Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of Ahi-1 and BCR-ABL in leukemic transformation Kennedy, Sean 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0452.pdf [ 9.29MB ]
Metadata
JSON: 831-1.0093105.json
JSON-LD: 831-1.0093105-ld.json
RDF/XML (Pretty): 831-1.0093105-rdf.xml
RDF/JSON: 831-1.0093105-rdf.json
Turtle: 831-1.0093105-turtle.txt
N-Triples: 831-1.0093105-rdf-ntriples.txt
Original Record: 831-1.0093105-source.json
Full Text
831-1.0093105-fulltext.txt
Citation
831-1.0093105.ris

Full Text

THE ROLE OF AHI-1 AND BCR-ABL IN LEUKEMIC TRANSFORMATION by SEAN KENNEDY B.Sc. St. Francis Xavier University, 2003  A T H E S I S SUBMITTED IN PARTIAL F U L F I L L M E N T O F THE REQUIREMENTS FOR THE D E G R E E OF MASTER OF SCIENCE IN T H E F A C U L T Y O F G R A D U A T E S T U D I E S in (GENETICS)  UNIVERSITY OF BRITISH C O L U M B I A August 2007 © Sean Kennedy 2007  ABSTRACT  Ahi-1 was first identified as an insertional target of Abelson virus in murine leukemias. Subsequently Ahi-1 was shown to encode a protein containing a SH3 domain and multiple WD40 repeats. Certain isoforms of Ahi-1 are upregulated in a variety of human leukemic cells, including primitive leukemic cells from patients with chronic myeloid leukemia. To investigate the types of effects that increased levels of Ahi-1 protein(s) may have on hematopoietic cells (both in the presence and absence of p210 " ), I compared both the biological and BCR  ABL  biochemical properties of several cloned lines of BaF/3 cells that had been transduced with either BCR-ABL or Ahi-1 or both control vectors. Overexpression of Ahi-1 mimicked the effect of BCR-ABL in reducing the growth factor dependence of BaF/3 cells and in enhancing their growth in response to IL-3. The response of the doubly-transduced cells was even greater. However, of these many signalling intermediates surveyed by Western blot analysis, only a few showed significant changes. In cells transduced with Ahi-1 alone and cultured in the presence of IL-3 (but not in the absence of IL-3), STAT5 phosphorylation was increased. SHIP expression was also increased in the same cells but only when they were cultured in the absence of IL-3. In cells that had been co-transduced with BCR-ABL and Ahi-1, both the level and kinase activity of p2i QBCR-ABL pp a  eare(  j enhanced and in these co-transduced cells, the known ability of BCR-ABL  to suppress SHIP expression was dominant over the stimulating effect of overexpressing Ahi-1. Unexpectedly, BCR-ABL transduction of BaF/3 cells strongly upregulated their endogenous Ahi1 expression. Taken together, these preliminary findings are consistent with a model in which Ahi-1 alone can behave as a weak oncogene in hematopoietic cells, and can also co-operate with BCR-ABL to enhance the combined effect achieved.  TABLE OF CONTENTS ABSTRACT TABLE OF CONTENTS LIST OF TABLES LIST OF FIGURES LIST OF ABBREVIATIONS ACKNOWLEDGEMENTS CHAPTER 1 Introduction 1.1 Chronic myeloid leukemia (CML) 1.2 CML and effects of p210 " on various signalling pathways 1.2.1 PI3K/AKT pathway 1.2.2 The Ras/Raf/MEK/ERK pathway 1.2.3 The JAK/STAT pathway , 1.2.4 The N F - K B pathway 1.2.5 The JNK/SAPK pathway 1.2.6 IL-3 pathway 1.3 Ahi-1 and its link to CML and BCR-ABL 1.4 Thesis hypothesis and objectives CHAPTER 2 Materials and Methods 2.1 Cells 2.2 Real time RT-PCR 2.3 Viability assays 2.4 Proliferation assays 2.5 Protein determinations 2.6 Western blot analyses 2.7 Statistical analyses CHAPTER 3 Results 3.1 Characterization of Ahi-1 expression in different clones of Ahi-1 transduced BaF/3 cells 3.2 The effect of forced overexpression of Ahi-1 on control and BCR-v45I-transduced BaF/3 cells in vitro 3.3 Evidence of the co-operatively enhanced expression of Ahi-1 and p210 " proteins in BaF/3 cells 3.4 The effect of Ahi-1 overexpression on various signalling intermediates CHAPTER 4 Discussion REFERENCES APPENDIX A List of antibodies used BCR  BCR  ABL  ABL  ii iii iv v vi vii 1 1 3 3 8 9 10 14 15 21 30 32 32 32 33 33 33 34 36 37 37 41 47 50 56 63 67  LIST OF TABLES Table 1. List of Western blots conducted, and observed effects  51  Table 2. List of antibodies used, along with supplier and phosphorylation site (if applicable)....75  V  LIST OF FIGURES Figure 1. The p210 " oncoprotein and the signalling pathways which it affects BCR  4  ABL  Figure 2. The PBK/Akt signalling pathway and its impact on cell survival  5  Figure 3. Mode of SHIP activation  7  Figure 4. Overview of JAK/STAT signalling  12  Figure 5. The N F K B pathway  13  Figure 6. The JNK pathway in IL-3-dependent cells  17  Figure 7. The IL-3 pathway activates several signalling pathways implicated in cancer Figure 8. Myeloid cell differentiation is controlled by a variety of cytokines Figure 9. Structure of the Ahi-1 protein  19 20 23  Figure 10. Expression of Ahi-1 in primary CML cells is elevated in the most primitive cells.. .26 Figure 11. Expression of the Ahi-1 gene is deregulated in rodent lymphomas  27  Figure 12. Expression of Ahi-1 is highly deregulated in some human leukemic cell lines  28  Figure 13. Overexpression of Ahi-1 induces a lethal leukemia in vivo and this is enhanced when the cells are co-transduced with BCR-ABL 29 Figure 14. Calculated levels of Ahi-1 transcripts (after normalization to Gapdh) in 5 different clones transduced with Ahi-1 Figure 15. Western analysis of Ahi-1 levels in BaF/3 cells transducerd with Ahi-1, BCR-ABL, or both by comparison to control cells when cultured either in the presence or absence of IL-3  38  40  Figure 16A. Viability of BaF/3 cells at varying IL-3 doses  42  Figure 16B. Viability of BaF/3 cells deprived of IL-3  43  Figure 17. H-thymidine incorporation into Ahi-1 and BCR-ABL transduced cells  46  Figure 18. Western analysis of p210 '  48  3  BCR ABL  Figure 19. Western analysis of p210 " BCR  ABL  phosphorylation  Figure 20. Western analysis of STAT5 phosphorylation  49 52  F i g u r e 21.  Western analysis of AKT phosphorylation  F i g u r e 22.  Western analysis of SHIP protein  LIST OF ABBREVIATIONS Abelson murine leukemia virus (A-MuLV) Abelson Helper Integration site (Ahi-1) Abelson breakpoint cluster region-1 gene (BCR-ABL) Abelson gene (c-ABL) Accelerated phase (AP) Acidic-rich (C-rich) Activating transcription factor 2 (ATF2) Anti-c-abl-specific antibody (8E9) APS (adaptor molecule containing pleckstrin homology and SH-2 domains) Bcl2-antagonist of cell death (BAD) Bovine serum albumin (BSA) C-Jun N-terminal protein kinase (JNK) Carboxy fluoroscein succinimidyl ester (CFSE) cAMP Response Element-Binding (CREB) Chronic myeloid leukemia (CML) Chronic phase (CP) Cluster of differentiation molecule (CD) Colony-forming cells (CFCs) Cycle threshold (Ct) Fetal calf serum (FCS) Forkhead transcription factor (FOXO-3) Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) Glycogen synthetase-3 kinase-P (GSK-3P) Granulocyte-macrophage colony stimulating factor (GM-CSF) Green fluorescence protein (GFP) Growth factor receptor bound protein-associated binder (GAB) Hematopoietic stem cell (HSC) Interleukin-3 (IL-3) IKB kinase (IKK) Inhibitors of apoptosis (IAPs) Janus family tyrosine kinase (JAK) Lineage-marker-negative (lin~) Lithium Dodecyl Sulfate (LDS) 2-mercaptoethanol (2-ME) Mitogen-activated protein kinase (MAPK) Mitogen-activated protein kinase (MAPK) Murine stem cell virus internal ribosome entry site (MSCV-IRES) Myeloblastosis oncogene (myb) Myelocytomatosis oncogene (c-Myc) Myeloid blast crisis (BC) Normal bone marrow (NBM) NP-40 (nonyl phenol ethylene oxide) Nuclear factor-KB (NFKP) p62 ternary complex factor (Elk-1) Philadelphia chromosome(Ph)  Phenylmethanesulphonylfluoride (PMSF) Phosphatidylinositol-dependent kinase (PDK-1) Phosphatidylinositol-3,4,5-trisphosphate [Ptdlns (3,4,5)P3] Phosphatase and tensin homologue (PTEN) Phosphate buffered saline (PBS) Phosphoinositol-3 kinase (PI3K) Polyvinylidene fluoride (PVDF) Proline-rich (P) Reverse transcriptase polymerase chain reaction (RT-PCR) Sarcoma tyrosine kinases (SRC) Serine/threonine-specific protein kinase (AKT) Short hairpin ribonucleic acid (shRNA) Signal transducer and activator of transduction molecules (STATs) Src homology2 (SH2) Src homology 3 (SH3) Src homology 2-containing inositol phosphatase (SHIP) Src homology protein tyrosine phosphatase 2 (SHP2) Standard error of the mean (SEM) Tris-Buffered Saline Tween-20 (TBST) Transforming growth factor-P (TGF- P) Tritiated thymidine ( H) Tumour-necrosis factor (TNF) Vascular endothelial growth factor (VEGF) Yellow fluorescence protein (YFP) 3  ACKNOWLEDGEMENTS I would like to thank the following people for their support on this project:  Connie Eaves Allen Eaves Xiaoyan Jiang Kyi Min Saw Leon Zhou  Special thanks to:  Rob Kay James Kennedy Margaret Kennedy David Kent Sarah Otto Mark Romanish Jens Ruschmann  I would also like to thank the National Science and Engineering Research Council for awarding me a two year Post Graduate Scholarship.  1  CHAPTER 1 INTRODUCTION  1.1. Chronic myeloid leukemia (CML) Hematopoiesis refers to all aspects of the hierarchally organized process of blood cell production. At least 10 different types of mature blood cells are now recognized - all of which trace their origin throughout life to a common hematopoietic stem cell (HSC) population (Eaves and Eaves 2004). The U.S. National Cancer Institute defines leukemia as cancer that starts in blood-forming tissue such as the bone marrow, and causes large numbers of blood cells to be produced and enter the bloodstream. Biologically, leukemia is viewed as a deregulated clone of hematopoietic cells that expands progressively, typically involving changes in the lineagespecific maturation processes and commonly leading to the rapid or eventual death of the host, depending on the mechanism of leukemogenesis. In fact, the term includes a large group of blood cancers that are subdivided into clinically and biologically distinct categories according to the cell types involved and the underlying genetic alteration responsible for generating and sustaining the leukemic population (Look 1997). All leukemias are thought to arise from clonally accumulated mutations that impact on the processes that normally control the production and differentiation of the different blood cell types. Because these mutations usually occur at very low frequencies, a large number of divisions is required for their successive acquisition. As a result, it is likely that the first leukemogenic mutations take place in HSCs because of their greatest proliferative ability (Eaves and Eaves 2004). The same arguments predict that the initial mutations confer a growth advantage to the affected cells leading to an expanded reservoir in which later mutations that perturb hematopoietic cell differentiation are more likely to arise (Sawyers 1999).  CML is an example of a myeloid leukemia in which these different steps can be readily investigated because the patients are typically diagnosed at an early stage (referred to as the chronic phase) when only a single genetic change is evident (Eaves and Eaves 2003). This was first recognized as a unique cytogenetic abnormality, the Philadelphia (Ph) chromosome (Sawyers 1999). Later the Ph was shown to reflect a rearrangement between the breakpoint cluster region-1 gene (BCR-1) on chromosome 22, and the Abelson gene (c-ABL) on chromosome 9 (Sawyers 1999). Most often the BCR-ABL fusion gene thus created encodes a 210 kDa oncoprotein (p210 " ) that displays at least 2 features that are important to its BCR  ABL  leukemogenic activity: a constitutively activated tyrosine kinase activity and an abnormal location primarily in the cytoplasm rather than in the nucleus (Figure 1) (Druker 1996). The Ph chromosome and underlying BCR-ABL fusion gene can be used to diagnose patients with CML, as they are detected in all of the leukemic cells, which include erythroid, megakaryocytic and Blineage cells as well as granulopoietic cells (Whang et al. 1963; Rastrick and Gunz 1968). In the chronic phase of CML, there is usually an excessive production of granulocytes that appear both morphologically and functionally normal. Later, additional genetic alterations are acquired that cause progression of the disease to a blast crisis phase that is untreatable and hence rapidly fatal. This terminal blast crisis phase is characterized by the emergence of an acute leukemic subclone in which myeloid differentiation is blocked and blasts accumulate in high numbers in the blood and marrow (Look 1997). This multi-step nature of the leukemogenic process highlights the importance of identifying all mutated or epigenetically altered genes involved and then characterizing their individual contributions to the deregulated growth and perturbed differentiation typical of the particular leukemias in which specific gene alterations are found.  1.2.  CML and effects of p 2 1 0  B C K A B L  on various signalling pathways  Numerous signalling pathways involved in regulating cell growth and apoptosis have been implicated in CML due to interactions of known signalling intermediates with the cytoplasmically located p210 " . These include effects on phosphoinositol-3 kinase (PI3K), BCR  ABL  the Akt serine/threonine kinase, mitogen-activated protein kinase (MAPK), the Janus family tyrosine kinase (JAK), the signal transducer and activator of transduction molecules (STATs), CJun N-terminal protein kinase (JNKVSAPK and nuclear factor-KJ3 (NFK|3) (Clarkson 2003). Many of these signalling intermediates are also affected by interleukin (IL)-3 activation of the IL-3 receptor (Clarkson 2003). 1.2.1. The PBKJAktpathway. PI3K is a lipid kinase that consists of an 85 kDa regulatory  subunit containing SH2 and SH3 domains, and a 110 kDa catalytic subunit. Activated PI3K phosphorylates the membrane lipid phosphatidylinositol (4,5)-bisphosphate to produce phosphatidylinositol (3,4,5)-tris-phosphate (Figure 2). The lipid products of PI3K serve to localize and activate additional downstream signal transduction molecules in the vicinity of the cell membrane. For example, phosphatidylinositol-dependent kinase (PDK-1) is translocated to the cell membrane through its lipid binding pleckstrin homology domain, where it is phosphorylated, in turn activating AKT (Shelton et al. 2003). It has been suggested that the PI3K signalling pathway, already known to be activated and important for BCR-ABL-mediated transformation, is also modified by the SH2-containing inositol phosphatase (SHIP) (Hunter and Avalos 1998). SHIP is a 145-kDa SH2-containing inositol phosphatase that is uniquely expressed in hematopoietic cells. When these are activated via many receptors leading to phosphorylation of the She adaptor protein, SHIP binds to She and is brought to the cell membrane where it selectively hydrolyzes the 5'-phosphate from inositol-  4  Figure 1. The p210 " BCR  ABL  oncoprotein and the signalling pathways which it affects. These  pathways include the RAF/MEK/ERK, JNK/SAPK, JAK/STAT and PI3K pathways, which are thought to be involved in inhibition of apoptosis, proliferation and growth factor independence of hematopoetic cells (Reproduced from Biocarta 2007).  Figure 2. The PI3K/Akt signalling pathway and its impact on cell survival. Activated Akt promotes cell survival, inhibiting apoptosis by phosphorylation of the Bad component of the Bad/Bcl-XL complex. Phosphorylated Bad binds to 14-3-3 causing dissociation of the Bad/BclX L complex and allowing cell survival. Akt can also promote cell survival by activating IKK-a, ultimately leading to NF-kb activation and cell survival. (Reproduced from Biocarta 2006).  1,3,4,5-tetraphosphate and phosphatidylinositol-3,4,5-trisphosphate [Ptdlns (3,4,5)P3] (Figure 3) (Liu, et al. 1994). Loss of SHIP by gene targeting in mice leads to a myeloproliferative syndrome (Sattleret al. 1999) and SHIP protein levels are decreased by the BCR-ABL oncoprotein in hematopoietic cell lines transduced with BCR-ABL through a BCR-ABL kinasedependent mechanism as seen in Figure 23, and reported in Sattler et al. 1999. This has implicated phosphatidylinositol pathway regulation as an important aspect of the clonal expansion that occurs in CML. In primary CML samples, SHIP was found to be expressed at reduced levels in later cells, whereas p85 PI3K and the tyrosine phosphatase Src homology protein tyrosine phosphatase 2 (SHIP2) expression appears unaffected (Sattler et al. 1999). The expression and tyrosine phosphorylation of the SHIP-related protein, SHIP2, are not changed in CML cells (Wisniewski et al.1999). However, although SHIP2, like SHIP, has Ptdlns (3,4,5)P3  specific 5'-phosphatase activity, it is unlikely that the activities of SHIP2 and SHIP are redundant, since SHIP"" mice have a severe hematopoietic phenotype (Wisniewski et al.1999). 7  The mechanism whereby loss of SHIP expression causes a myeloproliferative disease is unknown. A reasonable hypothesis, however, is that SHIP normally modulates levels of inositol lipids formed in response to activation of PI3K and related enzymes (Damen et al. 1998). It is also important to note that more recent studies have shown that SHIP expression is not reduced in primitive leukemic cells from chronic phase CML patients, suggesting that modulation of SHIP activity is restricted to the deregulated production of the later stages of leukemic cells and may not play a significant role in the CML stem cell population (Jiang et al.2002).  7  IL-3  ^PI-3,4,5-P ^  ll  J|  I  3  Ma)  \ :ri» PIC-r * ~ Blk P0K1 — " AM  \  PKC»  / / no* \ \ ' 1 \ /  V«w v  N  Ca*"  \  \  GSKJ  i-VW x * X  NPNY.  NPLY  I SHIP  ISH2 !  SAO FKMR  «rTOy  call  cell  into Suisse  swvnral  nwrphoiogy »« migration  *grarmla(iO!»  l£HJ  Figure 3. Mode of SHIP activation. First, a growth factor (e.g. IL-3) stimulates the Jak2mediated tyrosine phosphorylation of the  PIL-3 subunit of the  IL-3R at Y . This then attracts 577  She via its phosphotyrosine binding domain. She is then tyrosine phosphorylated by Lyn or JAK2, primarily at Y  2 3 9 a n d3 1 7  and this attracts SHIP via its SH2 domain to the cell membrane.  There, SHIP hydrolyzes the PI3K-generated PI-3,4,5-P to PI-3, 4-P , and this curtails PI-3,4,53  2  P3-mediated activation of multiple pathways (Figure reproduced from Sly et al. 2003 ).  8 The lipid phosphatase known as phosphatase and tensin homologue (PTEN) switches off the activation of Akt by hydrolyzing PI-3,4,5-P3 back to PI-4,5-P2, which then prevents the membrane localization of Akt (Aggerholm et al.2000). PTEN is also reported to block N F - K B activation without affecting the IKB degradation pathway (Aggerholm et al. 2000). Approximately 50% of human cancers contain biallelic inactivating mutations of PTEN, indicating the importance of these phospholipid phosphatases in regulating cell growth. However, an analysis of 10 patients with CML revealed no mutations suggesting that mutations in PTEN are infrequent in CML (Aggerholm et al. 2000). L2.2. The Ras/Rqf/MEK/ERKpathway. This signal transduction cascade is often induced after  receptor complex ligation by mitogens or growth factors (Cox and Der 2003). Ras is a member of multiple signal transduction pathways, activating both the PI3K/Akt and the Raf/MEK/ERK pathways. Certain Ras isoforms have different effects on PI3K and Raf activation. Multiple events are involved in the activation of the Raf proteins. Ras induces the translocation of the Raf protein to the cellular membrane where it may be phosphorylated on tyrosine residues by activated Src family kinases and a variety of serine/threonine kinases, including p21 -activated kinase, protein kinases A and C and Akt. Downstream of the Raf proteins is MEK1, a dual serine/threonine and tyrosine kinase (Cox and Der 2003). MEK transmits the signal further to the extracellular regulated serine/threonine kinases ERK1 and ERK2, and these, in turn, phosphorylate the p90 ribosomal S6 kinase (p90 ) and other Cyclic adenosine monophosphate Rsk  Response Element-Binding (CREB) kinases (Steelman et al. 2004). p90 is activated by ERK Rsk  and PDK1, and it phosphorylates Bad and CREB. ERK and CREB kinases phosphorylate certain transcription factors including Elk and CREB which enter the nucleus to regulate gene  9  transcription (Shelton et al. 2003). Therefore, the Ras/Raf/MEK/ERK cascade can transduce signals originating from the activation of membrane receptors to alter DNA transcription. 1.2.3.  The JAK/STATpathway. This pathway also transfers signals from activated membrane  receptors to the nucleus. Ligation of the receptors causes the JAKs to cross phosphorylate each other and then, the JAKs thus activated, immediately target the cytoplasmic portions of the receptors and receptor-associated proteins. The tyrosine phosphorylated sites become docking elements for SH2 and phosphotyrosyl binding domain-containing proteins present in the membrane or the cytoplasmic compartment, notably the STATs, which go on to interact with regulatory elements in the nucleus (Sadowski et al. 1993). The STATs are a family of latent cytoplasmic transcription factors involved in cytokine, hormone, and growth factor-initiated signal transduction. These proteins are involved in regulating cell growth, differentiation, apoptosis, fetal development, transformation, inflammation, and immune responses. In addition, STAT signalling plays a key role in the regulation of normal hematopoietic stem cell self-renewal (Abell and Watson 2005), later stages of herhatopoiesis and in BCR-ABL-mtdiated leukemogenesis in both transduction models and primary CML cells. Deregulation of STAT signalling pathways, particularly STAT3 and STAT5, contributes to malignant cellular transformation by two distinct mechanisms: constitutive activity of the fulllength molecule and expression of a c-terminally mutated one. Constitutive activation of STAT proteins has been reported in a number of malignant cell lines and human cancers, and is thought to be transformed by the oncogenic v-Src tyrosine kinase (Benekli et al. 2003). Interaction of the STAT pathway with other signalling pathway(s) from the hematopoietic growth factor receptor, e.g., the mitogen-activated protein (MAP) kinase pathway, may also play a role in oncogenesis.  10  STAT5 activity has also been found to play an important role in BCR-ABL-induced resistance to apoptosis (Sadowski et al. 1993). Recently, RNAi-mediated reduction of SHP2, STAT5, and Gab2 protein expression was reported to inhibit BCR-ABL-  but not cytokine-dependent  proliferation in a dose-dependent manner (Scherr et al. 2006). Also, colony formation by primary CML colony-forming cells (CFCs) - but not by normal CFCs was specifically reduced by inhibition of SHP2, STAT5, and Gab2 expression. In addition, co-expression of both antiBCR-ABL  and anti-SHP2 shRNAs from a single lentiviral vector produced stronger inhibition of  colony formation as compared to either shRNA alone (Scherr etal. 2006).  1.2.4. The NF-KB pathway. Normally, N F - K B (a p65-p50 or p65-p52 heterodimer) is  sequestered in the cytoplasm, owing to the binding of IKB to the nuclear-localization sequence of the p65/RELA N F - K B protein. Activating signals lead to the phosphorylation and ubiquitination of  IKB  and its degradation by the 26S proteasome, thereby freeing the N F - K B complex to move  to the nucleus and bind specific DNA promoter sequences (Richmond 2002). The activation of NF-KB  often occurs as a consequence of activation of chemokine receptors (Inoue et al. 2007).  Chemokines are small peptides that regulate the transport, activation and proliferation of several cell types, including myeloid cells. The expression of various chemokines is induced by several cytokines, such as tumour-necrosis factor (TNF), through a NF-KB-mediated event or by interferon-y through the JAK/STAT pathway. The transcription of chemokine genes is often inhibited by transforming growth factor-P (TGF- P). The activation of N F - K B induces the transcription of inhibitors of apoptosis, as well as factors that are associated with tumour angiogenesis, metastasis and growth, and blocking the activity of NF- KB targets tumour cells for apoptosis. Several tumour systems have been shown to have constitutive activation of N F - K B . This enhanced N F - K B activity is thought to allow tumour cells to constitutively express both  11  angiogenic and angiostatic chemokines, cytokines such as vascular endothelial growth factor (VEGF), IL-1 and IL-6. For example, the expression of chemokine (C-C motif) ligand in melanoma and breast cancer has been shown to correlate with the metastatic capacity of the tumour (Richmond 2002).  12  JAK/STAT signal transduction  Figure 4. Overview of JAK/STAT signaling. Ligand-induced phosphorylated tyrosines on the tail of the receptor serve as docking sites for the Src Homology-2 (SH-2) domain of the STAT protein, and JAK catalyzes the tyrosine phosphorylation of the receptor-bound STAT, followed by translocation of the STAT dimer to the nucleus. Once the activated transcription factors reaches the nucleus it binds to consensus DNA-recognition motif called gamma activated sites in the promoter region of cytokine inducible genes and activates transcription of these genes (Reproduced from Abell 2005).  13  Nature tovtews | Immumslosy  Figure  5.  The  NFKB  pathway. Activation of chemokine receptors such as TNFa and Toll-like  receptors lead to the phosphorylation and ubiquitination of IKB and its degradation by the 26S proteasome, thereby freeing the N F - K B complex to move to the nucleus and bind specific DNA promoter sequences which increase cell proliferation (reproduced from Richmond 2002).  14  1.2.5. The JNK/SAPK pathway.  JNK belongs to the MAPK superfamily and was originally  identified by its ability to specifically phosphorylate the transcription factor c-Jun on its Nterminal transactivation domain at two serine residues, Ser63 and Ser73 (Liu et al. 2005). Subsequent studies have shown that JNK also phosphorylates and regulates the activity of other transcription factors, including ATF2, Elk-1, p53 and c-Myc (Liu et al. 2005). Activation of JNK is mediated by a MAP kinase module, through sequential protein. JNK activity is also regulated by protein phosphatases, scaffold proteins such as JIP, P-arrestin and JSAP1, and NFK (Karin and Greten 2005). JNKs are key regulators of many cellular events, including apoptosis. In the absence of activation, prolonged JNK activation contributes to TNF-a-induced apoptosis (Liu et al.  NF-KB  2005). JNK is also essential for ultra violet (UV) light- induced apoptosis (Karin and Greten 2005). The key evidence indicating JNK induces apoptosis came from the observation that jnkY ''jnkl' ' 1  mice were resistant to UV-, anisomycin and methyl methanesulfonate-induced DNA  damage. However, JNK may also function as a modulator to break the brake on apoptosis, rather than as a genetic component of the apoptotic machinery to induce apoptosis. The best example of this is in the regulation of TNF-a-induced apoptosis by JNK activation (Liu et al. 2005). TNF-a is a pro-inflammatory cytokine, that exerts its biological functions by activating multiple downstream signalling pathways, including caspases, IKB kinase (IKK) and JNK. IKK activation inhibits apoptosis via the transcription factor N F - K B , whose target genes include the inhibitors of apoptosis (IAPs) family (Liu et al. 2005). Thus, TNF-g does not typically induce apoptosis unless N F - K B activation is inhibited. In addition to inhibiting caspase activation, N F K B negatively regulates TNF-a-induced activation of JNK (Liu et al. 2005). Although the  15 mechanism by which N F - K B inhibits JNK activation is still elusive, it is clear that  NF-KB-  mediated inhibition on JNK activation is critical for cell survival. Interestingly, recent studies reveal that JNK can suppress apoptosis in IL-3-dependent hematopoietic cells via phosphorylation of the pro-apoptotic Bcl-2 family protein BAD (Figure 5).  The phosphorylation results in reduced association of BAD with BCL-xL, thereby  suppressing apoptosis. Thus, JNK has pro- or anti-apoptotic functions, depending on the cell type, nature of the death stimulus, duration of its activation and the activity of other signalling pathways. 1.2.6. IL-3 pathway. IL-3 is a broadly acting cytokine that acts on multiple types of  hematopoietic cells at different stages of differentiation. IL-3 exerts its biologic activity through interaction with a specific cell surface receptor that consist of two subunits (a and P). These form a high-affinity receptor complex that transduces proliferative, anti-apoptotic and differentiation promoting signals (Figure 6). IL-3 receptor binding activates at least 3 downstream pathways in hematopoietic cells: the JAK/STAT, MAPK and the PI3-K pathways (Martinez-Moczygemba and Huston 2003). Activation of cytosolic tyrosine phosphatases controls the level of ligand-induced phosphorylated substrates through a negative feedback mechanism. SHP1 is involved in downregulating p chain activation because its overexpression results in suppression of cell growth in response to IL-3 (Testa et al. 2004). IL-3 can also synergize with other growth factors to stimulate many types of hematopoietic cells (Figure 8). For example, IL-3 synergizes with IL5 and granulocyte-macrophage colony stimulating factor (GM-CSF) to stimulate the differentiation and function of myeloid cells. However, IL-3, but not IL-5 or GM-CSF, prevents basophil apoptosis in vitro through the activation of the PI3-K pathway (Martinez-Moczygemba  16  and Huston 2003). IL-3 also promotes stem cell factor-induced mast cell differentiation in vitro in a dose-dependent manner (Testa et al. 2004).  17  DEATH  Figure 6. The JNK pathway in IL-3-dependent cells. Activation of JNK suppresses apoptosis via phosphorylation of the pro-apoptotic Bcl-2 family protein BAD. The phosphorylation of BAD reduces its association with BCL-xL, thereby suppressing apoptosis. (Figure reproduced from Liu et al. 2005).  18 In vitro, IL-3 also plays an important role in the growth and differentiation of CD34  +  progenitor cells into basophils and mast cells, myeloid-derived dendritic cells and nonmyeloidderived dendritic cells, and, to a lesser extent, eosinophils and monocytes-macrophages (Martinez-Moczygemba and Huston 2003). Interestingly, when the IL-3 gene or its alpha receptor subunit gene is disrupted no significant alteration of basal hematopoiesis is seen (Martinez-Moczygemba and Huston 2003). Although not normally expressed by B cells, the IL-3a receptor is present at higher than normal levels on circulating B-lineage cells in approximately 40% of patients with B cell-acute lymphocytic leukemia or acute myeloid leukemia. Furthermore, the increased expression of the IL-3a receptor is associated with enhanced blast proliferation, increased cellularity, and a poor prognosis. (Testa et al. 2004).  19  Figure 7. The IL-3 pathway activates several signalling pathways implicated in cancer, such as the the RAF/MEK/ERK, SHIP, and JAK/STAT pathways. (Figure reproduced from Biocarta 2006).  20  SCF, IL-3, IL-S  U « : Cell  GM-CSF  L4, GM-CSF, IL-1, *••* • »  cS» X +  PK>9*r*if  X  GM-CSF n_.j  | 4 mm  GM-CSF I 1.-71  G-CSF, GM-CSF  PwMiiCiia  ••  ii-s, meat , o 1  Pttjgmlat  M-CSF, mem,  IL4  0*  Eosinophil  NrtKfNI  M> DeodrneCW-1 (IL.1S"-.TH1» («.•«»>-TH2|  Figure 8. Myeloid cell differentiation is controlled by a variety of cytokines, including IL-3, IL5 and GM-CSF. (Figure reproduced from Martinez-Moczygemba and Huston 2003).  21  1.3. Ahi-1 and its link to CML and BCR-ABL Abelson murine leukemia virus (A-MuLV) is a highly lymphomagenic, replicationdefective murine retrovirus. The A-MuLV genome harbors the oncogene v-abl, which is essential for its transforming potential (Poirier et al. 1988). However, when A-MuLV is inoculated into neonatal mice, it induces primarily nonthymic clonal or oligoclonal pre-B-cell lymphomas several months later. This suggested that the expression of v-abl alone was not sufficient to fully transform pre-B cells and that another rare genetic event was required (Poirier et al. 1988). In addition, helper-free stocks of A-MuLV were found to be inefficient in inducing disease in several strains of mice, again suggesting that the introduction of v-abl into pre-B lymphoid cells on its own was not sufficient to cause their malignant transformation (Poirier et al. 1988). It was also found that both the in vivo leukemogenicity and the efficiency of in vitro transformation of hematopoietic cells by replication-defective A-MuLV were affected by the presence of a replication-competent helper Moloney virus present in A-MuLV stocks (Hines and Gragowski 1983). This virus is an efficient helper for A-MuLV replication but does not itself appear to directly contribute to the transformation of the target cell in vivo (Hines and Gragowski 1983). Molecular cloning of cellular sequences adjacent to inserted Moloney proviruses was used to identify a commonly affected site of insertion, the so-called Abelson Helper Integration site (Ahi-1). This region was found to be a locus of Moloney helper provirus integration in 16% of Abelson-induced pre-B-cell lymphomas, significantly exceeding the frequency expected for random integrations (Poirier et al. 1988). This finding suggested that A-MuLV-infected lymphoid cells carrying a Moloney provirus in Ahi-1 had acquired a growth advantage in vivo and were thus more likely to emerge as a malignant clonal outgrowth. Ahi-1 was mapped to mouse chromosome 10 and then by long-range restriction mapping found to be within 120 kb of,  22 the myb gene (Ganter 1999). Later it was shown that Ahi-1 is 35 kbp downstream of myb (Jiang et all994). However, no effect on myb expression was found in A-MuLV-induced lymphomas with Ahi-1 insertions. This then led to the search for another gene in the Ahi-1 locus that might be the responsible gene (Jiang et al.1994). The Ahi-1 gene was thus subsequently identified (Jiang et al.2002). Most of the Moloney helper proviral insertions were localized to the 3' end of Ahi-1 in an inverse transcriptional orientation, primarily near and downstream of the last exon of Ahi-1, although some inserts were found within various introns. Cloning of the Ahi-1 cDNA showed that it encodes a 1047 amino acid protein with a number of putative protein-binding sites including a SH3 (Src homology 3) domain, a WD40-repeat domain and nine SH3 binding sites (Figure 9) (Jiang et al.2002).  23  Figure 9. Structure of the Ahi-1 protein. Ahi is a 1047 amino acid protein with a number of putative protein-binding sites including one SH3 domain, 7 WD40 repeats, an acidic-rich (Crich) domain and 9 proline-rich (P) putative SH3 binding sites (Hunter 1998). Ahi-1 also harbors two potential tyrosine phosphorylation sites known to bind specifically to SH2 domains. These unique characteristics make Ahi-1 a possible signalling intermediate that could interact with BCR-ABL. The proline-rich sites were initially found to bind specifically to the SH3 domain of  ABL (Cicchetti et al. 1992). Interaction with other SH3-containing proteins has been reported for Src, and could be possible with Ahi-1. (X. Jiang, personal communication).  24  SH3 domains are often found in proteins containing SH2 domains and are known to bind to proline-rich motifs and to mediate specific protein-protein interactions (Pawson and Gish 1992; Schlessinger 1994; Mayer 2001). This binding to proline-rich ligands occurs with moderate affinity and selectivity with preferential binding to PxxP motifs. SH3 domains play a role in the regulation of enzymes by intramolecular interactions, changing the subcellular localization of signal pathway components and mediation of multiprotein complex assemblies (Mayer 2001). WD40-repeat domains werefirstidentified in the (3-subunits of G-proteins (Neer et al. 1994). A large number of WD40-repeat-containing proteins have now been identified (Neer et al. 1999).  These proteins have been implicated in multiple diverse aspects of cellular  metabolism and have recently been suggested to be involved in assembling and remodeling of chromosomal proteins (Henikoff 2003; Hennig et al. 2003). They have also been associated with several inherited diseases, such as Cockayne syndrome, Triple-A syndrome and lissencephaly (Li 2001). WD40 domains have also been found to cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. The domain typically contains a GH dipeptide 11-24 residues from its N-terminus and the 40 residue WD dipeptide at its C-terminus, hence the name WD40. It serves as a stable platform to which proteins can bind either stably or reversibly and forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel Psheet (Smith et al.1999). It is noteworthy that Ahi-1 is the only protein thus far identified to contain both WD40 repeats and a SH3 motif. Gene expression analyses of murine pre-B- and T-cell leukemic cells with insertional mutations in Ahi-1 have shown both increased expression of Ahi-1 and expression of truncated Ahi-1/viral fused transcripts, including splice variants in which the SH3 domain was deleted  25  (Jiang et al. 2002). A recent study showed that Ahi-1 transcript levels are normally downregulated during both early murine and human hematopoietic cell differentiation and are highly increased in several sources of human leukemic cells, including primary lineage-markernegative (lin") CD34CD38" cells from patients with CML (Figure 10) as well as several human +  leukemic cell lines (Jiang et al.2004). Deregulated expression of Ahi-1 has also been detected in murine leukemic tissues (Figure 11). This phenomenon is not exclusive to mice and rats, (Figure 12) human leukemic cell lines such as K562, Hut 78 and Hut 102, also show deregulation ofAhi1 transcripts (Jiang et al. 2004). Finally, the results of injecting NOD/SCID mice with cells with Ahi-1 transduced BaF/3 cells shows the in vivo leukemogenic properties of these cells but with a moderately long (70day) latency before death (Figure 13). In the same experiments, 5Ci?-^5I-transduced cells displayed a 45-day latency, and mice transplanted with cells transduced with both Ahi-1 and BCR-ABL survived for only 30 days (personal communication with X. Jiang). These results suggest that downregulation of Ahi-1 expression is an important step in normal hematopoietic cell differentiation and that perturbation of its expression may contribute to the development of leukemia.  26  Figure  10. Expression of Ahi-1 in primary CML cells is elevated in the most primitive cells.  Figure reproduced from Jiang et al.(2004) showing absolute Ahi-1 transcript levels calculated from real-time reverse transcriptase (RT) -PCR analyses of RNA isolated from FACS-purified lin"CD34CD38", lin"CD34CD38, lin"CD34, and linCD34" normal bone marrow (NBM, n =4) +  +  +  +  +  and CML cells in chronic phase (CP, n = 18), accelerated phase (AP, n = 8), and myeloid blast crisis (BC, n = 2). The mean levels of Ahi-1 expression in each population are indicated by the horizontal bars.  27  v-abl-mduced Pre-B Lymphomas  Moloney MuLV-induced Thymomas in MMTV/Myc Rat Thymomas Transgenic Mice  <c o —  i££ N  KB  5.0-  n <s  "4-  •  Kearr: — + + + + _ + +  3 3s 5.0  m% m% f A A M f t l 1 2 3 4 5 6 7 8 9 10 11  1  jt Ii  Kb  -  t  j I  4.2 -  »+ --  - 31 -  I a  7  4.2 — •  2.0-  2.0 —  u-  Rearr:  Rearr:  + —  +  iss — 4^4fc4fe4£ 12  3  4  12  3 4  Figure 11. Expression of the Ahi-1 gene is deregulated in rodent lymphomas. This figure shows  the presence of full-length and truncated versions of Ahi-1 transcripts in v-abl induced pre-B lymphomas, MuLV-induced rat thymomas, and thymomas in mouse mammary tumor virus/myc transgenic mice. The arrows on top indicate full-length Ahi-1, and arrows on the bottom indicate truncated versions (isoforms). (Figure reproduced from Jiang et al. 2002).  28  Figure 12. Expression of Ahi-1 is highly deregulated in some human leukemic cell lines. This  figure shows the increased number of Ahi-1 transcripts in K562, Hut78 and Hutl02 relative to normal human bone marrow and other leukemic cell lines, as listed on the X axis. The black arrows on top indicate full-length Ahi-1, and the lower arrows indicate truncated versions (isoforms) of Ahi-1. (Figure reproduced from Jiang et al.2004).  29  Days Post-transplant  Figure 13. Overexpression of Ahi-1 in BaF/3 cells causes them to produce a lethal leukemia in vivo and this is enhanced when the cells are co-transduced with BCR-ABL. Upon transplant of cells into murine hosts, mice injected with cells transduced with Ahi-1 alone survived for an average of 70 days, while mice transplanted with BCR-ABL alone survived only 40 days. Finally, mice transplanted with cells over expressing a combination of Ahi-1 and BCR-ABL survived for an average of only 30 days. Increased spleen size (splenomegaly) due to the accumulation of myeloid cells during leukemic blast crisis was also seen in mice injected with transduced cells (X. Jiang, personal communication).  30 1.4. Thesis objectives and hypotheses The overall aim of this project was to investigate the transforming properties of Ahi-1 as a potential contributing oncogene in the development of leukemia. To perform these studies, I chose to examine the specific effects of forced overexpression of Ahi-1, either alone or in cooperation with BCR-ABL, in the normally IL-3-dependent murine hematopoietic BaF/3 cell line model (Palacios 1984). My overall hypothesis was thai Ahi-1 can alter the growth of BaF/3 cells by altering the expression and or phosphorylation of signalling intermediates that normally are activated by IL-3 and/or perturbed in 5Ci?-^15L-expressing cells. The specific aims addressed were as follows: 1. To determine whether expression of Ahi-1 enhances the altered growth of BCR-ABLexpressing hematopoietic cells.  2. To determine what effect expression of BCR-ABL in hematopoietic cells has on the expression of endogenous Ahi-1.  3. To determine whether expression of Ahi-1 will further alter either the expression or the phosphorylation status (or both) of signalling proteins that are also affected by expression of BCR-ABL.  The biological endpoint assessed was cell growth and its IL-3 dependence. Effects on signalling pathways were examined by comparing the levels and phosphorylation status of various signalling pathway members using specific antibodies and immunoblotting. By correlating the biological and molecular findings, I hoped to determine whether BCR-ABL and Ahi-1 co-operate in enabling hematopoietic cells to by-pass their normal factor dependence for  31  cell survival and growth, and to identify potential pathway perturbations that might be responsible for these effects. The specific studies undertaken were: 1. To characterize the level of Ahi-1 transcripts and protein in BaF/3 cells transduced with - an Ahi-1 cDNA. 2. To investigate the effects of Ahi-1 overexpression on the growth and factor-dependence of BaF/3 cells and in BaF/3 cells also expressing BCR-ABL. 3. To determine whether changes in the activity of various signalling intermediates known to be affected by IL-3 and/or BCR-ABL activity are altered by Ahi-1 overexpression alone and/or whether such effects are exacerbated in 5Ci?-^4BZ,-transduced BaF/3 cells that have also been transduced with Ahi-1.  32 CHAPTER 2 MATERIALS AND METHODS 2.1. Cells  BaF/3 cells, an IL-3-dependent pro-B cell line (Palacio 1984) and polyclonal as well as clonal derivatives transduced either with a murine stem cell retroviral BCR-ABL-IRES-green fluorescence protein (GFP) vector with a Ahi-1-IRES-yellowfluorescenceprotein (YFP) vector,  or both, or control GFP or YFP vectors (MIG and MIY, respectively) were obtained from Dr. X. Jiang. These,cells were maintained in suspension cultures in RPMI 1640 plus 10% heatinactivated fetal calf serum (FCS), 10" M 2-mercaptoethanol (2-ME) and 5 ng/mL murine 4  recombinant IL-3 (StemCell Technologies, Vancouver, BC). Two different clonal cell lines were used per construct, in order to reduce the chance that any trends observed were unique features of a particular cell line rather than consistent downstream effects of overexpression of the constructs used.  2.2. Real-time RT-PCR  Total RNA was extracted using TRIzol (Invitrogen, Burlington, ON). An additional step was added whereby cells were passed through a needle approximately 10 times after TRIzol was added in order to make lysis more efficient. To perform real time RT-PCR analyses, 500 ng of RNA were reverse transcribed with random hexamers in a 20 uL volume using the Invitrogen Superscript II RNase H- Reverse Transcriptase Kit (Invitrogen). Real-time PCR was conducted using 12.5 uL SYBR Green Master Mix (Qiagen, Missisauga, ON), 1 pL of 20 pM specific primers, 1 to 2 pL of cDNA, and water to a volume of 25 uL. Amplicons were less than 150 bp in length. Primer pairs were Ahi-1 3,4 (5'CTGTCACAGAGGTGATACGTTC3' and 5'GACTGTTGTGAGGAAACTGGTG3'), Ahi-1 5,6 (5'GCCGAGATAGCCCGGTTTATC3'  33 and 5' TCAGTTCGGTGAATGTAAACTCC3'), and GAPDH (5'CTTCTCCATGGTGGTGAAGAC3' and 5'CCCATCACCATCTTCCAGGAG3'). Primer set Ahi-1 5,6 is specific to an N terminal region, while Ahi-1 3,4 is specific to a more C terminal sequence. Reaction conditions were 50 cycles of 2-step PCR (95°C for 15 seconds, 60°C for 60 seconds) with a hot start at 95°C for 10 minutes. Fluorescence data was collected at the second step. Following the reaction, cycle threshold (Ct) values were obtained from the exponential phase of the PCR. Relative expression was determined byfirstnormalizing the Ct values ofAhi1 to that of glyceraldehyde-3-phosphate dehydrogenase (Gapdh).  2.3. Viability assays „, Viable cell concentrations were determined by counting the number of cells excluding trypan blue in a hemacytometer chamber. To initiate each experiment, 3 x 10 viable, log-phase, 5  washed BaF/3 cells were suspended in 3 mL RPMI 1640 plus 10% FCS and 10" M 2-ME and 4  then placed into the individual wells of a 6-well plate with various concentrations of IL-3, as indicated. The cells were incubated for varying periods at 37°C and periodically a 10 uL aliquot was removed from each well and a viable cell count performed by staining cells with nigrosin.  2.4. Proliferation assays Aliquots of 2 x 10 viable, log-phase, washed BaF/3 cells were suspended in 50 uL 4  medium (as for the viability assays) and placed in triplicate round bottom wells of a 96-well Falcon plate. The cells were then incubated overnight at 37°C and, 4 hours prior to harvesting, 1 uCi of tritiated ( H) thymidine was added add to each well. The contents of each well were then 3  harvested using a Skatron Instruments Combi Harvester (LKB Wallace) onto pieces of filter  34  paper, which were then dried in a drying cabinet for 20-30 minutes. The filters were sealed in plastic bags, to each of which 10 mL of scintillation fluid was added and the bag was placed inside a cassette in a LKB Betaplate Scintillation Counter to measure the radioactivity present.  2.5. Protein determinations Bradford protein assays were carried out by creating bovine serum albumin (BSA) standards using 10 mg/mL BSA Solution (New England Biolabs, Toronto, ON) and phosphate buffered saline (PBS) for the creation of a standard curve. Standard dilutions were created at concentrations of 0.05-0.3 mg/mL over which the readout is a linear function of the BSA concentration. Next, protein lysate samples were diluted with PBS to concentrations of 1:10, 1:20, 1:30, 1:40 and 1:50. Dilutions were added to a 96-well plate, and 200 uE of BioRad Protein Assay Solution (Mississauga, ON) were added to each well, and incubated for 5 minutes at room temperature. The ELX808 Ultra Microplate Reader from Bio-Tek Instruments, Inc. (Winooski, VT) was used to determine the concentration of protein in each well, and these values were then multiplied by the individual dilution that had been made to determine the protein concentration in each sample.  2.6. Western blot analyses l x 10 cells were diluted 200-fold in a lysis buffer consisting of 1.5 mL PBS, 15 pL 6  phenylmethanesulphonylfluoride (PMSF) (Sigma-Aldrich, Oakville, ON), 1.5 pL aprotinin protease inhibitor (Sigma-Aldrich, Oakville, ON), 1.5 pL leupeptin protease inhibitor (SigmaAldrich, Oakville, ON) and 75 pL NP-40 (nonyl phenol ethylene oxide) detergent (SigmaAldrich, Oakville, ON) to give a concentration of 10 cells/mL. The cells were then centrifuged 4  and resuspended in PBS, the supernatant removed, and the pellet frozen. Lysis buffer was then  35 added to the samples, and mixed by pipetting, then placed on a Nutator rocker for 1 hour at 4 °C for lysis. Afterwards, debris was removed by centrifuging the sample at 12,000 rpm for 10 minutes at 4 °C. The supernatants, containing the cell protein lysates, were then harvested and stored at -80 °C until analyzed. Samples containing 20 pg of protein mixed with 5 uL of NuPAGE® LDS (Lithium Dodecyl Sulfate) Sample buffer (4X) (Invitrogen, Burlington, ON) and 2 pL of NuPAGE® Reducing Agent (10X) diluted with deionized water to a total volume of 20 uE were loaded into each well of 10-well 4-12% NuPAGE® Novex Bis-Tris Gels. 5 pL of Fermentas Prestained Protein Ladder (170 Da-10 kDa) (Burlington, ON) was loaded into the outermost wells of the gel for protein size determinations. The upper buffer chamber was filled with 200 mL of IX NuPAGE® running Buffer containing 500 pL NuPAGE® Antioxidant. The lower buffer chamber wasfilledwith 600 mL NuPAGE® SDS Running Buffer. Gels were run at 200V (constant) for 50 minutes. Proteins were then transferred to a 0.45 pm pore size Millipore Immobilon-P polyvinylidene fluoride (PVDF) transfer membrane, which was hydrated for 30 seconds in methanol, then soaked for 15 minutes in NuPAGE® Transfer Buffer. The Transfer Buffer consisted of 50 mL of NuPAGE® Transfer Buffer (20X), lmL of NuPAGE® Antioxidant, 100 mL of methanol, and 849 mL of deionized water. The XCE11II™ Blot Module was used for Western transfer at a power condition of 30V for 1 hour with the module surrounded by ice to cool the apparatus during transfer. Upon removal, the membrane was washed in deionized water for 5 minutes, then blocked with skim milk for 1 hour at room temperature, or overnight at 4 °C. Afterwards, membranes were incubated in primary antibody overnight at 4 °C, washed 4 times for 5minutes each in 7.4 pH TBST (Tris-Buffered Saline Tween-20) consisting of 25 mL of 20X TBS (= 160g NaCI, 4g KC1, 60g Tris and 36.2 mL of 12N HC1) and 250 pL of Tween 20 diluted  36 to a total volume of 1000 mL). The membranes were then incubated in secondary antibody (labeled with horseradish peroxidase) for 1 hour at room temperature, washed another 4 times for 5 minutes each in TBST. The blots were then developed using Perkin Elmer Western Lightning™ Chemiluminescence reagents, at a ratio of lmL Oxidizing Reagent :1 mL Enhanced Luminol Reagent (Woodbridge, ON). Band intensities were determined using ImageQuant (General Electric) software on scanned Western blots, and normalized to bands of actin for protein lysate sample from each cell line analyzed. For a list of antibodies used, see Appendix A. Quantified blots were analyzed using a one-tailed Student's t-test at a confidence level of p < 0.05 to assure that observed differences between band intensities were statistically significant.  2.7 Statistical analyses  Differences between groups were demonstrated by comparison of mean values using the Student's t-test and a p value of p <0.05 to establish significance.  37 CHAPTER 3  RESULTS  3.1. Characterization of Ahi-1 expression in different clones of ,4/i/-i-transduced BaF/3 cells As a first step towards delineating the role of Ahi-1 in the oncogenic progression of hematopoietic cells, BaF/3 cells, an IL-3-dependent pro-B cell line, were used (Palacio 1984). To allow any effects observed to be related to Ahi-1, several clonal isolates of BaF/3 cells that been transduced with a MIG vector that contains an IRES-GFP element and an Ahi-1 cDNA were obtained (Jiang, personal communication). Parental BaF/3 cells and parallel clonal isolates of BaF/3 cells that had been transduced with an empty MIY vector were used as controls. The first experiments were to measure the levels of Ahi-1 expression in these transduced and control clones using real-time RT-PCR to determine the extent of increase and variability in Ahi-1 expression that existed between the different transduced and control cells (Figure 14). To enable results from different samples to be compared, transcript levels for Gapdh, a housekeeping gene that is highly expressed in BaF/3 cells, were also determined and the results for Ahi-1 then normalized to the results obtained for Gapdh in the same preparations. As shown in Figure 14', the levels oi Ahi-1 transcripts in the v4/z/-i-transduced clones were all higher (on average 30 ± 1.5-fold, PO.05, Student's t-test) than in the control BaF/3 cells (data for parental BaF/3 cells and 2 MIY-transduced clones combined). However, some variation between different clones of the same type was noted, (30 ± 2.5-fold, P<0.05) consistent with the different clones representing biologically similar but independent isolates.  38  •  BaF/3 cells  EJMIY clones -[' Ahi-1 transduced cells  BaF3 1 2 MIY clones Figure  1  2 3 4 Ahi-1 clones  5  14. Calculated levels of Ahi-1 transcripts (after normalization to Gapdh) in 5 different  clones transduced with Ahi-1 (solid red bars), compared to endogenous Ahi-1 levels seen in nontransduced BaF/3 cells (open blue bar) and 2 clones transduced with an empty MIY vector (hatched blue bars).  39  The next goal was to examine the effects of Ahi-1 overexpression with and without BCRABL at a molecular level in order to try to identify potential pathways involved in mediating the biological effects observed. This involved performing Western blots on protein lysates obtained from log phase control BaF/3 cells (parental or transduced with an empty MIG or MIY vector) and BaF/3 cells that had been transduced either with Ahi-1 alone, BCR-ABL alone, or both in combination, and then cultured either in the presence of 5 ng/mL IL-3, or deprived of IL-3 for 24 hours. The protein lysates were electrophoresed to separate proteins of different sizes and these were then immobilized on a PVDF membrane and finally probed with a selected number of antibodies specific for various native or phosphorylated versions of signalling proteins previously implicated in regulating cell growth, regulation and apoptosis. Thefirstsuch experiments were focused on measuring the levels of Ahi-1 and p210 " BCR  ABL  in each of the cell  types being analyzed using an anti-Ahi-1 antibody specific for the c-terminus of Ahi-1 (Ringrose 2006). Figure 15 shows the results for Western analysis of expression of Ahi-1. In each case, panels A and B show representative Western blots for cells maintained in the presence and absence of IL-3, respectively. The combined results from all 3 such experiments performed are shown in Panels C and D. To enable comparisons from multiple experiments to be combined, the level of protein expression in each sample was normalized to the level of actin present in the same preparation on the same blot. As expected from the real-time RT-PCR results shown (Figure 14), the expression of endogenous Ahi-1 in the Ahi-1 -transduced cells were much higher (10-fold, P< 0.05) than in the parental cells or those transduced with an empty MIG vector, which were similar to the parental cells. Interestingly, these analyses also showed that endogenous Ahi-1 expression is increased markedly in cells transduced with BCR-ABL alone, both in the presence and absence of IL-3 (17  40  Western for AJhJ-1 (C-terminus) +IL-3 A BaF3MIY  Afe-1  BCR-  Ahi-1+  ABL  BCR-ABL  B BaF3/MIY  J  3  4  BCRABL  Ahi-1 + BCR-ABL  5  1  &  p130 Ahi-1  r  1001  2  Ahi-1  S_, K,Qa 1-180  P  |-130 -  40  H  h- 4 0 Ahi-1 C - T e r m i n u s N o r m a l i z e d t o <fc}jn  BaF3  100  MIY-9  Ahi-1-2  Ahi-1-1  BCR- BCRABL-2 ABL-3 "Jr 9 j Cell L i n e s ABL-1 t  R  Ahi-1 C - T e r m i n u s N o r m a l i z e d t o  Sj^' + C ; ABL-2 B  R  R  1  BaF3  MIY-9  Ahi-1-2  (IL-3-)  Ahi-1-1  BCR- BCR- ^ J , A D I •> d p i o + B C R Cell L i n e s ABL-1 B  1  +BCRABL-2  • control 0 Ahi-1 • BCR-ABL • Ahi-1 +BCR-ABL Figure 15. Western analysis of Ahi-1 levels in BaF/3 cells transduced with Ahi-1, BCR-ABL, or both by comparison to control cells when cultured either in the presence (left panels) or absence (right panels) of IL-3. Western blots were probed with an antibody specific for the c-terminus of Ahi-1, and the different lanes of the blot represent the different cell lines used. Data in the bar graphs represent the mean of values obtained from 3 replicate blot analyses, and error bars represent the SEM. Two replicates of each cell line were loaded in each blot, with the exception of control BaF/3 and MIY-9 cells, for which one of each cell line was used in each individual blot. An antibody specific to the c-terminus of full length Ahi-1 was used to probe the blots (Ringrose et al. 2006)  41 to 18-fold, relative to the parental BaF/3 cells, P<0.05). In fact, these increases were greater than those achieved by forced over expression of Ahi-1 only in cells maintained in the presence of IL3 and were equal to those able to survive for 24 hours in the absence of IL-3. They were also not additive with the effects of over expression of Ahi-1. Therefore, elevated expression of Ahi-1 appears to be a downstream consequence of BCR-ABL expression in these cells that may be positively regulated by IL-3 exposure and negatively regulated by the total level of Ahi-1 protein present.  3.2.  The effect of overexpression of Ahi-1 on control and 2?C/?-/12?Z,-transduced BaF/3  cells in vitro • It is well established that expression of BCR-ABL in BaF/3 cells reduces their dependence on IL-3 for survival and growth (Jiang et al.2002). It was therefore of interest to investigate whether over expression of Ahi-1 alone would have a similar effect on BaF/3 cells and what the effects on BaF/3 growth would be in BaF/3 cells that were co-transduced with both Ahi-1 and BCR-ABL (Zhou, manuscript in preparation). To address the first question, clones transduced with Ahi-1 only were cultured in medium containing decreasing amounts of IL-3 and the number of viable cells present 72 hours later was then measured. As can be seen in Figure 16A, higher numbers of viable Ahi-1 -transduced cells were present following 72 hours of culture in medium containing all concentrations of IL-3 tested including those that were suboptimal for control cells.' Notably, a limited number of ^/z/-7-transduced cells survived for 72 hours even in the absence of IL-3, whereas no viable control cells were detectable after 72 hours under these conditions (>7.5-fold decrease, Figure 16B). These results show that a 30-fold increase in Ahi-1 expression alone is sufficient to enhance the sensitivity of BaF/3 cells to IL-3 and to partially override their dependence on IL-3 to stay alive.  42  0 ng/mL  0.01 ng/mL  0.1 ng/mL IL-3 Dose  1 ng/mL  5 ng/mL  • Control • Ahi-1 transduced Figure 16A. Viability of BaF/3 cells at varying IL-3 doses. 3 x 10 viable, log-phase, washed 5  BaF/3 cells were suspended growth media as described in the Materials and Methods section. Red bars represents Ahi-1 -transduced cells, clear bars with blue borders represent control untransduced cells. Ahi-1 -transduced cells show an increase in the number of viable cells present relative to control cells after 72 hours of culture under decreasing concentrations of IL-3. The values shown are the mean of 3 experimental replicates, and error bars represent the SEM.  43  20 " ^18  43h  72h  168h  Elapsed time of IL-3 deprivation  • Control • Ahi-1 transduced  Figure 16B. Viability of BaF/3 cells deprived of IL-3. Transduction of Ahi-1 alone confers on BaF/3 cells a reduced dependence on IL-3, enabling them to survive much longer than control (MIY-transduced) cells when the populations are incubated in the absence of the growth factor. The values shown are the mean of 3 experimental replicates, and error bars represent the SEM.  44  To obtain more direct evidence of effects on cell proliferation under conditions where cell numbers do not show a net expansion, a second series of experiments were conducted in which incorporation of H-thymidine into newly formed strands of DNA was used to 3  demonstrate the presence of proliferating cells in cultures maintained under different conditions. In this case, BaF/3 cells were cultured for 24 hours in medium containing either 0 or 5 ng/mL IL3 and then H-thymidine was added to allow its incorporation into DNA to be measured another 3  4 hours later. To allow comparison of the effect of forced over expression of Ahi-1 alone with the effect of over expression BCR-ABL alone, and with the effect of both genes in combination, cultures of similarly initiated and treated 5Ci?-^5Z-transduced BaF/3 cells and dually (Ahi-1 and BCR-ABL)-transduced cells (Jiang et al.2004) were also analyzed in these experiments. As shown in Figure 17, BaF/3 cells transduced with Ahi-1 alone showed a higher proliferative activity (showed a higher amount of H-thymidine incorporation) than control cells 3  in cultures containing IL-3. Moreover, in the absence of IL-3, the Ahi-1 -transduced cells showed some evidence of proliferation, in contrast to the IL-3-deprived control cells. Thus Ahi-1 overexpression can override the dependence of BaF/3 cells on IL-3 to mount a proliferative response as well as to survive. However, these effects were less pronounced than those seen in the 5Ci?-^5Z-transduced BaF/3 cells compared in the same experiments. Interestingly, the dually-transduced cells showed the highest proliferative activity, both in cultures containing IL3, and in those to which no IL-3 was added, indicating a co-operative effect of BCR-ABL and Ahi-1 in decreasing the IL-3 dependence of BaF/3 cells. Although the detection of H-thymidine incorporation in this type of assay allows the 3  presence of proliferating cells to be inferred, the levels measured cannot be used to reflect the proportion of dividing cells since they will also be affected by ongoing rates of apoptosis. In cases such as those documented here, where effects on both parameters are likely, additional  45  experimental approaches are required to distinguish effects on these two responses. For example, Annexin V staining could be used to measure the proportion of cells undergoing apoptosis (van Heerde 2000) and carboxy fluoroscein succinimidyl ester (CFSE) labelling could be used to track the rate at which viable cells are dividing (Ganusov 2005).  46  IL-3  +IL-3 —  2600M  260001  2400W 20001H 160001 120001 0000 4000  MIY  Ajy-1 BCR-ABL  Ajy-1 + BCR-ABL  MIY  AJy-1 BCRABL BCR-AB1  Figure 17. H-thymidine incorporation into Ahi-1 and BCR-ABL-transduced cells. Increased 3  proliferation is evident in cultures of BaF/3 cells transduced with Ahi-1 and/or BCR-ABL both in the presence (5 ng/mL) and absence of IL-3. Bars represent the mean of 3 experiments, and error bars represent the SEM.  47 BCR ABL  3.3 Evidence of the co-operatively enhanced expression of Ahi-1 and p210  *  proteins  in BaF/3 cells Interest in the effects on p210 " BCR  ABL  over expression was based on the fact that BCR-  ABL expression, although ubiquitous in all CML cells, is also known to be modulated as the cells differentiate (Jamieson 2005), and the fact that Ahi-1 and BCR-ABL co-expression could have a unique effect on cells not seen in previous studies. Western analysis was conducted using an anti-c-abl-specific antibody (8E9) (Upstate). For p210 " , evidence of a small (~2-fold) but BCR  ABL  significant (P<0.05) increase in expression was seen in cells co-transduced with Ahi-1 and BCRABL  relative to the levels of p210 " BCR  ABL  in cells transduced with BCR-ABL alone when the cells  were all maintained in the presence of IL-3. However, this difference was not maintained when the same cells cultured in the absence of IL-3. These results are curious in that they do not parallel the results obtained for Ahi-1 expression where these were actually reduced in the cotransduced cells maintained in IL-3. To investigate whether the phosphorylated status of p210  BCR A B L  may be affected by the  level of Ahi-1 present, the blots represented earlier (Figure 18) were re-probed with an antibody that reacts with all tyrosine phosphorylated residues. As shown, the co-transduced cells all showed evidence of slightly increased phosphorylation of p210 " BCR  ABL  (Figure 19). This effect  was greater in the cells deprived of IL-3 (2-fold, P<0.05), consistent with the relatively higher Ahi-1 expression seen in the IL-3-deprived co-transduced cells (Figure 19). Taken together, these findings indicate that the expression of Ahi-1 and p210 " BCR  ABL  can positively stimulate the  expression of each other, but the mechanisms involved are likely to be complex.  48  Western for p150  ABL  and p210  BCR  +IL-3 BCR-ABL  BCR-ABL-2  ^  BL  -IL-3 Ahi-1 + BCR-ABL  BCR-ABL-3  BCR-ABL  Ahi-1-1 + BCR- ABL-3  Ahi-1-1 + BCR- ABL-1  BCR-ABL-2  Ahi-1 + BCR-ABL  BCR-ABL-3  Ahi-1-1 + BCR-ABL-3  Ahi-1-1 + BCR-ABL-1  Cell Lines  Cell lines  • BCR-ABL transduced • Ahi-1+BCR-ABL Figure 18. Western analysis of p210 " BCR  ABL  showing increased expression in IL-3-stimulated  cells co-transduced with Ahi-1 and BCR-ABL relative to those transduced with BCR-ABL alone. Data in the bar graphs represent the mean of values obtained from 3 replicate blot analyses, and error bars represent the SEM. An antibody specific to pi 50  ABL  probe the blots.  (Cell Signalling) was used to  49  Western for Phpsphpryl^d p 2 1 0 BaF3WIY  _2  Afci-1  BCR-ABL  -IL-3  B  BCR-ABL  BaFaiVIIV 1 2  3_  D210  42  BCRABL  Ahi-1 4  BCR-ABL 5 6  BCR-ABL T 8  ur  e  H  -  42  Tyrosine F^SKbOCiiSte^ p 2 1 0 " " - Normalized to :9pjjn  Tyrosine F^sSEbjrjiafed 0210""""*- Normalized to Ar^ip  t  BCR-ABL-2  BCR-ABL-2 BCR-ABL-3 Ahi-1-1+ Ahi-1-1 + „ ,, ,. BCR-ABL-3 BCR-ABL--1 Cell Lines  BCR-ABL-3  H  BCR-ABL-3 Cell Lines  AbM-1+ BCR-ABL-1  • BCR-ABL transduced • Ahi-1+BCR-ABL Figure 19. Western analysis of p210  B C R A B L  phosphorylation. Increased overall tyrosine  phosphorylation and tyrosine phosphorylated p210  BCR  "  ABL  in IL-3-stimulated cells co-transduced  with Ahi-1 and BCR-ABL, relative to those transduced with BCR-ABL alone. Levels of tyrosine phosphorylated p210  BCR  "  ABL  protein were inferred from measurements of the total  phosphorylated protein present in the 210 kD band. Data in the bar graphs represent the mean of values obtained from 3 replicate blot analyses, and error bars represent the SEM. A 4G10 antibody which detects overall tyrosine phosphorylation (Upstate) was used to probe the blots.  50 3.4. The effect of Ahi-1 over expression on various signalling intermediates A next series of Western blots were then performed using antibodies to specific signalling intermediates (see Table 1). Those that showed alterations in cells transduced with Ahi-1 or BCR-ABL,  or both, are described in detail below and the results are displayed for  STAT5 (Figure 20), AKT (Figure 21) and SHIP (Figure 22). To compare effects on the phosphorylation status of a given protein, the band intensities obtained with the phospho-specific antibody were normalized to the absolute levels of that particular protein determined on the same blot using an antibody specific for the protein independent of its phosphorylation status. Levels of STAT5 in all cells analyzed were the same but that levels of phosphorylated STAT5 were significantly altered by expression of Ahi-1 and/or p210 " BCR  ABL  (Figure 20).  Specifically, the amount of phosphorylated STAT5 was similarly increased in BaF/3 cells that had been individually transduced with either Ahi-1 or BCR-ABL and then maintained in IL3(2.80 ± 0.0765-fold, and 3.19 ± 1.60-fold, relative to non-transduced controls, P < 0.05). This effect was sustained in the absence of IL-3 in the 5Ci?-^J5I-transduced cells (± Ahi-1, P < 0.05), but not in the cells transduced with Ahi-1 only. Table 1 lists the Westerns conducted, along with the observed effect.  51  Signalling protein examined  Effect Observed  NF-KB  Lack of effect  Ras  Lack of effect  Raf  Lack of effect  MEK  Lack of effect  ERK  Lack of effect  JAK2  Lack of effect  STAT5  Lack of effect  STAT3  Lack of effect  PI3K  Lack of effect  AKT  Lack of effect  JNK  Lack of effect  SAPK  Lack of effect  SHIP  Lack of effect  SHP2  Lack of effect  S-SHIP  Lack of effect  SRC  Lack of effect  IKKB  Lack of effect  PTEN  Lack of effect  BAD  Lack of effect  MAPK  Lack of effect  Phosphorylated MEK  Lack of effect  Phosphorylated ERK  Lack of effect  Phosphorylated JAK2  Effect not statistically significant  Phosphorylated STAT5  increased phosphorylation in Ahi-1 transduced cells (+IL-3)  Phosphorylated STAT3  Lack of effect  Phosphorylated PI3K  Lack of effect  Phosphorylated AKT  increased phosphorylation in dually transduced cells {-IL-3)  Phosphorylated JNK  Lack of effect  Phosphorylated NF-KB  Lack of effect  Phosphorylated Ras  Lack of effect  Phosphorylated SHIP  Downreguiated by BCR-ABL, no additional Ahi-1 effect  Phosphorylated SHP2  Lack of effect  Phosphorylated Raf  Lack of effect  Phosphorylated SRC  Lack of effect  Phosphorylated IKKB  Lack of effect  Phosphorylated PTEN  Lack of effect  Phosphorylated BAD  Lack of effect  Phosphorylated MAPK  Lack of effect  Phosphorylated Raf  Lack of effect  Table 1. List of Western blots conducted, and observed effects.  52  STATS  Western for  -IL-3  B  KJte  BaF3jMIY jyj-1  1 2 3 a  BCR- J^tiM +  5  BCR-  BaF3/MIY Ahi-1  ABL BCR-ABL  1 2 3 4 5  6 7 8  iorr  -pQj phosphoSTAT5 -  100"  p STAT5 97  I  •^tji*'!  ABL BCR-ABL  6 7 8  _  KTl£  _ § | _ 72 -130 "100  _  42~  42  D Ftes^to'J/Sted STAT5 Normalized to STATS A  BaF3 MIY-3 Ahi-1-2 Ahi-1-1 BCR- BCR- Ahi-1-1 + Ahi-1-1 + ABL-2 ABL-3 BCR BCR Cell Lines "ABL-3 -ABL-1  StoasfowaUit^ STATS Normalized to STATS A  I I — , BaF3  MIY-9  . Ill Ahi-1-2 Ahi-1-1 BCR BCR Ahi-1-1 Ahi-1-1 -ABL-2 -ABL-3 + BCR- + BCRCell Lines ABL-3 ABL-1  • control  0 Ahi-1  • BCR-ABL • Ahi-1 +BCR-ABL Figure 20. Western analysis of STAT5 phosphorylation. Increased phosphorylation of STAT5 in cells transduced with BCR-ABL and cultured in the absence of IL-3. Data in the bar graphs represent the mean of values obtained from 3 replicate blot analyses, and error bars represent the SEM. Antibodies for 97P P hos  P  to probe the blots.  hoSTAT5  (Cell Signalling tyr 694) and P97  STAT5  (Upstate) were used  53 Levels of Akt also appeared unaffected by the genetic alterations of BaF/3 cells examined, but the levels of phosphorylated Akt appeared to be enhanced in lysates of cells that had been co-transduced with Ahi-1 and BCR-ABL, relative to all other cell lysates. These differences were marginal in cells cultured in the presence of IL-3 but became obvious when examined in cells able to survive in the absence of IL-3 (3-fold higher in the co-transduced relative to cells transduced with BCR-ABL only, PO.05,) (Figure 21). A comparison of SHIP expression in the various cell lines tested was also conducted through Western blot analysis (Figure 22). It can be seen that SHIP expression was higher in BaF/3 cells that had been transduced with Ahi-1 alone and then cultured in the absence of IL-3 (40-fold higher relative to BaF/3 parental and MIG-transduced cells, P<0.05). However, this effect was masked in cells cultured in the presence of IL-3 and was also not seen when BCR-ABL was co-expressed. BaF/3 cells transduced with BCR-ABL showed the same marked (40-fold, PO.05) suppression of SHIP expression previously reported by Sattler et al (1999) and this was sustained even when Ahi-1 was co-transduced with BCR-ABL. Thus the SHIP-promoting effect of Ahi-1 was not sufficient to override the SHIP-suppressing effect of p210 " . BCR  ABL  54  Western for Phosphorylated AKT -IL-3 BaF3/MIY  72  2  Ahi-1  3  BCRABL  4  5  6  Ahi-1 + BCR-ABL  7  BaF3MIY  8  BCRABL  2  3  5  4  Ahi-1 + BCR-ABL  6  7  8  -72  pgQphospho AKT AKT  p60  eo \mmm io  Ahi-1  Anti-Rb^atXQ-AJsl  • r -  l i m e  Abl-2  Abl-3  to|  Abl-2  3  Cell Lines  -Abl-3  1M.-3 iw..)  Cell Lines  • control 0 Ahi-1 • BCR-ABL • Ahi-1 +BCR-ABL  Figure 21. Western analysis of AKT phosphorylation. Increased phosphorylation of AKT in cells transduced with BCR-ABL and cultured in the absence of IL-3. Data in the bar graphs represent the mean of values obtained from 3 replicate blot analyses, and error bars represent the SEM. Antibodies for p60 blots.  phosphoA K T  (Upstate ser473) and p60  AKT  (Upstate) were used to probe the  55  SHIP Western nlL-3 BaF3WIIY  Srja  Ahi-1  1 23  Ahi-1 + BCR-ABL  BCRABL  BaF3MIY  Ahi-1  BCRABL  Ahi-1 + BCR-ABL  1 2 3 4 5 6 78  4 5 6 7 8 SH  p145  40  \mmm  mmm mmm w*mr  •»•«» w«m* w .  *  ^  KJto  130 -130 "—100  L. 40  jtlLf^tir>  SHIP Normalized to  SHIP Normalized to Ar&rj 30  | 2D ^ 15  I  Xi  10 05 BaF3  MIY-9  1  Ahi-1-2 Ahi-1-1 BCRCell Lines  BCR- ^i"—  1  ^SPD  BaF3  MIY-9 Ahi-1-2 Ahi-1-1 BCRAbl-2 Cell Lines  BCR- * £ ™ Abl-3  +J**" ^ " +  R  1  • control 0 Ahi-1 • BCR-ABL • Ahi-1+BCR-ABL Figure 22. Western analysis of SHIP protein. Decreased expression of SHIP in cells transduced with BCR-ABL. Data in the bar graphs represent the mean of values obtained from 3 replicate blot analyses, and error bars represent the SEM. An antibody for pl45 (Cell Signalling) was SHIP  used to probe the blot.  56 CHAPTER 4  DISCUSSION  This project aimed to investigate the mechanism by which increased expression of Ahi-1 can contribute to the development of leukemia and, particularly in co-operation with BCRABL. To address these questions, the effects of forced Ahi-\ expression either alone or in conjunction with BCR-ABL on cell proliferation and various signalling pathways were examined, in BaF/3 cells, a normally IL-3-dependent hematopoietic cell line model. BCR-ABL is also known to confer factor independence on BaF/3 cells (Jiang et al.2002). Indeed, increased sensitivity to cytokines is a common feature of cells expressing many leukemia-associated oncogenes, including BCR-ABL, TEL-ABL, TEL-PDGFRB, TEL-JAK2, JAK2, STAT5, MAPK, RAS, RAF, MEK, ERK and PI3K (Jiang et al. 2002). Therefore, I was also interested in determining whether the forced overexpression of Ahi-1 would overcome the IL-3 requirement of BaF/3 cells for survival and/or proliferation. Following infection with an MSCV Ahi-l-lRES GFP retrovirus, BaF/3 cells expressed 75 ± 4-fold higher levels of Ahi-1 transcripts as measured by quantitative RT-PCR. In addition, Western blotting using an Ahi-1 antibody showed an 18-fold increase in Ahi-1 protein levels relative to the parental BaF/3 cells. H-thymidine incorporation measurements showed that in 3  the presence of IL-3, there was twice as much H-thymidine incorporation in BCR-ABL3  transduced BaF/3 cells than control cells, and in the absence of IL-3, this value was 9.0-fold higher than in the controls although the absolute values were lower, due to the rapid decline of the control cells under these conditions. This corroborates the literature, which states that expression of BCR-ABL enhances the growth rate of BaF/3 cells and reduces their factor dependence (Jiang et al.2002). I also found that overexpression of BCR-ABL alone resulted in increased activation of the PI3K and STAT5 pathways and in decreased expression of SHIP  57 (Steelman et al. 2004, Sattler et al. 1999) but not JAK2, as previously reported (Clarkson 2003). As STAT5 is downstream of JAK2, its mechanism of activation in this case must therefore be independent of JAK2. Thus it is possible that p210 " BCR  ABL  itself, or another binding partner,  interacts with STAT5 to alter cell growth control. APS (adaptor molecule containing pleckstrin homology and SH-2 domains) is known to inhibit the JAK-STAT pathway by binding to the cytoplasmic domain of receptors that activate the JAK-STAT pathway (Kamei 2000). Perhaps BCR-ABL directly recruits STAT5, or it may recruit an adaptor such as Gab2 (Scherr et al. 2006). Taken together, these experiments validated the further use of the BaF/3 models used for investigating the effects of Ahi-1. See Table 1 for a summary of results obtained using Western blotting. Overexpression of Ahi-1 alone also had a significant effect on the growth of BaF/3 cells, with approximately twice as many viable transduced cells observed at the 72 hour point as compared to control cells. These cells were also able to survive three times longer than control cells when deprived of IL-3, the growth factor upon which they are normally dependent. However, when compared with expression of BCR-ABL in these cells, the effects of Ahi-1 transduction on cell proliferation were 1.3 (+IL-3) and 2.3 (-IL-3)-fold lower than values obtained for BCR-ABL-transduced cells (when compared to untransduced control cells). Thus deregulated Ahi-1 behaves like many known leukemia-inducing oncogenes in its ability to alter the factor-dependence of hematopoietic cells, but this effect is not as pronounced as when cells are transduced with BCR-ABL alone. Interestingly, concomitant overexpression of BCR-ABL and Ahi-1 in BaF/3 cells caused a 1.3 to 1.5-fold more pronounced increase in their proliferative activity relative to overexpression of BCR-ABL alone, regardless of the addition of IL-3. This finding prompted further investigations of candidate signalling pathways that Ahi-1 and p210 " BCR  A B L  might affect in an additive manner.  58 Of the various signalling intermediates investigated, the only significant effects of increasing Ahi-1 expression alone by comparison to control BaF/3 cells were related to STAT5 phosphorylation and SHIP expression (Table 1). The level of phosphorylated STAT5 in the Ahi7-transduced cells was increased 2.80 ± 0.0765-fold when these were stimulated with IL-3, a level equivalent to that obtained in similarly cultured 5C7?-,45£-transduced BaF/3 cells. However, in the case of the Ahi-1 -transduced cells, this effect was not sustained when the cells were cultured in the absence of IL-3, indicative of different sequelae of forced Ahi-1 and BCRABL expression in this model. Nevertheless, in cell lines transduced with both Ahi-1 and BCRABL there was no further increase in STAT5 phosphorylation regardless of whether the cells were further stimulated by IL-3 or not, suggesting that BCR-ABL may saturate the capacity of STAT5 to be phosphorylated and that the enhanced biological effects of Ahi-1 over expression in combination with p210 ~ BCR  ABL  may be due to activation of other pathways.  In contrast to the effects seen on STAT5 phosphorylation, the effect on SHIP was an increased expression of this signalling intermediate in Ahi-1 -transduced cells relative to control BaF/3 cells seen only in the absence of IL-3 stimulation. This effect is also the opposite of that obtained when BaF/3 cells are transduced with BCR-ABL which causes a marked suppression of SHIP expression (both in the presence, 5.8 ± 0.3-fold and absence, 30.0 ± 1.5-fold, of IL-3, as documented in previous experiments (Sattler et al. 1999) and confirmed here. Interestingly, the co-expression of Ahi-1, which alone enhanced SHIP expression, did not override the suppressive effect of p210 " . Thus, Ahi-1 over expression does not impact p210 " -mediated SHIP BCR  ABL  BCR  ABL  downregulation. The decreased expression of SHIP in the presence of p210 " BCR  ABL  regardless of Ahi-1  over expression implies that Ahi-1 does not regulate this phosphatidylinositol pathway, which is an important aspect of the clonal expansion that occurs in CML (Look 1997). It is possible that  59 Ahi-1 has a role in the activation status of downstream targets of SHIP, such as PDK-1 and AKT. The PI3K signalling pathway, (which includes AKT) is already known to be activated and important for p210  -mediated transformation, and is activated by SHIP to increase cell  BCRABL  survival (Sattler et al. 1999). Further evidence supporting this theory is that increased phosphorylation of AKT (2.2-fold, -IL-3 only) was observed in cells transduced with both BCRABL and Ahi-] in comparison to those transduced with BCR-ABL or Ahi-1 individually or the control non-transduced cells. Therefore lower SHIP levels could be affecting apoptosis regulation by downregulating AKT activation. This could lead to phosphorylation of many downstream targets implicated in the prevention of apoptosis, including the Bcl2-antagonist of cell death (BAD), glycogen synthetase-3 kinase-P  (GSK-3P),  forkhead transcription factor  (FOXO-3) and caspase-9 (Alvarez-Tejado 2001). The lipid phosphatase PTEN switches off the activation of AKT (Aggerholm et al. 2000) but deregulated phosphorylation and protein levels of PTEN were also not observed through Western blotting. Therefore, based on the observations made in the above experiments, AKT would be a protein of interest in this signalling cascade when examining the role of Ahi-1, but further research will be required to determine the nature of this relationship. Of note, we found that the expression of BCR-ABL in BaF/3 cells was consistently associated with an upregulation of endogenous Ahi-1 protein levels in both cell lines tested both in the presence and absence of IL-3. This suggests that the signalling pathways emanating from p210 " BCR  ABL  can drive the expression of endogenous Ahi-1. A similar, albeit less pronounced  finding of upregulated Ahi -1 expression has been noted in K562 cells, a highly BCR-ABL cell +  line derived from a patient with CML in blast crisis (Jiang et al.2004) and in primitive CD34  +  CML cells from patients (Jiang et al.2004). It would therefore be interesting to see if this same phenomenon occurs in primary human hematopoietic cells following BCR-ABL transduction of  60 CD34 cord blood cells. Notably, in our model, the forced overexpression of Ahi-1 did not yield +  a corresponding observable increase in P 2 1 0  BCR-ABL  P  R  O  T  D  N  L  E  V  E  L  S  One must also consider the fact that though expression of BCR-ABL increases the amount of full length Ahi -1 protein in BaF/3 cells, this does not necessarily confirm that the levels of every Ahi -1 isoform are increased along with p210 " . Different effects on the expression BCR  ABL  of the five known murine isoforms of Ahi -1 proteins might differentially affect downstream interacting proteins and elicit different biological effects. Therefore, unique effects of full-length Ahi -1 over expression in combination with p210 " could still be anticipated even though BCR  ABL  the levels of total Ahi -1 did not appear to be significantly increased above those obtained with 210 BCR  P  ABL  alone.  This possibility is supported by the altered expression of different Ahi-1 isoform transcripts discovered through real-time RT-PCR analyses using specific primers to detect the 3' end of each isoform (Jiang et al.2004). As compared to leukemic cell populations, normal human bone marrow cells had 10-fold fewer transcripts for an Ahi -1 isoform lacking the SH3 domain. In primary CML cells, a general pattern of upregulated expression of this Ahi-1 transcript isoform was seen in all populations analyzed (Jiang et al.2004). The absence of this SH3 domain means the transcript would be expected to encode truncated proteins with distinct properties, possibly including gain-of-function activities (Jiang et al.2004). Similar in vitro experiments examining cell viability and proliferation could be performed using cells transduced with Ahi-1 isoforms to Compare the outcome to the aforementioned results on BaF/3 cells transduced with full length Ahi-1. Western blots could also be conducted for signalling proteins of interest (STAT5, AKT, SHIP) on protein lysate obtained from cells transduced with different Ahi-1 isoforms to ascertain whether truncation of the Ahi-1 protein has a differential effect on cell signalling as compared to the full-length version.  61 Another interesting future experiment would be to examine STAT5, JAK2, AKT expression at varying time points in cells cultured in the presence or absence of IL-3. This could illuminate whether these expression levels vary over time, and what levels are needed to induce a biologically observable phenotype in these cells. Other possibilities would be to test the effects of inhibitors of transcriptional activation and/or apoptosis specific to different components of known cancer signalling pathways. RNA-mediated interference (RNAi) using nucleotide sequences complementary to desired signalling proteins could be analyzed through Northern or Western blots, in order to determine their effect on genes known to be implicated in cancer. As well, testing the effects of RNAi on tyrosine phosphorylation of these proteins through Western analysis could further elucidate the role of AKT and Ahi-1 in leukemic transformation. BCR-ABL transduction of mouse bone marrow cells is known to produce a CML-like  disease in transplanted recipients (Poirier et al. 1998). A similar experiment could be done using bone marrow cells from Ahi-1 knockout mice. This could help determine whether Ahi-1 is required for the CML-like disease produced by BCR-ABL-transduction, and whether the disease progresses at the same rate with the addition of Ahi-1 to BCR-ABL transduction. In'summary, this project has provided evidence that Ahi -1, an as yet poorly characterized candidate signalling protein with oncogenic potential, can, when deregulated affect the survival and/or proliferative activity of hematopoietic cells by partially overriding their factor dependence. These effects appear less pronounced than those caused by BCR-ABL expression but could enhance the latter at least in the model studied here. At a biochemical level, BCR A B L  deregulated Ahi-1 expression affected 2 signalling proteins that are also affected by p210 but differently. This shows that Ahi-1 must have unique targets that are not affected by p210 ABL  . In addition, this project has revealed that p210  BCRABL  alone upregulates endogenous Ahi -1  expression to levels equivalent to those obtained by forced Ahi-1 overexpression but that this is  62 not sufficient to mimic the enhanced growth obtained when Ahi-1 is co-transduced with BCRABL. This reinforces the possible importance of altered regulation of Ahi -1 isoform expression in the progression of CML and underscores the need for more detailed experiments to delineate the signalling pathways that deregulation of this gene can affect.  63 REFERENCES Abell K., Watson C.J. (2005). The Jak/Stat pathway: a novel way to regulate PI3K activity. Cell Cycle 4: 897-900. Aggerholm, A., K. Gronbaek, et al. (2000). Mutational analysis of the tumour suppressor gene MMAC1/PTEN in malignant myeloid disorders. Eur J Haematol 65: 109-13. Alvarez-Tejado, M., S. Naranjo-Suarez, et al. (2001). Hypoxia induces the activation of the phosphatidylinositol 3-kinase/AKT cell survival pathway in PC12 cells: protective role in apoptosis. J Biol Chem 276: 22368-74. Benekli M., Baer M.R., Baumann H. and Wetzler M. (2003). Signal transducer and activator of transcription proteins in leukemias. Blood 101: 2940-2954. Cicchetti, P., B. J. Mayer, et al. (1992). Identification of a protein that binds to the SH3 region of Abl and is similar to Bcr and GAP-rho. Science 257: 803-6. Clarkson (2003). Chronic myelogenous leukemia as a paradigm of early cancer and possible curative strategies. Leukemia 17: 1211-1262. Cox, A. D. and C. J. Der (2003). The dark side of Ras: regulation of apoptosis. Oncogene 22: 8999-9006. Damen, J. E., L. Liu, et al. (1998). Multiple forms of the SH2-containing inositol phosphatase, SHIP, are generated by C-terminal truncation. Blood 92: 1199-205. Druker, B. e. a. (1996). Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med 2: 561-6. Eaves, C. and A. Eaves (2004). Anatomy and Physiology of Hematopoiesis. Childhood Leukemias. C.-H. Pui. Cambridge, UK, Cambridge University Press. Eaves, C. J., X. (2003). New models to investigate mechanisms of disease genesis from primitive BCR-ABL(V) hematopoietic cells. Ann N Y Acad Sci 996: 1-9. Ganter, B. a. J. L. (1999). Myb and oncogenesis. Advances in Cancer Research 76: 21-60. Ganusov V.V., Pilyugin S.S., de Boer R.J., Murali-Krishna K., Ahmed R., Antia R. (2005). Quantifying cell turnover using CFSE data. J Immunol Methods 298: 183-200. Henikoff, S. (2003). Versatile assembler. Nature 423: 814-5, 817. Hennig, L., P. Taranto, et al. (2003). Arabidopsis MSI1 is required for epigenetic maintenance of reproductive development. Development 130: 2555-65.  64  Hines, D. L. and L. Gragowski (1983). Abelson murine leukemia virus: effect of helper virus from regressing Friend virus on leukemia development. Leuk Res 7: 251-60. Hunter, M. G. and B. R. Avalos (1998). Phosphatidylinositol 3'-kinase and SH2-containing inositol phosphatase (SHIP) are recruited by distinct positive and negative growth-regulatory domains in the granulocyte colony-stimulating factor receptor. J Immunol 160: 4979-87. Inoue, J., T.Akiyama, et al. (2007) N F - K B activation in development and progression of cancer.Cancer Science 98: 268-274. Jiang X, H. Z., Kaouass M, Girard L, Jolicoeur P. (2002). Ahi-1, a novel gene encoding a modular protein with WD40-repeat and SH3 domains, is targeted by the Ahi-1 and Mis-2 provirus integrations. J Virol 76: 9046-9059. Jiang, X., E. Ng, et al. (2002). Primitive interleukin 3 null hematopoietic cells transduced with BCR-ABL show accelerated loss after culture of factor-independence in vitro and leukemogenic activity in vivo. Blood 100: 3731-40. Jiang, X., L. Villeneuve, et al. (1994). The Myb and Ahi-1 genes are physically very closely linked on mouse chromosome 10. Mamm Genome 5: 142-8. Jiang, X., Y. Zhao, et al. (2004). Deregulated Expression in Ph+ Human Leukemias of AHI-1, a Gene Activated by Insertional Mutagenesis in Mouse Models of Leukemia. Blood 103: 38973904. Kamei T. et al..(2000). C-Cbl protein in human cancer tissues is frequently tyrosine phosphorylated in a tumor-specific manner. Int J Oncol 17: 335-339. Karin M. and F.R. Greten (2005). N F - K B : linking inflammation and immunity to cancer development and progression. Nature Reviews Immunology 5: 749-759. Karin M. and E. Gallagher (2005). From JNK to Pay Dirt: Jun Kinases, their Biochemistry, Physiology and Clinical Importance. IUBMB Life 57: 283-295. Klein B., K. Tarte, et al. (2003). Survival and Proliferation Factors of Normal and Malignant Plasma Cells. International Journal of HematoloRy 78: 106-113. Koch, C. A., D. Anderson, et al. (1991). SH2 and SH3 domains: elements that control interactions of cytoplasmic signalling proteins. Science 252: 668-674. Li, D. and R. Roberts (2001). WD-repeat proteins: structure characteristics, biological function, and their involvement in human diseases. Cell Mol Life Sci 58: 2085-2097. Liu L., L. Anning et al. (2005). Role of JNK activation in apoptosis: A double-edged sword. Cell Research 15: 36-42.  65 Liu, L., J. E. Damen, et al. (1994). Multiple cytokines stimulate the binding of a common 145kilodalton protein to She at the Grb2 recognition site of She. Mol Cell Biol 14: 6926-6935. Look, A. T. (1997). Oncogenic transcription factors in the human acute leukemias. Science 278: 1059-1064. Mayer, B. J. (2001). SH3 domains: complexity in moderation. J Cell Sci 114: 1253-1263. Miyajima A, Ito Y, Kinoshita T. (1999). Cytokine signalling for proliferation, survival, and death in hematopoietic cells. Int J Hematol 69: 137-146. Martinez-Moczygemba M. and D.P. Huston. (2003). Biology of common receptor-signalling cytokines: IL-3, IL-5, and GM-CSF. J. Allergy Clin Immun 112: 653-665. Neer, E. J., C. J. Schmidt, et al. (1994). The ancient regulatory-protein family of WD-repeat proteins. Nature 371: 297-300. Pawson, T. and G. D. Gish (1992). SH2 and SH3 domains: from structure to function. CeU 71: 359-362. Poirier, Y., C. Kozak, et al. (1988). Identification of a common helper provirus integration site in Abelson murine leukemia virus-induced lymphoma DNA. J Virol 62: 3985-3992. Rastrick J.M., Gunz F.W. (1968). Direct evidence for presence of Phi chromosome in erythroid cells. BrMedJl: 96-98. Richmond, A.(2002). Nf-Kb, chemokine gene transcription and tumour growth. Nature Reviews Immunology 2: 664 - 674. Ringrose A.,. Zhou Y., Pang E., Zhou L., Lin A.E., Sheng G., Li X.J., Weng A., Su M.W., Pittelkow M.R., Jiang X. (2006). Evidence for an oncogenic role of AHI-1 in Sezary syndrome, a leukemic variant of human cutaneous T-cell lymphomas. Leukemia. 20: 15931601. Sadowski, H. B., K. Shuai, et al. (1993). A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261: 1739-1744. Sattler, M., S. Verma, et al. (1999). BCR/ABL directly inhibits expression of SHIP, an SH2containing polyinositol-5-phosphatase involved in the regulation of hematopoiesis. Mol Cell Biol 19: 7473-7480. Sawyers, C. L. (1999). Chronic myeloid leukemia. N Engl J Med 340: 1330-1340. Schlessinger, J. (1994). SH2/SH3 signalling proteins. Curr Qpin Genet Dev 4: 25-30. Scherr M., A.Chaturvedi et al. (2006) Enhanced sensitivity to inhibition of SHP2, STAT5, and Gab2 expression in chronic myeloid leukemia (CML). Blood 107: 3279-3287.  66  Shelton, J. G., L. S. Steelman, et al. (2003). Effects of the RAF/MEK/ERK and PI3K/AKT signal transduction pathways on the abrogation of cytokine-dependence and prevention of apoptosis in hematopoietic cells. Oncogene 22: 2478-2492. Sly L.M., Rauh M.J., Kalesnikoff J., Buchse T., Krystal G. (2003). SHIP, SHIP2, and PTEN activities are regulated in vivo by modulation of their protein levels: SHIP is up-regulated in macrophages and mast cells by lipopolysaccharide. Exp Hematol 31: 1170-1181. Smith, T. F., C. Gaitatzes, et al. (1999). The WD repeat: a common architecture for diverse functions. Trends Biochem Sci 24: 181-185. Steelman, L. S., S. C. Pohnert, et al. (2004). JAK/STAT, Raf/MEK/ERK, PI3K/AKT and BCRABL in cell cycle progression and leukemogenesis. Leukemia 18: 189-218. Testa.U.., R. Riccioni, et al. (2004) Interleukin-3 receptor in acute leukemia. Leukemia 18: 219-226. Whang J., J.H. Tjio, et al. (1963). The distribution of the Philadelphia chromosome in patients with chronic myelogenous leukemia. Blood 22: 664-673. van Heerde W.L., Robert-Offerman S., Dumont E., Hofstra L., Doevendans P.A., Smits J.F., Daemen M.J., Reutelingsperger CP. (2000). Markers of apoptosis in cardiovascular tissues: focus on Annexin V. Cardiovasc Res 45: 549-559. Wisniewski, D., A. Strife, et al. (1999). A novel SH2-containing phosphatidylinositol 3,4,5trisphosphate 5-phosphatase (SHIP2) is constitutively tyrosine phosphorylated and associated with src homologous and collagen gene (SHC) in chronic myelogenous leukemia progenitor cells. Blood 93: 2707-2720.  67 Appendix A Signalling protein examined  Antibody supplier, Phosphorylation site  Ahi-1  (Ringrose 2006)  BCR-ABL  Cell Signalling  Actin  Sigma  4G10  Upstate overall tyrosine phosphorylation  MEK  Cell Signalling  ERK  Cell Signalling  JAK2  Cell Signalling  STAT5  Upstate  STAT3  Upstate  PI3K  Cell Signalling  AKT  Upstate  JNK/SAPK  Cell Signalling  NF-KB  Cell Signalling  Ras  Cell Signalling  SHIP  Cell Signalling  SHP2  Cell Signalling  Raf  Cell Signalling  SRC  Cell Signalling  IKKB  Cell Signalling  PTEN  Cell Signalling  BAD  Cell Signalling  MAPK  Cell Signalling  Phosphorylated MEK  Cell Signalling ser221  Phosphorylated ERK  Cell Signalling thr218/tyr220  Phosphorylated JAK2  Cell Signalling tyr1007/1008  Phosphorylated STAT5  Cell Signalling tyr694  Phosphorylated STAT3  Cell Signalling ser727  Phosphorylated PI3K  Cell Signalling tyr458  Phosphorylated AKT  Upstate ser473  Phosphorylated JNK  Cell Signalling thr183/tyr185  Phosphorylated NF-KB  Cell Signalling ser276  Phosphorylated Ras  Cell Signalling ser916  Phosphorylated SHIP  Cell Signalling tyr1020  Phosphorylated SHP2  Cell Signalling tyr542  Phosphorylated Raf  Cell Signalling ser338  Phosphorylated SRC  Cell Signalling tyr527  Phosphorylated IKKB  Ceil Signalling ser32  Phosphorylated PTEN  Cell Signalling ser380  Phosphorylated BAD  Cell Signalling ser112  Phosphorylated MAPK  Cell Signalling thr180/tyr182  Phosphorylated Raf  Cell Signalling ser299  Table 2. List of antibodies used, along with supplier and phosphorylation site (if applicable).  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0093105/manifest

Comment

Related Items