r e g e n e r a l l y q u i t e s i m i l a r t o the e q u i v a l e n t v e r t e b r a t e tRNAs, i n d i c a t i n g s t r o n g c o n s e r v a t i o n o f sequences o v e r e v o l u t i o n a r y time p e r i o d s . They a r e unremarkable o t h e r w i s e , f i t t i n g v e r y w e l l w i t h t h e g e n e r a l i z e d tRNA s t r u c t u r e o f R i c h and RajBhandary ( 8 ) . D.2. O r g a n i z a t i o n and s t r u c t u r e o f tRNA genes i n D r o s o p h i l a D.2.a. H y b r i d i z a t i o n o f tRNAs and genes t o p o l y t e n e chromosomes i n s i t u H y b r i d i z a t i o n t o p o l y t e n e chromosomes i n s i t u i s a powerful method f o r l o c a l i z i n g t he genes f o r p u r i f i e d tRNAs i n D r o s o p h i l a . S t a i n e d p o l y t e n e chromosomes from s a l i v a r y g l a n d s show a r e p r o d u c i b l e b a n d i n g p a t t e r n t h a t i s r e a d i l y v i s i b l e under t h e l i g h t m i c r o s c o p e . Each o f t h e r o u g h l y 500 - 24 -genome c o p i e s i n the p o l y t e n e chromosomes c o n t a i n s about 600 genes f o r t h e 60 tRNA s p e c i e s ( 1 0 7 ) . P u r i f i e d 3 H o r 1 2 5 I - l a b e l l e d tRNA can be h y b r i d i z e d t o t h e s e chromosomes, and tRNA genes l o c a t e d by the a p p e a r a n c e o f s i l v e r g r a i n s o v e r s p e c i f i c chromosomal bands a f t e r a u t o r a d i o g r a p h i c e x p o s u r e . The f i r s t gene l o c a l i z a t i o n o f t h i s s o r t was r e p o r t e d by G r i g l i a t t i e t a l . ( 1 0 8 ) . However, d e s p i t e e x t e n s i v e p r e c a u t i o n s , even the h i g h l y p u r i f i e d t R N A ^ y s used i n t h o s e e x p e r i m e n t s p r o v e d t o be s u f f i c i e n t l y c o n t a m i n a t e d t h a t the l o c a l i z a t i o n was i n c o r r e c t ( 1 0 9 ) . Through improvements i n p u r i f i c a -t i o n and h y b r i d i z a t i o n c o n d i t i o n s , t h e method has been r e f i n e d t o an e x t e n t t h a t has a l l o w e d l o c a l i z a t i o n o f genes f o r o v e r twenty tRNAs (109,110,111, 112). T h i s number i s o v e r o n e - t h i r d o f the t o t a l major tRNA s p e c i e s i n D r o s o p h i l a ( 9 1 ) . Two major c o n c l u s i o n s were r e a c h e d based on i n s i t u h y b r i d i z a t i o n o f p u r i f i e d tRNAs. F i r s t , tRNA genes a r e s p r e a d about t h e chromosomes. S i t e s o f h y b r i d i z a t i o n t h a t presumably c o n t a i n tRNA genes have been found on e v e r y chromosomal arm e x c e p t the v e r y s m a l l chromosome 4 ( 1 0 9 ) . Second, tRNA genes seem t o be a r r a n g e d as d i s p e r s e d c l u s t e r s . I n d i v i d u a l tRNAs g e n e r a l l y h y b r i d i z e t o more than one s i t e on p o l y t e n e chromosomes. These s i t e s may c o n t a i n more than one gene. F o r example, t R N A ^ h y b r i d i z e s t o r e g i o n s 84D, 92B, and 90BC on the r i g h t arm o f chromosome 3 (3R). Based on the numbers o f g r a i n s o v e r t h e s e s i t e s , i t was c o n c l u d e d t h a t t h e y c o n t a i n e d 5, 4, and 1 genes ( o r m u l t i p l e s t h e r e o f ) , r e s p e c t i v e l y ( 1 1 3 ) . In s i t u h y b r i d i z a t i o n can be p e r f o r m e d u s i n g r a d i o l a b e l e d r e c o m b i n a n t p l a s m i d s c o n t a i n i n g D r o s o p h i l a DNA. T h r e e p l a s m i d s s e l e c t e d by h y b r i d i z a -t i o n w i t h ^ I - t R N A ^ each h y b r i d i z e d to s i n g l e chromosomal s i t e s . These - 25 -were 84D and 90BC, t h e same as s i t e s h y b r i d i z i n g p u r i f i e d tRNA. Two p l a s m i d s h y b r i d i z e d to the minor s i t e a t 90BC, showing t h a t g r a i n s a t t h i s s i t e i n tRNA e x p e r i m e n t s were n o t a r t i f a c t u a l ( 1 1 4 ) . S i m i l a r r e s u l t s were o b t a i n e d on h y b r i d i z a t i o n o f tRNAJ[ a 1, tRNA_j e r, t R N A ^ e r , and r e c o m b i n a n t p l a s m i d s s e l e c t e d w i t h t h o s e tRNAs, t o p o l y t e n e chromosomes i n s i t u (109, 114). D.2.b. A n a l y s i s o f r e c o m b i n a n t p l a s m i d s c a r r y i n g D r o s o p h i l a tRNA genes D . 2 . b . i . Genes i n t h e 42A r e g i o n : t h e s t r u c t u r e o f a tRNA gene c l u s t e r A major c l u s t e r o f tRNA genes i d e n t i f i e d by h y b r i d i z a t i o n o f tRNAs t o p o l y t e n e chromosomes i n s i t u i s i n the 42A r e g i o n on chromosome 2R (109,112). The tremendous advances i n r e c o m b i n a n t DNA t e c h n o l o g y o v e r t h e p a s t s e v e r a l y e a r s have made p o s s i b l e the i s o l a t i o n and c h a r a c t e r i z a t i o n , even to t h e n u c l e o t i d e l e v e l , o f l a r g e segments o f DNA from t h i s chromo-somal r e g i o n . The f i r s t r e c o m b i n a n t p l a s m i d i s o l a t e d c o n t a i n i n g D r o s o p h i l a tRNA genes, pCIT 12, d e r i v e d from t h e 42A r e g i o n ( 1 1 5 ) . DNA sequence a n a l y s i s o f a l l tRNA-coding segments o f t h i s p l a s m i d was c a r r i e d o u t by S o i l and h i s co-workers ( 1 1 6 ) . T h i s group found e i g h t tRNA genes i n the 9.3 k i l o b a s e p a i r (kb) i n s e r t o f pCIT 12: t h r e e f o r t R N A A s n , t h r e e .for t R N A ^ , one f o r t R N A ^ , and one f o r t R N A ^ 6 . T h i s a n a l y s i s was ex t e n d e d by Yen and Da v i d s o n ( 1 1 7 ) , who i s o l a t e d o v e r l a p p i n g r e c o m b i n a n t phage s p a n n i n g 94 kb o f sequence d e r i v e d from t h e 42A r e g i o n . By r e s t r i c t i o n enzyme mapping t e c h n i q u e s and some DNA sequence a n a l y s i s , t h e y showed t h a t a r e g i o n o f 46 kb ( i n c l u d i n g pCIT 12 sequences) c o n t a i n e d 18 tRNA genes: e i g h t f o r t R N A A s n , f o u r f o r t R N A ^ 9 , f i v e f o r t R N A ^ , and a s i n g l e t R N A I 1 e gene. These genes a r e i r r e g u l a r l y spaced and a r e not a l l t r a n s c r i b e d from - 26 -the same DNA s t r a n d . In a l l c a s e s where DNA sequence was d e t e r m i n e d , r e d u n d a n t genes a t 42A h y b r i d i z i n g a p a r t i c u l a r tRNA have i d e n t i c a l s e quences. D . 2 . b . i i . O t h e r tRNA gene c l u s t e r s T r a n s f e r RNA genes from gene c l u s t e r s l o c a t e d a t o t h e r chromosomal s i t e s t h a n 42A have a l s o been a n a l y z e d a f t e r i s o l a t i o n i n r e c o m b i n a n t v e c t o r s . These i n c l u d e genes f o r t R N A ^ ( 1 1 8 ) , t R N A G l u ( 1 1 9 ) , t R N A L e u and tRNA 1 1 ^ ( 8 7 ) , t R N A G 1 y ( 1 2 0 ) , t R N A ^ e t ( 1 2 1 ) , and tRNA^ a 1 ( 1 2 2 ) . The ; o r g a n i z a t i o n o f t h e s e c l u s t e r s i s somewhat l i k e t h a t seen a t r e g i o n 42A. M u l t i p l e tRNA gene c o p i e s a r e p r e s e n t , some c l o s e t o g e t h e r . Two c l u s t e r s G1 u c o n t a i n i n g f i v e tRNA genes a r e p r e s e n t w i t h i n 4 kb o f sequence d e r i v i n g from chromosomal s i t e 62A ( 1 1 9 ) . Robinson and D a v i d s o n found seven genes f o r two tRNAs i n a 2.5-kb sequence f r o m r e g i o n 50AB ( 8 7 ) . Four t R N A ^ genes a r e p r e s e n t i n a 3 kb segment o f DNA from r e g i o n 42E ( 1 1 8 ) . Thus, t R N A ^ 5 genes from r e g i o n s 42A and 42E, the two major s i t e s o f t R N A ^ h y b r i d i z a t i o n i n s i t u ( 1 0 9 ) , have been i s o l a t e d . On t h e o t h e r hand, tRNA genes i n a c l u s t e r may be more w i d e l y Met s p r e a d . T h r e e tRNA^ genes from r e g i o n 61D a r e s e p a r a t e d on t h e genome by a t l e a s t 15 kb ( 1 2 1 ) . Thus, the o r g a n i z a t i o n o f tRNA gene c l u s t e r s i s a p p a r e n t l y q u i t e f l e x i b l e . D.2.c. A r e r e d u n d a n t tRNA genes i d e n t i c a l ? As d e s c r i b e d above, t h e DNA sequences o f a number o f tRNA genes from D. m e l a n o g a s t e r have been d e t e r m i n e d . In most c a s e s where the DNA sequences a r e known, t h e r e d u n d a n t tRNA genes a r e i d e n t i c a l . Most o f - 27 -the r e d u n d a n t genes f o r t R N A A s n , t R N A ^ , and t R N A A r g from r e g i o n 42A have been sequenced and a r e i d e n t i c a l (116,117). A t R N A ^ y S gene i s o l a t e d from 42E i n t h e genome i s i d e n t i c a l t o genes from the 42A r e g i o n (123,118). l i e F i v e genes f o r tRNA from r e g i o n 50AB a r e a l l i d e n t i c a l t o t h e s i n g l e tRNA 1 1 e gene from 42A i n pCIT 12 (87,116). Two t R N A L e u genes from 50AB ar e t h e o n l y " s p l i t " tRNA genes i d e n t i f i e d from D. m e l a n o g a s t e r t o d a t e ( 8 7 ) . These genes encode t h e same mature t R N A L e u , though t h e i n t e r v e n i n g sequences d i f f e r . However, i t i s becoming c l e a r t h a t n o t a l l genes h y b r i d i z i n g a p a r t i c u l a r tRNA have i d e n t i c a l s e quences. F i v e t R N A ^ u genes were found on p l a s m i d s d e r i v e d from t h e 62A r e g i o n . F our o f t h e genes a r e i d e n t i c a l ; t h e f i f t h d i f f e r s by a s i n g l e C t o T t r a n s i t i o n a t the f o u r t h n u c l e o t i d e o f t h e mature tRNA sequence ( 1 1 9 ) . T h i s r e p r e s e n t s one o f two i n s t a n c e s t h u s f a r where n o n - i d e n t i c a l genes f o r a tRNA o r i g i n a t i n g a t the same chromo-Met soma! s i t e have been r e p o r t e d . Genes f o r tRNA^ w i t h sequences m a t c h i n g and d i f f e r i n g from the known tRNA sequence a r e p r e s e n t a t r e g i o n 61D ( 1 2 1 ) . N o n - i d e n t i c a l sequences i s o l a t e d by h y b r i d i z a t i o n w i t h tRNA_^ a l (122) and t R N A ^ y s (124) have been found r e c e n t l y . These d i f f e r i n g genes d e r i v e from d i s t i n c t chromosomal s i t e s . Thus, w h i l e most sequences h y b r i d i z i n g w i t h a s i n g l e tRNA s p e c i e s may be i d e n t i c a l , n o t a l l a r e . The p o s s i b l e s i g n i f i c a n c e o f such n o n - i d e n t i t y o f tRNA genes i s d i s c u s s e d i n d e t a i l i n C h a p t e r IV. D.3. ..E x p r e s s i o n o f D r o s o p h i l a tRNA genes Val D.3.a. E x p r e s s i o n o f tRNA genes i n mutant f l i e s Val Genes f o r tRNA.^ a r e found i n two major c l u s t e r s on D. m e l a n o g a s t e r p o l y t e n e chromosomes ( 1 0 9 ) . Dunn e t al_. examined e x p r e s s i o n o f genes f o r - 28 -t R N A ^ 1 i n mutants . 1 c a r r y i n g d u p l i c a t i o n s o r d e f i c i e n c i e s o f DNA from one o f the two s i t e s ( 1 1 3 ) . F l i e s w i t h a d u p l i c a t i o n o f the 84D r e g i o n had i n c r e a s e d amounts o f tRNA^ a 1 and o f t R N A V a l . The i n c r e a s e i n t R N A ^ 1 , about 30%, was p r o p o r t i o n a l t o t h e i n c r e a s e i n gene number, based on a v a l u e o f n i n e genes t o t a l , f i v e a t 84D, i n the w i l d t y p e h a p l o i d genome. A c o r r e s p o n d i n g p r o p o r t i o n a l d e c r e a s e i n the amount o f t R N A ^ was seen i n f l i e s d e f i c i e n t f o r the 84D r e g i o n . However, the t o t a l amount o f tRNA^ a 1 p r e s e n t was the same as f o r w i l d t y p e f l i e s . T h i s s u g g e s t s t h a t a homeo-s t a t i c mechanism f o r m a i n t a i n i n g the t o t a l amount o f t R NA^ a 1 e x i s t s . D.3.b. T r a n s c r i p t i o n o f D r o s o p h i l a tRNA genes The e x i s t e n c e o f i n t e r n a l , s p l i t promoters f o r e u k a r y o t i c , RNA p o lymerase I l l - t r a n s c r i b e d 5 S r R N A and tRNA genes has.been r e p o r t e d r e c e n t l y (125,126,70). T h i s c o n c l u s i o n i s based on s t u d i e s o f t r a n s c r i p t i o n o f s y s t e m a t i c a l l y a l t e r e d r e c o m b i n a n t DNA c o n t a i n i n g genes from Xenopus l a e v i s , i n a homologous i n v i t r o t r a n s c r i p t i o n system d e r i v e d from e x t r a c t s o f Xenopus germin a l v e s i c l e s . S p e c i f i c t r a n s c r i p t i o n can a l s o be a c h i e v e d " i n v i v o " by m i c r o i n j e c t i n g r e c o m b i n a n t p l a s m i d s i n t o n u c l e i o f i n t a c t Xenopus o o c y t e s . The Xenopus i n v i v o and i n v i t r o systems have been used to s t u d y t r a n -s c r i p t i o n o f tRNA genejj^fxgm h e t e r o l o g o u s s o u r c e s i s o l a t e d i n r e c o m b i n a n t p l a s m i d s . The p r i m a r y t r a n s c r i p t o f a D r o s o p h i l a tRNA^ 1^ gene, i n c l u d i n g t h e 5 ' - t e r m i n a l ^ n u c l e o t i d e , was t h u s ' o b t a i n e d and c h a r a c t e r i z e d ( 1 2 7 ) . E x p e r i m e n t s u s i n g Xenopus -germinaV rv,esicle e x t r a c t s i n d i c a t e d - t h a t t h e mature tRNA c o d i n g sequence i s s u f f i c i e n t f o r a c c u r a t e t r a n s c r i p t i o n i n i t i a t i o n on - 29 -D r o s o p h i l a t R N A J ^ 5 genes ( 1 2 3 ) . In the same e x p e r i m e n t s , DeFranco, Schmidt, and S o i l showed t h a t 5' g e n e - f l a n k i n g sequences modulated t h e l e v e l o f s p e c i f i c gene t r a n s c r i p t i o n . I t a p p e a r s t h a t c o n c l u s i o n s based on t r a n s c r i p t i o n o f tRNA genes from h e t e r o l o g o u s s o u r c e s i n Xenopus systems a r e v a l i d and g e n e r a l l y L a p p l i c a b l e . Y e a s t t R N A ^ y r genes c o n t a i n i n g i n t e r v e n i n g sequences a r e t r a n s c r i b e d , t h e t r a n s c r i p t s p r o c e s s e d and p a r t i a l l y m o d i f i e d q u i t e a c c u r -a t e l y i n Xenopus o o c y t e s ( 1 2 8 ) . T r a n s c r i p t i o n o f D. m e l a n o g a s t e r and B. mori tRNA genes i n homologous sytems i s the same as i n Xenopus g e r m i n a l v e s i c l e e x t r a c t s (129,130). Two major c o n c l u s i o n s a r e s u g g e s t e d by s t u d i e s on t r a n s c r i p t i o n o f tRNA genes from e u k a r y o t e s , i n c l u d i n g D r o s o p h i l a , up t o t h e p r e s e n t t i m e . F i r s t , a c c u r a t e i n i t i a t i o n o f tRNA gene t r a n s c r i p t i o n depends on an i n t e r n a l , s p l i t promoter (123,70). Second, the l e v e l o f t r a n s c r i p t i o n i s modulated by f l a n k i n g sequences 5' t o the gene (123,130). A p r i m a r y purpose f o r t h e r e c e n t i n t e n s i v e DNA sequence a n a l y s i s o f c l o n e d tRNA genes i s t o have w e l l - c h a r a c t e r i z e d t e m p l a t e s f o r s t u d i e s o f gene e x p r e s s i o n . The DNA sequences o f many tRNA genes a r e now known. Thus, we can .expect t o see many s t u d i e s r e l a t i n g t o the c o n t r o l o f tRNA gene t r a n s c r i p t i o n i n the n e x t s e v e r a l y e a r s . - 30 -Cha p t e r II MATERIALS AND METHODS A. RNA Sequence A n a l y s i s Materials: C h e m i c a l s used were r e a g e n t grade commercial s t o c k s . Urea ( u l t r a - p u r e ) f o r p a r t i a l e n z y m a t i c h y d r o l y s e s o f RNA and E : c o l i tRNA were from Schwarz-Mann. N u c l e o s i d e 5 1 - p h o s p h a t e s f o r use as c h r o m a t o g r a p h i c s t a n d a r d s and ATP were from P-L B i o c h e m i c a l s . C y t i d i n e ( 2 1 + 3 1 ) - p h o s p h a t e was from C a i b i o c h e m . T h i n l a y e r chromatography p l a t e s (Macherey-Nagel CEL 300 DEAE, Macherey-Nagel CEL 300 .PEI, and c e l l u l o s e ) were p u r c h a s e d from Brinkmann. Cel 1 u l o s e a c e t a t e membrane s t r i p s (3cm x 55 cm) were from 32 S c h l e i c h e r and S c h u e l l . C a r r i e r - f r e e Hg P0^ was o b t a i n e d from New En g l a n d N u c l e a r o r from Amersham. Sodium 3 - p h o s p h o g l y c e r a t e (Grade I) was from 32 Sigma Chemical Co. [ y - P] ATP was e i t h e r p u r c h a s e d from Amersham R a d i o -c h e m i c a l s ( s p e c i f i c a c t i v i t y a t l e a s t 2000 Ci/mmole) o r p r e p a r e d by the method o f Glynn and C h a p p e l l (131) as d e s c r i b e d by Maxam and G i l b e r t (132) to a s p e c i f i c a c t i v i t y o f 1000-1500 Ci/mmole. U n l e s s s t a t e d o t h e r w i s e , most p r o c e d u r e s were c a r r i e d o u t i n 1.5 ml o r 1.9 ml capped, c o n i c a l p o l y -p r o p y l e n e tubes ( B i o - R a d o r E v e r g r e e n ) . Enzymes were o b t a i n e d from t h e f o l l o w i n g s o u r c e s : B o e h r i n g e r -Mannheim ( c a l f i n t e s t i n a l p h o s p h a t a s e ) , C a l b i o c h e m ( r i b o n u c l e a s e s T-|, Tg, A, n u c l e a s e P-j o f P e n i c i l l i u m c i t r i n u m , and h e x o k i n a s e ) , Enzo B i o c h e m i c a l s (RNase Phy I from Physarum p o l y c e p h a l u m ) , New England B i o L a b s (T« - 31 -p o l y n u c l e o t i d e k i n a s e and RNA l i g a s e ( R N a s e - f r e e ) ) , Sigma Chemical Co. ( 3 - p h o s p h o g l y c e r a t e p h o s p h o k i n a s e ) , and W o r t h i n g t o n B i o c h e m i c a l s ( r a b b i t muscle g l y c e r a l d e h y d e 3-phosphate d e h y d r o g e n a s e ) . I n d i v i d u a l tRNA s p e c i e s were p u r i f i e d by Dr. Ian G i l l a m by e s t a b l i s h e d p r o c e d u r e s and p r o v i d e d f o r RNA sequence a n a l y s i s . Methods A.1. N u c l e o t i d e c o n t e n t a n a l y s i s T h i s was performed e s s e n t i a l l y as d e s c r i b e d ( 4 2 ) , w i t h the f o l l o w i n g 32 m o d i f i c a t i o n s . A f t e r k i n a s e - l a b e l 1 i n g and c o n v e r s i o n o f e x c e s s [ y - P] ATP 3? to g l u c o s e - 6 - PO^, the n u c l e a s e P-j r e a c t i o n was c a r r i e d o u t i n t h e same T r i s - b u f f e r e d s o l u t i o n , s i n c e t h e 3 1 - p h o s p h a t a s e a c t i v i t y o f n u c l e a s e P-j i s near i t s maximum i n the pH range 7.5-8.0 ( 1 3 3 ) . To q u a n t i t a t e the n u c l e o t i d e s , s p o t s on the two d i m e n s i o n a l c e l l u l o s e p l a t e s l o c a t e d by a u t o -r a d i o g r a p h y were s c r a p e d from the b a c k i n g , c o l l e c t e d by s u c t i o n i n p i p e t t o r t i p s - p l u g g e d w i t h g l a s s w o o l , e l u t e d w i t h h^O, and Cerenkov cpm d e t e r m i n e d . 32 A.2. S y n t h e s i s o f [ 5 ' - P] c y t i d i n e 5', 3'^-bisphosphate (*pCp) The r e a c t i o n mix (10 u l ) c o n t a i n e d 1.2 mM Cp ( 2 1 + 3 ' ) , 30 mM T r i s H C l (pH 8 . 3 ) , 10 mM M g C l 2 , 10 mM d i t h i o t h r e i t o l , 30-40 uM [ y - P]ATP ( s p e c i f i c a c t i v i t y > 300 Ci/mmole), and 1-2 u n i t s o f T^ p o l y n u c l e o t i d e k i n a s e (100-200 U/ml). The r e a c t i o n (40-60 min. a t 37°) was s t o p p e d by h e a t i n g 32 1 min. a t 100°. S t o r a g e was a t - 2 0 ° . [ y - P] ATP was assumed to be q u a n t i -t a t i v e l y c o n v e r t e d t o *pCp ( s t a r t i n g Cp p r e s e n t i n 30-40 f o l d e x c e s s o v e r - 32 -ATP ) ; t h u s , t h e s p e c i f i c a c t i v i t y o f the *pCp i s the same as t h a t o f i n p u t [y- P] ATP. Excess Cp(2' + 3') does n o t seem to i n h i b i t t h e subs e q u e n t RNA 1 i g a s e - c a t a l y z e d l a b e l l i n g r e a c t i o n . T h e r e f o r e *pCp was p r e p a r e d and used i n the l a b e l l i n g r e a c t i o n w i t h o u t - f u r t h e r p u r i f i c a t i o n . A.3. S y n t h e s i s o f [ 3 ' - 3 2 P ] tRNA by RNA 1 i g a s e - c a t a l y z e d a d d i t i o n o f *pCp T h i s r e a c t i o n was performed as d e s c r i b e d ( 1 3 4 ) . The r e a c t i o n mix (30 u l ) c o n t a i n e d 1-2 ug o f p u r i f i e d tRNA, 50 mM HEPES (pH 8.3), 10 mM M g C l 2 , 3.3 mM d i t h i o t h r e i t o l , 5 yM ATP, 1 y l *pCp mix (from.10 y l t o t a l ; = 1 uM *pCp f i n a l c o n c e n t r a t i o n ) , 10% DMS0, 15% g l y c e r o l , and 1 y l o f RNA l i g a s e . L a b e l l i n g r e a c t i o n s were f o r 16-24 hours a t 4 ° . These were s t o p p e d by a d d i n g an equal volume o f 90% formamide c o n t a i n i n g 0.067% (w/v) x y l e n e , c y a n o l FF (XC) and bromophenol b l u e ( B B ) . [ 3 ' - 3 2 P ] RNA w i t h a *pCp a d d u c t was p u r i f i e d by e l e c t r o p h o r e s i s on t h i n , d e n a t u r i n g p o l y a c r y l a m i d e g e l s ( 1 3 5 ) , l o c a t e d by a u t o r a d i o g r a p h y , and e l u t e d ( 5 2 ) . Based on r a d i o a c t i v i t y r e c o v e r e d from f u l 1 - s i z e d ; tRNA p r o d u c t s , a f t e r e x c i s i o n o f the a p p r o p r i a t e gel s l i c e , i n p u t tRNA was r a d i o l a b e l e d and r e c o v e r e d w i t h 20-30% e f f i c i e n c y . A.4. D e - p h o s p h o r y l a t i o n o f tRNA D e - p h o s p h o r y l a t i o n was c a r r i e d o u t e s s e n t i a l l y as d e s c r i b e d ( 4 2 ) . The r e a c t i o n mix (10 y l ) c o n t a i n e d 2-3 yg o f tRNA, 20 mM T r i s H C l (pH 8.0), 0.2 mM EDTA, and 0.024 u n i t s o f c a l f i n t e s t i n a l p h o s p h a t a s e . R e a c t i o n s were f o r 40-75 min. a t 5 5 ° , f o l l o w e d by phenol e x t r a c t i o n and e t h e r e x t r a c -t i o n as d e s c r i b e d ( 4 2 ) . Samples were then d r i e d i n a d e s s i c a t o r c o n t a i n i n g P 90(- under a s p i r a t o r vacuum. - 33 -A.5. P o l y n u c l e o t i d e k i n a s e - c a t a l y z e d s y n t h e s i s o f [ 5 ' - P]tRNA o r  o l i g o n u c l e o t i d e s T h i s r e a c t i o n was c a r r i e d o u t i n the same tube as d e-phosphory-l a t i o n . The p r o c e d u r e was based on t h a t o f L i l l e h a u g and Kleppe ( 1 3 6 ) . The r e a c t i o n mix (10 u l ) c o n t a i n e d (5'-0H)tRNA o r o l i g o n u c l e o t i d e s ; 60 mM T r i s H C l (pH 8.0), 9 mM M g C l 2 , 10 mM d i t h i o t h r e i t o l , 40-50 uM [ y - 3 2 P ] A T P ( s p e c i f i c a c t i v i t y > 400/mmole), and 1-2 u n i t s p o l y n u c l e o t i d e k i n a s e (100-200 U/ml). The r e a c t i o n s were f o r 30-40 min. a t 3 7 ° , and were s t o p p e d by a d d i n g an equal volume/of formamide/dye mix (13:1:1, f o r m a m i d e : l % XC:1 % BB), h e a t i n g 1 min. a t 1 0 0 ° , and c h i l l i n g on i c e . Samples were s t o r e d a t -20% u n t i l use. A.6 P u r i f i c a t i o n o f [ 5 1 - 2 P ] RNA: 32 [ 5 ' - P]RNAs were p u r i f i e d by p o l y a c r y l a m i d e gel e l e c t r o p h o r e s i s ( 1 3 5 ) , l o c a t e d by a u t o r a d i o g r a p h y , and e l u t e d as d e s c r i b e d (52)-. The l a b e l l i n g r e a c t i o n i s i n e f f i c i e n t , y i e l d i n g about 250,000 Cerenkov cpm/ug i n p u t tRNA i n the f u l l - s i z e d tRNA (< 10% y i e l d ) . The y i e l d f o r o l i g o n u -c l e o t i d e s may be c o n s i d e r a b l y h i g h e r than f o r i n t a c t tRNA, b u t v a r i e s w i t h i n d i v i d u a l s u b s t r a t e s and w i t h t h e p a r t i c u l a r l o t o f enzyme used. A.7. "Gel r e a d - o f f " sequence a n a l y s i s o f [ 5 ' - 3 2 P ] o r [ 3 ' - 3 2 P ] R N A s 32 P a r t i a l b a s e - s p e c i f i c h y d r o l y s e s o f [ P]RNA p l u s c a r r i e r tRNA w i t h RNase T-| and RNase A were pe r f o r m e d e s s e n t i a l l y as d e s c r i b e d by D o n i s -K e l l e r e t aj_. (49) e x c e p t t h a t r e a c t i o n volumes were 10 ul i n s t e a d o f 20 ul» - 34 -marker dyes were added a f t e r t he r e a c t i o n s were s t o p p e d , and s e r i a l d i l u -t i o n s o f enzymes were n o t n o r m a l l y p e r f o r m e d . Random h y d r o l y s i s i n h o t formamide, o r b a s e - s p e c i f i c h y d r o l y s e s w i t h RNase and RNase Phy I were p e r f o r m e d as d e s c r i b e d ( 5 0 ) . S p e c i f i c d e t a i l s on r a t i o s o f enzyme t o sub-s t r a t e a r e found i n f i g u r e l e g e n d s . E l e c t r o p h o r e s i s o f the h y d r o l y s a t e s was i n a d j a c e n t s l o t s o f t h i n , d e n a t u r i n g p o l y a c r y l a m i d e g e l s (40 cm x 20 cm x 0.05 cm, s l o t s 1 cm x 1 cm x 0.05 cm). The c o n c e n t r a t i o n s o f a c r y l a m i d e used i n t h e s e g e l s were 12%, 20%, and 25% (w/v). A l l g e l s c o n t a i n e d 20 gm a c r y l a m i d e p e r gm o f m e t h y l e n e - b i s - a c r y l a m i d e , 7M u r e a , 90 mM T r i s - b o r a t e (pH 8.3), and 2.5 mM EDTA. F o r p o l y m e r i z a t i o n , ammonium p e r s u l f a t e was added t o 0.05% (w/v) and TEMED to 0.1% ( v / v ) . P o l y m e r i z a t i o n was n o r m a l l y c o m p l e t e d w i t h i n 15 min. E l e c t r o p h o r e s i s was c a r r i e d o u t a t c o n s t a n t power (abo u t 20 w a t t s ) , m o n i t o r i n g t h e run by the m i g r a t i o n s o f the marker dyes XC and BB. Brbmophenol b l u e c o m i g r a t e s w i t h o l i g o n u c l e o t i d e s o f l e n g t h 4-5 (25% g e l ) , 6 (20% g e l ) , o r 13-15 (12% g e l ) , [ 3 2 P ] o l i g o n u c l e o t i d e s were then l o c a t e d by a u t o r a d i o g r a p h y , and t h e o r d e r o f n u c l e o t i d e s " r e a d o f f " from t he a u t o r a d i o g r a p h s . A.8 Sequence a n a l y s i s o f tRNA by t h e method o f S t a n l e y and V a s s i l e n k o (52) A.8.a. P u r i f i c a t i o n o f tRNA by p o l y a c r y l a m i d e g el e l e c t r o p h o r e s i s To o b t a i n c l e a r r e s u l t s s e q u e n c i n g by the S t a n l e y and V a s s i l e n k o method, the tRNA sample s h o u l d be i n t a c t and f r e e o f s i g n i f i c a n t amounts o f any s i n g l e c o n t a m i n a t i n g RNA s p e c i e s . In a n a l y s i s o f t R N A ^ , f u r t h e r p u r i f i c a t i o n o f the s t a r t i n g m a t e r i a l was r e q u i r e d . T h i s was a c c o m p l i s h e d - 35 -by p o l y a c r y l a m i d e gel e l e c t r o p h o r e s i s o f 10 ug o f t R N A 2 b f o r 40 h r . a t 300V on a 20% g e l c o n t a i n i n g 4M u r e a , 90 mM T r i s - b o r a t e (pH 8 . 3 ) , and 2.5 mM EDTA ( 1 3 7 ) . Gel d i m e n s i o n s were 40 cm x 20 cm x 0.15 cm, w i t h s l o t s 1 cm x 1 cm x 0.15 cm. The f u l l - s i z e d tRNA was l o c a t e d under UV l i g h t a f t e r s t a i n i n g the g e l f o r 10 min. w i t h b u f f e r c o n t a i n i n g 0.1 yg/ml e t h i d i u m bromide. ( I t i s worth n o t i n g here t h a t w h i l e some p r o t o c o l s c a l l f o r s t a i n i n g the gel w i t h m ethylene b l u e (137) o r t o l u i d i n e b l u e ( 5 4 ) , t h e s e dyes must be used w i t h s p e c i a l c a r e as both c a t a l y z e c l e a v a g e o f DNA and RNA a t g u a n o s i n e r e s i d u e s i n the p r e s e n c e o f v i s i b l e l i g h t and m o l e c u l a r oxygen (138,139). T h i s can r e s u l t i n v e r y h i g h backgrounds i n s u b s e q u e n t sequence a n a l y s i s . ) RNA was e l u t e d from the e x c i s e d gel s l i c e i n 0.40 ml o f e l u t i o n b u f f e r (0.5. M NH 40Ac, 10 mM M g ( 0 A c ) 2 , 1 mM EDTA, 0.1% SDS) o v e r -n i g h t a t 4 ° . The tRNA e l u t e d was r e c o v e r e d by e t h a n o l p r e c i p i t a t i o n (2.5 volumes o f 95% e t h a n o l , 1 h r . on s o l i d c a r b o n d i o x i d e ) and c e n t r i f u g a t i o n f o r 4 min. a t room t e m p e r a t u r e i n an E p p e n d o r f c e n t r i f u g e . The s u p e r n a t a n t l i q u i d was d i s c a r d e d . The p e l l e t was washed w i t h 95% e t h a n o l (-20%) and r e c o v e r e d as above, then d r i e d b r i e f l y under a s p i r a t o r vacuum. A.8.b. P a r t i a l h y d r o l y s i s o f the tRNA A v a r i e t y o f h y d r o l y s i s c o n d i t i o n s were used, i n formamide s o l u -t i o n s and i n s e v e r a l b u f f e r e d aqueous s o l u t i o n s . Good r e s u l t s were o b t a i n e d when h y d r o l y s e s were pe r f o r m e d i n 70-100% formamide. Of s e v e r a l aqueous systems t r i e d , h y d r o l y s i s i n 10 mM NH^OAc (pH 4.6) worked b e s t , g i v i n g r e l a -t i v e l y u n i f o r m i n t e n s i t y o f l a b e l l i n g and low background. - 36 -Hydro!yses i n formamide were c a r r i e d o u t i n the f o l l o w i n g way. Samples o f tRNA (0.5-6 ug, d r y o r i n a s m a l l volume o f w a t e r ) i n a c o n i c a l p o l y p r o p y l e n e tube were mixed w i t h formamide to g i v e 70-100% formamide i n 10-20 u l t o t a l . H y d r o l y s i s was f o r 10-15 min. i n t h e s e a l e d tube i n a b o i l i n g w a ter b a t h , and was s t o p p e d by c h i l l i n g t he tube on i c e . One volume o f 0.6M NaOAc, then f i v e volumes o f 95% e t h a n o l were added, m i x i n g by i n v e r -s i o n a f t e r t he l a t t e r . Samples were s t o r e d a t -70% f o r a t l e a s t two h r . , o r o v e r n i g h t a t - 2 0 ° , then the RNA was c o l l e c t e d by c e n t r i f u g a t i o n i n an E p p e n d o r f c e n t r i f u g e (4 min. a t room t e m p e r a t u r e ) . The s u p e r n a t a n t l i q u i d was c a r e f u l l y removed, d i s c a r d e d , and the p e l l e t d r i e d under a s p i r a t o r vacuum. H y d r o l y s e s o f 0.5-2 ug o f tRNA i n 8-10 mM NH 40Ac (pH 4.6) were f o r 1 . 5 - 3 min. i n a b o i l i n g w a t e r bath i n a s e a l e d c a p i l l a r y t u b e . The c a p i l l a r y was then q u i c k l y c h i l l e d i n an i c e - w a t e r b a t h , i t s c o n t e n t s e x p e l l e d i n t o a c o n i c a l p o l y p r o p y l e n e tube and d r i e d under a s p i r a t o r vacuum. 32 A.8.c. L a b e l l i n g h y d r o l y s i s p r o d u c t s w i t h P by p o l y n u c l e o t i d e k i n a s e The l a b e l l i n g r e a c t i o n was c a r r i e d o u t i n t h e tube c o n t a i n e d the d r i e d h y d r o l y s a t e . T h i s was done as d e s c r i b e d above f o r s y n t h e s i s o f 32 32 [ 5 1 - P] tRNA o r o l i g o n u c l e o t i d e s , u n l e s s the [ y - P]ATP was a commercial s t o c k o f h i g h s p e c i f i c a c t i v i t y (> 2000 Ci/mmole). In t h a t c a s e , the con-c e n t r a t i o n o f ATP was 5-10 uM. - 37 -A.8.d. S e p a r a t i o n o f [ 5 ' - P]tRNA fragments by p o l y a c r y l a m i d e g e l e l e c t r o -e l e c t r o p h o r e s i s 32 [ 5 1 - P] o l i g o n u c l e o t i d e s g e n e r a t e d from tRNA by p a r t i a l h y d r o l y s i s and p o s t - l a b e l l i n g were s e p a r a t e d a c c o r d i n g t o s i z e by e l e c t r o p h o r e s i s . o n d e n a t u r i n g p o l y a c r y l a m i d e g e l s , as d e s c r i b e d above f o r the g e l " r e a d - o f f " s e q u e n c i n g method. From a 20 y l sample (50% formamide, c o n t a i n i n g SC and BB), a l i q u o t s o f 7-10 y l were l o a d e d i n t o 1 cm x 1 cm x 0.05 cm s l o t s and run f o r v a r y i n g l e n g t h s o f time on 20% o r 12% g e l s i n o r d e r t o c o v e r t h e e n t i r e tRNA sequence. ( F o r example, see F i g . 1 o f r e f . 53.) A n i o n exchange 32 paper was p l a c e d beneath t h e gel i n t h e l o w e r b u f f e r chamber to t r a p P0^ and u n r e a c t e d [ y - 3 2 P ] A T P ( 4 2 ) . The [ 3 2 P ] R N A bands were l o c a t e d by a u t o -r a d i o g r a p h y , t h e bands e x c i s e d from the .gel i n o r d e r o f i n c r e a s i n g o l i g o -n u c l e o t i d e l e n g t h , and each o l i g o n u c l e o t i d e e l u t e d o v e r n i g h t a t 4° i n 0.40 ml 0.3M NaCl , 0.1% SDS ( 5 2 ) . Analysis of 5 '-terminal ( P-labelled) nucleotides from oligonucleotides A.8.e. A n a l y s i s o f 5 ' - t e r m i n i as *pNp's A n a l y s i s o f 5 ' - t e r m i n a l *pNp's was c a r r i e d o u t by one o f t h r e e r e l a t e d p r o t o c o l s i n sequence a n a l y s i s o f (1) tRNA^ and tRNAy , (2) t R N A g y s , and (3) t R N A ^ . (1) H y d r o l y s e s o f i s o l a t e d [ 5 ' - 3 2 P ] o l i g o n u c l e o -t i d e s were w i t h 0.2M NaOH. Such h y d r o l y s e s and s u b s e q u e n t i d e n t i f i c a t i o n o f t h e *pNp's by chromatography on P E I - c e l l u l o s e were c a r r i e d o u t p r e c i s e l y as d e s c r i b e d i n C h a p t e r 2 o f r e f e r e n c e 43. 32 T h e r e a r e c e r t a i n s h o r t c o m i n g s t o a l k a l i n e h y d r o l y s i s o f t h e [ P] o l i g o n u c l e o t i d e s . The p r o d u c t s o f a l k a l i n e h y d r o l y s i s a r e n u c l e o s i d e - 38 -5', 3 ' - b i s p h o s p h a t e s and n u c l e o s i d e 5', 2 ' - b i s p h o s p h a t e s ; t h e l a t t e r a r e r e s i s t a n t t o the 3'-phosphatase a c t i v i t y o f n u c l e a s e P-| and c a n n o t be c o n v e r t e d t o n u c l e o s i d e 5'-phosphates (pN's) f o r f u r t h e r c h a r a c t e r i z a t i o n ( 1 3 3 ) . A l s o , some m o d i f i e d n u c l e o s i d e s a r e l a b i l e i n a l k a l i n e s o l u t i o n s . F o r example, 4 - a c e t y l c y t i d i n e l o s e s i t s a c e t y l s u b s t i t u e n t w i t h a h a l f - t i m e o f 6.8 min. a t 37° i n 0.1M NaOH ( 4 ) ; t h e p u r i n e r i n g o f 7 - m e t h y l g u a n o s i n e i s c l e a v e d a t h i g h pH ( 1 4 0 ) ; and 1 - m e t h y l a d e n o s i n e i s c o n v e r t e d by r i n g -o p e n i n g and r e a r r a n g e m e n t t o 6 - m e t h y l a d e n o s i n e under such c o n d i t i o n s ( 4 2 ) . Due t o such c o n s i d e r a t i o n s , m i l d e n z y m a t i c h y d r o l y s i s c o n d i t i o n s were used i n l a t e r sequence a n a l y s i s . 32 (2) P a r t o r a l l o f the P - l a b e l l e d m a t e r i a l r e c o v e r e d from each g e l s l i c e (as above) and 30ug o f c a r r i e r E . c o l i tRNA was p r e c i p i t a t e d w i t h e t h a n o l and c o l l e c t e d by c e n t r i f u g a t i o n i n an E p p e n d o r f c e n t r i f u g e (4 min. a t room t e m p e r a t u r e ) . A f t e r d i s c a r d i n g the s u p e r n a t a n t l i q u i d , t h e RNA-c o n t a i n i n g p e l l e t was a i r - d r i e d , t h e n d i g e s t e d o v e r n i g h t a t 37° w i t h 0.05 u n i t o f RNase-T 2 i n 10 y l 20 mM NH 40Ac (pH 4 . 6 ) . An a l i q u o t o f each r i b o -n u c l e a s e d i g e s t (2 y l ) was s p o t t e d a t 1 cm i n t e r v a l s a t the o r i g i n on a 20 cm x 20 cm P E l - c e l l u l o s e p l a t e ( p r e p a r e d i n the f o r m a t e form as d e s c r i b e d i n r e f . 141). The o r i g i n was washed w i t h H^O, and t h e p l a t e d e v e l o p e d w i t h 0.8M (NH^)^ S0^, 2 mM EDTA a t room temperature. The *pNp's ( 3 ' - p h o s p h o r y l a t e d , but n o t 2'-) were l o c a t e d by a u t o r a d i o g r a p h y o f the d e v e l o p e d t h i n l a y e r p l a t e . 32 (3) [ P] RNAs r e c o v e r e d by e l u t i o n from gel s l i c e s were r e c o v e r e d by e t h a n o l p r e c i p i t a t i o n and c e n t r i f u g a t i o n as above, t o g e t h e r w i t h 10 yg - 39 -E . c o l i tRNA c a r r i e r . A f t e r d i s c a r d i n g t h e s u p e r n a t a n t l i q u i d , t h e p e l l e t was a i r - d r i e d , then d i s s o l v e d i n 10 y l o f 10 mM NH^ OAc (pH 4.6) c o n t a i n i n g 0.2 u n i t RNase T-,, 0.2 u n i t . RNase A, and 0.1 u n i t . , RNase T 2 . The RNA was d i g e s t e d o v e r n i g h t a t 3 7 ° ; The h y d r o l y s a t e s were a i r - d r i e d , d i s s o l v e d i n 5 y l H^O, and 1 y l o f each sample a p p l i e d a t 1 cm i n t e r v a l s on 20 cm x 20 cm P E I - c e l l u l o s e t h i n l a y e r p l a t e s ( f o r m a t e f o r m ) . The o r i g i n s o f t h e p l a t e s were washed w i t h H^O, the p l a t e s d e v e l o p e d i n 0.8 M (NH^)^ S0^, 2 mM EDTA a t room t e m p e r a t u r e , and the n u c l e o t i d e s l o c a t e d by a u t o r a d i o g r a p h y . A . 8 . f . A n a l y s i s o f 5 ' - t e r m i n i as *pN's 32 5 ' - t e r m i n a l ( P - l a b e l l e d ) n u c l e o t i d e s t h o u g h t l i k e l y t o be m o d i f i e d , by v i r t u e o f c h r o m a t o g r a p h i c b e h a v i o r as the *pNp on P E I - c e l l u l o s e (above) o r p o s i t i o n i n the n u c l e o t i d e sequence, were a n a l y z e d f u r t h e r as the *pN's. The *pN's were g e n e r a t e d by n u c l e a s e P-| d i g e s t i o n o f e i t h e r i n t a c t [ 5 1 -32 P] o l i g o n u c l e o t i d e s ( e n d o n u c l e a s e a c t i v i t y ) o r o f *pNp's ( 3 1 ) r e s u l t i n g from RNase T 2 d i g e s t i o n o f the o l i g o n u c l e o t i d e s ( 3 ' - p h o s p h a t a s e a c t i v i t y o f 32 n u c l e a s e P-|) ( 1 3 3 ) . In the former c a s e , t h e [ P ] & o l i g o n u c l e o t i d e s were c o l l e c t e d t o g e t h e r w i t h c a r r i e r tRNA by e t h a n o l p r e c i p i t a t i o n and c e n t r i f u g a -t i o n (as d e s c r i b e d a b o v e ) , and d i g e s t e d i n 10 y l 10 mM NH^OAc (pH 4.6) c o n t a i n i n g 0.1 yg n u c l e a s e P^ f o r a t l e a s t 2 h r . a t 3 7 ° . In t h e l a t t e r c a s e , 0.1 yg n u c l e a s e P^ was added d i r e c t l y t o the r i b o n u c l e a s e d i g e s t i o n mix. The c o n v e r s i o n r e a c t i o n (*pNp t o *pN) was f o r a t l e a s t 2 h r . a t 3 7 ° . D i f f e r e n t h y d r o l y s i s c o n d i t i o n s were used when t h e 5 ' - t e r m i n a l n u c l e o t i d e was deemed l i k e l y t o be r i b o s e - m e t h y l a t e d (*pN m). In t h i s c a s e , 2r6 yg o f n u c l e a s e P-| was added (10 y l o f 10 mM NH^OAc, pH 4.6), and d i g e s t i o n was f o r a t l e a s t 7 h r . a t 37° (43, 142). - 40 -A.8.g. C h a r a c t e r i z a t i o n o f *pN's by t h i n l a y e r chromatography The c h r o m a t o g r a p h i c m o b i l i t i e s o f a v a r i e t y o f m o d i f i e d n u c l e o s i d e 5'phosphates have been r e p o r t e d f o r s e v e r a l d i f f e r e n t s o l v e n t systems (42, 143). In t h e work p r e s e n t e d i n t h i s t h e s i s , c h r o m a t o g r a p h i c m i b i l i t i e s on c e l l u l o s e t h i n l a y e r p l a t e s were d e t e r m i n e d f o r *pN's i n s o l v e n t A (66 ml i s o b u t y r i c a c i d : 1 ml cone. NH^OH: 32 ml H 20: 1 ml 0.2 M EDTA, pH 8.5) o r s o l v e n t B (100 ml 0.1 M Na 2HP0 4, pH 6.8: 68 gm ( N H 4 ) 2 S 0 4 : 2 ml 1-p r o p a n o l : 1 ml 0.2 M EDTA, pH 8.5) ( 4 2 ) . In many c a s e s , t h e *pN's were chromatographed i n two d i m e n s i o n s , d e v e l o p i n g i n the f i r s t d i m e n s i o n w i t h s o l v e n t A and i n the second w i t h s o l v e n t B, as d e s c r i b e d ( 4 2 , 4 3 ) . N u c l e o -t i d e s were i d e n t i f i e d on t h e b a s i s o f c h r o m a t o g r a p h i c m o b i l i t i e s i n one o r two d i m e n s i o n s r e l a t i v e t o n u c l e o s i d e 5'-phosphate s t a n d a r d s run on t h e same p l a t e s . C o m i g r a t i o n o f *pN w i t h a n u c l e o t i d e s t a n d a r d i n b o t h s o l v e n t systems was g e n e r a l l y c o n s i d e r e d s u f f i c i e n t t o i i d e n t i f y t he *pN. In o t h e r c a s e s c h r o m a t o g r a p h i c m o b i l i t i e s i n s o l v e n t s A and B, t a k e n t o g e t h e r w i t h t h e m o b i l i t y o f t h e *pNp on P E l - c e l l u l o s e i n 0.8 M ( N H 4 ) 2 S 0 4 and r i b o -n u c l e a s e s p e c i f i c i t i e s i n gel r e a d - o f f e x p e r i m e n t s , a l l o w e d i d e n t i f i c a t i o n o f t h e m o d i f i e d n u c l e o t i d e . A.8.h. C h a r a c t e r i z a t i o n o f s u l f u r - c o n t a i n i n g n u c l e o t i d e s N u c l e o t i d e s t h o u g h t l i k e l y t o be 2 - t h i o d e r i v a t i v e s o f the s t a n d a r d bases were t e s t e d f o r s e n s i t i v i t y t o cyanogen bromide (CNBr) as d e s c r i b e d (144,145). In m i l d a l k a l i n e s o l u t i o n s , CNBr w i l l form c y a n i d o d e r i v a t i v e s 2 4 o f n u c l e o t i d e s w i t h e x o c y c l i c t h i o - m o d i f i c a t i o n s , such as s U and s U. Such c y a n i d o n u c l e o t i d e d e r i v a t i v e s a r e u n s t a b l e i n a c i d i c s o l u t i o n s ( 1 4 4 ) . - 41 -The *pN sample to be t e s t e d ( a t l e a s t 2000 Cerenkov cpm) was d i s s o l v e d i n 20 u l o f 0.1 M NH 4 HC0 3 , pH 9.0. A l l s u b s e q u e n t s t e p s were c a r r i e d o u t i n a fume hood. As the c o n t r o l , a 5 u l a l i q u o t was removed p r i o r t o t r e a t m e n t w i t h CNBr. The m o d i f i c a t i o n r e a c t i o n was s t a r t e d by a d d i n g 2 y l o f CNBr (25 mg/ml i n e t h a n o l ) t o t h e r e m a i n i n g 15 y l o f *pN sample. The r e a c t i o n was f o r 10 min. a t room t e m p e r a t u r e . A f t e r 10 min., 10 y l was removed from t h e r e a c t i o n mix i n t o 100 y l o f 0.1 M H C l , w h i l e the r e m a i n d e r was f r o z e n on s o l i d CO2. A l i q u o t s o f 55 y l were t a k e n from the HCl s o l u t i o n and f r o z e n on s o l i d C0g a f t e r 4 h r . and 22 hr. a t room t e m p e r a t u r e . A l l samples were d r i e d i n a d e s s i c a t o r under a s p i r a t o r vacuum, i n a fume hood. The d r i e d samples were d i s s o l v e d i n 2 y l H^O, then a p p l i e d t o c e l l u l o s e t h i n l a y e r p l a t e s . The chromatograms were d e v e l o p e d i n e i t h e r s o l v e n t A o r 32 s o l v e n t B, as d e s c r i b e d above. The [ P ] - n u e l e o t i d e s were l o c a t e d by a u t o -r a d i o g r a p h y . N u c l e o t i d e s t a n d a r d s were l o c a t e d under UV l i g h t . A.9. Two-dimensional RNA s e q u e n c i n g : a v a r i a t i o n on S t a n l e y / V a s s i l e n k o T wo-dimensional RNA sequence a n a l y s i s was c a r r i e d o u t as d e s c r i b e d by Tanaka, Dyer, and Brownlee (54) e x c e p t t h a t e l e c t r o p h o r e s i s was i n p o l y -a c r y l a m i d e g e l s 40 cm i n l e n g t h r a t h e r than 80 cm, and t r a n s f e r s o f s e p a r a t e d o l i g o n u c l e o t i d e s were to 20 cm x 20 cm D E A E - c e l l u l o s e p l a t e s r a t h e r than t o 20 cm x 40 cm p l a t e s . 32 P r e p a r a t i o n o f [ P]RNA samples by l i m i t e d h y d r o l y s i s i n h o t formamide, p o s t - l a b e l l i n g , and s u b s e q u e n t p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s were as d e s c r i b e d above (Sequence a n a l y s i s o f tRNA by the method o f S t a n l e y and V a s s i l e n k o ) . D E A E - c e l l u l o s e p l a t e s were t r e a t e d b e f o r e use, washing by a s c e n d i n g chromatography i n 40 mM EDTA, pH 4.7, t h e n a g a i n i n H ? 0 i n t h e - 42 -same d i r e c t i o n . (Note t h a t t h e pH o f t h e EDTA s o l u t i o n used here i s impor-t a n t . ) A segment o f t h e p o l y a c r y l a m i d e g e l 20 cm x 1.5 cm was e x c i s e d u s i n g a s c a l p e l and removed by a d h e s i o n t o "used" X-ray f i l m , t h e n t r a n s f e r r e d t o the w e t t e d ( w i t h IM NH 40Ac,. pH 4.6) o r i g i n o f a D E A E - c e l 1 u l o s e p l a t e , as d e s c r i b e d ( 5 4 ) . A g l a s s p l a t e was p l a c e d o v e r t h e t r a n s f e r , the t r a n s f e r and g l a s s p l a t e s wrapped t i g h t l y i n c e l l o p h a n e , and w e i g h t s ( s e v e r a l pounds o f l e a d b l o c k s ) p l a c e d o v e r the o r i g i n where t h e g e l s t r i p l a y . T r a n s f e r s were l e f t f o r 16-24 h r . a t room t e m p e r a t u r e ( t r a n s f e r e f f i c i e n c i e s o f about 50% from 20% g e l s o r about 75% from 12% g e l s were o b s e r v e d ) . They were 32 then washed i n H^O and d r i e d . The [ 5 ' - P] o l i g o n u c l e o t i d e s were then d i g e s t e d by r i b o n u c l e a s e i n s i t u . About 100 y l o f RNase mix (0.10 M NH^OAc, pH 4.6, c o n t a i n i n g 0.2 U RNase T ^ y l , 0.2 U RNase A / y l , and 0.1 U RNase T 2 / y l ) was a p p l i e d a l o n g the o r i g i n on the D E A E - c e l l u l o s e p l a t e w i t h a p i p e t t o r ( t a k i n g c a r e not t o t o u c h the s u r f a c e o f t h e p l a t e , which i s e a s i l y damaged, w i t h the p i p e t t o r t i p ) . The p l a t e was wrapped i n Saranwrap, clamped between g l a s s p l a t e s and i n c u b a t e d a t 37° f o r 2-4 h r . The o r i g i n o f t h e D E A E - p l a t e was w a s h e d . f o r about 10 min. a t room t e m p e r a t u r e i n m e t h a n o l , and the p l a t e a i r - d r i e d . E l e c t r o p h o r e s i s i n the second d i m e n s i o n was i n t h e same d i r e c t i o n as the p r e - w a s h i n g i n EDTA. E l e c t r o p h o r e s i s was p e r f o r m e d u s i n g an a c i d b u f f e r composed o f 8% a c e t i c a c i d , 2% f o r m i c a c i d , 5 mM EDTA (pH 2.3). The D E A E - c e l l u l o s e p l a t e was w e t t e d by b l o t t i n g w i t h Whatman 3 MM f i l t e r s t r i p s soaked i n the a c i d b u f f e r , c o v e r i n g the o r i g i n l a s t . Wicks from the b u f f e r chambers were a l s o 3 MM f i l t e r p a per, t h o r o u g h l y w e t t e d i n t h e r u n n i n g b u f f e r . B e t t e r r e s u l t s were o b t a i n e d when the p l a t e s were l e f t exposed to the a i r r a t h e r than c o v e r e d w i t h Saranwrap. E l e c t r o p h o r e s i s o f *pNp's g e n e r a t e d by i n s i t u RNase h y d r o l y s i s was f o r 2.5-3 h r . a t 300 V on a w a t e r -c o o l e d S a v a n t f l a t b e d e l e c t r o p h o r e s i s a p p a r a t u s . A t t h i s t i m e , x y l e n e - 43 -c y a n o l marker dye s p o t t e d a t the o r i g i n had m i g r a t e d a b o u t 1.2-1.5 cm. I n d i v i d u a l *pNp's were l o c a t e d by a u t o r a d i o g r a p h y . A.10. "Wandering s p o t " a n a l y s i s o f [ 5 | 3 2 P ] o r [ 3 ' - 3 2 P ] t R N A : t w o - d i m e n s i o n a l  e l e c t r o p h o r e s i s / h b m o c h V o m a t o g r a p h y The methods used were e s s e n t i a l l y t h o s e d e s c r i b e d by J a y e t a l . ( 4 7 ) , e x c e p t t h a t p a r t i a l h y d r o l y s e s o f e n d - l a b e l l e d o l i g o n u c l e o t i d e s were i n h o t formamide ( r a t h e r than the e n z y m a t i c methods used i n r e f s . 42, 47, 32 and 4 8 ) . A sample o f P-end l a b e l l e d RNA was p a r t i a l l y h y d r o l y z e d i n 70-100% formamide f o r 60 min. ( 5 ' - l a b e l l e d RNA) o r 20 min. ( 3 ' * p C p - l a b e l l e d RNA) a t 1 0 0 ° . E l e c t r o p h o r e s i s on a w a t e r - c o o l e d Shandon f l a t b e d e l e c t r o -p h o r e s i s a p p a r a t u s was p e r f o r m e d i n the f o l l o w i n g way. A s t r i p o f c e l l u l o s e n i t r a t e was w e t t e d on both s i d e s by drawing i t t w i c e t h r o u g h a t r o u g h con-t a i n i n g 5% a c e t i c a c i d , 7M urea (pH 3.5). Excess b u f f e r was removed from the s t r i p by r u n n i n g a f i n g e r o v e r i t l e n g t h w i s e , then b l o t t e d w i t h t i s s u e p a p er. A s e c t i o n o f the membrane s t r i p a b o u t 10 cm from the c a t h o d e b u f f e r chamber was t h o r o u g h l y b l o t t e d w i t h t i s s u e paper b e f o r e a p p l y i n g 1-4 y l o f h y d r o l y s a t e c o n t a i n i n g , _ a minimum o f 5000 Cerenkov cpm. A s m a l l volume o f marker dye s o l u t i o n (0.33% (w/v) o f x y l e n e c y a n o l FF, orange G, and a c i d 32 f u c h s i n ) was s p o t t e d on e i t h e r s i d e o f the [ P ] h y d r o l y s a t e a t t h e o r i g i n . A f t e r sample and dyes had soaked i n t o t h e c e l l u l o s e n i t r a t e s t r i p , b o t h ends o f the s t r i p were c o v e r e d (above and below) by Whatman 3MM f i l t e r paper w i c k s from the b u f f e r chambers, t h o r o u g h l y w e t t e d w i t h r u n n i n g b u f f e r ( 5 % a c e t i c a c i d , a d j u s t e d w i t h p y r i d i n e t o pH 3.5). Membrane s t r i p s and w i c k s were c o v e r e d w i t h m y l a r f i l m , t h e n w i t h g l a s s p l a t e s . E l e c t r o p h o r e s i s was f o r 30-45 min. a t 3000V w i t h w a t e r - c o o l i n g , u n t i l t he orange and b l u e dyes were - 44 -s e p a r a t e d 'by 12-15 cm. O l i g o n u c l e o t i d e s were then t r a n s f e r r e d from the membrane s t r i p s t o 20 cm x 40 cm D E A E - c e l l u l o s e p l a t e s as d e s c r i b e d ( 1 4 6 ) . The p l a t e s were washed w i t h h^O t o remove urea a l o n g the t r a n s f e r l i n e , t hen a i r - d r i e d . Homochromatography was c a r r i e d o u t e s s e n t i a l l y as d e s c r i b e d by J a y e t al_. ( 4 7 ) . The o r i g i n s on the p l a t e s were we t t e d by b l o t t i n g w i t h 3MM f i l t e r p aper s t r i p s i n H^O, then the p l a t e s were d e v e l o p e d w i t h homomixture 5 (47) a t 65° u n t i l t h e s o l v e n t f r o n t r e a c h e d t h e top ( 1 0 - 1 2 ; h r . ) . The 3 2 P -l a b e l l e d o l i g o n u c l e o t i d e s were l o c a t e d by a u t o r a d i o g r a p h y . B. DNA Sequence A n a l y s i s Materials C h e m i c a l s used were g e n e r a l l y r e a g e n t grade commercial s t o c k s . H y d r a z i n e was from Eastman-Kodak. D i m e t h y l s u i f a t e was o b t a i n e d from A l d r i c h ("Sold L a b e l " r e a g e n t ) . P i p e r i d i n e , from F i s h e r Chemical Co., was r e - d i s t i l l e d 32 b e f o r e use. [a- P] d e o x y n u c l e o s i d e 5 1 t r i p h o s p h a t e s ( s p e c i f i c r a d i o a c t i v i t y a t l e a s t 2000 Ci/mmole) were o b t a i n e d from Amersham R a d i o c h e m i c a l s . E..  c o l i tRNA was from Schwartz-Mann. A g a r o s e ( e l e c t r o p h o r e t i c p u r i t y ) was o b t a i n e d from B i o - R a d . Most o f t h e r e s t r i c t i o n enzymes used were o b t a i n e d from New E n g l a n d Bio!.Labs, though some were from M i l e s o r from Bethesda R e s e a r c h L a b o r a t o r i e s . ;Fnu4H Ii, was g e n e r o u s l y p r o v i d e d by Dr. D a v i d R u s s e l l . The l a r g e fragment o f c o l i DNA pol y m e r a s e I (Klenow fragment) was o b t a i n e d from e i t h e r Boehringer-Mannheim o r New E n g l a n d B i o Labs. D i a l y s i s t u b i n g was p u r c h a s e d from F i s h e r Chemical Co. ( s i z e A ) . E. c o l i s t r a i n SF-8 (114) was used t o grow p l a s m i d s . - 45 -Methods B.1. P r e p a r a t i o n o f p l a s m i d DNA DNA o f the p l a s m i d s pBR 322, pDt 17R, pDt 27R, and pDt 73 was o b t a i n e d by a two-step p r o c e d u r e i n v o l v i n g p r e p a r a t i o n o f a c l e a r e d l y s a t e and chromatography .of the p a n c r e a t i c R N a s e - t r e a t e d , p r o t e a s e K - t r e a t e d , p h e n o l - e x t r a c t e d l y s a t e on an a g a r o s e A - l 5 0 M column (45 cm x 1.4 cm), and p r o v i d e d f o r use by Dr. A l l e n Delaney. DNA o f t h e p l a s m i d pDt 16, p r e p a r e d as d e s c r i b e d ( 1 1 4 ) , was p r o v i d e d by D. T a y l o r and Dr. R.C. M i l l e r , J r . B.2. A g a r o s e g e l e l e c t r o p h o r e s i s About 200 ml o f a g a r o s e s o l u t i o n i s r e q u i r e d t o f i l l t h e gel t r a y s (22 cm x 15 cm x 0.6 cm) commonly used i n o u r l a b o r a t o r y f o r a g a r o s e g e l e l e c t r o p h o r e s i s . A g a r o s e s o l u t i o n s (0.5-1.4%, w/v) were p r e p a r e d by d i s p e r s i n g the d e s i r e d amount o f a g a r o s e i n 200 ml o f 40 mM T r i s ( b a s e ) , 20 mM NaH^PO^, 1 mM EDTA c o n t a i n i n g 1 ug/ml e t h i d i u m bromide and h e a t i n g on a h o t p l a t e a t a b o u t 95° w i t h c o n t i n u o u s s t i r r i n g . Sample w e l l s were formed by c o o l i n g the a g a r o s e s o l u t i o n w i t h s l o t f o r m e r s (1 cm x 1 cm x 0.12 cm) i n p l a c e about 5 cm from one end o f the g e l t r a y . A l s o , two l a y e r s o f Whatman 3MM f i l t e r paper were i n s e r t e d as w i c k s i n t o each end o f the gel t r a y b e f o r e p o u r i n g the g e l . The a g a r o s e s o l u t i o n was a l l o w e d t o gel f o r a t l e a s t two hours b e f o r e use. The e l e c t r o p h o r e s i s b u f f e r was t h e same as i n the g e l (40 mM T r i s b ase, 20 mM N a H 2 P 0 4 > 1 mM EDTA). B e f o r e l o a d i n g t h e samples f o r e l e c t r o p h o r e s i s , the gel s u r f a c e was c o v e r e d w i t h t h i s b u f f e r and the w i c k s ( p l a c e d i n the e l e c t r o d e b u f f e r compartments) t h o r o u g h l y w e t t e d . Samples ( i n 10% s u c r o s e ) were l o a d e d i n t o the s l o t s u s i n g a u t o m a t i c p i p e t t o r s w i t h d i s p o s a b l e t i p s . U s u a l l y , sample volumes were a b o u t 20 y l - 46 -per s l o t c o n t a i n i n g a t l e a s t 1 ug o f DNA. F o r p r e p a r a t i v e a g a r o s e g e l e l e c -t r o p h o r e s i s , s l o t s were 1 cm x 1 cm x 0.45 cm, and volumes l o a d e d per s l o t were up t o 30 y l . P r i o r t o e l e c t r o p h o r e s i s , t h e l o a d e d , submerged g e l was c o v e r e d w i t h Saranwrap. E l e c t r o p h o r e s i s was c a r r i e d o u t on a f l a t - b e d S a v a n t a p p a r a t u s w i t h w a t e r - c o o l i n g . G e l s were g e n e r a l l y run o v e r n i g h t ( a b o u t 16 h r . ) a t 200V, though i n some c a s e s t h e y were run a t up t o 400V w i t h o u t a p p a r e n t l o s s o f r e s o l u t i o n . DNA fragments i n g e l s were v i s u a l i z e d by i l l u m i n a t i n g w i t h u l t r a -v i o l e t l i g h t . When d e s i r e d , fragment p a t t e r n s were photographed u s i n g a P o l a r o i d camera ( o r a n g e l e n s f i l t e r ) and p o l a r o i d t y p e 57 h i g h speed f i l m , i l l u m i n a t i n g t h e g e l w i t h s h o r t w a v e l e n g t h u l t r a v i o l e t l i g h t . A v a r i e t y o f d i f f e r e n t a g a r o s e c o n c e n t r a t i o n s was used i n d i f f e r e n t e x p e r i m e n t s . S p e c i f i c d e t a i l s c o n c e r n i n g g el c o n c e n t r a t i o n s and DNA fragment m o b i l i t i e s a r e p r e s e n t e d i n i n d i v i d u a l f i g u r e l e g e n d s . B.3. P o l y a c r y l a m i d e g el e l e c t r o p h o r e s i s o f d o u b l e - s t r a n d e d DNA fragments N a t i v e d o u b l e - s t r a n d e d DNA fragments were o f t e n p r e p a r e d by e l e c -t r o p h o r e s i s on n o n - d e n a t u r i n g p o l y a c r y l a m i d e g e l s . F o r f r a c t i o n a t i o n o f fragments 50 b.p. t o 600 b.p. i n l e n g t h ( o r c o n s i d e r a b l y more i n some c a s e s ) , g e l s (40 cm x 20 cm x 0.05 cm) c o n t a i n i n g 5% a c r y l a m i d e , 0.25% me t h y l e n e -b i s - a c r y l a m i d e , 90 mM T r i s - b o r a t e (pH 8.3), 2.5 mM EDTA were used. These were p o l y m e r i z e d by a d d i n g ammonium p e r s u l f a t e and TEMED t o f i n a l c o n c e n t r a -t i o n s o f 0.05% (w/v) and 0.1% ( v / v ) , r e s p e c t i v e l y . However, p o l y a c r y l a m i d e g e l s w i t h c o n c e n t r a t i o n s as low as 2.25% a c r y l a m i d e , 0.11% m e t h y l e n e - b i s -- 47 -a c r y l a m i d e were used to f r a c t i o n a t e DNA fragments as l a r g e as 4.4 kb. To a s s u r e d i s c r e t e DNA fragment bands, g e l s were run a t low v o l t a g e s (100-125 V) a t room t e m p e r a t u r e . 32 P - l a b e l l e d DNA fragments were l o c a t e d by a u t o r a d i o g r a p h y . Un-l a b e l l e d DNA fra g m e n t s were l o c a t e d by s t a i n i n g t h e g e l 5 min. i n a 1 ug/ml e t h i d i u m bromide s o l u t i o n , then i l l u m i n a t i n g the gel w i t h u l t r a v i o l e t l i g h t . Gel bands c o n t a i n i n g DNA fragments t o be c h a r a c t e r i z e d f u r t h e r were e x c i s e d w i t h a s c a l p e l and the DNA r e c o v e r e d by e l e c t r o e l u t i o n (below) o r by s o a k i n g i n 0.5 M ammonium a c e t a t e , 10 mM magnesium a c e t a t e , 1 mM EDTA, 0.1%(w/v) SDS. R e c o v e r i e s o f most fragments up to 500 b p. l o n g were 80-95% a f t e r s o a k i n g o v e r n i g h t a t 3 7 ° . F o r l o n g e r DNA f r a g m e n t s , e l u t i o n was f o r a l o n g e r time o r a t a h i g h e r t e m p e r a t u r e (up t o 6 5 ° ) . Fragments were c o l l e c t e d by e t h a n o l p r e c i p i t a t i o n . B.4. D i g e s t i o n o f DNA w i t h r e s t r i c t i o n enzymes A number o f d i f f e r e n t r e s t r i c t i o n enzymes were used t o d i g e s t DNA. R e a c t i o n mixes c o n t a i n e d DNA, b u f f e r , the r e s t r i c t i o n e n z y m e ( s ) , and some-tim e s b o v i n e serum a l b u m i n t o s t a b i l i z e t h e enzyme(s). R e a c t i o n c o n d i t i o n s were s i m i l a r , though n o t always i d e n t i c a l , to t h o s e recommended by commercial s u p p l i e r s . F or c o n v e n i e n c e , a l i m i t e d number o f s t a n d a r d b u f f e r s were used. (These were p r e p a r e d a t c o n c e n t r a t i o n s 1 0 - f o l d h i g h e r than t h e d e s i r e d c o n -c e n t r a t i o n i n the r e a c t i o n mix and s t o r e d a t -20°.) A l l r e a c t i o n mixes c o n t a i n e d 6 mM T r i s - H C l (pH 7.5), 6 mM MgC^, and 6 mM 2 - m e r c a p t o e t h a n o l , p l u s 150 mM NaCl ( f o r use w i t h Xho I , Xba I , E c o R I ) , o r 60 mM NaCl ( f o r use w i t h Sau96 I, BgJ_ I I , /Vj_u I, Pv_u I I , Hha I, P s t I, H i n f I , Sau3A I , Dde I ) , - 48 -o r 6 mM NaCl ( f o r use w i t h Hae I I I , T a £ I, Hind I I I , Ava I , CI a I, Xma I, BamH I , Fnu_4H I ) , o r 60 mM KCl ( f o r use w i t h BcJ_ I ) , o r 6 mM KCl ( f o r use w i t h Msp I ) . R e a c t i o n s were a t 37° e x c e p t w i t h T a £ I (use d a t 6 5 ° ) . DNA c o n c e n t r a t i o n s were e s t i m a t e d by m e a s u r i n g t h e A^Q ° ^ D ^ A samples (50 y g / ml/AggQ, e i t h e r i n HgO o r b u f f e r e d a t abo u t pH 7 ) . R e a c t i o n s were i n c u b a t e d f o r a t l e a s t t w i c e t h e time e s t i m a t e d t o be n e c e s s a r y f o r 100% d i g e s t i o n o f t h e i n p u t DNA based on s p e c i f i e d enzyme a c t i v i t y v a l u e s ( u n i t s / m l ) and t h e volume o f enzyme used. B o v i n e serum al b u m i n was g e n e r a l l y i n c l u d e d i n the r e a c t i o n mixes ( f i n a l c o n c e n t r a t i o n , 100 yg/ml) when r e a c t i o n s were f o r r e l a t i v e l y l o n g time p e r i o d s (4 h r . o r more). The DNA c o n c e n t r a t i o n i n d i g e s t i o n r e a c t i o n mixes was 1 y g / y l o r l e s s . As c o n t a m i n a n t s p r e s e n t i n some DNA samples i n h i b i t t h e r e s t r i c t i o n enzymes when p r e s e n t a t r e l a t i v e l y h i g h c o n c e n t r a t i o n s , t h e DNA c o n c e n t r a -t i o n (and t h a t o f p o s s i b l e c o n t a m i n a n t s ) was kep t low. I f a more c o n c e n t r a t e d DNA sample was r e q u i r e d f o r s u b s e q u e n t s t e p s ( p a r t i c u l a r l y f o r gel e l e c t r o -p h o r e s i s ) , t h e d i g e s t e d DNA was c o l l e c t e d by e t h a n o l p r e c i p i t a t i o n . Sodium a c e t a t e was added t o the r e a c t i o n mix t o a c o n c e n t r a t i o n o f 0.3M, the DNA p r e c i p i t a t e d by a d d i n g 2.5 volumes o f 95% e t h a n o l and c h i l l i n g ( a t l e a s t 1 hr. a t - 2 0 ° , o r 20 min. a t -70°) and c o l l e c t e d by c e n t r i f u g a t i o n i n an Ep p e n d o r f h i g h - s p e e d t a b l e - t o p c e n t r i f u g e (4 min. a t room t e m p e r a t u r e ) . A f t e r d i s c a r d i n g the s u p e r n a t a n t l i q u i d and d r y i n g b r i e f l y i n a d i s s i c a t o r , t h e sample was re a d y t o be d i s s o l v e d and used f u r t h e r . B.5. E l e c t r o e l u t i o n o f DNA fragments from g e l s The p o r t i o n o f an a g a r o s e o r p o l y a c r y l a m i d e gel c o n t a i n i n g a d e s i r e d DNA fragment was e x c i s e d w i t h a s c a l p e l and p l a c e d i n a g l a s s - 49 -w o o l - p i u g g e d P a s t e u r p i p e t w i t h a c u t - o f f , f i r e - p o l i s h e d t i p . D i a l y s i s t u b i n g ( p r e p a r e d by b o i l i n g f o u r t i m e s f o r 5-10 min. i n 1 mM EDTA, pH 7.0) was t i e d and clamped a t one end, f i l l e d w i t h 0.30 ml o f e l e c t r o e l u t i o n b u f f e r (20 mM T r i s - a c e t a t e , pH 7.0) and s l i d o v e r t h e narrow, p l u g g e d end o f t h e p i p e t . The p i p e t was f i l l e d w i t h t h e same b u f f e r , and the t u b i n g a d j u s t e d t o remove any a i r b u b b l e s a t the p i p e t t i p t h a t would impede the f l o w o f c u r r e n t . A f t e r p l a c i n g the p i p e t i n the e l e c t r o p h o r e s i s a p p a r a t u s , t h e bottom (anode) b u f f e r chamber was f i l l e d t o a l e v e l s u f f i c i e n t t o complete an e l e c t r i c a l , c i r c u i t but below t h e top o f the d i a l y s i s t u b i n g on the p i p e t . The upper ( c a t h o d e ) b u f f e r chamber was f i l l e d , and e l e c t r o p h o r e s i s o f DNA fragments from t h e gel s l i c e to...the d i a l y s i s t u b i n g c a r r i e d o u t a t 150V 32 (2 mA/tube) f o r 4-8 h r . a t room t e m p e r a t u r e . ( R e c o v e r y o f [ P] DNA can be checked by m o n i t o r i n g the d i a l y s i s t u b i n g w i t h a G e i g e r c o u n t e r , w h i l e u n l a b e l l e d , e t h i d i u r n - s t a i n e d DNA i s d e t e c t e d by t h e p r e s e n c e o f the orange dye i n t h e d i a l y s i s t u b i n g . ) The D N A - c o n t a i n i n g e l u a t e was removed f r o m the d i a l y s i s t u b i n g i n t o a p l a s t i c t e s t tube by low speed c e n t r i f u g a t i o n , one-n i n t h volume o f 3M sodium a c e t a t e added, and t h e DNA c o l l e c t e d by e t h a n o l p r e c i p i t a t i o n and c e n t r i f u g a t i o n as d e s c r i b e d above ( s e c t i o n B . 4 . ) . B.6. 3'-end l a b e l l i n g o f r e s t r i c t i o n fragments R e s t r i c t i o n fragments w i t h 5'-extended sequences were l a b e l l e d a t 3'-ends by r e p a i r s y n t h e s i s on the 5'-extended t e m p l a t e , u s i n g E . c o l i DNA 32 p o l y m e r a s e I (Klenow fragment) and [a- P] l a b e l l e d d e o x y n u c l e o s i d e t r i -p h o s p h a t e s ( 1 5 2 ) . - 50 -Because o f t h e h i g h s p e c i f i c i t y o f the enzyme, the r e p a i r r e a c t i o n i s v e r y " c l e a n " and i t can be m a n i p u l a t e d i n many c a s e s so t h a t o n l y . o n e o f two fragment ends ( g e n e r a t e d . b y two o r a t times by one r e s t r i c t i o n enzyme) i s r a d i o l a b e l e d . T h i s i s a c c o m p l i s h e d by u s i n g an a p p r o p r i a t e c o m b i n a t i o n 32 o f u n l a b e l l e d dNTP's p l u s a d i f f e r e n t [ a - P]dNTP which i s complementary t o o n l y one o f two 5'-extended t e m p l a t e s e q u e n c e s . In o t h e r c a s e s , both ends o f a r e s t r i c t i o n f ragment a r e l a b e l l e d , then s e p a r a t e d by c l e a v a g e w i t h a second r e s t r i c t i o n enzyme. (See C h a p t e r IV, s e c t i o n A.3, f o r s p e c i f i c examples.) E f f i c i e n t l a b e l l i n g o f r e s t r i c t i o n fragments by E . c o l i DNA p o l y m e r a s e I (0.5 - 1 u n i t ) was o b t a i n e d when, [ a i ; 3 2 P ] ; dNTPs, (> 2000 Ci/mmole) were . added t o r e s t r i c t i o n enzyme r e a c t i o n mixes ( f r o m 10 y l t o 100 y l ) i n v a r y i n g amounts (1-100 C i ; > 0.05 C i / y l ) . One y l o f each a p p r o p r i a t e u n l a b e l l e d dNTP (0.5 mM) was added t o t h e r e a c t i o n mixes. L a b e l l i n g r e a c t i o n mixes c o n t a i n e d 20-60 mM N a C l , 6 mM T r i s - H C l (pH 7.5), 6 mM M g C l 2 , and 6 mM 2-m e r c a p t o e t h a n o l , as w e l l as d e o x y n u c l e o s i d e t r i p h o s p h a t e s , DNA, and Klenow p o l y m e r a s e . R e a c t i o n s were a t room t e m p e r a t u r e f o r 5-10 min. Because o f t h e h i g h s p e c i f i c r a d i o a c t i v i t y and low c o n c e n t r a t i o n 32 o f the [ a - P] dNTP's, o n l y a f r a c t i o n o f the DNA ends p r e s e n t were u s u a l l y r a d i o l a b e l 1 e d . To e n s u r e u n i f o r m i t y o f the p r o d u c t where more than one r a d i o l a b e l e d p r o d u c t c o u l d o c c u r by p a r t i a l r e p a i r o f an end ( i . e . where 32 i t was p o s s i b l e to add one o r more than one [ P ] - n u c l e o t i d e to an e n d ) , a " c o l d c h a s e " s t e p was added t o f i l l o u t the end c o m p l e t e l y . T h i s was done by a d d i n g a l a r g e molar e x c e s s o f the a p p r o p r i a t e u n l a b e l l e d dNTP (2 y l ; 0.5 mM). The r e a c t i o n was c o n t i n u e d f o r 2-3 min. a t room t e m p e r a t u r e , then s t o p p e d by a d d i n g o n e - f o u r t h volume o f 60% s u c r o s e , 10 mM EDTA, 0.05 % XC and BB, and c h i l l i n g i n an i c e - w a t e r b a t h . - 51 -B e t t e r r e s u l t s were o b t a i n e d u s i n g Klenow polymerase from B o e h r i n g e r -Mannheim. The enzyme p r e p a r a t i o n o b t a i n e d from New E n g l a n d B i o L a b s was found t o c o n t a i n a s i g n i f i c a n t amount o f c o n t a m i n a t i n g 3 ' - e x o n u c l e a s e a c t i v i t y , w h i c h . r e s u l t e d i n h i g h backgrounds when a p p a r e n t l y u n i f o r m f r a g -ments, o b t a i n e d as d i s c r e t e bands by p o l y a c r y l a m i d e gel e l e c t r o p h o r e s i s were s u b j e c t e d t o M a x a m - G i l b e r t sequence a n a l y s i s ( b e l o w ) . B.7. S i z e d e t e r m i n a t i o n s f o r DNA fragments S i z e s o f DNA fragments were e s t i m a t e d based on e l e c t r o p h o r e t i c m o b i l i t i e s r e l a t i v e t o s t a n d a r d s o f known l e n g t h . T h i s was done e i t h e r g r a p h i c a l l y , e s t a b l i s h i n g a s t a n d a r d . c u r v e by p l o t t i n g i n v e r s e m o b i l i t i e s as a f u n c t i o n o f the known s i z e s o f s t a n d a r d DNA f r a g m e n t s ; o r u s i n g a l i n e a r r e g r e s s i o n computer program ( w r i t t e n by A l l e n D e l a n e y , UBC) based on r e f . 147. S t a n d a r d s used were H i n f T - c u t PBR 322 ( f o r the s i z e range 75-516 b.p.; r e f . 148) o r H i n d H I - c u t b a c t e r i o p h a g e XDNA ( f o r t h e s i z e range 0.5.4 kb t o 23 kb; 32 r e f . 149). When P - l a b e l l e d DNA s t a n d a r d s were d e s i r e d , a s m a l l amount (~lug) H i n f l - c u t pBR 322 o r H i n d i I I - c u t X DNA was 3'-end l a b e l l e d w i t h [ a- 3 2P]dATP (1-5 u C i ; 2000 Ci/mmolg) and E . c o l i DNA polymerase--!••(Klenow f r a g m e n t ) , then mixed w i t h 5-10 ug o f u n l a b e l l e d DNA ( c u t w i t h the same enzyme) i n 10% s u c r a s ^ a , ^ ^ mM EDTA, 0.02% (w/v) XC and BB. B.8. R e s t r i c t i o n enzyme mapping o f r e c o m b i n a n t p l a s m i d s The r e c o m b i n a n t p l a s m i d s used i n the work p r e s e n t e d here c o n t a i n H i n d l H fragments from D. m e l a n o g a s t e r genomic DNA i n s e r t e d i n t o t h e s i n g l e H i n d l H s i t e o f the p l a s m i d v e c t o r pBR 322 ( 1 1 4 ) . R e s t r i c t i o n s i t e s i n t h e p l a s m i d DNA a r e known, as t h e complete n u c l e o t i d e sequence o f pBR 322 has - 52 -been d e t e r m i n e d ( 1 4 8 ) . The unique a r r a y o f r e s t r i c t i o n s i t e s i n t h e i n s e r t DNA was d e t e r m i n e d as f o l l o w s . R e s t r i c t i o n mapping i n v o l v e d two s t e p s . F i r s t , a number o f d i f f e r e n t r e s t r i c t i o n enzymes r e c o g n i z i n g h e x a n u c l e o t i d e sequences were used t o d i g e s t r e c o m b i n a n t p l a s m i d s . The r e s u l t i n g f ragments ( o r uncut p l a s m i d ) were s e p a r a t e d a c c o r d i n g t o s i z e by a g a r o s e g el e l e c t r o -p h o r e s i s , and t h e i r s i z e s d e t e r m i n e d r e l a t i v e t o DNA fragments o f known s i z e r u n on the same gel ( s e e S e c t i o n B.7., a b o v e ) . S i n c e t h e l o c a t i o n s o f r e s t r i c -t i o n s i t e s i n pBR 322 DNA were known, enzymes c u t t i n g i n t h e i n s e r t were i d e n t i f i e d , and i n some c a s e s c l e a v a g e s i t e s c o u l d be p r e c i s e l y l o c a t e d i n t h e i n s e r t , a t t h i s s t a g e . Second, c o m b i n a t i o n s o f two enzymes found t o c u t i n t h e i n s e r t were used t o d i g e s t r e c o m b i n a n t p l a s m i d DNA, t h e d i g e s t i o n p r o d u c t s s e p a r a t e d by a g a r o s e g el e l e c t r o p h o r e s i s , and fragment s i z e s d e t e r m i n e d as above. The s i z e s o f a l l fragments seen on a g a r o s e g e l s were summed i n each c a s e t o e n s u r e a g a i n s t m i s s i n g one o f two fragments t h a t c o - m i g r a t e on the g e l s . ' S e r B.9. I d e n t i f i c a t i o n o f DNA fragments c o n t a i n i n g tRNA seq u e n c e s . S o u t h e r n  b l o t t i n g e x p e r i m e n t s (150) 32 S e r B.9.a. P r e p a r a t i o n o f [ 3 1 - P]tRNA 7 as a h y b r i d i z a t i o n probe P u r i f i e d t R N A ^ e r was 3'-end l a b e l l e d w i t h *pCp and RNA l i g a s e 32 S e r as d e s c r i b e d i n s e c t i o n A.3 o f t h i s c h a p t e r . [ PjtRNAy was s e p a r a t e d from *pCp, [ y - 3 2 P ] A T P , and N a 2 H 3 2 P 0 4 i n t h e l a b e l l i n g r e a c t i o n mix by Sephadex G-25 column chromatography. The sample was e l u t e d from the column (13 cm x 0.7<:cm) i n 2 x'SSC (0.30 M N a C l , 0.03 M sodium c i t r a t e ) , c o l l e c t i n g 32 5 drop f r a c t i o n s m a n u a l l y i n 1.9 ml p o l y p r o p y l e n e t u b e s . The P - l a b e l l e d - 53 -tRNA and s t a r t i n g m a t e r i a l s were l o c a t e d by m o n i t o r i n g each f r a c t i o n w i t h a 32 G e i g e r c o u n t e r . [ P] tRNA s e p a r a t e d c l e a n l y from r a d i o l a b e l e d s t a r t i n g m a t e r i a l s i n t h i s way. Depending on the s p e c i f i c r a d i o a c t i v i t y o f *pCp, up t o 6 x 10 Cerenkov cpm (30-40% o f i n p u t c o u n t s ) were r e c o v e r e d i n t h e f i r s t (tRNA) peak o f r a d i o a c t i v i t y . B.9.b. S o u t h e r n b l o t s from a g a r o s e g e l s DNA fragments were d i g e s t e d w i t h r e s t r i c t i o n enzymes and s e p a r a t e d a c c o r d i n g t o s i z e by a g a r o s e g e l e l e c t r o p h o r e s i s , then d e n a t u r e d , t r a n -32 S e r s f e r r e d t o a n i t r o c e l l u l o s e membrane and h y b r i d i z e d w i t h a [ P]tRNA^ probe, i n a p r o c e d u r e based on t h a t o f S o u t h e r n ( 1 5 0 ) . The s e c t i o n o f the a g a r o s e g e l c o n t a i n i n g t h e o r i g i n and DNA fragments was e x c i s e d w i t h a s c a l p e l and t r a n s f e r r e d from t he g e l t r a y t o a g l a s s t r a y . DNA i n t h e gel was de-n a t u r e d by immersing the gel i n 0.5 M NaOH, 1.5 M NaCl f o r 5 min. a t room t e m p e r a t u r e . The NaOH/NaCl was removed and r e p l a c e d w i t h 3 M N a C l , 0.5 M T r i s HCl (pH 7.0) t o n e u t r a l i z e r e m a i n i n g NaOH (10 min. a t room t e m p e r a t u r e ) . The g e l was p l a c e d on t h r e e l a y e r s o f Whatman 3MM f i l t e r paper ( t h o r o u g h l y w e t t e d w i t h 3M N a C l , 0.5 M T r i s HCl (pH 7.0), then c o v e r e d w i t h a s t r i p o f n i t r o c e l l u l o s e membrane ( c u t t o t h e d i m e n s i o n s o f t h e gel s e c t i o n ) t h a t had been u n i f o r m l y w e t t e d i n the same b u f f e r . S p e c i a l c a r e was taken a t t h i s s t e p t o e n s u r e t h a t no a i r b u b b l e s were t r a p p e d between the n i t r o -c e l l u l o s e s t r i p and the g e l . The n i t r o c e l l u l o s e s t r i p was c o v e r e d f i r s t w i t h two l a y e r s o f Whatman 3MM p a p e r , then w i t h a b s o r b e n t paper t o w e l s . A g l a s s p l a t e was p l a c e d on top o f the assembly ( t o m a i n t a i n good c o n t a c t t h r o u g h o u t f o r e f f i c i e n t w i c k i n g ) and the edges were c o v e r e d c l o s e l y w i t h - 54 -p o l y v i n y l c h l o r i d e f i l m t o m i n i m i z e e v a p o r a t i o n . T r a n s f e r was f o r 4 h r . 32 a t room t e m p e r a t u r e . As m o n i t o r e d by [ P] s i z e s t a n d a r d s p r e s e n t i n some g e l s , t r a n s f e r e f f i c i e n c y was a t l e a s t 90%. T r a n s f e r r e d DNA was c r o s s -l i n k e d t o the n i t r o c e l l u l o s e membrane s t r i p by b a k i n g f o r 2 h r . a t 80° (on a g l a s s p l a t e t o p r e v e n t c u r l i n g ) . F o r h y b r i d i z a t i o n s , the n i t r o c e l l u l o s e 32 S e r s t r i p w i t h bound DNA was w e t t e d on the g l a s s p l a t e w i t h [ P] tRNA 7 ( a t 2 l e a s t 4000 Cerenkov cpm/cm o f membrane) d i l u t e d w i t h 2 x SSC. The membrane s t r i p was c o v e r e d w i t h m y l a r f i l m , a second g l a s s p l a t e , t h e assembly t i g h t l y wrapped w i t h p o l y v i n y l c h l o r i d e f i l m and clamped t o g e t h e r . H y b r i d i z a t i o n was a t 65° f o r 6 h r . F o l l o w i n g h y b r i d i z a t i o n , t h e n i t r o c e l l u l o s e s t r i p was washed 4-5 t i m e s i n 2 x SSC t o lower r a d i o a c t i v e b ackground, d r i e d on 32 S e r a g l a s s p l a t e , and DNA bands h y b r i d i z i n g [ P] tRNA 7 l o c a t e d by a u t o r a d i o g r a p h y (2-4 d a y s ) . B.9.c. S o u t h e r n b l o t s from p o l y a c r y l a m i d e g e l s R e s t r i c t i o n fragments were s e p a r a t e d a c c o r d i n g t o s i z e on non-d e n a t u r i n g p o l y a c r y l a m i d e g e l s ( s e c t i o n B . 3 . ) . DNA i n t h e g e l , on a b a c k i n g g l a s s p l a t e , was d e n a t u r e d and n e u t r a l i z e d as f o r a g a r o s e g e l s ( a b o v e ) . T r a n s f e r o f DNA t o n i t r o c e l l u l o s e was a c c o m p l i s h e d as f o l l o w s . A n i t r o -c e l l u l o s e s h e e t ( c u t t o t h e d i m e n s i o n s o f the g e l ) was p l a c e d on the neu-t r a l i z e d p o l y a c r y l a m i d e gel ( a v o i d i n g t r a p p i n g a i r b u b b l e s ) , t h e n removed from the g l a s s b a c k i n g p l a t e ( t o g e t h e r w i t h the t i g h t l y a d h e r i n g g e l ) by i n v e r t i n g the g l a s s p l a t e and p e e l i n g o f f t h e n i t r o c e l l u l o s e s h e e t and g e l . The g e l , now on t o p , was c o v e r e d w i t h t h r e e l a y e r s o f Whatman 3MM paper ( t h o r o u g h l y w e t t e d i n 3M N a C l , 0.5 M T r i s H C l , pH 7.0), then i n v e r t e d - 55 -a g a i n so t h a t the n i t r o c e l l u l o s e s t r i p was a g a i n on t o p . T h r e e l a y e r s o f d r y Whatman 3MM paper were p l a c e d on top t o a b s o r b l i q u i d . The e n t i r e assembly was c l o s e l y c o v e r e d w i t h p o l y v i n y l c h l o r i d e f i l m , t hen a g l a s s p l a t e and l e a d w e i g h t s were p l a c e d on top t o m a i n t a i n good c o n t a c t t h r o u g h o u t f o r u n i f o r m , e f f i c i e n t t r a n s f e r . T r a n s f e r was f o r 16 h r . a t room t e m p e r a t u r e . 32 As m o n i t o r e d by [ P] DNA s i z e s t a n d a r d s i n c l u d e d i n t h e g e l , t r a n s f e r was 32 S e r e s s e n t i a l l y q u a n t i t a t i v e . F i l t e r s were baked, h y b r i d i z e d w i t h [ P] tRNA^ , washed, and h y b r i d i z i n g DNA bands l o c a t e d by a u t o r a d i o g r a p h y as f o r a g a r o s e g e l t r a n s f e r s ( a b o v e ) . B.10. Mapping o f s i n g l e - e n d l a b e l l e d DNA fragments by p a r t i a l d i g e s t i o n w i t h  r e s t r i c t i o n enzymes - S m i t h / B i r n s t i e l mapping R e s t r i c t i o n mapping o f s i n g l e - e n d l a b e l l e d DNA fragments was p e r -formed e s s e n t i a l l y as d e s c r i b e d by Smith and B i r n s t i e l ( 1 5 1 ) . A s i n g l e -32 end l a b e l l e d [ P] DNA fragment was p r e p a r e d by s p e c i f i c a l l y l a b e l l i n g one 32 3'-end w i t h an [a- P] dNTP and the l a r g e fragment o f E. c o l i DNA polymerase I ( s e c t i o n B.6., a b o v e ) . A l i q u o t s o f t h e p u r i f i e d , s i n g l e - e n d l a b e l l e d DNA fragment were p a r t i a l l y d i g e s t e d w i t h a number o f r e s t r i c t i o n enzymes. 32 Each d i g e s t i o n r e a c t i o n (20 y l ) c o n t a i n e d [ P] DNA ( a t l e a s t 20,000 Cerenkov cpm), 1 yg o f s h e a r e d c a l f thymus DNA as c a r r i e r , 100 yg/ml b o v i n e serum a l b u m i n , and r e s t r i c t i o n b u f f e r ( s e e " D i g e s t i o n w i t h r e s t r i c t i o n enzymes," a b o v e ) . R e s t r i c t i o n enzyme ( a b o u t 4 u n i t s , s u f f i c i e n t t o d i g e s t 1 yg o f DNA i n 15 min.) was added t o s t a r t t he r e a c t i o n , and 5 y l a l i q u o t s were removed a t 2, 4, 8, and 12 min. and added t o 1 y l o f 200 mM EDTA (pH 4.7) i n a p o l y p r o p y l e n e tube c h i l l e d on s o l i d c a r b o n d i o x i d e . ( T h i s amount o f +2 EDTA i s i n 1 . 7 - f o l d molar e x c e s s o v e r Mg i n the r e a c t i o n mix.) The - 56 -p o o l e d , f r o z e n sample was d r i e d o v e r P^O^ i n a d e s s i c a t o r under a s p i r a t o r vacuum, r e d i s s o l v e d i n 20% (w/v) s u c r o s e , 5 mM EDTA, 0.04% (W/v) XC and BB (10 y l p e r gel s l o t t o be r u n ) , and e l e c t r o p h o r e s e d on a n o n - d e n a t u r i n g p o l y a c r y l a m i d e g e l . R a d i o l a b e l e d r e s t r i c t i o n f ragments were l o c a t e d by a u t o -r a d i o g r a p h y . The d i s t a n c e s o f v a r i o u s r e s t r i c t i o n s i t e s from t h e r a d i o -32 l a b e l l e d end were d e t e r m i n e d by r e f e r e n c e t o t h e m o b i l i t i e s o f P - l a b e l l e d DNA fragments o f known s i z e run on the same gel ( s e e s e c t i o n B.7., a b o v e ) . B . l l . Sequence a n a l y s i s by t h e method o f Maxam and G i l b e r t (132) Samples o f s i n g l e - e n d l a b e l l e d DNA fragments ( t h a t were o b t a i n e d 32 from about 20 yg p l a s m i d , and c o n t a i n e d a t l e a s t 50,000 Cerenkov P-cpm i n 30 y l H^O) were sequenced by the c h e m i c a l m o d i f i c a t i o n method o f Maxam and G i l b e r t ( 1 3 2 ) . The p r o t o c o l used i n our l a b i s c l o s e l y r e l a t e d t o t h e one d e s c r i b e d by t h o s e a u t h o r s (an e x c e l l e n t d e s c r i p t i o n o f the method i s found i n r e f . 152, t o which t he r e a d e r i s d i r e c t e d f o r d e t a i l e d i n f o r m a t i o n ) . Four m o d i f i c a t i o n r e a c t i o n s were used, s p e c i f i c f o r G, A+G, C+T, o r C. R e a c t i o n s were c a r r i e d o u t i n c o n i c a l 1.9 ml p o l y p r o p y l e n e tubes w i t h t i g h t l y c l o s i n g c a p s . Modification of G with dimethylsulfate (DMS) The p r o c e d u r e was c a r r i e d o u t i n a fume hood. The r e a c t i o n mix 32 c o n t a i n e d o n e - s i x t h o f t h e [ P] DNA sample, 1 yg c a l f thymus DNA, 50 mM sodium c a c o d y l a t e (pH 8.0), 10 mM M g C l 2 , and 1 mM EDTA (200 y l ; room tempera-t u r e ) . The r e a c t i o n (3 min. a t room t e m p e r a t u r e ) was s t a r t e d by a d d i n g 2 y l o f DMS w i t h a p i p e t t o r ( d i s p o s a b l e t i p s ) . I t was s t o p p e d by a d d i n g - 57 -50 y l o f " s t o p mix" (1.5 M sodium a c e t a t e , pH 7.0, 1 M 2 - m e r c a p t o e t h a n o l , 100 yg/ml E. c o l i tRNA; 0°) then 750 y l 95% e t h a n o l (-70°; c h i l l e d 30-60 min. on s o l i d CO^) and mixed by i n v e r t i n g f o u r t i m e s . A f t e r s t o r i n g f o r 20-30 min. a t -70° on s o l i d CO^, the DNA sample was c o l l e c t e d by c e n t r i f u g a -t i o n (4 min. a t room t e m p e r a t u r e , E p p e n d o r f t a b l e - t o p c e n t r i f u g e ) . The s u p e r n a n t a n t l i q u i d was c a r e f u l l y removed w i t h a P a s t e u r p i p e t , and mixed w i t h 5M NaOH to d e s t r o y the DMS. P i p e t t o r t i p s c o n t a m i n a t e d w i t h DMS were t r e a t e d i n the same way. The p e l l e t was d i s s o l v e d i n 200 y l o f 0.3 M sodium a c e t a t e by a g i t a t i n g i t v i g o r o u s l y on a V o r t e x m i x e r , then the DNA was p r e -c i p i t a t e d w i t h 500 y l 95% e t h a n o l (-70?) and c o l l e c t e d by c e n t r i f u g a t i o n as d e s c r i b e d above. The s u p e r n a t a n t l i q u i d was d i s c a r d e d w i t h o u t s p e c i a l p r e c a u t i o n . The p e l l e t was f i n a l l y washed w i t h 500 y l 95% e t h a n o l (-70°), c e n t r i f u g i n g and d i s c a r d i n g the s u p e r n a t a n t l i q u i d as i n the p r e v i o u s s t e p . The p e l l e t was then d r i e d i n a d e s s i c a t o r f o r 5-10 min. under a s p i r a t o r vacuum. S t r a n d s c i s s i o n o f m o d i f i e d DNA was a c c o m p l i s h e d by d i s s o l v i n g the p e l l e t i n 100 y l o f 10% p i p e r i d i n e ( f r e s h l y d i l u t e d ) and h e a t i n g f o r 40 min. a t 90° i n the t i g h t l y c l o s e d 1.9 ml t u b e . A f t e r t h i s s t e p , the tubes were c o o l e d and c o n d e n s a t e c o l l e c t e d by c e n t r i f u g i n g b r i e f l y (1 s e c , E p p e n d o r f ) . The samples were d r i e d o v e r n i g h t from the open tubes i n a d e s s i c a t o r c o n t a i n i n g ?2®5 a n c' d r i e d m o l e c u l a r s i e v e s , under a s p i r a t o r vacuum. Samples were then d i s s o l v e d i n 25 y l H^0 and d r i e d i n an oven (45°) w i t h f o r c e d a i r c i r c u l a t i o n . T h i s p r o c e d u r e was r e p e a t e d t h r e e t i m e s . ( A t t h i s p o i n t , t h e r e s h o u l d be no r e s i d u a l s m e l l o f p i p e r i d i n e . ) F i n a l l y , samples were d i s s o l v e d i n 45 mM T r i s - b o r a t e (pH 8.3), 1.25 mM EDTA, 7M u r e a , 0.05% XC and BB (5 y l p e r s e q u e n c i n g g e l t o be r u n ) , h e a t e d 1 min. a t 1 0 0 ° , c h i l l e d on i c e , then a p p l i e d ( w i t h a c a l i b r a t e d , drawn-out c a p i l l a r y tube) t o t h i n , d e n a t u r i n g p o l y a c r y l a m i d e g e l s ( r e f . 135; - 58 -p r e p a r e d as d e s c r i b e d i n s e c t i o n A.7. above) and e l e c t r o p h o r e s e d . G e l s were run a t c o n s t a n t power (20 w a t t s ) u n t i l x y l e n e c y a n o l had m i g r a t e d 40% t h e l e n g t h o f a 20% g e l , 110% the l e n g t h o f a 12% g e l , 135-150% t h e l e n g t h o f an 8% g e l , o r 100-150% t h e l e n g t h o f a 6% g e l . Gel bands were l o c a t e d by a u t o r a d i o g r a p h y ( s e e f i g u r e l e g e n d s i n C h a p t e r IV f o r s p e c i f i c 32 d e t a i l s r e g a r d i n g P-cpm l o a d e d p e r s l o t and ti m e o f a u t o r a d i o g r a p h i c o e x p o s u r e i n i n d i v i d u a l e x p e r i m e n t s ) . The A+G reaction: depurination in fovmio acid The r e a c t i o n mix (20 y l ) c o n t a i n e d o n e - t h i r d o f the [ P]DNA sample and 1 yg o f c a l f thymus DNA, a t room t e m p e r a t u r e . The r e a c t i o n was s t a r t e d by a d d i n g 3 y l o f 10% f o r m i c a c i d (0°) and p l a c i n g the 1.9 ml tube i n a wa t e r b a t h a t 3 7 ° . A f t e r 13 min. a t 3 7 ° , t h e r e a c t i o n was s t o p p e d by a d d i n g 230 y l o f " s t o p mix" (0.3M sodium a c e t a t e , 0.1 mM EDTA, 20 yg/ml E . / c o l i tRNA; 0 ° ) , t h e n 750 y l 95% e t h a n o l (-70°), and mixed by i n v e r t i n g f o u r t i m e s . E t h a n o l p r e c i p i t a t i o n s and a l l s u b s e q u e n t s t e p s were per f o r m e d as d e s c r i b e d f o r t h e G r e a c t i o n , above. Modification of C+T with hydrazine The p r o c e d u r e was perf o r m e d i n a fume hood. To the r e a c t i o n mix 32 (20 y l , a t room t e m p e r a t u r e ) , c o n t a i n i n g o n e - t h i r d o f the [ P]DNA sample and 1 yg c a l f thymus DNA, was added 30 y l o f h y d r a z i n e (room t e m p e r a t u r e ) . A f t e r 10 min. a t room t e m p e r a t u r e , the r e a c t i o n was st o p p e d by a d d i n g 200 y T , o f ".s;to.pr.mix" (0.3M sodium a c e t a t e , 0.1 mM EDTA, 20 y g / m l E. c o l i tRNA; 0 ° ) , then 750 y l 95% e t h a n o l (-70°) and m i x i n g by i n v e r t i n g - 59 -f o u r t i m e s . ( A f t e r c e n t r i f u g a t i o n , the s u p e r n a t a n t l i q u i d , as w e l l as any p i p e t t o r t i p s c o n t a m i n a t e d w i t h h y d r a z i n e , was d i s c a r d e d i n t o 2M F e C l ^ . E t h a n o l p r e c i p i t a t i o n s and a l l s u b s e q u e n t s t e p s were o t h e r w i s e the same as d e s c r i b e d above f o r the G r e a c t i o n ) . Modification of C with hydrazine The p r o c e d u r e was s i m i l a r t o t h a t j u s t d e s c r i b e d but a t a h i g h NaCl c o n c e n t r a t i o n . To the r e a c t i o n mix ( 2 0 . p l , a t room t e m p e r a t u r e ) con-32 t a i n i n g o n e - s i x t h o f the [ P] DNA sample, 1 yg c a l f thymus DNA, and 3.75 M Na C l , was added 30 y l o f h y d r a z i n e (room t e m p e r a t u r e ) . A f t e r 14 min. a t room t e m p e r a t u r e , t h e r e a c t i o n was t e r m i n a t e d by a d d i n g 200 y l " s t o p mix." Then 750 y l 95% e t h a n o l (-70°) was added and mixed by i n v e r t i n g t h e tube f o u r t i m e s . The p r o d u c t was c o l l e c t e d by c e n t r i f u g a t i o n and t r e a t e d as d e s c r i b e d above. By the p r o c e d u r e d e s c r i b e d , i t was p o s s i b l e t o o b t a i n a c o n t i n u o u s sequence o f up to 240 n u c l e o t i d e s on the l a b e l l e d DNA s t r a n d . - 60 -Chap t e r I I I S E Q U E N C E A N A L Y S I S OF S E R I N E TRNAS I N D R O S O P H I L A A. I n t r o d u c t i o n The s t a n d a r d g e n e t i c code c o n t a i n s s i x codons t h a t a r e t r a n s l a t e d t o s e r i n e i n • p o l y p e p t i d e s (UCN, AGC, and AGU). One might e x p e c t a f a m i l y o f s e r i n e i s o a c c e p t o r tRNAs t o be complex r e l a t i v e t o o t h e r i s o a c c e p t o r f a m i l i e s r e a d i n g fewer codons. C e r t a i n l y t h i s i s t r u e i n D r o s o p h i l a S e r m e l a n o g a s t e r , where t h e r e a r e f i v e major and two minor tRNA s p e c i e s , making t h i s i s o a c c e p t o r f a m i l y more complex than a l l b ut one o r two o t h e r s i n t h e o r g a n i s m . ( 9 1 ) . S e r i n e tRNAs i n D r o s o p h i l a m e l a n o g a s t e r were the s u b j e c t o f a st u d y by White et_ al_. (102) i n which s e v e r a l i s o a c c e p t o r s were p u r i f i e d and t h e i r n u c l e o t i d e c o n t e n t s and c o d i n g s p e c i f i c i t i e s examined. These workers r e p o r t e d t h a t t h e f i v e major t R N A ^ e r s p e c i e s c o u l d be d i v i d e d i n t o two groups based on s i m i l a r n u c l e o t i d e c o n t e n t . The f i r s t group c o n s i s t e d o f t R N A 2 e r and t R N A g e r . These tRNAs were found t o c o n t a i n t 6 A o r mt 6A and t o r e s p o n d t o AGC and AGU t r i p l e t s i n r i b o s o m e - b i n d i n g a s s a y s . However, t R N A ^ e r and tRNA^ 1", which c o n t a i n i 6 A r a t h e r than t 6 A o r i t s d e r i v a t i v e s , r e s ponded t o UCG and UCU t r i p l e t s , r e s p e c t i v e l y . Though the c o d i n g p r o p e r t i e s S 6 V o f tRNAg ( t h e o t h e r major s e r i n e i s o a c c e p t o r ) were not d e t e r m i n e d , i t s n u c l e o t i d e c o n t e n t ( i n c l u d i n g i A) was found t o be v e r y s i m i l a r t o t h o s e o f - 61 -t R N A 4 e r and t R N A y e r ; t h u s , i t a l s o p r o b a b l y r e a d s codons o f t h e UCN group. The two groups o f s e r i n e tRNAs a r e a p p a r e n t l y s t r u c t u r a l l y d i s t i n c t , though f u n c t i o n a l l y i d e n t i c a l e x c e p t f o r codon s p e c i f i c i t i e s . Genes f o r a p u r i f i e d D r o s o p h i l a i s o a c c e p t o r tRNA can be l o c a l i z e d on p o l y t e n e chromosomes from s a l i v a r y g l a n d s o f the i n s e c t by h y b r i d i z a t i o n o f t he tRNA i n s i t u ( s e e C h a p t e r I , s e c t i o n D.2.a.). The ba n d i n g p a t t e r n s o f such chromosomes a r e known, and a c o m p o s i t e p h o t o g r a p h i c map has been assembled ( 1 5 3 ) . The c y t o g e n e t i c map has been c o r r e l a t e d w i t h t he g e n e t i c map o f D r o s o p h i l a , e s t a b l i s h e d by a n a l y s i s o f r e c o m b i n a t i o n f r e q u e n c i e s , i n many c a s e s ( 1 5 4 ) . Genes f o r t R N A ^ r ( 1 5 5 ) , tRNA^ 6 1", and t R N A y 6 r (109) have been Ser l o c a l i z e d by i n s i t u h y b r i d i z a t i o n . Genes f o r tRNAg^ a r e found a t s e v e r a l r e g i o n s o f chromosome 3: 86A, 88A9-12, and 94A6-8 ( 1 5 5 ) . These r e g i o n s a r e a l l d i s t i n c t from the h y b r i d i z a t i o n s i t e s f o r t R N A 4 e r and t R N A y 6 r . The " l a t t e r two tRNAs both h y b r i d i z e t o a major s i t e a t 12DE on t h e X chromoxome, and t o minor s i t e s a t 23E on the l e f t arm o f chromosome 2 ( 2 L ) , 56D on chromosome 2R, and 64D on chromosome 3L. They a r e i n d i s t i n g u i s h a b l e by RNA-DNA h y b r i d i z a t i o n i n s i t u , as e i t h e r tRNA competes w i t h t h e o t h e r f o r h y b r i d i z a t i o n (109,155). These o b s e r v a t i o n s r a i s e d c e r t a i n q u e s t i o n s r e g a r d i n g t R N A 4 e r , Ser tRNA 7 , and the genes c o d i n g f o r t h e s e i s o a c c e p t o r s , most n o t a b l y : do t h e two i s o a c c e p t o r s a r i s e from the same genes and d i f f e r o n l y i n e x t e n t o f m o d i f i c a t i o n ; o r do t h e y a r i s e from s i m i l a r b ut d i s t i n c t genes? I t was t o answer t h i s i n i t i a l q u e s t i o n t h a t sequence a n a l y s i s o f t R N A ^ e r and t R N A ^ e r was u n d e r t a k e n . - 62 -O t h e r r e a s o n s f o r a n a l y z i n g the sequences o f s e r i n e tRNAs from D r o s o p h i l a can be e n v i s a g e d . By comparing sequences o f s e v e r a l i s o a c c e p t o r s p e c i e s , we m i ght g a i n some i n s i g h t s i n t o how tRNA genes e v o l v e . A l s o , - b y sequence comparison o f r e l a t e d tRNAs i t m ight be p o s s i b l e i n some c a s e s t o i d e n t i f y s t r u c t u r a l f e a t u r e s r e c o g n i z e d ' by the c o g n a t e aminoacyl-tRNA s y n t h e -t a s e . An i m p o r t a n t c o n s i d e r a t i o n i n u n d e r t a k i n g t h i s a n a l y s i s was t o e s t a b l i s h a w e l l - c h a r a c t e r i z e d system f o r s t u d y i n g tRNA gene e x p r e s s i o n . T r a n s f e r RNAs i n t e r a c t w i t h many c e l l c o n s t i t u e n t s . Such i n t e r a c t i o n s p o t e n t i a l l y can be s t u d i e d g e n e t i c a l l y , and D r o s o p h i l a m e l a n o g a s t e r i s one o f a v e r y few m u l t i c e l l u l a r o r g a n i s m s amenable to both e x t e n s i v e g e n e t i c and b i o c h e m i c a l a n a l y s i s a t t h i s t i m e . As a model tRNA system, s e r i n e tRNAs have c e r t a i n d e s i r a b l e f e a t u r e s . F o r example, nonsense s u p p r e s s o r tRNAs can be g e n e r a t e d by a s i n g l e base change i n s t r u c t u r a l genes f o r tRNAs r e s p o n d i n g t o UCN codons. A l s o , i t may prove p o s s i b l e t o i s o l a t e mutant D r o s o p h i l a d e f e c t i v e f o r tRNA m o d i f y i n g enzymes. An enzyme t h a t i n t r o d u c e d a d i s t i n c t i v e m o d i f i c a t i o n i n t o o n l y a few tRNA s p e c i e s - f o r example, the enzymes i n v o l v e d i n s y n t h e s i s o f 4 - a c e t y l c y t i d i n e , 3 - m e t h y l c y t i d i n e , o r 6 - i s o p e n t e n y l a d e n o s i n e ( m o d i f i c a t i o n s f o u n d i n y e a s t , D r o s o p h i l a , and r a t l i v e r s e r i n e tRNAs) - would be e a s i e r t o i d e n t i f y than an enzyme m o d i f y i n g many tRNAs. In any c a s e , i d e n t i f i c a t i o n o f such mutant enzymes would r e q u i r e t h a t t h e sequence o f the r e l e v a n t w i l d t y p e tRNA be known, i n c l u d i n g m o d i f i c a -Spy* SPK* t i o n s . F i n a l l y , tRNA^ and tRNA 7 were o f i n t e r e s t t o us because the major s i t e o f i n s i t u h y b r i d i z a t i o n i s a t 12DE on t h e X chromosome. Genes f o r a b o u t 25 p u r i f i e d D. m e l a n g o a s t e r tRNAs have been l o c a l i z e d . Of t h e s e tRNAs, o n l y t R N A s ^ h y b r i d i z e r e l i a b l y t o a s i t e on the X chromosome. - 63 -(Under some h y b r i d i z a t i o n c o n d i t i o n s , t R N A g y s a l s o goes t o the 12DE r e g i o n . ) I s o l a t i o n o f mutants d e f i c i e n t f o r p a r t s o f the 12DE r e g i o n seems t o be a p o s s i b l e a p p roach t o s t u d y i n g i n v i v o e x p r e s s i o n o f tRNA genes. T h i s a p p r o a c h has been used p r e v i o u s l y t o s t u d y tRNA^ a- genes on chromosome 3 ( 1 1 3 ) . In p r i n c i p l e , i s o l a t i o n o f X - l i n k e d m u t a t i o n s i s an e a s i e r t a s k . Dunn e t al_. r e p o r t e d the i s o l a t i o n o f f i v e d i s t i n c t r e c o m b i n a n t p l a s m i d s h y b r i d i z i n g t R N A s ^ f , ( 1 1 4 ) . Four o f the p l a s m i d s ( p D t l 6 , 17R, pDt 27R, and pDt 73) d e r i v e from-the 12DE r e g i o n w h i l e t h e f i f t h p l a s m i d (pDt 1, pDt 5, and pDt 81 c o n t a i n t he same i n s e r t ) i s from 23E on chromosome 2L (114,155,156). S t u d i e s on e x p r e s s i o n o f tRNA genes from sex chromosomes and autosomes would be o f i n t e r e s t . Male f l i e s c o n t a i n one f u n c t i o n a l X chromosome and f e m a l e s two X chromosomes, s i n c e t h e r e i s no B a r r body forma-t i o n i n D r o s o p h i l a as i s found i n mammals. Thus, i t may be t h a t e x p r e s s i o n Ser o f X - l i n k e d and autosomal tRNA genes i s c o n t r o l l e d d i f f e r e n t l y . P r e -Ser l i m i n a r y t o s t u d i e s on e x p r e s s i o n o f tRNA genes i n r e c o m b i n a n t p l a s m i d s , c h a r a c t e r i z a t i o n o f t h e genes as w e l l as o f the tRNA p r o d u c t s would be needed. S e r i n e tRNAs and t h e i r genes i n D r o s o p h i l a m e l a n o g a s t e r c o n s t i t u t e a system t h a t c o u l d p r o ve u s e f u l i n a wide v a r i e t y o f g e n e t i c , m o l e c u l a r b i o l o g i c a l , and b i o c h e m i c a l s t u d i e s . T h i s t h e s i s p r e s e n t s i n i t i a l c h a r a c -t e r i z a t i o n o f t h i s system. The sequences o f t R N A 4 e r , t R N A y 6 r , and t R N A ^ r have been d e t e r m i n e d ; t he sequence a n a l y s e s a r e p r e s e n t e d here i n C h a p t e r I I I . In C h a p t e r IV I p r e s e n t d a t a c o n c e r n i n g t he s t r u c t u r e s and o r g a n i z a t i o n o f tRNA genes l o c a t e d on the X chromosome o f D r o s o p h i l a m e l a n o g a s t e r . - 64 -B. R e s u l t s The n u c l e o t i d e sequences o f s e r i n e tRNAs from D r o s o p h i l a m e l a n o g a s t e r were d e t e r m i n e d by a c o m b i n a t i o n o f r a p i d s e q u e n c i n g t e c h n i q u e s . The s t r a t e g y employed c o n s i s t e d o f t h r e e s t e p s . ( i ) The n u c l e o t i d e c o n t e n t o f the tRNA was a n a l y z e d . ( i i ) The n u c l e o t i d e sequence was a n a l y z e d by the method o f S t a n l e y and V a s s i l e n k o . N u c l e o t i d e s were a n a l y z e d by t h i n l a y e r 32 chromatography as [ 5 1 - P] n u c l e o s i d e 5', 3 ' - b i s p h o s p h a t e s (*pNp's), and where t h e r e was r e a s o n t o b e l i e v e t he base 32 was m o d i f i e d , as n u c l e o s i d e [ 5 1 - P] phosphates (*pN's) i n two s o l v e n t systems. ( i i i ) The n u c l e o t i d e sequences o f t e r m i n a l l y r a d i o l a b e l e d tRNAs o r o l i g o n u c l e o t i d e s were a n a l y z e d by the g e l r e a d r o f f method. In e v e r y c a s e , both 5'- and 3'-end. l a b e l l e d tRNAs were a n a l y z e d . In some c a s e s , the above a n a l y s e s were supplemented by two d i m e n s i o n a l "wandering s p o t " a n a l y s i s o f e n d - l a b e l l e d RNAs. By such c o m b i n a t i o n s o f methods, d i r e c t i n f o r m a t i o n on e v e r y n u c l e o t i d e i n each tRNA sequence was o b t a i n e d . Each o f t h e methods l i s t e d above i s d e s c r i b e d i n S e c t i o n A o f C h a p t e r I I . The sequence a n a l y s i s o f each t R N A ^ e r i s d e s c r i b e d s e p a r a t e l y . A n a l y s i s o f tRNAy i s p r e s e n t e d f i r s t , i n c o n s i d e r a b l e d e t a i l . A n a l y s e s o f tRNA 4 : and tRNA 2k were s i m i l a r , and a r e t h e r e f o r e d i s c u s s e d l e s s e x t e n s i v e l y . - 65 -B.1. Sequence a n a l y s i s o f D. m e l a n o g a s t e r tRNA-, ; E v e r y n u c l e o t i d e o f the tRNA, sequence c o u l d be i d e n t i f i e d p r i m a r i l y on the b a s i s o f d i r e c t e v i d e n c e o b t a i n e d f r o m g e l " r e a d - o f f " , "wandering s p o t " , o r S t a n l e y / V a s s i l e n k o e x p e r i m e n t s ( C h a p t e r I I ) . I n t e r -p r e t a t i o n o f sequence d a t a was a t tim e s s t r e n g t h e n e d by i n d i r e c t arguments based on homology w i t h t h e e q u i v a l e n t tRNA i n o t h e r e u k a r y o t e s and on base-p a i r i n g c o n s t r a i n t s . In g e n e r a l , each n u c l e o t i d e o f the sequence was i d e n t i f i e d unambiguously i n i n d e p e n d e n t e x p e r i m e n t s , u s u a l l y by two d i f f e r e n t methods. N u c l e o t i d e a n a l y s i s i n d i c a t e d t h e p r e s e n c e i n tRNAy o f t h e s t a n d a r d n u c l e o t i d e s pA, pG, pC, and pU; and o f the m o d i f i e d n u c l e o t i d e s p i , p G m, p a c 4 C , pT, pip, pD, p U m , pm 5C, pm 3C, and pnvA ( F i g . 4 a ) . N e i t h e r 2 6 S e r prr^G nor p i A was seen, though both were found i n tRNA^ by White e t a l . ( 1 0 2 ) . Both n u c l e o t i d e s were i d e n t i f i e d i n t h e tRNA d u r i n g S t a n l e y / V a s s i l e n k o e x p e r i m e n t s , however. T h e i r absences here a r e a t t r i b u t e d t o poor k i n a s e -fi 7 l a b e l l i n g o f i Ap, and o v e r l a p o f *pm 2G w i t h t h e l a r g e *pA s p o t . The m o d i f i e d 4 n u c l e o t i d e s p i , p G m , pac C and p U m were i d e n t i f i e d by c o - m i g r a t i o n w i t h c o m m e r c i a l l y o b t a i n e d n u c l e o t i d e s t a n d a r d s on two d i m e n s i o n a l t h i n l a y e r chromatography ( C h a p t e r I I , A . 8 . g . ) . O t h e r s were i d e n t i f i e d by t h e i r chroma-t o g r a p h i c m o b i l i t i e s , based on p u b l i s h e d v a l u e s ( 4 2 ) . The r e l a t i v e amounts o f t h e v a r i o u s n u c l e o t i d e s were q u a n t i t a t e d by e l u t i n g t h e r a d i o a c t i v e n u c l e o t i d e s from each s p o t and d e t e r m i n i n g r a d i o a c t i v i t y as Cerenkov cpm. The number o f each n u c l e o t i d e p r e s e n t p e r t R N A ^ e r m o l e c u l e was e s t i m a t e d r e l a t i v e t o pT,which s h o u l d be p r e s e n t once p e r tRNA. The r e s u l t s o f such a n a l y s i s a r e p r e s e n t e d i n T a b l e 1. - 66 -F i g u r e 4 - N u c e l o t i d e a n a l y s i s o f D r o s o p h i l a s e r i n e tRNAs. 32 S e r N u c l e o s i d e [ 5 1 - P] phosphates were p r e p a r e d from (a) tRNA 7 , (b) tRNA^ , and (c) t R N A ^ as d e s c r i b e d i n C h a p t e r I I . Samples o f 3 y l were a p p l i e d t o each t h i n l a y e r p l a t e . A f t e r chromato-graphy the t h i n l a y e r p l a t e s were exposed t o Kodak XR-1 X-ray f i l m f o r (a) 6 h r . , (b) 30 h r . , and (c) 16 h r . - 68 -T a b l e 1 - N u c l e o t i d e c o n t e n t o f s e r i n e tRNAs pG pA PC pU t R N A 7 e r 2 0 . 7 a ( 2 1 ) b 12.5 (13) 17.7 (19) 12.1 (10) t R N A 4 e r 1 6 . 7 a ( 2 2 ) b 9.3 (13) 16.9 (19) 10.7 (10) tRNA S e r 2b 2 4 . 1 a ( 2 2 ) b 16.3 (12) 21.2 (19) 12.5 (11) pm^G pG r a p i 6 A p t 6 A pmt^A pm A p i pm C pac C 5r pm C pU H m pT pD pijj 1.6 (1) (2) 0.39 (1) 1.2 (1) 1.45 (2) 0.68 (1) 0.70 (1) 0.28 (1) =1.00 (1) 1.79 (2) 3.2 (2) 1.2 (1) (2) 0.24 (1) 1.55 (2) 0.69 (1) 1.5 d (1) - (1) =1.00 (1) 2.0 .(,3) 2.6 (2) 0.85 (1) 0.86 (1) 1.85 -N.D. C ( 1 ) C 0.38 (1) 1.55 (2) 0.72 (1) 1 . 2 5 d ( l ) -- (1) =1.00 (1) 0.96 (3) 1.7 (4) a - V a l u e s e x p r e s s e d r e l a t i v e t o pT, which i s g i v e n a v a l u e 1.00. b - V a l u e s i n p a r e n t h e s e s a r e the e x p e c t e d v a l u e s based on the n u c l e o t i d e sequences d e t e r m i n e d . They a r e a d j u s t e d t o r e f l e c t t h e number o f Np's e x p e c t e d on d i g e s t i o n o f t h e tRNAs w i t h r i b o n u c l e a s e T 2 ; t h u s the sum o f t h e s e v a l u e s i s l e s s than 85. 6 6 c - V a l u e n o t d e t e r m i n e d . The sum o f v a l u e s f o r pt A and pmt A s h o u l d be one. 5 d - T h i s v a l u e i s the sum o f pm C and pl> m, which were n o t s e p a r a t e d by chromatography. 1 - 69 -Most o f the tRNA 7 n u c l e o t i d e sequence ( p o s i t i o n s 6-82), i n c l u d i n g m o d i f i e d n u c l e o t i d e s , was d e t e r m i n e d by t h e method o f S t a n l e y and V a s s i l e n k o . The ammonium s u l f a t e s o l v e n t system used t o s e p a r a t e pGp, pAp, pCp, and p U p o n P E I c e l l u l o s e p l a t e s a t times a l l o w e d m o d i f i e d n u c l e o t i d e s t o be d i s -t i n g u i s h e d ( F i g . 5 d ) . F u r t h e r c h a r a c t e r i z a t i o n o f t h e s e n u c l e o t i d e s , o r o f o t h e r s deemed l i k e l y because o f t h e i r l o c a t i o n s i n the tRNA " c l o v e r l e a f " 32 to be m o d i f i e d , was a c c o m p l i s h e d by d i g e s t i n g the same [• P] o l i g o n u c l e o t i d e w i t h n u c l e a s e P-| t o g e n e r a t e the 5 ' - t e r m i n a l *pN. I d e n t i f i c a t i o n o f m o d i f i e d n u c l e o t i d e s as *pN's was g e n e r a l l y s t r a i g h t f o r w a r d , as d e s c r i b e d above f o r n u c l e o t i d e a n a l y s i s . (See F i g u r e s 5 f , 5h.) The e n t i r e n u c l e o t i d e sequence o f tRNA^ was spanned i n gel " r e a d - o f f " a n a l y s e s o f the [ 5 1 - 3 2 P ] t R N A , [ 3 ' - 3 2 P ] t R N A , o r a 5'-end l a b e l l e d 3 ' - h a l f m o l e c u l e ( i n c l u d i n g p o s i t i o n s 36^85) t h a t was f o r t u i t o u s l y r e c o v e r e d i n h i g h y i e l d s from p o l y n u c l e o t i d e k i n a s e l a b e l l i n g r e a c t i o n s . Much o f the . s equence c o u l d be d e t e r m i n e d d i r e c t l y f r o m such e x p e r i m e n t s ( s e e f i g u r e s 6a, 6b, 6c, 6e, 6 g ) . In c o n j u n c t i o n w i t h the r e s u l t s o f S t a n l e y / V a s s i l e n k o e x p e r i m e n t s , n e a r l y a l l o f the t R N A 7 e r sequence was thus d e t e r m i n e d unambiguously. A n a l y s i s o f the 5 ' - t e r m i n a l sequence ( p o s i t i o n s 1-7) by a second method was deemed n e c e s s a r y t o i d e n t i f y a 2'-0-methyl n u c l e o t i d e a t p o s i t i o n 4 shown to be p r e s e n t i n gel " r e a d - o f f " e x p e r i m e n t s . T h e r e f o r e , the sequence o f n u c l e o t i d e s 1-12 was d e t e r m i n e d by t h e "wandering s p o t " method (two d i m e n s i o n a l e l e c t r o p h o r e s i s / h o m o c h r o m a t o g r a p h y ; see C h a p t e r I I ) . The o n l y p o s i t i o n s i n the tRNAy sequence n o t d e t e r m i n e d by two i n d e p e n d e n t methods were the u n i v e r s a l 3 ' - t e r m i n a l CCA. These n u c l e o t i d e s - 70 -S e r S e r F i g u r e 5 - S t a n l e y / V a s s i l e n k o sequence a n a l y s i s o f tRNA^ and tRNA 7 . S e r H y d r o l y s i s o f p u r i f i e d tRNAs and 5'-end l a b e l l i n g were performed as d e s c r i b e d i n C h a p t e r I I . S e c t i o n s (a) and (b) show t h e r e s u l t s o f t h e e l e c t r o -32 Spy SPV^  p h o r e t i c s e p a r a t i o n o f [ P] o l i g o n u c l e o t i d e s from tRNA 7 and tRNA| , r e s p e c t i v e l y , on 20% p o l y a c r y l a m i d e g e l s . S l o t s 1 and 4 c o n t a i n 1.7 yg o f tRNA : J e r and 1.4 yg o f t R N A ^ e r (8 u l / s l o t ) . The l a b e l l i n g r e a c t i o n s c o n -32 t a i n e d 37 uM [y- P]ATP (1300 Ci/mmole). E l e c t r o p h o r e s i s was f o r 48 h r . a t 1000V. A u t o r a d i o g r a p h y was f o r 10 min. u s i n g " n o - s c r e e n " X-ray f i l m . S l o t s 2,3,5, and 6 each c o n t a i n 1.2 yg o f t R N A S e r (1 Q u i / s l o t ) . The l a b e l l i n g 32 r e a c t i o n s c o n t a i n e d 30 yM [y- P]ATP (500 Ci/mmole). E l e c t r o p h o r e s i s was f o r 17 h r . a t 1200V ( s l o t s 2,5) o r 7 h r . a t 1200V ( s l o t s 3.6). A u t o r a d i o -32 graphy was f o r 2.5 h r . u s i n g " n o - s c r e e n " X-ray f i l m . The samples o f [ P] Spy Ser* o l i g o n u c l e o t i d e s from tRNA^ and tRNA-, shown i n s e c t i o n ( c ) were p r e p a r e d as d e s c r i b e d f o r s l o t 1 and 4 ( a b o v e ) , and s e p a r a t e d by e l e c t r o p h o r e s i s f o r 8 h r . a t 1000V. A u t o r a d i o g r a p h y was f o r 11 min. u s i n g " n o - s c r e e n " X - r a y f i l m . S e c t i o n s (d) and (e) show t h e r e s u l t s o f a n a l y s i s o f *pNp's from Spy Spy o l i g o n u c l e o t i d e s d e r i v e d from tRNA 7 and tRNA^ , r e s p e c t i v e l y , as d e s c r i b e d i n C h a p t e r I I . Samples c o n t a i n e d a t l e a s t 150 Cerenkov cpm, and were v i s u a l i z e d by a u t o r a d i o g r a p h y f o r n o t more than f o u r days ( " n o - s c r e e n " X-ray f i l m ) . The r e s u l t s o f c e l l u l o s e t h i n l a y e r chromatography o f *pN's from tRNA^ S e r and tRNA 4 . i n s o l v e n t A a r e shown i n s e c t i o n s ( f ) and ( g ) , r e s p e c t i v e l y . Spy Spy R e s u l t s o f chromatography o f *pN's from tRNA 7 and tRNA^ i n s o l v e n t B a r e shown i n s e c t i o n s (h) and ( i ) , r e s p e c t i v e l y . At l e a s t 250 Cerenkov cpm o f each sample was c h r o m a t o g r a p h e d . A u t o r a d i o g r a p h y was f o r 2 days u s i n g "no-s c r e e n " X-ray f i l m . The r e s u l t s o f t h i n l a y e r chromatography o f * p l 34 (6000 Cerenkov cpm) from t R N A 7 e r i s shown i n ( j ) , w h i l e *pC 16 (2700 cpm) S p r 'sPr from tRNA 7 and *pD 16 (2900 cpm) from tRNA^ a r e shown i n ( i ) . A u t o -r a d i o g r a p h y was f o r 3.5 days u s i n g " n o - s c r e e n " X-ray f i l m . - 71 3 < O O O < o => o tot 1 1 1 1 1 1 * s < u o O o 3 G m i i n i > ) i i i l i O I I I I I I M W i l l i II • 11 OCX Mft«UWII:llllilllH o 2 « l l l i i 1 <I I I I I I I I I i l I ' • • i I I I i i i nn (U^d^C < » O < O < 3 °o 0 : 3<V 3(9 o o < o j p ° ° a ((«(«* iwnmw w i n - 7 3 - 74 -- 75 -- 76 -F i g u r e 6 - Gel " r e a d - o f f " a n a l y s i s o f t R N A 4 e r and t R N A ^ . (a) : Samples o f t R N A ^ e r (4.5 yg) and t R N A y 6 r (5 yg) were d e - p h o s p h o r y l a t e d as d e s c r i b e d i n C h a p t e r I I , t h e n 5'-end l a b e l l e d w i t h p o l y n u c l e o t i d e 3? k i n a s e and [ y - P]ATP (30 yM; 450 Ci/mmole). R a d i o l a b e l 1 e d RNAs were ( s e p a r a t e d by e l e c t r o p h o r e s i s on a 20% p o l y a c r y l a m i d e g e l (4 h r . a t 1200V), and l o c a t e d by a u t o r a d i o g r a p h y (1.5 min. u s i n g " n o - s c r e e n " X-ray f i l m ) . (b) : Samples o f t R N A ^ e r (0.9 yg) and t R N A ^ (1.0 yg) were l a b e l l e d w i t h RNA l i g a s e and *pCp (1.2 yM; 320 Ci/mmole) as d e s c r i b e d i n C h a p t e r I I . R a d i o l a b e l l e d RNAs were s e p a r a t e d by e l e c t r o p h o r e s i s on a 12% p o l y -a c r y l a m i d e g e l (1.5 mm t h i c k i n s t e a d o f 0.5 mm) f o r 15 h r . a t 300V, and l o c a t e d by a u t o r a d i o g r a p h y (30 min. u s i n g " n o - s c r e e n " X-ray f i l m ) . ( c ) and 3 2 (d) : P a r t i a l e n z y m a t i c h y d r o l y s e s o f [ P]tRNAs were per f o r m e d as . d e s c r i b e d i n C h a p t e r I I , u s i n g t h e f o l l o w i n g amounts o f r i b o n u c l e a s e a c t i v i t y p e r microgram o f c a r r i e r tRNA: no enzyme (-E), 0.0067 u n i t RNase T ] ( T ) / y g , 0.0067 u n i t RNase U"2 ( U ) / y g , 0.17 u n i t RNase Phy I ( P h y ) / y g , o r 0.00067 u n i t RNase A ( A ) / y g . R e a c t i o n s were f o r 15 min. a t 55° (-E, T, A ) , 15 min. a t 0° ( U ) , 15 min. a t room t e m p e r a t u r e ( P h y ) , o r 40 min. a t 100° f o r the r e f e r e n c e l a d d e r ( L ) . Twice as 32 much [ P]RNA was used f o r t h e L, Phy, and A s l o t s as f o r t h e -E, T, and U s l o t s . The T s l o t s c o n t a i n e d 7,000 Cerenkov cpm ( c ) and 11,000 Cerenkov cpm ( d ) . E l e c t r o p h o r e s i s was f o r 2 h r . a t 1500V on a 20% p o l y a c r y l a m i d e g e l ( c ) o r f o r 2.8 h r . a t 1800V on a 25% p o l y a c r y l a m i d e gel ( d ) . A u t o r a d i o g r a p h y was f o r 4 days ( c ) o r f o r 9 days (d) a t -20° u s i n g Kodak XR-1 X-ray f i l m . (e) and ( f ) : P a r t i a l h y d r o l y s e s were p e r f o r m e d as d e s c r i b e d above f o r (c) and ( d ) . The s u b s t r a t e s were 5 ' - l a b e l l e d 3 ' - h a i f m o l e c u l e s , shown i n p a r t ( a ) . The T s l o t s c o n t a i n e d 17,500 Cerenkov cpm o f t h e 3 ' - h a l f o f t R N A y 6 r (e) o r 7,000 Cerenkov cpm o f the 3 ' - h a l f o f tRNA_ J e r ( f ) . As b e f o r e , - 77 -t w i c e as much [ P]RNA was p r e s e n t i n the L, Phy, and A s l o t s as i n t h e -E, T, and U s l o t s . E l e c t r o p h o r e s i s on 25° p o l y a c r y l a m i d e g e l s was f o r 5 h r . a t 1600V. A u t o r a d i o g r a p h y was f o r 4 days (e) o r 7 days ( f ) u s i n g Kodak " n o - s c r e e n " X-ray f i l m . (g) and 3 (h) : P a r t i a l h y d r o l y s e s were per f o r m e d u s i n g 2 x 10" u n i t RNase T-j/ug c a r r i e r tRNA ( T ) , 2 x 1 0 " 3 u n i t RNase U 2/ug ( U ) , 0.03 u n i t RNase Phy I/ug ( P h y ) , 1 x 1 0 " 3 and 1 x 1 0 ~ 4 u n i t RNase A/ug ( A - l and A-2, r e s p e c t i v e l y ) . Each s l o t c o n t a i n e d 23,500 Cerenkov cpm (g) o r 19,000 c p m / s l o t (h) e x c e p t t he r e f e r e n c e l a d d e r s (L) which c o n t a i n e d t w i c e as much r a d i o a c t i v i t y . E l e c t r o p h o r e s i s was f o r 2.75 h r . a t 1000V on 20% p o l y a c r y l a m i d e g e l s . A u t o r a d i o g r a p h y was f o r 37 h r . u s i n g Kodak " n o - s c r e e n " X-ray f i l m . - 79 -- 80 -III.."I 4 II i I - 4 1 l i U l i tMtiI i l M l i I < o o o o o => o o o o o 11 I 1 .1 4 I I ) • < o o o < o = o o o o o e 8 3 - 81 -S PK* were i d e n t i f i e d by gel " r e a d - o f f " a n a l y s i s o f tRNAy l a b e l l e d a t t h e 3'-t e r m i n u s w i t h *pCp by RNA l i g a s e . -The s t a t e m e n t s above a r e f a i r l y g e n e r a l i n t h e sense t h a t sequence a n a l y s e s o f t R N A ^ r , tRNA__j e r, and t R N A ^ y s were c a r r i e d o u t i n much t h e same way. A t t h i s p o i n t , i t i s r e l e v a n t t o g i v e a d e t a i l e d d e s c r i p t i o n o f the SPIT arguments used t o a r r i v e a t the c o m p l e t e d tRNAy sequence. My p r e s e n t a t i o n w i l l d e a l w i t h p o i n t s i n t h e sequence where d i f f i c u l t y was e n c o u n t e r e d , moving g e n e r a l l y from the 5'-end t o the 3'-end. As the same arguments a p p l y i n l a r g e p a r t t o both tRNA^ and t R N A 2 b a n a l y s e s , I w i l l d i s c u s s them much more b r i e f l y , e m p h a s i z i n g d i f f e r e n c e s from t R N A ^ e r . Spy11 The 5 ' - t e r m i n u s o f tRNAy i s pG. White e t al_. found pGp i n RNase T 2 d i g e s t s o f t h i s tRNA ( 1 0 2 ) . Gel " r e a d - o f f " a n a l y s i s o f [ 5 ' - 3 2 P ] tRNAy ( F i g . 6c) d e m o n s t r a t e d the p r e s e n c e o f G i n the t e r m i n a l p o s i t i o n , 32 as d i d c h r o m a t o g r a p h i c a n a l y s i s o f the *pN g e n e r a t e d from [ 5 1 - P]tRNA by n u c l e a s e P-j d i g e s t i o n ( r e s u l t not shown). N u c l e o t i d e a n a l y s i s i n d i c a t e d two p G m r e s i d u e s per tRNAy m o l e c u l e ( T a b l e 1 ) . One o c c u r s a t p o s i t i o n 17 as shown below; the o t h e r was deduced t o o c c u r i n p o s i t i o n 4 based on the f o l l o w i n g c o n s i d e r a t i o n s . The p r e s e n c e o f a 2 ' - 0 - m e t h y l n u c l e o s i d e a t p o s i t i o n 4 was shown by a gap i n the l a d d e r s o f gel " r e a d - o f f " e x p e r i m e n t s ( F i g . 6c) which a l s o i n d i c a t e d t h a t p o s i t i o n 5 c o n t a i n s u r i d i n e . The m o b i l i t y s h i f t seen i n "wandering s p o t " a n a l y s i s o f [ 5 ' - 3 2 P ] t R N A y e r ( F i g . 7a) i s c o n s i s t e n t w i t h the sequence G U o r U G; however, the l a t t e r p o s s i -m m K b i l i t y was d i s c a r d e d based on the r e s u l t s o f g e l " r e a d - o f f " e x p e r i m e n t s c i t e d above. T h e r e f o r e the sequence a t p o s i t i o n s 4 and 5 i s G mU. P o s i t i o n 12 c o n t a i n s ac C. In n u c l e o t i d e a n a l y s i s e x p e r i m e n t s ( F i g . 4 a ) , *pac C - 82 -F i g u r e 7 - "Wandering s p o t " a n a l y s i s o f t h e 5 ' - t e r m i n i o f tRNA. and Ser tRNAy . [ 5 ' - 3 2 P ] t R N A y e r (a) and [ 5 ' - 3 2 P ] t R N A 4 e r (b) were h y d r o l y z e d i n 70% formamide f o r 60 min. a t 100°. Samples (2 y l ) c o n t a i n e d 12,700 Cerenkov cpm (a) and 7900 Cerenkov cpm ( b ) . E l e c t r o p h o r e s i s and homochromatography were pe r f o r m e d as d e s c r i b e d i n C h a p t e r I I . A u t o -r a d i o g r a p h y was f o r 16 days u s i n g " n o - s c r e e n " X-ray f i l m . - 83 -- 84 -was i d e n t i f i e d by comparing i t s c h r o m a t o g r a p h i c p r o p e r t i e s w i t h t h o s e o f th e c o m m e r c i a l l y o b t a i n e d n u c l e o t i d e s t a n d a r d i n s o l v e n t s A and B ( C h a p t e r 32 I I , s e c t i o n A . 8 . g . ) . A n a l y s i s o f *pNp's g e n e r a t e d by h y d r o l y s i s o f [ P] o l i g o n u c l e o t i d e s i n 0.2M NaOH i n a S t a n l e y / V a s s i l e n k o e x p e r i m e n t showed o n l y C i n p o s i t i o n 12. T h i s r e s u l t would be e x p e c t e d w i t h an a l k a l i - l a b i l e n u c l e o s i d e such as ac^C (4, 157). A *pN w i t h the c o r r e c t m o b i l i t y i n s o l v e n t A was p r e s e n t i n s m a l l q u a n t i t i e s a t t h i s p o s i t i o n i n t h e same S t a n l e y / V a s s i l e n k o e x p e r i m e n t ( F i g . 5e o f r e f . 4 3 ) . In S t a n l e y / V a s s i l e n k o S G Y * a n a l y s i s o f tRNA^^ , the *pN i n t h i s p o s i t i o n was c l e a r l y shown t o be 4 *pac C, based on c o m i g r a t i o n w i t h the c o m m e r c i a l l y o b t a i n e d n u c l e o s i d e 5'-phosphate i n two s o l v e n t systems ( F i g . 1 0 c ) . The i d e n t i t y o f t h e n u c l e o -s i d e s p r e s e n t i n p o s i t i o n 12 o f t R N A y e r , t R N A ^ , and t R N A ^ r i s s u p p o r t e d by the d o u b l e t p a t t e r n seen i n the RNase A s l o t o f g e l " r e a d - o f f " e x p e r i m e n t s f o r t h e t h r e e tRNAs. ( T h i s i s seen most c l e a r l y f o r tRNA^ i n F i g . 6d, but compare w i t h t he e q u i v a l e n t p o s i t i o n i n tRNAy , F i g . 6c, and tRNA^^ , F i g . 9a.) The d o u b l e t s a r e n o t due t o p a r t i a l m o d i f i c a t i o n : o n l y one band i s p r e s e n t i n the r e f e r e n c e l a d d e r . The d o u b l e t s ar.e n o t due t o p a r t i a l d e - a c e t y l a t i o n i n the RNase A r e a c t i o n mix, as l a r g e r fragments c o n t a i n i n g p o s i t i o n 12 would show the same p a t t e r n . The d o u b l e t s c o u l d be the r e s u l t o f e f f i c i e n t r i n g - o p e n i n g o f the 2', 3 ' - c y c l i c phosphate produced by i n i t i a l RNase A - c a t a l y z e d c l e a v a g e . A s i m i l a r d o u b l e t has been o b s e r v e d a t a m C r e s i d u e i n y e a s t t R N A ^ l y ( F i g . 8 o f r e f . 4 3 ) . As t h e s u b s t i t u e n t i n m 5C i s n o t l a b i l e , i n c r e a s e d r a t e o f c y c l i c phosphate r i n g - o p e n i n g by RNase A a t m o d i f i e d c y t o s i n e r e s i d u e s i s t h e f a v o r e d e x p l a n a t i o n . Thus, t h e p r e s e n c e o f d o u b l e t bands i n the RNase A s l o t can be d i a g n o s t i c f o r t h e p r e s e n c e o f some m o d i f i e d c y t o s i n e s . - 85 -P o s i t i o n 16 o f tRNAy c o n t a i n s c y t o s i n e . T h i s i s c l e a r l y shown i n F i g . 5k, where the *pN o b t a i n e d from t h i s p o s i t i o n by n u c l e a s e P^ d i g e s t i o n i n a S t a n l e y / V a s s i l e n k o e x p e r i m e n t c o m i g r a t e d wi/th pC on a two d i m e n s i o n a l c hromatograph. (The p r e s e n c e o f c y t i d i n e here i s d i s c u s s e d f u r t h e r below.) Gel " r e a d - o f f " e x p e r i m e n t s show a gap i n the r e f e r e n c e l a d d e r a t p o s i t i o n 17 ( F i g . 6 c ) , as does the l a d d e r i n a S t a n l e y / V a s s i l e n k o e x p e r i m e n t ( F i g . 5 a ) . Gel " r e a d - o f f " e x p e r i m e n t s c l e a r l y show t h a t G i s p r e s e n t i n p o s i t i o n 18 ( F i g . 6 c ) . The G m i n p o s i t i o n 17 was i d e n t i f i e d as * p G m by i t s c h r o m a t o g r a p h i c m o b i l i t i e s i n s o l v e n t s A and B on c e l l u l o s e t h i n l a y e r p l a t e s a f t e r e x t e n s i v e n u c l e a s e P-j d i g e s t i o n ( M e t h o d s ) . Thus, t h e s l o w l y 32 m i g r a t i n g s p e c i e s ( F i g . 5d) d e r i v e d by a l k a l i n e h y d r o l y s i s o f a [ 5 1 - P] o l i g o n u c l e o t i d e i s the d i n u c l e o s i d e t r i p h o s p h a t e , *pG mGp. D i h y d r o u r i d i n e r e s i d u e s i n p o s i t i o n s 19 and 20 were i d e n t i f i e d as'*pN's by c e l l u l o s e t h i n l a y e r chromatography i n s o l v e n t s A and B ( F i g . 5 f and 5 h ) . 2 P o s i t i o n 26 c o n t a i n s n^G. The n u c l e o t i d e t h e r e i s a p p a r e n t l y r e s i s t a n t t o r i b o n u c l e a s e T-j c l e a v a g e ( F i g . 6c; r e f . 158). The *pNp c o -m i g r a t e s w i t h pCp ( F i g . 5 d ) . The n u c l e o t i d e from p o s i t i o n 26 o f tRNA^ 1", 2 i d e n t i f i e d as pn^G on the b a s i s o f c h r o m a t o g r a p h i c m o b i l i t i e s ( F i g . 4 c , 1 0 c ) , i s r e s i s t a n t t o RNase T-j c l e a v a g e and c o - m i g r a t e s w i t h pCp on PEI c e l l u l o s e d e v e l o p e d w i t h 0.80M ammonium s u l f a t e . T h e r e f o r e i t was c o n c l u d e d t h a t Ser 2 p o s i t i o n 26 o f tRNAy c o n t a i n s rr^G. 3 I d e n t i f i c a t i o n o f m C i n p o s i t i o n 32 i n the a n t i c o d o n l o o p , and i n p o s i t i o n 50 i n the e x t r a arm, c o u l d not be made on t h e b a s i s o f chromato-g r a p h i c m o b i l i t i e s as the *pN, s i n c e t h e r e were no r e l e v a n t p u b l i s h e d v a l u e s f o r t h i s n u c l e o t i d e ( 4 2 ) . A l s o , no v a l u e was r e p o r t e d by Gupta - 86 -and Randerath (53) f o r t h e m o b i l i t y o f pm Cp on PEI c e l l u l o s e i n an ammonium s u l f a t e s o l v e n t system. However, a number o f o b s e r v a t i o n s i n d i c a t e t h a t the n u c l e o s i d e a t p o s i t i o n s 32 and 50 i s i n d e e d m C. F i r s t , White e_t al_. (102) 3 i d e n t i f i e d a minor component o f f i v e s e r i n e tRNAs as m C , u s i n g the p e r i o d a t e o x i d a t i o n and b o r o t r i t i i d e - l a b e l l i n g method o f Randerath e t a l . 3 ( 1 5 9 ) . In the s o l v e n t systems used f o r chromatography, m C has d i s t i n c -t i v e m o b i l i t i e s , making i t s i d e n t i f i c a t i o n r e a s o n a b l y c e r t a i n . Second, the pNp has a h i g h m o b i l i t y on PEI c e l l u l o s e ( F i g . 5 d ) , s i m i l a r to pm^Ap and pm 7Gp which both c o n t a i n p o s i t i v e l y c h a r g e d b a s e s . 3 - m e t h y l c y t i d i n e c a r r i e s a +1 c h a r g e under the c o n d i t i o n s o f chromatography (pK = 8.7). T h i r d , t h e pN m i g r a t e s s i m i l a r l y t o pm A, pm 7G, and pC on two d i m e n s i o n a l c e l l u l o s e t h i n l a y e r p l a t e s ( F i g . 4 a ) . F o u r t h , t h i s n u c l e o s i d e i s r e s i s t a n t t o r i b o n u c l e a s e A c l e a v a g e ( F i g . 6 c ) . RNase A does not c l e a v e a t c y t o s i n e r e s i d u e s m o d i f i e d a t N-3 o f the p y r i m i d i n e r i n g ( 1 6 0 ) . F i f t h , t he "jump" between bands i n the r e f e r e n c e l a d d e r o f " r e a d - o f f " e x p e r i m e n t s due t o a d d i t i o n o f t h i s n u c l e o t i d e i s l a r g e , l i k e t h a t f o r a p u r i n e n u c l e o t i d e o r one c o n t a i n i n g a p o s i t i v e l y c h a r g e d base. For t h e s e r e a s o n s , the 3 n u c l e o s i d e a t p o s i t i o n s 32 and 50 was i d e n t i f i e d as m C. I n o s i n e i n p o s i t i o n 34 ( t h e "wobble" p o s i t i o n ) was i d e n t i f i e d as * p l by co-chromatography i n s o l v e n t s A and B w i t h c o m m e r c i a l l y o b t a i n e d i n o s i n e 5'-phosphate ( F i g . 5 j ) . The c h r o m a t o g r a p h i c m o b i l i t i e s d e t e r m i n e d f o r * p i 6 A ( p o s i t i o n 3 6 ) , o b t a i n e d i n a S t a n l e y / V a s s i l e n k o e x p e r i m e n t , i n s o l v e n t s A and B were t h e same as f o r c o m m e r c i a l l y o b t a i n e d p i A s t a n d a r d ( F i g . 5 f , 5 h ) . P s e u d o u r i d i n e i n p o s i t i o n s 39 and 64 chromatographed as e x p e c t e d f o r pty i n s o l v e n t s A and B ( F i g . 5 f , 5 h ) , and as e x p e c t e d f o r px/jp on PEI c e l l u l o s e p l a t e s i n t h e ammonium s u l f a t e s o l v e n t ( F i g . 5d; r e f s . - 87 -43,53). I t was c l e a v e d l i k e a U by r i b o n u c l e a s e s Phyl and A i n gel " r e a d -o f f " e x p e r i m e n t s ( F i g . 6 e ) . The sequence a t p o s i t i o n s 44-48 was deduced to be IMJCCC. The p r e s e n c e o f a 2 ' - 0 - m e t h y l n u c l e o s i d e a t p o s i t i o n 44 was shown by a gap i n the r e f e r e n c e l a d d e r o f g e l " r e a d - o f f " e x p e r i m e n t s . The n u c l e o s i d e 5'-phosphate r e l e a s e d by e x t e n s i v e n u c l e a s e P-| d i g e s t i o n i n a S t a n l e y / V a s s i l e n k o e x p e r i m e n t has the same c h r o m a t o g r a p h i c m o b i l i t i e s i n s o l v e n t s A and B as s t a n d a r d pU m- N u c l e o t i d e a n a l y s i s i n d i c a t e d the p r e s e n c e o f p U m a t l e s s than one m o l e c u l e p e r tRNAy ( F i g . 4a, T a b l e 1 ) , and both p G m r e s i d u e s ( T a b l e 1) were a c c o u n t e d f o r a t p o s i t i o n s 4 and 17. Thus p o s i t i o n 44 c o n t a i n s U . Gel " r e a d - o f f " e x p e r i m e n t s i n d i c a t e t h e n u c l e o s i d e a t p o s i t i o n 45 i s U. C o n s i s t e n t w i t h t h i s , t h e c h r o m a t o g r a p h i c m o b i l i t y o f the d i n u c l e o s i d e t r i p h o s p h a t e on PEI c e l l u l o s e i n 0.80M ammonium -s u l f a t e i s v e r y n e a r l y t h e same as t h a t d e t e r m i n e d f o r pU^pUp i n a s i m i l a r c h r o m a t o g r a p h i c system by Gupta and Randerath ( 5 3 ) . C46, C47, and to a l e s s e r e x t e n t C48 c o u l d be i d e n t i f i e d i n gel " r e a d - o f f " e x p e r i m e n t s , w h i l e C48, C47, and sometimes C46 c o u l d be o b t a i n e d as s e p a r a t e bands on p o l y -a c r y l a m i d e g e l s i n S t a n l e y / V a s s i l e n k o e x p e r i m e n t s ( F i g . 5 a ) , though bands i n t h i s r e g i o n tended t o compress d u r i n g e l e c t r o p h o r e s i s , presumably due t o p e r s i s t e n t s e c o n d a r y s t r u c t u r e ( 1 3 5 ) . (Such c o m p r e s s i o n was p a r -t i c u l a r l y t r o u b l e s o m e d u r i n g the e a r l i e r s e q u e n c i n g e x p e r i m e n t s i n the work r e p o r t e d h e r e , when we d i d n o t have a power s u p p l y t h a t would m a i n t a i n a s u f f i c i e n t l y h i g h amperage t o run p o l y a c r y l a m i d e g e l s a t e l e v a t e d tempera-t u r e s u s i n g s t a n d a r d b u f f e r s . ) The p o s s i b i l i t y remains t h a t p o s i t i o n 45 c o n t a i n s r a t h e r than U. N u c l e o t i d e a n a l y s i s i n d i c a t e d 3.2 p^ p e r tRNA m o l e c u l e e s t i m a t e d r e l a t i v e t o pT ( T a b l e 1 ) . Based on t h e methods used here t h a t p o s s i b i l i t y c a n n o t be e x c l u d e d . However, q u a n t i s a t i o n o f - 88 -m o d i f i e d n u c l e o t i d e s i n a tRNA i s s u b j e c t t o r a t h e r l a r g e e r r o r s a t ti m e s due t o v a r i a t i o n s i n p o l y n u c l e o t i d e k i n a s e l a b e l l i n g e f f i c i e n c y . L a c k i n g more d i r e c t e v i d e n c e f o r t h e presence, o f i> a t t h i s p o s i t i o n , t he sequence a t p o s i t i o n s 44-48 was deduced t o be ILUCCC. K m N u c l e o t i d e s 56-58 were p o o r l y l a b e l l e d by p o l y n u c l e o t i d e k i n a s e i n S t a n l e y / V a s s i l e n k o e x p e r i m e n t s ( F i g . 5 a ) , but c o u l d be t e n t a t i v e l y r e a d as Gm5CG. N u c l e o t i d e a n a l y s e s o f both t R N A ^ e r and t R N A ^ r i n d i c a t e d 5 7 the p r e s e n c e o f pm C, which m i g r a t e s v e r y near t o a pm G s t a n d a r d i n both Ser 5 s o l v e n t s A and B on c e l l u l o s e t h i n l a y e r p l a t e s . In tRNA^^ , t h i s pm C was l o c a t e d i n p o s i t i o n 57 ( F i g . 1 0 c ) . The pm Cp from t he same p o s i t i o n S e r o f tRNA^^ m i g r a t e d s l i g h t l y ahead o f pCp on PEI c e l l u l o s e p l a t e s i n the ammonium s u l f a t e system, as d i d the p u t a t i v e pm 5Cp from t R N A ^ . S u p p o r t i n g t h i s i n t e r p r e t a t i o n , gel " r e a d - o f f " e x p e r i m e n t s y i e l d e d c l e a r p a t t e r n s r e a d as GCG ( F i g . 6 e ) . In one c a s e a d o u b l e t p a t t e r n l i k e t h a t d i s c u s s e d above f o r a c 4 C was seen ( r e s u l t s n o t shown). "Wandering s p o t " a n a l y s i s 32 o f a [ P ] o l i g o n u c l e o t i d e o b t a i n e d i n a S t a n l e y / V a s s i l e n k o e x p e r i m e n t i n d i c a t e d the p r e s e n c e o f t h e sequence AGCGUAGG h e r e . Taken t o g e t h e r , 5 t h e s e d a t a a r e a l l c o n s i s t e n t w i t h t he sequence Gm CG a t p o s i t i o n s 56-58. R i b o t h y m i d i n e i n p o s i t i o n 63 and 1 - m e t h y l a d e n o s i n e i n p o s i t i o n 67 were both i d e n t i f i e d as *pN's by t h e i r c h r o m a t o g r a p h i c m o b i l i t i e s on c e l l u l o s e t h i n l a y e r p l a t e s i n s o l v e n t s A and B ( F i g . 5 f , 5 h ) . As pNp's, *pTp c o m i g r a t e s w i t h pUp ( F i g . 5 d ) , w h i l e *pm Ap ( d e r i v e d from *pm ApNp ••• CCA d u r i n g a l k a l i n e h y d r o l y s i s ; C h a p t e r I I , A.8.e.) m i g r a t e s somewhat f a s t e r than pAp ( F i g . 5 d ) . Both T and m'^ A a r e r e s i s t a n t t o r i b o n u c l e a s e c l e a v a g e i n " r e a d - o f f " e x p e r i m e n t s . A l a r g e "jump" i n the r e f e r e n c e l a d d e r - 89 -i s seen on a d d i t i o n o f m'A t o the 5' end i n such e x p e r i m e n t s . The d i s t i n c -t i v e p a t t e r n found a t the sequence GT^CGm^AA common i n tRNAs i s shown i n F i g . 6e. The sequence from p o s i t i o n s 68-82 was unambiguously d e t e r m i n e d i n S t a n l e y / V a s s i l e n k o and g e l " r e a d - o f f " e x p e r i m e n t s . The 3 ' - t e r m i n a l CCA sequence ( p o s i t i o n s 83-85) was d e t e r m i n e d by g e l " r e a d - o f f " a n a l y s i s o f t R N A y e r l a b e l l e d a t the 3'-end w i t h *pCp by RNA l i g a s e . C83 and C84 c o u l d be r e a d d i r e c t l y from a u t o r a d i o g r a p h s ( s e e F i g . 6 g ) . A85 was Se r i d e n t i f i e d by " n e a r e s t n e i g h b o r " a n a l y s i s o f * p C p - l a b e l l e d tRNAy , as f o l l o w s . R a d i o l a b e l e d t R N A y 6 r was d i g e s t e d t o n u c l e o s i d e 3 1 - p h o s p h a t e s 32 by RNase 1^ ( r e s u l t i n g i n t r a n s f e r o f the [ 5 1 - P] p h o s p h o r y l group o f *pCp t o i t s n e i g h b o r on the 5' s i d e ) t h e n u c l e o t i d e s s e p a r a t e d by c e l l u l o s e t h i n l a y e r chromatography i n s o l v e n t A ( t o g e t h e r w i t h -Np s t a n d a r d s ) , and 32 t h e [ P] p h o s p h o r y l group l o c a t e d i n Ap* by a u t o r a d i o g r a p h y ( r e s u l t s n o t shown). I t s h o u l d be no t e d t h a t t he p r e s e n c e o f a 3 ' - t e r m i n a l a d e n o s i n e can a l s o be deduced d i r e c t l y from g e l " r e a d - o f f " e x p e r i m e n t s , where a u t o -r a d i o g r a p h s show d o u b l e t band p a t t e r n s a t A r e s i d u e s on d i g e s t i o n o f t h e [ 3 ' - 3 2 P ] tRNA w i t h RNase U 2 ( s e e F i g . 6 g ) . T h i s p a t t e r n , which can be m i s l e a d i n g as t h e lower band (sometimes t he s t r o n g e r ) o c c a s i o n a l l y c o m i -g r a t e s w i t h t he n e x t s m a l l e r r e f e r e n c e l a d d e r band, r e s u l t s from a h i g h p e r c e n t a g e o f d o u b l y c l e a v e d m o l e c u l e s c o n t a i n i n g 3 ' - t e r m i n a l CCAp* r a t h e r than CCA*pCp. Thus, w h i l e " n e a r e s t n e i g h b o r " a n a l y s i s s h o u l d be p e r -formed r o u t i n e l y as p a r t o f t h e s e q u e n c i n g p r o t o c o l , i t i s n o t r e a l l y n e c e s s a r y i n e v e r y c a s e e n c o u n t e r e d . The completed tRNAy sequence, d e t e r m i n e d as d e s c r i b e d above, i s p r e s e n t e d as a " c l o v e r l e a f " s t r u c t u r e i n F i g . 8. - 90 -15 £oH "85 c G i - P G - C A - U 5 - G l T : A ^ G C - G 7 0 D K r A 1 0 U G C A U C C U A m i A rP °ArrrG G U A G G c < * G m a c 4 C C G 5 T l|J ^  65 G G G C G A ~ f D r , A A 4& II 1 1 P G G D A 2 y m u ' ' r u 20 C - G c U m l 5 0 U - A s o - G - C - ^ o ~ A - V m 3 C A U i 6 A I G A c t R N A S e r  T K I N A 7 ( 4 ) F i g u r e 8 - C l o v e r l e a f s t r u c t u r e o f t R N A ^ e r and t R N A 7 e r . - 91 -I t s h o u l d be noted here t h a t t h e c r i t e r i a a p p l i e d t o deduce the tRNA sequences p r e s e n t e d i n t h i s c h a p t e r a r e q u i t e r i g o r o u s , and sequences o b t a i n e d by t h i s g e n e r a l s t r a t e g y a r e a p p a r e n t l y a c c u r a t e , as DNA sequences 100% homologous to t R N A ^ e r ( s e e C h a p t e r IV) and t R N A ^ y s ( C h a p t e r V) have been f o u n d . T h i s p o i n t i s an i m p o r t a n t one i n the i n t e r -p r e t a t i o n o f DNA sequence a n a l y s e s p r e s e n t e d i n C h a p t e r IV. B.2. Sequence a n a l y s i s o f t R N A ^ e r The n u c l e o t i d e sequence o f tRNA^ was d e t e r m i n e d i n an a l m o s t i d e n t i c a l f a s h i o n t o t h a t o f t R N A y e r . G e n e r a l l y , t h e same e x p e r i m e n t s were c a r r i e d p u t i n p a r a l l e l w i t h t h e two tRNAs. N u c l e o t i d e a n a l y s i s i s p r e s e n t e d i n F i g . 4b; q u a n t i t a t i o n o f n u c l e o t i d e s i s i n T a b l e I. The r e s u l t s o f S t a n l e y / V a s s i l e n k o a n a l y s i s a r e shown i n F i g u r e s 5b, 5c, 5e, 32 5g, 5 i . The r e s u l t s o f r e p r e s e n t a t i v e gel " r e a d - o f f " a n a l y s e s o f [ 5 1 - P] tRNA 4 , a 5 ' - l a b e l l e d h a l f - m o l e c u l e c o n t a i n i n g n u c l e o t i d e s 36-85, and [ 3 ' - 3 2 P ] t R N A 4 e r l a b e l l e d by RNA l i g a s e a r e p r e s e n t e d i n F i g u r e 6d, 6 f , and 6h. The 5 ' - t e r m i n a l sequence i d e n t i f i e d i n a "wandering s p o t " e x p e r i m e n t i s shown i n F i g . 7b. The e n t i r e sequence was c o v e r e d two o r more t i m e s . A l l n u c l e o t i d e s e x c e p t the 3 ' - t e r m i n a l CCA were d e t e r m i n e d by two o r more i n d e p e n d e n t methods. The n u c l e o t i d e sequence o f t R N A ^ e r i s v e r y s i m i l a r to t h a t o f S e r tRNAy , d i f f e r i n g a t o n l y t h r e e o u t o f 85 p o s i t i o n s . The s i m i l a r i t y between t h e two sequences i s r e a d i l y seen by comparing e q u i v a l e n t g e l " r e a d - o f f " e x p e r i m e n t s . F o r example, p a t t e r n s o b t a i n e d from 5 ' - t e r m i n a l sequences ( F i g u r e s 6c, 6d) o r from 3 ' - t e r m i n a l sequences ( F i g u r e s 6e, 6 f ) - 92 -ar e n e a r l y i d e n t i c a l . However, each i s d i s t i n c t , d i f f e r i n g a t p o s i t i o n s i n d i c a t e d by arrows i n the f i g u r e s . The t h r e e p o s i t i o n s d i f f e r i n g between t R N A 4 e r and t R N A ^ e r a r e 16, 34, and 77. P o s i t i o n 16 c o n t a i n s a D i n t R N A 4 e r but C i n t R N A 7 e r , as i s c l e a r l y seen i n F i g . 5k. P o s i t i o n 34 i s t h e "wobble" p o s i t i o n o f the a n t i c o d o n . W hile t R N A ^ e r c o n t a i n s i n o s i n e S G Y* t h e r e ( F i g . 5 j ) , t h e same p o s i t i o n i n tRNA^ c o n t a i n s c y t i d i n e ( F i g u r e s 5e, 5g, 5 i ) . The g r e a t e s t d i f f i c u l t i e s e n c o u n t e r e d i n a n a l y s i s o f the t R N A ^ e r sequence were i n d e d u c i n g the sequence a t and around n u c l e o t i d e 77. The sequence i s e a s i l y r e a d as A-^CCGGCUGQQ i n the a u t o r a d i o g r a p h o f a " r e a d - o f f " g e l shown i n F i g . 6 f . However, i n gel " r e a d - o f f " a n a l y s i s o f [ 3 ' - P] tRNA^ , the sequence was r e a d as A 7 4 C G C G C U G S Q ( F i g . 6 h ) . In a S t a n l e y / V a s s i l e n k o e x p e r i m e n t , the sequence was r e a d as ACC-GCUG ( F i g . 5 b ) . One band i s m i s s i n g from t he l a d d e r r e l a t i v e t o t R N A 7 e r (compare to F i g . 5 a ) . In a s e p a r a t e S t a n l e y / V a s s i l e n k o e x p e r i m e n t , a d o u b l e t was seen a t t h i s p o s i t i o n ( F i g . 5 c ) . The 5 ' t e r m i n a l n u c l e o t i d e o f each band o f t h e d o u b l e t was *pGp ( r e s u l t s not shown). These d i s c r e p a n c i e s can be r e s o l v e d i n t h e f o l l o w i n g way. The g e l " r e a d - o f f " e x p e r i m e n t shown i n F i g u r e 6 f i s v e r y c l e a r and e a s i l y r e a d . The band p a t t e r n f o r t R N A 4 e r here matches t h a t f o r tRNA 7 ( F i g . 6e) a t a l l p o s i t i o n s e x c e p t 77, where the two tRNAs c o n t a i n G and A, r e s p e c t i v e l y . A l l problems e n c o u n t e r e d S e r a t t h i s r e g i o n o f the tRNA^ sequence i n v o l v e d t h e e l e c t r o p h o r e t i c b e h a v i o r 32 o f s h o r t [ P] o l i g o n u c l e o t i d e s c o n t a i n i n g t h e 3 ' - t e r m i n a l GCCA sequence. The sequence GCCA i s complementary t o GGC a t p o s i t i o n s 76-78. Thus, the 3 ' - t e r m i n a l sequence c o n t a i n i n g n u c l e o t i d e s 76-85 i s c a p a b l e o f f o r m i n g a h a i r p i n s t r u c t u r e c o n t a i n i n g t h r e e G-C base p a i r s and a t h r e e n u c l e o t i d e l o o p : - 93 -r G C C A G 1 U C G G 5' Under n o n - d e n a t u r i n g ' e l e c t r o p h o r e t i c c o n d i t i o n s o l i g o n u c l e o t i d e s * c o n t a i n i n g t h i s h a i r p i n might m i g r a t e t h r o u g h p o l y a c r y l a m i d e g e l s a t an a n o m a l o u s l y h i g h r a t e , r e s u l t i n g i n a p a t t e r n t h a t does n o t r e p r e s e n t the t r u e sequence. As n o t e d e a r l i e r , t h e power s u p p l y we were u s i n g a t t h i s t ime d i d n o t m a i n t a i n s u f f i c i e n t l y h i g h amperage t o run p o l y a c r y l a m i d e g e l s a t e l e -v a t e d t e m p e r a t u r e s ( i n d e e d , t h e problem c i t e d e a r l i e r i n v o l v e d the e x t r a arm o f tRNAy , a h a i r p i n s t r u c t u r e c o n t a i n i n g t h r e e c o n s e c u t i v e G-C base p a i r s and a t h r e e n u c l e o t i d e l o o p . ) However, such c o n s i d e r a t i o n s would n o t be r e l e v a n t i n gel " r e a d - o f f " a n a l y s i s o f [ 5 ' - 3 2 P ] t R N A 4 e r ( o r the 5'-end l a b e l l e d 3 ' - h a l f m o l e c u l e , as shown i n F i g . 6 f ) , s i n c e t h e 3'-t e r m i n a l GCCA i n v o l v e d i n f o r m i n g such a h a i r p i n would n o t be p r e s e n t i n r a d i o l a b e l l e d o l i g o n u c l e o t i d e s e n d i n g a t G77. The com p l e t e d n u c l e o t i d e sequence o f tRNA^ i s p r e s e n t e d as a " c l o v e r l e a f " s t r u c t u r e i n F i g . 8. The arrows p o i n t t o the n u c l e o t i d e SPK* S p r changes i n tRNA^ d i s t i n g u i s h i n g i t from tRNAy . S e r B.3. Sequence a n a l y s i s o f tRNA2|_) The n u c l e o t i d e sequence o f tRNAg^ was d e t e r m i n e d by the same Ser S e r methods used t o a n a l y z e tRNAy and tRNA^ , and a l s o by a v a r i a t i o n o f the S t a n l e y / V a s s i l e n k o method d e s c r i b e d by Tanaka ejt a_]_. ( r e f . 54; C h a p t e r Spy I I , A.9.). The d a t a o b t a i n e d were not so e x t e n s i v e as f o r tRNA^ y (above) but n o n e t h e l e s s a l l o w e d an unambiguous sequence t o be a s s i g n e d . - 94 -In c o n t r a s t t o tRNAs^ 7, n u c l e o t i d e a n a l y s i s c l e a r l y i n d i c a t e d 2 Ser 6 th e p r e s e n c e o f pm 2G i n t R N A 2 b , as w e l l as p t A and a n u c l e o t i d e t h a t i s fi Se r p r o b a b l y pmt A ( F i g . 4 c ) . N u c l e o t i d e c o n t e n t i n t R N A 2 b was e s t i m a t e d ; t h e s e v a l u e s a r e found i n T a b l e I. The e n t i r e sequence was c o v e r e d i n gel " r e a d - o f f " a n a l y s e s o f [ 5 ' - P] t R N A ^ , a 5 ' - l a b e l l e d 3 ' - h a l f m o l e c u l e 32 o b t a i n e d from p o l y n u c l e o t i d e k i n a s e l a b e l l i n g r e a c t i o n s , and [ 3 ' - P] SPP t R N A 2 b . R e p r e s e n t a t i v e a u t o r a d i o g r a p h y from such e x p e r i m e n t s a r e shown i n F i g u r e s 9a, 9b, and 9c. The n u c l e o t i d e sequence f r o m p o s i t i o n s 4-74 was d e t e r m i n e d i n S t a n l e y / V a s s i l e n k o e x p e r i m e n t s ( F i g . 1 0 ) . In t h o s e 4 e x p e r i m e n t s , pac C12, p G m l 7 , and pU m44 were i d e n t i f i e d by t h e i r c o - m i g r a t i o n w i t h c o m m e r c i a l l y o b t a i n e d n u c l e o s i d e 5'-phosphate s t a n d a r d s on c e l l u l o s e 2 5 t h i n l a y e r chromatography i n s o l v e n t s A and B; pm 2G26 and pm C57 were c l e a r l y i d e n t i f i e d on t h e b a s i s o f c h r o m a t o g r a p h i c m o b i l i t i e s i n t h e same s o l v e n t s (as mentioned i n s e c t i o n B.1. above d e a l i n g w i t h tRNA 7 ); and o t h e r m o d i f i e d n u c l e o t i d e s were i d e n t i f i e d by t h e i r m o b i l i t i e s as pN's ( F i g . 1 0 c ) , as d e s c r i b e d above. P o s i t i o n 37 a d j a c e n t t o the a n t i c o d o n g c o n t a i n s a n u c l e o t i d e w i t h c h r o m a t o g r a p h i c m o b i l i t i e s e x p e c t e d f o r p t A g ( r e f . 42) and an a d d i t i o n a l s p e c i e s t h a t i s l i k e l y t o be pmt A ( F i g . 4c g and l O d ) . S i n c e no m o b i l i t y v a l u e s f o r pmt A a r e a v a i l a b l e , t h i s i d e n t i f i c a -S e r t i o n i s i n d i r e c t , based on homology w i t h r a t l i v e r tRNA^ . The r a t C p Y> l i v e r tRNA sequence i s n e a r l y i d e n t i c a l t o t h a t o f t R N A 2 b ( 9 8 % ) , i n c l u d i n g m o d i f i c a t i o n s e l s e w h e r e i n ' t h e sequence. T h i s h i g h degree o f c o n s e r v a t i o n Spy1 i s l i k e l y m a i n t a i n e d a t p o s i t i o n 37 as w e l l , where r a t l i v e r tRNA^ g c o n t a i n s mt A ( 7 ) . White e t a_l_. (102) found an unknown n u c l e o t i d e i n SGT 6 6 tRNA ? w i t h p r o p e r t i e s s i m i l a r t o mt Ap, but d i d not see t Ap. Sequence - 95 -gure 9 - Gel " r e a d - o f f " a n a l y s i s o f t R N A ^ r . 32 Ser ) [ 5 1 - P]tRNA 9, was p r e p a r e d by d e - p h o s p h o r y l a t i n g 2 ug o f p u r i f i e d 32 tRNA and l a b e l l i n g w i t h p o l y n u c l e o t i d e k i n a s e and [ y - P]ATP (40 uM, 1000 Ci/mmole). P a r t i a l d i g e s t i o n s were per f o r m e d as d e s c r i b e d f o r F i g u r e 6c. C o n t r o l (-E, n o t shown), RNase T-| ( T ) , and RNase (U) s l o t s c o n t a i n e d 11,000 Cerenkov cpm w h i l e RNase Phy I ( P h y ) , RNase A (A) and r e f e r e n c e l a d d e r (L) s l o t s c o n t a i n e d t w i c e t h a t amount (22,000 cpm). E l e c t r o p h o r e s i s on 20% p o l y a c r y l a m i d e g e l s was f o r 2 h r . a t 1800V. A u t o -r a d i o g r a p h y was f o r 8 days a t -20° u s i n g Kodak " n o - s c r e e n " X-ray f i l m . ) The 5 ' - l a b e l l e d 3 ' - h a l f m o l e c u l e i n c l u d i n g n u c l e o t i d e s 35-85 o f t R N A ^ r was d i g e s t e d as i n p a r t (a) above. C o n t r o l (-E, n o t shown), RNase T-j ( T ) , and RNase (U) s l o t s c o n t a i n e d 6,500 Cerenkov cpm, w h i l e t he RNase Phy I ( P h y ) , RNase A (A) and r e f e r e n c e l a d d e r (L) s l o t s c o n t a i n e d t w i c e t h a t amount. E l e c t r o p h o r e s i s was a t c o n s t a n t power (30 w a t t s ) u n t i l t h e BB dye r e a c h e d t he bottom o f the g e l . A u t o r a d i o g r a p h y was f o r 6. days a t -20° u s i n g Kodak " n o - s c r e e n " f i l m . ) [ 3 ' - 3 2 P ] t R N A 2 b r was p r e p a r e d by l a b e l l i n g 1 yg t R N A ^ r w i t h RNA l i g a s e a n d ' l . S uM *pCp (~ 100 Ci/mmole). P a r t i a l h y d r o l y s e s were as d e s c r i b e d r f o r p a r t (a) above. -E ( n o t shown), T, and U s l o t s c o n t a i n e d 4100 Cerenkov cmp, w h i l e . t h e Phy, A, and L s l o t s c o n t a i n e d t w i c e t h a t ^ a m o u n t E l e c t r o p h o r e s i s was for...2.5. h r . a t " 1600V on a 2 5 % ' p o l y a c r y l a m i d e g e l . A u t o r a d i o g r a p h y was; for~T0" Tdays a t ^20° u s i n g Kodak" " n o - s c r e e n " X-ray f i lm. - 9 6 -s * I III I I I t» < nui II i I s I I S E s I n II II O O O G < < Q Q O 0 0 < 0 0 00 0 3 O O < - 97 -ber F i g u r e 10 - S t a n l e y / V a s s i l e n k o sequence a n a l y s i s o f t f W ^ . (a) Samples o f p u r i f i e d t R N A ^ (1 u g / s l o t ) were p a r t i a l l y h y d r o l y z e d i n 8 mM NH^OAc (pH 4.6) i n a s e a l e d c a p i l l a r y t u b e * r a d i o l a b e l l e d as d e s c r i b e d i n C h a p t e r I I , t h e n s e p a r a t e d by e l e c t r o p h o r e s i s on a 12% p o l y a c r y l a m i d e g e l as shown. E l e c t r o p h o r e s i s ( a t 20 w a t t s , c o n s t a n t ) was f o r 4.7 h r . o r f o r 2.5 h r . A u t o r a d i o g r a p h y was f o r 11 h r . a t -20° u s i n g Kodak XR-1 X- r a y f i l m . 32 (b) The 5 ' - t e r m i n a l n u c l e o t i d e s (*pNp's) o f [ P] o l i g o n u c l e o t i d e s s e p a r a t e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s were a n a l y z e d by PEI c e l l u l o s e chromatography as d e s c r i b e d i n C h a p t e r I I . N u c l e o t i d e s a r e r e p r e s e n t e d by symbols f o r the bas,es, w i t h p o s i t i o n s i n the tRNA sequence ( F i g u r e 12) i n d i c a t e d below. 32 (c) The 5 ' - t e r m i n a l n u c l e o t i d e s (*pN's) o f some [ P] o l i g o n u c l e o t i d e s were a n a l y z e d by chromatography on c e l l u l o s e t h i n l a y e r p l a t e s d e v e l o p e d e i t h e r i n s o l v e n t A o r i n s o l v e n t B as d e s c r i b e d i n C h a p t e r I I . The n u c l e o t i d e s a r e r e p r e s e n t e d by symbols f o r the b a s e s , w i t h p o s i t i o n s i n the tRNA sequence ( F i g u r e 12) i n d i c a t e d below. (d) The *pN from p o s i t i o n 37 a d j a c e n t t o t h e t R N A ^ r a n t i c o d o n was a n a l y z e d by two d i m e n s i o n a l c e l l u l o s e t h i n l a y e r chromatography as d e s c r i b e d i n C h a p t e r I I . The sample c o n t a i n e d l e s s t h a n 200 Cerenkov cpm. A u t o -r a d i o g r a p h y was f o r 18 days a t -20° u s i n g Kodak XR-1 X-ray f i l m . - 97 a -c pA » PC PU pG IP 12 16 17,18 17 19 JO 26 27 28 32 mV V T m^C n?C 67 64 63 57 30 44 44.45 39 37 32 Solvent A pG t • pA 12 16 17,18 17 19 20 26 W « 27 28 » 64 63 57 50 44 44.45 39 37 32 Solvent B - 99 -a n a l y s i s o f tRNA^ 1" by the s i m i l a r method o f Tanaka e t a l _ . (54) showed a s i n g l e s p o t a t t h i s p o s i t i o n , w i t h an e l e c t r o p h o r e t i c m o b i l i t y o f the pNp c o n s i s t e n t w i t h t h a t e x p e c t e d f o r p t Ap o r pmt Ap ( F i g . l i b ) . Whether t h e h e t e r o g e n e i t y o b s e r v e d a t p o s i t i o n 37 i n S t a n l e y / V a s s i l e n k o a n a l y s i s r e f l e c t s p a r t i a l m o d i f i c a t i o n o f t A t o mt A i n v i v o o r p a r t i a l breakdown a t some s t a g e o f sample p r e p a r a t i o n i s n o t c l e a r . However, I have a s s i g n e d fi 6 mt A t o p o s i t i o n 37, w i t h t h e r e s e r v a t i o n t h a t s i g n i f i c a n t amounts o f t A S e r may be p r e s e n t t h e r e i n tRNA,^ i n v i v o . Use o f r i b o n u c l e a s e l ^ i n S t a n l e y / V a s s i l e n k o e x p e r i m e n t s r a t h e r than 0.2M NaOH a l l o w e d t h e c h r o m a t o g r a p h i c p r o p e r t i e s o f pDp and prn^Ap (as w e l l as pm 7Gp; C h a p t e r V) i n 0.8 M ammonium s u l f a t e on PEI c e l l u l o s e t o be e s t a b l i s h e d . The m o b i l i t i e s o f a number o f pNp's from s e r i n e tRNAs and from t R N A g y S ( C h a p t e r V) a r e shown i n T a b l e 2. Spy* The n u c l e o t i d e sequence o f tRNAg^ from p o s i t i o n s 13-75 was a n a l y z e d by the method o f Tanaka, Dyer, and Brownlee (54) as w e l l as by S t a n l e y / V a s s i l e n k o and gel " r e a d - o f f " methods. Ex p e r i m e n t s u s i n g the method o f Tanaka e t al_. gave v e r y c l e a r r e s u l t s ( F i g . 11) a l l o w i n g most Ser o f the tRNA2(;) sequence to be r e a d unambiguously. In t h e s e e x p e r i m e n t s , two a l i q u o t s o f t h e same sample were e l e c t r o p h o r e s e d i n a d j a c e n t l a n e s o f a p o l y a c r y l a m i d e g e l . One l a n e was used f o r t h e s e t w o - d i m e n s i o n a l " r e a d -o f f " e x p e r i m e n t s , w h i l e i n d i v i d u a l bands from the o t h e r l a n e were l o c a t e d by a u t o r a d i o g r a p h y , e x c i s e d and t r e a t e d as usual i n my S t a n l e y / V a s s i l e n k o p r o t o c o l . O n l y the e x p e r i m e n t a l l o w i n g i d e n t i f i c a t i o n o f m o d i f i e d n u c l e o t i d e s from the 3' h a l f o f t R N A ^ r as t h e *pNs i s shown ( F i g . 10c, l O d ) , as the sequence i s o t h e r w i s e more c l e a r l y r e a d from the t w o - d i m e n s i o n a l a r r a y s i n F i g . 11. - 100 -F i g u r e 11 - Two-dimensional " r e a d - o f f " sequence a n a l y s i s o f t R N A ~ f r ; a v a r i a t i o n on S t a n l e y / V a s s i l e n k o . 2 b Two samples o f ~ 0.5 ug each g e l - p u r i f i e d t R N A 2 b ( h y d r o l y z e d 10 min. a t 100° i n 98% formamide) were l a b e l l e d w i t h p o l y n u c l e o t i d e k i n a s e and 4 uM 32 32 [ y - P]ATP (2000 Ci/mmole). The [ P] o l i g o n u c l e o t i d e s were s e p a r a t e d by e l e c t r o p h o r e s i s on 20% p o l y a c r y l a m i d e g e l s a t a c o n s t a n t power o f 18 w a t t s u n t i l t he XC dye had m i g r a t e d t o 45% (a) o r 95% (b) the l e n g t h o f the g e l . A f t e r t r a n s f e r , d i g e s t i o n w i t h RNase Tr, i n s i t u , and e l e c t r o p h o r e s i s i n t h e second d i m e n s i o n (3 h r . a t 250V), t h e D E A E - c e l l u l o s e p l a t e s were a i r - d r i e d and exposed to " s c r e e n " X - r a y f i l m f o r 16 h r . - 101 -Q . 3 C U A C C C U A ,,'A G C l T GGGU GnfcGCACG 5 7 5 70 65 60 55 b_ I • 1 * • 3' G U G m5C G C A C G Um^UCGUyQAACCUlA HUCGIA^CAGG 5' 60 55 50 40 35 30 - 102 -T a b l e 2 - M o b i l i t i e s o f n u c l e o s i d e - 5 1 , 3 ' - b i s p h o s p h a t e s on PEI c e l l u l o s e 9 . pNp pup pUp 1.00 pTp 1.00 p # 0.94 pDp 1.06 pAp 0.66 pm 6Ap 0.75 p i 6 A p 0.52, 0.61 C p i p 0.84 pCp 0.83 = 3' ( 0 . 7 9 ) d pm 3Cp 1.12 pGp 0.47 = 3' ( 0 . 4 0 ) d pm 7Gp 1.08 pm 2Gp 0.83 pm Cp 0.85 2 pm Gp 0.61 4 pac Cp 1.04 pn^Ap 1.12 a - Devel o p e d w i t h 0.80 M ammonium s u l f a t e (pH 5.3) a t room t e m p e r a t u r e , b - M o b i l i t y r e l a t i v e t o pUp. c - Two s p o t s , f o r t h e 2' and 3 ' - i s o m e r s , a r e found, d - M o b i l i t y v a l u e f o r t h e 2'-isomer. - 103 -£ O H " 8 5 c C - G G - C 5 - A - U ,c G " C 70 » G " C . U ^ ; U A I A G A 10 U V ^ r ? ? m £ n %rrG G U G G G c e G G G C G c ~ 5 5 D A M 2 G , . / , A C G D A 2 , UMQ, I / « M f - A U G p ^ 3 C 5 0 20 ij) - A ^ u ~ G ~ C 30 - G - C - 4 ° m 3 C A U mt6A G c U i 35 t R N A S e r 2b F i g u r e 12 - C l o v e r l e a f s t r u c t u r e o f tRNA^P r. CD - 104 -The 3 ' - t e r m i n a l CCA o f t R N A ^ r was d e t e r m i n e d by gel " r e a d - o f f " a n a l y s i s o f 3'-end l a b e l l e d tRNA ( F i g . 9 c ) , w h i l e sequence s l i g h t l y f u r t h e r 5' was d e t e r m i n e d by a n a l y s i s o f both 5'- and 3'-end l a b e l l e d RNAs ( F i g . 9b and 9 c ) . P o s s i b l e a m b i g u i t i e s i n i n t e r p r e t a t i o n o f " r e a d - o f f " e x p e r i m e n t s between p o s i t i o n s 81 and 73 were c l a r i f i e d by "wandering s p o t " a n a l y s i s o f 3'-end l a b e l l e d t R N A ^ r ( r e s u l t s n o t shown). The complete n u c l e o t i d e sequence o f t R N A 2 b i s p r e s e n t e d as a " c l o v e r l e a f " s t r u c t u r e i n F i g . 12. C. D i s c u s s i o n C . l . t Sequences o f i n d i v i d u a l s e r i n e tRNAs from D. m e l a n o g a s t e r The n u c l e o t i d e sequences o f t R N A ^ , t R N A 4 e r , and t R N A 7 e r from D r o s o p h i l a m e l a n o g a s t e r a r e u n r e m a r k a b l e . Each f i t s w e l l w i t h the g e n e r a l i z e d " c l o v e r l e a f " s t r u c t u r e o f R i c h and RajBhandary ( R e f . 8; F i g . 2 i n C h a p t e r I above) w i t h r e s p e c t t o stem l e n g t h s , i n v a r i a n t and s e m i - i n v a r i a n t n u c l e o s i d e s . Ser C.2. R e c o g n i t i o n o f D r o s o p h i l a tRNAs by s e r y l - t R N A s y n t h e t a s e The f e a t u r e s o f D r o s o p h i l a s e r i n e tRNAs r e c o g n i z e d by s e r y l -tRNA s y n t h e t a s e must be p r e s e n t i n a l l t h r e e tRNAs examined h e r e , r e g a r d -l e s s o f a n t i c o d o n . T h e r e a r e many homologous p o s i t i o n s i n a l l t h r e e tRNA sequences which c o u l d be r e c o g n i t i o n s i t e s f o r t h i s enzyme. I s u g g e s t t h a t the minimum number o f r e c o g n i t i o n s i t e s r e q u i r e d can be e s t i m a t e d , and some p o t e n t i a l r e c o g n i t i o n s i t e s i d e n t i f i e d , i n t h e f o l l o w i n g way. I t - 105 -may be t h a t s y n t h e t a s e r e c o g n i t i o n o f co g n a t e v e r s u s non-cognate tRNAs can be e x p r e s s e d as a s e t o f y e s - o r - n o d e c i s i o n s a t s p e c i f i c tRNA s t r u c -t u r a l " d e t e r m i n a n t s " . I f s o , each o f t h e twenty i s o a c c e p t o r tRNA f a m i l i e s would n e c e s s a r i l y c o n t a i n a t l e a s t f i v e " d e t e r m i n a n t s " ( y e s - o r - n o y i e l d s 5 two a l t e r n a t i v e s a t a " d e t e r m i n a n t s i t e " ; 2 = 32 > 20) . Each "determinant"" would be i n d e p e n d e n t l y r e c o g n i z e d by s y n t h e t a s e s as c o r r e c t o r d i s c a r d e d as i n c o r r e c t . Such " d e t e r m i n a n t s " might c o m p r i s e t he p r e s e n c e o f a p a r t i c u l a r base ( s t a n d a r d , o r m o d i f i e d ) i n a p a r t i c u l a r p o s i t i o n i n the t h r e e d i m e n s i o n a l c o n f i g u r a t i o n ; o r more s u b t l e f e a t u r e s , such as the p r e s e n c e o r absence o f a p u r i n e r i n g , a p y r i m i d i n e r i n g , o r perhaps a s u b s t i t u e n t such as a k e t o - f u n c t i o n i n the c o r r e c t p l a c e . R e c o g n i t i o n o f tRNA by the c o g n a t e s y n t h e t a s e would r e q u i r e a l l " y e s " answers; one "no" would r e s u l t i n r e j e c t i o n by t h e enzyme. The d i f f i c u l t i e s e n c o u n t e r e d by r e s e a r c h e r s t r y i n g t o e l u c i d a t e t h e n a t u r e o f tRNA r e c o g n i t i o n by s y n t h e t a s e demon-s t r a t e t h a t t he r e c o g n i t i o n p r o c e s s i s a complex one ( r e v i e w e d i n r e f . 161). The sequence d a t a p r e s e n t e d above a r e c e r t a i n l y i n s u f f i c i e n t to a l l o w . ' i d e n t i f i c a t i o n o f a l l such d e t e r m i n a n t s on tRNAs from D r o s o p h i l a . However, i t may be p o s s i b l e t o i d e n t i f y some o f them. I f we assume t h a t t h e model f o r s y n t h e t a s e b i n d i n g p r o p o s e d by R i c h and Schimmel ( 1 6 2 ) , which s u g g e s t s b i n d i n g a l o n g t h e i n s i d e o f the L-shaped tRNA m o l e c u l e ( F i g . 3 ) , i s c o r r e c t , we can d i s c a r d s u b s t a n t i a l b l o c k s o f s h a r e d sequence i n t h e D and T^C l o o p s - ( t h e s e a r e l o c a t e d on the o u t s i d e o f t h e L ) . I f we f u r t h e r assume e x t e n s i v e c o n s e r v a t i o n o f r e c o g n i t i o n r e q u i r e m e n t s between D r o s o p h i l a and r a t l i v e r s e r y l - t R N A s y n t h e t a s e s (which may w e l l SPY* SPY* be t r u e , s i n c e r a t l i v e r tRNA- i s n e a r l y i d e n t i c a l to D r o s o p h i l a tRNA^f , - 106 - o i n c l u d i n g m o d i f i c a t i o n s ) , we can c o n s i d e r the r a t l i v e r and D r o s o p h i l a SPY/1 tRNAs t o g e t h e r f o r homology. W i t h i n t h e s e c o n s t r a i n t s , numerous p o s s i b i l i t i e s r e m a i n . P o s s i b l e s i t e s i n v o l v e d i n s p e c i f i c s y n t h e t a s e r e c o g n i t i o n might i n c l u d e the D stem ( e s p e c i a l l y the a c e t y l s u b s t i t u e n t 3 i n p o s i t i o n 1 2 ) , G a t p o s i t i o n 82 i n the a m i n o a c y l stem, and Um CU a t the t i p o f the e x t r a arm. A l l o f t h e s e p o s i t i o n s a r e c o n s e r v e d among s i x S e r r a t l i v e r and D r o s o p h i l a tRNA seq u e n c e s . I have l a r g e l y a v o i d e d s u g g e s t i n g as p o s s i b l e r e c o g n i t i o n s i t e s n u c l e o s i d e s l o c a t e d i n stem s t r u c t u r e s ( f o r example G30-C40 and A31-i^39), Phe o r t h o s e t h a t a r e l i k e l y by a n a l o g y w i t h y e a s t tRNA to be i n v o l v e d i n 5 t e r t i a r y i n t e r a c t i o n s n e c e s s a r y f o r compact tRNA f o l d i n g ( s u c h as m C a t p o s i t i o n 5 7 ) , though such n u c l e o s i d e s meet the o t h e r c o n s t r a i n t s imposed above. I t i s d o u b t f u l t h a t the p o s i t i o n s I have s u g g e s t e d a r e s u f f i c i e n t f o r c o r r e c t r e c o g n i t i o n . H e t e r o l o g o u s a m i n o a c y l a t i o n e x p e r i m e n t s i n v o l v i n g Spy/* tRNAs and s e r y l - t R N A s y n t h e t a s e s from y e a s t , D r o s o p h i l a , and r a t l i v e r might h e l p c l a r i f y t h i s p o i n t . b e r C. 3. Homologies among e u k a r y o t i c s e r i n e tRNAs; tRNA gene e v o l u t i o n The n u c l e o t i d e sequences o f 10 e u k a r y o t i c s e r i n e tRNAs from S. c e r e v i s i a e , D. m e l a n o g a s t e r , and r a t . l i v e r were examined f o r sequence h o m o l o g i e s ( F i g . 1 3 ) . S i g n i f i c a n t homology (> 66%) e x i s t s between any p a i r o f tRNAs i n t h i s group. Indeed, 43 o f 85 p o s i t i o n s {'51%) a r e c o n s e r v e d i n a l l t e n tRNAs, d i s c o u n t i n g d i f f e r e n c e s i n m o d i f i c a t i o n ( F i g . 1 4 ) . D. m e l a n o g a s t e r tRNAs a r e g e n e r a l l y l e s s homologous to tRNAs from % homology Yeast minor (CGA) Yeast minor (U*GA Yeast 1 (IGA) Yeast 2 (IGA) Rat liver 1 (IGA) Rat liver 2a (CGA r Rat liver 3 (GCU) Drosophila 4 (CGA Drosophila 7 (IGA Drosophila 2b (GC Y e a s t minor ( C G A ) a ^ — 96 85 88 76 86 71 69 66 69 Y e a s t minor (U*GA) a^ -- -- 85 88 76 85 71 70 68 69 Y e a s t 1 (IGA) -- -- — 96 80 85 74 67 67 70 Y e a s t 2 (IGA) — -- -- -- 79 84 73 68 68 71 Rat l i v e r 1 (IGA) -- -- -- -- -- 96 76 76 78 , 74 Rat l i v e r 2a ( C G A ) b ) -- -- — -- -- -- 81 80 77 84 Rat l i v e r 3 (GCU) -- -- -- — -- — — 69 68 98 D r o s o p h i l a 4 (CGA) -- -- — -- — — — -- 96 72 D r o s o p h i l a 7 (IGA) — -- — — -- -- -- -- ,73 D r o s o p h i l a 2b (GCU) -- -- -- — -- -- -- — — — F i g u r e 13 - Sequence homologies between e u k a r y o t i c s e r i n e tRNAs Sequences f o r y e a s t minor s e r i n e tRNAs taken from r e f . 67. Complete sequence o f 2a n o t de t e r m i n e d . Comparison o n l y f o r 70 p o s i t i o n s d e t e r m i n e d f o r r a t l i v e r tRNASer ( r e f . 176). ca - 108 -F i g u r e 14 - Sequences o f e u k a r y o t i c s e r i n e tRNAs The n u c l e o t i d e sequences o f s e v e r a l s e r i n e tRNAs a r e shown, w i t h base m o d i f i c a t i o n s i n d i c a t e d above t h e l i n e s and r i b o s e - m e t h y l a t i o n s i n d i c a t e d below t h e l i n e s . The sequences c o r r e s p o n d t o the f o l l o w i n g t R N A S e r s p e c i e s : 1, tRNA S (T (CGA) from S. c e r e v i s i a e ; 2, t R N A S e r  r minor x ' minor (U*GA) from S. c e r e v i s i a e ; 3, t R N A ^ e r from S. c e r e v i s i a e ; 4, t R N A ^ from S. c e r e v i s i a e ; 5, tRNA^ from r a t l i v e r ; 6, t R N A 2 a f r o m r a t l i v e r ; 7, tRNA^ 1" from r a t l i v e r ; 8, t R N A ^ r from D. m e l a n o g a s t e r ; 9, t R N A ^ from D. m e l a n o g a s t e r ; and 10, t R N A y e r from D. m e l a n o g a s t e r . The l i n e s beneath t he D. m e l a n o g a s t e r tRNAy sequence (#10) i n d i c a t e p o s i t i o n s where th e base i s c o n s e r v e d i n a l l t e n sequences ( n o t c o u n t i n g m o d i f i c a t i o n 1 d i f f e r e n c e s ) . The n u c l e o t i d e sequences i n t h e f i g u r e were taken from r e f . 67 (#1,2), r e f . 176 (#6), C h a p t e r I I I o f t h i s t h e s i s (#8,9,10), o r r e f . 7 (#3,4,5,7). 4 2 3 • .6 5 ac m„ m 1 • M Cl V- 111 A "» pGGCACUAUGGCCGAGDGGDDAAGGCGAGAGACUCGAAAiJ;CUCUUGGGCUCUGCCCGCGCUGGTif;'CAAAUCCUGCUGGUGUCGCCA 1 m m 4 2 3 . 6 5 ac m . m ^ x m pGGCACUAUGGCCGAGDGGDDAAGGCGACAGACUUGAAAi|>CUGUUGGGCUCUGCCCGCGCUGGT!pCAAAUCCUGCUGGUGUCGCCA 2 m m 4 2 ,6 5 ac m i m pGGCAACUUGGCCGAGDGGDDAAGGCGAAAGAi/ylll GAAA^CUUUUGGGCUUUGCCCGCGCAGGT^CGAGUCCUGCAGUUGUCGCCA 3 m m 4 2 ' 4 6 5 ac i m pGGCAACUUGGCCGAGDGGDDAAGGCGAAAGA^UI GAAAi^CUUUUGGGCUCUGCCCGCGCAGGTipCAAAUCCUGCAGUUGUCGCCA 4 m m ' 4 2 3 .6 3 5 1 ac m m l m m m pGUAGUCGUGGCCGAGDGGDDAAGGCGAi''CGACUIGAAA^CCAUUGGGGUCUCCCCGCGCAGGTiJ;CGAAUCCUGCCGACUACGCCA 5 m m m 4 2 3 . 6 3 5 1 ac m 9 m l m m m pG GGCCGAGDGGDDAAGGCG^iOGGACUCGAAAiJJCCAAUGGGGUCUCCCCGCGCAGGT^CGAAUCCUG GCCA 6 m m m 4 2 3 6 3 5 1 ac m„ m mt m m m pGACGAGGUGGCCGAGDGGDDAAGGCGAiJ;GGACUGCUAA^CCAUUGiJ;GCUCUGCACGCGUGGGH(JCGAAU.CCCAUCCUCGUCGCCA 7 m m 4 2 3 6 3 5 1 ac m m mt m m m pGACGAGGUGGCCGAGDGGDDAAGGCG^GGACUGCUAA^CCAAUGUGCUCUGCACGCGUGGGT^CGAAUCCCAUCCUCGUCGCCA 8 m m 4 2 3 , 6 3 5 1 ac m m I m m m pGCAGUCGUGGCCGAGDGGDDAAGGCGDCUGACUCGAAAipCAGAUUCCCUCUGGGAGCGUAGGT^CGAAUCCUACCGGCUGCGCCA g m m m 4 2 3 . 6 ' 3 5 1 ac m m l m m m p GCAGUCGUGGC CGAGCGGDDAAGGCGUCUGACUI GAAAiJjCAGAUUCCCUCUGGGAG CGUAGGT^CGAAUCCUACCGACUGCGC CA 10 m m m FIGURE 14 - n o -the y e a s t S. c e r e v i s i a e than t o t h o s e from r a t l i v e r . However, r a t l i v e r t R N A s S e r a r e e q u a l l y homologous w i t h D r o s o p h i l a and y e a s t s e r i n e tRNAs. U n f o r t u n a t e l y , the sequence f o r r a t l i v e r t R N A ^ r ( a n t i c o d o n CGA; r e f . S e r 176) i s i n c o m p l e t e , w h i l e no sequence has been r e p o r t e d f o r a y e a s t tRNA w i t h a n t i c o d o n GCU, l i m i t i n g the v a l u e o f such c o m p a r i s o n s . N o n e t h e l e s s , i t may be p o s s i b l e t o draw l i m i t e d c o n c l u s i o n s a t t h i s p o i n t r e g a r d i n g t h e e v o l u t i o n o f e u k a r y o t i c s e r i n e tRNA genes. The t R N A s S e r w i t h a n t i c o d o n s IGA and GCU from D r o s o p h i l a and r a t SP Y* l i v e r have been sequenced. T r a n s f e r RNA-j (IGA) from r a t l i v e r i s 76% homologous to tRNA^ (GCU) from the same o r g a n i s m , d i f f e r i n g a t 20 o f 85 p o s i t i o n s . S i m i l a r l y , the D r o s o p h i l a tRNAs,. t R N A ^ e r (IGA) and t R N A ^ (GCU) a r e 73% homologous, d i f f e r i n g a t 23 o f 85 p o s i t i o n s . As shown i n F i g . 15, the s i t e s t h a t d i f f e r between between t R N A s S e r (IGA and GCU) i n t h e s e o r g a n i s m s a r e not d i s t r i b u t e d .randomly. S i x t e e n o f t h e 20 ( r a t l i v e r ) o r 23 (D. m e l a n o g a s t e r ) d i f f e r i n g s i t e s i n the tRNA " c l o v e r l e a f " c o i n c i d e . P a r t i c u l a r l y s t r i k i n g i s the r e l a t i o n s h i p seen w i t h e u k a r y o t i c s e r i n e tRNAs s p e c i f i c f o r UCN codons. D. m e l a n o g a s t e r t R N A ^ e r and t R N A ^ e r a r e 96% homologous, m a t c h i n g a t 82 o f 85 p o s i t i o n s . One o f t h e t h r e e d i f f e r e n c e s i s i n f i r s t p o s i t i o n o f t h e a n t i c o d o n ( t h e "wobble" p o s i t i o n ) . Four s e r i n e tRNAs from y e a s t r e a d i n g UCN codons have been sequenced: t R N A ^ e r ( a n t i c o d o n IGA), t R N A ^ e r ( I G A ) , t R N A ^ (CGA), and tRNAj^JJ (U*GA). Ser T r a n s f e r RNA 2 , t h e predominant s p e c i e s w i t h a n t i c o d o n IGA, i s 88% homolo-SPV SPY* gous t o both t R N A U C G and t R N A ^ . The l a t t e r two tRNAs a r e 96% homologous. They d i f f e r a t o n l y t h r e e p o s i t i o n s , one b e i n g the "wobble" p o s i t i o n o f the a n t i c o d o n . (The o t h e r two changes a r e t h e r e s u l t o f a G-C t o C-G - m -F i g u r e 15 - Comparison o f p o s i t i o n s d i f f e r i n g between s e r i n e tRNAs w i t h a n t i c o d o n s IGA and GCU i n D r o s o p h i l a and r a t l i v e r . The c l o v e r l e a f s t r u c t u r e o f tRNA 2, from D r o s o p h i l a m e l a n o g a s t e r (which d i f f e r s from r a t l i v e r tRNA 3 by a s i n g l e base p a i r ) i s shown. S o l i d l i n e s a d j a c e n t t o the c l o v e r l e a f s t r u c t u r e i n d i c a t e p o s i t i o n s d i f f e r i n g between D r o s o p h i l a t R N A ^ (GCU) and t R N A ^ e r (IGA). Wavy l i n e s i n d i c a t e p o s i t i o n s d i f f e r i n g between r a t l i v e r t R N A ^ e r (GCU) and t R N A ^ e r ( I G A ) . - 112 -AQH C m ii m U G - C ^ C C U A J A G4CCGG 5 G M G G T , C G ac GGC GQ>^ ^  m 3 C A U mt6A GcU F i g u r e "lb. - 113 -t r a n s v e r s i o n i n the a n t i c o d o n stem.) The p a r t i a l sequence o f r a t l i v e r Cpy. Ser t R N A ^ (CGA) d i f f e r s from the c o m p l e t e d sequence o f r a t l i v e r tRNA-j (IGA) a t 3 o f 70 c o r r e s p o n d i n g p o s i t i o n s . As w i t h the y e a s t tRNAs men-t i o n e d above, two o f the d i f f e r e n c e s a r e the r e s u l t o f a base p a i r t r a n s -v e r s i o n i n t h e a n t i c o d o n stem (ip-A t o A-U) w h i l e t h e t h i r d i s i n t h e " "wobble" p o s i t i o n o f the a n t i c o d o n . Though t R N A s ^ e r w i t h t h e same a n t i -codon (IGA o r CGA) from t h e s e o r g a n i s m s d i f f e r by up t o 32% ( F i g . 1 3 ) , tRNAs w i t h d i f f e r e n t a n t i c o d o n s w i t h i n each s p e c i e s a r e n e a r l y i d e n t i c a l . T h i s h i g h e x t e n t o f homology c a n n o t be r e q u i r e d f o r s e r i n e tRNAs i n t h e s e o r g a n i s m s t o f u n c t i o n i n p r o t e i n s y n t h e s i s , s i n c e s e r i n e tRNAs r e a d i n g AGPy codons i n r a t l i v e r and D. m e l a n o g a s t e r d i f f e r from t h o s e r e a d i n g S e r UCN codons by up t o 30%. The e x i s t e n c e o f t h e s e v e r y s i m i l a r tRNAs w i t h d i f f e r e n t s p e c i f i c i t i e s r a i s e s t h e q u e s t i o n o f how t h e i n t e g r i t y o f r e i t e r a t e d genes i s m a i n t a i n e d i n e u k a r y o t e s . One i n t e r p r e t a t i o n o f t h e s e d a t a i s t h a t t h e genes f o r e u k a r y o t i c S e r tRNAs s p e c i f i c f o r UCN codons a r e i n some sense e v o l u t i o n a r i l y " l i n k e d " , and c a n n o t e v o l v e i n d e p e n d e n t l y . (Such an i n t e r p r e t a t i o n i s r e l e v a n t t o t h e d i s c u s s i o n o f C h a p t e r IV, d e a l i n g w i t h tRNA i n D. m e l a n o g a s t e r ) . I t i s c u r i o u s , and may w e l l be s i g n i f i c a n t , t h a t the v e r y s i m i l a r p a i r s o f t R N A s S e r i n D r o s o p h i l a and r a t l i v e r ( a n t i c o d o n s IGA and CGA) a r e n o t e q u i v a l e n t t o the p a i r i n y e a s t (U*GA and CGA). T h i s s u g g e s t s t h a t the e v o l u t i o n o f e u k a r y o t i c s e r i n e tRNA genes has been q u i t e a complex p r o c e s s . I t must be c o n c l u d e d here t h a t too few e u k a r y o t i c t R N A ^ e r sequences a r e known to a l l o w e x t e n s i v e c o n c l u s i o n s t o be drawn c o n c e r n i n g e v o l u t i o n o f t h e i r genes. - 114 -Ch a p t e r IV S T R U C T U R E AND O R G A N I Z A T I O N O F S E R I N E TRNA G E N E S I N D R O S O P H I L A A. R e s u l t s Dunn e_t a]_. (114) i s o l a t e d seven r e c o m b i n a n t p l a s m i d s c o n t a i n i n g D. m e l a n o g a s t e r DNA t h a t h y b r i d i z e tRNA^J.. T h r e e o f t h e s e (pDt 1, pDt 5, and pDt 81) were shown by r e s t r i c t i o n a n a l y s i s and S o u t h e r n b l o t t i n g e x p e r i m e n t s (114) t o c o n t a i n t he same i n s e r t . By i n s i t u h y b r i d i z a t i o n o f r a d i o l a b e l 1 e d p l a s m i d t o p o l y t e n e chromosomes, pDt 5 was shown t o d e r i v e from t he minor t R N A ^ y s i t e a t 23E on chromosome 2L ( 1 1 4 ) . The f o u r r e m a i n i n g p l a s m i d s - pDt 16, pDt 17R, pDt 27R, and pDt 73 - a l l d e r i v e from t h e 12DE r e g i o n o f t h e X chromosome (114,155,156). These p l a s m i d s were chosen f o r f u r t h e r s t u d y . A . I . R e s u l t s o f S o u t h e r n b l o t a n a l y s i s o f r e c o m b i n a n t p l a s m i d s u s i n g  t e t r a m e r - r e c o g n i z i n g r e s t r i c t i o n enzymes The DNAs o f pDt 16, pDt 17R and pDt 73 were c l e a v e d by t h e r e s t r i c t i o n enzymes Hae I I I (GG +CC), Msp_ I (C +CGG), and Sau96'I (G^GNCC), s e p a r a t e d a c c o r d i n g t o s i z e on a 5% p o l y a c r y l a m i d e g e l , d e n a t u r e d and b l o t t e d onto n i t r o c e l l u l o s e f i l t e r s ( 1 5 0 ) , then h y b r i d i z e d w i t h [ 3 ' -32 S er P] tRNAy . The r e s u l t i n g p a t t e r n i s shown i n F i g . 16a. The DNAs o f pDt 27R, pDt 17R, and pDt 73 were c l e a v e d by the r e s t r i c t i o n enzymes Tag_ I « - 115 -F i g u r e 16 - S o u t h e r n b l o t a n a l y s i s o f r e c o m b i n a n t p l a s m i d s h y b r i d i z i n g D r o s o p h i l a s e r i n e tRNAs. (a) P l a s m i d DNAs ( l u g / s l o t ) were d i g e s t e d w i t h Mj>£ I, Hae_ I I I , o r Sau96 I. The r e s u l t i n g fragments were s e p a r a t e d by e l e c t r o p h o r e s i s on a non-d e n a t u r i n g 5% p o l y a c r y l a m i d e g e l f o r 16 h r . a t 100V, t r a n s f e r r e d t o a 32 Spr n i t r o c e l l u l o s e membrane, h y b r i d i z e d w i t h [ 3 ' - PjtRNA^ and washed as d e s c r i b e d i n C h a p t e r I I . A u t o r a d i o g r a p h y was f o r 5.5 days a t -70° u s i n g a c t i v a t e d " s c r e e n " X-ray f i l m (as d e s c r i b e d i n Methods, r e f . 4 3 ) . (b) P l a s m i d DNAs (1 y g / s l o t pDt 17R and pDt 73, 2 u g / s l o t pDt 27R) were d i g e s t e d w i t h Tac[ I, FnuD I I , o r Ava I. The r e s u l t i n g fragments were t r e a t e d as i n ( a ) . A u t o r a d i o g r a p h y was f o r 53 h r . a t -70° u s i n g a c t i v a t e d Kodak XR-1 " s c r e e n X-ray f i l m (Methods, r e f . 4 3 ) . - 117 -(T^CGA), FnuD II (C^GCG), and Ava I (C^PyCGPuG) and a n a l y z e d as above ( F i g . 16b). From t h e s e e x p e r i m e n t s , s e v e r a l p o i n t s became c l e a r . F i r s t , s i n c e S e r Hae I I I and Tag I a r e b o t h e x p e c t e d t o c u t w i t h i n tRNA^ y genes based on t h e tRNA sequences ( F i g . 1 7 ) , i t i s p o s s i b l e t o e s t i m a t e the number o f genes p r e s e n t on each p l a s m i d . pDt 17R and pDt 73 both c o n t a i n a s i n g l e SPY* SGV tRNA gene, as a s i n g l e tRNAy - h y b r i d i z i n g fragment was g e n e r a t e d by each o f the s i x r e s t r i c t i o n enzymes used t o c l e a v e t h e s e p l a s m i d s ( F i g . 1 6 ) . S e r pDt 16 c o n t a i n s two o r more tRNA genes, s i n c e c l e a v a g e w i t h Hae I I I and Msp I r e s u l t s i n two h y b r i d i z i n g f r a g m e n t s ( F i g . 16a). C l e a v a g e o f pDt 16 w i t h Sau96 I produces a s i n g l e h y b r i d i z i n g fragment a p p r o x i m a t e l y S e r 1.2 kb i n l e n g t h . Thus, the two tRNA genes a r e l o c a t e d f a i r l y c l o s e t o g e t h e r . C l e a v a g e o f pDt 27R DNA w i t h Tag I and S o u t h e r n b l o t a n a l y s i s showed f o u r h y b r i d i z i n g f r a g m e n t s i n t h i s p l a s m i d w i t h l e n g t h s o f about 345 b.p., 370 b.p., 395 b.p., and 435 b.p. Tag I i s e x p e c t e d t o c l e a v e S P Y* S P Y* tRNA^ genes i n two p l a c e s , tRNAy genes i n one ( F i g . 1 7 ) . C o n c e i v a b l y , S e r c l e a v a g e a t one Tag I s i t e i n a tRNA^ gene might i n h i b i t c l e a v a g e a t t h e second a d j a c e n t s i t e i n t h e gene. I f s o , p a r t i a l c l e a v a g e o f a s i n g l e Ser S e r tRNA 4 gene might r e s u l t i n t h r e e tRNA - h y b r i d i z i n g f r a g m e n t s : two e x t e n d i n g from the f i r s t Tag I s i t e 5' t o the gene t o the two Tag I s i t e s i n t h e gene a t p o s i t i o n s 33-36 and 64-67 ( t h e numbering i s based on t h e S P. Y* tRNA^ y se q u e n c e s , F i g . 8 ) , and a t h i r d e x t e n d i n g from the Tag I s i t e a t S e r p o s i t i o n s 33-36 o f t h e tRNA^ sequences t o t h e f i r s t r e s t r i c t i o n s i t e 3' t o t h e gene. (The fragment e x t e n d i n g from p o s i t i o n 65 t o the f i r s t Tag I s i t e 3' t o the gene would not form s t a b l e h y b r i d s w i t h t R N A S e r , as shown by the s i n g l e h y b r i d i z i n g band produced by c l e a v a g e o f pDt 17R.) The SP Y* f o u r t h band would a r i s e from a tRNAy g e n e y i e l d i n g a s i n g l e h y b r i d i z i n g D CGA G Ser 4 _i _ , 1 .CCA C IGA A Ser 7 Hae HinfTaq Hinf TaqH in f Hpa Fnu4H o e r ****** — i 1 l _ i _ i—i 1 ' 1 Hae Hinf TaqH in f ^ S e r S e r F i g u r e 17 - R e s t r i c t i o n maps e x p e c t e d f o r tRNA 4 and tRNAy genes, - 119 -Tag I f r a g m e n t . C l e a v a g e o f pDt 27R w i t h Ava I gave two l a r g e h y b r i d i z i n g f r a g m e n t s , s u p p o r t i n g t h e i n t e r p r e t a t i o n t h a t t h i s p l a s m i d c o n t a i n s two o r more t R N A ^ e r sequences. D i g e s t i o n w i t h Tag I was n o t c o m p l e t e , as shown by the p r e s e n c e o f s e v e r a l l i g h t bands i n a d d i t i o n t o t h e f o u r s t r o n g bands on the a u t o r a d i o g r a p h ( F i g . 16b). However, the r o u g h l y equal i n t e n s i t i e s o f the f o u r h y b r i d i z i n g bands r e s u l t i n g from Tag I c l e a v a g e o f pDt 27R and the a d j a c e n t s i n g l e band r e s u l t i n g from c l e a v a g e o f a r o u g h l y e q u i v a l e n t amount o f pDt 17R DNA s u g g e s t s t h a t pDt 27R does c o n t a i n f o u r t R N A ^ e r genes, i n the absence o f d i r e c t e v i d e n c e t o the c o n -t r a r y , t h i s s i m p l e s t i n t e r p r e t a t i o n o f the d a t a i s t h e p r e f e r r e d one. The d a t a shown i n F i g u r e s 16a and 16b t h e r e f o r e i n d i c a t e t h a t the C p Y* f o u r p l a s m i d s c o n t a i n a t o t a l o f e i g h t tRNA genes (one each i n pDt 17R and pDt 73, two i n pDt 16, and f o u r i n pDt 27R). As none o f the r e s t r i c -t i o n p a t t e r n s o b s e r v e d f o r t h e s e p l a s m i d s appear s i m i l a r , t h e r e seems t o be no r e a s o n t o s u s p e c t t h a t any p a i r o f the f o u r p l a s m i d s might be a l l e l i c . T h e r e f o r e , the 12DE r e g i o n o f the D. m e l a n o g a s t e r genome c o n -t a i n i n g t R N A S e r genes i n c l u d e s a t l e a s t 19 kb o f DNA sequence (encompassing the i n s e r t s o f the f o u r p l a s m i d s examined) and a t l e a s t e i g h t tRNA genes. T h i s i n t e r p r e t a t i o n i s c o n s i s t e n t w i t h r e s u l t s o f i n s i t u h y b r i d i -z a t i o n o f t R N A ^ y to p o l y t e n e chromosomes. Based on r e l a t i v e numbers o f s i l v e r g r a i n s o b s e r v e d a t d i f f e r e n t chromosomal r e g i o n s , i t can be e s t i m a t e d t h a t the 12DE r e g i o n o f the X chromosome c o n t a i n s r o u g h l y 5-10 t i m e s more Ser tRNA genes th a n the minor autosomal s i t e s ( 1 0 9 ) . Assuming one o r two genes a t the minor s i t e s , the g r a i n numbers a r e c o n s i s t e n t w i t h r o u g h l y 10 t o 20 genes a t the 12DE s i t e . - 120 -A.2. S t r a t e g y f o r DNA sequence a n a l y s i s o f r e c o m b i n a n t p l a s m i d s The s t r a t e g y f o r DNA sequence a n a l y s i s o f r e c o m b i n a n t p l a s m i d s c o n s i s t e d o f f o u r s t e p s , ( i ) The p l a s m i d was mapped w i t h r e s t r i c t i o n enzymes, and tRNA genes l o c a t e d i n t h e p l a s m i d by S o u t h e r n b l o t t i n g a n a l y s i s , ( i i ) Based on the map deduced, a DNA fragment c o n t a i n i n g the g e n e (s) was p u r i f i e d f o r sequence a n a l y s i s , ( i i i ) The r e s t r i c t i o n enzymes known from sequence a n a l y s i s o f t R N A ^ ^ t o c u t w i t h i n t R N A ^ e r genes were used to o b t a i n t h e gene sequence and some f l a n k i n g sequences by the method o f Maxam and G i l b e r t ( 1 5 2 ) . ( i v ) R e s t r i c t i o n enzyme s i t e s l o c a t e d o u t s i d e the genes were used t o sequence back i n t o the gene and v e r i f y the r e s t r i c t i o n s i t e s i n s i d e the gene used i n s t e p ( i i i ) . A.3. Sequence a n a l y s i s o f pDt 73 S o u t h e r n a n a l y s i s o f pDt 73 showed t h a t the s i n g l e tRNA gene was l o c a t e d w i t h i n a 520 b.p. Sau96 I fragment w h i c h , when i s o l a t e d a f t e r 32 [ 3 1 - P ] - l a b e l l i n g w i t h E. c o l i DNA p olymerase I (Klenow fragment) and 32 [a- P] dGTP, was found to c o n t a i n s i n g l e Hae I I I and Tag I r e s t r i c t i o n s i t e s r o u g h l y i n the m i d d l e . T h i s fragment was p u r i f i e d f o r f u r t h e r sequence a n a l y s i s by p r e p a r a t i v e p o l y a c r y l a m i d e gel e l e c t r o p h o r e s i s . I t was e x p e c t e d t o c o n t a i n a s i n g l e gene p l u s about,200 b.p. o f 5' and 3' f l a n k i n g sequences f o r comparison w i t h o t h e r t R N A ^ e r genes from 12DE and from autosomal s i t e s . V a r i o u s r e s t r i c t i o n e n d o n u c l e a s e s i t e s i n t h e 520 b.p. Sau96 I f ragment were s p e c i f i c a l l y 3'-end l a b e l l e d . T h i s was a c c o m p l i s h e d by by u s i n g the s p e c i f i c i t y o f E. c o l i DNA p olymerase I t o l a b e l e i t h e r t h e - 121 -Sau96 I ends ( 5 1 - e x t e n d e d , G GNCC) and s e p a r a t e t h e l a b e l l e d ends w i t h a second r e s t r i c t i o n enzyme; o r t o l a b e l t he ends g e n e r a t e d by c l e a v a g e w i t h a second enzyme. For example, c l e a v a g e o f the 520 b.p. Sau96 I fragment w i t h Tag I (T^CGA) a l l o w e d e x c l u s i v e l a b e l l i n g o f the Taci I ends oo w i t h [ a - P] dCTP and E. c o l i DNA polymerase I (Klenow f r a g m e n t ) . The two r e s u l t i n g s i n g l e e n d - l a b e l l e d fragments were p u r i f i e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s and s u b j e c t e d t o Maxam-Gilbert c h e m i c a l m o d i f i c a t i o n r e a c t i o n s . In t h e complementary e x p e r i m e n t , t h e 520 b.p. fragment was c l e a v e d by Taq^ I, l a b e l l e d a t t h e Sau96 I ends w i t h [ a - 3 2 P ] dGTP by E. c o l i DNA p o l y m e r a s e I (Klenow fragment) g e l - p u r i f i e d and sequenced. The n u c l e o t i d e sequence a t the Tag I r e s t r i c t i o n s i t e ( i n t h e gene) was v e r i f i e d by s e q u e n c i n g from the H i n d I I I s i t e j u s t 3' t o the gene. S p e c i f i c l a b e l l i n g o f t h e Hind I I I s i t e (A^AGCTT) w i t h [ d - 3 2 P ] dATP by E. c o l i DNA p o l y m e r a s e I a g a i n a l l o w e d the o n e - s t e p p u r i f i c a t i o n by p o l y a c r y l a m i d e gel e l e c t r o p h o r e s i s o f a s i n g l e - e n d l a b e l l e d s u b s t r a t e f o r the s e q u e n c i n g r e a c t i o n s . Note t h a t as t h e r e c o m b i n a n t p l a s m i d s c o n t a i n Hind I l l - c u t D.  m e l a n o g a s t e r DNA, t h e H i n d I I I s i t e a d j a c e n t t o the t R N A ^ e r g e n e o f pDt 73 marks t h e j u n c t i o n between i n s e r t and pBR 322 DNA sequences. Thus, o n l y e l e v e n n u c l e o t i d e s o f 3 ' - f l a n k i n g sequence c o u l d be d e t e r m i n e d f o r t h i s t R N A S e r gene. A l l n u c l e o t i d e s i n t h e sequence shown i n F i g . 18 were o b t a i n e d i n a t l e a s t two i n d e p e n d e n t e x p e r i m e n t s e x c e p t 139-167, which were o n l y o b t a i n e d once. Due t o t h e s c a r c i t y o f r e s t r i c t i o n s i t e s i n the v e r y A-T r i c h 5 ' - f l a n k i n g r e g i o n , l i t t l e o f the sequence was obtained..from both s t r a n d s . In r e g i o n s where the sequences o f both s t r a n d s were d e t e r m i n e d - 122 -F i g u r e 18 - N u c l e o t i d e sequence o f the tRNA g e n e - c o n t a i n i n g r e g i o n i n pDt 73. (a) The c o m p i l e d sequence o f the g e n e - c o n t a i n i n g r e g i o n i s shown (non-c o d i n g s t r a n d ) . The 474 gene sequence i s u n d e r l i n e d . (b) A r e s t r i c t i o n map o f the g e n e - c o n t a i n i n g r e g i o n i n pDt 73, i n d i c a t i n g t he e x t e n t s and d i r e c t i o n s o f sequences o b t a i n e d i n Maxam/Gilbert s e q u e n c i n g e x p e r i m e n t s , i s shown. S e v e r a l r e l e v a n t r e s t r i c t i o n enzyme c l e a v a g e s i t e s a r e i n d i c a t e d : S (Sau96 I ) , Hd ( H i n d I I I ) , T (Ta£ I ) , and Hf ( H i n f I ) . a. T h e N u c l e o t i d e S e q u e n c e o f p D t 7 3 10 2 0 3 0 4 0 5 0 GO . 7 0 8 0 9 0 100 T T A C G C A A A T T T A A T T G G A C A T A G A T A G A T A A C G C G T G A G T T T A A G T T C A A T T C T T A T C T A T T A A G T A T T T C G T T T A G G C G C A T T C C A A A G T A T T T A T A T 1 1 0 120 130 140 150 1G0 170 180 190 2 0 0 T T A G T T A T C A G T T C C G A A A T T C C A A T T T A T A T T A T C A G C T T A G G T T T T G C A C A A G A T A T G G A A A A T A T T T T T T G T T T T T G T A A A T T A A T A . T A A T A C T A T T 2 1 0 2 2 0 2 3 0 2 4 0 2 5 0 2 6 0 2 7 0 2 8 0 2 9 0 3 0 0 A A C T T T A T A T T A C T T T C T T A A A T T T T A T T G A T A T T T T T T G C G C A T A T A T C A A G G C A G T C G T G G C C G A G T G G T T A A G G C G T C T G A C T A G A A A T C A G A T T C C 3 10 3 2 0 3 3 0 3 4 0 C T C T G G G A G C G T A G G T T C G A A T C C T A C C G G C T G C G C T T G T A A G C T T s 4 7 4 3-Hf T Hd S 4-< 100 b.p. IN3 00 - 124 -F i g u r e 19 - Maxam-Gilbert sequence a n a l y s i s o f the s e r i n e tRNA gene i n pDt 73. (a) Sequence a n a l y s i s o f a Tag I/Sau96 I r e s t r i c t i o n fragment l a b e l l e d 32 a t t h e Taq_ I end w i t h [a- P]dCTP and E. c o l i DNA p o l y m e r a s e I ( l a r g e f r a g m e n t ) . The sequence shown i s on t h e n o n - c o d i n g s t r a n d . P o s i t i o n s Spy* SPF d i s t i n g u i s h i n g tRNA, and tRNAy a r e i n d i c a t e d w i t h a r r o w s . Numbers Spy* i n d i c a t e t h e p o s i t i o n s i n t h e tRNA sequence ( F i g u r e 8 ) . (b) Sequence a n a l y s i s o f . a Hind I I I / S a u 9 6 I r e s t r i c t i o n f ragment l a b e l l e d a t t he H i n d I I I end w i t h [a- P]dATP and E. c o l i DNA p o l y m e r a s e I ( l a r g e f r a g m e n t ) . The sequence shown i s on t h e n o n - c o d i n g s t r a n d . P o s i t i o n 77 i s one o f t h r e e d i s t i n g u i s h i n g t R N A ^ e r from t R N A y e r ( F i g u r e 8 ) . - 125 -a C CT AG G -T 16 • A 34 G A AG CT ~G 52 G G A G G G T T C 65 G A A T C C T A C C G 77 C T -.126 -S G V the agreement was v e r y good (98-100%). The tRNA gene sequence was o b t a i n e d i n m u l t i p l e e x p e r i m e n t s . The o n l y ambiguous p o s i t i o n e n c o u n t e r e d S e r i n the gene sequence was the G a t p o s i t i o n 10 o f the tRNA^ 7 sequence, where a l i g h t band was c o n s i s t e n t l y e n c o u n t e r e d i n the G - s l o t o f a u t o -r a d i o g r a p h s . T h i s p o s i t i o n was c o n f i r m e d as G by c l e a v a g e o f a H i n f I ( 3 2P-dAMP)/Sau96 I fragment w i t h Hae I I I (which s h o u l d c l e a v e o n l y i f G i s p r e s e n t a t p o s i t i o n 10) and e l e c t r o p h o r e s i s o f t h e d i g e s t i o n p r o d u c t a l o n g s i d e the p r o d u c t s o f Maxam-Gilbert s e q u e n c i n g r e a c t i o n s ( r e s u l t s not shown). The n u c l e o t i d e sequence o f t h e t R N A ^ e r gene i n pDt 73 does n o t c o r r e s p o n d t o e i t h e r t R N A ^ e r o r t R N A 7 e r . Genes f o r t h o s e tRNAs can be r e p r e s e n t e d as 444 o r 777 genes depending on the n u c l e o t i d e s p r e s e n t a t p o s i t i o n s +16, +34, o r +77 o f the tRNA sequences ( t h e t h r e e d i f f e r i n g p o s i t i o n s ) . A t R N A ^ e r gene (444) s h o u l d c o n t a i n T-16, C-34, and G-77, w h i l e a t R N A 7 e r gene (777) s h o u l d c o n t a i n C-16, A-34, and A-77. The t R N A S e r gene i n pDt 73 i s a " h y b r i d " 474 gene. I t c o n t a i n s an A i n the S 6 V a n t i c o d o n "wobble" p o s i t i o n (+34) c o r r e s p o n d i n g t o i n o s i n e i n tRNAy , Ser but T-16 and G-77 c o r r e s p o n d i n g t o D and G a t t h e s e p o s i t i o n s i n tRNA^ . As shown i n F i g . 17, two o f t h e t h r e e n u c l e o t i d e changes d i s t i n g u i s h i n g t R N A ^ e r from t R N A 7 e r s h o u l d r e s u l t i n the p r e s e n c e o f r e s t r i c t i o n s i t e s i n p r e s u m p t i v e 444 genes n o t found i n 777 genes. The r e s t r i c t i o n p a t t e r n s o b s e r v e d from the 520 b.p. fragment examined a r e i n agreement w i t h the p r e s e n c e o f a mixed 474 sequence ( l a c k i n g the 3'-CCA o f the mature tRNA). Examples o f M a x a m / G i l b e r t s e q u e n c i n g e x p e r i m e n t s a r e shown i n F i g u r e 19. - 127 -A.4. Sequence a n a l y s i s o f pDt 17R The r e s t r i c t i o n enzyme map o f pDt 17R was d e t e r m i n e d by a g a r o s e g e l e l e c t r o p h o r e t i c a n a l y s i s o f DNA f r a g m e n t s produced by d i g e s t i o n w i t h one o r two r e s t r i c t i o n enzymes r e c o g n i z i n g h e x a n u c l e o t i d e sequences ( f o r example, F i g . 20a). T h i s map was c o n f i r m e d by S o u t h e r n b l o t t i n g e x p e r i m e n t s t o l o c a t e fragments c o n t a i n i n g sequences homologous t o a [ 3 ' - 3 2 P ] t R N A 7 e r probe ( f o r example, F i g . 2 0 b ) . The t R N A - h y b r i d i z i n g sequence was l o c a l i z e d t o a 1.5 kb segment o f t h e 3.3 kb pDt 17R i n s e r t bounded by a Pvu II s i t e a t t h e l e f t end and an Xho I s i t e a t the r i g h t end (as drawn i n F i g . 2 1 ) . The completed r e s t r i c t i o n map f o r the i n s e r t i s p r e s e n t e d i n F i g . 21. The DNA segment i s o l a t e d f o r sequence a n a l y s i s was the 1.75 kb EcoR I/Xho I fragment c o n t a i n i n g the l e f t h a l f o f t h e i n s e r t ( F i g . 2 1 ) . I t was chosen because i t m i g r a t e d w e l l away from o t h e r d i g e s t i o n p r o d u c t s on 0.5% a g a r o s e g e l s ( F i g . 20a) and c o u l d thus be r e a d i l y p u r i f i e d i n b u l k . F i n e s t r u c t u r e mapping o f the 1.75 kb EcoR I/Xho I fr a g m e n t was a c c o m p l i s h e d i n two ways. F i r s t , t he s e t o f r a d i o l a b e l l e d f ragments d e r i v e d from the 1.75 kb fragment by d i g e s t i o n w i t h Tag I and 3'-end l a b e l l i n g was d i g e s t e d w i t h a number o f o t h e r r e s t r i c t i o n enzymes, t h e v a r i o u s f r a g m e n t s s e p a r a t e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s and l o c a t e d by a u t o r a d i o g r a p h y . Such an e x p e r i m e n t y i e l d s c o n s i d e r a b l e i n f o r m a t i o n r e -g a r d i n g p o s s i b l e r e s t r i c t i o n enzymes a p p r o p r i a t e f o r s e c o n d a r y c l e a v a g e o f d o u b l e - e n d l a b e l l e d f r a g m e n t s i n M a x a m - G i l b e r t sequence a n a l y s i s , as w e l l as h e l p i n g t o i d e n t i f y tRNA g e n e - c o n t a i n i n g fragments and p r o v i d i n g - 128 -F i g u r e 20 - R e s t r i c t i o n mapping o f pDt 17R. (a) DNA was d i g e s t e d w i t h Hind I I I ( s l o t 2 ) , Pvu II ( 3 ) , Pvu II and EcoRI ( 4 ) , EcoRI and BamHI < ( 5 ) , EcoRI and Xho I ( 6 ) , Hind I I I and Xho I ( 7 ) , o r P s t I ( 8 ) , and t h e r e s u l t i n g fragments s e p a r a t e d by e l e c t r o p h o r e s i s on a 0.5% a g a r o s e gel as d e s c r i b e d i n C h a p t e r I I . S i z e s t a n d a r d s were Hind I I I fragments o f b a c t e r i o p h a g e X DNA ( s l o t 1 ) . (b) R e s t r i c t i o n fragments from the g e l shown i n p a r t (a) were t r a n s f e r r e d to n i t r o c e l l u l o s e s h e e t s and h y b r i d i z e d w i t h [ 3 1 - P]tRNAy ( S o u t h e r n b l o t t i n g ; C h a p t e r I I ) . A u t o r a d i o g r a p h y was f o r 5 days. EHd PP X E P B Hd B ^ 0 . 2 " L55 " ' 0.5 'o.lj 0.45 0.5 F i g u r e 21 - R e s t r i c t i o n enzyme map o f the D r o s o p h i l a i n s e r t i n pDt 17R. A b b r e v i a t i o n s used f o r r e s t r i c t i o n enzymes a r e E ( E c o R I ) , Hd ( H i n d I I I ) , P (Pv_u I I ) , X (Xh£ I ) , and B (BamHI). Heavy l i n e s a t each end r e p r e s e n t pBR 322 sequences. - 131 -some e v i d e n c e r e g a r d i n g the r e l a t i v e p o s i t i o n s o f the Tag I f r a g m e n t s . Second, mapping o f the 1.75 kb f r a g m e n t by the method o f Smith and B i r n s t i e l (151) a f t e r s p e c i f i c a l l y l a b e l l i n g t h e EcoR I s i t e u s i n g E. c o l i DNA 32 S e r p o l y m e r a s e I and [a- PjdATP a l l o w e d the tRNA gene to be l o c a t e d and i t s o r i e n t a t i o n r e l a t i v e t o the EcoR I s i t e t o be e s t a b l i s h e d ( F i g . 2 2 ) . T h i s p r o c e d u r e a l s o p r o v i d e d u s e f u l i n f o r m a t i o n r e g a r d i n g a p p r o p r i a t e second enzymes f o r c l e a v i n g d o u b l e - e n d l a b e l l e d r e s t r i c t i o n f ragments i n M a x a m - G i l b e r t DNA sequence a n a l y s i s . Based i n i t i a l l y on the map i n f o r m a t i o n above, and drawing on DNA sequence d a t a as t h e y became a v a i l a b l e , a c o n t i n u o u s n u c l e o t i d e sequence ' Ser was o b t a i n e d c o n t a i n i n g the tRNA gene p l u s about 250 n u c l e o t i d e s o f 5 ' - f l a n k i n g seguence and 210 n u c l e o t i d e s o f 3 ' - f l a n k i n g seguence. The e x t e n t s and d i r e c t i o n s o f sequences o b t a i n e d i n v a r i o u s e x p e r i m e n t s a r e shown i n F i g . 23b. The n u c l e o t i d e sequence o f t h i s r e g i o n i s p r e s e n t e d i n F i g . 23a. The p r e s e n c e o f more r e s t r i c t i o n s i t e s i n the f l a n k i n g sequences than found f o r pDt 73 a l l o w e d most o f the 540 base p a i r sequence to be d e t e r m i n e d on both s t r a n d s . The e r r o r f r e q u e n c y i n sequence d e t e r -mi n a t i o n i s e s t i m a t e d t o be l e s s than 1%. The tRNA gene sequence was unambiguous. A sample e x p e r i m e n t i s shown i n F i g . 24. S e r The s i n g l e tRNA gene p r e s e n t i n pDt 17R i s a 777 gene c o r r e -s p o n d i n g e x a c t l y t o the t R N A ^ e r sequence, e x c e p t f o r the 3 ' - t e r m i n a l CCA o f the tRNA which i s not gene-coded. A.5. Sequence a n a l y s i s o f pDt 16 The S o u t h e r n b l o t t i n g e x p e r i m e n t s d e s c r i b e d i n s e c t i o n A . l . above i n d i c a t e d the p r e s e n c e o f a v e r y s m a l l (~ 100 b.p.) t R N A S e r - h y b r i d i z i n g - 132 -F i g u r e 22 - S m i t h / B i r n s t i e l r e s t r i c t i o n mapping o f the g e n e - c o n t a i n i n g r e g i o n i n pDt 17R. Mapping o f a 1.75 kb EcoRI/Xho I r e s t r i c t i o n f r a g m e n t l a b e l l e d a t t h e EcoRI: 32 s i t e w i t h [a- PjdATP and E. c o l i DNA polymerase I was a c c o m p l i s h e d u s i n g the method o f Smith and B i r n s t i e l ( C h a p t e r I I ) . The fragment was p a r t i a l l y d i g e s t e d w i t h Hae I I I ( H a e ) , H i n f I ( H i n f ) , Taq^ I ( T a q ) , Msp_ I (Msp), Hha I (Hha), Sau96 I (Sau96), o r Pvu_ II ( P v u ) . The s i z e s t a n d a r d s were H i n f I -32 d e r i v e d fragments o f pBR 322 l a b e l l e d w i t h [a- PjdATP and E. c o l i DNA polymerase I ( p B R / H i n f ) . E l e c t r o p h o r e s i s was f o r 15 h r . a t 150V on a 5% p o l y a c r y l a m i d e g e l . Each gel s l o t c o n t a i n e d 25,000 Cerenkov cpm. A u t o r a d i o g r a p h y was f o r 38 h r . a t -20° u s i n g Kodak XR-1 " s c r e e n " X-ray f i l m . - 133 -- 134 -F i g u r e 23 - N u c l e o t i d e sequence o f t h e tRNA g e n e - c o n t a i n i n g r e g i o n i n pDt 17R. (a) The c o m p i l e d sequence o f t h e g e n e - c o n t a i n i n g r e g i o n i s shown "(non-coding s t r a n d ) . The 777 gene seguence i s u n d e r l i n e d . (b) A r e s t r i c t i o n map o f the g e n e - c o n t a i n i n g r e g i o n i n pDt 17R, i n d i c a t i n g t he e x t e n t s and d i r e c t i o n s o f sequences o b t a i n e d i n Maxam/Gilbert s e q u e n c i n g e x p e r i m e n t s , i s shown. A number o f r e l e v a n t r e s t r i c t i o n enzyme c l e a v a g e s i t e s a r e i n d i c a t e d : P (Pvu I I ) , S (Sau96 I ) , Hf ( H i n f I ) , Ha (Hae I I I ) , T ( T a ^ I ) , and S3 (Sau3A I ) . a . T h e N u c l e o t i d e S e q u e n c e o f p D t 1 7 R 10 2 0 3 0 4 0 5 0 C A G C T G A A G G G A T G A A C A G A G G G G G G C C T T G C G T T C C C A C T T G A G T G G C A 1 10 120 130 140 150 A G C T G T G G G T G C T A A A G A T A A C A T A C T G C A T T T C T A A A G G T T G A G T C A A T 2 1 0 2 2 0 2 3 0 2 4 0 2 5 0 A A G A A A C C A A G A A A C T T C C A G C T A T A A A T A A A A A A A G C T G A A C A A A T A G C 3 1 0 3 2 0 3 3 0 3 4 0 3 5 0 C C T C T T G C A C C T C T T G A G A A C T C A A T T T T C G C C A C C C A C C C A T C A A G C A G 4 1 0 4 2 0 4 3 0 4 4 0 4 5 0 A G C G T A G G T T C G A A T C C T A C C G A C T G C G A T A T G A A G A G T A T C T T T T T T A T 5 1 0 5 2 0 5 3 0 5 4 0 5 5 0 A T A A T T C A A T A A T T G T C T A T G G C T T A A G T A G C C T A T T G G T T A G G T T G T A C 6 1 0 6 2 0 6 3 0 T T T A T A A T G A A C T G T T T G T T A G T A G T T C G T A A T T T T T A 6 0 7 0 8 0 9 0 100 A A C A A A T A G A T T A G A A A T A G A T T T C C C A A A G C G A G A A A G T T T A T T T C A A C 160 170 180 1 9 0 2 0 0 A A A T C T G T C A T G A A T A T T T T A A T T A A C T G T G G T T T C A T A A A G C G A A C G G A 2 6 0 2 7 0 2 8 0 2 9 0 3 0 0 G T A T T T A A A T A G C T A A C T A A A G T A T C T A T C A G A T A G T A T C T G C G A C C C A A 3 6 0 3 7 0 3 8 0 3 9 0 4 0 0 T C G T G G C C G A G C G G T T A A G G C G T C T G A C T A G A A A T C A G A T T C C C T C T G G G 4 6 0 4 7 0 4 8 0 4 9 0 5 0 0 G T C A G A T A C T T T T A T G T A T C T A T G G G A T C A A C G A T C T T A A A G A T A T A C A C 5 6 0 5 7 0 5 8 0 5 9 0 6 0 0 G C T T A T G A A A C C G C A G T T T C G A G T T C A A T T C A A T G G G T A G T A G T G C T T T A C O cn 7 7 7 I I p s Hf I I I Ha Hf T S3 \ S3 100 b.p. - 136 -F i g u r e 24 - M a x a m / G i l b e r t sequence a n a l y s i s o f the s e r i n e tRNA gene i n pDt 17R. (a) Seguence a n a l y s i s o f a H i n f I r e s t r i c t i o n f ragment l a b e l l e d s p e c i f i c a l l y 32 a t one end w i t h [ a - P]dTTP and E. c o l i DNA polymerase I ( l a r g e f r a g m e n t ) . The sequence shown i s on t h e n o n - c o d i n g s t r a n d . P o s i t i o n s marked w i t h arrows d i s t i n g u i s h t R N A 4 e r and t R N A y 6 r ( F i g u r e 8 ) . (b) Sequence a n a l y s i s o f a Sau3AI/Hae I I I r e s t r i c t i o n f ragment l a b e l l e d a t t h e Sau3AI and w i t h [ a - 3 2 P ] d G T P and E. c o l i DNA polymerase I ( l a r g e f r a g m e n t ) . The sequence shown, on the n o n - c o d i n g s t r a n d , i n -SPY* S PY* e l u d e s t h e t h r e e p o s i t i o n s d i s t i n g u i s h i n g tRNA^ and tRNAy (marked w i t h a r r o w s ; see F i g u r e 8 ) . - 138 -f r a g m e n t g e n e r a t e d by Msp_ I c l e a v a g e ( F i g . 16a). T h i s e s t i m a t e d s i z e i s o n l y s l i g h t l y l a r g e r than t h a t o f a t R N A S e r c o d i n g sequence. P r e v i o u s sequence a n a l y s i s o f a Tag I - g e n e r a t e d fragment from pDt 16 had i d e n t i f i e d SGT a sequence homologous t o the 5' t h r e e - q u a r t e r s o f tRNAy w i t h an Ms_p_ I s i t e l o c a t e d 30 n u c l e o t i d e s upstream o f the gene (D. T a y l o r , u n p u b l i s h e d o b s e r v a t i o n s ) . The s m a l l tRNA - h y b r i d i z i n g Msp I fragment seen i n S o u t h e r n b l o t t i n g e x p e r i m e n t s might then be due t o a second s o r t o f " h y b r i d " t R N A S e r gene sequence (a 774 g e n e ) . To t e s t t h i s p o s s i b i l i t y , pDt 16 and pBR 322 DNAs were c u t w i t h Msp_ I , r a d i o l a b e l e d w i t h [ a - 3 2 P ] d C T P by E. c o l i DNA polymerase I , and t h e p r o d u c t s s e p a r a t e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s . A fragment o f the p r e d i c t e d s i z e ( a b o u t 105 b.p.) p r e s e n t i n pDt 16 but n o t pBR.322 was r e c o v e r e d from the g e l f o r sequence S 6 Y* a n a l y s i s . A f t e r c l e a v a g e w i t h Hae I I I (which c u t s i n tRNA genes) and 32 p u r i f i c a t i o n on a p o l y a c r y l a m i d e g e l , t h e r e s u l t i n g Msp I ( P-dCMP)/Hae S s r I I I fragments were sequenced. P o s i t i o n s 16 and 34 o f the tRNA sequence p r e s e n t i n the 105 b.p. Msp I fragment were i d e n t i f i e d d i r e c t l y w h i l e p o s i t i o n 77 was i d e n t i f i e d by the Msp I r e s t r i c t i o n s i t e . In t h i s way, one o f the two t R N A ^ e r genes i n pDt 16 was shown to be a " h y b r i d " 774 gene ( F i g . 2 5 a). In o r d e r t o v e r i f y t he n a t u r e o f the 774 gene, and t o i d e n t i f y t h e second t R N A ^ e r gene p r e s e n t on t h e p l a s m i d , pDt 16 was c h a r a c t e r i z e d f u r t h e r . The r e s t r i c t i o n e n d o n u c l e a s e c l e a v a g e map o f pDt 16 was d e t e r m i n e d by gel e l e c t r o p h o r e t i c a n a l y s i s o f DNA fragments produced by d i g e s t i o n w i t h one o r two h e x a n u c l e o t i d e - r e c o g n i z i n g enzymes ( F i g . 26a), and by S o u t h e r n b l o t a n a l y s i s ( F i g . 26b). The r e s t r i c t i o n enzyme map f o r the - 139 -F i g u r e 25 - Maxam/Gilbert sequence a n a l y s i s o f t h e s e r i n e tRNA genes i n pDt 16. (a) Sequence a n a l y s i s o f an Msp I/Hae I I I r e s t r i c t i o n fragement l a b e l l e d 32 a t t h e Msp I end w i t h [a- P]dCTP and E. c o l i DNA p o l y m e r a s e I ( l a r g e f r a g m e n t ) . The sequence shown i s on t h e n o n - c o d i n g s t r a n d . C py* S P V Two o f the t h r e e p o s i t i o n s d i s t i n g u i s h i n g tRNA^ and tRNAy ( F i g u r e 8) a r e i n d i c a t e d by a r r o w s . The t h i r d i s i d e n t i f i e d by the p r e s e n c e o f t h e l a b e l l e d Msp I end. T h i s sequence i s f o r the 774 gene i n pDt 16. (b) Sequence a n a l y s i s o f a Tag^ I/Hae I I I r e s t r i c t i o n f ragment l a b e l l e d 32 a t t he Jaq_ end w i t h [a- P]dCTP and E. c o l i DNA p o l y m e r a s e I ( l a r g e f r a g m e n t ) . The sequence shown i s on the n o n - c o d i n g s t r a n d . P o s i t i o n s Spy-" SPP d i s t i n g u i s h i n g tRNA^ and tRNAy a r e i n d i c a t e d w i t h a r r o w s . The sequence shown i s i n t h e 777 gene o f pDt 16. (c ) Sequence a n a l y s i s o f a Tag I/Fnu4HI r e s t r i c t i o n f r agement l a b e l l e d 32 a t t he Tag I end w i t h [a- P]dCTP and E. c o l i DNA polymerase I ( l a r g e f r a g m e n t ) . The seguence shown, on t h e c o d i n g s t r a n d , i s complementary Se r t o tRNAy . The arrow i n d i c a t e s p o s i t i o n 77, t h e t h i r d p o s i t i o n d i s -t i n g u i s h i n g t h e 777 gene o f pDt 16. - 1 40 -cc o o o < o h - O o o i - < I-u < o i I 11 I I I I I If mi I I J // <o < O h O <o < \ \\ \ III I \\\ \ o o o o - 141 -F i g u r e 26 - R e s t r i c t i o n mapping o f pDt 16. . (a) DNA was d i g e s t e d w i t h Pvu II ( s l o t 3 ) , Pyu II and Hi n d I I I ( 4 ) , Pyu II and EcoR I ( 5 ) , Pvu II and BgJ_ II ( 6 ) , o r Pyu II and BamHI ( 7 ) , and the r e s u l t i n g f r a g m e n t s s e p a r a t e d by e l e c t r o p h o r e s i s on a 1.25% a g a r o s e g e l (as d e s c r i b e d i n C h a p t e r I I ) . S i z e s t a n d a r d s were Hind I l l - c u t b a c t e r i o p h a g e A. DNA ( s l o t 1) and H i n f I - c u t pBR 322 DNA ( s l o t 2) l a b e l l e d w i t h [ a - 3 2 P ] d A T P and E. c o l i p o l y m e r a s e I ( l a r g e f r a g m e n t ) . (b) R e s t r i c t i o n fragments from t h e gel shown i n p a r t (a) were t r a n s f e r r e d t o n i t r o c e l l u l o s e s h e e t s and h y b r i d i z e d w i t h [ 3 ' - P]tRNA^ ( S o u t h e r n b l o t t i n g , C h a p t e r I I ) . A u t o r a d i o g r a p h y was f o r 2 d a y s . - 143 -i n s e r t o f pDt 16 i s p r e s e n t e d i n F i g . 27. The two tRNA - h y b r i d i z i n g sequences i n pDt.16 ( S e c t i o n A.1. above) a r e l o c a t e d between the EcoR I and Bgl II s i t e s i n t h e i n s e r t . Ser The 3.6 kb Pvu II fragment c o n t a i n i n g the tRNA genes was p u r i f i e d by a g a r o s e g e l e l e c t r o p h o r e s i s f o r use i n mapping and sequence a n a l y s i s . C l e a v a g e o f t h i s fragment w i t h Bgl I I , r a d i o l a b e l l i n g o f t h e Bgl II ends, and s e p a r a t i o n o f the r e s u l t i n g fragments by gel e l e c t r o p h o r e s i s 32 gave two P - l a b e l l e d fragments o f r o u g h l y the e x p e c t e d s i z e s (2.3 kb and 1.3 kb) p l u s a t h i r d s m a l l (~ 150 b.p.) fragment. T h i s i n d i c a t e s t h e p r e s e n c e o f two c l o s e l y spaced Bgl II s i t e s i n t h e i n s e r t , s i m i l a r t o t h e S e r two c l o s e l y - s p a c e d Pvu II s i t e s near the tRNA gene i n pDt 17R. In n e i t h e r c a s e was the second r e s t r i c t i o n s i t e o b s e r v e d i n p r e l i m i n a r y mapping p r o c e d u r e s . The 2.3 kb B^l_ II ( 3 2P-dGMP)/Pvu II f r a g m e n t , which was e x p e c t e d to c o n t a i n the tRNA genes, was mapped f u r t h e r by the method o f Smith and B i r n s t i e l ( 1 5 1 ) . Ten d i f f e r e n t enzymes were used i n two mapping S 61" e x p e r i m e n t s . The l o c a t i o n s and o r i e n t a t i o n s o f the two tRNA genes c o u l d be d i s c e r n e d , as w e l l as a number o f s u r r o u n d i n g r e s t r i c t i o n s i t e s ( s e e f i g u r e 28). The two genes ,are p r e s e n t as a d i r e c t r e p e a t s e p a r a t e d by a s p a c e r r e g i o n o f about 400 b.p. The 5' ends o f t h e genes a r e l o c a t e d about 0.5 kb and 1.0 kb from the l a b e l l e d Bgl II s i t e . The f o r m e r gene was deduced t o be e i t h e r 477 o r 777 by the two H i n f I - g e n e r a t e d bands, one Tag I band, and absence o f a band i n the Msp I and Fnu4H I s l o t s ( F i g . 28). The l a t t e r gene i s the 774 sequence. I t was d i s t i n g u i s h e d as a r e g i o n c o n t a i n i n g two c l o s e l y spaced Msp I s i t e s , p l u s two H i n f I s i t e s , a Tac^ I s i t e , a Fnu4H I s i t e , and an Al_u I s i t e (known to be p r e s e n t from the u n p u b l i s h e d r e s u l t s o f D. T a y l o r and from sequence a n a l y s i s o f - 144 -F i g u r e 27 - R e s t r i c t i o n enzyme map o f the D r o s o p h i l a i n s e r t i n pDt 16. A b b r e v i a t i o n s used f o r r e s t r i c t i o n enzymes a r e E ( E c o R I ) , Hd ( H i n d I I I ) , P (Pvu I I ) , B (BamHI), and Bg (Bgl I I ) . Heavy l i n e s a t each end r e p r e s e n t pBR 322 sequences. 1 kb - 146 -F i g u r e 28 - S m i t h / B i r n s t i e l r e s t r i c t i o n mapping o f the g e n e - c o n t a i n i n g r e g i o n i n pDt 16. Mapping o f a 2.3 kb Bgl I I / P v u I I r e s t r i c t i o n f ragment l a b e l l e d a t the 32 Bgl II s i t e w i t h [a- P]dGTP and E. c o l i DNA polymerase I was a c c o m p l i s h e d u s i n g t h e method o f Smith and B i r n s t i e l ( C h a p t e r . I I ) . The fragment was p a r t i a l l y d i g e s t e d w i t h Hae I I I ( H a e ) , H i n f I ( H i n f ) , Tag_ I ( T a q ) , Msp I (Msp), Fnu4H I (Fnu 4H), Sau96 I (Sau96), Hha I (Hha), o r Al_u I ( A l u ) . The s i z e s t a n d a r d s were H i n f I - d e r i v e d fragments o f pBR 322 l a b e l l e d w i t h 32 [a- P]dATP and E. c o l i DNA p o l y m e r a s e I ( p B R / H i n f ) . E l e c t r o p h o r e s i s was f o r 16 h r . a t 125V on a 3% p o l y a c r y l a m i d e g e l . Each gel s l o t c o n -t a i n e d 42,000 Cerenkov cpm. A u t o r a d i o g r a p h y was f o r 39 h r . a t 4° u s i n g G e v a e r t " s c r e e n " f i l m . - 147 -pBR 1631 p D l l 6 - BglE^PvuE frogm«nt(2 .3kb) fiS Hoe Hinf Toq Msp Fnu4H Soj% Hha Alu U l i I t 774 777 - 148 -the 105 b.p. M s £ I f r a g m e n t , a b o v e ) . L i t t l e u s e f u l map i n f o r m a t i o n c o u l d be deduced f u r t h e r from the BgJ_ II s i t e than the-774 gene. The 3.6 kb Pvu II fragment was d i g e s t e d w i t h Tag_ I , and t h e f r a g -32 ments l a b e l l e d w i t h [a- PjdCTP w i t h the Klenow fragment o f E. c o l i DNA polymerase I. P o r t i o n s o f the r a d i o l a b e l e d DNA were d i g e s t e d w i t h a number o f o t h e r r e s t r i c t i o n enzymes and the p r o d u c t s s e p a r a t e d by p o l y -a c r y l a m i d e g e l e l e c t r o p h o r e s i s . In c o n j u n c t i o n w i t h S m i t h / B i r n s t i e l mapping (above) and p r e d i c t e d r e s t r i c t i o n maps based on tRNA^ 7 sequences ( F i g . 1 7 ) , the gene c o n t a i n i n g fragments c o u l d be i d e n t i f i e d . Mapping o f the 3.6 kb Pvu II fragment was a l s o a t t e m p t e d by d i -g e s t i n g the DNA w i t h Fnu4H I (GC +NGC) and 3'-end l a b e l l i n g w i t h the 32 Klenow fragment o f E. c o l i DNA polymerase I and (a- P) l a b e l l e d dATP, dGTP, dCTP, o r dTTP. The one n u c l e o t i d e 5 ' - e x t e n s i o n produced by c l e a v a g e w i t h t h i s enzyme a l l o w s s p e c i f i c l a b e l l i n g o f e v e r y f r a g m e n t end w i t h o n l y 32 one o f the f o u r [ P] d e o x y n u c l e o t i d e s . In some c a s e s the o r d e r i n g o f f r a g m e n t s can be deduced, s i n c e the two fragment ends produced by a s i n g l e c l e a v a g e w i t h Fnu4H I must be l a b e l l e d by complementary n u c l e o t i d e s (dATP and dTTP, o r dGTP and dCTP). A l s o , such mapping a l l o w s one t o d i s c e r n which f r a g m e n t s a r e s i n g l e - e n d l a b e l l e d (and t h e r e f o r e r e a d y f o r 32 sequence a n a l y s i s ) o r d o u b l e - e n d l a b e l l e d by a p a r t i c u l a r [a- P] dNTP and E. c o l i DNA polymerase I. DNA sequence a n a l y s i s o f fragments produced by Tag I ( F i g . 25b,c) o r Fnu4H I d i g e s t i o n o f the 3.6 kb Pvu II fragment a l l o w e d a n e a r l y c o n t i n u o u s DNA sequence o f 530 b.p. t o be d e t e r m i n e d , e x t e n d i n g from the Hae I I I s i t e a t the 5'-end o f t h e 777 gene t o the 3' end o f t h e 774 gene - 149 -gene ( F i g . 29a). Most o f the sequence was o b t a i n e d o n l y once. In t h e p l a c e s where a sequence was d e t e r m i n e d t w i c e , on one o r both s t r a n d s , good agreement was o b t a i n e d . The sequence o f the f i r s t gene, though not c o m p l e t e , S e r S e r i n c l u d e s t h e t h r e e p o s i t i o n s d i s t i n g u i s h i n g tRNA-, and tRNA 4 , and e s p e c i a l l y p o s i t i o n 16, which i s not p a r t o f a r e s t r i c t i o n enzyme r e c o g n i -t i o n sequence ( F i g . 1 7 ) . The sequence d e t e r m i n e d c o r r e s p o n d s t o a 777 gene ( F i g . 25 b , c ) , i n agreement w i t h t h e r e s u l t s o f S m i t h / B i r n s t i e l mapping. The CCA o f the mature tRNA i s not gene-coded. A l l e x c e p t t h e 3 ' - t e r m i n a l n u c l e o t i d e o f the 774 gene e i t h e r were d e t e r m i n e d d i r e c t l y by DNA sequence a n a l y s i s , o r c o u l d be deduced on the b a s i s o f Msp I and S Fnu4H I s p e c i f i c i t i e s . The t h r e e p o s i t i o n s d i s t i n g u i s h i n g tRNA^ and Q py* tRNAy genes were a l l d e t e r m i n e d a t l e a s t t w i c e ( t h e 3'-end by c l e a v a g e w i t h both Msp I and Fnu4H I ) . The e x t e n t s and d i r e c t i o n s o f seguences o b t a i n e d i n M a x a m - G i l b e r t seguence e x p e r i m e n t s a r e shown i n F i g . 29b. The n u c l e o t i d e sequence o f t h i s r e g i o n i s c o m p i l e d i n F i g . 29a. A.6. Summary o f r e s u l t s from DNA seguence a n a l y s i s o f pDt 16, pDt 17R,  and pDt 73 D e t e r m i n a t i o n o f the c o m p l e t e n u c l e o t i d e sequences o f two genes (pDt 73 and pDt 17R), and mapping and p a r t i a l n u c l e o t i d e seguence d e t e r m i n a -t i o n f o r two o t h e r genes (pDt 1 6 ) , showed the p r e s e n c e o f t h r e e d i f f e r e n t Spy* Spy* sequences r e l a t e d to tRNA^ and. tRNA-, i n a d i s t i n c t i v e way. The s i n g l e gene i n pDt 17R c o r r e s p o n d s e x a c t l y t o t R N A y e r (.777 g e n e ) . The s i n g l e 474 gene i n pDt 73, however, i s i n t e r m e d i a t e between the sequences e x p e c t e d i n t R N A 4 e r (444) and t R N A y e r (777) genes. R e s t r i c t i o n mapping and DNA sequence a n a l y s i s a l l o w e d i d e n t i f i c a t i o n o f t h e two t R N A S e r sequences i n - 150 -F i g u r e 29 - N u c l e o t i d e sequence o f the tRNA g e n e - c o n t a i n i n g r e g i o n i n pDt 16. (a) The c o m p i l e d sequence o b t a i n e d f r o m t he g e n e - c o n t a i n i n g r e g i o n o f Spy* pDt 16 i s shown ( n o n - c o d i n g s t r a n d f o r b o t h tRNA g e n e s ) . The 777 and 774 gene sequences a r e u n d e r l i n e d . (b) A r e s t r i c t i o n map o f t h e g e n e - c o n t a i n i n g r e g i o n i n pDt 16, i n d i c a t i n g t he e x t e n t s and d i r e c t i o n s o f sequences o b t a i n e d i n Ma x a m / G i l b e r t s e q u e n c i n g e x p e r i m e n t s , i s shown. A number o f r e l e v a n t r e s t r i c t i o n enzyme c l e a v a g e s i t e s a r e i n d i c a t e d : F (Fnu4H I ) , Ha (Hae I I I ) , M (Ms£ I ) , and T (Taq^ I ) . a. T h e N u c l e o t i d e S e q u e n c e o f p D t 1 6 10 2 0 3 0 4 0 5 0 1 10 120 130 140 150 A G A A A A A A T A G A T C G C T A G A A G A T C A G A A A A A G T A T T A A G A G C G C T G C T C 2 10 2 2 0 2 3 0 2 4 0 2 5 0 A A A T A A A A T C A T G C A C C T T T G T A A A G T T A C T G A T A T A A A G A A A G A A T T T A 3 10 3 2 0 3 3 0 3 4 0 3 5 0 G C T G A A A C C A A T T T A A C T T T T T T G A A T T T A A T C A T T A T C T A T T G T T A A A A 4 10 4 2 0 4 3 0 4 4 0 4 5 0 G A T A T T A A T G T A G C T A G A G C C G G G T A A T A A A G C C A C T A G A G T C A T C A A A G 5 10 5 2 0 5 3 0 G G G A G C G T A G G T T C G A A T C C T A C C G G C T G C 6 0 7 0 8 0 9 0 100 T A G G T T C G A A T C C T A C C G A C T G C G A A T A G C A A T C T G T T T T T T G G A A G T C C 160 170 180 1 9 0 2 0 0 T C T T A T A A T G C T T A A A A A A T A T T T C G T A G T A A A A G A G T A A A G T G T G T G G C 2 6 0 2 7 0 2 8 0 2 9 0 3 0 0 A T G A T T T A A A A A A T A G C C C A A C A A G T T G G G T G A T C T C T T A A A A A T A C A G T 3 6 0 3 7 0 3 8 0 3 9 0 4 0 0 A A G T G A T A T T A A T A G T T A T A T G A T C G T C T T T T C G C T A T A A A A A G A T C A G T 4 6 0 4 7 0 4 8 0 4 9 0 5 0 0 C A G T C G T G G C C G A G C G G T T A A G G C G T C T G A C T A G A A A T C A G A T T C C C T C T 5' 7 7 7 3' Ha 7 7 4 I I M Ha 1 I II T MF | »<r 1 100 b.p. - 152 -pDt 16. T h i s p l a s m i d c o n t a i n s both a 777 and a 774 gene as a d i r e c t r e p e a t s e p a r a t e d by a 376 b.p. s p a c e r r e g i o n . Thus, i n t h e f o u r genes a n a l y z e d , t h r e e d i f f e r e n t but c l o s e l y r e l a t e d sequences were f o u n d , o f S e r which o n l y one c o r r e s p o n d s t o a known tRNA sequence. The e x i s t e n c e o f a f o u r t h c l o s e l y r e l a t e d t R N A S e r sequence i s presumed, based on the known sequence o f t R N A ^ e r . A.7. Comparison o f g e n e - f l a n k i n g sequences A.7.a. 3 ' - f l a n k i n g seguences Extended sequences a d j a c e n t t o t h e 3' ends o f t R N A ^ e r genes were o b t a i n e d o n l y f o r the 777 genes i n pDt 16 and pDt 17R. No sequence 3' t o the 774 gene o f pDt 16 was o b t a i n e d , w h i l e the p r e s e n c e o f t h e H i n d I I I s i t e d e f i n i n g the end o f t h e pDt 73 i n s e r t o n l y f i v e n u c l e o t i d e s from t h e 474 gene a l l o w e d o n l y e l e v e n n u c l e o t i d e s o f f l a n k i n g sequence t o be d e t e r m i n e d . T h i s f l a n k i n g seguence does not extend t o a s e r i e s o f T r e s i d u e s ( n o n - c o d i n g , o r "+" s t r a n d ) t h o u g h t t o s i g n a l RNA p o l y m e r a s e I I I t r a n s c r i p t i o n t e r m i n a t i o n . T h e r e f o r e t h i s f l a n k i n g sequence i s not d i s c u s s e d f u r t h e r h e r e . The sequences f l a n k i n g the 3' ends o f 777 genes i n pDt 17R and pDt 16 s h a r e l i m i t e d homology when d i r e c t l y compared ( s e e F i g u r e 30a). Both seguences c o n t a i n t r a c t s o f s i x c o n s e c u t i v e T r e s i d u e s i n the non-c o d i n g s t r a n d b e g i n n i n g 13 and 15 n u c l e o t i d e s a f t e r the genes i n pDt 16 and pDt 17R, r e s p e c t i v e l y . These a r e presumably RNA polymerase I I I t e r m i n a t i o n s i g n a l s ( 1 6 3 ) . Both a l s o c o n t a i n f i v e n u c l e o t i d e homologies C o m p a r i s o n o f 3 ' - f l a n k I n g s e q u e n c e s + 1 + 1 0 + 2 0 + 3 0 + 4 0 + 5 0 + 6 0 + 7 0 + 8 0 + 9 0 + 1 0 0 + 1 1 0 + 1 2 0 pDt 16-777 T G C G A A T A G C A A T C T G T T T T T T G G A A G T C C A G A A A A A A T A G A J C G C T A G A A G A T C A G A A A A A G T A T T A A G A G C G C T G C T C T C T T A T A A T G C T T A A A A A A T A T T T C G T A G T A A A A G A G T A A A G T G T G T G G pDtl7R-777 T G C G A T A T G A A G A G T A T C T T T T T T A T G T C A G A T A C T T T T A T G T A T C T A T G G G A T C A A C G A T C T T A A A G A T A T A C A C A T A A T T C A A T A A T T G T C T A T G G C T T A A G T A G C C T A T T G G T T A G G T T G T A C G C T C o m p a r i s o n o f 5 ' - f l a n k 1 n g s e q u e n c e s - 1 2 0 - 1 1 0 - 1 0 0 - 9 0 - 8 0 - 7 0 - 6 0 - 5 0 - 4 0 - 3 0 - 2 0 - 1 0 +1 pDt 73-474 A T A T T A T C A G C T T A G G T T T T G C A C A A G A T A T G G A A A A T A T T T T T T G T T T T T G T A A A T T A A T A T A A T A C T A T T A A C T T T A T A T T A C T T T C T T A A A T T T T A T T G A T A T T T T T T G C G C A T A T A T C A A G G C A G pDt' 16-774 A A T T T A A T C A T T A T C T A T T G T T A A A A A A G T G A T A T T A A T A G T T A T A T G A T C G T C T T T T C G C T A T A A A A A G A T C A G T G A T A T T A A T G T A G C T A G A G C C G G G T A A T A A A G C C A C T A G A G T C A T C A A A G C A G pDtl7R-777 C T A T A A A T A A A A A A A G C T G A A C A A A T A G C G T A T T T A A A T A G C T A A C T A A A G T A T C T A T C A G A T A G T A T C T G C G A C C C A A C C T C T T G C A C C T C T T G A G A A C T C A A T T T T C G C C A C C C A C C C A T C A A G C A G Figure 30- Comparison of serine tRNA gene-flanking sequences. - 154 -a t 48-52 and 81-85 n u c l e o t i d e s a f t e r t h e genes, and f o u r o f f i v e a t 21-25 n u c l e o t i d e s a f t e r t h e genes. The f i r s t 125 n u c l e o t i d e s a f t e r the two 777 genes s h a r e 33% homology (42 o f 125). Most o f t h i s homology i s a p p a r -e n t l y a consequence o f the g e n e r a l Ar-T r i c h n e s s o f the DNA s equences: o n l y s i x o f 42 homologous p o s i t i o n s i n the r e g i o n s compared c o n t a i n G-C base p a i r s , and f o u r o f the s i x a r e l o c a t e d i n t h e s h o r t homologies n o t e d above. The f l a n k i n g r e g i o n s examined c o n t a i n o n l y 31% (pDt 16) and 30% (pDt 17R) G-C base p a i r s . D e t e r m i n a t i o n o f more tRNA - f l a n k i n g sequences might c l a r i f y whether t h e s m a l l c l u s t e r s o f homology o b s e r v e d a r e s i g n i f i c a n t . A.7.b. 5 ' - f l a n k i n g seguences The f i r s t 125 n u c l e o t i d e s o f 5 ' - f l a n k i n g sequences f o r 777 (pDt 17R), 774 (pDt 1 6 ) , and 474 (pDt 73) genes were examined f o r homology ( F i g . 30b). The seguences c o n t a i n a low f r a c t i o n o f G-C base p a i r s (pDt 16 c o n t a i n s 28% G-C; pDt 17R, 37%; and pDt 73, a v e r y low 1 9 % ) . L i t t l e s i m i l a r i t y was o b s e r v e d among the t h r e e sequences. By c o m p a r i s o n o f sequences a l i g n e d w i t h r e s p e c t t o the tRNA genes ( F i g . 30b), 13 o f 125 p o s i t i o n s were found t o c o n t a i n t h e same n u c l e o t i d e i n a l l t h r e e s equences. In a l l c a s e s , t h e p o s i t i o n c o n t a i n e d on A-T base p a i r . In no c a s e were two c o n s e c u t i v e n u c l e o t i d e s m a i n t a i n e d among the t h r e e sequences when a l i g n e d i n t h i s f a s h i o n . C e r t a i n f e a t u r e s l o c a t e d near t h e sequence c o d i n g f o r mature Ser tRNA were o f i n t e r e s t . A l l t h r e e sequences c o n t a i n e d the pentamer ATCAA i m m e d i a t e l y a d j a c e n t t o t h e tRNA sequence o r one n u c l e o t i d e removed from i t ( F i g . 30b). The pentamer GCCAC a p p e a r s a t -14 t o -18 r e l a t i v e t o - 155 -the 774 gene i n pDt 16, and a t -12 t o -16 r e l a t i v e t o the 777 gene i n pDt 17R. A s i m i l a r l y G-C r i c h , t h r o u g h n o t homologous, sequence (GCGCA) i s found a t -10 t o -14 r e l a t i v e to the 474 gene i n pDt 73. These c o n s e r v e d sequences may s e r v e a s p e c i f i c f u n c t i o n , f o r example i n t r a n s c r i p t i o n i n i t i a t i o n o r p r o c e s s i n g o f a tRNA p r e c u r s o r . However, a s s i g n m e n t o f such a f u n c t i o n a w a i t s d i r e c t e x p e r i m e n t a l e v i d e n c e . B. D i s c u s s i o n The DNA seguences o f f o u r t R N A ^ e r genes from D r o s o p h i l a m e l a n o g a s t e r were a n a l y z e d . The major r e s u l t o f t h i s work was the f i n d i n g t h a t s e v e r a l SPY* d i f f e r e n t c l o s e l y r e l a t e d tRNA sequences a r e p r e s e n t i n the D. m e l a n o g a s t e r SPY* SPY/* genome. Genes c o r r e s p o n d i n g t o mature tRNA^ and tRNA-, a r e d e s i g n a t e d 444 and 777 genes, r e s p e c t i v e l y , on the b a s i s o f the t h r e e d i f f e r i n g p o s i -t i o n s i n the two tRNA seguences. In th e a n a l y s e s p r e s e n t e d above, two 777 sequences were found as w e l l as s i n g l e 774 and 474 seg u e n c e s . S i n c e t R N A ^ e r e x i s t s , a c o r r e s p o n d i n g 444 gene must be p r e s e n t i n the genome. Spy/* Thus, a t l e a s t f o u r d i f f e r e n t but c l o s e l y r e l a t e d tRNA gene sequences a r e r e p r e s e n t e d i n the D. m e l a n o g a s t e r genome. Is sequence heterogeneity normal for reiterated eukaryotic tRNA genes? Based l a r g e l y on the r e s u l t s o f s t u d i e s on tRNA-DNA h y b r i d i z a t i o n k i n e t i c s , i t seems t o have been w i d e l y e x p e c t e d t h a t members o f r e i t e r a t e d gene f a m i l i e s would be i d e n t i c a l . T h i s e x p e c t a t i o n has l a r g e l y been s u p p o r t e d by the r e s u l t s o f DNA sequence a n a l y s i s o f tRNA genes, as - 156 -rev i e w e d i n C h a p t e r I. However, a number o f examples o f c l o s e l y r e l a t e d but n o n - i d e n t i c a l tRNA genes have been r e p o r t e d . I n c l u d e d i n t h i s c a t e g o r y a r e D. m e l a n o g a s t e r gene sequences c l o s e l y r e l a t e d b ut not i d e n t i c a l t o tRN$et ( 1 2 1 ) , tRNA^ a l ( 1 2 2 ) , t R N A G l u ( 1 1 9 ) , and t R N A ^ y S ( 1 2 4 ) . The h e t e r o -S e r g e n e i t y seen f o r tRNA genes i n the p r e s e n t work, though r e l a t i v e l y e xtreme, i s c o n s i s t e n t w i t h the r e s u l t s o f o t h e r workers mentioned above. SPV Because tRNA genes from t h e 12DE r e g i o n o f t h e D. m e l a n o g a s t e r chromosome r e p r e s e n t t h e most extreme e x c e p t i o n o b s e r v e d t o d a t e t o the g e n e r a l i z a t i o n t h a t r e i t e r a t e d tRNA genes a r e i d e n t i c a l , t h e y may prove t o be a u s e f u l model system f o r s t u d y i n g whether and how t h e i d e n t i t y o f r e d u n d a n t genes i s m a i n t a i n e d . Are the "hybrid" serine tRNA genes expressed? I t i s n o t y e t known whether t h e 774 and 474 s e r i n e tRNA genes a r e t r a n s c r i b e d . However, s e v e r a l o b s e r v a t i o n s s u g g e s t t h a t t h e y a r e l i k e l y t o 'be. A number o f examples o f c l o s e l y r e l a t e d i s o a c c e p t o r tRNA sequences (> 95% homologous) have been r e p o r t e d . T hese a r e p r e s e n t e d i n F i g . 31. Such tRNAs must a r i s e from t r a n s c r i p t i o n o f c l o s e l y r e l a t e d genes. ( A l s o , t h e i r e x i s t e n c e s u g g e s t s t h a t tRNA gene h e t e r o g e n e i t y i s not uncommon, S PK* r e l e v a n t t o the p r e v i o u s p a r a g r a p h . ) I t i s p o s s i b l e t h a t t h e h y b r i d tRNA genes may c o r r e s p o n d t o t R N A ~ e r , t R N A ^ e r , o r t R N A 2 6 r . P a r t i c u l a r l y l i k e l y SPT SGP c a n d i d a t e s would seem t o be tRNA g and tRNAg , as t h e i r c h r o m a t o g r a p h i c Spy* p r o p e r t i e s on RPC-5 columns a r e q u i t e s i m i l a r t o t h o s e o f tRNAy and Ser tRNA^ , r e s p e c t i v e l y . The p r e s e n c e o f t h e c o n s e r v e d p e n t a m e r i c sequence ATCAA p r e c e d i n g 777, 774, and 474 genes s u g g e s t s t h a t t h i s sequence may 157 F i g u r e 31 - C l o s e l y r e l a t e d b ut n o n - i d e n t i c a l tRNAs, Same a n t i c o d o n D i f f e r e n t a n t i c o d o n s tRNA E. c o l i (2 d i f f e r e n c e s t R N A 3 a ° 3 b o f y e a s t ( 2 t R N A J | [ r l b o f y e a s t (2 t R N A ^ ^ o f y e a s t (3 t R N A A 1 a o f y e a s t (1 t R N A s L e u o f hepatoma (1 t R N A ^ o f r a b b i t (2 tRNA Phe 1 g o f b o v i n e l e n s (1 " tRNA tRNA tRNA i S e r „ o f y e a s t (3 minor J K o f D r o s o p h i l a (3 " ||r1 o f r a t l i v e r (3 " a - R e f e r e n c e 7. b - R e f e r e n c e 67. c - Ch a p t e r I I I . d - R e f e r e n c e 176. - 158 -be i n v o l v e d i n t r a n s c r i p t i o n i n i t i a t i o n o r i n p r o c e s s i n g o f p r e c u r s o r tRNA . I t s e e m s . u n l i k e l y t h a t t r a n s c r i p t s from 774 o r 474 genes would be p r e f e r e n t i a l l y degraded s i m p l y because t he mature gene p r o d u c t s would be so s i m i l a r t o tRNA 4 and tRNAy . ( P r e f e r e n t i a l d e g r a d a t i o n o f p r e -c u r s o r s from t h e s e genes c a n n o t be r u l e d o u t . ) F u r t h e r , i t seems u n l i k e l y t h a t t h e p r e s e n c e o f t h e c o r r e c t n u c l e o t i d e s a t both p o s i t i o n s 16 and 77 i s r e q u i r e d f o r f u n c t i o n a l s p l i t promoters w i t h i n 474 o r 774 genes ( 7 0 ) . In any c a s e , such an argument would o n l y a p p l y t o 774 genes, s i n c e w i t h r e s p e c t t o the r e l e v a n t n u c l e o t i d e s l o c a t e d i n p u t a t i v e promoter r e g i o n s a 474^ gene i s e g u i v a l e n t t o a 444_ gene, which i s e x p r e s s e d as tRNA^ . Ser The q u e s t i o n o f whether " h y b r i d " tRNA genes a r e t r a n s c r i b e d c o u l d be t e s t e d by t r a n s c r i p t i o n o f pDt 16 (which c o n t a i n s both a 777 and a 774 gene) i n v i t r o i n r e c e n t l y d e v e l o p e d homologous D r o s o p h i l a systems (129,164), o r by sequence a n a l y s i s o f t R N A g e r , t R N A ^ e r , and/or t R N A ^ . Ser What is the significance of "hybrid"- tRNA genes in Drosophila? A mechanism presumably e x i s t s f o r m a i n t a i n i n g f a m i l i e s o f r e i t e r -a t e d tRNA genes i n a homogeneous s t a t e . T h i s s t a t e m e n t i s based on the numerous examples o f i d e n t i c a l tRNA genes p r e s e n t e d i n s e c t i o n s C and D o f C h a p t e r I. I t seems l i k e l y t h a t such a mechanism s h o u l d match p a i r s o f genes th r o u g h r e c o m b i n a t i o n . Such r e c o m b i n a t i o n s h o u l d be n o n - r e c i p r o c a l a r e c i p r o c a l p r o c e s s would n o t n o r m a l l y r e s u l t i n maintenance o f a w i l d -t y p e sequence. The d i s p e r s e d o r g a n i z a t i o n o f tRNA genes w i t h i n a c l u s t e r a r g u es a g a i n s t unequal c r o s s o v e r as a mechanism f o r m a i n t a i n i n g t h e s e genes i n D. m e l a n o g a s t e r . - 159 -Se r The d i s t i n c t i v e r e l a t i o n s h i p e x i s t i n g among tRNA genes i n D. m e l a n o g a s t e r s u g g e s t s t h a t 777, 774, 474, and 444 genes a r e p r o d u c t s o f t h e a c t i o n o f such a maintenance p r o c e s s . I t i s t r u e t h a t t he " h y b r i d " 774 and 474 sequences can be s i m p l y e x p l a i n e d as the p r o d u c t s o f r e c i p r o c a l r e c o m b i n a t i o n e v e n t s i n v o l v i n g t h e genes f o r tRNA^ and tRNAy . However, SPV the h i g h degree o f s i m i l a r i t y between tRNAs w i t h a n t i c o d o n s CGA and IGA Se r i n D. m e l a n o g a s t e r and i n r a t l i v e r , and between t h e minor tRNAs w i t h a n t i c o d o n s CGA and U*GA i n S. c e r e v i s i a e i s c o n s i s t e n t w i t h t he i d e a t h a t t h e c o r r e s p o n d i n g s e t s o f genes have.not been f r e e t o d i v e r g e d u r i n g e v o l u t i o n ( s e e a l so D i s c u s s i o n , C h a p t e r I I I ) . R e c i p r o c a l r e c o m b i n a t i o n seems t o have no b e a r i n g on t h i s o b s e r v a t i o n . On t h e o t h e r hand, i f v e r y s i m i l a r b ut n o n - i d e n t i c a l genes w i t h d i f f e r e n t a n t i c o d o n s were r e g u l a r l y c h e c k e d a g a i n s t each o t h e r i n t h e maintenance p r o c e s s , t h e y would be e x p e c t e d t o e v o l v e i n p a r a l l e l . I t i s c l e a r t h a t such c l o s e l y r e l a t e d tRNA sequences a r e n o t n e c e s s a r y f o r p r o p e r f u n c t i o n i n p r o t e i n b i o s y n t h e s i s , Ser s i n c e tRNAs r e s p o n d i n g t o UCN and AGPy codons have r e l a t i v e l y d i s s i m i l a r S 6 K* sequences ( C h a p t e r I I I ) . F u r t h e r , none o f the f o u r tRNA genes examined here c o n t a i n s a n u c l e o t i d e i n i t which i s n o t d i s t i n c t i v e o f e i t h e r t R N A ^ e r S e r o r tRNAy . I t seems g u i t e p o s s i b l e t h a t the v e r y h i g h d e g r e e o f s i m i -l a r i t y among the t h r e e t y p e s o f s e r i n e tRNA genes found i n p l a s m i d s d e r i v e d SPY* fronk.the 12DE r e g i o n and tRNA^ genes may r e s u l t i n a b e r r a n t maintenance o f the genes, and i n the " m i n g l i n g " o f t R N A ^ y sequences i n the genes. ( T h i s l a s t s t a t e m e n t i m p l i e s t h a t a maintenance p r o c e s s o p e r a t e s f o r tRNA genes on the X chromosome as w e l l as on t h e autosomes.) S t i l l a n o t h e r p o s s i b i l i t y i s t h a t t he " h y b r i d " genes o b s e r v e d a r e the p r o d u c t s o f r e c e n t r e c i p r o c a l c r o s s o v e r e v e n t s i n o p p o s i t i o n t o a maintenance p r o c e s s . - 160 -The s e r i n e tRNA gene seguences i n t h e 12DE r e g i o n may o r may not be s t a b l y m a i n t a i n e d o v e r l o n g time p e r i o d s . In view o f the s i m i l a r i t y o f t h e 777, 774, and 474 s e q u e n c e s , i t seems d o u b t f u l t o me t h a t t h e y c o u l d e x i s t s t a b l y o v e r e v o l u t i o n a r y time p e r i o d s i n t h e p r e s e n c e o f the p r e s u m p t i v e mechanism r e s p o n s i b l e f o r m a i n t a i n i n g v a r i o u s o t h e r r e i t e r a t e d genes i n an i d e n t i c a l s t a t e . Whether i n d i v i d u a l tRNA genes a r e s t a t i c o r d y n a m i c a l l y c h a n g i n g due t o the p r e s u m p t i v e maintenance p r o c e s s c o u l d be t e s t i n g by p r o b i n g genomic DNA f o r t h e p r e s e n c e o r the absence o f an Msp I s i t e i n i n d i v i d u a l t R N A ^ e r genes i n S o u t h e r n b l o t t i n g e x p e r i m e n t s . The S e r p r o b e s would be unique sequences f l a n k i n g t h e 5' o r 3' ends o f tRNA genes i n r e c o m b i n a n t p l a s m i d s a n a l y z e d h e r e . In p r i n c i p l e , such a p r o c e d u r e c o u l d be used t o t e s t genomic DNA i s o l a t e d from i n d i v i d u a l f l i e s o r from p o p u l a t i o n s . I f t h e maintenance p r o c e s s i s d y n a m i c a l l y i n t e r c o n v e r t i n g tRNA genes, i t might prove p o s s i b l e by such methods t o i d e n t i f y two d i f f e r e n t Msp I fragments i n genomic D. m e l a n o g a s t e r DNA which b o t h h y b r i d i z e the s p e c i f i c probe -and d i f f e r o n l y by the p r e s e n c e o r absence S e r o f an Msp I r e s t r i c t i o n s i t e w i t h i n a tRNA gene. F u r t h e r , by u s i n g both 5' and 3' g e n e - f l a n k i n g probes such e x p e r i m e n t s s h o u l d a l l o w one t o d i s t i n g u i s h between n o n - r e c i p r o c a l and r e c i p r o c a l r e c o m b i n a t i o n e v e n t s i n v o l v i n g t h o s e tRNA genes ( w i t h i n the l i m i t a t i o n t h a t r e c i p r o c a l d o u b l e - c r o s s o v e r e v e n t s o c c u r r i n g i n . a v e r y s h o r t sequence would appear n o n - r e c i p r o c a l ) . A c o n v i n c i n g b i o c h e m i c a l d e m o n s t r a t i o n t h a t maintenance o f tRNA gene f a m i l i e s i s a dynamic p r o c e s s might be a c h i e v e d by i s o l a t i n g two d i s t i n c t forms o f the same gene i n d e p e n d e n t l y i n r e c o m b i n a n t p l a s m i d s t h a t a r e o t h e r w i s e i d e n t i c a l . T h i s s o r t o f d e m o n s t r a t i o n c o u l d p o s s i b l y - 161 -be a c h i e v e d e x p e r i m e n t a l l y w i t h S. c e r e v i s i a e by i n t e g r a t i n g a r e c o m b i n a n t p l a s m i d c a r r y i n g a w i l d - t y p e tRNA gene i n t o the y e a s t genome a d j a c e n t t o a s u p p r e s s o r tRNA gene, then r e - i s o l a t i n g t he same r e c o m b i n a n t p l a s m i d from the y e a s t ( 1 6 5 ) . By s e l e c t i n g f o r y e a s t s t r a i n s w i t h enhanced s u p p r e s s o r f u n c t i o n , and r e - i s o l a t i n g the i n t e g r a t e d p l a s m i d from the y e a s t genome, i t m i g ht be p o s s i b l e t o d e m o n s t r a t e d i r e c t l y a s p e c i f i c a l t e r a t i o n o f a w i l d - t y p e tRNA gene t o a s u p p r e s s o r tRNA gene. Ser The s t r u c t u r e s o f t h e tRNA genes a n a l y z e d above s u g g e s t t h a t t h e s e genes a r e t h e r e s u l t o f a dynamic maintenance p r o c e s s . T h i s remains t o be shown e x p e r i m e n t a l l y . Based on the l i m i t e d number o f genes examined, t h e e x i s t e n c e o f 747 and 447 genes produced i n the same e v e n t s as 474 and 774 by r e c i p r o c a l r e c o m b i n a t i o n between 444 and 777 genes c a n n o t be d i s -c o u n t e d . Such d i v e r s i t y c a n n o t be r e a d i l y e x p l a i n e d w i t h o u t assuming t h a t one o f the 747 o r 447 genes i s i n a c t i v e . O t h e r w i s e , r e c i p r o c a l r e -c o m b i n a t i o n would r e s u l t i n s i x genes p r o d u c i n g tRNAs e r r e a d i n g UCN codons. T h e r e do n o t appear t o be enough t R N A j ^ s p e c i e s i n D. m e l a n o g a s t e r t o accommodate such d i v e r s i t y . No more than seven s e r i n e - a c c e p t i n g tRNAs a r e d i s t i n g u i s h e d on RPC-5 columns, o f which two r e s p o n d t o AGPy codons ( 1 0 2 ) . F u r t h e r , such a r e c i p r o c a l p r o c e s s would n o t l i m i t t h e e v o l u t i o n a r y d i v e r g e n c e o f two c l o s e l y r e l a t e d tRNA s p e c i e s , as d i s c u s s e d above. In t h e f o l l o w i n g d i s c u s s i o n , I assume t h a t the s i m i l a r i t y o f the 444 and 777 genes, and the e x i s t e n c e o f " h y b r i d " 474 and 774 genes, i s a consequence o f the o p e r a t i o n o f a n o n - r e c i p r o c a l maintenance p r o c e s s ; and t h a t t h e s e sequences a r e a t l e a s t i n p a r t i n t e r c h a n g e a b l e i n the p r o c e s s . Gene maintenance might o c c u r o n l y w i t h i n a s i n g l e gene c l u s t e r , o r a l s o between genes a t d i f f e r e n t chromosomal l o c a t i o n s . I t seems l i k e l y - 162 -t h a t t he f r e q u e n c y o f matching between two d i s p e r s e d genes would be con-s i d e r a b l y l e s s than t h a t between genes w i t h i n a s i n g l e c l u s t e r . Thus, S e r t h e p r e s e n c e o f n u c l e o t i d e s d i s t i n c t i v e o f tRNA^ i n two o f t h e f o u r t R N A S e r genes examined (774 and 474) may i n d i c a t e t h a t a t l e a s t one 444 gene i s p r e s e n t i n the 12DE gene c l u s t e r . A dynamic m a i n t e n a n c e p r o c e s s would p r o b a b l y be b i - d i r e c t i o n a l ( u n l e s s some mechanism e x i s t s f o r d i s -t i n g u i s h i n g " o l d " c o r r e c t DNA sequences, from "new" i n c o r r e c t ones.) F o r m a t i o n o f e i t h e r o f two p o s s i b l e p a i r s o f i d e n t i c a l p r o d u c t s ( " p r o d u c t s " r e f e r s t o the scope o f an i n d i v i d u a l maintenance e v e n t , which might span o n l y a few o r many n u c l e o t i d e s ) would be e q u a l l y l i k e l y . Thus, maintenance o f a sequence p r e s e n t i n m u l t i p l e c o p i e s would be f a v o r e d o v e r one p r e s e n t Ser i n a s i n g l e copy. As each o f t h e f o u r tRNA genes examined c o n t a i n s t h e same a n t i c o d o n , t h i s l a s t p o i n t may not be s i g n i f i c a n t here i n terms o f b i o l o g i c a l f u n c t i o n o f tRNA. However, such a c o n s i d e r a t i o n may be impor-t a n t i n terms o f genes c o n t a i n i n g a CGA a n t i c o d o n ( e . g . 444 genes) r a t h e r than AGA p r e s e n t i n 777, 774, and 474 genes. R e d u c t i o n i n t h e number o f genes w i t h a p a r t i c u l a r a n t i c o d o n such as CGA might r e s u l t i n d e c r e a s e d v i a b i l i t y o f the o r g a n i s m . (The same a p p l i e s t o genes w i t h AGA a n t i c o d o n s , o f c o u r s e . However, t h e r e does n o t seem t o be any s h o r t a g e o f t h i s a n t i -codon based on the l i m i t e d number o f genes sequenced.) A l t e r n a t i v e l y , some a n t i c o d o n s such as CGA c o u l d c o n c e i v a b l y be p r o t e c t e d i n some f a s h i o n a g a i n s t f r e q u e n t maintenance. A l o n g t h e s e l i n e s , i t i s i n t e r e s t i n g t o c o n s i d e r the genes i n S. c e r e v i s i a e c o d i n g f o r minor s e r i n e tRNAs t h a t r e a d UCA and UCG codons. T h r e e i d e n t i c a l gene c o p i e s f o r t R N A ^ and a s i n g l e gene copy f o r tRNAjjjig a r e p r e s e n t i n the h a p l o i d genome o f t h i s y e a s t ( 6 7 ) . M u t a t i o n s i n the a n t i c o d o n o f the U C G - s p e c i f i c tRNA gene a r e l e t h a l i n the h a p l o i d c e l l , and must be m a i n t a i n e d i n d i p l o i d s (67,166). - 163 -Spy/* The two mature tRNAs encoded by t h e s e genes d i f f e r a t o n l y t h r e e p o s i -t i o n s . One i s th e f i r s t p o s i t i o n o f the a n t i c o d o n . The o t h e r two r e s u l t from a G-C to C-G t r a n s v e r s i o n o f one base p a i r i n th e a n t i c o d o n stem. SPY* Spy Thus, t h e y a r e as s i m i l a r to each o t h e r as tRNA^ and tRNA^ o f JL_ Scy m e l a n o g a s t e r a r e . The s i n g l e gene f o r t R N A ^ g c o n t a i n s an i n t e r v e n i n g seguence a d j a c e n t t o th e a n t i c o d o n , whereas t h e t h r e e genes f o r tRNAjjj;^ do n o t . One might s p e c u l a t e t h a t one p o s s i b l e f u n c t i o n f o r t h e i n t e r v e n i n g Ser sequence i n the t R N A U C G gene i s t o p r o t e c t t h e a n t i c o d o n a g a i n s t change by p r e v e n t i n g m a t c h i n g o f UCA and U C G - s p e c i f i c a n t i c o d o n s e q u e n c e s . The r e c o g n i z a b l e homology o f i n t e r v e n i n g sequences i n t R N A L e u genes from S. c e r e v i s i a e and D. m e l a n o g a s t e r (87) i s c o n s i s t e n t w i t h c o n s e r v a t i o n o f a f u n c t i o n a l DNA seguence. P r o t e c t i o n o f th e a n t i c o d o n sequence may be one such f u n c t i o n . Such s p e c u l a t i v e arguments would be s t r e n g t h e n e d i f e g u i v a -Spy l e n t t R N A U C G genes i n D r o s o p h i l a and r a t l i v e r a r e found t o c o n t a i n i n t e r -v e n i n g sequences. Gene conversion as a possible mechanism, for maintaining reiterated genes By a n a l o g y w i t h y e a s t , a p o s s i b l e mechanism f o r m a i n t a i n i n g i d e n t i c a l r e i t e r a t e d tRNA genes i n D. me l a n o g a s t e r i s gene c o n v e r s i o n . I n t e g r a t i v e t r a n s f o r m a t i o n o f th e y e a s t S. c e r e v i s i a e by recomb i n a n t p l a s m i d s c a r r y i n g a y e a s t gene r e s u l t s i n f o r m a t i o n o f a non-tandem gene r e p e a t ( 1 6 7 ) . I n t e g r a t i o n o f a w i l d - t y p e gene i n t o t h e genome o f a y e a s t s t r a i n c a r r y i n g a mutant a l l e l e o f the gene a l l o w s one t o s e l e c t f o r and c h a r a c t e r i z e s p o r e s l a c k i n g gene f u n c t i o n . U s i n g such methods, S c h e r e r and D a v i s ( 1 6 8 ) , K l e i n and P e t e s ( 1 6 9 ) , and J a c k s o n and F i n k (170) have found t h a t n o n - r e c i p r o c a l gene c o n v e r s i o n e v e n t s r e s u l t i n g i n two mutant - 164 -gene c o p i e s o c c u r f r e q u e n t l y . Indeed, m e i o t i c gene c o n v e r s i o n may o c c u r w i t h a f r e q u e n c y as h i g h as 2-4% o f a l l t e t r a d s i s o l a t e d from such a y e a s t s t r a i n ( 1 6 9 ) . These a u t h o r s p o i n t o u t t h a t such c o n v e r s i o n c o u l d p l a y an i m p o r t a n t r o l e i n m a i n t a i n i n g r e i t e r a t e d gene c o p i e s i n an i d e n t i c a l s t a t e (168,169,170). E r n s t , S t e w a r t , and Sherman (171) have found t h a t a mutant CYC 1 gene i n S. c e r e v i s i a e can r e v e r t by r e c o m b i n a t i o n w i t h t h e n o n - a l l e l i c CYC 7 gene, r e s u l t i n g i n a "c o m p o s i t e " s t r u c t u r a l gene."containing sequences from both CYC 1 and CYC 7. These a u t h o r s s u g g e s t t h a t t he g e n e t i c exchange o b s e r v e d between n o n - a l l e l i c genes may be s i m i l a r t o t h e exchanges r e -s u l t i n g i n c o n v e r s i o n o f d u p l i c a t e d LEU 2 o r HIS 4 genes (169,170). The "co m p o s i t e " CYC 1/CYC 7 genes and the p r o c e s s by which t h e y a r e formed may w e l l be a n a l a g o u s t o the c a s e o f " h y b r i d " s e r i n e tRNA genes i n D.  m e l a n o g a s t e r . I n t e r e s t i n g l y , t h e l e n g t h o f t h e "c o m p o s i t e " seguence i n r e v e r t e d CYC 1 genes i s i n the range 43-71 b.p. ( 1 7 1 ) , a d i s t a n c e range e a s i l y a p p l i e d , by a n a l o g y , t o tRNA genes t o e x p l a i n t he " h y b r i d " sequences o b s e r v e d . H o t t i n g e r and L e u p o l d (1972) o b s e r v e d f r e q u e n t r e v e r s i o n o f f r a m e s h i f t s u p p r e s s o r m u t a t i o n s i n g e n e r a l ( m e i o t i c f r e g u e n c y ~ 10 s p o r e s ) and an e x t r e m e l y h i g h r a t e o f r e v e r s i o n o f f r a m e s h i f t s u p p r e s s o r -3 m u t a t i o n s a t the s u f 5 l o c u s ( m e i o t i c f r e g u e n c y ~ 10 s p o r e s ) i n the y e a s t S. pombe. They s u g g e s t t h a t t h e s u f 5 l o c u s may c o n t a i n two c o p i e s o f t he same tRNA gene sequence, and t h a t r e v e r s i o n t o the s u p p r e s s o r - i n -a c t i v e form c o u l d r e s u l t from f r e q u e n t h e t e r o l o g o u s r e c o m b i n a t i o n s between the a d j a c e n t tRNA genes. (As such r e c o m b i n a t i o n s would r e s u l t i n l o s s o f s u p p r e s s o r f u n c t i o n from e i t h e r tRNA gene, t h e y would be n o n - r e c i p r o c a l and thus gene c o n v e r s i o n e v e n t s . ) - 165 -I t has been s u g g e s t e d t h a t gene c o n v e r s i o n i s r e s p o n s i b l e f o r th e h i g h d egree o f s i m i l a r i t y between a p a i r o f d u p l i c a t e d human y g l o b i n genes (173,174). W h i l e f l a n k i n g sequences, d i v e r g e c o n s i d e r a b l y , t h e two f e t a l g l o b i n genes have been m a i n t a i n e d i n a n e a r - i d e n t i c a l s t a t e . B a l t i m o r e has d i s c u s s e d t h e p o s s i b l e i n v o l v e m e n t o f gene c o n v e r s i o n i n m a i n t a i n i n g immunoglobulin genes ( 1 7 5 ) . Both B a l t i m o r e (175) and E r n s t e t al_. (171) p o i n t o u t the p o s s i b l e i m p o r t a n c e o f gene c o n v e r s i o n , both i n m a i n t a i n i n g t h e homogeneity o f r e i t e r a t e d gene f a m i l i e s and i n g e n e r a t i n g p r o t e i n d i v e r s i t y d u r i n g e v o l u t i o n . To i d e n t i f y f o r m a l l y the p r e s u m p t i v e p r o c e s s r e s p o n s i b l e f o r maintenance o f r e i t e r a t e d genes i n : D r o s o p h i l a as gene c o n v e r s i o n would r e q u i r e t h a t a n o n - r e c i p r o c a l g e n e t i c e v e n t be d e m o n s t r a t e d . T h i s c a n n o t be d o n e , . s i n c e one c a n n o t be s u r e o f o b t a i n i n g a l l p o s s i b l e p r o d u c t s o f a m e i o t i c e v e n t . However, i t can be s a i d i n the p r e s e n t c a s e o f s e r i n e tRNA genes from t h e 12DE gene c l u s t e r o f D. m e l a n o g a s t e r t h a t t h e d a t a a r e q u i t e c o n s i s t e n t w i t h p o s s i b l e o p e r a t i o n o f such a p r o c e s s . C o n c l u d i n g Statement E v i d e n c e f o r f o u r c l o s e l y r e l a t e d t y p e s o f s e r i n e tRNA genes i n D r o s o p h i l a m e l a n o g a s t e r has been f o u n d . The e x i s t e n c e o f t h e s e f o u r sequences i n the D. m e l a n o g a s t e r genome may r e f l e c t t h e dynamic f u n c t i o n o f a p r o c e s s r e s p o n s i b l e f o r m a i n t a i n i n g t h e homogeneity o f r e i t e r a t e d genes. The h e t e r o g e n e i t y o b s e r v e d i n the work p r e s e n t e d here i s c o n s i s t e n t w i t h t h e r e s u l t s o f o t h e r w o r k e r s . s t u d y i n g f a m i l i e s o f tRNA genes, though r e l a t i v e l y r a t h e r an extreme c a s e . I t i s s u g g e s t e d t h a t due t o t h e - 166 -Sp Y* c o n s i d e r a b l e s i m i l a r i t y o f the v a r i o u s tRNA gene s e q u e n c e s , t h e genes can be i n t e r c o n v e r t e d by t h i s m aintenance p r o c e s s , which may be a n a l o g o u s t o gene c o n v e r s i o n o b s e r v e d i n y e a s t . Thus, s e r i n e tRNA genes may p r o v e to be a u s e f u l model system f o r the s.tudy o f the maintenance p r o c e s s i n D_ m e l a n o g a s t e r , as w e l l as f o r the s t u d y o f tRNA gene e x p r e s s i o n . - 167 -Cha p t e r V S E Q U E N C E A N A L Y S I S OF T R N A ^ Y S FROM D R O S O P H I L A A. I n t r o d u c t i o n S t u d i e s on o r g a n i z a t i o n o f e u k a r y o t i c tRNA genes have been g r e a t l y a i d e d by r e c e n t l y d e v e l o p e d r e c o m b i n a n t DNA t e c h n i q u e s (177) and r a p i d DNA sequence a n a l y s i s (132,178). E x p r e s s i o n o f t h e s e genes may be s t u d i e d u s i n g i n v i v o o r i n v i t r o t r a n s c r i p t i o n systems (179,128,129,164). Such s t u d i e s depend on knowing the n u c l e o t i d e seguence not o n l y o f the DNA but a l s o o f t h e mature tRNA p r o d u c t . In D r o s o p h i l a m e l a n o g a s t e r , t h e two l y s i n e codons (AAA, AAG) a r e r e a d by two predominant l y s i n e tRNAs, t R N A ^ 5 L vs and tRNAg . The f o r m e r has been seguenced ( 1 0 4 ) , as have a number o f i t s genes (116,123). T r a n s c r i p t i o n o f r e c o m b i n a n t p l a s m i d s c o n t a i n i n g normal o r r e a r r a n g e d t R N A ^ genes has a l s o been examined ( 1 2 3 ) . Genes f o r tRNAJ:-^ have been i s o l a t e d i n r e c o m b i n a n t p l a s m i d s ( 1 1 4 ) . As p a r t o f a s t u d y on l y s i n e tRNAs and t h e i r genes i n D. m e l a n o g a s t e r , t h e n u c l e o t i d e seguence o f t R N A ^ y s was examined. R e l e v a n t t o the s u b j e c t o f C h a p t e r s I I I and IV above, t R N A ^ h y b r i d i z e s t o the 12DE r e g i o n o f p o l y t e n e chromosomes under some c o n d i t i o n s 1— VS ( 1 0 9 ) . Thus, the tRNA^ seguence d e t e r m i n a t i o n p r e s e n t e d i n t h i s c h a p t e r a l s o r e p r e s e n t s a p a r t o f t h e comprehensive c h a r a c t e r i z a t i o n o f the 12DE r e g i o n o f the D r o s o p h i l a m e l a n o g a s t e r genome. - 168 -B. R e s u l t s The n u c l e o t i d e sequence o f t R N A g y s from D. m e l a n o g a s t e r was d e t e r m i n e d by a c o m b i n a t i o n o f r a p i d RNA s e q u e n c i n g t e c h n i q u e s ( C h a p t e r I I ) . A n a l y s i s o f n u c l e o t i d e c o n t e n t ( F i g . 32) i n d i c a t e d t h e p r e s e n c e o f prn^G, pm^G.pt^A, pip, pD, prn^C, pm^G, and prn^ -A i n a d d i t i o n t o the f o u r s t a n d a r d n u c l e o t i d e s . In some e x p e r i m e n t s s p o t s i n d i c a t i n g t h e p r e s e n c e o f o t h e r m o d i f i e d n u c l e o t i d e s i n tRNAg^ s were see n , but t h e s e c o u l d n o t be i d e n t i f i e d . The' sequence o f n u c l e o t i d e s 3^-69, o b t a i n e d by t h e method o f S t a n l e y and V a s s i l e n k o , i s p r e s e n t e d i n F i g . 33. A l l t h e m o d i f i e d n u c l e o t i d e s i d e n t i f i e d 1 2 6 i n n u c l e o t i d e a n a l y s i s (above) e x c e p t f o r pur G, pm G, and p t A were l o c a t e d unambiguously w i t h i n t h e t R N A ^ s sequence, based on c h r o m a t o g r a p h i c m o b i l i t i e s o f t h e *pNs i n s o l v e n t s A and B ( F i g . 33c) and on l o c a t i o n i n t h e tRNA sequence ( 7 , 8 ) . O t h e r m o d i f i e d n u c l e o t i d e s f o u n d i n t R N A ^ s a r e d i s c u s s e d below. The n u c l e o s i d e s a t p o s i t i o n s 1,2, and 70-76 were i d e n t i f i e d i n g e l " r e a d - o f f " e x p e r i m e n t s ( F i g . 3 5). These e x p e r i m e n t s a l s o c o n f i r m e d t he i d e n t i t i e s o f n u c l e o s i d e s i n many o f the p o s i t i o n s from 3 t o 69. A c o n -t a m i n a t i n g t R N A A r ^ l a c k i n g f i v e n u c l e o t i d e s from i t s 3 '-terminus was a l s o a n a l y z e d by the gel " r e a d - o f f " method ( F i g . 35a, 39, 4 0 ) . I t i s d i s c u s s e d s e p a r a t e l y below. The seguence from C75 t o G65 was d e t e r m i n e d by "wandering s p o t " a n a l y s i s ( F i g . 3 7 ) . A76 was i d e n t i f i e d by d i g e s t i n g t R N A ^ s , l a b e l l e d 32 a t t h e 3'end w i t h *pCp w i t h RNase T 2 , r e s u l t i n g i n t r a n s f e r o f the [ P] p h o s p h o r y l group from *pCp t o Ap*. The m o n o n u c l e o t i d e was i d e n t i f i e d by c h r o m a t o g r a p h i c m o b i l i t i e s i n s o l v e n t s A and B r e l a t i v e t o n u c l e o s i d e 3'-32 phosphate s t a n d a r d s , l o c a t i n g t h e [ P] n u c l e o s i d e 3'-phosphate by ... a u t o r a d i o g r a p h y . The n u c l e o t i d e sequence o f tRNAJ:-^ i s p r e s e n t e d i n the " c l o v e r l e a f " form i n F i g . 38. - 169 -F i g u r e 32 - N u c l e o t i d e a n a l y s i s o f D r o s o p h i l a tRNAg N u c l e o t i d e a n a l y s i s o f t R N A ^ s was performed as d e s c r i b e d i n C h a p t e r I I . A u t o r a d i o g r a p h y o f t h e t h i n l a y e r p l a t e was f o r 21 h r . a t -20° u s i n g Kodak XR-1 " s c r e e n " X-ray f i l m . - 170 -F i g u r e 32 - 171 -F i g u r e 33 - S t a n l e y / V a s s i l e n k o sequence a n a l y s i s o f tRNAj: y b. (a) Samples o f p u r i f i e d t R N A ^ y s (0.8 u g / s l o t ) were p a r t i a l l y h y d r o l y z e d i n ' formamide, r a d i o l a b e l l e d as d e s c r i b e d i n C h a p t e r I I , then s e p a r a t e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s a s shown. S l o t s 1 and 2: E l e c t r o -p h o r e s i s was on 12% p o l y a c r y l a m i d e g e l s a t a c o n s t a n t power o f 30 w a t t s f o r 3.7 h r . o r 1.7 h r . , r e s p e c t i v e l y . S l o t 3: E l e c t r o p h o r e s i s was f o r 2.4 h r . on a 20% p o l y a c r y l a m i d e g e l a t a c o n s t a n t power o f 30 w a t t s . A u t o r a d i o g r a p h y was f o r 20 min. ( s l o t s 1,2) o r 30 min. ( s l o t 3) u s i n g Kodak " n o - s c r e e n " X-ray f i l m . 32 (b) The 5 ' - t e r m i n a l n u c l e o t i d e s (*pNp's) o f [ P] o l i g o n u c l e o t i d e s s e p a r a t e d by p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s as shown i n p a r t (a) were a n a l y z e d by PEI c e l l u l o s e chromatography as d e s c r i b e d i n C h a p t e r I I . The n u c l e o t i d e s a r e r e p r e s e n t e d by symbols f o r t h e b a s e s , and p o s i t i o n s i n t h e tRNA sequence ( F i g . 38) i n d i c a t e d below. 32 ( c ) The 5 ' - t e r m i n a l n u c l e o t i d e s (*pN's) o f some [ P] o l i g o n u c l e o t i d e s were a n a l y z e d by chromatography on c e l l u l o s e t h i n l a y e r p l a t e s d e v e l o p i n g e i t h e r i n s o l v e n t A o r i n s o l v e n t B as d e s c r i b e d i n C h a p t e r I I . The n u c l e o t i d e s a r e r e p r e s e n t e d by t h e symbols f o r t h e b a s e s , and p o s i t i o n s i n t h e tRNA seguence ( F i g . 38) i n d i c a t e d below. (d) The PEI c e l l u l o s e p l a t e i n c l u d i n g p o s i t i o n s 54 and 55 o f t h e t R N A ^ y s sequence ( p a r t (b) above) was r e - e x p o s e d t o X-ray f i l m f o r s i x - f o l d l o n g e r than i n p a r t ( b ) . The arrow i n d i c a t e s *p4jp. 173 -• _ _ 5« 55 54 4* 47 46 • | « * t * « ' i * * » D O U 44> J7 14 » 17 10 » 11 Solvent A P<5 -> ~4r m>S W .V • J D D U n^G u }7 ]4 >• 17 10 » 11 10 l i f t * * JU III t m mV D m7C ¥ 51 55 54 4i 47 46 J« - 174 -F i g u r e 34 - Chromatography o f a t h i o n u c l e o t i d e a f t e r t r e a t m e n t w i t h CNBr. The m o d i f i e d n u c l e o t i d e from p o s i t i o n 34 o f t R N A ^ y s (-CNBr, arrow) was t r e a t e d w i t h CNBr, then w i t h HCl f o r 4 h r . o r 22 h r . and chromatographed on c e l l u l o s e t h i n l a y e r p l a t e s ( d e v e l o p i n g i n s o l v e n t A ) , as d e s c r i b e d i n C h a p t e r I I . A u t o r a d i o g r a p h y was f o r 6.5 days a t -70° u s i n g s e n s i t i z e d Kodak XR-1 " s c r e e n " X-ray f i l m (as d e s c r i b e d i n r e f . 4 3 ) . - 175 --CNBr +CNBr +HCI + HCl 4hr 22 hr F i g u r e 3 4 . - 176 -F i g u r e 35 - Gel " r e a d - o f f " a n a l y s i s o f [ 5 1 - 3 2 P ] t R N A g y s and l a r g e o l i g o n u c l e o t i d e s . (a) P r e p a r a t i o n o f [ 5 ' - 3 2 P ] R N A s . P u r i f i e d t R N A g y s (2.4 ug) was d e p h o s p h o r y l a t e d as d e s c r i b e d i n C h a p t e r I I , then l a b e l l e d w i t h p o l y n u c l e o t i d e k i n a s e and [ y - 3 2 P ] A T P (40 uM, 1200 Ci/mmole). The r e s u l t i n g [ 3 2 P ] R N A s were s e p a r -a t e d by e l e c t r o p h o r e s i s f o r 2.7 h r . a t 1500V on a d e n a t u r i n g 20% p o l y -a c r y l a m i d e g e l and l o c a t e d by a u t o r a d i o g r a p h y f o r 75 seconds u s i n g "no-s c r e e n " X-ray f i l m . Band 3 and band 4 i n c l u d e p o s i t i o n s 42-76 and 9-41 o f t h e t R N A ^ y s sequence, r e s p e c t i v e l y . (b) P a r t i a l h y d r o l y s e s o f [ 5 ' - 3 2 P ] tRNAJ: y s w i t h v a r i o u s enzymes were per f o r m e d i n F i g u r e 6 ( c ) above. E l e c t r o p h o r e s i s was f o r 2.5 h r . a t 1400V on a 20% p o l y a c r y l a m i d e g e l . RNase T-j ( T ) , RNase U 2 ( U ) , and c o n t r o l (-E) s l o t s c o n t a i n e d 26,000 Cerenkov cpm ea c h , w h i l e t h e RNase Phy I ( P h y ) , RNase A ( a ) , and r e f e r e n c e l a d d e r ( L ) s l o t s c o n t a i n e d 52,000 cpm each. A u t o -r a d i o g r a p h y was f o r 3 days a t -20° u s i n g Kodak " n o - s c r e e n " X-ray f i l m . 32 (c ) P - l a b e l l e d fragment 4 was d i g e s t e d as above (12000 c p m / s l o t f o r T, U, and -E; 24,000 c p m / s l o t f o r Phy, A, and L ) . E l e c t r o p h o r e s i s was f o r 2.5 hr.., a t c o n s t a n t power (34 w a t t s ) on a 20% p o l y a c r y l a m i d e g e l . A u t o -r a d i o g r a p h y was f o r 4 days a t -20° u s i n g " n o r s c r e e n " X-ray f i l m . 32 (d) P - l a b e l l e d fragment 3 was d i g e s t e d , e l e c t r o p h o r e s e d , and exposed to X-r a y f i l m as d e s c r i b e d f o r fragment 4 i n ( c ) above. a o o o o a > c * ( f n c ( ) » o o o o o o o o o c o > o o o o o o > o > oo >*tOO> c >. i l l I I I I IIIIIIIIIIIHIIM I i t * • ! li I i \ 1 %%4<\V \ w ° o c o ° o 1 3 1 o o o ' o o > o o o | - IOJ>> o c o c e o od I N K M i l > o - ZZ L -- 178 -F i g u r e 36 - Gel " r e a d - o f f " a n a l y s i s o f [ 3 ' - 3 2 P ] t R N A J : y s . was p r e p a r e d as d e s c r i b e d i n C h a p t e r I I . P a r t i a l h y d r o l y s e s w i t h v a r i o u s enzymes were performed as i n the l e g e n d t o F i g u r e 6 ( p a r t ( c ) ) . E l e c t r o p h o r e s i s was f o r 2.5 h r . a t 1500V on a 20% p o l y a c r y l a m i d e g e l . RNase T n ( T ) and RNase U 2 (U) s l o t s c o n t a i n e d 5000 Cerenkov cpm w h i l e RNase.Phy I ( P h y ) , RNase A ( A ) , and formamide l a d d e r (L) s l o t s c o n t a i n e d 10,000 cpm. A u t o r a d i o g r a p h y was f o r 12 days a t -20° u s i n g Kodak " n o - s c r e e n " X-ray f i l m . - 179 -L T U Phy A F i g u r e 36. - 180 -F i g u r e 37 - "Wandering s p o t " a n a l y s i s o f [ 3 1 - 3 2 P ] t R N A t y s b A sample o f [ 3 ' - 3 2 P ] t R N A J : y s ( c o n t a i n i n g 65,000 Cerenkov cpm) was h y d r o l y z e d , e l e c t r o p h o r e s e d on c e l l u l o s e a c e t a t e , t r a n s f e r r e d t o a D E A E - c e l l u l o s e t h i n l a y e r p l a t e and d e v e l o p e d w i t h homomixture V as d e s c r i b e d i n C h a p t e r I I . A u t o r a d i o g r a p h y was f o r 9 days a t -20° u s i n g s e n s i t i z e d Kodak XR-1 X - r a y f i l m (as d e s c r i b e d i n Methods, r e f . 4 3 ) . - 181 -F i g u r e 37. - 182 -i -pG-Q C-G £oH" 7 6 c G 55 PC-G C - G - 70 5 -G-C G-U 6,° •5 A-U f U G i P U GUCCCU m'A ^ D A n i r ' ? r A C AGGG C A C CUCmG r - r U) G GAG C D G D A 2'5 A G G m 7 G 1) - A N45 i l l -A G-C 30 - G-C -40 A-* C A U' t6A* SUUU i 35 I 20 t RNA Ly s 5 Lys F i g u r e 38 - C l o v e r l e a f s t r u c t u r e o f tRNA^ , - 183 -F i g u r e 39 - Gel " r e a d - o f f " a n a l y s i s o f [ 5 ' - 3 2 P ] t R N A ^ . The [ 5 1 - 3 2 P ] t R N A ^ ^ sample was o b t a i n e d from a t R N A g y s p r e p a r a t i o n as shown i n F i g u r e 35 ( a ) . (a) P a r t i a l h y d r o l y s e s were per f o r m e d as d e s c r i b e d i n the l e g e n d t o F i g u r e 6 ( p a r t ( e ) ) . C o n t r o l (-E), RNase T-j ( T ) , and RNase U 2 (U) samples c o n t a i n e d 11,000 Cerenkov cpm w h i l e RNase Phy I ( P h y ) , RNase A ( A ) , and formamide l a d d e r ( L ) samples c o n t a i n e d t w i c e t h a t amount. E l e c t r o p h o r e s i s on a 25% p o l y a c r y l a m i d e g e l was f o r 3 h r . a t c o n s t a n t power (30 w a t t s ) . A u t o r a d i o g r a p h y was f o r 6 days a t -20° u s i n g Kodak " n o - s c r e e n " X-ray f i l m . (b) The samples were t h e same as t h o s e used i n (a) above. E l e c t r o p h o r e s i s on a 20% p o l y a c r y l a m i d e g e l was f o r 4.25 h r . a t a c o n s t a n t power o f ! 34 w a t t s . A u t o r a d i o g r a p h y was f o r 4 days a t -20° u s i n g Kodak " n o - s c r e e n " X-ray f i l m . > 0 o O C O C Z O O C O > > C O t 7 ) - g a . i c 1 o ci e O c o o > o > z o O > > c o o > o >> o oo o<-< oo> o z O > > "> •> / / / //titmiuniitmmmmmmi - 185 -F i g u r e 40 - Gel " r e a d - o f f " a n a l y s i s o f [ 3 ' - 3 2 P ] t R N A ^ . 32 A r g H y d r o l y s e s o f [ 3 ' - P]tRNA were per f o r m e d as d e s c r i b e d i n ' t h e l e g e n d to F i g u r e 6 ( p a r t ( c ) ) . C o n t r o l (-E), RNase ( T ) , and RNase U 2 (U)) samples c o n t a i n e d 9000 Cerenkov c p m / s l o t w h i l e RNase Phy I ( P h y ) , RNase A ( A ) , and formamide l a d d e r ( L ) samples c o n t a i n e d 18,000 c p m / s l o t . E l e c t r o p h o r e s i s on a 25% p o l y a c r y l a m i d e g e l was f o r 3 h r . a t 1500V. A u t o r a d i o g r a p h y was f o r 44 h r . a t -20° u s i n g Kodak XR-1 X-ray f i l m . - 186 -" E L T U Phy A Figure 40. - 187 -M o d i f i e d n u c l e o s i d e s i n the t R N A ^ 0 sequence o t h e r than t h o s e i d e n t i f i e d above i n c l u d e m 2G 10, sU* 34, t 6 A * 37, a n d 5 4 , 5 5 ( F i g . 3 8). These were i d e n t i f i e d as f o l l o w s . p m*:G 10: The c h r o m a t o g r a p h i c m o b i l i t i e s o f t h e *pN from p o s i t i o n 10 were 0.71 i n s o l v e n t A ( r e l a t i v e t o pA) and 0.42 i n s o l v e n t B ( r e l a t i v e t o pU) compared w i t h p u b l i s h e d v a l u e s o f -0.75 and -0.47 f o r pm G, o r -0.62 and -0.46 f o r pm*G ( 4 2 ) . R i b o n u c l e a s e T^ ( G - s p e c i f i c ) c l e a v e s a t t h i s p o s i t i o n i n g e l " r e a d - o f f " e x p e r i m e n t s ( F i g . 35b). P o s i t i o n 10 i s i n the D s tem o p p o s i t e C25 i n the " c l o v e r l e a f " s t r u c t u r e o f F i g . 38. Wh i l e m G i s c a p a b l e o f f o r m i n g W a t s o n - C r i c k base p a i r s , m^G i s no t . O t h e r e u k a r y o t i c l y s i n e tRNAs examined have m G i n t h i s l o c a t i o n ( 7 ) . The m o b i l i t y o f t h e *pNp 2 from p o s i t i o n 10 ( F i g . 33b) c o r r e s p o n d s w e l l w i t h t h a t r e p o r t e d f o r pm Gp but not f o r pm*Gp i n a s i m i l a r ammonium s u l f a t e s o l v e n t ( 5 3 ) . On t h e b a s i s 2 o f t h e s e o b s e r v a t i o n s , m G was a s s i g n e d t o p o s i t i o n 10. Tm<Jj 54,55: A low background o f *pijjp was seen i n the gap r e s u l t i n g from a 2 ' - 0 - m e t h y l n u c l e o t i d e ( F i g . 33d), c o n s i s t e n t w i t h i n c o m p l e t e r i b o s e - m e t h y l a t i o n a t t h e sequence N .^ The c h r o m a t o g r a p h i c m o b i l i t y o f the d i n u c l e o s i d e t r i -p h osphate on PEI c e l l u l o s e i n 0.8 M ammonium s u l f a t e was s i m i l a r t o t h a t o f pU mUp from D. m e l a n o g a s t e r t R N A ^ e r and t R N A ^ e r ( C h a p t e r I I I ) . The chromato-g r a p h i c m o b i l i t i e s i n s o l v e n t s A and B o f t h e *pN m d e r i v e d from t h e d i n u c l e o t i d e by e x t e n s i v e n u c l e a s e P-| d i g e s t i o n were c o n s i s t e n t w i t h t h o s e e x p e c t e d f o r pT^. The c h r o m a t o g r a p h i c b e h a v i o r o f pN's i n t h e s e s o l v e n t s i s a l t e r e d i n a c h a r a c t e r i s t i c way by a d d i t i o n o f a 2'-0-methyl group. The m o b i l i t y o f th e p N m i s i n c r e a s e d by r o u g h l y 50% r e l a t i v e t o the pN i n s o l v e n t A, w h i l e - 188 -i n s o l v e n t B t h e pNffl m i g r a t e s s l i g h t l y s l o w e r than t h e pN ( r e f . 4 2 ) . R e l a -t i v e t o the p u b l i s h e d m o b i l i t y v a l u e s f o r pT ( r e f . 4 2 ) , the *pN m from p o s i t i o n 54 behaves as e x p e c t e d f o r pT^. A r i b o n u c l e a s e T 2 - r e s i s t a n t d i -n u c l e o t i d e c o n t a i n i n g w i t h p r o p e r t i e s o f T i/jp has been p r e v i o u s l y i d e n t i f i e d i n t h i s tRNA ( 1 8 1 ) . L y s i n e i s o a c c e p t o r tRNAs from r a b b i t l i v e r c o n t a i n Tm,;i|> (19,180) whereas y e a s t l y s i n e tRNAs c o n t a i n Tip "(7). T h e r e f o r e the sequence a t p o s i t i o n s 54 and 55 was i d e n t i f i e d as T m i j j . sU* 34: The *pNp sample c o n t a i n e d a t l e a s t one m o d i f i e d s p e c i e s , w i t h a m o b i l i t y g r e a t e r than pUp ( F i g . 33b). One d i m e n s i o n a l chromatographs o f t h e pN showed a complex p a t t e r n , w i t h a t l e a s t t h r e e s p e c i e s d i s t i n c t from t h e f o u r s t a n d a r d n u c l e o t i d e s ( F i g . 3 3 c ) . I t has been r e p o r t e d t h a t the amino a c i d a c c e p t o r a c t i v i t y o f t R N A ^ y s i s a b o l i s h e d by t r e a t m e n t w i t h cyanogen bromide ( 1 8 1 ) , which r e a c t s w i t h s u l f u r - c o n t a i n i n g bases (144,145). I t was s u g g e s t e d t h a t t h e C N B r - s e n s i . t i v e s p e c i e s might be a 2 - t h i o u r i d i n e d e r i v a t i v e i n t h e "wobble" p o s i t i o n o f t h e t R N A ^ y s a n t i c o d o n ( 1 8 1 ) . One m o d i f i e d pN, m i g r a t i n g s l i g h t l y ahead o f pC i n s o l v e n t A, w a s . m o d i f i e d by " CNBr t r e a t m e n t t o an a c i d - s e n s i t i v e d e r i v a t i v e ( F i g . 34; r e f . 144). In 32 gel " r e a d - o f f " e x p e r i m e n t s a d d i t i o n o f t h i s n u c l e o t i d e t o a [ 5 1 - P] o l i g o -n u c l e o t i d e r e s u l t s i n a l a r g e "jump" i n the r e f e r e n c e l a d d e r , c o n s i s t e n t w i t h t h e p r e s e n c e o f a h y p e r m o d i f i e d n u c l e o t i d e ( F i g . 3 5 c ) . D. m e l a n o g a s t e r c o n t a i n s two major l y s i n e tRNAs ( t R N A ^ 5 and t R N A g y s ) to r e a d the two l y s i n e c odons, AAA and AAG. The sequence o f tRNAg y s has b e e n . r e p o r t e d ( 1 0 4 ) . I t s a n t i c o d o n , CUU, s h o u l d r e s p o n d o n l y t o AAG. T h e r e f o r e , t R N A ^ y s must r e a d AAA codons, i n d i c a t i n g t h a t N 34 i s a d e r i v a t i v e o f u r i d i n e . Based on t h e c h r o m a t o g r a p h i c p r o p e r t i e s o f N 34 as a pNp and as a pN, i t s p r o p e r t i e s - 189 -i n g e l " r e a d - o f f " e x p e r i m e n t s , and the c o m p l e x i t y o f t h e p a t t e r n i t g i v e s on t w o - d i m e n s i o n a l chromatography ( r e s u l t s n o t shown), i t s s e n s i t i v i t y t o CNBr, and t h e f a c t t h a t i t s h o u l d r e a d AAA codons, N 34 i s i d e n t i f i e d as a h y p e r m o d i f i e d t h i o u r i d i n e d e r i v a t i v e . The e q u i v a l e n t l y s i n e tRNAs from 5 2 y e a s t and r a b b i t l i v e r c o n t a i n mem s U i n t h i s p o s i t i o n . Though N 34 may 5 2 w e l l be mem s U, i t c o u l d n o t be p o s i t i v e l y i d e n t i f i e d and i s p r e s e n t e d i n F i g . 38 as sU*. t^A* 37: The n u c l e o t i d e i n p o s i t i o n 37 i s c l e a v e d s l o w l y by RNase Phy I but i s r e s i s t a n t t o RNases T-j, l ^ , o r A. The m o b i l i t y jump o b s e r v e d i n t h e L s l o t i n d i c a t e s a h y p e r m o d i f i e d n u c l e o t i d e ( F i g . 3 5 c ) . T h i s n u c l e o t i d e g i v e s a complex p a t t e r n on one (or'two) d i m e n s i o n a l t h i n l a y e r chromatography as t h e *pN ( F i g . 3 3 c ) . A n u c l e o t i d e w i t h the c h r o m a t o g r a p h i c m o b i l i t i e s o f p t A was o b s e r v e d i n n u c l e o t i d e a n a l y s i s ( F i g . 32). I t was a l s o seen i n a n a l y s i s o f *pN's from the g e l band c o r r e s p o n d i n g t o p o s i t i o n 37 ( F i g . 3 3 c , d ) . The predominant form o f t h i s n u c l e o t i d e as a * p N p has a m o b i l i t y s l i g h t l y g r e a t e r than pAp ( F i g . 3 3 b ) , w h i l e t h e *pN has m o b i l i t i e s o f 0.67 ( r e l a t i v e t o pA) i n s o l v e n t A and 0.1 ( r e l a t i v e t o pU) i n s o l v e n t B. The p r e s e n c e o~f what appea r s t o be pt^A as a minor component i n t h e s e e x p e r i -ments s u g g e s t s t h a t the predominant m o d i f i e d n u c l e o t i d e i s a f u r t h e r m o d i f i e d d e r i v a t i v e o f p t A. Absence o f t h i s f u r t h e r m o d i f i e d s p e c i e s i n n u c l e o t i d e a n a l y s i s ( F i g . 32) can be e x p l a i n e d by a low a f f i n i t y o f p o l y n u c l e o t i d e k i n a s e f o r the n u c l e o s i d e 3'-phosphate, whereas a t the 5'terminus o f an o l i g o n u c l e o t i d e t h e enzyme l a b e l s t h i s n u c l e o t i d e e f f i c i e n t l y . F u r t h e r e x p e r i m e n t s c o n f i r m e d the p r e s e n c e o f m u l t i p l e m o d i f i e d s p e c i e s a t p o s i t i o n 37, a t l e a s t one o f which i s s e n s i t i v e t o CNBr ( r e s u l t s not shown). A l l c y t o p l a s m i c e u k a r y o t i c tRNAs r e s p o n d i n g t o codons ANN where t h e i d e n t i t y - 190 -o f n u c l e o t i d e 37 i s known c o n t a i n t°A o r a d e r i v a t i v e o f i t . ( 7 ) . In r a b b i t l i v e r t R N A ^ , the h y p e r m o d i f i e d n u c l e o t i d e 3' t o t h e a n t i c o d o n has been i d e n t i f i e d as ms t A (19,182). S i n c e a t l e a s t one form o f th e h y p e r m o d i f i e d n u c l e o t i d e i n D r o s o p h i l a t R N A ^ y s i s s e n s i t i v e t o CNBr, i t i s l i k e l y t h a t t he predominant form o f t h i s n u c l e o t i d e i s 2 6 ms t A o r c l o s e l y r e l a t e d t o i t . Due t o l a c k o f m a t e r i a l , we c a n n o t i d e n t i f y t h i s n u c l e o t i d e unambiguously, but p r e s e n t i t as t A*. m1 G: Though ITI'G was i d e n t i f i e d i n n u c l e o t i d e a n a l y s i s o f t R N A g y s h e r e ( F i g . 32) and e l s e w h e r e ( 1 8 1 ) , i t was not l o c a t e d i n sequence a n a l y s i s . A c o n t a m i n a t i n g tRNA fragment r e p r e s e n t i n g up t o 10% o f the RNA was found i n our t R N A g y s sample ( F i g . 3 5 a ) , d e s p i t e t h e m u l t i p l e s t e p s o f p u r i f i c a t i o n . The pm^G seen i n n u c l e o t i d e a n a l y s i s may come fr o m t h i s c o n t a m i n a n t . As m*G i s found i n p o s i t i o n s 9 and 37 i n e u k a r y o t i c tRNAs ( 7 ) , up t o 0.2 moles o f m^G per mole o f tRNA might be e x p e c t e d , c o n s i s t e n t w i t h my a n a l y s e s . - 191 -Sequence a n a l y s i s o f the c o n t a m i n a t i n g tRNA fragment The sequence o f the c o n t a m i n a t i n g tRNA was examined by gel r e a d -o f f e x p e r i m e n t s w i t h 5'- o r 3 ' - e n d - l a b e l e d RNA. T h i s c o n t a m i n a n t o f t R N A ^ y s a p p e a r s t o be t R N A ^ £ | ( p r o b a b l y t R N A ^ , r e f . 91) because o f i t s s i m i l a r i t y t o D r o s o p h i l a t R N A ^ 9 . A l s o , i t s codon r e s p o n s e (CGG) s h o u l d be complementary t o t R N A ^ 9 , which c o n t a i n s i n o s i n e (D. C r i b b s , u n p u b l i s h e d r e s u l t s ) and pre s u m a b l y decodes CGA, CGU, and CGC codons. The p a r t i a l n u c l e o t i d e sequence deduced i s pGACYGUGUG(m1 •G)GCUCAAUGGACAAGGC(ni2G)YYGGACU(CC)GNAUCCGAA'GANUGC-(A)GGT^CG(m 1A)GU(C)YUGUCACGGU. D e s p i t e t h e f a c t t h a t t h e t R N A g Y S sample 32 was s u f f i c i e n t l y pure t o use i n S t a n l e y and V a s s i l e n k o e x p e r i m e n t s , more P was i n c o r p o r a t e d i n t o t h e c o n t a m i n a n t than t R N A ^ s by p o l y n u c l e o t i d e k i n a s e ( F i g . 3 5 a ). The us u a l 3'-extended tRNA m o l e c u l e i s n o t r e a d i l y p h o s p h o r y l a t e d by p o l y n u c l e o t i d e k i n a s e ( 1 3 6 ) , but the c o n t a m i n a n t , which l a c k s f i v e n u c l e o -t i d e s from t h e 3'-end and i s t h e r e f o r e 5'-extended, was e f f i c i e n t l y l a b e l l e d . S i n c e t he t R N A A r 9 fragment was a l s o l a b e l l e d w i t h *pCp by RNA l i g a s e , i t c o n t a i n s a 3 ' - h y d r o x y l group on the 3 ' - t e r m i n a l n u c l e o t i d e . What enzyme(s) produced t h i s fragment i n s i g n i f i c a n t q u a n t i t y i s n o t c l e a r . C. D i s c u s s i o n The n u c l e o t i d e sequences o f t R N A ^ y s and o f a t R N A A r g f r a g m e n t were d e t e r m i n e d as d e s c r i b e d above. The t R N A ^ y s sequence s h a r e s e x t e n s i v e - 192 -homology w i t h o t h e r e u k a r y o t i c l y s i n e tRNAs. E x c l u d i n g d i f f e r e n c e s i n m o d i f i c a t i o n , tRNAJ: y s (sU*UU) i s 71% and 95% homologous t o t h e e q u i v a l e n t tRNAs from y e a s t and r a b b i t l i v e r , and 82% homologous t o tRNA!; y s (Cull) o f D. m e l a n o g a s t e r ( 7 ) . S i m i l a r l y , tRNAJ; y s i s 72% and 100% homologous to t h e e q u i v a l e n t l y s i n e tRNAs from y e a s t and r a b b i t l i v e r ( 7 ) . The h i g h d e gree o f s i m i l a r i t y between e q u i v a l e n t l y s i n e tRNAs from D. m e l a n o g a s t e r and r a b b i t l i v e r ( i n c l u d i n g m o d i f i c a t i o n s ) i n d i c a t e s e x t e n s i v e c o n s e r v a t i o n o f tRNA m o d i f y i n g enzyme a c t i v i t e s as w e l l as o f tRNA s t r u c t u r a l genes i n m u l t i c e l l u l a r e u k a r y o t e s . D. m e l a n o g a s t e r tRNA[; y s and t R N A ^ y s h y b r i d i z e i n s i t u t o d i s t i n c t s e t s o f s i t e s on p o l y t e n e chromosomes ( 1 0 9 ) . None o f t h e s e s i t e s match t h e l o c a l i z a t i o n a t 48F-49A on chromosome 2 o r i g i n a l l y r e p o r t e d f o r t R N A ^ y s ( 1 0 8 ) . Whether t h i s s i t e c o n t a i n s genes f o r tRNA^ j ? h a s . n o t been d e t e r m i n e d . 125 Lvs I-tRNAg samples gave g r a i n s a t the 12DE r e g i o n o f the X chromosome ( t h e major s i t e f o r tRNA^ and tRNAy h y b r i d i z a t i o n ) when i n s i t u h y b r i d i z a -t i o n s were c a r r i e d a t 65° i n 2 x SSC, but n o t a t 45° i n b u f f e r e d 70% formamide ( c o n d i t i o n s where tRNA^ j s t i l l h y b r i d i z e ; r e f . 109). The g r a i n s seen a r e p r o b a b l y due t o c r o s s - h y b r i d i z a t i o n between t R N A ^ y s o r t R N A ^ g and a s i m i l a r DNA s e q u e n c e ( s ) i n the 12DE r e g i o n . Because the tRNA!: y s b p r e p a r a t i o n a p p e a r s t o be a b o u t 90% p u r e , i t seems more l i k e l y t h a t tRNAJ: y s r a t h e r than t R N A ^ | i s t h e c r o s s - h y b r i d i z i n g s p e c i e s . A t any r a t e , t h e r e may w e l l be genes f o r tRNAs o t h e r than tRNA a t the 12DE r e g i o n o f t h e D. m e l a n o g a s t e r genome. A number o f r e c o m b i n a n t p l a s m i d s h y b r i d i z i n g w i t h tRNA|: y s have been i s o l a t e d ( 1 1 4 ) . As p a r t o f a comprehensive c h a r a c t e r i s a t i o n o f l y s i n e - 193 -tRNAs and t h e i r genes i n D. m e l a n o g a s t e r , the sequences h y b r i d i z i n g t R N A ^ i n two p l a s m i d s (pDt 39 and pDt 59) were d e t e r m i n e d . The s i n g l e gene i n pDt 39 has t h e sequence e x p e c t e d based on t h e t R N A ^ y s sequence p r e s e n t e d h e r e , w h i l e the gene i n pDt 59 d i f f e r s a t t h r e e p o s i t i o n s ( 1 2 4 ) . Both genes a r e t r a n s c r i b e d e f f i c i e n t l y i n v i t r o i n a homologous t r a n s c r i p t i o n s y s t e m ( 1 2 4 ) . Based on t h e same r e a s o n i n g as p r e s e n t e d i n C h a p t e r IV, s e c t i o n B., i t seems l i k e l y t h a t t he t R N A L y s gene d i f f e r i n g from t R N A g y S i s t r a n s c r i b e d i n viivo as w e l l . However, such a minor s p e c i e s was n o t i d e n t i f i e d i n the L vs tRNAr"7 sample a n a l y z e d h e r e . - 194 -R E F E R E N C E S A. R i c h and P.R. Schimmel (1977). A c c . Chem. Res. 10, 385-387. M.B. Hoagland, P.C. Zamecnik, and M.L. Stephenson ( 1 9 5 7 ) . B i o c h i m . B i o p h y s . A c t a 24, 215-216. R.W. H o l l e y , J . Apgar, G.A. E v e r e t t , J.T. Madison, M. M a r q u i s e e , S.H. M e r r i l l , J.R. Penswick, and A. Zamir (1965). S c i e n c e 147, 1462-1465. H.G. Zachau, D. D u t t i n g , and H. Feldmann ( 1 9 6 6 ) . H o p p e - S e y l e r ' s Z. P h y s i o l . Chem. 347, 212-235. J.T. Madison, G.A. E v e r e t t , and H. Kung (19 6 6 ) . S c i e n c e 153, 531 -534. U.L. RajBhandary, S.H. Chang, A. S t e w a r t , R.D. F a u l k n e r , R.M. H o s k i n s o n , and H.G. Khorana (1967). P r o c . Nat. Acad. S c i . USA 57, 751-758. D.H. Gauss and M. S p r i n z l (1981). N u c l e i c A c i d s Res. 9_ ( 1 ) , r l - r 2 3 . A. R i c h and U.L. RajBhandary (1976). Ann. Rev. Biochem. 45, 805-860. R.P. S i n g h a l and P.A.M. F a l l i s ( 1 9 7 9 ) . Prog. N u c l e i c A c i d s Res. Mol. B i o l . 23, 227-290. R. H a l l , "The M o d i f i e d N u c l e o s i d e s i n N u c l e i c A c i d s , " Columbia U n i v e r s i t y P r e s s , New York and London, 1971. B. S i n g e r and M. Kroger (1979). Prog. N u c l e i c A c i d s Res. Mol. B i o l . 23, 151-194. J.A. M c C l o s k e y and S. N i s h i m u r a (1977). A c c . Chem. Res. 1 0 , 403-410. S. N i s h i m u r a ( 1 9 7 2 ) . Prog. N u c l e i c A c i d s Res. Mol. B i o l . 12, 49-85. S. N i s h i m u r a , i n " T r a n s f e r RNA" ( e d . S. A l t m a n ) , M.I.T. P r e s s , Cambridge, Mass., 1978. D. S o i l ( 1971). S c i e n c e 173, 293-299. F.H.C. C r i c k (1966). J . Mol. B i o l . 19, 548-555. - 195 -C.T. Caskey, M. Beaudet, and M. N i r e n b e r g ( 1 9 6 8 ) . J . Mol. B i o l . 37, 99-118. J . E . Heckman, J . S a r n o f f , B. Alzner-DeWeerd, S. Y i n , and U.L. RajBhandary (1980). P r o c . Nat. Acad. S c i . USA 77, 3159-3163. M. Raba, K. Limburg, M. Burghagen, J.R. K a t z e , M. Simsek, J . E . Heckman, U.L. RajBhandary, and H.J. Gross (1979). Eur. J . Biochem. 97, 305-318. T. S e k i y a , K. T a k e i s h i , and T. U k i t a ( 1 9 6 9 ) . B i o c h i m . B i o p h y s . A c t a 182, 411-426. J . F . A t k i n s , R.F. G e s t e l a n d , B.R. R e i d , and C.W. Anderson (1979). C e l l 18, 1119-1131. G. R. B j o r k and P.C. N e i d h a r d t (1975). J . B a c t e r i d . 124, 99-111. S.H. Kim, G.J. Q u i g l e y , F.L. Suddath, A. McPherson, D. Sneden, J . J . Kim, J . W e i n z i e r l , and A. R i c h ( 1 9 7 3 ) . S c i e n c e 179, 285-288. J.D. R o b e r t u s , J . E . Ladner, J.T. F i n c h , D. Rhodes, R.S. Brown, B.F.C. C l a r k , and A. Klug ( 1 9 7 4 ) . N a t u r e 250, 546-551. J.D. R o b e r t u s , J . E . Ladner, J.T. F i n c h , D. Rhodes, R.S. Brown, B.F.C. C l a r k , and A. Klug ( 1 9 7 4 ) . N u c l e i c A c i d s Res. 1_, 927-932. B.F.C. C l a r k (1977). Prog. N u c l e i c A c i d s Res. Mol. B i o l . 20, 1-19. H. T. W r i g h t , P.C. Manor, K. B e u r l i n g , R.L. K a r p e l , and J.R. F r e s c o . In " T r a n s f e r RNA: S t r u c t u r e , P r o p e r t i e s , and R e c o g n i t i o n " ( e d . P.R. Schimmel, D. S o i l , and J.N. A b e l s o n ) , C o l d S p r i n g Harbor L a b o r a t o r y , 1979. R.W. S c h e v i t z , A.D. P o d j a r n y , N. K r i s h n a m a c h a r i , J . J . Hughes, P.B. S i g l e r , and J . L . Sussman (19 7 9 ) . N a t u r e 278, 188-190. " P r o c e d u r e s i n N u c l e i c A c i d R e s e a r c h , " V o l . 2 ( e d . G.L. C a n t o n i and D.R. D a v i e s ) , H a r p e r and Row, 1971. I. G i l l a m , S. M i l l w a r d , D. Blew, M. von T i g e r s t r o m , E. Wimmer, and G.M. T e n e r (1967). B i o c h e m i s t r y 6., 3043-3056. I. G i l l a m , D. Blew, R.C. W a r r i n g t o n , M. von T i g e r s t r o m , and G.M. T e n e r ( 1 9 6 8 ) . B i o c h e m i s t r y 7, 3459-3468. S. N i s h i m u r a , F. Harada, U. Narushima, and T. Seno (19 6 7 ) . B i o c h i m . B i o p h y s . A c t a 142, 133-138. W.M. Holmes, R.E. Hurd, B.R. R e i d , R.A. Rimerman, and G.W. H a t f i e l d (1975). P r o c . Nat. Acad. S c i . USA 72, 1068-1071. - 196 -R.L. P e a r s o n , J . F . W e i s s , and A.D. Kelmers (1971). B i o c h i m . B i o p h y s . A c t a 228, 770-774. R.P. S i n g h a l (1974). Eur. J . Biochem. 43, 245-252. H. G r o s j e a n , C. Takada, and J . P e t r e ( 1 9 7 3 ) . Biochem. B i o p h y s . Res. Comm. 5_3, 882-893. R. Salomon, S. Fuchs, A. Aharonov, D. G i v e o n , and U.Z. L i t t a u e r ( 1975). B i o c h e m i s t r y 14_, 4046-4050. U.L. RajBhandary, R.D. F a u l k n e r , and A. S t u a r t (1968). J . B i o l . Chem. 243, 575-583. E. Kubl i , T. S c h m i d t , and A.H., Egg, i n " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d . D. S o i l , J.N. A b e l s o n , and P.R. Schimmel), C o l d S p r i n g H a r b o r L a b o r a t o r y , 1980. A. F r a d i n , H. G r u h l , and H. Feldmann (1975). FEBS L e t t . 50, 185-189. E. R a n d e r a t h , R.C. Gupta, H.P. M o r r i s , and K. Randerath (1980). B i o c h e m i s t r y 1_9, 3476-3483. M. S i l b e r k l a n g , A.M. G i l l u m , and U.L. RajBhandary (1979). Meth. i n Enzymol. 54, P a r t G, 58-109. D. L. C r i b b s (1979). M.Sc. t h e s i s , U n i v e r s i t y o f B r i t i s h C o lumbia. R.W. H o l l e y ( 1 9 6 8 ) . Prog. N u c l e i c A c i d Res. Mol. B i o l . 8, 37-47. F. Sanger, G.G. Brownlee, and B.G. B a r r e l l ( 1 9 6 5 ) . J . Mol. B i o l . 13, 373-398. K. R a n d e r a t h , R.C. Gupta, and E. R a n d e r a t h , i n " T r a n s f e r RNA: S t r u c -t u r e , P r o p e r t i e s , and R e c o g n i t i o n " ( e d . P.R. Schimmel, D. S o i l , and J.N. A b e l s o n ) , C o l d S p r i n g Harbor L a b o r a t o r y , 1979. E. J a y , R. Bambara, R. Padmanabhan, and R. Wu (1974). N u c l e i c A c i d s Res. 1, 331-353. R.E. L o c k a r d , B. A l z n e r - D e w e e r d , J . E . Heckman, J . MacGee, M.W. T a b o r , and U.L. RajBhandary ( 1 9 7 8 ) . N u c l e i c A c i d s Res. 5_, 37-56. H. D o n i s - K e l l e r , A.M. Maxam, and W. G i l b e r t (1977). N u c l e i c A c i d s Res. 4, 2527-2538. A. S i m o n c s i t s , G.G. Brownlee, R.S. Brown, J.R. Rubin, and H. G u i l l e y ( 1977). N a t u r e 269, 833-836. D.A. P e a t t i e (1979). P r o c . Nat. Acad. S c i . USA 76, 1760-1764. - 197 -J . S t a n l e y and S. V a s s i l e n k o ( 1 9 7 8 ) . Nature 274, 87-89. R.C. Gupta and K. Randerath (1979). N u c l e i c A c i d s Res. 6_, 3443-3458. Y. Tanaka, T.A. Dyer, and G.G. Brownlee (1980). N u c l e i c A c i d s Res. 8, 1259-1272. H.P. A g r a w a l , K. Ra n d e r a t h , and E. Randerath (1981). N u c l e i c A c i d s Res. 9_, 2535-2541. H.M. S p r o u s e , M. Kashdan, L. O t i s , and B. Dudock (1981). N u c l e i c A c i d s Res. 9, 2543-2547. A. R a f a l s k i , J . K o h l i , P. A g r i s , and D. S o i l (1979). N u c l e i c A c i d s Res. 6, 2683-2695. J . A b e l s o n In " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d . D. S o i l , J.N. A b e l s o n , and P.R. Schimmel), C o l d S p r i n g Harbor L a b o r a t o r y , 1980. G.P. Mazzara and W.H. M c C l a i n . In " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d . D. S o i l , J:N. A b e l s o n , and P.R. Schimmel), C o l d S p r i n g Harbor L a b o r a t o r y , 1980. E. Lund and J . E . D a h l b e r g (1977). C e l l 1J_, 247-262. E. Lund, J . E . D a h l b e r g , L. L i n d a h l , S.R. J a s k u n i s , P.P. D e n n i s , and M. Nomura (1976). C e l l 7_, 165-177. J . R o s s i , J . Egan, M.L. Berman, and A. Landy. In " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d. D. S o i l , J.N. A b e l s o n , and P.R. Schimmel), C o l d S p r i n g H a r b o r L a b o r a t o r y , 1980. S. Altman and J.D. Smith (1971). N a t u r e New B i o l . 233, 35-39. H.G. Khorana, K.L. A g a r w a l , P. Besmer, H. B u c h i , M.H. C a r u t h e r s , P.J. C a s h i o n , M. F r i d k i n , E. J a y , K. Kl e p p e , R. K l e p p e , A. Kumar, P.C. Loewen, R.C. M i l l e r , K. Minamoto, A. Panet, U.L. RajBhandary, B. Ramamoorthy, T. S e k i y a , T. Takeya, and J.H. van de Sande (1976). J . B i o l . Chem. 251, 565-570. M.V. O l s o n , G..S. Page, A. S e n t e n a c , K. Loughney, J . K u r j a n , J . B e n d i t t , and B.D. H a l l . In " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d . D. S o i l , J.N. A b e l s o n , and P.R. Schimmel), C o l d S p r i n g H a r b o r L a b o r a t o r y , 1980. M.V. O l s o n , B.D. -Hal l , . J.R. Cameron, and.R.W. D a v i s (1979). J . Mol. B i o l . 127, 285-295. M.V. O l s o n , G.S. Page, A. S e n t e n a c , P.W. P i p e r , M. W o r t h i n g t o n , R.B. Weiss, and B.D. H a l l ( 1 9 8 1 ) . N a t u r e 291, 464-469. - 198 -S.G. C l a r k s o n , M.L. B i r n s t i e l , and I.F. Purdom (1973). J . Mol. B i o l . 79, 411-429. S.G. C l a r k s o n , M.L. B i r n s t i e l , and V. S e r r a (1973). J . Mol. B i o l . 79, 391-410. H. H o f s t e t t e r , A. Kressman, and M.L. B i r n s t i e l ( 1 9 8 1 ) . C e l l 24_, 573-585. F. M u l l e r and S.G. C l a r k s o n ( 1 9 8 0 ) . C e l l 19, 345-353. L. H a t t l e n and G. A t t a r d i (1971). J . Mol. B i o l . 56, 535-553. T. Santos and M. Z a s l o f f (1981). C e l l 23, 699-709. P. A r c a r i and G.G. Brownlee ( 1 9 8 0 ) . N u c l e i c A c i d s Res. 8, 5207-5212. M.H.L. de B r u i j n , P.H. S c h r e i e r , I.C. Eperon, B.G. B a r r e l l , E.Y. Chen, P.W. A r m s t r o n g , J.F.H. Wong, and B.A. Roe (1980). N u c l e i c A c i d s Res. 8, 5213-5222. B.G. B a r r e l l , A.T. B a n k i e r , and J . D r o u i n ( 1 9 7 9 ) . N a t u r e 282, 189-194. G. Macino, G. C o r u z z i , F.G. Nobrega, M. L i , and A. T z a g o l o f f (1979). P r o c . Nat. Acad. S c i . USA 76, 3784-3785. S. A n d e r s o n , A.T. B a n k i e r , B.G. B a r r e l l , M.H.L. de B r u i j n , A.R. C o u l s o n , J . D r o u i n , I.C. E p e r o n , D.P. N i e r l i c h , B.A. Roe, F. Sanger, P.H. S c h r e i e r , A.J.H. S m i t h , R. S t a d e n , and I.G. Young (19 8 1 ) . Nature 290, 457-465. D. O j a l a , J . Montoya, and G. A t t a r d i (1981). N a t u r e 290, 470-474. S.M. T i l g h m a n , D.C. T i e m e i e r , J.G. Seidman, B.M. P e t e r l i n , M. S u l l i v a n , J.V. M a i z e l , and P. L e d e r ( 1 9 7 8 ) . P r o c . Nat. Acad. S c i . USA 75, 725-727. R. B r e a t h n a c h , J . L . Mandel, and P. Chambon (197 7 ) . N a t u r e 270, 314-319. P.K. W e l l a u e r and I.B. Dawid (1977). C e l l 10, 193-212. R.L. White and D.S. Hogness (1977). C e l l 10, 177-192. H.M. Goodman, M.V. O l s o n , and B.D. H a l l (1977). P r o c . Nat. Acad. S c i . USA 74, 5453-5457. P. V a l e n z u e l a , A. Venegas, F. Weinberg, R. B i s h o p , and W.J. R u t t e r ( 1 9 7 8 ) . P r o c . Nat. Acad. S c i . USA 75, 190-194. - 199 -(86) A. Venegas, M. Q u i r o g a , J . Z a l d i v a r , W.J. R u t t e r , and P. V a l e n z u e l a (1979). J . B i o l . Bhem. 254, 12,306-12,309. (87) R.R. Robinson and N. Dav i d s o n (1980). C e l l 23, 251-259. (88) B. W i t t i g and S. W i t t i g (1979). C e l l 1_8, 1173-1183. (89) W. Koch, K. Edwards, and H. K o s s e l (1981). C e l l 25, 203-213. (90) R.A. Young, R. M a c k l i s , and J.A. S t e i t z (1979). J . B i o l . Chem. 254, 3264-3271. (91) B.N. White, G.M. T e n e r , J . Hold e n , and D.T. S u z u k i ( 1 9 7 3 ) . D e v e l . B i o l . 33, 185-195. (92) B.N. White, G.M. T e n e r , J . Hold e n , and D.T. Suzuki ( 1 9 7 3 ) . J . Mol. B i o l . 74, 635-651. (93) M. Al t w e g g and E. K u b l i (1980). N u c l e i c A c i d s Res. 8, 3259-3262. (94) M.A. Wosnick and B.N. White (1977). N u c l e i c A c i d s Res. 4, 3919-3930. (95) K.B. J a c o b s e n ( 1 9 7 1 ) . Nature New B i o l . 23J_, 17-19. (96) D.R. T w a r d z i c , E.H. G r e l l , and K.B. J a c o b s e n ( 1 9 7 1 ) . J . Mol. B i o l . 57, 231-245. (97) D. M i s c h k e , P. K l o e t z e l , and M. Schwochau (1975). N a t u r e 255, 79-80. (98) R. Dunn, W.R. A d d i s o n , I.C. G i l l a m , and G.M. Tener ( 1 9 7 8 ) . Can. J . Biochem. 56_, 618-623. (99) Robert J . Dunn (197 6 ) . Ph.D. t h e s i s , U n i v e r s i t y o f B r i t i s h Columbia. (100 W.R. A d d i s o n , u n p u b l i s h e d r e s u l t s . (101) W.R. A d d i s o n , I.C. G i l l a m , and G.M. Tener (1982). J . B i o l . Chem., i n p r e s s . (102) B.N. White, R. Dunn, I. G i l l a m , G.M. T e n e r , D.J. A r m s t r o n g , F. Skoog, C R . F r i h a r t , and N.J. Leon a r d ( 1 9 7 5 ) . J . B i o l . Chem. 250, 515-521. (103) M. A l t w e g g and E. K u b l i ( 1 9 8 0 ) . N u c l e i c A c i d s Res. 8, 215-223. (104) S. S i l v e r m a n , I.C. G i l l a m , G.M. T e n e r , and D. S o i l ( 1979). N u c l e i c A c i d s Res. 6, 435-442. - 200 -S. S i l v e r m a n , J . Heckman, G.J. C o w l i n g , A.D. Delaney, R.J. Dunn, I.C. G i l l a m , G.M. T e n e r , D. S o i l , and U.L. RajBhandary ( 1 9 7 9 ) . N u c l e i c A c i d s Res. 6, 421-433. M. A l t w e g g and E. K u b l i (1979). N u c l e i c A c i d s Res. ]_t 93-105. L. Weber and E. B e r g e r ( 1 9 7 6 ) . B i o c h e m i s t r y 1_5, 5511-5519. T.A. G r i g l i a t t i , B.N. White, G.M. Ten e r , T.C. Kaufman, and D.T. Su z u k i (1974). P r o c . Nat. Acad. S c i . USA 71_, 3527-3531. S. H a y a s h i , I.C. G i l l a m , A.D. Delaney, R. Dunn, G.M. T e n e r , T.A. G r i g l i a t t i , and D.T. S u z u k i ( 1 9 8 0 ) . Chromosoma 76, 65-84. S. H a y a s h i , W.R. A d d i s o n , I.C. G i l l a m , T.A. G r i g l i a t t i , and G.M. Ten e r (1981). Chromosoma 82, 385-397. E. K u b l i , T. Schmidt, and A.H. Egg. In " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d . D. S o i l , J.N. A b e l s o n , and P.R. Schimmel), C o l d S p r i n g Harbor L a b o r a t o r y , 1980. R.T. E l d e r , O.C. Uhlenbeck, and P. Szabo. In " T r a n s f e r RNA: B i o l o g i c a l A s p e c t s " ( e d . D. S o i l , J.N. A b e l s o n , and P.R.. Schimmel), C o l d S p r i n g Harbor L a b o r a t o r y , 1980. R. Dunn, S. H a y a s h i , I.C. G i l l a m , A.D. Delaney, G.M. T e n e r , T.A. G r i g l i a t t i , T.C. Kaufman, and D.T. S u z u k i ( 1 9 7 9 ) . J . Mol. B i o l . 128, 277-287. R. Dunn, A.D. Delaney, I.C. G i l l a m , S. H a y a s h i , G.M. T e n e r , T. G r i g l i a t t i , V. M i s r a , M.G. S p u r r , D.M. T a y l o r , and R.C. M i l l e r , J r . (1979). Gene 7, 197-215. P.H. Yen, A. S o d j a , M.. Cohen, S.E. Conrad, M. Wu, N. D a v i d s o n , and C. I l g e n (1977). C e l l 1J_, 763-777. B. Hovemann, S. Sharp, H. Yamada, and D. S o i l ( 1980). C e l l 19, 889-895. P.H. Yen and N. Da v i d s o n (1980). C e l l 22, 137-148. J.P. Gergen, J.Y. Loewenberg, and P.C. Wensink (1981). J . M o l . . B i o l . 147, 475-499. H.A. Hosbach, M. S i l b e r k l a n g , and B . J . McCarthy (1980). C e l l 21, 169-178. — N.D. Hershey and N. Da v i d s o n (1980). N u c l e i c A c i d s Res. 8, 4899-4910. - 201 -S. Sharp, D. De F r a n c o , M. S i l b e r k l a n g , H. Hosbach, J.P. Gergen, P.C. Wensink, R. D u d l e r , E. K u b l i , and D. S o i l ( 1981). M a n u s c r i p t s u b m i t t e d . W.R. A d d i s o n , C R . A s t e l l , A.D. Delaney, I.C. G i l l a m , S. H a y a s h i , R.C. M i l l e r , B. R a j p u t , M. Smith, D.M. T a y l o r , and G.M. Ten e r (1982). J . B i o l . Chem., i n p r e s s . D. De F r a n c o , 0. Schmidt, and D. S o i l ( 1980). P r o c . Nat. Acad. S c i . USA 77, 3365-3368. D. S o i l , p e r s o n a l communication. S. S a k o n j u , D.F. Bogenhagen, and D.D. Brown (1980). C e l l 19_, 13-25. D.F. Bogenhagen, S. S a k o n j u , and D.D. Brown (19 8 0 ) . C e l l 1_9, 27-35. S. S i l v e r m a n , 0. Schmidt. D. S o i l , and B. Hovemann ( 1 9 7 9 ) . J . B i o l . Chem. 254, 10290-1.0294. E.M. D e R o b e r t i s and M.V. O l s o n ( 1 9 7 9 ) . Nature 278, 137-143. T. Dingermann, S. Sharp, B. A p p e l , D. DeFranco, S. Mount, R. Heiermann, 0. Pongs, and D. S o i l ( 1 9 8 1 ) . N u c l e i c A c i d s Res. 9_, 3907-3918. K.U. Sprague, D. L a r s e n , D. Morton (1980). C e l l 22, 171-178. 1. M. Glynn and J.B. C h a p p e l l (1964). Biochem. J . 90, 147-149. A.M. Maxam and W. G i l b e r t ( 1 9 7 7 ) . P r o c . Nat. Acad. S c i . USA 74, 560-564. M. F u j i m o t o , A. Kuninaka, and H. Yo s h i n o ( 1 9 7 4 ) . Agr. B i o l . Chem. 38, 1555-1561. A.G. Bruce and 0 . C Uhlenbeck (1978). N u c l e i c A c i d s Res. 5_, 3665-3677. F. Sanger and A.R. C o u l s o n (1978). FEBS L e t t . 87, 107-110. J.R. L i l l e h a u g and K. Kleppe ( 1 9 7 7 ) . N u c l e i c A c i d s Res. 4, 373-379. J.-P. G a r e l , R.L. G a r b e r , and M.A.Q. S i d d i q u i ( 1 9 7 7 ) . B i o c h e m i s t r y 16, 3618-3624. M.I. Simon and H. Van Vu n a k i s ( 1 9 6 4 ) . A r c h . Biochem. B i o p h y s . 105, 197-206. L.H. Schulman ( 1 9 7 2 ) . P r o c . Nat. Acad. S c i . USA 69, 3594-3597. - 202 -140) J.A. H a i n e s , C.B. Reese, and A.R. Todd (1962). J . Chem. Soc. 5281-5288. 141) E.M. S o u t h e r n and A.R. M i t c h e l l (1971). Biochem. J . 123, 613-617. 142) Y. Yamada and H. I s h i k u r a ( 1 9 7 5 ) . B i o c h i m . B i o p h y s . A c t a 402, 285-287. 143) K. Ra n d e r a t h , R.C. Gupta, and E. Randerath ( 1 9 8 0 ) . Meth. i n . Enzymol., v o l . . 6 5 , 638-680. 144) M. S a n e y o s h i and S. N i s h i m u r a (1970). B i o c h i m . B i o p h y s . A c t a 204, 389-399. 145) M. S a n e y o s h i and S. N i s h i m u r a (1971). B i o c h i m . B i o p h y s . A c t a 246, 123-131. 146) B.G.. B a r r e l 1, i n "P r o c e d u r e s i n N u c l e i c A c i d R e s e a r c h , " V o l . 2 (e d . G.L. C a n t o n i and D.R. D a v i e s ) , pp. 751-795. Harper and Row, New York, 1971. 147) E.M. S o u t h e r n ( 1 9 7 9 ) . A n a l . Biochem. 100, 319-323. 148) J.G.. S u t c l i f f e ( 1978). N u c l e i c A c i d s Res. 5_, 2721-2728. 149) K. Murray and N.E. Murray (1975). J . Mol. B i o l . 98, 551-564. 150) E.M. S o u t h e r n (1975). J . Mol. B i o l . 98, 503-517. 151) H.0. Smith and M.L. B i r n s t i e l ( 1 9 7 6 ) . N u c l e i c A c i d s Res. 3, 2387-2398. 152) A.M. Maxam and W. G i l b e r t (1980). Methods i n Enzymol., v o l . 65, pp. 499-559. 153) D e l e t e d i n p r o o f . 154) D.L. L i n d s l e y and E.H. G r e l l , " G e n e t i c V a r i a t i o n s o f D r o s o p h i l a  m e l a n o g a s t e r , " C a r n e g i e I n s t i t u t i o n , Washington, D . C , 1972. 155) S. H a y a s h i , u n p u b l i s h e d r e s u l t s . 156) B. R a j p u t , u n p u b l i s h e d r e s u l t s . 157) D.M. Brown, A. Todd, and S. V a r a d a r a j a n (1956). J . Chem. Soc. 2384. 158) G.W. R u s h i z k y and H.A. Sober (1968). Prog. N u c l e i c A c i d Res. Mol. B i o l . - 8 , 171-207. 159) E. Ra n d e r a t h , C.-T. Yu, and K. Randerath ( 1 9 7 2 ) . A n a l . Biochem. 48, 172-198. 160) F.M. R i c h a r d s and H.W. Wyckoff, i n "The Enzymes" ( e d . P.D. B o y e r ) , Academic P r e s s , New York and London, 1971. - 203 -161) P.R. Schimmel and D. S o i l ( 1979). Ann. Rev. Biochem. 48, 601-648. 162) A. R i c h and P.R. Schimmel (1977). N u c l e i c A c i d s Res. 4, 1649-1665. 163) S.A. Endow and R.J. R o b e r t s (1977). J . Mol. B i o l . 11.2, 521-529. 164) B. R a j p u t , D. D e M i l l e , R.C. M i l l e r , and G.B. S p i e g e l m a n , p e r s o n a l communication. 165) B . - I . Ono, N. W i l l s , J.W. S t e w a r t , R.F. G e s t e l a n d , and F. Sherman (198 1 ) . J . Mol. B i o l . 150, 361-373. 166) M.C. B r a n d r i s s , J.W. S t e w a r t , F. Sherman, and D. B o t s t e i n (1976). J . Mol. B i o l . 102, 467-476. 167) A. Hinnen, J.B. H i c k s , and G.R. F i n k ( 1 9 7 8 ) . P r o c . Nat. Acad. S c i . USA 75, 1929-1933. 168) S. S c h e r e r and R.W. D a v i s ( 1 9 8 0 ) . S c i e n c e 209, 1380-1384. 169) H.L. K l e i n and T.D. P e t e s ( 1 9 8 1 ) . N a t u r e 289, 144-148. 170) J.A. J a c k s o n and G.R. F i n k (1981). Nature 292, 306-311. 171) J . F . E r n s t , J.W. S t e w a r t , and F. Sherman (1981). P r o c . Nat. Acad. S c i . USA 78, 6334-6338. 172) H. H o t t i n g e r and U. L e u p o l d (1981). C u r r e n t G e n e t i c s 3_, 133-143. 173) J . L . S l i g h t o m , A.E. B l e c h l , and 0. S m i t h i e s (1980). C e l l 2]_, 627-638. 174) S.-h. Shen, J . L . S l i g h t o m , and 0. S m i t h i e s ( 1 9 8 1 ) . C e l l 26, 191-203. 175) D. B a l t i m o r e ( 1 9 8 1 ) . C e l l 24, 592-594. 176) H. Rogg, P. M u l l e r , and M. S t a e h e l i n (1975). E ur. J . Biochem. 53, 115-127. 177) R.L. S i n s h e i m e r ( 1 9 7 7 ) . Ann. Rev. Biochem. 46, 415-438. 178) F. Sanger, S. N i c k l e n , and A.R. C o u l s o n (1977). P r o c . Nat. Acad. S c i . USA 74, 5463-5467. 179) E.H. B i r k e n m e i e r , D.D. Brown, and E. J o r d a n (1978). C e l l 15, 1077-1086. ~~ 180) H.J. G r o s s , M. Simsek, M. Raba, K. Limburg, J . Heckman, and U.L. RajBhandary (1974). N u c l e i c A c i d s Res. 1 , 35-44. - 204 -(181) B.N. White (1975). B i o c h i m . B i o p h y s . A c t a 395, 322-328. (182) A. Yamaizumi, S. N i s h i m u r a , K. Limburg, M. Raba, H.J. G r o s s , P.F. C r a i n , and J.A. McCloskey (1979). J . Am. Chem. Soc. 101, 2224-2225. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0094971/manifest

Comment

Related Items