Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Sequence analysis of transfer RNA 7 ser of Drosophila melanogaster Cribbs, David Lamar 1979

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1979_A6_7 C75.pdf [ 4.48MB ]
Metadata
JSON: 831-1.0094654.json
JSON-LD: 831-1.0094654-ld.json
RDF/XML (Pretty): 831-1.0094654-rdf.xml
RDF/JSON: 831-1.0094654-rdf.json
Turtle: 831-1.0094654-turtle.txt
N-Triples: 831-1.0094654-rdf-ntriples.txt
Original Record: 831-1.0094654-source.json
Full Text
831-1.0094654-fulltext.txt
Citation
831-1.0094654.ris

Full Text

SEQUENCE ANALYSIS OF TRANSFER RNAp OF DROSOPHILA MELANOGASTER by D A V I D LAMAR C R I B B S B . A . , T h e U n i v e r s i t y o f C o l o r a d o , 1975 A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L M E N T OF T H E REQUIREMENTS FOR T H E DEGREE OF MASTER OF S C I E N C E i n THE F A C U L T Y OF GRADUATE S T U D I E S DEPARTMENT OF B I O C H E M I S T R Y F A C U L T Y OF M E D I C I N E We a c c e p t t h i s t h e s i s a s c o n f o r m i n g t o t h e r e q u i r e d s t a n d a r d THE UNIVERSITY OF B R I T I S H COLUMBIA O c t o b e r 1979 @ D a v i d L a m a r C r i b b s , 1979 I n p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l l m e n t o f t h e r e q u i r e m e n t s f o r an a d v a n c e d d e g r e e a t The U n i v e r s i t y o f B r i t i s h C o l u m b i a , I a g r e e t h a t t h e L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r a n c e a n d s t u d y . I f u r t h e r a g r e e t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g o f t h i s t h e s i s f o r s c h o l a r l y p u r p o s e s may be g r a n t e d by t h e Head o f my d e p a r t m e n t o r by h i s o r h e r r e p r e s e n t a t i v e s . I t i s u n d e r s t o o d t h a t c o p y i n g o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l n o t be a l l o w e d w i t h o u t my w r i t t e n p e r m i s s i o n . SUMMARY (Abstract) S e q u e n c e a n a l y s i s o f tRNAy f r o m Drosophila melanogaster was c a r r i e d o u t , p r i m a r i l y by t h e f o r m a m i d e d e g r a d a t i o n a n d p o s t - l a b e l i n g m e t h o d o f S t a n l e y a n d V a s s i l e n k o . P r e l i m i n a r y a n a l y s i s was o n t h e t e r m i n a l 32 n u c l e o s i d e - 5 ' , 3 ' - b i s [ 5 1 - P ] p h o s p h a t e s o f e l e c t r o p h o r e t i c a l l y s e p a r a t e d 32 32 [ 5 1 - P ] r i b o o l i g o n u c l e o t i d e s , i d e n t i f y i n g t h e [ P ] - n u c l e o t i d e s by c h r o m a t o g r a p h y on P E I - c e l 1 u l o s e p l a t e s . F u r t h e r a n a l y s i s o f p o s s i b l e m o d i f i e d n u c l e o t i d e s was p e r f o r m e d by t h i n l a y e r c h r o m a t o g r a p h y o f [ 5 ' -32 P ] n u c l e o s i d e p h o s p h a t e s d e r i v e d by n u c l e a s e P-j d i g e s t i o n f r o m [ 5 1 -32 P ] o l i g o m e r s . The p a r t i a l s e q u e n c e g e n e r a t e d i n t h i s f a s h i o n was . 32 S e r s u p p l e m e n t e d by l a d d e r g e l s e q u e n c e a n a l y s i s o f [ 5 1 - P ] t R N A , a n d t o a l i m i t e d e x t e n t by two d i m e n s i o n a l h o m o c h r o m a t o g r a p h y . I n t h i s w a y , a s e q u e n c e was o b t a i n e d t h a t i s c o m p l e t e e x c e p t f o r p a r t o f t h e a m i n o a c y l s t e m a n d t h e 5 ' - e n d o f t h e e x t r a a r m . The d a t a a r e c o n s i s t e n t w i t h a s e q u e n c e f o r t R N A ^ e r o f pGCAGmUUGUGGCac4CGAGCGmGDDAAGGCXUCUGA— m 3 CUI GAi 6AAujCAGAUmUCCCUm3CUGGGAGm5CGUAGGTijjCGm1 AAUCCUACCGACUGCNCCA. i i TABLE OF CONTENTS P a g e SUMMARY i i L I S T OF TABLES i v L I S T OF FIGURES v ACKNOWLEDGMENTS v i C h a p t e r 1 INTRODUCTION . . . . . . . 1 . l . A . l RNA 1 1 . A . 2 t R N A . . . • , 2 1 . A . 3 tRNA Genes 6 I . B S e q u e n c i n g T r a n s f e r RNA 9 2 MATERIALS AND METHODS 18 A b b r e v i a t i o n s , G e n e r a l . . . . . . . . . 18 S y n t h e s i s o f [ y - 3 2 P ] A T P . 19 A u t o r a d i o g r a p h y 22 S e q u e n c i n g by t h e F o r m a m i d e D e g r a d a t i o n M e t h o d . . . . . 23 L a d d e r G e l A n a l y s i s . . . . 28 T w o - D i m e n s i o n a l H o m o c h r o m a t o g r a p h y . . . . . 30 3 RESULTS. . . . . . . . . . 32 4 DISCUSSION 6 3 BIBLIOGRAPHY . . . . . . 69 i i i LIST OF TABLES T a b l e P a g e if .1 C h r o m a t o g r a p h i c m o b i l i t i e s o f p N p ' s . . . 41 2 C h r o m a t o g r a p h i c m o b i l i t i e s o f p N ' s , 47 i v LIST OF FIGURES F i g u r e P a g e 1 C l o v e r l e a f s t r u c t u r e o f y e a s t tRNA 1 2 C l o v e r l e a f s t r u c t u r e o f r a t l i v e r t R N A ^ e r 2 3 S e p a r a t i o n o f [ 3 2 P ] R N A f r a g m e n t s . 3 3 - 3 4 4 C h r o m a t o g r a p h y o f p N p ' s , 3 5 - 4 0 5 I d e n t i f i c a t i o n o f m o d i f i e d n u c l e o t i d e s 4 2 - 4 5 6 Two d i m e n s i o n a l t h i n l a y e r c h r o m a t o g r a p h y o f * p N ' s 4 8 - 4 9 32 7 Two d i m e n s i o n a l h o m o c h r o m a t o g r a p h y o f a [ P ] r i b o o l i g o m e r . . 50 8 L a d d e r g e l a n a l y s i s o f y e a s t t R N A j l y 5 1 - 5 2 9 L a d d e r g e l a n a l y s i s , 3 ' - e n d o f t R N A ^ e r 5 3 - 5 4 10 L a d d e r g e l a n a l y s i s , 5 ' - e n d o f t R N A ^ e r 5 7 - 5 8 11 S e q u e n c e c o m p a r i s o n o f s e r i n e tRNAs . . . . . 59 12 C l o v e r l e a f s t r u c t u r e o f Dvosophila t R N A ^ e r 60 v ACKNOWLEDGMENTS I am i n d e b t e d t o t h e p e o p l e i n o u r l a b o r a t o r y o v e r t h e p a s t t h r e e y e a r s f o r h e l p a n d d i s c u s s i o n s , a n d p a r t i c u l a r l y t o I a n G i l l a m a n d G o r d o n T e n e r f o r w o r t h w h i l e a d v i c e a n d e n c o u r a g e m e n t . T h a n k s a l s o go t o w o r k e r s n o t i n o u r l a b f o r t h e i r p r a c t i c a l a d v i c e , i n c l u d i n g C a r o l i n e A s t e l l a n d D a v i d L e u n g ; a n d e s p e c i a l l y t o O t t o H a g e n b u c h l e , w h o s e h e l p was e x t e n s i v e a n d t i m e l y . S p e c i a l t h a n k s t o J e n n y , who g a v e me much h e l p a n d s u p p o r t . v i 1 . C h a p t e r 1 I N T R O D U C T I O N PART A l . A . l RNA R i b o n u c l e i c a c i d s (RNA) p e r f o r m a v a r i e t y o f f u n c t i o n s i n t h e c e l l . S t a b l e RNAs a r e p r i m a r i l y s t r u c t u r a l c o m p o n e n t s i n v o l v e d i n p r o t e i n s y n t h e s i s , a n d i n c l u d e t h e r i b o s o m a l RNAs ( r R N A ) a n d t r a n s f e r RNAs ( t R N A ) . M e s s e n g e r RNA (mRNA), i n e u k a r y o t e s a p p a r e n t l y d e r i v e d f r o m h i g h m o l e c u l a r w e i g h t n u c l e a r RNA ( h n R N A ) , i s more r a p i d l y m e t a b o l i z e d t h a n s t a b l e RNA, a n d i s i n f o r m a t i o n a l , d i r e c t i n g t h e i n c o r p o r a t i o n o f a m i n o a c i d s i n t o p r o t e i n . RNA i s d e r i v e d by t r a n s c r i p t i o n f r o m t h e g e n o m i c DNA o f a c e l l , a n d i t s s e q u e n c e r e f l e c t s t h a t o f t h e t e m p l a t e DNA. The f u n c t i o n a l RNA may d i f f e r g r e a t l y f r o m t h e i n i t i a l t r a n s c r i p t . M e c h a n i s m s b y w h i c h s p e c i f i c n u c l e a s e s a c t t o g e n e r a t e m a t u r e RNA s p e c i e s by r e m o v a l o f t e r m i n a l n u c l e o t i d e s e q u e n c e s h a v e b e e n s t u d i e d ( f o r r e v i e w , 1 ) . I t h a s r e c e n t l y b e e n f o u n d t h a t i n many e u k a r y o t i c g e n e s , t h e RNA t r a n s c r i p t i s n o t c o l i n e a r w i t h t h e DNA, due t o t h e p r e s e n c e o f i n t e r v e n i n g s e q u e n c e s i n t h e DNA (2-8). I n e x p r e s s i o n o f some y e a s t tRNA g e n e s , t h i s r e q u i r e s t h e p r e s e n c e o f . enzyme a c t i v i t i e s c a p a b l e o f e x c i s i n g t h e i n t e r v e n i n g s e q u e n c e f r o m a tRNA p r e c u r s o r a n d l i g a t i n g t h e s p l i t tRNA ( 9 , 1 0 ) . Y e a s t p r e c u r s o r tRNA 2 . i s p r o c e s s e d t o tRNA s i z e by enzyme a c t i v i t i e s p r e s e n t i n o o c y t e s o f Xenopus laevis ( 1 1 ) , s u g g e s t i n g t h a t i n t e r v e n i n g s e q u e n c e s i n tRNA g e n e s , a n d e n z y m e s l i k e t h o s e i n y e a s t n e e d e d t o e x c i s e t h o s e s e q u e n c e s , may be g e n e r a l i n e u k a r y o t e s . I n a c o m p r e h e n s i v e s t u d y o f a p a r t i c u l a r g e n e ' s e x p r e s s i o n , i t i s d e s i r a b l e t o know t h e s e q u e n c e o f t h e DNA a n d o f t h e RNA p r o d u c t , a n d a p r e c i s e k n o w l e d g e o f b o t h i s n e c e s s a r y t o i d e n t i f y i n t e r v e n i n g s e q u e n c e s . C o m p a r i s o n o f a l a r g e number o f s e q u e n c e s o f r e l a t e d RNAs may be o f v a l u e i n s t u d y i n g s t r u c t u r e - f u n c t i o n r e l a t i o n s h i p s ( 1 2 , 1 3 ) . F u r t h e r , c o m p a r a -t i v e s t u d i e s on gene s t r u c t u r e a r e now p o s s i b l e i n many c a s e s , d u e t o t h e g e n e s ' a c c e s s i b i l i t y t h r o u g h r e c o m b i n a n t DNA t e c h n i q u e s . Genes o f i n t e r e s t may be i s o l a t e d a s i n s e r t s i n t o p l . a s m i . d s o r b a c t e r i o p h a g e by m e t h o d s l i k e t h o s e o f G r u n s t e i n a n d H o g n e s s ( 1 4 ) o r o f M a n i a t i s et al. ( 1 5 ) , p r o v i d e d a s e l e c t i v e s y s t e m i s a v a i l a b l e t o r e t r i e v e DNA o f i n t e r e s t . P u r i f i e d RNAs d e f i n e s p e c i f i c r e g i o n s o f i n t e r e s t i n t h e g e n o m e , t h o s e e x p r e s s e d d u r i n g c e l l u l a r f u n c t i o n ; a n d b e i n g c o m p l e m e n t a r y t o t h e i r t e m p l a t e DNA, t h e RNAs a r e u s e f u l i n s e l e c t i n g f o r r e c o m b i n a n t c l o n e s c o n t a i n i n g t h e g e n e s t o be s t u d i e d . 1 . A . 2 tRNA The tRNA o f a c e l l i s a m i x t u r e o f a t l e a s t 20 d i f f e r e n t s p e c i e s , w i t h o n e o r more a c c e p t o r s f o r e a c h a m i n o a c i d r e q u i r e d f o r s y n t h e s i s o f p r o t e i n s . T r a n s f e r RNAs a r e s m a l l , n o r m a l l y 7 5 - 9 0 n u c l e o t i d e s i n l e n g t h , a n d c o n t a i n many m o d i f i e d n u c l e o t i d e s ( 1 6 ) . A s u b s t a n t i a l b o d y o f l i t e r a t u r e o n tRNA s e q u e n c e s h a s b e e n c o m p i l e d , a n d c e r t a i n f e a t u r e s o f 3 . tRNA s t r u c t u r e h a v e become c l e a r ( 1 7 ) . The n u c l e o t i d e s e q u e n c e s o f t R N A s may be d r a w n i n a s t a n d a r d " c l o v e r l e a f " c o n f i g u r a t i o n ( F i g . 1 , 2 ) . I n t h i s s t r u c t u r e t h e r e a r e d o u b l e - s t r a n d e d s t e m s o f s t a n d a r d l e n g t h , a 3 * - t e r m i n a l CCA s e q u e n c e , a n d n e a r l y i n v a r i a n t n u c l e o t i d e s a t c e r t a i n p o s i t i o n s ( 1 7 , 1 8 ) . T r a n s f e r RNAs a r e r e m a r k a b l e i n t h e v a r i e t y o f c e l l c o m p o n e n t s i n t e r a c t i n g w i t h t h e m . The tRNA p r e c u r s o r s t r a n s c r i b e d f r o m DNA a r e p r o -c e s s e d b y a number o f e n z y m e s , i n c l u d i n g n u c l e o t i d y l t r a n s f e r a s e w h i c h r e p a i r s t h e C C A - e n d . The m o d i f i e d n u c l e o t i d e s p r e s e n t i n m a t u r e tRNA a r e i n t r o d u c e d p o s t - t r a n s c r i p t i o n a l l y by s p e c i f i c t R N A - m o d i f y i n g e n z y m e s . T r a n s f e r RNAs a r e a l s o r e c o g n i z e d by many c o m p o n e n t s o f t h e p r o t e i n -s y n t h e t i c m a c h i n e r y , s u c h a s a m i n o a c y l - t R N A s y n t h e t a s e s , r i b o s o m e s , s e v e r a l p r o t e i n s i n v o l v e d i n i n i t i a t i o n , e l o n g a t i o n , a n d t e r m i n a t i o n o f p e p t i d e c h a i n s , a n d by m e s s e n g e r RNA. T h r o u g h t h e i r i n v o l v e m e n t i n p r o t e i n s y n t h e s i s , t R N A s a r e i n t i m a t e l y t i e d t o a w i d e v a r i e t y o f c e l l u l a r f u n c t i o n s . I t i s known t h a t c e r t a i n t R N A s c a n h a v e r e g u l a t o r y r o l e s . S e v e r a l c l a s s e s o f m u t a t i o n s i n Salmonella typhimuHvm c a u s e d e r e p r e s s i o n o f t h e h i s t i d i n e o p e r o n by t h e i r e f f e c t on h i s t i d i n e tRNA ( 1 9 ) . A number o f s u p p r e s s o r tRNAs h a v e b e e n c h a r a c t e r i z e d w h i c h i n s e r t an a m i n o a c i d i n t o p o l y p e p t i d e s i n r e s p o n s e t o a t e r m i n a t i o n c o d o n . The m o s t i n t e n s i v e l y s t u d i e d o f t h e s e i s t h e t y r o s i n e s u p p r e s s o r tRNA (sut) o f E-.coli, a g e n e f o r w h i c h h a s b e e n s y n t h e s i z e d ( 2 0 ) , b a s e d o n t h e s e q u e n c e o f t h e p r e c u r s o r RNA ( 2 1 ) , a n d i s b e i n g c h a r a c t e r i z e d i n d e t a i l . A l o n g somewhat d i f f e r e n t l i n e s , t r y p t o p h a n tRNA a c t s i n a t t e n u a t i o n o f t h e t r p o p e r o n o f E.ooli ( 2 2 ) , o r as a p r i m e r f o r t r a n s c r i p t i o n o f Rous s a r c o m a v i r u s ( 2 3 ) . The tRNAs o f E-.coli h a v e b e e n b e s t s t u d i e d . M o s t o f t h e tRNAs h a v e b e e n i s o l a t e d a n d s e q u e n c e d ( 1 7 ) , t h e i r c o d o n r e s p o n s e s e x a m i n e d ( 2 4 ) , 4. 15 h U G A C G G hU A 20 P'G G G C G U G T U m'G U G C G|Q • • • G C G C A 7 6 C c A c c u G C U A G G C C U C C G G h l l ' "'46 c . G AG u • A c • G c • G c • G u u ml 3A 1 GC F i g u r e 1 . C l o v e r l e a f s t r u c t u r e o f y e a s t tRNA 5. A - Q - S E B C c G P G - C U - A A - U G - C U - A C - G G - C U A A C U C G U C C A I M D . u G A G c c G 1 " " G M O G , • , G C A G G C G ' ' ' C - s M T4» g i g - ^ C - M A - 4»arvi 3 M - C A U A - I P F i g u r e 2. C l o v e r l e a f s t r u c t u r e o f r a t l i v e r t R N A ^ e r . 6 . a n d t h e i r g e n e s mapped o n t h e E.coli c h r o m o s o m e ( 2 5 ) . M u t a n t s t r a i n s w i t h a l t e r e d t R N A s , i n c l u d i n g i n f o r m a t i o n a l s u p p r e s s o r s ( 2 6 , 2 8 , 2 9 , 3 0 , 3 1 , 3 2 ) a n d t e m p e r a t u r e s e n s i t i v e l e s i o n s ( 2 7 ) h a v e b e e n i s o l a t e d a n d c h a r a c t e r i z e d . Some d i f f e r e n c e s a r e a p p a r e n t b e t w e e n t r a n s f e r RNAs o f p r o k a r y o t e s a n d e u k a r y o t e s . The c l o v e r l e a f s t r u c t u r e s o f i s o a c c e p t i n g t R N A s may b e m a r k e d l y d i f f e r e n t ( f o r e x a m p l e , t h e e x t r a a r m o f E.coli t R N A ^ r c o n t a i n s 8 n u c l e o t i d e s m o r e t h a n t h a t o f m a m m a l i a n t R N A ^ r ) ( 1 7 ) . A s o r g a n i s m s become more c o m p l e x , t h e i r t R N A s c o n t a i n i n c r e a s i n g l y more m o d i f i e d n u c l e o t i d e s , up t o 25% o f t h e t o t a l ( 1 6 ) . D i f f e r e n c e s a r e a l s o s e e n i n t h e t y p e s o f m o d i f i c a t i o n s p r e s e n t ( e . g . s U h a s b e e n f o u n d o n l y i n p r o k a r y o t i c t R N A s ) . I t i s n o t c l e a r how many o f t h e m o d i f i c a t i o n s a f f e c t tRNA f u n c t i o n i n p r o t e i n s y n t h e s i s . Removal o r a l t e r a t i o n o f a h y p e r m o d i f i e d b a s e a d j a c e n t t o t h e a n t i c o d o n may r e s u l t i n l o s s o f t e m p l a t e b i n d i n g a c t i v i t y o r a m i n o H i s a c i d t r a n s f e r f u n c t i o n ( 2 4 ) . H o w e v e r , tRNA f r o m h i s T m u t a n t s o f Salmonella typhimuriun, l a c k i n g two p s e u d o u r i d i n e r e s i d u e s n o r m a l l y p r e s e n t H i s i n t h e a n t i c o d o n r e g i o n o f w i l d t y p e tRNA ( 3 3 ) , i s p r e s e n t i n n o r m a l a m o u n t s , i s a m i n o a c y l a t e d n o r m a l l y , a n d a p p e a r s t o f u n c t i o n l i k e w i l d t y p e i n p r o t e i n s y n t h e s i s , a l t h o u g h n o t i n r e p r e s s i o n c o n t r o l ( 3 4 ) . I n t h i s l i g h t , i t i s o f v a l u e t o know t h e s e q u e n c e s o f many tRNA s p e c i e s , i n c l u d i n g m o d i f i e d n u c l e o t i d e s , t o w a r d an u n d e r s t a n d i n g o f tRNA f u n c t i o n s a n d t h e a t t r i b u t e s m a k i n g t h e m s u i t a b l e f o r t h e s e f u n c t i o n s . 1 . A . 3 tRNA Genes T r a n s f e r RNA g e n e s a r e a t t r a c t i v e model s y s t e m s , a n d many s t u d i e s o n t h e m h a v e b e e n u n d e r t a k e n i n r e c e n t y e a r s . I n E.,coli t h e r e a r e 7. a p p r o x i m a t e l y 60 tRNA g e n e s , m o s t l y l o c a t e d i n c l u s t e r s a t s e v e r a l l o c a -t i o n s o n t h e chromosome ( 2 5 , 3 5 ) , t h o u g h g e n e s f o r s e v e r a l tRNAs a r e f o u n d i n t h e s p a c e r r e g i o n s b e t w e e n 16S a n d 23S rRNA g e n e s a n d a r e c o - t r a n s c r i b e d w i t h t h e rRNAs ( 3 6 , 4 3 ) . I n e u k a r y o t e s t h e tRNA g e n e s a r e r e d u n d a n t , t h o u g h t h e o r g a n i z a t i o n o f g e n e s f o r a p a r t i c u l a r i s o a c c e p t b r may v a r y . T h e r e a r e a b o u t 3 2 0 - 4 4 0 tRNA gene c o p i e s i n y e a s t ( 3 7 ) . D i g e s t i o n o f y e a s t DNA w i t h r e s t r i c t i o n e n d o n u c l e a s e s a n d s e p a r a t i o n g i v e e i g h t d i s t i n c t f r a g m e n t s h y b r i d i z i n g t y r o s i n e tRNA ( 3 8 ) . T h i s i s i n a g r e e m e n t w i t h g e n e t i c s t u d i e s w h i c h i d e n t i f i e d e i g h t u n l i n k e d l o c i c a p a b l e o f m u t a t i o n t o t y r o s i n e - i n s e r t i n g n o n s e n s e s u p p r e s s o r s ( 3 9 ) , i n d i c a t i n g t h a t t h e s e tRNA g e n e s may be w i d e l y s c a t t e r e d . I n Xenopus laevis t h e r e a r e a b o u t 8 0 0 0 g e n e c o p i e s , e s t i m a t e d by h y b r i d i z a t i o n k i n e t i c s t o c o n s i s t o f 4 3 tRNA s e q u e n c e s e a c h r e i t e r a t e d a b o u t 200 t i m e s . T h e r e i s e x t e n s i v e c l u s t e r i n g o f g e n e s . M o s t o f t h e tRNA g e n e s a r e g r o u p e d t o g e t h e r w i t h s p a c e r DNA o v e r l o n g r e g i o n s e x t e n d i n g up 5 t o 10 b a s e - p a i r s o r more w i t h a n a v e r a g e s p a c e r o f a b o u t 8 0 0 b a s e - p a i r s ( 4 0 , 4 1 , 4 2 ) . A p p r o x i m a t e l y 100 s p e c i e s o f Drosophila melanogastev tRNA c a n be d i s t i n g u i s h e d by R P C - 5 c o l u m n c h r o m a t o g r a p h y , some o f w h i c h a r e h o m o g e n e i c , d i f f e r i n g o n l y i n e x t e n t o f m o d i f i c a t i o n ( 4 4 ) . I n D . melanogaster e s t i m a t e s o f gene number h a v e v a r i e d , f r o m 750 ( 4 5 ) t o a more r e c e n t v a l u e o f 5 9 0 , w i t h 59 tRNA s e q u e n c e s e a c h 1 0 - f o l d r e d u n d a n t ( 4 6 ) . S t u d i e s o n t h e o r g a n i z a t i o n o f Drosophila tRNA g e n e s h a v e b e e n p r i m a r i l y by in situ h y b r i d i z a t i o n o f r a d i o l a b e l e d p u r i f i e d tRNAs t o p o l y t e n e c h r o m o s o m e s f r o m s a l i v a r y c e l l s ( 4 7 , 4 8 , 4 9 , 5 0 ) . I n t h i s m a n n e r g e n e s f o r a number o f tRNAs h a v e b e e n l o c a t e d . . Work w i t h a r e c o m b i n a n t ' p i a s m i d c o n t a i n i n g Drosophila DNA h a s shown t h a t t h e r e i s some c l u s t e r i n g o f tRNA g e n e s ( 5 1 , 5 2 ) , i n a g r e e m e n t w i t h t h e r e s u l t s o f Dunn et al. f o r tRNA~f^ ( 4 9 ) . H o w e v e r , 8 . c o r r e l a t i o n o f g e n e numbers f r o m DNA-RNA h y b r i d i z a t i o n e x p e r i m e n t s w i t h t h e n u m b e r s o f r e s t r i c t i o n f r a g m e n t s o f Drosophila DNA h y b r i d i z i n g p u r i f i e d tRNA s p e c i e s ( 5 3 ) i n d i c a t e s t h a t t a n d e m r e d u n d a n c y l i k e t h a t f o u n d f o r 5S RNA a n d tRNAV g e n e s o f Xenopus laevis ( 5 4 , 5 5 , 5 6 ) , a n d 5 S , 1 8 S , a n d 28S rRNAs o f Drosophila ( 5 7 , 5 8 ) i s n o t g e n e r a l f o r Drosophila tRNA g e n e s . Drosophila melanogaster i s b i o l o g i c a l l y a n d g e n e t i c a l l y o n e o f t h e b e s t - s t u d i e d e u k a r y o t i c o r g a n i s m s . The p r e s e n c e o f p o l y t e n e c h r o m o s o m e s h a s a l l o w e d e x t e n s i v e c y t o l o g i c a l c h a r a c t e r i z a t i o n , w i t h g o o d c o r r e l a t i o n o f g e n e t i c and c y t o l o g i c a l m a p s . L o c a l i z a t i o n o f tRNA g e n e s i n Drosophila by in situ h y b r i d i z a t i o n o f p u r i f i e d t R N A s t o p o l y t e n e c h r o m o s o m e s ( 4 7 , 4 8 , 4 9 , 5 0 ) a n d c o n s t r u c t i o n o f r e c o m b i n a n t b a c t e r i a l p l a s m i d s c o n t a i n i n g Drosophila tRNA g e n e s ( 5 1 , 5 9 ) h a v e p r o c e e d e d r a p i d l y , a l l o w i n g s t u d i e s o f t h e s e g e n e s a t two d i s t i n c t a n d c o m p l e m e n t a r y l e v e l s , o r g a n i z a t i o n i n t h e genome a n d f i n e s t r u c t u r e o f i n d i v i d u a l g e n e s , t o be c a r r i e d o u t . A l s o , a s s i g n m e n t s o f g e n e l o c a t i o n by in situ h y b r i d i z a t i o n h a v e made p o s s i b l e g e n e t i c e x p e r i m e n t s s u c h a s c o n s t r u c t i o n o f d u p l i c a t i o n a n d . d e f i c i e n c y l e s i o n s s p a n n i n g s i t e s o f tRNA g e n e s , t o s t u d y c o n t r o l o f e x p r e s s i o n i n t h e o r g a n i s m ( 4 9 ) . As p a r t o f a s t u d y o n Drosophila t R N A g e n e s c a r r i e d o n r e c o m b i n a n t p l a s m i d s ( 5 9 ) , s e q u e n c e a n a l y s e s o f t h e s e r i n e i s o a c c e p t o r s t R N A ^ e r a n d tRNAy w e r e u n d e r t a k e n . T h e s e tRNAs w e r e o f i n t e r e s t f o r s e v e r a l r e a s o n s , ( a ) M u t a n t s e r i n e tRNAs a r e p o t e n t i a l s u p p r e s s o r s o f a m b e r j o c h r e , o r UGA n o n s e n s e m u t a t i o n s , a s h a s b e e n shown i n b a c t e r i o p h a g e T4 a n d t h e y e a s t Schizosacoharomyces pombe ( 2 6 , 6 0 ) . ( b ) T h e s e Drosophila s e r i n e tRNAs h a v e b e e n c h a r a c t e r i z e d f o r c o d o n s p e c i f i c i t y i n r i b o s o m e b i n d i n g e x p e r i m e n t s a n d shown t o h a v e d i f f e r e n t t r i p l e t r e s p o n s e s , and w e r e m a r k e d l y d i f f e r e n t 9 . o n R P C - 5 c o l u m n c h r o m a t o g r a p h y ( 6 1 ) . H o w e v e r , t h e i r m o d i f i e d b a s e c o n t e n t s a r e v e r y s i m i l a r ( 6 1 ) , a n d t h e y a r e i n d i s t i n g u i s h a b l e by in situ h y b r i d i -z a t i o n , by h y b r i d i z a t i o n t o r e c o m b i n a n t p l a s m i d s i n l y s e d b a c t e r i a l c l o n e s o n f i l t e r s , a n d i n s o l u t i o n ( u n p u b l i s h e d r e s u l t s , t h i s l a b ) . I t was t h e r e -S e r f o r e o f i n t e r e s t t o know w h e t h e r t R N A s ^ y a r e f r o m two s e t s o f g e n e s w i t h s i m i l a r s e q u e n c e s , o r f r o m o n e s e t o f g e n e s a n d d i f f e r i n g o n l y i n e x t e n t o f m o d i f i c a t i o n , ( c ) F u r t h e r , t h e r e i s a s t r o n g s i t e for in s i t u v h y b r i d i z a t i o n o n t h e X c h r o m o s o m e ( 5 0 ) , t h e o n l y s u c h c a s e f r o m a b o u t 20 p u r i f i e d t R N A s s t u d i e d t o d a t e . I n a d d i t i o n t o t h e s i t e o n t h e X , t h e r e a r e weak s i t e s o f h y b r i d i z a t i o n on t h e l e f t a n d r i g h t arms o f t h e s e c o n d , a n d t h e l e f t a r m o f t h e t h i r d , c h r o m o s o m e . C o m p a r a t i v e s t u d i e s b y DNA s e q u e n c i n g o f t R N A ^ e r g e n e s f r o m t h e d i f f e r e n t c h r o m o s o m e s w o u l d be o f i n t e r e s t . T o w a r d t h i s e n d , i t i s n e c e s s a r y t o h a v e a c c u r a t e s e q u e n c e s f o r b o t h s e r i n e t R N A s . S e r I n t h e p r e s e n t w o r k , t h e s e q u e n c e a n a l y s i s o f Drosophila tRNA^ i s p r e s e n t e d . P A R T B S e q u e n c i n g T r a n s f e r RNA The f i r s t c o m p l e t e tRNA s e q u e n c e , f o r y e a s t a l a n i n e t R N A , was r e p o r t e d b y H o i l e y a n d h i s c o - w o r k e r s i n 1 9 6 5 ( 6 2 ) . T h e y n o t e d t h a t t h e m o l e c u l e c o u l d be d r a w n a s a " c l o v e r l e a f " s t r u c t u r e ( F i g , 1) i n w h i c h a number o f s t a n d a r d W a t s o n - C r i c k b a s e p a i r s w e r e p r e s e n t . T h i s p r o p o s a l was s t r e n g t h e n e d when f u r t h e r s e q u e n c e s c o m p l e t e d s h o r t l y a f t e r w e r e f o u n d t o 1 0 . f i t t h e same p a t t e r n ( 6 3 , 6 4 , 6 5 ) . O t h e r p a t t e r n s a l s o e m e r g e d f r o m t h i s . e a r l y w o r k , p a r t i c u l a r l y t h e s i t e - s p e c i f i c i t y o f c e r t a i n m o d i f i e d n u c l e o t i d e s . The s e q u e n c i n g s t r a t e g y d e v e l o p e d by H o i l e y a n d h i s g r o u p f o r s m a l l RNAs i n v o l v e s ( a ) c l e a v a g e o f p u r i f i e d RNA w i t h n u c l e a s e s o f d i f f e r i n g s p e c i f i c i t i e s t o g e n e r a t e d i s t i n c t s e t s o f f r a g m e n t s , w h i c h a r e i d e n t i f i e d ; a n d ( b ) p a r t i a l d i g e s t i o n s w i t h t h e same e n z y m e s t o make l a r g e r f r a g m e n t s , w h i c h c a n be u s e d t o o r d e r t h e l i m i t d i g e s t o l i g o n u c l e o t i d e s ( 6 6 ) . T h i s s t r a t e g y was d e v e l o p e d f o r s e q u e n c i n g n o n - r a d i o a c t i v e RNA. I t was v e r y g o o d f o r i d e n t i f i c a t i o n o f m o d i f i e d n u c l e o t i d e s , s i n c e t h e l a r g e a m o u n t s o f f r a g m e n t s a n d n u c l e o t i d e s o r n u c l e o s i d e s u s e d c o u l d be a n a l y z e d b y t h e i r UV s p e c t r a . On t h e o t h e r h a n d , t h e a m o u n t o f m a t e r i a l r e q u i r e d l i m i t e d t h e a p p l i c a t i o n o f t h i s s t r a t e g y t o t h o s e t R N A s t h a t c o u l d be i s o l a t e d i n l a r g e q u a n t i t y . A m a j o r a d v a n c e i n s e q u e n c i n g n u c l e i c a c i d s was t h e i n t r o d u c t i o n b y S a n g e r o f t h e u s e o f t h e r a d i o i s o t o p e p h o s p h o r u s - 3 2 t o l a b e l n u c l e i c a c i d s ( 6 7 ) o r t h e i r d e g r a d a t i o n p r o d u c t s ( 6 8 , 6 9 ) , T h i s l e d t o d e v e l o p -m e n t o f t h e m i c r o t e c h n i q u e s now commonly u s e d i n n u c l e i c a c i d s e q u e n c i n g . Of p a r t i c u l a r v a l u e was t h e u s e o f b a c t e r i o p h a g e T 4 ^ i n d u c e d p o l y n u c l e o t i d e k i n a s e , t o r a d i o l a b e l a t h i g h s p e c i f i c a c t i v i t y t h e n u c l e i c a c i d s f r o m o r g a n i s m s w h i c h c o u l d n o t be c o n v e n i e n t l y g r o w n o n a r a d i o a c t i v e medium ( 7 0 ) . A s a c o n s e q u e n c e o f s u c h r a d i o l a b e l t r i g t e c h n i q u e s , t h e amount o f n u c l e i c a c i d s a m p l e r e q u i r e d f o r s e q u e n c e a n a l y s i s d e c r e a s e d by s e v e r a l h u n d r e d f o l d . F u r t h e r d e v e l o p m e n t o f m i c r o t e c h n i q u e s f o r s e q u e n c e a n a l y s i s o f n o n - r a d i o a c t i v e tRNAs a f t e r l a b e l i n g in vitro h a s a l l o w e d t h e c o m p l e t e 1 1 . s e q u e n c e o f a tRNA t o be e s t a b l i s h e d u s i n g j u s t s e v e r a l m i c r o g r a m s o f p u r i f i e d m a t e r i a l ( 7 0 ) . S e q u e n c i n g s t r a t e g i e s t h a t h a v e b e e n u s e d f o r r a d i o a c t i v e RNAs a r e l i k e t h a t d e s c r i b e d a b o v e f o r n o n - r a d i o a c t i v e RNA, a n d n o r m a l l y i n v o l v e two s t e p s : ( a ) l i m i t d i g e s t i o n w i t h b a s e - s p e c i f i c n u c l e a s e s f o l l o w e d by s e p a r a t i o n a n d i d e n t i f i c a t i o n o f i n d i v i d u a l f r a g m e n t s ; a n d ( b ) g e n e r a t i o n a n d a n a l y s i s o f l a r g e r , p a r t i a l d i g e s t i o n p r o d u c t s t o o r d e r t h e l i m i t d i g e s t p r o d u c t s . B e c a u s e t h e t R N A s o f m o s t h i g h e r o r g a n i s m s a r e n o t c o n v e n i e n t l y r a d i o l a b e l e d in vivo, t h e y a r e commonly l a b e l e d in vitro u s i n g p o l y n u c l e o t i d e k i n a s e . O n l y s e q u e n c i n g o f in vitro l a b e l e d RNA w i l l be d i s c u s s e d h e r e . U s i n g t h e s t r a t e g y a b o v e , l i m i t - d i g e s t o l i g o n u c l e o t i d e s f r o m RNase T-j o r p a n c r e a t i c RNase d i g e s t i o n a r e l a b e l e d a n d s e p a r a t e d by t w o -d i m e n s i o n a l e l e c t r o p h o r e s i s , o n c e l l u l o s e a c e t a t e i n t h e f i r s t d i m e n s i o n a n d D E A E - c e l l u l o s e p a p e r o r t h i n l a y e r p l a t e s i n t h e s e c o n d ( 7 0 , 7 1 , 7 2 , 1 1 ) ; o r by e l e c t r o p h o r e s i s o n c e l l u l o s e a c e t a t e s t r i p s , f o l l o w e d by homo-c h r o m a t o g r a p h y ( 7 1 , 7 2 , 7 3 ) o r c h r o m a t o g r a p h y on P E I - c e l l u l o s e t h i n l a y e r p l a t e s ( 7 4 ) . I d e n t i f i c a t i o n o f f r a g m e n t s i s b a s e d o n s e v e r a l l i n e s o f e v i d e n c e . The f i r s t i s t h e p o s i t i o n o f t h e f r a g m e n t i n t h e t w o - d i m e n s i o n a l " f i n g e r p r i n t . " C o m b i n e d w i t h a n a l y s i s o f t h e 5' - t e r m i n a l ( [ P ] - l a b e l e d ) m o n o n u c l e o t i d e a n d t h e known s p e c i f i c i t y o f t h e enzyme u s e d i n m a k i n g t h e f r a g m e n t s , t h e r e i s s u f f i c i e n t i n f o r m a t i o n f o r i d e n t i f i c a t i o n o f many RNase f r a g m e n t s f r o m a t R N A . F o r f r a g m e n t s f i v e n u c l e o t i d e s o r l e s s i n 32 l e n g t h , p a r t i a l e n z y m a t i c d i g e s t i o n o f [ 5 ' - P ] o l i g o n u c l e o t i d e s a n d . 32 m o b i l i t y s h i f t a n a l y s i s o f t h e [ 5 1 - P ] - i n t e r m e d i a t e s a f t e r o n e d i m e n s i o n a l e l e c t r o p h o r e s i s a t a c i d pH on D E A E - c e l l u l o s e p a p e r a l l o w s i d e n t i f i c a t i o n 1 2 . o f f r a g m e n t s l a c k i n g i n t e r n a l l y m o d i f i e d n u c l e o t i d e s . T h o s e w i t h i n t e r n a l m o d i f i c a t i o n s c a n be i d e n t i f i e d by m o b i l i t y s h i f t a n a l y s i s o f s u c c e s s i v e i n t e r m e d i a t e s i n t h e p a r t i a l d i g e s t a f t e r t w o - d i m e n s i o n a l h o m o c h r o m a t o -g r a p h y , by c o m p a r i s o n w i t h s t a n d a r d s f r o m tRNAs o f known s e q u e n c e ( 7 0 , 7 1 , 7 2 , 7 5 ) . ( S e q u e n c i n g by t w o - d i m e n s i o n a l h o m o c h r o m a t o g r a p h y i s d i s c u s s e d b e l o w . ) O r d e r i n g o f l i m i t f r a g m e n t s f r o m tRNAs h a s b e e n d o n e ( a ) by s e q u e n c i n g l a r g e f r a g m e n t s g e n e r a t e d b y p a r t i a l e n z y m a t i c o r s p e c i f i c c h e m i c a l c l e a v a g e ; o r ( b ) by s e q u e n c i n g t e r m i n a l l y l a b e l e d i n t a c t t R N A . S t e p ( a ) i s d o n e by t w o - d i m e n s i o n a l h o m o c h r o m a t o g r a p h y , by t w o - d i m e n s i o n a l p o l y a c r y l a m i d e g e l e l c t r o p h o r e s i s ( 7 6 ) , o r b y l a d d e r g e l a n a l y s i s , t h a t i s by a n a l y s i s o n p o l y a c r y l a m i d e g e l s o f s e t s o f b a s e - s p e c i f i c p a r t i a l d i g e s t s , g e n e r a t e d e i t h e r e n z y m a t i c a l l y ( 7 7 , 7 8 ) o r c h e m i c a l l y ( 7 9 ) . S t e p ( b ) i s d o n e by l a d d e r g e l a n a l y s i s . ( t h o u g h t w o - d i m e n s i o n a l h o m o c h r o m a t o -g r a p h y may be p e r f o r m e d t o o b t a i n t h e t e r m i n a l s e q u e n c e ) . T w o - d i m e n s i o n a l h o m o c h r o m a t o g r a p h y a f f o r d s some d i s c r i m i n a t i o n i n b o t h d i m e n s i o n s . I n t h e f i r s t , e l e c t r o p h o r e s i s a t pH 3 . 5 on c e l l u l o s e a c e t a t e s t r i p s , t h e r e l a t i v e m o b i l i t i e s o f o l i g o n u c l e o t i d e i n t e r m e d i a t e s i n a h o m o l o g o u s p a r t i a l d i g e s -t i o n s e r i e s w h i c h d i f f e r by a s i n g l e n u c l e o t i d e w i l l d e p e n d b o t h o n t h e pK o f t h e n u c l e o t i d e by w h i c h t h e y d i f f e r a n d on t h e s i z e a n d b a s e c o m p o -s i t i o n o f t h e s e q u e n c e common t o t h e m ( 7 0 ) . I n t h e s e c o n d d i m e n s i o n , h o m o c h r o m a t o g r a p h y o n D E A E - c e l l u l o s e p l a t e s , t h e f r a g m e n t s a r e d i s p l a c e d by o l i g o m e r s o f g r e a t e r l e n g t h i n a p a r t i a l h y d r o l y s a t e o f RNA ( 7 0 , 7 1 , 7 2 ) . M o b i l i t y i s r o u g h l y i n v e r s e l y p r o p o r t i o n a l t o f r a g m e n t s i z e , <but p u r i n e s c a n b e r e l i a b l y d i s t i n g u i s h e d f r o m p y r i m i d i n e s i n m o s t c a s e s ( 7 0 , 7 3 , 7 5 ) . W h i l e t h e f o u r common n u c l e o t i d e s c a n be " r e a d " f r o m t h e f i n g e r p r i n t 1 3 . r e l i a b l y i n t h i s m a n n e r , t h e d i f f e r e n c e s b e t w e e n m o d i f i e d a n d u n m o d i f i e d b a s e s a r e o f t e n s u b t l e , r e s u l t i n g f r o m s l i g h t l y a l t e r e d pK v a l u e s a n d h y d r o p h o b i c e f f e c t s ( 7 0 ) . D i s c e r n i n g a m o d i f i e d n u c l e o t i d e w i t h i n a f r a g m e n t i s d o n e by e l e c t r o p h o r e t i c m o b i l i t y a l o n e , s i n c e d i s c r i m i n a t i o n by h o m o c h r o m a t o g r a p h y i s l i m i t e d . T h u s , a m o d i f i e d n u c l e o t i d e s e v e r a l 32 r e s i d u e s f r o m t h e 5 ' - t e r m i n a l l a b e l o f a [ 5 ' - P ] o l i g o m e r may be i d e n t i f i -a b l e , o n l y i n t h e p r e s e n c e o f a s t a n d a r d o l i g o n u c l e o t i d e o f known s e q u e n c e , i f t h e n . I n t h e o r d e r i n g o f t h e i d e n t i f i e d l i m i t d i g e s t o l i g o n u c l e o t i d e s , t w o - d i m e n s i o n a l h o m o c h r o m a t o g r a p h y i s r e l i a b l e b u t t h e number o f n u c l e o t i d e s w h i c h may be r e a d f r o m a s i n g l e e x p e r i m e n t i s l i m i t e d by t h e RNA h y d r o l y s a t e u s e d ( 7 3 ) , a n d f r a g m e n t s 20 n u c l e o t i d e s o r l e s s i n l e n g t h a r e d e s i r a b l e . I n t w o - d i m e n s i o n a l p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s ( 7 6 ) , t h e f i r s t d i m e n s i o n i s r u n a t pH 3 . 5 i n a g e l o f s u f f i c i e n t l y h i g h p o r o s i t y t h a t s e p a r a t i o n o f f r a g m e n t s i n a l i m i t e d s i z e r a n g e d e p e n d s o n t h e i r s i z e a n d b a s e c o m p o s i t i o n . E l e c t r o p h o r e s i s i n t h e s e c o n d d i m e n s i o n i s t h r o u g h a d e n a t u r i n g g e l o f a c r y l a m i d e c o n c e n t r a t i o n s u f f i c i e n t l y h i g h t o e f f e c t a s e p a r a t i o n o n t h e b a s i s o f s . i z e a l o n e . The s e q u e n c e a s s i g n e d i s b a s e d p r i m a r i l y o n m o b i l i t y s h i f t s i n t h e f i r s t d i m e n s i o n . T h i s m e t h o d i s u s e d t o " r e a d " p y r i m i d t n e s as a c o m p l e m e n t t o t h e m e t h o d o f D o n i s - K e l l e r et al. f o r p u r i n e s ( 7 7 ) . I t h a s some a d v a n t a g e s o v e r t w o - d i m e n s i o n a l h o m o c h r o m a t o -g r a p h y ; i t c a n a l l o w o n e t o d e d u c e l o n g e r s e q u e n c e s f r o m a s i n g l e e x p e r i -m e n t , a n d t h e s i z e o f f r a g m e n t u s e d f o r a n a l y s i s i s f l e x i b l e s i n c e a c r y l a m i d e c o n c e n t r a t i o n s a r e r e a d i l y m a n i p u l a t e d . O v e r a l l , h o w e v e r , t h i s m e t h o d i s l e s s e f f e c t i v e t h a n o t h e r t e c h n i q u e s a v a i l a b l e , a n d i s n o t u s e d e x t e n -s i v e l y . A n a l y s i s o f p a r t i a l d i g e s t s o f t e r m i n a l l y r a d i o l a b e l e d tRNA by e l e c t r o p h o r e s i s on d e n a t u r i n g p o l y a c r y l a m i d e g e l s ( l a d d e r g e l a n a l y s i s ) 14. is generally the method of choice for ordering limit enzymatic digest oligonucleotides. A purified RNA carrying a terminal radiolabel (normally 32 125 P o r u I) at a unique site, the point of reference, is required for partial digestions, which may be done enzymatically (70,77,78) or chemically (79). Subsequent size separation of digestion products is by electro-phoresis in adjacent slots of a denaturing polyacrylamide gel, followed by exposure to X-ray film. All fragments located by autoradiography carry the point of reference; the identity of the opposite terminus is determined by the specificity of the nuclease or reagent used in digestion. Since the sets of fragments are ordered by size following electrophoresis, it is possible to deduce from the distinctive band pattern on the auto-radiograph much of the tRNA sequence. Partial enzymatic digestions of radiolabeled tRNA are performed using ribonucleases RNase (G-specific), RNase (A-specific), RNase A (cleaves at pyrimidine residues), and RNase Phy I from the slime mold Physarum polycephalwn (80; cleaves most sequences except CpN); and with hot formamide or alkali, which cleave randomly at all but ribose-methy-lated nucleotides, making a reference "ladder" for ordering oligonu-cleotides from the partial enzymatic digests. Ladder gel sequence analysis using partial enzymatic hydrolyses is not effective for distinguishing most modified nucleotides. The phosphodiester bonds of many modified nucleotides are cleaved slowly if at all by enzymes which specifically cleave 3'-esters of the unmodified counterparts. Analysis is further complicated by the difficulty in getting random cleavage by a nuclease at its potential cleavage sites, due to residual tertiary structure main-tained by tRNAs even in 7M urea at elevated temperatures (70,81). 1 5 . I n l a d d e r g e l a n a l y s i s u t i l i z i n g c h e m i c a l h y d r o l y s e s , i n d e p e n d e n t d i g e s t i o n s a r e c a r r i e d o u t u s i n g d i m e t h y l s u l f a t e ( G - s p e c i f i c ) , d i e t h y l p y r o c a r b o n a t e ( A - s p e c i f i c ) , a n d h y d r a z i n e i n t h e p r e s e n c e o r a b s e n c e o f s o d i u m c h l o r i d e (C+U o r U s p e c i f i c ) , t o r e m o v e t h e b a s e , f o l l o w e d by t r e a t -ment w i t h a n i l i n e t o c l e a v e t h e s u g a r - p h o s p h a t e b a c k b o n e . L a d d e r g e l a n a l y s i s o f p a r t i a l c h e m i c a l h y d r o l y s a t e s a s d e s c r i b e d by P e a t t i e ( 7 9 ) a p p e a r s t o g i v e more r e l i a b l e s e q u e n c e i n f o r m a t i o n t h a n e n z y m a t i c d i g e s t s , p a r t i c u l a r l y f o r d i s t i n g u i s h i n g C a n d U , b u t i s n o t w i t h o u t s h o r t c o m i n g s . D i s t i n g u i s h i n g t h e v a r i o u s n u c l e o t i d e s d e p e n d s on t h e r a t e s o f c h e m i c a l m o d i f i c a t i o n o f n u c l e o t i d e s by t h e r e a g e n t s u s e d . N u c l e o t i d e m o d i f i c a t i o n s c a n g r e a t l y a f f e c t t h e s e r a t e s o f m o d i f i c a t i o n . P s e u d o u r i d i n e d o e s n o t g i v e a b a n d on t h e s e l a d d e r g e l s ( 7 9 ) . R i b o t h y m i d i n e a n d 5 - m e t h y l c y t i d i n e w o u l d be e x p e c t e d t o r e a c t much more s l o w l y w i t h h y d r a z i n e t h a n u r i d i n e o r c y t i d i n e due t o s t e r i c h i n d r a n c e by t h e m e t h y l g r o u p a t C - 5 ( 7 9 , 8 2 ) . W h i l e t h e i d e n t i t i e s o f some m o d i f i e d n u c l e o t i d e s c o u l d p r o b a b l y be e s t a b l i s h e d , s u c h a s s i g n m e n t s m i g h t o f t e n be u n r e l i a b l e . T h u s , w h i l e s u f f i c i e n t f o r o r d e r i n g o f o l i g o -n u c l e o t i d e s , t h e l a d d e r g e l t e c h n i q u e s a r e n o t s u f f i c i e n t t o e s t a b l i s h a c o m p l e t e , u n a m b i g u o u s tRNA s e q u e n c e , a n d m u s t be u s e d i n c o n j u n c t i o n w i t h o t h e r m e t h o d s . An i n d e p e n d e n t m e t h o d f o r g e l s e q u e n c i n g o f tRNA was r e c e n t l y i n t r o d u c e d by S t a n l e y a n d V a s s i l e n k o ( 8 3 ) t h a t i s more u s e f u l as a p r i m a r y s e q u e n c i n g m e t h o d . I t makes u s e o f t h e r a n d o m c l e a v a g e by f o r m a m i d e o f RNA s e e n a t e l e v a t e d t e m p e r a t u r e s . P u r i f i e d tRNA ( 5 ' - p h o s p h o r y l a t e d ) , i s d i g e s t e d i n f o r m a m i d e u n d e r c o n d i t i o n s s u c h t h a t s i n g l y c l e a v e d o r u n c l e a v e d p r o d u c t s p r e d o m i n a t e . A f a m i l y o f i n t e r m e d i a t e - s i z e d f r a g m e n t s i s g e n e r a t e d , w i t h e a c h s i z e c l a s s e v e n l y r e p r e s e n t e d . E a c h i n t e r n a l c l e a v a g e o f an i n t a c t tRNA m o l e c u l e c r e a t e s a 5 ' - f r a g m e n t b e a r i n g a 5 ' - p h o s p h a t e a n d a 3 ' - c y c l i c p h o s p h a t e , a n d a 3 ' - f r a g m e n t t h a t h a s a 5 ' - h y d r o x y l a n d 1 6 . 3 ' - t e r m i n a l CCA. P o l y n u c l e o t i d e k i n a s e c a t a l y z e s t h e t r a n s f e r o f a p h o s p h a t e 32 f r o m [ y - P ] ATP t o f r a g m e n t s w i t h a 5 ' - h y d r o x y ! , t h a t i s t h o s e w i t h a 3 ' - t e r m i n a l CCA. The CCA i s t h u s t h e p o i n t o f r e f e r e n c e i n s u b s e q u e n t 32 a n a l y s i s o f [ P ] - o l i g o n u c l e o t i d e s , t h o u g h n o t r a d i o a c t i v e l y l a b e l e d . 32 The [ P ] - o l i g o m e r s a r e e l e c t r o p h o r e s e d t h r o u g h d e n a t u r i n g p o l y a c r y l a m i d e g e l s , t h e b a n d s l o c a t e d by a u t o r a d i o g r a p h y , e x c i s e d , a n d t h e RNA e l u t e d . E a c h f r a g m e n t i s d i g e s t e d t o m o n o n u c l e o t i d e s a n d t h e 5 ' - t e r m i n a l ( r a d i o -32 l a b e l e d ) n u c l e o t i d e i d e n t i f i e d . B e c a u s e t h e [ P ] - o l i g o n u c l e o t i d e s a r e o r d e r e d by s i z e a f t e r p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s a n d e a c h s u c h f r a g m e n t h a s a 3 ' - C C A , a n a l y s i s o f t h e 5 ' - t e r m i n a l n u c l e o t i d e s o f t h e o r d e r e d f r a g m e n t s a l l o w s d i r e c t d e t e r m i n a t i o n o f t h e s e q u e n c e . I n t h i s w a y , much o f a tRNA s e q u e n c e c a n be e s t a b l i s h e d . I n p r i n c i p l e , i t w o u l d be p o s s i b l e t o o b t a i n a s e q u e n c e c o m p l e t e e x c e p t f o r t h e 5 ' - a n d 3 ' - t e r m i n a l n u c l e o t i d e s ( w h i c h a r e p h o s p h o r y l a t e d o r p r e s e n t a s a n u c l e o s i d e a n d n o t l a b e l e d by p o l y n u c l e o t i d e k i n a s e , r e s p e c t i v e l y ) ( 8 3 ) , a n d n u c l e o t i d e s s h a r i n g t h e 3 ' - p h o s p h a t e o f a r i b o s e - m e t h y l a t e d n u c l e o t i d e ( f o r m a m i d e d e g r a d a t i o n i n v o l v e s f o r m a t i o n o f a 2 ' , 3 ' - c y c l i c p h o s p h a t e ) . The p a r t i c u l a r s t r e n g t h o f t h i s m e t h o d o f s e q u e n c e a n a l y s i s i s t h a t i t a l l o w s d i r e c t e v a l u a t i o n o f m o d i f i e d n u c l e o t i d e s t h a t w o u l d n o t be a c c e s s i b l e by s t a n d a r d p r o c e d u r e s d e s c r i b e d a b o v e . I t s l i m i t a t i o n s a r e p r i m a r i l y t h o s e o f l a b e l i n g u s i n g p o l y n u c l e o t i d e k i n a s e . The e f f i c i e n c y w i t h w h i c h f r a g m e n t s a r e l a b e l e d v a r i e s w i t h t h e 5 ' - t e r m i n a l n u c l e o t i d e ( o r o l i g o n u c l e o t i d e ) , a n d d e c r e a s e s i n t h e p r e s e n c e o f e x t e n s i v e s e c o n d a r y o r t e r t i a r y s t r u c t u r e . None o f t h e p r e v i o u s l y d e v e l o p e d s e q u e n c i n g m e t h o d s i s g e n e r a l l y s u f f i c i e n t t o o b t a i n a c o m p l e t e tRNA s e q u e n c e ; c o m b i n a t i o n s o f t e c h n i q u e s m u s t be e m p l o y e d f o r a p a r t i c u l a r t R N A . T h u s , i t i s r e a s o n a b l e t o t r y t o 1 7 . d e v e l o p n e w , more g e n e r a l s t r a t e g i e s e x t e n d i n g t h o s e p r e v i o u s l y u s e d . S e q u e n c i n g o f c e r t a i n tRNAs r e m a i n s d i f f i c u l t , due t o t h e h i g h i n c i d e n c e o f m o d i f i e d b a s e s , t h e t i g h t t e r t i a r y s t r u c t u r e , a n d t h e l a c k o f an a r r a y o f s p e c i f i c e n z y m e s o r c h e m i c a l r e a c t i o n c o n d i t i o n s a d e q u a t e f o r many s i t u a -t i o n s e n c o u n t e r e d . Thus a s t r a t e g y was d e v i s e d f o r tRNA s e q u e n c i n g i n v o l v i n g a n o v e l c o m b i n a t i o n o f t e c h n i q u e s . The b a s i s o f t h e s t r a t e g y i s t o u s e t h e f o r m a m i d e d e g r a d a t i o n m e t h o d a s t h e p r i m a r y s e q u e n c i n g t e c h n i q u e i n s t e a d o f a n a l y s i s o f r a d i o l a b e l e d l i m i t e n z y m a t i c d i g e s t i o n p r o d u c t s , due t o t h e a d v a n t a g e i t o f f e r s i n i d e n t i f y i n g m o d i f i e d b a s e s . T h e f o r m a m i d e d e g r a d a -t i o n s e q u e n c i n g m e t h o d i s l i m i t e d , a s d e s c r i b e d a b o v e . H o w e v e r , i t s l i m i t a -t i o n s a r e d i f f e r e n t f r o m t h o s e o f t h e l a d d e r g e l s e q u e n c i n g m e t h o d ( a b o v e ) ; t h u s t h e s e t w o m e t h o d s c o m p l e m e n t o n e a n o t h e r i n d e r i v i n g a ; t R N A s e q u e n c e . U s e o f l a d d e r g e l s e q u e n c e a n a l y s i s i n c o n j u n c t i o n w i t h a n a l y s i s o f f o r m a m i d e d e g r a d a t i o n p r o d u c t s w i l l i n p r i n c i p l e y i e l d a c o m p l e t e s e q u e n c e f r o m a l i m i t e d amount o f p u r i f i e d t R N A . The w o r k p r e s e n t e d h e r e d e s c r i b e s t h e s e q u e n c e a n a l y s i s o f a p r e v i o u s l y u n c h a r a c t e r i z e d tRNA f o l l o w i n g t h i s s t r a t e g y . 1 8 . C h a p t e r 2 HATERIALS AND METHODS General:, , U n l e s s s p e c i f i c a l l y i n d i c a t e d , a l l c h e m i c a l s w e r e r e a g e n t g r a d e . U n l e s s n o t e d , r e a c t i o n s a n d s a m p l e p r e p a r a t i o n s w e r e c a r r i e d o u t i n 1 . 5 ml p o l y p r o p y l e n e c o n i c a l t e s t t u b e s w i t h c a p s ( r e f e r r e d t o a s 1 . 5 ml t e s t t u b e s i n t h e t e x t ) . C e n t r i f u g a t i o n s w e r e i n a m i n i - c e n t r i f u g e ( M i c r o -S c i e n t i f i c C o . ) a t t a c h e d t o a v a r i a b l e p o w e r s o u r c e . H e r e , t h e a p p l i e d v o l t a g e s a r e g i v e n r a t h e r t h a n r p m . O n l y g l a s s d i s t i l l e d w a t e r was u s e d . Abbreviations: TEMED A T P * * pN pNp XC BPB f o r m a m i d e / d y e m i x N , N , N ' , N 1 - t e t r a m e t h y l e t h y l e n e d i a m i n e [y - 3 2 P ] ATP n u c l e o s i d e - 5 ' - p h o s p h a t e n u c l e o s i d e - 5 " , 3 1 - b i s p h o s p h a t e x y l e n e c y a n o l b r o m p h e n o l b l u e d e i o n i z e d f o r m a m i d e , 1% ( w / v ) X C , a n d .1% ( w / v ) B P B , 1 3 : 1 ; 1 by v o l u m e . 1 9 . A b b r e v i a t i o n s a d o p t e d f o r m o d i f i e d n u c l e o t i d e s w e r e t h o s e u s e d i n r e f . 17 w i t h t h e e x c e p t i o n o f X w h i c h i s u s e d i n t h i s t e x t t o r e f e r t o t h e unknown m o d i f i e d n u c l e o t i d e o c c u p y i n g p o s i t i o n 26 o f Drosophila S e r tRNAy , a n d Y , w h i c h i n F i g . 8 i n d i c a t e s a p y r i m i d i n e n u c l e o t i d e . 32 Synthesis of [y - P'JATP by enzyme-catalyzed exchange: The m e t h o d i s b a s e d on t h a t o f G l y n n a n d C h a p p e l l ( 1 0 8 ) , as m o d i f i e d by G i l b e r t a n d Maxam ( 8 2 ) . P r e p a r a t i o n o f e n z y m e s : R a b b i t m u s c l e g l y c e r a l d e h y d e - 3 - p h o s p h a t e d e h y d r o g e n a s e (GAPD) was o b t a i n e d f r o m W o r t h i n g t o n B i o c h e m i c a l s , I n c . , as a p r e c i p i t a t e i n 3 . 0 M ammonium s u l f a t e ( o n s u s p e n s i o n , 11 mg/ml a n d 75 . u n i t s / m g ) . The p r e c i p i t a t e was s u s p e n d e d w i t h a d i s p o s a b l e p i p e t t o r t i p , 100 y l t r a n s f e r r e d t o a 1 . 5 ml t e s t t u b e a n d c e n t r i f u g e d 10 m i n . a t 5 5 V , 4 ° . T h e s u p e r n a t a n t l i q u i d was r e m o v e d a n d d i s c a r d e d . T h e p r o t e i n p e l l e t was s u s p e n d e d i n 100 y l o f 3 . 2 M ammonium s u l f a t e (pH 8 . 0 ) , 50 mM T r i s H C l (pH 8 . 0 ) , 10 mM 2 - m e r c a p t o e t h a n o l , 1 mM EDTA, a n d 0 . 1 mM NAD, s t o r e d 3 h r . a t 4 ° , t h e n c e n t r i f u g e d as b e f o r e . The s u p e r n a t a n t l i q u i d was d i s c a r d e d , t h e p e l l e t s u s p e n d e d i n 100 y l o f t h e b u f f e r e d ammonium s u l f a t e s o l u t i o n , a n d s t o r e d a t 4 ° . 3 - P h o s p h o g l y c e r a t e k i n a s e (PGK) was o b t a i n e d f r o m S i g m a C h e m i c a l C o . as a p r e c i p i t a t e i n 3 . 0 M ammonium s u l f a t e ( o n s u s p e n s i o n , 12 mg/ml a n d 2100 u n i t s / m g ) . The p r e c i p i t a t e was s u s p e n d e d w i t h a d i s p o s a b l e p i p e t t i p , 10 y l r e m o v e d a n d a d d e d t o 90 y l 3 . 6 M ammonium s u l f a t e a t 0 ° i n a 1 . 5 ml t e s t t u b e . The s u s p e n s i o n was c e n t r i f u g e d 10 m i n . a t 55 V , 4 ° , t h e s u p e r n a t a n t l i q u i d r e m o v e d a n d d i s c a r d e d . T h e p e l l e t was s u s p e n d e d 2 0 . i n 100 y l o f 3 . 2 M ammonium s u l f a t e (pH 8 . 0 ) , 50 mM T r i s HC1 (pH 8 . 0 ) , 10 mM 2 - m e r c a p t o e t h a n o l , 1 mM EDTA, s t o r e d 3 h r . a t 4 ° , a n d c e n t r i f u g e d a s b e f o r e . T h e s u p e r n a t a n t l i q u i d - was d i s c a r d e d , t h e p e l l e t r e s u s p e n d e d i n 100 y l o f t h e same s o l u t i o n , a n d s t o r e d a t 4 ° . The enzyme s u s p e n s i o n h a d c o n c e n t r a t i o n s o f 11 mg/ml GAPD a n d 1 . 2 mg/ml PGK. T h e r e was no a p p a r e n t l o s s o f e i t h e r e n z y m a t i c a c t i v i t y a f t e r 6 m o n t h s a t 4 ° . S y n t h e t i c r e a c t i o n : P r i o r t o u s e , a 1 . 5 ml t e s t t u b e was r i n s e d 32 w e l l w i t h w a t e r . C a r r i e r - f r e e P 0 ^ ( 3 - 1 0 m C i ; New E n g l a n d N u c l e a r ) was d r i e d i n t h e t u b e , u n d e r a s p i r a t o r vacuum i n a d e s s i c a t o r c o n t a i n i n g ?2®5 a n d s o d i u m h y d r o x i d e p e l l e t s . The r e a c t i o n m i x (50 y l ) was 50 mM T r i s HC1 (pH 8 . 0 ) , 7 mM M g C l 0 , 1 mM EDTA, 2 mM g l u t a t h i o n e , 0 . 4 mM 3 - p h o s p h o g l y c e r a t e ( S i g m a C h e m i c a l C o . , G r a d e I ) , a n d c o n t a i n e d 2 - 4 n m o l e o f ATP ( P - L B i o c h e m i c a l s , I n c . ) . EDTA a t 1 mM was n e e d e d f o r c o n s i s t e n t l y h i g h y i e l d s a p p a r e n t l y 32 b e c a u s e o f h e a v y m e t a l c o n t a m i n a n t s i n some b a t c h e s o f c a r r i e r - f r e e P 0 ^ . ATP was p r e v i o u s l y t e s t e d f o r c o n t a m i n a t i n g ADP ( w h i c h d e c r e a s e s t h e e x t e n t o f r e a c t i o n ) by c h r o m a t o g r a p h y o n p o l y e t h y l e n e i m i n e - c e l l u l o s e p l a t e s ( P E I -c e l l u l o s e , B r i n k m a n n I n s t r u m e n t s , I n c . ) C h r o m a t o g r a p h i c d e v e l o p m e n t was w i t h 0 . 2 5 M KoH P 0 ^ (pH 7 . 0 ) a t room t e m p e r a t u r e f o r 2 . 5 - 3 h r . U n d e r c o n d i t i o n s w h e r e t h e p l a t e was h e a v i l y o v e r l o a d e d w i t h A T P , no ADP was d e t e c t e d u n d e r UV l i g h t . GAPD and PGK, a d d e d t o s t a r t t h e e x c h a n g e r e a c t i o n w e r e p r e p a r e d as f o l l o w s i m m e d i a t e l y b e f o r e a d d i t i o n . The p r e c i p i t a t e s i n ammonium s u l f a t e s o l u t i o n w e r e s u s p e n d e d w i t h a d i s p o s a b l e p i p e t t i p , 5 y l f r o m e a c h s u s p e n s i o n m i x e d i n a 1 . 5 ml t e s t t u b e , a n d c e n t r i f u g e d 10 m i n . a t 55 V , 4 ° . The s u p e r n a t a n t l i q u i d was d i s c a r d e d , a n d t h e p e l l e t d i s s o l v e d i n 50 y l H 9 0 . 2 1 . From t h i s s o l u t i o n , 1 u l ( c o n t a i n i n g a b o u t . 0 8 u n i t 6APD a n d 2 . 5 u n i t s PGK) was a d d e d t o t h e r e a c t i o n m i x . T h e r e a c t i o n was i n c u b a t e d 20 m i n . a t room t e m p e r a t u r e , a n d was t e r m i n a t e d by a d d i n g 5 u l 0 . 1 M EDTA a n d h e a t i n g 3 m i n . a t 1 0 0 ° . The t u b e was t h e n c h i l l e d on i c e , c e n t r i f u g e d 5 m i n . a t 40 V , 4 ° , a n d s t o r e d a t - 2 0 ° , D u r i n g t h e r e a c t i o n , a s s a y a l i q u o t s o f a b o u t 0 . 2 u l w e r e t a k e n a t 0 ( b e f o r e enzyme a d d i t i o n ) , 1 0 , a n d 20 m i n . , a n d s p o t t e d o n t o 32 32 a P E I - c e l l u l o s e p l a t e , t h e n d e v e l o p e d as a b o v e . T h e P 0 ^ a n d [y- P ] A T P w e r e l o c a t e d by a u t o r a d i o g r a p h y . M a r k e r d y e s w e r e n o t n e c e s s a r y t o a l i g n t h e TLC a n d a u t o r a d i o g r a p h as some r e s i d u a l r a d i o a c t i v i t y l o c a t e d t h e o r i g i n f o r e a c h a s s a y s a m p l e . E x t e n t o f r e a c t i o n was d e t e r m i n e d i n t h e f o l l o w i n g 32 32 m a n n e r , [y- P ] A T P a n d P 0 ^ w e r e c o l l e c t e d f r o m t h e P E I - c e l l u l o s e p l a t e s : t h e c e l l u l o s e was r e m o v e d f r o m i t s p l a s t i c b a c k i n g by s c r a p i n g t h e a p p r o p r i a t e s p o t s a n d g a t h e r e d by s u c t i o n i n t o a 1 ml d i s p o s a b l e p i p e t t o r t i p w h i c h was p l u g g e d w i t h g l a s s w o o l a n d i n s e r t e d i n t o a vacuum l i n e ( s i m i l a r t o t h e a p p a r a t u s d e s c r i b e d i n r e f . 7 2 ) . T h e - r a d i o l a b e l e d m a t e r i a l was e l u t e d w i t h 3 . 0 ml 2 M K C l a n d C e r e n k o v r a d i a t i o n d e t e r m i n e d i n a l i q u i d s c i n t i l l a -t i o n c o u n t e r . I f t h e s a m p l e c o n t a i n e d more t h a n a b o u t 5 x 10 c p m , an a l i q u o t was r e m o v e d a n d t h e C e r e n k o v r a d i a t i o n d e t e r m i n e d . E s s e n t i a l l y a l l 32 32 r a d i o l a b e l i s p r e s e n t as e i t h e r PO^ o r [y- P ] A T P . By d e t e r m i n i n g t h e 32 f r a c t i o n o f r a d i o l a b e l p r e s e n t i n [y- P ] A T P i n an a s s a y a l i q u o t , a n d k n o w i n g 32 32 t h e amount o f H 3 PO^ p l a c e d i n t h e r e a c t i o n m i x , t h e y i e l d o f [y- P ] A T P c a n be c a l c u l a t e d . The s p e c i f i c a c t i v i t y i s t h e amount o f r a d i o l a b e l i n ATP d i v i d e d by t h e m o l a r amount o f u n l a b e l e d ATP p l a c e d i n ; t h e r e a c t i o n 32 32 m i x . C o n v e r s i o n o f H 3 P 0 4 t o [y- P ] A T P was u s u a l l y 6 0 - 7 0 % , g i v i n g s p e c i f i c a c t i v i t i e s o f a b o u t 1500 C i / m m o l e . 2 2 . Autoradiography: A u t o r a d i o g r a p h y was as f o l l o w s . The p o l y a c r y l a m i d e g e l s o r t h i n l a y e r p l a t e s w e r e m a r k e d w i t h r a d i o a c t i v e dye i n a d i s t i n c t i v e p a t t e r n t o a l l o w a l i g n m e n t o f t h e a u t o r a d i o g r a p h w i t h t h e g e l o r p l a t e . The d y e s p o t s 32 c o n t a i n e d e n o u g h [ P ] - P 0 ^ t o g i v e d i s t i n c t s p o t s i n t h e e x p o s u r e t i m e u s e d . G e l s w e r e c o v e r e d w i t h S a r a n W r a p , and t h e d y e was a p p l i e d t o A E - c e l l u l o s e p a p e r (Whatman A E - 3 0 ) w h i c h was t a p e d t o t h e c o v e r e d g e l . The g e l was t h e n e x p o s e d i n a f i l m h o l d e r t o " n o - s c r e e n " N S - 5 T X - r a y f i l m ( K o d a k ) . F o r e x p o s u r e t i m e s l o n g e r t h a n 4 h r . , t h e e x p o s u r e was a t - 2 0 ° o r - 7 0 ° . F o r TLC p l a t e s ( c e l l u l o s e , D E A E - c e l l u l o s e , o r P E I - c e l l u l o s e ) , t h e d y e was s p o t t e d d i r e c t l y o n t o t h e p l a t e s , w h i c h w e r e t h e n c o v e r e d a n d e x p o s e d t o t h e X - r a y 32 f i l m as a b o v e . A g e l b a n d c o n t a i n i n g 2 0 , 0 0 0 [ P ] - d p m was c l e a r l y v i s i b l e a f t e r a 10 m i n . e x p o s u r e t o N S - 5 T f i l m . Somewhat more r a d i o l a b e l was r e q u i r e d i n a s p o t o n a t h i n l a y e r p l a t e , as t h e a r e a was l a r g e r t h a n t h a t o f a g e l b a n d . S c r e e n f i l m ( K o d a k - X R - 1 ) was o c c a s i o n a l l y u s e d f o r a u t o r a d i o g r a p h y . T h i s f i l m was a d e q u a t e w i t h o u t a c a l c i u m t u n g s - t a t e i n t e n s i f y i n g s c r e e n , b u t r e q u i r e d l o n g e r e x p o s u r e s ( r o u g h l y 5 - 1 0 f o l d ) t h a n was n e c e s s a r y w i t h " n p -s c r e e n " f i l m . On o c c a s i o n , an X - r a y i n t e n s i f y i n g s c r e e n was u s e d w i t h " s c r e e n " f i l m f o r a u t o r a d i o g r a p h y ( 8 4 ) . I n t h a t c a s e , t h e f i l m was a c t i v a t e d by f l a s h i n g w i t h a p u l s e o f l i g h t f r o m a p h o t o g r a p h i c f l a s h u n i t c o v e r e d w i t h a y e l l o w g e l a t i n f i l t e r ( W r a t t e n 2 2 , K o d a k ) , p l a c e d b e t w e e n t h e i n t e n s i f y i n g s c r e e n a n d t h e w r a p p e d g e l o r TLC p l a t e i n a f i l m h o l d e r , a n d e x p o s e d a t - 7 0 ° 32 ( 8 4 ) . S e n s i t i v i t y o f t h e s c r e e n f i l m f o r [ P ] was g r e a t l y i n c r e a s e d by t h i s p r o c e d u r e , a n d a s p o t on a t h i n l a y e r p l a t e c o n t a i n i n g a b o u t 50 C e r e n k o v cpm was c l e a r l y v i s i b l e a f t e r t w o d a y s ' e x p o s u r e . T h e e x p o s e d X - r a y f i l m was d e v e l o p e d by i m m e r s i n g f o r 7 m i n . i n d e v e l o p e r , 2 m i n . i n r u n n i n g w a t e r , a n d 10 m i n . i n f i x e r . ( T h e f i l m , o p a q u e 2 3 . a f t e r d e v e l o p i n g , becomes c l e a r a f t e r 1 - 2 m i n . i n t h e f i x e r s o l u t i o n , b u t was l e f t l o n g e r t o e n s u r e c o n s i s t e n t q u a l i t y o f t h e a u t o r a d i o g r a p h s . ) Ser Purification of tRNA^ from Drosophila melanogaster (Samarkand strain): The tRNA was p u r i f i e d b y e s t a b l i s h e d m e t h o d s ( 8 5 ) a n d p r o v i d e d f o r s e q u e n c i n g e x p e r i m e n t s by D r . I a n G i l l am. Ser Sequencing tRNA^ by the formamide degradation method (83): D e i o n i z e d f o r m a m i d e : t h e c o n d i t i o n s w e r e d e r i v e d f r o m t h o s e o f B r o w n l e e a n d C a r t w r i g h t ( 8 6 ) . F o r m a m i d e was a d d e d t o d r y Dowex-1 a n d D o w e x - 5 0 ( w e l l w a s h e d w i t h d H ^ O ) , l e f t f o r s e v e r a l m i n u t e s w i t h s t i r r i n g , t h e n f i l t e r e d t h r o u g h a n i t r o c e l l u l o s e f i l t e r a n d s t o r e d i n g l a s s a t room t e m p e r a t u r e . Dowex-1 was e q u i l i b r a t e d b e f o r e u s e i n . 0 1 M NaOH, D o w e x - 5 0 i n . 0 1 M HCL. P r e p a r a t i o n o f RNA f r a g m e n t s : t o 5 u g o f t R N A ^ e r i n 5. u l H^O i n a 1 . 5 ml t e s t t u b e was a d d e d 1 2 . 5 u l ( 2 . 5 v o l u m e s ) d e i o n i z e d f o r m a m i d e . T h e RNA was h y d r o l y z e d by h e a t i n g 15 m i n . a t 1 0 0 ° , t h e n c o o l e d o n i c e . F o r t y -f i v e u l ( 2 . 5 v o l u m e s ) o f 95% e t h a n o l was a d d e d , a n d t h e s a m p l e s t o r e d a t - 7 0 ° o v e r n i g h t . T h e RNA f r a g m e n t s w e r e c o l l e c t e d b y c e n t r i f u g a t i o n ( 1 5 m i n . a t 7 0 V , 4 ° ) , t h e s u p e r n a t a n t l i q u i d r e m o v e d , a n d t h e p e l l e t a i r - d r i e d a t room t e m p e r a t u r e . 32 L a b e l i n g o f tRNA f r a g m e n t s u s i n g [y- P ] a n d p o l y n u c l e o t i d e k i n a s e : t h e r e a c t i o n m i x (10 u l ) , i n t h e same t u b e , c o n t a i n e d 5 ug o f p a r t i a l l y h y d r o l y z e d t R N A , 85 mM T r i s HCI (pH 8 . 0 ) , -9 mM M g C l 2 , 2 mM EDTA, 24 mM * 2 - m e r c a p t o e t h a n o l , 40 uM ATP ( s p e c i f i c r a d i o a c t i v i t y 1300 C i / m m o l e ) , a n d 2 4 . 2 u n i t s o f p o l y n u c l e o t i d e k i n a s e ( P - L B i o c h e m i c a l s , I n c . ) . I m m e d i a t e l y b e f o r e a d d i t i o n o f t h e e n z y m e , t h e r e a c t i o n m i x was h e a t e d 1 m i n . a t 9 0 ° a n d c h i l l e d 1 m i n . on i c e . The r e a c t i o n was i n c u b a t e d 30 m i n . a t 3 7 ° , a n d was t e r m i n a t e d by a d d i n g 15 u l f o r m a m i d e / d y e m i x a n d h e a t i n g 1 m i n . a t 1 0 0 ° . S a m p l e s w e r e s t o r e s a t - 2 0 ° u n t i l e l e c t r o p h o r e s i s . 32 P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f [ P j RNA f r a g m e n t s : p o l y a c r y l a m i d e g e l s w e r e 20% a c r y l a m i d e ( w / v ) , 1% N , N ' -m e t h y l e n e - b i s - a c r y l a m i d e ( w / v ) , 7 M u r e a , 90 mM T r i s - b o r a t e , 1 mM EDTA (pH 8 . 3 ) . T h i s s o l u t i o n was p r e p a r e d j u s t p r i o r t o u s e , f i l t e r e d t h r o u g h a n i t r o c e l l u l o s e f i l t e r ( 0 . 4 5 m i c r o n p o r e s i z e ) , t h e n c h i l l e d o n i c e u n d e r a s p i r a t o r vacuum f o r 5 - 1 0 m i n . Ammonium p e r s u l f a t e was a d d e d t o 0 . 5 6 % ( w / v ) , TEMED t o 0 . 0 9 % ( v / v ) , a n d t h e s o l u t i o n d e - g a s s e d b r i e f l y . T h e s o l u t i o n was i m m e d i a t e l y p o u r e d b e t w e e n 2 0 c m X 4 0 cm g l a s s p l a t e s s e p a r a t e d by 0 . 0 5 cm T e f l o n s p a c e r s . The s l o t s (made w i t h a T e f l o n s l o t f o r m e r ) h a d d i m e n s i o n s 1 x 1 x 0 . 0 5 cm. F o l l o w i n g p o l y m e r i z a t i o n ( c o m p l e t e i n 1 0 - 1 5 m i n . ) , t h e s l o t s w e r e w a s h e d t h o r o u g h l y w i t h r u n n i n g b u f f e r ( 9 0 mM T r i s - b o r a t e , 1 mM EDTA, pH 8 . 3 ) , t h e n f i l l e d w i t h t h e same b u f f e r c o n t a i n i n g 6 . 5 M u r e a . The g e l was p r e - r u n 30 m i n . a t 3 0 0 V , a n d s l o t s w e r e r i n s e d w i t h b u f f e r ( n o u r e a ) - S a m p l e s w e r e l o a d e d u s i n g a d r a w n - o u t c a p i l l a r y t u b e , a n d e l e c t r o -p h o r e s i s c a r r i e d o u t a t no more t h a n 16 w a t t s o f p o w e r ( c o n s t a n t v o l t a g e a t a b o u t 1 2 0 0 V ) . N o r m a l l y , a n i o n e x c h a n g e p a p e r (Whatman A E - 2 3 ) was i n s e r t e d * 32 b e n e a t h t h e g e l t o b i n d u n r e a c t e d ATP a n d P 0 ^ f r o m t h e r e a c t i o n m i x . F o r l o n g r u n s , t h e r u n n i n g b u f f e r i n t h e e l e c t r o d e c h a m b e r s was c h a n g e d e v e r y 24 h r . 2 5 . A f t e r e l e c t r o p h o r e s i s , t h e g e l was e x p o s e d t o X - r a y f i l m t o 32 v i s u a l i z e t h e [ P]RNA b a n d s ( s e e M e t h o d s , A u t o r a d i o g r a p h y ) . T h e g e l a n d a u t o r a d i o g r a p h w e r e a l i g n e d by t h e r a d i o a c t i v e m a r k e r d y e , w i t h t h e a u t o -r a d i o g r a p h b e n e a t h t h e b a c k g l a s s p l a t e c a r r y i n g t h e g e l , a n d t h e b a n d s e x c i s e d i n o r d e r . (Good a l i g n m e n t i s c r i t i c a l , a n d r e q u i r e s s p e c i a l c a r e due t o t h e t h i c k n e s s o f t h e g l a s s p l a t e . ) 32 A n a l y s i s o f 5 ' - t e r m i n a T n u c l e o t i d e s o f [ 5 ' - P ] r i b o l i g o n u c l e o t i d e s : e a c h b a n d was e x c i s e d f r o m t h e g e l a n d p l a c e d i n a s c i n t i l l a t i o n v i a l w i t h 0 . 5 0 ml 0 . 3 M N a C l , 0 . 1 % S D S , a n d e l u t e d a t l e a s t 16 h r . a t 4 ° ( 8 0 - 9 5 % r e c o v e r y o f t R N A - s i z e f r a g m e n t s i s o b t a i n e d a f t e r 24 h r . ) . A f t e r e l u t i o n , 0 . 1 5 ml o f e l u a t e f r o m e a c h b a n d was a d d e d t o 0 . 5 0 ml o f 9 5 % e t h a n o l c o n t a i n i n g 50 y g o f E.coli tRNA ( S c h w a r z - M a n n ) as c a r r i e r , i n a 1 . 5 ml t e s t t u b e . The s a m p l e s w e r e m i x e d by i n v e r t i n g t h e c a p p e d t u b e s s e v e r a l t i m e s , s t o r e d o v e r n i g h t a t - 7 0 ° , a n d t h e RNA c o l l e c t e d by c e n t r i f u g a t i o n (10 m i n . a t 7 0 V , 4 ° ) . The s u p e r n a t a n t was r e m o v e d w i t h a P a s t e u r p i p e t a n d d i s c a r d e d . The p e l l e t ( c l e a r l y v i s i b l e ) was a i r - d r i e d f o r 1 - 2 h r . a t 3 7 ° , t h e n d i s s o l v e d i n 5 y l 0 . 2 M NaOH a n d i n c u b a t e d 16 h r . a t 3 7 ° ( t h e l i q u i d h a d u s u a l l y e n t i r e l y e v a p o r a t e d i n t o t h e t u b e i n t h i s t i m e ) . E a c h s a m p l e was n e u t r a l i z e d by a d d i n g 5 y l 0 . 2 4 M f o r m i c a c i d , a n d 3 y l o f e a c h was s p o t t e d i n o r d e r o n t o a P E I - c e l l u l o s e p l a t e a t 1 c m . i n t e r v a l s ( p l a t e s p r e p a r e d a s d e s c r i b e d by S o u t h e r n a n d M i t c h e l l , r e f . 8 7 ) . The p l a t e was w a s h e d i n d i s t i l l e d w a t e r , a i r - d r i e d , d e v e l o p e d w i t h 0 . 8 0 M ammonium * s u l f a t e a t room t e m p e r a t u r e a n d e x p o s e d t o X - r a y f i l m . The p N p ' s w e r e i d e n t i f i e d f r o m t h e i r m o b i l i t i e s , a n d much o f t h e tRNA s e q u e n c e c o u l d b e d e d u c e d f r o m t h e a u t o r a d i o g r a p h . 2 6 . N u c l e o t i d e s s u s p e c t e d o f b e i n g m o d i f i e d w e r e a n a l y z e d f u r t h e r a s p N ' s . O f t h e 0 . 5 ml o f e l u a t e ( a b o v e ) f r o m e a c h g e l s l i c e , 0 . 3 0 ml was p l a c e d w i t h 0 . 7 5 ml o f 95% e t h a n o l a n d 50 ug o f c a r r i e r tRNA i n a 1 . 5 ml t e s t t u b e , m i x i n g b y i n v e r t i n g s e v e r a l t i m e s . The s a m p l e was c h i l l e d a t - 2 0 ° o v e r n i g h t a n d c o l l e c t e d by c e n t r i f u g a t i o n (10 m i n . a t 7 0 V , 4 ° ) . The s u p e r n a t a n t was r e m o v e d a n d d i s c a r d e d a f t e r d e t e r m i n i n g t h a t a p e l l e t was p r e s e n t . T h e s a m p l e was a i r - d r i e d a t 3 7 ° , t h e n d i s s o l v e d i n 10 u l o f 20 mM NH^ a c e t a t e (pH 4 . 6 ) c o n t a i n i n g 0 . 2 ug n u c l e a s e P-j ( o b t a i n e d f r o m C a l b i o c h e m ) ( 7 0 , 8 8 ) . The d i g e s t i o n r a n 2 h r . a t room t e m p e a t u r e , a n d was t e r m i n a t e d by f r e e z i n g . S a m p l e s w e r e s t o r e d a t - 2 0 ° u n t i l u s e . A n a l y s i s o f r i b o s e - m e t h y l a t e d n u c l e o t i d e s : i n i t i a l d i g e s t i o n a s a b o v e w i t h n u c l e a s e P^ o f [ . P ] R N A f r a g m e n t s g a v e d i n u c l e o t i d e s , p N m p N , as p r o d u c t s u n d e r c o n d i t i o n s w h e r e h y d r o l y s i s was o t h e r w i s e c o m p l e t e ( 8 8 ) . I n t h i s c a s e , d i g e s t i o n was w i t h 6 ug o f n u c l e a s e P - j , i n 20 mM NH^ a c e t a t e (pH 4 . 6 ) a t 3 7 ° f o r a t l e a s t 7 . h r . ( 7 0 , 8 9 ) . The i n c r e a s e s o f 3 . 5 - f o l d a n d 3 0 - f o l d i n r e a c t i o n t i m e a n d enzyme c o n c e n t r a t i o n r e s u l t e d i n n e a r l y q u a n t i -t a t i v e h y d r o l y s i s o f t h e d i n u c l e o t i d e s t o g i v e p N m ' s as p r o d u c t . 4 32 A n a l y s i s f o r N - a c e t y l c y t i d i n e : a [ P j n u c l e o t i d e s a m p l e 4 t h o u g h t t o be p a c C was d i v i d e d i n t o t w o f r a c t i o n s . One was t h e c o n t r o l ; t h e o t h e r was d r i e d , d i s s o l v e d i n 4 u l 0 . 1 M NaOH, i n c u b a t e d 30 m i n . a t 3 7 ° , t h e n n e u t r a l i z e d w i t h 2 u 1 0 . 2 4 M f o r m i c a c i d . The h a l f - l i f e o f a c 4 C i n 0 . 1 M NaOH a t 3 7 ° i s 6 . 8 m i n . ( 9 0 ) , s o m o s t a c 4 C s h o u l d b e c o n v e r t e d t o C i n t h i s t i m e . 2 7 . * C h a r a c t e r i z a t i o n . g f p N ' s by t h i n l a y e r c h r o m a t o g r a p h y : i n i t i a l c h a r a c t e r i z a t i o n o f p N ' s was b y o n e - d i m e n s i o n a l c h r o m a -t o g r a p h y . N u c l e o t i d e s w e r e c h r o m a t o g r a p h e d a t room t e m p e r a t u r e i n s o l v e n t A ( 6 6 ml i s o b u t y r i c a c i d : 1 ml c o n e . NH^OH: 3 3 ml d r ^ Q ) . a n d s o l v e n t B (100 ml 0 . 1 0 M N a 2 H P 0 4 , pH 6 . 8 : 60 gm ammonium s u l f a t e : 2 ml 1 - p r o p a n o l ) on 20 x 20 cm c e l l u l o s e TLC p l a t e s ( E . M e r c k , p u r c h a s e d t h r o u g h B r i n k m a n n I n s t r u m e n t s , I n c . ) . N o n - r a d i o a c t i v e s t a n d a r d s (1 y l o f a m i x t u r e c o n t a i n i n g p A , p G , p U , a n d pC a t 0 . 2 A^QQ u n i t s o f e a c h p e r y l ; a n d 1 y l o f a p p r o -p r i a t e m o d i f i e d n u c l e o t i d e s t a n d a r d s , when a v a i l a b l e , a t a b o u t 0 . 2 u n i t s p e r y l ) w e r e s p o t t e d w i t h t h e pN s a m p l e s , c h r o m a t o g r a p h e d , a n d l o c a t e d u n d e r UV l i g h t . S p o t t i n g s a m p l e s o f no m o r e t h a n 5 y l ( p r e f -e r a b l y 1 - 3 y l ) a t 1 cm i n t e r v a l s p e r m i t t e d a n a l y s i s o f up t o 17 s a m p l e s on o n e p l a t e , l e a v i n g 2 cm c l e a r a t e a c h s i d e t o m i n i m i z e e d g e e f f e c t s . C h r o m a t o g r a p h i c d e v e l o p m e n t was c o n t i n u e d u n t i l t h e e l u t i n g s o l v e n t was w i t h i n 1 cm o f t h e t o p o f t h e p l a t e ( a b o u t 8 h r . w i t h s o l v e n t A , 6 h r , w i t h B ) , a n d t h e p N ' s w e r e l o c a t e d by a u t o r a d i o g r a p h y ( M e t h o d s , a b o v e ) . M o s t n u c l e o t i d e s c o u l d be i d e n t i f i e d a t t h i s p o i n t by c o m p a r i s o n o f t h e i r m o b i l i t i e s t o t h o s e o f p A ( s o l v e n t A) o r pU ( s o l v e n t B) ( T a b l e 3 i n r e f . 7 0 ) . Any f u r t h e r c h a r a c t e r i z a t i o n was by t w o - d i m e n s i o n a l T L C , e s s e n t i a l l y a s d e s c r i b e d ( 7 0 ) . Of p a r t i c u l a r i m p o r t a n c e , i t was f o u n d t o be n e c e s s a r y t o a l l o w a t l e a s t 30 h r . a t room t e m p e r a t u r e i n a fume h o o d f o r s o l v e n t * A t o e v a p o r a t e f r o m p l a t e s a f t e r t h e f i r s t d i m e n s i o n . The p N ' s w e r e i d e n t i f i e d by t h e i r p o s i t i o n s r e l a t i v e t o t h e s t a n d a r d s , i f p o s s i b l e ( F i g . 2 , r e f . 7 0 ) . 32 * N u c l e o s i d e 3 ' , 5 ' - b i s [ 5 1 - P ] p h o s p h a t e s ( p N p ' s ) w e r e a n a l y z e d b y o n e - d i m e n s i o n a l c h r o m a t o g r a p h y a s a b o v e , a n d i d e n t i f i e d a f t e r 2 8 . a u t o r a d i o g r a p h y by c o m p a r i s o n t o t h e m o b i l i t i e s o f pAp ( s o l v e n t A ) o r pUp ( s o l v e n t B) ( T a b l e 2 , r e f . 7 0 ) . The s t a n d a r d s w e r e p N p ' s i d e n t i f i e d by c h r o m a t o g r a p h y on P E I - c e l l u l o s e ( a s a b o v e ) i n a f o r m a m i d e d e g r a d a t i o n s e q u e n c i n g e x p e r i m e n t on a tRNA o f known s e q u e n c e ( y e a s t t R N A ^ y ) . 32 Analysis of [5r - P~]tRNA by partial digest-ton with base-specific  ribonucleases and gel electrophoresis: D e p h o s p h o r y l a t i o n o f t R N A ; The r e a c t i o n m i x (5 u l ) , i n a 1 . 5 ml t e s t t u b e , was 20 mM T r i s HCI (pH 8 . 3 ) , 0 . 2 mM EDTA, a n d c o n t a i n e d 2 y g o f tRNA^ a n d 0 . 0 2 6 u n i t o f b a c t e r i a l a l k a l i n e p h o s p h a t a s e ( B A P F ; W o r t h i n g t o n B i o c h e m i c a l s , I n c . ) . The m i x was h e a t e d 30 s e c . a t 9 0 ° w i t h t h e enzyme p r e s e n t , c h i l l e d o n i c e , t h e n i n c u b a t e d 4 0 m i n . a t 3 7 ° . T h e r e a c t i o n was s t o p p e d by a d d i n g 1 u l o f 50 mM n i t r i l o t r i a c e t i c a c i d (pH 7 . 0 ) ( A l d r i c h G o l d L a b e l ) a n d - h e a t i n g t o d r y n e s s a t 9 0 ° i n an o p e n t u b e ( 7 0 ) . ^ * L a b e l i n g ( 5 ' - OH)tRNA u s i n g ATP a n d p o l y n u c l e o t i d e  k i n a s e : t h e p o l y n u c l e o t i d e k i n a s e r e a c t i o n was c a r r i e d o u t i n t h e same t u b e . The r e a c t i o n m i x ( 1 0 y l ) was 70 mM T r i s H C l (pH 8 . 0 ) , 8 . 5 mM M g C l 2 , 24 mM 2 - m e r c a p t o e t h a n o l , 4 3 uM A T P * ( 5 0 0 C i / m m o l e ) a n d c o n t a i n e d 2 u n i t s o f p o l y n u c l e o t i d e k i n a s e . Enzyme was a d d e d t o i n i t i a t e t h e r e a c t i o n i m m e d i a t e l y a f t e r h e a t i n g 30 s e c . a t 9 0 ° a n d c h i l l i n g on i c e . The r e a c t i o n was i n c u b a t e d 15 m i n . a t 3 7 ° a n d t e r m i n a t e d by a d d i n g 15 y l o f f o r m a m i d e / d y e m i x a n d h e a t i n g 1 m i n . a t 9 0 ° . T h i s s a m p l e was l o a d e d o n t o a p r e - r u n d e n a t u r i n g p o l y a c r y l a m i d e g e l (10% a c r y l a m i d e , 0 . 5 % m e t h y l e n e - b i s - a c r y l a m i d e , 2 9 . 7M u r e a , 90 mM T r i s - b o r a t e , 1 mM EDTA, pH 8 . 3 ; 38 x 20 x 0 . 1 5 c m , s l o t s 1 x 1 x 0 . 1 5 c m ) . The r u n n i n g b u f f e r was 90 mM T r i s - b o r a t e , 1 mM EDTA, pH 8 . 3 . E l e c t r o p h o r e s i s c o n t i n u e d u n t i l t h e XC d y e had n e a r l y l e f t t h e * 32„ g e l ( 8 h r . a t 5 0 0 V , 25 m A ) . E x c e s s ATP a n d PO^ w e r e t r a p p e d o n a n i o n 32 e x c h a n g e p a p e r , a s d e s c r i b e d a b o v e . The [ 5 1 - P j t R N A b a n d was l o c a t e d by a u t o r a d i o g r a p h y , e x c i s e d , a n d e l u t e d w i t h 0 . 6 0 m l . 0 . 3 M N a C l , 0 . 1 % S D S , o v e r n i g h t a t 4 ° . The e l u a t e was d i v i d e d i n t o t h r e e f r a c t i o n s , 30 y g o f c a r r i e r tRNA a n d 2 . 5 v o l u m e s o f 95% e t h a n o l a d d e d t o e a c h , a n d t h e s a m p l e s s t o r e d a t - 7 0 ° o v e r n i g h t . The RNA was c o l l e c t e d by c e n t r i f u g a t i o n ( 1 0 m i n . a t 7 0 V , 4 ° ) , t h e s u p e r n a t a n t l i q u i d s d i s c a r d e d , t h e p e l l e t s d r i e d b r i e f l y u n d e r a s p i r a t o r v a c u y m , a n d e a c h s a m p l e d i s s o l v e d i n 5 y l dH^O. P a r t i a l h y d r o l y s e s w i t h b a s e - s p e c i f i c r i b o n u c l e a s e s : r i b o n u c l e a s e T-j a n d RNase l ^ w e r e f r o m S a n k y o , RNase A f r o m C a l b i o c h e m , a n d RNase Phy I f r o m E n z o B i o c h e m . T h e s e e n z y m e s s p e c i f i c a l l y c l e a v e 3 ' - e s t e r s o f G , A , p y r i m i d i n e s , o r o f a n y n u c l e o t i d e e x c e p t C , r e s p e c t i v e l y , u n d e r t h e c o n d i t i o n s u s e d ( 7 7 , 7 8 , 8 0 , 9 1 , 9 2 ) . E n z y m a t i c h y d r o l y s e s w e r e c a r r i e d o u t i n t h e f o l l o w i n g m a n n e r . E a c h r e a c t i o n c o n t a i n e d 6 y g RNA ( 8 0 0 0 C e r e n k o v c p m ) , RNase T-j a n d RNase A r e a c t i o n m i x e s (10 y l ) w e r e 20 mM s o d i u m c i t r a t e (pH 5 . 0 ) , 1 mM EDTA, 6 . ! 3 M u r e a ( S c h w a r t z - M a n n u l t r a p u r e ) , c o n t a i n i n g 0 . 0 1 u n i t , RNase T-| a n d . 0 . 0 0 1 u n i t RNase A a c t i v i t y . R e a c t i o n s r a n 2 0 m i n . a t 5 0 ° ; t h e y w e r e s t o p p e d by c h i l l i n g o n i c e , a n d XC and BPB d y e s w e r e a d d e d t o 0 . 0 5 % . RNase l l , r e a c t i o n m i x e s (5 y l ) w e r e 50 mM s o d i u m a c e t a t e (pH 4 . 5 ) , 4 mM EDTA, a n d c o n t a i n e d 0 . 0 1 u n i t o f e n z y m e . R e a c t i o n s r a n 20 r n i n . a t 0 ° a n d w e r e s t o p p e d by a d d i n g 5 y l 3 0 . f o r m a m i d e - d y e m i x a n d h e a t i n g 1 m i n . a t 1 0 0 ° . RNase P h y l r e a c t i o n m i x e s ( 5 y l ) c o n t a i n e d 10 mM s o d i u m a c e t a t e (pH 4 . 5 ) , 1 mM EDTA, a n d 0 . 3 u n i t o f e n z y m e . R e a c t i o n s r a n 20 m i n . a t room t e m p e r a t u r e a n d w e r e s t o p p e d a s d e s c r i b e d f o r t h e RNase r e a c t i o n s . A random m i x t u r e o f a l l p o s s i b l e i n t e r m e d i a t e - s i z e d h y d r o l y s i s p r o d u c t s f o r r e f e r e n c e was g e n e r a t e d b y h e a t i n g t h e RNA s a m p l e i n 5 y l o f 80% f o r m a m i d e , 40 m i n . a t 1 0 0 ° . The c o n t r o l r e a c t i o n ( m i n u s e n z y m e ) was c a r r i e d o u t a s d e s c r i b e d f o r R N a s e s T 1 a n d A . The s a m p l e s w e r e l o a d e d o n t o a d e n a t u r i n g 20% p o l y a c r y l a m i d e g e l ( d e s c r i b e d a b o v e ) , 0 . 5 mm t h i c k , a n d e l e c t r o p h o r e s e d a t 1 0 0 0 V f o r 5 o r 30 h r . t o a n a l y z e t h e 5 ' - o r 3 ' - t e r m i n i , r e s p e c t i v e l y . T h e g e l s ^ w e r e e x p o s e d t o n o - s c r e e n X - r a y f i l m ( K o d a k N S - 5 T ) f o r 3 d a y s a t - 2 0 % , a t w h i c h t i m e r e f e r e n c e l a d d e r b a n d s a n d m o s t b a n d s a r i s i n g f r o m e n z y m a t i c h y d r o l y s e s w e r e v i s i b l e i n t h e a u t o r a d i o g r a p h . Two-dimensional homochvomatogvaphy (wandering spot analysis): Two d i m e n s i o n a l h o m o c h r o m a t o g r a p h y was p e r f o r m e d as d e s c r i b e d by J a y et al. ( 7 3 ) , e x c e p t f o r t h e p a r t i a l h y d r o l y s e s . E l e c t r o p h o r e s i s on c e l l u l o s e a c e t a t e s t r i p s ( S c h l e i c h e r a n d . S c h u e l l No. 2 5 0 0 , 3 x 55 cm) was f o r 2 h r . a t 2 0 0 0 V o n a S h a n d o n h i g h v o l t a g e e l e c t r o p h o r e s i s a p p a r a t u s , u s i n g a pH 3 . 5 b u f f e r o f 5% a c e t i c a c i d a d j u s t e d w i t h p y r i d i n e . F o r t h e h o m o c h r o m a t o g r a p h y d i m e n s i o n , Homomix V ( 7 3 ; p r o v i d e d by D r . C . A s t e l l ) a n d P o l y g r a m C e l 300 D E A E - c e l l l i l o s e p l a t e s ( M a c h e r e y - N a g e l a n d C o . ) 32 w e r e u s e d . The [ P]RNA f r a g m e n t s w e r e o l i g o n u c l e o t i d e s f r o m a f o r m a m i d e d e g r a d a t i o n e x p e r i m e n t p u r i f i e d by g e l e l e c t r o p h o r e s i s . P a r t i a l h y d r o l y s e s 3 1 . w e r e i n 100% d e i o n i z e d f o r m a m i d e ( 5 y l ) , 2 . 5 h r . a t 1 0 0 ° . S a m p l e s o f 32 2 y l ( c o n t a i n i n g 4 5 0 0 dpm o f [ P ] - o l i g o n u c l e o t i d e ) w e r e a p p l i e d t o t h e c e l l u l o s e a c e t a t e s t r i p s . T h e s e s a m p l e s a r e a b s o r b e d s l o w l y by t h e s t r i p s r e l a t i v e t o a q u e o u s s a m p l e s o f e q u a l v o l u m e , b u t t h e f o r m a m i d e d o e s n o t a f f e c t e l e c t r o p h o r e s i s . A u t o r a d i o g r a p h y was f o r o n e week a t - 7 0 ° , u s i n g p r e - f o g g e d K o d a k XR-1 X - r a y f i l m a n d a n i n t e n s i f y i n g s c r e e n ( 8 4 ; M e t h o d s , A u t o r a d i o g r a p h y ) . 3 2 . R E S U L T S The n u c l e o t i d e s e q u e n c e o f t R N A ^ e r f r o m Drosophila was a n a l y z e d p r i m a r i l y by m e t h o d s d e r i v e d f r o m t h o s e o f S t a n l e y a n d V a s s i l e n k o ( 8 3 ) . 32 [ 5 ' - P ] - l . a b e l e d f r a g m e n t s w e r e g e n e r a t e d , i s o l a t e d f r o m p o l y a c r y l a m i d e g e l s ( F i g . 3 ) , a n d a n a l y z e d f o r t h e i r 5 ' t e r m i n a l n u c l e o t i d e s . M o s t s u c h n u c l e o t i d e s c o u l d be i d e n t i f i e d by t h e i r c h r o m a t o g r a p h i c m o b i l i t i e s as p N p ' s on P E I - c e l l u l o s e ( F i g . 4 ) . P r e l i m i n a r y e x p e r i m e n t s w i t h p N p ' s made * 32 by l a b e l i n g n u c l e o s i d e 3 ' - m o n o p h o s p h a t e s ( 9 3 ) , a n d p N p ' s f r o m [ 5 ' - P ] o l i g o m e r s g e n e r a t e d by t h e f o r m a m i d e d e g r a d a t i o n m e t h o d f r o m y e a s t t R N A ^ y , t h e s e q u e n c e o f w h i c h i s known ( 9 4 ) , a l l o w e d t h e c h r o m a t o g r a p h i c m o b i l i t i e s o f p A p , p G p , p C p , p U p , p # , a n d pTp t o be d e t e r m i n e d ( r e s u l t s n o t s h o w n ) . T h e s e r e s u l t s h a v e b e e n c o n f i r m e d a n d e x t e n d e d i n t h e w o r k p r e s e n t e d h e r e by i d e n t i f y i n g t h e c o r r e s p o n d i n g p N ' s by c h r o m a t o g r a p h y o n c e l l u l o s e t h i n l a y e r p l a t e s . C h r o m a t o g r a p h i c m o b i l i t i e s o f a number o f p N p ' s o n P E I -c e l l u l o s e a r e p r e s e n t e d i n T a b l e 1 . A number o f p N ' s w e r e i d e n t i f i e d o n t h e b a s i s o f t h e i r c h r o m a t o g r a p h i c m o b i l i t i e s i n two s o l v e n t s y s t e m s ( M e t h o d s ) , c o m p a r e d w i t h t h o s e l i s t e d i n T a b l e 2 o f r e f . 7 0 . T h o u g h p s e u d o u r i d i n e c o u l d be i d e n t i f i e d by i t s m o b i l i t y as a p N p , t h i s was c o n f i r m e d by o n e -d i m e n s i o n a l c h r o m a t o g r a p h y o f t h e pN on c e l l u l o s e p l a t e s i n s o l v e n t s A a n d B ( M e t h o d s ) . O t h e r n u c l e o t i d e s i d e n t i f i e d by o n e - d i m e n s i o n a l TLC w e r e fi 1 3 p G m , p U m , p D , p T , p i A , pm A , a n d pm C ( F i g . 5 ) . C o n f i r m a t i o n f o r pD a n d 3 3 ? pm C was by t w o - d i m e n s i o n a l c h r o m a t o g r a p h y ( M e t h o d s ) . I n o s i n e [ 5 1 - P ] 3 3 . F i g u r e 3 . P o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s o f [ J ^ P ] R N A f r a g m e n t s . 32 [ P]RNA s a m p l e s p r e p a r e d by h y d r o l y s i s i n f o r m a m i d e a n d p o s t -l a b e l i n g a s d e s c r i b e d i n M e t h o d s w e r e e l e c t r o p h o r e s e d t h r o u g h d e n a t u r i n g p o l y a c r y l a m i d e g e l s . The g e l r u n n i n g b u f f e r was 50 mM T r i s - b o r a t e , 1 mM EDTA, pH 8 . 3 , f o r ( a ) a n d ( b ) ; a n d 90 mM T r i s - b o r a t e , 1 mM EDTA, pH 8 . 3 , f o r (c). E l e c t r o p h o r e s i s was a t 1000V f o r ( a ) 8 . 6 h r . , o r ( b ) 21 h r . ; o r ( c ) a t 1200V f o r 40 h r . 3 5 . F i g u r e 4 . PEI c e l l u l o s e c h r o m a t o g r a p h y o f p N p ' s . 32 [ P]RNA f r a g m e n t s s e p a r a t e d by p o l y a c r y l a m i d e g e l e l e c t r o -p h o r e s i s a s shown i n F i g u r e 4 w e r e a n a l y z e d f o r t h e i r 5 ' -t e r m i n a l n u c l e o t i d e s a s d e s c r i b e d i n M e t h o d s , a n d a r e r e p r e -s e n t e d by t h e s t a n d a r d a b b r e v i a t i o n s u s e d i n R e f . 1 7 . 3 6 . S I It • t I 6 U C 8 0 A G C C A - U C C U A - » 6 A 7 5 7 0 37. C V T 6 G A U 6 5 6 0 G m5C G A G 6 6 U 5 5 38. «?C G G A U G nfb G A G G G u m3C U C 50 62 6 0 55 50 3 9 . d t • M i C C UJJ A G A 46 C f A i % A G I U A A 4 0 3 5 A G I U n & A G U C U X C G G A 35 30 25 4 1 . T a b l e 1 M o b i l i t i e s o f N u c l e o s i d e - 5 ' , 3 ' - B i s p h o s p h a t e s on P E I - C e l l u l o s e 5 pNp- R p U p PUp 1 . 0 0 pTp 1 . 0 0 P # 0 . 9 4 PDp 0 . 8 5 ( 1 . pAp 0 . 6 6 pm Ap 0 . 7 5 p i 6 A p 0 . 5 2 , 0 . 6 1 d p i p 0 . 8 4 pCp 0 . 7 9 , 0 . 8 3 d pm Cp 1 . 1 2 pGp 0 . 4 0 , 0 . 4 7 d D e v e l o p e d w i t h 0 . 8 0 M ammonium s u l f a t e (pH 5 . 3 ) a t room t e m p e r a t u r e . M o b i l i t y r e l a t i v e t o p U p . The v a l u e i n p a r e n t h e s e s c o r r e s p o n d s t o an a p p a r e n t d e g r a d a t i o n p r o d u c t o f D f r o m a l k a l i n e h y d r o l y s i s ( M e t h o d s ) . Two s p o t s , f o r t h e 2 ' a n d 3 ' - i s o m e r s , a r e f o u n d . 4 2 . F i g u r e 5 . I d e n t i f i c a t i o n o f m o d i f i e d n u c l e o t i d e s by t h i n l a y e r c h r o m a t o g r a p h y . S a m p l e s shown i n a , c , a n d e w e r e c h r o m a t o g r a p h e d i n s o l v e n t A , w h i l e s a m p l e s shown i n b , d , a n d f w e r e c h r o m a t o g r a p h e d i n s o l v e n t B , a s d e s c r i b e d i n M e t h o d s . I d e n t i f i c a t i o n was b a s e d on m o b i l i t y r e l a t i v e t o e i t h e r pA ( s o l v e n t A ) o r pU ( s o l v e n t B ) , a n d t h e a s s i g n m e n t s h e r e a r e b a s e d o n t h e m o b i l i t y v a l u e s p r e s e n t e d i n T a b l e 2 . 43. Am'A V Tm 3C U m U 77 67 64 63 50 44 € I6A i AD D G_G C x b # • # # # # f 5' A m'A Y T n. C U r aU t 37 34 32 20 19 17 16 12 | 6 A I n?C D D 6m6 C X 44. X^, C , 0 G G G 26 12 m m -OH" 1-OH" 4 6 . p h o s p h a t e was i d e n t i f i e d by c o m i g r a t i o n w i t h i t s n o n - r a d i o a c t i v e s t a n d a r d o n t w o - d i m e n s i o n a l TLC ( F i g . 6 ) . N u c l e o t i d e 26 ( p X ) c o u l d n o t b e i d e n t i f i e d on t h i s b a s i s ( F i g . 6 ) . The c h r o m a t o g r a p h i c m o b i l i t i e s o f t h e s e p N ' s a r e p r e s e n t e d i n T a b l e 2 . The p o s i t i o n s o f t h e s e m o d i f i e d n u c l e o t i d e s i n t h e c l o v e r l e a f s t r u c t u r e a r e t h e same as t h o s e i n r a t l i v e r tRNA^ ( F i g . 2 ) . 5 I d e n t i f i c a t i o n o f m C i n p o s i t i o n 57 was b a s e d o n s e v e r a l l i n e s o f e v i d e n c e . I t was c o n s i d e r e d t o be a m o d i f i e d n u c l e o t i d e , p r o b a b l y a . m o d i f i e d C , d u e t o i t s m o b i l i t y a s a pNp on P E I - c e l 1 u l o s e . On c e l l u l o s e t h i n l a y e r c h r o m a t o g r a p h y i n s o l v e n t A ( M e t h o d s ) , p ( N 5 ^ ) p r a n s l i g h t l y a h e a d o f p C p . From t w o - d i m e n s i o n a l h o m o c h r o m a t o g r a p h y , i t i s c l e a r t h a t n u c l e o t i d e 57 c o n t a i n s C o r a d e r i v a t i v e w i t h a s i m i l a r pK ( F i g . 7). The p r e s e n c e o f 5 m C was i n d i c a t e d b y n u c l e o t i d e a n d n u c l e o s i d e a n a l y s i s ( 6 1 ) . On l a d d e r g e l a n a l y s i s o f [ 5 ' - 3 2 P ] 3 ' - h a l f m o l e c u l e s o f y e a s t t R N A j l y , a d o u b l e t i n t h e RNase A s l o t was s e e n a t a s i t e w h e r e m^C s h o u l d be ( F i g . 8 ) . E q u i v a l e n c e o f t h e d o u b l e t b a n d t o m C i s n o t c e r t a i n , s i n c e an e x t r a n u c l e o t i d e was f o u n d i n t h i s r e g i o n by l a d d e r g e l a n a l y s i s w h i c h was n o t i n t h e p u b l i s h e d s e q u e n c e . ( 9 4 ) . H o w e v e r , t h e s e q u e n c e shown i n F i g . 8 ( a n d t h u s t h e c o r r e l a -5 t i o n o f t h e d o u b l e t b a n d p a t t e r n w i t h m C) seems m o s t l i k e l y t o b e t h e c o r r e c t S @ r* o n e . The s a m e d o u b l e t p a t t e r n i s s e e n f o r n u c l e o t i d e 57 i n tRNA^ ( n o t v i s i b l e i n t h e p h o t o F i g . 9 ) . The n u c l e o t i d e i n t h e e q u i v a l e n t s i t e i n o t h e r e u k a r y o t i c s e r i n e tRNAs s e q u e n c e d i s m C . N u c l e o t i d e 57 was i d e n t i f i e d as m5c o n t h e b a s i s o f t h e s e v a r i o u s d a t a . Two m o d i f i e d n u c l e o t i d e s p r e s e n t i n tRNA^ w e r e n o t i d e n t i f i e d . * N u c l e o t i d e 12 i s p r o b a b l y a d e r i v a t i v e o f c y t i d i n e , p C . T h e pN f r o m 4 7 . T a b l e 2 C h r o m a t o g r a p h i c M o b i l i t i e s o f N u c l e o s i d e - 5 ' - P h o s p h a t e s  on C e l l u l o s e T h i n L a y e r P l a t e s N u c l e o t i d e R fla pA R b R p A ( p u b l i s h e d ) 0 R p U ( p u b l i s h e d ) 0 pG 0 . 4 8 0 . 6 5 0 . 5 0 0 . 6 3 pA 1 . 0 0 0 . 3 7 1 . 0 0 0 . 3 4 pC 0 . 7 3 1 . 0 0 0 . 8 3 1 . 0 0 pU 0 . 5 0 1 . 0 0 0 . 5 7 1 . 0 0 P i 0 . 5 3 0 . 7 7 - - — . PT 0 . 6 1 0 . 8 2 0 . 7 6 0 . 8 1 pijj 0 . 4 1 1 . 0 1 0 . 4 6 1 . 0 1 pD 0 . 5 3 1 . 0 8 0 . 5 3 1 . 0 7 pm3C 0 . 8 5 1 . 2 0 - - — pm'A 0 . 8 9 1 . 1 0 0 . 9 2 1 . 0 7 p i 6 A 1 . 5 0 . 1 2 — pU v m 0 . 8 7 0 . 8 6 0 . 8 6 0 . 9 3 P G m 0 . 8 4 0 . 6 3 0 . 8 6 0 . 5 8 P X 2 6 0 . 6 5 0 . 3 6 --• a - M o b i l i t y r e l a t i v e t o p A , i n s o l v e n t A ( M e t h o d s ) , b - M o b i l i t y r e l a t i v e t o p U , i n s o l v e n t B ( M e t h o d s ) , c - V a l u e s f r o m T a b l e 3 o f r e f e r e n c e 7 0 . 48. F i g u r e 6 . Two d i m e n s i o n a l , t h i n l a y e r c h r o m a t o g r a p h y o f p N ' s . C h r o m a t o g r a p h y was c a r r i e d o u t a s d e s c r i b e d i n M e t h o d s . A . The m a i n s p o t c o - c h r o m a t o g r a p h e d w i t h i n o s i n e-5'-p h o s p h a t e . B . The n u c l e o t i d e *P%26 c o u ^ n o t ^ e i d e n t i f i e d b a s e d on i t s c h r o m a t o g r a p h i c m o b i l i t y : pm^G s h o u l d r u n a t a b o u t t h e same p o s i t i o n a s p A . 49. CVJ 50. 5 1 . F i g u r e 8 . L a d d e r g e l a n a l y s i s o f a [ 5 ' - ^ P ] R N A f r a g m e n t o f y e a s t t R N A j ^ . A n a l y s i s was c a r r i e d o u t s i m i l a r t o t h e d e s c r i p t i o n i n M e t h o d s . 32 Each r e a c t i o n c o n t a i n e d 4 0 , 0 0 0 C e r e n k o v P - c p m o f y e a s t t R N A j ^ f r a g m e n t a n d 4 m i c r o g r a m s o f c a r r i e r t R N A e x c e p t f o r t h e l a d d e r ( L ) , w h i c h c o n t a i n e d 8 0 , 0 0 0 cpm a n d 8 m i c r o g r a m s c a r r i e r t R N A . R e a c t i o n c o n d i t i o n s w e r e a s d e s c r i b e d i n M e t h o d s f o r t h e RNase T.n (T) r e a c t i o n , t h e l a d d e r , a n d t h e c o n t r o l ( - E ) . A l l o t h e r s w e r e a s d e s c r i b e d i n M e t h o d s e x c e p t f o r v a r y i n g enzyme c o n c e n t r a t i o n s : t h e R N a s e r e a c t i o n s U - l , U - 2 , a n d U - 3 c o n t a i n e d 0 . 0 2 , 0 . 0 1 , a n d 0 . 0 0 2 u n i t o f enzyme a c t i v i t y , t h e RNase P h y l r e a c t i o n s P h y - 1 a n d P h y - 2 c o n -t a i n e d 0 . 0 8 a n d 0 . 0 1 3 u n i t o f a c t i v i t y , a n d t h e RNase A r e a c t i o n s A-1 a n d A - 2 c o n t a i n e d 0 . 0 0 2 a n d 0 . 0 0 1 u n i t o f a c t i v i t y , r e s p e c t i v e l y . E l e c t r o p h o r e s i s ' w a s f o r 5 h r . a t 1100 V . A u t o r a d i o g r a p h y was f o r 2 . 5 d a y s a t - 2 0 ° . -E U l U-2 U-3 T L Phy-i PhY2 A-1 A - 2 5 3 . F i g u r e 9 . L a d d e r g e l a n a l y s i s o f [ 5 ' ^ p ] t R N A ^ , 3 ' - e n d . A n a l y s i s was c a r r i e d o u t as d e s c r i b e d i n M e t h o d s . E l e c t r o p h o r e s i s was f o r 24 h r . a t 1200 V , f o l l o w e d by e x p o s u r e t o X - r a y f i l m f o r 3 d a y s . 5 4 . A 5 5 . p o s i t i o n 12 g e n e r a t e d by n u c l e a s e P-j d i g e s t i o n o f a f o r m a m i d e d e g r a d a t i o n -32 d e r i v e d [ 5 1 - P ] o l i g o m e r i s d i s t i n c t f r o m pC on c e l l u l o s e T L C , w h i l e t h e * 32 pNp f r o m a l k a l i n e h y d r o l y s i s o f t h e same [ 5 ' - P]RNA f r a g m e n t c o u l d n o t be d i s t i n g u i s h e d f r o m pCp on P E I - c e l l u l o s e c h r o m a t o g r a p h y , i n d i c a t i n g t h a t t h e m o d i f i c i a t i o n i s a l k a l i - l a b i l e . N u c l e o t i d e 12 r u n s d i f f e r e n t l y on t w o - d i m e n s i o n a l TLC f r o m a n y n u c l e o t i d e p r e s e n t e d i n r e f . 7 0 , F i g . 2 . The n u c l e o t i d e f o u n d , a t p o s i t i o n 12 i n o t h e r s e q u e n c e d e u k a r y o t i c s e r i n e tRNAs ( w h i c h a r e v e r y s i m i l a r o r i d e n t i c a l t o tRNA^ f r o m Ug t o C g g , as i n F i g . 11) i s N 4 - a c e t y l c y t i d i n e , a n d t h e p r o p e r t i e s o f t h i s m o d i f i e d n u c l e o t i d e a r e c o n s i s t e n t w i t h t h e d a t a o b t a i n e d . S i n c e t h e Drosophila tRNA s e q u e n c e i s v e r y s i m i l a r t o t h a t o f tRNA^ f r o m r a t l i v e r ( F i g . 2 , 1 1 ) , t h e c l o v e r l e a f s t r u c t u r e d r a w n f r o m t h e Drosophila tRNA was t h a t p r o p o s e d f o r t h e r a t l i v e r s p e c i e s ( 9 5 ) . On t h i s b a s i s , n u c l e o t i d e 12 i s i n t h e D l o o p s t e m , a n d i s o p p o s i t e a G. F o r c o r r e c t W a t s o n - C r i c k b a s e - p a i r i n g , C-J2 s h o u l d be m o d i f i e d a t N - 4 , C - 5 , o r C - 6 . The a l k a l i - l a b i l i t y o f t h e m o d i f i c a t i o n i s c o n s i s t e n t w i t h a c y l a t i o n a t N - 4 . No a c C was d e t e c t e d i n n u c l e o s i d e o r n u c l e o t i d e a n a l y s i s ( 6 1 ) , b u t a c y l d e r i v a t i v e s o f c y t i d i n e a r e l a b i l e i n b o t h a c i d a n d a l k a l i ( 9 6 ) , a n d t h e c o n d i t i o n s o f a n a l y s i s may h a v e b e e n s u f f i c i e n t l y s e v e r e t o c a u s e d e a m i n a t i o n o r h y d r o l y s i s o f t h e a m i d e l i n k a g e ( 9 0 , 9 6 ) . T h e d a t a f o r n u c l e o t i d e 12 a r e c o n s i s t e n t w i t h 4 * i a c C , a n d w h i l e c o m p a r i s o n o f p C - | 2 w i t h o r w i t h o u t NaOH t r e a t m e n t ( M e t h o d s ) d i d n o t a l l o w u n a m b i g u o u s i d e n t i f i c a t i o n ( F i g . 5 ) , p N - ^ i s shown a s a c 4 C i n F i g . 1 2 . N u c l e o s i d e a n d n u c l e o t i d e a n a l y s i s o f tRNAy i n d i c a t e d t h e , 2 2 p r e s e n c e o f N , N - d i m e t h y l g u a n o s i n e ( 6 1 ) . . T h i s n u c l e o s i d e i s f o u n d o n l y 5 6 . i n t h e p o s i t i o n b e t w e e n t h e D l o o p a n d a n t i c o d o n s t e m s i n o t h e r tRNAs S 6 V* ( 1 7 ) , e q u i v a l e n t t o p o s i t i o n 26 o f tRNA-, . H o w e v e r , o n t w o - d i m e n s i o n a l c h r o m a t o g r a p h y * p X 2 6 r a n much d i f f e r e n t l y t h a n pm^G ( F i g . 6 ; c o m p a r e w i t h F i g . 2 o f r e f . 7 0 ) . C h r o m a t o g r a p h y o f p X 2 g a d j a c e n t t o a n u c l e a s e M e t 2 P.j d i g e s t o f y e a s t tRNA-j , w h i c h c o n t a i n s pn^G, d i d n o t a l l o w u n a m b i g u o u s M e t i d e n t i f i c a t i o n . T h o u g h t h e r e was. a n u c l e o t i d e i n t h e tRNA-j d i g e s t w h i c h * r a n w i t h p X 2 g , t h e y e a s t tRNA c o n t a i n s u n i d e n t i f i e d d e r i v a t i v e s o f A a n d G ( 1 7 ) , w h i c h c o u l d h a v e t h e same R^ a s pm^G. No b a n d c a n be s e e n f o r t h i s n u c l e o t i d e i n a l a d d e r g e l ( F i g . 1 0 ) , b u t RNase T-j c u t s a t 2 m2G r e s i d u e s s l o w l y ( 9 7 ) , a n d no c o n c l u s i o n s c a n be d r a w n f r o m t h i s n e g a -2 t i v e r e s u l t . T h e p o s s i b i l i t y t h a t X 2 g i s i n f a c t m 2 G c a n n o t b e r u l e d o u t b a s e d o n t h e d a t a h e r e . F u r t h e r s e q u e n c e d a t a w e r e o b t a i n e d b y p a r t i a l e n z y m a t i c d i g e s t i o n o f [ 5 1 - P ] tRNA a n d a n a l y s i s o f t h e d i g e s t i o n p r o d u c t s a s d e s c r i b e d ( M e t h o d s ) . The r e s u l t s c o n f i r m a n d e x t e n d t h o s e o b t a i n e d by t h e f o r m a m i d e d e g r a d a t i o n m e t h o d . I n t h i s way t h e i d e n t i t i e s o f a n d G ^ o n t h e 3 ' - s i d e o f r i b o s e - m e t h y l a t e d n u c l e o t i d e s w e r e e s t a b l i s h e d . N ^ , i m m e d i a t e l y 3 ' t o ( U m ) ^ » c o u l d n o t be i d e n t i f i e d i n t h i s w a y , b u t b y b a s e - p a i r i n g c o n s t r a i n t s w i t h i n t h e c l o v e r l e a f s t r u c t u r e i t s h o u l d be U ( F i g . 1 2 ) . T h e s i n g l e l a d d e r g e l c o v e r i n g t h e 5 ' - t e r m i n u s o f tRNA^ g a v e t h e s e q u e n c e ; 5 '—AJN^UUGUGG^Q—3 ' . T h i s s e q u e n c e i s c o m p l e m e n t a r y t o t h a t o b t a i n e d by t h e f o r m a m i d e d e g r a d a t i o n m e t h o d f o r t h e a m i n o a c y l s t e m a t t h e 3 ' -t e r m i n u s , t h o u g h i t i n t r o d u c e s o n e n o n - W a t s o n - C r i c k b a s e - p a i r ( I L - G..,). N 2 , by b a s e - p a i r i n g , i s p r o b a b l y C s i n c e i t i s o p p o s i t e G. S i m i l a r l y , (N ) i s o p p o s i t e C a n d s h o u l d be G . 5 7 . F i g u r e 1 0 . L a d d e r g e l a n a l y s i s o f [ 5 1 - ' P j t R N A ^ , 5 ' - e n d . A n a l y s i s was c a r r i e d o u t as d e s c r i b e d i n M e t h o d s . E l e c t r o -p h o r e s i s was f o r 5 h r . a t 1 1 0 0 V , a n d e x p o s u r e o f t h e g e l t o X - r a y f i l m f o r 2 d a y s . 3 A 4 3 . 6 3 5 1 a c m i m m m pGCAGUUGUGGCCGAGCGGDDAAGGCXUCUGACUIGAAAKAGAUUCCCUCUGGGAGCGUAGGTiJCGAAUCCUACCGACUGCNCCA D.m. t R N A y e r m m • m s D o ms l C A pGGAAGUGUGGCCGAGCGGDGAAGGCACCGGUCUUGAAAACCGGCGACCGAAGGGUUCCAGAGT^CGAAUCUCUGCGCUUCCGCCA E. coli t R N A , e r m m I S e r 2 4 m 2 . 6 5 a c 2 1 m pGGCAACUUGGCCGAGDGGDDAAGGCGAAAGA^UIGAAA^CUUUUGGGCUCUGCCCGCGCAGGT^CAAAUCCUGCAGUUGUCGCCA Y e a s t tRNA m m 4 ml 3 . 6 3 5 1 a c 2 m I m m m pGUAGUCGUGGCCGAGDGGDDAAGGCGA^GGACUIGAAA^CCAUUGGGGUCUCCCCGCGCAGGT^CGAAUCCUGCCGACUACGCCA R a t 1 i v e r t R N A : ? e r m a c 4 m 2 m 3 m t 6 m 3 m 5 m 1 pGACGAGGUGGCCGAGDGGDDAAGGCGA^GGACUGCUAA^CCAUUGWCUCUGCACGCGUGGGWGAAUCCCAUCCUCGUCGCCA R a t 1 i v e r t R N A ^ e r m a : c ! m Common s e q u e n c e b e t w e e n D.m. t R N A ^ e r a n d o t h e r s e r i n e tRNAs D . m . v s . E. coli I v s . Y e a s t I I Stems L o o p s T o t a l 2 5 / 4 8 2 6 / 4 0 5 1 / 8 8 2 4 / 4 8 3 1 / 3 7 5 5 / 8 5 3 0 / 4 8 3 4 / 3 7 6 4 / 8 5 2 5 / 4 8 31/37 5 6 / 8 5 v s . R a t l i v e r I v s . R a t 1 1 v e r 3 ^  ~r^j ^ i  U*J C O F i g u r e 1 1 . C o m p a r i s o n o f t h e s e q u e n c e o f D . m . tRNA^ w i t h o t h e r s e r i n e tRNAs m- tRNA Ser c G D 15 G D 2 0 PC A GM U U G A OH 85 C N c G 8 0 10 u oc &CG GGC A 25 x U C U 3°A u ^ 7* 7 t ° c - - 7 p u CAUCC • • * • • GUAGG 6A5? UMU GG G45 " C u A C 4 0 A A^ m'A G f C « 5 A 5CC>. U„?C 50 IGA 35 FIGURE 12 6 1 . The s e q u e n c e a n a l y s i s i n d i c a t e s t h a t t h e r e a r e t h r e e r i b o s e - m e t h y l a t e d n u c l e o t i d e s i n t R N A ^ e r . D i g e s t i o n w i t h RNase 1^ s h o u l d y i e l d t h e t h r e e d i n u c l e o t i d e s G p U p , G pGp a n d U p U p . C o n s i s t e n t w i t h t h i s , t h e n u c l e o t i d e a n a l y s i s o f W h i t e et al. ( 6 1 ) i n d i c a t e s t h r e e RNase 1^ s t a b l e d i n u c l e o t i d e s i n t h e t R N A , two o f w h i c h a r e f l u o r e s c e n t i n a c i d a n d t h u s c o n t a i n G o r a d e r i v a t i v e o f i t . 5 T h e p r e s e n c e o f a d o u b l e t b a n d c o r r e s p o n d i n g t o m C i n l a d d e r g e l a n a l y s i s o f RNase A d i g e s t s may be d i a g n o s t i c f o r t h a t n u c l e o t i d e . - The d o u b l e t i s t h e r e s u l t o f e n z y m a t i c h y d r o l y s i s , s i n c e i t i s / n o t s e e n i n t h e r e f e r e n c e l a d d e r ( F i g u r e s 8 , 9 ) . N o r m a l l y u n d e r c o n d i t i o n s o f p a r t i a l e n z y m a t i c d i g e s t i o n , f r a g m e n t s w i t h c y c l i c p h o s p h a t e s a t t h e i r 3 ' - t e r m i n i a r e g e n e r a t e d . A t h i g h e r r a t i o s o f enzyme t o s u b s t r a t e , o r on p r o l o n g e d d i g e s t i o n , r i n g - o p e n i n g o f t h e c y c l i c p h o s p h a t e o c c u r s ( 7 2 , 7 8 ) . I t a p p e a r s t h a t t h e d o u b l e t s e e n i n l a d d e r g e l s r e f l e c t s p a r t i c u l a r l y e f f i c i e n t 5 r i n g - o p e n i n g o f t h e c y c l i c p h o s p h a t e on 3 ' - t e r m i n a l m C by RNase A . T h e r e may be some c h a n g e i n t h e s p e c i f i c i t y o f RNase T 1 u n d e r t h e c o n d i t i o n s f o r p a r t i a l . h y d r o l y s i s u s e d ( M e t h o d s ; 8 3 ) . RNase T^ S e r n o r m a l l y c l e a v e s on t h e 3 ' - s i d e o f . i n o s i n e r e s i d u e s ( 9 1 ) , y e t f o r tRNA.^ t h e r e was no b a n d i n t h e RNase T-j c h a n n e l a t p o s i t i o n 34 d e s p i t e t h a t r e s i d u e ' s a c c e s s i b i l i t y s h o w n by a s t r o n g b a n d i n t h e RNase P h y I c h a n n e l . T h i s r e s u l t i s c o n t r a r y t o p r e v i o u s r e p o r t s i n d i c a t i n g t h a t t h e s p e c i f i c i t y o f RNase T-j i s n o t a l t e r e d u n d e r t h e c o n d i t i o n s u s e d ( 7 7 , 9 2 ) . C e r t a i n r e g i o n s o f t h e tRNA m o l e c u l e a r e r e s i s t a n t t o e n z y m a t i c h y d r o l y s i s . I n F i g . 9 , t h e s e q u e n c e f r o m N^-N^Q i s h i g h l y r e s i s t a n t t o c l e a v a g e . T h i s i s p r o b a b l y due t o t h e t e r t i a r y s t r u c t u r e o f t h e RNA. N u c l e o t i d e s i n t h i s r e g i o n w e r e p o o r l y l a b e l e d by p o l y n u c l e o t i d e k i n a s e 6 2 . i n s e v e r a l f o r m a m i d e d e g r a d a t i o n e x p e r i m e n t s , b u t t h e p o o r l a b e l i n g i s p r o b a b l y n o t due t o T a c k o f a f f i n i t y o f t h e enzyme f o r t h e t e r m i n a l n u c l e o t i d e s h e r e ( 7 0 ) a n d s h o u l d r e f l e c t r e s i d u a l s t r u c t u r e o f t h e f r a g m e n t s . E n z y m a t i c h y d r o l y s i s o f t h e a m i n o a c y l s t e m was a l s o weak ( F i g . 1 0 ) , p r e s u m a b l y due t o d o u b l e - s t r a n d e d s t r u c t u r e ( 8 1 ) . The c l o v e r l e a f s t r u c t u r e d r a w n f o r t R N A ^ e r o f Dvosophila was S e r A l a t h a t c o n s t r u c t e d f o r r a t l i v e r tRNA-j ( b a s e d i n t u r n on y e a s t tRNA ) ( 9 5 , 6 2 , 1 7 ) , w i t h e q u i v a l e n t n u m b e r s o f b a s e p a i r s i n e a c h . s t e m . A s s e e n i n F i g . 1 2 , t h e d a t a o b t a i n e d a r e c o n s i s t e n t w i t h t h a t s t r u c t u r e , a n d no m i s m a t c h e d b a s e - p a i r i n g i s s e e n ( U - G b a s e p a i r s l i k e Ug-G- ,g a r e o f t e n f o u n d i n t h e a m i n o a c y l s t e m s o f . t R N A s ) . A RNase T^ d i g e s t , o f tRNA^ c o n t a i n s pGp a n d A ( 6 1 ) , c o n s i s t e n t w i t h a 5 ' ' - t e r m i n a l • G a n d a 3 ' - t e r m i n a l A . A s s u m i n g a 3 ' - t e r m i n a l - C C A a s i n a l l o t h e r tRNAs s e q u e n c e d s o f a r ( 1 7 ) , t h e r e i s d i r e c t s e q u e n c e i n f o r m a t i o n on 76 o f 81 r e m a i n i n g n u c l e o t i d e s . F o u r o f t h e r e m a i n i n g f i v e n u c l e o t i d e s a r e p l a c e d w i t h i n s t e m s o f t h e c l o v e r l e a f s t r u c t u r e , a n d a r e s u b j e c t t o b a s e - p a i r i n g c o n s t r a i n t s . O n l y f o r Ng2 i s t h e r e no i n f o r m a t i o n w h a t e v e r . I d e n t i f i c a t i o n o f X^g may be a i d e d by d e t e r m i n a t i o n o f t h e gene DNA s e q u e n c e . F u r t h e r i n f o r m a t i o n on t h e m o d i f i e d n u c l e o t i d e a t p o s i t i o n 12 w o u l d be d e s i r a b l e . H o w e v e r , m o s t o f t h e s e q u e n c e i n f o r m a t i o n h a s b e e n v e r i f i e d i n s e p a r a t e e x p e r i m e n t s , a n d t h e s e q u e n c e shown i n F i g . 12 s h o u l d be a t l e a s t 95% a c c u r a t e . 63. C h a p t e r 4 D I S C U S S I O N T h e r e a r e e x t e n s i v e s e q u e n c e h o m o l o g i e s among t h e e u k a r y o t i c s e r i n e t r a n s f e r RNAs ( F i g . 1 1 ) . T h i s i s p a r t i c u l a r l y t r u e f o r l o o p r e g i o n s : d r a w n i n t h e c o n v e n t i o n a l c l o v e r l e a f s t r u c t u r e , t h e two r a t l i v e r s e r i n e t R N A s a r e n e a r l y i d e n t i c a l f o r t h o s e n u c l e o t i d e s n o t i n v o l v e d i n b a s e p a i r s . L i k e w i s e t h e n u c l e o t i d e s e q u e n c e s i n t h e l o o p r e g i o n s o f y e a s t tRNA-j 2 a r e a l m o s t i d e n t i c a l t o t h o s e o f t h e r a t s e r i n e t R N A s ( 1 7 ) . S i n c e t h e two Drosophila tRNAs s e q u e n c e d ( t R N A 2 y s a n d t R N A ^ e t ) a r e v e r y s i m i l a r t o t h e i r m a m m a l i a n c o u n t e r p a r t s ( 8 5 , 9 8 ) , t h e r e l a t i o n s h i p b e t w e e n Drosophila tRNA^ a n d r a t l i v e r tRNA^ , w h i c h h a s t h e same a n t i c o d o n , was e x a m i n e d . W i t h t h e e x c e p t i o n s o f C | g , X 2 g , w h i c h h a s n o t b e e n shown c o n c l u s i v e l y t o be d i s t i n c t f r o m m^G, a n d p o s s i b l y N g 2 , f o r w h i c h t h e r e i s no i n f o r m a -t i o n y e t , t h e Drosophila a n d r a t l i v e r tRNAs a r e i d e n t i c a l i n n o n - b a s e p a i r e d r e g i o n s . T h i s h i g h d e g r e e o f h o m o l o g y i s n o t m a i n t a i n e d i n s t e m s e q u e n c e s . The D , T I J J , a n d a m i n o a c y l s t e m s a r e v e r y s i m i l a r , w i t h no more t h a n o n e b a s e p a i r v a r y i n g . T h e i r e x t r a arms a r e s i m i l a r i n b a s e c o n t e n t (9 o f 11 p o s i t i o n s ) b u t a r e i n v e r t e d r e l a t i v e t o e a c h o t h e r s o t h a t o n l y 3 o f 11 n u c l e o t i d e s m a t c h . C o n s i d e r i n g b a s e c o n t e n t a s w e l l a s p r i m a r y s e q u e n c e , o n l y t h e a n t i c o d o n s t e m s v a r y much b e t w e e n t h e s e tRNAs ( F i g . 1 1 ) . 6 4 . ber The s i m i l a r i t i e s o f b a s e s e q u e n c e o f e u k a r y o t i c tRNAs a r e a p p a r e n t l y i n d e p e n d e n t o f t h e i r a n t i c o n d o n s . C o n s i s t e n t w i t h t h i s , w o r k i n p r o g r e s s i n d i c a t e s r o u g h l y 90% s e q u e n c e h o m o l o g y b e t w e e n Drosophila t R N A ^ e r a n d t R N A ^ e r ( w h i c h r e s p o n d t o UCG a n d UCU c o d o n s , r e s p e c t i v e l y ; r e f . 6 1 ) . Among t h e v a r i o u s f a m i l i e s o f e u k a r y o t i c tRNAs r e c o g n i z i n g c o d o n s b e g i n n i n g w i t h U ( C y s , L e u , P h e , S e r , T r p , a n d T y r ) , t h o s e tRNAs t h a t h a v e b e e n s e q u e n c e d show c e r t a i n s i m i l a r i t i e s . The D. l o o p s g e n e r a l l y C ^ c o n t a i n A 6 n — G G A ; t h e a n t i c o d o n l o o p s a r e u s u a l l y C U AHA, D r m w h e r e H i s a h y p e r m o d i f i e d p u r i n e n u c l e o t i d e ; a n d t h e T\j; l o o p s a r e u s u a l l y e i t h e r T^CGm'AAU o r TijjCGm'AUC, t h o u g h t h e r e may be v a r i a t i o n i n a s many a s t h r e e o f t h e s e v e n p o s i t i o n s ( 1 7 ) . The s t e m s v a r y more t h a n t h e l o o p s i n t h e s e tRNA f a m i l i e s , b u t t h e r e a r e c e r t a i n n e a r l y i n v a r i a n t r e s i d u e s . 2 I n t h e D s t e m , (m ) G ] o ^ n P y 1 2 ^ u 2 3 G 2 4 ' ' 2 5 ^ s ^ o m ^ ^ n m o s t c a s e s ( a b o u t 2 e q u a l p r o p o r t i o n s o f G a n d m G i n p o s i t i o n 1 0 ) ; G^Q-C^Q a n d ^2]~^39 b a s e p a i r s i n t h e a n t i c o d o n s t e m h a v e b e e n f o u n d i n 1 9 o f 2 0 t R N A s e x a m i n e d (m C a n d s o m e t i m e s r e p l a c e C a n d ty); a n d G 5 2 - C 7 0 1 S i n v a r i a n t . T h e s e b a s e p a i r s i n t h e a n t i c o d o n a n d T^ s t e m s a r e i m m e d i a t e l y a d j a c e n t t o t h e l o o p s t r u c t u r e s a s d r a w n i n t h e s t a n d a r d c l o v e r ! e a f ( F i g . 1 2 ) . T h e s e p a t t e r n s b r e a k down o u t s i d e tRNA f a m i l i e s r e c o g n i z i n g UNN c o d o n s . ( 1 7 ) . The y e a s t tRNAs w h o s e , g e n e s h a v e b e e n shown t o c o n t a i n i n t e r -v e n i n g s e q u e n c e s a l l r e s p o n d t o UNN c o d o n s ( 9 9 , 1 0 0 ) . A s y e t , no r e c o g n i -t i o n f e a t u r e f o r t h e e n z y m e ( s ) r e s p o n s i b l e f o r e x c i s i o n o f t h e i n t e r v e n i n g s e q u e n c e , w h i c h i s i n c l u d e d i n t h e p r e c u r s o r t R N A , i s a p p a r e n t , b u t s e q u e n c i n g o f g e n e s f r o m o t h e r o r g a n i s m s f o r t h e e q u i v a l e n t t R N A s m a y . p r o v e e n l i g h t e n i n g a n d i s now i n p r o g r e s s w i t h r e c o m b i n a n t p l a s m i d s 6 5 . S e r c o n t a i n i n g Drosophila W\k^ -j g e n e s . No tRNA g e n e s f r o m a n y o r g a n i s m ; e x c e p t y e a s t h a v e b e e n f o u n d t o c o n t a i n i n t e r v e n i n g s e q u e n c e s . The g e n e SGK* S P Y * f o r y e a s t t R N A y ^ ( e q u i v a l e n t t o Drosophila tRNA^ ) c o n t a i n s an i n t e r -Spy* SPY* v e n i n g s e q u e n c e , w h i l e t h a t f o r t R ^ i j c ( / \ c U) ( e 1 u 1 ' v a ' ' e n ' t t 0 t R N A 7 ) d o e s n o t ( u n p u b l i s h e d r e s u l t s o f G. P a g e ) . I t w i l l be o f i n t e r e s t t o c o m p a r e t h e s t r u c t u r e s o f t h e e q u i v a l e n t s e r i n e tRNA g e n e s f r o m Drosophila a n d y e a s t . The s e q u e n c e o f Drosophila tRNA^ i s g e n e r a l l y u n r e m a r k a b l e ; 3 i t i s s i m i l a r t o o t h e r e u k a r y o t i c s e r i n e tRNAs a n a l y z e d . I t c o n t a i n e d m C 4 a n d l i k e l y a c C , w h i c h , t h o u g h n o t f o u n d i n m o s t t R N A s , a r e common i n t h e e u k a r y o t i c s e r i n e tRNAs s t u d i e d ( 1 7 ) . S i x t e e n o f 85 n u c l e o t i d e s a r e m o d i f i e d , s i m i l a r t o o t h e r e u k a r y o t i c s e r i n e tRNAs ( F i g . 1 1 ) . One u n u s u a l Spy* f e a t u r e o f tRNA^ i s t h e r i b o s e - m e t h y l a t i o n a t p o s i t i o n 4 ( F i g . 1 2 ) . The o n l y o t h e r known c a s e s o f r i b o s e - m e t h y l a t i o n i n t h e a m i n o a c y l s t e m a r e g l y c i n e tRNAs o f y e a s t , w h e a t g e r m , awd Borribyx mori> a l s o m o d i f i e d a t n u c l e o t i d e 4 ( 1 7 ) . The c o d o n r e c o g n i t i o n p r o p e r t i e s o f t R N A ^ e r a r e u n u s u a l . The tRNA r e s p o n d s s i g n i f i c a n t l y i n t h e r i b o s o m e b i n d i n g a s s a y o n l y t o UCU ( 6 1 ) , b u t t h e 5 ' n u c l e o t i d e o f t h e a n t i c o d o n i s i n o s i n e . The p r e s e n c e o f i n o s i n e i n t h e w o b b l e p o s i t i o n n o r m a l l y a l l o w s a tRNA t o t r a n s l a t e c o d o n s e n d i n g i n A , C , o r U, a s i s t h e c a s e f o r y e a s t a l a n i n e a n d s e r i n e a n d r a t l i v e r s e r i n e tRNAs ( s e e F i g . 8 , r e f . 1 0 1 ) . The a n t i c o d o n l o o p o f t R N A ^ e r i s i d e n t i c a l t o t h a t o f r a t l i v e r t R N A ^ e r , a n d d i f f e r s by o n l y o n e n u c l e o t i d e f r o m y e a s t s e r i n e tRNAs 1 a n d 2 ( 1 7 ) . The f i r s t two b a s e p a i r s f r o m t h e a n t i c o d o n l o o p o f e a c h s t e m a r e a l s o t h e s a m e , e x c e p t f o r t h e r i b o s e - m e t h y l a t e d a t p o s i t i o n 39 i n r a t l i v e r t R N A ^ e r , w h i c h d o e s 6 6 . n o t a f f e c t t h a t t R N A ' s c o d o n r e s p o n s e c o m p a r e d w i t h t h e e q u i v a l e n t y e a s t tRNAs l a c k i n g t h a t m e t h y l a t i o n . T h u s , i t i s l i k e l y t h a t a s t r u c t u r a l f e a t u r e e l s e w h e r e i s r e s p o n s i b l e f o r t h e c o d o n r e s p o n s e o f t R N A ^ e r . A c a n d i d a t e w o u l d c e r t a i n l y be t h e r i b o s e - m e t h y l a t e d n u c l e o t i d e i n p o s i t i o n 4 , s i n c e t h i s i s an u n p r e c e d e n t e d m o d i f i c a t i o n f o r a s e r i n e t R N A , b u t no f i r m c o n c l u s i o n s c a n be d r a w n h e r e . The c o d o n r e s p o n s e o f tRNA^ i s n o t l i k e l y t o be t y p i c a l o f Drosophila tRNAs w i t h i n o s i n e i n t h e a n t i c o d o n . T r a n s f e r RNA^a^ c o n t a i n s i n o s i n e a n d r e s p o n d s t o c o d o n s e n d i n g i n A , C , a n d U ( 1 0 2 ) , i n d i c a t i n g t h a t i n o s i n e i s i n t h e f i r s t p o s i t i o n o f t h e a n t i c o d o n a n d c o n s i s t e n t w i t h t h e " w o b b l e " h y p o t h e s i s ( 1 0 3 ) . The m o d i f i e d n u c l e o t i d e s f o u n d i n s e q u e n c e a n a l y s i s o f Drosophila S e r 2 4 tRNA^ a g r e e w i t h a n a l y s e s o f W h i t e et al. ( 6 1 ) , e x c e p t f o r n^G a n d a c C . 2 W h i t e et al. f o u n d m 2 G i n t w o c h r o m a t o g r a p h i c s y s t e m s , b u t i n t h e p r e s e n t s t u d y t h e i d e n t i f i c a t i o n o f X 2 g a s m 2 G h a s n o t b e e n c o n f i r m e d . C - j 2 i s 4 l i k e l y t o be a c C. T h o u g h t h i s n u c l e o t i d e was n o t f o u n d by W h i t e et al. , t h i s i s u n d o u b t e d l y due t o i t s i n s t a b i l i t y i n b o t h a c i d a n d a l k a l i ( 9 0 , 9 6 ) . F u r t h e r e x p e r i m e n t s a r e r e q u i r e d f o r i d e n t i f i c a t i o n o f t h e s e two n u c l e o t i d e s . One p u r p o s e o f t h e s e q u e n c e a n a l y s i s p r e s e n t e d h e r e was t o a l l o w i d e n t i f i c a t i o n o f t h e tRNA g e n e w i t h i n a s e q u e n c e o f r e c o m b i n a n t Drosophila DNA; t h e r e i s s u f f i c i e n t i n f o r m a t i o n h e r e f o r t h a t . A l s o , t h e RNA s e q u e n c e shows t h a t t h e c o r r e s p o n d i n g g e n e f o r t R N A ^ e r s h o u l d c o n t a i n r e c o g n i t i o n s e q u e n c e s f o r t h e r e s t r i c t i o n e n d o n u c l e a s e s T a g I ( T C G A , p o s i t i o n s 6 4 - 6 7 ) a n d Hae I I I (GGCC, p o s i t i o n s 9 - 1 2 ) . T h i s s h o u l d make s e q u e n c i n g o f t h e tRNA gene by t h e G i l b e r t - M a x a m m e t h o d ( 8 2 ) r e l a t i v e l y e a s y , s i n c e i t 6 7 . w i l l be p o s s i b l e t o s e q u e n c e i n b o t h d i r e c t i o n s f r o m known s t a r t i n g p o i n t s w i t h i n a t R N A ^ e r g e n e . The s e q u e n c i n g s t r a t e g y e m p l o y e d h e r e ( I n t r o d u c t i o n ) was r e a s o n -a b l y s u c c e s s f u l . The f o r m a m i d e d e g r a d a t i o n m e t h o d made p o s s i b l e e x t e n s i v e c h a r a c t e r i z a t i o n o f t h e m o d i f i e d n u c l e o t i d e s , a n d g a v e m o s t o f t h e s e q u e n c e (72 o f 8 5 n u c l e o t i d e s ) . Gaps i n t h e s e q u e n c e o b t a i n e d by t h i s m e t h o d w e r e f i l l e d by l a d d e r g e l a n a l y s i s i n m o s t c a s e s . W a n d e r i n g s p o t a n a l y s i s o f g e l -32 p u r i f i e d [ 5 1 - P]RNA f r a g m e n t s g e n e r a t e d by f o r m a m i d e h y d r o l y s i s ( M e t h o d s ) was shown t o be e f f e c t i v e a s a means o f v e r i f y i n g r e g i o n s o f d i f f i c u l t y i n t h e s e q u e n c e ( F i g . 7 ) . L a d d e r g e l a n a l y s i s p r o v i d e d m o s t b u t n o t a l l o f t h e i n f o r -m a t i o n d e s i r e d f r o m i t . N u c l e o t i d e 4 5 , a s s i g n e d a s U ^ 5 by t h e c r i t e r i o n o f W a t s o n - C r i c k b a s e p a i r i n g , c o u l d n o t be r e a d f r o m t h e l a d d e r g e l s ( F i g . 9 ) . T h u s t h e r e i s no d i r e c t e v i d e n c e o n t h e i d e n t i t y o f t h i s n u c l e o t i d e , s i n c e i t i s 3 ' t o a r i b o s e - m e t h y l a t e d n u c l e o t i d e a n d i s n o t a c c e s s i b l e by t h e f o r m a m i d e d e g r a d a t i o n m e t h o d . On t h e o t h e r h a n d , G^g was r e a d i l y i d e n t i f i e d b y l a d d e r g e l a n a l y s i s ( F i g . 1 0 ) . The i n a b i l i t y t o i d e n t i f y by l a d d e r g e l a n a l y s i s may be a c o n s e q u e n c e o f u s i n g i n t a c t tRNA a s s u b s t r a t e : a c c e s s t o many p h o s p h o d i e s t e r b o n d s i s a p p a r e n t l y l i m i t e d f o r t h e n u c l e a s e s d u e t o t e r t i a r y s t r u c t u r e ( R e s u l t s ) . As s e e n i n F i g . 8 , t h i s i s l e s s a p r o b l e m w i t h tRNA h a l f - m o l e c u l e s . T h u s , g e n e r a t i o n o f h a l f - m o l e c u l e s by l i m i t e d e n z y m a t i c d i g e s t i o n ( 7 0 , 1 0 4 ) may be d e s i r a b l e f o r t h e s e a n a l y s e s . A l i m i t i n g f a c t o r i n l a d d e r g e l a n a l y s i s s o f a r h a s b e e n o b t a i n i n g s u f f i c i e n t r a d i o l a b e l e d RNA f o r s u b s t r a t e , s i n c e t h e r e c e s s e d 5 ' - t e r m i n i o f t R N A s make t h e m r e l a t i v e l y i n a c c e s s i b l e t o l a b e l i n g by p o l y n u c l e o t i d e k i n a s e ( 1 0 5 ) . S i n c e t h i s s h o u l d b e l e s s o f a p r o b l e m w i t h h a l f - m o l e c u l e s , t h e i r u s e may be a d v a n t a g e o u s . A n o t h e r a l t e r n a t i v e may be t o l a b e l a t t h e 3 ' - t e r m i n u s 6 8 . u s i n g RNA l i g a s e ( 7 0 , 1 0 6 ) . Once [ J ^ P ] R N A i s a v a i l a b l e , l a d d e r g e l a n a l y s i s u s i n g e i t h e r c h e m i c a l o r e n z y m a t i c d i g e s t i o n s w o u l d be c o m p a t i b l e w i t h t h e g e n e r a l s t r a t e g y e m p l o y e d h e r e . H o w e v e r , t h e c o n d i t i o n s o f c h e m i c a l h y d r o l y s i s a p p e a r t o g i v e a more u n i f o r m a r r a y o f p r o d u c t b a n d s a n d t h a t m e t h o d may w e l l be p r e f e r a b l e ( c o m p a r e F i g . 1 , r e f . 7 9 , w i t h F i g . 2 , r e f . 8 1 ) . A p o s s i b l e m o d i f i c a t i o n o f t h e f o r m a m i d e d e g r a d a t i o n m e t h o d i s d i r e c t 32 t r a n s f e r o f [ P]RNA f r a g m e n t s f r o m g e l s t o a n i o n e x c h a n g e t h i n l a y e r p l a t e s , f o l l o w e d by e n z y m a t i c h y d r o l y s i s in situ t o m o n o n u c l e o t i d e s a n d c h r o m a t o -g r a p h y ( 1 0 7 ) . The s u b j e c t i v i t y i n v o l v e d i n e x c i s i o n o f g e l b a n d s w o u l d t h e n be r e m o v e d . P l a c e m e n t o f p o o r l y l a b e l e d m o d i f i e d n u c l e o t i d e s w o u l d be e a s i e r , s i n c e t h e y c o u l d be i d e n t i f i e d , t h e n l o c a t e d p r e c i s e l y w i t h i n e v e n a h i g h b a c k g r o u n d o f c o n t a m i n a t i n g f r a g m e n t s ( d o u b l e " h i t " p r o d u c t s ) by c o m p a r i s o n t o l a d d e r g e l s c o v e r i n g t h e same s e q u e n c e . A d i s a d v a n t a g e o f d o i n g s u c h . t r a n s f e r s w o u l d be t h a t t w o - d i m e n s i o n a l h o m o c h r o m a t o g r a p h y c o u l d n o t be p e r f o r m e d . P r o v i d e d t h e i n i t i a l t r a n s f e r f r o m g e l t o p l a t e m a i n t a i n s r e s o l u -t i o n a n d i s r e a s o n a b l y e f f i c i e n t s u c h t r a n s f e r e x p e r i m e n t s ' m a y be s u f f i c i e n t , b u t t h e f l e x i b i l i t y p r o v i d e d by t w o - d i m e n s i o n a l n o m o c h r o m a t o g r a p h y as d e s c r i b e d h e r e ( M e t h o d s ) c a n be q u i t e u s e f u l s i n c e ' a n y r e g i o n o f t h e tRNA e x c e p t i t s 5 ' - t e r m i n u s i s a c c e s s i b l e t o a n a l y s i s i n t h i s w a y . W h i l e some m o d i f i c a t i o n s s u c h a s t h o s e m e n t i o n e d a b o v e may be d e s i r e d , t h e g e n e r a l s e q u e n c i n g s t r a t e g y e m p l o y e d h e r e was r e a s o n a b l y s u c c e s s f u l . On r e f i n e m e n t , i t s h o u l d be a t l e a s t a s f a s t , a c c u r a t e , a n d g e n e r a l l y a p p l i c a b l e a s a n y o t h e r s t r a t e g y now u s e d f o r tRNA s e q u e n c i n g . B I B L I O G R A P H Y 1 . R . P . P e r r y ( 1 9 7 6 ) . A n n a . - . R e v . B i o c h e m . 45_, 6 0 5 - 6 3 0 . 2 . S . M . T i l g h m a n , D . C . T i e m e i e r , J . G . S e i d m a n , B . M . P e t e r l i n , M. S u l l i v a n , J . V . M a i z e l , a n d P. L e d e r ( 1 9 7 8 ) . P r o c . N a t . A c a d . S c i . USA 75_, 7 2 5 - 7 2 7 . 3 . S . T o n e g a w a , C. B r a c k , N. H o z u m i , a n d R. S c h u l l e r ( 1 9 7 7 ) . P r o c . N a t . A c a d . S c i . USA 7 4 , 3 5 1 8 - 3 5 2 2 . 4 . S . M . B e r g e t , C. M o o r e , a n d P . A . S h a r p ( 1 9 7 7 ) . P r o c . N a t . A c a d . S c i . USA 7 4 , 3 1 7 1 - 3 1 7 5 . 5 . L . T . C h o w , R . E . G e l i n e s , T . R . B r o k e r , a n d R . J . R o b e r t s ( 1 9 7 7 ) . C e l l 1_2, 1 - 8 . 6 . P . K . W e l l a u e r a n d I . B . D a w i d ( 1 9 7 7 ) . C e l l 10, 1 9 3 - 2 1 2 . 7 . R . L . W h i t e a n d D . S . H o g n e s s ( 1 9 7 7 ) . C e l l J_0, 1 7 7 - 1 9 2 . 8 . R. B r e a t h n a c h , J . L . M a n d e l , a n d P . Chambon ( 1 9 7 7 ) . N a t u r e 2 7 0 , 3 1 4 - 3 1 9 . 9 . G . K n a p p , J . S . B e c k m a n n , P . F . J o h n s o n , S . A . F u h r m a n , a n d J . A b e l s o n ( 1 9 7 8 ) . C e l l 14_, 2 2 1 - 2 3 6 . 1 0 . P . Z . O ' F a r r e l l , B . C o r d e l l , P . V a l e n z u e l a , W . J . R u t t e r , a n d H . M . Goodman ( 1 9 7 8 ) . N a t u r e 2 7 4 , 4 3 8 - 4 4 5 . 1 1 . E . M . D e R o b e r t i s a n d M . V . O l s o n ( 1 9 7 9 ) . N a t u r e 2 7 8 , 1 3 7 - 1 4 3 . 1 2 . F . E . B a r a l l e a n d G . G . B r o w n l e e ( 1 9 7 8 ) . N a t u r e 2 7 4 , 8 4 - 8 7 . 1 3 . 0 . H a g e n b u c h l e , M. S a n t e r , J . A . S t e i t z , a n d R . J . Mans ( 1 9 7 8 ) . C e l l ' 1 _ 3 , 5 5 1 - 5 6 3 . 1 4 . M. G r u n s t e i n a n d D . S . H o g n e s s ( 1 9 7 5 ) . P r o c . N a t . A c a d . S c i . USA 7 2 , 3 9 6 1 - 3 9 6 5 . ~ 7 0 . 1 5 . T . M a n i a t i s , R . C . H a r d i s o n , E. L a c y , J . L a u e r , C. O ' C o n n e l l , D. Q u o n , G . K . S i m , a n d A . E f s t r a t i a d i s ( 1 9 7 8 ) . C e l l 1_5, 6 8 7 - 7 0 1 . 1 6 . R. H a l l , "The M o d i f i e d N u c l e o s i d e s i n N u c l e i c A c i d s , " C o l u m b i a U n i v e r s i t y P r e s s , New Y o r k a n d L o n d o n , 1 9 7 1 . 1 7 . M. S p r i n z l , F. G r u t e r , a n d D. H. G a u s s ( 1 9 7 9 ) . N u c l e i c A c i d s R e s . 6_, r l - r 9 . 1 8 . J . E . H e c k m a n , B . A l z n e r - D e w e e r d , a n d U . L . R a j B h a n d a r y ( 1 9 7 9 ) . P r o c . N a t . A c a d . S c i . USA 7 6 , 7 1 7 - 7 2 1 . 1 9 . M. B r e n n e r , J . A . L e w i s , D . S . S t r a u s , F. D e L o r e n z o , a n d B . N . Ames ( 1 9 7 2 ) . J . B i o l . Chem. 2 4 7 , 4 3 3 3 - 4 3 3 9 . 2 0 . H . G . K h o r a n a , K . L . A g a r w a l , P . B e s m e r , H. B u c h i , M . H . C a r u t h e r s , P . J . C a s h i o n , M . F r i d k i n , E. J a y , K. K l e p p e , R. K l e p p e , A . K u m a r , P . C . L o e w e n , R . C . M i l l e r , K. M i n a m o t o , A . P a n e t , U . L . R a j B h a n d a r y , B . R a m a m o o r t h y , T . S e k i y a , T . T a k e y a , a n d J . H . v a n de S a n d e ( 1 9 7 6 ) . J . B i o l . Chem. 2 5 1 , 5 6 5 - 5 7 0 . 2 1 . S . A l t m a n a n d J . D . S m i t h ( 1 9 7 1 ) . N a t u r e New B i o l . 2 3 3 , 3 5 - 3 9 . 2 2 . G. Z u r a w s k i , D. E l s e v i e r s , G . V . S t a u f f e r , a n d C . Y a n o f s k y ( 1 9 7 8 ) . P r o c . N a t l . A c a d . S c i . USA 7 5 , 5 9 8 8 - 5 9 9 2 . 2 3 . F. H a r a d a , R . C . S a w y e r , a n d J . E . D a h l b e r g ( 1 9 7 5 ) . J . B i o l . Chem. 2 5 0 , 3 4 8 7 - 3 4 9 7 . 2 4 . S . N i s h i m u r a , P r o g r e s s N u c l . A c i d s R e s . M o l . B i o l . 1_2, 4 9 - 8 5 . 2 5 . T . I k e m u r a a n d H . O z e k i ( 1 9 7 7 ) . J . M o l . B i o l . 1 J 7 , 4 1 9 - 4 4 6 . 2 6 . J . H . W i l s o n a n d J . N . A b e l s o n ( 1 9 7 2 ) . J . M o l . B i o l . 6 9 , 5 7 - 7 3 . 2 7 . S . P . E i s e n b e r g , L. S o l i , a n d M . Y a r u s ( 1 9 7 9 ) . J . B i o l . Chem. 2 5 4 , 5 5 6 2 - 5 5 6 6 . ~ 2 8 . S . B e n z e r . a n d S . P . Champe ( 1 9 6 2 ) . P r o c . N a t l . A c a d . S c i . USA 4 8 , 1 1 1 4 -1 1 2 1 . 2 9 . S . B r e n n e r a n d J . R . B e c k w i t h ( 1 9 6 5 ) . J . M o l . B i o l . ' 1 3 . , 6 2 9 - 6 3 7 . 3 0 . H . M . Goodman, J . A b e l s o n , A . L a n d y , S . B r e n n e r , a n d J . D . S m i t h ( 1 9 6 8 ) . N a t u r e 2 1 7 , 1 0 1 9 - 1 0 2 4 . 7 1 . 3 1 . L. S o i l a n d P. B e r g ( 1 9 6 9 ) . P r o c . N a t l . A c a d . S c i . USA 6_3, 3 9 2 - 3 9 9 . 3 2 . L. S o i l a n d P . B e r g ( 1 9 6 9 ) . N a t u r e 2 2 3 . , 1 3 4 0 - 1 3 4 2 . 3 3 . C . S i n g e r , G . S m i t h , R. C o r t e s e , a n d B . N . Ames ( 1 9 7 2 ) . N a t u r e New B i o l . 2 3 8 , 7 2 - 7 4 . 3 4 . M. B r e n n e r a n d B . N . Ames ( 1 9 7 2 ) . J . B i o l . Chem. 2 4 7 , 1 0 8 0 - 1 0 8 8 . 3 5 . J . D . S m i t h ( 1 9 7 6 ) . P r o g . N u c l e i c A c i d R e s . MoT. B i o l . 1_6, 2 5 - 7 3 . 3 6 . E. L u n d a n d J . E . D a h l b e r g ( 1 9 7 7 ) . C e l l 1J_, 2 4 7 - 2 6 2 . 3 7 . E. S c h w e i z e r , C . M a c K e c h n i e , a n d H . O . H a l v o r s o n ( 1 9 6 7 ) . J . M o l . B i o l . 4 0 , 2 6 1 . 3 8 . M . V . O l s o n , D . L . M o n t g o m e r y , A . K . H o p p e r , G . S . P a g e , F. H o r o d y s k i , a n d B . D . H a l l ( 1 9 7 7 ) . N a t u r e 2 6 7 , 6 3 9 - 6 4 1 . 3 9 . F. S h e r m a n , S . W . L i e b m a n , J . W . S t e w a r t , a n d M. J a c k s o n ( 1 9 7 3 ) . J . Mol B i o l . 7 8 , 1 5 7 - 1 6 8 . 4 0 . M . L . B i r n s t i e l , B . H . S e l l s , a n d I . F . Purdom ( 1 9 7 2 ) . J . M o l . B i o l . 6 3 , 2 1 - 3 9 . 4 1 . S . G . C l a r k s o n , M . L . B i r n s t i e l , a n d I . F . Purdom ( 1 9 7 3 ) . J . M o l . B i o l . 7 9 , 4 1 1 - 4 2 9 . 4 2 . S . G . C l a r k s o n , M . L . B i r n s t i e l , a n d V . S e r r a ( 1 9 7 3 ) . J . M o l . B i o l . 7 9 , 3 9 1 - 4 1 0 . 4 3 . E . L u n d , J . E . D a h l b e r g , L. L i n d a h l , S . R . J a s k u n i s , P . P . D e n n i s , a n d M. Nomura ( 1 9 7 6 ) . C e l l 7 , 1 6 5 - 1 7 7 . 4 4 . B . N . W h i t e , G . M . T e n e r , J . H o l d e n , a n d D . T . S u z u k i ( 1 9 7 3 ) . J . M o l . B i o l . 7 4 , 6 3 5 - 6 5 1 . 4 5 . F . M . R i t o s s a , R . C . A t w o o d , a n d S . S p i e g e l m a n ( 1 9 6 6 ) . G e n e t i c s 5 4 , 6 6 3 -6 7 6 . ~ 4 6 . L. Weber and. E. B e r g e r ( 1 9 7 6 ) . B i o c h e m i s t r y 1 5 , 5 5 1 1 - 5 5 1 9 . 7 2 . 4 7 . T . A . G r i g l i a t t i , B . N . W h i t e , G . M . T e n e r , T . C . K a u f m a n , a n d D . T . S u z u k i ( 1 9 7 4 ) . P r o c . N a t . A c a d . S c i . USA 71_, 3 5 2 7 - 3 5 3 1 . 4 8 . E. K u b l i a n d T . S c h m i d t ( 1 9 7 8 ) . N u c l e i c A c i d s R e s . 5 , 1 4 6 5 - 1 4 7 8 . 4 9 . R. D u n n , S . H a y a s h i , ' I . e . G i l l a m , A . D . D e l a n e y , G . M . T e n e r , T . A . G r i g l i a t t i , T . C . K a u f m a n , a n d D . T . S u z u k i ( 1 9 7 9 ) . J . M o l . B i o l . 1 2 8 , 2 7 7 - 2 8 7 . 5 0 . S . H a y a s h i , I . C . G i l l a m , A . D . D e l a n e y , R. D u n n , G . M . T e n e r , T . A . G r i g l i a t t i , a n d D . T . S u z u k i ( 1 9 7 9 ) . C h o m a s o m a , i n p r e s s . 5 1 . P . H . Y e n , A . S o d j a , M. C o h e n , S . E . C o n r a d , M. Wu, a n d N. D a v i d s o n ( 1 9 7 7 ) . C e l l n_, 7 6 3 - 7 7 7 . 5 2 . D. S o i l ( 1 9 7 9 ) . A b s t r a c t s , XI I n t e r n a t i o n a l C o n g r e s s o f B i o c h e m i s t r y . 5 3 . G . M . T e n e r , S . H a y a s h i , R. D u n n , A . D e l a n e y , I . C . G i l l a m , T . A . G r i g l i a t t i , T . C . K a u f m a n , a n d D . T . S u z u k i ( 1 9 7 9 ) . C o l d S p r i n g H a r b o r S y m p o s i u m o n Q u a n t i t a t i v e B i o l o g y , i n p r e s s . 5 4 . D . D . B r o w n , P . C . W e n s i n k , a n d . E. J o r d a n ( 1 9 7 1 ) . P r o c . N a t . A c a d . S c i . USA 6 8 , 3 1 7 5 - 3 1 7 9 . 5 5 . S . G . C l a r k s o n , M . L . B i r n s t i e l , a n d V . S e r r a ( 1 9 7 3 ) . J . M o l . B i o l . 7 9 , 3 9 1 - 4 1 0 . 5 6 . S . G . C l a r k s o n a n d V . K u r e r ( 1 9 7 6 ) . C e l l 8 , 1 8 3 - 1 9 5 . 5 7 . J . D . P r o c u n i e r a n d R . J . Dunn ( 1 9 7 8 ) . C e l l 1_5, 1 0 8 7 - 1 0 9 3 . 5 8 . B . A . H a m k a l o , O . L . M i l l e r , a n d A . H . B a k k e n ( T 9 7 3 ) . C o l d S p r i n g H a r b o r Symp. Q u a n t . B i o l . 3 8 , 9 1 5 - 9 1 9 . 5 9 . R. D u n n , A . D . D e l a n e y , I . C . G i l l a m , S . H a y a s h i , G . M . T e n e r , T . G r i l i a t t i , V . M i s r a , M . G . S p u r r , D . M . T a y l o r , a n d R . C . M i l l e r , J r . ( 1 9 7 9 ) . G e n e , i n p r e s s . 6 0 . A . R a f a l s k i , J . K o h l i , P . A g r i s , a n d D. S o l i ( 1 9 7 9 ) . N u c l e i c A c i d s R e s . 6 , 2 6 8 3 - 2 6 9 5 . 6 1 . B . N . W h i t e , R. D u n n , I . G i l l a m , G . M . T e n e r , D . J . A r m s t r o n g , F. S k o o g , C R . F r i h a r t , a n d N . J . L e o n a r d ( 1 9 7 5 ) . J . B i o l . Chem. 250_, 5 1 5 - 5 2 1 . 7 3 . 6 2 . R.W. H o l l e y , J . A p g a r , G . A . E v e r e t t , J . T . M a d i s o n , M . M a r q u i s e e , S . H . M e r r i l l , J . R . P e n s w i c k , a n d A . Z a m i r ( 1 9 6 5 ) . S c i e n c e 1 4 7 , 1 4 6 2 . 6 3 . J . T . M a d i s o n , G . A . E v e r e t t , a n d H. Kung ( 1 9 6 6 ) . S c i e n c e 1 5 3 , 5 3 1 . 6 4 . H . G . Z a c h a u , D. D u t t i n g , a n d H. F e l d m a n n ( 1 9 6 6 ) . Z . P h y s i o l . Chem. 3 4 7 , 2 1 2 - 2 3 5 . 6 5 . U . L . R a j B h a n d a r y , S . H . C h a n g . A . S t e w a r t , R . D . F a u l k n e r , R . M . H o s k i n s o n , a n d H . G . K h o r a n a ( 1 9 6 7 ) . P r o c . N a t . A c a d . S c i . USA 57_, 5 7 1 . 6 6 . R.W. H o l l e y ( 1 9 6 8 ) . P r o g . N u c l e i c A c i d R e s . M o l . B i o l . 8_, 3 7 - 4 7 . 6 7 . F. S a n g e r , G . G . B r o w n l e e , a n d B . G . B a r r e l ! ( 1 9 6 5 ) . J . M o l . B i o l . 1_3, 3 7 3 - 3 9 8 . 6 8 . M. S z e " k e l y a n d F. S a n g e r ( 1 9 6 9 ) . J . M o l . B i o l . 4 3 , 6 0 7 - 6 1 7 . 6 9 . F. L a b r i e a n d F. S a n g e r ( 1 9 6 9 ) . B i o c h e m . J . 1 1 4 , 2 9 P . 7 0 . M. S i l b e r k l a n g , A . M . G i l l u m , a n d U . L . R a j B h a n d a r y ( 1 9 7 9 ) . M e t h . i n E n z y m o l . 5 4 , P a r t G , 5 8 - 1 0 9 . 7 1 . B . G . B a r r e l l , i n " P r o c e d u r e s i n N u c l e i c A c i d R e s e a r c h " V o l . 2 ( G . L . C A n t o n i a n d D . R . D a v i e s , e d s . ) p . 7 5 1 . H a r p e r a n d Row, New Y o r k , 1 9 7 1 . 7 2 . G . G . B r o w n l e e , " D e t e r m i n a t i o n o f S e q u e n c e s i n R N A . " N o r t h - H o l l a n d , A m s t e r d a m , 1 9 7 2 . 7 3 . E. J a y , R. B a m b a r a , R. Padmanabhan a n d R. Wu ( 1 9 7 4 ) . N u c l e i c A c i d s R e s e a r c h 1_, 3 3 1 - 3 5 3 . 7 4 . B . E . G r i f f i n ( 1 9 7 1 ) . FEBS L e t t . 1_5, 1 6 5 - 1 6 8 . 7 5 . C . - P . D. T u , E. J a y , C P . B a h l , a n d R . Wu ( 1 9 7 6 ) . A n a l . B i o c h e m . 7 4 , 7 3 - 9 3 . 7 6 . R . E . L o c k a r d , B . A l z n e r - D e w e e r d , J . E . H e c k m a n , J . M a c G e e , M.W. T a b o r , a n d U . L . R a j B h a n d a r y ( 1 9 7 8 ) . N u c l e i c A c i d s R e s . 5_, 3 7 - 5 5 . 7 7 . H. D o n i s - K e l l e r , A . M . Maxam, a n d W. G i l b e r t ( 1 9 7 7 ) . N u c l e i c A c i d s R e s . 4 , 2 5 2 7 . 7 8 . A . S i m o n c s i t s , G . G . B r o w n l e e , R . S . B r o w n , J . R . R u b i n , a n d H. G u i l l e y ( 1 9 7 7 ) . N a t u r e 2 6 9 , 8 3 4 . 7 9 . D . A . P e a t t i e ( 1 9 7 9 ) . P r o c . N a t . A c a d . S c i . U S A . 7 6 , 1 7 6 0 - 1 7 6 4 . 8 0 . D. P i l l y , A . N i e m e y e r , M. S c h m i d t , a n d J . P . B a r g e t z i ( 1 9 7 8 ) . J . B i o l . Chem. 2 5 3 , 4 3 7 - 4 4 5 . 74. 8 1 . 6 . W i n t e r a n d G . G . B r o w n l e e ( 1 9 7 8 ) . N u c l e i c A c i d s R e s . 5_, 3129-3139. 8 2 . A . M . Maxam a n d W. G i l b e r t (1977) . P r o c . N a t . A c a d . S c i . USA 7 4 , 5 6 0 - 5 6 4 . 8 3 . J . S t a n l e y a n d S . V a s s i l e n k o ( 1 9 7 8 ) . N a t u r e 274, 8 7 - 8 9 . 8 4 . R . A . L a s k e y a n d A . D . M i l l s (1977) . FEBS L e t t . 82_, 314-316. 8 5 . S . S i l v e r m a n , J . H e c k m a n , G . J . C o w l i n g , A . D . D e l a n e y , R . J . D u n n , I . C . G i l l a m , G . M . T e n e r , D. S o i l , a n d U . L . R a j B h a n d a r y ( 1 9 7 9 ) . N u c l e i c A c i s R e s . 6 , 4 2 1 - 4 3 3 . 8 6 . G . G . B r o w n l e e a n d E . M . C a r t w r i g h t (1977) . J . M o l . B i o l . VI4_, 9 3 r l l 7 . 8 7 . E . M . S o u t h e r n a n d A . R . M i t c h e l l (1971) . B i o c h e m . J . 123, 613-617. 8 8 . M. F u j i m o t o , A . K u n i n a k a , a n d H . Y o s h i n o ( 1 9 7 4 ) . A g r . B i o l . Chem. 3 8 , 1555-1561. 8 9 . Y . Yamada a n d H. I s h i k u r a ( 1 9 7 5 ) . B i o c h i m . B i o p h y s . A c t a 4 0 2 , 285. 9 0 . H. F e l d m a n n , D. D i i t t i n g , a n d H . G . Z a c h a u ( 1 9 6 6 ) . Z . P h y s i o l . Chem. 3 4 7 , 2 3 6 - 2 4 8 . 9 1 . F. E g a m i , K. T a k a h a s h i , a n d T . U c h i d a ( 1 9 6 4 ) . P r o g . N u c l e i c A c i d R e s . M o l . B i o l . 3 , 5 9 - 1 0 1 . 9 2 . R . C . W a r r i n g t o n (1974). B i o c h i m . B i o p h y s . A c t a 3 5 3 , 6 3 - 6 8 . 9 3 . M. S i l b e r k l a n g , A . P r o c h i a n t z , A . - L . H a e n n i , a n d U . L . R a j B h a n d a r y (1977) . E u r . J . B i o c h e m . 7 2 , 4 6 5 - 4 7 8 . 9 4 . M. Y o s h i d a ( 1 9 7 3 ) . B i o c h e m . B i o p h y s . R e s . Comm. 5 0 , 779-784. 9 5 . T . G i n s b e r g , H. R o g g , a n d M. S t a e h e l i n (1971) . E u r . J . B i o c h e m . 2 1 , 2 4 9 - 2 5 7 . ~ 9 6 . D . M . B r o w n , A . T o d d , a n d S . V a r a d a r a j a n ( 1 9 5 6 ) . J . Chem. S o c . 2384. 97. G.W. R u s h i z k y a n d H . A . S o b e r ( 1 9 6 8 ) . P r o g . N u c l e i c A c i d s R e s . M o l . B i o l . 8 , 171-207. 7 5 . 9 8 . S . S i l v e r m a n , I . C . G i l l a m , G . M . T e n e r , a n d D. S o i l ( 1 9 7 9 ) . N u c l e i c A c i d s R e s . 6_, 4 3 5 - 4 4 2 . 9 9 . H . M . Goodman, M . V . O l s o n , a n d B . D . H a l l ( 1 9 7 7 ) . P r o c . N a t . A c a d . S c i . USA 7 4 , 5 4 5 3 - 5 4 5 7 . 1 0 0 . P . V a l e n z u e l a , A . V e n e g a s , F. W e i n b e r g , R. B i s h o p , a n d W . J . R u t t e r (19/ P r o c . N a t . A c a d . S c i . USA 7 5 , 1 9 0 - 1 9 4 . 1 0 1 . C T . C a s k e y , M. B e a u d e t , a n d M. N i r e n b e r g ( 1 9 6 8 ) . J . M o l . B i o l . 3 7 , 9 9 - 1 1 8 . ~ 1 0 2 . R. D u n n , W . R . A d d i s o n , I . C . G i l l a m , a n d G . M . T e n e r ( 1 9 7 8 ) . C a n . J . B i o c h e m . 56_, 6 1 8 - 6 2 3 . 1 0 3 . F . H . C . C r i c k ( 1 9 6 6 ) . J . M o l . B i o l . 1_9, 5 4 8 - 5 5 5 . 1 0 4 . J . R . P e n s w i c k a n d R.W. H o l l e y ( 1 9 6 5 ) . P r o c . N a t . A c a d . S c i . USA 5 3 , 5 4 3 - 5 4 6 . 1 0 5 . J . R . L i l l e h a u g a n d K. K l e p p e ( 1 9 7 7 ) . N u c l e i c A c i d s R e s . 4 , 3 7 3 - 3 7 9 . 1 0 6 . A . G . B r u c e a n d O . C . U h l e n b e c k ( 1 9 7 8 ) . N u c l e i c A c i d s R e s . 5 , 3 6 6 5 - 3 6 7 7 . 1 0 7 . K. R a n d e r a t h a n d R . C G u p t a ( 1 9 7 9 ) . F e d . P r o c . 3 8 , 4 9 9 ( a b s t r . 1 4 2 0 ) . 1 0 8 . I . M . G l y n n a n d J . B . C h a p p e l l ( 1 9 6 4 ) . B i o c h e m . J . 9 0 , 1 4 7 - 1 4 9 . 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0094654/manifest

Comment

Related Items