Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Gonadotropins and leptin : the role and molecular mechanism in normal and neoplastic ovarian epithelium… Choi, Jung-Hye 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-199541.pdf [ 20.22MB ]
Metadata
JSON: 831-1.0092924.json
JSON-LD: 831-1.0092924-ld.json
RDF/XML (Pretty): 831-1.0092924-rdf.xml
RDF/JSON: 831-1.0092924-rdf.json
Turtle: 831-1.0092924-turtle.txt
N-Triples: 831-1.0092924-rdf-ntriples.txt
Original Record: 831-1.0092924-source.json
Full Text
831-1.0092924-fulltext.txt
Citation
831-1.0092924.ris

Full Text

GONADOTROPINS AND LEPTIN: THE ROLE AND MOLECULAR MECHANISM IN NORMAL AND NEOPLASTIC OVARIAN EPITHELIUM CELLS by Jung-Hye Choi B. Pharm. Sc., Kyung Hee University, 2000 M . Pharm., Kyung Hee University, 2002 A THESIS SUBMITTED IN PARTIAL F U L F I L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Reproductive and Developmental Sciences) THE UNIVERSITY OF BRITISH C O L U M B I A September 2006 © Jung-Hye Choi, 2006 Abstract Ovarian cancer is the sixth most common cancer and the fifth leading cause of cancer-related death among women in developed countries. There is increasing evidence suggesting that the hormonal environment of the normal ovarian surface epithelium (OSE) and ovarian epithelial cancer (OEC) cells is associated with the development and progression of ovarian cancer. Exposure to excess gonadotropins and leptin, related to menopause or infertility therapy and obesity, respectively, has been implicated as a risk factor for ovarian cancer. However, the molecular mechanism underlying the response to gonadotropins is not clearly understood, and nothing is known about the role of leptin in either normal OSE or its malignant counterpart. In the present study, we hypothesized that: overexpression of the FSH receptor (FSHR) affects particular oncogenic pathways in OSE cells and treatment with FSH and/or L H alters cell proliferation and metastasis, respectively, by interacting with growth factor and/or other hormone systems, and regulating proteolysis. Whether leptin plays a proliferative role in ovarian cancer cells was also investigated. Furthermore, we examined the relevant intracellular signal transduction pathways mediating the actions of gonadotropins and leptin which may be important in the development and progression of ovarian cancer. The FSHR overexpressing-80PCF cell line showed increased levels of EGFR, HER-2/neu and c-Myc, as well as a constitutive activation of ERK1/2. The growth inhibitory effect of GnRH I/II was blocked by pretreatment with FSH or L H . Treatment of pre-neoplastic IOSE-80PC cells with gonadotropins resulted in a significant increase of EGFR mRNA and EGFR protein levels via ERK1/2 and phosphatidyl-inositol-3-kinase (PI3K) activation. Both FSH and L H induced a significant synergistic stimulation of mitogenesis in the presence of EGF. In parallel experiments on metastasis, treatment with FSH or L H significantly increased the invasion of ovarian cancer cells including BG-1, CaOV-3 and SKOV-3 cells. Treatment of SKOV-3 cells with FSH or L H enhanced net MMP/TIMP balance and proteolysis potential. With regard to leptin, treatment with leptin significantly stimulated the growth of estrogen-sensitive BG-1 cells via a ligand-independent E R a pathway. Taken together, these findings strongly support a regulatory role of gonadotropins and leptin in both normal and neoplastic OSE cells ii Table of Contents Abstract ii Table of Contents i i i List of Tables —-vi i List of Figures iix List of Abbreviations xi Preface -xiv Acknowledgement xviii CHAPTER I. Introduction 1 1.1 Ovarian cancer 1 1.1.1 Clinical feature of ovarian cancer 1 1.1.2 Clinicopathology and pathogenesis of ovarian epithelial cancer (OEC) 2 1.1.3 Epidemiology of OEC 4 1.1.4 Molecular pathogenesis and progression of OEC 6 1.1.5 Hormonal factors in ovarian surface epithelial (OSE) and OEC 9 1.2 Gonadotropins 12 1.2.1 Structure, production and regulation 12 1.2.2 Receptors and signaling— - 13 1.2.3 Physiological role 15 1.3 Gonadotropin theory 17 1.3.1 Animal models 18 1.3.2 Epidemiological data 21 1.3.3 Gonadotropin levels in patients with OEC 23 1.3.4 Gonadotropin receptors in OSE and OEC 25 1.4 Action of gonadotropins in OSE and OEC 27 1.4.1 Gonadotropin-regulated gene expression — 27 iii 1.4.2 Effect of gonadotropins on proliferation 28 1.4.3 Effect of gonadotropins on apoptosis 31 1.4.4 Effect of gonadotropins on metastasis— 32 1.5 Clinical approaches 32 1.5.1 Diagnostic and prognostic factor 32 1.5.2 Hormone therapy 33 1.5.3 Drug development- —34 1.6 Leptin 35 1.6.1 Structure, production, and regulation 36 1.6.2 Receptors and signaling 37 1.6.3 Physiological role 38 1.7 Leptin, obesity and cancer 40 1.8 Hypothesis and Objectives 42 1.9 Bibliography- 52 CHAPTER II. Overexpression of follicle-stimulating hormone receptor activates oncogenic pathways in preneoplastic ovarian surface epithelial cells 69 2.1 Introduction 69 2.2 Materials and methods 69 2.3 Results 73 2.4 Discussion 76 2.5 Bibliography 88 CHAPTER III. Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells- 90 3.1 Introduction 90 iv 3.2 Materials and methods 91 3.3 Results 95 3.4 Discussion 99 3.5 Bibliography 111 CHAPTER IV. Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer 114 4.1 Introduction— 114 4.2 Materials and methods 115 4.3 Results 117 4.4 Discussion 120 4.5 Bibliography 130 CHAPTER V . Gonadotropins activate proteolysis and increase invasion through protein kinase A and phosphatidyl-inositol-3-kinase pathways in human epithelial ovarian cancer cells 132 5.1 Introduction 132 5.2 Materials and methods 133 5.3 Results 137 5.4 Discussion 141 5.5 Bibliography 154 CHAPTER VI. Cyclic AMP-dependent Epac pathway is involved in gonadotropin-induced EGFR overexpression in human ovarian surface epithelial cells 156 6.1 Introduction 156 6.2 Materials and methods 156 6.3 Results — 158 6.4 Discussion - 160 6.5 Bibliography 169 v CHAPTER VII. Expression of leptin receptors and potential effect of leptin on the cell growth and activation of mitogen-activated protein kinases in ovarian cancer cells 171 7.1 Introduction 171 7.2 Materials and methods— —171 7.3 Results - — 174 7.4 Discussion— 175 7.5 Bibliography 182 CHAPTER VIII. A ligand-independent estrogen receptor pathway is involved in leptin-induced ovarian cancer cell growth 183 8.1 Introduction 183 8.2 Materials and methods 183 8.3 Results 187 8.4 Discussion 190 CHAPTER IX. Discussion and future work 204 9.1 Discussion and future work 204 9.2 Bibliography 214 VI List of Tables Table 1.1 Summary of the representative action of GnRH 1/ II, activin, inhibin, estrogen, progesterone and androgen in OSE and ovarian cancer 45 Table 1.2 Summary of the representative action of gonadotropins in OSE and ovarian cancer - —50 Table 4.1 List of primers used for the detection of FSHR, LHR, GnRH I, GnRH II, GnRHR and G A P D H by SYBR Green RT-PCR 124 vii List of Figures Figure 1.1 Hypothalamic-pituitary-gonadal axis— 46 Figure 1.2 A model of gonadotropins signaling in ovarian granulosa cells 47 Figure 1.3 Temporal association between ovarian cancer incidence and gonadotropins levels— 48 Figure 1.4 Immunohistochemical staining for FSHR(A) and LHR(B) in human ovarian serous tumor 49 Figure 1.5 Leptin receptors and their signaling pathway -51 Figure 2.1 Overexpression of FSHR mRNA and protein in IOSE cell line 81 Figure 2.2 Effect of overexpressed FSHR on the expression levels of EGFR, HER-2/neu, c-Myc and K-Ras oncogenic pathways 83 Figure 2.3 Effect of overexpressed FSHR on the phosphorylation of p38, JNK and ERK1/2 M A P K pathways — 85 Figure 2.4 Effect of overexpressed FSHR on cell growth 86 Figure 2.5 Effect of FSH and EGF in non-transfected 80PCV and FSHR over-expressing 80PCF cells 87 Figure 3.1 Expression of EGFR mRNA and protein in IOSE cell lines (IOSE-80 and IOSE-80PC) and ovarian cancer cell lines (OVCAR3 and SKOV3)-—104 Figure 3.2 Effect of FSH and L H on the expression of EGFR mRNA (A) and protein (B) 105 Figure 3.3 Effect of gonadotropins and EGF on the cell growth 106 Figure 3.4 Inhibitory effects of LY294002 and PD98059 on gonadotropins-induced EGFR up-regulation 107 Figure 3.5 Effect of FSH and L H on the phosphorylation of ERK1/2 and PI3K signaling pathway in IOSE-80PC —108 Figure 3.6 Effect of FSH and L H on the EGFR gene transcription 109 Figure 3.7 Effect of FSH and L H on the EGFR mRNA stability in IOSE-80PC cells 110 Figure 4.1 Expression of FSHR and L H R in IOSE and ovarian cancer cells -125 Figure 4.2 Effect of FSH and L H on GnRHI mRNA in IOSE and ovarian cancer cells via 126 Figure 4.3 Effect of FSH and L H on GnRH II mRNA in IOSE and ovarian cancer cells - 127 Figure 4.4 Effect of FSH and L H on GnRHR mRNA in IOSE and ovarian cancer cells 128 Figure 4.5 Effect of FSH or L H treatment on the growth inhibitory effect of GnRH I and II in IOSE-80 (A), OVCAR-3 cells (B) and SKOV-3 cells (C) 129 Figure 5.1 Effect of FSH and L H on ovarian cancer invasion 146 Figure 5.2 Effect of gonadotropins on mRNA expression, secretion and activation of MMP-2 and MMP-9 in SKOV-3 cells — 147 Figure 5.3 Effect of gonadotropins on mRNA expression, secretion and activation of TIMP-1 andTIMP-2 in SKOV-3 cells 149 Figure 5.4 Effect of gonadotropins on mRNA expression and secretion of uPA and PAI-1 in SKOV-3 cells 151 Figure 5.5 Inhibitory effect of M M P inhibitors on gonadotropin-induced invasion in SKOV-3 cells 152 Figure 5.6 Involvement of PI3K and P K A signaling pathways in gonadotropin-induced invasion and M M P production of SKOV-3 cells 153 Figure 6.1 Effect of FSH and L H on the accumulation of intracellular cAMP in IOSE cells 162 Figure 6.2 Effect of 8-br-cAMP (A) and forskolin (B) on the activation of the ERK1/2 and PI3K signaling pathways in IOSE cells 163 Figure 6.3 Effect of 8-br-cAMP (A) and forskolin (B) on EGFR expression in IOSE cells- 164 Figure 6.4 Effect of EGTA, B APT A - A M and SQ 22,536 on gonadotropins-induced EGFR up-regulation in IOSE cells 165 Figure 6.5 Expression of Epacl protein in IOSE cells (IOSE-80, IOSE-80PC, and IOSE-120) and ovarian cancer cells (OVCAR-3, CaOV-3, and SKOV-3) 166 IX Figure 6.6 Effect of an Epac-specific cAMP analogue 8-CPT-2ME-cAMP on the expression of EGFR (A) and the activation of the ERK1/2 and PI3K pathways (B) 167 Figure 6.7 Effect of overexpression of dominant negative Epacl on gonadotropins-induced EGFR up-regulation in IOSE cells 168 Figure 7.1 Expression of Ob-Rb (long isoform) and Ob-Rt (short isoform) leptin receptors in various ovarian cells and ovarian carcinoma cell lines 178 Figure 7.2 Effect of leptin on ERK1/2 activation in BG-1 ovarian cancer cell line- 179 Figure 7.3 Effect of leptin on p38 activation in BG-1 ovarian cancer cell line 180 Figure 7.4 Effect of leptin on cell proliferation in BG-1 cells 181 Figure 8.1 Effect of ICI 182,780 on leptin-induced cell growth in BG-1 cells 194 Figure 8.2 Expression of ERa and ERp in various ovarian normal and cancer cell lines 195 Figure 8.3 Effect of overexpression of ERa and ERp on cell growth in OVCAR-3 cells 196 Figure 8.4 Effect of leptin on nuclear abundance of ERa in BG-1 cells 197 Figure 8.5 Effect of leptin on functional activation of ERa in BG-1 cells 195 Figure 8.6 Effect of leptin on the activation of STAT-3 in BG-1 cells —199 Figure 8.7 Inhibitory effects of PD98059 and AG490 on leptin-induced proliferation -200 Figure 8.8 Interaction between P-STAT-3 and ERa. BG-1 cells were treated with leptin (100 ng/ml) in a time-dependent manner (30, 60, 90 and 120 min) 201 Figure 9.1 Diagrammatic representation of the potential role of gonadotropins in neoplastic transition of OSE cells — 211 Figure 9.2 Diagrammatic representation of the potential role of gonadotropins and leptin in ovarian cancer 212 Figure 9.3 Diagrammatic representation of gonadotropins and leptin signaling pathways in OSE and ovarian epithelial cancer 213 x List of Abbreviations A N O V A Analysis of variance Akt AKT8 virus oncogene cellular homolog AP-1 Activator protein 1 (c-jun and c-fos) A R Androgen receptor • BMI body mass index C Celcius Ca2+ Calcium cAMP Cyclic adenosine monophosphate Caspase Cystein proteases with aspartate specificity cDNA Complementary deoxyribonucleic acid Cdk cyclin dependent kinase cGMP Cyclic guanosine monophosphate c-Myc Avian myelocytomatosis cirus oncogene cellular homolog cpm Counts per minute CRE cAMP-response elements CREB CRE-binding protein D A G Diacylglycerol DDT Dithiothreitol DHT 5 a-dihydrotestosterone dNTP Deoxynucleoside triphosphate D N A Deoxynucleic acid DNase Deoxyribonuclease EDTA Ethylene diaminetetraacetic acid E2 170- estradiol EGF Epidermal growth factor ELISA Enzyme-lined immunosorbant assay Elk Ets-like transcription factor E M S A Electrophoretic gel mobility shift assays Epac Exchange protein directly activated by cAMP ER Estrogen receptor ERE Estrogen response element ERK1/2 Extracellular signal-regulated kinase lA Fas TNF superfamily receptor 6 FBS Fatal bovine serum F K H R Forkhead in rhabdomyosarcoma FSH Follicle stimulating hormone FSHR Follicle stimulating hormone receptor g Acceleration of gravity GDP Guanosine diphosphate GEF Guanine nucleotide exchange factors GnRH Gonadotropin-releasing hormone GnRH-II Gonadotropin-releasing hormone type II GnRHR Gonadotropin-releasing hormone receptor G-protein GTP-binding protein xi GPCR G-protein coupled receptors Grb2 growth factor receptor-bound protein GTP Guanosine triphosphate h • Hour HBSS Hank's balanced salt solution hCG Human chorionic gonadotropin HGF Hepatocyte growth factor hGLC Human granulosa-luteal cells IAP Inhibitor of apoptosis protein IGF Insulin-like growth factor IGFBP Insulin-like growth factor binding protein IL Interleukin IP Inositol phosphate IP3 Inositol 1,4,5-triphosphate IU International unit IOSE Immortalized ovarian surface epithelium IRS-2 insulin receptor substrate 2 IVF In vitro Fertilization JAK2 Janus family tyrosine kinase 2 JNK/SAPK c-jun terminal kinase/stress-activated protein kinases Kb Kilobase kDa Kilodaltons L H Luteinizing hormone L P A Lysophosphatidic acid Micro M A P K Mitogen-activated protein kinase M D M 2 Murine double minute2, a p53-accociated oncogene ml Mililiters min Minutes M M P Matrix metalloproteinase mRNA Messenger ribonucleic acid M W Molecular weight n(as in nM) Nono N F - K B Nuclear factor kappa B Ob obesity gene OEC Ovarian epithelium cancer OSE Ovarian surface epithelium P(as in pM) Pico P4 Progesterone PEGE Polyacrylamide gel electrophoresis PBS Phosphatase buffered saline-gelatin PCR Polymerase chain reaction PI Phosphatidylinositol PIP Phosphatidylinositol 3,4,5-triphosphate P K A Protein kinase A PKC Protein kinase C xii J P L A Phospholipase A PLC Phospholipase C PLD Phospholipase D P M A Phorbol 12-myristate 13-acetate PMSF Phenylmethylsulfonyl fluoride PR Progesterone receptor PTEN Phosphatase and tensin homologue deleted on chromosome 10 PTP Phosphotyrosine phosphatase PTX Pertussis toxin RIA Radioimmunoassay rpm Revolutions per min Rap Ras-related protein RAP-1A Rb Retinoblastoma protein RT Room temperature RT-PCR Reverse transcription polymerase chain reaction Sec Seconds SD Standard deviation SDS Sodium dodecyl sulphate SGK serum/glucocorticoid-regulated kinase SHP2 SH2-containing phosphatase 2 STAT-3 Signal transducers and activators of transcription-3 Taq Thermus acuaticus, source of a D N A polymerase TE Tris-EDTA T E M E D N,N,N',N'-tetramethylethlenediamine TGF Transforming growth factor TNF Tumor necrosis factor TIMP Tissue inhibitor of metalloproteinase Tris Tris(hydroxyl methyl) aminomethane U V ultraviolet V E G F vascular endothelial growth factor v/v Volume per volume w/v Weight per volume WHR wajst-to-hip ratio xiii Preface Refereed papers: Choi JH, Choi K C , Auersperg N , and Leung P C K Cyclic AMP-dependent Epac pathway is involved in gonadotropin-induced EGFR overexpression in human ovarian surface epithelial cells. Manuscript in preparation Choi JH, Choi K C , and Leung P C K A ligand-independent estrogen receptor pathway is involved in leptin-induced ovarian cancer cell growth. Submitted to FASEB J Choi JH, Choi K C , Auersperg N , and Leung P C K Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer. Endocr Relat Cancer. 13(2):641-651 (PMID: 16728589) Leung P C K and Choi JH Endocrine signaling in ovarian Surface Epithelium and Cancer. Hum Reprod Update. In press Choi JH, Choi K C , Auersperg N , and Leung P C K 2006 Gonadotropins activate proteolysis and increase invasion through protein kinase A and phosphatidyl-inositol-3-kinase pathways in human epithelial ovarian cancer cells. Cancer Res. 66(7):3912-3920 (PMID: 16585220) Choi JH, Choi K C , Auersperg N , and Leung P C K 2005 Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells. Endocr Relat Cancer. 12(2):407-21 (PMID: 15947112) xiv An BS, Choi JH, Choi K - C , Leung P C K 2005 Progesterone regulates gonadotropin-releasing hormone receptor gene at the transcriptional level in neuronal cells. J Clin Endocrinol Metab 90(2): 1106-13 (PMID: 15562029) Choi JH, Park SH, Leung PCK, Choi K - C 2005 Expression of leptin receptors and potential effect of leptin on the cell growth and activation of mitogen-activated protein kinases in ovarian cancer cells. J Clin Endocrinol Metab 90 (1): 207-210 (PMID: 15522945) Choi JH, Choi K - C , Auersperg N , Leung P C K 2004 Overexpression of follicle-stimulating hormone receptor activates oncogenic pathways in preneoplastic ovarian surface epithelial cells. J Clin Endocrinol Metab, 89(11), 5508-5516 (PMID: 15531506) Abstracts and Presentations: Choi JH, and Leung P C K Gonadotropins: the role and molecular mechanism in normal and neoplastic ovarian epithelium cells, 12 World Congress of Gynecological Endocrinology, Florence, Italy (Mar 2-5, 2006) -Oral Presentation Choi JH, and Leung P C K Gonadotropins: the role and molecular mechanism in normal and neoplastic ovarian epithelium cells, 16 th the annual meeting of the Indian Society for the Study of Reproduction and Fertility (ISSRR), Karnal, India (Feb 23-25, 2006)-Invited Presentation Choi JH, and Leung P C K Potential role of gonadotropins in normal and neoplastic ovarian surface epithelial cells, Kyunghee University, Seoul, Korea (Sep. 22, 2005)-Invited Presentation xv Choi JH, and Leung P C K Potential role of gonadotropins in normal and neoplastic ovarian surface epithelial cells, 5 t h international conference on reproductive endocrinology, Beijing, China (Sep. 9-13, 2005)-Invited Presentation Choi JH, Choi K - C , and Leung P C K Involvement of a ligand-independent estrogen receptor pathway in leptin-induced cell growth of epithelial ovarian cancer cells, ENDO 2005, San Diego, C A (Jun. 4-7, 2005) Choi JH, Choi K - C , Auersperg N , and Leung P C K Gonadotropins increase invasiveness and activate tumor proteinase in human epithelial ovarian cancer cells, 96 t h Annual Meeting of American Association for Cancer Research, Anaheim, C A (Apr. 16-20, 2005) -Poster Presentation Choi JH, Choi K - C , Auersperg N , and Leung P C K Gonadotropins increase tumor proteinase activation and invasion in human ovarian cancer cells, 7 t h annual northwest reproductive sciences symposium, Seattle, W A (Apr. 22-23, 2005) -Poster Presentation Choi JH, Choi K - C , Auersperg N , and Leung P C K Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human ovarian surface epithelium and ovarian cancer, 8th International Symposium on GnRH Analogues in Cancer and Human Reproduction, Salzburg, Austria (Feb. 10-13, 2005) Choi JH, Choi K - C , Auersperg N , Leung P C K Gonadotropins activate mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase as downstream pathways of epidermal growth factor receptor in human ovarian surface epithelial cells. The Society for the Study of Reproduction 37 t h Annual Meeting, Vancouver, BC (Aug. 1-4, 2004) -Oral Presentation Choi JH, Choi K - C , Auersperg N , Leung P C K Overexpression of follicle-stimulating hormone receptor activates oncogenic pathways in preneoplastic ovarian surface epithelial cells. 95 t h Annual Meeting of American Association for Cancer Research, Orlando, FL xvi (Mar. 27-31, 2004) -Poster Presentation Choi JH, Choi K - C , Auersperg N , Leung P C K Effect of gonadotropins on cell growth by up-regulation of epidermal growth factor receptor in ovarian epithelial cells. 4 t h Conference of the Pacific Rim Society for Fertility & Sterility, Okinawa, Japan (Mar. 8-11, 2004) -Poster Presentation xvii Acknowledgements I would like to express my greatest gratitude to the faculty, staff, friends, and colleagues at the Department of Obstetrics and Gynecology; Program of Reproductive and Developmental Sciences for their support at various phases of my work. I am most grateful to my supervisor, Dr. Peter C.K. Leung for his continuous support and great supervision throughout my PhD study. I want to thank Dr. Nelly Auersperg, who has given me friendly comments and constructive criticism on my work as well as fascinating ideas. My warm thanks also go to Dr. Keith K .C . Choi and Dr. Christian Klausen for their technical support and critical review of my works. I want to express my sincere gratitude to Dr. Kyungtae Lee (Kyunghee University), who has inspired me to continue my work in this field. I owe my warmest thanks to my parents and other family members, who have supported and encouraged me throughout my years of education. xviii CHAPTER I. Introduction 1.1 Ovarian cancer Ovarian cancer is the sixth most common cancer and the fifth leading cause of cancer-related deaths among women in developed countries (Greenlee et al., 2000). Worldwide, the total number of cases is approximately 190,000 per year (Gadducci et al., 2004). In the United States, about 23,000 new cases were diagnosed while approximately 14,000 women died from the disorder in the same year (Jemal et al., 2002). About 1 in 70 women in the United States will develop ovarian cancer (Quirk & Natarajan, 2005). 1.1.1 Clinical features of ovarian cancer Due to the absence of specific symptoms and signs and the lack of trustworthy screening system, only about one-quarter of women have localized disease at the time of diagnosis. Signs and symptoms of ovarian cancer may include abdominal discomfort and/or pain, nausea, loss of appetite, weight change, and abnormal vaginal bleeding. Despite the limitations of sensitivity and specificity, the combination of pelvic exam, transvaginal ultrasound, and CA125 assay are currently used as diagnostic tools. The International Federation of Gynecology and Obstetrics (FIGO) stage has been recognized as a significant prognostic factor in most studies (Heintz et al., 2001; Tingulstad et al., 2003). Patients in most cases present in stage III or IV with a 5-year survival of around 28% and 16%, respectively, while the 5-year survival rate is up to 80% for patients in stage I. Standard management for advanced ovarian cancer is cytoreductive surgery followed by paclitaxel/platinum-based chemotherapy. Current regimens can achieve 25-30% complete pathological response rate and 15.5-22 months median progression-free survival (Conte et a l , 1999; Gadducci et al., 2004). Although ovarian cancer is considered a chemosensitive neoplasm with 80% initially responding to conventional treatment, the common chemoresistance resulting in eventual tumor recurrence gives rise to a poor long-term survival rate among the women with advanced stage disease at diagnosis. Thus, improving the predictive value of screening and identifying the critical drug target is urgent for prevention, treatment, and 1 survival of patients. In this regard, current efforts are being directed toward increasing the understanding of mechanism by which ovarian cancer develops and progresses. 1.1.2 Clinicopathology and pathogenesis of ovarian epithelial cancer (OEC) According to the World Health Organization (WHO) histological classification, an ovarian tumor can be classified into three categories according to the most probable tissue of origin: surface epithelial tumors, sex cord-stromal tumors, and germ cell tumors. Approximately 90% of malignant tumors arise from the ovarian surface epithelium (OSE) with the rest originating from granulosa cells (~ 5%) or, rarely, germs cells (-1%). Surface epithelial tumors are believed to originate from the surface coelomic epithelium of the ovary, which embryologically give rises to the mullerian epithelium such as fallopian tubes, the endometrial lining, or the endocervical glands. According to the propensity of their proliferative and invasive behavior, ovarian tumors are classified as benign, borderline, or malignant. For example, benign tumors have little copious proliferation and invasive behavior while malignant cancers have both proliferative and invasive features. Borderline tumors, also known as low malignant potential, have aggressive cellular proliferation but no invasive behavior. Interestingly, the simple primitive OSE with mesenchymal features acquires the characteristics of mullerian epithelium as it develops to malignancy (Auersperg et al., 2001). In fact, the differential phenotypes used for classification of this disease are serous (fallopian tube), mucinous (endocervical-like) and endometrioid (endometrium-like) adenocarcinomas. The rare clear cell and transitional cell carcinomas are also classified as epithelial carcinoma, and they express features like mesonephros and urothelium, respectively (Auersperg et al., 2001; Chen et al., 2003). The ovarian surface epithelium is a single layer of flat-to-cuboidal epithelial cells covering the ovary (Nicosia & Johnson, 1984). While studies on the ovary have mainly focused on the other cell types such as granulosa and theca cells, which play a critical role in folliculogenesis and steroidogenesis, the OSE was among the least studied parts of the ovary. That is, until recent histopathological and immunocytochemical evidences suggested that about 90% of the epithelial ovarian carcinomas may arise in the OSE 2 (Auersperg et al., 1998; Herbst, 1994). Moreover, the cellular and molecular mechanism by which it undergoes tumor formation and neoplastic progression is not well understood. The OSE is separated from the hormone/growth factor-producing stroma by collagenous tunica albuginea and a basement membrane. Rupture of ovulation and aging stimulate the trapping of OSE fragments, resulting in surface invaginations (clefts) and inclusion cysts in the ovarian cortex (Murdoch, 1994). Numerous studies have provided direct evidence bearing on metaplasia and neoplastic conversion of the clefts and inclusion cyst, presumably, via the aberrant expose to the hormone/growth factor-rich stromal microenvironment (Blaustein et al., 1982; Maines-Bandiera & Auersperg, 1997; Mittal et al., 1995; Scully, 1995). Thus, the OSE trapped into the ovarian cortex has been generally considered a neoplastic progression-prone site for ovarian epithelial cancer. Whether the surface and/or cyst epithelial cells directly progress to a malignant neoplasm is still not clear. Scully suggested that a predominant proportion of serous and undifferentiated carcinomas, which accounts for about 65% of epithelial ovarian carcinoma, arise directly from the trapped OSE cells and spread rapidly (Scully, 2000). However, other studies suggested the possibility of a stepwise progression from serous benign and borderline tumors to serous carcinoma as well as de novo (Horiuchi et al., 2003; Shih Ie & Kurman, 2004; Tibiletti et al., 2003). In contrast with a de novo origin, mucinous carcinoma (about 13% of epithelial cancers) most likely appear to arise within or contiguous to pre-existing benign and borderline mucinous tumors (Bell & Scully, 1994; Puis et al., 1992). It has been suggested that the clear cell and endometrioid carcinoma (about 20% of epithelial cancers) may arise from endometriotic deposits or adenofibromas (Scully, 2000). Ness and Cottreau have suggested that an inflammatory microenvironment, rather than the trapping of the OSE into the stroma, may mediate the mutagenesis induced by ovarian ovulation. That is, inflammation during ovulation may stimulate cell damage, oxidative stress, and elevations of cytokines and prostaglandins, all of which may be mutagenic, such that the epithelium in and around the site of ovulation, which are intensively exposed to the mutagenic conditions, undergo tumorigenesis (Ness & Cottreau, 1999). In general, the OSE cells attach to as well as organized by a well-defined extracellular basement membrane. Repetitive loss of the basement membrane during ovulation has been implicated as an early event in the preneoplastic transformation of OSE, 3 maybe through enhanced survival mechanism of the epithelial cells and/or preferential selection of apoptosis-resistant cells (Capo-Chichi et al., 2002; Ozols et al., 2004; Roland et al., 2003). Although ovulation does not occur during menopause, ovulation like processes such as production of cytokines and proteases and inflammatory stimulation may still continue due to the consistent high levels of gonadotropins. Although all of these hypotheses seem to explain the preference of surface epithelium and/or inclusion OSE for neoplastic transformation and the involvement of ovulation in the formation of specific tumor-promoting microenvironment, no direct and/or experimental data can explain the exact pathogenesis of ovarian cancer. Specially designed studies of surface OSE and/or inclusion cysts are necessary to explore these mechanisms. Until recently, an appropriate animal model that will develop ovarian epithelial carcinoma did not exist, and methods to isolate and maintain the human OSE under experimental conditions have only been established in the past few years. Thus, in contrast to neoplasms in other organs, where the normal tissue of origin is well-defined, the physiology and susceptibility of the OSE to oncogenic influences is not well understood (Auersperg et al., 2002; Wong & Auersperg, 2002). 1.1.3 Epidemiology of OEC The etiology of ovarian cancer remains poorly understood. To date, family history of ovarian cancer, age, and nulliparity have been consistently recognized as risk factors of ovarian epithelial cancer, while pregnancy, oral contraceptive use, hysterectomy, and tubal ligation are protective factors. Familial ovarian epithelial cancer comprise approximately 5-10% of cases, and develop from germline mutations in the BRCA1 or BRCA2 genes, which mainly play a role in repair of D N A damage (Swisher, 2003). BRCA1 or BRCA2 mutations are found in about 50% and 70% of ovarian cancer patients with at least one first-degree and two or more affected relatives, respectively (Gayther et al., 1996; Reedy et al., 2002; X u & Solomon, 1996). The risk to develop ovarian cancer is likely to increase, as women grow older. In the United States, the mean age of incidence of ovarian cancer is 57-59 years, 50% of all cases occur over age 65, and age-specific incidence peaks in the mid-70s 4 (Ries, ; Weiss, 1996). Recent studies have linked tobacco products/smoking to an increased incidence of a specific type of ovarian cancer (Green et al., 2001; Marchbanks et al., 2000; Modugno et al., 2002). In addition, talc (Chang & Risch, 1997; Harlow et al., 1992), asbestos (Ness & Cottreau, 1999), and alcohol (Modugno et al., 2003) have been sometimes associated with an increased risk. However, these issues are limited by inconsistent data and/or the lack of supportive animal models. Thus, to date, epidemiological studies have failed to yield a consensus regarding the contribution of chemical carcinogens to the development of ovarian cancer. The data on obesity and ovarian cancer risk are inconclusive, but generally suggest an increased risk for obese women (see Chapter 1.7 for detail). Countless epidemiological findings demonstrated the influence of menstrual and/or reproductive factors in ovarian cancer development. Each additional pregnancy decreases the risk 10-16% (Hankinson et al., 1995; Risch et al., 1996). Interestingly, several studies have reported a significant trend of decreasing ovarian cancer risk with increasing age at first birth and/or greater age at last birth (Pike et al., 2004; Riman et al., 2002a; Whiteman et a l , 2003). For example, Pike et al. in their population-based case control study demonstrated that women whose only and last birth was after age 35 years had about a 50% reduced risk of invasive ovarian cancer while the protective effect was decreased with childbirth earlier than age 35 years (Pike et al., 2004). It is most likely that the use of oral contraceptives (OC) decreases ovarian cancer risk. In several recent studies, the reduction of ovarian cancer risk in women ever taking OC compared with non-users is about 30% (Bosetti et al., 2002; Modugno et al., 2004; Tung et al., 2005). The protection increases approximately 7% per year of use, such that the long term users (over 10 years) had up to an 80% reduction (Bosetti et al., 2002; McGuire et a l , 2004). The beneficial effect of OC against ovarian cancer risk persists for at least 10-15 years since last use, or even as long as 20-25 years (Bosetti et al., 2002; Ness et al., 2001; Whittemore et al., 1992). The favorable effect of OC has been observed in most histological subtypes, but mucinous, and even in B R C A mutation carriers (McGuire et al., 2004). No significant difference in protective effect among the diverse types of OC preparations is apparent. Hormone replacement therapy (HRT), which is frequently prescribed for menopausal women due to its possible benefits in reducing the risks of osteoporosis and heart disease, 5 provides another source for exogenous steroid. The epidemiologic findings concerning HRT use and ovarian cancer risk are equivocal. However, available data suggest that a moderately increased risk of ovarian cancer may be related to estrogen therapy alone, but not with estrogen-progestin combined regimes (Lacey et al., 2002; Riman et al., 2002b; Whittemore et al., 1992). Women suffering from infertility have about a twofold higher ovarian cancer risk than does the general population (Ness et al., 2002). Ovulation induction agents used in the treatment of infertility (clomiphene or gonadotropins) may also be a risk factor for ovarian cancer (Anderson & Dimitrievich, 1996; Lacey et al., 2002; Riman et al., 2002b; Rossing et al., 1994; Whittemore et al., 1992) (see Chapter 1.3 for detail). Tubal ligation and hysterectomy without oophorectomy reduced the risk of ovarian cancer, presumably due to decreased exposure of the ovary to potential carcinogen factors and/or inflammation (Kurian et al., 2005; Ness et al., 2001; Parazzini et al., 1993). 1.1.4 Molecular pathogenesis and progress of OEC Several recent studies have contributed to the understanding of the biology of the OSE and ovarian carcinogenesis. During neoplastic progression, the tendency of the OSE to undergo epithelio-mesenchymal conversion diminishes and the cells become increasingly committed to complex epithelial phenotypes, which include the appearance of E-cadherin (Kantak & Kramer, 1998; Sundfeldt et al., 1997), the receptor for hepatocyte growth factor (c-met) (Huntsman et al., 1999) and other secretory products, such as mucins (Van Niekerk et al., 1993; Young, 1988). Tumorigenesis is thought to result, at least in part, from genetic abnormalities that lead to the disruption or enhancement of intracellular signaling pathways that control cell proliferation, apoptosis, or metastasis. In recent years, several key signaling pathways have been extensively studied in ovarian cancer cells, including the loss of tumor suppressor genes, failure of cell cycle regulation, telomerase up-regulation and activation of oncogenic pathways. Specifically, tumor suppressor genes such as BRCA1/BRCA2 (Greenlee et al., 2000), p53 (Kacinski et al., 1989b), PTEN (Kurose et a l , 2001), Lot-1 (Abdollahi et al., 1997), OVCA-1 (Schultz et al., 1996), DOC-2 (Mok et al., 1996), and NOEY2 (ARHI) (Yu et al., 1999) are highly mutated in ovarian cancer. While the interaction of cyclins, cyclin-dependent kinases (CDKs) and C D K inhibitors (CDKIs) are tightly regulated in normal cells, some ovarian 6 cancer cells lose their growth regulation as a result of the overexpression of cyclins/CDKs and/or the loss of CDKIs such as p21 and p27 (Anttila et al., 1999; Farley et al., 2003; Garzetti et al., 1995; Ichikawa et al., 1996a; Schmider et a l , 2000; Worsley et al., 1997). Ovarian cancer cells have high levels of telomerase, a ribonucleoprotein enzyme complex that adds new oligonucleotide repeats to the ends of chromosomes, which maintains telomere length and eventually results in rescue from senescence and resistance to apoptosis (Counter et al., 1994; Kim et al., 1994; Kyo et al., 1996). In contrast, normal OSE and pre-malignant lesions have no telomerase activity (Counter et al., 1994; Kruk et al., 1999). Oncogenic signaling molecules, such as PI3K/Akt (Cheng et al., 1992; Mills et al., 2001), k-Ras (Enomoto et al., 1991), Src (Wiener et al., 2003), M A P K (Pan et al., 2002; Wang et al., 1999; Wong et al., 2001; Yamada et al., 2002; Yazlovitskaya et a l , 1999), and STATs (Burke et al., 2001), as well as tyrosine kinase receptors, including ERBB2 (Berchuck et al., 1990b), EGFR (Kohler et al., 1989), and cFMS (the receptor for colony-stimulating factor I) (Kacinski et al., 1990), are frequently amplified in ovarian carcinomas. In addition, growth factors, hormones, and even fluctuations in intracellular calcium levels can modulate cell proliferation and/or metastasis through the PI3K/Akt and M A P K pathways. Mitogen-activated protein kinases (MAPKs) are a group of serine/threonine kinases that are activated in response to a diverse array of extracellular stimuli and mediate signal transduction from the cell surface to the nucleus (Cobb & Goldsmith, 1995; Davis, 1994). M A P K s are divided into three major subgroups: ERK1/2, JNK, and p38, of which ERK1 (p44 M A P K ) and ERK2 (p42 M A P K ) have been studied extensively. It is well established that the M A P K cascades are activated by two distinct classes of cell surface receptors, i.e. receptor tyrosine kinases (RTKs) and G-protein-coupled receptors (Cobb & Goldsmith, 1995; Crespo et al., 1994; Kasuya et al., 1994; Ohmichi et al., 1994; van Biesen et al., 1996). The intracellular signals arising from these cascades invariably lead to the activation of a set of molecules that regulate cell growth, division, and/or differentiation. In ovarian cancer cells, M A P K s are regulated by cisplatin (Persons et al., 1999), paclitaxel (Wang et al., 1999), endothelin-1 (Vacca et al., 2000), gonadotropin-releasing hormone (GnRH) (Kimura et al., 1999), and gonadotropins (Choi et al., 2005a; Choi et al., 2002a). Phosphoinositide 3-kinase (PI3K) is a heterodimer composed of a p85 7 (regulatory) and a p i 10 (catalytic) subunit. PI3K phosphorylates inositol lipids at the 3' position of the inositol ring to generate PtdIns-3-P, PtdIns-3,4-P2, and PtdIns-3,4,5-P3. Akt, also known as protein kinase B, is the best characterized target of PtdIns-3,4-P2 and PtdIns-3,4,5-P3 (Datta et al., 1999; Kandel & Hay, 1999; Rameh & Cantley, 1999). The PI3K/Akt signaling pathway is now accepted as being at least as important as the ras-M A P K pathway in cell survival and proliferation, and hence its potential role in carcinogenesis is of immense interest. In ovarian cancer, it is becoming increasingly clear that the PI3K signaling pathway plays a major role in the regulation of cell proliferation, apoptosis, differentiation, tumorigenesis, and angiogenesis (Brader & Eccles, 2004; Chang et al., 2003; Vara et al., 2004). PI3K is stimulated by estrogen, gonadotropins, 4-hydroxy estradiol, hypoxia, and lysophosphatidic acid in ovarian cancer cells (Choi et al., 2005a; Gao et al., 2004; Lu et al., 2002; Vara et al., 2004; X u et al., 2004). In addition, PI3K may be involved in cell migration, invasion, and metastasis in normal and neoplastic tissues(Park et al., 2001; Tanno et al., 2001). Most deaths from ovarian cancer are due to metastasis that become resistant to conventional therapies. Recent findings have suggested that proteolysis directed at the interface between ovarian cancer cells and peritoneal tissues may play a role in the localized invasion and dissemination of ovarian cancer cells in the peritoneal cavity (Fishman et al., 1998; Rodriguez et al., 2001). The metalloproteinases (MMPs) and the urokinase plasminogen activator (uPA) systems have been the most intensely investigated in ovarian cancer. The M M P family contains 24 human members, of which MMP-2 and MMP-9 (gelatinase A , 72-kD type IV collagenase and gelatinase B , 92-kD type IV collagenase) have been observed in several ovarian cancer cell lines and detected in ascitic fluid from patients with advanced ovarian cancers. In ovarian cancer, uPA is also present in significant levels in ascites and increased levels are related to poor prognosis (Chambers et al., 1995; Moser et al., 1994; Schmalfeldt et al., 1995). The invasiveness of ovarian cancer cells has been reported to correlate with the expression of MMP-2/-9 and uPA (Ellerbroek et al., 1999; Pustilnik et al., 1999; Schmalfeldt et al., 2001). Drug resistance is described as a multifactorial phenomenon, involving the expression of defense factors and/or detoxification mechanisms, alterations in drug-target interactions (e.g., target accessibility, target sensitivity, persistence of D N A cleavage, 8 genomic localization of D N A damage) and cellular response to specific cytotoxic lesions (Zunino et al., 1997). The resistance to cytotoxic agents might be stimulated by increased expression of P-glycoprotein (P-gp), the drug efflux pumps, and multidrug resistance protein. However, recent data on the chemoresistance of ovarian cancer strongly suggested that a decreased susceptibility of the cancer to apoptosis is strongly associated with drug resistance (Arts et a l , 2000; Hanahan & Weinberg, 2000; Mor et al., 2002; Mueller et al., 1998; Xerri et al., 1997). Chemotherapy led to a significant increase in p53 expression of which plays a role in both apoptosis and D N A repair, along with enhanced chemoresistance (Levesque et al., 1995; Petty et al., 1998). Although prognostic value of the expression of Bcl-2 family is still inconclusive, up-regulation of Bcl-2 and/or down-regulation of Bax have been correlated with increased chemoresistance (Diebold et al., 1996; Eliopoulos et al., 1995; Herod et al., 1996; Tai et al., 1998). In addition, inhibitors of caspases such as FLICE inhibitory protein (FLIP) and inhibitor of apoptosis (IAP) were implicated as determinants of the chemosensitivity of ovarian cancer (Kirchhoff et al., 2000; Krueger et al., 2001; Sasaki etal., 2002; Sasaki et al., 2000; Zygmunt et al., 2002). 1.1.5 Hormonal factors in ovarian surface epithelial (OSE) and OEC A growing body of evidence indicates that several key reproductive hormones can influence the incidence and/or growth characteristics of ovarian cancer (Table 1.1). These findings are in line with the hormonal carcinogenesis hypothesis suggesting that the endocrine factors that control the normal growth of target organs can also provide suitable conditions for neoplastic transformation. Carcinomas of endocrine target tissues such as breast, uterus, and ovary account for approximately 30% of cancer mortality in women. Unlike external risk factors such as diet and smoking, endogenous hormone levels are not easily modified; thus, it is important to understand the molecular changes induced by endocrine factors that might have a positive or negative association with neoplastic transformation in ovarian cancer. Here, recent data regarding a potential role of gonadotropin-releasing hormone (GnRH) and estrogen in the physiology of normal and neoplastic OSE cells was summarized. The hypothalamic decapeptide GnRH is a key neuroendocrine regulator in the mammalian reproductive system. Besides the well-established function of classical 9 mammalian GnRH (GnRH-I) in the control of gonadotropin secretion from the pituitary, both GnRH-I and a second form of GnRH (GnRH-II), presumably acting via a common receptor (GnRHR), are expressed in extrapituitary tissues including the ovary (Dong et al., 1993; Kang et al., 2001c). For instance, the expression of GnRH-I, GnRH-II, and GnRHR has been demonstrated in different components of the human ovary, including granulosa-luteal, normal OSE, immortalized OSE (IOSE), and ovarian cancer cells (Kang et al., 2000b; Peng et al., 1994). GnRH-I and its receptor (i.e. type I GnRH receptor; GnRHR-I) are expressed in 80% of human ovarian epithelial tumors, OSE cells, and ovarian cancer cell lines (Emons et al., 1993; Miyazaki et al., 1997), suggesting that this decapeptide hormone may be an autocrine and/or paracrine regulator of the OSE and play a role in ovarian cancer pathophysiology (Grundker & Emons, 2003; Kang et al., 2003; Savino et al., 1992; Schally, 1999; Schally et al., 2001). Native GnRH-I and its synthetic analogs inhibit the growth of numerous GnRH receptor-bearing ovarian cancer cell lines in vitro (Emons et al., 1993; Imai et al., 1996; Kimura et al., 1999; Lee et al., 1991; Peterson et al., 1994). Interestingly, antagonistic analogs of GnRH, such as Cetrorelix, may also exert dose-dependent anti-proliferative effects in ovarian cancer cells (Tang et al., 2002; Yano et al., 1994). The growth inhibitory effects of GnRH analogs have also been observed in normal OSE cells (Kang et al., 2000a). More recently, it has been established that GnRH-II induced growth-inhibition in IOSE cells and ovarian cancer cells (Choi et al., 2001a; Grundker et al., 2002; Kang et a l , 2003; K im et al., 2005; K im et al., 2004). Several reports have shown that GnRH analogs can induce apoptosis or regulate drug-induced apoptosis in ovarian cancers (Grundker et al., 2000; Gunthert et al., 2004; Imai et al., 1998; Motomura, 1998; Ohta et al., 1998). In nude mice, the suppression of endogenous gonadotropin secretion from the pituitary by GnRH-agonist resulted in a growth inhibition of heterotransplanted ovarian cancers (Peterson et al., 1994). Physiologically, follicular granulosa cells mainly produce E2 and estrone (El). Postmenopausal women with ovarian epithelial cancer have an increased levels of peripheral and ovarian venous sex steroids, including E l and E2 (Heinonen et al., 1986). Evidence also shows that E2 is produced in human epithelial ovarian cancer cells (Taube et al., 2002; Wimalasena et al., 1991). Furthermore, aromatase expression was found in 10 OSE, epithelial ovarian tumors, and in some ovarian cancer cell lines, including BG-1, PE04, and PE014 (Cunat et al., 2005). These findings suggest that estrogen may provide a hormonal environment that promotes tumor progression and/or may play an active role in regulating the proliferation/survival of these cells. ERs are expressed in normal OSE cells as well as in ovarian cancers (Hillier et al., 1998; Lau et al., 1999; Pujol et al., 1998). Specifically, ERa is expressed in up to 60% of ovarian epithelial tumors where its levels are generally higher than in benign tumors or normal ovaries (Rao & Slotman, 1991; Risch, 1998a; Vierikko et al., 1983; Willcocks et al., 1983). In addition, ERp expression has been reported in normal OSE cells and in ovarian cancer cell lines at both the mRNA and protein levels by us (Choi et al., 2001c) and others (Brandenberger et al., 1998; Lau & Matzuk, 1999). However, the majority of studies suggest an increased ERa:ERP ratio in ovarian cancer, implying a mechanism that results in ERa overexpression or a selective growth advantage for ERa-positive cells (Brandenberger et al., 1998; Pujol et al., 1998; Rutherford et al., 2000). SKOV-3 cells, which are insensitive to E2 with respect to cell proliferation and induction of gene expression, were found to possess a mutated ERD resulting from a 32 bp deletion in exon l(Lau et al., 1999). This may provide an explanation for the lack of responsiveness and resistance to E2 in some ovarian cancers. Treatment with exogenous estrogens stimulated the growth of several ER-positive ovarian carcinoma cell lines in vitro (Choi et al., 2001c; Galtier-Dereure et al., 1992). In addition to cell growth, estrogen may also affect ovarian cancer invasion (Song et al., 2005). Although the proliferative effects of estrogen on ovarian cancer have been relatively well characterized, its effects on normal OSE are still controversial. E2 seems to have a biphasic effect on the growth of normal OSE cells such that higher concentrations (uM) of estrogen inhibit cell growth (Keith Bechtel & Bonavida, 2001; Wright et al., 2003; Wright et al., 2005; Wright et al., 2002), whereas no response (Bai et al., 2000; Choi et al., 2001c; Karlan et al., 1995; Wright et al., 2002) or a proliferative response (Syed et al., 2001) is observed at lower concentrations (nM or pM). Using rhesus OSE cells, Wright et al has demonstrated that micromolar doses of estrogen, similar to those observed during ovulation in primates, inhibit phosphorylation of retinoblastoma, induce the expression of C D K inhibitors (p21 and p53), and result in cell cycle arrest (Wright et al., 2003; Wright et al., 2005). In a neoplastic IOSE cell line, we have demonstrated that E2-mediated 11 growth-stimulation is attenuated by co-treatment with tamoxifen, an estrogen antagonist (Choi et al., 2001c). Moreover, the mechanism of E2 action may involve an up-regulation of Bcl-2 (anti-apoptotic gene) at both the mRNA and protein levels (Choi et al., 2001c). Since no significant difference was observed in the mRNA and protein levels of Bax (pro-apoptotic gene), our data suggest that estrogen may act by preventing apoptosis in tumorigenic OSE cells. Our observations are consistent with previous data suggesting that E2 suppresses basal and cisplatin-induced apoptosis by increasing D N A repair capacity and avoiding apoptosis in SKOV-3 and OVCAR-3 cells , eventually leading to uncontrolled cell growth and drug resistance of ovarian cancers in vivo (Murdoch & Van Kirk, 1997). In this regard, BRCA1 (DNA repair gene) can be a ligand-reversible barrier to transcriptional activation by promoter-bound ERa, and that functional inactivation of this gene may promote tumorigenesis through inappropriate E2-mediated regulation of breast and ovarian epithelial cell proliferation (Zheng et al., 2001). 1.2 Gonadotropins * 1.2.1 Structure, production, and regulation Gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH), belong to a family of glycoprotein hormones along with human placental chorionic gonadotropin (hCG) and thyroid-stimulating hormone. These four glycoproteins are heterodimers consisting of unique (3-subunits (FSH-p, LH-P , hCG-p, and thyrotropinp) that are non-covalently bound to a common a-subunit. In humans, the a subunit gene is on chromosome 21 and the single genes for FSH-P and LH-P gene are on chromosomes 11 and 19, respectively. hCG-p , which is encoded by six alleles located on chromosome 19, has 83% homology with LH-P protein while the promoter region of the gene are dissimilar to that of LH-P , which is regulated by hypothalamic peptides and steroids. The P-subunits of both gonadotropins are synthesized in and secreted from anterior pituitary gonadotropes and then attach themselves to the common a subunits, which are generally overproduced without any significant physiological functions as a free form. The glycosylation property of the subunits varies, leading to changes in the half-life of the hormones. Regulatory hormonal feedback loops reside in the hypothalamic-pituitary-gonadal axis (Figure 1.1). GnRH produced in the hypothalamus tightly regulates secretion of pituitary gonadotropins. 12 The pituitary gonadotropins FSH and L H and local factors including activin and inhibin control the production of steroid hormone in gonads. Gonadal steroids participate in the hormonal feedback loops by regulating the production of gonadotropins in the pituitary either directly or indirectly. While a a-subunit mutation resulting in gonadotropin dysfunction was not identified until now, only a few inactivating mutations of the FSH- and LH-P subunit have been found. Women with homozygous inactivating mutations for FSH-P have amenorrhea and infertility (Matthews & Chatterjee, 1997; Matthews et al., 1993). Heterozygous mutations of FSH-P do not appear to alter any reproductive function. To date, no homozygous LH-P genotype has been observed as opposed to the identification of heterozygous LH-p genotypes, which may be polymorphisms (McDonough, 2003). 1.2.2 Receptor and signaling When FSH and L H are secreted into the blood from anterior pituitary gonadotropes, they bind to and activate their respective receptors, FSHR and LHR, in ovarian target cells in women and testicular cells in men. Both gonadotropin receptors are G-protein-coupled receptors (GPCRs) with seven transmembrane domains. In fact, they contain a large extracellular domain binding to their heterodimeric ligands, a transmembrane domain including three extracellular and intracellular loops, and a cytoplasmic domain binding to G-protein. The FSHR and L H R are encoded by each single gene on chromosome 2p21pl6 with 10 and 11 exons, respectively. The GPCRs are characterized by the presence of seven a-helical transmembrane domains and owe their name to their communication with GTP-binding proteins (G-proteins), heterotrimeric proteins composed of a-, P-, and y-subunits. In general, receptor activation induces a conformational change in the G- protein that triggers the exchange of GDP, bound to the a-subunit, for GTP resulting in the activation and dissociation of G-subunits from G-subunits. Subsequently, the Ga- and GPy-subunits stimulate effector molecules such as adenylyl and guanylyl cyclases, phosphodiesterases, phospholipase C, and PI3Ks, thereby activating or inhibiting the production of second messengers, including cAMP, cGMP, diacylglycerol, and inositol trisphosphate. In addition, the induction of a calcium influx and the opening or closing of diverse ions channels are also 13 associated with GPCR signaling. It is becoming increasingly clear that the regulation of proliferation and differentiation, in various normal or malignant cells, by GPCRs involves more multifaceted signaling mechanisms than has been previously documented. For example, GPCRs can modulate cellular processes independently of G-proteins and/or can stimulate more than one subfamily of heterotrimeric G-proteins in parallel (Brzostowski & Kimmel, 2001; Gudermann et al., 1996; Hall et al., 1999). It is generally accepted that the protein kinase A (PKA) pathway mediates the effects of gonadotropins on granulosa and Leydig cells , such that activation of adenylyl cyclase by the stimulatory G- protein, Gas, is followed by a rapid increase in cAMP and a subsequent activation of P K A (Hsueh et al., 1984) (Figure 1.2). It is demonstrated that cAMP binds to the regulatory subunit of P K A , and consequently stimulates the dissociation and activation of the catalytic subunit (C subunit). The activated C subunit phosphorylates its substrates such as transacting factor either in the cytoplasm or the nucleus. A family of cAMP-responsive nuclear factors mediates the transcriptional regulation induced by cAMP-dependent pathway. These factors including CRE-binding protein (CREB) and ICER (inducible cAMP early repressor) generally contain the basic domain/leucine zipper motifs and bind as dimers to cAMP-response elements (CRE). For example, a transcriptional activation of CREB for its binding to a transcription coactivator CBP/p300 requires the phosphorylation of serine 133 in the KID domain of CREB (Sassone-Corsi, 1998). To date, about 12 activating and 20 inactivating mutations of L H R genes have been reported (Themmen & Huhtaniemi, 2000). Females with the inactivating mutations of L H R have a less severe phenotype of normal puberty, primary or secondary amenorrhea, hypoestergenism, and high L H levels but normal FSH levels than do males with the same mutation (Themmen & Huhtaniemi, 2000). No significant phenotype for the L H R activating mutations in females was found (Shenker et al., 1993). Thus far, only a few mutations have been identified in the FSHR gene in comparison to LHR. Females with an inactivating mutation for FSHR exhibit a disorder of folliculogenesis, which is identical to the phenotype of inactivating FSH-P mutations or the FSH-P and FSHR knockout mice (Aittomaki et al., 1996; Aittomaki et al., 1995). No clearly activating FSH mutations have been reported in females. In addition, several polymorphisms have been 14 found in both gonadotropin receptors as well as their ligands. Although several studies showed a link between the polymorphisms and disorders of pituitary-gonadal function including PCOS, infertility, and breast cancer, the area is not fully explored (Gromoll & Simoni, 2005; Themmen & Huhtaniemi, 2000). 1.2.3 Physiological role Pituitary gonadotropins are fundamental for the endocrine control of the menstrual cycle in women. The normal menstrual cycle has three successive phases: follicular, periovulatory, and luteal. At the beginning of the cycle, circulating levels of estrogen and progesterone are low, leading to an increased release of FSH from the pituitary. Thus, FSH plays a critical role in follicular maturation such as a stimulation of estrogen production. During preovulation, a surge in gonadotropins, especially L H , corresponds with oocyte release. L H stimulates the remaining follicle, thereby converting it into the corpus luteum. The luteal phase follows with increased progesterone secretion from the corpus luteum. If fertilization does not occur, the levels of both gonadal steroids decrease and the corpus luteum dies out by apoptosis, followed by a new menstrual cycle. The functions of both gonadotropins are well correlated with a temporal and spatial expression pattern of their receptors. FSHR is expressed in one-third of primary and secondary follicles, and all multilayer follicles. In a follicle, the granulosa cells, but not theca cells, express FSHR, and the expression peaks at the late follicular phase. L H R expression is limited to the theca interna in the mid-follicular phase, but spreads to the granulosa cells during the late follicular and periovulatory phases. In the corpora luteum, L H R expression peaks in the mid-luteal phase and then declines, becoming undetectable when the corpus luteum dies (Nishimori et al., 1995; Takao et al., 1997). That is, FSH plays a key role in follicular growth and androgen aromatization in the granulosa cells while L H extensively contributes to the androgen production in the theca cells of antral follicles and ovulation and luteinization in preovulatory follicles. Until recently, it has been believed that c A M P / P K A pathway exclusively mediates gonadotropin-induced various effects in the ovary. However, a growing evidence over the last several years strongly supports the involvement of an additional second messenger such as calcium and phospholipids and the cellular signaling pathways such as PKC, PI3K, 15 and M A P K in FSHR and L H R signaling in the granulosa cells (Figure 1.2) (Alam et al., 2004; Babu et al., 2000; Cameron et al., 1996; Chiang et al., 1997; Cunningham et al., 2003; Das et al., 1996; Flores et al., 1992; Gonzalez-Robayna et al., 2000; Herrlich et al., 1996; Pennybacker & Herman, 1991; Sekar & Veldhuis, 2001). Numerous reports have demonstrated that binding of gonadotropins to their receptors can increase inositol phosphate and accumulate intracellular calcium in granulosa cells (Flores et al., 1990; Gilchrist et al., 1996; Hirsch et al., 1996; Veldhuis, 1987). Coupling of activated L H R to the Gi subunit stimulated PLC to synthesize inositol-1,4,5-triphospate (IP3) and diacylglycerol, resulting in elevation of intracellular calcium level and activation of P K C (Flores et al., 1998; Herrlich et al., 1996; Kuhn & Gudermann, 1999). These findings are consistent with previous observations that not only Gs but also other G proteins including Gi and Gq/11 interact with gonadotropin receptors with stimulating additional secondary messengers; thus, both cAMP and IP3 are activated (Cooke, 1999; Hirsch et al., 1996; Kuhn & Gudermann, 1999; Wang et al., 1997). In addition, it is of interest that FSHR-3, which is an alternate splicing variant of FSHR containing growth type-1 receptor motif, leads to a cAMP-independent but calcium dependent ERK1/2 activation (Babu et al., 2000; Touyz et al., 2000). Recently, the cAMP-dependent signaling and kinase cascade in granulosa cells have been branching out, and the M A P K and PI3K are the two major downstream kinases of cAMP. Studies performed in the rat (Das et al., 1996; Gonzalez-Robayna et al., 2000), pig (Cameron et al., 1996), granulosa cells, and human luteinized granulosa cells (Dewi et al., 2002), demonstrated that FSH and L H stimulate the activation of ERK1/2 and/or p38, the two members of the M A P K family, in a cAMP/PKA-dependent manner. Moreover, with the identification of a new class of cAMP binding proteins, a growing body of evidence for cAMP-dependent but PKA-independent kinase activation by gonadotropins (de Rooij et al., 1998; Kawasaki et al., 1998). This protein, named exchange proteins directly activated by cAMP (Epacs) and also known as ' cAMP guanine nucleotide exchange factors' (cAMP-GEFs), is activated by cAMP, and it regulates small GTPases, such as Rapl . The GTPase which stimulates Raf and/or Ras kinase and leads to the activation of the PI3K/Akt and M A P K pathways (de Rooij et al., 1998; Gille & Downward, 1999; Kawasaki et al., 1998). 16 Gonzalez-Robayna et al. found that FSH and cAMP analogues activate Akt and PI3K inhibitor LY294002, but not P K A inhibitor H89 inhibits this activation. In contrast, the expression and activation of Sgk, which is a serum- and glucocorticoid-inducible kinase and associated with proliferative stages of granulosa cell, was regulated by the PI3K and p38 M A P K . Thus, it was speculated that Epac might be responsible for the cAMP-mediated phosphorylation of Akt and Sgk via PI3K, while P K A is obligatory for the transcription of Sgk in granulosa cells. Furthermore, the Epac is related to Un-stimulated progesterone production in human granulosa luteal cells (hGLC). In hGLC, treatment with 8 CPT-2 M E - c A M P (8-(4-chloro-phenylthio)-2'-0-methyladenosine-3',5'-cyclic monophosphate), the cAMP-GEF-specific cAMP analogue which does not react with P K A , increased progesterone synthesis and secretion in a dose-dependent manner. These data suggested that cAMP-dependent but PKA-independent activation of Epac/Rapl regulates progesterone production, probably via M A P K and Akt pathways (Chin & Abayasekara, 2004). Since cAMP-stimulated calcium is not mediated by P K A phosphorylation but by Epac activation in HEK923 cells, Epac is also likely associated with intracellular calcium regulation (Schmidt et al., 2001). In addition to Epac, an attempt to find possible link between gonadotropin and PI3K pathway, has found direct coupling of FSHR with APPL1 (adaptor protein containing PH domain, PTB domain, and leucine zipper motif) (Nechamen et al., 2004). APPL1, also known as DIP 13a have been shown to interact with the p i 10« catalytic and p85 regulatory subunit of PI3K as well as inactive Akt (Mitsuuchi et al., 1999; Yang et al., 2003). 1.3 Gonadotropin theory To date, several hypotheses have been suggested to explain the epidemiological findings. The "incessant ovulation" hypothesis, which was initially proposed by Fathalla et al. in 1971 and later extended by other researchers, postulates that repeated trauma during ovulation leads to an increased exposure of the OSE to genetic abnormalities and/or other risk factors (Casagrande et al., 1979; Fathalla, 1971). Indeed, early menarche, late menopause, and nulliparity, all of which have more ovulation episodes, increase the risk of developing ovarian cancer. On the other hand, conditions in which ovulation is 17 suppressed, such as multiple pregnancies and prolonged breastfeeding, have been reported to lower the risk to develop ovarian cancer (Ford et al., 1994; Ford et al., 1998; Greenlee et al., 2000). Although this incessant ovulation theory reconciles appreciable epidemiological and experimental data, the underlying mechanism remains poorly understood. Moreover, some observations do not fit this theory (Lambe et al., 1999; Westhoff et al., 1993; Whiteman et al., 2000; Whittemore et al., 1992). Several hypotheses explore the etiology of ovarian cancer, which are not exclusive with the incessant ovulation theory, and not with each other. Based on the risk factor of pelvic inflammatory disease and the favorable effects of hysterectomy and tubal ligation, the "inflammation" hypothesis was advocated (Ness & Cottreau, 1999). The "stromal" hypothesis suggests that some follicular cells escape from programmed cell death, continuously produce steroid hormones, and stimulate neoplastic conversion of the OSE cells in stroma (Cramer et al., 2002). Considering hormonal carcinogenesis shown in endocrine-related cancers such as breast and prostate cancers, two major hormonal hypotheses are currently under examination. One is an "androgenic/progesterone" hypothesis stating that androgens, which are increased in menopausal or obese women, stimulate tumorigenesis in the ovary while progesterone protects it (Risch, 1998a). The other is the "gonadotropin" hypothesis proposing that excessive levels of gonadotropins, related to the surge occurring during ovulation and the loss of gonadal negative feedback for menopause and premature ovarian failure, may play a role in the development and progression of ovarian epithelial cancer (Biskind, 1944; Cramer & Welch, 1983). 1.3.1 Animal models Several animal studies initially drew attention to a possible involvement of gonadotropins in ovarian tumorigenesis. In 1944, Biskind and Biskind reported ovarian tumors frequently occur in rat whose ovaries were autotransplanted to the spleen (Biskind, 1944). In contrast, they failed to observe the formation of the ovarian tumors when one ovary was left intact or when the ovary was autotransplanted in previously hypophysectomized animals (Biskind, 1948). This ovarian tumorigenesis has been characterized to elevated pituitary gonadotropins due to the deactivation of estrogen in the 18 liver and the consequent depletion of negative feedback of estrogen on the pituitary. Since then, the development of ovarian tumors has been reported in several transgenic or knockout animal models in hyper-gonadotropism (Keri et al., 2000; Kumar et al., 1999; Matzuk et al., 1992; Risma et al., 1995). However, these animal models were considered to have little relevance to explain the tumorigenic mechanism of the OEC because the tumors in the animal models commonly arise from the stromal cells that do not spare the compound epithelial pattern observed in human ovarian epithelial tumors. On the other hand, more recent animal studies that focus on the proliferation of the OSE or the factors involved in this process, have demonstrated that ovulation induction with gonadotropins significantly stimulates proliferation in the OSE, strongly supporting the "gonadotropin theory" for ovarian epithelial tumor. One study monitored the proliferative activity of the OSE cells during the lifetime of mice. The OSE cells were scarcely proliferative in adult life when compared to prenatal period. The OSE cells of non-pregnant, pregnant, and lactating mice showed little proliferative, but they significantly proliferated following the administration of P M S G or pure recombinant gonadotropins. This data suggest that gonadotropins may play a role in the proliferation of the OSE as well as their classical role in ovarian folliculogenesis(Davies et al., 1999). Similar patterns of increased proliferation were observed in rat and rabbit OSE after administration of gonadotropins. Concerning the site and duration of proliferation, it has been demonstrated that the increased proliferation of the OSE cells occurs adjacent to the ovulatory site and the corpus luteum, and then it persists throughout the most of the postovulatory period. In some studies, proliferation of the OSE cells was also detectable in nonovulatory sites after ovulation (Burdette et al., 2006; Osterholzer et al., 1985a; Stewart et al., 2004a). Stewart et al. further examined the effect of rupture, estrogen, and superovulation with gonadotropins on the OSE cells in two groups of rats, with and without surgically induced injury to the ovary. Administration of P M S G and hCG led to a more than 10-fold increase in proliferation of rat OSE cells and the effect persisted up 40 h. In contrast, surgical injury mimicking the rupture of ovulation induced just a five-fold increase in proliferation and the effect was relatively transient. It is noteworthy that surgery failed to alter the response of the OSE to the gonadotropin treatment while it doubled the effect of E2 alone on the OSE proliferation; thus, estrogen, 19 but not gonadotropins, may be involved in the regulation of the would-healing process of the OSE. Based on the results, the author postulated that hormones related to ovulation induction and HRT as well as injury- or ovulation-induced rupture of the OSE significantly stimulated proliferation of OSE cells, and consequently contributed to ovarian tumorigenesis via proliferation-stimulated D N A mutations and/or a rapid selection of OSE cells with accumulated mutations (Stewart et al., 2004a). The exact mechanism by which gonadotropin-induced ovulation and proliferation of OSE exert tumorigenic action in the ovary is poorly understood. A recent study carried out various histopathological examinations in three groups of rats including one, three, and six cycles of ovulation induction groups at the 12th month after treatment ended. Although a malignant ovarian lesion did not develop in any of the three groups after ovulation induction, epithelial dysplasia such as inclusion cysts, tufts, and epithelial stratification were significantly enhanced when the number of induction cycles increased . Since inclusion cysts and tufts are sites prone to ovarian cancer, this data may support the possibility that gonadotropin-induced superovulation stimulates ovarian cancer development by increasing epithelial dysphasia in the ovary (Celik et al., 2004). Most research on the "gonadotropin theory" focused on the role of gonadotropins in the initial transformation of normal OSE to neoplastic OSE. More recently, the possible involvement of gonadotropins in tumor progression was examined in several animal models. Stewart et al. developed a rat model using a carcinogen, D M B A (7,12-dimethylbenz(a)anthracene), which closely resembles the histopathology, pattern of metastasis and mutations of Tp53 and Ki-Ras in human OEC. Interestingly, the addition of gonadotropins following treatment with D M B A considerably stimulated lesion severity in this animal model. This indicates that gonadotropin stimulation may play a simulative role in the progression of OEC (Stewart et al., 2004b). Elevated levels of gonadotropins are related to increased angiogenesis of ovarian cancer, probably through the regulation of vascular endothelial growth factor (VEGF). For example, ovariectomy-induced or directly administrated gonadotropins notably stimulated the progression of human epithelial ovarian tumors in mouse models. MRI data showed increased neovascularization of human ovarian carcinoma spheroids in ovariectomized mice, and treatment with gonadotropins up-regulated V E G F in vitro and in vivo (Schiffenbauer et al., 1997). 20 1.3.2 Epidemiological data Several epidemiological studies seem consistent with the gonadotropin theory. First, a close temporal association between the increase in the incidence of ovarian epithelial tumor and the rise in circulating gonadotropin levels does exist (Figure 1.3). The onset of menopause, which happens at approximately age 51 years, follows gradual changes in the menstrual cycle, along with changes in gonadotropin levels. In the early menopausal years, hormone levels are particularly high, such that concentrations of FSH and L H peak at 10-20 and 3-4 times of the values recorded during the proliferative phase of menstrual cycle, respectively, two or three years after menopause (Chakravarti et al., 1976; Speroff, 1999). With the lack of primordial follicle pool available, diminished ovarian functions such as the termination of the menstrual cycle and folliculogenesis decrease the production of steroids such as estradiol and progesterone. Thus, the increased levels of gonadotropins, but without change in hypothalamic GnRH levels, occur because of the disruption of feedback control between the pituitary and ovary. The increase pattern of gonadotropins during menopause parallels the age-specific incidence rate for ovarian epithelial cancer, which shows 85-90% of incidence in peri- or postmenopausal women and a median age of 61-65 years. As mentioned above, multiple pregnancies and use of oral contraceptives (OC) are well-established protective factors for ovarian cancer incidence, such that each additional pregnancy leads to a 10-16% decrease in risk (Hankinson et a l , 1995; Risch et al., 1996). The protective effect of OC use increases 7% per each year of use, up to 80% reduction with long-term users (over 10 years) (Bosetti et al., 2002; McGuire et al., 2004). These data on multiple pregnancies and use of OC support the gonadotropins theory since both factors are associated with low levels of gonadotropins as well as the inhibition of "incessant ovulation". Additionally, early menarche and late menopause, both of which have more ovulation episodes and exposure to high gonadotropin levels, increased the risk of ovarian cancer development (Franceschi et al., 1994; Hankinson et al., 1995; Purdie et al., 1995). The ovarian cancer risk associated with ovulation induction treatment used for infertile women at in vitro fertilization (IVF) process has been considered direct evidence for the gonadotropin theory since the ovary is directly exposed to the superphysiological 21 levels of gonadotropins for multiple follicular development during the controlled ovarian hyperstimulation. In this regard, whether the superovulation with high gonadotropins is an independent risk factor for ovarian cancer has been studied by numerous researchers in various population pools (Kashyap et al., 2004; Lukanova & Kaaks, 2005). Two early studies, which prompted discussion of this issue, have suggested strong association between ovulation induction and ovarian cancer incidence. A case-control study by Whittemore et al. was reported in 1992 (Whittemore et al., 1992). They collected the data from 2,197 white patients with ovarian cancer and 8,893 white controls in 12 US case-control studies conducted from 1956 to 1986. In infertile women who had used fertility drugs, a 2.7-fold increased risk of ovarian cancer was observed. In 1994, Rossing et al. (Rossing et al., 1994) reported the risk of ovarian tumors in a cohort of 3837 women tested for infertility between 1974 and 1985 in Seattle. Eleven developed malignancies and the risk of invasive ovarian cancer development compared to that in the general population was 2.5 overall (95% confidence interval [95% CI] 1.3 to 4.5), 1.5 (95% CI 0.4 to 3.7) in invasive ovarian cancer, and 3.3 (95% CI 1.1-7.8) in borderline tumors. The relative risk among the women that used clomiphene citrate (CC) as compared with that among infertile women with no use was 2.3 overall (95% CI 0.5 to 11.4). The risk was most prominent in women with long-term use of CC (12 or more cycles with a relative risk (RR) of 11.1% (95% CI 1.5-82.3). Since then, most studies on this issue have observed either a weak or no association between the infertility treatment and ovarian cancer risk (Anderson & Dimitrievich, 1996; Balen, 1995; Franceschi et al., 1994; Kashyap et al., 2004; Modan et al., 1998; Ness et al., 2002; Rao & Slotman, 1991; Shoham, 1994). Some studies suggested an association between ovulation induction treatment and an increased risk of borderline tumor (Ness et al., 2002; Parazzini et al., 1998). Together, currently available findings on the risk of ovulation induction are inconclusive but generally reassuring. Indeed, a better understanding of this factor for ovarian cancer risk requires a larger population study, longer follow-up, and a consideration of histological types and related factors such as OC use. Like other hypotheses regarding the pathogenesis of ovarian cancer, the gonadotropin theory cannot reconcile all the epidemiological observations. For example, the observations of the strong protective effect from a twin pregnancy and the nonprotective effect of HRT, which 22 reduce to some extent the gonadotropin levels of menopausal women, are unlikely to be consistent with the theory. The gonadotropin theory, a long-lived theory regarding ovarian cancer etiology, primarily arose from animal models in the early 1950s. It was enriched by Cramer and Welch in 1998. They combined the gonadotropin theory with incessant ovulation theory, suggesting that ovulation simulates the entrapment of surface OSE within the ovarian stroma, and subsequent proliferation and transformation of the OSE may occur due to stimulation by high gonadotropin levels. As for the mechanism of gonadotropic stimulation, it was suggested that the excessive levels of gonadotropins act in the stroma compartment, rather than in OSE cells, as a stimulatory factor for steroidogenesis. Consequently, the steroidogenic stromal cells secrete increased levels of estrogen, which may play a mitogenic and/or carcinogenic role in the OSE cells in a paracrine manner. However, rapidly accumulating recent data demonstrate that gonadotropin receptors, FSHR and LHR, are expressed in the OSE and ovarian cancer cells as well as their classical expression site such as granulosa and theca cells. Furthermore, their binding to the ligands, FSH and L H , respectively, activates various key signaling transduction pathways, resulting in a number of biological effects. These findings brought the "gonadotropin" theory into a new era, where the direct effect of gonadotropins in the OSE cells should be considered to evaluate the association of gonadotropins with ovarian tumorigenesis as well as their indirect effects on other ovarian cells such as granulosa and theca cells. Furthermore, the expression of gonadotropin receptors in ovarian cancer cells (Figure 1.4) strongly suggests a potential role of gonadotropins in various aspects of ovarian cancer progression such as metastasis and chemoresistance. 1.3.3 Gonadotropin levels in patients with OEC Several groups have studied an association of prediagnostic serum gonadotropin levels with the risk for ovarian epithelial cancer. For example, no association between serum FSH and ovarian cancer risk (Arslan et al., 2003; Kramer et al., 1998), or the even reverse correlation has been observed (Blaakaer et al., 1992; Helzlsouer et al., 1995). Similarly, data on circulating L H levels suggested that neither wild-type L H level nor 23 variant L H status contributes to the ovarian cancer risk (Akhmedkhanov et al., 2001; Ala-Fossi et al., 1999; Kramer et al., 1998). In contrast, the free beta subunit of hCG is generally increased in the serum of women with ovarian cancer (Alfthan et al., 1992; Cole et al., 1988; Marcillac et al., 1992) and its prognostic value was evaluated (Vartiainen et al., 2001). A recent study that demonstrated the hCG-P gene expression in ovarian cancer tissues, in contrast to the lack of its expression in noncancerous tissues, proposed the possibility that the high levels of circulating hCG-P is directly produced from ovarian cancer tissue (Nowak-Markwitz et al., 2004). However, whether hCG-P plays a physiopathological role in OEC is still unknown. Interestingly, serum L H levels are associated with BRCA1 mutation status. Any significant difference among serum FSH levels in non-carriers, BRCA1 mutation carriers, and women from non-BRCAl/2 families was not found. In contrast, L H levels in the follicular phase among young healthy BRCA1 mutation carriers was drastically elevated compared with non-carriers from BRCA1 families, suggesting that high levels of L H may be a part of the BRCA1 phenotype (Jernstrom et al., 2005). •{• The observation of serum gonadotropins levels in women with ovarian cancer is inconsistent with the gonadotropin hypothesis of ovarian epithelial carcinogenesis. However, ovarian and peritoneal levels of gonadotropins are associated with ovarian cancer incidence. For instance, Kramer et al. found the high levels of gonadotropin in cysts of serous ovarian cancer in contrast to the low or absent gonadotropin levels in benign ovarian tumors while no significant difference was found in the serum FSH and L H concentrations (Kramer et al., 1998). L H levels in peritoneal fluid and ovarian cyst fluid from tumor aspirates was considerably higher in patients with ovarian cancer or borderline ovarian tumor than in patients with benign cysts or tumors (Chudecka-Glaz et al., 2004; Halperin et al., 2003). The concentrations of both gonadotropins in ovarian cancer fluid was greater than in fluid from borderline tumors, benign tumors, and functional cysts of the ovary, and their serum:tumor was lowest in ovarian cancer (Rzepka-Gorska et al., 2004). These data suggested that FSH and L H might play a role in ovarian cancer development; however, further larger-scale experiment should be employed to confirm the relation of the high levels of ovarian and peritoneal gonadotropins to the risk for ovarian cancer. 24 1.3.4 Gonadotropin receptor in OSE and OEC cells Both FSHR and L H R have been found to be expressed in normal OSE cells and ovarian tumors (Choi et al., 2002a; Kobayashi et al., 1996; Lu et al., 2000; Mandai et al., 1997; Minegishi et al., 2000; Parrott et al., 2001; Rajaniemi et al., 1981; Zheng et al., 2000). Eighty percent of cystadenomas, 71% of borderline tumors, and 40% of epithelial ovarian carcinomas are LHR/hCGR positive. The patients with LHR-positive cancer had a better prognosis compared to those without LHR, but no significant correlation between the receptor expression and the clinical stage of the disease was seen (Mandai et al., 1997).Additionally, Lu et al. examined the L H R expression in tumor epithelium and tumor stroma separately. The positivity of LHR declined from precursor lesions, benign, and borderline tumor to invasive ovarian cancer in both tumor epithelium and stroma, suggesting the role of L H on early tumorigenesis via direct stimulation of the epithelium and/or indirect activation of stromal cells (Lu et al., 2000). Zheng et al. demonstrated the mRNA expression of FSHR in 100% of epithelial inclusions, 100% of cystadenomas, 94% of borderline tumors, and 60% of the carcinomas, and, although the result was not statistically significant, negative correlation between the positivity and carcinoma grade was observed. This suggested that FSH may be more important in early tumorigenesis (Zheng et al., 2000). Recent studies have suggested a relationship between the expression of gonadotropin receptors and ovarian cancer development (Lu et al., 2000; Syed et al., 2001; Wang et al., 2003a). Indeed, semi-quantitative RT-PCR data demonstrated that the relative mRNA levels of FSHR in ovarian cancer cells were higher than those in primary cultures of human OSE cells or in immortalized cell lines while an opposite expression pattern was observed for LH-R mRNA (Syed et al., 2001). These data are consistent with a recent observation, using quantitative real-time PCR, that mRNA levels of FSHR significantly was enhanced in the order of normal OSE, benign tumor low malignant potential (LMP), tumor and invasive ovarian cancer (Ji et al., 2004). Furthermore, FSHR levels increased from presumed precursor lesions (OEIs, ovarian epithelial inclusion) to benign OETs (ovarian epithelial tumor) and to borderline OETs, while its levels decreased from borderline OETs to ovarian carcinomas (Wang et al., 2003a). Together, these observations suggest that both serum FSH levels and FSHR levels in the ovarian 25 epithelium may play a role in tumorigenesis of ovarian cancer, especially early in the process. Little is known regarding regulation of FSHR and L H R expression in normal OSE and its neoplastic counterpart. It is demonstrated that L H R gene expression in ovarian cancer cell lines is regulated in a different way upon diverse experimental conditions. For example, EFO-21 cells showed the remarkable down-regulation of L H R mRNA following treatment with hCG or EGF. In contrast, no considerable change in mRNA levels of L H R responding to the samples was observed in OVCAR-3 cells (Steinmeyer et al., 2003). The expression of FSHR in granulosa and Sertoli cells was modulated by single nucleotide polymorphisms (SNPs) (Wunsch et al., 2005) and the hypermethylation of some CpG sites in the promoter region of FSHR (Griswold & Kim, 2001), respectively, but the association of SNPs and the hypermethylation with the regulation of expression of gonadotropin receptors has not been evaluated in the OSE and ovarian cancer cells. As discussed earlier, the functional mutations of gonadotropin receptors including activating and inactivating mutations are rare in women. Among 37 tumors including 20 epithelial cancers and 5 carcinoma cell lines examined, Ichikawa et al. failed to identify any mutational sequence on G-protein-interaction domains of L H R and FSHR and on "hot spots" of the a subunit of adenylyl cyclase-binding G proteins, suggesting no relation of genetic mutations of the receptors to ovarian tumorigenesis (Ichikawa et al., 1996b). It is noteworthy that response to FSH stimulation is associated with FSH receptor genotype such as SNPs, resulting in various physiological /pathological conditions in the ovary (Greb et al., 2005; Gromoll & Simoni, 2005; Perez Mayorga et al., 2000). A recent finding identified two nonsynonymous SNPs of the FSHR gene in OSE cells, which occur at Ala307Thr and ser680Asn in the coding region of the gene, suggesting the possible involvement of these SNP in ovarian cancer development by changing the susceptibility of the OSE cells to FSH stimulation (Yang et al., 2006). Among 202 ovarian-cancer patients and 266 age-matched cancer free controls, the SNP carriers have shown an increased risk of developing serous and mucinous types of ovarian cancers, but not endometrioid and clear cell types. The functional aspects of these SNPs in ovarian carcinogenesis require further study. 26 1.4 Action of gonadotropins in OSE and OEC Gonadotropins may involve in the pathogenesis and progression of ovarian cancer. They modulate gene expression leading to changes in cell growth, apoptosis and/or metastasis of OSE and ovarian cancer (Table 1.2). 1.4.1 Gonadotropin-regulated gene expression The exact mechanism of the response to gonadotropins is not clearly understood in the OSE and ovarian cancer cells. Recently, two cDNA microarray studies have examined the gene expression profiles of normal and neoplastic cells following treatment with FSH (Ho et al., 2003; Ji et al., 2004). In a study using complementary D N A microarrays containing 2400 named genes, Ho et al. aimed to identify a set of genes, which may be involved in ovarian carcinogenesis, by comparing FSH-regulated genes in three immortalized OSE cells and three ovarian cancer cells. They found 312 genes and 197 genes of 200-300% change after treatment with FSH in IOSE and ovarian cancer cells, respectively. Only 18 genes were in common, suggesting that FSH may have dissimilar biological effects on normal and cancer cells. Among the 18 genes, 9 genes including Rap 1 GAP, heat shock factor-2, protein phosphatase inhibitor-2, neogenin, and restin were differentially regulated by FSH in normal and cancer cells, and it was assumed that those genes may play a key role in ovarian carcinogenesis, rather than the other gene group which exhibited the same direction of change response to FSH treatment. Furthermore, using their specific antisense oligonucleotides, neogenin and restin have been demonstrated to have proliferative effect in the ovarian cancer cell (Ho et al., 2003). Another cDNA microarray analysis using Affymetrix human genome HG-U95Av2 Gene Chips containing 10,000 full-length genes focused on FSH-induced gene expression profiles regarding proliferation of the OSE cells, and identified 91 up-regulated genes and 68 down-regulated genes for a more than 2-fold increase following FSH treatment. In MCV152 cells derived from SV40-transformed serous papillary cystadenoma transfected with telomerase hTERT, after FSH treatment, most of the up-regulated genes were related to metabolism (fatty acid desaturase-l/-2 and FAS), increased cell proliferation (Rab-GAP/TBC, cyclin G2), and oncogenesis (catenin 27 P-l, ems-1 Meis-1). In contrast, tumor suppressor genes (RBI, B R C A 1 , BS69) and genes related to decreased cell proliferation were down-regulated (Ji et al., 2004). Although the effect of gonadotropins in follicles and stroma have received little attention to evaluate the role of hormones in ovarian epithelial cancer, a number of findings from gene expression profiling in gonadotropin-stimulated granulosa cells suggested a possible involvement of the indirect effect of gonadotropins on granulosa cells. Along with the predicted amplification of steroidogenesis related genes such as StAR, cytochrome P450scc, and aromatase, gene transcript for growth factors such as epiregulin and amphiregulin, whose binding to EGFR and/or ERB4 stimulates oncogenic/mitogenic signaling pathways in several cancers including ovarian cancer, was markedly elevated in hGLC following L H and FSH stimulation (Rimon et al., 2004). These data are consistent with a previous finding for up-regulation of the epiregulin in granulosa layer after the administration of hCG to the rat (Espey & Richards, 2002). This increase in growth factors by gonadotropins may be associated with an enhanced risk not only for granulosa cell tumor but also for epithelial ovarian cancer due to the excessive exposure of trapped OSE to the growth factors secreted from granulosa cells. This speculation for the role of gonadotropins in growth factor milieu of the ovary is further supported by the findings in the OSE treated with FSH or LH/hCG. In the bovine OSE cells, gonadotropins increase the expression of growth factors such as keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), and kit ligand (KL), which possibly act as autocrine and/or paracrine mitogenic factors (Parrott et al., 2001). Similarly, both hormones increased mRNA expression of EGFR in the bovine OSE cells while hCG but not FSH augmented the expression of TGFa, a ligand for EGFR. Collectively, these data suggest the possible association of gonadotropins with a growth factor system in the ovarian cells including the granulosa and the OSE cells, resulting in a more proliferative microenvironment for the OSE cells (Doraiswamy et al., 2000). 1.4.2 Effect of gonadotropins on proliferation FSH and LH/hCG treatment appears to regulate the growth of normal OSE, IOSE, and some ovarian cancer cells in vitro. Although administration of gonadotropins certainly 28 stimulates proliferation of the OSE cells in most animal models (Burdette et al., 2006; Davies et al., 1999; Osterholzer et al., 1985a; Stewart et al., 2004a), the reports on the association of gonadotropins with the proliferation of OSE and ovarian cancer cells have been inconclusive. FSH possibly increases proliferation in the OSE and cancer cells (Choi et al., 2002a; Edmondson et al., 2006; Gubbay et al., 2004; Ji et al., 2004; Kraemer et al., 2001; Ohtani et al., 2001; Parrott et al., 2001; Syed et al., 2001; Wimalasena et al., 1992; Zheng et al., 2000), although, in other studies, no association (Wright et al., 2002) and even reduced proliferation have been observed (Ivarsson et al., 2001; Pon et al., 2005). Some studies reported the stimulatory effect of LH/hCG on cell growth (Edmondson et al., 2006; Gubbay et al., 2004; Kraemer et al., 2001; Kurbacher et al., 1995; Kuroda et al., 2001; Kuroda et al., 1998; Parrott et al., 2001; Syed et al., 2001; Tashiro et al., 2003; Wimalasena et al., 1992; Wimalasena et al., 1993), but its inhibitory effect (Tourgeman et al., 2002; Zheng et al., 2000) and no association (Ivarsson et al., 2001; Wright et al., 2002) were observed in other studies. The mechanism by which gonadotropins regulate the growth of OSE and ovarian cancer cells has been controversial. A few studies suggested the relation of gonadotropins to other hormones known to be mitogenic in ovarian cancer. For instance, Kraemer et al. found that OVCAR-3 has steroidogenic activity and produces estrogen responding to hCG and FSH. Because of mitogenic effect of estradiol in this ovarian cancer cells, the gonadotropin-stimulated secretion of estrogen led to growth stimulation in OVCAR-3 cells (Kraemer et al., 2001). This role of gonadotropins in steroid metabolism in ovarian epithelial cancer supports a previous finding that about 30% of primary cystadenocarcinoma cultures respond with increased estradiol secretion to hCG and FSH (Wimalasena et al., 1991). A report indicated the involvement of unopposed production of activin A , which stimulates the proliferation, in an increased proliferation by FSH in ovarian cancer cells (Zheng et al., 2000a). Moreover, recent studies have suggested interactions between gonadotropins and growth factors and/or cytokines. Indeed, combined treatments of hCG with estradiol may regulate the growth response of epithelial ovarian cancer cells through a mechanism involving insulin-like growth factor (IGF)-I (Wimalasena et al., 1993). This finding is further supported by a recent report proposing the possible association of IGF-1 and intergrinpl with anchorage-dependent and -29 independent growth of OSE cells by L H (Tashiro et al., 2003). In addition, FSH and hCG stimulated steady state mRNA levels of keratinocyte growth factor, hepatocyte growth factor, and kit ligand in bovine OSE cells (Shoham, 1994). Moreover, FSH-, L H - and estrogen-stimulated IOSE cell proliferation involves the interleukin 6 (IL-6)/signal transducer and activator of transcription-3 (STAT3) signaling pathway (Syed et al., 2002a; Syed et al., 2001). With regard to signaling pathway, it is generally accepted that the effects of gonadotropins on classical target cells such as granulosa and Leydig cells are mediated by the protein kinase A (PKA) pathway, such that activation of adenylyl cyclase by the stimulatory G protein, Gas, is followed by a rapid increase in cAMP and a subsequent activation of P K A (Hsueh et al., 1984). Some studies have proposed that the P K A pathway is also involved in gonadotropin-induced proliferation of OSE and ovarian cancer cells. For example, a specific P K A inhibitor, H89, completely abolished gonadotropin-stimulated cell growth via the IL-6/STAT3 pathway in human OSE and ovarian cancer (Syed et al., 2002b; Syed et al., 2001). Interestingly, a growing evidence shows;fhat FSHR, and L H R can activate a number of additional cellular signaling pathways such as PKC, PI3K, and M A P K as well as c A M P / P K A in granulosa cells (Alam et al., 2004; Babu et a l , 2000; Cameron et al., 1996; Chiang et al., 1997; Cunningham et al., 2003; Das et al., 1996; Flores et al., 1992; Gonzalez-Robayna et al., 2000; Herrlich et al., 1996; Pennybacker & Herman, 1991; Sekar & Veldhuis, 2001). In this regard, the regulation of alternative/additional signaling pathways by FSHR and L H R in OSE and ovarian cancer cells needs to be explored. Initial attempts to explore this question have found that treatment of OEC cells with FSH significantly increased the levels of P K C mRNA and protein, suggesting that the stimulation of P K C transcription is involved in FSH-induced cell proliferation (Ohtani et al., 2001). Our findings have demonstrated that phosphorylation of ERK1/2 and cell growth were significantly increased in preneoplastic IOSE-29 and neoplastic IOSE-29EC cells following treatment with FSH (Choi et al., 2001a). FSH-induced activation of ERK1/2 and proliferation were completely abolished in the presence of PD98059, suggesting that the growth-stimulatory effect of FSH is mediated by ERK1/2. In addition, treatment with FSH significantly phosphorylated a transcription factor, Elk-1, a well known downstream target of ERK1/2 (Choi et al., 30 2002a). It further showed that L H and hCG as well as FSH induced ERK1/2 dependent growth of both human and ovine OSE cells (Gubbay et al., 2004). 1.4.3 Effect of gonadotropins on apoptosis The overall 5-year survival rate for advanced ovarian cancer patients is still low (20-30%) and is due to chemoresistance to conventional cytotoxic drugs such as cisplatin in the primary or recurrent tumors, resulting in treatment failure (Katsaros et al., 1999; Kikuchi, 2001). Compared to the effects of gonadotropins on proliferation of OSE and OEC cells, little is known about whether gonadotropins play a role in chemosensitivity of ovarian cancer. During ovarian folliculogenesis, gonadotropins, especially FSH, inhibited apoptosis by changing the expression of anti-apoptotic proteins such as Bax (Tilly et al., 1995) and XIAP in granulosa cells (Wang et al., 2003b). In ovarian cancer, limited data regarding the link between gonadotropins and regulation of apoptosis are available. In OVCAR-3 cells bearing LHR, L H remarkably inhibited cisplatin-induced apoptosis by increasing the expression of IGF, but not Bcl-2 family proteins such as Bcl-2 andeBax (Kuroda et al., 2001). Fas system is well known to mediate the cisplatin cytotoxicity. L H interfered with the Fas-induced apoptosis in H E Y and CaOV-3 cells (Slot et al., 2006). Similarly, a study found that pretreatment OVCAR-3 cells with FSH significantly reduced cisplatin-induced apoptosis and cell cycle arrest using various methods such as MTT, T U N E L assay, and flow cytometry. Furthermore, this inhibitory effect is mediated by overexpression of a IAP family survivin and down-regulation of caspases activity (Huang et al., 2003a; Huang et al., 2003b). These data indicate that gonadotropins may be involved in chemoresistance, which is a main hurdle for ovarian cancer management. Accordingly, some reports revealed the apoptosis-protective effect of gonadotropins in OSE cells (Edmondson et al., 2006; Kuroda et al., 2001). A recent controversial study has suggested that gonadotropins stimulate apoptosis with decreasing N-cadherin expression via P K A but not ERK1/2 and P K C pathways (Pon et al., 2005). 31 J 1.4.4 Effect of gonadotropins on metastasis The adhesion and angiogenesis of ovarian cancer play a crucial role in peritoneal metastatic dissemination and nutrition supply, resulting in progression of ovarian cancer via invasion and metastasis. Gonadotropins enhance tumor angiogenesis and adhesion in ovarian cancer cells (Schiffenbauer et al., 1997; Schiffenbauer et al., 2002; Wang et al., 2002; Zygmunt et al., 2002). Schiffenbauer and colleagues found that human OEC progressed faster with increased neovascularization in ovariectormied mice as a result of elevated FSH and L H levels, which promoted the expression of V E G F in dose-dependent manner in vitro (Schiffenbauer et al., 1997). hCG significantly increased in vitro and in vivo neovascularization (Zygmunt et al., 2002). Gonadotropins up-regulated V E G F expression in both malignant and borderline tumor, but the effect of gonadotropins was significantly stronger in malignant tumor than in borderline tumor (Wang et al., 2002). In addition to angiogenesis and vascular remodeling, treatment with gonadotropins increased integrin av and CD44, the cell surface hyaluronan receptor, resulting in enhanced adhesion of the cancer cells to culture plates coated with hyaluronan, fibronectin, and a' thrombin derived RGD containing peptide (Schiffenbauer et al., 2002). No association was observed between gonadotropins and urokinase plasminogen activator (uPA), which has been implicated as a potential protease for OEC invasion (McDonnel & Murdoch, 2001). 1.5 Clinical approaches 1.5.1 Diagnostic and prognostic factor Ectopic production and secretion of hCG in various nontrophoblastic tumors including stomach, liver, testis, and ovary have been known to increase for decades (Vaitukaitis, 1974). hCG-P levels are elevated in serum of 30-40% and in urine of 50% patients with ovarian cancer (Alfthan et al., 1992; Cole et al., 1988; Marcillac et al., 1992). However, whether hCG-P plays a role as an independent prognostic factor for OEC is still controversial. Ind et al. investigated a prognostic significance of elevated levels of cancer antigen 125 (CA125), placental alkaline phosphatase (PLAP), cancer-associated serum antigen (CASA), and free hCG-P in 111 women with OEC. Increased hCG-P levels, like three other tumor markers, had a significant correlation with poor survival in OEC (P 32 value= 0.0002), but multivariate analysis of hCG-P together with disease stage, CA125 and PLAP failed to show any relevance as an independent prognostic factor (Ind et al., 1997). In contrast, a recent study done in 146 patients using more specific antibody and more sensitive method have demonstrated that elevation of hCG-P (29% of patients) was extensively associated with prognosis not only as single variable but also as multiple variables together with stage, grade, and age (Vartiainen et al., 2001). Indeed, in patients with stage III or IV and minimal residual disease, 5-year survival was up to 75% if hCG-p was normal. Thus, the use of hCG-P as a prognostic marker was suggested to assist the selection of therapy and/or the classification of patients for clinical studies. In a recent study, the expression of P-hCG-P gene in ovarian cancer tissues was found in contrast to the lack of its expression in non-cancerous tissues, suggesting that increased levels of circulating hCG-P may be due to direct production from ovarian cancer and can be used as a diagnostic factor ovarian cancer (Nowak-Markwitz et al., 2004). 1.5.2 Hormone therapy Various hormone therapies such as anti-estrogens, progestins, GnRH analogues, and anti-androgens have been tested in recurrent and/or chemoresistant ovarian cancer patient. GnRH analogues including both agonist (triptorelin and leuprolide) and antagonist agents (cetrorelix and flutamide) reduce gonadotropin secretion from the pituitary through eventual desensitization of the pituitary receptors, such that several clinical studies upon the "gonadotropin theory" were carried out using these hormonal analogues. Initially, a number of phase I and phase II clinical trials suggested that GnRH analogs may result in relevant response and/or disease stabilization in 10-30% of patients with refractory ovarian cancer (Emons et al., 1996). However, the benefit using GnRH analogues as a second-line therapy of advanced ovarian cancer is debatable. In several recent studies, the GnRH agonists such as leuprolide and triptorelin used as a second-line therapy, generally, but not all (du et al., 2002), showed modest efficacy in patients with platinum-refractory ovarian cancer (Balbi et a l , 2004; Duffaud et al., 2001; Paskeviciute et al., 2002). The GnRH agonist cetrorelix was also tested in a phase II study. Of 17 patients who received GnRH agonist cetrorelix 10 mg subcutaneously daily, 3 had partial remissions lasting 9, 16, and 17 weeks with minor toxicity but potential anaphylactic reactions (Verschraegen 33 et al., 2003). This is likely consistent with a observation that cetrorelix, singly or in combination with the bombesin/gastrin-releasing peptide antagonist, effectively inhibited the growth of ES-2 cells engrafted nude mice (Chatzistamou et al., 2001; Verschraegen et al., 2003). The combination therapy of another GnRH agonist goserelin with anti-estrogenic tamoxifen or conventional platinum regimens has demonstrated promise. . Patients with recurrent ovarian cancer were treated with oral tamoxifen 20 mg twice daily and subcutaneous goserelin 3.6 mg once a month until disease progression. About 50% of patients exhibited an "endocrine response" that included patients with complete response (3.8%>), partial responses (7.7%), and stable disease (38.5%) (Hasan et al., 2005). In a study that tested the combination effect of chemotherapy, radiotherapy, and goserelin, chemotherapy was effective only in the supplement with goserelin treatment or radiotherapy. In the goserelin treatment group, the 5-year survival rate rose 54% in contrast to only 19% in the non-treatment group. Of the goserelin treatment group, patients surviving at least 5 years or in complete remission at the time of this study showed significantly lower FSH levels in serum (Rzepka-Gorska et al., 2003). In addition to lowering the circulating levels of gonadotropins, anti-proliferative and/or apoptosis-inducing effect of GnRH analogues via its receptor in the ovarian cancer cells has been implicated as their supplementary mechanism of action (Verschraegen et al., 2003). In fact, GnRHR is expressed in about 80% of ovarian cancer and its ligands, GnRH I or GnRH II, probably inhibit cell growth (Emons et al., 1993; Imai et al., 1996; Kimura et al., 1999; Lee et al., 1991; Peterson et al., 1994). Hormonal therapies including the GnRH analogues may be beneficial because of its relatively lower toxicity, fewer side effects, and higher tolerability. 1.5.3 Drug development A number of researchers attempted to increase the specificity of conventional cytotoxic drugs based on the common expression of gonadotropin receptors in ovarian cancer cells. Despite a general prolonged survival rate by conventional chemotherapies containing platinum, taxanes, and anthracyclines for ovarian cancer, significant side effects and a high recurrence rate have been limiting the use of the chemotherapy 34 regimens. Cytostatics conjugated with hCG significantly increased the toxicity in L H R expressing breast (Gebauer et al., 2003) and prostate cancer cells (Hansel et al., 2001; Leuschner et al., 2001). In ovarian cancer, treatment with hCG-conjugated doxorubicin for two hours induced more than an 8-fold increase in cytotoxicity compared to unconjugated doxorubicin, and this effect was a prolonged antiproliferative action up to 168 hours rather than acute cytotoxic action (Beck et al., 2000). The conjugate-induced cytotoxicity in ovarian cancer cells was likely depended on L H R expression levels (Gebauer et al., 2004). A similar study on lytic peptides conjugated to hCG-p has shown that the conjugates selectively destroy OVCAR-3 cells in vitro and OVCAR-3 cells engrafted in nude mice models in vivo (Gawronska et al., 2002). In a group of animals treated by hecate-hCG-P, tumor volume expressed as a percentage of increase was 199±18.57% when control animals had 263.0±21.72% of that. The expression of LHR increased responding to estrogen, resulting in a positive correlation between steroids in the culture medium and sensitivity of the OVCAR-3 cells to the hecate-hCG-p. Together, these findings suggest that cytotoxic drugs conjugated with gonadotropins may be used to manage OEC bearing gonadotropin receptors. In this, regard, the expression pattern and its regulation of gonadotropin receptors in OSE and ovarian cancer should be evaluated not only for better understanding of ovarian cancer pathophysiology, but also for finding a new drug target. 1.6 Leptin Leptin, a product of obese (ob) gene, serves an endocrine function to regulate body fat stores. Before identification of leptin in 1994, the descriptions of the ob/ob mouse models suggested that a key circulating factor necessary for energy intake, storage, and usage was missing in ob/ob mice. Mutations in the mouse ob genes resulted in obese, infertile, hyperphagic, hypothermic, and diabetic phenotypes, most of which are generally observed in morbid human obesity (Coleman, 1978). Leptin, a secretary peptide, circulates in mouse and human plasma in contrast to its absence in plasma of the ob/ob mice. Body mass of wild-type as well as ob/ob mice was significantly diminished by treatment with recombinant leptin, presumably, through its effects on food intake and energy expenditure (Halaas et al., 1995). In humans, plasma levels of leptin is predominantly produced from adipose tissue mass, such that serum leptin levels strongly correlate with total body fat and 35 body mass index (BMI) and weight loss was associated with a decrease in plasma leptin concentration (Frederich et al., 1995; Thomas et al., 2000). Leptin plays a regulatory role in energy balance in both mice and human; however, unlike mice, human obesity is not likely related to leptin deficiency but to leptin resistance (Correia & Haynes, 2004; Mark et al., 2004). Interestingly, females have a significantly higher leptin levels (adjusted for total body fat mass) in their plasma than males do, probably due to differential sex hormonal regulation in leptin expression (Casabiell et al., 1998). 1.6.1 Structure, production and regulation Human leptin is a polypeptide hormone of 16 kda (167 amino acids). The ob gene was positionally cloned encoding a 4-5 kb R N A expressed exclusively in adipocytes and termed leptin (Greek: leptos=thin) (Zhang et al., 1994). In the ob gene encoded on chromosome 7q31, exon 1 codes for the 5'-untranslated region while the sequence coding for the leptin is contained in exons 2 and 3 (Isse et al., 1995). The peptide hormone has a structure of four-helix bundle, which is comparable with that of the long-chain helical cytokine family including IL-6, -11, -12, LIF, and G-CSF (Zhang et al., 1997). The hormone contains two cysteine residues, Cys96 and Cysl46, which are responsible for the structural integrity and stability of the leptin by forming a disulfide bond. Thus, a leptin variant without the disulfide bonds found in leptin-deficient ob/ob mice, had a lower biological response than did the wild-type (Rock et al., 1996). Initially, it was considered that leptin, as a adipokine, is exclusively produced in adipose tissues, especially white adipocytes (Zhang et al., 1994). However, recent studies have demonstrated that other tissues including gastric epithelium (Bado et al., 1998), skeletal muscle (Wang et al., 1998), placenta (Masuzaki et al., 1997b), brain, and the pituitary gland (Morash et al., 1999) secrete the hormone albeit a lower level compared to that of adipose. Physiological roles of the hormone as an autocrine/paracrine have been implicated in these tissues. From adipose tissues, leptin appears to be secreted in a pulsatile manner into the bloodstream (Licinio et al., 1997). In the plasma, leptin circulates freely or complexed to a binding protein, probably, ObR-f, the soluble isoform of receptor (Gavrilova et al., 1997). 36 The production of leptin in adipose tissue and its secretion into plasma are positively correlated with body fat and adipocyte size (Maffei et al., 1995), and can be modulated by various physiological factors such as nutrition and hormones. As for nutritional conditions such as fasting or eating, it has been suggested that insulin is partially involved in the nutrition-regulated leptin production. This hypothesis was supported by their parallel secretion patterns such as postprandial rise in leptin following the insulin peak (Saladin et al., 1995). Additionally, glucocorticoids and estrogen increase leptin production while melatonin decreases leptin (Castracane et al., 1998; Masuzaki et al., 1997a; Rasmussen et al., 1999). Indeed, promoter analysis revealed the existence of various regulatory elements including cAMP and glucocorticoid response elements and CCATT/enhancer and SP-1 binding sites in the leptin promoter site (Gong et al., 1996). With regard to the non-adipocyte expression, leptin expression in gastric epithelium and placenta are stimulated by gastrin and hypoxia, respectively (Bado et al., 1998; Masuzaki et al., 1997b). Although rare, several mutations of leptin such as a deletion of guanine in codon 133 and a C-to-T missense mutation have been reported (Ozata et al., 1999; Rau et al., 1999). Consequently, people with leptin deficiency mutations exhibit an ob/ob mice phenotype: hyperphagia, morbid obesity, hypothalamic hypogonadism, and immune suppression. Heterozygosity of the leptin gene results in notable phenotype change like increased body fat (Farooqi et al., 2001). 1.6.2 Receptors and signaling The effects of leptin are mediated by the transmembrane leptin receptor (ObR), a member of the type I cytokine receptor superfamily, which contains receptors for interleukin-6 (IL-6), leukemia inhibitory factor (LIF), and granulocyte-colony stimulating factor (CSF). The first leptin receptor (ObR) was discovered in mouse choroid plexus (Tartaglia et al., 1995). Today, at least six alternative spliced products of the same ObR gene (ObR a-f) have been identified. ObR, along with other class I cytokine receptors, contains a cytokine receptor homologous domain in the extracellular region and a single transmembrane domain. Two conserved disulfide links and a WSXWS motif are present in the N-terminus and the C-terminus, respectively. ObR isoforms share a similar extracellular ligand binding and transmembrane domain, but a diverse intracellular domain 37 and carboxyl-terminal domain. ObR-e contains only three exons coding the extracellular domain, resulting in circulating in plasma as a soluble receptor. ObR-a, -b, -c, -d, and - f have a key conserved Box l motif (amino acids 6-17) necessary for JAK2 (Janus kinase 2) association and signaling; however, only the 'long receptor', ObR-b, has a Box2 motif (amino acids 49-60), the STAT3 (signal transducers and activators of transcription 3) and SHP2 binding site responsible for maximal activation of JAK-STAT3 pathways (Tartaglia, 1997) (Figure 1.5). Thus, the long form of ObR-b with its 301-amino-acid intracellular tail and full JAK2-binding region activates the classical cytokine JAK2/STAT-3 pathways (Baumann et al., 1996; Yamashita et a l , 1998) as well as the E R K (Catalano et al., 2003; Catalano et al., 2004; Yamashita et al., 1998) and phosphatidyl-inositol 3'-kinase (PI3K) (O'Rourke et al., 2001) pathways. In contrast, the shorter ObR isoforms mainly activate E R K signaling pathways (Bjorbaek et al., 1997; Yamashita et al., 1998). Activated ObR-b by binding of leptin rapidly induces conformational changes and receptor oligomerization, stimulating phosphorylation of JAK2, constitutively associated protein tyrosine kinase. Once activated, JAK2 phosphorylates Tyr-985 and Tyr l l38 within the SHP2 and STAT3 binding sites of the intracellular domain of ObRb. Phosphorylated Tyr-1138 leads to binding of STAT3 to the ObRb receptor stimulating STAT3 tyrosine phosphorylation, dimerization, nuclear translocation, and induction of target genes such as vegf whose product is a well known angiogenesis factor (Frankenberry et al., 2004). The PI3K/Akt/GSk pathway is related to this ObR/JAK2 signaling pathway, probably via scaffolding protein IRS-l/2(Martin-Romero & Sanchez-Margalet, 2001). In parallel, induction of SHP2 leads to its tyrosine phosphorylation, binding to GRB2, and activation of ERK1/2 cascades. The physiological role and its signaling of the shorter and soluble forms of ObR are not well understood; however, roles of these receptors in leptin transport and storage and inactivation of ObR signaling were reported (Hileman et al., 2000; Yang et al., 2004) (Figure 1.5). 1.6.3 Physiological role Since it was discovered as an energy homeostasis factor like an anti-obesity hormone or a starvation signal, the central nervous system in general and the hypothalamus in particular have been implicated to be the major targets site for leptin. For 38 instance, leptin receptors are expressed in various hypothalamic nuclei producing a number of neuropeptides, which play a regulatory role in food intake and other physiological responses. One spotlighted effector neuropeptide is neuropeptide Y (NPY), a potent stimulator of food intake. The ob/ob mice increased N P Y levels and the levels was reduced by leptin administration, suggesting that decreased leptin secretion from adipocytes by weight loss may lose its inhibitory control on N P Y production from the hypothalamus, consequently up-regulating food intake and down-regulating energy expenditure (Ahima & Osei, 2004; Schwartz et al., 2000). In addition to energy homeostasis-regulatory effect via central nervous system, countless studies have demonstrated the neuroendocrine and metabolic effects of leptin. The neuroendocrine effects include an effect on reproductive-hypothalamic-pituitary-gonad axis and several hypothalamic hormones such as thyroid hormone, ghrelin, prolactin, and melatonin, and the metabolic effects affect glucose and lipid homeostasis (for review; (Ahima & Osei, 2004). Besides its actions in the centralmervous systems, leptin may play a range of roles directly in peripheral tissues such as hematopoiesis, angiogenesis, bone development, and immune system regulation. Indeed, the direct peripheral actions of leptin have been strongly supported by increasing observation that leptin exerts profound biological actions in various cell systems including vascular endothelium cells (Sierra-Honigmann et al., 1998), gastric mucosa cells (Schneider et al., 2001), keratinocytes (Stallmeyer et al., 2001), ovarian granulosa cells, adipocyte, hemopoietic cells, placenta, muscle cells, and pancreatic P cells (Islam et al., 1997). Leptin participates in regulation of the hypothalamic-pituitary-gonadal axis at multiple levels. For instance, leptin stimulates GnRH synthesis and potentiates the effect of insulin on GnRH release in the hypothalamus (Watanobe, 2002), and induces the synthesis and release of both FSH and L H in the pituitary (Finn et al., 1998; McCann et al., 1998). Furthermore, other evidence suggests a direct role of leptin in the ovary (Brannian & Hansen, 2002). ObR isoforms are expressed in various ovarian cells including granulosa , theca, and oocyte (Cioffi et al., 1996; Cioffi et al., 1997; Karlsson et al., 1997; Matsuoka et al., 1999). It suggests that leptin may play a direct physiologic role in follicular maturation and oocyte development. Results that leptin is produced within the 39 human ovary further support its potential role as an autocrine, as well as a paracrine, regulator of ovarian function (Loffler et al., 2001). Because circulating leptin levels are directly related to body adiposity, elevated leptin concentrations associated with obesity may partly explain the negative impact of obesity on fertility. 1.7 Leptin, obesity, and cancer In 2003-2004, 17.1% of US children and adolescents were overweight (BMI>25) and 32.2% of adults were obese (BMI>30). The prevalence of overweight among children and adolescents and obesity among men significantly increased during the 6-year period from 1999 to 2004; however, among women, no overall increase in the prevalence of obesity were observed (Ogden et al., 2006). Obesity has been implicated as a risk factor for death from any cause and furthermore is an independent risk factor for cardiovascular disease and diabetes (Stevens et al., 1998). Less is known regarding the association of leptin with cancer development and/or progression, compared to the cardiovascular diseases and diabetes. c In addition to its primary action as an energy homeostasis factor in the brain, leptin also exerts its physiological role in various peripheral sites. It is of interest that leptin promotes proliferation in various cell systems such as vascular endothelium, lung, gastric mucosa, keratinocytes, and pancreatic P cells. Moreover, recent studies have been demonstrated that this hormone stimulates growth, migration, invasion, and angiogenesis in tumor cell models, suggesting the involvement of leptin in cancer development and progression (Attoub et al., 2000; Dieudonne et al., 2002; Hu et al., 2002; Laud et al., 2002; Sierra-Honigmann et al., 1998; Tsuchiya et al., 1999; Wauters et al., 2000). Over last ten years, our understanding about the effect of leptin in various cancer cells system has improved (reviewed in (Somasundar et al., 2004). Numerous epidemiological studies investigating cancer risk in relation to obesity verified that obesity might elevate the incidence, to some extent, of breast, endometrial, and colorectal cancer while that of other cancers is inconclusive. The epidemiological findings are further strongly supported by data from in vitro experiments. Leptin plays a proliferative role in various cancers including breast(Catalano et al., 2003; Dieudonne et al., 2002; Hu et al., 2002; Y in et al., 2004), colon (Yin et al., 2004), prostate (Somasundar et al., 2004), and 40 lung cancer cell lines (Tsuchiya et al., 1999). In contrast, treatment with leptin decreased the proliferation in Mia-PaCa and PaNC-1, human pancreatic cancer cells (Somasundar et al., 2004). Leptin appears to be involved in cell transformation (Hu et al., 2002) as well as expression of oncogene c-myc (Yin et al., 2004) in breast cancer. In colon cancer, leptin increased invasiveness (Attoub et al., 2000) and decreased apoptosis (Rouet-Benzineb et al., 2004). However, available data related to serum levels of leptin are inconsistent. Obesity is likely associated with some physiological or pathological conditions in gynecology such as hormone levels, ovulatory function, infertility, polycystic ovary syndrome, hyperandrogenism, and endometriosis (Brannian & Hansen, 2002). Countless epidemiological studies have tested the link between body size and ovarian cancer risk. In early reviews of the literature, obesity was implicated as a risk factor for ovarian cancer (Frost & Coleman, 1997). Purdie et al., in a more recent systemic review using 11 population-based case-control studies and 5 cohort studies, found a consistent positive correlation between B M I and ovarian cancer risk (Purdie et al., 2001). Women in the top 15% of the B M I range have a significantly increased risk of ovarian cancer with an odds ratio of 1.9 (95% CI, 1.3 to2.6) compared with those in the middle 30%. A stronger effect was shown among inactive women (OR = 3.0, 95% CI 1.3to 6.9). The positive correlation was also observed in a number of studies using WHR (waist:hip ratio) for defining obesity (Dal Maso et al., 2002; Mink et al., 1996). A population-based and case-control study where established risk factors were stratified by race demonstrated that no significant difference of WHR risk among Whites and among African Americans. To contrast, among all races, weight at age 18 years, WHR and B M I were significantly related to ovarian cancer risk (Hoyo et al., 2005). A number of studies suggested that a high B M I in young adulthood, rather than recent B M I or adult weight change, is a risk factor for ovarian cancer (Fairfield et al., 2002; Kuper et al., 2002; Lubin et al., 2003). Despite the significant relevance of leptin in breast proliferation, little attention has been given to the possible involvement of the hormone in ovarian cancer development and/or progression, even though both tumor types share some relevant characteristics such as being hormone-sensitive and expressing hormonal receptors. Two recent studies on circulating leptin levels in ovarian cancer are prompting further experimental study on ovarian cancer. Tessitore et al. investigated whether leptin levels are associated with 41 hormonal status by measuring circulating leptin and its mRNA levels in adipose tissue in 87 patients with gynecological and breast cancers. Adipocyte expression and circulating levels of leptin increase in patients with ovarian cancer as well as breast and endometrial cancer patients (Tessitore et al., 2004). In addition, increased leptin levels seem to be associated with elevated levels of FSH, which is likely a mitogenic factor for ovarian cancer (Choi et al., 2002a; Syed et al., 2001). Leptin was tested as a potential tumor marker, along with other three proteins including prolactin, osteopontin, and insulin-like growth factor-II. Evaluation using ELISA revealed that all four proteins are highly secreted from ovarian tumors compared to the controls. A blind binary code study has shown that the combination of the four analytes significantly distinguishes the cancer group from the healthy controls with 95% sensitivity, 95% positive predictive value, 95% specificity and 94% negative predictive value whereas leptin alone, like other three proteins, was not significant (Mor et al., 2005). 1.8 Hypothesis and objectives ? Gonadotropins appear to play a role in the cell growth of ovarian cancer according to previous findings (Choi et al., 2002a; Edmondson et al., 2006; Gubbay et al., 2004; Ji et al., 2004; Kraemer et al., 2001; Ohtani et al., 2001; Parrott et al., 2001; Syed et al., 2001; Wimalasena et al., 1992; Zheng et al., 2000); Kurbacher et al., 1995; Kuroda et al., 2001; Kuroda et al., 1998; Tashiro et al., 2003; Wimalasena et al., 1993). However, the exact cellular and molecular mechanism of the action of gonadotropins to stimulate ovarian cancer development is not clearly understood yet. Furthermore, there is lack of information regarding to the other aspect of ovarian cancer progression such metastasis. Thus, in the present study, we hypothesized that gonadotropins may play a proliferative role in ovarian cancer by regulating the other hormon and/or growth factor system such as GnRH and EGF in the ovary. In addition, treatment with gonadotropin may affect the ovarian cancer metastasis via proteolysis and invasion. Furthermore, overexpression of FSHR may alter intracellular signalling pathways and activate oncogenic pathway in preneoplastic OSE because FSHR plays a crititcal role in early phase of ovarian cancer development (Syed et al., 2001; Wang et al., 2003a; Wang et al., 2003b). To our knowledge, a potential role of leptin in normal OSE and neoplastic counterparts is 42 unknown while leptin stimulates the proliferation of various human normal and neoplastic cells (Attoub et al., 2000; Dieudonne et al., 2002; Hu et al., 2002; Laud et al., 2002; Sierra-Honigmann et al., 1998; Tsuchiya et al., 1999; Wauters et al., 2000). In this regard, we hypothesized that leptin play a proliferative role in OSE and/or ovarian cancer. Objective 1. In Chapter II, to test the hypothesis that overexpression of follicle stimulating hormone receptor may activates oncogenic pathways in ovarian epithelial cells 1) The expression of FSHR at the mRNA and protein levels was evaluated in pre-neoplastic IOSE and two ovarian carcinoma cell lines, OVCAR-3 and SKOV-3. 2) The activation of oncogenic pathways and mitogen-activated protein kinases (MAPKs) was examined in FSHR-overexpressing IOSE cells. 3) The proliferative rate of FSHR-overexpressing IOSE cells was measured. Objective 2. In Chapter III, to investigate the effect of gonadotropins on the expression of EGFR. 1) The effect of gonadotropins on EGFR expression levels in immortalized OSE (IOSE) and ovarian cancer cell lines was evaluated. 2) Additive proliferative effect of gonadotropins and EGF was measured. 3) The mechanism of gonadotropin-induced actions in the regulation of EGFR system was tested. Objective 3. In Chapter IV, to investigate the role of gonadotropins in the regulation of GnRH I, GnRH II and GnRHR mRNA expression in human OSE and ovarian cancer cells. 1) GnRH-I, GnRH-II, GnRHR, FSHR and L H R mRNA was measured in the IOSE and ovarian cancer cell lines using real-time RT-PCR. 2) The ability of gonadotropins to modulate the growth-inhibitory effects of the two GnRHs was examined. 43 Objective 4. In Chapter V , to elucidate whether gonadotropins play a role in invasiveness and proteolysis in ovarian cancer cells. 1) The effect of gonadotropins on invasiveness of ovarian caner cells was tested. 2) The effect of gonadotropins on metastasis-related proteases was measured. 3) The mechanism of gonadotropin-induced actions in the regulation of invasiveness was examined. Objective 5, In Chapter VI , to investigate the upstream signaling pathway of gonadotropin-induced EGFR overexpression in IOSE cells 1) The effect of gonadotropins on intracellular cAMP levels was tested using ELISA assay. 2) The involvement of increased cAMP in gonadotropin-induced ERK1/2 or Akt activation and EGFR overexpression was evaluated. 3) The involvement of Epac in gonadotropin-induced EGFR overexpression was elucidated. i Objective 6. In Chapter VII, to investigate the effects of leptin on the proliferation of OSE and/or ovarian cancer cells 1) The expression of leptin receptors in immortalized OSE (IOSE) and ovarian cancer cell lines was investigated. 2) The effects of leptin on cell growth was evaluated Objective 7. In Chapter VIII, to investigate whether leptin-induced cell growth is specific for the ER-positive ovarian cancer cells 1) The involvement of ER in leptin-induced cell growth was estimated using ER antagonist and ERa or ER-overexpressing analysis. 2) The mechanism of leptin-induced ligand independent ER activation was examined. 44 Table 1.1 Summary of the representative action of GnRH 1/ II, activin, inhibin, estrogen, progesterone, and androgen in OSE and OEC cells Hormone Cell System Action of hormone Effect (References) GnRH-I Ovarian cancer/OSE Proliferation Decrease (Emons et al., 1993; Imai et al., 1996; Kang et al., 2000a; Kang et al., 2000b; Kimura et al., 1999; Lee et al., 1991; Peterson et al., 1994) Ovarian cancer Apoptosis Increase (Grundker et al., 2000; Gunthert et al., 2004; Imai et al., 1998; Motomura, 1998; Ohta et al., 1998) GnRH-II Ovarian cancer/OSE Proliferation Decrease (Choi et al., 2001a; Grundker et al., 2002; K i m et al., 2005; K im et al., 2004) Ovarian cancer Apoptosis Increase (Kim et al., 2004) IOSE/OSE Proliferation No effect (Choi et al., 2001b; Di Simone et a l , 1996; Steller et a l , 2005). Decrease (Choi et al., 2001 d) Activin Ovarian cancer Proliferation Increase (Choi et al., 2001b; Di Simone et al., 1996; Fukuda et' al., 1998; Steller et al., 2005). Ovarian cancer Invasion Increase (Steller et al., 2005) Inhibin Ovarian cancer Proliferation Decrease (Steller et al., 2005) Ovarian cancer Invasion Decrease (Steller et a l , 2005) Estrogen Ovarian cancer /IOSE/OSE Proliferation Decrease (Keith Bechtel & Bonavida, 2001; Wright et al., 2003; Wright et a l , 2005; Wright et al., 2002) No effect (Bai et al., 2000; Choi et al., 2001c; Karlan et al., 1995; Wright et al., 2002) Increase (Choi et al., 2001c; Galtier-Dereure et al., 1992; Syed et al., 2001) Ovarian cancer Invasion Increase (Song et al., 2005) Progesteron Ovarian cancer/OSE Apoptosis Increase (Bu et al., 1997; Hu & Deng, 2000; Rodriguez et al., 2002; Syed & Ho, 2003) c Ovarian cancer Invasion Decrease (McDonnel & Murdoch, 2001; McDonnel et al., 2003) Androgen Ovarian cancer/OSE Proliferation Increase (Evangelou et al., 2000; Syed et al., 2002b; Syed et al., 2001) 45 Hypothalamus 1+/ -LH GC and TC Ovary 1 — I n h i b i t ! Estrogen Progesterone Figure 1.1 Hypothalamic-pituitary-gonadal axis 46 y\ I ERK | [p38 SGW AKT Figure 1.2 A model of gonadotropins signaling in ovarian granulosa cells. Gonadotropins bind to their specific receptor, and activate downstream signaling pathway including, PI3K/Akt, M A P K and P K A cascades resulting in regulation of folliculogenesis and steroidogenesis in human granulosa cells. FSH, follicle stimulating hormone; FSHR, follicle stimulating hormone receptor; L H , luteinizing hormone; LHR, luteinizing hormone receptor; PLC, phospholipase C; D A G , diacylflycerol;IP3, inositol triphosphate; Gs, G-protein as; cAMP, cyclic adenosine monophosphate; Epac, exchange protein directly activated by cAMP; ERK, extracellular signal-regulated kinases 1/2; ER, endoplasmic reticulum; Akt, protein kinase B; P K A , protein kinase A ; PI3K, phosphoinositol 3 kinase; PKC, protein kinase C; CREB, CRE-binding protein; SGK, serum/glucocorticoid-regulated kinase; Rap, Ras-related protein RAP-1 A;Ca2+, calcium. 47 A B Figure 1.3 Temporal association between ovarian cancer incidence and gonadotropin levels. A.age-specific incidence of and mortality from ovarian cancer, 1998-2002 (Ries, 2006). B. change in circulating gonadotropin levels during human female life time (Speroff, 1999). 48 Figure 1.4 Immunohistochemical staining for FSHR (A) and LHR (B) in human ovarian serous tumor. The tissue sections were deparaffinized, rehydrated, treated with 30% H2O2 for 30 min, and then submitted to antigen retrieval by streaming in a modified citric acid solution (DAKO) for 20min. Slides were blocked in serum free blocking solution (DAKO) for 30 min followed by incubation with primary antibody anti-FSHR (1:200) or L H R (1:200) overnight at 4°C. The sections were then incubated with Biotin-labeled universal secondary antibody (DAKO) and Streptoavidin solution (DAKO), respectively, for 20 min at RT, developed in diaminobenzine (DAKO) and counterstained with Mayers hematoxylin. 49 Table 1.2 Summary of the representative action of gonadotropins in OSE and ovarian cancer Hormone Action of hormone Cell System Effect (References) FSH Proliferation OSE/IOSE Increase (Choi et al., 2002a; Edmondson et al., 2006; Gubbay et al., 2004; Ji et al., 2004; Parrott et al., 2001; Syed et al.,2001) No effect (Wright et al., 2002) Decrease (Ivarsson et al., 2001) Ovarian tumor/cancer Increase (Choi et al., 2002a; Kraemer et al., 2001; Ohtani et al., 2001; Wimalasena et al., 1992; Zheng et al., 2000; Zhou et al., 2002) Apoptosis OSE/IOSE Increase (Pon et al., 2005)) Decrease (Edmondson et al., 2006) Ovarian tumor/cancer Decrease (Huang et al., 2003a; Huang et al., 2003b) Adhesion /angiogenesi s Ovarian tumor/cancer Increase (Schiffenbauer et al, 2002; Wang et al, 2002; Zygmunt et al, 2002) LH/hCG Proliferation OSE/IOSE Increase (Edmondson et al., 2006; Gubbay et al., 2004; Parrott et al., 2001; Syed et a l , 2001; Tashiro et al., 2003) No effect (Ivarsson et al., 2001; Wright et al., 2002) Ovarian tumor/cancer Increase (Kraemer et al., 2001; Kurbacher et al., 1995; Wimalasena et al., 1992; Wimalasena et al., 1993) Decrease (Tourgeman et al., 2002; Zheng et al., 2000) Apoptosis OSE/IOSE Increase (Pon et al., 2005) Decrease (Edmondson et al., 2006; Kuroda etal., 2001) Ovarian tumor/cancer Decrease (Kuroda et al., 1998) Adhesion /angiogenesi s Ovarian tumor/cancer Increase (Schiffenbauer et al, 2002; Zygmunt et al., 2002) 50 Figure 1.5 Leptin receptors and their signaling pathways. Leptin binds to its long form receptor ObR b, and activate downstream signaling pathway including classical cytokine JAK2/STAT3 pathways as well as PI3K/Akt and ERK. The shorter ObRs isoforms may activate E R K signaling pathways or circulate without transmembrane domain. ERK, extracellular signal-regulated kinases 1/2; PI3K, phosphoinositol 3 kinase; STAT-3,signal transducers and activators of transcription-3; ER, estrogen receptor; ERE, estrogen response element; ICI, ICI 182,780; ObR, leptin receptor; SHP2, SH2-containing phosphatase 2; Grb2, growth factor receptor-bound protein; IRS-2, insulin receptor substrate 2; JAK2, janus kinase 2. 51 1.9 Bibliography Abdollahi, A. , Godwin, A .K . , Miller, P.D., Getts, L .A. , Schultz, D.C., Taguchi, T., Testa, J.R. & Hamilton, T.C. (1997). Cancer Res, 57, 2029-34. Ahima, R.S. & Osei, S.Y. (2004). Physiol Behav, 81, 223-41. Aittomaki, K. , Herva, R., Stenman, U.H. , Juntunen, K. , Ylostalo, P., Hovatta, O. & de la Chapelle, A . (1996). J Clin Endocrinol Metab, 81, 3722-6. Aittomaki, K. , Lucena, J.L., Pakarinen, P., Sistonen, P., Tapanainen, J., Gromoll, J., Kaskikari, R., Sankila, E .M. , Lehvaslaiho, H. , Engel, A.R., Nieschlag, E., Huhtaniemi, I. & de la Chapelle, A . (1995). Cell, 82, 959-68. Akhmedkhanov, A. , Toniolo, P., Zeleniuch-Jacquotte, A. , Pettersson, K.S. & Huhtaniemi, I.T. (2001). Am J Epidemiol, 154, 43-9. Ala-Fossi, S.L., Grenman, S., Zhang, F.P., Blauer, M . , Punnonen, R. & Maenpaa, J. (1999). Anticancer Res, 19, 4289-95. Alam, H. , Maizels, E.T., Park, Y . , Ghaey, S., Feiger, Z.J., Chandel, N.S. & Hunzicker-Dunn, M . (2004). J Biol Chem, 279, 19431-40. Alfthan, H., Haglund, C , Roberts, P. & Stenman, U.H. (1992). Cancer Res, 52, 4628-33. Anderson, S.M. & Dimitrievich, E. (1996). S D JMed, 49, 419-21. Anttila, M.A. , Kosma, V . M . , Hongxiu, J., Puolakka, J., Juhola, M . , Saarikoski, S. & Syrjanen, K . (1999). Br J Cancer, 79, 1870-8. Arslan, A . A . , Zeleniuch-Jacquotte, A. , Lundin, E., Micheli, A. , Lukanova, A. , Afanasyeva, Y . , Lenner, P., Krogh, V. , Muti, P., Rinaldi, S., Kaaks, R , Berrino, F., Hallmans, G. & Toniolo, P. (2003). Cancer Epidemiol Biomarkers Prev, 12, 1531-5. Arts, H.J., Van Der Zee, A .G . , De Jong, S. & De Vries, E.G. (2000). Int J Gynecol Cancer, 10, 47-52. Attoub, S., Noe, V . , Pirola, L. , Bruyneel, E., Chastre, E., Mareel, M . , Wymann, M.P. & Gespach, C. (2000). FasebJ, 14, 2329-38. Auersperg, N . , Edelson, M.I., Mok, S.C., Johnson, S.W. & Hamilton, T.C. (1998). Semin Oncol, 25, 281-304. Auersperg, N . , Ota, T. & Mitchell, G.W. (2002). Int J Gynecol Cancer, 12, 691-703. Auersperg, N . , Wong, A.S., Choi, K.C. , Kang, S.K. & Leung, P.C. (2001). EndocrRev, 22, 255-88. Babu, P.S., Krishnamurthy, H. , Chedrese, P.J. & Sairam, M.R. (2000). J Biol Chem, 275, 27615-26. Bado, A . , Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J.P., Bortoluzzi, M.N. , Moizo, L . , Lehy, T., Guerre-Millo, M . , Le Marchand-Brustel, Y . & Lewin, M.J. (1998). Nature, 394, 790-3. Bai, W., Oliveros-Saunders, B., Wang, Q., Acevedo-Duncan, M.E . & Nicosia, S.V. (2000). In Vitro Cell Dev Biol Anim, 36, 657-66. Balbi, G., Piano, L.D. , Cardone, A . & Cirelli, G. (2004). Int J Gynecol Cancer, 14, 799-803. Balen, A . (1995). Hum Reprod, 10, 2233-7. Baumann, H. , Morella, K . K . , White, D.W., Dembski, M . , Bailon, P.S., Kim, H. , Lai, C.F. & Tartaglia, L . A . (1996). Proc Natl Acad Sci USA, 93, 8374-8. Beck, E.P., Vincenti, D., Licht, P., Berkholz, A. , Jager, W., Lang, N . & Merkle, E. (2000). Anticancer Res, 20, 3001-6. 52 Bell, D.A. & Scully, R.E. (1994). Cancer, 73, 1859-64. Berchuck, A. , Kamel, A . , Whitaker, R., Kerns, B. , Olt, G., Kinney, R., Soper, J.T., Dodge, R., Clarke-Pearson, D.L., Marks, P. & et al. (1990). Cancer Res, 50, 4087-91. Biskind, G.R., Biskind, M.S. (1948). Science, 108, 137-138. Biskind, M.S., Biskind, G. R. (1944). ProcSoc Exp Biol Med, 55, 176-179. Bjorbaek, C , Uotani, S., da Silva, B. & Flier, J.S. (1997). J Biol Chem, 272, 32686-95. Blaakaer, J., Djursing, H. , Hording, U . , Bennett, P., Toftager-Larsen, K. , Bock, J.E. & Lebech, P.E. (1992). Acta Endocrinol (Copenh), 127, 127-30. Blaustein, A. , Kaganowicz, A . & Wells, J. (1982). Cancer, 49, 722-6. Bosetti, C , Negri, E., Trichopoulos, D., Franceschi, S., Beral, V. , Tzonou, A. , Parazzini, F., Greggi, S. & La Vecchia, C. (2002). Int J Cancer, 102, 262-5. Brader, S. & Eccles, S.A. (2004). Tumori, 90, 2-8. Brandenberger, A.W., Tee, M . K . & Jaffe, R.B. (1998). J Clin Endocrinol Metab, 83, 1025-8. Brannian, J.D. & Hansen, K . A . (2002). Semin ReprodMed, 20, 103-12. Brzostowski, J.A. & Kimmel, A.R. (2001). Trends Biochem Sci, 26, 291-7. Bu, S.Z., Yin , D.L., Ren, X . H . , Jiang, L.Z. , Wu, Z.J., Gao, Q.R. & Pei, G. (1997). Cancer, 79, 1944-50. Burdette, J.E., Kurley, S.J., Kilen, S.M., Mayo, K . E . & Woodruff, T.K. (2006). Endocrinology, 147, 2338-45. Burke, W.M. , Jin, X . , Lin, H.J., Huang, M . , Liu, R., Reynolds, R.K. & Lin, J. (2001). Oncogene, 20, 7925-34. Cameron, M.R., Foster, J.S., Bukovsky, A . & Wimalasena, J. (1996). Biol Reprod, 55, 111-9. Capo-Chichi, C D . , Smith, E.R., Yang, D.H., Roland, I.H., Vanderveer, L. , Cohen, C , Hamilton, T.C., Godwin, A . K . & Xu, X . X . (2002). Cancer, 95, 1802-15. Casabiell, X . , Pineiro, V. , Peino, R., Lage, M . , Camina, J., Gallego, R., Vallejo, L.G. , Dieguez, C. & Casanueva, F.F. (1998). J Clin Endocrinol Metab, 83, 2149-55. Casagrande, J.T., Louie, E.W., Pike, M.C. , Roy, S., Ross, R.K. & Henderson, B.E. (1979). Lancet, 2, 170-3. Castracane, V.D. , Kraemer, R.R., Franken, M.A. , Kraemer, G.R. & Gimpel, T. (1998). Fertil Steril, 70, 472-7. Catalano, S., Marsico, S., Giordano, C , Mauro, L . , Rizza, P., Panno, M . L . & Ando, S. (2003) . J Biol Chem, 278, 28668-76. Catalano, S., Mauro, L. , Marsico, S., Giordano, C , Rizza, P., Rago, V . , Montanaro, D., Maggiolini, M . , Panno, M . L . & Ando, S. (2004). J Biol Chem, 279, 19908-15. Celik, C , Gezginc, K. , Aktan, M . , Acar, A. , Yaman, S.T., Gungor, S. & Akyurek, C. (2004) . Int J Gynecol Cancer, 14, 600-6. Chakravarti, S., Collins, W.P., Forecast, J.D., Newton, J.R., Oram, D.H. & Studd, J.W. (1976). Br Med J, 2, 784-7. Chambers, S.K., Gertz, R.E., Jr., Ivins, C M . & Kacinski, B . M . (1995). Cancer, 75, 1627-33. Chang, F., Lee, J.T., Navolanic, P .M. , Steelman, L.S., Shelton, J.G., Blalock, W.L., Franklin, R.A. & McCubrey, J.A. (2003). Leukemia, 17, 590-603. Chang, S. & Risch, H.A. (1997). Cancer, 79, 2396-401. 53 Chatzistamou, I., Schally, A . V . , Szepeshazi, K. , Groot, K. , Hebert, F. & Arencibia, J .M. (2001). Cancer Lett, 1 1 1 , 37-45. Chen, V.W., Ruiz, B., Killeen, J.L., Cote, T.R., Wu, X . C . & Correa, C.N. (2003). Cancer, 97, 2631-42. Cheng, J.Q., Godwin, A . K . , Bellacosa, A. , Taguchi, T., Franke, T.F., Hamilton, T . C , Tsichlis, P.N. & Testa, J.R. (1992). Proc Natl Acad Sci USA, 89, 9267-71. Chiang, M . , Strong, J.A. & Asem, E.K. (1997). Comp Biochem Physiol A Physiol, 116, 361-8. Chin, E.C. & Abayasekara, D . R (2004). J Endocrinol, 183, 51-60. Choi, J.H., Choi, K .C. , Auersperg, N . & Leung, P.C. (2005). Endocr Relat Cancer, 12, 407-421. Choi, K.C. , Auersperg, N . & Leung, P.C. (2001a). J Clin Endocrinol Metab, 86, 5075-8. Choi, K .C . , Kang, S.K., Nathwani, P.S., Cheng, K.W. , Auersperg, N . & Leung, P.C. (2001b). Mol Cell Endocrinol, 174, 99-110. Choi, K.C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2001c). Endocrinology, 142, 2351-60. Choi, K .C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (200Id). J Clin Endocrinol Metab, 86, 2125-35. Choi, K.C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2002). J Clin Endocrinol Metab, 87, 2245-53. Chudecka-Glaz, A . , Rzepka-Gorska, I. & Kosmowska, B. (2004). Arch Gynecol Obstet, 270, 151-6. Cioffi, J.A., Shafer, A.W., Zupancic, T.J., Smith-Gbur, J., Mikhail, A. , Platika, D. & Snodgrass, H.R. (1996). Nat Med, 2, 585-9. Cioffi, J.A., Van Blerkom, J., Antczak, M . , Shafer, A. , Wittmer, S. & Snodgrass, H.R. (1997). Mol Hum Reprod, 3, 467-72. Cobb, M . H . & Goldsmith, E.J. (1995). J Biol Chem, 270, 14843-6. Cole, L .A. , Schwartz, P.E. & Wang, Y . X . (1988). Gynecol Oncol, 31, 82-90. Coleman, D.L. (1978). Diabetologia, 14, 141-8. Conte, P.F., Cianci, C. & Gadducci, A . (1999). Crit Rev Oncol Hematol, 32, 49-58. Cooke, B .A. (1999). Mol Cell Endocrinol, 151, 25-35. Correia, M . L . & Haynes, W.G. (2004). Curr Hypertens Rep, 6, 230-5. Counter, C M . , Hirte, H.W., Bacchetti, S. & Harley, C.B. (1994). Proc Natl Acad Sci US A, 91, 2900-4. Cramer, D.W., Barbieri, R.L., Fraer, A.R. & Harlow, B.L. (2002). Hum Reprod, 17, 221-7. Cramer, D.W. & Welch, W.R. (1983). J Natl Cancer Inst, 71, 717-21. Crespo, P., Xu, N . , Simonds, W.F. & Gutkind, J.S. (1994). Nature, 369, 418-20. Cunat, S., Rabenoelina, F., Daures, J.P., Katsaros, D., Sasano, H. , Miller, W.R., Maudelonde, T. & Pujol, P. (2005). J Steroid Biochem Mol Biol, 9 3 , 15-24. Cunningham, M.A. , Zhu, Q., Unterman, T.G. & Hammond, J .M. (2003). Endocrinology, 144, 5585-94. Dal Maso, L. , Franceschi, S., Negri, E., Conti, E., Montella, M . , Vaccarella, S., Canzonieri, V. , Parazzini, F. & La Vecchia, C. (2002). Eur J Cancer, 38, 1769-74. Das, S., Maizels, E.T., DeManno, D., St Clair, E., Adam, S.A. & Hunzicker-Dunn, M . (1996). Endocrinology, 137, 967-74. Datta, S.R, Brunet, A . & Greenberg, M.E . (1999). Genes Dev, 13, 2905-27. 54 Davies, B.R., Finnigan, D.S., Smith, S.K. & Ponder, B .A. (1999). Gynecol Endocrinol, 13, 75-81. Davis, R.J. (1994). Trends Biochem Sci, 19, 470-3. de Rooij, J., Zwartkruis, F.J., Verheijen, M.H. , Cool, R.H., Nijman, S.M., Wittinghofer, A . & Bos, J.L. (1998). Nature, 396,474-7. Dewi, D.A., Abayasekara, D.R. & Wheeler-Jones, C P . (2002). Endocrinology, 143, 877-88. Di Simone, N . , Crowley, W.F., Jr., Wang, Q.F., Sluss, P .M. & Schneyer, A . L . (1996). Endocrinology, 137,486-94. Diebold, J., Baretton, G., Felchner, M . , Meier, W., Dopfer, K. , Schmidt, M . & Lohrs, U . (1996). Am J Clin Pathol, 105, 341-9. Dieudonne, M.N . , Machinal-Quelin, F., Serazin-Leroy, V. , Leneveu, M.C. , Pecquery, R. & Giudicelli, Y . (2002). Biochem Biophys Res Commun, 293, 622-8. Dong, K.W., Y u , K . L . & Roberts, J.L. (1993). Mol Endocrinol, 7, 1654-66. Doraiswamy, V. , Parrott, J.A. & Skinner, M . K . (2000). Biol Reprod, 63, 789-96. du, B.A. , Meier, W., Luck, H.J., Emon, G., Moebus, V . , Schroeder, W., Costa, S., Bauknecht, T., Olbricht, S., Jackisch, C , Richter, B. & Wagner, U . (2002). Ann Oncol, 13, 251-7. Duffaud, F., van der Burg, M.E. , Namer, M . , Vergote, I., Willemse, P.H.B., ten Bokkel Huinink, W., Guastalla, J.P., Nooij, Kerbrat, P., Piccart, M . , Tumolo, S., Favalli, G., van der Vange, N . , Lacave, A.J. , Wils, J., Splinter, T.A., Einhorn, N . , Roozendaal, K.J . , Rosso, R. & Vermorken, J.B. (2001). Anticancer Drugs, 12, 159-62. Edmondson, R.J., Monaghan, J .M. & Davies, B.R. (2006). Int J Gynecol Cancer, 16, 171-7. Eliopoulos, A .G . , Kerr, D.J., Herod, J., Hodgkins, L. , Krajewski, S., Reed, J .C & Young, L.S. (1995). Oncogene, 11, 1217-28. Ellerbroek, S.M., Fishman, D.A., Kearns, A.S., Bafetti, L . M . & Stack, M.S. (1999). Cancer Res, 59, 1635-41. Emons, G., Ortmann, O., Becker, M . , Inner, G., Springer, B. , Laun, R., Holzel, F., Schulz, K .D. & Schally, A . V . (1993). Cancer Res, 53, 5439-46. Emons, G., Ortmann, O., Teichert, H .M. , Fassl, H. , Lohrs, U . , Kullander, S., Kauppila, A. , Ayalon, D., Schally, A . & Oberheuser, F. (1996). Cancer, 78, 1452-60. Enomoto, T., Weghorst, C M . , Inoue, M . , Tanizawa, O. & Rice, J .M. (1991). Am J Pathol, 139, 777-85. Espey, L . L . & Richards, J.S. (2002). Biol Reprod, 67, 1662-70. Evangelou, A. , Jindal, S.K., Brown, T.J. & Letarte, M . (2000). Cancer Res, 60, 929-35. Fairfield, K . M . , Willett, W . C , Rosner, B.A. , Manson, J.E., Speizer, F.E. & Hankinson, S.E. (2002). Obstet Gynecol, 100, 288-96. Farley, J., Smith, L . M . , Darcy, K . M . , Sobel, E., O'Connor, D., Henderson, B. , Morrison, L.E. & Birrer, M.J. (2003). Cancer Res, 63, 1235-41. Farooqi, I.S., Keogh, J.M., Kamath, S., Jones, S., Gibson, W.T., Trussell, R., Jebb, S.A., Lip, G.Y. & O'Rahilly, S. (2001). Nature, 414, 34-5. Fathalla, M.F. (1971). Lancet, 2, 163. Finn, P.D., Cunningham, M.J. , Pau, K . Y . , Spies, H.G., Clifton, D.K. & Steiner, R.A. (1998). Endocrinology, 139,4652-62. 55 Fishman, D.A., Kearns, A. , Chilukuri, K. , Bafetti, L . M . , O'Toole, E.A., Georgacopoulos, J., Ravosa, M.J. & Stack, M.S. (1998). Invasion Metastasis, 18, 15-26. Flores, J.A., Aguirre, C , Sharma, O.P. & Veldhuis, J.D. (1998). Endocrinology, 139, 3606-12. Flores, J.A., Leong, D.A. & Veldhuis, J.D. (1992). Endocrinology, 130, 1862-6. Flores, J.A., Veldhuis, J.D. & Leong, D.A. (1990). Endocrinology, 127, 3172-9. Ford, D., Easton, D.F., Bishop, D.T., Narod, S.A. & Goldgar, D.E. (1994). Lancet, 343, 692-5. Ford, D., Easton, D.F., Stratton, M . , Narod, S., Goldgar, D., Devilee, P., Bishop, D.T., Weber, B., Lenoir, G., Chang-Claude, J., Sobol, H. , Teare, M.D. , Struewing, J., Arason, A. , Scherneck, S., Peto, J., Rebbeck, T.R., Tonin, P., Neuhausen, S., Barkardottir, R., Eyfjord, J., Lynch, H. , Ponder, B.A. , Gayther, S.A., Zelada-Hedman, M . & et al. (1998). Am J Hum Genet, 62, 676-89. Franceschi, S., La Vecchia, C , Negri, E., Guarneri, S., Montella, M . , Conti, E. & Parazzini, F. (1994). Hum Reprod, 9, 1673-5. Frankenberry, K . A . , Somasundar, P., McFadden, D.W. & Vona-Davis, L .C . (2004). Am J Surg, 188, 560-5. Frederich, R.C., Lollmann, B. , Hamann, A. , Napolitano-Rosen, A. , Kahn, B.B. , Lowell, B.B. & Flier, J.S. (1995). J Clin Invest, 96, 1658-63. Frost, C. & Coleman, M.P. (1997). Eur J Cancer, 33, 1529-31. Fukuda, J., Ito, I., Tanaka, T. & Leung, P.C. (1998). Life Sci, 63, 2209-20. Gadducci, A. , Cosio, S., Gargini, A . & Genazzani, A.R. (2004). Gynecol Endocrinol, 19, 216-28. Galtier-Dereure, F., Capony, F., Maudelonde, T. & Rochefort, H . (1992). J Clin Endocrinol Metab, 75, 1497-502. Gao, N . , Nester, R.A. & Sarkar, M . A . (2004). Toxicol ApplPharmacol, 196, 124-35. Garzetti, G.G., Ciavattini, A. , Goteri, G., De Nictolis, M . , Stramazzotti, D., Lucarini, G. & Biagini, G. (1995). Gynecol Oncol, 56, 169-74. Gavrilova, O., Barr, V. , Marcus-Samuels, B. & Reitman, M . (1997). J Biol Chem, 272, 30546-51. Gawronska, B. , Leuschner, C , Enright, F . M . & Hansel, W. (2002). Gynecol Oncol, 85, 45-52. Gayther, S.A., Harrington, P., Russell, P., Kharkevich, G., Garkavtseva, R.F. & Ponder, B .A. (1996). Am J Hum Genet, 58,451-6. Gebauer, G., Fehm, T., Beck, E.P., Berkholz, A. , Licht, P. & Jager, W. (2003). Breast Cancer Res Treat, 77, 125-31. Gebauer, G., Mueller, N . , Fehm, T., Berkholz, A. , Beck, E.P., Jaeger, W. & Licht, P. (2004). AmJObstet Gynecol, 190, 1621-8; discussion 1628. Gilchrist, R.L., Ryu, K.S., Ji, I. & Ji, T.H. (1996). J Biol Chem, 271, 19283-7. Gille, H. & Downward, J. (1999). J Biol Chem, 274, 22033-40. Gong, D.W., B i , S., Pratley, R.E. & Weintraub, B.D. (1996). J Biol Chem, 271, 3971-4. Gonzalez-Robayna, I.J., Falender, A.E. , Ochsner, S., Firestone, G.L. & Richards, J.S. (2000). Mol Endocrinol, 14, 1283-300. Greb, R.R., Grieshaber, K., Gromoll, J., Sonntag, B., Nieschlag, E., Kiesel, L . & Simoni, M . (2005). J Clin Endocrinol Metab, 90, 4866-72. 56 Green, A. , Purdie, D., Bain, C., Siskind, V . & Webb, P .M. (2001). Cancer Causes Control, 12,713-9. Greenlee, R.T., Murray, T., Bolden, S. & Wingo, P.A. (2000). CA Cancer J Clin, 50, 7-33. Griswold, M.D. & Kim, J.S. (2001). Biol Reprod, 64, 602-10. Gromoll, J. & Simoni, M . (2005). Trends Endocrinol Metab, 16, 368-73. Grundker, C. & Emons, G. (2003). Reprod Biol Endocrinol, 1, 65. Grundker, C , Gunthert, A.R., Millar, R.P. & Emons, G. (2002). J Clin Endocrinol Metab, 87, 1427-30. Grundker, C , Schulz, K. , Gunthert, A.R. & Emons, G. (2000). J Clin Endocrinol Metab, 85,3815-20. Gubbay, O., Guo, W., Rae, M.T., Niven, D., Howie, A.F. , McNeilly, A.S., Xu, L. & Hillier, S.G. (2004). Reproduction, 128, 607-14. Gudermann, T., Kalkbrenner, F. & Schultz, G. (1996). Annu Rev Pharmacol Toxicol, 36, 429-59. Gunthert, A.R., Grundker, C , Bottcher, B. & Emons, G. (2004). Anticancer Res, 24, 1727-32. Halaas, J.L., Gajiwala, K.S., Maffei, M . , Cohen, S.L., Chait, B.T., Rabinowitz, D., Lallone, R.L., Burley, S.K. & Friedman, J.M. (1995). Science, 269, 543-6. Hall, R.A., Premont, R.T. & Lefkowitz, R.J. (1999). J Cell Biol, 145, 927-32. Halperin, R., Pansky, M . , Vaknin, Z., Zehavi, S., Bukovsky, I. & Schneider, D. (2003). Eur J Obstet Gynecol Reprod Biol, 110, 207-10. Hanahan, D. & Weinberg, R.A. (2000). Cell, 100, 57-70. Hankinson, S.E., Colditz, G.A., Hunter, D.J., Willett, W.C., Stampfer, M.J. , Rosner, B., Hennekens, C.H. & Speizer, F.E. (1995). Cancer, 76, 284-90. Hansel, W., Leuschner, C , Gawronska, B. & Enright, F. (2001). Reprod Biol, 1, 20-32. Harlow, B.L. , Cramer, D.W., Bell, D.A. & Welch, W.R. (1992). Obstet Gynecol, 80, 19-26. Hasan, J., Ton, N . , Mullamitha, S., Clamp, A. , McNeilly, A . , Marshall, E. & Jayson, G.C. (2005). Br J Cancer, 93, 647-51. Heinonen, P.K., Koivula, T., Rajaniemi, H . & Pystynen, P. (1986). Gynecol Oncol, 25, 1-10. Heintz, A.P., Odicino, F., Maisonneuve, P., Beller, U . , Benedet, J.L., Creasman, W.T., Ngan, H.Y. , Sideri, M . & Pecorelli, S. (2001). J Epidemiol Biostat, 6, 107-38. Helzlsouer, K.J . , Alberg, A.J. , Gordon, G.B., Longcope, C , Bush, T.L., Hoffman, S.C. & Comstock, G.W. (1995). Jama, 274, 1926-30. Herbst, A . L . (1994). Am J Obstet Gynecol, 170, 1099-105; discussion 1105-7. Herod, J.J., Eliopoulos, A .G . , Warwick, J., Niedobitek, G., Young, L.S. & Kerr, D.J. (1996). Cancer Res, 56, 2178-84. Herrlich, A. , Kuhn, B., Grosse, R., Schmid, A. , Schultz, G. & Gudermann, T. (1996). J Biol Chem, 271, 16764-72. Hileman, S.M., Tornoe, J., Flier, J.S. & Bjorbaek, C. (2000). Endocrinology, 141, 1955-61. Hillier, S.G., Anderson, R.A., Williams, A.R. & Tetsuka, M . (1998). Mol Hum Reprod, 4, 811-5. Hirsch, B., Kudo, M . , Naro, F., Conti, M . & Hsueh, A.J . (1996). Mol Endocrinol, 10, 1127-37. Ho, S.M., Lau, K . M . , Mok, S.C. & Syed, V . (2003). Oncogene, 22, 4243-56. 57 Horiuchi, A. , Itoh, K. , Shimizu, M . , Nakai, I., Yamazaki, T., Kimura, K. , Suzuki, A. , Shiozawa, L, Ueda, N . & Konishi, I. (2003). Gynecol Oncol, 88, 309-17. Hoyo, C , Berchuck, A. , Halabi, S., Bentley, R.C., Moorman, P., Calingaert, B. & Schildkraut, J .M. (2005). Cancer Causes Control, 16, 955-63. Hsueh, A.J . , Adashi, E.Y. , Jones, P.B. & Welsh, T.H., Jr. (1984). EndocrRev, 5, 76-127. Hu, X . , Juneja, S .C, Maihle, N.J. & Cleary, M.P. (2002). J Natl Cancer Inst, 94, 1704-11. Hu, Z. & Deng, X . (2000). Zhonghua Fu Chan Ke Za Zhi, 35, 423-6. Huang, C.F., Liu, D.Y. & Shen, K. (2003a). Zhongguo Yi Xue Ke Xue Yuan Xue Bao, 25, 447-50. Huang, C.F., Liu, D.Y., Xu, W.H. & Shen, K. (2003b). Zhongguo Yi Xue Ke Xue Yuan Xue Bao, 25, 443-6. Huntsman, D., Resau, J.H., Klineberg, E. & Auersperg, N . (1999). Am J Pathol, 155, 343-8. Ichikawa, Y . , Yoshida, S., Koyama, Y . , Hirai, M . , Ishikawa, T., Nishida, M . , Tsunoda, H., Kubo, T., Miwa, M . & Uchida, K . (1996a). Int J Cancer, 69, 466-70. Ichikawa, Y . , Yoshida, S., Suzuki, H. , Nishida, M . , Tsunoda, H. , Kubo, T., Miwa, M . & Uchida, K . (1996b). JpnJClin Oncol, 26, 298-302. Imai, A. , Takagi, A. , Horibe, S., Takagi, H. & Tamaya, T. (1998). Int J Oncol, 13, 97-100. Imai, A . , Takagi, H. , Furui, T., Horibe, S., Fuseya, T. & Tamaya, T. (1996). Cancer, 1 1 , 132-7. Ind, T., lies, R , Shepherd, J. & Chard, T. (1997). Br J Obstet Gynaecol, 104, 1024-9. Islam, M.S., Morton, N . M . , Hansson, A . & Emilsson, V . (1997). Biochem Biophys Res Commun, 238, 851-5. Isse, N . , Ogawa, Y . , Tamura, N . , Masuzaki, H. , Mori, K . , Okazaki, T., Satoh, N . , Shigemoto, M . , Yoshimasa, Y . , Nishi, S. & et al. (1995). J Biol Chem, 270, 27728-33. Ivarsson, K. , Sundfeldt, K. , Brannstrom, M . , Hellberg, P. & Janson, P.O. (2001). Hum Reprod, 16, 18-23. Jemal, A. , Thomas, A. , Murray, T. & Thun, M . (2002). CA Cancer J Clin, 52, 23-47. Jernstrom, H. , Borg, K . & Olsson, H. (2005). Mol Genet Metab, 86, 320-7. Ji, Q., Liu, P.I., Chen, P.K. & Aoyama, C. (2004). Int J Cancer, 112, 803-14. Kacinski, B . M . , Carter, D., Kohorn, E.I., Mittal, K. , Bloodgood, R.S., Donahue, J., Kramer, C.A., Fischer, D., Edwards, R , Chambers, S.K. & et al. (1989). Yale J Biol Med, 62, 379-92. Kacinski, B . M . , Carter, D., Mittal, K. , Yee, L.D., Scata, K . A . , Donofrio, L . , Chambers, S.K., Wang, K.I. , Yang-Feng, T., Rohrschneider, L.R. & et al. (1990). Am J Pathol, 137, 135-47. Kandel, E.S. & Hay, N . (1999). Exp Cell Res, 253, 210-29. Kang, S.K., Cheng, K.W., Nathwani, P.S., Choi, K .C . & Leung, P.C. (2000a). Endocrine, 13, 297-304. Kang, S.K., Choi, K . C , Cheng, K.W., Nathwani, P.S., Auersperg, N . & Leung, P.C. (2000b). Endocrinology, 141, 72-80. Kang, S.K., Choi, K . C , Yang, H.S. & Leung, P.C. (2003). Endocr Relat Cancer, 10, 169-77. Kang, S.K., Tai, C.J., Nathwani, P.S. & Leung, P.C. (2001). Endocrinology, 142, 182-92. Kantak, S.S. & Kramer, R.H. (1998). J Biol Chem, 273, 16953-61. 58 Karlan, B .Y. , Jones, J., Greenwald, M . & Lagasse, L.D. (1995). Am J Obstet Gynecol, 173, 97-104. Karlsson, C , Lindell, K. , Svensson, E., Bergh, C , Lind, P., Bil l ig, FL, Carlsson, L . M . & Carlsson, B. (1997). J Clin Endocrinol Metab, 82, 4144-8. Kashyap, S., Moher, D., Fung, M.F. & Rosenwaks, Z. (2004). Obstet Gynecol, 103, 785-94. Kasuya, Y . , Abe, Y . , Hama, H. , Sakurai, T., Asada, S., Masaki, T. .& Goto, K . (1994). Biochem Biophys Res Commun, 204, 1325-33. Katsaros, D., Fracchioli, S., Arese, P., Enria, R., Cassinelli, P., Mingrone, K. , Piccinno, R , Rigault de la Longrais, I.A. & Massobrio, M . (1999). Minerva Ginecol, 51, 483-99. Kawasaki, H. , Springett, G.M. , Mochizuki, N . , Toki, S., Nakaya, M . , Matsuda, M . , Housman, D.E. & Graybiel, A . M . (1998). Science, 282, 2275-9. Keith Bechtel, M . & Bonavida, B. (2001). Gynecol Oncol, 82, 127-38. Keri, R.A., Lozada, K . L . , Abdul-Karim, F.W., Nadeau, J.H. & Nilson, J.H. (2000). Proc Natl Acad Sci USA, 9 1 , 383-7. Kikuchi, Y . (2001). Hum Cell, 14, 115-33. Kim, K . Y . , Choi, K . C , Park, S.H., Auersperg, N . & Leung, P.C. (2005). J Clin Endocrinol Metab, 90, 1670-7. Kim, K . Y . , Choi, K . C , Park, S.H., Chou, C.S., Auersperg, N . & Leung, P.C. (2004). J Clin Endocrinol Metab, 89, 3020-6. Kim, N.W., Piatyszek, M.A . , Prowse, K.R., Harley, C.B., West, M.D. , Ho, P.L., Coviello, G.M. , Wright, W.E., Weinrich, S.L. & Shay, J.W. (1994). Science, 266, 2011-5. Kimura, A. , Ohmichi, M . , Kurachi, H. , Ikegami, H. , Hayakawa, J., Tasaka, K. , Kanda, Y . , Nishio, Y . , Jikihara, H. , Matsuura, N . & Murata, Y . (1999). Cancer Res, 59, 5133-42. Kirchhoff, S., Muller, W.W., Krueger, A. , Schmitz, I. & Krammer, P.H. (2000). J Immunol, 165, 6293-300. Kobayashi, F., Monma, C , Nanbu, K. , Konishi, I., Sagawa, N . & Mori, T. (1996). Gynecol Oncol, 62, 309-13. Kohler, M . , Janz, I., Wintzer, H.O., Wagner, E. & Bauknecht, T. (1989). Anticancer Res, 9 , 1537-47. Kraemer, S., Jaeger, W.H. & Lang, N . (2001). Anticancer Res, 21, 2005-10. Kramer, S., Leeker, M . & Jager, W. (1998). Int J Biol Markers, 13, 165-8. Krueger, A. , Schmitz, I., Baumann, S., Krammer, P.H. & Kirchhoff, S. (2001). J Biol Chem, 276, 20633-40. Kruk, P.A., Godwin, A .K . , Hamilton, T . C & Auersperg, N . (1999). Gynecol Oncol, 73, 229-36. Kuhn, B. & Gudermann, T. (1999). Biochemistry, 38, 12490-8. Kumar, T.R., Palapattu, G., Wang, P., Woodruff, T.K., Boime, I., Byrne, M . C & Matzuk, M . M . (1999). Mol Endocrinol, 13, 851-65. Kuper, H. , Cramer, D.W. & Titus-Ernstoff, L. (2002). Cancer Causes Control, 13, 455-63. Kurbacher, C M . , Jager, W., Kurbacher, J.A., Bittl, A. , Wildt, L . & Lang, N . (1995). Tumour Biol, 16, 374-84. Kurian, A.W., Balise, R.R., McGuire, V . & Whittemore, A.S. (2005). Gynecol Oncol, 96, 520-30. 59 Kuroda, H. , Mandai, M . , Konishi, I., Tsuruta, Y . , Kusakari, T., Kariya, M . & Fujii, S. (2001). Int J Cancer, 91, 309-15. Kuroda, H. , Mandai, M . , Konishi, I., Yura, Y . , Tsuruta, Y . , Hamid, A . A . , Nanbu, K. , Matsushita, K. & Mori, T. (1998). Int J Cancer, 76, 571-8. Kurose, K. , Zhou, X.P. , Araki, T., Cannistra, S.A., Maher, E.R. & Eng, C. (2001). Am J Pathol, 158, 2097-106. Kyo, S., Kanaya, T., Ishikawa, H. , Ueno, H. & Inoue, M . (1996). Clin Cancer Res, 2 , 2023-8. Lacey, J.V., Jr., Mink, P.J., Lubin, J.H., Sherman, M.E. , Troisi, R., Hartge, P., Schatzkin, A. & Schairer, C. (2002). Jama, 288, 334-41. Lambe, M . , Wuu, J., Rossing, M . A . & Hsieh, C C . (1999). Lancet, 353, 1941. Lau, A . & Matzuk, M . M . (1999). Gravit Space Biol Bull, 12, 75-82. Lau, K . M . , Mok, S.C & Ho, S.M. (1999). Proc Natl Acad Sci USA, 96, 5722-7. Laud, K. , Gourdou, I., Pessemesse, L. , Peyrat, J.P. & Djiane, J. (2002). Mol Cell Endocrinol, 188, 219-26. Lee, M.T., Liebow, C , Kamer, A.R. & Schally, A . V . (1991). Proc Natl Acad Sci USA, 88, 1656-60. Leuschner, C , Enright, F .M. , Melrose, P.A. & Hansel, W. (2001). Prostate, 46, 116-25. Levesque, M.A . , Katsaros, D., Yu , H. , Zola, P., Sismondi, P., Giardina, G. & Diamandis, E.P. (1995). Cancer, 75, 1327-38. Licinio, J., Mantzoros, C , Negrao, A.B. , Cizza, G., Wong, M.L . , Bongiorno, P.B., Chrousos, G.P., Karp, B. , Allen, C , Flier, J.S. & Gold, P.W. (1997). Nat Med, 3, 575-9. Loffler, S., Aust, G., Kohler, U . & Spanel-Borowski, K . (2001). Mol Hum Reprod, 7, 1143-9. Lu, J., Xiao Y j , Y.J . , Baudhuin, L . M . , Hong, G. & Xu, Y . (2002). J Lipid Res, 43, 463-76. Lu, J.J., Zheng, Y . , Kang, X . , Yuan, J.M., Lauchlan, S .C, Pike, M . C & Zheng, W. (2000). Gynecol Oncol, 79, 158-68. Lubin, F., Chetrit, A. , Freedman, L.S., Alfandary, E., Fishier, Y . , Nitzan, H. , Zultan, A . & Modan, B. (2003). Am J Epidemiol, 157, 113-20. Lukanova, A . & Kaaks, R. (2005). Cancer Epidemiol Biomarkers Prev, 14, 98-107. Maffei, M . , Halaas, J., Ravussin, E., Pratley, R.E., Lee, G.H., Zhang, Y . , Fei, H. , Kim, S., Lallone, R., Ranganathan, S. & et al. (1995). Nat Med, 1, 1155-61. Maines-Bandiera, S.L. & Auersperg, N . (1997). Int J Gynecol Pathol, 16, 250-5. Mandai, M . , Konishi, I., Kuroda, H. , Fukumoto, M . , Komatsu, T., Yamamoto, S., Nanbu, K. , Rao, C.V. & Mori, T. (1997). Eur J Cancer, 33, 1501-7. Marchbanks, P.A., Wilson, H. , Bastos, E., Cramer, D.W., Schildkraut, J .M. & Peterson, H.B. (2000). Obstet Gynecol, 95, 255-60. Marcillac, I., Troalen, F., Bidart, J.M., Ghillani, P., Ribrag, V . , Escudier, B. , Malassagne, B. , Droz, J.P., Lhomme, C , Rougier, P. & et al. (1992). Cancer Res, 52, 3901-7. Mark, A . L . , Correia, M.L . , Rahmouni, K. & Haynes, W.G. (2004). Clin Exp Hypertens, 26, 629-36. Martin-Romero, C. & Sanchez-Margalet, V . (2001). Cell Immunol, 212, 83-91. Masuzaki, H. , Ogawa, Y . , Hosoda, K. , Miyawaki, T., Hanaoka, I., Hiraoka, J., Yasuno, A. , Nishimura, H. , Yoshimasa, Y . , Nishi, S. & Nakao, K. (1997a). J Clin Endocrinol Metab, 82, 2542-7. 60 Masuzaki, H. , Ogawa, Y . , Sagawa, N . , Hosoda, K. , Matsumoto, T., Mise, H. , Nishimura, H. , Yoshimasa, Y . , Tanaka, I., Mori, T. & Nakao, K. (1997b). Nat Med, 3, 1029-33. Matsuoka, T., Tahara, M . , Yokoi, T., Masumoto, N . , Takeda, T., Yamaguchi, M . , Tasaka, K. , Kurachi, H. & Murata, Y . (1999). Biochem Biophys Res Commun, 256, 480-4. Matthews, C. & Chatterjee, V . K . (1997). N EnglJ Med, 337, 642. Matthews, C.H., Borgato, S., Beck-Peccoz, P., Adams, M . , Tone, Y . , Gambino, G., Casagrande, S., Tedeschini, G., Benedetti, A . & Chatterjee, V . K . (1993). Nat Genet, 5, 83-6. Matzuk, M . M . , Finegold, M.J. , Su, J.G., Hsueh, A.J . & Bradley, A . (1992). Nature, 360, 313-9. McCann, S.M., Kimura, M . , Walczewska, A. , Karanth, S., Rettori, V . & Y u , W.H. (1998). Domest Anim Endocrinol, 15, 333-44. McDonnel, A .C . & Murdoch, W.J. (2001). J Steroid Biochem Mol Biol, 78, 185-91. McDonnel, A . C , Van Kirk, E.A., Isaak, D.D. & Murdoch, W.J. (2003). Exp Biol Med (Maywood), 228, 308-14. McDonough, P.G. (2003). Ann N Y Acad Sci, 997, 22-34. McGuire, V. , Felberg, A. , Mills, M . , Ostrow, K . L . , DiCioccio, Pv., John, E . M . , West, D.W. & Whittemore, A.S. (2004). Am J Epidemiol, 160, 613-8. Mills, G.B., Lu, Y . , Fang, X . , Wang, FL, Eder, A. , Mao, M . , Swaby, R., Cheng, K.W., Stokoe, D., Siminovitch, K. , Jaffe, R. & Gray, J. (2001). Semin Oncol, 28, 125-41. Minegishi, T., Kameda, T., Hirakawa, T., Abe, K., Tano, M . & Ibuki, Y . (2000). Clin Cancer Res, 6, 2764-70. Mink, P.J., Folsom, A.R., Sellers, T.A. & Kushi, L . H . (1996). Epidemiology, 7, 38-45. Mitsuuchi, Y . , Johnson, S.W., Sonoda, G., Tanno, S., Golemis, E.A. & Testa, J.R. (1999). Oncogene, 18, 4891-8. Mittal, K.R., Goswami, S. & Demopoulos, R I . (1995). Histochem J, 27, 119-22. Miyazaki, M . , Nagy, A. , Schally, A .V . , Lamharzi, N . , Halmos, G., Szepeshazi, K. , Groot, K. & Armatis, P. (1997). J Natl Cancer Inst, 89, 1803-9. Modan, B. , Ron, E., Lerner-Geva, L. , Blumstein, T., Menczer, J., Rabinovici, J., Oelsner, G., Freedman, L. , Mashiach, S. & Lunenfeld, B. (1998). Am J Epidemiol, 147, 1038-42. Modugno, F., Ness, R.B. & Allen, G.O. (2003). Obstet Gynecol, ,102, 1336-43. Modugno, F., Ness, R.B., Allen, C O . , Schildkraut, J.M., Davis, F.G. & Goodman, M.T. (2004). Am J Obstet Gynecol, 191, 733-40. Modugno, F., Ness, R.B. & Cottreau, C M . (2002). Epidemiology, 13, 467-71. Mok, S .C, Chan, W.Y., Wong, K . K . , Muto, M.G. & Berkowitz, R.S. (1996). Oncogene, 12, 1895-901. Mor, G., Straszewski, S. & Kamsteeg, M . (2002). Biochem Pharmacol, 64, 1305-15. Mor, G., Visintin, I., Lai, Y . , Zhao, H. , Schwartz, P., Rutherford, T., Yue, L. , Bray-Ward, P. & Ward, D . C (2005). Proc Natl Acad Sci USA, 102, 7677-82. Morash, B., L i , A. , Murphy, P .R , Wilkinson, M . & Ur, E. (1999). Endocrinology, 140, 5995-8. Moser, T.L., Young, T.N., Rodriguez, G . C , Pizzo, S.V., Bast, R . C , Jr. & Stack, M.S. (1994). Int J Cancer, 56, 552-9. Motomura, S. (1998). Kurume Med J, 45, 27-32. 61 Mueller, P.W., Price, R.G. & Finn, W.F. (1998). Environ Health Perspect, 106, 227-30. Murdoch, W.J. (1994). Anat Rec, 240, 322-6. Murdoch, W.J. & Van Kirk, E.A. (1997). Apoptosis, 2,478-84. Nechamen, C.A., Thomas, R .M. , Cohen, B.D., Acevedo, G., Poulikakos, P.I., Testa, J.R. & Dias, J. A . (2004). Biol Reprod, 71, 629-36. Ness, R.B. & Cottreau, C. (1999). J Natl Cancer Inst, 91, 1459-67. Ness, R.B., Cramer, D.W., Goodman, M.T., Kjaer, S.K., Mallin, K. , Mosgaard, B.J., Purdie, D .M. , Risch, H.A., Vergona, R. & Wu, A . H . (2002). Am J Epidemiol, 155, 217-24. Ness, R.B., Grisso, J.A., Vergona, R., Klapper, J., Morgan, M . & Wheeler, J.E. (2001). Epidemiology, 12, 307-12. Nicosia, S.V. & Johnson, J.H. (1984). Int J Gynecol Pathol, 3, 249-60. Nishimori, K. , Dunkel, L. , Hsueh, A.J. , Yamoto, M . & Nakano, R. (1995). J Clin Endocrinol Metab, 80, 1444-8. Nowak-Markwitz, E., Jankowska, A. , Andrusiewicz, M . & Szczerba, A . (2004). Eur J Gynaecol Oncol, 25, 465-9. Ogden, C.L., Carroll, M.D. , Curtin, L.R., McDowell, M.A. , Tabak, C.J. & Flegal, K . M . (2006). Jama, 295, 1549-55. Ohmichi, M . , Sawada, T., Kanda, Y„ Koike, K. , Hirota, K. , Miyake, A . & Saltiel, A.R. (1994). J Biol Chem, 269, 3783-8. Ohta, H. , Sakamoto, H. & Satoh, K. (1998). Cancer Lett, 134, 111-8. Ohtani, K. , Sakamoto, H. , Kikuchi, A. , Nakayama, Y . , Idei, T., Igarashi, N . , Matukawa, T. & Satoh, K . (2001). Cancer Lett, 166, 207-13. O'Rourke, L. , Yeaman, S.J. & Shepherd, P.R. (2001). Diabetes, 50, 955-61. Osterholzer, H.O., Johnson, J.H. & Nicosia, S.V. (1985). Biol Reprod, 33, 729-38. Ozata, M . , Ozdemir, I.C. & Licinio, J. (1999). J Clin Endocrinol Metab, 84, 3686-95. Ozols, R.F., Bookman, M.A. , Connolly, D.C., Daly, M.B. , Godwin, A . K . , Schilder, R.J., Xu, X . & Hamilton, T.C. (2004). Cancer Cell, 5, 19-24. Pan, Z.Z., Bruening, W., Giasson, B.I., Lee, V . M . & Godwin, A . K . (2002). J Biol Chem, 2 1 1 , 35050-60. Parazzini, F., Negri, E., La Vecchia, C , Luchini, L. & Mezzopane, R. (1993). Obstet Gynecol, 81, 363-6. Parazzini, F., Negri, E., La Vecchia, C , Moroni, S., Polatti, A. , Chiaffarino, F., Surace, M . & Ricci, E. (1998). Gynecol Oncol, 68, 226-8. Park, B.K. , Zeng, X . & Glazer, R.I. (2001). Cancer Res, 61, 7647-53. Parrott, J.A., Doraiswamy, V. , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Paskeviciute, L. , Roed, H. & Engelholm, S. (2002). Gynecol Oncol, 86, 297-301. Peng, C , Fan, N.C. , Ligier, M . , Vaananen, J. & Leung, P.C. (1994). Endocrinology, 135, 1740-6. Pennybacker, M . & Herman, B. (1991). Mol Cell Endocrinol, 80, 11-20. Perez Mayorga, M . , Gromoll, J., Behre, H .M. , Gassner, C , Nieschlag, E. & Simoni, M . (2000). J Clin Endocrinol Metab, 85, 3365-9. Persons, D.L., Yazlovitskaya, E .M. , Cui, W. & Pelling, J.C. (1999). Clin Cancer Res, 5, 1007-14. 62 Peterson, C M . , Jolles, C.J., Carrell, D.T., Straight, R . C , Jones, K.P., Poulson, A . M . , Jr. & Hatasaka, H.H. (1994). Gynecol Oncol, 52, 26-30. Petty, R., Evans, A. , Duncan, I., Kurbacher, C. & Cree, I. (1998). Pathol Oncol Res, 4, 97-102. Pike, M.C. , Pearce, C.L., Peters, R , Cozen, W., Wan, P. & Wu, A . H . (2004). Fertility and Sterility, 82, 186-195. Pon, Y . L . , Auersperg, N . & Wong, A.S. (2005). J Biol Chem, 280, 15438-48. Pujol, P., Rey, J.M., Nirde, P., Roger, P., Gastaldi, M . , Laffargue, F., Rochefort, H . & Maudelonde, T. (1998). Cancer Res, 58, 5367-73. Puis, L.E. , Powell, D.E., DePriest, P.D., Gallion, H.H., Hunter, J.E., Kryscio, R.J. & Van Nagell, J., J. R. (1992). Gynecologic Oncology, 47, 53-57. Purdie, D., Green, A. , Bain, C , Siskind, V. , Ward, B., Hacker, N . , Quinn, M . , Wright, G., Russell, P. & Susil, B. (1995). Int J Cancer, 62, 678-84. Purdie, D .M. , Bain, C.J., Webb, P.M. , Whiteman, D . C , Pirozzo, S. & Green, A .C . (2001). Cancer Causes Control, 12, 855-63. Pustilnik, T.B., Estrella, V. , Wiener, J.R., Mao, M . , Eder, A. , Watt, M.A . , Bast, R . C , Jr. & Mills, G.B. (1999). Clin Cancer Res, 5, 3704-10. Quirk, J.T. & Natarajan, N . (2005). Gynecol Oncol, 97, 519-23. Rajaniemi, H. , Kauppila, A. , Ronnberg, L. , Selander, K. & Pystynen, P. (1981). Acta Obstet Gynecol Scand Suppl, 101, 83-6. Rameh, L .E. & Cantley, L . C (1999). J Biol Chem, 274, 8347-50. Rao, B.R. & Slotman, B.J. (1991). Endocr Rev, 12, 14-26. Rasmussen, D.D., Boldt, B . M . , Wilkinson, C.W., Yellon, S.M. & Matsumoto, A . M . (1999). Endocrinology, 140, 1009-12. Rau, H. , Reaves, B.J., O'Rahilly, S. & Whitehead, J.P. (1999). Endocrinology, 140, 1718-23. Reedy, M . , Gallion, H. , Fowler, J.M., Kryscio, R. & Smith, S.A. (2002). Gynecol Oncol, 85, 255-9. Ries, L .A. , Harkins, D., Krapcho, M . , Mariotto, A. , Miller, B.A„ Feuer, E.J., Clegg, L. , Eisner, M.P., Horner, M.J. , Howlader, N . , Hayat, M . , Hankey, B.F., Edwards, B.K. (ed.) (2006). SEER Cancer Statistics Review, 1975-2003. NIH Publication: Bethesda (MD). Ries, L .A . , Miller, B.A. , Hankey, B.F., Kosary, C.L., Harras, A. , Edwards, B.K. (ed.) (1994). SEER cancer statistics review, 1973-1991 .-tables and graphs. NIH Publication: Bethesda (MD). Riman, T., Dickman, P.W., Nilsson, S., Correia, N . , Nordlinder, H. , Magnusson, C M . & Persson, I.R. (2002a). Am J Epidemiol, 156, 363-73. Riman, T., Dickman, P.W., Nilsson, S., Correia, N , Nordlinder, H. , Magnusson, C M . , Weiderpass, E. & Persson, I.R. (2002b). J Natl Cancer Inst, 94,497-504. Rimon, E., Sasson, R., Dantes, A. , Land-Bracha, A. & Amsterdam, A. (2004). Int J Oncol, 24, 1325-38. Risch, H. (1998). JNCI Cancer Spectrum, 90, 1774-1786. Risch, H.A., Marrett, L.D., Jain, M . & Howe, G.R. (1996). Am J Epidemiol, 144, 363-72. Risma, K . A . , Clay, C M . , Nett, T.M. , Wagner, T., Yun, J. & Nilson, J.H. (1995). Proc Natl Acad Sci USA, 92, 1322-6. 63 Rock, F X . , Altmann, S.W., van Heek, M . , Kastelein, R.A. & Bazan, J.F. (1996). Horm Metab Res, 28, 649-52. Rodriguez, G.C., Haisley, C , Hurteau, J., Moser, T.L., Whitaker, R., Bast, R.C., Jr. & Stack, M.S. (2001). Gynecol Oncol, 80, 245-53. Rodriguez, G.C., Nagarsheth, N.P., Lee, K . L . , Bentley, R.C., Walmer, D.K., Cline, M . , Whitaker, R.S., Isner, P., Berchuck, A. , Dodge, R.K. & Hughes, C.L. (2002). J Natl Cancer Inst, 94, 50-60. Roland, I.H., Yang, W.-L., Yang, D.-H., Daly, M.B. , Ozols, R.F., Hamilton, T.C., Lynch, H.T., Godwin, A . K . & Xu, X . - X . (2003). Cancer, 98, 2607-2623. Rossing, M.A . , Daling, J.R., Weiss, N.S., Moore, D.E. & Self, S.G. (1994). N EnglJ Med, 331, 771-6. Rouet-Benzineb, P., Aparicio, T., Guilmeau, S., Pouzet, C , Descatoire, V . , Buyse, M . & Bado, A . (2004). J Biol Chem, 279, 16495-502. Rutherford, T., Brown, W.D., Sapi, E., Aschkenazi, S., Munoz, A . & Mor, G. (2000). Obstet Gynecol, 96, 417-21. Rzepka-Gorska, I., Chudecka-Glaz, A. , Kosmider, M . & Malecha, J. (2003). Int J Gynaecol Obstet, 81, 199-205. Rzepka-Gorska, I., Chudecka-Glaz, A . & Kosmowska, B. (2004). Endocr Relat Cancer, 11,315-21, Saladin, R., De Vos, P., Guerre-Millo, M . , Leturque, A. , Girard, J., Staels, B . & Auwerx, J. (1995) . Nature, 377, 527-9. Sasaki, H. , Kotsuji, F. & Tsang, B.K. (2002). Gynecol Oncol, 85, 339-50. Sasaki, H. , Sheng, Y . , Kotsuji, F. & Tsang, B.K. (2000). Cancer Res, 60, 5659-66. Sassone-Corsi, P. (1998). Int J Biochem Cell Biol, 30, 27-38. Savino, L. , Baldini, B. , Susini, T., Pulli, F., Antignani, L . & Massi, G.B. (1992). J Chemother, 4, 312-20. Schally, A . V . (1999). Peptides, 20, 1247-62. Schally, A . V . , Comaru-Schally, A . M . , Nagy, A. , Kovacs, M . , Szepeshazi, K. , Plonowski, A. , Varga, J.L. & Halmos, G. (2001). Front Neuroendocrinal, 22, 248-91. Schiffenbauer, Y.S. , Abramovitch, R., Meir, G., Nevo, N . , Holzinger, M . , Itin, A . , Keshet, E. & Neeman, M . (1997). Proc Natl Acad Sci USA, 94, 13203-8. Schiffenbauer, Y.S. , Meir, G., Maoz, M . , Even-Ram, S.C, Bar-Shavit, R. & Neeman, M . (2002). Gynecol Oncol, 84, 296-302. Schmalfeldt, B. , Kuhn, W., Reuning, U . , Pache, L. , Dettmar, P., Schmitt, M . , Janicke, F., Hofler, H . & Graeff, H. (1995). Cancer Res, 55, 3958-63. Schmalfeldt, B., Prechtel, D., Halting, K. , Spathe, K. , Rutke, S., Konik, E., Fridman, R., Berger, U . , Schmitt, M . , Kuhn, W. & Lengyel, E. (2001). Clin Cancer Res, 7, 2396-404. Schmider, A . , Gee, C , Friedmann, W., Lukas, J.J., Press, M.F., Lichtenegger, W. & Reles, A . (2000). Gynecol Oncol, 1 1 , 231'-42. Schmidt, M . , Evellin, S., Weernink, P.A., von Dorp, F., Rehmann, H. , Lomasney, J.W. & Jakobs, K . H . (2001). Nat Cell Biol, 3, 1020-4. Schneider, R., Bornstein, S.R., Chrousos, G.P., Boxberger, S., Ehninger, G. & Breidert, M . (2001). Horm Metab Res, 33, 1-6. Schultz, D . C , Vanderveer, L. , Berman, D.B., Hamilton, T . C , Wong, A.J . & Godwin, A . K . (1996) . Cancer Res, 56, 1997-2002. 64 Schwartz, M.W., Woods, S.C, Porte, D., Jr., Seeley, R.J. & Baskin, D.G. (2000). Nature, 404,661-71. Scully, R.E. (1995). J Cell Biochem Suppl, 23, 208-18. Scully, R.E. (2000). Lancet, 355, 1028-9. Sekar, N . & Veldhuis, J.D. (2001). Endocrinology, 142, 2921-8. Shenker, A. , Laue, L. , Kosugi, S., Merendino, J.J., Jr., Minegishi, T. & Cutler, G.B., Jr. (1993). Nature, 365, 652-4. Shih Ie, M . & Kurman, R.J. (2004). Am J Pathol, 164, 1511-8. Shoham, Z. (1994). Fertil Steril, 62,433-48. Sierra-Honigmann, M.R., Nath, A . K . , Murakami, C , Garcia-Cardena, G., Papapetropoulos, A. , Sessa, W . C , Madge, L .A. , Schechner, J.S., Schwabb, M.B. , Polverini, P.J. & Flores-Riveros, J.R. (1998). Science, 281, 1683-6. Slot, K . A . , de Boer-Brouwer, M . , Houweling, M . , Vaandrager, A .B . , Dorrington, J.H. & Teerds, K.J . (2006). J Endocrinol, 188, 227-39. Somasundar, P., McFadden, D.W., Hileman, S.M. & Vona-Davis, L . (2004). J Surg Res, 116, 337-49. Song, J., Fadiel, A. , Edusa, V . , Chen, Z., So, J., Sakamoto, H. , Fishman, D.A. & Naftolin, F. (2005). Cancer Lett, 220, 57-65. Speroff, L . , Glass, R., Kase, N . Clinical gynecologic endocrinology and infertility, Sixth edn. Lippincott Williams &Wilkins: Baltimore. Stallmeyer, B., Kampfer, H. , Podda, M . , Kaufmann, R , Pfeilschifter, J. & Frank, S. (2001). J Invest Dermatol, 1 1 1 , 98-105. Steinmeyer, C , Berkholz, A. , Gebauer, G. & Jager, W. (2003). Tumour Biol, 24, 13-22. Steller, M.D. , Shaw, T.J., Vanderhyden, B.C. & Ethier, J.F. (2005). Mol Cancer Res, 3, 50-61. Stevens, J., Cai, J., Pamuk, E.R., Williamson, D.F., Thun, M.J. & Wood, J.L. (1998). N Engl J Med, 338, 1-7. Stewart, S.L., Querec, T.D., Gruver, B.N. , O'Hare, B., Babb, J.S. & Patriotis, C. (2004a). J Cell Physiol, 198, 119-24. Stewart, S.L., Querec, T.D., Ochman, A.R., Gruver, B.N. , Bao, R , Babb, J.S., Wong, T.S., Koutroukides, T., Pinnola, A.D. , Klein-Szanto, A. , Hamilton, T.C. & Patriotis, C. (2004b). Cancer Res, 64, 8177-83. Sundfeldt, K. , Piontkewitz, Y . , Ivarsson, K. , Nilsson, O., Hellberg, P., Brannstrom, M . , Janson, P.O., Enerback, S. & Hedin, L . (1997). Int J Cancer, 74, 275-80. Swisher, E. (2003). Curr Womens Health Rep, 3 , 27-32. Syed, V . & Ho, S.M. (2003). Oncogene, 22, 6883-90. Syed, V. , Ulinski, G., Mok, S.C. & Ho, S.M. (2002a). J Natl Cancer Inst, 94, 617-29. Syed, V. , Ulinski, G., Mok, S.C. & Ho, S.M. (2002b). J Natl Cancer Inst, Vol. 94, pp 617-29. Syed, V. , Ulinski, G., Mok, S.C, Yiu, G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Tai, Y.T. , Lee, S., Niloff, E., Weisman, C , Strobel, T. & Cannistra, S.A. (1998). J Clin Oncol, 16, 2583-90. Takao, Y . , Honda, T., Ueda, M . , Hattori, N . , Yamada, S., Maeda, M . , Fujiwara, H. , Mori, T. & Wimalasena, J. (1997). Mol Hum Reprod, 3, 569-78. 65 j Tang, X . , Yano, T., Osuga, Y . , Matsumi, H. , Yano, N . , Xu, J., Wada, O., Koga, K. , Kugu, K. , Tsutsumi, O., Schally, A . V . & Taketani, Y . (2002). J Clin Endocrinol Metab, 87,3721-7. Tanno, S., Mitsuuchi, Y . , Altomare, D.A., Xiao, G.H. & Testa, J.R. (2001). Cancer Res, 61, 589-93. Tartaglia, L . A . (1997). J Biol Chem, 2 1 2 , 6093-6. Tartaglia, L .A. , Dembski, M . , Weng, X . , Deng, N . , Culpepper, J., Devos, R., Richards, G.J., Campfield, L .A. , Clark, F.T., Deeds, J., Muir, C , Sanker, S., Moriarty, A. , Moore, K.J . , Smutko, J.S., Mays, G.G., Wool, E.A., Monroe, C.A. & Tepper, R.I. (1995). Cell, 83, 1263-71. Tashiro, H. , Katabuchi, H. , Begum, M . , L i , X . , Nitta, M . , Ohtake, H . & Okamura, H. (2003) . Cancer Sci, 94, 953-9. Taube, M . , Hockenstrom, T., Isaksson, M . , Lindgren, P.R. & Backstrom, T. (2002). Int J Oncol, 20, 589-94. Tessitore, L. , Vizio, B., Pesola, D., Cecchini, F., Mussa, A. , Argiles, J .M. & Benedetto, C. (2004) . Int J Oncol, 24, 1529-35. Themmen, A.P .N. & Huhtaniemi, I.T. (2000). Endocr Rev, 21, 551-83. Thomas, T., Burguera, B. , Melton, L.J. , 3rd, Atkinson, E.J., O'Fallon, W.M. , Riggs, B.L. & Khosla, S. (2000). Metabolism, 49, 1278-84. Tibiletti, M.G. , Bernasconi, B., Taborelli, M . , Facco, C , Riva, C , Capella, C , Franchi, M . , Binelli, G., Acquati, F. & Taramelli, R. (2003). Cancer Genet Cytogenet, 146, 145-53. Tilly, J.L., Tilly, K.I., Kenton, M . L . & Johnson, A . L . (1995). Endocrinology, 136, 232-41. Tingulstad, S., Skjeldestad, F.E., Halvorsen, T.B. & Hagen, B. (2003). Obstet Gynecol, 101, 885-91. Tourgeman, D.E., Lu, J.J., Boostanfar, R., Amezcua, C , Felix, J.C. & Paulson, R.J. (2002). Fertil Steril, 78, 1096-9. Touyz, R .M. , Jiang, L . & Sairam, M.R. (2000). Biol Reprod, 6 2 , 1067-74. Tsuchiya, T., Shimizu, H. , Horie, T. & Mori, M . (1999). Eur J Pharmacol, 365, 273-9. Tung, K . H . , Wilkens, L.R., Wu, A .H . , McDuffie, K. , Nomura, A . M . , Kolonel, L .N . , Terada, K . Y . & Goodman, M.T. (2005). Am J Epidemiol, 161, 321-9. Vacca, F., Bagnato, A. , Catt, K.J . & Tecce, R. (2000). Cancer Res, 60, 5310-5317. Vaitukaitis, J.L. (1974). Ann Clin Lab Sci, 4, 276-80. van Biesen, T., Luttrell, L . M . , Hawes, B.E. & Lefkowitz, R.J. (1996). Endocr Rev, 17, 698-714. Van Niekerk, C C , Ramaekers, F.C., Hanselaar, A .G . , Aldeweireldt, J. & Poels, L .G. (1993). Am J Pathol, 142, 157-77. Vara, J.A.F., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C. & Gonzalez-Baron, M . (2004). Cancer Treatment Reviews, 30, 193-204. Vartiainen, J., Lehtovirta, P., Finne, P., Stenman, U.H. & Alfthan, H . (2001). Int J Cancer, 95,313-6. Veldhuis, J.D. (1987). Endocrinology, 120,445-9. Verschraegen, C.F., Westphalen, S., Hu, W., Loyer, E., Kudelka, A. , Volker, P., Kavanagh, J., Steger, M . , Schulz, K .D. & Emons, G. (2003). Gynecol Oncol, 90, 552-9. Vierikko, P., Kauppila, A . & Vihko, R. (1983). Int J Cancer, 32, 413-22. 66 Wang, J., Lin, L. , Parkash, V. , Schwartz, P.E., Lauchlan, S.C. & Zheng, W. (2003a). Int J Cancer, 103, 328-34. Wang, J., Liu, R., Hawkins, M . , Barzilai, N . & Rossetti, L. (1998). Nature, 393, 684-8. Wang, J., Luo, F., Lu, J. J., Chen, P.K., Liu, P. & Zheng, W. (2002). Int J Cancer, 97, 163-7. Wang, T.H., Popp, D .M. , Wang, H.S., Saitoh, M . , Mural, J.G., Henley, D.C., Ichijo, H . & Wimalasena, J. (1999). J Biol Chem, 2 1 A , 8208-16. Wang, Y . , Rippstein, P.U. & Tsang, B.K. (2003b). Biol Reprod, 68, 610-9. Wang, Z., Liu, X . & Ascoli, M . (1997). Mol Endocrinol, 11, 183-92. Watanobe, H. (2002). J Physiol, 545, 255-68. Wauters, M . , Considine, R.V. & Van Gaal, L.F. (2000). Eur J Endocrinol, 143, 293-311. Weiss, N.S., Cook, L.S., Farrow, D.C., Rosenblatt, K . A . (1996). Cancer epidemiology and prevention. Schottenfeld, D., Faumeni, F.S.J, (ed.). Oxford University Press: New York, pp 1040-1057. Westhoff, C , Murphy, P., Heller, D. & Halim, A. (1993). Am J Epidemiol, 138, 90-3. Whiteman, D.C., Murphy, M.F., Cook, L.S., Cramer, D.W., Hartge, P., Marchbanks, P.A., Nasca, P . C , Ness, R.B., Purdie, D . M . & Risch, H.A. (2000). J Natl Cancer Inst, 92, 1172-7. Whiteman, D . C , Siskind, V. , Purdie, D . M . & Green, A .C . (2003). Cancer Epidemiol Biomarkers Prev, 12, 42-6. Whittemore, A.S., Harris, R. & Itnyre, J. (1992). Am J Epidemiol, 136, 1184-203. Wiener, J.R., Windham, T . C , Estrella, V.C. , Parikh, N .U. , Thall, P.F., Deavers, M.T., Bast, R.C., Mills, G.B. & Gallick, G.E. (2003). Gynecol Oncol, 88, 73-9. Willcocks, D., Toppila, M . , Hudson, C.N., Tyler, J.P., Baird, P.J. & Eastman, C.J. (1983). Gynecol Oncol, 16, 246-53. Wimalasena, J., Dostal, R. & Meehan, D. (1992). Gynecol Oncol, 46, 345-50. Wimalasena, J., Meehan, D. & Cavallo, C. (1991). Gynecol Oncol, 41, 56-63. Wimalasena, J., Meehan, D., Dostal, R., Foster, J.S., Cameron, M . & Smith, M . (1993). Oncol Res, 5, 325-37. Wong, A.S. & Auersperg, N . (2002). Cancer Treat Res, 107, 161-83. Wong, A.S., Kim, S.O., Leung, P . C , Auersperg, N . & Pelech, S.L. (2001). Gynecol Oncol, 82,305-11. Worsley, S.D., Ponder, B.A. & Davies, B.R. (1997). Gynecol Oncol, 64, 189-95. Wright, J.W., Stouffer, R.L. & Rodland, K .D. (2003). Mol Cell Endocrinol, 208, 1-10. Wright, J.W., Stouffer, R.L. & Rodland, K .D. (2005). J Clin Endocrinol Metab, 90, 3688-95. Wright, J.W., Toth-Fejel, S., Stouffer, R.L. & Rodland, K .D. (2002). Endocrinology, 143, 2198-207. Wunsch, A. , Ahda, Y . , Banaz-Yasar, F., Sonntag, B., Nieschlag, E., Simoni, M . & Gromoll, J. (2005). Fertil Steril, 84, 446-53. Xerri, L . , Devilard, E., Hassoun, J., Mawas, C. & Birg, F. (1997). Mol Pathol, 50, 87-91. Xu, C.F. & Solomon, E. (1996). Semin Cancer Biol, 1 , 33-40. Xu, L. , Pathak, P.S. & Fukumura, D. (2004). Clin Cancer Res, 10, 701-7. Yamada, S.D., Hickson, J.A., Hrobowski, Y . , Vander Griend, D.J., Benson, D., Montag, A. , Karrison, T., Huo, D., Rutgers, J., Adams, S. & Rinker-Schaeffer, C.W. (2002). Cancer Res, 62, 6717-23. 67 Yamashita, T., Murakami, T., Otani, S., Kuwajima, M . & Shima, K. (1998). Biochem Biophys Res Commun, 246, 752-9. Yang, C.Q., Chan, K . Y . K . , Ngan, H.Y.S., Khoo, U.S., Chiu, P .M. , Chan, Q.K.Y. , Xue, W.C. & Cheung, A . N . Y . (2006). Carcinogenesis, bgl014. Yang, G., Ge, H. , Boucher, A. , Yu , X . & L i , C. (2004). Mol Endocrinol, 18, 1354-62. Yang, L. , Lin, H.K., Altuwaijri, S., Xie, S., Wang, L . & Chang, C. (2003). J Biol Chem, 278, 16820-7. Yano, T., Pinski, J., Radulovic, S. & Schally, A . V . (1994). Proc Natl Acad Sci USA, 91, 1701-5. Yazlovitskaya, E .M. , Pelling, J.C. & Persons, D.L. (1999). Mol Carcinog, 25, 14-20. Yin , N . , Wang, D., Zhang, H. , Y i , X . , Sun, X . , Shi, B. , Wu, H. , Wu, G., Wang, X . & Shang, Y . (2004). Cancer Res, 64, 5870-5. Young, R.H., Clement, P.B., Scully, R.E. The ovary In. Raven Press: New York. Yu, Y . , Xu , F., Peng, H. , Fang, X . , Zhao, S., L i , Y . , Cuevas, B. , Kuo, W.L., Gray, J.W., Siciliano, M . , Mills, G.B. & Bast, R.C., Jr. (1999). Proc Natl Acad Sci USA, 96, 214-9. Zhang, F., Basinski, M.B. , Beals, J.M., Briggs, S.L., Churgay, L . M . , Clawson, D.K., DiMarchi, R.D., Furman, T.C., Hale, J.E., Hsiung, H . M . , Schoner, B.E., Smith, D.P., Zhang, X . Y . , Wery, J.P. & Schevitz, R.W. (1997). Nature, 387, 206-9. Zhang, Y . , Proenca, R., Maffei, M . , Barone, M . , Leopold, L . & Friedman, J .M. (1994). Nature, 372, 425-32. Zheng, L. , Annab, L .A. , Afshari, C.A., Lee, W.H. & Boyer, T.G. (2001). Proc Natl Acad Sci US A, 98, 9587-92. Zheng, W., Lu, J.J., Luo, F., Zheng, Y . , Feng, Y . , Felix, J .C , Lauchlan, S.C. & Pike, M.C. (2000). Gynecol Oncol, 76, 80-8. Zhou, H. , Luo, M.P., Schonthal, A .H . , Pike, M . C , Stallcup, M.R., Blumenthal, M . , Zheng, W. & Dubeau, L. (2002). Cancer Biol Ther, 1, 300-6. Zunino, F., Perego, P., Pilotti, S., Pratesi, G., Supinp, R. & Arcamone, F. (1997). Pharmacol Ther, 76, 177-85. Zygmunt, M . , Herr, F., Keller-Schoenwetter, S., Kunzi-Rapp, K. , Munstedt, K. , Rao, C.V., Lang, U . & Preissner, K.T. (2002). J Clin Endocrinol Metab, 87, 5290-6. 68 CHAPTER II. Overexpression of follicle-stimulating hormone receptor activates oncogenic pathways in preneoplastic ovarian surface epithelial cells1 2.1 Introduction Many studies have demonstrated the expression of FSHR in normal OSE and/or ovarian cancer cells (Choi et al., 2002a; Parrott et al., 2001; Syed et al., 2001), however, to our knowledge, few reports have directly demonstrated an involvement of FSHR in ovarian epithelium tumorigenesis. Considering that FSH might play a role in ovarian cancer development (Konishi et al., 1999; Osterholzer et al., 1985b; Shushan et al., 1996; Whittemore et al., 1992; Wimalasena et al., 1992; Zheng et al., 2000; Zheng et a l , 1996), we sought to investigate the molecular events associated with FSHR expression in ovarian epithelial cells. It is hypothesized that overexpression of FSHR may alter intracellular signalling pathways and activate oncogenic pathway in normal and immortalized ovarian surface epithelial cells because FSHR plays a crititcal role in the early phase of ovarian cancer development (Syed et al., 2001; Wang et al., 2003a). Thus, in the present study, we investigated 1) the expression of FSHR at the mRNA and protein levels in pre-neoplastic IOSE and two ovarian carcinoma cell lines, OVCAR-3 and SKOV-3. These ovarian cancer cell lines are highly malignant and invasive in vivo, but OVCAR-3 cells adhere and form tightly cohesive epithelial colonies in culture, whereas SKOV-3 cells display a spindle-shaped dispersed phenotype (Zand et a l , 2003), 2) the activation of oncogenic pathways and mitogen-activated protein kinases (MAPKs) in FSHR-overexpressing IOSE cells, and 3) the proliferative rate of FSHR-overexpressing IOSE cells. 2.2 Materials and methods Cell transfections The expression vector of human FSHR (pcDNAHFSHR) was generously provided by Dr. T. Minegishi (Gumma Medical School, Gumma, Japan). The cDNA coding for the full human FSH receptor was cloned into the EcoRI site of the pcDNA 3.1 (Invitrogen Life Tech., San Diego, CA) expression vector. The stable transfection was performed in ' A version of this chapter has been published. Choi JH, Choi K - C , Auersperg N , Leung P C K 2004 Overexpression of follicle-stimulating hormone receptor activates oncogenic pathways in preneoplastic ovarian surface epithelial cells. J Clin Endocrinol Metab, 89(11), 5508-5516 69 the IOSE-80PC (passage 50-57) and the IOSE-398 (passage 13-18) cell line. One or two ug of the constructed plasmid pcDNAHFSHR was transfected into IOSE-80PC and IOSE-398 cells by FuGENE 6 (Roche Applied Science, Laval, QC) according to the manufacturer's suggested protocol when the cells were around 50 % confluent on 6-well plates. The transfected cells were grown in a selection medium including G418 (Invitrogen Life Tech., 200 ug/ml) and changed every 3 days for 3 weeks to obtain G418-resistant individual colonies (Auersperg et al., 1999). Cell culture Normal human OSE cells were scraped from the ovarian surface during laparoscopies from pre-menopausal women (n=3) for non-malignant disorders and cultured as previously described (Kruk et al., 1990). The use of these tissues was approved by the committee for Ethical Review of Research on the use of human subjects, University of British Columbia. A l l women provided informed written consent. The non-tumorigenic SV40 Tag-immortalized OSE-derived lines, IOSE-80PC (a post-crisis line) and IOSE-398, were cultured as previously described (Choi et al., 2001c) in medium 199:MCDB 105 (Sigma-Aldrich Corp., St. Louis, MO) containing 10% fetal bovine serum (FBS; Hyclone Laboratories Ltd., Logan, UT), 100 U/ml penicillin G and 100 ug/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5% C 0 2 - 9 5 % air and passaged with 0.06 % trypsin (1:250)/0.01 % EDTA in M g 2 + / C a 2 + - free Hanks balanced salt solution (HBSS) when confluent . For monolayer culture, the cell lines were maintained on tissue culture dishes (Falcon; Becton Dickinson, Franklin Lakes, NJ). The IOSE-80PC cell line was generously provided by Dr. A . Godwin (Fox Chase Cancer Center, Philadelphia, PA). The OVCAR-3 and SKOV-3 cells, ovarian adenocarcinoma cancer cell lines, were purchased from the American Type Tissue Collection (ATCC, Manassas, V A ) . RNA extraction, RT-PCR procedure and Southern blot analysis Total R N A was prepared from cultured cells using the RNaid kit (Bio/Can Scientific, Mississauga, Canada) according to the manufacturer's suggested procedure. R N A integrity was confirmed by using agarose gel electrophoresis and ethidium bromide 70 staining. The total R N A concentration was determined by spectrophotometric analysis at A260/280- Complementary D N A (cDNA) was synthesized from 2.5g total R N A by reverse transcription (RT) at 37 C for 2 h using a first strand cDNA synthesis kit (Amersham Pharmacia Biotech., Oakville, ON). The synthesized cDNA was used as a template for polymerase chain reaction (PCR) amplification. A semi-quantitative PCR amplification was carried out with denaturing for 1 min at 94 C, annealing for 60 sec at 55 C, extension for 90 sec at 72 C, and a final extension for 15 min at 72 C using a thermal cycler (DNA Thermal Cycler, Perkin-Elmer, Norwalk, CT). The primers were designed to amplify FSHR mRNA based on the published sequences of human FSHR (Zheng et al., 1996). In addition, amplification of human glyceraldehyde phosphate dehydrogenase (GAPDH) was performed using specific primers (Tokunaga et al., 1987) to rule out the possibility of R N A degradation, and was used to control the variation in mRNA amount in PCR reaction. The primers of FSHR are composed of sense, 5 ' - G A G A G C A A G G T G A C A G A G A T TCC-3 (exon 1, nucleotides 97 to 120), and antisense, 5'-CCTTT T G G A G A G A A T G A A T C TT-3' (exon 5, nucleotide 439 to 417). The sequences of G A P D H amplification are sense, 5'-ATGTT C G T C A TGGGT G T G A A C C A - 3 ' and antisense, 5'-T G G C A GGTTT TTCTA G A C G G CAG-3 ' . The PCR reactions were performed in 25 DI PCR mixture containing 1 X PCR buffer, 0.2 m M each dNTP, 1.6 m M M g C l 2 , 50 pmol specific primers, lu l cDNA template, and 0.25 unit Taq polymerase. Twelve ul PCR products were analyzed by agarose (1%) gel electrophoresis and visualized by ethidium bromide staining; the sizes were estimated by comparison to D N A molecular weight markers. Following electrophoresis, Southern blot analysis was performed to detect a specific signal with digoxigenin-labeled probes for FSHR or G A P D H as previously described (Choi et al., 2001c; Kang et al., 2000b). In addition, the PCR products isolated from gel were cloned into pCRII vector using the T A Cloning Kit (Invitrogen, San Diego, CA) and were sequenced by the dideoxy nucleotide chain termination method using the T7 D N A polymerase sequencing kit (Amersham Pharmacia Biotech.). Antibodies The antibody of FSHR was kindly provided by Dr. J. A . Dias (Wadsworth Center, David Axelrod Institute for Public health, Albany, NY) . The antibodies of epithelial 71 growth factor receptor (EGFR), c-Myc, K-Ras, HER-2/neu and the phosphorylated Jun-N-terminal kinase (p-JNK) were purchased from Santa Cruz Biotechnology Ltd. (Santa Cruz, CA). The antibodies of pan- and phosphorylated p38 mitogen-activated protein kinase (p-p38), and pan- and phosphorylated extracellular signal-regulated kinase (ERK 1/2) and pan-JNK were purchased from Biosource International, Inc. (Camarillo, CA). Immunoblot assay The cells were seeded at a density of 2 x 105 cells in 35 mm culture dishes and cultured in a humidified atmosphere of 5% C02-95% air at 37 C. The cells were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed in ice-cold RIPA buffer (150 mM NaCl, 1% Nondiet P-40, 0.5% deoxycholate, 0.1% SDS, 50 m M Tris (pH, 7.5), and 1 mM PMSF, 10 g/ml leupeptin, 100 g/ml aprotinin). The extracts were placed on ice for 15 min and centrifuged to remove cellular debris. Protein amount of supernatants was determined using a Bradford assay (Bio-Rad Laboratories). Thirty ug of total protein was run on 10% SDS-PAGE gels and electrotransferred to a nitrocellulose membrane (Amersham Pharmacia Biotech). The membrane was immunoblotted using specific primary antibodies at 4°C overnight. After washing, the signals were detected with horseradish peroxidase-conjugated secondary antibody for 1 h, and visualized using the E C L chemiluminescent system (Amersham Pharmacia Biotech). Quantitation of the immunoblots was performed on Scion Image 4.0.2. Briefly, intensities of interested protein bands were scanned and quantified by density plot (Choi et al., 2002a). In vitro growth assay The non-transfected, control vector-transfected, and FSHR-transfected IOSE-80PC cells were plated in medium 199:MCDB 105 containing 10% fetal bovine serum , 100 U/ml penicillin G and 100 ug/ml streptomycin in a humidified atmosphere of 5 % C O 2 -95 % air in 24-well plates at a concentration of 1 X 105 cells/ml, maintained in logarithmic growth by passaging them every 2-3 days (d), and incubated for 1, 2, 4, and 6 days. The cells were washed in PBS and passed through a 22-gauge needle to generate a single cell suspension. Cell numbers were counted by the trypan blue exclusion method. 72 [ H]thymidine incorporation assay [ HJthymidine incorporation assay was performed to analyze the effect of FSH on proliferative index in non-transfected and FSHR-transfected IOSE cell lines (Choi et al., 2001c; Choi et al., 2002a). The cells were plated in 24-well plates at 2 x 104 cells/well in 0.5 ml medium 199:MCDB105 supplemented with 10 % FBS and antibiotics, and incubated for 48 h. Human recombinant FSH was purchased from National Hormone and Pituitary Program (Harbor-University of California-Los Angeles Medical Center, Torrance, CA), and epithelial growth factor (EGF) was obtained from Sigma-Aldrich Corp. Before treatment with FSH and EGF, the cells were starved in serum-free media for 4 h. After starvation, the cells were incubated with 100 ng/ml of FSH and/or 10 nM EGF in serum-free media for 24 h. One (j.Ci[3H]thymidine (5.0 Ci/mmol; Amersham Pharmacia Biotech.) was added 4 h before the cells were harvested. At the end of the incubation period, the culture medium was removed and cells were washed three times with PBS, followed by precipitation with 0.5 ml 10 % trichloroacetic acid for 20 min at 4 C. The precipitate was washed in methanol twice and solubilized in 0.5 ml 0.1 N sodium hydroxide, and the incorporated radioactivity was measured in the Tri-Carb Liquid Scintillation Analyzer (Model 2100TR; Packard Instrument Com., Meriden, CT) as previously described (Kang et al., 2000b). Data analysis Data are shown as the means of three individual experiments with triplicate, and are presented as the mean ± SD. In the trypan blue and thymidine incorporation assays, the values are expressed as the percentage of growth compared with a control and are the mean ± SD of three individual experiments with triplicate. Data were analyzed by one-way A N O V A followed by Tukey's multiple comparison test or Dunnett's test. PO.05 was considered statistically significant. 2.3 Results Stable transfection in IOSE cells To generate the stable cell lines of FSHR overexpression, IOSE-398 and IOSE-80PC cells were transfected with FSHR expression vector (pcDNAHFSHR) containing 73 G418-resistance. Consequently, stable cell lines which survived in the G418 containing media were selected for further characterization. The mRNA expression of FSHR in transfectants was investigated by RT-PCR and Southern blot analysis. A predicted PCR product of FSHR was obtained as 369-bp and confirmed by Southern blot analysis using DIG-labeled FSHR probe (Figure 2.1 A). Human granulosa luteal cells (hGLCs) and immortalized granulosa cells (SVOG-4o) were used for a positive control to express FSHR (Lie et al., 1996). As seen in Figure 2.1 A , the IOSE-80PC and IOSE-398 transfected with FSHR cDNA expression vector (80PCF and 398F, respectively) showed a high level of FSHR mRNA when compared to vector-transfected IOSE-80PC or IOSE-398 cells. Human granulosa-luteal cells (hGLCs) constitutively expressed FSHR mRNA as well. In parallel with FSHR mRNA level, expression level of FSHR protein was further examined by immunoblot analysis. The expression of FSHR protein was significantly enhanced in 80PCF compared to non-transfected cells (Figure 2.1 B). Subsequently, further experiments were then performed using non-transfected IOSE-80PC (80PC), control vector-transfected IOSE-80PC (80PCV) and FSH-overexpressing IOSE-80PC (80PCF). Expression of FSHR in the transfectants and ovarian cancer cell lines To verify the expression levels of FSHR protein in non-transfected, FSHR-transfected IOSE, and ovarian cancer cell lines, immunoblot analysis was performed in 80PC, 80PCV, 80PCF and ovarian cancer cell lines, OVCAR-3 and SKOV-3 cells. As seen in Figure 2.1 C, low levels of FSHR protein were demonstrated in non-transfected 80PC and vector-transfected 80PCV cell lines. It is of interest that the FSHR protein was highly expressed up to 7-fold increase in 80PCF and OVCAR-3 , but not in SKOV-3 cells. The high level of FSHR protein was also observed in another human ovarian adenocarcinoma cell line, CaOV-3 cells (Data not shown). Expression of potential oncogenes in FSHR overexpressing 80PCF To investigate whether oncogenes that play a critical role in tumor formation and progression of ovarian cancer, are regulated by overexpression of FSHR, we determined the expression levels of oncogenes including EGFR, HER-2/neu, c-Myc and K-Ras in the 74 non-transfected, vector-transfected, FSHR-transfected IOSE cell lines and two ovarian carcinoma cell lines, OVCAR-3 and SKOV-3, as a positive control. The expression levels of EGF-R, c-Myc and HER-2/neu proteins were up-regulated by overexpression of FSHR in 80PCF cells (Figure 2.2). In addition, the oncogenes including EGFR, K-Ras, and HER-2/neu were significantly over-expressed in OVCAR-3 and SKOV-3 cell lines. The OVCAR-3 cells expressed a high level of c-Myc, but the expression level of c-Myc is significantly lower in the SKOV-3 cell line. In contrast, no significant increased expression level of K-Ras protein was observed following FSHR overexpression. Therefore, overexpression of FSHR in preneoplastic IOSE-80PC enhanced EGFR, HER-2/neu and c-Myc proteins, which may be related with neoplastic transformation of ovarian surface epithelium. Regulation of MAPKs in FSHR overexpressing 80PCF To examine the effects of FSHR overexpression on M A P K phosphorylation in non-transfected and FSHR-transfected IOSE cell lines, we performed immunoblot analysis with specific antibodies which can detect total JNK, p38 and ERK1/2 and their phosphorylated forms. No significant difference was detected in the expression levels of phosphorylated p38 (p-p38) and JNK (p-JNK) in 80PC, 80PCV and 80PCF cell lines. Interestingly, phosphorylation of ERK1/2 was enhanced in the FSHR overexpressing 80PCF cell line, and in two adenocarcinoma cell lines, OVCAR-3 and SKOV-3 compared to non-transfected 80PC and vector-transfected 80PCV cells (Figure 2.3). These results suggest that overexpression of FSHR in IOSE-80PC cells may activate ERK1/2, which plays an important role in proliferation and is regulated by external stimuli such as hormones and growth factors in ovarian cancer (Choi et al., 2002a). Growth stimulation following FSHR overexpression To investigate the role of FSHR in 80PCF, the doubling time of 80PCF cells was determined by trypan blue exclusion assay. The same number (1 X 105 cells/ml) of non-transfected, vector-transfected and FSHR-transfected IOSE-80PC cells were seeded, and the cell numbers were counted after growth for 1, 2, 4, and 6 day. Significant growth stimulation was observed from 2 days in FSHR overexpressing 80PCF compared to 80PC 75 and 80PCV cells as seen in Figure 2.4. The stimulatory effect in FSHR-overexpressing 80PCF was also observed in [3H] thymidine incorporation assay (Figure 2.5). These results indicate that FSHR-overexpressing 80PCF proliferated up to two-fold more rapidly compared to 80PC and 80PCV cell lines. Effects of FSH and EGF in FSHR over expressing 80PCF To evaluate the effects of FSH and EGF in FSHR overexpressing 80PCF and 80PCV cells, the cells were treated with FSH (100 ng/ml) in the presence or absence of EGF (10 nM) for 48 h. The dose and time of FSH treatment (100 ng/ml for 48 h) were selected based on our previous study (Choi et al., 2002a), and [3H]thymidine incorporation assay was performed. Treatment with FSH did not result in a significant increase in the thymidine uptake in 80PCV, whereas it induced a considerable increase in D N A synthesis in 80PCF cells (Figure 2.5). The EGF treatment alone resulted in significant growth stimulation in both 80PCV and 80PCF cells, but it appears that the effect of EGF on the stimulation of cell growth is much higher in 80PCF when compared to 80PCV cells. It is of interest that treatment with FSH plus EGF potentiated EGF-induced cell proliferation in both 80PCV and 80PCF cells as seen in Figure 2.5. 2.4 Discussion In addition to its well-documented functions in ovarian physiology, FSH, one of the pituitary glycoprotein hormones, has been suggested to play a role in ovarian cancer development. An increased occurrence of ovarian cancer with exposure to high levels of gonadotropins during postmenopause or infertility therapy has been suggested by epidemiological studies (Risch, 1998b; Shushan et al., 1996; Whittemore et al., 1992). Despite an involvement of FSH in ovarian tumorigenesis (Konishi et al., 1999; Zheng et al., 2000), limited information such as mRNA levels is available regarding the expression of FSHR in normal and neoplastic OSE cells (Lu et al., 2000; Minegishi et al., 2000; Parrott et al., 2001; Zheng et al., 2000). Recent results indicate that the levels of FSHR increased from presumed precursor lesions, OEIs (ovarian epithelial inclusions) to benign OETs (ovarian epithelial tumors) and to borderline OETs, while its levels decreased from borderline ovarian tumors to ovarian carcinomas (Wang et al., 2003a). Although it is 76 currently unclear whether OETs develop from OSE and/or OEI to cystadenomas, borderline tumors and carcinomas, these results suggest that not only serum FSH but also FSHR in ovarian epithelium may play a significant role in ovarian OET development. In this regard, it is important to confirm the protein expression level of FSHR in normal and neoplastic ovarian epithelium cells and to discern particular molecular changes following the binding of FSH to its receptor. To understand the role of FSHR and its overexpression in ovarian cancer, we evaluated altered signaling pathways following FSHR overexpression in 80PCF transfected with human FSHR cDNA. The FSHR protein was highly expressed in OVCAR-3 compared to IOSE-80PC cells, and scarcely expressed in SKOV-3 cells. The SKOV-3 cells represent a late stage of ovarian carcinogenesis, and a growth of ovarian cancer at the malignant stage becomes gonadotropin-independent. Thus, it is not surprising that the level of FSHR is low in SKOV-3 cells, and it appears that the growth of SKOV-3 cells may be independent on FSH action. The FSHR overexpressing 80PCF cells showed a significantly high level of FSHR mRNA and protein levels, compared to the 80PC and 80PCV cell lines, and the expression levels of FSHR mRNA and protein of 80PCF cells were comparable with those of OVCAR-3 cells. Epithelial ovarian carcinomas, which comprise approximately 90 % of human ovarian cancer, arise in the ovarian surface epithelium (OSE); while the rest originate in granulosa cells or, occasionally, in the stroma or germs cells (Godwin et al., 1993). The OSE is composed of a single layer of flat-to-cuboidal epithelial cells with few distinguishing features. Besides, there are no good animal models which develop ovarian epithelial carcinoma, and it is difficult to isolate and maintain normal human OSE under experimental conditions. Thus, in contrast to neoplasms in other organs where the normal tissue of origin is well defined, the physiology and susceptibility to oncogenic influences of the OSE are poorly understood (Choi et al., 2001c; Wong & Auersperg, 2002). Nevertheless, some recent studies contribute to our understanding of the biology of OSE and of carcinogenesis. The OSE in mature women expresses a combined epithelio-mesenchymal phenotype; epithelial features include keratin, mucin, desmosomes, apical microvilli, and a basal lamina but, like mesenchymal or stromal cells, OSE contains vimentin and N-cadherin and lacks the epithelial differentiation markers CA125 and E-cadherin (Choi et al., 2001c; Wong & Auersperg, 2002). With neoplastic progression, the 77 tendency of OSE to undergo epithelio-mesenchymal conversion diminishes and the cells become increasingly committed to complex epithelial phenotypes which include the appearance of E-cadherin (Maines-Bandiera & Auersperg, 1997; Sundfeldt et al., 1997), the receptor for hepatocyte growth factor (c-met) (Huntsman et al., 1999), and secretory products including mucins (MUC1, MUC2, MUC3, and MUC4) and CA125 (Van Niekerk et al., 1993; Young, 1988). The genetic changes such as augmentation, changed expression, and mutations in a few proto-oncogenes and tumor suppressor genes play a role in the progression of ovarian epithelial cancer. Thus, c-Myc (Tashiro et al., 1992), K -Ras (Enomoto et al., 1991), ERBB2 (Berchuck et al., 1990a), EGFR (Kohler et al., 1989) and cFMS (the receptor for colony-stimulating factor l)(Kacinski et al., 1989a) are frequently amplified in ovarian carcinoma. In the case of tumor suppressor genes, BRCA1/BRCA2 (Greenlee et al., 2000), p53 (Kacinski et al., 1989a), PTEN (Obata et al., 1998), NOEY2 (ARHI) (Yu et al., 1999) are frequently mutated in ovarian cancer. In the present study, we have demonstrated that EGFR, K-Ras, and HER-2/neu, which are overexpressed in ovarian cancer, are highly expressed in two ovarian cancer cell lines, OVCAR-3 and SKOV-3, compared to preneoplastic IOSE cell lines, while c-Myc was highly expressed in OVCAR-3 , but not in SKOV-3 cells. It is of interest that FSHR-overexpressing 80PCF cells showed high levels of EGFR, c-Myc and HER-2/neu. These results suggest that overexpression of FSHR resulted in an increased expression of EGFR, c-Myc and HER-2/neu. The mechanism by which levels of EGFR, c-Myc and HER-2/neu are enhanced through overexpression of FSHR warrants further investigation. M A P K s are a group of serine/threonine kinases that are activated in response to a diverse array of extracellular stimuli, and mediate signal transduction from the cell surface to the nucleus (Cobb & Goldsmith, 1995; Davis, 1994). These M A P K s are divided into three subgroups, which are ERK1/2, JNKs and p38. It is well known that M A P K cascade is activated by two distinct classes of cell surface receptors, receptor tyrosine kinases (RTKs) and G protein-coupled receptors (Cobb & Goldsmith, 1995; Crespo et al., 1994; Kasuya et al., 1994; Ohmichi et al., 1994; van Biesen et al., 1996). The signals transmitted through this cascade lead to activation of a set of molecules that regulate cell growth, division and differentiation. The most extensively studied members of the cascade are the ERK1 (p44 M A P K ) and ERK2 (p42 M A P K ) . In ovarian cancer cells, M A P K s are 78 regulated by cisplatin (Persons et a l , 1999), paclitaxel (Wang et al., 1999), endothelin-1 (Vacca et al., 2000), gonadotropin-releasing hormone (GnRH) (Kimura et al., 1999), and FSH (Choi et al., 2002a) in ovarian cancer cells. Moreover, in a previous study, we have shown that FSH stimulated the activation of M A P K cascade and phosphorylated Elk-1 in human OSE cells, which was responsible for proliferation by FSH (Choi et al., 2002a). In the present study, we observed that the constitutive phosphorylation of ERK1/2 was higher in FSHR-overexpressing 80PCF cells than in 80PC and 80PCV cells, while there was no difference in the expression levels of phosphorylated forms of JNK and p38. Although there is evidence that the MEK-p38 M A P K - C K 2 pathway participates in ovarian epithelial carcinogenesis (Wong et al., 2001), we failed to observe any change of pan- and phospho-p38 level in FSHR-overexpressing 80PCF cells compared to the control. These results suggest that the ERK1/2 pathway is probably a downstream cascade of FSHR-induced signaling pathways, and FSHR accelerates the phosphorylation of ERK1/2, but does not increase the constitutive protein level of ERK1/2. In order to evaluate the contribution of the FSHR to cell growth, we carried out a cell growth assay, and demonstrated that FSHR-overexpressing 80PCF cells showed rapid growth when compared to non-transfected and vector-transfected cell lines. It is known that aberrant oncogene magnification and inappropriate constitutive expression of growth factors and their receptors may lead to uncontrollable growth of transformed cells (Cramer & Welch, 1983). In the present study, treatment with FSH did not result in a significant increase in cell growth of 80PCV, whereas it induced a considerable increase in D N A synthesis of 80PCF cells. Although the expression levels of FSHR mRNA and protein are enhanced in 80PCF cells, the effect of FSHR overexpression on the cell growth is modest. It appears that the effect of EGF on the stimulation of cell growth is much higher in 80PCF when compared to 80PCV cells, indicating that elevated EGFR derived from FSHR overexpression may enhance the effect of EGF on the cell growth of 80PCF. In addition, it is of interest that treatment with FSH plus EGF potentiated EGF-induced cell proliferation in both 80PCV and 80PCF cells. Thus, these results suggest that the mitogenic effect due to FSHR overexpression may be derived from enhanced oncogenic pathways including EGFR, c-Myc, and HER-2/neu. In addition, the activated ERK1/2 pathway is also involved in increased cell proliferation in FSHR-overexpressing 79 80PCF cells. Regarding the effect of FSH in the FSHR overexpressing cell line, 80PCF, treatment with FSH induced a considerable increase in cell growth of 80PCF cells, while it failed to increase the thymidine uptake in 80PCV cells, suggesting that overexpression of FSHR may amplify the role of FSH in cell growth and intracellular signaling pathways via FSHR. The effect of EGF on the stimulation of cell growth is much greater in 80PCF when compared to 80PCV cells, suggesting that this effect of EGF in the cell growth is enhanced through FSHR-induced EGFR amplification. Furthermore, treatment with FSH plus EGF potentiated EGF-induced cell proliferation in both 80PCV and 80PCF cells, indicating that there is cross talk between FSH-FSHR and EGF-EGFR. In conclusion, the overexpression of FSHR increased the expression of EGFR, c-Myc, and HER-2/neu, and activated ERK1/2 M A P K in IOSE cells. In addition, the overexpression of FSHR accelerated cell proliferation in these cells. These results may support a pivotal role of FSHR in ovarian cancer development in terms of neoplastic conversion and growth potential. 80 -80PC 80PCV 80PCF O V S K FSHR Actin 1000 c g • lit £ — Q. O X 0. a> o > 750 500 250 80PC 80PCV 80PCF Figure 2.1 Overexpression of F S H R mRNA and protein in IOSE cell line. Immortalized ovarian surface epithelial cell lines, OSE-80PC (80PC) and IOSE-398 (398), were transfected with FSHR overexpression vector using FuGENE 6 reagent and stable cell lines were produced (80PCF and 398F, respectively). (A) The mRNA expression of FSHR was investigated by RT-PCR and Southern blot analysis. A predicted PCR product of FSHR was obtained as 369-bp and confirmed by Southern blot analysis using DIG-labeled probe and sequence analysis (data not shown). The amplification of G A P D H (373-bp) was performed to rule out the possibility of R N A degradation, and was used to control the variation in mRNA concentration in the PCR reaction. (B) The increased level of FSHR protein was demonstrated in FSHR overexpressing 80PCF cells by Western blot analysis. The human granulosa-luteal cells (hGLCs) and immortalized human granulosa-luteal cells (SVOG-4o) were used as a positive control, a, PO.05 vs. non-transfected control. (C) Expression of FSHR in FSHR-overexpressing cell line. The expression levels of FSHR protein were measured in non-transfected (80PC), vector-transfected (80PCV), FSHR-transfected (80PCF), OVCAR-3 (OV) and SKOV-3 (SK) cells. Data are shown as the means of three individual blots, and are presented as the mean ± SD. a, PO.05 vs. 80PC. 82 Relative EGFR expression (% of 80PC) ro 01 o o o CO o "0 o CO o TJ O < CO o -0 o m o o < H 0) 0) 0 0 Relative cMyc expression (% of 80PC) ->• ro o o o 300 80PC 80PCV 80PCF OV S K 80PC 80PCV 80PCF OV S K Figure 2.2 Effect of overexpressed FSHR on the expression levels of EGFR, HER-2/neu, c-Myc and K-Ras oncogenic pathways. The expression levels of EGFR, c-Myc, K-Ras and HER-2/neu were examined in non-transfected (80PC), vector-transfected (80PCV), FSHR-transfected (80PCF), OVCAR-3 (OV) and SKOV-3 (SK) cells. Data are shown as the means of three individual blots, and are presented as the mean ± SD. a, PO.05 vs. 80PC. 84 A 80PC 80PCV 80PCF O V S K B > 1 O Di ° > o> 300 200 100 ERK1/2 80PC 80PCV 80PCF OV SK Figure 2.3 Effect of overexpressed FSHR on the phosphorylation of p38, J N K and ERK1/2 M A P K pathways. The phosphorylated JNK, p38 and E R K normalized by total JNK, p38 and ERK, respectively, were analyzed in non-transfected (80PC), vector-transfected (80PCV), FSHR-transfected (80PCF), OVCAR-3 (OV) and SKOV-3 (SK) cells (A). The phosphorylation of ERK is shown as the means of three individual experiments, and presented as the mean ± SD. a, P<0.05 vs. 80PC as a control (B). 85 Figure 2.4 Effect of overexpressed FSHR on cell growth. The cell growth pattern was compared in non-transfected (80PC), vector-transfected (80PCV), and FSHR-transfected (80PCF) by trypan blue exclusion method. Data are shown as the means of three individual experiments performed in triplicate, and are presented as the mean ± SD. a, P<0.05 vs. 80PC. 86 EGF - + + - + + FSH - + - + + - + 80PCV 80PCF Figure 2.5 Effect of F S H and E G F in non-transfected 80PCV and FSHR overexpressing 80PCF cells. The cells were treated with FSH (lOOng/ml) and EGF (lOnM) for 48 h, and a [3H]thymidine incorporation assay was performed as described in the Materials and Methods. Data are shown as the means of three individual experiments performed in triplicate, and are presented as the mean ± SD. a, PO.05 vs. untreated control; b, PO.05 vs. EGF-treated only; c, P<0.05 vs. untreated 80PCV. 87 2.5 Bibliography Auersperg, N . , Pan, J., Grove, B.D., Peterson, T., Fisher, J., Maines-Bandiera, S., Somasiri, A . & Roskelley, C D . (1999). Proc Natl Acad Sci USA, 96, 6249-54. Berchuck, A. , Kamel, A. , Whitaker, R., Kerns, B. , Olt, G., Kinney, R., Soper, J.T., Dodge, R., Clarke-Pearson, D.L. & Marks, P. (1990). Cancer Res, 50, 4087-91. Choi, K . C , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P . C (2001). Endocrinology, 142, 2351-60. Choi, K.C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2002). J Clin Endocrinol Metab, 87, 2245-53. Cobb, M . H . & Goldsmith, E.J. (1995). J Biol Chem, 270, 14843-6. Cramer, D.W. & Welch, W.R. (1983). J Natl Cancer Inst, 71, 717-21. Crespo, P., Xu , N . , Simonds, W.F. & Gutkind, J.S. (1994). Nature, 369, 418-20. Davis, R.J. (1994). Trends Biochem Sci, 19, 470-3. Enomoto, T., Weghorst, C M . , Inoue, M . , Tanizawa, O. & Rice, J .M. (1991). Am J Pathol, 139, 777-85. Godwin, A . K . , Testa, J.R. & Hamilton, T.C. (1993). Cancer, 71, 530-6. Greenlee, R.T., Murray, T., Bolden, S. & Wingo, P.A. (2000). CA Cancer J Clin, 50, 7-33. Huntsman, D., Resau, J.H., Klineberg, E. & Auersperg, N . (1999). Am J Pathol, 155, 343-8. Kacinski, B . M . , Carter, D., Kohorn, E.I., Mittal, K. , Bloodgood, R.S., Donahue, J., Kramer, C.A., Fischer, D., Edwards, R. & Chambers, S.K. (1989). Yale J Biol Med, 62, 379-92. Kang, S.K., Choi, K . C , Cheng, K.W., Nathwani, P.S., Auersperg, N . & Leung, P.C. (2000). Endocrinology, 141, 72-80. Kasuya, Y . , Abe, Y . , Hama, H. , Sakurai, T., Asada, S., Masaki, T. & Goto, K. (1994). Biochem Biophys Res Commun, 204, 1325-33. Kimura, A. , Ohmichi, M . , Kurachi, H. , Ikegami, H. , Hayakawa, J., Tasaka, K. , Kanda, Y. , Nishio, Y . , Jikihara, H. , Matsuura, N . & Murata, Y . (1999). Cancer Res, 59, 5133-42. Kohler, M . , Janz, I., Wintzer, H.O., Wagner, E. & Bauknecht, T. (1989). Anticancer Res, 9, 1537-47. Konishi, I., Kuroda, H. & Mandai, M . (1999). Oncology, 57 SuppI 2, 45-8. Kruk, P.A., Maines-Bandiera, S.L. & Auersperg, N . (1990). Lab Invest, 63, 132-6. Lie, B.L. , Leung, E., Leung, P.C. & Auersperg, N . (1996). Mol Cell Endocrinol, 120, 169-76. Lu, J.J., Zheng, Y . , Kang, X . , Yuan, J .M., Lauchlan, S.C, Pike, M.C. & Zheng, W. (2000). Gynecol Oncol, 79, 158-68. Maines-Bandiera, S.L. & Auersperg, N . (1997). Int J Gynecol Pathol, 16, 250-5. Minegishi, T., Kameda, T., Hirakawa, T., Abe, K. , Tano, M . & Ibuki, Y . (2000). Clin Cancer Res, 6, 2764-70. Obata, K. , Morland, S.J., Watson, R.H., Hitchcock, A. , Chenevix-Trench, G., Thomas, E.J. & Campbell, I.G. (1998). Cancer Res, 58, 2095-7. Ohmichi, M . , Sawada, T., Kanda, Y . , Koike, K. , Hirota, K. , Miyake, A . & Saltiel, A.R. (1994). J Biol Chem, 269, 3783-8. Osterholzer, H.O., Streibel, E.J. & Nicosia, S.V. (1985). Biol Reprod, 33, 247-58. 88 Parrott, J.A., Doraiswamy, V. , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Persons, D.L., Yazlovitskaya, E .M. , Cui, W. & Pelling, J.C. (1999). Clin Cancer Res, 5, 1007-14. Risch, H.A. (1998). J Natl Cancer Inst, 90, 1774-86. Shushan, A. , Paltiel, O., Iscovich, J., Elchalal, U . , Peretz, T. & Schenker, J.G. (1996). Fertil Steril, 65, 13-8. Sundfeldt, K. , Piontkewitz, Y . , Ivarsson, K. , Nilsson, O., Hellberg, P., Brannstrom, M . , Janson, P.O., Enerback, S. & Hedin, L . (1997). Int J Cancer, 74, 275-80. Syed, V. , Ulinski, G., Mok, S.C, Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Tashiro, H. , Miyazaki, K. , Okamura, H. , Iwai, A . & Fukumoto, M . (1992). Int J Cancer, 50, 828-33. Tokunaga, K. , Nakamura, Y . , Sakata, K. , Fujimori, K. , Ohkubo, M . , Sawada, K. & Sakiyama, S. (1987). Cancer Res, 47, 5616-9. Vacca, F., Bagnato, A. , Catt, K.J . & Tecce, R. (2000). Cancer Res, 60, 5310-5317. van Biesen, T., Luttrell, L . M . , Hawes, B.E. & Lefkowitz, R.J. (1996). Endocr Rev, 17, 698-714. Van Niekerk, C.C., Ramaekers, F . C , Hanselaar, A .G . , Aldeweireldt, J. & Poels, L .G. (1993). Am J Pathol, 142, 157-77. Wang, J., Lin, L. , Parkash, V. , Schwartz, P.E., Lauchlan, S.C. & Zheng, W. (2003). Int J Cancer, 103, 328-34. Wang, T.H., Popp, D .M. , Wang, H.S., Saitoh, M . , Mural, J.G., Henley, D . C , Ichijo, H. & Wimalasena, J. (1999). J Biol Chem, 274, 8208-16. Whittemore, A.S., Harris, R. & Itnyre, J. (1992). Am J Epidemiol, 136, 1184-203. Wimalasena, J., Dostal, R. & Meehan, D. (1992). Gynecol Oncol, 46, 345-50. Wong, A.S. & Auersperg, N . (2002). Cancer Treat Res, 107, 161-83. Wong, A.S., Kim, S.O., Leung, P . C , Auersperg, N . & Pelech, S.L. (2001). Gynecol Oncol, 82, 305-11. Young, R.H., Clement, P.B., Scully, R.E. The ovary In. Raven Press: New York. Yu, Y . , Xu , F., Peng, H. , Fang, X . , Zhao, S., L i , Y . , Cuevas, B. , Kuo, W.L., Gray, J.W., Siciliano, M . , Mills, G.B. & Bast, R . C , Jr. (1999). Proc Natl Acad Sci USA, 96, 214-9. Zand, L. , Qiang, F., Roskelley, C D . , Leung, P.C. & Auersperg, N . (2003). In Vitro Cell DevBiolAnim, 39, 178-182. Zheng, W., Lu, J.J., Luo, F., Zheng, Y . , Feng, Y . , Felix, J .C , Lauchlan, S.C. & Pike, M.C. (2000). Gynecol Oncol, 76, 80-8. Zheng, W., Magid, M.S., Kramer, E.E. & Chen, Y.T. (1996). Am J Pathol, 148,47-53. 89 CHAPTER III. Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells2 3.1 Introduction The epidermal growth factor receptor (EGFR) is a single-transmembrane tyrosine kinase receptor and plays an important role in cell proliferation, differentiation, motility and survival (Zwick et al., 1999) . Over the last 20 years, it has been demonstrated that numerous cancer types express elevated levels of EGFR and its ligands including EGF and transforming growth factor (TGF) (Nicholson et al., 2001; Salomon et al., 1995a). In many cases, an aberrant EGFR activation mediated primarily through changes in gene expression and autocrine stimulation seems to be an essential factor in tumor development, as well as an important driving force for the uncontrolled growth behavior of cancer cells (Salomon et al., 1995b). High level of EGFR expression in multiple tumor types is therefore related to an increased probability of tumor recurrence and poor patient survival. The presence of EGFR in ovarian cancer has been well demonstrated using various methods such as ligand binding, immunohistochemistry, or Northern blot analysis (Battaglia et al., 1989; Bauknecht et al., 1993; Bauknecht et al., 1988; Berchuck et al., 1991; Henzen-Logmans et al., 1992; Morishige et al., 1991; Owens et al., 1991). EGFR is also frequently amplified and/or overexpressed when compared to normal OSE, and transfection with antisense construct of EGFR into human ovarian cancer cell line suppressed the malignant phenotype, cellular proliferation and tumorigenicity of these cells, suggesting its prognostic importance (Alper et al., 2000; Berns et al., 1992; Brader et al., 1998). Furthermore, the contribution of a TGF/EGF receptor autocrine loop to the growth of epithelial ovarian cancer cells is confirmed by several reports. Post-menopausal women showing the peak incidence rate of ovarian cancer exhibit elevated TGFa level in the normal ovary (Owens & Leake, 1992; Owens et al., 1991). EGF-related ligand, TGFa stimulates proliferation of ovarian cancer cells in vivo and in vitro, and its neutralizing 2 A version of this chapter has been published. Choi JH, Choi K C , Auersperg N , and Leung P C K 2005 Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells. Endocr Relat Cancer. 12(2):407-21 90 antibody inhibits the growth (Jindal et al., 1994; Morishige et al., 1991; Stromberg et al., 1992). Elevated co-expression of EGFR and its ligand may, therefore, initiate growth stimulatory autocrine and/or paracrine loops in ovarian carcinomas, and play an important role in tumorigenesis and cancer progression. Considering that gonadotropins might promote the growth of OSE and/or ovarian cancer cells by regulating the levels of growth factor receptors, we sought to investigate the effect of gonadotropins on the expression of EGFR. Thus, the present study was designed to evaluate 1) the effect of gonadotropins on EGFR expression levels in immortalized OSE (IOSE) and ovarian cancer cell lines, 2) additive proliferative effect of gonadotropins and EGF and 3) the mechanisms of gonadotropin-induced actions in the regulation of EGFR system. 3.2 Materials and methods Materials Human L H and recombinant FSH were provided from Dr. A . F. Parlow (National Hormone and Pituitary Program, Harbor-University of California Los Angels Medical Center, Torrance, CA). PD98059 [2-(2-amino-3-mathoxyphenyl)-4H-l-benzopyran-4-one], a MAPK7ERK kinase(MEK) inhibitor, and LY294002 [2-(4-Morpholinyl)-8-phenyl-l(4H)-benzopyran-4-one hydrochloride], a specific cell permeable phosphatidy-linositol 3-kinase inhibitor, were purchased from New England Biolas, Inc. (Beverly, MA) , and Sigma-Aldrich Corp. (St. Louis, MO), respectively. Cell culture The non-tumorigenic SV40 Tag-immortalized OSE-derived lines, IOSE-80 and IOSE-80PC, a post-crisis line, were cultured as previously described (Choi et al., 2001c) in medium 199:MCDB 105 (Sigma-Aldrich Corp., St. Louis, MO) containing 10 % fetal bovine serum (FBS; Hyclone Laboratories Ltd., Logan, UT), 100 U/ml penicillin G and lOug/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5 % C0 2-95 % air and passaged with 0.06 % trypsin (1:250)/0.01 % EDTA in M g 2 + / C a 2 + - free HBSS when confluent . For monolayer culture, the cell lines were maintained on tissue culture dishes (Falcon; Becton Dickinson, Franklin Lakes, NJ). IOSE-80PC, a post-crisis line, was generously provided by Dr. A . Godwin (Fox Chase 91 Cancer Center, Philadelphia, PA). The OVCAR-3 and SKOV-3 cells, ovarian adenocarcinoma cancer cell lines, were purchased from American Type Tissue Collection (ATCC, Manassas, V A ) and cultured in above-mentioned culture conditions and used for the following experiments (Choi et al., 2001b). RNA extraction, RT-PCR procedure and Southern blot analysis The cells were seeded at a density of 2 x 105 cells in 35 mm culture dishes and cultured in a humidified atmosphere of 5 % C02-95 % air at 37 C. Following 4 h serum starvation, the cells were treated with FSH (10"7 g/ml) and L H (10"7g/ml) for 24h with/without 20mins pretreatment of LY294002 (lOuM) and PD98059 (10 uM). Total R N A was prepared from cultured cells using the RNaid kit (Bio/Can Scientific, Mississauga, Canada) according to the manufacturer's suggested procedure. R N A integrity was confirmed by using agarose gel electrophoresis and ethidium bromide staining. The total R N A concentration was determined from spectrophotometric analysis at A260/280-Complementary D N A (cDNA) was synthesized from 2.5 ug total R N A by reverse transcription (RT) at 37 C for 2 h using a first strand cDNA synthesis kit (Amersham Pharmacia Biotech., Oakville, ON). The synthesized cDNA was used as a template for polymerase chain reaction (PCR) amplification. A semi-quantitative PCR amplification was carried out with denaturing for 1 min at 94 C, annealing for 60 sec at 57 C, extension for 90 sec at 70 C, and a final extension for 15 min at 72 C using a thermal cycler (DNA Thermal Cycler, Perkin-Elmer, Norwalk, CT). The primers were designed to amplify EGFR mRNA based on the published sequences of human EGF (Ullrich et al., 1984). In addition, amplification of human glyceraldehyde phosphate dehydrogenase (GAPDH) was performed using specific primers (Tokunaga et al., 1987) to rule out the possibility of R N A degradation, and was used to control the variation in mRNA amount in PCR reaction. The primers of EGFR are composed of sense, 5'-TGTTT G G G A C CTCCG GTCAG-3 ' , and antisense, 5 ' -GGCAG GTCTT G A C G C AGTGG-3 ' . The sequences of G A P D H amplification are sense, 5'-ATGTT C G T C A TGGGT G T G A A C C A - 3 ' and antisense, 5'-TGGCA GGTTT TTCTA G A C G G C A G - 3 ' . The PCR reactions were performed in 25ul PCR mixture containing 1 X PCR buffer, 0.2 m M each dNTP, 1.6 mM MgCb, 50 pmol specific primers, each cDNA template, and 0.25 unit Tag polymerase. 92 Twelve ul of PCR products was analyzed by agarose (1 %) gel electrophoresis and visualized by ethidium bromide staining, and the sizes were estimated by comparison to D N A molecular weight markers. Following electrophoresis, Southern blot analysis was performed to detect a specific signal with digoxigenine-labeled probes for EGFR or G A P D H as previously described (Choi et al., 2001c; Kang et al., 2000b). Antibodies The antibodies of EGFR and pan- and phosphorylated extracellular signal-regulated kinase (ERK1/2), were purchased from Santa Cruz Biotechnology Ltd. (Santa Cruz, CA) and Biosource International, Inc. (Camarillo, CA) , respectively. Phospho-Akt sampler kit including phospho-Akt (ser 473 and thr 308), GSK3 a/p (glycogen synthase kinase-3 a/p), F K H R (Forkhead in rhabdomyosarcoma) and pan-Akt was purchased from Cell Signaling Technology, Inc. (Beverly, M A ) Immunoblot assay The cells were seeded at a density of 2 x 105 cells in 35 mm culture dishes and cultured in a humidified atmosphere of 5 % CCV95 % air at 37 C. The cells were washed once with medium, and serum starved for 4 h prior to treatments with FSH and L H in a time (24 and 48 h) and/or dose dependent manner (10"7 and 10"6 g/ml). The cells were washed twice with ice-cold PBS and lysed in ice-cold RIPA buffer (150 m M NaCl, 1 % Nonidet P-40, 0.5 % deoxycholate, 0.1 % SDS, 50 mM Tris (pH, 7.5), and 1 mM PMSF, lOug/ml leupeptin, lOOug/ml aprotinin). The extracts were placed on ice for 15 min and centrifuged to remove cellular debris. Protein amount of supernatants was determined using a Bradford assay (Bio-Rad Laboratories). Thirty p,g of total protein was run on 10 % SDS-PAGE gels and electrotransferred to a nitrocellulose membrane (Amersham Pharmacia Biotech.). The membrane was immunoblotted using specific primary antibodies at 4°C overnight. After washing, the signals were detected with horseradish peroxidase-conjugated secondary antibody for 1 h, and visualized using the E C L chemiluminescent system (Amersham Pharmacia Biotech.). Quantitation of the Western blots was performed on Scion Image 4.0.2 software. Briefly, intensities of interested protein bands were scanned and quantified by density plot (Choi et al., 2002a). 93 [ H]thymidine incorporation assay [3H]thymidine incorporation assay was performed to analyze the additive proliferative effect of EGF and gonadotropins in IOSE-80PC cell line (Choi et al., 2001c; Choi et al., 2002a). The cells were plated in 24-well plates at 2 x 104 cells/well in 0.5 ml medium 199:MCDB105 supplemented with 10 % FBS and antibiotics, and incubated for 24 h. Before treatment with gonadotropins and EGF, the cells were starved in serum-free media for 4 h. After starvation, the cells were incubated with 100 and 1000 ng/ml of FSH and L H , and/or 10 nM EGF in serum-free media for 3 d and 6 d. One •Ci[ 3H]thymidine (5.0 Ci/mmol; Amersham Pharmacia Biotech.) was added before 4 h of harvesting the cells. At the end of the incubation period, the culture medium was removed and cells were washed three times with PBS, followed by precipitation with 0.5 ml 10 % trichloroacetic acid for 20 min at 4 C. The precipitate was washed in methanol twice and solubilized in 0.5 ml 0.1 N sodium hydroxide, and the incorporated radioactivity was measured in the Tri-Carb Liquid Scintillation Analyzer (Model 2100TR; Packard Instrument Com., Meriden, CT) as previously described (Kang et al., 2000b). Transfections and Luciferase assays The 1081-bp (-1100 to -19 bp, oriented to the translation start site as position +1)5' region of the EGFR gene ligated into the HindlU site of the luciferase expression vector pSVOALA5 ' (Hudson et a l , 1989), was provided by Dr. Gordon Gil l (Department of Medicine, University of California-San Diego). The transient transfection was performed in the IOSE-80PC (passage 50-55). One ug of EGFR promoter-luciferease D N A was transfected into IOSE-80PC cells by FuGENE 6 (Roche Applied Science, Laval, QC) according to the manufacturer's suggested protocol when the cells were around 50 % confluent on 6-well plates. To correct for different transfection percentage, the Rous sarcoma virus (RSV)-lacZ plasmid was co-transfected into the cells with EGFR promoter-luciferase construct. After transfection for 24 h, the cells were treated with gonadotropins for 24 h, and extracts prepared with luciferase cell lysis buffer (Promega, Madison, WI). Luciferase activity was measured in the extracts from triplicate samples using the luciferase assay kit (Promega). P-Galactosidase activity was measured using the P-94 galactosidase Enzyme Assay System (Promega) and used to normalized for varying transfection efficiencies. Promoter activity was calculated as luciferase activity/p-galactosidase activity. Transcription stability analysis IOSE-80PC cells were exposed to FSH and L H for 24 h prior to the addition of 5 uM actinomycin-D (Sigma Chemical Co., St Louis, MO) to arrest new R N A synthesis. A set of untreated cultures was also exposed to actinomycin-D to use as a control. Total R N A from transcriptionally arrested cells was isolated at a different time point following 12 h using TRIzol Reagent (Life Sciences Tech.). The levels of EGFR mRNA were determined by RT-PCR as described above. Data analysis Data are shown as the means of two or three individual experiments with triplicate, and are presented as the mean ± SD. In thymidine incorporation assay, values are expressed as the percentage of growth compared with the control value and are the mean + SD of two individual experiments with triplicate. Data were analyzed by one-way A N O V A followed by Tukey's multiple comparison test or Dunnett's test. PO.05 was considered statistically significant. 3.3 Results Expression of EGFR mRNA and protein The mRNA expression of EGFR in IOSE (IOSE-80 and IOSE-80PC) and ovarian cancer cell lines (OVCAR-3 and SKOV-3) was compared by RT-PCR and Southern blot analysis. A predicted PCR product of EGFR was obtained as 348-bp and confirmed by Southern blot analysis using DIG-labeled EGFR probe (Figure 3.1). As seen in Figure 3.1 A , the ovarian cancer cell lines including OVCAR-3 and SKOV-3 showed a higher level of EGFR mRNA compared with IOSE cell lines (IOSE-80 and IOSE-80PC). In parallel with EGFR mRNA level, the expression level of EGFR protein was further examined by immunoblot analysis, the expression of EGFR protein was significantly enhanced in ovarian cancer cell lines compared to IOSE cell lines. Between ovarian 95 cancer cell lines, SKOV-3 with more potential invasive property in our cell culture systems exhibited higher EGFR expression (Figure 3.1 B). IOSE-80PC, a post-crisis cell line originally generated from IOSE-80, showed similar EGFR mRNA and protein expression as IOSE-80 cells. Regulation of EGFR mRNA and protein by FSH and LH To investigate whether EGFR expression is regulated by FSH and L H in IOSE and ovarian cancer cell lines, we determined the expression levels of EGFR mRNA and protein following treatment of these cells with FSH and L H . While no significant up-regulation of EGFR mRNA was observed in SKOV-3 cells, 24 h treatment with FSH and L H resulted in significant up-regulation of EGFR mRNA in IOSE-80PC and OVCAR-3 cells (Figure 3.2). The up-regulation was more substantial in IOSE-80PC cells than in OVCAR-3 cells. Both FSH and L H increased EGFR mRNA in a dose-dependent manner with maximal 5-fold and 9- fold increase at 10"6g/ml, respectively in IOSE-80PC cells, whereas maximum 3-fold increase was observed at 10~6g/nil 0 f L H in OVCAR-3 cells (Figure 3.2 A) . In terms of protein level, 24 or 48 h treatment with FSH and L H also showed more potent effect on EGFR expression in IOSE-80PC than in OVCAR-3 , and the expression pattern is correlated with its mRNA expression (Figure 3.2 B). Also, the elevated levels of EGFR mRNA and protein by FSH and L H were observed in IOSE-80 cells (Data not shown). Subsequently, further experiments were then performed using IOSE-80PC to evaluate the effect of gonadotropins on the expression of EGFR. Additive proliferative effects of gonadotropins and EGF in IOSE-80PC cells To examine the effects of EGFR up-regulation on the growth of IOSE-80PC, the cells were treated with FSH and L H (10"7g/ml) plus EGF (10 nM) for 3 or 6 days, and a [3H] thymidine incorporation assay was performed as previously described (Choi et al., 2002a; Kang et al., 2000b). Treatment with FSH alone induced an approximate 20 % increase in [ HJthymidine incorporation and EGF alone showed 80 % increase of cell growth for 3 days. The combined treatment with FSH plus EGF for 3 days yielded 150 % increase in cell growth of IOSE-80PC cells. It is of interest that L H , which by itself did not show any mitogenic effect by 3-day treatment, further enhanced the growth-96 stimulation caused by the EGF treatment (Figure 3.3, left panel). With 6 days of treatments, both FSH and L H showed a significantly increased stimulation of mitogenesis in the presence of EGF (10 nM) when compared to the treatments with gonadotropins alone (Figure 3.3, right panel). These results suggest that an increased level of EGFR induced by gonadotropins in IOSE-80PC cells may contribute to an enhanced stimulation of cell growth by EGF. Inhibitory effects of LY294002 and PD98059 on gonadotropins induced EGFR up-regulation To determine signaling pathways that contribute to gonadotropin-induced EGFR, we examined the ability of the different pharmacological agents to block the changes in the expression of EGFR mRNA in IOSE-80PC cells. We found that PD98059, a ERK1/2 inhibitor, and LY294002, a PI3K inhibitor, blocked gonadotropin-induced EGFR up-regulation partially (Figure 3.4), while the inhibitors did not affect the basal level of EGFR level (Data not shown). In contrast, neither, H89 (a P K A inhibitor), GF 109203X (a PKC inhibitor) nor SB203580 (a p38 inhibitor), caused a substantial inhibition of EGFR up-regulation by gonadotropins (Data not shown). These results indicate that gonadotropins may increase EGFR expression by activating ERK1/2 and PI3K signaling pathways. Effects of FSH and LH on activation of ERK1/2 and PI3K signaling cascades To further test that ERK1/2 and/or PI3K signaling pathways are activated by gonadotropins, we examined the phosphorylation status of ERK1/2 and A K T and its downstream molecules after treatments of the cells with FSH and L H (10" g/ml) in a time-dependent manner (5-60 min) and dose-dependent manner (10"8, 10"7 and 10"6g/ml) at 15 min. We performed an immunoblot analysis with specific antibodies which can detect phosphorylated forms of E R K 1/2, A K T , GSK3a/p and FHKR, and total ERK1/2 and A K T for normalization. As shown in Figure 3.5 A , treatment.with FSH induced a significant increase in phosphorylated form of E R K 1/2 (p-ERKl/2) at 5 min, and sustained it for 60 min in IOSE-80PC cells. Treatment with L H also resulted in a significant increase in E R K 1/2 activation at 5 min, but the activated E R K 1/2 declined to the control at 60 min. 97 Similarly, FSH and L H induced phosphorylation of A K T at Ser 473 and Thr 308 within 5 min with the decrease of its level at 30 min (Figure 3.5 B). To confirm that increased A K T phosphorylation at Ser 473 and Thr 308 was an indication of increased activity, we measured the phosphorylation of two well-known downstream proteins including GSK3 a/p (glycogen synthase kinase-3 a/p) and F K H R (Forkhead in rhabdomyosarcoma) following same treatments. Parallel increase patterns of phosphorylation of GSK3 a/p and F H K R were observed in Figure 3.5 B following an activation of A K T . FSH- and L H -stimulated A K T , GSK3 and F H K R and E R K activation were completely abolished by pretreatment with PI3K inhibitor LY294002 and PD98059, respectively. In addition, treatment with LY294002 or PD98059 alone resulted in a significant decrease in basal activity of those signaling pathway in 80PC cells. Treatment with these drugs did not result in any cytotoxic effect under the present experimental condition. These results suggest that FSH and L H activate ERK1/2 and PI3K pathways in IOSE-80PC cells, which play may an important role in cell growth, survival and progression in ovarian cancer (Choi et al., 2002a). Effects of FSH and LH on EGFR promoter activity and its mRNA stability We further investigated whether gonadotropin regulation of EGFR is dependent on the gene transcription and/or receptor mRNA stability. To determine whether the EGFR 5'-flanking region plays a role in directing EGFR mRNA expression, the luciferase expression vector p S V O A L A 5 ' inserted with the proximal 1081-bp of the EGFR 5'-flanking regions was transiently transfected into IOSE-80PC cells. The treatment with FSH (10"6 and 10"7g/im) significantly enhanced the activity of 1081-bp of EGFR 5'-flanking region in IOSE-80PC cells (100 % vs. 220 % and 250 %), while the treatment with L H showed relatively less effect on the activity of EGFR (Figure 3.6). To assess the rates of degradation of EGFR mRNA transcripts, we pre-incubated IOSE-80 cells with or without FSH or L H for 24 h. After pre-incubation, 5 uM of actinomycin-D was added to arrest new R N A synthesis. The cells were harvested at 2, 4 and 8 h following an addition of the transcription inhibitor, and the expression level of EGFR mRNA was measured by RT-PCR. As shown in Figure 3.7, in the presence of FSH and L H , the decay curves for EGFR mRNA in IOSE-80PC (80PC) cells showed a 98 significant delayed half-life (5 h and 8 h) compared with control group (4 h). Interestingly, FSH showed stronger activation of EGFR gene than L H , whereas L H seems to be more effective than FSH in terms of EGFR mRNA stability. 3.4 Discussion Although numerous theories have been proposed to explain the etiology of ovarian cancer, the exact pathogenesis of ovarian cancer remains ambiguous. One of the predominant theories is a gonadotropin theory that circulating levels of pituitary gonadotropins increase the risk of malignancy and that pregnancies and oral contraceptives protect by suppressing secretion of these hormones (Gardner, 1961; Stadel, 1975). Based on recent studies, treatments with FSH and LH/hCG seem to result in the growth stimulation in normal, immortalized OSE and some ovarian cancer cells in a dose-and time-dependent manner in vitro (Choi et al., 2002a; Kraemer et al., 2001; Kurbacher et al., 1995; Ohtani et al., 2001; Parrott et al., 2001; Syed et al., 2001; Wimalasena et al., 1992), even though there are controversial reports (Ivarsson et al., 2001; Tourgeman et al., 2002; Venn et al., 1995; Wimalasena et al., 1991). Despite these observations, whether gonadotropins may play a role in normal OSE biology and ovarian tumorigenesis remains to be fully elucidated and the exact mechanism of the response to gonadotropins is not clearly understood. The growth of human ovarian carcinoma has been promoted by elevated levels of gonadotropins through induction of tumor angiogenesis in vivo (Schiffenbauer et al., 1997; Zygmunt et al., 2002), and the level of vascular endothelial growth factor (VEGF) was significantly elevated in both low malignant potential (LMP) and serous ovarian carcinoma (Wang et al., 2002). In addition, gonadotropin-induced stimulation resulted in an increase in the expression of integrin subunit alpha (v) and CD44, the cell surface hyaluronan receptor in M L S human epithelial ovarian carcinoma cells (Schiffenbauer et al., 2002). The treatment of epithelial ovarian cancer with FSH significantly increased the levels of P K C alpha mRNA and protein, suggesting that the stimulation of P K C alpha transcription is involved in the FSH-induced cell proliferation in these cells (Ohtani et al., 2001). In OVCAR-3 cells, gonadotropins stimulate estradiol secretion and modulate steroid dependent growth stimulation (Kraemer et al., 2001). Both FSH and L H stimulate cellular growth of human OSE and ovarian cancer, and interleukin 99 6 (IL-6)/signal transducer and activator of transcription-3 (STAT3) signaling pathway plays a role in FSH-, L H - and estrogen-stimulated immortalized OSE cell proliferation (Sundfeldt et a l , 1997; Syed et al., 2002a). It is of interest that recent studies suggest the interactions between gonadotropins and growth factors, for instance, combined treatment with hCG plus estradiol may regulate the growth response of epithelial ovarian cancer cells through insulin-like growth factor (IGF)-I pathway (Wimalasena et al., 1993). In addition, FSH and hCG stimulated steady state levels of keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), and kit ligand (KL) mRNA in bovine OSE cells, indicating a possible role of gonadotropins to enhance these growth factors (Shoham, 1994). In this regard, we hypothesize that gonadotropins, FSH and L H , may induce neoplastic transformation and cross-talk with growth factors in ovarian epithelial cells and these changes may effect the growth of OSE indirectly. In the present study, we demonstrated that the treatment with FSH and L H significantly increased EGFR mRNA and EGFR protein in the immortalized OSE cell line, IOSE-80PC, while the same treatment resulted in only a mild increase in OVCAR-3 and no change in SKOV-3 cells. Based on this finding and constitutive EGFR expression of these cell lines shown in Figure 3.1, there seem to be a reverse correlation between endogenous EGFR levels of cell lines and their sensitivity of EGFR induction to gonadotropins. Alper et al demonstrated that EGFR overexpression in ovarian cancer cells is dominant (70-100 %) and results in multiple invasive phenotypic changes to augment the invasiveness (Alper et al., 2001). Furthermore, late stage carcinoma generally has strong invasive potential. In this regard, the effect of gonadotropins on EGFR expression appears to be more potent in normal or early stages of cancers which may have low basal EGFR levels. In addition, IOSE-80 cells treated with gonadotropins and EGF (lOnM) exhibited an additive stimulation of mitogenesis as measured by [ HJthymidine incorporation assay. Overexpression of EGFR in ovarian cancer plays an important role in invasion and chemoresistance as well as proliferation (Alper et al., 2001; Liang et al., 2003). Therefore, EGFR up-regulation by gonadotropins implicates the further role of gonadotropins in invasion and chemoresistance. These results suggest that FSH and L H can stimulate EGFR expression in OSE during menopause, and this effect may play a role in the 100 initiation and/or progression of the ovarian cancer because postmenopausal women have high gonadotropin levels in their serum. Our finding of increased EGFR expression in response to FSH and L H is consistent with other previous studies. In bovine OSE cells, Doraiswamy et al. demonstrated two to three fold increases in EGFR mRNA expression after exposure to FSH and L H (Doraiswamy et al., 2000). However, they did not show the alteration of its protein level and the mechanism of action of these hormones. In the hamster ovary, FSH significantly induced EGFR expression in granulosa, theca, and interstitial cells whereas hCG stimulated its expression in theca and interstitial cells not in granulosa cells (Garnett et al., 2002). Fujinaga and coworkers have reported FSH and L H increased EGFR in rat granulosa cells (Fujinaga et al., 1994). In human testis, Foresta and Varotto demonstrated that EGFR protein was highly expressed in the subjects showing high FSH plasma levels and in all of the patients who received exogenous FSH (Foresta & Varotto, 1994). However, the previous studies did not address the mechanism of FSH and L H effects on the EGFR expression. The regulation of EGFR at the level of mRNA decay has been demonstrated in a variety of cancer cell lines (Balmer et al., 2001; Libermann et al., 1985; McCulloch et al., 1998). The observed increase in EGFR mRNA levels by FSH and L H may be the result of increased EGFR gene transcription and/or messenger RNA stability. These hormones seem to have dual effects although the preference was different. FSH mainly increased transcriptional activity from a luciferase reporter construct containing the full-length EGFR promoter in transiently transfected IOSE-80PC cells, whereas L H was found to prolong the half life of EGFR mRNA stability predominantly. However, treatments with gonadotropins did not alter the transactivation of EGFR in transiently transfected SKOV-3 cells with luciferase-EGFR promoter (Data not shown). Because FSH and L H activate ERK1/2 and PI3K signaling pathways in a distinct pattern, we may speculate that the distinct regulation of EGFR in IOSE cells by FSH and L H is at least derived from this divergence of signaling activation as well as activation of gene transcription. Further study in the mechanism is necessary to investigate an exact role of FSH or L H in ovarian cancer cells. The determination of the transcriptional mechanism that regulates EGFR expression in OSE and ovarian cancer may provide important insights into the mechanism that controls a response of ovarian surface epithelium to EGF and/or TGFa through the modulation of its receptor levels. 101 M A P K s are a group of serine/threonine kinases that are activated in response to a diverse array of extracellular stimuli, and mediate signal transduction from the cell surface to the nucleus (Cobb & Goldsmith, 1995; Davis, 1994). The signals transmitted through this cascade lead to activation of a set of molecules that regulate cell growth, division and differentiation. In ovarian cancer cells, M A P K s are regulated by cisplatin (Persons et al., 1999), paclitaxel (Wang et al., 1999), endofhelin-1 (Vacca et al., 2000), gonadotropin-releasing hormone (GnRH) (Kimura et al., 1999), and FSH (Choi et al., 2002a). Moreover, in a previous study, we have shown that FSH stimulated the activation of M A P K cascade and phosphorylated Elk-1 in human OSE cells, which was responsible for proliferation by FSH (Choi et al., 2002a). Phosphoinositide 3-kinase (PI3K) signaling pathway is now accepted as being at least as important as the ras-MAP kinase pathway in cell survival and proliferation, and hence its potential role in cancer is of great interest. In ovarian cancer, it is well known that PI3K signaling pathway plays a role in proliferation, anti-apoptosis, differentiation, tumorigenesis, angiogenesis (Brader & Eccles, 2004; Chang et al., 2003; Vara et al., 2004). PI3K are stimulated by estrogen, 4-hydroxy estradiol, hypoxia, L P A (Lysophosphatidic acid) in ovarian cancer (Gao et al., 2004; Lu et al., 2002; X u et al., 2004). This study is the first report to present the activation of PI3K by gonadotropins in OSE, although there is increasing evidence of potential involvement of the PI3K pathway in gonadotropins signaling in other reproductive tissue such as granulosa, Sertoli cells and oocyte (Alam et al., 2004; Carvalho et al., 2003; Hoshino et al., 2004; Meroni et al., 2004). In the present study, after gonadotropin treatment, IOSE-80PC cells showed Akt and ERK1/2 activation, and LY294002 (a PI3K inhibitor) and PD98059 (an ERK1/2 inhibitor) partially blocked the gonadotropin-induced EGFR up-regulation. These results suggest that the effect of gonadotropins on the EGFR expression is mediated, at least in part, through PI3K and ERK1/2 signaling pathways in these cells. Partial inhibition by the inhibitors may imply that alternative pathway is involved and further study using the combination of inhibitors is necessary. It is of interest that activation of ERK1/2 and PI3K by FSH are maintained in an activated status during 60 min, whereas their activation decreased at this time with L H . We examined the activation of these signaling pathways after longer treatment up to 24 h with FSH or L H (Data not shown). FSH effect lasted more than 2 h while L H effect already has returned to basal level at 60 min. These data 102 suggest that FSH and L H show diverse activation status of E R K and PI3K signaling pathway, and this discrepancy may relate to different mechanism of gonadotropins to increase EGFR mRNA as shown in Figure 3.6 and 3.7. Taken together, gonadotropins may be a contributing factor in ovarian tumorigenesis, presumably by enhancing cell proliferation through EGFR up-regulation. In addition, the effect of gonadotropins on the expression of EGFR may involve cell growth via ERK-1/-2 and PI3K pathways in pre-neoplastic ovarian surface epithelial cells. It appears that FSH and L H increased EGFR mRNA in a distinct manner. The former increased EGFR gene transcription essentially whereas the latter mainly enhanced EGFR mRNA stability. These findings may provide a possible mechanism of action of gonadotropins in part in the progression of ovarian cancers related with growth factor receptors. 103 EGFR GAPDH 1800 c o "Hi lit — b o a <? x m a> w a: o u, — (3 o 1200 600 IOSE-80 IOSE-80PC OVCAR3 SKOV3 B EGFR Actin 350 300 | s 250 11200 O 'S 150 Ul ^ •3 100 i 501 IOSE-80 IOSE- OVCAR3 SKOV 80PC Figure 3.1 Expression of E G F R mRNA and protein in IOSE cell lines (IOSE-80 and IOSE-80PC) and ovarian cancer cell lines (OVCAR3 and SKOV3) . (A) The mRNA expression of EGFR was investigated by RT-PCR and Southern blot analysis. (B) The level of EGFR protein was demonstrated using Western blot analysis. Data are shown as the means of three individual blots, and are presented as the mean ± SD. a, P<0.05 vs. IOSE-80 cells. [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421, 2005] 104 80PC Con FSH1 FSH2 LH1 LH2 O V C A R 3 Con FSH1 FSH2 LH1 LH2 S K O V 3 Con FSH1 FSH2 LH1 LH2 E G F R G A P D H 1200 a. O x £ or 9. u. ° O 01 o*-- 600 Con Con FSH1 FSH2 LH1 LH2 300 250 CO w a> :_ 200 to c a- o " 150 O 6 LU 100 50 Con FSH1 FSH2 LH1 LH2 150 a) -S. o 100 x i o c or ° u. « O o ^ 5 0 Con FSH1 FSH2 LH1 LH2 24h E G F R 24h Actin 80PC Con FSH1 FSH2 LH 1 LH 2 O V C A R 3 Con FSH1 FSH2 LH1 LH 2 SKOV3 Con FSH1 FSH 2 LH1 LH2 48h E G F R 48h Actin 300 240 S ° 1 2 0 I 60 • 24h • 48h I Con FSH1 FSH2 LH1 LH2 £ — 200 a o S l a o 150 g o m ^ 100 > — « 50 i 0 • 24h • 48h i 150 a. o 100 50 • 24h • 48h Con FSH1 FSH2 LH1 LH2 Con FSH1 FSH2 LH1 LH2 Figure 3.2 Effect of F S H and L H on the expression of E G F R m R N A (A) and protein (B). The expression level of EGFR was examined in IOSE-80PC (80PC) after treatment with FSH (If/ 7 and 10~6 g/ml) and L H (10"7 and 10"6 g/ml) for 24 h or 48 h, and RT-PCR and western blot were performed as described in the Materials and Methods. Con; control, FSH1; FSH l(r 7 g/ml, FSH2; FSH 10"6 g/ml, LH1; L H 10"7g/ml; LH2; L H 10"6 g/ml. Data are shown as the means of three individual blots, and are presented as the mean ± SD. a, P<0.05 vs. non-treated cells. [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421,2005] 105 FSH LH 6 days • w/o EGFJ • EGF FSH LH Figure 3.3 Effect of gonadotropins and E G F on the cell growth. The cells were treated with FSH or L H (10"7 g/ml) and EGF (10 nM) for 3 and 6 days, and a [3H]thymidine incorporation assay was performed in IOSE-80PC cells as described in the Materials and Methods. Data are shown as the means of three individual experiments performed in triplicate, and are presented as the mean ± SD. a, P<0.05 vs. untreated control, b, P<0.05 vs. EGF only treated group. [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421,2005] 106 Control FSH FSH+LY FSH+PD EGFR GAPDH Control LH LH+LY LH+PD EGFR GAPDH Figure 3.4 Inhibitory effects of LY294002 and PD98059 on gonadotropins-induced EGFR up-regulation. Following 20 min pretreatments with LY204002 (10 uM) and PD98059 (10 uM), the cells were treated with FSH (10"7 g/ml) and L H (10"7g/ml), and RT-PCR was performed as described in the Materials and Methods. [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421, 2005] 107 A B FSH LH 15 30 60 5 15 30 60 (min.) FSH LH 0 5 15 30 60 5 15 30 60 (min.) p-AKT(308) mm fp** f P-GSK3 p-FHKR T-AKT Figure 3.5 Effect of F S H and L H on the phosphorylation of ERK1/2 and PI3K signaling pathway in IOSE-80PC. Immunoblot analysis was performed in a time dependent manner (5, 15, 30 and 60 min) with FSH and L H (10~7g/ml) and increasing doses of FSH and L H (10"8, 10~7 and 10"6 g/ml) for 15 min. The phosphorylated ERK1/2 was normalized by total E R K (A). The phosphorylated A K T (Thr308 and Ser473), GSK3 and F H K R were normalized by total A K T (B). [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421,2005] 108 300 3 Q U c 0) o M c .E o C v-I ° — > re a or 200 100 Con FSH1 FSH2 LH1 LH2 Figure 3.6 Effect of F S H and L H on the E G F R gene transcription. IOSE-80PC cells were transiently transfected with a luciferase reporter plasmid driven by the full-length human EGFR gene promoter. The cells were exposed to increasing doses of FSH and L H (10 7 and 10"6 g/ml) for 24 h. Con; control, FSH1; FSH 10"7g/ml, FSH2; FSH 10"6 g/ml, LH1; L H 10"7g/ml; LH2; L H 10"6 g/ml. Untreated transfectants were used as a control. Data are shown as the means of three individual experiments performed in triplicate, and are presented as the mean ± SD. a, PO.05 vs. untreated control. [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421, 2005] 109 A B Time(h) Figure 3.7 Effect of F S H and L H on the E G F R mRNA stability in IOSE-80PC cells. IOSE-80PC cells were exposed to 10"7 g/ml FSH (•) or L H ( • ) for 24 h before an addition with actinomycin D (5 uM). Untreated cultures served as a control (•). Total RNA was isolated at the indicated times following the addition with actinomycin D. The level of EGFR was determined by RT-PCR. Data are shown as the means of three individual experiments performed in triplicate, and are presented as the mean ± SD. a, PO.05 vs. untreated control. [©Society for Endocrinology (2005). Reproduced with permission from Choi et al., Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells, Endocrine-related cancer 12:407-421,2005] 110 3.5 Bibliography Alam, H. , Maizels, E.T., Park, Y . , Ghaey, S., Feiger, Z.J., Chandel, N.S. & Hunzicker-Dunn, M . (2004). J Biol Chem, 279, 19431-40. Alper, O., Bergmann-Leitner, E.S., Bennett, T.A., Hacker, N.F., Stromberg, K . & Stetler-Stevenson, W.G. (2001). J Natl Cancer Inst, 93, 1375-84. Alper, O., De Santis, M.L . , Stromberg, K. , Hacker, N.F., Cho-Chung, Y.S . & Salomon, D.S. (2000). Int J Cancer, 88, 566-74. Balmer, L .A . , Beveridge, D.J., Jazayeri, J.A., Thomson, A . M . , Walker, C.E. & Leedman, P.J. (2001). Mol Cell Biol, 21, 2070-84. Battaglia, F., Scambia, G., Benedetti Panici, P., Baiocchi, G., Perrone, L. , Iacobelli, S. & Mancuso, S. (1989). Gynecol Obstet Invest, 27, 42-4. Bauknecht, T., Angel, P., Kohler, M . , Kommoss, F., Birmelin, G., Pfleiderer, A . & Wagner, E. (1993). Cancer, 71,419-29. Bauknecht, T., Runge, M . , Schwall, M . & Pfleiderer, A . (1988). Gynecol Oncol, 29, 147-57. Berchuck, A. , Rodriguez, G.C., Kamel, A. , Dodge, R.K., Soper, J.T., Clarke-Pearson, D.L. & Bast, R.C., Jr. (1991). Am J Obstet Gynecol, 164, 669-74. Beras, E .M. , Klijn, J.G., Henzen-Logmans, S.C, Rodenburg, C.J., van der Burg, M.E . & Foekens, J. A . (1992). Int J Cancer, 52, 218-24. Brader, K.R., Wolf, J.K., Chakrabarty, S. & Price, J.E. (1998). Oncol Rep, 5, 1269-74. Brader, S. & Eccles, S.A. (2004). Tumori, 90, 2-8. Carvalho, C.R., Carvalheira, J.B., Lima, M.H. , Zimmerman, S.F., Caperuto, L . C , Amanso, A. , Gasparetti, A . L . , Meneghetti, V. , Zimmerman, L.F., Velloso, L . A . & Saad, M.J. (2003). Endocrinology, 144, 638-47. Chang, F., Lee, J.T., Navolanic, P.M., Steelman, L.S., Shelton, J.G., Blalock, W.L., Franklin, R.A. & McCubrey, J.A. (2003). Leukemia, 17, 590-603. Choi, K.C. , Kang, S.K., Nathwani, P.S., Cheng, K.W., Auersperg, N . & Leung, P.C. (2001a). Mol Cell Endocrinol, 174, 99-110. Choi, K.C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2001b). Endocrinology, 142,2351-60. Choi, K . C , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2002). J Clin Endocrinol Metab, 87, 2245-53. Cobb, M . H . & Goldsmith, E.J. (1995). J Biol Chem, 270, 14843-6. Davis, R.J. (1994). Trends Biochem Sci, 19,470-3. Doraiswamy, V. , Parrott, J.A. & Skinner, M . K . (2000). Biol Reprod, 63, 789-96. Foresta, C. & Varotto, A. (1994). Fertil Steril, 61, 941-8. Fujinaga, H. , Yamoto, M . , Shikone, T. & Nakano, R. (1994). J Endocrinol, 140, 171-7. Gao, N . , Nester, R.A. & Sarkar, M . A . (2004). Toxicol Appl Pharmacol, 196, 124-35. Gardner, W.U. (1961). J Natl Cancer Inst, 26, 829-53. Garnett, K. , Wang, J. & Roy, S.K. (2002). Biol Reprod, 67, 1593-604. Henzen-Logmans, S .C, Berns, E .M. , Klijn, J.G., van der Burg, M.E . & Foekens, J.A. (1992). Br J Cancer, 66, 1015-21. Hoshino, Y . , Yokoo, M . , Yoshida, N . , Sasada, H. , Matsumoto, H . & Sato, E. (2004). Mol Reprod Dev, 69, 77-86. I l l Hudson, L. , Santon, J. & Gi l l , G. (1989). Mol Endocrinol, 3, 400-408. Ivarsson, K. , Sundfeldt, K. , Brannstrom, M . , Hellberg, P. & Janson, P.O. (2001). Hum Reprod, 16, 18-23. Jindal, S.K., Snoey, D .M. , Lobb, D.K. & Dorrington, J.H. (1994). Gynecol Oncol, 53, 17-23. Kang, S.K., Choi, K . C , Cheng, K.W., Nathwani, P.S., Auersperg, N . & Leung, P.C. (2000). Endocrinology, 141, 72-80. Kimura, A. , Ohmichi, M . , Kurachi, H. , Ikegami, H. , Hayakawa, J., Tasaka, K. , Kanda, Y . , Nishio, Y . , Jikihara, H. , Matsuura, N . & Murata, Y . (1999). Cancer Res, 59, 5133-42. Kraemer, S., Jaeger, W.H. & Lang, N . (2001). Anticancer Res, 21, 2005-10. Kurbacher, C M . , Jager, W., Kurbacher, J.A., Bittl, A. , Wildt, L . & Lang, N . (1995). Tumour Biol, 16, 374-84. Liang, K. , Ang, K . K . , Milas, L. , Hunter, N . & Fan, Z. (2003). IntJRadiat Oncol Biol Phys, 57, 246-54. Libermann, T.A., Nusbaum, H.R., Razon, N . , Kris, R., Lax, I., Soreq, H. , Whittle, N . , Waterfield, M.D. , Ullrich, A . & Schlessinger, J. (1985). Nature, 313, 144-7. Lu, J., Xiao Y j , Y.J . , Baudhuin, L . M . , Hong, G. & Xu, Y . (2002). J Lipid Res, 43, 463-76. McCulloch, R.K., Walker, C.E., Chakera, A. , Jazayeri, J. & Leedman, P.J. (1998). Int J Biochem Cell Biol, 30, 1265-78. Meroni, S.B., Riera, M.F., Pellizzari, E.H., Galardo, M . N . & Cigorraga, S.B. (2004). J Endocrinol, 180, 257-65. Morishige, K. , Kurachi, H. , Amemiya, K. , Fujita, Y . , Yamamoto, T., Miyake, A . & Tanizawa, O. (1991). Cancer Res, 51, 5322-5328. Nicholson, R.L, Gee, J .M. & Harper, M.E . (2001). Eur J Cancer, 37 Suppl 4, S9-15. Ohtani, K. , Sakamoto, H. , Kikuchi, A. , Nakayama, Y . , Idei, T., Igarashi, N . , Matukawa, T. & Satoh, K. (2001). Cancer Lett, 166, 207-13. Owens, O.J. & Leake, R E . (1992). Eur J Obstet Gynecol Reprod Biol, 47, 223-8. Owens, O.J., Stewart, C , Brown, I. & Leake, R.E. (1991). Br J Cancer, 64, 907-10. Parrott, J.A., Doraiswamy, V. , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Persons, D.L., Yazlovitskaya, E .M. , Cui, W. & Pelling, J .C (1999). Clin Cancer Res, 5, 1007-14. Salomon, D.S., Brandt, R., Ciardiello, F. & Normanno, N . (1995a). Crit Rev Oncol Hematol, 19, 183-232. Salomon, D.S., Brandt, R., Ciardiello, F. & Normanno, N . (1995b). Critical Reviews in Oncology/Hematology, 19, 183-232. Schiffenbauer, Y.S. , Abramovitch, R., Meir, G., Nevo, N . , Holzinger, M . , Itin, A. , Keshet, E. & Neeman, M . (1997). Proc Natl Acad Sci USA, 94, 13203-8. Schiffenbauer, Y.S. , Meir, G., Maoz, M . , Even-Ram, S.C, Bar-Shavit, R. & Neeman, M . (2002). Gynecol Oncol, 84, 296-302. Shoham, Z. (1994). Fertil Steril, 62, 433-48. Stadel, B .V. (1975). Am J Obstet Gynecol, 123, 772-4. Stromberg, K. , Collins, T.J.t., Gordon, A.W., Jackson, C.L. & Johnson, G.R. (1992). Cancer Res, 52, 341-7. 112 Sundfeldt, K. , Piontkewitz, Y . , Ivarsson, K. , Nilsson, O., Hellberg, P., Brannstrom, M . , Janson, P.O., Enerback, S. & Hedin, L. (1997). Int J Cancer, 74, 275-80. Syed, V. , Ulinski, G., Mok, S.C. & Ho, S.M. (2002). J Natl Cancer Inst, 94, 617-29. Syed, V. , Ulinski, G., Mok, S.C, Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Tokunaga, K. , Nakamura, Y . , Sakata, K. , Fujimori, K. , Ohkubo, M . , Sawada, K . & Sakiyama, S. (1987). Cancer Res, 47, 5616-9. Tourgeman, D.E., Lu, J.J., Boostanfar, R , Amezcua, C , Felix, J.C. & Paulson, R.J. (2002). Fertil Steril, 78, 1096-9. Ullrich, A. , Coussens, L. , Hayflick, J.S., Dull, T.J., Gray, A. , Tarn, A.W., Lee, J., Yarden, Y . , Libermann, T.A., Schlessinger, J. & et al. (1984). Nature, 309, 418-25. Vacca, F., Bagnato, A. , Catt, K J . & Tecce, R. (2000). Cancer Res, 60, 5310-5317. Vara, J.A.F., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C. & Gonzalez-Baron, M . (2004). Cancer Treatment Reviews, 30, 193-204. Venn, A. , Watson, L. , Lumley, J., Giles, G., King, C. & Healy, D. (1995). Lancet, 346, 995-1000. Wang, J., Luo, F., Lu, J.J., Chen, P.K., Liu, P. & Zheng, W. (2002). Int J Cancer, 97, 163-7. Wang, T.H., Popp, D .M. , Wang, H.S., Saitoh, M . , Mural, J.G., Henley, D . C , Ichijo, H. & Wimalasena, J. (1999). J Biol Chem, 274, 8208-16. Wimalasena, J., Dostal, R. & Meehan, D. (1992). Gynecol Oncol, 46, 345-50. Wimalasena, J., Meehan, D. & Cavallo, C. (1991). Gynecol Oncol, 41, 56-63. Wimalasena, J., Meehan, D., Dostal, R., Foster, J.S., Cameron, M . & Smith, M . (1993). Oncol Res, 5, 325-37. Xu, L. , Pathak, P.S. & Fukumura, D. (2004). Clin Cancer Res, 10, 701-7. Zwick, E., Hackel, P.O., Prenzel, N . & Ullrich, A . (1999). Trends Pharmacol Sci, 20, 408-12. Zygmunt, M . , Herr, F., Keller-Schoenwetter, S., Kunzi-Rapp, K. , Munstedt, K. , Rao, C.V., Lang, U . & Preissner, K.T. (2002). J Clin Endocrinol Metab, 87, 5290-6. 113 CHAPTER IV. Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer3 4.1 Introduction In addition to the classical form of mammalian gonadotropin-releasing hormone (GnRH I), a second form of GnRH (GnRH II) identical to chicken GnRH II (cGnRH II) has recently been found in the brain of primate including the human (Lescheid et al., 1997). Besides the hypothalamus and pituitary gland, GnRH I, GnRH II and their mutual receptor (GnRHR) have also been shown to be expressed in extrapituitary tissues including the ovary (Dong et al., 1993; Kang et al., 2001c). In the ovary, GnRH regulates the basal and gonadotropin-stimulated steroidogenesis in granulosa cells, and affects the expression of several genes related to folliculogenesis, ovulation and luteolysis (Kang et al., 2001b; Kang et al., 2001c; Peng et al., 1994; Vaananen et al., 1997). Moreover, GnRH has been shown to be an autocrine regulator and play an anti-proliferative effect on gynecological cancers (Savino et al., 1992; Schally et al., 2001). In human ovarian surface epithelium and ovarian cancer, anti-proliferative and apoptosis inducing effect of GnRH have been demonstrated (Grundker & Emons, 2003; Kang et al., 2003). Recent studies indicate that GnRH may modulate the growth of ovarian cancer cells by decreasing epidermal growth factor receptor (EGFR) expression and telomerase activity, and increasing the p53/p21 and Fas ligand-Fas system (Emons et al., 1993; Nagata & Golstein, 1995; Ohta et al., 1998; Tang et al., 2002). There is evidence that the expression of GnRH I, GnRH II and GnRHR is differentially regulated by its ligands, gonadal steroids (estrogen, progesterone, and testosterone) and peptide hormones (activin, inhibin and gonadotropin) (Cheng & Leung, 2005; Kang et al., 2001c; Khosravi & Leung, 2003). In human ovarian surface epithelial (OSE) and granulosa luteal (GL) cells, treatment with GnRH I results in a biphasic response in its own ligand and receptor mRNA levels such that, high concentrations 3 A version of this chapter has been published. Choi JH, Choi K C , Auersperg N , and Leung P C K Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer. Endocr Relat Cancer., 13(2), 641-651 114 decrease GnRH I and GnRHR mRNA levels whereas low concentrations increase the expression of both genes. In contrast, down-regulation of GnRH II and GnRHR mRNA levels was observed following treatment with GnRH II in G L cells (Kang et al., 2000b; Kang et al., 2001c). Estradiol down-regulates GnRH I and GnRHR gene expression in G L cells and ovarian cancer (OVCAR-3) cells (Kang et al., 2001a; Kang et al., 2003). Gonadotropins have been shown to regulate the mRNA levels of GnRH I, GnRH II and GnRHR in the ovary (Kang et al., 2001c; Olofsson et al., 1995; Peng et al., 1994). In human G L cells, the expression of GnRH I and GnRH II are differentially regulated by FSH and human chorionic gonadotropin (hCG) such that, gonadotropins increase the mRNA levels of GnRH II but decrease those of GnRH I in a dose-dependent manner (Kang et al., 2001c). The expression of FSHR and LHR, and the growth-stimulating effect of their ligands in normal OSE and ovarian cancer cells has been demonstrated (Choi et al., 2002b; Kobayashi et al., 1996; Kurbacher et al., 1995; Mandai et al., 1997; Minegishi et al., 2000; Ohtani et al., 2001; Parrott et al., 2001; Syed et al., 2001; Wimalasena et al., 1992; Zheng et al., 2000). However, the direct effect of gonadotropins on GnRH and GnRHR mRNA expression in the human OSE and ovarian cancer remains to be elucidated. Considering that the two forms of GnRH may play an important role as autocrine/paracrine regulators in OSE and ovarian cancer, the present study was designed to investigate the role of gonadotropins in the regulation of GnRH I, GnRH II and GnRHR mRNA expression in human OSE and ovarian cancer cells. In addition, we also examined the ability of gonadotropins to modulate the growth-inhibitory effects of the two GnRHs. 4.2 Material and methods Cell culture and treatments Human L H and recombinant FSH were provided by Dr. A . F. Parlow (National Hormone and Pituitary Program, Harbor-University of California Los Angels Medical Center, Torrance, CA). GnRH I analogue (D-Trp 6-GnRH) and GnRH II analogue (D-Arg 6 -Azagly 1 0 -GnRH II) were purchased from Bachem (Belmont, CA). Non-tumorigenic SV40 Tag-immortalized OSE-derived cells (IOSE-80) were cultured as previously described (Choi et a l , 2001c) in medium 199:MCDB 105 (1:1; Sigma-Aldrich Corp., St. Louis, MO) containing 10 % fetal bovine serum (FBS; Hyclone Laboratories Ltd., Logan, 115 UT), lOOuU/ml penicillin G and lOOug/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5 % C02-95 % air at 37°C. At confluency, the cells were passaged with 0.06 % trypsin (1:250)/0.01 % E D T A in M g 2 + /Ca 2 + - free HBSS. The ovarian adenocarcinoma cell lines (A2780, BG-1, CaOV-3, OVCAR-3 and SKOV-3) were cultured in above-mentioned culture conditions and used for the following experiments (Choi et a l , 2001b). To investigate the regulation of GnRH I, GnRH II and GnRHR mRNA levels, cells were plated, cultured for 24h, and then treated for additional 24hours with FSH or L H (100 or 1000 ng/ml). Following treatment, the cells were lysed and immediately frozen at -70°C until total R N A was extracted. Real-time RT- PCR Total R N A was prepared using TRIzol reagent (Invitrogen Canada, Burlington, ON, Canada), according to the manufacturer's instructions. Total R N A (2.5 jag) was reverse transcribed into first-strand cDNA (Amersham Pharmacia Biotech, Oakville, ON, Canada) following the manufacturer's procedure. Briefly, the R N A solution was incubation of 65°C for 10 minutes and then chilled on ice. 5 ul of the bulk first-strand cDNA reaction mix, lu l of 200 mM DTT, lu l of 0.2uM Not I-d(T),8 primer and the heat-denatured R N A were mixed, and incubated at 37°C for lh. The primers used for S Y B R Green real-time RT-PCR were designed using the Primer Express Software v2.0 (Perkin-Elmer Applied Biosystems, Foster City, CA) and listed in Table 4.1. These primers are specific for FSHR, LHR, G A P D H , GnRH I, GnRH II and GnRHR, as demonstrated using the B L A S T program (http://www.ncbi.nlm.nih. gov), and were purchased from Invitrogen. To build a standard curve for each gene, cDNA fragment generated by RT-PCR were extracted from agarose gel bands and then used for 10-fold dilution. Real-time PCR was performed using the A B I prism 7000 Sequence Detection System (Perkin-Elmer Applied Biosystems, CA, USA) equipped with a 96-well optical reaction plate. The reactions were set up with 12.5 ul SYBR® Green PCR Master Mix (Perkin-Elmer Applied Biosystems), 7.5ul of primer mixture (300nM) and 5ul of cDNA template. Real-time PCR conditions were as follows: 52°C for 2 min, followed by 95°C for lOmin, and 40 cycles of 95°C for 15 sec and 60°C for 1 min. A l l real-time experiments were run in triplicate and a mean value was used for the determination of 116 mRNA levels. Negative controls, containing water instead of sample cDNA, were used in each real-time plate. The standard curve quantitation method (ABI PRISM 7700 Sequence Detection System User Bulletin #2) was used in this study, and the slope (S) of the trend line represents the PCR efficiency. Deviation from 100% efficiency was determined by the equation: PCR efficiency= 10A( l /~ s)-l. The amount of transcript in each sample was calculated by interpolation using the following formula: (threshold cycle-y intercept)/S. The copy number of FSHR, LHR, GnRH I, GnRH II and GnRHR mRNAs in each cell line was normalized to the amount of G A P D H mRNA. MTT assay Cell viability was estimated using the MTT [3-(4,5-dimethylfhiazol-2-yl)-2,5-diphenyltetrazoliumbromide] (Sigma-Aldrich Corp., St. Louis, MO) assay. IOSE-80, OVCAR-3 and SKOV-3 cells were seeded in 96-well plates and incubated for 24 h. To examine the effect of FSH or L H on the growth-inhibitory effect of GnRH I and II agonists, IOSE-80, OVCAR-3 and SKOV-3 cells were pretreated with FSH or L H (lOOng/ml) for 24h and then treated with GnRH I or II agonist for 2 d. On the day of collection, the cells were incubated at 37 °C with 50 pi MTT solution [2 mg/ml in phosphate-buffered saline (PBS)] for 4 h. The supernatants were removed and the cells were solubilized in DMSO (lOOpl) for 30 min. The optical density at 570 nm was determined using a microplate spectrophotometer (Fisher Scientific Ltd., Ottawa, ON). Data analysis Data are shown as the mean ± SD of three individual experiments performed in triplicate, and are presented as the mean. For the MTT assay, values are expressed as the percentage of growth compared to control and are presented as the mean ± SD of three individual experiments performed in triplicate. Data were analyzed by one-way A N O V A followed by Dunnett's test. P<0.05 was considered statistically significant. 4.3 Results Validation of real-time RT-PCTfor FSHR, LHR, GAPDH, GnRH I, GnRH II and GnRHR 117 To examine whether the RT-PCR conditions produced primer-dimers and multiple amplicons, dissociation curve analysis and agarose gel electrophoresis were performed. Typical standard curves for the real-time amplification of FSHR, LHR, GnRH I, GnRH II, GnRHR and G A P D H were constructed (Data not shown). Agarose gel electrophoresis of the amplicons yielded a single band (Data not shown). The standard curve was log-linear for seven orders of magnitude (from 10 to 10 copies) and the coefficient of regression (r2) was >0.98. A dissociation curve analysis of FSHR, LHR, GnRH I, GnRH II and GnRHR amplicon resulted in a single peak (Data not shown). The identity of the amplicons was confirmed to be FSHR, LHR, GnRH I, GnRH II, GnRHR and G A P D H by sequencing analysis. Expression of FSHR and LHR in IOSE and ovarian cancer cells In a recent study, we demonstrated the expression of FSHR protein in IOSE cells and ovarian cancer cells using Western blot. Low levels of FSHR protein were shown in IOSE-80PC (an IOSE-80 line derived post-crisis) and SKOV-3 (a potential invasive line) cells, whereas FSHR was highly expressed in OVCAR-3 cells (up to 7-fold higher) (Choi et al., 2004). In the present study, we evaluated the mRNA levels of FSHR and L H R among two IOSE cell lines (IOSE-80 and IOSE-80PC) and five ovarian cancer cell lines (A2780, BG-1, CaOV-3, OVCAR-3 and SKOV-3) using real-time RT-PCR (Figure 4.1). We found that all of the seven cells expressed FSHR and L H R mRNA more than 0.0001 copy (ratio to GAPDH). The expression pattern of FSHR mRNA among IOSE-80, OVCAR-3 and SKOV-3 cells were similar to that of FSHR protein demonstrated in our previous study (Choi et al., 2004). No significant difference in either FSHR or L H R mRNA level was observed in between IOSE cells and ovarian cancer cells. Effect of FSH and LH on GnRH I, GnRH II and GnRHR To investigate whether GnRH I, GnRH II and GnRHR expression is regulated by FSH or L H in IOSE and ovarian cancer cell lines, the expression levels of GnRH I, GnRH II and GnRHR mRNA were examined following treatment of these cells with FSH or L H . The concentration of FSH and L H (100 and 1000 ng/ml) was selected from the previous results by which their doses made functional changes of OSE or ovarian cancers (Choi et 118 al., 2002b; Pon et al., 2005). In all of the cells examined including IOSE and ovarian cancer cells, no significant change in GnRH I mRNA levels was observed following treatment with gonadotropins (Figure 4.2). However, treatment with gonadotropins induced a significant decrease (-60 %) in GnRH II mRNA level in two IOSE cells and three ovarian cancer cells (A2780, BG-1, OVCAR-3), but not in CaOV-3 and SKOV-3 cells (Figure 4.3). In addition, treatment with FSH or L H for 24 h resulted in a significant down-regulation of GnRHR mRNA in all of the cell lines examined except CaOV-3 cells; however this effect was more elevated in IOSE cells than in ovarian cancer cells (Figure 4.4). For example, in IOSE-80 cells, both FSH and L H decreased GnRHR mRNA in a dose-dependent manner with maximal 60 % and 80 % decreases at 1000 ng/ml, respectively. In contrast, maximal 40 % and 60 % decreases were observed at 1000 ng/ml FSH and L H in OVCAR-3. These data suggest that gonadotropins may differentially regulate the expression of both forms of GnRH and its receptors in ovarian surface epithelium and its neoplastic counterpart. Effect of FSH and LH treatment on the growth inhibitory effect of GnRH I and GnRH II in IOSE-80 and OVCAR-3 cells It has been demonstrated that agonistic analogues of both GnRH I and II inhibit the growth of IOSE, OVCAR-3 and SKOV-3 cells (Kang et al., 2003). As gonadotropins decreased the mRNA expression of GnRH II and GnRHR, we used the MTT assay to further examine whether gonadotropins modulate the growth inhibition of IOSE-80, OVCAR-3 and SKOV-3 cells by GnRH agonists. The cells were pretreated with gonadotropin (lOOng/ml) or vehicle for 24 h and then treated with GnRH I or GnRH II agonist (10"7M), in the presence or absence of gonadotropin, for 48 h. The dose and time of GnRH treatment (10" 7M for 48 h) were selected based on a previous study (Kang et al., 2000b). In agreement with our previous findings (Choi et al., 2002b), treatment with FSH alone resulted in a significant increase in growth of both IOSE-80 and OVCAR-3 cells, but not SKOV-3. In contrast, treatment with L H alone showed a mitogenic effect only in OVCAR-3 cells. GnRH I and II agonists significantly inhibited the growth of all of three cells examined. Pretreatment with. gonadotropins for 24 h completely reversed the growth-inhibitory effect of GnRH I and II agonists in IOSE-80 (Figure 4.5A), OVCAR-3 119 (Figure 4.5 B) and SKOV-3 cells (Figure 4.5 C). 4.4 Discussion Ovarian cancers, mainly derived from the ovarian surface epithelium, are the most lethal gynecological malignancy and are the fifth leading cause for all cancer deaths in women (Auersperg et al., 2001). There is increasing evidence suggesting the positive or negative effect of reproductive hormone including GnRH and gonadotropins on ovarian cancer initiation and progression (Brekelmans, 2003; Riman et al., 1998; Risch, 1998a). It is of interest that ovarian cancer is more common in conditions with elevated gonadotropins such as post-menopausal women (Brekelmans, 2003; Holschneider & Berek, 2000). Reduced risk of ovarian cancer is associated with multiple pregnancies, breast feeding, oral contraceptives, and estrogen replacement therapy which are associated with lower levels and reduced exposure to gonadotropins (Daly & Obrams, 1998; Gnagy et al., 2000; La Vecchia, 2001). Moreover, it has been demonstrated that gonadotropins levels of ovarian cyst fluid significantly increase in patients with ovarian cancer as compared to patients with functional and benign ovarian cysts (Chudecka-Glaz et al., 2004; Halperin et al., 2003). The expression of FSHR and L H R in normal OSE and ovarian cancer cells has been demonstrated (Kobayashi et al., 1996; Mandai et al., 1997; Minegishi et al., 2000; Parrott et a l , 2001; Zheng et al., 2000). However, the role of FSH and L H in normal OSE and ovarian epithelial cancer is not well characterized. Although a gonadotropin theory is still controversial to date (Ivarsson et al., 2001; Tourgeman et al., 2002; Venn et al., 1995; Wimalasena et al., 1991), it is assumed that FSH and LH/hCG stimulate the growth of normal, immortalized OSE and some ovarian cancer cells in a dose- and time-dependent manner in vitro (Choi et al., 2002b; Kurbacher et al., 1995; Ohtani et al., 2001; Parrott et al., 2001; Syed et al., 2001; Wimalasena et al., 1992). In the present study, we examined the alteration in GnRH I, GnRH II and GnRHR mRNA expression in human OSE and ovarian cancer cells by FSH and L H at concentrations that are associated with the relatively high levels of gonadotropins in post-menopausal women. After menopause there is a 10-20-fold increase in gonadotropins compared to basal levels in the normal reproductive cycle. We also examined the ability of gonadotropins to modulate the growth-inhibitory effects of two forms of GnRHs. 120 GnRH-I and its receptor are expressed in 80 % of human OSE cells and ovarian cancer cell lines (Emons et al., 1993; Miyazaki et al., 1997), suggesting that this decapeptide may be an autocrine and/or paracrine regulator of the OSE and play a role in the pathophysiology of ovarian cancer (Grundker & Emons, 2003; Kang et al., 2003; Savino et al., 1992; Schally, 1999; Schally et al., 2001). In the present study, we found that four out of five ovarian cancer cells (A2780, BG-1, CaOV-3 and OVCAR-3) highly expressed basal GnRHR compared to IOSE cells. This is consistent with a recent report that primary ovarian cancer cells expressed higher level of GnRHR compared to normal ovarian tissues using RT-PCR, immuno-histochemistry and Western blot assay. For instance, the mean values of fold-increase of GnRHR mRNA level in stage I-IV ovarian cancer were 2.24, 2.58, 3.10 and 3.20 as compared with normal ovarian tissues, and overall 70 % (21/30) of ovarian cancer tissues had increased GnRHR mRNA level. As shown in Figure. 4.2 and 4.3, SKOV-3 cell with potential invasiveness in our cell culture system highly expressed both GnRH I and GnRH II compared to IOSE cells, whereas other ovarian cancer cells including A2780, BG-1 and OVCAR-3 showed modest increased level of GnRH II. Whether the expression of GnRHs as well as their receptor would be used to characterize the histological type, stage or grade of human ovarian epithelial cancer remains to be determined. In view of the recent observation that the GnRH/GnRHR system can be modulated by gonadotropins in hypothalamic GT1-7 neuron and human granulosa luteal cells (Kang et al., 2001c; Lei & Rao, 1994), we hypothesized that gonadotropins would interact with the GnRH/GnRHR system to regulate cell growth in OSE and ovarian cancer cells. This hypothesis is supported by the results of the present study that GnRH II and/or GnRHR mRNA levels are down-regulated by gonadotropin in IOSE cells and ovarian cancer cells. It can not be explained why the regulatory effect of gonadotropin on the GnRH/GnRHR system is relatively weak in SKOV-3 cells, such that FSH and L H can modulate only GnRHR (with a maximum 40 % decrease), and absent in CaOV-3 cells. Our results suggest that two forms of GnRH are differentially regulated under various physiological conditions. Indeed, in the brain of the female European silver eel, steroids induce an increase in mammalian GnRH and decrease in chicken GnRH II (cGnRH II) (Montero et al., 1995). In the chicken, only the level of mGnRH in the hypothalamus was modified by 121 castration (Sharp et al., 1990). In the goldfish, the ratio between salmon GnRH and cGnRH II changes with sexual maturation (Rosenblum et al., 1994). Treatment of human G L cells with FSH and hCG resulted in a marked increase in GnRH II mRNA levels but decreased those of GnRH I (Kang et al., 2001c). This differential regulation of two forms of GnRH by various factors including gonadotropins in a range of cell types suggests the distinct spatial expression and function of these peptides. Furthermore, considering the growth inhibitory effect of GnRH, decreased expression of GnRH-II or GnRH II/GnRH I ratio may play a critical role in the development of ovarian cancer by regulating the proliferation. The reason why gonadotropins differentially regulate the transcription for GnRH I and GnRH II genes is not clear yet. It is possible that two distinct transcription mechanisms exist for each GnRH in the ovary and gonadotropins regulate only GnRH II related mechanism. Further study is required to elucidate the physiological relevance and mechanism of the differential regulation of GnRH-I and GnRH-II by gonadotropin. Previously, we and others demonstrated that treatment with GnRH I and GnRH II inhibit the proliferation of IOSE and ovarian cancer cells by determined by thymidine incorporation (Grundker & Emons, 2003; Kang et al., 2003). In this study we further explored the possibility that gonadotropins may antagonize the growth inhibitory effect of GnRH I and GnRH II in IOSE, OVCAR-3 and SKOV-3 cells by regulating the expression level of GnRH ligands and their receptor. The growth-inhibitory effect of GnRH I and GnRH II was substantiated further in present study using the M T T assay. A decrease in cell number of approximately 20 % was observed in response to GnRH I or GnRH II in IOSE-80, OVCAR-3 and SKOV-3 cells, and this effect was reversed by pretreatment with FSH or L H . These results indicate that gonadotropins may function as growth regulator in IOSE-80, OVCAR-3 and SKOV-3 cells. A mechanism of gonadotropins action in this regard is not clear. We cannot rule out the possibility that the mitogenic activity of gonadotropins may override the growth inhibitory activity of GnRHa independent of down-regulation of GnRH II and GnRHR in these cells. As shown in Figure 4.5 C, the pretreatment with gonadotropins, which is not a mitogen in SKOV-3 cells, reversed GnRHa-inhibited cell growth. This result suggests that the mechanism of action of gonadotropins may include, at least in part, a reduction in GnRH II and GnRHR mRNA levels. As well, the effects of FSH and L H in these cells may also be indirect via other 122 growth factors. For instance, combined treatment with hCG and estradiol may regulate the growth of epithelial ovarian cancer cells through the insulin-like growth factor-I pathway (Wimalasena et al., 1993). Likewise, FSH and hCG stimulate steady state mRNA levels of keratinocyte growth factor, hepatocyte growth factor and kit ligand in bovine OSE cells (Shoham, 1994). Recently, we have demonstrated that treatment of immortalized OSE and OVCAR-3 cells with FSH and L H significantly increased EGFR mRNA and protein (Choi et al., 2005b). In summary, a significant decrease in GnRH II and GnRHR mRNA levels was observed in IOSE and ovarian cancer cells following treatment with FSH or L H . In contrast, treatment with either FSH or L H had no effect on GnRH I mRNA level in the cell lines employed, suggesting that gonadotropins regulate two forms of GnRH and its receptor differentially. Pretreatment of the cells with FSH or L H significantly reversed the growth inhibitory effect of GnRH I and GnRH II agonists in IOSE-80, OVCAR-3 and SKOV-3 cells. Taken together, these results suggest that FSH and L H may interact with the GnRH system to control the growth of ovarian surface epithelial cells and their neoplastic counterparts. 123 Table 4.1 List of primers used for the detection of FSHR, LHR, GnRH I, GnRH II, GnRHR and GAPDH by SYBR Green RT-PCR [©Society for Endocrinology (2006). Reproduced with permission from Choi et al., Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells, Endocrine-related cancer 13:641-651,2006] Gene SYBR Green Priner sequerce(5'->3') % G C Tm a Amplicon size (bp) GnRH I Forward GCCTTAGAATGMGCCAATTCAA 39 62 Reverse TCCACGCACGAAGTCAGTAGA 52 62 62 GnRH II Forward TCTGTTCCCCTC CAACTTTCTTC 48 63 Reverse A G G TCCATCC A TCTTTCCTTCA 46 62 64 GnRHR Forward ACCGCTCCCTGGCTATCAC 63 63 Reverse ACTGTTCCGACTTTGCTGTTGCT 50 64 60 FSHR Forward TTTCAAGAACAAGGATCCATTCC 39 61 Reverse CCTGGCCCTCAGCTTCTTAA 55 62 68 LHR Forward TTCAATGGGACGACACTGACTT 46 62 Reverse TGTGCATCTTCTCCAGATGTACGT 46 63 64 GAPDH Forward ATGGAAATCCCATCACCATCTT 41 62 Reverse CGCCCCA CTTGATTTTGG 56 62 57 124 0.60 0.50 ~ 0.40 Q Q. 3 0.30 0.20 o 0.10 o 0.00 J Z Z L . IOSE-80 IOSE-80PC A2780 BG-1 CaOV-3 O V C A R - 3 SKOV-3 B o 0.01 IOSE-80 IOSE-80PC A2780 BG-1 CaOV-3 O V C A R - 3 SKOV-3 Figure 4.1 Expression of FSHR and LHR in IOSE and ovarian cancer cells. First-strand cDNA from IOSE-80, IOSE-80PC, A2780, BG-1, CaOV-3, OVCAR-3 and SKOV-3 cells were amplified using two sets of PCR primers shown in Table 4.1. The expression levels of FSHR and L H R mRNA were normalized against G A P D H mRNA level. Data are derived from three experiments and are presented as the mean ± SD. [©Society for Endocrinology (2006). Reproduced with permission from Choi et al., Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells, Endocrine-related cancer 13:641-651, 2006] 125 0.008 1: Control 2: FSH 100ng/ml 3: FSH 1000ng/ml 4: LH 100ng/ml 3: LH 1000ng/ml fil I x I 1 2 3 4 5 IOSE-80 1 2 3 4 5 IIOSE-80PC I 1 2 3 4 5 A2780 1 2 3 4 5 BG-1 1 2 3 4 5 CaOV-3 1 2 3 4 5 I OVCAR-3 l 1 2 3 4 5 I SKOV-3 I Figure 4.2 Effect of FSH and L H on GnRHI mRNA in IOSE and ovarian cancer cells. The cells were plated and cultured for 24h. The cells are then treated with FSH (100 and 1000 ng/ml), or L H (100 and 1000 ng/ml) for 24h. Control cultures were treated with vehicle. Total R N A was extracted and reverse transcribed into first cDNA. The levels of GnRHI mRNA were measured by real-time RT-PCR. Data are shown as the means of three experiments and are presented as the mean ±SD. a, PO.05 vs. control of each cell. [©Society for Endocrinology (2006). Reproduced with permission from Choi et al., Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells, Endocrine-related cancer 13:641-651, 2006] 126 0.30 1: Control 2: FSH 100ng/ml 3: FSH 1000ng/ml 4: LH 100ng/ml 3: LH 1000ng/ml n a a I I a i a j ; 1 2 3 4 5 IOSE-80 1 2 3 4 5 |lOSE-80PC I 1 2 3 4 5 A2780 1 2 3 4 5 BG-1 1 2 3 4 5 CaOV-3 1 2 3 4 5 OVCAR-3 1 2 3 4 5 I SKOV-3 | Figure 4.3 Effect of FSH and L H on GnRH II mRNA in IOSE and ovarian cancer cells. The cells were plated and cultured for 24h. The cells are then treated with FSH (100 and 1000 ng/ml), or L H (100 and 1000 ng/ml) for 24h. Control cultures were treated with vehicle. Total R N A was extracted and reverse transcribed into first cDNA. The levels of GnRH II mRNA were measured by real-time RT-PCR. Data are shown as the means of three experiments and are presented as the mean ±SD. a, PO.05 vs. control of each cell. [©Society for Endocrinology (2006). Reproduced with permission from Choi et al., Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells, Endocrine-related cancer 13:641-651, 2006] 127 1: Control 2: FSH 100ng/ml 3: FSH 1000ng/ml 4: LH 100ng/ml 3: LH 1000ng/ml H o a a a T a OAO. a • i 1 r i I a a jjJJn 1 2 3 4 5 IOSE-80 1 2 3 4 5 | IOSE-80PC I 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 A2780 I BG-1 CaOV-3 1 2 3 4 5 I OVCAR-3 I 1 2 3 4 5 I SKOV-3 I Figure 4.4 Effect of FSH and L H on GnRHR mRNA in IOSE and ovarian cancer cells. The cells were plated and cultured for 24h. The cells are then treated with FSH (100 and 1000 ng/ml), or L H (100 and 1000 ng/ml) for 24h. Control cultures were treated with vehicle. Total R N A was extracted and reverse transcribed into first cDNA. The levels of GnRHR mRNA were measured by real-time RT-PCR. Data are shown as the means of three experiments and are presented as the mean ±SD. a, PO.05 vs. control of each cell. [©Society for Endocrinology (2006). Reproduced with permission from Choi et al., Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells, Endocrine-related cancer 13:641-651, 2006] 128 A IOSE-80 B. OVCAR-3 C. SKOV-3 Control GnRH I GnRH 10 Vehicle • FSH DLH Control GnRH I GnRH II a Vehicle • FSH QLH Control GnRH I GnRH II • Vehicle a FSH DLH Figure 4.5 Effect of FSH or L H treatment on the growth inhibitory effect of GnRH I and II in IOSE-80 (A), OVCAR-3 cells (B) and SKOV-3 cells (C). The cells were seeded on 96-well plates and incubated for 24h. Cells were pretreated with FSH or L H (lOOng/ml) for 24h and then treated with analogue of GnRH I (D-Trp6-GnRH) or GnRH II (D-Arg6-AzaglylO-GnRH II) for 2 days. Cell growth was measured using M T T assay as described in the materials and methods. Data are presented as the mean ± SD of three experiments, a, P<0.05 vs. control; b, P<0.05 vs. GnRH I or II agonist. [©Society for Endocrinology (2006). Reproduced with permission from Choi et al., Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells, Endocrine-related cancer 13:641-651, 2006] 129 4.5 Bibliography Auersperg, N . , Wong, A.S., Choi, K . C , Kang, S.K. & Leung, P.C. (2001). Endocr Rev, 22, 255-88. Brekelmans, C T . (2003). Curr Opin Obstet Gynecol, 15, 63-8. Cheng, C.K. & Leung, P.C. (2005). Endocr Rev, 26, 283-306. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2004). J Clin Endocrinol Metab, 89, 5508-16. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2005). Endocr Relat Cancer, In press. Choi, K.C. , Kang, S.K., Nathwani, P.S., Cheng, K.W., Auersperg, N . & Leung, P.C. (2001a). Mol Cell Endocrinol, 174, 99-110. Choi, K.C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2001b). Endocrinology, 142, 2351-60. Choi, K . C , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2002). J Clin Endocrinol Metab, Vol. 87, pp 2245-53. Chudecka-Glaz, A. , Rzepka-Gorska, I. & Kosmowska, B. (2004). Arch Gynecol Obstet, 270, 151-6. Daly, M . & Obrams, G.I. (1998). Semin Oncol, 25, 255-64. Dong, K.W., Yu , K . L . & Roberts, J.L. (1993). Mol Endocrinol, 1 , 1654-66. Emons, G., Ortmann, O., Becker, M . , Inner, G., Springer, B. , Laun, R., Holzel, F., Schulz, K .D. & Schally, A . V . (1993). Cancer Res, 53, 5439-46. Gnagy, S., Ming, E.E., Devesa, S.S., Hartge, P. & Whittemore, A.S. (2000). Epidemiology, 11, 102-5. Grundker, C. & Emons, G. (2003). Reprod Biol Endocrinol, 1, 65. Halperin, R., Pansky, M . , Vaknin, Z., Zehavi, S., Bukovsky, I. & Schneider, D. (2003). Eur J Obstet Gynecol Reprod Biol, 110, 207-10. Holschneider, C.H. & Berek, J.S. (2000). Semin Surg Oncol, 19, 3-10. Ivarsson, K. , Sundfeldt, K. , Brannstrom, M . , Hellberg, P. & Janson, P.O. (2001). Hum Reprod, 16, 18-23. Kang, S.K., Choi, K . C , Cheng, K.W., Nathwani, P.S., Auersperg, N . & Leung, P.C. (2000). Endocrinology, 141, 72-80. Kang, S.K., Choi, K . C , Tai, C.J., Auersperg, N . & Leung, P.C. (2001a). Endocrinology, 142, 580-8. Kang, S.K., Choi, K . C , Yang, H.S. & Leung, P.C. (2003). Endocr Relat Cancer, 10, 169-77. Kang, S.K., Tai, C.J., Nathwani, P.S., Choi, K .C . & Leung, P.C. (2001b). Endocrinology, 142, 671-9. Kang, S.K., Tai, C.J., Nathwani, P.S. & Leung, P.C. (2001c). Endocrinology, 142, 182-92. Khosravi, S. & Leung, P.C. (2003). J Clin Endocrinol Metab, 88, 663-72. Kobayashi, F., Monma, C , Nanbu, K. , Konishi, I., Sagawa, N . & Mori, T. (1996). Gynecol Oncol, 6 2 , 309-13. Kurbacher, C M . , Jager, W., Kurbacher, J.A., Bittl, A. , Wildt, L . & Lang, N . (1995). Tumour Biol, 16, 374-84. La Vecchia, C. (2001). Eur J Cancer Prev, 10, 125-9. Lei, Z . M . & Rao, C.V. (1994). Mol Endocrinol, 8, 1111-21. 130 Lescheid, D.W., Terasawa, E., Abler, L .A. , Urbanski, H.F., Warby, C M . , Millar, R.P. & Sherwood, N . M . (1997). Endocrinology, 138, 5618-29. Mandai, M . , Konishi, I., Kuroda, H. , Fukumoto, M . , Komatsu, T., Yamamoto, S., Nanbu, K. , Rao, C.V. & Mori, T. (1997). Eur J Cancer, 33, 1501-7. Minegishi, T., Kameda, T., Hirakawa, T., Abe, K. , Tano, M . & Ibuki, Y . (2000). Clin Cancer Res, 6, 2764-70. Miyazaki, M . , Nagy, A. , Schally, A .V . , Lamharzi, N . , Halmos, G., Szepeshazi, K. , Groot, K. & Armatis, P. (1997). J Natl Cancer Inst, 89, 1803-9. Montero, M . , Le Belle, N . , King, J.A., Millar, R.P. & Dufour, S. (1995). Neuroendocrinology, 61, 525-35. Nagata, S. & Golstein, P. (1995). Science, 267, 1449-56. Ohta, H. , Sakamoto, H . & Satoh, K. (1998). Cancer Lett, 134, 111-8. Ohtani, K. , Sakamoto, H. , Kikuchi, A. , Nakayama, Y . , Idei, T., Igarashi, N . , Matukawa, T. & Satoh, K. (2001). Cancer Lett, 166, 207-13. Olofsson, J.L, Conti, C C & Leung, P.C. (1995). Endocrinology, 136, 974-80. Parrott, J.A., Doraiswamy, V . , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Peng, C , Fan, N . C , Ligier, M . , Vaananen, J. & Leung, P.C. (1994). Endocrinology, 135, 1740-6. Pon, Y . L . , Auersperg, N . & Wong, A.S. (2005). J Biol Chem, 280, 15438-48. Riman, T., Persson, I. & Nilsson, S. (1998). Clin Endocrinol (Oxf), 49, 695-707. Risch, H. (1998). JNCI Cancer Spectrum, 90, 1774-1786. Rosenblum, P.M. , Goos, H.J. & Peter, R.E. (1994). Gen Comp Endocrinol, 93, 369-79. Savino, L. , Baldini, B., Susini, T., Pulli, F., Antignani, L . & Massi, G.B. (1992). / Chemother, 4, 312-20. Schally, A . V . (1999). Peptides, 20, 1247-62. Schally, A . V . , Comaru-Schally, A . M . , Nagy, A. , Kovacs, M . , Szepeshazi, K. , Plonowski, A. , Varga, J.L. & Halmos, G. (2001). Front Neuroendocrinal, 22, 248-91. Sharp, P.J., Talbot, R.T., Main, G.M. , Dunn, I .C, Fraser, H . M . & Huskisson, N.S. (1990). J Endocrinol, 124, 291-9. Shoham, Z. (1994). Fertil Steril, 62, 433-48. Syed, V. , Ulinski, G., Mok, S.C, Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Tang, X . , Yano, T., Osuga, Y . , Matsumi, H. , Yano, N . , Xu , J., Wada, O., Koga, K. , Kugu, K. , Tsutsumi, O., Schally, A . V . & Taketani, Y . (2002). J Clin Endocrinol Metab, 87,3721-7. Tourgeman, D.E., Lu, J.J., Boostanfar, R., Amezcua, C , Felix, J.C. & Paulson, R.J. (2002). Fertil Steril, 78, 1096-9. Vaananen, J.E., Tong, B.L. , Vaananen, C M . , Chan, I.H., Yuen, B .H. & Leung, P.C. (1997). Biol Reprod, 57, 1346-53. Wimalasena, J., Dostal, R. & Meehan, D. (1992). Gynecol Oncol, 46, 345-50. Wimalasena, J., Meehan, D. & Cavallo, C. (1991). Gynecol Oncol, 41, 56-63. Wimalasena, J., Meehan, D., Dostal, R., Foster, J.S., Cameron, M . & Smith, M . (1993). Oncol Res, 5, 325-37. Zheng, W., Lu, J.J., Luo, F., Zheng, Y . , Feng, Y . , Felix, J .C , Lauchlan, S.C. & Pike, M.C. (2000). Gynecol Oncol, 76, 80-8. 131 CHAPTER V. Gonadotropins activate proteolysis and increase invasion through protein kinase A and phosphatidyl-inositol-3-kinase pathways in human epithelial ovarian cancer cells4 5.1 Introduction Recent findings suggested that proteolysis directed at the interface between ovarian cancer cells and peritoneal tissues may play a role in the localized invasion and dissemination of ovarian cancer cells in the peritoneal cavity (Fishman et al., 1998; Rodriguez et al., 2001). Of various proteases, MMPs and the urokinase plasminogen activator (uPA) system have been the most intensely investigated in ovarian cancer as well as in other cancers. The M M P family contains 24 human members, of which MMP-2 and MMP-9 (gelatinase A , 72-kD type IV collagenase and gelatinase B, 92-kD type IV collagenase) have been observed in several ovarian cancer cell lines and detected in ascitic fluid from patients with advanced ovarian cancers. The invasiveness of ovarian cancer cells has been reported to correlate with the expression of MMP-2 and MMP-9 (Ellerbroek et al., 1999; Schmalfeldt et al., 2001). In ovarian cancer, uPA is also present in significant levels in ascites and increased levels are related to poor prognosis (Chambers et al., 1995; Schmalfeldt et al., 1995). Furthermore, uPA and its receptor have been demonstrated to increase in ovarian cancer cells (Pustilnik et al., 1999). Both MMPs and uPA are secreted from the cells in a pro-form and become active through proteolytic cleavage. Once activated, the proteases can degrade the E C M , and their activity is counterbalanced by their specific endogenous inhibitor such as tissue inhibitors of metalloproteinases (TIMP) for M M P and plasminogen activator inhibitor type I (PAI-1) for uPA. A possible role of gonadotropins in the development and progression of ovarian cancer has been suggested. Although the mitogenic effect of gonadotropins is still controversial, their proliferative effect has been demonstrated in OSE and ovarian cancer in vitro (Choi et al., 2002a; Ohtani et al., 2001; Parrott et al., 2001; Syed et al., 2001). However, little is known regarding the effects of gonadotropins on other aspects of ovarian cancer such as metastasis. Considering that gonadotropins may modulate 4 A version of this chaper has been published. Choi JH, Choi K C , Auersperg N , and Leung P C K 2006 Gonadotropins activate proteolysis and increase invasion through protein kinase A and phosphatidyl-inositol-3-kinase pathways in human epithelial ovarian cancer cells. Cancer Res. 66(7):3912-3920 132 invasiveness and interact with the M M P system in other cell models (Dabizzi et al., 2003; Hagglund et al., 1999; Islami et al., 2001; Schiffenbauer et al., 2002), we hypothesized that gonadotropins may play a role in ovarian cancer invasion via the M M P system. We performed the present study to examine 1) the effect of gonadotropins on invasiveness of ovarian caner cells, 2) the effect of gonadotropins on metastasis-related proteases and 3) the involvement of protein kinase A (PKA) and phosphatidyl-inositol-3-kinase (PI3K) signaling pathways in the regulation of invasiveness by gonadotropins. 5.2 Materials and methods Materials Human L H and recombinant FSH were provided by Dr. A . F. Parlow (National Hormone and Pituitary Program, Harbor-University of California Los Angels Medical Center, Torrance, CA). PD98059 [2-(2-amino-3-mathoxyphenyl)-4H-l-benzopyran-4-one], a M A P K / E R K kinase (MEK) inhibitor, was purchased from New England Biolabs, Inc. (Beverly, M A ) . LY294002 [2-(4-Morpholinyl)-8-phenyl-l(4H)-benzopyran-4-one hydrochloride], a specific cell permeable phosphatidyl-inositol 3-kinase inhibitor, and H-89 [2-(p-Bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide dihydrochloride], a P K A inhibitor, were obtained from Sigma-Aldrich Corp. (St. Louis, MO). GM6001 [(2R)-2-(hydroxamido-carbonylmethyl)-4-methylpentanoyl] -L-trypto-phan methylamide], a broad spectrum M M P inhibitor, and SB-3CT [3-(4-phenoxyphenylsulfonyl)-propylthiirane], a selective MMP2/MMP9 inhibitor, were acquired from Chemicon (Temecula, CA). AG1478, an EGFR kinase inhibitor [4-(3-Chloroanilino)-6,7-dimethoxyquinazoline], was purchased from Calbiochem (San Diego, CA). Cell culture and treatment OVCAR-3 , CaOV-3 and SKOV-3 cells, ovarian cancer cell lines, were purchased from the American Type Culture Collection (ATCC, Manassas, V A ) and were cultured as previously described (Choi et al., 2002a) in medium 199:MCDB 105 (1:1; Sigma-Aldrich Corp., St. Louis, MO) containing 10 % fetal bovine serum (FBS; Hyclone Laboratories Ltd., Logan, UT), 100 U/ml penicillin G and 100 ug/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5 % C0 2 -95 % air at 37°C. The cells 133 were passaged with 0.06 % trypsin (1:250)/0.01 % E D T A in M g z + / C a z + - free HBSS at confluence. For monolayer culture, the cell lines were maintained on tissue culture dishes (Falcon; Becton Dickinson, Franklin Lakes, NJ). BG-1 cells were generously provided by Dr. K.S. Korach (National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC) and cultured in above-mentioned culture conditions and used for the following experiments. To investigate the regulation of MMPs, TIMPs, uPA and PAI-1 mRNA and protein, the cells were plated, cultured in above-mentioned culture conditions, and then treated for an additional 24 or 48 h with FSH or L H (100 and 1000 ng/ml). Following treatment, conditioned media was then collected, centrifued, and stored at -80°C for immunoblot, zymography and ELISA. In addition, the cells were lysed and immediately frozen at -80°C for RT-PCR. Invasion Assay In vitro cellular invasion was assayed by determining the ability of cells to invade a synthetic basement membrane (Matrigel, BD sciences, Mississauga, ON, Canada). Briefly, polycarbonate filters (8-um pore size) were coated with Matrigel at a concentration of lug/ml and placed in a modified Boy den chamber. Trypsinized cells (1.5 x 105) were resuspended in M199:MCDB media containing 0.5% FBS and various concentrations of FSH or L H , and added to the top chamber in the presence or absence of pretreatment with GM6001 (10 uM, a total M M P inhibitor), SB-3CT (20 uM, a specific gelatinase inhibitor), LY294002 (10uM, a PI3K pathway inhibitor) or H89 (10uM, a P K A pathway inhibitor) for 20 min. Culture media containing 1% FBS were then added to the bottom chamber. The cells were incubated at 37°C and allowed to invade through the Matrigel barrier for 48 h. Following incubation, filters were fixed and stained with Crystal Violet. Non-invading cells were removed using a cotton swab, while invading cells on the underside of the filter were counted using an inverted microscope. A l l experiments were performed in triplicate, and a minimum of 10 fields per filter were counted. Real-time PCR Total R N A was prepared using TRIzol reagent (Invitrogen Canada, Burlington, ON, Canada), according to the manufacturer's instructions. Total R N A (2.5 \ig) was 134 reverse transcribed into first-strand cDNA (Amersham Pharmacia Biotech, Oakville, ON, Canada) following the manufacturer's procedure. Briefly, the R N A solution was incubation of 65°C for 10 minutes and then chilled on ice. 5 pi of the bulk first-strand cDNA reaction mix, lu l of 200 mM DTT, lu l of 0.2uM Not I-d(T)1 8 primer and the heat-denatured R N A were mixed, and incubated at 37°C for lh. The primers used for SYBR Green real-time RT-PCR were designed using the Primer Express Software v2.0 (Perkin-Elmer Applied Biosystems, Foster City, CA) and were as follows: for MMP-2, 5'-C C G C A G T G A C G G A A A GATGT-3 ' and 5 '-CACTT GCGGT C G T C A TCGTA-3 ' ; for MMP-9, 5 ' -GGACG A T G C C T G C A A CGT-3' and 5 ' - C A A A T A C A G C TGGTT C C C A A TCT-3' ; for TIMP-1, 5 ' -ACCAT GGCCC CCTTT G A - 3 ' and 5 ' -CAGCC A C A G C A A C A A C A G G A T-3'; for TIMP-2, 5 ' -AGCAT T T G A C C C A G A G T G G A A -3' and 5 ' - C C A A A G G A A A G A C C T G A A G G A-3 ' ; for uPA, 5'-CGCTT TCTTG CTGGT TGT-CA-3 ' and 5 ' -CCCAG TCTCT TCTTA C A G C T GATG-3 ' ; for PAI-1, 5'-C C G C C GCCTC TTCCA-3 ' and 5 ' -GCCAT C A T G G G C A C A G A G A - 3 ' ; for GAPDH, 5 ' -ATGGA A A T C C C A T C A C C A T C TT-3' and 5 ' -CGCCC C A C T T GATTT TGG -3'. These primers are specific for MMP-2, MMP-9, TIMP-1, TIMP-2, uPA, PAI-1 and G A P D H as demonstrated using the B L A S T program (http://www.ncbi.nlm.nih.gov), and were purchased from Invitrogen. Real-time PCR was performed using the A B I prism 7000 Sequence Detection System (Perkin-Elmer Applied Biosystems, C A , USA) equipped with a 96-well optical reaction plate. The reactions were set up with 12.5 ul SYBR® Green PCR Master Mix (Perkin-Elmer Applied Biosystems), 7.5pl of primer mixture (300nM) and 5(0.1 of cDNA template. Real-time PCR conditions were as follows: 52°C for 2 min followed by 95°C for 10 min, and 40 cycles of 95°C for 15 sec and 60°C for 1 min. A l l real-time experiments were run in triplicate and a mean value was used for the determination of mRNA levels. A negative control containing water instead of sample cDNA was used in each real-time plate. At the end of the PCR, baseline and threshold values (CT) for these genes were set using the ABI 7000 Prism Software and the calculated CT values were exported to Microsoft Excel for analysis. The relative expression of mRNA was calculated using the comparative CT method according to manufacturer's literature (Applied Biosystems). The steady-state concentration of mRNA for MMP-2, MMP-9, TIMP-1, TIMP-2, uPA and PAI-1 in SKOV-3 cells was normalized 135 to the amount of G A P D H mRNA. In order to compare the relative mRNA amount, untreated controls were designated as the calibrator and the normalized amount of target gene was divided by the averaged calibrator value. Antibodies MMP-2, MMP-9 and TIMP-1 antibodies were purchased from Neomarkers (Fremont, CA), and TIMP-2, uPA and PAI-1 antibodies were acquired from Santa Cruz Biotechnology Ltd. (Santa Cruz, CA). Phospho-Akt (ser 473), GSK3 a/p (glycogen synthase kinase-3 a/p), F K H R (Forkhead in rhabdomyosarcoma), pan-Akt, phospho-CREB (cAMP response element-binding protein) and pan-CREB antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, M A ) Immunoblot assay Thirty DI of conditioned medium was electrophoresed under reducing conditions on an 8 % SDS-poly-acrylamide gel to determine the secretion of MMPs, TIMPs, uPA and PAI-1 from SKOV-3 cells. To examine the activation of PI3K and P K A signaling pathway, the cells were washed once with medium, and serum starved for 4 h prior to treatments with FSH or L H (100 or lOOOng/ml) for 30 min. The cells were lysed in ice-cold RIPA buffer (150 mM NaCl, 1 % Nonidet P-40, 0.5 % deoxycholate, 0.1 % SDS, 50 mM Tris (pH, 7.5), and 1 mM PMSF, 10 ug/ml leupeptin, 100 ug/ml aprotinin). Thirty Dg of total protein was run on 10 % SDS-poly-acrylamide gels. After electrotransfering the proteins to a nitrocellulose membrane (Amersham Pharmacia Biotech.), the membrane was immunoblotted using specific primary antibodies at 4°C overnight. The signals were detected with horseradish peroxidase-conjugated secondary antibody for 1 h, and visualized using the E C L Chemiluminescent system (Amersham Pharmacia Biotech.). Zymography and reverse zymography To measure the activity of MMPs, the conditioned medium was incubated with nonreducing dilution buffer before electrophoresis on an 8 % SDS-poly-acrylamide gel containing 0.1 % gelatin. Following electrophoresis, the gel was washed two times in 2.5 % TritonX-100 to remove the SDS, followed by incubation overnight at 37 C in buffer 136 [0.1 m M glycine, 10 mM CaCh and l u M ZnCl2, pH 8.3] that allows both pro- and active gelatinase to digest the gelatin. The gel was then stained with Comassie blue G-250 (Bio-Rad Laboratories, Mississauga, ON, Canada) to visualize gelatinylytic activity. TIMP activity by Reverse Zymography was assayed in polyacrylamide gels containing gelatin as a substrate copolymerized with recombinant pro-MMPs as described previously (Nakagawa et al., 1994). Aliquots of conditioned medium were treated as described above for zymography, with the exception that the samples were separated on 15 % polyacrylamide gels containing 0.1 % SDS, 2.5 mg/ml gelatin, and 160 ng/ml recombinant pro-MMP-2. Enzyme-linked immunosorbent assay (ELISA) MMP-2, MMP-9 and TIMP-1 activity in conditioned medium was determined by using the Biotrak Assay (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Prior to ELISA analysis, samples were centrifuged at 14,000 rpm for 1 min. Three ELISA experiments were conducted, with each sample performed in duplicate. The optical density of the samples was measured at 450 nm using a microplate spectrophotometer. A standard curve was generated from which the concentrations of MMP-2, MMP-9 and TIMP-1 were obtained. Data analysis Data are shown as the means ± SD of three individual experiments performed in duplicate. For invasion assay, values are expressed as the percentage of invasion compared to control and are presented as mean ± SD of three individual experiments performed in duplicate or triplicate. Data were analyzed by one-way A N O V A followed by Dunnett's test and PO.05 was considered statistically significant. Representative images of Western blot, Zymography and Reverse zymography are shown. 5.3 Results Effect of FSH and LH on ovarian cancer invasion Numerous studies have demonstrated the expression of FSHR and L H R in ovarian cancer cells (Parrott et al., 2001; Zheng et al., 2000). We previously reported that FSHR 137 mRNA and protein are expressed in SKOV-3 and OVCAR-3 cells (Choi et a l , 2004), and the expression of FSHR and L H R in the four ovarian cancer cells tested were confirmed by RT-PCR and Western blot analysis (data not shown). To examine the effect of gonadotropins on invasive capacity of ovarian cancer cells, the Boyden chamber assay using a Matrigel-coated invasion chamber was performed. While no significant change was observed in invasion of OVCAR-3 cells which have little invasiveness in our cell culture system, we observed a significant increase in invasion of CaOV-3, BG-1 and SKOV-3 cells following the treatment with FSH or L H for 2 days (Figure 5.1). FSH stimulated invasive activity in a dose-dependent manner (10, 100 and 1000 ng/ml) with maximal 2-3 fold increase in CaOV-3, BG-1 and SKOV-3 cells. While BG-1 and CaOV-3 cells showed significant response to only higher dose of FSH (100 and 100 ng/ml), 10 ng/ml FSH significantly increased invasive activity in SKOV-3 cell. In contrast, maximal 1.5, 2.5 and 2.2-fold increases were observed at 1000 ng/ml L H in CaOV-3, BG-1 and SKOV-3 cells, respectively, and 100 ng/ml L H also showed a similar level of pro-invasive effect. Considering that FSH and L H showed the most potent effect on invasion in SKOV-3 cells, additional experiments were performed using this cell line to evaluate the mechanism of action of gonadotropins on the stimulation of invasion. In addition, using identical culture conditions as for invasion assay, we found that treatment of cells with gonadotropins did not induce any cell-growth or cyto-toxicity (data not shown) Effect of gonadotropins on mRNA expression, secretion and activation of MMPs and TIMPs in SKOV-3 cells We examined whether gonadotropins modulate the secretion of MMP-2 and MMP-9 from SKOV-3 cells by Western blot analysis. As shown in Figure 5.2 A , 2-day treatment with FSH and L H resulted in enhanced secretion of MMP-2 and MMP-9, which was not affected by pretreatment with AG1478, an EGFR kinase inhibitor. To elucidate whether gonadotropin-induced MMP-2 and MMP-9 secretion was transcriptionally controlled, mRNA expression levels of MMP-2 and MMP-9 were examined by real-time PCR following treatment of SKOV-3 cells with FSH or L H . Dissociation curve analysis of MMP-2 and MMP-9 yielded a single peak and their electrophoresis showed a single specific signal. Treatment with FSH or L H for 24 h resulted in a significant up-regulation 138 of MMP-2 and MMP-9 mRNA in SKOV-3 cells. Moreover, the treatment of the cells with actinomycin D, an inhibitor of transcription, abolished the effects of gonadotropins on M M P and TIMP expression (Figure 5.2 B), suggesting that enhanced M M P secretion by gonadotropins may be regulated at the transcriptional level. Because active MMP-2 and MMP-9 could not be detected by Western blotting, more sensitive zymography and ELISA kits were employed to measure the activity of MMP-2 and MMP-9 following treatment of SKOV-3 cells with FSH or L H . Since the gels were stained with Comassie blue to visualize the enzymatic digestion, the lysis zones representing the enzymatic digestion appeared as clear zones in the Zymography gel. As shown in Figure 5.2 C, treatment with FSH and L H increased active form of MMP-2 (66-kDa) and MMP-9 (86-kDa) as well as their latent forms (72- and 92-kDa, respectively) in a dose-dependent manner (100 and 1000 ng/ml) in SKOV-3 cells. The lytic zones at 66, 72, 88, and 92-kDa were easily inhibited by incubation of the gel with EDTA, a calcium chelator, thus confirming that the activity bands represent MMPs. These results were confirmed by an ELISA assay specific for the active forms of MMP-2 and MMP-9 (Figure 5.2 D). In addition, the secretion pattern of pro-MMPs in zymography was similar to that observed by immunoblot analysis data. TIMPs, the endogenous inhibitors of MMPs, can be regulated by various factors in human cancers, and bind to the catalytic site of MMPs in 1:1 ratio. In this study, mRNA expression and secretion of TIMP-1 and TIMP-2 were markedly decreased by treatment with gonadotropins in a dose-dependent manner, as shown by immunoblot and ELISA assays (Figure 5.3 A , B, and C). We demonstrated that decreased secretion of TIMPs resulted in a reduction in the inhibition of MMPs as assessed by reverse zymography, in which dark bands were undigested gelatin stained with Comassie blue, representing areas of M M P inhibition (Figure 5.3 D). Effect of gonadotropins on mRNA expression, secretion and activation of uPA and PAI-1 in SKOV-3 cells Because uPA was also found at high concentration and its level correlated inversely with prognosis in ovarian ascites and ovarian cancers (Pustilnik et al., 1999), we investigated whether gonadotropins could stimulate uPA mRNA expression and its release in SKOV-3 cells using real-time PCR and immunoblot analysis. Neither mRNA nor 139 protein level of uPA were altered, whereas expression level of PAI-1, an endogenous inhibitor of uPA, was moderately decreased by treatment with FSH or L H (Figure 5.4). Inhibitory effect of MMP inhibitors on gonadotropin-induced invasion in SKOV-3 cells To determine the role of these proteases in the gonadotropin-dependent invasion in SKOV-3 cells, a broad spectrum M M P inhibitor (GM6001) and a specific gelatinase (MMP-2 and MMP-9) inhibitor (SB-3CT) were employed. At the concentration used in our and other studies, these M M P inhibitors have no inhibitory effect on basal invasion rate in ovarian cancer (Rosano et al., 2001). The gonadotropin-induced increase in invasion was significantly reduced by the addition of 10 uM GM6001 and 20 uM SB-3CT as shown in Figure 5.5. It is of interest that the inhibitory effects of SB-3CT on gonadotropin-induced invasion were similar to those of GM6001, suggesting that only gelatinases including MMP-2 and MMP-9, not other groups of MMPs, play an essential role in ovarian cancer invasion stimulated by gonadotropins. Involvement of PKA and PI3K pathway in gonadotropin-induced invasion and MMP secretion in SKOV-3 cells To address the signaling pathway involved in the pro-invasive effect of gonadotropins, we examined the effects of specific signaling inhibitors on gonadotropin-induced invasion. We found that H89, a P K A inhibitor, and LY294002, a PI3K inhibitor, markedly blocked gonadotropin-induced invasion, while PD 98059 (a ERK1/2 kinase inhibitor), GF 109203X (a P K C inhibitor) and SB203580 (a p38 inhibitor) did not cause a substantial inhibition (Figure 5.6 A). Moreover, H89 and LY294002 significantly inhibited the gonadotropin-induced MMP2/9 secretion (Figure 5.6 B). These results indicate that gonadotropins may increase SKOV-3 cell invasion by activating the P K A and PI3K signaling pathways. To further test the effect of FSH and L H on activation of the P K A and PI3K signaling cascades, we examined the phosphorylation status of their downstream second messengers such as CREB and A K T after treatments of the cells with FSH and L H (100 and 1000 ng/ml) for 30 min. We performed an immunoblot analysis with specific antibodies to detect phosphorylated forms of A K T , GSK3a/p\ F H K R and CREB, and total A K T and CREB for normalization. FSH and L H induced 140 phosphorylation of A K T (Ser 473) and CREB at 30 min (Figure 5.6 C and D). The activation of the PI3K pathway was confirmed by the increased phosphorylation of the downstream proteins, GSK3 a/p (glycogen synthase kinase-3 a/p) and F K H R (Forkhead in rhabdomyosarcoma) (Figure 5.6 C). FSH- and LH-induced activations of A K T , GSK3 and F H K R were completely abolished by pretreatment with LY294002, a PI3K inhibitor. Similarly, the P K A inhibitor, H89, completely abolished FSH- and LH-induced phosphorylation of CREB. Treatment with these inhibitors did not result in any cytotoxic effects under the present experimental condition (data not shown). These results suggest that FSH and L H activated the PI3K and P K A pathways in SKOV-3 cells, which may play an important role in invasion of ovarian cancer. 5.4 Discussion Since the hypothesis that pituitary gonadotropins increase the risk of ovarian malignancy and that pregnancies and oral contraceptives protect the ovary by suppressing secretion of these hormones was suggested (Stadel, 1975), numerous studies have examined the role of gonadotropins on ovarian cancer. Treatment with FSH and LH/hCG appeared to stimulate the growth of normal and immortalized OSE and several ovarian cancer cell lines in a dose- and time-dependent manner in vitro. Although these observations have demonstrated the role of gonadotropins in initiation and proliferation of ovarian cancer, the contribution of gonadotropins to other aspects of cancer progression such as metastasis is poorly understood. Gonadotropins have been reported to enhance tumor angiogenesis and adhesion by regulating the expression of vascular endothelial growth factor (VEGF) and integrin subunit alpha (v) and CD44 in ovarian cancer cells (Schiffenbauer et al., 2002; Wang et a l , 2002; Zygmunt et al., 2002). In addition, hCG/LH appears to regulate cell-matrix adhesion and proteolysis during physiological or pathological processes such as trophoblast invasion, ovulation and metastasis of breast and endometrial cancer (Dabizzi et al., 2003; Islami et al., 2001; Rao Ch et al., 2004). Thus, we performed the present study to test the hypothesis that gonadotropins may affect ovarian cancer metastasis by regulating invasion and/or proteolysis. The effect of gonadotropins on ovarian cancer cells using an invasion chamber coated with Matrigel was primarily examined. Treatment with gonadotropins significantly 141 enhanced the invasiveness of three ovarian cancer cell lines; BG-1, CaOV-3 and SKOV-3, whereas no change was observed in OVCAR-3 cells. We can not explain why gonadotropins have no effect on OVCAR-3 cells among the four ovarian cancer cell lines tested in this study. It can be assumed that distinct effects may be proportional to the innate invasive capacity of these cell lines, as the pro-invasive effect of gonadotropins was greatest in SKOV-3 cells (most invasive cells in our culture system), whereas no effect was observed in OVCAR-3 cells (least invasive cells). It is commonly believed that EGFR expression is correlated with potent invasiveness as well as poor prognosis in ovarian cancer, and we previously demonstrated that the more invasive SKOV-3 cells have higher EGFR levels than OVCAR-3 cells. In addition, EGF stimulated MMP-9 production by regulating PI3K signaling in ovarian cancer (Ellerbroek et al., 2001). In this regard, the possibility exists that EGFR could somehow be involved in gonadotropin-stimulated invasion. We previously demonstrated that treatment with gonadotropins increased EGFR in immortalized ovarian surface epithelial (IOSE) and OVCAR-3 cells, but not in SKOV-3 cells (Choi et al., 2005b). In this study, we found that the EGFR kinase inhibitor, AG1478, did not show any significant inhibition of gonadotropin-induced MMP2/9 secretion in SKOV-3 cells (Figure 5.2 A) and gonadotropin-induced PI3K activation. Moreover, the phosphorylation of EGFR was not affected by gonadotropin treatment. These data suggest that the regulation of EGFR expression or activation does not appear to be the primary mechanism for, at least, gonadotropin-induced invasion in SKOV-3 cells. There is evidence that the expression and activation of MMPs and uPA are regulated by various cellular factors (EGF, TGF, LP A , and endothelin) and that the regulation of proteases by these factors eventually affect invasion and metastasis (Hirashima et al., 2003; Pustilnik et al., 1999; Rodriguez et al., 2001; Rosano et al., 2001). Gonadotropins are also involved in the activation and/or expression of M M P and TIMP family members in the physiology and pathophysiology of the ovary and trophoblast (Dabizzi et al., 2003; Hagglund et al., 1999; Islami et al., 2001). These observations prompted us to investigate whether or not gonadotropins may regulate these tumor proteinase systems. Both FSH and L H increased the expression and activation of MMP-2 and MMP-9, and decreased the expression and activation of their inhibitors, TIMP-1 and TIMP-2, in SKOV-3 cells, indicating that gonadotropins enhance the net MMP/TIMP 142 ratio and the capacity for proteolysis in ovarian cancer. Since an incomplete inhibition of invasion implies other mechanisms, we further evaluated the involvement of the uPA system, which is also essential for invasion. Treatment of SKOV-3 cells with FSH and L H did not result in any significant change in uPA mRNA expression and secretion. On the other hand, its inhibitor PAI-1 was moderately decreased by gonadotropins. This is in agreement with a previous study demonstrating that secretion of uPA was unaffected by human menopausal gonadotropins in SKOV-3 cells (McDonnel & Murdoch, 2001). The fact that PAI-1 reduced the migration and invasion of SKOV-3 cells due to its ability to inhibit uPA activation (Whitley et al.,'2004) supports the possibility that down-regulation of PAI-1 by gonadotropins contributes to the stimulation of ovarian cancer invasion. Other studies suggest that PAI-1 not only inhibits uPA but also functions in cell adhesion, angiogenesis and apoptosis to contribute to increased metastasis (Bajou et al., 1998; Palmieri et al., 2002). As for a partial inhibitory effect of M M P inhibitors on gonadotropin-induced invasion, one possible explanation would be that gonadotropins may play a role in other steps of invasion such as cell-matrix adhesion as well as proteolysis. We did not test the involvement of adhesion mechanisms in the pro-invasive effect of FSH and L H in this study. However, it is of interest that treatment of the epithelial ovarian carcinoma M L S with gonadotropins up-regulated CD44 and av-integrin expression, and consequently augmented cell adhesion (Schiffenbauer et al., 2002). The actions of FSH and L H on their principal target cells, such as granulosa and theca cells in the ovary, have been shown to be mediated primarily by their G-protein coupled transmembrane receptors. Furthermore, substantial data support the idea that gonadotropins induce cAMP production and activate the P K A pathway when they bind to their receptor. In addition, gonadotropins may cause an activation of PI3K and A K T in other reproductive tissue including granulosa cells, Sertoli cells and oocytes (Alam et al., 2004; Carvalho et al., 2003; Meroni et al., 2004). Gonadotropins have been also shown to activate E R K and p38 mitogen-activated protein kinase (MAPK) in granulosa cells (Gebauer et al., 1999; Maizels et al., 1998). As for ovarian cancers, we previously demonstrated that both FSH and L H increased EGFR levels through activation of M A P K and PI3K in human OSE cells (Choi et al., 2005b). Indeed, FSH-induced activation of the M A P K cascade and phosphorylated Elk-1 is responsible for its effects on proliferation in 143 OSE and ovarian cancer cells (Choi et al., 2002a). In addition, Ohtani et al. found that FSH significantly up-regulated the levels of PKC alpha mRNA and protein, and proposed the involvement of the P K C pathway in FSH-induced cell proliferation in ovarian cancer cells (Ohtani et al., 2001). FSH and L H also stimulated the growth of human OSE and ovarian cancer cells through the P K A and interleukin 6 (IL-6)/signal transducer and activator of transcription-3 (STAT3) signaling pathway (Syed et al., 2002a). In the present study, the effect of gonadotropins on invasion may be mediated through the PI3K and P K A signaling pathways. Aberrant activity of the PI3K signaling pathway in human cancer is of great interest. In ovarian cancer, the PI3K signaling pathway plays a role in proliferation, anti-apoptosis and tumorigenesis (Vara et al., 2004). Moreover, increasing evidence suggests the involvement of PI3K in cell migration, invasion and metastasis in normal and neoplastic tissues including ovarian cancer (Park et al., 2001). Up-regulation of AKT2 stimulated invasion by overexpression of integrin pi (Arboleda et al., 2003). P K A , a serine/threonine kinase, is the main mediator of cAMP signaling in mammals. Although a number of studies have demonstrated a role of P K A in suppressing the growth of different types of cancers, including ovarian cancer cells (Cho-Chung, 1990), P K A has been recently reported to positively regulate cell migration and invasion by increasing cell-substrate adhesion and/or M M P activation in different cellular models (Dabizzi et al., 2003; O'Connor & Mercurio, 2001; Whittard & Akiyama, 2001). Both FSH and L H , which have dissimilar roles in granulosa and theca cells respectively, have pro-invasive effect on ovarian cancer in this study. The parallel effect of gonadotropins on cell growth, adhesion and the expression of growth factors and their receptors, as well as co-expression of gonadotropin receptors in various normal OSE and ovarian cancer models were demonstrated (Choi et al., 2005b; Parrott et al., 2001; Schiffenbauer et al., 2002; Syed et al., 2002a; Syed et al., 2001; Wang et al., 2002). Considering that FSHR and L H R share various signaling pathways such as M A P K , PI3K and P K A as downstream pathways, the possibility of analogous effects of gonadotropins may exist. For example, PKA-mediated STAT3 activation was involved in both FSH- and L H - induced proliferation in IOSE and ovarian cancer cells (Syed et al., 2002a). These results were different from those of Ivarsson et al. which demonstrated anti-proliferative effects of FSH on OSE and the absence of effect by L H (Ivarsson et al., 2001). In contrast, 144 Zheng et al. demonstrated ovarian cancer growth stimulation by FSH and inhibition of the effect by L H (Zheng et al., 2000). The cause(s) of the discrepancies between the reports remains to be determined. Taken together, our results indicate that gonadotropins may increase proteolysis-dependent invasion by activating the PI3K and P K A pathways. Since ovarian cancer progression involves metastasis and is more common in conditions with high levels of gonadotropins, understanding the role of gonadotropins in invasion and/or metastasis on cellular and molecular levels may help elucidate the etiology of ovarian cancer development. 145 OVCAR-3 CaOV-3 con F10 F100 F1000 L10 L100 L1000 BG-1 0 400 C 0 0 300 0 2 200 0 a um 100 c "3 0 o con F10 F100 F1000 L10 L100 L1000 0 400 c 0 o 300 0 (fl 200 <5 J3 E 3 100 C Cell 0 con F10 F100 F1000 L10 L100 L1000 SKOV-3 o 400 C £ 300 o '200 o X) E 3 C O 100 con F10 F100 F1000 L10 L100 L1000 Figure 5.1 Effect of FSH and L H on ovarian cancer invasion. OVCAR-3 (A), CaOV-3 (B), BG-1 (C) and SKOV-3 cells were seeded in Matrigel-coated invasion chambers in the presence or absence of FSH or L H (10, 100, and 1000 ng/ml). Following incubation for 2 d, filters were stained and invading cells were quantified using an inverted microscope. Data from three individual experiments are presented as the mean ± SD. a, P<0.05 vs. non-treated cells. 146 A: Western blot +AG +AG F100 L100 F100 L100 MMP-9 MMP-2 B: Real-time RT-PCR </j 1 <u Q. 1.0 X < 0.5 & <§> £$> c?> c$ 0 ^ vN* ^ C. Zymography D. ELISA Con F100 F1000 L100 L1000 m m m m Pro-MMP-9 / « — Active-MMP-9 Active-MMP-2 MMP-2 MMP-9 Con FSH LH Con FSH LH 147 Figure 5.2 Effect of gonadotropins on mRNA expression, secretion and activation of MMP-2 and MMP-9 in SKOV-3 cells. A, conditioned media was collected from SKOV-3 cells after 2 d incubation with FSH or L H (100 ng/ml) in the absence or presence of A G 1478 (EGFR kinase inhibitor; 10 uM). The supernatants were normalized based on viable cell number (MTT assay) or P-actin protein levels. Western blot was performed for MMP-2 and MMP-9 (72- and 92-kDa) as described in the Materials and Methods. B, Following 1 d incubation with FSH or L H (100, 1000 ng/ml), expression of mRNA transcripts for MMP-2 and MMP-9, respectively, was detected by real-time PCR. Cells were treated with or without 5 ug/ml actinomycin D for 20 min prior to adding lOOng/ml FSH and L H for Id. C, Enzymatic activity of MMP-2 and MMP-9 was studied in conditioned media from SKOV cells by SDS-PAGE gelatin zymography as described in the Materials and Methods. Arrows, migration positions of latent (top) and active (bottom) MMP-2 and MMP-9. D, M M P gelatinase activities were measured in conditioned media from SKOV cells treated with FSH or L H (100 ng/ml) for 1 or 2 d, using an ELISA assay kit. Real-time PCR and ELISA data from three individual experiments are presented as the mean ± SD. a, PO.05 vs. non-treated cells; b, PO.05 vs. lOOng/ml FSH and L H treated cells. 148 a * u i * Con F 1 0 0 F 1 0 0 0 L 1 0 0 L 1 0 0 0 A. Western blot B. Real time RT-PCR mm Timp-1 — Timp-2 149 Figure 5.3 Effect of gonadotropins on mRNA expression, secretion and activation of TIMP-1 and TIMP-2 in SKOV-3 cells. A, conditioned media was collected from SKOV-3 cells after 2 d incubation with FSH or L H (100, 1000 ng/ml). The supernatants were normalized based on viable cell number (MTT assay) and p-actin protein levels. Western blot was performed for TIMP-1 and TIMP-2 (28- and 21-kDa) as described in the Materials and Methods. B, Following 1 d incubation with FSH or L H (100 and 1000 ng/ml), expression of mRNA transcripts for TIMP-1 and TIMP-2 was analyzed by real-time RT-PCR. Cells were treated with or without 5 ug/ml actinomycin D for 20 min prior to adding 100 ng/ml FSH and L H for Id. C, TIMP-1 secretion was measured in conditioned media from SKOV cells treated with FSH or L H (100 ng/ml) for 1 or 2 d, using an ELISA assay kit. D, Enzymatic activity of TIMP-1 and TIMP-2 was studied in conditioned media from SKOV cells by SDS-PAGE reverse zymography for TIMP-1 and TIMP-2 (28- and 21-kDa). Data for real-time PCR and ELISA are shown as the means ± SD of three individual experiments, a, PO.05 vs. non-treated cells; b, P<0.05 vs. 100 ng/ml FSH and L H treated cells. 150 A. Real time RT-PCR B. Western blot con F100 F1000 L100 L1000 Figure 5.4 Effect of gonadotropins on mRNA expression and secretion of uPA and PAI-1 in SKOV-3 cells. A, Following 1 d incubation with FSH or L H (100 and 1000 ng/ml), expression of mRNA transcripts for uPA and PAI-1 was analyzed by real-time PCR. B, Conditioned media was collected from SKOV-3 cells after 2 d incubation with FSH or L H (100 and 1000 ng/ml). The supernatants were normalized based on viable cell number (MTT assay) and P-actin protein levels. Western blot was performed for uPA and PAI-1 (54- and 45-kDa) as described in the Materials and Methods 151 Figure 5.5 Inhibitory effect of MMP inhibitors on gonadotropin-induced invasion in SKOV-3 cells. Following 20-min pretreatment with vehicle (0.1% DMSO), GM6001 (10 uM), a total M M P inhibitor, or SB-3CT (20 uM), a gelatinase specific inhibitor, the cells were treated with FSH or L H (100 ng/ml) and the invasion assay was performed as described in the Materials and Methods. Data from three individual experiments are presented as the mean ± SD. a, PO.Q5 vs. non-treated cells. 152 A B +LY +H89 con FSH LH C D Con F100 F1OO0 L100 L1000 Con F100 F1000 L100 L1OO0 Figure 5.6 Involvement of PI3K and P K A signaling pathways in gonadotropin-induced invasion and M M P production of SKOV-3 cells. Following 20-min pretreatments with 10 uM LY294002 (PI3K inhibitor), 10uM PD98059 ( M A P K inhibitor), lOuM GF109203 (PKA inhibitor), 20uM SB203580 (p38 inhibitor) or 10uM H89 (PKA inhibitor), the cells were treated with FSH or L H (100 ng/ml), and the invasion assay (A) or Western blot (B) was performed. Immunoblot analysis was performed with increasing doses of FSH and L H (100 and 1000 ng/ml) for 30 min. Phosphorylated A K T (Ser473), GSK3 and F H K R levels were normalized by total A K T (C). Phosphorylated CREB levels were normalized by total CREB (D). Data are shown as the mean ± SD of three individual experiments, a, P<0.05 vs. non-treated cells. 153 5.5 Bibliography Alam, FL, Maizels, E.T., Park, Y . , Ghaey, S., Feiger, Z.J., Chandel, N.S. & Hunzicker-Dunn, M . (2004). J Biol Chem, 279, 19431-40. Arboleda, M.J. , Lyons, J.F., Kabbinavar, F.F., Bray, M.R., Snow, B.E., Ayala, R., Danino, M . , Karlan, B . Y . & Slamon, D.J. (2003). Cancer Res, 63, 196-206. Bajou, K. , Noel, A. , Gerard, R.D., Masson, V. , Brunner, N . , Holst-Hansen, C., Skobe, M . , Fusenig, N.E. , Carmeliet, P., Collen, D. & Foidart, J .M. (1998). Nat Med, 4, 923-8. Carvalho, C.R., Carvalheira, J.B., Lima, M.H. , Zimmerman, S.F., Caperuto, L.C. , Amanso, A. , Gasparetti, A . L . , Meneghetti, V. , Zimmerman, L.F., Velloso, L . A . & Saad, M.J. (2003). Endocrinology, 144, 638-47. Chambers, S.K., Gertz, R.E., Jr., Ivins, C M . & Kacinski, B . M . (1995). Cancer, 75, 1627-33. Cho-Chung, Y.S. (1990). Cancer Res, 50, 7093-7100. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2004). J Clin Endocrinol Metab, 89, 5508-16. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2005). Endocr Relat Cancer, In press. Choi, K . C , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P . C (2002). J Clin Endocrinol Metab, 87, 2245-53. Dabizzi, S., Noci, I., Borri, P., Borrani, E., Giachi, M . , Balzi, M . , Taddei, G.L., Marchionni, M . , Scarselli, G.F. & Arcangeli, A . (2003). Cancer Res, 63, 4281-6. Ellerbroek, S.M., Fishman, D.A., Kearns, A.S., Bafetti, L . M . & Stack, M.S. (1999). Cancer Res, 59, 1635-41. Ellerbroek, S.M., Halbleib, J .M., Benavidez, M . , Warmka, J.K., Wattenberg, E.V., Stack, M.S. & Hudson, L .G. (2001). Cancer Res, 61, 1855-61. Fishman, D.A., Kearns, A. , Chilukuri, K. , Bafetti, L . M . , O'Toole, E.A., Georgacopoulos, J., Ravosa, M.J. & Stack, M.S. (1998). Invasion Metastasis, 18, 15-26. Gebauer, G., Peter, A.T., Onesime, D. & Dhanasekaran, N . (1999). J Cell Biochem, 75, 547-54. Hagglund, A . C , Ny, A. , Leonardsson, G. & Ny, T. (1999). Endocrinology, 140, 4351-8. Hirashima, Y . , Kobayashi, H. , Suzuki, M . , Tanaka, Y . , Kanayama, N . & Terao, T. (2003). J Biol Chem, 278, 26793-802. Islami, D., Mock, P. & Bischof, P. (2001). Semin Reprod Med, 19, 49-53. Ivarsson, K. , Sundfeldt, K. , Brannstrom, M . , Hellberg, P. & Janson, P.O. (2001). Hum Reprod, 16, 18-23. Maizels, E.T., Cottom, J., Jones, J.C. & Hunzicker-Dunn, M . (1998). Endocrinology, 139, 3353-6. McDonnel, A .C . & Murdoch, W.J. (2001). J Steroid Biochem Mol Biol, 78, 185-91. Meroni, S.B., Riera, M.F., Pellizzari, E.H., Galardo, M . N . & Cigorraga, S.B. (2004). J Endocrinol, 180, 257-65. Nakagawa, T., Kubota, T., Kabuto, M . , Sato, K. , Kawano, H. , Hayakawa, T. & Okada, Y . (1994). JNeurosurg, 81, 69-77. O'Connor, K . L . & Mercurio, A . M . (2001). J Biol Chem, 276, 47895-900. Ohtani, K. , Sakamoto, H. , Kikuchi, A . , Nakayama, Y . , Idei, T., Igarashi, N . , Matukawa, T. & Satoh, K. (2001). Cancer Lett, 166, 207-13. 154 Palmieri, D., Lee, J.W., Juliano, R.L. & Church, F.C. (2002). J Biol Chem, 277, 40950-7. Park, B.K. , Zeng, X . & Glazer, R.I. (2001). Cancer Res, 61, 7647-53. Parrott, J.A., Doraiswamy, V. , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Pustilnik, T.B., Estrella, V. , Wiener, J.R., Mao, M . , Eder, A . , Watt, M.A . , Bast, R.C., Jr. & Mills, G.B. (1999). Clin Cancer Res, 5, 3704-10. Rao Ch, V. , L i , X . , Manna, S.K., Lei, Z . M . & Aggarwal, B.B. (2004). J Biol Chem, 279, 25503-10. Rodriguez, G.C., Haisley, C , Hurteau, J., Moser, T.L., Whitaker, R., Bast, R.C., Jr. & Stack, M.S. (2001). Gynecol Oncol, 80, 245-53. Rosano, L. , Varmi, M . , Salani, D., Di Castro, V. , Spinella, F., Natali, P.G. & Bagnato, A . (2001) . Cancer Res, 61, 8340-6. Schiffenbauer, Y.S. , Meir, G., Maoz, M . , Even-Ram, S.C, Bar-Shavit, R. & Neeman, M . (2002) . Gynecol Oncol, 84, 296-302. Schmalfeldt, B., Kuhn, W., Reuning, U . , Pache, L. , Dettmar, P., Schmitt, M . , Janicke, F., Hofler, H . & Graeff, H . (1995). Cancer Res, 55, 3958-63. Schmalfeldt, B., Prechtel, D., Halting, K. , Spathe, K. , Rutke, S., Konik, E., Fridman, R., Berger, U . , Schmitt, M . , Kuhn, W. & Lengyel, E. (2001). Clin Cancer Res, 7, 2396-404. Stadel, B .V. (1975). Am J Obstet Gynecol, 123, 772-4. Syed, V. , Ulinski, G., Mok, S.C. & Ho, S.M. (2002). J Natl Cancer Inst, 94, 617-29. Syed, V. , Ulinski, G., Mok, S .C, Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Vara, J.A.F., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C. & Gonzalez-Baron, M . (2004). Cancer Treatment Reviews, 30, 193-204. Wang, J., Luo, F., Lu, J.J., Chen, P.K., Liu, P. & Zheng, W. (2002). Int J Cancer, 97, 163-7. Whitley, B.R., Palmieri, D., Twerdi, C D . & Church, F.C. (2004). Exp Cell Res, 296, 151-62. Whittard, J.D. & Akiyama, S.K. (2001). J Cell Sci, 114, 3265-72. Zheng, W., Lu, J.J., Luo, F., Zheng, Y . , Feng, Y . , Felix, J .C , Lauchlan, S.C. & Pike, M . C (2000). Gynecol Oncol, 76, 80-8. Zygmunt, M . , Herr, F., Keller-Schoenwetter, S., Kunzi-Rapp, K. , Munstedt, K. , Rao, C.V., Lang, U . & Preissner, K.T. (2002). J Clin Endocrinol Metab, 87, 5290-6. 155 CHAPTER VI. Cyclic AMP-dependent Epac pathway is involved in gonadotropin-induced EGFR overexpression in human ovarian surface epithelial cells5 6.1 Introduction It is generally accepted that the cAMP/adenylyl cyclase (AC)/protein kinase A (PKA) pathway mediates the effects of gonadotropins on their primary target cells such as ovarian granulosa cells. Interestingly, growing evidence suggests that FSHR and L H R can activate a number of key cellular signaling pathways such as PKC, PI3K and M A P K in both a cAMP/PKA-dependent and -independent manner in granulosa cells. Moreover, a new binding target of the cAMP named Epac (exchange protein directly activated by cAMP) was recently identified. Previously, we demonstrated that gonadotropins up-regulate EGFR expression through activation of the ERK1/2 and PI3K pathways, but not P K A , in IOSE cells. In this study, we investigated whether cAMP and/or Epac is involved in the gonadotropin-induced EGFR in IOSE cells. 6.2 Materials and methods Material Human L H and recombinant FSH were provided by Dr. A . F. Parlow (National Hormone and Pituitary Program, Harbor-University of California Los Angels Medical Center, Torrance, CA). 8-Br-cAMP[8-bromoadenosine 4, 5-cyclic monophosphate], 8-CPT-2ME-cAMP [8-(4-chloro-phenylthio)-2'-0-methyladenosine-3',5'-cyclic monophos phate], SQ22536 [9-(Tetrahydro-2-furanyl)-9H-purin-6-amine], E G T A [Ethylene-bis (oxyethyl enenitrilo) tetraacetic acid], B A P T A - A M [l,2-Bis(2-aminophenoxy) ethane-N,N,N',N'-tetraacetic acid tetrakis (acetoxymethyl ester)], and forskolin were purchased from Sigma-Aldrich (Oakville, ON). Antibody against EGFR and p-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho ERK1/2, Akt, and CREB were obtained from Cell Signaling Technology (Beverly, M A ) . An antibody against Epac was purchased from Gene Tex Inc., San Antonio, TX). 5 A version of this chapter will be submitted for publication. Choi JH, Choi K C , Auersperg N , and Leung P C K Cyclic AMP-dependent Epac pathway is involved in gonadotropin-induced E G F R overexpression in human ovarian surface epithelial cells. 156 Cell culture Non-tumorigenic SV40 Tag-immortalized OSE-derived cells (IOSE-80, 80PC and 80PCF) were cultured as previously described in medium 199:MCDB 105 (1:1; Sigma-Aldrich Corp., St. Louis, MO) containing 10 % fetal bovine serum (FBS; Hyclone Laboratories Ltd., Logan, UT), 100 U/ml penicillin G and lOOug/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5 % C02-95 % air at 37°C. At confluency, the cells were passaged with 0.06 % trypsin (1:250)/0.01 % EDTA in M g 2 + /Ca 2 + - free HBSS. The ovarian adenocarcinoma cell lines (OVCAR-3, CaOV-3, and SKOV-3) were cultured in above-mentioned culture conditions and used for the following experiments . Enzyme-linkedimmunosorbent assay (ELISA) for intracellular cAMP To measure intracellular cAMP levels, IOSE and hGL cells ( l x l 0 5 cells/ml) were plated onto 96-well microplates and cultured for 24 d. The cells were then preincubated in serum-free medium for 30 min and treated with FSH or L H for 0, 5 or 15 min. Intracellular cAMP levels were measured using a cAMP Biotrak Enzymeimmunoassay (EIA) sytem (Amersham Pharmacia Biotech, Oakville, ON, Canada), according to the manufacturer's suggested procedure. Cell transfection Dominant negative Epac mutant Epac-R279E was generously provided by Dr. X . Cheng (Department of Pharmacology and Toxicology, University of Texas Medical Branch). DN-Epac vector or empty vector was transfected into IOSE-80PC cells using FuGENE 6 (Roche Applied Science, Laval, QC) according to the manufacturer's suggested protocol at 50 % confluence on 6-well plates. The transfected cells were grown for 24h and used for confirmation of overexpression by immunoblot analysis. Immunoblot assay The cells were seeded at a density of 2 x 105 cells in 35 mm culture dishes and cultured. The cells were washed once with medium, and serum starved for at least 2 h prior to treatments with sample. The cells were washed twice with ice-cold phosphate 157 buffered saline (PBS) and lysed in ice-cold PJPA buffer (150 m M NaCl, 1 % Nonidet P-40, 0.5 % deoxycholate, 0.1 % SDS, 50 mM Tris [pH, 7.5], 1 m M PMSF, lOug/ml leupeptin, and lOOpg/ml aprotinin). The extracts were placed on ice for 15 min and centrifuged to remove cellular debris. The protein concentration of supernatants was determined using the Bradford assay (Bio-Rad Laboratories, Hercules, CA). Thirty ug of total protein was run on 10 % SDS-polyacrylamide gels and electrotransferred to a nitrocellulose membrane (Amersham Pharmacia Biotech.). The membrane was immunoblotted using specific primary antibodies at 4°C overnight. After washing, the signals were detected with horseradish peroxidase-conjugated secondary antibody for 1 h, and visualized using the E C L chemiluminescent system (Amersham Pharmacia Biotech.). 6.3 Results Effect of FSH and LH on intracellular cAMP levels Considering that gonadotropins have shown to stimulate a cAMP-independent pathway in several cell systems, we investigated whether the OSE cells can response to gonadotropin stimulation by increasing cAMP levels as do granulosa cells. Three immortalized ovarian surface epithelial cells (IOSE-80, IOSE-120, and IOSE-80PC) and one immortalized human granulosa luteal cells (SVOG-4M) were treated with FSH or L H , and then cAMP levels were measured using ELISA assay. As shown in Figure 6.1, FSH and L H treatment induced a four- to six-fold increase in intracellular cAMP levels in SVOG-4M cells used as a positive control. A l l three IOSE cells had comparable or slightly increased basal levels of cAMP when compared with SVOG-4M cells. Treatment with FSH or L H for 15 min substantially stimulated the cAMP levels in IOSE cells although the stimulatory effect was less potent than that in SVOG-4M cells. Involvement of increased cAMP in gonadotropin-induced EGFR up-regulation We have previously shown that gonadotropins up-regulate the epidermal growth factor receptor (EGFR) through activation of the ERK1/2 and PI3K pathways in IOSE-80PC cells. To evaluate whether an increased cAMP levels can mediate gonadotropin-induced EGFR overexpression in IOSE-80PC cells, first we examined the effect of a cAMP analogue 8-Br-cAMP (0.5 mM) and an adenylyl cyclase activator forskolin (10 158 uM) on the activation of the ERK1/2 and PI3K pathways. Following treatment with 8-br-cAMP or forskolin, the phosphorylation of E R K 1/2 and Akt was enhanced. (Figure 6.2, data shown for three independent paired experiments, lanes 1 versus 4, 2 versus 5, and 3 versus 6). Moreover, treatment with forskolin or 8-br-AMP for 24h significantly increased the protein expression of EGFR in the IOSE cells (Figure 6.3). Several studies have suggested that gonadotropins play a role in proliferation and steroidogenesis through a cAMP-dependent or -independent increase in calcium levels in a number of cell systems. Using an extracellular and intracellular calcium chelator, EGTA and B A P T A - A M , respectively, we evaluated the association of calcium with the gonadotropins-increased EGFR expression. Neither of calcium chelators significantly inhibited the changes in EGFR expression. In contrast, pretreatment with an adenylyl cyclase inhibitor SQ 22,536 notably blocked the stimulatory effect of gonadotropins on EGFR expression (Figure 6.4). Effect of the Epac-specific cAMP analogue on activation of ERK1/2 and PI3K pathways and expression of EGFR Even though P K A pathway has been considered an exclusive target of cAMP, in a previous study, we failed to find an association of the P K A pathway with the gonadotropin-induced EGFR up-regulation. In this regard, it seems reasonable to examine a new target of cAMP, Epac, also known as ' cAMP guanine nucleotide exchange factors' (cAMP-GEFs) (de Rooij et al., 1998; Kawasaki et al., 1998). First, using immunoblot analysis, we demonstrated the basal expression of Epac in all four IOSE cells tested (Figure 6.5). It is of note that the protein expression of Epac was hardly detectable in all three tested ovarian cancer cell lines (OVCAR-3, SKOV-3 and CaOV-3 cells). To investigate whether gonadotropins- or cAMP-induced EGFR up-regulation is associated with Epac, the cells were treated with a new cAMP analogue, 8-(4-chloro-phenylthio)-2'-0-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2ME-cAMP), which specifically activates Epac, but not P K A . As shown in Figure 6.6, the Epac-specific cAMP analogue stimulated the ERK1/2 and PI3K pathways and increased EGFR expression in IOSE-80PC cells. 159 Effect of Epacl on the gonadotropins-induced EGFR up-regulation Transient transfection of IOSE-80PC cells with dominant negative Epac vector was performed to evaluate whether Epac is involved in the response to gonadotropins. The expression of Epac mutants was significantly enhanced in DN-Epac-IOSE cells when compared to empty vector-transfected cells (Figure 6.7). Transfected cells were incubated with FSH or L H (lOOng/ml) for 24 h, and then assayed for immunoblot to evaluate the protein expression of EGFR. Both gonadotropins induced a significant increase in the EGFR expression in vector-transfected IOSE cells, but not in DN-Epac-IOSE cells (Figure 6.7). These results suggest that the Epac mediates the gonadotropin-increased EGFR expression in OSE cells. 6.4 Discussion Although gonadotropins have been reported to exert a biological role in the human OSE cells, little is known about their signaling mechanisms. Previously, we demonstrated that treatment with gonadotropins increase the expression of EGFR, resulting in an additive stimulation of mitogenesis in presence of EGF, a ligand for the EGFR. Moreover, the stimulatory effect was mediated by the activation of PI3K and ERK1/2 pathways, but not by P K A pathway which is a classical binding target of gonadotropin-induced cAMP, suggesting that a possible involvement of an additional second messenger such as calcium and/or an alternative binding target of cAMP in the gonadotropin signaling in OSE cells. In this study, we found that gonadotropin-induced EGFR expression is not likely dependent on the stimulation of calcium influx, but it is mediated by the activation of adenylyl cyclase followed by increase in cAMP levels. We also demonstrated, for the first time, that the novel target of cAMP, Epac, is expressed in IOSE and ovarian cancer cells, and it is responsible for mediating gonadotropin-induced activation of the E R K 1/2 and PI3K pathways, resulting in EGFR up-regulation in IOSE-cells. The observation regarding the involvement of Epac in gonadotropin and cAMP-induced signaling in IOSE cells is in agreement with recent studies on granulosa and ovarian cancer cells. In human granulosa luteal cells, increase in cAMP levels stimulated by L H and forskolin enhanced the expression of Epac and an Epac-specific cAMP 160 analogue as well as L H and forskolin induced progesterone secretion in a dose-dependent manner (Chin & Abayasekara, 2004). Similarly, Ramgarajan et al reported that cAMP mediated integrin-mediated adhesion of OVCAR-3 cells to fibronection through the Epac (Rangarajan et al., 2003). It is of note that our immunoblot analysis revealed that Epac protein is highly expressed in IOSE cells while it is hardly detectable in ovarian cancer cells including OVCAR-3 cells. Further experiments should be carried out to evaluate whether the significant change in Epac expression from pre-malignant IOSE cells to its neoplastic counterpart is associated with differential responses to gonadotropins stimulation in OSE and ovarian cancer cells. In a previous study, we found that the invasion stimulatory effect of gonadotropins involve the P K A and PI3K pathways in ovarian cancer cells. Some studies suggested that the P K A via the IL-6/STAT3 pathway mediates gonadotropin-induced proliferation of OSE and ovarian cancer cells (Syed et al., 2002b; Syed et al., 2001). Treatment of ovarian epithelial cancer cells with FSH significantly increased the levels of P K C mRNA and protein, suggesting that the stimulation of P K C is involved in FSH-induced cell proliferation (Ohtani et al., 2001). Taken together, these observations suggest that gonadotropin-induced cAMP levels stimulate the activation of both PKA-dependent and -independent signaling pathways, resulting in diverse biological roles of gonadotropins in OSE and its neoplastic counterpart. 161 700 4M 80 120 80PC Figure 6.1 Effect of F S H and L H on intracellular c A M P levels in IOSE cells. The cells were treated with FSH or L H for 0,5 and 15 min. As described in the Materials and Methods, ELISA assay was performed to evaluate the intracellular cAMP levels. SVOG-4m, the human granulosa luteal cells were used as a positive control. 162 A B vehicle 8 -br -cAMP vehicle forskolin 1 2 3 4 5 6 1 2 3 4 5 6 P - E R K 1 / 2 . n = P-Akt (3-actin Figure 6.2 Effect of 8-br-cAMP (A) and forskolin (B) on the activation of the ERK1/2 and PI3K signaling pathways in IOSE cells. The phosphorylation of E R K 1/2(A) and PI3K(B) was examined in IOSE-80PC cells after treatment with 8-br-cAMP (0.5 mM) or forskolin (10uM) for 15mins, and immunoblot analysis was performed as described in the Materials and Methods. The phosphorylated ERK1/2 and phosphorylated A K T (Ser473) were normalized by P-actin. Three independent paired experiments, lanes 1 versus 4, 2 versus 5, and 3 versus 6. 163 A vehicle 8-br-cAMP 1 2 3 4 5 6 E G F R p-actin ° vehicle forskolin 1 2 3~ 4 5 6 (3-actin — • — — — — Figure 6.3 Effect of 8-br-cAMP (A) and forskolin (B) on E G F R expression in IOSE cells. The expression of EGFR was examined in IOSE-80PC cells following treatment with 8-Br-cAMP (0.5 mM) or forskolin (lOuM) for 24 h, and immunoblot analysis was performed as described in the Materials and Methods. Three independent paired experiments, lanes 1 versus 4, 2 versus 5, and 3 versus 6. 164 SQ BA E G ConSQ BA EG F L F L F L F L E G F R * * '" ' «m m* Wt •-• p-actin Figure 6.4 Effect of E G T A , B A P T A - A M , and SQ 22,536 on gonadotropins-induced E G F R up-regulation in IOSE cells. The expression of EGFR was examined in IOSE-80PC cells following treatment with FSH (lOOng/ml) or L H (lOOng/ml) in an absence or presence of EGTA(EG), B A P T A - A M (BA)or SQ 22,536 (SQ). 165 80PC 80 120 OV Ca SK E p a d p-actin Figure 6.5 Expression of Epac in IOSE cells (IOSE-80PC, IOSE-80. and IOSE-120) and ovarian cancer cells (OVCAR -3 , CaOV-3, and SKOV-3). The levels of Epacl protein were demonstrated using immunoblot analysis. Each blot is representative of at least 3 independent experiments. 166 vehicle 8 M E - C P T - c A M P E G F R B-actin 15 30min P -Akt Figure 6.6 Effect of an Epac-specific cAMP analogue 8-CPT-2ME-cAMP on the expression of EGFR (A) and the activation of the ERK1/2 and PI3K pathways (B). The expression level of EGFR was examined in IOSE-80PC (80PC) after treatment with 8-CPT-2ME-cAMP (lOuM) for 24h (A). Following treatment with 8-CPT-2ME-cAMP (lOuM) in a time-dependent manner (0, 5, 15, 30 min), the phosphorylation of Akt and ERK1/2 was evaluated (B). Each blot is representative of at least 3 independent experiments. 167 DN-Epac Vector Con FSH LH Con FSH LH EGFR E p a d P-actin Figure 6.7 Effect of overexpression of dominant negative Epac on gonadotropins-induced EGFR up-regulation in IOSE cells. IOSE-80PC cells (IOSE) were transfected with DN-Epac 1 expression vector using FuGENE 6 reagent to produce DN-Epac-IOSE cells. Overexpression of DN-Epac was confirmed by immunoblot analysis using an antibody against Epac. Non transfected- and DN-Epac vector transfected-IOSE cells were treated with lOOng/ml FSH or L H for 24 h, and the expression of EGFR was evaluated by immunoblot analysis. 168 6.5 Bibliography Alam, H. , Maizels, E.T., Park, Y . , Ghaey, S., Feiger, Z.J., Chandel, N.S. & Hunzicker-Dunn, M . (2004). J Biol Chem, 279, 19431-40. Arboleda, M.J. , Lyons, J.F., Kabbinavar, F.F., Bray, M.R., Snow, B.E., Ayala, R., Danino, M . , Karlan, B . Y . & Slamon, D.J. (2003). Cancer Res, 63, 196-206. Bajou, K. , Noel, A. , Gerard, R.D., Masson, V. , Brunner, N . , Holst-Hansen, C., Skobe, M . , Fusenig, N.E. , Carmeliet, P., Collen, D. & Foidart, J .M. (1998). Nat Med, 4, 923-8. Carvalho, C.R., Carvalheira, J.B., Lima, M.H. , Zimmerman, S.F., Caperuto, L.C. , Amanso, A. , Gasparetti, A . L . , Meneghetti, V. , Zimmerman, L.F., Velloso, L . A . & Saad, M.J. (2003). Endocrinology, 144, 638-47. Chambers, S.K., Gertz, R.E., Jr., Ivins, C M . & Kacinski, B . M . (1995). Cancer, 75, 1627-33. Cho-Chung, Y.S. (1990). Cancer Res, 50, 7093-7100. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2004). J Clin Endocrinol Metab, 89, 5508-16. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2005). Endocr Relat Cancer, In press. Choi, K . C , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2002). J Clin Endocrinol Metab, 87, 2245-53. Dabizzi, S., Noci, I., Borri, P., Borrani, E., Giachi, M . , Balzi, M . , Taddei, G.L., Marchionni, M . , Scarselli, G.F. & Arcangeli, A . (2003). Cancer Res, 63, 4281-6. Ellerbroek, S.M., Fishman, D.A., Kearns, A.S., Bafetti, L . M . & Stack, M.S. (1999). Cancer Res, 59, 1635-41. Ellerbroek, S.M., Halbleib, J .M., Benavidez, M . , Warmka, J.K., Wattenberg, E.V., Stack, M.S. & Hudson, L .G. (2001). Cancer Res, 61, 1855-61. Fishman, D.A., Kearns, A. , Chilukuri, K. , Bafetti, L . M . , O'Toole, E.A., Georgacopoulos, J., Ravosa, M.J. & Stack, M.S. (1998). Invasion Metastasis, 18, 15-26. Gebauer, G., Peter, A.T., Onesime, D. & Dhanasekaran, N . (1999). J Cell Biochem, 75, 547-54. Hagglund, A . C , Ny, A. , Leonardsson, G. & Ny, T. (1999). Endocrinology, 140,4351-8. Hirashima, Y . , Kobayashi, H. , Suzuki, M . , Tanaka, Y . , Kanayama, N . & Terao, T. (2003). J Biol Chem, 278, 26793-802. Islami, D., Mock, P. & Bischof, P. (2001). Semin Reprod Med, 19,49-53. Ivarsson, K. , Sundfeldt, K. , Brannstrom, M . , Hellberg, P. & Janson, P.O. (2001). Hum Reprod, 16, 18-23. Maizels, E.T., Cottom, J., Jones, J.C. & Hunzicker-Dunn, M . (1998). Endocrinology, 139, 3353-6. McDonnel, A .C . & Murdoch, W.J. (2001). J Steroid Biochem Mol Biol, 78, 185-91. Meroni, S.B., Riera, M.F., Pellizzari, E.H., Galardo, M . N . & Cigorraga, S.B. (2004). J Endocrinol, 180, 257-65. Nakagawa, T., Kubota, T., Kabuto, M . , Sato, K. , Kawano, H. , Hayakawa, T. & Okada, Y . (1994). JNeurosurg, 81, 69-77. O'Connor, K . L . & Mercurio, A . M . (2001). J Biol Chem, 276,47895-900. Ohtani, K. , Sakamoto, H. , Kikuchi, A. , Nakayama, Y . , Idei, T., Igarashi, N . , Matukawa, T. & Satoh, K . (2001). Cancer Lett, 166, 207-13. 169 Palmieri, D., Lee, J.W., Juliano, R.L. & Church, F.C. (2002). J Biol Chem, 211,40950-7. Park, B.K. , Zeng, X . & Glazer, R.I. (2001). Cancer Res, 61, 7647-53. Parrott, J.A., Doraiswamy, V. , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Pustilnik, T.B., Estrella, V. , Wiener, J.R., Mao, M . , Eder, A. , Watt, M.A . , Bast, R . C , Jr. & Mills, G.B. (1999). Clin Cancer Res, 5, 3704-10. Rao Ch, V. , L i , X . , Manna, S.K., Lei, Z . M . & Aggarwal, B.B. (2004). J Biol Chem, 279, 25503-10. Rodriguez, G . C , Haisley, C , Hurteau, J., Moser, T.L., Whitaker, R., Bast, R . C , Jr. & Stack, M.S. (2001). Gynecol Oncol, 80, 245-53. Rosano, L. , Varmi, M . , Salani, D., Di Castro, V. , Spinella, F., Natali, P.G. & Bagnato, A . (2001) . Cancer Res, 61, 8340-6. Schiffenbauer, Y.S. , Meir, G., Maoz, M . , Even-Ram, S.C, Bar-Shavit, R. & Neeman, M . (2002) . Gynecol Oncol, 84, 296-302. Schmalfeldt, B., Kuhn, W., Reuning, U . , Pache, L. , Dettmar, P., Schmitt, M . , Janicke, F., Hofler, H . & Graeff, H . (1995). Cancer Res, 55, 3958-63. Schmalfeldt, B. , Prechtel, D., Halting, K. , Spathe, K. , Rutke, S., Konik, E., Fridman, R., Berger, U . , Schmitt, M . , Kuhn, W. & Lengyel, E. (2001). Clin Cancer Res, 1 , 2396-404. Stadel, B .V. (1975). Am J Obstet Gynecol, 123, 772-4. Syed, V . , Ulinski, G., Mok, S.C. & Ho, S.M. (2002). J Natl Cancer Inst, 94, 617-29. Syed, V. , Ulinski, G., Mok, S .C, Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Vara, J.A.F., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C. & Gonzalez-Baron, M . (2004). Cancer Treatment Reviews, 30, 193-204. Wang, J., Luo, F., Lu, J.J., Chen, P.K., Liu, P. & Zheng, W. (2002). Int J Cancer, 97, 163-7. Whitley, B.R., Palmieri, D., Twerdi, C D . & Church, F.C. (2004). Exp Cell Res, 296, 151-62. Whittard, J.D. & Akiyama, S.K. (2001). J Cell Sci, 114, 3265-72. Zheng, W., Lu, J.J., Luo, F., Zheng, Y . , Feng, Y . , Felix, J .C , Lauchlan, S .C & Pike, M . C (2000). Gynecol Oncol, 76, 80-8. Zygmunt, M . , Herr, F., Keller-Schoenwetter, S., Kunzi-Rapp, K. , Munstedt, K. , Rao, C.V., Lang, U . & Preissner, K.T. (2002). J Clin Endocrinol Metab, 87, 5290-6. 170 CHAPTER VII. Expression of leptin receptors and potential effect of leptin on the cell growth and activation of mitogen-activated protein kinases in ovarian cancer cells6 7.1 Introduction The growth regulation of normal and neoplastic OSE cells by endocrine factors may affect ovarian cancer development. To our knowledge, a potential role of leptin in normal OSE and neoplastic counterparts is unknown. Thus, in the present study, we investigated the expression of leptin receptors in immortalized OSE (IOSE) and ovarian cancer cell lines. In addition, we further examined the potential effects of leptin on cell growth and activation of mitogen-activated protein kinases (MAPKs) in BG-1 ovarian cancer cell line. 7.2 Materials and methods Materials Recombinant leptin was purchased from Sigma-Aldrich Corp. (Oakville, ON). Cell culture The use of ovarian cells and cancer cell lines was approved by the University of British Columbia Clinical Screening Committee for Research and Other Studies Involving Human Subjects. The ovarian cells including primary granulosa-luteal and immortalized granulosa cell line (SVOG-4o), and immortalized OSE cell lines (IOSE-120, IOSE-80, and IOSE-80PC) were cultured in medium 199:MCDB 105 (Sigma-Aldrich Corp., St. Louis, MO) containing 10% fetal bovine serum (FBS; Hyclone Laboratories Ltd., Logan, UT), 100 U/ml penicillin G and lOOug/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5 % C02-95 % air. The cells were sub-cultured with 0.06 % trypsin (1:250)/0.01 % EDTA in M g 2 + / C a 2 + - free HBSS when confluent. The MCF-7 breast cancer cell line was used as a positive control (Dieudonne et al., 2002). For monolayer culture, the ovarian cells were maintained on tissue culture 6 A version of this chapter has been published. Choi JH, Park SH, Leung PCK, Choi K - C 2005 Expression of leptin receptors and potential effect of leptin on the cell growth and activation of mitogen-activated protein kinases in ovarian cancer cells. J Clin Endocrinol Metab 90 (1): 207-210 171 dishes (Falcon; Becton Dickinson, Franklin Lakes, NJ). The primary human granulosa-luteal cells were collected from the patients undergoing an In Vitro Fertilization-Embryo Transfer program in the Department of Obstetrics and Gynaecology, University of British Columbia. The immortalized ovarian cell lines were generated from primary granulosa-luteal or ovarian surface epithelial cells by transfecting SV40-T antigen. The ovarian carcinoma cell lines, BG-1, CaOV-3, OVCAR-3 and SKOV-3 cells, were cultured in abovementioned culture conditions and used for the following experiments. The IOSE cell lines were generously provided by Drs. N . Auersperg (University of British Columbia, Vancouver, BC) and A . Godwin (Fox Chase Cancer Center, Philadelphia, PA). RNA extraction, RT-PCR procedure and Southern blot analysis Total R N A was prepared from cultured cells using the RNaid kit (Bio/Can Scientific, Mississauga, Canada) according to the manufacturer's suggested procedure. R N A integrity was confirmed by using agarose gel electrophoresis and ethidium bromide staining. The total R N A concentration was determined from spectrophotometric analysis at A260/280-Complementary D N A (cDNA) was synthesized from 2.5g total R N A by reverse transcription (RT) at 37 C for 2 h using a first strand cDNA synthesis kit (Amersham Pharmacia Biotech., Oakville, ON). The synthesized cDNA was used as a template for polymerase chain reaction (PCR) amplification. A semi-quantitative PCR amplification was carried out with denaturing for 1 min at 94 C, annealing for 60 sec at 55 C, extension for 90 sec at 72 C, and a final extension for 15 min at 72 C using a thermal cycler (DNA Thermal Cycler, Perkin-Elmer, Norwalk, CT). The primers were designed to amplify leptin receptors, Ob-Rb (long isoform) and Ob-Rt (short isoform), based on the published sequences (2). In addition, amplification of human glyceraldehyde phosphate dehydrogenase (GAPDH) was performed using specific primers (Choi et al., 2001a) to rule out the possibility of R N A degradation, and was used to control the variation in mRNA amount in PCR reaction. The primers of Ob-Rb (long isoform) consist of sense 5'-T C A CCC A G T G A T T A C A A G CT-3' and antisense 5'-CTG G A G A A C TCT GAT GTC CG-3' (1071-bp). The sequences of Ob-Rt (short isoform) amplification are sense 5'-CAT TTT A T C CCC ATT G A G A A G TA-3 ' and antisense 5'-CTG A A A ATT A A G TCC TTG TGC C C A G-3' (273-bp). Thirty two cycles of PCR amplification were 172 employed to obtain PCR products of both Ob-Rb and Ob-Rt. The PCR reactions were performed in 25ul PCR mixture containing 1 X PCR buffer, 0.2 m M each dNTP, 1.6 mM MgCb, 50 pmol specific primers, each cDNA template, and 0.25 unit Taq polymerase. Twelve ul of PCR products was analyzed by agarose (1%) gel electrophoresis and visualized by ethidium bromide staining, and the sizes were estimated by comparison to D N A molecular weight markers. Following electrophoresis, Southern blot analysis was performed to detect a specific signal with digoxigenine-labeled probes for leptin receptors and G A P D H as previously described (Choi et al., 2001a). Immunoblot assay The cells were seeded at a density of 2 x 105 cells in 35 mm culture dishes and cultured in a humidified atmosphere of 5 % C02-95 % air at 37 C. The cells were washed once with medium, and serum starved for 4 h prior to treatments with leptin in a dose-dependent manner. The cells were washed twice with ice-cold PBS and lysed in ice-cold RIPA buffer (150 mM NaCl, 1% Nondiet P-40, 0.5% deoxycholate, 0.1 % SDS, 50 mM Tris (pH, 7.5), and 1 m M PMSF, lOug/ml leupeptin, lOOug/ml aprotinin). The extracts were placed on ice for 15 min and centrifuged to remove cellular debris. Protein amount of supernatants was determined using a Bradford assay (Bio-Rad Laboratories). Thirty ug of total protein was run on 10% SDS-PAGE gels and electrotransferred to a nitrocellulose membrane (Amersham Pharmacia Biotech). The membrane was immunoblotted using specific primary antibodies at 4 C overnight. After washing, the signals were detected with horseradish peroxidase-conjugated secondary antibody for 1 h, and visualized using the E C L chemiluminescent system (Amersham Pharmacia Biotech). The quantitation of blots was performed on Scion Image 4.0.2. Briefly, intensities of interested protein bands were scanned and quantified by density plot. The antibodies of total- and phosphorylated p38 mitogen-activated protein kinase (p-p38), and total- and phosphorylated extracellular signal-regulated kinase (ERK1/2) were purchased from Biosource International, Inc. (Camarillo, CA). [ H]thymidine incorporation assay 173 [3H]thymidine incorporation assay was performed to analyze the effect of leptin on proliferative index in BG-1 cells. The cells were plated in 24-well plates at 2 x 104 cells/well in 0.5 ml medium 199:MCDB105 supplemented with 10 % FBS and antibiotics, and incubated for 48 h. Before treatment with leptin, the cells were starved in serum-free media for 4 h. After starvation, the cells were incubated with 1, 10, 100, and 1000 ng/ml of leptin in the absence or presence of PD98059 (20uM), an inhibitor of mitogen-activated protein kinase kinase (MEK), in serum-free media for 24 h. One Ci[3H]thymidine (5.0 Ci/mmol; Amersham Pharmacia Biotech.) was treated with leptin. At the end of the incubation period, the culture medium was removed and cells were washed three times with PBS, followed by precipitation with 0.5 ml 10 % trichloroacetic acid for 20 min at 4 C. The precipitate was washed in methanol twice and solubilized in 0.5 ml 0.1 N sodium hydroxide, and the incorporated radioactivity was measured in the Tri-Carb Liquid Scintillation Analyzer (Model 2100TR; Packard Instrument Com., Meriden, CT) as previously described. Data analysis Data are presented as the mean ± SD. Data were analyzed by one-way A N O V A followed by Tukey's multiple comparison test or Dunnett's test. P<0.05 was considered statistically significant. 7.3. Results Expression of leptin receptors, Ob-Rb and Ob-Rt mRNAs The mRNA expression of leptin receptors in ovarian cells and ovarian cancer cells was investigated. A predicted PCR product of Ob-Rb (long isoform) was obtained as 1071-bp by specific primers and confirmed by Southern blot analysis using DIG-labeled probe in MCF-7 (lane 1), IOSE-80PC (a post-crisis cell line, lane 6), BG-1 (lane 7), OVCAR-3 (lane 9) and SKOV-3 (lane 10) cells as demonstrated in Figure 7.1. However, we failed to see the mRNA expression of Ob-Rb in primary granulosa-luteal cells (lane 3), immortalized granulosa cell line (SVOG-4o, lane 3); IOSE-120 (lane 4), IOSE-80 (lane 5) and CaOV-3 cell line (lane 8) in Figure 7.1. In contrast to the differential expression of Ob-Rb, a short isoform of leptin receptors (Ob-Rt) was observed in all ovarian and ovarian 174 cancer cell lines as shown in Figure 7.1. Two isoforms of leptin receptors were observed in MCF-7, a breast cancer cell line, as a positive control (lane 1). Effect of leptin on ERK1/2 and p38 MAPKs To investigate the role of leptin on E R K 1/2 and p38 M A P K activation, the cells were treated with increasing doses of leptin (1, 10, 100, and 1000 ng/ml) for 15 min in BG-1 cells that expressed both short and long isoforms of leptin receptors. The phosphorylated forms of E R K 1/2 and p38 were measured following treatments with leptin. As seen in Figure 7.2, treatment with leptin (1, 10, 100 and 1000 ng/ml) resulted in an activation of ERK1/2 in BG-1 cells. Interestingly, treatments with leptin inhibited a constitutive phosphorylation of p38 M A P K in BG-1 cells (Figure 7.3). However, no significant difference was observed in the total E R K 1/2 and p38 M A P K within 15 min in these cells Effect of leptin on proliferative index To evaluate a physiological role of leptin in the cell growth of ovarian cancer, a [3H]thymidine incorporation assay was performed in the absence or presence of PD98059 (20uM) as previously described (Choi et al., 2001a). ERK1/2 play an important role in the cell growth of neoplastic cells, and PD98059, an inhibitor of M E K , was used to examine an involvement of this pathway caused by leptin treatment. Treatments with high concentrations of leptin (100 and 1000 ng/ml) resulted in the growth stimulation in BG-1 cells (Figure 7.4 A) . However, low doses of leptin (1 and 10 ng/ml) for 24 h did not induce any significant change in cell proliferation in these cells. It is of interest that treatment with PD98059 pretreatment completely reversed leptin-induced cell growth in BG-1 cells as shown in Figure 7.4 B. These results indicate that ERK1/2 M A P K is involved in the cell growth by leptin in ovarian cancer as a downstream pathway. 7.4 Discussion A correlation between an increased risk of ovarian cancer and obesity has not been verified, although obesity is one of risk factors in breast cancer development (Dieudonne et al., 2002; Hu et al., 2002; Laud et al., 2002). Leptin has been demonstrated to stimulate the proliferation of both normal and malignant breast epithelial cells by activating OB-Rb, 175 a long form of the leptin receptor. In addition, physiologic concentrations of leptin (25-100 ng/mL) activated both stress-activated protein kinase (SAPK) / Jun N-terminal kinase (INK) and ERK/AP-1 pathways in breast cancer cells (Hu et al., 2002). In addition to the role of leptin in breast cancer development, leptin has been positively associated with endometrial carcinogenesis as a consequence of obesity (Petridou et al., 2002). In the ovary, leptin receptor is expressed and leptin is present in follicular fluid, suggesting that leptin may induce biological responses and play a role in ovarian functions of human and other species (Karlsson et al., 1997; Ryan et al., 2003). However, the role of leptin in ovarian cancer has not been elucidated. Thus, in the present study, the expression of leptin receptors in IOSE and ovarian cancer cell lines was investigated. Both short and long isoforms of leptin receptors were observed in IOSE-80PC (a post-crisis cell line), BG-1, OVCAR-3 and SKOV-3 cell lines as well as MCF-7 breast cancer cell line, suggesting that leptin may play a role via these leptin receptors in ovarian cancer. In addition, treatment with leptin resulted in the cell growth of BG-1 ovarian cancer cell line that expresses both short and long isoforms of leptin receptors. We tested the stimulatory effect of leptin in the cell growth of IOSE-80PC and SKOV-3 cells that expressed a high level of long isoform of leptin receptor, but there was no significant difference in the cell proliferation by leptin in these cells (data not shown). These results suggest that not all ovarian cancer cell lines respond to leptin treatment, despite the presence of its receptors. As the first attempt to investigate the signaling pathway of leptin-induced cell growth in ovarian cancer, we examined the effect of leptin on the activation of E R K 1/2 and p38 M A P K . Treatment with leptin (1, 10, 100 and 1000 ng/ml) resulted in an activation of ERK1/2 and inhibited a constitutive phosphorylation of p38 M A P K in BG-1 cells. In addition, treatment with PD98059 pretreatment completely reversed leptin-induced cell growth in these cells, indicating that E R K 1/2 M A P K is involved in leptin-induced cell growth of ovarian cancer cells. Treatment of MCF-7 breast cancer cells with leptin (20 nM) induced an activation of E R K 1/2 M A P K and phosphorylation of STAT3 (Dieudonne et al., 2002). In addition, recent study demonstrated that leptin induced time- and dose-dependent signal transducer and activator of transcription 3 (STAT3) phosphorylation and ERK1/2 activation in breast carcinoma cells (Yin et al., 2004). It is noteworthy that leptin 176 decreased a constitutive phosphorylation of p38, which may be related with an inhibition of apoptosis in these cells. The effect of leptin on apoptosis in neoplastic OSE cells warrants future investigation. , In summary, we demonstrated for the first time that both short and long isoforms of leptin receptors are expressed in ovarian cancer cells, and treatment with leptin resulted in the growth stimulation of BG-1 cells via E R K 1/2 M A P K pathway. These results suggest that further studies are necessary to validate whether leptin may be a potential regulator for ovarian cancer. 177 Figure 7.1 Expression of Ob-Rb (long isoform) and Ob-Rt (short isoform) leptin receptors in various ovarian cells and ovarian carcinoma cell lines. The mRNA expression of Ob-Rb and Ob-Rt was investigated by RT-PCR. 1, MCF-7; 2, human granulosa luteal cells; 3, immortalized granulosa (SVOG-4o); 4, immortalized ovarian surface epithelium (IOSE)-120; 5, IOSE-80; 6, IOSE-80PC; 7, BG-1; 8, CaOV-3; 9, OVCAR-3; 10, SKOV-3 178 1 2 3 4 5 6 Figure 7.2 Effect of leptin on ERK1/2 activation in BG-1 ovarian cancer cell line. To investigate the role of leptin on ERK 1/2 activation, the cells were treated with increasing doses of leptin (1, 10, 100, and 1000 ng/ml) for 15min. The phosphorylated form of ERK1/2 (P-ERK1/2) normalized by total ERK1/2 (T-EKR1/2) was analyzed in BG-1 cells. Data are presented as the mean ± SD of three individual experiments, a, P<0.05 vs. untreated control. 1, untreated control; 2, vehicle; 3, leptin (1 ng/ml) treatment; 4, leptin (10 ng/ml) treatment; 5, leptin (100 ng/ml) treatment; 6, leptin (1000 ng/ml) treatment 179 1 2 3 4 5 6 Figure 7.3 Effect of leptin on p38 activation in BG-1 ovarian cancer cell line. To investigate the role of leptin on r>38 activation, the cells were treated with increasing doses of leptin (10"9, 10"8, 1CT or 1(T M) for 15 min. The phosphorylated form of p38 (P-p38) normalized by total form of p38 (T-p38) was analyzed in BG-1 cells. Data are presented as the mean ± SD of three individual experiments, a, P<0.05 vs. untreated control. 1, untreated control; 2, vehicle; 3, leptin (1 ng/ml) treatment; 4, leptin (10 ng/ml) treatment; 5, leptin (100 ng/ml) treatment; 6, leptin (1000 ng/ml) treatment 180 18a B Control 1 10 100 1000 Concentration of Leptin (ng/ml) Control DMSO 1000 1000 + PD98059 Concentration of Leptin (ng/ml) Figure 7.4 Effect of leptin on cell proliferation in BG-1 cells. BG-1 cells were treated with different concentration of Leptin in the absence (A) and presence (B) of PD98059 (20pM) for 24 h. A proliferative index was measured using the thymidine incorporation assay. Values are the mean±SD for three individual experiments with triplicate, a, P<0.05 vs. untreated control; b, PO.05 vs. leptin (1000 ng/ml) treatment 181 7.5 Bibliography Choi, K . C , Auersperg, N . & Leung, P.C. (2001). J Clin Endocrinol Metab, 86, 5075-8. Dieudonne, M.N . , Machinal-Quelin, F., Serazin-Leroy, V . , Leneveu, M . C , Pecquery, R. & Giudicelli, Y . (2002). Biochem Biophys Res Commun, 293, 622-8. Hu, X . , Juneja, S .C, Maihle, N.J. & Cleary, M.P. (2002). J Natl Cancer Inst, 94, 1704-11. Karlsson, C , Lindell, K. , Svensson, E., Bergh, C , Lind, P., Bill ig, H. , Carlsson, L . M . & Carlsson, B. (1997). J Clin Endocrinol Metab, 82, 4144-8. Laud, K. , Gourdou, I., Pessemesse, L. , Peyrat, J.P. & Djiane, J. (2002). Mol Cell Endocrinol, 188, 219-26. Petridou, E., Belechri, M . , Dessypris, N . , Koukoulomatis, P., Diakomanolis, E., Spanos, E. & Trichopoulos, D. (2002). Ann Nutr Metab, 46, 147-51. Ryan, N.K. , Van der Hoek, K . H . , Robertson, S.A. & Norman, R.J. (2003). Endocrinology, 144, 5006-13. Yin , N . , Wang, D., Zhang, H. , Y i , X . , Sun, X . , Shi, B., Wu, H. , Wu, G., Wang, X . & Shang, Y . (2004). Cancer Res, 64, 5870-5. 182 C H A P T E R VIII. A ligand-independent estrogen receptor pathway is involved in leptin-induced ovarian cancer cell growth7 8.1 Introduction A recent study demonstrated that adipocyte expression and circulating levels of leptin increase in ovarian, breast and endometrial cancer patients (Tessitore et al., 2004). In addition, increased leptin levels seem to be associated with elevated levels of follicle stimulating hormone (FSH) which is a mitogenic factor for ovarian cancer (Choi et al., 2005b; Choi et al., 2002a; Syed et al., 2001). We previously demonstrated that both long (ObRb) and short (ObRa) forms of leptin receptors are expressed in immortalized ovarian surface epithelium (IOSE) cells and ovarian cancer cells, including BG-1, OVCAR-3 and SKOV-3 cells. We also found that treatment with leptin resulted in the growth stimulation of BG-1 cells via the activation of ERK1/2 (Choi et al., 2005c). In the present study, we further investigated whether ER, especially ERa, is involved in leptin-induced cell growth in ovarian cancer cells. 8.2 Material and methods Materials Recombinant leptin was purchased from Sigma-Aldrich (Oakville, ON). PD98059 [2-(2-amino-3-methoxyphenyl)-4H-l-benzopy-ran-4-one], a M A P K / E R K kinase (MEK) inhibitor, and AG490 [a-cyano-(3,4-dihydroxy)-N-benzyl-cinnamide], a JAK-2/STAT-3 inhibitor, were purchased from New England Biolabs (Beverly, M A ) and Calbiochem (La Jolla, CA), respectively. Antibodies against ERa, ERp\ nucleolin and |3-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho-STAT-3 and total-STAT-3 were obtained from Cell Signaling Technology (Beverly, M A ) . Cell culture BG-1 cells were maintained in D M E M F12 medium supplemented with 10 % fetal 7 A version of this chapter has been submitted for publication. Choi JH, Choi K C , and Leung P C K A ligand-independent estrogen receptor pathway is involved in leptin-induced ovarian cancer cell growth. Submitted to F A S E B J 183 bovine serum (FBS; Hyclone Laboratories Logan, UT), 100 U/ml penicillin G and 100 ug/ml streptomycin (Life Technologies, Rockville, MD) in a humidified atmosphere of 5 % C02-95 % air at 37 C. For hormone induction, the cells were cultured in phenol red-free D M E M F12 containing 10 % charcoal-stripped FBS. Other ovarian cancer cells (OVCAR-3 and SKOV-3), immortalized granulosa-luteal cells (SVOG-40) and immortalized OSE cells (IOSE-80 and IOSE-80PC) were cultured in medium 199:MCDB 105 (Sigma-Aldrich) containing 10 % FBS, 100 U/ml penicillin G and 100 g/ml streptomycin in a humidified atmosphere of 5 % C02-95 % air at 37 C. The immortalized OSE cell lines were generated by transfecting ovarian surface epithelial cells with SV40-T antigen and generously provided by Drs. N . Auersperg (University of British Columbia, Vancouver, BC) and A. Godwin (Fox Chase Cancer Center, Philadelphia, PA). In addition, the BG-1 cell line was kindly provided by Dr. K . S. Korach (National Institute of Environmental Health Sciences, National institutes of Health, Research Triangle Park, NC). Cell transfection Full-length human ERa (pCMV5- ERa) and ERp (pRST7-ERp) expression plasmids were generously provided by Dr. B. S. Katzenellenbogen (Department of Molecular and Integrate of Physiology, University of Illinois at Urbana-Champaign) and Dr. P. P. McDonnell (Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC). ERa or ERp vector (0.5 ug) was transfected into O V C A R -3 cells using FuGENE 6 (Roche Applied Science, Laval, QC) according to the manufacturer's suggested protocol at 50 % confluence on 6-well plates. The transfected cells were grown for 1 day and used for confirmation of overexpression by Western blot analysis. Immunoblot and coimmunoprecipitation assay The cells were seeded at a density of 2 x 105 cells in 35 mm culture dishes and cultured for at least 2 days. The cells were washed once with medium, and serum starved for at least 4 h prior to treatments with leptin. The cells were washed twice with ice-cold phosphate buffered saline (PBS) and lysed in ice-cold RIPA buffer (150 mM NaCl, 1 % 184 Nonidet P-40, 0.5 % deoxycholate, 0.1 % SDS, 50 mM Tris [pH, 7.5], 1 mM PMSF, 10 ug/ml leupeptin, and 100 ug/ml aprotinin). The extracts were placed on ice for 15 min and centrifuged to remove cellular debris. Nuclear extracts were prepared using the NE-PER Nuclear and Cytoplasmic Extraction Reagents (PierceBiotech. Rockford, IL) according to the manufacture's suggested protocol. The protein concentration of supernatants was determined using the Bradford assay (Bio-Rad Laboratories, Hercules, CA). Thirty ug of total protein was run on 10 % SDS-polyacrylamide gels and electro transferred to a nitrocellulose membrane (Amersham Pharmacia Biotech.). The membrane was immunoblotted using specific primary antibodies at 4°C overnight. After washing, the signals were detected with horseradish peroxidase-conjugated secondary antibody for 1 h, and visualized using the E C L chemiluminescent system (Amersham Pharmacia Biotech.). To determine whether ER directly interacts with STAT-3, immuno-precipitation was carried out at 4°C for 1 h using an anti-ER antibody and protein A-magnetic beads (New England Biolabs). Immunoprecipitates were subjected to SDS-PAGE followed by Western blotting with a phospho-STAT-3 antibody. RT-PCR Total R N A was prepared using the TRIzol reagent (Invitrogen Canada, Burlington, ON, Canada), according to the manufacturer's instructions. Total R N A (2.5 (ig) was reverse transcribed into first-strand cDNA (Amersham Pharmacia Biotech, Oakville, ON, Canada) following the manufacturer's procedure. R N A integrity was confirmed by using agarose gel electrophoresis and ethidium bromide staining. The total R N A concentration was determined from spectrophotometric analysis at A260/280- Complementary D N A (cDNA) was synthesized from 2.5ug total R N A by reverse transcription (RT) at 37 C for 2 h using a first strand cDNA synthesis kit (Amersham Pharmacia Biotech.). The synthesized cDNA was used as a template for polymerase chain reaction (PCR) amplification. A semi-quantitative PCR amplification was carried out with denaturing for 1 min at 94 C°, annealing for 60 sec at 58 C°, extension for 60 sec at 70 C°, and a final extension for 15 min at 72 C using a thermal cycler (DNA Thermal Cycler, Perkin-Elmer, Norwalk, CT). The primers were designed to amplify pS2 mRNA based on the published sequences of human pS2 (Catalano et al., 2004). In addition, amplification of human 185 glyceraldehyde phosphate dehydrogenase (GAPDH) was performed using specific primers (Tokunaga et al., 1987) to rule out the possibility of R N A degradation, and was used to control the variation in mRNA amount in PCR reaction. The primers of pS2 are composed of sense, 5'-TTC TAT CCT A A T A C C A T C G A C G-3', and antisense, 5'-TTT G A G T A G T C A A A G T C A G A G C-3'. The sequences of G A P D H amplification are sense, 5'-ATGTT C G T C A TGGGT G T G A A CCA-3 ' and antisense, 5'-TGGCA GGTTT TTCTA G A C G G CAG-3 ' . The PCR reactions were performed in 25pi PCR mixture containing 1 X PCR buffer, 0.2 mM each dNTP, 1.6 mM M g C l 2 , 50 pmol specific primers, each cDNA template, and 0.25 unit Taq polymerase. [ H]thymidine incorporation assay [3H]thymidine incorporation assay was performed to analyze the proliferative effect of leptin in BG-1 cell line (Choi et al., 2001c; Choi et al., 2002a). The cells were plated in 24-well plates at 2 x 104 cells/well in 0.5 ml medium 199:MCDB105 supplemented with 10 % FBS and antibiotics, and incubated for 48 h. Before treatment with leptin, the cells were starved in serum-free media for at least 4 h. After starvation, the cells were incubated with leptin (100 ng/ml) or E2 (10"7M) in serum-free media for 24 h. One Ci[3H]thymidine (5.0 Ci/mmol; Amersham Pharmacia Biotech.) was added at 4 h prior to the termination of the experiments. At the end of the incubation period, the culture medium was removed, and the cells were washed three times with PBS and incubated in 10 % trichloroacetic acid for 20 min at 4 C. The precipitate was washed twice with methanol and solubilized in 0.1 N sodium hydroxide and the incorporated radioactivity was measured with a Tri-Carb Liquid Scintillation Analyzer (Model 2100TR; Packard Instrument, Meriden, CT) as previously described (Kang et al., 2000b). MTT assay Cell viability was estimated using the M T T (3-[4,5-dimethylthiazol-2-yl]-2,5-dipheyltetrazoliumbromide; Sigma-Aldrich) assay. Cells were seeded in 96-well plates and incubated for 24 h. To examine the growth stimulatory effect of leptin, BG-1 cells were treated with leptin for 24 h. On the day of collection, 50 pi of M T T solution [2mg/ml in PBS] was added to the medium and the cells were incubated at 37°C with for 4 h. The 186 MTT-containing medium was removed and the cells were solubilized in DMSO (100 ul) for 30 min. The optical density at 490 nm was determined using a microplate spectrophotometer (Fisher Scientific Ltd., Ottawa, ON). Luciferase assays The EPvE2-tkl09-Luc reporter plasmid was provided by Dr. J. L . Jameson (Division of Endocrinology, Metabolism and Molecular Medicine, Northwestern University Medical School, Chicago, IL). One ug of ERE2-luciferease vector was transfected into BG-1 cells using FuGENE 6 (Roche Applied Science) according to the manufacturer's suggested protocol when the cells were 50 % confluent in 6-well plates. To correct for varying transfection efficiencies, a Rous sarcoma virus (RSV)-lacZ plasmid was cotransfected into the cells. After transfection for 24 h, the cells were treated with leptin for 6 h and extracts were prepared with luciferase cell lysis buffer (Promega, Madison, WI). Luciferase activity was measured in the extracts from triplicate samples using the luciferase assay kit (Promega). P-galactosidase activity was measured using the P-Galactosidase Enzyme Assay System (Promega). Promoter activity was calculated as luciferase activity/p-galactosidase activity. Data analysis Data are shown as the mean ± SD of three individual experiments performed in triplicate and presented as the mean. Statistical analysis was performed by one-way A N O V A followed by Dunnett's test. P<0.05 was considered statistically significant. 8.3 Results Inhibitory effect of ER antagonist ICI182,780 on leptin-induced cell growth in BG-1 cells To examine the possible contribution of ER to leptin-stimulated cell growth of BG-1 cells, we evaluated the effect of ICI 182,780, a pure ER antagonist, on leptin-induced proliferation by thymidine incorporation and M T T assays. As illustrated in Figure 8.1 A , treatment with leptin (100 ng/ml) or E2 (10"7M) induced approximately a two-fold increase in cell proliferation as determined by thymidine incorporation assay. Pretreatment with ICI 182,780 completely abolished the proliferative effects of leptin or 187 E2 (Figure 8.1 A) , suggesting that ER mediates the proliferative effect of leptin in BG-1 cells. The inhibitory effect of ICI 182,780 on leptin-or E2-induced cell growth was also confirmed by measuring cellular viability using the MTT assay (Figure 8.1 B). Effect of ERa and ERP expression on the cell proliferative effect of leptin In the previous study, we demonstrated that leptin can stimulate cell growth in B G -1 cells, but not in other tested ovarian cancer cells including OVCAR-3 and SKOV-3 cells (Choi et al., 2005c). As shown in Figure 8.2, BG-1 cells were found to have a substantially higher expression level of ERa than other ovarian cancer cells (OVCAR-3 and SKOV-3) and immortalized ovarian cells (SVOG-40, IOSE-80 and IOSE-80PC). In contrast, no significant difference in ERp expression was observed among three other ovarian cancer cell lines. Transient transfection of OVCAR-3 cells with ERa or ERp was performed to evaluate which isoforms of ER is involved in the response to leptin. OVCAR-3 cells were used because they lack a proliferative response to leptin or E2 in our cell culture conditions. Overexpression of ERa and ERp was evaluated by Western blot assay. The expression of ERa and ERp was significantly enhanced in ERa-OV and ERP-OV, respectively, when compared to non-transfected cells (Figure 8.3 A) . Transfected cells were incubated with leptin (100 ng/ml) for 24 h, and then assayed for thymidine incorporation. Leptin and E2 induced a significant increase in the proliferation of ERa-OV cells (Figure 8.3 B). Furthermore, the effects of leptin or E2 in ERa-OV cells were suppressed by ICI 182,780 (Data not shown). These results indicate that leptin-induced cell growth is ER-dependent in ovarian cancer cells. In contrast, cell proliferation was decreased in ER-OV cells, suggesting a negative role of ER in ovarian cancer cell growth (Figure 8.3 B). Effect of leptin on the activation of ERa A member of a nuclear receptor superfamily, ERa is well known to undergo specific conformational changes leading to receptor dimerization and nuclear localization upon ligand activation. To test whether leptin can mimic classical ER activation by E2, we evaluated the abundance of cytoplasmic and nuclear ERa in BG-1 cells treated with leptin 188 (100 ng/ml) or E2 (10" 7M). As with E2, treatment with leptin for 6 h following 16 h of serum starvation increased the nuclear expression of ERa and decreased its cytoplasmic levels (Figure 8.4). In addition, to evaluate the functional activation of ER by leptin, semi-quantitative RT-PCR was performed to measure the mRNA expression of the E2-responsive pS2 gene. Stimulation of BG-1 cells with leptin or E2 increased pS2 mRNA levels in a time-dependent manner (Figure 8.5 A) . We further examined whether leptin stimulates the transactivation potential of ER in BG-1 cells by utilizing the ERE2-luciferase reporter gene construct. As shown in Figure 8.5, ERE2-luciferase activity in BG-1 cells was substantially increased following treatment with leptin (Figure 8.5 B). In the previous study, we demonstrated that leptin increased E R K 1/2 activation resulting in enhanced proliferation, whereas inhibition of the ERK1/2 pathway by PD98059 abolished leptin-induced proliferation of BG-1 cells (Choi et al., 2005c). Increasing evidence suggests that various signaling pathways, including ERK1/2, can regulate phosphorylation and activation of ER and/or ER related-transcription factors and ERE-mediated gene expression (Bunone et al., 1996; Campbell et al., 2001; Ince et al., 1994; Karas et al., 1998; Kato et al., 1995; Lee et al., 1997). Thus, we used PD98059 to test whether leptin-stimulated ERE activation is mediated by the E R K 1/2 pathway. Pretreatment with PD98059, significantly attenuated leptin-induced ERE2-luciferase activity in BG-1 cells (Figure 8.5 C). Effect of leptin on the activation of the STAT-3 signaling pathway Considering that leptin exerts its biological function in various tissues through JAK/STAT-3 as well as ERK1/2 (Bendinelli et a l , 2000; Briscoe et al., 2001; Tsumanuma et al., 2000; Y in et al., 2004), we further examined the phosphorylation of STAT-3 following treatment with leptin in a time-dependent (100 ng/ml for 5-90 min) and dose-dependent manner (10, 100 and 1000 ng/ml for 30 min). Immunoblot analysis was performed with specific antibodies targeting the phosphorylated and total forms of STAT-3. As shown in Figure 8.6, treatment with leptin induced a significant increase in phosphorylated STAT-3 in both a dose- and time-dependent manner in BG-1 cells. The involvement of STAT-3 in leptin-induced proliferation of BG-1 cells was investigated using a specific STAT-3 inhibitor, AG490. We observed that treatment with AG-490 189 significantly reduced leptin-induced, but not basal proliferation (Figure 8.7). Similarly, pretreatment with PD98059 did not affect basal proliferation but significantly reduced leptin-induced proliferation as illustrated in Figure 8.7. These results indicate that leptin-induced growth-stimulation appears to be mediated by the activation of JAK/STAT-3 as well as ERKl /2 /ERa . Effect of leptin on the interaction between STATS and ERa. To analyze the molecular basis of leptin-induced activation of the STAT-3 and ERa signaling pathways, we employed a co-immunoprecipitation technique to test for an interaction between ERa and STAT-3. BG-1 cells were treated with leptin for 30 min, immunoprecipitated with an ERa-specific antibody and the immunoprecipitates were immunoblotted with a phospho-STAT-3-specific antibody. As shown in Figure 8.8, treatment with leptin increased the amount of phospho-STAT-3 protein co-immuno-precipitated with ERa. These results indicate that leptin may induce a direct and functional protein-protein interaction between ER and STAT-3 in these cells. 8.4 Discussion Over the past few decades, mounting epidemiological findings have suggested the influence of obesity on the risk of death from cancer (Calle et a l , 2003). In addition to its essential role in metabolism and cardiovascular and renal function, there is convincing evidence that leptin functions as a mitogen in various cancers including breast, prostate and gastrointestinal cancer (Somasundar et al., 2004). Despite these observations, whether leptin plays a role in ovarian cancer remains to be elucidated and the exact mechanism of the response to leptin is poorly understood. Recently, we demonstrated that both short and long isoforms of leptin receptors are expressed in IOSE, BG-1, OVCAR-3 and SKOV-3 cells, and that treatment with leptin stimulated the growth of BG-1 cells (Choi et al., 2005c). Moreover, the stimulatory effect of leptin was significantly abolished in the presence of a M E K inhibitor. In this study, we demonstrated, for the first time, that ERa is responsible for mediating leptin-induced cell proliferation in a ligand-independent manner. Furthermore, we showed that leptin-stimulated proliferation is dependent on the activation of STAT-3. 190 In our previous study, we found that leptin exerts its proliferative action only in E2-sensitive BG-1 cells but not in other ovarian cancer cells including OVCAR-3 and SKOV-3 cells which are less sensitive to E2 with respect to cell growth. In addition, recent studies have suggested a functional cross talk between leptin and E2/ER system (Bennett et al., 1998; Catalano et al., 2003; Ghizzoni et al., 2001; Kitawaki et al., 1999; Machinal-Quelin et al., 2002; Spicer & Francisco, 1997). In this regard, we tested the hypothesis that the estrogen/ER system is implicated in the proliferative effect of leptin in estrogen-responsive ovarian cancer cells. This postulate was supported by our data that ICI 182,780, a pure ER-antagonist, blocked leptin-induced cell growth in BG-1 cells. The involvement of ER in leptin-induced signaling is in agreement with recent studies on breast cancer cells. In MCF-7 breast cancer cells, all of the effects of ICI 182,780; i.e., inhibited cell proliferation, rapid ER degradation, inhibited nuclear ER expression and reduced ER-dependent transcription from estrogen response element (ERE)-containing promoters, were significantly attenuated by simultaneous treatment of the cells with leptin (100 ng/mL) (Garofalo et al., 2004). Similarly, Catalano and coworkers reported that leptin can amplify E2 signaling via a direct functional activation of ERa and enhance in situ E2 production in breast cancer cells (Catalano et al., 2003; Catalano et al., 2004). The two ER isoforms (ERa and ERP) show tissue-dependent expression pattern in normal OSE, benign tumors and malignant ovarian cancers. ERa is mainly expressed in malignant cancer cells, while ERP is the dominant form in OSE, or benign tumors, suggesting that the ERa/ERp ratio seems to increase in ovarian cancer as in prostate and breast cancers (Cunat et al., 2004). In the present study, we sought to identify which ER isotype is mediating the effects of leptin by transfecting OVCAR-3 cells, which are less sensitive to leptin in our previous study, with either ERa- or ERP-expressing vector. Cell growth was significantly increased in ERa-overexpressing, but not in ERP-overexpressing, OVCAR-3 cells following leptin treatment. This phenomenon can explain our previous observations that leptin did not show any proliferative effect in OVCAR-3 with low expression of ERa or SKOV-3 cells bearing mutated ERa. Furthermore, it is noteworthy that overexpression of ERp decreased basal proliferation of OVCAR-3 cells. Since it has been suggested that ERP plays a protective role antagonizing ERa mitogenic activity, further study will be required to explore whether ERp exerts a similar effect on leptin/ERa 191 -induced proliferation. Interestingly, the mechanism by which leptin activates ER appears to be ligand-independent. Both, transcriptional activation of ERa and leptin-induced cell proliferation were observed in BG-1 cells even though all of the experiments were performed in phenol-red free medium containing charcoal-dextran treated serum to avoid an estrogenic effect. Moreover, to rule out the possibility that leptin induces E2 production in BG-1 cells, we measured estrogen levels in the culture medium following treatment with leptin. Although a recent report suggested stimulatory effect of leptin on aromatase activity in breast cancer (Catalano et al., 2003), no significant change in E2 level was observed in leptin-treated BG-1 cells when compared to control cells (Data not shown). Considering the accumulating evidence of ER activation in a ligand-independent manner, these results indicate that leptin may exert its action on BG-1 cell growth via activation of ERa in a ligand-independent manner. Indeed, ligand-independent ER activation has previously been reported in ovarian cancers. For example, an interaction between a membrane receptor CD44 and ERa in the absence of E2 has been suggested. CD44 interaction with hyaluronan recruits IQGAP1 and induces activation of ERK2 leading to the phosphorylation of both Elk-1 and ER. ERK2-mediated Elk-1 /ERa phosphorylation increases Elk-l/ERE-mediated transcription, as well as tumor migration via F-actin binding (Bourguignon et al., 2005). In addition, an interaction between EGF and ER signaling pathways has been proposed in ovarian cancer as well as in breast cancer (Kalli et al., 2004). The JAK/STAT signaling pathway regulates diverse biological responses and is associated with many hormones, cytokines and growth factors (Bromberg & Darnell, 2000). STAT-3, a well-known downstream signaling molecule of leptin in various tissues, has been shown to regulate the expression of several genes related to cell cycle, proliferation and apoptosis (Buettner et al., 2002). Consequently, changes in the activity of STAT-3 have been implicated in cell transformation and cancer progression (Buettner et al., 2002; Garcia & Jove, 1998). In the present study, we evaluated whether STAT-3 is involved in leptin-induced signaling. As in other cell systems, leptin stimulated the activation of STAT-3 in a time- and dose- dependent manner, and a specific STAT-3 inhibitor (AG490) significantly reduced leptin-stimulated proliferation of BG-1 ovarian 192 cancer cells. These results suggest that STAT-3 may play a role in leptin/ERa-mediated proliferation of BG-1 cells. However, how the activation of STAT-3 can affect ERKl /2 /ERa signaling remains to be elucidated. Our observation that leptin can increase the interaction between ERa and STAT-3 in BG-1 cells is in accordance with other findings that activated ERa can physically interact with the STATs family of transcription factors in various cell systems (Bjornstrom & Sjoberg, 2002; Wang et al., 2001; Yamamoto et a l , 2000). Several lines of evidences have also demonstrated an indirect cross-talk between STAT-3 and ER signaling via other transcription factors (Ciana et al., 2003; De Miguel et al., 2003; Wang et al., 2001). For example, in ER overexpressing CV-1 cells transfected with a constitutively active STAT-3 mutant, STAT-3 increased the transcriptional activity of ER and acted in a synergistic fashion with other coactivators such as SRC-1, pCAF and CBP, to increase the transcriptional activity of ER (De Miguel et al., 2003). In the present study, treatment with leptin (100 ng/ml) resulted in an increase in cell growth equal to that of E2 (10"7g/ml). However, the increase in transcriptional activation of an ERE by leptin was only about two-fold while E2 stimulated luciferase activity up to three-fold. Together these results suggest that, in addition to a pathway involving ERE activation, alternative mechanism(s) may be required to fully mediate the effects of leptin. One such mechanism may be the regulation of STAT-3-responsive genes via the GAS promoter. Although further experimentation is required to confirm this hypothesis, leptin-induced phosphorylation of STAT-3 and its increased binding to ERg may be involved in this type of regulation. Indeed, in neuroblastoma cells, increased interaction between STAT-3 and ERa induced activation of STAT-3-dependent transcription via GAS promoter (Ciana et al., 2003). Taken together, these results indicate that the stimulation of ovarian cancer cell growth by leptin involves, at least in part, a ligand-independent activation of ER and ERE via E R K and the activation of STAT-3. 193 250 250 Vehicle E2 Vehicle Leptin Vehicle E2 Vehicle Leptin Figure 8.1 Effect of ICI 182,780 on leptin-induced cell growth in BG-1 cells. The cells were treated for 24 h with estradiol (E2; 10~7M) or leptin (100 ng/ml) in the absence or presence of ICI 182,780 (10 nM). A , Proliferative index was measured using thymidine incorporation assay. B, Cell growth was measured using MTT assay. Data are derived from three experiments and are presented as the mean ± SD. a, PO.05 vs. vehicle 194 4 0 80 80PC O V B G S K E R a (70-kDa) ERp (50-kDa) P-actin — • Figure 8.2 Expression of ERa and ERp in various ovarian normal and cancer cell lines. The protein expression of ERa and ERp was determined by Western blot analysis. 40, immortalized granulosa (SVOG-40); 80, immortalized ovarian surface epithelium (IOSE)-80; 80PC, IOSE-80PC; OV, OVCAR-3; B G , BG-1; SK, SKOV-3 ovarian cancer cell line. 195 A OV ERa-OV OV ERP-OV ERa -(70-kDa) B-actin -ERB -(50-kDa) B-actin -B 200 c o 150 0 Q. -=« I 2 i 1 o> 800 I o 1 £ £ 50 X • OV • ERa-OV • ERP-OV 1 b Con E2 Leptin Figure 8.3 Effect of overexpression of ERa and ERp on cell growth in OVCAR-3 cells. OVCAR-3 cells (OV) were transfected with ERa or ERp expression vector using FuGENE 6 reagent to produce ERa-OV or ERP-OV, respectively. A, Overexpression of ERa and ERp was confirmed by Western blot analysis. B, Non transfected- and ER transfected-OVCAR-3 cells were treated with 10" 7M estradiol (E2) or 100 ng/ml leptin for 24 h. A proliferative index was measured using thymidine incorporation assay. Data are presented as the mean ± SD of three experiments, a or b, P<0.05 vs. non-transfected cells 196 Vehicle E2 ERa (70-kDaf ERa (70-kDaf Vehicle Leptin Cytoplasm Nuclear Figure 8.4 Effect of leptin on nuclear abundance of ERa in BG-1 cells. The cells were treated with 10"7 M estradiol (E2) or 100 ng/ml leptin for 6 h and the cytoplasmic and nuclear levels of ER were determined by Western blot analysis. The expression of P-actin and nucleolin was assessed as a control of protein loading. 197 Leptin E2 Con 4 8 12 24 8 12 (h) pS2 (210-bp) — G A P D H Control Leptin E2 c 4 3 0) o (D 3 0 If) 0 | 2 3 I 1 4-1 TO 3 • -PD98059 • + PD98059 Control Leptin Figure 8.5 Effect of leptin on functional activation of ERa in BG-1 cells. A, The cells were treated with 10"7 M estradiol (E2) or leptin (100 ng/ml) and the expression of an estrogen dependent gene, pS2, was determined by RT-PCR. The data are representative of 4 separate experiments. B, The cells were transfected with a luciferase-vector containing an estrogen response element (ERE), treated with E2 (10"7M) or leptin (100 ng/ml) for 6 h and luciferase activity was quantified. C, Following pretreatments with PD 98059 (10 uM) for 30 min, the cells were treated with leptin (100 ng/ml) for 6 h and a luciferase assay was performed. Data are presented as the mean ± SD of three experiments, a, PO.05 vs. control 198 Concentration Time P-STAT-3 (92-kDa) 0 L10 L100 L1000 Con 5 15 30 60 90 (min) T-STAT-3 (92-kDa) Figure 8.6 Effect of leptin on the activation of STAT-3 in BG-1 cells. Western blot analysis was performed following treatment with leptin (100 ng/ml) in a time-dependent manner (5, 15, 30, 60 and 90 min) or increasing doses of leptin (10, 100 and 1000 ng/ml) for 30 min. Total-STAT3 (T-STAT-3) was used to normalize the level of phosphorylated STAT-3 (P-STAT-3). Each blot is representative of at least 3 independent experiments. 199 300 250 a. ^ O «-•- o 200 150 I * 1 b 100 > .c E" 50 leptin • + leptin I M i Con AG490 PD98059 Figure 8.7 Inhibitory effects of PD98059 and AG490 on leptin-induced proliferation. Following pretreatments with PD98059 (10 uM) or AG490 (100 uM) for 30 min, the cells were treated with leptin (100 ng/ml) and thymidine incorporation assay was performed. Data are presented as the mean ± SD of three experiments, a, PO.05 vs. control; b, P<0.05 vs. leptin only treatment 200 IP: ERa C o n 30 60 90 120 (m in) P - S T A T - 3 (92-kDa) ERa (70-kDa) Figure 8.8 Interaction between P-STAT-3 and ERa. BG-1 cells were treated with leptin (100 ng/ml) in a time-dependent manner (30, 60, 90 and 120 min). Cell extracts were immunoprecipitated with an antibody against ER separated by SDS-PAGE and immunoblotted with a phosphorylated STAT-3 (P-STAT-3) antibody. Each blot is representative of at least 3 separate experiments. 201 8.5 Bibliography Bendinelli, P., Maroni, P., Pecori Giraldi, F. & Piccoletti, R. (2000). Mol Cell Endocrinol, 168, 11-20. Bennett, P.A., Lindell, K. , Karlsson, C , Robinson, I.C., Carlsson, L . M . & Carlsson, B. (1998). Neuroendocrinology, 67, 29-36. Bjornstrom, L . & Sjoberg, M . (2002). Mol Endocrinol, 16, 2202-14. Bourguignon, L . Y . , Gilad, E., Rothman, K . & Peyrollier, K. (2005). J Biol Chem, 280, 11961-72. Briscoe, C P . , Hanif, S., Arch, J.R. & Tadayyon, M . (2001). Cytokine, 14, 225-9. Bromberg, J. & Darnell, J.E., Jr. (2000). Oncogene, 19, 2468-73. Buettner, R., Mora, L .B . & Jove, R. (2002). Clin Cancer Res, 8, 945-54. Bunone, G., Briand, P.A., Miksicek, R.J. & Picard, D. (1996). Embo J, 15, 2174-83. Calle, E.E., Rodriguez, C , Walker-Thurmond, K . & Thun, M.J. (2003). N Engl J Med, 348, 1625-38. Campbell, R.A., Bhat-Nakshatri, P., Patel, N . M . , Constantinidou, D., A l i , S. & Nakshatri, H. (2001). J Biol Chem, 276, 9817-24. Catalano, S., Marsico, S., Giordano, C , Mauro, L. , Rizza, P., Panno, M . L . & Ando, S. (2003). J Biol Chem, 278, 28668-76. Catalano, S., Mauro, L. , Marsico, S., Giordano, C , Rizza, P., Rago, V . , Montanaro, D., Maggiolini, M . , Panno, M . L . & Ando, S. (2004). J Biol Chem, 279, 19908-15. Choi, J.H., Choi, K . C , Auersperg, N . & Leung, P.C. (2005a). Endocr Relat Cancer, 12, 407-421. Choi, J.H., Park, S.H., Leung, P.C. & Choi, K .C . (2005b). J Clin Endocrinol Metab, 90, 207-10. Choi, K . C , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2001). Endocrinology, 142, 2351-60. Choi, K.C. , Kang, S.K., Tai, C.J., Auersperg, N . & Leung, P.C. (2002). J Clin Endocrinol Metab, 87, 2245-53. Ciana, P., Ghisletti, S., Mussi, P., Eberini, I., Vegeto, E. & Maggi, A . (2003). J Biol Chem, 278,31737-44. Cunat, S., Hoffmann, P. & Pujol, P. (2004). Gynecol Oncol, 94, 25-32. De Miguel, F., Lee, S.O., Onate, S.A. & Gao, A.C . (2003). Nucl Recept, 1, 3. Garcia, R. & Jove, R. (1998). JBiomedSci, 5, 79-85. Garofalo, C , Sisci, D. & Surmacz, E. (2004). Clin Cancer Res, 10, 6466-75. Ghizzoni, L. , Barreca, A. , Mastorakos, G., Furlini, M . , Vottero, A. , Ferrari, B., Chrousos, G.P. & Bernasconi, S. (2001). Horm Metab Res, 33, 323-8. Ince, B.A. , Montano, M . M . & Katzenellenbogen, B.S. (1994). Mol Endocrinol, 8, 1397-406. Kall i , K.R., Bradley, S.V., Fuchshuber, S. & Conover, C A . (2004). Gynecol Oncol, 94, 705-12. Kang, S.K., Choi, K . C , Cheng, K.W., Nathwani, P.S., Auersperg, N . & Leung, P.C. (2000). Endocrinology, 141, 72-80. Karas, R.H., Gauer, E.A., Bieber, H.E., Baur, W.E. & Mendelsohn, M.E . (1998). J Clin Invest, 101,2851-61. 202 Kato, S., Endoh, FL, Masuhiro, Y . , Kitamoto, T., Uchiyama, S., Sasaki, FL, Masushige, S., Gotoh, Y . , Nishida, E., Kawashima, H. , Metzger, D. & Chambon, P. (1995). Science, 270, 1491-4. Kitawaki, J., Kusuki, I., Koshiba, H. , Tsukamoto, K . & Honjo, H . (1999). Mol Hum Reprod, 5, 708-13. Lee, A. V. , Weng, C.N., Jackson, J.G. & Yee, D. (1997). J Endocrinol, 152, 39-47. Machinal-Quelin, F., Dieudonne, M.N . , Pecquery, R., Leneveu, M.C. & Giudicelli, Y . (2002). Endocrine, 18, 179-84. Somasundar, P., McFadden, D.W., Hileman, S.M. & Vona-Davis, L . (2004). J Surg Res, 116, 337-49. Spicer, L.J. & Francisco, C.C. (1997). Endocrinology, 138, 3374-9. Syed, V . , Ulinski, G., Mok, S.C., Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Tessitore, L. , Vizio, B., Pesola, D., Cecchini, F., Mussa, A. , Argiles, J .M. & Benedetto, C. (2004). Int J Oncol, 24, 1529-35. Tokunaga, K. , Nakamura, Y . , Sakata, K. , Fujimori, K. , Ohkubo, M . , Sawada, K. & Sakiyama, S. (1987). Cancer Res, 47, 5616-9. Tsumanuma, I., Jin, L. , Zhang, S., Bayliss, J.M., Scheithauer, B.W. & Lloyd, R.V. (2000). Pituitary, 3,211 -20. Wang, L .H . , Yang, X . Y . , Mihalic, K. , Xiao, W., L i , D. & Farrar, W.L. (2001). J Biol Chem, 276,31839-44. Yamamoto, T., Matsuda, T., Junicho, A. , Kishi, H . , Saatcioglu, F. & Muraguchi, A . (2000). FEBS Lett, 486, 143-8. Yin , N . , Wang, D., Zhang, H. , Y i , X . , Sun, X . , Shi, B. , Wu, H. , Wu, G., Wang, X . & Shang, Y . (2004). Cancer Res, 64, 5870-5. 203 C H A P T E R IX . Discussion and future work 9.1 Discussion and future work The ovarian epithelial cancers encompass a diverse, biologically complex, group of malignant neoplasms with a dismal clinical prognosis. There is an urgent need for a better understanding of its pathogenesis, identification of specific diagnostic/prognostic factors and development of new preventive and/or therapeutic approaches. The present study on the role of gonadotropins and leptin in OSE and ovarian epithelial cancer including proliferation, invasion and/or proteolysis not only confirm their importance in the caner process but may prove useful for translation into clinical applications to eliminate primary and metastatic ovarian cancers. Although approximately 90% of the ovarian epithelial tumor has been shown to arise in the OSE (Auersperg et al., 1998; Herbst, 1994), the cellular and molecular mechanism by which it undergoes tumor formation and neoplastic progression is not well understood. The OSE, a single layer of flat-to-cuboidal epithelial cells covering the ovary, is separated from the hormone/growth factor-producing stroma by collagenous tunica albuginea and a basement membrane. Rupture of ovulation and aging stimulate the trapping of OSE fragments, resulting in surface invaginations (clefts) and inclusion cysts in the ovarian cortex (Murdoch, 1994). Numerous studies have provided direct evidence bearing on metaplasia and neoplastic conversion of the clefts and inclusion cyst, presumably, via the aberrant expose to the hormone/growth factor-rich stromal microenvironment (Blaustein et al., 1982; Maines-Bandiera & Auersperg, 1997; Mittal et al., 1995; Scully, 1995). The surge occurring during ovulation and the loss of gonadal negative feedback for menopause and premature ovarian failure will result in excessive levels of gonadotropins. Patients with ovarian cancer have higher level of gonadotropins in their tumor/peritoneal fluid compared to cancer-free women. As for the mechanism of development of ovarian tumor, Cramer and Welch in 1998 suggested that excessive level of gonadotropins may stimulate the steroidogenic stromal cells to secrete increased levels of estrogen, which is a mitogenic factor for ovulation-induced inclusion cyst. In contrast, our findings in the present study suggest a direct action of gonadotropins in the OSE cells. 204 In that, excessive levels of gonadotropins may induce an increase in EGFR expression in the OSE cells (Chapetr III). Consequently, the OSE stimulated by gonadotropins undergoes neoplastic transformation under EGF and TNFa-rich stromal environment. It is of note that post-menopausal women showing the peak incidence rate of ovarian cancer exhibit elevated TGFa level in the normal ovary (Owens & Leake, 1992; Owens et al., 1991) (Figure 9.1). Our finding of stimulated growth factor system in response to FSH and L H in OSE cells is consistent with other previous studies. In bovine OSE cells, Doraiswamy et al. demonstrated two to three fold increases in EGFR mRNA expression after exposure to FSH and L H (Doraiswamy et al., 2000). FSH and hCG stimulated steady state levels of keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), and kit ligand (KL) mRNA in bovine OSE cells, indicating a possible role of gonadotropins to enhance these growth factors (Shoham, 1994). In addition to the EGF/EGFR system, gonadotropins have been shown to interact with the GnRH system to control the growth of OSE and ovarian cancer cells (Chapter IV). This data is in a line with previous finding that the GnRH/GnRHR system can be modulated by gonadotropins in hypothalamic GT1-7 neuron and human granulosa luteal cells (Kang et al., 2001c; Lei & Rao, 1994). Our results that treatment with gonadotropins decreased GnRH II and GnRHR mRNA level but not GnRH I suggest that two forms of GnRH are differentially regulated under various physiological conditions. Indeed, in the brain of the female European silver eel, steroids induce an increase in mammalian GnRH and decrease in chicken GnRH II (cGnRH II) (Montero et al., 1995). In the chicken, only the level of mGnRH in the hypothalamus was modified by castration (Sharp et al., 1990). In the goldfish, the ratio between salmon GnRH and cGnRH II changes with sexual maturation (Rosenblum et al., 1994). Treatment of human GL cells with FSH and hCG resulted in a marked increase in GnRH II mRNA levels but decreased those of GnRH I (Kang et al., 2001c). This differential regulation of two forms of GnRH by various factors including gonadotropins in a range of cell types suggests the distinct spatial expression and function of these peptides. Furthermore, considering the growth inhibitory effect of GnRH, decreased expression of GnRH-II or GnRH II/GnRH I ratio may play a critical role in the 205 development of ovarian cancer by regulating the proliferation. The reason why gonadotropins differentially regulate the transcription for GnRH I and GnRH II genes is not clear yet. It is possible that two distinct transcription mechanisms exist for each GnRH in the ovary and gonadotropins regulate only GnRH II related mechanism. Further study is required to elucidate the physiological relevance and mechanism of the differential regulation of GnRH-I and GnRH-II by gonadotropin. Further study will be performed to elucidate the mechanism underlying the interaction between gonadotropins and the GnRH system. Since the inhibitory effect of GnRH on the EGFR signaling pathway has been implicated as a key mechanism to mediate the antiproliferative action of GnRHs in several cancer cells, it remains to be determined if co-treatment with GnRHs and gonadotropins play a role in the EGF/EGFR system in OSE and ovarian cancer cells. Furthermore, the physiological relevance and mechanism of the differential regulation of GnRH-I and GnRH-II by gonadotropins needs to be investigated. With regard to ovarian cancer metastasis, gonadotropins have been reported to enhance tumor angiogenesis and adhesion by regulating the expression of vascular endothelial growth factor (VEGF) and integrin subunit alpha (v) and CD44 in ovarian cancer cells (Schiffenbauer et al., 2002; Wang et al., 2002; Zygmunt et al., 2002). In Chapter V , we also demonstrated that treatment with gonadotropins significantly stimulate the invasiveness and proteolytic activity of ovarian cancer cells. Together, gonadotropins appear to play a role in ovarian cancer progression in various ways (Figure 9.2). Studying the differential expression pattern of gonadotropins and their receptors in ovarian epithelial tumors in relation to clinicopathological parameters will be important for the identification of potential diagnostic/prognostic markers and drug targets for ovarian cancer as well as to understand the physiopathological role of gonadotropins in this devastating disease. Despite the potential role of gonadotropins in ovarian tumorigenesis, limited information regarding their receptor expression is available in normal and neoplastic OSE cells (Lu et a l , 2000; Minegishi et al., 2000; Parrott et al., 2001; Zheng et al., 2000). Several studies have suggested a relationship between the 206 expression of gonadotropin receptors, especially FSHR, and ovarian cancer development (Lu et al., 2000; Syed et al., 2001; Wang et al., 2003a). Indeed, a quantitative real-time RT-PCR data demonstrated that FSHR levels increase from presumed precursor lesions (OEIs, ovarian epithelial inclusion) to benign OETs (ovarian epithelial tumor) and to borderline OETs, while its levels decreased from borderline OETs to ovarian carcinomas (Wang et al., 2003a), suggesting the potential role of FSHR in tumorigenesis of ovarian cancer, especially early in the process. The comparison of FSHR expression among our cell models using Western blot analysis in Chapter II was likely consistent with that RT-PCR data, as the FSHR protein was highly expressed in OVCAR-3 (hardly invasive ovarian cancer cells in our culture system) compared to IOSE-80PC cells (pre-neoplastic OSE cells), and scarcely expressed in SKOV-3 cells (significantly invasive cells representing a late stage of ovarian carcinogenesis). To confirm this phenomenon in actual ovarian cancer tissue, ovarian tumor tissue microarray with 600 cases including normal, hyperplastic and malignant tissues was immunostained for gonadotropin receptors. A correlation between the expression of FSHR and the clinical stage of the disease will be evaluated. Considering our findings that overexpression of FSHR results in an increased expression of EGFR, c-Myc and HER-2/neu (Chapter II) and treatment with gonadotropins induces an increase in EGFR expression (Chapter III) in IOSE cells, we will assess whether the expression level of these well-known oncogenes is associated with FSHR expression level. Despite ER status is recognized as a prognostic factor for breast cancer and a critical reference for breast cancer therapy, no clear relationship between ER expression and tumor characteristics has been noted in ovarian epithelial cancers (HILDRETH et al., 1981). Considering that ER is expressed in up to 60% of ovarian epithelial tumors and complex factors are associated with estrogen receptor signaling, the identification of regulatory factors for estrogen/ER system in ovarian cancer and the subsequent characterization of the molecular mechanisms underlying the action of the factors is required. The present study, for the first time, suggests that leptin abundance environment can be a stimulating factor of cell growth in ER-positive ovarian cancer. Thus, this finding 207 may provide advanced information regarding better attention to the ERa status in ovarian cancer patients with obesity. The continued characterization of the molecular and signaling mechanisms underlying the stimulatory or inhibitory actions of these hormones in the development and progression of ovarian cancer should bring about a better understanding of ovarian carcinogenesis. It will provide an opportunity for the development of preventive and/or therapeutic approaches targeting signal transduction pathways or key molecules. The gonadotropins-induced EGFR overexpression in IOSE cells was mediated by the activation of PI3K and ERK1/2 pathways, but not by P K A pathway (Chapter III) while the invasion stimulatory effect of gonadotropins involve the P K A as well as PI3K pathway in ovarian cancer cells (Chapter V). These results suggested a possible involvement of an additional second messenger such as calcium and/or an alternative binding target of cAMP in the gonadotropin signaling in OSE cells, as the P K A pathway is a classical binding target of gonadotropin-induced cAMP. Further mechanism study in Chapter IV revealed that that the novel target of cAMP, Epac, is expressed and responsible for mediating gonadotropin-induced activation of the ERK1/2 and PI3K pathways in IOSE cells, resulting in EGFR up-regulation. Interestingly, our immunoblot analysis exhibited that Epac protein is highly expressed in IOSE cells while it is hardly detectable in ovarian cancer cells including OVCAR-3 and SKOV-3 cells (Figure 6.5). It is noteworthy that the treatment with FSH and L H significantly increased EGFR expression in the immortalized OSE cell line, IOSE-80PC, while the same treatment resulted in only a mild increase in OVCAR-3 and no change in SKOV-3 cells (Figure 3.2). This observation is confirming the critical role of Epac in EGFR expression induced by gonadotropins. Furthermore, this suggests the possibility that the significant alteration in Epac expression from pre-malignant IOSE cells to its neoplastic counterpart may be associated with differential responses to gonadotropins stimulation in OSE and ovarian cancer cells. This hypothesis should be tested by investigating whether the cAMP/Epac is also involved in gonadotropin-stimulated proteolysis and/or invasion in ovarian cancer cells. Although it has been shown that gonadotropins can significantly increase EGFR expression through the E R K and PI3K pathways in adenylyl cyclase/cAMP/Epac dependent manner, the 208 downstream molecules of the E R K and PI3K remain to be investigated. Further experiments such as chromatin immunoprecipitation assays and transcriptional factor arrays should be carried out to identify transcription factors which regulate the transcriptional activity of EGFR following treatment with gonadotropins in the IOSE cells. In addition to Epac, an attempt to find possible link between gonadotropin and PI3K pathway, has found direct coupling of FSHR with APPL1 (adaptor protein containing PH domain, PTB domain, and leucine zipper motif) (Nechamen et al., 2004). APPL1, also known as DIP 13a have been shown to interact with the p i 10a catalytic and p85 regulatory subunit of PI3K as well as inactive Akt (Mitsuuchi et al., 1999; Yang et al., 2003). Our preliminary data found that a novel PI3K binding protein APPL1 is expressed and binds to FSHR in IOSE and ovarian cancer cells (data not shown). Further experiments should be carried out to evaluate whether APPL1 can also bind to LHR, and whether the direct binding of APPL1 to gonadotropins receptors is associated with the gonadotropin-stimulated PI3K pathway in IOSE and ovarian cancer cells. Our observation that leptin can increase the interaction between ERa and STAT-3 in BG-1 cells is in accordance with other findings that activated ER can physically interact with the STATs family of transcription factors in various cell systems (Bjornstrom & Sjoberg, 2002; Wang et al., 2001; Yamamoto et al., 2000). Several lines of evidences have also demonstrated an indirect cross-talk between STAT-3 and ER signaling via other transcription factors (Ciana et al., 2003; De Miguel et al., 2003; Wang et al., 2001). In Chapter VIII, treatment with leptin (lOOng/ml) resulted in an increase in cell growth equal to that of E2 (10"7g/ml). However, the increase in transcriptional activation of an ERE by leptin was only about two-fold while E2 stimulated luciferase activity up to three-fold. These results suggest that, in addition to a pathway involving ERE activation, alternative mechanism(s) may be required to fully mediate the effects of leptin. Whether leptin-induced phosphorylation of STAT-3 and its increased binding to ER may be involved in this type of regulation is required to confirm. It is generally accepted that only the long form receptor ObRb mediate leptin-induced STAT-3 signaling while both long and short forms of ObR have been reported to activate E R K signaling in other cell systems. Which isoform of ObR is involved in leptin-induced activation of the ERK1/2 should be evaluated. 209 Taken together, additional clinical approaches may be available considering that gonadotropins and leptin are involved in various key signal transduction pathways in the OSE and OEC cells (Figure 9.3) such as disrupting the binding of gonadotropins to their receptor, down-regulating expression of the receptors, and reducing expression and/or activation of a key downstream molecule. 210 Figure 9.1 Diagrammatic representation of the potential role of gonadotropins in neoplastic transition of OSE cells. Gonadotropins have been shown to regulate the expression of EGFR and EGnRH and its receptor, regulatin in the stimulation of growth potential in OSE trapped into the ovarian stroma. FSH, follicle stimulating hormone;LH, luteinizing hormone; EGF, Epidermal growth factor; TNFa, tumor necrosis factor alpha; GnRH, gonadotropin releasing hormone; GII, goandotropin releasing hormone type two; GR, gonadotropins releasing hormone receptor; B V , blood vessel; IC, inclusion cyst; OSE, ovarian surface epithelium. 211 Figure 9.2 Diagrammatic representation of the potential role of gonadotropins and leptin in ovarian cancer. Gonadotropins play a role in the invasiveness of ovarian cancer cells by regulating the expression and secretion of tumor protienases. In addition, leptin, a product of obese (ob) gene, regulated in the growth stimulation of ovarian cancer cia lignad-independent activation of ER. FSH, follicle stimulating hormone;LH, luteinizing hormone;BV, blood vessel; OEC, ovarian epithelial cancer; M M P , metrix metalloproteinase;ER, estrogen receptor. 212 Proliferation / cell survival Figure 9.3 Diagrammatic representation of gonadotropins and leptin signaling in OSE and ovarian epithelial cancer. Gonadotropins and leptin bind to their specific receptor, and activate downstream signaling pathway including, PI3K/Akt, M A P K and Stats cascades resulting in regulation of cell growth, apoptosis and metastasis in OSE and/or ovarian cancer. FSH, follicle stimulating hormone; FSHR, follicle stimulating hormone receptor; L H , luteinizing hormone; LHR, luteinizing hormone receptor; A C , adenylyl cyclase; Ga, G-protein as; cAMP, cyclic adenosine monophosphate; Epac, Exchange protein directly activated by cAMP; ERK, extracellular signal-regulated kinases 1/2; STAT-3,signal transducers and activators of transcription-3; ER, estrogen receptor; ERE, estrogen response element; M M P , metalloproteinase; TIMP, tissue inhibitor of metalloproteinase; EGFR, epidermal growth factor receptor; ICI, ICI 182,780; Akt, protein kinase B; P K A , protein kinase A ; PI3K, phosphoinositol 3 kinase; GnRH, gonadotropin releasing receptor hormone; ObR, leptin receptor. 213 9.2 Bibliography Auersperg, N . , Edelson, M . L , Mok, S .C, Johnson, S.W. & Hamilton, T . C (1998). Semin Oncol, 25, 281-304. Bjornstrom, L. & Sjoberg, M . (2002). Mol Endocrinol, 16, 2202-14. Blaustein, A. , Kaganowicz, A. & Wells, J. (1982). Cancer, 49, 722-6. Ciana, P., Ghisletti, S., Mussi, P., Eberini, I., Vegeto, E. & Maggi, A . (2003). J Biol Chem, 278,31737-44. De Miguel, F., Lee, S.O., Onate, S.A. & Gao, A.C . (2003). Nucl Recept, 1,3. Doraiswamy, V. , Parrott, J.A. & Skinner, M . K . (2000). Biol Reprod, 63, 789-96. Herbst, A . L . (1994). Am J Obstet Gynecol, 170, 1099-105; discussion 1105-7. HILDPvETH, N.G. , K E L S E Y , J.L., LIVOLSI, V . A . , FISCHER, D.B., HOLFORD, T.R., MOSTOW, E.D., SCHWARTZ, P.E. & WHITE, C. (1981). Am. J. Epidemiol, 114, 398-405. Kang, S.K., Tai, C.J., Nathwani, P.S. & Leung, P.C. (2001). Endocrinology, 142, 182-92. Lei, Z . M . & Rao, C.V. (1994). Mol Endocrinol, 8, 1111-21. Lu, J.J., Zheng, Y . , Kang, X . , Yuan, J.M., Lauchlan, S .C, Pike, M.C. & Zheng, W. (2000). Gynecol Oncol, 79, 158-68. Maines-Bandiera, S.L. & Auersperg, N . (1997). Int J Gynecol Pathol, 16, 250-5. Minegishi, T., Kameda, T., Hirakawa, T., Abe, K. , Tano, M . & Ibuki, Y . (2000). Clin Cancer Res, 6, 2764-70. Mitsuuchi, Y . , Johnson, S.W., Sonoda, G., Tanno, S., Golemis, E.A. & Testa, J.R. (1999). Oncogene, 18, 4891-8. Mittal, K.R., Goswami, S. & Demopoulos, R.I. (1995). Histochem J, 27, 119-22. Montero, M . , Le Belle, N . , King, J.A., Millar, R.P. & Dufour, S. (1995). Neuroendocrinology, 61, 525-35. Murdoch, W.J. (1994). AnatRec, 240, 322-6. Nechamen, C.A., Thomas, R .M. , Cohen, B.D., Acevedo, G., Poulikakos, P.I., Testa, J.R. & Dias, J.A. (2004). Biol Reprod, 71, 629-36. Owens, O.J. & Leake, R.E. (1992). Eur J Obstet Gynecol Reprod Biol, 47, 223-8. Owens, O.J., Stewart, C , Brown, I. & Leake, R.E. (1991). Br J Cancer, 64, 907-10. Parrott, J.A., Doraiswamy, V. , Kim, G., Mosher, R. & Skinner, M . K . (2001). Mol Cell Endocrinol, 172, 213-22. Rosenblum, P.M. , Goos, H.J. & Peter, R.E. (1994). Gen Comp Endocrinol, 93, 369-79. Schiffenbauer, Y.S. , Meir, G., Maoz, M . , Even-Ram, S.C, Bar-Shavit, R. & Neeman, M . (2002). Gynecol Oncol, 84, 296-302. Scully, R.E. (1995). J Cell Biochem Suppl, 23, 208-18. Sharp, P.J., Talbot, R.T., Main, G.M. , Dunn, I .C, Fraser, H . M . & Huskisson, N.S. (1990). J Endocrinol, 124, 291-9. Shoham, Z. (1994). Fertil Steril, 62, 433-48. Syed, V. , Ulinski, G., Mok, S .C, Yiu , G.K. & Ho, S.M. (2001). Cancer Res, 61, 6768-76. Wang, J., Lin, L. , Parkash, V . , Schwartz, P.E., Lauchlan, S.C. & Zheng, W. (2003). Int J Cancer, 103, 328-34. Wang, J., Luo, F., Lu, J.J., Chen, P.K., Liu, P. & Zheng, W. (2002). Int J Cancer, 97, 163-7. 214 Wang, L . H . , Yang, X . Y . , Mihalic, K. , Xiao, W., L i , D. & Farrar, W.L. (2001). J Biol Chem, 276, 31839-44. Yamamoto, T., Matsuda, T., Junicho, A. , Kishi, H. , Saatcioglu, F. & Muraguchi, A . (2000). FEBSLett, 486, 143-8. Yang, L. , Lin, H.K., Altuwaijri, S., Xie, S., Wang, L . & Chang, C. (2003). J Biol Chem, 278, 16820-7. Zheng, W., Lu, J.J., Luo, F., Zheng, Y. , Feng, Y . , Felix, J .C , Lauchlan, S.C. & Pike, M . C (2000). Gynecol Oncol, 76, 80-8. Zygmunt, M . , Herr, F., Keller-Schoenwetter, S., Kunzi-Rapp, K. , Munstedt, K. , Rao, C.V., Lang, U . & Preissner, K.T. (2002). J Clin Endocrinol Metab, 87, 5290-6. 215 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092924/manifest

Comment

Related Items