Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analysis of developmentally programmed changes in hematopoietic stem cells Bowie, Michelle Beatrice 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-199435.pdf [ 8.19MB ]
Metadata
JSON: 831-1.0092942.json
JSON-LD: 831-1.0092942-ld.json
RDF/XML (Pretty): 831-1.0092942-rdf.xml
RDF/JSON: 831-1.0092942-rdf.json
Turtle: 831-1.0092942-turtle.txt
N-Triples: 831-1.0092942-rdf-ntriples.txt
Original Record: 831-1.0092942-source.json
Full Text
831-1.0092942-fulltext.txt
Citation
831-1.0092942.ris

Full Text

A N A L Y S I S OF D E V E L O P M E N T A L L Y P R O G R A M M E D C H A N G E S IN HEMATOPOIETIC STEM CELLS by MICHELLE BEATRICE BOWIE B . S c , Queen's University, 2001  A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T OF THE REQUIREMENTS FOR THE D E G R E E OF D O C T O R OF PHILOSOPHY  in  T H E F A C U L T Y OF G R A D U A T E STUDIES  (Genetics)  T H E U N I V E R S I T Y OF BRISTISH C O L U M B I A July 2006  © Michelle Beatrice Bowie, 2006  ABSTRACT  To characterize the extent and timing o f changes i n hematopoietic stem cell ( H S C ) properties during ontogeny, experimental strategies were developed to allow quantitative assessment o f their proliferative activity, self-renewal potential and differentiation behaviour i n vivo. A l l H S C s in the fetal liver were found to be cycling and following their transplantation into irradiated adult hosts, they rapidly generated daughter H S C s and produced large numbers o f granulopoietic progeny. In contrast, adult H S C s , which are predominantly quiescent, regenerated new H S C s more slowly and produced fewer granulopoietic progeny. They also showed a coordinated change i n expression o f several transcription factors that regulate H S C functions. Interestingly, H S C s retained a fetal phenotype with respect to all these features until 3 weeks after birth and then, within one week, acquired an adult H S C phenotype. Additional studies o f serially transplanted H S C s indicated that this switch also took place within the same time frame i n adult mice reconstituted with fetal or 3-week post-natal H S C s , suggesting the switch is intrinsically programmed. To further investigate the mechanism o f this switch, an in vitro model suitable for monitoring the survival, proliferation and self-renewal activity o f highly purified fetal liver H S C s was developed. Using this model, I found that the cell cycle transit time o f optimally stimulated fetal H S C s and adult H S C s is the same, but with lower Steel factor requirements for fetal H S C s . This suggested that the fetal-to-adult switch involves a decreased response to c-Kit activation. Interestingly, the self-renewal behaviour o f fetal H S C s expressing a defective form o f c-Kit mimicked adult +/+ H S C s , both in vitro and i n vivo, but showed no difference i n cycling activity, suggesting that Steel factor responsiveness specifically regulates H S C self-renewal responsiveness i n vivo. Future studies o f changes in gene expression during  ii  the switch, including analyses o f c-Kit-defective H S C s as well as normal H S C s , may help to link the observed changes i n Steel factor responsiveness to the molecular mechanisms that control changes i n H S C self-renewal and cycling control during ontogeny.  iii  TABLE OF CONTENTS Abstract  ii  Table o f Contents  iv  List o f Tables  vii  List o f Figures  viii  List o f Abbreviations  x  Acknowledgements  xii  CHAPTER 1 INTRODUCTION  1  1.1  General overview of hematopoiesis  1  1.1.1  Definition and identification o f H S C s  1  1.1.2  The hierarchical organization o f hematopoiesis  3  1.2  1.3  Development o f hematopoiesis  6  1.2.1  Generation o f hematopoietic cells in the mouse embryo  6  1.2.2  Generation of hematopoietic cells from murine E S cells i n vitro  9  Differences between fetal and adult hematopoiesis  10  1.3.1  Mature cells  10  1.3.2  HSCs  11  1.3.2.1 Kinetic properties  11  1.3.2.2 Phenotypic properties  12  1.3.2.3 H o m i n g and mobilization  13  1.3.2.4 Self-renewal  16  1.3.2.5 Growth factor responsiveness  18  iv  1.4  Genes that regulate HSCs  19  1.4.1  Genes critical to both fetal and adult HSCs  19  1.4.2  Genes more critical to fetal than adult HSCs  20  1.4.3  1.5  1.4.2.1 Rural  20  1.4.2.2 Notch  22  1.4.2.3 Sci  23  Genes more critical to adult than fetal HSCs  25  1.4.3.1 Bmi-1  25  1.4.3.2 c-Kit  27  1.4.3.3 Gfi-1  28  1.4.3.4 Tie2  29  Experimental objectives  30  CHAPTER 2  HEMATOPOIETIC STEM CELLS PROLIFERATE UNTIL AFTER BIRTH AND SHOW A REVERSIBLE PHASE-SPECIFIC ENGRAFTMENT DEFECT  80  CHAPTER 3  FETAL-TO-ADULT CHANGE IN HEMATOPOIETIC STEM CELL SELF-RENEWAL PROPERTIES OCCURS AS AN ABRUPT AND PROGRAMMED POSTNATAL EVENT  120  CHAPTER 4 STEEL F A C T O R P L A Y S A DISTINCT R O L E IN THE S E L F - R E N E W A L PROPERTIES OF HEMATOPOIETIC S T E M C E L L S F R O M DIFFERENT STAGES OF D E V E L O P M E N T 153  CHAPTER 5 C O N C L U S I O N A N D R E C O M M E N D A T I O N FOR FURTHER W O R K  vi  172  LIST OF TABLES  Tables in Chapter 1 Table 1.1: Phenotypic comparison between fetal liver and adult bone marrow H S C s  36  Tables in Chapter 2 Table 2.1: Limiting dilution data for C R U frequency determinations for E l 8.5 fetal liver and bone marrow cells  106  Table 2.2: Limiting dilution data for C R U frequency determinations for lin" bone marrow cells from 3 and 4 week-old mice  107  Tables in Chapter 3 Table 3.1: C R U frequency determinations for purified (1/10) single fetal liver HSC-derived clones under two conditions (pooled data from 2 experiments)  vii  143  LIST OF FIGURES  Figures i n C h a p t e r 1 Figure 1.1: Hematopoiesis  33  Figure 1.2: Competitive repopulating unit ( C R U ) assay  34  Figure 1.3: Limiting dilution analysis ( L D A )  35  Figures i n C h a p t e r 2 Figure 2.1: A l l fetal H S C s are sensitive to cell cycle-specific drugs  99  Figure 2.2: F A C S profiles o f the distribution o f different lin" populations i n Go, G i and S/G /M  ...100  2  Figure 2.3: The cycling activity o f C R U s is down-regulated between 3 and 4 weeks o f age 101 Figure 2.4: Hoechst/Pyronin-sorted H S C s display an absolute but transient S/G2/M engraftment defect  102  Figure 2.5: The engraftment defect o f H S C s in S / G / M is corrected by treatment o f the host, 2  but not the cells, with SDF-1G2  103  Figure 2.6: Donor-derived repopulation of SDF-lG2-treated mice  104  Figure 2.7: Gene expression analysis of the G i and S / G / M subsets of highly purified lin" 2  S c a l C D 4 3 M a c l H S C s from fetal liver and 3-week bone marrow +  +  +  viii  105  Figures i n C h a p t e r 3 Figure 3.1: Fetal liver H S C s self-renew to a greater extent than bone marrow H S C s i n a transplant  137  Figure 3.2: H S C s switch from fetal liver-like self-renewal to adult bone marrow-like selfrenewal abruptly and intrinsically  138  Figure 3.3: Fetal liver-like and adult bone marrow-like H S C s generate distinct P B lineage contribution patterns when transplanted into irradiated recipients  139  Figure 3.4: Purification and culture o f fetal liver H S C s reveals a similar cell cycle length as adult bone marrow H S C s  140  Figure 3.5: N e w H S C developmental switch discovered  141  Figure 3.6: Gene expression analysis o f purified fetal liver, 3-wk, 4-wk and 10-wk-old bone marrow H S C s  142  Figures i n C h a p t e r 4 Figure 4.1: Comparison o f the effects o f different growth factor cocktails on fetal liver C R U self-maintenance i n vitro  163  Figure 4.2: Steel factor dose response curves for the i n vitro self-renewal of+/+ and W41 C R U s from fetal liver and adult bone marrow  164  Figure 4.3: Comparison o f c-Kit expression on fetal liver and adult bone marrow H S C s 165 Figure 4.4: C e l l cycle analysis o f W41 fetal liver H S C s  166  Figure 4.5: W41 fetal liver H S C s self-renew at the adult bone marrow H S C self-renewal rate 167  ix  LIST O F A B B R E V I A T I O N S  H - T d r - tritiated-thymidine  C M P - common myeloid progenitor  5 - F U - 5-fluorouracil  C R U - competitive repopulating unit  a4int - a4-integrin  C S F - colony stimulating factor  A G M - aorta-gonado-mesonephros  D N A - deoxyribonucleic acid  A M L - acute myeloid leukemia  E - embryonic day  A n g - Angiopoietin  E B - embryoid bodies  A P C - allophycocyanin  ES - embryonic stem  A T F - activating transcription factor  F A C S - fluorescence activated cell sorter  A T M - ataxia-telangiectasia mutated  F I T C - fluorescein isothiocyanate  BIT - bovine serum albumin, insulin and  F L - fetal liver  transferrin  G-gap  B F U - E - burst forming unit -erythroid  Gapdh - glyceraldehyde-3-phosphate  B M - bone marrow  dehydrogenase  B m i - B cell-specific Moloney murine  G E M M - granulocytes, erythroblasts,  leukemia virus integration site  megakaryocytes and macrophages  C A F C - cobblestone area forming cell  Gfi - growth factor independent  C b f - core-binding factor  G M P - granulocytes and monocytes  C D K - cyclin-dependent kinase  progenitors  C L P - common lymphoid progenitor  H A - hyaluronic acid  C F C - colony-forming cell  H S C - hematopoietic stem cell  C F U - S - colony-forming unit-spleen  HF/2 - Hanks balanced salt solution  C g y - centigray  containing 2% F C S  3  H S C - hematopoietic stem cell  Py - pyronin Y  Hst - Hoechst 33342  Rho - Rhodamine 123  IGF-2 - insulin-like growth factor 2  R N A - ribonucleic acid  I L - interleukin  R T K - receptor tyrosine kinase  L I F - leukemia inhibitory factor  Runx - runt-related transcription factor  L T C - I C - long-term culture-initiating cell  S - synthesis  M - mitosis  S C F - stem cell factor  M E M - minimum essential medium  SDF-1 - stromal cell-derived factor-1  M P D - myeloproliferative disorders  SF - Steel factor  m R N A - messenger ribonucleic acid  S F M - serum-free medium  N O D / S C I D - nonobese diabetic/severe  SP - side population  combined immunodeficient  S T A T - signal transducer and activator o f  N K - natural killer  transcription  O P N - osteopontin  T F - transcription factor  P B S - phosphate buffered saline  T P O - thrombopoietin  P E - phycoerythrin  W B C - white blood cell  p.c. - post coitus  W G A - wheat germ agglutinin  P c G - polycomb group PI - propidium iodide P I 3 K - phosphatidylinositol 3'-kinase Pias - protein inhibitor o f activated Stat3 P L C - phospholipase C Pre - polycomb repressive complex P-Sp - paraaortic splanchnopleure  xi  A C K N O W L E D G M E N T S  I would like to acknowledge expert technical assistance from Gayle Thornbury and Lindsey Laycock o f the F l o w Cytometry Facility o f the Terry Fox Laboratory and the staff o f the A n i m a l Resource Centre o f the B C Cancer Research Centre. Thank you to Debra Wytrykush for her secretarial assistance in the preparation o f this thesis and the derived manuscripts.  I was the recipient o f a Stem Cell Network Studentship and a Studentship funded by the Canadian Institute o f Health Research and the Michael Smith Foundation for Health Research. This work was also supported by grants from the National Cancer Institute o f Canada (with funds from the Terry Fox Foundation), the Stem Cell Network and P01 HL-55435 from the NHLBI/NIH.  Thank you to m y committee members, Robert K a y , Pamela Hoodless and Hugh Brock for their assistance with this Thesis.  Particularly, thank you to my supervisor, Connie Eaves.  xii  CHAPTER 1 INTRODUCTION  1.1  General overview of hematopoiesis  Hematopoiesis refers to the process of blood cell production, which occurs throughout life and in the mouse involves the regulated output every day of millions of cells of many different types. These include neutrophils, eosinophils, basophils/mast cells, monocytes/macrophages, erythrocytes, megakaryocytes, platelets, B-lineage cells, T-lineage cells and natural killer (NK) cells for long periods of time (see Figure 1.1). The production of these cells involves the execution of a complex series of molecular changes within more primitive hematopoietic precursors. In addition, these changes have to be co-ordinated with mechanisms that regulate cell proliferation and survival to ensure that thefinalnumbers of new blood cells produced meet physiological demands both during and after normal growth and in response to injury. Understanding the process of hematopoiesis thus requires a description of the complex cellular and molecular mechanisms that allow hematopoietic cells to differentiate into different blood cell types, the regulation of the changes that occur, as well as the elucidation of how these mechanisms interface with signalsfromthe environment.  1.1.1  Definition and identification of HSCs  Blood cell production is sustained throughout life by the proliferative activity of a small population of pluripotent cells with long-term self-renewal potential, referred to as hematopoietic stem cells (HSCs). Initial evidence for the existence in adult hematopoietic tissue of cells with these two properties; namely, pluripotency and self-renewal ability (i.e. the ability to divide without restriction or activation of this pluripotentiality) was provided by  1  morphological studies of the cells present in the bone marrow of patients with myeloproliferative disorders (MPD). These revealed that, although only a single type of mature blood cell was elevated in the circulation, precursors of the other lineages were also often found at high levels in the bone marrow which led to the suggestion that these disorders all originate in a common pluripotent precursor (1). Thefirstdirect support for this concept came from experiments that showed individual transplant-derived spleen colonies containing multiple lineages of myeloid cells carried the same unique cytogenetic marker, inferring the derivation of eachfroma single pluripotent cell, the so-called colony-forming unit-spleen (CFU-S) (2). Shortly thereafter, clonal marking of longer term transplants in mice provided definitive evidence of a single adult bone marrow cell with lympho-myeloid differentiation potential that could be serially transplanted (3-6). With the discovery in the 1980s that most CFU-S have, at best, limited self-renewal activity (7-9) and that most CFU-S can be separated prospectively from cells with long-term repopulating activity (7), quantitative transplant-based assays were devised with greater specificity for murine HSCs defined by their long-term lympho-myeloid repopulating activity (10). These assays now typically make use of congenic donor-recipient pairs of mice, that express distinct CD45 epitopes referred to as Ly5.1 and Ly5.2 to enable definitive identification of donor-derived cells among the lymphoid and myeloid cells regenerated in individual irradiated recipients. To allow thefrequencyof HSCs to be determined in a given "test" cell suspension, the test cells are injected in varying numbers until a limiting dose is achieved - i.e., a transplant dose that causes only afractionof the mice injected to show continued test-cell derived contributions to their lymphoid and myeloid blood cells long term, i.e., for at least 4 months (10). To enable the "negative" mice to survive, all recipients must be independently protected by a minimal dose of HSCs. These can either be co-transplanted  2  from a donor o f the same genotype as the recipient or can be provided endogenously; for example, using sublethally irradiated recipients with genetically compromised H S C s (11). H S C s detected using this methodology are called competitive repopulating units (CRUs) (Figure 1.2) and their frequencies are derived by limiting dilution analysis o f the proportion o f negative recipients obtained in a given set o f experiments (Figure 1.3) (10). C R U s thus defined constitute a very small percentage (~.01%) o f the cells in the bone marrow of normal adult mice (12; 13). The validity o f this approach is based on the assumption that the donor-derived lymphoid and myeloid progeny originated from a single common pluripotent donor cell that was likely to have undergone extensive self-renewal, as indicated by early retroviral marking experiments demonstrating the generation o f clonal populations o f multilineage cells containing the same common inserts (3-5). Additional evidence that C R U constitute a biologically discrete population have come from more recent experiments showing that C R U s can be purified to near homogeneity using several phenotype-based cell strategies. These have allowed both their pluripotent and self-renewal properties to be demonstrated by tracking the progeny produced in recipients o f single cell transplants (14-19). It has also been possible to use cell separation approaches to demonstrate that C R U can be prospectively separated from transplantable pluripotent cells with less durable repopulating ability (17;20-22).  1.1.2.  The hierarchical organization of hematopoiesis  The process by which H S C eventually give rise to mature blood cells proceeds as an extensive series o f progressive changes spanning multiple cell generations. This is the basis o f the creation o f a developmental hierarchy in which different intermediate cell types can now be distinguished by a variety o f robust, quantitative assays that detect differences in the  3  proliferation and differentiation capabilities o f these cells i n vitro or i n vivo. T w o important features o f these assays is their ability to measure the number (rather than just the activity) o f the input cell type being evaluated and the fact that there is a range o f cell doses over which the output is linearly related to input. Nevertheless they all have the disadvantage that they detect cells retrospectively by virtue o f the number and type o f progeny produced under defined (optimized) conditions and after a specified length o f time. A s a result, they are slow, labour-intensive and are generally less precise than direct detection methods. The long-term culture-initiating cell ( L T C - I C ) assay and the related cobblestone area forming cell ( C A F C ) assay are i n vitro methods that can detect a cell population that overlaps with C R U s (15;23). These exploit the ability o f H S C s and their immediate progeny to be maintained and to proliferate to varying degrees exclusively when cocultured i n contact with stromal feeder layers. The principle o f these assays is to extend the time o f culture to the point that it can be safely assumed that the cells being produced must have derived from H S C s in the original input. This assumption has not been rigorously examined, but correlative studies indicate that the detection o f myeloid colony-forming cell ( C F C ) progenitors (or C A ' s ) beyond 4-5 weeks depends on initiating the cultures with cells that share features with H S C s and that can support their expansion (15;24;25). M a n y types o f more differentiated cells can be characterized by their ability to form colonies o f mature progeny in semi-solid medium containing specific growth factors, hence the term C F C . This type o f methodology can detect pluripotent cells that generate colonies containing granulocytes, erythroblasts, megakaryocytes and macrophages ( C F C - G E M M ) (26;27) as w e l l as different types o f lineage-restricted C F C s . C e l l s that generate only granulocytes and macrophages are termed C F C - G M (28;29) and similar assays and nomenclature exist for cells that generate small or large colonies containing erythroid  4  progeny ( C F C - E and B F U - E , respectively) (30) or megakaryocytes ( C F C - M k and B F U M k , respectively) (31). More recently, the expanded availability o f monoclonal antibodies and improved machines for multi-parameter sorting o f viable cells in a sterile fashion has led to the identification o f surface profile phenotypes that can be used to directly identify cells at different stages o f hematopoietic differentiation i n defined tissues. However, it should be noted that most o f the markers used to establish these profiles do not show fidelity in their expression when the cells are stimulated. The use o f phenotypic markers is desirable because o f its speed and immediacy, but also has greater limitations o f sensitivity. The first differentiation steps that H S C s undergo usually lead to a loss o f either lymphoid or myeloid potential resulting i n the generation o f either a common lymphoid progenitor ( C L P ) (32) or a common myeloid progenitor ( C M P ) (33). C L P s are characterized as L i n ~ I L - 7 R T h y - l ~ S c a - l c - K i t cells i n adult mouse bone marrow and these markers +  lo  l0  identify cells that can produce T , B and N K cells, but not myeloid cells. Conversely, C M P s are F c R y ' ° C D 3 4 cells and can generate megakaryocytes, eryrthrocytes, granulocytes and +  macrophages, but not lymphoid cells. C M P s probably overlap with C F U - S and C F C - G E M M . Later cell types that are restricted to the production o f megakaryocytes and erythrocytes only ( M E P s ; functionally identified as B F U - E ) or to the production o f granulocytes and monocytes progenitors ( G M P s ; functionally as C F U - G M s ) can also be prospectively isolated by cell surface phenotype from both the bone marrow and the fetal liver (34). However, while this described hematopoietic hierarchy is applicable to the majority, it is not necessarily always the case (35). Examples o f such rare cell types were first seen when single cells were plated in culture; the colonies generated contained diverse combinations o f cell types not predicted from a rigid hierarchy (36). There are now a number o f cells that do not follow the standard  5  hematopoietic hierarchy briefly outlined i n Figure 1.1, such as lympho-myeloid cells that lack erytho-megakaryocytic potential (37) or a mature cell type with the potential to generate both B cells and macrophages (38).  1.2  Development of hematopoiesis  1.2.1.  Generation of hematopoietic cells in the mouse embryo  The first cells with transplantable H S C activity appear in the mouse embryo in the yolk-sac (39;40) and aorta-gonado-mesonephrous ( A G M ) regions (41) on embryonic days (E) 9 and 10 o f gestation, respectively. Since these cells have direct access to the circulation, it is thought that they are the origin o f the H S C s that appear i n the fetal liver on E l 1. The frequency o f H S C s ( C R U s ) reaches a peak i n the fetal liver on E l 4.5 with maintenance o f their numbers until day 16 (42) after which these numbers steadily decline, possibly due to an exodus o f H S C to the spleen and bone marrow (43). This redistribution o f H S C s into the spleen and bone marrow occurs over a period o f several days. H S C s are first detected in the fetal spleen o n E13 (44), which then increases over the next 2-3 days (E15.5-16.5), and on E17.5, H S C s are first detected in the fetal bone marrow (45). After birth, H S C numbers continue to decline i n the liver and spleen but increase in the bone marrow where H S C s then persist for the lifetime o f the mouse. This shift in the tissue location o f hematopoiesis appears to be an evolutionarily conserved process and, while the tissues involved differ, it can be seen in organisms as primitive as drosophila and as complex as humans (46). The murine yolk-sac is a splanchnopleure, which means that it is composed o f 2 layers o f tissue, extraembryonic mesodermal cells and visceral endoderm cells. This structure develops between E 7 and E7.5 (47;48) and is the first site o f blood cell production. The inner layer appears to be the origin o f primitive macrophages and erythroblasts and endothelial cells  6  can be seen to arise from the outer layer (49). The simultaneous appearance o f erythroblasts and endothelial cells that share expression o f F l k - 1 , C D 3 4 , Tie-2, G A T A - 2 , L M O - 2 and S C L has suggested that these 2 lineages arise from a common hemangioblast precursor within the developing yolk-sac (50). The E 8 para-aortic splanchnopleure (P-Sp)/aorta-gonad-mesonephros ( A G M ) region is another important and independent site o f hematopoietic cell genesis in mammalian embryos. In mice, this is the first intra-embryonic site i n which C F U - S can be detected between from E l 0 until E l l . After this time, the fetal liver takes over as the major hematopoietic tissue (41). It appears that the A G M is not conducive to the generation o f H S C s that can be detected by transplantation assays into adult recipients and only after cells from the A G M have further developed in the fetal liver can transplantable H S C s be detected (44). The fetal liver begins to form on E 9 and, at that time, the only hematopoietic cells it contains appear to be committed myeloid precursors (51-53). However, by E l 1, the fetal liver contains both C F U - S and C R U s (13;54;55). These cells are thought to be derived from colonizing cells that originated in the yolk-sac and/or A G M regions rather than representing the progeny o f mesenchymal precursors that are also present i n the fetal liver (56). The fetal liver remains the major site o f hematopoiesis from E12 until birth (57). The development o f bone marrow begins in the fetus with the formation o f a cellular matrix in the bone cavities, followed by their population by an influx o f H S C s , most likely emanating from the fetal liver and released into the circulation, starting around E l 7 . Bones that are hematopoietically active are characterized by a particular type o f cellular matrix, produced by mesenchymal precursors that migrate into the marrow cavity to generate the stroma o f the bone marrow and induce the migration o f H S C into these sites (58). This model is supported by the finding that primitive hematopoietic cells ( C F U - S ) that are genetically  7  unable to produce stromal derived factor-1 (SDF-1) or its receptor ( C X C R 4 ) fail to colonize the bone marrow o f fetal mice in spite o f apparently normal hematopoiesis in the fetal liver. However, it is important to note that most o f these data are limited to studies o f C F U - S (45) and comprehensive quantitative data on the frequency and rate o f expansion o f H S C s i n the fetal bone marrow have not been reported. Recently, the murine placenta has also been found to contain H S C activity, with a peak o f activity between E 1 2 and E l 4 , followed by a rapid drop i n stem cell frequency up to E l 5.5, as the liver expands (59). The large number o f H S C s found in the placenta raises the question as to whether this is a site o f independent stem cell generation or if, similar to the fetal liver, it is a transient niche supporting H S C expansion. A significant feature o f the development o f the hematopoietic system in the embryo is the apparent delayed appearance o f cells with the properties o f H S C s . In fact, the first recognizable hematopoietic cells that arise directly from mesenchymal derivatives are terminally differentiated cells which do not appear to be derived from cells with extensive pluripotent or proliferative ability. This stands in marked contrast to the conventionally recognized hierarchy o f hematopoietic cell types present in the adult (described above). These findings have led to the concept that different molecular programs may exist to regulate the generation o f hematopoietic cells at different stages o f ontogeny (60). It could therefore be informative to characterize more fully the differences that exist between fetal and adult H S C s i n order to elucidate the mechanisms by which one evolves from the other. Interestingly, a recent study provided evidence suggesting that all H S C s in the adult are derived from cells detectable as H S C s in the embryo by using the stem cell leukemia ( S C L ) locus to direct the expression o f a tamoxifen inducible Cre recombinase in hematopoietic and endothelial cells (61). They showed that the progeny o f S C L expressing  8  cells in the E l 0-11 embryo contribute to the bulk o f H S C s in both the fetal liver and adult bone marrow. However, as not all o f the cells in the fetus and adult were marked, some de novo generation o f H S C s in these tissues can not be ruled out (62).  1.2.2.  Generation of hematopoietic cells from murine ES cells in vitro  Embryonic stem (ES) cells are derived from the inner cell mass o f the embryonic blastocysts and are capable o f differentiating into all three primary germ layers o f the embryo (endoderm, mesoderm and ectoderm) and therefore to all cell types found in an adult (63). These cells propagate extensively and can be maintained indefinitely ex vivo in an undifferentiated state in the presence o f L I F (64). These cells can be genetically modified and reintroduced into blastocysts to allow the identification o f critical roles played by genes in all tissue types. T o assess the role o f a gene at a later stage o f development or in a particular tissue specifically, conditional knock-outs can be generated, where the gene is essentially shut-down under the control o f a tissue-specific promoter or upon the addition o f an exogenous signal at a chosen time during development (65;66). The generation o f the hematopoietic lineage from E S cells shows similar kinetics in vitro to that seen during normal embryonic development and proceeds through similar intermediates, from hemangioblasts to the long-term and short-term repopulating hematopoietic cells and to committed progenitors o f the myeloid and lymphoid lineages, which has allowed E S cells to be used to derive various hematopoietic lineages (67-73).  9  1.3  Differences between fetal and adult hematopoiesis  1.3.1  Mature cells  M a n y features o f terminally differentiating myeloid cells remain the same throughout ontogeny and, as noted above, appear to be produced by cells undergoing a similar sequence o f changes at the molecular level. Nevertheless, some differences are known, the most notable examples being the types o f haemoglobins produced by erythroblasts i n fetal and adult mice (74) and the speed with which these cells transit the cell cycle (75;76). Human fetal progenitors also demonstrate a faster growth rate than their adult bone marrow counterparts, as demonstrated by the speed and size o f colonies they generate i n vitro (76). In addition, cell tracking studies have shown directly that human fetal liver-derived C D 3 4 cells divide i n vitro +  with a shorter cell cycle time than do those derived from cord blood (77). In the case o f lymphoid cells, differences i n the programs o f maturing T-cells, B-cells and N K cells have also been described. These result i n differences in the T-cell receptor gene rearrangements exhibited by fetal and adult T-cells (78), differences in the surface marker profiles o f fetal and adult B-lineage cells (79) and differences in the receptors expressed by fetal and adult N K cells. In addition, there appears to be marked changes in the growth factor requirements o f fetal and adult lymphoid cells (80). For example, interleukin-7 is critical to Tand B-cell development, as demonstrated by mice with a homozygous null mutation o f the I L 7 gene (81). However, these same mice have detectable B lymphopoiesis in the fetus that is not seen in the adult, indicating the operation o f compensatory mechanisms that can support fetal B-cell differentiation that are either absent or not effective in the adult (82).  10  1.3.2  HSCs  A number o f differences in the way more primitive hematopoietic cells may differentiate are also well documented. Summarized below are the differences i n kinetic, phenotypic, homing, self-renewal and growth factor responsiveness properties o f fetal and adult H S C s .  1.3.2.1  Kinetic properties  Transplants o f murine fetal liver cells ( E l 4-18) repopulate the bone marrow and spleen o f irradiated recipients faster than do transplants o f adult bone marrow cells (54) with a 16-hour vs. a 25-hour doubling time o f the cell populations produced i n the bone marrow i n the first 3 weeks post-transplant (75). These classical experiments clearly point to differences in parameters that regulate the output o f cells from hematopoietic cells with repopulating activity but do not discriminate between differences in H S C self-renewal potential, cell cycle transit times and or possible differences i n rates o f cell loss due to cell death. Early studies also showed that primitive cells in the fetal liver and adult bone marrow differ in their proliferative activities, as indicated by the proportion that these cells are in cycle. For example, comparison o f the cycling status o f C F U - S from fetal liver and adult bone marrow revealed that those from fetal liver are mostly in cycle, whereas those from adult bone marrow are mostly quiescent (54). Subsequent studies confirmed that these differences extend to the H S C compartment with >80% o f adult bone marrow H S C s being resistant to in vivo treatment with 5-fluorouracil (5-FU), a cytotoxic agent, and 40% o f the cells in a subset o f fetal liver cells that contains the H S C s being found to be in the S/G2/M phase o f the cell cycle (83;84).' A number o f genes alter the cycling characteristics o f H S C , including p21, p27, p i 8, cyclinD (85-90) and Gfi-1 (91) . Various genes appear to regulate the proliferation o f fetal  11  liver and adult bone marrow H S C differently. A s discussed below in detail, these include genes for Steel factor (SF), c-Kit (92-94) and Tie-2 (95) that control H S C interactions with their microenvironment, as well as a number o f intrinsic signaling molecules and transcription factors that appear to be involved in regulating H S C function (see Section 1.4).  1.3.2.2  Phenotypic properties  Fetal and adult H S C s have also been found to display a different spectrum o f markers on their cell surface and to exhibit differences i n their dye efflux and adhesion properties (Table 1.1). Notable examples include a poor ability o f fetal liver H S C s to adhere to fibronectin and a positive expression o f C l q R p (96), a C-type lectin-like type I transmembrane protein recognized by the monoclonal antibody A A 4 . 1 (97). Fetal liver H S C s also express readily detectable levels o f C D 1 l b ( M a c l ) , an integrin component that is commonly found on mature macrophages from all developmental stages, but not on adult bone marrow H S C s (43;98). The demonstration that Mac-1 is expressed on fetal liver H S C s was one o f the first indications o f the lack o f differentiation stage-specificity o f many phenotypic markers. This highlights their inherent unreliability as surrogate direct indicators o f H S C s and, in particular, the problems caused by the indiscriminate use o f standard lineage-negative antibody cocktails to obtain enriched populations o f H S C s from manipulated cell suspensions (96;99;100). Rebel et al. (1996) avoided this, and carefully characterized the phenotypic similarities between fetal and adult stem cells as being the expression o f Sca-1, c-Kit, M H C class I and C D 4 3 antigens, as well as high binding to wheat germ agglutinin ( W G A + ) and the lack o f expression o f B220, Gr-1, L y - 1 , Thy-1, C D 7 1 and Fall-3. A s differences, they found that fetal liver H S C s stain positively with monoclonal antibodies against A A 4 . 1 , Mac-1 and C D 4 5 R B and fetal liver also retain Rhodamine 123 (are R h o l 2 3 ) whereas adult stem cells do +  12  not (98). In mice, C D 3 4 and C D 3 8 are also developmental^ regulated H S C cell surface markers. Murine fetal liver H S C s are C D 3 4 C D 3 8 " whereas adult bone marrow H S C s are +  C D 3 4 " C D 3 8 (101-104). The receptor tyrosine kinase Tie-2 may also be differentially +  expressed by H S C s during ontogeny, with reports suggesting that murine fetal liver H S C s express Tie-2 but adult H S C s do not (105-107). However, the Tie-2 antibody is not yet a reliable material and may prove to label both adult and fetal H S C s . H S C s from the fetal liver also do not efflux Hoechst 33342 and are thus not detectable within the gate used to identify adult H S C s as side population (SP) cells using fluorescent activated cell sorting ( F A C S ) (108). W i t h a few exceptions (e.g. c - K i t (92)), most developmentally regulated cell surface markers expressed on H S C s change in adult H S C s as a function o f an alteration in their proliferative activity and/or cytokine activation. Therefore, it seems likely that a similar explanation might apply to the phenotypic differences exhibited by fetal liver H S C s . For example, 5 - F U treatment o f mice leading to activation o f their H S C s in vivo (109) and/or direct activation o f adult H S C s i n vitro with cytokines causes the CD34", C D 3 8 , Mac-1", SP, +  Rho'° phenotype o f quiescent H S C s to acquire a C D 3 4 , CD38", M a c - 1 , non-SP, R h o +  +  +  phenotype, identical to that characteristic o f fetal liver H S C (102;104;108;110-112). A l s o noteworthy is the lack o f consistency in the phenotypic profiles o f murine and human H S C s . For example, human fetal liver H S C s are C D 3 4 (113), sharing the murine C D 3 4 expression +  pattern o f fetal liver H S C s , but bearing the SP phenotype o f adult bone marrow H S C s .  1.3.2.3  Homing and mobilization  Another important property o f H S C s is their motility and ability to migrate in response to specific chemoattractants. H S C s migrate from one site to another throughout life; i.e., from the fetal liver to the fetal spleen and bone marrow in the embryo and later a small percentage  13  of H S C s are constantly found in the peripheral circulation (114). This property underlies the ability o f H S C s from both mice and humans to be transplanted intravenously. The mechanisms that attract and retain H S C s in the bone marrow, as well as those that allow their release, are still not fully understood although a number o f molecular ligand-receptor pairs controlling H S C adhesion and migration have been identified. VLA-4  ((X4P1 integrin)  expressed on H S C s and its receptor V C A M - 1 on bone marrow  stromal cells are critical mediators o f adhesion and mobilization, as shown by the fact that treatment o f mice with antibodies to V L A - 4 and V C A M - 1 results in H S C mobilization. This appears to involve signaling through the c-Kit pathway, with both c-Kit and V L A - 4 being downregulated on H S C s when they are mobilized (115-125). Most recently, the 014 integrin component o f V L A - 4 has been shown to be required for the competitive function and selfrenewal o f H S C s in vivo due to their reduced retention within the niche in its absence (126). C - K i t is also thought to play a direct role i n H S C adhesion to the endosteal bone, but not necessarily i n their migration (127). C D 4 4 is another adhesion molecule expressed by H S C s (128). C D 4 4 has many ligands one o f which is hyaluronic acid ( H A ) , the major component o f the E C M i n the bone marrow (129) and E-selectin, which is expressed by endothelial cells (130). Some reports have suggested that antibodies to C D 4 4 could affect the homing o f H S C s (131 ;132), yet CD44"  /_  mice are healthy and fertile with normal numbers o f in vivo-homing H S C s (133). Nevertheless, in vitro, the SDF-1 -mediated induction o f human progenitor cells to migrate on H A was associated with their assumption o f a polarized morphology and the formation o f pseudopodia at the leading edges o f which C D 4 4 was concentrated (132). Interestingly, high levels o f C D 4 4 expression on tumour cells mediates their metastatic spread (134).  14  Matrix-bound cytokines, such as Steel Factor (SF) and Flt3-ligand (135-137) may also serve as adhesion molecules for their respective receptors (c-Kit, the receptor for SF, and F l t 3, the receptor for Flt3-ligand), both o f which are expressed on the surface o f H S C s . Certainly membrane-bound S F expressed on stromal cells can cause the adhesion o f c-Kit-expressing H S C s to them (138) and thus play a role in H S C retention in the bone marrow, that when reversed leads to their mobilization (139). SDF-1 may be a major regulator o f H S C homing and is produced in large amounts by bone marrow stromal cells (140). Conversely, administration o f antagonists o f SDF-1 into normal adult mice (or humans) causes the H S C s i n the bone marrow to detach from their niche and enter the circulation - a process referred to as mobilization (141). SDF-1 is a member o f the chemokine family o f molecules but is unique i n its ability to bind to a single receptor, C X C R 4 , a member o f the G-coupled receptor family. C X C R 4 is also the only chemokine receptor found to be expressed on H S C s thus conferring its response specifity to SDF-1 (142). However, C X C R 4 is not restricted in its expression to primitive hematopoietic cells and is highly expressed on B-lineage cells and many other cell types including numerous kinds o f metastatic tumor cells (143-145). In vitro, the chemoattractant properties o f SDF-1 on H S C s (and derivative progenitor types) have been well documented using transwell assays (140). Activation o f C X C R 4 leads to the activation o f phosphoinositol-3 kinase which i n turn activates P K C - z e t a , whose downstream targets include Pyk-2 and E R K 1 / 2 (146). Interestingly, the levels o f C X C R 4 expression on the cells it chemoattracts can vary widely and this parameter is not predictive o f either their in vitro chemoattractant responsiveness (147-149) or their in vivo homing activity (150). M i c e in which either the SDF-1 or C X C R 4 genes have been inactivated die at a late stage o f embryogenesis with gross bone marrow failure i n spite o f apparently normal hematopoiesis in the fetal liver, likely due  15  to an impaired ability o f the fetal liver H S C to migrate into or be retained within in the bone marrow (147; 151-154). SDF-1 elicits multiple responses in CXCR4-expressing cells including the induction o f a chemoattractant migratory response by H S C s (142;155), inhibition o f H S C cycling (156), and H S C mobilization (155;157). Additional mediators o f H S C chemotaxis are likely to be found, such as the recent discovery o f the P2Y-like receptor, GPR105,(158). Migration o f H S C s across the endothelium occurs preferentially i n the Go/Gi phase o f the cell cycle and fetal H S C s are more efficient than adult mobilized P B H S C s at this process (159). Similarly, the mobilized H S C s found in the circulation are predominantly Go/Gi cells (160; 161) even when the method o f mobilization is shown to initiate their prior entry into division within the bone marrow (162). Interestingly, adult H S C s stimulated to proliferate i n vitro or in vivo display an engraftment defect during their period o f transit through S/G2/M (84; 163; 164), although this defect could not be demonstrated for human fetal liver H S C s (165). Some differences in the expression o f adhesion and homing molecules were found when G1/G0 vs S/G2/M cells enriched in their content o f H S C s were compared, such as a higher expression o f V L A - 4 and a lower expression o f C D 4 4 in the G\/GQ cells (163). Adhesive interactions between H S C s and their microenvironment also play a role in the regulation o f H S C survival and proliferation as well as in their homing and mobilization.  1.3.2.4  Self-renewal  A s noted above, after the first appearance o f H S C on the 9 and 10 days o f embryogenesis, it th  th  is thought that the later expansion o f this compartment occurs by the execution o f symmetric self-renewal divisions; i.e., cell cycles in which competency for multi-lineage differentiation is maintained but not activated in both daughter cells. Self-renewal divisions are the hallmark  16  attribute o f all stem cells and much effort has been devoted to elucidating this process with a view of devising ways to manipulate it. Controlled enhancement o f H S C self-renewal ex vivo offers the potential both to develop strategies for obtaining amplified H S C populations and their mature progeny for a variety o f therapeutic applications and to create models for investigating mechanisms o f leukemogenesis (166; 167). Fetal liver H S C s have garnered interest as a population with seemingly greater intrinsic self-renewal potential than bone marrow H S C s , based on the sustained larger P B cell outputs by fetal liver H S C s as compared to bone marrow H S C s (99; 168; 169). In addition, fetal liver-derived cells reconstitute more daughter C R U s after a given period (168; 169) and can typically be serially transplanted more times than adult bone marrow cells. However, it appears that H S C numbers are not fully regenerated i n irradiated transplanted mice, even though mature blood cell output is fully restored (170;171) and when the transplant dose is corrected for the actual content o f C R U , huge expansions o f adult bone marrow C R U can be documented (172). A s yet, similar experiments have not been performed with H S C s regenerated in primary recipients o f fetal liver-derived H S C s . Thus, it has been difficult to discern the separate contributions o f increased self-renewal activity and greater survival or shorter cell cycle times o f fetal liver H S C s on the greater regenerative activity they have been found to display in experiments that do not measure these responses independently. Notably, only a single paper has been published describing the kinetics o f normal H S C expansion in mice transplanted with adult bone marrow cells (172) and similar data does not exist for fetal liver H S C s . A s a result, it is not known when recipients o f primary transplants should be assessed for secondary C R U content in order to provide a quantitative index o f the self-renewal activity o f the cells transplanted.  17  1.3.2.5  Growth factor responsiveness  There is now definitive evidence that the self-renewal o f H S C s can be modulated by exposure to different extrinsic factors, both in vivo and in vitro. In vivo evidence is seen following virtually every H S C transplant, where the number o f H S C s initially injected can be shown to increase at least 10-20 fold (169; 172), compared to their maintenance at a constant level i n normal adult mice. The same shifts seen in H S C self-renewal also occur when normal (+/+) H S C s are transplanted into ff-deficient recipients (defective i n normal c - K i t signaling) and are stimulated to expand their numbers (94; 173). Significant efforts have been made to identify factors that influence H S C self-renewal in vitro, although these have been focused primarily on H S C s from young adults (174; 175) or from samples o f human cord blood (176) and relatively little is known about self-renewal control in fetal liver H S C s .  The difficulty in finding one or more growth factors that w i l l  promote an expansion o f H S C is not due to an inability to identify factors that can optimize the entry o f H S C s into division (77), but rather because o f the relative inability o f any growth factors identified to date to effectively sustain the stem cell potential o f the stimulated H S C . Interestingly, certain G F s have been shown to stimulate H S C expansion but only over a narrow range (i.e., IL-6), while others (e.g. Steel factor, SF) attain their maximal effects only at high doses (>300ng/mL) (175). In the case o f fetal liver H S C s , even less is known about factors that may promote H S C self-renewal but some additional candidates have been identified (e.g., Fibroblast growth factor-1 (177), thrombopoietin (174), W n t proteins (178), Sonic hedgehog (179) and T A T - H o x B 4 (180).  18  1.4  Genes that regulate HSCs  1.4.1  Genes critical to both fetal and adult HSCs  Studies o f the generation and activity after transplantation o f H S C s from mice in which specific genes have been modified or completely inactivated, or are overexpressed, have provided a significant body o f information about specific intrinsically expressed receptors, signaling intermediates and transcription factors that appear to be important in controlling H S C proliferation and self-renewal. Many transcription factors regulate the self-renewal, proliferation, and/or the early differentiation o f H S C s . Those shown to play a critical role (as demonstrated by inactivation studies) include: Activating transcription factor ( A T F ) 4, required for high-level proliferation i n the fetal liver (181), Core-binding factor p, required for fetal liver H S C emergence and normal maturation (182; 183), c - M y b and p300, required for self-renewal and differentiation, respectively (184-186), c - M y c , required for differentiation (187), Gata-2, for normal proliferation, especially i n adult bone marrow H S C s after cytotoxic treatment (188;189), Ikaros, required for normal numbers of H S C (190-192), Lmo-2, required for emergence o f H S C s (193; 194), m e i s l , required for the proliferation/self-renewal o f H S C s (195; 196), M E F , required for normal maintenance o f adult H S C quiescence (197), mel-18, required to negatively regulate proliferation, by binding to cyclinD2 (198-200), mixed-lineage leukemia, required for emergence o f fetal liver H S C s (201), and those shown to play an important role (as demonstrated by overexpression studies): H o x genes (202-204), and rae-28 (205), both resulting i n enhanced self-renewal. There are also non-transcription factors that play critical roles in stem cells, such as signaling intermediates S T A T 3 , required for selfrenewal (206;207), S T A T 5 , required for normal competitive repopulating ability (208-212), and the cyclin-dependent kinase inhibitors described above p21, p27, p i 8, required to maintain quiescence, progenitor proliferation and to inhibit self-renewal, respectively (85-  19  87;90); receptors, such as the retinoic acid receptor y, that mediates cell cycle arrest (213) a n d the receptor for thrombopoietin, c-mpl, required for normal numbers o f H S C s (214); as are secreted factors such as transforming growth factor-|32, a positive regulator o f competitive repopulation in adult H S C s (215) and wnt, a positive regulator o f proliferation and expansion (167;178;216;217). Through studies o f chimeras and using conditional gene knock-out strategies, it has also become possible to determine whether identified candidates act in a cell autonomous fashion and whether they may differentially affect fetal and adult H S C s , particularly where marked deleterious effects on fetal cells are obtained. In the last decade, with the advent o f methods to obtain highly purified populations o f murine H S C s from both fetal and adult sources, it has also been possible to determine whether candidate regulators are differentially expressed i n these populations. It is interesting to note that many o f the genes found to have important effects on H S C were first identified because o f their involvement in fusion proteins created by translocations associated with different types o f acute myeloid leukemia ( A M L ) i n humans (218). This is not surprising, given that such diseases are thought to originate after sufficient accumulation o f genetic deregulation i n H S C s .  1.4.2  Genes more critical to fetal than adult HSCs  1.4.2.1  Runxl  Runxl (runt-related transcription factor 1) is the murine homolog o f a human gene originally called AML-1 to reflect its discovery on chromosome 21 from the cloning o f a common breakpoint in human A M L cells that carry a 8;21 translocation (219). Runxl encodes the D N A - b i n d i n g subunit o f a member o f the core-binding factor (Cbf) family o f transcription  20  factor complexes and has primarily activating functions i n myeloid cells (220-222). It has, therefore, also been called Cbfa2. Target genes identified include CyclinD3, IL-3, GM-CSF and RAG1 and TCRa (223-227). A critical role for Runxl i n early normal hematopoietic development was first revealed by the generation o f two Runxl-deficient mouse lines, both o f which died mid-gestation as a result o f bleeding in the central nervous system and soft tissues, with complete loss o f fetal liver hematopoiesis (228;229). A l l hematopoietic cell lineages were found to be affected by the loss o f Runxl, with the exception o f primitive erythropoiesis in the yolk-sac, which was minimally affected. Similarly, in vitro, Runxl'  A  E S cells could generate normal numbers of  primitive erythroid precursors but were impaired in their ability to generate blast colonyforming cells (cells that have properties o f hemangioblasts) and failed to produce definitive hematopoietic C F C s (230). In the fetal liver o f Runxl heterozygotes, hematopoietic progenitor numbers were found to be reduced by comparison to wild-type controls, suggesting that Runxl has a dose effect on mechanisms that regulate the production o f primitive hematopoietic cells in the fetus. Nevertheless, in adult haploinsufficient animals, no phenotype was detected, implying the operation o f different control mechanisms in the adult or an ability o f other genes to substitute for, or compensate for, a lack o f R u n x l (231). A n inducible gene-targeting strategy for Runxl was then pursued in order to assess directly the effect o f an absence o f R u n x l in adult cells that had been generated from cells that produced R u n x l at normal levels (232-234). A complete absence o f Runxl in the adult did not impair continued production o f hematopoietic cells suggesting that it is dispensible for the maintenance o f adult H S C activity although enhanced granulopoiesis and defective megakaryocytpoiesis and early lymphopoiesis was noted. Competitive repopulation assays confirmed that Runxl'  A  adult bone marrow cells contain elevated short-term myeloid  21  repopulating activity (<2 months) but are similar to +/+ bone marrow cells i n their ability to repopulate irradiated mice with mature neutrophils, monocytes and megakaryocytes for more prolonged periods. Using a "knock-in" marker strategy, R u n x l was shown to be expressed i n mesenchymal and endothelial cells at all sites i n the yolk-sac and embryo proper where the first definitive hematopoietic cells first appear, as well as i n all o f the H S C s that emerge during this process. However, when expression o f R u n x l , itself, was deleted, a complete block was seen in the generation o f hematopoietic cells at these locations (235;236). Taken together, these findings indicate an essential role o f R u n x l i n the generation o f fetal H S C s from hemangioblasts in the embryo but not for their later self-renewal. However, it is interesting to note that forced expression o f RUNX1-ETO (a fusion protein shown to act as a potent dominant negative inhibitor of R u n x l during development (228;229) i n C D 3 4 human +  cord blood cells enhanced the long term retention o f lympho-myeloid differentiation potential as well as an ability to repopulate irradiated N O D / S C I D mice (237). Thus, although Runxl may be dispensible for the maintenance and initial differentiation o f adult H S C s , these cells appear to remain sensitive to pathways that can be modulated by changes i n R u n x l activity.  1.4.2.2  Notch  Notch genes were discovered almost 80 years ago i n Drosophila and found to encode type 1 transmembrane glycoprotein receptors that are cleaved after activation by binding their specific ligands, either Jaggedl or 2, or Delta (238). Cleavage results in the translocation o f intracellular N o t c h to the nucleus where it can act as a transcriptional activator, for example for the c-myc promoter (239) . O f the 4 mammalian notch homologs, Notch-1 has been most extensively studied and its ability to inhibit H S C differentiation (promote H S C expansion)  22  documented (240-242).  Homozygous inactivation o f Notch-] causes embryonic lethality b y  day 9.5 (243;244) and at this time H S C s could not be detected when they were assayed for their ability to repopulate conditioned newborn mice (245). Further studies showed that i n vitro, Notch- Y ' E S cells proliferated normally and were not impaired in their ability to 1  generate either E B s or EB-derived definitive erythroid and myeloid C F C s . Following injection into wild-type blastocysts, they contributed initially to the C F C and C F U - S populations produced up to E l 0.5 o f gestation. However, after that time, these cells rapidly disappeared and were not replaced even though a high degree o f chimerism persisted in other organs (246). In contrast, elimination o f either Jaggedl or Notch 1 or both i n adult H S C s using an inducible Cre-loxP-mediated inactivation strategy revealed no effects on the ability o f the affected H S C to exhibit their self-renewal or multipotentiality either postransplant or endogenously after treatment o f the mice with 5 - F U (247). These findings strongly suggest that Notch 1 plays a differential role in regulating the ability o f fetal and adult H S C s to execute self-renewal divisions when stimulated to proliferate.  1.4.2.3  Sci  The stem cell leukemia (Sci) gene encodes a basic helix-loop-helix family member transcription factor, that can either activate or repress transcription, depending on the composition o f the multicomponent complexes it forms and plays an important role at multiple stages o f hematopoietic cell differentiation, as reviewed i n (248). The Sci protein would thus be expected to be able to play different roles through interactions with different partners present in varying levels in specific cell types (248). Some o f these are known to be critical for hematopoiesis, such as E 2 A , and the bridge protein L M O - 2 , which also binds G A T A - 1  23  (see below). This type o f complex can activate the c-Kit promoter, through functional interaction with S p l (249). Although studies o f cells from S c l " heterozgotes with a l a c Z / w +/  reporter gene knocked into one o f the Sci genes have now shown that Sci is expressed i n a number o f tissues, it has also been possible to establish that, within the hematopoietic system, Sci is expressed at the highest levels in the most primitive cells, including H S C s (61;250;251). The Sci gene was first targeted for disruption i n 1995 by 2 groups, who both found that this resulted i n embryonic lethality by E9.5, with complete loss o f blood formation in the yolksac (252;253). 5 c f E S cells are also unable to contribute to hematopoiesis i n mouse A  chimeras, demonstrating the cell-autonomous requirement for Sci in the generation o f both primitive and definitive hematopoiesis in the fetus (254;255). In vitro, Sc^' E S cells were able to generate f l k - l blast-CFC but the colonies then produced contained only vascular smooth +  muscle cells and no detectable endothelial or hematopoietic cells, suggesting that S c i may be required for the first steps in the transition from a mesodermal precursor to a hemangioblast (250;256). Recent m R N A knockdown studies i n zebrafish suggest that Sci may also play important roles i n the generation o f endothelial and hematopoietic cells i n this organism but not until after the hemangioblast stage when each o f these lineages has become distinct (257). To assess the role o f Sci in adult hematopoiesis, conditional knockout mice have been generated and studied. In one such study, analysis o f bone marrow cells from targeted adult mice revealed that Sci, like Runxl and Notch-1, is dispensable for continued H S C function. However, in the case o f the ScT H S C s , the ability to generate differentiated myeloid and A  lymphoid progeny was preserved, but the generation o f mature erythroid and megakaryocyte precursors was compromised (258). Similar results were reported by the second group who  24  found that Sci was required for the short-term repopulation o f irradiated recipients but did not appear necessary for H S C self-renewal (259;260). Interestingly, transduction of H S C s with vectors encoding either a wild-type Sci cD N A or a dominant-negative (dn) form also had downstream effects on hematopoiesis without altering the long-term repopulating capacity o f the transduced H S C s . The specific effects were the promotion o f short-term myeloid repopulation by the SW-transduced cells and promotion o f lymphoid contribution by the dnSW-transduced cells (261).  1.4.3  Genes more critical to adult than fetal HSCs  Genes critical to adult bone marrow H S C s but not fetal liver H S C s may be considered much easier to study as knock-outs o f these might be anticipated to allow the organism to initially develop normally with the consequences o f the mutant phenotype occurring later after birth. However, it is not clear when this point would be expected, since very little is known about the timing or relevance o f extrinsic vesus intrinsic factors in regulating changes in the H S C compartment between fetal life and adulthood. Nevertheless, some gross differences have become apparent from single generation transplants suggesting that genes more critical to adult than fetal hematopoiesis can be identified.  1.4.3.1  Bmi-1  B cell-specific Moloney murine leukemia virus integration site-1 (Bmi-1) is a gene encoding a member o f the Polycomb group (PcG) o f transcription factors. T w o general types o f multimeric P c G complexes are recognized. Both are involved in silencing genes through directing the modification o f chromatin structure, one i n the initiation o f this process (called polycomb repressive complex 2 or Prc2) and the other in the stable maintenance of gene  25  repression (called polycomb repressive complex 1 or P r c l ) , and as a result, both are considered strong candidates for playing important roles in orchestrating the epigenetic changes in gene regulation that must occur during the self-renewal and initiation o f lineage restrictive events that occur in stem cells (262;263). Bmi-1 is a member o f the P r c l complex and other members o f the P r c l complex are Mel-18, Rae28, R i n g l and M 3 3 . Bmi-1 is expressed at elevated levels i n highly purified H S C populations isolated from both fetal liver and adult bone marrow and acts to repress the C D K inhibitor p l 6  I n k 4 a  and p i 9 ^ ( 2 6 3 ; 2 6 4 ) .  A s predicted for a gene that differentially targets the self-renewal o f adult H S C s , homozygous deletion o f Bmi-1 allows the affected mice to survive until about 1-2 months after birth at which point they die with hypocellular marrows. Assessment o f the cellular composition o f the fetal liver o f Bmi' ' mice showed these have a normal cellularity with 1  unaltered numbers o f c - K i t S c a l T h y l . l'° lin" cells, a population that is normally enriched i n +  +  the fetal liver H S C s . However, when Bmi-1' ' fetal liver cells were transplanted into adult 1  irradiated mice, no B-lineage cells were produced and overall multi-lineage repopulating activity was reduced initially and declined irreversibly to undetectable levels within 8 weeks (265) unless Bmi-1 expression was restored, in which case H S C at near normal frequencies could be demonstrated (264;265). This demonstrates that the initial generation and expansion o f fetal liver H S C s is not impaired by a lack o f Bmi-1, but later, this transcription factor becomes increasingly critical for maintenance o f the H S C compartment both when the cells are allowed to develop endogenously or when transplanted directly into an adult irradiated environment. Consistent with this interpretation was the finding that cells with the c - K i t  +  S c a l Thy 1.1 lin" H S C phenotype were still detectable i n the bone marrow o f 4-5 week-old +  10  Bmi-1" " mice but at 10-fold reduced numbers and these were even more defective i n their 7  ability to reconstitute primary recipients (264;265). Interestingly, the greater biological effect  26  o f a Bmi-1 deficiency i n adult bone marrow cells was mirrored by similar differences in the extent o f activation obtained on Bmi-1 target genes including p l 6  t a k 4 a  and p i 9 ^ (265),  although later experiments showed that these did not translate into detectable effects on proliferative activity or H S C apoptosis (199). The latter investigation also showed that forced over-expression o f Bmi-1 could enhance the frequency o f symmetrical divisions by primitive pluripotent hematopoietic cell; stimulated by cytokines to proliferate i n vitro, corroborating the hypothesis that Bmi-1 acts maintain the competency o f H S C s (199).  1.4.3.2  c-Kit  C-Kit is a proto-oncogene that encodes a type 3 cell-surface tyrosine kinase receptor also referred to C D 1 1 7 (266). The ligand that binds to and activates c-Kit has been variably designated as c-Kit-ligand, Stem cell factor (SCF) and Steel factor (SF) because it is expressed on H S C s and is the product o f the Steel gene. Both c-Kit and its ligand are produced as transmembrane proteins that can be variably cleaved proteolytically to yield an additional soluble form with full binding activity (267;268). SF binding induces homodimerization and tyrosine phosphorylation o f the receptor, forming docking sites for S H 2 domain-containing signaling intermediates (269). These include phosphatidylinositol 3'-kinase (PI3 K ) and phospholipase Oy-1 (270), the Src family kinases Src, L y n , F y n (271), the GTPase activating protein G A P (272), proteins o f the p 2 1 R a s - M A P K pathway (269) and S T A T 1 , 3 and 5 (273275). Additional signaling molecules that couple to c-Kit, including V a v (276), Jak2 (277), Dok (278), Tec (279) and the tyrosine phosphatase SHP-1 (246). C - K i t is expressed on all H S C s and hematopoietic progenitors throughout embryonic and adult life and signaling downstream o f the c-Kit receptor is required for many aspects o f normal hematopoiesis.  27  The W (encoding c-Kit) and Steel (encoding Steel factor) loci were first identified from early genetic studies o f spontaneously arising mutant white spotted mice that shared the same profile o f pleiotropic phenotypes affecting coat colour, sterility and red blood cell production (280) . These phenotypes are caused by abnormalities i n the generation o f melanocytes, germ cells and erythroid cells. Severe W mutations conferred a cell-intrinsic defect on primitive hematopoietic cells normally detected as C F U - S , whereas severe Steel mutations conferred a defect that was not transplantable and restricted to the environment o f hematopoietic tissues (281) . T h e W / W 4 ,  4 1  mouse has a single nucleotide substitution i n the coding region o f the c-  K i t gene that results i n partial impairment o f the tyrosine kinase activity o f the SF receptor. The fetal liver o f these mice contains a normal number o f transplantable H S C s but their longterm competitive activity is slightly reduced (94). Moreover, i f they are simply allowed to expand without being transplanted, the numbers attained in the bone marrow by early adulthood is ~10-fold lower than that o f wild-type mice and the repopulating activity per W /W 4 1  4 1  H S C is also impaired (93). Similarly, the fetal liver o f Sl/Sl mice, which do not  express a functional S F protein, have been found to contain - 4 0 % of the normal number o f cells with a S c a l Thy 1.1 lin" phenotype on E l 3 and these then increased at the same rate as +  10  their counterparts in wild-type embryos until E l 5 when these embryos all die from anemia (92).  1.4.3.3  Gfi-1  The growth factor independent-1 (Gfi-1) gene encodes a zinc-finger transcription factor with repressor activity and was identified as a common site o f Moloney murine leukemia virus integration i n lymphoma cell lines that acquire I L - 2 independence (282). Gfi-1 is expressed i n H S C s and C L P s and granulopoietic progenitors but not i n C M P s or megakaryocyte-erythroid  28  progenitors (283). The Gfi-1 protein interacts with protein inhibitor o f activated Stat3 (Pias) to mediate proliferative responses to cytokines and can enhance Stat3 signaling in primary T cells (284). There have not yet been any reports o f experiments to measure H S C numbers or activity in the fetal liver o f Gfi-1*'" mice, but the fact that young Gfi-1" " mice are not anemic 7  and have sustained myelopoiesis suggests that Gfi-1 is not critical for the initial appearance and early expansion o f H S C s (285). However, adult G f i - 1 ' bone marrow cells showed a 7  greatly reduced ability to repopulate primary irradiated recipients and an almost complete failure to generate cells that w i l l repopulate secondary recipients (91;283). Interestingly this late appearance o f defective H S C self-renewal differed from that elicited by deletion of Bmi-1 where the H S C s conversion to a quiescent population was not altered (199). In contrast, i n the case o f G f i - l " ' " mice, both Hoechst 33342/PyroninY staining of the l i n " S c a l c - K i t population isolated from the bone marrow o f adult G f i - l ' " mice and +/+ +  +  7  controls (164; 165) and B r d U labelling studies (286;287) of these cells tracked over time showed an increased proportion o f the H S C s from the adult Gfi-1''" mice to be proliferating (91;283). In these cells G A T A - 2 was slightly upregulated and the cell cycle inhibitor p21 p 2 1  C i p l A V a f l  was 10-fold down-regulated (91). This is a significant observation since adult  ci i/wan_ P  1.4.3.4.  n u l l  m  i  c  e  h  a  y  e  a  s i m i l a r  H  S  C  d e f £ c t  (  g  5  )  Tie2  Tie2 is a tyrosine kinase receptor expressed on the surface o f endothelial cells and both fetal liver and adult H S C s (105;106;288;289). Tie2 and its ligands, the angiopoietins, have been suggested to play a role i n the recruitment and mobilization of adult H S C s from the bone marrow (290). Initial observations indicated that Tie-2" embryos display reduced /_  hematopoietic differentiation as cultured explants from early stages o f development (from the  29  P-Sp) in Tie2' " embryos did not generate expected numbers of differentiated cells (291). /  Nevertheless, fetal liver hematopoiesis was not significantly affected by inactivation o f the Tie2 gene whereas marked failure o f Tie2" "hematopoiesis was seen i n the bone marrow o f /  adult mice (95). The reason for the adult dependence o f H S C on Tie-2 signaling may be related to the nature o f the niche occupied by H S C s in the adult. H S C s are known to be concentrated at the periphery o f the marrow cavity adjacent to osteoblasts that secrete Angiopoietin-1 (Ang-1), a ligand for Tie-2, that can maintain adult H S C s i n vitro (292) and promotes adult H S C quiescence (293).  1.5.  Experimental objectives  A s reviewed above, strong evidence o f differences in the proliferative status and regenerative potential o f fetal liver and adult bone marrow H S C s has been found, although neither o f these putative differences have been rigorously documented or quantified. Surprisingly, attempts to maintain fetal liver H S C s i n vitro have shown that these H S C s are even more difficult to sustain than adult bone marrow H S C s (294;295) in spite o f the fact that both the proliferative activity and the regenerative ability o f fetal liver H S C s in vivo is thought to be greater. These latter findings suggested that effects o f specific growth factors on the ability o f fetal liver H S C s to maintain their undifferentiated status might be different from the results obtained for adult bone marrow H S C s (175) and predicted by studies of human cord blood and adult bone marrow L T C - I C expansion in vitro (296). Based on this information, I set out to define more precisely how the cycling and selfrenewal activity o f the H S C s present at different stages o f development change over time, to determine h o w these might relate to changes i n other potential indicators o f H S C function (i.e., output o f different types o f differentiated cells), and to examine whether any changes  30  observed were intrinsically or environmentally regulated and to try to determine how they might be regulated at a molecular level. M y overall working hypothesis was that the reported greater in vivo regenerative activity o f transplanted fetal liver H S C s is due to intrinsic differences i n the self-renewal potential o f these cells as compared to their adult counterparts. This required designing experiments that would allow their self-renewal activity to be measured independently o f their cycling activity. Accordingly, I first executed a series o f experiments to quantify the proportion o f functionally defined H S C s that are in Go (quiescent) vs G1/S/G2/M (actively proliferating) using a variety o f existing methodologies that could be directly coupled to assessing C R U frequencies. These methods were then applied to H S C s from different sources and stages o f development o f the mouse starting with E l 4.5 fetal liver and finishing with bone marrow cells from 10 week-old young adult mice. The results o f these experiments are presented i n Chapter 2. I then designed experiments to determine whether the self renewal properties o f fetal liver H S C s are truly different from adult bone marrow H S C s , and, i f so, to identify when they change. The first step was to delineate the precise kinetics o f H S C regeneration i n vivo from a fixed number o f transplanted H S C s . These data were used to define a time when differences in H S C regenerative activity could best be compared and then applied to transplants o f H S C s from the same sources assessed for changes i n their proliferative activity in Chapter 2. To test whether H S C from fetal liver and adult bone marrow can transit the cell cycle at different rates (i.e. have different cell cycle transit times) a method for purifying fetal liver H S C s to near homogeneity was developed and H S C proliferation was then monitored by direct visualization  31  o f these cells in single cell cultures. The results o f these experiments are presented in Chapter 3. A final series o f experiments was undertaken to explore a possible mechanism for the changes in H S C behaviour documented in Chapters 2 and 3. Given the importance o f SFstimulation o f adult H S C s to maximize the self-renewal of adult H S C s in vitro (175) in contrast to an apparent weak effect o f deficient S F signaling on fetal H S C s (92;94) a change i n S F signaling sensitivity might underlie the changes observed i n H S C cycling control and selfrenewal potential. T o test this hypothesis, I first undertook experiments to compare the dependence o f fetal liver and adult H S C s on S F stimulation in vitro and then asked how this dependence might be altered i n H S C s from W ^ / W  4 1  mice that have defective c-Kit signaling  and whether any differences observed might be predictive o f their self-renewal behaviour as assessed using the secondary transplant endpoint developed in Chapter 2. The results o f these experiments are presented in Chapter 4.  32  Lymphoid Stem Cell  T Lymphocyte B Lymphocyte NK Lymphocyte Neutrophils Eosinophils  Stem Cell  Basophils / mast cells Monocyte/ macrophages  Myeloid Stem Cell  Erythrocyte Megakaryocyte/ platelets  Figure 1.1:  Hematopoiesis  A simplified overview of the concept of hematopoiesis that progresses from stem cells to mature blood cells. Subsets of lineages are shown.  33  Multi-lineage Ly5.1 cells  400 cgy  +  ^W*i/W< -Ly5.2 mice 1  i  Ly5.1 cells (graded doses)  Figure 1.2: Competitive repopulating unit ( C R U ) assay. Schematic o f the principle components of a C R U assay: recipients are irradiated and transplanted with graded doses o f congenic cells; 16 weeks must elapse before the presence o f multilineage donor-type cells detected in the peripheral blood o f the recipient can indicate whether a C R U was present in the test cell population or not. A low dose o f irradiation (400 c G y instead o f 900 Cgy) eliminates the need to ensure recipient survival by co-injection o f helper cells with the test population, but does not eliminate the competing endogenous stem cell pool. W41 recipients have compromised H S C s (attenuated c-Kit signaling), and can therefore be used in combination with a low dose o f irradiation.  34  100 log-linear relationship characteristic of a singlehit process  37°>^n^qatjye ^. s  1  10  •  ^  [  •  I  1 frequency of cell of interest within test population  test cell dose (linear scale)  F i g u r e 1.3: Limiting dilution analysis ( L D A ) to determine the frequency o f C R U within a test population. Poisson statistics describe the probability distribution o f random counts and state that the frequency o f negative outcomes (recipients that are not repopulated i n all lineages long-term) is equal to e""^ (where n equals the number o f cells tested, and f equals the frequency o f stem cells (1 in f)). The log linear relationship o f the frequency of negatives = -n/f. so when n=f, the frequency o f negatives =e = 0.37 _1  C R U assay results can thus be plotted based on the above to determine at which test cell dose the proportion o f negative outcomes is equal to 37%.  35  T a b l e 1.1: Phenotypic similarities and differences between fetal liver and adult bone marrow HSCs Adult Bone M a r r o w H S C s  Fetal Liver  B 2 2 0 ' G r l " L y l " T h y - l " CD71" Fall-3" T e r l l 9 " N k l . F CD4" S c a - l c - K i t M H C class I C D 4 3 +  +  ClqRp AA4.1 Macl  +  WGA  +  ClqRp'  +  AA4.1'  +  Macl"  +  CD45RB Tie-2  +  +  CD45RB" Tie-2"  +  Rhodamine-bright  Rhodamine-dull  Hoechst-bright (non-side population)  Hoechst-dull or side population (SP)  CD34  CD34-  +  CD38"  CD38  36  +  REFERENCES  1. D A M E S H E K , W . 1951. Some speculations on the myeloproliferative syndromes. Blood 6:372-375.  2. Barnes,D.W., F O R D , C . E . , G R A Y , S . M . , and Loutit,J.F. 1959. Spontaneous and induced changes i n cell populations i n heavily irradiated mice. In Progress in nuclear energy (series V I ) . J.C.Bugher, CoursagetJ., and Loutit,J.F., editors. Pergamon Press Limited, London. 1-10.  3. D i c k J . E . , M a g l i , M . C , Huszar,D., Phillips,R.A., and Bernstein,A. 1985. Introduction of a selectable gene into primitive stem cells capable o f long-term reconstitution o f the hemopoietic system o f W / W v mice. Cell 42:71-79.  4. Keller,G., P a i g e , C , Gilboa,E., and Wagner,E.F. 1985. Expression o f a foreign gene i n myeloid and lymphoid cells derived from multipotent haematopoietic precursors. Nature 318:149-154.  5. Lemischka,I.R., Raulet,D.H., and Mulligan,R.C. 1986. Developmental potential and dynamic behavior o f hematopoietic stem cells. Cell 45:917-927.  6. W u , A . M . , T i l l , J . E . , Siminovitch,L., and M c C u l l o c h , E . A . 1968. Cytological evidence for a relationship between normal hemotopoietic colony-forming cells and cells o f the lymphoid system. J.Exp.Med. 127:455-464.  7. Jones,R.J., Collector,M.L, BarberJ.P., V a l a , M . S . , F a c k l e r , M J . , M a y , W . S . , Griffin,C.A., Hawkins,A.L., Zehnbauer,B.A., Hilton,J. et al. 1996. Characterization o f  37  mouse lymphohematopoietic stem cells lacking spleen colony-forming activity. Blood 88:487-491.  8. M a g l i , M . C , Iscove,N.N., and Odartchenko,N. 1982. Transient nature o f early haematopoietic spleen colonies. Nature 295:527-529.  9. Ploemacher,R.E. and Brons,R.H. 1989. Separation o f C F U - S from primitive cells responsible for reconstitution o f the bone marrow hemopoietic stem cell compartment following irradiation: evidence for a pre-CFU-S cell. Exp.Hematol. 17:263-266.  10. Szilvassy,S.J., Humphries,R.K., Lansdorp,P.M., E a v e s , A . C , and Eaves,C.J. 1990. Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc.Natl.Acad.Sci.U.S.A  87:8736-8740.  11. Szilvassy,S.J., N i c o l i n i , F . E . , Eaves,C.J., and M i l l e r , C . L . 2001. Quantification o f murine and human hematopoietic stem cells by limiting-dilution analysis i n competitively repopulated hosts. In Hematopoietic stem cell protocols. C.T.Jordan and K l u g , C . A . , editors. Humana Press, Tolowa, N J .  12. Metcalf,D. and M o o r e , M . A . S . 1971. Haemopoietic cells. North-Holland Pub. Co., Amsterdam.  13. Fleischman,R.A., Custer,R.P., and M i n t z , B . 1982. Totipotent hematopoietic stem cells: normal self-renewal and differentiation after transplantation between mouse fetuses. Cell 30:351-359.  38  14. Osawa,M., Hanada,K., Hamada,H., and Nakauchi,H. 1996. Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell. Science 273:242-245.  15.  Uchida,N., Dykstra,B-, Lyons.K.J., Leung,F.Y., and Eaves,C.J. 2003. Different in vivo repopulating activities o f purified hematopoietic stem cells before and after being stimulated to divide i n vitro with the same kinetics. Exp.Hematol. 31:1338-1347.  16.  Matsuzaki,Y., K i n j o , K . , M u l l i g a n . R . C , and Okano,H. 2004. Unexpectedly efficient homing capacity o f purified murine hematopoietic stem cells. Immunity. 20:87-93.  17.  K i e l , M . J . , Y i I m a z , O . H . , Iwashita,T., Y i l m a z , O . H . , Terhorst,C, and Morrison,S.J. 2005. S L A M family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 121:1109-1121.  18.  K i m , L , He,S., Y i l m a z , O . H . , K i e l , M . J . , and Morrison.S.J. 2006. Enhanced purification of fetal liver hematopoietic stem cells using S L A M family receptors. Blood.  19.  Balazs,A.B., Fabian,A.J., Esmon,C.T., and M u l l i g a n , R . C . 2006. Endothelial protein C receptor (CD201) explicitly identifies hematopoietic stem cells i n murine bone marrow. Blood 107:2317-2321.  20.  Jordan,C.T. and Lemischka,I.R. 1990. Clonal and systemic analysis o f long-term hematopoiesis in the mouse. Genes Dev. 4:220-232.  21.  Morrison,S.J. and WeissmanJ.L. 1994. The long-term repopulating subset o f hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity. 1:661-673.  39  22. Wagers,A.J. and WeissmanJ.L. 2006. Differential Expression o f {alpha}2 Integrin Separates Long-Term and Short-Term Reconstituting L i n - / l o T h y l . l l o c - k i t + Sca-1+ Hematopoietic Stem Cells. Stem Cells 24:1087-1094.  23. Breems,D.A., Blokland,E.A., Neben,S., and Ploemacher,R.E. 1994. Frequency analysis o f human primitive haematopoietic stem cell subsets using a cobblestone area forming cell assay. Leukemia 8:1095-1104.  24. van Hennik,P.B., de K o n i n g , A . E . , and Ploemacher,R.E. 1999. Seeding efficiency of primitive human hematopoietic cells i n nonobese diabetic/severe combined immune deficiency mice: implications for stem cell frequency assessment. Blood 94:30553061.  25. F r a s e r , C . C , Szilvassy,S.J., Eaves,C.J., and Humphries.R.K. 1992. Proliferation o f totipotent hematopoietic stem cells i n vitro with retention o f long-term competitive in vivo reconstituting ability. Proc.Natl.Acad.Sci. U.S.A 89:1968-1972.  26. Johnson,G.R. and Metcalf,D. 1977. Pure and mixed erythroid colony formation in vitro stimulated by spleen conditioned medium with no detectable erythropoietin. Proc.Natl.Acad.Sci. U.S.A 74:3879-3882.  27. Humphries.R.K., E a v e s , A . C , and Eaves,C.J. 1981. Self-renewal o f hemopoietic stem cells during mixed colony formation i n vitro. Proc.Natl.Acad.Sci. U.S.A 78:3629-3633.  28. Bradley,T.R. and Metcalf,D. 1966. The growth o f mouse bone marrow cells in vitro. Aust.J.Exp.Biol.Med.Sci.  44:287-299.  40  29.  SennJ.S., M c C u l l o c h , E . A . , and T i l l , J . E . 1967. Comparison o f colony-forming ability of normal and leukaemic human marrow in cell culture. Lancet 2:597-598.  30. Gregory,C.J. and Eaves,A.C. 1977. Human marrow cells capable o f erythropoietic differentiation in vitro: definition o f three erythroid colony responses. Blood 49:855864.  31. Hoffrnan,R. 1989. Regulation o f megakaryocytopoiesis. Blood 74:1196-1212.  32. K o n d o , M . , WeissmanJ.L., and A k a s h i , K . 1997. Identification o f clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91:661-672.  33. Akashi,K., Traver,D., Miyamoto,T., and WeissmanJ.L. 2000. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature 404:193-197.  34. Traver,D., Miyamoto.T., Christensen,J., Iwasaki-Arai,J., A k a s h i , K . , and WeissmanJ.L. 2001. Fetal liver myelopoiesis occurs through distinct, prospectively isolatable progenitor subsets. Blood 98:627-635.  35. O g a w a , M . 1993. Differentiation and proliferation o f hematopoietic stem cells. Blood 81:2844-2853.  36. TakanoJ-L, Ema,H., Sudo,K., and Nakauchi,H. 2004. Asymmetric division and lineage commitment at the level o f hematopoietic stem cells: inference from differentiation in daughter cell and granddaughter cell pairs. J.Exp.Med. 199:295-302.  37. A d o l f s s o n J . , Mansson,R., Buza-Vidas,N., Hultquist,A., Liuba.K., Jensen,C.T., Bryder,D., Yang,L., Borge,O.J., Thoren,L.A. etal. 2005. Identification o f Flt3+  41  lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell 121:295-306.  38. Cumano,A., Paige,C.J., Iscove,N.N., and Brady,G. 1992. Bipotential precursors o f B cells and macrophages in murine fetal liver. Nature 356:612-615.  39.  Y o d e r , M . C , Hiatt,K., Dutt,P., Mukherjee,P., B o d i n e , D . M . , and Orlic.D. 1997. Characterization o f definitive lymphohematopoietic stem cells in the day 9 murine yolk sac. Immunity. 7:335-344.  40. Y o d e r , M . C , Hiatt,K., and Mukherjee,P. 1997. In vivo repopulating hematopoietic stem cells are present i n the murine yolk sac at day 9.0 postcoitus. Proc.Natl.Acad.Sci.  41.  U.S.A 94:6776-6780.  M e d v i n s k y , A . L . , Samoylina,N.L., M u l l e r , A . M . , and Dzierzak,E.A. 1993. A n early preliver intra-embryonic source o f C F U - S in the developing mouse. Nature 364:64-66.  42. E m a , H . and Nakauchi,H. 2000. Expansion o f hematopoietic stem cells in the developing liver o f a mouse embryo. Blood 95:2284-2288 (Abstr.)  43. Morrison,S.J., Hemmati,H.D., W a n d y c z , A . M . , and WeissmanJ.L. 1995. The purification and characterization o f fetal liver hematopoietic stem cells. Proc.Natl.Acad.Sci.  U.S.A 92:10302-10306.  44. G o d i n J . , Garcia-Porrero,J.A., Dieterlen-Lievre,F., and Cumano,A. 1999. Stem cell emergence and hemopoietic activity are incompatible i n mouse intraembryonic sites. J.Exp.Med.  190:43-52.  42  45. ChristensenJ.L., Wright,D.E., Wagers,A.J., and WeissmanJ.L. 2004. Circulation and chemotaxis o f fetal hematopoietic stem cells. PLoS.Biol. 2:E75.  46. Evans,C.J., Hartenstein,V., and Banerjee,U. 2003. Thicker than blood: conserved mechanisms i n Drosophila and vertebrate hematopoiesis. Dev.Cell 5:673-690.  47. Jollie,W.P. 1990. Development, morphology, and function o f the yolk-sac placenta o f laboratory rodents. Teratology 41:361-381.  48. Russell,E.S. and Bernstein,S.E. 1966. Blood and blood formation. In Biology o f the Laboratory Mouse. E.L.Green, editor. M c G r a w - H i l l , N e w Y o r k . 351-372.  49. Haar,J.L. and Ackerman,G.A. 1971. A phase and electron microscopic study o f vasculogenesis and erythropoiesis in the yolk sac o f the mouse. The Anatomical Record 170:437-455.  50. Keller,G., Lacaud,G., and Robertson,S. 1999. Development o f the hematopoietic system in the mouse. Exp.Hematol. 27:777-787.  51. M o o r e , M . A . and Metcalf,D. 1970. Ontogeny o f the haemopoietic system: yolk sac origin o f in vivo and i n vitro colony forming cells in the developing mouse embryo. Br. J.Haematol. 18:279-296.  52. Johnson,G.R. and Jones,R.O. 1973. Differentiation o f the mammalian hepatic primordium i n vitro. I. Morphogenesis and the onset o f haematopoiesis. J.Embryol.Exp.Morphol.  30:83-96.  43  53. Houssaint,E. 1981. Differentiation o f the mouse hepatic primordium. II. Extrinsic origin o f the haemopoietic cell line. Cell Differ. 10:243-252.  54. M i c k l e m , H . S . , Ford,C.E., Evans,E.P., Ogden,D.A., and Papworth,D.S. 1972. Competitive in vivo proliferation o f foetal and adult haematopoietic cells in lethally irradiated mice. J.CellPhysiol  79:293-298.  55. M u l l e r , A . M . , Medvinsky,A., Strouboulis,J., Grosveld,F., and Dzierzak,E. 1994. Development o f hematopoietic stem cell activity in the mouse embryo. Immunity. 1:291-301.  56. Johnson,G.R. and M o o r e , M . A . S . 1975. Role o f stem cell migration i n initiation o f mouse foetal liver haemopoiesis. Nature 258:726-728.  57. Y o d e r , M . C . 2004. Generation o f H S C s in the embryo and assays to detect them. Oncogene 23:7161-7163.  58. Fliedner,T.M. and Calvo,W. 1978. Hematopoietic Stem-Cell Seeding o f a Cellular Matrix: A Principle o f Initiation and Regression o f Hematopoiesis. Cold Spring Harbor!51-113.  59. G e k a s , C , Dieterlen-Lievre,F., Orkin,S.H., and M i k k o l a , H . K . 2005. The Placenta Is a Niche for Hematopoietic Stem Cells. Dev.Cell 8:365-375.  60. Dzierzak.E. and Medvinsky,A. 1995. Mouse embryonic hematopoiesis. Trends Genet. 11:359-366.  44  61.  Gothert,J.R., Gustin,S.E., H a l l , M . A . , Green,A.R., Gottgens,B., Izon,D.J., and Begley,C.G. 2004. In vivo fate tracing studies using the S C L stem cell enhancer: embryonic hematopoietic stem cells significantly contribute to adult hematopoiesis.  Blood.  62.  Jiang,Y., Jahagirdar,B.N., Reinhardt,R.L., Schwartz,R.E., Keene,C.D., OrtizGonzalez,X.R., Reyes,M., Lenvik,T., Lund,T., Blackstad,M. et al. 2002. Pluripotency o f mesenchymal stem cells derived from adult marrow. Nature 418:41-49.  63. Marshak,D.R., Gottlieb,D., K i g e r , A . A . , Fuller,M.T., Kunath,T., Hogan,B., Gardner,R.L., Smith,A., Klar,A.J.S., Henrique,D. et al. 2001. Stem cell biology. D.R.Marshak, Gardner,R.L., and Gottlieb,D., editors. C o l d Spring Harbor Laboratory Press, C o l d Spring Harbor.  64.  W i l l i a m s , R . L . , Hilton,D.J., Pease,S., Willson,T.A., Stewart,C.L., Gearing,D.P., Wagner,E.F., Metcalf,D., N i c o l a , N . A . , and G o u g h , N . M . 1988. M y e l o i d leukaemia inhibitory factor maintains the developmental potential o f embryonic stem cells. Nature 336:684-687.  65. Bernstein,A. and Breitman,M. 1989. Genetic ablation in transgenic mice. Mol.Biol.Med. 6:523-530.  66.  Capecchi,M.R. 2005. Gene targeting i n mice: functional analysis o f the mammalian genome for the twenty-first century. Nat.Rev. Genet. 6:507-512.  45  67. Gutierrez-RamosJ.C. and Palacios,R. 1992. In vitro differentiation o f embryonic stem cells into lymphocyte precursors able to generate T and B lymphocytes i n vivo. Proc.Natl.Acad.Sci. U.S.A 89:9171-9175.  68. Nakano,T., Kodama,H., and Honjo,T. 1994. Generation o f lymphohematopoietic cells from embryonic stem cells i n culture. Science 265:1098-1101.  69.  Palacios,R., Golunski,E., and Samaridis,J. 1995. In vitro generation o f hematopoietic stem cells from an embryonic stem cell line. Proc.Natl.Acad.Sci.U.S.A  92:7530-7534.  70. C h o i , K . , Kennedy,M., Kazarov,A., PapadimitriouJ.C., and Keller,G. 1998. A common precursor for hematopoietic and endothelial cells. Development 125:725-732.  71. Robb,L. and Elefanty,A.G. 1998. The hemangioblast~an elusive cell captured i n culture. Bioessays 20:611-614.  72. Kaufman,D.S., Hanson,E.T., L e w i s , R . L . , Auerbach,R., and T h o m s o n J . A . 2001. Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc.Natl.Acad.Sci. U.S.A 98:10716-10721.  73.  O d o r i c o J . S . , Kaufrnan,D.S., and T h o m s o n J . A . 2001. Multilineage differentiation from human embryonic stem cell lines. Stem Cells 19:193-204.  74. Barker J . E . 1968. Development o f the mouse hematopoietic system. I. Types o f hemoglobin produced in embryonic yolk sac and liver. Dev.Biol. 18:14-29.  75.  Schofield,R. 1970. A comparative study o f the repopulating potential o f grafts from various haemopoietic sources: C F U repopulation. Cell Tissue Kinet. 3:119-130.  46  76. R o y , V . , Miller,J.S., and V e r f a i l l i e , C . M . 1997. Phenotypic and functional characterization o f committed and primitive myeloid and lymphoid hematopoietic precursors in human fetal liver. Exp.Hematol. 25:387-394.  77. G l i m m , H . and Eaves,C.J. 1999. Direct evidence for multiple self-renewal divisions o f human in vivo repopulating hematopoietic cells in short-term culture. Blood 94:21612168.  78. Weissman,I.L. 1994. Developmental switches in the immune system. Cell 76:207-218.  79. Mebius,R.E., Miyamoto,T., ChristensenJ., Domen,J., Cupedo,T., Weissman,I.L., and Akashi,K. 2001. The fetal liver counterpart o f adult common lymphoid progenitors gives rise to all lymphoid lineages, C D 4 5 + C D 4 + C D 3 - cells, as well as macrophages. J. Immunol. 166:6593-6601.  80. DouagiJ., Vieira,P., and Cumano,A. 2002. Lymphocyte commitment during embryonic development, in the mouse. Semin.Immunol. 14:361-369.  81. Freeden-Jeffry,U., Vieira,P., L u c i a n , L . A . , M c N e i l , T . , Burdach,S.E., and Murray,R. 1995. Lymphopenia i n interleukin (IL)-7 gene-deleted mice identifies I L - 7 as a nonredundant cytokine. J.Exp.Med. 181:1519-1526.  82. Carvalho,T.L., Mota-Santos,T., Cumano,A., Demengeot.J., and Vieira,P. 2001. Arrested B lymphopoiesis and persistence o f activated B cells i n adult interleukin 7(-/)mice. J.Exp.Med. 194:1141-1150.  47  83. B l a i r , A . and Thomas,D.B. 1998. The proliferative status o f haematopoietic progenitor cells i n the developing murine liver and adult bone marrow. J.Anat. 193 ( P t 3):443447.  84. Fleming,W.H., Alpern,E.J., Uchida,N., Ikuta,K., Spangrude,G.J., and WeissmanJ.L. 1993. Functional heterogeneity is associated with the cell cycle status o f murine hematopoietic stem cells. J. Cell Biol. 122:897-902.  85. Cheng,T., Rodrigues,N., Shen,H., Y a n g , Y . , Dombkowski,D., Sykes,M., and Scadden,D.T. 2000. Hematopoietic stem cell quiescence maintained by p 2 1 c i p l / w a f l . Science 287:1804-1808.  86. Y u a n , Y . , Shen,H., Franklin,D.S., Scadden,D.T., and Cheng,T. 2004. In vivo selfrenewing divisions o f haematopoietic stem cells are increased in the absence o f the early G I -phase inhibitor, p i 8 I N K 4 C . Nat. Cell Biol. 6:436-442.  87. Ezoe,S., Matsumura,L, Satoh,Y., Tanaka,H., and Kanakura,Y. 2004. C e l l cycle regulation i n hematopoietic stem/progenitor cells. Cell Cycle 3:314-318.  88. K o z a r , K . , Ciemerych,M.A., Rebel,V.L, Shigematsu,H., Zagozdzon,A., Sicinska,E., Geng,Y., Y u , Q . , Bhattacharya,S., Bronson,R.T. et al. 2004. Mouse development and cell proliferation i n the absence o f D-cyclins. Cell 118:477-491.  89. Sasaki,Y., Jensen,C.T., Karlsson,S., and Jacobsen,S.E. 2004. Enforced expression o f cyclin D 2 enhances the proliferative potential o f myeloid progenitors, accelerates i n vivo myeloid reconstitution, and promotes rescue o f mice from lethal myeloablation. Blood 104:986-992.  48  90. Y u , H . , Yuan,Y., Shen,H., and Cheng,T. 2006. Hematopoietic stem cell exhaustion impacted by p i 8 I N K 4 C and p21 C i p l / W a f l i n opposite manners. Blood 107:12001206.  91.  H o c k , H . , Hamblen,M.J., R o o k e , H . M . , SchindlerJ.W., Saleque,S., Fujiwara,Y., and Orkin,S.H. 2004. Gfi-1 restricts proliferation and preserves functional integrity o f haematopoietic stem cells. Nature 431:1002-1007.  92.  Ikuta,K. and WeissmanJ.L. 1992. Evidence that hematopoietic stem cells express mouse c-kit but do not depend on steel factor for their generation. Proc.Natl.Acad.Sci. U.S.A 89:1502-1506.  93.  M i l l e r , C . L . , Rebel,V.I., L e m i e u x , M . E . , Helgason,C.D., Lansdorp,P.M., and Eaves,C.J. 1996. Studies o f W mutant mice provide evidence for alternate mechanisms capable o f activating hematopoietic stem cells. Exp.Hematol. 24:185-194.  94. M i l l e r , C . L . , Rebel,V.I., Helgason,C.D., Lansdorp,P.M., and Eaves,C.J. 1997. Impaired steel factor responsiveness differentially affects the detection and long-term maintenance o f fetal liver hematopoietic stem cells in vivo. Blood 89:1214-1223.  95. P u r i , M . C . and Bernstein,A. 2003. Requirement for the T I E family o f receptor tyrosine kinases in adult but not fetal hematopoiesis. Proc.Natl.Acad.Sci.U.S.A  100:12753-  12758.  96. Jordan,C.T., McKearn,J.P., and LemischkaJ.R. 1990. Cellular and Developmental Properties o f Fetal Hematopoietic Stem Cells. Cell 61:953-963.  49  97. Dean,Y.D., McGreal,E.P., Akatsu,H., and Gasque,P. 2000. Molecular and cellular properties o f the rat A A 4 antigen, a C-type lectin-like receptor with structural homology to thrombomodulin. J.Biol.Chem. 275:34382-34392.  98. Rebel.V.L, M i l l e r . C . L . , Thornbury,G.R., Dragowska,W.H., Eaves,C.J., and Lansdorp,P.M. 1996. A comparison o f long-term repopulating hematopoietic stem cells i n fetal liver and adult bone marrow from the mouse. Exp.Hematol. 24:638-648.  99. Jordan,C.T., A s t l e , C . M . , Zawadski,J., Mackarehtschian,K., Lemischka,I.R., and Harrison,D.E. 1995. Long-term repopulating abilities o f enriched fetal liver stem cells measured by competitive repopulation. Exp.Hematol. 23:1011-1015.  100. Harrison,D.E., Zhong,R.K., Jordan,C.T., LemischkaJ.R., and A s t l e , C . M . 1997. Relative to adult marrow, fetal liver repopulates nearly five times more effectively long-term than short-term. Exp.Hematol. 25:293-297.  101. KawashimaJ., Zanjani,E.D., Almaida-Porada,G., Flake,A.W., Zeng.H., and O g a w a , M . 1996. C D 3 4 + human marrow cells that express low levels o f K i t protein are enriched for long-term marrow-engrafting cells. Blood 87:4136-4142.  102. Tajima,F., Deguchi,T., Laver,J.H., Zeng,H., and Ogawa,M. 2001. Reciprocal expression o f C D 3 8 and C D 3 4 by adult murine hematopoietic stem cells. Blood 97:2618-2624.  103. Ogawa,M., Tajima,F., Ito,T., Sato,T., Laver,J.H., and Deguchi,T. 2001. C D 3 4 expression by murine hematopoietic stem cells. Developmental changes and kinetic alterations.Ann.N.Y.AcadSci. 938:139-145.  50  104. Zanjani,E.D., Almeida-Porada,G., Livingston,A-G., Zeng,H., and Ogawa,M. 2003. Reversible expression o f C D 3 4 by adult human bone marrow long-term engrafting hematopoietic stem cells. Exp.Hematol.  31:406-412.  105. H s u , H . C , Ema,H., Osawa,M., Nakamura,Y., S u d a J . , and Nakauchi,H. 2000. Hematopoietic stem cells express Tie-2 receptor in the murine fetal liver. Blood 96:3757-3762.  106. Iwama,A., HamaguchiJ., Hashiyama,M., Murayama,Y., Yasunaga,K., and Suda,T. 1993. Molecular cloning and characterization o f mouse T I E and T E K receptor tyrosine kinase genes and their expression in hematopoietic stem cells. Biochem.Biophys.Res.  Commun. 195:301 -309.  107. Suda,T., Iwama,A., Hashiyama,M., Sakano,S., and O h n o , M . 1997. Receptor tyrosine kinases involved in hematopoietic progenitor cells. Leukemia 11 Suppl 3:451-453.  108. Uchida,N., Dykstra,B., Lyons,K., Leung,F., Kristiansen.M., and Eaves,C. 2004. A B C transporter activities o f murine hematopoietic stem cells vary according to their developmental and activation status. Blood 103:4487-4495.  109. Harrison,D.E. and Lerner,C.P. 1991. M o s t primitive hematopoietic stem cells are stimulated to cycle rapidly after treatment with 5-fluorouracil. Blood 78:1237-1240.  110.  Szilvassy,S.J. and Cory,S. 1993. Phenotypic and functional characterization o f competitive long-term repopulating hematopoietic stem cells enriched from 5fluorouracil-treated murine marrow. Blood 81:2310-2320.  51  111. Randall,T.D. and Weissman,I.L. 1997. Phenotypic and functional changes induced at :  the clonal level i n hematopoietic stem cells after 5-fluorouracil treatment. Blood 89:3596-3606.  112.  Sato,T., L a v e r J . H . , and Ogawa,M. 1999. Reversible expression o f C D 3 4 by murine hematopoietic stem cells. Blood 94:2548-2554.  113. Uchida,N., Fujisaki,T., E a v e s , A . C , and Eaves,C.J. 2001. Transplantable hematopoietic stem cells in human fetal liver have a CD34(+) side population (SP)phenotype. J.ClinJnvest 108:1071-1077.  114. Wright,D.E., Wagers,A.J., Gulati.A.P., Johnson,F.L., and Weissman,I.L. 2001. Physiological migration o f hematopoietic stem and progenitor cells. Science 294:19331936.  115. W i l l i a m s , D . A . , R i o s , M . , Stephens,C, and Patel,V.P. 1991. Fibronectin and V L A - 4 in haematopoietic stem cell-microenvironment interactions. Nature 352:438-441.  116. Watanabe,T., Dave,B-» Heimann,D.G., Lethaby,E., Kessinger,A., and Talmadge,J.E. 1997. G M - C S F - m o b i l i z e d peripheral blood CD34+ cells differ from steady-state bone marrow C D 3 4 + cells in adhesion molecule expression. Bone Marrow Transplant. 19:1175-1181.  117. V e r f a i l l i e , C , Blakolmer,K., and M c G l a v e , P . 1990. Purified primitive human hematopoietic progenitor cells with long-term in vitro repopulating capacity adhere selectively to irradiated bone marrow stroma. J.Exp.Med. 172:509-2.  52  118.  Simmons,P.J., Masinovsky,B., Longenecker,B.M., Berenson,R., Torok-Storb,B., and G a l l a t i n , W . M . 1992. Vascular cell adhesion molecule-1 expressed by bone marrow stromal cells mediates the binding o f hematopoietic progenitor cells. Blood 80:388395.  119.  Papayannopoulou,T., C r a d d o c k , C , Nakamoto,B., Priestley,G.V., and Wolf,N.S. 1995. The V L A 4 / V C A M - 1 adhesion pathway defines contrasting mechanisms o f lodgement of transplanted murine hemopoietic progenitors between bone marrow and spleen. Proc.Natl.Acad.Sci. U.S.A 92:9647-9651.  120.  Papayannopoulou,T., Priestley,G.V., and Nakamoto,B. 1998. A n t i - V L A 4 / V C A M - 1 induced mobilization requires cooperative signaling through the kit/mkit ligand pathway. Blood 91:2231 -2239.  121.  Leavesley,D.L, Oliver.J.M., Swart,B.W., B e r n d t , M . C , H a y l o c k , D . N . , and Simmons,P.J. 1994. Signals from platelet/endothelial cell adhesion molecule enhance the adhesive activity o f the very late antigen-4 integrin o f human CD34+ hemopoietic progenitor cells. J.Immunol. 153:4673-4683.  122.  Kikuta,T., Shimazaki,C., Ashihara,E., Sudo,Y., Hirai,H., Sumikuma,T., Yamagata,N., Inaba,T., Fujita,N., Kina,T. et al. 2000. Mobilization o f hematopoietic primitive and committed progenitor cells into blood i n mice by anti-vascular adhesion molecule-1 antibody alone or in combination with granulocyte colony-stimulating factor. Exp.Hematol. 28:311-317.  53  123.  Craddock,C.F., Nakamoto,B-> E l i c e s , M . , and Papayannopoulou,T. 1997. The role o f CS1 moiety o f fibronectin i n V L A mediated haemopoietic progenitor trafficking. Br.J.Haematol.  97:15-21.  124. Craddock,C.F., Nakamoto,B-> Andrews,R.G., Priestley,G.V., and Papayannopoulou,T. 1997. Antibodies to V L A 4 integrin mobilize long-term repopulating cells and augment cytokine-induced mobilization i n primates and mice. Blood 90:4779-4788.  125.  Bhatia,R., M c G l a v e , P . B . , and V e r f a i l l i e . C . M . 1995. Treatment o f marrow stroma with interferon-alpha restores normal beta 1 integrin-dependent adhesion o f chronic myelogenous leukemia hematopoietic progenitors. Role o f MIP-1 alpha.  J.Clin.lnvest  96:931-939.  126.  Priestley,G.V., Scott,L.M., Ulyanova,T., and Papayannopoulou,T. 2006. Lack o f alpha4 integrin expression i n stem cells restricts competitive function and self-renewal activity. Blood 107:2959-2967.  127.  Driessen,R.L., Johnston,H.M., and Nilsson,S.K. 2003. Membrane-bound stem cell factor is a key regulator in the initial lodgment o f stem cells within the endosteal marrow region. Exp.Hematol  128.  31:1284-1291.  Gunji,Y., Nakamura,M., Hagiwara,T., Hayakawa,K., Matsushita,H., Osawa,H., Nagayoshi,K., Nakauchi,H., Yanagisawa,M., M i u r a , Y . et al. 1992. Expression and function o f adhesion molecules on human hematopoietic stem cells: C D 3 4 + L F A - 1 cells are more primitive than C D 3 4 + L F A - 1 + cells. Blood 80:429-436.  54  129. Lee,J.Y. and Spicer,A.P. 2000. Hyaluronan: a multifunctional, megaDalton, stealth molecule. Curr.Opin.CellBiol.  12:581-586.  130. D i m i t r o f f , C J . , Lee,J.Y., Rafii,S., Fuhlbrigge,R.C, and Sackstein,R. 2001. C D 4 4 is a major E-selectin ligand on human hematopoietic progenitor cells. J. Cell Biol. 153:1277-1286.  131. Vermeulen,M., L e Pesteur,F., Gagnerault,M.C, Mary,J.Y., Sainteny,F., and Lepault,F. 1998. Role o f adhesion molecules i n the homing and mobilization o f murine hematopoietic stem and progenitor cells. Blood 92:894-900.  132. A v i g d o r , A . , Goichberg,P., Shivtiel,S., Dar,A., Peled,A., Samira,S., K o l l e t , 0 . , Hershkoviz,R., A l o n , R . , HardanJ. et al. 2004. C D 4 4 and hyaluronic acid cooperate with SDF-1 in the trafficking o f human CD34+ stem/progenitor cells to bone marrow. Blood 103:2981-2989.  133. Oostendorp,R.A., Ghaffari,S., and Eaves,C.J. 2000. Kinetics o f i n vivo homing and recruitment into cycle o f hematopoietic cells are organ-specific but CD44-independent. Bone Marrow Transplant. 26:559-566.  134. Marhaba,R. and Z o l l e r , M . 2004. C D 4 4 in cancer progression: adhesion, migration and growth regulation. J.Mol.Histol.  35:211-231.  135. Toksoz,D., Z s e b o , K . M , Smith,K.A., Hu,S., Brankow,D., Suggs,S.V., Martin,F.H., and W i l l i a m s , D . A . 1992. Support o f human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and  55  secreted forms o f the human homolog o f the steel gene product, stem cell factor. Proc.Natl.Acad.Sci. U.S.A 89:7350-7354.  136. H a r d y , C . L . and Minguell.J.J. 1995. Modulation o f the adhesion o f hemopoietic progenitor cells to the R G D site o f fibronectin by interleukin 3. J.Cell Physiol 164:315-323.  137.  S l a n i c k a , K . M . , N i s s e n , C , M a n z , C . Y . , Toksoz,D., Lyman,S.D., and WodnarF i l i p o w i c z , A . 1998. The membrane-bound isoform o f stem cell factor synergizes with soluble flt3 ligand in supporting early hematopoietic cells i n long-term cultures o f normal and aplastic anemia bone marrow. Exp.Hematol. 26:365-373.  138. W i l l i a m s , D . A . and Majumdar,M.K. 1994. Analysis o f steel factor (stem cell factor) isoforms i n the hematopoietic microenvironment. Stem Cells 12 Suppl 1:67-74.  139. Fleming,W.H., Alpern,E.J., Uchida,N., Ikuta,K., and WeissmanJ.L. 1993. Steel factor influences the distribution and activity o f murine hematopoietic stem cells in vivo. Proc.Natl.AcadSci.US.A  90:3760-3764.  140. Lapidot,T. and K o l l e t , 0 . 2002. The essential roles o f the chemokine SDF-1 and its receptor C X C R 4 in human stem cell homing and repopulation o f transplanted immunedeficient N O D / S C I D and N O D / S C I D / B 2 m ( n u l l ) mice. Leukemia 16:1992-2003.  141. Hattori,K., Heissig,B., and Rafii,S. 2003. The regulation o f hematopoietic stem cell and progenitor mobilization by chemokine S D F - 1 . LeukLymphoma 44:575-582.  56  142.  Wright,D.E., Bowman,E.P., Wagers,A.J., B u t c h e r , E . C , and WeissmanJ.L. 2002. Hematopoietic stem cells are uniquely selective i n their migratory response to chemokines. J.Exp.Med. 195:1145-1154.  143.  Juremalm,M. and Nilsson,G. 2005. Chemokine receptor expression by mast cells. Chem. Immunol. Allergy 87:130-144.  144. L i , S . , Huang,S., and Peng,S.B. 2005. Overexpression o f G protein-coupled receptors i n cancer cells: involvement in tumor progression. Int. J.Oncol. 27:1329-1339.  145.  Burger,J.A. and Kipps,T.J. 2002. Chemokine receptors and stromal cells i n the homing and homeostasis o f chronic lymphocytic leukemia B cells. LeukLymphoma 43:461466.  146. Petit,I., Goichberg,P., Spiegel,A., Peled,A., B r o d i e , C , Seger,R., Nagler,A., Alon,R., and Lapidot,T. 2005. Atypical P K C - z e t a regulates SDF-1-mediated migration and development o f human C D 3 4 + progenitor cells. J.Clin.Invest 115:168-176.  147. A i u t i , A . , Tavian,M., Cipponi,A., Ficara,F., Zappone,E., Hoxie,J., Peault,B., and Bordignon,C. 1999. Expression o f C X C R 4 , the receptor for stromal cell-derived factor-1 on fetal and adult human lympho-hematopoietic progenitors. Eur. J.Immunol. 29:1823-1831.  148. Honczarenko,M., Douglas,R.S., M a t h i a s , C , Lee,B., Ratajczak,M.Z., and Silberstein,L.E. 1999. SDF-1 responsiveness does not correlate with C X C R 4 expression levels o f developing human bone marrow B cells. Blood 94:2990-2998.  57  149.  Shen,H., Cheng,T., OlszakJ., Garcia-Zepeda,E., L u , Z . , Heirmann,S-, FallonJR.., Luster,A.D., and Scadden,D.T. 2001. C X C R - 4 desensitization is associated with tissue localization o f hemopoietic progenitor cells: J.lmmunol.  166:5027-5033.  150. R o s u - M y l e s , M . , Gallacher,L., Murdoch,B-, Hess,D.A., Keeney,M., K e l v i n , D . , Dale,L., Ferguson,S.S., W u , D . , Fellows,F. et al. 2000. The human hematopoietic stem cell compartment is heterogeneous for C X C R 4 expression. Proc.Natl.Acad.Sci.  U.S.A  97:14626-14631.  151. Kawabata,K., Ujikawa,M., Egawa,T., Kawamoto,H., Tachibana,K., Iizasa,H., Katsura,Y., Kishimoto,T., and Nagasawa,T. 1999. A cell-autonomous requirement for C X C R 4 i n long-term lymphoid and myeloid reconstitution.  Proc.Natl.Acad.Sci.U.S.A  96:5663-5667.  152. Nagasawa,T., Hirota,S., Tachibana,K., Takakura,N., Nishikawa,S., Kitamura,Y., Yoshida,N., Kikutani,H., and Kishimoto.T. 1996. Defects o f B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the C X C chemokine P B S F / S D F - 1 . Nature 382:635-638.  153. Peled,A., PetitJ., K o l l e t , 0 . , M a g i d , M . , Ponomaryov,T., B y k , T . , Nagler,A., Ben H u r , H . , M a n y , A . , Shultz,L. et al. 1999. Dependence o f human stem cell engraftment and repopulation o f N O D / S C I D mice on C X C R 4 . Science 283:845-848.  154. Ara,T., Tokoyoda,K., Sugiyama,T., Egawa,T., Kawabata,K., and Nagasawa,T. 2003. Long-term hematopoietic stem cells require stromal cell-derived factor-1 for colonizing bone marrow during ontogeny. Immunity. 19:257-267.  58  155. A i u t i , A . , WebbJ.J., B l e u l , C , Springer,T., and Gutierrez-Ramos,J.C. 1997. The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization o f CD34+ progenitors to peripheral blood. J.Exp.Med.  185:111-120.  156. Cashman,J., Clark-Lewis,L, Eaves,A., and Eaves,C. 2002. Stromal-derived factor 1 inhibits the cycling o f very primitive human hematopoietic cells in vitro and in N O D / S C I D mice. Blood 99:792-799.  157. M o o r e , M . A . , Hattori,K., Heissig,B., S h i e h J . H . , Dias,S., Crystal,R.G., and Rafii,S. 2001. Mobilization o f endothelial and hematopoietic stem and progenitor cells by adenovector-mediated elevation o f serum levels o f S D F - 1 , V E G F , and angiopoietin-1. Ann.N.Y.AcadSci.  938:36-45.  158. Lee,B.C., Cheng,T., Adams,G.B., A t t a r . E . C , Miura,N., Lee,S.B., Saito,Y., O l s z a k J . , Dombkowski,D., 01son,D.P. et al. 2003. P 2 Y - l i k e receptor, G P R 1 0 5 (P2Y14), identifies and mediates chemotaxis o f bone-marrow hematopoietic stem cells. Genes Dev. 17:1592-1604.  159. Y o n g , K . L . , Fahey,A., Pahal,G., L i n c h , D . C , Pizzey,A., Thomas,N.S., Jauniaux,E., Kinnon,C., and Thrasher,A.J. 2002. Fetal haemopoietic cells display enhanced migration across endothelium. Br. J.Haematol.  116:392-400.  160. Morrison,S.J., Wright,D.E., and Weissman,I.L. 1997. Cyclophosphamide/granulocyte colony-stimulating factor induces hematopoietic stem cells to proliferate prior to mobilization. Proc.Natl.Acad.Sci.U.S.A  94:1908-1913.  59  161. Uchida,N., He,D., Friera,A.M., Reitsma,M., Sasaki,D., Chen,B-, and Tsukamoto,A. 1997. The unexpected G0/G1 cell cycle status o f mobilized hematopoietic stem cells from peripheral blood. Blood 89:465-472.  162. W r i g h t D . E . , Cheshier,S.H., Wagers,A.J., Randall,T.D., ChristensenJ.L., and Weissman,I.L. 2001. Cyclophosphamide/granulocyte colony-stimulating factor causes selective mobilization o f bone marrow hematopoietic stem cells into the blood after M phase o f the cell cycle. Blood 97:2278-2285.  163. Habibian,H.K., Peters.S.O., H s i e h , C . C , Wuu,J., Vergilis,K., Grimaldi,C.I., R e i l l y J . , Carlson,J.E., Frimberger,A.E., Stewart.F.M. et al. 1998. The fluctuating phenotype o f the lymphohematopoietic stem cell with cell cycle transit. J.Exp.Med. 188:393-398.  164. G l i m m , H . , Oh,I.H., and Eaves,C.J. 2000. Human hematopoietic stem cells stimulated to proliferate i n vitro lose engraftment potential during their S/G(2)/M transit and do not reenter G(0). Blood 96:4185-4193.  165. Wilpshaar,J., Bhatia,M., Kanhai,H.H., Breese,R., Heilman,D.K., Johnson,C.S., FalkenburgJ.H., and Srour,EF- 2002. Engraftment potential o f human fetal hematopoietic cells in N O D / S C I D mice is not restricted to mitotically quiescent cells. Blood 100:120-127.  166. Thorsteinsdottir,U., Sauvageau,G., and Humphries,R.K. 1999. Enhanced in vivo regenerative potential o f HOXB4-transduced hematopoietic stem cells with regulation o f their pool size. Blood 94:2605-2612.  60  167. Reya,T., Duncan,A.W., A i l l e s , L . , Domen,J., Scherer,D.C, Willert,K., Hintz,L., Nusse,R., and WeissmanJ.L. 2003. A role for Wnt signalling in self-renewal o f haematopoietic stem cells. Nature 423:409-414.  168. R e b e l , V . L , M i l l e r , C . L . , Eaves,C.J., and Lansdorp,P.M. 1996. The repopulation potential o f fetal liver hematopoietic stem cells in mice exceeds that o f their liver adult bone marrow counterparts. Blood 87:3500-3507.  169. Pawliuk,R., E a v e s , C , and Hiimphries,R.K. 1996. Evidence o f both ontogeny and transplant dose-regulated expansion o f hematopoietic stem cells in vivo. Blood 88:2852-2858.  170. Harrison JD.E., A s t l e , C . M . , and DelaittreJ.A. 1978. Loss o f proliferative capacity in immunohemopoietic stem cells caused by serial transplantation rather than aging. J.Exp.Med. 147:1526-1531.  171. HarrisonJD.E. and A s t l e , C . M . 1982. Loss o f stem cell repopulating ability upon transplantation. Effects o f donor age, cell number, and transplantation procedure. J.Exp.Med. 156:1767-1779.  172. Iscove,N.N. and N a w a , K . 1997. Hematopoietic stem cells expand during serial transplantation in vivo without apparent exhaustion. Curr.Biol. 7:805-808.  173. Trevisan,M., Y a n , X . Q . , and Iscove,N.N. 1996. Cycle initiation and colony formation in culture by murine marrow cells with long-term reconstituting potential i n vivo. Blood 88:4149-4158.  61  174. Audet,J., M i l l e r , C . L . , Rose-John,S., P i r e t J . M . , and Eaves,C.J. 2001. Distinct role o f g p l 3 0 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc.Natl.Acad.Sci. U.S.A 98:1757-1762.  175. Audet,J., M i l l e r , C . L . , Eaves,C.J., and P i r e t J . M . 2002. Common and distinct features of cytokine effects on hematopoietic stem and progenitor cells revealed by doseresponse surface analysis. Biotechnol.Bioeng. 80:393-404.  176. Robinson,S., N i u , T . , de L i m a , M . , Ng,J., Y a n g , H . , M c M a n n i s J . , Karandish,S., Sadeghi,T., Fu,P., del A n g e l , M . et al. 2005. E x vivo expansion o f umbilical cord blood. Cytotherapy. 7:243-250.  177. de Haan,G., Weersing,E., Dontje,B., van Os,R., Bystrykh,L.V., Vellenga,E., and M i l l e r , G . 2003. In vitro generation o f long-term repopulating hematopoietic stem cells by fibroblast growth factor-1. Dev.Cell 4:241-251.  178. Willert,K., Brown,J.D., Danenberg,E., Duncan,A.W., WeissmanJ.L., Reya,T., Yates,J.R., I l l , and Nusse,R. 2003. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423:448-452.  179. Bhardwaj.G., Murdoch,B., W u , D . , Baker,D.P., Williams,K.P., Chadwick,K., L i n g , L . E . , Karanu,F.N., and Bhatia,M. 2001. Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via B M P regulation. Nat. Immunol. 2:172-180.  180. K r o s l J . , Austin,P., Beslu,N., Kroon,E., Humphries,R.K., and Sauvageau,G. 2003. In vitro expansion o f hematopoietic stem cells by recombinant T A T - H O X B 4 protein. Nat.Med. 9:1428-1432.  62  181. Masuoka,H.C. and Townes,T.M. 2002. Targeted disruption o f the activating transcription factor 4 gene results in severe fetal anemia in mice. Blood 99:736-745.  182. Sasaki,K., Y a g i , H . , Bronson,R.T., Tominaga,K., Matsunashi,T., Deguchi,K., Tani,Y., Kishimoto,T., and Komori,T. 1996. Absence o f fetal liver hematopoiesis in mice deficient i n transcriptional coactivator core binding factor beta. Proc.Natl.Acad.Sci. U.S.A 93:12359-12363.  183. M i l l e r , ! , Horner,A., Stacy,T., L o w r e y , C , L i a n J . B . , Stein,G., N u c k o l l s , G . H . , and Speck,N.A. 2002. The core-binding factor beta subunit is required for bone formation and hematopoietic maturation. Nat.Genet. 32:645-649.  184. Kasper,L.H., Boussouar,F., N e y , P . A . , Jackson,C.W., Rehg,J., van Deursen,J.M., and Brindle,P.K. 2002. A transcription-factor-binding surface o f coactivator p300 is required for haematopoiesis. Nature 419:738-743.  185. Rebel,V.I., K u n g , A . L . , Tanner,E.A., Y a n g . H . , Bronson,R.T., and Livingston,D.M. 2002. Distinct roles for C R E B - b i n d i n g protein and p300 in hematopoietic stem cell self-renewal. Proc.Natl.Acad.Sci.U.S.A  99:14789-14794.  186. Sandberg,M.L., Sutton,S.E., Pletcher,M.T., Wiltshire,T., Tarantino,L.M., Hogenesch,J.B., and Cooke,M.P. 2005. c - M y b and p300 regulate hematopoietic stem cell proliferation and differentiation. Dev. Cell 8:153-166.  187.  Wilson,A., Murphy,M.J., Oskarsson.T., Kaloulis,K., Bettess,M.D., Oser,G.M., Pasche,A.C., Knabenhans,C, Macdonald,H.R., and Trumpp,A. 2004. c-Myc controls  63  the balance between hematopoietic stem cell self-renewal and differentiation. Genes Dev. 18:2747-2763.  188. Orkin,S.H. 1995. Hematopoiesis: how does it happen? Curr.Opin.Cell  Biol. 7:870-877.  189. L i n g , K . W . , Ottersbach,K., van Hamburg,!P., Oziemlak,A., Tsai,F.Y., Orkin,S.H., Ploemacher,R., Hendriks,R.W., and Dzierzak,E. 2004. G A T A - 2 plays two functionally distinct roles during the ontogeny o f hematopoietic stem cells. J.Exp.Med. 200:871882.  190. Nichogiannopoulou,A., Trevisan,M., Neben,S., Friedrich,C, and Georgopoulos,K. 1999. Defects i n hemopoietic stem cell activity in Ikaros mutant mice. J.Exp.Med. 190:1201-1214.  191. Georgopoulos,K. 2002. Haematopoietic cell-fate decisions, chromatin regulation and ikaros. Nat.Rev.Immunol. 2:162-174.  192. Yoshida,T., Y a o - M i n g , N . S . , Zuniga-Pflucker,J.C, and Georgopoulos,K. 2006. Early hematopoietic lineage restrictions directed by Ikaros. Nat.lmmunol. 7:382-391.  193. Yamada,Y., Warren,A.J., Dobson,C., Forster,A., Pannell,R., and Rabbitts,T.H. 1998. The T cell leukemia L I M protein L m o 2 is necessary for adult mouse hematopoiesis. Proc.Natl.Acad.Sci. U.S.A 95:3890-3895.  194. Gering,M., Yamada,Y., Rabbitts,T.H., and Patient,R.K. 2003. Lmo2 and Scl/Tall convert non-axial mesoderm into haemangioblasts which differentiate into endothelial cells i n the absence o f G a t a l . Development 130:6187-6199.  64  195. Hisa,T., Spence,S.E., Rachel.R.A., Fujita,M., Nakamura,T., Ward,J.M., DevorHenneman,D.E., Saiki,Y., Kutsuna,H., Tessarollo,L. et al. 2004. Hematopoietic, angiogenic and eye defects in M e i s l mutant animals. EMBOJ.  23:450-459.  196. Wang,G.G., Pasillas,M.P., and K a m p s , M . P . 2005. M e i s l programs transcription of F L T 3 and cancer stem cell character, using a mechanism that requires interaction with P B X and a novel function o f the M e i s l C-terminus. Blood.  197. Lacorazza,H.D., Yamada,T., L i u , Y . , Miyata,Y., Sivina,M., Nunes,J., and Nimer,S.D. 2006. The transcription factor M E F / E L F 4 regulates the quiescence o f primitive hematopoietic cells. Cancer Cell 9:175-187.  198. Kajiume,T., Ninomiya,Y., Ishihara,H., Kanno,R., and K a n n o , M . 2004. Polycomb group gene mel-18 modulates the self-renewal activity and cell cycle status of hematopoietic stem cells. Exp.Hematol. 32:571-578.  199. Iwama,A., Oguro,H., Negishi,M., Kato,Y., Morita,Y., Tsukui,H., Ema,H., Kamijo,T., Katoh-Fukui,Y., K o s e k i , H . et al. 2004. Enhanced self-renewal o f hematopoietic stem cells mediated by the polycomb gene product B m i - 1 . Immunity. 21:843-851.  200. Chun,T., Rho,S.B., Byun,H.J., Lee,J.Y., and K o n g , G . 2005. The polycomb group gene product Mel-18 interacts with cyclin D 2 and modulates its activity. FEBS Lett. 579:5275-5280.  201. Ernst,P., Fisher,J.K., Avery,W., Wade,S., Foy,D., and Korsmeyer,S.J. 2004. Definitive hematopoiesis requires the mixed-lineage leukemia gene. Dev.Cell 6:437-443.  65  202. Lessard,J. and Sauvageau,G. 2003. Polycomb group genes as epigenetic regulators o f normal and leukemic hemopoiesis. Exp.Hematol. 31:567-585.  203. BjornssonJ.M., Larsson,N., B r u n , A . C , Magnusson,M., Andersson,E., Lundstrom,P., Larsson,J., Repetowska,E., Ehinger,M., Humphries,R.K. et al. 2003. Reduced proliferative capacity o f hematopoietic stem cells deficient in Hoxb3 and Hoxb4. Mol.Cell Biol. 23:3872-3883.  204. B r u n , A . C , Bjornsson,J.M., Magnusson,M., Larsson,N., Leveen,P., Ehinger,M., Nilsson,E., and Karlsson,S. 2004. Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation defect in hematopoietic stem cells. Blood 103:4126-4133.  205. Ohta,H., Sawada,A., K i m , J . Y . , Tokimasa,S., Nishiguchi.S., Humphries,R.K., Hara,J., and Takihara,Y. 2002. Polycomb group gene rae28 is required for sustaining activity of hematopoietic stem cells. J.Exp.Med. 195:759-770.  206. Oh,I.H. and Eaves,C.J. 2002. Overexpression o f a dominant negative form o f S T A T 3 selectively impairs hematopoietic stem cell activity. Oncogene 21:4778-4787.  207. Takizawa,M., Nobuhisa,I., Igarashi,K., U e n o , M . , Nakashima,K., Kitamura,T., and Taga,T. 2003. Requirement o f g p l 3 0 signaling for the A G M hematopoiesis. Exp. Hematol. 31:283-289.  208.  Schuringa,J.J., W u , K . , Morrone,G., and M o o r e , M . A . 2004. Enforced activation o f S T A T 5 A facilitates the generation o f embryonic stem-derived hematopoietic stem cells that contribute to hematopoiesis in vivo. Stem Cells 22:1191-1204.  66  209.  Schuringa,J.J., C h u n g , K . Y . , Morrone,G., and M o o r e , M . A . 2004. Constitutive activation o f S T A T 5 A promotes human hematopoietic stem cell self-renewal and erythroid differentiation. J.Exp.Med. 200:623-635.  210. Kato,Y., Iwama,A., Tadokoro,Y., Shimoda,K., Minoguchi,M., Akira,S., Tanaka,M., Miyajima,A., Kitamura,T., and Nakauchi,H. 2005. Selective activation o f S T A T 5 unveils its role i n stem cell self-renewal in normal and leukemic hematopoiesis. J.Exp.Med. 202:169-179.  211. Bunting,K.D., Bradley,H.L., Hawley,T.S., Moriggl,R., Sorrentino,B.P., and IhleJ.N. 2002. Reduced lymphomyeloid repopulating activity from adult bone marrow and fetal liver o f mice lacking expression o f S T A T 5 . Blood 99:479-487.  212.  Socolovsky,M., Fallon.A.E., Wang,S., Brugnara,C, and Lodish,H.F. 1999. Fetal anemia and apoptosis o f red cell progenitors i n Stat5a-/-5b-/- mice: a direct role for Stat5 i n B c l - X ( L ) induction. Cell 98:181-191.  213. Tocci,A., ParoliniJ., Gabbianelli,M., Testa,U., Luchetti.L., Samoggia,P., Masella,B-, Russo,G., V a l t i e r i , M . , and Peschle,C. 1996. Dual action o f retinoic acid on human embryonic/fetal hematopoiesis: blockade o f primitive progenitor proliferation and shift from multipotent/eiythroid/monocytic to granulocytic differentiation program. Blood 88:2878-2888.  214. Kaushansky,K. 2003. Thrombopoietin: accumulating evidence for an important biological effect on the hematopoietic stem cell. Ann.N.Y.Acad.Sci. 996:39-43.  67  215. L a n g e r , J . C , Henckaerts,E., Orenstein,!, and Snoeck,H.W. 2004. Quantitative trait analysis reveals transforming growth factor-beta2 as a positive regulator o f early hematopoietic progenitor and stem cell function. J.Exp.Med. 199:5-14.  216. A u s t i n , ! . W . , Solar,G.P., Z i e g l e r , F . C , L i e m , L . , and Matthews,W. 1997. A role for the Wnt gene family in hematopoiesis: expansion o f multilineage progenitor cells. Blood 89:3624-3635.  217.  Duncan,A.W., Rattis,F.M., D i M a s c i o , L . N . , Congdon,K.L., Pazianos,G., Zhao,C., Y o o n , K . , C o o k , J . M . , Willert,K., Gaiano,N. et al. 2005. Integration o f Notch and W n t signaling i n hematopoietic stem cell maintenance. Nat.Immunol. 6:314-322.  218. L o o k , A . T . 1997. Oncogenic transcription factors i n the human acute leukemias. Science 278:1059-1064.  219. M i y o s h i , H . , Shimizu,K., Kozu,T., Maseki,N., Kaneko,Y., and O h k i , M . 1991. t(8;21) breakpoints on chromosome 21 i n acute myeloid leukemia are clustered within a limited region o f a single gene, A M L 1 . Proc.Natl.Acad.Sci.U.S.A  88:10431-10434.  220. Wang,S., Wang,Q., Crute,B.E., Melnikova,I.N., Keller.S.R., and Speck,N.A. 1993. Cloning and characterization o f subunits o f the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol. Cell Biol. 13:3324-3339.  221.  Lutterbach,B., Westendorf,!!, Linggi,B., Isaac,S., Seto,E., and Hiebert,S.W. 2000. A mechanism o f repression by acute myeloid leukemia-1, the target o f multiple chromosomal translocations in acute leukemia. J.Biol.Chem. 275:651-656.  68  222.  Speck,N.A. and G i l l i l a n d , D . G . 2002. Core-binding factors i n haematopoiesis and leukaemia. Nat.Rev.Cancer 2:502-513.  223. Giese,K., K i n g s l e y , C , KirshnerJ.R., and Grosschedl,R. 1995. Assembly and function of a T C R alpha enhancer complex is dependent on LEF-1-induced D N A bending and multiple protein-protein interactions. Genes Dev. 9:995-1008.  224. Uchida,H., Zhang,J., and Nimer,S.D. 1997. A M L 1 A and A M L 1 B can transactivate the human IL-3 promoter. J.Immunol. 158:2251-2258.  225. Takahashi,A., S a t a k e , M , Yamaguchi-Iwai,Y., B a e , S . C , Lu,J., Maruyama,M., Zhang, Y . W . , Oka,H., A r a i , N . , A r a i , K . et al. 1995. Positive and negative regulation o f granulocyte-macrophage colony-stimulating factor promoter activity by A M L 1 - r e l a t e d transcription factor, P E B P 2 . Blood 86.-607-616.  226. Brown,S.T., Miranda,G.A., Galic,Z., Hartman,I.Z., L y o n , C . J . , and Aguilera,R.J. 1997. Regulation o f the R A G - 1 promoter by the N F - Y transcription factor. J.Immunol. 158:5071-5074.  227. Bernardin-Fried,F., Kummafue,T., Leijen,S., Collector,M.I., Ravid,K., and Friedman,A.D. 2004. A M L l / R U N X l increases during G l to S cell cycle progression independent o f cytokine-dependent phosphorylation and induces cyclin D3 gene expression. J.Biol.Chem. 279:15678-15687.  228.  Okuda,T., van DeursenJ., Hiebert,S.W., Grosveld,G., and D o w n i n g J . R . 1996. A M L 1 , the target o f multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84:321-330.  69  229.  Wang,Q., S t a c y J . , B i n d e r , M . Marin-Padilla,M., Sharpe,A.H., and Speck,N.A. 1996. 5  Disruption o f the Cbfa2 gene causes necrosis and hemorrhaging i n the central nervous system and blocks definitive hematopoiesis. Proc.Natl.Acad.Sci. U.S.A 93:3444-3449.  230. Lacaud,G., Gore,L., Kennedy,M., K o u s k o f l V . , Kingsley,P., Hogan,C., Carlsson,L., Speck,N., P a l i s J . , and Keller,G. 2002. R u n x l is essential for hematopoietic commitment at the hemangioblast stage o f development in vitro. Blood 100:458-466.  231.  Wang,Q., Stacy,T., M i l l e r J . D . , Lewis,A.F., G u , T . L . , Huang,X., Bushweller,J.H., B o r i e s J . C . , A l t , F . W . , Ryan,G. et al. 1996. The CBFbeta subunit is essential for CBFalpha2 ( A M L 1 ) function in vivo. Cell 87:697-708.  232.  Ichikawa,M., Asai,T., Saito,T., Seo,S., YamazakiJ., Yamagata,T., Mitani,K., Chiba,S., Ogawa,S., Kurokawa,M. et al. 2004. A M L - 1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance o f hematopoietic stem cells in adult hematopoiesis. Nat.Med. 10:299-304.  233.  G r o w n e y J . D . , Shigematsu,H., L i , Z . , Lee,B-H., AdelspergerJ., Rowan,R., Curley,D.P., Kutok,J.L., Akashi,K., W i l l i a m s J . R . et al. 2005. Loss o f R u n x l perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106:494504.  234. Putz,G., Rosner,A., Nuesslein,L, Schmitz,N., and Buchholz,F. 2006. A M L 1 deletion in adult mice causes splenomegaly and lymphomas. Oncogene 6:929-939.  70  235. North,T., G u , T . L . , Stacy,T., Wang,Q., Howard,L., B i n d e r , M . , Marin-Padilla,M., and Speck,N.A. 1999. Cbfa2 is required for the formation o f intra-aortic hematopoietic clusters. Development 126:2563-2575.  236. North,T.E., de Bruijn,M.F., Stacy,T., Talebian,L., L i n d , E . , R o b i n , C , Binder,M., Dzierzak,E., and Speck,N.A. 2002. R u n x l expression marks long-term repopulating hematopoietic stem cells i n the midgestation mouse embryo. Immunity. 16:661-672.  237. M u l l o y , J . C , Carnmenga,J., Berguido,F.J., W u , K . , Zhou,P., Comenzo,R.L., Jhanwar,S., M o o r e , M . A . , and Nimer,S.D. 2003. Maintaining the self-renewal and differentiation potential o f human C D 3 4 + hematopoietic cells using a single genetic element. Blood 102:4369-4376.  238. Artavanis-Tsakonas,S., Rand,M.D., and Lake,R.J. 1999. N o t c h signaling: cell fate control and signal integration i n development. Science 284:770-776.  239.  Satoh,Y., MatsumuraJ., Tanaka,H., Ezoe,S., Sugahara,H., M i z u k i , M . , Shibayama,H., Ishiko,E., Ishiko,J., Nakajima,K. et al. 2004. Roles for c - M y c i n self-renewal o f hematopoietic stem cells. J.Biol.Chem. 279:24986-24993.  240. P u i , J . C , Allman,D., X u , L . , DeRocco,S., Karnell,F.G., Bakkour.S., L e e J . Y . , Kadesch,T., Hardy,R.R., Aster,J.C. et al. 1999. N o t c h l expression i n early lymphopoiesis influences B versus T lineage determination. Immunity. 11:299-308.  241.  Karanu,F.N., Murdoch.B-, Miyabayashi,T., Ohno,M., Koremoto,M., Gallacher,L., W u , D . , Itoh,A., Sakano,S., and Bhatia,M. 2001. Human homologues o f Delta-1 and  71  Delta-4 function as mitogenic regulators o f primitive human hematopoietic cells. Blood 97:1960-1967.  242. Zhang,Z., Nadeau,P., Song,W., Donoviel,D., Y u a n , M . , Bernstein,A., and Yankner,B-A. 2000. Presenilins are required for gamma-secretase cleavage o f betaA P P and transmembrane cleavage o f Notch-1. Nat.Cell Biol 2:463-465.  243.  Swiatek,P.J., Lindsell,C.E., del A m o , F . F . , Weinmaster,G., and G r i d l e y J . 1994. N o t c h l is essential for postimplantation development i n mice. Genes Dev. 8:707-719.  244. Conlon,R.A., Reaume,A.G., and RossantJ. 1995. N o t c h l is required for the coordinate segmentation o f somites. Development 121:1533-1545.  245. Kumano,K., Chiba,S., Kunisato,A., Sata,M., Saito,T., Nakagami-Yamaguchi,E., Yamaguchi,T., Masuda,S., Shimizu,K., Takahashi,T. et al. 2003. N o t c h l but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity. 18:699-711.  246. K o z l o w s k i , M . , Larose,L., Lee,F., L e , D . M . , Rottapel,R., and Siminovitch,K.A. 1998. SHP-1 binds and negatively modulates the c-Kit receptor by interaction with tyrosine 569 in the c - K i t juxtamembrane domain. Mol.Cell Biol. 18:2089-2099.  247. Mancini,S.J., Mantei,N., Dumortier,A., Suter,U., Macdonald,H.R., and Radtke,F. 2005. Jagged 1-dependent Notch signaling is dispensable for hematopoietic stem cell self-renewal and differentiation. Blood 105:2340-2342.  248. Lecuyer,E. and Hoang,T. 2004. S C L : from the origin o f hematopoiesis to stem cells and leukemia. Exp.Hematol. 32:11-24.  72  249.  Lecuyer,E., Herblot,S., Saint-Denis,M., Martin,R., Begley,C.G., P o r c h e r , C , Orkin,S.H., and Hoang,T. 2002. The S C L complex regulates c-kit expression in hematopoietic cells through functional interaction with S p l . Blood 100:2430-2440.  250. E l e f a n t y A G . , Begley,C.G., Metcalf,D., Barnett,L., Kontgen,F., and Robb,L. 1998. Characterization o f hematopoietic progenitor cells that express the transcription factor S C L , using a lacZ "knock-in" strategy. Proc.Natl.Acad.Sci. U.S.A 95:11897-11902.  251.  E l e f a n t y A G . , B e g l e y , C . G , Hartley,L., Papaevangeliou,B., and Robb,L. 1999. S C L expression in the mouse embryo detected with a targeted lacZ reporter gene demonstrates its localization to hematopoietic, vascular, and neural tissues. Blood 94:3754-3763.  252.  Robb,L., Lyons,L, L i , R . , Hartley,L., Kontgen,F., Harvey,R.P., Metcalf,D., and Begley,C.G. 1995. Absence o f yolk sac hematopoiesis from mice with a targeted disruption o f the sci gene. Proc.Natl.AcadSci.US.A  253.  92:7075-7079.  Shivdasani,R.A., Mayer,E.L., and Orkin,S.H. 1995. Absence o f blood formation in mice lacking the T-cell leukaemia oncoprotein t a l - l / S C L . Nature 373:432-434.  254. P o r c h e r , C , Swat,W., Rockwell,K., Fujiwara,Y., A l t , F . W . , and Orkin,S.H. 1996. The T cell leukemia oncoprotein SCL/tal-1 is essential for development o f all hematopoietic lineages. Cell 86:47-57.  255.  Robb,L., Elwood,N.J., E l e f a n t y A G . , Kontgen,F., L i , R . , Barnett,L.D., and Begley,C.G. 1996. The sci gene product is required for the generation o f all hematopoietic lineages in the adult mouse. EMBOJ.  73  15:4123-4129.  256. D'Souza,S.L., Elefanty,A.G., and Keller,G. 2005. SCL/Tal-1 is essential for hematopoietic commitment o f the hemangioblast but not for its development. Blood 105:3862-3870.  257. D o o l e y , K . A . , Davidson,A.J., and Zon,L.I. 2005. Zebrafish sci functions independently in hematopoietic and endothelial development. Dev.Biol. 277:522-536.  258. M i k k o l a , H . K . , Klintman,J., Y a n g , H . , H o c k , H . , Schlaeger,T.M., Fujiwara,Y., and Orkin,S.H. 2003. Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence o f stem-cell leukaemia SCL/tal-1 gene. Nature 421:547551.  259. H a l l , M . A . , Curtis,D.J., Metcalf,D., Elefanty,A.G., Sourris,K., Robb,L., Gothert,J.R., Jane,S.M., and Begley,C.G. 2003. The critical regulator o f embryonic hematopoiesis, S C L , is vital i n the adult for megakaryopoiesis, erythropoiesis, and lineage choice in C F U - S 12. Proc.Natl.Acad.Sci. U.S.A 100:992-997.  260. Curtis,D.J., H a l l , M . A . , V a n Stekelenburg,L.J., Robb,L., Jane.S.M., and Begley,C.G. 2004. S C L is required for normal function o f short-term repopulating hematopoietic stem cells. Blood 103:3342-3348.  261.  Kunisato,A., Chiba,S., Saito,T., Kumano,K., Nakagami-Yamaguchi,E., Yamaguchi,T., and H i r a i , H . 2004. Stem cell leukemia protein directs hematopoietic stem cell fate. Blood 103:3336-3341.  262. Orlando, V . 2003. Polycomb, epigenomes, and control o f cell identity. Cell 112:599606.  74  263. Valk-Lingbeek,M.E., Bruggeman,S.W., and van Lohuizen,M. 2004. Stem cells and cancer; the polycomb connection. Cell 118:409-418.  264. Lessard,J. and Sauvageau,G. 2003. Bmi-1 determines the proliferative capacity o f normal and leukaemic stem cells. Nature 423:255-260.  265. P a r k J . K . , Qian,D., K i e l , M . , Becker,M.W., Pihalja,M., WeissmanJ.L., Morrison.S.J., and Clarke,M.F. 2003. Bmi-1 is required for maintenance o f adult self-renewing haematopoietic stem cells. Nature 423:302-305.  266. B r o u d y , V . C . 1997. Stem cell factor and hematopoiesis. Blood 90:1345-1364.  267. Wypych,J., Bennett.L.G., Schwartz,M.G., Clogston,C.L., L u , H . S . , B r o u d y , V . C , Bartley,T.D., Parker,V.P., and Langley,K.E. 1995. Soluble kit receptor in human serum. Blood 85:66-73.  268. Z s e b o , K . M . , W y p y c h J . , M c N i e c e J . K . , L u , H . S . , Smith,K.A., Karkare,S.B., Sachdev,R.K., Yuschenkoff,V.N., Birkett,N.C., Williams,L.R. etal. 1990. Identification, purification, and biological characterization o f hematopoietic stem cell factor from buffalo rat liver—conditioned medium. Cell 63:195-201.  269. Linnekin,D. 1999. Early signaling pathways activated by c-Kit i n hematopoietic cells.  Int.J.Biochem. Cell Biol. 31:1053-1074.  270. Vosseller,K., Stella,G., Yee,N.S., and Besmer,P. 1997. c-kit receptor signaling through its phosphatidylinositide-3'-kinase-binding site and protein kinase C : role in mast cell enhancement o f degranulation, adhesion, and membrane ruffling. Mol.Biol.Cell 922.  75  8:909-  271. Timokhina,L, Kissel,H., Stella,G., and Besmer,P. 1998. K i t signaling through PI 3kinase and Src kinase pathways: an essential role for R a c l and J N K activation in mast cell proliferation. EMBOJ. 17:6250-6262.  272. JhunJB.H., Rivnay,B., Price,D., and Avraham,H. 1995. The M A T K tyrosine kinase interacts in a specific and SH2-dependent manner with c-Kit. J.Biol.Chem. 270:96619666.  273. D e b e r r y , C , Mou,S., and Linnekin,D. 1997. Statl associates with c-kit and is activated in response to stem cell factor. Biochem.J. 327 ( P t l):73-80.  274. Gotoh,A., Takahira,H., M a n t e l , C , Litz-Jackson,S., Boswell,H.S., and Broxmeyer,H.E. 1996. Steel factor induces serine phosphorylation o f Stat3 in human growth factordependent myeloid cell lines. Blood 88:138-145.  275. R y a n J . J . , Huang,H., McReynolds,L.J., Shelburne,C., H u - L i , J . , Huff,T.F., and Paul,W.E. 1997. Stem cell factor activates S T A T - 5 D N A binding in IL-3-derived bone marrow mast cells. Exp.Hematol. 25:357-362.  276. A l a i , M . , M u i , A . L . , Cutler,R.L., Bustelo,X.R., Barbacid,M., and Krystal,G. 1992. Steel factor stimulates the tyrosine phosphorylation o f the proto-oncogene product, p95vav, in human hemopoietic cells. J.Biol.Chem. 267:18021-18025.  277.  Weiler,S.R., Mou,S., DeBerry.C.S., K e l l e r J . R . , Ruscetti,F.W., Ferris,D.K., Longo,D.L., and Linnekin,D. 1996. J A K 2 is associated with the c-kit proto-oncogene product and is phosphorylated in response to stem cell factor. Blood 87:3688-3693.  76  278. Carpino,N., Wisniewski,D., Strife,A., Marshak,D., Kobayashi,R., Stillman,B-, and Clarkson,B- 1997. p62(dok): a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells.  279.  Cell 88:197-204.  Tang,B-, M a n o , H . , Y i , T . , and Ihle,J.N. 1994. Tec kinase associates with c-kit and is tyrosine phosphorylated and activated following stem cell factor binding.  Mol. Cell  Biol. 14:8432-8437.  280.  Williams,D.E., de Vries,P., Namen,A.E., Widmer,M.B., and Lyman,S.D. 1992. The Steel factor.  281.  Dev.Biol. 151:368-376.  M c C u l l o c h , E . A . , Siminovitch.L., and T i l l , J . E . 1964. S P L E E N - C O L O N Y F O R M A T I O N IN A N E M I C M I C E OF G E N O T Y P E WW.  282.  Science 144:844-846.  G i l k s , C . B . , Bear,S.E., Grimes,H.L., and Tsichlis,P.N. 1993. Progression o f interleukin2 (IL-2)-dependent rat T cell lymphoma lines to IL-2-independent growth following activation o f a gene (Gfi-1) encoding a novel zinc finger protein.  Mol. Cell Biol.  13:1759-1768.  283.  Zeng,H., Yucel,R., K o s a n , C , Klein-Hitpass,L., and Moroy,T. 2004. Transcription factor G f i l regulates self-renewal and engraftment o f hematopoietic stem cells.  EMBO  J. 23:4116-4125.  284.  Rodel,B-» Tavassoli,K., Karsunky,H., Schmidt,T., Bachmann,M., Schaper,F., Heinrich,P., Shuai,K., Elsasser,H.P., and Moroy.T. 2000. The zinc finger protein Gfi-1 can enhance S T A T 3 signaling by interacting with the S T A T 3 inhibitor P I A S 3 . J. 19:5845-5855.  77  EMBO  285.  H o c k , H . , Hamblen,M.J., R o o k e , H . M . , Traver,D., Bronson,R.T., Cameron,S., and Orkin,S.H. 2003. Intrinsic requirement for zinc finger transcription factor Gfi-1 i n neutrophil differentiation. Immunity. 18:109-120.  286.  Bradford,G.B., Williams,B., Rossi,R., and Bertoncello,I. 1997. Quiescence, cycling, and turnover in the primitive hematopoietic stem cell compartment. Exp.Hematol. 25:445-453.  287.  Cheshier,S.H., Morrison,S.J., L i a o , X . , and WeissmanJ.L. 1999. In vivo proliferation and cell cycle kinetics o f long-term self-renewing hematopoietic stem cells. Proc.Natl.Acad.Sci. U.S.A 96:3120-3125.  288.  Dumont,D.J., Yamaguchi,T.P., Conlon,R.A., Rossant,J., and Breitman,M.L. 1992. tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors. Oncogene 7:1471-1480.  289.  Sato,T.N., Q i n , Y . , K o z a k , C . A . , and A u d u s , K . L . 1993. Tie-1 and tie-2 define another class o f putative receptor tyrosine kinase genes expressed in early embryonic vascular system. Proc.Natl.Acad.Sci.U.S.A  90:9355-9358.  290. Hattori,K., Dias,S., Heissig.B., Hackett.N.R., Lyden,D., Tateno,M., H i c k l i n , D . J . , Zhu,Z., Witte,L., Crystal,R.G. et al. 2001. Vascular endothelial growth factor and angiopoietin-1 stimulate postnatal hematopoiesis by recruitment o f vasculogenic and hematopoietic stem cells. J.Exp.Med. 193:1005-1014.  78  291. Takakura,N., Huang,X.L., Naruse,!., Hamaguchi,!, Dumont,D.J., Yancopoulos,G.D., and Suda,T. 1998. Critical role o f the TIE2 endothelial cell receptor in the development of definitive hematopoiesis. Immunity. 9:677-686.  292. Arai,F., Ohneda,0., M i y a m o t o , ! . , Zhang,X.Q., and Suda,T. 2002. Mesenchymal stem cells in perichondrium express activated leukocyte cell adhesion molecule and participate i n bone marrow formation. J. Exp. Med. 195:1549-1563.  293. Arai,F., Hirao,A., Ohmura,M., Sato,H., Matsuoka,S., Takubo,K., Ito,K., K o h , G . Y . , and Suda,T. 2004. Tie2/angiopoietin-l signaling regulates hematopoietic stem cell quiescence i n the bone marrow niche. Cell 118:149-16!  294. Zhang,C.C. and Lodish,H.F. 2004. Insulin-like growth factor 2 expressed in a novel fetal liver cell population is a growth factor for hematopoietic stem cells. Blood 103:2513-252!  295. N i c o l i n i , F . E . , Imren,S., O h , ! H . , Humphries,R.K., Leboulch,P., Fabry,M.E., Nagel,R.L., and Eaves,C.J. 2002. Expression o f a human beta-globin transgene in erythroid cells derived from retrovirally transduced transplantable human fetal liver and cord blood cells. Blood 100:1257-1264.  296. Zandstra,P.W., Conneally,E., P i r e t J . M . , and Eaves,C.J. 1998. Ontogeny-associated changes in the cytokine responses o f primitive human haemopoietic cells. Br. J.Haematol. 101:770-778.  79  CHAPTER 2  HEMATOPOIETIC S T E M C E L L S PROLIFERATE UNTIL AFTER BIRTH AND SHOW A REVERSIBLE PHASE-SPECIFIC ENGRAFTMENT DEFECT  The work presented in this Chapter was accepted for publication in the Journal o f Clinical Investigation. M . B . Bowie, K . D . M c K n i g h t , D . G . Kent, L . McCaffrey, P . A . Hoodless, C . J. Eaves  Kristen M c K n i g h t isolated E l 8.5 fetal bones, David Kent isolated R N A and generated c D N A from my samples, and Lindsay McCaffrey assisted with C R U analysis.  80  INTRODUCTION Hematopoietic stem cells (HSCs) are defined as cells with multi-lineage hematopoietic differentiation potential and sustained self-renewal activity. Operationally, H S C s are detected by their ability to regenerate longterm multi-lineage hematopoiesis in myeloablated recipients. H S C numbers can be quantified by endpoints that measure this regenerative activity i n genetically distinguishable, radio-protected hosts transplanted with limiting numbers o f H S C s (1). H S C s are also characterized by extensive heterogeneity. Variability in many H S C properties is dictated by changes in their state o f activation and the consequent changes in these properties are thus reversible. For example, most o f the H S C s present in normal adult mice are i n a deeply quiescent (Go) state (2-4) and, in association with this status, they express C D 3 8 but not C D 3 4 or M a c l (5;6). These Go H S C s also actively exclude certain fluorescent dyes, such as rhodamine-123 (Rho) (7;8) and Hoechst 33342 (Hst) (9). The latter property underlies the detection o f adult mouse H S C s as "side population" (SP) cells (10). However, when H S C s are activated, they rapidly down-regulate expression o f C D 3 8 (6;11), increase expression o f C D 3 4 (12) and M a c l (13; 14) and acquire a Rho-bright, non-SP phenotype (15). In association with these changes, some o f the H S C s begin to differentiate and hence permanently lose their longterm repopulating activity, but many do not, in spite o f their transiently altered phenotype (16). Another property o f H S C s that appears to vary reversibly is their ability to exit from the circulation into the bone marrow and re-initiate hematopoiesis. Quiescent adult mouse H S C s can execute this process at near unit efficiency in suitably myelosuppressed hosts, as shown by their ability to be detected at purities o f >20% following intravenous injection (15;17;18). However, notable changes in H S C engrafting potential have also been found to accompany the progression o f H S C s through the cell cycle both in vitro and in vivo (3; 19-21). Specifically, H S C activity was not detectable in suspensions o f adult or  81  neonatal hematopoietic cells i n S/G2/M, even when substantial H S C activity could be found i n the corresponding G i cells. The transient nature o f the silencing o f H S C homing activity during the progression o f these cells through S/G2/M is inferred from the fact that the populations studied did not contain Go H S C s , or were expanding their H S C content, although formal documentation o f the re-acquisition o f repopulating activity by incapacitated S/G2/M H S C s was not documented. The molecular mechanisms that control the bone marrow-homing activity o f H S C s are not fully elucidated, although a number o f cell surface ligand-receptor interactions with known involvement i n cell adhesion and chemotaxis have been implicated. These include stromal cell-derived factor-1 (SDF-1 V C X C R 4 , Steel factor (SF)/c-kit, CD44/Hyaluronic acid ( H A ) or osteopontin (OPN), V L A - 4 / V - C A M T and P 2 Y - l i k e receptor and an unknown ligand (22-25). The expression and activity o f some o f these appear to be variably affected by cytokine exposure (26;27); however, their specific involvement in the engraftment defect o f H S C s in S / G / M has remained unclear. 2  In the mouse embryo, pluripotent hematopoietic cells with longterm repopulating ability first appear in the aorta-gonado-mesonephros ( A G M ) region on the 9th day o f gestation (28). These cells then migrate to the fetal liver and later to the bone marrow with continuing expansion o f their numbers until young adulthood is reached (29). Most o f the H S C s in the embryonic day (E) 14.5 liver have phenotypic characteristics o f activated adult H S C s (CD38", M a c l , C D 3 4 , R h o , non-SP) (13;14), as might be expected for an expanding H S C +  +  +  population. The proportion o f H S C s i n the E14.5 fetal liver that are proliferating has been previously estimated from phenotyping studies to be - 4 0 % (3), although a more direct measurement o f this fraction as not been reported. In this study, we sought to investigate the possibility that the H S C S / G / M engraftment 2  defect is constant through ontogeny, while the cycling status o f H S C s is not.  82  A s a first step towards elucidating the mechanisms that regulate changes in H S C turnover and engraftment properties during ontogeny, we designed experiments to assess their proliferative status in mice at different stages o f development. Our results show that the entire H S C population remains in cycle until the 3rd week after birth regardless o f the tissue in which the H S C s are located. Then within a week, the majority o f the H S C s switch abruptly from an actively dividing to a quiescent state. Until this switch occurs, those H S C s that are i n S/G2/M show the same engrafting defect previously demonstrated for adult H S C s that have been stimulated to divide. Interestingly, prior to the establishment o f a quiescent H S C population, the H S C s in S/G2/M were found to express higher levels o f SDF-1 than those in G i and their defective engrafting activity could be completely reversed, either by holding them ex vivo for a few hours until they re-entered G i , or by pre-treating the host with a specific antagonist o f stromal cell-derived factor-1 (SDF-1).  RESULTS AU HSCs in the E14.5 fetal liver are rapidly proliferating To measure the proportion o f H S C s that are in cycle in the E l 4 . 5 fetal liver, we used 3 complementary strategies. In the first, we injected pregnant mice on E l 3 . 5 with 100 mg/kg o f 5-fluorouracil (5-FU) and then removed the fetuses 16 hours later, prepared cell suspensions from the fetal livers and measured the number o f H S C s present using a limiting dilution transplantation assay for longterm (16-week) competitive repopulating units ( C R U s ) (1). In these experiments, we detected very few C R U s in the fetal livers o f the 5-FU-treated embryos (Figure 2.1 A , left panel, 3 experiments). A comparison o f the yields o f C R U s from the 5 - F U treated fetal livers with the control fetal livers from pregnant mice injected on E l 3 . 5 with  83  phosphate buffered saline (PBS) indicated that the 5 - F U treatment had reduced the expected C R U population in vivo by more than 1000-fold. We then assessed the cycling status o f H S C s in the E l 4 . 5 fetal liver by measuring the proportion o f C R U s that survived a 16-hour exposure to high-specific activity H-thymidine 3  ( H-Tdr) (30). Sixteen hours was anticipated to be sufficient to allow all cycling H S C s to 3  enter S-phase, as confirmed later (see below), with minimal exit o f any quiescent cells from Go (31), as demonstrated for adult bone marrow H S C s , most o f which are i n Go (Figure 2.1 A , right panel). For these experiments, the T e r l 19 (erythroid) cells were first removed from the +  fetal liver cells to give a 10-fold enrichment in H S C content and the cells were then incubated i n a serum-free medium supplemented with 50 ng/ml SF only. This growth factor condition was chosen based on other data demonstrating that freshly isolated E14.5 fetal liver C R U s are maintained at input numbers for 16 hours under these conditions (Chapter 4). The results o f the H - T d r suicide experiments showed that this treatment reduced the number o f C R U s in the 3  suspensions o f E14.5 fetal liver cells more than 100-fold (P<.001, Figure 2.1A, middle panel), whereas the same treatment had no significant effect on the recovery o f C R U s in similarly treated lineage-marker-negative (lin") bone marrow cells from young adult (10 week-old) mice by comparison to either control cells (incubated without H - T d r , Figure 2.1 A , right panel, 3  P=0.17) or the starting values (data not shown). We then assessed the distribution o f C R U s between the Go and G1/S/G2/M fractions o f E14.5 T e r l 19" fetal liver cells. These subsets were isolated by fluorescence activated cell sorting ( F A C S ) on the basis o f their staining with Hst and pyronin Y (Py) (32). A representative F A C S profile o f the Hst and Py-stained cells is shown in Figure 2.2A. The combined results o f in vivo assays o f the sorted cells from 4 independent experiments are shown in the left part o f Figure 2.3. These indicate that all o f the transplantable C R U activity  84  was confined to the G1/S/G2/M fraction. Based on the total number o f Go cells assayed, the proportion o f quiescent H S C s could be estimated to be less than 0.02%.  HSCs undergo a complete and abrupt change in cycling activity between 3 and 4 weeks after birth Since H S C s are known to be present in the bone marrow o f mice at later times o f gestation, it was o f interest to investigate whether H S C s first become quiescent in the fetus at that site. T o address this question, we used the 16-hour H - T d r suicide assay to determine the cycling 3  status o f the C R U s present in the bone marrow o f mice at E l 8.5. For comparison, we also evaluated the cycling status o f C R U s in the E l 8.5 fetal liver. The frequency o f C R U s i n these 2 tissues was 1 per 1 0 a n d 1 per 7 x 10 total nucleated cells (Supplementary Table 1); i.e., ~5 5  4  and 3.5-fold lower than in adult bone marrow (1 per 2 x 10 total nucleated cells (33)), and 6 4  and 4-fold lower than in the E14.5 fetal liver (1 per 1.7 x 10 total nucleated cells (33)). After 4  overnight exposure to high-specific activity H - T d r , no C R U s could be detected i n the 3  suspensions o f either the E l 8.5 fetal bone marrow cells or the E l 8.5 fetal liver cells, in contrast to the control cells incubated i n the same medium without H-Tdr (Figure 2.1B). Thus all H S C s i n the fetus, irrespective o f their location, appear to be rapidly proliferating. To further investigate the pace and timing of the transition o f H S C s into a largely quiescent population, we analyzed the cycling status o f C R U s i n lin" bone marrow cell suspensions from 3 and 4 week-old (weanling) mice. In initial experiments, the frequencies o f C R U s in the lin" bone marrow cells obtained from the 3 and 4 week-old mice were found to be the same (1 per 6.5 x 10 and 1 per 6.3 x 10 lin" cells; Supplementary Table 2) and ~2-fold 3  3  lower than in the lin' bone marrow cells from 10 week-old (young adult) mice (1 per 2.9 x 10 lin" cells). Bone marrow cells from 3 and 4 week-old mice were then fractionated by F A C S  85  3  into their component Go and G]/S/G2/M subsets based on the gates shown in the left panels o f Figure 2.2B and 2.2C, and the sorted Go and G1/S/G2/M cells were assayed separately for C R U activity. Re-analysis o f the sorted Go and G i / S / G / M fractions after staining for K i 6 7 2  confirmed that the cells expressing this proliferation marker were confined to those we had designated as G1/S/G2/M (see representative profiles in the right panels o f Figure 2.2B). Remarkably, the results o f the in vivo assays showed that all o f the C R U s detected in the bone marrow o f 3 week-old mice were also confined to the G1/S/G2/M fraction, whereas >98% o f the C R U s i n the bone marrow o f 4 week-old mice were found in the Go fraction (Figure 2.3). Thus, there is a rapid down-regulation o f C R U proliferative activity in the bone marrow o f mice between 3 and 4 weeks o f age with little change in C R U numbers.  HSCs in S/G2/M show a specific and reversible engraftment defect regardless of their developmental origin or route of injection into assay recipients G i v e n the previously reported engraftment defect o f adult H S C s stimulated to enter S/G2/M (19), it was o f interest to determine whether the number o f proliferating H S C s present early i n development might be routinely underestimated due an inability o f those i n S/G2/M to be detected. T o investigate this possibility, the G1/S/G2/M population o f E14.5 T e r l 19" fetal liver cells was subdivided into its component G i and S/G2/M fractions and then each o f these 2 subsets was assayed separately for C R U s . In this case, the gate settings chosen to separate the G i (2n D N A ) and S-phase cells (>2n D N A ) were validated by the profiles obtained when the sorted cells were stained with propidium iodide (PI) and reanalyzed by F A C S (Figure 2.4A, left panel). A l l C R U activity detectable in the G1/S/G2/M fraction o f T e r l 19" E14.5 fetal liver cells was confined to the G i subset (left bars i n Figure 2.4B and control values i n the left side o f  86  Figure 2.5A). Similar experiments performed with lin" bone marrow cells from 3 week-old mice showed that the C R U s in the G1/S/G2/M population from this source were likewise confined to the G i fraction (control values in the right side o f Figure 2.5 A and data not shown). It is o f interest to note that the S/G2/M defect was specific to repopulating cells able to produce progeny i n all lineages for at least 16 weeks. In contrast, cells with short term repopulating activity (8 weeks) were readily detected in the S / G / M fraction as well as in the 2  G i fraction, thus confirming the restriction o f this cell-cycle-dependent engrafting defect to cells with sustained multi-lineage repopulating activity (34;35). To determine whether the apparent engraftment defect o f proliferating C R U s was reversible, we first assayed the C R U content o f aliquots o f the same isolated G i and S/G2/M cells after they had been incubated for 6 hours at 37°C in serum-free medium containing 50 ng/ml o f SF. During this time, many o f the G i cells progressed into S/G2/M and many o f the S/G2/M cells moved into G i , as seen by their altered PI (Figure 2.4A, right panel) or Hst (data not shown) staining profiles. In vivo assays showed that C R U activity reappeared when the S/G2/M cells were cultured for 6 hours, whereas the C R U activity originally present in the G i cells was partially lost (middle and left bars o f Figure 2.4B). W e next asked whether the inability o f intravenously transplanted C R U s i n S/G2/M to engraft recipient mice might be overcome by injecting the cells directly into the femoral bone marrow space. However, intrafemoral injection did not enable any C R U s i n this subset o f T e r l 19" E l 4 . 5 fetal liver cells to be detected (Figure 2.4B) even though the frequency of C R U s measured i n the corresponding G i E l 4 . 5 fetal liver cells after intrafemoral injection was the same as when the latter were transplanted intravenously (1 per 3.6 x 10 cells versus 1 per 3  3.8 x 10 cells). 3  87  The S/G2/M engraftment defect of HSCs can be overcome by pretreatment of the host with a SDF-1 antagonist Previous reports have shown that SDF-1 can promote both the mobilization (36) and the homing (37-39) o f H S C s . However, the mobilization o f primitive hematopoietic cells can also be stimulated by blocking SDF-1 / C X C R 4 signaling, as achieved by i n vivo administration o f A M D 3 1 0 0 , a SDF-1 antagonist (40). In addition, it has recently been shown that i n vivo administration o f A M D 3 1 0 0 can increase the competitive engrafting ability o f transplanted marrow cells in unirradiated hosts (41). These suggested that targeting the S D F - 1 / C X C R 4 pathway might also influence the variable engraftment properties o f cycling H S C s , either by influencing the H S C s themselves or the transplanted host. To investigate these alternatives, we asked whether either pretreating the hosts or the cycling H S C s to be transplanted with a specific antagonist o f SDF-1 might alter the level o f repopulation obtained 16 weeks later. The SDF-1 antagonist used i n these experiments was SDF-1 G2 (also called P 2 G because it is identical to SDF-1 except that the proline at position 2 has been converted to glycine (42)). SDF-1 G 2 is thus structurally quite different from A M D 3 1 0 0 but similar i n its ability to block SDF-1 from binding to C X C R 4 without activating C X C R 4 (42;43). SDF-1 G 2 also shares with A M D 3 1 0 0 an ability to elicit effects on primitive hematopoietic cells both i n vitro and i n v i v o (44). When mice were injected with 10 pg o f SDF-1 G2 (or P B S ) 2 hours prior to the transplantation o f FACS-sorted Gj or S/G2/M cells and then analyzed for the presence o f donor-derived blood cells 16 weeks later, the results for E l 4 . 5 fetal liver and 3-week mouse bone marrow cells were similar (Figure 2.5A). Treatment of recipients with SDF-1 G2 had no effect on the repopulating activity o f C R U s i n G i . In contrast, SDF-1 G 2 pretreatment o f recipients o f S/G2/M cells enabled long-term multi-lineage repopulation to be readily detected (7 and 4 o f 10 mice transplanted with fetal liver and 3-week bone marrow S/G2/M cells,  88  respectively, vs. 0 o f 10 in both sets o f controls injected with P B S , i n a total of 3 experiments). Moreover, the SDF-1 G2 pretreated hosts showed levels o f repopulation by both sources of S/G2/M cells that were indistinguishable from those seen i n mice transplanted with G j cells (Figure 2.6). O n the other hand, i f the SDF-1 G2 treatment was applied directly to the cells to be transplanted for 30 minutes before they were injected, no difference in the engrafting activity o f the transplanted G i or S/G2/M cells was seen by comparison to untreated controls over a wide range o f SDF-1 G2 and SDF-1 concentrations tested, either with or without added S F (Figure 2.5B).  HSCs in S/G2/M express higher levels of SDF-1 transcripts than HSCs in Gi T o begin to understand the mechanism behind the observed H S C S/G2/M engraftment defect and how it might be overcome by SDF-1 G 2 pre-treatment of the host, we isolated highly purified populations o f H S C s from E l 4 . 5 fetal livers and from the bone marrow o f 3 week-old mice (lin" S c a - 1 C D 4 3 M a c l cells representing - 2 0 % pure H S C s , Bowie, M B and Eaves, +  +  +  C J , manuscript in preparation) and sorted these into their corresponding Go/Gi and S/G2/M fractions as revealed by Hst staining. Aliquots o f from - 2 0 0 to 800 cells were collected from each fraction i n 3 independent sorting experiments and transcript levels for Gapdh, c-Kit, cmpl, CD44, a4-integrin (a4int), VCAM-1, CXCR4 and SDF-1 were measured by quantitative real-time analysis o f the c D N A s prepared from the isolated R N A extracts, as described in the Methods. Transcripts for all o f these genes were consistently detected i n both the Go/Gj and S/G2/M fractions o f the highly purified suspensions o f H S C s cell populations from fetal liver and 3 week bone marrow, including SDF-1, which had not previously been shown to be expressed by H S C s (Figure 2.7). Interestingly, SDF-1 was also the only one o f the genes  89  assessed that was found to be expressed at significantly different levels i n Go/Gi and S/G2/M H S C s (9-fold higher in the latter, P<.05).  DISCUSSION This study presents 2 new and clinically relevant features o f H S C regulation. The first is the unanticipated sudden and complete change in H S C proliferative activity that occurs in juvenile mice between 3 and 4 weeks o f age. Both the abruptness and the reproducibility o f this change suggest an underlying mechanism that is tightly controlled and broadly active. It is notable that this change was not linked to the migration o f H S C s during late embryogenesis from the microenvironment o f the fetal liver to that o f the bone marrow, but rather, was strictly associated with the developmental status o f the donor. Thus, although differences between bone marrow and fetal liver niches and stromal cells have been sought and described (45-48), these differences do not appear to directly determine the cycling activity o f the H S C s they are thought to regulate. The present data are more consistent with a model in which the mechanism o f H S C cycling control in vivo is indirectly controlled by external cues, perhaps v i a changing stimulation o f the stromal cells that then alter the signals they deliver, as suggested by studies o f the longterm marrow culture system (44;49) and o f elements o f the bone marrow microenvironment in vivo (25). However, internally programmed changes in H S C responsiveness to external factors could also contribute to a developmentally controlled alteration i n H S C cycling activity. In humans, an abrupt change in H S C proliferative activity at an analogous point in development (2-4 years) has been inferred from measurements o f the rate o f decline in telomere length o f circulating leukocytes (50). This suggests that the mechanisms involved i n regulating H S C proliferative activity during ontogeny may be preserved across these species  90  and the mouse w i l l be a relevant model for their future elucidation. It is interesting to note that, i n the mouse, a number o f other changes in hematopoietic cell properties or output parameters have already been found to change during ontogeny i n concert with this transition of the H S C compartment from a predominantly cycling to a predominantly quiescent population. These changes include the initial acquisition o f an SP and R h o " phenotype by du  H S C s (15), and the completion o f appearance and rapid cycling o f adult-type (Ly49 ) natural +  killer cells and peripheral T-cells (51;52). M a n y other differences in the properties o f fetal and adult H S C s and the programs they dictate have also been described (13;53;54). It w i l l clearly be o f interest to determine the extent to which these may be programmatically linked to the mechanisms that precipitate the change in H S C cycling that occurs in mice between 3 and 4 weeks o f age. Several genes have been implicated i n the differential control o f H S C behavior at different stages o f development. These include genes encoding various transcription factors, i.e., Runxl (55), Notch (56), Sci (57), bmil (58;59) and Gfi-1 (60;61), as well as the growth factor receptors, c-Kit (62;63) and Tie2 (64). Further delineation o f the molecular basis o f the unique programs operative i n fetal H S C s and how these regulate fetal H S C s cycling are o f major interest as this information could provide new strategies for expanding H S C s and offer potential insights into mechanisms o f leukemogenesis. The second significant set o f findings emanating from our studies are the universality and pronounced extent o f the engraftment defect found to characterize cycling H S C s in the S/G2/M phases o f the cell cycle, the specificity o f this effect for hematopoietic cells with prolonged versus short term repopulating activity, and the reversibility o f this defect either following their progression into G i , or by pre-treating the host with a specific antagonist o f S D F - 1 . Interestingly, the corrective effect o f i n vivo administered SDF-1 G2 could not be  91  replicated by treatment o f the cells with this agent prior to injection. The i n vivo effect o f SDF-1 G 2 could also not be mimicked by intrafemoral injection o f the test cells. The inability o f intrafemoral injection to overcome the defective engraftment o f H S C s i n S/G2/M suggests that this defect is likely mediated by events that affect the transplanted H S C s after they have entered the bone marrow environment. Quantitative analysis o f the level o f expression o f 7 candidate genes in the G i and S/G2/M subsets o f purified cycling H S C s from both fetal liver and 3 week bone marrow sources confirmed the expected expression o f c-Kit, c-mpl, CD44, a4int, VCAM-1 and CXCR4 and further revealed that these cells also all contain SDF-1 transcripts. Moreover, although the transcript levels were not different between the G i and S/G2/M fractions for c-Kit, c-mpl, CD44, a4int, VCAM-1 and CXCR4, a 9-fold increase in SDF-1 expression was noted in the S/G2/M H S C s . Previous work has suggested that the ability o f transplanted H S C s to reach a niche within the bone marrow that can support their self-maintenance may depend on the strength o f the SDF-1 gradient they encounter within the bone marrow space causing them to migrate towards the osteoblasts that line the bone (22). According to such a model, the ability o f H S C s to express varying levels o f SDF-1 in the absence o f changes in their expression o f C X C R 4 , might be anticipated to regulate their ability to respond to other more distal sources o f S D F - 1 . Up-regulated expression o f SDF-1 during the progression o f H S C s through S/G2/M, as demonstrated here, might then be sufficient to interfere with an appropriate intrabone marrow migratory response resulting i n the rapid differentiation, death or irreversible sequestration o f these cells in a site where they could not be stimulated to divide. Timed blockade o f C X C R 4 on cells within the bone marrow by injected SDF-1 G 2 might then be envisaged to increase in the level o f intra-marrow SDF-1 to a point that transiently restores an effective chemoattractant gradient for the otherwise insensitive H S C s i n S/G2/M. Such a  92  possibility has, in fact, recently been modeled in the zebrafish, where overexpression of SDF-1 in the germ cells was found to prevent the normal migration o f these cells towards endogenous SDF-1 signals (65). In the hematopoietic system, it is interesting to note that longterm repopulating SDF-1' '' H S C s could engraft irradiated hosts whereas only short term repopulation was obtained from CXCR4' ' cells (66;67). In addition, as would be predicted from the explanation we have 1  advanced, forced overexpression o f C X C R 4 in retrovirally-transduced (i.e. proliferating) human H S C s was able to enhance the in vivo engrafting activity o f these cells (68) and, conversely, treatment with antibodies to C X C R 4 had the opposite effect (69). However, S D F 1 levels in the bone marrow are also subject to regulation, for example, as occurs following the administration o f granulocyte colony-stimulating factor ( G - C S F ) (70). Recently, Chen et al. (41) found that administration o f A M D 3 1 0 0 pre-transplant can produce a modest improvement in the engraftment o f quiescent adult bone marrow H S C s transplanted into non-irradiated hosts. The.mechanism proposed was that the injected A M D 3 1 0 0 initiated the mobilization o f endogenous H S C s within the marrow thereby improving the ability o f the incoming transplanted H S C s to compete for niche occupancy. The studies o f Chen et al thus differed in several respects from those described here where we have observed an enhanced engraftment by H S C s that was more marked and exclusive to H S C s that were i n S/G2/M at the time o f injection. Therefore, it seems unlikely that the mechanisms responsible for the enhanced engraftment seen in both experimental models are similar, in spite o f the fact that they are both mediated by treatment o f the host with an SDF-1 antagonist. The fact that proliferating human H S C s show the same engraftment defect when they transit S/G2/M is noteworthy (20) and underscores the clinical implications o f these findings.  93  For example, our results predict that intrafemoral injection of transplants is unlikely to be a useful strategy for improving the therapeutic effectiveness of H S C s induced to expand in vitro. To date, interference o f SDF-1 action by specific C X C R 4 inhibitors has been used primarily for enhancing the yield o f H S C s from donors for transplantation into myeloablated patients (71;72). Another application o f such inhibitors suggested by the findings reported here could be to treat recipients o f transplants o f cycling cells. Thus significant benefit might also be derived by pretreatment o f the host, particularly when transplants o f genetically modified or cultured cells are to be administered since half o f the H S C s in an asynchronously dividing population would be expected to be i n S/G2/M.  MATERIALS AND METHODS Mice. Ly5-congenic strains o f C57B1/6 mice were used as donors and recipients. A l l recipients were also homozygous for the W  41  allele. M i c e were bred and maintained in  microisolators with sterile food, water and bedding at the B C Cancer Research Centre according to protocols approved by the University o f British Columbia A n i m a l Care Committee.  Cells. Single cell suspensions were prepared in Hank's balanced salt solution containing 2 % fetal calf serum ( F C S ) (HF/2, StemCell Technologies). Enriched populations o f H S C s were obtained by immunomagnetic removal o f T e r l 19 or l i n cells from fetal liver and bone +  +  marrow cell suspensions, respectively (using E a s y S e p ™ , StemCell Technologies). Antibodies used for isolation o f lin" cells between 4 and to 10 weeks o f age were anti-B220, T e r l 19, antiG r l , a n t i - L y l and anti-Macl (StemCell Technologies). To isolate lin" cells from 3 week-old  94  mice, the M a c l antibody was omitted because M a c l was known to be expressed on fetal and cycling H S C s (13;14;73).  Tritiated H-Tdr 3  suicide assay. Cells were suspended at 10 /ml in Iscove's medium 6  containing 5 x 10" mol/12-mercaptoethanol, a serum substitute ( B I T ™ , StemCell 5  Technologies) and 50ng/ml murine SF (StemCell Technologies). Equal volumes were then incubated at 37°C, in 5% CO2 in air for 16 hours in 35 mm petri dishes in the presence or absence o f 20 u C i / m l o f H - T d r (25 uCi/mmol; Amersham). The cells were then harvested, 3  washed twice with Iscove's medium containing 2 % F C S and limiting dilution C R U assays performed.  FACS isolation and analysis of cells in different cell cycle phases. Cells were suspended in H F / 2 containing 1 pg/ml Hst (Molecular Probes/Invitrogen) either 10 pmol/1 fumitremorgin C (a gift from D r . Susan Bates, N I H , Bethesda, M D ) or 50 pmol/1 reserpine (Sigma Chemicals) and then incubated at 37°C for 45 minutes. P y r o n i n Y (Py; Sigma) was added at 1 pg/ml and the cells incubated for another 45 minutes at 37°C. Cells were washed twice in HF/2 with 1 pg/ml PI (Sigma) i n the second wash and were finally resuspended in H F / 2 with PI and kept on ice in the dark until being sorted (PT cells only) on a 3 laser F A C S Vantage (Becton Dickinson). For analysis o f D N A content, cells were either re-stained with Hst only using the same protocol, or with PI at least 1 hour after storage at 4°C o f cells that had been washed twice i n ice-cold P B S with 0.1% glucose and fixed in 1 m l o f ice-cold 70% ethanol. To stain the cells with PI, cells were washed twice with 2% P B S and resuspended in P B S with 0.1% glucose, 5 pg/ml PI and 200 ug/mL R N A s e A . Cells were then incubated for at least 1 hour at 4°C and then analyzed directly on a F A C S C a l i b u r (Becton Dickinson). To stain sorted cells  95  for K i 6 7 , the cells were washed and resuspended i n 50 ul o f ice-cold 80% ethanol and then incubated at -20° C for at least 2 hours. The fixed cells were washed twice in 300 ul of P B S with 1% F C S and 0.09% N a N 3 (pH=7.2). Fluorescein isothiocyanate (FITC)-conjugated antihuman K i 6 7 antibody (Becton Dickinson) was then added and the cells incubated for 30 minutes at room temperature i n the dark. Cells were then analyzed by F A C S , using cell stained with a FITC-conjugated mouse IgGi (Becton Dickinson) as a control.  In vitro treatment ofS/G2/MHSCs.  Sorted cells were incubated at 37°C in 5% CO2 in air in  the wells o f a round-bottom 96-well plate i n serum-free media (as for the H-Tdr suicide assays) with one o f the following 6 additions: 100 ng/ml SDF-1 (a gift from I. Clark-Lewis, Biomedical Research Centre, University o f British Columbia, Vancouver, B C , Canada) or 300 ng/ml SDF-1 G 2 but no S F , or 50 ng/ml S F alone, or 50 ng/ml SF plus 100 ng/ml SDF-1 or 300 ng/ml SDF-1 or 300 ng/ml S D F - 1 G 2 . Cells were then harvested from the wells and equal aliquots injected into recipient mice such that each mouse received the equivalent o f either 4 x 10 starting G i cells or 1.2 x 10 starting S / G / M cells. 3  4  2  CRU assay. Recipient (W /^ ) 41  1  mice were sublethally irradiated with either 400 cGy of  1 3 7  Cs  y-rays or 360 c G y o f 250 k V p X-rays and then injected intravenously with the test cells except when injected intrafemorally as indicated. Intrafemoral injections were performed as described (74). C R U s were identified by their ability to have generated >1% donor Ly5-type blood cells including L y l  +  (T-cell), B 2 2 0 (B-cell) and G r l / M a c l +  +  (granulocyte/monocyte)  subsets that could be detected >16 weeks after transplantation (75). C R U frequencies were calculated using the L-calc program (StemCell Technologies) from the proportions o f mice that were negative for this endpoint. Recipients treated with SDF-1 G 2 (a gift from I. Clark-  96  Lewis) were injected intravenously with 10 |xg per mouse o f SDF-1 G 2 dissolved in P B S 2 hours after being irradiated and were then transplanted another 2 hours later. This schedule was used i n an attempt to minimize direct interaction o f the injected H S C s with SDF-1 G 2 i n the circulation (based on the likely rapid clearance o f SDF-1 G2) and maximize any potential effect on the host by keeping the interval between injecting the SDF-1 G 2 and the transplant as short as possible. Controls were injected with P B S instead o f the SDF-1 G2.  Real-time PCR. Cells were sorted into 1 m l H F / 1 0 and R N A was isolated using the P i c o P u r e ™ R N A Isolation K i t (Arcturus Biosciences Inc.) as recommended by the supplier including a 15 minute D N A s e l treatment (Qiagen) on the column at room temperature. R N A was eluted into an 11 ul volume and stored at -80°C. A c D N A preparation was then generated using the S u p e r s c r i p t ™ III First-Strand Synthesis System for R T - P C R (18080093, Invitrogen) again as recommended by the manufacturer, with the reaction scaled up to use 25ul. Quantitative real-time P C R was performed using the following primer pairs (5' to 3'): a4int (NM_010576.2) forward primer A G G A C A C A C C A G G C A T T C A T , reverse primer C C T C A G T G T T T C G T T T G G T G ; CD44 (NM_009851.1) forward primer C T T T A T C C G G A G C A C C T T G G C C A C C , reverse primer G T C A C A G T G C G G G A A C T C C ; cKit (NM_021099.2) forward primer A C A A G A G G A G A T C C G C A A G A , reverse primer G A A G C T C A G C A A A T C A T C C A G ; c-mpl (NM_010823.1) forward pimer A G T G G C A G C A C C A G T C A T C T , reverse primer G A G A T G G C T C C A G C A C C T T ; GXCR4 (NM_009911.2) forward primer C G G A G T C A G A A T C C T C C A G T , reverse primer C T G G T C A G T C T C T T A T A T C T G G A A A A ; Gapdh (NM_008084) forward primer A A C T T T G G C A T T G T G G A A G G , reverse primer A T G C A G G G A T G A T G T T C T G G ; SDF-1 (NM_001012477) forward primer G A G C C A A C G T C A A G C A T C T G , reverse primer  97  CGGGTCAATGCACACTTGTC;  VCAM-1 (NM_011693.2) forward primer  T G A T T G G G A G A G A C A A A G C A , reverse primer A A C A A C C G A A T C C C C A A C T T . The relative expression changes were determined with the 2 "  A A C T  method (76), and the  housekeeping glyceraldehyde-3-phosphate dehydrogenase (Gapdh) gene transcript was used to normalize the results.  Statistical analyses. Comparisons were made using the W a l d test.  98  25  CM  o  20 15  0)  o. 10  on o  5  E14.5 F L 5-FU  E14.5 F L H-Tdr  Wk 10 BM ^H-Tdr  3  a>  I  100  3  H-Tdr 1  > a  10  o a> $ c a> E18.5 F B M 3H-Tdr  Figure 2.1:  Control  1 1  — i — i — i — i — i  1  <D Q.  2  3  4  5  6  No. cells injected (x10 ) 5  E18.5 FL 3H-Tdr  A l l fetal H S C s are sensitive to cell cycle-specific drugs.  C e l l s from different mouse embryonic tissues were analyzed for C R U content either 16 hours after injection o f the pregnant mother with 100 mg/kg 5 - F U (or P B S ) , or after i n vitro incubation o f the cells for 16 hours with high-specific activity H - T d r (or not). A . The left panel shows the effects o f the 5 - F U injection on E l 4 . 5 fetal liver ( F L ) C R U s , data pooled from 3 independent experiments). The middle panel shows the effects o f H - T d r on E l 4 . 5 F L C R U s and the right panel shows the (lack of) effect o f H - T d r on C R U s from adult (10 weekold) mice assessed in parallel (data pooled from 6 independent experiments). B. The left and right panels show the effects o f H - T d r on E l 8 . 5 fetal bone marrow and F L C R U s (data pooled from 4 and 4 independent experiments, respectively). The middle panel shows the complete data set from the limiting dilution analysis o f the E l 8.5 fetal bone marrow cells. 3  3  3  3  99  B  3 week-old Lin BM  G^S/Gj/M  260  c  200  60%  O 160 >>  100-1  50-1 00  10%  60  100  150  200  260  o f M , l w , r o , , — A 0  200  400  600  800  1000  PI  C  4 week-old Lin- BM  •l  260-  200 .E 160 c  o  >> 100 0. 60  200  400  600  800  1X0  PI  10 week-old Lin- BM 260  •w •  >  0  200-  ^^23%  /  70%  I  150-  mm  100 60-  0  0-  0  60  100  160  200  260  60  Hoechst 33342  100  160  200  260  Hoechst 33342  F i g u r e 2.2: F A C S profiles o f the distribution o f different lin" populations i n G , G i and S/G /M. 0  2  A . The left panel shows a representative F A C S contour plot for E l 4 . 5 T e r l 19" fetal liver ( F L ) cells after staining with Hst and Py. Right panel shows the profile for the same cells after staining for K i 6 7 . B. The left panel shows a representative F A C S contour plot for lin" bone marrow ( B M ) cells from 3 week-old mice after staining the cells with Hst and Py. The middle panel shows the profile for the sorted Go cells after staining for K i 6 7 (>90% o f the Go cells showed no K i 6 7 expression). The right panel shows the profile for the sorted G1/S/G2/M cells after staining for K i 6 7 (>99% of the G i / S / G / M cells expressed Ki67). C . and D. Representative F A C S contour plots for lin" B M cells from 4 week-old and 10 week-old mice after staining the cells with Hst and Py. 2  100  o TJ Q) C O a> a  a  E14.5FL 3 wk BM 4 wk BM 10wkBM o  S  o  o  o  M  cT F i g u r e 2.3: The cycling activity o f C R U s is down-regulated between 3 and 4 weeks o f age. Results shown are the number o f C R U s per 10 initial total viable cells. For each tissue source, the difference i n the yields o f C R U s in the 2 subsets compared was significantly different (P<.001). For fetal liver (FL), these were depleted o f T e r l 19 cells; for the 3 and 4 week-old bone marrow ( B M ) cells, all l i n cells except M a c l cells had been removed and for, the 10 week-old B M cells, all l i n cells including M a c l cells were removed. Values shown are the mean ± S E M from data pooled from at least 3 experiments per tissue. 5  +  +  +  +  +  101  £  O  <? W  §  2  == o  ted S/G  o  35  2  '  2  2  t  CM  S/G /M + 6hrs  S/G /M + 6hrs  1  ted S/G  I  G + 6hrs J-Sorted  (3 O  1  s-Sorted  Before culture  G + 6hrs  Bi  Before culture  Bi  A  a:  o <? a:  Figure 2.4: Hoechst/Pyronin-sorted H S C s display an absolute but transient S/G2/M engraftment defect. A . E l 4 . 5 T e r l 19' fetal liver (FL) cells i n G1/S/G2/M were fractionated into their component G i and S/G2/M subsets, leaving a slight separation between them. Aliquots o f the sorted subsets were then stained with PI (or Hst/Py, data not shown). The sorted cells were cultured for 6 hours and then were stained again with PI. This showed that, during this 6 hour culture period, approximately a third o f the cells originally in Gj had progressed into S/G2/M and a similar proportion o f the cells originally in S/G2/M had progressed into Gj.. B. C R U s per IO initial T e r l 19" F L cells for G i and S/G2/M fractions before and after 6 hours in culture. There was a 3.5-fold loss o f C R U s when G i cells were cultured for 6 hours (P<.01), but no loss when the cultured cells were re-sorted for G i cells (P=.36). Conversely, we detected a >65-fold increase (P<.001) i n the number o f C R U s detected when C R U s in S/G2/M were cultured and a >128-fold increase (P<.00T) when the cultured cells were sorted for Gicells. Values shown are the mean ± S E M o f results from at least 3 experiments. 5  102  A  In vivo treatments  Figure 2.5: The engraftment defect o f H S C s i n S/G2/M is corrected by treatment o f the host, but not the cells, with SDF-1 G 2 . A . Effect o f injecting prospective recipients, 2 hours post-irradiation and 2 hours prior to transplant with 10 ng/ml SDF-1 G2(+) or P B S (-). Starting equivalents o f 4,000 G] cells per recipient mouse or 12,000 S/G2/M cells per recipient mouse were similarly tested. Results show a new ability o f fetal liver (FL) H S C s in S/G2/M and 3 week bone marrow ( B M ) H S C s in S / G / M to engraft only when they are transplanted into SDF-1 G2 treated recipients, whereas treated recipients were no more likely to be engrafted long term by H S C s in G i than were untreated recipients. Results are combined from 3 independent experiments. B. Effect o f in vitro treatment o f sorted T e r l 19' F L cells in G i or S/G2/M for 30 minutes at 37°C in serum-free medium plus various additives, as shown, on C R U detection. When present, S F was used at a concentration o f 50 ng/mL, SDF-1 at either 100 ng/ml or 300ng/m and S D F - 1 G 2 at 300 ng/ml. In vitro treatment had no significant effect on the number o f mice that subsequently showed multi-lineage repopulation from starting cells in either G i or S/G2/M. Results are combined from 3 independent experiments. 2  103  G , cells into SDF-1 G2-treated recipient  A 10" O 10 Q.  3  <  . 10*  44  t  ^^^41  3  10*|  28  17  o (^Hi) Po((, 10 10*  #  12  10"  10°  J  Gr-1/Mac-1 - PE B  10" 10°  10 10 10 B220 - PE 1  2  ;  8  10 10 10 10 Ly1 - PE 1  2  3  4  S/G /M cells into SDF-1 G2-treated recipient 2  10'  27  32  10" 10* 10' 10° 10 10 10 Gr-1/Mac-1 - PE 1  C  2  :  w ft"  10°  B220 - P E  S/G /M cells into PBS-treated recipient 10" i 10"  10 10 10 10 Ly1 - P E 1  2  3  4  2  £10-  10°  < ^10*  -  10*  10" 10° 10 10 10 10 Gr-1/Mac-1 - PE 1  2  3  4  10 10° u  1  ob"  1  10 10 10 10* B220 - PE 1  2  10  3  CO  10"  Figure 2.6:  10"  [Jjfj  10" 10°  10 10 10 10 Ly1 - P E 1  2  3  4  Donor-derived repopulation o f SDF-1 G2-treated mice.  Shown are representative F A C S profiles o f donor-specific cells detected after dual staining for the donor-type L y 5 allotype and various lineage-specific markers. A . Example o f a positively engrafted PBS-treated recipient o f fetal liver ( F L ) cells i n G | . B. Example o f a positively engrafted SDF-lG2-treated recipient o f F L cells in S / G / M . C . Example o f a PBS-treated recipient o f F L cells in S / G / M that does not show donor-derived hematopoiesis. 2  2  104  10 •  CD44  SDF-1  CXCR4  a4-lnt  c-kit  F L G  1  •  FLS/G /M  H  3wkG  •  3 wk S / G / M  2  1  2  c-mpl  VCAM-1  Figure 2.7: Gene expression analysis o f the G i and S / G / M subsets o f highly purified lin" S e a l C D 4 3 M a c l H S C s from fetal liver and 3-week bone marrow. 2  +  +  Gene expression in G i was set equal to 1 and the fold change in transcript levels in the corresponding S / G / M fraction is shown. Results shown are the mean ± S E M o f data from 2-3 biological replicates measured in triplicate. The difference between the level o f SDF-1 transcripts between the 2 pairs o f G i and S / G / M samples is significant, P<.05) 2  2  105  T a b l e 2.1: Limiting dilution data for C R U frequency determinations for E l 8 . 5 fetal liver and bone marrow cells (data pooled from 5 experiments). fetal liver  bone marrow  N o . of cells injected  N o . o f negative mice  N o . o f cells injected  N o . o f negative mice  per mouse ( x l O )  per total mice injected  per mouse ( x l O )  per total mice injected  3  2  2800  1/9  4725  0/4  250  0/6  2800  1/9  80  5/20  2500  0/3  20  11/14  1575  1/4  800  6/12  200  9/15  C R U frequency  1 / 73,000  C R U frequency  (range defined  + 1 / 59,000  (range defined  by±SEM)  -1/91,000  by ± S E M )  106  1 / 95,000 + 1 / 75,400 ,  -1/119.000  T a b l e 2.2.  Limiting dilution data for C R U frequency determinations for l i n bone marrow  cells from 3 and 4 week-old mice (pooled data from 2 experiments). 3-week bone marrow N o . o f cells injected  N o . o f negative mice  N o . o f cells injected  N o . o f negative mice  per mouse (x 10 )  per total mice injected  per mouse (x 10 )  per total mice injected  12  0/3  11  0/3  4  4/6  4  4/6  3  C R U frequency  1  4-week bone marrow  1 / 6,500  3  C R U frequency  1 / 6,300  (range defined  + 1 / 4,000  (range defined  + 1 / 4,000  by±SEM)  -1/10,000  by ± S E M )  - 1 / 10,000  •  .  107  REFERENCES  1. Szilvassy, S.J., Humphries, R.K., Lansdorp, P.M., Eaves, A.C., and Eaves, C.J. 1990. Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc. Natl. Acad. Sci. USA. 87:8736-8740. 2. Harrison, D.E., Astle, C M . , and Lerner, C. 1984. Ultimate erythropoietic repopulating abilities of fetal, young adult, and old adult cells compared using repeated irradiation. J. Exp. Med. 160:759-771. 3. Fleming, W.H., Alpern, E.J., Uchida, N., Ikuta, K., Spangrude, G.J., and Weissman, I.L. 1993. Functional heterogeneity is associated with the cell cycle status of murine hematopoietic stem cells. J. Cell Biol. 122:897-902. 4. Leemhuis, T., Yoder, M.C., Grigsby, S., Aguero, B., Eder, P., and Srour, E.F. 1996. Isolation of primitive human bone marrow hematopoietic progenitor cells using Hoechst 33342 and Rhodamine 123. Exp. Hematol. 24:1215-1224. 5. Osawa, M., Hanada, K., Hamada, H., and Nakauchi, H. 1996. Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell. Science. 273:242-245. 6. Randall, T.D., Lund, F.E., Howard, M.C., and Weissman, I.L. 1996. Expression of murine CD38 defines a population of long-term reconstituting hematopoietic stem cells. Blood. 87:4057-4067.  108  7. Bertoncello, I., Hodgson, G.S., and Bradley, T.R. 1985. Multiparameter analysis of transplantable hemopoietic stem cells: I. The separation and enrichment o f stem cells homing to marrow and spleen on the basis o f rhodamine-123 fluorescence. Exp. Hematol. 13:999-1006.  8. Spangrude, G . J . and Johnson, G . R . 1990. Resting and activated subsets o f mouse multipotent hematopoietic stem cells. Proc. Natl. Acad. Sci. USA. 87:7433-7437.  9. Wolf, N . S . , Kone, A . , Priestley, G . V . , and Bartelmez,S.H. 1993. In vivo and in vitro characterization o f long-term repopulating primitive hematopoietic cells isolated by sequential Hoechst 33342-rhodamine 123 F A C S selection. Exp. Hematol 21:614-622.  10.  Scharenberg, C . W . , Harkey, M . A . , and Torok-Storb, B . 2002. The A B C G 2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors. Blood. 99:507-512.  11.  Tajima, F., Deguchi, T., Laver, J.H., Zeng, H . , and Ogawa, M . 2001. Reciprocal expression o f C D 3 8 and C D 3 4 by adult murine hematopoietic stem cells. Blood. 97:2618-2624.  12.  Tajima, F., Sato, T., Laver, J.H., and Ogawa, M . 2000. C D 3 4 expression by murine hematopoietic stem cells mobilized by granulocyte colony-stimulating factor. Blood. 96:1989-1993.  13.  Rebel, V . I . , Miller, C . L . , Thornbury, G . R . , Dragowska, W . H . , Eaves, C.J., and Lansdorp, P . M . 1996. A comparison o f long-term repopulating hematopoietic stem cells i n fetal liver and adult bone marrow from the mouse. Exp. Hematol. 24:638-648.  109  14. Morrison, S.J., Hemmati, H . D . , Wandycz, A . M . , and Weissman, I.L. 1995. The purification and characterization o f fetal liver hematopoietic stem cells. Proc. Natl. Acad. Sci. USA. 92:10302-10306.  15. Uchida, N . , Dykstra, B . , Lyons, K . , Leung, F., Kristiansen, M . , and Eaves, C . 2004. A B C transporter activities o f murine hematopoietic stem cells vary according to their developmental and activation status. Blood. 103:4487-4495.  16. Passegue, E . , Wagers, A . J . , Giuriato, S., Anderson, W . C . , and Weissman, I.L. 2005. Global analysis o f proliferation and cell cycle gene expression in the regulation o f hematopoietic stem and progenitor cell fates. J. Exp. Med. 202:1599-1611.  17. Benveniste, P., Cantin, C , Hyam, D . , and Iscove, N . N . 2003. Hematopoietic stem cells engraft in mice with absolute efficiency. Nat. Immunol. 4:708-713.  18. Matsuzaki, Y . , Kinjo, K . , Mulligan, R . C . , and Okano, H . 2004. Unexpectedly efficient homing capacity o f purified murine hematopoietic stem cells. Immunity. 20:87-93.  19. Habibian, H . K . , Peters, S.O., Hsieh, C . C . , W u u , J., Vergilis, K . , Grimaldi, C . L , Reilly, J., Carlson, J . E . , Frimberger, A . E . , Stewart, F . M . et al. 1998. The fluctuating phenotype o f the lymphohematopoietic stem cell with cell cycle transit. J. Exp. Med. 188:393-398.  20.  G l i m m , H . , O h , I.H., and Eaves, C . J . 2000. Human hematopoietic stem cells stimulated to proliferate i n vitro lose engraftment potential during their S/G(2)/M transit and do not reenter G(0). Blood. 96:4185-4193.  110  21.  Orschell-Traycoff, C M . , Hiatt, K . , Dagher, R . N . , Rice, S., Yoder, M . C . , and Srour, E . F . 2000. H o m i n g and engraftment potential o f Sea-1 lin" cells fractionated on the +  basis o f adhesion molecule expression and position in cell cycle. Blood. 96:1380-1387.  22. Lapidot, T., Dar, A . , and Kollet, O . 2005. H o w do stem cells find their way home? Blood. 106:1901-1910.  23. Denhardt, D.T., Noda, M . , O'Regan, A . W . , Pavlin, D . , and Berman, J.S. 2001. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. J. Clin. Invest. 107:1055-1061.  24. Lee, B . C . , Cheng, T., Adams, G . B . , Attar, E . C , Miura, N . , Lee, S.B., Saito, Y . , Olszak, I., Dombkowski, D . , Olson, D . P . et al. 2003. P 2 Y - l i k e receptor, GPR105 (P2Y14), identifies and mediates chemotaxis o f bone-marrow hematopoietic stem cells. Genes Dev. 17:1592-1604.  25.  Stier, S., K o , Y . , Forkert, R., Lutz, C , Neuhaus, T., Grunewald, E . , Cheng, T., Dombkowski, D . , Calvi, L . M . , Rittling, S.R. et al. 2005. Osteopontin is a hematopoietic stem cell niche component that negatively regulates stem cell pool size. J. Exp. Med. 201:1781-1791.  26. Bonig, H . , Chang, K . H . , Nakamoto, B . , and Papayannopoulou, T. 2006. The p67 laminin-receptor identifies human erythroid progenitor and precursor cells and is functionally important for their bone marrow lodgment. Blood. e-Pub.  27. Becker, P.S., Nilsson, S.K., L i , Z . , Berrios, V . M . , Dooner, M . S . , Cooper, C . L . , Hsieh, C . C . , and Quesenberry, P.J. 1999. Adhesion receptor expression by hematopoietic cell  111  lines and murine progenitors: modulation by cytokines and cell cycle status. Exp. Hematol. 27:533-541.  28. Medvinsky, A . L . , Samoylina, N . L . , Muller, A . M . , and Dzierzak, E . A . 1993. A n early pre-liver intra-embryonic source o f C F U - S in the developing mouse. Nature. 364:6466.  29. Gothert, J.R., Gustin, S.E., Hall, M . A . , Green, A . R . , Gottgens, B . , Izon, D.J., and Begley, C . G . 2005. In vivo fate tracing studies using the S C L stem cell enhancer: embryonic hematopoietic stem cells significantly contribute to adult hematopoiesis. Blood. 105:2724-2732.  30. Ponchio, L . , Conneally, E . , and Eaves, C . 1995. Quantitation o f the quiescent fraction of long-term culture-initiating cells i n normal human blood and marrow and the kinetics o f their growth factor-stimulated entry into S-phase in vitro. Blood. 86:33143321.  31. Uchida, N . , Dykstra, B . , Lyons, K . J . , Leung, F . Y . , and Eaves, C . J . 2003. Different i n vivo repopulating activities o f purified hematopoietic stem cells before and after being stimulated to divide in vitro with the same kinetics. Exp. Hematol. 31:1338-1347.  32. Ladd, A . C . , Pyatt, R., Gothot, A . , Rice, S., M c M a h e l , J., Traycoff, C M . , and Srour, E.F. 1997. Orderly process o f sequential cytokine stimulation is required for activation and maximal proliferation of primitive human bone marrow CD34+ hematopoietic progenitor cells residing in GO. Blood. 90:658-668.  112  33.  Szilvassy, S.J., Ragland, P . L . , M i l l e r , C . L . , and Eaves, C.J. 2003. The marrow homing efficiency o f murine hematopoietic stem cells remains constant during ontogeny. Exp. Hematol. 31:331-338.  34.  Szilvassy, S.J., Meyerrose, T . E . , and Grimes, B . 2000. Effects o f cell cycle activation on the short-term engraftment properties o f ex vivo expanded murine hematopoietic cells. Blood. 95:2829-2837.  35.  G l i m m , H . , Eisterer, W . , Lee, K . , Cashman, J., Holyoake, T . L . , N i c o l i n i , F., Shultz, L . D . , von K a l l e , C , and Eaves, C . J . 2001. Previously undetected human hematopoietic cell populations with short-term repopulating activity selectively engraft N O D / S C I D beta2 microglobulin-null mice. J . Clin. Invest. 107:199-206.  36.  Hattori, K . , Heissig, B . , Tashiro, K . , Honjo, T., Tateno, M . , Shieh, J . H . , Hackett, N . R . , Quitoriano, M . S . , Crystal, R . G . , Rafii, S. et al. 2001. Plasma elevation o f stromal cellderived factor-1 induces mobilization o f mature and immature hematopoietic progenitor and stem cells. Blood. 97:3354-3360.  37.  Cashman, J., Dykstra, B . , Clark-Lewis, I., Eaves, A . , and Eaves, C . 2002. Changes in the proliferative activity o f human hematopoietic stem cells in N O D / S C I D mice and enhancement o f their transplantability after i n vivo treatment with cell cycle inhibitors. J. Exp. Med. 196:1141-1149.  38.  Fukuda, S., Broxmeyer, H . E . , and Pelus, L . M . 2005. Flt3 ligand and the Flt3 receptor regulate hematopoietic cell migration by modulating the S D F l a l p h a ( C X C L 1 2 ) / C X C R 4 axis. Blood. 105:3117-3126.  113  39. Lapidot, T. and Kollet, O. 2002. The essential roles o f the chemokine SDF-1 and its receptor C X C R 4 i n human stem cell homing and repopulation of transplanted immunedeficient N O D / S C I D and N O D / S C I D / B 2 m ( n u l l ) mice. Leukemia. 16:1992-2003.  40. De Clercq, E . 2005. Potential clinical applications o f the C X C R 4 antagonist bicyclam A M D 3 1 0 0 . Mini. Rev. Med. Chem. 5:805-824.  41.  Chen, J., Larochelle, A . , Fricker, S., Bridger, G . , Dunbar, C . E . , and Abkowitz, J.L. 2006. Mobilization as a preparative regimen for hematopoietic stem cell transplantation. Blood. 107:3764-3771.  42.  Crump, M . P . , Gong, J.H., Loetscher, P., Rajarathnam, K . , Amara, A . , ArenzanaSeisdedos, F., Virelizier, J.L., Baggiolini, M . , Sykes, B . D . , and Clark-Lewis, I. 1997. Solution structure and basis for functional activity o f stromal cell-derived factor-1; dissociation o f C X C R 4 activation from binding and inhibition o f H I V - l .  EMBOJ.  16:6996-7007.  43. De Clercq, E . 2003. The bicyclam A M D 3 1 0 0 story. Nat. Rev. Drug Discov. 2:581-587.  44.  Cashman, J., Clark-Lewis, I., Eaves, A . , and Eaves, C. 2002. Stromal-derived factor 1 inhibits the cycling of very primitive human hematopoietic cells in vitro and in N O D / S C I D mice. Blood. 99:792-799.  45.  Moore, K . A . 2004. Recent advances in defining the hematopoietic stem cell niche. Curr. Opin. Hematol. 11:107-111.  46. Heissig, B . , O h k i , Y . , Sato, Y . , Rafii, S., Werb, Z . , and Hattori, K . 2005. A role for niches in hematopoietic cell development. Hematology.  114  10:247-253.  47. Lemischka, I.R. 1997. Microenvironmental regulation of hematopoietic stem cells. Stem Cells 15 (Suppl l):63-68.  48. Hackney, J.A., Charbord, P., Brunk, B.P., Stoeckert, C.J., Lemischka, I.R., and Moore,K.A. 2002. A molecular profile of a hematopoietic stem cell niche. Proc. Natl. Acad. Sci. USA. 99:13061-13066.  49. Eaves, C.J., Cashman, J.D., Kay, R.J., Dougherty, G.J., Otsuka, T., Gaboury, L.A., Hogge, D.E., Lansdorp, P.M., Eaves, A.C., and Humphries, R.K. 1991. Mechanisms that regulate the cell cycle status of very primitive hematopoietic cells in long-term human marrow cultures. II. Analysis of positive and negative regulators produced by stromal cells within the adherent layer. Blood. 78:110-117. 50. Rufer, N., Brummendorf, T.H., Kolvraa, S., Bischoff, C , Christensen, K., Wadsworth, L., Schulzer, M., and Lansdorp, P.M. 1999. Telomere fluorescence measurements in . granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. J. Exp. Med. 190:157-167. 51. Dorfman, J.R. and Raulet, D.H. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. J. Exp. Med. 187:609-618. 52. Jamieson, A.M., Isnard, P., Dorfman, J.R., Coles, M.C., and Raulet, D.H. 2004. Turnover and proliferation of NK cells in steady state and lymphopenic conditions. J. Immunol. 172:864-870.  115  53.  Rebel, V . I . , M i l l e r , C . L . , Eaves, C.J., and Lansdorp, P . M . 1996. The repopulation potential of fetal liver hematopoietic stem cells i n mice exceeds that o f their liver adult bone marrow counterparts. Blood. 87:3500-3507.  54. Pawliuk, R., Eaves, C , and Humphries, R . K . 1996. Evidence of both ontogeny and transplant dose-regulated expansion o f hematopoietic stem cells i n vivo. Blood. 88:2852-2858.  55.  Okuda, T., Nishimura, M . , Nakao, M . , and Fujita, Y . 2001. R U N X 1 / A M L 1 : a central player in hematopoiesis. Int. J. Hematol. 74:252-257'.  56. Hadland, B . K . , Huppert, S.S., Kanungo, J., X u e , Y . , Jiang, R., Gridley, T., Conlon, R . A . , Cheng, A . M . , Kopan, R., and Longmore, G . D . 2004. A requirement for N o t c h l distinguishes 2 phases o f definitive hematopoiesis during development. Blood. 104:3097-3105.  57. Lecuyer, E . and Hoang, T. 2004. S C L : from the origin o f hematopoiesis to stem cells and leukemia. Exp. Hematol. 32:11-24.  58. Lessard, J. and Sauvageau, G . 2003. Bmi-1 determines the proliferative capacity o f normal and leukaemic stem cells. Nature. 423:255-260.  59. Park, I.K., Qian, D . , K i e l , M . , Becker, M . W . , Pihalja, M . , Weissman, I.L., Morrison, S.J., and Clarke, M . F . 2003. Bmi-1 is required for maintenance o f adult self-renewing haematopoietic stem cells. Nature. 423:302-305.  116  60.  Hock, H . , Hamblen, M . J . , Rooke, H . M . , Schindler, J.W., Saleque, S., Fujiwara, Y . , and Orkin, S.H. 2004. Gfi-1 restricts proliferation and preserves functional integrity o f haematopoietic stem cells. Nature. 431:1002-1007.  61. Zeng, H . , Y u c e l , R., Kosan, C , Klein-Hitpass, L . , and M o r o y , T. 2004. Transcription factor G f i l regulates self-renewal and engraftment o f hematopoietic stem cells. EMBO J. 23:4116-4125.  62. Ikuta, K . and Weissman, I.L. 1992. Evidence that hematopoietic stem cells express mouse c-kit but do not depend on steel factor for their generation. Proc. Natl. Acad .Sci. USA. 89:1502-1506.  63. M i l l e r , C . L . , Rebel, V . I . , Helgason, C D . , Lansdorp, P . M . , and Eaves, C J . 1997. Impaired steel factor responsiveness differentially affects the detection and long-term maintenance o f fetal liver hematopoietic stem cells in vivo. Blood. 89:1214-1223.  64. Puri, M . C . and Bernstein, A . 2003. Requirement for the T I E family o f receptor tyrosine kinases i n adult but not fetal hematopoiesis. Proc. Natl. Acad. Sci. USA. 100:12753-12758.  65.  Doitsidou, M . , Reichman-Fried, M . , Stebler, J., Koprunner, M . , Dorries, J., Meyer, D . , Esguerra, C . V . , Leung, T., and Raz, E . 2002. Guidance o f primordial germ cell migration by the chemokine S D F - 1 . Cell. 111:647-659.  66.  Kawabata, K . , Ujikawa, M . , Egawa, T., Kawamoto, H . , Tachibana, K . , Iizasa, H . , Katsura, Y . , Kishimoto, T., and Nagasawa, T. 1999. A cell-autonomous requirement  117  for C X C R 4 in long-term lymphoid and myeloid reconstitution. Proc. Natl. Acad. Sci. USA. 96:5663-5667.  67. M a , Q., Jones, D . , and Springer, T . A . 1999. The chemokine receptor C X C R 4 is required for the retention o f B lineage and granulocytic precursors within the bone marrow microenvironment. Immunity. 10:463-471.  68. Brenner, S., Whiting-Theobald, N . , K a w a i , T., Linton, G . F . , Rudikoff, A . G . , Choi, U . , Ryser, M . F . , Murphy, P . M . , Sechler, J . M . , and Malech, H . L . 2004. CXCR4-transgene expression significantly improves marrow engraftment of cultured hematopoietic stem cells. Stem Cells. 22:1128-1133.  69. Peled, A . , Petit, I., Kollet, O., M a g i d , M . , Ponomaryov, T., B y k , T., Nagler, A . , B e n Hur, H . , Many, A . , Shultz, L . et al. 1999. Dependence of human stem cell engraftment and repopulation of N O D / S C I D mice on C X C R 4 . Science. 283:845-848.  70. Petit, I., Szyper-Kravitz, M . , Nagler, A . , Lahav, M . , Peled, A . , Habler, L . , Ponomaryov, T., Taichman, R.S., Arenzana-Seisdedos, F., Fujii, N . et al. 2002. G - C S F induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating C X C R 4 . Nat. Immunol. 3:687-694.  71. Broxmeyer, H . E . , Orschell, C M . , Clapp, D . W . , Hangoc, G . , Cooper, S., Plett, P . A . , Liles, W . C , L i , X . , Graham-Evans, B . , Campbell, T . B . et al. 2005. Rapid mobilization o f murine and human hematopoietic stem and progenitor cells with A M D 3 1 0 0 , a C X C R 4 antagonist. J. Exp. Med. 201:1307-1318.  118  72. Flomenberg, N . , Devine, S . M . , Dipersio, J.F., Liesveld, J.L., M c C a r t y , J . M . , Rowley, S.D., Vesole, D . H . , Badel, K . , and Calandra, G . 2005. The use o f A M D 3 1 0 0 plus G C S F for autologous hematopoietic progenitor cell mobilization is superior to G - C S F alone. Blood  106:1867-1874.  73. Randall, T . D . and Weissman, I.L. 1997. Phenotypic and functional changes induced at the clonal level i n hematopoietic stem cells after 5-fluorouracil treatment. Blood. 89:3596-3606.  74. Mazurier, F., Doedens, M . , Gan, O.I., and Dick, J.E. 2003. Rapid myeloerythroid repopulation after intrafemoral transplantation of N O D - S C I D mice reveals a new class of human stem cells. Nat. Med. 9:959-963.  75. Szilvassy, S., N i c o l i n i , F . E . , Eaves, C.J., and Miller, C . L . 2002. Quantitation of Murine and Human Hematopoietic Stem Cells by Limiting Dilution Analysis i n Competitively Repopulated Hosts. Methods Mol. Med. 63:167-188.  76. Livak, K . J . and Schmittgen, T . D . 2001. Analysis o f relative gene expression data using real-time quantitative P C R and the 2(-DeIta Delta C(T)) Method. Methods. 25:402408.  119  CHAPTER 3  HEMATOPOIETIC STEM CELLS TRANSITION ABRUPTLY AND PROGRAMMATICALLY FROM A F E T A L TO AN ADULT STATE.  The work presented in this Chapter was submitted for publication  Michelle B. Bowie, David G. Kent, Brad Dykstra,, Kristen D. McKnight, Lindsay McCaffrey Pamela A. Hoodless and Connie J. Eaves  David Kent isolated the R N A and generated the cDNA preparations, Brad Dykstra assisted with the analysis of stage-specific GM-contribution, Kristen McKnight isolated E l 8.5 fetal bones and Lindsay McCaffrey assisted with C R U analysis.  120  INTRODUCTION The identification in the 1950's o f cells in adult mouse bone marrow that can individually regenerate all lineages o f the blood and lymphoid systems provided the first direct evidence o f a pluripotent hematopoietic stem cell ( H S C ) (1 ;2). Since that time much effort has been devoted to the development o f quantitative assays for enumerating, characterizing and purifying H S C s . Currently there is general agreement that H S C s can be most specifically identified by endpoints that detect competitively and permanently (>4 months) repopulated immunologically compatible recipients whose endogenous blood-forming system has been seriously compromised (e.g., by irradiation and/or genetic modification). H S C quantitation can then be achieved using a limiting dilution approach coupled with a strategy for keeping the recipients alive with a minimally competitive source and dose o f H S C s (3). This has allowed many shared biological properties and associated molecular features o f H S C s from different stages o f ontogeny to be identified (4). However, in spite o f these common properties, extensive heterogeneity in their individual behaviour is a hallmark o f every source of H S C thus far studied (5-8). Changes in the behaviour o f H S C s from different stages o f development have also been recognized for many years. O f particular note is the finding that H S C s from midgestation mouse fetal livers (embryonic day (E)14.5) regenerate H S C s in irradiated recipients at a faster rate than is seen with transplants o f adult bone marrow H S C s (9-11). This, in turn, results in an increased rate o f regeneration o f derivative myeloid progenitor cell types detected by short term colony assays both in vivo (colony-forming unit-spleen, C F U - S ) and in vitro (colony-forming cells, C F C s ) and their more mature progeny (6; 11; 12). The size, content and longevity o f clones produced in vivo by individual H S C s likely reflects their immediate self-renewal history; that is, the frequency with which they have generated one or  121  more daughter HSC(s) during their expansion post-transplant. However, changes in other H S C properties during development could also affect their clonal outputs post-transplantation: for example, changes that control their proliferative activity, cell cycle time, survival, or lineage-restriction. Comparisons o f the responses o f genetically-altered H S C s and their w i l d type counterparts stimulated in identical environments have led to a growing list o f intrinsic determinants o f H S C self-renewal activity (13-20), and a few o f these have been reported to affect fetal and adult H S C s differentially (13;20). Definitive evidence that the self-renewal o f H S C s can be modulated by the types and concentrations o f growth factors to which the H S C s are exposed both i n vivo (21) and in vitro (14;22-24) has also been demonstrated. Some o f these latter effects differ on fetal and adult H S C s , such as in vitro conditions that support adult but not fetal H S C self-renewal (25). Interestingly, the timing o f changes in the influence o f specific determinants o f H S C regenerative properties during development has not been previously explored. Recently, we showed that fetal mouse H S C s are maintained as a wholly cycling population until 3 weeks after birth, at which point they switch within one week to a largely quiescent population (as shown in Chapter 2). Here we show that this rapid change in H S C proliferative activity is accompanied by a similarly abrupt switch in the regenerative and differentiation properties these cells display after transplantation into irradiated recipients. In addition, we show that this switch occurs independently o f the age o f the host in which the H S C s are amplifying and is accompanied by pronounced changes in their transcriptional control.  122  RESULTS Kinetic analysis of the different rates of HSC production by transplants from fetal and adult sources Previous reports have provided some limited, albeit key information about the different kinetics o f H S C regeneration in irradiated recipients o f fetal and adult H S C s (6; 18), including effects o f the dose as well as the source o f the H S C s ( C R U s ) initially transplanted (26). Therefore, to maximize the differences displayed by H S C s from different sources, while also restricting other possible contributing variables, the number o f C R U s transplanted into each primary W41 recipient was set at 10, regardless o f the tissue from which they had been obtained (i.e., the contents o f either 10 T e r l 19" E l 4 . 5 fetal liver cells (27) or 10 lin" adult 5  s  bone marrow cells (28)). Groups o f recipients were then sacrificed from one to 24 weeks later and the changing bone marrow content o f in vivo amplified donor-derived H S C s determined by performing limiting dilution transplantation assays i n secondary W41 recipients. This general experimental design is shown schematically in Figure 3.1 A . The pooled results from 4 such experiments revealed 2 distinct and highly consistent patterns o f C R U amplification in primary recipients o f fetal liver and adult bone marrow C R U s (Figure 3.IB). Initially (during the first week), there was no net change in the number o f donor-derived H S C s detected in the bone marrow o f the transplanted mice. Then, between the first and second week, the number o f fetal liver-derived C R U s expanded rapidly (8-fold), whereas during the same interval, bone marrow-derived C R U s increased their numbers very little (1.5-fold). Thereafter, the rates o f expansion o f the 2 populations o f C R U s i n vivo became similar, doubling approximately every week, until saturation o f the regenerated C R U content.  123  To determine whether the different kinetics of C R U regeneration obtained from transplants o f fetal liver and adult bone marrow cells might be due to the co-transplantation o f accessory cells unique to one o f these tissues, the rates o f regeneration o f the progeny o f each was re-examined in mice injected with both (i.e., transplants o f Ly5.1 fetal liver cells containing 10 C R U s were co-injected with Ly5.2 adult bone marrow cells, also containing 10 C R U s , into both Ly5.1 and Ly5.2 W41 recipients) and the C R U output from each donor C R U type was then measured 2, 4 and 8 weeks later in secondary recipients. The results o f this experiment with mixed primary transplants showed that the kinetics o f C R U regeneration from the co-injected fetal liver and adult bone marrow C R U s were the same as when these cells were transplanted separately (data not shown). Taken together, these results show that fetal and adult H S C s expand at markedly different rates in irradiated mice during the second week after transplantation and that these differing rates o f expansion are cell autonomous.  Identification of an abrupt and programmed switch in the regenerative properties of HSCs between 3 and 4 weeks after birth W e next sought to investigate the timing and pace o f change in H S C ( C R U ) regenerative properties from those typical o f the C R U s present in the E l 4.5 fetal liver to those typical o f the C R U s present in adult bone marrow. We therefore repeated the experiment shown in Figure 3.1 A using bone marrow cells from mice at intermediate stages o f development (i.e. E l 8.5 fetal bone marrow, and 3 and 4-week post-natal bone marrow) as the cells initially transplanted. In each case, preliminary experiments were undertaken to define the number o f cells that contained 10 C R U s . This dose was then injected into each primary recipient and secondary limiting dilution transplants were performed from one to 4 weeks later to determine  124  the kinetics o f expansion o f H S C s derived from the injected cells initially transplanted into the primary recipients. These experiments focused on the initial 4-week period post-transplant because the greatest difference between the rate o f expansion o f fetal liver and adult bone marrow C R U s in vivo had been seen at this time (Figure 3.IB). A s shown in Figure 3.2A and B , the results o f the experiments with C R U s from donors at intermediate stages o f development revealed that the E l 8 . 5 fetal bone marrow and week 3 post-natal bone marrow C R U s expanded with the same kinetics as the E l 4 . 5 fetal liver C R U s , whereas the week 4 post-natal bone marrow C R U s behaved just like the transplants o f adult bone marrow C R U s . W e next asked whether this abrupt transition in the regenerative properties o f C R U s was unique to the weanling mouse entering puberty or whether a similarly timed switch might also be seen during the expansion o f fetal liver-derived C R U s in adult recipients. To discriminate between these possibilities, we transplanted secondary mice with 10 C R U s that had been regenerated in primary recipients o f 10 fetal liver C R U s transplanted 6 weeks previously. W e then assessed the kinetics o f expansion o f the progeny o f these in vivo expanded fetal liver C R U s during their further expansion i n the secondary recipients by performing limiting dilution C R U transplants in tertiary recipients (Figure 3.1 A ) . This experiment showed that within 6 weeks, the C R U s derived from fetal liver C R U s had acquired the regenerative properties o f adult bone marrow C R U s (Figure 3.2C). Thus, regardless o f the age or physiological conditions o f the host in which fetal liver C R U s proliferate, they generate a cohort o f C R U s with "adult" C R U regeneration properties within the same time frame.  125  Identification of an abrupt and programmed switch in the differentiation behaviour of HSCs between 3 and 4 weeks after birth To investigate whether the changes in H S C ( C R U ) regenerative activity were accompanied by parallel changes i n their differentiation properties, we examined the different types o f W B C s they produced at 16 weeks (Figure 3.3). The percentage o f all donor W B C s that expressed L y 6 G and/or M a c l ( G M ) was more than 2-fold higher in recipients o f fetal liver C R U s than in recipients o f adult bone marrow C R U s . A fetal liver-like G M output was obtained in primary recipients o f E l 8.5 bone marrow and 3 week-old bone marrow cells, as well as i n secondary recipients o f C R U s from mice transplanted with fetal liver C R U s 1 -2 weeks earlier. In contrast, an adult-like output change o f G M was seen in secondary recipients o f C R U s from mice transplanted with 3 week-old bone marrow cells, 2 weeks earlier. Similarly, this adultlike output was seen in primary recipients o f 4 week-old bone marrow cells, secondary recipients o f adult bone marrow cells, and tertiary recipients o f C R U s from secondary mice that had been transplanted 1 -2 weeks earlier with bone marrow from primary recipients o f fetal liver C R U s transplanted 6 weeks previously (refer to Figure 3.1 A schematic - indicated by asterisks on the 3° line). Interestingly, a G M output intermediate between that exhibited by fetal liver and that by adult bone marrow C R U s was seen in secondary recipients o f C R U s from primary mice that had been transplanted with 3 week-old bone marrow cells for just 1 week (chequered bar), suggesting that the C R U s ultimately tested were comprised o f a mixture of fetal-like and adult-like C R U s . Collectively, these findings point to the operation o f an intrinsically controlled switch that alters the differentiation properties o f C R U between 4.5 and 5.5 weeks after E14.5 (i.e. approximately 3-4 weeks after birth), regardless o f whether the fetal liver C R U s are left i n situ in their endogenous developmental setting or are transplanted directly into a myeloablated adult recipient.  126  The cell cycle transit time of self-renewing HSC does not change during ontogeny The different rates o f H S C ( C R U ) expansion measured in recipients o f fetal and adult C R U s could be influenced by several parameters: differences in the frequency o f symmetric selfrenewal divisions undertaken, differences i n H S C cell cycle transit times and differences in H S C death. These are difficult parameters to measure in vivo but can be assessed in single cell cultures o f highly purified C R U populations maintained under conditions that optimize each o f these parameters. We have previously reported the kinetics o f division o f approximately 40% pure populations o f adult bone marrow C R U s cultured under conditions that allow a 2- to 4-fold net expansion o f their numbers (14;24). Experiments showed that E l 4.5 fetal liver C R U s could be purified to purity o f approximately 10% by isolation o f the l i n " S c a - l M a c l C D 4 3 subset as shown by both limiting dilution transplants and transplants +  +  +  of single purified cells (Figure 3.4A). In preliminary experiments (for a detailed description please refer to Chapter 4), we found that 50 ng/ml SF gave a full net maintenance o f fetal liver C R U numbers after 48 hours in culture and this growth factor condition was superior in this regard to any o f a variety o f other growth factor cocktails tested, including that found to be optimal for adult bone marrow C R U s (i.e., 300 ng/ml SF + 20 ng/ml IL-11 ± 1 ng/ml Flt3ligand (14;24)). The kinetics o f cell division o f fetal liver H S C s were then monitored visually in single cell cultures containing 50 ng/ml SF and the results compared to previously published data for adult bone marrow H S C s (14;24). A s shown in Figure 3.4B, under these conditions, fetal liver H S C s divided with the same 14-hour cell cycle transit time as adult bone marrow H S C s , but without any initial delay, due to the fact that all o f the fetal liver H S C s are in cycle whereas all o f the purified adult bone marrow H S C s are quiescent (see Chapter 2). In addition, it can be seen that there was essentially no cell death in these cultures as previously shown for optimally stimulated adult  127  bone marrow H S C s (24). Thus, under optimally mitogenic conditions that also preserve H S C activity, all o f the fetal liver H S C s completed a first division within 28 hours whereas adult bone marrow H S C s would be just starting to divide at this time. More prolonged monitoring of the fetal liver H S C cultures showed that the fetal liver cells continued to proliferate in the same semi-synchronous fashion as previously shown for adult bone marrow H S C s and were thus completing their second and third divisions at the same times as adult bone marrow cells were found to be completing a first and second division, respectively (Figure 3.4C). Based on these findings, it seems likely that the expansion o f fetal liver and adult bone marrow H S C s stimulated i n the bone marrow o f myeloablated mice also occurs with minimal H S C death, with the same cell cycle transit times for both sources o f H S C s . Accordingly, differences in the frequency o f symmetric self-renewal divisions would be inferred. Interestingly, the same kinetics o f division were seen when these highly purified fetal liver cells were cultured in the cocktail used for adult bone marrow H S C s (i.e., 300 ng/ml SF + 20 ng/ml IL-11), even though this was found to lead to a rapid loss o f H S C activity (see Chapter 3), suggesting that the cell cycle transit times o f H S C s undergoing an initial differentiation step is the same as that o f H S C s maintaining self.  Identification of differences in gene expression between purified fetal liver and adult bone marrow HSCs that also distinguish the same phenotypes of cells in the bone marrow of 3 and 4 week-old mice Identification o f an abrupt transition between 3 and 4 weeks after birth o f a number o f properties in H S C s that distinguish these cells in the fetal liver and adult bone marrow (see Figure 3.5) suggested that changes in these properties might be accompanied by corresponding changes in gene expression. To test this hypothesis, highly enriched E14.5 fetal liver ( l i n S c a -  128  1 M a c l C D 4 3 , Figure 3.4A) and adult bone marrow (lin"Rho SP) (24) H S C s populations +  +  +  dull  were isolated (-20% and 40% pure, respectively), R N A extracts obtained and c D N A preparations made. Similar isolates were obtained from the l i n " S c a - l M a c l C D 4 3 and lin" +  Rho  dull  +  +  S P cells isolated from 3 and 4-week old bone marrow cells, respectively, based on the  assumption that the phenotype o f their H S C s , like their cycling (Chapter 2), self-renewal and differentiation properties (Chapter 3) would be similar to the phenotype o f fetal liver H S C s (Chapter 3) and adult bone marrow H S C s (24), respectively. We then looked for changes in the levels o f transcripts for a number o f candidate genes. Several genes previously reported to play a role in H S C expansion (cyclinD2, Ikaros, rae-28 and MEF) were found to be more highly expressed (P<.05) in fetal liver and 3-week bone marrow H S C s as compared to H S C s in 4 and 10 week bone marrow (Figure 3.6). Bmi-1, c-Kit, Gfi-1, Notchl and Ship showed no difference in expression in any o f the HSC-enriched samples. However, a marked and permanent upregulation o f expression o f ATM, Ezh2, Gata-2 and Runxl was noted in the purified H S C s o f 4 and 10 week-old bone marrow as compared to their earlier counterparts (P<.05). Increased expression o f Sci in adult vs. fetal H S C s was also noted, but expression o f this gene was not tested in the 3 and 4-week bone marrow H S C s .  DISCUSSION Here we have identified a unique time point in the expansion o f H S C s when these cells undergo an abrupt and tightly regulated change in properties that control their ability to execute symmetric self-renewal divisions. After this point, the H S C s show a decreased ability to rapidly generate large outputs o f progeny in long-term in vivo reconstitution assays. Concomitant with this change in self-renewal control is an alteration in the relative proportions o f terminally differentiated cells they generate, as evidenced by a changed average  129  output o f granulocytes and monocytes. O f note, the timing and unexpectedly abrupt kinetics o f these co-ordinated changes in H S C properties mirror precisely the change in cycling status of H S C s in vivo (Chapter 2). Until 3 weeks after birth, the H S C s remain a wholly cycling population, but between 3 and 4 weeks after birth they are converted to a largely quiescent population. Taken together, these findings point to the existence o f a novel and rapidly executed master switch that controls a spectrum o f key H S C properties. Interestingly, although there is no previous report o f such a switch at this time, several studies have described changes in other H S C properties around this time (expression o f C D 3 4 , C D 3 8 , and podocalyxin and Hoechst33342 and Rhodamine-123 efflux properties) (29-35). W e also show here that when optimally stimulated, fetal liver H S C s ( E l 4 . 5 ) and adult bone marrow H S C s have negligible apoptotic frequencies and identical cell cycle times (14 hours). In this latter respect, they differ from the more mature progeny that are generated from these cells which, in the fetal liver, clearly cycle more rapidly (36;37). Thus the enhanced rate o f expansion o f fetal liver H S C s after transplantation into irradiated adult hosts is likely due to differences in the intrinsic mechanisms that control their self-renewal ability, as opposed to differences in regulators o f their cell cycle transit times. The concept o f an intrinsically determined switch regulating H S C functions was further supported by experiments indicating that the rate o f H S C regeneration post-transplant changes after a fixed period o f H S C expansion, independent o f the particular in vivo environment in which the expansion took place (Figure 3.2C). To gain further insight into genes that might be involved in these developmentally programmed changes in H S C behaviour, we looked for correlated patterns o f change in the expression o f a number o f candidates previously implicated in H S C control (reviewed in Chapter 1). This survey included the following specific genes: ATM, which has been shown to  130  play a role in mediating the stress-response o f H S C s (38); Bmi-1, mel-18, rae-28, and Ezh2, P c G proteins thought to be important in the initiation (Ezh2) and maintenance (Bmi-1, mel-18, rae-28) o f gene repression and involved in the regulation o f H S C self-renewal (39-41); cyclinD2, a gene that is upregulated in proliferating cells and may contribute to H S C expansion when overexpressed (42); 2 genes that play critical roles in adult but not fetal H S C s ; i.e. c-Kit, the receptor for SF, a ligand that promotes self-renewal signalling (13) and Gfi-1, a zinc finger repressor thought to restrict the proliferation o f H S C s (43); Gata-2, whose expression in fetal and adult H S C s is driven by different promoters (44;45); Ikaros, a D N A binding subunit critical for H S C s expansion (46); MEF, a gene whose absence in H S C s results in their increased quiescence (47); Notchl (48-50), Runxl (51-53) and Sci (54-57) 3 genes critical to the generation o f H S C s in the fetus but not in the adult (Chapter 1); and Ship; o f interest due to a possible role in H S C s (58) and o f major interest to the lab o f Dr. Gerry Krystal, also in the Terry Fox Laboratories. These studies revealed a remarkably consistent pattern o f gene expression in the 4 populations analyzed (E14.5 fetal liver H S C s and 3, 4 and 10 week-old bone marrow HSCs). Although changes in the expression o f Gata-2 were consistent with the fact that the promoter used by this gene changes during development (45), none o f the results obtained for other categories o f genes were predicted. For example: within the P c G genes: expression o f Bmi-1 was unchanged whereas expression o f rae-28 was down-regulated after 3 weeks and the opposite was true for Ezh2 and mel-18. Previous evidence o f differential roles in fetal liver and adult bone marrow H S C s (e.g., Runxl, Sci and Notchl) was similarly unpredictive. Nevertheless, for those genes whose expression did change, a remarkably consistent pattern was identified, as might be expected for a major switch i n programming, i n which genes involved in the expansion o f H S C s through promotion o f cell cycle or self-renewal (CyclinD2,  131  Ikaros, MEF and rae-28) were more highly expressed in H S C s with fetal liver-like properties and genes involved in H S C maintenance {ATM, Ezh2, Gata-2, and mel-18) were more highly expressed in H S C s with adult properties. It is interesting to note that the levels o f expression of ATM, Ezh2, and Gata-2 were particularly elevated in the H S C s from 4-week bone marrow. It is thus conceivable that the products o f these genes, or the regulators o f their expression, may play an important role in regulating the actual transition that takes place in these cells between 3 and 4 weeks o f age. It w i l l also be important to confirm the H S C purities in the 3 and 4-week bone marrow phenotypes analyzed and to investigate their potential functional effects on influencing the developmental switch herein described.  MATERIALS AND METHODS Mice. C57Bl/6-Pep3B-Ly5.1 (Pep3B) and congenic C5TBM6-W /W -lsf52 4l  4,  (W41) mice  were bred, maintained and used in experiments as donors and recipients, respectively, in the A n i m a l Resource Centre o f the B C Cancer Agency according to protocols approved by the University o f British Columbia in accordance with Canadian Council o f A n i m a l Care guidelines. A l l mice were kept under microisolation conditions and supplied with sterile food and water.  Cell preparation. Livers were removed from E14.5 Pep3b fetuses and fetal femurs from E l 8.5 Pep3b fetuses. Both tissues were placed i n Hank's balanced salt solution (HF: StemCell Technologies) containing 2% fetal bovine serum (FBS) (HF/2), and a cell suspension obtained by forcing the tissue through a sieve using the plunger o f a 3 m l syringe. C e l l aggregates were removed using a 70 pm filter and, where indicated, T e r l 19 (erythroid) cells were removed +  132  immunomagnetically (using EasySep reagents and equipment; StemCell Technologies) as recommended by the supplier. Bone marrow cells were harvested from 3 week, 4 week and 34 month-old Pep3B mice by flushing excised femurs and tibiae with Dulbecco's M i n i m u m Essential medium ( D M E M ) containing 2% F B S . Where indicated, L i n ( B 2 2 0 , T e r l 19 , +  +  +  L y 6 G , M a c l , L y l ) cells were removed immunomagnetically (using EasySep). +  +  +  Purification of HSCs.  E14.5 T e r l 19" fetal liver and 3 week-old bone marrow cells were first  incubated with biotinylated anti-Grl ( R B 6 - 8 C 5 , granulocytes), anti-B220 ( R A 3 - 6 B 2 , B lymphocytes), and anti-Lyl (53-7.3, T lymphocytes), all o f which were prepared in the Terry Fox Laboratory, T E R - 1 1 9 , anti-CD4 and a n t i - N K l . l (all from Becton Dickenson [BD]), and phycoerythrin (PE)-labelled anti-Sca-1 ( B D ) and various combinations o f the following: fluorescein isothiocyanate (FITC)-conjugated anti-CD43, or anti-CD34 and allophycocyanin (APC)-conjugated anti-Mac 1 or c-Kit (all from B D ) . 4 week-old bone marrow or 10 week-old bone marrow cells were similarly stained for lineage-antibodies, including M a c l , selecting those that are negative for these, and enriched for cells that did not retain the dyes Rhodamine and Hoechst 33342, as previously described (24). Staining was carried out with cells in icecold H F plus 5% rat serum (Sigma Chemicals) and 3 ug/ml Fc receptor blocking antibody (2.4G2) at 10 cells/ml for at least 30 minutes in the dark. Cells were then washed in H F and 7  incubated for an additional 30 minutes on ice with streptavidin-PE-TexasRed. Cells were washed again in H F / 2 and then resuspended in H F / 2 plus 2 ug/ml propidium iodide (PI, Sigma). Cells were kept cold and protected from light during the analysis and sorting on a F A C S Vantage or F A C S A r i a ( B D ) .  133  Transplantation and HSC quantification. W41 mice were irradiated with 360 c G y o f 250 k V p X-rays and then varying numbers o f Pep3b cells injected as indicated. H S C s were identified retrospectively by their ability to produced B , T and granulopoietic W B C s in the W41 mice for >16 weeks after staining peripheral blood (PB) samples with antibodies for donor (Ly5.1) and recipient (Ly5.2) C D 4 5 allotypes plus lymphoid (B220 and L y l ) and myeloid ( G r l and M a c l ) cell surface markers, as previously described (Chapter 2 ) . M i c e were considered to be repopulated by > H S C when >1% o f the total P B W B C s were L y 5 . 1 and these included a +  contribution o f >1% L y 5 . 1 cells to the L y l , ( L y 6 G / M a c l ) and B 2 2 0 populations. Donor+  +  +  +  type H S C frequencies in the injected test populations were then determined from the proportions o f recipients scored using Poisson statistics and the method o f maximum likelihood (L-Calc software, StemCell Technologies) (28). To evaluate the frequency o f H S C s from transplants o f single purified cells, the cells were sorted using the F A C S into the individual wells o f a 96-well round-bottom plate containing 200 ul o f serum-free medium ( S F M ) and visually confirmed to contain only one cell per well. S F M consisted o f Iscove's M E M supplemented with a serum substitute ( B I T ™ , from StemCell Technologies) and 10" M 4  2-mercaptoethanol. The entire contents o f each well (1 cell + S F M ) were then taken up into a l m l syringe and injected intravenously into individual irradiated W41 recipients. In this case, the frequency o f H S C s was calculated directly from the proportion o f injected mice that showed multi-lineage Ly5.1 repopulation for 16 weeks. Values for total H S C s regenerated per transplanted mouse were calculated by multiplying H S C frequencies by 4x the number o f cells recovered from 2 femurs and 2 tibias, assuming 2 femurs and 2 tibias contain - 2 5 % o f the total bone marrow cells in an adult mouse (59).  134  Short term cultures. Single l i n ~ S c a - l C D 4 3 M a c l E14.5 fetal liver cells were deposited +  +  +  using the automatic cell deposition unit o f a F A C S Vantage directly into the individual round bottom wells o f a 96-well plate containing S F M with either 300 ng/ml Steel factor (SF) and 20 ng/ml IL-11 or 50 ng/ml SF only. Wells were then maintained at 37 C for up to 50 hours and monitored by direct visualization at 4-hour intervals using an inverted microscope to determine the timing o f the first and second cell divisions (the interval during which first 2, and later 3 or 4 cells were first seen i n each well).  Real-time PCR. Cells were sorted into 1 m l HF/10 and R N A was isolated using the PicoPure™ R N A Isolation K i t (Arcturus Biosciences Inc.) as recommended by the supplier including a 15 minute D N A s e l treatment (Qiagen). R N A was eluted into an 11 pi volume and stored at -80°C. A c D N A preparation was then generated using the S u p e r s c r i p t ™ III FirstStrand Synthesis System for R T - P C R (18080093, Invitrogen) again as recommended by the manufacturer, with the reaction scaled up to use 25ul. Quantitative real-time P C R was performed using the following primer pairs (5' to 3'): ^ r M ( N M _ 0 0 7 4 9 9 . 1 ) forward GCAGAGTGTCTGAGGGTTTGT  and reverse A A C T T C C A G C A A C C T T C A C C ; Bmi-1  ( N M 007552.3) forward A A A C C A G A C C A C T C C T G A A C A and reverse T C T T C T T C T C T T C A T C T C A T T T T T G A ; c-Kit ( N M 021099.2) forward G A T C T G C T C T G C G T C C T G T T and reverse C T G A T T G T G C T G G A T G G A T G ;  CyclinD2  (NM_009829.2) forward G G C C A A G A T C A C C C A C A C T and reverse A T G C T G C T C T T G A C G G A A C T ; Ezh2 (NM_007971.1) forward C A T C G A A G G C A G T G G A G T C and reverse G T C T G G C C C A T G A T T A T T C T T C ; ( N M 008090.3) forward T G A C T A T G G C A G C A G T C T C T T C and reverse A C A C A C T C C C G G C C T T C T ; Gfi-1 ( N M 010278.1) forward  135  Gata-2  C T G C T C A T T C A C T C G G A C A C and reverse A T T T G T G G G G C T T C T C A C C T ; Ikaros (NM_001025597) forward C C T G A G G A C C T G T C C A C T A C C and reverse A C G C C C A T T C T C T T C A T C A C ; MEF (NM_019680)  forward  T C T G T G G A T G A G G A G G T T C C and reverse G G G T G C T G G A G A A G A A C T C A ; mel-18 (NM_009545.1) forward T T C C C C C T C T T A A C G A T T T G and reverse G A T C C T G G A G G C T G T T T C C T ; Notch-1 ( N M 008714.2) forward G C A C A A C T C C A C T G A T C C T G and reverse G C A A A G C C G A C T T G C C T A ; rae-28 ( N M 007905.1) forward G T C C C A G G C C C A G A T G T A T and reverse C C C C A T T A G G C A T C A G G A ; Sci (NM_011527.1) forward T G A G A T G G A G A T T T C T G A T G G T C and reverse C A A A T G C C C C A T T C A C A T T ; Gapdh ( N M 008084) was used as an endogenous control: forward A A C T T T G G C A T T G T G G A A G G and reverse A T G C A G G G A T G A T G T T C T G G .  Statistical Analyses. Comparisons were made using the W a l d test except in Figure 3.3, where the students T-test was used.  136  B  Weeks post-transplant Figure 3.1: Fetal liver H S C s self-renew to a greater extent than bone marrow H S C s in a transplant. A. Schematic o f the experimental design followed to measure the rate o f self-renewal o f 10 H S C s in vivo or 10 H S C s previously expanded for 6 weeks in an adult recipient from 10 starting fetal liver (FL) H S C s . B. Results shown are the number o f donor C R U per recipient, as determined by secondary C R U assays, from the transplant o f E14.5 F L (black circles) or 10 week-old bone marrow ( B M ) (open squares) after x weeks in a primary recipient. Values shown are the mean ± S E M of results from 4 experiments. 137  Figure 3.2: H S C s switch from fetal liver-like S R to adult bone marrow-like S R abruptly and intrinsically. Results shown are the number o f donor C R U per recipient, as determined by secondary C R U assays, from the transplant o f 10 donor H S C s , assayed after weeks 1, 2, 3 and 4. For comparison, the similar results from 10 fetal liver ( F L ) (grey circles) and 10 bone marrow ( B M ) (grey squares) are shown. Values shown are the mean ± S E M o f results from 2 experiments. A . E l 8.5 fetal bone marrow H S C s self-renew at the same rate as E14.5 fetal liver C R U . Open circles denote the E l 8 . 5 fetal bone marrow (FBM)-generated C R U per recipient. B. A clear transition i n self-renewal potential from fetal liver-like to bone marrow (BM)-like is revealed between 3 and 4 week-old B M H S C s . Open diamonds denote the 3week-old BM-generated C R U per recipient and closed diamonds denote the 4-week-old B M generated C R U per recipient. C . After 6 weeks in a transplant, FL-derived H S C s self-renew at the same rate as B M C R U . Closed triangles denote the donor C R U . The experimental design is shown in Figure 3 . I B .  138  F i g u r e 3.3: Fetal liver-like and adult bone marrow-like H S C s generate distinct P B lineage contribution patterns when transplanted into irradiated recipients. Bars indicate the mean % G M o f donor W B C at 16 weeks post-transplant o f 4 to 24 recipients of multiple (-3-6) H S C s o f the source indicated. Error bars indicate the standard error of the mean. The percentage o f all donor W B C s that express L y 6 G and/or M a c l ( G M ) is more than two-fold higher in recipients o f fetal liver (FL) H S C s than recipients o f adult bone marrow ( A B M ) H S C s (leftmost bars). W i t h one exception, H S C s from other developmental stages and/or transplanted into secondary or tertiary recipients show distinctly F L - l i k e or A B M - l i k e repopulation patterns (remaining bars). Black bars indicate a significantly (p<0.05) greater G M contribution than primary recipients o f A B M . White bars indicate a significantly lower (p<0.05) G M contribution than primary recipients o f F L . Checkered bar indicates both a significantly greater % G M than A B M recipients and a significantly lower % G M than F L recipients.  139  B  Single Iin-Sca1+Mac1+CD43+ cells deposited Into wells  ©Q 0  2hr  Single cells visually confirmed Timing of each 1st division (2 ceils)  * ufpiaSI IQSKSIS9' Timing of each 2nd division (4 cells)  100 80  e o  1" division FL  UJ  60  •>  ~  40  >  E  20  o  ° 3 division FL j rd  0 20  30  40  Incubation time (hr)  Figure 3.4: Purification and culture o f fetal liver H S C s reveals a similar cell cycle length as adult bone marrow H S C s . A . L i n " S c a - l C D 4 3 M a c l E14.5 fetal liver ( F L ) cells are enriched for H S C activity. Cells were isolated based on the indicated phenotypes and assayed for C R U content by either limiting dilution, or where appropriate, by single-cell injection. Values shown are the mean ± S E M o f results from at least 2 experiments. L S C D 4 3 M a c l cells were assayed i n 4 different experiments by limiting dilution and 5 different experiments by single cell injection. B. Schematic o f the experimental set-up followed to measure the in vitro division kinetics o f purified H S C s . C . In vitro division kinetics o f single, pure (20%) F L H S C s compared to single, pure (40%) bone marrow ( B M ) H S C s reveals a same cell cycle transit time. The percentage o f cumulative divisions is shown with respect to time i n culture. F L H S C s are shown as open circles when cultured i n self-renewal conditions o f 50 ng/ml SF and closed circles when cultured i n differentiating-conditions o f 300 ng/mL S F and 20 ng/mL IL-11. +  +  +  +  140  E14.5  birth  3 wk 4 wk  10 wk  Pre-switch HSCs:  Post-switch HSCs:  Cycling  Quiescent  High self-renewal  Lower self-renewal  High GM output  Reduced GM output  F i g u r e 3.5: N e w H S C developmental switch discovered. A distinct and abrupt transition in H S C behaviour occurs both endogenously and posttransplantation, after the same length o f time. H S C s switch from fetal liver-like to adult bone marrow-like behavioural characteristics. Pre-switch H S C s are characterized by actively cycling, high rates self-renewal in transplants and high GM-regeneration per donor-derived W B C s . Post-switch H S C s are characterized by a large percentage in quiescence, low rates o f self-renewal in transplants and low GM-regeneration per donor-derived W B C s .  141  A  Figure 3.6: Gene expression analysis o f purified fetal liver, 3-wk, 4-wk and 10-wk-old bone marrow H S C s . Gene expression in the adult bone marrow ( A B M ) or 4 week bone marrow ( B M ) H S C s was calculated as a fold-change relative to gene expression in the fetal liver ( F L ) or 3 week B M H S C s , respectively, with values within each comparison normalized to levels o f Gapdh expression from each. A. Shown are the results for changes in gene expression between F L and A B M H S C s , with level o f gene expression from F L H S C s set equal to 1. B. Shown are the results for changes in gene expression between 3 week B M H S C s (set to 1) and 4 week B M H S C s . Results shown are the mean o f the biological duplicates o f the mean o f the individually measured triplicates ± S E M o f the duplicates. 142  T a b l e 3.1: C R U frequency determinations for purified (1/10) single fetal liver HSC-derived clones under two conditions (pooled data from 2 experiments). Condition 1: 50 ng/ml SF  Condition 2: 300 ng/ml SF + 20 ng/ml IL-11  N o . positively-engrafted mice  N o . positively-engrafted mice  per total tested  per total tested  Single clones  Pooled clones (2)  Single clones  Pooled clones (5)  2/18  4/10  0/12  1/16  C R U : 1 /10  C R U : 1 / 100  143  R E F E R E N C E S  1. Barnes,D.W., F O R D , C . E . , G R A Y , S . M . , and L o u t i t J . F . 1959. Spontaneous and induced changes in cell populations in heavily irradiated mice. In Progress in nuclear energy (series VI). J.C.Bugher, Coursaget,J., and Loutit,J.F., editors. Pergamon Press Limited, London. 1-10.  2. Turhan,A.G., Humphries,R.K., Phillips,G.L., E a v e s , A . C , and Eaves,C.J. 1989. Clonal hematopoiesis demonstrated by X - l i n k e d D N A polymorphisms after allogeneic bone marrow transplantation. N.Engl'.J.Med. 320:1655-1661.  3.  Szilvassy,S.J., N i c o l i n i , F . E . , Eaves,C.J., and M i l l e r , C . L . 2001. Quantification o f murine and human hematopoietic stem cells by limiting-dilution analysis in competitively repopulated hosts. In Hematopoietic stem cell protocols. C.T.Jordan and K l u g , C . A . , editors. Humana Press, Tolowa, N J .  4. Eaves,C.J. and Eaves,A.C. 2006. Anatomy and physiology o f hematopoiesis. In Childhood Leukemias. C . - H . P u i , editor. Cambridge University Press, Cambridge.  5. Humphries,R.K., E a v e s , A . C , and Eaves,C.J. 1981. Self-renewal o f hemopoietic stem cells during mixed colony formation in vitro. Proc.Natl.Acad.Sci.  U.S.A 78:3629-3633.  6. Pawliuk,R., E a v e s , C , and Humphries,R.K. 1996. Evidence o f both ontogeny and transplant dose-regulated expansion o f hematopoietic stem cells in vivo. Blood 88:2852-2858.  144  7. Jordan,C.T. and LemischkaJ.R. 1990. Clonal and systemic analysis o f long-term hematopoiesis in the mouse. Genes Dev. 4:220-232.  8. T I L L , J . E . , M C C U L L O C H , E . A . , and S I M I N O V I T C H , L . 1964. A S T O C H A S T I C M O D E L OF S T E M C E L L PROLIFERATION, B A S E D O N T H E G R O W T H OF S P L E E N C O L O N Y - F O R M I N G C E L L S . Proc.Natl.Acad.Sci.U.S.A  51:29-36.  9. Harrison,D.E., Zhong,R.K., Jordan,C.T., Lemischka,I.R., and A s t l e , C . M . 1997. Relative to adult marrow, fetal liver repopulates nearly five times more effectively long-term than short-term. Exp.Hematol. 25:293-297.  10. Harrison,D.E. and A s t l e , C . M . 1982. Loss o f stem cell repopulating ability upon transplantation. Effects o f donor age, cell number, and transplantation procedure. J.Exp.Med. 156:1767-1779.  11. Rebel,V.L, M i l l e r , C . L . , Eaves,C.J., and Lansdorp,P.M. 1996. The repopulation potential o f fetal liver hematopoietic stem cells in mice exceeds that o f their liver adult bone marrow counterparts. Blood 87:3500-3507.  12. Jordan,C.T., McKearn,J.P., and LemischkaJ.R. 1990. Cellular and developmental properties o f fetal hematopoietic stem cells. Cell 61:953-963.  13. M i l l e r , C . L . , Rebel,V.L, Helgason,C.D., Lansdorp,P.M., and Eaves,C.J. 1997. Impaired steel factor responsiveness differentially affects the detection and long-term maintenance o f fetal liver hematopoietic stem cells in vivo. Blood 89:1214-1223.  145  14. Audet,J., M i l l e r , C . L . , Eaves,C.J., and P i r e t J . M . 2002. Common and distinct features of cytokine effects on hematopoietic stem and progenitor cells revealed by doseresponse surface analysis. Biotechnol.Bioeng. 80:393-404.  15.  M i l l e r , C . L . , Rebel,V.I., Lemieux,M.E., Helgason,C.D., Lansdorp,P.M., and Eaves,C.J. 1996. Studies o f W mutant mice provide evidence for alternate mechanisms capable o f activating hematopoietic stem cells. Exp.Hematol. 24:185-194.  16.  B u s k e , C , Feuring-Buske,M., A b r a m o v i c h , C , Spiekermann,K., Eaves,C.J., Coulombel,L., Sauvageau,G., Hogge,D.E., and Humphries,R.K. 2002. Deregulated expression o f H O X B 4 enhances the primitive growth activity o f human hematopoietic cells. Blood 100:862-868.  17.  Sauvageau,G., Thorsteinsdottir,U., Eaves,C.J., Lawrence,H.J., L a r g m a n , C , Lansdorp,P.M., and Humphries,R.K. 1995. Overexpression o f H O X B 4 in hematopoietic cells causes the selective expansion o f more primitive populations in vitro and in vivo. Genes Dev. 9:1753-1765.  18.  Thorsteinsdottir,U., Sauvageau,G., and Humphries,R.K. 1999. Enhanced in vivo regenerative potential o f HOXB4-transduced hematopoietic stem cells with regulation of their pool size. Blood 94:2605-2612.  19.  Oh,I.H. and Eaves,C.J. 2002. Overexpression o f a dominant negative form o f S T A T 3 selectively impairs hematopoietic stem cell activity. Oncogene 21:4778-4787.  20.  LessardJ. and Sauvageau,G. 2003. Bmi-1 determines the proliferative capacity o f normal and leukaemic stem cells. Nature 423:255-260.  146  21.  Iscove,N.N. and N a w a , K . 1997. Hematopoietic stem cells expand during serial transplantation in vivo without apparent exhaustion. Curr.Biol.  7:805-808.  22. Jacobsen,S.E., Veiby,O.P., MyklebustJ., Okkenhaug,C, and Lyman,S.D. 1996. Ability o f flt3 ligand to stimulate the in vitro growth o f primitive murine hematopoietic progenitors is potently and directly inhibited by transforming growth factor-beta and tumor necrosis factor-alpha. Blood 87:5016-5026.  23. A u d e t J . , M i l l e r . C . L . , Rose-John,S., P i r e t J . M . , and Eaves,C.J. 2001. Distinct role o f g p l 3 0 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc.Natl.Acad.Sci.U.S.A  98:1757-1762.  24. Uchida,N., Dykstra,B., Lyons,K.J., Leung,F.Y., and Eaves,C.J. 2003. Different in vivo repopulating activities o f purified hematopoietic stem cells before and after being stimulated to divide in vitro with the same kinetics. Exp.Hematol. 31:1338-1347.  25. Rebel,V.I. and Lansdorp,P.M. 1996. Culture o f purified stem cells from fetal liver results in loss o f i n vivo repopulating potential. J.Hematother. 5:25-37.  26. Pawliuk,R., E a v e s , C , and Humphries,R.K. 1996. Evidence o f both ontogeny and transplant dose-regulated expansion o f hematopoietic stem cells in vivo. Blood 88:2852-2858.  27. Morrison,S.J., Hemmati,H.D., W a n d y c z , A . M . , and Weissman,I.L. 1995. The purification and characterization o f fetal liver hematopoietic stem cells. Proc.Natl.Acad.Sci. U.S.A 92:10302-10306.  147  28.  Szilvassy,S.J., Humphries,R.K., Lansdorp,P.M., E a v e s , A . C , and Eaves,C.J. 1990. Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc.Natl.Acad.Sci.U.S.A  29.  87:8736-8740.  Szilvassy,S.J. and Cory,S. 1993. Phenotypic and functional characterization o f competitive long-term repopulating hematopoietic stem cells enriched from 5fluorouracil-treated murine marrow. Blood 81:2310-2320.  30. Randall,T.D. and WeissmanJ.L. 1997. Phenotypic and functional changes induced at the clonal level in hematopoietic stem cells after 5-fluorouracil treatment. Blood 89:3596-3606.  31.  Sato,T., L a v e r J . H . , and Ogawa,M. 1999. Reversible expression o f C D 3 4 by murine hematopoietic stem cells. Blood 94:2548-2554.  32.  Tajima,F., Deguchi,T., L a v e r J . H . , Zeng,H., and Ogawa,M. 2001. Reciprocal expression o f C D 3 8 and C D 3 4 by adult murine hematopoietic stem cells. Blood 97:2618-2624.  33. Zanjani,E.D., Almeida-Porada,G., Livingston,A.G., Zeng,H., and Ogawa,M. 2003. Reversible expression o f C D 3 4 by adult human bone marrow long-term engrafting hematopoietic stem cells. Exp.Hematol. 31:406-412.  34. Uchida,N., Dykstra,B., Lyons,K., Leung,F., Kristiansen,M., and Eaves,C. 2004. A B C transporter activities o f murine hematopoietic stem cells vary according to their developmental and activation status. Blood 103:4487-4495.  148  35. Doyonnas,R., Nielsen,J.S., Chelliah,S., Drew,E., Hara,T., Miyajima,A., and M c N a g n y , K . M . 2005. Podocalyxin is a CD34-related marker o f murine hematopoietic stem cells and embryonic erythroid cells. Blood 105:4170-4178.  36. R o y , V . , Miller,J.S., and V e r f a i l l i e , C . M . 1997. Phenotypic and functional characterization o f committed and primitive myeloid and lymphoid hematopoietic precursors in human fetal liver. Exp.Hematol. 25:387-394.  37. G l i m m , H . and Eaves,C.J. 1999. Direct evidence for multiple self-renewal divisions o f human in vivo repopulating hematopoietic cells in short-term culture. Blood 94:21612168.  38.  Ito,K., Hirao,A., Arai,F., Matsuoka,S., Takubo,K., HamaguchiJ., Nomiyama,K., Hosokawa,K., Sakurada,K., Nakagata,N. et al. 2004. Regulation o f oxidative stress by A T M is required for self-renewal o f haematopoietic stem cells. Nature 431:997-1002.  39.  Orlando,V. 2003. Polycomb, epigenomes, and control o f cell identity. Cell 112:599606.  40. Valk-Lingbeek,M.E., Bruggeman,S.W., and van Lohuizen,M. 2004. Stem cells and cancer; the polycomb connection. Cell 118:409-418.  41.  L u n d , A . H . and van Lohuizen,M. 2004. Polycomb complexes and silencing mechanisms. Curr.Opin.Cell  Biol. 16:239-246.  42. Kozar,K., Ciemerych,M.A., Rebel,V.L, Shigematsu,H., Zagozdzon,A., Sicinska,E., Geng,Y., Y u , Q . , Bhattacharya,S., Bronson,R.T. et al. 2004. Mouse development and cell proliferation in the absence o f D-cyclins. Cell 118:477-491.  149  43.  H o c k , H . , Hamblen,M.J., R o o k e , H . M . , SchindlerJ.W., Saleque,S., Fujiwara,Y., and Orkin,S.H. 2004. Gfi-1 restricts proliferation and preserves functional integrity o f haematopoietic stem cells. Nature 431:1002-1007.  44. Orkin,S.H. 1995. Hematopoiesis: how does it happen? Curr.Opin.Cell  45.  Biol. 7:870-877.  L i n g , K . W . , Ottersbach,K., van HamburgJ.P., Oziemlak,A., Tsai,F.Y., Orkin,S.H., Ploemacher,R., Hendriks,R.W., and Dzierzak,E. 2004. G A T A - 2 plays two functionally distinct roles during the ontogeny o f hematopoietic stem cells. J.Exp.Med. 200:871882.  46. Nichogiannopoulou,A., Trevisan,M., Neben,S., F r i e d r i c h , C , and Georgopoulos,K. 1999. Defects in hemopoietic stem cell activity in Ikaros mutant mice. J.Exp.Med. 190:1201-1214.  47. Lacorazza,H.D., Yamada,T., L i u , Y . , Miyata,Y., Sivina,M., N u n e s J . , and Nimer,S.D. 2006. The transcription factor M E F / E L F 4 regulates the quiescence o f primitive hematopoietic cells. Cancer Cell 9:175-187.  48.  P u i J . C . , Allman,D., X u , L . , DeRocco,S., K a r n e l l , F . G , Bakkour,S., L e e J . Y . , Kadesch,T., Hardy,R.R., A s t e r J . C . et al. 1999. N o t c h l expression in early lymphopoiesis influences B versus T lineage determination. Immunity. 11:299-308.  49. Karanu,F.N., Murdoch,B-, Miyabayashi,T., O h n o , M . , Koremoto,M., Gallacher,L., W u , D . , Itoh,A., Sakano,S., and Bhatia,M. 2001. Human homologues o f Delta-1 and Delta-4 function as mitogenic regulators o f primitive human hematopoietic cells. Blood 97:1960-1967.  150  50. Zhang,Z., Nadeau,P., Song,W., Donoviel,D., Y u a n , M . , Bemstein,A., and Yankner,B.A. 2000. Presenilins are required for gamma-secretase cleavage o f beta-APP and transmembrane cleavage o f Notch-1. Nat. Cell Biol. 2:463-465.  51. Ichikawa,M., Asai,T., Saito,T., Seo,S., Yamazaki,L, Yamagata,T., Mitani,K., Chiba,S., Ogawa,S., K u r o k a w a , M . et al. 2004. A M L - 1 is required for megakaryocyte maturation and lymphocytic differentiation, but not for maintenance o f hematopoietic stem cells in adult hematopoiesis. Nat.Med. 10:299-304.  52.  Growney,J.D., Shigematsu,H., L i , Z . , L e e , B . H . , AdelspergerJ., Rowan,R., Curley,D.P., K u t o k J . L . , Akashi,K., Williams,I.R. et al. 2005. Loss o f R u n x l perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106:494504.  53. Putz,G., Rosner,A., NuessleinJ., Schmitz,N., and Buchholz,F. 2006. A M L 1 deletion in adult mice causes splenomegaly and lymphomas. Oncogene 6:929-939.  54. Porcher,C, S w a t W . , Rockwell,K., Fujiwara,Y., A l t , F . W . , and Orkin,S.H. 1996. The T cell leukemia oncoprotein SCL/tal-1 is essential for development o f all hematopoietic lineages. Cell 86:47-57.  55. Robb,L., Elwood,N.J., Elefanty,A.G., Kontgen,F., L i , R . , Barnett,L.D., and Begley,C.G. 1996. The sci gene product is required for the generation o f all hematopoietic lineages in the adult mouse. EMBO J. 15:4123-4129.  56. H a l l , M . A . , Curtis,D.J., M e t c a l f D . , Elefanty,A.G., Sourris,K., Robb,L., GothertJ.R., Jane,S.M., and Begley,C.G. 2003. The critical regulator o f embryonic hematopoiesis,  151  S C L , is vital i n the adult for megakaryopoiesis, erythropoiesis, and lineage choice i n C F U - S 12. Proc.Natl.Acad.Sci.U.S.A  57.  100:992-997.  Curtis,D.J., H a l l , M . A . , V a n Stekelenburg,L.J., Robb,L., Jane,S.M., and Begley,C.G. 2004. S C L is required for normal function o f short-term repopulating hematopoietic stem cells. Blood 103:3342-3348.  58.  Jiang,X., Stuible,M., Chalandon,Y., L i , A . , Chan,W.Y., Eisterer,W., Krystal,G., Eaves,A., and Eaves,C. 2003. Evidence for a positive role o f SHIP in the B C R - A B L mediated transformation o f primitive murine hematopoietic cells and i n human chronic myeloid leukemia. Blood 102:2976-2984.  59.  Boggs,S.S., Chervenick,P.A., and Boggs,D.R. 1972. The effect o f postirradiation bleeding or endotoxin on proliferation and differentiation o f hematopoietic stem cells. Blood 40:375-389.  152  CHAPTER 4  STEEL FACTOR RESPONSIVENESS REGULATES T H E HIGH SELF-RENEWAL PHENOTYPE OF F E T A L HEMATOPOIETIC STEM C E L L S  The work presented in this Chapter was submitted for publication  Michelle B . Bowie and Connie J. Eaves  David Kent isolated the R N A and generated c D N A .  153  INTRODUCTION In the studies described in Chapters 2 and 3, a developmental switch that appears to simultaneously alter two key H S C properties - proliferative status and self-renewal potential was identified. To investigate the molecular basis o f this switch, with respect to the change in self-renewal potential, an in vitro model that supports fetal H S C self-renewal divisions was sought. M u c h effort has been directed to analyzing the growth factor requirements for maintaining bone marrow H S C s in culture and cocktails that support moderate expansion o f these cells have been identified (1-11). Similar efforts with fetal liver H S C s are more limited and have shown that their growth factor responses are quite different from those o f adult H S C s (12). The disparity between the high self-renewal capacity o f fetal liver H S C s in vivo (13-15) and the inability to achieve their maintenance i n vitro has led to a series o f experiments testing the potential o f various cell types to substitute for soluble growth factors in this regard (1;16;17), followed by the report that IGF-2, a product o f some supportive cell types, might be effective (17). The W41 mouse has a single point mutation in the tyrosine kinase domain o f the SF receptor, c-Kit, resulting in attenuated signalling following ligand binding as compared to the wild-type (+/+) receptor (18). The importance o f c-Kit activation for stimulating adult H S C self-renewal has been well documented (4;9;19;20). The effect o f the W41 mutation on H S C generation in vivo is much less severe in the fetus than in the adult (19). Evidence o f a minimal requirement o f fetal liver cells with a H S C phenotype to be stimulated by SF in order to expand their numbers has also been reported (21). These findings led us to hypothesize that the S F responsiveness o f H S C s might also be programmed to switch; to a decreased state. This decrease in SF responsiveness in H S C s might thereby reduce both their ability to execute symmetric self renewal divisions and their ability to be mitogenically activated and therefore  154  be an important regulator o f the switch in H S C properties described in Chapters 2 and 3. The studies described in this Chapter were designed to test this possibility that a change in SF responsiveness can account for the change in H S C cycling status and/or self-renewal activity as shown in Chapters 2 and 3.  RESULTS Fetal liver CRUs are more sensitive to SF than adult bone marrow HSCs In a first series o f experiments, 11 cocktails o f 5 different growth factors were assessed in 12 experiments for their ability to maintain fetal liver C R U s in culture for at least 48 hours. The results are shown in Figure 4.1. Consistent with previous reports, most cocktails failed to sustain a significant level o f C R U activity over a 48 hour period in culture. However, an important exception to this result was obtained when only SF was present at a concentration o f 50 ng/ml. Under this condition, all the fetal liver H S C s divided (see Figure 3.4C), but the number o f C R U s present after 2 days was maintained. Intriguingly, 50 ng/ml o f S F in the presence o f 20 ng/ml IL-11 was not able to maintain fetal liver C R U s for 48 hours in culture. This suggests that 20 ng/mL IL-11 is inhibitory to fetal liver C R U self-renewal, in the presence o f 50 ng/ml SF alone. To more fully define the SF sensitivity o f fetal liver H S C s , a full dose response curve was then generated using the same experimental design. A s shown i n Figure 4.2, the generation o f daughter C R U s in these cultures was optimal when SF was present at a concentration o f 50 ng/ml SF, with significantly reduced C R U outputs at 2x higher or 5-fold lower SF concentrations. B y comparison, optimal self-renewal o f cultured C R U s from adult bone marrow requires 300 ng/ml SF (4). Thus the maintenance o f in vivo repopulating activity by fetal liver and adult bone marrow C R U s stimulated to divide is highly  155  dependent on SF activation but, in this regard, fetal liver C R U s are 6-fold more sensitive to SF than their adult counterparts.  Fetal liver and adult bone marrow HSCs express the same levels of c-Kit. Next, a series o f experiments were undertaken to determine whether the different responses exhibited by fetal liver and adult bone marrow H S C s could be attributed to differences in their expression o f the SF receptor, c-Kit. Accordingly, the l i n " S c a l C D 4 3 M a c l a n d lin"Rho +  +  +  dull  SP  subpopulations o f fetal liver and adult bone marrow cells, respectively, from Pep3b (+/+) mice (-20% and - 3 0 % pure H S C s , as described in Chapter 3 and (22), respectively) were isolated and the levels o f c-Kit m R N A and cell surface protein then determined (Figure 4.3). Quantitative R T - P C R measurements o f c-Kit transcript showed no difference between the 2 highly enriched H S C populations compared. F l o w cytometric analysis o f the level o f c-Kit protein expressed on the cell surface in the same highly purified C R U populations yielded similar results to the m R N A data, as expected from historical data obtained from less purified populations (Figure 4.3 and (21)).  W41 fetal liver CRUs mimic +/+ adult bone marrow CRUs in their SF requirement for self-maintenance in vitro The W41 mutation encodes a form o f c-Kit that confers a reduced signalling capacity o f this receptor following SF binding; W41 C R U s would thus be characterized by a reduced SF sensitivity than their +/+ counterparts. Given that W41 mice have normal numbers o f H S C s in the fetus but not in the adult, this reduced SF sensitivity might only affect H S C expansion once these mice age past 3 weeks, the same time point at which self-renewal potential, cycling activity and multilineage potential decrease. To directly assess the SF responsiveness o f W41  156  C R U self-renewal at different stages o f development, we used the same type o f dose-response analysis o f 2-day cultured cells performed on +/+ C R U s (Figure 4.2). These experiments showed that the E14.5 fetal liver C R U s from W41 mice have a SF sensitivity very similar to adult bone marrow C R U s from +/+ mice, with a peak response i n terms o f W41 C R U selfmaintenance in cultures that contained 500 ng/ml SF. When adult bone marrow C R U s from W41 mice were tested in the same way, their SF sensitivity was found to be at least 10-fold further reduced. Thus, in spite o f a greatly reduced ability to activate normal pathways downstream o f c-Kit, the C R U s in W41 mice appear to undergo the same switch in S F responsiveness that characterizes the development o f adult C R U s from +/+ mice. To determine whether the decreased SF responsiveness o f C R U s in the W41 fetal liver relative to +/+ fetal liver C R U might nevertheless be sufficient to maintain these cells in cycle in vivo, l i n " S c a l C D 4 3 M a c l fetal liver cells were isolated from W41 E14.5 fetal livers and then +  +  +  stained with Hst to determine the distribution o f G0/G1 and S/G2/M cells within this fraction o f +/+-CRU-phenotype cells. Although the C R U content o f this phenotype in the W41 fetal liver was not assessed, the frequency o f these cells among the T e r l 19-depleted cells was the same as in the corresponding +/+ T e r l 19-depleted cells (1/4115 ± 913 W41 fetal liver cells, n=2 vs. 1/4944 ± 834 +/+ fetal liver cells, respectively), consistent with a similar frequency o f C R U s (19). The Hst staining revealed an approximately equal proportion o f H S C s between the Go/Gi ( 2 N D N A ) and S / G / M (>2N D N A ) fractions (Figure 4.4), indicating that the W41 fetal 2  liver H S C s are a cycling population, despite lower SF responsiveness.  157  The proliferative activity of W41 CRUs is not impaired in the fetus but the self-renewal in vivo mimics the characteristic reduced activity of adult +/+ CRUs W41 H S C s are hyposensitive to soluble SF in vitro, like +/+ adult bone marrow H S C s , but their sensitivity to the more potent, membrane-bound SF (23) under transplantation conditions in vivo might be similar to +/+ fetal liver. We therefore examined the self-renewal activity o f W41 fetal liver C R U s in vivo, using the same serial transplant design outlined in Chapter 3. Accordingly, the 10 fetal liver cells (estimated to contain 10 W41 fetal liver C R U s (19)) were 4  transplanted into lethally irradiated Pep3b mice and then at weekly intervals up to 4 weeks later, the number o f W41 C R U s regenerated in the bone marrow o f these hosts was measured by performing limiting dilution C R U assays in secondary Pep3b recipients. The results, shown in Figure 4.5, indicate that the rate o f W41 fetal liver C R U self-renewal in vivo was the same as previously characterized for C R U s from +/+ adult bone marrow (Chapter 3), not +/+ fetal liver.  DISCUSSION Based on observations in Chapter 3, suggesting that fetal liver and adult bone marrow H S C s self-renew using different mechanisms, an initial objective was to identify critical signalling pathways for fetal liver H S C self-renewal. In vitro analysis o f potentially supportive growth factor conditions revealed that 50 ng/mL o f SF, in the absence o f other growth factors, can maintain fetal liver H S C s for 48 hours.  This condition obviously does not recapitulate the  HSC-supportive environment o f the E14.5 fetal liver and suggests that a variety o f other parameters may be required for optimal regenerative potential, such as cell-cell interactions. It did, however, draw attention to the fact that 50 ng/mL is a lower dose than that previously described as optimal for adult H S C s (4).  158  The objective o f the experiments was then to determine whether a change in SF signalling might explain the reduced proliferative activity and self-renewal potential acquired by H S C s during development. Here we demonstrate that a change in SF signalling alone is not sufficient to alter the proliferative activity o f H S C s , as W41 E14.5 fetal liver H S C s are a cycling population, but we provide evidence that the reduced self-renewal potential o f H S C s , both in vitro and in vivo, can be caused by a reduced sensitivity to SF. Dose response curves for SF-dependent H S C self-renewal in vitro revealed that the sensitivity o f fetal liver and adult H S C s differed by a factor o f approximately 6 (50 ng/mL vs. 300 ng/mL), occurred independently o f the amount o f c-Kit expressed by these cells and correlated with their selfrenewal behaviour in vivo as assessed quantitatively in a transplant-based regeneration assay. A s predicted by earlier studies, this change in SF sensitivity was not mediated by a change in c-Kit expression. Therefore, it seems more likely that these differential effects o f SF are due either to a developmentally regulated change in the surface organization o f c-Kit, or in the coordinated integration o f c-Kit activation within additional signalling pathways, or in downstream events that mediate effects o f c-Kit activation on self-renewal decisions. For example, in the latter case, a downstream effector o f c-Kit might be envisaged to become limiting as a result o f the fetal-to-adult switch. Previous studies have shown that the concentration o f SF required to maximize the mitogenesis o f adult H S C s is much lower than what is required to maximize their self-renewal i n vitro (4). This differential requirement for c-Kit activation might explain why the reduced signalling capacity o f W41 fetal liver H S C s would be sufficient to sustain their proliferation at a high rate in the fetus, in spite o f an impaired self-renewal activity when stimulated to grow in the microenvironment o f the irradiated adult bone marrow. The findings o f Iscove and N a w a that the self-renewal o f adult  159  bone marrow H S C s from +/+ mice could be enhanced by in vivo administration o f SF (and I L 11) is consistent with this hypothesis (20). It is important to acknowledge that soluble SF is not as potent as membrane-bound SF in c-Kit signalling and in vivo, membrane-bound SF is critical to adequately sustain hematopoiesis (23). Therefore, the SF concentration requirements documented here and in previous studies (4) presumably mirror those required to match the signalling achievable from cell-bound SF in vivo. Although not pinpointed here, we propose that the change in SF responsiveness is likely to occur abruptly between 3 week and 4 weeks after birth, similarly to the observed change i n self-renewal potential at this time point (Chapter 3). This could easily be determined by future comparison o f the SF dependence o f H S C self-renewal in vitro from 3 and 4 week-old mice.  MATERIALS AND METHODS Animals. C57Bl/6:Pep3B (Ly5.1) and W41 (Ly5.2) mice were used as donors and recipients, respectively, or vice versa, as indicated. C e l l suspensions were prepared from E l 4 . 5 fetal liver and the bone marrow o f 10 week-old adult mice as described in Chapter 2.  CRU assay. When Pep3B mice were used as recipients, they were irradiated with 2 doses o f 400 c G y X-rays, separated by 4 hours. W41 recipients were irradiated once with 360 c G y X rays. A l l transplants were injected intravenously. Recipients were analyzed for multi-lineage ( G r l , M a c l , B220, L y l ) donor-derived repopulation after 16 weeks and C R U frequencies calculated as described in Chapter 2.  160  HSC cultures. Fetal liver cells depleted o f T e r l 19 cells and W41 bone marrow cells depleted +  of l i n cells (EasySep, StemCell Technologies) were cultured at a concentration o f 10 +  6  cells/ml, for 48 hours i n serum-free medium with various growth factors as indicated.  After  48 hours, cells were harvested and C R U assays were performed.  RNA analysis. The l i n " S c a - l C D 4 3 M a c l fraction o f E14.5 fetal liver cells and the lin'Rho+  d u l l  SPCD45  m i d  +  +  fraction o f adult bone marrow cells were isolated by F A C S as described i n  Chapter 2 and (22), respectively. R N A was isolated, transcribed into c D N A and quantitativeR T - P C R was then performed (as described i n Chapter 2). Primers for c-Kit (NM_021099.2) were as follows: forward A C A A G A G G A G A T C C G C A A G A and reverse G A A G C T C A G C A A A T C A T C C A G , for Gapdh (NM_008084) were as follows: forward primer A A C T T T G G C A T T G T G G A A G G , reverse primer A T G C A G G G A T G A T G T T C T G G .  Protein expression. E14.5 fetal liver and week 10 bone marrow cells were stained with lin" (no M a c l ) S c a l C D 4 3 and lin" SP R h o " as described i n Chapter 2 and (22), analyzed by F A C S +  +  du  and the geometric mean o f their c-Kit fluorescence intensities determined and compared.  Cell cycle analysis. The l i n " S c a l C D 4 3 M a c l fraction o f E l 4.5 T e r l 19" fetal liver cells from +  +  +  were co-stained with Hoechst 33342 and their distribution i n Go/Gi vs. S/G2/M assessed using gates to distinguish cells with 2n vs. >2n D N A , respectively, as described i n Chapter 2.  Assays of HSC self-renewal in vivo. 10 unfractionated fresh Vf^'/W fetal liver cells, 5  41  containing an estimated 10 C R U s (19), were injected intravenously into irradiated primary Pep3b hosts and then 1,2,3 and 4 weeks later, groups o f these were sacrificed and the bone  161  marrow cells from these primary recipients was harvested from all four leg bones. Single cell suspensions were prepared and tested for regenerated ff^'/W C R U content by limiting 41  dilution assays performed in secondary irradiated Pep3b recipients, as described above and in Chapter 3.  Statistical  Analysis.  Comparisons were made using the W a l d test  162  FIGURES  20  40  60  80  100  CRU ouput (% of input)  F i g u r e 4.1: Comparison o f the effects o f different growth factor cocktails on fetal liver C R U self-maintenance in vitro The number o f C R U s recovered after 48 hours from each culture is expressed as a percent o f the input number., C R U numbers were determined by 16-week limiting dilution transplantation assays as described in Chapter 2. Values shown are the mean ± S E M o f results pooled from 2 to 5 experiments. Growth factor concentrations are in ng/ml.  163  F i g u r e 4.2: Steel factor dose response curves for the in vitro self-renewal o f +/+ and W41 C R U s from fetal liver and adult bone marrow. Data shown for each source o f C R U s are expressed as a percent o f the number of C R U s recovered in the culture that yielded the maximum C R U output: +/+ fetal liver (FL) (open circles); W41 F L (solid circles); W41 bone marrow ( B M ) (solid squares). Data for +/+ B M is redrawn from results presented in (4).  164  A  B  Rhodamine  Hst Red  cKit-APC  Figure 4.3: Comparison o f c-Kit expression on fetal liver and adult bone marrow H S C s . A. Representative profile o f E14.5 T e r l 19- fetal liver ( F L ) viable, lin" cells assessed for Seal and C D 4 3 expression, further analyzed for intensity o f c-Kit protein expression. B. Shown are the results o f fold-change in cKit gene expression relative to gapdh between purified Lin" S c a l C D 4 3 M a c l F L H S C s (as shown i n A ) and L i n " R h o " SP bone marrow ( B M ) H S C s (as shown in C ) on the left, and the geometric mean fluorescence intensity (M.F.I) o f c-Kit protein expression in each o f these same populations. C. Representative profile o f adult B M viable cells, selected within the L i n " R h o fraction, further enriched as SP cells and assessed for intensity o f c-Kit protein expression. +  +  +  du  dul  165  (  CD43-FITC  Hoechst 33342  Figure 4.4: C e l l cycle analysis of W41 fetal liver H S C s . Shown is a representative staining o f viable, lineage" E14.5 W41 fetal liver cells (n=2). These cells were further enriched for M a c l cells and their distribution in Go/Gi vs. S/G2/M was assessed by Hoechst staining. +  166  1  2  -  3  4  Weeks post-transplant  Figure 4.5: W41 fetal liver H S C s self-renew at the adult bone marrow H S C self-renewal rate. Results shown are the number o f donor C R U per recipient, as determined by secondary C R U assays, from the transplant o f 10 donor W41 fetal liver (FL) H S C s , assayed after weeks 1, 2, 3 and 4. For comparison, the similar results from +/+ F L (dotted line) and +/+ bone marrow ( B M ) (dashed line) are shown, as described in Chapter 3. Values shown are the mean ± S E M of results from 4 experiments.  167  R E F E R E N C E S  1. M o o r e , K . A . , Ema,H., and LemischkaJ.R. 1997. In vitro maintenance o f highly purified, transplantable hematopoietic stem cells. Blood 89:4337-4347.  2.  Audet,J., Zandstra,P.W., Eaves,C.J., and Piret,J.M. 1998. Advances in hematopoietic stem cell culture. Curr.Opin.Biotechnol. 9:146-151.  3.  Audet,J., M i l l e r , C . L . , Rose-John,S., Piret,J.M., and Eaves,C.J. 2001. Distinct role o f g p l 3 0 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc.Natl.Acad.Sci.U.S.A  98:1757-1762.  4. Audet,J., M i l l e r , C . L . , Eaves,C.J., and Piret,J.M. 2002. Common and distinct features of cytokine effects on hematopoietic stem and progenitor cells revealed by doseresponse surface analysis. Biotechnol.Bioeng. 80:393-404.  5. Ramsfjell,V., Borge,O.J., Veiby,O.P., Cardier,J., Murphy,M.J., Jr., Lyman,S.D., Lok,S., and Jacobsen,S.E. 1996. Thrombopoietin, but not erythropoietin, directly stimulates multilineage growth o f primitive murine bone marrow progenitor cells in synergy with early acting cytokines: distinct interactions with the ligands for c-kit and F L T 3 . Blood 88:4481-4492.  6. de Haan,G., Weersing,E., Dontje,B., van Os,R., Bystrykh,L.V., Vellenga,E., and M i l l e r , G . 2003. In vitro generation o f long-term repopulating hematopoietic stem cells by fibroblast growth factor-1. Dev. Cell 4:241-251.  168  7. Petzer,A.L., Eaves,C.J., Barnett,M.J., and Eaves,A.C. 1997. Selective expansion o f primitive normal hematopoietic cells in cytokine-supplemented cultures o f purified cells from patients with chronic myeloid leukemia. Blood 90:64-69.  8. Zandstra,P.W., Conneally,E., Petzer,A.L., Piret,J.M., and Eaves,C.J. 1997. Cytokine manipulation o f primitive human hematopoietic cell self-renewal. Proc.Natl.Acad.Sci.U.S.A  94:4698-4703.  9. M i l l e r , C . L . and Eaves,C.J. 1997. Expansion in vitro o f adult murine hematopoietic stem cells with transplantable lympho-myeloid reconstituting ability. Proc.Nad.Acad.Sci. U.S.A 94:13648-13653.  10.  Ema,H., Takano,H., Sudo,K., and Nakauchi,H. 2000. In vitro self-renewal division o f hematopoietic stem cells. J.Exp.Med. 192:1281-1288.  11.  Nakauchi,H., Sudo,K., and E m a , H . 2001. Quantitative assessment o f the stem cell selfrenewal capacity. Ann.N.Y.Acad.Sci. 938:18-24.  12.  Rebel,V.I. and Lansdorp,P.M. 1996. Culture o f purified stem cells from fetal liver results in loss o f in vivo repopulating potential. J.Hematother. 5:25-37.  13.  Morrison,S.J., Hemmati,H.D., W a n d y c z , A . M . , and WeissmanJ.L. 1995. The purification and characterization o f fetal liver hematopoietic stem cells. Proc.Natl.Acad.Sci. U.S.A 92:10302-10306.  14.  R e b e l , V J . , M i l l e r , C . L . , Eaves,C.J., and Lansdorp,P.M. 1996. The repopulation potential o f fetal liver hematopoietic stem cells in mice exceeds that o f their liver adult bone marrow counterparts. Blood 87:3500-3507.  169  15. Pawliuk,R., E a v e s , C , and Humphries,R.K. 1996. Evidence o f both ontogeny and transplant dose-regulated expansion o f hematopoietic stem cells in vivo. Blood 88:2852-2858.  16. Zhang,H., M i a o , Z . , He,Z., Yang,Y., Wang,Y., and Feng,M. 2005. The existence o f epithelial-to-mesenchymal cells with the ability to support hematopoiesis in human fetal liver. Cell Biol.Int. 29:213-219.  17. Zhang,C.C. and Lodish,H.F. 2004. Insulin-like growth factor 2 expressed in a novel fetal liver cell population is a growth factor for hematopoietic stem cells. Blood 103:2513-2521.  18. Herbst,R., Shearman,M.S., Obermeier,A., SchlessingerJ., and U l l r i c h , A . 1992. Differential effects o f W mutations on pl45c-kit tyrosine kinase activity and substrate interaction. J.Biol.Chem. 267:13210-13216.  19. M i l l e r , C . L . , Rebel,V.I., Helgason,C.D., Lansdorp,P.M., and Eaves,C.J. 1997. Impaired steel factor responsiveness differentially affects the detection and long-term maintenance o f fetal liver hematopoietic stem cells in vivo. Blood 89:1214-1223.  20. Iscove,N.N. and N a w a , K . 1997. Hematopoietic stem cells expand during serial transplantation in vivo without apparent exhaustion. Curr.Biol. 7:805-808.  21.  Ikuta,K. and WeissmanJ.L. 1992. Evidence that hematopoietic stem cells express mouse c-kit but do not depend on steel factor for their generation. Proc.Natl.Acad.Sci. U.S.A 89:1502-1506.  170  22. Uchida,N., Dykstra,B-, Lyons,K.J., Leung,F.Y., and Eaves,C.J. 2003. Different i n vivo repopulating activities o f purified hematopoietic stem cells before and after being stimulated to divide i n vitro with the same kinetics. Exp.Hematol. 31:1338-1347.  23. B r o u d y , V . C . 1997. Stem cell factor and hematopoiesis. Blood 90:1345-1364.  171  CHAPTER 5  CONCLUSIONS AND FUTURE DIRECTIONS  In this thesis, I have presented the results o f experiments that, for the first time, define the timing o f changes in H S C proliferative activity, self-renewal and differentiation behaviour that occur during development. These have revealed the unexpected discovery o f an abrupt and coordinated change in all o f these properties between 3 and 4 weeks after birth. For each o f these parameters, a quantitative assay/endpoint was devised and then H S C s from fetal, weanling and young adult mice were assessed with respect to each parameter. The first evidence o f this "switch" came from studies o f the proliferative activity o f the H S C s present at each o f these stages o f development, as assessed using 3 different methodologies (as described in Chapter 2), and subsequently confirmed by gene expression analyses o f highly purified H S C s populations isolated from these different sources. These studies indicated that all H S C s are maintained in a state o f constant turnover until 3 weeks after birth regardless o f their location (in the liver or bone marrow) but then, within a period o f one week >80% have transitioned into a quiescent state without further change in this level o f proliferative activity through to adulthood. Interestingly, when the self-regenerative properties o f H S C s from the same stages o f development were subsequently examined (Chapter 3), these were also found to transition from a fetal phenotype to an adult phenotype at exactly the same time. Thus, it was possible to show that the H S C s in transplanted bone marrow from 3 week-old mice displayed the rapid HSC-regenerating activity characteristic o f fetal H S C s , whereas the results for similarly assessed H S C s from the bone marrow o f 4 week-old mice were superimposable on the data for  172  H S C s from adult bone marrow, which display a much slower HSC-regenerating activity. In addition, I undertook a series o f experiments with highly purified fetal liver H S C s in vitro which demonstrated that, unlike their differentiating progeny (1 ;2), the cell cycle transit time of optimally stimulated fetal and adult H S C s is identical. These experiments are important as they strongly suggest that the different rates o f H S C regeneration obtained by fetal and adult H S C s in the bone marrow o f irradiated adult mice is determined by differences in their selfrenewal response to the conditions activated in these hosts. A s also shown in Chapter 3, the spectrum o f differentiated progeny generated by transplanted H S C s also changes at precisely the same time during development (resulting in a reduced output o f circulating granulocytes and monocytes by the H S C s present in mice that are 4 weeks-old or more). Both the distinctive high self-renewal behaviour and higher output of granulocytes and/or monocytes were also found to change after the same duration o f fetal H S C proliferation in transplanted adult hosts. Thus the switch itself, as well as its precise timing, does not appear to be dependent on extrinsic conditions that are determined either by the site or the developmental status o f the host, favouring the view that they are intrinsically programmed. The unexpected speed and synchrony o f these changes suggests the operation o f some master "switch" mechanism. A n d , i f the mechanism that regulates the intrinsic responsiveness o f H S C s to factors that control their cycling status proves to be independent o f the environment in which the H S C s are located, as found for their self-renewal potential and distribution o f mature progeny output, this would imply that this putative switch may, itself be intrinsically regulated and pre-programmed - perhaps determined either by time and/or the number o f divisions H S C s are stimulated to execute.  173  Because o f the evidence indicating that all H S C s are cycling up until 3 weeks after birth in the normal mouse, genetic strategies to promote H S C quiescence might be anticipated to cause a delay in the timing o f the 'switch' seen here to occur between 3 and 4 weeks o f age. Recently, the loss o f the transcription factor M E F was shown to promote the quiescence o f adult H S C s (3). Therefore, it would be interesting in the future to examine i f this might also be true o f fetal H S C s , and i f so, whether the predicted delay in altered self-renewal activity would also be seen. This is o f particular interest, given that Chapter 3 also shows that M E F is up-regulated in pre-switch H S C s . The other genes found to be higher in expression, such as Ikaros (4-6) or rae-28 (7), both genes shown to be critical to H S C expansion, would also be candidates o f interest for this strategy. M E F " bone marrow H S C s have also been found to _/  respond differently when maintained under homeostatic conditions as compared to conditions activated in response to hematologic injury. Conversely, forced overexpression in pre-switch H S C s o f genes found to be higher expressed in post-switch H S C s might also facilitate inducing a premature post-switch state. Particularly, A T M , Ezh2 and Gata-2, the genes with the highest fold change in the 4 week versus 3 week bone marrow H S C s would be strong candidates to study. These findings point to the likelihood that a small set o f genes, including MEF, rae-28, Ikaros, Ezh2, Gata-2 and ATM, may be part o f a program that co-regulates H S C proliferative activity and self-renewal function. Other candidates are the cyclindependent kinase inhibitor (CKI) p 2 1  C i p l / W a f l  which when deleted, has been shown to increase  specifically the proportion o f cycling H S C s (but not their derivative progenitors) and under these stress conditions self-renewal activity appeared to be compromised (8), the p l S ^ 1 1  4 0  C K I , shown to limit the potential o f adult H S C self-renewal in vivo (9), or genes within the specific clusters on chromosome 11, shown to be disproportionately distinctly expressed i n  174  D B A / 2 versus C 5 7 B L / 6 mice (10), specifically related to their demonstrated differences i n H S C proliferation (11). One can also envisage various mechanisms that might mediate such effects; for example, a very long-lived (or functionally sequestered) protein or m R N A that decayed at a slow rate to finally reach a critical threshold level. This type o f cell division-related threshold has been well studied in the case o f telomeres, and the regulation o f telomere length and telomerase activity is tightly linked to cell cycle regulation (12). Yet telomeres seem unlikely to be a playing this type o f critical role in murine H S C s as it has been proposed that telomere shortening evolved as a tumor suppressor mechanism not found i n short-lived mammals, such as mice (13). In fact, it has been demonstrated that significant numbers o f generations o f mice must be followed before defects due to telomere shortening become evident, as mouse telomeres are extremely long (14; 15). However, this does not preclude that a particular length of telomeres, long as it may be, is a threshold signal for a cascade o f 'switch' responses to begin. The demonstration that adult bone marrow H S C s have shorter telomeres than those from the fetal liver or cord blood seems to suggest a continued decline in telomere length occurs with age (16). The rapid switch that takes place in the type o f globin expressed in maturing erythroblasts has also been well-studied. There, a role for the chromatin-remodeling complex ( P Y R complex) and its T F binding partner, Ikaros, has been well demonstrated. M i c e null for Ikaros not only show a significant loss o f H S C s (4), but display a delay in the murine embryonic to adult P-globin switch (17). c D N A array analysis on these mice indicated that several hematopoietic-specific genes across all lineages were changed in the day 14 embryos. Therefore Ikaros, PYR and a number o f other chromatin-remodelling genes, such as members  175  of the polycomb-group (Bmi-1, mel-18, rae28, Ezh2) (18-20) continue to be strong candidates to test for playing a role i n the H S C switch demonstrated in this Thesis. It is worth noting that i f such a switch was determined to be cell division-dependent, it would not necessarily imply that one final H S C division was required for a transition from the fetal to the adult state. This could instead be quickly and easily regulated without the need o f a change-of-state cell division, by changing any number o f factors within the same cell: a loss or gain in a transcription factor, or set o f transcription factors, again past a given threshold; any epigenetic changes, etc. Complicating the matter further is the heterogeneity o f the adult H S C , for example with obvious subtypes related to differences in their patterns o f repopulation in vivo (21). Further investigations of H S C properties that are similarly altered during development may also offer new clues to the mechanisms that regulate the changes observed here. A s described in the Introduction to this Thesis (Chapter 1), there are a number o f cell surface markers whose expression is different between adult and fetal H S C s and i n some cases, evidence o f a post-natal change between 3. and 10 weeks o f age has been reported (22-28). More carefully timed analyses w i l l be useful to determine how closely these changes track relative to the functional changes described in this thesis. If coordinated, common transcription factor binding sites in the promoters o f genes encoding for these cell surface markers, along with those o f genes found i n Chapter 3 to change i n coordination, could then be sought in silico. Particularly, to look for activators o f expression o f genes found to be upregulated in post-switch H S C s and repressors o f those down-regulated in this population, as playing a role in promoting the switch itself.  176  A corresponding mechanistic change in H S C s has been described in Chapter 4, which points to a role for c-Kit signalling, responsible, at least, for to the change in self-renewal potential. Chapter 4 describes a change in the H S C responsiveness to SF signalling as H S C s progress through development, to explain the reduced self-renewal potential that H S C s acquire during development, as described in Chapter 3, but not their reduced proliferative potential. A full dose-response curve showed that the sensitivity o f fetal liver and adult H S C s differ, but that W41 fetal liver H S C s were similar to +/+ adult H S C s . However, purified fetal liver H S C s were shown to express the same level o f c-Kit m R N A as adult bone marrow H S C s and even the same mean fluorescence intensity o f c-Kit expressed on the cell surface o f pure fetal liver and adult bone marrow H S C s , suggesting that there is likely to be a developmentally regulated change in the surface organization o f c-Kit or in a downstream or cooperative signalling component. W41 fetal liver H S C s were demonstrated to also share the same in vivo self-renewal kinetics as adult bone marrow H S C s , indicating that H S C responsiveness to SF signalling was directly related to the rate o f self-renewal. These results suggest that the levels o f SF expressed in the bone marrow of an irradiated recipient is limiting to adult bone marrow, but not +/+ fetal liver H S C s , and treatment o f recipients o f bone marrow H S C s with SF could therefore be a means by which to increase the rate o f regeneration following bone marrow transplantation. These findings raise the question o f which effectors o f SF signalling, potentially transcription factors, might be regulating the intensity o f c-Kit downstream signalling, as these may be critical points o f control for the potential 'master switch'. A set o f transcription factors acting as negative regulators o f expression o f key components to c-Kit signalling would be presumed to be up-regulated at a point in time between 3 and 4 weeks post-birth.  177  Alternatively, complexes involved in the repression o f promoter accessibility o f genes mediated c-Kit signalling may be up-regulated, either as direct mediators o f chromatin condensation or by enhancing rapid methylation o f the promoter region; each o f which would result in a decreased amount o f expression o f such key genes in H S C s after 3 weeks post-birth. In Chapter 2, an examination o f the differences in cycling status o f H S C s through development highlighted one H S C - c y c l i n g property that did not change through development: H S C s in S / G 2 / M phase o f the cell cycle have a perpetual inability to engraft irradiated recipients. This has obvious clinical ramifications, as expanded H S C s are routinely used when there is a need for H S C s in the clinic and therefore a significant proportion o f these are useless under current procedures. Chapter 2 provides evidence that this defect can be overcome when the recipient environment specifically (not the test cells) is pre-treated with an antagonist to S D F - 1 . However, the mechanism by which the host interacts with a cell autonomous property such as the cell cycle status is still unclear, specifically after treatment with the SDF-1 antagonist. We have proposed a logical model based on the additional evidence that SDF-1 is up-regulated in S / G 2 / M H S C s compared to H S C s in G i , suggesting that the high levels o f SDF-1 in these cells saturates the C X C R 4 receptors expressed on these same cells, preventing their ability to respond to SDF-1 gradients, unless these gradients were very strong. In Chapter 2, we hypothesized that SDF-1 G2 treatment can generate a stronger gradient o f S D F 1 in the host, allowing S / G 2 / M H S C s to now engraft.  It is of great interest to determine  whether SDF-1 G2 treatment can result in increased levels o f SDF-1 expressed at niche cells. Since the SDF-1 antagonist acts on C X C R 4 in the niche, but not cell-autonomously on stem cells, the population o f cells in the recipient's environment that do express C X C R 4 and mediate the observed effects are o f great interest to identify and characterize. Various candidates, such as stromal and epithelial cells could be isolated and tested in vitro for their  178  differential ability to bind to S / G / M and G / G i H S C s . A s well, the ability o f S / G / M and 2  0  2  Go/Gi H S C s to migrate through these cells could be tested, both before and after SDF-1 G 2 treatment o f the niche cells under investigation. Such experiments w i l l provide evidence o f the mechanism that explains these exciting observations. There are potential clinical applications o f the findings presented in this Thesis. For example, in Chapter 2, the results o f experiments on the S / G / M engraftment defect predict 2  that intrafemoral injection o f transplants is unlikely to be a useful strategy for improving the therapeutic effectiveness o f H S C s induced to expand in vitro. Particularly exciting is the idea that pre-treatment o f recipients o f cycling cells with an SDF-1 antagonist could potentially improve the therapeutic effectiveness o f these cells by as much as 100% (assuming that half o f the H S C in a cycling population are in S / G / M ) . The induction o f adult bone marrow H S C 2  cycling is a consequence o f culturing to expand these prior to transplantation or to genetically modify these; currently readily used and increasingly attempted strategies, respectively. The information presented in Chapter 4 could also provide new strategies for expanding H S C s , particularly as one growth factor condition, 50 ng/ml SF, has now been shown to maintain fetal liver H S C s in culture. Again, the ability to maintain fetal liver H S C s in culture is a necessity for successful attempts at genetic modification. The induction, development, and progression o f a leukemic disease is thought to arise through deregulation o f the cycling, self-renewal and/or differentiation control in H S C s .  This  thesis has presented new evidence o f controlled changes in all o f these properties: Chapter 2 reveals programmed changes in the cycling status o f H S C s , Chapter 3 reveals programmed changes in the self-renewal and differentiation potential o f H S C s and Chapter 4 identifies a role for SF responsiveness in regulating differences in H S C self-renewal potential, but not the cycling status o f H S C s . This information thus provides the potential to gain further insights  179  into leukemogenesis, through continued delineation of the molecular basis of the unique programs operative in pre-switch HSCs and how these regulate the pre-switch HSC properties described.  180  REFERENCES  1. Schofield,R. 1970. A comparative study o f the repopulating potential o f grafts from various haemopoietic sources: C F U repopulation. Cell Tissue Kinet. 3:119-130.  2. R o y , V . , M i l l e r J . S . , and V e r f a i l l i e , C . M . 1997. Phenotypic and functional characterization o f committed and primitive myeloid and lymphoid hematopoietic precursors in human fetal liver. Exp.Hematol. 25:387-394.  3. Lacorazza,H.D., Yamada,T., L i u , Y . , Miyata,Y., Sivina,M., N u n e s J . , and Nimer,S.D. 2006. The transcription factor M E F / E L F 4 regulates the quiescence o f primitive hematopoietic cells. Cancer Cell 9:175-187.  4. Nichogiannopoulou,A., Trevisan,M., Neben,S., F r i e d r i c h , C , and Georgopoulos,K. 1999. Defects in hemopoietic stem cell activity i n Ikaros mutant mice. J.Exp.Med. 190:1201-1214.  5. Georgopoulos,K. 2002. Haematopoietic cell-fate decisions, chromatin regulation and ikaros. Nat.Rev.Immunol. 2:162-174.  6. Yoshida,T., Y a o - M i n g , N . S . , Zuniga-Pflucker,J.C, and Georgopoulos,K. 2006. Early hematopoietic lineage restrictions directed by Ikaros. Nat.Immunol. 7:382-391.  7. Ohta,H., Sawada,A., K i m , J . Y . , Tokimasa,S., Nishiguchi,S., Humphries,R.K., Hara,J., and Takihara,Y. 2002. Polycomb group gene rae28 is required for sustaining activity of hematopoietic stem cells. J.Exp.Med. 195:759-770.  181  8.  Cheng,T. and Scadden,D.T. 2002. C e l l cycle entry o f hematopoietic stem and progenitor cells controlled by distinct cyclin-dependent kinase inhibitors. Int.J.Hematol. 75:460-465.  9. Yuan,Y., Shen,H., Franklin,D.S., Scadden,D.T., and Cheng,T. 2004. In vivo selfrenewing divisions o f haematopoietic stem cells are increased in the absence o f the early GI-phase inhibitor, p l 8 I N K 4 C . Nat. Cell Biol. 6:436-442.  10. de Haan,G., Bystrykh,L.V., Weersing,E., Dontje,B., Geiger,H., Ivanova,N., LemischkaJ.R., Vellenga,E., and V a n Zant,G. 2002. A genetic and genomic analysis identifies a cluster o f genes associated with hematopoietic cell turnover. Blood 100:2056-2062.  11. de Haan,G., Nijhof,W., and V a n Zant,G. 1997. Mouse strain-dependent changes i n frequency and proliferation o f hematopoietic stem cells during aging: correlation between lifespan and cycling activity. Blood 89:1543-1550.  12. A l l s o p p , R . C . and WeissmanJ.L. 2002. Replicative senescence o f hematopoietic stem cells during serial transplantation: does telomere shortening play a role? Oncogene 21:3270-3273.  13. Baerlocher,G.M., Roth,A., and Lansdorp,P.M. 2003. Telomeres i n hematopoietic stem cells. Ann.N. Y.Acad.Sci. 996:44-48.  14. B l a s c o , M . A . , Lee,H.W., HandeJVI.P., Samper,E., Lansdorp,P.M., DePinho,R.A., and Greider,C.W. 1997. Telomere shortening and tumor formation by mouse cells lacking telomerase R N A . Cell 91:25-34.  182  15. N i i d a , H . , Matsumoto,T., Satoh,H., Shiwa,M., Tokutake,Y., Furuichi,Y., and Shinkai,Y. 1998. Severe growth defect i n mouse cells lacking the telomerase R N A component. Nat. Genet. 19:203-206.  16. V a z i r i , H . , Dragowska,W., A l l s o p p , R . C , Thomas,T.E., Harley,C.B., and Lansdorp,P.M. 1994. Evidence for a mitotic clock i n human hematopoietic stem cells: loss o f telomeric D N A with age. Proc.Natl.Acad.Sci.  U.S.A 91:9857-9860.  17. Lopez,R.A., Schoetz,S., DeAngelisJC., 0 ' N e i l l , D . , and Bank,A. 2002. Multiple hematopoietic defects and delayed globin switching i n Ikaros null mice. Proc.Natl.Acad.Sci. U.S.A 99:602-607.  18. Iwama,A., Oguro,H., Negishi,M., Kato,Y., and Nakauchia,H. 2005. Epigenetic regulation o f hematopoietic stem cell self-renewal by polycomb group genes. Int.J.Hematol. 81:294-300.  19. Vire,E., Brenner,C, Deplus,R., Blanchon,L., Fraga,M., D i d e l o t , C , Morey,L., V a n Eynde,A., Bernard,D., VanderwindenJ.M. et al. 2006. The Polycomb group protein E Z H 2 directly controls D N A methylation. Nature 439:871-874.  20. van Kemenade,F.J., Raaphorst,F.M., Blokzijl,T., Fieret,E., H a m e r , K . M . , Satijn,D.P., Otte,A.P., and Meijer,C.J. 2001. Coexpression o f B M I - 1 and E Z H 2 polycomb-group proteins is associated with cycling cells and degree o f malignancy i n B-cell nonHodgkin lymphoma. Blood 97:3896-3901.  183  21.  Uchida,N., Dykstra,B-> Lyons,K.J., Leung,F.Y., and Eaves,C.J. 2003. Different in vivo repopulating activities o f purified hematopoietic stem cells before and after being stimulated to divide in vitro with the same kinetics. Exp.Hematol 31:1338-1347.  22.  Szilvassy,S.J. and Cory,S. 1993. Phenotypic and functional characterization o f competitive long-term repopulating hematopoietic stem cells enriched from 5fluorouracil-treated murine marrow. Blood 81:2310-2320.  23.  Randall,T.D. and Weissman,I.L. 1997. Phenotypic and functional changes induced at the clonal level in hematopoietic stem cells after 5-fluorouracil treatment. Blood 89:3596-3606.  24.  Sato,T., L a v e r J . H . , and Ogawa,M. 1999. Reversible expression o f C D 3 4 by murine hematopoietic stem cells. Blood 94:2548-2554.  25. Tajima,F., Deguchi,T., Laver,J.H., Zeng,H., and Ogawa,M. 2001. Reciprocal expression o f C D 3 8 and C D 3 4 by adult murine hematopoietic stem cells. Blood 97:2618-2624.  26. Zanjani,E.D., Almeida-Porada,G., Livingston,A.G., Zeng,H., and Ogawa,M. 2003. Reversible expression o f C D 3 4 by adult human bone marrow long-term engrafting hematopoietic stem cells. Exp.Hematol. 31:406-412.  27. Uchida,N., Dykstra,B-, Lyons,K., Leung,F., Kristiansen,M., and Eaves,C. 2004. A B C transporter activities o f murine hematopoietic stem cells vary according to their developmental and activation status. Blood 103:4487-4495.  184  Doyonnas,R., Nielsen,J.S., Chelliah,S., Drew,E., Hara,T., Miyajima,A., and M c N a g n y , K . M . 2005. Podocalyxin is a CD34-related marker o f murine hematopoietic stem cells and embryonic erythroid cells. Blood 105:4170-4178.  185  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092942/manifest

Comment

Related Items