Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Implications of BRCA-loss phenotype in epithelial ovarian carcinoma Press, Joshua Zephyr 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0214a.pdf [ 11.4MB ]
Metadata
JSON: 831-1.0093060.json
JSON-LD: 831-1.0093060-ld.json
RDF/XML (Pretty): 831-1.0093060-rdf.xml
RDF/JSON: 831-1.0093060-rdf.json
Turtle: 831-1.0093060-turtle.txt
N-Triples: 831-1.0093060-rdf-ntriples.txt
Original Record: 831-1.0093060-source.json
Full Text
831-1.0093060-fulltext.txt
Citation
831-1.0093060.ris

Full Text

Implications of BRCA-loss Phenotype in Epithelial Ovarian Carcinoma By  Joshua Zephyr Press B.Sc, The University of British Columbia, 1996 M.D., The University of Alberta, 2001  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR T H E DEGREE OF  M A S T E R OF SCIENCE  In  THE F A C U L T Y OF G R A D U A T E STUDIES (Reproductive and Developmental Sciences) THE UNIVERSITY OF BRITISH C O L U M B I A  December 2006  © Joshua Zephyr Press, 2006  ABSTRACT Loss of B R C A 1 / B R C A 2 function through genetic or epigenetic mechanisms is common in epithelial ovarian carcinomas (EOC), but because there are multiple potential mechanisms of loss, the overall frequency is unknown. We characterized loss of B R C A 1 / B R C A 2 at the D N A , R N A and protein level from an unselected, consecutive series 49 non-mucinous, invasive EOC. BRCAl-loss was found in 21/49 tumors (43%). These included 8 tumors from patients with BRCA1 germline mutations, 1 tumor with a somatic BRCA1 mutation and 12 tumors (24%) that showed BRCAl-loss without evidence of BRCA1 mutation. Three tumors that contained BRCA2 mutations (2 germline/1 somatic) did not exhibit BRCAl-loss. The histopathology of the tumors showing BRCAl-loss was high-grade serous or undifferentiated carcinoma in every case (even in the absence of mutations) with 21/38 high-grade serous/undifferentiated EOC showing BRCAl-loss. None of the 11 tumors of non high-grade serous type (5 endometrioid, 4 clear cell, and 2 low-grade serous) exhibited BRCAl-loss. High-grade serous/undifferentiated EOC with BRCAl-loss showed different immunophenotype compared to those without BRCAl-loss (p53+, p21-, cyclin D1-). Progress in the treatment of EOC requires appropriate in vivo models to assess novel targeted therapeutic agents, such as the ability of Poly(ADP-ribose) polymerase (PARP) inhibitors to selectively damage B R C A l - n u l l tumor cells. We evaluated the genetic/phenotypic stability of primary human gynecological tumors grown as serially transplanted xenografts in NOD/SCID mice. Transplantable tumor lines were derived from 5 tumors, and serially transplanted for 2-6 generations. Comparisons were made between primary tumor and corresponding transplantable xenografts. Genetic stability was suggested by unsupervised hierarchical cluster analysis of a 287 feature comparative genomic hybridization array. Phenotypic stability was suggested by immunohistochemistry using antibodies against EGFR, HER2, HER3, IGF-IRp, Mucinl, E-cadherin, P-catenin, and V E G F . Analysis of a ii  xenograft from a patient with a known germline BRCA1 mutation confirmed the presence of a hemizygous truncating mutation within BRCA1 exon2 (del 185AG), associated with loss of heterozygosity (LOH). Another case had no mutations in B R C A 1 , but showed L O H and promoter hypermethylation, with undetectable B R C A 1 protein, indicating epigenetic loss. These models may be used to assess targeted therapeutics, such as PARP inhibitors in tumors with genetic or epigenetic BRCAl-loss  iii  TABLE OF CONTENTS Abstract Table of Contents List of Tables List of Figures Acknowledgements Co-authorship statement  ii iv vi vii viii ix  C H A P T E R 1: I N T R O D U C T I O N 1.1 Ovarian carcinoma 1.2 Clinical features of epithelial ovarian carcinoma 1.3 Molecular features of epithelial ovarian carcinoma 1.4 B R C A 1 and B R C A 2 genes and epithelial ovarian carcinoma 1.5 Function of B R C A 1 and B R C A 2 genes 1.6 BRCA-loss in sporadic epithelial ovarian carcinoma 1.7 Epithelial ovarian carcinoma tumor models 1.8 Fresh tumor xenograft models of epithelial ovarian carcinoma 1.9 Hypotheses and Objectives 1.10 References  1 1 2 3 5 6 9 10 10 11  C H A P T E R 2: T H E B R C A - L O S S P H E N O T Y P E IN H E R E D I T A R Y A N D S P O R A D I C OVARIAN CARCINOMA 2.1 Introduction 2.2 Materials and Methods 2.2.1 Recruitment 2.2.2 D N A and R N A extraction 2.2.3 Loss of heterozygosity 2.2.4 d H P L C mutation screening and mutation analysis 2.2.5 M L P A screening 2.2.6 B R C A 1 and F A N C F promoter hypermethylation 2.2.7 Real-time Q - R T - P C R for B R C A 1 2.2.8 Immunohistochemistry 2.2.9 Analysis 2.3 Results 2.3.1 Cases with B R C A 1 and B R C A 2 mutations 2.3.2 Molecular changes associated with B R C A 1 mutations 2.3.3 Cases without B R C A 1 or B R C A 2 mutations 2.3.4 Correlation of BRCAl-loss with other clinical, pathological and molecular features 2.3.5 B R C A 1 and B R C A 2 L O H 2.3.6 B R C A 1 and F A N C F promoter hypermethylation 2.3.7 B R C A 1 I H C protein and R N A levels 2.3.8 Comparison of high-grade serous/undifferentiated E O C with and without BRCAl-loss 2.4 Discussion  iv  17 18 19 19 20 21 22 22 23 24 24 25 25 26 26 27 27 27 28  2.5 References  39  C H A P T E R 3: X E N O G R A F T S O F P R I M A R Y H U M A N G Y N E C O L O G I C A L T U M O R S G R O W N U N D E R T H E R E N A L C A P S U L E O F NOD/SCID M I C E S H O W G E N E T I C AND PHENOTYPIC STABILITY DURING SERIAL T R A N S P L A N T A T I O N 3.1 Introduction 3.2 Materials and Methods 3.2.1 Tumor tissue samples 3.2.2 Xenografts 3.2.3 Tissue microarray construction 3.2.4 Immunohistochemical staining 3.2.5 Tissue microarray analysis 3.2.6 Array comparative genomic hybridization 3.2.7 Analysis of B R C A 1 and B R C A 2 3.3 Results 3.3.1 Histopathology 3.3.2 Immunohistochemistry 3.3.3 Array comparative genomic hybridization 3.3.4 B R C A alterations 3.4 Discussion 3.5 References  42 44 44 45 46 46 47 48 49 49 50 51 51 64  C H A P T E R 4: DISCUSSION A N D C O N C L U S I O N S 4.1 Study Limitations 4.1.1 Recruitment strategy 4.1.2 Limited B R C A 2 analysis 4.1.3 Limitations related to E O C samples 4.1.4. Limitations of real-time Q - R T - P C R analysis 4.2 Implications regarding germline B R C A 1 and B R C A 2 mutations 4.3 Implications of epigenetic BRCAl-loss in E O C 4.4 Fresh tissue xenograft mouse model for E O C 4.5 Implications regarding treatment of E O C : P A R P inhibitors 4.6 Implications of BRCA1 -null xenograft model 4.7 Concluding Remarks » 4.8 References  67 68 68 69 70 71 73 74 75 76 81  A P P E N D I X 1: Detailed Methodologies  83  A P P E N D I X 2: Consent form for collection of tumor tissue  99  A P P E N D I X 3: Consent form for participation in B R C A study  103  A P P E N D I X 4: Ethical approval form  110  LIST O F T A B L E S  Table 2.1  Germline and somatic mutations  33  Table 3.1  Characteristics of tumors  56  Table 3.2  Immunohistochemical staining of primary tumors and corresponding xenografts  57  Table 3.3  MI B - l proliferative indices of primary tumor, intial xenograft and transplantable tumor line  58  Table 4.1  Mutations and unclassified variants  77  Table 4.2  Germline mutations correlated with family history  78  vi  LIST O F FIGURES Figure 2.1  Representative examples of results from assessment of  34  BRCAl-loss Figure 2.2  Summary of B R C A 1 abnormalities and associated features  36  Figure 2.3  Schematic overview of BRCA1 abnormalities  38  Figure 3.1  Histopathology xenografted tumors  59  Figure 3.2  Hierarchical clustering of a C G H data  60  Figure 3.3  B R C A 1 mutation in Case 4  62  Figure 3.4  B R C A 2 mutation and B R C A 1 promoter hypermethylation in Case 1  63  Figure 4.1  Summary of B R C A 1 and B R C A 2 abnormalities and associated features  79  vii  ACKNOWLEDGEMENTS Joshua Press was supported by the Royal College of Physicians and Surgeons of Canada Clinician Investigator Program, and obtained a research grant from the Strategic Training Initiative in Research in Reproductive Health Sciences (STIRRHS). I extend my sincerest gratitude to Dr. Blake Gilks and Dr. David Huntsman for their constant support of my research endeavors. I am also grateful for the support of my committee members, Dr. Dianne Miller and Dr. Nelly Auersperg. In addition, without the guidance of my research collaborator, Alessandro De Luca, none of the research presented in this manuscript would have been possible. I am also grateful to various individuals in Dr. Huntsman's lab who provided academic and technical assistance, including Janine Senz, Lindsay Brown, Leah Prentice, Melinda Miller, Erika Yorida, and Dmitry Turbin. I would also like to acknowledge Dr. Y . Z Wang and Hui Xue for providing tissue from their xenograft mouse model. Lastly, I am grateful to Dr. Peter von Dadelszen for inspiring me to branch out from clinical medicine to explore basic medical research. The work in Chapter 2 was supported by a grant from the Canadian Cancer Society, through the National Cancer Institute of Canada. The work in Chapter 3 was supported in part by NCI Canada grant No. 014053, and a grant from the National Ovarian Cancer Association, Canada. Support was also provided by an unrestricted educational grant from sanofi-aventis, and from OvCaRe, an initiative of the V G H and U B C Hospital Foundation and the B C Cancer Foundation, Vancouver, Canada.  vni  CO-AUTHORSHIP STATEMENT  The two manuscripts represent a collaborative effort between a collective of researchers working on these projects. The author of this thesis (Joshua Press) participated in most aspects of Chapter 2 including: recruitment of patients post-operatively for participation, collection of tumor tissue samples, tumor tissue processing for D N A / R N A extraction, and construction of the tissue microarray. He also performed most laboratory analysis of BRCA1 and B R C A 2 in these tumors including: identification of somatic mutations by denaturing high performance liquid chromatography and direct sequencing, loss of heterozygosity analysis, promoter hypermethylation analysis, real-time PCR analysis of R N A expression, and protein expression analysis by immunohistochemistry. The author managed and organized the data, and performed much of the statistical analysis. In addition, he drafted the manuscript for submission to a peerreviewed journal, and incorporated revisions by co-authors. Work in this manuscript not performed by Dr. Press includes: genetic counseling and identification of germline mutations performed by the clinical staff from the British Columbia Cancer Agency Hereditary Cancer Program, M L P A analysis performed by Dr. Alessandro De Luca, and immunohistochemical staining with clinically validated antibodies performed by the pathology lab at Vancouver General Hospital. With respect to Chapter 3, all work with the xenograft NOD/SCID mice was performed by Hui Xue in the lab of Dr. Y . Z . Wang. The tissue was harvested from these mice and provided to Dr. Press for molecular analysis. Dr. Press then performed the comparative analysis between the primary tumors and xenograft tissue including histopathological examination, array comparative genomic hybridization analysis, tissue microarray construction, immunohistochemical staining, and B R C A 1 / B R C A 2 analysis. The author also participated in  ix  the statistical analysis of this data with the assistance of Dr. Blaise Clarke and Dr. Dmitry Turbin. The manuscript in Chapter 3 was composed by the author of this thesis.  C H A P T E R 1: INTRODUCTION 1.1 Ovarian carcinoma In Canada, ovarian cancer is the leading source of mortality due to gynecological malignancy. It is estimated that 1 in 68 women will develop ovarian cancer during their lifetime, and 1 in 100 women will die from this disease. In 2004 there were 2,300 new cases of ovarian cancer and 1550 deaths related to ovarian cancer (1). There were 267 new cases of ovarian cancer diagnosed in 2003 through the British Columbia Cancer Agency, and 244 related deaths (2). The classification system for ovarian carcinoma is related to the presumed cell of origin based on histological appearance (3). Approximately 90% of ovarian cancer are classified as epithelial ovarian carcinoma, and are thought to arise from the either the surface epithelium surrounding the ovary or the lining of the fallopian tube (4,5). The remaining 10% of ovarian carcinoma include a variety of tumors thought to arise from other progenitor cells, including stromal cells (eg. granulose-theca cell tumors, sertoli-leydig tumors) (6), and germ cells (eg. dysgerminoma, embryonal carcinoma) (7). These non-epithelial ovarian carcinoma represent a distinct category of ovarian tumors, which have fundamentally different cellular features, and thus specific treatment strategies. The remainder of this manuscript will focus on epithelial ovarian carcinoma.  1.2 Clinical features of epithelial ovarian carcinoma Epithelial ovarian carcinomas (EOC) are defined according to stage (extent of disease), histopathology, and grade of tumor. The stage is assigned after comprehensive surgical and pathological examination has determined the full extent of disease. The details of the staging system are complex, but in general terms: Stage I is confined to the ovaries, Stage II to the -1 -  pelvis, Stage III to the abdomen, and Stage IV refers to the presence of distant metastasis beyond the abdomen. Most EOC present as Stage III at the time of diagnosis, but it is unusual to find metastases outside the abdomen (Stage IV). EOC are subclassified based on their histological appearance and grade. Histological subtypes include serous, clear cell, endometrioid, mucinous, and undifferentiated carcinoma (8), and tumor grade is based on architecture, nuclear atypia, and mitotic activity. There is a developing consensus that serous E O C should be graded with a twotier system consisting of either low or high grade, where low grade serous carcinoma are characterized by the presence of mild to moderate nuclear atypia, and less than 13 mitoses per 10 high power fields (9). Most pathologists agree that all clear cell and undifferentiated carcinoma should be classified as high grade. Endometrioid EOC are generally graded from 1-3 (10), but it is often difficult to differentiate between grade 3 endometrioid EOC and high grade serous EOC. Furthermore, grade 3 endometrioid EOC exhibit similar molecular characteristics to high-grade serous EOC and cannot be distinguished from high-grade serous EOC using gene expression profiling (11). Pathological classification of EOC is further complicated by the occurrence of non-invasive tumors, called borderline E O C or EOC of low malignant potential, which exhibit similar morphological characteristics to invasive EOC. Borderline E O C are less aggressive, and even with Stage II or Stage III disease a good prognosis can be achieved with surgery alone (12). In fact, these tumors respond poorly to chemotherapy, and often a good outcome may be achieved with repeated surgical extirpation, even when the tumor has recurred at a distant site.  1.3 Molecular features of epithelial ovarian carcinoma In addition to the morphological differences between these subtypes, there is data indicating that the subtypes also possess distinct genetic and molecular alterations (13). For example, it has been speculated that endometrioid EOC arise in a background of endometriosis (14). Identical PTEN mutations and loss of heterozygosity (LOH) patterns at 10q23 have been -2-  documented in endometriotic cysts and endometriosis coexisting with endometrioid EOC (15, 16).  Furthermore, low-grade endometrioid EOC has been associated with frequent mutation of  CTNNB1, which encodes for B-catenin (17, 18). Interestingly, high-grade endometrioid EOC exhibit similar molecular alterations to high-grade serous EOC, including TP53 mutations and dysfunction of B R C A 1 and B R C A 2 . The serous subtype account for a majority of EOC, and most of these tumors are highgrade. Although low-grade and high-grade serous EOC show similar morphological characteristics, there is accumulating evidence suggesting that they have distinct underlying mechanisms. In fact, many features of low-grade serous EOC are more similar to borderline serous EOC than high-grade serous EOC. For instance, most low-grade invasive serous EOC occur in association with serous borderline tumors (19, 20, 21), while high-grade serous EOC rarely arise within a serous borderline tumor. Mutations in either KRAS or BRAF have been identified in 60% of serous borderline EOC and 68% of low-grade serous carcinoma (22,23). In contrast, the prevalence of K R A S mutations in high grade-serous EOC is between 0-12% (24,25), and B R A F mutations have not been reported in high-grade serous EOC.  Instead, high-  grade serous EOC are characterized by abnormalities in p53 and B R C A 1 / B R C A 2 pathways. TP53 mutations and p53 immunohistochemical overexpression have been identified in > 60% of high-grade serous EOC, whereas p53 abnormalities are uncommon in borderline and low-grades serous EOC (26, 27).  1.4 BRCA1 and BRCA2 genes and epithelial ovarian cancer The characterization of abnormalities in the BRCA1 and BRCA2 genes has provided significant insight into the etiology of EOC and contributed to the prevention of ovarian cancer. The correspondence between family history of breast and ovarian cancer and increased risk of developing breast and/or ovarian cancer has been known for many years. It is estimated that -3 -  heritable factors account for up to 20% of ovarian cancer risk, particularly with respect to highgrade serous or endometrioid subtype (28), while borderline tumors and mucinous tumors occur rarely, i f at all in these patients. A substantial portion of this hereditary risk has been attributed to mutations in two different genes identified in the early 1990's. The BRCA1 gene on chromosome 17q21 was identified by linkage analysis in 1990 (29), and cloned in 1994 (30); the BRCA2 gene was localized to 13ql2-13 and cloned in 1994 (31). Germline mutations in BRCA1 and BRCA2 genes are thought to occur in 10-15% of patients with ovarian cancer (32,33). However, in specific populations, such as Ashkenazi Jewish communities, up to 40% of ovarian cancer has been associated with BRCA1 or B R C A 2 mutations (34). The lifetime risk of developing ovarian cancer is up to 50% for women with a BRCA1 mutation and up to 25% for women with a BRCA2 mutation (35), while the lifetime risk of breast cancer is even higher, with some studies estimating a penetrance of 80%. Moreover, women with B R C A mutations tend to develop cancer at an earlier age - the cumulative risk of breast cancer by the age of 35 in a women with a BRCA1 mutations is 10% (36). Mutations in B R C A 2 have also been correlated with an increased risk of prostate and pancreatic cancer. The BRCA1 gene is located on chromosome 17q21, contains 24 exons, and encodes for a 5.6kb, 1863 amino acid protein. The B R C A 2 gene is located on chromosome 13ql2, contains 26 exons, and encodes for a 10.2kb, 3413 amino acid protein. More than 1230 BRCA1 mutations and more than 1380 B R C A 2 mutations have been identified. The broad diversity of mutations is documented by a routinely updated online database called the Breast Cancer Information Core (BIC) (37). In addition to clearly deleterious mutations (eg. nonsense mutation), there are many genetic changes which result in only minor modification to the proteins, such as single amino acid alterations. The clinical significance of these genetic alterations, called unclassified variants, is still being elucidated. Still, the ability to screen women for BRCA1 and BRCA2 germline mutations has impacted significantly on the prevention of ovarian cancer by identifying -4-  women who would benefit from prophylactic surgery. Performing a bilateral salpingoophorectomy +/- hysterectomy has been shown to significantly reduce the risk of developing ovarian cancer (38,39). As a result, current clinical practice includes offering genetic counseling/screening to women at risk of BRCA1 or BRCA2 mutations, based on a personal or family history of breast or ovarian cancer. Sequencing the entire B R C A 1 and B R C A 2 gene is extremely expensive and timeconsuming, and therefore techniques have been developed to screen D N A for evidence of mutations. At the British Columbia Cancer Agency Hereditary Cancer Program, D N A is extracted from blood and each exon of the B R C A 1 and B R C A 2 gene is screened for mutations using denaturing high performance liquid chromatography (dHPLC).  Any exon showing  evidence of a mutation by dHPLC is then sequenced to determine the exact nature of the mutation. dHPLC has been demonstrated to be a sensitive and cost-effective method for screening of germline BRCA1 and B R C A 2 mutations (40). In contrast, when an individual comes from a family known to carry a specific mutation they are initially assessed by sequencing for the previously identified mutation. Recently, large deletions and duplications have been identified involving the loss or gain of entire exons of B R C A 1 or B R C A 2 (41). These mutations would be missed by conventional screening techniques, and therefore alternative techniques have been developed, such as multiplex-ligation dependent probe amplification (MLPA) (42).  1.5 Function of BRCA1 and BRCA2 genes Since the identification of B R C A 1 and B R C A 2 , there has been extensive research examining the function of these genes, proteins, and their associated pathways. BRCA1 and BRCA2 genes are not closely related to each other based on sequence homology, but the proteins encoded by both genes play a critical role in repair of D N A double strand breaks (43).  Cells  that have BRCA1 or B R C A 2 abnormalities are found to be hypersensitive to chemicals that -5 -  produce double-stranded D N A breaks, including cisplatin and mitomycin C (44). More specifically, B R C A 2 interacts with both RAD51 and B R C A 1, and these proteins have been shown to participate in homologous recombination of double-stranded D N A breaks. If B R C A2 is absent the foci of RAD51 do not form at sites of D N A damage and D N A repair is deficient (45). BRCA1 has been implicated in a variety of control mechanisms beyond D N A repair (homologous recombination and nucleotide excision repair) including cell cycle checkpoint control, ubiquitylation of proteins, retinoblastoma protein hypophosphorylation, centrosome duplication and chromatin remodeling (46).  It is hypothesized that ovarian surface or fallopian  tube epithelial cells in women carrying germline BRCA mutations lose the remaining wild-type allele through another process, such as L O H or promoter hypermethylation (PHM). The resulting dysfunction in D N A repair contributes to genetic instability and the development and progression of EOC.  1.6 BRCA-loss in sporadic epithelial ovarian carcinoma The link between EOC and germline mutations of BRCA1 and BRCA2 has led researchers to investigate the role of B R C A 1 and B R C A 2 in sporadic ovarian cancer. A degree of fundamental similarity between sporadic and hereditary EOC is supported by global mRNA expression profiles (47). However, despite initial expectations that a significant portion of sporadic epithelial ovarian tumors would be found to have somatic mutations in the BRCA1 and BRCA2 genes, studies demonstrate that less than 10% of sporadic ovarian cancers exhibit somatic B R C A 1 mutations in tumor D N A (48, 49). Instead, it has been postulated that BRCA1 and B R C A 2 function may be lost through mechanisms other than D N A mutation (50), as suggested by studies looking at loss of heterozygosity (LOH), B R C A 1 promoter hypermethylation, and decreased BRCA1 R N A and protein expression in EOC. It appears there is a subset of sporadic cancer which, despite the lack of BRCA mutations, exhibit similar genetic -6-  and phenotypic features to familial-BRCAl carcinoma. The concept of a BRCA-loss phenotype in sporadic cancer has also been described in breast carcinoma, where familial-BRCAl tumors segregate strongly with 'basal'-type sporadic cancers using gene-expression profiling(51). These 'basal'-type breast carcinoma, demonstrate expression of basal, myoepithelial-cell-type cytokeratins and are characterized by specific features including ER-, ERBB2-, Cyclin E+, p53+, and p27- (52,53). Furthermore, breast carcinoma with B R C A 1 promoter hypermethylation demonstrate features consistent with this 'basal'-type phenotype (54) Aberrant D N A methylation is a cellular process hypothesized to play an important role in the development of cancer through epigenetic inactivation of important genes. The promoter region of some genes contains clusters of cytosine-guanine dinucleotides which have been termed CpG islands. Mechanisms exist by which a methyl group is attached to the cytosine residue within the CpG island, thereby preventing transcription of the gene (55). Evidence of BRCA1 promoter hypermethylation has been reported in 15-30% of EOC (56,57), and the largest study looking at BRCA1 promoter hypermethylation in EOC found this event in 44/215 (21%) tumors (58). On the contrary, B R C A 2 promoter hypermethylation has rarely been reported in EOC (59). In fact, Gras et al found no evidence of B R C A 2 promoter hypermethylation in a series of 35 EOC analyzed with the use of 5 unique methylation-specific PCR primers (60). Interestingly, B R C A 1 promoter hypermethylation appears a tumor-specific event which is limited to only breast and ovarian cancer (61). In the report by Esteller et al all tumors with BRCA1 promoter hypermethylation were associated with L O H at the BRCA1 locus. L O H is defined as the loss of one allele at a constitutional heterozygous locus, and has been proposed as a contributing event in the inactivation of important tumor suppressor genes. Various mechanisms have been proposed to result in L O H , including localized deletion, mitotic recombination, translocation, chromosome breakage and loss, or non-disjunction event (62). L O H has been proposed as the 'second hit' -7-  mechanism leading to the loss of the remaining wild-type allele in women with germline mutations in BRCA1 and B R C A 1 . Berchuck et al reported BRCA1 L O H in 100% of EOC possessing B R C A 1 mutations compared with only 58% of EOC without B R C A 1 mutations (63). Overall, loss of heterozygosity (LOH) at 17q21 (BRCA1 locus) has been identified in 50-70% of tumors (64), and L O H at 13ql2-ql4 (BRCA2 locus) has been identified in 30-50% of tumors (60). However, the significance of B R C A 1 and B R C A 2 L O H in the absence of associated germline mutations is unknown. Further evidence for BRCA-loss in EOC is provided by studies demonstrating that BRCA1 mRNA and protein expression are decreased in sporadic ovarian tumors (65,66). Studies of B R C A 1 promoter hypermethylation have demonstrated that tumors with BRCA1 promoter hypermethylation show loss of B R C A 1 protein expression when assessed by immunohistochemistry (57). A recent series assessing 230 sporadic EOC found a statistically significant decrease in BRCA1 expression (as determined by immunohistochemistry) with advancing stage of disease (67). This group also performed a rigorous assessment of histopathological subtype and found decreased B R C A expression in 60.5% of serous carcinomas, compared to only <10% of all other EOC subtypes.  The contribution of other  epigenetic phenomena, such as histone modification or post-translational protein modification, to the observed loss of B R C A 1 R N A and protein remains unknown. BRCA1 and B R C A 2 are participants in a complex DNA-repair pathway that involves many other genes and proteins, such as the Fanconi anemia proteins. It is possible that the BRCA-loss phenotype exhibited by some EOC may result from dysfunction of other important proteins within this DNA-repair pathway. For example, a recent report suggested that the B R C A pathway may be inactivated due to promoter hypermethylation of an associated protein in the Fanconi anemia pathway called F A N C F (68). Though epigenetic loss of B R C A 2 through promoter hypermethylation is uncommon, there is evidence that B R C A 2 may be inactivated -8-  secondary to amplification and overexpression of a B R C A 2 interacting protein called E M S Y (69).  1.7 Epithelial ovarian carcinoma tumor models As we gain a better understanding of the underlying molecular mechanisms contributing to EOC there will be increasing focus on the development of novel targeted therapeutics. Testing these therapies will require appropriate pre-clinical models which maintain enough features of the primary human EOC to accurately predict response in human subjects. The need for a suitable in vivo model is illustrated by the recent development of poly(ADP-ribose) polymerase (PARP) inhibitors. These small molecule inhibitors target the inability of B R C A null tumor cells in hereditary EOC to repair double-strand D N A breaks. It is hypothesized that PARP inhibitors should exhibit minimal effect on normal human cells which retain one corresponding wild-type B R C A allele. The selective effect of these molecules on tumor cells has been well documented with in vitro models (70, 71). However, the authors noted that "existing tumor cell models of B R C A 1 and B R C A 2 deficiency are unsuitable for xenograft growth for the testing of small-molecule therapeutics." Traditional ovarian carcinoma models have been derived by immortalizing ovarian carcinoma cells and propagating them within an in vitro culture system. Researchers have transplanted these immortalized cells into immunodeficient mice to create in vivo models for the testing of therapeutics. Unfortunately, many drugs demonstrating efficacy when tested with this type of model have not been effective in humans, suggesting that in vivo models derived from cultured cells do not adequately mimic human tumors (72). Furthermore, as revealed by the PARP inhibitor studies, tumor cells possessing important targets, such as BRCA-loss, may be difficult to establish in vivo.  1.8 Fresh tumor xenograft models of epithelial ovarian carcinoma Ensuring that tumor models more accurately reflect primary human tumors may require the development of a system that maintains some degree of primary tumor architecture and facilitates interactions between stromal cells and tumor cells. The growth of fresh tumor tissue under the renal capsule of immunodeficient mice has been proposed as such a model, resulting in the development of the subrenal capsule assay (SRCA). This technique involves testing chemotherapy regimens against human tumor tissue which has been grown for a short term (eg. 6 days) under the renal capsule of immunodeficient mice (73). The S R C A has been shown to predict chemoresistance and chemoresistance in 97% and 92% of cases respectively (74. Wang et al have been working for a number of years to develop an in vivo tumor model based on growing fresh tumor tissue under the renal capsule of NOD/SCID mice (75). They found that a variety of tumors, including EOC, can be grown in this fashion and retain the morphologic characteristics of the corresponding primary tumor (76). However, it is unclear if this type of model maintains the genetic and phenotypic characteristics of the primary tumor during serial transplantation from mouse to mouse over time. In addition, it is not known if tumor cells possessing significant molecular alterations, such as BRCA-loss, can be maintained with this system.  1.9 Hypotheses and Objectives: The first objective of our project was to determine the prevalence of B R C A 1 and B R C A 2 loss in a prospectively collected, consecutive, unselected series of invasive, non-mucinous EOC. We planned to characterize the mechanisms contributing to this BRCA-loss, and identify associated features, including histopathologic subtype and associated phenotypic markers. We hypothesized that the loss of function of B R C A 1 , B R C A 2 or both is common in high-grade, non-  - 10-  mucinous, invasive EOC. We subjected the series of tumors to comprehensive characterization of B R C A 1 and B R C A 2 abnormalities at the D N A , R N A and protein level. This included analysis of BRCA1 and BRCA2 germline and somatic mutations, BRCA1 and BRCA2 L O H , BRCA1 promoter hypermethylation, BRCA1 and B R C A 2 R N A expression, and BRCA1 protein expression. We also performed a panel of IHC stains with well characterized biomarkers to determine i f the subsets of EOC identified during our B R C A analysis exhibited a unique phenotype. This material is presented in Chapter 2. The second objective of our project was to establish the stability of the xenograft mouse model for EOC developed in the lab of Y . Z Wang. Fresh tumor tissue from high-grade E O C was grown under the subrenal capsule of NOD/SCID mice, and then this tissue was serially transplanted from mouse to mouse for multiple generations. We hypothesized that these EOC tumors would maintain morphologic, genetic and phenotypic stability over successive transplants, and maintain potential therapeutic targets, including BRCA1 abnormalities identified from our first objective discussed above. This material is presented in Chapter 3. Detailed methodology not provided in the manuscripts presented in Chapter 2 and Chapter 3 is included in Appendix 1. The consent form for tumor tissue banking is provided in Appendix 2. The consent form for the BRCA-loss study is provided in Appendix 3. Ethical approval was obtained from the University of British Columbia Clinical Research Ethics Board (Appendix 4).  1.10 References 1. Canadian Cancer Statistics 2004. Available from: http://www.cancer.ca 2. British Columbia Cancer Agency - Statistics by cancer type. Available from: http://www.bccancer.bc.ca/HPI/CancerStatistics/FF/CaType/OV.htm 3. Scully R E , Young R H , Clement PB. Tumors of the ovary, maldeveloped gonads, fallopian tube, and broad ligament. In: Rosai J, Sobin L H , eds. Atlas of tumour pathology, 3 Series. Washington, DC: Armed Forces Institute of Pathology, 1998. rd  4. Choi K C , Auersperg N . The ovarian surface epithelium: simple source of a complex disease. Minerva Ginecol 2003;55:297-314. 5. Kindelberger DW, Lee Y , Miron A , et al. Coexisting intraepithelial carcinoma of the fimbria and pelvic serous carcinoma: frequency and evidence for a causal relationship. A m J Surg Pathol 2006 (in press). 6. Schumer ST, Cannistra SA. Granulosa cell tumor of the ovary. J Clin Oncol 2003;21:1180-9. 7. Roth L M , Talerman A . Recent advances in the pathology and classification of ovarian germ cell tumors. Int J Gynecol Pathol 2006;25:305-20. 8. Cannistra SA. Cancer of the ovary. N Engl J Med 2004;351:2519-29. 9. Malpica A , Deavers M T , L u K, et al. Grading ovarian serous carcinoma using a two-tier system. A m J Surg Pathol 2004;28:496-504. 10. Silverberg SG. Histopathologic grading of ovarian carcinoma: a review and proposal. Int J Gynecol Pathol 2000;19:7-15 11. Schwartz DR, Kardia SL, Shedden K A , et al. Gene expression in ovarian cancer reflects both morphology and biological behavior, distinguishing clear cell from other poor-prognosis ovarian carcinomas. Cancer Res 2002;62:4722-9 12. Gilks C B , Alkushi A , Yue JJW, Lanvin D, Ehlen TG, Miller D M . Advanced-stage serous borderline tumors of the ovary: A clinicopathological study of 49 cases. Int J Gynecol Pathol 2003;22:29-36. 13. Bell D A . Origins and molecular pathology of ovarian cancer. Modern Pathol 2005; 18 :S 1932. 14. Jiang X , Morland SJ, Hitchcock et al. Allelotyping of endometrioisis with adjacent ovarian carcinoma reveals evidence of a common lineage. Cancer Res 1990;58:1707-12. 15. Sato N , Tsunoda H , Nishida M , et al. Loss of heterozygosity on 10q23.3 and mutation of the tumor suppressor gene P T E N in benign endometrial cyst of the ovary: possible sequence progression from benign endometrial cyst to endometrioid carcinoma and clear cell carcinoma of the ovary. Cancer Res 2000;60:7052-6. 16. Obata K , Morland SJ, Watson R H , et al. Frequent P T E N / M M A C mutations in endometrioid but not serous or mucinous epithelial ovarian tumors. Cancer Res 1998;58:2095-7. 17. Wu R, Zhai Y , Fearon ER, et al. Diverse mechanisms of (3-catenin deregulation in ovarian endometrioid adenocarcinomas. Cancer Res 2001 ;61:8247-55. 18. Gamallo C, Palacios J, Moreno G, et al. p-catenin expression pattern in stage I and II ovarian carcinomas. Relationship with P-catenin gene mutations, clinicopathological features and clinical outcome. A m J pathol 1999;155:527-36. - 12-  19. Smith Sehdev A E , Sehdev PS, Kurrnan RJ. Noninvasive and invasive micropapillary (lowgrade) serous carcinoma of the ovary: a clinicopathologic analysis of 135 cases. A m J Surg Pathol 2003;27:725-36. 20. Eichhorn JH, Bell D A , Young R H , et al. Ovarian serous borderline tumors with micropapillary and cribriform patters: a study of 40 cases and comparison with 44 cases without these patterns. A m J Surg Pathol 1999;23:397-409. 21. Burks RT, Sherman M E , Kurrnan RJ. Micropapillary serous carcinoma of the ovary. A distinctive low-grade carcinoma related to serous borderline tumors. A m J Surg Pathol 1996;20:1319-1330. 22. Singer G, Oldt III R, Cohen Y , et al. Mutations in B R A F and K R A S characterize the development of low-grade ovarian serous carcinoma. J Natl Cancer Inst 2003;95:484-6. 23. Sieben N L G , Macropoulos P, Roemen G M J M , et al. In ovarian neoplasms, B R A F , but not K R A S , mutations are restricted to low-grade serous tumours. J Pathol 2004;202:336-340. 24. Haas CJ, Diebold J, Hirschmann A , et al. In serous ovarian neoplasms the frequency of K i ras mutations correlates with their malignant potential. Virchows Arch 1999;434:117—120. 25. Caduff R, Svoboda-Newman S, Ferguson A , et al. Comparison of mutations of Ki-Ras and p53 immunoreactivity in borderline and malignant epithelial ovarian tumors. A m J Surg Pathol 2001;23:323-328. 26. Kohler M F , Kerns B M , Humphrey PA, et al. Mutation and over expression of p53 in earlystage epithelial ovarian cancer. Obstet Gynecol 1993;81:643-650. 27. Chan W Y , Cheung K K , Schorge JO, et al. Bcl-2 and p53 protein expression, apoptosis, and p53 mutation in human epithelial ovarian cancers. A m J Pathol 2000;156:409-417. 28. Lichenstein P, Holm N V , Verkasalo PK, Iliadou A , Kaprio J, Koskenvuo M , Pukkala E, Skytthe A , Hemminki K . Environmental and heritable factors in the causation of cancer analyses of cohort of twins from Sweden, Denmark, and Finland. N Engl J Med 2000;343:7885. 29. Hall J M , Lee M K , Newman B, et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-9. 30. M i k i Y , Swensen J, Shattuck-Eidens D, et al. A strong candidate for the breast and ovarian cancer susceptibility gene B R C A 1 . Science 1994;266:66-71. 31. Wooster R, Bignell G, Lancaster J, et al. Identification of the breast cancer susceptibility geneBRCA2. Nature 1995;378:789-92. 32. Risch H A , McLaughlin JR, Cole De et al. Prevalence and penetrance of germline BRCA1 and B R C A 2 mutations in population series of 649 women with ovarian cancer. A m J Hum Genet 2001; 68:700-710. - 13 -  33. Pal T, Permuth-Wey J, Berts JA, et al. BRCA1 and B R C A 2 mutations account for a large proportion of ovarian carcinoma cases. Cancer 2005;104:2807-16. 34. Moslehi R, Chu W, Karlan B, et al. BRCA1 and B R C A 2 mutation analysis of 208 Ashkenazi women with ovarian cancer. A m J Human Genet 2000;66:1259-72. 35. King M C , Marks JH, Mandell JB. Breast and Ovarian Cancer Risk due to inherited mutations in BRCA1 and B R C A 2 . Science 2003;203:643-6. 36. Antoniou A , Pharoah PD, Narod S, et al. Average risk of breast and ovarian cancer associated with BRCA1 or B R C A 2 mutations detected in case series unselected for family history: a combined analysi of 22 studies. A m J Hum Genet 2003;72:117:30. 37. Breast Cancer Information Core (BIC). Available from: http://research.nhgri.nih.gov/bic/ 38. Kauff N D , Satagopan J M , Robson M E , et al. Risk reducing salpingo-oophorectomy in women with a B R C A 1 or B R C A 2 mutation. N Engl J Med 2002;346:1609-15. 39. Rebbeck TR, Lynch HT, Neuhausen SL, et al. Prophylactic oophorectomy in carriers of BRCA1 and B R C A 2 mutations. New Engl J Med 2002;346:1616-22. 40. Wagner T, Stoppa-Lyonnet D, Fleischmann E, et al. Denaturing high-performance liquid chromatography detects reliably B R C A 1 and B R C A 2 mutations. Genomics 1999;62:369-376. 41. Woodward A M , Davis TA, Silva A G S , Kirk JA, Leary JA. Large genomic rearrangements of both B R C A 2 and BRCA1 are a feature of inherited breast/ovarian cancer phenotype in selected families. J Med Genet 2005;42:31-5. 42. Mazoyer S. Genomic rearrangements in the B R C A 1 and B R C A 2 genes. Hum Mutat 2005;415-22. 43. Hartman A R , Ford J M . BRCA1 induces D N A damage recognition factors and enhances nucleotide excision repair. Nat Genet 2002;32:180-4. 44. Moynanhan, M E , Cui T Y , Jasin M . Homology-directed D N A repair, mitomycin-c resistance, and chromosome stability is restored with correction Of a B R C A 1 mutation. Cancer Res 2001;61:4842-50. 45. Wong A K , Pero R, Ormonde PA, Tavtigian SV, Bartel PL. RAD51 interacts with the evolutionarily conserved B R C motifs in the human breast cancer susceptibility gene B R C A 2 . J Biol Chem 1997;272:31941-31944. 46. Narod SA, Foulkes WD. BRCA1 and B R C A 2 : 1994 and Beyond. Nature Rev Cancer 2004; 4: 665-676. 47. Jazaeri A A , Yee CJ, Sotiriou C, Brantley K R , Boyd J, Liu ET. Gene Expression Profiles of BRCA1-Linked, BRCA2-Lined, and Sporadic Ovarian Cancers. J Natl Cancer Inst. 2002;94: 990-1000. -14-  48. Berchuck A , Heron K A , Carney M E , et al. Frequency of Germline and Somatic BRCA1 Mutations in Ovarian Cancer. Clinical Can Res 1998;4:2433-7. 49. Merajver SD, Pham T M , Caduff RF, et al. Somatic mutations in the B R C A gene in sporadic ovarian carcinomas. Nat Genet 1995;9:439-443 50. Turner N , Tutt A , Ashworth A . Hallmarks of 'BRCAness' in sporadic cancers. Nature Rev Can 2004;4:1-6. 51. Sorlie T, Tibshirani R, Parker J, et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acd Sci U S A 2003;100:8418-23. 52. Foulkes WD, Stefansson IM, Chappuis PO, et al. Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J Natl Cancer Inst 2003;95:1482-5. 53. Korsching E, Packeisen J, Agelopoulos K , et al. Cytogenetic alterations and cytokeratin expression patterns in breast cancer: integrating a new model of breast differentiation into cytogenetic pathways of breast carcinogenesis. Lab Invest 2002;82:1525-33. 54. Catteau A , Harris W H , X u CF, et al. Methylation of the BRCA1 promoter region in sporadic breast and ovarian cancer: correlation with disease characteristics. Oncogene 1999;18:1957-65. 55. Plass C. Cancer epigenomics. Hum Mol Genet 2002;11:2479-2488. 56. Esteller M , Silva J M , Dominguez G, et al. Promotor hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumours. J Natl Cancer Inst 2000;92:564-9. 57. Baldwin R L , Nemeth E, Tran H , et al. BRCA1 promoter region hypermethylation in ovarian carcinoma: a population based study. Cancer Res 2000;60:5329-33. 58. Wiley A , Katsaros D, Chen H , et al. Aberrant promoter methylation of mutliple genes in malignant ovarian tumours and in ovarian tumours with low malignant potential. Cancer 2006;107:299-308. 59. Hilton JL, Geisler JP, Rathe JA, et al. Inactivation of B R C A 1 and B R C A 2 in ovarian cancer. J Natl Cancer Inst 2002;94:1396-1406. 60. Gras E , Cortes J, Diez O et al. Loss of heterozygosity on chromosome 13ql2-ql4, B R C A 2 mutations, and lack of B R C A 2 promoter hypermethylation in sporadic epithelial ovarian tumors. Cancer 2001;92:787-795. 61. Bianco T, Chenevix-Trench G, Walsh DC, Cooper JE, and Dobrovic A . Tumour-specific distribution of B R C A 1 promoter region methylation supports a pathogenetic role in breast and ovarian cancer. Carcinogenesis 2000:21:147-151. 62. Thiagalingam S, Foy R L , Cheg K , et al. Loss of heterozygosity as a predictor to map tumor suppressor genes in cancer: molecular basis of its occurrence. Curr Opin Oncol 2002;14:65-72. -15 -  63. Berchuck A , Heron K, Carney M E , et al. Frequency of germline and somatic BRCA1 mutations in ovarian cancer. Clin Cancer Res 1998;4:2433-37. 64. Futreal PA, Liu Q, Shattuck-Eidens D et al. B R C A 1 mutations in primary breast and ovarian carcinomas. Science 1994;266:326-30. 65. Zheng W, Luo F, Lu JJ, Baltayan A , Press M F , Zhang Z, Pike M . Reduction of B R C A 1 expression in sporadic ovarian cancer. Gynecol Oncol 2000;76:294-300. 66. Russell PA, Pharoah PDP, Foy K D , Ramus SJ, Symmonds I, Wilson A , Soctt I, Ponder B A J , Gayther SA. Frequent loss of B R C A 1 m R N A and protein expression in sporadic ovarian cancers. Int J Cancer 2000;87:317-321. 67. Thrall M , Gallion H H , Kryscio R, et al. B R C A 1 expression in a large series of sporadic ovarian carcinomas: a Gynecologic Oncology Group study. Int J Gynecol Cancer 2006; 6:16671. 68. Taniguchi T, Tischkowitz M , Ameziane N , et al. Disruption of the fanconi anemia-BRCA pathway in cisplatin-sensitive ovarian tumors. Nat Med 2003;9:568-74. 69. Brown L A , Irving J, Parker R. Amplification of E M S Y , a novel oncogene on 1 l q l 3 , in high grade ovarian surface epithelial carcinomas. Gynecol Oncol 2006;100:264-70. 70. Farmer H , McCabe N , Lord CJ, et al. Targeting the D N A repair defect in B R C A mutant cells as a therapeutic strategy. Nature 2005;434:917-21. 71. Bryant HE, Schultz N , Thomas HD, et al. Specific killing of B R C A - 2 deficient tumors with inhibitors of poly(ADP-ribose) polymerase. Nature 2005; 434: 913-7. 72. Kerbel RS. Human Tumor xenografts as predictive preclinical models for anticancer drug activity in humans. Cancer Bio Therapy 2003;2:S134-S139 73. Bogden A E , Cobb WR, Lepage DJ, et al. Chemotherapy responsiveness of human tumors as first transplant generation xenografts in the normal mouse : six-day subrenal capsule assay. Cancer 1981 ;48(1): 10-20. 74. Fiebig H H , Schuchhart C, Henss H , Fiedler L, Lohr GW. Comparison of tumor response in nude mice and in the patients. Behring Inst Mitt 1984;74:343-52. 75. Wang Y Z , Sudilovsky D, Cao M , et al. Establishing efficient xenograft models of low-grade human prostate cancer. Eur Urol 2003;2:30 76. Lee C, Xue H, Sutcliffe M , Gout PW, Huntsman D G , Miller D M , Gilks C B , Wang Y Z . Establishment of subrenal capsule xenografts of primary human ovarian tumors in SCID mice: potential models. Gynecol Oncol 2005;96:48-55.  - 16-  CHAPTER 2:  MOST HIGH-GRADE SEROUS/UNDIFFERENTIATED EPITHELIAL OVARIAN CARCINOMA SHOW BRCA1 LOSS  1  2.1 Introduction The subclassification of epithelial ovarian carcinoma (EOC) is based on histopathologic features, especially tumor cell type (eg. serous, endometrioid, clear cell) (1,2). These histological subtypes have been associated with particular underlying molecular genetic abnormalities (3), and different responses to chemotherapy (4). One important molecular feature providing insight into the etiology of EOC is the link between germline BRCA1/BRCA2 gene mutations and E O C (5). Germline mutations in BRCA1 and BRCA2 are present in 10-15% of EOC (6, 7) and women with BRCA1 or BRCA 2 mutations have a lifetime ovarian cancer risk of 25% and 50%, respectively (8, 9). These women generally develop tumors of high-grade serous histology (10). Despite a low prevalence of somatic BRCA1 and BRCA2 mutations in sporadic EOC (<10%) (11), it has been postulated that BRCA1 and B R C A 2 loss may be important in sporadic tumors through mechanisms other than D N A mutation (12). There is evidence that B R C A 1 mRNA and protein expression are frequently decreased in sporadic ovarian tumors (13, 14). Loss of heterozygosity (LOH) at 17q21 (BRCA1 locus) has been identified in 50-70% of EOC (15) and L O H at 13ql2-ql4 (BRCA2 locus) has been identified in 30-50% of tumors (16).  A version of this chapter will be submitted for publication. Press JZ, De Luca A, Young S, Ridge Y, Kaurah P, Kalloger SE, Smith M , Miller DM, Horsman D, Gilks CB, Huntsman DG. Most high-grade serous/undifferentiated epithelial carcinoma show BRCA1 loss. Clin Cancer Res 2006. 1  - 17-  Epigenetic loss through promotor hypermethylation of the BRCA1 gene has been demonstrated in approximately 20% of EOC (17, 18, 19). In a large series of sporadic EOC, decreased BRCA1 expression (as determined by immunohistochemistry) was seen in 60.5% of serous carcinomas (20); decreased BRCA1 expression was significantly associated with serous subtype and advanced stage disease. There is no single assay for BRCA1 function. Examination of a series of cases with a single assay, whether for BRCA1 protein with immunohistochemistry, or promoter hypermethylation, or gene sequencing does not fully characterize B R C A 1 loss, so that the prevalence of BRCA1 loss in EOC remains unknown. The objective of this study was to determine the prevalence of B R C A 1 loss in a consecutive, unselected series of invasive EOC and correlate BRCA1 loss with other pathologic features.  2.2 Materials and methods  2.2.1 Recruitment and tumor samples. This study was undertaken at the Vancouver General Hospital and British Columbia Cancer Agency in Vancouver, British Columbia, Canada, which is the primary referral center for patients with EOC for the province. Between January 2004 and September 2005 all women undergoing primary debulking surgery for ovarian carcinoma and who had consented preoperatively to the banking of tumor tissue were approached by JZP after surgery. Women diagnosed with mucinous and borderline tumors, as well as women who had received pre-operative chemotherapy were excluded. Pathology was reviewed by a single pathologist (CBG). Serous tumors were classified as low or high-grade as described previously (21), while undifferentiated and clear cell carcinomas were all considered high-grade. Endometrioid carcinomas were graded as grade 1, 2, or 3 according to the Silverberg grading system (22). Women interested in the project were referred to genetic counselors to discuss - 18-  germline B R C A testing. A l l germline testing results were provided to the participants through a post-test counseling session, and the family members of all germline mutation carriers were offered genetic counseling and testing, through the Hereditary Cancer Program. Ethical approval was obtained from the University of British Columbia Ethics Board.  2.2.2 DNA and RNA extraction. Pathologically extraneous cancer tissue was stored at -80 degrees and corresponding tissue was placed in paraffin blocks. H & E sections corresponding to the selected frozen tissue samples were reviewed to ensure that samples consisted of at least 70% tumor cells. Lymphocyte D N A was extracted from whole blood for germline analysis and tumor D N A was extracted for somatic analysis using the Puregene D N A Purification Kit (Gentra Systems, Inc, Wicklow, Ireland) according to manufacture's instructions. R N A was isolated with Trizol (Invitrogen, Carlsbad, CA) according to standard protocols. D N A and R N A were quantified using a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, DE). R N A quality was confirmed using primers designed to amplifying G A P D H .  2.2.3 Loss of heterozygosity analysis. Somatic loss of B R C A 1 / B R C A 2 in tumor tissue was assessed by L O H studies using microsatellite markers. Fluorescence labeled primers were created to amplify polymorphic loci located within or adjacent to the BRCA1 and B R C A 2 genes. Polymerase chain reactions were performed in 25-p.l final volume containing 2.5 ul of lOx P C R buffer, 1.5ul of 25mM M g C l , 0.5ul of lOmM dNTPs, 1.5ul of lOmM primers, 100 ng germline 2  or tumor D N A , and 0.125ui AmpliTaq Gold (Applied Biosystems, Foster City, CA). P C R conditions were initial denaturation at 94°C for 11 minutes followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at primer specific temperature (shown below) for 30 seconds, and extension at 72°C for 1 minute, followed by a final extension step at 72°C for 7 minutes.  - 19-  BRCA1 markers included D17S855 (60°C), D17S1185 (58°C), D17S1323 (56°C), and D1325 (56°C) (23), and B R C A 2 markers included D13S260 (60°C), D13S171 (50°C), D13S267 (53°C), D13S217 (55°C) (16). For marker D17S1185, 1.25ul D M S O was added to the mixture. PCR products were suspended in formamide containing ROX500 ladder (Applied Biosystems, Foster City, CA), electrophoresized in an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA), and analyzed with Genescan v3.1 software (Applied Biosystems, Foster City, CA). A commercial multiplex PCR based assay (PowerPlex™ 1.2 kit; Promega, Madison, WI) including 8 microsatellite loci (D16S539, D7S820, D13S317, D5S818, CSF1PO, TPOX, TH01, and vWA) from throughout the genome was used as per manufactures instructions to determine i f LOH/MSI at the BRCA1 and B R C A 2 loci were gene specific. L O H was defined as a complete or partial (at least 50%) signal reduction of one of the two corresponding alleles in the matching tumor D N A and normal D N A in at least one marker. Microsatellite instability (MSI) was defined as the presence of novel alleles in the tumor D N A that were not present in normal D N A in at least one marker. (24).  2.2.4 dHPLC mutation screening and mutation analysis. Screening for germline BRCA1 and BRCA2 mutations from lymphocyte D N A , and somatic BRCA1 and BRCA2 mutations from tumor D N A , was performed using denaturing high performance liquid chromatography (dHPLC). To ensure that somatic mutations were not missed by dHPLC screening due to L O H , tumor D N A was mixed in a 3:1 ratio with corresponding germline D N A for all tumors shown to possess L O H by microsatellite analysis (25). A tumor derived from a BRCA1 germline carrier with documented L O H was tested with serial dilutions to ensure that this 3:1 ratio resulted in a clearly visible dHPLC peak abnormality. PCR primers and conditions were developed by the Royal Melbourne Hospital (Australia) and are available on request (MS). PCR primers were used to amplify each exon of BRCA1 (24 exons) and BRCA2 (26 exons). A l l exons with -20-  abnormal dHPLC profiles were then sequenced to identify the nature of the mutation. PCR was performed in 25-ul final volume containing 2.5 ul of lOx PCR buffer with 10 m M of MgS04 (Roche Diagnostics Mannheim, Germany), 200uM dNTPs, 0.6uM primers, 50 ng tumor D N A , and 0.5U Pwo enzyme (Roche Diagnostics, Mannheim, Germany). A touchdown protocol was used to amplify all amplicons, consisting of an initial denaturation at 95 °C for 2 minutes was followed by 14 cycles of denaturation at 95°C for 30 seconds, 1 minute of annealing (decreasing by 0.5°C from 62°C to 55°C with each cycle) and extension at 72°C for 1 minute. Subsequently, 20 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute were performed, followed by a final extension step at 72°C for 7 minutes. PCR products were gel purified with QIAquick gel extraction kit (Qiagen, Mississauga, ON), and bi-directional sequencing was performed using A B I BigDye terminator v3.1 cycle sequencing kit (Applied Biosytems, Foster City, CA) and an A B I Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA).  2.2.5 MLPA screening. For the identification of germline BRCA1 single and multiple exon deletions or duplications, multiplex ligation-dependent probe amplification analysis (MLPA) kits S A L S A P002 BRCA1 and S A L S A P087 BRCA1 (MRC Holland, Amsterdam,NL) were used in the conditions suggested by the manufacturer. Amplified samples were denatured and separated by capillary electrophoresis on an A B I 3100 sequencer (Applied Biosystems, Foster City, CA). Data analysis was done by exporting the peak area to an Excel file. For normalization, relative probe signals were calculated by dividing the peak area of each test and control probe by the sum of all peak areas of that sample. The ratio of each individual relative probe area was then normalized to the mean obtained with five control samples for that specific probe (26).  -21 -  2.2.6 BRCA1 and FANCFpromoter hypermethylation analysis. The BRCA1 methylation status of each tumor was assessed using methylation-specific PCR (27) after tumor D N A was treated with sodium bisulfite to convert the cytosines in CpG islands to uracil. A methylation positive control was prepared by treating normal D N A with SssI methylase and normal human germline D N A was used as a negative control. Two different sets of primers located at different regions on the BRCA1 promoter were used. Primers were derived from Esteller et al (17) and Baldwin et al (18), and corresponding PCR protocol from these publications was replicated. F A N C F promoter hypermethylation was assessed using a Hpall restriction digest assay and a methylation-specific PCR protocol according to the protocol reported by Taniguchi et al (28).  2.2.7Real-time Q-RT-PCRfor BRCA1. The extracted R N A was treated with DNAse I (Invitrogen, Carlsbad, C A ) prior to creating c D N A using random hexamer priming and M M L V reverse transcriptase (Invitrogen, Carlsbad, CA). Applied Biosystems BRCA1 Taqman primer/probe kit (Hs00173233_ml) was used to quantify the mRNA expression level using realtime Q-RT-PCR (29). Quantification of gene expression was performed using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA). Relative gene expression quantification was calculated according to the comparative Ct method using human 18S ribosomal R N A (Applied Biosystems, Foster City, C A ) as an endogenous control and commercial R N A controls (Stratagene, L a Jolla, CA) as calibrator. Relative quantification was determined as follows:  2  ^  A C t s a m  P  | e  -  A C t c a l i b r a t o r  )  where ACt values of the calibrator and sample are  determined by subtracting the Ct value of the target gene from the value of the ribosomal R N A gene. Final results were obtained comparing relative gene expression quantification for each tumor against the average of all the tumors and a ratio less than 0.7 was scored as BRCA1 or B R C A 2 loss of mRNA expression.  -22-  2.2.8 Immunohistochemistry. Tissue for imrnunohistochemistry (IHC) was received fresh from the operating room and representative sections of tumor were fixed overnight in 10% neutral buffered formalin. Hematoxylin and eosin (H&E) stained sections of the primary tumor were reviewed and representative areas of tumor were selected and marked. Corresponding areas on the paraffin blocks were marked and two tissue cores from the representative areas in the donor blocks were removed using a Tissue Microarrayer (Beecher Instruments, Silver Spring, M D ) with a 0.6mm diameter needle and inserted into a single recipient paraffin block. Sections were cut from the tissue microarray (TMA) block using a standard microtome (4 pm). The T M A sections were deparaffinized in xylene and then rehydrated in ethanol. For BRCA1 immunohistochemistry an antibody against BRCA1 (Oncogene, Ab-1, 1:50 dil'n), was used and antigen retrieval was performed in l x E D T A buffer (pH 8.0) by micro waving for 2 minutes, and then boiling in a waterbath for 30 minutes. Endogenous peroxide activity was blocked with 3% hydrogen peroxide and then sections were incubated with 2.5% normal horse blocking serum. Following incubation with the primary antibody the Vector Laboratories (Burlingame, CA) ImmPRESS kit was used according to the manufacturer's recommendations to visualize the antibody complexes. Nuclear staining was assessed by B G , who was blinded to all other B R C A analysis. Tumors were considered BRCA1 positive i f greater than 5% of tumor nuclei showed staining. IHC was also performed with the following panel of previously validated antibodies, using a Ventana (Tucson, Az) automated immunostainer, according to the manufacturer's recommendations: P-catenin (BD Transduction,San Jose, C A , clone C14, 1:200 dil'n), E cadherin (Zymed Laboratories, San Francisco, C A , clone HECD-I , 1:4 dil'n), p21 (Neomarkers, Fremont, C A , clone DCS-60.2, 1:100 dil'n), p27 (Neomarkers, Fremont, C A , clone DCS-72.F6, 1:100 dil'n ), p53 (Dako, Carpinteria, C A , clone DO-7, 1:400 dil'n), Cyclin D l (Neomarkers, Fremont, C A , clone SP-4, 1:100 dil'n), PR (Neomarker, Fremont, C A , clone SP-2, 1:400 dil'n), E R (Neomarker, Fremont, C A , clone SP-1, 1:200 dil'n), EGFR (Zymed -23 -  Laboratories, San Francisco, C A , 31G7, 1:20), and WT-1 (Dako, Carpinteria, C A , clone 6F-H2, 1:50 dil'n). BRCA1 IHC was done on whole sections, unlike other IHC markers used in this study which were assessed using tissue microarray sections, as BRCA1 immunostaining was found to be relatively weak.  2.2.9 Data analysis. B R C A 1 loss was defined as having 3 or 4 of the following results: low relative BRCA1 R N A expression, negative BRCA1 IHC, BRCA1 L O H and BRCA1 promoter P M H . Tumors showing only one or none of these results were considered to not have BRCA1 loss. Tumors showing 2 of these 4 results were considered indeterminate for B R C A 1 loss. A chi-squared test was used to analyze categorical variables (LOH, IHC, Powerplex) and a student's t-test was used to analyze continuous variables (RNA expression). Sensitivity of mRNA expression or IHC for detecting patients who harbor BRCA1 germline mutations was defined as the proportion of cases with germline B R C A 1 mutations that had BRCA1 loss of mRNA expression or stained negative for BRCA1 IHC, respectively. Specificity was defined as the proportion of cases without germline B R C A 1 mutations who lacked B R C A 1 loss of mRNA expression or had positive IHC result, respectively.  2.3 Results  2.3.1 Cases with BRCA1 and BRCA2 mutations. Forty-nine women with invasive, nonmucinous EOC were recruited. A l l germline mutations and somatic mutations identified by mutation screening are listed in Table 2.1. A n example of the results of BRCA1 mutational analysis is shown as Figure 2.1 A and 2.IB. Mutations were only found in high-grade serous/undifferentiated EOC and included 8/49 (16%) BRCA1 germline mutations, 2/49 (4%) BRCA2 germline mutations, 1/49 (2%) BRCA1 somatic mutation and 1/49 (2%) BRCA2 somatic -24-  mutation. There were also 7 BRCA] unclassified variants and 15 BRCA2 unclassified variants identified during mutation screening (data not shown). There were no point mutations and no interstitial deletions identified on B R C A 1 M L P A analysis (data not shown).  2.3.2 Molecular changes associated with BRCA1 mutations. Seven of nine tumors with BRCA1 mutations also showed BRCA1 L O H . Representative results of L O H analysis are shown as Figure 2.1, C and D. Two of 9, including on case with BRCA1 L O H , showed BRCA1 promoter hypermethylation (PHM), and one was associated with microsatellite instability (MSI). Representative results of P H M and MSI analysis are shown in Figure 2.1, E and F. In 8/9 tumors from women with BRCA1 mutations the relative BRCA1 R N A expression was <0.7, and 9/9 were BRCA1 IHC negative. B R C A IHC typically showed variable intensity of staining of tumor nuclei, with less than 50% of nuclei staining positively in most IHC positive cases. Representative results of B R C A 1 IHC are shown as Figure 2.1, G and H . A l l tumors with B R C A 2 mutations had associated BRCA2 L O H , and 2/3 showed B R C A 2 relative R N A expression <0.7 (data not shown).  2.3.3 Cases without BRCA1 or BRCA2 mutations. Germline and somatic mutations were not present in clear cell, endometrioid, and low-grade serous carcinoma. The remaining cases of high-grade serous/undifferentiated carcinomas lacking mutations in either BRCA1 or BRCA2 fell into two main groups: 12 cases with evidence of B R C A 1 loss and 12 cases with no evidence of BRCA1 loss. Finally there were two tumors considered indeterminate for B R C A 1 loss. One showed decreased R N A expression and negative B R C A 1 IHC while the other showed negative BRCA1 IHC and L O H .  -25-  2.3.4 Correlation of BRCA1 loss with other clinical, pathological and molecular features. A graphical overview of BRCA1 abnormalities and other clinical, pathological and molecular abnormalities for all 49 cases is presented in Figure 2.2. Evidence of epigenetic BRCA1 loss was identified in 12/49 (24%) sporadic tumors and all of these tumors were high-grade serous/undifferentiated carcinoma. BRCA1 promoter hypermethylation was identified in 10/12 of these tumor, and this was associated with BRCA1 L O H , relative B R C A 1 R N A expression <0.7 and negative B R C A 1 IHC. There was a strong correlation between low BRCA1 R N A expression levels and B R C A 1 promoter hypermethylation (p = 0.0031). The 4 clear cell carcinomas, 5 endometrioid carcinoma, and 2 low-grade serous carcinomas in our series did not show B R C A 1 loss. The histopathological classification of these tumors was supported by WT1 IHC staining which was negative for clear cell and endometrioid carcinoma, but positive for lowgrade serous carcinoma (Figure 2.2). B R C A 1 promoter hypermethylation was identified in one clear cell carcinoma and BRCA1 L O H was identified in another clear cell carcinoma, however, these clear cell tumors exhibited positive BRCA1 IHC.  2.3.5 BRCA1 and BRCA2 LOH. L O H was common at the BRCA1 locus [32/48 (67%)] and the BRCA2 locus [25/48 (52%)]. Although L O H at the BRCA1 locus was very common in highgrade serous/undifferentiated tumors and correlated with negative BRCA1 IHC (p = 0.006), the occurrence of L O H alone did not correlate with low relative B R C A 1 R N A expression (p = 0.60). BRCA2 L O H almost invariably accompanied BRCA1 L O H ; there was only one case (#198) which had L O H at B R C A 2 in the absence of L O H at BRCA1. BRCA1 L O H was correlated with B R C A 2 L O H (p = 0.001). The powerplex assay for 8 polymorphic loci across the genome showed that there were only rare loci showing L O H in low-grade serous, endometrioid and clear cell carcinoma, in contrast to the very frequent L O H seen in high-grade serous/undifferentiated carcinomas, irrespective of BRCA] mutation status or B R C A 1 expression. Finding L O H at 50% -26-  or more of informative markers assessed by the powerplex assay was correlated with BRCA1 L O H (p = 0.001) and B R C A 2 L O H (p -= 0.001). Microsatellite instability (MSI) at the BRCA1 and BRCA2 loci was identified in 4/48 (8.3%) tumors, and powerplex analysis for 8 polymorphic tri- and tetranucleotide repeat elements from across the genome demonstrated MSI at all other loci tested in these tumors.  2.3.6 BRCA1 and FANCF promoter hypermethylation. Hypermethylation of the BRCA1 promoter was found in 13/49 (27%) tumors. In 12/13 cases BRCA1 promoter hypermethylation was identified with the use of both sets of PCR primers. Promoter hypermethylation of the FANCF gene was not demonstrated in any tumors by either Hpall digest protocol or methylation specific PCR (data not shown).  2.3.7 BRCA1 IHC protein and RNA levels. There was a strong correlation between BRCA1 R N A expression levels and the presence or absence of B R C A 1 protein, as assessed by IHC (p = 0.0002). Eight out of 23 (34.8%) patients with tumors showing negative B R C A 1 IHC carried a germline B R C A 1 mutation, while none of the 26 patients with tumors demonstrating detectable BRCA1 by IHC had a BRCA1 germline mutation. The sensitivity and specificity for detection of BRCA1 germline mutations using BRCA1 IHC was 8/8 (100%) and 26/41 (63%), respectively. The sensitivity and specificity for detection of patients who harbour BRCA1 germline mutations, based on assessment of B R C A 1 R N A expression, was 7/8 (87%) and 22/41 (54%), respectively.  2.3.8 Comparison of high-grade serous/undifferentiated EOC with and without BRCA1 loss. To determine whether there were differences between high-grade serous/undifferentiated EOC with and without B R C A 1 loss, in the absence of BRCA1 mutations, the cases were stained with a panel of immunomarkers. There were only 3 IHC markers showing differential expression -27-  between these groups: p21, p53, and Cyclin D l . The 12 high-grade serous/undifferentiated carcinomas demonstrating BRCA1 epigenetic loss were more commonly p53+ (p<0.025), p21(p<0.05), and Cylcin D l - (p<0.025), compared to high-grade serous/undifferentiated carcinoma without B R C A 1 loss. The low-grade serous, endometrioid and clear cell carcinomas typically were p21+, p53-, and Cyclin D1+. There were no statistically significant differences between IHC staining for (5-catenin, E-cadherin, p27, PR, ER, EGFR, and HER2, comparing the highgrade serous/undifferentiated carcinomas with and without BRCA1 loss (data not shown).  2.4 Discussion The largest population-based study of BRCA1/BRCA2 mutations in EOC reported that the prevalence of germline BRCA1 or BRCA2 mutations was 11.7% (6), However, a recent population-based series of 209 women using a more comprehensive mutation detection strategy reported a germline mutation rate of 15.3%, including 20 BRCA1 mutations and 12 BRCA2 mutations (7). In our study, 20% of patients had germline mutations in BRCA1/BRCA2, in keeping with the trend to find higher mutation rates with more comprehensive testing. This also reflects the effect of patient selection with exclusion of all mucinous and borderline tumors, which are not associated with germline B R C A 1 / B R C A 2 mutations (30). Considering just the patients with high-grade serous/undifferentiated carcinomas, 10/38 (26%) were found to have germline BRCA1 or BRCA2 mutations, with no mutations in clear cell, endometrioid or lowgrade serous EOC. Although there have been reports of non-serous EOC in BRCA carriers, most tumors have been high-grade and of serous type (6, 7, 31). In a series of cases that included 32 ovarian carcinomas from patients with germline mutations of BRCA1 or BRCA2, in which the reviewing gynecological pathologist was blinded to mutation status, histology was found to be serous in 100% of these cases (32). Not all studies have had central pathology review so that histopathological correlation with mutation status are difficult to interpret in these studies. Low-28-  grade serous carcinoma are more closely related to serous borderline tumors than high-grade serous EOC and it would not be surprising i f these uncommon tumor, like serous borderline tumors, prove not to be associated with B R C A mutations. Occasional high-grade endometrioid carcinomas have been reported in patients with BRCA mutations (6, 7, 31). However, high-grade endometrioid carcinomas of the ovary are not separable from high-grade serous carcinomas based on either studies of genetic events during oncogenesis or gene expression profiling (33, 34) and there is no compelling evidence to support the practice of attempting to make a diagnostic distinction between high-grade serous and endometrioid carcinoma. Our results add further support to the previous observation that germline mutations in BRCA1 and B R C A 2 are associated with the high-grade serous/undifferentiated subset of EOC, and not non-serous or low-grade serous EOC. In the study of Pal et al. a family history of breast and/or ovarian carcinoma was only reported in 65% of BRCA1 carriers and 75% of BRCA2 carriers. The use of family history clearly lacks sensitivity in identifying patients with germline BRCA mutations and the point at which BRCA mutation carriers will be identified will continue to be at the time of diagnosis of EOC for some patients. A l l the tumors from patients with BRCA] germline mutations were found to be BRCA1 IHC negative, and all but one tumor showed reduced BRCA1 R N A expression. The high relative BRCA1 R N A expression in #283, with 185delAG mutation, can be accounted for as this particular mutation results in the generation of transcripts that are not degraded by nonsense-mediated-mRNA-decay mechanism, as recently demonstrated by Buisson et al (35); these mutant transcripts are not translated to B R C A 1 protein, consistent with our finding of negative BRCA1 IHC in this case. Considering the suboptimal sensitivity and specificity of family history, there may be utility in screening tumor tissue by BRCA1 IHC to triage women with EOC into germline mutation screening programs. If this approach were used in this series of 49 cases, the sensitivity and specificity for identification of patients with germline BRCA] -29-  mutations would have been 100% and 63%, respectively, and a BRCA1 germline mutation would have been identified in 8/23 (34.8%) of EOC patients with negative IHC. This concept has already been proposed for colorectal carcinoma, where the analysis of tumor tissue for mismatch repair protein expression and microsatellite instability was identified as a sensitive and specific technique to screen for HNPCC syndrome (36). The validity and reproducibility of this proposal will require further validation using a larger series of cases. A consideration related to the handling of the specimens in this study is that all were received in pathology within 30 minutes of removal and small portions of tumor were immediately fixed overnight in formalin. This is different than routine practice and B R C A 1 IHC on routinely handled specimens may not be so successful. BRCA1 L O H was identified in tumor tissue from 10/12 cases with a germline or somatic BRCA1 mutation, confirming previous reports that this is a frequent mechanisms by which the remaining wild-type allele is inactivated. It appeared that the second BRCA1 allele was inactivated by BRCA1 promoter hypermethylation in case #186, and by MSI in case #223. L O H assessment, however, lacked utility in predicting BRCA1 loss as it was also seen in 9/11 highgrade serous/undifferentiated carcinomas without evidence of B R C A 1 loss (i.e. BRCA1 protein demonstrable by IHC). In these cases BRCA1 L O H correlated with genomic instability, as assessed by multiplex PCR assessment of multiple polymorphic repeats; L O H at the BRCA1 locus is very common in high-grade EOC and may be a manifestation of genome wide chromosomal instability rather than a specific B R C A 1 functional abnormality. With regards to genomic instability, it was a feature of the high-grade serous/undifferentiated tumors (21/38 cases showed L O H at 2 or more loci by multiplex assay, 11 showed L O H at 0 or 1 locus, 5 showed MSI and one was not assessable for technical reasons), but not the low-grade serous, endometrioid or clear cell tumors (10/11 showed L O H at 0 or 1 locus, and one showed MSI). The 8.3% incidence of MSI found in our series is consistent with previous reports regarding MSI -30-  in EOC (37). The mechanism leading to genomic instability in cases lacking either mutations in BRCA1/BRCA2, or epigenetic BRCA1 loss is not clear, but it could potentially reflect other mutations that are functionally equivalent to BRCA1 loss of function. For example, it has been proposed that the B R C A pathway may be disrupted by promoter methylation of the fanconi anemia gene FANCF.  We did not confirm this in any tumors using either methylation-specific  PCR or HP A digest protocols, despite a recent study demonstrating FANCF methylation in 4/19 (21%) primary ovarian tumors (38). This absence of FANCF promoter hypermethylation in EOC is supported by other previous studies (39). The term 'BRCAness' has been proposed to encompass subtypes of both breast and ovarian carcinoma (familial and sporadic) characterized by the loss of BRCA1 or B R C A 2 (12). Our analysis of an unselected, consecutive series of tumors demonstrates that loss of B R C A 1 is common in high-grade invasive EOC. Of high-grade serous/undifferentiated EOC without mutations in BRCA1 or B R C A 2 , 12/26 (46%) showed loss of B R C A 1 . Although we attribute this to epigenetic silencing of B R C A 1, and genetic abnormalities at the BRCA1 and BRCA2 loci were excluded to the extent possible, some of these cases may represent a mutation at the BRCA1 locus outside the coding region of BRCA 1 that was tested (e.g. in the promoter), leading to BRCA1 loss. Overall, in the group of high-grade serous/undifferentiated tumors, 21/38 (55%) showed loss of BRCA1 through either genetic or epigenetic mechanisms. We attempted to define an IHC profile that would distinguish between high-grade serous/undifferentiated tumors with and without BRCA1 loss. The high-grade tumors showing epigenetic BRCA1 loss were significantly different from those lacking BRCA1 loss, when tumors with B R C A 1 / B R C A 2 mutations were excluded, as they were significantly more likely to be p21-, p53+, and Cyclin D1-. These results suggest that tumors with and without BRCA1 loss, as defined in this study, are distinct entities with different underlying molecular abnormalities.  -31 -  Assessing BRCA1 or B R C A 2 loss in EOC may be useful for selecting patients for targeted therapy, in particular for treatment with Poly(ADP-ribose) polymerase (PARP) inhibitors. Without PARP, cells are unable to repair single-strand breaks in D N A , which will progress into double-strand breaks (DSB) during mitosis (40). In the absence of BRCA1 or B R C A 2 , the ability to efficiently repair DSBs through homologous recombination is lost. Inhibiting PARP will result in the formation of DSB which cannot be accurately repaired in tumor cells deficient in B R C A 1 or B R C A 2 , while normal cells, which even in patients with germline BRCA1 or BRCA2 mutations have one functional allele, will be unaffected. This has been demonstrated in vitro where PARP inhibition resulted in reduced survival of B R C A 1 or B R C A 2 deficient cells, compared to wild-type cells, even in the absence of other genotoxic treatments (41, 42). In our series, 63% of the high-grade serous/undifferentiated tumors showed evidence of B R C A 1 or B R C A 2 loss at either a genetic or epigenetic level (i.e. "BRCAness") (Figure 2.3). PARP inhibitors may be active against these tumors, while our data suggest that they would not be effective against low-grade serous, clear cell and endometrioid tumors. In conclusion, IHC and real-time PCR for B R C A 1 expression, L O H , and mutational analysis allow identification of EOC with B R C A 1 loss by either genetic or epigenetic mechanisms. B R C A loss is common in high-grade serous/undifferentiated EOC, but not in clear cell, endometrioid, and low-grade serous EOC. The significance of B R C A 1 loss, as either a prognostic marker or predictor of response to treatment in the subset of patients with high-grade serous/undifferentiated EOC, remains to be determined.  -32-  T a b l e 2.1 G e r m l i n e a n d s o m a t i c m u t a t i o n s detected in 49 unselected, consecutive women with non-mucinous invasive epithelial ovarian carcinoma  Tumor  Mutation Type  Gene  Exon  Genomic Mutation  283 239 223 329 327 186 336 293  Germline Germline Germline Germline Germline Germline Germline Germline  BRCA1 BRCA1 BRCA1 BRCA1 BRCA1 BRCA1 BRCA1 BRCA1  2 7 11 11 11 16 16 20  185delAG 546G>T 1351delAT 3450delCAAG 37260T 4797G>T 4920A>T 5370OT  305 163  Germline Germline  BRCA2 BRCA2  3 18  320G>T 8474delAG  W31X  -  Unreported Reported  379  Somatic  BRCA1  11  2250A>T  K711X  Unreported  212  Somatic  BRCA2  11  4265delCT  -  Reported  Amino Acid Substitution  * BIC database wehsite: http://research.nhgri.nih.gov/bic/ Previously reported in BIC database as a germline mutation  A  -33-  E143X -  -  R1203X G1560X K1601X R1751X  BIC Database*  Reported Reported Unreported Reported Reported Reported Reported Reported  A  FIGURE 2.1 (AH)  Figure 2.1: Representative examples of results from assessment of BRCA1 loss. (A) Mutation screening showing the abnormal denaturing high performance liquid chromatography peak corresponding to the 1351delAT mutation in tumour 223. The single blue line demonstrates the peak from a normal control, while the purple double peak shows the heteroduplex formed by the mutated exon 1 l c in tumour 223. (B) Direct D N A sequencing demonstrating the 185delAG mutation in tumour 283. Only the mutant allele is seen in the tumour because L O H is present. (C-E) Loss of heterozygosity (LOH) analysis using BRCA1associated microsatellite markers visualized on an A B I Prism 3100 Genetic Analyzer, where L O H is defined as >50% decrease in area under the curve when germline D N A (upper tracing) and tumour D N A (lower tracing) are compared. (C) The lack of L O H in tumour 240 demonstrated using microsatellite marker D17S1185, (D) L O H in tumour 283 demonstrated using microsatellite marker D17S855. (E) Microsatellite instability demonstrated in tumour 156 using microsatellite marker D17S1185. (F) BRCA 1 promoter hypermethylation assessment using methylation-specific PCR, with normal lymphocyte D N A as a control. Sssl+ refers to normal lymphocyte D N A methylated in vitro using Sssl methylase enzyme and Sssl- refers to normal lymphocyte D N A without in vitro treatment. Tumours 305, 319, 324, and 329 show only unmethylated BRCA1 promoter, while tumour 330 shows evidence of BRCA1 promoter hypermethylation. (G) A representative tumour with BRCA1 loss by immunohistochemistry; note the positive staining of some lymphocyte nuclei, (H) A tumour positive for expression of BRCA1 by immunohistochemistry; only a minority of tumour cell nuclei stain positively in this case.  -35-  FIGURE 2.2 BRCA1 Status Mut 186 223 329 293  283 239 336 327 379 217 330 332 388 201 363 161 344 345 384 178 229  LOH  Ser/Undiff-HG Serous - HG Serous - HG Serous - HG Serous - HG Serous - HG Ser/Undiff-HG Serous - HG  NO MSI LOH LOH LOH LOH LOH LOH LOH  Serous - HG Serous - HG Serous - HG Serous - HG Ser/Undiff-HG Serous - HG Ser/Undiff-HG Serous - HG Serous - HG Serous - HG Serous - HG Serous - HG  LOH LOH LOH LOH LOH LOH LOH LOH/MSI LOH/MSI LOH LOH LOH  N N N  Associated features BRCA2 Status Meth RNA IHCB PP WT1 p211 p 5 3 | C y D l l Mut LOH  M  M M M M M M M M M  M M  0.44 0.14 0.02 0.65 3.10 0.16 0.10 0.04 0.07 0.08 0.07 0.08 0.67 1.87 0.27 0.09 0.30 0.41 0.15 0.42 0.19  309 Serous - HG 394 Serous - HG  NO LOH  0.56 0.89  195 236 280 172 254 319 372 208 273 240 297 366  Serous - HG Serous - HG Ser/Undiff-HG Serous - HG Serous - HG Serous - HG Serous - HG Undiff-HG Undiff - HG Undiff - HG Serous - HG Serous - HG  N/A LOH LOH LOH LOH LOH LOH LOH LOH NO NO LOH  1.53 1.69 3.11 2.21 0.48 0.62 2.02 0.81 1.54 0.41 1.77 2.25  221 324 198 213 219 392 242 281 334 156 343  Serous - LG Serous - LG Clear cell Clear cell Clear cell Clear cell Endo - G2 Endo - G2 Endo-G1 Endo - G2 Endo - G2  LOH NO NO NO NO NO NO NO NO MSI NO  1.46 0.50 1.55 2.90 0.58 1.51 1.02 1.35 1.18 1.42 0.27  163 Serous - HG 305 Serous - HG 212 Serous - HG  LOH LOH LOH  M  2.08 1.54 1.22  0/4  0  N  MSI 5/6 1/7 4/6 1/5 3/5 3/8 7/8 2/4 2/3  LOH LOH NO LOH NO NO NO LOH/MSI MSI LOH LOH LOH  MSI N/A 2/2 2/4 0/6  N/A  N/A N/A  MSI MSI 4/6 4/6 4/7 0/5 0/3  N/A N/A N/A N/A  4/5 3/5 5/6 0/4 0/7 4/5 5/7 2/7 0/6 0/5 4/6 0/8 1/5 0/6 0/6 1/7 0/8 0/5 0/6  MSI 0/7 4/5 1/6 3/7  -36-  NO NO  JL _N_ _N_ _N_ _N_ _N_ _N_ N  N N/A  NO MSI LOH NO LOH NO LOH LOH LOH  N/A  _N_ _N_  JL JL N  JL N  JL JL N  N/A LOH LOH LOH LOH LOH LOH LOH LOH NO NO LOH NO NO LOH NO NO NO NO NO NO MSI NO LOH LOH LOH  Classification  BRCA1 loss through germline or somatic mutation  High grade carcinoma showing epigentic BRCA1 loss  Equivocal BRCA1 loss  High grade carcinoma without BRCA1 loss  Low grade serous, endometrioid, clear cell (No BRCA1 loss)  BRCA2 loss through mutation  Figure  2.2: Summary of B R C A 1 abnormalities and associated features. Pathology refers to the  tumor histopathology. Serous or Ser = serous carcinoma; Undiff = undifferentiated carcinoma; H G = high-grade; L G = low-grade; Clear cell = clear cell carcinoma; Endo = endometrioid carcinoma; G l = grade 1; G2 = grade 2; G3 = grade 3. B R C A 1 Status & B R C A 2 Status: Mut = mutation; G = germline; S = somatic; N = no mutations. L O H = loss of heterozygosity where L O H indicates that loss of heterozygosity is present, No indicates that loss of heterozygosity is not present, and MSI indicates that microsatellite instability is present in the tumor. Meth refers to B R C A 1 promoter hypermethylation; M = methylated promoter; U = unmethylated promoter. R N A refers to relative R N A expression compared to the average R N A expression in all samples, where the average R N A expression = 1.0. Tumors with relative R N A expression <0.7 are highlighted as showing B R C A 1 loss. IHC refers to BRCA1 immunohistochemistry; (+) indicates tumors with > 5% of nuclei stained positive for B R C A 1 , (—) indicates tumors with <5% of nuclei positive. Associated features: PP refers to the powerplex analysis of 8 polymorphic tri- and tetranucleotide repeat elements from throughout the genome, where the ratio indicates the number of microsatellite markers showing L O H compared with the total number of informative microsatellite markers. Tumors with L O H at 50% or more informative markers is highlighted. Associated immunohistochemical markers p21, p53, Cyclin D l (CyDl), and WT-1 refer to immunohistochemical staining results. Scoring of immunostaining was done as follows: p21: 0 = <5% nuclei positive and 1 = >5% of nuclei positive. p53: 0 = <50% nuclei positive and 1 = >50% of nuclei positive. WT1 and Cyclin D l : 0 = <5% nuclei positive, 1 = 5-50% nuclei positive, and 2 = >50% nuclei positive. N / A indicates that the data is not available for technical reasons. Features consistent with BRCA-loss are highlighted.  -37-  F I G U R E 2.3 Unselected, consecutive non-mucinous epithelial ovarian carcinoma 49 (100%)  Sporadic carcinoma  Hereditary carcinoma  39/49 (80%)  10/49 (20%)  Germline BRCA1 mutations  Somatic BRCA2 Mutation  Germline BRCA2 mutations  8/49 (16%)  2/49 (4%)  High grade serous  High grade serous  Evidence of BRCA1 loss  Indeterminate BRCA1 loss  13/49 (24%)  2/49 (4%) High grade serous  / Somatic BRCA1 Mutation 1/49 (2%) High grade serous  l Epigenetic or unexplained BRCA1 Loss 12/49(24%) High grade serous, undifferentiated  1/49 (2%) High grade serous  \  Absence of BRCA1 loss 24/49 (49%)  /  \  11/49 (22%)  12/49 (24%)  Low grade serous, endometrioid, clear cell  High grade serous, undifferentiated  Figure 2.3: Schematic overview of B R C A 1 abnormalities in 49 unselected, consecutive women with non-mucinous invasive epithelial ovarian carcinoma.  -38-  2.5 References: 1. Cannistra SA. Cancer of the ovary. N Engl J Med 2004;3512519-29. 2. Scully RE, Young R H , Clement PB. Tumors of the ovary, maldeveloped gonads, fallopian tube, and broad ligament. In: Rosai J, Sobin L H , eds. Atlas of tumour pathology, 3 Series edn. Washington, DC: Armed Forces Institute of Pathology, 1998. rd  3. Bell D A . Origins and molecular pathology of ovarian cancer. Mod Pathol 2005;18:S19-S32. 4. Mizuno M , Kikkawa F, Shibata K , et al. Long-term follow-up and prognostic factor analysis in clear cell adenocarcinoma of the ovary. J Surg Oncol 2006;94:138-43. 5. Scully R, Livingston D M . In search of the tumour-suppressor functions of B R C A 1 and B R C A 2 . Nature 2000; 408:429-432. 6. Risch H A , McLaughlin JR, Cole DEC, et al. Prevalence and penetrance of germline BRCA1 and B R C A 2 mutations in a population series of 649 women with ovarian cancer. A m J Hum Genet 2001;68:700-10. 7. Pal T, Permuth-Wey J, Berts JA, et al. BRCA1 and B R C A 2 mutations account for a large proportion of ovarian carcinoma cases. Cancer 2005;104:2807-16. 8. King M C , Marks JH, Mandell JB. Breast and Ovarian Cancer Risk due to inherited mutations in B R C A 1 and B R C A 2 . Science 2003;302:643-6. 9. Antoniou A , Pharoah PDP, Narod S, et al. Average risks of breast and ovarian cancer associated with BRCA1 or B R C A 2 mutations detected in a case series unselected for family history: a combined analysis of 22 studies. A m J Hum Genet 2003;72:1117-30. 10. Shaw PA, McLaughlin JR, Zweemer RP, et al. Histopathologic features of genetically determined ovarian cancer. Int J Gynecol Path 2002;21:407-11. 11: Merajver SD, Pham T M , Caduff RF, et al. Somatic mutations in the B R C A gene in sporadic ovarian carcinomas. Nat Genet 1995;9:439-443. 12. Turner N , Tutt A , Ashworth A . Hallmarks of 'BRCAness' in sporadic cancers. Nature Rev Cancer 2004;4:1-6. 13. Zheng W, Luo F, Lu JJ, et al. Reduction of B R C A 1 expression in sporadic ovarian cancer. Gynecol Oncol 2000;76:294-300. 14. Russell PA, Pharoah PDP, Foy K D , et al. Frequent loss of B R C A 1 m R N A and protein expression in sporadic ovarian cancers. Int J Cancer 2000;87:317-321. 15. Futreal PA, Liu Q, Shattuck-Eidens D et al. B R C A 1 mutations in primary breast and ovarian carcinomas. Science 1994;266:120-2.  -39-  16. Gras E, Cortes J, Diez O, et al. Loss of heterozygosity on chromosome 13ql2-ql4, B R C A 2 mutations, and lack of B R C A 2 promoter hypermethylation in sporadic epithelial ovarian tumors. Cancer 2001;92:787-795. 17. Esteller M , Silva J M , Dominguez G, et al. Promotor hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J Natl Cancer Inst 2000;92:564-9. 18. Baldwin R L , Nemeth E, Tran H, et al. BRCA1 promoter region hypermethylation in ovarian carcinoma: a population based study. Cancer Res 2000;60:5329-33. 19 Wiley A , Katsaros D, Chen H , et al. Aberrant promoter methylation of mutliple genes in malignant ovarian tumours and in ovarian tumours with low malignant potential. Cancer 2006;107:299-308. 20. Thrall M , Gallion H H , Kryscio R, et al. B R C A 1 expression in a large series of sporadic ovarian carcinomas: a Gynecologic Oncology Group study. Int J Gynecol Cancer 2006; 16:16671. 21. Malpica A , Deavers M T , Lu K , Bodurka DC, Atkinson E N , Gershenson D M , Silva EG. Grading ovarian serous carcinoma using a two-tier system. A m J Surg Pathol 2004;28:496-504. 22 Silverberg SG. Histopathologic grading of ovarian carcinoma: a review and proposal. Int J Gynecol Pathol 2000; 19:7-15 23. Wang C, Horiuchi A , Imai T, et al. Expression of B R C A 1 protein in benign, borderline, and malignant epithelial ovarian neoplasms and its relationship to methylation and allelic loss of the B R C A 1 gene. J Path 2004; 202:215-23. 24. Regitnig P, Moser R, Thalhammer M , et al. Microsatellite analysis of breast carcinoma and corresponding local recurrences. J Pathol 2002;198:190-7. 25 Liu W, Smith DI, Rechtzigel K J , Thibodeau SN, James CD. Denaturing high performance liquid chromatography (dHPLC) used in detection of germline and somatic mutations. Nucleic Acids Res 1998;26:1396-400. 26. Hogervorst FB, Nederlof P M , Gille JJ, et al. Large genomic deletions and duplications in the BRCA1 gene identified by a novel quantitative method. Cancer Res 2003;63:1449-53. 27 Herman JG, Graff JR, Myohanen S, Nelkin B D , Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci 1996;93:9821-6 28. Taniguchi T, Tischkowitz M , Ameziane N , et al. Disruption of the Fanconi anemia-BRCA pathway in cisplatin-sensitive ovarian tumors. Nat Med 2003;9:568-74. 29 Chan K Y , Ozcelik H , Cheung A N Y , Ngan H Y S , Khoo U . Epigenetic factors controlling the BRCA1 and B R C A 2 genes in sporadic ovarian cancer. Cancer Res 2002;62:4151-6.  -40-  30. Boyd J, Sonoda Y , Federici M G , et al. Clinicopathologic features of BRCA-linked and sporadic ovarian cancer. J A M A 2002:283:2260-5. 31. Werness B A , Ramus SJ, Whittemore A S , et al. Histopathology of familial ovarian tumors in women from families with and without germline B R C A 1 mutations. Hum Pathol 2000;31:14204. 32. Shaw PA, McLaughlin JR, Zweemer RP, et al. Histopathologic features of genetically determined ovarian cancer. Int J Gynecol Pathol 2002;21:407-l 1. 33 Hilton JL, Geisler JP, Rathe JA, Hattermann-Zogg M A , DeYoung B, Buller RE. Inactivation of BRCA1 and B R C A 2 in ovarian cancer. J Natl Cancer Inst 2002;94:1396-1406. 34. Schwartz DR, Kardia SL, Shedden K A , et al. Gene expression in ovarian cancer reflects both morphology and biological behavior, distinguishing clear cell from other poor-prognosis ovarian carcinomas. Cancer Res 2002;62:4722-9. 35. Buisson M , Anczukow O, Almoutassem B Z , Ware M D , Mazoyer S. The 185delAG mutation (c.68_69delAG) in the BRCA1 gene triggers translation reinitiation at a downstream A U G codon. Hum Mutat 2006;27:1024-9. 36. Southey M C , Jenkins M A , Mead L, et al. Use of molecular tumour characteristics to prioritize mismatch repair gene testing in early-onset colorectal cancer. J Clin Oncol 2005;23:6524-32. 37 Singer G, Kallinowski T, Hartmann A , et al. Different types of microsatellite instability in ovarian carcinoma. Int J Cancer 2004; 112:643-6. 38. Taniguchi T, Tischkowitz M , Ameziane N , et al. Disruption of the Fanconi anemia-BRCA pathway in cisplatin-sensitive ovarian tumors. Nat Med 2003;9:568-74. 39. Teodoridis J M , Hall J, Marsh S, et al. CpG island methylation of D N A damage response genes in advanced ovarian cancer. Cancer Res 2005;65:8961-7. 40. Turner N , Tutt A , Ashworth A . Targeting the D N A repair defect of B R C A tumors. Curr Opin Pharmacol 2005;5:388-94. 41. Farmer H, McCabe N , Lord CJ, et al. Targeting the D N A repair defect in B R C A mutant cells as a therapeutic strategy. Nature 2005;434:917-21. 42. Bryant HE, Schultz N , Thomas HD, et al. Specific killing of B R C A - 2 deficient tumors with inhibitors of poly(ADP-ribose) polymerase. Nature 2005; 434: 913-7.  -41 -  C H A P T E R 3: XENOGRAFTS OF PRIMARY HUMAN GYNECOLOGICAL TUMORS GROWN UNDER T H E RENAL CAPSULE OF NOD/SCID M I C E S H O W G E N E T I C A N D P H E N O T Y P I C STABILITY DURING SERIAL TRANSPLANTATION 1  3.1 Introduction Despite more aggressive surgery and the development of new therapeutic modalities, successful treatment outcomes for patients with ovarian carcinoma or uterine sarcoma have been limited by late detection, with advanced stage disease at presentation, and the frequent development of chemoresistance (1,2). The creation of cancer models which accurately reflect the genetic and phenotypic features of primary tumors is an important step in identifying novel therapeutic targets and testing new treatment modalities (3). The limited availability of animal models that spontaneously develop ovarian tumors comparable to human ovarian carcinoma has necessitated the use of in vitro studies with cancer cell lines and primary cultures. The creation of these renewable tumor cell lines requires tumor cells to be immortalized and then propagated within the environment of in-vitro culture systems. Though it is then possible to create xenograft models by implanting these lines of in-vitro propagated cells into immunodeficient mice, the inconsistent response to therapeutic agents suggest that these models do not adequately reflect the human tumors in vivo (4). For example, experiments utilizing these in-vitro propagated tumor cell lines and resulting xenografts have suggested that the application of particular anticancer drugs should be efficacious in the treatment of malignancy, however, ensuing phase I clinical trials revealed that these drugs have limited in-vivo activity when given to humans A version of this chapter has been submitted for publication. Press JZ, Clarke B A , Xue H , Turbin D, Miller M A , De Luca A , Miller D M , Huntsman DG, Gilks C B , Wang Y Z . Xenografts of primary human gynecological tumors grown under the renal capsule of NOD/SCID mice show genetic and phenotypic stability during serial transplantation. Int J Gynecol Cancer 2006. 1  -42-  subjects (5). A specific example is the anti-angiogenic drug endostatin, which exhibited strong anti-tumor properties against in vitro propagated cell lines grown subcutaneously in syngeneic mice, but no activity in human Phase 1 trials (6,7). Recently there have been several genetically engineered mouse models that develop ovarian carcinoma, providing insight into stepwise molecular progression that can lead to cancer (8). However, it remains to be seen whether these models will adequately represent true human tumors in terms of their response to treatment. Human cancer tissue xenograft models may also be established by obtaining tumor tissue directly from the operating room at the time of primary debulking surgery, and then implanting this fresh, histologically intact tumor tissue into immunodeficient mice. The heterogeneous composition of tumor tissue has been identified as an important contributor to tumor development and growth, and the importance of factors in the stroma and extracellular matrix to the provision of nutrients and regulatory signaling is incompletely understood (9).  Cancer  tissue xenografts encompassing cancer cells, stroma, and extracellular matrix may more accurately reflect the in vivo tumor environment, permitting a better model of human malignancy. Previously, we were able to show consistently high engraftment rates of ovarian cancer xenografts derived by introducing fresh, histologically intact human tumor tissue into the subrenal compartment of NOD/SCID mice (10). Histological examination of these tumors demonstrated preservation of immunophenotype and morphology. It has subsequently proven possible to serially transplant the tumor tissue growing within the subrenal compartment of these mice into new NOD/SCID mice. The maintenance of genetic and phenotypic stability within these transplantable tumor lines is fundamental to ensure that this model adequately represents the underlying genetic changes of primary gynecological malignancies, and has not diverged from the primary tumor with serial transplantation. Therefore, we performed a comparative analysis between primary human gynecological tumors and their corresponding serially transplanted xenografts to assess genetic and phenotypic stability. One of these transplantable -43 -  xenograft lines has been derived from primary tumor tissue which was surgically excised from a woman known to have a germline BRCA1 mutation, and another was from a primary tumor with B R C A 1 promoter hypermethylation, and loss of B R C A 1 expression, resulting in a potential model for testing novel targeted therapy such as inhibitors of poly(ADP-ribose) polymerase (PARP), which specifically target defects in D N A repair in B R C A null tumor cells.  3.2 M a t e r i a l s a n d methods  3.2.1 Tumor tissue samples. The human tumor specimens were obtained with informed consent from patients undergoing surgery at Vancouver General Hospital following a protocol approved by the University of British Columbia Clinical Research Ethics Board.  Fresh tumor tissue was  used to develop xenografts, a portion was snap frozen at -80°, and some tumor tissue was fixed in 10% neutral buffered formalin and paraffin embedded. Transplantable tumor lines were derived from 5 different tumors (4 ovarian carcinomas and 1 uterine sarcoma), and serially transplanted for between 2 and 6 generations. The histopathological and clinical characteristics of these tumors are shown in the Table 3.1.  3.2.2 Xenografts. Subrenal capsule grafting procedure was performed as described previously [10]. Briefly, under sterile conditions, a skin incision of approximately 2 cm was made along the dorsal midline of an anesthetized female mouse. A n incision was then made in the body wall slightly shorter than the long axis of the kidney. The kidney was slipped out of the body cavity by applying pressure on the other side of the organ using a forefinger and thumb. After exteriorization of the kidney, #5 fine forceps were used to gently pinch and lift the capsule from the renal parenchyma to allow a 2-4 mm incision in the capsule using fine spring-loaded scissors. A pocket between the kidney capsule and the parenchyma was then created by blunt dissection. -44-  Care was taken not to damage the parenchyma and thus prevent bleeding. The graft was transferred to the surface of the kidney using blunt-ended forceps. The cut edge of the renal capsule was lifted with fine forceps, and the graft inserted into the pocket under the capsule using a fire-polished glass pipette. Two or three grafts per kidney could be placed under the renal capsule. The kidney was then gently eased back into the body cavity and the body wall and skin incisions sutured. Mice were housed in groups of three in micro-isolators with free access to food and water and their health was monitored daily. Animal care and experiments were carried out in accordance with the guidelines of the Canadian Council on Animal Care. After 60 days of growth (or earlier i f required by the health status of the hosts) the animals were sacrificed in a CO2 chamber for necropsy. Tumors were harvested, measured, photographed and fixed for histopathological analysis. Some of the rapidly growing tumors were selected for serial subrenal capsule transplantation  into female  NOD/SCID  mice for multiple generations.  Five  transplantable lines, from five donors, were developed and used in this study.  3.2.3 Tissue Microarray Construction. Hematoxylin and eosin (H&E) stained sections of the primary tumor, the initial xenograft, and the most recent transplant xenograft (ie. highest passage number) were reviewed and representative areas of tumor were selected and marked. Corresponding areas on the paraffin blacks were marked, and using a Tissue Microarrayer (Beecher Instruments, Silver Spring, M D ) three tissue cores from the representative areas in the donor blocks were removed with a 0.6mm diameter needle and inserted into a single recipient paraffin block. Sections were cut from the tissue microarray (TMA) block using a standard microtome. These T M A sections therefore included triplicate cores of donor, initial xenograft and the most recent (highest generation) serially transplanted xenograft.  -45 -  3.2.4 Immunohistochemical staining. T M A sections were cut at a thickness of 4 urn and mounted on glass microscope slides. Sections were dewaxed in Histoclear and hydrated in graded alcohol solutions and distilled water. H & E staining was performed to ensure adequate representation of the tumors on the T M A . For immunophenotype analysis, antibodies were used against the following markers at the dilutions indicated: insulin-like growth factor IGF-1RP (Santa Cruz Biotechnology, Santa Cruz, C A 1:20); Her2 ( D A K O , 1:500); Her3 (Lab Vision Neomarkers, Fremont, C A , 1:10); Mucin-1 (Santa Cruz Biotechnology, Santa Cruz, C A , VU4H5, 1:20); p-catenin (BD Transduction,San Jose, C A , C14, 1:200); E-cadherin (Zymed Laboratories, San Francisco, C A , H E C D - I , 1:4); EGFR (Zymed Laboratories, San Francisco, 13  C A , 31G7, 1:20); V E G F (R&D Systems, Minneapolis, M N , 26503.11, 1:500), BRCA1 (Oncogene, Ab-1, Darmstadt, Germany, 1:50), and Ki-67 (MIB-1) (Immunotech, Marseilles, France, 1:100). Immunostaining was performed on 4-pm-thick tissue section, using either manual staining (E-cadherin, VEGF) or an Ventana automated immunostainer (Ventana, Tuscon, AZ) according to the manufacturer's recommended procedures (P-catenin, EGFR, HER2, HER3, IGF-1R, Mucin-1).  3.2.5 Tissue microarray analysis. After immunohistochemical staining, each T M A slide was scored by a pathologist (BG). Tumor cell cytoplasmic or nuclear staining (according to the antigen targeted) was scored as negative (<5% cells positive), weakly positive (5-50% of cells showing weak or moderately intense positivity), or strong positive (>50% of cells positive or 550%o of cells showing intense staining). In view of there being triplicate cores, score results were consolidated into one score per case with a higher score superseding a lower score in instances of discrepant results from different cores. For MIB-1 staining the number of positively staining  -46-  nuclei per 50 tumor cells in a randomly selected field was counted from each of 2 cores and averaged.  3.2.6 Array comparative genomic hybridization. H & E slides from tumor samples taken facing the snap-frozen samples were reviewed to ensure that samples consisted of >70% tumor cell nuclei. D N A was extracted using the Gentra D N A extraction kit (Gentra Systems, Minneapolis, MN). D N A was extracted from three separate pieces of the primary tumor tissue sample. In brief, frozen tumor tissue was digested in cell lysis solution, treated with Proteinase K solution and RNase A solution, and precipitated with protein precipitation solution. D N A was suspended in D N A Hydration solution (Gentra Systems, Minneapolis, MN), and the concentration was determined spectrophotometrically.  Array C G H was performed using the GenoSensor Array  300 Assay (Vysis, Des Plaines, IL).  Random primer mix was used to label 100 ng of tumor  D N A with Cy3, and 100 ng normal male human reference D N A was labeled with Cy5. Products were purified with Amersham MicroSpin columns (Amersham, Piscataway, NJ), precipitated with 3 M sodium acetate and 100% ethanol, and resuspended in Tris (pH 8.0). Probe quality was checked by running the products on a 2% agarose gel prior to combining the test and reference probes. The probe mix was applied to GenoSensor microarrays and hybridized for 72 hours at 37 degrees. Microarrays were washed in l x SSC/0.1% NP-40 at 58 degrees for 5 minutes, O.lx SSC/0.1% NP-40 at 58 degrees for 4 minutes, and then l x SSC for 1 minute. Microarrays were then rinsed in ddH20 and covered with DAPI mounting solution. Imaging and data analysis of the arrays was done with the GenoSensor Reader System (Vysis, Des Plaines, IL). The software automatically captured images of each chip, specific for the blue, the green, and the red color planes. The test/reference ratio was defined as the ratio of the sum of test intensity pixel values to the sum of reference intensity pixel values, after pixel intensity analysis within each individual spot and local background subtraction. Data was converted into a Microsoft Excel file, and B R B - 47-  Array Tools (11) was used for unsupervised hierarchical clustering to create a dendrogram. In addition, the total number of genes demonstrating copy number gains or deletions was tabulated for each tumor and xenograft sample. The frequency of gain or deletion was then compared between the 3 primary tumor samples and the corresponding xenograft using the Signed-Rank Test or Wilcoxon Test. Statistical Analysis of Microarrays (SAM) was used to identify any genes showing a significant differences in copy number in the primary tumors compared to the transplantable xenografts (12).  3.2.7Analysis of BRCA1 and BRCA2. Polymerase chain reactions of BRCA1 exon 2 and B R C A 2 exon 3 were performed in 25-ul final volume containing 2.5 pi of lOx PCR buffer with 10 m M of MgS04 (Roche Diagnostics Mannheim, Germany), 200uM dNTPs, 0.6uM primers, 50 ng tumor D N A , and 0.5U Pwo enzyme (Roche Diagnostics, Mannheim, Germany). Primers used were BRCA1 exon 2 (forward 5'-atgaagttgtcattttataaacctttt-3', reverse primer 5 ' cacaagagtgtattaatttgggattc-3') and B R C A 2 exon 3 (forward 5'cccgccgcccccgccgtgccttaacaaaagtaatccatagtc-3', reverse 5'-gcaaatcagtctctctggccgcg-3'). The same touchdown protocol was used to amplify BRCA1 exon 2 and B R C A 2 exon 3. Intial denaturation at 95°C for 2 minutes was followed by 14 cycles of denaturation at 95°C for 30 seconds, 1 minute of annealing (each cycle the annealing temperature was decreased starting from 62°C to 55°C in 0.5°C increments), and extension at 72°C for 1 minute. Subsequently, 20 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute were performed, followed by a final extension step at 72°C for 7 minutes. PCR products were gel purified using Qiagen gel purification kit (Quiagen, Mississauga, ON), and bi-directional sequencing was performed using A B I BigDye terminator Sequencing Kit v. 1.1 (Applied Biosytems, Foster City, C A ) and an A B I Prism 3100 Genetic Analyzer (Applied  -48-  Biosystems, Foster City, CA). Methylation of the BRCA1 promoter was assessed using methylation-specific PCR (13), and loss of heterozygosity (LOH) was analyzed using microsatellite markers (14).  3.3 Results  3.3.1 Histopathology. Histopathologic assessment was performed with the primary tumor, initial xenograft, and the most recent transplant (highest generation). No significant differences were observed among the three tissue types with regard to cellular morphology and architecture (Fig. 3.1). Note that individual tissue samples are labeled with three identifiers (eg. ITa where 1-5 refers to the case number, T = primary tumor, I = initial xenograft, and X = transplantable tumor line, and a-e refer to independent samples of tumor tissue)  3.3.2 Immunohistochemistry. Immunohistochemical results are shown in Table 3.2. Although there was some change in staining intensity between the primary tumor, xenograft, and transplantable line, there was no absolute loss or gain of biomarker positivity. Overall, most biomarkers demonstrated no change over serial transplantation; however, an increase in staining intensity was found in 2/5 samples for E G F R (Cases 1 and 2) and 3/5 samples for HER2 (Cases 1, 3, and 5). There was a decrease in V E G F staining intensity in 3/5 samples (Cases 1, 2, and 5). Assessment of proliferation using MIB-1 staining is shown in Table 3.3, and the only tumor showing an increase in MIB-1 staining between primary tumor and transplantable xenograft was the leiomyosarcoma (Case 2). The clear cell ovarian carcinoma (Case 5) exhibited a lower MIB-1 index than the papillary serous ovarian carcinomas, and this was maintained in the transplantable xenograft.  -49-  3.3.3 Array comparative genomic hybridization. The dendrogram created from the GenoSensor array data showed good correlation between gene copy number changes seen in the primary tumors and tissue from the corresponding transplantable xenograft lines (Fig 3.2). There was some intratumoral variability between samples from different areas of the primary tumor, however, the primary tumor samples consistently clustered with the corresponding transplantable xenograft. Case 5 was unique as the transplantable xenograft (5X) was derived from an omental metastasis. Three consecutive generations of case 5 transplantable xenograft tissue clustered together well (5Xa-c), however the primary tumor and primary omental metastasis from case 5 formed a separate cluster (5Ta,b,c,e). The only significant outlying sample was primary tumor from case 4Tb which showed closer correlation to the primary tumor and xenograft from case 5. The other two primary tumor samples from case 4 (4Ta/4Tc) clustered with their corresponding xenograft (4X). A similar correlation between primary tumor samples and transplantable xenografts was demonstrated when K-means clustering was applied (data not shown). When the total number of loci demonstrating copy number gains or deletions were compared, there were no statistically significant differences detected between the primary tumor and corresponding xenograft. The only region shown to be significantly amplified when S A M was used to compare the transplantable xenografts with primary tumors was the OCRL1 gene on Xq25 (30 fold amplification in the transplantable xenograft). However, this amplification in the transplantable xenograft tissue was not confirmed after applying a fluorescent in situ hybridization (FISH) probe for the OCRL1 loci to the tissue microarray (data not shown), indicating that the amplification identified by S A M was an artifact. This was most probably due to repetitive D N A sequence with sufficient homology to hybridize to the OCRL1 gene sequence on the array slide, which was derived from contaminating mouse D N A from the xenograft host.  -50-  3.3.4 BRCA alterations. Two of the transplantable tumor lines (Case 1 and Case 4) were derived from patients with well characterized alterations in B R C A 1 / B R C A 2 . Sequencing of D N A extracted from the germline, primary tumor, and transplantable xenograft from case 4 demonstrated the presence of a mutation in exon 2 of BRCA1 (185delAG) [15]. In addition, the primary tumor and xenograft have lost the wild-type allele, as the sequencing product demonstrated only the presence of D N A with the 185delAG deletion (Fig. 3.3). L O H at the BRCA1 locus was confirmed in both case 1 and case 4, using 2 intragenic and 2 flanking microsatellite markers for BRCA1 (data not shown). Promoter hypermethylation of the BRCA1 promoter was identified in the primary tumor D N A from case 1, and this phenomenon was maintained in the transplantable xenograft (Fig 3.4b). There were no BRCA1 mutations in either germline or tumor D N A in case 1 (data not shown). Immunohistochemical staining with a B R C A 1 antibody demonstrated loss of B R C A 1 protein in both case 1 and case 4. Sequencing of D N A from case 1 demonstrated the presence of a sequence alteration in intron 2 of B R C A 2 (IVS2-7delT), which was present in D N A derived from the germline, primary tumor and transplantable xenograft (Fig. 3.4a). The sequence demonstrated no evidence of B R C A 2 L O H in the primary tumor or transplantable xenograft, and this lack of B R C A 2 L O H was confirmed using 4 flanking microsatellite markers for B R C A 2 (data no shown). It has been suggested that IVS2-7delT functions as a pathological splice site mutation in B R C A 2 ; however, most authors consider this deletion to be an unclassified variant or B R C A 2 , rather than a mutation (16,17).  3.4  Discussion  We previously demonstrated that the subrenal capsule site in NOD/SCID mice can be successfully used for grafting primary human ovarian tumors, overcoming previous problems of poor engraftment rates. We also showed morphological and biomarker stability between the primary tumor and the initial xenograft. In the current study, we have demonstrated the -51 -  development of transplantable tumor lines from these initial xenografts, with some cases achieving up to 6 successive generations. Such transplantable lines provide renewable preclinical models to test new therapeutic agents and will allow analysis of tumor progression at cellular and molecular levels. Inherent in such a model is the possibility of genetic drift and altered phenotypic characteristics of the tissue occurring during serial transplantation, thereby potentially reducing the relevance. Overexpression of growth factors such as HER2 and EGFR, and angiogenic factors such as V E G F herald a poor prognosis and provide possible therapeutic targets (18,19). Investigation of these targets using our xenograft model will rely on stable inheritance of genetic and phenotypic features over successive transplantations. By comparing IHC markers in the primary tumor, xenograft and the most recent transplant, we have shown biomarker stability over successive generations. Genetic stability of the transplantable tumor xenograft model was verified with aCGH, using the GenoSensor array system which includes 287 loci known to play an important role in oncogenesis. Despite an overall genetic and phenotypic concordance between primary tumor and transplantable xenograft, there are several inconsistencies which merit discussion. IHC data demonstrated increased staining for E G F R and HER2, and decreased staining for V E G F within the transplantable xenograft compared with the primary tumor. In some cases these changes in the degree of protein expression may reflect the environmental differences between the human pelvis and the mouse subrenal capsule. The decreased staining for V E G F from strong to weak in some transplantable xenografts may reflect a reduced need for neovascularization when the xenograft tumor cells are growing within the highly vascular mouse renal capsule. Our array C G H data does demonstrate some genetic differences between the primary tumor and the corresponding transplantable xenograft; however, the degree of genetic variation is similar to that present between different tissue samples from the same primary tumor (ie. intratumoral heterogeneity). -52-  Ovarian carcinoma models have played an important role in our understanding of ovarian carcinoma (20). These models include both human and animal cell culture models involving the in vitro propagation of ovarian surface epithelial (OSE) cells. For example, manipulation of in vitro cell lines derived from OSE have been used to investigate the role of E-cadherin in ovarian neoplastic progression (21). In-vitro propagated cell lines have also been used to develop xenograft models in animals such as SC1D mice. For example, using the injection of T antigenimmortalized OSE cells into SCID mice it has been possible to create transplantable, invasive adenocarcinomas (22). Recently genetically engineered animal models have been developed which allow manipulation of specific genes resulting in spontaneous tumor development (23, 24). Dinulescu et al. have created a mouse model which develops endometriosis through the overexpression of the K-ras oncogene and endometrioid ovarian carcinoma through the additional silencing of PTEN tumor suppressor gene (25). This type of model allows for the dissection of specific molecular event in tumor development and progression. Despite the strengths of both cell culture and genetically engineered animal models, it is not established that they adequately reflect ovarian cancer in human patients to sufficiently predict treatment outcome. The formation of heterogeneous transplantable xenograft lines from fresh, histologically intact tumor tissue may provide a model which more accurately reflects the complexities of human tumor tissue. The subrenal capsule assay (SRCA) originally developed by Bogden consisted of using the short term (i.e. 6 days) growth of human cancer tissue under the renal capsule of immunodeficient mice to predict the response to chemotherapy (26, 27). The S R C A has been assessed using a variety of tumor types, and it has been demonstrated to correctly predict chemoresistance in 97% and chemosensitivity in 92% of cases (28). It has also been shown to be predictive of chemotherapy response in 60- 85% of patients with previously untreated gynecologic cancer (29, 30). Our model expands upon this work through the  -53-  development of a renewable xenograft model which may be used to examine the efficacy of novel drugs. Patients with BRCA1 or B R C A 2 germline mutations carry a high predisposition for the development of breast and ovarian carcinoma (31). BRCA1 and B R C A 2 play an important role in the efficient the repair of D N A double-strand breaks (DSBs) by RAD51-dependent homologous recombination. It is thought that ovarian surface epithelial cells or fallopian tube epithelial cells in women born with a germline B R C A mutation acquire a second hit, such as L O H , at some point during their life which results in a reduced ability to repair DSBs.  A new  strategy for treatment of cancer in patients with B R C A 1 and B R C A 2 has been proposed based on inhibition of a protein called PARP, which is important for repairing single-strand breaks in D N A (32). It has been suggested that inhibiting PARP should lead to the formation of D N A single-strand breaks, which cannot be accurately repaired in cells which lack BRCA1 or B R C A 2 . Therefore, PARP inhibitors should cause significant D N A damage to tumor cells which are deficient in BRCA1 or B R C A 2 , while having minimal effect on normal cells that possess functional BRCA1 or B R C A 2 . This has been demonstrated using in vitro models where PARP inhibition resulted in much greater reduction in cell survival when applied to B R C A 1 / B R C A 2 deficient cells than wild-type cells (32, 33). The available tumor cell models of B R C A 1 and B R C A 2 deficiency were not suitable for xenograft development for the in vivo testing of PARP inhibitors (33). Using a subrenal capsule xenografting technique incorporating tumor tissue from patients with a known B R C A mutation we have developed a model (case 4) possessing a BRCA1 mutation (185delAG). We also have established a transplantable xenograft model which maintains BRCA1 promoter hypermethylation during serial transplantation. BRCA1 promoter hypermethylation has been proposed as an alternative mechanism to mutation which leads to the somatic inactivation of the BRCA1 gene in a significant proportion (15%) of sporadic ovarian -54-  carcinomas (13, 14). The models we have developed may provide insight into the role of BRCA1 in ovarian cancer and could assist with the testing of new therapeutic modalities such as PARP inhibitors. In conclusion, in this study we have demonstrated successful creation of transplantable cancer lines derived from primary tumor tissue. These models maintain genetic and biomarker stability over successive generations. This will provide researchers with a renewable resource which may contribute to our understanding of carcinogenesis, and assist in the identification of novel therapeutic targets, facilitating development of innovative therapeutic regimens.  -55 -  Table 3.1 Characteristics of tumors. Case# '  Histopathology of Primary Tumor  Grade  Origin of Xenograft  Generation of Xenotransplant*  3  Ovary  6  High  Uterus  3  1  Papillary serous carcinoma  2  Leiomyosarcoma  3  Papillary serous carcinoma  3  Ovary  2  4  Papillary serous carcinoma  3  Ovary  2  5  Clear cell carcinoma  3  Omentum  4  * Generation of xenotransplant refers to the number of generations of serially transplanted xenografts created from the primary tumor  -56-  Table 3.2 Immunohistochemical staining of primary tumors and corresponding xenografts 1GF-1R  HER2  HER3  EGFR  1  NoA*  1-2**  NoA  NoA  1-2  NoA  2  NoA  NoA  NoA  NoA  NoA  NoA  2-1  NoA  3  NoA  1-2  NoA  NoA  NoA  NoA  NoA  NoA  4  NoA  NoA  NoA  1-2  NoA  1-2  NoA  NoA  5  NoA  1-2  NoA  1-2  NoA  NoA  2-1  NoA  Case#  P-catenin E-cadherin  VEGF 2_i  * * *  MUC-1 NoA  IHC rating: 0 = negative (<5% of cells), 1 = weak positive (5-50% of cells), 2 = strong positive (>50% of cells). * NoA indicates that staining was unchanged between primary tumor and transplantable xenograft ** 1-2 refers to a change from weak positive to strong positive ***2-l refers to a change from strong positive to weak positive.  -57-  Table 3.3: MI B-l proliferative indices of primary tumor, intial xenograft and transplantable tumor line  Case#  Primary Tumor*  Initial Xenograft*  1  43  36  Tranplantable Xenograft* 39  2  25  30  39  3  33  32  38  4  41  44  44  5  18  23  21  * Percent of positively stained tumor cell nuclei  -58-  FIGURE 3.1  Figure 3.1: Histopathology of xenografted tumors. Histopathology of primary tumors with corresponding initial xenograft and transplantable xenograft. 1-5 refers to case number. T = primary tumor tissue, I - initial xenograft tissue, X = transplantable xenograft line tissue.  -59-  F I G U R E 3.2  Correlation  0.8 —1  0.6 1  0.4 I  5Ta 5Te 5Tb 5Tc 5Xai 5Xb 5Xa 5Xc 4Tb 5Td 2X 2Tb 2Ta  'lit-  4X 4Ta 4Tc  -60-  0.2 L_  Figure 3.2: Hierarchical clustering of a C G H data. Hierarchical clustering of array comparative genomic hybridization data based on 287 loci using centered correlation and average linkage. Explanation of tumor coding system: Numbers 1-5 refers to case number, and T = primary tumor D N A , X = transplantable xenograft D N A . a-c indicates independent sampling from the same tumor. Case 5 primary tumor sample a,b,c are from the omentum and sample d,e are from the ovary. Sample 5Xai is a replicate analysis of 5Xa. The length of the each horizontal dendrogram arm indicates the degree of correlation between the different specimens, which vary from 0% to 100% correlation. The shorter the dendrogram arm, the greater the degree of correlation.  1  -61 -  F I G U R E 3.3  Figure 3.3:  B R C A 1  mutation in Case  4.  Sequencing of BRCA1 exon 2 from case 4 using  germline D N A , primary tumor D N A , and xenograft D N A demonstrating a 185delAG mutation in all 3 D N A samples. The normal sequence should be T C T T A G A G T G T C C C . The germline demonstrates an obvious frameshift mutation (185delAG) resulting from deletion of A G . In both the primary tumor and the transplantable xenograft, loss of heterozygosity (LOH) has resulted in the presence of only the mutated allele in the sequence.  -62-  FIGURE 3.4  mmm  Bk  Bk  M  U  IT M  mm  IT U  IX M  1X  Sss+  Sss+  Sss- Sss-  mm  (B) Figure 3.4: B R C A 2 mutation and B R C A 1 promoter hypermethylation in Case 1. (A) Sequencing of B R C A 2 exon 3 from case 1 using germline D N A , primary tumor D N A , and xenograft D N A demonstrating the presence of a IVS2-7delT splicing mutation in all 3 D N A samples. The normal sequence should be G A T T T T T T T T T T A A A T A G A T T . The T deletion results in a frameshift mutation in the germline D N A which is also apparent in the primary tumor and transplatable xenograft. There is no evidence of L O H in the sequence. (B) BRCA1 promoter hypermethylation. Bk = Blank, IT = primary tumor D N A from case 1, I X = transplantable xenograft D N A from easel, Sss+ = normal D N A methylated with SssI methylase, Sss- = normal D N A not treated with SssI methylase, M = PCR primers for methylated BRCA1 promoter, U = PCR primers for unmethylated BRCA1 promoter. -63 -  3.5 References: 1. Cannistra SA. Cancer of the ovary. N E J M 2005;351:2519-29. 2. Giuntoli RL, Metzinger DS, DiMarco CS, Cha SS, Sloan JA, Keeney G L , Bostout BS, Retrospective review of 208 patients with leiomyosarcoma of the uterus: prognostic indicators, surgical management, and adjuvant therapy. Gynecol Oncol 2003;89:460-69. 3. Kerbel RS. Human Tumor xenografts as predictive preclinical models for anticancer drug activity in humans. Cancer Bio Therapy 2003;2:S134-S139 4. Buick R N , Pullano R, Trent J M . Comparative properties of five human ovarian adenocarcinoma cell lines. Cancer Res 1985;45(8):3668-76. 5. Nomura T, Sakurai Y , Inaba M (eds): The nude mouse and anticancer drug evaluation. Kawasaki And Tokyo: Jointly by Central Institute for Experimental Animals and Japanese Journal of Cancer And Chemotherapy Publishers Inc. Tokyo, 1996. 6. Boehm T, Folkman J, Browder T, O'Reilly M S . Antiangiogenic therapy of experimental cancer does not induce acquired drug resistance. Nature 1997; 390: 404-407 7. Eder JP Jr, Supko JG, Clark JW, et al. Phase I clinical trial of recombinant human endostatin administered as a short intravenous infusion repeated daily. J Clin Oncol 2002;20:3772-84. 8. Boyd J. Mouse models of gynecologic pathology. N E J M 2005; 352: 2240-2242. 9. Pupa S M , Menard S, Forti S, Tagliabue E. New insights into the role of extracellular matrix during tumor onset and progression. J Cell Physiol 2002; 161(5): 1557-65. 10. Lee C, Xue H , Sutcliffe M , et al. Establishment of subrenal capsule xenografts of primary human ovarian tumors in SCID mice: potential models. Gynecol Oncol 2005;96:48-55. 11. Zorn K K , Bonome T, Gangi L , et al. Gene expression profiles of serous, endometrioid, and clear cell subtypes of ovarian and endometrial cancer. Clin Cancer Res 2005; 11(18):6422-30. 12. Tusher V G , Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 2001;98(25):14863-8. 13. Baldwin L , Nemeth E, Tran H , et al. BRCA1 promoter region hypermethylation in ovarian carcinoma: A population-based study. Can Res 2000;60:5329-33. 14. Chan K Y K , Ozcelik H , Cheung A N Y , Ngan H Y S , Khoo U . Epigenetic factors controlling BRCA1 and B R C A 2 genes in sporadic ovarian cancer. Cancer Res 2002; 62:4151-56 15. Liede A , Karlan B Y , Baldwin R L , Piatt L D , Kuperstein G, Narod SA. Cancer incidence in a population of Jewish women at risk of ovarian cancer. J Clin Oncol 2002;20(6): 1570-7  -64-  16. Koul A , Nilbert M , Borg A . A somatic B R C A 2 mutation in RER+ endometrial carcinomas that specifically deletes the amino-terminal transactivation domain. Genes Chromosomes Cancer 1999;24:207-212. 17. Santarosa M . Letter to the Editors. Splice variant lacking the transactivation domain of B R C A 2 gene and mutations in the splice acceptor site of intron 2. Genes Chromosomes Cancer 1999; 26:381-384. 18. Vaidya A P , Parnes A D , Seiden M V . Rationale and clinical experience with epidermal growth factor receptor inhibitors in gynecologic malignancies. Curr Treat Options Oncol. 2005;6:103-14. 19. See HT, Kavanagh JJ, Hu W, Bast R C . Targeted therapy for epithelial ovarian cancer: current status and future prospects. Int J Gynecol Cancer 2003;13:701-34. 20. Garson K , Shaw TJ, Clark K V , Yao D-S, Vanderhyden B C . Models of ovarian cancer—Are we there yet? Molecular and Cellular Endocrinology 2005;239(l-2):15-26. 21. Auersperg N , Pan J, Grove B D , et al. E-cadherin induces mesenchymal-to-epithelial transition in human ovarian surface epithelium. Proc Natl Acad Sci U S A 1999;96:6249-54. 22. Ong A , Maines-Bandiera SL, Roskelley CD, Auersperg N . A n ovarian adenocarinoma line derived from SV40/E-cadherin-transfected normal human ovarian surface epithelium. Int J Cancer 2000;85:430-437. 23. Flesken-Nikitin A , Choi K, Eng J, Shmidt E N , Nikitin A Y . Induction of carcinogenesis by concurrent inactivation of p53 and R b l in the mouse ovarian surface epithelium. Can Res 2003;63:3459-3463. 24. Connolly DC, Bao R, Nikitin A Y , et al. Female mice chimeric for expression of the Simian virus 40 Tag under control of the MISIIR promoter develop epithelial ovarian cancer. Can Res 2003; 63:1389-1397. 25. Dinulescu D M , Tan AI, Quade BJ, Shafer SA, Crowley D, Jacks T. Role of K-ras and Pten in the development of mouse models of endometriosis and endometrioid ovarian cancer. Nat Med 2005; 11:63-70. 26. Bogden A E , Haskell P M , LePage DJ, Kelton DE, Cobb WR, Esber HJ. Growth of human tumor xenografts implanted under the renal capsule of normal immunocompetent mice. Exp Cell Biol 1979;47(4):281-93. 27. Bogden A E , Cobb WR, Lepage DJ, et al. Chemotherapy responsiveness of human tumors as first transplant generation xenografts in the normal mouse : six-day subrenal capsule assay. Cancer 1981;48(l):10-20. 28. Fiebig H H , Schuchhart C, Henss H , Fiedler L , Lohr GW. Comparison of tumor response in nude mice and in the patients. Behring Inst Mitt 1984;74:343-52.  -65-  29. Maenpaa J, Kangas L, Gronroos M . Response of ovarian cancer to combined cytotoxic agents in the subrenal capsule assay. Obstet Gynecol 1985;66(5):708-13. 30. Stratton JA, Kucera PR, Rettenmaier M A , et al. Accurate laboratory predictions of the clinical response of patients with advanced ovarian cancer to treatment with cyclophosphamide, doxorubicin, and cisplatin. Gynecol Oncol 1986;25(3):302-10. 31. Antoniou A , Pharoah PDP, Narod S, et al. Average risks of breast and ovarian cancer associated with BRCA1 or B R C A 2 mutations detected in a case series unselected for family history: a combined analysis of 22 studies. A m J Hum Genet 2003;72:1117-1130. 32. Bryant HE, Schultz N , Thomas HD, et al. Specific killing of B R C A - 2 deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 2005;434:913-17. 33. Farmer H, McCabe N , Lord CJ, et al. Targeting the D N A repair defect in B R C A mutant cells as a therapeutic strategy. Nature;434:917-921.  -66-  C H A P T E R 4: DISCUSSION A N D C O N C L U S I O N S  4.1 Study Limitations  4.1.1 Recruitment strategy. A prospective, consecutive, unselected recruitment strategy was used in this study to obtain an accurate assessment of the overall prevalence of B R C A abnormalities in the population of women with EOC referred to the Vancouver hospital between January 2004 and September 2005. Unfortunately, the prospective nature of this series prevented any correlation of the BRCA-loss phenotype with patient outcome. Nonetheless, we intend to continue following these patients to establish any prognostic differences between the subsets of high-grade serous EOC with and without BRCAl-loss. In addition, our recruitment strategy limited the sample size obtained, which impacts the overall validity of our findings. In order to comprehensively characterize these tumors for BRCA-loss, it was necessary to screen each patient for evidence of germline BRCA mutations. Due to the ethical and legal issues surrounding BRCA mutation analysis (1), all potential participants were required to discuss the implications of testing with a genetic counselor during an appointment in the Hereditary Cancer Program office. A significant proportion of women who expressed interest in the B R C A project and provided consent for the use of tumor tissue were unable or unwilling to meet with the genetic counselor to discuss the ramifications of BRCA testing. We were cognizant that any mutations identified in the tumor tissue could reflect an underlying germline mutation, implying an increased risk of breast cancer for the patient and potential increased risk of breast and ovarian cancer for the patient's family members. Therefore, women who could not meet with the genetic counselor were excluded, despite our ability to screen their tumor tissue directly for -67-  evidence of mutations. As a result of our small sample size, we can only speculate about the absence of BRCAl-loss in the less common subtypes, such as low-grade serous and clear cell. Validation of this observation will require continuing analysis with a larger sample. Furthermore, as discuss below, we can only make limited recommendations regarding issues such as the use of B R C A 1 IHC to triage women with EOC into hereditary screening programs. To ensure the participation of women expressing interest in similar studies in the future, it would be prudent for the genetic counselor to meet potential patients at a location and time which is convenient for each patient.  4.1.2 Limited BRCA2 analysis. The assessment of B R C A 2 in this series was limited by our inability to measure BRCA2-loss, and the paucity of knowledge regarding epigenetic B R C A 2 loss. We were able to characterize the B R C A 2 germline and somatic mutations, and assess for L O H at the B R C A 2 locus. However, attempt to validate a B R C A 2 antibody failed. B R C A 2 promoter hypermethylation has rarely been reported in EOC, and therefore this was not evaluated (2). We did find variation in the relative level of B R C A 2 R N A expression using realtime Q-RT-PCR with an Applied Biosystems B R C A 2 Taqman primer/probe set (Hs00609060_ml). The BRCA2 relative RNA expression has been added the data from Figure 2.2 to demonstrate these results (Figure 4.1). Unfortunately, these results are difficult to interpret without an associated marker of protein loss (such as B R C A 2 IHC), or a measurable mechanism of epigenetic loss. There was no clear association between BRCA2 RNA expression and histopathologic subtype.  4.1.3 Limitations related to EOC samples. Epithelial ovarian tumors are morphologically heterogeneous, consisting of a varied mixture of abnormal tumor cells and apparently normal cells, such as stromal cells, and inflammatory cells. -68-  The frozen tumor tissue collected for this  study consisted of tumor cells mixed with a varying degree of normal cells. This was not an issue for the IHC analysis, as it was possible to differentiate the tumor cells from normal stroma during microscopic visualization. Prior to selecting the frozen tissue for analysis, a corresponding H & E slide was examined to ensure that the sample consisted of at least 70% tumor cells. Nonetheless, all tumor tissue was contaminated by some degree of normal cells, and during the extraction of D N A and R N A for B R C A analysis there was certainly D N A / R N A from normal cells incorporated into the samples.  For example, many of the samples demonstrating a  strong band in the methylation column of the methylation-specific PCR assay also showed a weak band in the unmethylated column. We are unable to differentiate whether the band in the unmethylated column represents unmethylated D N A derived from the background normal cells, or incomplete methylation of the BRCA1 promoter in the tumor cells. For future studies, it may possible to reduce the influence of D N A from normal cells by dissecting tumor tissue away from normal stroma using a tissue microdissector. However, in many EOC the normal stromal cells are scattered throughout the tumor cells which would reduce the usefulness of this strategy.  4.1.4. Limitations of real-time Q-RT-PCR analysis. The issue of background contamination from normal stromal cells has particular significance with respect to the real-time Q-RT-PCR analysis. Even tumors with a clearly deleterious B R C A 1 mutations and BRCA1 L O H demonstrated some degree of B R C A 1 R N A expression, likely due to contamination with normal stromal cells. The performance of real-time Q-RT-PCR requires a comparison between the R N A expression in the tumor samples and a normal control. It is hypothesized that EOC originates from the surface epithelium of the normal ovary, and therefore the ideal comparison would be normal surface epithelium. However, the ovarian surface epithelium is a single layer of cells which is often disturbed during the surgical removal of the ovary. We attempted to isolate R N A immediately from freshly excised benign ovaries; however the R N A obtained was of low -69-  quantity and quality. Instead, we chose to obtain a measure of R N A expression by comparing R N A expression level from each individual tumor to the average R N A expression from all the tumors analyzed in this series. As a result, for each tumor we can only comment on the relative expression of R N A , which may have been influenced by the quantity of contaminating normal stromal R N A present in the tumor sample.  4.2 Implications regarding germline BRCA1 and BRCA2 mutations In our series, BRCA1 and BRCA2 germline mutations were found in 10/49 (20%) of invasive, non-mucinous EOC. In addition, we identified 22 unclassified variants with unknown significance (Table 4.1). The 20% prevalence of deleterious mutations seen in our series is higher than that reported in older historical series (3). However, a higher rate of germline mutations reported in recent population-based studies has been equated with more comprehensive screening techniques, such as dHPLC. Furthermore, our data supports recent reports indicating that a significant proportion of women carrying germline mutations in BRCA1 and BRCA2 do not have a strong family history of breast or ovarian carcinoma (4). In our series 4/8 (50%) women with germline BRCA1 mutations and 1/2 (50%) women with B R C A 2 mutations did not have a family history of breast and ovarian carcinoma (Table 4.1). Without a suggestive family history, these women may not have met the criteria for hereditary screening programs. It is intriguing that all tumors derived from patients with BRCA1 germline mutations showed loss of B R C A 1 protein based on negative BRCA1 IHC, and in all but one case these tumors demonstrated low relative BRCA1 R N A expression. This finding highlights the potential of using BRCA1 IHC and BRCA1 R N A analysis on tumor tissue as a screening tool to determine which women with EOC should be referred to hereditary screening programs. However, as discussed previously, our prospective and consecutive recruitment strategy resulted in a sample size which is insufficient to address the validity of this hypothesis. This observation -70-  will require confirmation in a larger sample of patients prior to implementing this form of screening into clinical practice. Furthermore, transferring this type of analysis into the clinical setting may be problematic, as the reliability of the currently available B R C A 1 antibody applied to routinely collected pathological specimens is unclear. We had the advantage of working with a collaborator (S. Kalloger) available on a regular basis to collect surgically excised tumor tissue directly from the operating room and immediately perform fixation in formalin.  4.3 Implications of epigenetic B R C A l - l o s s in E O C The characterization of BRCA1 and B R C A 2 abnormalities in this series of women with EOC provides further support to the importance of BRCA-loss in both hereditary and sporadic ovarian carcinoma. This is the first consecutive, unselected series of EOC in which detailed analysis of BRCAl-loss has been correlated with histopathological subtype. We have demonstrated that B R C A 1 and B R C A 2 loss is common in high-grade serous/undifferentiated EOC, while there is minimal evidence of either BRCA1 or B R C A 2 loss in other subtypes, including low-grade serous, clear cell and endometrioid carcinoma. In addition, when tumors with B R C A 1 / B R C A 2 mutations were excluded, the high-grade serous/undifferentiated EOC showing epigenetic BRCAl-loss were significantly different from those lacking BRCA1 loss. High-grade serous/undifferentiated EOC with BRCAl-loss were significantly more likely to be p21-, p53+, and Cyclin D1-. These results suggest that tumors with and without BRCA1 loss, as defined in this study, are distinct entities with different underlying molecular abnormalities. Increased expression of p53 has been previously correlated with high-grade EOC and serous subtype (5), and overexpression of the cell cycle protein CyclinDl has been demonstrated in 50% of serous EOC (6). Although overall in our series there was CyclinDl overexpression in about 50% of serous EOC, the epigenetic BRCA1 loss group was predominately CyclinDl-. Loss of the cyclin-dependent kinase inhibitor p21 has been associated with higher grade serous -71 -  EOC (7). In addition, serous EOC with combined overexpression of p53 and loss of p21 have significantly shorter overall survival and progression-free survival (7,8). These findings suggest that the subgroup of tumors in our series with epigenetic B R C A 1 loss should have a worse prognosis, as these tumors were p53+ and p21-. This would be consistent with a recent report demonstrating adverse prognosis in EOC with BRCA1 promoter hypermethylation (9). These authors suggest that B R C A 1 promoter hypermethylation may signify a process of global epigenetic alterations that contribute to the aggressive nature of these tumors. However, this suggestion contrasts with the findings of Thrall et al who reported that negative BRCA1 IHC in sporadic EOC was associated with a favorable prognosis (10), suggesting, indirectly, that BRCA1 loss may be associated with a favorable prognosis. It was initially expected that EOC derived from women with BRCA germline mutations should have a more favorable response to chemotherapy, compared to sporadic EOC. Considering the critical role of B R C A 1 and B R C A 2 in the repair of D N A damage, it was assumed that tumors lacking these proteins would be more susceptible to chemotherapy. The literature is conflicted regarding differences in prognosis between hereditary and sporadic EOC. Some studies show significantly improved survival among patients with germline BRCA mutations (11, 12,13) compared to those without, while others show no difference in clinical outcome (14, 15). However, these conflicting results are not surprising when one considers the potential prevalence of epigenetic BRCAl-loss in sporadic EOC. It is impossible to know how many of the sporadic tumors in these studies actually expressed BRCA1 protein, and by which mechanism BRCAl-loss may have occurred. The prognostic significance of BRCAl-loss remains uncertain, but there is evidence that the mechanism of loss influences tumor behavior. The strategy we used to characterize BRCAl-loss may be helpful in addressing this question, as we have information regarding the mechanism leading to BRCAl-loss. However, it will be necessary to expand our series to obtain enough power to address the issue of prognosis. In the -72-  future, performing global methylation analysis on our tumor samples may help address questions regarding the influence of global methylation status on tumor behavior.  4.4 Fresh tissue xenograft mouse model for EOC We have demonstrated that fresh tissue from high-grade EOC and a uterine sarcoma can be grown under the renal capsule of NOD/SCID mice and serially transplanted from mouse to mouse for multiple generations. The histopathological and architectural features of the primary tumor are maintained in the xenograft after transplanting from mouse to mouse for up to 6 generations. In addition, the serially transplanted tumors maintain some degree of genetic stability based on the assessment of a 287 loci array aCGH platform. The assessment of genetic stability in this model is hindered by the high degree of genetic instability inherent in high-grade EOC. The series discussed in Chapter 2 demonstrated that high-grade E O C are characterized by significant genomic instability, as reflected by the frequent occurrence of L O H . To compensate for this in our analysis of genetic stability, we compared the xenograft tumor tissue to 3 different samples from different areas of the corresponding primary tumor. The divergence of genetic correlation between the 3 different areas of the same primary tumor highlights the degree of genomic instability present within high-grade EOC. However, we were encouraged to see that in most cases the xenograft tumor tissue clustered together with the primary tumor samples. In fact, the degree of genetic variability between the primary tumor and the xenografted tumor was not much greater than that seen between different samples of the same primary tumor. Testing of novel targeted therapeutics will require in vivo models which reflect the responsiveness of the tumors occurring in humans. Though we have demonstrated that our model maintains genetic stability and maintains the expression of potential targets, we have not assessed the response of our model to therapies. Prior to assessing the efficacy of targeted therapeutics in this xenograft model, it will be critical to determine whether the xenograft tumor -73-  tissue shows a similar response to that seen in the corresponding patient, when treated with the same chemotherapy protocol. This will require the development of a reproducible methodology to measure the response to treatment in the xenograft tumors, which can be reproducibly compared to the response in human patients.  4.5 Implications regarding treatment of EOC: PARP inhibitors The current treatment algorithm for EOC is similar regardless of histopathologic subtype, and consists of a combination of surgery and chemotherapy +/ - radiotherapy. Unless the patient presents with Stage IV disease or is medically unfit for surgery, the initial component of treatment consists of an attempt to remove all macroscopic disease, followed by chemotherapy using a combination of carboplatin and paclitaxel. The antitumor activity of carboplatin is mediated through the formation of platinum adducts with D N A , while paclitaxel stabilizes intracellular microtubules resulting in disordered cell division. Although 70% of patients with EOC show evidence of response to first line chemotherapy, 70% of these women will recur, and most of these women ultimately die with progressive disease. Rapidly growing tumor cells do exhibit increased sensitivity to carboplatin/paclitaxel; however, these chemicals still have a considerable impact on normal cells, resulting in potentially dose limiting side-effects. Despite evidence implicating unique molecular mechanisms in the development of different subtypes of EOC, there has been minimal progress with targeted treatment for EOC.  Most advances in the  treatment of EOC have been related to more aggressive surgery and variations on the regimens of non-targeted chemotherapy. However, the limitations of this strategy is highlighted by a recent multi-center trial (GOG 182) which showed no difference in outcome between multiple chemotherapy regimens, including a variety of newer non-targeted agents (16). Histological subtype and grade have some prognostic value, however even among highgrade serous EOC with identical morphological appearance there remains significant variability -74-  in treatment response, suggesting variable underlying molecular features.  The results of our  work indicating that high-grade serous EOC can be divided into 2 subsets based on BRCAl-loss, has potential therapeutic implications related to a group of molecules called PARP inhibitors. As mentioned previously, it has been proposed that these molecules may selectively damage B R C A null tumor cells in hereditary EOC while sparing the patient's normal cells (17). Our results indicate that up to 50% of sporadic high-grade EOC exhibit BRCAl-loss either through somatic mutation or epigenetic inactivation. In addition to somatic mutation or promoter hypermethylation, these sporadic EOC appear to have lost one BRCA1 allele through L O H , and the expression of B R C A 1 is significantly decreased in the tumor tissue. In contrast, these patient's normal cells should continue to express BRCA1 because they possess at least 1 wildtype BRCA1 allele in the germline D N A , and therefore normal cells should be protected from the effect of PARP inhibitors. However, the tumor cells should be sensitive to PARP inhibitors in a similar manner to tumor cells from BRCA-null hereditary EOC (18,19).  4.6 Implications of BRCAl-null xenograft model It is encouraging that both the 185delAG B R C A 1 mutation and the epigenetic loss through BRCA1 promoter hypermethylation is maintained during serial transplantations of the xenografted tumor tissue from mouse to mouse. Despite the lack of rigorous pre-clinical testing of PARP inhibitors in a suitable in vivo model of B R C A l - n u l l EOC, Phase I testing of PARP inhibitors in women with hereditary EOC has been initiated. It seems unlikely that tumor cells originating in women with germline BRCA mutations will reacquire B R C A when exposed to PARP inhibitors. However, this concept has not been examined in model systems prior to proceeding with Phase I trials. Furthermore, the influence of PARP inhibitors on EOC cells with BRCAl-loss secondary to BRCA1 promoter hypermethylation has not been reported. Despite reports that methylation patterns are transmitted to the next generation during cell division (20), -75-  it is unknown whether tumor cells with hypermethylation of the BRCA1 promoter will be able to demethylated the BRCA1 promoter when exposed to agents such as PARP inhibitors. The xenograft mouse models we have developed exhibiting genetic and epigenetic BRCAl-loss may help address these questions, as well as providing models to perform pre-clinical assessment of P A R P inhibitors.  4.7 Concluding Remarks Using a comprehensive assessment of BRCAl-loss in a consecutive, unselected series of EOC we have established that BRCAl-loss is present in >40% of these tumors. BRCAl-loss is present in >60% of high-grade serous/undifferentiated tumors, but is not found in low-grade serous, endometrioid or clear cell EOC. In addition, the subset of high-grade serous/undifferentiated E O C which possess epigenetic BRCAl-loss also exhibit a particular IHC profile (p53+, Cyclin D1-, p21-). The significance of BRCAl-loss with respect to prognosis and treatment remains unclear, but has increasing significance related to progress with PARP inhibitors. Further characterization of our xenograft model possessing either genetic or epigenetic BRCAl-loss may help address the implications of BRCA-loss in EOC, and assist with the development and testing of P A R P inhibitors.  -76-  Table 4.1 Mutations and unclassified variants.  Tumor  186 223 239 283 293 327 329 336 379 163 212 305 161 208 217 219 229 242 273 309 319 324 3  -  BRCA1 Mutations  BRCA2 Mutations  BRCA1 U V  BRCA2UV  G1560X 1351delAT E143X 185delAG R1751X R1203X 3450delCAAG K1601X K711X* -  8474delAG 4265delCT* W31X -  -  ~  -  ~  -  -  -  -  372  -  -  394  -  -  Y856H  3 6  -  M l 149V  -  R2108H  T1700A M l 6521 G890V D693N -  Y2215C IVS2-7delT  R841W S1040N -  U V : unclassified variant * Somatic mutation only, with wild-type germline D N A  -77-  D1420Y K3326X V2109I K3326X IVS10+12delT T3013I T1915M E2856A R2034 D2723A G1194D  T a b l e 4.2 G e r m l i n e m u t a t i o n s c o r r e l a t e d w i t h f a m i l y h i s t o r y  Tumor  Germline Mutation  156 161  None None  172 178 186 195 198 201 208 212 213 217 219 221  None None B1-G1560X None None None None None None None None None  229 236  None None  240 242 254 273 280 281  None None None None None None  Family History Sporadic Sporadic ^Sporadic Familial Familial Familial Sporadic Sporadic Sporadic Sporadic Sporadic N.A. Sporadic Sporadic Sporadic Familial Sporadic Sporadic! Familial Sporadic Familial Sporadic Sporadic Sporadic  Tumor 283 •  297 "305 309 319 324 329 330 332 334 336 343 344 345 363 366 372 379 384 388 392 394  Family History  Germline Mutation  Familial  B1 - 185delAG None " ~ ' B2-320G>T None None None B1 - 3 4 5 0 d e l C A A G None None None ^ B1 - K1601X None None None None None None None None None None None  '  Familial Familial Familial Familial Familial Familial Sporadic Familial Familial Familial _ Sporadic Sporadic Sporadic Sporadic Sporadic NA. N.A. Familial Sporadic Sporadic Sporadic  B l = BRCA1 germline mutation, B2 = B R C A 2 germline mutation, N . A . = not available * Germline mutations are highlighted to demonstrate the presence or absence of family history  -78-  FIGURE 4.1 Mut Ser/Undiff-HG 223 329 293 283 239 336 327  Serous - HG Serous - HG Serous - HG Serous - HG Serous - HG Ser/Undiff-HG Serous - HG S^oj^^+G^ Serous - HG  330 332 388 201 363 161 344 345 384 178 229  Serous - HG Serous - HG Serous - HG Ser/Undiff-HG Serous - HG Ser/Undiff-HG Serous - HG Serous - HG Serous - HG Serous - HG Serous - HG  BRCA1 Status BRCA2 Status Associated features LOH Meth RNA IHC • Mut LOH RNA 1 Classification 1 PP | WT1 | p21 |^S31 CyD1 NO MSI LOH LOH LOH LOH LOH LOH LOH  0.4 0.14 0.02 0.65 3.10 0.16 0.10 0.04 0.07  NO MSI LOH NO LOH NO LOH LOH LOH  2.68 0.45 0.03 0.78 0.47 0.30 0.11 0.06 0.12  LOH LOH LOH LOH LOH LOH LOH LOH/MSI LOH/MSI LOH LOH LOH  0.08 0.07 0.08 0.67 1.87 0.27 0.09 0.30 0.41 0.15 0.42 0.19  LOH LOH NO LOH NO NO NO LOH/MSI MSI LOH LOH LOH  0.43 0.37 2.53 1.42 1.32 4.56 1.47 2.30 0.28 0.87 1.67 0.15  M  BRCA1 loss through germline or somatic mutation  High grade carcinoma showing epigentic BRCA1 loss  NO LOH  0.56 0.89  NO NO  0.38 N/A  195 236 280 172 254 319 372 208 273 240 297 366  Serous - HG Serous - HG Ser/Undiff-HG Serous - HG Serous - HG Serous - HG Serous - HG Undiff - HG Undiff - HG Undiff - HG Serous - HG Serous - HG  N/A LOH LOH LOH LOH LOH LOH LOH LOH NO NO LOH  1.53 1.69 3.11 2.21 0.48 0.62 2.02 0.81 1.54 0.41 1.77 2.25  N/A LOH LOH LOH LOH LOH LOH LOH LOH NO NO LOH  1.85 1.87 3.02 1.28 0.27 0.40 0.84 0.79 0.33 0.25 1.28 5.90  221 324 198 213 219 392 242 281 334 156 343  Serous - LG Serous - LG Clear cell Clear cell Clear cell Clear cell Endo - G2 Endo - G2 Endo - G1 Endo - G2 Endo - G2  LOH NO NO NO NO NO NO NO NO MSI NO  1.46 0.50 1.55 2.90 0.58 1.51 1.02 1.35 1.18 1.42 0.27  NO NO LOH NO NO NO NO NO NO MSI NO  0.56 0.43 0.34 0.39 0.35 0.75 0.15 1.01 0.41 0.97 0.30  163 Serous - HG 305 Serous - HG 212 Serous - HG  LOH LOH LOH  2.08 1.54 1.22  LOH LOH LOH  0.35 • BRCA2 loss 1.00 • through 0.58 I mutation  -79-  4/6 1/5 3/5 3/8  foi  wmwm  309 Serous - HG 394 Serous - HG  M  0/4 MSI 5/6  Equivocal BRCA1 loss  High grade carcinoma without BRCA1 loss  Low grade serous, | endometrioid, clear cell (No BRCA1 loss)  1  Figure 4.1: Summary of B R C A 1 and B R C A 2 abnormalities and associated features.  Pathology refers to the tumor histopathology. Serous or Ser = serous carcinoma; Undiff= undifferentiated carcinoma; H G = high-grade; L G = low-grade; Clear cell = clear cell carcinoma; Endo = endometrioid carcinoma; G l = grade 1; G2 = grade 2; G3 = grade 3. BRCA1 Status & BRCA2 Status: Mut = mutation; G = germline; S = somatic; N = no mutations. L O H = loss of heterozygosity where L O H indicates that loss of heterozygosity is present, No indicates that loss of heterozygosity is not present, and MSI indicates that microsatellite instability is present in the tumor. Meth refers to BRCA1 promoter hypermethylation; M = methylated promoter; U = unmethylated promoter. R N A refers to relative R N A expression compared to the average R N A expression in all samples, where the average R N A expression = 1.0. Tumors with relative R N A expression <0.7 are highlighted as showing BRCAl-loss. IHC refers to B R C A 1 immunohistochemistry; (+) indicates tumors with > 5% of nuclei stained positive for B R C A 1 , (-) indicates tumors with <5% of nuclei positive. Associated features: PP refers to the powerplex analysis of 8 polymorphic tri- and tetranucleotide repeat elements from throughout the genome, where the ratio indicates the number of microsatellite markers showing L O H compared with the total number of informative microsatellite markers. Tumors with L O H at 50% or more informative markers is highlighted. Associated immunohistochemical markers p21, p53, Cyclin D l (CyDl), and WT-1 refer to immunohistochemical staining results. Scoring of immunostaining was done as follows: p21: 0 = <5% nuclei positive and 1 = >5% of nuclei positive. p53: 0 = <50% nuclei positive and 1 = >50% of nuclei positive. WT1 and Cyclin D l : 0 = <5% nuclei positive, 1 = 5-50% nuclei positive, and 2 = >50% nuclei positive. N / A indicates that the data is not available for technical reasons. Features consistent with BRCA-loss are highlighted.  -80-  4.8 References 1. Kodish E, Wiesner G L , Mehlman M , Murray T. Genetic testing for cancer risk - How to reconcile the conflicts. J A m Med Assoc 1998;279:179-81. 2. Gras E, Cortes J, Diez O et al. Loss of heterozygosity on chromosome 13ql2-ql4, B R C A 2 mutations, and lack of B R C A2 promoter hypermethylation in sporadic epithelial ovarian tumors. Cancer 2001;92:787-795. 3. Risch H A , McLaughlin JR, Cole De et al. Prevalence and penetrance of germline BRCA1 and B R C A 2 mutations in population series of 649 women with ovarian cancer. A m J Hum Genet 2001;68:700-710. 4. Pal T, Permuth-Wey J, Berts JA, et al. BRCA1 and B R C A 2 mutations account for a large proportion of ovarian carcinoma cases. Cancer 2005;104:2807-16. 5. Gomes CP, Andrade L A . P T E N and p53 expression in primary ovarian carcinomas: immunohistochemical study and discussion of pathogenic mechanisms. Int J Gynecol Cancer 2006; 16(Suppl): 254-8. 6 Chen C H , Shen J, Lee WJ, Chow SN. Overexpression of cyclin D l and c-Myc gene products in human primary epithelial ovarian cancer. Int J Gynecol Cancer 2005; 15: 878-83. 7. Bali A , O'Brien P M , Edwards LS, Sutherland R L , Hacker NF, Henshall S M . Cylin D l , p53, and p21 Wafl/Cipl expression is predictive of poor clinical outcome in serous epithelial ovarian cancer. Clin Cancer Res 2004; 10: 5168-77. 8. Geisler HE, Geisler JP, Miller G A , et al. p21 and p53 in ovarian carcinoma: their combined staining is more valuable than either alone. Cancer 2001; 92: 781-6. 9. Chiang JW, Karlan B Y , Cass L, Baldwin R L . B R C A 1 promoter hypermethylation predicts adverse ovarian cancer prognosis. Gynecol Oncol 2006; 101: 403-10. 10. Thrall M , Gallion H H , Kryscio R, et al. B R C A 1 expression in a large series of sporadic ovarian carcinomas: a Gynecologic Oncology Group study. Int J Gynecol Cancer 2006; 16: 16671. 11. Boyd J, Sonoda Y , Federici M G , et al. Clinicopathologic features of BRCA-linked and sporadic ovarian cancer. J A m Med Assoc 2000;283:2260-5. 12. Aida H, Takakuwa K, Nagata H , et al. Clinical features of ovarian cancer in Japanese women with germ-line mutations of B R C A 1 . N Engl J Med 1996;335:1413-6. 13. Pharoah PDP, Easton DF, Stockton D L , et al. Survival in familial, B R C A 1-associated, and BRCA2-associated epithelial ovarian cancer. Cancer Res 1999;59:868-71. 14. Johannsson OT, Ranstam J, Borg A , et al. Survival of B R C A 1 breast and ovarian cancer patients: a population-based study from southern Sweden. J Clin Oncol 1998;16:397-404. -81 -  15. Buller RE, Shahin M S , Geisler JP, et al. Failure of B R C A 1 dysfunction to alter ovarian cancer survival. Clin Cancer Res 2002;8:1196-2002. 16. Bookman M A : GOG0182-ICON5: 5-arm phase III randomized trial of paclitaxel and carboplatin vs combinations with gemcitabine , PEG-lipososomal doxorubicin, or topotecan in patients with advanced-stage epithelial ovarian or primary peritoneal carcinoma. [Abstract] J Clin Oncol 24 (Suppl 18): A-5002,256s, 2006. 17. Turner N , Tutt A , Ashworth A . Targeting the D N A repair defect of B R C A tumors. Curr Opin Pharmacol 2005;5:388-94. 18 Farmer H , McCabe N , Lord CJ, et al. Targeting the D N A repair defect in B R C A mutant cells as a therapeutic strategy. Nature 2005;434:917-21. 19 Bryant HE, Schultz N , Thomas HD, et al. Specific killing of B R C A - 2 deficient tumors with inhibitors of poly(ADP-ribose) polymerase. Nature 2005; 434: 913-7. 20. Santos F, Hendrich B, Reik W, Dean W. Dynamic reprogramming of D N A methylation in the early mouse embryo. Dev Biol 2002;241:172-182.  -82-  APPENDIX 1: DETAILED METHODOLOGIES:  Appl.l DNA extraction: Protocol for Extraction of D N A from Frozen Tissue using Gentra Systems PureGene D N A Extraction Kit: 1) Add lOOOul of Cell Lysis to a 1.5ml microcentrifuge tube 2) Using a warmed, clean scapel blade incise a 5mm x 5mm x 5mm segment of frozen tissue on a the sterile surface of a Petri dish 3) Morcelate the tissue fragment with the edge of the scalpel blade 4) Add the frozen tissue segment to the Cell Lysis solution 5) Add 5ul of Proteinase K Solution (20mg/ml) 6) Incubate in 55 degree waterbath overnight 7) Add 5ulofRNase A Solution (4mg/ml) 8) Incubate at 37 degrees for 1 hour 9) Add 333ul of Protein Precipitation Solution 10) Vortex and the Centrifuge at 16,000g x 3 minutes at room temperature 11) Remove supernatant and add equal quantities to 2 new 1.5ml microcentrifuge tubes containing 500ul of 100% Isopropanol 12) Invert the tubes 50 times 13) Centrifuge at 16,000 x g for 5 minutes at room temperature - pellet of D N A should form in the bottom of the tube 14) Remove and discard the supernatant 15) Add 500ul of 70% Ethanol to each tube 16) Centrifuge x 1 minute at room temperature with care to avoid dislodging the D N A pellet 17) Air dry 10-15 minutes 18) Add 75ul of D N A Hydration Solution to each tube 19) Incubate in 65 degree water bath x 1 hour 20) Combine the contents of the 2 microcentrifuge tubes into one 1.5ml microcentrifuge tube and store at 4 degrees  - 83 -  Appl.2 RNA extraction: Protocol for Extraction of R N A from Frozen Tissue using Trizol (Gibco B R L ) 1) Use filtered pipette tips and DEPC treated reagents for all steps in R N A extraction protocol 2) Add 1000ml of Trizol (Gibco B R L ) to a 15ml round bottom Falcon tube and store on ice 3) Keep all frozen tissue on dry ice during the extraction 4) Using a warmed, clean scalpel blade incise a 5mm x 5mm x 5mm segment of frozen tissue on a the sterile surface of a Petri dish 5) Add segment of tissue to Trizol and place the Falcon tube in a 1000 ml beaker filled with ice 6) Morcelate tissue in tissue homogenizer (in fume hood) while on ice 7) Transfer the Trizol to a 1.5ml microcentrifuge tube on ice (in fume hood) 8) Add 200ml of Chloroform and shake vigorously x 15 seconds (in fume hood) 9) Incubate at room temperature x 2 minutes 10) Centrifuge at 12,000 x g for 15 minutes at 4 degrees 11) Transfer the upper aqueous phase to a new 1.5 ml microcentrifuge tube 12) Add 0.5ml of 100% isopropanol, mix, and incubate sample at room temperature for 10 minutes 13) Centrifuge at 12,000 x g for 10 minutes at 4 degrees 14) Remove supernatant 15) Wash pellet once with 1ml of 75% ethanol (in DEPC water) 16) Vortex sample and centrifuge at 7,500 x g for 5 minutes at 4 degrees 17) Remove supernatant and allow to air dry for 10 minutes 18) Add RNase-free water and pass the solution a few times through a pipette tip 19) Incubate at 55 degrees for 10 minutes  -84-  Appl.3 L O H analysis: There were 4 microsatellite markers used to assess BRCA1 (chromosome 17) and 4 microsatellite markers used to assess B R C A 2 (chromosome 13)  BRCA1 Microsatellite markers: Name D17S855 D17S1323 D17S1325 D17S1185  Label (PAM) (HEX) (NED) (FAM)  Temperature 60 degrees 56 degrees 56 degrees 58 degrees (**must add D M S O to PCR, 1.25 ul per tube**)  B R C A 2 Microsatellite markers: Name D13S217 D13S171 D13S267 D13S260  Label (HEX) (FAM) (HEX) (FAM)  Temperature 55 degrees 50 degrees 53 degrees 60 degrees  P C R Mix:  lOx Buffer dNTPs(lO) MgCl(25) Primer F (10) Primer R (10) Taq Gold dH20 DNA  2.5 ul 0.5 ul 1.5 ul 1.5 ul 1.5 ul 0.125 ul 15.375 ul +2.0ul (50ng/ul)  P C R Protocol:  1) 2) 3) 4) 5) 6)  94 degrees x 3 min 94 degrees x 30 sec Primer specific temp x 30 seconds 72 degrees x 1 min Goto 2 for 34 cycles 72 degrees x 7 min  Loading mix for Genetic Analyzer:  R O X 500 Ladder Formamide PCR Product  0.5 ul 9.0 ul 0.5 ul -85-  LOH Primer Sequences and product size: D17S855 Left Primer: GGATGGCCTTTTAGAAAGTGG Right Primer: A C A C A G A C T T G T C C T A C T G C C Distance: 143 bps D17S1323 Left Primer: TAGGAGATGGATTATTGGTG Right Primer: A A G C A A C T T T G C A A T G A G T G Distance: 155 bps D17S1325 Left Primer: A A A G G T G G C A A T T C A C A G T T G Right Primer: G T G A T A A A A C T C A G T G G T A C T C Distance: 155 bps D17S1185 Left Primer: G G T G A C A G A A C A A G A C T C C A T C Right Primer: G G G C A C T G C T A T G G T T T A G A Distance: 203 bps D13S217 Left Primer: ATGCTGGGATCACAGGC Right Primer: A A C C T G G T G G A C T T T T G C T Distance: 160-174 bps D13S260 Left Primer: AGATATTGTCTCCGTTCCATGA Right Primer: C C C A G A T A T A A G G A C C T G G C T A Distance: 158-173 bps D13S171 Left Primer: C C T A C C A T T G A C A C T C T C A G Right Primer: T A G G G C C A T C C A T T C T Distance: 227-241 bps D13S267 Left Primer: GGCCTGAAAGGTATCCTC Right Primer: T C C C A C C A T A A G C A C A A G Distance: 148-162 bps  -86-  A p p 1.4 D N A mutation analysis: Sequence of the amplicons used for dHPLC and direct sequencing for each B R C A 1 and B R C A 2 exon. The primer sequences are highlighted. Primer sequences were developed by Dr. Margaret Smith in the department of Molecular Genetics, The Royal Melbourne Hospital, Parkville, Australia.  BRCA1  amplicons:  Exon 2 gcccccgccgalgasgttgtcattftata^ atttatctgctcttcgcgttgaagaagtacaaaatgtcattaatgctatgcagaaaatcttagagtgtccc  llillllill Exon 3  ||g_ffg_(|_^ ttttctccccccctaccctgctagte^ gtgge^^tcgggcggggg Exon 5 CCCgCCg']__tgg^{^  acttotcaacttagaagaaagggccttcacagtgtcc^ 'gcaacca^cgggcgg Exon 6 gcccccgccgccttaaaaggttgataajeaettgetgagtgtgtrtete agctt^gttgaagagctattgaaaatcatttgtgcttttcagctt  Exon 7 cgcccgccgc^tacatttttctctaactgcaaacataatgtffl actctcctgaacatctaaaagatgaagtttctatcatccaaagtatgggctacagaaaccgtgccaaaagacttctacagagtgaacccgaaa atccttccttggtaaaageatttgB Exon 8 ggacaaagcagcggatacaacctcaaaagacgtctgtxtacattgaattgggtaagggtctcaggtttttt  __^iSllMlg^l^_| Exon 9 fj|||^ tgggggjg^^  Exon 10 cctcaaggaaecagggatgaaatcagtttggattctgcaaaaaagggtaatggcaaagtttgc§|^^  -87-  Hxon 11 a  acggatgtaacaaatactgaacatcatcaacccagtaataatgatttgaacaccactgagaagcgtgcagctgagaggcatccagaaaagt atcagggtagftctgtttcaaacttgcatgtggagccatgtggcacaaatactcatgccagctcattacagcatgagaacagcag^ actaa^gacaga^^  _l^_^^_al Exon l i b  eagaa|gaj_gJ3^^ ggaaacatgtaatgataggcggactcccagcacagaaaaaaaggtagatctgaatgctgatcccctgtgtgagagaaaagaatggaataa gcagaaactgccatgctcagagaatcctagagatactgaagatgttcctt^ tccagaagtgatgaactgttaggttctgatgactcacatgatggggagtctgaatcaaatgccaaagtagctgatgtattggacgtt aggtagatgaatattctggttct Exon 11c f||||||§^^  gttctaaatgaggtagatgaatattctggttcttcagagaaaatagacttactggccagtgatcctcatgaggcW  agttcactccaaatcagtagagagtaatattgaagacaaaatattt^ aactgaaaatctaattataggagcatttgttactgagc^^ tacatcaggccttcatcctgaggattttatcaagaaagcagatttggcagttcaaaagactcctgaaatgataaatcag ggageagMlgg:^gtgatga Exon l i d  caaaagactcctgaaatgataaatcagggaactaaccaaacggagcagaatggtcaagtgatgaatattactaatagtggtcatgagaataa aacaaaaggtgattctattcagaatgagaaaaatcctaacccaatagaatcactcgaaaaagaatctgctttcaaaacgaaagctgaacctat aagcagcagtataagcaatatggaactcgaattaaatatccacaattcaaaagcacctaaaaagaataggctgaggaggaagtcttctacca ggcatattcatgcgcttgaacta^ ataaagaaaaaaafi^i^il^l^^illffl  Exon l i e flllllilll^  aaaagtacaaccaaatgccagtcaggcacagcagaaacctacaactcatggaaggtaaagaacctgcaactggagccaagaagagtaac aagccaaatgaacagacaagtaaaagacatgacagcgatactttcccagagctgaagt^ aataccagtgaacttaaagaatttgtcaatcctagccttccaagagaagaaaaagaagagaaactagaaacagttaaagtgtctaataatgct gaagaccccaaagatotcatgttaa^ attatggcactca__^S_la^l_^^l__a^ Exon 11 f  ttatggcactcaggaaagtatctcgttactggaagftagcactrt^ catttgaaaaccccaagggactaattcatggttgttccaaag ccacagtcgggaaacaagcatagaaatggaagaaagtgaacttgatgctcagtatttgcagaatacattcaaggtttca^ tgctccgttttcaaatccaggaaatgcagaagaggaatgtgcaacattctctgcccactctgggtccttaaagaaacaaagtcc^ ttttgaatgtgaajaaaaggaagaaaa  -88-  Exon l l g l^^^l^^^^^^atccaggaaatgcagaagaggaatgtgcaacattctctgcccactctgggtccttaaagaaacaaagtccaaaa gtcacttttgaatgtgaacaaaaggaagaaaatcaaggaaagaatgagtctaatatcaagcctgtacagacagttaatatcactgcagg ctgtggttggtcagaaagataagccagttgataatgcc cgaaactggactcattactccaaatoaacatggacttttocaaaaccca Exon 11 h ll^iiagffe^el^^ tatcgtataccaccact^cccatcaagtcatttgttaaaactaaatgtaagaaaaatctgctagaggaaaacW ctgaaagagaaatgggaaatgagaacattccaagtacagtgagcacaattagccgtaataacattagagaaaatgttW tcaagcaatattaatgaagtaggttccagtactaatgaagtgggctccagtattaatgaaataggttccagtgat^ taggtagaaacagagggccaaaattgaatgcMgcttagattagg itaageatcetga Exon l l i gjffieoaMgatgaa^ ggtctataaacaaagtcttcctggaagtaattgtaagcatcctgaaataaaaaagcaagaatatgaagaagtagtt ttctctccatatctgatttcagataacttagaacagcctatgggaagtagtcatgcatctcaggtttgttctgagaca atggtgaaataaaggaagatactagt^gctgaaaatgacattaaggaaagttctg^ Exon 11 j aaggagagcttagcaggagtcctagccctttcacccatacac^ agagaacttatctagtgaggatgaagagcttccctgctt^ caccgttgctaccgagtgtctgtctaagaacacagaggagaatttattatcattgaagaatagctte gcaaaggcatctcaggaacato, Exon I l k gglgctajigggjgj^ aaggcatctcaggaacatcaccttagtgaggaaacaaaatgttctgctagcttgttttcttcacag^ atacaaacacccaggatcctttcttgattggltcttccaaacaaatgaggcatcagtctgaaagccagggagtt^ ggtttcagatgatgaagaaagaggaacgggcttggaagaaaata^  gtttttgtgtttgccccagtctatttatagaagtgagctaaatg^^^^^^^  Exon 12 ^^^^^^^^^^^& g gg g g agcatctgggtgtgagagtgaaacaagcgtctctgaagactgctcagggc tatcctctcagagtgacatmaaccactcaggtaaaaagcgtgtgtgtgtgtgcacatgcgtgtgtgtggt tttt  ttatttaa  t  aa  c  Exon 13 ll[tft^  gttagaacagcatgggagccagccttctaacagctaccctt^ gcacatejgaaaaagg|g|g|attgiggf Exon 14  |||j||f§|^^ agaaggcctttctgctgacaagtttgaggtgte^ tgtaaagajgetg|gg|atoJgaGat6jffit' -89-  Exon 15  1§§|||^^ cttcagaatagaaactacccatctcaagaggagctcattaaggttgttgatgtgga gacggaaacatcttacttgccaaggcaagatctaggtaat^^ Exon 16 ctggaatcagcctcttctctgatgaccctgaatctg^ ctctgcattgaaagttccccaattgaaagttgcagaatctgcccagagtccagctgctgctcatactactgatactgctgggtataatgcaatg gaagaaagtgtgagcagggagaagccagaattgacagcttcaacagaaagggtcaacaaaagaatgtccatggtgg^ cccagaagaatttgtgagtgtatccatatgtatctccctaatgacteagactta^^^^^^^^^^g^§ Exon 17 ttaactaatctaattactgaagagactactcatgttgttatgaaaacaggtataccaagaacctttacagaataccttgcatctgctgca^^^  Exon 18 g»ggMiag^ggcaacttctaatccfflgagtgttmcatt ggaattgcgggaggaaaatgggtagttagctatttctgtaagtataatactatttctcccctcctcccttt Exon 19  §j|agageaggj^^ aagtacttgatgttacaaactoaccagagatattcatt^ ggjpa Exon 20 f||||fg1^^  gtcaatggaagaaaccaccaag^  Exon 21 aacatgcccacaggtaagagcctgggagaaccccagagttcca^ gMggggglifegai Exon 22 gtgcttctgtggtgaaggagctttcatcattcacccttggcacagtaagtattgggtgccctgtcagagagggaggacac glggaaga^ggS Exon 23 liliilg^  |g^gj|^g gg a  a c a a t  gg^^  -90-  Exon 24 gtgtgaggcacctgtggtgacccgagagtgggtgttggacagtgtagcactctaccagtgccaggagctggacacctacctgatacccca gatcccccacagccactactgactgcagccagccacaggtacagagccacaggaccccaagaatgagctt^^ ccctgggagctcctctcactcttcagtccttctactgtcctggct  BRCA2  Amplicons:  Exon 2 aagcattggaggaqtatcgtaggtaaaaatgectattggato aggtap^^^S|ttfa|S^^^? Exon 3 cccgccgcccccgccgtgcxsrcaacaa^ gtctgtcactggttaaaactaaggtgggattttttt^ cctataattctgaacctgcagaagaatctgaacataaaaacaacaattacgaaccaaacctatttaaaactcc tcagctggcttcaactccaataatattcaaagagcaagggctgactctgccgctgtaccaatctcctgtaaaagaattagataaattcaaatt acttaggtaagtaatgcaatatggtagactgggga gtcatgctgg'g^_aS_igtcb_:c_ggccgcg Exon 4 §i|||||§^^ ataaaagtcttcgcacagtgaaaactaaaatggatcaagcagatgatgttt^ ctattatattaaaatatttaaatgaaacattttcctacatatattt^ Exon.5/6 tcctgttgttctacaatgtacacatgtaacaccacaaagagal^gtcaggtatgattaaaaacaatgctr^ ataaaaataaaacttaacaattttcccctttttttacccccagtg ggtttatttttatgacttagtaatt^ Exon 7  _______  lllllll^^ aggtggatcctgatatgtcttggtcaagttctttagclacaccacccacccttagttctactgtgctcatag aagaaagag^gSglS^^^^ Exon 8 atgtctgacaaaaaataagtttttgcatte^ adtcctcatgatactactgctgtaagtaaatatgacattgattagactgttgaaatt|^^^^^^|^g^8>  Exon 9 -91 -  gtctgaagaaaaatgatagatttatcgcttrt^ gttgaactacaggttttmgttgttgttgttttga Exon 10a |g||||^  agggaattcatttaaagtaaatagctgcaaagaccacattggaaag tacctctgaagaagatagtttttcattatgtttttctaaatgta catgaagcaaacgctgatgaatgtgaaaaatctaaaaaccaagtgaaagaaaaatacte^ OcattagattcaMtgtagcaMtcagaa Exon 10b  llllflllli^^^ gtctttggcctgtgaatggtctcaactaaccctttcaggtctaaatggagcccagatggagaaaatacccctatt aaatatttcagaaaaagacctattagacacagagaacaaaagaaagaaagattttcttacttcagagaattctttgccacgtatttctagcctac caaaatcagagaagccattaaatgaggaaacagtggtaaataagagagatgaagaj^ Exon 10c cccccgccggcej&t*^ agcaggcaatatctggaacttctccagtggcttcttcatttcagggtatcaaaaagtctatatt^ aatgcaagtttttcaggtcatatgactgatccaaactttaaaaaagaaactgaagcctct^ gaaggaggactccttatgtccaaatttaattgataatggaagctggccagccaccaccacacagaattctgtagctttgaagaatgcaggttta at^^^^^^^^ga^acaaalcgggcggggg Exon lOd jl§|ilal^^  aaacaaataagtttatttatgctatacatgatgaaacatcttataaaggaaaaaaaataccgaaagaccaaaaatcagaactaattaactgttca gcccagtttgaagcaaatgcttttgaagcaccacttacatttgcaaatgctgattcaggt atagatgaegaftcejtetgtgpjCT Exon 11a cgcccgccgccgcccaaa&ttteg^ gaagctgttcacagaatgattctgaagaaccaactttgtcctta^ ctaataatacagtaatctctcaggatcttgattataaagaagcaaaatgtaataaggaaaaactacagttaffl^ gtcatgcctgcaggaaggacagtgtgaaaatgatccaaaaagcaaaaaagtto^  Exon 1 l b §||||f|||^^ caacattcaaaagtggaatacagtgatactgactttcaatcccagaaaagtcttttatatgatcatgaa^ cttccaaggatgttctgtcaaacctagtcatgattte^ gatgttgaattaaccaaaaatattcccatggaaaagaatcaagatgtatgtgctttaaatgaaaattataaaaacgttgagctgttgccacctga aaaaStgaiagtagc^ac'cttccgggcggggg Exon 11 c jafgaa^  ccacctgaaaaatacatgagagtagcatcaccttcaagaaaggtacaatt^ agaaactacttcaatttcaaaaat^ctgtcaatccagacte^ aggaataatcttgctttaggaaatactoaggaacttcat^ atggagacacaggtgataaacaagcaacccaagtgtcaattaaaa^^^^^^^^^^  -92-  Exon l i d fjj||§|§|||^^ gcatataaaaatgactctaggtcaagatttaaaatcggacatctccttgaatatagataaaataccagaaaaaaataatgattacatgaacaa^ gggcaggactcttaggtccaatttcaaatcacagtffi^ taagaaMagcaaaatgttcttcaaagatattgaagaacaatatcctactagttta ggccg Exon 11 e  gccc<xgccgp£^ agcttgtgttgaaattgtaaataccttggcattagataatcaaaagaaact^ tagtgtogttgtttctgattgtaaaaatagtcaMaac^^ aaaggcagaaattacagaactttctactatattagaagaatcag^  Exon 1 If f l l l i l l l l ^ ^  acttctgaggaatgcagagatgctgatcttcatgtcataatgaatgccccatcgattggtcaggtagacagcagcaagcaattt gttgaaattaaacggaagtttgctggcctgttgaaaaatgactgtaacaaaagtgcttctggttatttaacagatgaaaatgaagtggggi^ gggcttttattctgctcatggcacaaaactgaatgfflctactgaagctctgcaaaaagctgtgaaactgffl gaaacttct^gaggta^tejpMtaagfiicgggcggggg Exon l l g gaMgfl;e^ tgtaagtgaaaaaaataataaatgccaactgatattacaaaataatattgaaatg^ gagaaatactgaaaatgaagataacaaatatactgctgccagtagaaattctcataacttagaatttgatggcagtgattcaag^ ctgffigtattcataaagatgaaacggacttgctattto^ Exon 1 l h gcccccgccggetaotggejie^ tagaaattetcataacttagaatttgatggcagtgatt^ agcacaacatatgtcttaaattatctggccagtttatgaaggagggaaacactcagattaaagaagattt cgaaagctcaagaagcatgtcatggtaatacttcaaataaagaacagttaac^^  tgafacattttttcagactgcaagtgggaaaaaPMIR^^i^^ii Exon 1 l i gccccegceggfcfatg^^ acattttttcagactgcaagtgggaaaaatattagtgtcgccaaagagtcatttaataa cataacttttccttaaattctgaattacattctgacataagaaagaacaaaatggacattctaagttatgaggaaacagacatagttaaacacaaa ^^^^ai^gtgi^ccgggcgggggcggcgggccg Exon 1 lj gcccccgccgpiieatt^^^  aaagtgtcccagttggtactggaaatcaactagtgaccttccagggacaacccgaacgtgatgaaaagatcaaagaacctactctgttgggt tttcatacagctagcgggaaaaaagttaaaattgcaaaggaatc^ gaaatcaccagttttogccatcaatgggcaaagaccctaaagtacagagaggcctgtaaagacctt cacagctgccccaaagtgtaaagaaatgcagaattctctcaataatgataaaaa^^g^ffi^g^g^^g^gg Exon 1 l k  -93 -  iliiiiiis  J.—L  44.  44-  4-  4  4 4 - 4 -  4.  4-4-  cagaattctctcaataatgataaaaaccttgtttctattgagactgtggtgccacctaagctcttaag^ tcaaaacatcaaaaagtatctttttgaaagttaaagtacatgaaaatgtagaaaaagaaacagcaaaaagtcctgcaactt gtccccttattcagtcattgaaaattcagccto^ aaatggcttagagaaggaatalttgatgg^caaccaga^ Exon 111 gcggcccgccgcccccgccggtgagtcagacto aataaatactgcagattatgtaggaaattatttgtatgaaaataattcaaacagtactatagctgaaaatgacaaaaatcate^ agatacttatttaagtaacagtogcatgtrt^ attctggtattgagccagtattgaagaat^ ccacaaactgtaaatgaagatatttgcgttgaggaactt^ Exon 11m gcccccgccggtgactagc^^ cctgcatttaggatagccagtggtaaaatcgttt^ attaaggaaaacaacgagaataaatcaaaaaWgccaaacgaaaattatggcaggttgttacgaggca^ ataactctctagataatgatgaatgtagcacgcattcacataaggtttttgctgacattcagagtgaagaaatttt ciggattggagaaagmctaaaatatca^itgMg^gifigaaaccgggcggggg Exon 1 l n gcccccgccga^tatgtct'ggattggag ggaagcttcatogtcagtctcatctgcaaatacttgtgggattWagcacagcaagtggaaaa aacgcaagacaagtgttttctgaaatagaagatagtaccaagcaagtcttttccaaagtatt caagagaagaaaataclgctatacgtactcc^ agtacagcaagtggaaagcaagtttccattttagaaa^ Exon l l o agtcttcactattcacctacgtctagacaaaa^ ggaaaaaacctgcagtaaagaatttaaattatcaaataactt ctctctcaatttcaacaagacaaacaacagttggtattaggaaccaaagtctcactt^ acctaaaaacgtaaaaatggaaattggtaaaactgaaacttmctgatgttcctgtgaaaa Exon 1 l p ____ gcgtcccgccat'^ aaagaacaggcttcacctaaaaacgtaaaaatggaaattggtaaaactgaaacttfflctgatgtt acttactccaaagattcagaaaactactttgaaacagaagcagtagaaattgctaaagcr^  Exonllq gcccccgccgttgaaacagaage^agtagaaatt^ acattctctttttacatgtcccgaaaa^ agtgttcatttttacctttcgtgtt^ gggcgggggcggcg  Exon 12 -94-  4-  gcccccgccgeaaacattaggto ttgagaaataaaactgatattatttgcctta^ caggataatagaaaatcaagaaaaatccttaaaggctt^ gtatggtatataa^gl^^l^l^ Exon 13 __________ cgtcccgcccgtiacattcart^ atatgtaatataaaataattgtttcctaggcacaataaaagatcgaagattgtttatgcatcatgttt gtaagacatgtttaaatttttct^ Exon 14 gggt^saMa^aag^^  agagatacagaatccaaar^accgeacctggtcaagaatttctgtctaaatcteatttgtatgaacaM togcagtttcaggacatccattttate gttccaccttttaaaactaaatcacattttcacagagttgaac tggacatggctctgatgatagtaaaaataagattaatgacaa^ ttcacaaagtgtgaagaagaacctttaggtattgtatgacaatttgtgtgatgaatt Exon 15 atgcgaattaagaagaaacaaaggcaacgcgtctttccacagccaggcagtctgtatcttgcaaaaacatccactctg aaagcagcagtaggaggccaagttccctctgcgtgttctcataaacaggtatgtgtttgtctacaatactgatggcttttatgacagagtgtaatt ttatttcattaactagll^^^^^^^^tiu^cgggcg Exon 16 gcggcccgccgcccccgccgmggtaaatixagUttggW gtgttottttgtgtagctgMacgMggcgffi^ attttggt^ggaaagtttatggactggaaaaggaatacagttggctgatggtggatgg gaagaattttataggtactctatgcaaaaagattg^ Exon 17 cgtcccgc^catg^^ aaaaacttaatgatcttgaacaatgtagtr^ tttatttgttcagggctctgtgtgacactccaggtgtggatccaaagcttatttctagaattt ctggcagctatggaatgtgcctttcclaaggaatttg aaagcattacattacgtaatcatatacggcagtatggttaaggtttctgtgtagtctgtgacttccatgtcaaa^ Exon 18a _ _ _ _ _ _ _ _ gcccccgccggtttaaa^ cagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgca aatatatctgaaacttctagcaataaaactagtagtgcaga Exon 18b gccgcccccgccgtgagcj^^^ gatgggtggtatgctgttaaggcccagttagatcctcccctcttagctgtcttaaagaatggcagactgacagttggtc^ ggagcagaactggtgggctctcctgatgcctgtacacctcttgaagccccagaatctcttatgtt^ aatcacgggcgggggcgcg Exon 19 -95-  gcgtccegetei^ gectgctcgctggtataccaaacttggattcttt^ gtgttgatgtaattattcaaagagcataccctate^ ittgagajggagcgggcggggg Exon 20  llllilSl^^ gtgacttttttggtgtgtgtaacacatta^ gaagcagcaaaatatgtggaggcccaacaaaagagactagaagccttettcactaaaattcaggaggaatttgaagaacatgaagg ttagttatatggtacacattgttattto aattgactttattttt^ Exon 21 gcggcccgccgcccccgccgtctccettettf^ ttttgttttcttagaaaacacaacaaaaccatatttaccatcac tgaagcagtgaagaatgcagcagacccagcttaccttgaggtgagagagtaagaggacatataatgaggcttgatgattatt^ aagctgttttaaagtet^ Exon 22 caatatcttaaatggtcacagggttarttcagtgaagagc^ agatccagttggaaattaggaaggccatggaatctgctgaacaaaa tattgtaagctattcaaaaaaagaaaaagattcaggtaagtatgtaaatgctttgtttttatcagttttattaacttaaaaaatgaccttactaacaaa atgattataaatc<»gataaagtataaagttagttte  Exon 23 gcgtcccgp^ulcl^^  gcatctttctcatctttctccaaacagttatactgagtatttggcgtccatcatcagaW^ atcatcttgcaacttcaaaatctaaaagtaaatctgaaa tacaaacctttcattgtaatttttcagt^ Exon 24 ^ . ^ ^ ^ ^ ^ ^ gcgtcccgglg^gj^ ggagccccttcacttcagcaaatttttagatccagactttcagccatcttgttctga acaggtaatgcacaatatagttaattttttttattgatt^ Exon 25 gcgtcccgga&ttccUtcttg^ ttgtcagacgaatgttacaatttactggcaataaagttttggatagaccttaatg tccagtggcgaccagaatccaaatcaggccttcttacttlatttgctggagatr^ gacattcaacaaaatgaaaaatactgttgaggtaaggttacttttcagcatcaccacacat^ ^gggcgggcgggggcggcg  Exon 26 -96-  gcgtcccggtcc]^^^ ttcttagaatattgaeatactttgcaatgaagcagaaaacaagcttatgcatatactgcatgcaaatgatcccaagt gactgtacttcagggccgtacactgctcaaatcattcctggtacaggaaacaagcttctggtaagttaatgtaaactcaaggaatattataaga agtatatatggaggccatcgtaMtctgttgM^ cgggcggggg Exon 27a ^ gcggcccgccgcccccgccggtgigtaj^ ataggctacgttttcattttlltatcagatgtcttc ccacacctgtctcagcccagatgacttcaaagtcttgtaaaggggagaaagagattgatgaccaaaagaactgcaaaaagagaagagcctt ggatttcttgagtagactgccttte^ ttgtggcaccaaatacgaaacacccataaagaaaaaagaactgaattctcctcagatgactccatttaaaaaattcaatgaaatttctcttttgga  Exon 27b atecccaagctcttttgtctggttcaacaggagaaaaacaatttatatctgtcagtgaat^ ctcagactgaaacgacgttgtactacatctctgatcaaagaacaggagagttcccaggccagtacggaagaatgtgagaaaaataagcag gacacaattacaactaaaaaatatatctaagcatttgcaaaggcgacaataaattaUgacgcttaacctttccagtttataagactggaatataa mcaaaccacacattagtacttatgttgcacaatgagaa^^ gggccg  -97-  Appl.5 Primer sequences for BRCA1 and FANCF promoter hypermethylation assessment using methylation-specific PCR Esteller et al (BRCA1): Unmethylated = 86bp product UF: T T G G T T T T T G T G G T A A T G G A A A A G TGT UR: C A A A A A A T C T C A A C A A A C T C A C A C C A Methylated = 75bp product MF: TCGTGGTAACGGAAAAGCGC MR: A A A T C T C A A C G A A C T C A C G C C G  Baldwin et al (BRCA1): Unmethylated = 182bp product UF: G G T T A A T T T A G A G T T T T G A G A G A T G UR: T C A A C A A A C T C A C A C C A C A C A A T C A Methylated = 182bp product MF: GGTTAATTTAGAGTTTCGAGAGAC G MR: T C A A C G A A C T C A C G C C G C G C A A T C G  Taniguchi et al (FANCF): Unmethylated: UF: TTTTTGTGTTTGTTGG A G A A T T G G G T T T T T UR: A T A C A C C A C A A A C C A C C A A C A A A C A A A A C A Methylated M F : TTTTTGCGTTTGTTGG A G A A T C G G G T T T T C MR: A T A C A C C G C A A A C C G C C G A C G A A C A A A A C G  Appl.6 Fresh tissue xenografts: Note that the author of this manuscript did not participate in the development or maintenance of the xenografted NOD/SCID mice. The staff in the lab of Dr. Y . Z . Wang were supplied with primary tumor tissue, created the initial xenograft, and created the successive generations of serial transplants. The anthor of this manuscript was then supplied with tissue from the xenograft samples to perform comparisons with the primary tumor tissue.  -98-  APPENDIX 2: CONSENT FORM FOR COLLECTION OF TUMOR TISSUE THE  UNIVERSITY  OF B R I T I S H  COLUMBIA  Department of Obstetrics and Gynaecology  CONSENT FORM Formation of the B . C . Branch of the Canadian Ovarian Cancer Tissue Bank  Principal Investigator:  Dr. Nelly Auersperg, Department of Obstretics & Gynecology, University of British Columbia  Co-Investigator:  Dr. Blake Gilks, Department of Pathology, University of British Columbia, Tel: 604-822-7683  Emergency telephone number: Dr. Nelly Auersperg: 604-875-2424 ext. 6354 Background: In most industrialized countries, ovarian cancer is one of the most common causes of death from cancer in women. Among the main problems in the management of this disease are 1) the great variety in the properties of ovarian tumors, which makes it difficult to predict their behaviour and to chose the best treatment for any one individual woman and, the difficulty in detecting these cancers at an early, curable stage. It is therefore extremely important to improve our understanding of the properties of ovarian cancers so as to be able to individualize treatments and to discover new methods of early detection. Purpose: The purpose of the Ovarian Cancer Tissue Bank is to improve knowledge about ovarian cancer, by making available to scientists across Canada large numbers of ovarian tumor specimens and normal ovarian control tissues for studies in ovarian cancer biology, detection and treatment. To this end, pathologists, clinicians and cancer researchers in several centres across the country have formed the Canadian Ovarian Cancer Tissue Bank, which now includes a B. C. branch. You are being invited to participate in this project for one of the following reasons: (1) because you are having your ovaries removed for reasons unrelated to cancer, (2) because it has been determined that you may have ovarian disease which may be ovarian cancer, (3) because you may be at risk of developing ovarian disease and will need surgery.  -99-  Study procedures:  If you agree to contribute to this project, the following will happen:  1) Tissue that is removed from your body as part of your planned operation will be sent to the Pathology Department for examination, as is routinely done with any tissue removed in an operation. After this tissue has been evaluated by the pathologist, excess material not required by Pathology will be sent for storage to the Bank where it will be made available to investigators in B.C. and elsewhere for future research in ovarian disease. This research will define the appearance and characteristics of the tissue. In addition, genetic material (DNA) may be extracted and analysed. The tissue will be stored indefinitely until it is used. This tissue is being removed from your body as part of your treatment for gynaecological disease and would be removed even i f you were not participating in this project. No tissue will be removed solely for the purpose of contributing to the Tissue Bank. A l l samples will be kept at the B.C. Branch of the Bank at Vancouver General Hospital. 2) A blood sample of approximately 2 teaspoons may be drawn from a vein in your arm, which should take no more than 5 minutes. This blood will be stored frozen, and may be made available for investigators for specific studies. The studies may involve genetic research, or looking for specific ovarian cancer genes, and it is hoped that such correlations may lead to the development of blood tests to detect ovarian disease earlier and/or more accurately than is now possible. 3) No additional procedures will be performed that are related to the Tissue Bank. Any other procedures that are done are those that are normally done for you as a patient. 4) Medical information from your medical record will be used by the investigators. As it is important to know your future progress, your medical chart will be reviewed periodically for details concerning ovarian disease. You may be contacted in person under exceptional circumstances, i f any essential piece of information should be missing. Information will then be forwarded to the Bank, but with no identifiers (i.e. anonymous). Risks, Discomforts: 1) There are no potential discomforts or risks to you from the collection of tissues for research, as these tissues are routinely collected regardless of your participation in this project. The tissues will be taken in exactly the same manner surgically as would be done i f you were not participating in this project. . 2) Risks of venipuncture, or drawing blood, include temporary discomfort at the site of the needle stick, bruising and rarely, infection.  -100-  Subject Consent: You understand that participation in this project is entirely voluntary, that you may refuse to participate, that you may withdraw from it at any time without any consequences to your continuing medical care, and that you do not waive your legal rights by signing this consent form. Permission will not be requested from you for specific studies, as no identifying information will be available. If you should decide to withdraw consent and/or to withdraw your tissue from the Bank, you will contact your gynaecologist or the nurse participating in the clinical data collection and organization of the Bank to make the necessary arrangements. You can also make such arrangements by contacting Dr. N . Auersperg or Dr. B. Gilks who are in charge of the B.C. Bank branch. You will be informed of any new information related to this project that may affect your decision to participate.  You have received a copy of this consent form for your own records. You consent to participate in this project.  Subject Signature  Printed Name  Date  Witness Signature  Printed Name  Date  Investigator's Signature  Printed Name  Date  - 102-  Introduction  This study is being conducted by the Hereditary Cancer Program at the British Columbia Cancer Agency (BCCA) in conjunction with the B C C A gynecologic tumour group and the Genetic Pathology Evaluation Centre at the B C C A and Vancouver General Hospital. The purpose of this study is to understand how inherited and other risk factors contribute to ovarian cancer. It also may allow the investigators to define whether certain genetic abnormalities affect patient outcomes such as response to chemotherapy and survival after diagnosis and treatment. The combination of participants' family histories and laboratory studies will allow the investigators to identify the genetic factors that affect the predisposition to cancer in certain families, as well as the reasons women respond differently to chemotherapy. This invitation to participate in the study does not necessarily mean that your family has an inherited cause of ovarian cancer or that your family members are at an increased risk for cancer. You are being invited to participate only because your medical history meets our criteria for inclusion into our laboratory studies on ovarian cancer.  Background on Ovarian Cancer  Ovarian cancer is the fifth most common cause of cancer in women. In Canada, approximately 1 in 65 women will be diagnosed with ovarian cancer per year. Most of these occur in women over the age of 50 years, but ovarian cancer can affect younger women. The ovaries are a pair of organs in the female reproductive system. They are located in the pelvis (the lower part of the abdomen between the hip bones), one on each side of the uterus or womb (the hollow, pear-shaped organ where a baby grows). Each ovary is about the size and shape of an almond. The ovaries have two functions: they produce eggs and female hormones (chemicals that control the way certain cells or organs function). Every month, during the menstrual cycle, an egg is released from one ovary in a process called ovulation. The egg travels from the ovary through the fallopian tube to the uterus. The female hormones, estrogen and progesterone are mainly produced by the ovaries. These hormones influence the development of a woman's breasts, body shape, and body hair. They also regulate the menstrual cycle and pregnancy. The exact causes of ovarian cancer are still largely unknown. Most cases of ovarian cancer are sporadic in nature (that is, not inherited). Some of the risk factors in the sporadic cases include: Age: The likelihood of developing ovarian cancer increases as a woman gets older. Most ovarian cancers occur in women over the age of 50, with the highest risk in women over 60. Childbearing: Women who have never had children are more likely to develop ovarian cancer than women who have had children. In fact, the more children a woman has had, the less likely she is to develop ovarian cancer. Personal history: Women who have had breast or colon cancer may have a greater chance of developing ovarian cancer than women who have not had breast or colon cancer. - 104-  Fertility Drugs: Drugs that cause a woman to ovulate may slightly increase a woman's chance of developing ovarian cancer. Researchers are studying this possible association. Hormone replacement therapy (HRT). These are hormones (estrogen, progesterone, or both) given to women after menopause or "change of life" (the time of life when a woman's menstrual periods stop permanently) to replace the hormones no longer produced by the ovaries. It is also called menopausal hormone therapy. Some evidence suggests that women who use HRT after menopause may have a slightly increased risk of developing ovarian cancer. The strongest risk factor for ovarian cancer is a family history of ovarian cancer and/or breast cancer. First-degree relatives (mother, daughter, sister) of a woman who has had ovarian cancer are at increased risk of developing this type of cancer themselves. The likelihood is especially high if two or more first-degree relatives have had the disease. The risk is somewhat less, but still above average, if other relatives (grandmother, aunt, cousin) have had ovarian cancer. A family history of breast or colon cancer is also associated with an increased risk of developing ovarian cancer. In 10% or more of women with a family history of breast and/or ovarian cancer, there is a hereditary cause for the disease.  Background on Genetics Inherited information is contained in structures called chromosomes that are found in every cell (body's basic unit of life) of our body. We have 46 chromosomes that occur in pairs; 23 from our mother and 23 from our father. Each chromosome is made up of hundreds to thousands of genes. Hence, the genes also come in pairs. Genes are packages of inherited information and act as instructions for making proteins (specific substances in our bodies) that help it to function properly. A n alteration in this genetic information can cause a change in the instructions of the gene and interfere with normal protein function and hence proper body functions. These gene alterations are called mutations. There are certain genes that cause an increased chance to develop cancer when they have mutations. These genes are known as cancer susceptibility genes. The body is made up of many types of cells. Normally, cells grow, divide, and produce more cells when the body needs them. This orderly process helps to keep the body healthy. Sometimes, however, cells keep dividing when new cells are not needed. These extra cells form a mass of tissue, called a growth or tumour. Tumours can be benign (non-cancer) or malignant (cancer). Most cancers occur as a result of sporadic mutations that occur in the body during a person's lifetime. These mutations tend to occur as mistakes when the cells undergo division (a normal process) or in response to environmental factors. These mutations are not passed on to children. Hereditary cancer occurs when a gene mutation is passed down from parent (through the egg or the sperm) to child. Since the mutation is present right from the beginning, it is found in every cell of the body. Cancer will develop only when both genes in a pair are mutated. Hereditary cancer tends to develop at a younger age since the individual is already born with one mutation and needs only to acquire one additional sporadic mutation in the other gene for cancer to occur.  - 105 -  There are believed to be several genes involved in hereditary breast and ovarian cancer. Two of these, BRCA1 and B R C A 2 are mutated in only 70% of the families that have hereditary breast and ovarian cancer. That means that the other families have mutations in other cancer susceptibility genes. BRCA1 is located on chromosome 17. B R C A 2 is located on chromosome 13. Everybody has two copies of chromosomes 17 and 13 and therefore two copies of B R C A 1 and B R C A 2 . The B R C A proteins are believed to control the division of cells in the breasts and ovaries. The protein allows the breast and ovarian cells to divide during puberty and stops them from dividing at other times. In cancer cells, when B R C A protein is either partly or completely missing, the cells divide uncontrollably. If an individual inherits one BRCA1 or one B R C A 2 gene with a mutation, damage to the remaining normal B R C A gene may be the event that starts ovarian cancer. In females with a BRCA1 gene mutation, the chance of developing breast cancer is 50-85% over the lifetime, while the chance of developing ovarian cancer is 15-45%. In females with a B R C A 2 gene mutation, the lifetime chance of breast cancer is also 50-85% while the chance of ovarian cancer is up to 20%. Therefore, not everyone who carries the mutation develops cancer but the risk is increased considerably over the general population. When one parent carries a mutation in a cancer susceptibility gene such as B R C A , each one of his/her children has a 50% chance of inheriting that mutation. Males and females are both capable of passing the mutation on as well as inheriting the mutation. Purpose of Study  In this study, the investigators want to confirm that either inherited or acquired abnormalities in BRCA1 or B R C A 2 are the main cause of non-mucinous (meaning aggressive) ovarian cancers, This may then lead the study investigators to learn how these gene changes in BRCA1 or B R C A 2 affect certain patient outcomes such as progression free survival (the length of time during and after treatment that the cancer does not grow), disease free survival (length of time after treatment that a person experiences a complete remission that is, in which cancer is not detectable in the body) and overall survival. Studying the genetic changes that take place in hereditary ovarian cancer cases may have an impact on better understanding the genetic factors involved in all ovarian cancers. It may eventually lead to better detection methods as well as better treatment for ovarian cancer. The information obtained from this study will also be helpful to others who have strong family histories of ovarian cancer. The results of this study may benefit other individuals who are at an increased risk of ovarian cancer by helping to clarify their risks through genetic testing and in allowing them to make more informed health decisions.  Study Procedure  Participation in this study will be discussed with you by a clinical cancer geneticist or a genetic counsellor. A detailed family history will be obtained along with your personal medical history. It is important for such studies that the cancer diagnoses in the family are documented. For this reason, you and/or your relatives may each be asked to sign a release form so that each diagnosis of cancer in you and your family members may be confirmed. If this is necessary, you will be - 106-  provided with a separate "Release of Information" form to give to your relatives with cancer on a voluntary basis. If you agree to participate in the study after meeting with a genetic counsellor, a blood sample will be collected from you (30 cc or 2 tablespoons). Genetic material will also be obtained from frozen tumour tissue and tumour blocks collected at the time of your surgery for the tumour registry. This material will be used for testing the BRCA1 and B R C A 2 genes. Only the result of testing from the blood sample, which is the same testing that is offered as a clinical service to women with a strong family history of breast and ovarian cancer, will have known implications for you and your family members. You will be given the result of this testing only if you wish. Should a mutation be found in BRCA1 or B R C A 2 , you will be invited in for a discussion of the results with the clinical geneticist or genetic counsellor.  Possible Risks  Discomforts and risks of the blood draw that occur most frequently are temporary discomfort with the needle stick, bruising, and minimal bleeding. Less frequent risks of the blood draw are prolonged bleeding and/or discomfort, infection, possible fainting, or collection of blood in the tissue. These risks will be minimized by having trained health care professionals perform the blood draws. Some individuals experience emotional distress and anxiety from learning about the risk of inherited cancer relating to personal and/or family history and/or results of genetic testing. This may affect family relationships. If a specific BRCA1 or B R C A 2 alteration is identified through testing of your sample, testing of your unaffected family members may become an option. There is a small chance that future insurance coverage for individuals with no history of cancer could be affected by the results of their own genetic testing. Possible Benefits  Knowledge gained from this study might not benefit you directly. It may, however, be helpful in the care and medical management of your family members. The information obtained from this research study may also be helpful to others diagnosed with ovarian cancer in the future. Knowledge gained from this study may help the future development of earlier diagnostic tests, new forms of treatment and may help improve genetic counselling. Confidentiality  Your confidentiality will be respected. No information that discloses your identity will be released or published without your specific consent to the disclosure. Research records and medical records identifying you may be inspected in the presence of the Investigator or his designate by representatives of Health Canada and the U B C Research Ethics Board for the purpose of monitoring the research. However, no records which identify you by name or initials will be allowed to leave the Investigators' offices.  -107-  GENETIC FACTORS CONTRIBUTING T O HEREDITARY OVARIAN CONSENT  CANCER  F O R M  I agree to participate in this study after reading the attached information. This means genetic material from my blood sample and tumour block will be tested for genetic factors contributing to hereditary ovarian cancer. I understand that the results from analysis of B R C A 1 and B R C A 2 , genes known to have a contribution to hereditary cancer, will be available to me once completed and become part of my medical record at the B C Cancer Agency. I would like /would not like my physician, Dr. genetic test results of this study once it is completed.  , to be informed of the  If I am not available in the future when results become available, please give the results to , who is my: (relationship to you).  I agree  /disagree  to being contacted by phone for a medical and family history update.  Name:  Date:  Person authorized to consent for subject, if required (Legal representative): Date: _ Print name of legal representative  Signature of legal representative Witness, required:  Date: Print name of witness  Signature of witness  Name of Investigator  Signature of Investigator - 109-  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0093060/manifest

Comment

Related Items