Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression and function of semaphorin4F in the developing and adult rat nervous system Oschipok, Loren William 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-200636.pdf [ 15.39MB ]
Metadata
JSON: 831-1.0093003.json
JSON-LD: 831-1.0093003-ld.json
RDF/XML (Pretty): 831-1.0093003-rdf.xml
RDF/JSON: 831-1.0093003-rdf.json
Turtle: 831-1.0093003-turtle.txt
N-Triples: 831-1.0093003-rdf-ntriples.txt
Original Record: 831-1.0093003-source.json
Full Text
831-1.0093003-fulltext.txt
Citation
831-1.0093003.ris

Full Text

EXPRESSION AND FUNCTION OF SEMAPHORIN4F IN THE DEVELOPING AND ADULT RAT NERVOUS SYSTEM by Loren Wil l iam Oschipok B . S c , University of British Columbia, 1998 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y in The Faculty of Graduate Studies (Zoology) T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A July 2006 © Loren W. Oschipok, 2006 11 ABSTRACT Traumatic injury to the mature peripheral or central nervous system results in different regenerative outcomes. In the peripheral nervous system (PNS), neurons that suffer an axonal injury wi l l typically mount a successful regenerative response, leading to target reinnervation and functional recovery. Conversely, in the central nervous system (CNS), neurons do not mount a strong regenerative response after axonal injury, and thus fail to regenerate and functionally reinnervate their targets. This lack of C N S axonal regeneration and functional recovery is manifested in the permanent and devastating paralysis endured by individuals who suffer a spinal cord injury. Given the dissimilar regenerative outcomes between the C N S and PNS, elucidating the factors that contribute to this distinction - particularly those that promote successful regeneration in the P N S - may help us develop methods by which to promote functional regeneration of injured adult C N S neurons. Semaphorins are a family of growth-promoting (chemoattractive) and growth-inhibiting (chemorepulsive) proteins that, by virtue of their influence on axonal growth, may be important factors in regeneration after injury. In this thesis, I examined the expression of one member of this family, Semaphorin4F (Sema4F), in the adult vertebrate nervous system following axonal injury. I addressed the question: Does the expression of Sema4F in axotomized neurons coincide with the regenerative potential of the injured neuronal population? I found that neuronal populations able to mount a robust regenerative response after axonal injury also upregulate their expression of Sema4F, a process not observed in neurons lacking this response. This correlation between Sema4F expression following axotomy and the regenerative ability of the particular adult neuronal population suggests that Sema4F may play a positive role in the regenerative process. Furthermore, I also asked the question: Can Sema4F inhibit the extension of embryonic sensory neurites in culture? I determined that while neuronally-expressed Sema4F may function as a growth promoting cue in the injured adult PNS, in vitro, it functions as a membrane-bound, non-permissive cue to 's low' or 'stall ' the extension of embryonic-day-13 D R G neurites across H E K 293 cell islands. These findings suggest that Sema4F may play a multifaceted role in the developing and mature nervous system. TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iii LIST OF TABLES viii LIST OF FIGURES ix LIST OF ABBREVIATIONS xi ACKNOWLEDGEMENTS xii CHAPTER 1: GENERAL INTRODUCTION 1 1.1. A X O N A L R E G E N E R A T I O N I N T H E A D U L T N E R V O U S S Y S T E M 2 1.1.1. Introduction 2 1.1.2. The Cel l Body Response 2 1.1.3. Extrinsic Factors Influencing Neuronal Regeneration 3 1.1.4. Stimulating Axonal Growth in the Injured C N S 4 1.2. T H E S E M A P H O R I N F A M I L Y OF G U I D A N C E M O L E C U L E S 6 1.2.1. Introduction 6 1.2.2. Semaphorins 6 1.2.3. Vertebrate Semaphorins as Inhibitory Guidance Cues 10 1.2.4. Vertebrate Semaphorins as Attractive Guidance Cues 11 1.3. S E M A P H O R I N R E C E P T O R S : N E U R O P I L I N S A N D P L E X I N S 12 1.3.1. Introduction 12 1.3.2. The Neuropil ins 12 1.3.3. The Plexins 14 1.4. A D D I T I O N A L S E M A P H O R I N R E C E P T O R S 18 1.4.1. Introduction 18 1.4.2. Met 18 1.4.3. Cel l Adhesion Molecules 19 1.4.4. Off-track 20 1.4.5. Integrins 21 1.4.6. CD72 21 1.4.7. ErbB2 22 1.5. S E M A P H O R I N S I G N A L L I N G V I A P L E X I N S 24 1.5.1. Introduction 24 1.5.2. Class A Plexins 25 1.5.3. Class B Plexins 26 1.6. S E M A P H O R I N S I N T H E D E V E L O P I N G V E R T E B R A T E N E R V O U S S Y S T E M 30 1.6.1. Introduction 30 1.6.2. Class 3 Semaphorins in Vertebrate Nervous System Development 30 1.6.3. Membrane-Associated Semaphorins in Vertebrate Nervous System Development... 32 1.7. S E M A P H O R I N E X P R E S S I O N I N T H E I N J U R E D A D U L T N E R V O U S S Y S T E M 34 1.7.1. Introduction 34 1.7.2. Expression of Secreted Semaphorins Following Injury to the C N S 35 IV 1.7.3. Expression of Membrane-Associated Semaphorins following C N S injury 38 1.7.4. Expression of Semaphorins following PNS injury 40 1.7.5. Conclusion 41 1.8. S E M A P H O R I N 4 F 43 1.8.1. Background 43 1.8.2. Sema4F Signalling 44 1.8.3. Sema4F Expression Following Neuronal Injury 45 1.9. S U M M A R Y O F H Y P O T H E S E S A N D O B J E C T I V E S 47 C H A P T E R 2: M E T H O D S A N D M A T E R I A L S 49 2.1. S U R G I C A L T E C H N I Q U E S 50 2.1.1. Animal Care 50 2.1.2. Anesthetics 50 2.1.3. Facial Nerve Resection or Crush 50 2.1.4. Rubrospinal Tract Lesion 51 2.1.5. Dorsal Rhizotomy, Spinal Nerve, and Sciatic Nerve Lesions 52 2.2. T I S S U E C O L L E C T I O N A N D P R O C E S S I N G 59 2.2.1. Tissue Perfusion and Collection for In Situ Hybridization (ISH) Studies 59 2.2.2. Tissue Perfusion and Collection for Reverse Transcription Polymerase Chain Reaction (RT-PCR) and Western Blot Analysis : 60 2.2.3. Cryosectioning 61 2.3. A N A L Y S I S O F TISSUES 62 2.3.1. In situ hybridization (ISH) 62 2.3.2. Analysis of In Situ Hybridization Signal 64 2.3.3. R T - P C R 66 2.3.4. Western Blot 68 2.4. G E N E R A T I O N O F S E M A 4 F E X P R E S S I N G C E L L L I N E S 70 2.4.1. Construction of Expression Plasmid 70 2.4.2. Preparation of Cell Lines 70 2.5. T I S S U E C U L T U R E A N D C E L L I S L A N D A S S A Y 71 2.5.1. Cell Island Preparation 71 2.5.2. D R G Co-culture Preparation 71 2.5.3. Analysis of Neurite Outgrowth Across Sema4F-Expressing Cells 72 2.5.4. Immunohistochemistry 73 C H A P T E R 3: S E M A 4 F I S H I G H L Y E X P R E S S E D I N A X O T O M I Z E D A D U L T R A T F A C I A L M O T O N E U R O N S , B U T N O T I N N O N - R E G E N E R A T I N G R U B R O S P I N A L N E U R O N S 77 3.1. C H A P T E R O V E R V I E W 78 3.2. I N T R O D U C T I O N 80 3.2.1. Neuronal Expression of Semaphorins Following Injury 80 3.2.2. The Facial Motoneuron Model of PNS Injury 81 V 3 . 2 . 2 . 1 . Resect ion o f the A d u l t Rat Fac ia l N e r v e i ; 82 .3 .2 .2 .2 . C r u s h Injury : o f the A d u l t Rat Fac ia l N e r v e 82 3.2 .3 . The R e d N u c l e u s and the Rubrosp ina l N e u r o n M o d e l o f C N S Injury 83 3.3 . O V E R V I E W O F T H E E X P E R I M E N T A L Q U E S T I O N A N D H Y P O T H E S I S 85 3.4. R E S U L T S , 87 3 . 4 . 1 . F a c i a l Motoneurons Upregulate Sema4F m R N A Express ion after F a c i a l Nerve Crush 87 3 .4 .2 . F a c i a l Motoneurons Upregulate the Express ion o f S e m a 4 F after Fac ia l Nerve Resect ion 88 3.4 .3 . S e m a 4 F Immunoreact iv i ty in the Degenerat ing D i s t a l F a c i a l N e r v e and Denervated M u s c l e 89 3.4.4. C e l l s W i t h i n the N o r m a l or Degenerat ing F a c i a l N e r v e D o N o t Express Sema4F m R N A 90 3.4 .5 . Rubrosp ina l Neurons D o N o t Express Detectable L e v e l s o f Sema4F m R N A 91 3.4.6. Sema4F m R N A Express ion in the Injured A d u l t Rat Sp ina l C o r d 91 3.5. D I S C U S S I O N 107 3.5 .1 . S u m m a r y 107 3.5.2 . S e m a 4 F Express ion is Upregulated by Neurons o f the Vent ra l Sp ina l C o r d F o l l o w i n g a C e r v i c a l Sp ina l C o r d L e s i o n 108 3.5 .3 . Express ion o f S e m a 4 F in Regenerat ing Neurons 110 3.5.4. Poss ib le Funct ions o f S e m a 4 F in Regenerat ing Neurons 112 3 . 5 . 4 . 1 . A s a Postsynapt ica l ly L o c a l i z e d Prote in 112 3.5 .4 .2 . A s a Presynapt ica l l y L o c a l i z e d Protein 114 3.5 .5 . C o n c l u s i o n 115 C H A P T E R 4: E X P R E S S I O N O F S E M A 4 F IN A X O T O M I Z E D A D U L T D O R S A L R O O T G A N G L I O N N E U R O N S A N D S P I N A L M O T O N E U R O N S 116 4 . 1 . C H A P T E R O V E R V I E W 117 4.2. I N T R O D U C T I O N 118 4 . 2 . 1 . U s e o f D R G Neurons as a M o d e l o f N e u r o n a l Injury 118 4.2 .2 . Exp ress ion o f Semaphor ins in D e v e l o p i n g and A d u l t D R G Neurons 119 4 . 3 . 1 . Sp ina l Motoneurons as a M o d e l o f Neurona l Injury 120 4.3 .2 . Express ion o f Semaphor ins in D e v e l o p i n g and A d u l t Sp ina l Motoneurons 121 4.3 . O V E R V I E W O F T H E E X P E R I M E N T A L Q U E S T I O N A N D H Y P O T H E S I S 124 4.4. R E S U L T S 126 4 .4 .1 . A d u l t D R G Neurons D o N o t Express Sema4F m R N A F o l l o w i n g Dorsa l R h i z o t o m y 126 4 .4 .2 . Resect ion o f the Sp ina l Nerve Results in the U p - R e g u l a t i o n o f Sema4F mRNA Express ion in D R G Neurons 126 4.4 .3 . Per ipheral A x o t o m y Results in the D e l a y e d U p - R e g u l a t i o n o f Sema4F m R N A Express ion in A x o t o m i z e d Sp ina l Motoneurons 127 4.4.4 . A L o w L e v e l o f S e m a 4 F I S H Signal is Detected in the D i s t a l Sc iat ic Nerve , Seven Days F o l l o w i n g a Sp ina l N e r v e Resect ion Injury 128 4.5 . D I S C U S S I O N 139 v i 4 . 5 . 1 . S u m m a r y 139 4 .5 .2 . S e m a 4 F Express ion in A x o t o m i z e d Neurons Corresponds to the N e u r o n ' s Regenerat ive Potent ia l 139 4 .5 .3 . A Postsynapt ic R o l e for Sema4F in A x o t o m i z e d Sp ina l Motoneurons and D R G Neurons? 140 4 . 5 . 3 . 1 . C o u l d S e m a 4 F Express ion in A x o t o m i z e d Sp ina l Motoneurons B e Related to the L o s s o f Dendr i t i c Innervation? 141 4.5 .3 .2 C o u l d Postsynapt ica l ly L o c a l i z e d Sema4F P l a y a R o l e in Aberrant Synapse Fo rmat ion on Per iphera l l y A x o t o m i z e d D R G Neurons? : 142 4.5 .4 . Genera l Conc lus ions Regard ing the Express ion o f S e m a 4 F in A x o t o m i z e d A d u l t Vertebrate Neurons 142 C H A P T E R 5: I N H I B I T I O N O F R O C K A C T I V I T Y R E S U L T S IN A R E D U C T I O N IN E13, B U T N O T E16, D R G N E U R I T E E X T E N S I O N A C R O S S S E M A 4 F - E X P R E S S I N G C E L L I S L A N D S 144 5.1. C H A P T E R O V E R V I E W 145 5.2. I N T R O D U C T I O N 146 5 .2 .1 . M e m b r a n e - A s s o c i a t e d Semaphorins as A x o n a l Gu idance Cues 146 5.2.2. The R o l e o f the R h o A / R O C K S igna l l ing Pathway in M e d i a t i n g C lass 4 Semaphor in S i gna l l i ng 147 5.2 .3 . Semaphor in4F as an A x o n a l Gu idance C u e 148 5.3. O V E R V I E W O F T H E E X P E R I M E N T A L Q U E S T I O N A N D H Y P O T H E S I S 150 5.4. R E S U L T S 151 5 .4 .1 . Express ion o f S e m a 4 F in D e v e l o p i n g R a t D R G s and Sp ina l C o r d 151 5.4.2. R O C K Inhib i t ion S ign i f i cant ly Reduces E 1 3 D R G Neur i te Ex tens ion A c r o s s S e m a 4 F - E x p r e s s i n g H E K 293 C e l l s 152 5.4 .3 . Ne i ther S e m a 4 F N o r R O C K Inhibi t ion S ign i f i cant l y A l te rs the Extens ion o f E 1 6 D R G Neur i tes A c r o s s H E K 293 C e l l Islands 153 5.5. D I S C U S S I O N 161 5 .5 .1 . S u m m a r y 161 5.5.2. The R o l e o f the R h o A / R O C K S igna l l ing Pathway in M e d i a t i n g C lass 4 Semaphor in S igna l l i ng 161 5.5.3. C lass B P l e x i n s as S e m a 4 F Receptors? 164 5.5.4. C o n c l u s i o n 164 C H A P T E R 6: G E N E R A L D I S C U S S I O N , 165 6 .1 . T H E S I S O V E R V I E W 166 . 6.2. IS IT P O S S I B L E T O F O R M U L A T E A S I N G L E H Y P O T H E S I S O F S E M A 4 F F U N C T I O N I N T H E D E V E L O P I N G A N D A D U L T N E R V O U S S Y S T E M ? 168 6.3. C O U L D R E C E P T O R S F O R O T H E R M E M B R A N E - A S S O C I A T E D S E M A P H O R I N S A L S O M E D I A T E S E M A 4 F F U N C T I O N I N R E G E N E R A T I N G M O T O N E U R O N S ? 169 6.3 .2 . C o u l d P l e x i n s Serve as Receptors for Sema4F Expressed by Injured Neurons? 170 Vll 6.3.3. ErbB2 is Expressed by Schwann Cells within the Degenerating Distal Nerve Following Sciatic Nerve Lesion 170 6.3.4. The Tyrosine Kinase Receptor, Met, is Expressed in the Degenerating Distal Nerve Stump Following a Sciatic Nerve Lesion •. 172 6.3.5. A Role for Sema4F Signalling in the Injured PNS? 172 6.3.5.1. Sema4F Signalling Within the Degenerating Distal Nerve Stump 172 6.3.5.2. Sema4F Signalling at the Neuromuscular Junction 173 6.3.6. Summary 173 6.4. S E M A 4 F A S A N I N H I B I T O R OF S E N S O R Y N E U R I T E E X T E N S I O N 174 6.5. S E M A 4 F A S A B I F U N C T I O N A L S I G N A L L I N G M O L E C U L E ? 176 6.6. F U T U R E D I R E C T I O N S 178 6.7. C O N C L U S I O N S 183 BIBLIOGRAPHY , 185 APPENDIX A: EXPRESSION OF SEMAPHORIN3C IN ADULT MOUSE FACIAL AND RUBROSPINAL NEURONS FOLLOWING AXOTOMY 219 A . l . A P P E N D I X A I N T R O D U C T I O N A N D O V E R V I E W 220 A.2 . O V E R V I E W O F T H E E X P E R I M E N T A L Q U E S T I O N A N D H Y P O T H E S I S 221 A . 3. R E S U L T S 222 A.3 .1 . Following Resection of the Facial Nerve, Facial Motoneurons Transiently Upregulate the Expression of Sema3C m R N A 222 A . 3.2. Axotomy of the Adult Mouse Rubrospinal Tract Induces Sema3C m R N A Expression in Axotomized Rubrospinal Motoneurons 223 APPENDIX B: SUPPLEMENTARY FIGURES AND DOCUMENTATION 229 B . l . S U P P L E M E N T A R Y F I G U R E S 230 B.2. B L A S T S E A R C H : ISH O L I G O N U C L E O T I D E S E Q U E N C E S 234 B . 2.1. Sema4F Antisense Oligonucleotide Probe #1 234 B.2.2. Sema4F Antisense Oligonucleotide Probe #2 237 B.2.3. Sema3C Antisense Oligonucleotide Probe #1 240 B.2.4. Sema3C Antisense Oligonucleotide Probe #2 243 vi i i LIST OF TABLES Table 1.1. Semaphorins and their receptors 15 Table 2.1. Oligonucleotide composition 63 Table 2.2. Primer composition 67 Table 3.1. Summary of Sema4F expression in facial and rubrospinal neurons 93 Table 5.1. Effect of Sema4F and/or Y-27632 treatment on the extension of E13 and E16 D R G neurites across H E K 293 cell islands 156 Table A l . Expression of Sema3C m R N A in adult mouse facial and rubrospinal neurons 224 IX LIST OF FIGURES Figure 1.1. Semaphorins 9 Figure 1.2. Schematic detailing the intracellular signalling components downstream of P l ex in -Al (A), and P l ex in -B l (B), in growth cones 28 Figure 2.1. Schematic detailing the rat facial nerve injury models 53 Figure 2.2. Schematic of the rat midbrain, detailing the position of the red nucleus and location of the rubrospinal tract in the cervical spinal cord 55 Figure 2.3. Spinal cord cross-sectional schematic, detailing the dorsal root ganglion injury models used 57 Figure 2.4. Analysis of D R G neurite outgrowth across H E K 293 cell islands 75 Figure 3.1. Sema4F m R N A expression is transiently upregulated in facial motoneurons following a facial nerve crush 95 Figure 3.2. Sema4F expression following a facial nerve resection injury 97 Figure 3.3. Sema4F immunoreactivity in the degenerating distal facial nerve and denervated facial muscle following a facial nerve crush 99 Figure 3.4. Sema4F m R N A is not expressed in the normal or degenerating facial nerve 101 Figure 3.5. Sema4F mRNA is not detected in uninjured or axotomized rubrospinal neurons... 103 Figure 3.6. Sema4F mRNA is not detected within the spinal cord lesion site, but is expressed by neurons in the ipsilateral ventral horn 7 days after cervical axotomy 105 Figure 4.1. Expression of Sema4F m R N A in cervical D R G neurons following a dorsal rhizotomy 129 Figure 4.2. Expression of Sema4F m R N A in D R G neurons following a spinal nerve resection. 131 Figure 4.3. Scatter plots of Sema4F m R N A expression in D R G neurons following a spinal nerve resection 133 Figure 4.4. Sema4F m R N A is expressed by spinal motoneurons 14 days after spinal nerve resection 135 Figure 4.5. Sema4F is not expressed in the normal sciatic nerve, but may be upregulated in the degenerating distal nerve stump 7 days after a sciatic nerve transaction 137 X Figure 5.1 Expression of Sema4F in the developing rat spinal cord and D R G s 154 Figure 5.2. Y-27632 treatment leads to a significant decline in the extension of E13 D R G neurite across Sema4F-expressing H E K 293 cell islands 157 Figure 5.3. Y-27632 treatment does not alter the extension of E16 D R G neurites across Sema4F-expressing H E K 293 cell islands 159 Figure A . 1. Sema3C m R N A is expressed by mouse facial motoneurons and is significantly upregulated 3 days following a facial nerve resection 225 Figure A .2 . Sema3C m R N A expression is significantly upregulated in axotomized mouse rubrospinal neurons 227 Figure B . l . Testing Sema4F ISH specificity using Sema4F sense oligonucleotide probes 230 Figure B.2. Analysis of H E K 293 cell transfections and specificity of the Sema4F antibody and ISH probes 232 XI LIST OF ABBREVIATIONS Abl - abelson tyrosine kinase A M P A - a-amino-5-hydroxy-3-methyl-4-isoxazole propionic acid A N O V A - analysis of variance B D N F - brain-derived neurotrophic factor C A M - cell adhesion molecule c A M P - cyclic adenosine monophosphate Cdk5 - cyclin-dependent kinases 5 c G M P - cyclic guanosine monophosphate C G R P - calcitonin gene-mediate related peptide C M V - cytomegalovirus C N S - central nervous system C R I B - Cdc42/Racl interactive binding C R M P - collapse response mediator protein C S P G s - chondroitin sulphate proteoglycans C U B - complement binding ddH^O - double distilled water d H 2 0 - distilled water D R E Z - dorsal root entry zone D R G - dorsal root ganglion D T T - dithiothreitol E C M - extracellular matrix E G F - epidermal growth factor E13 - embryonic-day-13 E l 6 - embryonic-day-16 E n a - enabled E t B r - ethidium bromide E t O H - ethanol F B S - fetal bovine serum F M N s - facial motoneurons G A I P - G-a-interacting protein G A P - GTPase-activating protein G D N F - glial-derived growth factor G E F - guanine nucleotide-exchange factor G P I - glycosylphosphatidyl-inositol G P I C - GAIP-interacting protein, C terminus H A - hemagglutinin H E K - human embryonic kidney H G F - hepatocyte growth factor I G F - insulin-like growth factor Ig - immunoglobulin I S H - in situ hybridization L A R G - leukaemia-associated Rho-GEF L O T - lateral olfactory tract L P A - lysophosphatidic acid M A G - myelin-associated glycoprotein M A M - meprin A 5 receptor tyrosine phosphatase M I C A L - molecule interacting with casL mnd2 - motoneuron degeneration 2 M S K 1 - mitogen- and stress-activated protein kinase 1 N G F - nerve growth factor N M D A - N-methyl-D-aspartic acid N M J - neuromuscular junction npn-1 - neuropilin-1 n p n - 2 - neuropilin-2 O D - optical density O M g p - oligodendrocyte-myelin glycoprotein O R N s - olfactory receptor neurons O T K - off-track P A K - p21-activated kinase P B S - phosphate-buffered saline P C R - polymerase chain reaction P D G F - platelet-derived growth factor P D Z - a domain common to proteins involved in ptn-ptn interactions P K A - cAMP-dependent protein kinase P K C - protein kinase C P N S - peripheral nervous system P R K 2 - PKC-related protein kinase-2 P S D - 9 5 / S A P 9 0 - post-synaptic density-95/synapse-associated protein90 R A G - regeneration associated gene R G C - retinal ganglion cell R O C K - rho kinase R S N s - rubrospinal neurons R T - reverse transcription S D S - sodium dodecyl sulphate Ser/Thr - serine/threonine S S C - sodium chloride/saline citrate T i m - T cell immunoglobulin domain and mucin domain V E S P R - virus-encoded semaphorin protein receptor X l l l ACKNOWLEDGEMENTS The work presented in this thesis would not have been possible without the guidance and support of many people. Firstly, I would like to thank my supervisor, Dr. Wolfram Tetzlaff, for giving me the opportunity to pursue this work, and for mentoring me throughout my PhD experience. Over the years, you have been an invaluable source of support and guidance, always there to share in my success, while also directing me back along the right path whenever I lost my way. Your constant encouragement, sound advice, and eternal patience have made this all possible. I also wish to thank all the students and staff of I C O R D which I have had the great pleasure to work with over the years. Thank you all for providing such a stimulating and fun environment in which to learn and grow. In particular, I would like to thank Dr. Brian Kwon. Y o u are a great colleague and friend, and I w i l l always be grateful for the constant support and encouragement you provided over the years. I would also like to thank Carmen Chan, Anthony Choo, Kar l Fernandes, Clarrie Lam, Jie L i u , Lowel l McPhai l , Ward Plunet, Joe Sparling, Egidio Spinelli, and Joshua Teh for their support and friendship along the way. I feel privileged that you were all there to share in both my triumphs and failures. I would also like to thank Dr. Matt Ramer, Dr. John Steeves, and Dr. T im O'Connor, for their helpful comments through the years. Finally, to the staff at I C O R D , Cheryl Niamath, Jeremy Green, Emily Williamson and Chris McBride -thank you for always knowing the who, what, when, where, and why of any problem, and generally doing those mill ion little things that keep I C O R D running. I also wish to thank my entire family for all their love, support, and encouragement throughout my entire academic career. Although they long ago stopped asking when I would be finished, they always believed I would. Lastly, and most importantly, this thesis would be incomplete without the mention of the support given me by Martha Bal ick i , to whom this thesis is dedicated. Whenever I began to feel it was all hopeless, you were always there, my shining light in a sea of despair. Without your love and support, I doubt this thesis would ever have been completed. Chapter 1 General Introduction 2 1.1. A X O N A L R E G E N E R A T I O N IN T H E A D U L T N E R V O U S S Y S T E M 1.1.1 . Introduction T rauma to the adult spinal cord disrupts both ascending and descending central nervous system ( C N S ) axons, and can result in an immediate and irreversible loss o f motor , sensory, and autonomic funct ion b e l o w the level o f the injury. A l t h o u g h axotomized C N S neurons display a l imi ted regenerative response, axonal regeneration is t yp ica l l y unsuccessfu l . Th is results in the fai lure o f target reconnect ion and therefore funct ional recovery does not occur (Gr impe and S i lver , 2 0 0 2 ; R a m e r et a l . , 2 0 0 5 ; Fawcett , 2006) . In contrast, f o l l o w i n g axotomy, neurons o f the peripheral nervous system ( P N S ) are often able to successful ly extend regenerating axons across the injury site to the reg ion o f their or ig inal targets, thus leading to the restoration o f motor and sensory funct ions ( M a k w a n a and R a i v i c h , 2005) . G i v e n the different regenerative outcomes in these two models , it is important to identify the factors that under l ie the contrasting regenerative abi l i t ies o f P N S and C N S neurons, so elements unique to regenerating P N S neurons cou ld potential ly be u t i l i zed to promote the funct ional regeneration o f in jured adult C N S neurons. 1.1.2. The Cell Body Response In the adult vertebrate nervous system, one o f the key factors w h i c h determine i f a successful regenerative response occurs f o l l o w i n g axonal injury is the intr insic regenerative abi l i ty o f the neuron. Th is is e x e m p l i f i e d by the neurons o f the dorsal root gangl ion ( D R G ) , w h i c h possess a b i furcat ing axon that extends one axonal branch towards per ipheral targets, wh i le the other extends central ly a long the dorsal root and into the spinal cord dorsal horn. A x o t o m y o f per iphera l ly -pro ject ing D R G projections results in a strong regenerative response and reinnervation o f per ipheral targets (Horch , 1979; C h o n g et a l . , 1996; Donnerer , 2003) . In contrast, axotomy o f centra l ly -pro ject ing processes results in a poor regenerative response, w i th axons often f a i l i n g to traverse the dorsal root entry zone ( D R E Z ) and penetrate the C N S environment o f the dorsal horn (Richardson and Issa, 1984; R i c h a r d s o n and R i o p e l l e , 1986; Donnerer , 2003) . Further, w h i l e central ly -project ing D R G axons n o r m a l l y demonstrate a poor regenerative response to in jury , this response can be considerably enhanced i f the injury to the 3 centra l ly -pro ject ing branch is preceded by an injury to the per ipheral ly project ing branch (Chong et a l , 1996; Donnerer , 2003) . Studies have revealed that axotomy o f the per ipheral ly -project ing D R G branch can induce a series o f sustained molecu lar and b i o c h e m i c a l changes w i th in the injured D R G ce l l bodies (i.e. a ce l l body response) that are largely absent f o l l o w i n g a central process injury ( W o n g and Ob l inger , 1990; Schreyer and Skene, 1991, 1993; C h o n g et a l . , 1994; C h o n g et a l . , 1996). Th is ce l l body response f o l l o w i n g injury is not l imi ted to D R G neurons. T y p i c a l l y , injury to adult per iphera l ly -pro ject ing neurons induces a strong ce l l body response, characterized by the up-regulat ion and sustained expression o f a variety o f regeneration associated genes ( R A G s ) associated w i t h axonal growth both dur ing development and f o l l o w i n g axonal injury (Fernandes and Tetz laff , 2 0 0 0 ; P lunet et a l . , 2002) . R A G s inc lude genes f rom a number o f different fami l ies , i n c l u d i n g transcr ipt ion factors, receptors for axonal guidance molecu les , cytoskeletal proteins ( inc lud ing T a l - t u b u l i n ) , cytoskeletal regulatory proteins (such as G A P - 4 3 ) , ce l l adhesion molecu les , t rophic factors and cytokines, neuropeptides and neurotransmitter-synthesiz ing enzymes , ion channels, and membrane transporters (Tetz laf f et a l . , 1991; Schreyer and Skene, 1993; Te t z la f f et a l . , 1994; B roude et a l . , 1997; Cha isuksunt et a l . , 2000 ; Fernandes and Tetzlaff , 2 0 0 0 ; P lunet et a l . , 2002) . In general , the intensity o f R A G expression f o l l o w i n g neuronal in jury varies w i t h the severity o f the injury, as w e l l as the age and type o f neuron invo lved , but t yp ica l l y correlates w i th the regenerative potential o f the neuronal populat ion invo lved . Thus , in adult P N S neurons, axotomy induces a strong ce l l body response and the successful regeneration o f injured axons to peripheral targets, w h i l e in axotomized C N S neurons, R A G s expression is weaker and often transient, and manifests i tsel f in a lower regenerative potential (Tetz laf f et a l . , 1991; Fernandes and Tetzlaff , 2 0 0 0 ; P lunet et a l . , 2002) . 1.1.3. Extr ins ic Factors Influencing Neuronal Regeneration In addit ion to differences in the inherent regenerative capacity o f injured P N S and C N S neurons, the extracel lular env i ronment also contributes to the success or fa i lure o f neuronal regeneration. F o l l o w i n g P N S nerve in jury , an acute in f lammatory and reactive g l ios is response occurs w i th in the injury site and distal nerve stump. Th is is characterized by an in f lux o f macrophages that, in 4 turn, remove ce l lu lar debris associated w i th the degenerating distal nerve stump and stimulate Schwann ce l l pro l i ferat ion (Beuche and Fr iede, 1984; Perry et a l . , 1987; Terenghi , 1999). Schwann ce l l pro l i ferat ion occurs w i th in tube- l ike structures in the basal lamina , and contributes to the format ion o f structures k n o w n as bands o f von Bungner that funct ion as conduits to guide regenerating axons to their presumptive targets (Bunge et a l . , 1980; Salzer and Bunge , 1980; Son and T h o m p s o n , 1995). In addi t ion , Schwann cel ls also produce a variety o f neurotrophic factors that support neuronal surv iva l and stimulate axonal regeneration, inc lud ing bra in -der ived neurotrophic factor ( B D N F ) , g l ia l -der i ved growth factor ( G D N F ) , i n s u l i n - l i k e growth factor ( IGF) and nerve growth factor ( N G F ) (Heumann et a l . , 1987; A c h e s o n et a l . , 1991; Sendtner et a l . , 1992; F u n a k o s h i et a l . , 1993; N a v e i l h a n et a l , 1997; Terenghi , 1999). Injury to the adult C N S also induces a rapid cel lu lar response, character ized by the migrat ion and prol i ferat ion o f a var iety o f cel ls w i th in the lesion site, i n c l u d i n g macrophages, f ibroblasts, m i c r o g l i a , astrocytes, and o l igodendrocyte precursors (Fawcett and A s h e r , 1999; Pasterkamp et a l . , 2 0 0 1 ; G r i m p e and S i l ver , 2 0 0 2 ; K w o n et a l . , 2 0 0 2 a ; D a v i d and L a c r o i x , 2003) . These cel ls , in turn, clear m y e l i n and other cel lu lar debris f rom the pr imary les ion site, and act to re-establ ish the g l ia l imitans that n o r m a l l y surrounds the C N S (Fawcett and A s h e r , 1999; Fawcett , 2006) . Unfortunately , this process also results in the format ion o f a dense g l iot ic scar, bereft o f neurotrophic support and conta in ing an assortment o f molecu les k n o w n to inhibit axonal outgrowth, i n c l u d i n g chondro i t in sulphate proteoglycans ( C S P G s ) , tenascins, myel in -assoc iated g lycoprote in ( M A G ) , N o g o - A , o l igodendrocy te -mye l in g lycoprote in ( O M g p ) , and semaphorins ( M c K e r r a c h e r et a l . , 1994; Fawcett and Asher , 1999; C h e n et a l . , 2 0 0 0 b ; Pasterkamp and Verhaagen, 2 0 0 1 ; G r i m p e and S i lver , 2 0 0 2 ; Sandv ig et a l . , 2004) . Thus , un l ike the injured P N S , the cel lu lar invas ion that occurs f o l l o w i n g a C N S injury does not result in the establishment o f an environment conduc ive to axonal regeneration. Instead the dense g l ia l scar that forms functions as both a mechanica l and molecu lar barrier to regenerating axons. 1.1.4. Stimulating A x o n a l Growth in the Injured C N S A l t h o u g h the intr insic regenerative potential o f injured C N S neurons is re lat ively weak compared to that o f in jured P N S neurons, axotomized C N S neurons can extend axons over long distances i f 5 presented w i t h a g rowth -permiss ive environment such as a per ipheral nerve graft (Richardson et a l . , 1980; D a v i d and A g u a y o , 1981; B e n f e y and A g u a y o , 1982; D a v i d and A g u a y o , 1985; B r a y et a l . , 1987). Th is growth into peripheral nerve grafts can be further enhanced upon appl icat ion o f neurotrophic support to the injured neuronal ce l l bodies, w h i c h stimulates R A G expression (Kobayash i et a l . , 1997b; K w o n et a l . , 2002b) . Furthermore, f o l l o w i n g a C N S injury, the pharmaco log ica l r e m o v a l o f inhib i tory cues ( inc lud ing N o g o - A and C S P G s ) f rom the injured C N S envi ronment can also promote the growth o f axons through the C N S lesion site, in some cases result ing in a modest recovery o f funct ion (Schnel l and S c h w a b , 1990; M o o n et a l . , 2 0 0 1 ; Bradbury et a l , 2002) . These studies reveal that although the regenerative potential o f adult C N S neurons is often poor f o l l o w i n g injury, axonal regeneration in the C N S can be enhanced i f the cel lu lar envi ronment is made more permiss ive to axonal g rowth or i f the neuron's intr insic regenerative response is enhanced v i a appl icat ion o f t rophic factors. 6 1.2. T H E S E M A P H O R I N F A M I L Y O F G U I D A N C E M O L E C U L E S 1.2.1. I n t r o d u c t i o n Adding to the large number of molecules already known to contribute to the inhibitory nature of the injured adult mammalian C N S , a growing body of evidence suggests that a number of developmentally regulated axonal guidance molecules such as ephrins, slits, netrins, and semaphorins, likely also contribute to the inhibitory nature of the adult vertebrate C N S (Koeberle and Bahr, 2004). Highly expressed in the developing nervous system where they often function as chemorepulsive guidance cues, many axonal guidance cues continue to be expressed in the adult nervous system (Miranda et al., 1999; Madison et al., 2000; Pasterkamp and Verhaagen, 2001; Bundesen et al., 2003; de Wit and Verhaagen, 2003; Hagino et al., 2003). Given their known chemorepulsive effects, as well as the fact that many axonal guidance molecules and their associated receptors continue to be expressed or are even upregulated following a C N S injury, it is possible that they may significantly contribute to the failure of axonal regeneration in the injured C N S (Luo et al., 1993; Pasterkamp et al., 1998b; Pasterkamp et al., 1999b; Madison et al., 2000; Rodger et al., 2001; Astic et a l , 2002; Hagino et a l , 2003). 1.2.2. S e m a p h o r i n s Semaphorins are a large family of secreted and membrane-associated axonal guidance cues known to play a key role in nervous system development. The seminal member of this protein family, Fasciclin I V (now known as Semaphorin la), is a transmembrane protein first identified as an axonal guidance cue in the developing grasshopper nervous system (Kolodkin et a l , 1992). Soon after, Luo et al., (1993) purified a second, secreted semaphorin from the embryonic chick brain and designated it collapsin-1 (now known as Semaphorin3A). A prototypical member of the semaphorin family, Semaphorin3A (Sema3A) was shown to function as a strong chemorepulsive guidance cue, able to rapidly induce actin depolymerization and growth cone collapse of embryonic chick sensory neurons in vitro, which implicated it as a possible chemorepulsive guidance cue in the developing nervous system (Luo et al., 1993). 7 T o date, more than 30 semaphorins have been ident i f ied and c lass i f ied into eight subclasses based on both d o m a i n structure and species o f o r ig in : C lasses 1 and 2 consist o f semaphorins found in invertebrates; C lasses 3 , 4, 6, 7 consist o f semaphorins ident i f ied in vertebrates; C lass 5 consists o f semaphorins ident i f ied in both, invertebrate and vertebrate species; and Class 8 consists o f semaphorins ident i f ied in D N A viruses (Bahr i et a l . , 2 0 0 1 ; H e et a l , 2 0 0 2 ; Fu j i sawa, 2 0 0 4 ; K r u g e r et a l . , 2005) . (F igure 1.1) W h i l e structural ly and phy logenet ica l ly diverse, a l l semaphorins share a d ist inct ive , amino - te rmina l l y - located protein domain o f approximately 500 amino acids, k n o w n as the ' S e m a ' domain ( K o l o d k i n et a l . , 1993; Gherard i et a l . , 2004). B o t h secreted and membrane-assoc iated semaphorins exist as d i s u l f i d e - l i n k e d homodimers , and d imer izat ion o f this S e m a domain has been shown to be essential for proper semaphorin s ignal l ing (Eckhardt et a l , 1997; Fe iner et a l . , 1997; K o p p e l et a l . , 1997; K los te rmann et a l . , 1998; K o p p e i and Raper , 1998; Takahashi et a l . , 1998; Isbister et a l . , 1999). In contrast to the amino - te rmina l d o m a i n , the carboxy l - te rmina l regions o f semaphorins are h igh ly var iable. Classes 1, 4, 5 , and 6 are membrane-spanning proteins; C lasses 2 , 3 and 8 are secreted proteins; and C lass 7 semaphorins b i n d to the ce l l membrane v i a a g lycosy lphosphat idy l - inos i to l (GPI ) -ahchor m o t i f (Semaphor in Nomenc la ture Commit tee , 1999). In addit ion to the S e m a d o m a i n , several classes o f semaphorins contain addit ional protein domains thought to modulate their activ ity . Secreted C lass 3 semaphorins possess a cluster o f basic amino acids w i t h i n the carboxy l - te rmina l region that m a y faci l i tate association w i th the extracel lular matr ix ( K o p p e l et a l . , 1997; D e W i t et a l . , 2005) and promote b ind ing to receptor complexes ( A d a m s et a l . , 1997; Feiner et a l . , 1997; K o p p e l and Raper , 1998). C lass 2, 3 , and 4 semaphorins a l l contain a s ingle i m m u n o g l o b u l i n (Ig) C 2 - l i k e domain w h i c h is thought to assist in both homodimer i za t ion and receptor b ind ing (Feiner et a l . , 1997; H e and Tess ier -Lav igne , 1997; G i g e r et a l . , 1998c; K l o s t e r m a n n et a l . , 1998; K o p p e l and Raper , 1998; Isbister et a l . , 1999). C lass 5 semaphorins contain seven consecutive type-1 thrombospondin repeats, w h i c h may contribute to the chemoattractive act iv i ty o f at least one C lass 5 semaphorin (Kantor et a l . , 2004) . F i n a l l y , several members o f the C lass 4 semaphor in subfami l y contain a C - terminal P S D -95/Discs large/ZO-1 ( P D Z ) - b i n d i n g m o t i f w i th in their intracel lular domain , w h i c h facil itates interactions w i t h other P D Z domain -conta in ing proteins and m a y promote the local izat ion o f 8 Class 4 semaphorins to post-synaptic membranes (Wang et al., 1999; Schultze et al., 2001; Burkhardt et a l , 2005). In both the developing vertebrate and invertebrate nervous system, semaphorins are expressed by both neuronal and non-neuronal cells in distinct, yet partially overlapping patterns (Bonner and O'Connor, 2000; Fujisawa, 2004). Highly expressed during periods of axonal growth, semaphorins act as guidance cues to steer developing axons to their target tissues, fostering the formation of appropriate neural connections (Luo et al., 1995; Puschel et al., 1995; Wright et al., 1995; Adams et al., 1996; Puschel et al., 1996; Bagnard et al., 1998; Giger et al., 1998a; Skaliora et al., 1998; Chilton and Guthrie, 2003; Pascual et al., 2005). Within the adult nervous system, the expression of semaphorins becomes largely restricted to regions undergoing synaptic reorganization and neurogenesis (Eckhardt et al., 1997; Giger et al., 1998b; Skaliora et al., 1998; Williams-Hogarth et al., 2000; Holtmaat et al., 2002), in populations of cranial and spinal motoneurons (Giger et al., 1998b; Pasterkamp et al., 1998a), and at sites of C N S trauma (Pasterkamp and Verhaagen, 2001; De Winter et al., 2002b; de Wit and Verhaagen, 2003). While the role of many semaphorins in the adult nervous system is still unknown, the continued expression into adulthood may serve to stabilize existing synaptic connections, and prevent the formation of aberrant neuronal circuits (Giger et al., 1998a; Tang et al., 2004). Finally, in addition to their role in neurite repulsion and attraction, semaphorins have also been implicated in a variety of other functions, including regulation of the immune system (Kumanogoh and Kikutani, 2004), angiogenesis (Basile et al., 2004; Conrotto et al., 2005; Klagsbrun and Eichmann, 2005), tumorgenesis (Chedotal et al., 2005; Kusy et al., 2005; Neufeld et al., 2005), and organogenesis (Hinck, 2004; Toyofuku et al., 2004b; Toyofuku et al., 2004a). Figure 1 .1. Semaphorins. Invertebrate Vertebrate Viral Classes: Semaphorins: 1a 1b 2a 3A 3B 3C 3D 3E 3F 3G 4A 4B 4C 4D 4E 4F 4G 5A 5B 6A 6B 6C 6D 7A VA VB , — , Signal sequence c=s Basic domain _ Intracellular domain • Sema domain ^ Thrombospondin domain 3 Ig domain / \ GPI linkage 10 1.2.3. Vertebrate Semaphorins as Inhibitory Guidance Cues A number of in vitro studies have demonstrated that secreted semaphorins can act as chemorepellent guidance cues for a variety of embryonic vertebrate neurons (Nakamura et al., 2000; Raper, 2000; L i u and Strittmatter, 2001). Sema3A can induce repulsion or growth cone collapse in a variety of embryonic PNS and C N S neurons, including D R G neurons (Messersmith et al., 1995; Puschel et al., 1995; He and Tessier-Lavigne, 1997; Kolodkin et al., 1997), sympathetic neurons (Puschel et al., 1995) olfactory bulb neurons (Kobayashi et al., 1997a), various cranial motoneurons populations (Kobayashi et al., 1997a; Varela-Echavarria et al., 1997), hippocampal neurons, (Chedotal et al., 1998; Pozas et al., 2001), and spinal motoneurons (Varela-Echavarria et al., 1997). In addition, while Sema3A is the most widely studied member of the class 3 semaphorin subfamily, most, i f not all, class 3 semaphorins can function as inhibitory guidance molecules (Giger et al., 1998c; Koppel and Raper, 1998; He et al., 2002). Interestingly, even though Sema3B and Sema3C cannot induce growth cone collapse of embryonic D R G neurons in culture, they can function to inhibit Sema3A-mediated growth cone collapse in D R G neurons by competing with Sema3A for binding to its receptor, neuropilin-1 (Takahashi et al., 1998). This suggests that, in vivo, the ability of a specific class 3 semaphorin to alter growth cone dynamics may depend, in part, on the combination of semaphorins present. Although less is known about the ability of membrane-associated semaphorins to act as growth cone collapsing factors, a number of in vitro studies have revealed that several can act as guidance cues in the developing and postnatal nervous system. Sema5A has been shown to function as a repulsive guidance cue for embryonic retinal ganglion cell (RGC) axons (Encinas et al., 1999; Oster and Sretavan, 2003). Sema6A can collapse embryonic sympathetic growth cones (Xu et al., 2000), while both Sema6C and 6D can collapse embryonic D R G growth cones (Qu et al., 2002). Finally, Sema4D can act as an inhibitory guidance cue for postnatal primary sensory and cerebellar granule cell neurons in culture (Moreau-Fauvarque et al., 2003). 11 1.2.4. V e r t e b r a t e S e m a p h o r i n s as A t t r a c t i v e G u i d a n c e C u e s In addition to their roles as inhibitory guidance cues, a number of vertebrate semaphorins also function as chemoattractive guidance cues. Sema3A, a Class 3 semaphorin, has been identified as a bifunctional guidance cue, potentiating opposite guidance effects on embryonic cortical axon and dendrites. Although growing cortical axons are repelled by Sema3A, apical dendrites, which possess increased levels of cyclic guanosine monophosphate (cGMP) , are attracted to a Sema3A expressing source (Polleux et al., 2000). Altering intracellular levels of cyclic nucleotides may be a common mechanism with which neurons modulate their response to Sema3A, since pharmacologically elevating intracellular c G M P levels in Xenopus spinal neurons can convert Sema3A-mediated growth cone repulsion to attraction (Song et al., 1998). In addition to Sema3A, in vitro studies have revealed that several other Class 3 semaphorins can also act as both chemorepulsive and chemoattractive guidance cues, which suggests that this may be a common feature of the semaphorin subfamily (Bagnard et al., 1998; Moreno-Flores et al., 2003). Like Class 3 semaphorins, several membrane-associated semaphorins have been shown to act as chemoattractive guidance cues. Sema7A can enhance axonal extension in vitro from a variety of neurons, including those from the olfactory epithelium, olfactory bulb, cortex and D R G explants (Pasterkamp et al., 2003). Sema4D, which inhibits neurite outgrowth of postnatal sensory and cerebellar granule cell neurons, can enhance axonal outgrowth of embryonic cortical explants and embryonic NGF-responsive D R G neurons (Masuda et al., 2004; Worzfeld et al., 2004). Interestingly, while Sema5A can act as an attractive guidance cue for axons in the developing limbic system, the co-expression of CSPGs with Sema5A can convert this attractive response to an inhibitory one (Kantor et al., 2004). In summary, the ability of secreted and transmembrane semaphorins to promote neurite outgrowth suggests that many, i f not all, semaphorins may act as bifunctional guidance cues. The evidence suggests that in order to fully understand the effect of a semaphorin on a specific neuronal population, it is necessary to examine a number of factors, including the extracellular environment, the receptors expressed, and the intracellular state of the neuron. 12 1.3. S E M A P H O R I N R E C E P T O R S : N E U R O P I L I N S A N D P L E X I N S 1.3.1. Introduction W i t h i n the deve lop ing nervous system, both migrat ing neurons and g r o w i n g axons make pathf inding and target decis ions based on informat ion received f r o m numerous guidance cues expressed w i t h i n the deve lop ing nervous system. A n ind iv idua l neuron 's abi l i ty to respond to a part icular guidance cue depends on a number o f factors, i nc lud ing the repertoire o f receptors expressed, the intracel lu lar state o f the neuron, and the interaction o f different guidance factors in the extracel lular env i ronment ( G a l l o and Letourneau, 2004) . Studies o f semaphor in s ignal l ing in neurons have ident i f ied a number o f semaphor in receptors, the foremost among them the neuropi l ins and p lex in gene fami l ies . Despite the considerable amount o f study that has been devoted to ident i f y ing spec i f ic semaphorin/receptor interactions, the large number o f possible l igand-receptor interactions and the lack o f knowledge o f intracel lu lar s ignal transduction events has so far l imi ted the understanding o f semaphor in s igna l l ing in the nervous system. In the proceeding sect ion, I w i l l introduce two protein fami l ies , the neuropi l ins and p lex ins , k n o w n to play a major role in semaphor in s ignal l ing , w i t h the caveat that the study o f semaphorin receptors is a field st i l l very m u c h in evolut ion. 1.3.2. The Neuropilins N e u r o p i l i n - 1 (npn-1) is a type I transmembrane protein o r ig ina l l y ident i f ied in the embryonic Xenopus laevis nervous system dur ing a screen for molecu les i n v o l v e d in the formation o f the Xenopus laevis retinotectal system (Takagi et a l . , 1991). Subsequent ly , npn -1 was shown to act as a vertebrate-specif ic , h igh -a f f in i t y receptor for the C lass 3 semaphorins S e m a 3 A - 3 E (Chen et a l . , 1997; Fe iner et a l . , 1997; H e and Tess ie r -Lav igne , 1997; K o l o d k i n et a l . , 1997; Takahashi et a l . , 1998). (Table 1.1) A d d i t i o n a l screens resulted in the ident i f icat ion o f a second member o f the neuropi l in f a m i l y , neurop i l in -2 (npn-2) , w h i c h shares a 4 4 % amino ac id identity wi th npn-1 and binds the C lass 3 semaphorins S e m a 3 B , 3 C , 3 F , and 3 G (Chen et a l , 1997; K o l o d k i n et a l . , 1997; Takahashi et a l . , 1998; Tan iguch i et a l . , 2005) . (Table 1.1) The extracel lular regions o f neuropi l ins possess several protein moti fs k n o w n to mediate protein/protein interactions, 13 including two motifs similar to those found in complement components C l r and C i s , two coagulation factor domains similar to those found in coagulation factors V and VIII, and a single meprin A5 receptor tyrosine phospatase ( M A M ) domain similar to those found in meprin metalloendopeptidases, a family of transmembrane proteases (Fujisawa, 2004). Deletion studies have revealed that these domains play a critical role in mediating semaphorin signalling, as both the complement and coagulation factor domains determine semaphorin specificity, while the M A M domain facilitates the formation of both npn-1 and npn-2 homo- and heterodimers essential for semaphorin signal transduction (He and Tessier-Lavigne, 1997; Nakamura et al., 1998). Neuropilin homo- and heterodimers exhibit different binding affinities for Class 3 semaphorins, and, as such, the expression of one or both neuropilins is thought to underlie a neuron's sensitivity to specific Class 3 semaphorins (Chen et al., 1997; Feiner et al., 1997; Kolodkin et al., 1997; Takahashi et al., 1998; Giger et al., 2000). (Table 1.1) This specificity of semaphorin/neuropilin interaction is observed in in vitro studies of semaphorin-mediated growth cone collapse: Sema3A can induce growth cone collapse in npn-1 expressing embryonic rat D R G neurons; however, these neurons are resistant to Sema3C- or Sema3F-mediated growth cone collapse, since both of these semaphorins require the presence of npn-2 homodimers or npn-1/2 heterodimers to induce collapse (Chen et al., 1998). In contrast to embryonic rat D R G neurons, Sema3A, Sema3C, and Sema3F all induce growth cone collapse in embryonic rat sympathetic neurons, which express both npn-1 and npn-2 (Chen et al., 1998). Perhaps more interesting, even though Sema3B and Sema3C cannot induce growth cone collapse in npn-1-expressing neurons, both semaphorins have been shown to bind npn-1, and, in doing so, antagonize the binding of Sema3A and limit growth cone collapse (Takahashi et al., 1998). This suggests that, in addition to the neuropilins expressed, the presence of multiple semaphorins in the extracellular environment may also modulate a neuron's response to specific Class 3 semaphorins (Takahashi et al., 1998). In the developing vertebrate nervous system, both npn-1 and npn-2 are highly expressed in a number of neuronal populations in a largely non-overlapping pattern, particularly during phases of active axonal outgrowth and neuronal circuit formation (Kawakami et al., 1996; Chen et al., 14 1997; Giger et al., 1998c; Chen et al., 2000a; Moreno-Flores et al., 2003; Fujisawa, 2004). Although expression is largely down-regulated postnatally, both npn-1 and npn-2 continue to be expressed in the postnatal and adult nervous system in regions of high plasticity (such as the hippocampus and the olfactory system), within the peripheral sympathetic and sensory ganglia (although D R G neurons only express npn-1), and within various cranial nuclei (Kawakami et al., 1996; Reza et al., 1999; Pozas et al., 2001; Cloutier et al., 2002). This continued expression suggests that at least some neuronal populations in the mature vertebrate nervous system remain sensitive to Class 3 semaphorins. Although studies of semaphorin/neuropilin interactions suggest that neuropilins are essential for Class 3 semaphorin signalling, the neuropilin intracellular domain consists of a short, 40 amino acid cytoplasmic region lacking known signalling motifs. Experiments in which the transmembrane and intracellular domains of npn-1 were substituted with a GPI-anchorage motif have revealed that the extracellular domain of npn-1 is sufficient to mediate Sema3A-induced growth cone collapse (Nakamura et al., 1998; Renzi et al., 1999; Takahashi et al., 1999). These results suggested that additional membrane-spanning protein(s) are required to transduce Class 3 semaphorin signalling. In addition, although a number of semaphorins have been identified in the developing invertebrate nervous system, neuropilins are not expressed in the developing or adult invertebrate nervous system (Fujisawa and Kitsukawa, 1998). Most importantly, neuropilins do not interact with membrane-associated semaphorins, even though this group comprises two thirds of the total number of known semaphorins (Fujisawa, 2004; Potiron and Roche, 2005). This strongly implies that additional semaphorin receptors must exist to mediate semaphorin signalling. 1.3.3. T h e P l e x i n s Plexins are a family of single pass transmembrane proteins, identifiable by the presence of an extracellular protein domain showing -17% homology to the 'sema' protein motif common to all semaphorins (Winberg et al., 1998b; Artigiani et al., 1999). Originally identified as a novel neuronal cell surface molecule localized in the plexiform layers of the developing Xenopus optic tectum, unlike neuropilins, plexins are now known to be highly expressed in the developing 15 Table 1.1. Semaphorins and their receptors. Semaphorins Receptors Neuropilin Plexin Other Sema-la, lb Plexin-A 1 Offtrack2 Sema2a Sema3A neuropilin-13'5 plexin-Al , 5 , A 2 1 5 ' 1 6 , A3 /A4 1 4 , D I 1 7 L I 1 8 Sema3B neuropilin-1/212 N r C A M 2 8 Sema3C neuropilin-13, -2 6 ' 1 2 plexin-Al 1 5 , A 2 1 5 ' 1 6 , B 1 1 6 , D 1 1 7 Sema3D neuropilin-13 Sema3E neuropilin-13 plexin-Dl 1 3 Sema3F neuropilin-26'7' p lexin-Al 1 5 , A 2 1 9 , A 3 1 4 , A 4 1 4 N r C A M 2 8 Sema3G neuropilin-29'1 0 Sema4A Tim2 2 0 Sema4B Sema4C Sema4D plexin-Bl 2 1 CD72 4 , Met 2 2, ErbB-2 1 1 Sema4E Sema4F Sema4G Sema5A plexin-B3 2 3 Met 2 3 , CSPG/HSPG 8 Sema5B Sema5C Sema6A plexin-A4 2 4 Sema6B plexin-A4 2 4 Sema6C Sema6D plexin-Al 2 5 Offtrack25 Sema7A plexin-Cl 2 1 (31-Integrin26 S E M A V A / V B plexin-Cl 2 7 References: 1. W i n b e r g et a l . , (1998) ; 2. W i n b e r g et a l . , (2001) ; 3 . Feiner et a l . , (1997); 4. K u m a n o g o h et a l . , (2000) ; 5. H e and Tess ie r -Lav igne (1997) ; 6. C h e n et a l . , (1997); 7. G iger et a l . , (1998) ; 8. K a n t o r et a l . , (2004) ; 9. Tan iguch i et a l . , (2005) ; 10. Y u and M o e n s , (2005); 11. Sw ie rcz et a l . , (2004) ; 12. Takahashi et a l . , (1998); 13. G u et a l . , (2005) ; 14. Y a r o n et a l . , (2005); 15. Takahashi et a l , (1999) ; 16. R o h m et a l . , (2000) ; 17. G i t l e r et a l . , (2004) ; 18. Castel lani et a l . , (2002) ; 19. Takahash i and Strittmatter, (2001) ; 20. K u m a n o g o h et a l , (2002) ; 2 1 . Tamagnone et a l . , (1999); 2 2 . G i o r d a n o et a l . , (2002) ; 23 . A r t i g i a n i et a l . , (2004) ; 24. Suto et a l . , (2005); 2 5 . T o y f u k u et a l . , (2004) ; 26 . Pasterkamp et a l . , (2003) ; 27 . C o m e a u et a l . , (1998) ; 28 . Jul ien et a l . , (2005). 16 nervous systems of both vertebrates and invertebrates (Ohta et al., 1992; Ohta et al., 1995; Nakamura et al., 2000). To date, ten vertebrate plexins have been identified and are categorized into four subclasses ( A - D ) on the basis of sequence similarities (Tamagnone et al., 1999; Puschel, 2002; Fujisawa, 2004). In the developing vertebrate nervous system, plexins, as with semaphorins, are expressed in distinct, yet often overlapping patterns. Class A plexins are the most widely expressed, with four members having been detected in a variety of embryonic P N S and C N S neuronal populations including cortical neurons, hippocampal neurons, spinal motoneurons, several populations of cranial motoneurons and sensory neurons (Takahashi et al., 1999; Tamagnone et al., 1999; Cheng et al., 2001; Murakami et al., 2001; Suto et al., 2003; Cohen et al., 2005). Although the expression of Class B plexins in the developing nervous system is somewhat restricted, plexin-Bl and plexin-B2 m R N A has been detected in several neuronal populations, including D R G neurons and neurons located in the ventral spinal cord (Cheng et al., 2001; Worzfeld et al., 2004). Finally, unlike Class A and Class B plexins, Class C and D plexin expression is largely absent from the developing nervous system, although plexin-Cl and plexin-Dl m R N A is detected in the developing hippocampus and plexin-Dl m R N A expression has been detected in peripheral sensory ganglia (Cheng et al., 2001; van der Zwaag et al., 2002). Despite the fact that plexin expression largely declines in the postnatal and adult nervous system, expression of several Class A plexins persists in some neuronal populations, including several populations examined in the current study (Cheng et al., 2001; Murakami et al., 2001; Bagri et al., 2003; Suto et al., 2003). O f note, plexin-A1 m R N A expression has been detected in adult D R G neurons, and this expression is maintained following injury to peripherally or centrally-projecting axonal branches (Pasterkamp et al., 2001). A parallel study performed in our lab revealed that adult rodent facial motoneurons express m R N A for all 4 Class A plexins (A1-A4) , while rubrospinal neurons express plexin-Al, plexin-A2, andplexin-A4 m R N A (Spinelli, 2006). Within the semaphorin field, a growing body of evidence suggests that plexins can act as semaphorin receptors, either by interacting directly with invertebrate semaphorins or membrane-associated vertebrate semaphorins, or by acting as the signal transducing component of a Class 3 semaphorin plexin-neuropilin receptor complex (Takahashi et al., 1999; Tamagnone et al., 1999; Negishi et al., 2005b). Plexins were first identified as ligand-binding semaphorin receptors 17 dur ing a search for potential b ind ing partners to the v i ra l l y encoded semaphorins S e m a V A and S e m a V B on human B lymphocytes (Comeau et a l . , 1998). V E S P R (v i rus -encoded semaphorin protein receptor, later renamed P l e x i n - C l ) was subsequently shown to be be long to the p lex in fami l y o f t ransmembrane proteins and functions as a receptor for secreted v i ra l semaphorins, S e m a V A and S e m a V B ( C o m e a u et a l . , 1998). A d d i t i o n a l studies have revealed that p lex ins can direct ly interact w i t h a number o f membrane-associated vertebrate semaphorins and transduce semaphorin signals without requi r ing neuropi l ins as coreceptors (Tamagnone et a l . , 1999; Kanto r et a l . , 2 0 0 4 ; T o y o f u k u et a l . , 2 0 0 4 b ; T o y o f u k u et a l . , 2004a) . F i n a l l y , in addit ion to serving as receptors for a number o f vertebrate semaphorins, p lex ins also funct ion as semaphorin receptors in the deve lop ing invertebrate nervous system. In the embryon ic Drosophila melanogaster nervous system, p l e x i n - A serves as a h igh aff in i ty receptor for the transmembrane semaphorins Sema l a and S e m a l b that act as repuls ive guidance cues for a number o f peripheral and central axons ( W i n b e r g et a l . , 1998b). In contrast to invertebrate and membrane-associated vertebrate semaphorins, C lass 3 semaphorins, w i t h one except ion (Sema3E) , do not interact d i rect ly w i t h p lex ins (Puschel , 2 0 0 2 ; G u et a l , 2005) . Instead, C lass 3 semaphor in s igna l l ing is mediated by the interaction between members o f the C lass A p lex in subfami ly and neuropi l ins , w h i c h f o r m a receptor complex . In this complex , C lass 3 semaphorins b ind neuropi l in h o m o - or heterodimers, w h i l e homodimer i zed plex ins funct ion as the s ignal - t ransducing component in the receptor complex (Takahashi et a l . , 1999; Tamagnone et a l . , 1999; Tamagnone and C o m o g l i o , 2 0 0 0 ; Takahashi and Strittmatter, 2001) . U n l i k e the spec i f ic i ty often observed in l igand-receptor interactions, in vitro experiments have revealed that mul t ip le C lass A p lex ins can act as signal t ransducing subunits for a single C lass 3 semaphor in ( R o h m et a l . , 2 0 0 0 ; C h e n g et a l . , 2 0 0 1 ; Y a r o n et a l . , 2005) . G i v e n the evidence that many neuronal populat ions express mul t ip le p lex ins , this compl icates the search for the most p h y s i o l o g i c a l l y relevant p lex in -neurop i l in combinat ions in vivo. Th is multitude o f possible s igna l l ing complexes presents yet another mechan ism by w h i c h neurons cou ld m o d i f y their responses to semaphorins. 18 1.4. ADDIT IONAL S E M A P H O R I N R E C E P T O R S 1.4.1. Introduction In addition to neuropilins and plexins, a number of other transmembrane proteins have been found to function as semaphorin receptors, either by directly transducing semaphorin signals or by interacting with neuropilins and plexins as an additional component of a Class 3 semaphorin receptor complex. It has been suggested that the large number and wide variety of semaphorin receptor components, as well as the ability of individual semaphorins to signal through a number of different receptor components underlies the diverse biological functions of semaphorins (Kumanogoh and Kikutani, 2004). Here, I wi l l briefly introduce several additional semaphorin receptors, with a focus on those receptors which may play a role in mediating semaphorin signalling in the mature nervous system following axonal injury. 1.4.2. Met The hepatocyte growth factor (HGF) receptor, Met, is a tyrosine kinase receptor possessing a highly divergent 'sema' protein motif in its extracellular domain, making it structurally related to both plexins and semaphorins (Bottaro et al., 1991; Naldini et al., 1991; Winberg et al., 1998b). In endothelial cells, Met has been shown to directly associate with p lexin-Bl (Giordano et al., 2002). Exposure of endothelial cells to the p lexin-Bl ligand, Sema4D, results in the activation of plexin-B 1 and stimulation of the endogenous Met tyrosine kinase activity, leading to a Met-dependent induction of invasive growth (Giordano et al., 2002; Barberis et al., 2004; Conrotto et al., 2004; Conrotto et al., 2005). In addition to mediating Sema4D signalling, Met also plays a role in transducing signals from a second transmembrane semaphorin, Sema5A (Artigiani et al., 2004). Incubation of cultured plexin-B 1 and Met-expressing fibroblast, epithelial, or endothelial cells with Sema5A results in cellular collapse and cellular migration, activities that are dependent on both Sema5A binding to p lex in-Bl and the stimulation of Met tyrosine kinase activity (Artigiani et al., 2004). Although the interaction of Met and plexins in neurons has not yet been investigated, Met is expressed in a number different embryonic and mature PNS and C N S neuronal populations (Achim et al., 1997; Maina et al., 1997; Thewke and Seeds, 1999; Akimoto 19 et al., 2004), suggesting that Met could act to potentiate semaphorin signalling in the mature nervous system (Table 1.1). 1.4.3. Cell Adhesion Molecules L I is a cell adhesion molecule ( C A M ) belonging to an immunoglobulin (Ig) superfamily known to promote axon fasciculation and neurite outgrowth in vitro (Skaper et al., 2001). L I is highly expressed on embryonic growth cones, and stimulation of L I signalling via homo- or heterophilic interactions results in the activation of intracellular signalling pathways that promote cytoskeletal rearrangements (Skaper et al., 2001). Co-immunoprecipitation and binding experiments have revealed that L I can directly interact with an npn-1 /plexin-A1 receptor complex to form a functional Sema3A receptor complex (Castellani et al., 2000; Castellani et al., 2002). Furthermore, L I is known to be required for the endocytosis of npn-l/Sema3A complexes, a process necessary for Sema3A-induced growth cone collapse (Castellani et al., 2004). In neurons, L I expression is known to be required for Sema3A-mediated growth cone collapse; cortical and D R G neurons obtained from LI-knockout mice are unable to respond to sources of Sema3A in vitro (Castellani et al., 2000; Castellani et al., 2002). This inhibition of Sema3A-mediated growth cone collapse could not be reversed by application of a soluble L I fragment, suggesting that the intracellular domain of L I is required to mediate Sema3A signalling (Castellani et al., 2000). In fact, the addition of soluble L I to wild-type Ll-expressing neurons results in the conversion of the neuronal response to Sema3A from repulsion to attraction, demonstrating that L l - L l trans interactions may act to modulate growth cone responses to Sema3A (Castellani et a l , 2000; Castellani et al., 2002; Castellani et al., 2004). In vivo, L I may also contribute to Sema3A signalling following nervous system injury, as Sema3A-responsive adult D R G neurons continue to express npn-1, plexin-Al, and LI m R N A following axotomy (Pasterkamp et al., 1998b; Gavazzi et al., 2000). Interestingly, Castellani et al., (2004) demonstrated that an Ll/npn-1 receptor complex is sufficient to confer a Sema3A response in cultured COS-7 cells in the absence of plexins. This suggests that, at least in some situations, the expression of L I may be sufficient to transduce Sema3A signals. 20 Recent ly , a second C A M was ident i f ied as a co-receptor for C lass 3 semaphorins. N r C A M , a member o f the L I subfami l y o f Ig C A M s , interacts w i th n p n - 2 , and funct ional studies have shown that N r C A M is required in vitro for the guidance effects o f S e m a 3 B and Sema3F on anterior commissure neurons (Fa lk et a l . , 2005) . S i m i l a r to L I , N r C A M may also funct ion as a semaphorin co-receptor in vivo, as NrCAM and npn-2 m R N A are both expressed in olfactory bulb neurons, D R G s , h ippocampal py ramida l neurons, and ventral motor neurons in the deve lop ing c h i c k embryo (Lus t ig et a l , 2001) , a l l o f w h i c h are k n o w n to respond to C lass 3 semaphorins. 1.4.4. Off-track O r i g i n a l l y ident i f ied in Drosophila melanogaster, o f f - t rack ( O T K ) is a neuronal ly -expressed transmembrane prote in , w i t h h o m o l o g y to both ce l l adhesion proteins and receptor tyrosine kinases, w h i c h has been shown to interact w i th the Drosophila S e m a l a receptor, p l e x i n - A (Winberg et a l . , 2001) . The format ion o f this O T K / p l e x i n - A receptor complex is thought to be required for S e m a l a - m e d i a t e d growth cone repuls ion in Drosophila, since O T K knockout mutants show s imi la r defects in motor axon guidance as those seen in P l e x i n - A and S e m a l a mutants ( W i n b e r g et a l . , 2001) . In vertebrates, an O T K homologue has been ident i f ied w h i c h funct ions as a component o f a receptor complex that mediates C lass 6 semaphorin s igna l l ing , a group o f vertebrate transmembrane semaphorins structurally s imi lar to Drosophila S e m a l a (Zhou et a l . , 1997; Q u et a l . , 2 0 0 2 ; T o y o f u k u et a l . , 2004b) . W h i l e the role o f C lass 6 semaphorins in the vertebrate nervous system remains largely u n k n o w n , several in vitro studies have revealed that Class 6 semaphorins can induce growth cone col lapse o f embryon ic D R G s , h ippocampal neurons, and cort ical neurons ( X u et a l . , 2 0 0 0 ; Q u et a l . , 2002) . Recent l y , S e m a 6 D was shown to inhibit the migrat ion o f myocard ia l cel ls f r o m mouse embryon ic ventr ic le explants, a process that required the b ind ing o f S e m a 6 D to a p l e x i n - A l / O T K receptor c o m p l e x ( T o y o f u k u et a l . , 2004b) . A l t h o u g h the expression o f O T K in the developing and mature vertebrate nervous system is presently u n k n o w n , it is possible that O T K / p l e x i n receptor complexes m a y contribute to Class 6 semaphorin s igna l l ing in neurons. 21 1.4.5. Integrins Sema7A is a GPI-linked semaphorin first identified as a mammalian homologue to several viral semaphorins (Lange et al., 1998; X u et al., 1998). Highly expressed in the developing and adult immune system, Sema7A mediates immune cell function in vitro, stimulating chemotaxis and cytokine production in monocytes by binding to plexin-Cl (Comeau et al., 1998; X u et al., 1998; Holmes et al., 2002). While the role of Sema7A in the developing and mature nervous system is still unknown, in vitro it has been shown to act as a potent stimulator of axonal outgrowth for a variety of embryonic neuronal populations (Pasterkamp et al., 2003). However, unlike in monocytes, this effect is not mediated by plexin-Cl signalling, as Sema7A-mediated axonal outgrowth is not abolished in neurons obtained from plex in-Cl knockout mice (Pasterkamp et al., 2003). Instead, the presence of a [31-subunit-containing integrin receptor complex is essential for mediating Sema7A axonal outgrowth (Pasterkamp et al., 2003). Integrins are a large family of transmembrane proteins that mediate cellular adhesion via interactions with extracellular matrix molecules including N - C A M , N-cadherin and L I (Hynes, 2002). The use of function-blocking antibodies to inhibit the activity of the pi-integrin subunit is sufficient to abolish Sema7A-mediated axonal outgrowth in vitro, suggesting that Sema7A signalling in neurons may involve pi-integrin signalling (Pasterkamp et al., 2003). However, to date, no direct interactions between Sema7A and pi-integrins have been observed, which could suggest that pi-integrins interact with additional, unidentified co-receptors to transduce Sema7A signalling (Pasterkamp et al., 2003). 1.4.6. CD72 In addition to their role as chemorepellents and chemoattractants in the nervous system, a growing body of evidence suggests that semaphorins are key regulators of immune responses (Kikutani and Kumanogoh, 2003). One of the most well characterized immune system semaphorins, Sema4D (CD 100), is a Class 4 transmembrane semaphorin highly expressed in both the developing embryonic nervous and immune systems (Delaire et al., 1998; Kumanogoh and Kikutani, 2001). In culture, Sema4D induces growth cone collapse in plexin-Bl-expressing 22 embryonic retinal ganglion cells and hippocampal neurons, suggesting that p lexin-Bl can act as a Sema4D receptor in these neurons (Tamagnone et al., 1999; Perrot et al., 2002; Swiercz et al., 2002) . Unlike p l ex in -B l , Sema4D is expressed in both the mature immune and nervous systems (Delaire et al., 1998; Kumanogoh and Kikutani, 2001; Moreau-Fauvarque et al., 2003). Given the absence of p lex in-Bl expression in these systems, a search for additional Sema4D receptors was performed, ultimately leading to the identification of a novel semaphorin receptor, CD72. A transmembrane homodimeric protein belonging to the C-type lectin family, CD72 is highly expressed in B cells and dendritic cells, where it acts as a Sema4D immune system receptor, promoting T-cell growth and differentiation, enhancing B cell proliferation, and inhibiting monocyte migration (Kumanogoh et al., 2000; Tamagnone and Comoglio, 2000; Kikutani and Kumanogoh, 2003). Interestingly, while plexin-Bl expression is high in the developing mouse C N S , expression is rapidly down-regulated postnatally and it is not detected in the adult nervous system. In contrast, although CD72 is not expressed in embryonic mouse neurons, it is highly expressed in most postnatal and adult C N S neurons, suggesting that in adult mammalian C N S neurons, CD72, and not p l ex in -B l , may mediate Sema4D signalling (Moreau-Fauvarque et al., 2003) . 1.4.7. E r b B 2 The ErbB family of receptor tyrosine kinases serve as receptors for neuregulins, a family of epidermal growth factor (EGF)-related molecules (Lemke, 1996). In both embryonic and adult vertebrates, ErbB receptors are widely expressed in a number of different cell types, including C N S and PNS neurons, as well as many peripheral targets of P N S neurons (Altiok et al., 1995; Tessier-Lavigne, 1995; Gerecke et al., 2001; Kle in , 2004). One ErbB family member, ErbB2, is unique, as it does not directly interact with neuregulins. Instead, ErbB2, which functions as a co-receptor to mediate neuregulin signalling, interacts with other ErbB family members to form a heteromeric receptor complex (Peles and Yarden, 1993). Recently, ErbB2 has been shown to associate with p l ex in -B l , and has been found to be required for Sema4D-mediated growth cone collapse in embryonic rat hippocampal neurons (Swiercz et al., 2004). Binding of Sema4D to 23 plexin-Bl induces ErbB2 tyrosine kinase activity, resulting in the tyrosine phosphorylation of both p lexin-Bl and ErbB2 (Swiercz et al., 2004). This ErbB2-mediated phosphorylation of p lex in-Bl is required for plexin-Bl-mediated axonal growth cone collapse, suggesting that ErbB2 and p lex in-Bl form a receptor complex required to transduce Sema4D signalling in neurons (Swiercz et al., 2004). Given the widespread expression of ErbB family members in both the embryonic and adult nervous systems, combined with the evidence that the expression of several ErbB receptors is increased in adult rat D R G and spinal motoneurons following axotomy (Lindholm et al., 2002; Pearson and Carroll, 2004), it is possible ErbB receptors may also function as components of additional semaphorin receptor complexes mediating semaphorin signalling. 24 1.5. S E M A P H O R I N S I G N A L L I N G V I A P L E X I N S 1.5.1 . I n t r o d u c t i o n Over the past several years, an increasingly complex picture of semaphorin signalling has emerged; one in which semaphorin receptor activation on the growth cone results in the stimulation of a variety of intracellular signalling cascades, culminating in alterations to the stability of actin and microtubule networks. The end result of such alterations are changes to growth cone morphology or growth cone collapse (Yu and Bargmann, 2001; Dickson, 2002; Huber et al., 2003; Kruger et al., 2005; Negishi et al., 2005a). The Rho family of small GTP-binding proteins (including Rho/Rac/Cdc42) are major mediators of cytoskeleton structure, moderating actin polymerization, branching and depolymerization (Dickson, 2002; Huber et al., 2003). In neurons, the prevailing concept is that axonal guidance molecules mediate their effects on growth cones via small GTP-binding proteins. In this model, activation of Rac or Cdc42, or inhibition of RhoA signalling promotes growth cone extension, while RhoA activation or inhibition of Rac and Cdc42 signalling induces growth cone collapse and axonal retraction (Nobes and Hal l , 1995; Huber et al., 2003). In reality, such a concept is an oversimplification, as Rho GTPases are involved in multiple signalling pathways. As such, the regulation of growth cone guidance is most certainly more complicated than simple Rho/Racl/Cdc42 antagonism (Giniger, 2002). Although Rho GTP-binding proteins and their downstream effectors have been strongly implicated in semaphorin-mediated growth cone turning and collapse, many of the specific intracellular pathways, as well as the complex interactions between multiple downstream signalling molecules which likely underlie these processes, are still not fully understood. Evidence now suggests that the plexins play a critical role in mediating the downstream signalling pathways involved in semaphorin signalling. Therefore, in the following sections, I wi l l briefly summarize what is known regarding signalling in the two classes of plexins (Class-A and Class-B) relevant to this thesis. 25 1.5.2. Class A Plexins Early in vitro studies revealed that exposure of embryonic retinal ganglion neurons to Sema3A results in changes in growth cone morphology characterized by the breakdown and remodelling of the actin cytoskeleton (Fan and Raper, 1995). Surprisingly, unlike other guidance cues, Sema3A-mediated growth cone collapse was subsequently shown to occur independently of RhoA activity. Instead, activated R a c l was shown to bind directly a Cdc42/Racl interactive binding (CRIB) domain in the cytoplasmic tail of p l ex in -Al following the interaction of Sema3A with the receptor complex (Jin and Strittmatter, 1997; Kuhn et al., 1999; Vastrik et al., 1999; Turner et al., 2004). The direct interaction of R a c l with p l ex in -Al is required for p lex in-Al mediated collapsing activity, and may function to relieve an autoinhibitory conformation within the intracellular region of p l ex in -Al (Jin and Strittmatter, 1997; Kuhn et al., 1999; Turner et al., 2004). (Figure 1.2) In addition to R a c l , at least one other GTP-binding protein has been shown to mediate Class 3 semaphorin-induced growth cone collapse. Following the interaction of Sema3A with a plexin-A l containing receptor complex, R n d l , a constitutively active Rho family GTP-binding protein best known for an ability to antagonize Rho via activation of the RhoA inhibitor p i90 , transiently associates with the p lex in -Al cytoplasmic C R I B domain (Rohm et al., 2000; Barberis et al., 2005). (Figure 1.2) This, in turn, results in a conformational change in p lex in-Al and the activation of an endogenous p lex in -Al GTPase-activating (GAP) domain that stimulates the intrinsic GTPase activity of R-Ras, a Rho GTP-binding protein that promotes neurite outgrowth by stimulating integrin activity (Ivins et al., 2000; Oinuma et al., 2004; Toyofuku et al., 2005). This p lex in-Al mediated activation of the intrinsic GTPase activity of R-Ras results in the suppression of R-Ras activity and leads to a decrease in integrin-mediated attachment to the extracellular matrix and growth cone collapse (Oinuma et al., 2004; Toyofuku et al., 2005). The interaction of Sema3A with its receptor complex also induces the activation of two non-receptor tyrosine kinases, Fes and Fyn, which stimulate intracellular pathways known to contribute to growth cone collapse. The binding of Sema3A to npn-1 results in the Fes-mediated phosphorylation of both p lex in -Al and collapse response mediator protein-2 (CRMP-2) , an 26 intracellular protein that modulates microtubule dynamics (Gu and Ihara, 2000; Mitsui et al., 2002). In addition, Sema3A/npn-l interactions also stimulate the activity of Cdk5 (cyclin-dependent kinases 5), a serine/theronine kinase that can phosphorylate both C R M P - 2 and Tau, a microtubule-associated protein (Sasaki et al., 2002; Brown et al., 2004). This results in the destabilization of microtubule networks and leads to growth cone collapse (Arimura et al., 2000). (Fig. 1.2) Finally, the intracellular domains of both invertebrate and vertebrate class A plexins have recently been shown to interact directly with molecules interacting with casL ( M I C A L s ) , proteins related to flavoprotein monooxygenases that catalyze protein oxidation reactions implicated in the disruption of actin networks (Milzani et al., 1997; Terman et al., 2002). M I C A L s also regulate cytoskeletal function through their association with Cas, a scaffold protein found in focal adhesion complexes, which is expressed in both the developing and adult vertebrate nervous system, as well as within the spinal cord injury site (Milzani et al., 1997; Pasterkamp, 2005). 1.5.3. Class B Plexins Although Class A plexins induce growth cone collapse and neurite retraction in a RhoA-independent manner, at least one Class B plexin, p l ex in -B l , requires RhoA activation to trigger semaphorin-induced growth cone collapse and neurite retraction (Driessens et al., 2001). Unlike activated Rac, activated R h o A does not bind plexin-Bl directly. Instead, the binding of Sema4D to p lexin-Bl stimulates the activity of two Rho specific guanine nucleotide-exchange factors (GEFs), leukaemia-associated Rho-GEF ( L A R G ) and P D Z - R h o G E F , which interacts with p lexin-Bl at a PDZ-binding motif specific to the cytoplasmic domains of Class B plexins (Aurandt et al., 2002; Driessens et al., 2002; Perrot et al., 2002; Swiercz et al., 2002). Exposure of plexin-Bl-expressing embryonic hippocampal neurons to Sema4D results in robust RhoA activation in these neurons, which results in the disruption of the growth cone actin cytoskeleton and, thereby, growth cone collapse (Swiercz et al., 2002; Swiercz et al., 2004). Expression of dominant-negative P D Z - R h o G E F in these neurons abolishes RhoA activation and the resulting 27 growth cone collapse, illustrating the importance of these G E F s and RhoA signalling in mediating p lex in-Bl function in neuronal growth cones (Swiercz et al., 2002). (Figure 1.2) Like Class A plexins, at least one member of the Class B plexin subfamily, p lex in-Bl , can directly interact with activated Rac via the plexin C R I B domain (Vikis et al., 2000; Driessens et al., 2001). However, unlike Class A plexins, instead of relieving an auto-inhibitory configuration, the binding of activated Rac to the p lex in-Bl C R I B domain functions to sequester Rac from interacting with the downstream effector, p21 -activated kinase ( P A K ) (Vikis et al., 2000; Driessens et al., 2001). As P A K promotes actin polymerization, the suppression of P A K activity by the sequestering of activated Rac serves to inhibit actin polymerization and promotes disassembly of the cytoskeleton (Vikis et al., 2002). (Figure 1.2) In addition, the interaction of Sema4D with plexin-B 1 also results in the direct association of Rnd l with the p lex in-Bl C R I B domain (Swiercz et al., 2004). A s with Class A plexins, this interaction induces a conformational change in the cytoplasmic domain of p l ex in -Bl , stimulating the endogenous p lex in-Bl G A P activity and suppressing the activity of the Rho GTP-binding protein R-Ras (Oinuma et al., 2004). This results in a reduction in integrin activity and growth cone collapse (Oinuma et al., 2004). That the activation of both Class A and Class B plexins results in the disruption of integrin function suggests that the suppression of integrin activity may represent a common pathway in plexin-mediated semaphorin signalling (Serini et al., 2003; Barberis et al., 2004; Toyofuku et al., 2005). 28 F i g u r e 1.2. S c h e m a t i c d e t a i l i n g t h e i n t r a c e l l u l a r s i g n a l l i n g c o m p o n e n t s d o w n s t r e a m o f P l e x i n - A l ( A ) , a n d P l e x i n - B l ( B ) , i n g r o w t h c o n e s . Although neuropilins, plexins, and semaphorins are known to form dimers, for illustrative purposes, only a single member of each component is shown here. ( A ) Without ligand binding to the neuropilin-1/plexin-Al receptor complex, R-Ras is active, resulting in integrin-mediated attachment to the extracellular matrix ( E C M ) . Interaction of Sema3A with neuropilin-1 mediates a conformational change in p l e x i n - A l , resulting in R n d l and Rac association with the plexin C R I B domain. In turn, this mediates the activation of the P lex in -Al G A P domain, and results in the stimulation of the intrinsic GTPase activity of R-Ras and a downregulation in R-Ras activity. This suppression in R-Ras activity results in a decrease in the integrin-mediated attachment to the E C M . Activation of Fes and/or Fyn tyrosine kinases results in the phosphorylation of C R M P 2 and C D K 5 respectively, leading to destabilization of the microtubule network. In addition, activation of p l ex in -Al leads to M I C A L activation. This stimulates binding to the scaffold protein Cas, resulting in the disruption of actin networks. Diagram modified after Kruger et al., (2005). ( B ) When semaphorins are not bound to p l ex in -Bl , active Rac promotes activation of p21-associated kinase ( P A K ) , while R-Ras promotes integrin-mediated attachment to the E C M . Binding of Sema4D with P lex in -B l induces a conformational change, resulting in R n d l and Rac association with the plexin intracellular C R I B domain. Similar to Class A plexins, these interactions stimulate the P lex in -B l G A P domain, promoting R-Ras inactivation and decreasing integrin-mediated attachment to the ( E C M ) . The interaction of active Rac with the P lex in-Bl C R I B domain also results in a suppression of P A K activity, leading to actin cytoskeleton disassembly. Finally, Sema4D binding to P lex in -Bl also stimulates the association of L A R G and/or P D Z - R h o G E F with the P lex in -Bl P D Z domain, resulting in RhoA activation and disruption of the actin cytoskeleton. Additional transmembrane receptors which may also contribute to Class B plexin signalling, (i.e. ErbB-2 and Met) are not shown. Diagram modified after Kruger et al., (2005). No Ligand • Sema3A actin depolymerization microtubule reorganization U membrane actin depolymerization 30 1.6. S E M A P H O R I N S IN T H E D E V E L O P I N G V E R T E B R A T E N E R V O U S S Y S T E M 1.6.1. Introduction To address the role of semaphorins in vivo, a variety of laboratories have analyzed nervous system development in gene knockout animals lacking the expression of one or more semaphorin, neuropilin, or plexin genes. Although many of these knockout experiments result in the generation of a non-viable embryo, valuable information has been obtained regarding the surprising ability of neuronal fibre tracts to form normally, even in animals lacking the expression of one or more semaphorin. In general, these studies have revealed: 1) In the developing P N S , the loss of a single semaphorin often results in growth cone targeting errors and the defasiculation of peripheral nerve tracts, although the majority of tracts develop normally. 2) The effects of semaphorin, neuropilin, or plexin gene deletions on C N S development are often much more subtle than those seen in the developing P N S . 3) The loss of expression of one or more neuropilin or plexin genes, generating neurons that are insensitive to multiple semaphorins, often results in a more severe PNS phenotype. Given the large number of semaphorins known to be expressed in the developing vertebrate nervous system, a complete review of all of the literature addressing semaphorin expression in the developing nervous system is beyond the scope of this thesis. Instead, I wi l l outline several examples in an attempt to give a general overview of the field. 1.6.2. Class 3 Semaphorins in Vertebrate Nervous System Development A detailed morphological analysis of the developing nervous system of Sema3A-nu\\ mouse embryos has revealed significant defasiculation and targeting errors in the fibre tracts of several npn-1-expressing, peripherally-projecting cranial nerves, as well as in centrally projecting N G F -sensitive D R G axons, which inappropriately project into ventral regions of the spinal cord (Behar et al., 1996; Taniguchi et al., 1997). However, it is interesting to note that in at least one Sema3A knockout mouse strain, many of the initial targeting errors seen in centrally-projecting NGF-sensitive D R G axons are corrected during later developmental stages, and postnatally, most 31 axons are restricted to their normal synaptic fields (Whi te and Behar , 2000) . Th is suggests the presence o f compensatory mechanisms w i th in the deve lop ing nervous system w h i c h may funct ion to correct sensory axon pathf inding errors that occur ear ly in development (White and Behar , 2000) . In contrast to the defas iculat ion and targeting errors seen early in P N S development, the major i ty o f C N S fibre tracts in Sema3A knockout mice develop normal l y . H o w e v e r , un l ike in the P N S , axonal pathf ind ing errors in deve lop ing C N S fibre tracts are often not corrected, and persist in postnatal and adult Sema3A knockout animals . In the deve lop ing o l factory system o f Sema3A-nu l l m i c e , npn -1 pos i t ive o l factory axons often innervate non-target regions o f the olfactory bu lb , and the presence o f these ectopic connections in the adult o l factory system results in the formation o f distorted sensory maps (Schwart ing et a l . , 2 0 0 0 ; Tan iguch i et a l . , 2003) . M i n o r axonal pathf inding defects have also been reported for both py ramida l and entorhinal axons in the brains o f embryon ic Sema3A knockout mice , and as w i t h the ol factory defects, these errors persist postnatal ly (Po l leux et a l . , 1998; Po l l eux et a l . , 2 0 0 0 ; Pozas et a l . , 2 0 0 1 ; Sasaki et a l . , 2002) . S i m i l a r to the insights gained f rom the study o f mice lack ing S e m a 3 A expression, the generation o f Sema3F-nu\\ m i c e has revealed that Sema3F also contributes to the normal development o f both the P N S and C N S . The absence o f Sema3F expression in embryon ic mice results in mult ip le defasiculat ion errors in npn -2 expressing anterior commissure and vomeronasal sensory project ions, w h i l e axonal project ion errors are also observed in the amygda la , inf rapyramidal tract, and ol factory system (C lout ier et a l . , 2 0 0 2 ; Sahay et a l . , 2003) . In addi t ion, Sema3F is also essential for no rmal ocu lomotor and trochlear nerve format ion . In E l 1.5 Sema3F-nu\\ mice , embryos possess extensive defasiculat ion errors in npn -2 -pos i t i ve ocu lomotor nerves, and n p n - 2 -posit ive trochlear neurons fa i l to extend axons, result ing in the fai lure o f the trochlear nerve to fo rm (Sahay et a l , 2003) . Further in format ion was gained f rom the generation o f npn-1 or npn-2 knockout mice , w h i c h revealed that an absence o f funct ional neuropi l in expression in the deve lop ing nervous system results in the generation o f a morpho log ica l phenotype s imi la r to that seen in S e m a 3 A and 32 Sema3F knockout an imals . H o w e v e r , un l ike semaphor in knockout an imals , since both npn-1 and npn -2 can act as receptors for mul t ip le C lass 3 semaphor ins , the fasc iculat ion and targeting errors observed are often more severe, w i th misproject ion errors often persist ing into adulthood ( K i t s u k a w a et a l . , 1997; C h e n et a l . , 2 0 0 0 a ; G iger et a l . , 2 0 0 0 ; K a w a s a k i et a l . , 2 0 0 2 ; W a l z et a l . , 2002) . 1.6.3. Membrane-Associated Semaphorins in Vertebrate Nervous System Development A l t h o u g h few transgenic animals have been generated, ev idence suggests that, l ike C lass 3 semaphorins, membrane-assoc iated semaphorins may also p lay a role in patterning the developing vertebrate nervous system. H o w e v e r , the m o r p h o l o g i c a l defects observed in the developing nervous system suggest that, at least in the membrane-associated semaphorins investigated to date, defects in nervous system development are largely l imi ted to distinct neuronal populat ions. Studies o f Sema4A-nu]\ m i c e have revealed that S e m a 4 A is essential for the normal development o f retinal photoreceptors in the postnatal mur ine v isual system (R ice et a l . , 2004) . In w i ld - t ype m i c e , S e m a 4 A is n o r m a l l y expressed by gangl ion cel ls , inner ret inal neurons and retinal p igment epithel ial cel ls dur ing the stage in w h i c h photoreceptors are extending processes and fo rming synaptic contacts w i t h these cel ls . W h i l e the loss o f Sema4A expression fai ls to impede embryon ic retinal development , postnatal ly , photoreceptors fa i l to extend processes into the outer retinal layer, and most undergo apoptosis w i th in the first month o f l i fe (R ice et a l . , 2004) . Th is suggests that S e m a 4 A m a y act as a l igand on cel ls in the outer ret inal layer, and may be required for normal photoreceptor maturation (R ice et a l . , 2004) . In addit ion to axonal outgrowth, membrane-associated semaphorins have also been shown to p lay a role in mediat ing neuronal migrat ion in the deve lop ing m a m m a l i a n nervous system. F o r example , the loss o f Sema6A expression in the embryon ic mouse C N S results in an abnormal ventral project ion o f caudal thalamocort ical axons (which n o r m a l l y express S e m a 6 A ) , as w e l l as the fai lure o f granule ce l l migrat ion w i th in the deve lop ing cerebel lum (Le ighton et a l . , 2 0 0 1 ; Ker jan et a l . , 2005) . Furthermore, in mouse embryos l a c k i n g SemalA gene expression, a 33 significant reduction in lateral olfactory tract growth is observed, with many olfactory bulb axons failing to project to targets within the olfactory cortex (Pasterkamp et al., 2003). This suggests that Sema7A may play a role in the development of the olfactory system In summary, a large number of gene knockout studies have revealed that semaphorin signalling plays a key role in the development of the vertebrate nervous system. Furthermore, the presence of largely minor pathfinding defects in single semaphorin, plexin, or neuropilin knockout mice suggests that multiple semaphorins each have specific and restricted functions during normal nervous system development. 34 1.7. S E M A P H O R I N E X P R E S S I O N I N T H E I N J U R E D A D U L T N E R V O U S S Y S T E M 1.7.1 . I n t r o d u c t i o n Although widespread in the developing nervous system, the expression of semaphorins and their receptors becomes increasingly restricted in the adult nervous system (Luo et al., 1993; Giger et al., 1996; Giger et a l , 1998b; Pasterkamp et al., 1998b; Pasterkamp et al., 1998a). Given that neurons continue to express semaphorin receptors, and continue to respond to at least some semaphorins into adulthood, the possibility exists that the continued expression or re-expression of semaphorins following a C N S injury may contribute to the non-permissive nature of the neural scar to axonal regeneration (Luo et a l , 1993; (Luo et al., 1993; Gavazzi, 2001; Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003). A s well , the evidence that some mature neuronal populations express semaphorins and that, following injury, such expression often declines in neurons able to mount a robust regenerative response, suggests that semaphorins may play a role in determining the intrinsic ability of adult neurons to regenerate following injury. Throughout the past 10 years, a growing body of evidence has suggested that in the adult nervous system, semaphorins modulate a variety of processes including synaptic plasticity (Barnes et a l , 2003; Yang et al., 2005) and neuronal regeneration following injury (Holtmaat et al., 2002; de Wit and Verhaagen, 2003). In one of the first in vivo studies demonstrating that adult neurons maintain their ability to respond to semaphorins, Tanelian and colleagues demonstrated that Sema3A can cause repulsion of both established and regenerating trigeminal sensory afferents (Tanelian et al., 1997). In addition, several studies have revealed that NGF-sensitive adult D R G neurons continue to express npn-1 (Reza et al., 1999; Gavazzi et al., 2000; Owesson et al., 2000; Pasterkamp et al., 2001), and in an animal model of neuropathic pain, the overexpression of Sema3A in the adult rat spinal cord can prevent dorsally-terminating NGF-sensitive nociceptive axons from sprouting into inappropriate target areas (Tang et al., 2004). 35 1.7.2. Expression of Secreted Semaphorins Fol lowing Injury to the C N S Following a penetrating injury of the adult mammalian C N S , meningeal-derived fibroblasts invade the site of injury, and together with reactive astrocytes, form a dense astro-gliotic scar that functions as both a physical and biochemical barrier to regenerating axons (Frisen et al., 1998; Fawcett and Asher, 1999). Along with a number of other inhibitory molecules, such as tenascin-C and CSPGs , meningeal-derived fibroblasts in the C N S lesion site also upregulate the expression of Sema3A m R N A as early as 6 days following injury (Pasterkamp et al., 1999b; Pasterkamp et al., 2001; Pasterkamp and Verhaagen, 2001). Analysis of cultured neonatal rat fibroblasts has revealed that these cells also express Sema3A (Niclou et al., 2003). Protein extracts isolated from these cells are sufficient to induce growth cone collapse in npn-1 expressing embryonic D R G neurons, suggesting that Sema3A-expressing fibroblasts can act as an inhibitor to axonal outgrowth, and thus, are likely to contribute to the growth inhibitory properties of the neural scar (Niclou et al., 2003). Further immunological analysis of these fibroblasts has also revealed that these cells express a number of Class 3 semaphorins (Sema3A, 3B, 3C, 3E, and 3F), all of which are known to function as potent growth cone chemorepellents (De Winter et al., 2002b). Although the evidence is still circumstantial, a growing number of studies now suggest that, following injury to the adult spinal cord, the expression of semaphorins in the lesion site is likely to contribute to the inhibitory nature of the neural scar, thus inhibiting the regeneration of axotomized C N S axons. For example, following a dorsal rhizotomy or a dorsal column lesion, npn-1 and plexin-Al-posit ive ascending D R G collaterals are unable to invade regions of the lesion site populated with Sema3A-expressing fibroblasts (Pasterkamp et al., 1999b; Gavazzi, 2001; Pasterkamp et al., 2001). Similarly, neurons of the rubrospinal and corticospinal systems maintain their expression of Class 3 semaphorin receptors following axotomy, and are unable to regenerate their axons through portions of the lesion site containing semaphorin-expressing fibroblasts (De Winter et al., 2002b). Interestingly, the expression of neuropilins in rubrospinal and corticospinal neurons differs following axotomy. While axotomized corticospinal neurons express both npn-1 and npn-2, axotomized rubrospinal neurons only express npn-2 (De Winter et al., 2002b; Spinelli, 2006). This suggests that following axonal injury, regenerating rubrospinal 36 and corticospinal axons are likely to be sensitive to different Class 3 semaphorins expressed in the post-traumatic glial scar. The expression of the necessary receptors in these injured neuronal populations, coupled with the observation that they fail to regenerate axons into regions containing semaphorins, is consistent with the postulated role of Class 3 semaphorins as non-permissive elements within the post-traumatic glial scar of the C N S (De Winter et al., 2002b). Unlike the adult mammalian C N S , the neonatal C N S possesses a much greater capacity for regeneration, in part due to the absence of significant glial scar formation (Kal i l and Reh, 1979; Nicholls and Saunders, 1996). In addition, following neonatal C N S lesions, semaphorin expression is often much less prominent in the post-traumatic glial scar. A prime example of this concept is illustrated by studies of semaphorin expression following axonal injury to the neonatal and adult rat lateral olfactory tract (LOT). Transection of the adult rat L O T results in the invasion of Sema3A m R N A expressing fibroblast-like cells into the lesion site, which prevent axons from npn-1 immunopositive mitral cells (a neuronal population located within the olfactory bulb) from penetrating the lesion site (Pasterkamp et al., 1999a). In contrast, transection of the neonatal L O T results in robust axonal regeneration of npn-1 immunopositive mitral cell axons through a lesion site largely devoid of Sema3A m R N A expressing fibroblasts (Pasterkamp et al., 1999a). These experiments suggest that the role of Class 3 semaphorins in regulating C N S regeneration may depend not only on the receptors expressed by axotomized neurons, but also on the age of the organism, the intrinsic regenerative ability of the injured neurons, as well as the extent of semaphorin expression within the C N S lesion site. Although the expression of Class 3 semaphorins in the post-traumatic C N S glial scar is generally thought to inhibit axonal regeneration, following transection of the adult mammalian olfactory nerve, the expression of semaphorins at the site of injury may actually function to guide regenerating C N S axons towards distal targets. In contrast to the lack of regeneration observed in most other adult mammalian C N S tracts, after transection of the adult rat olfactory nerve, newly generated primary olfactory neurons successfully extend axons across the lesion site (Roskams et al., 1994; Astic and Saucier, 2001). Following olfactory nerve transection, Sema3A m R N A positive fibroblast-like cells invade the lesion site, organizing into string-like structures that may function to guide npn-1 immunopositive axons of newly generated primary olfactory 37 neurons through the injury site, allowing them to re-innervate targets within the olfactory bulb (Pasterkamp et al., 1998b). In contrast, following bulbectorhy (a more severe injury in which the olfactory bulb is removed), a large number of Sema3A-expressing fibroblast-like cells invade the lesion site, but instead of forming well defined structures, they fi l l the bulbar cavity, encapsulating the regenerating npn-1 immunoreactive axons and preventing their further extension (Meredith et al., 1983; Hendricks et al., 1994; Pasterkamp et al., 1998b). Therefore, one can conclude that, in addition to the age of the organism, the severity of the lesion is also likely to dictate the role the semaphorins play in regeneration in the adult mammalian C N S . In another illustration of the complexity of the semaphorin system, although the expression of Class 3 semaphorins in the lesioned spinal cord is thought to contribute to the growth inhibitory nature of the mature spinal cord, in at least some C N S neurons, injury results in the loss of semaphorin expression, possibly creating an environment conducive to axonal sprouting and the formation of new synapses. For example, adult hippocampal neurons express low levels of Sema3A, Sema3C and Sema3F m R N A , and functional studies suggest that the release of these semaphorins into the local environment may act in an autocrine/paracrine manner to suppress aberrant axonal sprouting and stabilize mature synapses (Chen et al., 2000a; Steup et al., 2000; Barnes et al., 2003; Holtmaat et al., 2003). However following axonal injury, hippocampal neurons transiently down-regulate the expression of all three semaphorins, a change mirrored by the up-regulation of GAP-43 m R N A expression, and axonal sprouting (Barnes et al., 2003; Holtmaat et al., 2003). This downregulation of semaphorin expression in injured neurons may result from the loss of synaptic connections, and could serve to remove an autocrine/paracrine block on synaptic rearrangement, thus promoting axonal sprouting and the formation of new synapses (Barnes et al., 2003). In summary, although a direct association between in vivo semaphorin expression and regeneration failure in the injured adult C N S has not firmly been established, the expression of semaphorin receptors in axotomized neurons, combined with the presence of multiple chemorepulsive semaphorins within the post-traumatic glial scar suggests that semaphorins may contribute to the failure of axonal regeneration. Unfortunately, such a model is likely to be an oversimplification, since the age of the organism and the severity of the lesion are also likely to 38 dictate the pattern and intensity of semaphorin expression in the injured CNS. Further complicating any interpretation of the role that secreted semaphorins play in the injured adult mammalian C N S is the finding that at least some adult C N S neurons express Class 3 semaphorins, and that downregulation of expression following injury coincides with the activation of a regenerative program and synaptic sprouting. Therefore, it is becoming increasingly evident that the role that secreted semaphorins play in the injured adult nervous system is complex, and dependent on a number of competing intrinsic and extrinsic factors. 1.7.3. E x p r e s s i o n o f M e m b r a n e - A s s o c i a t e d S e m a p h o r i n s f o l l o w i n g C N S i n j u r y Although membrane-associated semaphorins are highly expressed in the developing vertebrate nervous system, few studies to date have specifically addressed their expression within the adult CNS following injury, and their role remains unclear. Evidence from several studies suggests that, similar to Class 3 semaphorins, the expression of membrane-associated semaphorins in the adult C N S following injury may serve to increase the inhibitory environment of the injured CNS. In contrast, at least one class of membrane-associated semaphorins (Class 4) may be upregulated in newly generated olfactory receptor neurons (ORNs) following a bulbectomy, and this up-regulation coincides with the extension of axons and their arrive at their target regions (Williams-Hogarth et al., 2000). The latter point is illustrated by olfactory receptor neurons (ORNs) and their expression of Class 4 semaphorins during development. During development, ORNs express several Class 4 semaphorins at the stage when their axons are actively contacting and forming synaptic connections with targets in the olfactory bulb (Williams-Hogarth et al., 2000). In the adult rat olfactory system, mature ORNs residing in the olfactory epithelium express both Sema4A and Sema4C m R N A (Williams-Hogarth et al., 2000). Beginning three days following a unilateral bulbectomy, an injury which results in the axotomy and death of mature ORNs, Sema4A and Sema4C m R N A expression is no longer observed within the olfactory epithelium (Williams-Hogarth et al., 2000). Seven to fourteen days after injury, this neurodegeneration is followed by a period of neurogenesis, axon regrowth, and O R N maturation, although Sema4A and Sema4C m R N A expression is absent in these newly generated neurons (Williams-Hogarth et al., 2000). 39 However, beginning fourteen days after injury, Sema4A and Sema4C m R N A expression once again becomes detectable in the olfactory epithelium, a time course which coincides with the stage during which newly generated O R N axons arrive at presumptive targets within the olfactory bulb (Graziadei and Graziadei, 1979; Williams-Hogarth et al., 2000), although, in this injury model, the O R N targets have been ablated. While the role of Sema4A and Sema4C expression in regenerating ORNs is still unclear, their re-expression in newly generated mature ORNs following their arrive at presumptive targets within the region of olfactory bulb may suggest a role in the promotion of axonal sprouting or in synaptogenesis (Williams-Hogarth et al., 2000). Unlike Sema4A and Sema4C expression in the regenerating adult olfactory tract, the expression of Sema4D in the injured adult spinal cord is consistent with the notion that it contributes to axonal regenerative failure. Work by Moreau-Fauvarque and colleagues, (2003) • has demonstrated that, in vitro, Sema4D can act as an inhibitory guidance cue for mature PNS and C N S neurons, causing growth cone collapse and repulsion in both postnatal rat D R G and cerebellar granule neurons. Interestingly, unlike Class 3 semaphorins, Sema4D is not expressed in the spinal cord lesion site. Instead, following a thoracic spinal cord injury, oligodendrocytes present within the white matter surrounding the lesion site strongly upregulate Sema4D m R N A expression, which may act as a myelin-based inhibitor of axonal regeneration (Moreau-Fauvarque et al., 2003). Support for this concept includes the evidence that Sema4D can be detected in myelin extracts containing two other myelin-based inhibitors of axonal regeneration, Nogo-A and myelin associated glycoprotein ( M A G ) , (Moreau-Fauvarque et al., 2003). Given the spatial expression pattern of Sema4D in the injured spinal cord, along with the evidence that it can function as an inhibitory growth cone guidance cue, it is possible that Sema4D may also contribute to the inhibitory nature of the adult injured spinal cord. In summary, although few studies have focused on the expression of membrane-associated semaphorins following injury to the mature vertebrate C N S , at least one membrane-associated semaphorin may play a role in mediating axonal growth in the injured C N S . Surprisingly, current studies have also indicated that, in contrast to the downregulation of Class 3 semaphorin expression seen in some C N S neuronal populations following injury to the adult mammalian 40 olfactory tract, newly generated ORNs that are extending axons towards the C N S lesion site upregulate the expression of several Class 4 semaphorins (Williams-Hogarth et al., 2000). This novel finding may suggest that, in contrast to the common ideology that semaphorins act as inhibitors of axonal regeneration, the expression of Class 4 semaphorins in regenerating neurons may actually act to promote axonal growth. 1.7.4. Expression of Semaphorins following PNS injury As observed in many adult mammalian C N S neurons, a number of adult mammalian PNS neurons express semaphorins and/or semaphorin receptors (de Wit and Verhaagen, 2003). Although the role semaphorins and their receptors play in uninjured PNS neurons is still largely unknown, it has been hypothesized that, as with adult hippocampal neurons, semaphorin expression may serve to establish an autocrine/paracrine signalling system that acts to restrict afferent plasticity and prevent inappropriate structural remodelling of mature synapses (Gavazzi, 2001; Pasterkamp and Verhaagen, 2001). Experiments by several groups have revealed that, in the adult P N S , both facial and spinal motoneurons express Sema3A m R N A and the Sema3A receptor component npn-1 (Pasterkamp et al., 1998a; Gavazzi et al., 2000; Gavazzi, 2001). Following a peripheral nerve injury, a robust cell body response is detected in both neuronal populations, which continue to express npn-1 while simultaneously down-regulating the expression of Sema3A m R N A (Pasterkamp et al., 1998a; Gavazzi et al., 2000). This decreased expression of Sema3A m R N A following injury may be in response to the axotomy-induced loss of retrograde signals derived from distal muscle targets, as the expression of Sema3A m R N A returns to pre-injury levels following muscle re-innervation (Pasterkamp et al., 1998a). While the significance of this downregulation of Sema3A expression in injured PNS neurons is still unclear, it may act as the removal of a "biomolecular brake" on axonal and/or dendritic sprouting, allowing injured neurons to mount a regenerative response and extend axons towards denervated targets to form new synapses (Gavazzi, 2001; Pasterkamp and Verhaagen, 2001). In addition to changes in the neuronal expression patterns of semaphorins, injury to the adult PNS also results in the induction of semaphorin expression in both the degenerating distal nerve stump and in denervated peripheral targets. Following a sciatic nerve injury, Sema3A m R N A is 41 transiently upregulated by terminal Schwann cells at the neuromuscular junction (Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003), while fibroblasts located in the epineurium and perineurium of the degenerating distal nerve stump express a variety of Class 3 semaphorins (Scarlato et al., 2003; Ara et a l , 2004). Although the functional significance of Class 3 semaphorin expression within the degenerating distal nerve stump has not been examined, the finding that injured spinal motoneurons continue to express npn-1 following a sciatic nerve injury suggests that semaphorins expressed along the path of axonal growth could function to conduct regenerating axons to their presumptive targets. In addition, the presence of Sema3A at the neuromuscular junction may serve to stall the growth of regenerating axons at the motor endplate, facilitating the formation of yet more synapses and the mi l re-innervation of peripheral targets (Pasterkamp and Verhaagen, 2001; Scarlato et al., 2003). In general, the evidence outlined from the studies above suggests that alterations in Class 3 semaphorin expression may mediate a number of processes following injury to the adult P N S . While the downregulation in Sema3A m R N A expression in injured PNS neurons may promote axonal and/or dendritic sprouting, the presence of Class 3 semaphorins along the path of regeneration and at peripheral targets may serve to guide axons to their denervated targets and facilitate the formation of new synapses. In contrast to Class 3 semaphorin expression, there is currently only one published study in the literature examining the expression pattern of membrane-associated semaphorins following injury to adult peripherally-projecting neurons (Lindholm et al., 2004). 1.7.5. Conclusion Unlike the mature mammalian C N S , injury to the adult mammalian PNS often results in a robust regenerative response and functional recovery. Semaphorins, expressed by both mature C N S and PNS neurons, as well as by non-neuronal cells following traumatic nervous system injury, are likely to play a significant role in mediating axonal regeneration in the adult mammalian nervous system. Evidence gained from a number of studies has lead to the development of several possible models for the role of semaphorin expression following injury to the mature mammalian nervous system: 42 1. Following axonal injury, the downregulation of Class 3 semaphorin expression in C N S and PNS neurons capable of mounting a regenerative response may serve to remove an intrinsic "biomolecular brake" on axonal regeneration and/or sprouting. 2. Unlike Class 3 semaphorins, following axonal injury, the neuronal expression of at least some Class 4 semaphorins may positively contribute to axonal regeneration. 3. In both the adult mammalian C N S and PNS, trauma results in the expression of multiple chemorepulsive semaphorins at the site of injury. In the injured C N S , semaphorin expression is highest in the post-traumatic glial scar which, due to the highly disruptive physical nature of the scar, may serve as a biochemical barrier to C N S axon regeneration. In contrast, following a peripheral nerve injury, semaphorin expression may occur in highly structured patterns which could serve to guide regenerating axons through the PNS lesion site and the degenerating distal nerves to their denervated peripheral targets. Despite the growing number of studies that are advancing our understanding of the role that semaphorins play in the injured mammalian nervous system, many questions still remain. Although much work has been done in characterizing the physiologically relevant semaphorin-receptor interactions, the binding partners of many semaphorins remain unidentified. Consequently, the intracellular signalling pathways that mediate semaphorin signalling have only recently begun to be identified. Furthermore, even though membrane-associated semaphorins comprise almost two thirds of all identified vertebrate semaphorins, the expression of many of them in the mature vertebrate nervous system and after nervous system injury has not been examined. Thus, a major goal of this thesis was to identify additional semaphorin(s) that could either contribute to the growth inhibitory environment of the adult C N S following injury or, conversely, play a role in the successful regeneration of axotomized PNS neurons. Although a complete analysis of membrane-associated semaphorin expression following injury was beyond the scope of this thesis, during the course of a preliminary R T - P C R study, a PNS neuronal population (facial motoneurons) was observed to upregulate the expression of a transmembrane semaphorin, Semaphorin4F, after axotomy, and thus it was chosen for further study. 43 1.8. S E M A P H O R I N 4 F 1.8.1. Background Semaphorin4F (Sema4F) is a Class 4 semaphorin initially identified during a screen of expression sequence tags from a human brain expression library (Encinas et al., 1999). Subsequently identified in both adult mouse and rat brain c D N A libraries, protein sequence analysis revealed that Sema4F is highly conserved in vertebrates, with mouse and rat forms showing 97% amino acid sequence homology, and both rodent forms having approximately 91% sequence homology to human Sema4F. The rat Sema4F gene encodes an approximately 100 kDa, single-spanning membrane protein of 776 amino acids, composed of a 'Sema' domain, a single immunoglobulin (Ig)-like domain, a transmembrane domain, and a short (89 amino acid long) cytoplasmic domain (Encinas et al., 1999). (Fig. 1.1) In contrast to many class 3 semaphorins that are highly expressed in the developing nervous system but largely down-regulated postnatally, Sema4F expression in the developing embryo is initially restricted to several specific cell populations, but becomes more widespread in the postnatal and adult nervous system. Initial in situ hybridization analysis of the embryonic rat nervous system revealed that at embryonic day 15, Sema4F is expressed by spinal motoneurons, primary sensory neurons, sympathetic ganglia, retinal ganglion cells, and cells surrounding the optic nerve (Encinas et a l , 1999). However, in the adult rat, northern blot analysis revealed that Sema4F m R N A is widely expressed in a variety of both non-neuronal and neuronal structures, including the lung, cortex, cerebellum, spinal cord, olfactory bulb, and hippocampus (Encinas et al., 1999). To date, the role of Sema4F in the embryonic and adult vertebrate nervous system remains unknown. However, as Sema4F m R N A expression is largely confined to the nervous system (and lung) in adult rat, unlike other Class 4 semaphorins, it is unlikely to play a role in modulating immune responses (Encinas et al., 1999). 44 1.8.2. Sema4F Signalling Experiments utilizing an in vitro growth cone collapse assay have revealed that Sema4F possesses the ability to function as a growth cone collapsing factor. Exposure of embryonic day 6 chick retinal ganglion cells to membrane fractions purified from COS-7 cells expressing full-length rat Sema4F is sufficient to induce growth cone collapse in vitro (Encinas et al., 1999). This collapsing activity is maintained even when a truncated form of Sema4F, which lacks both the transmembrane and intracellular domains, is used. This suggests that, at least in culture, the extracellular domain of Sema4F is sufficient to induce growth cone collapse (Encinas et al., 1999). This ability of Sema4F to induce growth cone collapse in retinal ganglion cells, combined with its expression in the developing retina and optic nerve, suggests that it may play a role in the development of the visual system (Encinas et al., 1999). In addition, it has also been reported that Sema4F may act as a weak growth cone collapsing factor for both embryonic chick retinal ganglion neurons and spinal motor neurons in vitro (Encinas et al., 1999). In addition to functioning as ligands, evidence indicates that at least some transmembrane semaphorins possess the ability to initiate intracellular signals through their cytoplasmic domains (Eckhardt et al., 1997; Klostermann et al., 2000; Toyofuku et al., 2004a). Although lacking endogenous intracellular signalling motifs, the intracellular domains of most Class 4 semaphorins, including Sema4F, contain a single PDZ-domain interaction motif (Schultze et al., 2001). PDZ-binding motifs mediate protein-protein interactions and modulate a variety of intracellular processes, including the interaction of cytoplasmic proteins and membrane-bound receptors, and directing intracellular protein trafficking (Ziff, 1997; Boeckers et al., 2002). In addition, they also coordinating synaptic signalling by anchoring and clustering membrane receptors, cell adhesion molecules, cytoskeletal elements and proteins involved in potentiating intracellular signalling cascades (Ziff, 1997; Boeckers et al., 2002). Using a yeast two hybrid system, co-precipitation assays, and a COS-7 cell expression system, Schultz et al., (2001) established that PDZ-binding motif of Sema4F directly interacts with the P D Z domains of P S D -95, a 95 kDa protein found in the postsynaptic density. The postsynaptic density is a specialized electron dense structure located in the postsynaptic membrane of excitatory synapses, that acts to organize postsynaptic signal transduction complexes, coordinate activity-dependent changes in 45 postsynaptic structures, and establishes the topography of the postsynaptic membrane (Ziff, 1997). Immunohistochemical analysis of Sema4F expression in cultured rat hippocampal neurons has revealed that Sema4F can co-localize with both the postsynaptic marker PSD-95 as well as with the presynaptic marker synapsinl (Schultze et al., 2001). This suggests that Sema4F is likely to be localized to synaptic membranes (Schultze et al., 2001). Furthering the possibility that Sema4F may function as a bidirectional signalling molecule is evidence that the intracellular domain of Sema4F contains a single c A M P - and cGMP-dependent protein kinase phosphorylation site (Encinas et al., 1999). Modulation of cyclic nucleotides levels in neurons has previously been shown to mediate the ability of Class 3 semaphorins to function as inhibitory or attractive guidance cues via altering the activation of signal transduction pathways activated following receptor binding (Song et al., 1998; Campbell et al., 2001; Schmidt et al., 2002a; Steinbach et al., 2002; Ayoob et a l , 2004). The existence of a c A M P - and c G M P -dependent protein kinase phosphorylation site suggests that following binding of Sema4F to its receptor(s), cyclic nucleotides could play a role in mediating the activity of downstream signal transduction pathways, and thus the transmission of a Sema4F signal back into the cell on which it is expressed (Encinas et al., 1999). 1.8.3. S e m a 4 F E x p r e s s i o n F o l l o w i n g N e u r o n a l I n j u r y Although the expression of Sema4F in the injured nervous system is largely unknown, recently a study by Lindholm and colleagues reported that Sema4F m R N A is expressed in axotomized rat spinal motoneurons 3 weeks following a ventral funiculus lesion (Lindholm et al., 2004). This lesion paradigm, in which spinal motoneurons are axotomized proximal to their cell bodies, is unique because although up to 50% of lesioned motoneurons die one-three weeks post-axotomy, surviving motoneurons often upregulate a number of R A G s and extend new axonal processes, some of which successfully traverse the C N S lesion site (Linda et al., 1992). While the significance of Sema4F expression in axotomized neurons is unclear, it has been suggested that Sema4F may play a role in the re-establishment of synaptic inputs following injury (Lindholm et al., 2004). Experimental evidence has revealed that, three weeks following a 46 ventral funiculus lesion, surviving spinal motoneurons undergo a reduction in dendritic volume reduction and show a 90% decline in the number of excitatory glutamatergic nerve terminals impinging on motoneuron somata and proximal dendrites (Linda et al., 2000). Given that Sema4F expression is induced during a period of extreme synaptic loss, and that Sema4F may be localized to both pre- and post-synaptic membranes, injured neurons may induce the expression of Sema4F in a response to the loss of synaptic input. It is possible that Sema4F may be expressed in response to axonal injury, and could be linked to the activation of a growth program related to the (re)-establishment of new synaptic connections (Schultze et al., 2001; Lindholm et al., 2004). 47 1.9. S U M M A R Y O F H Y P O T H E S E S A N D O B J E C T I V E S Despite a growing number of studies examining the role that semaphorins play in the developing nervous system, the study of semaphorins in the adult vertebrate nervous system, particularly following neuronal injury, is still in its infancy. Although transmembrane semaphorins can act as axonal guidance cues and are expressed in the adult nervous system, to date, the majority of research into the function of semaphorins following neuronal injury has focused almost solely on secreted semaphorins. Work by the Verhaagen lab and others has shown that expression of Class 3 semaphorins in the injured adult nervous system may either promote or inhibit axonal regeneration depending on the context in which they are expressed. Following a spinal cord injury, the disordered Class 3 semaphorin expression observed in the post-traumatic glial scar may act as a biochemical barrier, preventing semaphorin-sensitive growth cones from traversing the scar site and, thereby, restricting C N S regeneration. In contrast, following a PNS injury, semaphorin expression distal to the injury site and along the path of axonal growth may act to guide regenerating axons to appropriate targets, rather than inhibiting axonal regeneration. In both the mature C N S and P N S , the downregulation of semaphorin expression in neurons able to mount a regenerative response may remove an intrinsic block on axonal growth, allowing injured neurons to mount a regenerative response. Given the lack of knowledge regarding the role of transmembrane semaphorins following nervous system injury, the main objective of my thesis was to examine the n e u r o n a l expression of the transmembrane semaphorin, Sema4F, following either injury to the adult PNS or C N S . In addition, many secreted semaphorins are known to function as axonal guidance molecules during vertebrate embryogenesis, however, the ability of many transmembrane semaphorins to influence axonal outgrowth remains unknown. Thus, I wi l l also attempt to determine whether n o n -neurona l ly expressed Sema4F can function as an in vitro guidance cue for embryonic sensory neurons. In doing so, I hope to open new avenues of research focusing on the ability of membrane-associated semaphorins to mediate both nervous system development as well as axonal regeneration in the mature mammalian nervous system. 48 The objectives of this thesis wi l l be to compare the expression of Sema4F before and after axotomy of PNS and C N S neurons, and to study the ability of Sema4F to act as an age-specific, in vitro guidance cue for rat embryonic D R G neurons. Specifically, I w i l l : 1. Compare the expression of Sema4F in two models of motoneuron injury: Axotomy of rat facial motoneurons (a PNS injury model, pg. 79) versus cervical axotomy of rat rubrospinal neurons (a C N S injury model, pg. 81). I h y p o t h e s i z e t h a t f a c i a l m o t o n e u r o n s w i l l u p r e g u l a t e t h e e x p r e s s i o n o f Sema4F f o l l o w i n g a x o t o m y , w h i l e Sema4F w i l l n o t b e e x p r e s s e d , o r w i l l b e d o w n - r e g u l a t e d i n r u b r o s p i n a l n e u r o n s f o l l o w i n g i n j u r y . (Chapter 3) 2. Compare the expression of Sema4F in two models of sensory neuron injury: Axotomy of peripherally-projecting Dorsal Root Ganglia (DRG) axons (spinal nerve lesion, pg. 114) versus the axotomy of centrally-projecting D R G axons (dorsal rhizotomy, pg. 114). I h y p o t h e s i z e t h a t p e r i p h e r a l l y a x o t o m i z e d D R G n e u r o n s w i l l u p r e g u l a t e t h e e x p r e s s i o n o f Sema4F f o l l o w i n g a x o t o m y , w h i l e Sema4F w i l l n o t b e e x p r e s s e d , o r w i l l b e d o w n - r e g u l a t e d , f o l l o w i n g a d o r s a l r h i z o t o m y . (Chapter 4) 3. Assess the potential of Sema4F to act as a short-range, membrane-bound, guidance cue for rat embryonic D R G neurons in vitro, and determine i f this effect can be modified via inhibition of Rho Kinase ( R O C K ) signalling. I h y p o t h e s i z e t h a t Sema4F w i l l f u n c t i o n as a n i n h i b i t o r y g u i d a n c e c u e f o r r a t e m b r y o n i c D R G n e u r i t e s i n c u l t u r e , g i v e n t h e o b s e r v a t i o n t h a t Sema4F c a n i n d u c e g r o w t h c o n e c o l l a p s e i n e m b r y o n i c c h i c k r e t i n a l g a n g l i o n c e l l s . In addition, given the evidence that activation of RhoA is required to mediate p lex in-Bl signalling, and that Class B plexins can function as a receptor for at least one Class 4 semaphorin, I h y p o t h e s i z e t h a t t h e e f f ec t o f Sema4F o n e m b r y o n i c D R G n e u r i t e s c a n b e i n h i b i t e d b y p h a r m a c o l o g i c a l i n h i b i t i o n o f R O C K . (Chapter 5) . Chapter 2 Methods and Materials 50 2.1. S U R G I C A L T E C H N I Q U E S 2.1.1. Animal Care A l l experimental animal procedures were performed in accordance with the guidelines of the Canadian Council for Animal Care, and approved by the University of British Columbia's Animal Care Committee. Male Sprague-Dawley (Chapter 3; n=96, 225-250 g) and Wistar rats (Chapter 4; h=42, 225-250 g) used in this study were obtained from Charles River Laboratory (Quebec, Canada) or bred within the University of British Columbia animal facility. In addition, pregnant female Wistar rats (n=14) were also obtained from the University of British Columbia animal facility for use in developmental expression studies and axon outgrowth assays (Chapter 5). A l l animals were housed in alternating 12 hour light-dark cycle and provided standard rodent food and water ad libitum. Care was taken to minimize animal stress and discomfort during all phases of these studies. 2.1.2. Anesthetics For all surgical procedures, rats were anaesthetized with an intraperitoneal injection consisting of ketamine hydrochloride (72 mg/kg; Ketalean®, Bimeda-MTC, Cambridge, ON) and xylazine hydrochloride (9 mg/kg; Rompun®, Bayer, Toronto, ON) and monitored regularly to ensure adequate anaesthesia and analgesia. Prior to the start of all surgical procedures, a tear substitute (Tear-Gel®, Novartis Ophthalmics, Mississauga, ON) was applied to the eyes to prevent eye damage. In addition, animals receiving a dorsal rhizotomy or a spinal nerve lesion (Chapter 4) received an additional injection of 0.4 mL of 2% lidocaine with epinephrine (Vetoquinol, Quebec, QC) into the exposed superficial musculature surrounding the spinal column, to minimize post-operative pain and lessen blood flow to the muscle during surgery. 2.1.3. Facial Nerve Resection or Crush Adult Sprague-Dawley rats were anaesthetized (as detailed in 2.1.2) and a small region immediately caudal to the left ear was shaved and sterilized using Betadine® (Purdue 51 Pharmaceuticals, Wilson, N C ) , a 10% providone-iodine solution that functions as a wide spectrum antimicrobial. Next, a small incision in the skin was made, and the underlying muscles carefully separated to expose the left facial nerve. In animals receiving a facial nerve resection injury, the facial nerve was transected immediately distal to its exit from the stylomastoid foramen and a small segment (3-5 mm) of the distal portion of the nerve removed to prevent nerve regeneration. (Figure 2.1) In animals in which the facial nerve was crushed, the nerve was first exposed as described above, and the large branch of the nerve, distal to the first bifurcation, crushed with #5 forceps (Fine Science Tools, Vancouver, B C ) , twice for a period of 5 seconds each. (Figure 2.1) Following surgery, surgical clips (Fine Science Tools, Vancouver, B C ) were used to close all skin incisions and animals placed in a heated cage to prevent hypothermia during the recovery period. At three, seven, fourteen or twenty-one days post injury, animals were injected with a lethal dose (approximately 900 mg/kg) of chloral hydrate ( B D H Chemicals, Toronto, ON) and monitored until loss of nociceptive reflexes was observed. 2.1.4. Rubrospinal Tract Lesion Adult Sprague-Dawley rats were anaesthetized (as described in 2.1.2) and the skin overlying the dorsal cervical region of the spinal cord shaved and sterilized with Betadine® (Purdue Pharmaceuticals, Wilson, N C ) . The head of each animal was secured within a stereotaxic frame and the body placed under light traction to stabilize the spinal column during surgery. Next, using a surgical microscope to visualize the surgical field, a small longitudinal incision was made along the cervical spine, and the underlying muscles split to expose the vertebral column at the cervical C3-C4 level. Then, bone rongeurs (Fine Science Tools, North Vancouver, B C ) were used to perform a small laminectomy, exposing the left side of the dorsal spinal cord. Subsequently, a 26 gauge needle was inserted into the lateral border of the left dorsal horn, medial to the rubrospinal tract, to a depth of approximately two thirds that of the spinal cord, to create a small hole. Into this hole was inserted one blade of a pair of fine iris scissors, which, when closed, cut the left dorsolateral funiculus, severing the rubrospinal tract. (Figure 2.2) The scissors were passed through the incision in the lateral aspect of the cord three times to ensure completeness of the injury. The overlying muscles were then returned to a midline position, and the skin incision closed using surgical clips (Fine Science Tools, Vancouver, B C ) . During the 52 surgical recovery period, animals were placed in a heated cage and monitored. In all cases, injuries were performed on the left side, axotomizing motoneurons located in the right red nuclei. Finally, at three, seven, or fourteen days post injury, animals were sacrificed as described in 2.1.3. 2.1.5. Dorsal Rhizotomy, Spinal Nerve, and Sciatic Nerve Lesions. Adult male Wistar rats were anesthetised (as described in 2.1.2) and the skin overlying the dorsal cervical region of the spinal cord shaved and sterilized with Betadine® (Purdue Pharmaceuticals, Wilson, N C ) . Using a surgical microscope to visualize the surgical field, a small longitudinal incision made along the cervical spine, and the underlying muscles split exposing the left side of the dorsolateral cervical spinal cord. In animals receiving a unilateral dorsal rhizotomy injury, bone rongeurs were used to perform a lateral hemilaminectomy, exposing the left cervical dorsal roots (C5-C8). Fine iris scissors were then inserted into small holes created in the overlying dura, and the dorsal roots transected midway between the D R G body and the spinal cord (-2.5 mm from each). (Figure 2.3) In animals receiving a unilateral spinal nerve axotomy, the left spinal nerves were carefully exposed from C5-C8 and transected at their exit point from the spinal column. A small (~ 5 mm) segment of distal nerve portion was then excised to ensure that all neurons within a particular D R G were axotomized. Finally, in animals undergoing a unilateral sciatic nerve transection, a small longitudinal incision was made along the left thigh, and the sciatic nerve was exposed by splitting the overlying gluteus muscles. Next, the left sciatic nerve was transected at the mid-thigh level and a small segment of distal nerve removed to prevent regeneration. Following all surgeries, wounds were closed in layers using sutures and animals placed into heated cages during the recovery period. Animal used in the dorsal rhizotomy and spinal nerve lesion injury paradigms were sacrificed at three, seven, or fourteen days post injury as described in 2.1.3., while animals which had received a sciatic nerve transection were sacrificed seven days after injury. 53 Figure 2.1. Schematic detailing the rat facial nerve injury models. (A) In the adult rat brain, the facial motoneuron nuclei (grey) are bilaterally positioned on either side of the ventral midline and located directly adjacent to the ventral surface of the brainstem. A line details the trajectory of the facial nerve, which initially projects dorsally, extending around the abducens nucleus (small arrow), before projecting ventrally and exiting the skull via the stylomastoid foramen (large arrow). (B) Lateral view of the primary branches of the rat facial nerve, outlining the two injury models used in this study. In a facial nerve resection injury, the left nerve was transected at its exit point from the skull, the stylomastoid foramen (scissors). This serves to axotomize all primary branches. In a facial nerve crush injury, the left facial nerve was crushed distal to the first bifurcation, which served to lesion all branches with the exception of the posterior auricular. P. A U R : posterior auricular, A . A U R : anterior auricular, Z Y G : zygomatic, B U C : buccal, M A N : mandibular. Images modified after (Kamijo et al., 2003; Moran and Graeber, 2004). Figure 2.1. 54 55 F i g u r e 2.2. S c h e m a t i c o f t h e r a t m i d b r a i n , d e t a i l i n g t h e p o s i t i o n o f t h e r e d n u c l e u s a n d l o c a t i o n o f t h e r u b r o s p i n a l t r a c t i n t h e c e r v i c a l s p i n a l c o r d . Rubrospinal neurons are located within two, distinct, bilaterally positioned nuclei within the rat midbrain (red area). Upon exiting the midbrain, the rubrospinal fibre tracts crossover at the ventral tegmental decussation, prior to entering the spinal cord and extending caudally (blue area) within the dorsolateral funiculus. The red hatched region delineates the approximate size of the injury site within the cervical spinal cord (C3/C4), which encompasses the rubrospinal tract. See text for details of the injury paradigm. Image modified after Kobayashi et al., (1997). Figure 2.2. 56 57 F i g u r e 2 .3 . S p i n a l c o r d c r o s s - s e c t i o n a l s c h e m a t i c , d e t a i l i n g t h e d o r s a l r o o t g a n g l i o n i n j u r y m o d e l s u s e d . (A) In a Dorsal Rhizotomy injury paradigm, resection of the left dorsal roots (C5-C8) results in axotomy of centrally projecting D R G afferents (red arrow). Both peripherally projecting sensory afferents (blue arrows) and motor afferents (green arrows) remain intact. (B) In a Spinal Nerve Lesion injury paradigm, the left peripherally projecting spinal nerves (C5-C8) are transected distal to the D R G body. This injury results in the axotomy of both peripherally extending sensory and motor afferents (red arrows), while sparing the centrally projecting D R G afferents (purple arrow). Figure 2.3. B Spinal Nerve Lesion 59 2.2. T I S S U E C O L L E C T I O N A N D P R O C E S S I N G 2.2.1. Tissue Perfusion and Collection for In Situ Hybridization (ISH) Studies Upon loss of nociceptive reflexes, all animals used in in situ hybridization were immediately transcardially perfused with 200-250 ml of 0 .1M phosphate-buffered saline (PBS) followed by 200-250 ml of ice cold, freshly hydrolyzed 4% paraformaldehyde (pH 7.4). Next, bone rongeurs were used to expose the brain and spinal cord, and the pertinent tissue carefully excised. In all facial nerve injured animals, the cerebellum and underlying brainstem were collected. For animals that underwent facial nerve transection, 5 mm segments of both the proximal and distal injured nerve, as well as the contralateral nerve, were harvested. In animals which received a rubrospinal tract lesion, both the forebrain and spinal cord injury site (including 2 segments rostral and caudal) were collected. Finally, in animals which received a dorsal rhizotomy or spinal nerve lesion, both the spinal cord and D R G s were excised and collected. A l l tissues were then post-fixed in 4% paraformaldehyde overnight at 4°C. Finally, over the course of 2 days, tissue was sequentially cryoprotected in 12%, 18%, and 24% sucrose in 0 .1M PBS, rapidly frozen in dry-ice cooled isopentane, and stored at -80°C. Embryos obtained for D R G in situ hybridization studies were obtained from non-perfused pregnant female rats which had received a lethal overdose of chloral hydrate (as described above). Immediately following the loss of nociceptive reflexes, embryos were extracted and briefly immersed in ice cold, O'.IM phosphate-buffered saline (PBS). Embryos were then post-fixed in 4%> paraformaldehyde overnight at 4°C, cryoprotected (as detailed above), frozen in dry-ice cooled isopentane, and finally stored at -80°C. Postnatal rats used for D R G in situ hybridization studies were also sacrificed using a lethal injection of chloral hydrate, and the entire spinal column with D R G s extracted, post-fixed overnight, and cryoprotected. Prior to freezing, iris scissors and #5 forceps (Fine Science Tools, Vancouver, B C ) were used to excise the spinal cord and D R G s from the spinal column, and four segments (C5-C8), consisting of the spinal cord and associated pair of D R G s , were isolated and frozen as described above . 60 2.2 .2 . T i s s u e P e r f u s i o n a n d C o l l e c t i o n f o r R e v e r s e T r a n s c r i p t i o n P o l y m e r a s e C h a i n R e a c t i o n ( R T - P C R ) a n d W e s t e r n B l o t A n a l y s i s Adult, postnatal, and.embryonic tissue used in Reverse Transcription Polymerase Chain Reaction (RT-PCR) or Western blot studies were obtained as follows. Immediately following a lethal injection of chloral hydrate and loss of nociceptive reflexes, pertinent tissue for each study was harvested from non-perfused animals. In order to isolate facial or rubrospinal nuclei, the brainstem or midbrain was first frozen on dry ice, and then individual nuclei were microdissected from the larger tissue blocks before being transferred to dry-ice cooled microcentrifuge tubes. Facial muscles were microdissected from individual vibrissae within the rat whisker pad, transferred to microcentrifuge tubes and fresh frozen on dry ice for western blot analysis. Similarly, facial nerves used in R T - P C R and western blot studies were also dissected from non-perfused animals, transferred to microcentrifuge tubes and fresh frozen. To facilitate the isolation of the spinal cord injury site for R T - P C R studies, a 2 cm section of rat spinal cord containing the lesion site was first dissected, placed ventral side down on a small square of moistened filter paper, and fresh frozen on dry ice. Using a scalpel blade (No. 11), the lesion site was precisely excised before being transferred to a dry-ice cooled microcentrifuge tube and frozen. For adult D R G studies, both axotomized and uninjured D R G s were dissected out from non-perfused adult animals, briefly immersed in ice cold, 0 .1M P B S to clean them of blood, and transferred to dry-ice cooled microcentrifuge tubes. Finally using a dissecting microscope, thoracic and lumbar D R G s were identified and dissected from non-perfused postnatal and embryonic rats. Dissected D R G s were transferred to an ice-cooled microcentrifuge tube containing 0 .1M P B S . Upon collection of sufficient numbers of D R G s , the microcentrifuge tubes were briefly spun in a centrifuge and the 0 .1M P B S removed. Microcentrifuge tubes containing the D R G s were then fresh frozen on dry ice. A l l tissue collected was stored at -80°C until required. 61 2.2.3. Cryosectioning A l l adult brain and spinal cord tissue used for in situ hybridization studies was mounted rostral side down for axial cutting in a caudal to rostral direction, while facial and sciatic nerves were mounted ventral side down for transverse cutting in a dorsal to ventral direction. Adult PNS and C N S tissue were cut at 14 pm thickness, while embryonic and postnatal tissue was cut at 16 pm, at temperatures ranging between -18 to -23°C. Prior to collecting the tissue sections, all tissue blocks were visually inspected and carefully adjusted to ensure a correct left-right balance. A l l sections were collected onto Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA) , and stored at -80°C until use. 62 2.3 . A N A L Y S I S O F T I S S U E S 2 .3 .1 . In situ h y b r i d i z a t i o n ( I S H ) In situ hybridization was used to examine the expression of Sema4F m R N A following adult neuronal injury as well as in the developing nervous system. This procedure results in the identification of m R N A expression in cells, allowing the researcher to identify changes in gene expression in specific cell types. To speed development times, two radioactivity labelled, 35 base, antisense oligonucleotide probes (Table 2.1) derived from the Sema4F sequence (ascension number NMO19272) were used in combination to detect changes in Sema4F m R N A expression. A Blast search was used to confirm the specificity of the antisense probes, while control (sense) probes were used in order to confirm the specificity of the Sema4F signal. Oligonucleotide probes were end-labelled with [ P]-dATP (Perkin-Elmer, Woodbridge, ON) using a standard deoxynucleotide terminal transferase labelling protocol which adds a radioactive polyA tail to the 3' end (Kobayashi et al., 1997b). A l l probes used in this study possessed a specific activity of at least 500,000 cpm/pl. In order to prevent m R N A degradation, all solutions in the following prehybridization steps were created using diethyl pyrocarbonate (DEPC)-treated water to minimize the presence of RNases. Prior to start to the I S H protocol, slides were removed from -80°C storage and air dried for 5 minutes at room temperature. Sections were then post-fixed in 4% paraformaldehyde for 30 minutes at 4 ° C to ensure uniform tissue fixation, then rinsed twice for 5 minutes each in l x P B S . To improve the ability of oligonucleotide probes to access their m R N A targets within cells, tissue sections were placed in a proteinase K solution (20 pg/ml) for 7.5 minutes. Slides were rinsed 3 times in l x P B S for 5 minutes each, fixed in 4% paraformaldehyde again for 5 minutes and then rinsed twice more in l x P B S . Tissue sections were then dehydrated using a graded series of ethanol, placed in chloroform for 5 minutes to delipidize the sections, back into 100 and 95% Ethanol (EtOH) washes for one minute each, then air-dried at room temperature for 10 minutes. Finally, to each slide, 100 pi of hybridization cocktail containing 1.2 x 106 cpm of labelled oligonucleotides (i.e. two probes; 600,000 cpm/probe) was added. Each ml of hybridization cocktail contained 6 x 10 6 cpm of labelled oligonucleotide #1, 6 x 10 6 cpm of T a b l e 2.1. O l i g o n u c l e o t i d e c o m p o s i t i o n . 63 Oligonucleotide name Oligonucleotide sequence (5' to 3') Oligo size (bases) Sequence A N T I S E N S E S E M A 4 F - a n t l C T T T C A A C C T G C T G G A A A C T G G A C A C A T C A A T A A C 35 Corresponding to bases 541 to 575 of the non-transcribed rat Sema4F sequence SEMA4F-an t2 A C G A C T C T G A G A T A G G C T G T A T C T G T A G T G A C C A G 35 Corresponding to bases 1369 to 1403 of the non-transcribed rat Sema4F sequence S E N S E S E M A 4 F - s e n l G T T A T T G A T G T G T C C A G T T T C C A G C A G G T T G A A A G 35 Corresponding to bases 541 to 575 of the transcribed rat Sema4F sequence SEMA4F-sen2 C T G G T C A C T A C A G A T A C A G C C T A T C T C A G A G T C G T 35 Corresponding to bases 1369 to 1403 of the transcribed rat Sema4F sequence 64 labelled oligonucleotide #2, 200 mg of salmon sperm D N A , and 200 mg t R N A , in a solution of 50% deionized formamide, 10% dextran sulfate, 5x sodium chloride/saline citrate (SSC), 5x Denhardt's solution, and 200 m M dithiothreitol (DTT). Following application of the hybridization cocktail, slides were then coverslipped and incubated in a moist chamber at 45°C for 16-18 hours. After incubation, coverslips were gently removed in a 4x SSC solution and slides washed for 20 minute intervals in solutions of increasing stringency in order to remove excess and non-specifically bound oligonucleotide probe: 2xSSC, three times in l x S S C , 0.5xSSC at 50°C, then two final washes in 0.25xSSC and O. lxSSC at 55°C. Slides were then rinsed in distilled water for 5 minutes, dehydrated in 60% and 95% E t O H , and dried overnight at room temperature. In order to observe the autoradiographic signal, dehydrated slides were dipped in Kodak N T B - 2 photographic emulsion (Kodak Canada, Toronto, ON) diluted 1:1 with double distilled water (ddFbO). Emulsion coated slides were subsequently air dried and stored in light-proof slide boxes at 4°C for 6 weeks (facial nucleus and red nucleus), or 9 weeks (DRGs, facial nerve, and sciatic nerve) to allow for the development of the autoradiography signal. Slides were developed using Kodak D-18 developer (Kodak Canada, Toronto, ON) , and the emulsion stabilized using Kodak Fixer (Kodak Canada, Toronto, ON) . Tissue sections were then counterstained with either 0.01% ethidium bromide (EtBr; to counterstain rubrospinal neurons), or with a fluorescent Nissl stain (Neurotrace, 1:200, Molecular Probes Inc. Eugene, OR; to visualize facial motoneurons and D R G neurons) before being dehydrated in a series of alcohols and coverslipped with Entallen (Fisher Scientific, Nepean, ON) . Processed slides were stored in the dark at -20°C until required. 2.3.2. Analysis of In Situ Hybr id iza t ion Signal A semi-quantitative analysis protocol was used to compare the expression of Sema4F m R N A between injured and uninjured neurons in the facial nucleus, red nucleus, and DRGs . In each study, a minimum of 3 animals were used per time point, with 3 sections per animal analyzed. In order to prevent neurons from being analyzed more than once, tissue sections selected were 65 spaced at least 100 pm apart. Using a digital camera attached to a fluorescent microscope (Carl Zeiss, Axioskop, Toronto, ON) , in combination with Northern Eclipse software (Empix Inc, Mississauga O N , Canada), both fluorescent (EtBr and Neurotrace) images of tissue sections and darkfield images of ISH silver grains were obtained for both injured and contralateral (uninjured) neuronal populations. In order to ensure an accurate comparison, all images were acquired using the same exposure and light intensity settings. SigmaScan Pro ImageAnalysis 5.0 Software (Systat Software, Inc, Point Richmond, C A ) was used to outline individual neuronal cell bodies visible in fluorescent (EtBr and Neurotrace) images, using a criterion in which cells were outlined i f a nucleus or nucleolus could be detected, or i f the cells were at least twice the diameter of an average glial cell. Then, an intensity threshold was applied to the corresponding darkfield ISH image, which was then overlaid on the resulting cell profile layer. Next, the area occupied by the silver grains in each cell profile was measured, and divided by the area of each outlined cell profile, to calculate the percent area occupied by the silver grains (i.e. the silver grain density) for each neuronal soma. For each set of paired images (i.e. axotomized and control), identical intensity thresholds were used. In order to determine the "background" autoradiographic signal, at least 2 regions lacking neuronal or glial cell bodies were circled on each fluorescent image, and the background grain density in each region calculated. Using SigmaPlot 2001 Software, the relative ISH signal for both axotomized and contralateral neurons was then represented in a bar graph as a magnitude of average background signal at each time point (Systat Software, Inc, Point Richmond, C A ) . In addition, raw Sema4F ISH data obtained from the spinal nerve lesion experiment was also graphed using a scatter plot to examine i f changes seen in Sema4F m R N A expression following a peripheral nerve injury were cell-size specific. Data was plotted as a ratio of ISH signal to background signal for each cell examined (signal-to-noise ratio), and the cross-sectional area of each cell as determined using the outlined cell profile. In this study, neurons with an ISH silver grain density greater than 2.5 times background levels were considered to express Sema4F m R N A . For all time points examined, 5 cervical D R G s pairs were analysed, and each graph represents data from approximately 1000 neurons. 66 A l l quantifications were done by an investigator blind with respect to the injury state of the neurons. Statistics were performed using SigmaStat 3.0 (Systat Software, Inc, Point Richmond, C A . ) and all data is presented as the mean ±standard error of the mean (SEM). The data were first subjected to a two-way analysis of variance ( A N O V A ) procedure to compare the factors of Injury (axotomized vs. uninjured) and Days post-injury (Time course). When differences in Sema4F expression were detected, a post-hoc Student's t-test was applied to the average neuronal area covered by ISH signal to determine i f significant differences exist between axotomized and contralateral (uninjured) neurons at specific time points. Finally, a one-way A N O V A was used to determine i f the expression level of Sema4F m R N A in axotomized neurons changes as a factor of time. A probability ofp < 0.05 was considered significant. Finally, all images acquired for the purpose of creating figures were imported into Abode Photoshop 7.0 (Adobe Systems, San Jose, C A , U S A ) , and any alterations made to contrast or brightness levels were applied uniformly to all images. 2.3.3. RT-PCR Using TRIZOL® Reagent (Invitrogen, Burlington, ON) according to the manufacturer's instructions, total R N A was isolated from paired microcentrifuge tubes containing pooled control or injured distal facial nerve (n=3) and cervical spinal cord (n=3) corresponding to the 7 day injury time point in for each model. In order to ensure the presence of a high quality template, an optical density (OD) absorption ratio (OD260nm : OD280 nm) of > 1.7 was required for all isolated R N A . Prior to reverse transcription (RT), samples were first treated with DNase I (Invitrogen, Burlington, ON) before Superscript I reverse transcriptase enzyme (Invitrogen, Burlington, ON) , and non-specific oligo-dT primers were used for first-strand complementary D N A (cDNA) synthesis. Polymerase chain reaction (PCR) for Sema4F was performed using primer sequences for semaphorin 4F located at base pairs 486-507 and 936-957 of the rat semaphorin 4F m R N A sequence, giving a final amplicon size of 471 base pairs (Table 2.2). The amplification program for Sema4F c D N A consisted of 38 cycles of 30 sec at 95°C, 1 min at 48°C and 1 min at 72°C. In 67 order to ensure that an equal amount of input c D N A was analysed, P C R for the rat ribosomal protein S12 (Lin et al. 1987), was also performed using primers corresponding to bases 131-148 and 481-498 of the rat S12 m R N A sequence, giving a final amplicon size of 367 base pairs (Table 2.2). The amplification program for S12 c D N A consisted of 24 cycles of 30 sec at 95°C, 1 min at 54°C and 1 min at 72°C. Serial dilution P C R reactions (25, 12.5, 6.25, and 3.12 ng of c D N A ) were performed in a total volume of 50 wl (Kobayashi et al. 1996). In every R T - P C R , a negative control without c D N A template, as well as a positive control containing c D N A obtained from adult rat cortex (25 ng) was run simultaneously. For each set of samples, the P C R experiment was repeated three times. A l l P C R products were visualized on 2% agarose gels using EtBr. Table 2.2. P r i m e r composition. Target Primer Name Primer Sequence (5' —> 3') Amplicon size (bp) Accession Number Sema4F SEMA4FF CAA TGC CTC TCA CCT CCT CAC G 471 NM019272 SEMA4FR CGT CGT CCA TCT CTG CTG AAG G S12 rRNA S12F CCT CGA TGA CAT CCT TGG 367 NM031709 S12R GGA AGG CAT AGC TGC TGG 68 2.3.4. Western Blot A n anti-Sema4F antibody was obtained from Sumitomo Pharmaceuticals (Japan) via a material transfer agreement. Polyclonal antibodies were raised in rabbits against an N-terminal derived peptide ( F Q Q V E R L E S G R G K C P F ) corresponding to amino acids 162-177 of the rat amino acid sequence of Sema4F (accession number AB002563). This polyclonal Sema4F antibody recognized a 100 k D band along with several smaller molecular weight bands (40, 30, 20, kD). Pre-incubation of the Sema4F antibody with the peptide used for immunization abolished the immunoreactive band present at 100 kD. Based on the correct molecular weight, absorption controls, and changes seen following injury, the 100 k D immunoreactive band was referred to as Sema4F. Western blot analysis was performed on a variety of fresh frozen tissue samples including microdissected facial nuclei (4 nuclei/sample), red nuclei (8 nuclei/sample), cervical (C5-C8) D R G s (6 DRGs/sample), facial nerve (n=3), facial muscle samples (from 3 animals/sample), embryonic D R G s (30-45/sample), and postnatal D R G s (15-25/sample). A l l samples were mechanically homogenized in ice-cold homogenization buffer (50 m M Tr is -HCI (pH 7.4), 1% Triton X-100, 0.25% SDS, 150 m M N a C l , 1 m M N a 3 V 0 4 , 1 m M NaF, containing a protease inhibitor cocktail (Roche, Germany), and protein concentrations determined using a bicinchoninic colormetric acid (BSA) assay (Pierce Chemical Company, Rockford, IL, U S A ) . Aliquots containing 8-30 pg of total protein were subjected to conventional 7.5% sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis, with the separated proteins later transferred onto an Immobilon-P Transfer Membrane (Millipore, Nepean, ON) . Membranes were then incubated in 5% skim milk powder in 0.01M Tris buffered saline with 0.5% Tween-20 (TBS-T) , p H 7.5, at room temperature for 1 hour to block non-specific binding sites, prior to incubation with the anti-Sema4F antibody (1:400 dilution) overnight at 4°C. The following day, membranes were washed in T B S - T and antibody-protein complexes were probed with a horseradish peroxidase-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, P A ; 1:2500 dilution) for 1.5 hours at room temperature. Protein bands were visualized using chemiluminescence (Amersham Biosciences, New Jersey) and exposed to 69 autoradiographic film. (Kodak Biomax, Eastman Kodak Company, Rochester, N Y , U S A ) . Finally, membranes were striped and re-probed with a pan-specific, monoclonal anti-actin antibody ( ICN Biomedicals, Costa Mesa, C A , U S A , #69101; 1:1500 dilution) to verify equal loading of samples. In some cases, high background levels following Sema4F western blotting required that the developed autoradiographic film undergo an additional processing step. I f required, autoradiographic film was briefly washed in Erase-It Background Eliminator Solution (Pierce Biotechnology, Rockford, IL, U S A ) to reduce background signals. 70 2.4. G E N E R A T I O N O F S E M A 4 F E X P R E S S I N G C E L L L I N E S 2.4.1. Construction of Expression Plasmid Rat Sema4F c D N A sequence was obtained through E c o R l digestion of a pBluescript plasmid containing full-length rat Sema4F c D N A (obtained through a transfer agreement with Sumitomo Pharmaceuticals, Japan). This c D N A sequence was subsequently subcloned into a pDisplay mammalian expression vector (Invitrogen, Burlington, Ont) containing a hemagglutinin (HA) tag 3 prime to a signal peptide. Numerous stop codons were added at the end of the Sema4F sequence leading to the expression of full-length, H A epitope-tagged, Sema4F driven by a cytomegalovirus ( C M V ) promoter present on the vector. 2.4.2. Preparation of Cell Lines To generate stable, Sema4F expressing cell lines, recombinant expression plasmids were transfected into H E K 293 cell lines using Lipofectamine™ 2000 (Invitrogen, Burlington, ON). Vacant pDisplay vectors were also used' to transform H E K 293 cells as controls. Stably transfected cells were selected using Geneticin (Invitrogen, Burlington, ON) , and subsequently derived stable cell lines maintained in Geneticin containing D M E M - F 1 2 culture media (Sigma-Aldrich, Oakville, ON) supplemented with 5% fetal bovine serum (FBS). The expression of Sema4F in transfected H E K 293 cells was confirmed by Western Blot analysis using a monoclonal anti-HA antibody (Sigma-Aldrich, Oakville, O N ; for western blots 1:3000 dilution) and the polyclonal anti-Sema4F antibody (1:400 dilution). 71 2.5. T I S S U E C U L T U R E A N D C E L L I S L A N D A S S A Y 2.5.1. Cell Island Preparation To obtain cell islands, Sema4F expressing or control H E K 293 cells were plated at low density onto glass coverslips precoated with a solution of 100 pg/ml poly-L-lysine (Sigma-Aldrich Canada, Oakville, ON) and 100 pg/ml mouse laminin (Chemicon International Inc. Temecula, C A ) . Cells were cultured overnight in D M E M - F 1 2 culture, media (Sigma-Aldrich, Oakville, ON) containing 5% F B S in a humidified 37°C incubator containing a 5% C02/95% air atmosphere, resulting in the formation of multiple cell islands. One hour prior to explanting embryonic D R G s , the D M E M - F 1 2 media was replaced with serum-free Neurobasal medium (Sigma-Aldrich, Oakville, ON) supplemented with B-27 nutrients, glutamine (0.5 mM) , 100 units/ml penicillin/streptomycin and nerve growth factor (NGF) at 20 ng/ml (provided by Regeneron Pharmaceuticals Inc., Tarrytown, N Y ) . 2.5.2. D R G Co-culture Preparation Dorsal root ganglia (DRG) explants were isolated from rat embryos aged 13 and 16 days and obtained in a manner approved by the University of British Columbia Committee on Animal Care. Briefly, pregnant Wistar rats were administered a lethal dose of chloral hydrate and monitored until loss of nociceptive reflexes were observed, at which time embryos were removed and immediately transferred to ice-cold, calcium/magnesium free Hank's Balanced Salt Solution (Invitrogen, Burlington, O N , # 14170-112) containing 0.5% glucose. D R G s were dissected from the embryonic thoracic and lumbar spinal cord and plated (4-6 DRGs/wel l ) onto glass coverslips previously prepared with H E K 293 cell islands. Immediately following the addition of the D R G explants, the Rho kinase ( R O C K ) inhibitor, Y-27632 (Tocris Cookson Ltd. , Avonmouth, Bristol, U K ) , was added to half the wells at a final concentration of 25 u M . Cultures were then placed in a humidified 37°C incubator containing a 5% C02 /95% air atmosphere for 24 hours, at which time cultures were supplied with fresh Neurobasal media and Y-27632. Thirty-six to 48 hours after explanting, cultures were fixed with 3.7% formalin (Fisher Scientific, Nepean, ON) in 0.1 M phosphate-buffered saline (PBS) at room temperature for 10 minutes. 72 2.5 .3 . A n a l y s i s o f N e u r i t e O u t g r o w t h A c r o s s S e m a 4 F - E x p r e s s i n g C e l l s In order to analyze the capacity of Sema4F to influence the extension of embryonic D R G neurites, the ability of neurites to cross control or Sema4F-expressing H E K 293 cell islands was analyzed by comparing neurite density on both the proximal and distal regions of a Sema4F-expressing cell island. Immunohistochemistry was performed using antibodies to P-tubulin (to visualize D R G neurites) and hemagglutinin (HA) (to identify Sema4F-expressing H E K 293 cells). Neurite density was calculated by examining the intensity of immunofluorescence attributed to D R G neurites on both the proximal and distal sides of a H E K 293 cell island. This density measurement, in turn, was used to calculate the ratio of neurites which successfully traverse Sema4F expressing, or control H E K 293 cell islands. This form of analysis was chosen as the density of neurite outgrowth, and degree of neurite fasciculation, from individual D R G explants made it impractical and extremely challenging to count individual neurites. A l l treatment and control images used in this study were obtained by a blinded investigator. H E K 293 cell islands were chosen for analysis based on strict selection criterion. In short, cell islands containing less than 6 cells, and large masses of cells which may act as a physical barrier to neurite outgrowth were rejected for analysis. In addition, cell islands were rejected i f they lay outside a strict positional criteria, namely i f the were located closer than 100 um or further than 700 um from the edge of the D R G explant. This range was chosen to ensure that neurites analysed had sufficient contact with the underlying substratum (laminin and poly-d-lysine) prior to contacting cell islands and were not forced to cross cell islands due to steric pressures, and to ensure that cell islands were not located beyond the periphery of neurite growth. Cell islands not adhering to all of these criteria were excluded from this study. A minimum of three randomly selected cell islands were examined for each D R G explant, with at least 2 explants per sample analyzed. Images were analyzed as follows: Greyscale images of chromophore-labelled D R G neurites were imported into SigmaScan Pro ImageAnalysis 5.0 Software (Systat Software, Inc, Point Richmond, C A ) and a laplace filter applied to each image to enhance neurite edges. Next, an intensity threshold was applied to each neurite image to remove non-specific background signal 73 prior to it being overlaid on the corresponding chromophore-labelled H E K 293 cell greyscale image. Subsequently, two pairs of rectangular boxes of equal size were drawn across the neurite profile, on either side of a cell island of interest. Care was taken to ensure that all boxes created were slightly shorter than the maximum diameter of the cell island being examined, in order to exclude neurites which may have bypassed the lateral edges of the island. (Figure 2.4) Finally using SigmaScan Pro ImageAnalysis 5.0 Software (Systat Software, Inc, Point Richmond, C A ) , the intensity of signal (roughly corresponding to the density of neurites) underlying boxes on either side of an individual cell island was calculated and averaged to obtain a neurite density measurement on either side of a cell island. This data, in turn, was used to obtain the ratio of neurites which successfully cross each cell island. A l l data obtained was analyzed using SigmaStat 3.0 (Systat Software, Inc, Point Richmond, C A . ) and is presented as the mean ± standard error of the mean (SEM) of three independently performed samples for each experimental condition. Data was analysed using both one-way and two-way analysis of variance ( A N O V A ) with a Holm-Sidak post hoc test used to determine significance between different groups. A probability ofp < 0.05 was considered significant. 2.5.4. Immunohistochemistry Following formalin fixation, coverslips were washed three times in 0.01 M PBS before being subjected to a 20 minute blocking step in 1% Bovine Serum Albumin (BSA) in 0.01 M PBS . Cultures were then incubated overnight at 4°C with a monoclonal mouse anti-HA antibody (Sigma-Aldrich, Oakville, O N ; 1:1500 dilution) to identify Sema4F-expressing cells, and a rabbit anti-tubulin antibody (Sigma-Aldrich, Oakville, O N ; 1:600 dilution) to label the D R G neurites, diluted in 0.01 M P B S with 1% B S A . The following day, coverslips were washed three times with 0.01 M P B S with 1% B S A prior to being incubated for 1 hour at room temperature with both an Alexa488-conjugated goat anti-mouse IgG secondary antibody (Molecular Probes Ratio of neurite crossing Signal density Signal density F distal proximal 74 Incorporated, Eugene, Oregon; 1:500 dilution) to visualize the H A immunoreactivity, as well as a Cy3-conjugated sheep anti-rabbit IgG secondary antibody (Sigma-Aldrich, Oakville, O N ; 1:500 dilution) to visualize the tubulin immunoreactivity. Finally, coverslips were washed in 0.01 M P B S and sealed with a 3:1 solution of glycerol:PBS on Superfrost Plus slides (Fisher Scientific, Pittsburgh, P A ) . Using a fluorescent microscope (Carl Zeiss, Axioskop, Toronto, ON) with an attached digital camera (Carl Zeiss, Axioskop, Toronto, ON) , greyscale images of the chromophore-labelled cells were captured using Northern Eclipse software (Empix Inc, Mississauga ON) . For figures, images were imported into Abode Photoshop 7.0 (Adobe Systems, San Jose, C A , U S A ) , axonal and cellular profiles overlaid, and any alterations made to contrast or brightness levels were performed uniformly across both experimental and control images. 75 F i g u r e 2 .4 . A n a l y s i s o f D R G n e u r i t e o u t g r o w t h a c r o s s H E K 2 9 3 c e l l i s l a n d s . H E K 293 cell islands in close proximity to D R G explants were chosen based on strict selection criteria. Cel l islands present at the periphery of neurite outgrowth (arrows) were excluded from the study. ( A ) Left panel: an untransfected H E K 293 cell island (red cells) in close proximity to a D R G explant is chosen and highlighted by the blinded investigator (dashed box). Right panel blinded investigator draws two boxes, all of equal size, on either the proximal (yellow) or distal (blue) side of the cell island, to isolate neurites which contact the cell island. The average signal density (corresponding to the underlying neurites) was calculated for both the proximal and distal side of the associated cell islands, and the ratio of neurite crossing obtained. (B) Process in (A) is repeated on using D R G s co-cultured with Sema4F-expressing cell islands (green cells), to ascertain the ability of Sema4F to modify outgrowth of embryonic D R G neurites. 76 F i g u r e 2.4. 77 Chapter 3 Sema4F is Highly Expressed in Axotomized Adult Rat Facial Motoneurons, But Not in Non-Regenerating Rubrospinal Neurons A version of this chapter will be submitted for publication. Oschipok L W , McPhail LT, Liu J, Spinelli ED, Teh J, Kimura T, O'Connor T, Tetzlaff W. Differential expression of Semaphorin4F in axotomized CNS versus PNS neurons. (In preparation) 78 3.1. C H A P T E R O V E R V I E W Following injury to the adult rat olfactory tract, newly generated olfactory receptor neurons upregulate the expression of several Class 4 semaphorins during a time associated with axonal growth and the formation of new synaptic connections (Williams-Hogarth et al., 2000). In this chapter, I used two rodent models of nervous system injury to evaluate the expression of the Class 4 semaphorin, Sema4F, in regenerating and non-regenerating neurons. Specifically, I compared the expression of Sema4F in axotomized adult rat facial motoneurons following a facial nerve injury, a P N S injury model that often results in the regeneration of lesioned axons to peripheral targets (Moran and Graeber, 2004), to expression in injured rubrospinal neurons (RSNs) following axotomy of the rubrospinal tract, a C N S injury model in which injured axons typically fail to regenerate (Tetzlaff et al., 1994). Using ISH and Western blot analysis, I determined that Sema4F expression in uninjured facial motoneurons is very low, and is not detectable in uninjured rubrospinal neurons. However, following a facial nerve crush injury, a significant increase in Sema4F m R N A was detected in axotomized facial motoneurons, with m R N A levels reaching maximum levels approximately seven days post-injury before gradually declining thereafter. In addition, 14 days following nerve crush, Sema4F protein levels peak in the distal degenerating facial nerve, a time course that correlates with the onset of reinnervation of peripheral targets by regenerating facial axons. When facial nerve regeneration was prevented by removing a small segment of the distal nerve stump (nerve resection), the increase in Sema4F expression in axotomized facial motoneurons was even more pronounced at 7 days post-injury. Furthermore, unlike after a facial nerve crush, following a facial nerve resection Sema4F levels remained elevated over time. In contrast, axotomized rubrospinal neurons do not express detectable levels of Sema4F following a cervical spinal cord injury. Finally, although semaphorin expression has been detected in both the spinal cord injury site (De Winter et al., 2002b) and within degenerating distal nerves following a PNS tract lesion (Scarlato et al., 2003; Ara et al., 2004), no Sema4F m R N A expression was detected at either site in this study. Instead, following a cervical spinal cord injury, low levels of Sema4F expression were detected in neurons located in the ventral spinal cord. 79 These results reveal that Sema4F expression is upregulated in at least one peripherally-projecting neuronal population that can undergo successful axonal regeneration following injury. Thus, while the semaphorins have been generally regarded as repulsive guidance cues in the injured adult vertebrate nervous system, the observed pattern of Sema4F expression in facial motoneurons following axotomy and their successful regeneration suggests that this particular semaphorin may instead promote or facilitate axonal regeneration. 80 3.2. I N T R O D U C T I O N 3.2.1. Neuronal Expression of Semaphorins Following Injury As outlined in the background chapter (Section 1.7), after an injury to the mature vertebrate nervous system, a number of semaphorins with known chemorepulsive properties are expressed by non-neuronal cells located within the C N S astrogliotic scar or within degenerating peripheral nerve stumps (Pasterkamp et al., 1999b; De Winter et al., 2002b; Scarlato et al., 2003; Ara et al., 2004). More importantly, many adult neuronal populations (both PNS and CNS) express semaphorin receptors following injury (Pasterkamp et al., 2001; de Wit and Verhaagen, 2003; Spinelli, 2006). Thus, regenerating axons belonging to these neuronal populations may respond to, and are likely influenced by semaphorins found in the surrounding PNS or C N S cellular environment after injury. Often overlooked during investigations into injury-induced semaphorin expression in the adult nervous system is the fact that, in addition to semaphorin receptors, several neuronal populations also express secreted (Class 3) and transmembrane (Class 4) semaphorins (Williams-Hogarth et al., 2000; Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003). While the significance of Class 4 semaphorin expression in adult neurons is unclear, studies of neuronal Class 3 semaphorin expression suggest that, in uninjured neurons, their release may serve to prevent maladaptive structural remodelling of mature synapses (Steup et al., 2000; Gavazzi, 2001; Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003). Following neuronal injury, the expression of many of these secreted semaphorins is down-regulated in neurons with a strong regenerative potential. Thus, it has been proposed that this loss of semaphorin expression may serve to remove an intrinsic inhibitor to axonal and/or dendritic growth, allowing injured neurons to mount a regenerative response (Gavazzi, 2001; Pasterkamp and Verhaagen, 2001; Barnes et al., 2003). Unlike the secreted Class 3 semaphorins, very few studies have focused on injury-induced changes in the neuronal expression of membrane-associated semaphorins in the adult vertebrate nervous system. Interestingly, studies of several neuronal populations that mount a successful 81 regenerative response after injury have shown that these neurons upregulate the expression of several Class 4 semaphorins (Williams-Hogarth et al., 2000; Lindholm et al., 2004). This suggests that, in contrast to Class 3 semaphorins, an increase in Class 4 semaphorin expression in injured neurons may correlate with the initiation of a regenerative response and the regrowth of injured axons. 3.2.2. The Facial Motoneuron Model of PNS Injury Although a variety of in vivo injury models have been used to study regeneration in the adult vertebrate P N S , one of the most common is the rodent facial nerve axotomy model (Moran and Graeber, 2004). The facial nerve is a motor axon fibre tract that originates in the facial nucleus, a well defined motoneuron population ventrolaterally located within the brainstem that receives afferent inputs from a variety of midbrain, metencephalon, and brainstem structures (Watson et al., 1982; Semba and Egger, 1986; Hattox et al., 2002). Although facial motoneurons are located in the C N S , their axons project peripherally, exiting the skull via the stylomastoid foramen and innervating the facial musculature (Watson et al., 1982; Semba and Egger, 1986). The manner in which the facial nerve leaves the skull allows for easy surgical access and nerve transection without disruption to the C N S blood-brain barrier (Streit and Kreutzberg, 1988). Finally, adult facial motoneurons are a useful model for the study of the cell body response to injury, as axotomy results in the induction of a robust cell body response in facial motoneurons, which, depending on the severity of the injury, can culminate in the regeneration of lesioned axons and the re-innervation of peripheral targets (Tetzlaff et al., 1991; Fernandes and Tetzlaff, 2000; Moran and Graeber, 2004). In this study, I have utilized two types of facial nerve injury, nerve resection and nerve crush, to study the expression of Sema4F in axotomized rat facial motoneurons. While both injury paradigms result in the transection of peripherally-projecting facial axons and the stimulation of a robust cell body response in facial motoneurons, these injuries differ in both lesion severity and regenerative outcome, as described below. i 82 3.2.2.1. R e s e c t i o n o f t h e A d u l t R a t F a c i a l N e r v e A nerve t r a n s e c t i o n is defined as a nerve injury in which the axons and connective tissue (endoneurium, perineurium, and epineurium) comprising the nerve sheath are completely severed, resulting in the total disruption in the continuity of the fibre tract. In basic terms, one simply cuts the nerve into two segments. In the nerve r e s e c t i o n injury paradigm, the nerve is not only cut, but a small intercalary segment of nerve is actually removed, so as to create a gap of a few millimeters between the distal and proximal nerve stumps. In the nerve transection model, the distal and proximal nerve stumps may end up apposed to one another and allow, in theory, regenerating axons to traverse the injury site and extend towards their targets. In the nerve resection model, however, the distal and proximal nerve stumps are separated by a gap, thus conceptually preventing such regeneration. Resection of the adult rat facial nerve completely axotomizes all affected motoneurons, and results in the development of an ipsilateral facial nerve palsy characterized by the loss of eyelid movement and spontaneous vibrissae movement (Mattsson et al., 1999; M c G r a w et al., 2002). Although resection of the facial nerve results in a strong cell body response in axotomized facial motoneurons, the inability of regenerating axons to bridge the lesion site prevents functional regeneration from occurring, resulting in the permanent loss of peripheral target innervation (Tetzlaff et al., 1991; Mattsson et al., 1999). 3.2.2.2. C r u s h I n j u r y o f t h e A d u l t R a t F a c i a l N e r v e In a facial nerve crush injury paradigm, forceps are used to crush the facial nerve, completely severing the underlying facial motor axons and resulting in the development of a facial nerve palsy on the afflicted side. Although this injury model also results in a strong cell body response in axotomized rat facial motoneurons, unlike a resection injury, a crush injury largely spares the overlying connective tissue of the nerve sheath (Tetzlaff and Bisby, 1989; Tetzlaff et al., 1991). The preservation of this overlying connective tissue provides a continuous conduit for regenerating axons, allowing regenerating facial axons to traverse the injury site and reinnervate of peripheral muscle targets (McGraw et al., 2002; Tomov et al., 2002; Kamijo et al., 2003). Thus, unlike resection of the facial nerve, following a facial nerve crush, facial axons successfully re-establish functional connections with denervated peripheral targets, a process that 83 results in the return of eyelid movement and voluntary vibrissae movement, often within several weeks of injury (McGraw et al., 2002). 3.2 .3 . T h e R e d N u c l e u s a n d the R u b r o s p i n a l N e u r o n M o d e l o f C N S I n j u r y The red nucleus is a distinct, ovoid, group of neurons (rubrospinal neurons) located bilaterally within the midbrain tegmentum of limb-using vertebrates (Kennedy et al., 1986; Huigrok and Cella, 1995). In rodents, as is the case with the majority of lower vertebrates, rubrospinal neurons are divided into two subpopulations based on size and position in the nucleus. Larger, magnocellular neurons which contribute the majority of axons that form the descending rubrospinal tract are ventromedially located in the caudal two-thirds of the red nucleus, while smaller parvocellular neurons which contribute relatively few fibres to the rubrospinal tract are dorsomedially located within the rostral one-third of the nucleus (Murray and Gurule, 1979; Kennedy et al., 1986; Strominger et al., 1987). Although rubrospinal neurons receive the majority of their afferent input from the cerebellum, a variety of other regions also innervate the red nucleus, including the cortex, posterior thalamic, and dorsal raphe nuclei (Huigrok and Cella, 1995). Emerging from the ventromedial aspect of the red nucleus, the vast majority of rubrospinal axons which form the rubrospinal tract cross at the level of the tegmental decussation prior to descending the spinal cord within the dorsolateral funiculus (Brown, 1974; Strominger et al., 1987). Although the rubrospinal tract descends the length of the spinal cord, the majority of rubrospinal axons terminate within laminae 5, 6, and 7 of the cervical cord (Huisman et al., 1982; Huigrok and Cella, 1995). There, most rubrospinal axons form synaptic connections with excitatory or inhibitory interneurons, although a few extend into the ventral horn, forming direct rubro-motoneuronal connections (Kuchler et al., 2002). A s with the facial nucleus, the rubrospinal system in rodents possesses several characteristics that make it a useful model system for the study of regeneration in the mature vertebrate C N S . Located entirely within the C N S , rubrospinal neurons are an easily identifiable neuronal population that, like facial motoneurons, can be successfully isolated for molecular and 84 biochemical analysis. In addition, the dorsolateral position of the rubrospinal tract in the spinal cord allows researchers to selectively transect the tract on one side of the cord while leaving the contralateral tract intact and able to serve as an internal control. In rodents, a cervical lesion of the rubrospinal tract results in the impairment of motor control in affected limbs, including alterations in the initiation and execution of goal directed or skilled forelimb movement as well as in locomotion (Houk et al., 1988; Whishaw et al., 1992; Whishaw and Gorny, 1996; Mui r and Whishaw, 2000; Webb and Muir , 2003). In addition, this injury results in the induction of some R A G expression in injured rubrospinal neurons. However, unlike axotomized facial motoneurons, this up-regulation in rubrospinal neurons is weak and largely transient, which contributes to the failure of axonal regeneration (Kobayashi et al., 1997b; Fernandes and Tetzlaff, 2000; Plunet et al., 2002). In this study, a cervical dorsolateral hemisection of the C3/C4 cervical cord was used to completely axotomize the left rubrospinal tract. This lesion model was used over other less severe injury paradigms (i.e. dorsal column crush model or weight drop model) in order to ensure that all spinally-projecting rubrospinal neurons for the affected nuclei were lesioned. A less severe injury model would potentially lead to the sparing of some rubrospinal axons, and result in a mixed population (i.e. injured and non-injured neurons) in the affected rubrospinal nuclei, which would influence the ISH analysis. In summary, the facial nerve crush injury model is one in which successful axonal regeneration does occur, while in contrast, the rubrospinal cervical injury model is one in which successful regeneration does not occur. This contrast provides an opportunity to evaluate the expression of Sema4F in each injury model, with the goal of elucidating how Sema4F might influence the phenomenon of axonal regeneration. 85 3.3. OVERVIEW OF THE EXPERIMENTAL QUESTION AND HYPOTHESIS Given the dearth of knowledge regarding the expression of membrane-associated semaphorins in injured mature vertebrate neurons, the goal of this study was to examine the expression of the transmembrane semaphorin, Sema4F, in axotomized rat rubrospinal neurons following a cervical spinal cord lesion (a C N S injury model), in axotomized rat facial motoneurons following either a nerve crush injury or a nerve resection injury (a PNS injury model), and in the rat spinal cord lesion site to test the following hypotheses: 1. Although Sema4F has been shown to possess growth cone collapsing properties (Encinas et al., 1999), studies have shown that several Class 4 semaphorins, including Sema4F, are expressed in neurons able to mount a regenerative response following injury to the adult vertebrate nervous system (Williams-Hogarth et al., 2000; Lindholm et al., 2004), / hypothesize that facial motoneurons, which can successfully regenerate lesioned axons following axotomy, will upregulate the expression of Sema4F in response to injury, while rubrospinal neurons will not express or will down-regulated Sema4F expression after injury. To test this hypothesis, animals received either a unilateral facial nerve crush or resection injury (to axotomize peripherally projecting facial axons), or a left dorsolateral hemisection of the cervical spinal cord (to unilaterally axotomize the centrally projecting rubrospinal tract). A combination of in situ hybridization and Western blot analysis was then used to examine the expression of Sema4F in both uninjured and axotomized facial motoneurons and rubrospinal neurons. 2. Following injury to the adult mammalian spinal cord, a number of known chemorepulsive semaphorins are expressed in the post-traumatic glial scar (De Winter et al., 2002b) as well as in the surrounding white matter (Moreau-Fauvarque et al., 2003). Given the evidence that Sema4F can cause growth cone collapse in at least one neuronal population (Encinas et al., 1999), / hypothesize that, following a cervical spinal cord injury, Sema4F will be expressed by cells within the spinal cord lesion site. To test this hypothesis, cervical spinal cords from uninjured animals, as well as from animals that had received a left dorsolateral hemisection of the cervical spinal cord were 86 collected, and subjected to R T - P C R and in situ hybridization analysis to examine the expression of Sema4F in the normal and lesioned spinal cord. 3. Given that a number of chemorepulsive semaphorins are expressed in the degenerating distal nerve following a PNS lesion (Scarlato et al., 2003; Ara et al., 2004), I hypothesize that Sema4F will be expressed within the degenerating distal facial nerve following transection of the nerve. To test this hypothesis, R T - P C R and in situ hybridization analysis was performed on segments of uninjured facial nerve, or segments of distal, degenerating facial nerve obtained 7 days following a facial nerve transection. 87 3.4. R E S U L T S 3.4 .1 . F a c i a l M o t o n e u r o n s U p r e g u l a t e Sema4F m R N A E x p r e s s i o n a f te r F a c i a l N e r v e C r u s h Using two, 35-mer oligonucleotide probes, in situ hybridization (ISH) was used to quantify Sema4F m R N A expression in adult rat facial motoneurons (FMNs) 3, 7, 14, and 21 days following a unilateral facial nerve crush. Very low levels of Sema4F ISH signal were found over normal F M N s (not shown) or over motoneurons in the contralateral facial nucleus (Fig. 3.1; left panels), while no glial expression was detected, even when autoradiographic exposure was increased to 8 weeks. Using a two-way A N O V A , analysis of Sema4F m R N A expression revealed that both axotomy (F (1, 29) = 104.01, p < 0.001) and the number of days following nerve crush (F (1, 29) = 11.62, p < 0.001) had a significant effect on the expression of Sema4F m R N A in F M N s . In addition, I detected a statistically significant interaction between these two factors (Injury vs. Time course; F (1, 29) = 8.82,/? < 0.001). Post-hoc analysis using Student's t-tests revealed that 3 days following a facial nerve crush, Sema4F m R N A expression in axotomized F M N s (n = 4 animals) was found to be significantly higher when compared to contralateral, uninjured F M N s (p < 0.001, t-test). (Table 3.1 and Fig . 3.1) Seven days after injury (n = 4 animals), Sema4F m R N A levels in injured F M N s remained significantly elevated when compared to uninjured, contralateral neurons (p = 0.002, t-test). (Table 3.1 and Fig. 3.1) In the adult rat, regeneration of facial motor axons following a nerve crush can be qualitatively tracked by observing both the return of spontaneous vibrissae movement (Lyons et al., 1995; McGraw et al., 2002). When the facial nerve is crushed distal to the stylomastoid foramen, the return of vibrissae movement is typically observed 2 weeks following injury, with near normal function typically seen 4 weeks after injury (Terao et al., 2000; McGraw et al., 2002). In this study, daily qualitative observation revealed that all animals observed had regained at least partial vibrissae movement beginning 12 days after nerve crush. Even so, Sema4F m R N A levels remained significantly elevated in regenerating F M N s 14 days following injury (n = 4 animals,/? = 0.002, t-test). (Table 3.1 and Fig . 3.1) When the expression of Sema4F m R N A in axotomized F M N s was analyzed, the results revealed a significant decrease in Sema4F expression over the 21 day experimental time course (F = 11.28,/? = 0.05, one-way A N O V A ) . B y 21 days following 88 nerve crush, Sema4F m R N A expression in axotomized neurons had declined, but was still statistically different than control (contralateral) expression levels (n = 4 animals, p = 0.003, t-test). (Table 3.1 and F ig . 3.1) ISH performed using sense oligonucleotide probes revealed only background autoradiographic signal over axotomized F M N s at any time point tested (data not shown). 3.4.2. Facial Motoneurons Upregulate the Expression of Sema4F after Facial Nerve Resection Next, ISH was used to examine the expression of Sema4F in F M N s 3, 7 and 14 days following a unilateral facial nerve resection, an injury which stimulates a strong cell body response in axotomized motoneurons, but also creates a large gap which prevents motor axons from reinnervating their target muscles. Analysis of the Sema4F ISH data revealed that resection of the facial nerve results in a significant increase in Sema4F m R N A expression in F M N s (F (1, 17) = 31.55, p < 0.001, two-way A N O V A ) . Unlike after a facial nerve crush, the number of days following nerve resection did not significantly affect Sema4F m R N A expression in F M N s (F (1, 17) = 2.69, p = 0.11, two-way A N O V A ) , and no significant interaction between Injury and Time course was observed (F (1, 17) = 2.23, p = 0.15, two-way A N O V A ) . Post-hoc analysis using t-tests revealed that 3 days following facial nerve resection, Sema4F m R N A levels are significantly elevated in axotomized facial motoneurons when compared to contralateral, uninjured motoneurons (n = 3 animals, p = 0.02, t-test). (Table 3.1 and Fig . 3.2) Seven days following facial nerve resection, Sema4F m R N A expression continues to be statistically higher in injured, compared to contralateral, uninjured F M N s (n = 3 animals,/? = 0.03, t-test). (Table 3.1 and Fig. 3.2) Interestingly, unlike a facial nerve crush, following a facial nerve resection Sema4F m R N A expression continues to rise, with levels approximately doubling between 3 and 7 days post-injury. Fourteen days following nerve resection, no recovery of ipsilateral whisker movement was observed in any animals, verifying that, in contrast to a facial nerve crush, facial motor axons failed to regenerate towards peripheral muscle targets following nerve resection. Quantification of Sema4F m R N A levels revealed that 14 days following nerve resection, Sema4F m R N A expression remained significantly elevated in axotomized F M N s when compared to motoneurons of the contralateral, uninjured side (n = 3 animals, p = 0.03, t-test). 89 (Table 3.1 and Fig . 3.2) Finally, analysis of Sema4F m R N A expression in axotomized F M N s revealed no significant decline in Sema4F expression over the 14 day experimental time course (F = 2.51,/? = 0.162, one-way A N O V A ) . Finally, Sema4F Western blot analysis was performed on total protein samples (10 pg per lane) isolated from micro-dissected control and injured facial nuclei (n = 4) obtained 7 days following facial nerve resection. In contrast to the robust up-regulation of Sema4F m R N A expression observed in axotomized facial motoneurons following nerve resection, Western blot analysis revealed a much smaller up-regulation in Sema4F protein in injured compared to contralateral uninjured facial nuclei 7 days following a facial resection injury. (Fig. 3.2) 3.4.3. Sema4F I m m u n o r e a c t i v i t y i n t h e D e g e n e r a t i n g D i s t a l F a c i a l N e r v e a n d D e n e r v a t e d M u s c l e A s only a relatively small increase in Sema4F protein levels was observed in the axotomized facial nucleus, I next used Western blot analysis to examine Sema4F protein levels in the degenerating distal facial nerve following a unilateral facial nerve crush. This was done in order to investigate whether the distal facial nerve, containing regenerating axons of axotomized F M N s , contained significant levels of Sema4F protein. The distal-most regions of the mandibular and buccal branches of the facial nerve (approximately 1 cm segment) were carefully microdissected from the connective tissue overlying the whisker pads on both the injured and uninjured sides 7, 14, or 21 days after nerve crush. Western blot analysis for Sema4F was performed on total protein (30 pg per lane) pooled from micro-dissected control and injured distal facial nerve (n = 3). Comparison of Sema4F protein levels in distal injured, and uninjured, contralateral facial nerve revealed an increase in Sema4F protein in the degenerating distal facial nerve, 14 days following nerve crush, a time course that parallels the onset of functional recovery. (Fig. 3.3) Twenty-one days following facial nerve crush, Sema4F protein levels in the injured distal nerve had declined to contralateral levels, mirroring the decline in Sema4F m R N A levels observed in axotomized F M N s 3 weeks post-injury. (Fig. 3.3) 90 To determine i f peripheral muscle targets of facial motor axons express Sema4F protein, Western blot analysis for Sema4F was performed using total protein isolated from facial muscles which normally control vibrissae movement located within the rat whisker pad. Western blot analysis was performed on total protein samples (30 pg per lane) obtained from uninjured and denervated vibrissae muscles (approximately 20 muscles per sample) micro-dissected from the rat whisker pads 7 days following a facial nerve crush. Results reveal no expression of Sema4F protein in either normal, injured muscle, or in denervated muscle 7 days after facial nerve crush. (Fig. 3.3) 3.4 .4 . Cells Within the Normal or Degenerating Facial Nerve Do Not Express Sema4F m R N A Following a peripheral nerve injury, the axotomized distal nerve stump undergoes Wallerian degeneration, a process characterized by the degeneration and clearance of distal axonal stumps and the proliferation of denervated Schwann cells which express a number of molecular components to establish an environment permissive for axonal regeneration (Bunge, 1993; Fu and Gordon, 1997). In addition, fibroblasts located in the basal lamina of the distal nerve stump express a number of Class 3 semaphorins (Scarlato et al., 2003; Ara et al., 2004). Therefore, using a combination of in situ hybridization and serial dilution R T - P C R I examined whether cells in the adult rat facial nerve express Sema4F m R N A and i f facial nerve axotomy alters Sema4F m R N A expression in the degenerating distal facial nerve. In situ hybridization performed on longitudinal sections of contralateral, uninjured facial nerve and degenerating distal facial nerve stumps obtained 7 days following a facial nerve resection injury revealed no Sema4F m R N A expression in either the normal uninjured, or degenerating distal facial nerve. (Fig. 3.4) Next, serial dilution R T - P C R analysis was performed on total R N A obtained from 1 cm segments of normal, uninjured and degenerating distal facial nerve stumps collected 7 days following a facial nerve resection injury. Similar to the ISH data, R T -P C R detected no expression of Sema4F m R N A in either the normal, uninjured facial nerve or in the degenerating distal nerve stump 7 days following facial nerve resection. (Fig 3.4) 91 3 . 4 . 5 . Rubrospinal Neurons Do Not Express Detectable Levels of Sema4F m R N A ISH was used to quantify Sema4F m R N A expression in rubrospinal neurons 3, 7, and 14 days following a dorsolateral hemisection of the cervical (C3/C4) spinal cord. ISH revealed only very low levels of Sema4F ISH signal over uninjured rubrospinal neurons in the contralateral red nucleus. (Fig. 3.5; left panels) In contrast to the considerable increase in Sema4F m R N A expression observed in F M N s following nerve injury, no significant change in Sema4F m R N A levels were detected in axotomized rubrospinal neurons 3, 7 or 14 days (n = 4 animals per time point) following a unilateral cervical rubrospinal tract axotomy (F (1,17) = 1.78,/? = 0.21, two-way A N O V A ) . (Table 3.1 and Fig. 3.5) Although the histogram of Sema4F m R N A expression in F ig 3.5 suggests a small downregulation of Sema4F m R N A in axotomized rubrospinal neurons 3 days post-injury, this change is not significant (n = 4 animals, p = 0.362, t-test) and may result from a slight hypertrophy detected within injured neurons at that time point (data not shown). To confirm that Sema4F expression in uninjured and axotomized rubrospinal neurons is below detectable levels, Western blot analysis was performed on total protein (8 pg per lane) pooled from micro-dissected uninjured and injured red nuclei (n = 8) obtained 7 days following a rubrospinal tract lesion. Western blot analysis confirms that Sema4F is not expressed in the normal, uninjured red nucleus, and no up-regulation in expression is detected following rubrospinal tract axotomy. (Fig 3.5) 3.4 .6 . Sema4F m R N A Expression in the Injured Adult Rat Spinal C o r d Results of several studies have revealed that, following a spinal cord transection, cells in the injured adult rodent spinal cord express a number of known chemorepulsive Class 3 semaphorins (Pasterkamp et al., 1999a; Pasterkamp et al., 2001; De Winter et al., 2002b). In addition, a study by Lindholm et al, (2004) revealed that, following a ventral funiculus lesion of the adult rat spinal cord, axotomized spinal motoneurons upregulate the expression of Sema4F m R N A . Therefore, I utilized serial dilution R T - P C R to examine Sema4F m R N A expression in both the injured and uninjured adult rat spinal cord. Serial dilution R T - P C R analysis was performed on 92 total R N A samples obtained from normal, uninjured rat cervical spinal cord (C3/C4), as well as on samples obtained from micro-dissected spinal cord lesion sites 7 days following a dorsolateral hemisection of the cervical (C3/C4) spinal cord (n = 3). R T - P C R revealed that Sema4F m R N A is not expressed in the normal, uninjured cervical spinal cord or in the spinal cord lesion site following a unilateral dorsolateral hemisection of the cervical spinal cord. (Fig 3.6) Although, to date, no Class 4 semaphorins have been detected in the spinal cord lesion site, following transection of the adult mouse thoracic spinal cord, at least one Class 4 semaphorin (Sema4D), is strongly upregulated in oligodendrocytes immediately surrounding the spinal cord lesion site (Moreau-Fauvarque et al., 2003). As Sema4F m R N A was absent within the spinal cord lesion site, I next used ISH to determine i f transection of the adult rat spinal cord was sufficient to induce Sema4F expression in cells surrounding the periphery of a spinal cord injury site. Seven days after cervical axotomy, ISH confirmed that Sema4F m R N A is not expressed by cells in the spinal cord lesion site, or by glia located rostral or caudal to the spinal cord lesion site (data not shown). Instead, following spinal cord injury, ISH revealed that neurons present in the ipsilateral ventral horn expressed low levels of Sema4F m R N A . (Fig. 3.6) Qualitative analysis revealed that not all neurons in the ipsilateral ventral horn expressed Sema4F following spinal cord transection. Instead, Sema4F m R N A expression was restricted to a subpopulation of atrophied neurons, located immediately adjacent to the C N S lesion site. A n examination of Sema4F m R N A expression in the ventral horn, both rostral and caudal to the spinal cord lesion site, revealed no increase in Sema4F m R N A expression. 93 Table 3.1. Summary of Sema4F expression in facial and rubrospinal neurons. Following a facial nerve crush injury, facial nerve resection injury, or lesion of the rubrospinal tract, the profiles of each neuronal cell body (in both the injured and uninjured nuclei) were outlined, and the area occupied by the silver grains in each cell profile was quantified and compared to the average background ISH grain density on each section. Results are represented as a magnitude of average background signal at each time point (i.e. times greater than background) and is presented as the mean ±standard error of the mean (Mean ± S.E.M.). Days Post Injury Facial Nerve Crush Facial Nerve Resection Rubrospinal Tract Lesion Uninjured Injured Uninjured Injured Uninjured Injured 3 3.8 ± 0.4 15.8 ±1.3 3.3 ± 0.4 14.4 ±2.0 2.6 ± 0.5 1.8 ±0.3 7 2.7 ± 0.3 14.3 ±1.8 4.4 ± 1.2 33.6 ± 7.5 2.7 ± 0.2 2.4 ± 0.2 14 3.6 ± 0.4 9.7 ± 1.2 3.9 ± 1.9 28.1 ± 5.5 2.7 ± 0.4 2.4 ± 0.3 21 2.5 ± 0.5 4.3 ±0.7 N/A N/A N/A N/A 95 F i g u r e 3.1. Sema4F m R N A e x p r e s s i o n is t r a n s i e n t l y u p r e g u l a t e d i n f a c i a l m o t o n e u r o n s f o l l o w i n g a f a c i a l n e r v e c r u s h . ( A ) Darkfield micrographs of Sema4F ISH signal in axotomized facial nuclei 3, 7, 14, and 21 days after a facial nerve crush. For each pair of horizontal panels, the left hand image corresponds to Sema4F m R N A expression in uninjured motoneurons, while the right hand images correspond to Sema4F m R N A expression in axotomized facial motoneurons following a facial nerve crush. Three days following a facial nerve crush, Sema4F m R N A expression is considerably higher in injured compared to uninjured, contralateral motoneurons (top panels). Sema4F m R N A levels remain elevated 7 days post-injury (second panels), but begin to decline 14 (third panels) and 21 days (bottom panels) post injury, a time course corresponding to the onset of re-innervation of denervated muscle targets by regenerating facial axons. (Scale bar = 50pm) (B) A t 3, 7, 14, and 21 days following a facial nerve crush injury, Sema4F m R N A expression is significantly greater in axotomized (crush) facial motoneurons when compared to contralateral, uninjured, motoneurons (p < 0.001, p = 0.002, p = 0.002, and p=0.003, respectively). A Student's t-test was used to compare Sema4F m R N A expression levels between injured and uninjured neurons at each time point. (** Indicates p < 0.005) F i g u r e 3.1. A uninjured crush B 25 •o c o 20 ra 15 S3 w a s - 10 ra c CT) CO uninjured crush ** it iL ** i I ** 3 7 14 21 days post lesion 97 F i g u r e 3.2. Sema4F e x p r e s s i o n f o l l o w i n g a f a c i a l n e r v e r e s e c t i o n i n j u r y . (A) Darkfield micrographs of Sema4F ISH signal in axotomized facial nuclei 3, 7, and 14 days after a facial nerve resection. For each pair of horizontal panels, the left image corresponds to Sema4F m R N A expression within uninjured F M N s , while the right hand images corresponds to Sema4F m R N A expression in axotomized F M N s following nerve resection. Three days following a resection injury, Sema4F m R N A expression is considerably higher in injured compared to uninjured, contralateral motoneurons (top panels). Sema4F m R N A levels remain elevated 7 (middle panels) and 14 (bottom panels) days post injury when compared to uninjured, contralateral motoneurons. (Scale bar = 50pm) (B) Graph detailing changes in Sema4F m R N A levels in facial motoneurons following a nerve resection injury. Quantification of Sema4F m R N A expression 3, 7 and 14 days following axotomy shows that Sema4F m R N A expression is strongly upregulated in axotomized facial motoneurons, and this remains significantly higher compared to uninjured, contralateral facial motoneurons (p = 0.02, p = 0.03, and p = 0.03, respectively). A Student's t-test was used to compare Sema4F m R N A expression levels between injured and uninjured motoneurons at each time point. (* Indicates p < 0.05) (C) Sema4F protein expression was analyzed by Western blot from protein samples obtained from pooled facial nuclei. Seven days after facial nerve resection, a slight increase in Sema4F protein levels were observed in protein extracts obtained from axotomized facial nuclei. Total protein obtained from 4 facial nuclei was pooled and run in both lanes containing injured (axo) and uninjured (con) facial nuclei. Protein obtained from adult rat cortex was used as a positive control (right lane), while an antibody to total actin was used to confirm that equal amounts of total protein obtained from injured (axo), and uninjured (con) facial nuclei was used. Western blots were performed using three different protein samples obtained from pooled facial nuclei, and the blot shown is representative of the results obtained from all experimental blots. 98 Figure 3.2. B uninjured resection 50 C 40 2 30 i 2 0 c O l 5 10 uninjured * resection 3 7 14 days post lesion Sema4F Actin 99 F i g u r e 3.3. Sema4F i m m u n o r e a c t i v i t y i n t h e d e g e n e r a t i n g d i s t a l f a c i a l n e r v e a n d d e n e r v a t e d f a c i a l m u s c l e f o l l o w i n g a f a c i a l n e r v e c r u s h . (A) Western Blot analysis for Sema4F was performed on total protein samples (n = 3) obtained from pooled injured (axo), and uninjured (con) distal facial nerve samples acquired 7, 14 and 21 days following a facial nerve crush injury. In all lanes containing contralateral, uninjured facial nerve samples (7d con, 14d con, 2Id con), little to no Sema4F protein was detected. Seven days following facial nerve crush, no obvious increase in Sema4F protein is detected within the degenerating distal nerve (7d axo). Fourteen days following facial nerve crush, a visible increase in Sema4F protein levels is detected in the regenerating distal facial nerve (14d axo). B y 21 days following nerve crush Sema4F protein within the injured distal nerve had declined (2Id axo) to contralateral, uninjured levels. The arrow identifies the Sema4F immunoreactive band, while an antibody to total actin was used to confirm equal loading of protein samples. Western blots were performed using protein obtained from three different protein samples, and the blot shown is representative of the results obtained from all experimental blots. (B) Western blot analysis of Sema4F protein levels in normal, uninjured (con), and denervated (axo) vibrissae muscles, obtained 7 days following facial nerve crush. Results reveal that Sema4F protein is not detected in either normal, uninjured muscle or in denervated muscle, 7 days following a facial nerve crush injury. A n antibody to total actin was used to confirm that equal amounts of total protein obtained from uninjured (con), and denervated (axo) vibrissae muscles were used. Western blots were performed using three different protein samples obtained from uninjured or denervated muscle, and the blot shown is representative of the results obtained from all experimental blots. F i g . 3.3. 100 101 Figure 3.4. Sema4F m R N A is not expressed in the normal or degenerating facial nerve. Seven days following a facial nerve resection, longitudinal sections of contralateral, uninjured facial nerve (A-C) and degenerating distal facial nerve stumps (D-F), were subjected to in situ hybridization for Sema4F m R N A . In each horizontal series of images, the leftmost image consists of a bright-field micrograph of either an uninjured nerve (A), or the degenerating distal nerve stump (D). The middle panels (B, E) are dark-field micrographs of Sema4F ISH signal in control (B) or degenerating distal facial nerve (E). Rightmost images (C-F) are overlays of bright-field and dark-field images to detect the presence or absence of Sema4F ISH signal in nerve segments. Sema4F m R N A signal was not detected in the uninjured facial nerve (A-C) nor in degenerating distal nerve (D-F). The red signal co-localizing with the connective tissue surrounding the nerves in C and F are artifacts from tissue processing and does not represent m R N A signal. The tissue sections in A and D were stained with haematoxylin-eosin. (Scale bar = 100 pm) ( G ) Serial dilution R T - P C R analysis of Sema4F m R N A expression in uninjured (contralateral) facial nerve and in degenerating distal facial nerve (axotomized) 7 days following a nerve resection injury. R T - P C R confirmed that Sema4F m R N A expression is absent in both the normal, uninjured facial nerve, as well as in the degenerating distal nerve stump 7 days after axotomy. Serial dilution R T - P C R for the ribosomal component protein SI2, performed as an internal loading control, revealed a slight increase in SI 2 m R N A levels in the axotomized distal nerve stump; this increase did not affect the experimental results. See section 2.3.3 for details of c D N A amounts used. [(+) = positive control for Sema4F expression in adult rat cortex. (-) = negative control containing no c D N A . ] Fig. 3.4. 102 103 F i g u r e 3.5. Sema4F m R N A is n o t d e t e c t e d i n u n i n j u r e d o r a x o t o m i z e d r u b r o s p i n a l n e u r o n s . ( A ) Darkfield micrographs of Sema4F ISH signal in rubrospinal neurons 3, 7, and 14 days following a dorsolateral hemisection of the cervical (C3/C4) spinal cord. For each set of horizontal panels, the leftmost image corresponds to Sema4F m R N A expression within uninjured rubrospinal neurons, while middle panels depict Sema4F m R N A expression in axotomized rubrospinal neurons. Rightmost images are fluorescent images of ethidium bromide stained neurons underlying the ISH signal present in the middle panels. Expression of Sema4F m R N A is not detected in contralateral, uninjured rubrospinal neurons (left panels). A t all time points examined, Sema4F m R N A expression was not detected in axotomized rubrospinal neurons (right panels). (Scale bar = 50pm) (B) Graph depicting changes in Sema4F m R N A levels in rubrospinal neurons following axotomy. Quantification of Sema4F mRNA expression in rubrospinal neurons following 3, 7, or 14 days following axotomy reveals no significant difference in Sema4F m R N A when compared to contralateral, uninjured neurons (p = 0.362, p = 0.398, and p = 0.607, respectively). A Student's t-test was used to compare Sema4F m R N A expression levels between injured and uninjured neurons at each time point. (C) Western blot analysis for Sema4F protein expression in rubrospinal neurons. Seven days after cervical axotomy, the results reveal that Sema4F protein expression is not detected in either injured (axo) or uninjured (con) rubrospinal neurons. A n antibody to total actin was used to confirm that equal amounts of total protein obtained from injured (axo), or uninjured (con) rubrospinal neurons were loaded. Western blots were performed using three different protein samples obtained from injured (axo) or uninjured (con) rubrospinal neurons, and the blot shown is representative of the results obtained from all experimental blots. 105 F i g u r e 3.6. Sema4F m R N A is n o t d e t e c t e d w i t h i n t h e s p i n a l c o r d l e s i o n s i te , b u t is e x p r e s s e d b y n e u r o n s i n t h e i p s i l a t e r a l v e n t r a l h o r n 7 d a y s a f t e r c e r v i c a l a x o t o m y . ( A ) Serial dilution R T - P C R analysis of Sema4F m R N A expression in uninjured cervical spinal cord and in the spinal cord lesion site. R T - P C R reveals that Sema4F m R N A is non-detectable in the uninjured, cervical spinal cord (uninjured), as well as from the spinal cord lesion site (lesion site), 7 days following a cervical axotomy. Serial dilution R T - P C R for the ribosomal component protein SI2, performed as an internal loading control, revealed that equal, amounts of c D N A were loaded. See section 2.3.3 for details of c D N A amounts used. [(+) = positive control for Sema4F expression in adult rat cortex. (-) = negative control containing no c D N A . ] (B) Sema4F m R N A expression in neurons of the ventral horn. ISH was performed on transverse sections of uninjured (top row; uninjured) or injured (bottom row; axotomized) cervical spinal cord 7 days after axotomy. Sema4F m R N A expression was not detected in the ventral horn of the uninjured spinal cord. However, 7 days after cervical axotomy, Sema4F m R N A expression is detected in neurons present in the ipsilateral ventral horn. For both horizontal series of images, the leftmost image consists of a fluorescent Neurotrace® image used to identify neuronal cell bodies. Middle panels are false coloured darkfield micrographs of Sema4F ISH signal over uninjured or injured (axotomized) neurons with arrows indicating the position of underlying neurons. Finally, right hand images are overlays of brightfield and darkfield images, showing the colocalization of Sema4F ISH signal. (Scale bar = 100pm). 106 Fig. 3.6. 107 3.5. D I S C U S S I O N 3.5.1. Summary Unlike the adult vertebrate P N S , very little structural and functional regeneration occurs following injury to the adult vertebrate C N S (Schwab and Bartholdi, 1996; Selzer, 2003). While a combination of both intrinsic and extrinsic factors is likely to underlie this difference in regenerative potential following axonal injury, a major determinant to successful neuronal regeneration is the ability of injured neurons to mount a strong cell body response. Although the underlying molecular mechanisms are only partly understood, following axotomy, peripherally-projecting neurons (such as facial motoneurons) often upregulate the expression of a number of R A G s known to promote to axonal growth (Tetzlaff et al., 1991; Bisby and Tetzlaff, 1992; Tetzlaff et al., 1994; Fernandes and Tetzlaff, 2000). In contrast, R A G expression is often weaker and more transient in injured C N S neurons, and this frequently correlates with an abortive growth response and the absence of significant regeneration (Plunet et al., 2002). A major focus of the field of neuronal regeneration is not only to identify those R A G s most responsible for promoting axonal regeneration in the injured adult P N S , but also to identify previously unrecognized R A G s that may also promote PNS regeneration. A number of studies suggest that, following injury to the adult vertebrate PNS or C N S , changes in the spatial and temporal expression patterns of a number of Class 3 semaphorins can directly influence the success or failure of axonal regeneration in these systems (Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003). Following injury to the mature C N S , the presence of a number of known chemorepulsive Class 3 semaphorins within the C N S injury site is thought to contribute to the inhibitory nature of the post-traumatic glial scar (Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003). In addition, a variety of adult PNS and C N S neurons express Class 3 semaphorins, and following axonal injury, successful regeneration of lesioned axons may hinge on the ability of neurons to down-regulate semaphorin expression (Gavazzi, 2001; Pasterkamp and Verhaagen, 2001; de Wit and Verhaagen, 2003). Although the above evidence is still largely correlative, taken together, it implies that the expression of semaphorins is, in general, detrimental to the regeneration of axotomized adult neurons. 108 Here, I have examined the post-axotomy changes in Sema4F m R N A and protein expression in the adult rat facial nucleus and facial nerve, and in the red nucleus and spinal cord. Although Sema4F expression is not detected in the spinal cord lesion site 2 weeks following a cervical spinal cord injury, neurons within the ventral spinal cord do express Sema4F at this time. The results of my study have revealed that adult facial motoneurons, which possess a strong regenerative propensity following injury, significantly upregulate Sema4F expression following axotomy. In contrast, axotomized rubrospinal neurons, a neuronal population which fails to regenerate following injury, does not express detectable levels of Sema4F following injury. Taken together, these observations suggest that the expression of Sema4F in axotomized adult vertebrate neurons may correlate with regenerative potential of the injured neuronal population. 3.5.2. Sema4F Expression is Upregulated by Neurons of the Ventral Spinal C o r d Following a Cervical Spinal C o r d Lesion. Following injury to the mature mammalian spinal cord, cellular components of the post-traumatic glial scar express a number of Class 3 semaphorins (De Winter et al., 2002b). In contrast, the results of this study have shown that Sema4F m R N A is not expressed by cells in the post-traumatic glial scar. This absence of Sema4F expression is not unique, since there are no published reports of Class 4 semaphorin expression in the C N S glial scar, although Sema4D is expressed by oligodendrocytes following a spinal cord transection (Moreau-Fauvarque et al., 2003). This suggests that, unlike Class 3 semaphorins, Class 4 semaphorins are unlikely to contribute to the non-permissive nature of the C N S neural scar to axonal regeneration. Despite the fact that Sema4F expression was not detected in the spinal cord lesion site, neurons of the ipsilateral ventral horn were observed to express Sema4F m R N A , one week following a cervical spinal cord injury. This finding was somewhat expected, since during the course of this study, a second group independently reported a significant increase in Sema4F m R N A expression in axotomized spinal motoneurons 3 weeks following a ventrolateral funiculus lesion of the adult rat spinal cord (Lindholm et al., 2004). In the present study, I was unable to visually confirm the identity of the Sema4F-expressing neurons observed'in the injured spinal cord, because of the large lesion size and the wide area of secondary damage. Furthermore, 109 immunohistochemistry could not be used to determine the identity of the neurons because of the tissue processing required for I S H analysis. Nonetheless, the overall morphology and location of these neurons within the ventral horn indicates that they are likely spinal motoneurons. The transection of the ventrolateral funiculus is a unique C N S injury model, since the injury results in the intraspinal axotomy of spinal motoneurons, which are often able to mount a robust regenerative response, like that commonly observed after a peripheral axonal injury (Cullheim et a l , 1999; Cullheim et al., 2002). A s observed with facial motoneurons, the cell body, dendrites and most proximal axon segment of spinal motoneurons are located in the C N S , while the majority of the axon is peripherally located, and extends through the ventral roots and peripheral nerves towards targets in the peripherally. Although Lindholm and colleagues (2004) did not examine the function of Sema4F in axotomized spinal motoneurons, the authors noted that Sema4F has been shown to co-localize with both pre- and post-synaptically targeted proteins at the sites of synaptic contact between cultured hippocampal neurons (Schultze et al., 2001). Since the time course of Sema4F expression in intraspinally axotomized spinal motoneurons correlates with a reduction in dendritic field observed in axotomized spinal motoneurons (Linda et al., 2000), the authors suggested that Sema4F may function in the re-establishment of dendritic synaptic contacts following axonal injury (Lindholm et al.,' 2004). This hypothesis is supported by evidence that other members of the Class 4 semaphorin sub-family are expressed in both the developing rodent olfactory system, as well as following axotomy of the adult olfactory tract. In both the developing and regenerating systems, newly generated ORNs upregulate the expression of three Class 4 semaphorins (Sema4A, 4B, and 4C) during stages of axonal extension and synaptogenesis (Williams-Hogarth et al., 2000). Unlike the Lindholm et al. (2004) study, in which an increase in Sema4F expression was observed 3 weeks after a ventrolateral funiculus lesion, in the present study, an increase in Sema4F m R N A expression was detected as early as 1 week after a dorsolateral hemisection injury. (Figure 3.6) This difference in the temporal expression patterns of Sema4F observed in these two studies may be attributed to several differences between these two injury models. First, unlike in the ventrolateral funiculus injury used by Lindhom and colleagues (2004), following a dorsolateral hemisection, a large region of secondary damage is observed to extend 110 beyond the initial injury site, and the increase in the severity of the lesion may accelerate the initiation of Sema4F expression seen in this injury model. In addition, Lindholm and colleagues observed an increase in Sema4F expression in injured spinal motoneurons following intraspinal axotomy. However, in my study, it is unknown i f the up-regulation in Sema4F expression observed in our model is in response to a direct lesion to dendritic processes, or due to the exposure of the neurons to neurotoxic compounds originating from the initial injury site (i.e. secondary damage). Despite the fact that the up-regulation in Sema4F expression observed in my injury model was much more rapid than that observed by Lindholm and colleagues, the results of this study expand on the investigations of Lindholm et al., (2004) by demonstrating an up-regulation in Sema4F m R N A expression in motoneurons of the adult rat spinal cord following a traumatic injury. 3.5.3. E x p r e s s i o n o f Sema4F i n R e g e n e r a t i n g N e u r o n s . Following injury to the adult rubrospinal tract, axotomized rubrospinal neurons are unable to mount and maintain a robust cell body response, resulting in the failure of functional regeneration to occur (Tetzlaff et al., 1991; Fernandes et al., 1999; Fernandes and Tetzlaff, 2000). M y analysis of Sema4F m R N A and protein expression in rubrospinal motoneurons revealed that, unlike injured spinal motoneurons, axotomized rubrospinal motoneurons do not express Sema4F. This differential gene expression between the two injury models is not unique to Sema4F. The intensity of R A G expression often varies in different injured neuronal populations, with increased levels often correlating with an increased regenerative potential (Fernandes and Tetzlaff, 2000; Cullheim et a l , 2002; Plunet et al., 2002). Unlike injured rubrospinal neurons, following a crush injury to the facial nerve, Sema4F m R N A expression is rapidly induced in axotomized adult facial motoneurons, and reaches its highest level 7 days after injury. (Fig. 3.1) Although Sema4F expression remains significantly elevated for at least 3 weeks.after injury, in general^ Sema4F expression begins to decline towards control levels 2 to 3 weeks after crush injury. This temporal expression pattern, in turn, closely corresponds to the time course of axonal regeneration and the restoration of whisker function (Terao et al., 2000; M c G r a w et al., 2002). Unlike the time course of Sema4F expression seen in I l l axotomized facial motoneurons following a nerve crush, resection of the facial nerve, which prevents functional recovery from occurring, resulted in Sema4F m R N A expression remaining highly elevated throughout the time course of the experiment. (Figure 3.2) In the adult vertebrate nervous system, injury to peripherally-projecting neurons induces changes in the expression of a number of genes implicated in neuronal survival, neurotransmission, and axonal growth (Fernandes and Tetzlaff, 2000; Plunet et al., 2002; McGraw et al., 2004). Although the exact mechanisms driving Sema4F expression in axotomized facial motoneurons are still unknown, it is interesting to note that Sema4F expression in injured facial motoneurons closely parallels that of G A P - 4 3 , which is considered to be an important R A G (Tetzlaff et al., 1991; Benowitz and Routtenberg, 1997). The expression of GAP-43 is highly upregulated in PNS neurons after axonal injury or the disruption of axonal transport, both of which act to interrupt the retrograde transport of target-derived factor(s) produced in peripheral muscle targets (Woolf et al., 1990; Bisby and Tetzlaff, 1992; W u et al., 1993; Fernandes and Tetzlaff, 2000). In addition, expression of G A P - 4 3 , like Sema4F, is low in uninjured adult facial motoneurons, but becomes significantly elevated in response to axonal injury. A s well , after axotomy, the expression of both Sema4F and GAP-43 declines following the re-innervation of distal muscle targets by regenerating axons, but remains elevated i f functional recovery is prevented (Tetzlaff et al., 1991; Lyons et al., 1995; Fernandes and Tetzlaff, 2000). These correlative observations suggest that the up-regulation of Sema4F expression seen after injury may be due, in part, to a response to the loss of target derived factors(s) present in distal muscle targets. Although not addressed in this study, it is possible that, in addition to the loss of target-derived factor(s), the presence of factors expressed within the lesion site could also influence the expression of Sema4F in injured facial motoneurons. Following a PNS nerve injury, Schwann cells in the injury site and in the degenerating distal nerve stump express numerous cytokines and neurotrophic factors, that, when taken up by injured axons and, retrogradely transported to the neuronal cell body, stimulate changes in gene expression, and promote axonal regeneration (Zigmond et a l , 1996; Matsuoka et al., 1997; Naveilhan et a l , ,1997). 112 3.5.4. P o s s i b l e F u n c t i o n s o f S e m a 4 F i n R e g e n e r a t i n g N e u r o n s A n increasing number of studies have revealed that individual semaphorins are likely to have a number of different functions in the developing and mature mammalian nervous system, and these functions are, in part, dictated by spatial and temporal expression patterns. Several members of the Class 4 semaphorin sub-family, including Sema4F, have been shown to induce growth cone collapse in embryonic neuronal populations, which suggests that they may function as chemorepulsive axonal guidance cues (Encinas et al., 1999; Moreau-Fauvarque et al., 2003; Oinuma et al., 2004). Therefore, although it was somewhat unexpected to observe an up-regulation of Sema4F expression in regenerating motoneurons, my results would suggest that neuronally-expressed Sema4F plays a different and still unidentified role in axotomized neurons. 3.5.4.1. A s a P o s t s y n a p t i c a l l y L o c a l i z e d P r o t e i n A possible function for neuronally-expressed Sema4F comes from a study by Schultze and colleagues (Schultze et al., 2001), which identified a direct interaction between the P D Z domains of Sema4F and PSD-95. PSD-95 is a neuronally expressed protein located in the postsynaptic membrane of glutamatergic synapses which interacts with the glutamate N M D A receptor subunit, N R 2 A , as well as a number of other cytoplasmic and membrane bound proteins (Ziff, 1997; Tezuka et a l , 1999; Boeckers et al., 2002). In cultured rat hippocampal neurons, immunohistochemistry has revealed that Sema4F co-localizes with both PSD-95 and the presynaptic marker synapsin-1 at glutamatergic synapses (Schultze et al., 2001). Although this evidence is only correlative, it suggests that neuronally-expressed Sema4F may play a role in the formation or maintenance of synaptic connections (Schultze et al., 2001). Despite this in vitro evidence, it is currently not known i f Sema4F interacts with PSD-95 and N R 2 A and whether it plays a role in the formation or maintenance of glutamatergic synapses upon axotomized facial motoneurons. Evidence for such a hypothesis comes from the finding that both' PSD-95 and N R 2 A are expressed in uninjured facial motoneurons (Che et a l , 2000; Eleore et al., 2005). Although a decline in PSD-95 m R N A expression is detected after a facial nerve injury, both PSD-95 and N R 2 A immunoreactivity in the neuronal somata and proximal 113 dendrites of axotomized facial motoneurons remains unchanged (Che et al., 2000; Eleore et al., 2005). While only a small increase in Sema4F protein expression was detected within the injured facial nucleus in my study (Fig. 3.2), it is possible that, unlike Sema4F m R N A expression, any increase in Sema4F protein levels that may occur at the level of the cell soma and dendrites could be too small to be detected using Western blot analysis. This may be a result of the rapid anterograde transport of Sema4F protein down lesioned axons, or because of the inherent limitations of Western blotting to detect small changes in in vivo protein expression due to a dilution effect that can occur with the inclusion of non-relevant micro-dissected tissue. Thus, it is possible that Sema4F could interact with PSD-95 and N R 2 A at postsynaptic membranes in axotomized facial motoneurons. Furthermore, it is possible that Sema4F could interact with other extrasynaptic PDZ-domain-containing proteins following a facial nerve axotomy. One potential binding partner may be GAIP-interacting protein, C terminus (GIPC), a PDZ-domain containing scaffold protein that plays a role in the clustering of transmembrane receptors and intracellular signalling molecules, as well as in modulating vesicular trafficking (Lou et al., 2001; Jeanneteau et al., 2004). Highly expressed in the mature nervous system, GIPC has been shown to interact with at least two members of the Class 4 semaphorin subfamily (Cai and Reed, 1999; Wang et a l , 1999; Burkhardt et al., 2005). Although the expression of GIPC in facial motoneurons has not yet been investigated, it is possible that it could act to localize Sema4F to postsynaptic membranes in axotomized facial motoneurons. Following axotomy, adult mammalian facial motoneurons undergo alterations in the density of afferent synaptic input to their dendritic fields. A s early as one day after injury, the density of synaptic contacts on the somata and dendrites of axotomized facial motoneurons increases to a level three-fold higher than that seen on uninjured neurons (Ikeda and Kato, 2005). However, this initial increase in the number of synaptic contacts is not maintained, as 5 days following a facial nerve transection, the number of synaptic contacts on axotomized facial motoneurons significantly declines, as evidenced by the decrease in staining for the presynpatic marker synaptophysin, and the downregulation in the expression of a number of excitatory glutamatergic A M P A and N M D A receptor subunits (Gehlert et al., 1997; Eleore et al., 2005; Ikeda and Kato, 2005). This loss of glutamate receptor expression in axotomized facial motoneurons is most evident approximately one week after injury, a time course that coincides with the highest levels 114 of Sema4F m R N A expression. (Fig. 3.1, 3.2) One week following axonal injury, A M P A and N M D A receptor expression begins to return to pre-injury levels (Eleore et al., 2005), mirroring a gradual restoration in the density of afferent input and the downregulation in Sema4F expression levels. Therefore, in axotomized facial motoneurons, the up-regulation of Sema4F expression observed coincides with rapid changes in the synaptic inputs on the somata and proximal dendrites of injured neurons, with the highest levels of Sema4F occurring during the time in which the greatest loss of afferent input is occurring. Finally, unlike facial motoneurons, following a cervical spinal cord lesion, axotomized rubrospinal spinal neurons show only minor alterations in the density of synaptic inputs on their somata and dendritic fields, as observed by their continued expression of glutamatergic receptor subunits (Wang et al., 2002; Wang and Tseng, 2004a, b). This lack of reduction in synaptic density is mirrored by the absence of Sema4F expression in axotomized rubrospinal neurons observed in Chapter 3. 3.5 .4 .2 . A s a P r e s y n a p t i c a l l y L o c a l i z e d P r o t e i n Evidence for an alternative role for Sema4F expression in axotomized facial motoneurons may come from the observations of Sema4F protein expression following a facial nerve crush. Following a facial nerve crush, an increase in Sema4F protein was detected in the distal facial nerve during a stage in which regenerating facial axons have begun to reach their denervated muscle targets. (Fig. 3.3) Sema4F has previously been reported to co-localize with synapsinl, a presynaptic phosphoprotein associated with presynaptic vesicles (Schultze et al., 2001). Given the fact that synapsinl is associated with the neuromuscular junction (NMJ) (Wang et al., 1995; L u et al., 1996), it is possible that in axotomized facial motoneurons, Sema4F protein may be anterogradely transported down regenerating axons and become localized to the presynaptic membrane, where it could play a role in the reestablishment of the new synaptic contacts. Although there is still no conclusive evidence that Class 4 semaphorins play a role in synapse formation in vertebrates (Williams-Hogarth et al., 2000), at least one semaphorin has been implicated in synapse formation in the developing invertebrate nervous system. Semala is a transmembrane semaphorin highly expressed in neurons of the developing Drosophila nervous 115 system (Godenschwege et al., 2002). Thought to be required for the proper formation of synapses at the neuromuscular junction, in the developing Drosophila nervous system, Semala is localized to the presynpatic membrane of developing motoneurons where it is thought to interact with an as yet unidentified muscle-derived ligand (Godenschwege et al., 2002). It is possible that, in the developing and adult vertebrate nervous system, Sema4F could play a similar role to Semala in Drosophila. Following axonal injury, the expression of Sema4F in axotomized facial motoneurons, may be related to the re-establishment of synapses at the neuromuscular junction through an interaction with a still unidentified muscle-derived ligand. This concept wi l l be explored further in Chapter 6. 3.5.5. Conclusion This study demonstrates that in the adult rodent nervous system, injury to PNS and C N S neurons results in different spatial and temporal expression patterns of Sema4F. Given the in vitro evidence that Sema4F is localized to synaptic membranes,, it is possible that, in axotomized facial motoneurons, Sema4F is targeted to pre- or post-synaptic membranes in response to the loss of contact with peripheral muscle targets. Although the function of Sema4F in axotomized neurons remains unknown, its expression in neurons with a strong regenerative potential suggests that, in contrast to Class 3 semaphorins, Sema4F expression in regenerating neurons may contribute to successful axonal regeneration, synaptogenesis, or the re-establishment of synaptic input following injury. 116 Chapter 4 Expression of Sema4F in Axotomized Adult Dorsal Root Ganglion Neurons and Spinal Motoneurons A version of this chapter will be submitted for publication. Oschipok LW, McPhail LT , Liu J, Spinelli ED, Teh J, Kimura T, O'Connor T, Tetzlaff W. Differential expression of Semaphorin4F in axotomized CNS versus PNS neurons. (In preparation) 117 4.1. C H A P T E R O V E R V I E W In the previous chapter, I described the up-regulation of Sema4F expression in adult rat facial motoneurons, but not rubrospinal neurons, after axonal injury. In this chapter, I wi l l use in situ hybridization to examine the expression of Sema4F in adult rat D R G neurons following either a spinal nerve resection or a dorsal rhizotomy. Following resection of the spinal nerve, a significant increase in Sema4F m R N A expression was detected in axotomized D R G neurons. In contrast, after a dorsal rhizotomy, axotomized D R G neurons did not express Sema4F m R N A . In addition to lesioning peripherally-projecting D R G neurons, resection of the spinal nerve also results in the axotomy of peripherally-projecting spinal motoneurons. In situ hybridization revealed that, although spinal motoneurons also upregulate the expression of Sema4F m R N A in response to axotomy, this expression is delayed, and is only first observed 14 days after injury. Sema4F m R N A expression was absent in the uninjured adult rat sciatic nerve, although Sema4F may be expressed in the degenerating distal sciatic nerve, 7 days after a sciatic nerve resection injury. These results build on my conclusions in the previous chapter, by identifying additional peripherally-projecting neuronal populations that upregulate Sema4F expression in response to axonal injury. 118 4.2 . I N T R O D U C T I O N 4 . 2 . 1 . U s e o f D R G N e u r o n s as a M o d e l o f N e u r o n a l I n j u r y The dorsal root ganglion (DRG) is a well defined swelling of the dorsal root containing the cell somata of primary sensory neurons (i.e. D R G neurons) that convey sensory information from the periphery into the C N S . The neurons of the D R G make up a heterogeneous population which can be divided into a number- of subclasses based on various criteria such as function, cell size, neurotrophin receptor expression, or the presence of histochemical markers. The most prevalent neuronal type (comprising approximately 40% of the total D R G population) are small diameter neurons immunopositive for T r k A and calcitonin gene-mediate related peptide (CGRP) which mediate the transmission of thermo- and nocioceptive information from the periphery (Wright and Snider, 1995; Mol l iver et al., 1997; Bradbury et al., 2000). A second group of small diameter neurons also involved in thermo- and nocioception (comprising approximately 30% of the total D R G population) are identified by their expression of the glial-derived neurotrophic factor ( G D N F ) receptor R E T , as well as their ability to bind the lection IB4 (Molliver et al., 1997; Bennett et al., 1998; Snider and McMahon, 1998; Bradbury et al., 2000). Finally, the remaining D R G neurons (~ 30%) consist of medium to large diameter sensory neurons that function to transmit proprioceptive information, and can be identified by their expression of the calcium-binding proteins parvalbumin and calretinin, as well as the NT-3 receptor, TrkC (McMahon et al., 1994; Aver i l l et al., 1995; Wright and Snider, 1995; Bradbury et al., 2000). Despite their heterogeneous nature, all D R G neurons possess a single bifurcating axon that extends one branch peripherally along a peripheral nerve and one branch centrally through the dorsal root to innervate targets within the spinal cord. Disruption of peripherally-projecting D R G axons results in a strong regenerative response in affected neurons, and, i f the continuity of the peripheral nerve in which the axons travel is not compromised, reinnervation of peripheral targets can occur (Broude et al., 1997; Donnerer, 2003). In contrast, axotomy of centrally-projecting D R G axons results in only a limited regenerative response (Schreyer and Skene, 1993; Chong et al., 1996; Broude et al., 1997; Donnerer, 2003). While centrally-projecting axons are often able to extend through the environment of the dorsal root, they are unable to penetrate the 119 glia limitans of the dorsal root entry zone (DREZ) , and, thus, do not enter the C N S (Carlstedt, 1985; Broude et al., 1997; McPhai l et al., 2004). The presence of cell-specific markers for identification, the relative ease with which the D R G can be accessed surgically, and the existence of both peripherally- and centrally-projecting axons with differential regenerative responses, make D R G neurons an excellent model for studying the molecular and biochemical changes that occur in axotomized neurons. In this study, I compared the expression of Sema4F m R N A in adult rat cervical D R G neurons following resection of either the spinal nerve (a peripheral axotomy), or after a dorsal rhizotomy, which lesions centrally-projecting axons (See Chapter 2 for injury details). 4.2 .2 . E x p r e s s i o n o f S e m a p h o r i n s i n D e v e l o p i n g a n d A d u l t D R G N e u r o n s Evidence from a number of studies suggests that at least one Class 3 semaphorin can shape the development of the mammalian D R G sensory system. Small and large diameter D R G neurons extend axons into distinct regions of the mature spinal cord: small diameter (nocioceptive), N G F -sensitive axons synapse with targets in the outer lamina of the dorsal horn, while larger diameter (proprioceptive) NT-3-sensitive axons project into more ventral regions (Ozaki and Snider, 1997). These distinct projection fields are established early in the developing nervous system and likely involve Sema3A-mediated chemorepulsion. Prior to day E13.5, Sema3A is homogeneously expressed throughout the embryonic rodent spinal cord possibly preventing npn-1 immunoreactive D R G axons from penetrating the environment of the developing cord (Puschel et al., 1996). However, at later stages, Sema3A expression becomes localized to the ventral aspect of the developing cord, and despite the fact that both N G F - and NT-3-sensitive neurons continue to express npn-1, the two populations of D R G neurons differ in their response to Sema3A. While NT-3-sensitive axons are able to penetrate Sema3A-expressing regions of the ventral cord, NGF-sensitive axons are excluded, projecting instead into the outer lamina of the dorsal horn (Messersmith et al., 1995; Puschel et al., 1995; Wright et al., 1995; Puschel et al., 1996). Although the exact mechanism underlying the different sensitivities of the N G F - and N T -3-sensitive D R G neurons to Sema3A is unknown, the expression of different Class A plexins in the two populations may underlie these observed differences (Yaron et al., 2005). Thus, in the 120 developing nervous system, at least one Class 3 semaphorin is thought to regulate the development of D R G sensory projections. Furthermore, although embryonic D R G neurons do not express Class 3 semaphorins, at least two membrane-associated semaphorins, Sema4F and Sema6C, are known to be expressed by developing sensory neurons (Encinas et a l , 1999; Kikuchi et al., 1999). Although there is no evidence that mature D R G neurons express semaphorins, at least some D R G neurons continue to express the Class 3 semaphorin receptors p lex in-Al and npn-1 into adulthood (Gavazzi et al., 2000; Pasterkamp et al., 2001). Within the intact, uninjured D R G , approximately 40% of D R G neurons (small and intermediate sized NGF-sensitive neurons), express npn-1 m R N A , while the majority of large diameter sensory neurons express plexin-Al m R N A (Pasterkamp et al., 2001). Following either a peripheral or central axotomy, both small and large diameter D R G neurons express npn-1 and p lex in -Al (Pasterkamp et al., 2001; Pasterkamp and Verhaagen, 2001). Although information regarding the role of semaphorins in D R G regeneration is still correlative, the growth cones of mature D R G neurons continue to respond to sources of Sema3A in culture (Reza et al., 1999). Furthermore, following a dorsal column lesion, Sema3A m R N A is expressed within the spinal cord lesion site, where it may act to inhibit the growth of D R G axons through the post-traumatic glial scar (Pasterkamp et a l , 2001) . 4.3.1. Spinal Motoneurons as a Model of Neuronal Injury Spinal motoneurons are large, easily identified neurons located in the ventral horns of the mature vertebrate spinal cord. They are organized into well defined, 'motor pools' that serve to innervate both the axial muscles of the trunk, as well as muscles within the limb (Price et al., 2002) . Spinal motoneurons, like other peripherally-projecting motoneuron populations, are located in both C N S and PNS environments. While the motoneuron soma and most proximal axonal segment are located within the spinal cord, the majority of the axon is located peripherally, exiting the spinal cord via the,ventral root and projecting through spinal and peripheral nerves to innervate specific muscles targets (Cullheim et al., 2002). 121 Given the fact that spinal motor axons are located in both the C N S and P N S , spinal motoneurons are a useful neuronal population with which to study the ability of motoneurons to mount a cell body response following either a PNS or CNS-based lesion. Following a peripheral nerve lesion, axotomized spinal motoneurons switch from a 'transmitting' to a 'growth' mode, down-regulating the expression of genes related to signal transduction, while simultaneously up-regulating the expression of a number of. R A G s (Linda et al., 1992; Piehl et al., 1993; Piehl et al., 1995; Rende et al., 1995; Cullheim et al., 2002). Provided that the continuity of the peripheral nerve is maintained or repaired following axonal injury, peripherally axotomized spinal motoneurons can often re-innervate, albeit non-specifically, denervated peripheral muscle targets (Brushart, 1993; Nguyen et al., 2002). In contrast, axotomy of spinal motoneurons in the C N S environment (i.e. following ventral root avulsion or spinal cord injury), often results in motoneuron death, and a poor cell body response and regenerative outcome for surviving motoneurons (Koliatsos et al., 1994; Piehl et al., 1998; Carlstedt, 2000). Surprisingly, following a ventrolateral funiculus lesion (a C N S injury that results in the formation of a much smaller glial scar), the majority of axotomized spinal motoneurons survive, upregulate the expression of R A G s , and can often extend axons through the lesion site and into the PNS (Linda et al., 1992; Cullheim et al., 2002). In this study, I examined the expression of Sema4F m R N A in adult rat spinal motoneurons following a spinal nerve resection, an injury that axotomizes spinal motor axons in the environment of the PNS (See Chapter 2 for injury details). 4.3.2. E x p r e s s i o n o f S e m a p h o r i n s i n D e v e l o p i n g a n d A d u l t S p i n a l M o t o n e u r o n s Recently, several studies examining the expression of Class 3 semaphorins and their receptors in the developing rodent spinal cord have shown that semaphorins play a role in mediating the targeting of spinal motor axons to distinct regions in the periphery. Spinal motoneurons express a number of Class 3 semaphorins receptors, including npn-1 and npn-2, p l e x i n - A l , plexin-A3 and plexin-A4, and the patterns of these receptors define distinct subpopulations in the developing cord (Chen et al., 1997; He and Tessier-Lavigne, 1997; Cohen et al., 2005; Huber et al., 2005). Huber and colleagues (2005) have shown that, in the developing rodent nervous 122 system, both Sema3A and Sema3F expression mediate the timing of motor axon projection into the periphery, spinal axon fasciculation, and target selection (Huber et al., 2005). Loss of Sema3A or npn-1 expression results in the premature extension of motor axons into the limbs, extensive defasiculation of spinal nerves, and inappropriate target innervation, which suggests that Sema3A/npn-l signalling plays an important role in the development of spinal motor nerves (Huber et al., 2005). Similarly, expression of Sema3F within dorsal regions of the developing limb is required to properly guide the axons of a subset of medially-located brachial motoneurons into specific regions in the ventral limb. In Sema3F or npn-2 knockout animals, this dorsal-ventral targeting of axons is lost, and axons innervate inappropriate target regions (Huber et a l , 2005). In addition to expressing receptors for Class 3 semaphorins, developing spinal motoneurons also express a number of Class 3 semaphorins. Spinal motoneurons can be divided into a large number of subpopulations based on the number and identity of semaphorins and their expressed receptors (Cohen et al., 2005). While some motoneurons express only a single Class 3 semaphorin, neuropilin and plexin family member, neighbouring populations may express multiple Class 3 semaphorins, along with a number of semaphorin receptors (Cohen et al., 2005). While the reason for this complex pattern of semaphorin and receptor expression is still not known, Cohen and colleagues (2005) have suggested a number of possible reasons. First, spinal motoneurons in specific motor pools receive afferent input from proprioceptive sensory neurons that innervate the same target region. It is possible that the expression of distinct semaphorin combinations in specific motoneuron pools may act as a molecular code, preventing afferent fibres from innervating inappropriate motor pools. Alternatively, as semaphorins have been shown to mediate axon fasciculation (Kitsukawa et al., 1995; Kitsukawa et al., 1997; Y u et al., 2000; Cloutier et al., 2002), the differential expression of Class 3 semaphorins may play a role in mediating the sorting of axons from distinct motor pools into muscle-specific fascicles. Finally, as Class 3 semaphorins have been implicated in mediating neuronal migration in the developing brain, it is possible that the expression of distinct Class 3 semaphorins and receptor combinations may contribute to the segregation of spinal motoneurons into different motor pools (Cohen et al., 2005). This last hypothesis is likely to involve a number of different semaphorin/receptor interactions, since Huber et al. (2005) has shown that brachial spinal motoneurons migrate 123 normally in the embryonic spinal cords of Sema3A, Sema3F, npn-1 or npn-2 knockout mice. In addition to Class 3 semaphorins, embryonic rat spinal motoneurons also express Sema4F, although, as in D R G neurons, the function of Sema4F in developing spinal motoneurons is still unknown (Encinas et al., 1999). A s in the developing nervous system, spinal motoneurons continue to express a number of Class 3 semaphorins, as well as both npn-1 and npn-2, in the mature nervous system (De Winter et al., 2002a; Lindholm et al., 2004). Although the role of the continued expression of chemorepulsive semaphorins and their receptors in uninjured motoneurons is still unknown, their continued expression may play a role in limiting the structural remodelling of mature synapses (see Chapter 3, Section 3.2.1 for details). Although few studies have focused on injury-induced changes in semaphorin expression in adult spinal motoneurons, at least two studies have revealed that in spinal motoneurons, the expression of semaphorins and their receptors changes following axotomy. Following a peripheral nerve lesion, adult rat spinal motoneurons down-regulate the expression of Sema3A m R N A while maintaining their expression of the Sema3A receptor, npn-1 (Pasterkamp et al., 1998a). This downregulation of Sema3A expression in axotomized motoneurons may serve to remove an intrinsic block on axonal growth and/or dendritic remodelling, while their continued expression of npn-1 would allow motoneurons to continue to be responsive to Sema3A expressed in the peripheral environment. This is particularly advantageous, as following a peripheral nerve injury terminal Schwann cells overlying the denervated motor endplate express Sema3A m R N A (Pasterkamp and Verhaagen, 2001). This Schwann cell-derived Sema3A may serve to slow the growth of regenerating npn-1 containing motor axons, thereby promoting the formation of new synaptic connections and the re-establishment of motor synapses in denervated muscle targets (Pasterkamp and Verhaagen, 2001). Finally, unlike a peripheral nerve lesion, following an intraspinal axotomy (a CNS-based lesion), axotomized spinal motoneurons not only continue to express npn-1 m R N A , but also upregulate, rather than down-regulate, the expression of both Sema3A and Sema4F m R N A (Lindholm et al., 2004). 124 4.3. OVERVIEW OF THE EXPERIMENTAL QUESTION AND HYPOTHESIS The goals of this chapter were: 1) To examine the expression of Sema4F m R N A in adult rat cervical dorsal root ganglion (DRG) neurons following either spinal nerve resection or after a dorsal rhizotomy, and 2) To examine the expression of Sema4F m R N A in adult rat spinal motoneurons following a spinal nerve resection injury. This study tested the following hypotheses: 1. Given that Sema4F expression is upregulated in injured neurons following the axotomy of peripherally-projecting, but not centrally-projecting, fibre tracts (Chapter 3), / hypothesize that adult rodent DRG neurons will upregulate the expression of Sema4F mRNA following a peripheral axotomy, but that after axotomy of the centrally projecting branch, the expression of Sema4F mRNA will not change. To test this hypothesis, animals received either a unilateral spinal nerve resection or a unilateral dorsal rhizotomy to axotomize all D R G neurons within cervical levels C5-C8. In situ hybridization was then used to examine the expression of Sema4F in axotomized D R G neurons in both injury models. 2. Given the evidence that Sema4F m R N A is upregulated in adult rat spinal motoneurons following a ventral column lesion (Lindholm et al., 2004), / hypothesize that following transection of the spinal nerve, which axotomizes spinal motor axons distal from the ventral root, an increase in Sema4F mRNA expression will be detected in axotomized spinal motoneurons. To test this hypothesis, animals received a unilateral spinal nerve resection to axotomize all spinal motoneurons within cervical levels C5-C8. In situ hybridization was then used to examine the expression of Sema4F in axotomized spinal motoneurons. 125 3. Given the absence of Sema4F m R N A expression in the degenerating distal facial nerve following axotomy of the adult rat facial nerve (Chapter 3), I hypothesize that, following a sciatic nerve resection, Sema4F mRNA will not be expressed in the degenerating distal sciatic nerve. To test this hypothesis, animals received a unilateral sciatic nerve resection injury. Seven days following injury, animals were sacrificed and in situ hybridization analysis was performed on longitudinal segments of uninjured sciatic nerve as well as on segments of the distal degenerating sciatic nerve to observe Sema4F expression, or lack thereof. 126 4.4. R E S U L T S 4.4.1. Adult D R G Neurons Do Not Express Sema4F m R N A Following Dorsal Rhizotomy ISH was used to examine the expression of Sema4F m R N A in uninjured and injured adult cervical D R G neurons, 3, 7 and 14 days after a dorsal rhizotomy (n = 5 per time point). ISH analysis revealed that uninjured D R G neurons do not express Sema4F m R N A . (Fig. 4.1) Following a dorsal rhizotomy, Sema4F m R N A expression was not detected in axotomized D R G neurons at all time points examined (Fig. 4.1), even when the length of autoradiographic exposure was increased to 12 weeks (data not shown). These results suggest that injury to centrally-projecting axons does not induce Sema4F mRNA expression in adult rat D R G neurons. 4.4.2. Resection of the Spinal Nerve Results in the Up-Regulation of Sema4F m R N A Expression in D R G Neurons Unlike a dorsal rhizotomy, injury to the peripherally-projecting axons of adult D R G neurons results in a significant increase in Sema4F m R N A expression. Using ISH, I examined Sema4F m R N A expression in adult cervical D R G neurons, 3, 7, and 14 days following a unilateral spinal nerve resection. Using a two-way A N O V A , analysis of Sema4F m R N A expression revealed that resection of the spinal nerve resulted in a significant increase in Sema4F m R N A expression in D R G neurons (F (1, 29) = 18.38, p < 0.001), a difference that was maintained throughout the time course of the study (F (1, 29) = 3.74, p = 0.04). However, no significant interaction between the injury state of the neuron and number of days following injury was observed (Injury vs. Time course, F (1, 29) = 0.95, p = 0.40, two-way A N O V A ) . Post-hoc analysis using a Student's t-test revealed that although the mean hybridization signal was greater over injured D R G neurons compared to uninjured D R G neurons, 3 days following injury, this increase was not statistically significantly (n = 5, p = 0.110, t-test). (Fig. 4.2 A - C , J) In contrast, 7 days following a spinal nerve resection, Sema4F m R N A expression was significantly elevated over control levels (n = 5,p = 0.001, t-test), and remained statistically elevated over controls levels, 14 days following injury (n = 5,p = 0.03, t-test). (Fig. 4.2 D-J) 127 Next, a scatter plot was used to examine the size distribution of Sema4F expressing D R G neurons 3, 7 and 14 days following a spinal nerve resection. The scatter plots reveal that most D R G neurons do not upregulate the expression of Sema4F in response to a peripheral axotomy. Instead, following a spinal nerve resection, the increase in Sema4F m R N A expression detected in axotomized D R G neurons primarily occurs in a subset of small and medium-sized neurons (<1000 um 2). In this study, immunohistochemistry was not used to determine the phenotype of these neurons, due to the processing techniques required for radioactive ISH analysis. Finally, it is important to note that D R G neurons were sized using the cross-sectional area outlined through the course of the I S H analysis. Neurons were identified from randomly selected tissue sections, and soma area determined using the cell profile in that section. A s a stereological approach was not used, it is possible that in the estimation of cell sizes, the bias was towards not only over sampling larger sized neurons, but also underestimating the total area of these same neurons. 4.4.3. P e r i p h e r a l A x o t o m y R e s u l t s i n t h e D e l a y e d U p - R e g u l a t i o n o f Sema4F m R N A E x p r e s s i o n i n A x o t o m i z e d S p i n a l M o t o n e u r o n s Along with axotomizing the peripheral axonal branch of D R G neurons, resection of the spinal nerve also severs the peripherally-projecting axons of spinal motoneurons located in the ventral spinal cord. Therefore, I next examined the expression of Sema4F in uninjured and injured spinal motoneurons following a spinal nerve resection. ISH analysis revealed that Sema4F m R N A expression is low or absent in uninjured motoneurons. (Fig. 4.4 A - C ) In contrast to D R G neurons and facial motoneurons, following a peripheral axotomy no increase in Sema4F m R N A expression was observed within the first week after injury (data not shown). Instead, an increase in Sema4F m R N A expression was first detected in axotomized spinal motoneurons 14 days after resection of the spinal nerve. (Fig. 4.4) This finding expands on the previous work of Lindholm and colleagues, (2004) who documented the delayed expression of Sema4F m R N A in axotomized spinal motoneurons, which was first detected 3 weeks following a ventral funiculus lesion. 128 4.4.4 . A Low Level of S e m a 4 F I S H Signal is Detected in the Distal Sciatic Nerve, Seven Days Following a Spinal Nerve Resection Injury Recently, several studies have demonstrated that, following a crush or transection of the sciatic nerve, cells in the basal lamina of the degenerating distal nerve stump express a number of Class 3 semaphorins (Scarlato et al., 2003; Ara et a l , 2004). Thus, to determine i f cells in the uninjured or degenerating adult rat sciatic nerve express Sema4F m R N A , ISH was performed on longitudinal sections of contralateral, uninjured sciatic nerve, as well as on degenerating distal sciatic nerve stumps, 7 days following a sciatic nerve resection injury. The results revealed that Sema4F m R N A is not expressed in the mature, uninjured sciatic nerve. (Fig. 4.5) However, seven days following resection of the sciatic nerve, a low level of Sema4F ISH signal was detected over the degenerating distal sciatic nerve. (Fig. 4.5) Although this small increase in ISH signal may signify an increase in Sema4F signal in the degenerating sciatic nerve, the proliferation of cells within the distal nerve following axotomy could also lead to an increase in the non-specific background ISH signal. If so, the increase observed may not correspond to an increase in Sema4F m R N A levels in the degenerating nerve. 129 Figure 4 .1 . Expression of Sema4F m R N A in cervical D R G neurons following a dorsal rhizotomy. (A-I) Darkfield and fluorescence photomicrographs of Sema4F m R N A expression in axotomized cervical D R G neurons, 3 (A-C) , 7 (D-F), or 14 (G-I) days following a unilateral dorsal rhizotomy. In each series of horizontal panels, the leftmost image corresponds to Sema4F m R N A expression in uninjured D R G neurons (A, D , G) , while the middle panels (B, E , H) depict Sema4F m R N A expression in D R G neurons 3, 7, or 14 days after dorsal rhizotomy. Rightmost images (C, F , I) are fluorescent images of Neurotrace® counterstained neurons underlying the ISH signal present in the middle panels. Results reveal that Sema4F m R N A is not expressed in uninjured adult D R G neurons (A, D , G) , or in axotomized D R G neurons, 3 (B), 7 (E), or 14 (H) days after dorsal rhizotomy. Arrows in the middle and right hand panels indicate the absence of I S H signal over injured neurons. (Scale bar = 50pm) Fig . 4.1. 130 131 Figure 4.2. Expression of Sema4F m R N A in D R G neurons following a spinal nerve resection. (A-I) Darkfield and fluorescence photomicrographs of Sema4F m R N A expression in axotomized cervical D R G neurons, 3 ( A - C ) , 7 (D-F), or 14 (G-I) days following a unilateral spinal nerve resection. In each series of horizontal panels, the leftmost image corresponds to Sema4F m R N A expression in uninjured D R G neurons (A, D , G) , while the middle panels (B, E , H ) depict Sema4F m R N A expression in D R G neurons 3, 7, or 14 days following spinal nerve resection. Rightmost images are fluorescent images of Neurotrace® counterstained neurons underlying the I S H signal present in the middle panels. Arrows in the middle and right hand panels indicate the localization of ISH signal over injured neurons. Examination reveals an increase in Sema4F m R N A expression in axotomized D R G neurons, 3 (B), 7 (E), and 14 (H) days after a spinal nerve lesion. (Scale bar = 50pm) (J) Histogram detailing changes in Sema4F m R N A ISH signal in cervical D R G neurons 3, 7 and 14 days levels following a spinal nerve lesion. ISH signal was graphed as times greater than non-specific background signal. Quantification of Sema4F m R N A expression reveals that 3 days following axotomy, a slight increase in Sema4F m R N A expression is detected in injured, compared to uninjured D R G neurons, although, at this time point, the difference observed is not statistically significant (p = 0.110). In contrast, 7 and 14 days following spinal nerve resection, Sema4F m R N A expression is significantly higher in axotomized D R G neurons when compared to contralateral, uninjured, neurons (p = 0.001, and p = 0.03, respectively). A Student's t-test was used to compare Sema4F m R N A expression levels between injured and uninjured neurons at each time point. (* Indicates p < 0.05, ** Indicates p < 0.005) Note that the apparent decline in Sema4F m R N A levels observed 7 days after injury (in both uninjured and axotomized D R G neurons) is an artifact due to a reduction in emulsion thickness, and does not alter the comparison of Sema4F mRNA levels between 7 day uninjured and axotomized D R G neurons. • 132 Fig . 4.2. u n i n j u r e d a x o t o m i z e d IP lis 1 K B Bi §JI1 Mil _^ __T______K#_£ • 133 Figure 4.3. Scatter plots of Sema4F m R N A expression in D R G neurons following a spinal nerve resection. Scatter plots of Sema4F m R N A expression comparing uninjured and axotomized cervical D R G neurons, 3 (A-B), 7 (C-D) and 14 (E-F) days after unilateral spinal nerve resection. Each plot represents a total of approximately 1000 neurons from 5 different D R G s , and neuronal profiles are plotted according to neuronal cross-sectional area and the ratio of neuronal Sema4F ISH signal to non-specific background signal in each D R G (S/N ratio). The dashed line on each scatter plot serves as a reference point, indicating a grain density of 2.5 times that of the background level, above which neurons were considered positively labelled for Sema4F m R N A . Comparison of Sema4F m R N A expression in uninjured and axotomized D R G neurons reveals that 3 (A-B), 7 (C-D) and 14 (E-F) days after a spinal nerve resection, an increase in Sema4F ISH signal was most apparent in small and medium-sized (< 1000 um ) D R G neurons. 134 Fig. 4.3. B 3 Day Uninjured 0 500 1000 1500 2000 2500 cross sectional area (um 2) 3 Day Axotomized 500 1000 1500 2000 2500 cross sectional area ((im'j 40 30 I 2 0 co 7 Day Uninjured 500 1000 1500 2000 2500 cross sectional area (nm') 7 Day Axotomized 500 1000 1500 2000 2500 cross sectional area (um 2) 14 Day Uninjured 14 Day Axotomized 500 1000 1500 2000 2500 cross sectional area (um2) 500 1000 1500 2000 2500 cross sectional area (um2) 135 Figure 4.4. Sema4F m R N A is expressed by spinal motoneurons 14 days after spinal nerve resection. Darkfield and fluorescence photomicrographs detailing expression of Sema4F m R N A in spinal motoneurons, 14 days following a spinal nerve lesion. ISH was performed on transverse sections of uninjured (top row; uninjured) or injured (bottom row; axotomized) cervical spinal cord, 14 days after spinal nerve resection. For both horizontal series of images, the leftmost image consists of a fluorescent Neurotrace® image used to identify neuronal cell bodies (A, C) , while the middle panels are false coloured dark-field micrographs of Sema4F ISH signal over uninjured or injured (axotomized) motoneurons (B, D). Finally, right hand images are overlays of fluorescent and dark-field images, revealing the localization of Sema4F ISH signal over axotomized (F), but not uninjured (C), spinal motoneurons. Results reveal that uninjured spinal motoneurons do not express detectable levels of Sema4F m R N A (A-C) . Instead, 14 days following a spinal nerve lesion, axotomized motoneurons of the ipsilateral ventral horn express Sema4F m R N A (D-F). (Scale bar = 100pm) 136 F i g . 4.4. nissl Sema-4F merged 137 F i g u r e 4 .5. Sema4F is n o t e x p r e s s e d i n t h e n o r m a l s c i a t i c n e r v e , b u t m a y b e u p r e g u l a t e d i n t h e d e g e n e r a t i n g d i s t a l n e r v e s t u m p 7 d a y s a f t e r a s c i a t i c n e r v e t r a n s a c t i o n . Seven days following a unilateral sciatic nerve resection, longitudinal sections of contralateral, uninjured, sciatic nerve ( A - C ) and degenerating distal sciatic nerves (D-F) , were subjected to in situ hybridization for Sema4F m R N A . In each horizontal series of images, the leftmost image consists of a bright-field photomicrograph of either an uninjured nerve (A), or the degenerating distal nerve stump (axotomized) (D). Middle panels (B, E ) are dark-field photomicrographs of Sema4F ISH signal in uninjured (B) or degenerating distal sciatic nerve (axotomized) ( E ) . Finally, right hand images ( C - F ) are overlays of bright-field and dark-field images, showing presence or absence of Sema4F ISH signal over cell within the nerve segments. ISH analysis reveals that Sema4F m R N A is not expressed by cells in the uninjured sciatic nerve ( A - C ) . Seven days following a sciatic nerve transaction, a small increase in I S H signal, which could be Sema4F specific, is observed in the degenerating sciatic nerve stump (D-F) . Note that the ISH signal localized to the margin of the uninjured sciatic nerve in B and C is an artifact from tissue processing and does not represent m R N A signal. The sections in A and D were counterstained with haematoxylin-eosin (Scale bar = 100pm). 138 F i g . 4.5. Uninjured Axotomized B C E F 139 4.5. D I S C U S S I O N 4.5.1. S u m m a r y In this chapter, I identified two additional neuronal populations that upregulate the expression of Sema4F in response to a peripheral nerve injury. I found that, following a peripheral axotomy, adult rat D R G neurons upregulate the expression of Sema4F m R N A , an effect not observed following a dorsal rhizotomy. Comparison of neuronal soma size and Sema4F expression revealed that, following a peripheral nerve injury, only a subset of small to medium-sized D R G neurons upregulate the expression of Sema4F. Furthermore, the up-regulation in Sema4F m R N A expression in peripherally axotomized D R G neurons did not coincide with changes in the expression of Sema4F in peripheral nerves, since after a sciatic nerve transection, Sema4F m R N A was not detected in the degenerating distal sciatic nerve. Finally, following a spinal nerve resection, axotomized spinal motoneurons within the ventral spinal cord also upregulate Sema4F m R N A expression, although this increase in expression did not occur until several weeks after injury. These results demonstrate that, in addition to facial motoneurons (discussed in Chapter 3), at least one population of adult mammalian sensory neurons upregulates Sema4F m R N A expression in response to a peripheral nerve injury. In addition, the findings of this study expand on the study of Sema4F expression in axotomized spinal motoneurons performed by Lindholm and colleagues (2004) by demonstrating that peripherally axotomized spinal motoneurons, like intraspinally axotomized spinal motoneurons, also express Sema4F m R N A . 4.5.2. Sema4F E x p r e s s i o n i n A x o t o m i z e d N e u r o n s C o r r e s p o n d s t o t h e N e u r o n ' s R e g e n e r a t i v e P o t e n t i a l In the previous chapter, I outlined how facial motoneurons, which exhibit a robust cell body response to injury, strongly upregulate Sema4F expression after injury, while axotomized rubrospinal neurons, which mount only a weak regenerative response to axonal injury, do not express Sema4F. Similarly, in this chapter, I have detailed how a peripheral nerve lesion, which 140 results in the induction of a strong cell body response in axotomized D R G neurons, also leads to an up-regulation of Sema4F m R N A in these neurons, an effect not observed following injury to centrally-projecting sensory axons. In addition, spinal motoneurons upregulate Sema4F m R N A expression after axonal injury within either the peripheral nerve (Fig. 4.4), or in the C N S environment (Lindholm et al., 2004). Adult spinal motoneurons are unique, since in both injury models, axotomized motoneurons often upregulate the expression of a number of R A G s and extend regenerating axons towards targets in the periphery (Linda et al., 1992; Hammarberg et al., 1998; Piehl et al., 1998; Cullheim et al., 2002). The evidence suggests that ability of injured neurons to express Sema4F corresponds to the intrinsic growth state of the injured neurons, with axotomized neurons able to mount a robust cell body response to injury strongly up-regulating Sema4F expression, while neurons unable to mount a strong response failing to do so. 4.5.3. A Postsynaptic Role for Sema4F in Axotomized Spinal Motoneurons and D R G Neurons? In Chapter 3, I compared the expression of Sema4F in peripherally axotomized adult rat facial motoneurons and cervically axotomized rubrospinal neurons. Following a facial nerve injury, axotomized facial motoneurons rapidly upregulate Sema4F m R N A as early as 3 days after injury. (Fig. 3.2) In contrast, axotomized rubrospinal neurons do not express Sema4F at any time point examined. (Fig. 3.5) In this chapter, peripherally axotomized spinal motoneurons were also observed to upregulate Sema4F m R N A expression, although in this neuronal population, Sema4F expression was delayed, and was not observed until several weeks after injury. (Fig. 4.4) What could account for rapid onset of Sema4F expression in axotomized facial motoneurons, the delayed up-regulation seen in spinal motoneurons, and the absence of Sema4F expression in axotomized rubrospinal neurons? In the previous chapter I outlined several possible mechanisms of Sema4F action in axotomized motoneurons based on either a pre- or postsynaptic localization following injury. In this chapter, the results obtained have allowed me to further build on the post-synaptic model of Sema4F action, by comparing the temporal expression patterns of Sema4F in both axotomized spinal motoneurons and D R G neurons, with the time course of the morphological changes that occur in the dendritic fields of these axotomized neuronal populations. 141 4.5.3.1. Could Sema4F Expression in Axotomized Spinal Motoneurons Be Related to the Loss of Dendritic Innervation? Like facial motoneurons, axotomized spinal motoneurons also show a reduction in the density of synaptic innervation of their dendritic fields, although unlike facial motoneurons, this occurs very gradually. Following an intraspinal axotomy, the number of synaptic inputs on neuronal somata and proximal dendrites of axotomized spinal motoneurons gradually declines, and by 3 weeks after injury, up to 90% of glutamatergic synapses are lost (Linda et al., 2000). A similar decline is also observed following a peripheral nerve lesion, although unlike intraspinally axotomized spinal motoneurons, the density of synaptic inputs largely recovers i f motor axons are allowed to successfully re-innervate their peripheral targets (Brannstrom et al., 1992a, b; Brannstrom and Kellerth, 1999). This gradual decline in the reduction of afferent inputs observed in axotomized spinal motoneurons closely coincides with the expression of Sema4F seen following a spinal nerve lesion (Figure 4.4) or following an intraspinal axotomy (Lindholm et al., 2004), with the highest levels of Sema4F expression coinciding with the greatest reduction in the dendritic innervation. The observation that the time course of Sema4F expression correlates with the loss of dendritic innervation could explain the expression of the Sema4F in spinal motoneurons observed 7 days following a spinal cord transection (Fig. 3.6). In addition to the effect at the primary lesion site, this injury leads to the degeneration of neuronal processes adjacent to the initial lesion, because of an expanding wave of secondary damage. The process is likely to result in degeneration of axonal processes of higher order neurons which normally synapse on ventral spinal motoneurons. This, in turn, could explain the up-regulation in Sema4F expression observed in ventral motoneurons in Chapter 3. Although the data is thus far circumstantial, the aforementioned observations are consistent with a model in which the up-regulation of Sema4F in neurons after axonal injury is linked to a reduction in afferent input. Given the evidence that Sema4F associates with at least one post-synaptically targeted protein (Schultze et al., 2001), it is possible that, following axonal injury, Sema4F may be targeted to the somata and dendritic fields of injured neurons in the response to the loss of afferent input. 142 4.5 .3 .2 C o u l d P o s t s y n a p t i c a l l y L o c a l i z e d S e m a 4 F P l a y a R o l e i n A b e r r a n t S y n a p s e F o r m a t i o n o n P e r i p h e r a l l y A x o t o m i z e d D R G N e u r o n s ? Given the in vitro evidence that Sema4F can interact with post-synaptically localized proteins, it is possible that, as outlined above for spinal motoneurons, Sema4F may also contribute to the establishment or maintenance of synapses on the soma of axotomized sensory neurons. Following a spinal nerve resection injury, a subset of axotomized sympathetic fibres abnormally project into the injured D R G , where at least some sympathetic fibres possessing synaptic-like structures are found near or in apposition to the somata of axotomized D R G neurons (Chung et al., 1996; Chung et al., 1997; Ramer and Bisby, 1998; Ramer et al., 1999; Chung and Chung, 2001). This process is associated with the development of neuropathic pain. Given the evidence that the onset of sympathetic axon extension into the axotomized D R G corresponds to the time course of Sema4F up-regulation in axotomized D R G neurons (Chung et al., 1996), it is possible that Sema4F may be involved in the formation of these aberrant synaptic structures. Although these sympathetic processes are thought to be noradrenergic or acetylcholinergic, as opposed to glutamatergic in origin, (Ernsberger and Rohrer, 1999), peripherally axotomized D R G neurons have been shown to express the noradrenaline receptor, a2-adrenoreceptor, on their cell soma (Chen et al., 1996; Shinder et a l , 1999). Although a more detailed study must be done before any conclusion can be drawn, it is possible that Sema4F functions postsynaptically in axotomized sensory neurons to mediate the localization or establishment noradrenaline receptors on the cell somata of axotomized sensory neurons. 4 .5 .4 . G e n e r a l C o n c l u s i o n s R e g a r d i n g t h e E x p r e s s i o n o f S e m a 4 F i n A x o t o m i z e d A d u l t V e r t e b r a t e N e u r o n s In conclusion, in this chapter, as well as in Chapter 3, I have presented evidence that Sema4F m R N A expression is upregulated in both motor and sensory neurons following a peripheral nerve lesion. Without question, much more work needs to be done to delineate the role that Sema4F plays in axotomized neurons. Currently, the absence of immunohistochemically useful anti-Sema4F antibodies and the lack of knowledge regarding Sema4F's receptors limits our ability to 143 define a precise role for Sema4F in axotomized neurons. However, with the data presented here, along with that present in the literature, one could speculate that, following axonal injury, Sema4F may become pre- or post-synaptically localized in neurons in response to the loss of contact with peripheral targets, in response to the loss of afferent input, or both. Thus, it is possible that Sema4F may function as a common component for the establishment of synapses and/or receptor complexes following axotomy. 144 C h a p t e r 5 Inhibition of R O C K Activity Results in a Reduction in E13, But Not E16, DRG Neurite Extension Across Sema4F-Expressing Cell Islands A version of this chapter will be submitted for publication. Oschipok L W , Wang, W, Kimura T, O'Connor T, Tetzlaff W. Inhibition of R O C K Activity Results in a Reduction of E l 3, But Not E l 6, D R G Neurite Extension Across Sema4F-Expressing Cell Islands. (In preparation) 145 5.1. C H A P T E R O V E R V I E W While semaphorins are now known to mediate a number of biological processes, they were originally identified as chemoattractive and chemorepulsive neuronal and growth cone guidance cues. Therefore, in this chapter, I wi l l examine the ability of Sema4F to influence the extension of embryonic rat D R G neurites in culture. D R G explants obtained from embryonic-day 13 ( E l 3) and embryonic-day 16 (E l6 ) rat embryos were cultured in the presence of Sema4F-expressing or control H E K 293 cells, and the ability of NGF-responsive D R G neurons to extend neurites over Sema4F-expressing or control H E K 293 cell islands was quantified. The results revealed that while Sema4F did not significantly reduce the extension of E l 3 NGF-responsive D R G neurites across H E K 293 cell islands, when E l 3 D R G neurons were treated with a pharmacological inhibitor to Rho kinase ( R O C K ) , E13 D R G neurite extension across Sema4F-expressing cells was significantly reduced, suggesting that inhibition of the R h o A / R O C K signalling pathway may play a role in mediating Sema4F signalling. In contrast, neither Sema4F nor inhibition of R O C K activity, either along or in concert, significantly altered the extension of E l 6 NGF-responsive D R G neuritis across H E K 293 cells. The observation that both E13 and E16 D R G s express Sema4F in vivo suggests that the action of Sema4F is not due to neuronally expressed Sema4F, but could be mediated by an as yet unidentified Sema4F receptor. 146 5.2. I N T R O D U C T I O N 5 .2 .1 . M e m b r a n e - A s s o c i a t e d S e m a p h o r i n s as A x o n a l G u i d a n c e C u e s . Within the field of vertebrate semaphorin research, a number of studies have revealed that most, i f not all , secreted (Class 3) semaphorins can function as chemorepulsive and/or chemoattractive neuronal or growth cone guidance cues for a wide variety of C N S and PNS neuronal populations (Raper, 2000; He et al., 2002; Fujisawa, 2004). In contrast, relatively few studies have investigated the ability of membrane-associated semaphorins to act as neuronal or growth cone guidance cues. The studies that have been done suggest that, like Class 3 semaphorins, a number of membrane-associated semaphorins can act as chemoattractive and/or chemorepulsive neuronal or growth cone guidance cues. Both Sema4A and Sema4D have been shown to function as growth cone collapsing factors and chemorepulsive guidance cues for a number of embryonic and postnatal P N S and C N S neuronal populations (Swiercz et al., 2002; Moreau-Fauvarque et al., 2003; Yukawa et al., 2005). Similarly, Sema5A can induce growth cone collapse in postnatal retinal ganglion cells (Goldberg et al., 2004). Furthermore, several members of the Class 6 semaphorin subfamily can also act as chemorepulsive guidance cues: exposure to Sema6A can induce growth cone collapse and neurite repulsion of embryonic vertebrate sympathetic and sensory neurons, (Xu et al., 2000), while both Sema6C and Sema6D act as potent growth cone collapsing factors for embryonic vertebrate sensory and neonatal hippocampal neurons (Kikuchi etal., 1999; Qu etal. , 2002). In contrast to the chemorepulsive effects of the semaphorins outlined above, Sema7A has been shown to enhance axonal growth from a number of embryonic PNS and C N S neuronal populations, including neurons of the olfactory epithelium, the olfactory bulb, cortex and dorsal root ganglia (Pasterkamp et al., 2003). In addition, Sema5A has recently been shown to function as a bifunctional growth cone guidance cue for neurons in the habenular nucleus, a C N S neuronal population associated with limbic function (Kantor et al., 2004). Using embryonic organotypic explants, Kantor and colleagues (2004) revealed that Sema5A can act as a chemoattractive guidance cue for habenular nucleus axons, but this effect can be reversed 147 following the interaction of Sema5A with chondroitin sulfate proteoglycans (CSPGs) (Kantor et al., 2004). In summary, although the ability of many membrane-associated vertebrate semaphorins to act as neuronal or growth cone guidance cues is still unknown, the evidence obtained to date suggests that membrane-associated semaphorins, like secreted semaphorins, can also function as chemoattractive and/or chemorepulsive guidance cues. 5.2.2. The Role of the R h o A / R O C K Signalling Pathway in Mediating Class 4 Semaphorin Signalling. The Rho GTPase, RhoA, along with its primary downstream effector, R O C K , are potent regulators of the actin-myosin cytoskeleton architecture (Luo, 2000; Dickson, 2001). In neurons, in vitro studies have revealed that a number of chemorepulsive or growth cone collapsing factors including M A G , Nogo-A, OMgp , ephrins, and lysophosphatidic acid ( L P A ) , require activation of the R h o A / R O C K signalling pathway in order to mediate their effects (Kranenburg et al., 1999; Shamah et al., 2001; Hunt et a l , 2002; Niederost et al., 2002). Activation of the R h o A / R O C K signalling pathway stimulates the contraction of the actin-myosin cytoskeletal network via phosphorylation of the myosin light chain and inhibition of myosin phosphatase (Luo, 2002; Schmidt et al., 2002b). It also promotes stabilization of the actin network, preventing actin filament turnover through the inactivation of the actin depolymerizing factor, cofilin (Maekawa et a l , 1999). Conversely, disruption of the R h o A / R O C K signalling pathway can promote both neurite sprouting and extension over substrates normally inhibitory to neurite outgrowth (Jalink et al., 1994; Lehmann et al., 1999; Bito et al., 2000; Wahl et al., 2000; Borisoff et al., 2003; Da Silva et al., 2003). Despite the evidence that the R h o A / R O C K signalling pathway plays a significant role in mediating growth cone collapse and neurite repulsion for a number of inhibitory compounds, its role in Class 4 semaphorin signalling is still contentious. Evidence from several studies suggests that RhoA and/or R O C K activation is required for Sema4A and Sema4D-mediated cellular or growth cone collapse, which can be prevented via the pharmacological inhibition of 148 R h o A / R O C K signalling (Aurandt et al., 2002; Swiercz et a l , 2002; Oinuma et al., 2003; Yukawa et al., 2005). Conversely, a separate study investigating the ability of Sema4D to induce cytoskeletal disruption in a non-neuronal model of cytoskeletal collapse has revealed that this process is dependent on the downregulation in RhoA activity, and is enhanced following the pharmacological inhibition of R O C K activity (Barberis et al., 2004; Barberis et al., 2005). In addition, the function of p l 9 0 - R h o G A P , a GTPase activating protein (GAP) which can down-regulate R h o A activity (Brouns et a l , 2000), has been shown to be necessary for the potentiation of Sema4D activity on non-neuronal cells (Barberis et al., 2005). Interestingly, despite the fact that Sema4D has been observed to induce growth cone collapse in a number of embryonic and postnatal neuronal populations, other studies have revealed that in the presence of N G F , Sema4D can promote neurite outgrowth in PC12 cells (Fujioka et al., 2003; Barberis et al., 2005). Investigation of this process has shown that, like the Sema4D-mediated cellular collapse identified in non-neuronal cells, P C 12 neurite outgrowth can be abolished in the absence of functional p l 9 0 - R h o G A P activity (Barberis et a l , 2005). This suggests that in both P C 12 cells and non-neuronal cells, Sema4D signalling requires suppression of the R h o A / R O C K signalling pathway. Overall, the existence of conflicting data from several groups means that, to date, the role of the R h o A / R O C K signalling pathway in mediating Class 4 semaphorin signalling remains unclear. 5.2 .3 . S e m a p h o r i n 4 F as a n A x o n a l G u i d a n c e C u e . In an important study of Sema4F function by Encinas and colleagues (1999), the ability of Sema4F to function as a growth cone collapsing factor was evaluated. The authors used a standard growth cone collapse assay in which embryonic chick R G C s were exposed to COS-7 cell membrane fractions containing full-length Sema4F protein, and the percentage of collapsed growth cones quantified. Sema4F was observed to induce a significant increase in R G C growth cone collapse when compared to control membrane fractions (Encinas et al., 1999). Encinas and colleagues (1999) also report that Sema4F-containing membrane fractions did not induce a significant increase in growth cone collapse in embryonic sensory and spinal motoneuron cultures. Although this suggests that embryonic sensory and spinal motoneurons are unresponsive to Sema4F, it is possible that a compound with only a weak growth cone collapsing 149 ability could still function as a weak inhibitory guidance cue, able to suppress growth cone extension over specific targets, but induce growth cone collapse. Because of the study discussed above, instead of examining the ability of Sema4F to induce growth cone collapse in culture, the goal of the present study was to examine the ability of Sema4F to function as a contact-dependent,, non-permissive molecule for neurite outgrowth. This was done by investigating the ability of embryonic rat D R G s to extend neurites over Sema4F-expressing or control H E K 293 cell islands. In addition, given the conflicting evidence regarding the role of the R h o A / R O C K signalling pathway in mediating Class 4 semaphorin signalling, I also examined i f suppression of R O C K activity in embryonic rat D R G neurons could influence D R G neurite outgrowth over Sema4F-expressing H E K 293 cells. 150 5.3 . O V E R V I E W O F T H E E X P E R I M E N T A L Q U E S T I O N A N D H Y P O T H E S I S Expression of Sema4F m R N A has previously been reported in rat D R G neurons as early as embryonic day 15 (Encinas et al., 1999). Therefore, the first goal of this study was to e x p a n d o n t h i s i n i t i a l e x p r e s s i o n s t u d y b y e x a m i n i n g t h e e x p r e s s i o n o f Sema4F m R N A i n r a t D R G n e u r o n s a t e a r l i e r a n d l a t e r d e v e l o p m e n t a l s tages . Next, given that several members of the Class 4 semaphorin family, including Sema4F, can induce growth cone collapse, the second goal of this study was t o e x a m i n e t h e a b i l i t y o f S e m a 4 F t o f u n c t i o n as a n i n h i b i t o r y g u i d a n c e c u e f o r N G F - r e s p o n s i v e E 1 3 a n d E 1 6 r a t D R G n e u r o n s i n c u l t u r e . Finally, given that the R h o A / R O C K signalling pathway has been shown to mediate the chemorepulsive effects of a number of inhibitory guidance cues (Jalink et al., 1994; Wahl et al., 2000; Borisoff et al., 2003), including members of the Class 4 semaphorin subfamily (Aurandt et al., 2002; Swiercz et al., 2002; Barberis et al., 2004; Yukawa et al., 2005), the third goal of this study was t o d e t e r m i n e i f t h e e f f ec t o f S e m a 4 F o n N G F - r e s p o n s i v e E 1 3 a n d E 1 6 r a t D R G c a n b e a t t e n u a t e d b y t h e p h a r m a c o l o g i c a l i n h i b i t i o n o f R O C K . This study tested the following hypothesis: the expression of Sema4F on the cell surface of HEK293 cells will act to create a non-permissive environment for the growth of embryonic rat DRG neurites, and that this inhibition of neurite outgrowth is mediated by the activation of the RhoA/ROCK signalling pathway. To test this hypothesis, in situ hybridization and Western blot analyses were used to examine the Sema4F expression in embryonic and postnatal rat D R G s . In addition, E l 3 or E l 6 rat D R G explants were co-cultured with either Sema4F-expressing or control H E K 293 cell islands in the presence or absence of [25pM] of the R O C K inhibitor, Y-27632. Thirty-six to 48 hours later, the cultures were fixed and the extension of D R G neurites over H E K 293 cell islands examined. 151 5.4. R E S U L T S 5.4.1. Expression of Sema4F in Developing Rat D R G s and Spinal C o r d In this study, ISH for Sema4F was performed on transverse sections of embryonic and postnatal rat spinal cords. Analysis revealed that Sema4F m R N A expression is detected in the developing rat spinal cord as early as embryonic-day-13 (El3) . A t this stage, a strong Sema4F ISH signal was observed in both the E13 D R G , as well as in the lateral ventral root. (Fig. 5.1 A ) Examination of Sema4F m R N A expression in embryonic-day-16 (E l6 ) embryos reveals that Sema4F continues to be robustly expressed by both D R G s as well as spinal motoneurons. (Fig. 5.IB) In addition, as observed in the Sema4F embryonic expression study performed by Encinas and colleagues (1999), a gradient of Sema4F ISH signal was also detected throughout the grey matter of the E16 spinal cord, with a strong Sema4F ISH signal observed in the ventral horns, but little to no expression detected dorsally. (Fig. 5.IB) B y embryonic-day 18 (El8) , D R G s continue to robustly express Sema4F m R N A , although at this stage, Sema4F m R N A is only weakly expressed in the ventral grey matter. (Fig. 5.1C) In contrast to strong Sema4F ISH signal observed embryonically, I S H analysis reveals that Sema4F m R N A expression rapidly declines postnatally, and is not detected in the postnatal-day-14 (PI4) rat D R G (Fig. 5.ID), or in the P14 spinal cord (not shown). In order to confirm the results of the Sema4F ISH study, Western blot analysis was used to examine Sema4F protein levels in embryonic and postnatal D R G s . The results reveal that embryonic rat D R G s express Sema4F protein as early as E l 3 , and continue to express it until at least E l 6 . (Fig. 5.IE) However, in the neonatal rat D R G , Sema4F protein expression is rapidly down-regulated, and is no longer detected by postnatal-day-2. (Fig. 5.IE) 152 5.4.2 . R O C K I n h i b i t i o n S i g n i f i c a n t l y R e d u c e s E 1 3 D R G N e u r i t e E x t e n s i o n A c r o s s S e m a 4 F -E x p r e s s i n g H E K 293 C e l l s A n in vitro cell island assay was used to examine the ability of full-length, transmembrane Sema4F to influence the extension of NGF-responsive, E13 D R G neurites across H E K 293 cells. D R G s obtained from E13 rat embryos were explanted onto laminin and poly-L-lysine coated coverslips containing small groups of control or Sema4F-expressing HEK293 cells (i.e. cell islands) in serum-free media supplemented with N G F at 20ng/mL. Thirty-six to 48 hrs later, cultures were fixed, counterstained, and the ability of D R G neurites to project over and/or through Sema4F-expressing or control H E K 293 cell islands analyzed. To determine i f the R h o A / R O C K signalling pathway plays a role in mediating Sema4F signalling, the experiment described above was repeated, but in addition, [25pM] of the R O C K inhibitor Y-27632 (Uehata et al., 1997), was added to the culture media of both control and experimental cultures. Analysis of neurite outgrowth in the four treatment groups (Control, Control/Y-27632, Sema4F, and Sema4F/Y-27632) revealed a statistically significant difference in E13 D R G neurite extension amongst the different treatment groups (F (1, 46) = 9.84, p < 0.001; one-way A N O V A ) . However, when neurite extension,over control (0.82 ± 0.06), or Sema4F-expressing (0.67 ± 0.07) H E K 293 cell islands was compared, analysis revealed no significant difference in neurite extension between the two treatment groups (p = 0.08; Holm-Sidak test). (Table 5.1, Fig. 5.2) This result suggests that Sema4F does not significantly inhibit the extension of E13 D R G neurites over H E K 293 cell islands. In contrast, following treatment with Y-27632, post-hoc analysis revealed a significant reduction in the ability E l 3 D R G neurites to extend across Sema4F-expressing H E K 293 cell islands (0.46 ± 0.05) compared to E13 neurite extension across control H E K 293 cell islands (p < 0.001; Holm-Sidak test). (Table 5.1, Fig. 5.2) This reduction in E l 3 neurite extension across Sema4F-expressing cells was not due to a non-specific effect of R O C K inhibition, as no significant difference in E l 3 D R G neurite extension across control H E K 293 cell islands in the presence (0.77 ± 0.03) or absence (0.82 ± 0.06) of Y-27632 treatment detected (p = 0.551; Holm-Sidak test). (Table 5.1, F ig . 5.2) Finally, following Y -27632 treatment, a significant reduction in E l 3 neurite extension across Sema4F-expressing cell islands is observed (p - 0.002; Holm-Sidak test). (Table 5.1) 153 In conclusion, these results reveal that Sema4F can reduce the extension of E13 D R G neurites across H E K 293 cell islands, but only following treatment with the pharmacological R O C K inhibitor Y-27632. 5.4.3. Neither Sema4F Nor R O C K Inhibition Significantly Alters the Extension of E16 D R G Neurites Across H E K 293 Cell Islands Next, I tested the ability of Sema4F to influence the extension of E l 6 NGF-responsive D R G neurites over H E K 293 cell islands. Unlike the significant group effect seen in E13 D R G cultures, analysis of E16 D R G neurite extension revealed no statistically significant difference amongst the four treatment groups (Control, Control/Y-27632, Sema4F, and Sema4F/Y-27632) (F (1, 51) = 1.81,p = 0.157, one-way A N O V A ) . (Table 5.1, Fig. 5.3) These results reveal that, unlike E l 3 D R G s , neither Sema4F nor Y-27632 treatment, either alone or in combination, significantly alters the ability of E16 D R G neurites to extend across H E K 293 cell islands. • • • • . . " > * • 154 Figure 5.1. Expression of Sema4F in the developing rat spinal cord and D R G s . (A-D) Low-magnification photomicrographs of Sema4F ISH signal in rat embryonic and postnatal spinal cord and D R G s . In each panel, a Sema4F ISH signal (red) is overlaid on a bright-field image of a transversely cryosectioned spinal column or D R G . (A) A t E l 3 , Sema4F ISH signal is detected in D R G neurons (*) as well as in the lateral ventral root (VR) . (B) In the E16 spinal column, Sema4F continues to be highly expressed in both D R G neurons as well as in spinal motoneurons (M), with weaker Sema4F ISH signal observed throughout the ventral grey matter. (C) B y E l 8 , Sema4F continues to be highly expressed in D R G neurons, but largely declines throughout the ventral spinal cord. (D) B y postnatal day 14, Sema4F ISH signal is not longer detected in the rat D R G . A l l tissue sections were counterstained with haematoxylin. (Scale bar = 250pm) (E) Western blot analysis of Sema4F protein expression in embryonic and postnatal rat D R G s . Sema4F protein levels were analyzed using protein obtained from pooled embryonic (35-45/sample) or postnatal (15-25/sample) D R G s . The results reveal that embryonic rat D R G s express Sema4F as early as E l 3 and expression is maintained until at least E l 6 . Following birth, Sema4F expression is rapidly lost, and is no longer detected in the postnatal and adult D R G . Arrow indicates the protein band corresponding to Sema4F. A n antibody to total actin was to verify equal loading of samples. 155 Fig . 5.1. 156 T a b l e 5 .1 . E f f e c t o f S e m a 4 F a n d / o r Y - 2 7 6 3 2 t r e a t m e n t o n t h e e x t e n s i o n o f E 1 3 a n d E 1 6 D R G n e u r i t e s a c r o s s H E K 2 9 3 c e l l i s l a n d s . The ability of E13 and E16 D R G neurites to extend across control or Sema4F-expressing H E K 293 cell islands was examined by measuring the intensity of P-tubulin immunofluorescence attributed to D R G neurites on both the proximal and distal sides of individual HEK293 cell islands. In turn, this data was used to calculate the ratio of D R G neurites able to successfully traverse a H E K 293 cell island and extend beyond the cell island perimeter. This was done by dividing the intensity of p-tubulin immunofluorescence signal observed on the distal side of a cell islands by the proximal P-tubulin immunofluorescence signal. In addition, a similar quantification was performed to examine the extension of D R G neurites in the presence of 25 u M of the R O C K inhibitor, Y-27632. Numbers shown represent the mean values ± S E M . , while the numbers in brackets represent the number of H E K 293 cell islands analyzed. [Y-27623] E13 DRG E16 DRG Control Sema4F Control Sema4F 0 0.82 ± 0.06 (7) 0.67 ±0.07 (15) 0.99 ±0.04 (8) 0.88 ± 0.06 (20) 25 0.77 ±0.03 (9) 0.46 ±0.05 (19) 0.91 ± 0.04 (9) 0.77 ±0.06 (18) 157 F i g u r e 5 .2 . Y - 2 7 6 3 2 t r e a t m e n t l e a d s t o a s i g n i f i c a n t d e c l i n e i n E 1 3 D R G n e u r i t e e x t e n s i o n a c r o s s S e m a 4 F - e x p r e s s i n g H E K 2 9 3 c e l l i s l a n d s . E l 3 rat D R G explants were cultured in the presence of control H E K 293 cell islands (A, C) or those transfected to express HA-tagged Sema4F (B, D). While 20 ng/mL of N G F was added to each culture, in some experiments, 2 5 p M of Y-27632 was also added to the culture medium immediately following explanting of D R G s (C-D). Thirty-six to 48 hours later, cultures were immunostained an anti-(3-tubulin antibody (red) to identify D R G neurites, and an anti-HA antibody (green) to identify Sema4F-expressing H E K 293 cells. In each image, the D R G cell body is located beyond the bottom of the image, and the direction of neurite outgrowth is towards the top of the image. (A) E13 D R G neurites can successful extend across control H E K 293 cell islands. (B) In contrast, when E l 3 D R G s are cultured in the presence of Sema4F-expressing H E K 293 cell islands, a slight reduction in neurite extension across cell islands is observed. (C) Treatment of E l 3 D R G s with Y-27632 does not alter the ability of E l 3 D R G neurites to extend across control H E K 293 cell islands. (D) A reduction in the extension of E l 3 D R G neurites across Sema4F-expressing cell islands is observed following treatment with Y -27632. Scale bar, 100 um. , ( E ) Analysis of E l 3 NGF-responsive D R G neurite extension across control or Sema4F-expressing H E K 293 cell islands reveals that treatment of neurons with 25 p M of Y-27632 significantly reduces the extension of D R G neurites across Sema4F-expressing H E K 293 cell lines. The ability of D R G neurites to extend across H E K 293 cell islands was calculated by measuring the intensity of P-tubulin immunofluorescence distal and proximal to each cell island, and the ratio of neurites able to extend across H E K 293 cell islands calculated. Data shown represents the mean values ± S E M . A one-way A N O V A with Holm-Sidak post-hoc analysis was used to determine significance between groups. (** Indicates p < 0.001) Control Sema4F 159 Figure 5.3. Y-27632 treatment does not alter the extension of E16 D R G neurites across Sema4F-expressing H E K 293 cell islands. E l 6 rat D R G explants were cultured in the presence of control H E K 293 cell islands (A, C) or those transfected to express HA-tagged Sema4F ( B , D ) . While 20 ng/mL of N G F was added to each culture, in some experiments, 25 u M of Y-27632 was also added to the culture medium immediately following explanting of D R G s (C-D). Thirty-six to 48 hours later, cultures were immunostained an anti-P-tubulin antibody (red) to identify D R G neurites, and an anti-HA antibody (green) to identify Sema4F-expressing H E K 293 cells. In each image, the D R G cell body is located beyond the bottom of the image, and the direction of neurite outgrowth is towards the top of the image. E16 D R G neurites can successful extend across both (A) control and (B) Sema4F-expressing H E K 293 cell islands. Treatment of E16 D R G s with Y-27632 does not alter the ability of neurites to extend across (C) control or (D) H E K 293 cell islands. Scale bar, 100 um. (E) Analysis of E16 D R G neurite extension across control or Sema4F-expressing H E K 293 cell islands. The results reveal that the expression of Sema4F does not significantly inhibit the extension of E16 D R G neurites across H E K 293 cell islands, even following pharmacological inhibition of R O C K activity. The ability of D R G neurites to extend across H E K 293 cell islands was calculated by measuring the intensity of P-tubulin immunofluorescence distal and proximal to each cell island, and the ratio of neurites able to extend across H E K 293 cell islands calculated. Data shown represents the mean values ± S E M . 160 F i g . 5.3. 161 5.5. D I S C U S S I O N 5.5.1. Summary Semaphorins are a heterogeneous group of molecules that mediate a variety of functions in both neuronal and non-neuronal cells. In previous chapters (Chapters 3 and 4), I examined the expression of Sema4F in mature mammalian PNS and C N S neurons following axonal injury. Here, I examined the ability of Sema4F to act in vitro as a short-range, membrane-bound guidance cue for embryonic NGF-responsive rat D R G neurites. The results of this study demonstrate that Sema4F is highly expressed by embryonic rat D R G s and in the embryonic ventral spinal cord. In addition, using an in vitro cell island assay, I showed that Sema4F can inhibit the extension of E13, but not E16, D R G neurites across H E K 29.3 cell islands, but only following treatment with the pharmacological R O C K inhibitor Y-27632. The evidence presented here suggests that Sema4F influences the growth of E l 3 D R G neurites through a process likely to involve the inhibition of the R h o A / R O C K signalling pathway, although further studies must be done before any solid conclusions can be drawn. 5.5.2. The Role of the R h o A / R O C K Signalling Pathway in Mediating Class 4 Semaphorin Signalling In this chapter, I have revealed that Serha4F slightly inhibits the extension of E13 D R G neurites across H E K 293 cell islands, an effect dependent on the pharmacological inhibition of R O C K . (Fig. 5.3) Although it has not yet been determined i f Sema4F signalling requires the inhibition of the R h o A / R O C K signalling pathway, the preliminary evidence present here suggests that a downregulation in the R h o A / R O C K signalling pathway may promote the Sema4F-mediated inhibition of neurite extension. Within the field of semaphorin research, this requirement for the inhibition of the R h o A / R O C K activity to mediate semaphorin signalling is not unique to Sema4F, as recently, a similar downregulation in RhoA activity was observed in non-neuronal cells following Sema4D-mediated p lex in-Bl activation (Barberis et al., 2004; Barberis et al., 2005). Given the fact that several studies have shown that inhibition of the R h o A / R O C K signalling pathways is known to promote neurite outgrowth across inhibitory substrates (Jalink 162 et al., 1994; Lehmann et al., 1999; Bito et a l , 2000; Wahl et al., 2000; Borisoff et a l , 2003; Da Silva et al., 2003), a major question raised by this study is: "What role, if any, does the RhoA/ROCK signalling play in Sema4F-mediated inhibition of neurite outgrowth? " The answer may lie in two recent studies by Barberis and colleagues (2004, 2005) that examined the downstream effectors of the Sema4D receptor, p l ex in -B l . Using non-neuronal cellular migration and cytoskeletal collapse assays, the authors report that Sema4D-mediated activation of p lex in-Bl leads to the downregulation of RhoA signalling and an uncoupling of focal adhesive complexes from the underlying actin cytoskeleton (Barberis et al., 2004; Barberis et al., 2005). This results in the inhibition of integrin-dependent cell adhesion, which, in turn, results in a reduction in cellular attachment to adhesive substrates and abolishes lamellipodia extension, thereby inhibiting cell migration (Barberis et al., 2004; Barberis et al., 2005). Recently, RhoA and R O C K activity in growth cones has been, shown to stabilize the formation of integrin-dependent adhesion sites required for filopodial and lamellipodial membrane protrusions, and is necessary for integrin-dependent growth cone, migration (Woo and Gomez, 2006). Embryonic D R G neurons express a number of integrin subunits (Tomaselli et al., 1993; Venstrom and Reichardt, 1995; Condic et al., 1999; Guan et al., 2003), which suggests that the binding of Sema4F to an unidentified Sema4F receptor on E l 3 D R G growth cones could inhibit the activity of R h o A / R O C K signalling pathway, thus abrogating integrin-dependent growth cone adhesion. The evidence obtained in this study suggests that the chemorepulsive properties of Sema4F may not be sufficient to completely abolish neurite outgrowth across Sema4F-expressing cells, even following Y-27632 treatment, since many neurites still succeed in crossing Sema4F-expressing cell islands. It is interesting to note that the activation of p l ex in -Bl , a known Class 4 semaphorin receptor, results in the suppression of both R-Ras and P A K activity, decreasing integrin-mediated attachment to the extracellular matrix ( E C M ) and promoting actin cytoskeleton disassembly (Oinuma et al., 2004; Vik i s et a l , 2002). Therefore, in the future, it w i l l be important to determine i f these signalling pathways are also involved in Sema4F-mediated inhibition of D R G neurite outgrowth. 163 While the in vivo function of non-neuronally expressed Sema4F is still unknown, the in vitro evidence presented in this chapter suggests that it can influence D R G neurite outgrowth in a contact-dependent manner. Interestingly, Barbaris and colleagues (2004) report that Sema4D-mediated p lex in-Bl activation does not induce cellular detachment from the underlying substratum, but only attenuates cell-substrate adhesion. They suggest that plexin-B 1 signalling may act as a biomolecular 'clutch', inhibiting the adhesion-dependent protrusion of cellular processes. This could allow other molecular cues to alter the path of growth cone extension, as occurs with embryonic commissural axons crossing the ventral midline (Kaprielian et al., 2001), or to induce a change in the growth cone from a motile structure into one involved in synaptic signalling, as neuroligins have been observed to do (Dean and Dresbach, 2006). It is possible that Sema4F could also function to 's low', 'stall ' , or 'redirect' growth cone extension over intermediate or terminal target points, allowing the growth cone time to integrate additional signalling cues. In such a system, downregulation of R h o A / R O C K activity, and the resultant loss of integrin-mediated cellular adhesion, may promote growth cone stalling over Sema4F-expressing cell islands Finally, it must be noted that although Y-27632 is relatively selective inhibitor of R O C K , at higher concentrations (> 25 uM) it has been shown to also inhibit the activity of other several kinases, including protein kinase C (PKC) , cyclic AMP-dependent protein kinase ( P K A ) , mitogen- and stress-activated protein kinase-1 ( M S K 1 ) , and PKC-related protein kinase-2 (PRK2) (Uehata et al., 1997; Davies et al., 2000). Therefore, it is possible that the concentration of Y-27632 used in this study (25 uM), could have also inhibited the activity of additional protein kinases. In order to determine the role, i f any, that the R h o A / R O C K signalling pathway plays in mediating the inhibitory action of Sema4F, a more in depth pharmacological study needs to be undertaken. Not only is it necessary to repeat the in vitro cell island assay using lower concentrations of Y-27632, but additional inhibitors to the R h o A / R O C K signalling such as the C3-exoenzyme, which specifically inactivates Rho (Dillon and Feig, 1995), must be utilized. 164 5.5.3. Class B Plexins as Sema4F Receptors? Analysis of Sema4F m R N A has revealed that Sema4F is robustly expressed in both E13 and E l 6 rat D R G s (Fig. 5.1) which suggests that the differences in the ability of E l 3 and E l 6 D R G neurites to extend across Sema4F-expressing cell islands is not attributable neuronally expressed Sema4F. Instead, the differences in neurite outgrowth may be due to the differential expression of an unidentified Sema4F receptor in E13 and E l 6 D R G neurons. While no Sema4F receptors have been identified, at least one member of the Class B plexin subfamily is known to function as a Class 4 semaphorin receptor. Unfortunately, to date, there are several conflicting reports regarding to the expression patterns of Class B plexins in embryonic mammalian D R G neurons. ISH and R T - P C R analysis has revealed that between E12.5-E14.5, mouse D R G s express both plexin-Bl and plexin-B2 m R N A , but in the mature mouse D R G , only plexin-Bl m R N A is detected (Masuda et al., 2004; Worzfeld et al., 2004). In contrast, a study by Moreau-Fauvarque and colleagues (2003) reported that plexin-Bl m R N A is not expressed in embryonic rat D R G s . Although the expression of Class B plexins was not examined in my study, given the similarities between Sema4F and Sema4D signalling, the possibility exists that the differential expression of one or more members of Class B plexins in E l 3 and/or E l 6 D R G neurons could underlie the differences in Sema4F-mediated inhibition of neurite extension observed. 5.5.4. Conclusion In conclusion, the evidence presented in this study shows that Sema4F reduce the in vitro extension of embryonic E l 3 NGF-sensitive D R G neuritis across H E K 293 cell islands, but only following the pharmacological inhibition of the R h o A / R O C K signalling pathway. C h a p t e r 6 General Discussion 166 6.1 . T H E S I S O V E R V I E W In this thesis, I examined the expression and function of Sema4F in the developing and adult vertebrate nervous system, with the overall objective of addressing two main questions. 1. I n t h e a d u l t v e r t e b r a t e n e r v o u s s y s t e m , d o e s t h e e x p r e s s i o n o f S e m a 4 F i n a x o t o m i z e d n e u r o n s c o i n c i d e w i t h t h e r e g e n e r a t i v e p o t e n t i a l o f t h e i n j u r e d n e u r o n a l p o p u l a t i o n ? The results of my studies can be summarized as follows. Sema4F is detectable in both the developing spinal cord and D R G neurons. However, Sema4F expression levels are very low or undetectable in any of the uninjured adult neuronal populations investigated (i.e. facial motoneurons, spinal motoneurons, rubrospinal neurons, and D R G neurons). Following an acute axonal injury, up-regulation of Sema4F expression is observed in adult neuronal populations that are able to mount a successful regenerative response following injury, such as facial and spinal motoneurons and peripherally axotomized D R G neurons. In contrast, an up-regulation of Sema4F is not observed in axotomized adult neuronal populations that lack a robust regenerative response, such as rubrospinal neurons and D R G neurons subjected to a dorsal rhizotomy that disrupts their centrally projecting axons. This correlation between the expression of Sema4F following axotomy and the regenerative ability of the particular adult neuronal population suggests that Sema4F may play a positive role in the regenerative process. 2. C a n S e m a 4 F f u n c t i o n i n h i b i t t h e e x t e n s i o n o f e m b r y o n i c D R G n e u r i t e s i n c u l t u r e ? The results of my studies can be summarized as follows. Using an in vitro cell island assay, I found a significant reduction in the ability of E l 3 NGF-responsive D R G neurites to extend across Sema4F-expressing H E K 293 cells islands, but only following treatment with a pharmacological inhibitor to R O C K . In contrast, there was no significant reduction in E16 N G F -responsive D R G neurites extension across Sema4F-expressing H E K 293 cell islands, even following the pharmacological inhibition of R O C K . These results indicate that while neuronally-expressed Sema4F may function as a growth promoting cue in the injured adult vertebrate PNS, in culture, Sema4F functions as a membrane-bound cue to ' s low' , 'stall ' , or 'redirect' the 167 extension of NGF-responsive E13 D R G neurites. The involvement of the R h o A / R O C K signalling pathway in mediating the inhibitory properties of Sema4F is not clearly understood, and this area requires further study. In this thesis, much of the discussion pertaining to the experimental results has been covered in each individual chapter. The goal of this chapter is to examine several of the topics in more detail, as well as to outline some future directions for the study of Sema4F. 168 6.2. IS IT P O S S I B L E T O F O R M U L A T E A S I N G L E H Y P O T H E S I S F O R S E M A 4 F F U N C T I O N IN T H E D E V E L O P I N G A N D A D U L T N E R V O U S S Y S T E M ? Throughout this thesis, I investigated two very different questions regarding the function of Sema4F. First, in Chapters 3 and 4,1 examined the in vivo expression of Sema4F in the mature mammalian P N S and C N S following injury. The goal of this study was to determine i f the expression of Sema4F in axotomized neurons correlates with their relative regenerative potential. The results led me to propose that neuronally-expressed Sema4F plays a role in mediating the (re)-establishment or stabilization of peripheral or central synapses after injury. In contrast, the in vitro studies in Chapter 5 focused on the ability of Sema4F to function as a membrane-bound guidance cue. The results of this study led to the proposal that Sema4F can function as an inhibitory guidance cue which could act to 's low', 'stall ' , or 'redirect' the growth of embryonic D R G growth cones. Given the conflicting proposed functions for Sema4F in light of the results of the regeneration and in vitro studies presented here, the question remains: Is it possible to outline a hypothesis for Sema4F function that consolidates the evidence from these very different experimental systems? Unfortunately, although we now have a better idea of the expression and function of Sema4F in the embryonic and adult nervous system, the current answer to this question is, "not yet." The absence of a specific anti-Sema4F antibody for use in immunocytochemistry studies precludes the examination of the cellular localization of the Sema4F protein, which would allow investigators to determine i f Sema4F is localized to dendrites or enriched in the growth cone of peripherally axotomized neurons. Similarly, like many other membrane-associated semaphorins, neither the physiological binding partner(s), nor the intracellular signalling pathway(s) mediating Sema4F activity have been identified. The lack of knowledge surrounding the intracellular signalling pathways activated by Sema4F is particularly limiting; given that Sema4F possesses several cytoplasmic protein-binding domains (Encinas et al., 1999; Schultze et al., 2001) it is possible that Sema4F could not only function as a transmembrane ligand, but also a bifunctional signalling molecule. Therefore, at this time, it is not possible to categorically define Sema4F's function. 169 6.3. C O U L D R E C E P T O R S F O R O T H E R M E M B R A N E - A S S O C I A T E D S E M A P H O R I N S A L S O M E D I A T E S E M A 4 F F U N C T I O N IN R E G E N E R A T I N G M O T O N E U R O N S ? 6.3.1. Introduction In this thesis, I have offered several hypotheses relating to the function of Sema4F expressed by axotomized adult PNS neurons. First, Sema4F protein could become localized to the regenerating growth cone, where it could contributes to axonal regeneration and the (re)-establishment of motor and sensory synaptic connections with denervated peripheral targets. Second, Sema4F could become dendritically localized following neuronal axotomy, where it could play a post-synaptic role in reversing the loss of dendritic innervation which often occurs. These concepts are largely based on evidence obtained from studying Sema4F expression in axotomized motoneurons: First, the up-regulation of Sema4F m R N A observed in axotomized motoneurons corresponds to an increase Sema4F immunoreactivity in the distal nerve at the stage during which motor axons are beginning to contact denervated targets (Fig. 3.3). Second, the time course of Sema4F m R N A expression in axotomized motoneurons corresponds to the onset of synaptic loss within the dendritic tree of axotomized motoneurons (Section 4.5.3). In the following sections, I w i l l further explore the idea that Sema4F could contribute to axonal regeneration and the (re)-establishment of synaptic connections within denervated muscle targets. Evidence from a number of studies has revealed that several known semaphorin receptors, some of which might also mediate Sema4F signalling, are expressed by Schwann cells located within adult vertebrate PNS nerves. Following axonal injury, Sema4F expressed on the growth cones of regenerating motor axons may interact with these Schwann cell expressed receptors, resulting in the activation of signalling pathways within either the Schwann cell or the regenerating growth cone. In addition, at least one Class 4 semaphorin co-receptor, ErbB2, is expression in mature skeletal muscle, where it may also function as a component of a Sema4F receptor complex located within the N M J . 170 Finally, due to the fact that I was unable to determine i f Sema4F is localized to dendritic processes in axotomized neurons, I wi l l limit my discussion to that of possible Sema4F-receptor interactions in the peripheral nerve and at the N M J . 6.3 .2 . C o u l d P l e x i n s S e r v e as R e c e p t o r s f o r S e m a 4 F E x p r e s s e d b y I n j u r e d N e u r o n s ? To date, no receptor(s) for Sema4F have been identified. However, plexins are known to function as receptors for a number of invertebrate and vertebrate semaphorins (Chedotal et al., 2005; Yazdani and Terman, 2006). Although several studies have examined plexin expression in adult neurons following a PNS injury (Pasterkamp and Verhaagen, 2001; De Winter et al., 2002a), little is known about the spatial and temporal expression of plexins by non-neuronal cells located in the degenerating distal.nerve or at the NMJ. . Despite this lack of knowledge regarding the injury-induced expression of plexins in peripheral nerves, a recent study by Ara and colleagues (2005) revealed that postnatal Schwann cells located within the uninjured sciatic nerve express a number of Class A plexins (p lex in-Al , - A 2 , and -A3) . Unlike Class B plexins, members of the Class A plexin subfamily have not been shown to function as receptors for Class 4 semaphorins. Nonetheless, plexin-A4 has been shown to function as a receptor for the transmembrane semaphorins Sema6A and Sema6B (Suto et al., 2005), which indicates that Class A plexins, much like plexins from other sub-classes, can also act as receptors for membrane-associated semaphorins. Therefore, although the Schwann cell expression of plexins following a PNS lesion has not been examined, given that Schwann cells have been observed to express multiple plexins and that Class A plexins can function as receptors for transmembrane semaphorins, it is possible that plexins expressed on Schwann cells could serve as receptors for the Sema4F expressed on regenerating axons. 6 .3 .3 . E r b B 2 is E x p r e s s e d b y S c h w a n n C e l l s w i t h i n t h e D e g e n e r a t i n g D i s t a l N e r v e F o l l o w i n g S c i a t i c N e r v e L e s i o n Despite the fact that our knowledge of plexin expression following PNS injury is limited, the injury-induced expression of several other transmembrane receptors known to potentiate Class 4 semaphorin signalling has been described. ErbB2 is a member of the Epidermal Growth Factor 171 (EGF) family of receptor tyrosine kinases that serves as receptors for a number of ligands, including E G F , as well as the Neuregulin-1 family of growth and differentiation factors (Olayioye et al., 2000; Hynes et a l , 2001). One of four ErbB family members (ErbBl-4) , ErbB2 is distinctive as it has no known ligands, but instead functions as a signal-transducing component of a heteromeric receptor complex (Olayioye et al., 2000; Hynes et al., 2001). Along with its ability to dimerize with other members of the ErbB family, ErbB2 has also been shown to stably associate in a receptor complex with p lex in-Bl (Swiercz et al., 2004). Furthermore, binding of Sema4D to plexinB 1 stimulates the intrinsic tyrosine kinase activity of ErbB2, resulting in the phosphorylation of both ErbB2 and plexinB 1 and, subsequently, Sema4D-mediated growth cone collapse (Swiercz et al., 2004). ErbB2 is known to be a required component of the Sema4D signalling complex, since a dominant negative form of ErbB2 blocks activation of the RhoA signalling pathway and prevents Sema4D-induced growth cone collapse in primary hippocampal neurons (Swiercz et al., 2004). Given the evidence that ErbB2 is required to mediate signalling of Sema4D, could it also play a role in mediating Sema4F signalling in the injured adult PNS? ErbB2 is highly expressed by Schwann cells in the embryonic and postnatal P N S , where it mediates Schwann cell differentiation, survival, and proliferation, as well as the postnatal myelination of PNS nerves (Dong et al., 1995; Morrissey et al., 1995; Trachtenberg and Thompson, 1996; Garratt et al., 2000). In the mature P N S , ErbB2 expression is largely undetectable (Cohen et al., 1992). However, following a sciatic nerve lesion, Schwann cells within the degenerating distal nerve strongly upregulate ErbB2 expression, and increased ErbB2 immunoreactivity is observed in the distal nerve as early as 5 days after injury (Carroll et al., 1997; K w o n et al., 1997). Given the evidence that ErbB2 is known to serve as a Class 4 semaphorin co-receptor, and that up-regulation of ErbB2 expression in the distal nerve stump occurs at time during which motor axons are extending into the degenerating nerve, ErbB2 could contribute to the formation of a receptor complex for Sema4F expressed on regenerating motor axons. 172 6.3 .4 . T h e T y r o s i n e K i n a s e R e c e p t o r , M e t , is E x p r e s s e d i n t h e D e g e n e r a t i n g D i s t a l N e r v e S t u m p F o l l o w i n g a S c i a t i c N e r v e L e s i o n Along with ErbB2, evidence suggests that a second receptor tyrosine kinase expressed by Schwann cells in the degenerating distal nerve could also serve a component of the Sema4F receptor complex. Four days following a sciatic nerve ligation, Schwann cells located in the degenerating distal nerve also upregulate the expression of Met, a receptor tyrosine kinase which serves as a receptor for Hepatocyte Growth Factor (HGF) (Hashimoto et al., 2001). Like ErbB2, Met has also been shown to interact with p lexin-Bl to form a functional Sema4D receptor complex (Giordano et al., 2002). In much the same way that ErbB2 potentiates Sema4D signalling, the interaction of Sema4D with p lex in-Bl activates the intrinsic tyrosine kinase activity of Met, resulting in the phosphorylation of both Met and plexin-B 1 and the induction of downstream signalling pathways (Giordano et al., 2002). Given the expression pattern of Met in the injured P N S , along with the evidence that Met can function as a Class 4 semaphorin co-receptor, it is possible that Met could mediate Sema4F signalling in the injured PNS. 6 .3 .5 . A R o l e f o r S e m a 4 F S i g n a l l i n g i n t h e I n j u r e d P N S ? 6 .3 .5 .1 . S e m a 4 F S i g n a l l i n g W i t h i n t h e D e g e n e r a t i n g D i s t a l N e r v e S t u m p If Sema4F expressed on regenerating growth cones interacts with receptors expressed by Schwann cells located within the degenerating distal nerve stump, what function might such an interaction mediate? First, following a peripheral nerve injury, Schwann cells within the degenerating distal nerve do not immediately upregulate the expression of either ErbB2 or Met. Instead, Schwann cells upregulate ErbB2 and Met expression several days following injury, a time course which coincides with the extension of Sema4F-expressing axons into the degenerating distal nerve stump. Therefore, as regenerating axons begin to penetrate the distal nerve stump, axonally expressed Sema4F could interact with plexin/ErbB2 and/or plexin/Met receptor complexes located on Schwann cells, and in doing so, alter intracellular signalling cascades involved in mediating Schwann cell proliferation or myelination. Alternatively, the binding of Sema4F to a receptor complex could also serve to transduce a signal back into the 173 regenerating growth cone. Following a sciatic nerve lesion, terminal Schwann cells at the N M J play an important role in mediating axonal regeneration by extending processes believed to guide regenerating motor axons back to their original synaptic sites (Love and Thompson, 1998). If Sema4F is able to transduce a signal back into the growth cone, it is possible that a Sema4F receptor expressed on Schwann cells could function as a guidance cue that promotes the regeneration of motor axons towards denervated muscle targets. Such an idea is particularly intriguing given the observation that following a facial nerve crush, Sema4F expression in axotomized facial motoneurons is down-regulated at a time in which regenerating axons have presumably reached their denervated muscle targets. 6.3.5.2. Sema4F Signalling at the Neuromuscular Junction If it turns out that Sema4F does not interact with receptors expressed by Schwann cells in the degenerating nerve, could Sema4F instead play a more direct role in mediating the reinnervation of the N M J following axotomy? There is evidence that ErbB2 is highly expressed in muscle cells of both mature and developing skeletal muscle, and is highly concentrated at the N M J (Altiok et al., 1995; Moscoso and Sanes, 1995). Although the expression of ErbB2 in denervated muscle is unknown, it is possible that ErbB2 expression at the N M J may be maintained following the loss of motor axon innervation. Given the ability of the ErbB2 to function as a component in the Sema4D receptor complex, it is possible that ErbB2 could function as component of a Sema4F receptor complex at the N M J , although the downregulation in Sema4F expression observed at the time of target contact argues against this possibility. 6.3.6. Summary In summary, evidence from the literature reveals that several receptors known to mediate transmembrane semaphorin signalling are expressed in the postnatal PNS and/or following PNS injury. Although it is possible that these receptors functionally interact with Serha4F expressed by regenerating PNS axons, none have yet been shown to bind Sema4F. The identification and characterization of the receptor(s) for Sema4F would be extremely valuable in the effort to delineate the role of Sema4F in axotomized PNS neurons. 174 6.4. SEMA4F AS AN INHIBITOR OF SENSORY NEURITE EXTENSION Unlike many semaphorins, the evidence presented in this thesis and in the literature suggests that Sema4F does not function as a strong repulsive guidance cue. Although Encinas and colleagues (1999) found that Sema4F can induce collapse of embryonic chick retinal ganglion growth cones, Sema4F does not induce growth cone collapse in several other neuronal populations, including embryonic D R G neurons. However, using an in vitro cell island assay, I discovered that Sema4F can reduce the extension of E l 3 NGF-sensitive D R G neurites across HEK293 cell islands following inhibition of R O C K activity. This suggests that Sema4F could function in vivo as a guidance cue for developing vertebrate sensory neurons. Using what is known about the time course of peripheral sensory innervation of the developing limbs and spinal cord is it possible to form a hypothesis as to the role of Sema4F in the developing nervous system? Studies on the time course of sensory fibre innervation in the developing rat reveal that between embryonic day 13 and 14, TrkA-positive (i.e. NGF-sensitive) D R G fibres begin to penetrate the developing hindlimb, although innervation is highly restricted at this stage and fibres do not enter the epidermis (Jackman and Fitzgerald, 2000). However, by E l 6 , TrkA-positive D R G fibres begin to penetrate and innervate targets within the lateral and medial epidermis (Jackman and Fitzgerald, 2000). In contrast, at E l 6 , centrally-projecting TrkA-positive sensory fibres are still largely excluded from the dorsal horn of the spinal cord, and are restricted mainly to the superficial white matter (Jackman and Fitzgerald, 2000). With this developmental data, it is tempting to speculate that Sema4F could play a role in inhibiting the extension of E13 NGF-sensitive sensory axons into the periphery. Currently, there is insufficient evidence to either prove or disprove this hypothesis. While Sema4F inhibits the extension of E l 3 D R G neurites in culture, it is unknown whether Sema4F is actually expressed in the E l 3 hindlimb. However, the observation that Sema4F expression between E l 3 and E16 is largely limited to regions of the ventral cord (Fig 5.1) suggests that Sema4F does not have a role in the sensory fibre innervation, which occurs in the dorsal spinal cord. In order to determine i f Sema4F plays a role in mediating the sensory neuron innervation of the developing embryo, a number of issues must be addressed. First, ISH and, when available, 175 immunohistochemistry studies must be performed to determine i f Sema4F is expressed in the developing musculature and epidermis. In addition, E13 D R G neurons are likely to possess an as yet unidentified Sema4F receptor, which is not expressed by, or is not functionally coupled to the R h o A / R O C K signalling pathway in E l 6 D R G neurons. Therefore, as mentioned in the previous section, the identification of the receptor(s) for Sema4F would be invaluable to continuing these lines of investigation. 176 6.5. SEMA4F A S A B I F U N C T I O N A L S I G N A L L I N G M O L E C U L E ? Traditionally, studies of neuronal and/or growth cone guidance cues have focused on the identification of unidirectional ligand-receptor systems. In these signalling systems, a ligand, consisting of a secreted or membrane-associated protein, imparts unidirectional guidance information on a growth cone or neuron expressing the concomitant receptor. In the semaphorin family, such a signalling arrangement exists for secreted Class 2, Class 3, and Class 8 semaphorins, which signal through a number of related receptor complexes but do not signal back into the cell that expresses them (Kruger et al., 2005; Yazdani and Terman, 2006). However, unlike this unidirectional signalling system, evidence from a growing number of molecular and biochemical studies has revealed that several membrane-associated semaphorins and their receptors may possess the ability to mediate intracellular signalling in both the ligand-and receptor-expressing cells (Kruger et al., 2005; Yazdani and Terman, 2006). Although a relatively recent concept in the semaphorin field, these bi-directional signalling systems have been observed to occur in a number of different protein families involved in growth cone guidance, the foremost among them being the ephrins-Eph system (Cowan and Henkemeyer, 2002; Pasquale, 2005; Vearing and Lackmann, 2005). In the semaphorin field, the best studied example of bidirectional signalling is the invertebrate transmembrane semaphorin, Semala. In the developing Drosophila nervous system, Semala has been observed to act as a ligand that can induce the defasciculation of embryonic motor axons via interaction with the PlexA/Otk receptor complex (Winberg et al., 2001). In addition, Drosophila Semala can also function as a receptor required for the proper assembly of both the giant fibre synapse and guidance of photoreceptor axons. This process requires the interaction of the Semala intracellular domain with Enabled (Ena), a suppressor of Abelson (Abl) tyrosine kinase (Godenschwege et al., 2002; Cafferty et al., 2006). Similar to Semala, the cytoplasmic domains of several vertebrate semaphorins have also been shown to interact with intracellular signalling or cytoskeletal proteins. For example, members of the Class 6 semaphorin family possess large, proline-rich cytoplasmic domains which serve as binding sites for a number of intracellular tyrosine kinases including A b l and c-Src, as well as members of the Ena /VASP (enabled/vasodilator-stimulated phosphoprotein) family of actin regulatory proteins (Eckhardt 177 et al., 1997; Klostermann et al., 2000; Toyofuku et a l , 2004a). A s well , Sema4D has also been shown to interact with an unidentified Ser/Thr kinase (Elhabazi et al., 1997). Given the structure of the Sema4F intracellular domain, it is possible that Sema4F could interact with a number of intracellular signalling molecules, although this topic has not, for the most part, been investigated. L ike Class 6 semaphorins, the intracellular domain of Sema4F contains several proline-rich domains, a single cyclic nucleotide-dependent protein kinase phosphorylation site, as well as a single a P D Z protein binding domain, all of which could mediate interactions with intracellular signalling or cytoskeletal proteins (Encinas et al., 1999; Schultze et al., 2001). Therefore, although the prerequisite studies have not yet been done, it is possible that Sema4F may act as a bifunctional signalling molecule with the ability to transduce signals back into the cell on which it is expressed. 178 6.6. FUTURE DIRECTIONS In this thesis, I have presented evidence • that Sema4F m R N A expression is significantly upregulated in adult neuronal populations known to mount a regenerative response following axotomy. This result, combined with the evidence that Sema4F expression is not upregulated in neurons that fail to regenerate following injury, suggests that Sema4F may play a role in the regenerative process. In addition, in vitro functional studies have shown that Sema4F possesses the ability to reduce the ability of NGF-responsive E13 D R G neuritis to extend across HEK293 cell islands, an effect that may involve inhibition of the R h o A / R O C K signalling pathway. Although these findings provide insight into possible functions of Sema4F in the embryonic and regenerating nervous system, many questions remain. In the following section, I wi l l outline several topics which I believe must be addressed in order to better understand the mechanism of Sema4F action in the nervous system. 1. Where is Sema4F localized in neurons? Throughout this thesis, I have used a number of techniques to examine the expression of Sema4F in the developing and adult vertebrate nervous system. The results I obtained have allowed me to develop several different hypotheses regarding Sema4F function in neurons. These hypotheses differ in the assumptions I made regarding the localization of Sema4F protein in neurons (i.e. dendritic processes, axonal processes, or both). These assumptions were made because I was unable to examine the distribution of Sema4F protein in neurons due to specificity issues with the anti-Sema4F antibody obtained for use in this study. Therefore, I have been unable to determine i f Sema4F protein is localized to dendritic or axonal processes in developing or injured neurons. This, unfortunately, hinders the formulation of a more concrete hypothesis regarding the role of Sema4F in the nervous system. In order to gain a better understanding of Sema4F's role in neurons, it wi l l be important to develop new antibodies that are specific to Sema4F for use in immunohistochemical studies. Although the production of highly specific antibodies to semaphorins has proven problematic since many semaphorins share large regions of homology, the development of new Sema4F-179 specific antibodies is necessary for the field to progress. While the expression and function of semaphorins can be studied in an in vitro assay by transfecting cells to express a recombinant semaphorin containing an easily identifiable protein 'tag' (such as the hemagglutinin tag utilized in this study), such a process cannot easily be utilized for in vivo studies. The development of new Sema4F antibodies w i l l lend much to our understanding of the function of Sema4F by allowing for a more thorough investigation into the spatial and temporal expression of Sema4F in both the developing embryo as well as in the injured adult nervous system. 2. Can Plexins serve as receptors for Sema4F? In Section 6.3,1 outlined two transmembrane receptors (ErbB and Met receptor tyrosine kinases) which, based on their expression patterns and ability to function as co-receptors for Sema4D, could hypothetically serve as components of a Sema4F receptor complex. However, neither receptor has been shown to mediate Sema4F signalling. Clearly, the identification of Sema4F receptors is essential in the development of any concrete hypotheses on Sema4F function. Given that plexins have been shown to function as receptors for several membrane-associated semaphorins (Winberg et al., 1998b; Artigiani et al., 2004; Chabbert-de Ponnat et al., 2005; Suto et al., 2005), including at least one member of the Class 4 semaphorin subfamily (Tamagnone et al., 1999), it is possible that plexins may also mediate Sema4F signalling. In the semaphorin field, many studies reporting semaphorin-plexin interactions utilize an in vitro alkaline phosphatase assay to demonstrate receptor-ligand interactions (Winberg et al., 1998a; Tamagnone et al., 1999; Artigiani et a l , 2004; Chabbert-de Ponnat et al., 2005; Suto et al., 2005). Therefore, this process could also be employed to determine i f members of the plexin family can interact with Sema4F. In such a study, cells transfected to express different candidate plexins would be incubated with a recombinant Sema4F protein consisting of the extracellular domain of Sema4F fused to a placental secreted alkaline phosphatase (AP) domain. If Sema4F interacts with any of the candidate plexins, this would be reflected in an observable increase in the A P activity on the surface of transfected cells. Following the identification of candidate plexins, growth cone and cellular collapse assays could be used to demonstrate the ability of candidate plexins to transduce Sema4F signals. If one or more members of the plexin subfamily 180 are shown to function as Sema4F receptors, neurons lacking the expression of the. candidate plexin are likely to be resistant to Sema4F-mediated growth cone collapse or inhibition. Since several different lines of plexin-knockout mice exist (Suto et al., 2005; Walzer et al., 2005; Yaron et al., 2005), it may be possible investigate the ability of plexins to serve as receptors for Sema4F by repeating the neurite extension study performed in Chapter 5 using embryonic neurons obtained from plexin-null mice. Identification of one or more Sema4F receptor(s) is of great interest, as it would allow for the identification of embryonic neuronal or non-neuronal cell populations that may be sensitive to Sema4F signalling. In addition, knowledge of potential receptors would also facilitate studies of the downstream intracellular signalling pathways that mediate Sema4F action. 3. Is Sema4F required for nervous system development and axonal regeneration? Evidence present by Encinas and colleagues (1999) (and expanded on in this study), have revealed that Sema4F is highly expressed in the embryonic mammalian nervous system, and is particularly prevalent in D R G s and the ventral spinal cord. (Fig. 5.1) B y embryonic day 13, a time point coinciding with the onset of motor and sensory fibre innervation of peripheral targets, Sema4F mRNA expression is detected in both embryonic D R G s as well as throughout the ventral spinal cord (Mimics and Koerber, 1995; Jackman and Fitzgerald, 2000; Lomo, 2003). Despite these observations, it is unknown i f Sema4F is required for normal nervous system development. In order to address the physiological function of Sema4F in the developing nervous system, it may prove worthwhile to undertake the generation of a Sema4F knockout mouse. Generation of a Sema4F-nu\\ mouse w i l l allow researchers to better investigate the function of Sema4F in the developing nervous system. Despite the fact that the inactivation of some semaphorin genes results in embryonic or perinatal lethality (Behar et al., 1996; Feiner et al., 2001; Fiore et al., 2005), many semaphorin-null mice, including several lacking Class 4 semaphorins, remain viable (Sahay et al., 2003; Rice et al., 2004; Kumanogoh et al., 2005). Survival of Sema4F-null mice into adulthood would be especially beneficial, as it would allow for the use of these mice in axonal regeneration studies to examine the role of Sema4F in PNS regeneration. Using a peripheral nerve injury model (ex. facial or sciatic nerve crush), investigators could analyze 181 axonal regeneration in these systems to determine i f the absence of Sema4F results in alterations to the rates of axonal regeneration, Schwann cell myelination, or re-innervation of peripheral targets. 4. Does the up-regulation of Sema4F mRNA expression in peripherally axotomized DRG neurons coincide with the development of neuropathic pain? The final topic for future study I wish to address is the possibility that the expression of Sema4F in peripherally axotomized D R G neurons may be related to the development of neuropathic pain, a subject I touched upon briefly in Chapter 4. ISH analysis has shown that resection of the spinal nerve, which axotomizes the peripherally-projecting axons of D R G neurons, results in the up-regulation of Sema4F m R N A expression in subset of small and medium-sized D R G neurons. (Fig. 4.3) In addition, this injury also results in the axotomy of peripherally-projecting sympathetic axons originating from the adjacent sympathetic ganglia, and results in the formation of a neuroma, a disorganized bulbous swelling within the terminal region of the proximal nerve stump composed primarily of axons and Schwann cells (Kryger et al., 2001). Although the majority of axotomized sensory axons terminate within the neuroma, at least a subset of axotomized sympathetic axons do not (Zhang et al., 1996; Kryger et al., 2001). Instead, as early as 2 days following spinal nerve resection, these axotomized sympathetic axons project proximally into the adjacent sensory ganglia (Chung et al., 1996; Ramer et al., 1999). There, sympathetic fibres terminate in close proximity to the somata of axotomized D R G neurons, sometimes encasing them in structures termed 'sympathetic baskets' (Chung et al., 1996; Chung et al., 1997; Ramer and Bisby, 1998; Chung and Chung, 2001). This invasion of sympathetic fibres peaks several weeks after injury and, although levels slowly decline thereafter, sympathetic innervation of the injured D R G remains elevated for at least 5 months after injury (Chung et al., 1996; Ramer and Bisby, 1998). In turn, this increased sympathetic innervation has been shown to correlate with the onset of neuropathic pain responses which, in injured animals, becomes fully developed within 3 days of injury. This increased sensitivity to pain remains highly elevated in injured animal for several weeks before gradually declining towards pre-injury levels over the course of several months (Chung et al., 1996). 182 Although the evidence is largely correlative, it is possible that up-regulation of Sema4F expression in peripherally axotomized D R G neurons plays a role in the development of neuropathic pain. First, both the formation of sympathetic baskets and the up-regulation of Sema4F m R N A expression in D R G s only occur in response to a spinal nerve lesion, and neither is observed following a dorsal rhizotomy (Ramer et al., 1999). Furthermore, the time course of Sema4F m R N A expression in axotomized D R G neurons parallels that of sympathetic basket formation and the onset of neuropathic pain behaviours in the injured animals. (Fig. 4.2) Most significantly, sympathetic baskets have been observed to form transiently around a population of small diameter D R G neurons shortly after the spinal nerve ligation (< 4 weeks) and only at later time points (> 4 weeks) do they become associated with large diameter D R G neurons (Chung et al., 1996; Ramer and Bisby, 1998). Similarly, ISH analysis has shown that Sema4F m R N A expression is preferentially upregulated in smaller D R G neurons for at least 2 weeks after injury (Fig. 4.3), the same population of D R G neurons preferentially encapsulated by sympathetic fibres at this time point (Chung et al., 1996). Given the evidence outlined above, it would be interesting to expand on the Sema4F studies performed in this thesis to determine i f a link exists between Sema4F expression in peripherally-axotomized D R G neurons and the development of neuropathic pain. Provided that more specific anti-Sema4F antibodies are generated, immunohistochemistry could be used to determine i f Sema4F protein is localized to the cell soma of axotomized D R G neurons, in close proximity to sympathetic fibres. In addition, although I did not examine the expression of Sema4F in axotomized D R G neurons at later time points (> 2 weeks after injury) the initial ISH study could be expanded to determine i f Sema4F m R N A expression is upregulated in larger diameter D R G neurons at later time points. Finally, embryonic sympathetic neurons express both ErbB2 as well as several plexins, including one (plexin-A4) previously shown to function as a receptor for Class 6 semaphorins (Britsch et al., 1998; Murakami et al., 2001; Suto et al., 2005; Yaron et al., 2005). Therefore, it would be of interest to examine the expression of both plexins and ErbB2 in axotomized sympathetic neurons to determine i f they could serve as receptors for, Sema4F expressed by axotomized D R G neurons, and play a role in the development of neuropathic pain. 183 6.7. CONCLUSIONS From the initial identification in 1992 of a chemorepulsive axonal guidance molecule in the developing grasshopper embryo, the semaphorin gene family has grown to include almost 30 members, the vast majority of which are expressed in vertebrates. Although best known for their role in mediating nervous system development, an increasing number of studies have shown that semaphorins play a role in a wide variety of biological processes. In this thesis, I examined the expression and function of Sema4F in both the mature and embryonic vertebrate nervous system with the overall objective of addressing two main questions. First, I asked: Does the expression of Sema4F in axotomized adult vertebrate neurons coincide with the regenerative potential of the injured neuronal population? The results of my studies have revealed that a number of neuronal populations able to mount a strong regenerative response after axonal injury also upregulate the expression of Sema4F, a process not observed in axotomized neuronal populations lacking this response. Second, I asked: Can Sema4F inhibit the extension of embryonic primary sensory neurons in culture? Using an in vitro cell island assay, I found a significant reduction in the ability of E13 NGF-responsive D R G neurites to extend across Sema4F-expressing H E K 293 cells islands, but only following treatment with a pharmacological inhibitor to R O C K . In contrast, there was no significant reduction in E l 6 N G F -responsive D R G neurites extension across Sema4F-expressing H E K 293 cell islands, even following the pharmacological inhibition of R O C K . Although the role of Sema4F in both the developing and regenerating vertebrate nervous system is still unknown, in this thesis, I have proposed four potential roles for Sema4F which could explain the data obtained from these very different experimental systems. 1) Sema4F functions as an axonal guidance cue for developing or regenerating neurons. 2) Sema4F plays a role in mediating the (re)-formation of peripheral synapses during embryogenesis or following a peripheral nerve lesion. 3) Sema4F contributes to the (re)-establishment of dendritic innervation during embryogenesis or following the 'synaptic stripping' which often occurs following a peripheral nerve lesion. 4) Following a spinal nerve injury, Sema4F mediates the creation of 184 aberrant sympathetic/DRG synaptic contacts associated with the development of neuropathic pain. M y decision to examine Sema4F expression came about as the result of a R T - P C R pilot study in the summer of 2000. A t the time, very little information regarding the expression and function of membrane-associated semaphorins in the adult vertebrate nervous system existed. Today, although more is known about the expression and function of membrane-associated semaphorins in the developing nervous system, detailed knowledge of the spatial and temporal expression patterns of many semaphorins in the adult vertebrate nervous system is still not available. Although there are many unanswered questions regarding the role of Sema4F in the developing and mature nervous system, it remains an important field of study. M y hope is that the findings presented in this thesis w i l l not only contribute to this growing field, but also stimulate additional research into this difficult but rewarding area of research. 185 BIBLIOGRAPHY Acheson A , Barker P A , Alderson R F , Mi l le r F D , Murphy R A (1991) Detection of brain-derived neurotrophic factor-like activity in fibroblasts and Schwann cells: inhibition by antibodies to N G F . Neuron 7:265-275. Achim C L , Katyal S, Wiley C A , Shiratori M , Wang G , Oshika E , Petersen B E , L i J M , Michalopoulos G K (1997) Expression of H G F and cMet in the developing and adult brain. Brain Res Dev Brain Res 102:299-303. Adams R H , Betz H , Puschel A W (1996) A novel class of murine semaphorins with homology to thrombospondin is differentially expressed during early embryogenesis. Mech Dev 57:33-45. Adams R H , Lohrum M , Klostermann A , Betz H , Puschel A W (1997) The chemorepulsive activity of secreted semaphorins is regulated by furin-dependent proteolytic processing. Embo J 16:6077-6086. Akimoto M , Baba A , Ikeda-Matsuo Y , Yamada M K , Itamura R, Nishiyama N , Ikegaya Y , Matsuki N (2004) Hepatocyte growth factor as an enhancer of nmda currents and synaptic plasticity in the hippocampus. Neuroscience 128:155-162. Al t iok N , Bessereau JL , Changeux JP (1995) ErbB3 and ErbB2/neu mediate the effect of heregulin on acetylcholine receptor gene expression in muscle: differential expression at the endplate. Embo J 14:4258-4266. Ara J, Bannerman P, Shaheen F, Pleasure D E (2005) Schwann cell-autonomous role of neuropilin-2. J Neurosci Res 79:468-475. Ara J, Bannerman P, Hahn A , Ramirez S, Pleasure D (2004) Modulation of sciatic nerve expression of class 3 semaphorins by nerve injury. Neurochem Res 29:1153-1159. Arimura N , Inagaki N , Chihara K , Menager C, Nakamura N , Amano M , Iwamatsu A , Goshima Y , Kaibuchi K (2000) Phosphorylation of collapsin response mediator protein-2 by Rho-kinase. Evidence for two separate signalling pathways for growth cone collapse. J B io l Chem 275:23973-23980. Artigiani S, Comoglio P M , Tamagnone L (1999) Plexins, semaphorins, and scatter factor receptors: a common root for cell guidance signals? I U B M B Life 48:477-482. Artigiani S, Barberis D , Fazzari P, Longati P, Angelini P, van de Loo JW, Comoglio P M , Tamagnone L (2003) Functional regulation of semaphorin receptors by proprotein convertases. J B i o l Chem 278:10094-10101. 186 Artigiani S, Conrotto P, Fazzari P, Gilestro G F , Barberis D , Giordano S, Comoglio P M , Tamagnone L (2004) Plexin-B3 is a functional receptor for semaphorin 5A. E M B O Rep 5:710-714. Astic L , Saucier D (2001) Neuronal plasticity and regeneration in the olfactory system of mammals: morphological and functional recovery following olfactory bulb deafferentation. Cel l M o l Life Sci 58:538-545. Astic L , Pellier-Monnin V , Saucier D , Charrier C, Mehlen P (2002) Expression of netrin-1 and netrin-1 receptor, D C C , in the rat olfactory nerve pathway during development and axonal regeneration. Neuroscience 109:643-656. Aurandt J, V ik i s H G , Gutkind JS, A h n N , Guan K L (2002) The semaphorin receptor p lexin-Bl signals through a direct interaction with the Rho-specific nucleotide exchange factor, L A R G . Proc Natl Acad Sci U S A 99:12085-12090. Aver i l l S, M c M a h o n SB, Clary D O , Reichardt L F , Priestley J V (1995) Immunocytochemical localization of t rkA receptors in chemically identified subgroups of adult rat sensory neurons. Eur J Neurosci 7:1484-1494. Ayoob JC, Y u H H , Terman JR, Kolodkin A L (2004) The Drosophila receptor guanylyl cyclase Gyc76C is required for semaphorin-la-plexin A-mediated axonal repulsion. J Neurosci 24:6639-6649. Bagnard D , Lohrum M , Uzie l D , Puschel A W , Bolz J (1998) Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections. Development 125:5043-5053. Bagri A , Cheng H J , Yaron A , Pleasure SJ, Tessier-Lavigne M (2003) Stereotyped pruning of long hippocampal axon branches triggered by retraction inducers of the semaphorin family. Cel l 113:285-299. Bahri S M , Chia W , Yang X (2001) Characterization and mutant analysis of the Drosophila sema 5c gene. Dev D y n 221:322-330. Barberis D , Casazza A , Sordella R, Corso S, Artigiani S, Settleman J, Comoglio P M , Tamagnone L (2005) p i 9 0 Rho-GTPase activating protein associates with plexins and it is required for semaphorin signalling. J Cel l Sci 118:4689-4700. Barberis D , Artigiani S, Casazza A , Corso S, Giordano S, Love C A , Jones E Y , Comoglio P M , Tamagnone L (2004) Plexin signalling hampers integrin-based adhesion, leading to Rho-kinase independent cell rounding, and inhibiting lamellipodia extension and cell motility. FasebJ 18:592-594. 187 Barnes G , Puranam R S , Luo Y , McNamara JO (2003) Temporal specific patterns of semaphorin gene expression in rat brain after kainic acid-induced status epilepticus. Hippocampus 13:1-20. Basile JR, Barac A , Zhu T, Guan K L , Gutkind JS (2004) Class I V semaphorins promote angiogenesis by stimulating Rho-initiated pathways through plexin-B. Cancer Res 64:5212-5224. Behar O, Golden J A , Mashimo H , Schoen FJ , Fishman M C (1996) Semaphorin III is needed for normal patterning and growth of nerves, bones and heart. Nature 383:525-528. Benfey M , Aguayo A J (1982) Extensive elongation of axons from rat brain into peripheral nerve grafts. Nature 296:150-152. Bennett D L , Michael GJ , Ramachandran N , Munson JB, Aver i l l S, Yan Q, McMahon SB, Priestley J V (1998) A distinct subgroup of small D R G cells express G D N F receptor components and G D N F is protective for these neurons after nerve injury. J Neurosci 18:3059-3072. Benowitz L I , Routtenberg A (1997) GAP-43 : an intrinsic determinant of neuronal development and plasticity. Trends Neurosci 20:84-91. Beuche W, Friede R L (1984) The role of non-resident cells in Wallerian degeneration. J Neurocytol 13:767-796. Bisby M A , Tetzlaff W (1992) Changes in cytoskeletal protein synthesis following axon injury and during axon regeneration. M o l Neurobiol 6:107-123. Bito H , Furuyashiki T, Ishihara H , Shibasaki Y , Ohashi K , Mizuno K , Maekawa M , Ishizaki T, Narumiya S (2000) A critical role for a Rho-associated kinase, p l 6 0 R O C K , in determining axon outgrowth in mammalian C N S neurons. Neuron 26:431-441. Boeckers T M , Bockmann J, Kreutz M R , Gundelfinger E D (2002) ProSAP/Shank proteins - a family of higher order organizing molecules of the postsynaptic density with an emerging role in human neurological disease. J Neurochem 81:903-910. Bonner J, O'Connor TP (2000) Semaphorin function in the developing invertebrate peripheral nervous system. Biochem Cel l B i o l 78:603-611. Borisoff JF, Chan C C , Hiebert G W , Oschipok L , Robertson GS , Zamboni R, Steeves JD, Tetzlaff W (2003) Suppression of Rho-kinase activity promotes axonal growth on inhibitory C N S substrates. M o l Cell Neurosci 22:405-416. Bottaro DP, Rubin JS, Faletto D L , Chan A M , Kmiecik T E , Vande Woude G F , Aaronson S A (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science 251:802-804. " ' 188 Bradbury EJ , McMahon S B , Ramer M S (2000) Keeping in touch: sensory neurone regeneration in the C N S . Trends Pharmacol Sci 21:389-394. Bradbury EJ , Moon L D , Popat RJ , K ing V R , Bennett GS , Patel P N , Fawcett JW, McMahon SB (2002) Chondroitinase A B C promotes functional recovery after spinal cord injury. Nature 416:636-640. Brannstrom T, Kellerth JO (1999) Recovery of synapses in axotomized adult cat spinal motoneurons after reinnervation into muscle. Exp Brain Res 125:19-27. Brannstrom T, Havton L , Kellerth JO (1992a) Changes in size and dendritic arborization patterns of adult cat spinal alpha-motoneurons following permanent axotomy. J Comp Neurol 318:439-451. Brannstrom T, Havton L , Kellerth JO (1992b) Restorative effects of reinnervation on the size and dendritic arborization patterns of axotomized cat spinal alpha-motoneurons. J Comp Neurol 318:452-461. Bray G M , Villegas-Perez M P , Vidal-Sanz M , Aguayo A J (1987) The use of peripheral nerve grafts to enhance neuronal survival, promote growth and permit terminal reconnections in the central nervous system of adult rats. J Exp B i o l 132:5-19. Britsch S, L i L , Kirchhoff S, Theuring F, Brinkmann V , Birchmeier C, Riethmacher D (1998) The ErbB2 and ErbB3 receptors and their ligand, neuregulin-1, are essential for development of the sympathetic nervous system. Genes Dev 12:1825-1836. i Broude E , McAtee M , Kelley M S , Bregman B S (1997) c-Jun expression in adult rat dorsal root ganglion neurons: differential response after central or peripheral axotomy. Exp Neurol 148:367-377. Brouns M R , Matheson SF, H u K Q , Delalle I, Caviness V S , Silver J, Bronson RT, Settleman J (2000) The adhesion signalling molecule p i90 R h o G A P is required for morphogenetic processes in neural development. Development 127:4891-4903. Brown L T (1974) Rubrospinal projections in the rat. J Comp Neurol 154:169-187. Brown M , Jacobs T, Eickholt B , Ferrari G , Teo M , Monfries C, Q i R Z , Leung T, L i m L , Hall C (2004) Alpha2-chimaerin, cyclin-dependent Kinase 5/p35, and its target collapsin response mediator protein-2 are essential components in semaphorin 3A-induced growth-cone collapse. J Neurosci 24:8994-9004. Brushart T M (1993) Motor axons preferentially reinnervate motor pathways. J Neurosci 13:2730-2738. 189 Bundesen L Q , Scheel T A , Bregman B S , Kromer L F (2003) Ephrin-B2 and EphB2 regulation of astrocyte-meningeal fibroblast interactions in response to spinal cord lesions in adult rats. J Neurosci 23:7789-7800. Bunge M B , Will iams A K , Wood P M , Uitto J, Jeffrey JJ (1980) Comparison of nerve cell and nerve cell plus Schwann cell cultures, with particular emphasis on basal lamina and collagen formation. J Cel l B i o l 84:184-202. Bunge R P (1993) Expanding roles for the Schwann cell: ensheathment, myelination, trophism and regeneration. Curr Opin Neurobiol 3:805-809. Burkhardt C, Mul ler M , Badde A , Garner C C , Gundelfinger E D , Puschel A W (2005) Semaphorin 4B interacts with the post-synaptic density protein PSD-95/SAP90 and is recruited to synapses through a C-terminal PDZ-binding motif. F E B S Lett 579:3821 -3828. Cafferty P, Y u L , Long H , Rao Y (2006) Semaphorin-la functions as a guidance receptor in the Drosophila visual system. J Neurosci 26:3999-4003. Cai H , Reed R R (1999) Cloning and characterization of neuropilin-1-interacting protein: a PSD-95/Dlg /ZO- l domain-containing protein that interacts with the cytoplasmic domain of neuropilin-1. J Neurosci 19:6519-6527. Campbell DS , Regan A G , Lopez JS, Tannahill D , Harris W A , Holt C E (2001) Semaphorin 3A elicits stage-dependent collapse, turning, and branching in Xenopus retinal growth cones. J Neurosci 21:8538-8547. Carlstedt T (1985) Dorsal root innervation of spinal cord neurons after dorsal root implantation into the spinal cord of adult rats. Neurosci Lett 55:343-348. Carlstedt T (2000) Approaches permitting and enhancing motoneuron regeneration after spinal cord, ventral root, plexus and peripheral nerve injuries. Curr Opin Neurol 13:683-686. Carroll SL , Mi l l e r M L , Frohnert PW, K i m SS, Corbett J A (1997) Expression of neuregulins and their putative receptors, ErbB2 and ErbB3, is induced during Wallerian degeneration. J Neurosci 17:1642-1659. Castellani V , Falk J, Rougon G (2004) Semaphorin3A-induced receptor endocytosis during axon guidance responses is mediated by L I C A M . M o l Cel l Neurosci 26:89-100. Castellani V , De Angelis E , Kenwrick S, Rougon G (2002) Cis and trans interactions of L I with neuropilin-1 control axonal responses to semaphorin 3A. Embo J 21:6348-6357. Castellani V , Chedotal A , Schachner M , Faivre-Sarrailh C, Rougon G (2000) Analysis of the L i -deficient mouse phenotype reveals cross-talk between Sema3A and L I signalling pathways in axonal guidance. Neuron 27:237-249. 190 Chabbert-de Ponnat I, Marie-Cardine A , Pasterkamp RJ , Schiavon V , Tamagnone L , Thomasset N , Bensussan A , Boumsell L (2005) Soluble C D 100 functions on human monocytes and immature dendritic cells require plexin C I and plexin B l , respectively. Int Immunol 17:439-447. Chaisuksunt V , Zhang Y , Anderson P N , Campbell G , Vaudano E , Schachner M , Lieberman A R (2000) Axonal regeneration from C N S neurons in the cerebellum and brainstem of adult rats: correlation with the patterns of expression and distribution of messenger R N A s for L I , C H L 1 , c-jun and growth-associated protein-43. Neuroscience 100:87-108. Che Y H , Tamatani M , Tohyama M (2000) Changes in m R N A for post-synaptic d'ensity-95 (PSD-95) and carboxy-terminal P D Z ligand of neuronal nitric oxide synthase following facial nerve transection. Brain Res M o l Brain Res 76:325-335. Chedotal A , Kerjan G , Moreau-Fauvarque C (2005) The brain within the tumor: new roles for axon guidance molecules in cancers. Cel l Death Differ 12:1044-1056. Chedotal A , Del Rio J A , Ruiz M , He Z , Borrell V , de Castro F, Ezan F, Goodman CSi, Tessier-Lavigne M , Sotelo C, Soriano E (1998) Semaphorins III and I V repel hippocampal axons via two distinct receptors. Development 125:4313-4323. Chen H , He Z , Bagri A , Tessier-Lavigne M (1998) Semaphorin-neuropilin interactions underlying sympathetic axon responses to class III semaphorins. Neuron 21:1283-1290. Chen H , Chedotal A , He Z , Goodman CS , Tessier-Lavigne M (1997) Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema I V but not Sema III. Neuron 19:547-559. Chen H , Bagri A , Zupicich J A , Zou Y , Stoeckli E , Pleasure SJ, Lowenstein D H , Skarnes W C , Chedotal A , Tessier-Lavigne M (2000a) Neuropilin-2 regulates the development of selective cranial and sensory nerves and hippocampal mossy fiber projections. Neuron 25:43-56. ; Chen M S , Huber A B , van der Haar M E , Frank M , Schnell L , Spillmann A A , Christ F, Schwab M E (2000b) Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1. Nature 403:434-439. Chen Y , Michaelis M , Janig W, Devor M (1996) Adrenoreceptor subtype mediating sympathetic-sensory coupling in injured sensory neurons. J Neurophysiol 76:3721-3730. Cheng H J , Bagri A , Yaron A , Stein E , Pleasure SJ, Tessier-Lavigne M (2001) Plexin-A3 mediates semaphorin signalling and regulates the development of hippocampal axonal projections. Neuron 32:249-263. Chilton JK , Guthrie S (2003) Cranial expression of class 3 secreted semaphorins and their neuropilin receptors. Dev Dyn 228:726-733. 191 Chong M S , Woo l f CJ , Turmaine M , Emson P C , Anderson P N (1996) Intrinsic versus extrinsic factors in determining the regeneration of the central processes of rat dorsal root ganglion neurons: the influence of a peripheral nerve graft. J Comp Neurol 370:97-104. Chong M S , Reynolds M L , Irwin N , Coggeshall R E , Emson P C , Benowitz L I , Woolf C J (1994) GAP-43 expression in primary sensory neurons following central axotomy. J Neurosci 14:4375-4384. Chung K , Chung J M (2001) Sympathetic sprouting in the dorsal root ganglion after spinal nerve ligation: evidence of regenerative collateral sprouting. Brain Res 895:204-212. Chung K , Yoon Y W , Chung J M (1997) Sprouting sympathetic fibers form synaptic varicosities in the dorsal root ganglion of the rat with neuropathic injury. Brain Res 751:275-280. Chung K , Lee B H , Yoon Y W , Chung J M (1996) Sympathetic sprouting in the dorsal root ganglia of the injured peripheral nerve in a rat neuropathic pain model. J Comp Neurol 376:241-252. Cloutier JF, Giger R J , Koentges G , Dulac C, Kolodkin A L , Ginty D D (2002) Neuropilin-2 mediates axonal fasciculation, zonal segregation, but not axonal convergence, of primary accessory olfactory neurons. Neuron 33:877-892. Cohen JA, Yachnis A T , Ara i M , Davis JG, Scherer SS (1992) Expression of the neu proto-oncogene by Schwann cells during peripheral nerve development and Wallerian degeneration. J Neurosci Res 31:622-634. Cohen S, Funkelstein L , Livet J, Rougon G , Henderson C E , Castellani V , Mann F (2005) A semaphorin code defines subpopulations. of spinal motor neurons during mouse development. Eur J Neurosci 21:1767-1776. • Comeau M R , Johnson R, DuBose R F , Petersen M , Gearing P, VandenBos T, Park L , Farrah T, Buller R M , Cohen JI, Strockbine L D , Rauch C, Spriggs M K (1998) A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, V E S P R . Immunity 8:473-482. Condic M L , Snow D M , Letourneau PC (1999) Embryonic neurons adapt to the inhibitory proteoglycan aggrecan by increasing integrin expression. J Neurosci 19:10036-10043. Conrotto P, Corso S, Gamberini S, Comoglio P M , Giordano S (2004) Interplay between scatter factor receptors and B plexins controls invasive growth. Oncogene 23:5131-5137. Conrotto P, Valdembri D , Corso S, Serini G , Tamagnone L , Comoglio P M , Bussolino F, Giordano S (2005) Sema4D induces angiogenesis through Met recruitment by Plexin B I . Blood 105:4321-4329. 192 Cowan C A , Henkemeyer M (2002) Ephrins in reverse, park and drive. Trends Cell B io l 12:339-346. Cullheim S, Carlstedt T, Risl ing M (1999) A x o n regeneration of spinal motoneurons following a lesion at the cord-ventral root interface. Spinal Cord 37:811-819. Cullheim S, Wallquist W , Hammarberg H , Linda H , Piehl F , Carlstedt T, Risling M (2002) Properties of motoneurons underlying their regenerative capacity after axon lesions in the ventral funiculus or at the surface of the spinal cord. Brain Res Brain Res Rev 40:309-316. Da Silva JS, Medina M , Zuliani C , D i Nardo A , Witke W, Dotti C G (2003) R h o A / R O C K regulation of neuritogenesis via profilin Ila-mediated control of actin stability. J Cell B io l 162:1267-1279. David S, Aguayo A J (1981) Axonal elongation into peripheral nervous system "bridges" after central nervous system injury in adult rats. Science 214:931-933. David S, Aguayo A J (1985) Axonal regeneration after crush injury of rat central nervous system fibres innervating peripheral nerve grafts. J Neurocytol 14:1-12. David S, Lacroix S (2003) Molecular approaches to spinal cord repair. Annu Rev Neurosci 26:411-440. Davies SP, Reddy H , Caivano M , Cohen P (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351:95-105. de Castro F, H u L , Drabkin H , Sotelo C, Chedotal A (1999) Chemoattraction and chemorepulsion of olfactory bulb axons by different secreted semaphorins. J Neurosci 19:4428-4436. De Winter F, Holtmaat A J , Verhaagen J (2002a) Neuropilin and class 3 semaphorins in nervous system regeneration. A d v Exp M e d B i o l 515:115-139. De Winter F, Oudega M , Lankhorst A J , Hamers FP, Blits B , Ruitenberg M J , Pasterkamp RJ , Gispen W H , Verhaagen J (2002b) Injury-induced class 3 semaphorin expression in the rat spinal cord. Exp Neurol 175:61-75. de Wit J, Verhaagen J (2003) Role of semaphorins in the adult nervous system. Prog Neurobiol 71:249-267. De Wit J, De .Winter F, Klooster J, Verhaagen J (2005) Semaphorin 3 A displays a punctate distribution on the surface of neuronal cells and interacts with proteoglycans in the extracellular matrix. M o l Cel l Neurosci 29:40-55. 193 Dean C, Dresbach T (2006) Neuroligins and neurexins: linking cell adhesion, synapse formation and cognitive function. Trends Neurosci 29:21-29. Delaire S, Elhabazi A , Bensussan A , Boumsell L (1998) C D 100 is a leukocyte semaphorin. Cel l M o l Life Sci 54:1265-1276. Dickson B J (2001) Rho GTPases in growth cone guidance. Curr Opin Neurobiol 11:103-110. Dickson B J (2002) Molecular mechanisms of axon guidance. Science 298:1959-1964. Di l lon ST, Feig L A (1995) Purification and assay of recombinant C3 transferase. Methods Enzymol 256:174-184! Dong Z , Brennan A , L i u N , Yarden Y , Lefkowitz G , Mirsky R, Jessen K R (1995) Neu differentiation factor is a neuron-glia signal and regulates survival, proliferation, and maturation of rat Schwann cell precursors. Neuron 15:585-596. Donnerer J (2003) Regeneration of primary sensory neurons. Pharmacology 67:169-181. Driessens M H , Ol ivo C, Nagata K , Inagaki M , Collard JG (2002) B plexins activate Rho through P D Z - R h o G E F . F E B S Lett 529:168-172. Driessens M H , H u H , Nobes C D , Self A , Jordens I, Goodman C S , Hal l A (2001) Plexin-B semaphorin receptors interact directly with active Rac and regulate the actin cytoskeleton by activating Rho. Curr B i o l 11:339-344. Eckhardt F, Behar O, Calautti E , Yonezawa K , Nishimoto I, Fishman M C (1997), A novel transmembrane semaphorin can bind c-src. M o l Cel l Neurosci 9:409-419. Eleore L , Vassias I, Vida l PP, de Waele C (2005) Modulation of the glutamatergic receptors ( A M P A and N M D A ) and of glutamate vesicular transporter 2 in the rat facial nucleus after axotomy. Neuroscience 136:147-160. Elhabazi A , Lang V , Herold C, Freeman GJ , Bensussan A , Boumsell L , Bismuth G (1997) The human semaphorin-like leukocyte cell surface molecule C D 100 associates with a serine kinase activity. J B i o l Chem 272:23515-23520. Encinas J A , Kikuchi K , Chedotal A , de Castro F, Goodman C S , Kimura T (1999) Cloning, expression, and genetic mapping of Sema W, a member of the semaphorin family. Proc Natl Acad Sci U S A 96:2491-2496. Ernsberger U , Rohrer H (1999) Development of the cholinergic neurotransmitter phenotype in postganglionic sympathetic neurons. Cell Tissue Res 297:339-361. 194 Falk J, Bechara A , Fiore R, Nawabi H , Zhou H , Hoyo-Becerra C, Bozon M , Rougon G , Grumet M , Puschel A W , Sanes JR, Castellani V (2005) Dual functional activity of semaphorin 3B is required for positioning the anterior commissure. Neuron 48:63-75. Fan J, Raper J A (1995) Localized collapsing cues can steer growth cones without inducing their full collapse. Neuron 14:263-274. Fawcett JW (2006) Overcoming inhibition in the damaged spinal cord. J Neurotrauma 23:371-383. Fawcett JW, Asher R A (1999) The glial scar and central nervous system repair. Brain Res Bu l l 49:377-391. Feiner L , Koppel A M , Kobayashi H , Raper J A (1997) Secreted chick semaphorins bind recombinant neuropilin with similar affinities but bind different subsets of neurons in situ. Neuron 19:539-545. Feiner L , Webber A L , Brown C B , L u M M , Jia L , Feinstein P, Mombaerts P, Epstein JA, Raper J A (2001) Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development 128:3061-3070. Fernandes K J , Tetzlaff W (2000) Gene Expression in Axotomized Neurons: Identifying the Instrinsic Determinants of Axonal Growth. In: Axonal Regeneration in the Central Nervous System (Ingoglia N A , Murray M , eds), pp 219-266. New York: Marcel Dekker, Inc. Fernandes K J , Fan D P , Tsui B J , Cassar SL , Tetzlaff W (1999) Influence of the axotomy to cell body distance in rat rubrospinal and spinal motoneurons: differential regulation of G A P -43, tubulins, and neurofilament-M. J Comp Neurol 414:495-510. Fiore R, Rahim B , Christoffels V M , Moorman A F , Puschel A W (2005) Inactivation of the Sema5a gene results in embryonic lethality and defective remodeling of the cranial vascular system. M o l Cel l B io l 25:2310-2319. Frisen J, Risl ing M , Korhonen L , Zirrgiebel U , Johansson C B , Cullheim S, Lindholm D (1998) Nerve growth factor induces process formation in meningeal cells: implications for scar formation in the injured C N S . J Neurosci 18:5714-5722. Fu S Y , Gordon T (1997) The cellular and molecular basis of peripheral nerve regeneration. M o l Neurobiol 14:67-116. Fujioka S, Masuda K , Toguchi M , Ohoka Y , Sakai T, Furuyama T, Inagaki S (2003) Neurotrophic effect of Semaphorin 4D in P C 12 cells. Biochem Biophys Res Commun 301:304-310. 195 Fujisawa H (2004) Discovery of semaphorin receptors, neuropilin and plexin, and their functions in neural development. J Neurobiol 59:24-33. Fujisawa H , Kitsukawa T (1998) Receptors for collapsin/semaphorins. Curr Opin Neurobiol 8:587-592. ; Funakoshi H , Frisen J, Barbany G , Timmusk T, Zachrisson O, Verge V M , Persson H (1993) Differential expression of m R N A s for neurotrophins and their receptors after axotomy of the sciatic nerve. J Cel l B i o l 123:455-465. Gallo G , Letourneau P C (2004) Regulation of growth.cone actin filaments by guidance cues. J Neurobiol 58:92-102. Garratt A N , Voiculescu O, Topilko P, Charnay P, Birchmeier C (2000) A dual role of erbB2 in myelination and in expansion of the Schwann cell precursor pool. J Cel l B io l 148:1035-1046. Gavazzi I (2001) Semaphorin-neuropilin-1 interactions in plasticity and regenerationj of adult neurons. Cel l Tissue Res 305:275-284. Gavazzi I, Stonehouse J, Sandvig A , Reza J N , Appiah-Kubi L S , Keynes R, Cohen J (2000) Peripheral, but not central, axotomy induces neuropilin-1 m R N A expression; in adult large diameter primary sensory neurons. J Comp Neurol 423:492-499. Gehlert D R , Stephenson D T , Schober D A , Rash K , Clemens J A (1997) Increased expression of peripheral benzodiazepine receptors in the facial nucleus following motor neuron axotomy. Neurochem Int 31:705-713. Gerecke K M , Wyss J M , Karavanova I, Buonanno A , Carroll S L (2001) ErbB transmembrane tyrosine kinase receptors are differentially expressed throughout the adult rat central nervous system. J Comp Neurol 433:86-100. 1 Gherardi E , Love C A , Esnouf R M , Jones E Y (2004) The sema domain. Curr Opin Struct B io l 14:669-678. Giger RJ , Wolfer D P , De Wit G M , Verhaagen J (1996) Anatomy of rat semaphorin III/collapsin-1 m R N A expression and relationship to developing nerve tracts! during neuroembryogenesis. J Comp Neurol 375:378-392. Giger RJ , Pasterkamp R J , Holtmaat A J , Verhaagen J (1998a) Semaphorin III: role in neuronal development and structural plasticity. Prog Brain Res 117:133-149. Giger RJ , Pasterkamp R J , Heijnen S, Holtmaat A J , Verhaagen J (1998b) Anatomical distribution of the chemorepellent semaphorin III/collapsin-1 in the adult rat and human brain: predominant expression in structures of the olfactory-hippocampal pathway; and the motor system. J Neurosci Res 52:27-42. ! 196 Giger RJ , Urquhart E R , Gillespie S K , Levengood D V , Ginty D D , Kolodkin A L (1998c) Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity. Neuron 21:1079-1092. Giger RJ , Cloutier JF, Sahay A , Prinjha R K , Levengood D V , Moore SE, Pickering S, Simmons D , Rastan S, Walsh FS , Kolodkin A L , Ginty D D , Geppert M (2000) Neuropilin-2 is required in vivo for selective axon guidance responses to secreted semaphorins. Neuron 25:29-41. Giniger E (2002) How do Rho family GTPases direct axon growth and guidance? A proposal relating signalling pathways to growth cone mechanics. Differentiation 70:385-396. Giordano S, Corso S, Conrotto P, Artigiani S, Gilestro G , Barberis D , Tamagnone L , Comoglio P M (2002) The semaphorin 4D receptor controls invasive growth by coupling with Met. Nat Cel l B i o l 4:720-724. Godenschwege T A , H u H , Shan-Crofts X , Goodman C S , Murphey R K (2002) Bi-directional signalling by Semaphorin l a during central synapse formation in Drosophila. Nat Neurosci 5:1294-1301. Goldberg JL , Vargas M E , Wang JT, Mandemakers W, Oster SF, Sretavan D W , Barres B A (2004) A n oligodendrocyte lineage-specific semaphorin, Sema5A, inhibits axon growth by retinal ganglion cells. J Neurosci 24:4989-4999. Graziadei G A , Graziadei PP (1979) Neurogenesis and neuron regeneration in the olfactory system of mammals. II. Degeneration and reconstitution of the olfactory sensory neurons after axotomy. J Neurocytol 8:197-213. Grimpe B , Silver J (2002) The extracellular matrix in axon regeneration. Prog Brain Res 137:333-349. Gu C, Yoshida Y , Livet J, Reimert D V , Mann F, Merte J, Henderson C E , Jessell T M , Kolodkin A L , Ginty D D (2005) Semaphorin 3E and p lex in-Dl control vascular pattern independently of neuropilins. Science 307:265-268. Gu Y , Ihara Y (2000) Evidence that collapsin response mediator protein-2 is involved in the dynamics of microtubules. J B io l Chem 275:17917-17920. Guan W, Puthenveedu M A , Condic M L (2003) Sensory neuron subtypes have unique substratum preference and receptor expression before target innervation. J Neurosci 23:1781-1791. Hagino S, Iseki K , M o r i T, Zhang Y , Hikake T, Yokoya S, Takeuchi M , Hasimoto H , Kikuchi S, Wanaka A (2003) Slit and glypican-1 m R N A s are coexpressed in the reactive astrocytes of the injured adult brain. Gl ia 42:130-138. 197 Hammarberg H , Risl ing M , Hokfelt T, Cullheim S, Piehl F (1998) Expression of insulin-like growth factors and corresponding binding proteins ( IGFBP 1-6) in rat spinal pord and peripheral nerve after axonal injuries. J Comp Neurol 400:57-72. Hashimoto N , Yamanaka H , Fukuoka T, Dai Y , Obata K , Mashimo T, Noguchi K (2001) Expression of H G F and cMet in the peripheral nervous system of adult rats following sciatic nerve injury. Neuroreport 12:1403-1407. * , Hattox A M , Priest C A , Keller A (2002) Functional circuitry involved in the regulation of whisker movements. J Comp Neurol 442:266-276. He Z , Tessier-Lavigne M (1997) Neuropilin is a receptor for the axonal chemdrepellent Semaphorin III. Cel l 90:739-751. He Z , Wang K C , Koprivica V , M i n g G , Song H J (2002) Knowing how to navigate: mechanisms of semaphorin signalling in the nervous system. Sci S T K E 2002:RE1. Hendricks K R , Kott J N , Lee M E , Gooden M D , Evers S M , Westrum L E (1994) Recovery of olfactory behavior. I. Recovery after a complete olfactory bulb lesion correlates with patterns of olfactory nerve penetration. Brain Res 648:121-133. Heumann R, Korsching S, Bandtlow C, Thoenen H (1987) Changes of nerve growth factor synthesis in nonneuronal cells in response to sciatic nerve transection. J Cell B i o l 104:1623-1631. Hinck L (2004) The versatile roles of "axon guidance" cues in tissue morphogenesis. Dev Cell 7:783-793. • Holmes S, Downs A M , Fosberry A , Hayes P D , Michalovich D , Murdoch P, Moores K , Fox J, Deen K , Pettman G , Wattam T, Lewis C (2002) Sema7A is a potent monocyte stimulator. Scand J Immunol 56:270-275. ; Holtmaat A J , De Winter F , De Wit J, Gorter JA , da Silva F H , Verhaagen J (2002) Semaphorins: contributors to structural stability of hippocampal networks? Prog Brain Res 138:17-38. Holtmaat A J , Gorter J A , De Wit J, Tolner E A , Spijker S, Giger RJ , Lopes da Silva F H , Verhaagen J (2003) Transient downregulation of Sema3A m R N A in a rat model for temporal lobe epilepsy. A novel molecular event potentially contributing to mossy fiber sprouting. Exp Neurol 182:142-150. Horch K (1979) Guidance of regrowing sensory axons after cutaneous nerve lesions in the cat. J Neurophysiol 42:1437-1449. " " \ y . ..' . ' \ • : Houk JC, Gibson A R , Harvey C F , Kennedy PR, van Kan P L (1988) Activity of primate magnocellular red nucleus related to hand and finger movements. Behav Brain Res 28:201-206. 198 Huber A B , Kolodkin A L , Ginty D D , Cloutier JF (2003) Signalling at the growth cone: ligand-receptor complexes and the control of axon growth and guidance. Annu Rev Neurosci 26:509-563. Huber A B , Kania A , Tran TS, G u C, De Marco Garcia N , Lieberam I, Johnson D , Jessell T M , Ginty D D , Kolodkin A L (2005) Distinct roles for secreted semaphorin signalling in spinal motor axon guidance. Neuron 48:949-964. Huigrok T J H , Cella F (1995) Precerebellar nuclei and red nucleus. In: The Rat Nervous System (Paxinos G , ed), pp 277-308. San Diego: Academic Press. Huisman A M , Kuypers H G , Verburgh C A (1982) Differences in collateralization of the descending spinal pathways from red nucleus and other brain stem cell groups in cat and monkey. Prog Brain Res 57:185-217. Hunt D , Coffin R S , Anderson P N (2002) The Nogo receptor, its ligands and axonal regeneration in the spinal cord; a review. J Neurocytol 31:93-120. Hynes N E , Horsch K , Olayioye M A , Badache A (2001) The ErbB receptor tyrosine family as signal integrators. Endocr Relat Cancer 8:151-159. Hynes R O (2002) Integrins: bidirectional, allosteric signalling machines. Cel l 110:673-687. Ikeda R, Kato F (2005) Early and transient increase in spontaneous synaptic inputs to the rat facial motoneurons after axotomy in isolated brainstem slices of rats. Neuroscience 134:889-899. Isbister C M , Tsai A , Wong ST, Kolodkin A L , O'Connor TP (1999) Discrete roles for secreted and transmembrane semaphorins in neuronal growth cone guidance in vivo. Development 126:2007-2019. Ivins J K , Yurchenco P D , Lander A D (2000) Regulation of neurite outgrowth by integrin activation. J Neurosci 20:6551-6560. Jackman A , Fitzgerald M (2000) Development of peripheral hindlimb and central spinal cord innervation by subpopulations of dorsal root ganglion cells in the embryonic rat. J Comp Neurol 418:281-298. Jalink K , van Corven EJ , Hengeveld T, Mor i i N , Narumiya S, Moolenaar W H (1994) Inhibition of lysophosphatidate- and thrombin-induced neurite retraction and neuronal cell rounding by A D P ribosylation of the small GTP-binding protein Rho. J Cel l B i o l 126:801-810. Jeanneteau F, Diaz J, Sokoloff P, Griffon N (2004) Interactions of GIPC with dopamine D2, D3 but not D4 receptors define a novel mode of regulation of G protein-coupled receptors. M o l B i o l Cel l 15:696-705. 199 Jin Z , Strittmatter S M (1997) R a c l mediates collapsin-1 -induced growth cone collapse. J Neurosci 17:6256-6263. K a l i l K , Reh T (1979) Regrowth of severed axons in the neonatal central nervous system: establishment of normal connections. Science 205:1158-1161. Kamijo Y , Koyama J, Oikawa S, Koizumi Y , Yokouchi K , Fukushima N , Mori izumi T (2003) Regenerative process of the facial nerve: rate of regeneration of fibers and their bifurcations. Neurosci Res 46:135-143. Kantor D B , Chivatakarn O, Peer K L , Oster SF, Inatani M , Hansen M J , Flanagan JG, Yamaguchi Y , Sretavan D W , Giger RJ , Kolodkin A L (2004) Semaphorin 5A is a bifunctional axon guidance cue regulated by heparan and chondroitin sulfate proteoglycans. Neuron 44:961-975. Kaprielian Z , Runko E , Imondi R (2001) Axon guidance at the midline choice point. Dev Dyn 221:154-181. Kawakami A , Kitsukawa T, Takagi S, Fujisawa H (1996) Developmentally regulated expression of a cell surface protein, neuropilin,in the mouse nervous system. JNeurobiol 29:1-17. Kawasaki T, Bekku Y , Suto F, Kitsukawa T, Taniguchi M , Nagatsu I, Nagatsu T, Itoh K , Yagi T, Fujisawa H (2002) Requirement of neuropilin 1-mediated Sema3A signals in patterning of the sympathetic nervous system. Development 129:671-680. Kennedy PR, Gibson A R , Houk JC (1986) Functional and anatomic differentiation between parvicellular and magnocellular regions of red nucleus in the monkey. Brain Res 364:124-136. Kerjan G , Dolan J, Haumaitre C, Schneider-Maunoury S, Fujisawa H , Mitchell K J , Chedotal A (2005) The transmembrane semaphorin Sema6A controls cerebellar granule cell migration. Nat Neurosci 8:1516-1524. Kikuchi K , Chedotal A , Hanafusa H , Ujimasa Y , de Castro F, Goodman C S , Kimura T (1999) Cloning and characterization of a novel class V I semaphorin, semaphorin Y . M o l Cel l Neurosci 13:9-23. Kikutani H , Kumanogoh A (2003) Semaphorins in interactions between T cells and antigen-presenting cells. Nat Rev Immunol 3:159-167. Kitsukawa T, Shimono A , Kawakami A , Kondoh H , Fujisawa H (1995) Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121:4309-4318. 200 Kitsukawa T, Shimizu M , Sanbo M , Hirata T, Taniguchi M , Bekku Y , Yagi T, Fujisawa H (1997) Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice. Neuron 19:995-1005. Klagsbrun M , Eichmann A (2005) A role for axon guidance receptors and ligands in blood vessel development and tumor angiogenesis. Cytokine Growth Factor Rev 16:535-548. Kle in R (2004) Eph/ephrin signalling in morphogenesis, neural development and plasticity. Curr Opin Cel l B i o l 16:580-589. Klostermann A , Lohrum M , Adams R H , Puschel A W (1998) The chemorepulsive activity of the axonal guidance signal semaphorin D requires dimerization. J B i o l Chem 273:73126-7331. Klostermann A , Lutz B , Gertler F, Behl C (2000) The orthologous human and murine semaphorin 6A-1 proteins ( S E M A 6 A - l / S e m a 6 A - l ) bind to the enabled/vasodilator-stimulated phosphoprotein-like protein ( E V L ) via a novel carboxyl-terminal zyxin-like domain. J B i o l Chem 275:39647-39653. Kobayashi H , Koppel A M , Luo Y , Raper J A (1997a) A role for collapsin-1 in olfactory and cranial sensory axon guidance. J Neurosci 17:8339-8352. Kobayashi N R , Fan D P , Giehl K M , Bedard A M , Wiegand SJ, Tetzlaff W (1997b) B D N F and NT-4/5 prevent atrophy of rat rubrospinal neurons after cervical axotomy, stimulate GAP-43 and Talphal-tubulin m R N A expression, and promote axonal regeneration. J Neurosci 17:9583-9595. Koeberle P D , Bahr M (2004) Growth and guidance cues for regenerating axons: where have they gone? J Neurobiol 59:162-180. Koliatsos V E , Price W L , Pardo C A , Price D L (1994) Ventral root avulsion: an experimental model of death of adult motor neurons. J Comp Neurol 342:35-44. Kolodkin A L , Matthes D J , Goodman CS (1993) The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cel l 75:1389-1399. Kolodkin A L , Levengood D V , Rowe E G , Tai Y T , Giger R J , Ginty D D (1997) Neuropilin is a semaphorin III receptor. Cel l 90:753-762. Kolodkin A L , Matthes D J , O'Connor TP, Patel N H , Admon A , Bentley D , Goodman CS (1992) Fasciclin IV : sequence, expression, and function during growth cone guidance in the grasshopper embryo. Neuron 9:831-845. : Koppel A M , Raper J A (1998) Collapsin-1 covalently dimerizes, and dimerization is necessary for collapsing activity. J B i o l Chem 273:15708-15713. 201 Koppel A M , Feiner L , Kobayashi H , Raper J A (1997) A 70 amino acid region within the semaphorin domain activates specific cellular response of semaphorin family members. Neuron 19:531-537. Kranenburg O, Poland M , van Horck FP, Drechsel D , Hal l A , Moolenaar W H (1999) Activation of R h o A by lysophosphatidic acid and Galphal2/13 subunits in neuronal cells: induction of neurite retraction. M o l B i o l Cel l 10:1851-1857. Kruger RP , Aurandt J, Guan K L (2005) Semaphorins command cells to move. Nat Rev M o l Cel l B i o l 6:789-800. Kryger GS , Kryger Z , Zhang F, Shelton D L , Lineaweaver W C , Buncke H J (2001) Nerve growth factor inhibition prevents traumatic neuroma formation in the rat. J Hand Surg [Am] 26:635-644. Kuchler M , Fouad K , Weinmann O, Schwab M E , Raineteau O (2002) Red nucleus projections to distinct motor neuron pools in the rat spinal cord. J Comp Neurol 448:349-359. Kuhn T B , Brown M D , Wilcox C L , Raper JA, Bamburg JR (1999) Myel in and collapsin-1 induce motor neuron growth cone collapse through different pathways: inhibition of collapse by opposing mutants of rac 1. J Neurosci 19:1965-1975. Kumanogoh A , Kikutani H (2001) The CD100-CD72 interaction: a novel mechanism of immune regulation. Trends Immunol 22:670-676. Kumanogoh A , Kikutani H (2004) Biological functions and signalling of a transmembrane semaphorin, CD100/Sema4D. Cell M o l Life Sci 61:292-300. Kumanogoh A , Shikina T, Watanabe C, Takegahara N , Suzuki K , Yamamoto M , Takamatsu H , Prasad D V , M i z u i M , Toyofuku T, Tamura M , Watanabe D , Parnes JR, Kikutani H (2005) Requirement for CD100-CD72 interactions in fine-tuning of B-ce l ! antigen receptor signalling and homeostatic maintenance of the B-cel l compartment. Int Immunol 17:1277-1282. Kumanogoh A , Watanabe C, Lee I, Wang X , Shi W, Araki H , Hirata H , Iwahori K , Uchida J, Yasui T, Matsumoto M , Yoshida K , Yakura H , Pan C, Parnes JR, Kikutani H (2000) Identification of CD72 as a lymphocyte receptor for the class I V semaphorin CD100: a novel mechanism for regulating B cell signalling. Immunity 13:621-631. Kusy S, Nasarre P, Chan D , Potiron V , Meyronet D , Gemmil l R M , Constantin B , Drabkin H A , Roche J (2005) Selective suppression of in vivo tumorigenicity by semaphorin S E M A 3 F in lung cancer cells. Neoplasia 7:457-465. Kwon B K , Borisoff JF, Tetzlaff W (2002a) Molecular targets for therapeutic intervention after spinal cord injury. M o l Interv 2:244-258. 202 Kwon B K , L i u J, Messerer C, Kobayashi N R , McGraw J, Oschipok L , Tetzlaff W; (2002b) Survival and regeneration of rubrospinal neurons 1 year after spinal cord injury. Proc Natl Acad Sci U S A 99:3246-3251. Kwon Y K , Bhattacharyya A , Alberta JA , Giannobile W V , Cheon K , Stiles C D , Pomeroy S L (1997) Activation of ErbB2 during wallerian degeneration of sciatic nerve. J Neurosci 17:8293-8299. Lange C, Liehr T, Goen M , Gebhart E , Fleckenstein B , Ensser A (1998) New eukaryotic semaphorins with close homology to semaphorins of D N A viruses. Genomics 51:340-350. Lehmann M , Fournier A , Selles-Navarro I, Dergham P, Sebok A , Leclerc N , Tigyi G , McKerracher L (1999) Inactivation of Rho signalling pathway promotes C N S axon regeneration. J Neurosci 19:7537-7547. Leighton P A , Mitchell K J , Goodrich L V , L u X , Pinson K , Scherz P, Skarnes W C , Tessier-Lavigne M (2001) Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature 410:174-179. Lemke G (1996) Neuregulins in development. M o l Cel l Neurosci 7:247-262. Linda H , Shupliakov O, Ornung G , Ottersen OP, Storm-Mathisen J, Risl ing M , Cullheim S (2000) Ultrastructural evidence for a preferential elimination of glutamate-immunoreactive synaptic terminals from spinal motoneurons after intramedullary axotomy. J Comp Neurol 425:10-23. Linda H , Cullheim S, Risl ing M , Arvidsson U , Mossberg K , Ulfhake B , Terenius L , Hokfelt T (1990) Enkephalin-like immunoreactivity levels increase in the motor nucleus after an intramedullar axotomy of motoneurons in the adult cat spinal cord. Brain Res 534:352-356. Linda H , Piehl F, Dagerlind A , Verge V M , Arvidsson U , Cullheim S, Risling M , Ulfhake B , Hokfelt T (1992) Expression of GAP-43 m R N A in the adult mammalian spinal cord under normal conditions and after different types of lesions, with special reference to motoneurons. Exp Brain Res 91:284-295. Lindholm T, Cullheim S, Deckner M , Carlstedt T, Risl ing M (2002) Expression of neuregulin and ErbB3 and ErbB4 after a traumatic lesion in the ventral funiculus of the spinal cord and in the intact primary olfactory system. Exp Brain Res 142:81-90. Lindholm T, Skold M K , Suneson A , Carlstedt T, Cullheim S, Risl ing M (2004) Semaphorin and neuropilin expression in motoneurons after intraspinal motoneuron axotomy. Neuroreport 15:649-654. 203 L i u B P , Strittmatter S M (2001) Semaphorin-mediated axonal guidance via Rho-related G proteins. Curr Opin Cel l B i o l 13:619-626. Lomo T (2003) What controls the position, number, size, and distribution of neuromuscular junctions on rat muscle fibers? J Neurocytol 32:835-848. Lou X , Yano H , Lee F , Chao M V , Farquhar M G (2001) G I P C and G A I P form a complex with T r k A : a putative link between G protein and receptor tyrosine kinase pathways. M o l B i o l Cel l 12:615-627. Love F M , Thompson W J (1998) Schwann cells proliferate at rat neuromuscular junctions during development and regeneration. J Neurosci 18:9376-9385. L u B , Czernik A J , Popov S, Wang T, Poo M M , Greengard P (1996) Expression of synapsin I correlates with maturation of the neuromuscular synapse. Neuroscience 74:1087-1097. Luo L (2000) Rho GTPases in neuronal morphogenesis. Nat Rev Neurosci 1:173-180. Luo L (2002) Act in cytoskeleton regulation in neuronal morphogenesis and structural plasticity. Annu Rev Ce l l Dev B io l 18:601-635. Luo Y , Raible D , Raper J A (1993) Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cel l 75:217-227. Luo Y , Shepherd I, L i J, Renzi M J , Chang S, Raper J A (1995) A family of molecules related to collapsin in the embryonic chick nervous system. Neuron 14:1131-1140. Lustig M , Zanazzi G , Sakurai T, Blanco C, Levinson SR, Lambert S, Grumet M , Salzer J L (2001) N r - C A M and neurofascin interactions regulate ankyrin G and sodium channel clustering at the node of Ranvier. Curr B io l 11:1864-1869. Lyons W E , Steiner JP, Snyder S H , Dawson T M (1995) Neuronal regeneration enhances the expression of the immunophilin F K B P - 1 2 . J Neurosci 15:2985-2994. Madison R D , Zomorodi A , Robinson G A (2000) Netrin-1 and peripheral nerve regeneration in the adult rat. Exp Neurol 161:563-570. Maekawa M , Ishizaki T, Boku S, Watanabe N , Fujita A , Iwamatsu A , Obinata T, Ohashi K , Mizuno K , Narumiya S (1999) Signalling from Rho to the actin cytoskeleton through protein kinases R O C K and LIM-kinase. Science 285:895-898. Maina F, Hilton M C , Ponzetto C, Davies A M , Kle in R (1997) Met receptor signalling is required for sensory nerve development and H G F promotes axonal growth and survival of sensory neurons. Genes Dev 11:3341-3350. 204 Makwana M , Raivich G (2005) Molecular mechanisms in successful peripheral regeneration. Febs J 272:2628-2638. Masuda K , Furuyama T, Takahara M , Fujioka S, Kurinami H , Inagakr S (2004) Sema4D stimulates axonal outgrowth of embryonic D R G sensory neurones. Genes Cells 9:821-829. Matsuoka I, Nakane A , Kurihara K (1997) Induction of L I F - m R N A by TGF-beta 1 in Schwann cells. Brain Res 776:170-180. Mattsson P, Meijer B , Svensson M (1999) Extensive neuronal cell death following intracranial transection of the facial nerve in the adult rat. Brain Res B u l l 49:333-341. McGraw J, McPhai l L T , Oschipok L W , Horie H , Poirier F, Steeves JD, Ramer M S , Tetzlaff W (2004) Galectin-1 in regenerating motoneurons. Eur J Neurosci 20:2872-2880. McGraw TS, Mick le JP, Shaw G , Streit W J (2002) Axonal ly transported peripheral signals regulate alpha-internexin expression in regenerating motoneurons. J Neurosci 22:4955-4963! McKerracher L , David S, Jackson D L , Kottis V , Dunn RJ , Braun P E (1994) Identification of myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite growth. Neuron 13:805-811. McMahon SB, Armanini M P , L ing L H , Phillips HS (1994) Expression and coexpression of Trk receptors in subpopulations of adult primary sensory neurons projecting to identified peripheral targets. Neuron 12:1161-1171. McPhai l L T , Fernandes K J , Chan C C , Vanderluit JL , Tetzlaff W (2004) Axonal reinjury reveals the survival and re-expression of regeneration-associated genes in chronically axotomized adult mouse motoneurons. Exp Neurol 188:331-340. Meredith M , Graziadei PP, Graziadei G A , Rashotte M E , Smith JC (1983) Olfactory function after bulbectomy. Science 222:1254-1255. Messersmith E K , Leonardo-ED, Shatz CJ , Tessier-Lavigne M , Goodman CS , Kolodkin A L (1995) Semaphorin III can function as a selective chemorepellent to pattern sensory projections in the spinal cord. Neuron 14:949-959. Mi lzani A , Dalledonne I, Vailati G , Colombo R (1997) Paraquat induces actin assembly in depolymerizing conditions. Faseb J 11:261-270. Miranda JD, White L A , Marci l lo A E , Willson C A , Jagid J, Whittemore SR (1999) Induction of Eph B3 after spinal cord injury. Exp Neurol 156:218-222. 205 Mimics K , Koerber H R (1995) Prenatal development of rat primary afferent fibers: I. Peripheral projections. J Comp Neurol 355:589-600. Mitsui N , Inatome R, Takahashi S, Goshima Y , Yarhamura H , Yanagi S (2002) Involvement of Fes/Fps tyrosine kinase in semaphorin3A signalling. Embo J 21:3274-3285. Moll iver D C , Wright D E , Leitner M L , Parsadanian A S , Doster K , Wen D , Yan Q, Snider W D (1997) IB4-binding D R G neurons switch from N G F to G D N F dependence in early postnatal life. Neuron 19:849-861. Moon L D , Asher R A , Rhodes K E , Fawcett JW (2001) Regeneration of C N S axons back to their target following treatment of adult rat brain with chondroitinase A B C . Nat Neurosci 4:465-466. Moran L B , Graeber M B (2004) The facial nerve axotomy model. Brain Res Brain Res Rev 44:154-178. Moreau-Fauvarque C, Kumanogoh A , Camand E , Jaillard C, Barbin G , Boquet I, Love C, Jones E Y , Kikutani H , Lubetzki C, Dusart I, Chedotal A (2003) The transmembrane semaphorin Sema4D/CD100, an inhibitor of axonal growth, is expressed on oligodendrocytes and upregulated after C N S lesion. J Neurosci 23:9229-9239. Moreno-Flores M T , Martin-Aparicio E , Martin-Bermejo M J , Agudo M , McMahon S, A v i l a J, Diaz-Nido J, Wandosell F (2003) Semaphorin 3C preserves survival and induces neuritogenesis of cerebellar granule neurons in culture. J Neurochem 87:879-890. Morrissey T K , Levi A D , Nuijens A , Sliwkowski M X , Bunge R P (1995) Axon-induced mitogenesis of human Schwann cells involves heregulin and pl85erbB2. Proc Natl Acad Sci U S A 92:1431-1435. Moscoso L M , Sanes JR (1995) Expression of four immunoglobulin superfamily adhesion molecules ( L I , N r - C A M / B r a v o , neurofascin/ABGP, and N - C A M ) in the developing mouse spinal cord. J Comp Neurol 352:321-334. Mui r G D , Whishaw IQ (2000) Red nucleus lesions impair overground locomotion in rats: a kinetic analysis. Eur J Neurosci.12:1113-1122. Murakami Y , Suto F, Shimizu M , Shinoda T, Kameyama T, Fujisawa H (2001) Differential expression of plexin-A subfamily members in the mouse nervous system. Dev Dyn 220:246-258. Murray H M , Gurule M E (1979) Origin of the rubrospinal tract of the rat. Neurosci Lett 14:19-23. Nakamura F, Kalb R G , Strittmatter S M (2000) Molecular basis of semaphorin-mediated axon guidance. J Neurobiol 44:219-229. 206 Nakamura F, Tanaka M , Takahashi T, Kalb R G , Strittmatter S M (1998) Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse. Neuron 21:1093-1100. Naldini L , Vigna E , Narsimhan R P , Gaudino G , Zarnegar R, Michalopoulos G K , Comoglio P M (1991) Hepatocyte growth factor (HGF) stimulates the tyrosine kinase activity of the receptor encoded by the proto-oncogene c - M E T . Oncogene 6:501-504. Naveilhan P, ElShamy W M , Ernfors P (1997) Differential regulation of m R N A s for G D N F and its receptors Ret and G D N F R alpha after sciatic nerve lesion in the mouse. Eur J Neurosci 9:1450-1460. Negishi M , Oinuma I, Katoh H (2005a) R-ras as a key player for signalling pathway of plexins. M o l Neurobiol 32:217-222. Negishi M , Oinuma I, Katoh H (2005b) Plexins: axon guidance and signal transduction. Cell M o l Life Sci 62:1363-1371. Neufeld G , Shraga-Heled N , Lange T, Guttmann-Raviv N , Herzog Y , Kessler O (2005) Semaphorins in cancer. Front Biosci 10:751-760. Nguyen QT, Sanes JR, Lichtman J W (2002) Pre-existing pathways promote precise projection patterns. Nat Neurosci 5:861-867. Nicholls J, Saunders N (1996) Regeneration of immature mammalian spinal cord after injury. Trends Neurosci 19:229-234. Nic lou SP, Franssen E H , Ehlert E M , Taniguchi M , Verhaagen J (2003) Meningeal cell-derived semaphorin 3 A inhibits neurite outgrowth. M o l Cel l Neurosci 24:902-912. Niederost B , Oertle T, Fritsche J, McKinney R A , Bandtlow C E (2002) Nogo-A and myelin-associated glycoprotein mediate neurite growth inhibition by antagonistic regulation of RhoA and Rac 1. J Neurosci 22:10368-10376. Nobes C D , Hal l A (1995) Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cel l 81:53-62. Ohta K , Takagi S, Asou H , Fujisawa H (1992) Involvement of neuronal cell surface molecule B2 in the formation of retinal plexiform layers. Neuron 9:1.51-161. Ohta K , Mizutani A , Kawakami A , Murakami Y , Kasuya Y , Takagi S, Tanaka H , Fujisawa H (1995) Plexin: a novel neuronal cell surface molecule that mediates cell adhesion via a homophilic binding mechanism in the presence of calcium ions. Neuron 14:1189-1199. 207 Oinuma I, Katoh H , Harada A , Negishi M (2003) Direct interaction of R n d l with P lex in-Bl regulates PDZ-RhoGEF-mediated Rho activation by P l ex in -B l and induces cell contraction in COS-7 cells. J B i o l Chem 278:25671-25677. Oinuma I, Ishikawa Y , Katoh H , Negishi M (2004) The Semaphorin 4D receptor P lex in-Bl is a GTPase activating protein for R-Ras. Science 305:862-865. Olayioye M A , Neve R M , Lane H A , Hynes N E (2000) The ErbB signalling network: receptor heterodimerization in development and cancer. Embo J 19:3159-3167. Oster SF, Sretavan D W (2003) Connecting the eye to the brain: the molecular basis of ganglion cell axon guidance. B r J Ophthalmol 87:639-645. Owesson C, Pizzey J, Tonge D (2000) Sensitivity of NGF-responsive dorsal root ganglion neurons to semaphorin D is maintained in both neonatal and adult mice. Exp Neurol 165:394-398. Ozaki S, Snider W D (1997) Initial trajectories of sensory axons toward laminar targets in the developing mouse spinal cord. J Comp Neurol 380:215-229. Pascual M , Pozas E , Soriano E (2005) Role of class 3 semaphorins in the development and maturation of the septohippocampal pathway. Hippocampus 15:184-202. Pasquale E B (2005) Eph receptor signalling casts a wide net on cell behaviour. Nat Rev M o l Cel l B i o l 6:462-475. Pasterkamp R J (2005) R-Ras fills another G A P in semaphorin signalling. Trends Cell B i o l 15:61-64. Pasterkamp RJ , Verhaagen J (2001) Emerging roles for semaphorins in neural regeneration. Brain Res Brain Res Rev 35:36-54. Pasterkamp R J , Giger RJ , Verhaagen J (1998a) Regulation of semaphorin III/collapsin-1 gene expression during peripheral nerve regeneration. Exp Neurol 153:313-327. Pasterkamp RJ , Ruitenberg M J , Verhaagen J (1999a) Semaphorins and their receptors in olfactory axon guidance. Cel l M o l B io l (Noisy-le-grand) 45:763-779. Pasterkamp RJ , Anderson P N , Verhaagen J (2001) Peripheral nerve injury fails to induce growth of lesioned ascending dorsal column axons into spinal cord scar tissue expressing the axon repellent Semaphorin3A. Eur J Neurosci 13:457-471. Pasterkamp RJ , De Winter F, Holtmaat A J , Verhaagen J (1998b) Evidence for a role of the chemorepellent semaphorin III and its receptor neuropilin-1 in the regeneration of primary olfactory axons. J Neurosci 18:9962-9976. 208 Pasterkamp RJ , Peschon JJ, Spriggs M K , Kolodkin A L (2003) Semaphorin 7A promotes axon outgrowth through integrins and M A P K s . Nature 424:398-405. Pasterkamp RJ , Giger R J , Ruitenberg M J , Holtmaat A J , De Wit J, De Winter F, Verhaagen J (1999b) Expression of the gene encoding the chemorepellent semaphorin III is induced in the fibroblast component of neural scar tissue formed following injuries of adult but not neonatal C N S . M o l Cel l Neurosci 13:143-166. Pearson RJ , Jr., Carroll S L (2004) ErbB transmembrane tyrosine kinase receptors are expressed by sensory and motor neurons projecting into sciatic nerve. J Histochem Cytochem 52:1299-1311. Peles E , Yarden Y (1993) Neu and its ligands: from an oncogene to neural factors. Bioessays 15:815-824. Perrot V , Vazquez-Prado J, Gutkind JS (2002) Plexin B regulates Rho through the guanine nucleotide exchange factors leukemia-associated Rho G E F ( L A R G ) and PDZ-RhoGEF. J B io l Chem 277:43115-43120. Perry V H , Brown M C , Gordon S (1987) The macrophage response to central and peripheral nerve injury. A possible role for macrophages in regeneration. J Exp Med 165:1218-1223. Piehl F, Tabar G , Cullheim S (1995) Expression of N M D A receptor m R N A s in rat motoneurons is down-regulated after axotomy. Eur J Neurosci 7:2101-2110. Piehl F, Hammarberg H , Tabar G , Hokfelt T, Cullheim S (1998) Changes in the m R N A expression pattern, with special reference to calcitonin gene-related peptide, after axonal injuries in rat motoneurons depends on age and type of injury. Exp Brain Res 119:191-204. Piehl F, Arvidsson U , Johnson H , Cullheim S, Dagerlind A , Ulfhake B , Cao Y , Elde R, Pettersson R F , Terenius L , et al. (1993) GAP-43 , aFGF, C C K and alpha- and beta-CGRP in rat spinal motoneurons subjected to axotomy and/or dorsal root severance. Eur J Neurosci 5:1321-1333. Plunet W, K w o n B K , Tetzlaff W (2002) Promoting axonal regeneration in the central nervous system by enhancing the cell body response to axotomy. J Neurosci Res 68:1-6. Polleux F, Morrow T, Ghosh A (2000) Semaphorin 3A is a chemoattractant for cortical apical dendrites. Nature 404:567-573. Polleux F, Giger R J , Ginty D D , Kolodkin A L , Ghosh A (1998) Patterning of cortical efferent projections by semaphorin-neuropilin interactions. Science 282:1904-1906. 209 Potiron V , Roche J (2005) Class 3 semaphorin signalling: the end of a dogma. Sci S T K E 2005:pe24. Pozas E , Pascual M , Nguyen Ba-Charvet K T , Guijarro P, Sotelo C, Chedotal A , Del Rio JA , Soriano E (2001) Age-dependent effects of secreted Semaphorins 3A, 3F, and 3E on developing hippocampal axons: in vitro effects and phenotype of Semaphorin 3A (-/-) mice. M o l Cel l Neurosci 18:26-43. Price SR, De Marco Garcia N V , Ranscht B , Jessell T M (2002) Regulation of motor neuron pool sorting by differential expression of type II cadherins. Cel l 109:205-216. Puschel A W (2002) The function of neuropilin/plexin complexes. A d v Exp M e d B io l 515:71-80. Puschel A W , Adams R H , Betz H (1995) Murine semaphorin D/collapsin is a member of a diverse gene family and creates domains inhibitory for axonal extension. Neuron 14:941-948. Puschel A W , Adams R H , Betz H (1996) The sensory innervation of the mouse spinal cord may be patterned by differential expression of and differential responsiveness to semaphorins. M o l Cel l Neurosci 7:419-431. Qu X , Wei H , Zhai Y , Que H , Chen Q, Tang F, Wu Y , X i n g G , Zhu Y , L i u S, Fan M , He F (2002) Identification, characterization, and functional study of the two novel human members of the semaphorin gene family. J B io l Chem 277:35574-35585. Ramer L M , Ramer M S , Steeves JD (2005) Setting the stage for functional repair of spinal cord injuries: a cast of thousands. Spinal Cord 43:134-161. Ramer M S , Bisby M A (1998) Differences in sympathetic innervation of mouse D R G following proximal or distal nerve lesions. Exp Neurol 152:197-207. Ramer M S , Thompson SW, McMahon SB (1999) Causes and consequences of sympathetic basket formation in dorsal root ganglia. Pain Suppl 6:S111-120. Raper J A (2000) Semaphorins and their receptors in vertebrates and invertebrates. Curr Opin Neurobiol 10:88-94. Rende M , Giambanco I, Buratta M , Tonali P (1995) Axotomy induces a different modulation of both low-affinity nerve growth factor receptor and choline acetyltransferase between adult rat spinal and brainstem motoneurons. J Comp Neurol 363:249-263. Renzi M J , Feiner L , Koppel A M , Raper J A (1999) A dominant negative receptor for specific secreted semaphorins is generated by deleting an extracellular domain from neuropilin-1. J Neurosci 19:7870-7880. 210 Reza JN , Gavazzi I, Cohen J (1999) Neuropilin-1 is expressed on adult mammalian dorsal root ganglion neurons and mediates semaphorin3a/collapsin-l-induced growth cone collapse by small diameter sensory afferents. M o l Cel l Neurosci 14:317-326. Rice DS , Huang W, Jones H A , Hansen G , Y e G L , X u N , Wilson E A , Troughton K , Vaddi K , Newton R C , Zambrowicz B P , Sands A T (2004) Severe retinal degeneration associated with disruption of semaphorin 4A. Invest Ophthalmol V i s Sci 45:2767-2777. Richardson P M , Issa V M (1984) Peripheral injury enhances central regeneration of primary sensory neurones. Nature 309:791-793. Richardson P M , Riopelle R J (1986) Influences of peripheral nerve components on axonal growth. A n n N Y Acad Sci 486:182-193. Richardson P M , McGuinness U M , Aguayo A J (1980) Axons from C N S neurons regenerate into PNS grafts. Nature 284:264-265. Rodger J, Lindsey K A , Leaver SG, K i n g C E , Dunlop S A , Beazley L D (2001) Expression of ephrin-A2 in the superior colliculus and EphA5 in the retina following optic nerve section in adult rat. Eur J Neurosci 14:1929-1936. Rohm B , Ottemeyer A , Lohrum M , Puschel A W (2000) Plexin/neuropilin complexes mediate repulsion by the axonal guidance signal semaphorin 3A. Mech Dev 93:95-104. Roskams A J , Bredt DS , Dawson T M , Ronnett G V (1994) Nitric oxide mediates the formation of synaptic connections in developing and regenerating olfactory receptor neurons. Neuron 13:289-299. Sahay A , Mol l iver M E , Ginty D D , Kolodkin A L (2003) Semaphorin 3F is critical for development of limbic system circuitry and is required in neurons for selective C N S axon guidance events. J Neurosci 23:6671-6680. Salzer JL , Bunge R P (1980) Studies of Schwann cell proliferation. I. A n analysis in tissue culture of proliferation during development, Wallerian degeneration, and direct injury. J Cel l B io l 84:739-752. Sandvig A , Berry M , Barrett L B , Butt A , Logan A (2004) Myel in- , reactive glia-, and scar-derived C N S axon growth inhibitors: expression, receptor signalling, and correlation with axon regeneration. Gl ia 46:225-251. Sasaki Y , Cheng C, Uchida Y , Nakajima O, Ohshima T, Yagi T, Taniguchi M , Nakayama T, Kishida R, Kudo Y , Ohno S, Nakamura F, Goshima Y (2002) Fyn and Cdk5 mediate semaphorin-3A signalling, which is involved in regulation of dendrite orientation in cerebral cortex. Neuron 35:907-920. 211 Scarlato M , Ara J, Bannerman P, Scherer S, Pleasure D (2003) Induction of neuropilins-1 and -2 and their ligands, Sema3A, Sema3F, and V E G F , during Wallerian degeneration in the peripheral nervous system. Exp Neurol 183:489-498. Schmidt H , Werner M , Heppenstall P A , Henning M , More M I , Kuhbandner S, Lewin G R , Hofmann F, Fei l R, Rathjen F G (2002a) cGMP-mediated signalling via cGKIalpha is required for the guidance and connectivity of sensory axons. J Cel l B io l 159:489-498. Schmidt JT, Morgan P, Dowell N , Leu B (2002b) Myosin light chain phosphorylation and growth cone motility. J Neurobiol 52:175-188. Schnell L , Schwab M E (1990) Axonal regeneration in the rat spinal cord produced by an antibody against myelin-associated neurite growth inhibitors. Nature 343:269-272. Schreyer DJ , Skene J H (1991) Fate of GAP-43 in ascending spinal axons of D R G neurons after peripheral nerve injury: delayed accumulation and correlation with regenerative potential. J Neurosci 11:3738-3751. Schreyer DJ , Skene J H (1993) Injury-associated induction of GAP-43 expression displays axon branch specificity in rat dorsal root ganglion neurons. J Neurobiol 24:959-970. Schultze W, Eulenburg V , Lessmann V , Herrmann L , Dittmar T, Gundelfinger E D , Heumann R, Erdmann K S (2001) Semaphorin4F interacts with the synapse-associated protein SAP90/PSD-95. J Neurochem 78:482-489. Schwab M E , Bartholdi D (1996) Degeneration and regeneration of axons in the lesioned spinal cord. Physiol Rev 76:319-370. Schwarting G A , Kostek C, Ahmad N , Dibble C, Pays L , Puschel A W (2000) Semaphorin 3A is required for guidance of olfactory axons in mice. J Neurosci 20:7691-7697. Selzer M E (2003) Promotion of axonal regeneration in the injured C N S . Lancet Neurol 2:157-166. Semaphorin Nomenclature Committee (1999) Unified nomenclature for the semaphorins/collapsins. Semaphorin Nomenclature Committee. Cel l 97:551-552. Semba K , Egger M D (1986) The facial "motor" nerve of the rat: control of vibrissal movement and examination o f motor and sensory components. J Comp Neurol 247:144-158. Sendtner M , Stockli K A , Thoenen H (1992) Synthesis and localization of ciliary neurotrophic factor in the sciatic nerve of the adult rat after lesion and during regeneration. J Cell B io l 118:139-148. Serini G , Valdembri D , Zanivan S, Morterra G , Burkhardt C, Caccavari F, Zammataro L, Primo L , Tamagnone L , Logan M , Tessier-Lavigne M , Taniguchi M , Puschel A W , Bussolino F 212 (2003) Class 3 semaphorins control vascular morphogenesis by inhibiting integrin function. Nature 424:391-397. Shamah S M , L i n M Z , Goldberg JL , Estrach S, Sahin M , H u L , Bazalakova M , Neve R L , Corfas G , Debant A , Greenberg M E (2001) EphA receptors regulate growth cone dynamics through the novel guanine nucleotide exchange factor ephexin. Cel l 105:233-244. Shinder V , Govrin-Lippmann R, Cohen S, Belenky M , Ilin P, Fried K , Wilkinson H A , Devor M (1999) Structural basis of sympathetic-sensory coupling in rat and human dorsal root ganglia following peripheral nerve injury. J Neurocytol 28:743-761. Skaliora I, Singer W , Betz H , Puschel A W (1998) Differential patterns of semaphorin expression in the developing rat brain. Eur J Neurosci 10:1215-1229. Skaper SD, Moore SE, Walsh FS (2001) Cel l signalling cascades regulating neuronal growth-promoting and inhibitory cues. Prog Neurobiol 65:593-608. Snider W D , M c M a h o n SB (1998) Tackling pain at the source: new ideas about nociceptors. Neuron 20:629-632. Son Y J , Thompson W J (1995) Schwann cell processes guide regeneration of peripheral axons. Neuron 14:125-132. Song H , M i n g G , He Z , Lehmann M , McKerracher L , Tessier-Lavigne M , Poo M (1998) Conversion of neuronal growth cone responses from repulsion to attraction by cyclic nucleotides. Science 281:1515-1518. Spinelli E (2006) Expression of plexins in the vertebrate nervous system following injury. In preparation. Steinbach K , Volkmer H , Schlosshauer B (2002) Semaphorin 3E/collapsin-5 inhibits growing retinal axons. Exp Cel l Res 279:52-61. Steup A , Lohrum M , Hamscho N , Savaskan N E , Ninnemann O, Nitsch R, Fujisawa H , Puschel A W , Skutella T (2000) Sema3C and netrin-1 differentially affect axon growth in the ' hippocampal formation. M o l Cel l Neurosci 15:141-155. Streit WJ , Kreutzberg G W (1988) Response of endogenous glial cells to motor neuron degeneration induced by toxic ricin. J Comp Neurol 268:248-263. Strominger R N , McGiffen JE, Strominger N L (1987) Morphometric and experimental studies of the red nucleus in the albino rat. Anat Rec 219:420-428. Suto F, Murakami Y , Nakamura F, Goshima Y , Fujisawa H (2003) Identification and characterization of a novel mouse plexin, plexin-A4. Mech Dev 120:385-396. 213 Suto F, Ito K , Uemura M , Shimizu M , Shinkawa Y , Sanbo M , Shinoda T, Tsuboi M , Takashima S, Yag i T, Fujisawa H (2005) Plexin-a4 mediates axon-repulsive activities of both secreted and transmembrane semaphorins and plays roles in nerve fiber guidance. J Neurosci 25:3628-3637. Swiercz J M , Kuner R, Offermanns S (2004) Plexin-B 1/RhoGEF-mediated RhoA activation involves the receptor tyrosine kinase ErbB-2. J Cel l B i o l 165:869-880. Swiercz J M , Kuner R, Behrens J, Offermanns S (2002) P l ex in -B l directly interacts with P D Z -R h o G E F / L A R G to regulate RhoA and growth cone morphology. Neuron 35:51-63. Takagi S, Hirata T, Agata K , Moch i i M , Eguchi G , Fujisawa H (1991) The A 5 antigen, a candidate for the neuronal recognition molecule, has homologies to complement components and coagulation factors. Neuron 7:295-307. Takahashi T, Strittmatter S M (2001) Plexinal autoinhibition by the plexin sema domain. Neuron 29:429-439. Takahashi T, Nakamura F, Jin Z , Kalb R G , Strittmatter S M (1998) Semaphorins A and E act as antagonists of neuropilin-1 and agonists of neuropilin-2 receptors. Nat Neurosci 1:487-493. Takahashi T, Fournier A , Nakamura F, Wang L H , Murakami Y , Kalb R G , Fujisawa H , Strittmatter S M (1999) Plexin-neuropilin-1 complexes form functional semaphorin-3A receptors. Cel l 99:59-69. Tamagnone L , Comoglio P M (2000) Signalling by semaphorin receptors: cell guidance and beyond. Trends Cel l B io l 10:377-383. Tamagnone L , Artigiani S, Chen H , He Z , M i n g GI, Song H , Chedotal A , Winberg M L , Goodman C S , Poo M , Tessier-Lavigne M , Comoglio P M (1999) Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cel l 99:71-80. • Tanelian D L , Barry M A , Johnston SA, Le T, Smith G M (1997) Semaphorin III can repulse and inhibit adult sensory afferents in vivo. Nat Med 3:1398-1401. Tang X Q , Tanelian D L , Smith G M (2004) Semaphorin3A inhibits nerve growth factor-induced sprouting of nociceptive afferents in adult rat spinal cord. J Neurosci 24:819-827. Taniguchi M , Yuasa S, Fujisawa H , Naruse I, Saga S, Mishina M , Yagi T (1997) Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projection. Neuron 19:519-530. 214 Taniguchi M , Nagao H , Takahashi Y K , Yamaguchi M , Mitsui S, Yagi T, M o r i K , Shimizu T (2003) Distorted odor maps in the olfactory bulb of semaphorin 3A-deficient mice. J Neurosci 23:1390-1397. Taniguchi M , Masuda T, Fukaya M , Kataoka H ; Mishina M , Yaginuma H , Watanabe M , Shimizu T (2005) Identification and characterization of a novel member of murine semaphorin family. Genes Cells 10:785-792. Terao E , Janssens S, van den Bosch de Aguilar P, Portier M , Klosen P (2000) In vivo expression of the intermediate filament peripherin in rat motoneurons: modulation by inhibitory and stimulatory signals. Neuroscience 101:679-688. Terenghi G (1999) Peripheral nerve regeneration and neurotrophic factors. J Anat 194 ( Pt 1):1-14. Terman JR, Mao T, Pasterkamp RJ , Y u H H , Kolodkin A L (2002) M I C A L s , a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cel l 109:887-900. Tessier-Lavigne M (1995) Eph receptor tyrosine kinases, axon repulsion, and the development of topographic maps. Cel l 82:345-348. Tetzlaff W, Bisby M A (1989) Neurofilament elongation into regenerating facial nerve axons. Neuroscience 29:659-666. Tetzlaff W, Alexander SW, Mi l l e r F D , Bisby M A (1991) Response of facial and rubrospinal neurons to axotomy: changes in m R N A expression for cytoskeletal proteins and GAP-43 . J Neurosci 11:2528-2544. Tetzlaff W, Kobayashi N R , Giehl K M , Tsui B J , Cassar S L , Bedard A M (1994) Response of rubrospinal and corticospinal neurons to injury and neurotrophins. Prog Brain Res 103:271-286. Tezuka T, Umemori H , Akiyama T, Nakanishi S, Yamamoto T (1999) PSD-95 promotes Fyn-mediated tyrosine phosphorylation of the N-methyl-D-aspartate receptor subunit N R 2 A . Proc Natl Acad Sci U S A 96:435-440. Thewke DP , Seeds N W (1999) The expression of m R N A s for hepatocyte growth factor/scatter factor, its receptor c-met, and one of its activators tissue-type plasminogen activator show a systematic relationship in the developing and adult cerebral cortex and hippocampus. Brain Res 821:356-367. Tomaselli K J , Doherty P, Emmett C J , Damsky C H , Walsh FS , Reichardt L F (1993) Expression of beta 1 integrins in sensory neurons of the dorsal root ganglion and their functions in neurite outgrowth on two laminin isoforms. J Neurosci 13:4880-4888. 215 Tomov T L , Guntinas-Lichius O, Grosheva M , Streppel M , Schraermeyer U , Neiss WF, Angelov D N (2002) A n example of neural plasticity evoked by putative behavioral demand and early use of vibrissal hairs after facial nerve transection. Exp Neurol 178:207-218. Toyofuku T, Yoshida J, Sugimoto T, Zhang H , Kumanogoh A , Hor i M , Kikutani H (2005) F A R P 2 triggers signals for Sema3A-mediated axonal repulsion. Nat Neurosci 8:1712-1719. Toyofuku T, Zhang H , Kumanogoh A , Takegahara N , Yabuki M , Harada K , Hori M , Kikutani H (2004a) Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling. Nat Ce l l B i o l 6:1204-1211. Toyofuku T, Zhang H , Kumanogoh A , Takegahara N , Suto F , Kamei J, A o k i K , Yabuki M , Hori M , Fujisawa H , Kikutani H (2004b) Dual roles of Sema6D in cardiac morphogenesis through region-specific association of its receptor, P l e x i n - A l , with off-track and vascular endothelial growth factor receptor type 2. Genes Dev 18:435-447. Trachtenberg JT, Thompson W J (1996) Schwann cell apoptosis at developing neuromuscular junctions is regulated by glial growth factor. Nature 379:174-177. Turner L J , Nicholls S, Hal l A (2004) The activity of the p l ex in -Al receptor is regulated by Rac. J B i o l Chem 279:33199-33205. Uehata M , Ishizaki T, Satoh H , Ono T, Kawahara T, Morishita T, Tamakawa H , Yamagami K , Inui J, Maekawa M , Narumiya S (1997) Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389:990-994. van der Zwaag B , Hellemons A J , Leenders WP, Burbach JP, Brunner H G , Padberg G W , Van Bokhoven H (2002) P L E X I N - D 1 , a novel plexin family member, is expressed in vascular endothelium and the central nervous system during mouse embryogenesis. Dev Dyn 225:336-343. Varela-Echavarria A , Tucker A , Puschel A W , Guthrie S (1997) Motor axon subpopulations respond differentially to the chemorepellents netrin-1 and semaphorin D . Neuron 18:193-207. Vastrik I, Eickholt B J , Walsh FS, Ridley A , Doherty P (1999) Sema3A-induced growth-cone collapse is mediated by R a c l amino acids 17-32. Curr B i o l 9:991-998. Vearing CJ , Lackmann M (2005) "Eph receptor signalling; dimerisation just isn't enough". Growth Factors 23:67-76. Venstrom K , Reichardt L (1995) Beta 8 integrins mediate interactions of chick sensory neurons with laminin-1, collagen IV, and fibronectin. M o l B i o l Cel l 6:419-431. 216 Vik i s H G , L i W , Guan K L (2002) The plexin-B 1/Rac interaction inhibits P A K activation and enhances Sema4D ligand binding. Genes Dev 16:836-845. Vik i s H G , L i W, He Z , Guan K L (2000) The semaphorin receptor p lexin-Bl specifically interacts with active Rac in a ligand-dependent manner. Proc Natl Acad Sci U S A 97:12457-12462. Wahl S, Barth H , Ciossek T, Aktories K , Mueller B K (2000) Ephrin-A5 induces collapse of growth cones by activating Rho and Rho kinase. J Cel l B i o l 149:263-270. Walz A , Rodriguez I, Mombaerts P (2002) Aberrant sensory innervation of the olfactory bulb in neuropilin-2 mutant mice. J Neurosci 22:4025-4035. Walzer T, Galibert L , De Smedt T (2005) Dendritic cell function in mice lacking Plexin C l . Int Immunol 17:943-950. Wang L H , Kalb R G , Strittmatter S M (1999) A P D Z protein regulates the distribution of the transmembrane semaphorin, M-SemF. J B i o l Chem 274:14137-14146. Wang T, X i e K , L u B (1995) Neurotrophins promote maturation of developing neuromuscular synapses. J Neurosci 15:4796-4805. Wang Y J , Tseng G F (2004a) Spinal axonal injury induces brief downregulation of ionotropic glutamate receptors and no stripping of synapses in cord-projection central neurons. J Neurotrauma 21:1624-1639. Wang Y J , Tseng G F (2004b) Spinal axonal injury transiently elevates the level of metabotropic glutamate receptor 5, but not 1, in cord-projection central neurons. J Neurotrauma 21:479-489. Wang Y J , Chen JR, Tseng G F (2002) Fate of the soma and dendrites of cord-projection central neurons after proximal and distal spinal axotomy: an intracellular dye injection study. J Neurotrauma 19:1487-1502. Watson C R , Sakai S, Armstrong W (1982) Organization of the facial nucleus in the rat. Brain Behav Evo l 20:19-28. Webb A A , M u i r G D (2003) Unilateral dorsal column and rubrospinal tract injuries affect overground locomotion in the unrestrained rat. Eur J Neurosci 18:412-422. Whishaw IQ, Gorny B (1996) Does the red nucleus provide the tonic support against which fractionated movements occur? A study on forepaw movements used in skilled reaching by the rat. Behav Brain Res 74:79-90. 217 Whishaw IQ, Pellis S M , Pellis V C (1992) A behavioral study of the contributions of cells and fibers of passage in the red nucleus of the rat to postural righting, skilled movements, and learning. Behav Brain Res 52:29-44. White F A , Behar O (2000) The development and subsequent elimination of aberrant peripheral axon projections in Semaphorin3A null mutant mice. Dev B i o l 225:79-86. Williams-Hogarth L C , Puche A C , Torrey C, Cai X , Song I, Kolodkin A L , Shipley M T , Ronnett G V (2000) Expression of semaphorins in developing and regenerating olfactory epithelium. J Comp Neurol 423:565-578. Winberg M L , Mitchell K J , Goodman CS (1998a) Genetic analysis of the mechanisms controlling target selection: complementary and combinatorial functions of netrins, semaphorins, and I g C A M s . Cel l 93:581-591. Winberg M L , Tamagnone L , Ba i J, Comoglio P M , Montell D , Goodman CS (2001) The transmembrane protein Off-track associates with Plexins and functions downstream of Semaphorin signalling during axon guidance. Neuron 32:53-62. Winberg M L , Noordermeer J N , Tamagnone L , Comoglio P M , Spriggs M K , Tessier-Lavigne M , Goodman CS (1998b) Plexin A is a neuronal semaphorin receptor that controls axon guidance. Cel l 95:903-916. Wong J, Oblinger M M (1990) A comparison of peripheral and central axotomy effects on neurofilament and tubulin gene expression in rat dorsal root ganglion neurons. J Neurosci 10:2215-2222. Woo S, Gomez T M (2006) R a c l and RhoA promote neurite outgrowth through formation and stabilization of growth cone point contacts. J Neurosci 26:1418-1428. Wool f CJ , Reynolds M L , MolanderC, O'Brien C, Lindsay R M , Benowitz LI (1990) The growth-associated protein GAP-43 appears in dorsal root ganglion cells and in the dorsal horn of the rat spinal cord following peripheral nerve injury. Neuroscience 34:465-478. Worzfeld T, Puschel A W , Offermanns S, Kuner R (2004) Plexin-B family members demonstrate non-redundant expression patterns in the developing mouse nervous system: an anatomical basis for morphogenetic effects of Sema4D during development. Eur J Neurosci 19:2622-2632. Wright D E , Snider W D (1995) Neurotrophin receptor m R N A expression defines distinct populations of neurons in rat dorsal root ganglia. J Comp Neurol 351:329-338. Wright D E , White F A , Gerfen R W , Silos-Santiago I, Snider W D (1995) The guidance molecule semaphorin III is expressed in regions of spinal cord and periphery avoided by growing sensory axons. J Comp Neurol 361:321-333. 218 W u W, Mathew T C , Mi l l e r F D (1993) Evidence that the loss of homeostatic signals induces regeneration-associated alterations in neuronal gene expression. Dev B i o l 158:456-466. X u X , N g S, W u Z L , Nguyen D , Homburger S, Seidel-Dugan C, Ebens A , Luo Y (1998) Human semaphorin K l is glycosylphosphatidylinositol-linked and defines a new subfamily of viral-related semaphorins. J B io l Chem 273:22428-22434. X u X M , Fisher D A , Zhou L , White F A , N g S, Snider W D , Luo Y (2000) The transmembrane protein semaphorin 6 A repels embryonic sympathetic axons. J Neurosci 20:2638-2648. Yang J, Houk B , Shah J, Hauser K F , Luo Y , Smith G , Schauwecker E , Barnes G N (2005) Genetic background regulates semaphorin gene expression and epileptogenesis in mouse brain after kainic acid status epilepticus. Neuroscience 131:853-869. Yaron A , Huang P H , Cheng H J , Tessier-Lavigne M (2005) Differential requirement for Plexin-A 3 and - A 4 in mediating responses of sensory and sympathetic neurons to distinct class 3 Semaphorins. Neuron 45:513-523. Yazdani U , Terman JR (2006) The semaphorins. Genome B i o l 7:211. Y u H H , Huang A S , Kolodkin A L (2000) Semaphorin-la acts in concert with the cell adhesion molecules fasciclin II and connectin to regulate axon fasciculation in Drosophila. Genetics 156:723-731. Y u T W , Bargmann CI (2001) Dynamic regulation of axon guidance. Nat Neurosci 4 Suppl: 1169-1176. Yukawa K , Tanaka T, Bai T, Ueyama T, Owada-Makabe K , Tsubota Y , Maeda M , Suzuki K , Kikutani H , Kumanogoh A (2005) Semaphorin 4 A induces growth cone collapse of hippocampal neurons in a Rho/Rho-kinase-dependent manner. Int J M o l Med 16:115-118. Zhang X , Bao L , X u Z Q , Diez M , Frey P, Hokfelt T (1996) Peripheral axotomy induces increased expression of neurotensin in large .neurons in rat lumbar dorsal root ganglia. Neurosci Res 25:359-369. Zhou L , White F A , Lentz SI, Wright D E , Fisher D A , Snider W D (1997) Cloning and expression of a novel murine semaphorin with structural similarity to insect semaphorin I. M o l Cel l Neurosci 9:26-41. Z i f f E B (1997) Enlightening the postsynaptic density. Neuron 19:1163-1174. Zigmond R E , Hyatt-Sachs H , Mohney RP, Schreiber R C , Shadiack A M , Sun Y , Vaccariello S A (1996) Changes in neuropeptide phenotype after axotomy of adult peripheral neurons and the role of leukemia inhibitory factor. Perspect Dev Neurobiol 4:75-90. 219 A p p e n d i x A Expression of Semaphorin3C in Adult Mouse Facial and Rubrospinal Neurons Following Axotomy A version of this chapter will be submitted for publication. Oschipok LW, Teh J, McPhail LT , Tetzlaff W. Differential expression of Semaphorin3C mRNA in the facial and red nucleus following axotomy. (In preparation) 220 A . l . A P P E N D I X A I N T R O D U C T I O N A N D O V E R V I E W A member of the Class 3 semaphorin subfamily, Semaphorin3C (Sema3C) functions as either a chemoattractive or chemorepulsive guidance cue for a number of PNS and C N S neuronal populations (Takahashi et al., 1998; de Castro et al., 1999; Steup et al., 2000). In this section, I detail the results of a separate ISH pilot study which examined the expression of Sema3C m R N A in both adult mouse facial motoneurons and rubrospinal neurons following axotomy. The results revealed that uninjured, adult mouse facial motoneurons express Sema3C m R N A . Following a facial nerve resection injury, axotomized facial motoneurons transiently upregulate the expression of Sema3C m R N A , with expression peaking approximately 3 days after injury. In contrast, uninjured adult mouse rubrospinal neurons do not express Sema3C m R N A . However, following transection of the rubrospinal tract at the level of the cervical spinal cord, ISH analysis revealed that axotomized rubrospinal motoneurons significantly upregulate Sema3C m R N A expression between 7 and 14 days after injury. In previous chapters, I outlined how Sema4F is differentially expressed in several populations of axotomized neurons with varying regenerative potentials. In contrast to the expression profile of Sema4F, the evidence presented here reveals that following axotomy, Sema3C m R N A expression is upregulated in both regenerating and non-regenerating neurons. Although this is novel finding, due to time constraints and the lack of commercially available Sema3C-specific antibodies, this project was not continued. However, I present the results of the Sema3C ISH analysis in this appendix. 221 A . 2 . O V E R V I E W O F T H E E X P E R I M E N T A L Q U E S T I O N A N D H Y P O T H E S I S Following axotomy, adult rat facial motoneurons, which possess a high regenerative propensity, down-regulate Sema3A expression (Pasterkamp et al., 1998). Given evidence that several adult neuronal populations down-regulate the expression of Class 3 semaphorins in response to injury (Pasterkamp et al., 1998b; Gavazzi et al., 2000; Gavazzi, 2001; Barnes et al., 2003; Holtmaat et al., 2003), it is possible that this downregulation in Class 3 semaphorin expression may be a common response to injury in neurons with a high regenerative propensity. Thus, the goal of this study was to examine injury induced changes in the expression of a second Class 3 semaphorin, Sema3C, in mouse rubrospinal neurons (a non-regenerating neuronal population), and in mouse facial motoneurons (a regenerating neuronal population). This study tested the following hypotheses: 1. Given the evidence that the expression of Sema3A is down-regulated in facial motoneurons in response to axonal injury (Pasterkamp et al., 1998b), / hypothesis that following a facial nerve resection injury, adult mouse facial motoneurons will down-regulate the expression of Sema3C mRNA. To test this hypothesis, mice received a unilateral facial nerve resection injury, and in situ hybridization was used to examine the expression of Sema3C m R N A in both uninjured and axotomized facial motoneurons: 2. A s rubrospinal neurons fail to regenerate lesioned axons following axotomy, / hypothesize that rubrospinal neurons will not express or will down-regulated Sema3C expression in response to injury. To test this hypothesis, mice received a left dorsolateral hemisection of the cervical spinal cord to unilaterally axotomize the centrally projecting rubrospinal tract and in situ hybridization used to examine the expression of Sema3C m R N A in both uninjured and axotomized rubrospinal neurons. 222 A . 3 . R E S U L T S A .3.1. Axotomized Facial Motoneurons Transiently Upregulate Sema3C m R N A Expression Although in previous chapters, the rat was used as a model organism to study injury-induced changes in semaphorin expression, at the time that this study was performed, the only published Sema3C gene sequence available was for the mouse. Therefore, this study was performed in mice. ISH was used to examine Sema3C m R N A expression in uninjured and axotomized adult mouse F M N s , 1, 3, 7, and 14 days following a unilateral facial nerve resection and performed using two, 50-mer oligonucleotide probes complementary to bases 1211-1260, and 2002-2051 of the transcribed mouse Sema3C sequence (ascension number NMO13657). The results of the ISH study reveal that uninjured adult F M N s express Sema3C m R N A (Fig. A l ) . Following facial nerve resection, analysis of Sema3C ISH results revealed that both the injury (F (1, 23) = 22.21, p < 0.001, two-way A N O V A ) , and the number of days following nerve resection (F (1, 23) = 4.35, p = 0.02, two-way A N O V A ) had a significant effect on the expression of Sema3C m R N A in F M N s . In addition, a statistically significant interaction was observed to occur between these two variables (Injury vs. Time course; F (1, 23) - 4.43, p = 0.02, two-way A N O V A ) . Post-hoc analysis revealed that 1 day following a facial nerve resection injury, Sema3C m R N A expression in axotomized F M N s (n = 3 animals) was not statistically elevated when compared to contralateral, uninjured F M N s (p = 0.169, Student's t-test; F ig . A l ) . However, 3 days following a facial nerve resection, (n = 3 animals), Sema3C m R N A expression is significantly elevated in axotomized F M N s when corripared to contralateral, uninjured motoneurons (p = 0.01, Student's t-test; F ig . A l ) . This up-regulation in Sema3C m R N A expression in axotomized F M N s is transient, as analysis of Sema3C expression 7 and 14 days (n = 3 animals/time point) following injury reveal that the expression of Sema3C m R N A in axotomized F M N s is no longer statistically different when compared to uninjured, contralateral neurons, (p = 0.139, and p -0.524, respectively, Student's t-test; Fig . A l ) . See Table A l for results. These results reveal that, unlike the downregulation in Sema3A m R N A expression observed to occur in rat F M N s following axotomy, axotomized mouse F M N s upregulate Sema3C m R N A expression in response to injury. 223 A . 3 . 2 . A x o t o m y o f t h e A d u l t M o u s e R u b r o s p i n a l T r a c t I n d u c e s Sema3C m R N A E x p r e s s i o n i n A x o t o m i z e d R u b r o s p i n a l M o t o n e u r o n s Next, ISH was used to examine the expression of Sema3C m R N A expression in adult mouse RSNs 3, 7 and 14 days following a dorsolateral hemisection of the cervical (C3/C4) spinal cord. Unlike F M N s , Sema3C m R N A expression was not detected in uninjured rubrospinal neurons (Fig. A2) . However,, following a unilateral cervical rubrospinal tract axotomy, analysis of Sema3C ISH data reveals that both the injury (F (1, 27) = 231.43, p < 0.001, two-way A N O V A ) , and the number of days following tract axotomy (F (1, 27) = 36.57, p < 0.001, two-way A N O V A ) had a significant effect on the expression of Sema3C m R N A in RSNs. In addition, a statistically significant interaction was observed to occur between these two variables (Injury vs. Time course; F (1, 27) = 33.79,p < 0.001, two-way A N O V A ) . Three days following a unilateral cervical rubrospinal tract axotomy, post-hoc analysis reveals no significant increase in Sema3C m R N A expression in axotomized rubrospinal neurons, when compared to uninjured, contralateral neurons (n = 4 animals, p = 0.07, Student's t-test; F ig . A2) . However, qualitative analysis revealed that a small number of axotomized rubrospinal did upregulate Sema3C m R N A expression at this time point (Fig. A2) . In contrast, 7 days following rubrospinal tract axotomy, Sema3C m R N A expression is significantly elevated in axotomized rubrospinal neurons when compared to contralateral, uninjured neurons (n = 5 animals,/? < 0.001, Student's t-test; Fig. A2) . Finally, unlike the time course of Sema3C m R N A expression observed in axotomized F M N s (Fig. A l ) , 14 days following injury, Sema3C m R N A expression in axotomized rubrospinal motoneurons continues to be significantly upregulated when compared to uninjured, control rubrospinal neurons (n = 5 animals, p < 0.001, Student's t-test; F ig . A2) . See Table A l for results. These results reveal that adult uninjured mouse rubrospinal neurons do not express Sema3C m R N A , but following cervical axotomy of the rubrospinal tract, upregulate Sema3C m R N A expression in response to injury. 224 Table A . l . Expression of Sema3C m R N A in adult mouse facial and rubrospinal neurons. Following injury, the profiles of each neuronal cell body (in both the injured and uninjured nuclei) were outlined and the area occupied by the silver grains in each cell profile was quantified and compared to the average background ISH grain density on each section. Results are represented as a magnitude of average background signal at each time point (i.e. times greater than background) and is presented as the mean ±standard error of the mean (Mean ± S.E.M.). Days Post Facial Nerve Resection Rubrospinal Tract Lesion Injury Uninjured Axotomized Uninjured Axotomized 1 7.2 ± 1.9 10.7 ± 6.8 N/A N/A 3 6.7 ± 1.5 18.2 ± 2.2 0.9 ± 0.03 1.5 ±0 .3 7 6.7 ± 1.2 11 .4±2.3 1.0 ±0.1 4.5 ± 0.3 14 6.6 ±0 .6 7.3 ±0 .9 1.0 ± 0.07 4.9 ± 0.3 225 F i g u r e A . l . Sema3C m R N A is e x p r e s s e d b y m o u s e f a c i a l m o t o n e u r o n s a n d is s i g n i f i c a n t l y u p r e g u l a t e d 3 d a y s f o l l o w i n g a f a c i a l n e r v e r e s e c t i o n . ( A ) Darkfield micrographs of Sema3C ISH signal in facial motoneurons 1, 3, 7, and 14 days after a facial nerve resection. In each series of horizontal panels, the leftmost image corresponds to Sema3C m R N A expression in uninjured facial motoneurons neurons, while the middle panels depict Sema3C m R N A expression in axotomized facial motoneurons 1, 3, 7, or 14 days after facial nerve resection. Rightmost images are fluorescent images of Neurotrace® counterstained neurons underlying the ISH signal present in the middle panels. Results reveal that Sema3C m R N A is expressed in uninjured adult facial motoneurons. Following a facial nerve resection injury, a slight increase in Sema3C m R N A expression is detected in axotomized facial motoneurons 3 days after injury. Arrows in the middle and right hand panels indicate the co-localization of Sema3C ISH signal over axotomized facial motoneurons. (Scale bar = 100pm) (B) Quantification of Sema3C m R N A expression in adult mouse facial motoneurons. Results reveal that the Sema3C m R N A expression is significantly upregulated in axotomized facial motoneurons 3 days following a facial nerve resection injury, when compared to contralateral, uninjured, motoneurons (p = 0.01; Student's t-test). (* Indicatesp < 0.05) 227 F i g u r e A . 2 . SemaSC m R N A e x p r e s s i o n is s i g n i f i c a n t l y u p r e g u l a t e d i n a x o t o m i z e d m o u s e r u b r o s p i n a l n e u r o n s . ( A ) Darkfield micrographs of Sema3C ISH signal in rubrospinal neurons 3, 7, and 14 days following a dorsolateral hemisection of the cervical (C3/C4) spinal cord. In each series of horizontal panels, the leftmost image corresponds to SemaSC m R N A expression in uninjured rubrospinal neurons, while the middle panels depict Sema3C m R N A expression in axotomized rubrospinal neurons. Rightmost images are fluorescent images of Neurotrace® counterstained neurons underlying the ISH signal present in the middle panels. Results reveal that uninjured rubrospinal neurons do not express SemaSC m R N A . Axotomized rubrospinal neurons upregulate the expression of SemaSC m R N A as early as 3 days after injury, and expression is widespread in axotomized neurons 7 and 14 days following injury. Arrows in the middle and right hand panels indicate the co-localization of Sema3C ISH signal over axotomized rubrospinal neurons. (Scale bar = 100pm) (B) Quantification of SemaSC m R N A expression in adult mouse rubrospinal neurons. Results reveal that the SemaSC m R N A expression is significantly upregulated in axotomized rubrospinal neurons 7 and 14 days following axotomy, when compared to contralateral, uninjured rubrospinal neurons, (p < 0.001, Student's t-test). (**Indicatesp < 0.001) Fig. A.2. 228 u n i n j u r e d a x o t o m i z e d \ • % P f i Jf. *t~..' yj; . 4 . " B 6 1 3 5 o 4H ro -C in E X CO uninjured axotomized ** i • • 3 7 14 days post lesion A p p e n d i x B Supplementary Figures and Documentation 230 B . l . S U P P L E M E N T A R Y F I G U R E S Figure B . l . Testing Sema4F I S H specificity using Sema4F sense oligonucleotide probes. Darkfield micrographs of Sema4F Sense ISH signal in facial motoneurons (top panels) and D R G neurons (bottom panels), 7 days following a facial nerve resection injury or a spinal nerve lesion. In each series of panels, the leftmost images correspond to the ISH signal obtained following hybridization with Sema4F sense probes, while the rightmost images are fluorescent images of Neurotrace® counterstained neurons underlying the ISH signal detected in the left panels. Results reveal that no ISH signal is detected in either injured or uninjured peripherally-axotomized neurons following ISH using control Sema4F probes. (Scale bar = 100pm) 7d Facial Resection ISH With Sema4F Sense Probes I S H N i s s l 7d SNL ISH With Sema4F Sense Probes I S H N i s s l 232 Figure B.2. Analysis of H E K 293 cell transfections and specificity of the Sema4F antibody and I S H probes. (A) Characterization of Sema4F-expressing H E K 293 cells. Western blot analysis was used to confirm the expression of full-length Sema4F in H E K 293 cells following transfection. First, an antibody to H A was used to examine Sema4F expression in H E K 293 cells (left blot). The results revealed that HA-tagged Sema4F was not detected in either Mock transfected cells, or in cells transfected with an empty expression plasmid. In contrast, strong H A immunoreactivity was detected in two cell lines transfected to express full-length, HA-tagged, Sema4F. Next, Sema4F expression was confirmed using an antibody directed against the N -terminal region of rat Sema4F (right blot). The results confirm that both Sema4F-expressing cell lines are immunoreactive for Sema4F, although the expression in one line (Sema4F #2) was much higher. A s such, Sema4F #2 line was used in all subsequent experiments. (B) Western blot analysis on protein samples obtained from adult rat cortex or cerebellum (40 pg) to test the specificity of the Sema4F antibody. Pre-absorption of the anti-Sema4F antibody with the peptide (BP) used to create the antibody is sufficient to abolish the presumptive Sema4F band observed at approximately 100 kDa (S4F lanes). (C-D) Full-length versions of Western blots present in Figures 3.2 and 3.5. (C) Results confirm both the absence of Sema4F protein expression in both uninjured (L) and axotomized (R) rubrospinal neurons, 7 days post axotomy. (D) Following a facial nerve resection, and increase in Sema4F protein expression in the axotomized facial nucleus (L). A much lower level of expression is detected in the uninjured facial nucleus (R), while Sema4F immunoreactivity is observed in the adult rat cortex (Ctx). See Sections 3.4.2 and 3.4.5 for details. (E) Serial dilution R T - P C R analysis on Sema4F m R N A expression in the uninjured and axotomized facial nuclei, 7 day following a facial nerve resection. R T - P C R on serially diluted samples of c D N A [(1) 25ng, (2)12.5 ng, (3) 6.25 ng, or (4) 3.25 ng], reveal Sema4F m R N A is upregulated in axotomized facial motoneurons, 7 days after injury. [B/- no c D N A control; C/+ positive Cortex control]. 233 F i g . B.2. A 280 mm 280 _ 131 89 - — — 131 89 - 4 41 — 41 Anti-HA Blot Anti-Sema4F Blot B 200 — 111 — 59 — 30 — BP S4F C 7d RN L R 200— 111 — 59 — Actin — D 7d FN L R Ctx 200-1 111-59 - % Actin Sema4F S12 7d Facial Nucleus axotomized uninjured B C 1 2 3 4 234 B.2. B L A S T S E A R C H : I S H O L I G O N U C L E O T I D E S E Q U E N C E S B.2.1. Sema4F Antisense Oligonucleotide Probe #1 1. gi|9507082|ref|NM_019272.1| R a t t u s n o r v e g i c u s sema domain, i m m u n o g l o b u l i n domain ( I g ) , transmembrane domain (TM) and s h o r t c y t o p l a s m i c domain, (semaphorin)4F (Sema4f), mRNA Length=4008 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 57 5 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 541 2. gi|74226220|dbj|AK143196.1| Mus musculus 0 day neonate e y e b a l l cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:E130305L08 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=4059 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 624 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 590 3. gi|74199421|dbj|AK158292.1| Mus musculus a d u l t i n n e r e a r cDNA, RIKEN f u l l -l e n g t h e n r i c h e d l i b r a r y , clone:F930101F23 product:sema domain, immunoglobulin domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=3549 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 547 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 513 4. gi|26091917|dbj|AK047067.1| Mus musculus 10 days neonate c e r e b e l l u m cDNA RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:B930015M09 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=2855 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) S t r a n d = P l u s / M i n u s Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 ' l I I I II I I I I I I II I I I I I I I I I I I I I I I I I I I I I S b j c t 597 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 563 5. gi|26084949|dbj|AK035993.1| Mus musculus 16 days neonate c e r e b e l l u m cDNA RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:9630025H20 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=2719 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) S t r a n d = P l u s / M i n u s Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 I II I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I S b j c t 613 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 57 9 6. gi|31543684|ref|NM_011350.2| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain (Sema4f), mRNA Length=4002 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) S t r a n d = P l u s / M i n u s Query • 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I S b j c t 581 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 547 236 7. gi|4104674|gb|AF038652.1| Mus musculus semaphorin M mRNA, p a r t i a l eds Length=2354 Score = 69.9 b i t s (35), E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 35 I I I I 'I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 34 0 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 306 8. gi|63101609|gb|BC094567.1| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, mRNA (cDNA c l o n e MGC:106526 IMAGE:6834138), complete eds Length=4062 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s 35 574 Query 1 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 608 CTTTCAACCTGCTGGAAACTGGACACATCAATAAC 237 B.2.2. Sema4F Antisense Oligonucleotide Probe #2 1. gi |9507082|ref |NM_019272.1| R a t t u s n o r v e g i c u s sema domain, i m m u n o g l o b u l i n domain ( I g ) , transmembrane domain (TM) and s h o r t c y t o p l a s m i c domain, (semaphorin)4F (Sema4f), mRNA Length=4008 Score = 69.9 b i t s ( 3 5 ) , E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s Query 1 ACGACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1403 ACGACTCTGAGATAGGCTGTATCTGTAGTGACCAG 1369 2. gi |4519426|dbj |AB002563.1| R a t t u s n o r v e g i c u s mRNA f o r semaphorin W, complete eds Length=4008 Score = 69.9 b i t s (35), E x p e c t = 7 e - l l I d e n t i t i e s = 35/35 (100%), Gaps = 0/35 (0%) St r a n d = P l u s / M i n u s Query 1 ACGACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I S b j c t 1403 ACGACTCTGAGATAGGCTGTATCTGTAGTGACCAG 1369 3. gi134785263|gb|BC057048.1| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , 'TM domain, and s h o r t c y t o p l a s m i c domain, mRNA (cDNA c l o n e IMAGE:6832579), p a r t i a l eds Length=3943 Score = 56.0 b i t s .(28), E x p e c t = l e - 0 6 I d e n t i t i e s = 31/32 ( 9 6 % ) , Gaps = 0/32 (0%) St r a n d = P l u s / M i n u s Query 4 ACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1314 ACTCTGAGATAGGCTGTATCCGTAGTGACCAG 1283 238 4. gi|3980430|gb|AC003061.1| Mouse Chromosome 6 BAC C l o n e b 2 4 5 c l 2 , complete sequence Length=162691 Score = 56.0 b i t s ( 2 8 ) , E x p e c t = l e - 0 6 I d e n t i t i e s = 31/32 ( 9 6 % ) , Gaps = 0/32 (0%) S t r a n d = P l u s / M i n u s Query 4 ACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 128913 ACTCTGAGATAGGCTGTATCCGTAGTGACCAG 128882 5. gi|74226220|dbj|AK143196.1| Mus musculus 0 day neonate e y e b a l l cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:E130305L08 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=4059 Score = 56.0 b i t s (28), E x p e c t = l e - 0 6 I d e n t i t i e s = 31/32 ( 9 6 % ) , Gaps = 0/32 (0%) S t r a n d = P l u s / M i n u s Query 4 ACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I II I I I I I I I I I I I I I II I I I I S b j c t 1450 ACTCTGAGATAGGCTGTATCCGTAGTGACCAG 1419 6. gi|74199421|dbj|AK158292.1| Mus musculus a d u l t i n n e r e a r cDNA, RIKEN f u l l -l e n g t h e n r i c h e d l i b r a r y , clone:F930101F23 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=3549 Score = 56.0 b i t s ( 2 8 ) , E x p e c t = l e - 0 6 I d e n t i t i e s = 31/32 ( 9 6 % ) , Gaps = 0/32 (0%) S t r a n d = P l u s / M i n u s Query 4 ACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I S b j c t 1372 ACTCTGAGATAGGCTGTATCCGTAGTGACCAG 1341 239 7. gi|21627994|emb|AL732309.9| Mouse DNA sequence from c l o n e RP23-132N23 on chromosome 2, complete sequence Length=221859 ' * Score = 42.1 b i t s ( 2 1 ) , E x p e c t = 0.029 I d e n t i t i e s = 21/21 (100%), Gaps = 0/21 (0%) St r a n d = P l u s / M i n u s Query 28 CCTCCTGTCTTTGTCTTTCTG 48 I I I I I I I I I I I I I I I I I I I I I S b j c t 52715 CCTCCTGTCTTTGTCTTTCTG 52695 8. gi |26091917|dbj|AK047067.1| Mus musculus 10 days neonate c e r e b e l l u m cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:B930015M09 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , TM domain, and s h o r t c y t o p l a s m i c domain, f u l l i n s e r t sequence Length=2855 Score = 56.0 b i t s ( 2 8 ) , E x p e c t = l e - 0 6 I d e n t i t i e s = 31/32 ( 9 6 % ) , Gaps = 0/32 (0%) St r a n d = P l u s / M i n u s Query 4 ACTCTGAGATAGGCTGTATCTGTAGTGACCAG 35 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1422 ACTCTGAGATAGGCTGTATCCGTAGTGACCAG 1391 240 B.2.3. Sema3C Antisense Oligonucleotide Probe #1 1. gi|46048360|ref|NM_013657.4| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C (Sema3c), mRNA Length=4970 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1260 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 1211 2. gi|25189048|gb|AC122936.3| Mus musculus BAC c l o n e RP23-20H6 from 5, complete sequence Length=234064 Score = 99.6 b i t s (50), E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I • S b j c t 14 4333 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 1442 84 3. gi|44890686|gb|BC066852.1| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , - (semaphorin) 3C, mRNA (cDNA c l o n e MGC:76673 IMAGE:30093230), complete eds Length=4970 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 12 60 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 1211 241 4. gi|854331|emb|X85994.1| M.musculus mRNA f o r semaphorin E Length=2477 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) S t r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1212 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 1163 5. gi|74150054|dbj|AK140348.1| Mus musculus 4 days neonate male a d i p o s e cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:B430214B22 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin)3C, f u l l i n s e r t sequence Length=4344 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) S t r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t . 17 96 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 17 4 7 6. gi|26329808|dbj|AK034239.1| Mus musculus a d u l t male d i e n c e p h a l o n cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:9330166N11 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin)3C, f u l l i n s e r t sequence Length=3884 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) S t r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1319 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 127 0 242 7. gi|109472980|ref|XM_001064163.1| PREDICTED: R a t t u s n o r v e g i c u s sema domain, i m m u n o g l o b u l i n domain I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C ( p r e d i c t e d ) ( S e m a 3 c _ p r e d i c t e d ) , mRNA Length=3408 Score = 91.7 b i t s (46), E x p e c t = 3e-17 I d e n t i t i e s = 49/50 ( 9 8 % ) , Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1331 CTTCCTTGTGGGCAAAAGGCCCATTGAATACAGTCTGTATATCAGATAAA 12 82 8. gi|109471622|ref|XM_231381.4| PREDICTED: R a t t u s n o r v e g i c u s sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C ( p r e d i c t e d ) ( S e m a 3 c _ p r e d i c t e d ) , mRNA Length=3393 Score = 91.7 b i t s ( 4 6 ) , E x p e c t = 3e-17 I d e n t i t i e s = 49/50 ( 9 8 % ) , Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 CTTCCTTGTGGGCAAAGGGCCCATTGAATACAGTCTGTATATCAGATAAA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1316 CTTCCTTGTGGGCAAAAGGCCCATTGAATACAGTCTGTATATCAGATAAA 1267 243 B.2.4. Sema3C Antisense Oligonucleotide Probe #2 1. gi|46048360|ref|NM_013657.4| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C (Sema3c), mRNA Length=4970 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 2051 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 2002 2. gi|44890686|gb|BC066852.1| Mus musculus sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C, mRNA (cDNA c l o n e MGC:76673 IMAGE:30093230), complete eds Length=4970 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 2051 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 2002 3. gi|74150054|dbj|AK140348.1| Mus musculus 4 days neonate male a d i p o s e cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:B430214B22 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin)3C, f u l l i n s e r t sequence Length=4344 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I'l I I I S b j c t 2587 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 2538 244 4. gi|26097245|dbj|AK077231.1| Mus musculus 11 days p r e g n a n t a d u l t female o v a r y and u t e r u s cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:5031405M08 p r o d u c t r s e m a domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C, f u l l i n s e r t sequence Length=4076 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) S t r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 1174 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 1125 5. gi|26329808|dbj|AK034239.1| Mus musculus a d u l t male d i e n c e p h a l o n cDNA, RIKEN f u l l - l e n g t h e n r i c h e d l i b r a r y , clone:9330166N11 product:sema domain, i m m u n o g l o b u l i n domain ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C, f u l l i n s e r t sequence Length=3884 Score = 99.6 b i t s ( 5 0 ) , E x p e c t = l e - 1 9 I d e n t i t i e s = 50/50 (100%), Gaps = 0/50 (0%) S t r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 2110 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 2061 6. gi|854331|emb1X85994.1| M.musculus mRNA f o r semaphorin E Length=2477 Score = 91.7 b i t s ( 4 6 ) , E x p e c t = 3e-17 I d e n t i t i e s = 49/50 ( 9 8 % ) , Gaps = 0/50 (0%) S t r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 2003 AATGCGCTCGTTCAGTTTACCCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 1954 245 7. gi|109472980|ref|XM_001064163.1| PREDICTED: R a t t u s n o r v e g i c u s sema domain, i m m u n o g l o b u l i n d o m a i n ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C ( p r e d i c t e d ) ( S e m a 3 c _ p r e d i c t e d ) , mRNA Length=3408 Score = 83.8 b i t s ( 4 2 ) , E x p e c t = 8e-15 I d e n t i t i e s = 48/50 ( 9 6 % ) , Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 2122 AATGCGTTCATTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 2073 8. gi|109471622|ref|XM_231381.4| PREDICTED: R a t t u s n o r v e g i c u s sema domain, i m m u n o g l o b u l i n d o m a i n ( I g ) , s h o r t b a s i c domain, s e c r e t e d , (semaphorin) 3C ( p r e d i c t e d ) ( S e m a 3 c _ p r e d i c t e d ) , mRNA Length=3393 Score = 83.8 b i t s ( 4 2 ) , E x p e c t = 8e-15 I d e n t i t i e s = 48/50 ( 9 6 % ) , Gaps = 0/50 (0%) St r a n d = P l u s / M i n u s Query 1 AATGCGCTCGTTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 50 I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S b j c t 2107 AATGCGTTCATTCAGTTTAACCTCCTTCCTCCTGTCTTTGTCTTTCTGCA 2058 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0093003/manifest

Comment

Related Items